Page 1

B

Heidi Kristine Grønlien

Cato Tandberg Kristin Glørstad Tsigaridas

Bi 2

B IOLOGI 2

2

Læreverket Bi for programfagene Biologi 1 og 2 i videregående skole består av følgende komponenter: • Bi 1 for Biologi 1 • Bi 2 for Biologi 2 • Smartbøker: www.smartbok.no • Nettsted: www.gyldendal.no/bi Mer informasjon om verket finner du på www.gyldendal.no/vgs/bi

Grønlien • Tandberg • Glørstad Tsigaridas • Ryvarden

Bi

Bi B IOLOGI 2

Leif Ryvarden

2


© Gyldendal Norsk Forlag AS 2014 2. utgave, 1. opplag Læreboka er skrevet etter gjeldende læreplan i faget Biologi 2, programfag i studiespesialiserende utdanningsprogram Printed in Norway by: 07 Media – 07.no, 2014 ISBN 978-82-05-45162-9 Redaktør: Ellen Semb Bilderedaktør: Hanne Erøy Design: Mette H. Tønsberg Layout: Mette H. Tønsberg Sats og layout: 07 Media – 07.no Omslagsdesign: Johanna Figur Waddington Omslagsillustrasjon, omslagsbilde: Illustratører: Deborah Maizels, John Arne Eidsmo, Anne Langdalen, Bjørn Norheim Bilder, illustrasjoner: se side 448 Det må ikke kopieres fra denne boka i strid med åndsverkloven eller avtaler om kopiering inngått med KOPINOR, interesseorgan for rettighetshavere til åndsverk. Kopiering i strid med lov eller avtale kan medføre erstatningsansvar og inndragning og kan straffes med bøter eller fengsel. Alle henvendelser om forlagets utgivelser kan rettes til: Gyldendal Undervisning Redaksjonen for videregående skole Postboks 6860 St. Olavs plass 0130 Oslo E-post: undervisning@gyldendal.no www.gyldendal.no/undervisning Heidi Kristine Grønlien og Cato Tandberg har mottatt støtte fra Det faglitterære fond til denne boka. Alle Gyldendals bøker er produsert i miljøsertifiserte trykkerier. Se www.gyldendal.no/miljo


Forord 2. utgave Biologi er et viktig fag for det samfunnet vi lever i og for framtiden. Biologi­ faget er i stadig utvikling, og vi ønsker at våre læreverk skal være faglig oppdaterte og dagsaktuelle både i innhold og pedagogisk struktur. Det er nå 6 år siden 1. utgaven av Bi 2 kom på markedet, og vi mener at tiden var moden for en revisjon for å opprettholde vår visjon. I vårt arbeid med 2. utgaven av Bi 2 har vi vært i kontakt med mange lærere og elever, og vi vil rette en stor takk til dere. Vi har alle jobbet mot et felles mål – best mulig lærebok. På neste side finner du et oppslag som viser hvordan de ulike elementene i boka kan leses og brukes aktivt i læringsprosessen. Den største endringen er at Bi 2 nå er en alt-i-ett bok. Sjekkpunkter er lagt til underveis i teksten, mens oppgaver finner du på slutten av kapittelet. Tips til og svar på oppgavene finner du på vårt nettsted www.gyldendal.no/bi. I Bi 2 har vi i tillegg laget et eget kapittel som handler om oppgaveløsning i biologi­ faget. Praktisk arbeid er plassert bakerst i boka, mens fagstoff og tips til feltarbeid finner du på nettstedet. Etter nøye vurdering og oppfordring fra lærere, har vi forandret noe på kapittelrekkefølgen. Boka begynner med et kapittel om evolusjon fordi vi anser at dette er et viktig grunnlag for bedre økologiforståelse. Økologikapittelet er plassert som kapittel 2 fordi feltarbeid ofte utføres om høsten. Deretter kommer kapitlene om cellebiologi og genetikk, mikroevolusjon og metabolismen, før vi avslutter med bioteknologien. Bi 2 vil alltid være godt faglig forankret, for med et grundig faglig ankerfeste tror vi det blir enklere å delta i dagens og morgendagens debatter i biologi. Å arbeide med tekst er en lang og krevende prosess. Vi har hatt mange støtte­spillere og alle fortjener en stor takk fra oss. Vi ønsker først og fremst å takke våre elever, studenter, lærere, kollegaer og konsulenter for nyttige innspill, gode og krevende spørsmål som har hensatt både spørsmålsstiller og mottager i undring og ny ivrig søk etter kunnskap. En spesiell takk til redaktør Ellen Semb for konstruktive kommentarer og for å ha loset oss vel i havn med prosjektet. Vi vil også takke designere og illustratører som har bidratt til å gjøre boka så flott. Lykke til med biologi 2! Oslo/Fredrikstad april 2014 Heidi Kristine Grønlien, Cato Tandberg, Kristin Glørstad Tsigaridas, Leif Ryvarden


4 • Hvordan bruke boka

Hvordan bruke boka På kapittel­start­ siden finner du:

3

Fra gen til protein Ord og faguttrykk du bør kunne før du begynner på kapitlet

• eukaryot

• ribosom

• prokaryot

• bæreprotein

• cellekjerne

• reseptor

• cytosol

• enzym

– Læreplanmålene som kapitlet handler om. – Ord og faguttrykk som du bør kunne før du begynner på selve kapittelet.

Mål for dette kapitlet er at du skal kunne • forklare strukturen til DNA • gjøre greie for transkripsjon og translasjon av gener • forklare hvordan regulering av gener kan styre biologiske prosesser • forklare hvordan den genetiske sammensetningen blir endret gjennom mutasjoner

218 • Kapittel 6

Populasjoner • 219

Sjekkpunkter:

Egenskaper ved r- og K-selekterte arter.

r-selekterte arter

K-selekterte arter

Nye ord og faguttrykk: livshistoriestrategi, yngelpleie, r-seleksjon, K-seleksjon

Mange avkom på en gang

Relativt få avkom på en gang

Hvordan ser en overlevelseskurve for en torsk ut?

Reproduserer ofte bare én gang

Reproduserer ofte flere ganger

Reproduserer raskt

Reproduserer relativt langsomt

Liten omsorg for avkommet

Stor grad av omsorg for avkommet

Tidlig fruktbar alder

Høy fruktbarhetsalder

Lever ofte kort

Lever ofte lenge

Liten konkurranseevne

Stor konkurranseevne

Ofte små individer

Ofte store individer

Ofte ukjønnet formering

Oftest kjønnet formering

Lag en liste over fire forskjeller mellom en r-selektert art og en K-selektert art. Gi to eksempler på r-selekterte arter og to eksempler på K-selekterte arter. Forventer du å finne r- eller K-selekterte arter i et ustabilt miljø?

Vekstrater og vekstkurver

Hva er det så som avgjør hvilken livshistoriestrategi en art har? Som nevnt er det evolusjon som har drevet fram de ulike tilpasningene de forskjellige artene har i dag. Det er miljøet der arten lever, som avgjør hvilken livshistorie det skal satses på. Dersom en art lever i et skiftende og uforutsigbart miljø, er det bra å kunne produsere mange avkom på en gang når forholdene er gunstige. Tilsvarende er det hvis predasjonspresset fra rovdyr er stort. Blir det produsert mange avkom, er det større sjanse for at noen overlever. Dersom miljøet er stabilt og konkurransen om ressursene som er der, er stor, er det derimot en fordel å produsere relativt få avkom som foreldrene sørger for, slik at de har en større sjanse til å nå fruktbar alder. Forsøk med bananflue (Drosophila melanogaster) har vist at forskjellige populasjoner av samme art kan vise ulik grad av r- eller K-seleksjon, avhengig av miljøet.

For å gjøre regnestykket enklere for oss ser vi nå bort fra inn- og utvandring. En populasjon blir da bare større dersom det blir født flere enn det dør. Store populasjoner har et større antall fødte enn små populasjoner. Men vokser de

Fødsler

Innvandring

Antall avkom

8000 avkom per år

200 avkom per år

12 avkom per år

2 avkom per år

1 avkom hvert 5. år

K-strateger

Populasjonsdynamikk. En populasjon blir større når nye individer blir født eller nye individer flytter inn til populasjonen. En populasjon blir mindre dersom individer dør eller forlater populasjonen.

Tabeller Oppsummerer og gir deg god oversikt.

Populasjonsstørrelse

Foreldreomsorg Overlevelsessannsynlighet

r-strateger

Hvordan øker en populasjon? En populasjon blir større når nye individer blir født eller nye individer flytter inn til populasjonen. En populasjon minsker når individer dør eller forlater populasjonen. For at en populasjon skal øke, må summen av fødsler og innvandring være større enn summen av dødsfall og utvandring.

Fødsler og innvandring gir nye individer til populasjonen

Har du lurt på hva r-en og K-en står for? r står for vekstraten for populasjonen, mens K står for bæreevnen i det lokale miljøet.

r-selekterte og K-selekterte arter. r-selekterte arter får mange avkom med lav sannsynlighet for overlevelse. K-selekterte arter får få avkom og har stor grad av yngelpleie.

Figurer er en viktig del av biologifaget. Det er derfor lurt å jobbe aktivt med figurene mens du leser.

Hvorfor har noen arter stor grad av yngelpleie, mens andre arter har ingen?

Eksempler på r-selekterte arter er insekter, bakterier og ettårige planter. Store pattedyr og fugler er oftest K-selekterte arter, det samme er trær med store frø som eik, kokosnøtt og valnøtt. Som sagt finnes det også mellomformer. Bartrær lever lenge og har stor konkurranseevne, men får likevel mange avkom på en gang og investerer lite i avkommet.

Figurer

Utvandring

Død

Død og utvandring fjerner individer fra populasjonen

Bladtekstene Forskningsnyheter og andre interessevekkere.

Sjekkpunkter Sjekk at du har fått med deg det viktigste.


Hvordan bruke boka • 5

Tips til oppgavene finner du på www.gyldendal.no/bi.

Fotosyntese • 321

Oppgaver 10 Karotenoider er pigmenter som brukes i fotosyntesen. Men de brukes og gir farge til mange andre plantedeler også. Gi eksempler på slike plantedeler og forklar hva som kjennetegner karotenoidene.

Temperatur målt i °C

04.00

8

06.00

14

12 En plante som står i svakt lys, vil etter hvert tape vekt. Forklar hvorfor og hvordan dette skjer.

10.00

19

12.00

23

13 Forklar med figurer og tekst hva som er forskjellen mellom en C4-plante og en C3-plante. I besvarelsen må du også forklare hvilke fordeler en C4-plante og en C3-plante har, og nevne eksempler på arter som har dem.

15.00

25

14 Forklar med figur hva som skiller en CAM-plante fra en C3- og en C4-plante. 15 Forklar med figur hvordan karbondioksid bindes, og at det kan dannes glukose hos planter. Du velger selv om du tar en C3-, C4- eller CAM-plante.

19 Bruk figuren til å forklare de fire kurvene, A, B, C og D. Det er temperaturen og konsentrasjonen av CO2 som blir angitt. Legg vekt på hva som er de hemmende faktorene for netto vekst, altså fotosyntese.

18 Kurven under viser døgnvariasjonen for en plantepopulasjon i Sør-Norge. Du får disse tilleggsopplysningene: Klokkeslett

11 Dersom du heller varmt vann over en brunalge, blir den grønn. Gjør forsøket, sjekk påstanden og forklar hva som skjer.

18.00

18

24.00

10

D 0,13 % CO2

225

C 0,13 % CO2

E blir karbondioksid bundet av rubisco

A Både fotodelen og syntesedelen av fotosyntesen foregår i stroma.

ved 30 °C

B Fotofosforylering foregår i stroma.

ved 20 °C

C Calvin-syklusen foregår i grana.

150

D Dannelsen av ATP via kjemoosmose foregår i tylakoidmembranen.

0,03 % CO2

B ved 30 °C A 0,03 % CO2

75

ved 20 °C

0

Soloppgang klokken 04.30 Solnedgang klokken 19.30 Det var svært tørt under målingene.

D er ATP dannet ved å omdanne glycerat-3-fosfat til triosefosfat

22 Hva er rett?

300

1

2

3

4

24 Hvilke PÅSTANDER er gale? A Elektroner beveger seg gjennom fotosystem 1 og så fotosystem 2.

5 6 7 Lysintensiteten

B Syklisk fotofosforylering involverer kun fotosystem 1. 20 Hvilke(n) PÅSTAND(ER) er feil? 0507_Fotosyntesehastighet.pdf I fotodelen av fotosyntesen

CO2-opptak

C Vann splittes av lys, og oksygen slippes ut som et biprodukt.

A blir ATP brukt under syklisk fotofosforylering

D Syklisk fotofosforylering involverer både fotosystem 1 og 2.

B skjer det en kondenseringsreaksjon, og det dannes vann 16 Hvilke(n) funksjon(er) har

C er NADP+ oksidert

a lukkecellene

2

4

6

8

b rubisco

10 12 14 16 18 Klokkeslett

20

22 24

25 Hva er det kloroplasten ikke inneholder:

D blir klorofyll både oksidert og redusert

A Grana

E blir det dannet oksygen

B Stroma

c glyceraldehyd-3-fosfat

f eksitering av elektroner 17 I 1882 gjorde den tyske forskeren H.T. Engelmann et forsøk. Resultatet av forsøket hans er gjengitt nedenfor. Vann

b Forklar kurveformen. (Hvorfor stiger kurven noen steder, mens den faller andre steder? Hvorfor ligger kurven over aksen noen steder og under aksen andre steder?)

Aerobe bakterier

400

500

Lysets 700 bølgelengde (nm)

600

D Tylakoidmembran E DNA F Ribosomer

B blir NADPH + H+ oksidert under dannelsen av triosefosfat C katalyserer rubisco dannelsen av ribulosebifosfat ved hjelp av karbondioksid

Lysets bølgelengde

Tråd av grønnalgen Cladophora

C Matriks

A binder pyruvat seg til ribulose-bifosfat og danner glycerat-3-fosfat

G Membraner H Endoplasmatisk retikulum 23 Hvilke av grafene under viser absorpsjonsspektrum for fotosyntesen? Absorpsjon

a Merk av kompensasjonspunktene. Forklar hva disse punktene viser.

e karotenoider

21 Hvilke(n) PÅSTAND(ER) er feil? I syntesedelen av fotosyntesen

Lysets bølgelengde

d stivelse

Absorpsjon

Varierte oppgaver på alle nivåer gir deg god trening.

320 • Kapittel 9

Fotosyntesehastigheten, målt som mm 3 CO2 cm -2t -1

Oppgaver

a0505_Grønnalge.pdf Forklar figuren. b Forklar hvorfor bakterien viser en slik spredning. A

Absorpsjon

B

Temperatur

Lysets bølgelengde

C

D

Lysets bølgelengde

0508_Lysets_bølgelengde.pdf

Å løse oppgaver i biologi Eget kapittel med mange nyttige tips om oppgaveløsning, og forberedelse til eksamen.

402 • Å svare på spørsmål i biologi

Å svare på spørsmål i biologi • 403

Databaserte oppgaver

En kompleks graf kan være som vist under.

Databaserte oppgaver er oppgaver hvor du må hente informasjon fra tekst og figur. Figurene er ofte en tabell og/eller en graf. Tabeller og grafer er svært viktige hjelpemidler i biologi, og i andre realfag. Typisk tabeller kan være slik som den under. Konsentrasjon Konsentrasjon Prosentvis før 1750 2012 endring 1750 – 2012

Effektivitet som drivhusgass

Levetid i atmosfæren

Kilder

0,1

Kort

Naturlige

Vanndamp

H2O Variabelt

Karbondioksid

CO2

0,028 %

Metan

CH4

0,00007 %

0,00018 %

157

21

12 år

Naturlige og menneskeskapte

Lystgass

N2O 0,000027 %

0,000030 %

11

310

310 år

Naturlige og menneskeskapte

Ozon

O3

0,0000025 %

0,0000034 %

36

Noen timer

Naturlige og menneskeskapte

Klorfluorkarboner

KFK

0

0,000003 %

-

Tusenvis av år

Kun menneskeskapte

Variabelt 0,038 %

36

1

1000-20 000

50-200 år

Naturlige og menneske

I en slik tabell er det viktig å få oversikt slik at du kan hente ut korrekt informasjon. Ofte er oppgavene nivådelt slik at det enkleste nivået er å hente ut informasjon og skrive med ord det som tabellen gir deg av informasjon. Slike spørsmål er av typen: Hvor mye høyere effektivitet som drivhusgass har metan sammenlignet med CO2? En mer kompleks oppgave, der du skal anvende den informasjonen du får i tabellen til å svare på et annet spørsmål, kan være: Drøft hvilken drivstoffgass du ville ha prioritert å endre dersom du skulle ha som mål å samlet senke drivhuseffekten? De mer komplekse oppgavene vil du få flere poeng for enn de enkle, men de er naturlig nok også vanskeligere å svare på og det er viktig å strukturere svaret slik at du kun svarer på det du blir bedt om å svare på.

Grafen over er kompleks. Men det er god trening å lese slike grafer, og det er viktig at du selv øver på å bruke grafer i besvarelsen din. Er den for vanskelig så begynn med noen enklere. Det ligger tips på www.gyldendal.no/bi. Ordlyden i oppgaven vil ofte være som for tabeller. Noen ganger blir du også bedt om å skissere en ny graf basert på de samme dataene + noen nye som blir gitt i en tekst. Du skal angi med faglig begrunnelse, hvordan videre forløp høyst sannsynlig vil være. Dette er ofte knyttet til hovedområdene økologi og evolusjon. Vær påpasselig med grafene dine slik at du har med enheter, realistiske måltall/forhold osv. Når du blir bedt om å sammenligne eller drøfte kan være lurt å sette opp en tabell med de ulike argumentene i kladden din. Denne kan også brukes i besvarelsen, men ofte ber oppgaven om flytende tekst. Øv på dette og diskuter det med lærerne din.

Struktur og flyt i besvarelsen God struktur er alfa og omega – altså så godt som alt. En godt strukturert besvarelse viser at du har oversikt, kan anvende relevant fagstoff og fremstiller det korrekt. Et triks kan være å bruke «5–avsnittsmetoden» som en tommelfingerregel. Det betyr i korthet følgende: Innledning Tre argumenter - ett argument, ett avsnitt. Avslutning

Praktisk arbeid Alle forsøkene kan du skrive ut fra www.gyldendal.no/bi.

430 • Praktisk arbeid

Fotosyntese Kapittel 9

1. Påvisning av stivelse i blad Jodløsning påviser stivelse ved at det gir stivelsesmole­ kylene en blå farge. I dette forsøket skal du påvise hvor i et blad det vil være stivelse under gitte forhold.

Praktisk arbeid • 431

2.Trengs det lys for å danne stivelse? I disse forsøkene skal du teste om fravær av lys også fører til at det ikke blir dannet stivelse. Sammensetningen av glukoseenheten foregår i stroma i kloroplasten. Forsøket er todelt. Forsøk A

Forsøk B

Fotosyntese og rustne spiker Kapittel 9

Utstyr – Blad fra plante som har stått mørkt en stund (helst over fire dager) (Geraniumarter eller Coleus) – Sterile petriskåler

I dette forsøk skal du sjekke om en vannplante kan påvirke dannelsen av rust på en spiker og i så fall hvorfor den kan gjøre det. A

B

C

– Sukkerløsning – 3 g per 100 ml vann – Jodløsning

Utstyr – Blad, helst tynt og grønt

– Etanol

Utstyr – Vannplante, vasspest eller javabregne

– Aluminiumsfolie

– Glukoseløsning

– Vann

– Jodløsning

– Etanol

– Reagensglass

– Jodløsning

– Pinsett

Framgangsmåte 1. Skjær av bladstilken helt inntil bladplaten. 2. Legg ett blad i petriskålene med sukkerløsning. Løsnin­ gen skal dekke hele bladet.

– Petriskål

3. Legg ett blad i petriskålene med vann.

– Gassbrenner, kokeplate

Framgangsmåte 1. Lag et mønster på en bit aluminiumsfolie. 2. Dekk et område av et grønt blad med aluminiums­ folien. 3. La planten stå ved vanlige forhold i tre til fem dager. 4. Klipp så av bladet med folien og et annet blad fra den samme planten. 5. Kok bladene i vann et par minutter. 6. Legg så bladene i etanol. 7. Ta bladene over i petriskålene og tilsett jod. Resultater Noter resultatet og ta gjerne et bilde av bladet med møn­ steret. Gi en forklaring på de områdene som ikke blir far­ get av jod.

Framgangsmåte 1. Plasser vannplantene enten lyst eller mørkt i minst fire dager. Det bør være en del plantemateriale da det skal fordeles videre senere. 2. Fjern blader fra plantene, både fra dem som har stått lyst, og dem som har stått mørkt. 3. Drypp jod på bladene og noter hva som skjer. 4. Del den vannplanten som har stått mørkt, i to like deler (minst 4 cm i hver). 5. Legg den ene delen i vann.

7. Sett begge mørkt en ukes tid.

Resultat

Stått mørkt

Til læreren: Denne øvelsen kan også gjøres ved at du isolerer pigmentene og gir elevene i oppdrag å finne en metode for å kunne undersøke hvilket pigment de har fått utlevert, og så gjennomføre øvelsen. Det er viktig å ikke løse pigmentene opp i for mye etanol da dette innebærer at konsentrasjo­ nen av pigmenter lett kan bli for lav.

7. Skyll grundig med vann og legg bladene i petri skåler. 8. Tilsett jodløsning til bladene. 9. Noter hva som skjer med bladet og jodløsningen. Resultat

Spørsmål På hvilken måte blir dette påvirket av lyset?

Spalteåpninger

Sett resultatene inn i tabellen.

Dersom du tilsetter jodløsning til glukose, vil du ikke få en fargeforandring i løsningen. Hva er det som gjør at jod kan danne et fargekompleks med stivelse?

6. Kok så begge bladene i etanol.

Hvor foregår dannelsen av stivelse i bladet?

8. Etter ei uke fjerner du blader fra begge vannplantene og tilsetter jod til hver av dem.

Vasspest eller javabregne

5. Etter en uke tas bladene fram og kokes i vann.

Hvilket blad dannet stivelse i mørke?

6. Legg den andre delen i sukkerløsning.

Spørsmål

4. Plasser de to petriskålene på samme mørke sted i en uke.

Testet ved jod

Stått lyst Stått mørkt + sukkerløsning Stått mørkt + vann Til læreren: Dette forsøket kan du også gjøre ved å bruke blader fra for eksempel geranium og andre vanlige stueplanter. Husk at bladene da må kokes i vann og varmes i etanol, se forrige forsøk.

Kapittel 9 Spalteåpninger er helt vitale for en plante og for hvordan et blad organiserer gassutvekslingen sin. Tenk ut et forsøk der du enkelt skal kunne vise på hvilken side av bladet de fleste stueplantene har sine spalteåpninger (sukkulenter er ikke med her). Bladene som skal brukes, må være fra sam­ me art og må ha stått lyst. Gi først en forklaring på disse to kravene, og tenk så ut et forsøk der du kan vise på hvilken side spalteåpningene er. NB: Det er ikke lov å bruke lupe eller mikroskop.

Utstyr – Reagensrør med kork – Vannplanter, vasspest eller javabregne – Kokt og avkjølt vann – Aluminiumsfolie – Lyskilde – Spiker (ikke galvaniserte) – Begerglass – Sandpapir

Framgangsmåte 1. Puss hver av de tre spikrene med sandpapir før de legges ned i reagensrøret. 2. Merk rørene a, b og c og legg en spiker i hver av dem. 3. Legg like mye vannplante i rørene B og C. 4. Fyll reagensrørene fullstendig fulle med det kokte og avkjølte vannet. Få vekk mest mulig av luftboblene. 5. Dekk reagensrør C med aluminiumsfolie eller annet dekkmateriale som vil gjøre det lystett.


6 • Innhold

Innhold 2.3 Populasjonsstørrelser og spredning 56

Metoder for beregning av populasjons­størrelser 57

2.4 Samspill mellom arter 59

1 Evolusjon 10

1.1 Hva er evolusjon? 12 1.2 Mekanismer i evolusjonen 14 Reproduksjon i overflod 14

Nisjer og konkurranse 60

Predasjon – å spise eller bli spist 61

Symbiose – samliv 62

Sykdom 63

Endring i økosystemene 64

Arv med variasjon 15

2.5 Økosystemene 66

Seleksjon og overlevelse 16

Trofiske nivåer, næringsnett og næringskjeder 66

Evolusjon – betyr om og om igjen … 16

Karbonets kretsløp 71

Naturlig seleksjon 18

Nitrogenets kretsløp 73

Kunstig seleksjon – avl 22

Sammenlikning av energistrøm og grunnstoffenes kretsløp 75

1.3 Milepæler i evolusjonen 23 Selvreplikerende molekyler → Grupper av komplekse molekyler 25

2.6 Menneskelig påvirkning av økosystemene 76

Overgjødsling 76

Uavhengige replikatorer → Sammenhengende gentråd 25

Drivhuseffekten og klimakrisen 77

RNA som både gen og enzym → Gener av DNA og enzymer dannet av proteiner 25

Miljøgifter 81

Ozonlaget 83

Prokaryote celler → Eukaryote celler 26

Sur nedbør 83

Ukjønnet formering → Kjønnet formering 28

Trusler mot det biologiske mangfoldet 84

Encellede organismer → Dyr, planter og sopp 29

Enkeltindivider → Kolonier med sterile kaster 30 Primatsamfunn → Menneskesamfunn og dannelse av språk 31

Sammendrag 87 Oppgaver 89

1.4 Evolusjon av språk og kultur 32 1.5 Evolusjon som revolusjon 33

Belegg for evolusjon 38

Sammendrag 42

Oppgaver 43

3 Fra gen til protein 98

3.1 DNA 100

DNA er en dobbeltspiral 101

DNA er organisert i kromosomer 102

3.2 Fra gen til protein 104

Hva er et gen? 104

Aminosyrer er byggesteinene i proteiner 105

Transkripsjon – fra gen til mRNA 106

2.1 Hva er økologi? 48

mRNA-bearbeiding 108

Transport av mRNA ut av cellekjernen til cytosol 109

2.2 Artenes utbredelse – et samspill mellom organismene og miljøet 53

Den genetiske koden 109

Translasjon – fra mRNA til protein 111

2 Økologi 46


Innhold • 7

3.3 Proteiner 115

Proteiners strukturnivåer 115

Sortering av nylagde proteiner 116

Proteiners funksjoner 117

3.4 Genregulering 118 3.5 Mutasjoner 121

Substitusjon 121

Insersjon og delesjon 123

Mutagener 124

Sammendrag 125 Oppgaver 126

5 Genetikk 156

5.1 Hva er genetikk? 158

Genetiske faguttrykk 158

Mendels arvelover 160

5.2 Monohybrid arvegang 161

Testkryssing 164

Stamtavler 165

5.3 Dihybrid arvegang 166

Dihybrid arvegang med kobling av gener 168

5.4 Kjønnsbundet arvegang 172 5.5 Sammensatte arvemønstre 175

4 Celledeling 132

4.1 Fra celle til organisme 134 4.2 Kopiering av DNA 136

Starten på DNA-kopiering 136

DNA-kopiering 137

Korrekturlesing av nylaget DNA 139

4.3 Mitose – produksjon av nye celler med identisk DNA 140 Kromosomer 140

De ulike fasene i mitosen 142

4.4 Meiose – produksjon av kjønnsceller 144

De ulike fasene i meiosen 144

Genetisk variasjon 147

4.5 Sammenlikning av mitose og meiose 148 4.6 Kontroll av celledelingen 149

Endepunktet i en celles livssyklus – celledød 150

Sammendrag 152 Oppgaver 153

Skala av dominans 175

Multiple genvarianter 177

Letale gener 178

Pleiotrope gener 179

Epistase 179

Nedarving av kvantitative egenskaper 182

Nedarving av menneskelige egenskaper 183

5.6 Epigenetikk 185

Epigenetiske mekanismer 186

Hva kan epigenetiske forandringer føre til? 187

Imprinting og X-inaktivering 188

5.7 Genetiske sykdommer 189

Recessive arvelige sykdommer 190

Dominante arvelige sykdommer 193

Kjønnsbundne arvelige sykdommer 195

Kromosomavvik 196

5.8 Sykdom – et samspill mellom arv og miljø 198

Fedme 199

Diabetes 199

Kreft 200

Hjerte- og karsykdommer 200

Sammendrag 201 Oppgaver 202


8 • Innhold

7.4 Navnsetting av enzymer 259 7.5 Kofaktorer og koenzymer 260

6 Populasjoner 214 6.1 Livshistoriestrategier – reproduksjon og overlevelse 216

7.6 Regulering av enzymaktivitet 260

Hemmere av enzymaktivitet 261

Allosteriske enzymer – kontroll ved å endre seg 262

Tilbakekopling 263

Livshistoriestrategi 216

Sammendrag 264

Vekstrater og vekstkurver 219

Oppgaver 265

6.2 Populasjonsgenetikk 226

Mutasjoner 226

Genetisk drift i små populasjoner – tilfeldighetens kraft 227

Genflyt og isolerte populasjoner 228

Hardy-Weinbergs likevekt 229

6.3 Dannelse av en ny art 233

Barrierer for reproduksjon 234

Artsdannelse ved polyploidi 236

6.4 Genetisk analyse – Hva betyr det for anslåtte slektskap og evolusjon? 238 Sammendrag 242 Oppgaver 243

8 Celleånding 268

8.1 Næringsstoffer i kostholdet 270

Fett 271

Proteiner 272

Karbohydrater 272

8.2 Nedbrytning av glukose 273

Glykolyse 274

8.3 Videre nedbrytning av glukose uten oksygen 276

7 Metabolisme 250

7.1 Alt levende trenger en kilde for energi og karbon 253

Forholdet mellom fotosyntese og katabolisme 254

7.2 Enzymer 255

Hvordan øke reaksjonshastigheten til en reaksjon? 256

Hva er et enzym? 256

7.3 Enzymer og miljø 258

Dannelse av etanol ved anaerob nedbrytning 277

Dannelse av melkesyre ved anaerob nedbrytning 277

8.4 Videre nedbrytning av glukose ved tilgang på oksygen 278

Mitokondriet 279

Oksidasjon av pyruvat – nøkkelen inn i mitokondriets matriks 279

Krebssyklus 280

Oksidativ fosforylering 281

8.5 Kontrollmekanismer i celleåndingen 284

Enzymer som virker inn på glykolysen og krebssyklusen 284

8.6 Evolusjon av metabolisme 285

pH-verdien 258

Temperatur 258

Sammendrag 287

Mengden av substrat og enzym 258

Oppgaver 288


Innhold • 9

10.4 Genterapi og gentester 347

9 Fotosyntese 292 9.1 Energi 294

Lysenergi 295

9.2 Fotosyntesen 298

Genterapi 347

Bioteknologi og kreft 349

Gentesting 350

DNA-bibliotek og mikromatriser (chip) 352

DNA-chip 352

10.5 Stamceller 353

Hvor finner vi stamceller? 354

Hva kan stamceller brukes til? 355

Kloroplaster 299

Fotodelen av fotosyntesen 300

10.6 Kloning 357

Protongradient og produksjon av ATP 302

Kloning av gener 357

Syntesedelen av fotosyntesen 304

Kloning av celler 357

Kloning av organismer 357

9.3 Ytre faktorers påvirkning og tilpasninger 308

Karbondioksid, CO2 308

Kjemisk påvirkning (herbicider) 312

9.4 Andre former for fotosyntese 315

Økologisk betydning av fotosyntetiserende bakterier 316

Sammendrag 317 Oppgaver 318

10.7 DNA-profil, rettsgenetikk og moderne biologi 361

Hva er en DNA-profil? 361

Rettsgenetikk 362

Strekkoding – Barcode 362

Bioinformatikk 363

Systembiologi 363

10.8 Lovgivning 364 10.9. Anvendelse av kunnskapen 365

Etikk 365

Sammendrag 370

10 Bioteknologi 324 10.1 Hva er bioteknologi? 326 10.2 Verktøy i arbeid med DNA 327

Kutte DNA – bruk av restriksjons­enzymer 327

Oppformere ønsket DNA – bruk av PCR 331

Sette inn ønsket DNA 333

Oppformere DNA i bakterier 339

Identifisere ønsket DNA 339

10.3 Genmodifiserte organismer (GMO) 340

Bruk av transgene planter 342

Bruk av transgene dyr 345

Andre produkter fra moderne bioteknologisk virksomhet 347

Oppgaver 372

Grunnleggende kjemi i biologien 378 Å svare på spørsmål i biologi 398 Praktisk arbeid 408 Læreplan i biologi 435 Stikkord 441


1

Evolusjon Ord og faguttrykk du bør kunne før du begynner på kapitlet

• populasjon

• RNA

• pollinator

• basepar

• herbivor

• prokaryot

• DNA

• eukaryot

Mål for dette kapitlet er at du skal kunne • gjøre greie for grunntrekkene i evolusjonsteorien og hva slags kunnskap den bygger på • gjøre greie for teorier om hvordan livet på jorda har oppstått, og beskrive noen hovedtrekk i hvordan utviklingen av livet på jorda har foregått


12 • Kapittel 1

1

«Ingenting i biologien gir mening, unntatt i lys av evolusjonen.» T. Dobzhansky, amerikansk biolog (1973)

1.1 Hva er evolusjon?

volvere (lat.) – rulle volvo (lat.) – jeg er rullende evolvere (lat.) – rulle ut

Evolusjon er utvikling. Selve ordet evolusjon kommer fra det latinske verbet volvere, som betyr å rulle. Når vi setter en e som forstavelse, blir betydningen å rulle ut. I evolusjonsfaget ruller på samme måte livet seg ut, og kunnskapen om opphavet til og utviklingen av livet. Verbet evolvere stammer fra den tiden da en rullet ut leserullene, eller datidens bøker.

Som 22-åring ble Charles Darwin (1809–1882) tilbudt å bli med som natur­ vitenskapsmann på en jordomseiling. Reisen med skipet «Beagle» tok fem år, og han kom hjem med et overveldende vitenskapelig materiale. Det var først da han begynte å bearbeide observasjonene sine, særlig de om finkene på øygruppen Galápagos utenfor Sør-Amerika, at han langsomt begynte å utforme teorien om at alle livsformer har utviklet seg fra tidligere arter og former. Men denne utviklingen måtte ha foregått over et nesten ufattelig langt tidsrom, langt større enn det de religiøse skapelsesmytene ga rom for. Samtidig hadde geologer forstått at alderen på jorda var mange millioner år, og det betydde at Darwins gradvise tilpasningsteori kunne være holdbar.

Charles Darwin (1809–1882). empiri – grunnet på erfaring

Det er viktig å understreke at evolusjonsteorien ikke kan bevises på samme måte som et matematisk bevis, men bygger på stadige observasjoner som underbygger teorien. Dette er et iboende problem med alle empiriske vitenskaper. Et utsagn som «alle hester er hvite» kan ikke bevises, men bare motbevises dersom vi ser en brun hest. I dag er evolusjonsteorien så godt underbygd gjennom over 150 års observasjoner og forsøk at den er allment godtatt i vitenskapen. Den er en av naturvitenskapens fundamenter. Det betyr ikke at det evolusjonsbiologene sier, er absolutt korrekt, eller at alt vi tror om livet i dag, er korrekt og uforanderlig. Som de fleste andre fag er biologien i stadig forandring og utvikling. Det er likevel slik at i alle seriøse biologiske miljøer er evolusjonsteorien et viktig og aktivt brukt redskap fordi den beskriver generelle prosesser som er grunn­ leggende for å forstå all biologi. Etter at oppbygningen av DNA ble kjent, har vi fått en langt bedre forståelse av hvordan det kan oppstå vilkårlige forandringer i genmaterialet. Slike forandringer kan føre til endringer i organismene, og slike endringer kommer igjen under påvirking av miljøet. All moderne biologi bygger i dag på evolusjonsteorien. Dessuten har vi fått en langt mer pålitelig tidsskala for når de enkelte arter eller former oppstod, se figuren på neste side.


Evolusjon • 13

millioner år 0.15

Homo sapiens

45

Hvaler

50

Hester

80

Primater

130

Blomsterplanter

150

Fugler

210–65

Dinosaurer

210

Primitive pattedyr

260

Pattedyrlignende krypdyr

300

Nakenfrøete planter

340

Krypdyr

350

Karsporeplanter

390

Padder, insekter

450

Planter, sopp og virvilløse dyr på land

500

Fisk

1000 2000–1500

Første flercellede dyr Oksygen i atmsofæren og dermed også ozon, som beskytter mot UV-stråling

2000

Aerobe cyanobakterier danner oksygen ved fotosyntese

2100

Første eukaryote celle

3500–3000 3500 4600–4000 4600

Anaerobe kjemotrofe bakterier, anaerobe heterotrofe bakterier Tidligste spor av anaerobe fotosyntetiserende bakterier Jorden avkjøles og får fast overflate Jorden dannes

Begrepet evolusjon og verbet å evolvere gir en mer presis beskrivelse av de prosessene som har skjedd, og som skjer, enn det mer generelle begrepet utvikling. Grunnen er at utvikling også kan brukes om det å vokse, utvikle seg fra en zygote til et voksent individ, eller når mennesker med en plan og et mål utvikler en ny ting eller et redskap. Evolusjonen forandrer derimot gen­materialet mellom generasjonene, og prosessen har ikke en plan, heller ikke et formål. Evolusjonen har implikasjoner på alle nivåer i livet. I biologien skiller vi ofte mellom mikronivå og makronivå. Det kan også være hensiktsmessig om vi vil observere og forstå evolusjonen. Mikroevolusjonen dreier seg om evolusjonen av ulike gener, mens makroevolusjonen handler om konsekvensene disse forandringene får for organismer og arter. Med mikroevolusjon mener vi altså hvordan genene i en populasjon kan endre seg over noen få generasjoner, les mer om dette i kapittel 6 Populasjoner, mens vi med makroevolusjon mener hvordan en art kan gi opphav til en eller flere nye arter over et lengre tidsspenn. Dette er en svært skjematisk inndeling, og evolusjonen omfatter dem begge. Darwin visste ikke om gener eller hvordan de blir nedarvet. Men han observerte makroevolusjon ved å studere fossiler og likheter mellom nålevende arter. Evolusjonsbegrepet brukt i denne boka bygger på den moderne syntesen, der Darwins observasjoner er flettet sammen med og gitt vitenskapelig belegg fra fagfeltene genetikk, matematikk og økologi.

Tidsakse. Å forstå den enorme tiden det har tatt å utvikle livet til det vi kjenner i dag, er ofte svært vanskelig.


14 • Kapittel 1

Det som evolverer, altså forandrer seg over tid, er genene, mens det som blir selektert, er individer. At noe blir selektert, betyr at en variant overlever bedre eller kopierer sitt genmateriale mer effektivt enn en annen variant. Dermed smelter mikro- og makroevolusjonen sammen i moderne biologi, også kalt den moderne syntesen i evolusjonen. Det er samme prosess, men forskjellige metoder som blir brukt for å observere den på forskjellige nivåer. Molekylære metoder og studier av individer bruker vi for å studere evolusjon på kort sikt, mens en bruker sammenlikning av fossiler og organismer over lang tid for å forstå livets tre og slektskapet mellom artene. Dette kapitlet skal i hovedsak handle om makroevolusjon, mens kapittel 6 Populasjoner i hovedsak handler om mikroevolusjon.

Sjekkpunkter: Nye ord og faguttrykk: empiri, mikroevolusjon, makroevolusjon, seleksjon Hva betyr evolusjon? Har evolusjonen en retning eller et mål? Hva er mikroevolusjon? Hva er makroevolusjon?

1.2 Mekanismer i evolusjonen Evolusjon ved naturlig utvalg skjer på grunn av tre faktorer: • reproduksjon • variasjon • seleksjon

Reproduksjon i overflod

Antall individer etter seks dager: A: 26 = 64 B: 36 = 729 729/64 = 11,4

Evnen til å reprodusere, det vil si å lage kopier av seg selv, er en av forut­ setningene for evolusjon. Dersom vi ser tilbake på evolusjonshistorien, er det tydelig at de artene som eksisterer i dag, er de som har vært gode til å reprodusere seg. For å illustrere hvilket enormt press det er for å reprodusere hurtig, kan du tenke deg to arter, A og B. Arten A produserer to avkom hver dag, mens arten B produserer tre avkom. Dersom avkommene overlever med samme sannsynlighet, er det etter bare seks dager elleve av art B for hvert individ av art A. Etter 34 dager er det bare én av en million avkom som tilhører arten A. Med matematisk språk sier vi at slike populasjoner har muligheten til å vokse eksponentielt. Denne voldsomme konkurransen i å reprodusere hurtig eksisterer mellom arter, men også mellom individer av samme art.


Evolusjon • 15

De aller fleste organismene på kloden produserer avkom i overflod. En voksen hunntorsk gyter for eksempel noen millioner egg hvert år, og de blir befruktet av melke. Til sammen blir det befruktet langt flere egg enn de to individene som må til for å erstatte foreldrene slik at populasjonen holder seg like stor. Dersom alt avkommet skulle overlevd, ville det bare tatt noen få år før vi kunne vandre tørrskodd på et berg av torsk over Atlanteren. Før populasjonen når slike størrelser, blir den begrenset av en mengde andre faktorer som konkurranse, predasjon, sykdom, stress og opphoping av avfallsstoffer. Les mer om dette i kapittel 6. I naturen er det derfor slik at de aller fleste avkommene dør før de selv rekker å reprodusere seg. Thomas Malthus (1766–1834) ble kjent da han postulerte at befolknings­ veksten er mye høyere enn økningen av matvareproduksjonen. Som en følge av det kan bare en liten del av befolkningen overleve på lang sikt.

Arv med variasjon Den neste forutsetningen for evolusjon ved naturlig utvalg er at egenskaper går i arv fra en generasjon til den neste. Hos de levende organismene på jorda er det genene, kodet i DNA, som blir nedarvet. Kopieringen av DNA er ikke 100 % perfekt slik at arvematerialet som regel forandrer seg litt fra generasjon til generasjon. Hos for eksempel bakterier er det først og fremst mutasjoner som fører til at DNA blir litt annerledes. Årsaken til dette er at bakteriene deler seg oftere, enn de som har kjønnet formering og derved blanding av gener. Mutasjonene kan enten være endringer i enkelte basepar, eller det kan være deler av arve­materialet som blir duplisert eller faller bort, se kapittel 3 Fra gen til protein. Ved ukjønnet formering er derfor avkommet svært likt opphavet sitt, men sjelden helt likt. Vi sier likevel at det er en klon av morindividet. Hos arter med kjønnet formering blander gametene (kjønnscellene) fra foreldrene seg og dermed genmaterialet. Halvparten av genene kommer fra hver av foreldrene. Ved kjønnet formering blir det derfor større genetiske forskjeller mellom foreldrene og avkommet, og også mellom avkom fra samme foreldrepar. Når vi synes foreldre og barn likner hverandre i oppførsel og evner, sier vi ofte at «eplet ikke faller langt fra stammen». Det gjenspeiler at vi ser arveligheten i barnet, men også den variasjonen det har.

Ved kjønnet formering er det viktig å huske at det ikke bare er mutasjoner på gennivå som gir genetiske variasjoner hos arter, men også hvordan kromosomene fordeler seg, og mulige rekombinasjoner i forbindelse med celledelingene. Mer om dette i kapittel 5 Genetikk. Denne variasjonen gjør at evolusjonen får stadig nye genkombinasjoner å jobbe med. I kapitlet om celledeling kan du lese mer om hvordan DNA blir kopiert og nedarvet, og hvilke molekylære mekanismer som bidrar til arv og variasjon.


16 • Kapittel 1

Variasjon er svært viktig i alt levende, men ofte vanskelig å forstå viktigheten av. Det skyldes kanskje nettopp at vi mennesker streber etter å systematisere og kategorisere. Vi rasjonaliserer og tenker nok heller i homogene, ensartede grupper enn i heterogene grupper. Men i naturen er variasjon selve funda­ mentet for utvikling, og liten variasjon fører ofte til store skader for populasjonen, særlig hos høyerestående dyr. Hos mennesket viser de fleste undersøkelser at omtrent halvparten av all variasjonen mellom individer er genetisk, mens den andre halvdelen skyldes miljø.

Seleksjon og overlevelse Fordi individene er litt forskjellige, er det alltid noen som er dårligere tilpasset miljøet, altså de abiotiske og biotiske forholdene et individ lever i. Dersom disse individene forblir under de samme forholdene, har de en høyere sannsynlighet for å dø. Enten dør de oftere av sykdom og av at de blir spist, eller av mangel på ressurser. De har altså langt færre muligheter til å få ført genene sine videre til neste generasjon. Noe forenklet kan vi si at økologien er det fagfeltet som beskriver hvordan seleksjonen finner sted, enten det gjelder hvordan organismen er tilpasset de fysiske miljøforholdene, eller konkurranse­ forhold innenfor en populasjon eller mellom arter. Du kan lese mer om dette i kapittel 6 Populasjoner. Foredling, eller kunstig seleksjon og formering, av planter og dyr er en gammel tradisjon innenfor landbruket. Darwin fikk da også inspirasjon fra denne foredlingsteknikken til å forklare evolusjonen som naturlig seleksjon.

fitness (eng.) – egnethet

Et individ som viderefører genene sine oftere til neste generasjon enn andre individer, har høy fitness. Fitness er altså et uttrykk for hvor mye ens eget genmateriale er med i de framtidige generasjonene.

Evolusjon – betyr om og om igjen … Reproduksjon skaper mange avkom som arver egenskaper fra opphavet, men siden nedarvingen ikke er 100 % perfekt, er det variasjon blant avkommene. Det er de best tilpassede som overfører flest av sine gener til neste generasjon. Disse to setningene oppsummerer de grunnleggende mekanismene i evolusjonen ved naturlig utvalg. Fordi disse prosessene skjer om igjen og om igjen i generasjon etter generasjon, består populasjonen etter hvert av individer som er bedre og bedre tilpasset de fysiske og biologiske omgivelsene de lever i. Denne prosessen kalles tilpasning og er produktet av evolusjon ved naturlig utvalg.


Evolusjon • 17

Nedenfor følger fire punkter som viser og sammenfatter hvordan disse mekanismene sørger for at organismer over tid evolverer. • Det er ikke noe mål eller noen hensikt med evolusjonen, og det er heller ingen guddommelighet som står for seleksjonen. I hver generasjon er det økologien, slik den er akkurat der og da, som står for den naturlige seleksjonen. Fordi evolusjonen ikke kan se framover i tid eller planlegge, sier vi ofte at den er en blind prosess. • Evolusjonen skjer gradvis og ofte i små skritt ved å flikke på eksisterende løsninger. Bare sjeldne ganger hender det at store mutasjoner kan føre til raskere endringer og nye løsninger. • Fordi naturlig seleksjon favoriserer de best tilpassede i hver eneste generasjon, må hver utgave av en egenskap være litt bedre enn den forrige. Når for eksempel fiskene, som puster med gjeller, utviklet seg til landlevende dyr som puster med lunger, må hver eneste overgangsform ha vært litt bedre tilpasset miljøforholdene enn den forrige. I en ubrutt kjede må de gradvis ha taklet livet på land bedre, fra fisk med gjeller, via fisk som pustet med svømmeblæren, til landlevende dyr med lunger. • Den naturlige seleksjonen virker på individer, ikke på arter eller populasjoner. Det som blir nedarvet, er gener. Evolusjonen skjer på populasjonsnivå, se kapittel 6.2 Populasjonsgenetikk. Moderne evolusjonbiologer med Richard Dawkins i spissen har utviklet et begrepspar som enklere forklarer logikken i evolusjon ved naturlig utvalg. Hver organisme inneholder en replikator. Replikatoren er arvematerialet som inneholder en oppskrift god nok til å kopiere seg selv. En del av oppskriften blir brukt til å bygge en kropp eller organisme, som replikatoren eksisterer inne i. Denne kroppen blir kalt farkosten, og farkosten hjelper replikatoren gjennom en generasjon og aller helst videre til neste generasjon. Den engelske evolusjonsbiologen Richard Dawkins bruker i sin bok «River out of Eden» følgende metafor: Organismene er farkoster som replikatorene bruker i seilasen på Livets elv.

Replikatoren (DNA-et) overlever nesten uforandret fra generasjon til generasjon, og det er den som gradvis evolverer. På mange måter kan vi si at replikatoren sikter på evig liv. Farkosten (kroppen) blir satt sammen på nytt i hver eneste generasjon. Den kommer til å dø før eller siden, og den er konstruert for bare å vare en stund.


18 • Kapittel 1

Naturlig seleksjon

Plantehøyde Evolvert populasjon

a) Stabiliserende seleksjon

Antall individer

Naturlig seleksjon kan påvirke fenotypen i en populasjon på tre forskjellige måter. Den kan virke stabiliserende, være rettet eller virke splittende. • Stabiliserende – En stabiliserende seleksjon selekterer bort de individene som for eksempel er høyere eller lavere enn gjennomsnittet, se figuren. Resultatet blir at det er flest av de genvariantene som gir gjennom­snittlig høyde. Det kan for eksempel skyldes at de lave plantene må leve i skyggen av høyere planter, mens de aller høyeste blir mest utsatt for vind og kan knekke. • Rettet – En rettet seleksjon favoriserer de genene som gir en ekstrem fenotype, for eksempel enten svært høye eller svært små planter. Som et resultat beveger populasjonen seg enten mot høyere eller lavere planter. • Splittende – En splittende seleksjon favoriserer de genvariantene som er forskjellige fra hverandre. I vårt eksempel kan det være fordi de middels høye plantene møter sterk konkurranse fra andre arter, som fører til at både lave og høye planter blir favorisert av den naturlige seleksjonen. Dermed blir de mellomhøye plantene selektert bort. I noen tilfeller kan sterkt splittende seleksjon over lengre tid føre til at én art blir til to arter. Antall individer

Antall individer

Naturlig utvalg og naturlig seleksjon betyr det samme. De er begge oversatt fra natural selection (eng.)

Plantehøyde

Plantehøyde

Opprinnelig populasjon

b) Rettet seleksjon

c) Splittende seleksjon

Ulike seleksjonstyper: Seleksjon kan virke ulikt på en populasjon. Dersom vi favoriserer plantene med middels høyde, er det en stabiliserende seleksjon (a); dersom vi favoriserer de høye eller lave, er det en rettet seleksjon (b), mens det blir en splittende seleksjon (c) dersom vi favoriserer både store og små.

Seksuell seleksjon For de artene som har utviklet kjønn, snakker vi i biologien også om en type seleksjon knyttet til selve formeringen. Seksuell seleksjon oppstår når et individ kan velge sin seksuelle partner. Seksuell seleksjon kan være interseksuell eller intraseksuell. Interseksuell seleksjon er at hunnene velger hannen på bakgrunn av egenskaper hos ham, for eksempel når påfuglhunner velger hvilken hann de vil pare seg med. Den


Evolusjon • 19

Stangende rein som slåss om simler til haremet sitt.

intraseksuelle seleksjonen er konkurranse mellom hannene om hunnene, for eksempel når to reinsdyrbukker slåss for å samle simler til haremet sitt. Charles Darwin var selv en av pionerene innenfor fagområdet seksuell seleksjon, noe som kanskje ikke er så rart når vi vet at han særlig observerte fugler. Fargeprakten hos hannfuglene har imponert mennesket i mange år. Fenomenet seksuell seleksjon kan til tider gi de merkeligste resultater, og dette var også bakgrunnen for hvorfor Darwin ble opptatt av denne seleksjonsmekanismen. For eksempel er det hos paradisfugl (finnes ikke i Norge) slik at den dominante hannen har en fjærdrakt som klart hemmer ham i flygning og dermed gjør at han lettere kan bli tatt av en predator. Men dersom han overlever, har denne hannen høy fitness fordi hunnene velger å pare seg med ham. Dermed blir altså «glamourkostnaden» oppveid av den høye sannsynligheten for at genene blir videreført. Dette er et eksempel på interseksuell seleksjon. Viften av halefjær hos påfuglhannen er et annet eksempel på resultatet av seksuell seleksjon. Eksempler fra norsk fauna er storfugl, tiur og røy (Tetrao urogallus) og orrfugl (Tetrao tetrix). Konkurranse mellom hanner skjer ikke bare før paringen, som en kamp om gunst hos hunnene, men også etterpå. Når hunner parer seg med mer enn én hann, kan det også oppstå konkurranse mellom spermiecellene fra ulike hanner. Hos slike arter er det observert at hannens kjønnsorgan er utviklet for å takle og delta i en slik spermiekrig. Et eksempel er øyestikkere og deres paringsdans. Øyestikkerhannens penis er slik utformet at den kan fjerne sæd fra andre hanner i hunnens kjønnsorgan, før hannen selv ejakulerer i det. Etterpå forblir hannen sammen med hunnen, og de kan observeres flygende oppå hverandre. Dette har både en skremmende effekt på andre hanner, og det kan sikre denne hannens sæd større mulighet for å befrukte eggene. Noe av det samme kan vi observere hos planter. Tidlig pollenspiring og rask vekst av pollenslangen øker muligheten for befruktning for de to sædcellene som er inne i pollenslangen. Det blir dermed konkurranse mellom pollenkorn om å ha den raskeste pollenspiringen.

Påfuglhann med en enorm fjærdrakt. Den flotte viften av halefjær er et resultat av seksuell seleksjon.

Øyestikkere i paringsdans.


20 • Kapittel 1

ejakulasjon = sædtømming

Våre nære slektninger blant primatene, sjimpanse og gorilla, har ulike tilpasninger til den intraseksuelle seleksjonen. Hunngorillaen parer seg bare med én hann ved hver eggløsning, mens hunnsjimpansen parer seg med mange. Til tross for at en hannsjimpanse veier omtrent en fjerdedel av hanngorillaen, har sjimpansen fire ganger så store testikler. Store testikler sørger for en høyere produksjon av sædceller og også flere sædceller under ejakulasjonen. Samlet sett økes muligheten for at én av sædcellene kan få befruktet en eggcelle. Vi kan altså si at det er en tilpasning til flere partnere hos hannsjimpansen. Hanngorillaen derimot satser på å bli valgt av hunngorillaen heller enn å produsere flere sædceller. Blir han valgt, har han mange nok sædceller. I forhold til kropps­ vekten ligger testikler hos mennesket et sted mellom gorilla og sjimpanse. I en normal ejakulasjon hos menn kan det være mellom 1 og 6 ml sæd. Det er sædceller blandet med flere væsker som til sammen danner den sæden som blir frigitt. Det dannes svært mange sædceller per mann.

Stokkender (Anas platyrhynchos) har tydelig forskjell i hannlig og hunnlig fjærdrakt. Hannen har en markant og synlig drakt med flere farger. Hunnen er grålig med mørkere flekker.

Det er flere forklaringer på hvorfor en slik interseksuell seleksjon kan foregå. Tilsynelatende virker det ulogisk at en egenskap som gjør at du som hann­ individ lever et svært farlig liv, skal gi deg så høy fitness. Men flere teorier peker på at det kan være et samsvar mellom hvordan hannen ser ut, eller hvordan han har pyntet seg, og den generelle helsetilstanden hans. Så hvis en hann har klare farger og ellers er frisk, er kvaliteten på immunforsvaret hans bra. Og han blir dermed valgt. Hos de aller fleste virveldyr i dyreriket er det hannen som har jobben med å gjøre seg synlig, lekker og uimotståelig for en mulig partner. Det er også hannen som produserer store mengder av gameter, mens hunnen produserer få. Seksuell seleksjon er ofte forklaringen på at kjønnene hos mange dyr til dels er svært ulike. For eksempel bidrar seksuell seleksjon til at hannene hos mange fuglearter har sterke farger, men forskjellen i utseende mellom kjønnene blir i tillegg forsterket av seleksjon for kamuflasjefarger hos hunnen, som ruger eggene. Hos arter som padde og frosk blir hunnen påvirket av hvor kraftig hannen synger. Så velger hun den som synger best, og går til hans dam. Men på veien dit kan hun lett bli overfalt av yngre hanner som har tapt i territoriell kamp mot den store hannen. Disse hannene parer seg ofte med hunnen og kan da få overført genene sine uten egentlig å ha blitt valgt av hunnen.

Koevolusjon Når to arter lever i et avhengighetsforhold, får vi en koevolusjon. Koevolusjon er ingen artsdannelse. Men utvikler den ene arten seg, må den andre tilpasse seg denne endringen. Så snart den ene arten endrer seg, blir det et sterkt seleksjonspress på den andre for å utjevne den oppståtte forskjellen. Dette er særlig tydelig hos parasitter som hele tiden må tilpasse seg vertens utvikling uten å bli for effektiv. Blir parasitten for effektiv, dør verten. Det samme gjelder forholdet rovdyr/byttedyr eller plante/herbivore, se side 224.


Evolusjon • 21

Planter og fugler har også utviklet et avhengighetsforhold ettersom mange planter er avhengige av fugler for å få spredd frøene sine. Det gjør de ved å la frøene være inne i en frukt eller et bær. Jo flottere farger, desto bedre ser fuglene bærene, og desto bedre spredning blir det. Og jo bedre fargesyn fuglene har, desto lettere ser de bærene og får tilsvarende mer næring. Planter og insekter har også utviklet et avhengighetsforhold. Det gjelder både insekter brukt som pollinatorer og insekter som hjelper til med å spre frøene. For eksempel visner en del planter ned til bakken når frøene er modne. Da får maurene lett tak i frøene. Jo flere frø maurene får tak i, desto bedre spredning blir det. Maurene spiser på sin side fettet på utsiden av frøene, og desto flere frø de finner, desto større suksess har de i næringssøket sitt. Det fettet som plantene legger utenpå frøet, er ikke nødvendig for at frøet skal spire.

Mimikry Å herme etter noe eller noen er en enkel og billig måte å få fordeler på. Og det er ikke bare mennesker som tenker slik. I naturen er det flere organismer som hermer etter andre arter for å slippe å bli spist, eller for å få spredt pollen. Når organismer hermer slik, kaller vi det mimikry. Mimikry oppstår og blir vedlikeholdt gjennom naturlig seleksjon.

mimikos (gr.) – imitere

Sommerfugllarve som ligner på en slange. Få predatorer tar sjansen på å prøve seg på denne.


22 • Kapittel 1

Mange insekter hermer etter giftige insektarter fordi predatorer har lært seg å unngå å spise dem. Dersom etterlikningen er effektfull, tjener «hermeren» dobbelt på det. Hun blir ikke spist, og hun slipper å produsere giftstoffet, noe som ofte er energikrevende. I 1998 ble forskerne klar over en av havets kanskje beste etterliknere. Det er blekkspruten med det dekkende navnet Thaumoctopus mimicus. Den finnes ikke i norske farvann.

Kunstig seleksjon – avl Kunstig seleksjon er når det individet som blir valgt ut, er valgt av mennesket i stedet for at den naturlige seleksjonen påvirker hvem som skal overleve og reprodusere. Hensikten med kunstig seleksjon er ofte å utvikle varianter med spesielle egenskaper, for eksempel matplanter med høyt næringsinnhold, rask vekst eller høy motstand mot sykdommer. Slik seleksjon kaller vi ofte planteog dyreforedling eller avl, og den har et mål med utviklingen sin i motsetning til evolusjonen. Dette har for eksempel gitt oss flere ulike typer kål. Et annet eksempel er alle de ulike hunderasene som finnes. Særlig blant enkelte populære raser kan vi nå se at mange individer sliter med sykdom, og en del av de hunderasene vi har i dag, ville ikke ha klart seg ute i naturen alene. Avl fører ofte til sykdom og opphopning av sykdommer hos individene. Tilsvarende problematikk får vi dersom det forekommer innavl. Innavl vil si at genetisk nært beslektede individer parer seg. Det gir liten genetisk variasjon og dermed særlig økt sannsynlighet for recessive sykdommer og defekter hos avkommet. Se mer i kapittel 5 Genetikk. Kål. Alle de seks typene av kål: hodekål, savoykål, romanescokål, brokkoli, nykål og rødkål, stammer fra én art, Brassica oleracea, som var en vanlig kålplante langs vestkysten av Europa.

På Norsvins seminstasjon på Hamar tappes sæd fra råner til utallige purker i landet. Ved hjelp av kunstig inseminasjon gir én råne opphav til enormt mange griser. Bildet viser sædtuber med rånesæd.

Christian 5.s norske lov av 1687 forbød ekteskap mellom tremenninger, søskenbarn og andre nært belektede.


Evolusjon • 23

Fram til tidlig i 1970-årene var plante- og dyreforedling knyttet til å velge ut og krysse hele organismer. Med de nye mulighetene som bioteknologien har gitt oss, se kapittel 10 Bioteknologi, kan vi overføre enkeltgener mellom individer av samme art og mellom individer som ellers ikke kunne ha utvekslet gener. Dermed er avlsarbeidet ikke lenger begrenset av de genene som i utgangs­ punktet finnes i populasjonen, eller de sjeldne mutasjonene som oppstår under­veis. Forskeren kan derimot hente egenskaper fra organismer som kan være ganske fjernt fra hverandre i systematikken.

Sjekkpunkter: Nye ord og faguttrykk: fitness, nisje, interseksuell seleksjon, intraseksuell seleksjon, innavl, koevolusjon, mimikry Hvilke tre faktorer må være til stede for at en art skal evolvere? Hva er fitness? Forklar tilpasning/adaptasjon. Hva er en replikator? Forklar forskjellen mellom rettet og stabiliserende naturlig seleksjon. Hva er interseksuell seleksjon? Hva betyr koevolusjon?

1.3 Milepæler i evolusjonen Til tross for at evolusjonsteorien er svært godt underbygd og alle seriøse biologiske fagmiljøer støtter den, betyr ikke det at evolusjonsbiologer er helt enige om alle detaljene i teorien. Men at evolusjonen skjer, er de enige om. Vi skal i dette avsnittet trekke fram åtte milepæler i evolusjonshistorien og vise hvordan disse åtte punktene gir opphav til alt det levende vi har rundt oss i dag. Disse åtte punktene ble først satt fram av John Maynard Smith og Eörs Szathmáry i boka The Major Transitions in Evolution i 1995. Flere av dem lærer du mer om seinere i boka, og de er her bare ment som oversiktspunkter. Hver milepæl innebærer forandringer i hvordan informasjon, oftest i form av gener, er lagret, videreført og oversatt. Punktene er skjematisk framstilt på neste side. Jorda kalles den blå planeten fordi over 70 % av overflaten er dekket av hav. Hvordan vannet opprinnelig ble dannet, er omdiskutert. En teori er at det ble tilført gjennom nedslag av enorme ismeteoritter. Vannet kan ikke ha blitt dannet ved en eksplosjon mellom hydrogen og oksygen. Det krever nemlig fritt oksygen, og det ble først dannet etter at fotosyntesen var etablert.


24 • Kapittel 1

millioner år 0.15

Milepæl nummer

8

Primatsamfunn menneskesamfunn og dannelse av språk

7

Enkeltindivider sterile kaster

Oksygen i atmsofæren og dermed også ozon, som beskytter mot UV-stråling

6

Encellede organismer og sopp

2000

Aerobe cyanobakterier danner oksygen ved fotosyntese

5

2100

Første eukaryote celle

Ukjønnet formering formering

4

Prokaryot

Jorden avkjøles og får fast overflate

3

Jorden dannes

2

RNA som både gen og enzym gener av DNA og enzymer av proteiner Uavhengig replikator sammenhengende gentråd Selvreplikerende molekyler grupper av komplekse molekyler

Homo sapiens

45

Hvaler

50

Hester

80

Primater

130

Blomsterplanter

150

Fugler

210–65

Dinosaurer

210

Primitive pattedyr

260

Pattedyrlignende krypdyr

300

Nakenfrøete planter

340

Krypdyr

350

Karsporeplanter

390

Padder, insekter

450

Planter, sopp og virvilløse dyr på land

500

Fisk

1000 2000–1500

3500–3000 3500 4600–4000 4600

kolonier med

Første flercellede dyr

Anaerobe kjemotrofe bakterier, anaerobe heterotrofe bakterier Tidligste spor av anaerobe fotosyntetiserende bakterier

1

dyr, planter kjønnet

eukaryot

Enkelte av disse milepælene husker du kanskje fra systematikken i Bi 1, hvor vi også snakket om hvordan formeringen har utviklet seg hos ulike arter. Mer om dette seinere. Universet oppstod for omkring 13 milliarder år siden, og jordkloden ble dannet omkring åtte milliarder år seinere. Den var da en glødende masse av smeltet materiale, hvor de tyngre elementene, særlig jern, sank inn i kjernen. De lettere silikatmineralene ble igjen på overflaten, hvor de etter hvert stivnet til et skall. Da temperaturen sank under 100 °C, begynte vannet å kondensere, og det dannet seg et mønster av hav og kontinenter. Atmosfæren var forskjellig fra det den er i dag, blant annet fordi det ikke fantes noe oksygen. Den inneholdt derimot ammoniakk, metan, nitrogen og hydrogensulfid, og disse forbindelsene ble alle langsomt overført med regnvannet til havet. Vi skal se nærmere på hver enkelt av de åtte overgangene. De er oppsummert i tabellen på side 31.


5 Milepæl nummer

millioner år 0.15 2100

Homoeukaryote sapiens celle Første

45 3500–3000

Hvaler kjemotrofe bakterier, anaerobe heterotrofe bakterier Anaerobe

50 3500 80 4600–4000 130 4600

Hester spor av anaerobe fotosyntetiserende bakterier Tidligste Primater Jorden avkjøles og får fast overflate Blomsterplanter Jorden dannes

Selvreplikerende molekyler ––> Grupper av komplekse molekyler 150

210–65

Fugler

Dinosaurer

8

formering Primatsamfunn menneskesamfunn og dannelse av språk

4

ProkaryotEvolusjon eukaryot

3

RNA som både gen og enzym gener av DNA og enzymer av proteiner Uavhengig replikator sammenhengende gentråd Selvreplikerende molekyler grupper av komplekse molekyler

2 1

210 Primitive pattedyr En mener at starten på en replikerende del av verden er enkle molekyler som 260 Pattedyrlignende kan ha vært forløperen til RNA.krypdyr Molekylene kunne ikke lage eller instruere 300 Nakenfrøete planter Som nevnt kopierer ingen replikator seg selv andre strukturer, det kom seinere. med 100 %340nøyaktighet, og særlig anses disse første replikatorene for å ha Krypdyr vært unøyaktige og for å ha 350 Karsporeplantergjort mange «feil». «Feil» i evolusjonen innebærer 7 derimot variasjon og muligheter for seleksjon og utvikling i populasjonen av 390 Padder, insekter millioner år Milepæl nummer replikatorer. Miljøet forandrer seg, og dersom replikatoren hadde vært perfekt 0.15 Homo 450 Planter,sapiens sopp og virvilløse dyr på land 8 og ikke kunnet endre seg, ville den før eller siden bli gammeldags og 45 Hvaler 500 Fisk utkonkurrert av de replikatorene som av og til gjorde feil og derfor skapte 50 1000 Første flercellede dyr variasjon med nyeHester muligheter. Under enkelte forhold kan polymerer og andre Primater 6 2000–1500 Oksygen i atmsofæren og dermed også samle ozon, som mot UV-stråling substanser i 80 en «ursuppe» av organiske stoffer segbeskytter og danne en 130 Blomsterplanter protobiont. En protobiont er en celleliknende struktur som ikke har noen 2000 Aerobe cyanobakterier danner oksygen ved fotosyntese 5 organeller2100 eller ekte cellemembran, men har en hinne mot omverdenen. 150 en Fugler Første eukaryote celle Slik får vi210–65 dannet Dinosaurer et indre rom med et mer kontrollert miljø. 3500–3000 Anaerobe kjemotrofe bakterier, anaerobe heterotrofe bakterier 210 3500

300 4600 340

kjønnet

bioun (gr.) – leve

Nakenfrøete planter Jorden dannes

2

RNA som både gen og enzym gener av DNA og enzymer av proteiner Uavhengig replikator sammenhengende gentråd Selvreplikerende molekyler grupper av komplekse molekyler Enkeltindivider kolonier med sterile kaster

Krypdyr

1

2100

Første eukaryote celle

5

RNA som både gen og enzym 4 ––> Gener av DNA og enzymer dannet 3 av proteiner 4600

Ukjønnet formering protos (gr.) – først formering

dyr, planter

3

Aerobe cyanobakterier danner oksygen ved fotosyntese

4600–4000

Encellede organismer og sopp

Pattedyrlignende Jorden avkjøles ogkrypdyr får fast overflate

2000

3500

Primatsamfunn menneskesamfunn og dannelse av språk

Prokaryot

I alle organismer som eksisterer nå, er arvematerialet organisert i enheter, for 7 350 Karsporeplanter eksempel som kromosomer eller som sirkulære tråder, plasmider. Det betyr 390 Padder, insekter at en enkel450 replikator, et gen, har bundet seg sammen med andre replikatorer Planter, sopp og virvilløse dyr på land i en sammenhengende tråd. En slik organisering sørger for at når ett gen blir 500 Fisk replikert, så blir alle det. Det forhindrer konkurranse mellom genene i en 1000 Første flercellede dyr enhet, og gjør det også mulig at gener som virker godt sammen, blir nedarvet 6 2000–1500 Oksygen i atmsofæren og dermed også ozon, som beskytter mot UV-stråling sammen.

3500–3000

kolonier med

4

Primitive pattedyr Tidligste spor av anaerobe fotosyntetiserende bakterier

Uavhengige replikatorer ––> Sammenhengende gentråd 260 4600–4000

Enkeltindivider sterile kaster

• 25

eukaryot

Encellede organismer og sopp Ukjønnet formering formering

dyr, planter kjønnet

Anaerobe kjemotrofe bakterier, anaerobe heterotrofe bakterier Tidligste spor av anaerobe fotosyntetiserende bakterier Jorden avkjøles og får fast overflate Jorden dannes

2

I dag samarbeider DNA og RNA om å produsere proteiner og å lagre oppskriftene 1 på proteinene. Det har utviklet seg en spesialisering av arbeidsoppgaver mellom de to nukleinsyrene. Men det er rimelig å anta at dette var arbeids­ oppgaver som RNA klarte alene i livets tidligere stadier. Når et RNA-molekyl fungerer som enzym, kalles det et ribozym. Enzymer fungerer ved å senke aktiveringsenergien i en reaksjon og dermed øke sannsynligheten for at en reaksjon skjer. Det er gjort forsøk i laboratorium som viser at RNA kan lage kopier av seg selv ved å fungere som et enzym. Enzymet kan sette nukleo­ tidene sammen. Det er også observert en seleksjon av slike RNA-populasjoner. Et slikt stadium kalles populært en «RNA-verden».

Prokaryot

eukaryot

RNA som både gen og enzym gener av DNA og enzymer av proteiner Uavhengig replikator sammenhengende gentråd Selvreplikerende molekyler grupper av komplekse molekyler


26 • Kapittel 1

pæl nummer

tråling

8

Primatsamfunn menneskesamfunn og dannelse av språk

7

Enkeltindivider sterile kaster

6

Encellede organismer og sopp

5

Ukjønnet formering formering

4

Prokaryot

3

RNA som både gen og enzym gener av DNA og enzymer av proteiner Uavhengig replikator sammenhengende gentråd Selvreplikerende molekyler grupper av komplekse molekyler

2 1

kolonier med

dyr, planter kjønnet

eukaryot

Overgangen fra en RNA-verden til en verden med DNA og proteiner krever evolusjonen av den «genetiske koden» som fundament for proteinsyntese, se kapittel 3 Fra gen til protein. En stor forskjell mellom DNA og RNA er at RNA i all hovedsak er enkelttrådet. Det betyr at en RNA-tråd har muligheten til å danne tredimensjonale former når nukleotidene baseparer. Dermed blir det laget forskjellige RNA-molekyler avhengig av rekkefølgen på nukleotidene. Slik kan noen RNA-molekyler være mer stabile og replikere raskere under bestemte forhold. Fordi RNA er enkelttråder, blir feil ikke reparert, og vi får variasjon. Dermed kan det bli en seleksjon av de RNA-molekylene som er best tilpasset forholdene der og da. Det er viktig å se likhetene og forskjellene mellom hvordan RNA her kan lage tredimensjonale ribozymer på bakgrunn av den rekkefølgen nukleotidene kommer i, og hvordan rekkefølgen av aminosyrene bestemmer strukturen til proteiner, se kapittel 3 Fra gen til protein. At alle genene skulle være samlet på én tråd og så bli kopiert over på en ny tråd, gir visse begrensninger. Når arvestoffet er enkelttrådet, er det ikke noen mulighet for å «lese korrektur» på kopieringen, og da bør ikke genomet være for stort. I dag er det bare enkelte virus som har RNA som arvemateriale, og de har ofte små genom. DNA har en mye mer stabil form fordi det er dobbelt­ trådet, og det forekommer i all hovedsak i en heliksstruktur. Dermed blir det mulig å korrekturlese kopieringen, noe som åpner for større presisjon, og dermed mulighetene til et større genom.

Prokaryote celler ––> Eukaryote celler Vi antar at prokaryote celler oppstod for ca. 3,5 milliarder år siden, og både prokaryoter og eukaryoter eksisterer fremdeles. Prokaryotene omfatter rikene Archaea og Bacteria og er enkeltceller som ikke har organeller, og de har som regel et sirkulært kromosom. Den grunnleggende forskjellen mellom dem finner vi i membranlipidene. Hos bakterier og alle eukaryoter er de dannet med ester­ bindinger, mens de hos arkebakteriene er dannet med eterbindinger. Eter­bindinger er i motsetning til esterbindingene meget motstandsdyktige mot nedbrytning. Det forklarer hvorfor vi finner arkebakterier på steder med ekstreme livsbetingelser, hvor alt annet ville dødd. Noen av dem lever for eksempel nær dyphavskilder med en vanntemperatur omkring 100 °C, mens andre finnes i svovelkilder hvor pH-verdien er under 3, det vil si at de lever i en fortynnet svovelsyre. Enkelte Archaea-bakterier lever i saltvannssjøer og kilder hvor saltinnholdet kan gå opp i 25 %, uten at de dør. Det er imponerende hvordan de kan motstå det osmotiske trykket som bygger seg opp under slike betingelser.


Evolusjon • 27

Innenfor bakterierikene finner vi de prokaryote cellene som etter hvert utviklet seg til eukaryote celler. Denne overgangen betyr forenklet sett to nye prinsipper: • Et liv uten bakteriecellevegg • Membranavgrensede organeller inne i en celle Et liv uten en rigid cellevegg åpner for mulighetene for endocytose og eksocytose. Disse prosessene gjør det lettere for cellen å ta inn stoffer og å slippe stoffer ut. Bakterier kan bare ta opp næringsstoffer molekyl for molekyl, mens eukaryote celler kan ved endocytose danne en næringsvakuole og bryte den ned til næringsstoffer inne i cellen. Disse mekanismene er også involvert i svært mange andre viktige prosesser inne i cellen, for eksempel sortering av proteiner. Dersom vi antar at celleveggen først ble svekket, blir det enklere å forstå at cellen kunne ta inn en bakteriecelle og leve i et symbioseforhold med den. Den endocyterte bakterien beholder sin cellemembran, og det som etter hvert blir organellen mitokondrium eller kloroplast, har derfor en slik dobbel membran. Denne dannelsesmåten kalles endosymbiose. Et avgjørende bevis på at det virkelig kan ha foregått slik, er at alle eukaryote celler har DNA både i kjernen og i mitokondriene, mens planteog algecellene også har DNA i sine kloroplaster.

Brunalge

Eukaryot celle tar opp en rødalge ved endosymbiose

Plantecelle Rødalge

Rødalge

Endosymbiose av kloroplast. Kloroplasten i plante­riket har oppstått ved at en cyanobakterie (blågrønn­bakterie) ble tatt opp av en celle og grønnalgen ble utviklet. En videre utvikling av grønnalgene har resultert i planteriket, mens dannelsen av kloroplasten i en brunalge skjedde ved at en rødalge ble tatt opp av en eukaryot celle. Det siste kalles en sekundær endosymbiose.

Grønnalge

Eukaryot celle med mitokondrier tar opp cyanobakterie ved endosymbiose

Cyanobakterie Eukaryot celle


28 • Kapittel 1

Det har også vært en utveksling av DNA mellom organellen og kjernen. Det er først og fremst Lynn Margulis som har jobbet med å bevise endosymbiose­ teorien i moderne tid. Men allerede for over hundre år siden var det forskere som anslo at den selvstendige delingen og den spesielle formen på både kloroplasten og mitokondriet kunne tyde på at de hadde vært selvstendige bakterier på et tidligere stadium. I en enkelt plantecelle er det tre ulike sett med DNA som må samarbeide for å få hele cellen til å fungere som en enhet, og deretter som en del av hele planten. Plantecellen har DNA i både kjernen, mitokondriet og kloroplastene.

Milepæl nummer

t UV-stråling

8

Den encellede eukaryote protisten Paramecium bursaria finnes ofte i et symbiose­forhold med en fotosyntetiserende grønnalge. Parameciumarten har «svelget» grønnalgen ved endocytose, men bryter den ikke ned. Det viser seg Primatsamfunn menneskesamfunn og dannelse av språk at de to samarbeider: Parameciumcellen frakter grønnalgen til lyset, og de deler næringen som blir produsert, se kapittel 9 Fotosyntese. Når paramecium­ cellen er klar til å dele seg, har også algen delt seg slik at det følger med alger i hver dattercelle av Paramecium bursaria. Paramesium bursaria med en grønnalgesymbiont inne i seg.

7

Enkeltindivider sterile kaster

6

Encellede organismer og sopp

5

Ukjønnet formering formering

4

Prokaryot

3 2 1

kolonier med

dyr, planter kjønnet

Ukjønnet formering ––> Kjønnet formering

Utviklingen fra ukjønnet formering eller kloning til en kjønnet formering er en overgang som sikrer variasjon, men som også er risikofylt. Kostnaden for RNA som både gen og enzym gener individer med kjønnet formering ligger i dannelsen av et «ekstra kjønn», av DNA og enzymer av proteiner i dannelsen av kjønnsceller og i å få seg en partner. Denne kostnaden måtte Uavhengig replikator oppveies dersom det skulle bli et seleksjonspress i retning av kjønnet formering. sammenhengende gentråd Selvreplikerende molekyler grupperDet har det blitt: Så godt som alle høyerestående planter og dyr har det i dag. Det av komplekse molekyler er også slik i de to rikene at det ene «kjønnet» produserer svært mange gameter og det andre betydelig færre. Kjønnet formering sikrer en blanding av gener, og dermed opprettholdes en viss variasjon som seleksjonen kan virke på. Dermed kan en populasjon som har kjønnet formering, lettere svare på en forandring i miljøet. På kort sikt kan det også være gunstig for et hunnindivid å produsere avkom som er ulikt henne selv med tanke på ulike konkurranseforhold. eukaryot


Evolusjon • 29

Horisontal genoverføring I en horisontal genoverføring blir det overført gener fra individ til individ både innenfor og mellom arter. Det står i motsetning til vertikal genoverføring hvor genmaterialet blir overført under reproduksjonen, fra en generasjon til den neste innen samme art. Tidligere ble teorier om genoverføring mellom to forskjellige arter ikke tatt alvorlig. Moderne DNA-teknikker som fingeravtrykk og sekvensering av gener har derimot vist at det slett ikke er uvanlig. Særlig er det vanlig blant bakterier. millioner år 0.15

Milepæl nummer

8 Et aktuelt eksempel er overføringen av gener som gjør at flere og flere 45 Hvaler bakterier blir resistente mot visse typer antibiotika. Det har blitt et meget 50 Hester alvorlig medisinsk problem fordi et økende antall bakterieinfeksjoner ikke 80 Primater lenger kan behandles med vanlige typer antibiotika, men krever langvarig isolasjon og130behandling på sykehus. Noe av den resistensen vi ser, kan skyldes Blomsterplanter rene mutasjoner som igjen sprer seg raskt i populasjonene. Mye tyder på at 150 Fugler horisontal genoverføring spiller en stor rolle. Mange mener at den enorme 210–65 Dinosaurer diversiteten vi ser blant bakteriene, nettopp skyldes horisontal genoverføring 210 Primitive pattedyr i millioner av år, og så seleksjon på det nydannede arvematerialet. 260

Homo sapiens

Pattedyrlignende krypdyr

Den endosymbiosen som erplanter omtalt tidligere, hvor en bakterie har blitt en del 300 Nakenfrøete av en eukaryot kan også sees på som horisontal genoverføring selv om 340 celle, Krypdyr de to genomene opererer hver for seg. I de eukaryote cellene har det også blitt 350 Karsporeplanter 7 utvekslet gener mellom genomet i cellekjernen og DNA-et i mitokondriene og 390 Padder, insekter kloroplastene. 450

Planter, sopp og virvilløse dyr på land

500

Fisk

Encellede organismer ––> Dyr, planter 6 og sopp 1000

2000–1500

2000

Primatsamfunn menneskesamfunn og dannelse av språk

Enkeltindivider sterile kaster

kolonier med

Første flercellede dyr

Oksygen i atmsofæren og dermed også ozon, som beskytter mot UV-stråling Aerobe cyanobakterier danner oksygen ved fotosyntese

5

Flercellede organismer som dyr, planter og sopp er satt sammen av mange 2100 Første eukaryote celle forskjellige celler. Cellene er spesialiserte for å utøve en bestemt type oppgave, 3500–3000 Anaerobe kjemotrofe bakterier, anaerobe heterotrofe bakterier for eksempel sender nerveceller elektriske signaler. Cellene i ett individ inneholder 4 3500 Tidligste spor men av anaerobe fotosyntetiserende bakterier det samme arvematerialet, er altså forskjellige både i struktur, form og 4600–4000 avkjøles og får fast overflate 3 funksjon. På det Jorden molekylære nivået har det nå oppstått en mulighet for å kontrollere4600 hvilkeJorden generdannes som skal uttrykkes. Det fører igjen til en differensiering2 og til at cellene blir forskjellige, og den flercellede organismen kan danne vev 1 og organer. De første flercellede organismene kjenner vi fra fossiler som er omkring 1,2 milliarder år gamle. Det begynte med at celler som delte seg, forble sammen­koplet, og utviklet en slags koloni. Denne typen organisering av livsformer finner vi i dag blant annet hos noen alger og hos slimsoppene. Hos noen slike kolonier kan det så ha skjedd en spesialisering slik vi kjenner det hos noen av dagens alger. Volvox er for eksempel en algekoloni som kan bestå av opptil to tusen celler av kun to typer, vanlige celler og celler som produserer kjønnsceller.

Encellede organismer og sopp Ukjønnet formering formering

Prokaryot

dyr, planter kjønnet

eukaryot

RNA som både gen og enzym gener av DNA og enzymer av proteiner Uavhengig replikator sammenhengende gentråd Selvreplikerende molekyler grupper av komplekse molekyler

En koloni av grønnalgen Volvox.


30 • Kapittel 1

Radiærsymmetri

Symmetriplan

Forpart

Bakpart

0312 Symmetri

Milepæl nummer

ot UV-stråling

r

Tosidig symmetri

8

Et viktig utviklingstrekk hos dyrene er utviklingen av en tosidig symmetri. Noen av dagens organismer har beholdt en radiærsymmetrisk organisering, som svamper og nesledyr. De andre nålevende dyrene har alle en tosidig symmetri, Primatsamfunn menneskesamfunn noe som blant annet letter bevegelse, og de har en munn i forkanten og en og dannelse av språk utløpskanal i den andre enden. Det første dyret vi kjenner med antydning til tosidig symmetri, er fra kinesiske fossiler som er omkring 600 millioner år gamle. Paleontolog Jørn Hurum og medarbeidere har funnet skjeletter etter minst ti store svane- og fiskeøgler på Svalbard. De døde for omkring 250 millioner år siden, og de største er opptil 15 meter lange. De er fortsatt under utgraving, men på grunn av permafrosten tar det år før skjelettene er helt ute av bakken.

7

6 5

4 3 2 1

Enkeltindivider sterile kaster

kolonier med

Enkeltindivider ––> Kolonier med sterile kaster

Noen dyr lever i relativt store kolonier, for eksempel insektene maur, bier, termitter og veps. Slike insekter som lever i større samfunn, kalles gjerne sosiale insekter. I en slik koloni er det et hierarkisk samfunn, hvor ofte bare Encellede organismer dyr, planter noen få får reprodusere seg. De fleste individene er sterile. Selv om de dør ut, og sopp gjør deres bidrag til matsank, forsvar og liknende at kolonien kan leve videre. Ukjønnet formering kjønnet Dessuten er det liten genetisk forskjell mellom individene. Dronningen, som er formering diploid, er mor til alle. Hun har paret seg med noen få hanner. Disse hannene er haploide. Det vil si at arbeidere med felles far derfor har 75 % av genene Prokaryot eukaryot felles. Derfor består kolonien av individer som er så genetisk like seg selv at det RNA som både gen og enzym generå reprodusere for å få genene videre, blir mindre viktig enn å sørge for at et av DNA og enzymer av proteiner søsken overlever. Uavhengig replikator

sammenhengende gentråd Honningbier (Apis mellitus) Selvreplikerende molekylerBier grupper på vei in i en bikube. er av komplekse molekyler sosiale insekter med en klar intern rangstige.


Evolusjon • 31

Primatsamfunn ––> Menneskesamfunn 8 og dannelse av språk millioner år 0.15

45

Milepæl nummer

Homo sapiens

Primatsamfunn menneskesamfunn og dannelse av språk

Hvaler

I et dyresamfunn kan dyrene ofte gjenkjenne hverandre som individer, inngå 50 Hester allianser, og de kan samarbeide. Disse egenskapene er delvis grunnet i felles 80 Primater gener, men også hukommelse og tidligere erfaringer med det individet en 130 Blomsterplanter eventuelt skal samarbeide med. 150

Fugler

Den store210–65 overgangen fra et apesamfunn til et menneskesamfunn var utviklingen Dinosaurer av språk. Språket forenkler og styrker muligheten til å bygge ulike relasjoner. Men 210 Primitive pattedyr forskjellene ligger også i hvordan vi som mennesker organiserer samfunnene våre, 260 Pattedyrlignende krypdyr hvordan vi lærer, og hvordan vi fører videre en kultur med ideer og verdier. 300 Nakenfrøete planter Dersom du i morgen skulle flytte til en fjern by på et annet kontinent, ville det 340 Krypdyr nok bli en stor overgang. Men overgangen skyldes ikke at det er stor forskjell 350 Karsporeplanter i genene mellom deg og menneskene der, men fordi det er store kulturelle 7 390 Padder, forskjeller mellom her oginsekter der. Og den enheten som lærer og gir oss kultur, er språket. Denne så sentral 450 overgangen Planter, sopp er og virvilløse dyr at på den land er tema for neste delkapittel. Milepæler.

500

1000

Fra

Enkeltindivider sterile kaster

kolonier med

Fisk Første flercellede dyr Encellede organismer

dyr, planter

Oksygen i atmsofæren og dermed også ozon, som beskytter mot UV-stråling Til

6 Milepæl og sopp

2000

Aerobe cyanobakterier danner oksygen ved fotosyntese Grupper av komplekse molekyler, knyttet til

2100

membran Første eukaryote celle eller avgrensning

Ukjønnet formering kjønnet 5 Kjemiskformering evolusjon og ursuppeteorien

2000–1500

1 S elvreplikerende molekyler 3500–3000

Anaerobe kjemotrofe bakterier, anaerobe heterotrofe bakterier

2U  avhengige replikatorer 3500

en slags tidlig

Sammenhengende gentråd organisert i kromosomer

Tidligste spor av anaerobe fotosyntetiserende bakterier

Replikatorene slår seg sammen til Prokaryot eukaryot 4 større enheter

5 Ukjønnet formering

Kjønnet formering

RNA som både gen og enzym gener av DNA og enzymer av proteiner Uavhengig replikator 2 Endosymbioseteorien sammenhengende gentråd Selvreplikerende molekyler grupper 1 Dannelse diploide celler av av komplekse molekyler

6 Encellede organismer

Dyr, planter og sopp

Spesialiserte celler og vev

7 Enkeltindivider

Kolonier hvor bare noen få reproduserer

Sosiale insekter, bier, maur og termitter

8 Primatsamfunn

Menneskesamfunnet og dannelse av språk

Kultur og memer

avkjølesGener og får 3 R NA4600–4000 som både genJorden og enzym avfast DNAoverflate og enzymer dannet av proteiner, «RNA-verden» 4600

4 Prokaryote celler

Jorden dannes

Eukaryote celler

Sjekkpunkter: Nye ord og faguttrykk: protobiont, ribozym, endosymbiose, horisontal genoverføring Hva kjennetegner et selvreplikerende molekyl? Hva betyr begrepet RNA-verden? Hva er endocytose og eksocytose? Hvordan har kloroplasten blitt en del av en annen celle? Hva er horisontal genoverføring? Hvilke fordeler har en kjønnet formering? Hvorfor blir det i en samling av sosiale insekter ikke kjempet om å få reprodusere seg?

3


32 • Kapittel 1

1.4 Evolusjon av språk og kultur Språket fungerer som en bærer av informasjon på en måte som kan minne om DNA. Der de fire baseparene i DNA kan oversettes til forskjellige proteiner med svært mange forskjellige former, kan språket med sine 30 til 40 distinkte lyder eller fonemer og grammatiske regler danne et utall av forskjellige meninger. Denne likheten mellom genetikken og språklære (lingvistikk) ble framsatt av Richard Dawkins i 1976, og han gav det navnet mem. Et mem kan defineres som en informasjonsbærende struktur som kan lagres i hjernen, og som er i stand til å replikere seg selv. Tenk på smilefjeset. Det er et bilde som har satt seg fast hos mange med en bestemt mening, og som vi raskt sender videre når vi mener det er rett. Dawkins sier også at mennesket har en hjerne som kan inneholde kulturell arv. Memet skal betegne de minste overførbare elementene i kulturen vår. Memene kan spres på mange måter, for eksempel gjennom læring, etter­likning og indoktrinering. Men hvordan er det forskjellige ideer eller memer sprer seg? For eksempel er sladder noe av det som sprer seg raskest i så godt som alle kulturer. Andre typer av tanker har langt større problemer med å komme inn i en hjerne, for eksempel regler for brøkregning eller hva som kjennetegner syntese­delen i fotosyntesen. Disse forskjellene kan i hovedsak forklares med hvilke problemer mennesket gjennom evolusjonær tid har hatt behov for å løse, og som så har ført til en evolusjon av hjernen. I utallige generasjoner har forfedrene våre hatt nytte av å kjenne igjen ansikter og huske gode og dårlige handlinger. Nesten like lenge har vi hatt nytte av å kunne lære ferdigheter av andre, og også tusenvis av generasjoners nytte av å kunne huske og gjenfortelle de gode historiene. Denne tiden har genene brukt til å lage spesielle «sentre» i hjernen som ivaretar disse oppgavene. Selv om forskerne ikke er helt enige om hvor mange moduler hjernen skal deles inn i, er det i alle fall mange som regner med at en sosial modul og en språkmodul er med. Flere forskere tenker seg at fordi mennesker så enkelt lærer seg et språk, kan det virke som om vi har et «språkorgan».

Språket er det store skillet mellom mennesket og apene. Alle mennesker ser ut til å ha evne til å lære seg et språk, og mange kan også lære seg flere. Språk er funda­mentet for å forstå en annen kultur og kunne kommunisere med denne kulturen. Faget språkhistorie ser på hvordan de ulike språkene har utviklet seg. Flere av utviklingstrinnene, for eksempel innenfor språk som er beslektet med norsk, skyldes en tilpasning til å uttrykke enkelte fonemer forskjellig. På den samme måten som vi i biologi prøver å systematisere livets utvikling i et livets tre, har mange språkforskere lagd språkets tre. Det er de samme prinsippene som blir lagt til grunn. En ser på en egenskap og hvordan denne egenskapen utvikler seg. Slik får vi greiner på treet og kan forklare hvorfor norsk og islandsk er nærmere hverandre enn for eksempel norsk og spansk.


Evolusjon • 33

Flere atferdsøkologer har vist at den som behersker kultur og språk, øker mulighetene for å få overført genene sine til neste generasjon, altså at egenskaper i språk og kultur gir økt fitness. Rødvingetrosten (Turdus iliacus) har ulike dialekter avhengig av hvor i Norge den lever. En slik dialekt blir ikke overført genetisk, men «kulturelt» gjennom imitasjon av foreldrenes sang.

Språk er ikke bare formuleringsevne, men også at hva du sier, gjenspeiler hva du tenker og hvor mye du forstår av det sosiale spillet. Når språket først har oppstått og blir videreutviklet, er det derfor en indikator på hvor godt hjernen fungerer.

Sjekkpunkter: Hva er et mem? Hva er likheten mellom gener og språk? Hvorfor er enkelte memer enklere å spre i kulturen enn andre? Hva er likheten mellom et språktre og livets tre?

1.5 Evolusjon som revolusjon I dag er det ingen seriøse naturvitenskaplige miljøer som benekter evolusjonen, men evolusjonsteorien har gjennomgått debatter i naturvitenskapelige miljøer før bevisene tydeligere og tydeligere viste at Darwin stort sett hadde rett. Hovedårsaken til at det har tatt så lang tid, er at kunnskapen om arv og hvordan DNA blir nedarvet, ikke ble forstått i detalj før på 1900-tallet. En annen viktig årsak er at de aller fleste religioner har en skapelsesmyte, særlig et bilde av hvordan mennesket ble til, som ikke er direkte forenlig med evolusjons­ teorien. Likevel var tankene om artenes utvikling og dannelse på ingen måte ny da Darwin til slutt gav slipp på sin On the origin of species i 1859. I 2009 var det både 150-årsjubileum og 200-årsjubileum for Darwins hovedverk og han selv.

Franskmannen George Buffon (1707–1788) var den første som antydet at levende organismer kunne forandre seg over tid, noe han blant annet baserte på studier av fossiler. Han skjønte likevel at en slik idé ville være ytterst kontroversiell med tanke på den katolske kirken og dens bibelsyn. Han skjulte derfor ideene sine i et enormt naturhistorisk verk over 44 bind, hvor han beskriver alle de arter som den gangen var kjent. Det var da heller ingen i kirken som oppdaget hans dristige påstander før flere hundre år seinere.


34 • Kapittel 1

Franskmannen Jean-Baptiste de Lamarck (1744–1829) mente at arter kunne forandre seg over mange generasjoner ved å tilpasse seg nye miljøer. Han trodde at livet hadde utviklet seg fra dødt materiale og videre gjennom mer og mer komplekse former til det han kalte «den menneskelige perfeksjonen». Lamarck mente at endret atferd i forhold til miljøet ville endre individets egenskaper, og de var arvelige. Dette prinsippet kalte han «arv av tillærte egenskaper». Når giraffen stadig strakk hals for å nå de øverste greinene i et tre, ville det gjøre at giraffen langsomt utviklet den lange halsen som vi ser på dagens giraffer. Lamarck var den første som framsatte en evolusjonsteori i 1809. Det som for alvor skulle motbevise hans teori om at tillærte egenskaper går i arv, var Weismann, som i 1902 kunne bevise at arveanlegget ikke forandrer seg. To muskuløse foreldre får ikke nødvendigvis et muskuløst barn, men sannsynlighetene for at dette barnet får positive stimuli i retning av å trene seg opp til å bli muskuløst er derimot store. Erasmus Darwin (1731–1802), bestefar til Charles Darwin, levde samtidig med Buffon og Lamarck og trodde på Lamarcks teori. Erasmus viste blant annet til hvordan avl hadde frambrakt husdyr og nytteplanter som ikke fantes i naturen. Her kunne en med kunstige inngrep forandre artenes egenskaper, for eksempel utvikle nye hunderaser til bestemte formål. Det var altså på den tiden en klar forståelse av at livet hadde utviklet seg, og at egenskaper kunne forandres, men noen samlende forklaring eller teorier om de bakenforliggende prinsippene var ikke framsatt eller beskrevet. Tiden var altså moden i Europa da Charles Darwin framsatte sin revolusjonerende teori. Charles Darwin (1809–1882) skulle egentlig bli prest, men slo raskt over til biologien. Reisen med «Beagle» (1831–36) tok fem år. Det var først da han begynte å bearbeide observasjonene sine, særlig om finkene på øygruppen Galápagos utenfor Sør-Amerika, at han langsomt begynte å utforme sin teori.

Nebbformer. Darwins finker slik de er avbildet i hans bok om reisen med Beagle fra 1839. Det var John Gould som fortalte Darwin at disse fuglene var nye arter. de spesialiserte nebbformene som brukes som eksempel på evolusjon, ble først påpekt av David Lack i 1947.


Evolusjon • 35

Finkene på Galápagos likner på hverandre, men gruppevis har de forskjellige nebbtyper. Darwin mente at finkene hadde kommet til øyene en gang for lenge siden, og at artene på de enkelte øyene etter hvert hadde spesialisert seg til det miljøet som hadde møtt dem på den enkelte øya. Noen finker hadde for eksempel kraftige, korte nebb, fint tilpasset å knuse frø og frukter. Andre arter hadde finere og spissere nebb, tilpasset å plukke ut insekter og smådyr fra barken på trær. Atter andre igjen hadde nebb som lett kunne åpne kaktusfrukter. Alle finkene var ellers nokså like i fjærdrakt. Darwin postulerte derfor at en eller annen gang hadde noen finker ved en tilfeldighet landet på en av øyene. Siden spredde de seg til de andre øyene med hvert sitt spesielle miljø. Langsomt ble det på hver øy etablert tilpasninger i forhold til nærings­ grunnlaget, som gav de etterfølgende generasjoner bedre overlevelsesevne. Vel hjemme i England ble Darwin sterkt påvirket av geologen Charles Lyell (1797–1875) og økonomen Thomas Malthus (1766–1834). Lyell hadde forstått at alderen på jorda var mange millioner år. Det betydde at livet altså kunne ha utviklet seg over et enormt langt tidsrom, slik at Darwins gradvise og langsomme tilpasningsteori kunne være holdbar. Malthus var berømt fordi han postulerte at mens produksjonen av matvarer utviklet seg lineært, utviklet befolkningsveksten seg eksponentielt. Krig, sult og sykdommer begrenser derfor før eller seinere befolkningsveksten, særlig blant de fattige. Konklusjonen var at bare en liten del av befolkningen ville ha ressurser nok til å overleve og reprodusere seg. Med disse teoriene i bakhodet og sine egne observasjoner foran seg begynte Darwin å skrive ned sin egen utviklings­teori: At det produseres for mange avkom, at egenskapene er arvelige, men med en viss variasjon, at bare de best tilpassede ville overleve og reprodusere, og at de etterfølgende generasjoner derfor stadig ville bli bedre tilpasset levemiljøet. Darwin skjønte at teoriene hans ville vekke oppsikt, særlig det at også mennesket hadde utviklet seg fra arter som var utdødd, og ikke var skapt en gang for alle i et «Guds bilde». Han satt derfor og finpusset manuskriptet i over 15 år inntil han en dag fikk sjokk da han mottok et manuskript som nøyaktig beskrev hans egen teori. Forfatteren var biologen Alfred Wallace, som i årevis hadde reist og studert i Sørøst-Asia og Australia. Her var han blitt slått av de store forskjellene det er i dyrelivet mellom Indonesia og Australia. Wallace og Darwin publiserte teoriene

Darwin på frimerker. Her representert ved Russland, Storbritannia, Rwanda og Equador.


36 • Kapittel 1

sine i et vitenskapelig tidsskrift som bare ble lest av spesialister. De ble overbevist av argumentasjonen, og det ble derfor ingen offentlig debatt. Det ble det derimot da Darwin utviklet teorien videre og publiserte den i boka On the origin of species (1859). Den vakte enorm oppsikt, og det utviklet seg raskt en sterkt opphetet debatt, som dels har vart til i dag. Boka er likevel fundamentet for vår forståelse av biologien, selv om den er delvis ufullstendig på flere felter. Blant annet hadde Darwin liten genetisk innsikt. Darwin kjente ikke til Mendels arvelover (se side 160). Hadde Darwin kjent til dem, kunne han ha underbygd teorien sin bedre. Evolusjonsteorien skaper fortsatt stor konflikt i religiøse miljøer, særlig knyttet til de to største religionene kristendom og islam. Evolusjonsteorien er i dag så grundig dokumentert at den alene kan forklare dannelsen av liv og utviklingen av livet helt uten å henvise til en ytre kraft eller skaper. Det står i stor kontrast til mange av de religiøse skapermytene som vi har hørt om, og kan virke provoserende i en del religiøse miljøer. Å tone ned evolusjonslærens stilling i skolene har vært kilde til sterke diskusjoner i mange land. I Norge forsøkte daværende kirke- og undervisningsminister Kjell Magne Bondevik å hindre at evolusjonslæren ble med i læreplanen for grunnskolen på midten av 1980-årene.

Sjekkpunkter: Hvorfor ventet Darwin så lenge med å gjøre resultatene sine kjent? Hvilken teori hadde Lamarck om evolusjon? Hva skiller Darwins teori fra Lamarcks teori om evolusjon? På hvilken måte bidro Malthus til Darwins teori? Hva er det som fortsatt skaper debatt i evolusjonslæren?


Evolusjon • 37

Ulike lands holdning til evolusjonslæren: Figuren viser ulike lands holdninger til evolusjonslæren. I Norge trodde hver fjerde innbygger at evolusjonslæren var gal. N = antall spurte i undersøkelsen per land. Island (n=500) Danmark (1013) Sverige (1023) Frankrike (1021) Japan (2146) Storbritannia (1308) Norge (976) Belgia (1024) Spania (1035) Tyskland (1507) Italia (1006) Nederland (1005) Ungarn (1000) Luxembourg (518) Irland (1008) Slovenia (1061) Finland (1006) Tsjekkia (1037) Estland (1000) Portugal (1009) Malta (500) Sveits (999) Slovak (1241) Polen (999) Østerrike (1034) Kroatia (1000) Romania (1005) Hellas (1000) Bulgaria (1008) Litauen (1003) Latvia (1034) Kypros (505) USA (1484) Tyrkia (1005) 0%

20%

Aksepterer evolusjonsteorien

40% Vet ikke

Kilde: Miller et al 2006. Science 313, p.765–766.

60%

80%

100%

Aksepterer ikke evolusjonsteorien


38 • Kapittel 1

Belegg for evolusjon Empiri som viser at evolusjon har foregått, og hvordan den har foregått, gjennomsyrer biologien. Det gjelder både flere ulike typer belegg for at evolusjon har foregått, og belegg for at naturlig seleksjon har foregått og foregår nå. I studiet av evolusjonen bruker forskerne mange metoder for å underbygge det teoretiske grunnlaget sitt. Det er studier av fossiler, sammenliknende utvikling av fostre, sammenliknende anatomi og genetiske studier. Studie av fossiler er en bokstavelig måte å grave i jordas historie på. Enkelte steder, som i Grand Canyon i USA, har elver gjort utgravningsjobben for oss, se figuren. Her finner vi fossiler fra eldre og yngre tider. Etter hvert som vi beveger oss framover i avleiringen, forandrer artene seg, og det dukker opp nye arter samtidig som andre forsvinner. Fossiler kan gi oss et godt innblikk i hvordan artene har utviklet seg. Men sannsynligheten for at et individ fra en art skal bli et fossil, og aller helst et godt et, er liten. Likevel finner vi stadig flere fossiler som også underbygger Fossilfunn i Crand Canyon.

225 mill. år siden

Øvre perm

Øyenstikker

Bartre Panserpadde Hai

Nedre perm

Halepadde

280 Frøbregne Karbon Tidlig landplante

Lungefisk 345

Devon

395

Kambrium Trilobitt

Korall Sjøstjerne 543

Prekambrium Alger

1030_Grand_Canyon


Evolusjon • 39

Fellestrekk ved lemmene hos virveldyr.

a Skjematisk framstilling av beina i b forlemmene

1 Menneske (griper)

a Overarmsbein b Spolebeinet c c Albuebeinet d Håndrotsbeinet d e Mellomhåndsbein og fingre e Hval (svømmer)

2 3 4 5

a a b d e 1 2 3 45

b

Flaggermus (flyr) 1 d b og c a c

d e

1

e

Hest (løper)

c

5 2

2 a

3

4

5 c b d

3 4 Fugl (flyr) a 12

e

d

e 3

b c

3

teorien om evolusjon. Et klassisk eksempel er evolusjonen av hesten slik vi 1031_Lemmer kjenner den i dag. Se nettsidene våre for figurer og flere detaljer om hvordan hesten har utviklet seg. Vi kan også se på fellestrekk i anatomien hos nærstående dyr. Dersom vi ser på menneskets arm sammenliknet med tilsvarende lemmer hos andre virveldyr, ser vi forskjellige tilpasninger av en grunnstruktur som er lik, se figuren. Slike fellestrekk er greie å forstå dersom vi antar at organismene har evolvert fra et felles opphav. Fossiler hjelper oss til å finne de såkalte «missing links» i et utviklingsmønster. Med bedre teknikker og mer forskning finner også forskerne mer. Og det som finnes, stemmer svært ofte overens med det teorien anslår det skal være. Fellestrekkene i fosterutviklingen hos virveldyr peker også i retning av et felles opphav. Til tross for at artene er svært ulike av utseende som voksne individer, er den tidlige utvikling som foster lik. Også i organismers biokjemi, deres evne til å bryte ned og bygge opp stoffer, ser vi store likheter. Det støtter også et evolusjonsbiologisk perspektiv. Samtidig kan vi se at det blir gradvise forandringer og tilpasninger i hvordan for eksempel nedbrytningen foregår. Felles for alle organismer er ATP som


40 • Kapittel 1

energibærer. Gassutveksling og ekskresjon hos dyr, se Bi 1, tyder også på et slektskap, og på at en evolusjon har funnet sted. Likheten i arvematerialet er slående. DNA som den informasjonsbærende enheten er felles for alt som er definert som levende. Også hvordan DNA uttrykkes, er svært likt, se kapittel 3 Fra gen til protein. Alle organismer inneholder også proteiner som er bygd opp av de tjue samme aminosyrene. På side 238 kan du lese mer om hvordan bruken av molekylære teknikker har gjort det mulig å se på slektskap mellom grupper av organismer. Slikt slektskap er vanskelig å forklare dersom vi ikke antar at det har skjedd en evolusjon. Noen eksempler på evolusjonshistorie og på naturlig seleksjon.

Fossilrekka

Lagene av fossiler bekrefter antakelsene om hvilke grupper av organismer som har evolvert fra hvilke: Fisk kommer alltid før de første amfibiene, deretter dukker krypdyr og pattedyr opp.

Homologi – likheter som skyldes felles stamform

Anatomiske eksempler: armer, frambein, luffer, vinger – alt er forreste par av ekstremiteter. Molekylære homologier. Mange viktige enzymer som er svært like mellom ulike arter, for eksempel den genetiske koden.

Overflødige organer

Rester etter lemmer hos slanger og hval, halebein hos menneske.

Konvergent seleksjon

Når ubeslektede organismer får like bygningstrekk som tilpasning til et spesielt miljø eller et spesielt levesett: Mange pungdyr og placentale pattedyr med likt levevis likner hverandre, kroppsform hos svømmende dyr som hai og delfin, sukkulente planter som de ubeslektede gruppene kaktus og vortemelk. Det finnes mange eksempler på strukturer som virker «dårlig konstruert». De kan vanskelig forklares på annen måte enn at de har evolvert fra allerede eksisterende strukturer. · Pattedyr puster ut og inn delvis samme luft. At andre løsninger er mulig, ser vi hos fuglene. · Cellulose – den største kilden til karbohydrater kan ikke brukes direkte av flercellede dyr.

«Feilkonstruksjoner»

· Flyndrens øyne og munn: Som unge svømmer flyndrene normalt, men som voksne ligger de på bunnen på den ene kroppssiden: Munn og ett øye må vandre rundt til oversiden. · Virveldyrøyet: Øyet hos virveldyr er ikke «perfekt»: Nervene fra synscellene går utover og samler seg i «den blinde flekken». For eksempel har blekkspruter nervene på baksiden av netthinnen. · Menneskets sædledere: Sædlederne går oppom urinlederne, for tidligere i evolusjonen lå testiklene i bukhulen – som hos mange pattedyr. · Sjiraffens strupenerve: En av nervene mellom hjernen og strupen går nedom aortabuen fra hjertet hos alle virveldyr. Hos fisk er dette den korteste veien. Hos pattedyr blir dette ganske merkelig. Nerven er mer enn fem meter lang hos sjiraffen. · Bjørkelurvemåler (Biston betularia): Finnes i en mørk og lys, spraglete versjon. Under den industrielle revolusjonen i Storbritannia ble den mørke vanlig fordi trærne mistet lavdekket og ble mørke. Med rensing av utslipp og gjenkomst av lav på trærne utover på 1900-tallet ble den lyse vanligst igjen.

Naturlig seleksjon

· Insektmiddelresistens: Sprøyter vi en populasjon av insekter med kjemiske midler, får de som er motstands­ dyktige, en voldsom fordel, og snart dominerer de populasjonen, og midlet virker ikke lenger (f.eks. DDT). · Medisinresistens i hiv og antibiotikaresistens i bakterier: Samme mekanisme som for insektmiddel – de motstandsdyktige øker sterkt i frekvens.


Evolusjon • 41

Bjørkelurvemåler – velkjent eksempel på naturlig seleksjon.

Sjiraffens strupenerve er urimelig lang der den går fra hjernen ned rundt aortabuen og opp til strupen.


Sammendrag • Ifølge evolusjonslæren har alt liv i dag utviklet seg fra tidligere livsformer. Det vil si at levende organismer er mer eller mindre i slekt med hverandre, og at mennesket ikke står i noen særstilling blant livsformene.

• Mennesket er kjennetegnet ved blant annet språk og kultur. Språk og kultur er bærere av informasjon som kan sammenliknes med hvordan DNA bærer informasjon. En slik sammenlikning har gitt opphavet til et mem.

• Mekanismene i evolusjonen er –– Reproduksjon i overflod –– Arv med variasjon –– Seleksjon og overlevelse

• Jean-Baptiste de Lamarck mente at arter kunne forandre seg gjennom tillærte egenskaper. Det ble motbevist da arveanleggene ikke blir forandret av egenskaper du lærer deg gjennom livet.

• Resultatet av de tre mekanismene i evolusjonen er at de individene som er best tilpasset, får overført flest av genene sine til neste generasjon

• Grunnlag for påstanden om at evolusjonen har funnet sted: –– Fossiler –– Fellestrekk ved nålevende organismer –– DNA og cellens biokjemi –– Fosterutvikling

• Det finnes flere hypoteser om hvordan livet ble til, men for å forklare livet slik vi ser det i dag, er særlig åtte milepæler nødvendige: –– Selvreplikerende molekyler → grupper av komplekse molekyler –– Uavhengige replikatorer → sammenhengende gentråd –– RNA som både gen og enzym → Gener av DNA og enzymer laget av proteiner –– Prokaryote celler → eukaryote celler –– Ukjønnet formering → kjønnet formering –– Encellede organismer → dyr, planter og sopp –– Enkeltindivider → kolonier med sterile kaster –– Primatsamfunn → menneskesamfunn og dannelse av språk


Evolusjon • 43

Oppgaver Tips til oppgavene finner du på www.gyldendal.no/bi 1 Hva er evolusjon? I svaret ditt bør du komme inn på hvorfor utvikling og evolusjon ikke behøver å være det samme.

9 a Hva er seksuell seleksjon? b Nevn noen arter som har seksuell seleksjon. c Hva er forskjell på interseksuell og intraseksuell seleksjon?

2 Hva er forskjellen på mikroevolusjon og makroevolusjon?

d På hvilken måte bidrar seksuell seleksjon til evolusjon?

3 Gjør rede for hvorfor arv med variasjon må være en av de tre hovedmekanismene i evolusjonen. 4 Hvordan bidrar kjønnet formering til evolusjon? 5 a Hva er seleksjon? b Hva er forskjellene og likhetene mellom kunstig seleksjon og naturlig seleksjon? 6 Hva menes med splittende seleksjon? Bruk figur og en konkret art som eksempel i svaret ditt. 7 En forsker observerer at den samme arten av en bestemt plante blir kortere og mer kompakt desto høyere opp i fjellet hun observerer dem. Hun samler frø av de ulike plantene og sår dem ut i lik høyde over havet, og med ellers like vilkår. Da viser det seg at det er minimale høydeforskjeller mellom plantene. Hvilken av disse konklusjonene er riktig?

e Forklar hvordan seksuell seleksjon også kan foregå på mikronivå hos organismer. 10 I mediene kan vi ofte lese at Darwins utviklingslære er det samme som den sterkestes rett, og at det er den som er sterkest, som vil overleve. Bruk den biologiske kunnskapen din til å skrive et essay eller leserinnlegg hvor du forklarer at dette ikke behøver å være riktig. 11 Hvilke likheter og ulikheter er det mellom fitness i helsestudioet og det darwinistiske fitness-begrepet? 12 Hva er koevolusjon? Bruk minst ett eksempel i svaret ditt. 13 Hva er mimikry? Bruk minst ett eksempel i svaret ditt. 14 Ta utgangspunkt i bildet og forklar hva kunstig seleksjon er.

A Høyde er ikke en kvantitativ parameter. B Fenomenet som ble observert, skyldes genetisk variasjon. C Forskjellen i foreldregenerasjonens høyde skyldes rettet seleksjon. D Fenomenet som ble observert, var et eksempel på en ikke-genetisk miljøtilpasning. E Stabiliserende seleksjon virket på frøene under spiring. 8 Ta utgangspunkt i bildet og forklar seksuell seleksjon.

15 Lag en sammenhengende tekst med figurer hvor du viser hva som er felles for de aller fleste organismer, og som støtter et evolusjonært syn på livet. Hvordan kan fossiler underbygge dette?


44 • Kapittel 1

Oppgaver 16 Hvordan forklarte Jean-Baptiste de Lamarck (1744– 1829) evolusjonen? På hvilke områder tok han grunnleggende feil?

19 Prøv å gi en forklaring på hvorfor så mange personer ikke vil akseptere evolusjonen som et produkt av reproduksjon i overflod, arv med variasjon og seleksjon.

17 Beskriv og vis hvordan den kontinentale fordelingen av levende organismer på kloden viser evolusjon ved naturlig seleksjon.

20 Ta for deg dannelsen av den eukaryote cellen som en milepæl i evolusjonen. Tegn og forklar hvordan en eukaryot celle oppstod.

18 Enkelte arter omtales som rødlistede eller svartlistede. Diskuter denne bruken av ord knyttet til hvordan disse artene sprer seg i et mer evolusjonært perspektiv.

21 «Kloroplasten har vært en egen organisme.» Gi argumenter for denne påstanden og underbygg dem gjerne med en figur.

Nett-, gruppe- og presentasjonsoppgaver 22 I ulike medier kan vi støte på begreper som «vellykket art». Diskuter og gjør rede for hva dette begrepet betyr innenfor biologien. Underbygg svaret ditt med eksempler. Finn fram til en mediekilde hvor dette er brukt, og vurder om det der blir brukt korrekt som en biologisk fagterm.

30 Pek på likhetstrekk ved utviklingen av språktrær for å studere språkets evolusjon og livets tre for å studere evolusjonen av livet på jorda. 31 Dersom kontinenter igjen blir samlet til ett, som Pangea, hvilke evolusjonære trekk forventer du vil oppstå da?

23 Ta for dere en av de ikke-vitenskapelige måtene å framstille livets utvikling på, og diskuter hvorvidt det er biologifaglig mulig å akseptere det som hevdes der.

32 Ta et utvalg av land i hele verden og finn ut om, og eventuelt hva, de skal lære om evolusjon i skolen.

24 Søk gjennom ulike media og sjekk hvordan begrepet seleksjon blir brukt der. Brukes det riktig, eller hva legger en i det der?

33 Alu-elementer er det som blir kalt innskutte repetitive elementer i DNA. Dette er elementer i DNA som kopierer seg selv, og som plasserer seg på ulike steder i genomet. Velg en av disse oppgavene:

25 Ta for dere en art som har seksuell seleksjon. Gjør rede for hvordan mekanismen virker hos denne arten, og vis til studier av dette. Knytt gjerne oppgaven til det økosystemet dere har jobbet med. 26 Lag en undersøkelse der dere spør et utvalg mennesker hva de tror om evolusjon. Spør om både begrepet, tankene bak og om evolusjon kanskje bare gjelder andre organismer enn mennesket. Sørg for å lage flere spørsmål slik at du kan framstille dataene dine på en måte som viser sammenhenger. 27 Velg en av de åtte milepælene i evolusjonen og finn ut mer om den. 28 Les om evolusjonen av språk og kultur som det store skillet mellom menneskedyret og de andre dyrene. Forklar hvordan et slikt skille ble mulig, og diskuter om memer eksisterer. 29 Forklar hva som er forskjellen mellom den typen kommunikasjon som vi mennesker har, og den typen kommunikasjon vi kan observere i andre dyregrupper, for eksempel en gruppe av hyener.

a Finn ut mer om disse elementene og lag en presentasjon av hvordan de kan kopiere seg. b Finn ut hvordan disse elementene kan forårsake alvorlige sykdommer hos mennesket. c Finn ut og vis hvordan disse elementene har blitt brukt til å styrke «ut av Afrika-teorien » om menneskets utvikling. 34 Er bokstaver og ord språkets og kulturens DNA? Finn ut mer om memer og sjekk om det også eksisterer slike memer i ulike ungdomsmiljøer eller i russemiljøet. 35 I 2009 var det to store hendelser knyttet til Charles Darwin som ble feiret. Velg ut tre ulike mediekanaler hvor dette ble presentert. Lag en rapport der du/dere kommenterer det som skjedde faglig, og hva slags påvirkning dette kan ha på vanlige folk. Ledespørsmål kan være: Hadde noen av mediene en agenda? Finnes det motgrupperinger? Og hvem var mottakerne av den informasjonen som ble presentert?


Evolusjon • 45

36 Finn ut mer om hvordan kulturell evolusjon hos mennesket er og var avhengig av en økt hjernestørrelse. 37 Finn ut mer om RNA og hvilken funksjon det antas å ha hatt tidlig i evolusjonen. Forklar også begrepet «RNAverden». 38 Finn ut mer om homologe organer hos dyr, og vis hvordan dette kan brukes til å forklare evolusjonen av enkelte dyregrupper.

39 Finn ut mer om forskeren Trofim Lysenko og forsøkene hans. Hva slags form for evolusjonær tro var det han hadde? Hva ble resultatet av forskningen hans? 40 Det er vanlig å bruke ulike lemmer til å vise fellestrekk og utviklingstrekk blant dyrearter. Ta for deg et par slike lemmer og forbered et foredrag om det for gruppa. 41 Den 12. februar hvert år arrangeres Darwindagen ved mange universiteter i Norge og verden for øvrig. Finn programmet og velg ut noe du/dere vil høre på og fortelle om det til gruppa seinere.

Korte foredrag • Les Bryan Sykes’ bok Evas sju døtre (The Seven Daughters of Eve) og presenter boka og dens innhold for gruppa.

• Ubx-genfamilien • Mottagelsen av Darwins teori i Norge på slutten av 1800-tallet

• Endosymbioseteorien og kvinnen • Les Judith Rich Harris' bok The bak Nurture Assumption, Why Children Turn Out the Way They Do, og bruk denne til å • Ulike skapelsesmyter i religioner presentere innholdet og hvorfor fra hele verden den har skapt så stor debatt.

• Finn ut mer om arter som har mimikry. Lag et foredrag om en av dem.


2

Økologi

Ord og faguttrykk du bør kunne før du begynner på kapitlet

• evolusjon

• gen

• naturlig utvalg

• art

• seleksjon

• biologisk mangfold

• tilpasning • DNA

• drivhuseffekt

Mål for dette kapitlet er at du skal kunne • samle, bestemme og klassifisere ulike organismer og knytte opplysninger om levevis og tilpasninger til et utvalg av organismene • gjøre greie for faktorer som regulerer vekst og størrelse på populasjoner og forvaltning av bestander i et bærekraftig perspektiv • gjøre greie for kretsløpet til karbonet og nitrogenet i et økosystem, og hvordan miljøgifter blir konsentrert i næringskjeder • gjøre greie for hvordan energistrømmen mellom trofiske nivåer påvirker økosystemet • forklare hvordan økosystemer kan endre seg over tid, og knytte det til klimaendring og andre miljøproblemer • drøfte miljøutfordringer lokalt og globalt med utgangspunkt i biologisk kunnskap


48 • Kapittel 2

2

«The library of life is burning, and we don’t even know the titles of the books.» Gro Harlem Brundtland (1993)

2.1 Hva er økologi? Økologi er et ord som er mye brukt i dagligtale. Vi snakker for eksempel om økologisk jordbruk og om økologisk mat. Når vi i dette kapitlet bruker ordet økologi, er det faguttrykket økologi vi mener. Økologi kommer av de greske ordene oikos, dvs. hjem eller levested, og logos, som betyr læren om. Økologien er derfor læren om sammenhengen mellom de enkelte organismene og miljøet de lever i. Så lenge vi har eksistert, har vi mennesker vært en del av dette samspillet, og vi har påvirket og endret miljøet som vi har vært en del av. Med utviklingen av ny teknologi har denne evnen til å påvirke miljøet ført til at vi i mange tilfeller er i ferd med å gjøre uopprettelig skade. Blant annet utrydder vi i dag så mange dyrearter at mange mener vi er inne i en ny masse­utryddelses­ periode. Mange av disse artene er til og med ukjente for oss, og vi møter store utfordringer slik Gro Harlem Brundtland uttrykker i sitatet over. Likevel er det håp. Flere ganger har det blitt vist at dersom vi har kunnskap om økologi og farer som truer miljøet vårt, og bruker denne kunnskapen godt, er det mulig å snu en negativ trend. Slik kunnskap er du nå i ferd med å skaffe deg. Økologi er et enormt vidt område, så for å snevre det inn kan vi i denne sammenhengen si at vi stiller oss to spørsmål i økologien: Hvor lever organismene, og hvor mange er de? Til det første spørsmålet må vi også svare på hvilke faktorer som bestemmer hvor en art finnes. Det andre spørsmålet krever også at vi svarer på hvilke faktorer som kontrollerer hvor mange det kan leve av denne arten i disse områdene. Det blir brukt mange faguttrykk i økologien. Noen av dem er nye for deg nå, mens du har vært borti andre tidligere. Nedenfor forklarer vi viktige uttrykk ved hjelp av eksempler fra et marint økosystem. Faguttrykkene er også samlet i en tabell med eksempler fra et terrestrisk økosystem. En av de grunnleggende enhetene i økologien er økosystemet. Et økosystem er definert som et geografisk avgrenset område med både biotiske og abiotiske faktorer. Biotiske faktorer er levende faktorer, og de kan deles inn i de tre gruppene produsenter, konsumenter og nedbrytere. Eksempler er planter og dyr. Abiotiske faktorer er ikke-levende faktorer, som vann, næringssalter og lys. Et økosystem varierer i størrelse. Det kan være lite som en vannpytt, eller stort som et hav. Hele biosfæren kan også sies å være et økosystem. Biosfæren er den delen av jorden der det finnes levende organismer. Hvis vi tenker oss økosystemet fjæra, er rur og alger som lever der, eksempler på biotiske faktorer, mens abiotiske faktorer som påvirker rur og alger, er for eksempel hvor salt vannet er, hvor utsatt organismene er for bølger, og hvordan bunnforholdene er.


Økologi • 49

Økosystem Vind og temperatur: abiotiske faktorer

Sollys: abiotisk faktor

Vann: abiotisk faktor

Alle populasjonene: biotiske faktorer

pH, næringssalter, oksygen, karbondioksid: abiotiske faktorer

Abiotiske og biotiske faktorer.

Alle individer som lever i fjæra, tilhører en art. En art er ifølge det biologiske artsbegrepet en samling individer som kan formere seg og få forplantnings­ dyktig avkom. Det finnes også andre måter å definere en art på, men det skal vi ikke gå inn på her. Individene i fjæra kan være av samme art, eller av forskjellige arter. For eksempel er rurene som lever i området, antageligvis av samme art, for eksempel fjærerur (Semibalanus balanoides), mens ruren og en brunalge som blæretang (Fucus vesiculosus) tilhører forskjellige arter. Fjærerurene som lever i samme område, sier vi tilhører samme populasjon, dvs. en gruppe individer av samme art som lever innenfor et avgrenset område. Populasjonen av fjærerur utgjør sammen med populasjonen av blæretang og alle andre populasjoner i det samme området et samfunn. Samfunnet utgjør den biotiske delen av et økosystem. Stedet der en art finnes, kaller vi artens habitat. Den steinen en rur vokser på, er for eksempel rurens habitat. Det stedet der vi finner et samfunn, kaller vi en biotop. Overgangen mellom biotop og økosystem kan være flytende. Alle samfunn består av produsenter, konsumenter og nedbrytere. Organismer som driver fotosyntese i et økosystem, kaller vi produsenter. De omformer lysenergi til kjemisk energi. Algene i fjæra er eksempler på produsenter. Vi kaller også produsentene autotrofe fordi de selv kan danne organiske molekyler fra uorganiske molekyler. Alle organismene i samfunnet er avhengige av produsentene, for det er de som omdanner lysenergien til den energiformen som organismene kan nyttiggjøre seg av. De danner karbonforbindelser som senere kan utnyttes av både produsenten selv og andre organismer. Organismer som er avhengige av å bryte ned karbonforbindelser som andre har bygd opp, kaller vi heterotrofe. Når en heterotrof organisme spiser en annen organisme, kan organiske molekyler i den som blir spist, brukes som

Fjærerur (Semibalanus balanoides).


50 • Kapittel 2

Individ, populasjon, samfunn og økosystem. Individ

En enkelt hare

Populasjon

Alle harene i området

Alle populasjonene i området

Samfunn

Økosystem

Alle populasjonene og alle ikke-levende faktorer

byggematerialer eller energikilde av den som spiser. Heterotrofe organismer deler vi igjen inn i konsumenter og nedbrytere. En organisme som spiser en annen levende organisme, kaller vi en konsument. Ruren i fjæra er et eksempel på en konsument. Den spiser plankton som den fanger i vannet. Nedbrytere spiser dødt organisk materiale. De er utrolig viktige i økosystemet, for uten dem ville store mengder organisk materiale hopet seg opp i økosystemene. Bare se for deg en død blåhval (Balaenoptera musculus) som ikke blir brutt ned, og tenk på


Økologi • 51

hvor mange hvaler som har dødd i årenes løp! Eksempler på nedbrytere i fjæra er store krepsdyr som strandkrabbe (Carcinus maenas), eremittkreps (Paguridae sp.) og strandreke (Palaemon sp.), og selvfølgelig også bakteriene. En annen viktig nedbryter i naturen er soppene. Det finnes dyr som er både nedbrytere og konsumenter, og overgangen kan være flytende. Dersom for eksempel ruren spiser plankton som allerede er dødt, er den jo en nedbryter. Alle organismer, uavhengig av hvilket økosystem de lever i, blir påvirket av organismene rundt seg. De konkurrerer om mat, plass, lys, vann, næringssalter osv., både med individer av samme art som dem selv og med individer av andre arter. Konkurranse innenfor samme art kalles intraspesifikk konkurranse, mens konkurranse mellom forskjellige arter kalles interspesifikk konkurranse. Når for eksempel to fjærerur konkurrerer om den samme næringen, er det intraspesifikk konkurranse, men hvis fjærerur konkurrerer med et blåskjell (Mytilus edulis), er det interspesifikk konkurranse. I begge tilfellene blir konkurransen større desto flere blåskjell og fjærerur som lever i det samme habitatet. Miljøfaktorer som blir påvirket av tettheten til individene i en populasjon, kaller vi tetthetsavhengige miljøfaktorer. De blir mer og mer framtredende jo flere individer populasjonen består av. Eksempler på tetthetsavhengige miljøfaktorer er konkurranse om ressurser som næring, lys og vann, og konkurranse om plass. Det kan også være sykdommer, opphoping av avfallsstoffer, stress og økt predasjon. Predasjon vil si at en organisme spiser hele eller deler av en annen organisme. Jo flere individer som lever i samme habitat, desto tettere lever individene, og desto større press opplever de i konkurransen om ressursene der. Det er lettere å bli smittet av sykdommer, mengden avfallsstoffer øker, og individene opplever økt grad av stress. De kan også oppleve økt grad av predasjon på populasjonen fordi noen predatorer foretrekker å spise byttedyr dersom der er mange av dem, men spiser noe annet dersom det er færre individer i populasjonen. Mange predatorer kan for eksempel utvikle et visuelt søkebilde for en bestemt type byttedyr. Når byttedyret er sjeldent, ignorerer predatoren det og dreper relativt få. Når det blir flere byttedyr, fokuserer predatoren derimot på det og dreper en relativt større andel av populasjonen. Et eksempel er spissmus (Soricidae spp.), som spiser forholdsvis flere nattsvermerpupper når det er mange av dem enn når de er mer sjeldne. Tetthetsavhengige miljøfaktorer påvirker fødselsog dødsraten i en populasjon. Færre individer fødes, flere dør, eller vi ser en kombinasjon av disse to. Dette kommer vi tilbake til i kapittel 6 Populasjoner. Miljøfaktorer som ikke påvirkes av tettheten av individene, kalles tetthets­ uavhengige miljøfaktorer. De påvirker populasjonen likt uansett hvor mange som lever der. Dette er faktorer som for eksempel temperatur, naturkatastrofer, saltholdighet og hvor utsatt de er for bølger. Individene opplever påvirkningen av disse faktorene likt om det er mange eller få som lever der.

Huskeregel: intranett og internett; Internett er «mellom alle»

Blåskjell (Mytilus edulis).


52 • Kapittel 2

Økologiske faguttrykk.

Faguttrykk

Definisjon

Eksempel

Økosystem

Et geografisk avgrenset område med både biotiske og abiotiske faktorer

En skog, et fjellområde, en myr

Biotiske faktorer

Levende faktorer

Hare (Lepus timidus), sitronsommerfugl (Gonepteryx rhamni), bjørk (Betula pubescens)

Abiotiske faktorer

Ikke-levende faktorer

Lys, temperatur, vind

Biosfære

Den delen av jorden der det finnes levende organismer

Art

En samling individer som kan formere seg og få forplantningsdyktig avkom

Elg (Alces alces), svartskogsnegl (Arion ater), gran (Picea abies)

Populasjon

En gruppe individer av samme art som lever innenfor et avgrenset område

Alle elgene i et område, alle svartskogsneglene i et område eller alle grantrærne i et område

Samfunn

Alle populasjonene i et område, den biotiske delen av et økosystem

Elgpopulasjonen, svartskogsneglpopulasjonen, grantre­ populasjonen og alle de andre populasjonene i området

Habitat

Stedet der en art finnes

Elgene og svartskogsneglene lever i skogen, skogen er da deres habitat.

Biotop

Stedet der vi finner et samfunn

Elgpopulasjonen, svartskogsneglpopulasjonen, grantre­ populasjonen og alle de andre populasjonene i området lever innenfor et avgrenset område. Det området der vi finner dette samfunnet, er samfunnets biotop.

Produsent

Organisme som produserer organiske molekyler ved hjelp av solenergi eller kjemisk energi

Et grantre, en smørblomst (Ranunculus acris)

Autotrof

Organisme som lager organiske molekyler fra uorganiske

Et grantre, en smørblomst

Heterotrof

Organisme som er avhengige av å bryte ned karbonforbindelser som andre har bygd opp

En elg, en svartskogsnegl, en rød fluesopp (Amanita muscaria)

Konsument

Organisme som spiser en annen levende organisme

En elg, en svartskogsnegl

Nedbryter

Organisme som spiser dødt organisk materiale

En rød fluesopp

Predator

Organisme som spiser hele eller deler av en annen organisme

En rødrev (Vulpes vulpes) som spiser en skogmus (Apodemus sp.)

Intraspesifikk konkurranse

Konkurranse innenfor samme art

To elger som konkurrerer om samme mat

Interspesifikk konkurranse

Konkurranse mellom forskjellige arter

Et grantre og et furutre (Pinus sylvestris) som konkurrerer om vann

Tetthets­ avhengige miljøfaktorer

Miljøforhold som avhenger av tettheten av individene

Mattilgang, vanntilgang, spredning av sykdom

Tetthets­ uavhengige miljøfaktorer

Miljøforhold som påvirker populasjonen likt uavhengig av hvor mange som lever der

Temperatur, vind, flom, brann, tørke


Økologi • 53

Sjekkpunkter: Nye ord og faguttrykk: se tabellen på forrige side. Finn et annet eksempel på hvert av faguttrykkene i tabellen på forrige side. Finn et eksempel på en art som er både konsument og nedbryter.

2.2 Artenes utbredelse – et samspill mellom organismene og miljøet Hvorfor finnes en art akkurat der den gjør, og ikke andre steder? Hvordan har det seg at den har akkurat denne utbredelsen? Det er selvfølgelig mange faktorer som spiller inn. Hvis en art ikke finnes i et område, kan vi først spørre oss om det er fordi området er utilgjengelig for arten, eller om det ikke har gått tilstrekkelig tid til at den har kunnet spre seg dit. Den kan for eksempel være hindret av et fjell eller et hav, eller det kan være at den kommer til å spre seg dit senere. Dersom dette ikke er tilfellet, kan det være biotiske faktorer som avgjør artens utbredelse. Alle arter har utviklet tilpasninger til å leve der de gjør. Tilpasninger har utviklet seg over lang tid, mens områder kan endre seg raskt. Det kan være at selv om en art kunne ha levd i et område, har den utviklet andre tilpasninger som gjør at den ikke lever der likevel. Området var ikke tilgjengelig da arten tilpasset seg, og nå gjør noen av disse tilpasningene at den ikke bebor dette nye området. Eksempler finner vi hos flere insektarter, der hunnene ofte legger egg bare som respons på bestemte stimuli. Hunnene legger derfor bare eggene sine i visse habitater, og det begrenser hvor artene finnes. Interspesifikk konkurranse kan føre til at en art som ellers kunne ha levd i et område, blir utkonkurrert av en annen art. Hvordan det skjer, skal vi komme tilbake til seinere. En art kan også forsvinne fra et område fordi den blir spist opp, mange arter er også forsvunnet fordi de er overbeskattet av menneskene. En art kan også forsvinne av mangel på mat eller på grunn av sykdom. Noen ganger er arter også avhengige av andre arter, for eksempel til formering slik tilfellet er for flere plantearter. Dersom arten som overfører pollen fra ett individ av arten til et annet, ikke er til stede, kan heller ikke plantearten reprodusere seg og leve i området. Noen arter, for eksempel flere insektarter, er også avhengige av en eller noen få plantearter som matkilde. Er plantene de lever av, ikke til stede, kan heller ikke insektarten leve der.


54 • Kapittel 2

Neslesommerfugl (Nymphalis urticae). Larvene til neslesommerfuglen lever bare på neslearter.

Arten finnes ikke i området fordi

Noen biotiske faktorer som begrenser utbredelsen til en art.

Biotisk faktor

Eksempel

Tilpasninger

En insektart som bare legger egg i bestemte habitater

Interspesifikk konkurranse

To fuglearter som konkurrerer om den samme maten

Predasjon

En planteart blir spist opp

Mat

Et rovdyr forsvinner fra et område på grunn av mangel på byttedyr

Sykdom

En art blir smittet av en sykdomsframkallende bakterie og forsvinner fra et område

Formering

En planteart som er avhengig av en annen art til formering

Hvis det heller ikke er biotiske faktorer som bestemmer utbredelsen av arten, er de abiotiske faktorene avgjørende. I svært mange tilfeller er det nettopp de abiotiske faktorene som bestemmer hvor de forskjellige artene lever. Det er for eksempel klimaet som avgjør at det lever kameler (Camelus ferus) i ørkenen og ikke i Arktis, og at det ikke lever isbjørner (Ursus maritimus) i ørkenen. Ja

Spredning begrenser utbredelsen? Nei

Området er utilgjengelig for arten eller det har ikke gått nok tid

Ja

Biotiske faktorer begrenser utbredelsen? Nei

Faktorer som begrenser utbredelsen av en art.

Tilpasninger, predasjon, konkurranse, sykdommer

Kjemiske faktorer

Abiotiske faktorer begrenser utbredelsen? Fysiske faktorer

Vann Oksygen Saltholdighet PH Næringsstoffer, etc. Temperatur Lys Fuktighet Jordstruktur Brann, etc.

Alle artene må tilpasse seg de abiotiske faktorene i området der de lever. Dette er en kontinuerlig prosess der de best tilpassede individene er de som får overført flest gener til neste generasjon, slik at de best tilpassede genene blir vanligere i populasjonen. På lengre sikt blir hele arten bedre og bedre tilpasset miljøet sitt dersom miljøet er stabilt. Dette er mekanismen bak naturlig utvalg som du leste om i kapittel 1 Evolusjon. De abiotiske faktorene blir dermed svært viktige for hvilke egenskaper artene har, og også for hvor stor utbredelse de kan ha.


Økologi • 55

Høyvann

Sjøsalat

Lavvann

Tarmgrønske Grisetang Sagtang

Krusflik Sukkertare

Fagerving

Blæretang kan være et eksempel. Den er en brunalge som har spesifikke krav 0712_Alger til bunnforhold, saltholdighet og lys. Den trenger et hardt underlag for å kunne leve i et område, og den kan ikke leve på bløtbunn som sand. Den lever i salt­ vann, vi kan altså ikke finne blæretang i ferskvann. Ved kysten er det ofte partikler i vannet som absorberer blått lys. Dette fører til at blæretangen ikke kan vokse på dypet, da får den ikke nok lys til å drive fotosyntese. Rødalgene har pigmenter som gjør at de kan absorbere lys i den grønne delen av spekteret. De er derfor tilpasset å leve dypere i et slikt kystvann. De kan dermed leve der brunalgene ikke kan leve, og ha en annen utbredelse enn brunalgene, selv om de ellers kan ha like krav til saltholdighet og bunnforhold. Tilsvarende er det naturlig nok også på landjorda. Her er temperatur og vann blant de viktige abiotiske faktorene. Noen arter har tilpasset seg å leve der det er kaldere, og til årstidsvariasjoner. Dyr som lever i slike områder, har blant annet utviklet tykk pels og vinterfarger, slik som fjellreven (Vulpes lagopus). Plantene har for eksempel utviklet behåring som fjellsvevene, eller de lever i tuer som fjellsmelle (Silene acaulis). Planter og dyr som lever der det er tørt og varmt, utvikler tilpasninger for å spare på vannet. Kaktus har for eksempel bladene omformet til pigger og kan lagre vannet i stammen. Andre viktige abiotiske faktorer er vind, jordsmonn og næringssalter i jorda. Artene er ikke bare tilpasset til å leve der de gjør, de endrer seg også til stadighet, og som oftest gradvis, slik at de blir enda bedre tilpasset, eller de kan utvide leveområdene sine. Slik blir artene også preget av de abiotiske faktorene. For dyr som svømmer, er det en fordel å være strømlinjeformet. En strømlinje­ formet kropp minsker motstanden fra vannet. Både fisker og hav­pattedyr har utviklet en strømlinjeformet fasong, helt uavhengig av hverandre, fordi det har vært en fordel å ha denne formen i havet. En strøm­linje­formet fasong er mindre energikrevende. Energien kan derfor brukes på andre oppgaver til fordel for dyret. Individene i de forskjellige populasjonene med best mulig strømlinjeformet

Soneinndeling i kystvann. Ved kysten er det ofte partikler i vannet som absorberer blått lys. Rød­ algene har pigmenter som gjør at de kan absorbere lys i den grønne delen av spekteret. De er derfor tilpasset å leve dypere i et slikt kystvann. Artene sprer seg nedover i vannet avhengig av hvilken bølgelengde de kan nyttiggjøre seg av i foto­ syntesen. Grønnalgene er øverst, så kommer i hoved­sak brunalgene og nederst rødalgene.


56 • Kapittel 2

kropp har klart seg best og fått flest avkom gjennom utallige generasjoner, slik at artene til slutt har fått den formen de har i dag. Tilsvarende er det for andre abiotiske faktorer. I tillegg er de biotiske faktorene viktige for utviklingen av tilpasningene, for eksempel hos rovdyr og byttedyr. Rovdyrene utvikler tilpasninger for å bli bedre til å fange byttedyr, mens byttedyrene utvikler tilpasninger for å slippe unna rovdyrene. Dette kan du lese mer om senere i kapitlet. Tilpasninger kunne du også lese om i kapittel 1 Evolusjon.

Sjekkpunkter: Sild i stim. Silda (Clupea harengus) er godt tilpasset å leve i havet, blant annet på grunn av den strømlinje­ formede fasongen.

Hvilke grunner kan det være til at en art ikke finnes i et område? Gi et eksempel på en tilpasning til et liv i kalde områder. Gi et eksempel på en tilpasning til et liv i varme, tørre områder. Hvorfor har både fiskene og hvalene en strømlinjeformet fasong?

2.3 Populasjonsstørrelser og spredning I tillegg til å undersøke hvor og hvorfor en art lever der den gjør, er det også interessant å vite hvor mange individer arten eller de enkelte populasjonene består av. Videre vil vi gjerne vite hvordan populasjonen fordeler seg utover i et område, lever de tett eller spredt utover, og er fordelingen tilfeldig, jevn eller klumpvis? Det er også interessant å vite hvordan aldersfordelingen er i populasjonene, og hvordan fordelingen mellom kjønnene er, hvordan individene reproduserer, og hvor lenge de lever. Vi sier at vi har to ytterpunkter i måter artene gjennom naturlig utvalg selekteres på. Vi kaller disse ytter­ punktene for r-seleksjon og K-seleksjon, se tabellen. Du kan lese mer om populasjoner, og om r- og K-seleksjon i kapittel 6 Populasjoner. Egenskaper ved r- og K-selekterte arter.

r-selekterte arter

K-selekterte arter

Mange avkom på en gang

Relativt få avkom på en gang

Reproduserer ofte bare én gang

Reproduserer ofte flere ganger

Reproduserer raskt

Reproduserer relativt langsomt

Liten omsorg for avkommet

Stor grad av omsorg for avkommet

Tidlig fruktbar alder

Høy fruktbarhetsalder

Lever ofte kort

Lever ofte lenge

Liten konkurranseevne

Stor konkurranseevne

Ofte små individer

Ofte store individer

Ofte ukjønnet formering

Oftest kjønnet formering


Økologi • 57

Med slik informasjon kan vi forutsi noe om hvor mange individer i en populasjon som kan leve i et område over en lengre tidsperiode. Dette kalles områdets bæreevne for arten og kan blant annet hjelpe oss til å forvalte artene rundt oss på en fornuftig måte.

Metoder for beregning av populasjons­størrelser For noen populasjoner hvor det er få individer i et område, er det nok å telle antall individer direkte, eller fra et flyfoto, for å vite hvor mange som lever i området. Men for de fleste populasjonene er antallet så stort at det må andre metoder til for å vite hvor mange individer som lever der. En metode som kan brukes for å beregne populasjonsstørrelser hos enkelte dyr, kalles fangst-gjenfangstmetoden. Metoden går ut på at vi fanger et visst antall dyr, merker dem og slipper dem ut i populasjonen igjen. Etter en stund fanger vi et visst antall dyr igjen og registrerer hvor mange av de vi nå fanger, som er merket. Ut fra dette kan vi beregne en omtrentlig størrelse på populasjonen. Vi tar et eksempel: I et vann lever en fiskeart. Vi fanger 650 fisker, merker dem og slipper dem ut igjen. Etter en tid fanger vi 470 fisker. Av disse er 34 merket, se figuren. Hvor stor beregner vi da at populasjonen omtrentlig er? Vi får en enkel likning: antall fisk i gjenfangsten totalt antall fisker _______________________ ​        ​ = ​ ______________________________         ​og med tall: totalt antall merkede fisk antall merkede fisk i gjenfangsten 470 650 · 470 x   ​ = _____   ​ _____ ​   ​  . Vi løser likningen og får x = __________ ​   ​  ≈ 8985. 650 34 34 Fangst-gjenfangst­metoden. Fangst 1: 650 fisker Merket (M) = 650

pes jen Slip ig net n a ut i v

Fangst 2: 470 fisker Fangst (F) = 470 Gjenfangst av merkede (G) = 34 Populasjonsstørrelse (N) = 650 · 470 34 N=

M·F G


58 • Kapittel 2

Metoden er grov, men med forbehold forteller tallene oss at det antakeligvis lever mellom 8000 og 10 000 individer av arten i vannet. Metoden har sine svakheter. Vi kan for eksempel ikke vite om de individene vi opprinnelig fanget, lettere lar seg fange enn andre i populasjonen, eller om de tvert imot har blitt mer sky etter å ha blitt fanget en gang. Hvis det første er tilfellet, blir beregningen for lav. Hvis det andre er tilfellet, beregner vi for høy populasjonsstørrelse. Det er også mulig å anslå populasjonsstørrelser ut fra spor som fotavtrykk eller avføring, eller å telle antall reder i et område. For populasjoner som ikke flytter på seg, kan vi velge oss ut et tilfeldig område, for eksempel en rute på 1 m x 1 m og telle antall eller dekningsgrad i prosent av arten innenfor ruten. Så fortsetter vi med en ny tilfeldig rute og teller antall individer i denne ruten. Når vi har gjort dette mange nok ganger, kan vi anslå hvor mange individer som lever i området totalt. Det kalles ruteanalyse. For fiskepopulasjoner kan det også benyttes ekkoloddregistrering for å beregne populasjonsstørrelser, mens plankton­populasjoner kan beregnes ved hjelp av planktontrekk og mikro­ skopering. For fugl er det mulig å gjøre beregninger av populasjons­størrelser ved hjelp av trekkfugltelling eller basert på en kombinasjon av tellinger og sang. Et eksempel er prosjektet «Ekstensiv overvåking av hekkefugl (TOV-E)», som er et overvåkingsprosjekt for terrestriske hekkefugler som skal overvåke bestands­ utviklingen til norske fuglearter på land. De benytter en metode der de deler området inn i ruter, som igjen er delt inn i punkter. På hvert punkt skal arter registreres i et likt antall minutter innenfor et gitt datointervall og tidspunkt på dagen. Dersom de benytter samme metode over flere år, kan de sammenlikne resultatene.

Noen individer lever i flokk, andre lever mer spredt. Elefanter lever i flokker.

Et problem når vi skal anslå størrelser på populasjoner, er at individene som regel ikke er tilfeldig fordelt utover i området. Hos mange arter lever individene sammen i klynger med ujevne mellomrom. Ofte kan det skyldes at miljøet varierer i hvor gunstig det er å leve der. Det er lett å tenke seg at en populasjon med nedbrytere er svært klumpvis fordelt rundt en nylig død organisme. Se for deg et tre som har falt over ende, eller et stort dyr som ligger og råtner. Andre


Økologi • 59

eksempler på klumpvis fordeling er dyr som lever i flokk. Som en følge av klumpvis fordeling kan beregningen av hvor mange individer som lever i området, bli upresis. Noen arter forsvarer territorier. Alle individene forsvarer da omtrent like store områder, og resultatet blir at de fordeler seg jevnt utover. Jevn fordeling kan også forekomme der predatorer går spesifikt på én art. Da lønner det seg ikke å opptre for samlet.

Sjekkpunkter: Nye ord og faguttrykk: r-selekterte arter, K-selekterte arter, bæreevne, fangst-gjenfangstmetoden, ruteanalyse Gi tre eksempler på hvordan vi kan beregne hvor mange individer en populasjon består av. Nevn en svakhet ved fangst-gjenfangstmetoden. Hvorfor kan det være en utfordring at noen populasjoner er klumpvis fordelt når vi skal beregne populasjonsstørrelser?

2.4 Samspill mellom arter Ingen arter lever alene. Alle arter lever i samspill med andre. Samspillet kan gå på konkurranse om de samme ressursene, altså interspesifikk konkurranse, det kan være et samspill mellom rovdyr og byttedyr, beiting, symbiose, eller det kan være gjennom sykdommer. Samspill mellom arter. Symbiose: lusa er parasitt i pelsen til musa

Konkurranse: fuglen og musa konkurrer om larven

Beiting: larven spiser av bladet Rovdyr spiser byttedyr: musa spiser larven Predasjon Symbiose: mutualisme mellom erteplanten og bakteriene


60 • Kapittel 2

Nisjer og konkurranse Det foregår hele tiden en konkurranse i naturen der vinnerne er de som er best tilpasset, og som dermed overlever best og får overført flest av sine gener til neste generasjon. Hvert individ må konkurrere med andre individer av samme art og med individer av andre arter som kan utnytte de samme ressursene som det. Summen av de biotiske og abiotiske ressursene en art kan benytte seg av i miljøet sitt, kaller vi artens økologiske nisje. Vi kan enkelt si at nisje forteller noe om hva arten gjør, og hvor den gjør det. Dersom to ulike arter har over­ lappende nisjer, altså at de kan utnytte noen av de samme ressursene, konkurrerer de i den delen av deres nisjer som overlapper. Den arten som er best tilpasset forholdene i området, vinner denne konkurransen og benytter seg av disse ressursene. Den andre arten må nøye seg med å få benyttet en mindre del av sin nisje. Dersom de to artene har helt overlappende nisjer, utkonkurrerer den arten som er best tilpasset, den andre arten helt. Det var den russiske dyreøkologen Georgyi F. Gause som viste prinsippet med nisjer i 1930-årene ved å la to arter av slekten Paramecium, tøffeldyr, ha den samme nisjen, se figuren under. Derfor kaller vi også denne regelen det gauske konkurranseprinsippet. Hele artens nisje kan vi kalle fundamental nisje, mens vi kaller den delen av nisjen som arten faktisk får utnytte, realisert nisje. På figuren på neste side ser

Antall individer

a) Utvikling av en populasjon. P. aurelia (alene)

0

2

4

6

8

10

12

14

16 18 Tid (døgn)

Antall individer

b) Utvikling av en populasjon. P. caudatum (alene)

0

2

4

6

8

10

12

14

16 18 Tid (døgn)

c) Utvikling av populasjonene sammen Antall individer

Konkurranse blant arter med overlappende nisjer. To arter av tøffeldyr, Paramecium aurelia og Paramecium caudatum, konkurrerer om ressursene. De har helt overlappende nisjer, og bare den ene overlever når de lever sammen.

To arter av tøffeldyr, Paramecium aurelia og Paramecium caudatum, konkurrerer mye om ressursene. Bare den ene overlever når de lever sammen. 0

2

4

6

8

10

12

14

16 18 Tid (døgn)


Økologi • 61

Øvre flomål Chthamalus realisert nisje

Normal situasjon

Øvre flomål

Etter fjerning av fjærerur

Chthamalus Fjærerur Chthamalus fundamental nisje

Fjærerur realisert nisje

Nedre fjæremål

Nedre fjæremål

vi hvordan den realiserte nisjen til ruren Chthamalus stellatus er mindre enn den fundamentale nisjen der denne vokser sammen med fjærerur (Balanus balanoides). De to rurartene har delvis overlappende nisjer. Fjærerur har et konkurransefortrinn, dvs. at den er bedre tilpasset, og det gjør at den får utnyttet mer av ressursene enn det Chthamalus stellatus får. C. stellatus ble forhindret i å feste seg til underlaget fordi fjæreruren var raskere ute med å feste seg, vokste raskere og utkonkurrerte C. stellatus der denne allerede hadde festet seg. C. stellatus ble fortrengt til områder som ble for tørre til at fjærerur kunne leve der. Dersom arter har overlappende nisjer, kan artene utvikle seg i hver sin retning slik at konsekvensen blir mindre overlapp mellom nisjene deres. Det kaller vi ressursfordeling og kan føre til at konkurransen mellom disse artene blir mindre.

Sjekkpunkter: Nye ord og faguttrykk: nisje, fundamental nisje, realisert nisje, ressursfordeling Hvilke former for samspill kan det finnes mellom to arter? Hva skjer dersom to arter med identiske fundamentale nisjer blir plassert i samme habitat? Hva skjer dersom to arter med overlappende, men ikke identiske nisjer blir plassert i samme habitat? Hva kan over tid skje med to arter der nisjene i utgangspunktet overlapper? Hva kaller vi dette?

Predasjon – å spise eller bli spist Ikke alle arter konkurrerer direkte med hverandre, noen inngår i et samspill fordi de spiser eller blir spist. Som vi har sett, blir størrelsen til noen populasjoner regulert av at de blir spist av andre. For alle samspill mellom bytte og predator er det en evig kamp for å overleve. Dette vil, gjennom naturlig utvalg, vise seg gjennom tilpasninger både hos de som blir spist og hos de som spiser. De som blir spist, utvikler ulike tilpasninger som gjør at de for eksempel kan kamuflere

Interspesifikk konkurranse og overlappende nisjer. C. stellatus har en mye mindre realisert nisje enn fundamental nisje. Den kan leve lenger ned på svaberget enn den vanligvis gjør, fordi den taper konkurransen om plassen med fjærerur.


62 • Kapittel 2

seg bedre, løpe fortere, eller utvikle torner eller ulike former for antibeitestoffer. Predatorene utvikler seg på den andre siden slik at de lettere oppdager byttet, og lettere kan fange byttet for eksempel ved å løpe fortere, gjerne i kombinasjon med skarpe tenner eller klør. De som spiser planter, utvikler tilpasninger som for eksempel gjør at de klarer å oppdage passende planter og å tygge og fordøye maten.

Symbiose – samliv Dersom to arter lever i direkte kontakt med hverandre, kalles det symbiose. Symbiose betyr samliv og er en fellesbetegnelse for parasittisme, kommensalisme og mutualisme. Dersom det er parasittisme, får parasitten næring fra verts­ organismen uten å yte noe tilbake. For vertsorganismen er dette samlivet derfor en ulempe fordi parasitten tar ressurser som de ellers kunne brukt til andre formål. Noen arter er heltidsparasitter, mens andre er det bare i en viss periode av livssyklusen sin. Noen arter har bare én vert, mens andre har komplekse livssykluser med flere verter. Eksempler på parasitter er malaria­ parasitten (Plasmodium sp.), flått (Ixodidae sp.) og lakselus (Lepeophtheirus salmonis). Flått (Ixodidae sp.) kan parasittere både mennesker og dyr, og kan være både plagsom og skadelig for vertsorganismen.

Dersom den ene arten har en fordel av samlivet og den andre verken er positivt eller negativt påvirket, kaller vi det kommensalisme. Rur som vokser på en hval, kan være et eksempel på kommensalisme dersom de ikke er til ulempe for hvalen. Ruren får god tilgang på plankton og samtidig et feste, mens hvalen tilsynelatende ikke får noen negative effekter av blindpassasjerene. Store flokker med planteetere, for eksempel vannbøffel (Bubalus bubalis), jager opp insekter. Fugler som følger flokken, kan dra nytte av dette fordi de spiser disse insektene. Fuglenes tilstedeværelse har ikke noen umiddelbar effekt for flokken, slik at samspillet blir positivt for fuglene og nøytralt for vannbøflene, og vi ser et eksempel på kommensalisme.


Økologi • 63

Det er også mulig at fuglene kan være til nytte for flokken, for eksempel hvis de varsler om fare fra predatorer. Da er ikke forholdet kommensalistisk, men mutualistisk fordi begge arter har en fordel av forholdet. Andre eksempler på mutualisme er lav og mykorrhiza. Lav er en sopp og en alge eller en cyanobakterie som lever sammen til felles beste. Mykorrhiza er en landboende plante og en soppart som lever sammen. Planten, algen eller cyanobakterien gir næring til soppen, mens soppen bidrar med mineraler og beskyttelse. Så å si alle grønne planter har mutualisme med en soppart, og det er primært planterota som inngår i symbioseforholdet.

Sykdom Sykdomsframkallende organismer kan inngå i samspill med andre organismer. Sykdom fører til at individet som blir rammet av sykdommen, blir svekket. Den sykdomsframkallende organismen bruker av ressursene til verten og er en ulempe for den. Individet får da dårligere konkurranseevne enn friske individer i populasjonen. Sykdom er en viktig tetthetsavhengig faktor. Jo flere individer det er i populasjonen, desto lettere smitter sykdommen, og desto flere blir syke. Sykdom kan føre til store reduksjoner i størrelsen til en populasjon. Effekt av samspill for de artene som er involvert.

Samspill

Effekt for artene

Konkurranse

Negativ for den ene, positiv for den andre

Predasjon

Negativ for den ene, positiv for den andre

Parasittisme

Negativ for den ene, positiv for den andre

Kommensalisme

Ingen effekt for den ene, positiv for den andre

Mutualisme

Positiv for begge

Sykdom

Negativ for den ene, positiv for den andre

Sjekkpunkter: Nye ord og faguttrykk: symbiose, parasittisme, kommensalisme, mutualisme Hva er symbiose en fellesbetegnelse for? Hvilken form for symbiose er positiv for begge arter? Kan du gi et eksempel på en parasitt? Hva er lav? Hva er mykorrhiza?


64 • Kapittel 2

Endring i økosystemene Arter som lever i det samme miljøet, inngår i et samspill. Men artssammen­ setningen i et økosystem kan endre seg. Suksesjon er en gradvis, retnings­ bestemt endring av et økosystem over tid. Endringen kan skyldes artene selv, for eksempel når et tjern blir gjengrodd, eller ytre forhold som skogbrann, storm og isbreer som trekker seg tilbake, eller menneskeskapte endringer som hogst eller taretråling. Suksesjonen følger et fast mønster. Dersom suksesjonen skjer i et område uten jordsmonn, kaller vi det primær­ suksesjon. Det kan for eksempel være et område der en isbre smelter og trekker seg tilbake, eller når en vulkansk øy stiger opp av havet. Ved primærsuksesjon i terrestriske områder er de første artene oftest lav, fordi lav kan leve på steingrunn og kan overleve under ekstreme forhold med for eksempel temperatursvingninger og tørke. Etter hvert blir det på grunn av disse tidlige artene dannet et jordsmonn slik at det blir mulig for andre arter å leve der. Etter en stund blir derfor de første artene utkonkurrert av andre arter med bedre konkurranseevne, som igjen blir utkonkurrert av andre. Primærsuksesjon i et terrestrisk miljø.

Bare steiner

Lav, moser og små virvelløse dyr

Strå, gress, større virvelløse dyr og små pattedyr

Busker, trær, større pattedyr og fugler

Tid 1 Når habitater etableres eller forstyrres vil kolonisering, vekst og reduksjon foregå i en forutsigbar rekkefølge.

2 De første som koloniserer er typiske r-strateger, som mindre planter og dyr. Plantene stabiliserer jorden med røttene sine, slik at andre planter kan etablere seg og vokse der. Etter hvert som habitatet blir mer stabilt, vil K-strateger begynne å kolonisere området.


Økologi • 65

Dersom jordsmonnet i et terrestrisk økosystem er til stede, for eksempel etter flatehogst, kaller vi det sekundærsuksesjon. Sekundærsuksesjon kan skje raskere enn en primærsuksesjon siden jordsmonnet allerede er til stede. De første artene er gjerne arter med rask formeringsevne, for eksempel bringebær (Rubus idaeus) og geitrams (Chamerion angustifolium) i et skogsområde. Disse artene er typisk r-selekterte arter som produserer mye avkom på kort tid, men som har liten konkurranseevne, og som etter hvert blir utkonkurrert. Etter hvert blir artssammensetningen i området relativt stabil, og det skjer få endringer i samfunnet. Vi kaller det da et klimakssamfunn. Det består da typisk av K-selekterte arter med stor konkurranseevne. Avhengig av hvilken type samfunn vi studerer, regner vi med at det er tre typer mekanismer for hvordan artene erstatter hverandre i en suksesjon. Artene kan enten gjøre miljøet mer gunstig for artene som kommer etter, de kan hindre arter som kommer etter, eller de kan ha en nøytral innvirkning som verken gjør det bedre eller verre for etterfølgende arter. Et typisk eksempel på et samfunn der artene gjør miljøet mer gunstig for andre arter, er der en isbre trekker seg tilbake, som nevnt ovenfor. Et eksempel på at arter kan gjøre det vanskeligere for andre arter å etablere seg, ble gjort i et forsøk av Wayne Sousa. Han studerte en fjæresone der den første arten som etablerte seg, var grønnalger av slekten Ulva. Når en fjernet Ulva fra underlaget, kunne rødalgen Chondracanthus canaliculatus etablere seg raskere. Suksesjonen ville likevel skjedd på lengre sikt fordi Ulva er mer sårbar for predatorer og et hardt fysisk miljø, men Ulva gjorde det vanskeligere for den etterfølgende arten å etablere seg. Suksesjonen tok derfor lengre tid. Et eksempel på at arter virker nøytralt på etterfølgende arter, er dersom et tre faller over ende i en skog. Suksesjonen blir for en stor grad bestemt av arter som allerede finnes, som frø eller røtter i jorda. Dersom treet faller tidlig på året, er det andre arter som kommer først enn dersom det faller seinere på året. Disse artene blir så igjen utkonkurrert av andre.

Sjekkpunkter: Nye ord og faguttrykk: suksesjon, klimakssamfunn, primærsuksesjon og sekundærsuksesjon Gi et eksempel på primærsuksesjon. Hvilken type arter kommer først i en sekundærsuksesjon? Gi eksempler på hvordan en art kan påvirke arter som følger etter den i en suksesjon.


66 • Kapittel 2

2.5 Økosystemene Trofiske nivåer, næringsnett og næringskjeder

Krill.

I et økosystem er de heterotrofe organismene, altså de som må spise andre organismer for å overleve, avhengige av de autotrofe organismene, det vil si produsentene, for å overleve. Hadde det ikke vært produsenter i økosystemene, hadde det heller ikke vært noe levende liv der. En konsument spiser en produsent. Et eksempel er dyreplankton som krill, som spiser planteplankton. Energi og organisk stoff fra planteplanktonet kan da brukes av krillen. Dersom krillen så blir spist av en fisk som lodde (Mallotus villosus), kan lodda utnytte energien og stoffene i krillen, osv. En konsument som spiser en

5. Trofiske nivå Kvartærkonsument

Musvåk

Spekkhogger

4. Trofiske nivå Tertiærkonsument

Hoggorm

Sild

3. Trofiske nivå Sekundærkonsument

Småskogmus

Reke

2. Trofiske nivå Primærkonsument Hagebåndfly

Dyreplankton

1. Trofiske nivå Produsent

To forskjellige nærings­ kjeder. Pilene viser hvordan energi og organiske molekyler går gjennom de trofiske nivåene.

Groblad

Planteplankton

En terrestrisk næringskjede

En marin næringskjede


Økologi • 67

produsent, kaller vi primærkonsument. Primærkonsumenten kan igjen bli spist av en sekundærkonsument, og hvis en ny organisme spiser sekundær­ konsumenten, blir denne organismen tertiærkonsument, osv. Vi kan framstille dette i en næringskjede, se figuren på forrige side. Hvert ledd i en næringskjede kalles et trofisk nivå. Næringskjeden i figuren har altså fem trofiske nivåer. Det er viktig at pilene i en næringskjede peker fra den som blir spist og til den som spiser, for energien og det organiske stoffet går jo fra den som blir spist til den som spiser. Ofte er det ikke slik at en type produsent blir spist av bare én type primær­ konsument, som i sin tur blir spist av bare én type sekundærkonsument, osv. Planteplanktonet krillen spiser, kan også være mat for eksempel for hoppe­ kreps, og hoppekreps kan igjen bli mat for lodda eller en annen art, for eksempel sild (Clupea harengus). Når vi framstiller slike nettverk av næringskjeder i et økosystem, lager vi et næringsnett. Noen arter er ekstra viktige i økosystemene fordi mange andre arter er avhengige av disse artene. Vi kaller slike arter nøkkelarter, og de har en sentral rolle i næringskjedene til et økosystem. Et eksempel på en slik nøkkelart er hoppekrepsen raudåte (Calanus finmarchicus), som er mat for både mange av fiskene i havet og for larvene til flere fiskeslag. Et eksempel fra landjorda er blåbær, som spises av dyr som fugl, bjørn, rådyr og hare. Blåbær er også levested for larver, og de igjen blir mat for fugl.

Fugl

Fiskebåt Planteplankton

Dyreplankton (raudåte, krill, amfipoder, etc)

Polartorsk

Sild

Sel

Lodde

Spekkhogger

Torsk

Reke

Bunnorganismer

Marint næringsnett. Et næringsnett viser hvordan flere nærings­kjeder henger sammen. Mange av artene inngår i flere næringskjeder og kan være på ulike trofiske nivåer, avhengig av hvilken nærings­kjede de inngår i.


68 • Kapittel 2

Terrestrisk næringsnett. Et næringsnett viser hvordan flere nærings­kjeder henger sammen. Mange av artene inngår i flere næringskjeder og kan være på ulike trofiske nivåer, avhengig av hvilken nærings­kjede de inngår i.

En organisme er ikke alltid på bare ett trofisk nivå. For eksempel spiser flere krillarter både plante- og dyreplankton, og mange kan også spise dødt organisk materiale. Krillen er da både primær- og sekundærkonsument og nedbryter samtidig. Det samme kan sies om flere andre dyr. For eksempel spiser kråke (Corvus cornix) både planter, dyr og åtsler. For enkelhets skyld utelates nedbrytere ofte i næringskjeder og næringsnett, men de inngår naturlig nok også i disse kjedene og nettene, både fordi de lever av alle trofiske nivåer, og fordi de selv kan være bytte for rovdyr. Energi og organisk stoff går over fra en organisme til en annen når denne organismen blir spist. Men blir all energien overført fra ett trofisk nivå i nærings­kjeden til det neste? Sagt på en annen måte: Kan all energien som produsentene tar opp fra sollyset, overføres fra produsentene til primær­ konsumentene og videre til sekundærkonsumentene? Svaret er nei. Hvis vi ser bort fra nedbrytere, parasitter og sykdomsframkallende mikroorganismer og bare ser på de større dyrene i en næringskjede, går ca. nitti prosent av energien ut av næringskjeden, og bare ti prosent blir overført til det neste trofiske nivået. Vi må likevel huske på at dette er et svært forenklet bilde, og at noen organismer utnytter maten bedre enn andre. Hvor mye energi som blir tilgjengelig for neste


Økologi • 69

trofiske nivå i næringskjeden, avhenger av hvor stor del av det foregående leddet som faktisk blir spist av det neste leddet, hvor mye som blir absorbert av det som blir spist, og hvor mye av det som blir absorbert, som blir til ny biomasse. Energistrøm i en nærings­kjede. Tertiærkonsument

10 J

Sekundærkonsument

100 J

Primærkonsument

1000 J

Produsent

10 000 J

1 000 000 J fra sollys

Det er bare den delen av energien og organiske molekyler som blir brukt til å bygge opp biomasse i en organisme, som blir tilgjengelig for neste ledd i næringskjeden. Hvor blir det av energien i en hare som blir tatt av en rev? Energien i en fanget hare

Energi i hår og bein som

Energi i den delen av haren som fordøyes

reven ikke spiser

Energi i ufordøyd

Energi i det fordøyde materialet

materiale. Ekskrementer

Energi i

Energi i de forbindelsene som går inn i stoffskiftet

ekskresjonsprodukter

Energi som blir

Energi til vekst

brukt for å erstatte det

Energi til

celle­materialet

aktivitet

som hele tiden blir brutt ned

Celleånding

og reproduksjon, ca. 10 % av energien i haren


70 • Kapittel 2

Noe energi går for eksempel tapt som deler av organismen som ikke ble spist, eller som ufordøyd mat. Resten av energien går til celleånding for å få energi til å drive prosesser i organismen selv. Disse prosessene er for eksempel bevegelse, varme og transport i organismen, og oppbygging av de organiske molekylene krever i seg selv også energi. Energien blir omskapt til varmeenergi og forsvinner til slutt ut i verdensrommet. Vi må likevel huske på at all energien ikke nødvendigvis er tapt for økosystemet selv om den er tapt for en næringskjede. Deler som ikke ble spist eller ikke fordøyd, kan brukes av en annen næringskjede der nedbrytere inngår. Hvis vi ser bort fra nedbrytere, parasitter og sykdomsframkallende mikro­ organismer og bare ser på de større dyrene i en næringskjede, begrenser dette store tapet av energi fra ett ledd til det neste hvor mange ledd en nærings­ kjede kan bestå av. En næringskjede blir sjelden mer enn fire–fem ledd, selv om næringskjedene i havet kan være noe lengre enn terrestriske nærings­ kjeder. Det er rett og slett ikke energi igjen til flere ledd. Dette er som sagt ikke helt sant, for nedbryterne bryter igjen ned de døde organismene og blir igjen i sin tur brutt ned osv. Men for enkelhets skyld ser vi bort fra dette her. Sammen med energien som forsvinner fra ett trofisk nivå til det neste, forsvinner også biomassen ut av næringskjeden. Slik blir det også ca. nitti prosent mindre biomasse for hvert trofisk nivå. Biomassen på ett nivå er med andre ord som regel omkring ti ganger så stor som på neste nivå i næringskjeden. Dette kan framstilles i en biomassepyramide, se figuren under.

Biomassepyramide.

Kvartærkonsument Spekkhogger Tertiærkonsument Sild Sekundærkonsument Reke Primærkonsument Dyreplankton

10 × 10 × 10 × 10 ×

Produsent Planteplankton 10 000 × massen av spekkhogger


Økologi • 71

På grunn av synkende biomasse blir det som oftest også færre og færre individer for hvert ledd i næringskjeden, men ikke alltid. Biomassen av planteplankton kan for eksempel være mindre enn biomassen av primær­ konsumenter, fordi planteplanktonet reproduserer så raskt. Skulle vi tegnet en biomassepyramide for en slik næringskjede, ville bunnen vært mindre enn neste ledd. Grunnen til det er at biomassepyramider bare viser et øyeblikks­ bilde. Derfor kan de av og til stå på hodet.

Sjekkpunkter: Nye ord og faguttrykk: primærkonsument, sekundærkonsument, næringskjede, trofisk nivå, næringsnett, nøkkelart Hvilken vei går pilene i en næringskjede? På hvilket trofisk nivå er en tertiærkonsument? Hvor mye av energien blir overført fra ett trofisk nivå til det neste i en næringskjede? Hvor blir det av resten av energien? Hvorfor blir det som regel mindre biomasse høyere opp i næringskjeden?

Karbonets kretsløp Over har vi beskrevet hvordan energien fra sollyset blir bundet i organisk stoff, og hvordan denne energien strømmer gjennom næringskjedene. Men det er ikke bare energien fra sollyset som plantene binder i fotosyntesen, de binder også karbondioksid og vann. Hvordan det skjer, kan du lese mer om i kapittel 9 Fotosyntese. Vi skal her følge karbonets vei gjennom et økosystem. Karbon er et svært viktig grunnstoff fordi det inngår i alle organiske stoffer. Karbon finnes i atmosfæren i uorganisk form som CO2, og gjøres om til organisk form i fotosyntesen. Karbonet blir dermed også tilgjengelig for de heterotrofe organismene fordi de spiser de autotrofe organismene. Karbon blir tilført atmosfæren igjen ved celleånding fra alle levende organismer. Celle­ånding kan du lese mer om i kapittel 8. Vulkaner er også en kilde til CO2. Karbon blir lagret i fossile brennstoff, jordsmonn, sedimenter i sjøer og hav, oppløste karbon­­ forbindelser i havet, biomasse i autotrofe og heterotrofe organismer, og i atmos­færen. Det største lageret er likevel sedimentære bergarter. Målinger viser at mengden karbondioksid i atmosfæren har steget med mer enn 25 prosent de siste femti årene. Det skyldes i all hovedsak forbruk av fossilt brenn­ stoff. I tillegg foregår det mange steder rovhogst av skogen, særlig i tropene, og det sender karbonet raskere tilbake til atmosfæren enn hva som ville skjedd med en langsom, naturlig nedbrytning. Når det ikke er skjedd en enda større endring i atmosfærisk karbondioksid, skyldes det at havet absorberer mye av karbon­dioksidet som blir sluppet ut. Havet har absorbert ca. tretti prosent av de menneskeskapte utslippene av karbondioksid. Ikke desto mindre har denne økningen ført til global oppvarming med de problemene det medfører. Ifølge FNs klimapanel (IPCC) er det en såkalt positiv tilbakekobling mellom klima­endringene og karbonsyklusen. Det vil


72 • Kapittel 2

Karbonets kretsløp. Karbon finnes i atmosfæren i uorganisk form som CO2, og gjøres om til organisk form i fotosyntesen. Karbon blir tilført atmosfæren igjen ved celleånding fra alle levende organismer. Vulkaner er også en kilde til CO2. Karbon blir lagret i fossile brennstoffer, jords­monn, sedimenter i sjøer og hav, som oppløste karbon­forbindelser i havet, biomasse i organismer, og i atmosfæren.

Lys

CO2 i lufta

Fotosyntese Celleånding Forbrenning

Celleånding

Løst i vann

Nedbrytning

Celleånding

Fotosyntese Torv Kull Nedbrytning Sedimenter

Gass Olje

si at jo større klima­endringene er, desto større del av karbondioksidutslippene blir værende i atmosfæren. Det øker igjen klimaendringene osv. Du kan lese mer om global oppvarming i kapittel 2.6 Menneskelig påvirkning av økosystemene. Når karbondioksid fra atmosfæren løser seg i vann, blir det produsert karbonsyre, og vi får denne likevekten:  H2CO3 CO2 + H2O   karbonsyre karbondioksid + vann  Karbonsyre kan avgi to hydrogenioner (protoner):  HCO3− + H+ H2CO3   hydrogenkarbonat + hydrogenion karbonsyre   CO32− + H+ HCO3−   karbonat + hydrogenion hydrogenkarbonat 


konsentrasjon av CO2 (ppmv)

Økologi • 73

Atmosfærisk karbondioksid målt ved Mauna Loa, Hawaii. Keelingkurven viser endringer i CO2 konsentrasjonen i atmosfæren siden 1958 og baserer seg på målinger gjort av Charles Keeling. Mange forskere gir Keelings graf æren for å gjøre verden oppmerksom på den økende mengden karbon­ dioksid i atmosfæren.

400

380

360

340

320

1960

1970

1980

1990

2000

2010 år

Det blir produsert mer karbonsyre jo mer karbondioksid som er til stede. Som vi ser av likevektene, fører produksjonen av karbonsyre til at hydrogen­ioner blir frigjort til vannet. Det gjør havet surere. Forsuring av havet og konsekvenser av det kan du lese mer om på side 78.

Sjekkpunkter: Hvor finnes karbon naturlig lagret? I hvilken prosess blir karbon gjort om til organisk form? Hvorfor har mengden karbondioksid i atmosfæren steget? Hva skjer når karbondioksid fra atmosfæren løser seg i vann? Hvorfor fører mer karbondioksid i atmosfæren til surere vann?

Nitrogenets kretsløp Nitrogen er et livsviktig grunnstoff i alt levende fordi det inngår i aminosyrer som bygger opp proteiner, i ATP og ikke minst nukleinsyrene DNA og RNA. Det er ca. 78 % nitrogen i atmosfæren, slik at mengdene av dette grunnstoffet er ufattelig store. I atmosfæren forekommer nitrogen likevel bare som nitrogen­ gass (N2), og denne formen kan ikke produsentene bruke. Det krever svært mye energi å sprenge bindingene mellom de to atomene, og det er bare noen få bakterier som greier det. Nitrogen er derfor en begrensende faktor i mange økosystemer, dvs. at den begrenser populasjonsveksten. Planter og alger kan bare bruke to former for uorganisk nitrogen, ammonium (NH4+) eller nitrat (NO3). Ulike bakterier kan også bruke ammonium og nitrat i tillegg til nitritt (NO2-). Dyr kan bare bruke organiske former for nitrogen. De


74 • Kapittel 2

må altså spise andre organismer for å få i seg nitrogen. Naturlig blir nitrogen tilført et økosystem ved lynutladninger i atmosfæren. Her blir nitrogenet omgjort til nitrogenoksid (NOx), som er vannløselig, og som derfor kommer ned med regnvannet. Noen planter, som oretrær og alle erteplanter, lever i symbiose med nitrogenfikserende bakterier som har evne til å omdanne nitrogenet i luft til forbindelser som produsentene kan ta opp. I første rekke kommer de vertsplantene til gode, seinere også økosystemet. Det finnes også nitrogenfikserende bakterier som lever fritt i jorda. Proteiner i dødt materiale blir frigjort av nedbrytere, mest i form av ammonium­ ioner, som så omdannes ved hjelp av bakterier til nitritt og så til nitrat, som deretter kan tas opp av produsentene med vannet. Via produsentene går det så over i konsumentene. Det finnes også såkalte denitrifiserende bakterier som omdanner nitrat til N2, som går tilbake til atmosfæren og dermed går tapt for økosystemet. På røttene av oretrærne er det knollaktige bakteriekolonier som omdanner nitrogengass (N2) til forbindelser som plantene kan ta opp. Oretrærne har derfor et overskudd av dette grunnstoffet, og det har følgelig ikke vært et seleksjonspress for å bevare det. Oretrærne feller derfor bladene grønne om høsten. Dette i motsetning til alle andre norske løvtrær som bryter ned klorofyllet for å ta vare på nitrogenet og andre verdifulle stoffer, slik at karotenoidene kommer fram og farger bladene i rødt og gult.

Nitrogenmolekyler i atmosfæren 78 %

sjo

n

Lynutladning

De

ni

tr

ifi

ka

Kunstgjødselindustri

Forbrenningsgasser Planteprotein

Erteplante

Dyreprotein

Husdyrgjødsel og kompost

Nitrogenets kretsløp. I et naturlig økosystem kommer nitrogenet fra tre kilder, ned­brytning av døde organismer, nitrogenbinding via bakterier, og ved lyn­ utladninger i atmosfæren. I tillegg fører mennesket store mengder nitrogen til systemet.

Nitrat og Ammonium

Organisk avfall brytes ned av sopp og bakterier

Nitrogenfiksering i bakterier

Ammonium Nitrat Omdannes av bakterier Nitratutvasking

03_20 Nitrogenkretsløp

Omdannes av bakterier

Nitritt


Økologi • 75

For å øke matvareproduksjonen har mennesket forstyrret dette kretsløpet ved å bruke enorme mengder kunstgjødsel. Når vi produserer kunstgjødsel, blir atmosfærisk nitrogen omgjort slik at det er løselig i vann. Nitrogenet kan da tas opp av produsentene og brukes i deres produksjon. I tillegg skjer det mini­­­ lynutladninger i millioner av forbrenningsmotorer under forbrenningen av brennstoff. Avgassene inneholder derfor store mengder nitrogenoksid (NOx) som er løselig i vann. Av samme grunn inneholder regnvann i dag langt større mengder nitrogen enn det som er naturlig. Denne overgjødslingen skjer særlig i de industrialiserte samfunnene og skaper problemer i mange økosystemer. Dette kommer vi tilbake til seinere i kapitlet. Andre kretsløp er også viktige i økosystemene. Kretsløpet til fosfor og vann kan du lese om på www.gyldendal.no/bi.

Sammenlikning av energistrøm og grunnstoffenes kretsløp Som vi har sett over, er både energi og grunnstoffene livsviktige for livet i økosystemene. Men de inngår i økosystemene på forskjellige måter. Hvis vi ser bort fra menneskelig påvirkning, tilføres det lite nytt grunnstoff til et økosystem, og det er også lite som forsvinner ut av det. Det meste går fra den abiotiske delen av økosystemet til den biotiske, gjennom næringskjedene og tilbake til den abiotiske delen. Det blir altså resirkulert og går med andre ord i sirkel eller kretsløp. Energien må derimot hele tiden tilføres økosystemene utenfra, dvs. fra sollyset. Det går så via produsentene til de neste trofiske leddene i nærings­ kjeden, men for hvert ledd forsvinner ca. nitti prosent fra nærings­kjeden og til slutt ut av økosystemet som varme. Energien går altså gjennom næringskjedene og forsvinner ut av dem, mens grunnstoffene hele tiden går i kretsløp og blir værende i økosystemet. Vi sier at næringskjedene er lukkede kretsløp når det gjelder grunnstoffene, men åpne når det gjelder energi. Mange forskere mener at vi står overfor en fosforkrise. Fosfor er et svært viktig grunnstoff i levende organismer, og er en viktig bestanddel av kunst­gjødsel. Grunnstoffene fra avlingene vi høster, blir ikke ført tilbake til jordene. Lagrene av fosfor i verden har derfor minket kraftig, og det fryktes at jordbruket i framtiden får for lite fosfor, og at det kan gi matmangel. Et tiltak for å hindre dette er å gjenvinne fosfor fra for eksempel kloakk, og så føre det resirkulerte fosforet tilbake til jordene.


76 • Kapittel 2

Sjekkpunkter: Nye ord og faguttrykk: nitrogenfikserende bakterier, denitrifiserende bakterier Gi tre eksempler på hvor vi finner nitrogen i levende organismer. Hvorfor er nitrogen en begrensende faktor i mange økosystemer? Hvilke former for nitrogen kan dyr og planter benytte seg av? Hvordan blir nitrogen naturlig tilført et økosystem? Hvorfor sier vi at næringskjedene er lukkede kretsløp når det gjelder grunnstoffene, men åpne når det gjelder energi?

2.6 Menneskelig påvirkning av økosystemene Oppblomstring av grønn­ alger i strandsonen. Som en følge av overgjødsling har veksten av grønnalger økt kraftig. Stranden har blitt et mindre fristende badested, og det biologiske mangfoldet er endret.

Menneskene har gjennom hele sin historie påvirket og endret økosystemene. Med økende befolkning på jorda har også påvirkningen på økosystemene økt. I dag kan handlingene våre føre til endringer som får konsekvenser på globalt nivå, og som påvirker alle på jorda. Vi skal her se på noen eksempler på menneskelig påvirkning.

Overgjødsling Nitrogen er et viktig grunnstoff for organismene, og nødvendig for vekst i alle organismer. Det samme er tilfellet med fosfor. Men når mennesket tilfører for mye næringssalter som nitrogen og fosfor til økosystemene, blir det et problem. De viktigste årsakene til overgjødsling i Norge er i dag utslipp av næringssalter fra fiskeoppdrett, avrenning fra jordbruksarealer, industri og kloakk. Økt oppdrettsaktivitet de siste tjue årene har økt mengdene av næringssalter fra denne industrien. Husdyrgjødsel og kunstgjødsel fra jord­bruket gir et overskudd av næringssalter som renner ut i bekker og vann og i sjøen. Økende grad av industri og transport øker også mengden av nitrogen­holdige gasser i atmo­ sfæren, som så kan nå vannet via regn eller som partikler. For dårlig rensing av kloakk er også en viktig kilde til overgjødsling. I tillegg kan klimaendringene føre til økt tilførsel av næringssalter fordi større nedbørs­mengder og større temperatursvingninger kan bidra til at mer næringssalter vaskes ut av jorda. Konsekvensene av overgjødsling er flere. Dersom mengden av næringsstoffer i vannet øker, øker også mengden planktonalger. Flere planktonalger gir dårligere sikt i vannmassene, og det kan også hope seg opp alger som konsumentene ikke vil spise. Disse algene synker til bunns og kan forårsake oksygenmangel når de blir brutt ned. Det kan igjen redusere det biologiske mangfoldet etter som forholdene blir ugunstige for dyr som lever på bunnen. Både opphoping av alger på bunnen og dårligere lysforhold nedover i vannet gir dårligere forhold for produsentene. Det fører igjen til dårligere forhold for konsumentene, og til at færre dyr lever der. Et resultat av overgjødsling kan også være hyppigere oppblomstring av giftalger, og at dyr som spiser disse algene, blir


Økologi • 77

giftige. Ytterligere konsekvenser er redusert kvalitet på drikkevann og badevann. Økt algevekst av ettårige arter i strandsonen, særlig grønnalger, fører til endret biologisk mangfold og til at strendene blir mindre tiltalende for oss mennesker. Selv om tiltak allerede er satt i gang for å stanse overgjødslingen, blir vann­ kvaliteten likevel forringet flere steder fremdeles, og flere tiltak må gjennom­ føres. Utslipp fra industri, transport og landbruk må begrenses ytterligere, rensekravene og utslippstillatelsene må skjerpes, og fiskeoppdrett må reguleres strengere. Her er det viktig med et internasjonalt samarbeid, og at det blir økt fokus på disse problemene. Det er også viktig med observasjoner av nærmiljøet slik at mulige utslipp blir oppdaget tidlig og skadevirkningene kan begrenses.

Sjekkpunkter: Nye ord og faguttrykk: overgjødsling Hva er de viktigste årsakene til overgjødsling i Norge i dag? Nevn tre konsekvenser av overgjødsling.

Drivhuseffekten og klimakrisen Drivhuseffekten er livsnødvendig for livet på jorda. Den sørger for at varme­ stråling, som ellers ville ha sluppet rett ut i atmosfæren, blir sendt tilbake til jorda og varmer den opp. Drivhuseffekten kommer av skyer og såkalte klimagasser, se figuren på neste side. Klimagassene sørger for at mer av varmen bevares i jordatmosfæren. Uten den naturlige drivhuseffekten ville middeltemperaturen på jorda vært ca. minus 18 °C, mens den med drivhuseffekten er ca. 15 °C. Problemene oppstår når menneskene forstyrrer det naturlige systemet, og drivhuseffekten øker. Konsentrasjonen av klimagassene metan (CH4), karbondioksid (CO2), lystgass (N2O) og fluorgasser har økt i atmosfæren på grunn av menneskelig aktivitet, se for eksempel figuren på side 73. De økte konsentrasjonene av disse gassene har forsterket drivhuseffekten. Dette har igjen ført til at mer varme blir holdt tilbake på jorda, noe som igjen har ført til global oppvarming. Målinger viser at den globale middeltemperaturen har økt med ca. 0,85 °C fra 1880 til 2012. For å kunne sammenlikne de ulike klimagassene er det laget en skala. Ved hjelp av disse GWP-verdiene (Global Warming Potential) kan utslipp regnes om til oppvarmingseffekt på atmosfæren over et valgt tidsrom, sammenliknet med CO2. GWP-verdier sammenliknet med CO2.

GWP for tidsrom Klimagass

20 år

100 år

500 år

Karbondioksid (CO2)

1

1

1

Metan (CH4)

72

25

7,6

Lystgass (N2O)

289

298

153

Utdrag fra tabell 2.14, IPCCs fjerde hovedrapport, 2007


78 • Kapittel 2

Drivhuseffekten. 2 En del av solstrålingen blir reflektert tilbake fra bakken og atmosfæren

Drivhuseffekten

4 Varmestrålingen tas opp av klimagassene som sender CO2 noe av varmen tilbake til H2O jordoverflaten. Dette skaper CH4 drivhuseffekten

5 Menneskenes utslipp av klimagasser gir en forsterket drivhuseffekt

1 Atmosfæren slipper inn kortbølget solstråling som varmer opp jorda

CO2

3 Jorda sender ut langbølget varmestråling

FNs klimapanel (IPCC) anslår i sin femte hovedrapport at middeltemperaturen på jorda øker med mellom 0,3 °C og 4,8 °C innen 2100. Havnivået antas å stige mellom 26 og 82 cm. I Norge kommer antakeligvis temperaturen til å øke mest om vinteren og minst om sommeren. Konsekvensene av klima­ endringene blir store. Ifølge miljøstatus.no er eksempler på endringer som er påvist, at isbreer minker, permafrost tiner, trær blomstrer tidligere om våren og fugler legger egg tidligere. Enkelte plante- og dyrepopulasjoner flytter mot høyere breddegrader og større høyder. Den observerte økningen i overflate­ temperaturen i tropiske hav de siste tiårene har dessuten ført til en omfattende bleking av korallrev, det vil si at algene som lever inne i korallene, dør. Havet har også blitt surere som en konsekvens av økende mengde karbondioksid tatt opp av havet. Havet har blitt 26 prosent surere siden 1750. Surere hav fører til at mindre kalk blir tilgjengelig, fordi hydrogenioner reagerer med karbonat og danner hydrogenkarbonat, se side 72. Dermed blir karbonat bundet opp. Karbonat er en viktig bestanddel i kalk, og dyr som er avhengige av kalk for å bygge skjelett eller skall, kan forsvinne. Dette kan igjen påvirke næringskjedene i havet. Økt temperatur i havet kan også påvirke sirkulasjonen i havet.


Økologi • 79

°C 0,8 0,6 0,4 0,2 0 –0,2 –0,4 –0,6 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 år

I sin femte hovedrapport fra 2014 oppsummerer FNs klimapanel (IPCC) virkningene av global oppvarming. De legger til grunn fem grunner til bekymring (RFC, Reasons For Concern) som danner et rammeverk for å oppsummere nøkkelrisikoer. De fem grunnene til bekymring er: 1 Skade på unike og truede systemer. Inkluderer både økosystemer og kulturer. 2 Ekstreme værhendelser, slik som hetebølger, ekstrem nedbør og oversvømmelse ved kysten. 3 Ulik fordeling av virkning. Virkningen av global oppvarming er ujevnt fordelt og er generelt større for ugunstig stilte mennesker eller samfunn. 4 Samlede globale virkninger for biologisk mangfold og økonomi. Tap av biologisk mangfold og skader for økonomien. 5 Irreversible hendelser i stor skala. Eksempelvis kan noen økosystemer, som tropiske korallrev og arktiske økosystemer, nå et vippepunkt som gjør at det ikke er mulig å snu trenden. Nøkkelrisikoene, som alle bidrar til en eller flere grunner til bekymring, er risiko for: • Død, skade, redusert helse eller ødelagt livsgrunnlag i lavtliggende kyst­ områder og små øyer, grunnet stormer, oversvømmelser og stigende havnivå. • Redusert helse og ødelagt livsgrunnlag i tettbygde strøk i noen regioner på grunn av oversvømmelser i innlandet. • Sammenbrudd av infrastruktur og tjenester som elektrisitet, vannforsyning og helsetjenester på grunn av ekstreme værhendelser. • Død og sykdom under perioder med ekstrem varme. • Usikker mattilgang på grunn av ujevne og ekstreme tilfeller av varme, tørke, oversvømmelser og nedbør. Fattige befolkninger er særlig utsatt. • Tap av livsgrunnlag i jordbruksområder på grunn av utilstrekkelig tilgang på drikke- og vanningsvann og redusert produksjon av jordbruksprodukter, særlig i halvtørre områder. • Tap av marine økosystemer og økosystemer langs kysten, biologisk mangfold og alt hva økosystemene bringer med seg for samfunnene langs kysten, særlig for fiskesamfunn i tropene og i Arktis. • Tap av terrestriske og ferskvannsøkosystemer, biologisk mangfold og alt hva økosystemene bringer med seg for samfunnene.

Global middeltemperatur fra 1880 til 2012. Avvik fra normalperioden (1901 – 2000). Kilde: National Oceanic and Atmospheric Administration, 2013 / miljøstatus.no


80 • Kapittel 2

Jo mer temperaturen på jorda øker, desto større blir konsekvensene av klimaendringene, se figuren. Konsekvensene er mest alvorlige for utviklingsland. Grunnen er både at de fleste utviklingslandene ligger i de mest utsatte områdene, og at de har mindre ressurser til å håndtere konsekvensene av klimaendringer.

Mulige konsekvenser av klimaendringer. Kilde: miljøstatus.no (http://www. miljostatus.no/Tema/Klima/)

Det er ikke nytt at klimaet endrer seg. Hastigheten og omfanget det skjer med er likevel nytt i historisk tid. Ifølge Miljøverndepartementet er det ventet at endringene i Norge gir varmere vær og mer nedbør de fleste steder. Det blir mindre snø og mer regn og høyere frekvens av ekstremvær. Endringene får store konsekvenser for både naturen og samfunnet, og for å takle disse endringene best mulig må det planlegges best mulig i alle deler av samfunnet. I mai 2013 la regjeringen fram en stortingsmelding om klimatilpasning i Norge, og det finnes i dag en nasjonal nettportal for klimatilpasning. Lenke til denne nettportalen finner du på læreverkets nettsted (www.gyldendal.no/bi).


Økologi • 81

Sjekkpunkter: Nye ord og faguttrykk: klimagasser Hvor mye har den globale middeltemperaturen økt fra 1880 til 2012? Hvilke klimagasser har økt i atmosfæren på grunn av menneskelig aktivitet? Hva er en GWP-verdi? Gi tre eksempler på endringer i klimaet fram til i dag. Hva er konsekvensene av surere hav? Nevn fire konsekvenser av global oppvarming på lengre sikt.

Miljøgifter Miljøgifter er kjemiske forbindelser som er lite nedbrytbare, som hoper seg opp i organismene, og som er giftige. Når en forbindelse ikke blir brutt ned i en organisme, men blir lagret, blir det over tid mer og mer av den i organismen, den hoper seg opp. Vi sier da at stoffet blir bioakkumulert. Stoffer kan også regnes som miljøgifter dersom de er svært lite nedbrytbare og svært lett bioakkumuleres, selv om de ikke har en kjent giftvirkning. Skader fra miljøgifter er alvorlige og omfatter nedsatt immunforsvar og reproduksjons­ evne, høyere dødelighet hos avkommet, kreft og skader på arvestoffet. Vanlige grupper av miljøgifter er tungmetaller, organiske miljøgifter og radioaktive stoffer. Eksempler på tungmetaller er kvikksølv, bly og kadmium. Organiske miljøgifter er for eksempel klorerte hydrokarboner som PCB, DDT og dioksiner, PAH-er (polyaromatiske hydrokarboner), bromerte flammehemmere og PFOSforbindelser (perfluorerte og polyfluorerte organiske forbindelser). Eksempler på radioaktive stoffer er isotopene cesium-137, technetium-99 og plutonium-239/240. Noen miljøgifter kan spres over store avstander med luft- og havstrømmer, og slik kan de forurense andre steder enn der de ble sluppet ut. Mange miljøgifter har slik endt opp i sårbare områder som Arktis, for eksempel kvikksølv og PCB. Med unntak av PFOS-forbindelsene er organiske miljøgifter generelt fettløselige. Det vil si at de lagrer seg i fettvevet i organismene. Stoffer som ikke er fettløselige, kan lagres andre steder i kroppen. For eksempel kan PFOS-relaterte forbindelser binde seg til proteiner i blod og bioakkumuleres i lever og galle­ blære. Metylkvikksølv blir hovedsakelig lagret i nyrene og i hjernen. Kadmium blir lagret i nyrene og kan gi kroniske nyreskader. I pattedyr blir bly akkumulert i skjelettet og i bløtvev. Selv utslipp av små mengder miljøgift kan få alvorlige konsekvenser for dyr langt opp i næringskjeden dersom giften blir lagret i organismene. En slik oppkonsentrering av giftstoff i en nærings­kjede kalles biomagnifisering. Siden stoffene ikke er naturlige, har heller ikke organismer utviklet enzymer som kan bryte dem ned, og miljøgiftene blir lagret i organismene. Oppkonsentreringen skjer fordi biomassen på hvert trofisk nivå blir til ved å spise en mye større biomasse av nivået under. Jo lengre næringskjeden er, desto større blir oppkonsentreringen av giftstoffer.


82 • Kapittel 2

Biomagnifisering. En mengde miljøgift som er svært liten når den blir sluppet ut, kan få alvorlige konsekvenser for dyr langt opp i næringskjeden dersom den lagres i organismene. Desto blåere, desto høyere konsentrasjon av giftstoffet.

Isbjørn

Ringsel

Torsk

Reke

Plankton

Miljøgifter kan også overføres fra en generasjon til den neste. Det er funnet miljøgifter i melken til pattedyr, inkludert mennesket, og pattedyrunger kan også få overført miljøgifter via morkaka. Dersom miljøgifter fører til endring av DNA i kjønnscellene, kan også endringene overføres til neste generasjon. Norge har som mål å stanse utslippene av tretti prioriterte miljøgifter innen 2020. Insektmiddelet DDT ble brukt i enorme mengder fra midten av andre verdens­krig og fram til 1972, og det ble i utgangspunktet sett på som ufarlig. Men den amerikanske forfatteren Rachel Carson hadde lagt merke til at populasjonene av svært mange sangfugler var gått sterkt tilbake. Hun mente at det kunne skyldes nettopp bruken av DDT. Hennes bok Den tause våren vakte enorm oppsikt og førte til at problemet med miljøgifter som DDT kom i fokus i miljødebatten. Boka kom ut i 1962, og i 1972 ble det innført forbud mot DDT i den vestlige verden.

Sjekkpunkter: Nye ord og faguttrykk: bioakkumulasjon, biomagnifisering Gi to eksempler på miljøgifter. Forklar hvordan en miljøgift kan bioakkumuleres i en organisme. Gi et eksempel på hvor en ikke-fettløselig miljøgift kan lagres i en organisme. Hvorfor skjer det en oppkonsentrering av giftstoff i en næringskjede?


Økologi • 83

Ozonlaget Ozonlaget beskytter livet på jorda mot skadelig ultrafiolett stråling. Det ligger i stratosfæren ca. mellom 15 og 35 km over jordoverflaten og har en høyere konsentrasjon av ozon enn resten av atmosfæren. Ozon er O3-molekyler. Fra 1975 til slutten av 1990-årene ble ozonlaget gradvis tynnere på grunn av utslipp av ozonreduserende stoffer som KFK og haloner. I dag har bruken av slike stoffer blitt kraftig redusert. Ozonlaget har stabilisert seg, og er gradvis på vei tilbake til sin opprinnelige størrelse. Det er likevel ikke før i 2050–2070 at det antas å være slik det var. Montrealprotokollen av 1987 er en forpliktende, internasjonal avtale om beskyttelse av ozonlaget, og alle land i verden har undertegnet denne avtalen. Det er takket være verdenssamfunnets oppfølging av denne protokollen at utslippene av de ozonreduserende stoffene har avtatt. Et tynnere ozonlag fører til at større doser skadelig ultrafiolett stråling når jordoverflaten. Det har igjen konsekvenser for livet på jorda og kan føre til flere tilfeller av kreft, infeksjonssykdommer og øyeskader. Det kan også redusere produksjonen av organisk materiale fordi det skader produsentene. Det får igjen konsekvenser for næringskjedene og for matvareproduksjonen på jorda. Klimaendringer kan påvirke gjenoppbyggingen av ozonlaget, men det er usikkert hvordan. Økt drivhuseffekt øker temperaturen i den laveste delen av atmosfæren, men senker temperaturen i den øverste delen av atmosfæren, stratosfæren, der ozonlaget befinner seg. Svært lave temperaturer i stratosfæren øker nedbrytingen av ozonlaget. Økt drivhuseffekt øker altså nedbrytingen av ozonlaget. Ozon er i seg selv en klimagass, slik at en nedbryting av ozonlaget kan redusere drivhuseffekten. Redusert ozonlag kan også forårsake økt UVB-stråling. Det kan igjen føre til nedbryting av klimagassen metan og dermed redusere drivhuseffekten.

Sur nedbør Sur nedbør skyldes utslipp av svovel- og nitrogenforbindelser. Det forsurer vann og vassdrag og kan føre til at vannet blir for surt til at det kan leve fisk der. Også levevilkårene til andre dyr og planter kan bli påvirket. Store kutt i utslippene, særlig av svovelforbindelser, har ført til at problemet med sur nedbør nå er blitt betydelig mindre enn problemet var fra 1970- til 1990-årene. Likevel er forsuring fremdeles et stort miljøproblem. Store områder i Sør-Norge er fortsatt utsatt for og skadet av sur nedbør. Sur nedbør i Norge kommer hovedsakelig fra land i Europa. Siden sur nedbør kan ramme andre steder eller land langt fra der utslippet skjedde, er det viktig med internasjonale avtaler for å begrense utslippene. I dag finnes det flere forpliktende konvensjoner og protokoller som de fleste europeiske landene har undertegnet for å begrense utslippene ytterligere. Et tankekors er likevel at selv om det er kutt i utslippene av særlig svovelforbindelser, har mengden av CO2 økt, og også det fører til surere vann.


84 • Kapittel 2

Sjekkpunkter: Nye ord og faguttrykk: ozonlaget Hva er Montrealprotokollen? Gi to eksempler på konsekvenser av et tynnere ozonlag. Hva skyldes sur nedbør? Hvorfor er problemene med sur nedbør mindre i dag enn tidligere?

Trusler mot det biologiske mangfoldet

Arealendinger. At leve­ områder blir stykket opp eller redusert kan være en trussel mot det biologiske mang­ foldet. Kartene viser villmarks­ pregede områder i Norge fra 1900 til 2014 (områder som ligger fem kilometer eller mer i horisontalplanet fra tyngre tekniske inngrep). Kilde: Bruun, Magne; NOU 1986:13 (1900 og 1940), Direktoratet for naturforvaltning / Miljødirektoratet (1988 og 2014) Villmarkspregede områder i Norge 1900

1900

Biologisk mangfold er summen av all den variasjonen vi finner i den levende delen av naturen. Vi kan dele det biologiske mangfoldet inn i tre nivåer: mangfoldet av gener, mangfoldet av ulike arter og mangfoldet av økosystemer på jorda. I dag er det flere forhold som truer det biologiske mangfoldet på jorda. Mange forskere mener vi er på randen av en ny masseutryddelse, så det er stor fare for at vi er i ferd med å gjøre jorda til et biologisk sett fattigere sted å være. Vi gir her en kort oppsummering av de viktigste truslene mot det biologiske mangfoldet, men du kan lese mer om biologisk mangfold i Bi1, kapittel 1. Vi kan sammenfatte de viktigste truslene mot det biologiske mangfoldet slik: • Fysiske inngrep som fører til at leveområder blir ødelagt eller stykket opp • Tap av genetisk mangfold • Overbeskatning av biologiske ressurser • Innføring av fremmede arter, også genmodifiserte organismer • Forurensning og miljøgifter • Klimaendringer som skyldes menneskelig aktivitet • Økonomisk vekst, som en årsak til mange av de andre punktene Villmarkspregede områder i Norge 1940

1940

Villmarkspregede områder i Norge 1988

1988

Villmarkspregede områder i Norge 2013

2013

Kilde: Bruun, Magne, NOU-1986 Kilde: Bruun, Magne, NOU-1986 Kilde: Bruun, Magne, NOU-1986 Kilde: Bruun, Magne, NOU-1986 INON-produksjon 2013-14, Miljødirektoratet. Redaksjonell bearbeiding og grafisk INON-produksjon produksjon Asplan 2013-14, ViakMiljødirektoratet. AS 2014 Redaksjonell bearbeiding og INON-produksjon grafisk produksjon2013-14, Asplan Viak Miljødirektoratet. AS 2014 Redaksjonell bearbeiding ogINON-produksjon grafisk produksjon2013-14, Asplan Viak Miljødirektoratet. AS 2014 Redaksjonell bearbeiding og grafisk produksjon Asplan Viak AS 2014 Målestokk: 1:7.000.000 Målestokk: 1:7.000.000 Målestokk: 1:7.000.000 Målestokk: 1:7.000.000


Økologi • 85

Som vi har sett tidligere i kapittelet, blir det stadig flere mennesker på jorda. Det fører igjen til at vi trenger mer plass til å leve på og flere og flere ressurser for å opprettholde liv og levestandard. Dette fører til et enormt press på alle de andre artene vi deler jorda med, og fører blant annet til problemene over. I norske områder er fysiske inngrep og ødeleggelse av leveområder den alvorligste trusselen mot det biologiske mangfoldet. Av de truede artene i Norge er 87 % påvirket negativt av menneskeskapte endringer i områdene der artene lever. I tillegg er seks prosent truet på grunn av forurensninger og seks prosent på grunn av klimaendringer. I hele verden utrydder vi arter både for å skaffe plass til oss selv og for å skaffe mat. Det har ført til og fører fremdeles til at vi overbeskatter artene rundt oss, det vil si at vi utnytter en større del av en populasjon enn den naturlig klarer å gjenoppbygge, slik at individantallet i populasjonen synker. Vi finner mange eksempler på populasjoner som har blitt overbeskattet. Norsk vårgytende sild hadde et sammenbrudd rundt 1970, mengden kysttorsk avtok fra 1994 til 2003 og har deretter holdt seg på et lavt nivå, kystsel har i dag kvoteregulert fangst på grunn av for sterk beskatning tidligere, og det drives ikke lenger kommersiell fangst av hval i Norge, med unntak av vågehval. Dette er bare noen eksempler fra Norge, og lista er lang, både her hjemme og i resten av verden. Noen arter klarer å bygge opp populasjoner igjen etter et sammenbrudd på grunn av overbeskatning, mens andre har dødd ut på grunn av for sterk beskatning. Et eksempel på det siste er geirfuglen (Pinguinus impennis), som døde ut på grunn av menneskelig jakt ca. 1850. Andre arter er i dag kritisk truet, som det svarte neshornet (Diceros bicornis). Uttrykket «the Hundred Heartbeat club» ble tatt i bruk av biolog E.O. Wilson og blir brukt om arter som har færre enn hundre gjenlevende individer.

For å opprettholde økonomisk vekst, og samtidig sørge for at miljøet ikke blir utnyttet mer enn det som er forsvarlig, forsøker en i dag å følge prinsippet om bærekraftig utvikling. Bærekraftig utvikling har som mål at dagens behov skal kunne dekkes, samtidig som framtidige generasjoner skal få mulighet til å få dekket sine behov. Som et ledd i dette har en blant annet opprettet klima­kvoter og kvoter for fangst av forskjellige dyr. Bak all forvaltning av naturen bør også føre var-prinsippet brukes. Dette prinsippet går ut på at dersom det er tvil om en handling får konsekvenser som er alvorlige for miljøet der handlingen skal skje, skal vi handle slik at vi unngår alvorlig skade på miljøet, selv om det ikke foreligger fullstendig vitenskapelig visshet om omfang og konsekvenser av problemet. «Føre var» kommer av det gamle uttrykket «bedre føre var enn etter snar». Som et eksempel skal det ikke fiskes mer av en populasjon av fisk enn at fiskedødeligheten er under et føre var-nivå. Det vil si at vi ikke fisker mer enn det populasjonen klarer å reprodusere, slik at populasjonen ikke synker over tid. Da sier vi at populasjonen høstes bærekraftig. Føre var-prinsippet blir brukt i mange internasjonale miljøvernavtaler i dag. Eksempler er Cartagena­protokollen om handel med og bruk av levende genmodifiserte organismer, Konvensjonen


86 • Kapittel 2

Javaneshorn (Rhinoceros sondaicus). Et av medlemmene i «the Hundred Heartbeat Club».

om biologisk mangfold, Stockholmkonvensjonen om persistente organiske forbindelser og i FN-avtalen om fiske på åpent hav. Det er ikke bare nasjoner som bør handle etter føre var-prinsippet. Også for kommuner, bedrifter, organisasjoner og enkeltmennesker bør dette prinsippet gjelde. Som bare ett individ av mange milliarder er det lett å tenke at ens egne handlinger ikke betyr noe i den store helheten. Men hvis alle handler etter føre var-prinsippet, monner summen av bidrag til sammen. Bare tenk på hvor stor makt forbrukerne har i dagens samfunn. Dersom alle lot være å kjøpe produkter fra utryddingstruede planter og dyr, ville etterspørselen ikke vært der, og de utryddingstruede artene fikk kanskje være i fred. Det svarte neshornet er for eksempel i dag først og fremst truet fordi det er stor etterspørsel etter hornet som feilaktig påstås å kurere en lang rekke medisinske lidelser. Det er viktig at vi som enkeltmennesker lar være å kjøpe produkter dersom vi er i tvil om de kommer fra utryddingstruede eller sårbare arter, og prøver å unngå produkter som vi vet øker forurensning eller forringer miljøet. Vi kan også bidra ved å redusere vårt eget forbruk. Tenke globalt, handle lokalt.

Sjekkpunkter: Nye ord og faguttrykk: overbeskatning, bærekraftig utvikling, føre var-prinsippet Hva er biologisk mangfold? Gi tre eksempler på trusler mot biologisk mangfold. Hva er den alvorligste trusselen mot det biologiske mangfoldet i norske områder? Gi et eksempel på en art som har blitt overbeskattet. Hvorfor er føre var-prinsippet så viktig? Nevn tre ting du kan gjøre for å bidra til å bevare det biologiske mangfoldet.


Økologi • 87

Sammendrag • Et økosystem er definert som et geografisk avgrenset område med både biotiske og abiotiske faktorer. • Samfunnet utgjør den biotiske delen av et økosystem og består av produsenter, konsumenter og nedbrytere. • Konkurranse innenfor samme art kalles intraspesifikk konkurranse, og konkurranse mellom forskjellige arter kalles interspesifikk konkurranse. • Det finnes flere metoder for å beregne populasjonsstørrelser, fangst-gjenfangstmetoden og ruteanalyse er to eksempler. • Det finnes ulike former for samspill mellom arter. Samspillet kan gå ut på konkurranse om de samme ressursene, det kan være samspill mellom rovdyr og byttedyr, beiting, symbiose eller gjennom sykdommer. • Dersom to ulike arter har overlappende nisjer, konkurrerer de i den delen av deres nisjer som overlapper. Den realiserte nisjen til en art kan dermed bli mindre enn den fundamentale nisjen. Ressursfordeling kan føre til at konkurransen mellom to arter med overlappende nisjer blir mindre. • Suksesjon er en gradvis, retningsbestemt endring av et økosystem over tid. Vi skiller mellom primær­ suksesjon og sekundærsuksesjon. Det er tre typer mekanismer for hvordan artene erstatter hverandre i en suksesjon. Når artssammensetningen i et område har blitt relativt stabil og det skjer få endringer i samfunnet, kaller vi det et klimaks­ samfunn. • Hvert ledd i en næringskjede kalles et trofisk nivå. Ca. 90 % av energien og biomassen forsvinner ut av næringskjeden for hvert trofisk nivå. • Karbon finnes i atmosfæren i uorganisk form som CO2 og gjøres om til organisk form i fotosyntesen. Karbon blir tilført atmosfæren igjen ved celle­ ånding fra alle levende organismer. Vulkaner er også en kilde til CO2. Mengden karbondioksid i atmosfæren har steget med mer enn 25 % de siste femti årene. Det skyldes i all hovedsak forbruk av fossilt brennstoff.

• Nitrogen inngår blant annet i aminosyrer, i ATP og DNA og RNA. Planter og alger kan ta opp ammonium (NH4+) eller nitrat (NO3-). Dyr kan bare bruke organiske former for nitrogen, de må spise andre organismer for å få i seg nitrogen. I et naturlig økosystem kommer nitrogenet fra tre kilder: nedbrytning av døde organismer, nitrogenbinding via bakterier, og som lynutladninger i atmosfæren. I tillegg tilfører mennesket store mengder nitrogen. • Vi sier at næringskjedene er lukkede kretsløp når det gjelder grunnstoffene, men åpne når det gjelder energi. • Menneskelig påvirkning av økosystemene inkluderer blant annet overgjødsling, klima­ endringer, miljøgifter, reduksjon av ozonlaget, sur nedbør og trusler mot det biologiske mangfoldet. • Overgjødsling skyldes blant annet utslipp av næringssalter fra fiskeoppdrett, avrenning fra jordbruksarealer, industri og kloakk. Konsekvenser av overgjødsling er opphoping av alger på bunnen, dårligere lysforhold nedover i vannet, hyppigere oppblomstringer av giftalger og redusert kvalitet på drikkevann og badevann. Det igjen kan føre til blant annet redusert biologisk mangfold. • Menneskelig aktivitet har ført til global oppvarming. Målinger viser at den globale middeltemperaturen har økt med ca. 0,85 °C fra 1880 til 2012. Middeltemperaturen på jorda kommer antakeligvis til å øke med mellom 0,3 °C og 4,8 °C innen 2100. Havnivået antas å stige mellom 26 og 82 cm. Global oppvarming kan blant annet føre til redusert biologisk mangfold og dårligere levevilkår for mange mennesker. • Når et stoff ikke blir brutt ned i en organisme, men blir lagret, hoper det over tid seg opp i organismen. Vi sier da at stoffet blir bioakkumulert. Oppkonsentrering av giftstoff i en næringskjede kalles biomagnifisering. Skader fra miljøgifter omfatter nedsatt immunforsvar og reproduksjons­ evne, høyere dødelighet hos avkommet, kreft og skader på arvestoffet.


Sammendrag • Fra 1975 til slutten av 1990-årene ble ozonlaget gradvis tynnere på grunn av utslipp av ozon­ reduserende stoffer som KFK og haloner. I dag har bruken av slike stoffer blitt kraftig redusert, og ozonlaget har stabilisert seg og er gradvis på vei tilbake til sin opprinnelige størrelse. Det er likevel ikke før i 2050–2070 at det antas å være slik det var. Klimaendringer kan påvirke gjenoppbyggingen av ozonlaget. • Sur nedbør skyldes utslipp av svovel- og nitrogen­ forbindelser. Det forsurer vann og vassdrag og kan føre til at vannet blir for surt til at fisk kan leve der. Også levevilkåra til andre dyr og planter kan bli påvirket. Store kutt i utslippene, særlig av svovel­ forbindelser, har ført til at problemet med sur nedbør nå er betydelig mindre enn problemet var fra 1970- til 1990-årene.

• Vi kan sammenfatte de viktigste truslene mot det biologiske mangfoldet slik: Fysiske inngrep som fører til at leveområder blir ødelagt eller stykket opp, tap av genetisk mangfold, overbeskatning av biologiske ressurser, innføring av fremmede arter, forurensning og miljøgifter og klimaendringer som skyldes menneskelig aktivitet. Økonomisk vekst er årsak til mange av de andre punktene. • Bærekraftig utvikling har som mål at dagens behov skal kunne dekkes, samtidig som framtidige generasjoner skal få mulighet til å få dekket sine behov. • Både nasjoner, kommuner, bedrifter, organisasjoner og enkeltmennesker bør handle etter føre-varprinsippet.


Økologi • 89

Oppgaver Tips til oppgavene finner du på www.gyldendal.no/bi 1 Trekk strek mellom faguttrykk og forklaring Faguttrykk

Definisjon

Økosystem

En gruppe individer av samme art som lever innenfor et avgrenset område

Biotiske faktorer

Konkurranse mellom forskjellige arter

Abiotiske faktorer

Organisme som spiser dødt organisk materiale

Biosfære

Miljøforhold som avhenger av tettheten av individene

Art

Et geografisk avgrenset område med både biotiske og abiotiske faktorer

Populasjon

Organismer som er avhengig av å bryte ned karbonforbindelser som andre har bygget opp

Samfunn

En samling individer som kan formere seg og få forplantningsdyktig avkom

Habitat

Ikke-levende faktorer

Biotop

Organisme som spiser en annen, levende, organisme

Produsent

Miljøforhold som påvirker populasjonen likt uavhengig av hvor mange som lever der

Autotrof

Stedet der vi finner et samfunn

Heterotrof

En organisme spiser hele eller deler av en annen organisme

Konsument

Alle populasjonene i et område. Den biotiske delen av et økosystem

Nedbryter

Stedet der en art finnes

Predator

Organismer som lager organiske molekyler fra uorganiske

Intraspesifikk konkurranse

Den delen av jorden der det finnes levende organismer

Interspesifikk konkurranse

Organisme som produserer organiske molekyler ved hjelp av solenergi eller kjemisk energi

Tetthetsavhengige miljøfaktorer

Levende faktorer

Tetthetsuavhengige miljøfaktorer

Konkurranse innenfor samme art


90 • Kapittel 2

Oppgaver 2 Lag en beskrivelse av ett av områdene på bildene under. Bruk følgende faguttrykk: økosystem, art, populasjon, samfunn, habitat, abiotiske miljøfaktorer, biotiske miljøfaktorer, produsenter, konsumenter, nedbrytere

5 Gi et eksempel som ikke står i boka, på a interspesifikk konkurranse b intraspesifikk konkurranse c tetthetsavhengige miljøfaktorer d tetthetsuavhengige miljøfaktorer 6 Dersom du spiser kjøtt du har kjøpt i butikken – er du da konsument eller nedbryter? Begrunn svaret ditt. 7 Hva må du undersøke dersom du lurer på hvorfor en art ikke finnes i et område? 8 Hvorfor kan rødalgene leve dypere enn brunalger i vann med partikler som absorberer blått lys? 9 Hvorfor er svært mange fisker mørke på oversiden og lyse i buken?

3 Kan et individ være både konsument og nedbryter? Begrunn svaret ditt. 4 Gi tre eksempler som ikke står i boka, på a Produsenter b Konsumenter c Nedbrytere

10 Mye dyreplankton vandrer opp til overflaten om natten og synker ned mot bunnen om dagen. Hva kan være årsaken til denne døgnvandringen?


Økologi • 91

11 Lag en tabell over fire ulike måter man kan beregne populasjonsstørrelser på, og gi ett eksempel på en type organisme som hver av metodene egner seg for.

Rute nr

Antall individer

1

10

2

20

3

9

4

2

5

21

6

25

7

3

8

7

13 Tenk deg at du skal studere en blomsterart på en eng:

9

10

a Beskriv hvordan du ville gått fram dersom du ville beregne populasjonsstørrelsen eller tettheten av denne arten på engen.

10

12

11

35

12

2

b Hvilke svakheter er det ved metoden?

13

1

c Hva ville du gjort for å begrense feilkildene?

14

19

15

19

12 Tenk deg at du skal studere en fugleart i et skogsområde: a Beskriv hvordan du ville gått fram dersom du ville beregne populasjonsstørrelsen av denne fuglearten i skogsområdet. b Hvilke svakheter er det ved metoden? c Hva ville du gjort for å begrense feilkildene?

14 I et vann lever det en fiskeart. For å beregne populasjonsstørrelsen av arten fanger du 367 fisk, merker dem og slipper dem ut i vannet igjen. Etter en tid fanger du igjen fiskearten i det samme vannet og på den samme måten. Denne gangen fanger du 423 fisk, og av disse er 97 merkede. Omtrent hvor stor regner du med at populasjonen er? 15 Du vil beregne populasjonsstørrelsen av en fugleart i et område. Du fanger, merker og slipper ut igjen 57 fugler. Etter en tid fanger du igjen fuglearten i det samme området og på den samme måten. Denne gangen fanger du 69 fugler, og av disse er 26 merkede. Hvor stor regner du omtrent med at populasjonen er? 16 Du vil finne ut hvor mange individer det lever av en planteart på en eng. Du bruker en ruteanalyse med ruter på 1 x 1 m, og teller antall individer i 15 ruter som du har spredt tilfeldig utover på enga. Resultatene av rute­analysene ser du i tabellen øverst til høyre. Du beregner hele området til å være på ca. 100 m2. Omtrent hvor mange individer av denne arten lever det på denne enga, ifølge dine beregninger?

17 I et skogholt vokser det hvitveis (Anemone nemorosa) om våren. Du er interessert i å finne ut hvor stor del av skogholtet som er dekket av hvitveis, og gjør derfor en ruteanalyse. Du teller dekningsgraden av hvitveis i 10 ruter tilfeldig fordelt i området og får følgende resultat: Rute nr

Dekningsgrad

1

20 %

2

15 %

3

0%

4

80 %

5

100 %

6

5%

7

50 %

8

30 %

9

20 %

10

30 %

Basert på resultatene dine: Hvor stor del av arealet i skog­holtet regner du omtrent med er dekket av hvitveis om våren? 18 Noen arter lever i flokk. Hvilke problemer kan være forbundet ved å beregne populasjonsstørrelsen til flokkdyr?


92 • Kapittel 2

Oppgaver 20 Hva skjer dersom to ulike arter har delvis overlappende nisjer?

24 Lag graf(er) som viser hva som kan skje dersom to arter med overlappende nisjer plasseres i det samme området.

21 Hva skjer dersom to ulike arter har helt overlappende nisjer?

25 a Hva er ressursfordeling?

19 Forklar hva som menes med en arts nisje.

22 Studer figuren under og forklar hva som har skjedd. Bruk faguttrykk i forklaringen din.

Antall individer

a) Utvikling av en populasjon. P. aurelia (alene)

0

2

4

6

8

10

12

14

16 18 Tid (døgn)

b) Utvikling av en populasjon. P. caudatum (alene)

b Hvordan kan ressursfordeling oppstå? c Hvorfor er ressursfordeling en fordel for artene? 26 Det viser seg at dersom arter med overlappende nisjer lever i samme område, er de utseendemessig mer forskjellig fra hverandre enn om de lever i adskilte områder. Forklar hvorfor dette er tilfelle, og hvilken fordel det gir artene når de lever sammen. 27 Lag en tabell over ulike former for samspill mellom to arter. Vis i tabellen om samspillet er en fordel eller ulempe for artene som deltar i samspillet. Gi også et eksempel på hver form for samspill.

Antall individer

28 Forklar hvorfor sykdom er en viktig tetthetsavhengig faktor. 29 a Forklar hva suksesjon er. 0

2

4

6

8

10

12

14

16 18 Tid (døgn)

Antall individer

c) Utvikling av populasjonene sammen

b Tegn et bilde over hvordan en hogstflate i en skog endrer seg over tid. Lag en forklaring til tegningen din der disse faguttrykkene inngår: jordsmonn, sekundærsuksesjon, r-selekterte arter, K-selekterte arter, konkurranse, formering, klimaksfase. hovedforskjellen på aurelia en primærTo 30 Hva arter av er tøffeldyr, Paramecium og og en Paramecium caudatum, konkurrerer mye om sekundærsuksesjon? ressursene. Bare den ene overlever når de lever sammen.

31 Hvilke arter kommer først ved en primærsuksesjon i terrestriske miljøer? Forklar hvorfor.

0

2

4

6

8

10

12

14

16 18 Tid (døgn)

32 Forklar hvorfor det er flest r-selekterte arter tidlig i en suksesjon og flest K-selekterte arter senere.

23 Forklar figuren ved hjelp av følgende faguttrykk: fundamental nisje, realisert nisje, overlappende nisje, interspesifikk konkurranse, tilpasning Øvre flomål Chthamalus realisert nisje

Normal situasjon

Øvre flomål

Chthamalus Fjærerur Chthamalus fundamental nisje

Fjærerur realisert nisje

Nedre fjæremål

Nedre fjæremål

Etter fjerning av fjærerur


Økologi • 93

33 På hvilke måter kan en art påvirke arter som kommer etter den i en suksesjon? Lag en tabell og gi et eksempel på hver måte.

36 Kan en organisme være på flere trofiske nivå? Begrunn svaret ditt og gi et eksempel. 37 a Hva er en nøkkelart?

34 Hva er trofisk nivå?

b Gi et eksempel på en nøkkelart og begrunn hvorfor den er en nøkkelart.

35 a Tegn en næringskjede med 5 ledd. b Skriv under hver av organismene i næringskjeden din hvilket trofisk nivå de befinner seg på (for eksempel primærkonsument). c Hvor mange trofiske nivå har du i kjeden din?

38 Sammenlikn energistrøm gjennom en næringskjede med et av grunnstoffenes kretsløp gjennom denne næringskjeden. 39 Studer næringsnettet under.

d Tegn inn på figuren hvor mye energi som overføres fra ett trofisk nivå til det neste, og hvor mye som tapes fra næringskjeden.

a På hvilket trofisk nivå befinner planteplanktonet seg? b På hvilket trofisk nivå befinner polartorsken seg?

e Hva går energien som tapes, til?

c På hvilket trofisk nivå befinner selen seg?

f Bruk dette til å forklare hvorfor det finnes færre rovdyr enn produsenter.

d Hvordan tror du det ville påvirket de andre populasjonene i næringsnettet dersom loddepopulasjonen ble veldig liten?

g Bruk dette til å forklare hvorfor næringskjeder sjelden har mer enn 4 eller 5 ledd dersom vi ser bort fra nedbryterne.

40 Lag en tegning som viser hvordan karbonet sirkulerer i et økosystem. Skriv en forklarende tekst til tegningen din.

h Hvor mange kilo må du omtrent ha av produsenten i næringskjeden du har tegnet, for å produsere én kg av organismen i ledd nr 5?

Fugl

Fiskebåt Planteplankton

Dyreplankton (raudåte, krill, amfipoder, etc)

Polartorsk

Sild

Sel

Lodde

Spekkhogger

Torsk

Reke

Bunnorganismer


94 • Kapittel 2

Oppgaver 41 Hvorfor blir havet surere når mengden karbondioksid i atmosfæren øker? Bruk passende kjemiske likevekter som en del av forklaringen din. 42 Hva trenger organismene nitrogen til? 43 Hvilke former for nitrogen kan ulike organismer ta opp? 44 Hvor kommer nitrogenet i et økosystem naturlig fra? 45 Atmosfæren består av ca. 78 % nitrogengass. Hvorfor kan ikke plantene bruke dette nitrogenet direkte? 46 Hvordan bidrar menneskene til økt nitrogenutslipp til økosystemene? 47 Lag en tegning som viser hvordan nitrogenet sirkulerer i et økosystem. Skriv en forklarende tekst til tegningen din. 48 a Hva er overgjødsling? b Hvor kommer næringssaltene i overgjødslingen fra? c Hva kan overgjødsling føre til? d Hvilke tiltak bør gjennomføres for å begrense overgjødslingen? 49 Forklar hva en klimagass er, og gi tre eksempler på ulike klimagasser. 50 Forklar drivhuseffekten ved hjelp av en figur. 51 Har karbondioksid, metan eller lystgass høyest GWPverdi? Hva betyr dette? 52 Forklar hva som er årsakene til den globale oppvarmingen.

53 Fyll ut tabellen om klimaendringer fram til i dag: Fysisk faktor

Endring

Global middeltemperatur Havoverflate Havnivå Forsuring av havet Havisutbredelse i Arktis Snødekke på den nordlige halvkule 54 Forklar hvorfor surere hav kan være et problem for dyrene i havet. 55 Tenk deg at du skal skrive et innlegg i en avis der du skal overbevise politikerne om at det skjer en global oppvarming, og hvorfor dette kan få alvorlige konsekvenser for menneskene. Skriv innlegget. 56 Lag en liste over seks viktige konsekvenser av global oppvarming. 57 Lag en liste over minst 5 ting du kan gjøre for å redusere utslippene av klimagasser. Sammenlikn listen din med de andre i klassen sine lister. Hvor mange punkter får dere alt i alt? 58 Forklar hva en miljøgift er. 59 Hva er forskjellen på bioakkumulering og biomagnifisering? 60 Vis med en figur hvorfor konsekvensene av miljøgifter er mer alvorlige for dyr lenger opp i næringskjeden. Hvis det for eksempel slippes ut 100 gram av et giftig stoff, hvorfor kan det få større konsekvenser for en rovfisk enn for et dyreplankton?


Økologi • 95

61 Fyll ut tabellen: Problem

Årsak til problemet

Biologisk konsekvens

Tiltak for å løse problemet

Tynnere ozonlag Sur nedbør 62 Fyll ut tabellen: Trussel mot biologisk mangfold

Eksempel på årsak til problemet

Eksempel på mulig tiltak mot problemet

Overbeskatning av biologiske ressurser Fysiske inngrep som fører til at leveområder blir ødelagt eller stykkes opp Tap av genetisk mangfold Innføring av fremmede arter, også genmodifiserte organismer Forurensning og miljøgifter Klimaendringer som skyldes menneskelig aktivitet

63 Forklar hvorfor økonomisk vekst kan være en årsak til mange av de andre truslene mot biologisk mangfold. 64 Lag en prioritert liste over de fem alvorligste menneskelige påvirkningene av økosystemene. Begrunn prioriteringen din. 65 Hva betyr det dersom man sier at man høster en fiskepopulasjon bærekraftig? 65 Gi et eksempel på en situasjon der det er viktig å bruke føre-var-prinsippet.

66 Eksamensoppgave, 2005 Ta utgangspunkt i det økosystemet du kjenner best. Velg to abiotiske faktorer. a Forklar hvordan du kan måle dem. b Forklar hvordan de to faktorene varierer med årstiden. c Forklar hvilke forskjeller det vil være i de to faktorene på ulike høyder eller på ulike dyp i det økosystemet du har valgt.


96 • Kapittel 2

Oppgaver

prosent økning (%)

67 Eksamensoppgave, 2004 (endret)

1976

80

1977

1978

70 60 50 40 30 20 10 0 j f ma m j j a s o n d j f ma m j j a s o n d j f ma m j j a s o n d

måned

tallet på individer

1976

1977

1978

1400 1200 1000 800 600 400 200 j f ma m j j a s o n d j f ma m j j a s o n d j f ma m j j a s o n d

måned

tilgjengelig frømengde (g/m2)

1976

1977

1978

12 10

Tørke førte til lynrask utvikling I 1977 kom det usedvanlig lite nedbør på Daphne, den minste av Galápagosøyene. Små planter med grunne røtter fikk ikke laget frø det året, og mange av plantene tørket ut og døde. For den frøspisende ”Darwinfinken” Geospiza fortis ble det vanskelig å finne nok mat. G. fortis spiser helst små frø med tynne skall. Disse frøene ble nes­ ten helt borte. Det som var tilbake, var store frø med tykke skall som var mye vanskeligere å knekke. Ornitologene Peter og Rosemary Grant hadde stu­ dert fuglene på øya Daphne i mange år, og nå ble de vitne til noe overraskende: I løpet av bare to år ble Geospiza fortis i gjennomsnitt mye større og fikk mye kraftigere nebb.

8 6 4 2 j f ma m j j a s o n d j f ma m j j a s o n d j f ma m j j a s o n d

Kilde for opplysningene om Geospiza spp. i denne oppgaven: Peter R.Grant, Ecology and Evolution of Darwin’s Finches, Princeton Science Library, 1986

måned

store frø med tykt skall

små frø med tynt skall

1976

1977

1978

a Studer teksten og diagrammene. Bruk dette til å forklare hva som skjedde med populasjonen av G. fortis på øya Daphne, og hvordan fuglene kunne tilpasse seg en ny type næring. b En annen finkeart som kalles G. scandens, konkurrerer med G. fortis om de mindre frøene, men G. scandens spiser også mye billelarver og pupper. Hvordan kan tørkeperioden tenkes å ha påvirket forholdet mellom de to artene?

j f ma m j j a s o n d j f ma m j j a s o n d j f ma m j j a s o n d

måned


Økologi • 97

Nett-, gruppe- og presentasjonsoppgaver 68 a Finn ut hvordan malariaparasitten lever, og beskriv livssyklusen dens, gjerne med en tegning. b Hvordan blir mennesket smittet av denne parasitten? c Hva er symptomene på at en person har fått malaria? Hvordan kan man bli frisk av malaria? d Hvor mange mennesker smittes årlig av malaria, og hvor mange dør årlig som følge av sykdommen? 69 Velg deg ut en konsument og en produsent i samme økosystem. Finn ut hvordan de har tilpasset seg til å leve akkurat der de gjør. 70 Finn et byttedyr og en predator som lever i samme økosystem. Finn ut hvordan disse har tilpasset seg, byttedyret for å slippe unna rovdyrene og rovdyret for å bli bedre til å fange byttedyr. 71 Finn ut mer om bleking av korallrev og hva det kan føre til. 72 Lag et rollespill der dere er tre stykker som skal delta i et debattprogram på tv. Debattprogrammet heter global oppvarming – skremselspropaganda eller fakta? En av dere skal spille en som ikke tror på at det har skjedd en global oppvarming, en skal spille en miljøaktivist og en skal spille en klimaforsker. Dere kan også ha en programleder. Forbered hvert deres innlegg og hold debatten. 73 Lag et rollespill der du skal delta i en debatt om oljeboring i Lofoten. Det er tre personer som skal delta i debatten: en forvalter/forsker, en fra et oljeselskap og en fra en miljøvernorganisasjon. Fordel rollene, og lag en liste over argumenter for en av de tre deltakerne, og gjennomfør debatten. En person kan eventuelt ha rolle som programleder.

74 Nedenfor ser du en liste over noen miljøgifter. – kvikksølv – bly – kadmium – PCB – DDT – PAH-er (polyaromatiske hydrokarboner) – bromerte flammehemmere – PFOS-forbindelser (perfluorerte og polyfluorerte organiske forbindelser) – cesium-137 Velg deg ut en av dem og finn ut mer om giften. Du kan for eksempel finne ut: a Hvor i organismen hoper miljøgiften seg opp? b Hvordan blir organismene påvirket av denne miljøgiften? c I hvilke områder er det påvist forekomster av stoffet? d Hvor brukes stoffet? 75 Finn ut mer om en art som er utryddingstruet i dag. Forklar hvorfor den er utryddingstruet, og hva som kan gjøres for å hindre at den dør ut. 76 Gå i butikken og finn et fiskeprodukt der firmaet reklamerer med at det er drevet bærekraftig fiske. Finn ut mer om firmaet. 77 Finn ut mer om CITES-registrerte produkter. Prøv å finne et produkt på nettet som inneholder truede arter. 78 Gå inn på www.miljostatus.no og søk på kart over klimaendringer. Hver gruppe velger seg ett område. Lag en kort oppsummering av konsekvensene av klimaendringene i deres område. Presenter oppsummeringen deres for resten av klassen.

Korte foredrag • Lévy Walks

• Nordmenns forbruksvaner

• Hovedtrekkene fra FNs klimapanels (IPCC) siste hovedrapport

• Mitt CO2-forbruk i forhold til mennesker i resten av verden

• The Hundred Heartbeat club

• Er torsken en utryddingstruet art?

• Fjellreven – hvorfor er den truet, og hvordan kan vi bevare den? • Den verste parasitten jeg kunne tenke meg


3

Fra gen til protein Ord og faguttrykk du bør kunne før du begynner på kapitlet

• eukaryot

• ribosom

• prokaryot

• bæreprotein

• cellekjerne

• reseptor

• cytosol

• enzym

Mål for dette kapitlet er at du skal kunne • forklare strukturen til DNA • gjøre greie for transkripsjon og translasjon av gener • forklare hvordan regulering av gener kan styre biologiske prosesser • forklare hvordan den genetiske sammensetningen blir endret gjennom mutasjoner


100 • Kapittel 3

3 DNA – Deoksyribo Nucleic Acid

Proteiner er noen av de viktigste store molekylene i en organisme. Når du ser et dyr, er det ofte proteiner som hud, hår, negler og andre strukturproteiner du ser. Og når du trekker noen til deg, så er det proteiner i musklene dine som gjør det. Det er også proteiner som har den fininnstilte kontrollen over hvordan stoffer blir brutt ned og bygd opp i en enkelt celle. Proteiner blir laget etter oppskrift i DNA.

3.1 DNA I eukaryote celler ligger DNA inne i cellekjernen, skilt fra resten av cellen. I tillegg har mitokondrier og kloroplaster et eget DNA. Prokaryote celler mangler cellekjerne og andre membranavgrensede organeller, men DNA ligger likevel samlet i et bestemt område i cellens cytosol. DNA i eukaryote celler er lineært, mens det er sirkulært i prokaryote celler. DNA har samme kjemiske oppbygning og samme funksjon i alle organismer. Informasjonen om egenskapene til cellen og individet ligger i DNA, og denne informasjonen blir overført til nye celler og til nye organismer (avkom). All nedarvet informasjon kodet i DNA kalles organismens genom. DNA er et stort molekyl bygd opp av små enheter som kalles nukleotider. Nukleotidene består av tre deler: et sukkermolekyl (deoksyribose), en fosfat­ gruppe og en nitrogenbase. Basen er enten adenin (A), tymin (T), cytosin (C) eller guanin (G). Nukleotidene er bundet til hverandre og bygger en enkel DNA-tråd. DNA-molekylet består av to DNA-tråder. DNA-trådene er rettet hver sin vei og har fått navn etter hvilken vei de peker. Navnet på DNA-tråden viser til hvilket karbon på sukkermolekylet fosfatet er bundet, se figuren på neste side. Den ene tråden sier vi går i retningen fem-merket til tre-merket (5’→ 3’), mens den andre går i retningen tre-merket til fem-merket (3’→ 5’).

Modell av DNA.


Fra gen til protein • 101

5’ ende

Hydrogenbindinger

O -O

P

OH

3’ ende

O H2C5´

O

O -O

T

A 1´

O

OH 3´

O

5’CH2

O

P O H2C

G

O

O

C O

O -O

O

C

O

O

G O

-O

O

O

P H2C

P

O

O

P O

A

O

1´ 3´

OH

T 1´

Nitrogenbase

O

Deoksyribose

3’ ende

O

P

OO

4´ 5’CH2

O HO

Fosfat

O-

CH2

O

H2C5´

O-

CH2

O

O

P

Oppbygning av et DNAmolekyl. DNA-molekylet er bygd opp av nukleotider. Et nukleotid består av en fosfatgruppe, en deoksyribose og en nitrogenbase som enten er adenin (A), tymin (T), cytosin (C) eller guanin (G).

P

OO

5’ ende

DNA er en dobbeltspiral 04_01 DNA-molekylet

Vi kan sammenlikne DNA-et med en trapp som snor seg rundt og rundt. De to DNA-trådene i DNA-et utgjør en dobbeltspiral kalt DNA-dobbelheliks, se figuren på neste side. «Rekk­verket» i trappen er et repeterende mønster av sukker – fosfat – sukker – fosfat – osv. bundet til hverandre med kovalente bindinger. Fosfatgruppen har negativ ladning og gjør DNA til et negativt ladet molekyl. Til hvert sukkermolekyl er det festet en base (A, T, G eller C), og basene peker inn mot sentrum av DNA. Hver base på den ene DNA-tråden er bundet til en base på den andre DNA-tråden med hydrogenbindinger. Sammen danner basene «trinnene» i trappen. Det er alltid slik at basen A er bundet til T med to hydrogenbindinger, og basen C er bundet til G med tre hydrogenbindinger. Siden A og T alltid går sammen til et basepar, sier vi at disse basene er komplementære. Det samme gjelder for C og G, også de er komplemen­tære. Det er hydrogenbindingene mellom de komplementære basene som gjør DNA-molekylet til en stabil dobbeltspiral.

helix (gr.) – spiral

Baseparregel: A baseparer alltid med T, og C baseparer alltid med G complere (lat.) – utfylle


102 • Kapittel 3

DNA-dobbelheliks. Rekkverket i «DNA-trappen», her tegnet i blått, består av sukker og fosfat bundet til hverandre i et repeterende mønster. Trappetrinnene er nitrogenbasene adenin (A), tymin (T), cytosin (C) eller guanin (G). Adenin (A) base­ parer alltid med tymin (T), og cytosin (C) baseparer alltid med guanin (G). Mellom hvert basepar er avstanden 0,34 nm (1 nanometer = 10–9 m). For de fleste DNAmolekyler er en fullstendig runde av DNA-dobbelheliksen 3,4 nm og har plass til ti basepar.

5’

3’

C T

G

A

G

C

C

G T

A A

3,4 nm

T C

G G

C

A

T

DNA-grop

C C T A

C

G

G

A T

Basepar

G G

5’

0,34 nm

C 3’

04_02 DNA-dobbelheliks DNA er organisert i kromosomer

chroma (gr.) – farge soma (gr.) – kropp

Oppbygning av en bakterie. I bakteriens cytosol ligger bakteriekromosomet, plasmider og ribosomer. På figuren ser du også ytre strukturer som cellevegg, pilus og flageller.

Det sirkulære DNA-et i prokaryote celler kalles bakteriekromosomet. Størrelsen på kromosomet varierer fra art til art. I tillegg har mange bakterier plasmider, som er små sirkulære DNA-molekyler med noen få gener. Plasmidene blir kopiert uavhengig av kromosomet, og antall plasmider i en prokaryot celle varierer fra én til flere hundre kopier. Plasmider inneholder gener som ofte ikke er livsviktige for cellen under normale vekstforhold, men de kan være fordel­ aktige å ha dersom miljøet endrer seg. For prokaryote celler er det totale genomet både bakteriekromosomet og plasmidene. Ribosomer Plasmid Bakteriekromosom Cellemembran Cellevegg Kapsel

Bakterieflagell

Pilus


Fra gen til protein • 103

DNA i eukaryote celler er lineært og inneholder mange gener. I utstrakt tilstand ville alt DNA i en menneskecelle vært hele to meter – en lengde som er over 250 000 ganger større enn cellediameteren. For å beskytte og holde orden på det lange DNA-molekylet i eukaryote celler er DNA organisert i små enheter kalt kromosomer. Hvert kromosom består av et lineært DNA-molekyl som er kveilet rundt et proteinskjelett. Proteinene kalles histoner. Videre pakkes DNA og histonene tettere og tettere sammen. Resultatet blir en økende diameter og en kortere lengde av kromosomet. Pakkingen gjør det mulig for cellekjernen å inneholde så store mengder DNA. Vanligvis er kromosomene relativt tynne, lange tråder. Det siste nivået av pakkingen skjer like før celledeling. Hvert kromosom finnes da i to kopier, se side 136 i kapittel 4 Celledeling. Hver art har et karakteristisk antall kromosomer i cellene sine. Tabellen viser eksempler på kromosomantall fra noen organismer.

Kromosomantallet hos noen arter.

Art

Antall kromosomer

Menneske

46

Sjimpanse

48

Katt

38

Gullfisk

100

Bananflue

8

Erteplante

14

Jordbær­plante

56

Åkersnelle

148

Orme­tunge

344–1140

Bakterie

1

Cellekjerne

Celle rett før delingsfasen

Histoner Basepar T

AG C

A C T G T A

DNA

0408 Sjekkpunkter: Kromosom og DNA

Nye ord og faguttrykk: DNA, genom, nukleotider, adenin (A), tymin (T), cytosin (C), guanin (G), DNA-dobbelheliks, DNA-tråd, basepar, komple­ mentær, kromosom, plasmid, histoner Hvordan er DNA-molekylet bygd opp? Hvilke baser er komplementære? Hva betyr baseparing? Hvordan er DNA organisert i kromosomer?

Kromosomer i eukaryote celler. Et lineært DNAmolekyl er kveilet rundt histoner som videre pakkes sammen til et kromosom. Figuren viser en celle rett før celledeling, kromosomene finnes da i to kopier.


104 • Kapittel 3

3.2 Fra gen til protein Vi kan sammenlikne DNA-et i cellen med en kokebok. Kokeboka inneholder oppskriftene til forskjellige matretter, mens cellens DNA inneholder alle oppskriftene for alle proteinene som kan lages i en celle. Oppskriftene i koke­ boka er beskrevet med ord, mens i genet er basene i nukleotidene det genetiske alfabetet. «Ordene» i DNA er alltid tre og tre baser sammen, og hver av disse basetriplettene forteller hvilken ingrediens, altså aminosyre, som skal brukes og settes sammen, én etter én. Resultatet av «matlagingen» er et protein. Sammenlikning av en kokebok med DNA-et i en celle. Kokebok

DNA-et i cellen

Bokstaver

Nukleotider med basene A, T, C eller G

Ord

Basetriplett (kodon)

Oppskrift

Gen

Kopiert oppskrift

mRNA

Ingredienser

Aminosyrer

Matrett

Proteiner

Hva er et gen? genesis (lat.) – opprinnelse

Fra gen til protein i en eukaryot celle. De ulike trinnene i proteinsyntesen beskrives nærmere senere i kapittelet.

Ordet gen ble brukt lenge før vi visste at DNA var selve arvestoffet. Gen ble den gang definert som en arvelig egenskap som kunne overføres fra én generasjon til den neste. Egenskapene til en organisme er bestemt av proteiner, og for hvert protein som blir laget i en celle, finnes det en kodesekvens i DNA. Denne koden kalles et gen og er et bestemt avsnitt av DNA-et. gen

5’ 3’

3’ 5’ DNA

Transkripsjon

Cellekjerne

5’

3’ pre-mRNA

Protein (Aminosyrekjede)

RNA-spleising 5’

Cytosol

3’ Ribosom

mRNA

3’

mRNA

Transport 5’

04_04 Gen til protein

Translasjon


Fra gen til protein • 105

Et gen er kodet gjennom rekkefølgen til nukleotidene langs hver tråd. Hver base – A, C, T eller G – kan bli sett på som bokstaver i et firebokstavers alfabet, og det biologiske budskapet er beskrevet ved hjelp av dette alfabetet. Størrelsen på et gen er definert ut fra hvor mange basepar (bp) genet har. Antall basepar i et gen varierer fra under hundre til flere hundretusener. Antall gener varierer mellom ulike arter. Det er kanskje litt rart å tenke på at en rotte har nesten like mange gener som et menneske, men vi er ikke så forskjellige fra rotter som vi kunne tro. Hele 90 % av genene hos rotter og mennesker er like. Ser vi på hva som skjer i den enkelte cellen, er mange av de biokjemiske prosessene identiske, og ser vi litt godt etter, likner et menneske i bygning på en rotte. Vi er begge pattedyr. Forskning viser at et gen kan ligge inne i et annet gen og kode for et annet protein. Det kalles overlappende gener. Kunnskapen om overlappende gener gjør kartleggingen av antall gener i en organisme temmelig usikker og vanskelig.

I vårt DNA er det bare 1–2 % som koder for proteiner. Vi antar at mennesker har ca. 22 000 gener. Vi vet lite om funksjonene til DNA-et som ligger mellom genene, men vi vet at det er viktig i reguleringen av hvilke gener som skal være aktive. Aktive gener sier vi er uttrykte som et produkt.

Aminosyrer er byggesteinene i proteiner

Aminogruppe H

Karboksylsyregruppe H

O

N C C Aminosyrene er byggesteinene i et protein, og rekkefølgen av aminosyrene gir H OH proteinet en spesiell egenskap og en spesifikk struktur. Det som kjennetegner R en aminosyre er at den har en felles oppbygning, et «skjelett». Skjelettet Variabel sidekjede består av en aminogruppe (-NH2), en karboksylsyregruppe (-COOH) og et Aminosyreskjelett. Skjelettet hydrogenatom (-H) knyttet til et sentralt karbonatom, se figuren. Til dette 0115_Aminosyre.pdf består av en amino­gruppe skjelettet av aminogruppe, karboksylsyregruppe, hydrogenatom og et karbon­ (-NH2), en karboksylsyre­ atom er det også bundet en sidegruppe vist på figuren som R. Det er denne gruppe (-COOH), et sidegruppen som gjør aminosyrene forskjellige fra hverandre, og som gir dem hydrogen­atom (-H) og en ulike kjemiske egenskaper. Proteiner er satt sammen av tjue ulike aminosyrer, variabel sidegruppe (R) knyttet til et sentralt karbonatom. og i tabellen på side 389 ser du oppbygningen til alle de tjue aminosyrene.

Av disse tjue aminosyrene som bygger proteiner, er det ni aminosyrer vi mennesker ikke kan lage. Disse ni kalles essensielle aminosyrer og må tilføres kroppen via maten. Mange aminosyrer blir modifisert i cellene og får dermed en annen funksjon. Et eksempel er dopamin, som er et produkt laget med utgangspunkt i aminosyren tyrosin. Dopamin er en nevrotransmitter i nerve­ systemet hos mennesket. Naturen utvikler med andre ord nye produkter ved å bearbeide et allerede laget produkt og gir det nye funksjoner.


106 • Kapittel 3

Transkripsjon – fra gen til mRNA Transkripsjon

04_07 Transkripsjon

transcription (eng.) – skrive av mRNA – messenger Ribo Nucleic Acid (eng.) promote (eng.) – pådrive

Første prosess ut når et protein skal lages, er å lage en avskrift av genet som inneholder oppskriften til proteinet. Se for deg at du kopierer oppskriften i kokeboka for å ta den med deg på kjøkkenbenken. Kopieringsprosessen av genet kalles transkripsjon, og avskriften heter mRNA. I forkant av alle gener er det et område på DNA som forteller at her skal transkripsjonen starte. Dette DNA-området kalles promotor. Startsignalet for transkripsjonen av et gen er at en rekke proteiner som kalles transkripsjons­ faktorer, binder seg til promotoren på genet. Det gjør at enzymkomplekset RNA-polymerase kan feste seg til promotoren, og starte transkripsjonen, se figuren. De mange enhetene i RNA-polymerase har forskjellige roller i transkripsjonen. Én del sørger for å binde seg til promotoren i det aktuelle genet, en annen del tvinner opp DNA-dobbelheliksen slik at den tredje delen av RNA-polymerasen kan komme til og lage en mRNA-tråd. I likhet med DNA er mRNA bygd opp av nukleotider bundet til hverandre. Forskjellene mellom mRNA og DNA er at sukkermolekylet i RNA er en ribose, basen tymin (T) er byttet ut med basen uracil (U), og mRNA består av bare én tråd. Promotor

Gen

3’ 5’

3’ DNA 5’ Generelle transkripsjonsfaktorer

1

3’ 5’

3’ 5’

RNA-polymerase

2

3’ 5’

3’

3

5’ mRNA

Transkripsjon. 04_08 Transkripsjonsfaktorer

1

Transkripsjonsfaktorer i cellekjernen binder seg til et promotorområde på DNA. RNA-polymerasen kan dermed feste seg til promotoren. 3 RNA-polymerasen starter transkripsjonen av genet ved å lage en mRNA-tråd. 2


Fra gen til protein • 107

Oppskriften til hvordan proteinet skal se ut, ligger i den rekkefølgen nukleo­ tidene har i genet. Nukleotidene i mRNA må derfor ha samme rekkefølge som nukleotidene i genet. Inne i cellekjernen ligger det frie RNA-nukleotider, og ved hjelp av RNA-polymerase blir det laget en mRNA-tråd komplementær til den DNA-tråden som blir lest av. RNA-polymerasen følger baseparregelen: Har DNA-tråden cytosin (C), setter RNA-polymerasen inn RNA-nukleotidet med basen guanin (G), har DNA-tråden guanin (G), setter RNA-polymerasen inn RNA-nukleotidet med basen cytosin (C), og har DNA-tråden basen tymin (T), setter RNA-polymerasen inn RNA-nukleotidet med basen adenin (A). Men RNA har ikke tyminbaser (T) i nukleotidene sine. Så når DNA-tråden inneholder basen adenin (A), er det RNA-nukleotidet med basen uracil (U) som blir satt inn. RNA-nukleotidene binder seg kovalent til hverandre og lager en mRNA-tråd. mRNA blir laget fra den DNA-tråden som går i retningen tre-merket til femmerket (3’→ 5’), og mRNA er komplementær til denne DNA-tråden. mRNAtråden går derfor i retningen fem-merket til tre-merket (5’→ 3’), og den er lik den andre DNA-tråden i dobbelheliksen med unntak av at basen T i DNA er U i mRNA, og sukkermolekylet er ribose. Det er denne DNA-tråden som kalles den kodende DNA-tråden, det vil si den DNA-tråden som inneholder den genetiske koden, se side 110. Et lite stykke av den nylagde RNA-tråden henger sammen med DNA-tråden inne i RNA-polymerasen ved hjelp av hydrogenbindinger. Bindingene er svake og blir brutt utenfor polymerasen. Etter at RNA-polymerasen har passert, går DNA-trådene tilbake til sin opprinnelige dobbelheliksstruktur.

RNA (enkeltrådet) 5’ ende O -O

P

Ribose

OH O

H2C 5’

O

4’ 3’

O -O

OH

P O

O

G

O

O

OH

P O H2C

O -O

U

2’

O

H2C

-O

1’

C

O

O

OH

P O H2C 5’

Fosfat 3’ ende

A

O

4’

1’ 3’

OH

2’

OH

Nitrogenbase

04_09 Nukleinsyrer

RNA-polymerase lager mRNA med en hastighet på ca. femti nukleotider per sekund.

RNA-polymerase RNA-nukleotider

5’

A

T

G

C

A

A

T

T

DNA

3’

0410 Transkripsjon

G

3’

C

5’

U A

U

G

C

A

A

T

A

C

G

T

T

U

A

A

5’ mRNA

G

Retning transkripsjon

C

RNA-polymerase driver transkripsjonen. En del av enzymet henter RNA-nukleotider som er komplemen­tære til DNA-nukleotidene, og setter dem sammen til en mRNA-tråd.


108 • Kapittel 3

Hvert gen inneholder et område på DNA som signaliserer til RNA-polymerasen at transkripsjonen nå skal avsluttes. Når RNA-polymerasen kommer til dette området på slutten av genet, løsner den voksende RNA-tråden helt fra DNAtråden, og transkripsjonen er ferdig. Det finnes mange typer RNA som samarbeider om å lage proteiner, men det er bare mRNA som inneholder en oppskrift på et protein. Andre typer RNA skal vi komme tilbake til under translasjonen.

Sjekkpunkter: Nye ord og faguttrykk: gen, essensielle aminosyrer, transkripsjon, mRNA, promotor, transkripsjonsfaktorer, RNA-polymerase, ribose, uracil (U) Hva er et gen? Hva vil det si at et gen blir uttrykt? Hvorfor kalles noen aminosyrer essensielle, mens andre ikke? Beskriv hovedtrekkene i transkripsjonen av et gen. Hva skjer i genets promotor? Hva er forskjellene mellom DNA og RNA?

mRNA-bearbeiding RNA-spleising

I eukaryote celler blir mRNA bearbeidet før det forlater kjernen. Den første transkriberte utgaven av mRNA kalles pre-mRNA. En rekke enzymer i kjernen hjelper til i bearbeidingen. Den første bearbeidingen av pre-mRNA er at enzymer modifiserer begge endene, både 5’- og 3’-ende. 5’-ende av pre-mRNA får en kappe av fosfat­ grupper. Kappen kalles 5’Cap. 3’-ende av pre-mRNA får en hale av nukleotider med basen adenin. Halen kalles 3’Poly-A, se figur på neste side. Modifiseringen av endene beskytter blant annet mRNA mot å bli ødelagt i cytosol, men den er også med på å sikre transport av mRNA ut av kjernen, og at ribosomet fester seg riktig på mRNA-et.

04_11 RNA-spleising

ekson – expressed sequences (eng.) – uttrykte sekvenser intron – intervening sequences (eng.) – mellomsekvenser

Et gen består av områder som inneholder oppskriften til deler av proteinet, mens andre områder i genet ikke inneholder oppskrift. Områdene med oppskrift sier vi er kodende, og de kalles eksoner, mens de ikke-kodende områdene av genet kalles introner. Introner ligger alltid mellom to eksoner. Hvor mange og hvor lange intronene er, varierer fra gen til gen. For eksempel er genet som koder for insulin, et lite gen med bare tre introner, mens genet for proteinet dystrofin er det største humane genet med hele 78 introner. Før mRNA kan brukes til å lage et protein, må intronene i pre-mRNA fjernes. Fjerningen skjer inne i cellekjernen, og denne typen bearbeiding av pre-mRNA kalles RNA-spleising. RNA-spleising krever et stort enzymkompleks kalt spleisosom. Spleisosomet kutter opp pre-mRNA i begge endene av eksonet, fjerner intronene og spleiser eksonene sammen igjen til et ferdigspleiset mRNA.


Fra gen til protein • 109

Ekson 1

Intron

Ekson 2

DNA

Transkripsjon polyA-hale

5’Cap

RNA-bearbeiding. pre-mRNA blir først modifisert i endene ved at en Cap settes til i 5’-ende og en Poly-A settes til i 3’-ende. Etter modifiseringen fjerner enzymkomplekset spleisosom intronene fra pre-mRNA og danner mRNA.

pre-mRNA Spleisosom

polyA-hale

5’Cap

RNA-spleising

Intron

Ekson 1

Ekson 2 polyA-hale

5’Cap

mRNA

04_12 RNA-spleising

Transport av mRNA ut av cellekjernen til cytosol Proteiner blir produsert i cytosol. I eukaryote celler blir bare korrekt bearbeidet mRNA transportert ut av cellekjernen. I cellekjernen er det et stort enzym­ kompleks som gjenkjenner korrekt bearbeidet mRNA, og som tillater bare denne typen mRNA å passere gjennom kjerneporene i kjernemembranen.

Den genetiske koden Den genetiske koden er universell. Det betyr at den er kjent og lik for alle levende organismer, både prokaryoter og eukaryoter. Det tyder på at prosessen for produksjon av proteiner oppstod svært tidlig i evolusjonen. Den genetiske koden bestemmer hvordan proteinene skal bygges opp, og oppskriften ligger i baserekkefølgen til genet, se neste side. mRNA er som sagt en avskrift av den kodende delen av genet. Baserekkefølgen i mRNA blir kodet til en bestemt aminosyrerekkefølge som er avgjørende for hvilket protein som skal lages. Hvordan kan da rekkefølgen av de fire basene A, U, C og G være utgangs­ punkt for de tjue ulike aminosyrene som cellen bruker til å bygge proteiner?

Transport

0413 Transport


110 • Kapittel 3

3’ DNA

5’

Gen 2

Gen 1 Gen 3

DNA-tråd 3’

5’ T A C A C C G A G G G C C

T A A T

T

Transkripsjon mRNA

5’

Den genetiske koden. Baserekkefølgen i genet koder for aminosyre­ rekkefølgen i proteinet. En basetriplett (kodon) på mRNA koder for en bestemt aminosyre.

3’ A U G U G G C U C C C G G A U U A A Kodon

Translasjon Protein Met

Trp

Leu

Pro

Asp

Stopp

04_14genetiske Translasjonkoden er slik at tre og tre baser på mRNA-tråden koder for en Den bestemt aminosyre. En slik basetriplett kalles kodon. På figuren under ser du hvilke kodoner på mRNA som koder for hvilke aminosyrer. Si at du på mRNA leser baserekkefølgen UAC. For å finne ut hvilken aminosyre dette kodonet koder for, begynner du innerst i hjulet på U. Så går du et trinn utover fra U til

Asp

U

C

Gly

Leu*

AGUC A GU UC AG C

Glu

Ser*

A

G

Tyr

n

do U ko C Stopp odon A C A toppk C G S U C A G U Cys C Val A don G U A Stoppko C U G Trp U G G U Arg* A G U C A C A Leu* C Ser* U G A C G U A C Lys C A A C Pro U G G U G Asn U A C A CU G His G U C A Thr C UGA

G A

G

U

Gln

Me

t

Ala

Ile

*Aminosyre som opptrer to ganger Ala Arg Asn Asp Cys Glu Gln Gly His Ile

= Alanin = Arginin = Aspargin = Aspartat/Asparginsyre = Cystein = Glutaminsyre = Glutamin = Glysin = Histidin = Isoleucin

0506_Genetisk_kode.pdf

Arg* Startkodon Leu = Leucin Lys = Lysin Met = Metionin Phe = Fenylananin Pro = Prolin Ser = Serin Thr = Treonin Trp = Tryptofan Tyr = Tyrosin Val = Valin

Phe

Leu*

Ser* AGUC A GU UC G A C C A Tyr U G n do G U G U Ala ko A C Stopp odon A C A toppk C G S U C A G U Cys C Val A don G U A Stoppko C U G Trp U G G U Arg* A G U C A C A Leu* C Ser* U G A C G U A C Lys C A A C Pro U G G U G Asn U A C A CU G His G U C A Thr C UGA Asp

Me t

Phe

Gly Glu

Gln

Ile

Arg*

Det genetiske hjulet. Hjulet viser hvilke kodoner som gir 04_15b Genetisk kode hvilke aminosyrer. Figuren til høyre viser hvordan koden UAC leses av. Start innerst i hjulet med U og beveg deg utover. Koden UAC koder for aminosyren tyrosin (tyr).


Fra gen til protein • 111

A og videre fra A ett trinn utover til C. Utenfor her står det Tyr, og fra listen under ser du at Tyr står for aminosyren tyrosin. Siden RNA er bygd opp av fire baser (A, U, C og G), gir det 64 mulige kodoner (43). Men celler bruker bare tjue forskjellige aminosyrer til å bygge opp proteinene sine, så derfor har de fleste aminosyrene flere kodoner.

Sjekkpunkter: Nye ord og faguttrykk: pre-mRNA, 5’Cap, 3’Poly-A, eksoner, introner, RNA-spleising, spleisosom, basetriplett, kodon Hvorfor modifiseres endene på mRNA? Forklar forskjellen mellom introner og eksoner. Hva gjør et spleisosom? Hva er den genetiske koden?

Translasjon – fra mRNA til protein Translasjonen av mRNA skjer på ribosomene og er selve produksjonen av proteiner. Vi kan se på ribosomet som en «kjøkkenbenk» der aminosyrene skal festes sammen. Prosessen krever energi. For å oversette baserekkefølgen i mRNA til et protein brukes tRNA, som ligger fritt i cytosol. tRNA er bygd opp av RNA-nukleotider og har som oppgave å transportere aminosyrer til mRNA. Det finnes forskjellige tRNA, og ett bestemt tRNA binder én bestemt aminosyre. For eksempel kan tRNAala bare binde aminosyren alanin, og tRNAtyr kan bare binde aminosyren tyrosin. Utgangs­punktet for at ett tRNA binder én bestemt aminosyre, er et område på tRNA hvor tre RNA-nukleotider danner et antikodon, se figuren. Enzymet tRNA-syntetase gjenkjenner antikodonet og kopler tRNA sammen med korrekt amino­syre. Aminosyrene stammer fra proteiner som har blitt brutt ned enten på innsiden eller på utsiden av cellen. Aminosyrene fra utsiden av cellen har blitt transportert gjennom bæreproteiner i cellemembranen og inn i cytosol. Aminosyre fenylanin Bindingssete for aminosyre

tRNA-syntetase

tRNA – transport-RNA

Energi

A A G

A A G

Antikodon

Binding av en aminosyre til et tRNA-molekyl. Enzymet tRNAsyntetase gjenkjenner en bestemt tRNA og en bestemt aminosyre og kopler dem sammen inne i enzymet. Aminosyren binder seg til tRNA-molekylet. 04_17 Aminosyre tRNA

04_31 Translasjon

translation (eng.) – oversette

tRNA

A A G

Translasjon


112 • Kapittel 3 Aminosyre metionin Translasjonsfaktor

mRNA

Startkodon

U A C U A C

A U G

A U G

Ribosomets lille subenhet 5’Cap

Energi

U A C

A U G

Starten på translasjonen. Den lilleTranslasjon subenheten på 04_18 start ribosomet gjenkjenner et startkodon (AUG) på mRNA, og tRNA med komplementært antikodon (UAC) blir ført til mRNA ved hjelp av translasjons­ faktorer. Deretter fester den store subenheten seg til komplekset, og translasjonen starter.

rRNA – ribosomalt-RNA

Ribosomets store subenhet

Translasjonen av mRNA starter når den lille subenheten i ribosomet gjenkjenner 5’Cap i starten av mRNA. Alle mRNA inneholder et lite område etter 5’Cap som ikke koder for aminosyrer. Her kan ribosomet feste seg og bevege seg langs mRNA til det treffer et startsignal. Startsignalet er et startkodon med baserekkefølgen AUG. Når den lille enheten av ribosomet treffer startkodonet, stopper den opp, og tRNA med det komplementære antikodonet UAC kan binde seg. Dette er tRNA med aminosyren metionin (tRNAmet). Bindingen av riktig tRNA til mRNA blir drevet av ulike translasjonsfaktorer både i cytosol og i ribosomet. Disse faktorene sørger også for at antikodonet i tRNAmet baseparer med kodonet i mRNA. Nå kan den store enheten av ribosomet binde seg til mRNA, og translasjonen starter. Når hele ribosomet er festet til mRNA, blir det laget to seter ved siden av hverandre i den store enheten, se figuren på neste side. I disse setene kan to tRNA-molekyler binde seg til hvert sitt kodon på mRNA-tråden. Det betyr at nå kan en ny tRNA feste seg i nabosetet for tRNAmet. Dette tRNA-et inneholder et antikodon som er komple­men­tært til det neste kodonet på mRNA. rRNA i ribosomet gjør at aminosyrene på tRNA-ene blir ført så tett sammen at metionin binder seg til den nye amino­syren med peptidbindinger. Etter denne bindingen løsner tRNA-et, som nå er uten metionin, fra ribosomet og diffunderer ut i cytosol og kan ta opp en ny metionin.


Fra gen til protein • 113

Translasjon. Syntese av aminosyrekjeder (proteiner). Prosessen krever energi og mange «hjelpere» som ikke er vist på figuren.

Aminosyrekjede tRNA

1 Antikodon gjenkjenner kodon. Antikodonet på tRNA baseparer med det komplementære kodonet på mRNA.

mRNA Ribosom

3 Translokasjon. tRNA uten aminosyre forlater komplekset og mRNA med sitt bundne tRNA flyttes i forhold til den store subenheten. Det neste kodonet kan nå binde en ny tRNA, og translasjonen fortsetter.

04_19 Translasjon.pdf Når et tRNA forlater ribosomet, flytter ribosomet seg ett kodon fram. Denne prosessen kalles translokasjon. Det blir nå et ledig sete i den store subenheten på ribosomet, og antikodonet til et nytt tRNA baseparer med det neste kodonet på mRNA. Aminosyrekjeden binder seg videre til aminosyren på det nye tRNA-molekylet, tRNA uten aminosyre kan forlate ribosomet, og det skjer en ny translokasjon. Slik fortsetter prosessen, og det blir produsert en stadig voksende aminosyrekjede.

Translasjonen blir avsluttet når ribosomet treffer et stoppkodon på mRNA. Stoppkodonet er enten UAA, UAG eller UGA. For disse kodonene finnes det ingen tRNA med antikodon som kan feste seg, og ribosomet stopper opp. Et protein som kalles en stoppfaktor, binder seg til stoppkodonet, og hele ribosomkomplekset løsner fra hverandre, se figuren øverst neste side. Translasjonen av mRNA-et foregår helt til mRNA-tråden blir brutt ned i cytosol. Det er også mulig å starte translasjonen med et nytt ribosom før andre ribosomer er ferdige. Flere proteiner kan dermed bli laget samtidig på samme mRNA-tråd.

2 Dannelsen av peptidbinding. rRNA i den store subenheten sørger for at det dannes peptidbindinger mellom ny aminosyre og den voksende aminosyrekjeden.


114 • Kapittel 3

Aminosyrekjede

Ribosomets store subenhet Stoppfaktor Stoppfaktor

PolyA-hale

mRNA

Stoppkodon Ribosomets lille subenhet

Slutten på translasjonen. mRNA inneholder et stopp­ kodon som avslutter transla­ sjonen. stopp­kodonet 04_20 For Translasjon slutt finnes det ingen tRNA med komplementært antikodon. En stoppfaktor binder seg til stoppkodonet, og hele komplekset løsner fra hverandre.

Hvor lenge et mRNA er i cytosol før det blir brutt ned, bestemmer hvor mange proteiner som kan lages fra mRNA-et. Derfor kan produksjonen av proteiner også reguleres ved å påvirke nedbrytningen av mRNA i cytosol. I cytosol finnes det egne enzymer, RNaser, som bryter ned mRNA. Ofte er baserekkefølgen til mRNA avgjørende for om nedbrytningen skjer raskt eller sakte. Noen bestemte baserekkefølger virker beskyttende og hindrer derfor rask nedbrytning. Aminosyrene settes sammen til en aminosyrekjede nøyaktig etter den oppskriften mRNA-et brakte med seg ut fra cellekjernen. Aminosyrekjeden vil videre foldes og settes sammen til et protein. De minste proteinene har om lag femti aminosyrer, men i de største proteinmolekylene kan det være mange tusen aminosyrer etter hverandre. På den måten kan det lages svært mange ulike og komplekse proteiner. Vi har nå sett på prosessene fra gen til protein, og vi sier at genet er uttrykt når proteinet er til stede.

Sjekkpunkter: Nye ord og faguttrykk: tRNA, antikodon, tRNA-syntetase, startkodon, translasjonsfaktorer, rRNA, translokasjon, stoppkodon, stoppfaktor, RNaser Hvordan er det mulig at en type tRNA binder en type aminosyre? Forklar hvordan translasjonen av mRNA starter. Hvilke roller har translasjonsfaktorer og rRNA i translasjonen? Hva er translokasjon? Forklar forskjellen mellom stoppkodon og stoppfaktor. Hva gjør RNasene?


Fra gen til protein • 115

3.3 Proteiner Proteiners strukturnivåer De aller fleste proteinene er ikke klare til bruk rett etter translasjonen. Det er også naturlig fordi mange proteiner har komplekse arbeidsmåter og er svært spesialiserte. Proteiner kan være bygd opp av flere aminosyrekjeder. Et typisk protein varierer mellom 100 og 600 aminosyrer, men det finnes også svært store og mer komplekse proteiner. Et eksempel på det er enzymet glutamatdehydrogenase som har ca. 40 aminosyrekjeder og består av ca. 8300 aminosyrer.

proteios (gr.) – det viktigste

Proteinene får sin spesielle form avhengig av hvilke aminosyrer de er satt sammen av. Særlig viktig for strukturen er aminosyrenes sidegruppe (R) som ofte danner bindinger seg i mellom. Proteiners struktur kan angis på fire forskjellige nivåer, se figuren under. Primærstruktur

Lys – Gly – Arg – Cys

C

C

N

C

R

N H

C C N O

C

N

R

R

C

C C N H O

N

C

O

C C N

C

H

O

C R

N

C R

H

R

O C

N

C

H

H

R

O C

C C O

R

H

C

N

R

R

O

H

O

H

O

H

O

R R C C O

C C N O

C

N

R

R

C

H -plate-struktur

R C C O

N H

Hydrogenbindinger

C

C C N O

H

C O

H

R

O C

N

C

H

H

R N

H

N

H C

R

R

N C C

O

N

H R

C

R

O H

C

N

O H

C

Sekundærstruktur

R C

N C C

O

R C

C

R

O H

C

N

Kvartærstruktur

04_22 Proteinstruktur

C

R

C O

H N C

R

C O

-heliks-struktur

Tertiærstruktur

Strukturnivåer til proteiner. Proteiner kan danne ulike strukturer og disse angis som primær-, sekundær-, tertiær- og kvartiærstruktur.

H N


116 • Kapittel 3

Dersom foldingen av et protein ikke går så bra, kan det være svært alvorlig for cellen. Vanligvis blir disse ødelagte proteinene raskt brutt ned, men de kan også påvirke andre proteiner og forstyrre disse. Dersom proteinene ikke blir brutt ned, kan de hope seg opp og flere forskere tror nå at det kan være en av flere årsaker til alvorlige sykdommer som Alzheimer og Parkinson. Den alvorligste formen for forstyrrelser slike proteiner kan gi, er at de galt foldete proteinene påvirker andre proteiner til å folde seg slik som dem, altså galt. Det er dette som skjer ved prionsykdommer, se figuren under. I Bi 1 leste du om prioner og Creutzfeldt-Jacobs sykdom. Prioner angriper hjerne­ celler. Prioner er proteiner som påvirker andre proteiner til å bli prioner. Prionene lenker seg sammen i lange kjeder og ødelegger hjernecellen.

Normale hjerneproteiner

Mange prioner Nye prioner

Hjernecelle Prion

Originalt prion

1009_Prioner

Sortering av nylagde proteiner De aller fleste proteinene som blir laget i en celle, blir ikke brukt der de blir produsert. I Bi 1 skrev vi om organellene endoplasmatisk retikulum (ER) og golgiapparatet. Begge disse organellene er sentrale i sorteringen og transporten av proteiner i en celle. De to organellene samarbeider om jobben, og det er ulike enzymer i golgiapparatet som gjenkjenner bestemte aminosyre­rekke­ følger i proteinet, merker proteinet og dermed sender det til riktig sted. Hvis proteinet for eksempel har aminosyrerekken – prolin – prolin – lysin – lysin – lysin – argenin – lysin – valin, blir det gjenkjent av et enzym, og proteinet blir merket med et «gå til cellekjernen»-signal. Adresselapp: “Gå til cellemembranen”

Protein

Vesikkel Vesikkel

ER

Ulike typer proteiner

Golgiapparatet Protein

Adresselapp: “Gå til peroksisomene”

0118 ER til Golgi

Vesikkel Peroksisom

membran Celle

Sortering av proteiner. Nylagde proteiner blir transportert i vesikler fra ER til golgiapparatet. I golgi­ apparatet gjenkjennes bestemte aminosyre­rekke­ følger i proteinet og proteinet blir merket med «adresse­ lapper» som sender dem til riktig sted.


Fra gen til protein • 117

Proteiners funksjoner Proteiner har svært mange funksjoner i en celle og i en organisme. De er spesialiserte og viser et stort mangfold. Vi kan dele dem inn etter hvilken funksjon de har, se tabellen. Proteinfunksjoner

Forklaring

Reisverket i cellen

Celleskjelettet er bygd opp av ulike typer proteiner. Disse proteinene gir cellen form og mekanisk styrke. Eksempler: mikrotubuli og aktinfilamenter

Signalstoffer inne i og utenfor cellen

Inne i cellen er et nettverk av signalsystemer hvor mange av signalmolekylene er proteiner. Mange av signalmolekylene mellom cellene er også proteiner. Eksempler: insulin og MAP-kinase

Katalysatorer for en rekke kjemiske reaksjoner i cellen

Mange kjemiske reaksjoner får hjelp fra en type proteiner som kalles enzymer. Enzymene driver reaksjonene. Eksempler: RNApolymerase og spleisosom

Regulerer genene

Proteiner kan binde seg til promotorer, enhancere og silencere og påvirke hvordan genene blir uttrykt. Eksempler: transkripsjons­ faktorer og reseptorer-fettløselige-hormon-kompleks

Sørger for bevegelse av organismen

I muskelcellene jobber proteiner sammen for at muskelen skal trekke seg sammen og dermed skape bevegelse. Eksempler: aktin og myosin

Styrer transport av stoffer gjennom cellemembranen

Vannløselige stoffer kan ikke passere rett gjennom fosfolipidlaget i cellemembranen. Proteiner lager kanaler og bæreproteiner for disse stoffene. Andre stoffer kan feste seg til reseptorproteiner i cellemembranen og signalisere inn i cellen. Eksempler: natriumkanal, natrium-kalium-pumpen og reseptor for adrenalin

Bekjemper mikro­ organismer

Immunsystemet hos planter og dyr består av en rekke proteiner som direkte går til angrep på mikroorganismene eller styrer andre celler i angrepet. Eksempler: antistoff, komplement­proteiner og cytokiner

Figur

04_38 Struktur A

04_42 Signal B

“av” 04_40 Katalysator “på”

04_37 Regulering

04_39 Bevegelse

04_41 Transport

04_43 Antistoff

Sjekkpunkter: Nye ord og faguttrykk: prioner, proteinstruktur Beskriv de ulike strukturnivåene et protein kan ha. Hvilke organeller sørger for at nylagde proteiner havner der de skal? Nevn tre forskjellige funksjoner proteiner kan ha i en organisme.


118 • Kapittel 3

3.4 Genregulering Hvordan er det mulig at cellene i en organisme inneholder ulike proteiner når alle cellene har samme DNA? Forklaringen ligger i regulering av genene. En celles funksjon og form er avhengig av hvilke proteiner som er til stede. Mengden av proteiner og proteintype bestemmes av hvilke gener som blir uttrykt, det vil si hvilke gener det blir laget proteiner fra. I menneskekroppen finnes det over to hundre celletyper med hver sin unike funksjon, men sammen utgjør de en enhet, nemlig et menneske. I en celle er det mange gener som alltid blir uttrykte. Det er med andre ord alltid bundet transkripsjonsfaktorer til disse genene, og dermed blir proteiner til enhver tid produsert. Noen gener blir aldri uttrykt i en celle fordi det ikke er behov for proteiner av denne typen. Andre gener blir uttrykt når cellen og organismen har behov for det. Eksempler er nedbrytningen av klorofyllmolekyler i bladene hos mange trær om høsten og celledeling i et barn som vokser raskt. Signalene som stimulerer cellene, kan for eksempel være enzymer, hormoner eller nervesignaler. Enhancer

Promotor

Gen

Promotor

Gen

Spesiell transkripsjonsfaktor

1 Enhancer

Generell transkripsjonsfaktor

2 3 Promotor

RNA-polymerase

Enhancer

Regulering av gener. 04_24 Enhancere

1

En enhancer til et gen ligger foran selve genet. En spesiell transkripsjons­faktor binder seg til enhanceren. Enhancer og spesiell transkripsjonsfaktor stimulerer de generelle transkripsjonsfaktorene til å feste seg til promotoren. 3 RNA-polymerasen blir dermed rekruttert til pro­motoren, og transkripsjonen av genet kan starte. 2


Fra gen til protein • 119

Det viktigste reguleringspunktet er å starte transkripsjonen av et gen. Som sagt begynner transkripsjonen av et gen når transkripsjonsfaktorer binder seg til promotoren i genet og dermed sørger for at RNA-polymerase kan feste seg, se figuren på side 107. Mange gener har andre kontrollområder som virker sammen med promotoren. Spesielle transkripsjonsfaktorer kan feste seg til disse områdene og regulere transkripsjonen av genet. Enhancere er DNAområder som sammen med spesielle transkripsjonsfaktorer stimulerer til transkripsjon av genet, se figuren på forrige side. Det er viktig å vite at de spesielle transkripsjonsfaktorene forsterker transkripsjonen fordi RNApolymerasen lettere kan feste seg, men ikke påvirke transkripsjonshastigheten. DNA-områder som hemmer transkripsjonen når spesielle transkripsjonsfaktorer fester seg, kalles silencere. For å illustrere hvordan ytre signaler kan regulere genene i en celle, ser vi på hvorfor flere celler deler seg i en ung gutt enn i en gammel mann. Behovet er der, gutten skal vokse. Figuren finner du på neste side. I gutten er det mange veksthormoner som sirkulerer rundt med blodet. Disse veksthormonene påvirker mange av cellene hos gutten ettersom de binder seg til reseptorer i cellemembranen. Den biologiske responsen inne i cellen er en rekke reaksjoner som til slutt aktiverer en transkripsjons­­faktor. Denne transkripsjonsfaktoren fester seg til en enhancer og hjelper generelle transkripsjonsfaktorer med å binde seg til promotoren. Genet med denne promotoren blir dermed transkribert av RNA-polymerasen. Proteinet som dette genet koder for, stimulerer cellen til å dele seg. En mann skal ikke vokse mer, og her erstatter celledelinger bare døde celler. Derfor har en voksen mann færre vekst­ hormoner i blodet, det blir færre aktive transkripsjonsfaktorer, og færre celler deler seg. Det samme vekstprinsippet gjelder for alle eukaryote organismer!

Sjekkpunkter: Nye ord og faguttrykk: spesiell transkripsjonsfaktor, enhancer, silencer Hvordan er det mulig at cellene i en organisme inneholder ulike proteiner når alle cellene har samme DNA? Hva menes med at et gen blir uttrykt? Hva gjør de spesielle transkripsjonsfaktorene? Forklar forskjellen mellom enhancer og silencer.

enhance (eng.) – forsterke

silence (eng.) – forstumme


120 • Kapittel 3

Veksthormon

1

Veksthormonreseptor

Kroppscelle

2 Inaktiv spesiell transkripsjonsfaktor

Aktiv spesiell transkripsjonsfaktor

3

Enhancer

Promotor Gen

7 Protein som stimulerer cellen til å dele seg

DNA

4 RNA-polymerase

Generell transkripsjonsfaktor

Translasjon Spesiell transkripsjonsfaktor

5

Transkripsjon mRNA

6

Et eksempel på genregulering. Veksthormoner 1 04_25 Et veksthormon binder 2 3 4 5 6 7

seg til reseptoren i cellemembranen. Binding til reseptor starter en rekke reaksjoner inne i cellen som ender med å aktivere en spesiell transkripsjonsfaktor. Transkripsjonsfaktoren transporteres inn i cellekjernen og fester seg til et bestemt enhancerområde i DNA. Den spesielle transkripsjonsfaktoren hjelper generelle transkripsjonsfaktorer å binde seg til promotoren i genet den kontrollerer, og RNA-polymerase kan starte transkripsjon av genet. mRNA transporteres ut av cellekjernen og til et ribosom i cytosol. I ribosomet starter translasjonen av mRNA og et protein som kontrollerer celledeling blir laget. Dette proteinet gir signaler til cellen om å begynne DNA-kopieringen med etterfølgende mitose.


Fra gen til protein • 121

3.5 Mutasjoner Forandringer i strukturen eller rekkefølgen av baser i DNA-et kalles en mutasjon. Dersom endringen omfatter hele eller større deler av et kromosom, kaller vi det en kromosommutasjon, og dersom det bare er baserekkefølgen som blir endret, er det en genmutasjon. Organismer som er annerledes enn de andre på grunn av en mutasjon, kaller vi mutanter. En mutasjon er med på å skape variasjon i arvematerialet. Variasjonen gir ulik overlevelse i et skiftende miljø. Slik variasjon sammen med variasjon fra for eksempel kjønnet formering, er en av hovedkreftene bak evolusjonen, se kapittel 1 Evolusjon. De aller fleste mutasjonene skjer i de delene av DNA-et som ikke koder for noe protein, og vi ser da ingen effekt av mutasjonen. Men det behøver ikke å bety at mutasjonen ikke får følger. Det er fortsatt mye vi ikke vet om DNA-et mellom genene. Det er også et meget viktig skille om mutasjonen oppstår i kjønnscellene eller i kroppscellene. DNA-et i kjønnscellene blir videreført til neste generasjon, mens kroppscellene dør med individet. Videre i dette kapitlet skal vi se på genmutasjoner og hvilke konsekvenser mutasjoner innad i et gen får for den genetiske koden og proteinet som blir uttrykt. Ved kromosommutasjoner er det liknende mutasjonsmekanismer som ved genmutasjoner, bare at her er større deler av DNA-et blitt endret. Konsekvenser av kromosommutasjonene kan du lese om i kapittel 5 Genetikk (se for eksempel side 197). Når mutasjonen involverer kun ett basepar kalles det en punktmutasjon. Mutasjoner kan skje på forskjellige måter; Ved • substitusjon – som betyr å bytte om på • insersjon – som betyr å sette inn • delesjon – som betyr å fjerne

Substitusjon Substitusjon er når ett eller flere basepar blir byttet til andre basepar. Mutasjoner ved substitusjon kan ha svært ulik innvirkning på strukturen til proteinet. Mange slike mutasjoner er tause, det vil si mutasjoner der forandringen av baserekkefølgen ikke har noen betydning for innsetningen av aminosyren. Dette er mer vanlig dersom mutasjonen skjer i den tredje basen i tripletten. Se figuren på side 110 for oversikt over hvilke kodoner som koder for hvilke aminosyrer. Også når mutasjonen fører til en endring av aminosyrerekkefølgen, er det ikke alltid det svekker eller ødelegger proteiner. I slike tilfeller er det viktig hva slags type protein som blir utsatt for mutasjonen, og hvor i proteinet mutasjonen


122 • Kapittel 3

DNA 3’ 5’ før T A C A C C G A G G G C C T A A T T mutasjonen DNA 3’ 5’ etter T A C A C C G A G G G A C T A A T T mutasjonen (basesubstitusjon)

Transkripsjon

mRNA

5’

3’ A U G U G G C U C C C U G A U U A A

Translasjon Aminosyrekjede

Met

Trp

Leu

Pro

Asp

Stopp

Taus mutasjon ved substitusjon. En mutasjon behøver ikke å ha betydning for cellen. Figuren viser en punkt­mutasjon hvor C er byttet ut til A i posisjon 12. Mutasjonen fører ikke til endring av amino­ ­syre­rekkefølgen i dette proteinet fordi både kodon CCG og CCU koder for aminosyren prolin.

04_26 Basesubstitusjon-1 DNA 3’ 5’ før T A C A C C G A G G G C C T A A T T mutasjonen 3’ 5’ DNA etter T A C A C C G A G G G C C A A A T T mutasjonen (basesubstitusjon)

Transkripsjon

mRNA

5’

3’ A U G U G G C U C C C G G U U U A A

Translasjon Aminosyrekjede Met

Trp

Leu

Pro

Val

Mutasjon ved substitusjon hvor en aminosyre endres. Figuren viser en punkt­ mutasjon hvor T er byttet ut til A i posisjon 14. Dette fører til at aminosyrekjeden inneholder aminosyren valin (Val) istedenfor den opprinnelige aminosyren aspartat (Asp).

Stopp

04_27 Basesubstitusjon-2 DNA 3’ 5’ før T A C A C C G A G G G C C T A A T T mutasjonen DNA 3’ 5’ etter T A C A T C G A G G G C C T A A T T mutasjonen (basesubstitusjon)

Transkripsjon

mRNA

5’

3’ A U G U A G C U C C C G G A U U A A

Translasjon Aminosyrekjede Metonin

Stop

Mutasjon ved substitusjon hvor translasjonen stopper opp. Figuren viser en punktmutasjon hvor C er byttet ut til T i posisjon 5. Dette fører til at det opprinnelige kodonet UGG blir forandret til UAG som er et stoppkodon. Translasjonen stopper dermed opp.

04_28 til Basesubstitusjon-3 fører at en aminosyre blir endret. Dersom det skjer i det aktive setet på et enzym, er det svært alvorlig for enzymets aktivitet og spesifisitet, se side 257. Skjer det andre steder på det samme enzymet, kan en endring av en aminosyre ha liten betydning. Dersom mutasjonen kommer i stoppkodonet, eller er slik at det dannes et stoppkodon, har det store konsekvenser. Da blir proteinet som regel så ødelagt at cellen bryter det ned.


Fra gen til protein • 123

Insersjon og delesjon Insersjon er når det blir satt inn ett eller flere basepar i DNA-et. Delesjon er når det blir fjernet ett eller flere basepar fra DNA-et. Slike mutasjoner er alvorlige fordi de påvirker rekkefølgen av aminosyrer i proteinet. Når vi får en slik forskyvning, enten fordi det blir flere basepar eller færre, skjer det en lese­ramme­­mutasjon. En lese­ramme er en triplett som koder for en aminosyre. Når det oppstår mutasjon her, blir tripletten forskjøvet i leserekkefølge. Det fører til at helt andre aminosyrer enn de DNA-et er kodet for før mutasjonen, blir lest og satt sammen til et protein, se figuren. Ofte gir dette proteiner som er så ødelagte at cellen må bryte dem ned. DNA 3’ 5’ før T A C A C C G A G G G C C T A A T T mutasjonen DNA 3’ 5’ etter T A C A C C T G A G G G C C T A A T T mutasjonen (insersjon)

Transkripsjon

mRNA

5’

3’ A U G U G G A C U C C C G G A U U A A

Translasjon Aminosyrekjede

Met

Trp

Thr

Pro

Gly

Mutasjon ved insersjon. Figuren viser en punktmutasjon hvor T er satt inn mellom base 6 og 7. Dette fører til at hele leserammen forskyver seg, og dermed vil det settes sammen helt andre aminosyrer enn de opprinnelige.

Leu

04_29 Insersjon DNA 3’ 5’ før T A C A C C G A G G G C C T A A T T mutasjonen C

DNA 3’ 5’ etter T A C A C C G A G G G C T A A T T mutasjonen (delesjon)

Transkripsjon

mRNA

5’

3’ A U G U G G C U C C C G A U U A A

Mutasjon ved delesjon. Figuren viser en punktmutasjon hvor C i posisjon 12 er fjernet. Dette fører til at hele leserammen forskyver seg, og dermed vil det settes sammen helt andre aminosyrer enn de opprinnelige.

Translasjon Aminosyrekjede

Met

04_30 Delesjon

Trp

Leu

Pro

Ile

Sykdommen talassemi skyldes en mutasjon i genet for en av aminosyre­ kjedene til hemoglobin. Mutasjonen går ut på at det har skjedd en punkt­ mutasjon ved substitusjon på stoppkodonet i sekvens nummer 142. Dermed blir dette mRNA-et ikke stoppet i avlesningen og avkodingen der, men først på base­par­nummer 173. Den sekvensen som blir avlest fra dette genet, danner da delproteiner (en av aminosyrekjedene) til hemoglobin, som inneholder for mange aminosyrer og dermed ikke fungerer som de skal.

inserere (lat.) – sette inn deletio (lat.) – ødelegge


124 • Kapittel 3

Mutagener Faktorer som kan være årsak til mutasjoner, kaller vi mutagener. Det er mange slike i det daglige miljøet vårt og i maten. Det er først og fremst mengden av dem som kan være skadelig for oss. Et eksempel er nitritt, NO2–. Dette tilsetnings­stoffet var ikke lov å bruke i Norge før, men er nå tillatt. Vi vet at nitritt kan gjøre om på basen og forandre baseparingen. Det skjer fordi nitritt kan fjerne en aminogruppe fra en base (deaminere), og dermed blir det produsert en ny base som ikke kan delta i den samme baseparingen. Nitritt er brukt som konserveringsmiddel og er svært vanlig i produkter som salami og liknende. Det hjelper til med å forlenge det vi oppfatter som den friske, røde kjøttfargen. Stråling, både ultrafiolett og ioniserende, er en annen faktor som fører til mutasjon. Igjen er det dosen som er avgjørende for hvor skadelig strålingen er. Stråling er energi og hvis DNA får tilført energi, øker det sannsynligheten for at de enkelte delene av molekylet kan endre seg. Er dosen høy, kan cellen eller hele organer dø momentant. Radon er en radioaktiv gass som siver ut av berggrunnen og inn i hus mange steder i Norge. Denne gassen kan ved høye konsentrasjoner føre til dobbelttrådbrudd. Det betyr at begge sidekantene er brutt, og DNAmolekylet er delt i to.

Sjekkpunkter: Nye ord og faguttrykk: mutasjon, kromosommutasjon, genmutasjon, mutanter, punktmutasjon, substitusjon, insersjon, delesjon, mutagener Hva er forskjellen mellom en genmutasjon og en kromosommutasjon? Når bruker vi begrepet punktmutasjon? Hva er en taus mutasjon? Hvilke konsekvenser kan substitusjon gi? Forklar forskjellen mellom insersjon og delesjon. Gi eksempler på mutagener.


Fra gen til protein • 125

Sammendrag • DNA har samme oppbygning og funksjon i alle organismer. DNA er bygd opp av nukleotider, og et nukleotid består av et sukkermolekyl (deoksyribose), en fosfatgruppe og en nitrogenbase (A, T, C, G). Nukleotidene er bundet til hverandre og danner en DNA-tråd. • DNA-molekylet består av to tråder som sammen bygger en dobbelheliks. Den ene tråden går fra 3’ → 5’, mens den andre tråden går fra 5’ → 3’. A i den ene DNA-tråden baseparer alltid med T i den andre. Tilsvarende baseparer C alltid med G. • DNA er organisert i kromosomer. DNA i prokaryoter er sirkulært, mens DNA i eukaryoter er lineært. I eukaryoter er DNA kveilet rundt histoner. • Et gen er et avsnitt av DNA som inneholder koden til et fungerende produkt, oftest et protein. Antall gener varierer mellom ulike arter. • Aminosyrene er byggesteinene i et protein, og felles for alle aminosyrer er at de har en amino­ gruppe (-NH2), en karboksylsyregruppe (-COOH) og et hydrogenatom (-H) knyttet til et sentralt karbon­atom. Det som varierer mellom aminosyrene er sidegruppen (R). • Dannelsen av et protein er en fireleddet prosess som består av transkripsjon, mRNA-bearbeiding, translasjon og ferdigstilling av proteinet. • Transkripsjon er avskriving fra gen til mRNA. Prosessen drives av RNA-polymerase og igangsettes av transkripsjonsfaktorer som bindes til promotor­ området på genet. • Endene til nylaget mRNA (også kalt pre-mRNA) merkes i 5’ ende med en 5’Cap og i 3’ ende med en 3’Poly-A. Et gen består av både introner og ekstroner. Introner er deler av genet som ikke koder for proteiner og blir fjernet fra mRNA i en prosess kalt mRNA-spleising.

• Translasjon er oversettelse fra mRNA til en amino­ syre­kjede. Translasjonen foregår på ribosomene i cytosol. På ribosomet kobles aminosyrene sammen ved hjelp av tRNA, rRNA og translasjonsfaktorer. Rekkefølgen på aminosyrene bestemmes av baserekkefølgen i mRNA, hvor et kodon (base­ triplett) koder for en bestemt aminosyre. • På bakgrunn av aminosyrenes kjemiske egenskaper, gitt ved R-gruppen, vil proteinene danne ulike strukturer og flere aminosyrekjeder settes sammen. Proteiner har svært mange funksjoner i en celle og i en organisme. • En celles funksjon er avhengig av hvilke gener som uttrykkes, altså hvilke proteiner som er i cellen. Et gen kan skrues av og på ved hjelp av transkripsjons­­­ faktorer som fester seg til regulerings­områder utenfor genet. • Mutasjoner er forandringer i DNA eller RNA. Konsekvensene av mutasjoner er helt avhengig av hvor i DNA de skjer. • Mutasjon som involverer ett basepar, kalles en punktmutasjon. • Det er tre hovedmekanismer som gir mutasjoner: substitusjon, insersjon og delesjon. • Faktorer som fremmer eller øker sannsynligheten for en mutasjon, er mutagener, som for eksempel stråling.


126 • Kapittel 3

Oppgaver Tips til oppgavene finner du på www.gyldendal.no/bi 1 a Tenk deg at du skal lage DNA. Hvilke molekyler trenger du? b Hva står bokstavene i «DNA» for? c Hva er et nukleotid? 2 a Tegn og forklar hvordan DNA-molekylet er bygd opp. b Vis på figuren 3’og 5’ende. c Begrunn hvordan du gjorde merkingen i b.

12 Hva menes med utsagnet «DNA har et firebokstavers alfabet»? 13 a Sett navn på delene av figuren nedenfor. b Tegn aminosyrene alanin, glutamin og tyrosin. c Når sier vi at en aminosyre er essensiell for en organisme?

3 Forklar hvorfor DNA-molekylet blir kalt en dobbelheliks. 4 Hvilke baser i DNA-molekylet er komplementære? 5 Basene fra en DNA-prøve ble analysert. Hvilket resultat er korrekt? A antall A = antall G B antall T + antall A = antall C + antall G C antall G = antall C 6 Den ene tråden i en DNA-bit har følgende baserekkefølge: -CTTACTCGTCAAGGTCa Bestem baserekkefølgen til den komplementære DNA-tråden. b Hvor mange basepar har DNA-biten? 7 Gjør rede for organiseringen av DNA i kromosomer både i prokaryoter og i eukaryoter. 8 Hva er et plasmid, og hvorfor er det fordelaktig for bakterier å ha plasmider? 9 Den totale lengden på DNA i et menneske er ca. 20 milliarder kilometer, noe som tilsvarer 67 ganger fram og tilbake til sola. Hvor langt er det fra jorda til sola? Vis utregningen din. 10 Drøft utsagnet «DNA-et i en celle kan sammenlignes med en kokebok». 11 Forklar med egne ord hva gener er.

H

H N H

C

R

O C OH

14 a Tegn og forklar med egne ord hvordan mRNAmolekylet er bygd opp. b Beskriv forskjellene i oppbygningen av et DNA04_45 Aminosyre molekyl og et RNA-molekyl.

15 a Gjør rede for de generelle transkripsjonsfaktorenes rolle under transkripsjonen. Bruk enkle illustrasjoner i forklaringen din. b Tegn og forklar hvordan RNA-polymerase driver transkripsjonen av genet. c Hvordan slutter transkripsjonen av et gen? 16 a Hva kalles den første utgaven av det transkriberte genet? b Hvordan modifiseres denne utgaven i endene? c Hvorfor modifiseres denne utgaven i endene? 17 a Forklar fagordene introner og eksoner. b Hvorfor fjernes intronene fra pre-mRNA? c Hvordan fjernes intronene? Hva heter denne prosessen? 18 Hvorfor er det bare riktig spleiset mRNA som blir transportert ut av cellekjernen? 19 Hva menes med den genetiske koden, og hvorfor sier vi at den er universell?


Fra gen til protein • 127

20 Vi tenker oss at DNA-sekvensen nedenfor er del av den kodende tråden av et gen:

29 Sammenlikn transkripsjon og translasjon ved å fylle ut i tabellen nedenfor. Du finner en tabell som du kan bruke til å fylle inn i, på nettstedet til boka.

5’- G G T A T G C C A T T G G C A T A C –3’ Transkripsjon Translasjon a Hva er baserekkefølgen i den komplementære DNA-tråden? b Bestem baserekkefølgen i mRNA. c Hvilken aminosyrekjede koder DNA-sekvensen for? 21 Det finnes tre hovedtyper av RNA i en eukaryot celle.

Hvor skjer prosessene? Kopieringsgrunnlag Molekyler som er involvert

a Beskriv de tre typene og hvilken funksjon de har i en celle.

Enzymer som er involvert

b Hvor mange ulike mRNA-er tror du vi kan finne i en celle? Begrunn svaret ditt.

Produkt

22 Beskriv hvordan en aminosyre bindes til tRNA. Hvorfor er det alltid samme aminosyre som bindes til en bestemt tRNA? 23 Gjør rede for dette utsagnet: «Et antikodon bindes komplementært til et kodon.» 24 Hvordan starter translasjonen av mRNA? Tegn og forklar.

Bearbeiding av produktet 30 Du har isolert en DNA-sekvens og ønsker å finne ut hvilke aminosyrer denne DNA-sekvensen koder for. 3’- G C G G A T C A T A T A A C G T C C G T A C T TTTGAGTGGGTACGCTTCCCAAAA G T A C A A C T G T C C A T T G C C –5’

25 Tegn og forklar de ulike trinnene under translasjonen av mRNA. I forklaringen din skal du bruke faguttrykkene: ribosom, mRNA, kodon, antikodon, tRNA, rRNA, translokasjon

a Det som kjennetegner et promotorområde, er baserekkefølgen T A T A. Kan du finne promotoren i DNA-sekvensen?

26 Hvor mange DNA-sekvenser kan kode for aminosyrekjeden nedenfor?

c Finn startkodonet.

- Ser - Val - Met - Phe - Glu 27 Hvordan stopper translasjonen av mRNA? Tegn og forklar. 28 På figuren på side 113 lages det en aminosyrekjede. Finn ut hvilke aminosyrer de ulike symbolene (trekant, stjerne, runding og firkant) representerer.

b Bestem baserekkefølgen til mRNA.

d Bestem aminosyrerekkefølgen som DNA-sekvensen koder for. e Hvilke konsekvenser ville det fått dersom den første basen etter promotorsekvensen ble transkribert feil? f Hvilke konsekvenser ville det fått dersom den første basen etter startkodonet var blitt transkribert feil og A var byttet ut med U? 31 a Hvordan brytes mRNA ned etter translasjon? b Hvorfor kan vi si at nedbrytningen av mRNA regulerer proteindannelsen?


128 • Kapittel 3

Oppgaver 32 Hvilke PÅSTANDER om proteinsyntesen er gale? A Produksjon av mRNA fra DNA kaller vi translasjon. B Et kodon består av tre baser på mRNA. C Et antikodon består av tre baser på tRNA. D Et antikodon binder seg komplementært til et kodon. E En promotor er et område på mRNA. F Translasjonen blir regulert av transkripsjonsfaktorer. G En basetriplett og kodon er det samme. H RNA-polymerase kan ikke transkribere genet uten transkripsjonsfaktorer. 33 Forklar hvorfor proteiner ikke er klare til bruk rett etter translasjonen. 34 Ta utgangspunkt i figuren på side 115 og beskriv med egne ord de ulike strukturnivåene proteiner har. 35 Forklar og vis med en enkel skisse hvordan

39 Hos sangfugler deler nerveceller i hjernens sangsenter seg når det blir vår. Sollyset stimulerer til økt utskillelse av fettløselige kjønnshormoner. Beskriv hvordan kjønnshormoner regulerer genet som koder for celledelingsproteinet. I din beskrivelse skal følgende begreper være med: gen, transkripsjonsfaktor, promotor, RNA-polymerase, transkripsjon og translasjon. 40 a Forklar hva som kan skje når en transkripsjonsfaktor binder seg til et silenceområde til et gen. b Lag en skisse av det som skjer i a. 41 a Hvor i cellen finner vi DNA, mRNA og tRNA? b Hvilke fagord i høyre kolonne hører sammen med DNA, mRNA og tRNA? c Gi en forklaring på hvorfor de hører sammen. DNA mRNA

a proteiner blir transportert i en celle b proteiner blir modifisert i en celle c Gi eksempler på proteiner som blir modifisert og transportert ut av cellen. 36 Det finnes mange forskjellige typer proteiner. Ta for deg to typer og forklar funksjonen til disse to grundig. 37 Hva ligger i utsagnet «Regulering av genene bestemmer hvilke gener som uttrykkes»? 38 Gå sammen med en medelev og diskuter genregulering ved å bruke figuren på side 120.

tRNA

Silencer Eksoner Kodon Basetriplett Introner Gen Promotor Antikodon Enhancer

42 a Hva er en mutasjon? b Hva er forskjellen på en kromosommutasjon og en genmutasjon? c Når brukes faguttrykket punktmutasjon om en mutasjon?

43 Du har følgende DNA-sekvens: DNA

3’- A G T G G C G T C C T G C C C T G G A G T C T C C A T T T T A A A G C G –5’

Mutasjon 1

3’- A G T G G C G T C C T G C C C T G G A T T C T C C A T T T T A A A G C G –5’

Mutasjon 2

3’- A G T G G C G T C C C C T G G A G T C T C C A T T T T A A A G C G –5’

Mutasjon 3

3’- A G T G G C G T C C T G A T C C C T G G A T T C T C C A T T T T A A A G C G –5’

a Finn aminosyrekjeden som den ikke-muterte DNAsekvensen koder for. b I mutasjon 1 skjer det en punktmutasjon i posisjon 20. Hvordan har mutasjon skjedd? Hva heter mekanismen? c Hvordan har det skjedd en mutasjon i mutasjon 2? Beskriv mutasjonsmekanismen og angi posisjonen for mutasjonen.

d Hvordan har det skjedd en mutasjon i mutasjon 3? Beskriv mutasjonsmekanismen og angi posisjonen for mutasjonen. e Finn mRNA-sekvensene til de muterte DNAsekvensene. f Hvilke konsekvenser får mutasjonene?


Fra gen til protein • 129

44 Tegn og forklar de ulike mekanismene som gir genmutasjon.

46 Hva er et mutagen? Gi eksempler på ulike mutagener.

45 Under ser du en kromosommutasjon. Forklar hvordan mutasjonen skjer.

Gruppe-, nett- og presentasjonsoppgaver 47 Ta for dere en art og finn ut mer om størrelsen på genomet, antall gener og antall kromosomer. 48 DNA finnes også i andre organeller enn kjernen. Hvilke? Finn ut hva dette DNA-et betyr for cellen. 49 Diskuter hvordan introner kan være med på å øke variasjonsmulighetene av proteiner. 50 Begrunn hvorfor det ikke er nødvendig at korrekturlesingen av RNA-polymerase er så nøyaktig som DNA-polymerasens. Figur 04_47.eps 51 Lag et rollespill hvor dere setter opp stykket «Fra gen til Debbie Maizels debbie@zoobotanica.com protein». Dere bestemmer selv rollebesetning og rekvisitter.

52 Grønland har en gang fortjent sitt billedlige navn. Finn ut mer om hvordan forskere tror det så ut på Grønland for 450 000 år siden på grunnlag av DNA-funn. 53 Diskuter mulige konsekvenser av en mutasjon i et gen som koder for en transkripsjonsfaktor. 54 Ved Universitetet i Oslo er det en forskergruppe som har funnet et gen i vårskrinneblom (Arabidopsis thaliana) som regulerer bladfellingen. Dette genet heter IDA. Finn ut mer om dette genet, og diskuter en mulig kommersiell utnyttelse av dette funnet.

55 Det finnes en rekke små RNA-molekyler som sammen med RNaser regulerer nedbrytningen av mRNA. Forskere antar at de små RNA-ene (siRNA og miRNA) regulerer mRNA-nedbrytningen som et forsvar mot RNA-virus. Prosessen kalles RNA-interferens. Finn ut mer om hvordan RNA-interferens kan tenkes som et forsvar mot denne typen virus. 56 Vi deler 90 % av genene våre med rotter. Forskning viser at det som først og fremst skiller oss fra rotter, er områdene mellom genene. Rotter og mennesker har blant annet ulike enhancere og silencere. Diskuter hvorfor slike forskjeller er så avgjørende. 57 Fram til nå har fokus i genetikkforskningen vært rettet mot gener og genenes betydning, men områdene mellom genene har med stor sannsynlighet vel så stor betydning. Finn ut mer om noen av oppgavene områdene mellom genene kan ha. 58 Finn ut mer om overlappende gener i E.coli. Diskuter hvilke utfordringer dette gir for kartleggingen av gener.


130 • Kapittel 3

Gruppe-, nett- og presentasjonsoppgaver 59 Under ser dere genet som koder for en del av proteinet hemoglobin. Dette proteinet finnes inne i de røde blodcellene og sørger blant annet for transport av oksygen i blodet. DNA-sekvensen er hentet fra databaser som forskere bruker. I forskerverdenen er det ikke den DNA-tråden som blir transkribert, som vises, men alltid den andre, komplementære DNA-tråden. Sekvenser som ikke blir transkribert, vises med små bokstaver. Eksonene er tegnet med rosa farge. De oransje basene viser signalet til RNA-polymerasen om at transkripsjonen skal slutte. a Diskuter hvorfor det er hensiktsmessig å vise den komplementære DNA-tråden i stedet for den som blir transkribert.

b Finn promotorområdet på genet (gjenkjennes med baserekkefølgen T A T A på den DNA-tråden som blir transkribert). Hvorfor er alle gener avhengig av et slikt område? c Hvilke forskjeller er det mellom genet og pre-mRNA? d Finn ut hvor mange introner genet har. Merk av på figuren hvor intronene er. Diskuter hvordan spleisosomet kutter intron 2 i pre-mRNA. e Hva er det som kjennetegner signalet som slutter transkripsjonen? f Bruk deres kunnskaper om start- og stoppkodon og merk av på figuren hvor translasjonen starter og slutter.

5´....... a g g g a g c c a g g g c t g g g c a t a t a g t c a g g g c a g a g c c a t c t a t t g c t t ACATTTGCTT CTGACACAAC TGTGTTCACT AGCAACCTCA AACAGACACC ATG CTG CAC CTG ACT CCT GAG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG AAC GTG GAT GAA GTT GGT GGT GAG GCC CTG GGC AGG TTTGGTATCA AGGTTACAAG ACAGGTTTAA GGAGACCAAT AGAAACTGGG CATGTGGAGA CAGGAGAAGA CTCTTGGGTT TCTGATAGGC ACTGACTCTC TCTGCCTATT GGTCTATTTT CCCACCCTTAGG CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTC CAC GTG GAT CCT GAG AAC TTC AGG GTGAGTCTAT GGGACCCTTG ATGTTTTCTT TCCCCTTCTT TTCTATGGTT AAGTTCATGT CATAGGAAGG GGAGAAGTAA CAGGGTACAG TTTAGAATGG CAAACAGACG AATGATTGCA TCAGTGTGGA AGTCTCAGGA TCGTTTTAGT TTCTTTTATT TGCTGTTCAT AACAATTGTT TTCTTTTGTT TAATTCTTGC TTTCTTTTTT TTTCTTCTCC GAATTTTTAC TATTATACTT AATGCCTTAA CATTTGTGTAT AACAAAAGGA AATATCTCTG AGATACATTA AGTAACTTAA AAAAAAACTT TACACAGTCT GCCTAGTACA TTACTATTTG GAATATATGT GTGCTTATTT GCATATTCAT AATGTCCCTA CTTTATTTTA TTTTTAATTG ATACATAATC ATTATACATA TTTATGGGTT AAAGTGTAAT GTTTTAATAT GTGTACACAT ATTGACCAAA TCAGGGTAAAT TTTGCATTTG TAATTTTAAA AAATGCTTTC TTCTTTTAAT ATACTTTTTT GTTTATCTTA TTTCTAATAC TTTCCCTAAT CTCTTTCTTT CAGGGCAATA ATGATACAAT GTATCATGCC TCTTGCACCA TTCTAAAGAA TAACAGTGAT AATTTCTGGG TTAAGGCAAT AGCAATATTT CTGCATATAA ATATTTCTGC ATATAAATTG TAACTGATGT AAGAGGTTTC ATATTGCTAA TAGCAGCTAC AATCCAGCTA CCATTCTGCT TTTATTTTAT GGTTGGGATA AGGCTGGATT ATTCTGAGTC CAAGCTAGGC CCTTTTGCTA ATCATGTTCA TACCTCTTAT CTTCCTCCCACAG CTC CTG GGC AAC GTG CTG GTC TGT GTG CTG GCC CAT CAC TTT GGC AAA GAA TTC ACC CCA CCA GTG CAG GCT GCC TAT CAG AAA GTG GTG GCT GGT GTG GCT AAT GCC CTG GCC CAC AAG TAT CAC TAA GCTCGCTTTC TTGCTGTCCA ATTTCTATTA AAGGTTCCTT TGTTCCCTAA GTCCAACTAC TAAACTGGGG GATATTATGA AGGGCCTTGA GCATCTGGAT TCTGCCTAAT AAAAAACATT TATTTTCATT TCTGCCTAAT AAAAAACATT t a t t t t c a t t g c a a t g a t g t a t t t a a a t t a t t t c t g a a t a t t t t a c t a a a a a g g g a a t g t g g g a g g ....... 3´

60 Finn ut mer om de aminosyrene som er essensielle for mennesket. Hva bør vi spise for å få dem i oss? 61 Planter har en betydelig større mulighet for å danne ulike typer aminosyrer. Lag en presentasjon der dere viser hvordan planter kan skaffe seg aminosyrer eller lage dem ut fra karbonskjeletter helt uten at de «spiser proteiner».

62 Lag en fyldig forklaring på hvordan prioner fungerer, og hvorfor sykdommer som blir et resultat av dem, er svært skadelige. Lag en litteraturliste og vær kritisk til kildene deres. 63 Lag en kort liste over en del mutagener i omgivelsene våre. Ta så for dere et par av dem og presenter dem for de andre i gruppa.


Fra gen til protein • 131

64 Lag en spørreundersøkelse der dere sjekker hva «folk flest» vet om DNA og mutasjoner. Undersøkelsen skal ende opp som en slags sluttrapport for om regjeringen bør satse mer på opplæring rundt emnet DNA, mutasjoner og kreft. 65 Som biolog kan det noen ganger være slitsomt å lese hvordan mediene dekker en del naturvitenskapelige fakta. Nedenfor får du noen utsagn: • «Mutasjoner gjorde meg syk.»

• «Sol, både ekte og kunstig, skaper mutasjoner i cellene dine.» • «Strålte bort smerten og fikk livet i gave.» • «Arvet hudkreften fra mamma.» Ta for dere disse utsagnene og skriv et essay der dere gjør rede for hva som kan ligge bak slike uttalelser. Forklar også hva dere mener er biologifaglig rimelige antakelser, og hva dere mener er feil.

• «Hun må være en mutant – ingen i familien vår har blitt meteorolog før.»

Korte foredrag • Fra gen til protein

• Hva skjer på ribosomene?

• Funksjonen til RNA-polymerase

• Sammenlikning av DNA med en kokebok

• Proteiner er de viktigste store molekylene • Pass opp for mutagener

• Den genetiske koden er universell • Mutasjoner gjorde meg syk


4

Celledeling

Ord og faguttrykk du bør kunne før du begynner på kapitlet

• kjønnet formering

• prokaryot

• diploid

• gen

• haploid

• mutasjon

• gameter

• enzym

• eukaryot

Mål for dette kapitlet er at du skal kunne • forklare hvordan DNA blir kopiert før cellene deler seg • sammenlikne mitose og meiose med vekt på fordelingen av genmaterialet i cellene som blir dannet


134 • Kapittel 4

4

Vi består alle av celler. Små organismer har færre celler enn store organismer. Cellens evne til å dele seg er avgjørende for livet til en organisme. Vi har alle vært én celle, og denne befruktede eggcellen har delt seg, og delt seg, og delt seg. Hele delingsmaskineriet er nøye kontrollert, slik at hver lille prosess skjer i riktig rekkefølge og til rett tid.

4.1 Fra celle til organisme For encellete organismer, for eksempel en amøbe, gir en celledeling to nye avkom. For flercellete organismer gjør celledeling det mulig å utvikle seg fra en befruktet eggcelle, også kalt en zygote. Utviklingen fra en eneste celle til en flercellet organisme krever mange celledelinger. Men en flercellet organisme er ikke bare en stor klump med like celler. Cellene finnes i mange ulike størrelser Eggcelle (n)

Sædcelle (n)

MEIOSE

BEFRUKTNING

Diploid zygote (2n = 46) Testikler

Eggstokker

MITOSE og CELLEDIFFERENSIERING


Celledeling • 135

og former. I flercellete organismer utfører forskjellige celletyper mange ulike typer funksjoner. Celler i øret kan for eksempel oppfatte lyd, muskelceller kan trekke seg sammen, og nerveceller kan sende og motta elektriske signaler. I de første sju dagene av et menneskes fosterliv er alle celler like, men etter hvert utvikler de seg forskjellig. Utviklingen skyldes at gener skrues av og på, og cellene inneholder derfor ulike typer proteiner. Denne spesialiseringen av cellen kalles celledifferensiering. Vi mennesker består av ca. 200 forskjellige celletyper. Celledifferensiering foregår i alle flercellete organismer. Stamceller er celler som ennå ikke har gjennomgått full differensiering. Disse cellene kan dele seg og bli til mange ulike celletyper.

Når en celle først er differensiert, fortsetter den å dele seg akkurat som denne celletypen. De ulike celletypene går sammen og utvikler vev som går videre sammen og blir til organer. De ulike organene danner et ungt individ. Dette unge individet vokser og fornyer seg ved gjentatte celledelinger, mens celle­ delingen i et voksent individ først og fremst gir et tilskudd av nye celler som erstatter døde og ødelagte celler i organismen. Planter blir derimot i teorien aldri utvokst, slik at her fører celledelinger i «voksne» individer også til vekst.

Nervecelle

Muskelcelle Befruktet eggcelle (diploid zygote)

Blodcelle

Bindevevscelle

MITOSE

CELLEDIFFERENSIERING

Celledifferensiering. Cellene spesialiserer seg ved at ulike gener blir uttrykt. Cellene inneholder derfor forskjellige proteiner.


136 • Kapittel 4

Interfase

Vekst

DNA-kopiering

Vekst Del ings fase

Livssyklusen til en celle. 05_06 DNA-kopiering

De fleste cellene følger samme livssyklus – de vokser, og de deler seg. Cellens livssyklus inneholder to hovedfaser, interfasen og delingsfasen. Interfasen er den lengste delen av cellesyklusen, her vokser cellen og forbereder seg på celledeling. Flercellete organismer har to typer celledeling. Celledelingen som fører til vekst og vedlikehold av organismen, kalles mitose, mens celledelingen som gir kjønnsceller og mulighet for kjønnet formering, kalles meiose. Likt for begge typene er at før det kan skje en celledeling, må alt DNA i cellekjernen kopieres. Det skjer i interfasen. Kopieringen må skje raskt og ikke minst nøyaktig.

Mitose = vekstdeling Meiose = kjønnscelledeling

Sjekkpunkter: Nye ord og faguttrykk: zygote, celledifferensiering, interfase, delingsfase, mitose, meiose Hvilke to faser deler vi cellens livssyklus inn i? Hva skjer i de to fasene i cellens livssyklus? Hvordan kan en befruktet eggcelle bli til et individ?

4.2 Kopiering av DNA Kopiering av DNA er en komplisert biokjemisk prosess som involverer over tjue proteiner, og som krever energi i form av ATP. Mye av det vi vet om hvordan kopieringen fungerer, har vi lært gjennom å studere bakterier, men prosessene for kopiering av DNA er grunnleggende likt for prokaryoter og eukaryoter.

Starten på DNA-kopiering Kopieringen av et DNA-molekyl starter på bestemte steder på DNA-molekylet. For å kunne kopiere DNA-molekylet må de to trådene i dobbelheliksen skille lag, det vil si at hydrogenbindingene mellom de komplementære basene må brytes. Enzymet helikase begynner separeringen i startstedet og fortsetter i begge retninger ut fra det. Helikasen lager en kopieringsboble, og ved hver ende i kopieringsboblen er et Y-formet område hvor de nye DNA-trådene blir dannet, se figuren øverst på neste side. Kopieringen begynner med å lage en liten oppstartdel kalt primer. Prosessen skjer ved hjelp av enzymet primase. Det sirkulære bakteriekromosomet har ett startsted, mens eukaryote kromosomer har flere.


Celledeling • 137

Startsted

Helikase

Primer

DNA

Primase

Kopieringsboble

Starten på en DNAkopiering. Enzymet helikase deler de to DNA-trådene fra hverandre i startstedet på DNA. Enzymet primase lager en liten oppstartdel, primer, og kopieringen kan begynne.

DNA-kopiering Prinsippet bak DNA-kopieringen er at de to trådene i DNA-molekylet er komplementære, det vil si at hver DNA-tråd inneholder informasjon som er nødvendig for å lage den andre tråden. Når en celle kopierer sitt DNA, er hver av de to gamle DNA-trådene en mal for hvordan nukleotidene skal settes sammen i den nye, komplementære tråden. Basene i de nye nukleotidene danner hydrogenbindinger med baser på den gamle DNA-tråden etter baseparregelen: A med T og G med C. Nukleotidenes sukkermolekyl og fosfat blir bundet sammen med kovalente bindinger i den nye tråden. A T

A

C G

C

T A

T

T

A C

G A

T

C G

A

A

T

A T

G C

G

C

G C

2

A T

G

A T

1

T

T

A

A T

A T

C G

C G

T A

T A

T

A T

A T

G C

G C

G C

A

3

4

Skjematisk oversikt over DNA-kopieringen. 1 DNA-et som skal kopieres. Sukker-fosfat-rekkverket i DNA-molekylet er vist i mørkeblått. 2 Hydrogenbindingene mellom basene brytes, og de to DNA-trådene skiller lag. 3 Hver av de to gamle DNA-trådene er mal for hvordan den nye komplementære DNA-tråden settes sammen. Basene i de nye nukleotidene danner hydrogenbindinger med baser på den gamle DNA-tråden etter baseparregelen: A med T og C med G. Sukker-fosfat-rekkverket i de nye DNA-trådene er vist i lyseblått. 4 De to kopiene av DNA-molekylet består av en gammel og en ny DNA-tråd.

Kopieringen av DNA fortsetter i begge retninger ut fra startstedet til hele DNA-molekylet er kopiert. De nye DNA-trådene blir produsert ved hjelp av enzymkomplekset DNA-polymerase. DNA-polymerase kan ikke starte produksjonen, men fortsetter på primeren laget av enzymet primase. Ved hjelp av DNA-polymerase blir løse nukleotider i cellekjernen satt sammen, én etter én, til den voksende enden av den nye DNA-tråden, se figuren på neste side. De løse nukleotidene kommer fra andre ødelagte celler, enten organismens egne eller fra næring den tar til seg. Etter som kopieringen går framover, må stadig nye deler av det opprinnelige DNA-molekylet skilles fra hverandre. Helikase fortsetter å åpne dobbelheliksen i hver sin ende av kopieringsboblen.


138 • Kapittel 4

Startsted

Primer

C

G

G

T

A

C

C

A

T

C

C

T

G

A

A

DNA-polymerase

C

G

G

C

A

C

G

A

A

A

T

G

C

G C

G

T

A

T

T

C

A

G

G

G

C

A

T

T

G

C

T

C

C

C

3’

T

G

5’

C

Helikase

Ny DNA-tråd

C

T

G

A

Primer

Ny DNA-tråd

A

G C

G

A

T

C

G

G

C T

G

C

T

A

T

A

T

A

C

C C

G

G

G

T A

T

T

5’

G

C

G

A

G

G C

G

A

T T

C

C G

A

A

3’

A

T

A

C

DNA-polymerase

T G

Gammel DNA-tråd

5’

DNA-kopiering. Enzymet helikase åpner og deler det gamle DNA-molekylet. Enzymet primase lager en primer i retning 5’ → 3’. Enzymkomplekset DNA-polymerase fortsetter å lage ny DNA-tråd komplementær til den gamle. DNA-polymerase kan bare lage ny 05_04a DNA-kopiering DNA-tråd i retning 5’ → 3’. Den ene nye DNA-tråden blir derfor laget i små fragmenter. Hvert DNA-fragment starter med en primer. En primer er i virkeligheten mellom 5 og 10 nukleotider.

T

T

A

A

T

C G

G

C G

G

T A

G

G

T

A

A

T

C G

G

C

G

T

A

A

A

T

T

G C

C

G

C

A T

G

T

A

G

G

G

C

A

T

T

G

C

3’

T

C

C

C

A

A

A G C

G

5’

T

C

Ny sammenhengende DNA-tråd

C

G

C

Helikase

Ligase

C

DNA-polymerase 5’

A

A

C

A

Ny DNA-tråd

A T

G C

C

A

T

G

G

C T

C

G

C

A

T

A

T

T

A

G

G

C C

C G

T

G

C

5’

G

A

A

G

G C

A

G C

T

T

C G

T A

A

3’

A

T

A

C

DNA-polymerase

T G

Gammel DNA-tråd

5’

05_04b Ligase

Funksjonen til DNA-ligase. Primerne erstattes også med DNA-nukleotider og enzymet DNA-ligase limer alle de nye DNA-fragmentene sammen slik at de blir til en sammenhengende ny DNA-tråd også i retningen 3’ → 5’.


Celledeling • 139

I et DNA-molekyl går de to trådene i hver sin retning, se figuren på side 101. DNA-polymerase kan bare tilføre nukleotider til den tremerkede (3’) enden, derfor blir nye DNA-tråder alltid kopiert i retningen 5’ → 3’. For den ene av de nye DNA-trådene lager DNA-polymerasen derfor en kontinuerlig tråd i retningen 5’ → 3’. Men for den andre nye DNA-tråden, den som går i retningen 3’ → 5’, blir først små fragmenter kopiert i motsatt retning av forlengingen av DNA-tråden. Alle fragmentene starter med en primer. De små fragmentene limes sammen til en hel DNA-tråd av enzymet ligase, se figuren. De to kopiene av DNA, hvor hver består av en gammel og en nylaget DNAtråd, tvinnes sammen til to nye DNA-dobbelhelikser.

ligare (lat.) – binde

De små, nylagde DNA-fragmentene blir kalt okazakifragmenter etter en av japanerne som oppdaget dem i 1966.

Korrekturlesing av nylaget DNA Det er viktig å gjøre minst mulig feil under kopieringen. En av feilene som kan oppstå, er at det blir satt inn et nukleotid med en base som ikke er komplementær til basen på den gamle tråden, se mutasjoner på side 121. Dersom for eksempel den gamle DNA-tråden har basen A, skal det settes inn et nukleotid med basen T til den nye, voksende DNA-tråden. Ved feil kan det for eksempel settes inn et nukleotid med basen G, se figuren under. En slik feil fører til at det blir laget DNA med en annen baserekkefølge enn den opprinnelige. Gammel tråd A

G

G

C

A

T

G

G

A

C

A

T

A

T

C

C

G

T

A

C

C

T

G

T

A

G

Ny tråd

T

G

T

T

A

C

G

T

A

A

G skiftes ut med T

G er gal base DNA-polymerase

Korrekturlesing av nylaget DNA. Den komplementære basen til A er T, ikke G, som 05_05 er blitt satt innPolymerase her. En del av enzymkomplekset DNA-polymerase retter umiddelbart opp feilen.

Feil i baseparing oppstår omtrent for hvert 105 (100 000) nukleotid i en nylaget DNA-tråd. Heldigvis har DNA-polymerasen en innebygd korrekturleser. Her blir feilen reparert umiddelbart. Det finnes også en rekke andre DNA-reparasjons­ enzymer. Feilraten blir redusert til ca. én feil hver 109 (1 000 000 000) nukleotid i en nylaget DNA-tråd. Konsekvenser av ulike feil kan du lese om i blant annet kapittel 1 Evolusjon og kapittel 5 Genetikk. Ved dette tidspunktet i livssyklusen til en celle, altså etter at DNA er vellykket kopiert, går cellen inn i en ny vekstfase og forbereder seg på celledeling. Cellen vokser i størrelse og øker antall celleorganeller.

Interfase

Vekst

DNA-kopiering

Vekst Del ings fase

05_06 DNA-kopiering


140 • Kapittel 4

Sjekkpunkter: Nye ord og faguttrykk: DNA-kopiering, helikase, primase, primer, DNApolymerase, ligase Hva skjer i startstedet for en DNA-kopiering? Hvorfor trenger DNA-polymerasen en primer? Hvilken funksjon har enzymet ligase? Hva retter opp feil i DNA-kopieringen?

4.3 Mitose – produksjon av nye celler med identisk DNA mitos (gr.) – tråd osis (lat.) – utvikling

Den vanligste formen for celledeling er mitose. I mitosen blir det laget to nye celler fra den opprinnelige cellen. Disse nye cellene er genetisk like den opprinnelige cellen, det vil si at de har identisk DNA. Opprinnelig celle Homologe kromosomer

Homologe kromosomer

DNA-KOPIERING

Søsterkromatider

MITOSE og CYTOKINESE

Oversikt over mitosen. En celle blir to genetisk identiske celler.

To genetisk identiske nye celler

Kromosomer I kapittel 3 Fra gen til protein kunne du lese at de lineære DNA-molekylene er pakket som kromosomer. I diploide organismer har alle kroppsceller et dobbelt sett av kromosomer. Hvert sett utgjør et kromosompar, og individet har arvet ett kromosom fra hver av foreldrene. Kromosomene i kromosomparet er homologe siden de er like lange og bærer gener som kontrollerer de samme


Celledeling • 141

Sædcelle (n)

Eggcelle (n)

×

BEFRUKTNING

Homologe kromosomer

Homologe kromosomer

Diploid zygote (2n)

Homologe kromosomer i et kromosom­par. Homologe kromosomer er like lange og inneholder gener som kontrollerer de samme egenskapene. De utgjør et par, ett kromosom fra hver av foreldrene. For å vise opphavet til kromosomene i et kromosompar er de tegnet med forskjellig fargenyanse.

Kromosomer i en menneskecelle. Våre celler har 46 kromosomer totalt, 22 par homologe autosomer og ett par kjønns­ kromosomer. Er dette en gutt eller jente?

arvelige egenskapene. Om vi for eksempel ser på genet som kontrollerer egenskapen ørevoksproduksjon, er det lokalisert på ett bestemt sted på et kromosom. Det homologe kromosomet har også et gen som kontrollerer ørevoksproduksjon på samme sted. Dette lærer du mer om i neste kapittel. Kromosomene hos diploide organismer består av autosomer og kjønns­ kromosomer. Mennesket har 44 autosomer og 2 kjønnskromosomer. Hos menn er ikke kjønnskromosomene homologe. Etter DNA-kopieringen består hvert enkelt kromosom av to kopier, kalt søster­ kromatider. Søsterkromatidene henger sammen i et bestemt område kalt sentromér. I starten av delingsfasen blir hvert kromosom kveilet ytterligere opp, og kromosomet blir både tykkere og kortere. Kromosomene er nå synlige i et lysmikroskop, se figuren på side 103.

DNA-KOPIERING Sentromér

«Gi meg kromosomet ditt, så skal jeg fortelle hvor gammel du er.» I enden av hvert kromosom finnes en repeterende DNA-sekvens som beskytter kromosomet. Dette området blir kalt en telomer, og ved hver DNAkopiering blir telomeren litt kortere. Telomerer blir ofte brukt som markører for biologisk aldring.

Søsterkromatider


142 • Kapittel 4

De ulike fasene i mitosen Delingsfasen består av mitosen og cytokinesen. I mitosen beskrives hvordan cellekjernen deler seg og blir til to identiske cellekjerner, mens det i cytokinesen beskrives hvordan cellen fysisk deler seg i to. Mitosen er delt inn i fem faser: profase, prometafase, metafase, anafase og telofase. I tabellen under vises hva som skjer i de ulike fasene. Her tar vi utgangspunkt i en tenkt celle med bare to kromosompar, og hvert av kromosomene består av to kopier (søster­ kromatider). Kromosomene er tegnet med forskjellige farger for at du lettere skal kunne følge det enkelte kromosomet.

Interfase Cellekjerne

MITOSE Profase

Prometafase

Metafase

Anafase

Telofase

Cytokinese

Spindeltråd Midtplanet

Sentromér

Hendels

Blir ikke regnet som en del av mitosen. Her skjer DNAkopieringen. Kromosomene er lange og tynne.

Kromosom

Søsterkromatider

Kromosomene består av to kopier (søster­ kromatider). De kopierte kromosomene kveiles opp ytterligere og blir synlige i lys­mikro­skopet. Det blir laget spindel­tråder bygd opp av mikrotubuli.

Kjerne­membranen løser seg opp. Spindel­trådene fester seg til sentroméren i kromosomene. De kopierte kromosomene beveger seg mot midt­planet i cellen.

kytos (lat.) – celle kinesis (gr.) – bevegelse

Separerte søsterkromatider

De kopierte kromosomene samles enkeltvis i midt­­planet i cellen.

De kopierte kromosomene blir splittet når søster­kromatidene skiller lag. Spindel­trådene blir forkortet og trekker de to søster­kromatidene til hver sin ende. Resultatet blir identiske og fullstendige sett kromosomer ved hver ende.

Spindel­trådene forsvinner, og det blir laget to nye kjerne­ membraner rundt kromo­somene. Kromosomene blir tynnere og lengre fordi noe av kveilingen løser seg opp. Telofasen er slutten på mitosen.

Blir ikke regnet som en del av mitosen. Cellene blir fysisk separert. Resultatet er to diploide celler som går inn i interfase.

Etter mitosen deler cellen seg slik at hele celleinnholdet blir fordelt omtrent likt mellom de to nye cellene. Den fysiske separasjonen kalles cytokinese. I dyre­ celler blir cellen snørt av på midten og delt i to. I planteceller blir det laget en celleplate i midten av cellen. Celleplaten dannes når vesikler med materiale til cellevegg smelter sammen. Celleplaten går sammen med den opprinnelige cellemembranen, og cellen deler seg i to med cellevegg mellom seg, se figuren på neste side. Resultatet for begge celletypene er to nye diploide celler med identisk DNA som den opprinnelige cellen. I en flercellet organisme er det voksne individet et resultat av enormt mange mitoser. Derfor er alle cellene i et individ utstyrt med identisk DNA.


Celledeling • 143

Inne i cellen er det et helt maskineri av enzymer som styrer og kontrollerer cytokinesen. Dersom det skjer mutasjoner i genene som koder for disse enzymene, kan separasjonen komme ut av kontroll, og det kan føre til store skader i organismen.

Cytokinese i dyreceller

Nye dyreceller

Cytokinese i planteceller

Celleplate

Nye cellevegg

Vesikler med celleveggmateriale

Nye planteceller

Sjekkpunkter: Nye ord og faguttrykk: kromosompar, homologe kromosomer, autosomer, kjønnskromosomer, søsterkromatider, sentromér, profase, prometafase, metafase, anafase, telofase, cytokinese Er alle kromosomer i kromosompar homologe? Hva er forskjellen mellom et søsterkromatid og et kromosom? Forklar hva som skjer i de ulike fasene under mitosen. Er cytokinesen en del av mitosen? Hva er forskjellen mellom cytokinese i planteceller og i dyreceller?


144 • Kapittel 4

4.4 Meiose – produksjon av kjønnsceller meiosis (gr.) – forminskning

I en ukjønnet formering blir det ikke utvekslet DNA mellom to individer. Her er de nye cellene en kopi av opphavscellen med samme DNA. I eukaryote celler er mitose delingsmekanismen for ukjønnet formering. De aller fleste flercellete organismene formerer seg kjønnet. Her møtes to individer av motsatt kjønn. Kjønnsceller (gameter) fra hvert av individene smelter sammen og utvikler en zygote. Kjønnscellene har bare ett enkelt sett med kromosomer og er derfor haploide (n). Zygoten er diploid (2n), og hvert kromosompar har fått ett kromosom fra hver av kjønnscellene. Høyerestående planter og dyr produserer kjønnsceller (gameter) fra diploide celler i spesialiserte organer. De diploide cellene må dele seg til haploide celler for å kunne lage kjønnsceller. En deling fra diploide til haploide celler er en meiose.

De ulike fasene i meiosen I likhet med mitosen starter meiosen etter at alt DNA-et i cellen er kopiert. For meiose er det spesielt viktig at kopieringen skjer korrekt, siden kopieringsfeil blir overført til neste generasjon. Etter DNA-kopieringen består hvert enkelt kromosom av to søsterkromatider som er festet sammen i sentroméren. I starten av delingsfasen blir hvert kromosom kveilet ytterligere opp, og kromosomet blir både tykkere og kortere. Kromosomene er nå synlige i et lysmikroskop. Kromosomer. Bilde av kromosomer i starten av delingsfasen. Kromosomene er kopierte og består av to søsterkromatider som er bundet sammen i sentroméren.


Celledeling • 145

Cellen går nå inn i to etterfølgende delinger, meiose I og meiose II. Hver av delingene deles inn i fem faser med samme navn som fasene under mitose: profase, prometafase, metafase, anafase og telofase. I tabellen på neste side vises hva som skjer i de ulike fasene i de to delingene. Vi tar også her utgangs­ punkt i en tenkt diploid celle med bare to kromosompar. Kromosomene er tegnet med forskjellige farger for at du lettere skal kunne følge det enkelte kromosomet. Cellen gjennomgår cytokinese både etter meiose I og etter meiose II. I meiosen blir det laget fire nye haploide celler fra den opprinnelige diploide cellen. Opprinnelig diploid celle i gonadene (kjønnsorganene) Homologe kromosomer

Homologe kromosomer

DNA-KOPIERING

Søsterkromatider

MEIOSE I og CYTOKINESE

MEIOSE II og CYTOKINESE

Fire haploide kjønnsceller (gameter)

Oversikt over meiosen. En diploid celle blir til fire haploide kjønnsceller (gameter).


146 • Kapittel 4

Interfase

MEIOSE I: Separering av homologe kromosomer Profase I

Prometafase I

Metafase I

Anafase I

Telofase I

De kopierte kromosomene fra hvert homologe par skiller lag ved at de blir trukket mot hver sin ende ved hjelp av spindeltrådene.

Det blir laget to nye kjerne­membraner med halvert kromosom­tall i hver kjerne. Hvert kromosom består fremdeles av to søster­ kromatider.

Cytokinese

Spindeltråd Cellekjerne

Midtplanet

Overkrysning

Søsterkromatider Sentromér

Blir ikke regnet som en del av meiosen. Her skjer DNAkopieringen. Kromosomene er lange og tynne.

De kopierte kromosomene kveiles opp ytterligere og blir synlige i mikro­ skopet. Homologe kromosomer holdes sammen i kontakt­punkter. Her kan det skje overkrysning. Det blir produsert spindeltråder bygd opp av mikrotubuli.

Kjernemembranen løser seg. Spindel­trådene fester seg til sentroméren i kromosomene. De kopierte kromosomene beveger seg mot midtplanet i cellen.

De kopierte kromosomene samler seg parvis i midtplanet i cellen. Homologe kromosomer ligger rett overfor hverandre.

MEIOSE II: Separering av søsterkromatider Profase II

Prometafase II

Metafase II

Anafase II

Telofase II

Det blir produsert spindeltråder bygd opp av mikrotubuli.

Kjerne­membranen går i opp­løsning. Spindel­trådene fester seg til sentroméren i kromo­somene. De kopierte kromosomene beveger seg mot midt­planet i cellen.

De kopierte kromosomene plasserer seg enkeltvis i midt­planet i cellen.

De kopierte kromosomene blir splittet når søster­kroma­tidene skiller lag. Spindel­trådene blir forkortet og trekker de to søster­ kromatidene til hver sin ende.

Spindeltrådene forsvinner, og det blir utviklet to nye kjernemembraner. Kromosomene blir tynnere og lengre fordi noe av kveilingen løser seg opp.

Cellen deler seg i to, og begge går i gang med ny deling. Resultatet er to haploide celler, men hvert kromosom består frem­deles av to søster­ kromatider.

Cytokinese

Blir ikke regnet som en del av meiosen. Begge cellene deler seg fysisk i to. Resultatet blir fire haploide kjønns­celler.


Celledeling • 147

Genetisk variasjon I en ukjønnet formering blir avkommet genetisk likt opphavet. Men det kan skje mutasjoner i kopieringen av DNA, og det kan gi en liten variasjon fra generasjon til generasjon. Også i en kjønnet formering kan mutasjoner under produksjonen av kjønnsceller gi genetisk variasjon. Men viktigst for variasjonen er at i en befruktning blir gener fra to celler blandet fra ulike individer. Nye kombinasjoner av gener oppstår, og den nye generasjonen blir genetisk ulik opphavet. Opprinnelig diploid celle i gonadene (kjønnsorganene)

DNA-KOPIERING

To mulige veier i anafase I

Kombinasjon Kombinasjon 1 2

Kombinasjon Kombinasjon 3 4

Haploide kjønnsceller

Grunnlaget for den store variasjonen ligger i det som skjer i meiosen. Alle kjønnsceller (gameter) har ett kromosom fra hvert av de homologe kromosomene i kromosomparet. De to homologe kromosomene fordeler seg tilfeldig og uavhengig av hverandre. Figuren over viser kombinasjons­mulighetene i kjønns­celler til et tenkt individ med to kromosompar. Vi ser at i meiose I kan kromosomene fordele seg på to ulike måter. Det er som sagt tilfeldig hvordan kromosomene fordeler seg, men mulige kombinasjoner er fire ulike kjønns­celler. En generell formel for antall ulike kombinasjoner av kromosomer kan skrives slik: 2antall kromosompar

Genetisk variasjon. Her vises de ulike kombinasjonene av kromosomer i kjønns­cellene (gametene) for et individ med to kromosompar.


148 • Kapittel 4

I vårt tilfelle med to kromosompar gir det 22 = 4 mulige kombinasjoner av kromosomer i kjønnscellene. Ser vi på oss mennesker som har 23 kromosom­ par, får vi 223 = 8 388 608 mulige kombinasjoner av kromosomer i kjønns­ cellene våre. Dersom det blir en befruktning, møtes én eggcelle og én sædcelle. Hos mennesker gir det 223 · 223 = 246 (7,04 · 1013) mulige kombinasjoner av kromosomer når et menneskebarn blir til. Men variasjonsmulighetene er egentlig mye større. Under profase I i meiosen ligger kopierte kromosomer fra et homologt kromosompar fysisk inntil hverandre, og kromosomfragmenter kan bli byttet. Det kaller vi overkrysning. Overkrysning skjer på tilfeldige steder og ulikt ved hver meiose. Konsekvensene av overkrysning lærer du om i kapittel 5 Genetikk. Vi ser at både mutasjoner, den tilfeldige fordelingen av kromosomene under meiosen og overkrysninger gir avkommet en ny genetisk sammensetning sammenliknet med opphavet. Dette er utgangspunktet for at kjønnet formering bidrar til stor genetisk variasjon i en populasjon.

4.5 Sammenlikning av mitose og meiose Meiose og mitose har mange fellestrekk, men det er også store og viktige forskjeller. Hovedforskjellen er at i en mitose blir det laget nye celler med identisk mengde kromosomer som hos den opprinnelige cellen. I meiosen gir den opprinnelige cellen (diploid) opphav til fire nye celler med halvert antall kromosomer (haploide). Ved sammenlikning av mitose og meiose, bruk tabellene på side 142 og 146. Legg merke til at det er tre unike hendelser som bare skjer for meiosen: • I metafase I i meiosen legger de homologe kromosomene seg parvis i midtplanet. I mitosens metafase blir kromosomene lagt enkeltvis i midtplanet. • I anafase I i meiosen blir de to homologe kromosomene skilt fra hverandre. Det fører til at hver av de nye cellene inneholder ett kromosom fra hvert av kromosomparene. I mitosens anafase er det søsterkromatidene som skiller lag. Denne hendelsen kan sammenliknes med anafase II i meiosen. Den store forskjellen er at i mitosen har alle de nye cellene kromosomparene intakt. • I profase I i meiosen blir det utvekslet kromosomfragmenter mellom homologe kromosomer. Prosessen kalles overkrysning, og betydningen av dette kan du lese mer om i kapittel 5 Genetikk på side 170. Dette skjer ikke i mitosen.


Celledeling • 149

Tabellen under oppsummerer de viktigste forskjellene og likhetene mellom mitosen og meiosen. Sammenlikning av mitose og meiose.

Hendelse

Mitose

Meiose

DNA-kopiering

Ja Skjer i interfasen før mitosen begynner.

Ja Skjer i løpet av interfasen før meiosen begynner.

Antall delinger

Én

To

Antall nye celler og genetisk sammensetning

To Hver av dem er diploide (2n). Begge er genetisk identiske med den opprinnelige cellen.

Fire Hver av dem er haploide (n). De inneholder halvparten av så mange kromosomer som den opprinnelige cellen. Alle er genetisk forskjellig fra den opprinnelige cellen og fra hverandre.

Overkrysning (se side 170)

Nei

Skjer i profase I. Kopierte homologe kromosomer holdes sammen i kontaktpunkter hvor overkrysning kan skje.

Sjekkpunkter: Nye ord og faguttrykk: meiose I, meiose II, overkrysning Hva skjer i meiose I? Hva skjer i meiose II? Hvilke tre mekanismer gir genetisk variasjon i en kjønnet formering? Nevn tre hendelser som er forskjellige mellom mitose og meiose.

4.6 Kontroll av celledelingen Hva er det som gjør at noen celletyper deler seg oftere enn andre? Forskning viser at cellen har et eget kontrollsystem som starter og koordinerer de forskjellige hendelsene i en celles livssyklus. Det er fremdeles usikkert hvordan kontrolleringen foregår, men mange av de involverte signalmolekylene er identifisert. Det viktigste sjekkpunktet for en celle er om det skal gå inn i en celledeling eller ikke. Før en celle kan dele seg, må DNA kopieres. I dette sjekkpunktet blir blant annet cellestørrelse og celletilstand registrert. Og er cellen klar for deling, får den et internt «gå videre»-signal. Enkelte celler får aldri et slikt signal, og de deler seg derfor aldri. Cellen kan også få signaler fra utsiden av cellen som leder cellen inn i celledeling. Et viktig ytre signal for celledeling i høyerestående organismer er veksthormoner. Veksthormoner stimulerer celler til å dele seg oftere, se figuren på side 120.

Er cellen stor nok?

Kontrollsystem

Er DNA-kopieringen vellykket?

Kontroll av cellesyklus. 05_19 Kontrollsystem I livssyklusen til en celle er cellen gjennom flere kontrollpunkter, her merket med et stoppskilt.


150 • Kapittel 4

Elektronmikroskopbilde av Tetrahymena vorax. Når vekstvilkårene er gode deler T. vorax seg ca. hver 7. time.

Interfase = 6 t og 15 min

Delingsfase = 45 min

Livssyklusen til ciliaten Tetrahymena vorax. 0413_Delingsfase Hos sangfugler starter nervecellene i hjernens «sangsenter» å dele seg om våren som en reaksjon på økende mengde kjønnshormoner. Celledelingene gjør fuglene klare for sine syngende vårritualer.

Endepunktet i en celles livssyklus – celledød For encellete organismer betyr celledød at organismen dør. I flercellete organismer er det alltid en balanse mellom antall celledelinger og celledød. Det kan være ulike årsaker til at celler dør. De kan for eksempel bli ødelagt av andre celler på grunn av alder, eller de kan bli fysisk ødelagt av slag eller skadelige stoffer. Slike celleskader blir oftest raskt reparert av organismen fordi andre celler deler seg. apo (gr.) – bort ptosis (gr.) – fall

Celler kan også ødelegge seg selv. Når cellene blir programmert til å gå ut av cellesyklusen for å dø, kalles det apoptose. Mekanismene for apoptose er at cellen krymper seg selv ved å bryte ned for eksempel cellekjerne, mitokondrier, pigmenter, kloroplaster osv. Til slutt deler cellen seg opp i små biter. Apoptose sørger for at celler som ikke fungerer slik de skal, blir fjernet. En annen grunn til at celler gjennomfører apoptose, er at de vil vike plass slik at andre celler kan utvikle seg normalt. Eksempler på denne typen apoptose er når rumpetroll skal kvitte seg med halen, eller når bladstilken skal kvitte seg med bladene.


Celledeling • 151

Fra rumpetroll til frosker. Når rumpetroll skal bli til frosker må de kvitte seg med halen. I haleroten vil celler begå apoptose og dø. Det fører til svekkelse i haleroten, og halen vil falle av.

Mange forskere tror det er en sammenheng mellom mangel på apoptose og utvikling av kreftceller. Framtidens kreftmedisiner kan derfor få kreft­ celler til å begå apoptose.

Som sagt er det hele tiden en balanse mellom antall celledelinger og dermed nydannelse av celler i en organisme, og mellom antall celler som dør. En ubalanse i dette forholdet kan gi sykdom. I verste fall kan organismen dø.

Sjekkpunkter: Nye ord og faguttrykk: apoptose Hva blir kontrollert i de ulike kontrollpunktene i cellesyklusen? Hvorfor er apoptose viktig?


Sammendrag • Den evnen cellen har til å dele seg, er avgjørende for livet til en organisme. For encellete organismer gir celledeling nye avkom, mens for flercellete organismer gir celledelinger vekst, utvikling og fornyelse. • Alle cellene i en flercellet organisme har samme DNA, men cellene differensierer fordi ulike gener er aktive i de ulike celletypene. • Cellesyklusen kan deles inn i to faser, interfasen og delingsfasen. I interfasen vokser cellen, og DNA kopierer seg. I delingsfasen deler cellen seg enten ved mitose eller ved meiose. • DNA kopierer seg ved hjelp av en rekke enzymer, blant annet helikase, primase, DNA-polymerase og ligase. Helikase splitter de to DNA-trådene, primase lager en liten oppstartdel (primer), og DNApolymerase lager to nye DNA-tråder, hver av trådene er komplementær til den gamle DNAtråden. DNA-polymerase syntetiserer bare i retningen 5’ → 3’. Det gjør at den ene nye

DNA-tråden blir laget som små fragmenter som ligase limer sammen. • Mitose er utvikling av to genetisk identiske nye celler. Delingen skjer i ulike faser som samlet sett fører til at søsterkromatidene i et kopiert kromosom skiller lag. • Meiose er dannelsen av fire nye kjønnsceller med halvert antall kromosomer. Kjønnscellene er ikke genetisk like opphavscellen. • Mutasjon, en tilfeldig fordeling av kromosomene under meiosen og overkrysninger mellom homologe kromosomer, gir genetisk variasjon mellom avkommene. • Celledelingen blir kontrollert av egne kontrollsystemer i cellen.


Celledeling • 153

Oppgaver Tips til oppgavene finner du på www.gyldendal.no/bi 1 Ta utgangspunkt i figuren på side 134 og forklar hvordan du har blitt til. 2 Hvordan kan det være forskjellige typer celler i en organisme når alle cellene har samme DNA? 3 Beskriv kort hva som skjer i de to hovedfasene i livssyklusen til en celle. 4 Kryss av for riktig svaralternativ. Muskelcellene våre er forskjellige fra nervecellene våre fordi A de inneholder forskjellige gener B ulike gener er aktive C de har forskjellige kromosomer 5 Hvorfor beskriver vi de to trådene i DNA-molekylet ut fra hvilken retning de går i? 6 a Når kopierer DNA-et i en celle seg? b Hva er det første som skjer når DNA-et skal kopieres? Lag enkle tegninger som viser hva som skjer. c Hvorfor trenger DNA-polymerasen en primer? d Hvilken funksjon har enzymet ligase i DNAkopieringen? 7 Ta utgangspunkt i figuren på side 138 og tegn og forklar hvordan DNA-et blir kopiert. I besvarelsen din er det viktig at du presiserer hvilken retning DNA-trådene går. 8 Forklar hvorfor en av de to kopiene av DNA-molekylet består av en gammel og en nylaget DNA-tråd. 9 Gjør rede for DNA-polymerasen sin korrekturlesning av nylaget DNA-tråd.

12 a Tegn et kromosom med to søsterkromatider. Marker på figuren hvor sentroméren er. b Når består kromosomet av to søsterkromatider? 13 Ranger hendelsene under mitosen etter rekkefølge i tid. Gi en kort beskrivelse av hva som kjennetegner fasen, og tegn de ulike fasene. Bruk en diploid celle med tre kromosompar. Du finner en tabell som du kan bruke til å fylle inn i, på nettstedet til boka. Rekkefølge

Fase

Beskrivelse

Figur

Prometafasen Profasen Anafasen Telofasen Metafasen Cytokinese 14 DNA-innholdet i en diploid celle i første vekstfase av interfasen blir målt. Kall denne DNA-mengden for Z. Hva blir DNA-innholdet i cellen under profasen i mitosen? 15 En diploid organisme har celler med 11 kromosompar. a Hvor mange kromatider er synlig ved slutten av mitosens profase? b Hvor mange kromosomer beveger seg til hver ende under mitosens anafase? 16 Ta utgangspunkt i en haploid celle med tre kromosomer. Vis hvordan denne cellen deler seg til to datterceller.

10 Forklar med enkle skisser hva som menes med utsagnet «Kromosomene i et kromosompar er homologe».

17 Sammenlikn cytokinese i dyreceller og planteceller.

11 Hvilken celletype er en menneskecelle som inneholder 22 autosomer og ett Y-kromosom?

18 a Hvor foregår meiosen i et menneske? Hvor foregår meiosen i en frøplante? b Forklar hvorfor kjønnscellene i et menneske er haploide. c Hva er en zygote? Er zygoten haploid eller diploid? Begrunn svaret ditt.


154 • Kapittel 4

Oppgaver 19 En diploid celle i kjønnsorganene skal utvikle seg til kjønnsceller. Ranger hendelsene etter hverandre i tabellen. Flere av hendelsene kommer flere ganger. Begynn med signal om celledeling.

24 Hvor mange mulige kombinasjoner av kromosomer under produksjon av kjønnsceller kan finne sted a i en sjimpanse (48 kromosomer) b i en gullfisk (100 kromsosomer)

Rekkefølge

Hendelse

c i en jordbærplante (56 kromsosomer)

Cytokinese

25 Beskriv de tre mekanismene som gir genetisk variasjon.

Cellevekst DNA-kopiering

26 Gjør rede for dette utsagnet: «Meiose, i motsetning til mitose, gir stor genetisk variasjon.»

Meiose II Kontroll av cellesyklus Signal om celledeling Meiose I Dannelse av kjønnsceller

27 Hvilke PÅSTANDER om mitose og meiose er gale? A Mitose fører til to datterceller som er genetisk lik opphavscellen. B Meiose ligner på mitose fordi kromosomantallet blir redusert. C Mitose ligner på meiose fordi homologe kromosomer legger seg inntil hverandre.

20 Tegn de ulike fasene i meiose I og meiose II. Bruk en diploid celle med tre kromosompar. Forklar hva som skjer i hver fase. 21 Sammenlikn mitose og meiose ved å se på både forskjellene og likhetene. Bruk figurer i besvarelsen din. 22 Etter fødselen deler normalt ikke nerveceller hos mennesker seg. De kopierer derfor ikke DNA-et sitt. En forsker fant ut at DNA-mengden i en human nervecelle var lik Z. Forskeren målte DNA-mengden i fire andre celletyper fra mennesker. Hvilken celletype hører sammen med hvilken DNA-mengde? Mengde DNA

Hører sammen med

E Meiose ligner på mitose fordi de nye cellene er diploide. F Mitose ligner på meiose fordi DNA kopieres før delingen. 28 Vis på figuren kontrollpunktene i livssyklusen til en celle. Hva er det som blir kontrollert ved de ulike kontrollene? Interfase

Celletype

2Z

Eggcelle

1,6 Z

Beinmargcelle tidlig i interfasen

0,5 Z

Hudcelle i interfasen under DNA-kopiering

Z

D Meiose av en celle gir fire nye celler med samme antall kromosomer.

Tarmcelle i begynnelsen av mitosen

23 Vis hvordan tilfeldig fordeling av kromosomene under produksjonen av kjønnsceller gir stor genetisk variasjon. Ta utgangspunkt i en diploid organisme med tre kromosompar. Se bort fra overkrysninger.

Vekst

DNA-kopiering

Vekst Del ings fase

29 Forklar hvordan og hvorfor celler øverst i halepartiet til 05_06 DNA-kopiering rumpetroll begår apoptose.


Celledeling • 155

Gruppe-, nett- og presentasjonsoppgaver 30 Diskuter hvilke faktorer som påvirker livssyklusen til en encellet organisme. Her vil dere også finne mer informasjon i Bi 1, kapittel 2 Systematikk. 31 Lag et rollespill hvor dere setter opp stykket «DNA-kopiering».

35 Setter dere en purre i vann, vil det vokse ut røtter. a Beskriv livssyklusen til rotcellene. b Sammenlign livssyklusen til rotcellene med bladcellene i purren. c Forklar hvordan kontrollsystemet påvirker cellene både i rota og i bladet.

Rollelisten: – DNA

d Hvordan kan faktorer fra andre deler av planten påvirke rotcellen?

– Helikase

e Dersom dere tar ut purren av vannet – hva tror dere skjer da? (Det er mulig å studere cellene i røtter til purre, se øvelsen på side 415.)

– Primase – Primer – DNA-polymerase

36 Tenk dere at en celle i en menneskekropp deler seg uavbrutt. Diskuter hva som kan ha skjedd i denne cellen, og hvilke konsekvenser ukontrollert cellevekst kan ha.

– Ligase – Frie nukleotider 32 Hva er okazakifragmenter? Finn ut mer om funksjonen til disse fragmentene. 33 Drøft utsagnet «Gi meg kromosomet ditt så skal jeg fortelle hvor gammel du er». 34 I denne oppgaven skal dere illustrere hendelsene i mitosen ved hjelp av enten – tegninger

37 Diskuter hvorfor stamceller kan bli til mange ulike celletyper. 38 Finn ut mer om apoptose, både mekanismene i cellen og hvilke konsekvenser apoptose kan få for organismen. 39 Finn ut mer om sangfuglers reaksjon på at lysmengden øker om våren (tips: se oppgave 39, side 128).

– figurer (for eksempel ved at dere klipper ut en celle og kromosomer i papp) – animasjoner – mennesker

Korte foredrag • Livssyklusen til en celle

• Telomerer

• Fra celle til organisme

• Hvilken betydning genuttrykket har for en celle

• Hvorfor DNA kopieres før celledeling

• Meiose, i motsetning til mitose, gir stor genetisk variasjon

• Matematisk grunnlag for genetisk variasjon • Hvordan rumpetroll mister halen


5

Genetikk

Ord og faguttrykk du bør kunne før du begynner på kapitlet

• gen

• meiose

• mutasjoner

• enzym

• kromosomer

• diploid

• søsterkromatider

• homologe

Mål for dette kapitlet er at du skal kunne • sette opp og teste hypoteser for kjønnsbundet og dihybrid arvegang med og uten kobling av gener • forklare hvordan regulering av gener kan styre biologiske prosesser • forklare genetiske sykdommer ved å bruke kunnskap om arv og mutasjoner • gjøre greie for hvordan samspillet mellom arv, miljø og livsstil kan påvirke helsen hos mennesker


158 • Kapittel 5

5

Alle levende organismer er produkter av arv og miljø. Men hva er arv, og hva er miljø? Og er det et klart skille? Utseendet vårt, som kroppsfasong og nese­ størrelse, er i stor grad bestemt av et samspill mellom en rekke gener. Men hva vi spiser, er avgjørende for både kroppsfasong og nesestørrelse. Alt ligger ikke i genene, men mye gjør det, og miljøet påvirker i hvor stor grad genene får «bestemme».

5.1 Hva er genetikk? Genetikk er læren om hvordan egenskaper går i arv. Det er viktig å merke seg at det som blir overført fra generasjon til generasjon, er arvestoffet og ikke egenskapen. Så tidlig som i 1866 rapporterte munken Gregor Mendel at egenskaper blir nedarvet etter visse mønstre. Mendel visste ingenting om DNA, og definerte et gen som en egenskap som nedarves. I dag vet vi at ett gen gir ett genprodukt (oftest et protein) og ikke en egenskap. De fleste egenskaper er styrt av et samspill mellom mange gener. Gregor Mendels arbeider fikk liten oppmerksomhet da de ble gitt ut i 1866 og i 1870. Samtidens forskere forstod ikke det han skrev, først og fremst fordi han var forut for sin tid. Det gikk over tretti år før Mendels arbeid ble videreført og genetikk som vitenskap ble grunnlagt.

Genetiske faguttrykk Kromosomene hos individer av samme art inneholder gener som koder for de samme genproduktene. Så hva gjør et individ innenfor en art unikt? Forklaringen ligger i at hvert gen finnes i forskjellige varianter. De ulike variantene av genet er bestemmende for samme egenskap, men fordi de er litt forskjellige, blir egenskapen også litt forskjellig. Det gjelder for eksempel genet som koder for øyefarge hos bananfluer. En variant av genet gir røde øyne, mens en annen variant kan gi hvite øyne. Et annet eksempel er genet som koder for ørevoksproduksjon hos mennesker. Den ene varianten gir klebrig, gul ørevoks, mens den andre varianten av genet kan gi en tørr og grålig ørevoks. genvariant = allel = genutgave = arveanlegg = gen

I denne boka bruker vi faguttrykket genvariant for å vise at genet har forskjellige utgaver. Begrepene allel, arveanlegg og genutgave kan også brukes. Men det er viktig å merke seg at de alle er gener. I tabellen på neste side finner du en oversikt over noen genetiske faguttrykk.


Genetikk • 159

Genetisk faguttrykk

Forklaring

Gen

Et avgrenset område av et kromosom som inneholder oppskriften på et funksjonelt produkt, oftest et protein.

Genet som koder for proteinet som gir den menneskelige egenskapen ørevoks.

Homologe kromosomer

Kromosom fra hver av foreldrene som inneholder de samme genene. De homologe kromosomene utgjør et kromosompar.

Mennesker har i alt 22 autosome kromosom­ par, hvor hvert par består av ett kromosom fra mor og ett kromosom fra far. Kromosomene i autosome kromosompar er homologe.

Genets locus

Ett gen har en bestemt plass på kromosomet. Denne plassen kalles genets locus. Hos to homologe kromosomer har ett gen samme locus.

På kromosom 16 hos mennesker er det et gen som koder for et protein som bestemmer den menneskelige egenskapen ørevoks. Dette genet har en bestemt plass på kromosomet, det vil si et bestemt locus.

Genvariant (allel, arveanlegg, genutgave)

Ett bestemt gen kan finnes i flere mulige varianter. Alle genvariantene har lik locus på homologe kromosomer.

Genet som koder for egenskapen ørevoks, foreligger i to varianter: den som gir gul, klebrig ørevoks, eller den som gir grå, tørr ørevoks. Genvarianten som gir klebrig ørevoks, er symbolisert med F, og genvarianten som gir tørr ørevoks, er symbolisert med f.

Eksempel

Figur Gen

06_01 GenHomologe

kromosomer

Genlocus 06_02 Homologe kromosomer

06_03 Genlocus Genvariant F

Genvariant f

06_04 Genpar Genvariant

Genpar

Genvarianter fra hvert sitt homologe kromosom utgjør et genpar.

I vårt eksempel kan et individ ha ett av tre ulike genpar for egenskapen ørevoks: FF, Ff, ff.

Fenotype

Fenotypen for en organisme kommer til uttrykk i de egenskapene organismen har. Egenskapene kan være synlige eller ikke synlige.

I vårt eksempel er fenotypen til individet enten gul, klebrig ørevoks eller grå, tørr ørevoks. Det dreier seg også ofte om egenskaper på biokjemisk nivå, for eksempel evnen til å bryte ned melkesukkeret laktose.

Genotype

Genotypen til en organisme bestemmes av hvilke genvarianter den inneholder.

I vårt eksempel har personer med grå, tørr ørevoks genotypen ff, mens både genotype FF og Ff gir gul, klebrig ørevoks.

Homozygot genpar

Et homozygot genpar har like genvarianter på de to homologe kromosomene.

Heterozygot genpar

Et heterozygot genpar har ulike genvarianter på de to homologe kromosomene.

I vårt eksempel er personene med genotypen Ff heterozygote.

Dominant og recessiv arv

En genvariant er dominant over en annen når den er bestemmende for fenotypen. Recessiv fenotype vises kun når begge genvariantene i genparet er recessive.

I vårt eksempel er F dominant over f. f er recessiv i forhold til F. Det betyr at dersom personen har genvarianten F i genparet, er fenotypen alltid gul, klebrig ørevoks.

06_05 Genpar

Ørevoks

06_06 Fenotype f

f Genotype ff

06_07 Genotype

I vårt eksempel er personene med genotypen FF og ff homozygote.

F

F Homozygote f genpar

06_08 Homozygot F

Heterozygot f genpar

06_09 Heterozygot

f


160 • Kapittel 5

Mendels arvelover Mendel valgte seg egenskaper som var mulig å studere ved at egenskapen antakelig skyldtes ett genpar. I ettertid vil vi si at han hadde stor flaks med utvelgelse av egenskaper. Eller jobbet han bare videre med egenskapene han kunne forklare? Mendel gjorde mange forskjellige krysningsforsøk, ett av dem var mellom erteplanter hvor han så på egenskaper knyttet til ertenes farge og form. Han gjentok forsøkene mange ganger, samtidig som han hver gang brukte mange erteplanter. På bakgrunn av alle krysningsforsøkene sine formulerte han to arvelover. Arvelovene er tilpasset vår kunnskap om gener, men lovene bærer hans navn og gjelder den dag i dag. • Mendels første arvelov: Hver av genvariantene i genparet skiller lag tilfeldig og har derfor lik sannsynlighet for å bli ført videre til neste generasjon. • Mendels andre arvelov: Ulike genpar fordeles til neste generasjon uavhengig av hverandre.

Gregor Mendel (1822–1884)

Den andre arveloven gjelder bare for gener som sitter på ulike kromosomer. De egenskapene som Mendel valgte ut, vet vi i dag ligger på ulike kromosomer, slik at de faktisk blir nedarvet uavhengig av hverandre. Vi skal i avsnittet om koblete gener se at gener på samme kromosom følger hverandre og blir nedarvet sammen. Det er verdt å merke seg at de fleste arvelige sykdommer og egenskaper for øvrig ikke følger mendeliansk nedarving. En egenskap er oftest styrt av et komplekst samspill mellom mange gener og mellom miljøet. Det skal vi komme tilbake til seinere i kapitlet.

Sjekkpunkter: Nye ord og faguttrykk: genvariant, genpar, homozygot, heterozygot, genotype, fenotype, recessiv Hva er genetikk? Hvem var Gregor Mendel? Hva er et gen, og hva mener vi med genets locus? Forklar forskjellen mellom et kromosompar og et genpar. Forklar forskjellen mellom genotype og fenotype. Forklar forskjellen mellom homozygot og heterozygot genotype. Hva er dominant arv? Formuler Mendels arvelover.


Genetikk • 161

5.2 Monohybrid arvegang I monohybrid arvegang følger vi nedarving av én egenskap som bestemmes av ett genpar. Mendel studerte blant annet egenskaper hos erteplantene. Mange av erteplantenes egenskaper er bare styrt av ett genpar, for eksempel blomster­farge (rød/hvit), ertefarge (gul/grønn) og erteform (rund/skrukkete). Men det er verdt å merke seg at hos oss er det relativt få egenskaper som bare er styrt av ett gen­par, se tabellen på side 184. For de fleste egenskapene er mange gener involvert. Når vi følger arvegangen til en egenskap, ser vi på nedarvingsmønstre gjennom flere generasjoner. Den første generasjonen blir kalt foreldregenerasjonen eller P-generasjonen. Krysser vi individer fra P-generasjonen med hverandre, får vi avkom som tilhører F1-generasjonen, og krysser vi individer fra F1-generasjonen innbyrdes, får vi en F2-generasjon.

T

t

T

Én egenskap som bestemmes av ett genpar mono – alene hybrid (lat.) – bastard

P står for parentes (lat.) – foreldre F står for filia (lat.) – datter

t

X

P-generasjon

Homozygot, dominant

Homozygot, recessiv

meiose

meiose

T

t

Kjønnsceller

T

t

T

t

X

F1-generasjon

Heterozygot

Heterozygot

meiose T

meiose

t

T

t

Kjønnsceller

T

T

t

T

T

t

t

t

F2-generasjon

Homozygot, dominant

Heterozygot

Heterozygot

Samme dominante fenotype

06_12 Kjønnsceller og egenskaper

Homozygot, recessiv Recessiv fenotype

Nedarvingsmønster til et genpar gjennom generasjoner. I P-generasjonen blir en homozygote dominant (symbolisert med genotype TT) krysset med en homozygot recessiv (symbolisert med tt). Eggcellene i P-generasjonen har alle den dominante genvarianten T, mens alle sædcellene har den recessive genvarianten t. Alle avkommene i F1-generasjonen blir da heterozygote (genotype Tt). De heterozygote individene i F1-generasjonen har like mange kjønnsceller med genvariant T som med gen­variant t. Krysser vi individer fra F1-generasjonen med hverandre, er det fire mulige genkombinasjoner for avkommene i F2-generasjonen.


162 • Kapittel 5

Vanligvis framstiller vi krysninger mellom to individer i et krysningsskjema. I et slikt skjema ser vi på sannsynligheten for avkommets genotype når de to individene blir krysset. Krysningsskjemaet viser oss altså mulige genkombinasjoner i et krysningsforsøk. Det er flere måter å tegne et krysningsskjema på, se figuren under. I denne boka har vi valgt den skråformede for lettest å illustrere genotypen til gametene (eggceller og sædceller). Hvordan setter vi opp et krysningsskjema? Det er flere måter å lage et krysnings­skjema på. I denne boka har vi valgt utformingen til venstre.

T

t

T

t

T

t

T

X

T

X

T

T

TT T

t

T Tt

t

t

Ttt tt

t

T

TT T

T Tt

t

Tt

tt

eller

06_13 Krysningsskjema

Vi tenker oss at vi gjør et forsøk hvor vi krysser erteplanter med forskjellige typer erter. Vi har et drivhus med planter som har gule erter og et annet drivhus med planter som har grønne erter. Drivhuset hindrer planter med andre genotyper å blande seg inn i krysningsforsøkene våre. Ertefargen er bestemt av ett genpar og hvilke genvarianter dette genparet har. En genvariant gir gule erter, mens den andre gir grønne erter. Forsøkets P-generasjon er en plante med gule erter og en plante med grønne erter. Vi krysser disse plantene. Alle plantene i F1-generasjonen har fenotypen gule erter. Vi krysser deretter Erteplanter. Figuren viser fenotypene gule og grønne erter.

Erteplante

Erteplante

Belg med grønne erter

06_11 Monohybrid arv

Belg med gule erter


Genetikk • 163

planter i F1-generasjonen med hverandre. Resultatet av denne krysningen (F2-generasjonen) er 96 planter med fenotypen gule erter og 32 planter med fenotypen grønne erter. Hvordan kan det forklares? Svaret er at genvarianten som gir gul farge (symbolisert med G), er dominant over genvarianten som gir grønn farge (symbolisert med g), som da er recessiv. I P-generasjonen hadde erteplanten med fenotypen gule erter genotypen GG og var homozygot dominant. Erteplanten med fenotypen grønne erter hadde genotype gg, og var homozygot recessiv. Etter meiosen inneholder kjønns­cellene til erteplanten med gule erter genvarianten G, mens kjønnscellene til erteplanten med grønne erter inneholder genvarianten g. Ved befruktning får vi en F1-generasjon med den heterozygote genotypen Gg. Siden G er dominant over g, får alle i F1generasjonen fenotypen gule erter. Dersom vi fortsetter å studere erteplanter og lar de heterozygote individene i F1-generasjonen selvpollinere, kan vi se på sannsynligheten til avkommets genotype i et krysningsskjema. Under dannelsen av kjønnsceller i F1-plantene har halvparten av kjønnscellene genvarianten G på kromosomet, mens den andre halvparten av kjønnscellene har genvarianten g på kromosomet. For individer i F2-generasjonen er det tre mulige genkombinasjoner. Sannsynlig­heten for at et avkom skal ha genotype Gg, er 2¼ (50 %), mens sannsynligheten for å få enten genotype GG eller gg er ¼ (25 %). Det gir oss et forhold mellom genotypene på 1 : 2 : 1 (GG : Gg : gg). Det betyr ikke at ett av fire avkom alltid har genotypen GG, men dersom vi ser på et stort antall avkom, har omtrent ¼ genotypen GG. I vårt forsøk om erte­farge analyserer vi ikke genotypen, men ser på fenotypen. Siden gul ertefarge er dominant, er sannsynligheten for å få fenotypen gul ertefarge ¼ (GG) + 2¼ (Gg) = ¾, og sannsynligheten for grønn ertefarge er ¼ (gg). Forholdet mellom feno­typene blir derfor 3 : 1 (gul : grønn). Ser vi på tallene over antall planter i F2-generasjonen med gule og grønne erter, er det akkurat et slikt forhold vi finner.

P-generasjon G

G

g

X GG

g

gg

Homozygot dominant

g

G G

F1-generasjon

Homozygot recessiv

g

Gg Gg

Gg Gg

G

g

G

X Gg

Gg

Heterozygot

Heterozygot

G g F2-generasjon

g

G g

GG Gg

Gg gg

¾

¼

Fenotypeforhold 3 : 1

Monohybrid arvegang. Her ser vi på nedarving av 0805_Krysningsskjema erte­farge hos erteplanter. Krysnings­­skjemaet viser mulige genkombinasjoner når erteplanter krysses. Ertefarge styres av genvariantene G som gir gul farge, og g som gir grønn farge. G er dominant over g.


164 • Kapittel 5

X

PTC P

P

PP

pp

Homozygot dominant

PTC

P

p

p

Homozygot recessiv

p

P

p

Pp PTC

PTC

Pp

X

PTC

PTC P

p

Pp

Heterozygot

PTC

p

p

Homozygot recessiv

p

P

p

Pp PTC

pp

Pp

p

pp

PTC

PTC

PTC

Pp PTC

pp

Pp

Monohybrid arvegang. Her ser vi på nedarving av genet som koder for om vi smaker PTC eller ikke. Vi må her sette opp 0806_Krysning_tunge to skjemaer siden vi ikke vet om personen som smaker PTC, er homozygot eller heterozygot. P er dominant over p. Personen med et homozygot recessivt genpar smaker ikke PTC. PTC – Phenyl Thio Carbamide

Menneskets evne til å smake det veldig bitre stoffet PTC er i hovedsak bestemt av ett genpar. Genet som gir deg evnen til å smake PTC (symbolisert med P), er dominant, mens genet for ikke-smak av PTC (symbolisert med p) er recessivt. I skjemaet over finner du mulige genkombinasjoner dersom en person som smaker PTC, får barn med en person som ikke smaker PTC. Her må vi sette opp to skjemaer fordi vi ikke kan vite om personen som smaker PTC, er homozygot eller heterozygot.

Testkryssing Forsøkene med erteplanter er eksempler på hvordan genetikere testkrysser individer for å undersøke ulike nedarvingsmønstre. Testkryssing blir også brukt i plante- og dyreforedling. Her ønsker man å avle fram enkelte egenskaper, og da er det viktig å vite genotypen til individene man bruker. Er målet å avle fram for eksempel en sau med lang ull og genet for lang ull er dominant (symbolisert med U), gjelder det å velge ut homozygote langhårete avlsdyr. Langhårete sauer kan enten ha genotype UU eller Uu. Ved testkryssing tar bonden en langhåret vær og krysser den med søyer med kort ull (genotype uu). På figuren på neste side finner du krysningsskjema for to slike krysninger. Dersom væren er homozygot, får alle lammene lang ull. En heterozygot vær kan gi lam med både lang og kort ull. Vi ser fra krysningsskjemaet at forholdet da er 1 : 1 (lang ull : kort ull). I mange tilfeller er det enklere å genteste individet vi ønsker å drive avl med, i stedet for å testkrysse.


Genetikk • 165

u

X

u

U

uu

u

u

Uu

Homozygot recessiv

u

uu

Uu

u u

u

U

UU

Homozygot recessiv

U Uu

U

uu Heterozygot

u

X

u

U U

Uu Uu

Uu

uu

Homozygot dominant

Uu

½

½

Fenotypeforhold 1 : 1

0826_Sauer

Stamtavler Erteplanter er greie genetiske forskningsobjekter for krysningsforsøk. Vi mennesker er ikke det. En menneskegenerasjon er på rundt tjue år, og avkommene er få. I tillegg er det ikke lov å krysse mennesker i forsknings­ øyemed. I stedet kan vi studere resultatet av forplantning som allerede er gjort. Analysen går ut på å samle inn all informasjon om familiehistorien til en bestemt arvelig egenskap og presentere det i en stamtavle. Dersom arve­ formen er monohybrid dominant, tar vi utgangspunkt i de individene som viser fenotypen til homozygot recessiv genotype. Ser vi på eksempelet med ørevoks­ konsistens, vet vi at de med grå, tørr ørevoks er homozygot recessive, mens de med gul, klebrig ørevoks er enten homozygot dominant eller heterozygot. Under ser du en tenkt stamtavle til denne egenskapen.

Ff

FF eller Ff Gul, klebrig ørevoks Genotype: FF eller Ff

Ff

ff

ff

ff

Ff

06_39 Ørevoks

ff Grå, tørr ørevoks Genotype: ff

= Mann med gul, klebrig ørevoks = Kvinne med grå, tørr ørevoks

Stamtavle. Her følger vi nedarving av ørevoks­ konsistens i en familie gjennom tre generasjoner.

Ff

Ff

ff

FF eller Ff

Testkrysning. Her ser vi på nedarving av egenskapen ullengde hos sau. Krysnings­ skjemaene viser mulige genkombinasjoner når en homozygot recessiv søye blir krysset enten med en homozygot dominant vær eller med en heterozygot vær. Genet som gir lang ull (symbolisert med U), er dominant over genet som gir kort ull (symbolisert med u).


166 • Kapittel 5

Sjekkpunkter: Nye ord og faguttrykk: monohybrid arvegang, krysningsskjema, testkryssing, stamtavle Hva er en monohybrid arvegang? Hva ser vi på i et krysningsskjema? Hva er vi ute etter når vi testkrysser? Hva er presentert i en stamtavle?

5.3 Dihybrid arvegang To egenskaper som bestemmes av hvert sitt genpar

di – to

I en dihybrid arvegang følger vi nedarvingen av to egenskaper hvor hver av egenskapene bestemmes av ett genpar. Vi skal først se på dihybrid arvegang når genparene ligger på forskjellige kromosompar. I slike tilfeller blir genene nedarvet uavhengig av hverandre (se Mendels andre lov, side 160). For å illustrere en dihybrid arvegang gjør vi igjen et forsøk med erteplanter. Denne gangen skal vi studere nedarvingen av både farge og form på ertene. Ertene kan være gule eller grønne og ha rund eller skrukkete form. Gen­varianten som styrer gul farge (symbolisert med G), er dominant over genvarianten som gir grønn farge (symbolisert med g). På et annet kromosom ligger genparet som styrer formen på ertene. Genvarianten som gir rund form (symbolisert med R), er dominant over genvarianten som gir skrukkete form (symbolisert med r). Vi har ett drivhus hvor alle ertene er gule og runde, mens vi i et annet drivhus bare har erteplanter med grønne og skrukkete erter. P-generasjonen er homozygote med enten genotypene GGRR eller ggrr, og kjønnscellene fra P-generasjonen har enten genotypen GR eller gr. Krysser vi erteplantene i P-generasjonen med hverandre, ser du av figuren på neste side at alle i F1-generasjonen har erter som er gule og runde. Ut fra krysningsskjemaet kan vi lese at alle plantene i F1-generasjonen blir heterozygote med genotypen GgRr. Vi krysser deretter de heterozygote plantene fra F1-generasjonen med hverandre, se figuren på neste side. Kjønnscellene fra F1 kan være av fire typer, her symbolisert med GR, Gr, gR og gr. Vi trenger derfor et krysningsskjema på 4 x 4 ruter for å se på mulige genkombinasjoner i F2-generasjonen. Krysnings­ skjemaet viser også det typiske dihybride forholdet mellom fenotyper når nedarvingen er dominant. I vårt tilfelle er genene for gul farge og rund form dominante. Forholdet mellom fenotypene er 9 : 3 : 3 : 1 (gul og rund : gul og skrukkete : grønn og rund : grønn og skrukkete).


Genetikk • 167

P-generasjon G

G

R

X

R

g

GGRR Homozygot dominant

g

r

r

ggrr Homozygot recessiv

gr

GR

gr

GR GgRr F1-generasjon GgRr

GgRr GgRr

G

g

R

X

r

G

GgRr

g

R

r

GgRr

Heterozygot

Heterozygot

GR

GR

Gr

Gr GGRR

gR

gR GGRr

GGRr

gr

gr GGrr

GgRR

GgRR

F2-generasjon GgRr

GgRr

GgRr ggRR

Ggrr ggRr

/

9 16

/

3 16

/

3 16

/

1 16

GgRr Ggrr

ggRr ggrr

Fenotypeforhold 9 : 3 : 3 : 1

Dihybrid arvegang. Her ser vi på nedarving av ertefarge og erteform hos erteplanter. 0810_Krysning viser mulige genkombinasjoner når erteplantene krysses. Erte­fargen Krysningsskjemaet er styrt av gen­variantene G, som gir gul farge, og g, som gir grønn farge. G er dominant over g. Erteformen er styrt av gen­variantene R, som gir rund form, og r, som gir skrukkete form. R er dominant over r. De to genparene ligger på forskjellige kromosomer.


168 • Kapittel 5

Fra plantene i forsøket vårt teller vi i alt 208 erteplanter i F2-generasjonen. Vi ser at 115 planter har gule og runde erter, 41 planter har gule og skrukkete erter, 36 planter har grønne og runde erter, mens det bare er 16 stykker som har grønne og skrukkete erter. Disse tallene passer bra ut fra det forhold vi venter mellom fenotypene i krysningsskjemaet.

Fenotype for egenskapene erteform og ertefarge Forventet antall erteplanter

117

39

39

13

Faktisk antall erteplanter

115

41

36

16

Resultatet av krysnings­ forsøket. Her ser vi på 06_18 Erter egenskapene ertefarge og erteform hos erteplanter.

Gen 1

Gen 2

Koblete gener. To gener som sitter på samme kromosom, kaller vi koblete gener.

0822_Gener

Nedarving av koblete gener 1. Her ser vi på nedarving av egenskapene kroppsfarge og vingelengde hos bananfluer. Krysnings­ skjemaet viser mulige genkombinasjoner når en homozygot, dominant bananflue (genotype KKVV) blir krysset med en homozygot, recessiv bananflue (genotype kkvv). Kroppsfargen er styrt av genvariantene K, som gir grå farge, og k, som gir svart farge. K er dominant over k. Vingelengden er styrt av genvariantene V, som gir lange vinger, og v, som gir korte vinger. V er dominant over v. Genene sitter på samme kromosom.

Dihybrid arvegang med kobling av gener I nedarvingsmønstrene vi har gjennomgått til nå, har vi forutsatt at ulike genpar ligger på ulike kromosomer og blir nedarvet uavhengig av hverandre. Men det kan ligge tusenvis av gener på ett og samme kromosom. Vi kaller genene på ett kromosom for koblete gener, og de nedarves sammen. For å illustrere dihybrid arvegang av koblete gener ser vi på to egenskaper hos bananfluer: kroppsfarge og vingelengde. Kroppsfarge er styrt av genvariantene K, som gir grå farge, og k, som gir svart farge. K er dominant over k. Vingelengde er styrt av genvariantene V, som gir lange vinger, og v, som gir korte vinger. V er dominant over v. Genene er koblete, det vil si at de sitter på samme kromosom. Vi krysser en homozygot dominant flue med fenotype grå kropp og lange vinger (genotype KKVV) med en homozygot recessiv flue med fenotype svart kropp og korte vinger (genotype kkvv). Alle individene i F1generasjonen har grå kropp og lange vinger, og genotypen er heterozygot for begge genparene (KkVv), se figur under.

P-generasjon K V

K V

X KKVV

Homozygot dominant

kkvv KV

KV

kv

F1-generasjon

KkVv

KkVv KkVv

0823_Fluer2

k v

Homozygot recessiv

kv KkVv

k v


Genetikk • 169

K

k

V

v

X KkVv

kkvv

Heterozygot

KV kv

k v

k v

Homozygot recessiv

kv kv

KkVv KkVv

kkvv

kkvv

0824_1_Fluer3

I forsøket videre krysser vi individene fra F1-generasjonen (genotype KkVv) med homozygote recessive fluer (genotype kkvv). Siden genene sitter på samme kromosom, blir genene nedarvet sammen. Vi ville derfor forventet at den heterozygote flua har kjønnsceller med enten genotypen KV eller kv. Det ville gitt oss et forhold mellom fenotypene på 1 : 1 (grå kropp og lange vinger : svart kropp og korte vinger), se figuren over.

Nedarving av koblete gener 2. Her ser vi på nedarving av egenskapene kroppsfarge og vingelengde hos bananfluer. Krysnings­skjemaet viser mulige genkombinasjoner når en heterozygot bananflue (genotype KkVv) blir krysset med en homozygot, recessiv banan­flue (genotype kkvv). Kroppsfargen er styrt av genvariantene K, som gir grå farge, og k, som gir svart farge. K er dominant over k. Vingelengden er styrt av genvariantene V, som gir lange vinger, og v, som gir korte vinger. V er dominant over v. Genene er koblet og blir nedarvet sammen. Det røde krysset symboliserer at dette ikke er den fulle sannheten.

Men studerer vi fenotypene til avkommene, er ikke forholdet 1 : 1. I tillegg til foreldrenes fenotyper finner vi også flueavkom med nye kombinasjoner av de to genparene. Noen fluer er grå med korte vinger (genotype Kkvv), mens andre er svarte med lange vinger (genotype kkVv), se tabellen. Hva har skjedd?

Fenotype for egenskapene kroppsfarge og vingelengde

Antall flueavkom

06_22 Rekombinanter

kkVv

Kkvv

kkvv

KkVv

178

199

903

938

Resultatet av krysnings­ forsøket. Her ser vi på egenskapene kroppsfarge og vingelengde hos bananfluer.


170 • Kapittel 5

Overkrysning Søsterkromatider

Meiosens profase I. Hvert av 06_23 Profase 1 de homologe kromosomene i kromosom­paret består av to kopier (søsterkromatider). På denne figuren har vi lagt på forskjellige fargenyanser for å vise at hvert kromosompar har ett kromosom arvet fra far og ett kromosom arvet fra mor.

De nye genkombinasjonene i krysningsforsøket vårt har oppstått under dannelsen av kjønnsceller i den heterozygote forelderen. Kjønnsceller blir til ved meiose, se side 146. Husk at før meiosen blir alt DNA kopiert, og hvert av de homologe kromosomene i kromosomparet består derfor av to kopier (søsterkromatider). I meiosens profase I ligger de homologe kromosomene tett inntil hverandre og lager kontaktpunkter. I disse kontaktpunktene kan det oppstå brudd, og vi kan få en overføring av kromosomfragmenter mellom de homologe kromosomene. Dette kalles overkrysning. Dannelsen av kontakt­ punkter er tilfeldig, slik at overkrysning skjer ulikt for hver meiose og gjerne flere steder langs kromosomene under samme meiose. Hos oss mennesker skjer det ca. femti overkrysninger ved hver meiose. Det betyr at hvert kromosom vi arver fra mor, kan være en blanding av de to kromosomene hun har arvet fra sin far og mor. Det samme gjelder med hvert kromosom vi har arvet fra far.

Overkrysning. Under profase I i meiosen ligger homologe kromosomer, hver med to søsterkromatider, tett inntil hverandre og lager et kontakt­punkt. De homologe kromosomene er her vist med rød og oransje farge. Ved hjelp av en rekke enzymer danner det seg et brudd i kontaktpunktet, og kromosomfragmentene blir koblet sammen igjen på kryss. Det har skjedd en overføring av kromosomfragmenter mellom homologe kromosomer. 06_24 Kromosomer

re – på nytt

For homozygote individer har overkrysninger ingen betydning for den genetiske variasjonen i kjønnscellene, siden genene er like. Men for heterozygote individer fører overkrysninger til at noen kjønnsceller har andre genkombinasjoner enn de foreldrene har. I flueforsøket vårt har noen kjønnsceller hos fluemoren de nye genotypene Kv og kV. Flueavkom med andre genkombinasjoner enn foreldrene kalles rekombinanter. Rekombinasjon i meiosen skjer som sagt på vilkårlige steder langs kromosomet, og for at det skal utvikles rekombinanter, må overkrysningen skje mellom genene, i vårt forsøk mellom genene K/k og V/v, se figuren på neste side. En over­krysning nedenfor V/v gir ikke noen rekombinasjoner av disse genene. Jo større fysisk avstand det er mellom genene, desto større sjanse er det for at det kan skje en rekombinasjon mellom dem. Det er derfor interessant å finne


Genetikk • 171

K

k

V

v

X KkVv

kkvv

k

k

v

v

DNA-kopiering

DNA-kopiering

K

K

k

k

k

k

k

k

V

V

v

v

v

k

v

v

Meiose I:

Meiose I og II:

Overkrysning gir nye genkombinasjoner

Overkrysning gir ingen nye genkombinasjoner

K

K

k

k

V

v

V

v

Meiose II:

Separering av søsterkromatidene gir kjønnsceller med nye genkombinasjoner

k

K

k

K

V

v

v

V

Kjønnsceller

k

k

k

k

v

v

v

v

Rekombinante

KV kv Kv kV

kv

Kkvv Kkvv

Kkvv

kkvv Kkvv

kkVv 06_25_Fluer4

KkVv

kkvv

kkVv

kv

KkVv

kkvv

kkVv

kv

KkVv

kkvv

kkVv

kv

KkVv

Nedarving av koblete gener med overkrysning. Her ser vi på nedarving av de koblete genene som bestemmer kroppsfarge og vingelengde hos bananfluer. Overkrysninger under profase I i meiosen øker den genetiske variasjonen i eggcellene til fluemoren. Det skjer også overkrysninger i meiosen i den homozygote recessive fluefaren, men over­ krysningen gir ikke flere genkombinasjoner.


172 • Kapittel 5

hvor mange prosent rekombinanter som oppstår etter et krysningsforsøk. I likhet med flueforsøket er det vanlig å krysse heterozygoter med recessive homozygoter. Vi beregner rekombinanter i prosent (%) etter denne formelen: Formel for beregning av rekombinanter.

( 

)

Antall rekombinante ___________________ ​     Rekombinante i % = ​     ​  ​· 100 % Totalt antall avkom Siden sannsynligheten for overkrysning øker med avstanden, betyr det at jo større prosent rekombinanter vi beregner, desto lengre er avstanden mellom genene. I vårt flueforsøk fikk vi i alt 2218 flueavkom. Av dem var 938 grå med lange vinger, 903 var svarte med korte vinger, 199 var grå med korte vinger og 178 var svarte med lange vinger. De aller fleste avkommene har fenotype som foreldrene, men 17 % var rekombinanter.

Beregning av rekombinanter i krysnings­forsøket.

( 

)

199 + 178 ​        ​  ​· 100 % = 17 % Rekombinante i % = ​ ______________________ 938 + 903 + 199 + 178

Sjekkpunkter: Nye ord og faguttrykk: dihybrid arvegang, koblete gener, rekombinanter Hva er dihybrid arvegang? Hva er en forutsetning for Mendels andre arvelov? Hvordan blir koblete gener nedarvet? Beskriv hva som skjer i en overkrysning. Hva er rekombinanter?

5.4 Kjønnsbundet arvegang De fleste diploide organismer har ett par kjønnskromosomer. Siden det i all hovedsak finnes to forskjellige kjønn, er kjønnskromosomene av to slag. Hos mennesker kaller vi dem X og Y, og Y er betydelig mindre og inneholder langt færre gener enn X. Menn har kromosomparet XY, mens kvinner har XX. De haploide sædcellene hos mannen har enten X eller Y og bestemmer derfor kjønnet ved befruktningen. Noe liknende finner vi hos mange andre arter. Kjønnskromosomene hos mennesker. Legg merke til hvor mye mindre Y-kromosomet er sammen­ liknet med X-kromosomet.

Vi er alle unisex fram til sjuende svangerskapsuke. Et gen på Y-kromosomet blir da «slått på» og starter utviklingen av mannlige kjønnskarakterer. Uten dette genet blir babyen en jente.

På kjønnskromosomene ligger også gener som ikke bestemmer kjønns­karakterer. Spesielt gjelder det X-kromosomet. Disse genene har menn bare ett sett av, kvinnen har to.


Genetikk • 173

Arv som er knyttet til gener på kjønnskromosomene, kalles kjønnsbundet arv. Som tidligere nevnt er Y-kromosomet lite og inneholder svært få gener. Derfor gir genene på X-kromosomet utslag hos mannen uansett om disse genene er dominante eller recessive. Dette gir et ulikt arvemønster for recessiv, kjønnsbundet arvegang hos kvinner og menn. Hos høns er det hannen som har to like kjønnskromosomer.

For å illustrere en kjønnsbundet arvegang skal vi igjen bruke bananfluene. Bananfluer er gode modellorganismer til forskning på nedarvingsmønstre siden de har så kort generasjonstid (ca. 10 dager). Bananfluer har to

P-generasjon F

F

X XFXF

Xf Y

f

XX

XY

Homozygot dominant

XF XF

X

f

Y

XFXf

F1-generasjon

XF Y

XFXf XF Y

F

f

X XFXf

Xf Y

XX

XY

Heterozygot

XF Xf

Xf Y

XFXf

F2-generasjon

XF Y

XfXf XfY

0815_Fluer

f

Kjønnsbundet arvegang. Her ser vi på nedarving av øyefarge hos bananfluer. Krysningsskjemaet viser mulige genkombinasjoner når bananfluer med forskjellig øyefarge krysses. Øyefargen er styrt av genvariantene F, som gir rød farge, og f, som gir hvit farge. F er dominant over f. Siden genet F/f sitter på X-kromosomet, skriver vi XF eller Xf.


174 • Kapittel 5

kjønnskromosomer, hvor hunner har XX og hanner har XY. Hos bananfluer vet vi om en rekke arveegenskaper knyttet til recessiv, kjønnsbundet arv. Et eksempel er øyefargen, som enten kan være rød eller hvit. På figuren på forrige side ser du et krysningsskjema for nedarvingen av øyefarge hos banan­ fluer. Genvarianten som gir rød øyefarge (symbolisert med F) er dominant over genvarianten som gir hvit øyefarge (symbolisert med f). Det er viktig å merke seg at når vi lager et krysningsskjema for kjønnsbundet arvegang, så må vi vise om genet sitter på X- eller Y-kromosomet. I vårt eksempel med øyefargen til bananfluer sitter genet på X-kromosomet. Derfor skriver vi XF eller Xf. I resultatet må fenotypen presiseres for hvert av kjønnene. Krysningsskjemaet viser mulige genkombinasjoner når en homozygot rødøyet hunnflue (genotype XFXF) blir krysset med en hvitøyet hann (genotype XfY). Vi ser at alle avkommene får røde øyne uavhengig av kjønn. Men krysser vi en heterozygot rødøyet hunn (genotypen XFXf) med en hvitøyet hannflue (genotypen XfY), er det 50 % sannsynlig at avkommene har hvite øyne. Ved denne krysningen er det lik sannsynlighet for avkom av begge kjønn å få øyefargen hvit. Hunner må være homozygot recessive med genotype XfXf for å få hvite øyne. Blødersyke og fargeblindhet er kjente eksempler på kjønnsbundet arvegang hos mennesker. Når vi skal undersøke nedarvingsmønstre hos mennesker, tar vi ofte utgangspunkt i en stamtavle. Figuren under viser en stamtavle fra en familie hvor noen er fargeblinde. Den recessive genvarianten b gir farge­blindhet og sitter på X-kromosomet. I dette tilfellet er det ikke gjort gentesting av familie­ medlemmene, derfor kjenner vi ikke med sikkerhet alle genotypene. Dersom det er flere mulige genotyper til et individ, blir alle presentert i stamtavlen. Stamtavle fra en familie hvor vi ser på nedarving av fargesyn. Fargesynet er styrt av genvariantene B, som gir fargesyn, og b, som gir fargeblindhet. B er dominant over b. Siden genet B/b sitter på X-kromosomet, skriver vi XB eller Xb. Alle menn med genotypen XbY er fargeblinde. Kvinner som ikke er farge­ blinde, kan være enten homozygot dominante (genotypen XBXB) eller heterozygote (genotypen XBXb).

1

2

XbY

XBXb

3

4

5

6

7

8

X BY

XBXb

XBXb

XB Y

XBY

X bY Fargeblind mann

9

10

11

12

13

XBXB / XBXb

XbY

XBY

XBY

XBY

Ikke fargeblind kvinne

Sjekkpunkter: Nye ord og faguttrykk: kjønnsbundet arv, X-kromosom, Y-kromosom Hva bestemmer kjønnet til en diploid organisme? Hva er kjønnsbundet arv? Hvorfor er det viktig å angi kjønn i krysningsskjemaet for kjønnsbundet arv? Gi eksempler på gener som følger et kjønnsbundet arvemønster.


Genetikk • 175

5.5 Sammensatte arvemønstre Vi har nå sett på nedarvingsmønstre hvor ett genpar bestemmer én egenskap, og genvariantene gir dominant eller recessiv fenotype. Men nedarvings­ mønstrene er ofte mer kompliserte. De aller fleste arvelige egenskapene er styrt av flere genpar i et samspill med hverandre. Vi skal nå se på ulike måter ett eller flere genpar i kombinasjon er avgjørende for fenotypen.

Skala av dominans Ufullstendig dominans Fullstendig dominans

Kodominans

Skala av dominans.

Dominansforholdet følger en skala. I den ene enden har vi fullstendig 06_31 Dominansskala dominans, og i den andre enden ligger kodominans. Mellom disse ytterpunktene har vi forskjellige former for ufullstendig dominans. Når en genvariant er bestemmende for fenotypen, kaller vi det fullstendig dominans. I virkeligheten er det ofte ikke slik at en genvariant dominerer fullstendig over en annen. Et eksempel er blomsterfargen til planten løvemunn. Når homozygote hvite planter blir krysset med homozygote røde planter, får alle individene i F1-generasjonen rosa blomster, se figur på neste side. Det viser seg at genvarianten som gir rød blomsterfarge (symbolisert med FR), bare er delvis dominant over genvarianten som gir hvit blomsterfarge (symbolisert med FH). Symbolene viser at for genet F er ingen genvariant dominant over den andre. Et nedarvings­mønster hvor heterozygote avkom ikke har samme fenotype som noen av de homozygote foreldrene, kalles ufullstendig dominans. Krysser vi individene fra F1-generasjonen med hverandre, finner vi at forholdet mellom genotypene i F2-generasjonen blir den samme som med monohybrid dominant nedarving 1 : 2 : 1 (FRFR : FRFH : FHFH). Men siden de heterozygote har sin egen fenotype, blir forholdet mellom fenotypene også 1 : 2 : 1 (rød : rosa : hvit), se figuren på neste side. I en dominant monohybrid arvegang er forholdet mellom fenotypene 3 : 1. Genene våre avgjør hvordan vi opplever svettelukt. I svette finnes det mye av stoffet androstenon. Androstenon fester seg til en reseptor i nesen din, og hvilken genvariant du har for denne reseptoren, avgjør hvordan du opplever svettelukt. Er du homozygot for den ene varianten, opplever du svette som en ubehagelig lukt, mens svette lukter ingen ting dersom du er homozygot for den andre varianten. Forskere har også nylig funnet ut at dersom du er heterozygot, er det store muligheter for at du opplever svette som vanilje.

Løvemunn.


176 • Kapittel 5

Ufullstendig dominans. Her ser vi på nedarving av blomsterfargen hos planten løvemunn. Krysningsskjemaet viser mulige gen­kombinasjoner når løvemunn blir krysset. Blomsterfargen er styrt av genvariantene FR, som gir rød farge, og FH, som gir hvit farge. Ingen av genvariantene er dominante.

P-generasjon

FR

X

FR

FH

FRFR

FH

FHFH

Homozygot

Homozygot

F

FH

R

FR

FH

FRFH

F1-generasjon

FRFH

FRFH FRFH

FR

X

FH

FR

FRFH

FH

FRFH

Heterozygot

Heterozygot

F

F

R

R

FH

FH

FRFR

F2-generasjon

FRFH

FRFH FHFH

/

14

/

24

/

14

Fenotypeforhold 1 : 2 : 1

O kommer av det tyske ordet ohne som betyr uten

0807_Krysning_blomster Når begge genvariantene i et genpar viser sin fulle virkning samtidig, har vi kodominans. Her får vi ingen mellomformer som når vi har ufullstendig dominans. Kodominans sier vi er «både-og». Et eksempel er blodsystemet ABO hos mennesker. Det er mulig å ha disse blodtypene: A, B, AB og O. Bokstavene viser til to typer karbohydrater (A og B) på overflaten av røde blodceller. Bokstaven O forteller at personen verken har karbohydrat A eller B. Genene A og B bidrar til at henholdsvis karbohydrat A og B fester seg til cellemembranen hos røde blodceller. For mennesker med blodtypen AB blir genene som gir karbohydrat A og B, uttrykt like mye, det vil si at det er kodominans mellom disse genene.


Genetikk • 177

Genotype

Fenotype Blodtype

IAi IAIA

Rød blodcelle

A

Kodominans. Personer med blodtypen AB har røde blodceller med like mye karbohydrat A som karbohydrat B på overflaten. Personer med blodtypen O har ingen slike karbohydrater på overflaten. Personer med blodtypen O kalles universalblodgivere. De kan med andre ord gi blod til alle.

Karbohydrat A

IBi IBIB

B Karbohydrat B

IAIB

AB

Karbohydrat A Karbohydrat B

ii

O

06_30 Blodceller

For å kartlegge blodtypen til et menneske opererer vi i dag med hele 21 forskjellige systemer. To av dem er ABO-systemet og rhesussystemet. Nye oppdagelser om den molekylære strukturen på overflaten til blod­ cellene tilføyer nye systemer som det er viktig å ta hensyn til ved bestemmelse av blodtyper.

Når vi studerer et dominansforhold, tar vi bare utgangspunkt i hvordan gen­variantene er uttrykt i fenotypen. Går vi tilbake til blomsterfargen på løvemunn, ser vi at nedarvingen viser et ufullstendig dominansmønster fordi fenotypen til den heterozygote er en mellomform. Det er viktig å merke seg at vi ikke sier noe om hvordan de to genene forholder seg til hverandre. Ved kodominans får fenotypen trekk fra begge de to homozygote fenotypene i foreldregenerasjonen. Dominans­forholdet sier heller ingenting om hvilke genvarianter som er de mest vanlige i en populasjon.

Multiple genvarianter Når et genpar har flere enn to mulige varianter, kalles de multiple genvarianter. La oss igjen se på eksemplet med blodsystemet ABO hos mennesker. Fordi egenskapen skyldes bare ett genpar, skulle vi forventet tre ulike fenotyper: blod­ type A, B og AB (pga. kodominans). Men som nevnt finnes det fire ulike ABOblodtyper. Forklaringen er at det er tre ulike genvarianter som kan inngå i gen­ paret, her symbolisert med IA, IB og i. Genvarianten IA bestemmer at karbo­hydrat A skal sitte på blodcellene, og genvarianten IB bestemmer at karbohydrat B skal sitte


178 • Kapittel 5 Multiple genvarianter. Her ser vi på nedarvingsmønsteret av blodtype hos mennesker. Skjemaet viser mulige genkombinasjoner når en heterozygot person med blodtype A (genotype IAi) får barn med en heterozygot person med blodtype B (genotype IBi). IA og IB er kodominante i forhold til hverandre og dominante i forhold til i.

IA

i

IB

X

i

IBi

IAi IA

IB

i

i IAIB IBi

IAi ii

0809_Blodtyper

der. Genvarianten i har ingen innvirkning på hvilke karbohydrater som skal sitte på blodcellene. Genene IA og IB er kodominante i forhold til hverandre og dominante i forhold til i. Det er derfor de skrives med stor I. En person med genotypen ii har verken karbohydrat A eller karbohydrat B på overflaten. Vi sier at personen har blodtype O. Figuren over viser et skjema for mulige genkombinasjoner når en person med blodtype A får barn med en person med blodtype B. Begge foreldrene er heterozygote. Forholdet mellom fenotypene blir 1 : 1 : 1 : 1 (blodtype AB : blodtype A : blodtype B : blodtype O).

Letale gener letum (lat.) – død

Letale gener er genvarianter som fører til død når de blir uttrykt, ofte i foster­ livet. For å illustrere hvordan letale gener virker, skal vi se på nedarvingen av pelsfarge hos mus. Mus har normalt gråspettet pels. Genet som koder for denne pelsfargen, kaller vi g. Denne genvarianten er recessiv overfor den dominante genvarianten G, som gir gul farge. En heterozygot (Gg) mus har gul farge. Hvis vi krysser to heterozygote gule mus, skulle vi forvente et normalt monohybrid forhold mellom fenotypene på 3 : 1 (gul : grå). Vi ville forvente at de med genotype GG og Gg, blir gule, mens bare de med genotype gg blir grå. Men teller vi antall gule og grå museavkom, er forholdet 2 : 1 (gul : grå). Forklaringen er at genvarianten G er letal. Dominant homozygote gule mus aborteres før fødselen fordi genvarianten i dobbel dose gjør musefosteret ute av stand til å produsere livsviktige byggestoffer.


Genetikk • 179

G

X

g

Gg

G

g

Gg

Heterozygot

Heterozygot

G g

G

Letale genvarianter. Her ser vi på nedarvingsmønsteret av pelsfarge hos mus. Krysnings­ skjemaet viser mulige genkombinasjoner når vi krysser to heterozygote mus for genet som koder for pelsfarge. Genvarianten G er letal og dominant over g.

g

GG Gg

Gg gg 2/3

1/3

Fenotypeforhold 2 : 1

0820_Mus

Pleiotrope gener Mange gener påvirker ikke bare én egenskap, men flere. Slike gener kalles pleiotrope. Et eksempel er genet som koder for kloridkanaler i celle­membranen. Disse kanalene påvirker mange egenskaper i organismen. Hos mennesker bidrar kanalen blant annet i respirasjonen og fordøyelsen. Mennesker med defekte kloridkanaler kan ha sykdommen cystisk fibrose, se side 191. Et annet eksempel på pleiotrope gener er genet OCA2 hos mennesker. Dette genet er med på å bestemme både øyefarge, hårfarge og fregner. Når dette genet er fullstendig slått av, har personen albinofarger (røde øyne, hvitt hår og hvit hud).

pleion (gr.) – flere

Epistase Til nå har vi sett på at ett genpar bestemmer én eller flere ulike egenskaper. Men ofte er en fenotypekarakter avhengig av to eller flere gener fra forskjellige genpar. Samhandlingen mellom mange genpar om én egenskap kalles epistase. Det finnes en rekke slike samhandlinger som gir opphav til mange ulike fenotypeforhold når to heterozygote individer blir krysset. For å illustrere epistase skal vi se på et par eksempler som gir ulike fenotypeforhold. Under oppgaver finner du flere eksempler på epistase som du kan jobbe med.

Eksempel 1 – Pelsfarge hos rotter I dette eksempelet skal vi ta utgangspunkt i hvordan pelsfarge hos rotter kommer til uttrykk.

epistasis (gr.) – hindring


180 • Kapittel 5

Genvarianten som gir grå pelsfarge (symbolisert med B), er dominant overfor genvarianten som gir brun pelsfarge (symbolisert med b). Brune rotter har genotypen bb. Men det er flere faktorer som påvirker pelsfargen. Et annet genpar (symbolisert med A/a) som ligger på et annet kromosom, påvirker om det i det hele tatt blir pigmentproduksjon i pelsen. Genvariant A må være til stede for at pigmentproduksjonen skal sette i gang. Pelsfargen bestemmes da ut fra genparet B/b. Dersom rotta er homozygot recessiv for dette «på eller av»-genparet (aa), blir rotta hvit (albino), uavhengig av hvordan genotypen til pigmentgenparet er. Epistase – eksempel 1. Illustrasjonen viser hvordan Genvariant A genparene A/a og B/b samvirker om hvilken Substrat pelsfarge rotta får. Produkt 1 gir grå pelsfarge, mens produkt 2 gir brun pelsfarge. Genene B/b er avhengig av genvariant A for å bli uttrykt. Alle rotter med genotype aa 06_35 Samvirkende genpar II blir hvite. Verken produkt 1 eller 2 lages. A

Produkt 1 Genvariant B Genvariant b Produkt 2

a

A B

b

X AaBb

B

AaBb

Heterozygot

Heterozygot

AB

AB

aB

aB

AABB

Ab

Ab AaBB

AaBB

ab

ab aaBB

AABb AaBb

Epistase – fenotypeforhold 9 : 3 : 4. Her ser vi på nedarving av pelsfarge hos rotter. Krysningsskjemaet viser mulige genkombinasjoner og fenotyper når to grå rotter som er heterozygote for både «på eller av»-genparet (symbolisert med Aa) og grå/ brun-genparet (symbolisert med Bb), blir krysset. De to genparene samvirker om hvordan pelsfargen skal komme til uttrykk.

a

AABb AaBb

AaBb AAbb

aaBb Aabb

AaBb aaBb

Aabb aabb

9/16

3/16 Fenotypeforhold 9 : 3 : 4

06_36 Samvirkende genpar 2

4/16

b


Genetikk • 181

Hva skjer når to grå rotter som er heterozygote for begge genparene, parer seg? Selv om de to genparene påvirker samme egenskap, her pelsfarge, blir de nedarvet uavhengig av hverandre siden de sitter på hvert sitt kromosom. Nedarvingen følger derfor samme mønster som for dihybrid kryssing. På forrige side finner du et krysnings­skjema som viser mulige genotyper og fenotyper til avkommene av disse to rottene. Forholdet mellom fenotypene blir 9 : 3 : 4 (grå : brun : hvit). De fleste kjæledyrrotter er albinoer. Hvorfor? Kan det være at andre egen­ skaper nedarves sammen med albinisme, for eksempel dårligere syn og mindre aggressivitet, som gjør det mulig å ha rotte som kjæledyr?

Eksempel 2 – Hvetekornets kjernefarge I dette eksempelet skal vi ta utgangspunkt i hvordan fargen på hvetekornets kjerne kommer til uttrykk. Noen ganger kan ulike genpar ha den samme rollen i å bestemme fenotypen. Da er det nok at en av genvariantene produserer genproduktet for at egenskapen skal komme til uttrykk. Vi kan tenke oss at vi har to enzymer, enzym A og enzym B. Enzymene har alternative måter å lage et produkt P på. Genene som koder for disse enzymene, er dominante og symbolisert med A og B. Det er da nok å ha én av de dominante genvariantene for at produktet P skal lages. Genvariant A Genvariant a

Enzym A

Substrat

Genvariant b

Produkt

Enzym B Genvariant B

Epistase – eksempel 2. Illustrasjonen viser hvordan genparene A/a og B/b ensvirker om hvilken farge hvete­ kornets kjerne får. Både genvariant A og genvariant B koder for enzymer som gir samme produkt fra substratet. Dette produktet gir farget hvetekorn. Alle hveteplanter med genotype aabb blir hvite.

06_33 Ensvirkende genpar Hvetekornets kjerne kan være fargete eller helt hvite, og fargen styres av de to genparene A/a og B/b. For at hvetekorn skal bli farget, må produktet P lages. Det er da tilstrekkelig med en av de dominante genvariantene. Dersom hveteplanten er homozygot recessiv for begge genparene, er kornene hvite. Selv om de to genparene påvirker samme egenskap, blir de nedarvet uavhengig av hverandre. Nedarvingen følger derfor samme mønster som for dihybrid kryssing. På neste side finner du et krysningsskjema med mulige fenotyper og genotyper når to heterozygote individer blir krysset. Vi ser ut fra figuren at forholdet mellom fenotypene blir 15 : 1 (produkt P (farget) : ikke produkt P (hvit)).


182 • Kapittel 5

B A

b

a

X

AaBb

B

AaBb

A

Heterozygot

Heterozygot

AB

P

aB

P

ab

AaBB

P AaBb

P Aabb

AB

P

Ab

Epistase – fenotypeforhold 15 : 1. Her ser vi på nedarving av evnen til å lage produkt P når to genpar ensvirker om hvordan produkt P kommer til uttrykk. Krysningsskjemaet viser mulige genkombinasjoner og fenotyper når to heterozygote individer for både enzym A-genparet (symbolisert med Aa) og enzym B-genparet (symbolisert med Bb), blir krysset.

b

a

AABb

P AaBb

P aaBb

AABB

P AAbb

P aaBB

P

Ab

P AABb

P AaBb

P

aB

P

ab

AaBB

P

P AaBb

Aabb

aaBb

aabb 15/16 Produkt (P)

1/16 ikke Produkt (P)

Fenotypeforhold 15 : 1

0819_Produkt Nedarving av kvantitative egenskaper

Det er enkelt å avgjøre om en ert er gul eller grønn, eller om en bananflue har røde eller hvite øyne. Men mange egenskaper hos dyr og planter har et helt spekter av ulike nyanser med gradvis forandring mellom seg. Ofte gir summen av effekten fra mange genpar en kvantitativ normalfordelt egenskap. I tillegg påvirker miljøet. For å illustrere nedarving av kvantitative egenskaper skal vi se på hudfarge hos mennesker. Tre genpar på tre forskjellige kromosompar påvirker pigmentproduksjonen i huden. Jo flere dominante pigment­gen­ varianter det finnes til sammen, desto mørkere blir hudfargen. Med andre ord er det mengden, altså kvantiteten av dominante genvarianter, som bestemmer hvor mørk huden blir. Se for deg at to personer, en med veldig mørk hudfarge og en med lys hudfarge, får barn. Barna blir alle middels mørke. Dersom individer med middels pigmentert hudfarge får barn, kan barna få sju forskjellige hudfargenyanser. Figuren på neste side viser sannsynligheten for avkommenes genotype og fenotype når to heterozygote individer for alle tre genparene som bestemmer hudfarge, får barn. Miljøet er også en sterk bidragsyter til hvordan fenotypen faktisk er. I tilfellet med hudfarge påvirker sola pigmentproduksjonen. Derfor sier vi at genotypen sier noe om hvilke disposisjoner vi har for å utvikle en fenotype, men miljøet avgjør hvordan fenotypen blir.


Genetikk • 183

mann A

a

A

b

B

kvinne a

X C

b

B

c

C

c

barn

aabbcc

Aabbcc

AaBbcc

AaBbCc

AABbCc

AABBCc

AABBCC

Fordeling av genkombinasjoner

20/64

15/64

6/64

1/64

aabbcc

Aabbcc

AaBbcc

AaBbCc

AABbCc

AABBCc

AABBCC

06_37 Kvantitative egenskaper

Hvor høy du blir, følger også samme nedarvingsmønster som hudfarge. Det er mange gener som gir deg ulike disposisjoner for om du blir høy eller lav. Men maten du spiser, er også avgjørende for hvordan du vokser. Dersom du ikke får i deg de nødvendige næringsstoffene i oppveksten, blir du lavere enn det genene dine gir grunnlag for.

Nedarving av menneskelige egenskaper Det er bare et fåtall av menneskers egenskaper som vi med sikkerhet vet nedarvingsmønsteret til. Som du sikkert har lagt merke til, har det ikke vært mange eksempler med mennesker når vi har sett på de ulike nedarvings­ mønstrene. Flere egenskaper har vi tidligere trodd ble styrt av ett genpar, men så viser forskningen at nedarvingen er mer komplisert, og veldig ofte er mange genpar involvert.

Nedarving av kvantitative egenskaper. Her ser vi på nedarving av hudfarge hos mennesker. Figuren viser en forenklet modell av fordelingen av gen­ kombinasjoner når to heterozygote mennesker for alle genparene (symbolisert med genotypen AaBbCc) får barn. Fenotypen avgjøres ut fra hvor mange dominante genvarianter avkommet har, men også ut fra hvor mye sol avkommet utsettes for.


184 • Kapittel 5

Tabellen viser noen få menneskelige egenskaper og deres antatte nedarvingsmønstre.

Egenskap hos mennesker Fenotyper

Nedarvingsmønster

Ørevoks

Gul, klebrig ørevoks Grå, tørr ørevoks

Følger en monohybrid arvegang. Ett genpar styrer ørevoksproduksjonen. Genvarianten som gir gul, klebrig ørevoks, er dominant over genvarianten som gir grå, tørr ørevoks.

Albinisme

Har albinofarger (hvitt hår og hud, røde øyne) Har ikke albinofarger

Følger en monohybrid arvegang. Ett genpar styrer om du får albinofarger eller ei. Genvarianten som gir albinisme, er recessiv i forhold til genvarianten som ikke gir albinisme. Personen må være homozygot recessiv for å utvikle albinisme.

Evnen til å smake det bitre stoffet PTC

Smaker PTC Smaker ikke PTC Mellomformer finnes

Følger hovedsakelig en monohybrid arvegang hvor ett genpar styrer om du smaker PTC eller ikke. Men genvarianten som gir PTC-smak, er ikke fullstendig dominant over genvarianten som ikke gir PTC-smak, slik at det eksisterer mellomformer. Det diskuteres også om det er miljøfaktorer som påvirker smaken av PTC.

Tungerulling

To ytterpunkter: Kan rulle tunge og kan ikke rulle tunge. Mange mellomformer

Det er få vitenskapelige bevis på at tungerulling følger en monohybrid arvegang. Om det er arvelig og i så fall hvordan nedarvingsmønsteret er, er uvisst.

Øyefarge

Spekter av fargenyanser

Det er i alle fall 16 gener som er med på å påvirke øyefargen hos mennesker. Flere av genene som er involvert i øyefarge, styrer også hårfarge. Nedarvingen er et eksempel på epistase med ulike dominansforhold innad i et genpar og mellom genpar.

Hudfarge

Spekter av fargenyanser – fra helt hvit til mørk brun

Følger kvantitativ nedarving. Tre genpar på tre forskjellige kromosompar påvirker pigmentproduksjonen i huden. Jo flere dominante pigmentgenvarianter det finnes til sammen, desto mørkere blir hudfargen. Miljøet er også en sterk bidragsyter.

Hårfarge

Spekter av fargenyanser

Hårfarge er et resultat av tre ulike pigmenter som blir produsert i ulik mengde. Ulike enzymer som blir uttrykt fra forskjellige genpar, styrer pigmentproduksjonen. Men det kan se ut som om rød hårfarge styres av bare ett genpar som følger en monohybrid arvegang. Er dette genparet homozygot recessivt, er fenotypen rødt hår. Alle andre hårfarger er et resultat av epistase mellom mange genpar.

IQ

Gradvis skala

Gjennom statistiske analyser har en kommet fram til at IQ følger en form for kvantitativ nedarving hvor miljøet bidrar sterkt. En regner også med epistase. Det er uvisst hvor mange genpar som påvirker IQ.

Sjekkpunkter: Nye ord og faguttrykk: ufullstendig dominans, kodominans, multiple genvarianter, letale genvarianter, pleiotrope gener, epistase, kvantitativ egenskap Hva mener vi med en skala av dominans i genetikken? Forklar forskjellen mellom ufullstendig dominans og kodominans. Når er gener pleiotrope? Gi eksempler på epistase. Hva er en kvantitativ arvelig egenskap? Gi eksempler på arvelige menneskelige egenskaper.


Genetikk • 185

5.6 Epigenetikk Alle levende organismer er produkter av både arv og miljø. I epigenetikken ser vi på forandringer i genaktivitet som ikke er forårsaket av endringer i den genetiske koden. De epigenetiske forandringene nedarves gjennom celledelinger og er ofte korttidstilpasninger til det ytre miljøet. Nyere forskning viser at epigenetiske forandringer også kan gi langsiktige effekter som nedarves gjennom generasjoner. For å illustrere et eksempel på epigenetisk arv skal vi se på ciliaten Tetrahymena vorax. Vanligvis svømmer denne encellede organismen rundt i ferskvann og ernærer seg på bakterier og dødt organisk materiale. Ved hjelp av spesialiserte flimmerhår i cellens munnparti velger de mat bare etter størrelsen. Men med en gang den lille ciliaten Tetrahymena thermophila er i miljøet, forandrer Tetrahymena vorax form dramatisk. Munnpartiet blir gigantisk, og den begynner å livnære seg på disse små «byttedyrene». Det spesielle er at den nye rovformen deler seg, og neste generasjon er også en rovform. Slik fortsetter det, til og med en stund etter at «byttedyrene» er spist opp. Denne store forandringen i fenotypen skyldes genregulering ved hjelp av signalstoffer fra byttedyrene. Det overraskende er at også genaktiviteten blir videreført til neste generasjoner uten at det har skjedd forandringer i den genetiske koden. Mekanismene bak disse epigenetiske forandringene vet vi foreløpig lite om. Derimot vet vi en del om epigenetiske mekanismer hos planter, mus og rotter.

Vanlig form Tetrahymena vorax

Rovform Tetrahymena vorax

epi (gr.) – over

Utvikling til rovform av ciliaten Tetrahymena vorax. Vanligvis livnærer T. vorax seg på bakterier og annet organisk materiale. Men er «byttedyrene» Tetrahymena thermophila til stede i miljøet, utvikler T. vorax seg til en rovfom som spiser «byttedyrene».

«Byttedyr» Tetrahyena thermophila


186 • Kapittel 5

Epigenetiske mekanismer I kapittel 3 Fra gen til protein kunne du lese om pakkingen av de lange DNAmolekylene inne i cellekjernen. For å organisere DNA-et slik at det får plass i cellekjernen samtidig som de riktige genene leses av, pakker DNA seg rundt histoner. Generelt sett kan vi si at det er lettere å aktivere gener som er løst pakket, enn de som er tettpakket. Pakkingen av DNA nedarves, det vil si at i en celledeling (mitose og meiose) arver de nye cellene DNA-pakkingsmønster til den opprinnelige cellen. Vi skal se på to epigenetiske mekanismer som er avgjørende for hvor tett DNA blir pakket: • DNA-metylering • histonmodifisering Epigenetisk mekanisme: histonmodifisering

Histoner

Histonhale

Histonhale

DNA tilgjengelig, aktivt gen DNA utilgjengelig, inaktivt gen

Histoner

Metyl

G

C

C

T

G

T

C

A

A A

G G

T

C

C

A

G C

G

G

A

T

C

T

Epigenetiske mekanismer. DNA-metylering av cytosin­ baser og histon­modifisering påvirker hvor tett DNA-et pakkes, og avgjør dermed om et gen kan slås av eller på.

Metyl

Epigenetisk mekanisme: DNA-metylering

06_41 Epigenetiske mekanismer DNA-metylering

I de fleste plante- og dyrecellene er noen cytosinbaser i DNA merket med en metylgryppe (-CH3). Det kalles DNA-metylering. Det er spesielt de cytosin­ basene som ligger ved siden av guanin, som blir metylert. Metyleringen er styrt av spesielle enzymer, og det viser seg at tette strukturer av DNA ofte er


Genetikk • 187

forbundet med mye metylering. Det betyr at gener med mange metyleringer ofte er inaktive og ikke blir uttrykt. Det er uvisst hva som styrer at DNA-metyleringen skjer på riktig sted til riktig tid, og det blir forsket mye på dette. Det vi ser, er at metyleringen av gener har spesielt stor betydning for å utvikle ulike celletyper i en flercellet organisme, det vi kaller celledifferensiering, se side 135.

Histonmodifisering Histoner er proteiner med en hale som kan modifiseres når spesielle enzymer setter på en kjemisk gruppe (for eksempel acetyl). Det påvirker hvor tett DNA blir pakket, og dermed hvor lett gener kan skrus av eller på. Grovt sett kan vi si at jo mer histonmodifisering som finnes i et område, desto løsere blir DNA pakket, og dermed blir det lettere for genene i dette området å bli uttrykt. Nyere forskning viser at histonmodifiseringen kan være regulert av små, ikke-kodende RNA-molekyler (siRNA). Det spekuleres i om det er histon­ modifiseringen i seg selv eller om det er siRNA-ene som blir nedarvet. Uansett blir genuttrykket nedarvet.

RNA-molekyler opprettholder genaktiviteten En tredje epigenetisk mekanisme er nedarving av genaktivitet ved hjelp av RNA-molekyler. Noen ganger kan et gen som blir slått på, transkribere et produkt som opprettholder aktiviteten i genet, selv om signalet for å være på ikke er til stede. Dette produktet kan være ulike former for RNA. Etterkommere av denne cellen hvor genet en gang var slått på, arver genaktiviteten selv om det originale signalet for å skru på genet ikke er til stede.

Hva kan epigenetiske forandringer føre til? I de siste årene har forskning vist at påvirkninger fra miljøet tidlig i livet regulerer pakkingen av DNA og dermed genuttrykket i cellen. Dette gen­ uttrykket blir overført gjennom celledeling enten fra celle til celle, eller til neste generasjon gjennom produksjon av kjønnsceller. Eksempler på ulike faktorer som påvirker, er temperatur, kosthold, medisiner, kjemikalier og stress. La oss se på noen eksempler som viser hvordan ulike miljøfaktorer gir epigenetiske forandringer. Vi vet for eksempel at planten vårskrinneblom (Arabidopsis thaliana) «husker» en kuldeperiode for å kunne blomstre til rett tid. Mekanismen er at lav temperatur modifiserer histoner som blir nedarvet epigenetisk gjennom celledelinger i planten. Hos mus ser vi at dietten til mor påvirker avkommene. Gir vi musemor en diett med mye metyl, ser vi at avkommet har forandringer i pelsfarge, vekt og disposisjon for kreft. Det skyldes sannsynligvis epigenetiske mekanismer forårsaket av dietten.


188 • Kapittel 5

Vi har lenge visst at kjemikalier og gifter påvirker genene våre i større eller mindre grad. Nylig er det vist at mus som fødes av mødre med høyt alkohol­ inntak under graviditeten, har høyere risiko for å få avkom med både mentale og fysiske defekter. Studien tyder på at dette skyldes epigenetiske forandringer. Et annet epigenetisk funn kommer fra studier på hannrotter som ble utsatt for en soppgift på fosterstadiet. Soppgiften gav ingen observerte mutasjoner. Men disse hannrottene hadde økt risiko for å utvikle kreft og nyresvikt. Denne økte risikoen for sykdom hadde også rotter i de tre neste generasjonene. Forskere tror at grunnen skyldes epigenetiske forandringer i sædcellene. Stress kan også sette sine spor i genuttrykket i en organisme. Et eksempel på det har vi sett hos musebarn som ble fjernet fra moren en time hver dag de første ti levedagene. De stressutsatte musebarna hadde vedvarende epigenetiske endringer, og de reagerte mer på stress i voksen alder enn andre mus. Epigenetikk er meget aktuelt og et ungt forskningsfelt. I framtiden kan forskning avdekke andre spennende og kanskje skremmende konsekvenser av samspillet mellom arv og miljø.

Imprinting og X-inaktivering For mange egenskaper viser det seg at mor og far bidrar forskjellig. For flere gener er fenotypen til avkommet avhengig av om genet ble arvet fra far eller mor. Genene er altså preget ulikt av mor og far. Fenomenet kalles imprinting og er kjent hos de fleste pattedyrene. Under utviklingen av egg- og sædceller fører DNA-metylering til at enkelte gener blir inaktivert, og denne inaktiveringen blir nedarvet til kommende generasjoner. Imprinting skjer ulikt i kjønnscellene hos hunner og hanner, slik at en aldri opplever at begge genvariantene i et genpar er inaktive. Pattedyrhunner har alle to X-kromosomer, mens hannen har én. For å unngå at hunner har dobbelt så mange genprodukter fra X-kromosomene som det hanner har, inaktiveres en av X-kromosomene hos hunnene. Mekanismen bak inaktivering er tettpakking av kromosomet. Hvilket X-kromosom som inaktiveres i en celle er tilfeldig.

Sjekkpunkter: Nye ord og faguttrykk: epigenetisk arv, DNA-metylering, histonmodifisering, siRNA, imprinting, X-inaktivering Hva er forskjellen mellom genetikk og epigenetikk? Hva blir metylert i en DNA-metylering? Hva mener vi med histonmodifisering? Gi eksempler på epigenetisk arv. Hvorfor er det viktig at imprinting skjer ulikt i kjønnsceller hos kvinner og menn? Hva er X-inaktivering?


Genetikk • 189

5.7 Genetiske sykdommer Forklaringen og kanskje også løsningen på mange sykdommer ligger i genene våre. Fellesnevneren for alle genetiske sykdommer er at de på en eller annen måte skyldes forandringer i eller på DNA-et. Forandringer i DNA-et oppstår ved mutasjoner. Dersom mutasjonene skjer i et gen, kan proteinet som genet koder for, miste sin normale funksjon, se kapittel 3 Fra gen til protein. Proteiner har mange forskjellige roller i en celle, se tabellen på side 117. Defekte proteiner kan deles inn i to hovedkategorier. Vi har de som ikke fungerer i det hele tatt, og de som utfører oppgaven sin feil.

Forandringer i DNA = mutasjoner

En enkeltstående mutasjon i en tilfeldig kroppscelle er ofte betydningsløs. For det første er det bare noen få gener som er aktive i hver celle, og mutasjoner i inaktive gener gir ingen konsekvenser. En mutasjon i en kjønnscelle kan derimot være alvorlig. Dersom denne kjønnscellen deltar i en befruktning, rammer mutasjonen alle cellene i det nye individet. Konsekvensene av slike mutasjoner er mange, og noen mutasjoner kan gi forskjellige typer arvelige sykdommer. Forandringer i kjønnscellens DNA kan ha oppstått på flere måter. Mutasjonen kan ha skjedd for mange generasjoner siden, og individet har da samme mutasjon i sine øvrige celler. Det er også mulig at mutasjonen har oppstått i akkurat denne kjønnscellen ved at ytre faktorer muterer gener eller som kopieringsfeil eller en feil i kromosomfordelingen i meiosen. Med forandringer på DNA-et mener vi epigenetiske forandringer. Mange genetiske sykdommer har ofte en epigenetisk faktor som påvirker uttrykket og forekomsten av sykdommen. Vi skal se på ulike nedarvingsmønstre av genetiske sykdommer. Dette er interessant fordi dersom vi kjenner arvegangen til en sykdom, kan vi ved hjelp av Mendels lover beregne sannsynligheten for at en arvelig sykdom blir overført fra foreldre til barn. Det er viktig å huske på at sykdomsbildet ofte er mer komplekst, siden både disposisjoner for sykdommen og epigenetiske forandringer også er arvelige. Oversikt over noen arvelige sykdommer i Norge*

Recessive arvelige sykdommer

Dominante arvelige Kjønnsbundne Kromosom­ sykdommer arvelige sykdommer avvik

Cystisk fibrose

Huntingtons sykdom

Ulike typer blødersykdommer

Downs syndrom

Føllings sykdom

Nevrofibromatose

Fargeblindhet

Turners syndrom

Angelmans syndrom

Osteogenesis imperfecta

Duchennes muskeldystrofi

Klinefelters syndrom

* I tillegg har vi arvelige disposisjoner for sykdommer som ikke er tatt med i tabellen

Forandringer på DNA = epigenetiske forandringer


190 • Kapittel 5

Recessive arvelige sykdommer Recessive arvelige sykdommer er ofte knyttet til mutasjoner som gir ikkefunksjonelle proteiner. Rammer for eksempel mutasjonen et gen som koder for et enzym, blir effekten av enzymet hindret på den tilhørende kjemiske reaksjonen. Men cellene våre har to varianter av et gen og dermed en «sikkerhetskopi» dersom den ene genvarianten er mutert. Den friske genvarianten danner funksjonelle proteiner som tar seg av proteinets oppgaver i cellen, og dermed veier opp for sykdomsgenet. For at sykdommen skal inntreffe, må begge genvariantene i genparet være sykdomsgener. Arvegangen for sykdommen er derfor recessiv, og syke personer har homozygot genotype for det recessive sykdomsgenet (symbolisert med rr). Heterozygote personer (Rr) har et sykdomsgen og et friskt gen i genparet. De kalles bærere og er ikke syke. Vi sier at bærere bærer sykdomsgenet til neste generasjon. Det betyr at friske foreldre kan få syke barn når begge er bærere av sykdomsgenet. Nyere forskning viser nå at for enkelte recessive arvelige sykdommer kan de friske heterozygote bærerne av sykdomsgenet vise fysiologiske tegn som tyder på at de er bærere. Det er derfor mulig å kartlegge også bærerne av sykdommen. Det finnes en lang rekke recessive arvelige sykdommer, og mange av dem er meget alvorlige. Nedarving av recessiv arvelige sykdom. Skjemaet viser mulige genkombinasjoner når to bærere av sykdommen får barn.

R

X

r

R

Rr

Rr

Heterozygot

Heterozygot

R

R RR

r

r

Frisk

Rr

Rr

Bærer Syk

rr

1/4

2/4 Fenotypeforhold 1 : 2 : 1

0828_Sykdom

r

1/4


Genetikk • 191

Noen recessive sykdomsgener forekommer relativt hyppig i en befolkning. Et eksempel på en slik sykdom er cystisk fibrose. I Norge er én av 25 bærere av denne sykdommen, slik at muligheten for at to bærere med sykdomsgenet får barn sammen og sykdommen dukker opp, er til stede. Andre recessive sykdomsgener kan være meget sjeldne, og det er tilfeldig at to etterkommere med mutasjonen får barn sammen. Mutasjonen som gir sykdomsgenet, kan ha skjedd for flere generasjoner siden. To norske brødre svetter ved lave temperaturer (ca. 10 °C), og det er ikke kjent at andre i Norge gjør dette. Syndromet skyldes en mutasjon på kromosom 19. Moren og faren til guttene er helt friske, men de er bærere av denne mutasjonen. Men moren og faren er ikke i slekt, trodde de … Etter grundig leting i kirkebøker og bygdebøker kom det fram at de hadde en felles forfar ni generasjoner tilbake i tid. Mutasjonen har etter all sannsynlighet oppstått her, blitt nedarvet recessivt og dermed vært «skjult» i alle disse årene.

Men dersom to personer innenfor samme slekt får barn sammen, og det i denne slekten forekommer en sjelden recessiv sykdom, er sannsynligheten for at begge er bærere av sykdomsgenet mye større enn for tilfeldig gifte. Det øker risikoen for å få syke barn. Vi skal se nærmere på tre recessive arvelige sykdommer: cystisk fibrose, Føllings sykdom og Angelmans syndrom.

Cystisk fibrose Personer med cystisk fibrose har unormal salt svette og unormal slimdannelse blant annet i lunger og bukspyttkjertel. Det defekte genet sitter på kromosom 7 og koder for et protein som er en kloridkanal. Denne kloridkanalen sørger for transport av kloridioner (Cl-) gjennom cellemembranen. Bærere av denne sykdommen har et normalt gen som gir funksjonelle kloridkanaler. Det finnes mange former av sykdommen, noen mer dødelige enn andre. Grunnen er at det finnes flere varianter av defekte gener som gir ulik grad av funksjonalitet av kloridkanalen. Gode behandlingstilbud kan hemme sykdomsutviklingen, men ikke helbrede den. Til tross for behandling må en forvente nedsatt levetid, ofte bare førti– femti år. På neste side finner du en stamtavle fra en familie med cystisk fibrose. Menn med cystisk fibrose har som regel tette sædledere og kan derfor ikke få barn på den naturlige måten. Men de kan i dag få assistert befruktning der en med nål henter ut sædceller fra testiklene.

r

r

Kromosompar 7

Mutert kloridkanal-gen på

0829_Kromosom_7 kromosom 7. Dersom begge

genvariantene har en mutasjon (symbolisert med r), har personen cystisk fibrose.


192 • Kapittel 5

Stamtavle fra en familie med cystisk fibrose. Alle familiemedlemmene er gentestet. Her følger vi nedarvingen av cystisk fibrose gjennom tre generasjoner.

= Kvinne frisk = Mann bærer

Rr

Rr

rr

RR

= Kvinne syk

RR

Rr

Rr

RR

rr

RR

Rr

RR

Rr

Rr

rr

Rr

RR

I0830_Sykdom2 Europa er cystisk fibrose den mest utbredte av de alvorlige genetiske sykdommene. Utbredelsen er langt sjeldnere i andre befolkningsgrupper, se tabellen under. Forekomst av cystisk fibrose.

Etnisk gruppe

Bærere

Syke

Nordeuropeisk

1 av 25

1 av 2 500

Afrikansk

1 av 65

1 av 17 000

Asiatisk

1 av 150

1 av 90 000

Føllings sykdom f

f

Kromosompar 12

Mutert fenylalaninhydroksylase-gen på kromosom 12. Dersom begge genvariantene har en mutasjon (symbolisert med r), har personen Føllings sykdom.

06_47_ Føllings sykdom

En annen vanlig recessiv arvelig sykdom er Føllings sykdom. Det er en stoffskiftesykdom som hemmer utviklingen av nervesystemet og gir varige hjerneskader. Sykdomsgenet sitter på kromosom 12, og normalt koder genet for enzymet fenylalanin hydroksylase. Uten dette enzymet klarer ikke cellen å bryte ned aminosyren fenylalanin. Opphopningen av fenylalanin inne i den enkelte cellen er veldig giftig for cellen. Sykdommen kan motvirkes hvis pasienten får egen diett fra meget ung alder. I Norge blir derfor blodet til alle nyfødte testet for Føllings sykdom. Mannen som oppdaget denne sykdommen og dermed reddet mange barn fra en trist skjebne, heter Ivar Følling. Forskningsmetodene hvor han kombinerte kjemi, biologi og medisin, er et mønster til etterlevelse for mange forskere.

Angelmans syndrom Angelmans syndrom er en recessiv arvelig sykdom som blant annet kjenne­ tegnes ved alvorlig grad av utviklingshemning, forsinket utvikling av motorikk og munterhet. Sykdomsgenet sitter på kromosom 15. Dette sykdomsgenet er meget sjeldent, men sykdommen er mer vanlig enn det vi skulle forventet ved normal recessiv arvegang.


Genetikk • 193

R

X

r

R

Rr

R

RR

Heterozygot

Homozygot dominant

R

Ri RRi

r

Ri

rRi

RRi

Frisk Bærer Syk

rRi

2/4

2/4

Fenotypeforhold 1 : 1

06_48 Angelmanns syndrom

Grunnen til dette er at den delen av kromosom 15 hvor genet ligger, kan være imprintet. Imprintingen skjer bare på det kromosomet som en arver fra far, og imprintingen gjør genet inaktivt uavhengig av om det er friskt eller sykt. Dette gjør at dersom en arver et sykdomsgen fra mor, er dette genet bestemmende for fenotypen selv om det er recessivt.

Dominante arvelige sykdommer For sykdommer som følger dominant arvegang, er det nok å ha ett eksemplar av sykdomsgenet (symbolisert med D) for å bli syk. En frisk person må da være homozygot for den normale genvarianten (dd). Dominante arvelige sykdommer kan forklares med at proteinproduktet fra genet D i seg selv er skadelig, og det hjelper derfor lite å ha ett normalt gen d. Hvis genet D er relativt sjelden, er de aller fleste syke heterozygote (Dd). En syk (Dd) og en frisk person (dd) har 50 % risiko for å få et sykt barn, se figuren på neste side. På en stamtavle ser vi at et barn som arver sykdommen, alltid har en far eller mor med sykdommen. Dominante sykdomsgener som forårsaker en dødelig sykdom, er mye sjeldnere enn dødelige recessive sykdomsgener. Vi antar at alle dødelige gener har oppstått som mutasjoner i en av kjønnscellene. Forskere tror også at slike mutasjoner oppstår likt for både recessive og dominante gener. Men dersom et

Nedarving av Angelmans syndrom. Skjemaet viser mulige genkombinasjoner når en kvinnelig bærer får barn med en frisk mann som ikke er bærer. Sykdomsgenet sitter på kromosom 15. Den delen av kromosomet hvor genet sitter, er imprintet i mannens sædceller, og dermed blir genet inaktivert (symbolisert med Ri). Genet som en arver fra mor, er derfor bestemmende for fenotypen.


194 • Kapittel 5

Nedarving av dominant genetisk sykdom. Skjemaet viser mulige genkombinasjoner hos avkommene når en heterozygot syk person får barn med en frisk person.

D

X

d

d

Dd

d

dd

Heterozygot

Homozygot recessiv

D

d Dd

d

d Dd

dd

Frisk Syk

dd

2/4

2/4

Fenotypeforhold 1 : 1

0832_Sykdom3 dominant sykdomsgen forårsaker at barnet dør før det får mulighet til å få egne avkom, blir ikke sykdomsgenet overført til nye generasjoner. Derimot kan dødelige recessive sykdomsgener bli overført fra generasjon til generasjon av heterozygote bærere med normal fenotype (friske).

Huntingtons sykdom Letale dominante sykdomsgener blir bare arvet videre dersom genet fører til død ved relativ voksen alder. På den måten kan sykdomsgenet allerede ha blitt overført til neste generasjon. Et eksempel på en dødelig dominant arvelig sykdom er Huntingtons sykdom. Sykdommen rammer nervesystemet og fører til hjernesvinn. Symptomene inntrer ofte ikke før i førti–femtiårsalderen, med ufrivillige bevegelser og ulike former for sløvhet. Tilstanden forverrer seg, og normalt dør en person 10–15 år etter at de første symptomene har vist seg. Det letale genet sitter på kromosom 4. På midten av 1800-tallet ble det beskrevet en sykdom som var spesielt vanlig i Setesdal. Personene med sykdommen hadde ufrivillige rykninger i kroppen og var spesielt sløve og nedstemte. Mannen som behandlet de syke, het dr. Lund og kalte sykdommen setesdalsrykkja. Dette er den samme sykdommen som Huntington kartla noen år seinere (i 1872).


Genetikk • 195

Stamtavle fra en familie med Huntingtons sykdom. Her følger vi nedarvingen av Huntigtons sykdom gjennom fire generasjoner.

= Kvinne frisk = Mann syk

dd

dd

dd

dd

Dd

Dd

dd

dd

dd

Dd

dd

dd

dd

dd

Dd

Dd

dd

dd

Dd

dd

0833_Sykdom4

Kjønnsbundne arvelige sykdommer Kjønnsbundne arvelige sykdommer er oftest knyttet til gener som sitter på X-kromosomer. Menn har i motsetning til kvinner bare én genvariant for de fleste genene som sitter på kjønnskromosomene. For å presisere at sykdoms­ genet sitter på X-kromosomet, skriver vi Xr, og ikke bare r. De fleste kjønnsbundne arvelige sykdommene er recessive. Kvinner med ett sykdomsgen og ett normalt gen på X-kromosomene sine (XRXr), blir vanligvis ikke syke, men er bærere av sykdommen. For at en kvinne skal få sykdommen, må begge genvariantene være defekte (XrXr). For menn gir derimot et sykdoms­­ gen på X-kromosomet sykdommen (XrY). Hos menn finnes det ikke en annen genvariant på Y-kromosomet som kan kompensere for det defekte genet.

R

r

X X

R

X XRXr

XRY XR

XR XRXR

Xr

X Y

XRXr

Y XRY

Frisk Bærer Syk

XrY

0834_Sykdom5

Nedarving av kjønns­bundet genetisk sykdom. Skjemaet viser mulige genkombinasjoner når en kvinnelig bærer får barn med en frisk mann. Kvinner med et sykdomsgen på ett av X-kromosomene er bærere av sykdommen, mens menn med sykdomsgen på X-kromosomet sitt har sykdommen.


196 • Kapittel 5

Kvinnelige bærere har kjønnsceller hvor halvparten inneholder et X-kromosom med et sykdomsgen. Barn av denne kvinnen har derfor 50 % risiko for å arve sykdomsgenet. Men om disse barna blir syke, er avhengig av om de er jenter eller gutter. Dersom kvinnen får barn med en frisk mann, arver de jentene som arver sykdomsgenet fra mor, et normalt X-kromosom fra far. Disse jentene blir bærere. Gutter som arver et X-kromosom med et sykdomsgen fra mor, arver et Y-kromosom fra far. Disse guttene blir syke. Kjønnsbundne arvelige sykdommer er derfor mye vanligere hos menn enn hos kvinner. Til tross for inaktivering av det ene X-kromosomet hos kvinner blir ikke heterozygote kvinner syke. Årsaken er at noen celler i kroppen inaktiverer det ene X-kromosomet, mens andre celler inaktiverer det andre. Det fører til at cellene som har et funksjonelt gen på sin aktive X, veier opp for dem som har det funksjonelle genet på sin inaktiverte X.

Blødersyke For at blod skal størkne ved blødninger, trengs en rekke faktorer. Mangler vi en av disse faktorene, størkner ikke blodet, og vi kan få livstruende blodtap. Genene som koder for flere av disse faktorene sitter på X-kromosomet, og det er derfor oftere menn enn kvinner som er blødere. Den kongelige slekten i Europa har mange blødere. Vi kan spore blødersykdommen tilbake til dronning Victoria og tsarfamilien i Russland. Med mye inngifte i kongeslekten har denne sykdommen fått god grobunn.

Det var tidligere vanlig å gi blødere blodoverføring av blod som inneholdt disse viktige faktorene som får blodet til å størkne. Slike blodoverføringer har gitt en rekke blødere hiv fordi blodgiverne ikke var testet for hiv. Nå kan disse faktorene produseres ved hjelp av genteknologi, se kapittel 10 Bioteknologi.

Kromosomavvik Fellestrekk for de arvelige sykdommene vi har sett på til nå, er en defekt i genet. Ved kromosomavvik er det en forstyrrelse i mengden av DNA, slik at cellene i kroppen avviker fra den normale DNA-mengden. Slike individer har utviklet seg fra en zygote som enten inneholder ekstra kromosomer, eller som mangler kromosomer. Årsakene til kromosomavvikene skjer som oftest i meiosen hos en av foreldrene. Forstyrrelser i meiosen kan føre til at et kromosompar ikke splittes, men i stedet blir trukket til samme ende av cellen, og dermed havner de i samme kjønnscelle. Resultatet blir at det dannes to kjønnsceller hvor den ene har 24 kromosomer og den andre har 22. Normale kjønnsceller har 23 kromosomer.


Genetikk • 197

Meiose I

Meiose I

Meiose II

Meiose II

Kjønnsceller

n+1

Kjønnsceller

n+1

n-1

Antall kromosomer

n-1

n+1

n-1

n

n

Antall kromosomer

0839_Meiose1 Når disse kjønnscellene smelter sammen med normale kjønnsceller fra et annet individ, har de zygotene som utvikler seg, et kromosompar som enten består av tre kromosomer eller bare av ett kromosom. De fleste embryoer med kromosomavvik er ikke levedyktig og fører dermed til spontanabort. Men noen kromosomavvik er ikke så alvorlige, og avkommene lever opp.

Kromosomavvik. Figuren viser mekanismen for hvordan kromosomavvik oppstår.

Downs syndrom Downs syndrom er bare arvelig dersom personer med Downs selv får barn. Syndromet skyldes avvik under dannelsen av kjønnscellen til en av foreldrene. Personer med Downs syndrom har tre kromosomer av kromosompar 21. Risikoen for å få barn med Downs syndrom øker betydelig med morens alder.

Kromosompar 21

Tre kromosomer i kromosom­ par 21 gir Downs syndrom. 06_53 Tre kromosomer


198 • Kapittel 5

Mennesker med Downs blir moderat mentalt tilbakestående, og har et karakteristisk utseende med blant annet stor tunge, kort nakke og skjev øyestilling. Om lag halvparten har medfødt hjertefeil, og de fleste har forstyrrelser av tarmfunksjonen.

Turners syndrom og Klinefelters syndrom Disse syndromene er relatert til forstyrrelser i antall kjønnskromosomer. Mennesker med Turner har bare ett kjønnskromosom, bare én X. De er kvinner med ofte helt normale mentale funksjoner. De er kortvokste og kan ikke selv få barn. X

X X Y

X Y Y

En eller tre kjønns­ kromosomer gir ulike 06_55 Turners og Klinfelters syndromer.

Personer med Klinefelters syndrom har tre kjønnskromosomer, XXY. Dette er menn med mindre tydelige maskuline kroppskarakterer enn menn med XY. Kombinasjonen XYY forekommer også, og dette er menn med ofte overdrevent maskulint utseende.

Sjekkpunkter: Nye ord og faguttrykk: recessiv arvelig sykdom, dominant arvelig sykdom, kjønnsbunden arvelig sykdom, kromosomavvik Hvorfor kan mutasjoner gi sykdom? Hva kjennetegner en recessiv arvelig sykdom? Gi eksempler på recessive sykdommer. Hva kjennetegner en dominant arvelig sykdom? Gi eksempler på dominante sykdommer. Når er arvelige sykdommer kjønnsbundne? Hva mener vi med å være bærer av en sykdom? Hvordan oppstår kromosomavvik?

5.8 Sykdom – et samspill mellom arv og miljø I snever forstand kan vi forstå arvelige sykdommer ut fra mutasjoner. Men i en lang rekke tilfeller er det ikke sykdommen i seg selv en arver, men disposisjonen for sykdommen. Ofte er livsstilen avgjørende for om en person blir syk eller ikke. Derfor finnes det ingen skarp grense mellom arvelige sykdommer og sykdommer forårsaket av hvordan vi lever. Sykdommen er i hvert enkelt tilfelle et resultat av samspillet mellom arv og miljø. Noen bestemte gener kan representere en sykdomsdisposisjon som i seg selv ikke gjør deg syk. Men dersom kroppen blir utsatt for skadelige påkjenninger som mangel på oksygen, næringsmangel, feilernæring, giftige stoffer og infeksjoner, så kan sykdommen utvikle seg. Eksempler på sykdommer som er avhengige av mange faktorer for å utvikle seg, er diabetes, kreft og hjerte- og karsykdommer. Moderne medisin kan også motvirke eller hindre utviklingen av flere og flere sykdommer, selv om vi har et gen som er defekt.


Genetikk • 199

Eneggete tvillinger er viktige for forskningen. Studier av eneggete tvillinger kan gi svar på betydningen av miljø for en rekke genetiske sykdommer.

Fedme Overvekt og fedme skyldes som oftest en kombinasjon av arv og miljø. De med genetiske disposisjoner for å utvikle fedme er mer utsatt for å utvikle sterk fedme. Men en forutsetning for å utvikle fedme er uansett årsak tilgangen på mat. Appetitt er styrt av en rekke gener hvor mutasjon i ett av dem kan føre til arvelig fedme. Alle disse genene har en sentral rolle i reguleringen av appetitten i hjernen. Personer med feil i ett av disse genene føler seg aldri mette, men sultfølelsen avtar med matinntak. Ingen av genene sitter på kjønnskromosomene, slik at jenter og gutter rammes likt. De fleste av personene med denne arvelige disposisjonen for fedme kan ikke helbredes. Men det er mulig å forebygge følgesykdommene som type 2-diabetes, muskel- og skjelettlidelser, flere typer kreft og hjerte- og karsykdommer. Fore­ byggingen er et valg en må ta ved å tilpasse matinntaket etter kroppens behov. Det finnes håp for pasienter med mutasjoner i genet som koder for signalstoffet leptin. Leptin er metthetssignalet til hjernen. Tilføring av dette signalstoffet gir disse pasientene følelsen av å være mett.

Diabetes Diabetes skyldes manglende regulering av glukoseinnholdet i blodet. Det finnes to hovedtyper, type-1- og type-2-diabetes. Det er ikke for noen av typene funnet et enkelt gen eller et arvemønster som forklarer sykdommen. Det vi ser, er at det er en rekke faktorer som spiller inn. Pasienter med type-1-diabetes mangler evnen til å skille ut insulin fra bukspytt­ kjertelen. Disse pasientene må behandles med insulininjeksjoner. Type-1-diabetes viser et familiært arvemønster. Det betyr at det er en høyere risiko for å utvikle sykdommen dersom du er i familie med en som har type-1-diabetes. Men nedarvingsmønsteret er ukjent. Nyere epigenetisk forskning viser en sammenheng mellom kostholdet til tidligere generasjoner og forekomsten av diabetes. For pasienter med type-2-diabetes starter den manglende reguleringen av glukoseinnholdet i blodet med at insulin ikke virker slik som det skal på cellene i kroppen. Type-2-diabetes viser også et klart familiært arvemønster, og barn av foreldre med type-2-diabetes har økt risiko for å få det selv. Kosthold og mangel på fysisk aktivitet har stor betydning for utvikling av sykdommen. Nasjonalt og internasjonalt er det et økende antall pasienter med type-2diabetes. Tidligere ble sykdommen kalt aldersdiabetes fordi den var mest vanlig hos eldre mennesker. I vårt samfunn er det flere og flere unge som får diagnosen.


200 • Kapittel 5

Kreft Kreft er en samlebetegnelse på sykdommer hvor reguleringen av cellens livssyklus har kommet ut av kontroll, se side 149. Kreft gir derfor ukontrollert cellevekst i form av svulster. Det er en rekke gener som er knyttet til ulike kreftformer. Disse genene kan inneholde mange ulike mutasjoner, og hver mutasjon kan øke disposisjonen for kreft. Ofte kan flere mutasjoner sammen forsterke virkningen. Det er mulig å arve slike mutasjoner i tillegg til at de kan oppstå i oss selv. Det typiske for utvikling av kreft er at både en genetisk faktor og en miljøfaktor virker sammen. Mange stoffer er kreftframkallende uten at de gir mutasjoner. I den seinere tid er det funnet ut at flere av disse stoffene gir epigenetiske forandringer. Hvordan og om de epigenetiske forandringene øker kreftfaren i etterfølgende generasjoner, vet vi foreløpig lite om, men dette er et fagfelt det blir forsket mye på, og framtiden gir oss forhåpentligvis svar.

Hjerte- og karsykdommer Forskning har vist at dersom en i familien din har hjerte- og karsykdommer, øker faren for at du kan bli syk. Det er nå kartlagt to gener hvor mutasjoner viser seg å øke risikoen for enten å få unormale mengder av kolesterol eller lipider i blodet. Slike tilstander øker risikoen for at blodårene blir tette. En arvelig disposisjon kan bekjempes med en sunn livsstil. Det vi vet, er at røyking, fysisk inaktivitet og usunt kosthold øker risikoen for å få hjerte- og karsykdommer.

Sjekkpunkter: Hva mener vi med begrepet sykdomsdisposisjon? Gi eksempler på sykdommer hvor vi vet at både arv og miljø spiller inn for sykdomsutviklingen.


Genetikk • 201

Sammendrag • Genetikk er læren om hvordan egenskaper går i arv. Gregor Mendel er genetikkens far og postulerte to arvelover som til en viss grad gjelder den dag i dag. • Hvert gen finnes i forskjellige varianter. Gen­ variantene har samme locus på de homologe kromosomene, og de danner et genpar. Homozygote genpar har like genvarianter, mens heterozygote genpar har to forskjellige genvarianter. • Genotypen bestemmes av hvilke genvarianter genparet inneholder, mens fenotypen er hvordan genotypen kommer til uttrykk i organismen. Dominante genvarianter er bestemmende for fenotypen. Recessive genvarianter kommer bare til uttrykk når genparet er homozygot for denne varianten. • I en monohybrid arvegang følger vi nedarvingen av én egenskap som bestemmes av ett genpar. • I et krysningsskjema presenterer vi avkommenes mulige genkombinasjoner når to individer med kjent genotype blir krysset. • Når vi ønsker å avle fram spesielle egenskaper, testkrysser vi individene for å finne genotypen. • For å studere nedarvingsmønstre hos mennesker bruker man ofte stamtavler. • I en dihybrid arvegang følger vi nedarvingen av to egenskaper hvor hver av egenskapene bestemmes av ett genpar. Dersom genene sitter på forskjellige kromosomer, nedarves genene uavhengig av hverandre. Når genene sitter på samme kromosom, blir de nedarvet sammen, og under dannelsen av kjønnsceller kan det skje overkrysninger. • Kjønnsbundet arv er arv som er knyttet til gener på kjønnskromosomene. Hanner har ofte ett X- og ett Y-kromosom, og genene på X finnes derfor i bare én variant. Det gir ulikt nedarvingsmønster hos hunner og hanner for recessive kjønnsbundne gener. • I fullstendig dominans er en genvariant bestemmende for fenotypen. I ufullstendig dominans kan det oppstå fenotypiske mellomformer i forhold til foreldrene, fordi ingen av genvariantene er bestemmende for fenotypen. Når begge genvariantene viser sin fulle virkning samtidig, kalles det kodominans.

• Genpar som har flere enn to mulige varianter, kalles multiple genvarianter. Når en genvariant kan føre til død, kalles den letal. • Gener som styrer flere forskjellige egenskaper, kalles pleiotrope. • Epistase er en samhandling mellom mange genpar om én egenskap. Det finnes en rekke samhandlinger hvor alle gir ulike fenotypeforhold. • Kvantitative egenskaper er egenskaper som kommer til uttrykk som summen av effekten fra to eller flere genpar i samspill med miljøet. • Menneskelige egenskaper følger sjelden enkle nedarvingsmønstre. Egenskapene kommer til uttrykk etter et komplekst samspill mellom mange ulike gener og med miljøet. • I epigenetikken ser vi på forandringer i genaktivitet som ikke er forårsaket av forandringer i den genetiske koden. Det er tre hoved­mekansimer som gir epigenetiske forandringer; DNA-metylering, histonmodifisering og RNA-molekyler som opprettholder genaktiviteten. • Mutasjoner i et gen kan gi genetiske sykdommer. Noen mutasjoner gir recessive sykdomsgener som ofte er ikke-funksjonelle proteiner. Andre mutasjoner gir dominante sykdomsgener som ofte gir proteiner som skader cellene. Dette er utgangspunktet for at nedarvingsmønstrene for recessive og dominante arvelige sykdommer er forskjellige. • Dersom sykdomsgenet sitter på ett av kjønnskromosomene, er nedarvingen avhengig av kjønnet. Dersom sykdomsgenet sitter på X-kromosomet, er menn mer utsatt siden de bare har én X. Kvinner med ett recessivt sykdomsgen er friske, men bærere av sykdommen. • De fleste arvelige sykdommene er styrte av mange gener i samspill med ulike miljøfaktorer. Genene forteller noe om sykdomsdisposisjon, men livsstilen har stor betydning for om sykdommen bryter ut eller ikke.


202 • Kapittel 5

Oppgaver Tips til oppgavene finner du på www.gyldendal.no/bi Når man skal løse genetikkoppgaver, er det viktig å sette opp krysningsskjemaer. Lag dine egne eller bruk krysningsskjemaet under som mal. Disse malene ligger også på nettstedet til boka.

1 Gi en forklaring til hvert av fagordene gen, genvariant (allel), locus, homologe kromosomer, genpar, genotype og fenotype. Bruk enkle skisser og eksempler. 2 a Forklar forskjellen på et heterozygot og et homozygot genpar. b Hva betyr det at en genvariant er dominant?

X

c Lag en skisse som viser homologe kromosomer med genparet for en person med grå og tørr ørevoks. Genvarianten for gul, klebrig ørevoks er dominant over genvarianten for grå og tørr ørevoks. 3 Hva menes med at et gen kommer i flere varianter? 4 Formuler Mendels arvelover og bruk eksempler som underbygger lovene hans. Hvilke forutsetninger ligger til grunn for at disse lovene skal gjelde?

0701_Heterozygote.pdf

X

5 Om stengelen er lang eller kort på en erteplante, bestemmes av ett genpar. Genvarianten som gir lang stengel, er dominant over genet som gir kort stengel. Genet sitter ikke på kjønnskromosomene. To heterozygote planter krysses. Sett opp krysningsskjema og bestem kjønnscellenes genotyper, avkommenes mulige genkombinasjoner og det forventede forholdet mellom avkommenes fenotyper. Du bestemmer selv bokstavsymbolene for genvariantene. 6 Hos erteplanter bestemmes fargen på blomsten av ett genpar. Genvarianten som gir lilla farge (symbolisert med L), er dominant over genet som gir hvit farge (symbolisert med l). Genet sitter ikke på kjønns­ kromosomene. En homozygot dominant plante krysses med en homozygot recessiv plante. a Hvilke fenotyper og genotyper har P-generasjonen? b Hva kaller vi avkommets generasjon? c Hvilke mulige fenotyper og genotyper kan avkommene ha? d Lag et krysningsskjema som viser mulige gen­ kombinasjoner når avkommene krysses med hverandre.

0702_Pels.pdf

e Hva blir forholdet mellom fenotypene i F2generasjonen?


Genetikk • 203

7 En recessiv genvariant gir svart kropp hos homozygote bananfluer. Bananfluer med den dominante genvarianten gir grå kroppsfarge. Genet sitter ikke på kjønns­ kromosomene. Hvilket forhold mellom avkommenes fenotyper kan vi forvente dersom en heterozygot grå hunn pares med en homozygot svart hann? 8 Pelsfargen til kaniner bestemmes blant annet av ett genpar hvor genvarianten for svart pels er dominant over genvarianten for brun pels. Genet sitter ikke på kjønnskromosomene. Forklar resultatene ved hvert krysningsforsøk nedenfor, og bestem foreldrenes sannsynlige genotype. a To svarte kaniner parer seg, og alle kaninungene blir svarte. b To svarte kaniner parer seg, og ca. 25 % av kaninungene får brun pels.

10 La oss anta at kløft i haka bestemmes av ett genpar som ikke sitter på kjønnskromosomene. Det er den dominante genvarianten som gir kløft i haka. En person med kløft får barn med en person uten kløft i haka. Personen med kløft er gentestet for «kløftgenet», og testen viser at hun er heterozygot. a Sett opp et skjema som viser ulike genkombinasjoner barna til disse personene kan få. b Hva er sannsynligheten for at barnet får kløft i haka? c Har du kløft i haka? Hvilke(n) genotype(r) kan du ha? 11 Hos kanin er genvarianten for svart pels dominant over genvarianten for brun pels, og genvarianten for kort pels er dominant over genvarianten for lang pels. De to genene sitter på forskjellige kromosomer og ikke på kjønnskromosomene. To heterozygote kaniner for begge genparene parer seg.

c En av foreldrene har svart pels, og den andre har brun pels, alle kaninungene får svart pels.

a Hvilken fenotype har disse kaninene? b Bestem genotypene til kjønnscellene (eggcelle og sædcelle).

d En av foreldrene har brun pels, den andre har svart pels, ca. 50 % av kaninungene får svart pels, mens den andre halvparten får brun pels.

c Sett opp et krysningsskjema og vis mulige genkombinasjoner hos kaninungene.

9 På figuren under ser du en stamtavle over nedarvingen av øreflippform i en familie. Øreflippformen er i hovedsak styrt av ett genpar. Genvarianten som gir fri øreflippform (symbolisert med F), er dominant. Bestem den sannsynlige genotypen til personene i stamtavlen.

d Hva er det forventede forholdet mellom fenotypene til kaninungene? e Hvor stor sannsynlighet er det for at en kaninunge får brun, kort pels? mann kvinne

fri a.

b.

fast e.

c.

d.

j.

k.

l.

s.

t.

r.

0704_Øreflippform.pdf

f.

m.

u.

h.

g.

n.

i.

o.

p.

q.

v.

w.


204 • Kapittel 5

Oppgaver 12 Du er bonde og ønsker å starte med ullsalg i tillegg til kjøtt fra sau. Ute på jordet ditt beiter en rekke sauer med både kort og lang ull. Noen sauer er grå, mens andre er svarte. La oss anta at ullengden er styrt av ett genpar, mens ullfargen er styrt av et annet genpar. Genparene sitter på forskjellige kromosomer. Vi tar utgangspunkt i at genvariantene for kort ullengde og svart farge er recessiv. Hvordan ville du gå fram dersom du ser at markedet for svart ull er stort?

d Vi tenker oss at under dannelsen av kjønnscellene skjer det en overkrysning hvor bruddet er mellom genene H/h og R/r. Illustrer overkrysningen og vis de ulike genkombinasjonene i kjønnscellene til både høna og hanen.

13 a Hva menes med en egenskap i genetikken?

f Samme høne og hane blir paret over noen år. Resultatet av krysningsforsøkene finner du i tabellen under. Bestem antall rekombinanter i prosent.

b Diskuter med en medelev forskjellen mellom egenskap og fenotype. 14 a Hva vil det si at gener er koblet? b Når skjer det overkrysning mellom kromosomer? c Beskriv hvordan en overkrysning skjer. d Hvorfor øker overkrysninger den genetiske variasjonen? 15 På figuren under ser du seks kromosompar fra tre celler. I hver celle er det to kromosompar (ett stort og ett lite par). Tenk deg at hver av cellene deler seg ved meiose. Vis hvilke gen­kombinasjoner kjønnscellene kan ha.

a b

aa a aa b b c b cc b cc d dd d

A cB d

AA

A A B B C B CC B CC D D DD D

a Cb D

Fjærfarge

Fjærform

Fenotype for egenskapene fjærfarge og fjærform hos høns

Antall avkom

Hvite og rynkete fjær

53

Brune og rette fjær

50

Hvite og rette fjær

12

Brune og rynkete fjær

8

17 La oss anta at et tredje genpar hos høns (se oppgave 15) styrer om de voksne hønene og hanene utvikler fjærhette eller ikke. Genvarianten som koder for fjærhette, er dominant, og ligger på samme kromosom som genene som styrer fjærfarge og fjærform. I et A A a aA C pares en høne med fenotypene brune B cC B Cc krysningsforsøk bB c b fjær og ingen fjærhette med en hane med fenotype D D d d dD hvite fjær med fjærhette. Hanen er heterozygot.

16 Hos høns tar vi utgangspunkt i at egenskapene fjærfarge og Diploide fjærform er styrt av hvert sitt ene genpar. Genene er 06_6506_65 Diploide Diploide 06_65 celler celler celler koblet. I tabellen finner du en oversikt over de ulike genvariantene til de tilhørende egenskapene. En høne med genotype HhRr pares med hane med genotypen hhrr. Egenskap Genvariant

e Lag et krysningsskjema som viser mulige genkombinasjoner kyllingene kan få. Hvilke fenotyper har de rekombinante kyllingene når de blir voksne?

Dominant/ Symbol recessiv

a Bestem genotypene til høna og hanen. b Vis ved hjelp av et krysningsskjema hvilke genotyper og fenotyper avkommene kan få. c Samme høne og hane blir paret over noen år. Resultatet av krysningsforsøkene finner du i tabellen under. Bestem antall rekombinanter i prosent.

Gen for hvite fjær

Dominant

H

Fenotype for egenskapene fjærfarge og fjærhette hos høns

Gen for brune fjær

Recessiv

h

Hvite fjær med fjærhette

58

Gen for rynkete fjær Dominant

R

Brune fjær uten fjærhette

56

Gen for rette fjær

r

Hvite fjær uten fjærhette

16

Brune fjær med fjærhette

19

Recessiv

a Bestem fenotypen til høna og hanen. b Tegn de homologe kromosomene med genparene for både høna og hanen. c Vis ved hjelp av krysningsskjema mulige genkombinasjoner til kyllingene dersom det ikke har skjedd noen overkrysninger i løpet av meiosen hos høna.

Antall avkom

d Genet for fjærfarge ligger mellom genene for fjærhette og fjærform. Bruk svarene i c og oppgave 16 f til å bestemme hvilket gen som ligger nærmest genet for fjærfarge. Illustrer resultatet ved å tegne genene inn på et kromosom.


Genetikk • 205

18 a Genparet som bestemmer lengden av antennene på bananfluer, sitter på kromosom II. En mutasjon i dette genet gjør at homozygote recessive bananfluer har korte antenner. En homozygot bananflue med lange antenner blir krysset med en bananflue med korte antenner. Individer fra F1-generasjonen blir krysset med hverandre. Illustrer nedarvingen ved hjelp av krysningsskjemaer. Velg selv bokstavsymboler for genene.

e Hva slags fargesyn har farmoren hans? f Kan vi med sikkerhet bestemme fargesynet til mormoren og farfaren hans? Begrunn svaret ditt. g Tegn en stamtavle som viser arvegangen gjennom tre generasjoner. 21 Ser du hva som står her? Diskuter resultatet.

b En annen mutant har korte vinger. Normalt har bananfluer lange vinger. En homozygot dominant bananflue med lange vinger blir krysset med en mutant (homozygot recessiv). Individene i F1generasjonen blir krysset med hverandre. Bestem forholdet mellom fenotypene i F2-generasjonen. c I et krysningsforsøk ble det brukt en heterozygot hunn med lange antenner og lange vinger, og en homozygot recessiv hann med korte antenner og korte vinger. Resultatet av krysningsforsøket kan du lese i tabellen nedenfor. Forklar resultatet ved hjelp av krysningsskjemaer og utfyllende tekst. Fenotype for egenskapene vinge- og antennestørrelse hos bananfluer

Antall avkom

Lange vinger og lange antenner

2315

Korte vinger og korte antenner

2212

Lange vinger og korte antenner

703

Korte vinger og lange antenner

694

19 a Hvorfor er det naturlig at det oftere skjer overkrysninger mellom koblede gener som ligger langt fra hverandre på kromosomet, enn mellom gener som ligger svært nær hverandre? b Sammenlign resultatene fra krysningsforsøkene med bananfluer som er beskrevet på side 172 og i oppgave 18 c. Alle genene ligger på samme kromosom (II). Hvilket gen ligger nærmest vingelengdegenet – antennelengdegenet eller kroppsfargegenet? 20 Genet for normalt fargesyn er dominant og sitter på X-kromosomet. En mann har en fargeblind mor, mens faren har normalt syn. a Hva slags fargesyn har mannen selv? b Hva slags fargesyn har brødrene hans? c Hva slags fargesyn har søstrene hans? d Hva slags fargesyn har morfaren hans?

22 En plante med gule blomster krysses med en med blå blomster. Alle avkommene får grønnaktige blomster. Blomsterfargen bestemmes av ett genpar. Gjør rede for mulig nedarvingsform. 23 Drøft dette utsagnet: «Kodominans og ufullstendig dominans er vel egentlig det samme. Dette ser vi tydelig på blomsterfargen hos løvemunn. De heterozygote blomstene får rosa blomsterfarge fordi begge genvariantene uttrykkes like mye. Hvitt blandet med rødt gir jo rosa.» 24 En plante med prikkete blader krysses med en plante med flekkete blader. Alle plantene i F1-generasjonen får både prikkete og flekkete blader. Ta utgangspunkt i at prikker og flekker på bladene bestemmes av ett genpar. Gjør rede for nedarvingsform. 25 Forklar hva som menes med multiple genvarianter i et genpar. 26 En kvinne med blodtype A gifter seg med en mann med blodtype B. Deres første barn får blodtype O. a Hvilken genotype har disse tre individene? b Hvilke andre genotyper er mulige for framtidige barn? c Bestem sannsynligheten for de ulike fenotypene til barna dette paret får. d Hvor mange varianter har genet som bestemmer blodtypen? Hva kaller vi disse genvariantene?


206 • Kapittel 5

Oppgaver 27 Nedenfor finner du noen spørsmål knyttet til blodtypesystemet ABO. Begrunn svarene dine. a En mor har blodtype A, og barnet har blodtype O. Hvilke(n) blodtype(r) kan faren ha? b Både mor og far har blodtype A. Hvilke(n) blodtype(r) kan barnet få? c En kvinne med blodtype A føder et barn med blodtype B. Kan en mann med blodtype O være far til barnet? d Mor har blodtype A, og barnet har blodtype AB. Hvilke(n) blodtype(r) kan faren ha? e Både mor og far har blodtype B, mens barnet har blodtype O. Barnets farfar har blodtype O. Hvilke(n) blodtype(r) kan farmor ha? 28 Arten brunrotte (Rattus norvegicus) kan ha gul pels. Det gule fargepigmentet skyldes en dominant genvariant (symbolisert med G). Denne genvarianten er letal (dødelig) i dobbel dose, og homozygote dør allerede som fostre. Homozygote recessive brunrotter er brune. a To gule brunrotter parer seg med hverandre. Lag en oversikt over forventede genkombinasjoner og fenotypeforhold til avkommene. b Genvarianten G er også et pleiotropt gen. Begrunn hvorfor. 29 Blomsterfargen til en erteplante bestemmes av et samvirke mellom to genpar. Genparene sitter på forskjellige kromosomer. Begge genparene må ha minst en dominant utgave for å kunne gi en purpurfarget blomst. Den biokjemiske forklaringen på virkemåten til disse genene er noe forenklet at produksjon av pigmenter i blomsten er en totrinnsprosess. Det første trinnet fra substrat 1 til substrat 2 styres av enzym A. For å få et fungerende enzym A må genvarianten være dominant (symbolisert med A). Neste trinn er tilsvarende, her må den dominante genvarianten B være til stede for at enzym B skal være funksjonelt og gi et purpurfarget produkt. Dersom ikke det purpurfargete produktet lages, blir erteblomsten hvit.

30 Pelsfarge hos hester er i hovedsak styrt av to genpar som sitter på hvert sitt kromosom. Ingen av genparene sitter på kjønnskromosomene. Genet som koder for enzymet E, gir svart farge på pelsen uavhengig av det andre genparet. Derimot er hesten homozygot recessiv for dette enzym E-genparet (symbolisert med ee), påvirkes fenotypen av et annet genpar (symbolisert med C/CCR). Genvariantene i dette genparet viser et ufullstendig dominansforhold. Genvarianten CCR står for creamy. Under finner du en tabell som litt forenklet viser hvilke genotyper som gir hvilke fenotyper for egenskapen pelsfarge. Genotype

Fenotype for egenskapen pelsfarge hos hester

EECC EECCRCCR EECCCR EeCC EeCCRCCR EeCCCR

Svart pels

eeCC

Kastanjefarget pels

CR

CR

eeC C

Hvit pels

eeCCCR

Gyllen pels

a Lag en illustrasjon som viser hvordan genene fra de to genparene virker sammen. b To heterozygote hester for begge genparene pares. Vis ved hjelp av krysningsskjema mulige genotyper og fenotyper som avkommene kan få. c Bestem fenotypeforholdet mellom avkommene i b. 31 Vi tar utgangspunkt i at vanlig skallethet skyldes et dominant, ikke kjønnsbundet gen (symbolisert med S). Det recessive genet (symbolisert med s) gir ikke skallethet. Det mannlige kjønnshormonet testosteron må være til stede for at egenskapen skallethet skal komme til syne. Genet som dirigerer testosteron­ produksjonen, kaller vi sry-genet, og det sitter på Y-kromosomet.

a Lag en oversikt over hvilke genotyper som gir hvilke fenotyper for egenskapen blomsterfarge.

a Lag en oversikt over hvilke genotyper som gir hvilke fenotyper for egenskapen skallethet.

b Lag en illustrasjon som viser hvordan genene fra de to genparene virker sammen.

b Lag en illustrasjon som viser hvordan genet for testosteron påvirker genet for skallethet.

c To heterozygote erteplanter for begge genparene krysses. Vis ved hjelp av krysningsskjema mulige genotyper og fenotyper som avkommene kan få.

c To heterozygote for genet for skallethet får barn. Sett opp et skjema som viser mulige genkombinasjoner for barna. Bestem hvor stor sannsynlighet det er for at neste barn blir skallet.

d Bestem fenotypeforholdet mellom avkommene i c.


Genetikk • 207

d En skallet mann får tre sønner og en datter. Ingen av dem utvikler skallethet. Hva er den mest sannsynlige genotypen til mannen, konen og barna hans? Begrunn svaret ditt. e Det er vanlig å si til gutter at de skal se på morfaren sin om de blir skallet eller ikke. Stemmer dette? Begrunn svaret ditt. 32 I oppgave 31 skriver vi «testosteron må være til stede for at egenskapen skallethet skal komme til syne». Diskuter med en medelev hvordan testosteron kan tenkes å virke. 33 Ta utgangspunkt i at hvor høy du blir, styres kvantitativt av flere genpar som sitter på forskjellige kromosomer. Forklar hvorfor det er sannsynlig at en veldig høy far vil få en lavere sønn. 34 I middelalderen ble menneskene i gjennomsnitt bare 1,5 m høye. Det er veldig små forskjeller mellom genene til disse menneskene og våre gener. Hvordan er det da mulig at vi i gjennomsnitt blir mye høyere i dag? 35 Ta for deg tabellen på side 184. Velg deg noen egenskaper hvor du finner din egen fenotype og mulig genotype(r).

41 Pelsfargen til en bestemt kattetype bestemmes av kun et gen som sitter på X-kromosomet. Genvarianten som gir svart pelsfarge, er fullstendig dominant over genvarianten som gir oransje pelsfarge. Men likevel er heterozygote hunner spraglete. Alle hanner er enten oransje eller svarte. Forklar hvorfor heterozygote hunnkatter er spraglete. 42 Forklar på en genetisk faglig måte hvorfor ekteskap mellom søskenbarn øker sjansen for arvelige sykdommer. Bruk ordene genvariant, gen, recessiv, dominant, homozygot, heterozygot og mutasjon i forklaringen din. 43 Genetiske sykdommer skyldes forandringer i og/eller på DNA. Forklar hva som menes med det. 44 Beskriv hvordan mutasjoner kan gi recessive og dominante arvelige sykdommer. 45 Personer med sykdommen pseudohypertrofisk muskulær dystrofi dør tidlig i tenårene. Gjør rede for hvorfor denne sykdommen ville ha dødd ut dersom den hadde vært dominant. 46 To bærere for sykdommen cystisk fibrose får barn. a Vis mulige genkombinasjoner barna kan få.

36 Drøft utsagnet «Kvantitativ arv er egentlig det samme som epigenetisk arv». 37 a Beskriv med egne ord hva som menes med epigenetikk. b Hva er forskjellen mellom genetikk og epigenetikk?

b Hvor stor sannsynlighet er det for at barnet får sykdommen? Begrunn svaret ditt. c Hvor stor sannsynlighet er det for at barnet er bærer? 47 En kvinne som er bærer for Angelmans syndrom, får barn med en mann som er frisk og ikke bærer.

38 Beskriv de ulike mekanismene som gir epigenetiske forandringer. Hvilke konsekvenser kan disse forandringene få for uttrykket av et gen?

a Vis mulige genkombinasjoner barna kan få.

39 Beskriv tre eksempler på konsekvenser av epigenetiske forandringer.

c Hvor stor sannsynlighet er det for at barnet er bærer?

40 Genet for vekstfaktoren Igf2 er en av mange gener som styrer veksten i pattedyr. Genet ligger ikke på kjønnskromosomene. En mutasjon i dette genet fører til dvergvekst. Men det viser seg at krysses en mus med normal vekst med en dvergmus, er høydestatusen til avkommet avhengig av om det er moren eller faren som er dverg. Det er kun når faren er dverg, at museungen kan bli dverg. Gjør rede for arveform av dette genet.

b Hvor stor sannsynlighet er det for at barnet får sykdommen? Begrunn svaret ditt.

48 I tabellen på side 192 ser du at i Nord-Europa er 1 av 25 bærere for sykdommen cystisk fibrose. a Forklar ved hjelp av sannsynlighetsberegning hvorfor man antar at ca. 1 av 2500 blir syke. b Tenk deg at alle som er syke, velger å ikke få barn. Forklar hvorfor dette får liten innvirkning på utbredelsen av sykdommen.


208 • Kapittel 5

Oppgaver 49 En frisk person får barn med en som senere vil utvikle den dominante arvelige Huntingtons sykdom. a Vis mulige genkombinasjoner barna kan få. b Hvor stor sannsynlighet er det for at barnet får sykdommen? Begrunn svaret ditt. c Forklar hvordan det er mulig at dominante, letale sykdomsgener er arvelige. d En person får vite at moren døde av Huntington. Hvor stor sannsynlighet er det for at personen har arvet sykdomsgenet? e Tenk deg at denne personen kommer til deg for å få råd. Personen vet lite om sykdommen, og er i tvil om han skal genteste seg for å finne ut om han har arvet sykdommen. Reflekter over hvordan du ville gått frem i rådgivingen. 50 En mann med blødersykdommen hemofili har en datter som ikke har hemofili. Hun gifter seg med en mann som ikke har hemofili. Hemofili skyldes et recessivt, X-kjønnsbundet gen.

51 Diabetes insipidus er en sjelden sykdom som enten skyldes at hypofysen ikke produserer hormonet ADH, eller at hypofysen produserer ADH, men hormonet virker ikke som det skal. I Bi 1 kunne du lese at ADH sørger for tilbaketransport av vann fra nefronkanalens samlekanal, slik at kroppen ikke taper for mye vann. Den første sykdomstypen skyldes et dominant gen A, som ikke er kjønnsbundet. Den andre typen skyldes et recessivt gen b som sitter på X-kromosomet. En mann med denne sykdommen vet at moren har sykdommen, mens faren er frisk. Både broren og søsteren hans er friske. a Har mannen den kjønnsbundne eller den ikkekjønnsbundne sykdommen? Begrunn svaret ditt. b Hvilke genotyper er det mest sannsynlig at foreldrene og søsknene har? 52 Gjør rede for kromosomfordelingen i kjønnscellene til en person med Downs syndrom. Dersom to personer med Downs syndrom ønsker seg barn, hvordan vil kromosomfordelingen for kromosom 21 i de befruktede eggcellene kunne være?

a Hvor stor er sannsynligheten for at de vil få en datter med hemofili? b Hvor stor er sannsynligheten for at de vil få en sønn med hemofili? c Paret får fire sønner som alle har hemofili. Hvor stor var sannsynligheten for at dette skulle skje?

Sammensatte oppgaver 53 I denne oppgaven skal du se på blodtyper i ABOsystemet og i rhesussystemet. De to blodtypesystemene styres av hvert sitt genpar på forskjellige kromosomer. Genparet som styrer ABO-blodtypen, inneholder multiple genvarianter (symbolisert med IA/IB/i). For rhesus­systemet har du enten rhesusfaktoren i blodcelle­ membranen (Rh+) eller du mangler denne faktoren (Rh–). Genvarianten som styrer rhesusfaktoren (symbolisert med R), er dominant. Homozygote recessive har blodtypen Rh–. En mann med genotype IBirr lager mange barn med en kvinne med genotype IAiRr.

a Hvilken fenotype har kvinnen og mannen? b Hva er det forventede forholdet mellom genotypene til barna? c Hva er det forventede forholdet mellom fenotypene til barna? d Dersom moren har genotype IAIBRr og faren genotype iirr, hva ville svarene på a–c vært da?


Genetikk • 209

54 Bananfluer har normalt grå eller svart kropp, og gen­ varianten som gir grå kropp (symbolisert med K), er dominant over genvarianten som gir svart kropp (symbolisert med k). Kroppsfargen bestemmes av et genpar som ligger på kromosom II. Men et gen på X-kromosomet virker sammen med dette genparet. En mutasjon i dette genet gir gul kropp uavhengig av hvilket genpar bananfluen har på kromosom II. Genvarianten som gir gul kropp (symbolisert med g), er recessiv.

Hunnene er også homozygote dominante for svart/ grå kroppsfarge. Bestem avkommenes mulige genotyper og fenotyper. c I det andre forsøket skal dere krysse grå hunner med gule hanner igjen, men denne gangen er både hunnene og hannene heterozygote for genparet på kromosom II. Hunnene er også heterozygote for genparet på X-kromosomene. Bruk krysningsskjemaet under til å vise avkommenes mulige fenotyper.

a Lag en illustrasjon som viser hvordan genene virker sammen.

d Sett opp forholdet mellom fenotypene for hunner og hanner hver for seg.

b I det første forsøket skal dere krysse grå hunner med gule hanner. Både hunnene og hannene er homozygot dominante for genparet på kromosom II.

K

X

k G

e Bestem sannsynligheten for at avkommet blir en gul hann.

g

K

g

KkXGXg X

KkXgY

X

II

KXG KXg kXG kXg

KXg KY

KKXGXg

KkXGXg KkXGY

KkXGY

KkXgXg kkXGXg

kkXgXg

KkXgY

kkXGY kkXgY

kY

KkXGXg

KKXgY

KkXgY

kXg

KKXGY

KKXgXg

KkXgXg

0706_Bananflue.pdf

k

X Y


210 • Kapittel 5

Sammensatte oppgaver 55 I denne oppgaven skal du følge tre genpar som sitter på hvert sitt kromosom. a Et heterozygot individ for alle tre genparene har genotypen AaBbCc. Hvor mange ulike kjønnsceller har dette individet for disse genparene? b To heterozygote individer krysses. Vis mulige genkombinasjoner til avkommene. Bruk figur side 183 til å bestemme forholdet mellom genotypene. 56 I tabellen nedenfor finner dere resultatet av tre krysningsforsøk med erteplanter. Bestem foreldrenes genotype for genene som bestemmer erteform og ertefarge ved hvert av forsøkene. Er genene koblet? Begrunn svaret ditt. Fenotype for egen- Antall skapene fjærfarge avkom i forsøk 1 og fjærform hos høns Gul og rund 308

Antall avkom i forsøk 2

Antall avkom i forsøk 3

06_72 ert-02 Grønn og

rund

223

297

0

74

106

92

77

301

06_72 ert-03

Grønn og skrukkete

0

e To gule rotter som er heterozygote for albinogenet, parer seg med hverandre. Hvilken fordeling av fargevarianter kan vi forvente mellom de levendefødte ungene til disse rottene? 58 Eksamensoppgave, 1990 (endret) a Et foreldrepar som ikke har Føllings sykdom, får fem barn. To av dem blir behandlet for Føllings sykdom. Velg symboler for genene, og forklar hvilke genotyper foreldrene og barna har. Sett opp krysningsskjema. b Ett av de friske barna fra a venter barn med en person som også har søsken med Føllings sykdom, men som er frisk selv. Hva er sannsynligheten for at de skal få et barn med denne sykdommen? Begrunn svaret ditt. c Hva ville sannsynligheten være hvis genvarianten for Føllings sykdom bare forekom i den ene av familiene?

06_72 ert-01

Gul og skrukkete

d En albino rotte parer seg med en brun rotte, og alle avkommene blir gule. Bestem foreldrenes og avkommenes genotyper.

26

96

06_72 ert-04

57 Arten brunrotte (Rattus norvegicus) kan ha gul pels. Det gule fargepigmentet skyldes en dominant genvariant (symbolisert med G). Denne genvarianten er letal (dødelig) i dobbel dose, og homozygote dør allerede som fostre. Homozygote recessive brunrotter er brune. a To gule brunrotter parer seg med hverandre. Lag en oversikt over forventede genkombinasjoner og fenotypeforhold til avkommene. b Genvarianten G er et pleiotropt gen. Begrunn hvorfor. c Ta utgangspunkt i at hvite brunrotter (albinoer) skyldes en recessiv genvariant, og at denne genvarianten sitter på et annet kromosom enn genet for gul/brun pelsfarge. Albinorotter danner ikke pigmenter i pelsen, verken brunt eller gult. Lag en illustrasjon som viser samvirket mellom genene som er involvert i dannelse av pelsfarge.

d De to som venter barn, har begge mørkt hår, men er bærere av den recessive genvarianten som gir rødt hår. La oss forenklet si at mørkt hår er dominant over rødt hår. Anta at begge personene også er bærere av Føllings sykdom. Velg symboler for genene og lag et skjema som viser fordelingen av de ulike fenotypene for egenskapene hårfarge og Føllings sykdom. Genene sitter ikke på samme kromosom. e Personer med Føllings sykdom har alltid lys hårfarge fordi den genfeilen som gir Føllings sykdom, også hindrer eventuelle gener for mørkt/rødt hår å komme til uttrykk. Lag en illustrasjon som viser hvordan genet for Føllings sykdom virker sammen med genet for hårfarge (forenklet sett genet for mørkt/rødt hår). Vis fordelingene av barnas fenotyper for hårfarge når to heterozygote individer for begge genparene får barn. 59 I stamtavlen på neste side ser du nedarving av en veldig sjelden sykdom. Personer med denne sykdommen er markert med et kryss. Forskere har funnet ut at sykdommen skyldes kun ett genpar. a Bruk stamtavlen til å avgjøre hvordan sykdommen sannsynligvis nedarves.


Genetikk • 211

mann kvinne

b I den samme familien er en gutt blitt bløder (X-bundet, recessiv arv) akkurat som morfaren. Bruk 06_69 Stamtavle1 stamtavlen nedenfor til å vise hvordan sykdommen er nedarvet. mann kvinne

60 En gutt er både fargeblind og bløder, mens foreldrene er verken blødere eller fargeblinde. Guttens mormor, derimot, er fargeblind, mens guttens morfar var bløder. Genene for disse egenskapene sitter på X-kromosomet og nedarves recessivt. Begrunn hvorfor det er mulig at gutten har blitt både fargeblind og bløder. 61 Fargen på kronbladene til primula (kusymre på norsk) er kontrollert av samhandling mellom to genpar. Pigmentet som kalles malvidin, gir blå kronblader. Syntese av malvidin er kontrollert av genvarianten M, men produksjonen kan undertrykkes av genvarianten S. Genene finnes på forskjellige kromosomer. I dette tilfellet er genvarianten S dominant over M, slik at planter med genotype MmSs ikke vil produsere malvidin. a Lag en oversikt over hvilke genotyper som gir hvilke fenotyper i dette eksempelet. b Lag en illustrasjon som viser hvordan de to genparene påvirker fenotypeuttrykket.

c Bruk den samme familien og illustrer en sykdom hvor du bestemmer nedarvingsformen. Test gjerne en 06_70 Stamtavle2 medelev om han eller hun klarer å finne nedarvingsformen.

c To heterozygote for begge genparene krysses. Sett opp et krysningsskjema som viser mulige genotyper og fenotyper for kronbladfarge (blå/ikke-blå). d Bestem fenotypeforholdet mellom avkommene i c (blå kronblader : ikke-blå kronblader).

Gruppe-, nett- og presentasjonsoppgaver 62 Gjør rede for hva som ligger i utsagnet: «Dersom du er over 5 år og tåler melk, er du en mutant!» 63 Tenk dere at alle har et genbibliotek over sine egne gener. Diskuter hvilke konsekvenser det vil kunne få for valget av kjæreste. 64 Cystisk fibrose er den vanligste genetiske sykdommen i Norge. Finn ut mer om denne sykdommen – både hvordan den arter seg, og hvilke mutasjoner som forårsaker sykdommen. 65 Parkinson er en dominant genetisk sykdom. Finn ut mer om denne sykdommen – både hvordan den arter seg, og hvilke mutasjoner som forårsaker sykdommen. 66 En sædcelle med et Y-kromosom befrukter en eggcelle, men barnet som vokser opp, utvikler i liten grad sekundære mannlige karaktertrekk. Drøft med utgangspunkt i de genetiske kunnskapene dine hvordan dette er mulig.

67 Nyere forskning viser at noen kvinner identifiserer svettelukt som vanilje. Hva er det som lukter vanilje, og hvilke gener er involvert i denne ekstravagante luktesansen? 68 ADHD (hyperaktivitet) er en kompleks lidelse, men en faktor som ofte forekommer, er en ubalanse i mengden av nevrotransmitteren serotonin i hjernen (se Bi 1 side 139). Nyere forskning har vist at en mutasjon i et gen som koder for enzymet som styrer produksjonen av serotonin, kan være avgjørende for utvikling av ADHD. Diskuter hvilke konsekvenser funnet av disse mutasjonene kan få for ADHD-pasienter. 69 Hver dag kommer det nye epigenetiske funn fra forskningsverdenen som binder arv og miljø tett sammen. Finn et dagsaktuelt humant epigenetisk tema og lag en presentasjon.


212 • Kapittel 5

Gruppe-, nett- og presentasjonsoppgaver 70 Diskuter fordeler og ulemper med gentesting av sterkt overvektige for «fedmegener». 71 Ta utgangspunkt i en av sykdommene nedenfor og diskuter forholdet mellom arv og miljø for utvikling av sykdommen: – diabetes – kreft – hjerte- og karsykdommer 71 Finn ut mer om sykdommene under og bruk skjemaet til å vise nedarvingen av den enkelte sykdommen. Et tilsvarende skjema finner dere på www.gyldendal.no/bi. – Nevrofibromatose – Duchennes muskeldystrofi – Diabetes insipidus

X

06_73 Krysning

72 I en koloni med honningbier ser vi store fenotypiske forskjeller mellom dronningbien og arbeiderne både i utseende, atferd og fysiologi. Dette til tross for at de er genetisk identiske. Grunnen er larvenes diett. I starten blir alle larver gitt en spesiell gelé, men ganske raskt blir arbeiderlarvene avvent denne dietten og gis i stedet nektar og pollen. Dronningbiene derimot bader i den kongelige geléen gjennom hele larvestadiet og inn i voksenlivet. Finn ut hva som er i denne kongelige geléen som fører til forskjellene mellom de to kastene, og forklar den epigenetiske mekanismen.


Genetikk • 213

Korte foredrag • Eksempler på epigenetikk

• Genet tph2

• Årsaker og konsekvenser av DNA-metylering

• Downs syndrom

• Huntingtons sykdom • Cystisk fibrose

• Imprinting

• Konsekvenser av livsstil for genetiske sykdommer

• Utvikling av honningbie­ dronninger


6

Populasjoner

Ord og faguttrykk du bør kunne før du begynner på kapitlet

• genvariant

• populasjon

• mutasjon

• naturlig utvalg

• art

• evolusjon

• meiose

Mål for dette kapitlet er at du skal kunne • forklare hvordan den genetiske sammensetningen i populasjoner blir endret gjennom mutasjoner, naturlig seleksjon, genetisk drift, genflyt, horisontal genoverføring og endring av kromosomtall • beskrive mekanismer som hindrer genflyt mellom arter, og gjøre greie for teorier om hvordan nye arter kan utvikles • forklare hvordan molekylærbiologi og genteknikker gir oss ny kunnskap om opphavet til arter og utviklingen av slektskapstre • gjøre greie for faktorer som regulerer vekst og størrelse på populasjoner og forvaltning av bestander i et bærekraftig perspektiv


216 • Kapittel 6

6

Den endringen som skjer i en populasjons genetiske sammensetning fra generasjon til generasjon, kalles mikroevolusjon. Prosessene som gir mikroevolusjon, gir over tid makroevolusjon, det vil si nye arter og etter hvert større nyvinninger som amfibier fra fiskeliknende dyr, og frøplanter fra bregner. Det er populasjonene som evolverer. Når vi betrakter populasjonene, kan vi observere evolusjon i praksis.

6.1 Livshistoriestrategier – reproduksjon og overlevelse Livshistoriestrategi Som vi så i kapittel 2 Økologi, har artene forskjellige spredningsmønstre og forskjellig tetthet i miljøet der de lever. Men de har også tilpasset seg miljøet ulikt i måten de reproduserer på, og her spiller graden av forutsigbarhet i miljøet en stor rolle. «Målet» for hvert individ er å få overført flest mulig gener til neste generasjon, men hvordan artene har tilpasset seg for å oppnå dette, er ulikt. Det ideelle for en organisme hadde vært å reprodusere uendelig mange ganger med uendelig mange avkom hver gang den reproduserer, og beskytte alle avkommene godt. Men det koster både å produsere avkom og å ta vare på dem, og ingen kan få i både pose og sekk. Artene gjør en slags avveining – de må velge å satse på noe og velge bort noe annet. Dette er selvsagt ikke noe artene bevisst velger seg. Det er en prosess som har skjedd gjennom naturlig utvalg, der de som har vært best tilpasset miljøet, har klart seg best og fått overført flest av sine gener. Se kapittelet 1 Evolusjon for mer om selve evolusjonsprosessen. En darwinsk demon er en tenkt organisme som er fritatt for alle de begrensninger som vanlige organismer er bundet av. Den har ubegrensede ressurser og har ikke gjort noen avveining, men vil kunne reprodusere rett etter fødselen, få uendelig mange avkom og leve uendelig lenge.

Hos noen arter lever individene kort, og alderen når de begynner å reprodusere, er lav. Individene kan kanskje bare reprodusere én gang, men da produserer de til gjengjeld mange avkom. Hos andre arter lever individene lenge og kan kanskje reprodusere flere ganger, men bruker lengre tid på å nå fruktbar alder og får færre avkom hver gang. Det finnes selvfølgelig også en mellomting mellom disse to. Vi sier at hver art har sin livshistoriestrategi. Dersom det er gjort undersøkelser av en art, kan vi få et bilde av hvordan aldersfordelingen i en populasjon er, og hvor mange som dør i forskjellige faser av livet. Ut fra


Populasjoner • 217

Antall overlevende (logaritmisk skala) 1000

100

10

1

0

50

100 % av maksimal levealder

Idealiserte overlevelseskurver for tre ulike arter. Torsk (Gadus morhua) har stor dødelighet i begynnelsen av livet, mens skjære (Pica pica) har jevn dødelighet hele livet. Mennesket har lav dødelighet til ganske høy alder. De fleste menneskene lever altså relativt lenge.

slike undersøkelser kan vi anslå hvor lenge et individ av en art vanligvis lever, og vi kan si hvor sannsynlig det er at et individ når en viss alder. Vi kaller det livshistorietabeller. Når vi plotter slike data i en graf, får vi en overlevelseskurve.

r–seleksjon og K-seleksjon Artene har også ulike strategier for hvor godt de tar vare på avkommet sitt. Noen, for eksempel primatene, følger opp avkommene sine lenge, mens andre har liten eller ingen form for oppfølging av avkommet. Det henger igjen sammen med mengden avkom. Jo færre avkom, desto større grad av yngelpleie (pass av avkommet). De som investerer mye energi på få, relativt store avkom, satser på at avkommene faktisk vokser opp, ellers får de ikke videreført noen gener. Se for deg en elefant (Elephantidae sp.) som går drektig i nesten to år, og siden gir melk til ungen. Det er svært energikrevende både å gå drektig og å produsere melk, og ikke uventet investerer elefanten mye krefter i å ta vare på avkommet sitt. Som en kontrast til dette står for eksempel husfluen (Musca domestica), som legger 100–150 egg på en gang, men der overlevelsen for hvert individ er usikker. Produksjonskostnaden av hvert flueegg er forholdsvis lav, og fluen har ingen grad av yngelpleie. Den satser heller på mange avkom, og på at noen overlever. Disse ulike strategiene for reproduksjon gjør at vi får to ytterpunkter i måter artene selekteres på gjennom naturlig utvalg. Vi kaller disse ytterpunktene r-seleksjon og K-seleksjon. Det finnes naturlig nok mellomformer, men for enkelhets skyld deler vi artene i r-selekterte arter og K-selekterte arter. Det som typisk preger r- og K-selekterte arter, går fram av tabellen på neste side.


218 • Kapittel 6

Egenskaper ved r- og K-selekterte arter.

r-selekterte arter

K-selekterte arter

Mange avkom på en gang

Relativt få avkom på en gang

Reproduserer ofte bare én gang

Reproduserer ofte flere ganger

Reproduserer raskt

Reproduserer relativt langsomt

Liten omsorg for avkommet

Stor grad av omsorg for avkommet

Tidlig fruktbar alder

Høy fruktbarhetsalder

Lever ofte kort

Lever ofte lenge

Liten konkurranseevne

Stor konkurranseevne

Ofte små individer

Ofte store individer

Ofte ukjønnet formering

Oftest kjønnet formering

Eksempler på r-selekterte arter er insekter, bakterier og ettårige planter. Store pattedyr og fugler er oftest K-selekterte arter, det samme er trær med store frø som eik, kokosnøtt og valnøtt. Som sagt finnes det også mellomformer. Bartrær lever lenge og har stor konkurranseevne, men får likevel mange avkom på en gang og investerer lite i avkommet. Har du lurt på hva r-en og K-en står for? r står for vekstraten for populasjonen, mens K står for bæreevnen i det lokale miljøet.

Hva er det så som avgjør hvilken livshistoriestrategi en art har? Som nevnt er det evolusjon som har drevet fram de ulike tilpasningene de forskjellige artene har i dag. Det er miljøet der arten lever, som avgjør hvilken livshistorie det skal satses på. Dersom en art lever i et skiftende og uforutsigbart miljø, er det bra å kunne produsere mange avkom på en gang når forholdene er gunstige. Tilsvarende er det hvis predasjonspresset fra rovdyr er stort. Blir det produsert mange avkom, er det større sjanse for at noen overlever. Dersom miljøet er stabilt og konkurransen om ressursene som er der, er stor, er det derimot en fordel å produsere relativt få avkom som foreldrene sørger for, slik at de har en større sjanse til å nå fruktbar alder. Forsøk med bananflue (Drosophila melanogaster) har vist at forskjellige populasjoner av samme art kan vise ulik grad av r- eller K-seleksjon, avhengig av miljøet. Antall avkom

Foreldreomsorg Overlevelsessannsynlighet

r-selekterte og K-selekterte arter. r-selekterte arter får mange avkom med lav sannsynlighet for overlevelse. K-selekterte arter får få avkom og har stor grad av yngelpleie.

r-strateger

8000 avkom per år

200 avkom per år

12 avkom per år

2 avkom per år

1 avkom hvert 5. år

K-strateger


Populasjoner • 219

Sjekkpunkter: Nye ord og faguttrykk: livshistoriestrategi, yngelpleie, r-seleksjon, K-seleksjon Hvordan ser en overlevelseskurve for en torsk ut? Hvorfor har noen arter stor grad av yngelpleie, mens andre arter har ingen? Lag en liste over fire forskjeller mellom en r-selektert art og en K-selektert art. Gi to eksempler på r-selekterte arter og to eksempler på K-selekterte arter. Forventer du å finne r- eller K-selekterte arter i et ustabilt miljø?

Vekstrater og vekstkurver Hvordan øker en populasjon? En populasjon blir større når nye individer blir født eller nye individer flytter inn til populasjonen. En populasjon minsker når individer dør eller forlater populasjonen. For at en populasjon skal øke, må summen av fødsler og innvandring være større enn summen av dødsfall og utvandring. For å gjøre regnestykket enklere for oss ser vi nå bort fra inn- og utvandring. En populasjon blir da bare større dersom det blir født flere enn det dør. Store populasjoner har et større antall fødte enn små populasjoner. Men vokser de Fødsler og innvandring gir nye individer til populasjonen

Fødsler

Innvandring

Populasjonsstørrelse

Utvandring

Død

Død og utvandring fjerner individer fra populasjonen

Populasjonsdynamikk. En populasjon blir større når nye individer blir født eller nye individer flytter inn til populasjonen. En populasjon blir mindre dersom individer dør eller forlater populasjonen.


220 • Kapittel 6

Vekstrate (r) = fødselsrate (f) – dødsrate (d)

likevel raskest, relativt sett? For å kunne sammenlikne populasjoner av ulike størrelser finner vi fødselsraten og dødsraten til populasjonen. Fødselsraten til en populasjon er antall fødte individer delt på totalt antall individer i populasjonen. Dødsraten er antall døde individer delt på totalt antall individer. For å finne vekstraten til populasjonen trekker vi dødsraten fra fødselsraten. Er vekstraten positiv, vokser populasjonen, og fødselsraten er større enn dødsraten. I motsatt fall avtar populasjonen. Er vekstraten null, er populasjonen stabil. Jo større vekstrate, desto større vekst i populasjonen. Vi tar et regneeksempel (se også figuren under): I en populasjon på 10 000 individer blir det født 2000 unger. I samme tidsperiode dør det 1800 individer. Fødselsraten (f) er = 2000/10 000 = 0,2, og dødsraten (d) er = 1800/10 000 = 0,18. Vekstraten (r) = 0,2 – 0,18 = 0,02. En vekstrate på 0,02 betyr at populasjonen øker med to prosent per tidsperiode, det blir altså to prosent flere individer per tidsperiode.

Fødsels-, døds- og vekstrate i en populasjon.

1800 dødsfall Dødsrate (d): 1800 = 0,18 10 000

2000 fødsler Fødselrate (f): 2000 = 0,2 10 000

Populasjonsstørrelse: 10 000 Vekstrate (r = f – d): 0,2 – 0,18 = 0,02 Populasjonen vokser med 2 % per tidsperiode

Sjekkpunkter: Nye ord og faguttrykk: fødselsrate, dødsrate, vekstrate Når øker en populasjon? Hva betyr positiv vekstrate? Hva betyr det hvis vekstraten er null?


Populasjoner • 221

J-kurve: eksponentiell vekst La oss så tenke oss en populasjon som vokser. Hva skjer med populasjonen etter hvert? Svaret kommer an på om det er nok ressurser til stede eller ikke. Er det nok ressurser, altså nok mat, plass, osv. til alle individene, trenger de ikke å konkurrere. Det er ingen tetthetsavhengige faktorer som virker inn. Når det er tilfellet, kan populasjonen bare vokse og vokse. Den kan da vokse med en fast vekstrate. Populasjonsstørrelsen øker sakte i starten når det er få individer i populasjonen, men går raskere og raskere etter hvert som det blir flere og flere individer som reproduserer. Siden populasjonen øker med en fast prosent i hver periode, kaller vi det eksponentiell vekst. Eksempler på faktorer som virker inn på populasjonstørrelsen.

Tetthets­avhengige

Tetthets­uavhengige

Konkurranse om ressurser som mat, plass, lys og vann Predasjon Sykdom Opphoping av avfallsstoffer Stress

Temperatur Vind Tørke Flom Brann

Tilvekst til en populasjon på opprinnelig 10 000 individer med en vekstrate på 0,02. Vi ser at tilveksten blir større for hvert år. Populasjonen vokser eksponentielt.

Opprinnelig populasjon

Populasjon året etter

Tilvekst etter ett år

10 000

10 200

200

10 200

10 404

204

10 404

10 612

208

populasjonsstørrelse

Vi tenker oss populasjonen fra eksempelet over. Populasjonen bestod av 10 000 individer og vokste med to prosent per tidsperiode, for eksempel år. Året etter er de altså 10 000 ∙ 1,02 = 10 200 individer. Året etter er de 10 200 ∙1,02 = 10 000 ∙ 1,022 = 10 404 individer, og etter tre år er de 10 404 ∙1,02 =10 000 ∙ 1,023 = 10 612 individer. Etter ett år har det altså kommet 200 nye individer til populasjonen. I løpet av det andre året har det kommet 204 nye individer, og i løpet av det tredje året har det kommet 208 nye individer.

Vi ser at tilveksten av individer til populasjonen blir større for hvert år. En slik eksponentiell vekst kan framstilles i en graf, og vi ser at grafen får form som en j-kurve. tid

Eksponentiell vekst over lang tid er ikke vanlig i naturen. Som oftest blir det etter hvert ressursmangel, og tetthetsavhengige faktorer begrenser populasjons­ veksten. Vi kan likevel observere eksponentiell vekst når en populasjon er liten, eller når forholdene er spesielt gunstige, som når en art inntar et nytt område. De r-selekterte artene kan vise eksponentiell vekst når forholdene er gunstige, men de kan ha en nedgang når konkurransen fra andre arter øker.

Eksponentiell vekst. Vekstraten er konstant. Populasjonsstørrelsen øker sakte i starten, men raskere og raskere jo flere individer populasjonen består av.


222 • Kapittel 6

Sjekkpunkter: Nye ord og faguttrykk: eksponentiell vekst, j-kurve Under hvilke forhold kan en populasjon vokse eksponentielt? Hvor mange individer er det i en populasjon på 1000 individer om tre år dersom den vokser med én prosent per år?

S–kurve: logistisk vekst Det andre alternativet når en populasjon vokser, er at det etter hvert blir mangel på ressurser. Da begynner tetthetsavhengige faktorer å virke inn. Det oppstår konkurranse mellom individer om for eksempel mat, lys og vann og plass. Siden individene lever tettere, blir de lettere smittet av sykdommer, og det kan bli en så stor opphoping av avfallsstoffer at det påvirker individene. Alle disse faktorene kan øke stressnivået i populasjonen, og også muligens øke predasjonen. Som en konsekvens av økt grad av tetthetsavhengig påvirkning på individene dør flere individer, færre blir født, eller vi får en kombinasjon av disse to. Det fører til at vekstraten til populasjonen synker. Det er de best tilpassede individene som har størst sjanse til å overleve når presset på populasjonen øker. Desto større populasjonen er, desto sterkere blir presset på ressursene. Det fører igjen til økende grad av press på individene, som igjen fører til en stadig synkende vekstrate i populasjonen. Til slutt flater veksten i populasjonen helt ut, og vekstraten er null. Det er viktig å merke seg at det er vekstraten som er null, ikke antall fødsler, men det fødes like mange individer som det dør. Siden veksten i populasjonen først øker, så flater ut og til slutt stopper opp, får en slik vekstkurve en s-form, og vi kaller den s-kurve.

populasjonsstørrelse

Logistisk vekst. S-kurven består av tre faser: 1. Forholdene er gunstige, og veksten øker. 2. Tetthetsavhengige faktorer virker stadig sterkere inn, og vekstraten begynner å flate ut. Tilveksten er størst ved dette punktet fordi det med lavere populasjons­størrelse er færre individer som bidrar til reproduksjonen, og med økende populasjons­størrelse virker de tetthets­avhengige faktorene sterkere og sterkere inn. 3. Populasjonen når områdets bæreevne for arten. Vekstraten er null, og det blir født like mange individer som det dør.

En populasjon som følger en slik kurve, sier vi har logistisk vekst. Når vekstraten er null, sier vi at populasjonen er i likevekt, og at den har nådd områdets bæreevne for arten. Bæreevne er det største antall individer av en populasjon som kan leve i et område over lengre tid. Bæreevnen for en populasjon er ikke konstant. Den er avhengig av tetthetsavhengige faktorer, men også av

3

områdets bæreevne

2

1 tid


Populasjoner • 223

tetthetsuavhengige faktorer som klima. Dersom én eller flere miljøfaktorer endrer seg, kan også bæreevnen for området endre seg. Tenk for eksempel at det plutselig kommer en flom og skyller bort det meste av jordsmonnet i et område. Det påvirker drastisk bæreevnen til populasjonene som lever der. De ulike typene vekstkurver kan vi igjen knytte til livshistoriestrategier. En art som har eksponentiell vekst, er en typisk r-selektert art med høy reproduksjon og lite konkurranse i miljøet. En art som følger en s-kurve, og som lever rundt områdets bæreevne for arten, opplever høy grad av konkurranse og at populasjonen blir begrenset av tetthetsavhengige faktorer. En slik art er typisk K-selektert.

Sjekkpunkter: Nye ord og faguttrykk: s-kurve, logistisk vekst, likevekt Hvorfor synker etter hvert vekstraten hos populasjoner med logistisk vekst, og hvorfor blir vekstraten til slutt null? Hvilke individer overlever best når de tetthetsavhengige faktorene virker sterkere inn? Er bæreevnen for et område alltid den samme? Gi en kort begrunnelse.

Svingninger De to typene vekst er modeller på populasjonsvekst og ikke nødvendigvis slik populasjoner oppfører seg i virkeligheten. Populasjoner som har eksponentiell vekst, har topper for så å ha en nedgang igjen kanskje fulgt av seinere topper osv. Tenk for eksempel på en skogsflate som er ryddet. Først kommer pioner­ artene, de som er r-selekterte og har en rask populasjonsvekst, som geitrams (Chamerion angustifolium). Etter hvert blir de utkonkurrert av mer konkurranse­ dyktige arter, og populasjonene til pionerartene har en nedgang igjen. Plankton­ algene har oppblomstringer om våren og til dels også om høsten når omrøring fører næring til overflaten igjen. Mange populasjoner som følger en tilnærmet s-kurve, svinger rundt bære­evnen for området. Et slikt eksempel er sauene (Ovis aries) som fikk formere seg fritt på øya Tasmania sør for Australia, se figuren på neste side. Når en populasjon svinger rundt bæreevnen, virker både tetthetsavhengige og tetthetsuavhengige faktorer inn. Etter hvert som populasjonen vokser, blir veksten begrenset av de tetthets­avhengige faktorene. Er forholdene gunstige, overlever flere individer. Dersom forholdene blir dårligere neste år, dør flere individer, og populasjonen avtar. Blir forholdene gunstigere igjen, så vokser populasjonen på nytt. Populasjoner av arter med høy reproduksjonsrate har lettere for å svinge rundt bæreevnen enn populasjoner av arter med lavere reproduksjonsrate. Årsaken er at individene rekker å reprodusere mer før virkningen av endrede forhold gjør seg gjeldende, og slik har de lettere for å overskride bæreevnen. I noen populasjoner varierer populasjonsstørrelsen uregelmessig, slik vi har sett over. Andre populasjoner har regelmessige svingninger i populasjonsstørrelsen, og vi kaller det sykliske svingninger.

Geitrams (Chamerion angustifolium).


Svingninger rundt bæreevnen. Populasjonen følger tilnærmet en s - kurve, men med svigninger rundt bæreevnen for området. Noen år er forholdene gunstige, og flere individer overlever. Når forholdene blir dårligere, dør flere individer og populasjonen avtar igjen, til forholdene på nytt blir gunstigere.

antall sauer (millioner)

224 • Kapittel 6

2,5 2,0 1,5 5 1,0 0 Faktisk antall Glatt kurve

0,5 5

1814 1824 1834 1844 1854 1864 1874 1884 1894 1904 1914 1924 1934 årstall

På figuren nederst ser vi et eksempel på sykliske svingninger i hare- og gaupe­ populasjonen i et område i Canada. Vi ser at begge populasjonene svinger regelmessig med en topp i populasjonsstørrelse ca. hvert tiende år, men at de ikke har en topp samtidig. Harens populasjonstopp ligger noe før i tid enn gaupas populasjonstopp. Det har vært forsket på hva disse sykliske svingningene kan skyldes, og tre hypoteser har vært testet ut. Hypotese 1: Gaupene spiser hare. Den ene hypotesen går ut på at jo flere harer som er tilgjengelig, desto gunstigere er vilkårene for gaupene, og desto flere gauper overlever. Det fører til en nedgang i harepopulasjonen, og når mattilgangen forsvinner, blir det fulgt av en nedgang i gaupepopulasjonen.

Sykliske svingninger hos hare (Lepus timidus) og gaupe (Lynx lynx).

antall individer

Hypotese 2: Den andre hypotesen går ut på at det er harenes tilgang på næring som er avgjørende for svingningene. Noen planter kan begynne å produsere antibeitestoffer dersom de blir beitet på. Antibeitestoffene gjør at harene får dårligere fordøyelse og utnytter næringsstoffene i planten dårligere. Når harepopulasjonen vokser, øker også beitingen på plantene som disse spiser, og plantene reagerer på dette med å utvikle antibeitestoffer. Jo mer

1845

Hare Gaupe

1855

1865

1875

1885

1895

1905

1915

1925

1935 årstall


Populasjoner • 225

beiting, desto mer antibeitestoffer. Dermed får harene mindre næring, og populasjonen synker. Gaupa er avhengig av haren som matkilde, så når harepopulasjonen synker, synker gaupepopulasjonen en stund etter. Hypotese 3: Den tredje hypotesen går ut på at både predasjon fra gaupa og tilgang på næring har betydning. Etter forskjellige forsøk med hare­populasjoner har det vist seg at svingningene først og fremst kommer av at gaupene spiser harene, men at harenes næringstilgang også spiller en viss rolle. Generelt kan vi si at populasjonsstørrelser bli regulert bunn-opp eller topp-ned. En populasjon som er begrenset på grunn av næringstilgang, sier vi er bunnopp-regulert, mens en populasjon som er begrenset av predatorer, er toppned-regulert. En kombinasjon er selvsagt også mulig, slik vi ser med harepopulasjonen i eksempelet over.

Den menneskelige populasjonsveksten

16000 15000 14000 13000 12000 11000 10000 9000 8000 7000 6000 5000 4000 3000 2000 1000 0

Estimert Høy Middels Lav Faktisk

18 00 18 20 18 40 18 60 18 80 19 00 19 20 19 40 19 60 19 80 20 00 20 20 20 40 20 60 20 80 21 00

millioner mennesker

Med det vi nettopp har lært om populasjonsvekst og populasjonskurver, kan vi spørre oss: Hvilken type kurve følger den menneskelige populasjonsveksten? I moderne tid har populasjonsveksten hos mennesket steget og steget. Teknologien har gjort det mulig for oss å dyrke mer mat, og vi har fått medisiner og bedre hygiene som gjør at flere overlever. I dag (2014) er det over sju milliarder mennesker på jorda. Hvor mange er det plass til? Fortsetter den menneskelige populasjonsveksten å følge en eksponentiell kurve slik vi ser i dag, eller flater den ut og følger en s-kurve? Ifølge FN nådde vekstraten til verdens befolkning en topp i perioden 1965–1970 da den var på 2,065 prosent per år og var nede på 1,198 prosent per år i perioden 2005–2010. Det kan med andre ord se ut som om verdens befolkningsvekst er i ferd med å flate ut. Spørsmålet er likevel om dette er nok. Vi blir fremdeles stadig flere, presset på ressursene blir stadig større, og det som er til overs til alle de andre levende organismene på jorda, blir stadig mindre.

årstall

Den menneskelige populasjonsveksten. Beregninger over den menneskelige populasjons­ veksten fra 1800 til 2100. Grafene i rød, oransje og blå farge baserer seg på beregninger fra FN og følger en henholdsvis høy, medium og lav modell for befolknings­ vekst. Ifølge den høyeste beregningen kommer verdens ­populasjon til å stige til over 16 milliarder innen 2100. Ifølge den laveste beregningen kan den synke til i overkant av 6,5 milliarder. Den grønne delen av grafen er basert på målinger, mens den lilla delen av grafen er beregnet av US Census Bureau historical estimates.


226 • Kapittel 6

Sjekkpunkter: Nye ord og faguttrykk: sykliske svingninger, bunn-opp-regulert, topp-ned-regulert Hvorfor kommer r-selekterte arter først til en hogstflate? Forklar hvorfor sauene i Tasmania svinger rundt bæreevnen. Hvor ofte er det en topp i populasjonsstørrelsen hos hare og gaupe? Hvorfor har haren og gaupa sykliske svingninger? Gi et eksempel på en topp-ned-regulert art. Hvor mange mennesker er det på jorda i dag? (2014) Hvor mange mennesker er det på jorda innen 2100 ifølge den midterste beregningen på figuren på forrige side?

6.2 Populasjonsgenetikk I populasjonsgenetikken er vi særlig opptatt av utbredelsen og nedarvingen av gener i en populasjon. Et viktig begrep i populasjonsgenetikken er frekvensen eller hyppigheten av en genvariant. Frekvensen av en genvariant betyr hvor ofte denne utgaven av genet er representert i populasjonen. Den samlede mengden gener i en populasjon kaller vi et genreservoar. Mikroevolusjon kan derfor defineres som en forandring av genfrekvensen i genreservoaret til en populasjon. Videre i kapitlet ser vi nærmere på noen av de mekanismene som kan føre til endringer av en genvariant i en populasjon.

Mutasjoner Det første vi ofte tenker på når vi skal beskrive hvorfor genene i en populasjon forandrer seg over tid, er kanskje mutasjoner. Mutasjoner oppstår tilfeldig og er små endringer i arvematerialet mellom foreldrene og avkommet. Mutasjoner kan skyldes at kopieringen under DNA-replikasjonen ikke er perfekt siden den perfekte kopieringen ennå ikke har blitt selektert for i naturen. Mutasjoner kan også skyldes at det har oppstått skader i DNA underveis. Etter hvert er det en naturlig seleksjon som eventuelt øker frekvensen av genet med mutasjonen eller mutasjonene. Det er økt sannsynlighet for det dersom mutasjonen skulle inneholde eller føre til en god egenskap. Likevel er det slik at de aller fleste mutasjoner er negative eller tilsynelatende ikke har noen betydning, og de blir derfor selektert bort over tid. Det er viktig å huske at mutasjoner ikke oppstår fordi det er «behov» for dem. Det kan derimot være en forandring i miljøet som gjør at individet med mutasjonen blir bedre tilpasset, og dermed får reprodusert hyppigere enn andre. Dersom det skal kunne bli selektert for et mutert gen i en populasjon, må det kunne arves. Skal DNA-et i neste generasjon få denne genvarianten, må altså mutasjonen skje i DNA-et i kjønnscellene, se kapittel 4 Celledeling.


Populasjoner • 227

Genetisk drift i små populasjoner – tilfeldighetens kraft Tenk deg at du knipser en mynt opp i lufta og så noterer om det er myntsiden eller kronesiden du kan se når mynten har falt til jorda. Første gang blir det enten mynt eller krone. Så gjør du forsøket i ett minutt, og så i tre timer. Dersom du summerer opp resultatene dine, er det større sannsynlighet for at du vil ha et tilnærmet 1 : 1 forhold mellom krone og mynt i det langvarige forsøket. Når bestanden blir stor, blir betydningen av tilfeldigheter mindre. I store populasjoner betyr følgelig tilfeldigheter mindre enn i en liten populasjon. Når tilfeldige hendelser avgjør om genfrekvensen endrer seg, kaller vi det genetisk drift. Genetisk drift får størst innvirkning i små populasjoner. Det kan for eksempel være at et individ med god tilpasningsevne tilfeldigvis ikke får reprodusert. De gode egenskapene til individet går dermed tapt. To andre former for genetisk drift, flaskehalseffekten og grunnleggereffekten, skal vi behandle noe nærmere.

Genetisk drift.

Flaskehalseffekten og grunnleggereffekten Under spesielle hendelser som jordskjelv, vulkanutbrudd, flom, skogbrann, sterk tørke eller andre katastrofer kan en populasjon bli dramatisk redusert. De overlevende er ikke nødvendigvis selektert på bakgrunn av spesielle genvarianter, men det kan være tilfeldighetene som avgjør om et bestemt individ ble rammet eller ikke. Som du ser av figuren under, er det etter en slik hendelse ingen røde biter igjen i den nye populasjonen. I så måte er frekvensen av gener endret, og det har skjedd en evolusjon. Men det er en evolusjon helt uten noen naturlig seleksjon. Dette kalles flaskehalseffekten. Grunnleggereffekten oppstår når noen få individer av en populasjon inntar et nytt område. Som regel er det helt tilfeldig hvilken frekvens av genvarianter disse individene har. Men fordi de er så få, er det stor sannsynlighet for at en genvariant ikke blir med fra den store populasjonen. Om det skjer, forandrer frekvensen av genvarianter seg, og vi har fått en evolusjon. a) Flaskehalseffekten

To former for genetisk drift, flaskehalseffekt og grunnleggereffekt. I små populasjoner kan genetisk drift ha stor betydning for genreservoaret. Ved en flaskehalseffekt er det tilfeldig hvem som får videreført genene sine, og en genvariant kan lett dø ut (a). Ved grunn­legger­effekten er det også tilfeldig hvilke gener som går ut av populasjonen og danner en ny (b).

b) Grunnleggereffekten

Opprinnelig populasjon Flaskehalseffekt

Opprinnelig populasjon

Ny populasjon

Grunnleggerpopulasjon


228 • Kapittel 6

Svalbardvalmue (Papaver dahlianum)

Et godt eksempel er svalbardvalmuen (Papaver dahlianum). På Svalbard varierer fargen på kron­bladene fra gul til hvit med alle mellomformer. På Varangerhalvøya i Finnmark har vi derimot noen små isolerte populasjoner hvor alle blomstene er hvite. Det antyder at en grunnleggereffekt har ført til bare hvite blomster. Enten ble det rent tilfeldig bare overført frø som alle hadde anlegg for hvit blomsterfarge, eller så har den gule varianten forsvunnet ved en tilfeldighet, mest sannsynlig mens populasjonen ennå var liten. Hvilken mekanisme som i dette tilfellet er ansvarlig for de hvite valmuene på Varangerhalvøya, vet vi ikke. Et liknende tilfelle har vi med laksen i Byglandsfjorden i Setesdalen. Etter hvert som landet hevet seg etter istiden, ble fossene mellom Byglandsfjorden og Skagerrak så høye at laksen ikke lenger klarte å forsere dem på sin naturlige vandring. De individene som tilfeldig befant seg i vannet, ble da isolert fra populasjonene i havet. De ble tvunget til å gyte i Otra, og over tid har små mutasjoner gjort at laksestammen her er litt forskjellig fra laksen i den nedre delen av vassdraget. En tilsvarende innestengt laksestamme kjenner vi fra Vänern i Sverige, som bruker Klarälven/Trysilelven som gyteelv.

Genflyt og isolerte populasjoner I naturen er populasjoner sjelden helt isolerte fra hverandre. Vi kan finne unntak på øde øyer, og dyre- og plantelivet på øde øyer er derfor svært godt likt av evolusjonsbiologer. I 6.3 skal vi se nærmere på isolasjon som pådriver til utvikling av nye arter. Bevegelsen av gener mellom to populasjoner kalles genflyt og oppstår når individer vandrer eller migrerer mellom forskjellige eller isolerte populasjoner.


Populasjoner • 229

Hardy-Weinbergs likevekt I populasjonsgenetikken kan vi samle data om genfrekvensene i en populasjon. Det kan gjøres ved at vi bruker molekylære teknikker til å analysere DNA direkte, eller vi studerer trekk ved individet som vi vet er under genetisk kontroll, for eksempel blomsterfarge. Et interessant spørsmål er om det pågår seleksjon i populasjonen, altså om trekket vi ser på, påvirker fitness eller ikke. Til det bruker vi ofte Hardy-Weinbergs likevekt. Tenk deg at skolen har et drivhus, og at det i dette drivhuset er plantet ut hundre erteplanter av en bestemt sort. Hver erteplante har to varianter av genet som bestemmer høyden på dem, ett fra mor og ett fra far. Genet finnes i to utgaver: HL og HH. Samlet gir det tre genotyper; HHHH, HHHL og HLHL. Fenotypisk er HHHH en høy erteplante, mens HLHL er liten og HHHL er middels høy siden vi har ufullstendig dominans. Samlet sett er det altså i populasjonen av erteplanter i dette drivhuset to hundre utgaver av genet for høyde. Ved en opptelling av plantene viser det seg at populasjonen av erteplanter i drivhuset består av 64 høye planter, 32 middels høye og 4 korte planter. Av figuren ser du at hyppigheten av den genotypen som gir de høye plantene, er 0,64 (64/100), for de mellomhøye er hyppigheten 0,32 (32/100), og for genotypen som gir lave planter, er hyppigheten 0,04 (4/100). Summen av genotypefrekvensene er alltid 1.

HLHL HHHL HHHH

1020_Drivhus

Genutgave

HLHL HHHH 20x HLHL 80x

Genreservoaret for genet som bestemmer høyde hos denne populasjonen

1021_Genreservoar


230 • Kapittel 6

Når vi ønsker å finne frekvensen av genvariantene i genreservoaret, må vi regne litt annerledes. De høye plantene har 128 genutgaver av HH, mens de mellomhøye har 32 genvarianter av HH og 32 genvarianter av HL. De lave erteplantene har åtte genvarianter av HL. Dermed er det i genreservoaret, som totalt består av to hundre genvarianter, 160 av HH og 40 av HL. Frekvensen av HH er 0,8 (160/200), og frekvensen for HL er 0,2 (40/200).

p2 + 2pq + q2 = 1

La oss nå anta at denne populasjonen skal gi opphav til en ny generasjon, og at det skal være helt tilfeldig hvilke gener som kommer videre. Det skal altså ikke være verken naturlig, seksuell eller kunstig seleksjon. Fordi summen av genfrekvensene alltid er 1, kan vi bruke likningen i margen for å beregne frekvensen av de ulike genvariantene under de gitte forholdene. Tenk deg at du blander genene i en hatt slik at genfrekvensen for HH er p = 0,8 og for HL er q = 0,2. Så skal du trekke to og to gener til hvert individ i neste generasjon. Med 0,8 sjanse for å trekke HH og 0,8 sjanse for å trekke enda en HH er sjansen for HH · HH altså p · p = p2 = 0,82 = 0,64. For de andre kombinasjonene forventer vi å få dette: Frekvensen av HHHH i den nye populasjonen = p · p = p2 = 0,64 Frekvensen av HLHL i den nye populasjonen = q · q = q2 = 0,04 Frekvensen av HHHL i den nye populasjonen = p · q + q · p = 2pq = 0,32 Satt inn i likningen p2 + 2pq + p2 = 1 får vi 0,64 + 0,04 + 0,32 = 1 Når vi sammenlikner det vi forventer å få, med de plantene som faktisk var i populasjonen, ser vi at det stemmer overens. Populasjonen er altså genetisk sett i likevekt. Denne andregradslikningen omtales som Hardy-Weinbergs likevekt, og er oppkalt etter de to som utledet den. Dersom du i stedet i neste generasjon hadde fått færre av de lave erteplantene enn det forventningene tilsa, kunne vi slutte at det på en eller annen måte hadde skjedd en evolusjon siden populasjonen da ikke ville vært i Hardy-Weinbergs likevekt. Hardy-Weinbergs likevekt forteller oss altså om frekvensen av høye, mellomhøye og lave erteplanter når det ikke skjer en evolusjon i populasjonen. På figuren til høyre kan du se et annet eksempel på Hardy-Weinbergs likevekt hvor genfrekvensene er annerledes enn i planteeksemplet over. Eksempelarten er kengururotte, en rotteart vi ikke har i norsk fauna.


Populasjoner • 231

Foreldregenerasjon (populasjon = 1000)

Mørkebrun ørkenrotte

Flekket ørkenrotte

Lysebrun ørkenrotte

Genotype

BB

Bb

bb

Antall individer i populasjonen

16

222

762

Frekvens av genutgavene p = (2 × 16 + 222)/2000 = 0,127

B

Hvert enkelt Bb-individ har en kopi av B Hvert enkelt BB-individ har to kopier av B q = (2 × 762 + 222)/2000 = 0,873

b

Hvert enkelt Bb-individ har en kopi av b Hvert enkelt bb-individ har to kopier av b

Reproduksjon (antar tilfeldig paring)

B bb p = 0,127 q = 0,873 p= 0,127

p2 = 0,016

pq = 0,111

q= b 0,873

pq = 0,111

q2 = 0,762

B

Frekvens av genotype BB

p2 = 0,016

Bb

2pq = 0,222

bb

q2 = 0,762

Neste generasjon (1000 avkom)

Mørkebrun ørkenrotte

Flekket ørkenrotte

Lysebrun ørkenrotte

Genotype

BB

Bb

bb

Antall individer i populasjonen

16

222

762

Hardy-Weinbergs likevekt. I en populasjon i HardyWeinbergs likevekt kan vi forutsi frekvensen av den undersøkte genotypene i neste generasjon.


232 • Kapittel 6

En reell populasjon er aldri i genetisk likevekt Hardy-Weinbergs likevekt er en beskrivelse av genfrekvensene i populasjonene framover i tid. For å opprettholde den genetiske likevekten i en populasjon må disse fem forutsetningene være oppfylt: 1 Naturlig seleksjon kan ikke forekomme. Det vil si at om erteplantene er høye eller lave, ikke skal ha noen betydning for deres muligheter til å vokse og formere seg i drivhuset. 2 Populasjonen må være stor. Hundre individer er ikke en stor populasjon, verken for planter, dyr eller sopp, så her kunne både genetisk drift og grunnleggereffekter påvirket resultatet. 3 Populasjonen må være isolert slik at det ikke skjer innvandring eller utvandring. Erteplantene må forbli i drivhuset, og ingen nye frø eller pollen må komme inn i det. 4 Det må ikke skje mutasjoner. Dersom nye gener kommer til i tillegg til HH og HL, vil matematikken i likningen forandre seg. 5 Det må være en tilfeldig paring i populasjonen. Dersom plantene for eksempel var sortert etter høyde og de dermed pollinerte seg hyppigst med naboplantene, ville det antakelig ha blitt flere av HH HH og HL HL enn det Hardy-Weinbergs likevekt forutsa. Som du ser av forutsetningene, er det svært sjelden at en populasjon ute i naturen kan oppfylle alle disse fem kravene. Men dersom det skjer, blir fordelingen av genvariantene lik mellom generasjoner, og ingen evolusjon skjer. Loven om genetisk likevekt gir altså et speilbilde av alle de elementer som er nødvendige, enten enkeltvis eller flere sammen, for at det skal skje endringer og dermed muliggjøre en evolusjon. Tenk over om det er realistisk at en populasjon med tusen ørkenrotter oppfyller de fem forutsetningene som den genetiske likevekten til Hardy-Weinberg krever.

Sjekkpunkter: Nye ord og faguttrykk: genfrekvens, genetisk drift, genreservoar Hva betyr frekvensen av en genvariant? Hva er genetisk drift? Hva er grunnleggereffekten? Hva sier Hardy-Weinbergs likevekt oss? Hva er et genreservoar? Hvorfor er ikke reelle populasjoner i en genetisk likevekt?


Populasjoner • 233

6.3 Dannelse av en ny art Vi har nå sett hvordan variasjonene i genvarianter kan føre til forandringer, og vi skal se nærmere på hvordan mekanismene i evolusjonen kan føre til utvikling av en ny art. Vi skiller mellom allopatrisk artsdannelse og sympatrisk arts­ dannelse. Ved sympatrisk artsdannelse blir det utviklet en ny art, mens den gamle og den nye arten stadig er i geografisk kontakt med hverandre. Allopatrisk artsdannelse skjer når det blir utviklet en ny art, mens artene er geografisk isolert fra hverandre, se figuren under.

allos (gr.) – annet patra (gr.) – hjemland syn (gr.) – sammen

Allopatrisk artsdannelse skjer når to populasjoner som lever på atskilte steder, kan evolvere i forskjellige retninger og etter hvert bli til to arter. Som eksempler kan vi se på artsmønstre sett i lys av kontinentaldrift. Kontinentaldriften er hvordan kontinentene på jorda har beveget seg fra hverandre. For 250 millioner år siden hang alle dagens kontinenter sammen i et superkontinent som kalles Pangaea. Da dette begynte å brekke opp til dagens kontinenter, ble arter spredd over flere landmasser som ikke lenger var i kontakt med hverandre. Fordi miljøet var ulikt, evolverte populasjonene i hver sine retninger og gav til slutt nye arter som resultat. For eksempel ble Australia dominert av pungdyr, mens pattedyrene med morkake dominerte i Nord- og Sør-Amerika og Eurasia. Sympatrisk artsdannelse, altså at det oppstår arter mens populasjonene fremdeles befinner seg i samme område, har vært mye vanskeligere å forklare. Så lenge genene i en populasjon blir blandet fullstendig, er det nesten umulig at det evolverer to forskjellige retninger som igjen kan gi opphav til nye arter. For å forklare sympatrisk artsdannelse må vi derfor se nærmere på mekanismer som kan føre til reproduktive barrierer – det vil si at genene blir hindret i å bli utvekslet fritt i hele populasjonen. Vi skal også se på polyploidi som en spesiell mekanisme som kan føre til sympatrisk artsdannelse. Artsdannelse kan skje ved allopatrisk eller sympatrisk artsdannelse. Ved allopatrisk artsdannelse (a) utvikler arten seg på to ulike steder. Ved sympatrisk artsdannelse (b) skjer det mens artene er på samme sted.

a) Allopatrisk artsdannelse

b) Sympatrisk artsdannelse


234 • Kapittel 6

Pattedyr med morkake (ku) og pungdyr (kenguru). Mens pattedyrene med morkake ble dominerende i Nord- og Sør-Amerika samt Eurasia, ble pungdyrene dominerende i Australia. pre – før post – etter zygote – befruktet eggcelle

Barrierer for reproduksjon Artsbegrepet er definert noe ulikt, men det biologiske artsbegrepet krever at individene i en art må kunne reprodusere seg med hverandre. Vi skal nå se nærmere på noen av de barrierene som sørger for at individer i en populasjon kan utvikle seg til atskilte arter. Vi skiller mellom to hovedformer for barrierer, prezygotiske og postzygotiske. De prezygotiske barrierene hindrer formering fordi kjønnscellene ikke kan befruktes, eller fordi de aldri møtes. De postzygotiske virker fordi den befruktede zygoten enten blir spontanabortert, eller fordi avkommet får redusert fruktbarhet. Ny forskning ved Naturhistorisk museum i Oslo viser at arktiske planter av tilsynelatende lik art ser ut til å ha krysningsbarrierer. Slik skjult artsdannelse kalles treffende nok kryptisk artsdannelse.

hybrida (lat.) – bastard

Hybrider er individer som har blitt dannet etter krysning mellom to ulike arter. Det er ikke så vanlig i dyreriket, men vanligere i planteriket. Muldyr er en krysning mellom hest og esel og er en steril hybrid. Rakkelhane (Tetrao hybridus urogalloides) er en hybrid mellom storfugl og orrfugl. Vanligvis er hybrider sterile, men i noen få tilfeller er de fruktbare, for eksempel en del orkideer. Særlig innenfor enfrøbladete planter er det vanlig med hybridisering. Disse hybridene kan skape litt bry for en ivrig botaniker, og i en god flora bør det også være en beskrivelse av dem.


Populasjoner • 235

Barrierer for reproduksjon.

Type barriere

Beskrivelse

Prezygotiske Geografisk

Populasjonene er atskilt av noe fysisk, som en elv eller et fjell.

Økologisk

Populasjonene har ulike habitat og kan derfor sjelden møtes.

Tid

Populasjonene reproduserer til ulike årstider eller til ulik tid på dagen.

Atferd

Individene i populasjonen har ikke kompatibel paringsatferd; kurtise og andre paringsritualer er ofte svært spesifikke

Mekanisk

Genitaliene til individene passer ikke sammen anatomisk

Gamet

Reproduksjon blir hindret fordi gametene ikke kan danne en zygote

Postzygotiske Spontanabort av hybrider

Det blir dannet en zygote, men den blir spontanabortert av morindividet

Sterilitet

Hybridindividet er sterilt eller har nedsatt fruktbarhet

Beskrivelsen nedenfor og tegningene i margen er hentet fra Lids flora (7. utgave 2007. Det Norske Samlaget). 75 C. demissa Hornem. [C. viridula Michx ssp. oedocarpa (Andersson) B.Schmid, C. tumidicarpa Andersson] – grønstorr – 5–25 cm. Små tuver. Blad slakke, mørkgrøne, flate, utbøygde og noko vridne, 2–5 mm breie, ofte om lag jamlange med eller lengre enn stråa. Strå bøygde. Akssamling av eitt, oftast noko skafta hannaks og 2–4 runde eller avlange, grøne hoaks, det nedste ofte i eit bladhjørne langt nedanfor dei andre. Nedste støtteblad mykje lengre enn akssamlinga, opprett eller sprikjande. Dekkskjel lysbrune med smal, grøn nerve. Fruktgøyme 3–4 mm langt, grønt, med skapre, tydelege nervar, det rette nebbet er om lag 1/3 av heile fruktgøymet. FSo-MSo. 2n = 70. – Fuktig beitemark, grøfter, vasskantar, vegkantar, stigar og overrisla berg, mest på basefattig grunn. Vanleg på Austlandet nord til He Kongsvinger. Op Østre Toten (og Skjåk, komen vestfrå?) og Bu Flå og Nore og Uvdal og i kyststrøk og dalføre nord til No Bø og Tr Bjarkøy, i Trøndelag inn til ST Røros. Til 1150 m i No Rødøy. Nem-MBor. Amfi-atlantisk, boreal. • C.demissa x flava [C. x alsatica Zahn] – Noko fertil og kryssar seg attende med foreldra. – Nokså vanleg i kyststrøk og lågare dalføre nord til Nordland. • C. demissa x hostiana – Steril. – Sjeldsynt i kyststrøk frå Øf Hvaler og Ak Oslo til No Herøy. • C. demissa x lepidocarpa – Noko fertil. – Bu Nedre Eiker, Ro Hå og Karmøy, SF Selje, fleire stader frå MR til No Meløy. • C. demissa x jemtlandica – Bu Lier og Nedre Eiker. • C. demissa x serotina coll. – Noko fertil. – Spreidd i kyststrøk og lågare dalføre nord til No Vågan og Vestvågøy.

Grønnstarr (Carex demissa).


236 • Kapittel 6

Faktorer som danner en barriere mot bevegelse av gener mellom to populasjoner av samme art, kan over tid føre til to nye arter. Artsdannelse er følgelig en kontinuerlig prosess. Isbjørnen og brunbjørnen har oppstått fra et felles opphav.

Gråkråke Svartkråke

Hybridsone. 0214 Kråker Europeisk kråke og svartkråke danner en hybridsone i Skottland, Danmark, Midt-Tyskland og Østerrike.

Europeisk kråke (Corvus corone cornix) er grå og svart og lever i NordøstEuropa. Svartkråke (Corvus corone corone) er helt svart og lever i Vest-Europa. Disse kråkeartene danner en hybridsone mellom Skottland, Danmark, MidtTyskland og Østerrike, der atskilte populasjoner kan møtes. Disse kråkeartene er eksempler på artsdannelse, hvor det skjer genetiske forandringer på hver side av den isbarrieren som isolerer populasjonene. Et annet eksempel er sildemåke og gråmåke. Det er to atskilte arter i Skandinavia og på de britiske øyene. De parer seg ikke med hverandre, har ulikt levesett og kan enkelt skilles fra hverandre ved for eksempel å se på beina. Sildemåke har gule bein, gråmåke grå. Men langs de arktiske kystene av Amerika og Asia finner vi måkepopulasjoner med mellomformer, og disse mellomformene parer seg med hverandre.

Artsdannelse ved polyploidi Polyploidi er en betegnelse brukt om arter som har høyere antall kromosomer enn foreldreartene. Det kan skje på flere måter. Vanligvis blir kromosomtallet i kjønnscellene halvert under meiosen, se side 144. Av og til skjer det en feil slik at kjønnscellene blir dannet uten en slik reduksjonsdeling, og avkommet får da dobbelt så mange kromosomer. Det må skje både i eggcellene og i spermiecellene. En befruktning mellom to individer med likt antall kromosomer, men av ulik art, kan bli en ny art. Et eksempel er oslosildre. Oslosildre er en art som er dannet ved en befruktning mellom trefingersildre og skåresildre, se figuren på neste side. Begge har 2n = 22, mens oslosildre har 2n = 44. Det har skjedd på grunn av hybridisering mellom artene og påfølgende utvikling av gameter som ikke hadde redusert antall kromosomer. Skåresildre er en arktisk art, mens trefinger­sildre er en sørøstlig art. De møtes likevel i en smal kontaktsone fra Stockholm til Oslo. Blant planter er polyploidi relativt vanlig.

Alsikkekløver (Trifolium hybridum).

En annen art som antakelig er blitt til på samme måte, er alsikkekløver, oppkalt etter stedet Alsikke utenfor Uppsala i Sverige. Det var her Linné fant den og forstod at den var en hybrid mellom hvitkløver og rødkløver. Han kalte den derfor Trifolium hybridum. Hos denne arten har det likevel skjedd en reduksjon av kromosomtallet etter den opprinnelige krysningen.


Populasjoner • 237 Celle fra art 2

Celle fra art 1

Saxifraga ascendens

Saxifraga tridactylites

(Skåresildre)

(Trefingersildre)

(22 kromosomer)

(22 kromosomer)

kjønnsceller

kjønnsceller

(11 kromosomer)

(11 kromosomer)

1 Hybrid (blandingsplante) med 22 kromosomer, men to og to kromosomer er ikke homologe (ikke like) 2 Det skjer en feil ved reduksjonsdelingen. Alle kromosomene dras inn i én kjønnscelle.

R!

kjønnsceller 22 kromosomer

3 En ny art dannes

22 kromosomer

Saxifraga osloensis (Oslosildre)

Planten har 44 kromosomer. To og to kromosomer er homologe.

Sjekkpunkter:

07_22 Planter

Nye ord og faguttrykk: sympatrisk, allopatrisk, prezygot, postzygot, hybrid, polyploid. Hvilke former for artsdannelse har vi? Hva bygger artsbegrepet på? Hva er en barriere for reproduksjon? Nevn en postzygotisk og en prezygotisk barriere for reproduksjon. Hva er polyploidi?

Dannelse av en ny art ved polyploidi, oslosildre (Saxifraga osloensis).


238 • Kapittel 6

6.4 Genetisk analyse – Hva betyr det for anslåtte slektskap og evolusjon? Da det ble enkelt og billig å analysere og sammenlikne DNA-materiale, var det mange som trodde at den zoologiske og botaniske systematikken måtte skrives helt om. Det ble en sannhet med store modifikasjoner. Tilgangen til DNA-materialet og mulighetene til å sekvensere og finne ut av genene hos organismer har gitt oss ny innsikt i systematikken, men kanskje først og fremst ny dokumentasjon for evolusjonen og hvordan den skjer på mikronivå. Basert på rRNA-gensekvenser kan alle levende organismer deles inn i tre domener. Ribosomal RNA er viktig i dannelsen av proteiner, se kapittel 3 Fra gen til protein, og alt levende trenger å kunne danne proteiner. Grunnlaget for å skille gruppene er hvordan det har oppstått endringer i de repeterte rRNA-gensekvensene hos de undersøkte organismene. Det leder oss til tre hovedgrupper, domener, av organismer. Mer om teknikker knyttet til slike undersøkelser finner du i kapittelet om bioteknologi. Domener. Basert på rRNA gensekvenser har forskere funnet at alt levende kan deles inn i tre domener. Domenene er bakterier, erkebakterier og eukaryoter.

EUKARYOTER Planter Grønnalger

BAKTERIER

Rødalger

Brunalger

Proteobacteria (Mitokondrium)

Blågrønnbakterier (Kloroplaster)

Gram positive

Spirochaetes

Amøber

Sporedyr Flimmerdyr

Metandannende

Chlamydias

Kiselalger

Fureflagellater

ERKEBAKTERIER

Sopp Dyr

Poredyr

Eggsporesopp

Plasmodiale slimsopp

Stråledyr Cellulære slimsopp Diplomonader

Saltelskende Varmeelskende

Øyealger


Populasjoner • 239

Flue Mygg Sommerfugl Forandring i proteinstrukturen

Møll Bille Spretthale

Mutasjon i Ubx-genet hos insekter. Mutasjon i et Ubx-gen hindrer dannelse av lemmer fra det bakre leddet (abdomen) hos insekter. Derfor har insektene seks bein, mens for eksempel en edderkopp har åtte.

Reke Edderkopp Felles opphav

Tusenbein Onychophoran (finnes ikke i Norge)

I Bi 1 leste du om leddyrene, og at denne rekken inneholder flere svært artsrike klasser. Den kanskje største klassen er insektene. Disse dyrene har ikke bein på det siste leddet på kroppen (abdomen). Alle leddyrene har et gen som heter Ubx. Hos insektene har dette genet en mutasjon som fører til at dannelsen av bein på det bakre leddet på kroppen blir forhindret. Det er forklart på figuren over. Denne mutasjonen har oppstått samtidig med andre utviklingstrinn og er med på å skille insektene fra andre leddyr som reke eller edderkopp. Evolusjon på mikronivå skyldes forandringer i DNA. Mikroevolusjon kan skje på mange måter, og ofte har det absolutt ingen direkte betydning for individet. Men over tid kan det skje systematiske endringer som får betydning for arten.

Grønn blomsterbukk er et insekt med tre beinpar.

Leddyr Leddormer Bløtdyr Virveldyr Pigghuder

Flatormer

Rundormer

Nesledyr Svamper

Dyr

Den vanlige husedderkoppen er et leddyr med fire beinpar.


240 • Kapittel 6

257

Myoglobin

81

Alphakjeder (α1, α2)

120

Zetakjede (ζ)

Felles opphav 49

76

178

27

Epsilonkjede (ε)

6

32

Gammakjeder (Αγ,Gγ)

36

9

Deltakjede (δ)

11

Betakjede (β)

Myoglobin

Hemoglobin

Numrene viser antatt antall DNA-sekvenser som er endret i forgreiningspunktene

Utviklingstre for globinfamilien. Dette utviklingstreet viser at genene som koder for alfakjedene og zetakjeden, divergerte fra betafamilieenhetene (merket rødt) etter skille fra myoglobin. Skillet mellom betafamilieenhetene og alfafamilieenhetene antar man skjedde for ca. 450 millioner år siden.

Når en genetiker strukturerer alt materialet som er å finne på et kromosom, kan hun finne en genfamilie. En slik genfamilie har oppstått fordi genene har duplisert seg, og en utgave av genet kan da utvikle seg videre uten at individet blir direkte rammet. I en slik genfamilie finner du en gruppe gener med relaterte funksjoner, ofte etter hverandre på et kromosom. Et nøye studert eksempel på en slik genfamilie er globinfamilien. Hemoglobin er et molekyl som består av fire subenheter, to alfaglobinkjeder (α1 og α2) og to betaglobulinkjeder (β). Det gir oss et hemoglobinmolekyl slik vi har i blodet vårt. Det er spesialisert til å ta opp og frakte O2 og CO2. Myoglobin er derimot et enkelt molekyl som vi finner i muskelcellene våre. Det har en mye større evne til å ta opp oksygen enn hemoglobin. Hvorfor utviklet da hemoglobin seg og fikk bli i naturen som et vellykket produkt? Som du ser av figuren, har hemoglobin måttet utvikle seg flere ganger, og det har et bredere spekter enn myoglobin. For det første kan det binde fire O2-molekyler om gangen, det kan fraktes med blodbanen og kan også frakte andre stoffer enn O2. Hos mennesket samarbeider disse to oksygenbindingsmolekylene.


Populasjoner • 241

8

Ulike

Aminosyrer i betakjeden av hemoglobin

32

45

125 146

138

Like

114

101

21

Menneske

0

Rhesus ape

Hund

Fugl

23 46 112 Tid siden siste felles stamfar (millioner år)

Niøye

564

Genetisk likhet. Figuren viser genetisk likhet i betakjeden i hemoglobinet hos de utvalgte artene. Betakjeden består av 146 aminosyrer. Hund og mennesket har 114 av disse felles, mens 32 er ulike. Siden mennesket har 138 felles aminosyrer med rhesusapen, mot 114 med hund, indikerer det at mennesket er mer i slekt med rhesusapen enn med hunden.

Sjekkpunkter: Nye ord og faguttrykk: genfamilie Hvilke gener har vi brukt i utviklingen av tredomenesystemet? Hvordan skjer en mikroevolusjon?


Sammendrag • Artene varierer i hvordan de bruker tilgjengelige ressurser på vekst og reproduksjon. Vi sier at hver art har sin livshistoriestrategi.

• Dersom en populasjon har regelmessige svingninger i populasjonsstørrelsen, kaller vi det sykliske svingninger.

• r-selekterte arter får mange avkom med lav sannsynlighet for overlevelse. K-selekterte arter får få avkom og har stor grad av yngelpleie.

• I dag (2014) er det over sju milliarder mennesker på jorda. Det er usikkert hvordan den menneskelige populasjonsveksten vil være i framtiden.

• Vekstrate (r) = fødselsrate (f) – dødsrate (d). En populasjon vokser dersom vekstraten er positiv.

• Populasjonsgenetikk er studie av en genvariants frekvens i en populasjon.

• Eksponentiell vekst gir en J-formet vekstkurve. Vi kan observere eksponentiell vekst når en populasjon er liten, eller når forholdene er spesielt gunstige.

• Dersom tilfeldighetene avgjør om genfrekvensen endrer seg i en populasjon, er det genetisk drift. To former for genetisk drift er flaskehalseffekten og grunnleggereffekten.

• Dersom veksten i populasjonen først øker, så flater ut og til slutt stopper opp, får vekstkurven en s-form. En populasjon som følger en slik kurve, sier vi har logistisk vekst. • Når vekstraten er null, sier vi at populasjonen er i likevekt, og at den har nådd områdets bæreevne for arten. • Bæreevne er det største antall individer av en populasjon som kan leve i et område over lengre tid. Områdets bæreevne for en art er avhengig av tetthetsavhengige og tetthetsuavhengige faktorer. • Mange populasjoner som følger en tilnærmet s-kurve, svinger rundt bæreevnen for området.

• Hardy-Weinbergs likevektslov beskriver en populasjon som ikke evolverer, og den har fem forutsetninger for å fungere. • Dannelse av en ny art kan skje ved allopatrisk eller sympatrisk artsdannelse. • Barrierer for reproduksjon er dels prezygotiske (geografisk, økologisk, tidsmessig, atferd, mekanisk, gamet) og dels postzygotiske (spontanabort og sterile hybrider) • Polyploidi er en spesiell mekanisme som kan føre til sympatrisk artsdannelse.


Populasjoner • 243

Oppgaver Tips til oppgavene finner du på www.gyldendal.no/bi

Aldersgruppe

Antall Antall overlevende overlevende logaritmisk skala

0–1

1000

3,00

1–2

810

2,91

2–3

783

2,89

3–4

774

2,89

4–5

759

2,88

5–6

733

2,87

6–7

691

2,84

7–8

641

2,81

8–9

572

2,76

9–10

442

2,65

10–11

249

2,40

11–12

95

0,70

12–13

5

0,70

13–14

4

0,60

a Bruk opplysningene over til å tegne en overlevelses­kurve for populasjonen. Lag en figurtekst til grafen din. b Hvor stor andel av populasjonen lever ved 6–7 års alder? c Hva er sannsynligheten for at et tilfeldig individ overlever til det når aldersgruppen 13–14 år? 2 Hvilke av organismene i listen nedenfor er r- selekterte, og hvilke er K- selekterte? Gi en begrunnelse for hver av dem: – Stikkemygg (Culicidae)

3 a Hvorfor er det en fordel å være r-strateg i et ustabilt miljø? b Hvorfor er det en fordel å være K-strateg i et stabilt miljø? 4 a Forklar hva som menes med bæreevne. b Hvorfor slutter en populasjon å vokse og når områdets bæreevne for arten? c Er bæreevnen i et område den samme for alle arter? Begrunn svaret ditt. d Er bæreevnen i et område for en art konstant? Begrunn svaret ditt. 5 I en populasjon lever det 3000 individer. I løpet av ett år dør det 200 individer, og det fødes 232 individer. Hva blir: a Fødselsraten i populasjonen? b Dødsraten i populasjonen? c Vekstraten i populasjonen? d Hvor mange individer vil det være i populasjonen om fire år dersom vekstraten er konstant? e Tegn en graf over populasjonsveksten over ti år. La populasjonen starte på 3000 individer i år null. Lag en figurtekst som forklarer grafen din. 6 Figuren under viser veksten til en populasjon i et område. Forklar figuren. Bruk følgende faguttrykk i forklaringen din: likevekt, bæreevne, logistisk vekst, s-kurve, konkurranse, tetthetsavhengige faktorer, vekstrate. populasjonsstørrelse

1 Om en populasjon med amerikansk snøfår (Ovis dalli) får du oppgitt følgende data:

3

områdets bæreevne

2

– Flodhest (Hippopotamus amphibius) – Geitrams (Chamerion angustifolium) – Kokospalme (Cocos nucifera) – Torsk (Gadus morhua) – Husmus (Mus musculus)

1 tid


244 • Kapittel 6

Oppgaver ___    ​= r ∙ N ∙ ____ 7 Logistisk vekst kan beskrives med formelen​   ∆N ​ K–N    ​ der K står for områdets bæreevne for arten, N er ∆t   K   ∆N ___ populasjonsstørrelsen, r er vekstraten og​  ∆t      ​er tilveksten til populasjonen per tidsenhet. Vi antar her at et år er en tidsenhet. Anta at du skal studere en populasjon der det i utgangspunktet lever 20 individer. Bæreevnen for populasjonen i området er 700 individer og vekstraten er 0,8. Bruk formelen og eksemplene gitt i de to første radene til å fylle ut tabellen under. Bruk gjerne excel til beregningene dine. Tegn deretter grafen for populasjonsveksten og lag en figurtekst som forklarer grafen din.

Populasjonsstørrelse (N )

N  ______ ​  K –  ​  

K –  ​ N    r ∙ ​ ______ K

Tilvekst per år = ΔN    ​ ____ ​ Δt

0

20

700 – 20 _________ ​     ​  = 0,97

0,8 ∙ 0,97 = 0,78

20 ∙ 0,78 = 15,6 ≈ 16

1

20 + 16 = 36

700 – 36    ​  = 0,96 ​ _________ 700

0,8 ∙ 0,96 = 0,77

36 ∙ 0,77 = 27,7 ≈ 28

År

K

700

2 3 4 5 6 7 8 9 10 11 12 8 Bruk figuren under til å svare på spørsmålene:

9 Hvilken av grafene over den menneskelige populasjonsveksten synes du er mest sannsynlig? Begrunn svaret ditt.

a Hva kaller vi kurver som har denne formen? b Forklar populasjonsveksten til haren.

00

80

21

60

20

40

20

20

20

00

20

80

20

60

19

40

19

20

19

00

19

80

19

60

18

40

18

18

18

00

Hare Gaupe

Estimert Høy Middels Lav Faktisk

20

antall individer

d Hvorfor svinger de to kurvene «i utakt»?

16000 15000 14000 13000 12000 11000 10000 9000 8000 7000 6000 5000 4000 3000 2000 1000 0 18

millioner mennesker

c Forklar populasjonsveksten til gaupa.

årstall

1845

1855

1865

1875

1885

1895

1905

1915

1925

1935 årstall


Populasjoner • 245

10 Eksamensoppgave, 1999 Ørekyt er en 5–6 cm lang karpefisk som sprer seg sterkt i norske vassdrag. Når det kommer ørekyt i et vann der det lever ørret, blir det konkurranse mellom ørekyta og ørreten. I de fleste vann klarer de to artene å leve sammen, men i noen typer vann kan ørekyta utkonkurrere ørreten helt.

Bestandsstørrelse

Figurene viser forandringer av ørekyt- og ørretpopulasjonene slik de blir observert i tre forskjellige vann etter at ørekyta er introdusert. Bruk disse kurvene og informasjonen de inneholder, til å vise din kompetanse når det gjelder populasjonsvekst og konkurranse.

Ørekyt

Populasjonsvekst av ørekyt i et vann uten ørret

1 Ørekyt

Bestandsstørrelse

Bestandsstørrelse

Tid (år)

Vann med ørretbestand som var stabil før ørekyta kom

2 Ørekyt

3 Ørekyt

Ørret

Ørret

Tid (år)

1001_Ørekyt.pdf

Vann med ørretbestand som var stabil før ørekyta kom

Tid (år)


246 • Kapittel 6

Oppgaver 11 Eksamensoppgave, 2004 (endret) Det har i lang tid vært gode bestander av både elg og rådyr i et område. I det siste har også et par hjorter slått seg ned der. a Bruk opplysningene i tabellen nedenfor og gi to forskjellige eksempler på hvordan hjortepopulasjonen kan utvikle seg framover. Tegn kurver, og forklar grunnene til at utviklingen kan bli slik du skisserer.

b Forklar hvordan økologiske nisjer blir påvirket av konkurranse.
 c Er det grunn til å vente at de økologiske nisjene til elg og rådyr vil bli påvirket av en voksende hjortebestand? Bruk opplysningene i tabellen nedenfor for å grunngi svaret.

Oversikt over næringsvalget til de tre vanligste hjortedyra i Norge

Sommer

Normal vinter

Vinter med mye snø

Elg

Knopper, blad og bark av lauvtrær. Vannplanter

Kvister, knopper og bark av lauv- Spiser i tillegg kvister, knopper og bark av furu og delvis gran trær. Elgen kan nå opp til 4 m over bakken og spiser delvis grov kvist

Hjort

Gress, urter, blåbærlyng og lauv (gjerne bjørk)

Lyng og annen vegetasjon på bakken (gjerne i bratt terreng der det er mindre snø). Lav som vokser på trær

Kvist, knopper og bark av lauvtrær (unntatt or), og av einer. I vanskelige vintrer også av gran, furu og gråor. Middels grov kvist

Rådyr

Gress, urter og blad

Blåbærlyng, røsslyng og bregner (gjerne i bratt terreng der det er mindre snø). Lav fra trær

Kvist og knopper av lauvtrær unntatt or. I vanskelige vintrer også av gran og furu. Bare de tynneste kvistene

Kilder for opplysningene i tabellen: Direktoratet for naturforvaltning, og Norges Dyr, Cappelen 1980

12 Hva er populasjonsgenetikk? 13 I en populasjon av 200 mus er 98 homozygote dominante for en egenskap (BB), 84 er heterozygote, og 18 er homozygote recessive (bb). a Hva er frekvensen av de ulike genvariantene i denne populasjonen av mus? b Hva er genotypefrekvensen i denne populasjonen? 14 Hva er genetisk drift? Bruk figur i besvarelsen din. 15 Når en populasjon har denne genotypefrekvensen, CC = 0,42, Cc = 0,46 og cc = 0,12, hva er da frekvensen av genvariantene? A C = 0,42 og c = 0,12 B C = 0,6 og c = 0,4 C C = 0,65 og c = 0,35 D C = 0,76 og c = 0,24 E C = 0,88 og c = 0,12

16 Hvilke(t) av alternativene (A–E) er riktig(e)? Genetisk drift er mest sannsynlig i en populasjon A som har en høy mutasjonsrate B som opplever store miljøforandringer C hvor naturlig seleksjon skjer D som er liten E som har en høy migrasjonsrate 17 Ofte kan Hardy-Weinbergs lov omtales som en negativ lov. Gi argumenter for dette utsagnet og vis hva det innebærer, med et eksempel. 18 Ofte sier vi at i en stor populasjon er det stor genetisk variasjon fordi genreservoaret er stort. Forklar og gi eksempler på hvorfor dette ikke alltid er riktig.


Populasjoner • 247

22 a Bruk figuren nedenfor til å forklare hvordan allopatrisk og sympatrisk artsdannelse er ulike former for artsdannelse.

19 Fyll ut denne tabellen om reproduktive barrierer:

Type barriere

Pre- eller Eksempel postzygotisk To froskearter pares i et laboratorium og produserer et sterilt avkom To grønnalger slipper gametene sine på samme tid og sted, men ingen befruktning oppstår To orkideer med ulik lengde på nektarrøret blir pollinert av ulike sommerfuglarter

b Hvilken av de to artsdannelsene skaper mer diskusjon og er vanskeligere å forklare enn den andre?

Tidsmessig prezygotisk adskillelse

23 Forklar og vis med figur hvordan Ubx-genet kan brukes som genetisk verktøy til å fastslå et skille mellom leddyr.

Økologisk

24 Forklar bakgrunnen for at alt levende i dag kan klassifiseres innenfor tre domener.

prezygotisk

20 Forklar hvordan polyploidi kan gi opphav til nye arter. Bruk figur i forklaringen din. 21 Fyll ut dette begrepskartet:

individer med på grunn av

Populasjon har

påvirkes av

som er kan endre

ra

n ge

fo

in

genetisk likevekt

genfrekvens og genutgave

• •

• mekanisme for

evolusjon

ingen

dersom likning

0901_Genetisk_variasjon

g

in

r nd


248 • Kapittel 6

Oppgaver 25 Eksamensoppgave, 2011 (endret) Forklar populasjonsveksten til lemen og røyskatt ved hjelp av kurvene under.

prosent av lemenreir som er besøkt av røyskatt

lemen pr hektar (individ pr 10 000 m2)

nordlig halsbåndlemen (Dicrostonyx groenlandicus) den viktigste lemenpredatoren: røyskatt (Mustela erminea)

100 10 1 0.1 0.01 1988

1992

1996

2000

År


Populasjoner • 249

Nett-, gruppe- og presentasjonsoppgaver 26 Lag og gjennomfør et forsøk der du/dere ser på genetisk drift i små populasjoner. Bruk samme metode på en stor populasjon. De dataene som blir samlet inn, bearbeides og presenteres. Bruk matematikk til å vise at størrelsen på populasjonen har mye å si.

30 Finn en hybrid planteart, og lag et foredrag om denne. Du/dere må også ha med foreldreplantene til hybriden. 31 Gå inn på www.gyldendal.no/bi og last ned excel-arket «S-kurve». Du starter med 10 individer, en vekstrate på 0,5 og en bæreevne på 500 individer.

27 Polyploidi har blitt hevdet å være en strategi for arktiske planter. Søk etter relevant litteratur og finn fram en eller to artikler som støtter dette. 28 Ubx-genene – hva forteller de oss oss om evolusjon, og hvorfor? 29 Ta utgangspunkt i figurene på side 240 og 241, og forklar for en Biologi 1-gruppe hvordan og hvorfor hemoglobinmolekylet har utviklet seg ulikt hos mange dyr.

a Studer grafen på excel-arket. Deretter forandrer du på vekstraten. Hvordan påvirker vekstraten populasjonsveksten? Ved hvilke vekstrater endrer kurven drastisk form? Gi en forklaring på hvorfor. Ved hvilken vekstrate overskrides bæreevnen for populasjonen? b Endre på bæreevnen. Undersøk hvordan områdets bæreevne påvirker populasjonsveksten. Gi en forklaring på hvorfor.

Korte foredrag • Lotka-Volterra modellen

• Kaninene i Australia

• Lemenår

• Yngelpleie hos fisk

• Kryptisk artsdannelse


7

Metabolisme Ord og faguttrykk du bør kunne før du begynner på kapitlet

• celleorganell

• eukaryot

• prokaryot

Mål for dette kapitlet er at du skal kunne • forklare hvordan enzymer og andre kofaktorer virker • forklare hvordan aktiviteten til enzymer blir regulert i celler og vev


252 • Kapittel 7

7 metabole (gr.) – forandre

For å forstå hvordan en organisme lever og fungerer, må vi forstå hvordan én enkelt celle kan gjøre det. Mange av de helt nødvendige kjemiske reaksjonene handler om å bryte ned og forbrenne molekyler, eller å bygge opp monomerer og polymerer av viktige molekyler. Samlet er dette metabolismen. Metabolismen er den prosessen som alt levende skaffer seg energi fra og omformer energien i. Lovene i termodynamikken sier at energi verken kan oppstå eller forsvinne, bare omformes. Og lovene forteller oss også at energien går fra høyverdig til lavverdig nivå. Det skjer også i metabolismen, hvor vi kan omforme fra lys­ energi til kjemisk energi, og til varmeenergi. Metabolisme betyr å forandre, noe som nettopp er hva de fleste av disse biokjemiske reaksjonene gjør. Reaksjons­rekkene i metabolismen er til tross for sin kompleksitet grunn­ leggende sett like i alle organismer. Det viser oss en klar evolusjonær sammenheng mellom alle levende organismer.

Glukose + O2

Lysenergi

Katabolisme i mitokondriet

CO2 + H2O

Fotosyntese i kloroplasten

CO2 fra lufta

0714a_Fotosyntese_katabolisme

ATP


Metabolisme • 253

Metabolismen er delt i to deler, katabolismen og anabolismen. Katabolisme er en fellesbetegnelse på alle de reaksjonene som bryter ned store molekyler i en organisme. Deler av katabolismen kalles også respirasjon eller celleånding. Energien fra de store molekylene blir overført til energibærere som ATP, NADH og FADH2 eller blir frigitt som varme. Selv plantene, som altså lager egne nærings­rike molekyler, må bryte ned disse molekylene for å få nok ATP. Cellens nedbrytning av glukose er emnet i kapittel 8 Celleånding. Komplekse produkter ADP + Pi NAD + H+

Nedbrytning

Oppbygning

kata- (gr.) – ned ana- (gr.) – opp bolein (gr.) – kast

ATP og NADHs rolle i metabolismen. ATP og NADH er energibærere som dannes ved ned­ brytning av karbo­hydrater, fett og proteiner. ATP og NADH blir igjen en energi­kilde i dannelse av nye stoffer i cellene.

NADH ATP Enkle produkter

Det motsatte av å bryte ned er å bygge opp. Også dette gjør cellene, og da kalles reaksjonsveiene samlet anabolisme. Slår du sammen cellens anabolske og katabolske reaksjoner, får du metabolisme. Fotosyntesen er den anabolske prosessen som blir forklart i detalj i kapittel 9 Fotosyntese.

7.1 Alt levende trenger en kilde for energi og karbon Alle organismer trenger energi og karbon for å danne organiske molekyler. Organiske molekyler danner basis for livet slik vi kjenner det i dag. Organismene kan grupperes etter sine karbonkilder enten som autotrofe eller heterotrofe, se tabellen på side 254. En autotrof organisme er for eksempel et tre. Et tre bruker fotosyntesen til å danne næringsrike molekyler selv, og bryter ned disse stoffene på samme måte som andre organismer. En heterotrof organisme, for eksempel mennesket, kan bare få i seg energi og karbon ved å bryte ned karbonholdige forbindelser som andre har bygd opp.

autos (gr.) – selv heteros (gr.) – annen mixis (gr.) – blande trophe (gr.) – næring


254 • Kapittel 7

Kilde for energi og karbon.

Næringstype

Energikilde

Karbonkilde

Type organisme

Fotoautotrof

Lys

CO2

Fotosyntetiserende prokaryoter, planter, alger

Kjemoautotrof

Uorganiske forbindelser

CO2

Enkelte prokaryoter

Fotoheterotrof

Lys

Organiske forbindelser

Enkelte prokaryoter

Kjemoheterotrof

Organiske forbindelser

Organiske forbindelser

Dyr, sopp, mange prokaryoter og protister og enkelte parasittiske planter

Miksotrofe kaller vi de organismene som kan være både heterotrofe og autotrofe. Et eksempel er øyealgen Euglena, som spiser alger som har kloroplaster. Disse kloroplastene forblir aktive inne i øyealgen en stund etter at algen er spist.

Forholdet mellom fotosyntese og katabolisme Alle fotosyntetiserende organismer omformer og lagrer lysenergi i foto­ syntesen. Men for å frigjøre den kjemiske energien som ATP må disse organismene bryte ned de energirike molekylene og danne ATP på samme måte som de heterotrofe organismene. Dersom det er oksygen til stede, blir for eksempel glukose brutt ned til CO2 og vann, som sammen med lys er utgangspunktet for fotosyntesen. Om det ikke er nok oksygen til stede, danner cellene produkter som melkesyre eller etanol. Denne formen for forbrenning kalles anaerob og er omtalt grundigere på side 276. Metabolske reaksjonsveier, som kan være svært så innfløkte, er en serie av enzymatisk kontrollerte reaksjoner med et spesifikt endeprodukt. Hver reaksjon har sitt spesifikke enzym. På www.gyldendal.no/bi finner du et metabolsk atlas med oversikt over mange av reaksjonsveiene. Før du lærer mer om disse reaksjonene, er det derfor viktig å ha kunnskap om enzymer og hvordan enzymene fungerer og blir påvirket av det miljøet de er i.

Sjekkpunkter: Nye ord og faguttrykk: metabolisme, katabolisme, anabolisme, autotrof, heterotrof Hvilke andre navn kan deler av katabolismen ha? Gi eksempel på en autotrof organisme.


Metabolisme • 255

Solenergi

Økosystem

Fotosyntese (i kloroplaster)

CO2 Karbondioksid

Glukose + Oksygen O2

+ H2O Vann

Celleånding (i mitokondrier) ATP ATP til cellulært arbeid Varmeenergi

08_03 Celleånding

7.2 Enzymer Enzymer er en stor gruppe proteiner med en helt bestemt oppgave, nemlig å sørge for at kjemiske reaksjoner som ellers ville tatt lang tid, skjer kontrollert og raskt. Enzymer kan for eksempel få en reaksjon til å gå over 100 000 ganger raskere. Derfor kalles enzymer også biologiske katalysatorer. En katalysator er en substans som påvirker reaksjonshastigheten uten selv å bli brukt i eller forandret av reaksjonen. Enzymer betyr i gjær eller i surdeig på gresk. Navnet ble valgt fordi det var gjærceller en først klarte å isolere enzymer fra.

Sammenhengen mellom fotosyntesen og celle­ åndingen.


256 • Kapittel 7

Hvordan øke reaksjonshastigheten til en reaksjon? Vi kan øke reaksjonshastigheten på flere måter: • Øke konsentrasjonen av de stoffene som skal reagere. Når konsentrasjonen øker, blir det flere molekyler. Det øker sannsynligheten for at to av dem skal støte sammen og reagere. • Øke temperaturen. Med økt temperatur har molekylene mer energi (det vil si større hastighet), og flere molekyler treffer hverandre med nok energi til å reagere. • Tilsette en katalysator, for eksempel et enzym. Katalysatoren senker aktiveringsenergien for reaksjonen. Aktiveringsenergien er den energi­ mengden som må tilføres for at en reaksjon skal skje.

Fri energi

Aktiveringsenergi med enzym

Aktiveringsenergi uten enzym

Reaktanter

Forandring i fri energi

Produkter Reaksjonsretning

Det finnes også noen få molekyler som fungerer som enzymer, men som ikke 0531_Aktiveringsenergi.pdf er proteiner. Dette er RNA-molekyler som har en katalytisk funksjon. Det er en av årsakene til at en mener RNA var det første arvestoffet. Vi skal ta for oss hvordan enzymer fungerer, og hvilke typer enzymer vi har.

Hva er et enzym? Et enzym er en biologisk katalysator som virker på en reaksjon ved å senke akti­verings­energien. Aktiveringsenergi er den mengden energi som må inve­steres for at en reaksjon skal skje. Det gjelder for både eksoterme og endo­terme reaksjoner. En eksoterm reaksjon avgir energi, og en endoterm reaksjon tar opp energi fra omgivelsene. I biokjemien i en celle blir slike reaksjoner ofte koplet, for da kan cellen oppnå større effektivitet. Enzymer blir ikke brukt opp eller forandret i reaksjonene.


Metabolisme • 257

Enzymer blir brukt til svært mange ting i hverdagen. For eksempel er enzymet alkalase mye brukt i vaskemidler. Alkalase bryter ned proteiner som har kommet på klærne.

I en kjemisk reaksjon er det alltid reaktanter (R) og produkt (P). Reaktanter er stoffer som reagerer med hverandre, og produkt er det reaktantene «lager», det som er igjen når reaksjonen har skjedd. Slike reaksjoner kan både bryte ned stoffer og bygge dem opp. Når vi bruker enzymer (E) for å få en slik reaksjon til å gå, heter reaktanten substrat (S) for det nevnte enzymet. En generell likning for en slik reaksjon blir da: E + S → ES-kompleks → E + P Et eksempel på en slik reaksjon kan være hvordan kroppen bryter ned sukrose, som er vanlig sukker du kjøper i butikken. Enzymet som katalyserer denne reaksjonen, er sukrase, og sukrose er substrat for dette enzymet.

E – enzym S – substrat P – produkt

Sukrose + vann + sukrase → ES-kompleks → glukose + fruktose + sukrase S S E P P E Enzymer senker aktiveringsenergien fordi: 1 De er spesifikke for noen få spesielle stoffer. Substratet passer i enzymet, slik en nøkkel passer i en lås. 2 De har ett eller flere aktive seter. Det aktive setet gjør at substratet fester seg til enzymet, og det blir dannet et kompleks av enzym og substrat (ES). Det aktive setet er en eller flere kløfter i enzymet. 3 Fordi substratene er løst festet til det aktive setet, «møtes» de, og enzymet sørger for at det oppstår bindinger mellom dem. 4 Når et produkt er dannet, blir det frigjort, og enzymet kan ta imot nye substrater uten å bruke energi.

Substrat

Laktose

Laktase Aktivt sete

1

Hvert enzym har et aktivt sete som passer perfekt for substratet

2

Som en «nøkkel i lås» passer substratet til enzymets aktive sete. Bindingene mellom sukkerene blir brutt.

Det var den tyske kjemikeren Emile Fischer som første gang sammenliknet substrat og enzym med nøkkelen i en lås. Det gjorde han allerede i 1894. Men først i 1965 ble det bevist at han hadde rett.

Sjekkpunkter: Nye ord og faguttrykk: katalysator, aktiveringsenergi, reaktant, substrat

Glukose

Galaktose

Nevn tre forskjellige funksjoner proteiner kan ha i en organisme. Hva er aktiveringsenergi? Hvordan kan enzymer senke aktiveringsenergien?

3

De to monomerene som utgjør laktose blir frigjort fra enzymet laktase

Enzym med aktivt sete.

08_05 Enzym


258 • Kapittel 7

7.3 Enzymer og miljø Alle enzymer blir påvirket av det miljøet de er i. Det er særlig tre faktorer i miljøet som er vesentlige for aktiviteten til et enzym, nemlig pH-verdien, temperaturen og mengden substrat og enzymer.

reaksjons reaksjonsrate

pH-verdien

pH

optimus (lat.) – best

Aminosyrene som enzymene består av, kan ha både syrekarakter og base­ karakter. Det betyr at de kan ha forskjellig ladning ved ulik pH-verdi. Dersom et enzym er i et surt miljø, er det et overskudd av H+-ioner i dette miljøet. H+ kan da reagere med deler av enzymet og dermed hemme eller ødelegge det. H+, eller OH– dersom det er en basisk løsning, kan reagere og påvirke ladningen til enzymet. Ladningen til et enzym er ofte viktig for dets mulighet til å binde til seg substratet. Hvert enzym har sin pH-verdi hvor det fungerer best. Dette er enzymets pH-optimum. Dersom pH-verdien i løsningen avviker mye fra pHoptimum, fungerer ikke enzymet. Er det stort avvik, kan enzymet denaturere. Da hjelper det ikke om forholdene når optimum for enzymet, siden et denaturert protein er et ødelagt protein.

reaksjon reaksjonsrate

Temperatur

temperatur

Som for pH-verdien har de aller fleste enzymene også et temperaturoptimum, en temperatur hvor de fungerer best. Generelt gjelder tommelfingerregelen om at reaksjoner går raskere ved høyere temperaturer. Men blir temperaturen for høy, denaturerer de fleste enzymene. Denaturering er irreversibel. Hviten i et speilegg blir ikke blank igjen om du legger den tilbake i kjøleskapet. Mange organismer er avhengige av temperaturen, og når du ser på vekst og spiring av frø og planter, er det ofte også viktig med en minimumstemperatur. Alle reaksjoner som skjer i celler, er tilpasset de omgivelsene de er i, og omgivelsene varierer fra art til art. Enzymene hos mennesket er noe mer temperaturtolerante enn flere av enzymene til de bakteriene som infiserer oss. Det er derfor en «klok beslutning» kroppen tar når den øker temperaturen (feber) og dermed svekker bakteriene. Dette er et resultat av år med evolusjon.

reaksjons reaksjonsrate

Mengden av substrat og enzym Reaksjonshastigheten øker når mengden av substrat og enzym øker. Det øker sannsynligheten for at substrat og enzym raskere kan få reaksjonen i gang. Enzymet blir som tidligere nevnt ikke brukt opp eller forandret i reaksjonen, men det blir substratet. Derfor er det oftere mengden substrat enn mangelen på enzym som får reaksjonen til å gå saktere. enzymkonsentrasjon


Metabolisme • 259

7.4 Navnsetting av enzymer Enzymene får navn etter det substratet de har, og etter den reaksjonen de katalyserer. I tillegg ender alle enzymnavnene på -ase. Noen av de første enzymene som ble oppdaget, følger dessverre ikke disse navnereglene, for eksempel enzymet pepsin. Pepsin bryter ned proteiner og tilhører en stor familie med enzymer som gjør det, nemlig peptidaser. Et annet enzym som derimot følger regelen, er alkoholdehydrogenase. Det er et enzym som fjerner hydrogen fra alkohol (etanol). Vi har seks hovedgrupper av enzymer som er organisert som vist i tabellen. I figurene i denne boka er alle enzymer markert med blå farge. Tabellen viser hovedgrupper av enzymer og hvilke typer reaksjoner de påvirker. Tabellen er ment som en hjelp til bedre å forstå mekanismene i en enzymatisk reaksjon, og hvorfor navnsetting av enzymer kan gi oss informasjon om hvilke typer reaksjoner de katalyserer.

Gruppe

Figur

Reaksjon = Reduksjonsekvivalent

Oksidoreduktaser

+

Oksiderer eller reduserer organiske stoffer. Noen av de viktigste enzymene våre i celleåndingen er i denne klassen. Også katalaser er med i denne gruppen.

+ Boks

Ared

Aoks

Bred

Overfører en gruppe fra ett stoff til et annet. En stor undergruppe her er kinasene, enzymer som flytter en fosfatgruppe fra ett molekyl til et annet. Et eksempel er heksokinase, som vi finner i starten av glykolysen.

0539a_Enzymgrupper1

Transferaser

+

+

A–B

C

A

B–C

0539b_Enzymgrupper2

Hydrolaser

+

Spalter større molekyler til mindre ved bruk av vann. Her er mange av fordøyelsesenzymene våre, for eksempel peptidasene, lipasene og glykosidasene.

+

A–B

H2O

A–H

B–OH

Katalyserer spalting og noen ganger produksjonen av kovalente bindinger. En viktig undergruppe er dekarboksylasene, som spalter av CO2 fra karboksyl­syregrupper. Et viktig eksempel her er pyruvatdehydrogenase – se celleånding.

0539c_Enzymgrupper3

Lyaser

+ A

B

A–B

0539d_Enzymgrupper4

Katalyserer endringer i et molekyl som gjør det til en isomer form. Isomere former har samme bruttoformel.

Isomeraser A

Iso-A B X = A,G,U,C

Ligaser

0539e_Enzymgrupper5X

+

XDP

+

P P P

XTP A

0539f_Enzymgrupper6

X

P P P

A–B

Katalyserer produksjonen av kovalente bindinger. Det krever energi i form av ATP. To svært, svært vanlige enzymer er med her, rubisko (se foto­ syntese) og DNA-ligase.


260 • Kapittel 7

7.5 Kofaktorer og koenzymer Kofaktorer og koenzymer er stoffer som virker sammen med enzymet for å få det til å virke slik at et produkt kan dannes. Typiske kofaktorer er metallionene jern (Fe2+/Fe3+), magnesium (Mg2+), mangan (Mn2+), kopper (Cu2+) og sink (Zn2+). Kofaktorene er særlig viktige i redoksreaksjoner fordi de bidrar med elektronoverføring. Prostetisk gruppe er brukt om kofaktorer som blir tett bundet til enzymet og forblir bundet til det under hele reaksjonen. Et eksempel på en prostetisk gruppe er hemgruppen i hemoglobin. Koenzymer er organiske stoffer som er nødvendige for at ett eller flere enzymer skal kunne fungere. Koenzymene er løst bundet til enzymene og blir forandret under reaksjonen. Hovedoppgaven deres er å fjerne eller legge til kjemiske grupper eller bidra til elektrontransport, se tabellen under. Mange av ko­ enzymene våre dannes fra vitaminer, eller de er vitaminer. Etter reaksjonen blir koenzymet gjendannet og deltar i den samme reaksjonen igjen. I menneskets kost er alle de vannløselige vitaminene forløpere til koenzymer.

Noen av de vanligste stoffene som virker sammen med enzymer.

Type molekyl

Funksjon Jern (Fe2+/Fe3+)

Kofaktorer

Koenzym

Prostetiske grupper

Kopper (Cu2+)

Oksidasjons- og reduksjonsreaksjoner

Sink (Zn2+)

Hjelper til med binding av NAD

Biotin

Frakter COO– koenzym

Koenzym A

Frakter pyruvat

NAD, FAD

Frakter elektroner

Hem (jernring)

Binder ioner, frakter O2 og elektroner

Sjekkpunkter: Nye ord og faguttrykk: denaturere, kofaktor, koenzym, prostetisk gruppe Hvilke faktorer påvirker effektiviteten av enzymer? Hvordan er «navnereglene» for et enzym? Hva er forskjellen på en prostetisk gruppe og et koenzym?

7.6 Regulering av enzymaktivitet Som vi skrev tidligere, kan enzymer få reaksjoner til å gå svært mye raskere enn de ellers ville ha gjort. Det krever kontroll. Ett av kjennetegnene på liv er homøostase, som er en opprettholdelse av stabile indre forhold. Hvordan en celle kan klare dette med tusenvis av kjemiske reaksjoner på samme tid, er meget fascinerende.


Metabolisme • 261

Hver delreaksjon i en celle er kontrollert av et enzym. Delreaksjonen er også avhengig av at den forrige reaksjonen ble korrekt utført.

Tilstedeværelse av aktivatorer (til venstre) og hvordan hemmere (til høyre) virker inn på reaksjonsraten.

reaksjonsrate reaksjon

reaksjonsrate reaksjon

Enzymer kan bli påvirket av hemmere, aktivatorer og miljøet rundt dem.

mengden d aktivator k

mengden hemmere

Hemmere av enzymaktivitet En del stoffer virker hemmende på enzymer. De kalles hemmere eller inhibitorer og fungerer noe forskjellig. Vi har to hovedgrupper: • Konkurrerende hemmer. En konkurrerende hemmer til enzymet konkurrerer med substrat om plassen i det aktive setet. Dersom hemmeren får denne plassen, skjer det ingen ting. Reaksjonen skjer ikke. Ofte er en slik binding av en konkurrerende hemmer reversibel, det vil si at den løsner fra det aktive setet etter en tid. • Ikke-konkurrerende hemmer. En ikke-konkurrerende hemmer fester seg et annet sted enn det aktive setet på et enzym. Men bindingen forandrer det aktive setet på enzymet, og substratet passer etter hemmerens binding ikke like bra. Konkurrerende hemmer

Aktivt sete

Enzym Ikke-konkurrerende hemmer

Konkurrerende hemmer. Hemmeren konkurrerer med substratet om plassen i det aktive setet. 0533_Hemmere.pdf

Ikke-konkurrerende hemmer. Dette er en hemmer som 0534_Ikkekonkurrerende_hemmer.pdf ikke konkurrerer med substratet om det aktive setet, men kan likevel hemme reaksjonen. Hemmeren binder seg til andre steder enn det aktive setet på enzymet, men det påvirker det aktive setet slik at substratet ikke lenger passer.

Enkelte hemmere kan også binde seg til enzymet irreversibelt. Det betyr at det hemmer enzymet konstant, at det ikke er mulig å snu den reaksjonen som skjer når det binder seg til og endrer enzymet. Slike stoffer er farlige for organismen. Et eksempel på en gruppe av slike stoffer er nervegassene. De er konstante hemmere av acetylkolinesterase, som er helt avgjørende for at


262 • Kapittel 7

nervesystemet vårt skal fungere normalt. Dersom acetylkolin ikke blir brutt ned, blir det sendt konstante impulser i nervesystemet vårt. Konstante impulser i nervesystemet resulterer i krampe og til slutt død. Antabus er en medisin som er brukt mot alkoholisme. Den fungerer ved å være en konkurrerende hemmer av aldehyddehydrogenase. Dette enzymet er ansvarlig for ledd to i nedbrytningen av alkohol, omgjøringen av acetaldehyd til acetat. Opphopning av acetalaldehyd i kroppen er svært ubehagelig.

Allosteriske enzymer – kontroll ved å endre seg allo (gr.) – forskjellig stery (gr.) – form

Allosterisk regulering av enzymer. Allosteriske enzymer kan påvirkes både i inaktiv og aktiv form, og både hemmes og aktiveres.

Allosteriske enzymer er en type enzymer som kan forandre form ved hemming eller aktivering. Dette bruker cellen til å gjøre en del enzymer inaktive når det ikke er behov for dem, heller enn å bryte dem ned. Inaktiv form

Aktiv form

Katalytisk enhet Hemmende sete

Regulerende enheter

Aktivt sete

Aktiveringssete

Substrat

Allosterisk hemmer

Ikke produkt

Allosterisk aktivator

Produkt

0535_Allosteriske_enzymer.pdf

Bruk av kjemiske våpen er dessverre fortsatt en realitet. Nobels fredspris for 2013 ble gitt til Organisasjonen for forbund mot kjemiske våpen (OPCW) for deres innsats for å destruere kjemiske våpen i verden.


Metabolisme • 263

Tilbakekopling Ettersom mange av de viktige reaksjonene i en celle er kjedereaksjoner, er det viktig at de kan startes og stoppes når cellen har behov for det. Det løses ved en mekanisme som heter tilbakekopling. Tilbakekopling betyr at sluttproduktet i en reaksjonskjede påvirker det første eller ett av de første enzymene som setter denne reaksjonen i gang, se figuren. Dersom tilbakekoplingen hemmer prosessen, sier vi at det er en negativ tilbakekopling. Dersom den aktiverer, sier vi det er en positiv tilbakekopling. Slike tilbakekoplingsmekanismer er svært vanlige og viktige i metabolismen. For eksempler fra celleåndingen, se side 285.

Første substrat Enzym B

Mellomprodukt 1

Enzym C

Mellomprodukt 2

Sluttprodukt

Hemmende sete Enzym A

Tilbakekopling (sluttproduktet er en hemmer på enzym A)

0536_Tilbakekopling.pdf

Sjekkpunkter:

Nye ord og faguttrykk: inhibitor, irreversibel, allosteriske enzymer, tilbakekopling Hva er en negativ tilbakekopling? Hvordan fungerer en ikke-konkurrerende hemmer?

Tilbakekopling. Tilbakekopling av en reaksjonsrekke har vi når det siste produktet påvirker dannelsen av det første. Negativ tilbakekopling betyr at sluttproduktet hemmer enzym A, som (her) starter reaksjonsrekken.


Sammendrag • Metabolismen er delt i to deler, katabolismen og anabolismen. • Katabolismen bryter ned store molekyler i cellen.

• Enzymer er spesifikke, og de kan kontrolleres. • Enzymaktiviteten er avhengig av temperatur, pH, substrat- og enzymkonsentrasjonen, og blir begrenset av aktivatorer eller hemmere.

• Anabolismen bygger opp molekyler i cellen. • Enzymer får navn etter substratet og ender på -ase. • Enzymer er biologiske katalysatorer som senker aktiveringsenergien og dermed får flere reaksjoner til å skje. • Bindingsstedet for et substrat er det aktive setet. Når substratene har reagert og dannet produkter, løsner disse fra enzymet, og enzymet blir brukt igjen.

• Vi kan dele enzymene inn i seks hovedgrupper avhengig av hvilken type kjemisk reaksjon de katalyserer.


Metabolisme • 265

Oppgaver Tips til oppgavene finner du på www.gyldendal.no/bi

b Hva er forskjellen på katabolisme og anabolisme? 2 Hvilke hovedgrupper av næringsstoffer har vi for mennesket? 3 Hva heter den biokjemiske nedbrytningsveien for fett? 4 Forklar hvordan og hvorfor NAD(P)H og ATP kalles energibærere. Bruk gjerne en figur i svaret i ditt. 5 Hva er forskjellene på en autotrof og en heterotrof organisme? Bruk eksempler i svaret ditt. 6 Hva er forskjellen på en fotoautotrof og en kjemo­ heterotrof organisme? Bruk eksempler i svaret ditt.

raskere. Gi konkrete forslag til hvordan du kan gjøre ett eller flere eksperimenter for å finne ut hvordan forholdene må være for at enzymet skal fungere så effektivt som mulig. Gi eksempler på hvilke resultater du kan få dersom forsøkene blir vellykkete. 11 Vi studerer reaksjonen A + B → C, som blir katalysert av et enzym. Reaksjonshastighet

1 a Hva består metabolismen av?

7 Eksamensoppgave, 2011 Hvilket utsagn beskriver best forskjellen mellom hetero­ trofe og autotrofe organismer?

B Bare autotrofe organismer omdanner uorganiske forbindelser til organiske. C Bare autotrofe organismer har celleånding. D Bare heterotrofe organismer bruker oksygen. 8 Hva er et enzym? Forklar hvorfor de er så sentrale i for eksempel nedbrytning av glukose i kroppen vår. 9 Forklar ved bruk av figurer a hva forskjellen på en eksoterm og en endoterm reaksjon er b hva aktiveringsenergi er c hva som skjer i det aktive setet i et enzym d hva som skjer når enzymet er i en løsning med mye lavere pH-verdi enn sitt optimum

0

10

20

a Hvordan kan vi måle

30

40

50

60 Temperatur (°C) reaksjonshastigheten?

b I en forsøksrekke lar vi en bestemt mengde substrater (A og B) og enzymer reagere ved temperaturer 0405_Reaksjonshastighet.pdf mellom 0 og 60 °C. Kurven på figuren over viser hvordan reaksjonshastigheten varierer med temperaturen. Forklar kurveformen. c Hva blir enzymets optimumstemperatur her? d I en annen forsøksrekke lar vi en bestemt mengde enzymer reagere med ulike konsentrasjoner av substrat. I hvert forsøk måler vi reaksjonshastigheten. Resultatet er framstilt grafisk på figuren under. Forklar kurveformen. Reaksjonshastighet

A Bare heterotrofe organismer tar opp kjemiske forbindelser fra omgivelsene.

10 Eksamensoppgave, 2000 (endret) a Vis at du forstår og har kunnskaper om hva enzymer er, og hvordan de virker. b Ananas inneholder et proteinspaltende enzym. Mos av ananas kan derfor brukes til å mørne kjøtt. Du ønsker å finne ut hvordan de fysiske og kjemiske forholdene må være for at mørningen skal gå

Substratkonsentrasjon

0406_Reaksjonshastighet2.pdf


266 • Kapittel 7

Oppgaver 12 Tegn opp en temperaturkurve for et tenkt enzym A. a Forklar de ulike delene av kurven. b Angi på figuren når enzymet denaturerer. c Angi i hvilket temperaturområde den enzymatiske hastigheten øker mest. 13 Forklar hvordan enzymer får navn, og hva navnet kan fortelle oss om enzymets virkemåte. Gi minst to eksempler på slik navnsetting. 14 Forklar og vis med en skisse hvordan et enzym kan senke aktiveringsenergien til en kjemisk reaksjon. 15 a På figuren under reagerer A og B med hverandre. Denne reaksjonen katalyseres av enzymet E. Forklar hvorfor stoffet C er et hemmende stoff (giftstoff) for denne reaksjonen.

A

B

C

E b Fyll inn i boksene i figuren under og forklar hva slags hemming som gir de ulike grafene. 0407_Giftstoffhemmer

Graf som viser effekten hemming av en reaksjon ved en fast konsentrasjon av hemmere og en økende konsentrasjon av substrat.

0408_Hemming.pdf

16 Tilbakekopling er en viktig måte å regulere mange biokjemiske reaksjoner i cellene på. Forklar dette begrepet og vis med en skisse og med eksempler hvordan dette skjer. 17 Eksamensoppgave del 1, 2013 a Forklar kort virkemåten til enzymer og hvordan ytre faktorer påvirker enzymer og enzymreaksjoner. b Det følgende er et forslag til svar på oppgave 17a. Gi tilbakemelding på innhold, språk og struktur på besvarelsen. Det finnes mange enzymer i kroppen som alle har ulike funksjoner i kroppen. Som regel bidrar enzymer til ulike reaksjoner i kroppen og virker som katalysa­ torer. En katalysator er et stoff som ikke inngår i reaksjonen som en reaktant, men som er med på å øke reaksjonshastigheten. Enzymet bidrar da med å senke aktiveringsenergien til reaksjonen. Aktive­ ringsenergien er den energien som kreves for å få reaksjonen til å skje. Ved å minske denne kreves det mindre energi, og reaksjonen kan skje hurtigere. Enzymer inngår også i dannelsen av proteiner. Proteiner kan «ødelegges» eller denatureres ved endring av pH eller ved for høye temperaturer. Enzymaktiviteten i reaksjoner kan også påvirkes, for eksempel under høye temperaturer. Da vil reaksjons­ hastigheten gå raskere fordi det er mer bevegelse av molekylene, der bevegelsesenergien øker og mole­ kylene lettere kan treffe hverandre og reagere.


Metabolisme • 267

18 Hos mange trær mister bladene grønnfargen om høsten. a Hvorfor mister bladene grønnfargen? b Ta utgangspunkt i at enzym A er med i reaksjonsveien for nedbrytning av klorofyll. Dette enzymet er ikke aktivt i grønne blader. Gi en forklaring på gennivå som viser hvorfor bladene mister grønnfargen. Bruk figuren på side 120 når du besvarer oppgaven. c Hvilke faktorer tror du øker nedbrytningen om høsten?

20 Eksamensoppgave, 2003 (endret) a Planter trenger enzymet EFSPS for å danne aminosyrene tyrosin, tryptofan og fenylalanin. Glyfosfat hemmer dette enzymet ved å virke som en inhibitor. Ta utgangspunkt i disse opplysningene, og bruk dem til å vise at du vet hva enzymer er, hvordan de virker, og hvordan de reguleres. Hvilket strukturnivå av proteiner tror du EFSPS er på? b Forklar deretter hvorfor plantene dør når de ikke kan danne disse tre aminosyrene, og hvorfor de ikke kan bruke andre aminosyrer i stedet.

19 Forklar hva et allosterisk enzym er, og hvordan slike enzymer fungerer. Bruk eksempler og figurer i svaret ditt.

Nett-, gruppe- og presentasjonsoppgaver 21 Finn ut mer om angrep på sivile og soldater der det har vært brukt ulike former for hemmere som har virket irreversibelt, eller som har bundet seg sterkt til enzymet.

24 Bruk og vis fram et animasjonsprogram for hvordan proteiner danner ulike strukturer, og hvorfor dette er avgjørende for et valgt enzyms funksjonalitet.

22 Et dårlig fungerende enzym eller et defekt enzym kan ofte gi sykdom. Velg ut en slik sykdom og forklar hvilket enzym som er involvert.

25 Følg med i media over en to-ukers periode. Noter all bruk av begrepene enzym og koenzym. Lag en liste og kommenter bruken av begrepene. Si også noe om målgruppa for disse tekstene og hvilken biologfaglig relevans de har/hadde.

23 Lag en presentasjon eller en modell av et valgt enzym. Bruk denne til å vise hvordan enzymet virker, og hvilken reaksjon det katalyserer.

26 Lag et foredrag med vekt på kofaktorer i pilleform.


8

Celleånding

Ord og faguttrykk du bør kunne før du begynner på kapitlet

• energibærer

• protoner

• redoksreaksjon

• tilbakekopling

• karbohydrater

• metabolisme

Mål for dette kapitlet er at du skal kunne • sammenligne hovedtrekkene og energiutbyttet i aerob og anaerob nedbrytning av glukose • knytte energiomsetning i celler til sammensetning av næringsstoffer i kostholdet


270 • Kapittel 8

8

Alt levende trenger energi, og for de fleste dyr betyr det at de må fordøye ulike næringsstoffer produsert av andre organismer. Nedbrytningen kalles katabolisme og er så godt som lik i alle organismer. I dette kapitlet lærer du om hvordan energien i næringsstoffer som glukose kan brytes ned til ATP. ATP er energikilde for den enkelte cellen. Det er ATP som får deg til å løpe, lese og om litt bla om denne siden.

8.1 Næringsstoffer i kostholdet Alle heterotrofe organismer «spiser» for å skaffe seg energi. Det vi spiser, blir omtalt som kostholdet vårt. Kostholdet er viktig for hvilke veier cellen skal bruke for å skaffe og lagre energi i kroppen vår. De vanligste stoffene du finner i et måltid, er karbohydrater, fett og proteiner. Disse stoffene blir brutt ned forskjellig, og mange av dem blir bare delvis brutt ned, og så blir de bygd på til å bli andre molekyler som cellen trenger. Legg merke til at pilene på figuren de fleste steder går begge veier. Det betyr at cellen og kroppen regulerer forbruk og eventuell lagring av næringsstoffer. Glykolyse Glukose

Polysakkarider (stivelse)

Sukker

2 Pyruvat

Glyserol

Pyruvatoksidering

Fett

Metabolisme av fett, proteiner og karbo­ hydrater. Alle heterotrofe organismer «spiser» for å skaffe seg energi. Figuren viser at de ulike nærings­ stoffene brytes ned forskjellig. Mange av dem brytes bare delvis ned, og bygges så på til å bli andre molekyler cellen trenger. Legg merke til at pilene mange steder går begge veier. Hvilken retning avhenger av hva organismen har mest behov for.

Acetyl CoA

Fettsyrer

Proteiner

Aminosyrer

Krebssyklus

Oksidativ fosforylering: Elektrontransportkjede og dannelse av ATP 09_01 Metabolisme


Celleånding • 271

Mennesker, aper og marsvin er de eneste dyrene som har selektert bort et nøkkelenzym for produksjon av vitamin C. De må derfor ha dette i kosten.

Fett Fett blir brutt ned til bestanddelene glyserol og fettsyrer. Fettsyrene kan omgjøres til acetyl-CoA via en rekke reaksjoner som samlet heter β-oksidasjon (se figuren). Når fettsyrene er spaltet til acetyl-CoA, kan acetyl-CoA brytes videre ned i krebssyklus på samme måte som glukose, se side 280. En fullstendig forbrenning av en fettsyre på seks karbonatomer gir betydelig mer ATP enn en fullstendig nedbrytning av ett glukosemolekyl. Nedbrytning av fett krever oksygen. Dersom vi ønsker å trene bort fettet, er det viktig å la muskelen jobbe under aerobe forhold over tid. Reaksjonen over kan også gå motsatt vei. Da blir det dannet fett fra acetyl-CoA. Det er en viktig mekanisme for å lagre næringsstoffer hos organismer. Det er særlig viktig hos dyr som går i dvale, fordi de naturlig nok ikke har noe matsanking gjennom vinterhalvåret. Planter og enkelte bakterier kan derimot også bygge om fett til glukose. Det er gunstig fordi glukose i motsetning til fett er vannløselig og enkelt kan fraktes rundt i planten. Dette forklarer også hvorfor så mange planter har olje som opplagsnæring. Reaksjonen krever et samarbeid mellom to celleorganeller, glykosysomer og mitokondrier. Det er særlig viktig for planten når den spirer, fordi mange frø har oljer som opplagsnæring, og spiring krever mye energi, også i form av nedbrytning av glukose.

Fettsyre

H

H

C

C

H

H

O C OH

oxys (gr.) – sur ATP

CoA

AMP + PPi

soma (gr.) – kropp Fettsyre

H

H

O

C

C

C

H

H

CoA

FAD

Fettsyre 2C kortere

FADH2

Fettsyre

H

H

O

C

C

C

HO

H

O

C

C

C

H

H

CoA

H2O

Fettsyre

CoA

NAD+ NADH

CoA

Fettsyre

O

H

O

C

C

C

CoA

H Acetyl-CoA

Krebssyklus

Oversikt over β-oksidasjonen. Gjennom en serie av reaksjoner blir de to siste 0705_B_oksidasjoner karbonatomene på en fettsyre satt sammen med CoA. Dette krever ATP. Fettsyra må så bearbeides slik at det blir mulig å spalte fra de to siste karbonatomene og feste CoA på dem. Dette skjer i tre trinn hvor det brukes H2O, dannes FADH2 og NADH + H+, i tillegg til acetyl-CoA som brytes videre ned i krebssyklus.


272 • Kapittel 8

Proteiner O

HO

Urea

C C

H

H

C

H

H

C

H

H2N

C

NH3

C

O

H

C

H

H

C

H

C

C HO

O

HO

O

HO

Glutamat

O

-Ketogluterat

Deaminering av amino­ 0704_Glutamat syren glutamat. Når vi fjerner aminogruppen (NH3) fra glutamat, får vi α-ketogluterat, som er et mellomprodukt i krebssyklus. Aminogruppen blir til urea, som blir skilt ut med urin hos en del dyr.

Proteiner blir brutt ned til de enkelte aminosyrene de består av. Oppbyggingen av aminosyrer er beskrevet på side 115. Veldig ofte blir aminosyrene fraktet til andre steder i kroppen og brukt der. Men dersom kroppen skal bryte ned aminosyrene, skjer det i to hovedtrinn: 1 Fjerning av aminogruppen. Aminogruppen må fjernes fra aminosyrene via en prosess som heter deaminering. 2 Når aminogruppen er fjernet, står det et karbon­ skjelett igjen. Det kan variere noe i størrelse, men kan ofte lett gjøres om til ett av mellomproduktene i krebssyklus eller i glykolysen og bli brutt fullstendig ned til CO2 og energi.

Ammonium (NH4+) er giftig for organismen fordi stoffet fort blir omgjort til ammoniakk (NH3). Ammoniakk kan forstyrre og i verste fall stoppe krebssyklusen. Prosessen med deaminering krever energi og produserer urinstoffer, for eksempel urea. Urea blir produsert i leveren hos mennesket og er en lang og kompleks reaksjonsrekke. En del aminosyrer har også svovelgrupper, og de må enten reorganiseres i andre molekyler eller oksideres til sulfat (SO42–) som blir skilt ut med urinen. Frosken skifter i løpet av livet måte å skille ut aminogruppen på. Når den er et rumpetroll, gjør den som fiskene og skiller aminogruppen ut som ammoniakk. Men etter overgangen til delvis landdyr som voksen frosk skiller den ut urea.

Stivelse

Glukose Fruktose

0723_Fruktose

Karbohydrater Karbohydrater er ofte satt sammen av mange enheter og danner polymerer, se side 384. Disse lange kjedene av sukker blir spaltet opp og så tatt opp i tarmen. Glukose blir tatt opp fra tarmen ved aktiv transport. Glukose kan brukes direkte, eller den blir lagret i kroppen som fett eller glykogen, se figuren på side 270. Fruktose blir tatt opp fra tarmen ved passiv transport gjennom bæreproteiner.

Sjekkpunkter: Nye ord og faguttrykk: β-oksidasjon, deaminering Hvilke forskjellige andre stoffer kan proteiner gjøres om til? Hvilket organ er viktig i fjerningen av aminogrupper på aminosyrene? Hva kalles nedbrytningen av fett? Krever nedbrytning av fett oksygen? Hvordan blir glukose lagret hos mennesket?


Celleånding • 273

8.2 Nedbrytning av glukose Glukose, også kalt druesukker, er et sukker som består av seks karbonatomer, altså er det en heksose. Glukose er en svært vanlig næringskilde for mange organismer, både prokaryote og eukaryote. Når glukose blir brutt helt ned i en celle, noe som krever at cellen har tilgang på oksygen, får vi vann, CO2 og ATP. ATP er en energibærer i cellen og resten av organismen. For å opprettholde en effektiv nedbrytning av glukose er det viktig for den enkelte cellen at CO2 blir fraktet bort og O2 blir tilført. Hos mennesket er det løst via respirasjons­ systemet vårt, se Bi 1 kapittel 5.2 Respirasjonssystemet. Hos plantene er det spalteåpningene som tar seg av gassutvekslingen, se Bi 1 side 237. Glukose kan brytes ned både med og uten oksygen. Dersom oksygen ikke er til stede, får vi en gjæringsreaksjon. Denne reaksjonen, som også heter anaerob celleånding, gir oss enten melkesyre, etanol eller smørsyre. Vi skal først ta for oss hvordan glukose blir brutt ned i glykolysen.

CH2OH O H

HO

H

H OH

H

H

OH

OH

0722_Glukose

aerob – aer + bios (gr.) – lever bare i luft (oksygen) anaerob (gr.) – lever uten luft (oksygen)

Glykolyse Glukose 2 ATP

2 NADH

Gjæring 2 Melkesyre eller 2 Etanol + 2 CO2

2 Pyruvat

2 NADH

Pyruvatoksidering

6 NADH

2 CO2

4 CO2

Krebssyklus

2 ATP

Oksidativ fosforylering

32 ATP

2 FADH2

6 O2

6 H2O

Oversikt over reaktantene og produktene: C6H12O6 + 6 O2

09_07 Katabolisme oversikt

6 CO2 + 6 H2O + 36 ATP

Oversikt over deler av katabolismen. Figuren viser en oversikt over hvordan nedbrytningen av glukose gir energi i form av ATP. Figuren vil bli forklart nærmere under de ulike delene.


274 • Kapittel 8

Glykolyse glyco (gr.) – søt/sukker lysis (gr.) – splitting

Glykolyse Glukose

2 Pyruvat

Pyruvatoksidering

Krebssyklus

Oksidativ fosforylering

0909 Glykolysedelen

Glykolysereaksjonene er første ledd i nedbrytningen av glukose i alle levende celler. Den foregår i cytosol og har ikke behov for oksygen. Det vil si at glykolysen er helt lik i absolutt alle celler, også de som bryter ned glukose anaerobt. Det er ti delreaksjoner, som alle har sitt spesifikke enzym. Det betyr at hvert ledd i nedbrytningen kan kontrolleres i form av å bli stimulert eller hemmet. Les mer om dette på side 284. Målet med glykolysen er å danne to pyruvatmolekyler (trekarbonforbindelser), ATP og NADH. Pyruvat kan forekomme i to former og har derfor to navn. Når stoffet er i syreform, heter det pyrodruesyre, og når det er i saltform, heter det pyruvat. Det er pH-verdien i cellen som avgjør om stoffet er i syre- eller saltform. Svært ofte er det i saltform, og vi har derfor valgt å bruke pyruvat konsekvent i dette kapitlet. De ti reaksjonene kan deles i to hoveddeler, se figuren under. I de første reaksjonene må det brukes energi for å få splittet glukosemolekylet. Årsaken er at glukose har en ringstruktur hvor karbonatomene danner skjelettet. Å svekke en slik struktur og dermed kunne få gjort seg nytte av energien som er i den, krever først en investering av energi. Investeringen skjer ved bruk av to ATP-molekyler. Denne investeringen gir straks avkastning i den neste delen av glykolysen. Denne delen av glykolysen produserer ATP i reaksjonene 7 og 10 og NADH + + H+ i reaksjon 6, se figuren på neste side. Legg merke til at det ikke blir skilt ut noe CO2 i glykolysen. Det betyr at det ikke skjer noen forbrenning av glukosen. I glykolysen er det bare en omforming og frigjøring av den energien som ligger i ringstrukturen til glukose. To molekyler pyruvat er sluttproduktet av glykolysen. For å få en fullstendig forbrenning av disse to molekylene må cellen ha oksygen, og pyruvatmolekylene må fraktes inn i mitokondriet. Så langt har omdannelsen av et glukosemolekyl til to pyruvatmolekyler gitt fire ATP og to NADH, men starten på glykolysen krevde to ATP, så nettoresultatet er to ATP og to NADH.

2 Energigivende reaksjoner

1 Energi-invisterende reaksjoner 2 ATP

Glukose

4 ATP

2 NADH

H2O

Ustabilt molekyl som er klart til å bli brutt ned Energi invistert –2 ATP

2 Pyruvat

Energi avgitt +4 ATP +2 NADH

Oversikt glykolysen: I den første fasen blir to ATP «investert» for å gjøre sukker­ molekylet ustabilt. Et ustabilt molekyl er lettere å bryte ned. Det skjer i neste fase, som gir fire ATP og to NADH.


Celleånding • 275

Energi-investerende reaksjoner

Energigivende reaksjoner

CH2OH

CH2O P O

H

H

H

H

Glukose HO

OH

H

H

OH

C

OH

C

O

H

OH

2 Pi

Fosfoglyseraldehyddehydrogenase

2 NAD+

ATP Heksokinase

2 NADH

ADP H O H

H H

OH

H

O

Fruktose-6-fosfat

OH

H

CH2OH P

OH

OH

C

O

HO

H

HC

O

C

O

P

OH

2 H2O

CH2OH

Dihydroksyacetonfosfat

0703_Glykolyse

C

O

C

O

Pyruvat kinase CH2O P H

P

Fosfofenolpyruvat (2 molekyler)

O-

Aldolase

O

Glysersyre-2-fosfat (2 molekyler)

CH2

H

Isomerase

Glysersyre-3-fosfat (2 molekyler)

Fosfoglysermutase

Enolase

OH

C

C

O

Fruktose-1,6-difosfat

CH2O P

2 ATP

O-

ADP

CH2O P

H

Glysersyre-1,3-difosfat (2 molekyler)

CH2O

ATP

Fosfofruktokinase

O

O-

CH2OH

H

C

CH2O P H

HO

OH

Fosfoglyserylkinase

Fosfoheksoisomerase

H

C

2 ADP

OH

OH

CH2OH P

H+

O P

Glukose-6-fosfat HO

+

CH2O P

CH2OH P H

Glyseraldehyd-3-fosfat (2 molekyler)

C

OH

C

O

H

2 ADP 2 ATP

CH3

Glyseraldehyd-3-fosfat (2 molekyler)

C

O

C

O

O-

Pyruvat (2 molekyler)


276 • Kapittel 8

Nedbrytning av glukose. Når det er oksygen tilstede blir sluttproduktene CO2 og H2O. Uten oksygen tilstede blir sluttproduktet melkesyre eller CO2 og etanol.

Glukose

Glykolysen

Pyruvat

CO2

H2O

Melkesyre

CO2

Etanol

8.3 Videre nedbrytning av glukose uten oksygen 09_16 Metabolisme

Anaerob celleånding

Uten O2-tilgang

Glykolyse Glukose

2 Pyruvat

Gjæring

Melkesyre, etanol eller smørsyre

Dersom cellene ikke har oksygen, trenger de likevel energi. Energi i form av ATP kan da dannes i en prosess som kalles anaerob celleånding eller gjæring. Gjæring kalles også fermentering. Gjæring er en videre nedbrytning av pyruvat, når pyruvatmolekylet ikke kan gå via pyruvatoksidasjon, se side 279. Når noe gjærer, gjendannes NAD+ slik at glykolysen kan skje igjen med et nytt molekyl glukose, se figuren 277. Generell likning for gjæring: organisk molekyl + NADH → redusert organisk molekyl + NAD+ Denne måten å skaffe seg energi på anses som den eldste måten å bryte ned glukose på, fordi oksygen først kom med evolusjonen av fotosyntesen. Bakterier har flere forskjellige fermenteringsreaksjoner, og noen av dem blir brukt kommersielt til å lage oster og yoghurt. Det er for eksempel mange melkesyrebakterier i melk, og de lever av å gjøre laktose om til melkesyre via glukose. Det er det som er hovedårsaken til at melken blir sur, og dersom vi ikke hadde pasteurisert den, ville holdbarheten vært betydelig kortere enn hva den er i dag. Louis Pasteur fant ut at alkoholen i vin kunne omdannes til eddiksyre dersom den fikk tilgang på oksygen, og at det er eddiksyrebakterier som gjør det.

09_12_Katabolisme2 høyre


Celleånding • 277

Vi skal se nærmere på utviklingen av etanol hos gjær (sopp) og melkesyre i muskelceller hos mennesket. Etanol og melkesyre blir produsert i disse cellene når de ikke har tilgang på oksygen.

Dannelse av etanol ved anaerob nedbrytning Gjær og enkelte planteceller har enzymer som kan fjerne CO2 fra pyruvat og dermed produsere acetaldehyd under avspalting av CO2. Det er avspaltingen av CO2 som gjør at gjærdeigen hever seg. Når acetaldehyd så blir omgjort til etanol, blir NADH til NAD+. Da har NAD+ blitt gjendannet (se figuren på neste side), og det kan produseres ATP via glykolysen igjen. Det er denne prosessen som gjør at vi får etanol i øl og vin. Etanol er et biprodukt i fermenteringen hos gjær, og er faktisk giftig for gjærcellene. Det er grunnen til at naturlig gjæret vin og øl ikke inneholder særlig mer enn 12 % etanol.

Glukose

H

2 ADP

G LY K O LY S E N

H

2 ATP

OC

O

C

O

CH3

C CH3

2 Etanol 2 NAD+ 2 NADH

H C

CO2 2 Pyruvat

OH

O

CH3 2 Acetaldehyd

0712_Etanol

Dannelse av melkesyre ved anaerob nedbrytning I muskelcellene våre er det enzymet laktatdehydrogenase som gir oss den smertefulle melkesyren. Men samtidig er dette enzymet med på å gjøre det mulig for glykolysen å fortsette nedbrytningen av glukose. Dersom produksjonen av melkesyre pågår over lang tid og det ikke blir tilført oksygen, går muskelen til slutt i krampe fordi det blir skapt et overskudd av H+ inne i muskelcellene. Sirkulerende blod i kroppen frakter med seg melkesyre på ioneform, laktat, fra muskelcellene. Melkesyre blir i leveren i hovedsak omgjort til glukose igjen via en prosess som heter glukoneogenese, som betyr ny produksjon av glukose.


278 • Kapittel 8

O-

2 ADP 2 ATP

OC

O

C

O

CH3

G LY K O LY S E N

Glukose

H

C

O

C

OH

CH3 2 Melkesyre 2 NAD+ 2 NADH

2 Pyruvat

Muskelcellene våre0711_Melkesyre er langstrakte i form, og de kalles ofte muskelfibre. Vi har flere typer muskelfibre. De langsomme muskelfibrene har høyere oksidativ fosforylering enn de raske muskelfibrene, se side 281. Det gjør at de er mer utholdende. Mange av de musklene som holder oss i en fast kroppsstilling, har langsomme muskelfibre, og dem finner vi i rygg og ben. Fordelingen av fibre er personavhengig, og en sprinter har mange av de raske muskelfibrene. De er lite utholdende og skaffer seg mye energi ved bare å kjøre glykolyse i cellene. Med langvarige treningsøkter med lav til moderat intensitet får vi ikke flere muskler, men muskelfibrene får flere mitokondrier og blir omgitt av flere kapillærer, små blodårer. Dette øker utholdenheten i muskelen. Glykogenlagrene i en muskel varer én til to timer under hardt muskelarbeid.

Sjekkpunkter: Nye ord og faguttrykk: anaerob, aerob, gjæring/fermentering, glukoneogenese Hvordan kan mennesker lage fett fra glukose? Hva er forskjellen mellom aerob og anaerob nedbrytning av glukose? Hvordan får cellene energi ut av gjæringsreaksjonene? Hvilket organ omdanner i hovedsak melkesyre hos mennesket? Hvordan kan en muskelfiber produsere flere mitokondrier?

8.4 Videre nedbrytning av glukose ved tilgang på oksygen Aerob celleånding

Dersom cellen har tilgang til oksygen, kan glukosen som ble spaltet til to pyruvatmolekyler i glykolysen, brytes videre ned. En videre nedbrytning gir fullstendig forbrenning og mer ATP til cellen. Krav for den videre prosessen er altså oksygen og en organelle, nemlig mitokondriet.


Celleånding • 279

Mitokondriet Mitokondrier er celleorganeller som finnes i alle eukaryote celler. Hovedoppgaven deres er å skaffe cellen ATP. Det kan den fordi tre hovedreaksjoner foregår der, nemlig pyruvat oksidasjon, krebssyklus og oksidativ fosforylering. Å danne ATP er helt essensielt for at celler og dermed organismer kan leve. Du lærer mer om disse hovedreaksjonene seinere i dette kapitlet. Som du ser av figuren, er mitokondriet ellipseformet, og det har en indre struktur som er omgitt av to atskilte membraner. Den innerste delen av mitokondriet kalles matriks og er avgrenset av en indre sterkt foldet membran. Den ytre membranen avgrenser organellen fra resten av cellen.

0119 Mitokondrier

Mitokondriet har sitt eget DNA og produserer derfor en del proteiner selv. Enkelte av disse proteinene fungerer som enzymer i mange av de biokjemiske reaksjonene som skjer inne i mitokondriene. Det mitokondrielle DNA-et styrer også kopieringen av mitokondriet under celledelingen. Et eget DNA hos en celleorganell er et sterkt tegn på at denne celleorganellen en gang har vært en selvstendig celle. Det er en del av begrunnelsen for den endosymbiotiske teorien om hvordan eukaryote celler ble dannet, se side 27. Mitokondrier blir arvet maternalt, som betyr at du har fått alle mitokondriene i kroppen din fra mor.

Oksidasjon av pyruvat – nøkkelen inn i mitokondriets matriks Pyruvatmolekylet blir oksidert inne i mitokondriet hos eukaryote celler og er en flerleddet reaksjon kontrollert av enzymkomplekset pyruvat-dehydrogenase. Dette enzymkomplekset sørger for at tre delreaksjoner kan skje: 1 Pyruvat blir oksidert til acetat, og CO2 blir frigjort 2 Energien fra oksidasjonen blir brukt til en reduksjon av NAD+ til NADH + H+ 3 Koenzym A (CoA) fester seg til acetat og danner acetyl-CoA Det neste store leddet i nedbrytningen kan begynne, nemlig krebssyklusen. Arsenikk, et klassisk giftmiddel i krimbøker, fungerer ved å blokkere pyruvat-dehydrogenase-komplekset. Dermed stopper krebssyklusen opp, cellen får ikke produsert mer ATP, og organismen dør.

Elektronmikroskopbilde av mitokondrium. Legg merke til innbuktningene som gir stor overflate og muligheten til å danne en protongradient.

Glykolyse Glukose

2 Pyruvat

Pyruvatoksidering

Krebssyklus

Oksidativ fosforylering 09_15 Pyruvatoksidasjon


280 • Kapittel 8

Skjer kun når det er tilgang på oksygen, aerob celleånding.

Krebssyklus kalles også sitron­­ syresyklus og trikarboksyl­syre­ syklus Glykolyse Glukose

2 Pyruvat

Pyruvatoksidering

Krebssyklus

Oksidativ fosforylering

Krebssyklus Syklusen foregår i mitokondriets matriks. I syklusen blir det skapt energibærere i form av NADH, FADH2 og ATP. Syklusen består av ni delreaksjoner, som alle er katalysert av enzymer. I og med at det under glykolysen blir produsert to pyruvatmolekyler av ett glukosemolekyl, går syklusen to ganger for hvert påbegynt glukosemolekyl. Den kan deles inn i tre hovedblokker, angitt som del 1, del 2 og del 3 på figuren under. Krebssyklusen har fått navnet sitt etter den tyskfødte Hans Krebs. Han fikk nobelprisen for arbeidet sitt i 1953.

• Del 1: Syklusen starter som vist på figuren med at 4-karbonsforbindelsen oksaleddiksyre reagerer med acetyl-CoA, og CoA blir spaltet av. Da blir det dannet en ny forbindelse med to + fire karbonatomer. Den nye 6-karbon­ forbindelsen er sitronsyre. CoA blir gjenbrukt til å produsere et nytt acetylCoA. De to «nye» karbonene fra acetyl blir spaltet av i to forskjellige reaksjoner som CO2. • Del 2: Flere delreaksjoner som reduserer sitronsyre til ravsyre, skiller ut to CO2 og produserer to NADH + H+ og ett molekyl ATP. • Del 3: Nydannelse av oksaleddiksyre fra ravsyre slik at denne igjen kan reagere med acetyl-CoA, og syklusen kan ta en ny runde. Energibærere blir produsert i form av ett FADH2-molekyl og ett NADH-molekyl.

09_17 Krebssyklus Glykolysen

Pyruvatoksidering

CoA(Acetyl-CoA)

Krebssyklus

CoA

ATP 4-karbonforbindelse

6-karbonforbindelse

(Oksaleddiksyre)

Oksidativ fosforylering

(Sitronsyre)

NAD+

NADH NAD+

NADH

Del 1

CO2

4-karbonforbindelse Del 3

Krebssyklus

NAD+

l2

FADH2

5-karbonforbindelse

NADH

De

FAD

CO2

4-karbonforbindelse (Ravsyre)

4-karbonforbindelse

ATP 09_18 Krebssyklus

ADP + P


Celleånding • 281

Selv om krebssyklusen ikke skaper mye ATP direkte, bare to ATP per glukosemolekyl, er den en svært viktig kilde til produksjonen av ATP. For hvert glukosemolekyl blir det produsert to FADH2 og seks NADH. De er bærere av energi fordi frigivelsen av protoner (H+) som disse «bærer», kan brukes til å skape en protongradient inne i mitokondriet. I tillegg kan de energirike elektronene fra FADH2 og NADH brukes i elektrontransportkjeden. Pyruvatoksidering

Forandringen av fri energi, G (kcal/mol), for glykolysen og Krebssyklus

Glykolysen

ATP

Krebssyklus

ATP 2 NADH + H+

0 Glukose

2 ATP

2 ATP

-100

2 NADH + H+ -200

-300

Pyruvat

Acetyl CoA

2 NADH + H+

Sitronsyre -400

2 NADH + H+ 2 ATP

-500

-600

-700

2 FADH2 2 NADH + H+ Oksaleddiksyre

Oksidativ fosforylering 0708_Fri_energi Nedbrytningen av sukker gir som kjent energi, og det i form av ATP. Men det er altså helt til sist i nedbrytningen at det for alvor blir produsert mye ATP. Oksidativ fosforylering har to hoveddeler, elektrontransportkjeden og produksjon av ATP ved hjelp av en protongradient (H+-gradient).

Forenklet figur som viser Gibbs frie energi, ΔG, for glykolysen, oksideringen av pyruvat og krebssyklus. Krebssyklus frigjør mer energi enn glykolysen. Se også hvordan bruken av ATP i glykolysen (den energi­ investerende delen) gir grafen en oppgang i starten. Glykolyse Glukose

2 Pyruvat

Pyruvatoksidering

Elektrontransportkjeden Elektroner fra NADH og FADH2 går via en serie av elektronbærere som alle er knyttet til den indre membranen i mitokondriet. Denne bevegelsen av elektroner gjør at protoner aktivt kan fraktes ut av matriks. Dermed blir det bygd opp en protongradient mellom matriks og det ytre rommet inne i mitokondriet. Denne gradienten blir brukt til å danne ATP. Energien som ligger i denne reaksjonen, NADH + H+ + ½ O2 → NAD+ + H2O, er så stor at den må leveres til en kjede av reaksjoner (elektron­transport­ kjeden) og ikke til en enkel reaksjon.

Krebssyklus

Oksidativ fosforylering

09_20 Glykolysedelen


282 • Kapittel 8

Elektrontransportkjeden består av store integrerte proteiner (ett–fire), ett mindre og mobilt protein (Cc) og et lite lipidmolekyl (Q). Elektronenes vandring gjennom kjeden danner en protongradient når protoner blir pumpet fra matriks til rommet utenfor, og har vann som sluttprodukt. Energien fra energibærerne NADH+, H+ og FAD er nå omformet til en protongradient over den indre membranen i mitokondriet. Det kan utnyttes til å produsere ATP om enzymet ATP-syntase er i membranen.

Dannelse av ATP ATP blir produsert av enzymet ATP-syntase. Dette enzymet kopler bevegelsen av H+ fra det ytre til det indre av mitokondriet med en reaksjon som fører til at ADP får festet til seg et fritt fosfat (Pi) og danner ATP, se figuren under. Protonet kan bare bevege seg fra høy konsentrasjon til lav konsentrasjon via ATP-syntase. Det er altså protongradienten mellom de to membranene i mitokondriet som driver produksjonen av ATP. Dersom oksygenet ikke er til stede og blir redusert (tar imot elektronet), stopper hele den oksidative fosforyleringen opp.

Cytosol

Ytre membran

Elektrontransportkjeden Indre membran

H+

H+

H+ H+

Dannelse av ATP H+

H+

H+

Q NAD+ + 2 H+

H+

H+

Matriks (lav konsentrasjon av H+) 0707_Fosforylering

FADH2

4

3

e-

+

H+

e-

e-

NADH

H+

H+

1

H+

H+

H+

e-

ATP-Syntase

2 FAD + 2 H+

H+

H+ H2O

Cytokrom c (Cc)

O2

H+ ADP + Pi

ATP


Celleånding • 283

Teorien om å kople en dannet protongradient over mitokondriemembranen eller tylakoidmembranen ved hjelp av elektrontransportkjeder og slik produsere ATP via ATP-syntaseenzymet kalles den kjemoosmotiske teorien. Hypotesen ble framsatt i 1961 av Peter Mitchell, som i 1978 fikk nobel­ prisen i kjemi for dette.

Energiutbyttet i form av produsert ATP per glukosemolekyl ATP. Tabellen viser hvor mange ATP-molekyler som kan bli produsert når vi har en fullstendig nedbrytning av glukose. Vi antar her at ett NADH gir tre ATP, og at ett FADH2 gir to ATP.

Fase

Produsert ATP

Forbruk ATP

Produsert NADH

Glykolysen

4

2

2

Krebssyklus

2

Frakt* SUM

8

Produsert FADH2

2

2 brutto 36/ netto 32

* Frakt betyr at de to molekylene av NADH som blir produsert i glykolysen, må fraktes inn til matriks slik at de der kan avgi elektroner til den oksidative fosforyleringen. Dette arbeidet krever to ATP. Men det gjelder bare for eukaryote celler.

Den faktiske produksjonen av ATP i en eukaryot celle er noe lavere enn vist i tabellen. Den indre membranen er ikke 100 % tett, og derfor kan enkelte H+ passere membranen andre steder enn via ATP-syntase. Mitokondriet kan også enkelte ganger bruke protongradienten til andre formål enn produksjon av ATP.

Sjekkpunkter: Nye ord og faguttrykk: pyruvat oksidasjon, krebssyklus, oksidativ fosforylering Hvor foregår glykolysen? Blir det produsert ATP i glykolysen? Hva er oppgaven til Koenzym–A, CoA? Hva er en elektrontransportkjede? Hvor foregår krebssyklus? Hvor i nedbrytningen av glukose blir det produsert CO2? Hvordan danner ATP-syntase nye ATP-molekyler? Hvordan bidrar NADH og FADH2 til at det blir produsert ATP?


284 • Kapittel 8

8.5 Kontrollmekanismer i celleåndingen Celleånding er helt vitalt for en celle, og det er derfor viktig at mange av leddene i den kan kontrolleres. Flere av mellomproduktene kan også brukes til å lage andre makromolekyler som cellen måtte trenge. Krebssyklus er sentral i å bygge sammen ulike molekyler, og for å bryte dem ned. Vi ser først på hvordan enkelte enzymer kan påvirke glykolysen og krebssyklusen.

Enzymer som virker inn på glykolysen og krebssyklusen

Fruktose-6-fosfat CH2OH P

O CH2OH

H

H

HO

OH

H

OH

ATP

Fosfofruktokinase

ADP

Fruktose-1,6-difosfat CH2OH P

O CH2O P

H

H

HO

OH

H

OH

0703_1_Glykolyse_trinn_23

Hver enkelt delreaksjon i celleåndingen er kontrollert av enzymer. Enzymer kan regulere en reaksjon på mange måter, se side 258, men eksemplene nedenfor gjelder positiv tilbakekopling og negativ tilbakekopling. Bruk figuren i margen på neste side aktivt mens du leser teksten. Fosfofruktokinase er et enzym som virker tidlig i glykolysen, og det blir regulert av tre stoffer, AMP, ATP og sitronsyre. Enzymet katalyserer reaksjonen fra fruktose-6-fosfat til fruktose-1,6-difosfat. Det betyr at enzymet legger til en fosfatgruppe til fruktose-6-fosfat, og dette fosfatet blir tatt fra et ATP-molekyl. Fosfofruktokinase blir hemmet av ATP og sitronsyre, mens det blir stimulert av ADP og AMP. Sitronsyre er et produkt tidlig i krebssyklusen. Det at et sluttprodukt, som ATP er i nedbrytningen av glukose, påvirker negativt en tidlig reaksjon i den reaksjonsrekkefølgen det selv er et resultat av, er en negativ tilbakekoplingsmekanisme, se figuren på neste side. Negative tilbakekoplinger er røde og markert med -. Det samme kan forklare hvorfor sitronsyre også hemmer dannelsen av fruktose-1,6-difosfat. Med høy konsentrasjon av sitronsyre i cellen er det sannsynligvis ikke behov for å lage mer fruktose-1, 6-difosfat, og det er rasjonelt å stoppe fosforyleringen og dermed bruken av ATP så tidlig som mulig. Skjer det derimot en gjæringsreaksjon i cellen, fortsetter fosfofruktokinasen sin jobb fordi det dannes lite ATP og cellen trenger mer pyruvat. I krebssyklusen er enzymet isositronsyre-dehydrogenase sentralt. Dette enzymet katalyserer flere delreaksjoner, og resultatet av dem er at isositronsyre omdannes til α-ketogluterat, og det blir avspaltet CO2, se figuren på side 280 og i margen på neste side. Isositronsyre-dehydrogenase blir stimulert av NAD+ og ADP, og hemmes av ATP og NADH. Dannelsen av ATP er sluttproduktet i den oksidative fosforyleringen. Dersom cellen har et høyt nivå av ATP, er det meningsløst å lage flere elektronbærere i form av NADH og FADH2, som igjen gir mer ATP. Når vi blokkerer produksjonen av α-ketogluterat, hemmer vi krebssyklusen betraktelig. Dersom det fortsetter, får vi økt konsentrasjon av isositronsyre og sitronsyre.


Celleånding • 285

En høy konsentrasjon av sitronsyre hemmer fosfofruktokinasen, og glykolysen stopper også. Så dersom krebssyklusen blir dempet på grunn av høy konsentrasjon av ATP (og ikke oksygenmangel), hemmer altså både konsentrasjonen av ATP og konsentrasjonen av sitronsyre fosfofruktokinasen og stopper dermed hele nedbrytningen av glukose. Et annet viktig kontrollpunkt i celleåndingen er reguleringen av dannelsen til acetyl-CoA. Dersom det er nok ATP til stede i organismen, men den fortsatt har næringsopptak, blir acetyl-CoA brukt til å lage fett som kan lagres i kroppen og forbrennes seinere. Dette er en av grunnene til at mennesker som spiser for mye, akkumulerer fett.

Glykolyse Glukose

Fruktose-6-fosfat

ADP eller AMP

ATP

Fruktose-1,6-difosfat

Sjekkpunkter: Hva er negativ tilbakekopling?

2 Pyruvat

Hvordan påvirker mengden ATP krebssyklusen? Hvordan påvirker mengden ADP eller AMP glykolysen? Pyruvatoksidering

Hva er grunnen til at acetyl-CoA også kan lage fettsyrer?

8.6 Evolusjon av metabolisme

Fettsyrer

Acetyl CoA ATP eller NADH

Metabolismen kan virke enorm og vanskelig å få tak på for en som lærer det for første gang. Evolusjonen av metabolismen har skjedd over svært langt tid, og deler av utviklingen er vanskelig å fastslå eksakt. Videre møter du seks milepæler i utvikling av metabolismen slik vi kjenner den i dag. De mest primitive formene for liv tror vi har skaffet seg kjemisk energi ved å bryte ned organiske molekyler dannet abiotisk ved uorganiske prosesser da jorda var ung. Omtrent på dette tidspunktet anslås det at energi kunne fraktes i ATP-molekylet. Disse viktige hendelsene henger naturlig nok sammen med de milepælene du leste om i kapittel 1 Evolusjon.

Sitronsyre

Krebssyklus

-Ketogluterat

Isositronsyre ADP eller NAD+ ATP eller NADH

Oksidativ fosforylering

Aktivering og hemming av celleåndingen. En rekke Den neste store hendelsen var glykolysen. Det er en biokjemisk reaksjonsrekke 09_07 Katabolisme delreaksjoner i katabolismen kan aktiveres eller hemmes. som er universell for alle organismer, og den ser ikke ut til å ha endret seg de Det er en angitt på figuren. siste to milliarder årene. De grønne pilene angir hvilke stoffer som virker aktiverende Fotosyntese blir en milepæl i evolusjonen av metabolisme. Istedenfor å på hvilke enzymer, og de røde omorganisere kjemiske bindinger som i glykolysen og frigjøre energi på det, viser de som er hemmere.

blir det utviklet organismer som bruker lyset til å pumpe protoner over en membran. Dermed får de skapt en protongradient, som de deretter kan bruke til å lage ATP.


286 • Kapittel 8

Den første fotosyntesen oppstod ikke slik den er beskrevet i kapittel 9. Den utviklet seg i fravær av oksygen. I havet var det på den tiden oppløst store mengder hydrogensulfid (H2S), og H2S ble spaltet og fritt S avgitt. Dermed ble det laget en protongradient som kunne brukes til å produsere ATP. Neste trinn i evolusjonen av fotosyntese er å bytte ut H2S med H2O. Dermed frigjør vi oksygengass, en gass som ikke hadde vært der før, og som gradvis øker konsentrasjonen sin i atmosfæren. For en videreutvikling av livet ble det nødvendig å skaffe en kilde til mer nitrogen. Nitrogen er et sentralt atom både i nukleinsyrer og aminosyrer. Å få tak i nitrogen fra nitrogengass er komplisert fordi bindingen mellom de to nitrogenatomene er svært sterk. Nitrogenfiksering oppstod i en tidlig fase da det var lite eller ikke noe oksygen. Oksygen forhindrer nitrogenfiksering. Hos arter som kan gjøre dette i dag, foregår reaksjonen i en oksygenfattig eller oksygenfri omgivelse, eller artene har konstruert egne oksygenfrie lommer hvor reaksjonen kan foregå. Aerob celleånding blir den sjette milepælen i evolusjonen av metabolismen. Med en celleorganell som mitokondriet inne i alle eukaryote celler, kan eukaryote organismer nyttiggjøre seg en fullstendig nedbrytning av næringsstoffene.


Celleånding • 287

Sammendrag • Metabolisme er et fellesbegrep for hvordan en organisme bryter ned (katabolisme) eller bygger opp (anabolisme) polymerer. • Fett er et svært energirikt lagringsmolekyl og gir mer ATP når det blir brutt ned. Nedbrytning av lange fettsyrer til acetyl-CoA heter β-oksidasjon. • Nedbrytning av proteiner innebærer en deaminering av aminosyrene dersom de skal brytes ned. • Glukose kan brytes ned med oksygen (aerobt) og uten oksygen (anaerobt). • Glykolysen er en omstrukturering av glukose og krever ATP for å komme i gang. Den foregår i cytosol og er nesten helt lik hos alle organismer.

• Krebssyklus er en syklus som skiller ut CO2, krever oksygen og gir ett ATP, fire NADH og ett FADH2. • Denne protongradienten over membranen blir utnyttet til å skape ATP fra ADP og Pi ved hjelp av enzymet ATP-syntase. • Ved fullstendig nedbrytning av glukose blir det laget ca. 36 ATP-molekyler. En slik nedbrytning krever oksygen, et mitokondrium og koenzym A. • Alle delreaksjoner i nedbrytningen av glukose er styrt av enzymer. Reaksjonen kan hemmes og stimuleres med negative og positive tilbakekoplingsmekanismer. • Metabolismen slik vi kjenner den hos eukaryote celler, har hatt en lang utviklingslinje og har seks hovedmilepæler.


288 • Kapittel 8

Oppgaver Tips til oppgavene finner du på www.gyldendal.no/bi 10 Hvilke(n) av PÅSTANDENE om mitokondriet er gal(e)?

1 Hva kjennetegner en katabolsk reaksjon? 2 a Hva er forskjellen på en autotrof og en heterotrof organisme?

A Den indre membranen er foldet for å danne en større overflate. B Det er lineært DNA i matriks.

b Gi tre eksempler på autotrofe og heterotrofe organismer.

C Det er ribosomer i mitokondriet.

3 Forklar ved hjelp av figurer hva som skjer med nedbrytningen av glukose når cellen ikke har tilgang på oksygen 4 Lag en oversiktsfigur som viser hva som skjer med glukosemolekylet under glykolysen. Bruk så denne figuren til å forklare hvorfor oksygen ikke har noen betydning her. Bruk også figuren til å forklare påstanden om at glykolysen bare er en reorganisering av karbonatomer. 5 Bruk figuren på side 280 til å forklare Krebssyklusen og angi hvor det dannes energibærere, og dessuten hvor mange karbonatomer det er. 6 Ta for deg reaksjonen fra pyruvat til dannelsen av sitronsyre. Lag en figur av reaksjonene og forklar hvilke enzymer som er involvert. 7 Dannelsen av acetyl-CoA blir gjerne kalt nøkkelreaksjonen. Kan du gi noen argumenter for hvorfor dette er et beskrivende navn? 8 Bruk figuren på side 282 i boka til å forklare oksidativ fosforylering. 9 Kryss av for riktig alternativ. Den aktive transporten av protoner i mitokondriet skjer 1 fra område B til C

D Den ytre membranen er foldet for å danne en større overflate. E Organellen har oppstått som følge av en eksocytose. F Antallet mitokondrier varierer fra celle til celle. G Mitokondriet arves fra moren. 11 Hvilke er riktige PÅSTANDER om én runde i Krebssyklusen? A Fire molekyler CO2 blir frigitt. B To molekyler CO2 blir frigitt. C To molekyler av acetyl-CoA er brukt. D To molekyler av FADH2 er dannet. E Ett molekyl ATP og to NADH + H+ dannes. F Ett molekyl FADH2 og et molekyl ATP dannes. G Den foregår i mitokondriets matriks. 12 Kryss av for riktig alternativ. Enzymene som er aktive under Krebssyklusen, finner du A i membranen mellom matriks og det ytre rommet B i matriks C som integrerte proteiner i den ytre membranen, med det aktive setet mot matriks D i væsken mellom matriks og den ytre membranen 13 Antallet ATP-molekyler som blir dannet direkte i sitronsyresyklus per glukosemolekyl, er:

2 fra område C til B 3 fra område A til C

A 1

4 fra region C til A

B 2 C 3 D 4 14 I elektrontransportkjeden i mitokondriene går elektroner fra A høyt til lavere energinivå B lavt til høyere energinivå

C A 0604_Mitokondrium.pdf

B

C matrix til hulrommet mellom indre og ytre membran D hulrommet mellom indre og ytre membran til matrix


Celleånding • 289

15 Når muskulaturen din stivner ved hard fysisk aktivitet, skyldes det A etanol B melkesyre C pyruvat

b Dersom rotenondosen er så lav at fiskene ikke dør, kan vi måle at cellenes forbruk av oksygen minker. Gi en forklaring på denne observasjonen. 21 Fyll ut tabellen: Prosess

D glukose 16 Eksamensoppgave, 2010 Når et molekyl glukose brytes ned under celleåndingen, dannes det vann (ifølge reaksjonslikningene). Hvor blir det dannet flest vannmolekyler? A i glykolysen B i melkesyregjæringen C i Krebssyklusen (sitronsyresyklusen) D i elektrontransportkjeden (oksidativ fosforylering) 17 a Tegn en skisse av et mitokondrium og sett navn på de ulike delene. b Forklar så hvor disse reaksjonene skjer: glykolyse, pyruvatoksidasjon, Krebssyklus og elektrontransportkjeden. c Gi en forklaring på hvorfor det er riktig å si at mitokondriets oppbygning er godt tilpasset funksjonen det har. 18 Gjør greie for hva som er likt og ulikt ved anaerob nedbrytning av glukose i en gjærcelle og i en menneskecelle.

Hovedfunksjon

Krever

Gir

Glykolyse Pyruvat oksidering Krebssyklus Fermentering Oksidativ fosforylering 22 Eksamensoppgave, 2002 (endret) Du skal velge to påstander, finne feilene i påstandene du velger, og omtale dem på en slik måte at du viser biologikunnskapene dine. Du skal ikke omtale de andre påstandene. Alle de fem påstandene i denne oppgaven inneholder feil eller unøyaktigheter. Velg de to du mener egner seg best for å vise dine kunnskaper, og kommenter dem grundig. A Det er bare dyr som tar opp O2 til celleånding. B Sitronsyresyklus (Krebssyklus) inngår i nedbrytingen av karbohydrat, men spiller ingen rolle i nedbrytingen av fett og protein. C Den anaerobe nedbrytingen av glukose foregår i mitokondriene.

19 a Forklar kort hvilken nytte organismene har av celleåndingen.

D For å få ut mest ATP under nedbrytingen av glukose må mitokondriene ha rikelig med oksygen.

b Vis deretter med figurer og tekst hvordan elektrontransportkjeden og den oksidative fosforyleringen fungerer.

E I elektrontransportkjeden (oksidativ fosforylering) brukes energi fra ATP til å transportere H+ gjennom mitokondriets innermembran.

20 Eksamensoppgave, 1996 (endret) a Stoffet rotenon har vært brukt til å utrydde ørekyte i vassdrag. Rotenon fungerer ved at det binder seg til cytokrom-b-komplekset og hindrer opptak av elektroner. Cytokrom-b-komplekset er en del av elektrontransportkjeden og den oksidative fosforyleringen. Bruk kunnskapene dine i biologi til å forklare hvorfor fisken dør når bare cytokrom-bkomplekset blir rammet.


290 • Kapittel 8

Oppgaver 23 Eksamensoppgave, 2006 Laks lagrer fettsyrer i muskelvevet. Under forbrenningen blir fettsyrene fraktet inn i mitokondriene, brutt ned og omdannet til acetyl-Coenzym A. Forklar hvilken nytte cellene har av acetyl-Coenzym A. 24 Eksamensoppgave, 2000 I celleåndingen og fotosyntesen inngår mange viktige hjelpemolekyler. Noen av dem er NADP, NAD, ATP og CoA (koenzym A). Velg ett av disse molekylene, og forklar så nøye du kan hvordan det fungerer, og hvilken rolle det spiller. Du skal ikke forklare hele celleåndingen eller fotosynte­ sen, bare de prosessene der det ene molekylet du har valgt, inngår.

26 Eksamensoppgave, 2004 Ricin er et giftig protein fra frøene til oljebønneplanten Ricinus communis (fam. Euphorbiaceae). Proteinet inne­ holder et enzym som bryter ned RNA og ødelegger ribosomene. Forklar hvordan enzymer er bygd opp og fungerer. For­ klar ut fra dette hvordan ett eneste ricinmolekyl kan ødelegge mange tusen ribosomer. 27 Eksamensoppgave, 2007 Forklar hvordan enzymer fungerer ved ulike temperatu­ rer. Gjør greie for om det er grunn til å vente at enzy­ mene i et pattedyr har andre optimumstemperaturer enn enzymene i et insekt.

25 Fyll ut dette begrepskartet: Oksidativ fosforylering

tar energi fra

ATP

via fungerer som

over i

og danner

også ved hjelp av

0606_Oksidativ_fosforylering

elektrontransportkjeder


Celleånding • 291

Nett-, gruppe- og presentasjonsoppgaver 28 Velg et av enzymene i nedbrytningen av glukose, og forklar hvordan dette virker. Det kan være lurt å også bruke kapittel 7 Metabolisme i denne oppgaven. Lag en skisse for virkningsmekanismen, og forklar hvordan enzymet blir kontrollert. 29 Bruk relevante kilder og finn ut mer om hvordan fett kan omdannes til glukose. 30 Bruk relevante kilder til å finne ut mer om hvordan organismer som går i dvale, lagrer fett og holder den nødvendige metabolismen i gang. 31 Hvorfor er fett så viktig for dyr? Hvordan kan dyr danne fett fra sukker? I besvarelsen bør det også komme fram hva som er kilden til fettet. 32 Finn ut mer om kommersiell framstilling av planteoljer og hva disse oljene brukes til. 33 Les utdraget fra Allers nr. 17, 2000. Utdraget finner du på www.gyldendal.no/bi. Bruk din biologifaglige kompetanse til å vurdere noen av påstandene i artikkelen.

34 Transfett er en betegnelse som brukes om en spesiell form for behandlet fett. Finn ut mer om dette og hvordan det brukes i næringsmiddelindustrien. Hvorfor bør vi unngå å spise transfett? 35 Nyere forskning tilsier at den gamle regelen om at NADH gir 3 ATP og FADH2 gir 2 ATP, er i overkant av hva som faktisk skjer. Finn ut mer om dette, og legg ved en litteraturliste over det dere har lest. 36 Mange vitaminer er fettløselige. Gi en oversikt over disse vitaminene og diskuter påstandene om at det er nødvendig å ta slike vitaminer som tilskudd til det ordinære kostholdet. 37 Ta for dere et medium og følg dette med hensyn på ulike slankeoppskrifter (januar måned er det store tipset) som presenteres. Vurder disse opp mot det språket som mediet bruker, og dets faglige relevans. Presenter resultatene deres enten som en webside eller et foredrag.

Korte foredrag • Anabole steroider + proteinpulver • Kvinnelige kroppsidealer før og • Fett er svært viktig for mennesker, nå – biologi eller kultur? = store muskler? Lag et foredrag særlig som spedbarn. Forklar med denne overskriften hvor hvorfor fett er svært viktig i denne samspillet og konsekvensene ved • Fruktose – hvordan tar kroppen perioden, og hvordan fett lagres hos et slikt forbruk kommer fram. mennesket som voksne individer. opp det? • Amming og morsmelk – Norge er • Mannlige kroppsidealer før og nå • Sukkeralkoholer – hva er det, og – biologi eller kultur? et av få land hvor kvinner ammer hvorfor bruker vi det? lenge. Lag et foredrag der positive sider ved dette kommer fram.


9

Fotosyntese Ord og faguttrykk du bør kunne før du begynner på kapitlet

• reduksjon

• kjemisk energi

• oksidasjon

• hydrofob

• produsenter

Mål for dette kapitlet er at du skal kunne • forklare hvordan lysenergi kan overføres til kjemisk bunden energi i fotosyntesen, og hvordan energien blir brukt til å produsere glukose • gjøre greie for hvordan ytre faktorer virker inn på fotosyntesen


294 • Kapittel 9

9 photos (gr.) – lys syn (gr.) – sammen tithenei (gr.) – å plassere

01.21 Kloroplaster

Innhøsting av sukkerrør. Produksjonen av sukkerrør på store plantasjer i USA gav grunnlag for den store triangelhandelen på 1600- og 1700-tallet. Denne gav Europa sukker og rom fra Amerika, tok med seg våpen og redskap til Afrika, og mer enn 11 millioner slaver fra Afrika til Amerika.

Livet på jorda er helt avhengig av fotosyntesen. Ikke bare produserer den oksygen og gir grunnlaget for alt liv som trenger det. Den danner også kjemisk energi i form av glukose og stivelse. Det er igjen nærings­ grunnlag for alle andre organismer. Fotosyntese betyr å sette sammen ved hjelp av lyset. Planter og noen få bakteriearter er de eneste som kan «sette sammen» energien i sollyset til kjemisk energi.

9.1 Energi Energi, slik vi ofte tenker på det, er det som får noe til å skje, eller som kan få noe til å skje. Vi har alle sett at de fleste planter vokser og ofte strekker seg mot lyset. Altså får lyset noe til å skje med og i planten. Dette «noe» er fotosyntesen, og gjennom denne prosessen får planten energien som kan brukes til blant annet å vokse. Fotosyntesen foregår i kloroplastene hos planter. Energi kan verken oppstå eller forsvinne, bare omformes. I fotosyntesen blir energien i lyset omformet til kjemisk energi i form av glukose og stivelse. Kjemisk energi er en energiform som også kan brukes av andre organismer. Derfor omtaler vi planter og alger som produsenter i økologien. Når energi blir overført fra lysenergi til kjemisk energi, sier vi at den går fra en høyverdig energiform til en lavverdig energiform. Det betyr ikke at noe energi blir «borte», men at energien blir gradvis mindre tilgjengelig. For eksempel er elektrisitet en høyverdig energiform fordi vi i dag enkelt kan benytte den til mange forskjellige oppgaver. Men dersom elektrisitet blir omformet til lydbølger og varmestråling fra et tog, er det to energiformer som vi ikke så enkelt kan benytte oss av. Derfor sier vi at for eksempel lydbølger og varmestråling er lavverdige energiformer.


Fotosyntese • 295

Til tross for at lysenergi er en høyverdig energiform, er den ikke særlig tilgjengelig for andre enn alger og plantene direkte. Men planten og algen omformer denne energiformen, og mennesket kan nyttiggjøre seg den ved å spise planten eller høste fruktene fra den. Dersom vi ser på den generelle likningen for fotosyntesen, finner vi igjen denne omformingen av lysenergi: 6 CO2 + 12 H2O → C6H12O6 + 6 H2O + 6 O2 6 karbondioksid + 12 vann → glukose + 6 vann + 6 oksygen I dette kapitlet skal vi se på fotosyntesen slik den er hos høyere planter. Både alger og enkelte bakterier kan gjennomføre samme prosess, men mange av detaljene er forskjellige.

Lysenergi Lyset har både bølgeegenskaper og partikkelegenskaper. Det består av fotoner som kan beskrives som små pakker av energi. Energien til et foton er omvendt proporsjonal med dets bølgelengde. Fotonene til blått lys (ca. 450 nm) har altså mer energi enn fotonene til rødt lys (ca. 650 nm), se figuren.

Elektromagnetisk spekter. Figuren viser at det kun er et lite område i det elektro­ magnetiske spekteret mennesker kan se. En huske­ regel for dette området er roggbif (rødt, oransje, gul, grønn, blå, indigo, fiolett). Det er de korte bølge­ lengdene som har mest energi.

103 m Radiobølger

750 nm

1m

700 nm Mikrobølger

103 nm

Synlig lys

550 nm

UV 500 nm

1 nm Røntgenstråler

450 nm

Gammastråler

400 nm 380 nm

10-3 nm

10-5 nm

0615_Elektromagnetisk_spekter

Økt energi

600 nm

Infrarød

Økt bølgelengde

650 nm

106 nm

chloros (gr.) – grønngul


296 • Kapittel 9

Eksitert tilstand Kjerne Elektron

Grunntilstand

Økende energi

Fotonet absorberes av et molekyl

Eksitert tilstand

Grunntilstand

Foton

Et eksitert atom. Når et atom er eksitert, har et elektron hoppet til et skall lenger ut enn sitt 0620_Eksitert_elektron opprinnelige.

Antennekompleks. Figuren viser et lysfangende kompleks i tylakoidemembranen. Ulike pigmenter absorberer lys med ulike bølgelengder. Når lyset blir absorbert, skjer det en eksitasjon i molekylet. Dette fører til at molekylet får en eksitasjons­energi. Denne energien gjør at molekylet vibrerer, og energien overføres videre til et annet molekyl. Denne overføringen kalles induktiv resonans. Slik går energien fram til reaksjonssenteret, der det sentrale klorofyllmolekylet blir eksitert.

Foton

Når et foton treffer et molekyl, kan ett av tre skje. Fotonet blir reflektert, går tvers igjennom eller blir absorbert. Når et foton blir absorbert av et molekyl, blir energien i fotonet overført til molekylet. Dette molekylet kan bli eksitert, det vil si at et elektron beveger seg ut fra sitt opprinnelige elektronskall, se figuren over. Elektronet kan falle tilbake til sitt opprinnelige elektronskall, og da frigjøres det energi som kan oppfattes som lys og/eller varme.

Pigmenter For å nyttiggjøre seg energien i et foton må fotonet bli absorbert. Når et foton blir absorbert, blir energien i fotonet overført til molekylet som absorberer det. Når energi blir overført på denne måten, får molekylet en eksitasjonsenergi. Eksitasjonsenergien gjør at molekylet vibrerer og kan sende energien videre til et annet molekyl. Det er komplekse molekyler som kalles pigmenter som absorberer fotoner. Hovedpigmentene hos fotosyntetiserende organismer er klorofyll, se figuren på neste side. Det er flere typer klorofyll, for eksempel klorofyll a, b og c. Fotosyntetiserende bakterier har også klorofyll, men dette klorofyllet er annerledes enn de som plantene har. Derfor kalles de bakterieklorofyll a, b osv. Kloroplast Samling av pigmentmolekyler i membranen Foton

Grana (stabler av tylakoider)

e–

Tylakoidmembran

08-06 Antennesystem

Reaksjonssenter

Overføring av energi

Fotosystem

Primær elektronakseptor

Elektronoverføring Reaksjonssenter, Klorofyll a Antennepigmentmolekyler


Fotosyntese • 297

Et fotosystem består av et lysfangende kompleks (antennekompleks) og et reaksjonssenter, se figuren på side 296. I antennekomplekset er det flere pigmenter enn bare klorofyllpigmentene. Disse pigmentene absorberer også lys og viderefører energien til de sentrale klorofyllmolekylene. Pigmentene heter derfor hjelpe­pigmenter. Blant dem finner vi karotenoidene. Det er en stor gruppe pigmenter som har det til felles at de gir en gul til oransje/rød farge, og at de har en lang hydrokarbonkjede. Gruppen er delt i to, de rene hydrokarbonene, karotenene, for eksempel β-karoten, og hydrokarboner med oksygen, som kalles xantofyller. Hos andre fotosyntetiserende organismer kan det være andre pigmenter. For eksempel har mange bakterier og rødalger pigmentene fykobiliner. Når et legeme reflekterer alle fotonene, er det hvitt, og når det absorberer alle, er det svart. Et blad er som regel grønt for oss, og det betyr at bladet reflekterer de bølgelengdene (ca. 500 nm) som vi oppfatter som grønt lys. De andre bølgelengdene har blitt absorbert eller er gått gjennom bladet.

CH2

CH3 (CHO i

klorofyll b)

CH

CH3

CH

CH2

H3C N

N Mg

HC N

H3C

CH N CH3

H H2C CH2 O

C O CH2

H H C C

C O

O

O CH3

CH

Hos planter er flere ulike pigmenter samlet i to forskjellige fotosystemer. Når fotoner blir absorbert av disse pigmentene, blir det tilført energi til reaksjons­ sentra, hvor det skjer en reaksjon.

Absorbsjon

De flotte gulrøde bladene mange planter får om høsten, skyldes at kloro­ fyllene er brutt ned, mens karotenoidene er igjen og gir farge til bladet.

Lysspekteret

Klorofyll b Klorofyll a Karotenoider

Fykoerythrin Fykocyanin

400

500

600

700 nm Bølgelengde

Absorpsjonsspekter. Figuren viser absorpsjonsspekter til noen utvalgte pigmenter, det 0613_Pigmenter vil si mengden lys de absorberer av de ulike bølge­lengdene. Planter, alger og blågrønnbakterier, som har klorofyll a som sitt primær­pigment, absorberer best i det lilla-blå og røde området. Bakterier og rødalger har i tillegg fykocyanin og fykoerythrin, som absorberer best i det blå-grønne og gule området. Lysspekteret (gul linje) viser den totale absorbansen til de angitte pigmentene.

0617 Klorofyll Klorofyllmolekylet. Figuren viser molekyl­strukturen til hovedpigmentene klorofyll a og klorofyll b hos planter. «Halen» er hydrofob og ankrer molekylet til et protein inne i tylakoide­membranen. Lyset blir absorbert i ring­ strukturen.


298 • Kapittel 9

Sjekkpunkter: Nye ord og faguttrykk: fotoner, eksitert elektron, antennekompleks, fotosystem, reaksjonssentre, pigmenter Hvordan «fanger» bladet lysenergien? Hva er et foton? Hva betyr det at et foton blir absorbert? Hva er forskjellen mellom en lavverdig og høyverdig energiform? Hvorfor er de aller fleste plantene produsenter? Hva er et hjelpepigment?

9.2 Fotosyntesen Fotosyntesen hos høyerestående planter har to hoveddeler. Den ene er helt avhengig av lyset og kalles fotodelen eller den lysavhengige delen. Her blir lysenergi omgjort til kjemisk energi i form av energibærerne ATP og NADPH, se figuren. Den andre delen kalles syntesedelen eller calvin-benson-syklusen fordi den syntetiserer (bygger opp) glukose ved hjelp av energibærere og CO2.

synthesisi (gr.) – sette sammen

Fotosyntese forekommer også hos arter utenfor planteriket, blant annet hos en del prokaryote celler som ikke har noen kloroplaster. Måten disse cellene Oversikt over fotosyntesen.

CO2

H2O

Kloroplast

Lys NADP+

Granum

Stroma

NADPH ADP + Pi

Tylakoidmembran

ATP

O2

10_09 Fotosyntesen

Glukose


Fotosyntese • 299

utfører fotosyntese på, og hvordan fotosyntesen har utviklet seg, lærer du mer om i 9.4 Andre former for fotosyntese.

Kloroplaster Hos eukaryote celler foregår fotosyntesen i en egen organell, kloroplasten. I kloroplasten blir lysenergi omformet til kjemisk energi ved bruk av lys, CO2 og vann. Inne i kloroplastene finner du en formløs, geléaktig masse, stroma. I stroma foregår syntese av glukose og produksjonen av stivelse. I stromaet er det også små membranomsluttende sekker, tylakoidene. Rommet inne i tylakoiden er tylakoidlumen. Mange tylakoider oppå hverandre er et granum, i flertall grana. Mellom et granum og et annet dannes det stromatylakoider, se figuren under.

lumen (lat.) – hulrom

Fotodelen av fotosyntesen hos høyere planter skjer i tylakoidmembranen, mens syntesedelen skjer i stroma. Kloroplaster utvikler seg fra proplastider. Med mye lys blir denne utviklingen stimulert i planten. Kloroplasten er en organell som har oppstått via endosymbiose og har derfor eget DNA, se kapittel 1 Evolusjon. Når en organell har eget DNA, kalles dette DNA-et et plastom. Plastom-DNA koder for flere av de proteinene som er brukt i fotosyntesen. Men flere av proteinene blir kodet for av gener som ligger i cellekjernen. Disse proteinene blir laget i cytosol og fraktet inn i kloroplasten. Stromatylakoider

Indre membran

Tylakoid

Stroma

Ytre membran

Stromatylakoider Grana (stabler av tylakoider)

Granum (en stabel av tylakoider) Tylakoid

07-25B_0602 Membraner

Tylakoidlumen

Kloroplastanatomi. Kloroplasten er en organell med egne membran­ omsluttende sekker, tylakoidene. Inne i tylakoidene finner vi lumen. Membranen mellom lumen og stroma (tylakoidemembranen) er membranen hvor fotodelen av fotosyntesen foregår. Væsken inne i kloroplasten er stroma. Flere tylakoider samlet i en stabel er et granum.


300 • Kapittel 9

Fotodelen av fotosyntesen I fotodelen av fotosyntesen blir det laget O2, ATP og NADPH ved å omforme lysenergi. På figuren under ser du mer detaljert hva som skjer. Alt skyldes en bevegelse av elektroner. ATP og NADPH er energibærere som blir brukt i syntesedelen. I syntesedelen gjør ATP og NADPH at det blir produsert glukose og stivelse.

Oversikt over fotodelen av fotosyntesen. Numrene i figuren er forklart i teksten. På side 302 finner du tilsvarende figur med flere detaljer.

Hovedreaksjonene i fotodelen skjer i to fotosystemer, fotosystem 1 (FS 1) og fotosystem 2 (FS 2). Begge fotosystemene ligger i tylakoidmembranen. Et foto­ system består av et lysfangende kompleks (antennekompleks) og et reaksjons­ senter. Reaksjonssenteret for fotosystem 1 er der det sentrale klorofyll­atomet gir fra seg et eksitert elektron. Det skjer ved en bestemt bølge­lengde, og denne bølge­lengden er navnet på reaksjonssenteret, P700. Foto­system 2 har også et reaksjonssenter, P680. P700 og P680 er reaksjonssentrene til FS 1 og FS 2, og det er ved bølgelengdene 700 nm og 680 nm at det sentrale klorofyll­atomet gir fra seg et eksitert elektron.

Elektronmottager

Elektronmottager

1

3

2 e-

2 e5

Lys

2 e4

P680

6

P700

Fotosystem 2 0607_Fotodelen_1

Lys

Fotosystem 1

Mellom fotosystemene er det en rekke redoksreaksjoner som vi skal forklare seinere. Hos planter kommer FS 2 før FS 1, men det er FS 1 som evolusjonært er den første. Nummereringen av fotosystemene sier altså ikke noe om i hvilken rekkefølge reaksjonene skjer. I forklaringen som følger på neste side, viser numrene til tilsvarende numre på figuren. Det er lurt å lese teksten samtidig som du studerer figuren.


Fotosyntese • 301

Fotosystem 2, FS 2 1 Lysenergien blir absorbert («fanget») av pigmentene i et eget antenne­ kompleks. Pigmentene fører den mottatte energien via andre pigmenter videre inn til kjernen av reaksjonssenteret. Når lysenergien når det sentrale klorofyll a-molekylet i reaksjonssenteret (P680), får molekylet tilført så mye energi at et elektron blir eksitert. Det eksiterte elektronet blir overført til en elektronmottaker, og denne mottakeren er inngangen til de første redoksreaksjonene i elektrontransportkjeden.

Fotosystem 2 produserer O-to

2 For at det sentrale klorofyll a-molekylet skal få tilbake elektronet, blir det spaltet et vannmolekyl. Det gir to elektroner, to H+ og et halvt O2. Det er bare ett elektron som «passerer» fotosystemene om gangen, men strømmen av elektroner er kontinuerlig så lenge det er lys og vann tilgjengelig for bladet. Vann fungerer som elektrongiver til fotosystemet. Komplekset som splitter vann, kalles vannsplittingskomplekset eller oksygendannende kompleks. Det er denne prosessen som er fundamentet for en aerob tilværelse fordi det skiller ut oksygen. De to protonene (H+) blir seinere brukt til å lage ATP, se side 303.

Ele

ktr

on 3 tra nsp

PQ

ort

3 Når PQ (plastokinon) mottar elektronet, tar det opp to H+-ioner fra stroma. De blir transportert inn i lumen, mens elektronet blir overført til cytokromkomplekset. Her blir så de to H+-ionene på innsiden av tylakoidmembranen frigjort i lumen (4). Det øker konsentrasjonen av H+ på innsiden av tylakoidmembranen. Den økte konsentrasjonen av H+ skaper en protongradient som blir brukt til å lage ATP, se side 303. PC (plastocyanin) overfører elektronet til reaksjonssenteret i fotosystem 1. Reaksjonene i denne elektrontransportkjeden er reduksjons- og oksidasjonsreaksjoner, samlet kalt redoksreaksjoner.

kje

Cytokromkompleks

de

PC

4

H+

10_12 Fotodelen del 3

Fotosystem 1, FS 1 5 Det sentrale klorofyllmolekylet i reaksjonssenteret i FS 1 absorberer lys på 700 nm maksimalt. Det blir eksitert et nytt energirikt elektron. Elektronet blir overført til en elektronmottaker, og neste runde med redoksreaksjoner kan ta til. Det eksiterte elektronet blir erstattet av elektroner fra vann­ splittings­komplekset, se punkt 2. 6 Det eksiterte elektronet blir overført via noen ledd til Fd (ferredoksin). Fra Fd blir det så avgitt elektroner til FNR (ferredoksin-NADP+-reduktase). Når FNR får to elektroner, fungerer det som et enzym, og reaksjonen NADP+ + 2 H+ → NADPH + H+ blir katalysert. Reaksjonene i denne elektron­ transportkjeden er redoksreaksjoner. Med dannelsen av NADPH slutter veien til elektronene gjennom tylakoidmembranen.

NADP+ + 2H+ NADPH + H+

Fd

Ele

ktr

on

NADP+ reduktase

tra

nsp ort 6 kje

de

10_13 Fotodelen del 6


302 • Kapittel 9

Elektronmottager

Elektronmottager

Splitting av vann frigjør oksygen og elektroner

Ele

H2O

2 e-

PQ

on 3 tra nsp

ort

Cytokromkompleks

½ O2 + 2 H+

Lys

NADPH + H+

ktr

1

2

NADP+ + 2H+

Fd

2 e-

kje

de 5

Ele

ktr

on

PC

2 e-

Lys

4 P680

NADP+ reduktase

tra

nsp ort 6 kje

de

P700 H+

Fotosystem 2

Oversikt over fotodelen av fotosyntesen detaljer i 10_14 Fotodelenmed oversikt 2 elektrontransport­kjedene.

Fotosystem 1

Oppsummert kan vi si at de to fotosystemene og de respektive elektron­ transportkjedene deres bidrar til fotodelen av fotosyntesen på denne måten: • Fotosystem 1 bruker lysenergi til å redusere NADP+ til NADPH og H+. • Fotosystem 2 bruker lysenergi til å spalte vannmolekyler og dermed produsere elektroner, protoner og oksygen. Oksygenet diffunderer ut av bladet, protonene blir brukt til å skape en protongradient mellom lumen og stroma, mens elektronene erstatter de elektronene som eksiterer i det sentrale klorofyll a-molekylet. Enkelte av elektronbærerne i elektrontransportkjedene er mobile, noe som gir kloroplasten visse muligheter til å tilpasse seg forandringer på kort sikt.

Protongradient og produksjon av ATP I forbindelse med fotodelen av fotosyntesen blir det dannet flere H+ inne i lumen enn ute i stroma. En slik konsentrasjonsforskjell i H+-ioner (protoner) kalles en protongradient. Protongradienten skyldes at tylakoidmembranen ikke er gjennomtrengelig for H+, og at H+ blir fraktet inn i lumen via PQ og cytokromkomplekset, se figuren. Når H+ blir fraktet inn i lumen, vann blir spaltet og H+ også er brukt i stroma til produksjon av NADPH, blir det en stor konsentrasjonsforskjell mellom lumen og stroma. Denne konsentrasjonsforskjellen blir utnyttet av ATP-syntasen, et enzymkompleks som kopler ADP og fritt fosfat (Pi) sammen til ATP. Det er den samme mekanismen som er brukt i celleåndingen, og enzymet har det samme navnet.


Fotosyntese • 303

Lys

Fotosystem 2

Cytokromkomplekset

Fotosystem 1

Lys

2 H+

Fd

e-

e-

NADP+ + 2H+

e-

PQ

PC

FNR

NADPH + H+

H2O

Lumen ½ O2 + 2 H+

2 H+

Stroma

ATP

Tylakoidmembran

ATP-syntase

ADP +

H+

Pi

10_15Om Protongradient lag 60 % av aminosyresekvensene i ATP-syntasen hos kloroplastene er

identiske med mitokondriell ATP-syntase hos mennesker. Det er en utrolig stor likhet med tanke på at det felles opphavet til planter og dyr var for over én milliard år siden.

Dersom det er produsert nok NADPH og H+ og planten bare har behov for ATP, kan den ha en litt annerledes form for bevegelse av elektronene gjennom fotosyntesen. Dersom målet bare er å produsere ATP, må det lages en protongradient som så kan benyttes ved hjelp av ATP-syntasen til å danne ATP fra ADP og Pi. For å få det til må det være en syklisk elektrontransport. Syklisk elektrontransport innebærer at Fd leverer elektronet til PQ, heller enn FNR. Dermed blir det en bevegelse av protoner over membranen via elektron­ transportkjeden knyttet til fotosystem 1. Når lyset (fotoet) er kilden til protongradienten, slik det er i fotodelen av fotosyntesen, kalles det en fotofosforylering.

Dannelse av proton­ gradient i lumen. Under fotodelen blir det dannet en høy konsentrasjon av H+ (protoner) i lumen ved spalting av vann og ved at PQ og cytokromkomplekset frakter H+ inn fra stroma. H+ kan kun diffundere til stroma via ATP-syntase-enzymet i membranen. Når det skjer, dannes det ATP fra ADP + Pi. Dette kalles fotofosforylering.


304 • Kapittel 9

CO2

H2O

Kloroplast

Lys NADP+

Granum

NADPH ADP

Syntesedel

Stroma

+ Pi

Tylakoidmembran

ATP

O2

Glukose

Syntesedelen av fotosyntesen

10_16 Fotosyntese med uthevet syntesedel

Syntesedelen kalles også calvinsyklus, calvin-bensonsyklus og mørkereaksjonen.

I denne delen av fotosyntesen blir CO2 satt sammen med et hydrokarbon, og som seinere kan bli til glukose. Denne sykliske prosessen skjer i stroma og krever NADPH og ATP, som ble dannet under fotodelen. Syklusen har mange delreaksjoner, og de er alle styrt av enzymer. Syklusen kan deles i tre hovedfaser: 1 Karbonfiksering (assimilasjon) 2 Reduksjon og produksjon av sukker 3 Regenerering

RuBP – ribulose bifosfat

CO2 kommer inn i bladet via spalteåpningene, som ofte ligger på undersiden av bladet. I de første reaksjonene i syntesedelen blir CO2 tatt opp og satt sammen med et femkarbonsukker (RuBP) med to fosfatgrupper. Enzymet i denne reaksjonen er ribulose-1,5-bifosfatase karboksylase/oksygenase (rubisco). Det er mest sannsynlig verdens vanligste protein, og kan utgjøre hele 50 % av proteinene i et blad. Syntesedelen er vist med to figurer. Figuren på side 305 har færre detaljer enn den på side 307. 1 I denne hovedfasen blir CO2-molekylet inkorporert og lager en meget ustabil sekskarbonforbindelse som straks blir delt i to trekarbonforbindelser (3-fosfoglycerat). Begge trekarbonforbindelsene har en fosfatgruppe knyttet


Fotosyntese • 305

Syntesedelen av foto­ syntesen. Numrene i figuren er forklart i teksten. Legg merke til at syklusen må gå seks ganger for å danne et glukosemolekyl da det kun bindes ett CO2 -molekyl per omgang. Figuren er forenklet ved at enkelte biokjemiske detaljer er utelatt. En mer detaljert figur finner du på side 307.

6 Karbondioksid (CO2)

Stroma

Rubisco

6 ADP

3

12 ATP 12 ADP

Syntesedelen

nn els ea v sukker

6 ADP

nerering Rege

bonfiksering Kar

2

Reduksjon

da og n Reduksjo

10_17 Syntesedelen forenklet

til seg. Reaksjonen bruker også vann. Fordi den første stabile forbindelsen etter bindingen av CO2 er to trekarbonforbindelser, kalles denne måten å binde CO2 på en C3-binding.

2 I denne hovedfasen blir de to forbindelsene redusert ved hjelp av ATP og NADPH til trekarbonforbindelsen glyceraldehyd-3-fosfat. Denne trekarbonforbindelsen er brukt som grunnlag for å danne svært mange andre viktige makromolekyler i plantecellen. 3 I fem av seks tilfeller går glyseraldehyd-3-fosfat over i den siste hovedfasen av syntesedelen, hovedfase 3. Her blir glyseraldehyd-3-fosfat via mange reaksjoner og bruk av ATP omdannet til utgangspunktet, nemlig femkarbonet RuBP. Alle sykluser må lages på nytt, og i denne syklusen blir det bare bundet ett nytt karbonatom per runde. Det vil si at dersom det skal produseres glukose, som er en sekskarbonforbindelse, må syklusen gå seks ganger. Som du ser av figuren, er det gjort forenklinger av denne syklusen.

Når vi vil angi hvor mange karbon det er i et sukker, skriver vi antallet på gresk. Et femkarbonsukker blir altså en pent + ose = pentose


306 • Kapittel 9

Alle sukkerarter ender på -ose

Stivelse

Sukrose

0623_Stivelse

Lagringsorganer. Knoller og frukt er lagringsorganer for stivelse.

Men dersom du tenker deg at syklusen går seks ganger, blir det enklere å forstå at seks karbonatomer binder seg og blir gjort om til glukose samtidig som syklusen består. Det samme gjelder nydannelsen av RuBP. Ett molekyl glyseraldehyd kan ikke alene lage en ny RuBP som er en femkarbon­ forbindelse. Men ti glyseraldehyd-3-fosfat (ti ganger trekarbonforbindelse = tretti karbonatomer) kan gi seks RuBP (seks ganger femkarbonforbindelse = tretti karbonatomer). Stivelse er opplagsnæring for planten, og er et polysakkarid av glukoseenheter. Stivelse kan lagres lokalt i kloroplastene, men som regel blir de fraktet til egne lagringsorganer, for eksempel knoller eller i frukten. De delene av en plante som ikke har fotosyntese, får energirike forbindelser fra andre celler i planten. I slike tilfeller blir glukose og fruktose satt sammen til disakkaridet sukrose (i cytosol), som kan fraktes med silvevet til det stedet det skal brukes eller lagres. Planter har mange forskjellige og kompliserte veier for å lage sukker, for eksempel fruktose. Rubiscoenzymet er et proteinkompleks bestående av åtte små og åtte store enheter. Disse proteinene er kodet for i DNA-et til både kloroplasten og cellekjernen. Det betyr at deler av enzymet blir laget i cytosol og fraktet inn i kloroplasten hvor det blir satt sammen til et funksjonelt enzym.


Fotosyntese • 307

Karbondioksid (CO2) 6 molekyler

Stroma

H2 O

Rubisco Ribulose-1,5-difosfat

RuBP

12 ATP

Syntesedelen

nn els ea v sukker

12 ADP

3

6 ATP

PGA 12 molekyler

1

nerering Rege

6 ADP

3-fosfoglycerat

bonfiksering Kar

6 molekyler

Syntesedelen av foto­ syntesen: Numrene i figuren er forklart i teksten. Legg merke til at syklusen må gå seks ganger for å danne et glukosemolekyl da det kun bindes ett CO2 -molekyl per omgang.

1,3-difosfoglycerat 12 molekyler

12 NADPH

2

12 NADP+ da g 12 P o i Reduksjon Glyceraldehyd-3-fosfat

4 Pi Glyceraldehyd-3-fosfat 10 molekyler

12 molekyler

Glyceraldehyd-3-fosfat 2 molekyler

Glukose 10_19 Syntesedelen med alt

Sjekkpunkter: Nye ord og faguttrykk: stroma, tylakoide, grana, lumen, fotosystem 1, fotosystem 2, syklisk elektrontransport, fotofosforylering, rubisco Hvilke to hovedfaser har fotosyntesen hos planter? Hvilken funksjon har vannsplittingskomplekset? Hvor foregår fotodelen av fotosyntesen? Hvilket fotosystem spalter av oksygen? Hva er rubisco, og hva gjør det? Hvor foregår syntesedelen av fotosyntesen? Hvordan blir det laget en protongradient inne i lumen? Hvor blir NADPH + H+ laget? Hva skjer i hovedfase 2 i syntesedelen av fotosyntesen?

Rubisco. Bildet viser et røntgen­krystallfotografi av rubiscoenzymet.


308 • Kapittel 9

9.3 Ytre faktorers påvirkning og tilpasninger I Bi 1 skrev vi om ulike tilpasninger hos planter, og hvordan planter kan spesialisere seg for å få et maksimalt utbytte av fotosyntesen der de lever. En del av disse tilpasningene lærer du mer om nå. Fra kapittel 9.1 Energi vet du at planter har forskjellige pigmenter som fanger lys i ulike deler av det elektro­magnetiske spekteret. Fotosyntetiserende organismer som lever i vann, må ha muligheten til å benytte seg av andre bølgelengder enn de bølge­ lengdene som de landlevende organismene benytter. Det kommer av at lyset blir brutt når det treffer vannet, og det gir andre bølgelengder i vannmassene enn på overflaten. Som du ser av figuren, har de ulike algene ulik farge og dermed ulik mengde av hjelpepigmenter. Også hos algene er klorofyll fortsatt det sentrale pigmentet i fotosyntesen. Mennesket opplever fargen på en alge som den bølgelengden algen reflekterer. Soneinndeling i havet. Artene sprer seg nedover i vannet etter hvilke bølge­ lengder den kan nyttegjøre seg av i fotosyntesen. Grønnalgene er øverst, så kommer i hovedsak brun­ algene og nederst rødalgene.

Høyvann

Sjøsalat

Lavvann

Tarmgrønske Grisetang Sagtang

Krusflik Sukkertare

Fagerving

0712_Alger Karbondioksid, CO2

I Bi 1 ble tilpasninger til karbondioksid og samspillet mellom opptak av CO2 og forbruk av vann omtalt som C3-, C4- og CAM-fotosynteser. Forskjellene mellom dem ligger i hvordan de binder og oppbevarer CO2. Disse biokjemiske tilpasningene skal du lære mer om nå, og det du har lest om fram til nå, er C3-planter. Den måten å binde CO2 til et organisk molekyl som er beskrevet under syntesedelen, heter C3-binding. Bakgrunnen for begrepet er at det første stabile molekylet som blir laget etter inkorporeringen av CO2, har tre


Fotosyntese • 309

karbonatomer. Dette er den mest vanlige formen i Norge. Ved lav konsentrasjon av CO2, ved varme og lite vann er denne måten å binde CO2 på mindre effektiv enn andre former. Nøkkelenzymet i syntese­delen er rubisco. Dette enzymet kan fungere både som oksidase og som karboksylase. Det vil si at det kan sette inn oksygen eller karbon i et annet molekyl. Når rubisco setter inn oksygen, kalles det fotorespirasjon, og planten bruker O2 i stedet for CO2. Dersom oksygen blir satt inn i karbonforbindelsen i stedet for CO2, spalter karbonforbindelsen seg, og i de videre reaksjonene avgir planten CO2. Fotorespirasjon skaper en mye mindre effektiv binding av CO2. Sluttproduktet av fotorespirasjonen er glycerat, og i tillegg skiller plantene ut CO2 under fotorespirasjonen. Totalt bindes en fjerdedel mindre CO2 når C3-plantene har fotorespirasjon.

Ribulose1,5-difosfat

O2

Rubisco

Fotorespirasjon

Rubisco

CO2 + H2O

Binding av CO2

2 x 3C-forbindelse

3C + 2C

3C 2 x 2C

CO2

Sukker

3C

Fotorespirasjon. Enzymet rubisco kan også binde oksygen fast 0616_Fotorespirasjon til en karbonforbindelse, se blå pil. Dermed dannes andre forbindelser enn ved binding av CO2. Produktene som dannes, er mindre anvendelig for planten, og det spaltes også av CO2 i fotorespirasjonen.

Tenk deg et blad hos for eksempel rose, bjørk eller havre. Ytterst på bladet er det et vokslag, kutikula, og innenfor dette laget er det ulike celletyper. I meso­ fyll­cellene, som er spesialiserte celler i bladet (se figuren under), er det mange kloroplaster, og i dem er det enzymet rubisco som binder CO2. Men når lufttemperaturen stiger, stenger bladet spalteåpningene for ikke å tape vann og få vannstress. Fotosyntesen fortsetter inne i mesofyllcellene samtidig som det blir brukt CO2 og produsert O2. Etter hvert blir konsentrasjonen av O2 så høy rundt rubisco at dette enzymet heller binder O2 enn CO2. Da har vi foto­ respirasjon, som altså oppstår lettere ved høye temperaturer. Rubisco har ti ganger så høy affinitet for CO2 som O2.

For å unngå problemet med fotorespirasjon er det evolvert to alternative måter å binde CO2 på: C4-planter og CAM-planter. Kutikula

Bladanatomi: Figuren viser et tverrsnitt av et typisk blad med ulike lag.

Øvre ytterhudslag Mesofyllceller Svampvev Ledningsvev

0620_01_Blad_tverrsnitt

Spalteåpning Lukkecelle

Nedre ytterhudslag Luftrom


310 • Kapittel 9

1 C4-planter. Dette er planter som er tilpasset å leve i områder med mye lys og høy temperatur. De stenger også spalteåpningene når temperaturen blir høy, men har liten fotorespirasjon. Grunnen til at de kan få til dette, ligger i deler av bladets anatomi og enzymet PEP-karboksylase, se figuren under. Hos disse artene samarbeider to celletyper om økt effektivitet på fotosyntesen. Det er mesofyllceller og slireceller. Slirecellene er organisert rundt ledningsvevet og har kloroplaster. Vi antar at C3-bindingen av karbon er den eldste, ca.3,5 milliarder år gammel, mens bindingen av C4 «bare» er ca. 12 millioner år gammel.

Slirecellene utfører syntesedelen av fotosyntesen, mens det i mesofyllcellene er et annet enzym enn rubisco som binder CO2, nemlig PEP-karboksylase. Dette enzymet kan bare binde CO2 og gjør det derfor mer effektivt enn rubisco. Slik blir CO2 bundet til en trekarbonforbindelse og danner en firekarbonforbindelse, derav navnet C4. Denne C4-forbindelsen blir en midlertidig lagringsform for CO2. Når det trengs mer CO2 og spalteåpningen er lukket, blir C4-forbindelsen fraktet til slirecellen, og CO2 blir spaltet av der, se figuren. Dermed får rubisco en høy konsentrasjon av CO2 også når spalteåpningene er lukket, og effektiviteten på fotosyntesen holdes høy. Med denne måten å binde CO2 på unngår planten fotorespirasjon fordi konsentrasjonen av CO2 blir holdt høy. Eksempel på slike plantearter er mais og sukkerrør. Mesofyllcelle

CO2

PEP karboksylase

PEP, C3

C4

AMP

Kloroplast Ledningsrør

C4

ATP

Pyruvat, C3 CO2

Slirecelle

Syntese

Glukose/ stivelse Celle i ledningsvevet

Spalteåpning

Bladanatomi hos C4-planter. Hos planter tilpasset å drive en C4-fotosyntese, 10_26 C4Planterer organiseringen i bladet litt annerledes. De har slire­­celler, som har en viktig funksjon i fotosyntesen hos disse artene.

Samarbeid mellom mesofyllceller og slireceller hos C4-planter. Hos C4-plantene er bindingen og inkorporeringen av CO2 atskilt i forskjellige celler. Meso­fyll­cellene binder CO2 ved hjelp av enzymet PEP-karboksylase, og slirecellene utfører syntese­ delen av fotosyntesen.


Fotosyntese • 311

fotosyntese hastighet

Fotosyntesehastighet hos C3- og C4-planter varierer med hensyn til CO2-tilgang og temperatur.

fotosyntese hastighet C3 C4 C4

C3

0

20

40

60

80

100 (CO2)

0

10 15 20 25 30 35 40 45 °C temperatur

2 CAM-planter. Dette er planter som er tilpasset tørke og mye lys. De har spalteåpningene åpne om natta og lukket om dagen. Denne tilpasningen gjør at de taper svært lite vann, men må lagre CO2 om natta. For å binde CO2 kreves NADPH og ATP, og de blir dannet under fotodelen. CAMplantene løser denne utfordringen ved at de også har PEP-karboksylaseenzymet. Det betyr at CAM-plantene binder CO2 om natta ved hjelp av PEP-karboksylase og frigjør den om dagen til enzymet rubisco. Slik drives det effektiv fotosyntese selv om spalteåpningene er lukket. Hos CAM-plantene kan vi derfor si at CO2-bindingen og syntesedelen av foto­ syntesen er atskilt i tid, mens det hos C4-plantene er atskilt i forskjellige celler (mesofyllceller og slireceller). Sammenligning av C3-, C4- og CAM-planter.

C3-planter

C4-planter

CAM-planter

Fotorespirasjon

Ja

Minimalt

Minimalt

Calvinsyklus

Ja

Ja

Ja

Fotosyntetiserende bladceller

Mesofyll

Mesofyll og slireceller

Mesofyll

Første CO2bindingsenzym

Rubisco

PEP karboksylase og Rubisco

PEP karboksylase og Rubisco

Åpne spalteåpninger

Dag, om ikke for varmt

Dag, om ikke for varmt

Natt

Første stabile karbonforbindelse etter CO2-binding

Trekarbonforbindelse, C3

Firekarbonforbindelse, C4

Firekarbonforbindelse, C4

Optimumstemperatur for fotosyntese

15–25 °C

30–47 °C

30–35 °C

CAM (eng.) – Crassulacean Acid Metabolism


312 • Kapittel 9

I Norge finner vi arter med CAM-binding av CO2 i bergknappfamilien, Crassulaceae. En annen plante som binder CO2 på den samme måten, er ananas. Tabellen på forrige side sammenfatter noen likheter og ulikheter mellom de tre hovedmåtene for planter å binde CO2 på.

Kjemisk påvirkning (herbicider) Det finnes mange kjemikalier som er framstilt for å drepe planter. De kalles gjerne plantevernmidler eller herbicider. Det er store muligheter i å utvikle nye midler ettersom den gammeldagse lukingen krever mange mennesker i arbeid og derfor blir kostbar. Men vi ønsker å drepe de «riktige» artene og ikke forurense mer enn nødvendig. Derfor bør et godt herbicid virke på spesifikke reaksjonsveier i en plante. Det er også viktig at stoffet ikke skader andre organismer, for eksempel mennesker. Herbicidet må også påføres i slike mengder til jordene at det har blitt ufarliggjort før det eventuelt når grunnvannsreservoarer. Floghavre er et «ugras» med egne regler og egen lov.

Vi skal se nærmere på noen herbicider som påvirker fotosyntesen, hvordan enkelte hormoner påvirker planten, og hvordan dannelse av enkelte amino­ syrer i plantene gjør det. Alle påvirkningene er sentrale ledd i utviklingen og livet til en plante. DCMU – DiKlorfenyldi­Metyl­Urea

Paraquat NADP+

DCMU

QA NADPH

QB P700 P680 H2O

½ O2 + 2 H +

Virkested for 10_27 DCMU ogherbicidet paraquat

DCMU og paraquat. DCMU er et herbicid som blokkerer elektrontransporten hos planter. Dette gjør den ved å hindre en videre flyt av elektroner i elektrontransport­kjeden knyttet til fotosystem 2. Paraquat virker ved å blokkere elektron­transport­kjeden knyttet til fotosystem 1.

Innvirkninger på fotosyntesen Herbicider har et bredt virkespekter, men flere av dem virker inn på fotosyntesen. Et mye brukt herbicid er DCMU. DCMU virker inn på fotodelen i fotosyntesen, nærmere bestemt elektron­ transportkjeden. DCMU er en «hermer» (analog) til PQ og tar plassen til denne hermeren i transportkjeden av elektron. Men DCMU tar ikke opp H+ fra stroma, og fører heller ikke elektronene videre. Slik blir fotosyntesen sperret, og planten svekkes og dør. Paraquat er et annet herbicid som påvirker transportkjeden av elektron i tylakoidmembranen. Dette herbicidet virker fordi det selv mottar elektroner fra elektrontransportkjeden etter FS 1 og bruker energien til å danne svært reaktive forbindelser som hydrogenperoksid, H2O2. Det er et stoff som planten i moderate doser selv kan avgifte. Men dersom planten blir utsatt for store doser, som når den bruker paraquat, må den gi tapt. Det finnes også herbicider som virker fordi de ødelegger produksjonen av pigmenter, både klorofyll og karotenoider. Det hemmer og ødelegger foto­ syntesen, og planten dør.


Fotosyntese • 313

Hormoner I Bi 1 leste du om plantenes hormoner og at enkelte av dem også kan brukes til å manipulere plantene. Særlig kjent er syntetiske auxiner fordi de ble brukt av amerikanerne under Vietnamkrigen. Det syntetiske auxinet som ble brukt da, sørget for å få trærne til å felle bladene. Auxinet inneholdt et giftig dioksin (2,3,8,9-tetraklorodibenzo-para-dioksin). Flere av beboerne og soldatene fikk store skader, og det ble notert en økning av deformasjoner og skader på fostrene i området. Aksjonen gikk under dekknavnet «agent orange». Bladfelling behøver ikke å ta livet av et tre direkte, men det hindrer naturlig nok fotosyntesen. Skjer dette flere ganger, blir treet svakere og dør.

Aminosyrer Glyfosat er et herbicid som hemmer synteseveiene for flere aminosyrer i planter. Dette gjør den ved å blokkere en bestemt reaksjon. Denne reaksjonen er helt avgjørende for at planten skal kunne lage de aromatiske aminosyrene fenylalanin, tryptofan og tyrosin. Dette stoffet kommer vi tilbake til i bioteknologien fordi det har blitt utviklet glyfosattolerante (resistente) planter ved hjelp av bioteknologiske metoder. Alle planter har i ulik grad enzymer som kan detoksifisere. Å detoksifisere er å gjøre et giftig stoff om til ett eller flere mindre giftige stoffer. Dette kan gjøre det vanskelig å bruke herbicider eller plantevernmidler korrekt, og bruken av herbicidtolerante planter kan lett spre seg og bli en del av kultur­ landskapet.

Stressfysiologi Når planter opplever stress, påvirker det fotosyntesen. Og som hos mennesker er det sjelden bare én stressfaktor som blir den ødeleggende, men flere som virker samtidig, og som da kan føre til skade. Når samlet stress blir så stort at det hemmer normal fotosyntese, sier vi at det forekommer en fotoinhibering. Stressfaktorer kan være for sterkt lys, lav eller høy temperatur, lav konsentrasjon av CO2 og lite vann. Normalt er skader fra fotoinhibering reversible, slik at planten ikke får varige skader. Planter har ulike tilpasninger til lys og lysmengde. Et hovedskille går mellom de plantene som har spesialisert seg på å være skyggeplanter, og de som er lys­planter. En slik tilpasning til lysmengde er ikke dynamisk, og den er arvet. En skyggeplante blir ikke en lysplante om den får mye lys. I Bi 1 skrev vi om at planter har ulike former for bevegelser. Det betyr at en lyskjær plante som eføy bøyer bladet mot lyskilden slik at bladet skal få mer lys. Motsatt kan skygge­ planter endre på bladorienteringen slik at de får mindre lys. Det skjer ofte ved at bladene «klapper sammen», de henger ned. Gauksyre er en typisk representant for skyggeplantene.

toxikon (gr.) – gift


314 • Kapittel 9

fotosyntese hastighet

lysplante

skyggeplante

lysintensitet kompensasjonspunkt

Fotosyntesehastighet hos lysplante og skyggeplante. Grafen viser hvordan skyggeplanter og lysplanter er ulikt tilpasset mengden lys. Kompensasjons­punktet angir den lysmengden der planten produserer like mye oksygen ved foto­syntese som den bruker i celleåndingen.

Gauksyre (Óxalis acetosélla).

Med for høy lysintensitet kan planten gjøre flere ting for å unngå stress. Det ene er å forandre stilling på selve bladet slik at lysinnstrålingen blir endret. Eller de kan ha en overflate som bare reflekterer noe av lyset. Dersom lyset først blir absorbert, kan det bli overskuddsenergi i kloroplasten. Denne energien bruker kloroplasten til varme, fluorescens eller til å drive spesielle kjemiske sykluser. Pigmentene karotenoider er her aktive, både til å fjerne overskuddsenergi som varme og som en del av den kjemiske syklusen som bruker energi og oksygen. For mye energi kan klart være skadelig for planten, og innebærer at den blir stresset. En stresset plante er mer utsatt for infeksjoner, på samme måte som stressede dyr er det. Oksygen blir ofte betraktet som et ufarlig og nødvendig kjemisk stoff. Men å splitte vann og få produsert oksygen kan også være en farlig prosess. Oksygen er svært reaktivt og kan forårsake reaksjoner som ikke er ønskelige. Dessuten kan en høy konsentrasjon av oksygen påvirke syntesedelen av fotosyntesen, særlig hos C3-plantene. Høy temperatur påvirker også C3plantene sterkere enn andre planter fordi C3-planter har fotorespirasjon, noe som hemmer effektiviteten av fotosyntesen sett under ett. Dersom planter blir utsatt for en plutselig temperaturøkning fra 5 til 10 oC, reagerer de på det ved å produsere varmesjokkproteiner. Disse proteinene hjelper cellene ved å virke som chaperoner og motvirker dermed forandringer av proteiner i cellene i forbindelse med raske temperatursvingninger. Chaperoner er hjelpeproteiner som er med på å gi store og komplekse proteiner rett form. Luftforurensning er særlig skadelig for bladene og dermed for fotosyntesen. Bladet er på mange måter den tynne huden på planten og er kontrollorgan for gassutveksling. Dersom det er mye partikler i lufta, blir lysinnstrålingen forandret, og alle partiklene i lufta faller før eller seinere ned til jorda og på bladene. Her kan de lage skyggeskader, eller de kan bli tatt opp i bladet. Mange gasser som stammer fra forbrenningen av fossile brennstoffer, inneholder


Fotosyntese • 315

blant annet svoveldioksid (SO2) og/eller nitrogenoksider (NOx). De følger samme vei som CO2 inn i bladet, men bladene kan ikke bruke dem direkte, men må bearbeide og detoksifisere dem til former som planten kan bruke. Fotokjemisk smog er et produkt av kjemiske reaksjoner drevet av sollys, NOx og organiske komponenter. Resultatet kan være ozon (O3) og peroksyacetyl­ nitrat (PAN). Disse stoffene kan være direkte skadelige for planten. De kan også være skadelige fordi de reagerer med andre stoffer. Særlig kan ozon reagere og lage hydrogenperoksid (H2O2), som er et reaktivt og giftig stoff som må detoksifiseres i plantecellen.

9.4 Andre former for fotosyntese Fotosyntesen har oppstått i en tid da det ikke var oksygen til stede. Den første formen for fotosyntese antar vi brukte hydrogensulfid (H2S) som elektronkilde. Fotosyntetiserende bakterier er alle mikroorganismer som lever i vann som saltvann, ferskvann, pytter eller liknende. Bakterier er prokaryote organismer, som blant annet betyr at de ikke har noen organeller med egen membran rundt seg. I bakterier blir fotosyntesen derfor drevet av innbuktninger i celle­ membranen. Det finnes fortsatt bakteriearter som driver fotosyntese med bruk av H2S, for eksempel purpursvovelbakterier. Bakterien Halobacterium halobium har et fotosyntesepigment som er svært likt et fotopigment i øyet til mennesket, nemlig rhodopsin. Fotosyntese­ pigmentet heter da også bakterierhodopsin.

Noen arter, blågrønnbakteriene, har utviklet fykobiliosomer, som er små lysfangende blærer med pigmenter i. Disse bakteriene er aerobe og driver en fotosyntese som produserer oksygen. Også rødalger har fykobiliosomer. Det er et stort mangfold blant disse organismene. De har tilpasset seg fordi de for eksempel både kan ha organiske syrer som elektronkilde og samtidig bruke hydrogen eller hydrogensulfid. Noen kan også bruke svovel. Bakteriene har andre pigmenter enn alger og planter. Pigmentene kalles bakterieklorofyll (det er seks hovedtyper) og likner på klorofyll a og b hos planter. Reaksjonssentrene hos bakterier er annerledes og likner ikke på dem som er omtalt i 9.2. Bakteriene har også et annet absorpsjonsmaksimum. Svovelbakterier har for eksempel P870, mens det hos planter er P680 i fotosystem 2.


316 • Kapittel 9

Økologisk betydning av fotosyntetiserende bakterier Under anaerobe forhold blir organiske stoffer gjæret av forskjellige mikro­ organismer til ulike stoffer som CO2, H2, etanol, H2S, N2 og enkle fettsyrer. Men de hoper seg opp (akkumulerer) i økosystemet dersom de ikke ble brutt ned videre. En videre nedbrytning av disse stoffene gjør blant annet purpur­svovel­ bakterier og grønne svovelbakterier. Når vi også tenker på den enorme utbredelsen til disse mikroorganismene, er det ikke vanskelig å forstå at de spiller en svært viktig rolle i syklusen til grunnstoffer som svovel (S), nitrogen (N), karbon (C), fosfor (P) og hydrogen (H).

Sjekkpunkter: Nye ord og faguttrykk: oksidase, karboksylase, fotorespirasjon, mesofyllcelle, slirecelle, PEP-karboksylase, herbicid, detoksifisering, fotoinhibering Hvorfor må alger i sjøen ha ulike pigmenter for å drive fotosyntese i forskjellige soner? Hvorfor er rubisco årsaken til fotorespirasjonen? Hvilket enzym binder CO2, men lar seg ikke påvirke av oksygen? Hva er hovedforskjellen mellom en C4-plante og en CAM-plante? Hvordan hindrer DCMU fotosyntesen hos planter? Hva betyr fotoinhibering? Hvilke tilpasninger har en skyggeplante?


Fotosyntese • 317

Sammendrag • Sollys blir absorbert av ulike pigmenter slik at energien kan samles og føre til en eksitasjon av et elektron i fotodelen av fotosyntesen.

• ATP blir laget ved en utlikning av protongradienten over tylakoidmembranen. Protonene går gjennom enzymet ATP-syntase. Det kalles fotofosforylering.

• Fotosyntese = fotodel + syntesedel

• Giftstoffer og herbicider kan blokkere elektrontransporten i fotosyntesen.

• Fotosyntesen foregår i kloroplasten, fotodelen i tylakoidmembranen og syntesedelen i stroma. • Fotosystem 1 bruker lysenergi til å redusere NADP+ til NADPH og H+. • Fotosystem 2 bruker lysenergi til å spalte vannmolekyler og dermed produsere elektroner, protoner og oksygen. Oksygenet diffunderer ut av bladet, protonene blir brukt til å lage en proton­ gradient mellom lumen og stroma, mens elektronene erstatter de elektronene som eksiterer i det sentrale klorofyll a-molekylet. • Syntesedelen er syklisk og binder sammen CO2 og vann til glukose.

• Stor variasjon i lys, temperatur, vanntilgang og CO2 kan stresse planter. • Planter har tre ulike tilpasninger til samspillet mellom binding av CO2 og tap av vann. Disse er C3, C4 og CAM. • C4-planter binder og frigjør CO2 i forskjellige celler (slirecelle og mesofyllcelle), mens CAM-planten binder og frigjør CO2 til ulike tider av døgnet (natt og dag). • Fotoinhibering er at den samlede mengden stress på en plante er så høy at det resulterer i mindre fotosyntese enn vanlig.


318 • Kapittel 9

Oppgaver Tips til oppgavene finner du på www.gyldendal.no/bi 1 a Hva er energi? b Hvilke typer energi finner vi i fotosyntesen? c Forklar uttrykket energiovergang. 2 a Hva er lys?

7 Forklar begrepene i denne tabellen. Begrep Foton

b Hva betyr det at lys blir reflektert?

Antennekompleks

c Hvilke lysbølger reflekteres ikke av en rødalge?

Lumen

3 Tegn og forklar hvordan en plante kan utnytte lysenergi til å spalte vann og eksitere elektroner. 4 a Bruk figuren under til å forklare det elektro­ magnetiske spekteret.

Forklaring

Tylakoid Stroma Stivelse Foto­ fosforylering Karotenoider

b Lag en graf av a og tegn inn på figuren pigmentene som vil være typiske for en grønn plante. c Hvilke endringer måtte du ha gjort på figuren i b for at den skulle vise pigmentene til en rødalge?

CAM P700 Enzym som setter sammen ADP og Pi Enzymet rubisco inkorporerer oksygen i stedet for karbondioksid

5 Sett navn på denne figuren. Slirecelle

0613_Pigmenter

Produkt av kjemiske reaksjoner som er drevet av sollys, NOx og organiske komponenter 8 Bruk figuren øverst på neste side og skriv en forklaring på hvordan elektroner brukes til å danne en protongradient, hvordan fotosyntesen kan danne oksygen, og hvordan protongradienten kan utnyttes til å lage ATP. I forklaringen bør du også trekke fram hvordan kloroplasten er tilpasset de oppgavene du forklarer.

6 a Hvor i kloroplasten vil du finne fotosystemene?

0602_Kloroplastanatomi

b Hvordan er de ulike enhetene i fotosyntesen lokalisert? c Kan enhetene knyttet til FS 1 og FS 2 bevege seg? d Kan du tenke deg en årsak til at Fd-komplekset er plassert på yttersiden av tylakoidmembranen? e Hvor i kloroplasten dannes det stivelse?


Fotosyntese • 319

Elektronmottager

Elektronmottager

1

3

2 e-

2 e5

Lys

2 e-

Lys

4

P680

6

P700

Fotosystem 1

Fotosystem 2 0607_Fotodelen_1

9 Fyll ut dette begrepskartet: Fotosyntese

omformer

involverer bĂĽde

hvor

til

kjemisk energi

H2O splittes og

lagret som

hvor

gĂĽr gjennom

reduserer NAPD+ til

k

ed

u br

v

n ge

er

er

re

elektrontransportkjeder

ved bruk av

danner danner

ATP

og danner 2 triosefosfat

er

0504_Fotosyntese

av

danner


320 • Kapittel 9

Oppgaver 10 Karotenoider er pigmenter som brukes i fotosyntesen. Men de brukes og gir farge til mange andre plantedeler også. Gi eksempler på slike plantedeler og forklar hva som kjennetegner karotenoidene.

18 Kurven under viser døgnvariasjonen for en plantepopulasjon i Sør-Norge. Du får disse tilleggsopplysningene: Klokkeslett

Temperatur målt i °C

04.00

8

06.00

14

12 En plante som står i svakt lys, vil etter hvert tape vekt. Forklar hvorfor og hvordan dette skjer.

10.00

19

12.00

23

13 Forklar med figurer og tekst hva som er forskjellen mellom en C4-plante og en C3-plante. I besvarelsen må du også forklare hvilke fordeler en C4-plante og en C3-plante har, og nevne eksempler på arter som har dem.

15.00

25

18.00

18

24.00

10

11 Dersom du heller varmt vann over en brunalge, blir den grønn. Gjør forsøket, sjekk påstanden og forklar hva som skjer.

14 Forklar med figur hva som skiller en CAM-plante fra en C3- og en C4-plante.

Soloppgang klokken 04.30 Solnedgang klokken 19.30 Det var svært tørt under målingene.

15 Forklar med figur hvordan karbondioksid bindes, og at det kan dannes glukose hos planter. Du velger selv om du tar en C3-, C4- eller CAM-plante.

CO2-opptak

16 Hvilke(n) funksjon(er) har a lukkecellene

2

b rubisco

4

6

8

10 12 14 16 18 Klokkeslett

20

22 24

c glyceraldehyd-3-fosfat d stivelse a Merk av kompensasjonspunktene. Forklar hva disse punktene viser.

e karotenoider f eksitering av elektroner 17 I 1882 gjorde den tyske forskeren H.T. Engelmann et forsøk. Resultatet av forsøket hans er gjengitt nedenfor. Vann

Aerobe bakterier Tråd av grønnalgen Cladophora

400

500

600

Lysets 700 bølgelengde (nm)

a Forklar figuren. 0505_Grønnalge.pdf b Forklar hvorfor bakterien viser en slik spredning.

b Forklar kurveformen. (Hvorfor stiger kurven noen steder, mens den faller andre steder? Hvorfor ligger kurven over aksen noen steder og under aksen andre steder?)


Fotosyntese • 321

D er ATP dannet ved å omdanne glycerat-3-fosfat til triosefosfat

Fotosyntesehastigheten, målt som mm 3 CO2 cm -2t -1

19 Bruk figuren til å forklare de fire kurvene, A, B, C og D. Det er temperaturen og konsentrasjonen av CO2 som blir angitt. Legg vekt på hva som er de hemmende faktorene for netto vekst, altså fotosyntese.

E blir karbondioksid bundet av rubisco 22 Hva er rett?

300

D 0,13 % CO2

A Både fotodelen og syntesedelen av fotosyntesen foregår i stroma.

ved 30 °C

C 0,13 % CO2

225

B Fotofosforylering foregår i stroma.

ved 20 °C

C Calvin-syklusen foregår i grana.

150 0,03 % CO2 B ved 30 °C A 0,03 % CO2 ved 20 °C

75

0

1

2

3

4

D Dannelsen av ATP via kjemoosmose foregår i tylakoidmembranen. 23 Hvilke PÅSTANDER er gale? A Elektroner beveger seg gjennom fotosystem 1 og så fotosystem 2.

5 6 7 Lysintensiteten

B Syklisk fotofosforylering involverer kun fotosystem 1. 20 Hvilke(n) PÅSTAND(ER) er feil? 0507_Fotosyntesehastighet.pdf I fotodelen av fotosyntesen

C Vann splittes av lys, og oksygen slippes ut som et biprodukt.

A blir ATP brukt under syklisk fotofosforylering

D Syklisk fotofosforylering involverer både fotosystem 1 og 2.

B skjer det en kondenseringsreaksjon, og det dannes vann C er NADP+ oksidert

24 Hva er det kloroplasten ikke inneholder:

D blir klorofyll både oksidert og redusert

A Grana

E blir det dannet oksygen

B Stroma C Matriks

21 Hvilke(n) PÅSTAND(ER) er feil? I syntesedelen av fotosyntesen

D Tylakoidmembran

A binder pyruvat seg til ribulose-bifosfat og danner glycerat-3-fosfat

E DNA F Ribosomer

B blir NADPH + H+ oksidert under dannelsen av triosefosfat

A

Absorpsjon

0508_Lysets_bølgelengde.pdf

H Endoplasmatisk retikulum

B

Temperatur

Absorpsjon

25 Hvilke av grafene under viser absorpsjonsspektrum for fotosyntesen? Absorpsjon

Lysets bølgelengde

Lysets bølgelengde

C katalyserer rubisco dannelsen av ribulosebifosfat ved hjelp av karbondioksid

G Membraner

C

Lysets bølgelengde

D

Lysets bølgelengde


322 • Kapittel 9

Oppgaver 26 Forklar hvordan herbicidet paraquat og DCMU virker inn på fotosyntesen. 27 Hvilken nytte kan vi ha av å vite hvordan ytre faktorer som CO2-konsentrasjonen og lys virker inn på fotosyntesen?

Fotosynteseintensitet (glukose/min.)

28 Grafen nedenfor viser to forskjellige fotosynteseforsøk. Forsøk 1 skjer ved svakt lys, mens forsøk 2 skjer ved sterkt lys. For begge forsøkene øker temperaturen fra 0 til 40 °C. Forklar de to kurvene og årsakene til at de er forskjellige.

29 Mange hageplanter forekommer i mange varianter, med ulike farger og fargebrytning. Eksempler på dette er sibirkornell og brokekornell (hvitbroket kornell). Dersom disse plantene settes ut i en hage når de er jevnstore, vil sibirkornellen vokse raskere. Gi en forklaring på dette fenomenet. 30 Forklar hvordan disse fire stoffene inngår i fotosyntesen: ATP, karbondioksid, NADP og vann. Lag en skisse som viser hvor de inngår. 31 Figuren nedenfor viser variasjonen i O2-innholdet i det øverste laget av en innsjø i løpet av et døgn. Målingen ble gjort en dag det var stille og klart vær.

Forsøk 2 (sterkt lys)

a Bruk det du vet om fotosyntese og celleånding, til å gi en forklaring på kurven. b Lag en skisse av CO2-innholdet i vannet i den samme tidsperioden. c Hvorfor kan kraftig algevekst føre til oksygenmangel i en innsjø?

Forsøk 1 (svakt lys)

0

10

20

30 40 Temperatur i °C

0509_Fotosynteseforsøk.pdf

100 % oksygenmetning

Høyt oksygeninnhold

Lavt oksygeninnhold

Klokkeslett: 00

0605_Døgnvariasjon2.pdf

30 % oksygenmetning

02

04

06

08

10

12

14

16

18

20

22

24


Fotosyntese • 323

32 Eksamensoppgave, 2000 I celleåndingen og fotosyntesen inngår mange viktige hjelpemolekyler. Noen av dem er NADP, NAD, ATP og CoA (koenzym A). Velg ett av disse molekylene, og forklar så nøye du kan hvordan det fungerer, og hvilken rolle det spiller. Du skal ikke forklare hele celleåndingen eller fotosyntesen, bare de prosessene der det ene molekylet du har valgt, inngår. 33 Gjør rede for to faktorer som kan påvirke fotosyntesen hos en plante. Bruk figurer i besvarelsen din.

34 Eksamensoppgave, 2008 Hvor mange karbondioksidmolekyler må tilføres til enzymet RUBISCO (ved starten av den lysuavhengige reaksjonen) for å danne ett glukosemolekyl? A 2 B 3 C 4 D 5 E 6 35 Hvordan kan fotosyntesen i en levende plante påvises eller måles?

Nett-, gruppe- og presentasjonsoppgaver 36 Finn ut mer om fotosyntese hos bakterier og lag en framstilling av stoffet dere har funnet. 37 Velg et lysfangende pigment og finn ut mer om hvordan dette fungerer i en plante, og hvordan det blir dannet. 38 Lag en liste over andre stoffer enn vann som kan brukes som elektrondonorer i fotosyntesen. Velg så ett av stoffene og forklar hvordan dette fungerer som en elektrondonor, og hos hvilke organismer dette skjer. 39 Finn ut mer om hvordan enzymet rubisco blir satt sammen av proteiner fra både cytosol og stroma.

40 For å binde CO2 foreslår mange at skogen må få stå urørt. Drøft dette synspunktet og hent inn informasjon fra andre kilder. Vær kritisk til kildene dine. 41 Enkelte arter av for eksempel gran kan vokse raskere enn vår vanlige gran. Finn ut mer om disse artene, og drøft om vi i Norge burde plante slike granskoger. 42 I forbindelse med at matvareprisene går opp, diskuteres det nå om det er riktig å dyrke planter som kan brukes til å lage biodrivstoff. En måte å unngå dette på er å danne såkalt andregenerasjons biodrivstoff. Finn ut hva dette er, og hvordan fotosynteseproduktene blir brukt her.

Korte foredrag • Hvordan Melvin Calvin og hans • Biodrivstoff kollegaer fant ut hvordan planter – Hva er det? binder CO2 – Hva er lovverket i Norge og EU?

• Fotorespirasjon • Spalteåpningsapparatet


10

Bioteknologi

Ord og faguttrykk du bør kunne før du begynner på kapitlet

• enzymer

• ekson

• plasmid

• haploid

• genom

• diploid

• intron

Mål for dette kapitlet er at du skal kunne • gjøre greie for framstilling av genetiske fingeravtrykk, og hvordan de kan brukes i rettsmedisin og i studium av slektskap mellom individer og grupper av organismer • forklare hvordan genmodifiserte organismer kan framstilles, drøfte hvordan dette kan brukes i medisin, produksjon av mat og biologisk forskning, og hvilke følger det kan ha for miljøet • gjøre greie for den biologiske verdien av stamceller, forklare prinsippene for reproduktiv og terapeutisk kloning og drøfte etiske sider ved valg av ulike kilder for stamceller • formulere og drøfte problemstillinger knyttet til bruk av gendiagnostikk og genterapi på mennesker • forklare hvordan molekylærbiologi og genteknikker gir oss ny kunnskap om opphavet til arter og utviklingen av slektskapstre


326 • Kapittel 10

10

Knome, 23andMe og Mygenome er bare noen av de mange selskapene som tilbyr genetiske tester via Internett. Budskapet og triggeren er at kunnskap om genene og genomet ditt er genuin kunnskap om deg, til deg! På mange vis er dette riktig, men samtidig gir en genetisk test og en full sekvensering av genomet ditt også informasjon om foreldrene dine, om deres slekt og om dine mulige framtidige barn. Du får mye informasjon, ofte er den gitt som sannsynlighet for eller risiko for en sykdom. Spørsmålet blir om vi ønsker slik informasjon tilsendt og levert av en anonym kilde? Og hvor sikre er vi på lagringen av slike data? Bør vi ha flere genetiske veiledere i denne informasjonsjungelen?

10.1 Hva er bioteknologi? Bioteknologi er å bruke levende celler til å produsere et ønsket produkt. For oss kan det produktet vi ønsker, være mat, medisiner og andre kjemikalier. For eksempel er den velkjente kunsten å få gjær til å lage alkohol i øl og vin mer enn 8 000 år gammel. Det samme gjelder kulturer av melkebakterier som produserer yoghurt og utallige typer ost. Styrt befruktning av husdyr (avl) er heller ikke ukjent i historien. Vil du avle fram en hest som er rask til å løpe, velger du ut en hest av hvert kjønn som begge løper raskt. Tradisjonell avl er altså bioteknologi, men kanskje sjelden det vi mest forbinder med ordet i dag. Genteknologi er derimot teknikker som innebærer at arvestoffet blir isolert, karakterisert, modifisert og satt inn i levende celler eller virus. Fordi omtrent alt levende lagrer arvematerialet sitt som DNA og informasjonskodingen i DNA er universell, kan DNA i prinsippet overføres fra en hvilken som helst organisme til en annen organisme. Et gen som koder for et bestemt protein i en bakterie, gjør det samme om det kommer inn i en celle hos deg. Med genteknologi kan vi overføre DNA mellom organismer som ellers ikke ville ha utvekslet DNA. Dermed krysser vi de biologiske artsgrensene, og vi bestemmer hvilke arter som kan utveksle DNA med hverandre. Skillene mellom moderne bioteknologi og genteknologi er små, og i hverdags­ språket blir disse faguttrykkene brukt om hverandre. I teksten nedenfor betrakter vi genteknologi som en undergrein av den moderne bioteknologien. Et sentralt spørsmål i genteknologien er å få isolert et ønsket gen, overført dette genet, og at dette genet deretter blir uttrykt i høy grad i organismen. Utviklingen innenfor dette fagfeltet er enorm, og vi regner med at det bare de siste tjue årene har blitt samlet kunnskap og forståelse på dette feltet som faktisk tilsvarer hele historien til biologifaget.


Bioteknologi • 327

Kutte

Fem hovedmetoder/teknikker: kutte, oppformere ved hjelp av PCR, sette inn, oppformere ved hjelp av bakterier og identifisere. Disse fem verktøyene er mye brukt i bioteknologien i dag.

Oppformere (PCR)

Sette inn

Oppformere (bakterier)

Identifisere

10.2 Verktøy i arbeid med DNA For å arbeide med DNA må DNA-et først isoleres. Det er mange teknikker som kan brukes til dette, men felles er at cellene må ødelegges, og at DNA-et ofte blir felt ut som hvitaktige tråder. Dersom utfellingen gir nok DNA til videre undersøkelser, kan vi gå rett over til å kutte opp DNA-et. Er det derimot for lite, må DNA kopieres opp ved hjelp av PCR, se oppformere på side 331, før vi kan starte fra klippedelen.

Kutte DNA – bruk av restriksjons­ Kutte enzymer Restriksjonsenzymene er svært viktige i genteknologien. Slike enzymer kjenner igjen bestemte sekvenser i DNA-et, restriksjonsseter, og kutter DNA-tråden der. Du kan tenke deg restriksjonsenzymene som sakser som klipper på allerede bestemte steder i en DNA-tråd. Det gir stor presisjon og mange muligheter. Restriksjonsenzymer ble først oppdaget og analysert på slutten av 1960-årene. Enzymene stammer fra bakterier som bruker dem i forsvar mot virus som angriper dem. Slike virus kalles bakteriofager.

bakterio (lat.) – liten stav fagi (gr.) – sluking


328 • Kapittel 10

Restriksjonsenzymer ble isolert for første gang i 1968. Werner Arber, Daniel Nathans og Hamilton Smith fikk i 1978 nobelprisen i fysiologi og medisin for oppdagelsen av restriksjonsenzymer.

Et virus angriper en celle, uavhengig om den er prokaryot eller eukaryot, ved å sprøyte sitt DNA eller RNA inn i cellen. Metoden som viruset bruker, er generell, men selve viruset er ofte spesifikt for en bestemt eukaryot celle eller en prokaryot celle. Virus kan ligge skjult i vertscellens genom. 1 Viruset angriper en vertscelle. 2 Viruskapselen brytes ned. 3 Viruset legger sitt genom til vertscellens genom. Hver gang vertscellen deler seg og genomet kopieres, blir også virusets genom kopiert.

Virusgenom

Virus 1

Deler av viruskapsel Vertscellens genom

2 3

Vertscelle

endo (gr.) – inni nukle – kort form for nukleinsyre ase – indikerer enzym

1007_Virus2 Bakterier har svart på slike angrep ved å lage restriksjonsenzymer som altså kutter opp det fremmede DNA-et. De bakteriene som har denne egenskapen, har fått videreført flere av genene sine til neste generasjon. Restriksjons­ enzymene klarer å skille mellom cellens eget DNA og DNA-et til inntrengeren. Cellens eget DNA er modifisert på disse restriksjonssetene, og derfor kutter ikke restriksjonsenzymene der. Restriksjonsenzymer kalles også restriksjons­ endonukleaser. Det betyr at de er enzymer som har restriksjonsstedet sitt inne i et DNA-molekyl, se ordforklaring i margen.

For bioteknologien er restriksjonsenzymer like viktige som skalpellen og mikroskopet var det for de første fysiologer og anatomer. De gir oss mulighetene til å kutte DNA-et i bestemte biter og gir muligheten til å overføre og klone ett eller flere ønskede DNA-fragmenter i andre organismer, som ellers ikke ville vært mulig. palin (gr.) – tilbake dromos (gr.) – bane/vei

De fleste restriksjonssetene er mellom fire og ti basepar lange. Mange av restriksjonssetene er palindromer. De er altså ord som kan leses fra både venstre og høyre og fortsatt gi den samme meningen. Jentenavnet Anna eller guttenavnet Otto er eksempel på palindromer. Palindromer blir brukt i skjønnlitteraturen, for eksempel har Edvard Hoem skrevet en bok som heter «Ave eva». Finsk har verdens lengste enkeltordspalindrom, saippuakauppias, som betyr såpeselger på norsk.


Bioteknologi • 329

Restriksjonssete

G T A G A A T T C A T T C A C G C A C A T C T T A A G T A A G T G C G T Palindrom

G T A G

Restriksjonsenzymer. Restriksjonsenzymer kan framstilles som sakser som kutter på bestemte steder i DNA og danner fragmenter av DNA-tråden.

A A T T C A T T C A C G C A

C A T C T T A A

G T A A G T G C G T

Fragment 1

Fragment 2

Restriksjonsenzymet EcoR1 (leses Eko R én) er et slikt enzym. Det kjenner igjen denne sekvensen på DNA-tråden 5’ … GAATTC … 3’ 3’ … CTTAAG … 5’ Enzymet kutter mellom G og A i denne baserekkefølgen. Det er denne rekkefølgen av baser som er restriksjonssetet for EcoR1. EcoR1 har fått navnet etter den bakterien den har blitt isolert fra, Escherichia coli. Når et DNAmolekyl blir kuttet med EcoR1, blir det produsert små, overhengende DNAtråder etter kuttet, dersom denne sekvensen er i DNA-molekylet. Disse basene kan bare basepare med en komplementær basesekvens. Det blir utnyttet ved at både det ønskede DNA-fragmentet og stedet der det skal settes inn, blir kuttet med det samme enzymet. Det må også tilsettes et enzym som sørger for at det blir mulig for disse DNA-fragmentene å koble seg til hverandre med en kovalent binding. Det enzymet er en ligase og kalles ofte «limeenzymet». Ligase danner fosfodiesterbindinger mellom fosfat og OH-gruppen på sukkeret i et nukleotid. Dersom det på denne måten blir satt sammen en ny DNA-tråd fra ulike DNA-kilder, er det skapt et rekombinant DNA-molekyl. EcoR1 kutter svært ofte i de fleste genomene, og er derfor en viktig forsvars­arbeider for E.coli. Men det er en bakteriofag, T7, hvor denne sekvensen ikke forekommer blant dets 40 000 basepar store genom. Da sliter E.coli. i forsvar.

Det finnes flere tusen spesifikke restriksjonsenzymer som det i dag er mulig å kjøpe. Restriksjonsenzymer blir laget ved at genet som koder for enzymet, har blitt isolert fra organismen, klonet og masseprodusert i bakterier. Det er nå også mulig å kjøpe tørrenzymer som ikke må stå på is når vi jobber med dem, eller bli oppbevart ved –20 °C ved kortvarig lagring. Tørrenzymene kan oppbevares i romtemperatur. Dersom de skal oppbevares langvarig, bør alle andre restriksjonsenzymer lagres ved –80 °C. Det første rekombinante DNA-et som ble laget med bruk av restriksjonsenzymer og DNA-ligase, ble laget av Paul Berg i 1972.

ligare (lat.) – lime eller flette sammen


330 • Kapittel 10

Å skape rekombinant DNA. Et restriksjonsenzym binder seg til et restriksjonssete og kutter DNA mellom to nukleotider. Dersom det samme restriksjonsenzymet blir brukt på to forskjellige organismer, vil det bli dannet DNA-fragmenter som er komplementære til hverandre. Tilsettes enzymet DNA-ligase, kan fragmentene bindes sammen, og det dannes et rekombinant DNA-molekyl.

Restriksjonssete G A AT TC C T TA AG

DNA

Tilfør restriksjonsenzym G C T TA A

A AT TC G

A AT TC G

G C T TA A

DNA fra en annen organisme A AT TC

G

C T TA A

G

G

A AT TC

C T TA A

G

Tilfør DNA-ligase

Rekombinert DNA

Navn

Restriksjonssekvens

Type enzymer

→ GGATCC CCTAGG

HaeIII

GGCC CCGG

XhoI

CTCGAG GAGCTC

SmaI

CCCGGG GGGCCC

XmaI

CCCGGG GGGCCC

Palindrom endonuklease, som gir overhengende baser

BamHI

→ →

Palindrom endonuklease, som gir butte ender

→ →

Palindrom endonuklease, som gir overhengende baser

→ →

Palindrom endonuklease, som gir butte ender

→ Palindrom endonuklease, som gir overhengende baser

Restriksjonsenzymer. Tabellen viser noen vanlige restriksjonsenzymer og sekvensene de kjenner igjen i DNA. Pilene angir mellom hvilke baser enzymet kutter, og om det danner en rett kutteflate, eller om det blir fritt hengende baser.

Restriksjonsenzymer er en egen klasse enzymer fordi de utfører en klart definert oppgave. De kutter på bestemte steder inne i en nukleinsyre. Men ellers er de som enzymer «flest» – de har sin optimale temperatur, krav til pH-verdi og substratkonsentrasjon. Se kapittel 7 Metabolisme for mer om enzymer.


Bioteknologi • 331

Oppformere ønsket DNA – bruk av PCR

Oppformere (bakterier)

For å kunne jobbe videre med det ønskede DNA-et må vi være sikre på å få nok av det. Når vi skal kopiere det ønskede DNA-et, gjør vi det i all hovedsak med en egen teknikk, PCR, Polymerase Chain Reaction. Om det ønskede DNA-et er et stort fragment, kan det kopieres av organismer. Dette kan du lese mer om på side 333.

PCR (eng.) – Polymerase Chain Reaction

Utvikling av PCR har revolusjonert store deler av den molekylærbiologiske forskningen. Kary Mullis gjorde mye av arbeidet bak denne metoden og satte ideene om den ut i livet i 1985. Det var også han og hans forskningsgruppe som fikk den automatisert. Det er særlig to ting som har gjort at denne metoden har hjulpet forskningen framover. For det første kan en ved bruk av PCR isolere og analysere en liten bit DNA i en stor DNA-blanding, for eksempel i en blodprøve. Slik kan vi isolere og kopiere akkurat det DNA-et vi søker i blandingen. Det gir forskere og etterforskere en stor mulighet til å være spesifikke. For det andre kan metoden også brukes til å kopiere DNA fra et svært lite materiale, som hår og celler. Den kan også kopiere DNA fra gammelt vev fra mumier eller annet godt bevart dødt materiale. For å kunne jobbe videre med DNA-et, enten vi vil kutte i det, klone det eller kartlegge det, må vi ha en viss konsentrasjon av det. Til dette er PCR en svært effektiv metode. PCR bygger på det samme prinsippet som finner sted i DNA-replikasjonen, se side 137. PCR-metoden kopierer rett og slett det gitte DNA-et utenfor cellen. Når du ser etterforskerne på TV blir overlykkelige over et hårfunn, er det utelukkende på grunn av PCR. Hår, sæd og hudceller inneholder DNA, men ikke i store nok mengder, så de må kopieres opp i et stort antall via PCR, før det rettsmedisinske laboratoriet kan analysere det og se om det kan være et bevis.

For å kunne kopiere DNA-et ved hjelp av PCR kreves det at vi kjenner en bit i hver ende av det stykket vi vil kopiere. Disse bitene blir endestykkene på de nye kopiene. Dersom vi har noen korte enkelttrådede DNA-stykker som er komplementære til de DNA-bitene som skal kopieres, kan enzymet DNApolymerase begynne jobben med å kopiere. Disse stykkene kalles primere, se side 332. En slik primer, eller oppstarter, er som regel tjue til tretti nukleotider lang. Med spesifikke primere kan vi kopiere bare de delene av DNA-materialet vi ønsker.

PCR-maskin.

primer (eng.) – å prege


332 • Kapittel 10

Nobelprisen i kjemi i 1993 ble tildelt Kary Mullis og Michael Smith for deres arbeider knyttet til DNA og PCR-syntese av det. Men en norsk forsker, Kjell Kleppe, la grunnlaget for metoden allerede i 1970-årene. Han hadde da vist de grunnleggende prinsippene i metoden, at et lite, syntetisk DNA ble duplisert ved bruk av to primere og DNA-polymerase. Deretter ble reaksjonsblandingen varmet opp, og ny primer og nytt enzym ble tilsatt. Kleppe døde i 1988, men flere forskningsmiljøer både i Norge og i verden for øvrig reagerte på at hans navn ikke ble trukket fram ved tildelingen.

PCR er en prosess som blir repetert flere ganger. Repetisjonene kaller vi sykluser. Det er tre hovedtrinn i prosessen som gjentas i 25–35 sykluser i det samme reaksjonsrøret. Hovedtrinnene har en forhåndsprogrammert varighet, og temperaturen kan forhåndsbestemmes av den som programmerer maskinen. Den sykliske prosessen er denne: 1 Denaturering: DNA-dobbelttråden blir varmet opp (til ca. 95 °C) og blir til to enkelttråder. Dobbelttråden må skilles fra hverandre for at den enkelte DNA-tråden kan leses og kopieres. Hver av de opprinnelige DNA-trådene blir brukt som original for å lage en ny. 2 Påsetting av primere: Blandingen blir kjølt ned til ca. 60 °C. Primerne eller oppstarterne «limer» seg til hvert sitt startområde på DNA-tråden som skal kopieres. Dette skjer ved komplementær baseparing. 3 Forlengelse av DNA-tråden ut fra primerne: Blandingen blir varmet opp til 72 °C. Dette er en temperatur hvor den tilsatte DNA-polymerasen jobber best. Fra hver primer lages en ny DNA-tråd ved hjelp av varmestabil DNApolymerase og nukleotider. Polymerasereaksjonen, PCR, trinn for trinn. PCR er en rask og automatisert prosess for å kopiere opp en mengde DNA i et rør. Prosessen er tredelt, se teksten i figuren, og repeteres omtrent hvert 2–3 minutt. Veksten av DNA er eksponentiell, så prosessen er svært effektiv.

DNA

1

2

Primer

3

Et DNA-fragment er skilt fra hverandre ved høy temperatur

DNA-et kjøles, og primere binder seg til enden av DNA-fragmentene

1. syklus gir 2 molekyler DNA polymerase syntetiserer en komplementær tråd fra hvert nye adskilte DNA-fragment

2. syklus gir 4 molekyler, 22

3. syklus gir 8 molekyler, 23


Bioteknologi • 333

Det må benyttes en DNA-polymerase som tåler varme i denne maskinen. DNA-polymerase er et enzym som katalyserer dannelsen av en ny DNA-tråd med den gamle DNA-tråden som mal. Ved så høye temperaturer som det er i en PCR-maskin, vil vanlige enzymer denaturere. Det var også slik det var i begynnelsen av PCR-maskinens historie. Da ble det tilsatt nye enzymer mellom hver syklus. Men seinere har det blitt funnet en varmestabil DNApolymerase. Enzymet ble funnet i den varmekjære bakterien Thermus aquaticus og kalles Taq-polymerase. Med det varmestabile enzymet ble det mulig å helautomatisere prosessen og lage egne PCR-maskiner. PCR-maskinen er en meget effektiv kopieringsmaskin. DNA-et får eksponentiell vekst, noe som betyr at dersom et gen går gjennom 36 vellykkede sykluser i maskinen, får vi 236 kopier av genparet på det kromosomet. Det er hele 68 millioner kopier.

Sjekkpunkter: Nye ord og faguttrykk: bioteknologi, genteknologi, restriksjonsenzymer, restriksjonssete, rekombinant DNA, PCR, primer Hva er et restriksjonsenzym? Gi et eksempel på en palindrom sekvens. Hva er ligase? Hvilken ladning har DNA? Hva bruker vi PCR til? Hvilke tre hovedtrinn består en PCR-syklus av?

Sette inn ønsket DNA Sette inn

Når vi ønsker å sette et annet gen, eller flere samvirkende gener, inn i en organisme, må vi bruke en vektor. En vektor er en bærer av det ønskede DNA-materialet og fører det inn i en organisme der genet eller genene blir uttrykt. Typiske vektorer er plasmider, se figuren på neste side. Vi kan også bruke virus som vektorer. For å få vektoren inn i vertsorganismen må verten ofte bearbeides noe. Det er ikke selvsagt for en bakterie at den skal ta opp det DNA-et som måtte være i dens omgivelser. For å øke sannsynligheten for at et rekombinert plasmid skal bli tatt opp av en bakterie, blir bakterien behandlet først. Behandlingen består i å bryte ned deler av celleveggen, slik at det blir enklere å få plasmidet inn i cellen. Det kan gjøres på forskjellige måter, men både kjemiske metoder og bruk av elektrisitet i form av elektrosjokk er vanlig. Begge behandlingene gir bakterier som er svekket og redusert. Slike behandlede celler kalles kompetente celler. Kompetente celler tar lettere opp plasmider fra omgivelsene. Når plasmidet er tatt opp, legges forholdene til rette for at bakteriene kan vokse og dele seg. Dette kan du lese mer om på side 339.


334 • Kapittel 10

Bruk av bakterier til å produsere insulin ved hjelp av rekombinant DNA. Mange bakterier inneholder plasmidet med ønsket gen. Bakteriene produserer nå insulin som kan tappes fra bakteriekulturen (ikke vist på figuren).

DNA-fragment med menneskegenet for insulin

Bakterie med eget DNA

+

Kuttet plasmid-DNA

Rekombinant DNA-molekyl Plasmidet med ønsket gen tas opp i en bakterie

Bakterie med eget DNA + plasmid

Mange bakterier inneholder plasmidet med ønsket gen. Bakteriene produserer nå insulin

Vi kan også bruke en annen vektor, nemlig virus. Da benytter vi oss av virusets egne egenskaper for å overføre DNA-et. Virus infiserer nemlig celler med sitt arvestoff. Fordelen med å sette DNA inn i et virus er at vi kan sette inn store mengder DNA, og dermed potensielt klone store DNA-fragmenter. Virus er et viktig verktøy for å lage genbaserte vaksiner fordi virus kan få vaksine-DNA inn i cellene våre. Vi kan ikke gjøre alle cellene i et menneske kompetente i et laboratorium. Men celler kan utsettes for en elektrode og lokalt bli gjort kompetente. Setter vi vaksinen i en av de bearbeidete cellene, blir opptaket av den genbaserte vaksinen bedre. Når vi lager rekombinante plasmider med genet for insulin og overfører til bakterieceller, gjør vi det fordi vi ønsker at bakterien skal produsere proteinet insulin som medisin til diabetikere. Da «tapper» vi insulin fra store kulturer og rasjonaliserer framstillingen av medikamentet.


Bioteknologi • 335

Transformasjon av planter Transformasjon av planter innebærer at DNA-et fra en annen organisme blir overført til en plante. Hos planter kan DNA overføres direkte eller indirekte. Direkte genoverføring innebærer at ønsket DNA først må isoleres, så overfører vi det til planten. Tabellen under gir en oversikt over ulike metoder for direkte genoverføring hos planter. Vil du produsere en genmodifisert plante, ikke bare jobbe med celler, må de transformerte plantecellene dyrkes opp og differensieres til vev og organer. Det skjer ved hjelp av in vitro-teknikker, det vil si dyrking på vekstmedium i prøveglass, og videre i veksthus.

in vitro (lat.) – i glass

Oversikt over ulike metoder for direkte genoverføring hos planter. Fordi mem­ branen og celleveggen i plantecellene fungerer som barriere, er de fleste metodene basert på svekking av plasmamembranen og celleveggen, slik at genet kan trenge inn fra den omkringliggende løsningen.

Teknikk

Forklaring

Genkanon

Små metallpartikler dekket med DNA blir skutt inn i cellene.

Elektroporering

Cellene får påført en elektrisk puls som gjør at det blir laget porer som genene kan tas opp gjennom.

PEG-indusert opptak

Protoplaster blir behandlet med polyetylenglycol (PEG) slik at plasmamembranen blir permeabel, og DNA kan trenge inn.

Mikroinjeksjon

DNA blir sprøytet inn i en celle, eventuelt kjernen, ved hjelp av et tynt glassrør (se figuren på side 337).

Elektroforese

DNA blir støpt inn i agarosegel i et plastrør, som igjen blir festet til meristem, en vekstsone hos planter. DNA blir så overført til meristemene ved at det blir sendt en strøm gjennom planten. Negativ pol blir satt på meristem i skuddspissen, den positive polen på basis av planten. DNA er negativt ladet og beveger seg derfor mot den positive polen.

Silikonkarbid­ teknikk

Cellene blir blandet med skarpe fibre og DNA og rørt kraftig slik at det oppstår sår i cellene der DNA kan trenge inn.

Ultrasonisk lyd

Celler blir svekket ved hjelp av høyfrekvente lydbølger.

Laserperforering

Celler blir svekket ved hjelp av laserstråler.

Liposommediert genoverføring

Liposomer, små kunstige blærer omgitt av fosfolipider, frakter DNA inn i cellene ved endocytose.

Indirekte genoverføring betyr at en annen organisme overfører DNA-et. Som regel er dette bakteriene Agrobacterium tumefaciens, A.rhizogenes eller et virus. Virus er sjelden brukt. De mest utbredte overføringsteknikkene hos planter er Agrobacterium tumefaciens og genkanon, og vi skal derfor forklare disse to metodene nærmere. Genkanoner ble utviklet i 1980-årene som et redskap til å transformere enfrøbladede planter. Metoden ble utviklet fordi Agrobacterium ikke naturlig infiserer enfrøbladede, og fordi mange av de viktigste matplantene i verden nettopp er enfrøbladede. Metoden er vanlig å bruke for å transformere matplanter som mais, bygg, hvete og ris. Prinsippet er at mikroprosjektiler,

Krongalle på stengel. Planten er infisert av bakterien Agrobacterium tumefaciens og danner store utvekster som kalles krongaller.


336 • Kapittel 10

oftest kuler av gull eller wolfram, blir dekket med DNA og skutt inn i intakt plantevev eller cellekulturer. Partiklene får så høy fart at cellevegg og celle­ membran punkterer. Partiklene med DNA-et kan dermed trenge inn i cellene. Bruk av genkanon er en direkte genoverføring. Agrobacterium tumefaciens er en bakterie som naturlig infiserer tofrøbladede planter, og den blir derfor brukt til å transformere for eksempel potet, tomat og soya. Nå er det også utviklet bakteriestammer av Agrobacterium, som også kan infisere enfrøbladede planter. Agrobacterium er opprinnelig en jord­bakterie som utvikler svulster i planter. Bakterien overfører et eget plasmid (Ti– plasmid) til DNA-et i plantene. Det geniale her er at vi kan designe vårt eget plasmid-DNA med det genet vi har interesse av, sette det inn i bakterien og infisere planteceller med bakteriene. Transformerte skudd kan senere identifiseres ved hjelp av et markørgen, se side 339. a)

b) Agrobacterium-bakterie Bakteriekromosom

Genkanon Planteceller infiseres med Agrobacterium Mikropartikler av gull,dekket med DNA

Planteceller

Bakteriesuspensjon Sted hvor restriksjonsenzym kutter

T DNA

Planteceller

Overføring av DNA til planteceller

Plantecelle DNA integreres i plantecellenes arvestoff

Ti-plasmid

Restriksjonsenzym og DNA-ligase tilsettes

Plantecelle

DNA med gen av interesse

Rekombinant Ti-plasmid

Regenerering av planter fra genmodifiserte planteceller

Transformasjon av planter. a) Genkanon: Mikroprosjektiler blir dekket med DNA og skutt inn i planteceller, enten ved hjelp av komprimert gass, elektrisk utladning eller en sprengladning. b) Agrobacterium: Genet av interesse blir satt inn i isolerte Ti-plasmider, som igjen blir satt inn i bakterien. Den sykdoms­ framkallende evnen til bakterien fjernes. Deretter blir planteceller infisert med bakteriene. Bakterien blir dyrket sammen med plantevevet i tre–fire dager og deretter tilsatt antibiotika for å drepe bakterien. Når skuddene blir laget, tilsettes noe for å identifisere de transformerte skuddene. Hva som blir tilsatt, avhenger av type markørgen i plasmidet.


Bioteknologi • 337

Transformasjon av dyr Så godt som alt vi vet om regulering av gener hos mennesket, har vi fra forskning på mus og rotter. Det er derfor naturlig å bruke mus som eksempel på hvordan genteknologi blir brukt i dag, og hvilke muligheter det gir oss og alt har gitt oss. Mus er velegnet siden det bare tar ni uker fra en hunnmus blir født til hun kan føde nye mus. Hos dyr kan genoverføringen skje på én av to måter: ved mikroinjeksjon av DNA i befruktede egg eller modifisering av embryonale stamceller. Mikroinjeksjon av DNA i befruktede egg var den første metoden som ble brukt for å genmodifisere dyr, og det er også den vanligste metoden i dag. Det er en relativt enkel metode. Genet sprøytes inn i en befruktet eggcelle, se figuren, og egget blir satt inn i en surrogatmor. Injeksjonen må skje før sædcellen og eggcellens cellekjerner har smeltet sammen, altså før det er skapt en zygote. DNA-et må sprøytes inn i en av cellekjernene. Alle celler i det genmodifiserte avkommet inneholder da genet. Dersom det nye DNA-et ikke blir satt sammen med det DNA-et som alt er der, før etter et par celle­delinger, blir dyret Vektor bare delvis genmodifisert. Metoden kan brukes på alle dyr. Modifisering av embryonale stamceller er en mer komplisert metode og er foreløpig bare brukt på mus. Embryonale stamceller blir isolert fra musefostre, manipulert, satt tilbake i embryoet (< 50 celler), og embryoet blir overført til en surrogatmor. Avkommet har celler av to typer, opprinnelige og genmodifiserte.

Mikroinjeksjon av DNA. Bilde viser en metode for å overføre DNA-materiale. På bildet ser du en eggcelle hvor det føres DNA direkte inn i eggcellen.

Ønsket gen

Markørgen

1 Ønsket gen er inaktivert fordi det splittes av markørgenet Embryonal stamcelle fra mus

2 Vektor med ønsket gen og markørgen settes inn i en embryonal stamcelle 3 Ønsket gen fester seg til homolog sekvens i musekromosomet (det samme genet)

Knockout-mus. Teknikken baserer seg på at vi i en embryonal stamcelle erstatter et normalt gen med et defekt gen. Her benytter vi oss av såkalt homolog rekombinasjon, en prosess i cellekjernen knyttet til DNA-reparasjon. Den embryonale stamcellen blir så satt inn i et svært tidlig fosterstadium (blastocyst), som deretter blir satt inn i livmoren til en hunnmus. Ved videre avl framkommer mus der begge genvarianter i det aktuelle genparet er defekte. Det er laget knockout-mus for et stort antall ulike gener. Dersom vi krysser disse musestammene med hverandre, kan vi lage mus som er defekte på flere gener samtidig.

4 Rekombinasjon. Sekvensen som fester seg fra vektoren byttes ut med sekvensen fra kromosomet Inaktivert musegen Blastocyst Stamcelle

Utvikling og fødsel

5 Stamceller transplanteres inn i et museembryo

6 “Knock-out” mus


338 • Kapittel 10

Metoden kan brukes for innsetting av nye gen eller endring av eksisterende. For eksempel blir metoden brukt for å lage såkalte knockout-mus, framavlede mus der ett eller flere gen er slått av, det vil si mus som mangler normale kopier av genet (se figuren på forrige side). Knockout-mus gir forskerne mulighet til å undersøke funksjonen til et bestemt gen ved å studere hva som skjer når genet ikke er aktivt. Musene blir ofte brukt som modeller for humane sykdommer, for eksempel cystisk fibrose, og for utprøving av medisiner. Mer om stamceller finner du på side 353. Se også genterapi, side 347. Hybridgen er et gen som er satt sammen av DNA-fragmenter fra forskjellige gener og ofte også fra forskjellige organismer. I nærheten av den sekvensen på en DNA-tråd som koder for et protein, befinner det seg en regulerende sekvens for dette genet, se kapittel 4 Fra gen til protein. Når vi ønsker å få vite mer om hvordan denne regulerende sekvensen virker, kan vi sette den inn sammen med en kodende sekvens for et annet protein. Slik danner vi et hybridgen, se figuren under. Hybridgener blir ofte skapt med et protein som er enkelt å påvise i celler og vev. Det gjør det enklere å vite om genet er aktivt eller inaktivt, eller på/av. Hybridgenet setter vi inn i et befruktet museegg ved hjelp av mikroinjeksjon. Vi kan da sjekke hvordan det nye genet blir uttrykt i ulike celler og vev i musa. Vi kan også sjekke om genet blir uttrykt eller ikke under ulike, men styrte forhold som vi kan utsette musa for. Dannelse av hybridgen. Figuren viser hvordan man kan danne hybridgener. Metoden brukes særlig når genreguleringen skal undersøkes.

Genet med det regulerende DNA-et man ønsker å undersøke

Regulerende Proteinkodende DNA-sekvens DNA-sekvens

Bakterien som koder for et lett påviselig protein

Regulerende DNA-sekvens

Proteinkodende DNA-sekvens

Hybridgenet mikroinjiseres i befruktet museegg

Transgen mus

Sjekkpunkter: Nye ord og faguttrykk: vektor, kompetente celler, direkte genoverføring, indirekte genoverføring, hybridgen Nevn tre metoder for direkte genoverføring hos planter. Hva er en knockout-mus? Hva er et hybridgen?


Bioteknologi • 339

Oppformere DNA i bakterierOppformere (PCR)

Når en celle er transformert, enten fordi den har tatt opp et plasmid eller DNA har blitt skutt/sprøytet inn i den, trenger den hvile, næring og vekst. For bakteriene betyr dette stabil varme, næring og forsiktige bevegelser for å blande løsning og bakterier. I denne løsningen er det også en styrt seleksjon. Det er bare de bakteriene som har tatt opp det ønskede DNA-et, som får leve videre.

Identifisere ønsket DNA Bruk av seleksjonsmarkører

Identifisere

For å kunne selektere for celler som har et ønsket DNA, må dette ønskede DNA-et også bære med seg en seleksjonsmarkør. En seleksjonsmarkør er for eksempel et gen som gir resistens mot antibiotika. Gjør vi det, kan vi luke ut og gi god behandling til de bakteriecellene som uttrykker genet eller de ønskede genene, fordi det er bare de som overlever. En seleksjonsmarkør kan også være genet for et fluoriserende protein. Det gjør det enklere å velge ut de koloniene av bakterier som uttrykker det genet vi ønsket. Legger du petriskålene med bakteriekolonier på en UV-lampe, se bildet, ser du tydelig hvilke kolonier som kan produsere fluoriserende protein og dermed også det ønskede genet.

Gelelektroforese Gelelektroforese er en svært vanlig måte å analysere DNA-et på. Den består av en gel, et gelelektroforesekar og en spenningskilde. I en gelelektroforese skiller vi DNA-fragmenter fra hverandre etter størrelsen. De ulike fragmentene er skapt under kuttingen med restriksjonsenzymer og er i gelen som ulike bånd, se bildet under. Det grunnleggende prinsippet i gelelektroforese er å utnytte at DNA er negativt ladet. Fordi DNA har negativ ladning, beveger det seg mot en positiv pol dersom det blir utsatt for et spenningsfelt. Det skjer i elektroforesekaret når bufferen, som blant annet består av salter, leder strøm i karet og over gelen. Da beveger DNA-et seg fra minuspolen mot plusspolen, og dermed gjennom gelen.

Å velge ut bakteriekoloni ved fluoriserende protein. Figuren viser bakterier som har fått satt inn genet for et fluoriserende protein og uttrykker dette. Ved å lyse med en UV-lampe under petriskålen kan man se de lysende koloniene av bakterier og vite at disse er transformerte.

Når DNA-et beveger seg i en gelelektroforese, beveger det seg gjennom et medium. Dette mediet er en gel som består av agarose. Agarose er en sukkerart som er isolert fra en alge. Prinsippet i tillagingen av denne gelen er det samme som når du lager dessertgelé hjemme. Du blander det tørre i en løsning, varmer denne, og kjøler den så ned igjen. Når løsningen er kald, har gelen stivnet. Når du tilsetter DNA-et til gelen, beveger det seg i den. Små DNA-fragmenter går raskest, mens de store DNA-fragmentene går saktere. Det skjer fordi agarosegelen fungerer som en rekke av flettede tråder med større og mindre rom i. De store DNA-fragmentene møter her større motstand, og derfor bruker de lengre tid på å bevege seg i det elektriske feltet enn de små fragmentene.

Gelelektroforese. Ferdig gel med mange ulike bånd med separerte fragmenter.


340 • Kapittel 10

Radiomerket DNA Det er også mulig å bruke radioaktivt merket DNA for å søke opp det ønskede DNA-et i en løsning. Det merkede DNA-et må være komplementært til det ønskede DNA-et. Merket DNA kalles ofte probe. For å bruke denne metoden må det først tilsettes en løsning som gjør alt DNA enkelttrådet, så tilsetter vi merket DNA, og det merkede DNA-et baseparer med ønsket DNA, se figuren. 1

Identifisering av DNA. 1 For å finne ønsket DNA i et genbibliotek må DNA ut av bakteriene og gjøres om til enkelttrådet DNA. 2 Radioaktivt merket enkelttrådet DNA (probe) tilsettes. Dette er det genet vi søker etter. 3 Det tilsatte radioaktive enkelttrådede DNA vil basepare med ønsket gen. Det er mulig å finne det ønskede genet fordi det er radioaktivt merket. For videre arbeid må radio­ aktiviteten vaskes ut.

3

2

Genbibliotek

T G A C

C

A G

A

T

T

A

A T

G

T

C

G

A

T

C

Sjekkpunkter: Nye ord og faguttrykk: seleksjonsmarkør, probe Hva er en seleksjonsmarkør? Hvilken ladning har DNA? Forklar hvorfor korte DNA-fragmenter beveger seg lenger enn lange i en elektroforesegel.

10.3 Genmodifiserte organismer (GMO) Siden DNA er et molekyl som er universelt, kan vi i prinsippet sette DNA fra en hvilken som helst organisme inn i en annen organisme. Organismer som er laget på en slik måte, har fått flere navn, for eksempel GMO og transgene organismer. GMO står for Gen Modifiserte Organismer. En genmodifisert organisme kan ha fått overført nye gener på forskjellige måter. Når vi sier at en organisme er transgen, betyr det at den har fått satt inn ett eller flere gener som organismen ikke hadde i utgangspunktet. Genene er satt inn på et tidlig tidspunkt, og genet er derfor til stede i alle celler i organismen. Det innebærer at disse egenskapene kan arves dersom organismen ikke er steril. En transgen organisme har fått satt inn gener fra en annen art, mens en cisgen organisme har fått satt inn gener fra samme art. Teknikkene som brukes for å danne transgene organismer, er ganske nye og har i hovedsak blitt brukt de siste tretti–førti årene. Når slike forsøk blir utviklet og forskerne undersøker mulige hypoteser om hva som kan skje eller ikke,


Bioteknologi • 341

bruker de svært ofte en modellorganisme. En modellorganisme er en organisme som er lett tilgjengelig, enkel å holde i live, har kort generasjonstid, et lite genom, og som de ofte allerede vet mye om. I genetikken og bioteknologien er bananfluer (Drosophila melanogaster), mus, vårskrinneblom (Arabidopsis thaliana), grønnalgen Chlamydomonas reinhardtii og nematoden Caenorhabditis elegans alle eksempler på slike modellorganismer. Modellorganismene danner grunnlaget for mer kommersiell bruk av genmodifiserte organismer. I 2002 ble nobelprisen i fysiologi/medisin gitt til Sydney Brenner, Robert Horvitz og John Sulston for deres oppdagelser knyttet til genregulering av organutvikling og styrt celledød i modellorganismen Caenorhabditis elegans, som er en nematode.

Organismer og forskningsområder.

Virus

Mye brukt til forskning på genregulering, transport av proteiner inne i en celle, infeksjoner og immunitet, genterapi og kreftforskning.

Gjær

Kontroll av cellesyklus, celledifferensiering og celledeling Sekresjon av proteiner og utvikling av membraner Aldringsmekanismer

Bananflue

Utviklingen av kroppsplan Celledifferensiering Genetisk kontroll av atferd Kreftgener Effekter av narkotiske stoffer og insektmidler

Mus

Utvikling av kroppsvev Funksjon til immunforsvaret hos pattedyr Utvikling og funksjon av hjerne og nervesystemet Modell for humane sykdommer, blant annet kreft Genregulering og nedarvingsprinsipper

Bakterier

Proteiner involvert i DNA, RNA, proteinsyntesen og metabolismen Genregulering, cellesyklus og forskning på ny antibiotika

Rundorm

Utviklingen av et kroppsplan Nervesystemet Programmert celledød Genregulering og kromosomstruktur Aldringsmekanismer Atferd

Vårskrinneblom

Utvikling av vev hos planter Cellebiologi Plantefysiologi Genregulering Immunitet, forsvarsmekanismer mot infeksjoner

Sebrafisk

Utvikling av kroppsvev hos vertebrater Embryologi Kreftforskning Utvikling og funksjon av hjerne og nervesystemet

Modellorganisme. Bananfluen (Drosophila melanogaster) er en velegnet modellorganisme.


342 • Kapittel 10

Bruk av transgene planter Planter er fundamentet for alt levende på jorda, vi andre lever av det nærings­ overskuddet som plantene produserer og lagrer. Kan bruk av transgene planter gi oss et bedre miljø, mer mat og med det også en helseeffekt? Noen gløder for nettopp dette, mens andre mener at transgene planter kan gi oss nye miljøproblemer, og gi mennesker og andre dyr sykdom. Disse problem­ stillingene skal vi se nærmere på nå. Det er særlig tre hovedområder som er interessante når vi tenker på utnyttelsen og dannelse av nye transgene planter: • Endring av vekstmulighetene, for eksempel å gjøre planten motstandsdyktig mot insekter. • Endring av planten eller fruktens kvalitet, for eksempel å endre næringsverdien i den. • Bruk av planter til å produsere nytt materiale, for eksempel legemidler eller plast. Det er viktig å huske at svært få av disse plantene blir satt ut, de er i hovedsak til bruk for forskningen. Men transgene varianter av nytteplanter som mais, soya, raps og bomull blir produsert for salg på det ordinære markedet. Antallet transgene planter øker. I Norge må vi søke om og få godkjenning for å kunne dyrke transgene planter utenfor laboratoriet. Vi må også søke dersom vi vil importere spiredyktige nytteplanter til mat som mais og tomater. Også avskårne blomster må blomsterforretningen søke om tillatelse til å ha og selge dersom de er transgene, for eksempel nellik. I en eventuell godkjenning skal myndig­ hetene legge vekt på den transgene plantens bidrag til samfunnsnytte, etikk og bærekraftig utvikling. Det blir naturlig nok også tatt hensyn til plantens eventuelle helse- og miljøfare. Genmodifisert lilla nellik er i dag tillatt i Norge. I 2012 ble det dyrket transgene planter på ca. 171 millioner hektar på verdensbasis.

Genmodifiserte planter.

Planteart

Ny egenskap

Gendonor

Raps, tomat, tobakk

Toleranse for herbicidet glyfosat

Bakterien Salmonella typhimurium

Mais, tomat

Motstandsdyktighet mot insektangrep, Bt-genet

Bakterien Salmonella typhimurium

Raps

Endret sammensetning av endospermen for lettere å utnytte oljen i frøet

Gener fra bakterier, virus og andre planter

Tobakk, raps

Muligheter til å overleve i jord med kvikksølvforbindelser og å omdanne disse til mindre giftig fritt kvikksølv

Gen fra bakterie

Tomat

Langsommere modning

Gen fra virus, bakterie og andre tomatplanter


Bioteknologi • 343

Dersom en transgen plante som er fruktbar, blir satt ut i naturen, er det vanskelig å vite hvilke konsekvenser det kan få. Alle søknader må gjennom en grundig vurdering, men det er vanskelig å kunne se alle mulige konsekvenser. En mulighet for å hindre spredning av gener som vi ikke er sikre på hvordan de vil opptre i naturen, er å klone dem inn i genomet til kloroplastene. Pollen inneholder ikke kloroplaster, og dermed er spredningsfaren av en slik transgen plante kraftig redusert. Vi skal se nærmere på hvordan matplanten mais har blitt en transgen plante med egenskaper fra en bakterie. Resultatet er nettopp en maisplante som er resistent mot angrep av insektlarver.

Sjekkpunkter: Nye ord og faguttrykk: transgen, modellorganisme Hva kjennetegner en modellorganisme? Hvilke tre hovedområder er mest interessante med tanke på utnyttelse av transgene planter? Hva er utfordringene med bruk av transgene organismer/GMO?

Insektresistente transgene planter Mange planter blir angrepet og får bladene sine spist av insekter. Det er gjort beregninger som viser at kanskje en så stor andel som 30 % av avlingene i verden blir angrepet av insekter og andre skadegjørere. Dette ødelegger helt eller reduserer avlingene. Selv om denne beregningen skulle være for høy, ser vi tydelig at det ligger et stort potensial i å bedre verdens matvareproduksjon om vi kunne ha unngått eller redusert insekt­angrepene. For å få til dette begynte forskerne å jobbe med en spesiell bakterie, jordbakterien Bacillus thuringiensis. Den har lenge vært kjent for å drepe insekter. Derfor hadde også bønder allerede brukt jordbakterien som sprøytemiddel på infiserte områder. Bakterien inneholder nemlig et protein som i insektmagen tar livet av insektet gjennom å ødelegge fordøyelseskanalen. Fordi dette proteinet er giftig for insektene, kalles det Bt-toksin. Når vi kjenner et protein og dets struktur, er det mulig å komme fram til DNA-et som koder for dette proteinet. Når dette så kan isoleres fra bakterien, kan vi overføre genet til planten, som blir transgen med resistens mot insektangrep, se figuren på neste side. Både mais- og tomatplanter har i dag fått satt inn genet for Bt-toksin og overlever et insektangrep. Det proteinet som blir skapt, og som til slutt ødelegger tarmen til insektlarven, er ikke skadelig for mennesket fordi vi har andre celler i vårt tarmsystem.

Bakterien Bacillus thuringiensis (Bt) lager proteiner som dreper insekter. Disse proteinene er farget lilla på bildet. Genene for disse giftige stoffene er nå satt inn i mange planter og gjort dem til transgene planter som vil overleve et insektangrep.


344 • Kapittel 10

Angrep av insekter

Planten skades og dør ofte

Vanlig plante

En transgen plante kan overleve et insektangrep. En transgen plante som inneholder Bt-toksin-genet fra Bacillus thuringiensis vil produsere et giftig protein, Bt-toksinet. Det hindrer alvorlig angrep ved at de spisende insektlarvene dør. Mennesker reagerer derimot ikke på disse proteinene.

Produksjon av Bt-toksin Bt-toksin-gen i plantecelle Angrep av insekter

Transgen plante med innsatt Bt-toksin-gen

Planten motstår angrep fra insekter

Hvem dyrker transgene planter? I verdens landbruksproduksjon er det særlig fire planter som er dyrket mye, og som også er transgene. Det er soya, bomull, raps og mais. I soya er over halvparten av genomet modifisert. Av all soya som ble dyrket på verdensbasis i 2012, var om lag 80 % genmodifisert. Store land som USA, Kina, Argentina, Brasil og Canada dyrker flest transgene planter, men også i Europa gjøres dette. I Spania dyrker de for eksempel transgen mais. Både i EU og i Norge må en gjennom en omfattende søknadsprosedyre for å få godkjenning for å dyrke en transgen plante. Forskning på, og dyrking av, transgene planter kan knyttes til det storpolitiske spillet i verden. Det er svært ofte private institusjoner som forsker og får patent på en slik plante, men den blir dyrket i U-land. I USA dyrker de i dag stadig flere transgene planter. Når vi samtidig vet at de samme institusjonene ofte har rettighetene til å produsere gjødsel og sprøytemidler for de plantene som blir dyrket, ser vi at mye av makten havner i multinasjonale selskaper med hoved­ sete i Vesten. Et interessant tilfelle her er Zambias reaksjon på matvarehjelpen fra USA i 2002–2003. Myndighetene i Zambia stilte en rekke spørsmål til myndighetene i USA om den transgene maisen de fikk tilbud om som nødhjelp. Spørsmålene dreide seg først og fremst om mulige helseeffekter, og om mulighetene for at frø fra nødhjelpen ville kunne ødelegge landets egen­ produksjon av mais. Zambia eksporterer nemlig mye av sin mais til land som er skeptiske til transgene planter. Zambia fikk ikke noe svar og nektet å ta imot matvarehjelpen. Dette eksemplet belyser også en annen diskusjon, nemlig om slik nødhjelp er utelukkende for å hjelpe befolkningen ut av en krisesituasjon,


Bioteknologi • 345

eller om den også blir brukt for å få nye markeder for produktene sine. Den viser også at kunnskapen rundt transgene planter må økes. Hadde for eksempel myndighetene malt opp maisen og delt den ut til de sultende under kontrollerte forhold, ville ikke maisen hatt noen økologiske konsekvenser. En stor utfordring ved å bruke sprøytemiddelresistente planter til matproduksjon er at vi fortsatt ikke kjenner helt sikkert hvilke konsekvenser det får eller kan få at en transgen plante for eksempel uttrykker et modifisert bakteriegen, og hvordan dette eller disse proteinene kan påvirke den biologiske responsen i planten. I desember 2013 offentliggjorde Bioteknologinemnda en rapport, Sprøyte­ middelresistente genmodifiserte plantar og berekraft. Rapporten er gratis og kan lastes ned eller bestilles via Bioteknologinemnda.

Bruk av transgene dyr Transgene dyr blir i hovedsak produsert med to ulike metoder. Den ene er å bruke mikroinjeksjon, og den andre er å bruke embryonale stamceller. Stamceller, se side 353, er celler som ikke har blitt spesialisert, og som dermed kan spesialisere seg til det organismen måtte trenge. Det betyr at når vi benytter mikroinjeksjon, tilfører vi nytt DNA, mens vi også kan endre på de genene som allerede er i cellen, dersom vi bruker embryonale stamceller. Metoden er mer komplisert enn mikroinjeksjon, og den har også skapt mer debatt. Du lærer mer om stamceller og hvordan vi kan bruke dem hos mennesker, i 10.5 Stamceller. Noe av det mest fascinerende med genene våre er hvordan de blir regulert. Dette er fortsatt et felt vi vet lite om, men vi har fått ny kunnskap, blant annet ved bruk av transgene dyr. Det gjør at vi kan bruke transgene dyr som modeller for å • forske på kjente sykdommer • studere genregulering • studere den biologiske funksjonen til gener som gir sykdom, og andre gener ved å tilføre eller fjerne genet • bruke dem som organdonorer • bruke dem som produsenter av viktige medisiner I Bi 1 skrev vi om organtransplantasjon og mangel på organdonorer. En organdonasjon er svært kompleks fordi immunsystemet hos mennesket straks støter fra seg noe som det oppfatter som en inntrenger i sin egen kropp. Og et organ som ikke er laget av egne celler eller celler svært like ens egne, blir oppfattet som en inntrenger. Disse avstøtningsmekanismene er vanlige ved donasjon mellom mennesker. Forskere har prøvd å bringe fram en ny løsning ved å bruke transgene dyr som organdonorer. Transgene dyr er en mulig løsning på organmangel, men ikke på avstøtningsproblemet. Overføring av organer mellom dyr og menneske kalles xenotransplantasjon. Når vi setter inn gener fra mottakeren av organet i donordyret, håper vi å forhindre eller dempe


346 • Kapittel 10

den avstøtningsmekanismen som kroppen automatisk har mot noe ukjent. Det er gjort slike forsøk ved å sette inn et grisehjerte i en bavian. Men resultatene viser at bavianen ikke godtar det nye organet og dør etter bare noen dager til tross for at det nye organet har noen av bavianens egne gener. Forsøkene viser også at dersom grisehjertet ikke hadde fått innsatt genet fra bavianen, ville den ha dødd i løpet av få timer på grunn av en mer massiv avstøtning av organet. Slike forsøk er komplekse både fordi donordyret må fødes og leve i et sterilt miljø, og fordi forskerne er redde for at det kan være sovende virus i donordyrets genom. Dersom det er tilfellet, er et smittet menneske en fare for en hel befolkning. Det er for tiden midlertidig stans i slike forsøk, i hvert fall i Norge. Transgene dyr kan også brukes til å produsere enkelte medisiner. En skotsk forskergruppe lagde sauen Tracy, som skiller ut medisin i melken sin. Medisinen er alfa-1-antitrypsin og blir blant annet brukt mot alvorlige lungesykdommer. Sykdommene skyldes et recessivt gen på kromosom nummer 14. Årsaken til at Tracy kan skille ut denne medisinen i melk, er at forskerne har laget et hybridgen. Dette hybridgenet består av en reguleringssekvens fra sauens melkekjertler og et gen fra mennesket. Under ser du en tabell med flere slike medisinproduserende transgene dyr. Alle skiller de ut stoffene i melken sin. Transgene dyr kan brukes til å produsere medisiner.

Dyr

Stoff

Bruk

Genopphav

Sau

Koaguleringsfaktor lX

Medisin til blødere

Hybridgen menneske og sau

Gris

Koaguleringsfaktor Vlll

Medisin til blødere

Hybridgen menneske og gris

Geit

Antitrombin lll

Medisin ved fare for blodpropp

Hybridgen geit og menneske

Mange av proteinene hos høyerestående dyr er komplekse og krevende å lage. Dette er en av grunnene til at det er en fordel å bruke transgene dyr til dette, fordi for eksempel bakterier ikke har den samme muligheten til modifisering av proteiner som sau eller geit. Bakterier er prokaryote celler, og dermed har de ikke de samme biokjemiske forutsetningene som en eukaryot celle. Og store dyr gir mye melk og har dermed en høy produksjon av medisinen. Utilsiktede problemer kan oppstå når det blir satt gener fra en prokaryot inn i en eukaryot celle. Ovariene hos hamster blir brukt til å produsere rekombinant menneskelig erythropoetin, rhu-EPO. EPO har vært sentralt i mange dopingskandaler i idretten.


Bioteknologi • 347

Andre produkter fra moderne bioteknologisk virksomhet Teknikkene og organismene som kan brukes til å lage ulike genprodukter, er relativt lett tilgjengelige i dag. Det betyr at mye av det vi omgir oss med i hverdagen, er laget av bedrifter med bioteknologi som verktøy. De aller fleste enzymer i vaskepulver er framstilt ved bioteknologi. Det har også gitt oss muligheten til å endre på disse enzymene slik at de for eksempel kan ha lavere temperaturoptimum. Det har igjen mye å si for energibruken i samfunnet. Enzymer som insulin og laktase blir også produsert ved bruk av genmodifiserte organismer. Det er til og med laget enzymer som kan tilsettes blekings­ prosessen av papir slik at mengden klor kan reduseres kraftig. Genmodifiserte organismer kan også danne andre kjemiske produkter, som antibiotika og aminosyrer. Mange aminosyrer blir brukt som smaksforsterkere, i kosmetikk, til medisinsk bruk og to av dem også som antioksidanter. I renseanlegg benytter en mikroorganismer som kan gjøre giftstoffer om til mindre giftige forbindelser. Mange av disse er genetisk modifisert.

Sjekkpunkter: Hva er en insektresistent transgen plante? Hvilke nytteplanter har blitt genetisk modifisert? Hva er fordelene og ulempene med eventuelt å bruke transgene dyr til organdonasjon? Nevn to hverdagslige produkter av bioteknologisk virke.

10.4 Genterapi og gentester Genteknologi kan nyttes for diagnostisering og til behandling av mennesker og i teorien andre organismer. Bruken av genteknologi i medisin har for alvor skutt fart i debatten og informasjonen knyttet til alle de mulighetene vi må ta stilling til med denne kunnskapen. Med muligheter følger også ansvar og valgmuligheter. Det kan gi oss etiske dilemmaer. Med kunnskap om hva en gentest er, og hva genterapi er og kan være, kan de etiske sidene ved bruken av denne kunnskapen diskuteres.

Genterapi Genterapi er å behandle et gen som ikke fungerer som det skal i pasienten. Det kan være defekte gener, eller det kan være at vi bare har én utgave av genet som er funksjonelt. Genterapi kan også brukes dersom genet mangler. Det er gjort mange forsøk med genterapi, og ett av dem er på fedme hos mus. Hos mus fant en at de som spiste mye mer mat enn nødvendig, ikke uttrykte proteinet leptin. Leptin har den funksjonen at det regulerer matlysten. Forskerne


348 • Kapittel 10

klarte å behandle det defekte genet, og musen fikk normalt nivå av leptin. Dette ble gjort ved å bruke virus som en vektor. Det friske genet ble satt inn i et virus, og viruset overførte det til musa. Genet ble så uttrykt i musecellene. Hos mennesker blir det fortsatt gjort forsøk med genterapi, og svært mye av dette gjøres på kreftsykdommer. En prøver å få immunsystemet til å reagere og angripe kreftcellene. Det er viktig å skille mellom genterapi på vanlige celler og genterapi på kjønnscellene. I det øyeblikket vi utfører genterapi på kjønns­ cellene, kan egenskapen nedarves. Slik terapi er forbudt i hele verden i dag. Vi skal se nærmere på tre strategier: å innføre en kopi av et normalt gen, å erstatte det muterte genet og å hemme et mutert gen i cellen. Det er viktig å huske at slik genterapi fortsatt er på utprøvingsstadiet og viser seg å være komplisert å få gjennomført i celler. Når vi innfører et friskt gen, kan pasienten bli frisk eller friskere ved for eksempel recessive sykdommer som cystisk fibrose. Dersom genet blir tatt opp og uttrykt, blir det utviklet et funksjonelt genprodukt i cellen. Å hemme gener som gir sykdom eller kreftgener, betyr i praksis å forandre hvordan genet blir uttrykt. Derfor kalles dette oftere gensilencing enn genterapi. Vi endrer ikke på genet, men hvordan det blir uttrykt i cellen. Det kan gjøres på flere måter. Vi kan hemme avlesningen av genet ved å tilsette en kort tråd med nukleotider som kan binde seg til DNA-et på en slik måte at DNA-et endrer form og blir en DNA-trippelheliks. Genterapi ved hjelp av virus.

Virus Proteinkappe Inntrenging Celle

Cellens DNA Arvemateriale avdekkes Danning av dobbeltstrenget DNA fra virusarvematerialet Virus-DNA trenger inn i cellekjernen Virus-DNA integreres i cellens DNA

Cellekjerne


Bioteknologi • 349

Vi kan også hemme genuttrykket på RNA-nivå. Dersom vi lager en RNA-tråd som er komplementær til det mRNA-et som det omtalte genet produserer, er mRNA-et svært ofte ikke funksjonelt, og det blir ikke utviklet et genprodukt. Tilsvarende kan små RNA-fragmenter (siRNA, snRNA) og RNAi dempe genuttrykket i celler. Det er i gang forsøk med hiv-pasienter og bruk av RNA i demping av virusuttrykket.

Det er også mulig å tilsette ribozymer, som er RNA-molekyler som fungerer som enzymer. De kan lages slik at de kutter i mRNA som er laget fra det genet som gir sykdom. Dermed blir det ikke skapt noe produkt fra det genet. X-SCID er en sykdom som har blitt kurert ved hjelp av genterapi på mennesker. X-SCID er en alvorlig sykdom i immunforsvaret som gir svekket immunforsvar. Genet hvor denne mutasjonen oppstår, ligger på X-kromosomet. Men det er også enkelte pasienter som utviklet den alvorlige kreftformen leukemi av de som har fått slik terapi.

Bioteknologi og kreft Kreft skyldes celler som ikke følger normal cellesyklus. De deler seg betydelig raskere enn andre celler. Mange kreftceller gjør dette fordi et spesielt protein stadig forteller dem at de skal dele seg. Genet bak dette proteinet er rasgenet. Oppstår det en mutasjon i dette genet, blir det til et gen som stadig ber cellen dele seg. Gener som fører til en slik celledeling, kalles onkogener. I cellene våre har vi også naturlig gener som skal hindre en ukontrollert cellevekst. Når det oppstår mutasjoner i disse genene, fungerer de ikke, og det naturlige kreftforsvaret vårt er svekket. Et slikt gen, p53, blir gjerne omtalt som genomets vakt. Genspleiset retrovirus

Genterapi kan begrense utviklingen av kreft.

Injeksjon av genspleiset retrovirus i kreftsvulst i lungen

Pasientens egne p53-gener i cellekjernen er defekte.

VirusDNA

p53-gen Virus(innspleiset) DNA

Virus

Kreftcelle Cellekjerne

Arvematerialet fra viruset integreres i kreftcellenes arvemateriale. Krefcellen kan nå produsere p53-protein og slutter å dele seg ukontrollert


350 • Kapittel 10

p53-genet har det blitt forsket på, og det har blitt utført genterapi med dette genet som aktør. Når en satte genet inn i et retrovirus og infiserte kreftcellene med det, klarte en å overføre det friske genet til cellene, og kreftsvulsten bremset opp. Dette er genterapi.

Gentesting Dersom vi undersøker arvestoffet (DNA-et) til en person for å se hvilke gen­ varianter personen har, har vi utført en gentest. Genetiske tester eller gendiagnostikk utføres først og fremst for sjeldne, alvorlige sykdommer der det er en klar sammenheng mellom et bestemt gen og sykdommen. Enten utføres en kromosomanalyse (mikroskopi) eller en analyse av genene (DNA-elektroforese, sekvensering eller DNA-chip-analyse). I introduksjonen til dette kapitlet på side 326 kan du lese om hvordan mange av firmaene reklamerer for og selger produktene sine. Blir det tatt gentester i forbindelse med utredning eller behandling på sykehus, har vi som pasienter krav på samtale med en genetisk veileder. Skjermbilde fra en av de kommersielle aktørene som tilbyr gentester via Internett.

Arvelig kreft – brystkreft Brystkreft er en av de vanligste kreftformene hos kvinner. Det er forsket mye på denne kreftformen, og utsiktene for pasienten er ofte gode. Tre av fire kvinner med brystkreft blir friske igjen, og ca. 20 000 kvinner har denne diagnosen i Norge i dag. Det blir også ført store mammografiprogrammer for kvinner over femti år, slik at de kan få sjekke etter mulige kreftsvulster ved stråling av brystene. Det finnes forskjellige former for brystkreft, og vi skal her se nærmere på én av dem, nemlig den som kan arves. Den utgjør ca. 5 % av brystkrefttilfellene. Det er funnet to gener som gir brystkreft hos kvinner, og disse genfeilene er arvelige. De kalles BRCA 1 og BRCA 2. Antakelig finnes det flere gener som kan mutere og gi brystkreft. Kvinner som har arvet en mutert utgave av en


Bioteknologi • 351

genvariant, kan ha opptil 85 % risiko for å utvikle brystkreft. Det finnes i dag genetiske tester for kvinner som antas å være i risikogruppen. Men som for alle typer genetisk testing finnes det spørsmål om hvem som skal få tilgang til informasjonen. Har for eksempel kvinner som har fått brystkreft, en moralsk plikt til å teste seg slik at de kan informere eventuelle andre kvinner i familien som kan være bærere av genet? Skal for eksempel arbeidsgiveren din kunne kreve å få vite om du har høyere risiko for å få brystkreft enn andre? Det siste er forbudt i Norge i dag.

Gentesting av befruktede egg Preimplantasjonsdiagnostikk, PGD, er en genetisk undersøkelse av befruktede egg utenfor kroppen før egget blir satt inn i livmoren. Slik gentesting kan brukes for å sørge for at barn ikke arver en alvorlig sykdom. Det kan også brukes til å få redningssøsken, barn som kan være donorer for syke søsken. Verdens første «PGD-barn» ble født i England i 1990. I Norge ble PGD tillatt fra 1. januar 2008 der én eller begge foreldrene er bærere av en alvorlig arvelig sykdom og det er stor fare for at sykdommen kan overføres til et kommende barn. For å bruke PGD må paret benytte seg av prøverørs­ befruktning. Vanligvis injiseres en sædcelle i en eggcelle ved mikroinjeksjon, og når det befruktede egget er på 8-cellerstadiet, blir en–to celler fjernet, og det aktuelle genet blir undersøkt der. Egget tar ikke skade av denne behandlingen. Av de zygotene som ikke har genfeilen, blir ett eller to satt inn i kvinnens livmor.

Fosterdiagnostikk

1 Egget befruktes av en sædcelle utenfor livmoren, i et glass

2 Den befruktede eggcellen deler seg til et embryo bestående av få celler

3 En celle tas ut fra embryoet og testes for en mutasjon. Embryoet oppbevares i fryseren

Å stille diagnoser hos fosteret kan gjøres ved å ta ut fostervann eller en morkakeprøve. En slik test øker risikoen for spontanabort. I prinsippet kan det testes for alle sykdommer, men i Norge er det primært Huntingtons sykdom og cystisk fibrose det har blitt sjekket for. Slike tester kan gjøres tidlig i svangerskapet, slik at muligheten til å velge bort et sykt barn er reell. I en slik fosterdiagnostikk har foreldrene krav på genetisk veiledning. Det utføres også testing for Downs syndrom, spesielt for par hvor kvinnen er i siste del av trettiårene eller eldre.

4 Hvis testen viser at embryoet ikke har den mutasjonen den er undersøkt for, implanteres det i livmoren

Nye metoder for fosterdiagnostikk er under utvikling. Det gjelder metoder som særlig senker risikoen for spontanabort. En kan benytte foster-DNA som sirkulerer fritt i morens DNA. Det åpner for at vi i teorien kan teste hele fosterets genom, noe som gir en rekke nye etiske utfordringer. Preimplantasjons­ diagnostikk


352 • Kapittel 10

DNA-bibliotek og mikromatriser (chip) Å vite hvilke gener som blir uttrykt i ulike faser av sykdommen, gjør det mulig å diagnostisere, medisinere og kanskje på lengre sikt få til en genterapi for lidelsen. DNA-biblioteker kan bidra med data til dette. Et DNA-bibliotek er en base med ulike DNA-fragmenter som allerede er kuttet opp og satt inn i forskjellige organismer. DNA-chiper kan også brukes i gentesting for å sjekke hvilken genvariant en person har av et bestemt gen. Teknologien gjør det mulig å sjekke enormt mange gener på en gang. Hastigheten på sekvenseringen av DNA-materiale er nå så høy at det i større og større grad er mulig å få ferdig sekvenserte sekvenser av DNA-et, eller det komplette DNA-et i en celle. Disse sekvensene kan lagres som små DNA-chiper, se under.

DNA-chip Et viktig mål for biologer er å finne ut hvordan gener fungerer sammen, slik at de utvikler og opprettholder en funksjonell og frisk organisme. Siden hele genomer nå er sekvensert, oppstår nye muligheter. Gensekvenser kan brukes til å undersøke om gener er aktive eller inaktive i bestemte celler eller vev, under bestemte miljøbetingelser, i ulike sykdomsstadier eller i ulike utviklings­ stadier. Slike studier av genuttrykk gjøres ved hjelp av DNA-chiper (mikro­ matriser) som er enda et eksempel på mer moderne teknologi. En DNA-chip er en tynn liten glassbrikke på størrelse med et SIM-kort, der det sitter tett i tett med små enkelttrådede DNA-biter. Ideelt sett representerer disse DNA-bitene alle genene til en organisme. Vi vet nøyaktig hvilke gener som sitter hvor på chipen. En lang rekke DNA-chiper kan nå bestilles over Internett. a) DNA-chip. a) Bildet viser en DNA-chip (mikromatrise). b) Bildet viser en forstørrelse av resultatet etter tilsetting av DNA på en DNA-chip.

b)


Bioteknologi • 353

En nyere type chip er nå utviklet takket være framskritt i mikroskala væskemekanikk. Den nye teknikken gjør det mulig å avsløre sykdommer på et svært tidlig stadium. Små brikker av silisium på størrelse med objektglass kan for eksempel fange opp sirkulerende kreftceller fra en blodprøve. En kreftsvulst hvor som helst i kroppen avslører nesten alltid seg selv i form av noen ganske få kreftceller som flyter rundt i blodet. På chipen er det etset inn et mønster med søyler. Søylene er belagt med et antistoff mot et protein som sitter tett i tett på overflaten av nesten alle kreftceller. Når blodprøven blir pumpet inn i chipen, binder derfor kreftcellene seg til søylene, og vi kan observere om det er kreftceller til stede, og hvor stor forekomst det er av dem. Slik «lab-on-a-chip»teknologi ser ut til å gi uante muligheter i tiden som kommer.

Sjekkpunkter: Nye ord og faguttrykk: genterapi, onkogener, preimplantasjonsdiagnostikk, DNA-bibliotek, DNA-chip/mikromatrise Hva er genterapi? Hvilke former for genterapi har vi i dag? Hva er preimplantasjonsdiagnostikk? Hva er en DNA-chip (mikromatrise)?

10.5 Stamceller Stamceller kan sies å være kroppens opphavsceller eller morceller. Når en stamcelle deler seg, blir det laget to ulike celler som likevel er genetisk identiske. Den ene forblir en stamcelle, mens den andre begynner å differensiere seg, se figuren på neste side. Vi kan derfor si at stamcellene har «evig liv», for de kan dele seg i det uendelige, i motsetning til vanlige celler, som har et begrenset antall ganger de kan dele seg. Denne begrensningen hos vanlige celler skyldes trolig måten DNA blir kopiert på. Før en celle deler seg, blir DNA kopiert ved hjelp av enzymet DNA-polymerase. Enzymet klarer likevel ikke å kopiere helt ut til endene på DNA-tråden, og dette fører til at kromosomene blir litt kortere for hver celledeling. På endene av kromosomene er det DNA-sekvenser som kalles telomerer. Telomerene kan sammenliknes med de forsterkede endene på skolisser som sørger for at lissene ikke fliser seg opp og blir ødelagt. Telomerene består av korte sekvenser som er repetert flere hundre ganger og sørger for å beskytte kromosomendene. Uten telomersekvensene blir kromosomene brutt ned fra endene og blir ustabile, og cellen dør til slutt. Noen få celletyper i kroppen har et enzym som kalles telomerase. Celler som har enzymet, får kontinuerlig forlenget telomerendene sine og kan fortsette å dele seg fordi endene aldri blir for korte til å beskytte kromosomet. Stamceller har et høyt nivå av telomerase. Vanlige celler har ikke telomerase, og en antar at det er hovedgrunnen til at de eldes etter hver celledeling.


354 • Kapittel 10

Nervecelle

Muskelcelle Befruktet eggcelle (diploid zygote)

Blodcelle

Bindevevscelle

MITOSE Celledifferensiering. Cellene spesialiserer seg ved at ulike gener blir uttrykt. Cellene inneholder derfor forskjellige proteiner. Før cellen spesialiserer seg er den en stamcelle.

toti – alt multi – mange pluri – flere

CELLEDIFFERENSIERING

Hvor finner vi stamceller? Stamcellene er uspesialiserte celler og opphavet til spesialiserte celler. Stamcellene har forskjellige egenskaper alt etter hvor vi finner dem. I mennesket finner vi stamceller i flere faser i den menneskelige utviklingen: i det befruktede egget, embryoet, fosteret og det fødte mennesket. Disse stamcellene har ulikt potensial, og vi skiller mellom tre typer: totipotente, pluripotente og multi­ potente stamceller. Totipotente stamceller finnes i befruktede egg fram til 8- eller 16-cellerstadiet. De har ubegrensede muligheter og kan gi opphav til et nytt individ. Når cellene deler seg videre og spesialiserer seg, blir det utviklet et embryo og deretter et foster. I embryo og i kjønnsorganene til fostre finnes pluripotente (embryonale) stamceller. De kan utvikle seg (differensiere) til hvilke som helst av kroppens over to hundre celletyper, bortsett fra morkakeceller. Embryonale stamceller kan også lages kunstig ved hjelp av kjerneoverføring. Multipotente stamceller er celler i et født individ som kan utvikle seg til et utvalg av spesialiserte celler. Vi vet ennå ikke hvor alle de multipotente stamcellene sitter i kroppen, selv om de er påvist i en rekke organer. De multipotente stamcellene som forskerne vet mest om, befinner seg i beinmargen og er de som lager blodceller. En alternativ kilde til multipotente stamceller er navlestrengsblod. Lenge trodde en at multipotente stamceller bare kunne lage én type celler, for eksempel at stamceller i leveren bare kunne lage leverceller, og at stamceller i beinmargen bare kunne lage blodceller. Nyere forskning viser derimot at de multipotente stamcellene har et større potensial enn antatt. Forskerne har for eksempel klart å få stamceller fra beinmarg til å lage nerve- og hjertemuskelceller, og nerve­ stamceller fra hjernen til å lage blodceller.


Bioteknologi • 355

Stamceller kan altså hentes fra ulike kilder: befruktede egg, embryo, fostre, fødte mennesker og embryo dannet ved kjerneoverføring. Etiske betenkeligheter knyttet til bruken av de ulike kildene har lagt begrensninger på forskningen. Det har derfor vært ønskelig å finne kilder til stamceller som er mindre etisk omstridt. Et stort gjennombrudd kom i 2007, da to uavhengige forskergrupper i Japan og USA klarte å produsere stamceller fra hudceller. Metoden gikk ut på å omprogrammere voksne celler ved å tilføre fire gener. Disse fire genene er normalt slått av etter at stamcellen har utviklet seg til en spesialisert celle. Disse genene ble nå aktivert igjen, slik at hudcellene fikk tilbake sine stamcelle­ liknende egenskaper. Videre manipulerte forskerne cellene til å bli til nerve­ celler og hjertemuskelceller. Etter at de fikk vokse i tolv dager, begynte små klumper med hjertemuskelceller å trekke seg sammen i laboratoriet. Det er nå høye forventninger til nye forskningsresultater innenfor stamcelleforskning, men før cellene kan brukes på mennesker, må det vises at de er trygge. Vi skal se litt mer på hva stamceller kan brukes til.

Hva kan stamceller brukes til? I prinsippet kan stamceller brukes til produksjon av alle typer celler og vev, muligens også organer. Det er denne egenskapen og evnen til å dele seg uendelig, som gir håp om at stamceller en dag skal kurere sykdommer. En ser for seg at skadet vev og defekte organer kan erstattes av nytt. For eksempel har forskere klart å lage en pumpende hjertemuskel og en nyre som skiller ut urin. Visjonene er at stamceller for eksempel kan reparere hjerteinfarkt, bekjempe leukemi, kurere Parkinson og Alzheimer, lage insulin og kurere diabetes, og reparere muskler og bein. Kanskje kan nye nerveceller erstatte ødelagte nerveceller, og også kurere lammelser. Foreløpig er metodene bare på forskningsstadiet, med unntak av én behandlingsmetode: multipotente stamceller fra beinmarg blir i dag brukt rutinemessig i behandling av blodkreft og andre blodsykdommer. Den første transplantasjonen med stamceller fra beinmarg ble gjort av professor E. Donnall Thomas i USA i 1959, og i Norge ble samme transplantasjon utført for første gang på Rikshospitalet i 1968. Stamceller fra navlestrengsblod kan brukes til nedfrysing eller donasjon. I navle­ strengsblodet finnes stamceller, som i framtiden kanskje kan brukes til å behandle alvorlige sykdommer. Forskning har dokumentert at disse cellene kan brukes i behandlingen av blodkreft, lymfekreft, medfødt immunsvikt og blodsykdommer. Foreløpig kan de bare brukes til behandling av barn som veier under tretti kilo, fordi det er for få celler i en navlestreng til å behandle voksne. I 1988 ble den første vellykkede transplantasjonen med stamceller fra navle­ strengen gjennomført i USA. I dag tilbyr flere private navlestrengbanker sine tjenester (tapping og nedfrysing) rundt om i verden. Den første private tappingen av navlestrengsblod i Norge skjedde på Haukeland sykehus i 2002. Et samlet norsk fagmiljø anbefaler likevel ikke å lagre navlestrengsblod for eget bruk fordi nytten er så usikker. Men i bioteknologien skjer det store framskritt på kort tid, og biologiske sannheter i dette faget har nå kort levetid.


356 • Kapittel 10

Potensiell bruk av stam­ celler til å behandle skadet vev. Totipotente menneskelige embryonale stamceller kan bli dyrket i laboratorium og differensiere seg til ulike celletyper. Å få fram slike cellevev for å erstatte skadet eller dødt vev forskes det mye på verden over.

Human blastocyst Indre cellemasse

1 Blastocysten dyrkes på et næringsmedium

2 Kjemikalier tilsettes slik at det blir tre celleklumper. Hver celleklump vokser til en koloni av embryonale stamceller 3 Forskjellige differensieringsfaktorer tilsettes de ulike koloniene

Koloni av bruskceller

Koloni av Koloni av celler fra de Langerhanske øyene hjertemuskelceller

4 Differensierte celler settes inn i skadet vev

Det er en stor fordel å bruke pasientens egne stamceller i behandlingen. De blir ikke avstøtt når de blir satt tilbake i pasienten. På den måten slipper pasienten å gå på immundempende medikamenter, medikamenter som skal hindre at de blir avstøtt resten av livet. Celler og vev med pasientens eget DNA kan også framskaffes ved terapeutisk kloning (kjerneoverføring), se side 359. Dersom sykdommen skyldes en genetisk defekt, hjelper det ikke å bruke pasientens egne stamceller. Embryonale stamceller er så langt de beste å arbeide med på grunn av det store vekstpotensialet deres. Embryonale stamceller viser stort potensial i dyreforsøk og er i dag et nødvendig forskningsverktøy. Multipotente stam­ celler er vanskeligere å masseprodusere. De finnes ikke overalt i kroppen, er få i antall, vanskelige å isolere og vokser langsommere enn totipotente og embryonale stamceller. Praktisk bruk av multipotente stamceller kan kanskje bli en større mulighet i framtiden.


Bioteknologi • 357

Sjekkpunkter: Nye ord og faguttrykk: totipotente celler, pluripotente celler, multipotente celler Hva er en stamcelle? Hva er en totipotent celle? Hvor kan vi finne stamceller hos mennesket? Hvor kan vi finne stamceller hos planter? Hvilke fordeler har det for pasienten å bruke hans eller hennes egne stamceller i behandlingen?

10.6 Kloning Å klone betyr å skape en genetisk identisk kopi av noe. Det kan være kopier av et gen, en celle eller en organisme. En slik samling av like kopier som har nøyaktig samme arvestoff, kalles en klon. En klon er identisk med opphavet, og klonene er identiske med hverandre. Dersom du dyrker opp bakterier på en agarplate og det utvikler seg små ansamlinger av bakterier, er hver av disse ansamlingene eller prikkene en koloni eller klon, med millioner av identiske bakterier dersom det ikke har skjedd mutasjoner. Uttrykket kloning blir altså brukt i forskjellige sammenhenger med noe ulik betydning. Både de etiske og de tekniske problemene er forskjellige avhengig av hva slags form for kloning det er snakk om, for eksempel om det gjelder gener, celler, planter, dyr eller mennesker.

Kloning av gener For å kunne undersøke hvordan et gen virker, trenger vi mange kopier av DNA-biten med genet. De vanligste måtene å klone gener på er ved hjelp av bakterier eller PCR, teknikker som alt er omtalt.

Kloning av celler Kloning av celler er en naturlig prosess som foregår hele tiden hos flercellede organismer. I en vanlig celledeling (mitose) får vi to celler med identisk arvestoff. De kan kalles en klon. I laboratoriet kloner forskere celler for å lære mer om hvordan celler og celledelinger fungerer. Mye av forskningen retter seg mot studier av stamceller.

Kloning av organismer Vi skiller gjerne mellom to former for kloning av organismer, reproduktiv kloning og terapeutisk kloning. Med reproduktiv kloning er målet å lage en kopi av en organisme. Det som er beskrevet ovenfor om kloning av planter, dyr og mennesker, handler om reproduktiv kloning. Med terapeutisk kloning er


358 • Kapittel 10

målet å kunne produsere celler, vev eller organer til medisinske formål. En benytter her kjerneoverføring, der kroppscellen blir hentet fra den pasienten vi ønsker å behandle. I stedet for at egget blir satt inn i en surrogatmor som under reproduktiv kloning, blir embryoet dyrket kunstig på laboratoriet. De embryonale stamcellene blir hentet ut og kan differensieres til alle typer kroppsceller, se figuren på neste side.

Kloning av planter Å klone planter har lange tradisjoner i landbruk og hagebruk. Særlig benytter vi oss av at planter kan formere seg ukjønnet. Vi dyrker fram nye poteter av én settepotet og har jordbærplanter som sprer seg med utløpere. Denne formen for nyproduksjon av planter kalles vegetativ formering og foregår uten at det blir skapt frø. De nye plantene er genetisk identiske med morplanten. Potetene i en potetåker tilhører således samme klon forutsatt at settepotetene har samme opphav. Selv om bønder ikke bruker kloningsbegrepet, er vegetativ formering en form for kloning. I laboratoriet kan enkeltceller og vevsbiter fra planter dyrkes opp til hele planter.

Kloning av dyr Kloning: Ved å sette et blad eller en del av en plante i vann vil det vokse fram røtter. Setter du så dette i jord, vil du lage en ny plante som er genetisk identisk med den planten du tok bladet/delen fra. Bildet viser stiklinger fra stueplanten fakkelblomst.

Kloning av dyr foregår både naturlig og i forskningsøyemed. Kloning er utført på virvelløse dyr som svamper, småmaneter, flatormer, noen havlevende leddmark og sjøstjerner. Kutter vi dem i biter, kan hver bit gi opphav til et nytt individ. Det er riktignok begrenset hvor mange biter vi kan dele et levende individ i før de ikke lenger klarer å regenerere hele individet. Dyr som svamper, nesledyr og mosdyr lager naturlige kloner når de formerer seg ved knoppskyting. Bladlus føder levende unger ved «jomfrufødsel» (partenogenese). Andre insekter og frosk har mennesker klart å klone. Pattedyr har det ikke vært like enkelt å klone, men etter at sauen Dolly ble født i 1996, har forskerne lyktes i å klone blant annet geit, gris, ku, hest, ape, hund, katt, kanin og mus. Teoretisk skulle det være mulig å etablere et nytt individ fra enhver kroppscelle hos alle dyr, ettersom cellen inneholder alle individets arveanlegg. Men det lar seg likevel ikke gjøre hos de fleste dyr siden en stor del av genene normalt blir inaktive etter svært kort tid under fosterutviklingen. Det er dette som er grunnlaget for differensiering av de ulike celle-, vevs- og organtypene i kroppen. Så langt har derfor forskerne måttet gå omveien om en eggcelle, og det er i hovedsak to teknikker som blir brukt for å klone dyr, embryosplitting og kjerneoverføring. Embryosplitting: Når egget deler seg etter befruktningen, kan vi fram til 8-cellerstadiet splitte embryoet opp i sine individuelle celler. Hver enkelt celle kan utvikle seg til et nytt individ hvis det blir satt inn i en livmor. Dette er en relativt utbredt teknikk i dyreoppdrett, og til tider skjer også prosessen naturlig slik at vi får eneggede tvillinger.


Bioteknologi • 359

Kjerneoverføring: Denne metoden gjør det mulig å klone et voksent individ. En vanlig kroppscelle blir tatt fra individet som skal klones. Kjernen fra kroppscellen blir satt inn i en kjerneløs eggcelle, og egget blir satt inn i en livmor, se figuren. Men mitokondriene fra eggcellen blir ikke fjernet, og siden mitokondriene inneholder DNA, er ikke avkommet hundre prosent genetisk identisk med individet kroppscellen ble hentet fra. Dette glemmes ofte når folk snakker om identitet hos kunstig klonede dyr. Kjerne­overføring er problematisk fordi mange klonede egg ikke utvikler seg, de dør eller gir foster med defekter. Det ble for eksempel brukt 277 celle­kjerner i forsøket med å lage Dolly. Av dette fikk forskerne 29 fostre, og bare ett eneste lam ble født. Eventuelle senvirkninger vet vi ennå lite om. Sauen Dolly ble avlivet i 2003 på grunn av en progressiv lungesykdom, men det er foreløpig uklart om sykdommen skyldtes at sauen var klonet.

Kjerneoverføring og kloning. Figuren viser kjerne­overføring brukt i reproduktiv kloning og i terapeutisk kloning.

Kjernen fjernes fra eggcelle

Somatisk celle fra voksen donor tilføres

Kjerne fra donorcelle

Embryo

Reproduktiv kloning

Embryoet settes inn i livmoren til en rugemor

En klon av donoren blir født

Kroppsceller (somatiske celler): alle andre celler i kroppen enn kjønnscellene (sædceller og eggceller)

Terapeutisk kloning Embryonale stamceller fra embryoet dyrkes i kultur Stamcellene gis ulike vekstfaktorer og spesialiserer seg f.eks. til muskelvev, nervevev


360 • Kapittel 10

Tvillinger. Bildet viser to ett år gamle eneggede tvillinger. Likt DNA, men ikke helt like likevel.

Årsaken til at forskere ønsker å klone dyr, er at det kan gi dem tilgang til genetisk like forsøksdyr, slik at sikrere resultater kan oppnås med færre forsøks­dyr. Andre ønsker å reprodusere individer med spesielt ønskede gener, for eksempel utryddingstruede arter, premieokser eller genmodifiserte dyr som produseres til medisinsk bruk. Det finnes også privatfinansierte forsknings­ prosjekter som har som mål å klone høyt elskede kjæledyr. Kloning av mennesker er i teorien mulig ved hjelp av kjerneoverføring, selv om det er etisk uakseptabelt og er forbudt i Norge og i de fleste andre land. Om det er lettere eller vanskeligere å klone mennesker enn andre dyr, vet vi ikke i dag. Det er flere forskningsgrupper som har erklært at de har klonet mennesker, og flere babyer har visstnok vært på vei, men ingen har ennå vist fram et klonet barn. Noen vil kanskje tro at et klonet menneske gjenskaper en persons egenskaper, personlighet og handlinger, men det beror på misforståelser. To kloner deler bare det samme arvestoffet og er ikke mer like enn eneggede tvillinger. Klonene utvikler i tillegg forskjellige trekk fordi de vokser opp i ulike miljøer, og fordi de har ulikt arvemateriale i mitokondriene.

Sjekkpunkter: Nye ord og faguttrykk: reproduktiv kloning, terapeutisk kloning, kjerneoverføring, somatiske celler Hva er en klon? Hva er terapeutisk kloning? Hvilke to teknikker kan brukes for å klone dyr? Hvordan kloner vi en plante?


Bioteknologi • 361

10.7 DNA-profil, rettsgenetikk og moderne biologi Hva er en DNA-profil? Én til to prosent av DNA-et vårt består av kodende DNA-sekvenser, gener. Utenfor genene finnes det blant annet områder som består av repeterte DNA-sekvenser, såkalte VNTR-områder (variable number of tandem repeats). Dette er sekvenser av to til flere hundre baser som blir gjentatt mange ganger etter hverandre. Antall repetisjoner varierer mye fra person til person. Det er også vanlig at mutasjoner blir akkumulert i disse områdene. Mutasjoner i kodende DNA-sekvenser «siles» med stor sannsynlighet ut i en naturlig seleksjon og blir derfor i mindre grad akkumulert. Det er derfor større variasjon mellom individer i ikke-kodende DNA enn i gener, og disse VNTR-områdene egner seg derfor spesielt godt til å identifisere personer. Dersom vi analyserer disse områdene, får vi laget DNA-profiler eller fingeravtrykk.

DNA-profilanalyse Vi skiller mellom klassisk og moderne DNA-profilanalyse. Klassisk DNA-profilanalyse. Klassisk DNA-profilanalyse betegnes som en såkalt RFLP-analyse (restriction fragment length polymorfism). Her bestemmer vi lengden på fire–fem utvalgte VNTR-områder. DNA-et blir kuttet i biter ved hjelp av et restriksjonsenzym, kopiert til høy konsentrasjon med PCR og separert ved gelelektroforese, se figuren på neste side. En RFLP-analyse krever mye tid og mye DNA. Denne metoden blir derfor ikke lenger brukt i DNAprofilanalysene i dag, men mange av prinsippene er fremdeles de samme. Moderne DNA-profilanalyse. Moderne DNA-profilanalyse, såkalt STRanalyse, ble tatt i bruk i midten av 1990-årene. Her benyttes en type VNTRområder som bare har fire–fem basepar per gjentatte sekvens. Disse områdene kalles STR-områder (short tandem repeats). Hensikten er å bestemme antallet gjentakelser av hvert STR-område. For å få en sikker DNA-profil blir det brukt en kombinasjon av 10–13 slike STR-områder. STR-områdene oppformeres ved PCR og analyseres, for eksempel i en sekvenseringsmaskin. Sekvenserings­ maskinene gjør STR-analyse til en mer effektiv og automatisert metode enn en RFLP-analyse. Blant annet kommer prøveresultatene direkte opp på en dataskjerm. Singel nukleotid polymorfisme (SNP) betegner ulikhet i en enkelt nukleotid i DNA-et. Slike ulikheter er svært vanlige og kan ha ulik betydning for organismene avhengig av hvor den er. For å se SNP må DNA sekvenseres slik at hver enkelt DNA-enhet, nukleotiden, blir vist, se figuren. Vi kan i dag relativt enkelt få SNP-chiper på flere millioner SNP-er. Det blir så mange at det nærmer seg en sekvensering av alt DNA-et, altså en sekvensering av genomet til individet.

Bildet viser en utskrift fra en DNA-prøve som ble levert til sekvensering.


362 • Kapittel 10

RFLP-analyse i retts­ genetikk. Restriksjons­ enzymet klipper DNA-et til de to personene i ulike fragmenter på grunn av stor variasjon i VNTR-områdene. Størrelsen på fragmentene blir fastsatt ut fra den lengden de vandrer i agarosegelen.

Restriksjonsenzymer tilsettes DNA fra åsted

DNA fra mistenkt

Fragment w Kutt

C C G G

G G C C

C C G G

G G C C

Fragment z

A C G G

T G C C

C C G G

G G C C

Fragment x

Kutt Fragment y

Lengre – fragmenter

Kutt Fragment y

DNA fra åsted

DNA fra mistenkt

z x

Kortere + fragmenter

w y

y

Rettsgenetikk Rettsgenetikk omfatter genetisk kunnskap og vitenskap anvendt i sivil og strafferettslig sammenheng. Hovedoppgaven er oppfølging av biologiske spor i straffesaker, farskapssaker og identifisering både av levende og døde. I Norge er det etablert et nasjonalt rettsgenetisk senter ved Universitetet i Tromsø, som har vært aktivt siden 2009.

Strekkoding – Barcode Strekkoding er du nok kjent med fra kassa i butikken når du kjøper mat, klær eller noe annet. Det samme prinsippet, en genuin strekkode for hver «vare», ligger også bak begrepet i biologien.

Strekkoden til denne boka.

Metoden er basert på at genetisk variasjon i et spesifikt DNA-segment er større mellom arter enn innenfor arter. Slik kan arter skilles fra hverandre og slektskapstrær lages.


Bioteknologi • 363

Strekkoden som blir brukt for mange høyerestående dyr, er en 648 basepar lang region i mitokondriet cytochrome c oxidase 1 genet, mt-co1 («CO1»). Det har blitt anvendt i studier av fugler, sommerfugler, fisk og fluer. For å identifisere planter på denne måten er ikke CO1-strekkoden effektiv. Da brukes heller regioner av gener som ligger på kloroplast-DNA. De to genene er matK og rbcL. 0

268

269

537

538

657

Bioinformatikk Som navnet antyder, er bioinformatikk en sammensetning av biologisk informasjon og anvendelse av kunnskap hentet fra faget informatikk. Ettersom teknikker som PCR og datasekvensering ble vanlige metoder, har det samlet seg en stor mengde informasjon om ulike genomer. Denne informasjonen må være tilgjengelig og søkbar for forskere. Slik har bioinformatikken dannet et nytt felt innenfor biologien. For å finne ulike genfamilier og deres utvikling er bruken av bioinformatikk svært viktig, se kapittel 1 Evolusjon. Å jobbe med bioinformatikk kan også være å se gjenkjennelsesmønstre, søke etter DNA-sekvenser og modellere. Det er også mye arbeid innenfor fagområdet biokjemi, for eksempel å lage 3D-bilder av proteiner, og simulere og modulere komplekse proteinstrukturer. Faget er rimelig nytt og ansees å være et viktig fag for industrien i framtiden. Denne fagkunnskapen er mangelvare i Norge i dag.

Systembiologi Systembiologi er studiet av en organisme som et samhandlende og helhetlig nettverk av gener, proteiner og biokjemiske reaksjoner. I stedet for å analysere individuelle prosesser eller komponenter i organismen, som fotosyntesen eller et mitokondrium, fokuserer systembiologene på alle komponentene og sam­spillet mellom dem. De ser dem som en del av ett system. Samspillet mellom komponentene er i siste instans ansvarlig for en organismes form og funksjoner. For eksempel er ikke immunsystemet et resultat av en enkel mekanisme eller ett gen. Det er heller samspillet mellom mange gener, proteiner, mekanismer og organismens ytre miljø som produserer immun­ reaksjoner, og som bekjemper infeksjoner og sykdommer. Tradisjonell molekylærbiologi har jobbet med å identifisere enkeltgener, proteiner og celler, og studere deres spesifikke funksjoner. Den typen biologi gir relativt begrenset innsikt i hvordan en organisme fungerer. Biologer, genetikere og medisinere har hatt begrenset suksess med å kurere komplekse sykdommer som kreft, hiv og diabetes, fordi de innenfor tradisjonell molekylærbiologi bare ser på noen få aspekter av en organisme om gangen.

Strekkoden til en honningbie (Apis mellitus).


364 • Kapittel 10

Med framveksten av mer avanserte verktøy og teknologier har forskerne vist at gener og proteiner nesten aldri fungerer alene. Gener og proteiner samhandler med hverandre og med andre molekyler på svært strukturerte, men utrolig komplekse måter. Gjennom systembiologien forsøker forskerne nå å forstå disse komplekse samhandlingene siden de er nøklene til å forstå livet. Systembiologi ses ofte på som en etterfølger etter molekylærbiologi, genetikk, matematisk biologi og biofysikk. Det er nå etablert som en sentral del av forskningsfronten i biologifaget.

Sjekkpunkter: Nye ord og faguttrykk: RFLP-analyse, STR-analyse, SNP Hva er forskjellen mellom en klassisk DNA-profilanalyse og en moderne DNA-profilanalyse? Hvilken genregion blir brukt for strekkoding av mange dyrarter? Hva er bioinformatikk? Hva er systembiologi?

10.8 Lovgivning Da de store forskningsmiljøene for alvor begynte å se potensialet i bioteknologien og genteknologien i 1970-årene, bestemte de seg for å samles og å lage regler for denne nye kunnskapen. Det skjedde i 1975, i Asilomar, og forskerne lot være å jobbe med genteknologi i et helt år. De samlet data og lagde retningslinjer for videre arbeid. Dette er et handlingsmønster som viser en ydmykhet for de oppgavene vi står foran. I Norge er Stortinget den lovgivende makten, også i bioteknologisaker. Men regjeringen satte i 1991 ned en nemnd, Bioteknologinemnda, som er en frittstående nemnd med 21 medlemmer. Bioteknologinemnda er i skrivende stund foreslått endret til å bestå av 15 medlemmer og å endre navnet til Bioteknologirådet. Bioteknologinemnda er en høringsinstans for de norske myndighetene når det gjelder moderne bioteknologi. I Norge har vi i 2014 disse lovene som angir hvordan vi skal forholde oss til genteknologi og bioteknologi: genteknologiloven, bioteknologiloven, behandlings­biobankloven og helseforskningsloven. Genteknologiloven omhandler all bruk av genteknologi på planter og dyr, med unntak av mennesket. Medisinsk bruk av bioteknologi på mennesker er behandlet i bioteknologi­ loven. Biobankloven omhandler hvordan biologisk materiale skal behandles, lagres og destrueres.


Bioteknologi • 365

I EU skal godkjenning av nye GMO skje i tråd med føre var-prinsippet: Den som søker om utsetting, må vise til metoder for å spore organismen i naturen og ha en plan for å overvåke hvordan organismen virker på helse og miljø. Den norske genteknologiloven er i samsvar med reglene i EU-land, men et tillegg gjelder for Norge: All framstilling og bruk av GMO skal foregå på en etisk forsvarlig måte, være nyttig for samfunnet og i tråd med prinsippet om bærekraftig utvikling. Dyrehelseaspektet for genmodifisering av dyr er behandlet i lov om dyrevern. Det er forbudt å forårsake unødig lidelse. I Norge er kloning av krepsdyr og virveldyr forbudt. Kloning av mennesker ble forbudt ved lov i 1998. Forskning på overtallige befruktede egg ble tillatt fra 2008. Dette forutsetter at forskningen skjer innen 14 dager etter at egget ble befruktet, at det gis samtykke til bruk av eggene, og at bruken er knyttet til genetiske undersøkelser, studier av befruktningsteknikker eller framtidig sykdomsbehandling. Ifølge matloven og fôrvareloven er antibiotikaresistente gener i mat og fôr forbudt i Norge. Det sentrale er om det er DNA til stede i et produkt eller ikke. En matolje som ikke inneholder DNA, kan derfor tenkes å bli godkjent, selv om oljen er produsert i eller av en genmodifisert organisme med antibiotikaresistente gener. Mer om disse lovene finner du på www.lovdata.no. Bioteknologinemnda har også en oppgave med å gi informasjon til befolkningen og skape debatt i samfunnet. Det gjør den blant annet ved å holde gratis informasjons- og debattkvelder rundt omkring i landet. En transgen organisme som er godkjent i EU, er i prinsippet også lovlig i Norge, men den kan forbys dersom den bryter med den norske genteknologi­ loven. Norsk lovverk krever en bred gjennomgang av spørsmålet om en organisme kan godkjennes eller ikke. Blant annet skal en kunne gjøre rede for samfunnsnytten av en transgen organisme. Slik kan vi sikre et bredt spekter av interesser i samfunnslivet.

Sjekkpunkter: Hvilke lover er knyttet til bioteknologi og genteknologi i Norge? Hvilken funksjon har den norske Bioteknologinemnda?

10.9. Anvendelse av kunnskapen Etikk Etikk og moral er noe spesifikt menneskelig. Det er tenkning og teoretisk refleksjon omkring hva som er rett eller galt, og det er de bevisste vurderingene våre som resulterer i de handlingene vi gjør. Vi sier ofte at handlingene våre har en årsak, et slags «bør», og dette er unikt for menneskene. Menneskeheten er slett ikke enig om hva dette «bør» skal

ethos (gr.) – sed og skikk


366 • Kapittel 10

normativ etikk = hvordan vi bør handle, hvilke prinsipper som skal ligge til grunn for handlingen vi gjør

telos (gr.) – mål, formål deon (gr.) – plikt

innebære, og hvilke forpliktelser vi som mennesker har overfor hverandre og naturen, og for noen også overfor en gud. Det gjenspeiler den vitenskapelige bredden i etikkfaget. Det har vært behandlet av både filosofer og teologer. Faget er i dag en akademisk disiplin innenfor filosofifaget, hvor det blir skilt mellom etikk og moral ved å si at moral har med en konkret handling å gjøre, mens etikken er tenkningen rundt handlingen og årsaken til den. Forenklet kan vi si at du kan handle umoralsk, men når du tenkte over hvilke normer og regler som skulle legges til grunn for en sak, da drev du med etikk. Etikk er en intellektuell aktivitet som reflekterer over handlingen og teorien bak den. Etikk er nær knyttet til livssyn, grunnleggende verdier og normer, noe som betyr at de etiske retningslinjene kan være forskjellige i ulike kulturer. Etikken har mange ulike retninger, og vi skal her bare ta for oss to av den normative etikkens hovedretninger, nemlig pliktetikken og konsekvens- eller formålsetikken. Dessuten skal vi ta for oss noen enkle regler for argumentasjon i en tekst som omhandler en etisk problemstilling.

Pliktetikk Pliktetikken hevder at det finnes moralske standarder som er uavhengige av konsekvensene handlingen måtte ha. En handling er derfor rett når den oppfyller et overordnet prinsipp, for eksempel at det er galt å fortelle en løgn – helt uavhengig av hvilken konsekvens det måtte få. Ofte er slike regler generelle, og hovedvekten ligger på selve handlingen og at den er i tråd med reglene.

Konsekvensetikken I konsekvensetikken skal vi alltid handle slik at vi bringer fram de best mulige konsekvensene. Dermed er en handling i seg selv ikke ond eller god, men den er god dersom konsekvensene av den er gode. Slik sett er det et stort skille mellom de to retningene. Et mye brukt eksempel er å bruke forsøksdyr. Det er skadelig og enkelte ganger dødelig for forsøksdyret, men det framskaffer informasjon som kan redde svært mange mennesker. Den er dermed formålstjenlig. Vi kan fortsatt mene at det er galt å benytte forsøksdyr, men nytten er i dette tilfellet så stor at den opphever at handlingen i utgangs­ punktet «var gal».

Etisk resonnement og argumentasjon Genteknologi skaper etiske problemer fordi den gir oss store muligheter til å endre på levende organismer og luke ut anlegg vi ikke ønsker. I spørsmål som er knyttet til menneskers liv, for eksempel moderne bioteknologi, er det ofte svært vanskelig å oppnå enighet i samfunnet. Men det er viktig at denne uenigheten er rimelig, altså at alle parter er ærlige i sin argumentasjon og heller ikke unnlater å erkjenne selvsagte sannheter. Hovedårsaken til en slik uenighet er tuftet på at etiske dilemmaer nettopp er kjennetegnet ved at ingen løsninger er perfekte, altså at alle løsningene innebærer noen negative konsekvenser. Dessuten er mange av de spørsmålene som moderne


Bioteknologi • 367

bioteknologi reiser, av en slik karakter at de er nye for oss som samfunn. Derfor har vi ikke i samme grad som med andre etiske spørsmål en moralsk intuisjon om hva som er rett og galt ved dem. Når vi argumenterer, er det viktig at vi også skiller mellom hva som kan være uønsket, uakseptabelt og hva vi ønsker skal være forbudt. Mange kan mene at det er uakseptabelt å være utro, men skal det være forbudt ved lov? Mange argumenterer imot med at det er uheldig om vi skal ha en lov som skal dekke alle sider ved livet vårt. En etisk problemstilling spør ikke om hva som er lovlig eller ulovlig (det er en juridisk vurdering), men hva som er rett, og hva som er galt. Svært ofte søker lovverket å forene dette, men et eksempel på når dette ikke går, kan være bruk av sivil ulydighet. Noen vanlige argumenter vi kan møte i en etisk debatt: Det er særlig fire former for argumentasjon det er vanlig å møte i den etiske diskusjonen rundt moderne bioteknologi. • Absolutiske argumenter: Dette er argumenter som ligger tett opp til et pliktetisk syn, for eksempel at det er en gal handling å drepe et menneske, uavhengig av alt annet. • Konsekvensetiske argumenter: Argumenter som betrakter og vurderer en handling ut fra om den er god eller dårlig i sine konsekvenser. • Rettighetsbaserte argumenter: Argumentasjon som tar utgangspunkt i en lov eller en rettighet. Det kan for eksempel være retten som barn av en sæddonor har til å få vite navnet på sin biologiske far når en fyller 18 år, dersom de vet at de er et produkt av en sæddonor. • Skråplansargumenter: Dette er en argumentasjon som sier noe om hva som kan skje dersom vi godtar prosess A. Slik argumentasjon er av typen: Godtar vi handlingen A, må vi snart godta handling B, osv., og dermed sklir vi ned «skråplanet». Slik argumentasjon er svært vanlig i all diskusjon om å sette grenser og blir ofte brukt som et maktmiddel. Det kan innvendes mot skråplansargumentasjonen at den ofte diskuterer noe annet enn den opprinnelige handlingen. Motargumentet er faktisk å vise at det er en forskjell mellom handling A og B, og at det er mulig å stoppe etter handling A. Ordvalg. Valg av ord i en tekst er alltid viktig. Mange ganger klarer vi ikke å skjule hva slags oppfatning, livssyn eller tro vi har, når vi skriver. Dette er ikke nødvendigvis noe å hige etter heller, men det er viktig at vi er klar over at ord­valget vårt kan påvirke ganske kraftig den muligheten vi har til å slå igjennom med argumentasjonen vår, eller i det hele tatt bli tatt alvorlig i debatten. Når diskusjonen kommer inn på bioteknologi og evolusjon, blir det fort ladede uttrykk, noe som sjelden gagner debatten. Slike ord kan være genmanipulering, DNA-rekombinasjon, transgen, hybrid, genmodifisering eller tukling med naturen og skaperverket. Alle ordene betyr i handling det samme, vi avslører en grunnleggende ulik holdning til handlingen. I debatten omkring moderne bioteknologi møter vi gjerne et par begreper som har stått svært sentralt i den vestlige kulturen, nemlig menneskeverd og likeverd. Dette er ord som på ingen måte er enkle å definere, men kanskje var Nordahl Grieg nær i sitt dikt «Til ungdommen» i 1936.


368 • Kapittel 10

Kringsatt av fiender, gå inn i din tid! Under en blodig storm – vi deg til strid!

Ubygde kraftverker, ukjente stjerner – skap dem, med skånet livs dristige hjerner!

Kanskje du spør i angst, udekket, åpen: hva skal jeg kjempe med, hva er mitt våpen?

Edelt er mennesket, jorden er rik! Finnes her nød og sult, skyldes det svik.

Her er ditt vern mot vold, her er ditt sverd: troen på livet vårt, menneskets verd.

Knus det! I livets navn skal urett falle. Solskinn og brød og ånd eies av alle.

For all vår fremtids skyld, søk det og dyrk det, dø om du må – men: øk det og styrk det!

Da synker våpnene maktesløs ned! Skaper vi menneskeverd, skaper vi fred.

Stilt går granatenes glidende bånd. Stans deres drift mot død, stans dem med ånd!

Den som med høyre arm bærer en byrde, dyr og umistelig, kan ikke myrde.

Krig er forakt for liv. Fred er å skape. Kast dine krefter inn: døden skal tape!

Dette er løftet vårt fra bror til bror: vi vil bli gode mot menskenes jord.

Elsk – og berik med drøm – alt stort som var! Gå mot det ukjente, fravrist det svar.

Vi vil ta vare på skjønnheten, varmen – som om vi bar et barn varsomt på armen! Nordahl Grieg, 1936

Sentrale etiske emner knyttet til biologi Det er mange emner innenfor det omfattende biologifaget som kan gi opphav til en etisk debatt. Nedenfor har vi svært kort listet opp noen av dem. Moderne bioteknologi. Mye av diskusjonen omhandler i hvor stor grad samfunnet skal styre utviklingen gjennom lovverket. Men diskusjonen er også individualistisk på den måten at du i større grad må forholde deg til at gentesting blir lettere tilgjengelig, og at nye transgene organismer kan bli mer vanlige. Det samme gjelder en mulig terapeutisk kloning og bruk av ulike metoder for å få barn eller teste embryoet i en svært tidlig fase for sykdommer eller egenskaper. Med dagens teknikker er det fullt mulig for en kvinne å bestemme mange av egenskapene til barnet ved at hun kan velge bort enkelte egenskaper. Diskusjonen gjelder forhold som menneskeverd, likeverd og selvbestemmelse.


Bioteknologi • 369

Biologi/medisin og toppidrett. Hva og hvor lenge virker ulike typer av doping på prestasjonsevner. Mye tyder på at prestasjonsfremmende dopingmidler har effekt på organismen også etter at inntaket av dem har opphørt. Dødshjelp. Vitenskapen har utviklet mange nye medikamenter som gjør det mulig selv å velge når og hvordan vi skal dø med lite eller ingen smerte. Slike debatter bunner ofte i et ulikt syn på hva som er menneskeverd. Miljø- og klimadebatten. Nasjonale og globale interesser står ofte mot hverandre, og debatten har også vært preget av ulik situasjonsbeskrivelse. Seksualetikk: Gjelder både individ og samfunn, for eksempel bruk av preventiver, legning, kjønnsroller, kjønnslemlestelse og masturbasjon. Noen vil kanskje si at debatten rundt evolusjon også er en etisk debatt. Men ettersom etikken omhandler en spesifikk reflektert menneskelig handling, blir det urimelig å si at det synspunktet en har til evolusjonen, er et rent etisk valg. Men evolusjonen skaper også debatt på et filosofisk, religiøst og livssynsmessig plan. Ofte er det en kilde til debatt at evolusjonen har en forklaringsmodell på den viktigste utviklingen i livet uten å benytte en ytre kraft eller ånd. Dette kan virke urimelig for enkelte ut fra deres religion og religionens syn på livets opprinnelse og utvikling.

Noen hovedmomenter til en samtale eller skriftlig diskusjon rundt et etisk emne • Klargjør hverandres synspunkter. Hva er dere enige om, og hva er dere uenige om? • Søk å ha som formål at debatten skal kunne utvide kunnskapen din og utvikle deg som menneske. Det kan lett bety at du må lære deg om det den andre står for. Å lære om er ikke det samme som å bli enig. • Toleranse og respekt for motparten som et menneske med de samme rettighetene som du selv. • Alltid saklighet i bruk av ord og argumenter. Sleivspark virker lite imponerende, er umodent og viser lite eller ingen toleranse eller respekt for motparten. Noen emner i livet blir aldri enkle å diskutere eller å forholde seg til. Men slike emner er der, og det kan hjelpe oss å diskutere dem før vi plutselig havner i en situasjon. Målet med en etisk diskusjon er ikke å «vinne» eller å fordømme, men å forstå den andres argumentasjon slik at vi bedre kan bedømme problemet. Husk tommelfingerregelen om at overdrevent sterke ord vanligvis betyr en svak sak!


Sammendrag • Bioteknologi er å bruke levende celler til å produsere et ønsket produkt. • Genteknologi er teknikk som innebærer at arvestoffet blir isolert, karakterisert, modifisert og satt inn i levende celler igjen. • Restriksjonsenzymer er viktige redskaper fordi de kutter DNA-et på bestemte restriksjonsseter, noe som gjør det mulig å få presis og kjent kutting av DNA. • Ligase er et enzym som sørger for å «lime» sammen DNA-fragmenter. • Rekombinant DNA-molekyl er satt sammen av DNA-et fra ulike DNA-kilder. • Plasmid er et lite, sirkulært DNA som finnes i bakterier. Brukes som vektor for å bringe ønsket DNA inn i en annen celle. • Gelelektroforese er en separeringsteknikk for DNA. DNA vandrer ulikt i gelen når gelen blir utsatt for et spenningsfelt, fordi de har forskjellig ladning, form og størrelse. De små fragmentene vandrer lengst. • PCR er en teknikk som mangfoldiggjør DNA-et ved å gå gjennom mange kopieringssykluser. Krever primere, nukleotider og enzymer. • Genetisk fingeravtrykk er en metode for å identifisere personer. DNA-et blir kuttet opp, og det synliggjøres i en gelelektroforese. De delene av DNA som blir benyttet, er små, repeterende sekvenser som er svært forskjellige hos mennesker. • For å øke mulighetene for overføring av et rekombinert plasmid til bakteriene blir bakterie­ cellene gjort kompetente. Det kan skje kjemisk eller ved bruk av elektrisitet. Resultatet er en svekket cellevegg, og fremmede DNA tas enklere opp av cellen. • Sammen med genet som ønskes klonet, må det være en seleksjonsmarkør. Dette markørgenet er lett å identifisere. Ofte blir det brukt gener for antibiotikaresistens.

• Genpistol/genkanon og mikroinjeksjon er andre former for overføring av DNA. Ved bruk av genpistol fester DNA-et seg til partikler som så blir skutt inn i cellekjernen. Ved mikroinjeksjon blir DNA-et sprøytet direkte inn i en cellekjerne. • Transgene organismer har fått satt inn gener fra en annen organisme, mens en cisgen organisme har fått satt inn gener fra samme art. • Modellorganismer er enkle organismer og billige å holde, og de har en kort livssyklus. Eksempler er mus, vårskrinneblom, gjær og bananflue. • Å klone er å skape noe som er likt. Vi kan klone gener, celler og hele organismer. • Terapeutisk kloning gir nye celler, mens reproduktiv kloning gir et nytt individ. • Vi må søke om godkjenning for å dyrke transgene planter. • Det finnes i dag flere transgene nytteplanter som er motstandsdyktige mot angrep fra insekter. • Transgene dyr blir brukt i forskning på sykdommer, genregulering og som produsenter av viktige medisiner. • Det blir stadig utviklet nye gentester for ulike sykdommer eller anlegg for sykdom. Hvordan disse testene skal brukes, og hvordan informasjonen om brukeren skal lagres, er andre viktige samfunnsspørsmål som genteknologien gir oss. • Det er fire lover som styrer og regulerer bruken av bio- og genteknologi i Norge. • Bioteknologinemnda er en frittstående, rådgivende nemnd i slike saker i Norge. Nemnda vurderer søknader i forbindelse med genteknologi. • Bioinformatikk er et nytt fag hvor all den informasjonen som blir produsert i form av sekvensering av genomer og liknende, blir samlet og gjort tilgjengelig for forskere.


Bioteknologi • 371

Sammendrag • I den normative etikken er det to hovedretninger: pliktetikk og konsekvensetikk. –– I pliktetikk vektlegges det at handlingens etikk er uavhengig av dens konsekvenser. –– Konsekvensetikken vektlegger etiske konsekvenser av handlingen.

• En etisk problemstilling spør om hva som er rett og galt, ikke hva som er lovlig eller ulovlig.


372 • Kapittel 10

Oppgaver Tips til oppgavene finner du på www.gyldendal.no/bi 1 a Hva er forskjellen og hva er likheten mellom bioteknologi og genteknologi? b Tror du denne forskjellen har noen betydning for «folk flest»? Begrunn synspunktene dine. 2 Lag en liste over produkter som du vanligvis har rundt deg i løpet av en dag, og som du vet er produsert ved hjelp av bioteknologi. 3 Hvilke verktøy er de mest grunnleggende i arbeid med DNA knyttet til genteknologi? 4 Restriksjonsenzymer er svært viktige i bioteknologien. a Vis med en figur hva et restriksjonsenzym gjør.

7 a Hva er PCR? b Bruk figuren på side 332 til å forklare hvorfor PCR er en svært god kopimaskin, og hvilke ingredienser den trenger. c Hvorfor har PCR-maskinen vært så viktig for utviklingen av fagfeltene genetikk og molekylærbiologi de siste 20 årene? 8 Figuren under viser ulike steg i kloningen av et gen ved hjelp av en bakterie. Forklar hva som skjer på hvert enkelt trinn. +

b Hvilke organismer har opprinnelig restriksjonsenzymer, og hvorfor har de dem? c Nevn tre restriksjonsenzymer og restriksjonssetet deres. d Hva betyr det at restriksjonsenzymer er endonukleaser? e Hva er en vektor i bioteknologien? Forklar og vis med en figur. f Forklar og vis med en figur hvorfor både vektoren og det ønskede DNA må kuttes med samme restriksjonsenzym. g Hvorfor tror du restriksjonsenzymet EcoR1 fungerer best ved 37 °C? 5 Hvilken av disse DNA-sekvensene er mest trolig et restriksjonssete? Gi begrunnelser for svaret ditt. 1 G A A T T C C T T A A G 2 C A G C A G G T C G T C 3 G T G C T G C A C G A C 6 a Gjør greie for hva et DNA-bibliotek og et cDNAbibliotek er. Hva er hovedforskjellen mellom disse bibliotekene? b Si også noe om hva som er fordelene og ulempene ved disse to typene av DNA-bibliotek.

9 Hvilke to hovedformer for genoverføring har vi hos planter? 10 Forklar med figur hvorfor det blir galt å si at mikroinjeksjon er en indirekte metode for overføring av DNA.


Bioteknologi • 373

11 a Hva er en transgen organisme? b Gi eksempler på transgene dyr og planter. c Lag en skisse hvor du viser hvordan du må gå fram for å lage et transgent dyr. d Hvordan er lovverket rundt transgene organismer i Norge? 12 Vis med figur og forklaring hva et hybridgen er. 13 Forklar hvordan man kan identifisere kjent DNA i løsning. Velg en metode som du forklarer grundig, og vis denne med en figur.

16 Fyll ut denne tabellen: Teknikk/ hjelpemiddel Restriksjons­ enzymer Gelelektroforese PCR

Rask kopiering av DNA-materi­ alet utenfor en celle

DNAsekvensering mRNA fra celler blir behandlet med revers transkriptase, og det resulterer i et DNA-mole­ kyl uten introner

15 Et blodig drap har skjedd, og politiet fikk prøver fra to mistenkte og fra åstedet. a Forklar hvilke metoder de ansatte på laboratoriet brukte for å komme fram til den gelen som er vist under. b Hvem tror du er den skyldige, og hvorfor? c Hvilken del av DNAet er brukt i denne analysen? d Kan vi være sikre på et slikt resultat? Offer

Brukes til

DNA-chip

14 Hva er GMO?

Spor

Beskrivelse

Mistenkt Mistenkt 1 2

17 Lag en oversikt over hvordan bruken av bioteknologi påvirker livet vårt. Disse stikkordene og formuleringene må være med og må være forklart: medisinsk bruk, transgene organismer, genterapi, sikkerhet og etiske aspekter ved bruk av bioteknologi. 18 Gi en definisjon av disse begrepene: a Rekombinant DNA b Transgen organisme c Hybridgen d Primer e Vektor f Plante- og dyreforedling 19 a Hva er en modellorganisme, og hvilke krav stiller vi til den? b Nevn tre modellorganismer. c Forklar og vis med et eksempel hvordan bruken av modellorganismer har gitt oss ny kunnskap om mennesket.


374 • Kapittel 10

Oppgaver 20 Forklar hvordan jordbakterien Bacillus thuringiensis har bidratt til å lage transgene (GMO) planter, og hvorfor dette har blitt gjort. 21 Eksamensoppgave, 2000 (endret)

Tekstutdrag 1: Forskere fra Pasteur-instituttene i Paris og Antananarivo har rapportert om tilfeller av pest der årsaken var en multiresistent stamme av Yersina pestis. … Resistens­ genet var i et plasmid som i laboratoriet lett ble over­ ført til andre pestbakterier og til tarmbakterier. Stammen var resistent mot penicillin og sju andre antibiotika. Et niende antibiotikum har vist seg å helbrede pasientene. Tekstutdrag 2: Resistens hos tuberkulosebakteriene (Mycobacterium tuberculosis) skyldes mutasjoner i selve bakterie­ kromosomet. … Multiresistent tuberkulose betyr at tuberkulosebakteriene er resistente mot de to hoved­ medikamentene isoniazid og rifampicin. Pasienter med slike tuberkulosebakterier er svært vanskelige å behandle, og det innebærer blant annet isolasjon. b Vis med tekst og skisse hvordan plasmider kan brukes for å få bakterier til å produsere et protein som de naturlig ikke har. c Velg en annen metode for genoverføring og gjør rede for denne metoden med tekst og skisser. 22 Dvergvekst hos mennesket kan ha mange ulike årsaker. En type dvergvekst skyldes at kroppen ikke får produsert nok veksthormon. Genet for dette veksthormonet ligger på kromosom 17. Ved en undersøkelse av seks personer, hvor en av dem var en kontrollperson som ikke hadde dvergvekst, ble deler av kromosompar 17 tatt ut og

Start

5

11

12

13

6 Kontroll –

26 kb 23 kb 18,5 kb 16 kb

+

Vandringsretning ved elektroforesen

a Av de to tekstutdragene nedenfor går det fram at bakterien Y. pestis og M. tuberculosis er blitt antibiotikaresistente på to ulike måter. Bruk tekstene til å vise at du forstår dette, og hvordan antibiotikaresistens kan oppstå og spre seg.

kuttet med restriksjons­enzym. Når disse prøvene settes på gelen og en gjennomfører en gelelektroforese, vil det hos mennesker med normal produksjon av vekst­ hormoner komme tre like bånd på henholdsvis 26 kb, 23 kb og 16 kb. Nedenfor ser du resultatet av de seks prøvene som ble tatt:

Kromosompar nr17

26 kb

16 kb

23 kb

Genets lokus

a Hvorfor er det ulik tykkelse på DNA-båndene til deltakerne? b Forklar hvorfor du kan si at prøve 11 er fra en person som er dverg. c Selve vekstproteinet er på 191 aminosyrer. Bruk kunnskapen din om DNA hos eukaryote organismer til å forklare hvor mange basepar det minst trengs for å lage dette veksthormonet. d Det faktiske genet er på 1600 basepar. Forklar med en figur hvordan det stemmer overens med svaret ditt i c.


Bioteknologi • 375

23 a Hva er genterapi? b Hvilke former for genterapi har vi? 24 Bruk figuren til å forklare homolog rekombinasjon. Gi eksempler på bruken av denne teknikken. Hvilke etiske betenkeligheter har denne metoden?

Vektor

Ønsket gen

25 Forklar ved hjelp av skisser hvordan virus kan brukes som vektorer. Drøft hvilke problemer bruken av virus som vektor har. 26 Tegn en skisse av framgangsmåten ved reproduktiv kloning hos høyerestående dyr, og forklar denne. Hvorfor er ikke den samme framgangsmåten nødvendig med mange planter? 27 Transgene organismer er både fra de prokaryote rikene og fra de eukaryote rikene. Hvorfor kan vi ikke alltid bare benytte oss av for eksempel bakterier når vi ønsker å lage ulike proteiner, når DNA er universelt? 28 a Hva er assistert befruktning? b Hvem kan benytte seg av assistert befruktning i dag? c Forklar framgangsmåten ved assistert befruktning.

Embryonal stamcelle fra mus

d Hvordan er lovgivningen på dette feltet ellers i Europa? e Synes du det er riktig at det norske sykehussystemet skal bruke tid og penger på å hjelpe eller behandle ufruktbare personer? f Bør det være aldersgrense(r), eller krav om sivilstand for å få assistert befruktning? Begrunn svaret ditt. 29 Brystkreft er den vanligste formen for kreft hos norske kvinner. a Hvordan har Norge prøvd å møte dette i form av nasjonale helsetiltak? b Forklar hva som skjer ved arvelig brystkreft.

Inaktivert musegen Blastocyst Stamcelle

Utvikling og fødsel

c Bør en pålegge kvinner som har fått påvist arvelig kreft, å informere sine nærmeste slektninger som kan ha det samme genet? Begrunn svaret ditt. 30 Forklar med figur og ord hva som skjer ved terapeutisk kloning. Forklar også hvordan lovgivningen rundt dette emnet er i Norge. Er du enig i lovgivningen? Begrunn svaret ditt. 31 a Hva er en DNA-chip? b Forklar hvordan en slik chip/mikromatrise kan vise om en person er disponibel for en sykdom eller ikke.


376 • Kapittel 10

Oppgaver 32 Fyll ut de feltene som er blanke på figuren nedenfor. Bruk så denne figuren til å forklare hva stamceller er, og hvilket potensial som ligger i dem. Drøft også de etiske sidene ved at vi i dag i all hovedsak må benytte oss av embryonale stamceller.

33 Hvor kan man finne stamceller hos planter og hos dyr? 34 Vis og forklar hvorfor det vil være gunstigst å bruke pasientens egne stamceller i behandling av alvorlige sykdommer. 35 Forklar hva rettsgenetikk betyr, og hvordan dette brukes i samfunnet vårt.

Indre cellemasse

36 Hva er en «barcode» i biologisk betydning? 37 Hvilke lover er det som styrer norsk bioteknologi?

2 Kjemikalier tilsettes slik at det blir tre celleklumper. Hver celleklump vokser til en koloni av embryonale stamceller

4 Differensierte celler settes inn i skadet vev

38 Hvordan kan vi bruke bioteknologiske metoder til å vise slektskap og danne slektstrær i biologien? Hvordan kan de samme slektstrærne underbygge og vise en evolusjon? Bruk eksempler og figurer i forklaringen din. 39 Skriv et innlegg eller et essay der du tar for deg emnet ufrivillig barnløshet – et samfunnsansvar? Teksten din bør drøfte lovverket og praksisen og skal ha et biologifaglig innhold.


Bioteknologi • 377

Nett-, gruppe- og presentasjonsoppgaver 40 Følg med i ulike media i en lengre periode (minst tre uker) og se særlig hvordan de behandler A transgene dyr

45 Lag et foredrag om regelverket som er knyttet til å bruke og å donere kjønnsceller. Pek også på lovverket i land som er geografisk i nærheten av oss. 46 Ta for deg en eller to transgene planter og forklar hvorfor disse er eller kan bli viktige i landbruket.

B transgene planter C genterapi

47 Ta for deg artikkelen «urovekkende funn» i Genialt 2–2013. Bruk denne og kildene/referansene den bruker, til å redegjøre for problematikken om mulig økt kreftforekomst ved fôring med genmodifisert mais.

D kloning E biologiske spor F DNA-fingeravtrykk som bevis 41 Se en av disse filmene eller dokumentarene og skriv et essay der du kommenterer det biologifaglige innholdet i den. 1 GATTACA 2 Mirakel 3 The boys from Brazil 4 Dokumentar om rugemødre vist på NRK i april 2008 42 Bruk Internett til å sjekke hvilke gentester dere kan kjøpe, og hva de koster. Tenk over og forklar hva det kan bety om noen lurer deg til å teste deg for noe du ikke vil testes for. 43 I dag er det slik at den som finner et gen for en bestemt egenskap, kan ta patent på dette genet. Patentet, eller eierskapet, er uavhengig av om genet i utgangspunktet er hans eller hennes. Sett opp en liste der dere finner argumenter både for og imot dette lovverket, og hvor dere viser hvilke konsekvenser det har fått og kan få.

48 Ta for deg artikkelen «Genmodifisert mygg på frifot» i Genialt 5–2012. Forklar hva den handler om, og søk etter om målet er nådd eller ikke for dette prosjektet. 49 Ta for deg en dyrerase eller en slekt som du vet det har blitt brukt enten plante- eller dyreforedling på, og presenter for gruppa de ulike trinnene og hvorfor det har vært en kunstig seleksjon for enkelte egenskaper. 50 Bruk relevante kilder om stamcelleforskning som går ut på å få differensierte celler til å bli udifferensierte igjen. Lag en presentasjon som også skal inneholde en refleksjon over etiske aspekter ved forskning på stamceller. 51 Finn ut mer om terapeutisk kloning og velg en sykdom som det jobbes med. Presenter den informasjonen dere har funnet, og vær kildekritisk. Hvordan ville dere ha framstilt det samme dersom dere var journalister i en løssalgsavis? 52 Finn ut mer om mammografitilbudet der du bor, og lag en presentasjon for gruppa.

44 Lag et foredrag om konsekvensetikken eller nytteetikken og vis hvordan disse to etiske retningene kan gi oss ulike svar på en del grunnleggende spørsmål innenfor bioteknologi.

Korte foredrag • Mammografi • Bioteknologinemnda • Dyreforedling av en hunderase, for eksempel golden retriever eller schæfer

• Lag et foredrag der du ser nærmere på hvordan science fiction-sjangeren har framstilt kloninger og andre genteknologiske produkter i litteraturen eller på film. Relater dette til det biologfaglige og drøft hvorvidt framstillingen er korrekt eller ei.

• Ufruktbarhet hos menn – typiske årsaker • Ufruktbarhet hos kvinner – typiske årsaker • Prostatakreft – den vanlige, men ikke mye omtalte kreftformen


378

Grunnleggende kjemi i biologien I biologien studerer vi det levende både på mikronivå og makronivå. For å gjøre dette og for bedre å forstå det vi observerer, trenger vi som biologer å anvende en del grunnleggende fysikk og kjemi. I dette kapitlet tar vi for oss de mest sentrale delene av kjemien. Kapitlet er ment som et oppslags- og repetisjonskapittel for enklere å få på plass kjemien i de biokjemiske prosessene som beskrives i resten av boka.

Atomer og molekyler atomos (gr.) – udelelig

Stoff er alt som har masse, og som krever plass. Alt stoff består av atomer. Atomene ble lenge ansett som den minste delen alt bestod av, men det stemmer ikke lenger. Atomer er igjen bygd opp av elementærpartikler (elektroner, protoner, nøytroner og kvarker). Et atom består av en kjerne, som er tyngdepunktet i atomet. Rundt kjernen er det en sky av negativt ladde elektroner. Elektronene er fordelt i ulike energinivåer som vi kaller skall.

Atomstrukturen. Alle atomer har en kjerne av protoner og nøytroner, bortsett fra hydrogen. Hydrogen, det minste atomet, har oftest bare ett proton i kjernen.

Hydrogen

Oksygen

1 proton 1 elektron

8 protoner 8 nøytroner 8 elektroner

proton (positiv ladning)

0102_Atommodell

elektron (negativ ladning)

nøytron (ingen ladning)


Grunnleggende kjemi i biologien • 379

Eksitert tilstand Kjerne Elektron

Grunntilstand

Økende energi

Eksitert tilstand

Fotonet absorberes av et molekyl

Grunntilstand

Foton Foton

Elektronene har minimal masse sammenliknet med kjernen, som består av 0620_Eksitert_elektron protoner og nøytroner. Protoner har positiv ladning, mens nøytronene ikke har noen ladning. På grunn av forskjellene i ladning mellom kjernen og elektronene beveger elektronene seg rundt kjernen. Et grunnstoff består bare av én type atomer. Det vil si at grunnstoffet karbon utelukkende består av karbonatomer. Det finnes i verden i dag 118 grunn­ stoffer, men bare 92 av dem er naturlige. Menneskene har organisert grunnstoffene i et periodisk system, se side 398. Et atom er altså en enhet bestående av elementærpartikler, mens et molekyl er to eller flere atomer bundet sammen. Dersom et atom blir tilført energi, kan elektroner «sprette ut» av et elektron­ skall, se figuren over. Det blir da dannet et eksitert elektron. Et atom som er tilført energi, er ustabilt og reagerer ofte tilbake til utgangspunktet sitt og frigir da energi. Den frigitte energien kan sette i gang en ny reaksjon, som ellers ikke ville ha skjedd. Det skjer for eksempel i fotodelen av fotosyntesen, se side 300. Ofte faller bare elektronene tilbake til sin opprinnelige plass og sender ut et foton, en energimengde. Antallet elektroner og fordelingen av dem rundt kjernen er avgjørende for hvor stabilt et atom er. Stabile atomer har åtte elektroner i det ytterste skallet. Dersom et atom er ustabilt, tenderer det til å reagere med andre atomer, like eller ulike. Atomet avgir da elektroner, eller det tar opp elektroner. Det varierer hvor mange elektroner som blir tatt opp, og hvordan det gjøres. Det er elektronene som er lengst fra kjernen, valenselektronene, som lettest deltar i slike reaksjoner. Dette er viktig for å forstå og se de forskjellige typene av bindinger som kan eksistere mellom atomer og mellom molekyler.

Viktige grunnstoffer i biologien Omtrent 98 % av massen til en levende organisme er satt sammen av de seks grunnstoffene karbon (C), hydrogen (H), nitrogen (N), oksygen (O), fosfor (P) og svovel (S). Dette er altså stoffer som du kommer til å møte ofte i biologi­ faget.

Eksitering av elektroner. Når et elektron blir eksitert, blir den overførte energien brukt til å frakte elektronet et skall lenger ut enn det opprinnelige.


380

Noen av disse grunnstoffene er også molekyler. Det er for eksempel svært sjelden med fritt oksygen. Oksygen forekommer som regel sammen med et annet oksygenatom, altså som O2, eller i andre kjemiske forbindelser.

Bindingslære okta (gr.) – åtte

For å lage molekyler må atomene binde seg sammen, og i den reaksjonen er valenselektronene sentrale. For å få et så stabilt atom som mulig må det ytterste skallet være fullt. Dette skallet kan som hovedregel ha åtte elektroner, og regelen om fullt ytterste skall kalles derfor oktettregelen. Men det gjelder ikke for det innerste skallet. Det blir fullt allerede med to elektroner, og derfor har helium (He) fullt ytre skall med to elektroner. For å endre antallet elektroner må et atom enten få, ta eller dele elektroner. Da lager atomet en binding med et annet atom. Vi skal se nærmere på tre hovedgrupper av bindinger som er sentrale i biologien: kovalente bindinger, hydrogenbindinger og ionebindinger.

Kovalente bindinger cum (lat.) – sammen valere (lat.) – være sterk, være verdt

Kovalente bindinger er bindinger der atomer deler elektronpar. Dersom to elektronpar blir delt, sier vi at det er en dobbel kovalent binding, og bindingen er trippel kovalent dersom tre elektronpar blir delt, se figuren under. Dersom det ene atomet trekker mer på de delte elektronene enn det andre, har vi en polar kovalent binding. Det har vi for eksempel i vann, H2O, der oksygenatomet trekker mest på elektronparet som binder det til hydrogen. Kovalente bindinger og ionebindinger, er sterke. Det betyr at det kreves mye energi for å bryte dem.

Kovalente bindinger: I en kovalent binding deler atomene på elektronparet. En kovalent binding kan være a) enkel, b) dobbel eller c) trippel.

Enkel kovalent binding

H

H

Hydrogengass

Dobbel kovalent binding

O

O

N

N

Oksygengass

Trippel kovalent binding Nitrogengass

0104_Kovalente_bindinger


Grunnleggende kjemi i biologien • 381

Ikke polar kovalent binding

Polar kovalent binding

Ionebinding

Atomene har ingen ladning

Atomene har svak ladning

Atomene har ladning

Elektronpar: Graden av deling på elektronparene kan vises som en linje fra lik deling av elektronene i en ikke polar kovalent binding, som hos H2, via vann, som er en polar kovalent binding, og til slutt en ionebinding, der det er ingen deling av elektroner, men en overføring.

H H

H

Hydrogen

H

C

H

H

N

H

H

H

Metan

Ammoniakk

Lik deling av elektronene

Na+ Cl-

O H

H Vann

Natriumklorid Overføring av elektronene

0105_Elektronpar Hydrogenbindinger

Hydrogenbindinger er svake bindinger mellom molekyler, der hydrogenatomet er bundet til et elektronegativt atom. Elektronegative atomer er atomer som trekker mer på elektronene i en binding enn det andre atomet. Elektronene er da oftere rundt det elektronegative atomet som får et overskudd av negativ ladning. Derfor har slike molekyler en svak positiv og en svak negativ ladning i seg. Mellom slike molekyler kan det dannes hydrogenbindinger. Hydrogenbindinger er svært viktige i biologien fordi mange sentrale molekyler har dem. Det er for eksempel hydrogenbindingene mellom nitrogenbasene i DNA-tråden som holder tråden sammen, men som også gjør det mulig å åpne den uten å bruke for mye energi. Det er også hydrogenbindingene mellom vannmolekylene som gir vann mange av dets helt unike egenskaper.

Ionebindinger

H

δ(+)

O

H

δ(-)

δ(+) H

Hydrogenbindinger

δ(-)

O H

δ(-)

H

O

δ(+) (+) H δ

H δ(-)

O

δ(+) H

H δ(+) O δ(-)

0603_Vannmolekyl

Når et atom avgir eller tar opp elektroner, sier vi at det dannes et ion. Ione­ binding oppstår når det ene atomet beholder bindingselektronene og blir et negativt ion, mens det andre atomet mister negativ ladning og blir et positivt ion. Na → Na+ + e– Cl + e– → Cl– Na+ + Cl– → NaCl, vanlig koksalt Det vi får når negative og positive ioner har utliknet hverandre, som i NaCl ovenfor, kalles et salt. Salter er ofte løselige i vann. Bindingen i et molekyl bestemmer formen på molekylet, mens bindingen mellom molekyler gir stoffet egenskaper som kokepunkt og smeltepunkt.

H

Hydrogenbindinger. Det oppstår hydrogenbindinger mellom vannmolekylene fordi vannmolekylet er svakt positivt ladet ved hydrogen­ atomene og svakt negativt ladet ved oksygenatomet.


382

Organiske molekyler poly (gr.) – mange mono (gr.) – én

Organisk kjemi er karbonforbindelsenes kjemi, med noen få unntak. Cellene er bygd opp av organiske molekyler. I cellen foregår det mange forskjellige reaksjoner. En del av dem er beskrevet i kapitlene 8 Celleånding og 9 Foto­ syntese. Alle disse reaksjonene har noe felles. De bygger enten opp polymerer, eller de «river» polymerene fra hverandre. En polymer er mange enheter satt sammen i en lang kjede. Én enhet kalles monomer. Vi tar videre for oss karbo­ hydrater, nukleinsyrer, proteiner og fett og deres polymerer og monomerer.

Cellestruktur

Polymer

Monomer CH2OH O

Karbohydrat

H

HO

Stivelseskorn i kloroplast

H

H

Stivelse

OH

H

H

OH

OH

Monosakkarid

G

Fosfatgruppe C T

G

A

Nukleinsyre

A

C

P

T

T

O

T

C A

G

G

T

A

C

A

Nitrogenbase

A

OH T

5-karbon sukker

A

A T

C T

Kromosom

DNA-spiral

Nukleotid

G

Protein

Ala Ala Val

Filament

Ser

Polypeptid

CH3

H

Val

N

C

H

O C OH

H Aminosyre

O H H H H H H H H H H H HO C C C C C C C C C C C C H H H H H H H H H H H H

Fett

Fettsyre H H C O H

Fettvev

Polymere makromolekyler. 0107_Oversikt

Fire makromolekyler og deres monomerer.

Triglyserid

H C O H

H C H O H

Glyserol


Grunnleggende kjemi i biologien â&#x20AC;˘ 383

Funksjonell gruppe

OH eller HO

Molekylnavn

Strukturformel

R

Alkoholer

Eksempel

OH

H

Hydroksyl

H

C

C

H

H

OH

Etanol

H

O CHO

H

R

Aldehyder

H

C

Aldehyd

O

C

H

C H

H

Acetaldehyd

O CO

R

Ketoner

R

C

H

H

O

H

C

C

C

H

Keto

Karboksyl

H Aceton

H

O COOH

H

R

Karboksylsyrer

H

C OH

C

O C OH

H Etansyre

H

H NH2

R

Aminer

H

N

Amino

H

C

H N H

H Glysin

-O

O C

O OPO32â&#x20AC;&#x201C; Fosfat

SH

Organiske fosfater

R

O

P O-

Tioler

Sulfhydryl

R

SH

O-

H

C

OH

O

H

C

O

P

O-

H O3-fosfoglyserat

H

H

H

C

C

H

H

SH

Merkaptoetanol

0108_Funksjonelle_grupper.pdf

Tabell som viser disse funksjonelle gruppene. Det er de funksjonelle gruppene til molekylene som gir dem deres egenskaper. Tabellen viser de funksjonelle gruppene i de organiske molekylene som er mest relevante i Bi 2.


384

Karbohydrater Karbohydrater finnes i alle levende organismer og er viktige deler av for eksempel celleveggen til planter. Cellulose, som er det mest utbredte organiske stoffet på jorda, er et karbohydrat. Karbohydratene har to hovedfunksjoner i cellen: 1 Energikilde 2 Byggekloss for cellen slik at cellen kan bygge opp andre molekyler Det er vanlig å dele karbohydratene inn i grupper etter hvor mange enheter de består av: di (gr.) – to

Navn

Antall enheter

Eksempel

saccharide (gr.) – sukker

Monosakkarider

1

Glukose, fruktose

Disakkarid

2

Sukrose (vanlig sukker), laktose

Polysakkarider

Mange

Stivelse, cellulose, glykogen

Karbohydratene får navn som ender på -ose. Monosakkaridene deles inn etter hvor mange C-atomer de har, og får et felles navn etter dette. For eksempel heter alle monosakkaridene som har seks karbonatomer, heksoser. Når monosakkaridet får fem eller flere karbonatomer (de kan maksimum ha ni karbonatomer), danner de ofte ringstrukturer.

6

CH2OH

5

H

O 1

C

H HO

Fire former av D-glukose. D-glukose kan forekomme på fire ulike former. Enten som et lineært molekyl, eller som et molekyl med ringstruktur. Ringstrukturen kan igjen være på α- eller β-form. Forskjellen mellom disse to formene ligger i hvordan OH-gruppen er organisert på det første karbonatomet, angitt som 1 på figuren.

H H H

2

C

3

C

4

C

5

C

6

C

O H

H

1

4

H

HO

3

OH

6

H OH OH

CH2OH

5

H

H

H O

HO

OH H

D-glukose

H OH

α-D-glukose

H

H

C1

2

6

OH

CH2OH

5

H

O OH

H

1

4

D-glukose

HO

OH 3

H

β-D-glukose

0111_D_glukose.pdf

OH

2

O

H

4

3

OH

OH

H 2

OH

H


Grunnleggende kjemi i biologien â&#x20AC;˘ 385

Navnsetting av karbohydrater.

Navn

Antall C-atomer

Eksempel

Figur O

H C

Triose

3

Glyseraldehyd

H

C

OH

H

C

OH

H

Glyseraldehyd

C

H2OH

0109_1_Glyceraldehyd.pdf

Tetrose

4

Ribulose

C

O

H

C

OH

H

C

OH

CH2OH

Ribulose

O

H

0109_2_Ribulose.pdf C

Pentose

5

Ribose

C

OH

C

OH

C

OH

CH2OH

Ribose

0109_3_Ribose.pdf O

H

C

Heksoser

6

Glukose, fruktose, galaktose

H

C

OH

HO

C

H

H

C

OH

H

C

OH

CH2OH

Glukose

0109_4_Glukose.pdf


386

I gruppen karbohydrater er det en enorm variasjon. Noe av grunnen til dette mangfoldet er at monosakkaridene kan fungere på forskjellige måter, til tross for at de har like mange C-atomer. De finnes som åpne molekyler og som molekyler med ringstruktur. Ringstrukturen kan være i α-form og i β-form, se figuren på side 384. Med åpen struktur på et monosakkarid mener vi den strukturen som er vist lengst til venstre på figuren, og ringstrukturen er vist i midten. Når for eksempel heksosen glukose lager en ringstruktur, blir det forandringer fra den åpne strukturen for karbonatomene 1 og 5. Noen ganger er OH-gruppen opp på karbonatom 1, og da har vi en β-form av glukose­molekylet. Dersom OH-gruppen er ned på det første karbonatomet, er det derimot en α-form. Monosakkaridene veksler mellom disse tre formene, D- ringstruktur, ring­ struktur med β-form og ringstruktur med α-form. Glukose­molekylet har derimot en fastere ringstruktur enn mange av de andre monosakkaridene, og det er mer i α- eller β-form enn i D-ringstruktur.

Nukleinsyrer Nukleinsyrer er polymerer som er spesialisert for å lagre, overføre og bruke genetisk informasjon. Det er to typer nukleinsyrer, DNA (deoksyribonukleinsyre) og RNA (ribonukleinsyre). Den genetiske informasjonsflyten i en celle går fra DNA til mRNA og så til proteiner. En nukleinsyre er bygd opp av nukleotider, som består av en pentose, en organisk base og en fosfatgruppe. Nukleotid. Et nukleotid består av tre enheter: en fosfatgruppe, en pentose og en base.

Base Base

+

+ Ribose eller deoksyribose

Base

P P Fosfat

= Nukleotid

0113_Nukleotid.pdf Ryggen på en nukleinsyre består av en binding mellom en fosfatgruppe og neste pentose. Denne bindingen er en fosfodiesterbinding og skjer mellom det femte karbonatomet i en pentose og det tredje karbonatomet i neste pentose. Derfor kan vi også angi retningen på en nukleinsyre fordi den enden som ikke har en fosfatgruppe på karbonatom 3 (men derimot en OH-gruppe), er 3’ enden. Den andre enden blir 5’ ende, se figuren på neste side.

Det er fem organiske baser som kan knyttes til pentosen. Disse organiske basene skiller vi i to grupper, pyrimidiner og puriner (se figuren på neste side). Det er også faste regler for hvilke baser som parer med hverandre. Guanin (G) baseparer alltid med cytosin (C). Adenin (A) i en DNA-tråd baseparer alltid med tymin (T), mens vi i en RNA-tråd alltid får basepar med en uracil (U).


Grunnleggende kjemi i biologien • 387

RNA (enkeltrådet) Fosfodiesterbinding

5’ ende

5’ ende

Ribose

O P

-O

DNA (dobbeltrådet)

O

-O

O H2C

O

U

O

O

-O

OH

P

-O

G

O

O

C

O

G

-O

A

O

H2C

OH

OH

3’ ende 5’

O

A

O

T

3’

OH

Deoksyribose

1’

OO

P

OO

3’

CH2

5’

O

HO

O

4’

P

O

O

O

3’ ende

O

CH2

P

N

O-

CH2

O

O

O

P

O

H 2C

NH

H2C 5’ O

C

P

O

OH

P

G

O

O

O

NH O

O

-O

C

O

O

-O

CH2

O

O

NH

O

A

P H2C

O H2C

T

O

NH NH

O

O

O

O O

3’ ende OH

O

O O

H2C

OH

H2C

O

P

-O

P

NH

OH

O

Hydrogenbinding

Fosfat

O

OH

P

OO

5’ ende

2’

Nummereringen av ribosekarbonene er utgangspunktet for identifikasjonen av 3’ og 5’ ende i RNA og DNA

0112_Nukleinsyrer.pdf Pyrimidiner NH2

O

C

C

HC

N

HC

C

N H Cytosin (C)

H3C

C

C

NH

HC O

O HC

C

HC O

N H Tymin (T)

NH C O

N H Uracil (U)

Puriner N

NH2

O

C

C

C

N

N

HC

NH

C

HC N H

C

CH N

Adenin (A)

N H

C

C N

NH2

Guanin (G)

0114_Pyrimidiner.pdf Pyrimidiner og puriner. De fem ulike organiske basene er delt i to grupper: pyrimidiner og puriner.

DNA- og RNA-molekyler er nukleinsyrer. I DNA er basene festet til deoksiribose. Det er en pyrimidinbase som er unik for DNA, og det er T. Hydrogenbindinger mellom pyrimidiner og purinene holder de to DNA-trådene sammen. Det er tre hydrogen­ bindinger mellom C og G, mens det er to mellom A og T. I RNA er basene festet til ribose. RNA har pyrimidinene U der hvor det i DNA ville vært pyrimidinen T.


388

Forskjellen mellom RNA og DNA.

Nukleinsyre

Pentose

Organisk base

Dobbelttrådet

DNA

Deoksyribose

Adenin, Cytosin, Guanin, Tymin

Ja, som oftest

RNA

Ribose

Adenin, Cytosin, Guanin, Uracil

Nei, sjelden

De aller fleste DNA-molekylene foreligger som dobbelttrådete helikser, men DNA kan også forekomme som enkelttrådet. Trådene blir holdt sammen av hydrogenbindinger, og trådene som ligger motsatt vei, er antiparallelle. Det vil si at 3’-enden alltid baseparer med en 5’-ende, se figuren på side 387. ATP (adenosin trifosfat) er også en nukleotid, men har helt andre oppgaver. Den er energibærer, se side 395.

Proteiner Funksjonen til proteinene er mangfoldig og ofte svært spesialisert, se tabellen på side 398 og figuren under. Dannelsen av proteiner kan du lese mer om i kapittel 3 Fra gen til protein. A

Struktur Primær

Sekundær

Tertiær Kvartiær

B “av” “på”

Funksjon

Regulering

Oversikt over proteinenes struktur og funksjon. Proteiner har svært mange funksjoner i en celle og i en organisme. De er spesialiserte og viser et stort mangfold.

Signal

A Struktur

Transport B Bevegelse

0528_Proteinstruktur.pdf

Katalysator


Grunnleggende kjemi i biologien • 389

De tjue aminosyrene som kan settes sammen til protein. R er den gruppen som varierer mellom aminosyrene, og * betyr at aminosyren er essensiell for mennesket, altså at vi ikke kan produsere den selv.

NH2 C

+

NH2

NH

CH3 H 2N

C

C

H

O

OH

H 2N

Alanin

CH2

NH2

CH2

C

CH2

CH2

C

C

H

O

OH

H 2N

H 2N

C

C

H

O

OH

H 2N

Fenylalanin*

C

O

SH

CH2

C

C

H

O

OH

H2N

CH2

C

C

H

O

OH

H2N

O

C

CH2

CH2

CH2

CH2

C

C

H

O

OH

Glutamin

H 2N

C

C

H

O

HC

+

NH

O

CH C

C

H

O

OH

H 2N

Glutaminsyre

NH

CH2

H

C

OH

Cystein

Asparaginsyre

O–

NH2

CH2

O

Asparagin

Arginin

C

O–

C

C

H

O

OH

H2 N

C

C

H

O

OH

Histidin

Glycin

+

NH3

CH3 CH3

CH2 H

C

CH3

H 2N

C

C

H

O

OH

H 2N

Isoleucin*

CH2

CH3

CH3

CH2

S

CH

CH2

CH2

CH2

CH2

CH2

C

C

H

O

OH

H2N

Leucin*

C

C

H

O

OH

H 2N

Lysin*

CH2

C

C

H

O

OH

H2C

CH2

H2 N

C

C

H

O

Metionin*

OH

Prolin

OH NH

CH2 H2N

C CH

CH3

OH

C

C

H

O

OH

Serin

12_16 Aminosyrer

H

C

OH

H 2N

C

C

H

O

Treonin*

CH3

CH2 OH

H 2N

CH2

C

C

H

O

Tryptofan*

OH

H2 N

C

C

H

O

Tyrosin

OH

CH3

CH

H2N

C

C

H

O

Valin*

OH


390

Aminogruppe H

H N H

Karboksylsyregruppe

C

O C

R

OH

Variabel sidekjede

Generell aminosyre. Det er 0115_Aminosyre.pdf den kjemiske gruppen som er festet til R på figuren, som avgjør hvilken aminosyre det er. Resten er felles for alle aminosyrene.

Det er via proteinsyntesen proteiner blir bygd. Alle proteiner består av amino­ syrer. Det er tjue forskjellige aminosyrer, og det er sidegruppene, markert med R på figuren, som gir dem ulike egenskaper og dermed ulike funksjoner. Når aminosyrer blir bundet sammen, blir det spaltet av et vannmolekyl. Det kalles kondensasjonsreaksjon. Funksjonene til proteinene.

Funksjon

Eksempler

Struktur

Komponenter i celleveggene, inne i cellen, negler, flageller, cilier og muskler

Enzymer

Laktase, helikase

Regulering

De hormonene som er proteiner, for eksempel insulin

Transport

Kanaler og pumper i cellemembranen, se Bi 1 kapittel 3.3

Forsvar og angrep

Antistoffer er viktige bestanddeler av immunsystemet vårt; mange organismer lager skadelige/giftige proteiner for å forsvare seg

Hvilke aminosyrer som skal bygge opp et protein, og i hvilken rekkefølge de skal komme, er bestemt i genene våre og blir uttrykt gjennom proteinsyntesen. Essensielle aminosyrer er aminosyrer som kroppen ikke kan produsere selv. I spedbarnsalderen har mennesket behov for ni essensielle aminosyrer, mens det etter spedbarnsstadiet kan danne én av disse aminosyrene selv (cysteine).

Fett hydrofob – frykt for vann

Fett (lipider) er en stor og divers gruppe organiske molekyler. Men felles for molekylene er at de ikke er løselige i vann på grunn av de mange upolare kovalente bindingene. Derfor kaller vi dem hydrofobe stoffer. Polymeren til mange fettstoffer er triglyserid, en forbindelse med tre fettsyrer som har reagert med den treverdige alkoholen glyserol. En binding mellom en alkohol og en fettsyre kalles esterbinding. En fettsyre består av lange upolare kjeder med en polar karboksylsyregruppe, se figuren øverst neste side.

070207_Fosfolipid1

Mettet og umettet fettsyre. 070208_Fosfolipid2

Fett og oljer kan ha enkle og doble bindinger i de lange fettkjedene. De fettkjedene som utelukkende har enkeltbindinger, er mettede fettsyrer. Fettkjeder med én eller flere dobbeltbindinger er umettede eller flerumettede. Oljer er fettstoffer som er væsker ved romtemperatur. I tabellen på neste side finner du noen av hovedgruppene av lipider og deres funksjoner. Det er i hovedsak fettsyrer og glyserolbundne vannuløselige stoffer vi tenker på som lipider. Vitaminene i tabellen er fettløselige.


Grunnleggende kjemi i biologien • 391

H H

C

OH

H

C

OH

+

H

H

O

C

HO

C

C

H

C

C

H

H

H

H

C

C

H

H

H

H

C

C

H

H

H

H

C

C

H

H

H

H

C

C

H

H

H

H

C

H

H

H

H C H

Triglyserid. H C

H

H

Fettsyre C

H

OH H2O

H Glyserol

+ 2 fettsyrer til

H H

C

O O

C

H C H

O H

C

O

C

H C H

O H

C

O

C

H C

H H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C H H C H H C H

H C

H

H H C

H

H H C

H

H

0116_Fett1.pdf Ulike lipider.

Type lipid

Funksjon

Eksempel

Fett og olje

Næring (gir omtrent tre ganger så mye energi per enhet som sukker og proteiner), isolerer mot støt og kulde

Olivenolje, margarin

Fosfolipider

Danner barrierer mot vann i cellemembranen og lager biologiske membraner, er utgangspunkt for syntese av flere signalmolekyler i kroppen

Fosfolipider i cellemembranen, DAG og IP3

Karotenoider

Lysfangende pigmenter, gir farge og er forløperen for produksjon av vitamin A hos mennesker

β-karoten er ett av hjelpepigmentene i det lysfangende komplekset i fotosyntesen

Steroider

Hormoner, er forløper for vitamin D2 og gallesalter

Kolesterol og testosteron

Myelin

Fettlag som øker hastigheten på en nerveimpuls

Voks

Forsvarer mot uttørring og angrep fra sopp og bakterier, «honeycombs»

Kutikula på blader, blir utskilt av voks på hår/fjærdrakt

Vitaminer

Viktige for synsfunksjonen, blodlevring, absorpsjon av Ca2+ og PO42–, antioksidanter

Vitaminene A, D, E og K er fettløselige


392

Vann, pH-verdi, syrer og baser Omne vivium ex aqua – intet liv uten vann

Vann er et svært viktig stoff for alt levende, og det levende har oppstått i vann. Livet utviklet seg i vann over tre milliarder år før det ble liv på land. Alle organismer trenger vann for å vokse og reprodusere seg. Mennesket består av ca. 70 % vann, og vi merker fort om vi får for lite av dette stoffet. Mange av de unike egenskapene til vann ligger i den måten molekylet er bundet sammen på. Vann er altså et polart og lite molekyl. Det kan forekomme i tre faser: fast, væske og gass. Mellom vannmolekylene blir det skapt hydrogenbindinger som er med på å gi vann mange av dets egenskaper.

Vannmolekylets struktur er viktig. a Ett enkelt vannmolekyl har to svakt positive ladninger og en svakt negativ ladning. På grunn av disse kreftene vil det være en fast vinkel mellom hydrogen­beina c i molekylet. b På grunn av ladnings­ forskjellen vil det oppstå hydrogenbindinger mellom vannmolekylene.

δ(-)

a)

b) H

O δ(+)

H

H

H

O

O δ(+)

δ

O H

δ(-) O

δ(-)

δ(+) H

δ(+)

Hydrogenbindinger

(-)

H

δ(-)

c)

δ(+)

H

H

δ(+)

105° Vinkelen mellom de to hydrogenbeina er fast, 105°

δ(+) (+) H δ

H δ(-)

O

δ(+) H

H δ(+) O δ(-)

H

0603_Vannmolekyl pH-verdi

Om en løsning er sur eller ikke, kan uttrykkes ved hjelp av pH-verdien til løsningen eller hvor på pH-skalaen løsningen er. Skalaen er logaritmisk og går fra 0 til 14. Når en løsning er nøytral, ligger verdien rundt 7 (rent vann), mens pH-verdier under 7 blir betraktet som sure og over 7 som basiske. Det at skalaen er logaritmisk, betyr at for eksempel en væske med pH-verdi 8 er ti ganger mer basisk enn en væske med pH-verdi 7. De aller fleste organismene er svært følsomme for variasjoner i pH-verdien. Det løser de ved å bruke ulike stoffer som buffere. En buffer kan dempe virkningen av den syren eller basen som blir tilført. Buffer er en løsning som kan reagere med både en syre og en base. Dermed endrer ikke pH-verdien seg noe særlig i en slik løsning. Mennesker bruker for eksempel bikarbonat og karbonsyre som buffer og transportør av CO2, se figuren på neste side.


Grunnleggende kjemi i biologien • 393

[H+] mol/l 100 = 1

pH 0

pH 0

Sterkt sur

1 2 3 Svakt sur

Magesaft Sitronsaft Brus

4 5

Svart kaffe

6

10-1 = 0,1

1

10-2 = 0,01

2

10-3 = 0,001

3

10-4 = 0,0001

4

10-5 = 0,00001

5

10-6 = 0,000001

6

pH-skala. Figuren viser pH til en del vanlige produkter og konsentrasjonen av H+ ved ulik pH.

Spytt (6–8) Nøytral

7

Destillert vann, melk

10-7 = 0,0000001

Nøytral 7

Blod

8 9 Svakt basisk 10

11 12

10-8 = 0,00000001

8

10-9 = 0,000000001

9

Sjøvann

Husholdningssalmiakk

13 Sterkt basisk 14

10-10 = 0,0000000001

10

10-11 = 0,00000000001

11

10-12 = 0,000000000001

12

10-13 = 0,0000000000001

13

10-14 = 0,00000000000001

14

I naturen fungerer kalkrik berggrunn som buffer for sur nedbør fordi forvitring 0119_pH_skala.pdf av en kalkrik berggrunn er med på å produsere hydrogenkarbonationer/ bikarbonationer (HCO3–), som kan nøytralisere den sure nedbøren. Det skjer ikke i nevneverdig grad i sjøen, og dermed er økt CO2 i atmosfæren med på å forsure havet, og blir i sin tur en trussel for organismene i havet.

+

Vann (H2O)

+

Karbondioksid (CO2)

Karbonsyre (H2CO3)

0120_Bikarbonat.pdf Syrer

Syrer er stoffer som kan avgi protoner (H+). I en sur løsning er det derfor flere H+ enn i rent vann. I magesekken hos mennesket skiller vi ut hydrogenklorid, (saltsyre, HCl), som er en sterk syre, og dette er årsaken til at pH-verdien i magesekken ligger rundt 2.

Bikarbonat-ion (HCO3–)

Proton (H+)

Bikarbonat som buffer. Når CO2 reagerer med vann, dannes karbonsyre (H2CO3). Denne spaltes lett til bikarbonat og frigjør H+. Reaksjonen kan også gå motsatt vei.


394

Baser Baser er stoffer som har evnen til å ta opp H+. I en basisk løsning er det derfor færre H+ enn i rent vann. I fordøyelsen hos mennesket må pH-verdien økes når magesekken tømmer seg gradvis ut i tolvfingertarmen. Tolvfingertarmen fungerer som en buffersone, og her blir det blant annet skilt ut bikarbonat (HCO3–) som tar opp H+ og blir til karbonsyre (H2CO3).

Redoksreaksjoner Reduksjonsreaksjoner og oksidasjonsreaksjoner kalles ofte samlet redoks­ reaksjoner. Det er en gruppe av kjemiske reaksjoner som omfatter opptak og/ eller avgivelse av elektroner. Reduksjonsreaksjoner er reaksjoner hvor et atom får elektroner og blir redusert: Cu2+ + 2e– → Cu En oksidasjonsreaksjon er en reaksjon hvor et atom avgir elektroner og blir oksidert: Zn → Zn2+ + 2e– Redoksreaksjonen: Zn + Cu2+ → Zn2+ + Cu + energi. Disse reaksjonene er knyttet til hverandre. Samlet kan vi da tenke på redoks­ reaksjoner som reaksjoner som har en elektrondonor og en elektronmottaker. Alle forbrenningsreaksjoner er redoksreaksjoner. Slike reaksjoner skjer også i celler. Men i en celle blir gjerne flere reaksjoner koplet slik at det ikke blir frigjort så mye varmeenergi som ved å forbrenne propan på blusset. I redoks­reaksjoner i cellen, for eksempel elektrontransportkjedene i fotosyntesen og celleåndingen,

+

Forbrenning av propan. Redoksreaksjon er avgivelse og opptak av elektroner. Karbon «avgir» elektroner og blir oksidert til karbondioksid. Oksygen «får» elektroner og blir redusert til vann.

+

C3H8

+

5 O2

3 CO2

Propan

+

Oksygengass

Karbondioksid

Reaktanter

0121_Propan.pdf

+

+

+

4 H2O

+

Varme og lys

Vann

+

Energi

Produkter


Grunnleggende kjemi i biologien • 395

blir elektroner overført fra et atom i ett molekyl til et atom i et annet molekyl. Når det skjer, følger det ofte med et proton (H+). I biologiske systemer innebærer derfor en reduksjon ofte at det blir lagt til H+, og oksidasjon at det blir fjernet H+. Når disse reaksjonene skjer samtidig, kan H+ transporteres inn i og gjennom en membran uten nevneverdig bruk av energi og nydannelse av transportmolekylet. Et eksempel er NAD+ + 2e– + 2H+ → NADH + H+ i celle­åndingen, mens det i fotosyntesen er NADP+ + 2e– + 2H+ → NADPH + H+.

Energi- og elektronbærere Det er mange stoffer som bidrar til å drive de mange kjemiske reaksjonene som omformer energi i organismer. Du møter her noen av dem som står sentralt i biologien, særlig innenfor emner som fotosyntese og celleånding.

ATP – AdenosinTriFosfat ATP er et molekyl som cellen bruker til å lagre energi, og det gir energi til energikrevende reaksjoner og prosesser. ATP er bygd opp som en enhet satt sammen av tre forbindelser: 1 Et nukleotid, adenin 2 En pentose, ribose 3 Tre fosfatgrupper

ATP – AdenosinTriFosfat

Bindingene mellom de to ytterste fosfatgruppene er ustabile og er angitt på figuren med en krøll (~). Det kreves mye mindre energi å bryte dem enn det de selv frigjør. Derfor sier vi at ATP er en energibærer, og at det gir fra seg energi når det blir spaltet av en fosfatgruppe. Når en organisme skal lagre energi over lengre tid, lagrer den energien i form av fett eller stivelse. ATP → ADP + Pi + energi

ADP – AdenosinDiFosfat

ADP → AMP + Pi + energi

AMP – AdenosinMonoFosfat H

H

C N

N

N C

H

C

C

N N

C H

H

OH

C C

H

O HH C

Fosfat

O

C

O

C H H

OH Adenosin 12_23 Defosforylering

P O-

O O

P O-

O O

P O-

O


396

Disse to reaksjonene kan også gå motsatt vei, og det er en fosforylerings­ reaksjon. Pi står for uorganisk fosfat (aniondelen av fosforsyre). Cellen lager ATP på to forskjellige måter: 1 Direkte fosforylering 2 Ved hjelp av en skapt protongradient, via fotofosforylering og oksidativ fosforylering (fotosyntesen og celleåndingen) Ved en direkte fosforylering er det enzymer i cytosol som overfører en fosfat­ gruppe fra et energirikt organisk molekyl til ADP, og det blir produsert ATP. ADP + Pi → ATP Når det blir skapt en protongradient over en membran, kan celler bruke den energien som ligger i den skapte spenningsforskjellen. Det blir gjort i fotosyntesen og i celleåndingen, se kapittel 8 Celleånding og 9 Fotosyntese. Protonene går gjennom et proteinkompleks, som er enzymet ATP-syntase. ATP blir brukt til syntese av nye stoffer i cellen, og til bevegelse og transport av stoffer.

FAD – FlavinAdeninDinukleotid FAD er et koenzym som kan motta eller avgi to protoner og to elektroner når det er fullstendig redusert. Denne egenskapen blir for eksempel brukt i krebssyklusen. Koenzym er et organisk molekyl som binder seg til enzymet, og da blir det dannet et produkt. FAD + 2H+ + 2e– → FADH2 FAD er bygd opp av to nukleotider, adenosinfosfat og ribotol. Til ribotol er det knyttet en nitrogenholdig base, og de to enhetene kalles til sammen riboflavin. Dette stoffet kan vi ikke lage selv, men vi får det i oss som et vitamin, B2vitaminet.

NAD (P) – NiacinAdeninDinukleotid (fosfat) NAD er et koenzym som kan motta eller avgi to elektroner og ett proton når det er redusert. Denne egenskapen er blant annet brukt i celleåndingen. NAD+ + H+ + 2e– → NADH NAD+ inneholder to riboser, adenin og en niacinamid/niacin. NADP har bare en ekstra fosfatgruppe, se figuren, sammenliknet med NAD. NADP blir brukt i syntesedelen i fotosyntesen. Niacin er et B-vitamin.


Grunnleggende kjemi i biologien • 397

NAD+

H

(Oksidert)

C

NAD.

NADH

O

H

(Redusert)

NH2

H

Reduksjon

O C

+ 2 e– + H+

NH2

Oksidasjon

N+

O

P

P O

O H

O–

H HO

HO

CH2

P

O– H

O O

NH2 N

P O

O

CH2

O

O–

O O

O

CH2

O

N

O–

H HO

HO

CH2

N

H N

H HO

HO

N

H

O

H

NH2 N

N

H

N O

H

N

H HO

HO

0124_NAD_NADH.pdf

Kofaktorer En kofaktor er en del av enzymet som er nødvendig for at enzymet skal fungere. Kofaktorer kan være uorganiske eller organiske. Er de organiske, kalles de ofte prostetisk gruppe. Typiske kofaktorer er metallionene jern (Fe2+/ Fe3+), magnesium (Mg2+), mangan (Mn2+), kopper (Cu2+) og sink (Zn2+). Kofaktorene er særlig viktige i redoksreaksjoner fordi de bidrar til elektronoverføring.

H


398 • Å svare på spørsmål i biologi

Å svare på spørsmål i biologi Tips til oppgavene som vises her finner du på www.gyldendal.no/bi

Biologi er et muntlig, skriftlig og praktisk fag. Oppgaver du kan få på eksamen og i andre sammenhenger vil ofte inneholde alle disse tre fremstillingsmåtene og metodene i faget. Eksamen kan være skriftlig og muntlig, og svært ofte har begge eksamensformene innslag av praktisk arbeid. Siden biologi er et teksttungt fag vil vi her gi noen tips primært knyttet til hvordan du kan jobbe med ulike oppgaver i Biologi 2 med sikte på en best mulig skriftlig besvarelse. Biologi som skriftlig fag i videregående skole har mange ulike sjangre. Du skal vise din faglighet på svært mange måter, og det krever trening. Biologi kan ofte bli mange ord, og eksamenssettene er intet unntak. Derfor er det særlig viktig å kunne finne ut hva du skal bruke teksten til, og hva du blir bedt om å svare på i oppgavene. Tid er som oftest den begrensende faktoren for mange elever, og øvelse kan gi deg muligheten til raskt å se hvor du bør bruke tiden din i eksamenssettet.

Hvilke oppgavetyper du kan forvente å få på skriftlig eksamen i Biologi 2 Den skriftlige eksamenen i Biologi 2 er todelt. Første del inneholder flervalgsoppgaver knyttet til alle hovedområdene i læreplanen, også hovedområdet ”Den unge biologen”. Del 1 har også oppgaver som skal besvares med egenprodusert tekst og figur. De kalles for kortsvarsoppgaver. På denne delen av eksamen har du ikke lov å bruke noen former for hjelpemidler. Den andre delen av eksamen består ofte av to eller tre hovedoppgaver med mange underoppgaver. Disse oppgavene er gjerne knyttet til en tekst, noen gitte data (i for eksempel en tabell og/eller en graf) og/eller et forsøk som du må sette deg inn i. I denne delen kan du benytte alle ikke-kommunikative hjelpemidler, men du må selvsagt oppgi kilde til slik kunnskap og referere korrekt til den. Mer om kildebruk på side 401.

Flervalgsoppgaver Flervalgsoppgaver er oppgaver der du blir bedt om å velge blant fire eller fem faglige påstander knyttet til et utsagn eller et spørsmål. Som regel blir du bedt om å finne det riktige svaret. Mye av trikset for å løse flervalgsoppgaver godt


Å svare på spørsmål i biologi • 399

er, i tillegg til å kunne stoffet godt, å ha en strategi i møte med dem og ikke bruke for mye tid. Å bruke 10 – 15 min. på en flervalgsoppgave kan være en dårlig investering i og med at du får dårligere tid på de delene av eksamen hvor du selv skal utforme teksten og ofte kan hente flere poeng. Her kommer noen tips når du skal løse flervalgsoppgaver: • Hva spør oppgavene om? Dette kan virke dumt, men det er svært viktig at du er helt sikkert på hva du skal svare på. Hold gjerne hånda eller et ark over svaralternativene så du ikke fristes til å lese dem for å tenke deg til hva spørsmålet er. Vet du at dette kan du for dårlig til å svare raskt på det, så la det vente – gjør det du kan først! Dessuten kan svaralternativene ofte forvirre. Tenk ut et svar før du ser på svaralternativene Dette er en god strategi da den kan gi deg to gevinster – raskt å kjenne igjen svaret og også psykologisk – du vet svaret og leter etter en formulering som stemmer med din. • Stryk ut gale svar • Par med motsatte svar • Ta pauser Det er krevende å være så konsentrert. De fleste blir slitne og slurver et stykke ut i flervalgsoppgavene. Ta derfor pauser, og jobb rasjonelt. Begynn eventuelt på kortsvarsoppgavene og vend tilbake til flervalgsoppgavene litt senere. • Bruk blyant Bruker du blyant fungerer det som en kladd, og du kan pusse ut eventuelle gale svar eller formuleringer

To eksempler på flervalgsoppgaver Eksempel 1. Denne oppgaven er teksttung, og krever at du leser teksten og tabellen grundig. Likevel er det en faglig sett god oppgave da den gir deg mulighet til å vise at du kan flere emner innenfor biologifaget. Et mål på effektiviteten til fotosyntesen kan være (1) energien som trengs for å fiksere et molekyl CO2 eller (2) forholdet mellom hvor mye vann som transpireres og mengden CO2 fiksert i fotosyntesen. Tabellen under viser verdiene for tre ulike plante­arter. Plante A

Plante B

Plante C

3:1

5:1

6,5 : 1

700 : 1

300 : 1

70 : 1

Energibehov (forholdet mellom ATP brukt og CO2 produsert) Transpirasjonsforholdet (forholdet mellom antall H2O og antall CO2)

Hvilken påstand om fotosyntesen i planter er riktigst? A Plante B er best tilpasset tørre omgivelser med høy temperatur B Plante B krever mer energi, men de bruker mindre vann enn plante A og plante C C Plante C krever mer energi, men de bruker mindre vann enn plante A og plante B D Plante A krever mer energi, men de bruker mindre vann enn plante B og plante C


400 • Å svare på spørsmål i biologi

Eksempel 2. Dette er en klar ”pugge og reprodusere” oppgave som ikke er uvanlig som flervalgsoppgave. Hvilke av disse er produkter av fotosyntesens fotodel/lysavhengige del som brukes i Calvin syklus/syntesedelen? A ADP og NADH B CO2 og H2O C ATP og NADPH D C6H12O6 og O2

Disse to flervalgsoppgavene er ikke like enkle og vil kunne bli vektet noe ulikt ved prøver eller eksamen. Ikke nødvendigvis i poeng, men ved at oppgavetype 1 vil kunne kreve noe mer tid enn oppgavetype 2.

Kortsvar uten hjelpemidler Kortsvarsoppgaver uten hjelpemidler er oppgaver som gjerne omhandler et tema og er mer spesifikke i spørsmålstillingen. Det kan for eksempel være slik: Sett opp en energikjede fra det økosystemet du har jobbet mest med. Angi organismene med artsnavn fra det økosystemet du hadde feltarbeidet ditt.

• Hva spør oppgavene om? Dette kan virke dumt, men det er svært viktig at du er helt sikkert på hva du skal svare. Du får raskere en bedre struktur på besvarelsen din når du kan gå rett inn i gang med besvarelsen og ikke skal ”innom alt for å få noen poeng”. Er du usikker så la den vente litt. Når du vender tilbake til oppgaven, les den på nytt og se etter nøkkelbegreper. Kan du forklare disse er du godt på vei til å svare på spørsmålet. Fra oppgavene over vil nøkkelbegrepene kunne være energikjede og arter fra feltarbeidet/valgt økosystem. • Disposisjon og stikkord Det er viktig å ikke «skrive seg bort» på disse oppgavene. Lag en disposisjon med stikkord som du skal ha med i svaret ditt. Bruk faguttrykk der du kan, det gir økt presisjon i svaret og er et krav for en karakter over middels. Les spørsmålet en gang til etter at du har skrevet en disposisjon: har jeg svart på spørsmålet? • Lag en figur Bruk en tegning, graf eller skisse til å underbygge det du skriver. Ofte kan mange detaljer som det er vanskelig å skrive i korrekt rekkefølge derimot tegnes rett. Ingen sensor forventer profesjonelle figurer. Figur kan gjerne brukes som en introduksjon til svaret ditt også. Bruk tid gjennom året til å få på plass et utvalg av sentrale figurer i pensum som du kan så godt at «de sitter i hånda di». • Les alltid spørsmålet på nytt etter at du har svart, og se hvordan du oppfatter spørsmålet nå.


Å svare på spørsmål i biologi • 401

Svar med hjelpemidler Del to på eksamen inneholder fra to til tre store oppgaver med underoppgaver til. Oppgavene er som regel satt inn i en kontekst, noe som krever at du må lese en tekst og trekke ut vesentlig informasjon av den. I tillegg er det gjerne en graf, en figur og eller en tabell som gir deg informasjon. Det kan være vrient å hente ut kun nødvendig informasjon fra en slik tekst, og det er derfor viktig å trene på dette. Å markere nøkkelord i oppgaveteksten er ett tips. Husk at oppgaver hvor alle hjelpemidler er tillatt ikke i samme grad som oppgaver uten hjelpemidler er interessert i spesifikke detaljer. Slike oppgaver gir deg bedre uttelling om du viser at du kan anvende detaljene i en større sammenheng. Sørg for at du har svart kort og konsist på det oppgavene spør om. Sjekk med disposisjonen din og les oppgaven igjen. Du får ikke ekstrapoeng for ha med andre ting du kan, eller har slått opp om emnet. Slike oppgaver krever også redelighet med hensyn til bruk av kilder. Det skrivetekniske vil vi ikke omtale her, men noen viktige tips er: Å henvise til andre er svært viktig. Gjør du ikke dette så regnes svaret ditt som juks. Det er ulike regler for hvordan man referer i løpende tekst og hvordan du oppgir kildene dine i en kildeliste. Alt dette kan du ha en mal for liggende på datamaskinen din. Eksempel på kildemal finner du på www.gyldendal.no/bi.

Hva er hjelpemidler? Hjelpemidler på del 2 er alle ikke-kommunikative midler. Du kan bruke datamaskin og det er lov å ha lastet ned det du vil ha av hjelpemidler på datamaskinen. Noe av det mest fornuftige man kan gjøre med hjelpemidlene er å strukturere dem, og å ikke ha for mange av dem. Stort sett klager elevene over dårlig tid på denne eksamensdelen. Velg ut hjelpemidler tilhørende hvert hovedområde i læreplanen. I økologi er det lurt å ha ekskursjonsrapporten, i genetikk noen ferdig løste oppgaver innenfor de kategoriene du skal kunne. I genetikk vil vi også sterkt anbefale å ha en mal for krysningsskjema som tydelig viser de haploide kjønnscellene. Mal for krysningsskjemaet finner du også på www.gyldendal.no/bi. Hovedområdene evolusjon, energiomsetning og økologi knyttes gjerne sammen i en stor oppgave hvor alle hjelpemidler er tillatt. Av mer generelle hjelpemidler vil vi anbefale å ha med en gjennomarbeidet lærebok hvor du lett kan slå opp og hvor du gjerne har merket deg sentrale figurer som vil forenkle skriveprosessen. Du bør også ha en oversikt over relevante faguttrykk slik at du kan være sikker på at du har forstått oppgaveteksten og at du kan formulere et presist svar på oppgaven. Vår erfaring er at mange elever går seg vill i hjelpemidlene de har med seg, eller ikke bruker dem i det hele tatt. Vi vil anbefale å begynne med få hjelpemidler og bruke disse grundig slik at du kjenner dem godt og dermed bruker kort tid på å slå opp det du lurer på.

En oversikt over ord og fag­uttrykk i biologi vil være et nyttig hjelpemiddel.


402 • Å svare på spørsmål i biologi

Databaserte oppgaver Databaserte oppgaver er oppgaver hvor du må hente informasjon fra tekst og figur. Figurene er ofte en tabell og/eller en graf. Tabeller og grafer er svært viktige hjelpemidler i biologi, og i andre realfag. Typisk tabeller kan være slik som den under. Konsentrasjon Konsentrasjon Prosentvis før 1750 2012 endring 1750 – 2012

Effektivitet som drivhusgass

Levetid i atmosfæren

Kilder

Vanndamp

H2O Variabelt

Variabelt

-

0,1

Kort

Naturlige

Karbondioksid

CO2

0,028 %

0,038 %

36

1

50-200 år

Naturlige og menneske

Metan

CH4

0,00007 %

0,00018 %

157

21

12 år

Naturlige og menneskeskapte

Lystgass

N2O 0,000027 %

0,000030 %

11

310

310 år

Naturlige og menneskeskapte

Ozon

O3

0,0000025 %

0,0000034 %

36

Noen timer

Naturlige og menneskeskapte

Klorfluorkarboner

KFK

0

0,000003 %

-

Tusenvis av år

Kun menneskeskapte

1000-20 000

I en slik tabell er det viktig å få oversikt slik at du kan hente ut korrekt informasjon. Ofte er oppgavene nivådelt slik at det enkleste nivået er å hente ut informasjon og skrive med ord det som tabellen gir deg av informasjon. Slike spørsmål er av typen: Hvor mye høyere effektivitet som drivhusgass har metan sammenlignet med CO2? En mer kompleks oppgave, der du skal anvende den informasjonen du får i tabellen til å svare på et annet spørsmål, kan være: Drøft hvilken drivstoffgass du ville ha prioritert å endre dersom du skulle ha som mål å samlet senke drivhuseffekten? De mer komplekse oppgavene vil du få flere poeng for enn de enkle, men de er naturlig nok også vanskeligere å svare på og det er viktig å strukturere svaret slik at du kun svarer på det du blir bedt om å svare på.


Å svare på spørsmål i biologi • 403

En kompleks graf kan være som vist under.

gjennomsnittlig kolesterolnivå hos voksne personer (mg/100 cm–3)

220 210 200 190 180 170 160 150 130

140

150

160

170

180

gjennomsnittlig kolesterolnivå hos unge personer (mg/100 cm–3) (Kilde: Posada-Romero et al, Salud Publica de Mexico, 34 (2), side 157–167, 1992)

Grafen over er kompleks. Men det er god trening å lese slike grafer, og det er viktig at du selv øver på å bruke grafer i besvarelsen din. Er den for vanskelig så begynn med noen enklere. Det ligger tips på www.gyldendal.no/bi. Ordlyden i oppgaven vil ofte være som for tabeller. Noen ganger blir du også bedt om å skissere en ny graf basert på de samme dataene + noen nye som blir gitt i en tekst. Du skal angi med faglig begrunnelse, hvordan videre forløp høyst sannsynlig vil være. Dette er ofte knyttet til hovedområdene økologi og evolusjon. Vær påpasselig med grafene dine slik at du har med enheter, realistiske måltall/forhold osv. Når du blir bedt om å sammenligne eller drøfte kan være lurt å sette opp en tabell med de ulike argumentene i kladden din. Denne kan også brukes i besvarelsen, men ofte ber oppgaven om flytende tekst. Øv på dette og diskuter det med lærerne din.

Struktur og flyt i besvarelsen God struktur er alfa og omega – altså så godt som alt. En godt strukturert besvarelse viser at du har oversikt, kan anvende relevant fagstoff og fremstiller det korrekt. Et triks kan være å bruke «5–avsnittsmetoden» som en tommelfingerregel. Det betyr i korthet følgende: Innledning Tre argumenter - ett argument, ett avsnitt. Avslutning


404 • Å svare på spørsmål i biologi

Altså: Én og én ting av gangen! Se på eksempelet under. Nedenfor er det gjengitt et tenkt svar på følgende eksamensspørsmål fra 2011, del 1: Forklar kort virkemåten til enzymer og hvordan ytre faktorer påvirker enzymer og enzymreaksjoner.

Les svaret nedenfor, rett opp feil, og strukturer svaret. Lag også din egen disposisjon for hvordan du ville løst denne oppgaven. Det finnes mange enzymer i kroppen som alle har ulike funksjoner i kroppen. Som regel bidrar enzymer til ulike reaksjoner i kroppen. Enzymer er katalysatorer. En katalysator er et stoff som ikke inngår i reaksjonen som en reaktant, men som er med på å øke reaksjonshastigheten. Enzymet bidrar ved å senke aktiverings­ energien. Aktiveringsenergien er den energien som kreves for å få reaksjonen til å skje. Ved å minske denne kreves det mindre energi, og reaksjonen kan skje hurtigere. Enzymer er proteiner. Proteiner kan «ødelegges» eller denatureres ved endring av pH  eller ved for høye temperaturer. Enzymaktiviteten i reaksjoner kan også påvirkes, for eksempel ved høye temperaturer. Da vil reaksjonshastigheten gå raskere. Enzymer er ofte en minimumsfaktor i en reaksjon.

Tekstbaserte oppgaver er vanlig på del 2.Nedenfor ser du et eksempel på en slik oppgave og to tenkte besvarelser. Svarer disse elevene tydelig og presist på oppgaven? Er det god struktur og bruk av faguttrykk? Diskuter med en medelev. Oppgave 3 (våren 2011, noe endret) Emma og Karima er 14 år. Karima: Hvordan gikk det på sykehuset? Fant de ut hva som var i veien med deg? Emma: Jeg har en slags blødersykdom. Det er derfor jeg har sånn kjempekraftig menstruasjon som varer så lenge. Karima: Men jenter kan vel ikke få blødersykdom! Er det ikke bare gutter som kan bli blødere? Emma: Nei, jenter kan i alle fall få den typen blødersykdom som jeg har. Det heter vWD. Det er faktisk ikke så veldig sjelden heller, sa de. – Og det er like vanlig at jenter får det som at gutter får det. Karima: Hvor vanlig er det da? Jeg har aldri hørt om det før! Emma: Det er faktisk ganske mange som har det, kanskje én av hundre, sa legen, men de fleste merker lite til det og vet ikke engang at de har det. Karima: Får du medisin for det? Emma: Jeg har fått en nesespray som jeg skal bruke når jeg har mensen. Medisinen kommer over i blodet fra innsiden av nesen. Karima: Men du er ikke veldig syk, er du vel? Emma: Nei, jeg er ikke det, selv om de som har blodtype O, slik som jeg og mamma har, får sykdommen litt sterkere enn andre. Skulle ønske at jeg heller hadde arvet pappas blodtype. Han har blodtype A.


Å svare på spørsmål i biologi • 405

Karima: Hvordan har du fått denne blødersykdommen da? Er den arvelig? Emma: De har testet pappa og sier at jeg har arvet det fra ham, så han har genet i seg, men han føler seg helt frisk. Hvis mamma hadde hatt det, ville hun sikkert hatt slik menstruasjon som jeg har, men det har hun ikke. Legen ga meg en kopi av en side i en amerikansk bok for å forklare meg hvordan det virker med arven. Jeg er i alle fall heldig som ikke har arvet det fra både mamma og pappa, for de som får det fra begge foreldrene, blir visst virkelig syke. De får blåmerker bare du tar i dem, de blør neseblod for ingenting og må ta sprøyter for å holde seg friske. Heldigvis er det sjelden. Karima: Jeg kjenner en gutt i Oslo som har den andre blødersykdommen, den som vi har lært om på skolen, og som det ikke er vanlig at jenter får. Han tar sprøyter hele tiden. Han sier at det bare er én av fem tusen gutter som har det. Han er forresten ganske kul. Han heter Anders. Tenk om du og han ble sammen og du fikk barn med ham. Da ville vel alle bli blødersyke? Svar på disse spørsmålene: a Forklar om det Emma forteller er nok til at du kan si hvilken type arv det er snakk om. Blir vWD nedarvet kjønnsbundet eller autosomalt? vWD er en forkortelse for von Willebrandt disease. Forklar hvordan opplysningene i samtalen gjør deg i stand til å avgjøre om vWD blir nedarvet som en recessiv eller en dominant genvariant (allel). Kall genvarianten som gir sykdommen vWD for R og genvarianten for normal blodkoagulering for r. Kall genvariantene for ABO- blodtypene for A, B og (liten) o b Skriv opp de dihybride genotypene til Emma og foreldrene, og fortell hvordan vi kan vite at de må ha akkurat disse genotypene. c Sett opp et dihybrid krysningsskjema for ABO-blodtype og sykdommen vWD for foreldrene til Emma, og gjør greie for hvor stor sannsynlighet det er for at de skal få et barn med både blodtype O og vWD, slik Emma har. d Forklar ut fra genetisk kunnskap om det er riktig at jenter ikke kan få recessiv hemofili A (kjønnsbundet blødersykdom). Svar fra kandidat A Oppgave 3 a) Det Emma forteller er nok til å kunne si hvilken arv det er snakk om. Det kan ikke være Autosomalt arv fordi autosomale kromosomer er kromosomer i en organisme som ikke er kjønnskromosomer. Ved kjønnsbundet arv sitter et gen på et kjønnskromosom. Emma forteller at hun har arvet sykdommen fra faren sin og hvis vi ser på bildet legen har gitt henne så er det beskrevet hvordan det virker ved arv. Menn har XY kromosomer og kvinner har XX. Y kromosomet hos menn har veldig lite gener på den. Ut ifra de opplysningene kan vi si at nedarvingen er et dominant allel. Y kromosomet fra faren dominerer og derfor er det et dominant allel. b) Det jeg vet ut ifra mine biologi kunnskaper så har menn XY kromosomer og kvinner XX. I oppgave a) har jeg forklart hvorfor jeg tror Emma har genotype XY. c) Ikke besvart


406 • Å svare på spørsmål i biologi

d) Det er veldig lite sannsynlighet for det. Fordi jenter har to X-kromosomer. Derimot gutter de har et X-kromosom og et Y kromosom de trenger bare en mutasjon i X-kromosomet. Mutasjon vil si en forandring i struktur eller rekkefølge av baser i DNA, men i dette tilfellet siden det er stor del av kromosomet som blir påvirket av mutasjonene kalles det kromosommutasjon. Blodlevringsfunksjonen blir bestemt i X-kromosomet og siden jenter har et ekstra X-kromosom får de ikke blødersykdom med unntak til spesielle tilfeller1. 1

Wikipedia som kan brukes uten nett tilgang. Søkeord: blødersykdom og Bi2 s. 151

Svar fra kandidat B Oppgave 3 Etter hva Emma forteller, blir vWD nedarvet autosomalt. Først sier hun at det er like vanlig at jenter får det som at gutter får det; hadde det vært kjønnsbundet hadde det vært hvertfall litt forskjell på kjønnene. Menn har jo bare ett X-kromosom. Så sier hun at det er faren hun har fått det fra og at moren er helt frisk, og så viser hun fram den kopien. Her ser vi at faren har ett allel med sykdommen, og ett som er friskt. Begge morens alleler er friske. Hadde dette vært kjønnsbundet arv, måtte sønnene fått Y-kromosomet fra faren, nettopp for at de skal bli gutter. Dette gir ikke sykdom, fordi det altså ikke er noen gener på det. Fordi man arver halvparten fra far og halvparten fra mor, måtte derfor X-genet kommet fra moren. Siden begge hennes er friske, måtte sønnene fått et friskt allel til, og de ville ikke blitt syke. Men på kopien er den ene sønnen syk, altså kan det ikke være kjønnsbundet. Fordi hun sier at hun har fått det ene fra faren, men at faren virker helt frisk, tyder det på at han er «bærer» av sykdomsgenet. Da skulle sykdommet blitt arvet recessivt. Men fordi hun også sier at mange ikke merker at de har det, og fordi faren ikke får mensen, tyder det på at han kan være dominant syk likevel. At han har blodtype A som gjør at han får den svakere enn de med blodtype 0, tyder også på at han kan ha det dominant uten å merke det (Dette er tydeligvis et veldig svakt sykdomsgen). Når jeg ser på kopien blir jeg helt sikker. Hadde sykdommen vært recessiv, måtte de syke hatt to sykdomsgener. Men de har bare ett, og derfor kan jeg vite at sykdommen nedarves som et dominant allel på et autosomalt kromosom. b) R = vWD r = normal Ii/I0 = blodtype 0

IA = blodtype A IB = blodtype B

Emmas mor: fordi hun er helt frisk, må hun ha to små r. Hadde hun hatt en stor og en liten, ville hun vært syk, siden sykdommen nedarves som et dominant allel. Emma forteller også at moren har blodtype 0 – da er eneste mulige kombinasjon I0I0, fordi denne blodtypen er recessiv i forhold til de andre blodtypene. Emmas mor har altså genotypen rr I0I0. Emma: Emma har arvet halvparten av genene sine fra moren, og halvparten fra faren, altså har hun arvet en r fra moren, siden hun har to r. Siden hun er syk, må den andre være R. Hun har også blodtype 0: I0I0. Emma har altså genotypen Rr I0I0. Faren til Emma er også syk, og har gitt dette genet til Emma, derfor må han ha en stor R. Fordi han ikke merker noe til sykdommen og fordi Emma sier at hvis man (hun) hadde fått 2 sykdomsgener (RR) ville hun vært veldig syk, er det tydelig at faren ikke har begge to. Han har nok en r i tillegg. Fordi han har blodtype A, har han i hvert fall en IA. Fordi Emma har to I0I0 må hun ha arvet den ene fra ham, altså har han en I0 i tillegg (men siden IA dominerer over I0, har han fortsatt blodtype A). Emmas far har altså genotypen RrIAI0.


Å svare på spørsmål i biologi • 407

c) Emmas far x Emmas mor RrIAI0 rr I0I0 F1:

rI0

rI0

rI0

rI0

RIA

RrIAI0

RrIAI0

RrIAI0

RrIAI0

rI0

rrI0I0

rrI0I0

rrI0I0

rrI0I0

RI0

RrI0I0

RrI0I0

RrI0I0

RrI0I0

rIA

rrIAI0

rrIAI0

rrIAI0

rrIAI0

Det er ¼ = 25 % sjans for å få et barn med vWD og blodtype 0. d) Hvis hemofili A er en recessiv sykdom, må man ha to utgaver av dette allelet for å få sykdommen (rr). Hvis den også er kjønnsbundet, må gutter ha genotypen XrY og jenter XrXr for å få sykdommen. For gutter holder det altså å bare ha ett sykdomsgen for å få sykdommen. Derfor er en slik sykdom mye vanligere hos gutter enn hos jenter. Men jenter kan også få sykdommen hvis både moren og faren er syk, eller om faren er syk og moren er bærer (datteren må da få sykdomsgenet fra moren, ikke det friske). Jenter kan altså få sykdommen. Eksempel på en slik lidelse er rød/grønn-fargeblindhet.

På naturfag.no vil det bli lagt ut hele eksempelsett fra eksamen. Disse er ferdig sensurert med karakter, men viktigst, de er med veiledning og hint om hva som bør forbedres i besvarelsen. For de to tenkte besvarelsene brukt i teksten over vil du finne kommentarer på Bi 2 sine hjemmesider.

Muntlig eksamen Muntlig eksamen i Biologi 2 er organisert fylkesvis. Det betyr at rammene for eksamensavviklingen vil være noe ulik. Det er faglæren din som lager eksamen og som vil være din eksaminator. Muntlig eksamen skal vektlegge det som har skjedd i undervisning gjennom året, men kandidaten skal vise bredde og dybde i alle hovedmål. Ofte vil du også måtte gjennomføre eller diskutere et forsøk du har gjort. Struktur, figurer og presist språk (med korrekt bruk av ord og faguttrykk) vil igjen gi deg uttelling. Tankekart eller en oversiktsfigur av den typen som er på omslaget av boka kan være lurt å ha med seg eller bruke når du øver. Det å se sammenhenger vil alltid gi uttelling.


408 • Praktisk arbeid

Praktisk arbeid Oversikt over hvilke aktiviteter som passer til hvilke kapitler Kapittel 1

2

3

4

5

6

Aktivitet

Side

Naturlig utvalg

410

Å lage et tre som avspeiler utvikling

410

Naturlig utvalg

410

Ruteanalyse

Kapittel

Aktivitet

Side

Enzymer

421

Alkohol som gift- test på spirende frø

424

Celleånding

425

410

Celleånding hos gjær

426

Linjeanalyse

411

Alkohol som gift- test på spirende frø

424

Tilpasninger hos blåbær og tyttebær

411

Celleånding

425

Gjærcellens livssyklus

411

Celleånding hos gjær

426

Livssyklusen til ciliater

412

Alkohol som gift- test på spirende frø

424

Isoler ditt eget DNA

412

Fotosyntesepigmenter

427

Fra gen til protein

413

Fotosyntesepigmenter hos planter

428

Isolering av DNA

414

Fotosyntese

430

Gjærcellens livssyklus

411

Spalteåpninger

431

Livssyklusen til ciliater

412

Fotosyntese og rustne spiker

431

Mitose i rotspissen av purreløk

415

Lys og vannplanten javabregne

432

Isoler ditt eget DNA

412

Ytre faktorers påvirkning på fotosyntesen

432

Isolering av DNA

414

Å lage et tre som avspeiler utvikling

410

Blodtypetesting

416

Isoler ditt eget DNA

412

Noen arvelige egenskaper hos mennesket

417

Isolering av DNA

414

Modellforsøk av dihybrid arv

418

Kloning av plante

433

Hvor mange egenskaper trengs for at alle elevene i klassen skal være unike?

419

In vitro-plantekultur

434

Genetisk drift

420

Fangst-gjenfangst

420

7

8

9

10


Praktisk arbeid • 409

Sikkerhetsregler for laboratoriearbeid Under elevforsøk og demonstrasjoner er det alltid fare for større eller mindre uhell. For at denne risikoen skal bli minst mulig, er det nødvendig med ro og orden ved alt laboratoriearbeid. Før du begynner på øvelsen, må du lese igjennom det du skal gjøre. Det er viktig å kjenne alle sikkerhetsregler som gjelder for øvelsen. 1. Les gjennom HMS-databladene for kjemikaliene du skal bruke slik at du vet hvordan du skal forholde deg til disse. 2. Sett ikke i gang med forsøk på egen hånd. Dersom du har ideer til endringer eller andre forsøk, må du snakke med læreren om det først. Ved åpne eksperimenter er det viktig å tenke sikkerhet under planleggingen. Dersom det er nødvendig skal læreren godkjenne de prosedyrer og metoder dere velger å bruke. 3. Kjenn bruken av • brannslukningsapparatet • nøddusjen • flaskene for øyevask • nødstopp for elektrisk utstyr 4. Kjenne til • plassering av medisinskapet • rømningsveiene • regler for bruk av brennere – Beholderen skal være festet slik at den ikke kan velte. De eldre blå brennerne skal festes med festering. De nye grå brennerne kan brukes uten festering. – Beholderen skal alltid stå oppreist. Flytt ikke brenneren fra arbeidsbordet når den er tent. – Når du skal tenne brenneren, skal du holde en tent fyrstikk ved brenneren før du åpner ventilen (kranen). – Merker du gasslukt, må du kontrollere din egen brenner og melde fra til læreren. Rommet må luftes og dere må finne lekkasjen før noen brennere blir tent. – Beholderen må ikke utsettes for oppvarming fra for eksempel radiatorer, direkte sollys eller andre brennere.

De gamle symbolene finner dere på www.gyldendal.no/bi.

5. Bruk alltid ansiktsskjerm eller vernebriller når du arbeider med kjemikalier som kan gi skade. 6. Det er ikke tillatt å spise eller drikke i laboratoriet. 7. Smak aldri på kjemikalier. Berør aldri kjemikalier med hendene. Lukt aldri rett i glasset. Dersom du skal lukte på et stoff, skal du holde glasset på en viss avstand og vifte dampen mot nesen med hånden. Du kan smake på ting dersom du får uttrykkelig beskjed om det fra læreren og emballasjen på stoffet er merket med «Til smaksprøver». 8. Bruk aldri munnen ved pipettering. Bruk en sugeballong (Peleusballong e.l.) eller engangssprøyte. 9. Når du skal skyve et glassrør, en glasstav, et termometer e.l. inn i et hull i en propp, eller når du skal tre en gummislange over et glassrør, må enden av glassrøret først smøres med fett (hanefett), glyserol e.l. Hold med et håndkle nær enden av glasset når du skyver eller vrir det inn i hullet. 10. Når du varmer opp en væske i et reagensglass, er det alltid fare for støtkoking. Røråpningen må vende bort fra alle personer i nærheten. Beveg glasset hele tiden for å få en jevn oppvarming av væsken. Bruk alltid vernebriller ved slikt arbeid. 11. Du må aldri tette til rør eller kolber som du varmer opp. 12. Faste stoffer som løser seg lett i vann, kan du kaste i vasken. Deretter spyler du vasken godt med vann. Faste stoffer som er uløselige i vann, for eksempel jernpulver, kan du kaste i den brannsikre avfallskassa. Små mengder med fortynnende løsninger av syrer, baser og salter kan du tømme i vasken. Etterpå må du spyle vasken godt med vann. 13. Læreren skal ta hånd om rester av brennbare væsker og konsentrerte syrer og baser. 14. Når øvelsen er utført, må du vaske det brukte glassutstyret. Alt utstyr setter du tilbake på plass. Rydd og tørk arbeidsplassen. Vask alltid hendene godt etter en laboratorietime. Teksten er utviklet av Naturfagsenteret og Institutt for lærerutdanning og skoleutvikling ved Universitetet i Oslo.


410 • Praktisk arbeid

Praktisk arbeid Naturlig utvalg

Ruteanalyse

Kapittel 1, 2

Kapittel 2

Utstyr

For å trene på å gjøre ruteanalyse før dere skal planlegge deres eget feltarbeid, kan det være greit å gjøre en rute­ analyse i nærområdet til skolen.

– Gelebønner – Salatbønner – Skål Framgangsmåte 1. Legg ca 30 gelebønner og 30 salatbønner i en skål. 2. Send skåla rundt, og la hver elev velge én bønne, med forutsetning om at den skal spises. 3. Når alle elevene har valgt en bønne, teller dere opp hvor mange det er igjen i skåla av hver type. Resultater Tenk dere at de bønnene som det er flest igjen i skåla etter at alle har valgt seg én bønne, har et «fortrinn» fremfor de andre bønnene. Dette «fortinnet» kan «arves av avkommet» til bønnene. Bruk deretter forsøket til å gi en forklaring på mekanismen bak naturlig utvalg.

Å lage et tre som avspeiler utvikling Kapittel 1, 10 I denne øvelsen skal du lage et system ut av vanlige objekter som du kan finne på skolen eller ha med deg. Du må legge til grunn at det vanligvis går fra enkelt mot mer komplekst, og at det er én egenskap som forandrer seg om gangen. Det er også sjelden egenskaper gjenoppstår, men en egenskap kan selekteres ulikt for ulike grupper slik at den samme egenskapen kan ha en annen funksjon i en annen gruppe. Lag treet ditt med greiner og forklar hvert forgreiningspunkt grundig. Lag gjerne to varianter der du viser at en annen egenskap, isolert sett, kan gi et annet tre.

Utstyr – Målebånd eller fire lister på 1 m, snekret sammen til et kvadrat. Det er også mulig å dele kvadratet inn i mindre ruter ved å stifte hyssing fast til rammen. Dette kan gjøre det lettere å telle eller bestemme dekningsgrad. – Bestemmelseslitteratur

Framgangsmåte 1. Hver elevgruppe måler opp et tilfeldig kvadrat på 1 m x 1 m i området som skal undersøkes, eller dere legger ut kvadratet dere har laget på forhånd. 2. Tell antall av arten dere vil bestemme antallet til, eller bestem dekningsgraden hvis dere skal undersøke tettheten av arten i området. Det er også mulig å artsbestemme alle artene i ruten og notere dekningsgrad eller antall for alle artene. 3. Flytt dere deretter til et nytt, tilfeldig valgt sted innenfor området og gjenta ruteanalysen der. 4. Fortsett deretter til en ny, tilfeldig rute osv, til dere har dekket en tilfredsstillende del av hele området. Tips til læreren: Det er også mulig at hver elevgruppe bare gjør en eller noen få ruteanalyser og at man samler hele klassens resultater etterpå.

Resultater Beregn total dekningsgrad eller totalt antall av arten eller artene i området deres. Var resultatene deres som forventet? Drøft feilkilder ved ruteanalysen og hva dere kunne ha gjort for å begrense feilkildene. Tips: Det er også mulig å gjøre ruteanalyser i to forskjellige miljøer og sammenlikne disse med hensyn på tilpasninger hos artene som lever der.


Praktisk arbeid • 411

Linjeanalyse Kapittel 2 Dersom dere skal gjøre undersøkelser i områder med sonering, for eksempel i fjæra eller i en myr, kan dere gjennomføre en linjeanalyse.

Biotiske faktorer – Studer vegetasjonen rundt og prøv å artsbestemme så mange trær som mulig. – Undersøk hvordan planten vokser på stedet. – Kjenn på bladet. Resultater

Utstyr – Målebånd eller tau med merke (for eksempel en knute eller farget teip) for hver meter – Bestemmelseslitteratur

Framgangsmåte 1. Legg ut tauet eller målebåndet på tvers av variasjonsretningen. 2. Noter meter for meter hvilke arter dere finner. Det er viktig å notere seg hvor artene kommer til eller forsvinner. Dere kan notere arter i et smalt belte langs målebåndet eller dere kan velge å analysere 1 m til hver side for tauet. 3. Noter også hvordan de abiotiske faktorene varierer langs den samme linjen.

Prøv med bakgrunn i observasjonene dine å sammenligne de to artene. Kan du si noe om hvilke tilpasninger de to artene har? Finnes det biotoper hvor sjansen for å finne mye blåbær eller mye tyttebær er størst?

Gjærcellens livssyklus Kapittel 4, 2 Gjærceller er encellede organismer som tilhører soppriket. De deler seg ved knoppskyting, som er en type mitose hvor dattercellen vokser som en liten knopp på opphavscellen. I denne øvelsen er hensikten å studere ulike abiotiske faktor­er som påvirker livssyklusen til gjærcellen. Design et forsøk hvor dere ser på ulike faktorer. Diskuter med læreren og gjennomfør forsøket.

Resultater Forklar hvorfor området er sonert, og hvorfor artene kommer til eller forsvinner langs linja.

Tilpasninger hos blåbær og tyttebær Kapittel 2 Tyttebær og blåbær er vanlige planter i norsk flora og finnes mange steder, men ofte er det slik at på noen steder er det mest blåbær og andre steder mest tyttebær. Prøv å finne to slike typiske steder, ett hvor blåbær dominerer, og ett hvor tyttebær dominerer (helst i nærheten av hverandre). På begge steder gjennomfører du de samme under­søkelsene av abiotiske og biotiske faktorer. Abiotiske faktorer – Hvor dypt er jordsmonnet? – Hvordan er fuktigheten i jordsmonnet? – Hvordan er lysforholdene i området?

Til læreren: Se www.gyldendal.no/bi for ulike tips til øvelsen.


412 • Praktisk arbeid

Praktisk arbeid Livssyklusen til ciliater

Isoler ditt eget DNA

Kapittel 2, 4

Kapittel 3, 5, 10

I denne øvelsen skal dere studere celledeling i encellede organismer fra protistriket. For å lage en gresskultur med mange protister kan dere se på øvelsen Mikroorganismer i en gresskultur, side 372 i Bi 1. Her tar vi utgangspunkt i gresskulturen. Fra denne gresskulturen skal dere isolere 5–10 ciliater og studere hvordan ciliatene deler seg.

Alt DNA i cellene dine er pakket inn med proteiner og omgitt av fett (fosfolipider i cellemembraner). I denne øvelsen skal du isolere ditt eget DNA ved å løse opp cellemem­ braner, bryte ned proteiner og felle ut DNA.

Utstyr Utstyr – Gresskultur – Petriskåler (d = 2,5 cm) – Pipetter (stor spiss og liten spiss) – Objektglass – Dekkglass – Mikroskop

– Saltvannsløsning (1 ts salt til 1 liter vann)* – 5 ml Zalo-løsning (25 %) – 10–15 ml iskald isopropanol/Blårens** – Prøverør Framgangsmåte 1. Ta saltvann i munnen. Gurgl løsningen i ca. et halvt minutt. 2. Spytt ned i prøverøret.

Framgangsmåte 1. Bruk en pipette med stor spiss og sug opp noe av overflatehinnen og væsken under, og overfør til en petriskål (nr. 1). 2. Sug forsiktig opp 4 ml fra vannet i gresskulturen. Sørg for at du ikke får med deg noe fra overflatehinnen eller gress. Overfør vannet til en ny petriskål (nr. 2). 3. Se på overflatehinna under et mikroskop. 4. Bruk en pipette med tynn spiss og plukk opp 5–10 ciliater (svømmende encellede organismer), og overfør disse til petriskål nr. 2. 5. Kontroller at du har fått med ciliater ved å se på petriskål nr. 2 under mikroskopet. 6. Tell hvor mange ciliater som er til stede i petriskål 2. 7. Overfør 4 ml vann fra gresskulturen til petriskål 1. 8. La begge petriskålene stå lunt i 2-7 dager. Det er viktig at petriskålene ikke tørker ut. 9. Studer og sammenlign livet i begge petriskålene. 10. Plukk ut celler som kan tenkes å være i delingsfasen, og studer disse. Resultater Diskuter resultatene deres. Til læreren: Det er også mulig å bruke lupe til selektering. For å ha nok med næring kan dere bruke gjær og/eller proteose pepton. Tips til hvordan dere lager pipette med liten spissdiameter, finner dere på www.gyldendal.no/bi.

3. Hell i zaloløsning og bland forsiktig. 4. Hold røret på skrå, og hell forsiktig på den iskalde alkohol­en. 5. Etter en liten stund dannes det tynne hvite tråder – dette er DNA fra cellene i munnen din! Spørsmål Hvorfor brukte vi zalo? Hvorfor helte vi forsiktig i alkohol? Hvilke feilkilder har dette forsøket? Hva kan du gjøre for å redusere feilkildene? Til læreren: * Ampuller med nesedråper kan også brukes. ** Blårens kan kjøpes i jernvarehandelen.


Praktisk arbeid • 413

Fra gen til protein Kapittel 3 I denne øvelsen skal dere lage en animasjon som viser hvordan proteiner lages inne i en celle. Se www.gyldendal.no/bi for animasjonstips.

Utstyr – A3-ark – A4-ark i forskjellige farger – Saks – Blyant – Tape/lim/gummiklister – Mobiltelefon/filmkamera Framgangsmåte La oss anta at følgende gen koder for et lite protein: 5’ C T T C A T A T G C G A T G T G T G A A C a t c c A A C C C G T G T A C A C A T A G A 3’ 3’ G A A G T A T A C G C T A C A C A C T T G t a g g T T G G G C A C A T G T G T A T C T 5’

1. Tegn en celle som dekker hele A3-arket. 2. Klipp ut genet og plasser genet der det hører hjemme i cellen. 3. Den første prosessen dere skal animere er hvordan det lages en kopi av genet. Bruk figuren på side 107 som inspirasjon. Promotorområdet på DNA inneholder basene TATA på den kodende DNA-tråden. Diskuter hvordan dere bør gå frem for å animere prosessen transkripsjon. 4. Lag en voice-over-tekst og øv flere ganger før dere filmer animasjonen Transkripsjon. Dere kan eventuelt velge å filme helt til slutt når alle delprosessene er animer­t. Bruk mobiltelefon eller filmkamera. 5. Den neste prosessen dere skal animere er mRNA-­ bearbeiding. Bruk figuren på side 109 og diskuter hvordan dere vil gå frem for å lage animasjonen. Basen­e skrevet inn med små bokstaver i genet, er et intron. 6. Lag en voice-over-tekst og øv flere ganger før dere filmer animasjonen mRNA-bearbeiding. 7. Før dere starter med å animere prosessen translasjon, må dere filme transporten av mRNA ut av cellekjernen.

8. Nå skal selve avkodingen av den genetiske koden animeres­. Før dere starter å animere må dere finne ut hvilke aminosyrer mRNA koder for. Bruk figurene på side 110–114 og diskuter hvordan dere vil gå frem for å lage en animasjon. Husk at både start og slutt i translasjonsprosessen skal være med. 9. Lag en voice-over-tekst og øv flere ganger før dere filmer animasjonen Translasjon. 10. Hva skjer med aminosyrekjeden? Lag til slutt en animasjon­som viser hvordan proteiner lages og ulike funksjoner proteiner har. Denne animasjonen kaller dere Proteiner. 11. Sett sammen alle filmsnuttene til en film som kalles Fra gen til protein. Det er også mulig å filme alle animasjonene i ett. Resultat Vis filmen for resten av gruppen og diskuter de ulike måtene­dere har animert på.


414 • Praktisk arbeid

Praktisk arbeid Isolering av DNA Kapittel 3, 5, 10 Alt DNA i cellene til en organisme er pakket inn med proteine­r og omgitt av fett (fosfolipider i cellemembraner). I denne øvelsen skal du isolere DNA ved å løse opp cellemembraner, bryte ned proteiner og felle ut DNA i etanol.

Utstyr – Løk – Begerglass (250 ml) – Oppvaskmiddel blandet i vann i forholdet 1 : 10 – Salt (NaCl) – Målesylindere (100 ml og 10 ml) – Hurtigmikser, stavmikser eller blender – Vannbad (60 °C) – Isbiter – Trakt – Kaffefilter – Reagensrør

Resultater

– Iskald etanol – Protease

Presenter forsøket ved å legge vekt på de ulike trinnene i isoleringsprosessen:

– Glasstav

– Hvilken oppgave har oppvaskmiddelet?

Framgangsmåte 1. Kutt en halv løk i små biter på ca. 5 x 5 mm. 2. Ha løken i et begerglass sammen med 100 ml av oppvaskmiddel­løsningen og 1 teskje salt. 3. Sett blandingen på vannbad ved 60 °C i ca. 15 minutte­r. 4. Avkjøl blandingen på is i et par minutter. 5. Hell blandingen over i hurtigmikser og kjør på full styrk­e i 5 sekunder. 6. Filtrer blandingen gjennom et kaffefilter. 7. Ta ca. 10 ml av den filtrerte løsningen over i et reagens­rør og tilsett et par dråper protease. 8. Hell forsiktig på ca. 10 ml iskald etanol og la løsningen stå rolig i et par minutter. 9. DNA flyter opp i det øvre etanollaget. DNA-et har en gråaktig og gjennomsiktig konsistens. Kveil forsiktig DNA-et opp på en glasstav ved å legge glasstaven innti­l reagensrøret mens du vrir rundt.

– Diskuter hvorfor løken i oppvaskmiddelløsning først varmes opp og deretter avkjøles. – Hvilken oppgave har protease? – Hvilken oppgave har etanol? Til læreren: Det er fullt mulig å isolere DNA fra andre grønnsaker eller frukter. Prøv for eksempel med banan, kiwi, tomat eller hvitløk. Tilsettingen av protease kan sløyfes, men da vil mindre mengde DNA felles ut. Det er også spennende å lage sitt eget DNA-smykke, se tips på www.gyldendal.no/bi.


Praktisk arbeid • 415

Mitose i rotspissen av purreløk Kapittel 4 I unge planterøtter som er i god vekst, skjer det mange celledelinger (mitose) i området like bak rotspissen. I rotspisser fra purre er delingssonen ca. 0,5 mm fra tuppen. I denne øvelsen skal du lage et preparat av et rotskudd fra purre og studere de ulike fasene i mitosen.

1. Lage egne preparater

7. Legg rotspissen over på et objektglass i en dråpe med 45 % eddiksyre. 8. Skjær av den røde spissen og kast resten. 9. Legg et dekkglass over, snu objektglasset og legg det på et papir med dekkglasset ned. Press hardt med tommelen på objektglasset slik at cellene spres utover. Tørk vekk overflødig eddiksyre, se figuren. 10. Se på cellene i et mikroskop. 11. Let i preparatet og finn celler som er i ulike faser i mitosen. Identifiser fasene ved hjelp av tabellen på side 142.

Utstyr – Purre – Begerglass – 3 reagensrør – Pinsett – Skalpell – Fikseringsløsning (1 del iseddik, 3 deler etanol) NB! Bruk beskyttelsesbriller! – 1 M saltsyre (HCl) – Feulgen-farge – 45 % eddiksyre

Resultater Tegn celler i forskjellige delingsfaser, og gi en begrunnelse på hvordan du identifiserte de ulike fasene.

– Vannbad eller varmeskap (60 °C) – Objektglass

2. Ferdiglagde preparater

– Dekkglass – Mikroskop

Utstyr – Ferdiglagde preparater av rotspissceller

Framgangsmåte 1. Legg purre i et begerglass med vann i omtrent en uke for å få den til å spire. Røttene er klare til farging når de er ca. 2 cm lange.

Framgangsmåte

2. Skjær av 7–8 mm av den ytterste delen av rotspissen og legg den i et reagensrør med fikseringsløsning i 10 minutter.

Se på cellene i et mikroskop. Cellene vil være i forskjellige faser av celledelingen. Let i preparatet og finn celler som er i ulike faser av mitosen. Identifiser fasene.

3. Varm saltsyreløsningen til 60 °C i et vannbad eller i et varmeskap.

Resultater

4. Legg rotspissen i den varme saltsyreløsningen i ca. 10 minutter. 5. Stopp prosessen ved å overføre rotspissene til kaldt vann. 6. Overfør rotspissen til feulgen-fargen og la den ligge her til tuppen er farget rød, vanligvis ca. 5 minutter. Den kan også ligge over natten i denne løsningen.

– Mikroskop

Tegn cellene i rekkefølge slik at fasene i celledelingen følge­r etter hverandre. Angi forstørrelsen. Begrunn hvorda­n du identifiserer de ulike fasene. Til læreren: Løk er et alternativ til purre, gjerne økologisk. Temperaturen på saltsyreløsningen er viktig. Dersom skolen ikke har varmebad, er det mulig å bruke et sandbad i et varmeskap. På www.gyldendal.no/bi finner dere tips om kjemikaliene og hvor dere kan få kjøpt de ferdiglagde preparatene.


416 • Praktisk arbeid

Praktisk arbeid Blodtypetesting

Utstyr

Kapittel 5 Menneskers blodtype bestemmes av antigener i cellemembranen til de røde blodcellene og antistoffer i blodplasmaet. Blodets antistoffer binder seg til antigenene. Hvilke kombinasjoner vi har av antigener og antistoffer, bestemmes av arv. De to viktigste blodtypesystemene er ABO og Rhesus. Utgangspunktet for å kunne bestemme hvilken blodtype en har, er at antistoffet (anti-A) som binder seg til antigenet A får blodceller med antigen A til å klumpe seg sammen. Denne prosessen kaller vi agglutinering. Den samme reaksjonen skjer mellom anti-B og blodceller med karbohydrat B og anti-rh og blodceller med rhesusfaktoren. Dette betyr at har du blodceller med antigen A, har du ikke anti-A, osv. På figuren nedenfor ser du hvilke antistoffer som er representert ved de forskjellige blodtypene. I denne øvelsen skal du bestemme din egen blodtype ved at du tar utgangspunkt i når blodet ditt agglutinerer. Det er viktig at du ikke kommer i kontakt med andres blod, og at du jobber sterilt på din egen pult.

Blodtype A

Blodtype B

Antistoff B

Antistoff A

Rhesus +

Rhesus –

– Papir – Penn – Objektglass – Blodlansett – Etanol – anti-A-serum – anti-B-serum – anti-Rh-serum – Tannpirkere

Blodtype AB

Blodtype 0

Rød blodcelle

Antistoff i blodet

Rød blodcelle

Antistoff i blodet

1218_Blodtype.pdf

Kan ha antistoff

Antistoff A og antistoff B


Praktisk arbeid • 417

Framgangsmåte 1. Merk et objektglass (eller et papir under glasset) med anti-A, anti-B og anti-Rh.

Noen arvelige egenskaper hos mennesket Kapittel 5

Anti-A

Anti-B

Anti-Rh

2. Drypp en dråpe anti-A-serum ved anti-A-merket, en 1221_Antistoffer.pdf dråpe anti-B-serum på merket anti-B og anti-Rh-serum på det tredje merket. 3. La armen henge ned og rist den kraftig i noen sekund­ er. Vask fingeren med etanol og stikk. 4. Press deretter ut blod ved at du «melker» fingeren, og sett en dråpe på merket med anti-A, en dråpe på merke­t anti-B og en dråpe på merket anti-Rh på objekt­glasset. 5. Bland serumet og bloddråpen godt ved å røre med en tannpirker. NB! Du må bytte tannpirker for hver blanding. 6. Dersom blodcellene agglutinerer, får dråpen et kornete utseende. Dette ser du lettest ved å vippe på objektglasset. Noter om blodet agglutinerer (+) eller ikke (-) ved de tre reaksjonene.

De fleste egenskaper hos mennesket skyldes et samvirke mellom flere genpar, men la oss anta at noen egenskaper skyldes bare virkningen av ett genpar. Når vi bare følger ett genpar, kaller vi det monohybrid arvegang. I denne øvelsen skal du studere ulike egenskaper hos mennesket som vi antar kan følge monohybrid arvegang med fullstendig dominans.

Utstyr – PTC-smakspapir

Framgangsmåte 1. Registrer fenotype til egenskapene fra tabellen nedenfor hos eleven du arbeider sammen |med. 2. Skriv ned genotype for alle egenskapene du under­ søker hos medeleven. For en dominant fenotype skrive­s genotypen med stor bokstav og en strek, for eksempel R-. Det er fordi individet kan ha to mulige genotyper, RR og Rr, for den fenotypen du registrerer. Egenskap

Fenotype

Genotype Fenotype

ikke rødt hår

R-

rødt hår

rr

fregner

mulighet for å få fregner

A-

ikke fregner

aa

hårfeste

hårlinje danner en spiss ned mot pannen

H-

rett hårlinje

hh

fingerledd

ytre lille­ finger­ledd bøyd inn mot ring­ finger

L-

ytre lille­ finger­ledd rett

ll

øreflippform

fri øreflipp

F-

fastvokst øreflipp

ff

PTC-smak

Smaker den bitre PTC-smaken

P-

smaker ikke PTC

pp

Etterarbeid Lag en oversikt over fordelingen av blodtyper i gruppa. Finn fordelinger av blodtyper i den norske befolkningen. Er resultatene fra gruppa i samsvar med fordelingen i befolkninge­n? Begrunn svaret ditt. Finn ut hvilken blodtype personer må ha for at du kan gi blod til dem, og hvem som kan gi blod til deg. Lag en universaloversikt med utgangs­punkt i ABO-systemet og rhesus-systemet som viser hvem som kan gi blod til hvem. Til læreren: Her er det viktig at elevene jobber sterilt. Lansettspissen skal ikke komme borti noe før bruk, og elevene skal ikke ha kontakt med hverandr­e.

Recessiv

hårfarge

Resultater Begrunn hvilke blodtype du har, ved at du illustrerer hva som skjedde med blodcellene dine ved de forskjellige antistoffene. Bestem hvilke mulige genotyper du kan ha. Hvilke genotyper kan foreldrene dine ha?

Dominant

Genotype

nærsynthet

ikke nærsynt

N-

nærsynt

nn

blodtype ABO

A og/eller antigen B

IA-/IB-/IAIB

ingen antigen A, B

ii

blodtype rhesus

rhesus faktor (Rh) i celle­mem­ branen

B-

ingen antigen Rh

bb


418 • Praktisk arbeid

Praktisk arbeid Resultater Finn ut hvilken dominant og hvilken recessiv fenotype som er mest utbredt i gruppa di. Beregn den prosentvise fordelingen mellom dominant og recessiv fenotype for hver egenskap. Har to eller flere elever samme fenotype for alle egenskapene dere har undersøkt? Etterarbeid Plukk ut tre egenskaper hvor du viser dominant fenotype, ved å ta utgangspunkt i at en av foreldrene dine har recessive fenotyper for disse egenskapene. Anta at genene ikke er koblet. Tenk deg at du i framtiden får barn med en homozygot recessiv person for disse egenskapene. Hvilke egenskaper kan barna dine få? Beregn sannsynligheten for de enkelte egenskapene. Hvor stort er genreservoaret for gruppa din? Beregn frekvens­en til de ulike genvariantene.

Framgangsmåte 1. Dere jobber sammen to og to. 2. Lag eller finn noe som kan symbolisere genvariantene. For eksempel klipp et rosa ark i fire like store deler. På to av delene skriver dere stor G, mens på de andre to delene skriver dere liten g. Klipp så et blått ark i fire like store deler, skriv stor R på to deler og liten r på de andre to. 3. Legg en lapp av hver type i hver skål. I hver skål skal det da være fire lapper som symboliserer genotypen GgRr. Krøll så lappene sammen. 4. De to skålene symboliserer diploide celler fra hver av plantene. 5. «Krysningen» mellom erteplantene foregår ved at en av dere trekker en rosa og en blå lapp fra skål 1. Den andre gjør det samme fra skål 2. Legg de fire lappene sammen på bordet. De symboliserer nå genotypen til avkommet.

Modellforsøk av dihybrid arv

6. Noter hvilken genotype dere fikk, og legg tilbake lappen­e i skålene de kom fra.

Kapittel 5

7. Gjør til sammen 16 «krysninger».

Hensikten med denne øvelsen er å studere forholdet mellom avkommenes genotyper når vi gjør få krysninger, og når vi gjør mange. Anta at krysningene er tilfeldige og genparene sitter på forskjellige kromosomer. Tenk dere at dere skal krysse to erteplanter. Begge erteplantene har gule og runde erter. Dere finner ut ved gentesting at begge plantene har genotypen GgRr. Under finner du en tabell med oversikt over hvilke genotyper som gir hvilke fenotyper.

8. Tell så opp hvor mange dere har av de ulike geno­ typene.

Egenskap

Fenotype

Genotype

Erteform

Rund ert

RR/Rr

Skrukkete ert

rr

Gul ert

GG/Gg

Grønn ert

gg

Ertefarge

Utstyr – To fargede ark med ulik farge – To skåler

Resultater Beregn sannsynligheten for de ulike genkombinasjonene til avkommene for denne krysningen. Stemmer tallene dere fikk, med det dere forventet? Bestem hvor mange dere har av de ulike fenotypene. Finn det forventede forholdet mellom fenotypene. Hvordan stemmer resultatet deres med det forventede?


Praktisk arbeid • 419

ld

d

LD

fol

fo

LD

FO

FO LD fo ld

HAIK

HLIL

haik

IK

hli l

ik

HA

FOLD

fold FO LD fo ld EF

ha

53

fold FOLD

ØR

56

55 54

HAIK h aik HA IK ha HLIL ik hli l ØRE F

37

38

39

43

rf

FOLD

fold

29

fold FOLD

28

FO

27

41

24

fold

FOLD

26

42

23

LD

25

48 49 50 5 1 5 46 47 2

fold FOLD

22

ld

fold

FOLD

fold FO LD fo ld

FO fo

40

Buet

HÅRF

v-formet

Hårf

Frie

ØREF

Resultater

Fast

Øref

Hår på midterste ledd på lille­fingeren

Hår

HLIL

Ikke hår

Hlil

Slå sammen resultatene fra alle i gruppa. Noter genotyper og fenotyper. Er det mer samsvar mellom resultatene deres og det forventede nå? Begrunn svarene deres.

Haiketommel

Ikke bøyd tommel­ fingerledd

HAIK

Bøyd tommel­ fingerledd

Haik

Høyre tommel øverst

FOLD

Finnes det noen mennesker som ikke kan skilles fra hverandr­e på denne måten?

Venstre tommel øverst

fold

Kan noen av disse egenskapene ha betydning for mennesk­ets utvikling?

Framgangsmåte 1. Alle fyller ut med egenskapene sine i det genetiske hjulet og bestemmer nummeret sitt. Begynn i midten. 2. Sett opp en fordeling av antall elever til hvert nummer (for eksempel: 3 elever er nr. 17). 3. Læreren undersøker flere egenskaper slik at alle blir unike.

33 34 3 5 36

Folding av hender

1 32 30 3

Øreflippform

Hvor mange egenskaper var det nødvendig å bruke for at alle ble unike? Etterarbeid

Til læreren: Bruk tabellen i øvelsen på side 417 til videre inndeling.

5 16 17 18 19 14 1 20 13 21

45

12

44

11

K

I HAIK haik HA

fold

FOLD

haik

K

I HA

LD FO d l fo LD FO d fol D FOL fold

ik ha

ld fo LD FO d fol D FOL

HAIK

HL

10

IL

haik

9

f

hlil

LD

FO

ik

hlil

øre

EF

l

IK

ha

ik ha

8

IK HA

HLIL

HA

HA

f øre

RF

7

IL HL

IK

ha

ik

ØRE F

f

hli

HA

LD ld fo LD FO

FO

f øre

ØR

IL

d fol

6

l

rf

HL

fold D FOL

5

hli

IL

øre

FOLD

4

RF

fold

fold

FOLD

FOLD

fold D FOL

d

Hårfeste

d fol LD FO

FOLD fold

3

HLIL

HL

FO LD fold

2

IK

hlil

d

ik

Mann

♀ ♂

fol

ha

Kvinne

Symbolisert med

IK

1

haik HAIK haik

HAIK

ik ha

HA

LD

hlil

Kjønn

Fenotype

LD

Egenskap

ld

FO

AIK haik H

De egenskapene dere skal studere er:

FO

Kapittel 5 Menneskets egenskaper er styrt av et stort antall gener. De fleste av disse regulerer flere egenskaper, og mange virker sammen med andre gener. Noen gener styrer imidlertid tydelige egenskaper som vi kjenner. I denne øvelsen forenkler vi virkeligheten og tar ikke hensyn til epistase og dominansforhold mellom genene, vi ser kun på egenskaper vi vet er arvelige.

58

57 fo

59

64 62 63

61

60

l fo

Hvor mange egenskaper trengs for at alle elevene i klassen skal være unike?


420 • Praktisk arbeid

Praktisk arbeid Genetisk drift Kapittel 6

Resultater Sett opp resultatene for hver runde i en tabell. Sammenlign utviklingen i deres gruppe med utviklingen i andre grupper. Spørsmål

Utstyr – Plastkuler eller lignende, hvor alle har lik form. Hver gruppe skal ha 2 farger og 100 kuler av hver farge – Beger eller skåler

Hvilke evolusjonære mekanismer er det øvelsen forsøker å etterligne? Hvorfor er det viktig at den som trekker, har bind for øynen­e? Forsøk via Internett å finne grupper av dyr (eller mennesker) hvor det er vist at slike mekanismer har foregått. Til læreren: «Perler» som barn lager bilder av ved hjelp av strykejern, egner seg til denne øvelsen.

Fangst – gjenfangst Kapittel 6 Å beregne en populasjonsstørrelse kan gjøres ved hjelp av fangst-gjenfagstmetoden. I dette forsøket skal du fange, merke og gjenfange bønner.

Utstyr – Bønner – Treflis/bark – Stort kar

Framgangsmåte 1. Tell opp 50 av hver farge og bland dem i et beger.

Framgangsmåte 1. Tell opp et bestemt antall bønner.

2. En av deltakerne med bind for øynene trekker ut 10 kuler.

2. Legg sagflis/bark i et kar.

3. Tell opp antall av hver farge.

4. Ta bind for øynenen eller se vekk slik at du vilkårlig tar opp en bønne.

4. Lag en ny blanding kuler med 100 kuler som har den fordelingen som du fikk i punkt 3. 5. Gjenta prosessen fra punkt 2. 6. Hold på til du bare har en type kuler i uttrekket.

3. Bland bønner og sagflis.

5. Merk denne bønna. 6. Gjenta til du har plukket opp to av de merkede bønnene. 7. Bruk formlene, side 57, for å beregne mengden bønner du har hatt i karet, altså populasjonen.


Praktisk arbeid • 421

Enzymer Kapittel 7

1 Enzymer kan mørne kjøtt Kjøtt består av mye proteiner. Kjøtt har i utgangspunktet ulik mørningsgrad, og det kan også mørnes kunstig ved at man bruker glutamat som selges som mørningssalt i butikkene. I dette forsøket skal vi se hvordan enzymer fra ananas og eller papaya kan gjøre kjøtt mørt eller bryte det helt ned.

er blant produktene i reaksjonen, vil føre til en forandring av pH-verdien, som gjør at indikatoren fenoftalein skifter farge fra rosa til fargeløs. Dette forsøket viser at både enzyme­t lipase fra bukspyttkjertelen og galle fra leveren er nødvendig for normal fordøyelse og opptak av fett.

Utstyr – 4 reagensrør – Pipetter – Lipase (1 % løsning)

Utstyr – Frukt: ananas og/eller papaya – Seigt kjøtt fra sau eller storfe – Petriskåler – Kjøleskap Framgangsmåte 1. Skjær opp kjøttet i tynne skiver. 2. Skjær opp fruktene eller mos dem.

– Gallesalt (1 % løsning) – Helmelk – Fenoftalein eller fenolrød indikator – 0,1 M NaOH Framgangsmåte 1. Ta 30 ml melk i et begerglass og tilsett 2,5 ml fenoftalein­indikator. 2. Gjør melken basisk ved å tilsette 5 ml 0,1 M NaOH.

3. Sjekk hvor seigt kjøttet er før du tilsetter frukt.

3. Om fargen på melken nå ikke er rosa, så tilsetter du dråpevis noe mer NaOH til du får fargeomslag.

4. Smør inn kjøttet med frukten og sett dette i kjøleskap et par dager.

4. Sett fire reagensrør i et stativ og merk dem 1–4. Tilsett dette i hvert rør:

5. Lag også en kontroll – en petriskål med kjøtt som er ubehandlet. Resultater Sammenlign resultatene med bruk av ulike frukter. Sammenlign behandlet kjøtt med ubehandlet kjøtt. Spørsmål I ananas og papaya er det ulike enzymer som fører til at kjøttet mørner. Finn ut hvilke enzymer det er. Hva slags type proteiner består kjøtt av, og hvordan er de organisert?

2. Enzymet lipase og betydningen av gallesaft Mesteparten av fettet i kosten foreligger i form av triglyserider. Ved fordøyelsen blir to fettsyrer avspaltet fra triglyseridmolekylene, og sluttproduktene er dermed frie fettsyrer og monoglyserider. Både frie fettsyrer og monoglyserider tas opp fra tarmkanalen. Når fettet kommer i kontakt med gallesalter, blir fettdråpene mindre. Det gjør at grenseoverflaten mellom fett og vann øker, slik at fettspaltingen ved hjelp av lipase kan foregå mye hurtigere. Fettsyrene, som

Rør nr.

1

2

3

4

Innhold

Mengde (ml)

Basisk melk med indikator

6

6

6

6

Vann

1

1

2

Gallesalt

1

1

Lipase

1

1

5. Start klokken og noter hvor lang tid det tar før den rosa fargen forsvinner.


422 • Praktisk arbeid

Praktisk arbeid Resultat

Framgangsmåte

Forklar hva som har skjedd. Før resultatet i en tabell, og regn ut hastigheten på lipasens nedbrytning av melkefett (ml melk/min) alene og når det er gallesalt til stede. Framstill dataene i et søylediagram. Hvor stor effekt (i %) har gallesaltet på nedbrytningen av melkefettet ved lipase?

Forsøk A 1. Samle et par ml spytt i et reagensrør.

Videre arbeid Med utgangspunkt i dette forsøket og de resultatene du har fått, lager du et nytt forsøk der du sjekker det samme, men med ulik substratkonsentrasjon eller ved ulike temperaturer. Diskuter det nye forsøket med faglæreren din.

3. Enzymet amylase Enzymet amylase blir produsert og skilt ut fra spyttkjertler i munnen og fra bukspyttkjertelen. Amylase spalter stivelse og glykogen til forbindelser som inneholder 2 – 9 glukoseenheter. Det vanligste spaltningsproduktet er maltose, som er et disakkarid. Spytt inneholder amylase, og ned­ brytningen av stivelse starter derfor allerede i munnen. I dette forsøket skal du undersøke amylaseaktiviteten i ditt eget spytt. Forsøket viser at det er individuelle forskjeller i enzymaktivitet, og illustrerer hvordan amylaseaktiviteten varierer gjennom fordøyelsessystemet. Til læreren: Forsøket kan også brukes til å teste andre melkeprodukter og se på korrelasjon mellom fettinnhold og tiden det tar for fargeomslag.

Jods fargereaksjon med stivelse Stivelse består av to polysakkarider: amylose og amylopektin. Når jod reagerer med stivelse, skjer det ved at jod legger seg inni amylosespiralen, og komplekset får en mørk blå farge. Jo flere glukoseenheter det er i amylosen, desto blåere blir blandingen med jodløsning. I amylose med mer enn 45 glukosemolekyler blir fargen blå, med ca. 40 glukose­ molekyler blåpurpur, ca. 36 glukosemolekyler purpur, ca. 31 glukosemolekyler rød og ca. 12 glukosemolekyler svakt rød, og 9 glukosemolekyler får vi en ufarget løsning. I2 er gulfarget og I- fargeløs.

Utstyr

2. Merk 11 rør (1–11) og tilsett 1 ml løsning (pH 7) til alle rørene. 3. Lag en fortynningsrekke av spyttet på denne måten: a Tilsett 1 ml spytt i rør nr. 1 b Bland ved å suge opp og ned. Overfør 1 ml av blandingen til rør nr. 2 og bland igjen. c Overfør så 1 ml av rør nr. 2 til rør nr. 3, og fortsett på denne måten til rør nr. 10. I rør 10 tar du ut 1 ml og kaster innholdet. Du har nå laget en fortynningsrekke fra 1 : 2 til 1 : 1024. d I rør nr. 11 skal det kun være løsning med pH 7 (kontroll). 4. Tilsett 1 ml stivelsesløsning i alle rørene (1–11) og bland ved å tappe på røret. 5. La stå i 15 minutter. 6. Etter 15 minutter tilsetter du 2 dråper jodløsning til hvert rør og blander. Noter fargeforandringen. Forsøk B 1. Samle spytt i et rør og fortynn 1 : 5 ved å tilsette 4 ml vann til 1 ml spytt. 2. Fyll et rør med 1,5 ml løsning med pH 7 og et annet med 1,5 ml løsning med pH 3. 3. Tilsett 0,5 ml stivelse. 4. Tilsett så 0,5 ml av det fortynnede spyttet. 5. La stå i 15 minutter. 6. Tilsett deretter 2 dråper jodløsning og noter farge­ forandringen. Resultat Framstill resultatene dine i en tabell. Samle resultatene fra de andre i klassen og se ved hvilken fortynning all stivelsen blir brutt ned (gjennomsnitt for gruppene).

– Pipetter

Spørsmål

– Plastrør

Bruk resultatene til å forklare hvorfor enzymet amylase må skilles ut to ganger i løpet av fordøyelsesapparatet hos mennesket. Amylase forekommer i høy konsentrasjon i spirend­e korn – hvorfor det? Hva er mulige feilkilder i dett­e forsøket?

– Markørpenn – Stoppeklokke – Løsninger med ulik pH-verdi (f.eks. pH 3, pH 7) – Jodløsning – Stivelsesløsning (bør være fersk og godt oppløst) – Spytt


Praktisk arbeid • 423

4. Enzymet katalase Enzymet katalase er et enzym som forekommer i alle levend­e celler. I leveren hos dyr er det særlig høy forekomst av enzymet. Det er fordi det i leveren foregår en mengde detoksifiseringsreaksjoner, og en del av disse danner hydrogenperoksid (H2O2), som er en gift. Denne giften må svært raskt omdannes til vann og oksygen. I og med at det danne­s en gass, kan effekten synliggjøres ved mengden bobler som blir dannet på ulikt vev. 2H2O2 - 2H2O + O2 I dette forsøket skal dere se på hvordan ulike stoffer kan påvirket enzymet, og om det er mer eller mindre av det i ulike celler.

Utstyr – Lever, potet, eple – 3 % H2O2 – 0,1 M blynitrat – Begerglass, målesylinder

Forsøk B: Påvirkning av blynitrat 1. Knus lever slik at du får ca. to spiseskjeer med fersk most lever. 2. Ta en spiseskje med most lever i en målesylinder og tilset­t 3 ml destillert vann. 3. Ta en spiseskje med most lever i en målesylinder og tilset­t 3 ml 0,1 M blynitrat. 4. Tilsett en dråpe oppvaskmiddel i hver målesylinder og bland forsiktig. 5. Tilsett 5 ml av hydrogenperoksidet til hver målesylinder. 6. Noter det som skjer. Forsøk C: Mengden katalase i ulike celler 1. Skjær ut like biter av fersk lever, eple og potet. 2. Knus de ulike cellene i morteren. 3. Fordel mosen av de ulike cellene i hver sin målesylinder. 4. Tilsett en dråpe oppvaskmiddel i hver målesylinder og bland forsiktig.

– Oppvaskmiddel

5. Tilsett 5 ml av hydrogenperoksidet til hver målesylinder.

– Teskjeer

6. Noter det som skjer.

– Morter

Forsøk D: Temperaturens innvirkning 1. Mos fersk lever slik at du får to spiseskjeer med lever.

– Varmebad 50 °C – Kniv – Destillert vann – Stoppeklokke

Tips til læreren: Noen grupper kan eventuelt sette rørene i vannbad ved 37 °C ved punkt 5 i forsøk A og B.

Framgangsmåte Forsøk A: Form på lever 1. Skjær ut to biter på størrelse med en stor teskje fra leveren.

2. Overfør en spiseskje med lever til en målesylinder og tilsett 3 ml destillert vann. 3. Sett en av de to målesylindrene i vannbadet på 50 °C. Den andre i romtemperatur. 4. Tilsett en dråpe oppvaskmiddel i hver målesylinder og bland forsiktig. 5. Tilsett 5 ml av hydrogenperoksidet til hver målesylinder. 6. Noter det som skjer. Resultat Sett resultatene dine inn i en tabell og forklar resultatene.

2. Knus den ene i morteren. 3. Ta leverbiten og den knuste leveren over i hver sin måle­sylinder, skyll morteren med 3 ml destillert vann og hell dette i målesylinderen med most lever. 4. Tilsett 3 ml destillert vann til målesylinderen med fast lever. 5. Tilsett en dråpe oppvaskmiddel i hver målesylinder og bland. 6. Tilsett 5 ml av hydrogenperoksidet til hver målesylinder. 7. Noter det som skjer.

Spørsmål Hvordan ville du bevise at det er oksygengass som dannes ved spalting av hydrogenperoksid? Hvorfor er det forskjell i mengden katalase i en frukt og i en lever? Hvor i cellen finner vi katalase?


424 • Praktisk arbeid

Praktisk arbeid 5. Enzymet pepsin Pepsin er et enzym som kan bryte ned proteiner. Virkningen av dette enzymet er det enkelt å observere kvalitativt ved at man legger små biter av kokt eggehvite i en løsning. Du skal nå lage et forsøk hvor du bruker eggehvite og pepsin, og hvor du skal se på to av faktorene som påvirker effektiviteten til et enzym: • temperaturoptimum • pH-optimum • mengden substrat • mengden enzym • hemmere Diskuter forsøket ditt med faglæreren og tenk særlig over hvilke feilkilder som lett kan oppstå og hvordan du unngår dem.

Framgangsmåte 1. Gjør klar de fem dramsglassene slik det er vist i denne tabellen. Glass

0

1

2

3

Antall frø

25

25

25

25

Vann

5 ml

5 ml

5 ml

5 ml

Dråper alkohol

0

1

2

4

2. Rør i glassene (ikke med samme glasstav!). 3. Sett glassene bort til neste time eller i minst 40 minutter­et mørkt sted. 4. Plasser papir i bunnen av hver petriskål. Skjær til papiret­slik at det ikke ligger langs kanten. Det må altså være noe mindre i diameter enn petriskålen. 5. Hell glasset med frø ut i de respektive petriskålene (husk å merke dem).

Alkohol som gift – test på spirende frø

6. Fordel frøene med en pinsett slik at de blir spredt jevnt utover petriskålen. Ikke løft på frøene, bare skyv dem med pinsetten.

Kapittel 7, 8, 9

7. Lim lokket fast til bunnen med teip slik at det blir helt tett.

Etanol, vanlig kjøpesprit, er et giftstoff for organismer. Et giftstoff kan påvirke en organisme på ulike måter. I dette forsøket skal du se på hvordan alkohol påvirker spiringsprosent og vekstlengde hos karsefrø.

Utstyr – Tusj

8. Sett skålene mørkt og ved stabil temperatur, for eksempel i en eske inne i et skap. 9. La skålene stå i to til tre dager. 10. Etter første vekstperiode tar du fram skålene og åpner lokket.

– Ca. 125 karsefrø per gruppe

11. Tell hvor mange som har spirt, og tegn hvordan de ulike skålene ser ut.

– Pinsett

12. Tilsett så 5 ml destillert vann til alle skålene.

– Tørkerull (uten farge) eller kaffefilter/watmannpapir

13. Lim fast lokket igjen og sett skålene mørkt i fire dager.

– Dramsglass – 5 petriskåler per gruppe – Destillert vann – Parafilm eller teip

14. Etter fire dager tas skålene fram, og lokket tas av. 15. Mål lengden på spiren. Det gjør du ved å måle fra frøbladene og ned til rota. Resultater Lag en tabell over spiringsprosent og mengden alkohol. Lag også en tabell over lengden på stengelen. Samle data fra hele gruppa og finn fram til gjennomsnittslengde og standardavvik ved de ulike behandlingene. Ikke spirende planter settes lik 0. Finner du en grenseverdi for mengden alkohol? * Tips: Hvordan du regner ut standardavvik er beskrevet på www. gyldendal.no/bi.


Praktisk arbeid • 425

Celleånding Kapittel 7, 8

1. Celleånding gir CO2 Det skjer forbrenning i oss (celleånding), og det skjer forbrenning­i et stearinlys. I begge disse eksemplene på forbrenning blir det dannet CO2, og det kan påvises ved at kalkvann blakkes.

Framgangsmåte 1 Fyll 4 reagensrør fulle med vann. 2 Tilsett ca. 15 dråper med fenolrødt. 3 Legg en bit av vannplanten, helst en hel «stengel», i to av de fire rørene. 4 Sett et rør med vannplante og et rør med bare væske og fenolrødt ved en lyskilde i romtemperatur og til­ svarende i et lukket skap. Resultat

Utstyr – Erlenmeyerkolbe – Reagensrør – Kalkvann – Sugerør – Stearinlys

Framgangsmåte 1. Pust gjennom et sugerør og ned i kalkvann. 2. Tenn et stearinlys og hold en erlenmeyerkolbe over lyset mens det brenner. 3. Etter to minutter snur du kolben forsiktig og heller raskt på litt kalkvann. 4. Sett på kork og rist kolben slik at gassen blander seg med væsken. Resultater Forklar hva som skjer i de to forsøkene. Skriv opp reaksjons­ligningen for den reaksjonen som skjer.

2. Celleånding hos planter Planter må som alle andre eukaryote celler drive celle­ ånding for å overleve. Det punktet hvor en plante skiller ut like mye karbondioksid som den binder i fotosyntesen, kaller vi plantens kompensasjonspunkt.

Utstyr – Vannplante: javabregne eller vasspest – Reagensrør – Et skap som er lystett – Lyskilde – Fenolrødt

Ta fram glassene etter to til tre dager og observer resultatet­. Forklar forskjellene og hvorfor det ble brukt en kontroll­prøve både i skapet og ved lyskilden. Forklar kjemisk­, med ord og reaksjonslikning, det som forårsaker forskjellen mellom mørkebehandling og lysbehandling av vannplantene.


426 • Praktisk arbeid

Praktisk arbeid Celleånding hos gjær

Framgangsmåte 1. Løs gjær, for eksempel 25 gram, i 150 ml vann i en erlenmeyerkolbe.

Kapittel 7, 8 Når celler forbrenner næringsstoffer, dannes det CO2-gass. Denne gassen kan fortrenge væske, og på denne måten kan mengden fortrengt væske bli et mål på hvor mye gass som har blitt dannet. Når gjærceller har anaerob celle­ ånding, vil sukker bli brutt ned til pyruvat, og så vil det neste leddet bli dannelsen av etanol i reaksjoner kjent som fermentering. For å bevise at cellen ikke lenger har oksygen, benyttes indikatoren Janus B grønn (C30H31N6Cl). Indikatoren skifter farge fra dypblå til rosa når oksygenet forsvinner. Gruppa kan med fordel deles opp i mindre grupper slik at flere parametere (temperatur, mengde glukose, mengden gjær) kan sjekkes. Glukose

G LY K O LY S E N

H

2 ATP

OC

O

C

O

CH3

C

OH

CH3 2 Etanol 2 NAD+ 2 NADH

2 Pyruvat

4. Rist forsiktig til sukkeret er løst i løsningen. 5. Gjærløsningen er anaerob når den er rosa. 6. Les av målesylinderen som står opp ned i vannbadet. (NB: Ikke det vannbadet som gjærløsningen står i.) 7. Putt så slangen under målesylinderen i vannet og start målingene.

Resultat Samle resultatene dine og fra de andre gruppene og present­er dem både i en tabell og som graf. Ved hvilke forhold ble det dannet mest CO2?

H C

CO2

3. Tilsett 1 ml 0,03 % Janus B grønn og mengden glukos­e.

8. Les av gassmålingen hvert fjerde minutt i ca. 40 minutter­.

H

2 ADP

2. Sett opp utstyret.

Spørsmål O

CH3 2 Acetaldehyd

Hvorfor bruker vi helst kokt og avkjølt vann i dette forsøke­t? Reaksjonslikningen for fermenteringen er C6H12O6 → C2H5OH + 2 CO2 + energi

0712_Etanol

Utstyr – Gjær – Kokt og avkjølt vann – Vannbad ved ulike temperaturer (fra 10 til 100 °C) – Ulik mengde glukose, for eksempel 1 gram og 2 gram – 1 ml 0,03 % Janus B grønn – Målesylindere, helst 500 ml eller 1 liter og helst av glass – Slanger og klemmer – Klokke – Erlenmeyerkolbe

Det betyr at for 1 mol glukose vil det bli dannet 2 mol etano­l og karbondioksid. Finn molekylvekten til glukose og beregn hvor mye vann som teoretisk skulle blitt fortrengt ved de ulike mengdene glukose. Ved denne utregningen kan du bruke formelen som tilsier at 1 mol gass vil fortrenge 22,4 l væske. Tips til læreren: En variant av denne øvelsen finner du på læreverkets nettsider.


Praktisk arbeid • 427

Fotosyntesepigmenter Kapittel 9

1. Ekstrahering av pigmenter fra blad En fotosyntetiserende organisme vil inneholde ulike pigmenter for å kunne fange lyset og bruke energien derfra til å eksitere et elektron i fotodelens reaksjonssenter. Disse pigmentene vil særlig være til stede i bladene hos planter. Dere kan undersøke dem ved at dere løser dem opp i en væske. Denne væskeløsningen kan brukes i øvelsene på de neste sidene.

Utstyr – Blader fra ulike planter (men unngå svært saftige blader og blader med mye voks) – Aceton – Morter – Begerglass – Tesil

Framgangsmåte 1. Riv opp bladene i småbiter og ha dem i morteren. 2. Tilsett ca. 5 ml aceton til løsningen og knus bladene så godt du kan. Jo grundigere du knuser bladene, desto mer pigment får du løst ut i løsningen. 3. Hell løsningen over i et lite begerglass og press ut så mye som mulig av væsken fra det plantematerialet som ligger igjen i morteren. 4. Løsningen kan nå helles over i en liten glassbeholder med tett lokk og oppbevares noen dager i kjøleskap dersom du ikke skal bruke den i øvelsen på side 428 og 429, del 1 eller del 2 med en gang.

2. Ekstrahering fra en algekultur Du kan også ekstrahere klorofyllpigmenter fra grønnalger. Algekulturen bør ha høy konsentrasjon og mørk grønnfarge.

Utstyr – Grønnalge, Chlamydomonas reinhardtii eller Scenedesmus quadricauda – Sentrifuge – Aceton

Framgangsmåte 1. Bruk 4 ml 100 % aceton til 1 ml algekultur (husk glassrør). 2. Vent i 5 minutter. 3. Spinn så ned kulturen ved 10 000 rpm i 5 minutter. 4. Dekanter fra supernantanten til test-tubene. Test-tubene kan nå brukes til papirkromatografi, eller til spektrofotometer/kolorimeter (neste øvelse). Til læreren: Se www.gyldendal.no/bi for forslag til dyrking av alger. Elevene kan ekstrahere fra både alger og blader og deretter skanne disse prøvene i et spektrofotometer i bølgelengdene 350 nm til 730 nm.


428 • Praktisk arbeid

Praktisk arbeid Fotosyntesepigmenter hos planter

3. Tørk med en hårføner og gjenta punkt 2 til du har fått en mørk flekk på kromatograferingspapiret.

Kapittel 9

4. Tilsett løpevæske til den typen kar du bruker (nok til at enden på papiret er nede i løsningen). Vær rask og presis, for løpevæsken er flyktig og fordamper raskt.

1. Papirkromatografering av foto­ syntesepigmenter

5. Fest papiret og sett det ned i løpevæsken. Den avsatte flekken MÅ være over væsken.

Papirkromatografi er en enkel og billig måte å separere stoffer fra hverandre på. Flekker med en blanding av flere stoffer settes på papiret, og løpevæsken med pigmentene i trekker seg oppover i papiret på grunn av kapillærkreftene. Store molekyler møter større motstand i cellulosen enn de små molekylene. Stoffene har også ulik løselighet i løpevæsken, og de mest løselige stoffene stiger høyest. Løpevæsken består av organiske løsemidler.

6. Tett igjen karet med aluminiumsfolie eller en tett pose. 7. Etter ca. 30 minutter, eller når væsken har trukket minst 10 cm opp i papiret, kan du ta ut papiret og la det stå til tørk stående. 8. Væskefrontene er en betegnelse på hvor langt væsken har gått i papiret. Merk av dette punktet på papiret. a)

b) Aluminiumsfolie

Utstyr

Kork

– Ekstraherte pigmenter i acetonløsning, se side 427

Nål

– Løpevæske (petroleumseter : aceton = 9 : 1) – Pasteurpipette

Papir

– Kromatograferingspapir – Målesylinder, begerglass, kromatograferingskar

Målesylinder (100 ml)

– Aluminiumsfolie – Knappenål – Hårføner

Kromatograferingspapir

Framgangsmåte 1. Trekk en horisontal linje med blyant og linjal ca. 2 cm opp på kromatografipapiret (kortsiden). 5 ml løpevæske

2. Bruk pasteurpipetten til å avsette løsningen på et bestem­t punkt på den opptrukne linja.

Kromatograferingspapir

En flekk med en blanding av flere stoffer er satt på papiret

1211_Stoffer

Glassklokke

Kar med organisk løsningsmiddel (løpevæske)

1212_Klorofyll

Løsningsmidlet trekker oppover

Stoffene i den opprinnelige flekken har skilt lag


Praktisk arbeid • 429

Resultater Presenter resultatet ved at du setter navn på de ulike pigmentene som ble funnet. Presenter resultatet som en tabell der du også regner ut Rf-verdien til de ulike pigmentene. Rf-verdien til et pigment sier noe om hvor langt pigmentet har beveget seg i løpevæsken. Du finner den på denne måten: Rf= b/a, der b er avstanden mellom startpunktet og sluttpunktet der pigmentet stoppet, og a er avstanden mellom startpunktet og væskefronten. Spørsmål Diskuter fordelingen av ulike pigmenter hos de forskjellige artene som ble laget til i gruppa.

2. Klipp biten i enda mindre biter og ha dem i en kolbe. 3. Tilsett aceton i kolben til bitene er godt dekket. 4. Rist til fargen er borte fra papirbitene. 5. Hell det oppløste fargestoffet over i en ny og ren kolbe­. 6. Sett kolben i det kokende varmebadet, og la acetonet dampe av. 7. Løs opp fargestoffet i litt etanol slik at papiret dekkes. 8. Hell fargeløsningen over i en kyvette som kan brukes i spektrofotometeret eller kolorimeteret. 9. Mål transmisjonen med jevne mellomrom fra 380 nm til 780 nm.

Til læreren: Petroleumseter er svært brannfarlig, og kan erstattes med n-heksan.

10. Noter resultatene.

2. Analyse av fotosyntese­ pigmenter ved bruk av spektro­ fotometer eller kolorimeter

Absorpsjon

Ofte blir det igjen noe brunlig der pigmentløsning ble tilsatt. Hva tror du det er? Dersom det er et pigment, hvorfor har det ikke bevegd seg med løsningen?

Framgangsmåte 1. Klipp opp et bånd fra papirkromatografien.

Lysspekteret

Klorofyll b Klorofyll a Karotenoider

Med et spektrofotometer kan du måle hvor mye en løsning absorberer ved ulike bølgelengder. Et kolorimeter er en enklere utgave av spektrofotometeret og kan benyttes i dette forsøket. Når du jobber med slike apparater, er det viktig å huske at kyvetten ikke må holdes feil, for da blir fingermerkene dine feilkilder, og apparatet må til stadighet nullstilles oppimot en prøve.

Fykoerythrin Fykocyanin

400

500

600

700 nm Bølgelengde

Utstyr – Pigmenter som er atskilt ved papirkromatografi (se side 428) – Saks – Kolbe – Spektrofotometer, kolorimeter – Aceton – Etanol – Kokende vannbad

0613_Pigmenter Resultater

Framstill resultatene dine grafisk. Dersom dere hadde forskjellig­e planter, samler dere alle dataene i en tabell og framstiller den grafisk.


430 • Praktisk arbeid

Fotosyntese Kapittel 9

1. Påvisning av stivelse i blad Jodløsning påviser stivelse ved at det gir stivelsesmole­ kylene en blå farge. I dette forsøket skal du påvise hvor i et blad det vil være stivelse under gitte forhold.

Utstyr – Blad, helst tynt og grønt

2.Trengs det lys for å danne stivelse? I disse forsøkene skal du teste om fravær av lys også fører til at det ikke blir dannet stivelse. Sammensetningen av glukoseenheten foregår i stroma i kloroplasten. Forsøket er todelt. Forsøk A

Utstyr – Vannplante, vasspest eller javabregne

– Aluminiumsfolie

– Glukoseløsning

– Vann

– Jodløsning

– Etanol

– Reagensglass

– Jodløsning

– Pinsett

– Petriskål – Gassbrenner, kokeplate

Framgangsmåte 1. Lag et mønster på en bit aluminiumsfolie. 2. Dekk et område av et grønt blad med aluminiums­ folien. 3. La planten stå ved vanlige forhold i tre til fem dager. 4. Klipp så av bladet med folien og et annet blad fra den samme planten. 5. Kok bladene i vann et par minutter. 6. Legg så bladene i etanol. 7. Ta bladene over i petriskålene og tilsett jod. Resultater Noter resultatet og ta gjerne et bilde av bladet med mønsteret. Gi en forklaring på de områdene som ikke blir farget av jod.

Framgangsmåte 1. Plasser vannplantene enten lyst eller mørkt i minst fire dager. Det bør være en del plantemateriale da det skal fordeles videre senere. 2. Fjern blader fra plantene, både fra dem som har stått lyst, og dem som har stått mørkt. 3. Drypp jod på bladene og noter hva som skjer. 4. Del den vannplanten som har stått mørkt, i to like dele­r (minst 4 cm i hver). 5. Legg den ene delen i vann. 6. Legg den andre delen i sukkerløsning. 7. Sett begge mørkt en ukes tid. 8. Etter ei uke fjerner du blader fra begge vannplantene og tilsetter jod til hver av dem. Resultat Sett resultatene inn i tabellen.

Spørsmål

Vasspest eller javabregne

Dersom du tilsetter jodløsning til glukose, vil du ikke få en fargeforandring i løsningen. Hva er det som gjør at jod kan danne et fargekompleks med stivelse?

Stått mørkt

Til læreren: Denne øvelsen kan også gjøres ved at du isolerer pigmentene og gir elevene i oppdrag å finne en metode for å kunne undersøke hvilket pigment de har fått utlevert, og så gjennomføre øvelsen. Det er viktig å ikke løse pigmentene opp i for mye etanol da dette innebærer at konsentrasjonen av pigmenter lett kan bli for lav.

Testet ved jod

Stått lyst Stått mørkt + sukkerløsning Stått mørkt + vann Til læreren: Dette forsøket kan du også gjøre ved å bruke blader fra for eksempel geranium og andre vanlige stueplanter. Husk at bladene da må kokes i vann og varmes i etanol, se forrige forsøk.


Praktisk arbeid • 431

Forsøk B

Fotosyntese og rustne spiker Kapittel 9

Utstyr – Blad fra plante som har stått mørkt en stund (helst over fire dager) (Geraniumarter eller Coleus) – Sterile petriskåler

I dette forsøk skal du sjekke om en vannplante kan påvirke dannelsen av rust på en spiker og i så fall hvorfor den kan gjøre det. A

B

C

– Sukkerløsning – 3 g per 100 ml vann – Jodløsning – Etanol

Framgangsmåte 1. Skjær av bladstilken helt inntil bladplaten. 2. Legg ett blad i petriskålene med sukkerløsning. Løsningen skal dekke hele bladet. 3. Legg ett blad i petriskålene med vann. 4. Plasser de to petriskålene på samme mørke sted i en uke. 5. Etter en uke tas bladene fram og kokes i vann. 6. Kok så begge bladene i etanol. 7. Skyll grundig med vann og legg bladene i petri skåler. 8. Tilsett jodløsning til bladene. 9. Noter hva som skjer med bladet og jodløsningen. Resultat Hvilket blad dannet stivelse i mørke? Spørsmål Hvor foregår dannelsen av stivelse i bladet? På hvilken måte blir dette påvirket av lyset?

Spalteåpninger Kapittel 9 Spalteåpninger er helt vitale for en plante og for hvordan et blad organiserer gassutvekslingen sin. Tenk ut et forsøk der du enkelt skal kunne vise på hvilken side av bladet de fleste stueplantene har sine spalteåpninger (sukkulenter er ikke med her). Bladene som skal brukes, må være fra samme art og må ha stått lyst. Gi først en forklaring på disse to kravene, og tenk så ut et forsøk der du kan vise på hvilken side spalteåpningene er. NB: Det er ikke lov å bruke lupe eller mikroskop.

Utstyr – Reagensrør med kork – Vannplanter, vasspest eller javabregne – Kokt og avkjølt vann – Aluminiumsfolie – Lyskilde – Spiker (ikke galvaniserte) – Begerglass – Sandpapir

Framgangsmåte 1. Puss hver av de tre spikrene med sandpapir før de legge­s ned i reagensrøret. 2. Merk rørene a, b og c og legg en spiker i hver av dem. 3. Legg like mye vannplante i rørene B og C. 4. Fyll reagensrørene fullstendig fulle med det kokte og avkjølte vannet. Få vekk mest mulig av luftboblene. 5. Dekk reagensrør C med aluminiumsfolie eller annet dekkmateriale som vil gjøre det lystett.


432 • Praktisk arbeid

6. Sett de tre reagensrørene i et begerglass og fyll dette med vann. 7. Sett begerglasset foran lyskilden. 8. Etter fire dager sjekker du de forskjellige spikrene. Gjør deretter dette daglig i inntil 9 dager fra forsøket starte­r.

4. Klipp av stilken – under vann! 5. Få stilken inn i sprøytebeholderen og fest denne med klesklype slik det er vist på bildet ovenfor. 6. Tell boblene.

9. Noter det du ser i de ulike reagensrørene. Resultat Framstill resultatene dine i en enkel tabell og drøft årsakene til dem. Spørsmål Hvorfor brukte vi kokt vann i dette forsøket? Hvorfor vil eventuelle luftbobler i rørene være viktige feil­ kilder? Hvorfor er det viktig at spikrene blir pusset med sandpapir før de legges i reagensrørene?

Lys og vannplanten javabregne Kapittel 9 I dette forsøket skal du se på noen faktorer som påvirker fotosyntesemengden hos javabregne. Gruppa bør gjøre forsøket på tre ulike steder hvor en parameter måles – for eksempel ved en lyskilde, en lyskilde med filtrert lys og i vanlig klasseromslys.

Utstyr – Vannplante – helst javabregne (eventuelt vasspest, elodea)

Resultat Sett resultatene inn i en tabell og forklar de ulike tallene dere har fått. Pek på ulike feilkilder i dette forsøket. Til læreren: Skolelaboratoriet i biologi ved UiO og Naturfagssenteret har sammen med SAPS utviklet et forsøk hvor man enkelt og kvantitativt kan sjekke ytre faktorers påvirkning på fotosyntese. Lenke til forsøksbeskrivelsen finner du på www.gyldendal.no/bi.

– Saks – Pinsett – Beholderdelen av en sprøyte som er tettet

Ytre faktorers påvirkning på fotosyntesen

– Liten pipette, pasteurpipette

Kapittel 9

– Målesylinder

– Klesklype – Lyskilde

Framgangsmåte 1. Legg vannplanten i en målesylinder. 2. Tett beholderdelen av en sprøyte slik det er vist på figuren (med plastilin, tyggegummi eller annet). 3. Fyll vann i beholderen.

Med tanke på de ulike metodene du nå har lært av de foregående forsøkene om fotosyntese, skal du selv sette sammen et forsøk der du ser på hvordan en ytre faktor påvirker fotosyntesen. Lag først et så grundig utkast som mulig, og så diskuterer du dette med faglæreren din. Sørg for å ha tenkt igjennom mulige feilkilder og at det kun er én parameter du sjekker i forsøket ditt. TIPS: Ofte kan det være enklere å gjøre kontrollerte forsøk om du bruker grønnalger heller enn planter i forsøket ditt.


Praktisk arbeid • 433

Kloning av plante Kapittel 10 Kloning av planter kan foregå på mange forskjellige vis. Den mest kjente er kanskje stiklinger. Kloning av planter kalles også ofte i planteforedlingen for regenerering. Her skal vi se nærmere på bladstiklinger. Det er viktig å huske at disse bladene allerede er spesialiserte organer med ulike vev. Dette blir nullstilt, og differensieringen begynner på nytt når vi kloner slike celler. Det betyr at vi får dannet en stamcelle fra en differensiert celle. Vi skal se på tre ulike måter å gjøre dette på, som er tilpasset den arten som vi vil klone.

Utstyr – Planter: saintpaulia, begonia og svigermorstunge (sansevieria) – Potter med jord (blanding av veksttorv og sand) – Plastposer (gjennomsiktige) og strikk

B Begonia 1. Velg et friskt, velutviklet blad. 2. Fjern bladstilken og lag snitt gjennom bladflaten nedenf­or hovednervens forgrening. 3. Legg bladet med undersiden ned på jorda og legg noen ankerpunkt på, enten noen småstein eller potteskår­. 4. Etter noen få uker bryter det fram nye planter i snittflatene­. C Svigermorstunge 1. Skjær av et velutviklet blad fra planten. 2. Del bladet opp i biter på ca. 5 cm. Husk hva som er opp og ned på bladet. 3. Sett bladbiten med nedre snittflate i jorda. 4. Trekk en plastpose over og fest med strikk. 5. Etter 5–6 uker kommer det nye planter ut av de snitted­e bladene.

– Kniv – Småstein, potteskår

Framgangsmåte A Saintpaulia 1. Skjær av to blader med lang bladstilk. Bruk en skarp kniv og snitt bestemt. 2. Stikk to hull i potten for stiklingene. 3. Sett bladstilkene nedi hullene og jevn til jorda. Blad­ platen skal ikke berøre jorda. 4. La vann få renne gjennom potta. 5. Fest en plastpose over potta med en strikk. 6. Når det nye skuddet kommer, bør det settes i egen potte.

Resultat Forklar hvordan det er mulig å bruke allerede spesialiserte celler til å danne et nytt individ hos planter. Hvor høy «klonings­prosent» fikk du til – ble det nye planter ut av alle forsøkene? Hvis ikke, forklar i så fall feilkildene.


434 • Praktisk arbeid

In vitro plantekultur Kapittel 10 Ved snitting av plantevev vil det på sårflater dannes et sårvev, eller et kallus. Kallus er en celleklump med aktiv celle­ deling. Dette kalluset kan dyrkes på ulike næringsmedier, og når vi setter til ulike hormoner i kombinasjon med nærings­mediet, kan kalluset danne røtter og differensiere seg til en ny plante. Dersom vi tar ut meristematisk vev fra en plante og setter det i et slikt næringsmedium, kan vi få framvekst av nye gentisk identiske planter. Ved slikt arbeid er det viktig å jobbe så sterilt som mulig siden nærings­ mediet er som et ferdig dekket bord med mat for alt som måtte finnes av sporer, bakterier osv i lufta rundt oss.

Utstyr – MS-medium (kjøpes ferdig, Murashige & Skoogs medium) – Steriliseringsmuligheter – Etanol – Pinsett

Framgangsmåte 1. Skjær bladstilken av et blad eller vask en gulrot. 2. Med en sterilisert skalpell skjærer du ut små biter fra margen av gulrota. 3. Legg gulrotbitene og bladet i 7,5 % klorløsning i 30 minutter. 4. Skyll grundig i sterilt vann. 5. Dypp bitene 30 sekunder i 70 % etanol. 6. Skyll i sterilt vann. 7. Skjær opp bladet i små biter (unngå «nervene») og fjern de ytterste lagene av gulrotbiten. 8. Overfør plantebitene til petriskålen med vekstmediet i. Legg biten raskt på plass, og ikke hold lokket på petriskålen mer oppe enn nødvendig. Ha fem biter i hver petriskål. 9. Tett igjen lokk og bunn med parafilm eller teip. 10. Etter 8–10 dager vil du begynne å se at det blir dannet kallus på snittflatene.

– Skalpell

Resultat

– Gassbrenner

Tegn eller ta bilde av kallus. Forklar hva som har skjedd med cellene.

– Parafilm – Blader eller gulrot – Sterilt vann (kokt og avkjølt holder)


Læreplan i biologi • 435

Læreplan i biologi – programfag i studiespesialiserende utdannings­ program Fastsett som forskrift av Utdanningsdirektoratet 29. mars 2006 etter delegasjon i brev 26. september 2005 frå Utdannings- og forskings­ departementet med heimel lov av 17. juli 1998 nr. 61 om grunnskolen og den vidaregåande opplæringa (opplæringslova) § 3-4 første ledd. Gjelder fra 01.08.2006

Føremål Menneske har alltid vore avhengige av kunnskapar om naturen for å overleve. Biologisk kunnskap inkluderer alt frå det forunderlege som skjer på mikronivå i det indre av cellene, til samspelet i økosystema på jordkloden. Tilfanget av kunnskap aukar raskt, og biologi handlar om å kunne bruke kjend fagkunnskap til å beskrive og forstå nye fenomen, skape ny kunnskap og delta med fagleg kompetanse i samfunnsdebatten. Programfaget skal gje grunnlag for å bruke biologisk fagkunnskap i ulike samanhengar, i praktiske situasjonar i kvardagen og til vurderingar kring etiske spørsmål. Gjennom programfaget biologi skal den einskilde bli medviten om at mennesket er ein av mange artar, at det er ein vekselverknad mellom menneska og naturen, og at biologisk kunnskap er ein vesentleg føresetnad for ei berekraftig forvalting av naturressursar og naturmiljø. Programfaget skal leggje til rette for å bli kjend med kulturen, språket og arbeids­ måtane i faget, og øve opp ulike former for kommunikasjon. Det skal øve opp evna til å fokusere på detaljar og til å byggje opp ei heilskapleg forståing, og det legg vekt på observasjonar, diskusjon, kritisk vurdering og krav til grunn­gjevingar. Programfaget gjev grunnlag for vidare studium innanfor biologi og biologirelaterte område. På same tid skal opplæringa leggje vekt på dei allmenndannande sidene ved biologifaget, som biologisk kunnskap knytt til miljøutfordringar, berekraftig utvikling, bioteknologiske spørsmål og spørsmål knytte til kropp og helse. Denne kompetansen kan leggje grunnlag for å tileigne seg ny kunnskap gjennom heile livet. Sidan biologifaget er i stadig utvikling, inngår òg eit historisk perspektiv i faget. Programfaget gjev gode høve til å ta opp variasjon og avvik frå teori og modellar som grunnlag for å utvikle ny teori og nye modellar. Programfaget skal gjere bruk av naturen som læringsarena og på den måten leggje eit grunnlag for å oppleve glede og undring over naturen og respekt for han. For å utvikle kunnskap om metodar og tenkjemåtar i biologi er det nødvendig å arbeide både praktisk og teoretisk med programfaget. Vekselverknaden mellom teoretiske kunnskapar og praktiske ferdigheiter og opplevingar frå laboratorium og feltarbeid er grunnleggjande for biologisk forståing. Opplæringa skal leggje til rette for at desse perspektiva blir varetekne i arbeidet med programfaget.


436 • Læreplan i biologi

Hovudområder Biologi 2 Den unge biologen Hovudområdet handlar om å bruke biologifaglege arbeidsmåtar i økologisk feltarbeid og i undersøkingar og forsøk i laboratoriet. Vidare inngår arbeid med miljøutfordringar og vurdering av informasjon i media i hovudområdet. Etiske sider ved biologisk arbeid inngår òg.

Energiomsetning Hovudområdet handlar om dei grunnleggjande oppbyggings- og nedbrytingsprosessane i fotosyntese og celleanding. I tillegg tek hovudområdet opp den rolla enzym og kofaktorar spelar for biokjemiske prosessar.

Genetikk Hovudområdet handlar om oppbygginga av DNA-molekyl og korleis dei er utgangspunktet for styring av livsprosessane. I tillegg dreiar hovudområdet seg om korleis nedarvingsmønster kan studerast frå generasjon til generasjon, og korleis endringar i kodinga til DNA-molekyla kan føre til mutasjonar og sjukdommar.

Bioteknologi Hovudområdet handlar om utviklinga innanfor bioteknologi og genteknologi og korleis det har ført til nye hjelpemiddel og teknikkar innanfor medisin, produksjon av mat og biologisk forsking. Etiske utfordringar og miljøutfordringar i samband med bruk av bioteknologi inngår i hovudområdet.

Økologi Hovudområdet handlar om at alle levande organismar er påverka av andre organismar og av dei fysiske og kjemiske tilhøva der dei lever. I tillegg dreiar hovudområdet seg om vilkåra som regulerer og påverkar ulike populasjonar i eit økosystem. Menneskeskapte miljøproblem er òg ein del av hovudområdet.

Evolusjon Hovudområdet handlar om korleis livet på jorda kan ha oppstått, og hovudtrekka i utviklinga fram til i dag. Sentralt i hovudområdet er opphav av nye artar med nye eigenskapar sett i samanheng med dei grunnleggjande mekanismane som kan endre den genetiske samansetjinga i populasjonar.


Læreplan i biologi • 437

Grunnleggjande ferdigheiter Grunnleggjande ferdigheiter er integrerte i kompetansemåla, der dei medverkar til å utvikle fagkompetansen og er ein del av han. I biologi forstår ein grunnleggjande ferdigheiter slik: Å kunne uttrykkje seg munnleg og skriftleg i biologi inneber å gjere greie for eigne observasjonar og røynsler frå naturen og laboratoriet ved å bruke biologifaglege omgrep. Det omfattar å formulere spørsmål og hypotesar som kan undersøkjast, argumenterast for og drøftast i høve til annan biologisk informasjon. I tillegg vil det seie kritisk vurdering av ulike typar biologisk informasjon i fagtidsskrift og i media. Å kunne lese i biologi inneber å trekkje ut, tolke og reflektere over informasjonen som finst i biologifaglege tekstar, brosjyrar, aviser og bøker og på Internett. Det omfattar å forstå oppskrifter, tabellar, diagram og symbol. Å setje seg inn i nye område av faget ved å forstå stadig meir krevjande biologisk litteratur er ein del av kompetansen. Å kunne rekne i biologi inneber å bruke tal og utrekningar, registrere, gjere enkle statistiske analysar, arbeide med og presentere resultat av eigne observasjonar. Å setje seg inn i og bruke matematiske modellar frå biologisk forsking inngår òg. Like eins inneber det å forstå resultat i form av grafar og tabellar. Å kunne bruke digitale verktøy i biologi inneber å hente informasjon og utforske, registrere, arbeide med og presentere resultat av eigne observasjonar. Det omfattar å bruke animasjonar og simuleringar til å illustrere og utdjupe biologifagleg stoff. Å vurdere nettbasert biologifagleg informasjon inngår òg.

Kompetansemål Biologi 2 Bioteknologi Mål for opplæringa er at eleven skal kunne • gjere greie for framstilling av genetiske fingeravtrykk, og korleis dei kan brukast i rettsmedisin og i studium av slektskap mellom individ og grupper av organismar • forklare korleis genmodifiserte organismar kan framstillast, drøfte korleis dette kan nyttast innanfor medisin, produksjon av mat og biologisk forsking, og kva følgjer dette kan ha for miljøet • gjere greie for den biologiske verdien av stamceller, forklare prinsippa for reproduktiv og terapeutisk kloning og drøfte etiske sider ved val av ulike kjelder for stamceller • formulere og drøfte problemstillingar kring bruk av gendiagnostikk og genterapi på menneske


438 • Læreplan i biologi

Den unge biologen Mål for opplæringa er at eleven skal kunne • planleggje og gjennomføre undersøkingar i laboratorium frå alle hovudområda, rapportere frå arbeida med og utan digitale verktøy og peike på feilkjelder i undersøkingane • planleggje og gjennomføre eit større feltarbeid med ei undersøking av biotiske og abiotiske faktorar i eit økosystem, og vurdere og presentere resultata med og utan digitale verktøy • forklare kvifor publisering og fagleg kritikk er nødvendige prosessar i biologi som vitskap • finne fram til ny kunnskap i biologi frå ulike medium og vurdere informasjon og påstandar i media på eit fagleg grunnlag • diskutere på eit fagleg grunnlag etiske utfordringar innanfor biologisk forsking • drøfte miljøutfordringar lokalt og globalt med utgangspunkt i biologisk kunnskap • bruke animasjonar og simuleringsprogram til å vise fenomen og biologiske samanhengar

Energiomsetning Mål for opplæringa er at eleven skal kunne • samanlikne hovudtrekka og energiutbytet i aerob og anaerob nedbryting av glukose, og knyte energiomsetjing i celler til samansetjing av næringsstoff i kosthaldet • forklare korleis enzym, ATP og andre kofaktorar verkar, og korleis aktiviteten til enzym blir regulert i celler og vev • forklare korleis lysenergi kan overførast til kjemisk bunden energi i fotosyntesen, og korleis energien blir brukt til å produsere glukose • gjere greie for korleis ytre faktorar verkar inn på fotosyntesen

Evolusjon Mål for opplæringa er at eleven skal kunne • gjere greie for grunntrekka i evolusjonsteorien og kva slag kunnskap han byggjer på • gjere greie for teoriar for korleis livet på jorda har oppstått, og beskrive nokre hovudtrekk i korleis utviklinga av livet på jorda har gått føre seg • forklare korleis den genetiske samansetjinga i populasjonar blir endra gjennom mutasjonar, naturleg seleksjon, genetisk drift, genflyt, horisontal genoverføring og endring av kromosomtal • beskrive mekanismar som hindrar genflyt mellom artar, og gjere greie for teoriar om korleis nye artar kan utviklast • forklare korleis molekylærbiologi og genteknikkar gjev oss ny kunnskap om opphavet til artar og utviklinga av slektskapstre


Læreplan i biologi • 439

Genetikk Mål for opplæringa er at eleven skal kunne • forklare strukturen til DNA og korleis DNA blir kopiert før cellene deler seg • gjere greie for transkripsjon og translasjon av gen og forklare korleis regulering av gen kan styre biologiske prosessar • samanlikne mitose og meiose med vekt på fordelinga av genmateriale i cellene som blir danna • setje opp og teste hypotesar for kjønnsbunden og dihybrid arvegang med og utan kopling av gen • forklare genetiske sjukdommar ved å bruke kunnskapar om arv og mutasjonar, og gjere greie for korleis samspelet mellom arv, miljø og livsstil kan påverke helsa hos menneska

Økologi Mål for opplæringa er at eleven skal kunne • samle, bestemme og klassifisere ulike organismar og knyte opplysningar om levevis og tilpassingar til eit utval av organismane • gjere greie for faktorar som regulerer vekst og storleik av populasjonar og forvalting av bestandar i eit berekraftig perspektiv • gjere greie for krinsløpet til karbonet og nitrogenet i eit økosystem, og korleis miljøgifter blir konsentrerte i næringskjeder • gjere greie for korleis energistraumen mellom trofiske nivå påverkar økosystemet • forklare korleis økosystem kan endre seg over tid, og knyte det til klimaendring og andre miljøproblem


440 • Læreplan i biologi

Vurdering Føresegner for sluttvurdering:

Standpunktvurdering Programfag

Ordning

Biologi 1

Elevane skal ha standpunktkarakter.

Biologi 2

Elevane skal ha standpunktkarakter.

Eksamen for elevar Programfag

Ordning

Biologi 1

Elevane kan trekkjast ut til munnleg-praktisk eksamen. Eksamen blir utarbeidd og sensurert lokalt.

Biologi 2

Elevane kan trekkjast ut til skriftleg eksamen eller munnleg-praktisk eksamen. Skriftleg eksamen blir utarbeidd og sensurert sentralt. Munnleg-praktisk eksamen blir utarbeidd og sensurert lokalt.

Eksamen for privatistar Programfag

Ordning

Biologi 1

Privatistane skal opp til munnleg-praktisk eksamen. Eksamen blir utarbeidd og sensurert lokalt.

Biologi 2

Privatistane skal opp til skriftleg eksamen og munnleg-praktisk eksamen. Skriftleg eksamen blir utarbeidd og sensurert sentralt. Munnleg-praktisk eksamen blir utarbeidd og sensurert lokalt.

Dei generelle føresegnene om vurdering er fastsette i forskrift til opplæringslova.


Stikkord • 441

Stikkord (2n) 144 (n) 144 3’ 100 3’-ende 108 3’Poly-A 108 5’ 100 5’Cap 108 5’-ende 108

A abiotisk faktor 48, 52 absolutiske argumenter 367 adenin 100 aerob celleånding 286 agarose 339 aktiveringsenergi 256 aktivt sete 257 allopatrisk artsdannelse 233 allosterisk enzym 262 aminogruppe 105 aminosyre 105, 272 aminosyre, essensiell 105 aminosyrekjede 113 ammonium 73 anabolisme 253 anaerob 254 anaerob celleånding 273, 276 anafase 142 Angelmanns syndrom 192 antennekompleks 297 antikodon 111 apoptose 150 art 49, 52 artsdannelse 233 arv 158 Asilomar 364 autosom 141 autotrof 49, 52, 66, 253 auxin 313 avl 22 avstøtning 345

B bakterieklorofyll 315 bakteriekromosom 102 bakteriofag 327 barcode 362 basepar 101 baseparregelen 107 baserekkefølge 112 basetriplett 110 behandlingsbiobankloven 364 β-oksidasjon 271 bioakkumulering 81 bioinformatikk 363 biologisk mangfold 84 biomagnifisering 81, 82 biomassepyramide 71 biosfære 48, 52 bioteknologi 326 bioteknologiloven 364 Bioteknologinemnda 346, 364 biotisk faktor 48, 52 biotop 49, 52 blodtype 176 blødersyke 196 Bt-toksin 341 Buffon, George 33 bunn-opp-regulert 225 bæreevne 57, 222 bærekraftig utvikling 85 bæreprotein 111 bærere 190

C C3-binding 304 C3-planter 308, 311 C4-planter 310, 311 calvin-benson-syklus 298 CAM-planter 311 celle 134 celledeling 134 celledifferensiering 135, 354 celledød 150

celleplate 142 cellevegg 142 chaperon 314 cisgen 340 CO2 71 cystisk fibrose 191 cytokinese 142 cytokromkompleks 301 cytosin 100

D Darwin, Charles 12, 33 Darwin, Erasmus 34 DCMU 312 de Lamarck, Jean-Baptiste 34 deaminere 272 delesjon 123 delingsfase 136 denaturere 258 denitrifiserende 74 deoksiribose 100 detoksifisere 313 diabetes 199 dihybrid arvegang 166 diploid 140, 144 direkte genoverføring 335 DNA 25, 100, 327 DNA-bibliotek 352 DNA-chip 352 DNA-dobbelheliks 101 DNA-kopiering 136 DNA-molekyl 100 DNA-polymerase 137 DNA-profil 361 DNA-profilanalyse 361 DNA-reparasjonsenzym 139 DNA-tråd 100 domene 238 dominans, fullstendig 175 dominans, ufullstendig 175 dominansforhold 177 dominant 159


442 • Stikkord

dominante arvelige sykdommer 193 Downs syndrom 197 drivhuseffekt 77, 79, 83 dyreforedling 22 dødsrate 220

E egenskaper, kvantitative 182 egenskaper, menneskelige 182 eggcelle 134 eksitasjonsenergi 296 eksitert 296 ekson 108 eksoterm 256 eksponentiell vekst 221 elektrontransportkjede 281 embryonal stamcelle 337 embryosplitting 358 empirisk 12 endosymbiose 27, 279, 299 endoterm 256 energi 294 energibærer 253 energiform 294 enhancer 119 enzym 25, 255 epigenetikk 185 epigenetiske forandringer 187 epigenetiske mekanismer 186 epistase 179 essensiell aminosyre 105 etanol 273 etikk 347, 365 eukaryot 26, 100, 103, 109 evolusjon 12, 285 evolusjonsteorien 12

F F1-generasjon 161 F2-generasjon 161 fangst-gjenfangstmetoden 57 farkost 17 Fd 301 fedme 199 fem-merket 100

fenotype 159 fermentering 276 ferrodoksin 301 ferrodoksin-NADP+-reduktase 301 fett 270, 271 fettsyre 271 fitness 16 flaskehalseffekt 227 fluorescerende protein 339 FNR 301 folding, protein 116 formering 144 formering, kjønnet 28 formering, ukjønnet 28 formering, vegetativ 358 fôrvareloven 365 fostervann 351 fotodel 298 fotofosforylering 303 fotoinhibering 313 fotokjemisk smog 315 foton 295 fotorespirasjon 309 fotosyntese 298 fotosystem 1 300 fotosystem 2 300 fotosystem 297 FS 1 300 FS 2 300 fullstendig dominans 175 fundamental nisje 60 funksjon, protein 116 fykobilisomer 315 fødselsrate 220 Føllings sykdom 192 føre var-prinsipp 85

G gamet 144 gelelektroforese 339 gen 104 Gen Modifiserte Organismer 340 gener, letale 178 gener, pleiotrope 179 genetikk 158 genetisk drift 227

genetisk hjul 110 genetisk kode 26, 109 genetisk variasjon 147 genetisk veileder 350 genetiske sykdommer 189 genets locus 159 genfamilie 240, 363 genflyt 228 genkanon 335 genkombinasjon 163 genmutasjon 121 genom 100 genotype 159 genoverføring, direkte 335 genoverføring, indirekte 335 genpar 159 genregulering 118 genreservoar 226 gensilencing 348 genteknologi 326 genteknologiloven 364 genterapi 347 gentest 350 genvariant 158 genvarianter, multiple 177 gjæring 273 global oppvarming 71 globinfamilie 240 glukoneogenese 277 glukose 273 glyfosat 313 glykolyse 274 GMO 340, 365 grana 299 granum 299 grunnleggereffekt 227 guanin 100 GWP-verdi 77

H habitat 49, 52 haploid 144 Hardy-Weinbergs likevekt 229 helikase 136 helseforskningsloven 364 hemmer 261


Stikkord • 443

hemoglobin 240 herbicider 312 heterotrof 49, 52, 66, 253 heterozygot 159 histon 103 histonmodifisering 187 hjerte- og karsykdommer 200 homolog 140 homozygot 159 homøostase 260 Huntingtons sykdom 194 hybrid 234 hybridgen 338, 346 hybridsone 234 hydrogenbinding 101

I ikke-konkurrerende hemmer 261 imprinting 188 in vitro-teknikker 335 indirekte genoverføring 335 inersjon 123 inhibitor 261 innavl 22 interfase 136, 142 interseksuell seleksjon 18 interspesifikk konkurranse 51, 52 intraseksuell seleksjon 18 intraspesifikk konkurranse 51, 52 intron 108

J j-kurve 221 juridisk vurdering 367

K karbohydrater 270, 272 karboksylsyregruppe 105 karbondioksid 71 karbonets kretsløp 71, 72 karbonsyre 72 karotenoider 297 katabolisme 253 katalysator 255

kjemisk energi 252, 294 kjerneoverføring 355, 359 kjønnet formering 28 kjønnsbundet arvegang 172 kjønnsbundne arvelige sykdommer 195 kjønnscelle 121, 144 kjønnskromosom 141 klassisk DNA-profilanalyse 361 klimagass 77 klimakssamfunn 65 Klinefelters syndrom 198 klone 357 kloning, reproduktiv 357 kloning, terapeutisk 357 klorofyll 296 kloroplast 27, 294, 299 knoppskyting 358 koblete gener 168 kodominans 176 kodon 110 koenzym 260 koevolusjon 20 kofaktor 260 kommensalisme 62 kompetent celle 333 komplementær base 101 konkurranse, interspesifikk 51, 52 konkurranse, intraspesifikk 51, 52 konkurrerende hemmer 261 konsekvensetikk 366 konsekvensetisk argument 367 konsument 50, 52, 66 kontinentaldrift 233 kopieringsboble 136 korrekturlesing 139 krebssyklus 280 kreft 200, 350, 355 kromosom 102, 140 kromosomavvik 196 kromosommutasjon 121 kromosompar 140 kroppscelle 121 krysningsforsøk 162 krysningsskjema 162 K-seleksjon 56, 217 K-selektert 65, 218

kunstig seleksjon 22 kutikula 309 kvantitative egenskaper 182 kvartærstruktur 115

L lav 63 leserammemutasjon 123 letale gener 178 ligase 139 likevekt 222 lille subenhet 112 livshistoriestrategi 223 locus 159 luftforurensning 314 lys 295 lysavhengig del 298 lysenergi 252 lysfangende kompleks 297

M makroevolusjon 13 Malthus, Thomas 34 markørgen 336 meiose 136, 144 meiose I 145 meiose II 145 melkesyre 273, 277 Mendel, Gregor 158 menneskelige egenskaper 182 mesofyllceller 309 metabolisme 252 metafase 142 mikroevolusjon 13 mikroinjeksjon 337 miljøfaktor 51 mimikry 21 mitokondrie 27, 279 mitose 136, 140 modellorganisme 340 moderne DNA-profilanalyse 361 moderne syntese 13 molekylærbiologi 363 monohybrid arvegang 161 moral 365


444 • Stikkord

morkakeprøve 351 motargument 367 mRNA 106 mRNA-bearbeiding 108 multiple genvarianter 177 multipotent 354 mutant 121 mutasjon 15, 121, 226 mutualisme 62 mykorrhiza 63 myoglobin 240

N naturlig seleksjon 18 nedbryter 50, 52 negativ tilbakekopling 284 nisje 60 nisje, fundamental 60 nisje, realisert 60 nitrogenfikserende 74 nitrat 73 nitritt 73 nitrogenbase 100 nitrogenets kretsløp 73 nitrogenoksid 74 normativ etikk 366 NOx 74 nukleotid 100 næringskjede 67, 70 næringsnett 67, 68 næringsstoff 270 nøkkelart 67

O O3 315 oksidativ fosforylering 281 onkogen 349 organdonor 345 organmangel 345 overbeskattet 85 overgjødsling 76 overkrysning 148, 170 overlevelseskurve 217 ozon 315 ozonlag 83

P P680 300 P700 300 palindrom 328 PAN 315 Paraquat 312 parasittisme 62 PC 301 PCR 331 PEP-karboksylase 310 peptidbinding 112 peroksyacetylnitrat 315 PGD 351 P-generasjon 161 pH-optimum 258 pH-verdi 258 pigment 296 planteforedling 22 plantevernmidler 312 plasmid 102 plastocyanin 301 plastokinon 301 plastom 299 pleiotrope gener 179 pliktetikk 366 pluripotent 354 Polymerase Chain Reaction 331 populasjon 49, 52 populasjonsgenetikk 226 populasjonsvekst, menneske 225 positiv tilbakekopling 284 postzygotisk 234 PQ 301 predasjon 61 predator 52 preimplantasjonsdiagnostikk 351 pre-mRNA 108 prezygotisk 234 primase 136 primer 136, 331 primærkonsument 67 primærstruktur 115 primærsuksesjon 64 prion 116 prionsykdommer 116 probe 340 produkt 257

produsent 49, 52, 66 profase 142 prokaryot 26, 100, 102, 109 prometafase 142 promotor 106 prostetisk gruppe 260 protein 104, 115, 270, 272 proteinfolding 116 proteinfunksjon 116 proteinsortering 166 proteinstruktur 115 protobiont 25 protongradient 303 punktmutasjon 121 pyrodruesyre 274 pyruvat 274

R radioaktivt merket DNA 340 ras-gen 349 reaksjonshastighet 256 reaksjonssenter 297, 300, 301 reaktant 257 realisert nisje 60 recessiv 159, 348 recessive arvelige sykdommer 190 redoksreaksjon 260 rekombinant plasmid 333 rekombinant 170 rekombinasjon 170 replikator 17, 25 reproduktiv barriere 233 reproduktiv kloning 357 ressursfordeling 61 restriksjonsenzym 327 restriksjonssete 327 rettet seleksjon 18 rettighetsbasert argument 367 rettsgenetikk 362 RFC, Reasons For Concern 79 RFLP-analyse 361 ribose 106 ribosom 111 ribosomalt RNA 238 ribozym 25 RNA 25, 106, 187


Stikkord • 445

RNAi 349 RNA-nukleotid 111 RNA-polymerase 106 RNA-spleising 108 RNA-verden 26 rRNA 112 r-seleksjon 56, 217 r-selektert 65, 218, 221 rubisco 304 RuBP 304 ruteanalyse 58

S samfunn 49, 52 samspill 59, 63 seksuell seleksjon 18 sekundærkonsument 67 sekundærstruktur 115 sekundærsuksesjon 65 seleksjon, interseksuell 18 seleksjon, intraseksuell 18 seleksjon, kunstig 22 seleksjon, naturlig 18 seleksjon, rettet 18 seleksjon, seksuell 18 seleksjon, splittende 18 seleksjon, stabiliserende 18 seleksjonsmarkør 339 sentromér 141 silencer 119 singel nukleotid polymorfisme 361 siRNA 187, 349 skråplansargument 367 s-kurve 222 skyggeplante 313 slirecelle 310 smog 315 smørsyre 273 SNP 361 snRNA 349 sortering, protein 116 spalteåpning 304, 309 spesiell transkripsjonsfaktor 119 spleisosom 108 splittende seleksjon 18 stabiliserende seleksjon 18

stamcelle 135, 353 stamcelle, embryonal 337 stamtavle 165 startkodon 110, 112 stivelse 306 stoppfaktor 113 stoppkodon 110, 113 STR-analyse 361 strekkoding 362 stroma 299 stromatylakoider 299 STR-område 361 subenhet, lille 112 substitusjon 121 substrat 257 suksesjon 64 suksesjon, primær 64 suksesjon, sekundær 65 sur nedbør 83 surrogatmor 337 sykdommer, dominante arvelige 193 sykdommer, genetiske 189 sykdommer, kjønnsbundne arvelige 195 sykdommer, recessive arvelige 190 syklisk elektrontransport 303 syklisk svingning 223 symbiose 62 sympatrisk artsdannelse 233 syntesedel 298, 304 systembiologi 363 søsterkromatid 141

T telofase 142 telomer 353 telomerase 353 temperaturoptimum 258 terapeutisk kloning 357 tertiærstruktur 115 testkryssing 164 tetthetsavhengig miljøfaktor 51, 52, 222 tetthetsuavhengig miljøfaktor 51, 52

tilbakekopling 263 Ti-plasmid 336 topp-ned-regulert 225 totipotent 354 transformasjon 335 transgen 340 transkripsjon 106 transkripsjonsfaktor 106 transkripsjonsfaktor, spesiell 119 translasjon 111 translasjonsfaktor 112 translokasjon 113 tre-merket 100 tRNA 111 tRNA-syntetase 111 trofisk nivå 67, 68 Turners syndrom 198 tylakoide 299 tylakoidlumen 299 tymin 100

U Ubx 239 ufullstendig dominans 175 ukjønnet formering 28 uracil 106 ursuppe 25

V variasjon, genetisk 147 varmeenergi 252 varmesjokkprotein 314 vegetativ formering 358 vekstkurve 220 vekstrate 220 vektor 333 VNTR-område 361

X xenotransplantasjon 345 X-inaktivering 188 X-kromosom 173


446 • Stikkord

Y Y-kromosom 173 yngelpleie 217

Z zygote 134, 144, 234

Ø økologi 48 økosystem 48, 52


Bildekreditering â&#x20AC;˘ 447

Bildekreditering