10voorBiologie - Boek OpMaat - vwo

Page 1

Moleculaire genetica

8.0 START HOOFDSTUK

Wat moet je kennen / kunnen?

• Je kunt de betekenis noemen van de vetgedrukte termen in dit hoofdstuk.

THEORIE

Moleculaire genetica

In 1882 ontdekte de Duitse embryoloog Walther Flemming als eerste in cellen de draadvormige structuren die hij chromatine noemde. Deze draadvormige structuren worden nu chromosomen genoemd. Halverwege de twintigste eeuw behandelde Rosalind Franklin, een Britse chemica, DNA met röntgenstraling, een techniek waarmee men inzicht kan krijgen in kristalstructuren en organische verbindingen. Het verstrooiingspatroon, zichtbaar op fotografische film, kan ook gebruikt worden om meer te ontdekken van de structuur van het DNA.

© Wikipedia / Raymond Gosling, Kin
Moleculaire genetica Start hoofdstuk
Figuur 1 Rosalind Franklin’s röntgendiffractie

Twee andere Britse onderzoekers, Watson en Crick, gebruikten de informatie die Franklin hen verschaft had, om uiteindelijk de structuur van DNA op te helderen. Door allerlei modellen te bouwen van aan elkaar geplakte nucleotiden analyseerden zij de structuur van het DNA. Uiteindelijk ontdekten ze, mede door de foto’s van Franklin, dat de spiraalstructuur van DNA uit twee complementaire strengen moest bestaan. Na deze ontdekking in 1953 kon gestart worden met het uiteenrafelen van de werking van DNA.

Voor hun werk ontvingen zij in 1962 de Nobelprijs voor geneeskunde en fysiologie. Franklin werd niet geëerd, omdat zij kort daarvoor aan kanker was gestorven. Het onderzoek van Watson en Crick naar de structuur van DNA werd gepubliceerd in april 1953 in het prestigieuze tijdschrift Nature. Het artikel was slechts één pagina groot, en de één na laatste zin van het artikel is wel heel speciaal onderkoeld: “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material”.

Inmiddels is duidelijk dat het erfelijk materiaal van alle organismen (bacteriën, schimmels, planten, dieren, maar ook virussen) bestaat uit de nucleïnezuren (DNA of RNA). Ze bepalen welke eiwitten er in je lichaam worden aangemaakt en of je bijvoorbeeld blauwe ogen, donker haar of aanleg voor bepaalde ziekten hebt.

Moleculaire genetica Start hoofdstuk

8.1 DE STRUCTUUR VAN DNA

Wat moet je kennen / kunnen?

• Je weet wat chromosomen zijn.

• Je kunt uitleggen uit welke moleculen DNA opgebouwd is.

• Je kunt de PCR-methode beschrijven.

THEORIE

De structuur van DNA

Ieder organisme bezit erfelijk materiaal in zijn lichaamscellen. Ook in de voortplantingscellen is dit aanwezig, zodat het kan worden doorgegeven aan het nageslacht. Het erfelijk materiaal is opgeslagen in de kern in de vorm van chromatine. Chromatine bestaat uit DNA en bepaalde eiwitten (histonen). Met een elektronenmicroscoop zijn een soort van kralen, de nucleosomen, te zien in de chromatineketen. Het zijn de plaatsen waar de DNA-streng zich om de histonen windt. De nucleosomen zijn met elkaar verbonden door stukjes los DNA. De nucleosomen op hun beurt liggen weer als een spiraal opgewonden.

Scan de QR-code en bekijk de animatie over chromosomen op Bioplek.

Nucleosomen dienen twee belangrijke doelen in de celkern. Ten eerste zorgen ze ervoor dat het ongeveer 2 meter lange DNA-molecuul in de celkern past. Dat gebeurt door het DNA te spiraliseren. Ten tweede is de code in het DNA rond de nucleosomen als het ware afgeschermd, waardoor deze delen van het DNA niet gebruikt worden als ze niet nodig zijn in cellen. Bepaalde enzymen kunnen een nucleosoom verschuiven, zodat dan weer andere delen van het DNA afgeschermd worden.

Tussen twee celdelingen in is chromatine onder de lichtmicroscoop zichtbaar als een korrelige structuur in de celkern. De korrelige structuur wordt veroorzaakt, doordat op sommige plaatsen het chromatine heel dicht opeengepakt is en inactief (heterochromatine) en op andere plaatsen veel minder compact en actief (euchromatine). Wanneer een lichaamscel zich deelt, wordt het erfelijk materiaal zichtbaar in de vorm van draadvormige structuren, de chromosomen. Deze bestaan uit zeer sterk gespiraliseerd chromatine. (In figuur 2 is een dubbelchromosoom te zien.)

Moleculaire genetica De structuur van DNA 8.1

DNAmolecuul

chromosoom detail chromosoom histonen met DNA

Figuur 2 De structuur van een chromosoom

DNA is een polymeer van een heel lange keten van nucleotiden. Elke nucleotide bestaat uit een suiker (desoxyribose), een fosfaatgroep en een stikstofbase. Terwijl de suiker en de fosfaatgroep in het hele DNA altijd dezelfde zijn, komen er vier verschillende stikstofbasen (of kortweg basen) voor: adenine (A), thymine (T), guanine (G) en cytosine (C). Aan elke desoxyribose is een stikstofbase verbonden. Er zijn in DNA dus vier verschillende nucleotiden te vinden. De desoxyribosemoleculen zijn onderling met elkaar verbonden door de fosfaatgroepen.

thymine adenine fosfaatgroep

desoxyribose

cytosine guanine

nucleotide

H-brug

P

S S S

C

A P

P P P

T T

A

G

S S S

DNA bestaat uit twee hele lange ketens van nucleotiden. De twee ketens zijn op een speciale manier met elkaar verbonden. Tegenover base A in de ene keten ligt altijd een base T in de andere keten; tegenover base C ligt altijd een base G. Daarom noem je A en T evenals G en C complementaire basen. De basen worden onderling met elkaar verbonden door waterstofbruggen. Door deze opbouw lijkt een DNA-molecuul op een lange, spiraalvormige ladder. De lange zijden van de ladder worden gevormd door de ketens van fosfaat-desoxyribose-fosfaat-desoxyribose-… enzovoort, terwijl de basenparen A-T en G-C de sporten van de ladder zijn. Paar A-T is even breed als paar G-C.

G T T C S S S S S S A P P P P A kern
P
C C H H
H H H
H H H O O
C N C N
H-brug
C
C C C C N C N
N N N C H H H
H H
H
H H H N O
O C N C N C
C C C C N C N N
N N
Figuur 3 Nucleotiden als bouwstenen van het DNA
Moleculaire genetica De structuur van DNA 8.1

Bij de lange zijde (de desoxyribose-fosfaatketen) is de oriëntatie van de desoxyriboses precies omgekeerd aan die van de tegenover elkaar liggende ketens (bekijk hiervoor de plaatjes in Binas); het O-atoom van desoxyribose ligt in de ene keten de ene kant uit gericht en in de andere keten de andere kant uit gericht. Dit heeft te maken met hoe de afzonderlijke nucleotiden bij de vorming van het DNA aan elkaar gekoppeld worden (altijd in de richting van het 5’C-atoom van desoxyribose naar het 3’C-atoom van desoxyribose).

Scan de QR-code en bekijk de animatie van Bioplek.

In de volgorde van de basen is de erfelijke informatie van een bepaald organisme vastgelegd. Een stukje DNA dat de erfelijke code bevat om één of meer eiwitten te synthetiseren heet een gen. Een gen kan bestaan uit betrekkelijk weinig (circa 100) of uit zeer veel nucleotiden (duizenden). Een gen levert de instructie voor een opbouw van een bepaald eiwit (vaak een enzym) en daarmee voor een erfelijke eigenschap in een organisme.

Een chromosoom bevat heel veel verschillende naast elkaar gelegen genen. Men schat dat in de chromosomen van de mens in totaal circa 21.000 genen liggen opgeslagen.

In 2001 werden de genen van de mens globaal in kaart gebracht. Dit gebeurde in een internationaal project, het zogenaamde HUGO-project (‘Human Genome Organisation’).

Groot was de verbazing toen bleek dat de mens niet of nauwelijks meer genen heeft dan andere levensvormen. Het piepkleine aaltje Caenorhabditis elegans bijvoorbeeld heeft precies 19.099 genen. Kennelijk is het aantal genen geen maat voor complexiteit. Van een groot deel van de menselijke genen is de functie nog niet bekend.

De wijze waarop de erfelijke informatie is vastgelegd, is universeel, dat wil zeggen gelijk voor bacteriën, schimmels, planten en dieren. De celkern is niet het enige celorganel waarin DNA voorkomt. Chloroplasten en mitochondria bezitten ook een DNA-molecuul. In het mitochondriale DNA van de mens ligt informatie opgeslagen voor ongeveer dertien verschillende erfelijke eigenschappen. In het hoofdstuk ‘Evolutie’ staat uitgelegd hoe dit gegeven belangrijk is bij de endosymbiosetheorie (zie 26.2 ‘Van eencellig naar meercellig’).

Moleculaire genetica De structuur van DNA 8.1

KLASSIEKE GENETICA

Replicatie: verdubbeling van het DNA

Elke enkele DNA-streng bestaat uit een serie nucleotiden. Elke nucleotide zit aan de ene kant met zijn fosfaatgroep vast aan de desoxyribose van de vorige nucleotide. En aan de andere kant zit deze nucleotide met zijn desoxyribose aan de fosfaatgroep van de volgende vast.

De kant van de fosfaatgroep noemen we de 5’-kant van de nucleotide; de kant van de desoxyribose is de 3’-kant. Daardoor heeft een DNA-streng als geheel ook een richting.

Infographic: genetica op drie niveaus
mitose
meiose meiose bevruchting bevruchting transcriptie replicatiereplicatie replicatie replicatie spiralisatie desp ira l isa t ie translatie eiwit kernmembraan genotype lichaamscellen voortplantingscellen voortplantingsmoedercellen aanvoer van genetisch materiaal geslachtscellen mRNA mRNA DNA Aa Aa Aa 2n 2n n n 2n A a a A A A a a A A A a a a a a A A A a a n AA AA Aa Aa A 50%A50%a A A a A n n n n n n 2n 2n 2n 2n DNA a A n = haploïd 2n = diploïd A = gen A a = gen a DNA van
GENETICA OP DRIE NIVEAUS A Verklaring van symbolen
LEVENSCYCLUS
CHROMOSOMEN/DNA
de eicel-/spermamoedercel OVERZICHT
Moleculaire genetica De structuur van DNA 8.1

In de dubbele helix is de richting van de ene streng altijd tegengesteld aan die van de andere streng. Begint de ene streng met een 5’-kant en eindigt hij met een 3’-kant, dan begint de complementaire streng met een 3’-kant en eindigt met een 5’-kant.

Vóór de celdeling, in de interfase, verdubbelt het DNA (zie ook paragraaf 3.2 ‘De celdeling’) zich. Bij eukaryoten wordt de DNA-dubbelspiraal op verschillende plaatsen ‘opengeritst’ door het enzym helicase. Dit enzym verbreekt de waterstofbruggen tussen beide DNA-ketens. Dat gebeurt bij een specifieke nucleotidenvolgorde (ofwel DNA-sequentie), bijvoorbeeld A-T.

De plaats waar het openritsen begint, ziet er uit als een Y-vormige structuur en wordt de replicatievork genoemd. Langs de gedeelten DNA die nu enkelstrengs zijn, komen complementaire nucleotiden te liggen.

Het enzym DNA-polymerase koppelt deze nucleotiden aan elkaar. Dit enzym ‘leest’ de DNA-volgorde af in de 3’-5’-richting. Dat betekent dat de nieuwe DNA-keten in de 5’-3’-richting wordt gevormd. Omdat de complementaire DNA-ketens een tegenovergestelde richting hebben, wordt langs de ene keten, de ‘leidende streng’ (‘leading strand’) nieuw DNA continu gevormd. Langs de andere keten, de ‘volgende streng’ (of ‘lagging strand’) wordt het nieuwe DNA in stukjes aan elkaar geplakt. Die stukjes worden Okazaki-fragmenten genoemd. De Okazaki-fragmenten worden aan elkaar gekoppeld door middel van het enzym ligase. Bekijk nu nog eens de animatie op Bioplek. Als het hele DNA op deze manier gekopieerd is, zijn er twee DNA-dubbelstrengen ontstaan, waarvan telkens de ene keten oud is en de andere nieuw gevormd.

Polymerase-kettingreactie

De polymerase-kettingreactie, vaak afgekort tot PCR (van Polymerase Chain Reaction), is een methode om in het laboratorium kleine stukjes DNA heel vaak te kopiëren tot er genoeg van is om het DNA te bouwen en te analyseren.

Voor deze methode is nodig:

• het enzym DNA-polymerase;

• het stuk DNA dat gekopieerd moet worden;

• heel veel nucleotiden (A, C, G en T);

• kleine beginnetjes, primers genoemd, van waaruit de polymerisatie kan starten. Een primer is een stukje enkelstrengs DNA dat op de begin- of eindnucleotide van het te kopiëren stuk DNA past. Er zijn voor het proces twee primers nodig. Eén primer past op het begin van het te kopiëren stuk DNA en één primer past op het eind van het te kopiëren stuk DNA.

De ingrediënten worden tegelijk in een daarvoor geschikte container in de PCRmachine geplaatst. Tijdens de zogenoemde PCR-cyclus wordt het stukje DNA één keer gekopieerd. De PCR-cyclus bestaat uit drie stappen:

Stap 1: het DNA wordt verhit tot ongeveer 95°C; hierdoor denatureert het en gaan de twee DNA-strengen uit elkaar. (Duur: 30 seconden)

Stap 2: de temperatuur wordt verlaagd om de primers te laten binden. (Duur: 30 seconden)

Stap 3: de temperatuur wordt weer verhoogd tot 72°C en DNA-polymerase en de nucleotiden worden toegevoegd. Vanuit de primers worden langs de enkelstrengen DNA nieuwe strengen DNA gevormd. Dit wordt de verlenging genoemd. Het enkelstrengs DNA dient als matrijs voor de vorming van de nieuwe strengen. (Duur: 1 minuut, soms ook 5 minuten)

Moleculaire genetica De structuur van DNA 8.1

Het hier gebruikte DNA-polymerase is afkomstig van bacteriën die in hete bronnen leven. Het heeft een optimum van ongeveer 72°C, maar denatureert pas bij temperaturen boven de 94°C.

De PCR-cyclus duurt ongeveer 2 minuten. Daarna start de cyclus opnieuw en wordt nog 30-40 keer herhaald. Na 30 cycli (ongeveer 70 minuten) zijn er al meer dan 1 miljard kopieën van het stuk DNA. En dat is genoeg om te gebruiken bij gelelektroforese.

Het maakt uit in welke verhouding de hoeveelheden A-T / G-C er in de te kopiëren DNA-streng zitten. Hoe meer G-C, des te langer het duurt, omdat G en C steviger aan elkaar gekoppeld zijn. Ook de totale lengte van de te kopiëren keten heeft invloed op de tijd die nodig is voor een cyclus.

denatureren, 95°C primers, 60°C DNA-polymerase en nucleotiden, 72°C

Figuur 4 PCR (Polymerase Chain Reaction)

3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ + + + + + + + + 1 1 1 2 2 2 3 3 3 1 2 3 1
2 3 1 2 3
99%
Moleculaire genetica De structuur van DNA 8.1

Een animatie van de PCR kun je op Bioplek bekijken. Scan hiervoor de QR-code.

Het belangrijkste principe in de genetica, de selectieve binding van A aan T en van C aan G (ook wel complementariteit genoemd), vormt de grondslag van de celdeling en de voortplanting, kortom van het biologische leven zelf. Op ditzelfde principe is de PCR-methode gebaseerd. Elke nieuw gevormde streng kan weer de matrijs vormen voor een nieuwe kopie. Vandaar de naam kettingreactie, omdat het aantal kopieën exponentieel toeneemt.

De PCR-methode, die in 1983 werd uitgevonden door Kary Mullis, wordt tegenwoordig voor allerlei doeleinden gebruikt.

Enkele voorbeelden:

• Het kloneren van een gewenst stuk DNA van een organisme om het bijvoorbeeld in een ander organisme te brengen (bij genetische modificatie).

• Bij het analyseren van DNA-monsters bij forensisch onderzoek.

• Om verwantschap na te gaan; je kunt bijvoorbeeld aantonen dat iemand de vader is van een bepaald kind.

• Om bij infectieziekten de ziekteverwekker aan te tonen; het DNA van de ziekteverwekker moet dan natuurlijk wel bekend zijn.

Er is extra tijd nodig voor het telkens weer opwarmen en afkoelen van het monster gedurende die 30-40 cycli. Moderne PCR-machines zijn sterk geautomatiseerd: de temperatuurregeling en het op de juiste momenten toevoegen van de verschillende benodigde stoffen in de juiste hoeveelheden gebeurt machinaal. Vanaf het starten van de machine tot het kunnen aflezen van de uitkomst zit in totaal ongeveer twee uur.

Sequensen

DNA-sequensen, of kortweg sequensen, is het vaststellen van de nucleotidenvolgorde van een stuk DNA. Er worden steeds nieuwe en snellere sequensiemethodes ontwikkeld.

Dit heeft tot gevolg dat het genoom van steeds meer soorten nu bekend is. Er gaat bijna geen dag voorbij zonder dat er weer een genoom van een soort is opgehelderd.

Voorafgaand aan het sequensen wordt het stuk DNA, waarin men is geïnteresseerd, eerst miljoenen malen gekopieerd in een polymerase-kettingreactie (PCR): de dubbele DNA-keten wordt losgemaakt door verhitting, korte stukjes DNA (primers) binden aan de uiteinden van de keten en een DNA-polymerase begint te kopiëren. Bij het sequensen worden er heel veel ‘gewone’ nucleotiden en een geringer aantal dideoxynucleotiden toegevoegd. Een dideoxynucleotide lijkt op een normaal nucleotide, maar heeft een H-groep in plaats van een OH-groep aan het 3‘-eind. Zodra een dideoxynucleotide wordt ingebouwd, stopt de replicatie.

Bij het repliceren van een DNA-keten zullen dus vaak de gewone nucleotiden gebruikt worden en soms wordt er een ddT, ddA, ddC of ddG ingebouwd, waarna de replicatie van dat fragment DNA stopt. Vroeger of later zullen alle kopieën afgesloten worden met een dideoxynucleotide. Alle ketens zijn op dezelfde plaats begonnen en allemaal eindigen ze met een ddT, ddA, ddC of ddG. Er ontstaat een verzameling van miljoenen DNA-fragmenten van alle mogelijke verschillende lengtes met ieder een dideoxynucleotide op het eind.

Scan de QR-code en bekijk ook de animatie op Bioplek.

Moleculaire genetica De structuur van DNA 8.1

De DNA-fragmenten worden op grootte gescheiden door gelelektroforese.

DNA wordt gedenatureerd en primers worden toegevoegd.

Aan dideoxynucleotiden wordt een fluorescerende groep gehecht, elk met een andere kleur.

DNA-polymerase, dideoxynucleotiden en gewone nucleotiden worden toegevoegd. Replicatie stopt als een dideoxynucleotide wordt ingebouwd.

Er ontstaan miljoenen stukjes DNA van verschillende lengte.

Door UV-licht worden de labels zichtbaar.

Figuur 5 Sequensen

Ze worden afgelezen en naar de computer gestuurd.

Met behulp van gelelektroforese worden de DNA-fragmenten op grootte gescheiden. Hiertoe is aan de dideoxynucleotides een fluorescerende groep gehecht (elk een andere kleur), zodat ze fluoresceren onder UV-licht. Dideoxy-C, bijvoorbeeld, zendt blauw licht uit. De kleinste fragmenten zakken het verst naar beneden, de grootste blijven bovenaan. De plaats en afstand tonen de relatieve grootte. Door steeds de plaats van de dideoxynucleotide te bepalen krijg je uiteindelijk de hele DNA-volgorde (sequentie) in beeld. Als de kortste keten bijvoorbeeld eindigt met een ddT, weet je dus daar een T in de DNA-keten zit (en een A in de streng die als matrijs diende). Zo kun je de totale nucleotidenvolgorde achterhalen. Het aflezen van de gel gebeurt automatisch.

ddA ddC ddT ddG 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’
A C T G
Moleculaire genetica De structuur van DNA 8.1

GCGAATGCGTCCACAACGCTACAGGTG

GCGAATGCGTCCACAACGCTACAGGT

GCGAATGCGTCCACAACGCTACAGG

GCGAATGCGTCCACAACGCTACAG

GCGAATGCGTCCACAACGCTACA

GCGAATGCGTCCACAACGCTAC GCGAATGCGTCCACAACGCTA

GCGAATGCGTCCACAACGCT

GCGAATGCGTCCACAACGC

GCGAATGCGTCCACAACG

GCGAATGCGTCCACAAC

GCGAATGCGTCCACAA

GCGAATGCGTCCACA

GCGAATGCGTCCAC

GCGAATGCGTCCA

GCGAATGCGTCC GCGAATGCGTC GCGAATGCGT GCGAATGCG GCGAATGC GCGAATG GCGAAT

Figuur 6 Afgelezen gelelektroforese

DNA-analyse ofwel Whole Genome Sequencing Je kunt via internet je genoom laten sequensen. Er zijn tal van obscure bedrijfjes die voor veel geld (enkele delen van) je opgestuurde DNA (uit speeksel) willen onderzoeken. Maar wat nu de precieze betekenis is van deze informatie, is helemaal niet duidelijk. Genetici weten nog niet van alle varianten of afwijkingen te zeggen welke invloed ze hebben op de gezondheid. De meeste ziekten zijn namelijk multifactorieel overerfbaar. Dit houdt in dat meerdere genen, levensstijl en omgevingsfactoren een rol spelen bij het ontstaan ervan. Als uit de screening blijkt dat je een afwijking hebt die een verhoogd risico geeft op bijvoorbeeld hartaandoeningen, kan men voorlopig toch niets meer doen dan algemene adviezen geven, zoals ‘gezond eten’, ‘bewegen’ en ‘niet roken’, wat eigenlijk voor iedereen geldt.

Gel:
G
T G G A C A T C G C A A C A C C T G C G T
Moleculaire genetica De structuur van DNA 8.1

OEFENVRAGEN

Oefenvragen bij 8.1

1 Juist of onjuist

Je kunt voor het beantwoorden eventueel gebruik maken van Binas tabel 71A, 71B en 71C, of ScienceData tabel 16.3.

Geef van de volgende beweringen aan of ze juist zijn of niet.

Juist Onjuist

1 Een chromosoom is er altijd in de cel, maar deze is niet altijd zichtbaar. ◯ ◯

2 Twee chromosomen worden verbonden door een centromeer. ◯ ◯

3 Een chromosoom bestaat altijd uit twee chromatiden. ◯ ◯

4 Voor het verdubbelen van DNA heeft de kern geen aanvoer van fosfaat en desoxyribose nodig. ◯ ◯

5 Aminozuren zijn ketens van eiwitten. ◯ ◯

6 De volgorde van aminozuren van een eiwit ligt vast in de genetische code. ◯ ◯

7 De genetische code ligt vast in eiwitten. ◯ ◯

2 Kern

Leg uit waarom het zo noodzakelijk is dat bij celdeling de dochtercellen precies zo’n kern krijgen als de moedercel.

3 Moleculen

Kies het juiste woord.

1 De moleculen adenine en thymine zijn wel | niet ongeveer even groot.

2 De moleculen adenine en guanine zijn wel | niet ongeveer even groot.

3 Een nucleotide bevat wel | niet een fosfaatmolecuul.

4 De bindingen tussen de basen in een DNA-molecuul zijn ionbindingen | waterstofbruggen.

5 De basen A en T zijn wel | niet complementaire basen.

Moleculaire genetica De structuur van DNA 8.1

4 Waar of niet waar

Geef aan of de volgende beweringen waar of niet waar zijn.

Waar Niet waar

1 Een gen is een stukje DNA dat codeert voor een eigenschap. ◯ ◯

2 Desoxyribose is een suikermolecuul in het DNA. ◯ ◯

3 Aminozuren zijn bouwstenen van DNA. ◯ ◯

4 DNA is een organische stof. ◯ ◯

5 Een gen codeert voor de aminozuurvolgorde in een eiwit. ◯ ◯

6 Een chromosoom bestaat uit 100% DNA. ◯ ◯

5 3’ en 5’

Waarvoor worden de aanduidingen 3’ en 5’ gebruikt?

6 Basencombinaties

Leg uit dat de basencombinaties AG en TC in een DNA-molecuul zouden leiden tot een onregelmatig gevormd molecuul.

Moleculaire genetica De structuur van DNA 8.1

THEORIE

TRANSCRIPTIE : DNA OVERSCHRIJVEN

Wat moet je kennen / kunnen?

• Je kunt uitleggen uit welke deelmoleculen DNA opgebouwd is.

• Je kunt aangeven op welke manier transcriptie plaatsvindt en weet welke begrippen daarbij horen.

Transcriptie: DNA overschrijven

De genen met informatie voor de eiwitaanmaak in de cel liggen in het DNA. Maar DNA kan de kern niet zomaar verlaten. Bovendien is het op de histonen opgerolde DNA niet toegankelijk. Er moet dus het een en ander gebeuren, voordat de informatie in het DNA in de kern leidt tot de synthese van een eiwit in het cytoplasma. Als er in de cel behoefte is aan een bepaald eiwit (bijvoorbeeld een enzym), gaat er een signaal naar de kern. Daarop wordt de dubbele spiraal van het DNA over de lengte van het gen, dat voor het gewenste eiwit codeert, opengemaakt.

Eén helft van de DNA-spiraal wordt nu overgeschreven in de vorm van een molecuul dat de kern wél kan verlaten. Dit heet transcriptie (L. transcribere = overschrijven). Het nieuw gevormde molecuul is een RNA-molecuul, dat de informatie van het DNA overbrengt naar de ribosomen die het bedoelde eiwit kunnen synthetiseren. Daarom wordt dit RNA ook boodschapper-RNA, of messenger-RNA genoemd, meestal afgekort tot mRNA. RNA heeft een iets andere moleculaire structuur dan DNA. RNA bevat de base uracil (U) in plaats van de base thymine (T). Deze base U kan met de base A een binding aangaan. De basen A, G en C komen in zowel DNA als RNA voor. Verder bevat RNA de suikergroep ribose in plaats van desoxyribose. Het derde verschil is dat RNA normaal gesproken slechts uit één lange keten nucleotiden bestaat, dus enkelstrengs is. Deze keten kan in sommige gevallen zodanig zijn opgevouwen dat sommige stukken RNA dubbelstrengs lijken. Dit komt vooral voor bij een speciaal soort RNA: transport-RNA of transfer-RNA, meestal afgekort tot tRNA (in § 8.4 ‘Translatie: eiwitsynthese door de ribosomen’ wordt tRNA besproken).

Scan de QR-code en bekijk op Bioplek de verschillen tussen RNA en DNA.

8.2
Moleculaire genetica Transcriptie: DNA overschrijven 8.2

DNA-streng transcriptie mRNA translatie eiwit Figuur 7 Transcriptie en translatie

A U

G

C G

A U

Messenger-RNA

C G

A

C G

A U

A U

G C

G C

C A

T U

Zoals je figuur 7 kunt zien, wordt er tijdens het transcriptieproces tegenover elke G in het DNA een C in het mRNA-molecuul neergezet, en tegenover elke C een G. Tegenover elke T van het DNA komt een A in het mRNA. Maar… elke A in het DNA bindt met een U in het mRNA. Als de transcriptie compleet is, en dus het gen helemaal overgeschreven is, kan het mRNA-molecuul de kern verlaten.

Bij eukaryoten begint de transcriptie in de celkern. Dat wil zeggen dat er aan de hand van de informatie in het DNA een mRNA-keten gevormd moet worden. Van het dubbelstrengs DNA wordt één helft wel en de andere helft niet afgelezen. De streng die niet wordt afgelezen, heet de coderende streng (coding-streng of sense). De andere streng heet de matrijsstreng (template-streng of antisense); deze wordt afgelezen. Het enzym RNA-polymerase koppelt de RNA-nucleotiden aan elkaar in een volgorde die complementair is aan de matrijsstreng. Met complementair wordt bedoeld dat voor elke DNA-base A een U wordt ‘geschreven’ in het RNA en voor elke T in het DNA een A in het RNA. C in het DNA leidt tot G in het RNA, en G in DNA levert C in RNA op. Het overschrijven van de code in mRNA vindt plaats in de 3’-5’-richting van de matrijsstreng; dat betekent dat het mRNA in de 5’-3’-richting gemaakt wordt.

DNA-molecuul
gen
gen 3
Phe Trp Gly Ser
gen 1
2
Moleculaire genetica Transcriptie: DNA overschrijven 8.2

3’ 5’ 5’

DNA kernmembraan coderende streng matrijsstreng RNA-polymerase

terminator 3’

porie in de kernmembraan mRNA bouwstenen van mRNA promotor

Figuur 8 Het ontstaan van een mRNA-streng

Voordat de matrijsstreng afgelezen kan worden, moeten eerst de waterstofbruggen tussen de beide DNA-ketens verbroken worden. Bij eukaryoten moet het sterk gespiraliseerde DNA bovendien eerst gedespiraliseerd worden, voordat de code kan worden overgeschreven. De transcriptie begint op een plaats met een specifieke DNA-volgorde, de promotor. Het is de plaats waar het RNA-polymerase bindt aan het DNA. Bij een andere specifieke DNA-volgorde, de terminator, eindigt de transcriptie.

Bij de transcriptie zijn ook nog enzymen betrokken, die er samen voor zorgen dat RNA-polymerase wel of niet gebonden wordt aan het DNA. Dit zijn de transcriptiefactoren, zij bepalen in feite of een bepaald gen wel of niet wordt afgelezen. Dan hebben we het over genregulatie: dit proces wordt besproken in § 13.6 ‘Genregulatie’.

Scan de QR-code en bekijk nu de animatie van de transcriptie op Bioplek.

Introns en exons

Bij eukaryoten zijn er binnen het gen delen die niet coderen voor aminozuren; je noemt ze introns. Je zou kunnen zeggen dat er in de DNA-zin woorden zonder betekenis voorkomen. De delen die wel codes bevatten voor aminozuren, zijn de exons. Zij worden later ‘vertaald’ in aminozuren. ‘Ex’ in exons verwijst naar ‘expression’ (Engels: uitdrukken / in dit geval: uitvoeren). Het mRNA dat bij transcriptie gevormd wordt, bevat zowel de code van de introns als de exons. Dit mRNA wordt ook wel pre-mRNA genoemd. Voordat het mRNA de kern verlaat, wordt het nog gewijzigd. Aan het begin (de 5’-kant) wordt een gewijzigde G-nucleotide geplaatst en aan het eind een variabel aantal A-nucleotiden.

Moleculaire genetica Transcriptie: DNA overschrijven 8.2

Deze toegevoegde stukjes spelen een rol bij het transport van mRNA naar het cytoplasma en bij de eiwitsynthese. Vervolgens knippen enzymen de introns uit het mRNA; dit proces heet splicing. De introns worden afgebroken. Het mRNA is nu klaar en gaat vanuit de celkern naar het cytoplasma voor de eiwitsynthese. Bekijk hiervoor ook het schema in Binas.

intron intron intron exon exon 5’ UTR 3’ UTR

exon

pre-mRNA mRNA

Figuur 9 Exons komen in het mRNA terecht

Over de functie van de introns zijn de geleerden het nog niet eens. Het aantal en de lengte van de introns zijn sterk afhankelijk van het organisme. Het kost natuurlijk tijd, energie en bouwstenen om de introns te vermenigvuldigen, zodat het onwaarschijnlijk is dat ze helemaal geen functie hebben.

Door de introns wordt het gen in een aantal stukken opgedeeld: hierdoor is het mogelijk dat na het verwijderen van de introns uit het pre-mRNA de exons op verschillende manieren aan elkaar gekoppeld worden. Het gevolg is dat er op grond van de code van het gen verschillende soorten eiwitten gevormd kunnen worden (alternative splicing). Op deze manier kunnen op basis van een relatief klein aantal genen grote aantallen verschillende eiwitten worden gemaakt.

De één-gen ► één eiwit-hypothese klopt niet meer.

Scan de QR-code en bekijk ook de animatie op Bioplek.

Epigenetica

Epigenetica is de studie van erfelijke veranderingen in de genfunctie die optreden zonder dat de DNA-sequentie (nucleotidenvolgorde) wijzigt.

Er verschijnen steeds vaker berichten dat eeneiige tweelingen meer van elkaar verschillen dan je op grond van hun identieke genoom zou verwachten (zie paragraaf 8.6 ‘Tweelingonderzoek’). Een mogelijke verklaring is dat er na de splitsing van de bevruchte eicel of van het vroegste embryo in één van de twee een mutatie optreedt (zie paragraaf 5.5 ‘Bevruchting en zwangerschap’). Waarschijnlijker is dat hier epigenetica in het spel is: er is op moleculair niveau iets gebeurd waardoor een kenmerk van het individu is veranderd, zonder dat de genen zelf gewijzigd zijn.

Elke cel van een meercellig organisme bevat dezelfde voorraad genen, maar ze zijn niet in elke cel actief. Het hangt er van af tot welke vorm en functie de cel is gedifferentieerd. Er zijn honderden verschillende soorten cellen in je lichaam. Zo zijn de kenmerken van een volwassen zenuwcel totaal anders dan die van een levercel. Tijdens de embryonale ontwikkeling worden genen aan- of uitgeschakeld. Dit proces heet genomische afstempeling of genomic imprinting. Genomische afstempeling gebeurt tijdens de differentiatie; het ‘aan-uit-patroon’ wordt bij de celdeling in een weefsel doorgegeven aan de dochtercellen. Van de ongeveer 21.000 genen in het menselijk genoom is na differentiatie in elk celtype dus een groot deel van de genen levenslang geblokkeerd.

Moleculaire genetica Transcriptie: DNA overschrijven 8.2

Omstandigheden in de vroege ontwikkeling blijken daar ingrijpende invloed op te kunnen hebben. Tot voor kort meende men dat bij de vorming van ei- en zaadcellen alle epigenetische kenmerken worden uitgeschakeld, maar soms blijkt zo’n epigenetische verandering naar een volgende generatie te worden doorgegeven. Uit recent onderzoek is gebleken dat omgevingstoestanden een invloed hebben op de overdraagbaarheid van genomische afstempeling op volgende generaties. Uit gegevens en cijfers van een ruim en compleet Zweeds bevolkingsregister is aangetoond dat perioden van hongersnood tijdens de jeugd in veel gevallen diabetes (suikerziekte) bij de derde generatie tot gevolg hadden. Ook is gebleken dat stressgevoeligheid bij kinderen van wie de moeder tijdens de zwangerschap aan sterke stressprikkels (denk aan oorlogen!) werd blootgesteld in verhouding veel hoger ligt. Er zijn aanwijzingen dat kinderen van moeders die tijdens de zwangerschap rookten later vaker aan obesitas (vetzucht) lijden.

Epigenetische factoren bepalen de ‘open’ of ‘gesloten’ toestand van delen van het genoom en beheersen zo de ‘aan’- of ‘uit’-stand van genen. De drie pijlers waarop deze factoren berusten zijn: DNA-methylering, RNA en het nucleosoom.

Soms wordt er aan een nucleotide een methylgroep gebonden. Dit wordt DNA-methylering of kortweg methylering genoemd. Bij eukaryoten wordt een methylgroep meestal aan cytosine in een CG-volgorde gekoppeld. De methylering verhindert de genexpressie, vooral als deze plaatsvindt in een promotorgebied. Methylgroepen kunnen ook weer worden verwijderd; methylering is een omkeerbaar proces.

Methyleringen kunnen in een vast patroon of als reactie op omgevingsfactoren plaatsvinden. Methyleringen in een vast patroon vinden plaats tijdens de ontwikkeling en differentiatie van een individu. In dit proces worden in van elkaar differentiërende celtypes andere genen gemethyleerd. Dit heeft tot gevolg dat cellen gaan verschillen in genen die actief zijn, ook al bezitten ze dezelfde genen.

Methylering als reactie op omgevingsfactoren kan soms worden doorgegeven aan voortplantingscellen. Omstandigheden tijdens de zwangerschap kunnen invloed hebben op het methyleringspatroon van nakomelingen. Een voorbeeld uit eigen land is het afwijkende methyleringspatroon bij mensen die vlak na de hongerwinter 1944-1945 zijn geboren; hun DNA blijkt epigenetisch te zijn veranderd door de prenatale blootstelling aan een ongunstige omgeving.

Naast de RNA’s die betrokken zijn bij de eiwitsynthese zijn nu twee typen epigenetisch RNA bekend: hele kleine RNA’s, de microRNA’s, en hele grote niet-coderende RNA’s met de naam ncRNA (non coding RNA). Deze RNA’s hebben invloed op het ‘open’ of ‘gesloten’ zijn van delen van chromosomen of zelfs hele chromosomen. Waar een chromosoom een gesloten structuur heeft, is de DNA-code niet af te lezen en kan er geen transcriptie plaatsvinden. Verder zijn er ook stukjes dubbelstrengs RNA ofwel dsRNA (double-stranded RNA) betrokken bij het inactiveren van een gen.

Het nucleosoom is een structuur waarin het DNA is verpakt (zie § 8.1 ‘De structuur van DNA’). Nucleosomen bestaan uit histonen. Histon-eiwitten kunnen op een aantal verschillende plekken worden veranderd door toevoeging of verwijdering van kleine chemische verbindingen, zoals acetyl-, methyl- en fosfaatgroepen, of grotere peptiden.

Als gevolg van deze veranderingen wordt de aard van het nucleosoom gewijzigd: het chromatine kan hierdoor meer ‘open’ of meer ‘gesloten’ raken.

Het is duidelijk dat genen alleen niet simpelweg bepalen welke kenmerken een organisme heeft.

Scan de QR-code en bekijk het YouTube-filmpje met uitleg over epigenetica.

Moleculaire genetica Transcriptie:
overschrijven 8.2
DNA

OEFENVRAGEN

Oefenvragen bij 8.2

1 DNA

DNA kan de kern niet verlaten.

Geef daarvoor twee redenen.

2 Kernporie

Beantwoord de vragen.

a Geef een voorbeeld van een stof die door een kernporie de kern verlaat.

b Geef ook een voorbeeld van een stof die door de kernporie de kern binnen zal gaan.

3 Moleculen en DNA

Kies het juiste woord.

• Ribose is een stikstofbase | suikermolecuul

• Een molecuul desoxyribose bevat een zuurstofatoom meer | minder dan ribose.

• RNA is enkelstrengs | dubbelstrengs

• De basen A, T, G en C komen wel | niet in zowel DNA als RNA voor.

• Uracil is wel | niet een stikstofbase.

4 Volgorde

Zet de gebeurtenissen in de juiste volgorde.

Noteer de cijfers 1 t/m 7 in de vakjes.

De waterstofbruggen tussen de DNA-strengen worden verbroken.

Polymerase stopt als het in het DNA de code van de terminator heeft bereikt.

In de cel is een bepaald enzym nodig.

De coderende streng en de matrijsstreng liggen vrij.

De matrijsstreng wordt door RNA-polymerase afgelezen in de richting van 3’ naar 5’.

De transcriptiefactor bepaalt dat het DNA voor het benodigde enzym kan worden afgelezen.

RNA-polymerase bindt aan DNA bij de promotor.

Moleculaire genetica Transcriptie: DNA overschrijven 8.2

Transcriptie

Termen en processen die te maken hebben met transcriptie zijn: coderen voor meerdere eiwitten, exons, introns, mRNA, pre-mRNA, splicing, transcriptie.

Vul de juiste begrippen in.

Kies uit de genoemde termen en processen.

• Polymerase heeft gezorgd voor de van DNA en zo een RNA-keten gevormd.

• Dit kan de celkern nog niet verlaten.

• Er moeten wijzigingen worden aangebracht. Aan de uiteinden van de keten worden extra nucleotiden geplakt.

• Enzymen knippen uit de keten.

• Dit proces heet

• De definitieve RNA-keten is het dat de celkern wel kan verlaten.

• Het is goed mogelijk dat de die in de definitieve keten terechtkomen niet in een vaste volgorde gezet worden. Zo kan één gen

6 Aan- en uitzetten van genen

De cellen van je huid en die in je hart hebben hetzelfde DNA als dat in de bevruchte eicel waaruit je bent ontstaan. Dat ze zo verschillend zijn, komt doordat in deze celtypen niet allemaal dezelfde genen actief zijn. Sommige genen zijn ‘uitgezet’.

Beantwoord de vragen.

a Hoe noem je het proces waarmee genen kunnen worden aan- of uitgezet?

b Een ouderpaar, de een met lange wimpers en krullen en de ander met korte wimpers en sluik haar, krijgt een kind. Het kind heeft de krullen van de ene ouder en de korte wimpers van de andere ouder. Er is geen sprake van duidelijk dominante of recessieve genen. Leg uit dat dit met epigenetica wel te verklaren is.

5
Moleculaire genetica Transcriptie: DNA overschrijven 8.2

Vlasbekje

Het vlasbekje of vlasleeuwenbekje (Linaria vulgaris) maakt soms afwijkende bloemen die er helemaal niet uitzien als leeuwenbekjes. De afwijkende bloemetjes zijn buisvormig. De verandering blijft meestal maar twee generaties zichtbaar. In 1999 al werd aangetoond dat het om een epigenetische mutatie gaat.

Beantwoord de vragen.

a Wat is er gebeurd met de genen voor de bloemen van het vlasbekje waardoor de bloemvorm veranderde?

b De verandering blijft een of twee generaties. Hoe kan dat?

c De verandering verdwijnt ook weer. Hoe kan dat?

d Wat is het verschil tussen een epigenetische mutatie en een mutatie in het DNA?

7
Moleculaire genetica Transcriptie: DNA overschrijven 8.2

8.3 DE GENETISCHE CODE

Wat moet je kennen / kunnen?

• Je weet wat chromosomen zijn.

• Je kunt uitleggen uit welke moleculen DNA opgebouwd is.

• Je kunt vertellen wat een gen is en hoe een gen in het mRNA te vinden is dankzij het start- en stopcodon.

• Je kunt aangeven op welke manier transcriptie en translatie plaatsvinden en je weet welke begrippen daarbij horen.

THEORIE De genetische code

Voordat we ingaan op de synthese van een door de cel gewenst nieuw eiwit, moet je eerst meer weten over de genetische code. De genetische code voor het te vormen eiwit ligt vast in de volgorde van de nucleotiden in het DNA. Eiwitten bestaan uit lange ketens aminozuren. In alle organismen op aarde worden dezelfde twintig aminozuren gebruikt. Voor elk aminozuur bestaat een DNA-code in de vorm van een triplet: drie nucleotiden achter elkaar. Uitgaande van de vier stikstofbasen kunnen 64 verschillende tripletten worden gevormd. Voor de meeste van de twintig aminozuren is dan ook meer dan één triplet voorhanden. Sommige tripletten hebben andere functies dan het coderen van een aminozuur, zoals ‘stop’ en ‘start’.

Het overgeschreven mRNA bevat in feite dezelfde tripletopbouw; alleen voor elke A in het DNA staat er een U, en voor de G, C en T in DNA staan er in mRNA respectievelijk een C, een G en een A. Drie opeenvolgende mRNA-basen die met elkaar de code voor een bepaald aminozuur vormen, worden een codon genoemd. Bij het codon AUG hoort bijvoorbeeld het aminozuur methionine. In tabel 1 staan de aminozuren met hun codons in het mRNA.

aminozuur codon in mRNA

Alanine (ala)

Arginine (arg)

Asparagine (asn)

Asparaginezuur (asp)

Cysteïne (cys)

Glutamine (gln)

Glutaminezuur (glu)

Glycine (gly)

Histidine (his)

Isoleucine (ile)

Leucine (leu)

Lysine (lys)

Methionine (met)

Proline (pro)

Serine (ser)

Threonine (thr)

Tryptofaan (trp)

Tyrosine (tyr)

Valine (val)

Startcodon Stopcodons

GCU GCC GCA GCG CGU CGC CGA CGG AGA AGG AAU AAC GAU GAC UGU UGC CAA CAG GAA GAG GGU GGC GGA GGG CAU CAC AUU AUC AUA

CUU CUC CUA CUG UUA UUG AAA AAG AUG

CCU CCC CCA CCG

UCU UCC UCA UCG AGU AGC ACU ACC ACA ACG UGG UAU UAC GUU GUC GUA GUG AUG UAA UAG UGA

Tabel 1 De aminozuren en hun codon

Moleculaire genetica De genetische code 8.3

In tabel 1 is te zien dat er voor elk aminozuur minimaal één codon beschikbaar is. Soms zijn er meerdere voor hetzelfde aminozuur. Zo coderen zowel UUU als UUC voor het aminozuur phenylalanine (phe). Het maakt hier dus niet uit of de derde base een U of een C is. Bij leucine (leu) passen de codons UUA, UUG, CUU, CUC, CUA en CUG. Dat verschillende codons coderen voor een zelfde aminozuur, is het gevolg van de evolutie van het systeem. Het betekent ook dat een kleine fout in een base van een codon niet direct tot een mutatie hoeft te leiden, en dus ook geen gevolgen heeft voor het organisme.

Tabel 1 is handig om codons te zoeken bij bekende aminozuren. Maar als je mRNA afleest, heb je alleen codons. Wil je weten welk aminozuur daar bijhoort, dan kun je beter tabel 2 gebruiken. In Binas vind je ook een dergelijke tabel.

1e letter

2e letter 3e letter

Tabel 2 Codons in het mRNA en de bijbehorende

aminozuren

Voor een cel is het van belang dat alle benodigde aminozuren in het cytoplasma voorradig zijn. Sommige worden in de stofwisseling van de cel zelf aangemaakt, de andere moeten van buitenaf aangevoerd worden (via de voeding). Deze van buitenaf aangevoerde aminozuren noem je essentiële aminozuren. Opvallend is dat niet alle diersoorten dezelfde essentiële aminozuren hebben. Planten kunnen uiteraard wel alle aminozuren zelf maken.

Evolutie van de genetische code

Waarom de genetische code in het DNA is zoals zij is, werd lang gezien als toeval. Crick noemde het systeem een ‘frozen accident’: toevallig ooit zo ontstaan en nooit meer veranderd. Er konden af en toe foutjes in ontstaan en die zouden geen gevolg hebben als het veranderde triplet toevallig hetzelfde aminozuur opleverde. Andere, gelijksoortige foutjes veroorzaakten veranderingen waardoor het gevormde eiwit niet meer kon werken. In zeer zeldzame gevallen zou zo’n mutatie een verbetering betekenen - en daar hebben we evolutie aan te danken.

Maar twintig jaar na de ontrafeling van de genetische code begonnen anderen te ontdekken dat deze code helemaal niet toevallig is, dat er een ‘code binnen de code’ zit. De genetische code vormt de sleutel tot het ontstaan van het systeem. DNA is echt een ‘uitvinding’ van het leven, nadat het allereerste leven met RNA had gewerkt. Doordat men lang aannam dat de code puur toevallig was, duurde het een hele tijd voordat er serieus onderzoek naar kwam.

Moleculaire genetica De genetische code 8.3

Pas toen iemand ernaar ging kijken vanuit het idee dat deze het resultaat moet zijn van biosynthese, van het werk van cellen, kwam er oog voor de ‘code binnen de code’.

Figuur 10 De genetische code zoals deze in het RNA zit (waar de T uit het DNA vervangen is door een U, uracil)

Lees vanuit het centrum naar buiten. Glycine kan als derde letter vier verschillende letters hebben, tryptofaan (middenrechts) slechts één.

Voor iedere letter van een triplet geldt een ander patroon. De eerste is het meest opvallend. Deze heeft te maken met de verbinding waaruit het aminozuur wordt gemaakt. Alle aminozuren, die gemaakt worden van pyrodruivenzuur, hebben bijvoorbeeld een code die begint met de T.

De tweede letter in het triplet staat in verband met de oplosbaarheid van het aminozuur in water (hydrofilie). Het andere uiterste is hydrofobie: hydrofobe stoffen zijn niet oplosbaar in water, maar wel in vetten. De meest hydrofiele aminozuren hebben een A als tweede letter, de meest hydrofobe een T, en de tussenliggende een C of een G. En de derde letter doet er in sommige gevallen helemaal niet toe.

Dat laatste is interessant. Een code die uit twee letters bestaat kan voor 16 verschillende aminozuren coderen. Als we van alle 20 verschillende aminozuren de 5 meest complexe aminozuren even schrappen, blijven er 15 over plus een stopcodon. Deze 15 bezetten 53 van de 64 tripletten, hebben elk drie of vier codons. De conclusie is dat er hoogstwaarschijnlijk eerst minder aminozuren werden gebruikt en dat de code uit doubletten bestond.

Moleculaire genetica De genetische code 8.3

De derde letter zou door toeval bepaald kunnen zijn - of door selectie. Er zijn later een paar aminozuren bijgekomen en die hebben één of twee varianten in de derde letter. Die hebben ze waarschijnlijk ‘gekaapt’ van een aminozuur waar ze op lijken. Onderzoekers hebben de werkelijke code vergeleken met miljoenen door de computer gegenereerde codes en gekeken wat het gevolg is van puntmutaties in die codes. Wat bleek? De natuurlijke code (zoals die in de natuur bestaat) is het minst gevoelig voor veranderingen. Bij puntmutaties blijft in veel gevallen het aminozuur hetzelfde of er wordt een aminozuur gevormd dat veel lijkt op het oorspronkelijke. De natuurlijke code is geen toevalstreffer, maar het resultaat van natuurlijke selectie: de kans op schadelijke mutaties is gering, en de kans op gunstige mutaties zou zelfs groter zijn. De universele code is het resultaat van natuurlijke selectie. Dit proces moet al gebeurd zijn voordat de ‘oer’-bacteriën zich splitsten in soorten, want de code geldt voor alle levende wezens.

Niet-coderend DNA

Het percentage DNA dat bij eukaryoten voor eiwitten codeert, wordt geschat op slechts 1,5%. De rest wordt niet-coderend DNA genoemd. Daartoe behoren de eerder genoemde promotoren, terminatoren en transcriptiefactoren en de introns (zie § 8.2 ‘Transcriptie: DNA overschrijven’).

Een andere categorie niet-coderend DNA zijn de pseudogenen. Zij hebben wel de structuur van een gen, maar leveren geen eiwit op. Voor een deel zijn dit onwerkzame ‘fossiele genen’ die in voorouders nog wel functioneerden. Een voorbeeld hiervan is het gen dat bij de meeste zoogdieren verantwoordelijk is voor de productie van vitamine C. Dit gen is bij primaten (waartoe onder andere de apen, mensapen en mensen behoren) nog wel terug te vinden, maar is niet meer werkzaam.

Nog een groep niet-coderend DNA zijn de stukken die wel in RNA worden overgeschreven, maar niet voor een eiwit coderen. Dit RNA noem je niet-coderend RNA (ncRNA). Deze RNA-moleculen blijken veel genregulerende functies te hebben (zie § 8.2 ‘Transcriptie: DNA overschrijven’). De DNA-delen die voor dit RNA coderen, worden RNA-genen (RNA genes) genoemd. Andere delen van het DNA die wel in RNA worden overgeschreven, maar geen eiwit opleveren, zijn de genen voor transfer-RNA en ribosomaal RNA.

In het genoom van eukaryoten, zoals de mens, komen vaak herhalingen van korte nucleotidereeksen voor. Deze worden microsatellieten genoemd, in het Engels short tandem repeats (STR’s) of simple sequence repeats (SSR’s); in het Nederlands repetitief DNA. Het aantal herhalingen op een bepaalde plaats (locus) in het genoom kan variëren en is net als een gen erfelijk. Per locus erf je dus een reeks herhalingen van je vader en een andere reeks van je moeder. In het menselijk genoom zijn duizenden van deze plaatsen aangetroffen. Door deze variabiliteit kunnen microsatellieten een hoofdrol vervullen in forensisch onderzoek en onderzoek naar verwantschap. Door van bepaalde loci het aantal herhalingen te bepalen kun je van elk persoon een uniek DNA-profiel (DNA-fingerprint of DNA profiling) maken. Dit profiel bevat dus wel genetische informatie, maar niet over genen.

Genetisch onderzoek

Bij genetisch onderzoek wordt veel meer onderzocht dan alleen de voor eiwitten coderende genen. Men kijkt ook naar factoren als microsatellieten (zie paragraaf 8.3 ‘De genetische code’), histonen (zie paragraaf 8.1 ‘De structuur van DNA’) en bepaalde epigenetische kenmerken (zie § 8.2 ‘Transcriptie: DNA overschrijven’). Daarnaast zijn er nog andere DNA-kenmerken die van belang zijn in genetisch onderzoek, onder andere single nucleotide polymorphisms en haplotypes.

Moleculaire genetica De genetische code 8.3

Single nucleotide polymorphism

In het DNA komen puntmutaties voor. Zo wordt een basenpaar incidenteel vervangen door een ander paar. Als deze puntmutatie in geslachtscellen gebeurt en niet tot dramatische gevolgen leidt voor het individu, wordt deze aan (een deel van) de nakomelingen doorgegeven. Hierdoor bestaan in de populatie voor deze nucleotide twee allelen naast elkaar, een deel van de populatie heeft een cytosine (C) en het andere deel heeft een thymine (T) op die plek. Zo’n veranderd basenpaar wordt een single nucleotide polymorphism genoemd, kortweg SNP.

Figuur 11 SNP (Single Nucleotide Polymorphism)

SNP’s komen veel voor en ook in de menselijke populatie zijn er tientallen miljoenen in kaart gebracht. Daardoor kunnen zij in medisch onderzoek gebruikt worden. Men vergelijkt bijvoorbeeld groepen mensen die in één bepaalde eigenschap verschillen, bijvoorbeeld mensen met en zonder diabetes (suikerziekte). Door van elk individu het patroon van SNP’s te bepalen en na te gaan of deze patronen correleren met het al of niet hebben van diabetes, kunnen plaatsen in het genoom worden opgespoord die te maken hebben met de onderzochte eigenschap. Dit type onderzoek bestrijkt het hele genoom en wordt daarom genome wide association study genoemd. Voor de analyse van resultaten bij grote aantallen is biostatistische software onmisbaar.

Haplotypes

In onderzoek naar verre menselijke voorouders en hun migratie (genographics) wordt gebruik gemaakt van haplotypes. Een haplotype is een combinatie van microsatellieten en genen in een chromosoom waartussen vrijwel geen recombinatie optreedt. Hierdoor worden deze elementen altijd gezamenlijk doorgegeven aan het nageslacht. De verspreiding van een haplotype kan worden bestudeerd en geeft aanwijzingen voor migratiepatronen. Verwante haplotypes met een gemeenschappelijke voorouder noemt men een haplogroep. De meest bekende onderzoeken betreffen de haplogroepen van het mitochondriaal DNA (afstamming in de vrouwelijke lijn) en van het Y-chromosoom (afstamming in de mannelijke lijn).

Ook in Nederland is onderzoek gedaan in dit verband, scan de QR-code en lees het artikel hierover.

C C C C C C C C C G C G C G C G C G C G T A T A T A T A T A T A T A T A C C C C C C C C C G C G C G C G C G C G T A T A C G T A T A T A T A T A SNP
Moleculaire genetica De genetische code 8.3

ouderdom Y-chromosoom

200 000 - 100 000 100 000 - 50 000 50 000 - 25 000 25 000 - 10 000 10 000 - 1 000

Figuur 12 De menselijke migratie op basis van SNP’s

TOETSVRAGEN

Toetsvragen bij 8.1 t/m 8.3

1 Nucleotidensamenstelling

Een student doet onderzoek naar de nucleotidensamenstelling van een bepaald stuk dubbelstrengs DNA. Hij gebruikt hiervoor het mRNA dat gevormd is door transcriptie van dit bepaalde stuk DNA. Dit mRNA bestaat voor 45% uit adenine, voor 15% uit cytosine, voor 25% uit guanine en voor 15% uit uracil. Op grond van deze gegevens kan de nucleotidensamenstelling van het corresponderende DNA worden afgeleid.

Wat is de procentuele verdeling van de verschillende nucleotiden in dit stuk DNA?

Adenine 20%, cytosine 30%, guanine 30%, thymine 20%

Adenine 25%, cytosine 45%, guanine 15%, thymine 15%

Adenine 30%, cytosine 20%, guanine 20%, thymine 30%

Adenine 45%, cytosine 15%, guanine 25%, thymine 15%

2 Mitochondriaal DNA

In de matrix van mitochondriën bevindt zich onder andere DNA. Mitochondriaal DNA wordt uitsluitend van moeder op kind overgedragen. In een populatie bevinden zich verschillende typen mitochondriaal DNA. Nederlandse onderzoekers zijn een bijzondere vorm van diabetes mellitus (suikerziekte) op het spoor gekomen, die overerft via mitochondriaal DNA. Vrouwen met deze ziekte krijgen kinderen die ook aan de ziekte lijden. De onderzoekers hebben vastgesteld waardoor de afwijking ontstaat. Zij zeggen: “Het gaat om een afwijking aan één van de genen voor het genetisch ‘afleesapparaat’ van de mitochondriën”.

Wat bedoelen de onderzoekers met het ‘genetisch afleesapparaat’?

◯ de enzymsystemen die resulteren in RNA-synthese

◯ de enzymsystemen die betrokken zijn bij het herstel van DNA

◯ de enzymsystemen die de eiwitsynthese in ribosomen regelen

Moleculaire genetica De genetische code 8.3

Bacterie, gistcel, virus

S T

Q R

virus Figuur 1

bacterie gistcel

In figuur 1 zijn een bacterie, een gistcel en een virus getekend. In zowel de bacterie als in de gistcel zijn twee processen schematisch weergegeven. Een aantal delen en deeltjes is met letters aangegeven.

a In welk of in welke van de organismen in figuur 1 is zeker DNA aanwezig?

◯ alleen in de bacterie

◯ alleen in de gistcel

◯ alleen in het virus

◯ alleen in de bacterie en in de gistcel

◯ alleen in de bacterie en in het virus

◯ in de bacterie, in de gistcel en in het virus

b Noem de namen van de delen die met Q, R, S en T zijn aangegeven.

c Noem de namen van de twee processen die schematisch zowel in de bacterie als in de gistcel zijn weergegeven.

4 Twee strengen

DNA bestaat uit twee strengen. mRNA wordt gevormd door middel van base-paring met een deel van één van deze strengen. In dat geval heet dit deel van het DNA de ‘template’ streng. Het tegenoverliggende (complementaire) deel van de andere streng wordt de ‘coderende’ streng genoemd. Een bepaald eiwit bevat onder andere de aminozuren valine en methionine. Met behulp van Binas zijn alle codes af te leiden die in de coderende streng van DNA voor het aminozuur valine mogelijk zijn.

Noem al die codes.

3
Moleculaire genetica De genetische code 8.3

Triplet

Door een mutatie wordt de middelste base in het triplet, dat in het RNA het aminozuur methionine codeert, vervangen door één van de andere basen die in RNA voorkomen.

Voor welk aminozuur of voor welke aminozuren kan het triplet dat zo ontstaat coderen?

6 Vier perioden in de celcyclus

In de celcyclus zijn vier perioden te onderscheiden: de mitose (M-fase), de periode van DNA-verdubbeling (S-fase), de G1-fase tussen de M- en de S-fase, en de G2-fase tussen de S- en de M-fase. Een onderzoeker wil de duur van de S-fase in één celcyclus vaststellen. Daarbij gebruikt hij cellen waarvan het DNA gemerkt is met radioactieve H-atomen. Deze cellen zijn verkregen door ze gedurende één celcyclus te laten groeien in een kweekvloeistof die de met radioactieve H-atomen gelabelde stof Q bevat. Stof Q kan uitsluitend worden ingebouwd in het tijdens de S-fase nieuw gevormde DNA. Vier stoffen zijn: adenine, cytosine, guanine en thymine.

Welke van deze stoffen is de gelabelde stof Q? ◯ adenine ◯ cytosine ◯ guanine ◯ thymine

7 Kunstmatig samengesteld RNA

Bij het onderzoek naar de aantallen nucleotiden in de codons voor aminozuren is gebruik gemaakt van kunstmatig samengesteld RNA. Dit kunstmatige RNA bevat afwisselend de basen A en C.

a Beschrijf de aminozuurvolgorde van het polypeptide dat met behulp van dit kunstmatige RNA kan worden gemaakt, wetende dat elk codon drie nucleotiden bevat.

b Stel dat een codon zou bestaan uit vier nucleotiden.

Beantwoord de vragen.

1 Geef de codons weer die het onderzoek met dit kunstmatige RNA dan oplevert.

2 Noem het aantal verschillende polypeptiden dat in dat geval ontstaat.

3 Noem het aantal verschillende soorten aminozuren dat een gevormd polypeptide dan bevat.

5
Moleculaire genetica De genetische code 8.3

Stikstofbasen

organisme (A+T)/(G+C) bacterie tarweplant mens beer

0,97 1,22 1,40 1,86

A = adenine T = thymine G = guanine C = cytosine

Tabel 1

Bij verschillende organismen worden de verhoudingen tussen de stikstofbasen in het DNA bepaald. In tabel 1 is de verhouding tussen A+T en G+C van deze organismen weergegeven.

a Wat is de verhouding tussen A+G en T+C ofwel (A+G)/(T+C) bij een tarweplant of is dat niet te bepalen?

◯ 0,78 ◯ 1,00 ◯ 1,22 ◯ niet te bepalen

b Van elk van de organismen in de tabel wordt een willekeurig gen getranscribeerd. De gevormde mRNN’s worden met elkaar vergeleken.

Kun je op grond van tabel 1 voorspellen bij welk van deze organismen het percentage uracil in het gevormde mRNA het grootst is of is dat niet te voorspellen?

◯ bij de bacterie ◯ bij de tarweplant ◯ bij de mens ◯ bij de beer

◯ niet te voorspellen

9 Voorlopercellen van rode bloedcellen

In een experiment wordt mRNA geïsoleerd uit voorlopercellen van rode bloedcellen van de mens. Dit mRNA wordt ingespoten in eicellen van een kikker (groep 1). Een andere groep van dezelfde eicellen dient als controle en blijft onbehandeld (groep 2). De eicellen bevinden zich in een kweekmedium waarin zij zich kunnen ontwikkelen. Structuren in de eicel zijn: golgi-systeem, kern, lysosomen en ribosomen.

In welke van deze structuren vindt mRNA-synthese plaats?

◯ in het golgi-systeem

◯ in de kern

◯ in lysosomen

◯ in ribosomen

8
Moleculaire genetica De genetische code 8.3

Polypeptide

Een deel van een bepaalde genetische code is: AUG GCU AAU UGU GAA UAA. Op basis van deze nucleotidenvolgorde wordt een polypeptide gevormd. Over deze code en de wijze waarop het polypeptide wordt gevormd, wordt de volgende combinatievraag gesteld. Er zijn vier zinnen 1, 2, 3 en 4 en tien begrippen/getallen a tot en met j.

Zin:

1 Deze nucleotidenvolgorde wordt ... genoemd.

2 Voor de translatie worden minimaal ... tRNA moleculen gebruikt.

3 De drie nucleotiden die het DNA-startcodon van de ‘lagging strand’ vormen, zijn ...

4 Als het zevende nucleotide uit het gegeven molecuul verdubbelt, ontstaat na translatie een polypeptide met ... aminozuren.

Begrip/getal:

a TAC b UAC c AUG d ATG e DNA f tRNA g mRNA h vier i vijf j zes

Combineer het cijfer van elke zin met de letter van het begrip of het getal dat in de zin moet worden ingevuld.

10
Moleculaire genetica De genetische code 8.3

Moleculaire genetica

Translatie: eiwitsynthese door de ribosomen

TRANSLATIE : EIWITSYNTHESE DOOR DE RIBOSOMEN

Wat moet je kennen / kunnen?

• Je kunt aangeven op welke manier translatie plaatsvindt en je weet welke begrippen daarbij horen.

• Je kunt verklaren waarom we mRNA en tRNA nodig hebben voor de synthese van eiwitketens.

• Je kunt tekenen en uitleggen hoe ribosomen translatie mogelijk maken.

• Je kent het begrip niet-coderend DNA en kunt functies daarvan noemen.

THEORIE

Translatie: eiwitsynthese door de ribosomen

Als de code van het DNA overschreven is op mRNA, kan de volgende fase beginnen: de eiwitsynthese. Dan pas is de code voor het eiwit ‘vertaald’ naar het gewenste eiwit. Daarom wordt dit proces translatie (= vertaling) genoemd. Behalve de mRNA zijn voor de eiwitsynthese nodig: losse aminozuren, ribosomen en tRNA (= transport-RNA = transferRNA). tRNA-moleculen transporteren de aminozuren naar het ribosoom.

aminozuur specifiek voor dit tRNA

een afwijkende base speciaal voor tRNA’s

Figuur 13 Een voorbeeld van een tRNA-molecuul

De tRNA-moleculen zijn door een aantal lussen gedeeltelijk dubbelstrengs. In de middelste lus zit een belangrijk triplet, het past namelijk op ‘zijn’ complementaire codon in het mRNA. Dit triplet wordt het anticodon genoemd. Aan de andere kant van een tRNA-molecuul zit het aminozuur dat bij het codon hoort. Er moeten minimaal twintig verschillende tRNA’s voor de verschillende aminozuren zijn, maar omdat voor veel aminozuren meerdere codons bestaan, zijn het er veel meer.

8.4
A C G CUU AA GACAC C C U U G G G G G C UGUG C U U G A A A A A GG U GAA CC A G A GAGC CUC G C GG A UU anticodon
* * * * * * * * * * * * *
8.4

De ribosomen bestaan ook deels uit RNA; het wordt ribosomaal-RNA ofwel rRNA genoemd. De ribosomen ‘rijgen’ de aminozuren aan elkaar in de volgorde waarop deze aangevoerd worden door de tRNA-moleculen. De translatie gaat als volgt:

1 mRNA verlaat de kern via de kernporiën.

2 Aan de 5’-kant bindt een klein ribosoomdeel zich aan de startcode van het mRNA, tegenover het startcodon, de startcode (AUG) komt tegenover het tRNA met het bijbehorende anticodon te liggen. Dit tRNA heeft het bijbehorende aminozuur bij zich.

3 Vervolgens hecht het grote ribosoomdeel zich aan het mRNA.

4 Het ribosoom schuift nu langs het mRNA in de richting van het volgende codon. Er is dus een afleesrichting, richting de 3’-kant

5 Tegenover het tweede codon komt nu het tRNA met het volgende anticodon te liggen. Dat heeft ook weer zijn bijbehorende aminozuur bij zich.

6 Het eerste aminozuur laat los van zijn tRNA en wordt aan het tweede aminozuur gebonden. Het vrijgekomen tRNA gaat weer een aminozuur ophalen.

Zo schuift het ribosoom steeds verder langs het mRNA en worden steeds nieuwe aminozuren aan de peptideketen toegevoegd. Het loslaten gebeurt, doordat aan het einde van het gen een stopcodon zit. Bij het stopcodon (zie tabel 1 in § 8.3 ‘De genetische code’) hoort geen aminozuur en daardoor wordt de synthese van de eiwitketen afgebroken.

Wanneer het ribosoom bij het stopcodon is aangekomen, zorgt een release factor ervoor dat de ribosoomdelen loslaten van het mRNA en de gevormde eiwitketen; het ribosoom kan aan de vorming van een nieuwe polypeptideketen (= eiwit) beginnen. Het mRNA kan tegelijkertijd door meerdere ribosomen worden afgelezen.

Scan de QR-code en bekijk nu de animatie op Bioplek.

8.4
Moleculaire genetica Translatie: eiwitsynthese door de ribosomen
U A C M G A C L A A A U U U U U U G G G G G G C C C 5' 3' ACC W H2N UAC M G A C L A A A U U U U U U G G G G G G C C C 5' 3' H2N tRNA zonder M uit ribosoom ribosoom schuift op release factor M G A C L A A A U U U U U U G G G G G G C C C 5' 3' H2N A C C W M GAC L A A A U U U U U U G G G G G G C C C 5' 3' H2N W A A G M L F A A A A U U U U U U G G G G G G C C C 5' 3' H2N W AAG M L F A A A A U U U U U U G G G G G G C C C 5' 3' H2N COOH W A A G M L F A A A A U U U U U U G G G G G G C C C 5' 3' H2N COOH UAC M U A C M A A A U U U U U U G G G G G G C C C mRNA 5' 3' U A C M A A A U U U U U U G G G G G G C C C A kant A kant P kant P kant 5' 3' U A C M GAC L A A A U U U U U U G G G G G G C C C 5' 3' L-tRNA Figuur 14 De vorming van een eiwit in het cytoplasma Moleculaire genetica Translatie: eiwitsynthese door de ribosomen 8.4

OEFENVRAGEN

Oefenvragen bij 8.3 en 8.4

1 DNA

Gebruik voor het beantwoorden ook Binas (zesde editie) tabel 71 of ScienceData hoofdstuk 16.

Het DNA blijkt voor maar een klein deel te coderen voor eiwitten.

Beantwoord de vragen.

a Hoe wordt dergelijk DNA genoemd?

b Noem drie voorbeelden van DNA dat wél een taak heeft, maar niet voor een eiwit codeert.

c Er zijn ook DNA-stukken die niet coderen voor eiwitten, maar waarvan de functie niet duidelijk is. Hoe worden deze gedeelten genoemd?

2 DNA-gedeelten

Soms blijken DNA-gedeelten over een bepaalde lengte telkens herhaald te zijn.

Beantwoord de vragen.

a Hoe worden deze stukken genoemd? Geef het Nederlandstalige begrip én een Engelstalig begrip.

b De herhaalde reeksen zijn goed bruikbaar voor onderzoek. Welk onderzoek? Om welke reden?

Moleculaire
8.4
genetica Translatie: eiwitsynthese door de ribosomen

Moleculaire genetica

Translatie: eiwitsynthese door de ribosomen

DNA-onderzoek

Soms gebeurt het dat in een gezin één van de kinderen als deze volwassen is erg twijfelt of de opvoeders wel de biologische ouders zijn. Er kan dan DNA-onderzoek worden gedaan. Dat kan gebeuren met hulp van het onderzoek waarover opdracht 2 gaat, maar het kan ook gedaan worden met hulp van onderzoek naar haplotypen.

Beantwoord de vragen.

a Wat is een haplotype?

b Als je wilt weten of de moeder wel de biologische moeder is, welke haplotype komt dan in aanmerking?

c En als het gaat om de vader, welke haplotype dan? Kan dat ook bij dochters?

4 Eiwitsynthese

Zet de gebeurtenissen die zich bij de eiwitsynthese afspelen in de juiste volgorde.

Noteer de cijfers 1 t/m 8 in de vakjes.

De DNA-code wordt vastgelegd in mRNA.

De ribosomen lezen mRNA af.

mRNA verlaat de kern door de kernporiën.

Telkens drie mRNA-basen worden gelezen als een aminozuurcode.

mRNA hecht zich aan het ribosoom.

De eiwitketen is af en laat los van het ribosoom.

Verschillende tRNA voeren verschillende aminozuurmoleculen aan.

DNA in de kern wordt afgelezen.

5 Codons

Kies de juiste optie.

• Elke code voor een eiwit begint met een startcodon | stopcodon

• In eiwitten worden maximaal 20 | 40 verschillende aminozuren gebruikt.

• Een stopcodon codeert niet | wel voor een aminozuur.

• Voor veel aminozuren | eiwitten zijn er meerdere codons in het DNA / RNA mogelijk.

• De codes TAC (in DNA) en AUG (in RNA) betekenen niet | wel hetzelfde.

3
8.4

Moleculaire genetica

Translatie: eiwitsynthese door de ribosomen

DNA en RNA

Vul ‘ja’ of ‘nee’ in.

enkelstrengs dubbelstrengs met ATGC met AUGC in en buiten de celkern nooit buiten de celkern wordt doorgegeven aan dochtercellen

TOETSVRAGEN

Toetsvragen bij 8.4

1

Proto-oncogenen

DNA RNA

In de chromosomen van een muis komen proto-oncogenen voor. Deze genen zijn betrokken bij de regulatie van de delingsactiviteit van cellen. Door mutatie kunnen deze proto-oncogenen veranderen in oncogenen. Als de oncogenen tot expressie komen, wordt de delingsactiviteit van een cel niet meer normaal geregeld en gaat die cel zich ongeremd en ongecoördineerd delen. In zo’n geval ontstaat een tumor. Blaaskanker wordt bij muizen mede veroorzaakt door een mutatie van het proto-oncogen EJ. Dit proto-oncogen bestaat uit ongeveer vijfduizend nucleotiden.

De basenvolgorde van de template-streng in een belangrijk stukje van dit proto-oncogen EJ is als volgt:

CAC CAC CCG CGG CCG CCA CAC

De template-streng is de draad van het DNA die wordt gebruikt als matrijs voor de vorming van mRNA. De basenvolgorde van het overeenkomstige stukje van het oncogen EJ is:

CAC CAC CCG CGG CAG CCA CAC

Typen mutatie zijn: genmutatie, chromosoommutatie (verandering in de lengte van het chromosoom) en verandering in het aantal chromosomen (ploïdiemutatie).

a Door welk van deze typen mutatie ontstaat het oncogen EJ uit het proto-oncogen EJ?

b Transcriptie van het gegeven stukje template-streng in het proto-oncogen vindt plaats van links naar rechts. Vervolgens vindt translatie in dezelfde richting plaats.

Welke aminozuren en in welke volgorde bevat het op basis van dit deel van het proto-oncogen gevormde stukje eiwit?

6
8.4

genetica Translatie: eiwitsynthese door de ribosomen

c Transcriptie en translatie van het oncogen vinden op dezelfde wijze plaats als die van het proto-oncogen.

Noem het aminozuur waarvoor het gemuteerde triplet in het oncogen codeert.

d Met een speciale techniek wordt in een stukje blaastumorweefsel de aanwezigheid van het oncogen EJ vastgesteld. Deze blaastumor is ontstaan, doordat onder andere eenmalig een bepaalde mutatie is opgetreden.

Leg uit waardoor het aannemelijk is dat het oncogen EJ in alle cellen van het tumorweefsel aanwezig is en niet slechts in één cel of in een beperkt aantal cellen van de tumor.

8.4
Moleculaire

THEORIE

MUTATIES

Wat moet je kennen / kunnen?

• Je kunt werken met de codontabel in Binas / ScienceData en zo zelf een DNA-keten vertalen naar een aminozuurketen.

• Je kunt benoemen welke typen mutaties mogelijk zijn en je weet welk effect ze kunnen hebben.

Mutaties

Naar schatting treden er op moleculair niveau bij de mens in iedere cel per dag duizenden beschadigingen op aan het DNA. Deze beschadigingen kunnen de structuur van het DNA-molecuul aantasten, waardoor de transcriptie van een gen beïnvloed wordt. Andere beschadigingen leiden tot potentieel gevaarlijke mutaties. Gelukkig wordt de schade in de meeste gevallen gerepareerd door constant actieve DNA-herstelmechanismen (DNA-repairsystem).

DNA-schade kan spontaan of ten gevolge van normale metabolische processen gebeuren, maar ook door omgevingsfactoren. Omgevingsfactoren die mutaties kunnen veroorzaken, noem je mutagene factoren.

Voorbeelden zijn mutagene straling (zoals UV-straling), mutagene stoffen (zoals bepaalde gifstoffen) of, in een aantal gevallen aangetoond, bepaalde virussen.

Er zijn drie typen mutaties: 1 Ploïdiemutaties; dit zijn mutaties als gevolg van een verandering van het aantal chromosomen. Het haploïde aantal chromosomen kan in een cel in drievoud, viervoud of in meervoud voorkomen. In de meeste organismen komt in lichaamscellen een diploïde aantal chromosomen voor. Voorbeelden van deze mutaties zijn tarwe (hexaploïd = 6n), cultuuraardappel (tetraploïd = 4n) of suikerbiet (triploïd = 3n). Veel cultuurgewassen zijn ontstaan, doordat ooit dergelijke mutaties hebben plaatsgevonden. Ze komen voor zover bekend alleen bij planten voor. Ook kan het zijn dat één van de chromosomen in plaats van in tweevoud in drievoud voorkomt of zelfs ontbreekt. Dit is gebeurd bij het syndroom van Down (3x chromosoom 21) en het syndroom van Turner (één X-chromosoom i.p.v. XX of XY).

2 Chromosoommutaties; dit zijn veranderingen in de structuur van een chromosoom, bijvoorbeeld door het verkrijgen, verdubbelen, omkeren, verliezen of verplaatsen van een chromosoomsegment. Het verplaatsen van een chromosoomsegment hoeft voor het organisme in kwestie geen gevolgen te hebben, wanneer er niets verandert aan de samenstelling van het genoom. Alle genen zijn er immers nog, alleen de locus is gewijzigd. Andere typen chromosoommutaties kunnen wel ernstige gevolgen hebben.

3 Genmutaties; deze betreffen veranderingen in een gen. Er kan iets met een of meerdere nucleotiden gebeurd zijn. Soms is er één of zijn er enkele nucleotiden toegevoegd; dat heet een insertie. Is één nucleotide of zijn enkele nucleotiden uit een gen verdwenen, dan noem je dat een deletie. Wanneer ergens in een DNA-keten één enkele base verwijderd, vervangen of toegevoegd wordt, is sprake van een puntmutatie.

8.5
Moleculaire genetica Mutaties 8.5

Komt er een base bij of verdwijnt er een, dan treedt een verschuiving op in de basenvolgorde per triplet. De Engelse term voor deze verschuiving is frame-shift. Als het bewuste stuk DNA gebruikt wordt voor de aanmaak van mRNA, kan zo’n mutatie uiteindelijk leiden tot de productie van een verkeerd eiwit. Soms zijn deze genmutaties zonder gevolgen voor de functie van het eiwit waarvoor het codeert. Maar als door de mutatie de tertiaire structuur van het eiwit ingrijpend verandert, kan dit schadelijke gevolgen hebben voor de cel.

De ziekte van Huntington wordt veroorzaakt door een genmutatie: een bepaald triplet in het gen wordt vele malen herhaald. Het is een zogeheten ‘stotter-triplet’. Bij gezonde mensen is het aantal herhalingen tussen de 5 en 34 keer. Als er meer dan 40 herhalingen zijn (soms komt tot wel 180 voor!), ontwikkelt de persoon in kwestie de ziekte. In families waar deze ziekte voorkomt, neemt het aantal herhalingen in elke generatie toe, zodat ook de ernst van de aandoening toeneemt. Op www.huntington.nl vind je meer informatie over de ziekte van Huntington.

G G C C T C T A

G G C C C T A A

C C G G A G A U

C C G G G A U U

Figuur 15 Voorbeeld van een puntmutatie

Een thymine-base wordt vervangen door adenine. Hierdoor ontstaat een afwijkend hemoglobine-eiwit; dit leidt tot sikkelcelanemie.

Mutaties kunnen vooral schadelijk zijn in cellen die veel delen. De mutatie zal immers in elke dochtercel aanwezig zijn. Wanneer de mutatie in een voorloper van een geslachtscel optreedt, is sprake van een potentieel gevaarlijke situatie voor de nakomeling(en). Het erfelijk materiaal van de geslachtscel komt bij bevruchting terecht in de zygote. Uit de zygote ontstaat na vele delingen het uiteindelijke individu. Een mutatie in de zygote is daardoor in iedere cel van het organisme terug te vinden.

Niet iedere mutatie hoeft een schadelijk effect te hebben. Sommige mutaties zijn noch schadelijk noch gunstig. In de natuur komen mutaties voor waarbij het genotype van een organisme zodanig verandert dat dit organisme erfelijk beter is toegerust om zich te handhaven in een bepaald milieu. In dat geval zal het betere overlevingskansen hebben. Men noemt dit binnen de evolutietheorie ‘the survival of the fittest’ (zie § 26.4 ‘De evolutietheorie’).

DNA mRNA eiwit proline glutamine glutamine normaal hemoglobine
DNA mRNA eiwit proline valine glutamine sikkelcel-hemoglobine
Moleculaire genetica Mutaties 8.5

OEFENVRAGEN

Oefenvragen bij 8.5

1 Mutaties

Voor het beantwoorden kan je Binas 71G of ScienceData 16.9 gebruiken.

Niet alle mutaties zijn blijvend.

Hoe wordt het verschijnsel genoemd waarbij een mutatie in het DNA ongedaan wordt gemaakt?

2 Mutageen

Wat betekent het woord mutageen letterlijk?

3 Mutaties

Mutaties kunnen ontstaan door:

◯ straling, bepaalde mutagene stoffen of ‘zomaar’ (spontaan)

◯ bepaalde chemische stoffen, bacteriën of ‘zomaar’ (spontaan)

◯ alleen door straling of bepaalde mutagene stoffen

4 Mutagene stof

Geef een voorbeeld van een mutagene stof.

5 Spontane mutatie

Een mutatie die ‘spontaan’ ontstaat, heeft natuurlijk ook een oorzaak.

Noem er twee.

Moleculaire genetica Mutaties 8.5

6

Ploïdiemutaties

Ploïdiemutaties bij planten kunnen ‘spontaan’ ontstaan, maar ook door menselijk ingrijpen. Je kunt bloemen behandelen met een stof (colchicine), waardoor de metafase bij de meiose I niet plaatsvindt. Als je twee planten (2n) die zo behandeld zijn met elkaar kruist, krijg je nakomelingen die xn zijn.

Wat moet er voor x worden ingevuld?

7 Chromosoommutatie

Een chromosoommutatie waarbij een deel van een chromosoom verplaatst is, heeft voor dat individu geen gevolgen.

Is dat ook zo voor nakomelingen?

8 mRNA

De code van een stukje mRNA is: AUC GGC AAG.

Beantwoord de vragen.

a Voor welke aminozuren codeert dit stukje?

b Er vindt deletie plaats van de vierde base. Welke aminozuurvolgorde ontstaat er nu?

9 SNP’s

SNP’s zijn ook mutaties (zie paragraaf 8.3 ‘De genetische code’).

Wat is er bijzonder aan deze mutaties?

Moleculaire genetica Mutaties 8.5

TWEELINGONDERZOEK

Wat moet je kennen / kunnen?

• Je kunt uitleggen dat tweelingonderzoek belangrijk is om kennis te vergaren over eigenschappen die het gevolg zijn van milieufactoren of epigenetische invloeden.

THEORIE Tweelingonderzoek

Het milieu heeft grote invloed op de verschijningsvorm, het fenotype. De regel is immers: fenotype = genoom + milieu. Om te onderzoeken of en hoe een bepaalde eigenschap bij een mens door het genotype (het DNA dus) dan wel door het milieu bepaald wordt, doet men vaak tweelingonderzoek. Eeneiige tweelingen zijn grotendeels genetisch identiek aan elkaar. Onderlinge verschillen tussen deze tweelingen zijn bijna altijd toe te schrijven aan invloeden van buitenaf (milieufactoren). Een voorbeeld is de lichaamslengte van een eeneiige tweeling. De verschillen zijn onder andere toe te schrijven aan de hoeveelheid voedsel die opgenomen wordt, of ziekten die doorgemaakt zijn. Het feit dat eeneiige tweelingen onderling niet veel verschillen in lengte, geeft aan dat erfelijkheid bij deze eigenschap een grote rol speelt.

Als een bepaalde eigenschap bij eeneiige tweelingen niet van elkaar verschilt, ongeacht de verschillende milieu-invloeden, dan wordt deze eigenschap voor 100% genotypisch bepaald. Een voorbeeld is de bloedgroep. Deze is altijd gelijk bij eeneiige tweelingen. Bij de mens is met behulp van tweelingen uitvoerig onderzoek gedaan naar allerlei kenmerken. De tweelingen die daarvoor gebruikt worden, zijn:

1 eeneiige tweelingparen (ET) die zich onder gelijke uitwendige omstandigheden hebben ontwikkeld;

2 eeneiige tweelingparen die zich onder verschillende uitwendige omstandigheden hebben ontwikkeld;

3 twee-eiige tweelingparen (TT) die zich onder gelijke uitwendige omstandigheden hebben ontwikkeld;

4 twee-eiige tweelingparen die zich onder verschillende uitwendige omstandigheden hebben ontwikkeld.

De grootte van het verschil van een kenmerk uit groep 1 met hetzelfde kenmerk uit groep 2 is een maat voor de werking van het milieu bij gelijke erfelijke samenstelling.

De vergelijking tussen groep 1 en groep 3 geeft informatie over het gevolg van erfelijkheidsverschillen op de vorming van een kenmerk; de verschillen tussen TT en ET die in hetzelfde milieu zijn opgegroeid, moeten een erfelijke oorsprong hebben. Hoe kleiner de verschillen binnen eeneiige tweelingparen ten opzichte van die binnen twee-eiige tweelingparen, des te groter de rol van erfelijkheid.

Conclusies over het al dan niet erfelijk zijn van kenmerken kunnen, zo blijkt uit recente onderzoeken, niet altijd direct getrokken worden. Er kunnen veranderingen optreden in de genen na de bevruchting en na de splitsing van de bevruchte eicel. Ook kan de activiteit van genen veranderen, lang voor de geboorte, al dan niet door milieu-invloeden (zie § 8.2 ‘Transcriptie: DNA overschrijven’).

8.6
Moleculaire genetica Tweelingonderzoek 8.6

eerste tweelingbroer

180

160

140

120

100 80 60

180

160

Onderzochte lichaamskenmerken van de mens zijn onder andere: schedellengte, suikerstofwisseling (hoe reageert het lichaam op schommelingen van het suikergehalte in het bloed?), vatbaarheid voor allerlei besmettelijke ziekten, elektro-encefalogram (EEG), intelligentie (IQ), lichaamsgewicht, lichaamslengte en borstomvang. mg bloedsuiker per ml bloed uren

200 mg bloedsuiker per ml bloed 100 80 60

140

120

eeneiige tweeling twee-eiige tweeling tweede tweelingbroer eerste tweelingbroer tweede tweelingbroer uren

200 0 1 2 3 4 0 1 2 3 4

Figuur 16 Vergelijking tussen de suikerstofwisseling van eeneiige en twee-eiige tweelingen

Moleculaire genetica Tweelingonderzoek 8.6

THEORIE

ZIEKTEN WAARIN GENEN EEN ROL SPELEN

Wat moet je kennen / kunnen?

• Je kunt voorbeelden noemen van aandoeningen en ziekten waar genen een rol spelen.

• Je kunt uitleggen dat milieu-invloeden van buitenaf genbeschadigingen kunnen veroorzaken, waardoor aandoeningen of ziekten ontstaan.

Ziekten waarin genen een rol spelen Door uitgebreid erfelijkheidsonderzoek zijn bij de mens vele erfelijke ziekten ontdekt. Deze variëren van redelijk onschuldige afwijkingen, zoals kleurenblindheid tot ingrijpende afwijkingen, zoals bloederziekte of de ziekte van Huntington. Ook de verhoogde kans op bepaalde vormen van kanker kan erfelijk zijn. Op de site van erfelijkheid.nl vind je hierover informatie. Bij veel aandoeningen speelt overigens niet alleen iemands erfelijke aanleg een rol, vaak is ook een invloed vanuit het milieu aanwijsbaar.

Dankzij de toegenomen kennis op het gebied van de genetica hoopt men erfelijke ziekten te kunnen genezen of voorkómen door gezonde genen in te brengen. Dit noem je gentherapie. Gentherapie zal mogelijk in de toekomst op grotere schaal gebruikt kunnen worden Tot nu toe lukt het nog niet erg. Meestal blijkt het effect maar kort te duren en soms ontstaan er ernstige, ongewenste bijwerkingen. Wel kunnen patiënten met taaislijmziekte (cystic fibrosis, CF) tijdelijk geholpen worden, door een onschadelijk virus met het goede gen in te ademen. Dit moet echter steeds herhaald worden, de longcellen veranderen niet blijvend.

Iemand met ‘gezonde’ genen kan ziek worden door invloeden van buitenaf. Schadelijke milieu-invloeden kunnen de genen van weefselcellen beschadigen. Kleine asbestvezels bijvoorbeeld kunnen weefselcellen in longen en borstvlies bij de mens aanzetten tot ongecontroleerde deling. Dan is sprake van long- of borstvlieskanker. Bepaalde vormen van baarmoederhalskanker worden veroorzaakt door een infectie met het op zichzelf vrij onschuldige humaan papilloma virus (HPV). Het virus blijkt de celdeling in dat gebied te ontregelen.

Daarnaast zijn er meerdere stoffen die carcinogeen (kankerverwekkend) zijn. Vooral de laatste jaren streeft de overheid ernaar om deze stoffen niet meer te gebruiken in allerlei gebruiksgoederen. Een voorbeeld hiervan is dioxine, dat bekend staat als een van de meest giftige stoffen op aarde. Vroeger werd deze stof onder andere gebruikt in condensatoren. Dioxine komt ook vrij bij verbranding van organische stoffen bij te lage temperatuur. Dioxine ontregelt de celdeling al bij zeer lage concentraties. Een gevolg hiervan is dat de cel op hol slaat en ongecontroleerd gaat delen. Er is dan sprake van kanker. Een bepaalde vorm van huidkanker kan het gevolg zijn van overmatige blootstelling aan UV-straling van de zon.

Sommige mensen hebben door hun genetische aanleg een hoog cholesterolgehalte in het bloed (zie § 17.3 ‘Functies van de lever’). De bewuste erffactor werkt storend op het vermogen van de lever om de lipoproteïnegehaltes in evenwicht te houden. Wanneer cholesterol in te hoge concentraties in het bloed voorkomt, kan het zich gaan afzetten tegen de binnenbekleding van de bloedvaten (atherosclerose). Deze kunnen daardoor dichtslibben en een infarct veroorzaken.

8.7
spelen 8.7
Moleculaire genetica Ziekten waarin genen een rol

THEORIE

KLASSIEKE VEREDELINGSTECHNIEKEN

Wat moet je kennen / kunnen?

• Je kunt een aantal moderne technieken noemen die men gebruikt bij de plantenveredeling en het fokken van dieren.

• Je kunt een onderbouwde mening vormen over biotechnologie en het gebruik daarvan in de maatschappij.

• Je weet wat er bedoeld wordt met biotechnologische benadering van DNA en kunt van een aantal de mogelijkheden die daaruit voortkomen benoemen.

Klassieke veredelingstechnieken

Vanaf de tijd dat de mens landbouw ging bedrijven, verzamelde hij zaden van de beste planten en zocht hij de meest geschikte dieren uit als landbouwhuisdier. Op deze manier werden landbouwgewassen en landbouwhuisdieren langzaam maar zeker aangepast aan de wensen van de mens (domesticatie). In het begin verschilden geteelde planten of dieren niet wezenlijk van hun wilde verwanten. In de loop van de tijd kregen de gedomesticeerde planten en dieren andere erfelijke eigenschappen, doordat de mensen steeds de beste uitkozen; ze selecteerden op bepaalde genetische kenmerken. Daardoor verschillen gedomesticeerde planten en dieren genetisch nu sterk van hun wilde voorouders. Door de domesticatie ontwikkelden dieren eigenschappen die de wilde vormen nog niet hadden. Zo kregen schapen en guanaco’s veel meer wol dan in wilde staat en leggen onze kippen een groot deel van het jaar eieren, terwijl de bankivahoen, de voorouder van de kip, maar een klein aantal eieren legt. Een wilde appel is niet groter dan een kers!

Geleidelijk aan zijn mensen meer doelgericht gaan selecteren op specifieke gewenste eigenschappen. Op deze manier ontstonden rassen. Rassen zijn groepen gedomesticeerde planten of dieren die morfologisch en fysiologisch op elkaar lijken. Het onderscheid tussen rassen is niet eenduidig: soms is één genvariatie genoeg om van een ander ras te spreken, zoals bijvoorbeeld het gen dat de haarkleur beïnvloedt. Zo zijn door het selecteren op verschillende kenmerken overal ter wereld zogeheten landrassen ontstaan.

Klassieke technieken voor het verkrijgen van de gewenste erfelijke eigenschappen bij planten (plantenveredeling) en dieren (fokkerij) berusten op selectie en kruising. Pas toen de wetten van de erfelijkheid bekend werden, ging men begrijpen wat plantenveredeling en fokkerij nu eigenlijk inhielden.

Uit een groep organismen van dezelfde soort, maar met verschillende fenotypen worden organismen geselecteerd die de meest gunstige eigenschappen bezitten. Men hoopt dan dat deze gunstige eigenschappen grotendeels door het genotype worden bepaald. Selecteren vraagt veel geduld en is tijdrovend. Het duurt enige tijd voordat de nakomelingen zich ontwikkeld hebben. Van generatie op generatie moet vervolgens worden uitgezocht welke erfelijke eigenschappen in de nakomelingen aanwezig zijn en op welke manier deze eigenschappen in wisselende milieus tot uiting komen. De ontwikkeling van een aardappelras op de klassieke manier duurt wel 25 jaar! Bij het kweken van een zwarte tulp selecteert men bijvoorbeeld de donkerste exemplaren, die dan verder worden gekruist totdat uiteindelijk een kleur wordt verkregen die zwart benadert.

8.8
Moleculaire genetica Klassieke veredelingstechnieken 8.8

Wat gunstige eigenschappen zijn, wordt door allerlei factoren bepaald. Het ras moet liefst veel opbrengst leveren en tegen allerlei ziekten en plagen bestand zijn. Of gunstige eigenschappen ook altijd beter zijn, is de vraag. Men let meestal vooral op economisch aantrekkelijke eigenschappen, zoals bijvoorbeeld een goed uiterlijk: wel mooie appels, maar bepaald niet lekker geurend. De tijd en kosten die bij het ontwikkelen van het ras gemaakt zijn, moeten nu eenmaal terugverdiend worden. Vooral uniforme gewassen zijn gewild: even groot en tegelijk rijp, om ze mechanisch te kunnen oogsten en elk jaar een ongeveer even grote oogst, ondanks wisselende weersomstandigheden. Spruitjes (de dikke okselknoppen van spruitkool) werden oorspronkelijk van onder naar boven rijp. Bij de gekweekte spruitkool zijn alle spruitjes tegelijk rijp, even groot en staan ze een mechanische oogst toe. De meeste tomatenrassen zijn tegenwoordig hard, omdat men er in de supermarkt aan moet kunnen voelen, voordat ze gekocht worden. Daar moeten die tomaten wel tegen kunnen.

oorspronkelijke wilde koolsoort grote eindknoppen wit huidige koolsoort bloemkool broccoli spruitjes

aantallen bloemknoppen gegroepeerde kleine bladknoppen

groen

Figuur 17 Door jarenlange selectie is een grote variëteit aan koolsoorten verkregen.

Belangrijk is dat gewassen resistent zijn tegen parasitaire infecties (door schimmels, bacteriën, virussen, e.d.) of tegen aantasting door vraat. De gewenste resistentie is vaak te vinden bij de wilde verwanten. Tomatenplanten moeten bijvoorbeeld resistent zijn tegen het tomaat-mozaïekvirus (het virus vernietigt jaarlijks 15% van de oogst), tegen de bladschimmel Fusarium en tegen bruine wortelrot. De resistentie hiertegen is te vinden bij wilde soorten die nog voorkomen in Zuid-Amerika, waar de tomaat oorspronkelijk vandaan komt.

Hieruit blijkt dat het belangrijk is om een grote verscheidenheid aan genen, zoals die bij wilde planten voorkomt, te behouden. Eén van de economische argumenten om aan natuurbehoud te doen! Sinds februari 2008 is er op Spitsbergen een diepvrieskluis waar men zo’n 700.000 verschillende zaden ingevroren (-18 graden Celsius) bewaart.

Scan de QR-code en bekijk meer informatie over Svalbard Global Seed Vault.

In de land- en tuinbouw en de fruitteelt is het van belang dat het gewas zoveel mogelijk alle gunstige eigenschappen bezit die de landbouwer of tuinbouwer wenst. Dat betekent dat het ras genotypisch constant moet blijven. Dat kan bij sommige landbouwgewassen door vermeerdering via ongeslachtelijke voortplanting.

Moleculaire genetica Klassieke veredelingstechnieken 8.8

Een aardappelteler gebruikt ieder jaar pootaardappelen met hetzelfde genotype. In feite staat er dan op de akker een kloon van een zelfde aardappelras.

Maar bij de meeste land- en tuinbouwgewassen is ongeslachtelijke voortplanting niet mogelijk. Dat betekent dat veredelingsbedrijven ouderlijnen van kruisingen in stand moeten houden en telkens opnieuw zaad moeten leveren.

Figuur 18 Enten

Soms zijn ingewikkelde kruisingen niet nodig om toch de gewenste eigenschappen te krijgen. Tegen het eind van de 19de eeuw was vanuit Amerika een wortelluissoort in Frankrijk gekomen. Deze luis parasiteert op de wortels van planten van het geslacht Vitis De druivenplant behoort tot dat geslacht en bleek hoogst gevoelig: de Franse wijncultuur werd met de ondergang bedreigd. Toen de nood begon te klemmen, kwam iemand op de gedachte wilde Amerikaanse druivensoorten te gebruiken; deze waren al lange tijd aan de wortelluis gewend en dus redelijk resistent geworden. Maar voor kruisen was geen tijd, en de regels van de genetica waren nog niet bekend. Daarom besloot men de hoogwaardige Franse druiven te enten op de wortelstelsels van de resistente Amerikaanse druiven (zie figuur 18). En met succes. Nog altijd worden alle gekweekte druiven in Europa op zulke onderstammen geënt. Hetzelfde gebeurt met rozen (op onderstammen van hondsrozen), vruchtbomen en andere houtige tuinbouwgewassen.

Kloneren

Nakomelingen die ontstaan zijn door ongeslachtelijke voortplanting uit één organisme en daardoor allemaal hetzelfde genotype hebben, heten klonen. Bij veel soorten planten ontstaan van nature klonen, maar kloonvorming komt ook bij dieren en schimmels voor. De mens maakt gebruik van deze natuurlijke wijze van kloonvorming om gewassen te vermeerderen. Met behulp van moderne biotechnieken kan op grote schaal gekloneerd worden. Voorbeelden zijn weefselkweek, celfusie, kerntransplantatie of het gebruik van stamcellen. De verschillende methodes om klonen te verkrijgen, het kloneren, en de mogelijkheden voor het gebruik van verkregen klonen worden in deze en andere paragrafen besproken.

enttak onderstam
Moleculaire genetica Klassieke veredelingstechnieken 8.8

Scan de QR-code en bekijk eerst de animatie op Bioplek.

In de plantenwereld is kloneren betrekkelijk gemakkelijk. Vier belangrijke manieren van kloneren zijn:

1 het vermeerderen met behulp van knollen; 2 of van bollen; 3 stekken maken; 4 weefselkweek maken.

Een kloon vormen met knollen en bollen verloopt via de natuurlijke weg. Een kloon vormen via stekken en weefselkweek verloopt kunstmatig, omdat de mens daarbij actief ingrijpt.

Knollen zijn ondergrondse verdikte stengels waarin veel reservevoedsel opgeslagen wordt. Als een knol in de grond gezet wordt (men noemt dat poten), zal met behulp van het reservevoedsel in de knol een nieuwe plant uitgroeien. Zodra deze plant bladeren heeft, zal hij met behulp van zonlicht zelf voedsel kunnen maken. Een deel van dit voedsel wordt ondergronds in knollen opgeslagen. De nieuwe knollen hebben hetzelfde genotype als de ouderplant. Dit gebeurt o.a. met aardappelen en dahlia’s.

Bollen zijn samengedrongen stengels met dicht op elkaar staande vlezige bladeren. Bollen groeien ondergronds. Aan een bol, zoals die van de tulp of ui, ontwikkelen zich per jaar meerdere nieuwe bollen die na splitsing elk weer tot een plant kunnen uitgroeien. Ook in deze nieuwe ondergrondse bollen zit het reservevoedsel opgeslagen dat door de moederplant in de bovengrondse bladeren met behulp van zonlicht is gemaakt.

Figuur 19 Kloneren door middel van ondergrondse stengelknollen (= aardappels) Figuur 20 Kloneren door middel van bollen (hier bij de tulp)
Moleculaire genetica Klassieke veredelingstechnieken 8.8

Figuur 21 Kloneren door middel van uitlopers (bij de aardbeiplant)

Bij stekken wordt een stengeldeel van de moederplant afgenomen en in water of in natte aarde gezet. Onderaan de stengel groeien dan bijwortels, zodat zich een nieuwe plant kan ontwikkelen. Om de wortelvorming aan het stengeldeel te bevorderen wordt soms gebruik gemaakt van plantaardige groeihormonen (zie paragraaf 11.9 ‘Plantenhormonen’) die de celdeling versnellen; een voorbeeld is auxine. Stekken gebeurt bij veel soorten sierplanten, zoals de fuchsia, maar ook in kwekerijen voor buxusstruiken. De aardbei in de figuur vermeerdert zich door uitlopers, die je kunt beschouwen als natuurlijke stekken.

Voor- en nadelen van kloneren in de landbouw

Bij het kloneren worden nakomelingen verkregen met hetzelfde erfelijke materiaal als dat van de ouder. Op deze wijze worden de gunstige eigenschappen van de ouder gehandhaafd bij de nakomelingen. Land- en tuinbouwgewassen worden net zo lang geslachtelijk doorgekweekt en geselecteerd, totdat de gewenste combinatie van erfelijke eigenschappen gevonden is. Vervolgens wordt het gewas door kloneren verder vermeerderd, als dat mogelijk is. Voordeel hiervan is dat alle planten van dat ras dezelfde gewenste eigenschappen hebben. Een nadeel is dat er geen erfelijke variatie binnen het ras is en bij veranderende milieuomstandigheden (bijvoorbeeld klimaatverandering) alle planten even slecht zijn aangepast aan het milieu. Treedt er een nieuwe ziekte of plaag op, dan zijn alle organismen van dat ras daar gevoelig voor. Daardoor is het ras kwetsbaar. Rassen bestaan om die reden niet eeuwig. Je hebt nu bijvoorbeeld veel andere aardappelrassen dan twintig jaar geleden.

Dieren fokken

Het kunstmatig kloneren van dieren is alleen goed mogelijk met lagere dieren, zoals bijvoorbeeld eencellige dieren, holtedieren en bepaalde soorten wormen, vissen en amfibieën. Bij zoogdieren is het veel moeilijker. Er zijn wel zoogdieren gekloneerd, zoals het beroemde schaap Dolly, maar dit is zo duur en omslachtig dat het voor de praktijk niet van belang is. Het fokken en selecteren van de ‘beste’ (landbouw)huisdieren berust dan ook op geslachtelijke voortplanting. Daarbij worden telkens die dieren gekruist die bepaalde gewenste eigenschappen hebben. Voorbeelden van gewenste eigenschappen zijn: niet-agressief (sommige hondenrassen), hoge melkproductie (runderen), snel of juist sterk (paarden). De nakomelingen uit deze kruisingen zijn telkens weer geselecteerd op gewenste eigenschappen. Zo zijn de koeienrassen ontstaan die buitensporig veel melk geven, de zeer snelle paarden en de enorme variatie aan duiven-, katten- en hondenrassen. Zie voor die laatste bijvoorbeeld de site van Wikipedia of Hondenplaza.

Moleculaire genetica Klassieke veredelingstechnieken 8.8

Om het ras uniform te krijgen worden verwante dieren gekruist. Het is dus een vorm van inteelt. Dat heeft ook het gevolg dat hondenrassen nogal eens lijden aan ziekten en afwijkingen.

Het fokken van nieuwe rassen kost vanzelfsprekend veel tijd: het duurt wel even voor een koe volwassen genoeg is om kalveren te krijgen, met andere woorden de generatietijd is lang. Voorlopig zijn er voor het fokken van dieren met een lange generatietijd geen alternatieven om het proces te versnellen.

Moderne voortplantingstechnieken

Kunstmatige inseminatie (KI) heeft een geweldige invloed gehad op de intensieve fokkerij. Vroeger ging een fokstier of fokbeer (mannetjesvarken) letterlijk van het ene naar het andere bedrijf om vrouwtjes te dekken. Nu blijft een kampioenstier op het KI-bedrijf en wordt zijn sperma verzameld en bij tien-, zelfs honderdduizenden koeien ingebrachtwereldwijd.

Een andere veelgebruikte techniek is embryotransplantatie. Bij vrouwelijke dieren van goede kwaliteit wordt een superovulatie (d.w.z. dat er veel eicellen tegelijk rijpen) opgewekt. Na bevruchting worden de embryo’s ingeplant bij diverse draagmoeders. Bij sommige diersoorten (varkens en pluimvee) gebeurt het genetische werk door kleine gespecialiseerde centra. Zij leveren hun meest productieve dieren aan vermeerderingsbedrijven. Deze bevoorraden de producenten. Bij runderen wordt het fokken gecombineerd met het houden van melk- of vleesvee. Aan de hand van catalogi bepaalt de veehouder welk sperma hij wil gebruiken.

Door deze voortplantingstechnieken neemt de genetische diversiteit van een ras af. Voor het zwartbonte Holsteinrund is berekend dat de populatiegrootte van al die miljoenen koeien die over de hele wereld geteeld worden, is te herleiden tot 50! Wanneer er door fokken dieren met goede eigenschappen zijn ontstaan, is kloneren een mogelijkheid om genetisch dezelfde dieren met allemaal dezelfde voedselbehoefte en producten van dezelfde kwaliteit te krijgen. Er lopen inmiddels al kloonkoeien rond in Texas. Maar het kloneren zelf is problematisch: het lukt maar heel zelden en 25% van de klonen heeft allerlei problemen. En een groep genetisch identieke dieren is extra kwetsbaar voor besmettelijke ziekten.

Behoud diversiteit

Een fokker is meer gebaat bij een grote genetische diversiteit; om die reden wordt het steeds belangrijker om oude rassen als reservoir van potentieel interessante eigenschappen te bewaren. Genetische diversiteit is noodzakelijk voor aanpassing van onze landbouwgewassen en -huisdieren aan nieuwe ziekten, veranderende productiemethodes (biologische landbouw), een veranderend klimaat of nieuwe wensen van de consument. Deze genetische diversiteit die in de landbouwpraktijk van vele eeuwen tot stand is gekomen, gaat wereldwijd sterk achteruit. Deze achteruitgang vormt een belangrijke bedreiging van de toekomstige wereldvoedselvoorziening en beperkt de mogelijkheden voor verduurzaming van de landbouwproductie.

Om plantaardige en dierlijke genetische bronnen te behouden worden wereldwijd collecties van genetisch uitgangsmateriaal van gewassen en landbouwhuisdieren verzameld en bewaard in zogenaamde genenbanken (zie tabel 3, bron: http://www.cgn.wur.nl/).

Moleculaire genetica Klassieke veredelingstechnieken 8.8

Soort    Aantal rassen/lijnen   Aantal dieren   Aantal spermarietjes    rund 9 4585 181.753 hond 2 10 162 geit 2 30 3.820 paard 5 59 10.906 varken 16 519 69.981 pluimvee 20 270 18.827 schaap 7 228 23.810

Tabel 3 Aantal rassen/lijnen per diersoort in de genenbank WUR (2010)

Weefsel kweken

In 1907 zag R. Harrison axonen uitgroeien in stukjes embryonaal zenuwweefsel van een kikker, dat op een glaasje in leven werd gehouden. Sindsdien heeft de weefselkweek zich ontwikkeld tot een onontbeerlijk hulpmiddel in vele takken van de biologische wetenschap. Doordat cellen, weefsel en organen buiten het organisme geen gebruik kunnen maken van de natuurlijke afweermechanismen, zijn ze weerloos tegen tal van infecties. Tot 1940 ontwikkelde de weefselkweek zich daarom traag, doordat antibiotica ontbraken. In de weefselkweek onderscheidt men celculturen (kweek van losse cellen, bijvoorbeeld voor de bereiding van virusvaccins), weefselculturen (vooral voor biochemisch en fysiologisch onderzoek) en orgaanculturen. Alle drie vereisen specifieke omstandigheden en verschillende technieken.

Een uitzondering op het verschijnsel dat menselijke cellen moeilijk gekweekt kunnen worden, zijn de zogenoemde HeLa-cellen. HeLa staat voor Henriëtta Lacks, een vrouw die in 1951 een bijzonder agressieve vorm van baarmoederhalskanker kreeg en daaraan overleed. In de tijd dat zij in het ziekenhuis lag (in Virginia, VS), was men aan het proberen menselijke cellen te kweken. Het zoeken naar een geschikt kweekmedium en geschikte kweekomstandigheden verliep uiterst moeizaam. De behandelend arts van Henriëtta meende dat kankercellen een goede kans van slagen hadden: zij delen immers gemakkelijk. Ongevraagd (!) nam hij daarom bij zijn patiënte monstertjes (biopten) van het kankerweefsel, om vervolgens te proberen deze cellen in leven te houden. De naam van zijn celkweken leidde hij af van de naam van zijn patiënte. Na de vele mislukkingen lukte de kweek van de HeLa-cellen uiteindelijk.

Moleculaire genetica Klassieke veredelingstechnieken 8.8

Figuur 22 HeLa-cellen

Sindsdien zijn HeLa-cellen voor wetenschappelijk onderzoek niet meer weg te denken: het is de belangrijkste cellijn van menselijke cellen die gebruikt wordt voor het testen van onder andere geneesmiddelen, toevoegingen aan voedsel en cosmetica.

Steeds meer laboratoria beheersen de kunst van het kweken van dierlijke cellen. Die kweken worden onder andere gebruikt voor het maken van vaccins en het testen van geneesmiddelen.

Scan de QR-code en lees meer over HeLa-cellen op Wikipedia.

Een weefselkweek van plantaardige cellen moet onder speciale omstandigheden worden gemaakt. Een cel of groep cellen van een wortel- of stengeltop wordt uit een plant genomen en op een speciale voedingsbodem gebracht. Onder de juiste kweekomstandigheden (temperatuur, licht, vocht) en na toevoeging van de juiste hormonen in een bepaalde concentratie zal zich na verloop van tijd uit de ene opgenomen cel een nieuw organisme ontwikkelen. Het is van belang dat er geen infecties optreden van schimmels of van andere organismen in het kweekmateriaal.

In korte tijd zijn veel nakomelingen te verkrijgen, meer dan bij andere ongeslachtelijke vermeerderingsmethodes, zoals stekken.

De laatste jaren is de techniek voor het kweken van weefsel met sprongen verbeterd. Veel plantensoorten worden tegenwoordig via weefselkweek vermeerderd. Dat een orchidee voor op de vensterbank tegenwoordig niet zo duur meer is, hebben we te danken aan de weefselkweektechniek, waardoor de planten in grote hoeveelheden op de markt gebracht kunnen worden. Gunstig effect is ook dat het importeren van wilde orchideeën uit tropische bossen overbodig geworden is.

© Shutterstock / Heiti Paves
Moleculaire genetica Klassieke veredelingstechnieken 8.8

THEORIE

MODERNE TECHNIEKEN

Wat moet je kennen / kunnen?

• Je kunt een aantal moderne technieken noemen die men gebruikt bij de plantenveredeling en het fokken van dieren.

• Je kunt een onderbouwde mening vormen over biotechnologie en het gebruik daarvan in de maatschappij.

• Je weet wat er bedoeld wordt met biotechnologische benadering van DNA en kunt van een aantal de mogelijkheden die daaruit voortkomen benoemen.

Moderne technieken

In de twintigste eeuw werden enorm veel technieken ontwikkeld om de productie van stoffen op welke manier dan ook steeds groter te maken.

Na de ontdekking van de structuur van het DNA en de opheldering van het menselijk genoom raakten ontwikkelingen in een stroomversnelling. Vooral de kennis van het DNA en alles wat ermee samenhangt heeft steeds nieuwe toepassingen opgeleverd. En het onderzoek gaat in sneltreinvaart verder; door verregaande automatisering kunnen onderzoeken een grote vlucht nemen.

Binnen veel contextgebieden hebben nieuwe gentechnieken, genetische modificaties en biotechnologieën grote impact, denk bijvoorbeeld aan de levensmiddelentechnologie (voedselproductie) en gezondheidszorg (geneesmiddelenproductie, humane genetica).

Plantenveredeling

Om nieuwe variëteiten te ontwikkelen gebruikt de plantenveredelaar de wereldwijd beschikbare diversiteit binnen de lokale landrassen en van de nog levende wilde voorouders van gedomesticeerde soorten, in combinatie van moderne veredelingstechnieken. Hierna bespreken we enkele veredelingsmethodes.

Heterosis en hybriden

Amerikaanse maïsveredelaars ontdekten aan het eind van de negentiende eeuw dat nakomelingen van twee vrijwel homozygote maïsplanten (verkregen door inteelt) nakomelingen opleveren die een veel sterkere groeikracht hadden dan die van de ouders en zelfs van de oorspronkelijke populatie. Dit verschijnsel heet heterosis ofwel hybride groeikracht. Plantenrassen die via kruising van inteeltlijnen ontstaan noem je hybriden Hybriden zijn in allerlei opzichten uniform: alle planten en/of vruchten hebben dezelfde afmetingen en vorm, en rijpen tegelijk af. Dit laatste verkort de oogstperiode. Ook verpakken en afhandelen verloopt door de uniformiteit soepeler. Een groot nadeel is dat de heterosis (en dus de uniformiteit) zich in de volgende generatie niet voortzet. Het zaad van de hybriden is door geslachtelijke voortplanting ontstaan, waardoor recombinatie is opgetreden en de volgende generatie weer even variabel zou zijn als oorspronkelijke (niet-homozygote) populatie. De boeren kunnen dus het zaad van de hybriden niet gebruiken en zijn afhankelijk van de kwekers die hen ieder jaar nieuw hybridenzaad moeten leveren. Op deze manier werd (en is) de markt zeer interessant voor zaadbedrijven.

8.9
Moleculaire genetica Moderne technieken 8.9

Het ontwikkelen van hybriden vergt veel tijd, geld, land en menselijke organisatie. De cruciale fase is het kruisen van twee inteeltlijnen. De moederlijn mag geen stuifmeel produceren, zodat alleen bestuiving door de andere inteeltlijn plaatsvindt. Het is nu ook mogelijk om haploïde planten op te kweken uit stuifmeelkorrels of eicellen. Door het chromosoomaantal te verdubbelen tot diploïd ontstaan volledig homozygote planten. Daardoor is het maken inteeltlijnen veel eenvoudiger geworden.

Mutatie-inductie

Om meer variatie te creëren maken veredelaars gebruik van mutatie-inductie. Hierbij wordt de natuurlijke mutatiefrequentie aanzienlijk verhoogd door de cellen/ weefsels te behandelen met mutagene stoffen of mutagene straling. Deze behandelingen leveren weliswaar veel mutaties op, maar vele daarvan zijn niet bruikbaar. Er is veel selectie nodig om uit een populatie die door mutatie-inductie is ontstaan de bruikbare mutanten te halen. Mutanten zijn individuen, waarbij uit hun fenotype blijkt dat hun erfelijke informatie gemuteerd is.

Nadat bekend werd dat een aantal land- en tuinbouwgewassen van nature polyploïd zijn (zie paragraaf 8.5 ‘Mutaties’) - bijvoorbeeld aardappel (4n), tarwe (6n) en aardbei (8n) -, is geprobeerd andere landbouw- en tuinbouwgewassen door mutatie-inductie polyploïd te maken. De gedachte hierachter was dat meer chromosomen in de kern grotere cellen en daardoor grotere organen opleveren. Er is wel tetraploïde spinazie ontwikkeld (deze slinkt minder in de pan bij het koken); maar de meeste pogingen om gewassen polyploïd te maken hebben niets opgeleverd.

Merkergeassisteerde veredeling Eén van de belangrijkste stappen in een veredelingsprogramma is het selecteren van de meest interessante nakomelingen, die als uitgangsmateriaal dienen voor een nieuwe kruisingsronde. Daarbij letten veredelaars op nieuwe gunstige eigenschappen. Deze zijn lang niet altijd zichtbaar met het blote oog of worden dat pas na lange tijd, zoals de kleur of smaak van vruchten. Hierbij kunnen DNA-merkers een oplossing bieden. Dat zijn stukjes DNA die gekoppeld zijn aan een gewenst gen, gemakkelijk zijn op te sporen en waarvan de overerving van generatie op generatie gevolgd kan worden. Er zijn verschillende technieken om DNA-merkers op te sporen. Door het gebruik van DNA-merkers is de energie en tijd die nodig is voor kruisingen verminderd. Bij de veredeling zonder gebruik van gentechnologie duurt het maken van een nieuw ras meer dan tien jaar. Omdat tegenwoordig het ene na het andere genoom op de kaart gezet wordt, gaat het vinden van goede merkers voor gewassen steeds sneller.

Scan de QR-code en bekijk hierover de Bio-bits-film (duur: 15 minuten).

Transgene gewassen

Dit zijn gewassen waarbij met behulp van recombinant DNA-technologie veranderingen in eigenschappen zijn aangebracht. Door genoomanalyses wordt bij veel gewassen achterhaald welk stuk DNA verantwoordelijk is voor een bepaalde eigenschap. Met behulp van knip- en plakenzymen en een methode om het genetische materiaal over te brengen worden planten van gewenste genen voorzien. Genetische modificatie maakt jarenlang kruisen overbodig. Bovendien worden de soortbarrières vaak overschreden; ‘gewone’ kruisingen zijn immers alleen mogelijk tussen organismen die sterk verwant zijn. Er zijn veel handelingen nodig om planten genetisch te modificeren; de nieuwe genen komen meestal maar in enkele cellen terecht. Via weefselcultures groeien deze cellen uit tot een transgene plant. Er is een screening nodig om te zien of de cellen gemodificeerd zijn of niet. Hierbij wordt ook weer gebruik gemaakt van merkers.

Moleculaire genetica Moderne technieken 8.9

In Europa bestaat veel bezwaar tegen het telen van transgene gewassen. Toch is het gebruik van transgene planten wereldwijd groot. In de bezwaren die mensen hiertegen hebben, wordt geen onderscheid gemaakt tussen genetische modificatie waarbij het genetisch materiaal afkomstig is van niet-verwante soorten (transgeen) of uit dezelfde soort of een verwante soort (cisgeen). Maar bij de veredeling die al duizenden jaren is toegepast, zijn soorten ook genetisch veranderd. Door de moderne technologie gebeurt het verbeteren van soorten nu veel sneller en effectiever. Het bezwaar dat sommige mensen aandragen, dat het ‘tegennatuurlijk’ is, gaat voorbij aan het feit dat het ook in natuurlijke omstandigheden voorkomt. Denk bijvoorbeeld aan de virussen die stukken DNA in genomen van gastheercellen plaatsen.

Scan de QR-code en bekijk de animatie op Bioplek.

Moleculaire technieken in de fokkerij Kwantitatieve eigenschappen, zoals het geven van melk of de productie van vlees, worden door diverse factoren bepaald. De opbrengst hangt enerzijds af van uitwendige invloeden, zoals het klimaat en de hoeveelheid en kwaliteit van het voedsel. Anderzijds zijn meerdere genen bij een eigenschap betrokken. Met moleculaire technieken is inzicht te verkrijgen over welke genen dat precies zijn en waar ze zich binnen het genoom bevinden. Daar zijn kruisingswerk, statistische verwerking en enorm veel tijd voor nodig.

Door het gebruik van DNA-merkers en genoomanalyse (zie paragraaf 8.1 ‘De structuur van DNA’) is het mogelijk deze genen te identificeren. Door snelle DNA-testen zijn de eigenschappen van een embryo te achterhalen. Naar schatting kan de efficiëntie van het fokken met zo’n 10 tot 20% worden verhoogd door gebruik van moleculaire technieken.

Ook gentechnologie is te gebruiken voor het genetisch modificeren van dieren. Traditioneel worden transgene dieren gekruist met niet-transgene dieren. De nakomelingen hebben dan niet allemaal het vreemde gen. Door het combineren van kerntransplantatie met genetisch modificeren wordt de efficiëntie verbeterd. Het bewuste gen kan ook ingebracht worden in embryonale stamcellen. Uit de stamcellen die het gen opgenomen hebben, worden de cellen geselecteerd die het gen op de gunstigste plaats in het genoom hebben geïntegreerd. De kern uit elke geselecteerde cel wordt dan in een lege eicel, die tot embryo uitgroeit, geplaatst.

De kranten hebben vol gestaan over koeien die melk zouden gaan produceren met daarin een bepaald eiwit, lactoferrine, een middel tegen ontstekingen. De vader van deze koeien, de stier Herman, was voorzien van het menselijke gen dat voor lactoferrine codeert. Herman was dus een transgene stier.

Forensisch onderzoek

Forensisch onderzoek helpt bij het opsporen van de daders of de oorzaken van (mogelijke) misdrijven in het kader van strafrechtelijke bewijsvoering. Een belangrijk instrument dat bij identificatie en opsporing van mogelijke daders gebruikt wordt, is het DNA-profiel. Ook vaak DNA-fingerprint genoemd.

Elk mens heeft in zijn DNA unieke stukjes, die samen een persoonlijke code vormen, vergelijkbaar met je vingerafdrukken. Het DNA bevat niet-coderende stukken binnen de genen, zoals de introns en de short tandem repeats, de STR’s.

Moleculaire genetica Moderne technieken 8.9

Delen van het niet-coderend DNA bestaan uit herhalingen van DNA-sequenties, alsof het DNA hier begint te stotteren. Deze stukjes DNA, de STR’s, zijn uniek voor ieder mens. Nadat dit 1984 bekend werd, ontwikkelde men in 1984 een methode om iemands genetische vingerafdrukte bepalen.

Een paar maanden later al, in 1985, werd de methode in een rechtszaak gebruikt. Het betrof de zaak van een Afrikaanse jongen die door de Britse immigratiedienst niet werd toegelaten. De DNA-test bewees dat de vrouw die hem in Engeland wilde opnemen zijn tante was. Zes maanden later werd DNA-profiel voor het eerst gebruikt in een strafzaak tegen een man die werd verdacht van de verkrachting en moord op twee jonge meisjes. Het vaginale vocht van de meisjes werd onderzocht en vergeleken met zijn DNA-monsters. Hij bleek onschuldig te zijn. Beide zaken, begeleid door veel publiciteit, zorgden voor een vliegende start van de DNA-fingerprintmethode.

Figuur 23 Vergelijken van DNA-profielen DNA-profielen van het slachtoffer (Lane 1), van materiaal gevonden op het plaats delict (Lane 2) en van verdachten. Verdachte 1 (Lane 3) is de dader.

Niet lang daarna werd de polymerase-kettingreactie (PCR) uitgevonden, een methode om DNA-fragmenten miljoenen keren te vermenigvuldigen (zie paragraaf 8.1 ‘De structuur van DNA’). Vanuit één molecuul DNA of RNA zijn oneindig veel identieke moleculen te maken. Vaak is op de plaats van het misdrijf maar weinig DNA aanwezig of het is erg beschadigd. PCR maakte het mogelijk de DNA-fractie te vermenigvuldigen. Hierdoor kan met heel weinig DNA van de mogelijke dader (een haar of een spoortje bloed) toch de identiteit worden vastgesteld.

gevonden DNA slachtoffer verdachte 1 verdachte 2
Moleculaire genetica Moderne technieken 8.9

Mensen erven van beide ouders STR’s, die vaak verschillend van lengte zijn. In het DNA-profiel van een kind komen de erfelijke kenmerken van beide biologische ouders tot uiting. In figuur 24 staat een voorbeeld van variabele fragmenten in vier verschillende genen van een ouderpaar en één van hun kinderen.

Figuur 24 DNA-profielen van een moeder, kind en man Gebaseerd op DNA-polymorfismen in de allelen van vier verschillende genen. De blauw omlijnde allelen zijn afkomstig van de moeder en de rood omlijnde allelen van de man.

DNA-databanken

Of DNA van een bepaalde persoon afkomstig is, kan alleen worden vastgesteld wanneer het overeenkomt met DNA dat zeker van die persoon is. Sinds 1985 zijn daarom in veel Europese landen DNA-databanken opgericht.

Regels voor de afgifte van DNA en het opnemen van DNA-profielen in een databank zijn niet overal hetzelfde. In Nederland houdt de afdeling biologie van het Nederlands Forensisch Instituut (NFI) zich bezig met het DNA-onderzoek in strafzaken. Vóór 1994 werd alleen DNA-onderzoek gedaan als de verdachte meewerkte. Na dat tijdstip was weigeren niet meer mogelijk. In de Nederlandse DNA-databank worden automatisch DNA-profielen opgenomen van verdachten, veroordeelden, ex-gedetineerden (op vrijwillige basis), overleden slachtoffers en van sporen aangetroffen op een ‘plaats delict’ Het NFI is verantwoordelijk voor de opname van de DNA-profielen in de databank. Indien op een ‘plaats delict’ meerdere malen hetzelfde DNA-profiel wordt aangetroffen, wordt het slechts één maal opgenomen in de DNA-databank. Alle nieuw in de DNA-databank opgenomen DNA-profielen worden vergeleken met alle daarin reeds aanwezige DNA-profielen. De gegevens van een verdachte blijven alleen in de DNA-databank als zij nadien veroordeeld worden. In Nederland bevatte de databank begin 2015 meer dan 100.000 monsters.

Een DNA-databank zou in principe helemaal los kunnen staan van een ‘crimineel bestand’. Je zou ze kunnen zien als uitbreiding van je geboortebewijs, als biologische identiteitskaart, waarbij je een zogenaamde DNA-pincode kunt gebruiken. Het zou kunnen zijn dat in de toekomst door op de voordeur te spugen of hem aan te raken de deur vanzelf open gaat. De databank moet dan wel van goede waarborgen worden voorzien, door onafhankelijke instanties worden beheerd met versleutelde DNA-pincodes.

9
Moeder Vader Kind 9 9 9 9 12 12 12 12 10 10 13 12 11 11 11 11 4 4 4 4
D55418 D75420 D145539 Penta D
Moleculaire genetica Moderne technieken 8.9

Hoe betrouwbaar is het DNA-profiel?

De uitkomst van een DNA-vergelijking wordt gegeven in termen van waarschijnlijkheid. De betrouwbaarheid van de DNA-test wordt groter naarmate het gebruikte DNA vollediger is. De kans dat twee personen hetzelfde DNA-profiel hebben, is altijd kleiner dan 1 op 109 (1.000.000.000). Ook het DNA van familieleden kan gebruikt worden voor identificatie. Van iemand die voor het eerst is opgepakt, is nog geen DNA beschikbaar. Dan kan zijn DNA vergeleken worden met dat van een naaste verwant. De methode blijkt statistisch nog zwak.

Gerechtelijke dwalingen zijn lang nog niet uitgesloten. De moordzaak in de USA waarmee O.J. Simpson bekend werd, werd opnieuw geopend. Het voorgaande onderzoek was een opeenstapeling geweest van onkundig gebruik van DNA-materiaal. Ook in Nederland zijn er dubieuze veroordelingen geweest, zoals de Puttense moordzaak. In Amerika is in 1992 het Innocence project gestart, waarbij rechtenstudenten oude zaken van ter doodveroordeelden en van verkrachting beschuldigden analyseerden. Al spoedig toonden de studenten de onschuld aan van een ter dood veroordeelde, omdat het toenmalige DNA-bewijs zeer zwak was.

Bij het DNA-onderzoek is een intensieve controle nodig om verontreiniging van monsters tegen te gaan. Elk individu is in het bezit van DNA. Als er op de plaats van het misdrijf sporen gevonden worden, hoeven die niet per se van de dader afkomstig te zijn. En het is ook mogelijk om bewust te misleiden: je kunt iemands koffiebekertje ergens neerzetten, zijn of haar peuken uitstrooien bij het misdrijf of een condoom met sperma leeggooien.

Een bekend geval is ‘dader X’. In een groot aantal misdrijven werd bij het sporenonderzoek telkens hetzelfde DNA gevonden. Deze persoon, ‘dader X’ genoemd, werd maar niet gevonden. Uiteindelijk bleek het DNA afkomstig van een vrouw, die in een bedrijf werkte waar de wattenstokjes voor het DNA-fingerprint-onderzoek gefabriceerd werden. Om die reden zijn bij het Nederlands Forensisch Instituut (NFI) ook alle DNA-profielen opgeslagen van de personeelsleden van het NFI.

Biotechnologie

Biotechnologie is het gebruik van organismen of onderdelen van organismen in technische processen. Het woord biotechnologie bestaat uit twee delen: bio dat aangeeft dat het met leven te maken heeft en technologie wat laat zien dat er menselijke vaardigheid en kennis aan te pas komen. In de biotechnologie worden (micro-)organismen of onderdelen van organismen gebruikt voor de productie van stoffen. Hierbij kun je onderscheid maken tussen klassieke biotechnologie en moderne biotechnologie.

Het maken van kaas, wijn en zuurkool en het laten rijzen van brooddeeg zijn voorbeelden van klassieke biotechnologie. Organismen (zoals gist, melkzuurbacteriën) worden daarbij op een natuurlijke manier gebruikt om een bepaald product te maken. Aan klassieke biotechnologie wordt elders aandacht besteed, onder andere in § 12.4 ‘Dissimilatie’).

Bij moderne biotechnologie is de aanpak anders. Daarbij worden organismen genetisch veranderd, zodat ze voor een bepaald doel te gebruiken zijn, bijvoorbeeld voor de productie van een enzym. Dit heet genetische modificatie. Moderne biotechnologie is niet meer weg te denken uit onze samenleving. Denk bijvoorbeeld aan de enzymen in wasmiddelen die met behulp van moderne biotechnologie zijn ontwikkeld. Of aan de productie van geneesmiddelen, zoals insuline. Of aan de productie van zoetstoffen, die worden gebruikt in ‘light’ producten. De productiviteit van penicilline door de gist Penicillium is door gentechnologie en verbetering van het productieproces meer dan 5000 maal toegenomen, sinds de allereerste productie in de veertiger jaren van de vorige eeuw.

Moleculaire genetica Moderne technieken 8.9

Biotechnologie wordt in allerlei contexten toegepast: in het medische vakgebied, de agrarische bedrijfstakken en ter vervanging van (petro-)chemische productie.

Recombinant-DNA-technologie

Met behulp van de gentechnologie zijn genen te identificeren, te isoleren en te kloneren. Daardoor is het mogelijk om DNA-fragmenten opnieuw te combineren: de recombinant-DNA-technologie. De techniek maakt gebruik van plasmiden en restrictie-enzymen (knipenzymen) en ligases (plakenzymen).

Plasmiden zijn kleine, ringvormige stukjes DNA die naast het grote ringvormige DNA-molecuul in bacteriën voorkomen. Plasmiden kunnen zich onafhankelijk van het chromosomale DNA van de bacterie repliceren. Met hulp van plasmiden kunnen bacteriën genen met soortgenoten of zelfs met andere soorten bacteriën uitwisselen. Restrictie-enzymen spelen een rol in de natuurlijke afweer van bacteriën tegen virussen. Ze kunnen DNA ‘openknippen’; daarom noem je ze knipenzymen. De restrictie-enzymen schakelen een binnengedrongen virus uit door zijn DNA stuk te knippen. Waar de knip gebeurt, ontstaan twee uiteinden, die sticky ends (kleverige eindjes) worden genoemd. Ligases zijn enzymen die in staat zijn gebroken DNA-strengen te repareren, aan elkaar te ‘plakken’. Vandaar dat ze plak-enzymen worden genoemd. Vooral de sticky ends worden gemakkelijk aan elkaar geplakt.

De recombinant-DNA-techniek verloopt als volgt (hierna uitgebeeld bij het menselijke gen dat voor insuline, zie § 19.11 ‘Suikerziekte’, codeert):

• Een plasmide wordt met behulp van restrictie-enzymen opengeknipt.

• Een stuk DNA met het insulinegen wordt uit het menselijke DNA geknipt en met behulp van ligase in de plasmide geplakt.

• De plasmiden worden opgenomen door bacteriën die in cultuur gebracht worden en zich vele malen delen. Zo ontstaan er miljoenen bacteriën met het gerecombineerde plasmide.

• De bacterie is transgeen geworden door genetische modificatie. Transgeen betekent dat er een gen van een ander soort organisme is ingebracht.

Scan de QR-code en bekijk de animatie op Bioplek.

Moleculaire genetica Moderne technieken 8.9

stukje (menselijk) DNA met code voor insuline (na behandeling met restrictie-enzymen)

T T

A A A A

T T

bacterie plasmide

“bacterie DNA’ met ingebouwde code voor insuline

Figuur 25 Recombinant-DNA-techniek

door inwerking van restrictie-enzymen opengeknipt

bacterie neemt plasmide op

insulineproductie door bacterie

Om insulineproducerende bacteriën te kweken. In de figuren is heel schematisch weergegeven hoe recombinant-DNA-techniek in zijn werk gaat. De techniek is in werkelijkheid minder simpel; vaak zijn veel pogingen nodig voor het goed lukt. Een probleem is dat een bacterie niet altijd de gemodificeerde plasmide opneemt. Daarom brengt men behalve het gewenste gen ook een gen in dat de bacterie ongevoelig maakt voor antibiotica.

A A A A
T T
T T
A A T T A A T T A A T T A A T T
A A T T A A T T
Moleculaire genetica Moderne technieken 8.9

Van bacteriën die na behandeling met antibiotica blijven leven, weet je zeker dat de genen in de plasmiden zijn ingebouwd (zie figuur 26).

plasmide bacterie niet alle bacteriën nemen de plasmide op voedingsbodem met antibiotica uit bacteriën met de plasmide ontstaan kolonies gen voor antibioticumresistentie

gewenst gen

Figuur 26 Selectie van bacteriën die in hun plasmiden een recombinant-DNA ingebouwd hebben

Om het stukje recombinante DNA goed te laten functioneren moeten ook de promotor en terminator (zie § 8.2 ‘Transcriptie: DNA overschrijven’) worden ingebouwd. Bovendien moeten de stukken niet-coderend DNA (zie § 8.3 ‘De genetische code’) uit het in te voegen DNA worden verwijderd. Dit zijn allemaal stappen die de techniek ingewikkelder maken dan het lijkt. Als dan de beschreven stappen zijn genomen en de bacterie is transgeen, dan moet je maar afwachten of hij de bedoelde eiwitten (bijvoorbeeld insuline) gaat produceren. Het kan voorkomen dat het geproduceerde eiwit niet actief is of wordt afgebroken. Er is op dit gebied nog veel onderzoek nodig. Toch zijn er al successen geboekt. De menselijke insulineproductie door transgene bacteriën is gelukt en er zijn gistcellen die een vaccin maken tegen hepatitis-B. Bepaalde transgene bacteriën en gisten maken chymosine, een enzym dat de melk doet stremmen bij de kaasbereiding. Recombinant-DNA-techniek is voorlopig het best toepasbaar bij bacteriën en gisten, maar is soms ook bij planten mogelijk. Het gifproducerend gen van de bacterie Bacillus thuringiensis is onder andere in maïs ingebracht, waardoor de plant dit bacteriële gif kan maken. Door het gif gaan maïsetende rupsen dood. Deze transgene maïs heet Bt-maïs (naar de bacterie die het gif-gen heeft). Zo hoeven de boeren minder insecticiden te gebruiken. De recombinant-DNA-techniek is bij (zoog)dieren heel moeilijk en bij velen omstreden. De stier Herman was een - in Nederland tot nu toe enige algemeen bekendevoorbeeld van genetische modificatie bij een zoogdier.

De bedoeling was dat koeien melk zouden gaan produceren met daarin het eiwit lactoferrine, een middel tegen ontstekingen. De vader van deze koeien, stier Herman, was voorzien van het menselijke gen dat voor lactoferrine codeert. Herman was dus een transgene stier

© Wikipedia / Peter Maas Figuur 27 De transgene stier Herman
Moleculaire genetica Moderne technieken 8.9

Door voortplanting zou het gen doorgegeven worden aan zijn nakomelingen. Koeien zouden dan melk produceren met daarin het lactoferrine. Bij koeien wordt dat vooral gebruikt tegen uierontsteking. Het project waarin stier Herman en zijn nakomelingen gebruikt werden voor de productie van lactoferrine is inmiddels gestopt. Het gen dat in Herman was geplaatst, werkte niet goed en inmiddels zijn er andere - veel goedkoperetechnieken om lactoferrine te produceren.

Inmiddels is stier Herman op de gezegende leeftijd van 13 jaar (dat is oud voor stieren) overleden. Hij werd tot het laatst verzorgd in een stal op het terrein van het Nederlands Centrum voor Biodiversiteit Naturalis. Daarna is hij opgezet; en sindsdien staat hij op een ereplaats in dit museum.

Recombinant-DNA-technologie is ook toe te passen binnen verwante soorten, resulterend in cisgene organismen. Zo zijn er schimmels gemaakt die betere en andere penicillines produceren dan de natuurlijke schimmelvariant.

Om het gen dat je geïsoleerd hebt in een ander organisme te kunnen brengen moet het eerst worden ingebracht in een zogeheten vector, die dient als drager van het DNA. Dit kan een stukje plasmide zijn, maar ook een virus, een liposoom (een vetbolletje) of een goudkogeltje waarop het DNA geplakt zit. Welke vector gebruikt wordt, hangt af van het doel waarvoor het DNA van het ene naar het andere organisme wordt overgebracht.

Enkele voorbeelden:

Bij de toepassing van de gentherapie worden virussen of liposomen gebruikt. Bij genetisch modificeren van tweezaadlobbige planten wordt het DNA aan de bacterie Agrobacterium toegevoegd, die het DNA opneemt in een plasmide. Deze bacteriën worden in een oplossing van losse cellen of op bladponsjes van het doelorganisme gebracht. Bij eenzaadlobbige planten wordt het DNA op minuscule, met goud bedekte kogeltjes aangebracht, die daarna met een speciaal pistool in het doelorganisme worden geschoten.

Gentherapie met een virus als vector Virussen (zie § 25.9 ‘Virussen, leven aan de grens’) zijn zeer kleine deeltjes die voor hun voortbestaan afhankelijk zijn van levende gastheercellen. Binnen de gastheercel vindt vermenigvuldiging van het virus plaats. Er zijn twee typen virussen: DNA-virussen en RNA-virussen. DNA-virussen laten de gastheercel op grond van hun DNA nieuwe virale eiwitten en vervolgens nieuwe virussen maken. RNA-virussen bezitten een speciaal enzym, reverse transcriptase genoemd, waarmee de code van hun RNA in de gastheercel omgezet wordt in DNA, waarna dit DNA ingebouwd wordt in het gastheer-DNA. Daarna kunnen nieuwe virussen worden gemaakt.

Naast de recombinant-DNA-techniek met plasmiden is DNA ook in te bouwen met behulp van RNA-virussen, die van nature hun eigen erfelijk materiaal al in het DNA van de gastheercel brengen. Je gebruikt het virus als een soort transporteur, ook wel vector genoemd. Door een gewenste DNA-code in te brengen in het virus ontstaat een recombinantvirus, dat vervolgens als vector van het DNA dient. Het DNA van het virus wordt daarna ingebouwd in de gastheercel, die vervolgens de gewenste eiwitten gaat maken. Een voorwaarde is wel dat de gastheercel zich gaat delen. Pas dan wordt DNA tijdens de replicatie (DNA-verdubbeling) opnieuw aangemaakt. Als het gewenste erfelijk materiaal eenmaal is ingebracht, zullen alle nakomelingen van de delende cel het nieuwe DNA aanmaken.

Moleculaire genetica Moderne technieken 8.9

receptor voor de vector doelcel

Moleculen die alleen aan bepaalde celtypen binden.

Het virus (vector) hecht aan de doelcel die de verkeerde genetische informatie heeft.

Virussen met een correctie-gen worden in de bloedbaan gespoten.

Figuur 28 Virus als vector bij gentherapie

doelcel

ribosoom met mRNA

Synthese van eiwitten die de cel vóór de behandeling niet kon maken. DNA mRNA

Het correctie-gen wordt in de doelcel gebracht. M.b.v. reverse transcriptase wordt dubbelstrengs DNA gemaakt. Dit wordt ingebouwd in het DNA van de doelcel.

Deze techniek wordt ook op andere manieren gebruikt. Bij de mens komt de ziekte van Gaucher voor, een stofwisselingsziekte. Cellen produceren afvalproducten die normaal opgeruimd worden met behulp van speciale opruimenzymen in de lysosomen (zie § 2.2 ‘Celstructuren en hun functie’). Als deze enzymen ontbreken, zoals bij de ziekte van Gaucher het geval is, hopen de afvalstoffen zich op in de cel. Deze aandoening wordt daarom ook wel lysosomale stapelingsziekte genoemd. Doordat het enzym ontbreekt, wordt het afval door macrofagen (letterlijk ‘grote eters’, een type witte bloedcellen) opgenomen (zie § 21.4 ‘De tweede afweerlinie’). Dit geeft allerlei complicaties in botten, lever en milt.

De recombinanttechniek zou hier uitkomst kunnen bieden door het gen voor de vorming van het afbraakenzym in een virus in te brengen. Vervolgens wordt het erfelijk materiaal ingebracht in een gastheer-stamcel van waaruit zich bloedcellen en macrofagen ontwikkelen. Dit gebeurt in het laboratorium. Als de overdracht is gelukt, wordt de stamcel met het gen dat codeert voor het afbraakenzym ingebracht in het beenmerg van de patiënt (een beenmergtransplantatie). Door deling zullen vele enzymen geproduceerd worden die allemaal inzetbaar zijn bij de afbraak van de afvalproducten in de cellen. Hoewel het idee voor een dergelijke gentherapie veelbelovend is, blijken er in de praktijk veel problemen in de uitvoering te zijn. Gentherapie, waarbij mensen dus een vervangend gen krijgen voor een gen dat bij henzelf niet goed werkt, is een belangrijk onderzoeksterrein.

In oktober 2009 werd bekend dat twee jongetjes met een ernstige hersenziekte (adrenoleukodystrofie, ALD) succesvol zijn behandeld. De enige behandeling bestond uit beenmergtransplantatie in een heel vroeg stadium, maar voor deze jongens was geen beenmerg beschikbaar. Men heeft toen stamcellen uit hun eigen beenmerg geïsoleerd en die genetisch veranderd. Deze cellen zijn gekloneerd en vervolgens bij de jongens teruggebracht in hun beenmerg. Een deel van de genetisch veranderde stamcellen blijken hun werk in de hersenen te hebben gedaan: na twee jaar is de hersenschade hersteld of stabiel gebleven. Het is voor het eerst dat zo’n ernstige hersenziekte met gentherapie werd behandeld.

Moleculaire genetica Moderne technieken 8.9

CRISPR-Cas

In de jaren tachtig van de vorige eeuw ontdekten Japanse onderzoekers in het DNA van de bacterie Escherichia coli op veel plekken stukjes repeterend ‘palindromisch’ DNA (een palindroom is een woord dat je kunt omdraaien zonder dat het verandert, zoals lepel). Die stukjes werden afgewisseld met soortvreemd DNA, afkomstig van virussen of plasmiden.

Na deze ontdekking werd het repeterende DNA in veel andere bacteriën en eencellige organismen gevonden. De onderzoekers kwamen erachter dat de herhalende DNA-patronen samen met speciale enzymen en gespecialiseerde RNA-moleculen een rol spelen in het afweersysteem van prokaryoten (bacteriën en Archaea).

CRISPR, Clustered Regularly Interspaced Short Palindromic Repeats, is inmiddels een bekende term, voor dit verschijnsel. De speciale enzymen worden aangeduid met Cas (Crispr-associated system) en het hele complex wordt CRISPR-Cas genoemd. De enzymen werken als een soort schaar en de RNA-moleculen als een biologisch navigatiesysteem.

Je kunt het CRISPR beschouwen als een archief waar bacteriën die virusaanvallen hebben overleefd stukjes vijandig DNA opgeborgen hebben. Wanneer bacteriën aangevallen worden en de aanval overleven, bewaren ze zo’n stukje vijandig DNA tussen de CRISPR’s als zogeheten ‘spacers’. Deze stukken kunnen worden overgeschreven in een speciaal RNA-molecuul, dat guideRNA (gRNA) genoemd wordt. Als er een virus (bijvoorbeeld een bacteriofaag) is binnengedrongen, scant Cas alle bacteriële DNA totdat het een match vindt tussen het vijandige virus-DNA dat de bacterie is binnengedrongen en het DNA van die bacterie dat was opgeslagen in CRISPR. Als er een 100%-match gevonden wordt, kan Cas het DNA van het binnengedrongen virus onschadelijk maken. De Cas-enzymen zijn nucleases; zij knippen de dubbele DNA-strengen door.

CRISPR-Cas9

Twee wetenschappers Jennifer Doudna (Universiteit van Californië) en Emmanuelle Charpentier (Umea Universiteit) ontdekten dat ze dit afweermechanisme van prokaryoten kunnen gebruiken voor genetische modificatie. Het door hun ontwikkelde CRISPR-Cas9-systeem maakt gebruik van CRISPR, een Cas-enzym dat Cas9 heet en hybride RNA dat geprogrammeerd kan worden om een bepaalde genenreeks te identificeren, af te knippen en zelfs te vervangen door een ander stuk DNA.

CRISPR-Cas9 is programmeerbaar en werkt in elke soort cel. Zo kunnen stukken DNA makkelijk, snel, goedkoop en extreem precies worden bewerkt. Het kan mutaties wegknippen, genen aan- of uitzetten en het kan in cellen van planten, dieren en mensen. In 2015 werd CRISPR-Cas9 in het laboratorium gebruikt om het hiv-virus uit levende cellen van patiënten te knippen om te laten zien dat het mogelijk is. Binnenkort kan CRISPR-Cas9 ook andere retrovirussen die zich verstoppen in DNA - zoals herpesbestrijden. CRISPR-Cas9 zou misschien zelfs in de toekomst kanker kunnen bestrijden, door witte bloedcellen beter kankercellen te laten opsporen.

De beoogde doelen met de CRISPR-Cas9-techniek zijn: ziekten behandelen (bijv. aids), het gezond houden van bacteriestammen in de industrie (zoals bij yoghurt), geneesmiddelenproductie, ecologische ingrepen (zoals resistentiegenen tegen malaria inbrengen in muggen), voedselverbetering (zout-resistente en klimaatbestendige gewassen) en sleutelen aan de mens (erfelijke ziekten uitbannen).

CRISPR is zo belangrijk, omdat oudere technieken voor genetische modificatie veel minder trefzeker zijn; vaak komt het ingebrachte gen helemaal niet in het DNA van het organisme terecht, of op een willekeurige plek in het DNA, wat tot gevolg heeft dat het gen niet tot expressie komt. Er zijn daarom altijd veel pogingen nodig voor een genetische modificatie.

Moleculaire genetica Moderne technieken 8.9

Er is veel te vinden op internet over CRISPR-Cas, scan de QR-code en bekijk bijvoorbeeld het YouTube-filmpje.

Anti-CRISPR bestaat ook.

Zoals overal in de natuur is er ook een verdedigingssysteem: er zijn al genen in bacteriofagen gevonden die coderen voor anti-CRISPR-enzymen; dezelfde onderzoekers hebben nu ook fagen gevonden die een tegengif bezitten tegen Cas9. Ze beschreven drie anti-Cas9-genen en toonden aan dat deze de activiteit van CRISPR-Cas9 in menselijke cellen kunnen blokkeren. Deze anti-Cas9-eiwitten kunnen het mogelijk maken de effecten van CRISPR precies te regelen, dat wil zeggen het te stoppen op het gewenste moment.

Celfusie

Bepaalde witte bloedcellen, de B-cellen (zie § 21.5 ‘Derde afweerlinie: het afweersysteem’), maken antistoffen tegen ziekteverwekkers. B-cellen zijn zo specifiek dat ze maar één type antistof maken. Antistoffen worden gebruikt bij de behandeling van bepaalde ziekten. Vroeger haalde men de antistoffen uit bloedserum, maar dan kreeg je altijd een mengsel van antistoffen in handen. Dat was verre van zuiver en soms maakten patiënten zelfs antistoffen tegen de antistoffen waarmee ze behandeld werden. Dat was niet de bedoeling. Daarom ontstond het idee om de B-cellen te kweken op een voedingsbodem om zuivere antistoffen te verkrijgen.

Maar het lukte niet om een weefselkweek van de witte bloedcellen te maken. De witte bloedcellen bleven wel in leven en ze produceerden antistoffen, maar ze deelden niet. De vraag was hoe de cellen aan het delen te krijgen. De onderzoekers beredeneerden: “Als we die cellen zover kunnen krijgen dat ze zich als tumorcellen gaan gedragen, dan zouden ze ongeremd blijven delen. Daarvoor moet je de delingseigenschappen van de tumorcellen verenigen met de antistof-makende cellen. We proberen de cellen te laten fuseren!”

Dat lukte, natuurlijk na het nodige vallen en opstaan.

Een cel die het resultaat is van een geslaagde celfusie tussen een B-cel en een tumorcel, noem je een hybridoma. De cellen zijn eindeloos in weefselkweken verder te kweken; elke cellijn (kloon) maakt dan één antistof; zo ontstaan de zogeheten monoklonale antistoffen. Zie figuur 29.

Moleculaire genetica Moderne technieken 8.9

'Kreupele' tumorcellen uit kweek worden geïsoleerd. tumorcellen

Een muis wordt besmet met antigeen.

Miltcellen worden geïsoleerd. Miltcellen maken verschillende antistoffen. fusie

Uit dit mengsel van cellen worden de gefuseerde cellen die een bepaalde antistof produceren geselecteerd.

Gefuseerde cellen die het gewenste antistof produceren worden doorgekweekt.

Figuur 29 De productie van monoklonale antistoffen

Ook bij plantencellen zijn door celfusie hybride cellen te verkrijgen. Voordat de celfusie plaatsvindt, moet je eerst de celwand van de beide plantencellen verwijderen. Dit gebeurt met een speciaal daarvoor bestemd enzym (cellulase).

Moleculaire genetica Moderne technieken 8.9

plant 1 plant 2

cellen zonder celwand cellen zonder celwand fusie

regeneratie van de celwand hybride weefsel hybride plant

Figuur 30 Een hybride plant door celfusie

Onderzoekers hebben een cel uit een aardappelplant laten fuseren met een cel uit een tomaatplant. Door celdeling vanuit de hybride cel ontstond een plant met eigenschappen van zowel de aardappelplant als de tomaatplant. Deze plant werd de ‘aardmaat’ genoemd. De aardmaat had zowel de chromosomen van de aardappel als van de tomaat, maar leverde helaas niet aardappelen en tomaten, zoals men hoopte.

Kerntransplantatie

Kloneren is een techniek die de mens al eeuwenlang gebruikt, maar ook op natuurlijke wijze ontstaan klonen. Bij eencellige organismen door celdeling, bij planten door vorming van wortelstokken en uitlopers, bij ongewervelde dieren bijvoorbeeld door knopvorming (poliepen) en bij gewervelde dieren door het ontstaan van eeneiige tweelingen of meerlingen. Ook het kweken van bacteriekolonies valt onder kloneren. Een kloon hoeft overigens niet per se uit organismen te bestaan, ook een cellijn wordt kloon genoemd (zie de vorige subparagraaf ‘Celfusie’).

In de landbouw en veeteelt ontstaan door veredeling en genetische modificatie organismen met de gewenste genencombinaties, die alleen blijven bestaan bij ongeslachtelijke voortplanting (kloneren). Bij planten is kloneren meestal mogelijk; mede door het gebruik van weefselcultures. Maar bij landbouwhuisdieren en pluimvee was kloneren tot het eind van de vorige eeuw niet goed mogelijk. Daar is verandering in gekomen.

De meest klassieke methode om dieren te kloneren is embryosplitsing. Dit gebeurt door een embryo in tweeën of vieren te delen. De efficiëntie hiervan neemt af naarmate men verder klieft; je komt niet verder dan een tweeling of hooguit een vierling. Embryosplitsing is dus niet heel productief en gebeurt op kleine schaal.

De moderne methode is kloneren door middel van kerntransplantatie. In 1997 werd het schaap Dolly (genoemd naar de zangeres Dolly Parton) geboren, als eerste product van een succesvolle kerntransplantatie bij een zoogdier. Hierbij is de kern van een lichaamscel van een volwassen schaap in een eicel gebracht waaruit de kern verwijderd was (zie de figuur). Uit deze eicel groeide een embryo. Nadat het embryo in de baarmoeder van een ander schaap was gebracht, ontwikkelde het zich verder.

Moleculaire genetica Moderne technieken 8.9

Het schaap dat na deze ontwikkeling werd geboren, had hetzelfde genotype als het schaap waarvan de kern afkomstig was.

ras A ras B

kweek van borstklierweefsel uit uier diploïde cellen

vijf dagen voedselarmoede zet de celcyclus stil uiercel met kern (diploïd)

celfusie diploïd zygote met erfelijke informatie van schapenras A

Dolly heeft precies dezelfde erfelijke eigenschappen als het dier dat de uiercel leverde. Dolly is een kloon van dat dier.

Figuur 31 Kloneringstechniek, zoals gebruikt bij Dolly

eicel (haploïd) eicel ontdaan van chromosomen

lege eicel (met de cellen die de eicel verzorgen er nog omheen)

ontwikkeling van Dolly na implantatie in de baarmoeder

Ook deze kloneringsmethode verloopt niet zonder problemen: aan Dolly gingen 270 mislukte pogingen vooraf. En bovendien bleek Dolly vroeg te verouderen; ze werd maar zes jaar oud (schapen leven gemiddeld 12 jaar). Ook later gekloonde lammeren waren verre van gezond; ze hadden onder andere misvormde poten en niet goed werkende longen en nieren.

Na Dolly zijn nog allerlei andere diersoorten op deze manier gekloneerd, onder andere ratten, muizen, koeien, varkens, honden en apen. Maar er blijven problemen. De techniek mislukt vaak, want de meeste gekloneerde organismen sterven al voor ze geboren worden. Na de geboorte is er vaak heel wat mis met de gezondheid: veel dieren hadden een slechte afweer, waren onvruchtbaar en leden aan overgewicht, ademhalings- en bloedcirculatieproblemen, nier- en hersenafwijkingen, suikerziekte en vervormde ledematen. Ze verouderden sneller.

Stamcelklonering

Stamcellen zijn ongedifferentieerde cellen die onbeperkt kunnen blijven delen (zie § 3.4 ‘Delen als differentiatie’). Na de deling ontstaan nieuwe stamcellen en cellen die zich gaan specialiseren tot een bepaald celtype (differentiëren). Bij planten zitten de stamcellen in de meristemen (zie § 11.5 ‘Groei’). Planten zijn, dankzij de stamcellen, in staat voortdurend nieuwe organen te vormen, zoals bladeren, bloemen en stengels.

Moleculaire genetica Moderne technieken 8.9

Diktegroei van stengels en bomen is mogelijk door de aanwezigheid van het secundaire meristeem (cambium).

Bij dieren zijn stamcellen weliswaar in alle organen aanwezig, maar ze leveren alleen nieuwe weefselcellen, geen nieuwe organen - zeker niet bij de ‘hogere’ dieren waarbij de organen uit meerdere soorten weefsels bestaan. Er zijn verschillende soorten stamcellen; zij verschillen van elkaar in de mogelijkheid om tot verschillende celtypen te differentiëren. Zo kunnen de stamcellen in het rode beenmerg alleen tot verschillende soorten bloedcellen (zie § 14.3 ‘Bloed’) differentiëren en stamcellen in de wand van het darmkanaal alleen tot darmwandcellen. Stamcellen worden ingedeeld op grond van het aantal celtypes waarin ze kunnen differentiëren: je hebt totipotente, pluripotente, multipotente en unipotente stamcellen.

De ultieme stamcel is natuurlijk de bevruchte eicel, de zygote. Een zygote is een voorbeeld van een totipotente stamcel; deze cel is namelijk in staat om uit te groeien tot een compleet organisme met alle verschillende soorten cellen waaruit het bestaat. Bij zoogdieren ontstaat uit de zygote ook al het weefsel om het embryo heen, zoals placenta, navelstreng en vruchtvliezen (zie § 5.5 ‘Bevruchting en zwangerschap’). De cellen die ontstaan na de eerste klievingsdelingen van de zygote zijn dan ook totipotent. Na een vast aantal delingen ontstaat de blastula. In dit stadium zijn bepaalde cellen voorbestemd om het eigenlijke embryo te worden. Deze cellen zijn niet meer totipotent (want ze vormen geen weefsels buiten het embryo), maar pluripotent. De pluripotente stamcellen ontwikkelen zich tot alle typen cellen waaruit een baby bij geboorte bestaat. De toti- en pluripotente stamcellen bij het embryo noem je embryonale stamcellen. Multipotente stamcellen en unipotente stamcellen kunnen maar tot respectievelijk een beperkt aantal celtypes en één celtype differentiëren. Je noemt ze volwassen stamcellen of kortweg stamcellen. Het zijn de niet-gedifferentieerde cellen die na de geboorte voorkomen in de gedifferentieerde weefsels van een organisme. Ook volwassen organismen bezitten nog steeds stamcellen. Ze komen bijna overal in het lichaam voor, als stille echo’s van het embryo. Niet in heel grote aantallen - ongeveer 1 op de 1.000.000.000 (miljard) lichaamscellen is een stamcel -, maar voldoende om nieuwe, gespecialiseerde cellen te leveren als daar behoefte aan is. Op sommige plaatsen in het lichaam komen relatief veel stamcellen voor, vooral daar waar continu groei en vernieuwing plaatsvinden. Een voorbeeld is het rode beenmerg, waar dagelijks nieuwe bloedcellen ontstaan, daar is 1 op de 10.000 cellen een stamcel.

Een gedifferentieerde cel kan onder normale omstandigheden geen stamcel worden. Evenzo kan een multi- of unipotente stamcel geen toti- of pluripotente stamcel worden. Dit heeft te maken met het feit dat tijdens de ontwikkeling en differentiatie steeds meer genen min of meer geblokkeerd worden. Dit gebeurt door epigenetische regulatie (zie § 8.2 ‘Transcriptie: DNA overschrijven’). Daar blijken overigens wel uitzonderingen op te zijn, onder andere bij het ontstaan van een kankercel.

Therapeutisch kloneren

Men verwacht veel van het gebruik van stamcellen in de medische wetenschap. Mensen met ziekten als suikerziekte, de ziekte van Parkinson, ziekte van Alzheimer of taaislijmziekte (cystic fibrosis) zouden door stamceltherapie wellicht in de toekomst genezen kunnen worden. Je zou gezonde cellen van eilandjes van Langerhans, zenuwcellen of slijmcellen van de luchtwegen kunnen verkrijgen via het kweken vanuit stamcellen. Vervolgens dien je die cellen dan op een slimme manier aan de patiënt toe, zodat ze gezonde weefselcellen kunnen gaan produceren (op deze manier worden mensen met bloedcelkanker al tientallen jaren behandeld).

Moleculaire genetica Moderne technieken 8.9

Het probleem is dat er geen mogelijkheden zijn om geschikte volwassen stamcellen in grote hoeveelheden te verkrijgen.

Daarom maakt men gebruik van embryonale stamcellen. Dat zou in theorie als volgt kunnen gaan: in een eicel wordt een kern geplaatst uit bijvoorbeeld een gezonde huidcel van een patiënt. Dit is een kerntransplantatie. Vervolgens wordt deze cel opgekweekt tot een embryo. Zodra dit embryo is uitgegroeid tot een blastula (zie § 5.5 ‘Bevruchting en zwangerschap’), kunnen de pluripotente stamcellen worden geïsoleerd en verder worden gekweekt. De gekweekte huidcellen noem je een stamcellijn. In principe kun je uit het embryo stamcellijnen van alle weefsels kweken.

Je kunt ook embryo’s gebruiken die zijn overgebleven van een ivf-behandeling (zie § 5.7 ‘Bevorderen van zwangerschap’), maar aan dat gebruik zijn allerlei voorwaarden verbonden: er moet onder andere toestemming zijn van degenen van wie de geslachtscellen afkomstig waren of degene voor wie het embryo bestemd was. In de Embryowet is precies vastgelegd wat er wel en niet gedaan mag worden met embryonale stamcellen. De biomedische wetenschap is nog lang niet zo ver dat er menselijke stamcellijnen succesvol zijn gekweekt, laat staan voor behandeling zijn gebruikt.

De ‘kloonkoning’ Hwang Woo-Suk

Scan de QR-code en lees op de site van Nemo Kennislink over de activiteiten van de Zuid-Koreaan Hwang (1953), die heel ver is gegaan met stamcelklonering. Hij werd in 2009 tot een voorwaardelijke gevangenisstraf van twee jaar veroordeeld wegens verduistering van fondsen en overtreding van de bio-ethische wetgeving. Hij vervalste onderzoeksgegevens, wat een schokgolf in de wetenschappelijke wereld veroorzaakte. Hij werkte voor de Seoul National University en presenteerde in 2005 een spraakmakend stamcelonderzoek. Hij claimde er als eerste in te zijn geslaagd menselijke stamcellen te kloneren. Daardoor leek de behandeling van bijvoorbeeld de ziekte van Alzheimer dichterbij te komen. Hwang werd een held in Zuid-Korea, maar al snel bleek een groot deel van de resultaten te zijn vervalst. Hij verloor zijn baan en viel van zijn voetstuk. In 2005 bleek zijn claim te kloppen dat hij voor het eerst een hond had gekloneerd. Hwang Woo-Suk houdt zich nog altijd bezig met het kloneren van dieren.

Reproductief kloneren

Naast therapeutisch kloneren is ook reproductief kloneren mogelijk met de techniek van kerntransplantatie. De eicel met een nieuwe kern wordt dan in een draagmoeder geplaatst om zo een nakomeling te verkrijgen. Het ‘maken’ van het schaap Dolly is een voorbeeld van reproductief kloneren. In veel landen - waaronder Nederland - is reproductief kloneren verboden. Het kloneren van mensen is in veel landen verboden, vanwege medisch-ethische bezwaren. In Nederland zegt de Embryowet hierover: “Het is verboden handelingen met geslachtscellen of embryo’s te verrichten met het oogmerk op de geboorte van genetisch identieke menselijke individuen” (artikel 24, lid f).

- Extra - Nieuwe ontwikkelingen in stamcelonderzoek

Vanwege de vele bezwaren die kleven aan het gebruik van embryonale stamcellen (zowel ethisch als medisch) is men er na heel veel experimenten in geslaagd om ‘gewone’ lichaamscellen te herprogrammeren. Dit herprogrammeren berust op het gebruik van transcriptiefactoren die gewoonlijk tot expressie komen in vroege embryo’s en embryonale stamcellen. Transcriptiefactoren zijn eiwitten, die ervoor zorgen dat het DNA van de vele verschillende genen afgelezen wordt (zie ook § 8.2 ‘Transcriptie: DNA overschrijven’ en § 13.6 ‘Genregulatie’).

Moleculaire genetica Moderne technieken 8.9

iPS-cellen

Er werd een combinatie van vier genen gevonden die geschikt was om gedifferentieerde huidcellen van een muis te herprogrammeren. De geherprogrammeerde cellen gedragen zich vrijwel hetzelfde als embryonale stamcellen: ze kunnen blijven delen en ze kunnen differentiëren tot ieder celtype. Ze worden induced pluripotent stemcells of iPS-cellen genoemd. Er is van vrijwel ieder celtype aangetoond dat er iPS-cellen van gemaakt kunnen worden. In 2007 werden voor het eerst menselijke huidcellen geherprogrammeerd tot iPS-cellen.

De methode werd voor het eerst beschreven door de Japanner Yamanaka, die er in 2012 de Nobelprijs voor geneeskunde voor kreeg. De vier genen die bij deze herprogrammering betrokken zijn, worden dan ook Yamanaka-factoren genoemd.

De Yamanaka-factoren worden bij herprogrammering niet rechtstreeks aan de cellen toegevoegd; er wordt meestal gebruik gemaakt van retrovirussen, die ervoor zorgen dat het DNA in de cel terechtkomt. Omdat het niet zo wenselijk is dat vreemd DNA in het DNA van de te herprogrammeren cel terechtkomt, zijn er inmiddels methodes ontwikkeld om de Yamanaka-factoren in de cel tot expressie te brengen zonder dat het DNA in het genoom wordt ingebouwd.

De iPS-cellen zijn erg nuttig voor de biomedische wetenschap, omdat ze kunnen differentiëren tot verschillende weefseltypen. Daarmee kan de vorming van weefsels bestudeerd worden en wordt onderzoek gedaan naar het ontstaan en verloop van ziekten.

Nieuwe organen

Het is nu mogelijk om cellen in dunne kunststof plaatjes te kweken. Via kanaaltjes in de plaatjes worden de cellen van voedingsstoffen en zuurstof voorzien en worden afvalstoffen afgevoerd. Op deze manier worden ‘organen op een chip’ gemaakt. Dat zijn natuurlijk geen echte organen, maar deze methode biedt wel de mogelijkheid om weefsels te bestuderen. Een van de vele mogelijke toepassingen is het uittesten van medicijnen. Als daarbij stamcellen van een patiënt gebruikt worden, is na te gaan of deze goed reageren op het medicijn. Dat kan de ontwikkelkosten en het gebruik van proefdieren sterk verminderen.

Organen bevatten multipotente stamcellen voor een continue vernieuwing van cellen in het orgaan of als reactie op beschadiging aan een weefsel. Door de spectaculaire ontwikkelingen in het stamcelonderzoek kan men van veel typen organen mini-organen ofwel organoïden vanuit deze stamcellen laten ontstaan. Deze kunnen gevormd worden door gebruik te maken van de drie typen stamcellen: embryonale stamcellen, multipotente stamcellen en iPS-cellen.

De organoïden kunnen bijvoorbeeld gebruikt worden voor het testen van medicijnen voor patiënten met ernstige (erfelijke) ziekten.

Dat is al met succes gebeurd voor een medicijn voor taaislijmziekte. In 2015 werd er een test gedaan met de minidarmpjes van een ernstig zieke jongen met taaislijmziekte. Deze minidarmpjes waren gemaakt met behulp van zijn eigen stamcellen. Het bleek dat de darmcellen goed op het medicijn reageerden. Nadat er gestart was met een behandeling met behulp van dit medicijn, was de conditie van de jongen enorm verbeterd. Deze methode is erg kostbaar en werkt helaas nog maar bij een klein deel van de patiënten.

Moleculaire genetica Moderne technieken 8.9

OEFENVRAGEN

Oefenvragen bij 8.9

1 Weefselkweek

Weefselkweek bij planten is stukken eenvoudiger dan bij dieren. De techniek is in de loop van de jaren steeds verfijnder geworden. De basisprocedure is weergegeven in figuur 1. explants

knop worteltop stengeltop afsnijden sterilisatie van de buitenkant verschillende wasbeurten in gesteriliseerd gedestilleerd water laatste keer afsnijden en kweken op de voedingsbodem incubatie/ broeien subculturen

Figuur 1 Basisprocedure voor weefselkweek bij planten

Moleculaire genetica Moderne technieken 8.9

Beantwoord de vragen.

a Leg uit waarom juist stengel- of worteltoppen en knoppen geschikt zijn om een weefselkweek mee te beginnen.

b Wat is een explant?

c Leg uit dat steriel werken heel belangrijk is bij weefselkweek.

d De voedingsbodem bevat niet alleen mineralen, maar ook glucose. Leg uit dat dit nodig is voor het weefsel dat opgekweekt zal worden.

e Na verloop van tijd groeit het stukje weefsel in de buis uit tot een plantje. Hoe noem je de verzameling plantjes die op deze manier verkregen zijn?

f Wat stelt het laatste figuurtje in figuur 1 voor?

Moleculaire genetica Moderne technieken 8.9

2

Weefselkweek van dierlijke organismen

Weefselkweek van dierlijke organismen is nog niet zo heel lang mogelijk, maar de ontwikkelingen gaan snel. Niet alleen het kweken van breintjes (figuur 2), maar ook mini-levers en mini-darmen is gelukt.

stamcellen worden afgenomen uit een volwasssene

stamcellen worden opgekweekt tot ‘embryoid bodies’

signaalstoffen sturen de ontwikkeling richting zenuwweefsel

er ontstaat voorloperweefsel van hersenen

in een druppel speciale gel ontwikkelen zich verschillende soorten hersencellen

de organoïden groeien verder in een roerende bioreactor de brein-organoïden groeien verder tot de grootte van een erwt

Figuur 2 Basisprocedure voor het kweken van dierlijke weefsels en organen

Moleculaire genetica Moderne technieken 8.9

Beantwoord de vragen.

a In figuur 2 groeien de stamcellen uit tot embyoïd bodies. Zal hier al differentiatie hebben plaatsgevonden?

b Wat voor stoffen zouden er in de voedingsbodem (figuur 1) en in de ‘speciale’ gel (figuur 2) zitten, zodat de ontwikkeling gestuurd wordt?

c Bij figuur 2: hoe noem je het hele proces dat plaatsvindt vanaf figuurtje 3 t/m 5?

d Wat zou het nut zijn van het roeren?

e Welke mogelijkheden heb je met zo’n minibrein? Geef een voorbeeld.

3 Recombinatie

In deze paragraaf is recombinatie een belangrijk begrip.

Geef voor de volgende voorbeelden aan of het juiste of onjuiste voorbeelden zijn voor recombinatie.

Juist Onjuist

1 Twee ouders zijn homozygoot voor een bepaald allel, de ene voor het recessieve, de andere voor het dominante. De nakomelingen zijn recombinanten.

◯ ◯

2 In een bacterie wordt een stukje menselijk DNA geplakt dat voor insuline codeert. ◯ ◯

3 Bij gentherapie worden cellen voorzien van een niet-defect gen waar die cellen eerst alleen het defecte gen hadden. ◯ ◯

4 Het schaap Dolly is gemaakt met hulp van kerntransplantatie. ◯ ◯

5 Door celfusie van aardappel en tomaat ontstaat een hybride plant met zowel aardappel- als tomaat-eigenschappen. ◯ ◯

6 Met hulp van CRISPR-Cas9 wordt een ziekteverwekkende mutatie uit een cel geknipt. ◯ ◯

Moleculaire genetica Moderne technieken 8.9

Recombinant-DNA-technologie

Zet de handelingen die noodzakelijk zijn bij recombinant-DNA-technologie op de juiste volgorde. Noteer de cijfers 1 t/m 9 in de vakjes.

Isoleer uit de bacteriën plasmiden.

Een deel van de bacteriën neemt de behandelde plasmiden op. Het plasmide is opengeknipt.

Voeg aan de plasmideketentjes DNA toe met de gewenste code.

Gebruik restrictie-enzymen.

Gebruik ligases.

Voeg aan een suspensie van bacteriën de behandelde plasmiden toe.

Gebruik een suspensie (= oplossing) van bacteriën.

Isoleer de bacteriën die plasmiden hebben opgenomen.

5 RNA-spray

Door planten te sprayen met ‘RNA-spray’ is het mogelijk de groei van planten te remmen of ze te beschermen tegen rupsenvraat. De spray bevat bacteriën van het geslacht Agrobacterium waarin RNA was gebracht met de code voor stoffen die de groei remmen. Nadat de bacteriën op de plant zijn gesprayd, wordt hun erfelijke informatie (ook het extra ingebrachte RNA) vermenigvuldigd. Het RNA wordt daarna door de plantencellen gewoon gebruikt zoals RNA altijd wordt gebruikt. De behandeling heeft daarmee in principe alleen effect op de gewassen die op dat moment op het land staan.

Beantwoord de vragen.

a In de tekst wordt gebruik gemaakt van Agrobacterium. Leg uit dat deze groep bacteriën handig is voor dit doel.

b De bacteriën brengen RNA de plantencel binnen. Daarom is de bacterie een ... voor het RNA.

c Er vindt translatie plaats van het RNA. Welke organellen doen dit?

d Er staat: “De behandeling heeft daarmee in principe alleen effect op de gewassen die op dat moment op het land staan.”

Het gaat dus om een tijdelijk effect. Leg uit dat dit inderdaad zo is.

e Zijn de planten nu genetisch gemodificeerd?

4
Moleculaire genetica Moderne technieken 8.9

TOETSVRAGEN

Toetsvragen bij 8.5 t/m 8.9

1 Genmutaties

Sinds 1964 is een methode in gebruik die plantenveredelaars in staat stelt snel op recessieve mutaties te selecteren. Op een voedingsbodem brengen zij cellen die door meiose uit stuifmeelkorrelmoedercellen zijn ontstaan. Deze haploïde cellen delen zich en groeien uit tot haploïde planten (zie figuur 1). Door radioactieve straling kunnen in DNA genmutaties worden veroorzaakt.

callusvorming

colchine druppelen

tabaksplant S1 (n)

tabaksplant T (2n)

Figuur 1

a Over genmutaties worden de volgende beweringen gedaan:

een aantal tabaksplanten V (2n)

1 Een genmutatie kan berusten op de vervanging van een molecuul adenine door een molecuul guanine.

2 Een genmutatie kan berusten op de vervanging van een molecuul desoxyribose door een molecuul ribose.

3 Een genmutatie kan berusten op de afsplitsing van een molecuul fosforzuur van het DNA.

Welke van deze beweringen is of welke zijn juist?

alleen bewering 1

alleen bewering 2

alleen bewering 3

alleen de beweringen 1 en 2

alleen de beweringen 2 en 3 ◯ de beweringen 1, 2 en 3

Moleculaire genetica Moderne technieken 8.9

b Een plantenveredelaar wekt door middel van straling genmutaties op in een tabaksplant

T. Uit haploïde cellen van deze tabaksplant T met een gen dat door mutatie is ontstaan, wordt op deze wijze een aantal planten gekweekt. Deze planten S zijn kleiner dan plant

T. Ze krijgen wel bloemen, maar deze bloemen zijn steriel. Eén van de steriele planten (S1) heeft een eigenschap die de plantenveredelaar wil behouden.

Is uit dit resultaat af te leiden of het gen dat door mutatie is ontstaan dominant of recessief is?

◯ Nee, dit is niet uit de resultaten af te leiden.

◯ Ja, de mutatie is dominant.

◯ Ja, de mutatie is recessief.

c De kweker brengt een stukje stengel van de plant S1 op een voedingsbodem. Het stukje stengel vormt dan wondweefsel (callus). Op dit callusweefsel wordt colchicine gedruppeld. Door de colchicine-behandeling ontstaan kernen met een dubbel aantal chromosomen. Uit het callusweefsel ontstaan knoppen, die uitgroeien tot nieuwe tabaksplanten V (zie figuur 1).

Over deze tabaksplanten V worden drie beweringen gedaan:

1 De planten V zijn in principe homozygoot voor alle eigenschappen.

2 De planten V zijn alleen homozygoot voor de als gevolg van de genmutatie ontstane eigenschap.

3 De planten V zijn door ongeslachtelijke voortplanting ontstaan.

Welke van deze beweringen is of welke zijn juist?

◯ alleen bewering 1

◯ alleen bewering 2

◯ alleen bewering 3

◯ de beweringen 1 en 3

◯ de beweringen 2 en 3

2 ADA-SCID

ADA-SCID is een zeldzame erfelijke ziekte bij de mens die wordt gekenmerkt door ernstige afweerstoornissen. Vanwege een erfelijk defect kan een bepaald enzym, adenosine-deaminase (ADA), niet worden geproduceerd. Dit enzym is betrokken bij stofwisselingsprocessen van iedere lichaamscel. Door de afwezigheid van het enzym wordt deoxyadenosinetrifosfaat (dATP) opgehoopt in de cellen. dATP is giftig voor lymfocyten (een type witte bloedcellen), zowel wanneer deze in rust zijn als wanneer deze zich delen. Patiënten die lijden aan ADA-SCID (SCID = severe combined immune deficiency) kunnen hierdoor zonder behandeling alleen in een steriele omgeving in isolement overleven. De afweerstoornis is in principe te behandelen door een weefseltransplantatie.

Op een aantal plaatsen in de wereld worden ADA-SCID-patiënten behandeld met gentherapie. Gentherapie verloopt in het algemeen als volgt: in een daarvoor geschikt medium kweekt men cellen die vanwege het defecte ADA-gen niet goed functioneren. In deze cellen wordt een intacte versie van dit gen binnengebracht met behulp van een virus als vector. De genetisch veranderde cellen waarin het binnengebrachte intacte gen tot expressie komt, worden daarna teruggeplaatst in de patiënt. Deze ingreep brengt geen veranderingen voor zijn nageslacht met zich mee.

Moleculaire genetica Moderne technieken 8.9

Beantwoord de vragen.

a Waardoor heeft gentherapie bij een ADA-SCID-patiënt een positieve invloed?

b Waardoor brengt de gentherapie geen veranderingen voor zijn nageslacht met zich mee?

3 Vachtkleur

stap 1 stap 4 P1 P1

Q1 Q1 Q2 Q2 stap 2

stam Q stam P stam R embryo van P embryonale cellen van P

stap 3 stap 5 stap 6

? ? ?

Figuur 2

Bij muizen is de vachtkleur erfelijk bepaald. In een experiment worden drie homozygote muizenstammen gebruikt: muizen van stam P zijn zwart, muizen van stam Q zijn grijs, muizen van stam R zijn wit. Het experiment bevat de volgende stappen (zie figuur 2):

• Stap 1: uit een muis van stam Q wordt een pas bevruchte eicel gehaald; in deze cel bevinden zich de twee kernen Q1 en Q2, die nog niet zijn versmolten.

• Stap 2: uit een jong muizenembryo van stam P worden cellen gehaald.

• Stap 3: uit één van deze cellen wordt een kern P1 gehaald, die wordt overgebracht in de cel met de kernen Q1 en Q2.

• Stap 4: de kernen Q1 en Q2 worden, nog voordat ze versmelten, uit de cel verwijderd; de cel bevat nu alleen de kern P1; de cel gaat zich delen en er ontstaat een embryo.

• Stap 5: het embryo wordt, als het achtcellig is, in de baarmoeder van een muis van stam R gebracht waarin het zich tegelijk met een aantal eigen embryo’s van deze muis innestelt.

• Stap 6: de muis van stam R krijgt een aantal jongen.

a Het verloop van de embryonale ontwikkeling bij muizen komt overeen met dat bij de mens.

Welke kleur heeft het jong dat zich uit het geïmplanteerde embryo heeft ontwikkeld? Geef een verklaring voor je antwoord.

Moleculaire genetica Moderne technieken 8.9

b Hoe heet het embryonale stadium van het embryo van stam P waaruit de getransplanteerde kern afkomstig is?

c Waarom wordt in dit experiment een cel van een jong embryonaal stadium (stap 2) gebruikt en niet van een ouder stadium?

d Met het implanteren van het embryo wordt gewacht totdat dit achtcellig is. Noem één reden waarom niet de cel met kern P1 wordt geïmplanteerd.

4 Zelfbestuiving

Een klassieke methode om bepaalde planten te verkrijgen is het toepassen van zelfbestuiving, zoals in het volgende voorbeeld wordt beschreven. Van een bepaalde plantensoort hebben de homozygote individuen rode of witte bloemen en de heterozygote individuen roze bloemen. De bloemkleur wordt door twee allelen bepaald. Een kweker heeft alleen planten met roze bloemen. Deze planten (generatie 1) vermeerdert hij door zelfbestuiving; hierdoor ontstaat generatie 2. Van de daaropvolgende generatie (generatie 3) worden alle nakomelingen ook uitsluitend door zelfbestuiving verkregen. Alle planten leveren steeds evenveel nakomelingen.

planten met rode bloemen planten met roze bloemen planten met witte bloemen

Tabel met antwoordmogelijkheden

Welke planten en in welke verhouding heeft deze kweker in generatie 3? Kies uit de antwoordmogelijkheden in de tabel.

A 0 1 0 B 1 2 1 C 1 0 1 D 3 2 3 E 5 6 5 F 9 3 4
◯ A ◯ B ◯ C ◯ D ◯ E ◯ F Moleculaire genetica Moderne technieken 8.9

THEORIE

Belangrijkste termen

In dit hoofdstuk kwam je vetgedrukte termen tegen. Je kunt de betekenis van deze termen noemen / beschrijven / uitleggen. Hier staan ze op alfabetische volgorde: (essentiële) aminozuren (land)rassen 3’-kant 5’-kant adenine (A) afleesrichting anticodon biotechnologie (klassiek/ modern) carcinogeen celfusie cholesterol chromosomen chromosoommutatie cisgeen coderende streng (of coding streng of sense) codon complementaire basen CRISPR-Cas9 (geen deelconcept voor examen) cytosine (C) deletie desoxyribose dioxine DNA DNA-herstel/ DNA-repairsystem DNA-merker DNA-methylering/methylering DNA-polymerase DNA-sequensen/sequensen DNA-virus dubbelstrengs eiwitsynthese embryonale stamcel embryosplitsing embryotransplantatie enkelstrengs epigenetica epigenetische factoren exon fokken forensisch onderzoek fosfaatgroep

gen genetische modificatie genmutatie genomische afstempeling genregulatie gentherapie guanine (G) haplotype histonen hybride insertie intron kerntransplantatie kloneren kloon knipenzym kunstmatige inseminatie leidende streng/leading strand ligase/plak-enzym matrijsstreng (template streng of antisense) messenger-RNA (boodschapper-RNA/mRNA) monoklonale antistoffen mutatie multifactoriële overerving multipotent mutagene stoffen mutagene straling niet-coderend DNA nieuwe genencombinaties (gewenste genencombinaties) nucleïnezuren nucleosomen nucleotiden Okazaki-fragment ongeslachtelijke voortplanting plantenveredeling plasmide ploïdiemutatie pluripotent polymerase-kettingreactie (PCR/PCR-cyclus) primers promotor

puntmutatie recombinant-DNA-technologie replicatievork restrictie-enzym reverse transcriptase ribose ribosomaal RNA/rRNA ribosomen RNA RNA-polymerase RNA-virus stamcel stamceltherapie startcodon stikstofbase stopcodon terminator thymine (T) totipotent transcriptie transcriptiefactoren transgeen translatie transport-RNA (transfer-RNA/ tRNA) triplet uracil UV-straling vector veredelen volgende streng/lagging strand weefselkweek

8.10
HOOFDSTUKAFSLUITING
Moleculaire genetica Hoofdstukafsluiting 8.10

Leerdoelen

Wat moet je kennen/kunnen na dit hoofdstuk?

1 Je weet wat chromosomen zijn.

2 Je kunt uitleggen uit welke moleculen DNA opgebouwd is.

3 Je kunt vertellen wat een gen is en hoe een gen in het mRNA te vinden is dankzij het start- en stopcodon.

4 Je kunt aangeven op welke manier transcriptie en translatie plaatsvinden en je weet welke begrippen daarbij horen.

5 Je kunt de PCR-methode beschrijven.

6 Je kunt verklaren waarom we mRNA en tRNA nodig hebben voor de synthese van eiwitketens.

7 Je kunt tekenen en uitleggen hoe ribosomen translatie mogelijk maken.

8 Je kunt werken met de codontabel in Binas / ScienceData en zo zelf een DNA-keten vertalen naar een aminozuurketen.

9 Je kent het begrip niet-coderend DNA en kunt functies daarvan noemen.

10 Je kunt benoemen welke typen mutaties mogelijk zijn en je weet welk effect ze kunnen hebben.

11 Je kunt uitleggen dat tweelingonderzoek belangrijk is om kennis te vergaren over eigenschappen die het gevolg zijn van milieufactoren of epigenetische invloeden.

12 Je kunt een aantal klassieke plantenveredelingstechnieken beschrijven.

13 Je kunt uitleggen wat kloneren bij planten en dieren inhoudt.

14 Je kunt uitleggen wat het belang van HeLa-cellen is bij biotechnologisch onderzoek aan menselijke weefsel- en orgaankweken.

15 Je begrijpt hoe erfelijke ziekten kunnen ontstaan.

16 Je kunt een aantal moderne technieken noemen die men gebruikt bij de plantenveredeling en het fokken van dieren.

17 Je weet wat er bedoeld wordt met biotechnologische benadering van DNA en kunt van een aantal de mogelijkheden die daaruit voortkomen benoemen.

18 Je kunt een onderbouwde mening vormen over biotechnologie en het gebruik daarvan in de maatschappij.

Moleculaire genetica Hoofdstukafsluiting 8.10
www.thiememeulenhoff.nl/biologie
Issuu converts static files into: digital portfolios, online yearbooks, online catalogs, digital photo albums and more. Sign up and create your flipbook.