Page 1

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 9 Núm. 4, pp. 614- 854, OCTUBRE-DICIEMBRE-2018

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 9 Núm. 4, pp. 614-854, OCTUBRE-DICIEMBRE-2018


Ovejas multíparas sometidas a altas temperaturas. Rebaño del Instituto de Ciencias Agrícolas de la UABC. Fotografía tomada por: Ulises Macías Cruz.

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 9 Número 4 octubrediciembre, 2018. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Microbiología Animal, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 04-2016-060913393200-203. ISSN: 2448-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Microbiología Animal, Km. 15.5 Carretera MéxicoToluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en octubre de 2018.

DIRECTORIO FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITOR EN JEFE Arturo García Fraustro

Microbiología: Epidemiología: Parasitología: Reproducción: Genética: Nutrición:

Apicultura: Socioeconomía: Forrajes y Pastizales:

Inocuidad: Inmunología:

EDITORES POR DISCIPLINA Elizabeth Loza Rubio INIFAP Juan Carlos Saiz Calahorra INIA María Cristina Schneider PAHO Ramón Molina Barrios IT Sonora Elisa Rubí Chávez UNAM Guillermina Ávila Ramírez UNAM Emmanuel Camus CIRAD Héctor Jiménez Severiano INIFAP José J. Hernández Ledesma Consultor Juan Heberth Hernández Medrano UNAM Sergio Román Ponce INIFAP Mauricio A. Elzo Univ. Florida Armando Partida de la Peña INIFAP José L. Romano Muñoz INIFAP Alejandro Plasencia Jorquera UABJ Juan Ku Vera UADY Ricardo Basurto Gutiéerez INIFAP Maria Salud Rubio Lozano UNAM Silvia Elena Buntinx Dios UNAM Yolanda B. Moguel Ordóñez INIFAP Fernando Cervantes Escoto UA Chapingo Adolfo G. Alvarez Macías UAM-Xochimilco José Alfredo Cesín Vargas UNAM Javier F. Enríquez Quiroz INIFAP Martha H. Martín Rivera Univ. Sonora URN Fernando A. Ibarra Flores Univ. Sonora URN James A. Pfister USDA Eduardo Bolaños Aguilar INIFAP Martín Talavera Rojas UAEM Sergio Rodríguez Camarena INIFAP

México España EE.UU. México México México Francia México EE.UU. México México EE.UU. México México México México México México México México México México México México México México EE.UU. México México México

TIPOGRAFÍA Y FORMATO Nora del Rocío Alfaro Gómez Indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters.com/). Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com). I


REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria.

total por publicar es de $ 5,600.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx.

Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados.

La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Microbiología Animal, Km 15.5 Carretera MéxicoToluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 38718700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx.

The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products.

For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Microbiología Animal, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 300.00 per article in both printed languages.

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II


REVISTA MEXICANA DE CIENCIAS PECUARIAS REV. MEX. CIENC. PECU.

VOL. 9 No. 4

OCTUBRE-DICIEMBRE-2018

CONTENIDO ARTÍCULOS

Pág.

Análisis de pedigrí en la determinación de la diversidad genética de poblaciones bovinas para carne mexicanas Pedigree analysis for determination of genetic diversity in mexican beef cattle populations Rodolfo Ramírez-Valverde, Antonio R. Delgadillo-Zapata, Joel Domínguez-Viveros, Jorge Á. Hidalgo-Moreno, Rafael Núñez-Domínguez, Felipe A. Rodríguez-Almeida, Claudia Reyes-Quiroz, José G. García-Muñiz ......................... 614

Construcción de un índice de selección para rasgos de comportamiento en toros de lidia Building of a selection index for behavioral traits in fighting bulls Joel Domínguez-Viveros, Felipe Alonso Rodríguez-Almeida, Nicolás Callejas-Juárez, Nelson Guadalupe Aguilar-Palma, Juan Ángel Ortega-Gutiérrez .............................................................................. 636

Épocas de nacimiento basadas en un índice climático para el ajuste de modelos estadísticos para peso vivo de ganado bovino en México Birth seasons based on a climatic index for statistical model fitting of live weight of bovine cattle in México Jessica Beatriz Herrera-Ojeda, Gaspar Manuel Parra-Bracamonte, Nicolás López-Villalobos, José Fernando Vázquez-Armijo, Karlos Edmundo Orozco Durán, Juan Gabriel Magaña-Monforte, Juan Carlos Martínez-González, Francisco Joel Jahuey-Martínez .............................................................................. 646

Modelos para programación y optimización de agua de riego en avena forrajera Models for irrigation timing and optimization in oats for forage Miguel Servin Palestina, Ricardo Alonso Sánchez Gutierez, Orlando Ramírez Valle, Manuel Antonio Galindo Reyes, Héctor Gutiérrez Bañuelos .................................................................................................................................. 667

Secuencias de cultivo alternativas para incrementar el potencial forrajero y productividad del agua Alternative crop sequences for increasing the forage potential and water productivity David Guadalupe Reta Sánchez, J. Santos Serrato Corona, Héctor Mario Quiroga Garza, Arturo Gaytán Mascorro, Uriel Figueroa Viramontes ................................................................................................................................... 685

Uso de retenedores de humedad edáfica en la sobrevivencia y crecimiento de dos especies de pastos Bouteloua curtipendula [Michx.] Torr. y Chloris gayana Kunth Use of soil moisture retainers on the survival and growing of two grass species Bouteloua curtipendula [Michx.] Torr. and Chloris gayana Kunth Luis Gerardo Yáñez-Chávez, Aurelio Pedroza-Sandoval, Martín Martínez-Salvador, Ignacio Sánchez-Cohen, Francisco Guadalupe Echavarría-Cháirez, Miguel Agustín Velásquez-Valle, Armando López-Santos ............................. 702

Kisspeptina en becerras prepúberes: 2. Respuesta de LH, FSH y GH a distintas dosis de kisspeptina-10 y su asociación con IGF-I y leptina circulantes Kisspeptin in prepuberal heifers: 2. Response of LH, FSH and GH to different doses of kisspeptin-10 and its association with circulating IGF-I and leptin Alejandro Villa Godoy, Rubén Santos Echeverría, Jorge Víctor Rosete Fernández, René Carlos Calderón Robles, Gerardo Perera Marín, Jesús Alejandro Arreguín Arevalo, Terry M. Nett................................................................... 719

III


Variaciones en las respuestas termoregulatorias de ovejas de pelo durante los meses de verano en un clima desértico Variations in the thermoregulatory responses of hair ewes during the summer months in a desert climate Ulises Macías-Cruz, Miguel A. Gastélum, Leonel Avendaño-Reyes, Abelardo Correa-Calderón, Miguel Mellado, Alfonso Chay-Canul, Carlos F. Arechiga ................................................................................................................ 738

Identificación molecular y frecuencia de patógenos aislados de mastitis bovina en establos de la Península de Baja California, México Molecular identification and frequency of isolated pathogens from bovine mastitis in dairy herds from Baja California Peninsula, Mexico

Jennifer Brisuela Raygosa, Javier Palacios Torres, Gilberto López Valencia, Sawako Hori-Oshima, José Carlomán Herrera Ramírez, Lourdes Carolina Pujol Manríquez, Carlos Eliud Angulo Valadez, Tomás Benjamín Rentería Evangelista, Gerardo Enrique Medina Basulto ................................................................. 754

Immunolocalization of VirB11 protein in the Anaplasma marginale outer membrane and its reaction with bovine immune sera Inmunolocalización de la proteína VirB11 en la membrana externa de Anaplasma marginale y su reacción con sueros inmunes de bovino América Ivette Barrera Molina, Raquel Cossío Bayúgar, José A. Gutiérrez-Pabello, Ángel Tolentino Tello López, Jesús Francisco Preciado de la Torre, Sergio Darío Rodríguez Camarillo .................................................................. 769

Uso de nisina y quitosano para la inhibición de Staphylococcus aureus resistente a antibióticos y asociado a mastitis bovina Use of nisin and chitosan for the inhibition of antibiotic resistant Staphylococcus aureus bovine mastitis-associated Mónica Sánchez-Ceja, Ma. Teresa Arceo-Martínez, Ma. Guadalupe Sandoval-Flores, Patricia Nayeli Alva Murillo, Rafael Jiménez-Mejía, Pedro Damián Loeza-Lara ................................................................................................... 792

Caracterización y tipificación de explotaciones de dehesa asociadas a cooperativas: un caso de estudio en España Characterization and typification of dehesa farms associated to cooperatives: a case study in Spain Francisco Maroto-Molina, Augusto Gómez-Cabrera, José E. Guerrero-Ginel, Ana Garrido-Varo, José A. Adame-Siles, Dolores C. Pérez-Marín ................................................................................................................................................................. 811

NOTAS DE INVESTIGACIÓN Frecuencia de Neospora caninum en bovinos doble propósito en fincas del estado Guárico, Venezuela Frequency of Neospora caninum in double purpose cattle on herds at the State of Guárico, Venezuela Juan Carlos Pinilla León, Natalia Da Silva Borges ................................................................................................... 833

Niveles de fumonisinas en rastrojo de maíz para consumo equino en el estado de Jalisco Levels of fumonisins in corn stover for equine consumption in Jalisco state Waldina Patricia Reyes-Velázquez, Claudia Nayeli Anguiano-Sevilla, Rubén Anguiano-Estrella, Luis Alfonso Jiménez-Ortega, Pablo Torres-Morán, Federico Rojo ........................................................................... 845

IV


Actualización: abril, 2018 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas. Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes).

2.

Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo.

3.

El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y formato de derechos patrimoniales disponibles en el propio sitio oficial de la revista.

4.

5.

6.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

indican, empezando cada uno de ellos en página aparte. Página del título Resumen en español Resumen en inglés Texto Agradecimientosy conflicto de interés Literatura citada Cuadros y gráficas 7.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8.

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se

V


En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección.

apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda los autores deberán mencionar si existe algún conflicto de interés. 12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como referencias, aunque pueden insertarse en el texto (entre paréntesis).

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus. Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”). I)

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in

VI


pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis. XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

No se indica el autor. IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

Suplemento de revista. V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Libros y otras monografías

Autor total.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Publicaciones electrónicas XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Autor de capítulo. IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Memorias de reuniones. X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos

VII


necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales.

km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las gráficas y figuras se deberán elaborar en Word, Power Point, Corel Draw y enviadas en archivo aparte (nunca insertarlas como imágenes en el texto). Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados. 18. Abreviaturas de uso frecuente: cal cm °C DL50 g ha h i.m. i.v. J kg

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s) hectárea (s) hora (s) intramuscular (mente) intravenosa (mente) joule (s) kilogramo (s)

vs

versus

xg

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s). 19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

VIII


Updated: April, 2018 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts).

2.

All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt.

3.

Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias�. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

4.

5.

6.

Text Acknowledgments References Tables and Graphics 7.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

8.

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

9.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts: Introduction Materials and Methods Results Discussion Conclusions and implications

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

b) Technical Notes. They should be brief and be evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of the research article but without section titles.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page. Title page Abstract

c) Reviews. The purpose of these papers is to

summarize, analyze and discuss an outstanding topic.

IX


The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

the country, the printing house, the year, and the initial and final pages. f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. References. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume

Key rules for references

II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one.

III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given

b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article).

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

Organization, as author

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the names(s), the number of the edition, the country, the printing house and the year.

VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book,

In press VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000.

X


XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Books and other monographs

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Author(s) VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003.

Conference paper X)

XI)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003.

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

13. Final version. This is the document in which the authors have incorporated all the corrections and modifications asked for by the editors. Graphs and figures should be submitted separately in Microsoft Word, MS Power Point, or Corel Draw. Figures must not be inserted as images within the text. In Tables do not use internal horizontal or vertical lines.

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

Organization as author

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines.

XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

17. List of abbreviations: cal cm °C

XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

XI

calorie (s) centimeter (s) degree Celsius


DL50 g ha h i.m. i.v. J kg km L log Mcal MJ m Âľl Âľm mg ml mm min ng

P

lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s) mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s)

probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

vs

versus

xg

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XII


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Editorial La

Revista Mexicana de Ciencias Pecuarias en su constante camino por incorporar las tecnologías más recientes para conservar la calidad y prestigio; en esta oportunidad ha concursado en la Convocatoria abierta del Consejo Nacional de Ciencia y Tecnología denominada: “Fondo concursable para el posicionamiento nacional e internacional de revistas de ciencia y tecnología editadas en México”, misma que fue publicada en agosto de este año y cuyos resultados serán publicados el 21 de septiembre próximo. En esta Convocatoria nuestra revista participa con el proyecto: “Transición a la edición continua y estrategias de mejoramiento del impacto de la Revista Mexicana de Ciencias Pecuarias”, mediante el cual se plantea la realización del cambio paulatino de la publicación periódica a la publicación continua de los manuscritos que se postulen en nuestra revista. Como su nombre lo indica, la publicación continua es una modalidad de publicación de artículos científicos, en la que no es necesario que un número se encuentre completo para ser publicado, una vez que un artículo se encuentre listo para ser publicado, éste puede ser presentado en el sitio web de la revista. Con esta modalidad de publicación lo que se pretende alcanzar es una reducción entre los tiempos de recepción y de publicación de un artículo, minimizar riesgos en la desactualización de los datos de las investigaciones, tener disponibilidad inmediata de los manuscritos, incrementar en la visibilidad de las investigaciones y mejorar en los flujos editoriales; todas estas ventajas se verán reflejadas en beneficio de autores y lectores de la revista. Por otro lado, hacemos mención que la portada de este número está dedicada al grupo de investigación del Instituto de Ciencias Agrícolas de la Universidad Autónoma de Baja California, el cual está desarrollando estudios sobre el estrés calórico y las variaciones termoregulatorias en ovejas de pelo bajo condiciones de clima desértico. Finalmente hacemos la invitación a toda la comunidad pecuaria para que estén atentos a las novedades que próximamente esté presentando nuestra revista.

Arturo García Fraustro Editor en Jefe

XIII


http://dx.doi.org/10.22319/rmcp.v9i4.4654 Artículo

Análisis de pedigrí en la determinación de la diversidad genética de poblaciones bovinas para carne mexicanas Pedigree analysis for determination of genetic diversity in mexican beef cattle populations

Rodolfo Ramírez-Valverdea Antonio R. Delgadillo-Zapataa Joel Domínguez-Viverosb Jorge A. Hidalgo-Moreno a Rafael Núñez-Domíngueza* Felipe A. Rodríguez-Almeidab Claudia Reyes-Quiroza José G. García-Muñiza

a

Universidad Autónoma Chapingo. Departamento de Zootecnia.. Km 38.5 Carretera México-Texcoco. 56230, Chapingo, Estado de México. México. b

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología. Chihuahua, Chih. México.

*Autor de correspondencia: rafael.nunez@correo.chapingo.mx

Resumen: El objetivo de este estudio fue evaluar la diversidad genética de siete poblaciones de bovinos para carne en México, mediante análisis de sus pedigríes. Los análisis se realizaron con el


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

programa Endog, utilizando información de los animales inscritos en el libro genealógico nacional de cada raza. Los tamaños de los pedigríes estudiados fueron: Angus (AN)= 73,271; Brangus Negro (BN)= 68,474; Brangus Rojo (BR)= 12,925; Hereford (HE)= 13,248; Limousin (LI)= 53,221; Salers (SA)= 14,065; y Suizo Europeo (SE)= 184,788. En general, las poblaciones mostraron mejoras importantes en la integridad de sus pedigríes en los 10 años más recientes, con parámetros comparables a los publicados en otras poblaciones de bovinos. El intervalo generacional varió de 5.1 a 7.2 años entre razas. Los coeficientes de consanguinidad y de relación genética aditiva promedio fueron relativamente bajos en las diferentes poblaciones (0.9-4.2 y 0.3-6.5 %, respectivamente); aunque en algunas razas (BN, BR y HE) se detectaron incrementos de estos indicadores en los 10 años más recientes. El tamaño efectivo de población fluctuó entre 24 y 192, con valores menores que 50 en BR y SA. Los parámetros relacionados con la probabilidad de origen de los genes indican que las contribuciones desbalanceadas de los animales fundadores, los cuellos de botella y la deriva genética, han tenido un efecto importante en las poblaciones actuales, con la consecuente pérdida de diversidad genética. Se recomienda continuar o adoptar estrategias de apareamiento que minimicen la consanguinidad, y el uso intensivo de pocos animales para mantener la variabilidad genética de futuras generaciones, así como ampliar la diversidad genética mediante el uso estratégico de genes provenientes de otros países. Palabras clave: Tamaño población, Consanguinidad, Número ancestros, Intervalo generacional.

Abstract: The objective of this study was to evaluate genetic diversity of seven Mexican beef cattle populations, using pedigree analyses. The analyses were carried out with the Endog software, using information of the registered animals on national herd-book of each breed. The size of the populations studied were: Angus (AN)= 73,271; Black Brangus (BN)= 68,474; Red Brangus (BR)= 12,925; Hereford (HE)= 13,248; Limousin (LI)= 53,221; Salers (SA)= 14,065; and Braunvieh (SE)= 184,788. In general, the populations showed important improvements in pedigree integrities for the more recent 10 yr, with comparative parameters to other published in cattle populations. The generation interval varied among breeds from 5.1 to 7.2 yr. The average inbreeding and relatedness coefficients were relatively low in the different populations (0.9-4.2 and 0.3-6.5 %, respectively); although increases of these indicators during the 10 more recent years were detected in some breeds (BN, BR and HE). The effective population size of studied populations fluctuated between 24 and 192, with values lower than 50 in BR and SA. The parameters related with probability of gene origin indicated that the unbalanced contribution of founders, the bottlenecks and genetic drift have had an important effect on the current populations with the consequent losses in genetic diversity. It is recommended to continue or adopt mating strategies that minimize inbreeding

615


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

and the intensive use of few animals to maintain genetic variability in future generations, and to increase the genetic diversity through the strategical use of genes from other countries. Key words: Population size, Inbreeding, Number ancestors, Generation interval.

Recibido 04/10/2017 Aceptado 26/12/2017

Introducción

El monitoreo de la estructura poblacional, la consanguinidad, el tamaño efectivo de población y la probabilidad de origen de los genes, permite prevenir pérdidas de diversidad genética en las poblaciones bovinas(1), particularmente en poblaciones bajo procesos de selección(2). Por lo anterior, su estudio es necesario para implementar de manera más integral los programas de selección(3). En varios países se ha generado información acerca de la diversidad genética de sus poblaciones animales, tanto para razas locales como para transfronterizas (presentes en varios países), lo que ha sido ampliamente estudiado mediante análisis de pedigrí y usado en poblaciones de animales domésticos(1-5). Sin embargo, en México, los estudios publicados utilizando el análisis de pedigrí en sus poblaciones han sido escasos(6,7), por lo que el análisis de la estructura y variabilidad genética de sus poblaciones de animales domésticos debe ser una acción prioritaria de investigación en mejoramiento genético animal(8). Los métodos de selección comúnmente usados, como los basados en las predicciones de los valores genéticos obtenidos mediante el modelo animal, pueden incrementar los niveles de consanguinidad y disminuir la variabilidad genética de las poblaciones(9). En México, las evaluaciones genéticas nacionales en razas de bovinos para carne iniciaron en 2001. En 2010 se reportó que 21 razas ya tenían evaluaciones genéticas(10), en las cuales es importante conocer la diversidad genética presente. Por lo anterior, el objetivo de este estudio fue evaluar la diversidad genética de siete poblaciones de bovinos para carne en México, mediante el análisis de sus pedigríes.

616


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Material y métodos

La información genealógica utilizada fueron las bases de datos de las poblaciones nacionales de bovinos Angus (AN), Brangus Negro (BN), Brangus Rojo (BR), Hereford (HE), Limousin (LI), Salers (SA) y Suizo Europeo (SE); provenientes de las respectivas asociaciones mexicanas de criadores de ganado de registro. El libro genealógico de cada raza incluyó animales nacidos en los periodos 1973-2017, 1964-2016, 1973-2017, 1935-2016, 1953-2017, 1976-2016 y 1927-2016 para AN, BN, BR, HE, LI, SA y SE, respectivamente. Los pedigríes originales se editaron para evitar la presencia de incongruencias, como registros duplicados, edades de los hijos mayores que las de sus progenitores o diferencias de edad no razonables biológicamente, y registros de animales como padres y como madres. Los análisis de los pedigríes se llevaron a cabo mediante el programa Endog v4.8, donde se describen los detalles de los procedimientos usados para estimar los parámetros poblacionales estudiados(11). Los análisis se realizaron para el total de los animales (PT) en cada raza, y para sus poblaciones de referencia (PR) se consideraron los animales en los 10 años más recientes (potencialmente vivos) de la población correspondiente. El significado de los parámetros poblacionales se describe a continuación.

Integridad del pedigrí

Los principales factores que influyen en la exactitud de los parámetros de las poblaciones usando el análisis de pedigrí son la integridad y nivel de completitud del pedigrí(12). En este estudio, la integridad de los pedigríes se determinó mediante las estimaciones del número de generaciones completas (GC), número máximo de generaciones trazadas (MGT) y número de generaciones completas equivalentes (GE). Se consideró una generación completa cuando se conocían los 2n antepasados de un individuo, mientras que las generaciones máximas trazadas relacionaron el número máximo de éstas que separan a un individuo de su ancestro más lejano(11). Para un individuo dado, el número de generaciones completas equivalentes se obtuvo mediante la suma para todos los ancestros conocidos de los términos calculados como

617


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

la suma de (1/2)n de todos los antepasados conocidos, donde n es el número de generaciones que separan al individuo de cada ancestro conocido(13). Adicionalmente, como medida complementaria a la de integridad de los pedigríes, se calcularon los porcentajes de ancestros conocidos hasta la tercera generación parental.

Intervalo generacional (IG)

El IG fue definido como la edad promedio de los padres cuando nace su descendencia(14). Este parámetro se calculó para las cuatro rutas gaméticas de selección: padre-hijo, padre-hija, madre-hijo y madre-hija.

Coeficientes de consanguinidad (F) y de relación genética aditiva promedio (CRP)

El F se calculó usando el algoritmo establecido por Meuwissen y Luo(15), basado en el principio de que los fundadores no están emparentados y, además, en que su F es igual a cero. El CRP fue definido como la probabilidad de que un alelo escogido al azar de entre toda la población en el árbol genealógico pertenezca a un animal determinado(11); por tanto, es una medida del porcentaje de genes que, en promedio, comparte cada individuo con el resto de los individuos del pedigrí. El cálculo del CRP se obtuvo del promedio de los coeficientes en la fila correspondiente al individuo en la matriz de relaciones genéticas aditivas “A”(14,16).

618


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

Tamaùo efectivo de población (Ne) y tasa de incremento en consanguinidad (ΔF)

El Ne es el nĂşmero de individuos que darĂ­an lugar a la tasa calculada de consanguinidad, si fueran criados bajo el sistema de la poblaciĂłn idealizada(17). El Ne representa las relaciones de parentesco entre los nĂşmeros de machos y hembras que contribuyen genĂŠticamente en la poblaciĂłn y el parĂĄmetro es inversamente proporcional a la ΔF(5). El incremento en đ?‘Ą consanguinidad se estimĂł mediante: ∆đ??šđ?‘– = 1 − √1 − đ??šđ?‘– , donde t es el nĂşmero de generaciones equivalentes. El Ne se basĂł en el ∆đ??šđ?‘– y se calculĂł promediando los ∆đ??šđ?‘–´đ?‘ de los Ě…Ě…Ě…đ?‘’ = 1 (18,19). Ambos indicadores (ΔF y Ne) fueron estimados n individuos incluidos como đ?‘

Ě…Ě…Ě…Ě… 2∆đ??š

para las PR respectivas.

Probabilidad de origen de los genes

El pedigrĂ­ de un individuo puede ser rastreado para calcular la contribuciĂłn a su genoma de su eventual fundador o ancestro. Un fundador fue definido como un ancestro con progenitores desconocidos, pero cuando sĂłlo se conoce un progenitor, el progenitor desconocido es considerado como fundador. La preservaciĂłn de la diversidad genĂŠtica de los fundadores hacia la poblaciĂłn de estudio puede ser medida por sus contribuciones(12). Se considerĂł como nĂşmero efectivo de fundadores (fe) al nĂşmero de animales fundadores que contribuyeron por igual para producir la diversidad genĂŠtica observada en la poblaciĂłn(20). Si todos los fundadores contribuyen por igual a la descendencia, fe es igual al nĂşmero de fundadores (f); por el contrario, si la contribuciĂłn es desigual, fe es de menor valor(12,20). Por otro lado, se considerĂł como nĂşmero efectivo de ancestros (fa) al nĂşmero mĂ­nimo de ancestros (fundadores o no) necesarios para explicar la diversidad genĂŠtica completa de una poblaciĂłn(12). Este parĂĄmetro toma en cuenta la posible existencia de cuellos de botella en el pedigrĂ­, por el uso extensivo de algunos individuos en ciertas generaciones. Finalmente, se considerĂł el parĂĄmetro nĂşmero efectivo de genomas fundadores equivalentes (fg) al nĂşmero de fundadores que podrĂ­a esperarse produjeran la misma diversidad genĂŠtica de la poblaciĂłn bajo estudio, si los fundadores estuvieran igualmente representados y no

619


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

hubiera ocurrido pérdida de alelos(21). Adicionalmente, considerando las contribuciones genéticas marginales(12), se obtuvieron los números de ancestros que explican el 50 % de los genes, y la contribución del principal ancestro.

Resultados y discusión

Censos en las poblaciones

En el Cuadro 1 se muestra una descripción general de los animales considerados en cada raza estudiada. El número de animales utilizados por raza en el total del pedigrí fue variable (aproximadamente entre 13,000 y 185,000 para las PT, y entre 4,000 y 37,000 para las PR). Los promedios de hijos por semental en cada población fluctuaron entre 6 y 31, pero en las PR los valores fueron prácticamente el doble que en las respectivas PT, excepto en la raza SE que fueron la mitad. Los promedios de hijos por vaca oscilaron entre 1.8 y 2.7. Los porcentajes de animales con padre o madre desconocidos en las PT fue similar en todas las poblaciones, y en promedio fue alrededor de 16 %, oscilando para las diferentes poblaciones entre 8 (BN) y 33 % (HE); los valores disminuyeron sustancialmente para los animales nacidos en los 10 años más recientes (PR).

620


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 1: Descripción general del número (N) de animales (A) en los pedigríes de las siete poblaciones bovinas mexicanas estudiadas, para la población total y la población de referencia* (dentro de paréntesis) Concepto NA total N de sementales N de madres NA con padre desconocido NA con madre desconocida N de hijos por semental (NHS) Máximo NHS N de hijos por vaca N de hatos

AN 73,271 (34,433) 8,224 (905) 30,948 (8,357) 10,539 (988) 11,420 (1,282) 7.63 (16.67) 412 (246) 2.00 (2.00) 202 (175)

Población total (población de referencia) BN BR HE LI SA 68,474 (30,356) 4,408 (696) 25,090 (5,735) 5,612 (204) 5,048 (333) 14.26 (17.72) 561 (293) 2.53 (1.97) 152 (122)

12,925 (6,329) 1,842 (280) 6,124 (1,895) 2,133 (5) 2,129 (9) 5.86 (10.90) 312 (219) 1.76 (1.80) 86 (70)

13,248 (4,444) 1,408 (123) 4,587 (890) 4,413 (168) 4,450 (164) 6.27 (14.40) 150 (71) 1.92 (1.92) 48 (37)

53,221 (22,804) 4,220 (385) 20,587 (4,067) 6,219 (213) 6,812 (389) 11.14 (20.87) 710 (182) 2.25 (2.14) 214 (132)

14,065 (4,885) 1,382 (67) 5,377 (511) 1,768 (7) 1,765 (5) 8.90 (17.91) 358 (65) 2.29 (1.97) 118 (21)

SE 184,788 (37,245) 5,157 (481) 59,609 (5,042) 21,845 (3) 24,337 (4) 31.60 (16.36) 1,620 (155) 2.70 (1.78) 648 (308)

AN= Angus; BN= Brangus Negro; BR= Brangus Rojo; HE= Hereford; LI= Limousin; SA= Salers; SE= Suizo Europeo. * Población de referencia (10 años más recientes).

Integridad de los pedigríes

Los valores promedio de los GC, MGT y GE para las poblaciones bovinas estudiadas se muestran en el Cuadro 2. De acuerdo con los GE obtenidos para la PT, las poblaciones con mayor información sobre las genealogías fueron BN y SE (GE > 4), mientras que en las demás poblaciones, los valores estimados (2.0 a 3.9) fueron inferiores a los obtenidos en otras investigaciones con razas europeas transfronterizas para carne (4.0 a 9.3)(22,23). Los valores para los MGT y GC en las razas estudiadas tuvieron un patrón similar al observado para los GE. Con excepción de HE, los MGT estimados para las demás poblaciones fueron superiores o similares (5.4 a 10.3) a los estimados (4.2 a 6.9)(24,25) en razas bovinas criollas (Costeño con Cuernos, Blanco Orejinegro, Romosinuano y Sanmartinero) y transfronterizas (Guzerat). Sin embargo, inferiores (12 a 14)(22) a los publicados para otras razas bovinas transfronterizas

621


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

(Chianina, Marchigniana y Romagnola). Los GC estimados en las poblaciones (2.4 a 3.0) fueron mayores que los obtenidos en bovinos Guzerat (1.7)(25), con excepción de la población HE, donde se obtuvo un valor menor (1.5). Los GE, GC y MGT obtenidos en la PR fueron mayores que los de las respectivas PT y comparables con los publicados en otras poblaciones de bovinos(22-25).

Cuadro 2: Números de generaciones máximas trazadas (MGT), completas (GC) y completas equivalentes (GE) conocidas en los pedigríes de las siete poblaciones bovinas mexicanas estudiadas, para la población total y la población de referencia* (dentro de paréntesis) Población total (población de referencia) Indicador MGT GC GE

AN

BN

8.09 (11.61) 10.28 (13.48) 2.52 (3.41) 3.05 (3.66) 3.87 (5.32) 5.89 (7.51)

BR

HE

5.40 (8.09) 2.29 (3.25) 3.38 (4.91)

3.32 (6.22) 1.45 (2.55) 2.03 (3.55)

LI

SA

7.65 (11.16) 6.83 (10.61) 2.41 (3.50) 2.58 (3.93) 3.76 (5.42) 3.84 (5.62)

SE 8.50 (13.03) 2.37 (3.64) 4.28 (6.38)

AN= Angus; BN= Brangus Negro; BR= Brangus Rojo; HE= Hereford; LI= Limousin; SA= Salers; SE= Suizo Europeo. * Población de referencia (10 años más recientes).

Según Maignel et al(26), el criterio más apropiado para caracterizar la información del pedigrí es el GE, mientras que los MGT y GE son indicadores complementarios que dan mejor idea del grado de profundidad del pedigrí. Las proporciones de ancestros conocidos sobre todas las generaciones trazadas (GE) obtenidas en este estudio para las PT, indican que algunas estimaciones de parámetros poblacionales pudieran tener limitaciones al compararse con las de otras poblaciones de otros estudios. Sin embargo, con excepción de HE, para las PR de las demás poblaciones estos valores fueron mayores (4.9 a 7.5), lo que muestra los esfuerzos recientes de los criadores en el registro de información genealógica de sus animales. El grado de integridad de los pedigríes en las poblaciones estudiadas se confirmó con las estimaciones de porcentajes de ancestros conocidos (Cuadro 3). La PT de HE presentó los menores porcentajes de progenitores conocidos hasta la tercera generación (38 a 67 %); mientras que las demás poblaciones presentaron porcentajes razonables de ancestros conocidos en la primera (>84 %), segunda (>71 %) y tercera (>61 %) generación parental. En las PR, los porcentajes de progenitores conocidos hasta la tercera generación aumentaron sustancialmente (>90 %), con excepción de HE, donde los valores fueron entre 77 y 90 %. Los porcentajes de ancestros conocidos publicados en otros estudios han sido variables; valores superiores al 90 % de ancestros conocidos en la tercera generación parental han sido reportados para la población Marchigiana(27), mientras que en las poblaciones españolas Bruna de los Pirineos y Asturiana de los Valles se han estimado valores cercanos al 3 %(14). Por otro lado, las poblaciones de este estudio mostraron un patrón similar de valores entre las rutas paterna y materna, lo que sugiere que la captura de registros fue equitativa entre

622


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

sexos. Conocer la profundidad del pedigrí es importante, ya que esto influye en la estimación de parámetros que son sensibles a la completitud de la información genealógica disponible(12); por lo anterior, para HE se esperarían subestimaciones en algunos de los parámetros analizados, principalmente en los F.

Cuadro 3: Porcentajes de ancestros conocidos de las siete poblaciones bovinas mexicanas estudiadas, para la población total y la población de referencia* (dentro de paréntesis) Ancestros¥ Progenitores S M Abuelos SS MS SM MM Bisabuelos SSS MSS SMS MMS SSM MSM SMM MMM

Población total (población de referencia) BR HE LI SA

AN

BN

SE

86 (98) 84 (97)

92 (100) 93 (100)

84 (100) 84 (99)

67 (98) 66 (98)

88 (99) 87 (99)

87 (100) 87 (100)

88 (100) 87 (100)

80 (98) 80 (96) 74 (95) 73 (93)

90 (99) 89 (99) 86 (97) 87 (98)

76 (99) 75 (97) 71 (98) 71 (98)

56 (97) 56 (97) 49 (88) 49 (88)

84 (99) 84 (99) 77 (97) 76 (96)

82 (100) 80 (100) 78 (100) 78 (100)

84 (100) 82 (100) 78 (100) 77 (100)

75 (96) 76 (97) 72 (96) 73 (96) 69 (94) 69 (95) 64 (92) 63 (90)

87 (99) 86 (97) 84 (96) 84 (96) 84 (97) 82 (95) 81 (96) 82 (96)

69 (99) 69 (97) 65 (96) 66 (96) 65 (97) 65 (96) 61 (96) 61 (96)

46 (90) 46 (90) 44 (91) 44 (90) 40 (82) 39 (82) 38 (77) 38 (77)

81 (99) 81 (97) 76 (99) 76 (89) 73 (97) 72 (96) 64 (95) 64 (88)

78 (100) 72 (100) 71 (94) 72 (98) 74 (100) 74 (99) 70 (98) 71 (100)

82 (100) 77 (98) 77 (98) 74 (99) 74 (99) 72 (100) 66 (99) 63 (98)

AN= Angus; BN= Brangus Negro; BR= Brangus Rojo; HE= Hereford; LI= Limousin; SA= Salers; SE= Suizo Europeo. * Población de referencia (10 años más recientes). ¥ S= semental; M= madre.

Intervalo generacional

Los IG estimados para las poblaciones estudiadas en las cuatro rutas de selección posibles se muestran en el Cuadro 4. En promedio, para las PT los IG de las razas estudiadas fluctuaron entre 5.1 y 6.5 años, incrementándose sus valores en todas las PR (5.5 a 7.2 años). Las

623


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

pérdidas de diversidad genética se producen a mayor velocidad con menores IG; sin embargo, provocan mayor progreso genético por unidad de tiempo(16). En general, los IG promedios de las poblaciones de este estudio fueron menores a los de otros estudios(25,28,29) con bovinos para carne de razas transfronterizas (Guzerat, Charolais, Limousin, Hereford, Angus y Simmental) y locales (Alentejana). Sin embargo, para LI y SE en la PT, y para las PR, los IG fueron mayores en la ruta de padres para producir hijos que en las demás rutas gaméticas, lo que sugiere el uso de sementales por periodos prolongados, con posiblemente un uso de pocos reproductores e inseminación artificial. Este patrón de comportamiento con mayores IG para la ruta padre-hijo fue similar al publicado en Angus(28) y Suizo Pardo(30). En investigaciones con razas bovinas locales, algunos estudios(14,24) han estimado IG en las rutas paternas menores que los de las maternas, atribuyéndolo al reemplazo temprano de los sementales.

Cuadro 4: Intervalos generacionales (años) estimados para las cuatro rutas gaméticas de selección en animales reproductores de las siete poblaciones bovinas mexicanas estudiadas, para la población total y la población de referencia* (dentro de paréntesis) Población total (población de referencia) Ruta gamética

AN

BN

BR

HE

LI

SA

SE

Padre-hijo Padre-hija

6.19 (6.64) 5.25 (5.82) 5.54 (6.50) 4.93 (6.71) 7.67 (11.12) 5.09 (7.57) 8.19 (8.90) 5.41(5.71) 5.50 (5.71) 5.56 (5.57) 5.36 (5.59) 7.45 (8.23) 4.98 (6.92) 5.79 (6.99)

Madre-hijo

5.19 (5.55) 5.35 (5.53) 5.26 (5.51) 5.31 (5.85) 5.91 (6.09) 5.04 (6.86) 6.95 (6.38)

Madre-hija

5.27 (5.59) 5.74 (5.82) 5.14 (5.21) 5.45 (5.54) 5.50 (5.63) 5.19 (6.71) 5.95 (6.40)

Promedio

5.4 (5.7)

5.6 (5.8)

5.3 (5.5)

5.4 (5.7)

6.5 (7.2)

5.1 (6.9)

6.4 (6.7)

AN= Angus; BN= Brangus Negro; BR= Brangus Rojo; HE= Hereford; LI= Limousin; SA= Salers; SE= Suizo Europeo. * Población de referencia (10 años más recientes).

Pirchner(31) menciona que los IG en las rutas padre-hijo= 6.5 a 9.0, padre-hija= 4.5 a 6.5, madre-hijo= 5.0 a 6.5 y madre-hija= 5.0 a 6.5 años, son valores que pueden considerarse como estándar en bovinos para carne. De acuerdo con esa clasificación, en general, los valores estimados en este estudio fluctuaron en esos rangos (con excepción de la PR de LI para las rutas padre-hijo y padre-hija, donde se obtuvieron IG mayores a los estándares); sin embargo, para BN, BR, HE y SA en la ruta padre-hijo fueron inferiores a los estándares (<5.6 años) en la PT, lo que sugiere recambios cortos y continuos de los sementales activos.

624


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Consanguinidad y relación genética aditiva promedio

Los F y los CRP en las poblaciones estudiadas se muestran en el Cuadro 5. Los valores promedio de los F para las PT de las poblaciones estudiadas fueron relativamente bajos (0.9 a 3.5 %), por lo que podría esperarse poca manifestación de la depresión endogámica; sin embargo, en los años recientes algunas poblaciones muestran mayores niveles de F (>4 %; BN y BR), posiblemente debido al uso más intensivo de pocos sementales. Resultados intermedios a los valores de F obtenidos en este estudio han sido publicados para poblaciones de bovinos Tropicarne (1.8 %) y Suizo Europeo (1.5 %) de México(6), y en varias poblaciones pequeñas de bovinos (Alistana, Morucha, Pirenaica, Blanco Orejinegro, Romosinuano, Marchigniana, Bonsmara, Charolais, Limousin y Simmental, entre otras) reportadas por diversos autores(14,24,27,32). Los aumentos importantes en el porcentaje de animales consanguíneos y su consanguinidad promedio en la PR con relación a la PT, para las razas BN y SA, sugieren poca atención en la asignación de apareamientos de estas poblaciones en los años recientes.

Cuadro 5: Porcentajes de animales consanguíneos (PAF), del coeficiente de relación genética aditiva promedio (CRP), y del promedio de coeficientes de consanguinidad en la población (F-PO) y en los animales consanguíneos (F-AC) de las siete poblaciones bovinas mexicanas estudiadas, para la población total y la población de referencia* (dentro de paréntesis) Población total (población de referencia) AN

BN

BR

HE

LI

SA

SE

PAF

47.4 (75.8)

77.2 (94.9)

38.5 (60.4)

13.7 (30.9)

29.3 (44.9)

39.2 (71.4)

56.3 (95.7)

F-PO F-AC

0.9 (1.4)

3.5 (4.8)

2.6 (4.0)

0.9 (1.8)

0.9 (0.8)

0.9 (2.2)

1.5 (2.4)

2.0 (1.9)

4.6 (5.0)

6.8 (6.6)

6.2 (5.7)

2.9 (0.8)

2.3 (3.1)

2.7 (2.5)

CRP

0.5 (0.7)

5.2 (6.5)

1.7 (2.7)

0.3 (0.5)

0.5 (1.1)

1.0 (1.5)

1.1 (1.4)

AN= Angus; BN= Brangus Negro; BR= Brangus Rojo; HE= Hereford; LI= Limousin; SA= Salers; SE= Suizo Europeo. * Población de referencia (10 años más recientes).

Considerando los valores de todos los parámetros asociados con los F, las poblaciones BN y HE pudieran presentar problemas futuros, esta última debido a posibles subestimaciones en los parámetros, ya que tiene las mayores proporciones de padres y madres desconocidos (Cuadro 1), y menores integridades de sus pedigríes (Cuadros 2 y 3).

625


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Con la excepción de BN y BR, los CRP de las demás poblaciones fueron bajos (<1.5 %), lo que sugiere que la consanguinidad podría decrecer en las poblaciones si se practica migración entre hatos(14) dentro de poblaciones. Los CRP estimados en BN y BR (>1.7 %) sugiere problemas futuros para evitar apareamientos entre individuos no emparentados en esas poblaciones. Los CRP son indicadores de la consanguinidad a largo plazo en una población; cuando estos alcanzan valores mayores que los F, los apareamientos deben ser cuidadosamente planificados, para evitar apareamientos entre animales emparentados(33) y sugieren problemas de la población para mantener la variabilidad genética(34), como es el caso de BN del presente estudio. Al respecto, Gutiérrez et al(14) mencionan que un CRP bajo junto con un F alto en poblaciones, indica que la proporción de apareamientos dentro de hatos es alta y que el intercambio de animales entre hatos es poco frecuente. Una alternativa sugerida(35) es que los reproductores con un menor valor individual del CRP deben preferirse como progenitores de las próximas generaciones, para minimizar los incrementos de los F de los animales en el largo plazo. La selección de animales basada en el mejor predictor linear insesgado (BLUP) también favorece la selección de animales emparentados y, por tanto, da lugar a valores altos de F y CRP(36). En todas las poblaciones del presente estudio, los porcentajes de animales consanguíneos y los F a través del tiempo mostraron una tendencia gradual creciente (Figura 1); además, la implementación de evaluaciones genéticas en las poblaciones estudiadas, acicatea la necesidad de establecer estrategias para el control de la consanguinidad. En los 10 años más recientes, aunque en forma fluctuante para algunas razas, la tendencia fue de mantener los F, con la excepción de SA donde continuó el incremento gradual de F. Lo anterior sugiere atención de algunos criadores en la asignación de los apareamientos en los años recientes.

626


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Figura 1: Coeficientes de consanguinidad promedio (%) de las siete poblaciones bovinas mexicanas estudiadas

Tasa de incremento en consanguinidad y tamaño efectivo de la población

La ΔF y el Ne estimados en las razas de bovinos mexicanos estudiadas se muestran en el Cuadro 6. El Ne osciló entre 24 (SA) y 192 (LI). La ΔF se comportó de forma análoga al Ne, debido a que son inversamente proporcionales. Según la FAO(37), para la conservación y mejora de las poblaciones es deseable contar con un Ne mínimo de 50, que es equivalente al 1 % en la ΔF. De las poblaciones del presente estudio, sólo dos poblaciones (BR y SA) se encontraron por debajo del nivel recomendado por la FAO. Henson(38) señaló que la heterocigosidad o diversidad genética presente en cada generación decrece a una tasa acelerada en poblaciones con Ne menor que 100 y que el incremento en homocigosis como consecuencia de un Ne reducido resulta en la pérdida de habilidad adaptativa, depresión endogámica y por último la extinción. Esta situación sería preocupante en cuatro de las razas

627


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

analizadas en este estudio (BN, BR, HE y SA); sin embargo, dado el carácter transfronterizo de las razas estudiadas, es posible la migración y flujo de germoplasma entre países. Bajo este escenario, la entrada de genes nuevos a las poblaciones de bovinos de México, podría traer beneficios a la diversidad genética nacional; sin embargo, de no hacerse, podría afectar negativamente en el caso de diseminación masiva de material genético de pocos reproductores por diversas técnicas reproductivas en animales altamente seleccionados.

Cuadro 6: Tasas de incremento en consanguinidad promedio (∆𝐹) y tamaños efectivos de población (Ne) de las siete poblaciones bovinas mexicanas estudiadas, considerando los 10 años más recientes Población (raza) Parámetro

AN

BN

BR

HE

LI

SA

SE

∆𝐹 Ne

0.32 155

0.74 68

1.04 48

0.65 77

0.26 192

2.08 24

0.45 110

AN= Angus; BN= Brangus Negro; BR= Brangus Rojo; HE= Hereford; LI= Limousin; SA= Salers; SE= Suizo Europeo.

El Ne estimado a partir del incremento en consanguinidad individual ha sido evaluado en pedigríes simulados y reales de distintas especies(39,40,41). Danchin-Burge et al(40) realizaron una comparación entre tres distintas metodologías utilizadas en la obtención del Ne para ocho razas de ganado lechero francés, una mediante la obtención de la ΔF a partir de la regresión lineal del F sobre el tiempo, otra mediante el cálculo del incremento individual en el F, y la otra basada en el incremento en la coancestría. En general, el método de incremento individual en el F presentó valores mayores que los otros dos, donde la menor diferencia fue estimada en las poblaciones más grandes y con mejor calidad de pedigrí. Según Cervantes et al(39), la ΔF individual depende en gran parte de la calidad de pedigrí y necesita al menos cinco generaciones completas equivalentes para hacerse constante. Al respecto, se comenta que cuando la información de pedigrí es incompleta, puede provocar sesgos al estimar la ΔF y, en consecuencia, del Ne(12). Danchin-Burge et al(40) evaluaron el Ne a partir del ΔF individual, obteniendo valores de Ne entre 67 y 243 en ocho razas francesas de bovinos lecheros, mientras que en otro trabajo(41) obtuvieron un estimado de 94 en la raza Gir de Brasil. Por otro lado, valores reportados de Ne por otros métodos han sido extremadamente variables, donde las razas locales y lecheras especializadas son las que presentan los menores valores(14,23,26,28,42). En general, las poblaciones analizadas en el presente estudio se encontraron dentro del intervalo de la mayoría de valores publicados, excepto SA que tuvo un Ne inferior.

628


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Probabilidad de origen del gen

Los parámetros descriptivos de la probabilidad de origen del gen de las siete poblaciones estudiadas se muestran en el Cuadro 7. En general, las estimaciones de los parámetros relacionados con la probabilidad de origen de los genes indican que la presencia de contribuciones desbalanceadas del uso de los animales fundadores, los cuellos de botella genéticos y la deriva genética, han tenido un efecto importante en las poblaciones actuales (10 años más recientes), con la consecuente pérdida de diversidad genética.

Cuadro 7: Parámetros descriptivos de la probabilidad de origen de los genes estimados en las siete poblaciones bovinas mexicanas estudiadas, para la población total y la población de referencia* (dentro de paréntesis) Población total (población de referencia) Parámetro¥

AN

BN

BR

HE

LI

SA

SE

10,168 (9,019) 4,827 (3,622) 2,131 (1,855) 2,439 (1,618) 5,862 (4,214) 1,728 (1,134) 11,886 (3,412)

f fe

541 (431)

113 (97)

192 (125)

413 (308)

519 (299)

331 (237)

307 (246)

fa

224 (168)

33 (27)

55 (32)

254 (159)

199 (96)

105 (62)

166 (87)

fa / fe , %

41.4 (39.0)

29.2 (27.8)

28.6 (25.6)

61.5 (51.6)

38.3 (32.1)

31.7 (26.2)

54.1 (35.4)

189

19

54

361

187

90

93

Cmax , %

3.2 (3.4)

13.0 (14.6)

9.3 (11.9)

1.5 (2.3)

2.6 (4.2)

4.4 (6.3)

3.1 (3.8)

N50

177 (102)

16 (12)

44 (16)

94 (56)

100 (190)

44 (25)

42 (31)

fg

AN= Angus; BN= Brangus Negro; BR= Brangus Rojo; HE= Hereford; LI= Limousin; SA= Salers; SE= Suizo Europeo. * Población de referencia (10 años más recientes). ¥ f= número total de fundadores; fe= número efectivo de fundadores; fa= número efectivo de ancestros; Cmax= contribución del principal ancestro; N50= número de ancestros que contribuyen con el 50 % de los genes a la población; fg= número efectivo de genomas fundadores.

Los valores de los f fueron mayores que los fe, lo que indica disminución en diversidad genética, debido a desbalances en el uso de los animales fundadores. En porcentaje, la contribución desigual de los fundadores (fe/f) en las PT fue más importante en AN, BN y SE (2.3 a 5.3 %) que en BR, HE, LI y SA (8.9 a 19.2 %); valores que fueron similares en las respectivas PR, con sólo ligera mejora detectada para SE. La contribución desigual de los fundadores es indicador de posibles incrementos en consanguinidad para generaciones futuras, lo que reflejaría la pérdida de diversidad genética (reducción de heterocigosidad y pocas variantes alélicas por locus) presente en los fundadores(20). En el presente estudio, la contribución muy desbalanceada de los fundadores implica que un reducido número de animales se están utilizando como reproductores en BR, LI y SA, mientras que en ese 629


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

indicador para HE, adicionalmente pudiera tener influencia la poca integridad del pedigrí. Al respecto, Boichard et al(12) señalan que en poblaciones con baja calidad de pedigrí puede existir una gran cantidad de fundadores fantasmas, lo que provoca sobreestimaciones del f y fe. Algunas poblaciones de razas de bovinos para carne transfronterizas (Chianina, Marchigniana, Romagnola y Nelore) han mostrado una baja relación (0.23 a 1.09 %) en los parámetros mencionados(22,43). No obstante, valores similares a los de este estudio han sido reportados en otros estudios con razas bovinas para carne (Charolais, Limousin, Hereford, Angus y Simmental)(23,28). En el presente estudio, el fa estimado en las siete poblaciones bovinas analizadas fue menor que su respectivo fe, lo que indica disminución en la diversidad genética por la presencia de cuellos de botella genéticos en todas las poblaciones, definidas a partir de su fundación. Los efectos del cuello de botella fueron más importantes en los pedigríes de las PT para AN, BN, BR, LI y SA (fa/fe <50%), mientras que para HE y SE se estimaron valores mayores que 50 %. Lo anterior podría sugerir un efecto pequeño de los cuellos de botella genéticos en esas últimas poblaciones; sin embargo, la información debe considerarse con cautela en HE, dado que esa población es la que presentó peor integridad de pedigrí. De acuerdo con algunos autores(12), los parámetros derivados de la probabilidad de origen del gen son sensibles a la calidad del pedigrí, aunque en menor grado que el F, siendo el fa el más afectado. Los cuellos de botella fueron más estrechos (fa/fe entre 26 y 52%) para todas las poblaciones en los 10 años más recientes (PR), lo que indica la necesidad de establecer medidas para incrementar la diversidad genética. A partir de las contribuciones marginales consideradas en la estimación de los fa, es posible identificar a los ancestros más sobresalientes por su contribución marginal relativa a la diversidad genética de la población en estudio(12). Con base en ello, el número de ancestros que explicaron el 50 % de la diversidad genética presente para la PT en cada una de las siete poblaciones estudiadas fue variable, fluctuando desde 16 individuos en BN hasta 177 en AN (Cuadro 7), y con disminuciones para las respectivas PR. Las altas contribuciones marginales de algunos ancestros provocaron que el número de individuos que explican el 50 % de la diversidad genética presente en las poblaciones bajo estudio muestren una relativamente reducida base genética. Diversos autores han reportado cantidades menores que 10 individuos(6,32,40,42), valores menores que en las poblaciones estudiadas en la presente investigación. Sin embargo, estas contribuciones de los ancestros a los genes de las respectivas poblaciones deben ser consideradas por los criadores, debido a que la alta presencia de genes de unos pocos reproductores en las poblaciones podría llevar a un incremento de apareamientos entre animales emparentados, consecuentemente a la generación de individuos consanguíneos y pérdida de variabilidad genética. En general, los fa fueron mayores que los fg de las PT, sugiriendo disminuciones, de ligeras a moderadas, en la diversidad genética por la presencia de pérdidas aleatorias de alelos en todas

630


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

las poblaciones (deriva genética), desde los progenitores fundadores a sus progenies, por lo que se recomienda el uso de un rango más amplio de sementales.

Conclusiones e implicaciones

La diversidad genética presente en las poblaciones de bovinos mexicanas evaluadas fue variable. Aunque en todas las poblaciones los coeficientes de consanguinidad promedio fueron relativamente bajos, en algunas se detectaron problemas de pocos reproductores utilizados, tamaño efectivo de población pequeño y potenciales problemas con apareamientos entre individuos emparentados, presentando (en mayor o menor grado) pérdidas en diversidad genética por contribuciones desbalanceadas del uso de los animales fundadores, cuellos de botella genéticos y deriva genética. Considerando los parámetros estudiados, las poblaciones AN, LI y SE fueron las que presentaron la mayor diversidad genética. En SA se requiere incrementar su tamaño efectivo de población, el uso de mayor diversidad en reproductores y la atención en la asignación de apareamientos. Las razas BN, BR y HE presentaron las mayores pérdidas de diversidad genética e incrementos en consanguinidad, por lo que se deben implementar estrategias para mantener su variabilidad genética futura; específicamente en HE se debe mejorar la integridad y completitud de su pedigrí, ya que afecta la estimación de algunos de los parámetros y su interpretación apropiada. A pesar que se detectan esfuerzos recientes de los criadores en el registro de información genealógica de sus animales, se recomienda continuar con el monitoreo de parámetros relacionados con la diversidad genética y la captura de información de pedigrí. Además, aunque se trata de razas transfronterizas, es necesario implementar estrategias para incrementar sus tamaños efectivos, evitar los incrementos en consanguinidad y las pérdidas de diversidad genética, mediante los diseños de apareamientos y el uso estratégico de migración con genes provenientes de otros países.

631


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Agradecimientos

Se agradece a las Asociaciones Mexicanas de Criadores de Ganado: Angus, Brangus, Hereford, Limousin, Salers y Suizo Europeo, por facilitar las bases de datos genealógicos para el presente estudio; y al Consejo Nacional de Ciencia y Tecnología por el financiamiento para los estudios de Maestría del segundo autor.

Literatura citada: 1.

Santana Jr. ML, Pereira RJ, Bignardi AB, Ayres DR, Menezes GRO, Silva LOC, et al. Structure and genetic diversity of Brazilian Zebu cattle breeds assessed by pedigree analysis. Livest Sci 2016;187:6-15.

2.

Sheikhlou M, Abbasi MA. Genetic diversity of Iranian Lori-Bakhtiari sheep assessed by pedigree analysis. Small Ruminant Res 2016;141:99-105.

3.

Bernardes PA, Grossi DA, Savegnago RP, Buzanskas ME, Ramos SB, Romanzini EP, et al. Population structure of Tabapuã beef cattle using pedigree analysis. Livest Sci 2016;187:96-101.

4.

Abeledo CM, Santana I, Hernández S, Acuña N, Gutiérrez M, Brache JF, et al. Parámetros poblacionales en cerdos CC21 cubanos a partir de su información genealógica. AICA 2017;9:122-128.

5.

Barros EA, Brasil LHA, Tejero JP, Delgado-Bermejo JV, Ribeiro MN. Population structure and genetic variability of the Segureña sheep breed through pedigree analysis and inbreeding effects on growth traits. Small Ruminant Res 2017;149:128-133.

6.

Ruíz-Flores A, Núñez-Domínguez R, Ramírez-Valverde R, Domínguez-Viveros J, Mendoza-Domínguez M, Martínez-Cuevas E. Niveles y efectos de la consanguinidad en variables de crecimiento y reproductivas en bovinos Tropicarne y Suizo Europeo. Agrociencia 2006;40:289-301.

7.

Domínguez-Viveros J, Rodríguez-Almeida FA, Ortega-Gutiérrez JA, SantellanoEstrada E. Análisis de la información genealógica y estimación de parámetros de poblaciones en bovinos de Lidia y equinos de pura raza española de México. Rev Cient FCV-LUZ 2012;22:443-450. 632


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

8.

Ramírez-Valverde R, Núñez-Domínguez R, Fabián-Ramos E. Caracterización de las publicaciones sobre mejoramiento genético animal en revistas científicas mexicanas. Ecosist Recur Agropec 2014;1(1):59-72.

9.

Belonsky GM, Kennedy BW. Selection on individual phenotype and best linear unbiased predictor of breeding values in a closed swine herd. J Anim Sci 1988;66(5):1124–1131.

10. Ríos UA. Evaluación genética nacional. En: Montaño BM, Martínez VG editores. Guía técnica de control de producción y mejoramiento genético en bovinos para carne. México, DF. Editado por SAGARPA-CONARGEN; 2010:32-44. 11. Gutiérrez JP, Goyache F. A note on Endog: a computer program for analyzing pedigree information. J Anim Breed Genet 2005;122:172-176. 12. Boichard D, Maignel L, Verrier E. The value of using probabilities of gene origin to measure genetic variability in a population. Genet Sel Evol 1997;29:5-23. 13. Boichard D, Maignel L, Verrier E. Analyse généalogique des races bovines laitières françaises. Prod Anim 1996;9(5):323-335. 14. Gutiérrez JP, Altarrabia J, Díaz C, Quintanilla R, Cañón J, Piedrafita J. Pedigree analysis of eight Spanish beef cattle breeds. Genet Sel Evol 2003;35:43-63. 15. Meuwissen THE, Luo Z. Computing inbreeding coefficients in large populations. Genet Sel Evol 1992;24:305-3013. 16. Cervantes N. Estructura genética del caballo de pura raza árabe español y su influencia en razas derivadas: aplicación de nuevas metodologías en el cálculo del tamaño efectivo [tesis doctoral]. Madrid, España. Universidad Complutense de Madrid; 2008. 17. Wright S. Evolution in Mendelian populations. Genetics 1931;16:97-159. 18. Gutiérrez JP, Cervantes I, Molina A, Valera M, Goyache F. Individual increase in inbreeding allows estimating realized effective sizes from pedigrees. Genet Sel Evol 2008;40:359-378. 19. Gutiérrez JP, Cervantes I, Goyache F. Improving the estimation of realized effective population sizes in farm animals. J Anim Breed Genet 2009;126:327-332. 20. Lacy R. Analysis of founder representation in pedigrees: founder equivalents and founder genome equivalents. Zoo Biol 1989;14:565-578. 21. Ballou JD, Lacy RC. Identifying genetically important individuals for management of genetic variation in pedigreed populations. In: Ballou JD, et al, editors. Population

633


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

management for survival and recovery: Analytical methods and strategies in small population management. New York, USA: Columbia University Press; 1995:76-111. 22. Bozzi R, Franci O, Forabosco F, Pugliese C, Crovetti A, Filippini F. Genetic variability in three Italian beef cattle breeds derived from pedigree information. Ital J Anim Sci 2006;5:129-137. 23. Bouquet A, Venot E, Laloë D, Forabosco F, Fogh A, Pabiou T, et al. Genetic structure of the European Charolais and Limousin cattle metapopulations using pedigree analyses. J Anim Sci 2011;89:1719-1730. 24. Martínez RA, García D, Gallego JL, Onofre G, Pérez J, Cañón J. Genetic variability in Colombian Creole cattle populations estimated by pedigree information. J Anim Sci 2008;86:545–552. 25. Peixoto MGCD, Poggian CF, Verneque RS, Egito AA, Carvalho MRS, Penna VM, et al. Genetic basis and inbreeding in the Brazilian Guzerat (Bos indicus) subpopulation selected for milk production. Livest Sci 2010;131:168-174. 26. Maignel L, Boichard D, Verrier E. Genetic variability of French dairy breeds estimated from pedigree information. Interbull Bulletin 1996;14:49-54. 27. Santana Jr. ML, Oliveira PS, Eler JP, Gutiérrez JP, Ferraz JBS. Pedigree analysis and inbreeding depression on growth traits in Brazilian Marchiguiana and Bonsmara breeds. J Anim Sci 2012;90:99-108. 28. Mc Parland S, Kearney JF, Rath M, Berry DP. Inbreeding trends and pedigree analysis of Irish dairy and beef cattle populations. J Anim Sci 2007;85:322-331. 29. Carolino N, Gama LT. Indicators of genetic erosion in an endangered population: The Alentejana cattle breed in Portugal. J Anim Sci 2008;86:47-56. 30. Gebremariam W, Forabosco F, Zumbach B, Palucci V, Jorjani H. Characterization of the global Brown Swiss cattle population structure. Interbull Bulletin 2010;42:16-20. 31. Pirchner F. Population genetics in animal breeding. New York, USA: Plenum Press; 1983. 32. Kadlecík O, Pavlík I. Genealogical analysis in small populations: The case of four Slovak beef cattle breeds. Slovak J Anim Sci 2012;45:111-117. 33. Goyache F, Gutiérrez JP, Fernández I, Gómez E, Álvarez I, Díez J, et al. Using pedigree information to monitor genetic variability of endangered populations: The Xalda sheep breed of Asturias as an example. J Anim Breed Genet 2003;120:95-105.

634


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

34. Ivanković A, Ramljak J, Kelava N, Konjačić M. Pedigree analysis of the Croatian autochthonous cattle breeds: Management of conservation strategy. Stočarstvo 2010;63:3-15. 35. Dunner S, Checa ML, Gutiérrez JP, Martin JP, Cañon J. Genetic analysis and management in small populations: The Asturcon pony as an example. Genet Sel Evol 1998;30:397-405. 36. Verrier E, Colleau JJ, Foulley JL. Long-term effects of selection based on the animal model BLUP in a finite population. Theor Appl Genet 1993;87:446-454. 37. FAO. Secondary guidelines for development of national farm animal genetic resources management plans: Management of small populations at risk. Rome, Italy: FAO; 1998. 38. Henson EL. In-situ conservation of livestock and poultry. Rome, Italy: FAO Animal Production and Health Paper 99; 1992. 39. Cervantes I, Goyache F, Molina A, Valera M, Gutiérrez JP. Application of individual increase in inbreeding to estimate effective sizes from real pedigrees. J Anim Breed Genet 2008;125:301-310. 40. Danchin-Burge C, Leroy G, Brochard M, Moureaux S, Verrier E. Evolution of the genetic variability of eight French dairy cattle breeds assessed by pedigree analysis. J Anim Breed Genet 2012;129:206-217. 41. Santana Jr. ML, Pereira RJ, Bignardi AB, El Faro L, Tonhati H, Albuquerque LG. History, structure, and genetic diversity of Brazilian Gir cattle. Livest Sci 2014;163:2633. 42. Sorensen AC, Sorensen MK, Berg P. Inbreeding in Danish dairy cattle breeds. J Dairy Sci 2005;88:1865-1872. 43. Vozzi PA, Marcondes CR, Magnabosco CU, Bezerra LAF, Lobo RB. Structure and genetic variability in Nellore (Bos indicus) cattle by pedigree analysis. Genet Mol Biol 2006;29:482-485.

635


http://dx.doi.org/ 10.22319/rmcp.v9i4.4296 Artículo

Construcción de un índice de selección para rasgos de comportamiento en toros de lidia Building of a selection index for behavioral traits in fighting bulls

Joel Domínguez-Viverosa* Felipe Alonso Rodríguez-Almeidaa Nicolás Callejas-Juáreza, Nelson Guadalupe Aguilar-Palmaa Juan Ángel Ortega-Gutiérreza

a

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología. Periférico Francisco R. Almada, km 1. Chihuahua, Chih. México.

* Autor de correspondencia: joeldguezviveros@yahoo.com.mx

Resumen: En la ganadería de lidia, la selección está en función del desempeño del toro durante la lidia. Posición de la cabeza (PC) y de las manos (PM), recorrido del toro (RE) y modo de finalizar (FI) la embestida define el desempeño del toro, y pueden ser considerados como criterios de selección. El objetivo fue estimar heredabilidades (h2) y correlaciones genéticas (rg) para PC, PM, FI y RE; y construir dos índices de selección: IS1 con valores relativos de un análisis factorial, IS2 con valores relativos a partir de la desviación estándar de cada rasgo. Se calculó la respuesta a la selección (RS) y exactitud (EX) de cada IS. El número de observaciones (valor promedio ± desviación estándar) para PC, PM, RE y FI fue 984 (5.46 ± 1.4), 978 (2.93 ± 1.1), 981 (3.15 ± 0.7) y 785 (2.88 ± 1.1), respectivamente; con escalas de uno a siete para


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

PC, y de uno a cinco para el resto de las variables. Para h2 y rg se realizó un análisis multivariado con el software MTDFREML. La h2 fue de 0.20 ± 0.06, 0.15 ± 0.05, 0.13 ± 0.03 y 0.17 ± 0.05 para PC, RE, PM y FI, respectivamente; todas las rg fueron positivas, de 0.57 a 0.94, con valor promedio de 0.753. IS1 = 0.068*PC + 0.048*RE - 0.012*PM + 0.088*FI; con EX de 0.46 y RS de 0.325. IS2 = 0.231*PC + 0.249*RE - 0.038*PM + 0.298*FI; con EX de 0.45 y RS de 1.15. Palabras clave: Parámetros genéticos, Análisis multivariado, Mejoramiento genético, Respuesta selección.

Abstract: In Lidia cattle breed, the selection is based on the performance of the bull during the fighting. Head position (HP) and hands (PH), course of the bull (CB) and finish of the onslaught (FO), define the performance of the bull, and can be implemented as selection criteria. The objective was to estimate heritability (h2) and genetic correlation (rg) for HP, PH, CB and FO; and building two selection indexes: IS1 with relative values of factorial analysis, IS2 by relative values from the standard deviation of each trait. The response to selection (RS) and accuracy (AC) were calculated. The number of observations (average ± standard deviation) value for HP, PH, CB and FO were 984 (5.46 ± 1.4), 978 (2.93 ± 1.1), 981 (3.15 ± 0.7) and 785 (2.88 ± 1.1), respectively; with scales of one to seven for HP, and one to five for the rest of the variables. For h2 and rg a multivariate analysis was performed with MTDFREML software. The h2 was of 0.20 ± 0.06, 0.15 ± 0.05, 0.13 ± 0.03 y 0.17 ± 0.05 for HP, CB, PH y FO, respectively. All rg were positive, from 0.57 to 0.94, with average value of 0.753. IS1 = 0.068*HP + 0.048*CB - 0.012*PH + 0.088*FO; with AC of 0.46 and RS of 0.325. IS2 = 0.231*HP + 0.249*CB - 0.038*PH + 0.298*FO; with AC of 0.45 and RS of 1.15. Key words: Genetic parameters, Multivariate analysis, Genetic improvement, Selection response.

Recibido 11/10/2016 Aceptado 19/06/2017

637


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Introducción

En la ganadería de lidia, los objetivos de selección están en función del desempeño del toro durante la lidia, valorando caracteres de comportamiento como agresividad y bravura, los cuales han diferenciado y caracterizado a esta raza de bovinos. A la lidia solo se envían los machos, y los criadores evalúan el desempeño del toro con dos notas de comportamiento: la lidia al caballo (LC), que se refiere a la embestida sobre el caballo y la respuesta a la pulla; y la lidia al torero (LT), que resume el comportamiento y desenvolvimiento con relación al torero(1). Un toro bravo es aquel individuo que decide atacar o embestir al torero o al caballo, el cómo desarrollar el ataque o la agresión permite identificar o clasificar el nivel de bravura de esta raza de bovinos. Las notas de LC y LT son un resumen general del comportamiento del toro; sin embargo, existen otros rasgos que explican las diferencias en el desempeño del toro al realizar la agresión, la posición de la cabeza (PC) y posición de las manos (PM), definen la postura y el estilo del toro al realizar el ataque; el recorrido del toro (RE) sobre la muleta y el modo de finalizar (FI) la acometida, representan la movilidad y la emotividad del toro al embestir. Las cuatro variables (PC, PM, RE y FI) en su conjunto definen el desempeño del toro en función de la bravura y pueden ser implementadas como criterios de selección. En el establecimiento de programas de mejoramiento genético, la definición de criterios de selección requiere cuantificar la proporción de los posibles efectos genéticos y ambientales, que inciden sobre la variabilidad total de la población(2); del mismo modo, considerar dos o más características en los criterios de selección, requiere implementar un método de selección para caracteres múltiples, como es el caso del índice de selección(3). El índice de selección permite la predicción de valores genéticos de los candidatos a selección, aplicando ponderaciones a los valores fenotípicos con propiedades de mejor predictor lineal, además: a) minimiza el error de predicción, b) maximiza la exactitud en las predicciones, así como la respuesta a la selección, y c) maximiza la probabilidad de ordenar correctamente a los animales con base en el arreglo de valor aditivo(4,5). Los objetivos del presente estudio fueron: a) estimar parámetros genéticos para los rasgos de PC, PM, FI y RE; y, b) generar un índice de selección con base en los cuatro rasgos analizados.

Material y métodos

La base de datos con la información genealógica y de variables de comportamiento fue proporcionada por la ganadería Los Encinos, ubicada en el estado de Querétaro; datos

638


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

particulares del origen, conformaciĂłn y sistema de producciĂłn, asĂ­ como estudios previos sobre estructura del pedigrĂ­ y parĂĄmetros de poblaciones fueron publicados por Castillo(6) y DomĂ­nguez-Viveros et al(7). Se analizĂł la informaciĂłn de PC, PM, RE y FI; durante la lidia el ganadero evaluĂł el desempeĂąo del toro y al final asignĂł una anotaciĂłn para cada uno de los rasgos, con escalas de uno a siete para PC, y de uno a cinco para el resto de las variables, concediendo el valor mĂĄs alto al mejor. El nĂşmero de observaciones (valor promedio Âą desviaciĂłn estĂĄndar) para PC, PM, RE y FI fue 984 (5.46 Âą 1.4), 978 (2.93 Âą 1.1), 981 (3.15 Âą 0.7) y 785 (2.88 Âą 1.1), respectivamente; los toros con informaciĂłn de comportamiento son nacidos de 1994 a 2013, y las valoraciones se realizaron por un solo evaluador. Posterior al proceso de ediciĂłn, con la prueba estadĂ­stica de Kolmogorov se verificĂł que las variables analizadas cumplieran con las especificaciones de normalidad; ademĂĄs, se realizaron anĂĄlisis de varianza para caracterizar a la poblaciĂłn en funciĂłn de los efectos ambientales y definir la estructura de grupos contemporĂĄneos(1,8,9); los anĂĄlisis se realizaron con los procedimientos UNIVARIATE y GLM, del programa para anĂĄlisis estadĂ­stico SAS(10). Para la estimaciĂłn de parĂĄmetros genĂŠticos, se realizĂł un anĂĄlisis multivariado con las cuatro variables, a partir del modelo mixto: y = Xb + Za + e; donde y es el vector de registros; b es el vector de efectos fijos, que incluyĂł los grupos contemporĂĄneos definidos por la combinaciĂłn de aĂąo y ĂŠpoca de nacimiento, mĂĄs la covariable de edad del individuo a la lidia en funciĂłn lineal y cuadrĂĄtica; a es el vector de efectos aleatorios, genĂŠticos aditivos directos; e es el vector de efectos residuales aleatorios; X y Z son matrices de incidencia que relacionan a las observaciones en y con los respectivos đ?&#x2018;Śđ?&#x2018;&#x2013; efectos. El arreglo matricial para el anĂĄlisis multivariado quedĂł definido como: [đ?&#x2018;Ś ] = đ?&#x2018;&#x2014; đ?&#x2018;&#x2019;đ?&#x2018;&#x2013; đ?&#x2018;Ľđ?&#x2018;&#x2013; 0 đ?&#x2018;?đ?&#x2018;&#x2013; đ?&#x2018;§đ?&#x2018;&#x2013; 0 đ?&#x2018;&#x17D;đ?&#x2018;&#x2013; [ 0 đ?&#x2018;Ľ ] [ ] + [ 0 đ?&#x2018;§ ] [đ?&#x2018;&#x17D; ] + [đ?&#x2018;&#x2019; ]. La dimensiĂłn y estructura de las matrices X y Z estuvo đ?&#x2018;&#x2014; đ?&#x2018;&#x2014; đ?&#x2018;&#x2014; đ?&#x2018;?đ?&#x2018;&#x2014; đ?&#x2018;&#x2014; en funciĂłn del nĂşmero de individuos (N) con datos de comportamiento para cada variable analizada; las suposiciones del modelo fueron: E[y]=Xβ, E[a]=0 y E[e]=0, y la estructura de 2 đ??´đ?&#x153;&#x17D;đ?&#x2018;&#x17D;đ?&#x2018;&#x2013; đ??´đ?&#x153;&#x17D;đ?&#x2018;&#x17D;đ?&#x2018;&#x2013;đ?&#x2018;&#x17D;đ?&#x2018;&#x2014; 0 0 đ?&#x2018;&#x17D; đ?&#x2018;&#x2013;

2 đ??´đ?&#x153;&#x17D;đ?&#x2018;&#x17D;đ?&#x2018;&#x2013;đ?&#x2018;&#x17D;đ?&#x2018;&#x2014; đ??´đ?&#x153;&#x17D;đ?&#x2018;&#x17D;đ?&#x2018;&#x2014; 0 0 đ?&#x2018;&#x17D;đ?&#x2018;&#x2014; varianzas y covarianzas quedo de la siguiente forma: đ?&#x2018;&#x2030;đ?&#x2018;&#x17D;đ?&#x2018;&#x; [ đ?&#x2018;&#x2019; ] = , 2 đ?&#x2018;&#x2013; 0 0 đ??źđ?&#x2018; đ?&#x153;&#x17D;đ?&#x2018;&#x2019;đ?&#x2018;&#x2013; đ?&#x153;&#x17D;đ?&#x2018;&#x2019;đ?&#x2018;&#x2013;đ?&#x2018;&#x2019;đ?&#x2018;&#x2014; đ?&#x2018;&#x2019;đ?&#x2018;&#x2014; 2 0 đ?&#x153;&#x17D;đ?&#x2018;&#x2019;đ?&#x2018;&#x2013;đ?&#x2018;&#x2019;đ?&#x2018;&#x2014; đ??źđ?&#x2018; đ?&#x153;&#x17D;đ?&#x2018;&#x2019;đ?&#x2018;&#x2014; [0 ] donde: A, es la matriz con todas las relaciones genĂŠticas aditivas (parentesco) entre todos los animales en el pedigrĂ­; Ď&#x192;2ai= varianzas de efectos genĂŠticos aditivos directos; Ď&#x192;aiaj= covarianzas entre efectos genĂŠticos aditivos directos; Ď&#x192;2ei= varianzas residuales; Ď&#x192;eiej= covarianzas entre efectos residuales. El pedigrĂ­ estuvo conformado por 8019 individuos

639


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

nacidos de 1964 a 2015. Con el procedimiento de máxima verosimilitud restringida, y libre de derivadas, se estimó las (co)varianzas genéticas y fenotípicas (σ2p); así como la heredabilidad (h2 = σ2a / σ2p) para cada variable, y las correlaciones genéticas (rg = σaiaj / σai*σaj) a través de las cuatro variables de estudio; el análisis se realizó con el software MTDFREML(11). Para la construcción del índice de selección (IS), el objetivo de selección (H) está definido por una función lineal de los valores genético aditivos (g), ponderados por los valores económicos o relativos (a) de las características consideradas en los criterios de selección: H = a1g1 + a2g2 + a3g3 + a4g4. El IS se definió como una función lineal de I = b1x1 + b2x2 + b3x3 + b4x4; la estimación de los bi se realizó a partir de(4,5) Pb = Ga, y se resolvió como b = P-1Ga, donde: P= matriz simétrica con la estructura de varianzas (en la diagonal) y covarianzas (fuera de la diagonal) fenotípicas; G= matriz simétrica de (co)varianzas genéticas; b= vector con los coeficientes de regresión múltiple para cada característica; xi = valor fenotípico de la i-ésima característica considerada en el criterio de selección, expresada como una desviación de su media; a= vector de valores relativos (VR) o de proporción, los cuales fueron calculados en dos modalidades: VR1 = valores relativos estimados a través de un análisis de factorial (AF); y, VR2 = valores relativos asignados a una desviación estándar del cambio de cada carácter, específicamente, los pesos fueron los recíprocos (1/p = p / 2p) de la desviación estándar fenotípica(5,12). El AF(13,14), a través de la matriz correlaciones, tiende a explicar una variable observada (Z) por un número de variables latentes, o no observadas, que se denominan factores (F); en el modelo de análisis factorial, cada variable Z será una combinación de los F más de los errores (e). La variable Z define el comportamiento del toro durante la lidia, los F son los rasgos analizados, y el AF se realizó con la matriz de correlaciones fenotípicas. Los rasgos analizados (F) se encuentran correlacionados, dado que comparten algo en común, y algo que los diferencia; las diferencias en Z se deben a los F que comparten (comunalidad) y a los factores específicos o propios (especificidad). En términos de varianzas, la varianza en Z se debe a la varianza de comunalidad más la variabilidad especifica; el vector de valores relativos (a) se obtuvo a partir de los elementos de la varianza de comunalidad, los cuales se ajustaron a términos de proporción de la suma total; el valor a proporción de cada rasgo, expresó cuánto de la varianza común en Z es explicado por el rasgo en particular. Con los vectores de valores relativos, se generaron dos índices de selección: IS1 para VR1, e IS2 para VR2. Se estimó la varianza de cada IS(15,16,17) (2IS = b´Pb) y del H (2H = a´Ga), así como las covarianzas (IS,H = b´Ga) y las correlaciones: rIS,H = IS,H /IS*H = b´Ga / (b´Pb)0.5(a´Ga)0.5. La correlación rIS,H establece la exactitud del IS, y permitió estimar la respuesta a la selección, SH = i*rIS,H*H; donde i es la intensidad de selección, y H = (2H)0.5; para i se utilizó el valor promedio de 1.735, a partir de una presión de selección del 50 % en vaquillas y del 1 % en machos, dado las características de la ganadería de toros de lidia(7).

640


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Los análisis del AF y las operaciones con matrices del IS se realizaron con los procedimientos FACTOR e IML, del programa para análisis estadísticos SAS(10).

Resultados y discusión

En el Cuadro 1 se presentan los resultados para las h2 y rg a través de las cuatro variables analizadas; así como los VR1 y VR2 utilizados en los IS. La h2 promedio fue de 0.163, con un valor mínimo de 0.13 ± 0.03; las h2 pueden ubicarse como de medio a bajo índice de herencia, como criterio de selección la respuesta a la selección va a ser muy baja, por lo que debe acompañarse de características con valores de índice de herencia de medio a alto, y sus valores de correlación genética, para mejorar el pronóstico. Todas las rg fueron positivas con un valor promedio de 0.753, en un rango de 0.57 ± 0.11 a 0.94 ± 0.18; estos rasgos que determinan el comportamiento del toro en la lidia están asociadas genéticamente, y la posible respuesta a la selección correlacionada, o de manera conjunta, sería en el mismo sentido. Los IS construidos fueron: IS1 = 0.068*PC + 0.048*RE - 0.012*PM + 0.088*FI, con los componentes: 2IS = 0.033, 2H = 0.161, rIS,H = 0.46, y SH = 0.325. De igual forma, IS2 = 0.231*PC + 0.249*RE - 0.038*PM + 0.298*FI, con sus componentes: 2IS = 0.446, 2H = 2.17, rIS,H = 0.45, y SH = 1.15.

Cuadro 1: Valores relativos y parámetros genéticos para los rasgos que determinan el comportamiento del toro de lidia PC PC RE PM FI

0.20±0.06 0.57±0.11 0.69±0.13 0.90±0.18

Parámetros genéticos RE PM 0.15±0.05 0.72±0.15 0.70±0.16

0.13±0.03 0.94±0.18

FI

0.17±0.05

Valores relativos FC VR1 VR2 0.834 0.24 0.714 0.785 0.23 1.428 0.899 0.26 0.909 0.916 0.27 0.919

PC= posición de la cabeza, RE= recorrido, PM= posición de las manos, F= finalización. Estimaciones de heredabilidad (± error estándar) en la diagonal, y de correlaciones genéticas bajo la diagonal. FC= vector resultado del análisis factorial. VR1= vector de valores a proporción, a partir del análisis factorial. VR2= vector de valores relativos, producto del reciproco de la desviación estándar fenotípica (1/p).

641


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

En estudios afines, Pelayo et al(18) estimaron h2 en un intervalo de 0.13 a 0.41, con valor promedio de 0.29, para doce variables asociadas al desempeño del toro; además, el 93.9 % de las rg fueron positivas en el intervalo de 0.01 a 0.90, las rg negativas (6.1 %) oscilaron entre -0.17 y -0.38. Asimismo, con un análisis multivariado (correlaciones canónicas) reagruparon las doce variables analizadas a través de tres índices de selección, en función de tres criterios de selección: agresividad, fuerza de ataque y movilidad. En España(19) analizaron catorce variables relacionadas con el comportamiento de los toros durante la lidia, y estimaron h2 en un intervalo de 0.08 a 0.35, con un promedio general de 0.25; de la misma forma, Silva et al(20) para variables asociadas a la lidia como agresividad, ferocidad y movilidad, publicaron estimaciones de h2 en un intervalo de 0.28 a 0.36. En la ganadería de lidia mexicana las notas de LC y LT son los principales criterios de selección; DomínguezViveros et al(1) publicaron h2 de 0.09 para LC y 0.18 para LT, para la ganadería del presente estudio; de igual forma, reportaron h2 en un intervalo de 0.16 a 0.47 para LC, y de 0.22 a 41 para LT, de otras tres ganaderías mexicanas de lidia. En su contexto, el IS maximiza la exactitud en las predicciones, así como la respuesta a la selección(4,5); la exactitud del IS1 e IS2 fueron similares; las diferencias en respuesta a la selección (0.325 vs 1.15) se atribuyen a la estructura y efectos de los valores relativos (VR1 y VR2) sobre la desviación estándar del índice (H). En la ganadería de lidia el proceso de selección se realiza en la tienta; los toros evaluados durante la lidia aportan información que se utiliza para la selección; sin embargo, la lidia finaliza con la muerte del toro. La tienta es una prueba de comportamiento similar a la lidia, sin sacrificio del animal y se realiza alrededor de los dos años de edad; en esta prueba se evalúa el comportamiento del animal y la expresión de los rasgos que determinan la calidad y el desarrollo de la lidia. En machos la selección se enfoca en tres aspectos: prospectos a semental, clasificación de los toros para los diferentes festejos o corridas, y desechos; en hembras, la selección se enfoca en vaquillas para reemplazo y desechos. Con el IS, el criador podrá jerarquizar a los prospectos en función de los tres aspectos de selección, con base en el valor genético aditivo, y maximizando la probabilidad de ordenar correctamente a los animales con arreglo a su valor aditivo en función de los cuatro rasgos(15). Un IS, es una herramienta muy específica de una ganadería de lidia; el IS se realiza en función de los objetivos de selección, sus características y cualidades dependen de la estructura, calidad y cantidad de información genealógica y de comportamiento, de los parámetros genéticos asociados a los criterios de selección, así como la importancia relativa o porcentual de cada criterio de selección, entre otras variantes(21,22). La apreciación, clasificación y valoración de los objetivos de selección difieren a través de ganadería; un IS es estricto dentro de ganadería, cada criador o evaluador tiene una apreciación diferente del buen comportamiento o calidad del desempeño del toro durante la lidia. El IS permite separar individuos con base en la evaluación simultánea de varios caracteres; cada IS tiene una eficiencia diferente, depende de las características que incluya, sus valores relativos, la

642


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

variabilidad genética y fenotípica y sus valores de correlaciones entre ellas, el IS que proporcione la ganancia genética máxima por unidad de tiempo es el mejor(23). El toro de lidia como raza especializada, posee su patrón racial denominado “trapío”, y las características que definen la bravura (en lo particular y correlacionadas) están asociadas al desempeño durante la lidia, que a través del tiempo le han ido delimitando y atribuyendo los criadores; estos sistemas de producción y las características de su mercado, dado las diversas plazas o festejos donde van los toros a la lidia, tienen sus contrastes que deben considerarse al establecer un programa de mejoramiento genético con base en selección. Sánchez et al(24) calificaron el comportamiento del toro en la lidia a través de 21 rasgos específicos, y posterior a un análisis multivariado con base en componentes principales, definieron el desempeño del toro a través de cuatro componentes: decisión de ataque o bravura en la muleta; decisión o bravura al caballo; calidad de la embestida a la muleta; postura y progreso de la lidia.

Conclusiones e implicaciones

Las heredabilidades para los rasgos analizados quedaron en el intervalo de 0.13 a 0.20; aunque de mediana a baja magnitud, indica que presentan variabilidad genética y pueden ser considerados como criterios de selección. Todas las correlaciones genéticas fueron positivas, en el intervalo de 0.57 a 0.94. Los rasgos evaluados están asociados genéticamente, y la posible respuesta a la selección correlacionada sería en el mismo sentido. Se generaron dos índices de selección, en función al procedimiento de estimación del vector de valores relativos; la exactitud del índice fue similar en ambos casos (0.45); sin embargo, la respuesta a la selección fue superior en el índice de selección generado con valores relativos a partir de la desviación estándar fenotípica.

Agradecimientos

Se agradece al propietario de la ganadería Los Encinos, el proporcionar la información genealógica y de comportamiento para el desarrollo del presente estudio.

643


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Literatura citada: 1.

Domínguez-Viveros J, Rodríguez-Almeida FA, Núñez-Domínguez R, RamírezValverde R, Ruiz-Flores A. Parámetros genéticos y tendencias genéticas para características de comportamiento en ganaderías de lidia mexicanas. Rev Mex Cienc Pecu 2014;5:261-271.

2.

Delgado JV, Molina A, Camacho ME, Rodero A. Evolución de la metodología de la mejora genética en el vacuno de carne. Arch Zootec 1995;44:111-121.

3.

Bourdon RM. Understanding animal breeding. First ed. New Jersey, USA: Prentice Hall; 1997.

4.

Van Vleck D. Selection index and introduction to mixed model methods. First ed. Florida, USA: CRC Press; 1993.

5.

Cameron, ND. Selection indices and prediction of genetic merit in animal breeding. First ed. Edinburgh, UK: CAB International; 1997.

6.

Castillo GE. Nuestro toro. Asociación Nacional de Criadores de Toros de Lidia. México, DF. 2003.

7.

Domínguez-Viveros J, Rodríguez-Almeida FA, Núñez-Domínguez R, RamírezValverde R, Ortega-Gutiérrez JA, Ruiz-Flores A. Análisis del pedigrí y efectos de la consanguinidad en el comportamiento del ganado de lidia mexicano. Arch Zootec 2010;59:63-72.

8.

Robinson GK. That BLUP is a good thing: the estimation of random effects. Statist Sci 1991;6:15-32.

9.

Gianola D. Statistic in animal breeding. J American Statis Assoc 2000;95:296-299.

10. SAS. SAS/STAT User's Guide (Release 9.0). Cary NC, USA: SAS Inst. Inc. 2005. 11. Boldman KG, Kriese LA, Van Vleck LD, Van Tassell CP, Kachman SD. A Manual for use of MTDFREML. A set of programs to obtain estimates of variances and covariances (Draft). USDA. ARS. 1995. 12. Atil H. A comparison of different selection indices for genetic improvement for milk traits in Holstein Friesian cattle in Turkey by using one standard deviation as relative economic weight. Pak J Biol Sci 2006;9:285-288.

644


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

13. Hair JF, Anderson RE, Tatham RL, Black WC. Multivariate data analysis. First ed. Madrid, España: Prentice Hall International, Inc; 1999. 14. Peña D. Análisis de datos multivariantes. Madrid, España: Editorial McGraw Hill; 2002. 15. Hazel LN, Dickerson GE, Freeman D. The selection index – then, now and for the future. J Dairy Sci 1994;77:3236-3251. 16. Lin CY. An iterative procedure for deriving selection indexes with constant restrictions. J Anim Sci 2005;83:2313-2318. 17. Falconer DS, Mackay TFC. An Introduction to quantitative genetics. 4th ed. London, UK: Longman Pub; 1996. 18. Pelayo R, Solé M, Sánchez MJ, Molina A, Varela M. Behavioural linear standardized scoring system of the Lidia cattle breed by testing in herd: estimation of genetic parameters. J Anim Breed Genet 2016;133:414-421. 19. Silva B, Gonzalo A, Cañón J. Genetic parameters of behavior traits in the bovine (Bos taurus). Proc. 7th Wld Congr Genet Appl Livest Prod. Montpellier, France. 2002. 20. Silva B, Gonzalo A, Cañón J. Genetic parameters of aggressiveness, ferocity and mobility in the fighting bull breed. Anim Res 2006;55:65-70. 21. Vergara GO, Iriarte MC. Determinación de un índice de selección para el peso al nacer y al destete en ganado Cebú. Rev MVZ Córdoba 2002;7:148-151. 22. Montes VD, Vergara GO, Prieto ME. Determinación de un índice de selección para el peso al nacer y al destete en ganado bovino de la raza Brahman. Rev MVZ Córdoba 2008;13:1365-1368. 23. Cerón-Rojas JJ, Sahagún-Castellanos J. Un índice de selección basado en componentes principales. Agrociencia 2005;39:667-677. 24. Sánchez JM, Riol JA, Castro MJ, Gaudioso VR. Comportamiento del toro de lidia frente al caballo y muleta: aspectos aplicativos en la selección de la raza. Arch Zootec 1990;39:165-174.

645


http://dx.doi.org/ 10.22319/rmcp.v9i4.4517 Artículo

Épocas de nacimiento basadas en un índice climático para el ajuste de modelos estadísticos para peso vivo de ganado bovino en México Birth seasons based on a climatic index for statistical model fitting of live weight of bovine cattle in México

Jessica Beatriz Herrera-Ojedaa Gaspar Manuel Parra-Bracamonteb* Nicolás López-Villalobosc,d José Fernando Vázquez-Armijo d Karlos Edmundo Orozco-Duráne Juan Gabriel Magaña-Monfortef Juan Carlos Martínez-Gonzálezg Francisco Joel Jahuey-Martínezb

a

Universidad Michoacana de San Nicolás de Hidalgo-Instituto de Investigaciones Agropecuarias y Forestales. Carretera Morelia-Zinapécuaro km 9.5. 58880. Morelia, Michoacán, México. b

Instituto Politécnico Nacional-Centro de Biotecnología Genómica. Tamaulipas, México.

c

Institute of Veterinary, Animal and Biomedical Sciences. Massey University. New Zealand. d

Universidad Autónoma del Estado de México. Centro Universitario UAEM Temascaltepec, Estado de México, México. e f

Instituto Tecnológico del Valle de Morelia, Tarímbaro, Michoacán. México.

Universidad Autónoma de Yucatán. Facultad de Medicina Veterinaria y Zootecnia. Yucatán, México.


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

g

Universidad Autónoma de Tamaulipas. Facultad de Ingeniería y Ciencias. Tamaulipas, México.

*Autor de correspondencia: gparra@ipn.mx

Resumen: El objetivo fue comparar los efectos de una metodología para la clasificación de épocas climáticas, que tradicionalmente son utilizadas para establecer épocas de nacimiento (EN) en estudios y experimentos estadísticos. Esta metodología se basa en un índice de aridez (IA) para clasificar las EN utilizando información meteorológica histórica. Se trabajó una base de datos con un pedigrí de 7,460 animales, se ajustaron dos modelos para peso al nacimiento y peso al destete en bovinos Charolais manejados en pastoreo extensivo. Los modelos incluyeron el efecto fijo de grupo contemporáneo (GC= subclase de hato, sexo, año y EN) y edad de la madre. Los mismos modelos se compararon utilizando una clasificación tradicional de estaciones del año para clasificar las EN. Al estimar los componentes de varianza y valores genéticos (DEP) con sus exactitudes, los modelos fueron diferentes de acuerdo a la prueba de razón de verosimilitudes (P<0.01). El número de GC se redujo en 25 % para la EN basada en el IA, con GC con mayor número de individuos. El principal efecto observado en los modelos analizados fue el cambio en la jerarquización de las DEP para ambas características. Este método de clasificación de épocas de nacimiento, puede ayudar a mejorar el ajuste de modelos estadísticos en los sistemas ganaderos manejados en pastoreo extensivo. Palabras clave: Bovinos, Charolais, Evaluación genética, Indice de aridez, Modelos, Peso vivo.

Abstract: The objective of this study was to compare the effects of a methodology for the climatic season classification that traditionally had been used as birth season (BS) in statistical assessments. This methodology bases in an aridity index (AI) to classify BS using meteorological historic information. Using a 7,460-pedigree animals dataset were fitted two statistical models for birth and weaning weights of Charolais cattle. Genetic models included the fixed effect of contemporary groups (CG= herd, sex, year and BS) and dam age as a covariate (linear and quadratic). Same models compared with a traditional season classification for BS. When variance component and expected progeny differences (EPD)

647


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

were predicted with their accuracies, models were statistically different accordingly to the likelihood ratio test (P<0.01). An improvement and reduction in CG conformation (25 %) were observed for those models including IA based BS. The main effect in assessed models was the ranking changes in EPD from both traits. This classification method of birth season can improve the model fitting in animal production based in extensive systems. Palabras clave: Aridity index, Cattle, Charolais, Genetic evaluation, Live weight.

Recibido 13/06/2017 Aceptado 03/01/2018

Introducción

El clima puede afectar el desempeño del ganado de diferentes maneras; modifica la calidad o cantidad de los alimentos disponibles, el requerimiento de agua y energía, el consumo energético y su uso. El efecto del clima en la producción animal se reconoce como un factor altamente variable y complejo que condiciona e impacta el ambiente en el que los animales viven, se desempeñan y se reproducen(1,2). El ganado enfrenta los efectos del clima mediante diferentes mecanismos de modificación de las constantes fisiológicas y etológicas; de esta manera mantiene su homeostasis en respuesta a las condiciones ambientales(3). Como consecuencia, es posible observar alteraciones en el consumo de materia seca, en el comportamiento, actividad física y productividad, que se reflejan en cambios en algunos indicadores económicos, como el peso al nacimiento, producción lechera, peso al destete y ganancia diaria de peso. Estos efectos impactan significativamente los sistemas productivos basados en condiciones extensivas de manejo(4,5,6). Es común que al utilizar modelos estadísticos para evaluar la productividad animal y sus componentes, uno de los principales factores a considerar sean las épocas climáticas. Los diferentes criterios para establecer dichas épocas contemplan generalmente componentes climáticos que son inexactos al explicar las variaciones que definen un determinado periodo del año, ya que el clima está determinado por circunstancias atmosféricas globales, pero posee un comportamiento específico para cada zona o región(7). En ganado bovino en

648


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

sistemas extensivos de pastoreo existe una compleja interacción de factores como la temperatura, humedad relativa, viento, precipitación y radiación solar, siendo éstas las principales variables que influyen en la productividad(8). A la fecha, no existe una metodología que incluya dichos elementos como condicionantes de la variación del tiempo atmosférico en una época particular del año, y menos aún, relacionados con indicadores de crecimiento en bovinos. Por ello se propone una metodología más eficiente y conveniente para clasificar y describir períodos climáticos en una zona determinada de estudio. El propósito es aportar información que minimice las fuentes de variación que inciden sobre la expresión fenotípica de los indicadores productivos y poder mejorar la estimación de los valores y parámetros requeridos en la evaluación genética en los hatos y a nivel individual. Los modelos usados para análisis estadísticos de características productivas incluyen la época o el mes de nacimiento como uno de los principales factores que inciden sobre la expresión del potencial productivo de los animales(9,10). En las evaluaciones genéticas, para poder estimar parámetros y valores de cada animal con alta confiabilidad, los modelos incluyen la época de nacimiento como un efecto fijo dentro de las ecuaciones de los modelos mixtos, lo que ayuda a aislar mejor los componentes de la varianza de los efectos aleatorios, lo que se ha considerado como el mejor estimador lineal insesgado(11). El mes o época de nacimiento (periodo estacional en el que ocurre el nacimiento), puede llegar a contribuir hasta con el 13 % de la variación de los pesos al nacimiento (PN) y al destete (PD)(12). La época de nacimiento involucra diversos factores climáticos reconocidos por impactar la variabilidad de estos indicadores de producción(5); generalmente los efectos ambientales que determinan la variación en las características de crecimiento son diferentes según la zona agroecológica, el sistema de producción y la población que se estudia(13,14). Cuando se han tratado de definir estos períodos climáticos para el ajuste de modelos estadísticos en características productivas, el criterio principal para la clasificación es la definición específica asociada a la presencia o ausencia de la precipitación pluvial, clasificando los climas simplemente en secos o lluviosos(15,16), aunque algunos autores han considerado también la temperatura(17), estaciones del año(17,18) o criterios definidos por clústeres entre meses durante el año(19,20). El objetivo de este estudio fue evaluar los efectos de un método matemático para clasificar períodos climáticos considerando el índice de aridez en diferentes regiones de estudio, sobre parámetros productivos y estimaciones en el ajuste de modelos estadísticos de evaluación genética en ganado bovino criado en condiciones extensivas.

649


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Material y métodos

Información climática

La información climatológica utilizada se obtuvo por medio del Extractor Rápido de Información Diaria (ERIC III versión 3.2.), que facilita la obtención de información de la base de datos CLICOM (clima computarizado) del banco de datos histórico de la Comisión Nacional del Agua(21). La información utilizada fue de datos históricos de 30 años (1985 a 2015) de información meteorológica diaria de la precipitación pluvial (PP), temperaturas medias (TM), mínimas y máximas, radiación solar (RS), humedad (H) y velocidad del viento (VV). La clasificación propuesta se logró a través de la elaboración de un índice de aridez (IA), utilizando la precipitación pluvial y el índice de evapotranspiración (ET0). Bajo un método descrito previamente(22) como:

Donde: ET0= Índice de evapotranspiración, Ra= Radiación solar extraterrestre, TMax= Temperatura máxima, TMin= Temperatura mínima. Posteriormente, se estimaron los IA en cada una de las estaciones, por medio de la metodología propuesta en el Diario Oficial de la Federación (1 de junio de 1995), para desarrollar criterio clasificatorio de la aridez a partir de la relación entre la precipitación pluvial diaria (PP) y la ET0, lo que permite clasificar regiones en áridas, semiáridas, subhúmedas y húmedas(23), considerando los niveles de 0.0 a 0.20 para clasificar un mes árido (A), 0.21 a 0.50 como semiárido (SA), 0.51 a 0.65 como subhúmedo (SH) y >0.65 como húmedo (H) (Cuadro 1). De esta manera la dinámica de IA fue considerada para cada hato particular de acuerdo a las estimaciones calculadas (Figura 1). Las ecuaciones para elaborar el ET0 se estimaron en el software R(24).

650


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 1: Categorías del índice de aridez (IA) utilizadas para la reclasificación de las épocas climáticas Escala de IA 0.00 a 0.20 0.21 a 0.50 0.51 a 0.65 > 0.65

Categorías

Clave

Áridos Semiáridos Subhúmedos secos Húmedos

A SA SH H

Figura 1. Tendencias anuales de índice de aridez en tres localidades estudiadas

Líneas punteadas (roja, naranja y verde): límite de clasificación de época de acuerdo al Cuadro 1. (H1= Hermosillo, H2= Mamulique, H3= Salinas Victoria).

Efecto de la clasificación propuesta

Se utilizaron las bases de datos de tres hatos de ganaderías de registro de ganado Charolais, en Sonora y Nuevo León, México, que contaban con información genealógica y con registros de producción. Conformando un pedigrí de 7,460 animales. Utilizando la localización geográfica de cada hato se obtuvo la información meteorológica diaria de tres estaciones cercanas a las regiones de los hatos incluidos en el estudio. Las estaciones

651


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

meteorológicas consideradas fueron Hermosillo, Sonora (H1: 29°05´44”´N, 110°57´03”O), y Mamulique (H2: 26°98´25”N, 10°18´49”O) y Salinas Victoria, Nuevo Léon (H3: 25°58´00”). Una vez establecidos los períodos climáticos por localización geográfica, utilizando el criterio de IA, se compararon dos modelos de ajuste para analizar las variables dependientes. Como comparación se consideró una clasificación previamente descrita(20), donde se consideraron las épocas de nacimiento en: 1) enero-marzo; 2) abril-junio; 3) julioseptiembre y 4) octubre-diciembre, en un análisis de parámetros genéticos con ganado Charolais, de tal manera que el primer modelo se definió de acuerdo a esta clasificación para representar el método tradicional (MTR). El segundo modelo considerado en el estudio fue la propuesta con el criterio de IA (MIA). Se examinó la correlación entre las dos clasificaciones comparadas mediante el coeficiente de correlación de Spearman, utilizando el paquete estadístico SAS(25). Para examinar la proporción de varianza explicada por la época de nacimiento (EN) en cada uno de los métodos (MTR y MIA) sobre el peso al nacimiento (PN) y peso al destete (PD), se ajustó un modelo mixto que consideró los efectos fijos de hato, el sexo del animal, y los efectos lineal y cuadrático de la edad de la vaca como covariable, más el efecto aleatorio de la EN, del semental y del año de nacimiento. Estos análisis se realizaron utilizando el PROC MIXED del paquete estadístico SAS(25). Posteriormente, se ajustaron los mismos modelos (MTR y MIA), para estimar los componentes de varianza bajo el método de máxima verosimilitud restringida libre de derivadas en el paquete de evaluaciones genéticas MTRDFREML(26), el modelo para PN y PD fue, en forma matricial: Y = Xβ + Zd + Wm + e Donde: Y es el vector de observaciones para PD, X, Z y W con matrices conocidas de incidencia que relacionan las observaciones con sus respectivos vectores de efectos fijos y aleatorios; β es el vector de efectos fijos antes descritos; d es el vector de efectos genéticos aditivos directos; m es el vector de efectos genéticos aditivos maternos; e es el vector de efectos aleatorios residuales. En ambos modelos el grupo contemporáneo estuvo integrado por animales del mismo hato, sexo, año y época de nacimiento. La época de nacimiento se diferenció por la reclasificación entre modelos. El criterio de convergencia de los modelos se fijó en 1x10-19.

652


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Para la comparación de modelos se utilizó una prueba de razón de verosimilitudes, que se basa en las diferencias entre los logaritmos de las funciones de verosimilitud (Log L), estimadas en el programa y comparadas con el valor de Ji-cuadradra (X2) con un grado de libertad con un alpha= 0.01. La prueba de acuerdo a Lynch y Walsh(27) puede presentarse como λ=-2(Log L MIA – Log L MTR). Donde Log L= logaritmo de verosimilitud, con las reglas de decisión: Si λ ≥ x2, el modelo MIA se acepta significativamente como diferente al modelo MTR y si λ ≤ x2, el modelo MTR y el MIA no son significativamente diferentes. De cada modelo se estimaron las diferencias esperadas en la progenie (DEP) y sus exactitudes, estimando sus medias y desviaciones típicas. Posteriormente se extrajo el 10 % superior de los valores de DEP y sus exactitudes de acuerdo a una jerarquización basada en el modelo MTR para cada característica, y considerando para PN los valores inferiores y para el PD los valores superiores. Se estimó la correlación de rango de Spearman entre estos valores predichos en cada modelo por característica para determinar cambios en el ordenamiento de los animales superiores, usando el procedimiento CORR del paquete estadístico SAS v 9.2(25).

Resultados y discusión

En el presente estudio las dos características de peso vivo fueron similares a las reportadas previamente en ganado Charolais mexicano en sistemas extensivos(20,22) con 39.0 y 227.0 kg para PN y PD, respectivamente (Cuadro 2).

Cuadro 2: Estadísticos descriptivos para peso al nacimiento (PN) y peso al destete ajustado a 205 días (PD) de bovinos Charolais de registro (kg) Característica PN PD

n

Media

SD

CV

Máximo

Mínimo

6398 5901

40.51 228.52

7.36 41.76

18.18 18.28

66.00 396.60

15.00 101.50

n= número de observaciones; DE= desviación estándar; CV= coeficiente de variación.

Recientemente, se propuso un método para reclasificar épocas climáticas basadas en un índice de aridez, estimando el efecto de este cambio en el análisis de modelos mixtos de

653


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

evaluación genética con una pequeña población de ganado Charolais(22). En el presente trabajo se comparó el método propuesto con una población conformada por un pedigrí con mayor número de animales. No es frecuente encontrar estudios que evalúen la importancia específica del componente ambiental en el ajuste de modelos estadísticos como los de evaluación genética. La mayoría da por hecho que la inclusión de los factores que son importantes como fuentes de variación puede basarse en criterios que se usan de manera general (por ejemplo, la conformación de grupos contemporáneos) y cuando no exista un problema con la estructura de los datos, o con la elección de los niveles que conforma el vector de los efectos fijos (por ejemplo, el sexo)(28), lo que consecuentemente conformará el BLUE (Mejor Estimador Lineal no Sesgado; por sus siglas en inglés)(11). Para el caso de factores que explican una proporción sustancial de la variación fenotípica y poseen complejidad para su conformación, es necesario considerar su preclasificación de acuerdo a un criterio objetivo para seleccionar su inclusión, ya sea individualmente o en bloques, como los grupos contemporáneos, sobre todo en el caso de evaluaciones genéticas que incluyen diferentes sistemas de producción con diferencias agroclimáticas. Para el establecimiento de épocas de nacimiento que conforman los grupos contemporáneos en evaluaciones genéticas, una clasificación provista por el IA explica sustancialmente mayor variabilidad que una clasificación tradicional, por lo que la IA es capaz de aislar y explicar en algunos casos aproximadamente el 10 % de la variabilidad de la característica, lo que indica un mejoramiento en la estructura de los factores analizados y el número de observaciones que contiene(22). Los cambios observados en la varianza genética aditiva para PN en los componentes de la varianza encontrados en el presente estudio fueron pequeños (Cuadro 3). Al comparar la heredabilidad directa obtenida en MIA contra MTR se encontraron cambios menores entre modelos; de la misma forma para PD el ajuste del modelo MIA, mostró valores ligeramente superiores en sus componentes de la varianza, sobre todo en la varianza genética aditiva y la covarianza entre la varianza genética directa y materna, excepto en la varianza materna, en la cual hubo una ligera reducción para el PD. En ambas comparaciones (PN y PD) los modelos fueron significativamente diferentes de acuerdo a la prueba de razón de verosimilitudes (P<0.01), lo que sugiere que la inclusión del IA produce un cambio en la estructura de los datos que influyen en la captura de la varianza genética aditiva estimada y subsecuentemente en la predicción genética.

654


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 3: Componentes de la varianza y parámetros genéticos a partir del ajuste de dos modelos para caracteres de peso vivo en ganado Charolais manejado en condiciones extensivas

Componentes y parámetros

–2 Log L

PN

PD

MTR 13.276

MIA 15.103

MTR 265.989

MIA 341.904

11.864

12.571

234.165

269.442

-7.912

-8.810

-67.543

-109.800

21.219

21.292

595.888

652.066

38.448

40.156

1028.888

1153.613

28091.6333a 0.35 ± 0.05

28537.0584b 0.38 ± 0.05

44068.0588a 0.26 ± 0.04

45238.2424b 0.30 ± 0.04

0.31 ± 0.03

0.31 ± 0.03

0.24 ± 0.03

0.23 ± 0.03

-0.63 ± 0.05

-0.64 ± 0.05

-0.27 ± 0.10

-0.36 ± 0.09

0.55 ± 0.03

0.53 ± 0.03

0.58 ± 0.03

0.57 ± 0.03

MTR= modelo de época tradicional, MIA= modelo con la época de acuerdo al IA (Cuadro 1). =Varianza genética directa; =Varianza genética materna; =Covarianza genética directa y materna,

=Varianza ambiental,

=Varianza fenotípica; h2= heredabilidad directa; m2=

heredabilidad materna; rdm=correlación directa-materna, e2=proporción de varianza ambiental relativa a la varianza fenotípica; Log L= logaritmo de verosimilitud. a,b Literales distintas entre modelos en cada característica son diferentes (P<0.01).

Estos resultados demuestran que la reclasificación de la EN, probablemente tenga mayores efectos en el ajuste de modelos más complejos, que incluyan además del efecto genético directo, el efecto materno debido a las conexiones genéticas que puedan establecerse entre los grupos contemporáneos, y con poblaciones con mayor número de evaluaciones nacionales, en las que sean incluidas más regiones del país en condiciones climáticas heterogéneas. Un aspecto importante entre los datos analizados de cada modelo, es que MIA mostró una reducción muy importante (>25 %) en el número de los grupos contemporáneos en la base de datos analizada, lo que pudiera sugerir grupos de comparación más grandes y mejor distribuidos por año. Se ha propuesto que este aspecto es fundamental en las evaluaciones genéticas, ya que la predicción de valores genéticos depende principalmente de la correcta estimación de los componentes de varianza; así como de la correcta definición de los efectos medioambientales. Una mejor definición de 655


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

los efectos fijos responsables de la variación fenotípica puede ayudar a disminuir sesgos causados por diferencias en las condiciones ambientales de los animales(29,30). Los grupos contemporáneos en las evaluaciones genéticas han sido una estrategia fundamental para lograr reducir la variabilidad causada por diferentes efectos ambientales. Dentro de tal estrategia resulta clave la búsqueda de una mejor definición de los grupos contemporáneos, en cuya clasificación se incluyan factores que permitan predicciones más reales del mérito genético en indicadores de interés económico. Esto es esencial en el proceso de selección para ganado de carne, ya que de esto depende en parte el progreso genético de la población(31,32). El análisis específico de los promedios de los valores predichos en las DEP y sus exactitudes (Cuadro 4) no sugiere cambios sustantivos en la distribución poblacional de los predictores genéticos o de sus valores de confiabilidad. Los promedios y sus desviaciones típicas son similares entre modelos para las dos características de peso vivo estudiadas. Sin embargo, al analizar el 10 % de los animales superiores clasificados con base en las DEP, la estimación de los coeficientes de correlación, mostró que el efecto en los valores predichos que clasifican a los individuos incluidos en la evaluación genética es importante (Cuadro 5). Los menores valores de correlación se observaron entre las DEP directas de PN y PD. La reducción de la categorización de las DEP también fue notoria en los predictores maternos.

Cuadro 4: Medias y desviaciones típicas de las diferencias esperadas en la progenie y exactitudes en dos modelos evaluados en caracteres de peso vivo de ganado Charolais Valor predicho

PN

PD

MTR

MIA

MTR

MIA

DEP D

-0.160 ± 1.920

-0.144 ± 2.132

2.151 ± 9.068

2.247 ± 10.302

EX D

0.529 ± 0.168

0.546 ± 0.175

0.519 ± 0.140

0.535 ± 0.154

DEP M

0.408 ± 1.864

0.391 ± 1.935

1.302 ± 7.445

1.197 ± 7.585

EX M

0.535 ± 0.104

0.541 ± 0.102

0.495 ± 0.118

0.492 ± 0.114

MTR= modelo de época tradicional, MIA= modelo con la época de acuerdo al IA (Cuadro 1), DEP D= diferencias esperadas de las progenies directas; EX D= exactitudes de la DEP D; DEP M= diferencias esperadas de las progenies maternas; EX M= exactitud de la DEP M.

656


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 5: Coeficientes de correlación entre las diferencias esperadas de la progenie y sus exactitudes de caracteres de peso vivo de ganado Charolais, estimados con dos modelos Correlación de Spearman

Característica PN D PN M PD D PD M

DEP

Exactitud

0.646 0.895 0.736 0.954

0.96 0.99 0.97 0.99

DEP D= diferencias esperadas de las progenies directas; PN D y PD D= diferencias esperadas de las progenies directas para peso al nacimiento y destete, respectivamente; PN M y PD M= diferencias esperadas de las progenies maternas para peso al nacimiento y destete, respectivamente.

Los cambios identificados entre los modelos estudiados podrían explicarse por el cambio en la estructura de los grupos contemporáneos ocasionada por la reclasificación de la época de nacimiento. Algunas de las aproximaciones utilizadas en las publicaciones disponibles nacionalmente no proveen evidencia sustancial sobre sus criterios de clasificación. Las épocas de nacimiento entre los diversos estudios realizados en México se definen constantemente considerando dos variables climatológicas: la distribución del patrón de precipitación y la temperatura mensual de acuerdo a un promedio histórico. En este sentido, existen reportes donde para evaluar la magnitud de interacción entre genotipos de ganado Suizo Europeo y el clima se clasificaron grupos contemporáneos con épocas de nacimiento definidas por la presencia de lluvias a través de los años estudiados y temperaturas mensuales (secas: junio-octubre y lluvias: noviembre-mayo)(33); aunque para evaluar la interacción genotipo-ambiente en este estudio se definieron clústeres con zonas climatológicas para México (trópico seco: oeste y sureste; trópico húmedo: este y templado: norte y centro), éstas no se tomaron en cuenta para una mejor clasificación de las épocas de nacimiento. De igual manera, al explorar el efecto de los GC de acuerdo a la cantidad de registros que tuvieran (3, 7 o 10 registros) y su inclusión como un efecto fijo o aleatorio, algunos autores establecieron grupos contemporáneos de acuerdo a la distribución de las lluvias y la temperatura registrada por la estación meteorológica más cercana a cada unidad de estudio(13). Por otra parte, se ha utilizado la presencia de la precipitación y las temperaturas mensuales para establecer épocas (secas, lluvias y nortes) en cinco Estados del sureste y del norte de México (Campeche, Tabasco, Chiapas, Tamaulipas y Yucatán), justificando que estos Estados comparten un clima similar (caliente subhúmedo con lluvias en verano)(17). Sin

657


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

embargo, de acuerdo a los resultados de este estudio, cuando se utilizan otras variables climatológicas, los estados del norte mostraron comportamiento diferente a los del sureste del país. Algunos autores tratando de definir el modelo estadístico más apropiado para la evaluación genética de indicadores de crecimiento en ganado mexicano, escogieron utilizar como único criterio para las épocas de nacimiento la presencia de lluvia, sin especificar la fuente de información utilizada para categorizar esta variable(28,34,35). Las condiciones particulares de la clasificación de grupos contemporáneos reportados en la literatura no incluyen dentro de la estructura de los datos, elementos climatológicos importantes, que en este estudio han demostrado acercar los modelos estadísticos a una situación más real para los datos. Aunque estos ligeros cambios en los parámetros genéticos y la diferencia encontrada en el ordenamiento de los valores genéticos diferencialmente podrían significar un mejor ajuste en el modelo con IA como criterio de clasificación de la EN, la superioridad de sus efectos solamente se podrían confirmar si se considerara el análisis incluyendo el valor genético verdadero de una población de animales.

Clasificación de épocas climáticas

En la Figura 1, se observan las curvas de IA estimadas para las tres localidades de los hatos incluidas en el estudio. Las tendencias observadas en el gráfico indican que las condiciones climáticas son similares desde junio hasta noviembre para H2 y H3; estos meses se ubican entre subhúmedos y húmedos por estar localizados en una región relativamente cercana (menos de 200 km de distancia), pero muy diferentes a H1 en el cual se observó que el único mes subhúmedo es agosto. En países como México donde los sistemas de producción de ganado de carne se basan en áreas de pastoreo y agostaderos, es común que los animales se expongan a los efectos medioambientales en distinta magnitud, debido a diferencias en la variedad y calidad del forraje, topografía y a las variables climáticas. Los componentes del clima (radiación solar, humedad relativa, precipitación, temperatura ambiental, velocidad del viento) en conjunto ejercen una acción directa en la industria ganadera, afectando el grado de bienestar fisiológico de los animales y un efecto indirecto a través de la producción y calidad de los alimentos, documentándose su influencia en la eficiencia de los sistemas de producción de bovinos de carne en regiones con clima tropical(1,36).

658


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Para poder capturar las variables del clima que pueden afectar tanto al animal como a la oferta de alimento en los sistemas de pastoreo extensivo, el índice de aridez, permite evaluar el agua que se pierde tanto por evaporación como por la transpiración de los forrajes, y al mismo tiempo incluyendo variables fisiológicas que en el ganado se traducen en cambios de temperatura corporal, tasa de respiración y la sudoración, así como el consumo de agua y materia seca(37). Por lo tanto, el uso de este criterio considera de manera más efectiva las condiciones a las que los animales o cultivos forrajeros se someten en condiciones reales, lo que ayudaría a remover o estimar la variación que explica fenotípicamente los caracteres que se expresan bajo condiciones extensivas. Bajo esta premisa, las épocas climáticas estimadas con la metodología propuesta serían equivalentes a pesar de la región geográfica, dado que los componentes climáticos considerados en su clasificación serían comparables, lo que podría explicar el por qué en algunas regiones se consideraría la existencia de dos épocas climáticas, cuando en otras podrían existir las cuatro, independientemente del mes. En el presente trabajo, la estimación de índices de aridez para 106 municipios en diferentes Estados de México está disponible en el Anexo 1 para fines de análisis. Estos valores podrían ser utilizados como referencia para clasificación de las épocas en estudios que incluyan experimentos o datos de campo bajo sistemas productivos en condiciones extensivas.

Conclusiones e implicaciones

El estudio realizado utilizando un mayor número de animales en una base de datos con un mayor pedigrí, permitió comprobar que el índice de aridez definido como criterio de clasificación de meses y épocas de nacimiento para incluir los factores ambientales que inciden sobre el desempeño productivo de los animales en condiciones extensivas es útil. El análisis entre los modelos de evaluación genética incluyendo el contraste de grupos contemporáneos en el índice de aridez mostró que su implementación no produce cambios específicos en los parámetros genéticos, pero sí en el ordenamiento de los individuos basados en sus valores genéticos aditivos predichos. Esta información podría ayudar a hacer más precisos los programas de mejora genética al analizar modelos complejos. Con base en los resultados, el uso del índice de aridez puede extenderse a diferentes esquemas de aplicación agropecuaria en los cuales animales o cultivos estén sometidos a condiciones

659


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

extensivas cuando se tenga disponibilidad de la información climatológica que permita esta clasificación.

Literatura citada: 1.

Arias RA, Mader TL, Escobar C. Factores climáticos que afectan el desempeño productivo del ganado bovino de carne y leche. Arch Med Vet 2008;(40):7-22.

2.

Berman A. Are adaptations present to support dairy cattle productivity in warm climates? J Dairy Sci 2011;(94):2147-2158.

3.

Wheelock JB, Rhoads RP, VanBaale MJ, Sanders SR, Baumgard LH. Effects of heat stress on energetic metabolism in lactating Holstein cows. J Dairy Sci 2009;(93):644655.

4.

Nardone A, Ronchi B, Lacetera N, Bernabucci U. Climatic effects on productive traits in livestock. Vet Res Commun 2006;(30):75-81.

5.

Nienaber JA, Hahn GI. Livestock production system management responses to thermal challenges. Int J Biometeorol 2007;(52):149-157.

6.

Tao S, Bubolz JW, Amaral BC, Thompson IM, Hayen MJ, Johnson SE, Dahl GE. Effect of heat stress during the dry period on mammary gland development. J Dairy Sci 2011;(94):5976-598.

7.

Morillo DE. Efectos de la época seca sobre la producción forrajera y bovina. Rev Fac Agron 1994;(15):2-7.

8.

Hahn GL, Mader TI, Eigenberg RA. Perspective on development of thermal indices for animal studies and management. In: Lacetera N, et al editors. Interactions between climate and animal production. 1rst ed. Wageningen, The Netherlands: Wageningen Academic Publishers; 2003:31044-31056.

9.

Martínez JCM, Martínez AA, Hernández J, Parra GM, Castillo SP. Características predestete de bovinos Simmental (Bos taurus) y sus cruces con Brahman (Bos indicus) en el trópico mexicano. Rev Colomb Cienc Pecu 2008;(21):365-371.

10. Chin RC, Magaña JG, Segura JC, Núñez R. Factores ambientales y proporción racial que influyen en el peso al nacimiento, al destete y edad al primer parto en bovinos Suizo Pardo en México. Trop Sub-trop Agroeco 2012;(15):55-60. 11. Mrode RA. Linear models for the prediction of animal breeding values. 3rst ed. Oxxford, United Kingdom: Cabi International; 2014.

660


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

12. Martínez GG, Petrocinio J, Herrera PD. Factores que afectan el peso al destete en un rebaño de bovinos de carne. Rev Fac Agron 1998;(15):2-7. 13. Ramírez-Valverde R, Nuñez-Domínguez R, Ruíz-Flores A, García-Muñíz G, MagañaValencia F. Comparación de definiciones de grupos contemporáneos en la evaluación genética de bovinos suizo europeo. Téc Pecu Méx 2008;46(4):359-370. 14. Garrick DJ. An animal breeding approach to the estimation of genetic and environmental trends from field populations. J Anim Sci 2010;(88):E3-E10. 15. Parra-Bracamonte GM, Martínez JC, García FJ; González AM, Briones F, Cienfuegos EG. Tendencias genéticas y fenotípicas de características en el ganado Brahaman de registro de México. Rev Cient 2007;(17):262-267. 16. Martínez-González JCM, García-Esquivel FJ, Parra-Bracamonte GM, Castillo-Juárez H, Cienfuegos-Rivas EG. Genetic parameters for growth traits in mexican Nellore cattle. Trop Anim Health Prod 2010;(42):887-892. 17. Medina-Zaldívar JM, Osorio-Arce MM, Segura-Correa JC. Influencias ambientales y parámetros genéticos de crecimiento en ganado Nelore en México. Rev Cient FCVLuz 2005;(3):325-241. 18. Martínez-González JC, Gutiérrez-Michel JF, Briones-Encinia F, Lucero-Magaña FA, Castillo-Rodríguez SP. Factores no genéticos que afectan el peso al nacer y destete de terneros Angus. Zootecnia Trop 2011;(2):151-159. 19. Ríos A, Velázquez GM, Tsuruta S, Bertrand JK, Murillo VEV, Bermúdez MM. Estimadores de parámetros genéticos para características de crecimiento de ganado Charolais mexicano. Téc Pecu Méx 2007;45(2):121-130. 20. Ríos UA, Martínez G, Vega VG, Montaño M. Efectos genéticos para características de crecimiento de bovinos Charolais y Charbray mexicanos estimados con modelos alternativos. Rev Mex Cienc Pecu 2012;3(3):275-290. 21. CONAGUA. 2016. Banco de datos histórico. Comisión Nacional del Agua. http://sMIA.cna.gob.mx/informacion-climatologica-ver-estado?estado=son. Consultado 30 May, 2017. 22. Herrera-Ojeda JB, Parra-Bracamonte GM, Herrera-Camacho J, López-Villalobos N, Magaña-Monforte JG, Martínez-González JC, Lobit P, Vázquez-Armijo JF. Información climática asociada a estaciones productivas para el ajuste de modelos estadísticos de sistemas bovinos bajo condiciones extensivas. Arch Zootec 2018;(257):21-28.

661


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

23. UNEP. United Nations Environment Programme. Biodiversity Country Studies: Executive Summary. New York: UNEP. 1992. 24. R Development Core Team R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna Austria. 2008 http://www.Rproject.org. 25. SAS Institute. SAS/STAT Software: Changes and enhancements through Release 9.1 Cary, NC. 1996. 26. Boldman KG, Kriese LA, VanVleck LD, VanTassell CP, Kachman SD. A manual for use of MTDFREML. A set of programs to obtain estimates of variances and covariances [DRAFT]. USDA Agr Res Serv. USA. 1995. 27. Lynch M, Walsh B. Genetics and analysis of quantitative traits 1rst ed. Sunderland. USA; Sinauer; 1998. 28. Wilson AJ, Reale D, Clements MN, Morrissey MM, Postma E, Walling CA, Kruuk LE, Nussey DH. An ecologist’s guide to the animal model. J Anim Ecol 2010;(79):1326. 29. Domínguez-Viveros J, Rodríguez-Almeida FA, Ortega-Gutiérrez JA, FloresMariñelarena A. Selección de modelos, parámetros genéticos y tendencias genéticas en las evaluaciones genéticas nacionales de bovinos Brangus y Salers. Agrociencia 2009;(43):107-117. 30. Pascoa LA, Elzo A, Ferreira DL, Bezerra LA, Barbosa R. Effect of several structures of (co) variances and genetic parameters for weaning weight in Nellore cattle. Ciênc Anim Bras 2013;(14):151-158. 31. Oliveira JGA, Pereira J, Ramírez-Díaz J, Sterman JB, Santana ML. Inclusion of weaning management group as a random effect in the genetic evaluation of postweaning traits in Nellore. Trop Anim Health Prod 2014;(46):1031-1036. 32. Pedrosa VB, Eler JP, Ferraz JBS, Groeneveld E. Use of weaning management group as a random effect for a more robust estimation of genetic parameters for post-weaning traits in Nellore cattle. Genet Mol Res 2014;13(3):7013-7021. 33. Saavedra-Jiménez LA, Ramírez-Valverde R, Núñez-Domínguez R, García-Muñiz J, Lopez-Villalobos N, Ruiz-Flores A. Genotype by climate interaction in the genetic evaluation for growing traits of Braunvieh cattle in Mexico. Trop Anim Health Prod 2013;45(7):1489–1494.

662


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

34. Estrada León RJ, Magaña JG, Segura JC. Comparación de modelos en la evaluación genética de caracteres de crecimiento del ganado Brahman en el sureste de México. Arch Latinoam Prod Anim 2008;(16):224-233. 35. Domínguez-Viveros J, Rodríguez-Almeida FA, Núñez-Domínguez R, OrtegaGutiérrez JA, Ramírez-Valverde R; Santellano-Estrada E, Espinosa-Villavicencio JL. Ajuste de modelos de regresión aleatoria en evaluaciones genéticas de bovinos tropicarne. Agrociencia 2011;(45):325-337. 36. Córdova RA, Rodríguez G, Córdova M, Córdova C, Pérez J. Ganancia diaria y peso al destete en terneros de cruces de Bos taurus y Bos indicus en trópico húmedo. Rev MVZ Córdoba 2005;(10):589-592. 37. Hargraves GH. Defining and using reference evapotranspiration. J Irrigation Drainage Eng 1994;(20):1132–1139.

Anexo 1: Clasificación de épocas climáticas en diferentes municipios de México usando el índice de aridez Estado

Municipio

1

2

3

4

5

6

Aguascalientes

Aguascalientes

SA

A

A

A

A

Aguascalientes

Calvillo

SA

A

A

A

Aguascalientes

Rincón de Romos

SA

A

A

Aguascalientes

Jesús María

SA

A

Baja California

Mexicali

A

Baja California

9

10

11

12

SH H

SH H

SA

A

A

A

SH H

H

SA

A

A

A

A

SA

SH SH SA

A

A

A

A

A

SH H

H

SH SA

A

A

A

A

A

A

A

A

A

A

A

A

SA

Ensenada

SH A

A

A

A

A

A

A

A

A

A

A

Baja California

Tijuana

H

SH SH A

A

A

A

A

A

A

SH H

BC Sur

La Paz

SA

A

A

A

A

A

A

SA

SA

A

A

SA

BC Sur

Mulege

A

A

A

A

A

A

A

A

SA

A

A

A

Campeche

Campeche

SA

A

A

A

SA

H

H

H

H

H

SH SA

Campeche

Escárcega

SH SA

A

A

SH H

H

H

H

H

H

SH

Campeche

Calkiní

SA

SA

A

SA

SA

H

H

H

H

H

H

SH

Campeche

Champotón

SA

SA

A

A

SA

H

H

H

H

H

H

SH

Chiapas

Tapachula

SH SH A

SH H

H

H

H

H

H

H

A

Chiapas

Tuxtla Gutiérrez

A

A

A

A

SA

H

H

H

H

H

A

A

Chiapas

Palenque

H

H

SA

SA

H

H

H

H

H

H

H

H

Chiapas

Comitán

A

A

A

SA

H

H

H

H

H

H

SA

A

Chihuahua

Buenaventura

A

A

A

A

A

SA

H

H

H

SA

A

A

Chihuahua

Delicias

A

A

A

A

A

A

SA

SA

SA

A

A

A

663

7

H

8

H


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Chihuahua

Ahumada

A

A

A

A

A

A

SA

SA

SA

SA

A

SA

Chihuahua

Cuauhtémoc

A

A

A

SA

A

SA

H

H

H

SA

A

A

Coahuila

Torreón

A

A

A

A

A

A

SA

SA

SA

A

A

A

Coahuila

Sabinas

A

A

A

SA

SA

SA

A

SA

SH SH SA

SA

Coahuila

Matamoros

A

A

A

A

A

A

A

SA

A

A

A

Coahuila

Saltillo

SA

A

A

A

A

SA

SA

SA

SH SA

A

A

Colima

Cuauhtémoc

SA

A

A

A

A

H

H

H

H

H

SA

A

Colima

Tecomán

SA

A

A

A

A

H

H

H

H

H

SA

A

Durango

Mezquite

SA

A

A

A

A

SA

H

H

SH SH A

SA

Durango

Gómez Palacio

A

A

A

A

A

SA

A

SA

SA

A

A

Durango

Tamazula

SA

A

A

A

A

SA

H

H

H

SH SA

SH

Durango

Tlahualilo

A

A

A

A

A

SA

SA

SA

SA

A

A

A

Durango

Cuencamé

A

A

A

A

A

SA

SA

SH SH SA

A

A

Edo. de México

Temascaltepec

A

A

A

A

SA

H

H

H

H

H

SA

A

Edo. de México

Toluca

A

A

A

SA

SH H

H

H

H

SH A

A

Guanajuato

Celaya

A

A

A

A

A

H

H

H

H

SA

A

A

Guanajuato

León

A

A

A

A

A

H

H

H

H

SA

A

A

Guanajuato

SL de La Paz

A

A

A

A

SA

SH SH SA

H

SA

A

A

Guanajuato

Abasolo

A

A

A

A

A

H

H

H

H

SA

A

A

Guerrero

Chilpancingo

A

A

A

A

SA

H

H

H

H

H

A

A

Guerrero

Cuajinicuilapa

A

A

A

A

SA

H

H

H

H

H

A

A

Guerrero

Iguala

A

A

A

A

SA

H

H

H

H

H

A

A

Hidalgo

Huejutla

H

SH SA

SA

SH H

H

H

H

H

H

H

Hidalgo

Zacualtipán

SH SA

SA

SA

SA

H

H

H

H

H

H

SH

Hidalgo

Pachuca

A

A

A

A

SA

SH SH SA

SH SA

A

A

Hidalgo

Actopan

A

A

A

A

SA

SA

SA

SA

SH SA

A

A

Jalisco

Tonalá

A

A

A

A

H

H

H

H

H

SA

A

A

Jalisco

Arandas

A

A

A

A

SA

H

H

H

H

SA

SA

A

Jalisco

Lagos de Moreno A

A

A

A

A

H

H

H

H

SA

A

SA

Jalisco

Ameca

SA

A

A

A

A

H

H

H

H

SA

A

A

Jalisco

Tepatitlán

A

A

A

A

SA

H

H

H

H

SA

A

A

Jalisco

Cd. Guzmán

SA

A

A

A

A

H

H

H

H

SA

A

A

Michoacán

Arteaga

SA

A

A

A

A

H

H

H

H

H

SA

A

Michoacán

Apatzingán

A

A

A

A

A

H

H

H

H

SH A

A

Michoacán

La Huacana

A

A

A

A

A

H

H

H

H

H

A

A

Michoacán

Sahuayo

SA

A

A

A

A

H

H

H

H

SA

A

A

Morelos

Cuautla

A

A

A

A

SA

H

H

H

H

SH A

A

Morelos

Tepalcingo

A

A

A

A

SA

H

H

H

H

SH A

A

Nayarit

Santiago Ixcuintla

SA

A

A

A

A

H

H

H

H

H

SA

SA

Nayarit

La Yesca

A

A

A

A

A

H

H

H

H

SA

A

A

Nayarit

Compostela

A

A

A

A

A

H

H

H

H

SH A

664

A

A

SA


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Nayarit

Tepic

SA

SA

A

A

A

H

H

H

H

H

SA

SH

Nuevo León

Galeana

A

A

A

A

SA

SA

SA

SA

H

SA

A

A

Nuevo León

Villaldama

SA

A

A

A

SA

SA

SA

SA

SA

SA

SA

SA

Nuevo León

Monterrey

SA

SA

SA

SA

SH SH SA

SH H

H

SA

SA

Nuevo León

Apodaca

SA

SA

A

SA

SA

SA

SA

H

SH SA

SA

Oaxaca

Tuxtepec

H

SA

SA

SA

SH H

H

H

H

H

SH

Oaxaca

San Pedro Mixtepec

A

A

A

A

SA

H

H

H

H

SH A

A

Oaxaca

Pinotepa Nacional

A

A

A

A

A

H

H

H

H

H

A

A

Oaxaca

Juchitán

A

A

A

A

SA

H

H

H

H

H

SA

A

Puebla

Tehuacán

A

A

A

A

SA

H

SH SH H

SA

A

A

Puebla

Tlacotepec

A

A

A

SA

SH H

SA

H

SA

A

A

Puebla

Tecamachalco

A

A

A

SA

SH H

SH SH H

SA

A

A

Q. Roo

Chetumal

H

SA

SA

SA

H

H

H

H

H

H

H

H

Q. Roo

Felipe Carrillo P.

H

SH SA

SA

H

H

H

H

H

H

H

H

Q. Roo

Bacalar

SH SH SA

SA

SA

H

H

H

H

H

H

H

Querétaro

San Juan del Río A

A

A

A

SA

H

H

H

H

SH A

A

Querétaro

Ezequiel Montes

A

A

A

A

SH SA

H

SA

SA

SA

A

A

Querétaro

Querétaro

A

SA

A

A

SA

SH H

SA

A

A

Sinaloa

Guasave

SA

A

A

A

A

A

SH H

H

SA

SA

SA

Sinaloa

Culiacán

SA

A

A

A

A

A

H

H

H

SA

SA

SA

Sinaloa

Mocorito

SA

A

A

A

A

A

H

H

H

SA

SA

SA

Sinaloa

Mazatlán

A

A

A

A

A

SA

H

H

H

A

A

A

San Luis Potosí

San Luis Potosí

A

A

A

A

SA

SA

SH SA

SH SA

A

A

San Luis Potosí

Villa de Arriaga

A

A

A

A

SA

SA

SH SA

SH SA

A

A

San Luis Potosí

Matehuala

SA

A

A

SA

SA

SH SH SH H

SA

A

SA

San Luis Potosí

Ciudad del Maíz

A

A

A

A

SA

SA

H

SH SA

SA

Sonora

Agua Prieta

SA

SA

A

A

A

A

SH SH SA

SA

SA

SH

Sonora

Ures

SA

SA

A

A

A

A

SH SH SH A

A

SH

Sonora

Rosario

A

A

A

A

A

SA

H

H

H

A

A

A

Sonora

Álamos

SA

SA

A

A

A

A

H

H

H

SA

SA

SA

Sonora

Navojoa

SA

A

A

A

A

A

SH H

H

SA

A

SA

Tabasco

Villahermosa

H

H

SA

SA

SH H

H

H

H

H

H

H

Tabasco

Balancán

H

SH SA

SA

H

H

H

H

H

H

H

H

Tabasco

Jonuta

H

H

SA

SA

SH H

H

H

H

H

H

H

Tabasco

Jalpa de Méndez H

H

SA

SA

SA

H

H

H

H

H

H

H

Tamaulipas

Aldama

SA

A

A

A

SA

H

H

H

H

H

SA

SA

Tamaulipas

Tampico

SA

SH A

A

SA

H

H

H

H

H

A

SA

Tamaulipas

Victoria

SA

SA

A

SA

SH H

SA

H

H

H

SA

A

Tamaulipas

Nuevo Laredo

SA

SA

A

SA

SA

SA

A

SA

SH H

SA

SA

Veracruz

Acayucan

SH SA

A

A

SA

H

H

H

H

H

H

665

SA

SA

SH H

SH H

H

H


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Veracruz

Veracruz

SA

SA

H

A

SA

H

H

H

H

SH H

SA

Veracruz

Minatitlan

H

H

SA

SA

H

H

H

H

H

H

H

H

Veracruz

Ozuluama

H

SA

A

SA

SA

H

H

H

H

H

H

H

Yucatán

Mérida

SH SA

SA

SA

SH H

H

H

H

H

H

SH

Yucatán

Tizimín

SH SA

SA

SA

H

H

H

H

H

H

SH H

Yucatán

Bucztotz

SH SA

SA

A

SH H

H

H

H

H

SH SH

Yucatán

Oxkutzcab

SA

SA

SA

SH H

H

H

H

H

SH H

SA

1-12= meses del año, A= árido, SA= semiárido, SH= subhúmedo H= húmedo.

666


http://dx.doi.org/ 10.22319/rmcp.v9i4.4404 Artículo

Modelos para programación y optimización de agua de riego en avena forrajera Models for irrigation timing and optimization in oats for forage

Miguel Servin Palestinaa* Ricardo Alonso Sánchez Gutiérreza Orlando Ramírez Valleb Manuel Antonio Galindo Reyesc Héctor Gutiérrez Bañuelosd

a

INIFAP. Campo Experimental Zacatecas. Km. 24.5 Carretera Zacatecas-Fresnillo, 98500 Calera de Víctor Rosales, Zacatecas, México. b

INIFAP. Campo Experimental Sierra de Chihuahua. Chihuahua. México.

c

INIFAP. Campo Experimental Pabellón. Aguascalientes. México.

d

Universidad Autónoma de Zacatecas. Facultad de Medicina Veterinaria, México.

* Autor de correspondencia: servin.miguel@inifap.gob.mx

Resumen: La avena como forraje es un cultivo de riego importante para la industria pecuaria en zonas áridas y semiáridas. Sin embargo, hay poca información sobre la relación del rendimiento de materia seca con la evapotranspiración real del cultivo o demanda hídrica, por lo que el objetivo del estudio fue generar modelos para describir el rendimiento de forraje y la productividad del agua al variar el aporte de agua de riego. Al aplicar 610.13 mm se logró el máximo (P<0.05) rendimiento (12.78 t ha-1) y la máxima (P<0.05) eficiencia del uso del agua


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

(2.36 kg de forraje m-3) fue al aplicar 463.64 mm y con rendimiento de 11.22 t ha-1, cosechando a grano lechoso-masoso (155 días después de la siembra o 1,291.5 grados días de desarrollo). El modelo cúbico ajustó mejor las características del cultivo y los efectos promedios de la evaporación del suelo (Kc) en función de los grados días de desarrollo. Con dichos modelos y la evapotranspiración potencial, es posible representar la demanda hídrica diaria del cultivo con un modelo matemático y concluir, que la demanda máxima es de 7.15 mm dia-1 y la demanda óptima sin poner en riesgo el rendimiento es de 5.8 mm dia-1. Estos modelos constituyen una herramienta útil para optimizar la producción de forraje con avena de riego con base en la aplicación oportuna y cantidad adecuada de agua de riego. Palabras clave: Planeación agrícola, Productividad del agua, Funciones de respuesta, Grados días de desarrollo, Uso consuntivo.

Abstract: Irrigated oats is an important forage-crop for livestock industry in arid and semi-arid zones; however, there is a lack of information regarding the relationship of dry matter yield and crop actual evapotranspiration or water demand; then the objective of the study was to develop mathematical models to describe yield and water use efficiency at different levels of irrigation water added. Maximum (P<0.05) yield (12.78 t ha-1) was found when 610.13 mm of water was applied, highest (P<0.05) water use efficiency was 2.36 kg of forage m-3 with 463.64 mm water applied and yielded 11.22 t ha-1, harvesting at the milky-dough stage (155 d after sowing or 1,291.5 degree days). Crop characteristics and mean effect of the soil evaporation (Kc), in function of the degree days, were better described by a cubic model. Using these models, in addition with the potential evapotranspiration, it is possible to estimate daily water demand, and it can be concluded that 7.15 mm d-1 is the maximum demand while 5.8 mm d-1 is the optimal demand without compromising yield. These models are a useful tool to optimize forage production from irrigated oats based on time and amount of water to be applied. Key words: Agricultural planning, Water productivity, Response functions, Degree days, Consumptive water use.

Recibido 13/03/2017 Aceptado 23/01/2018

668


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Introducción

La avena como forraje es un cultivo de amplia adaptación climática(1,2) e ideal para el ciclo otoño-invierno en zonas áridas y semiáridas por su alto contenido energético(3). El rendimiento de forraje fluctúa de 7 a 15 t ha-1 con apoyo de riego, el intervalo en rendimiento responde a la amplia variabilidad genética y a la disponibilidad de agua. Aunque se considera un cultivo de bajo requerimiento hídrico, algunos estudios presentan valores de 3,212 m-3 ha1(4) y 3,788 a 5,290 m-3 ha-1(5) a madurez fisiológica, y los altos costos de extracción y la disponibilidad del agua de riego son factores limitantes para su producción en zonas áridas(6). Por tal razón, se requiere de una aplicación en el momento oportuno y con la cantidad de agua necesaria para satisfacer los requerimientos hídricos del cultivo y lograr un rendimiento óptimo(7). La pobre precisión en determinar los requerimientos hídricos y la aplicación de la cantidad de agua de riego basada en la experiencia empírica, puede ocasionar láminas excesivas o insuficientes en etapas críticas para el cultivo, propiciando rendimientos de forraje por debajo del potencial(8,9). Uno de los enfoques clásicos para llevar a cabo la optimización del agua consiste en analizar la respuesta del cultivo a diferentes grados de déficit hídrico; también, obtener las relaciones funcionales que permiten maximizar el rendimiento por unidad de agua usada, así como estimar la producción del cultivo cuando este recurso es restringido(10,11,12). Sin embargo, existe poca información de los requerimientos hídricos de la avena y la relación del rendimiento de forraje con respecto a la cantidad de agua aplicada. El objetivo del estudio fue desarrollar herramientas para la programación del riego, que permitan conocer la demanda hídrica diaria en función del coeficiente del cultivo y la respuesta en rendimiento de forraje a la cantidad de agua aplicada en una zona árida templada, para identificar la máxima eficiencia y así optimizar el uso del agua.

Material y métodos

El estudio se realizó en el Campo Experimental Zacatecas (CEZAC), ubicado a 22º 54' N y 102º 39' O y 2,197 msnm, temperatura media anual de 14.6 ºC, ~ 600 unidades frío de noviembre a febrero, precipitación media anual de 416 mm, concentrada (75 %) en el verano

669


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

(junio a septiembre) el resto durante el invierno y una evaporación media anual de 1,609 mm(13). El suelo es Kastanozem, textura franca arcillosa, pH de 7.9, 2.0 % materia orgánica, densidad aparente de 1.42 g cm-3, capacidad de campo (CC) y punto de marchitez permanente (PMP) de 30.62 y 15.04 % respectivamente, para 0 a 30 cm y 34.63 y 15.02 % para 30 a 60 cm de profundidad de suelo. La avena variedad Cuauhtémoc se sembró en seco el 26 de noviembre del 2015, en surcos de 0.76 m usando una sembradora de precisión a doble hilera de plantas colocadas en chorro con separación entre hileras de 0.10 m y densidad de siembra de 100 kg ha-1. Se utilizaron cuatro bloques de 30 m de largo por 7 m de ancho, donde se colocó tubería de PVC de 2’’, entre el bloque 1-2 y 3-4 sobre la cual se colocaron cruceros de riego dobles con válvulas de seccionamiento de polietileno de 2” espaciadas a 6 m, quedando un total de 20 unidades experimentales. En cada bloque se distribuyeron los tratamientos al azar. La dosis de fertilización (NPK) fue 150-60-00 (urea y fosfato monoamónico solubles) fraccionada en cinco aplicaciones durante el ciclo por medio del sistema de riego a los 22, 48, 64, 91 y 125 días después de siembra (DDS) con porcentajes de 30-10, 30-10, 20-20, 10-30 y 10-30 de nitrógeno y fósforo respectivamente. Los tratamientos fueron cinco niveles de recuperación de la demanda atmosférica 110 (T110), 100 (T100), 85 (T85), 65 (T65) y 50 (T50) % de la evapotranspiración potencial (EToin) calculada por el método de Penman Monteith(14), obtenida diariamente de una estación Adcon® ubicada dentro del experimento. La aplicación de agua de riego se realizó mediante una cintilla autocompensada calibre 6 milésimas de pulgada, con separación de emisores a 20 cm y gasto del emisor de 0.94 lph y se colocó un medidor volumétrico de ½’’ marca TD Meters® sobre la cintilla del surco central en cada parcela. La unidad experimental fue de seis surcos de 0.76 m por 6.0 m de largo. La parcela útil fueron los dos surcos centrales con 2.5 m de largo. La cosecha de las plantas se realizó manualmente en el estadio de desarrollo de grano lechoso-masoso. La parcela útil se cortó a 5 cm por arriba del suelo y se pesó, de allí se tomó una submuestra de 300 g que se llevó a una estufa de secado donde se dejó a 60 °C durante 72 h para calcular el porcentaje de materia seca. Al inicio del experimento se realizó un muestreo gravimétrico para determinar el contenido de humedad residual (CHR), y así calcular la lámina de riego inicial(15) para el establecimiento del experimento (Ec. 1), para los tratamientos 110 y 100 de EToin se llevó a capacidad de campo (100 % de la humedad aprovechable). Los demás tratamientos fueron a 85, 65 y 50 % de la humedad aprovechable en los primeros 60 cm del perfil del suelo. Las láminas de establecimiento se aplicaron por pulsos de 20 a 30 mm durante la primera semana después de la siembra, hasta cubrir el porcentaje de humedad aprovechable para cada tratamiento. Posteriormente se estableció un programa de riego con base en sumar dos veces por semana los datos diarios de la EToin obtenidos de la estación Adcon y se restó la precipitación efectiva (Pe) (Ec. 2); se consideró como precipitación efectiva aquélla que superó los 5 mm y sólo se considera únicamente el 75 %(16). 670


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

đ??żđ?&#x2018;&#x2026;đ??¸ = (đ??śđ??ś â&#x2C6;&#x2019; đ??śđ??ťđ?&#x2018;&#x2026;/100) â&#x2C6;&#x2014; đ??ˇđ?&#x2018;&#x17D; â&#x2C6;&#x2014; đ?&#x2018;&#x192;đ?&#x2018;&#x; đ?&#x2018;&#x203A;

đ?&#x2018;&#x203A;

đ??żđ?&#x2018;&#x;đ?&#x2018;&#x2013; = â&#x2C6;&#x2018; đ??¸đ?&#x2018;&#x2021;đ?&#x2018;&#x153;đ?&#x2018;&#x2013;đ?&#x2018;&#x203A;

đ?&#x2018;&#x2013;â&#x2C6;&#x2019;1 â&#x2C6;&#x2019; â&#x2C6;&#x2018; đ?&#x2018;&#x192;đ?&#x2018;&#x2019;đ?&#x2018;&#x2013;â&#x2C6;&#x2019;1

đ?&#x2018;&#x2013;=1

đ?&#x2018;&#x2013;=1

Ec. 1 Ec. 2

Donde: LRE= låmina de riego de establecimiento (cm); CC= capacidad de campo (%); CHR= contenido de humedad residual (%); Da= densidad aparente (g cm-3); Pr= Profundidad del perfil (cm); Lri= låmina de riego (mm); ETo= evapotranspiración diaria en (mm); Pe= precipitación efectiva diaria (mm); n= número de días entre riegos de 3 o 4 (riegos dos veces por semana). Para determinar la låmina de riego neta (Lrn) se consideró un 95 % de eficiencia de aplicación. El tiempo de riego se obtuvo dividiendo la Lrn entre la tasa horaria (TH), que es la cantidad de agua suministrada por el sistema de riego en milímetros en una hora de operación, la cual fue TH = 6.18 mm h-1(6). Considerando una separación entre líneas regantes de 0.76 m. Con la sumatoria de Lri de cada riego se determinó la låmina total (mm, R) y para corroborar el volumen total de agua en cada tratamiento se tomaron las lecturas de los medidores volumÊtricos. Las variables obtenidas fueron rendimiento de forraje base materia seca (kg ha-1), y se calculó la evapotranspiración real del cultivo (ETc1) que es la suma de R mås la precipitación efectiva de todo el ciclo (Pet). TambiÊn se calculó la eficiencia en el uso de agua EUA =Rendimiento / R y la productividad del agua PA = Rendimiento / ETc1 ambas representadas en kg m-3(17). El anålisis estadístico fue con anålisis de varianza para las variables rendimiento, EUA y PA, con un modelo de diseùo en bloques al azar; la comparación de medias fue por Tukey al 5% de probabilidad(18). Posteriormente la función de respuesta del cultivo a los diferentes niveles de humedad, se obtuvo al relacionar los datos observados del rendimiento (t ha-1) y productividad de agua (kg m-3) como variables dependientes y la evapotranspiración real del cultivo (mm; ETc1) como variable independiente, y se realizó mediante una regresión en SAS con el procedimiento Stepwise, ajuståndolos a un modelo cuadråtico de segundo orden, de la forma: Rendimiento=β0+β1ETc+β2ETc2 y PA=β3ETc+β4 ETc2, donde β0= ordenada al origen, β1 a β4 = coeficientes de la regresión. Para obtener la evapotranspiración del cultivo que maximiza el rendimiento de forraje: evapotranspiración del cultivo måxima (ETcmax) y la

671


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

evapotranspiración del cultivo que presenta el valor más alto de productividad de agua y rendimiento óptimo: Evapotranspiración óptima del cultivo (ETcopt), se realizó un análisis de optimización con la teoría de máximos y mínimos del cálculo diferencial e integral(19). Además, se cuantificaron los días después de siembra (DDS) para las etapas de: inicio, desarrollo del cultivo, mitad de temporada y final de temporada y se calcularon los grados día de desarrollo (GDD) con la metodología curva seno modificada(20), como temperaturas base y máxima (a las cuales el desarrollo de la avena no es afectado), se tomaron 5 y 30 °C respectivamente(21). Para obtener el coeficiente del cultivo diario se utilizó el modelo Kc(r) = -9.2347D3+10.902 D2-1.7314D+0.2686, donde: Kc(r)= coeficiente de cultivo de avena para grano (adimensional) y D= porcentaje de desarrollo del cultivo representando con valores de 0 a 1 obtenido con los datos del manual número 56 de la FAO de la página 106 y 111 para avena de grano(14), utilizando la metodología descrita por Servín(6) (Figura 1).

Figura 1: Curva generalizada de coeficiente de cultivo para avena de grano con datos obtenidos de manual 56 de la FAO, la línea punteada muestra el Kc final para producción de forraje en la etapa de masoso-lechoso 1.4 Kc (r) = 0.2686 - 1.7314 D + 10.902 D2 -9.2347 D3 R² = 0.97

Coeficiente de cultivo (Kc)

1.2

C

Kcmed = 1.15

D

Modelo Kc (r)

1.0

Kc Datos FAO-56

0.8

Kcfin Forraje

0.6 0.4

Kcini = 0.3

B

A

0.2

E Kcfin = 0.25

0.0 0.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

Desarrollo (D) Inicial 20

Desarrollo del cultivo 50 días

Mitad de temp. 60 días

Final de temp. 30 días

Para obtener el Kc final para forraje de la zona de estudio, se dividieron los días de corte en la etapa grano masoso-lechoso a los 155 DDS, entre los días que llego a madurez fisiológica

672


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

el cultivo de avena, que fue a los 165 DDS, (D=0.94), el valor se sustituyó en el modelo Kc(r) (Figura 1), quedando Kcfin= 0.61, que será el valor utilizado para generar la curva generalizada de coeficiente de cultivo para forrajes de avena [Kc(f)], considerando los puntos observados en el experimento establecido de “AB” 35 días “BC” 40 días “CD” 60 días y “DE” 20 días y los coeficientes de cultivo de 0.3 y 1.15 para Kcini y Kcmed, respectivamente. Se calculó el porcentaje de desarrollo para cada etapa y se obtuvo un modelo cúbico para estimar el coeficiente del cultivo para forraje [Kc (f)]. Posteriormente se obtuvo el Kc(f) diario y se multiplicó por la evapotranspiración potencial calculada por el método de Penman Monteith(14), obtenida diariamente de una estación Adcon® ubicada a 1.5 km de la parcela experimental (EToout), y se obtuvo la evapotranspiración diaria del cultivo calculada (ETci). Finalmente se realizó una sumatoria para obtener evapotranspiración del cultivo calculada (∑ETc). Consecutivamente con los valores de ETcmax y ETcopt obtenidos del análisis de optimización se procesaron en “SOLVER”, una herramienta complementaria de Excel, que optimiza numéricamente los modelos sujetos a restricciones, y emplea un algoritmo matemático con el cual se encuentran las decisiones óptimas para un modelo determinado en una hoja de cálculo(22) y con un método de gradiente reducido generalizado(23) se logra un modelo de coeficiente de cultivo que maximiza el rendimiento (Kcmax) y el que optimiza el rendimiento (Kcopt). Posteriormente se calculó el Kcmax y Kcopt diario y se multiplicó por EToout registrada diariamente en la estación agroclimática, y se obtuvo la evapotranspiración diaria del cultivo calculada ETcmax y ETcopt, que al relacionarlas con el porcentaje de desarrollo (de 0-1) obtenido con los grados días de desarrollo, se obtienen los modelos máximos y óptimos de uso consuntivo para producción de forraje de avena en clima árido templado.

Resultados

Condiciones climáticas

La precipitación del ciclo de desarrollo del cultivo fue de 75.7 mm; mientras que el promedio de los últimos 13 años (2002 a 2015) fue de 64.59 mm; esto indica que el ciclo de establecimiento del experimento fue más húmedo sobre todo en diciembre y marzo, ya que

673


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

se registró el 74 %, mientras que los meses de enero y febrero solo se registraron 7 mm, mostrando una distribución irregular con un periodo muy largo de sequía, mientras que en los promedios históricos se muestra una distribución más uniforme. Para ETO durante la estación de crecimiento fue 663.4; y el promedio histórico fue de 734.4 mm, esto significa una disminución de 10.7 % en ETO, sobre todo en diciembre y marzo. Estos meses coinciden con las precipitaciones y por consiguiente en el incremento de la humedad relativa. En cuanto al promedio de las temperaturas para la estación de crecimiento fueron 21.65 y 3.83 °C, un poco inferiores a los promedios históricos de 22.19 y 4.24 °C para la Tmax y Tmin respectivamente (Figura 2).

Figura 2: Variables climáticas registradas durante la estación de crecimiento y promedios históricos (13 años) de la estación CEZAC INIFAP-Zacatecas. *Promedios decenales 30

8.0 7.0

25 6.0 20

15

4.0 3.0

ETo (mm)

Pp (mm)

5.0

10 2.0 5 1.0

26/12/15

HR (%)

Pp Decenal

26/01/16

26/02/16

Pp *Dec (13 años)

0.0 26/04/16

26/03/16

Eto

Eto (13 años)

90

35.0

80

30.0

70

25.0

60

20.0

50

15.0

40

10.0

30

5.0

20

0.0

10

-5.0

0 26/11/15

26/12/15

26/01/16

26/02/16

26/03/16

-10.0 26/04/16

HR *De c

HR *De c (13 año s)

TMa x

Tma x (13 año s)

TMi n

Tmi n (1 3 a ños)

674

Temperatura ( C)

0 26/11/15


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Rendimiento y productividad

El tratamiento que mostró el rendimiento más alto (P<0.05) fue T85 con 12.7 t ha-1, los tratamientos extremos presentaron los rendimientos más bajos sin diferencia (P>0.05) entre ellos. El rendimiento incrementó gradualmente con la lámina de riego hasta llegar a T85 y posteriormente se redujo a mayor lámina de riego. La EUA y PA fueron máximos (P<0.05) con T50, con valores de 2.64 y 2.40 respectivamente, aunque en rendimiento fue de los tratamientos más bajos; T110 mostró un rendimiento similar al de T50, pero con la mayor cantidad de agua aplicada (757 mm), por lo que EUA fue 92 y 69 % menor que T50 y T85 respectivamente (Cuadro 1).

Cuadro 1: Rendimiento base materia seca, eficiencia y productividad de agua en avena en etapa de lechoso-masoso irrigada a diferente proporción de la evapotranspiración potencial (ETo) ETo (%) 50 65 85 100 110 CV MSE

R (mm) 383 446 551 708 757

Pet (mm)

39

ETc1 (mm) 422 485 590 747 796

MS (t ha-1) 10.13±0.4 c 11.72±0.4 b 12.78±0.2 a 11.21±0.2 b 10.39±0.2 c 3.05 0.34

EUA (kg m-3 ) 2.64±0.12 a 2.62±0.09 b 2.32±0.05 b 1.58±0.03 c 1.37±0.03 c 3.52 0.07

PA (kg m-3 ) 2.40±0.11 a 2.42±0.08 b 2.17±0.04 b 1.50±0.03 c 1.31±0.03 c 3.46 0.06

R = lámina de riego aplicada; Pet= precipitación efectiva total; ETc1= evapotranspiración real del cultivo; MS= rendimiento base materia seca; EUA= eficiencia en el uso de agua; PA= productividad de agua de riego; CV= coeficiente de variación; MSE= cuadrado medio del error. abc Medias en igual columna con al menos una literal en común no son diferentes (Tukey al 5%).

675


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Modelos de optimización

Rendimiento y PA mostraron una relación cuadrática con los cambios en ETc1 con un ajuste aceptable y coeficientes de regresión diferentes de cero (P≤0.01) (Figura 3). El punto de máximo de rendimiento y máxima PA no coincidieron, donde se intersectan ambas curvas se encuentra el punto óptimo para productividad del agua y rendimiento considerados en conjunto.

Figura 3: Relación de rendimiento de materia seca y productividad de agua del cultivo de avena para forraje sometida a déficit hídrico en Zacatecas, México YLD =- 10.885+ 0.8287ETc -0.0073ETc2 R² = 0.91 CV =3%

3.0 YLDMAX

12

2.5

YLDOPT

10

2.0

8 1.5

YLD1 6

WP1 1.0

4

0.5

2

WP =0.0102ETc - 0.000011ETc2 R2 = 0.97 CV=3%

0 0

200

400

600

800

Productividad del agua (kg m-3 ;WP)

Rendimiento de materia seca (t ha-1 ; YLD)

14

0.0 1000

Evapotranspiracion del cultivo (mm; ETc)

Con los modelos de rendimiento y PA el análisis de optimización permite deducir que la avena forrajera maximiza su producción a 12.78 t ha-1, cuando consume ETcmax= 610.13 mm y la máxima productividad del agua de 2.36 kg m-3 se alcanza cuando consume ETcopt = 463.64 mm presentando un rendimiento óptimo de 11.22 t ha-1, hasta los 155 DDS que abarca de la siembra al estado lechoso-masoso.

676


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Coeficiente de cultivo ajustado

Con los datos observados de 35, 40, 60 y 20 días para la etapa de: inicio, desarrollo del cultivo, mitad de temporada y final de temporada respectivamente, se obtuvo el desarrollo acumulado Kc, donde: B=0.27, C=0.53 D=0.80 (A y B es 0 y 1 respectivamente) y valores de coeficiente de cultivo de: Kcini=0.3, Kcmed=1.15 y Kcfin=0.61. Se generó la curva generalizada de kc, posteriormente se ubicaron 10 puntos para suavizar la curva (Figura 4) y se sometió a un análisis de regresión.

Figura 4: Curva generalizada del coeficiente de cultivo de avena para forraje en la etapa de masoso-lechoso Grados dias de desarrollo (GDD)

0

100

200

300

400

500

600

700

800

900

1000 1100 1200

1.4 Kc (f) =0.2772 - 1.2462D + 8.7745D2 - 7.2552D3 R² = 0.97

Coeficiente de cultivo (Kc)

1.2

Kcmed = 1.15

C

D

Kc Ajus FAO-56 Kcfin Forraje Kc (0.1) Kc max Kc opt

1.0 0.8 0.6

E

0.4

Kcmax = 0.3417 - 1.2462D + 8.8010D2 - 7.2552D3

B

Kcini =

Kcopt = 0.1570 - 1.2462D + 8.7237D2 - 7.2552D3

A

0.2

Kcfin = 0.61

0.0 0.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

Desarrollo (D) Inicial 35 días 274.9 GDD

Desarrollo del cultivo 40 días 232.3 GDD

Mitad de temp. 60 días 557.4 GDD

Final de temp. 20 días 226.9 GDD

Línea negra representa los valores de Kc (Fuente: FAO-56), mientras que las líneas punteadas son el resultado de análisis de optimización de Kc max y Kc opt.

Los grados días de desarrollo por etapa fueron: AB=274.9, BC=232.3, CD=557.4 y DE=226.9 que corresponden a: inicio, desarrollo del cultivo, mitad de temporada y final de temporada, respectivamente, el total fue 1,291.5 GDD durante los 155 días del cultivo, que al hacer divididos entre los grados diarios acumulados de siembra hasta la cosecha del forraje, da como

677


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

resultado el porcentaje de desarrollo, que al sustituirlo al modelo Kc(f) genera el coeficiente de cultivo diario y al multiplicarlo por la EToout diaria resulta una ∑ETc= 520.02 mm. Al someter el análisis en “SOLVER” por medio de interacciones y cambiar los valores positivos de modelo Kc (f), β0= 0.2772 y b β2=8.7745, hasta ETcmax= ∑ETc y ETcopt = ∑ETc se obtuvieron los modelos que se muestran en la Figura 4, donde: Kcmax= coeficiente de cultivo que maximiza el rendimiento (adim); Kcopt= coeficiente de cultivo que optimiza el rendimiento (adim) y D= porcentaje de desarrollo representado en tanto por 1 en función de los grados días de desarrollo.

Evapotranspiración del cultivo

Al relacionar las necesidades de agua de cultivo representada en evapotranspiración de cultivo (ETc) como variable dependiente, que es el producto de la EToout , por el coeficiente del cultivo diario (obtenidos de los modelos de Kcmax y Kcopt) y porcentaje de desarrollo en función de los grados días de desarrollo acumulados representado de 0 a 1 como variable independiente, se obtuvo un modelo polinomio de tercer grado mediante un análisis de regresión, y de esa manera calcular la demanda de agua diaria del cultivo (Figura 5).

678


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Figura 5: Evapotranspiración diaria del cultivo cuando maximiza su rendimiento y cuando el cultivo optimiza su rendimiento

Con los resultados mostrados en la Figura 5, se puede deducir, que la demanda evapotranspirativa máxima del cultivo es de 7.15 mm dia-1 para alcanzar un rendimiento máximo y 5.85 mm día-1 para alcanzar la mayor productividad del agua, valores que se representa como uso consuntivo para producción de avena forrajera de otoño e invierno para zonas áridas templadas.

Discusión

A pesar que la precipitación no fue una variable importante para determinar la cantidad de agua aplicada en cultivo (Pe=39 mm), tuvo un efecto indirecto en la demanda evapotranspirativa, ya que se observó un efecto en humedad relativa y temperaturas, variables importantes en el consumo de agua en los cultivos(24). Los procesos fisiológicos que se realizan durante el crecimiento y desarrollo de las plantas están fuertemente 679


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

influenciados por la temperatura. Su variación depende de la especie y variedad, ya que para cereales de invierno se han aceptado umbrales de 4 a 5°C(25). Durante el presente estudio se observó un promedio de temperatura mínima de 3.83 °C, lo que ocasionó que se alargara el ciclo vegetativo de 150 días a 165 días hasta grano maduro de avena(26). Los rendimientos coinciden con Jiménez(27) y Gutiérrez(28), ya que mencionaron rendimientos de forraje en los Valles Altos de México de 9 a 13 t ha-1 con las variedades Saia, Ópalo y Cevamex. Espitia et al(2) evaluaron 24 genotipos de avena en cuatro localidades del centro del país en P-V en temporal donde se presenta Pp mayor de 400 mm durante el ciclo, con valores de 10 a 19 t ha-1 sembrada a chorrillo en surcos espaciados a 30 cm; sin embargo, son inferiores a los reportados por otros autores(26) que obtuvieron 17.2 t ha-1 en la etapa de grano masoso en Zacatecas con la variedad Chihuahua sembrada de la misma manera (surco doble hilera) con 80 kg de semilla por ha, con una dosis de fertilización de 80-46-0 Kg ha-1 de N P K respectivamente. Usando como fuentes sulfato de amonio y superfosfato triple en dos aplicaciones 50-100-0 % a la siembra y 50-0-0 % al primer riego de auxilio, con una lámina total aproximada de 40 cm aplicada con multicompuertas. Las láminas de riego aplicadas para cereales de invierno se reportan en 500 a 600 mm por ciclo(29), que corresponden a ciclos completos hasta madurez fisiológica, que es más largo que para forraje. También se han reportado láminas de 65.3 cm y rendimientos de materia seca de 7.27 kg ha-1 para la variedad Avemex (1.14 kg MS m-3) sembrada en surcos a doble hilera con una dosis de 100-70-00 de NPK(30), y rendimientos de 13.7 t ha-1 con láminas de riego de 55 cm y una productividad de 2.5 kg m-3(31). Las variaciones de los resultados reportados en los diferentes trabajos de investigación son atribuibles a la variedad, ambiente agroecológico y manejo, principalmente de riego y siembra. Además, con riego superficial en la Comarca Lagunera una tendencia lineal entre rendimiento de materia seca y el agua aplicada. Las láminas reportadas fueron de 44.3 a 62.5 cm mientras que los rendimientos fueron de 14.28 hasta 15.53 t ha-1 con eficiencias en el uso de agua de 3.14 a 2.14 kg de forraje por m-3(32). Otros autores reportan para sorgo una relación sigmoidal entre el rendimiento y el agua aplicada mediante el riego(33,34,35). Es importante explorar toda la curva, donde el cultivo tenga exceso de agua, y por otro lado esté sometido a estrés donde la ETreal sea menor a ETmax, para los cultivos forrajeros el exceso de vigor no será un problema, pero sí la mala aireación(36). Con lo que respecta a Kc para avena forrajera algunos reportes de investigación presentan valores de Kcini=0.4, Kcmed=1.20 y Kcfin=0.8(37) que están por encima de los que se tomaron de referencia que son trabajos más recientes. El Kc comienza teniendo valores pequeños y aumenta a medida que la planta cubre el suelo(14). Los valores máximos de Kc se alcanzan en la floración, se mantienen durante la fase media y finalmente decrece durante la fase de maduración, tendencias similares son reportadas(38,39,40).

680


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Dellacanonica et al(41), realizaron un balance hídrico del suelo en avena y mencionan que las necesidades netas del cultivo fueron 370 mm sometido a un déficit hídrico de 38 hasta 46 %. Con rendimientos promedios de 9.40 t ha-1 de MS, el déficit hídrico suele provocar pérdida de turgencia y en consecuencia una disminución en la tasa de crecimiento(41). De acuerdo a los resultados mostrados 610.13 mm el cultivo expresa su potencial en función del agua disponible y 463.64 mm el cultivo es sometido a un déficit controlado que no pone el riesgo la tasa de crecimiento.

Conclusiones e implicaciones

En avena para forraje la relación de rendimiento de forraje y eficiencia del uso del agua se describe mediante un modelo cuadrático con respecto de la cantidad de agua de riego aplicada, sin coincidencia en los niveles de agua aplicada para lograr máximo rendimiento y máxima eficiencia. El modelo cúbico de coeficiente del cultivo óptimo (Kcopt) es una herramienta confiable para calcular la demanda hídrica diaria de avena para forraje en función de los grados días de desarrollo, lo que a su vez permite una programación y calendarización de riego en tiempo real en periodos mayores de un día sin poner en riesgo el rendimiento de forraje de avena.

Literatura citada: 1.

Sánchez GRA, Gutiérrez BH, Serna PA, Gutiérrez LR, Espinoza CA. Producción y calidad de forraje de variedades de avena en condiciones de temporal en Zacatecas. Rev Mex Cienc Pecu 2014;5(2):131-142.

2.

Espitia RE, Villaseñor ME, Tovar GR, de-la-O OM, Limón OA. Momento óptimo de corte para rendimiento y calidad de variedades de avena forrajera. Rev Mex Cienc Agr 2012;3(4):771-783.

3.

Ghanbari BA. Intercropped wheat and bean as a low-input forage [doctoral thesis]. London: Wye College Univ; 2000.

4.

Abraha MG, and Savage MJ. The soil water balance of rainfed and irrigated oats, Italian rye grass and rye using the CropSyst model. Irrigation Sci 2008;26(3):203-212.

681


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

5.

Drastig K, Prochnow A, Libra J, Koch H, Rolinski S. Irrigation water demand of selected agricultural crops in Germany between 1902 and 2010. Sci Total Environment 2016;(569):1299-1314.

6.

Servin PM. Sistema para programar y calendarizar el riego de los cultivos en tiempo real [tesis maestria], Texcoco México. Colegio de Potsgradudados; 2015.

7.

Inzunza IMA, Villa CM, Catalán VEA, Mendoza MSF. Modelo para estimar el rendimiento de maíz en función de la humedad del suelo. Terra Latinoamericana, 2006;24(2):179-185.

8.

Sammis, TW. Yield of alfalfa and cotton as influenced by irrigation. Agronomy J 1981;73(2):323-329.

9.

Abdul-Jabbar, AS, Sammis TW. Effect of moisture level on the root pattern of alfalfa. Irrigation Sci 1982;3(3):197-207.

10. Reck, WR, Overman AR. Estimation of corn response to water and applied nitrogen. J Plant Nutr 1996;19(1):201-214. 11. Llewelyn RV, Featherstone AM. A comparison of crop production functions using simulated data for irrigated corn in western Kansas. Agric Systems 1997;54(4):521-538. 12. Reca J, Roldan J, Alcaide M, López R, Camacho E. Optimization model for water allocation in deficit irrigation systems. I. Description of the model. Agric Water Manage 2001;48(2):103-116. 13. Medina G, Ruíz A. Estadísticas Climatológicas Básicas del Estado de Zacatecas (Período 1961 – 2003). SAGARPA-INIFAPCIRNOC- Campo Experimental Zacatecas. Libro Técnico No. 3. 2004. 14. Allen R, Pereira L, Raes D, Smith M. Evapotranspiración del cultivo. Guías para la determinación de los requerimientos de agua de los cultivos. FAO. Riego y Drenaje 56. Roma, Italia; 2006. 15. Palacios VE. ¿Por qué, cuándo, cuánto y cómo regar?: para lograr mejores cosechas. México, DF: Editorial Trillas; 2002. 16. Serna PA, Zegbe JA, Mena CJ. Rendimiento y calidad de chile seco Mirasol cultivado bajo riego parcial de la raíz. Revista Chapingo Serie Horticultura 2011;17(SPE 1):1924. 17. Caviglia OP, Andrade FH. Sustainable intensification of agriculture in the Argentinean pampas: Capture and use efficiency of environmental resources. Am J Plant Sci Biotechnol 2010;3:1-8.

682


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

18. SAS. Version 9.3 [Computer software]. SAS Institute, Cary, NC. 2011. 19. Steel RG, Torrie JH, Dickey DA. Principles and procedures of statistics. A biometrical approach. Third ed. USA: The McGraw-Hill Companies, Inc; 1997. 20. Villa CM, Catalán VE, Román LA, Inzunza IMA, Mendoza M, Duarte J, Báez A, Gómez L. Parámetros fisiotécnicos y requerimientos agroclimáticos de la canola (Brassica napus L.) Agrofaz 2007;9:13-19. 21. Rouphael Y, Cardarelli M, Rea E, Colla G. The influence of irrigation system and nutrient solution concentration on potted geranium production under various conditions of radiation a temperature. Scientia Horticulturae 2008;118(4):328-337. 22. Eppen GD, Gould FJ, Schmidt CP, Moore JH, Weatherford LR. Investigación de operaciones en las ciencias administrativas. Trad. Español. González, RAC, Sánchez, GG. 5th ed. México, DF: Pearson; 2000. 23. Muramatsu M. Risk solver. Versión 11.5. Incline Village, Nevada, EUA: Frontline systems Inc.; 2011. 24. Sánchez DM, Aguirreola J. Relaciones hídricas. En: Azcon D, Talon M, editores. Fisiología y bioquímica vegetal. España: Mc Graw-Hill Interamericana de España; 1996:49-90. 25. Villalpando IJF. Metodología de investigación en agroclimatología. Documento de circulación interna mimeografiado. INIA-SARH. Zapopan, Jalisco. 1985. 26. Nájera MDJ, Gutiérrez SRA, Cháirez EFG, Luna GR, Nieto RCA, González SH. Producción y calidad de forraje en mezclas de veza común con cebada, avena y triticale en cuatro etapas fenológicas. Rev Mex Cienc Pecu 2016;7(3):275-291. 27. Jiménez GCA. Descripción de variedades de avena cultivadas en México. Campo Experimental Valle de México. CIRCE. INIFAP. SARH. Chapingo, Estado de México. Folleto técnico Núm. 3. 1992. 28. Gutiérrez JM. Cómo producir avena forrajera de temporal en el estado de México. INIFAP. 500 Tecnologías Llave en Mano. INIFAP-SAGAR. Tomo I, México. 1999. 29. Gutiérrez JM. Cómo producir avena forrajera de temporal en el estado de México. INIFAP. 500 Tecnologías Llave en Mano. Serie 1999. Tomo I. INIFAP-SAGAR. México. 1999:17-18. 30. Jasso IR, Faz CR, Berzoza MM, Chávez SN, Nuñez HG, Orozco HG. Requerimientos hídricos y manejo del agua de riego en cultivos forrajeros. Campo Experimental Delicias CIRNOC-INIFAP, Folleto Científico No. 4. 2007.

683


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

31. García HRV, Flores GH, Narváez MMP, Osuna CES. Eficiencia en el uso del agua y producción de forraje en avena (Avena sativa L.) invernal. Semana Internacional de Agronomía FAZ-UJED Venecia Durango, México. 2016:603-608. 32. Anaya SA, Núñez HG, Cruz CJJ, Faz CR, Rodríguez HK, Figueroa VU, Serrato MHA. Producción, manejo y eficiencia en el uso del agua en explotaciones lecheras de la Región Lagunera en el período 2011-2013. AGROFAZ 2014;14(1):119-128. 33. Núñez HG, Cruz CJJ, Iván SO, Rodríguez HK, Sánchez DJ. Modelo de procesos para el diagnóstico del uso del agua de riego en la producción de forrajes en explotaciones lecheras del sistema intensivo en ambientes cálido y templado. AGROFAZ 2012; 12(4):103-111. 34. Musick JT, Dusek DA. Grain sorghum response to number, timing, and size of irrigations in the Southern High Plains. Trans. ASAE 1971;14(3):401-404. 35. Martin DL, Watts DG, Gilley JR. Model and production function for irrigation management. J Irrigat Drain Eng 1984;110(2):149-164. 36. Santa-Olalla MM, Valero JAJ. Las funciones de producción versus agua. 1ra ed. Madrid, España: Mundi Prensa; 1993. 37. González RF, Herrera PJ, López ST, Cid LG. Respuesta del sorgo al riego en dos épocas de siembra. Función agua rendimiento. Rev Cien Tec Agrop 2011;20(1):40-46. 38. Shuttleworth WJ. Evaporation. In: Maidment DR. editor. Handbook of hydrology. New York, USA: Mc. Graw Hill; 1993. 39. Garay COB. Manual de uso consuntivo del agua para los principales cultivos de los Andes centrales peruanos (No. F06 G37-F). Lima Perú, Instituto Geofísico del Perú. 2009. 40. MaiaI CE, de-MoraisI ERC. Coeficiente de cultura do meloeiro irrigado com água salina estimado por modelo matemático. Ciência Rural 2008;38(5):1273-1278. 41. Dellacanonica C, Bermejillo A, Moradito J. Rendimiento y calidad de un cultivo de avena (Avena sativa L.), bajo distintas láminas de riego en el noroeste de Chubut (Argentina). INTA EEA Esquel – Chubut Argentina, 2011 http://www.riegoyfertirriego.com.ar/VI_Jornadas/VI_JARF_TrabajosCompletos/Della canonica.pdf. Consultado Feb 15, 2017.

684


http://dx.doi.org/ 10.22319/rmcp.v9i4.4333 Artículo

Uso de retenedores de humedad edáfica en la sobrevivencia y crecimiento de dos especies de pastos Bouteloua curtipendula [Michx.] Torr. y Chloris gayana Kunth Use of soil moisture retainers on the survival and growing of two grass species Bouteloua curtipendula [Michx.] Torr. and Chloris gayana Kunth

Luis Gerardo Yáñez-Cháveza Aurelio Pedroza-Sandovala* Martín Martínez-Salvadorb Ignacio Sánchez-Cohenc Francisco Guadalupe Echavarría-Cháirezd Miguel Agustín Velásquez-Vallee Armando López-Santosa

a

Universidad Autónoma Chapingo. Unidad Regional Universitaria de Zonas Áridas. Km 40 Carretera Torreón-Chihuahua. 35230 Bermejillo, Durango. México. b

CIRNOC-INIFAP, Centro Experimental “La Ventana”. Chihuahua, Chih., México.

c

INIFAP, Centro Nacional de Investigación Disciplinaria en Relaciones Agua Suelo Planta Atmósfera, Gómez Palacio, Durango. México. d

CIRNOC-INIFAP. Centro Experimental de Calera, Calera, Zacatecas, México.

e

CIRNE-INIFAP. Campo Experimental Saltillo, Saltillo, Coahuila, México.

*Autor de correspondencia: apedroza@chapingo.uruza.edu.mx


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Resumen: El 85 % de las zonas áridas y semiáridas de México presentan problemas de erosión por sobrepastoreo en áreas de pastizal, con el consecuente incremento en el proceso de desertificación de los suelos. El objetivo del presente estudio, fue evaluar diferentes especies y prácticas de retención de humedad en el suelo en el establecimiento y desarrollo de pasto en zonas semiáridas. Se usó un diseño experimental de bloques al azar en un arreglo de parcelas divididas con tres repeticiones. Las parcelas grandes correspondieron a las dosis de rastrojo de maíz (0 y 10 t ha-1), las parcelas medianas a las dosis de hidrogel (0, 10 y 20 kg ha-1) y las parcelas chicas a las dos especies de pastos Bouteloua curtipendula [Michx.] Torr. y Chloris gayana Kunth. Se usó el método de trasplante. El porcentaje de sobrevivencia fue superior a 72 % en promedio general, aun cuando B. curtipendula fue sobresaliente en las diferentes fechas de evaluación. El rastrojo de maíz como cobertura vegetal, registró un contenido de humedad en el suelo de 16.9 % en relación al testigo, con el consecuente aumento de 24.9 % en la producción de biomasa en términos de materia seca. Lo anterior se asoció a plantas con mayor altura, un mayor número de macollos y un mayor contenido de clorofila. El hidrogel, sólo influyó durante los primeros 15 días después del trasplante al inicio de elongación, con un mejor porcentaje de sobrevivencia después del trasplante de los pastos; sin ningún efecto en fechas posteriores durante la fase de crecimiento y desarrollo del pasto. Palabras clave: Cobertura vegetal, Rastrojo de maíz, Hidrogel, Forraje, Pastizal.

Abstract: About 85 % of the arid and semiarid zones of Mexico have erosion problems related to overgrazing in livestock farms, with the consequent increase in the degradation of the soil. The objective of the study was to evaluate different species and practices of soil moisture retention in the survival and development of grass in semiarid lands. A random experimental block design was used in a split-split plots arrangement with three replications. The large plots corresponded to the doses of stubble of corn (0 and 10 t ha-1), medium plots were the hydrogel doses (0, 10 and 20 kg ha-1) and small plots were the two species of grass Bouteloua curtipendula [Michx.] Torr, and Chloris gayana Kunth. The transplanting method was used. The survival percentage was greater than 72 % from general average; but this variable was outstanding in the C. curtipendula during different evaluation dates. The corn stubble as crop coverture increased the soil moisture content in 16.9 % in relation to the control, it as consequent increase of 24.9 % in biomass production in terms of dry matter. Before it was associated with plants of higher height, and higher number of tillers and higher chlorophyll content. The hydrogel in any doses used, only influenced the better of survival percentage of the grasses at the first 15 d after transplanting, when started the elongation step, but not in their growing and development.

703


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Key words: Crop coverture, Dry corn stubble, Hydrogel, Forage, Pasture.

Recibido 30/11/2016 Aceptado 22/01/2018

Introducción

Las características más recurrentes en los pastizales de las zonas áridas y semiáridas son las sequías y la alta presión del uso del suelo por el sobrepastoreo(1). Los sistemas poco productivos en las regiones áridas y semiáridas con escasa cobertura vegetal en el suelo y bajo contenido de materia orgánica, son más proclives al proceso de erosión y desertificación(2,3,4). La degradación de los recursos naturales de los pastizales en las zonas áridas y semiáridas como una forma de desertificación, es lo que más afecta al ecosistema donde se practica ganadería extensiva(2). El manejo inadecuado de las áreas de pastoreo, ha propiciado una degradación física, lo cual las hace más vulnerables a la errática precipitación en la temporada de lluvia y a precipitaciones menores a las esperadas, generándose un problema para los habitantes de las comunidades rurales por la disminución de la capacidad productiva de sus áreas de agostadero(5). Para minimizar los efectos de las sequías en las zonas áridas y semiáridas, es importante incorporar prácticas que permitan mitigar los efectos de años secos y su impacto en la economía de las comunidades de estas regiones(1). El establecimiento de pastos en suelos con degradación física, implica la posibilidad de obtener alimento para el ganado y mejorar la condición del terreno. La cuenca media de los ríos Nazas-Aguanaval, es un área predominantemente de pastizal en condición árida. Esta región registra un deterioro ambiental por la existencia de terrenos dedicados a la ganadería extensiva con sobrepastoreo y la consecuente pérdida parcial de la cubierta vegetal y de suelo(6). Para la rehabilitación de esta zona, es importante considerar especies de pastos tolerantes a las condiciones marginales y de estrés, tanto de tipo biótico, como abiótico(7). La incorporación al suelo de coberturas vegetales, así como el uso de retenedores de humedad, representan tecnologías para reducir la alta tasa de evaporación y prolongar la disponibilidad del agua para las plantas. Este tipo de tecnologías son aún poco

704


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

exploradas y no bien valoradas para un eficiente establecimiento de vegetación en suelos degradados por efecto de la erosión y desertificación en zonas áridas. El objetivo de este estudio fue evaluar diferentes prácticas de retención de humedad en el suelo para el establecimiento y desarrollo de pastos en áreas degradadas de zonas áridas.

Material y métodos

El estudio se llevó a cabo en San Luis del Cordero, Durango, México en 2015. La región se encuentra ubicada en los paralelos 25° 15’ y 25° 31’ N y los meridianos 104° 07’ y 104° 33’ O, a una altitud de 1,508 m. La temperatura máxima es de 40 °C en los meses de mayo a agosto, y la mínima es de 0 °C entre diciembre y marzo. El régimen de precipitación es de 362.1 mm anuales y ocurre de junio a octubre(8).

Diseño experimental

Se usó un diseño experimental de bloques al azar en un arreglo de parcelas divididas con tres repeticiones. Las parcelas grandes fueron las dosis de rastrojo de maíz (0 y 10 t ha-1); las parcelas medianas correspondieron a las dosis de hidrogel (0, 10 y 20 kg ha-1); y las parcelas chicas fueron las dos especies de pastos B. curtipendula [Michx.] Torr.) y C. gayana Kunth (el primero corresponde a un pasto nativo y el segundo a un pasto introducido). Cada unidad experimental fue de 12 surcos de 12 m de largo x 5 m de ancho, con una superficie experimental de 2,160 m2. La parcela útil correspondió a los seis surcos centrales, en los cuales se seleccionaron cuatro plantas al azar en las que se midieron las variables correspondientes. La siembra del pasto se realizó en charolas de unicel en condiciones de invernadero el 15 de agosto de 2015. Como sustrato se utilizó “peat moss”. Se aplicaron riegos ligeros uniformes diariamente, evitando la deshidratación de las plántulas. La germinación ocurrió a los tres días después de la siembra en las dos especies de pasto.

705


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

El trasplante se hizo manualmente en el ĂĄrea experimental el 19 de septiembre de 2015. El rastrojo de maĂ­z se aplicĂł superficialmente como cobertura vegetal antes del trasplante de los pastos. La aplicaciĂłn del hidrogel se realizĂł manualmente, al mismo tiempo que el trasplante. El hidrogel se depositĂł a la misma profundidad que el cepellĂłn de la plĂĄntula, aplicando 1 y 2 g planta-1. La distancia entre plantas fue 50 cm, con una densidad de 26,667 plantas ha-1. Los hidrogeles son copolĂ­meros granulados que tienen un contenido de materia seca de 85 a 90 %, densidad aparente de 0.85 g ml-1, peso especĂ­fico de 1.10 g cm-3 y pH de 8.1(9); tienen una capacidad de incrementar la retenciĂłn de humedad del suelo y con ello aprovechar mejor el agua de lluvia o riego. El temporal de lluvias ocurre en los meses de junio a octubre, donde la precipitaciĂłn es suficiente para el desarrollo de los cultivos en la regiĂłn(8). Un escurrimiento superficial previo al trasplante, producto de un lluvia ocurrida el 11 de septiembre del 2015, con una precipitaciĂłn de 27.8 mm, permitiĂł el trasplante. La precipitaciĂłn acumulada fue de 40.4 mm in situ entre los meses de septiembre a noviembre.

Variables

Durante la etapa de germinaciĂłn y crecimiento de la plĂĄntula en las charolas se midiĂł la velocidad de germinaciĂłn de acuerdo a la ecuaciĂłn(10): VG= â&#x2C6;&#x2018;

(đ??§đ??˘) đ??­

Donde: VG= velocidad de germinaciĂłn; ni= nĂşmero de semillas germinadas en el dĂ­a; T= tiempo de germinaciĂłn desde la siembra hasta la germinaciĂłn de la Ăşltima semilla. En la etapa de campo, a los 15, 30, 45 y 60 dĂ­as despuĂŠs del escurrimiento (DDE), se midiĂł: contenido de humedad en el suelo (%) a las profundidades de 15 y 30 cm, mediante un determinador de humedad Lutron Modelo PMS-714 (Taipei, TPE); sobrevivencia de plĂĄntula (%), con un sistema de muestreo aleatorio con tramos de 3 m lineales por tratamiento a los 15 DDE; nĂşmero de macollos, mediante conteo directo por planta; altura de planta (cm), con uso de cinta mĂŠtrica graduada; Ă­ndice de clorofila (ICC), con medidor de clorofila Fieldscout

706


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

CM 1000 (Plainfield IL, USA); contenido de materia seca (g) de la parte aérea y la raíz de la planta, mediante muestreo destructivo y secado en estufa de aire recirculante, HAFO® modelo 1600, USA, a 75 °C por 36 h.

Análisis estadístico

Se realizaron análisis de varianza y prueba de medias de Tukey (P≤0.05) entre tratamientos, con sus respectivas interacciones entre factores de variación en cada variable, así como un análisis de regresión para obtener las tasas de crecimiento con los modelos de mejor ajuste en la velocidad de germinación de semillas. Se usó el paquete estadístico SAS® Versión 9.0(11).

Resultados y discusión

Por la ausencia de interacción entre las especies de pastos con la cobertura vegetal y dosis de hidrogel, se procedió a la exposición de los resultados del crecimiento y desarrollo de las dos especies de pasto de manera independiente a los factores de variación citados.

Velocidad de germinación

La tasa logarítmica de germinación de B. curtipendula fue significativamente mayor (P≤0.05) respecto a C. gayana, con valores de 106.2 (R2= 0.97) y 91.9 (R2= 0.95), respectivamente. (Figura 1). Este efecto de respuesta está relacionado al mecanismo de latencia de las especies nativas, referido a una alta capacidad de germinación(12); pero aun cuando se tenga un porcentaje alto de germinación en especies exóticas, no existen evidencias 707


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

claras para su éxito en la producción potencial(12). Adicionalmente, se indica que una característica del pasto banderita (C. curtipendula), es su rápida velocidad de germinación(13).

Figura 1: Tasa de germinación (no. de semillas día-1) en pastos B. curtipendula [Michx.] Torr. y C. gayana Kunth

225.0

Número de semillas germinadas

200.0

y = 106.26ln(x) + 2.238 R² = 0.9782

175.0 150.0 125.0

y = 91.914ln(x) - 20.102 R² = 0.9566

100.0 75.0 50.0 25.0 0.0 1

2

3

4

5

6

7

8

Días B. curtipendula [Michx.] Torr.

C. gayana Kunth

Contenido de humedad en el suelo

El contenido de humedad fue significativamente (P≤0.05) mayor al aplicar hidrogel a los 15 días después del escurrimiento (DDE) en cada profundidad evaluada, al registrar valores en promedio 3 % superiores, con respecto al testigo; este efecto se disipó en las fechas posteriores de evaluación para ambas profundidades. La tasa exponencial de abatimiento de humedad en el tiempo a los 15 cm de profundidad fue de -0.16 (R2= 0.96), -0.14 (R2= 0.98) y -0.10 (R2= 0.98) en los tratamientos de 20, 10 y 0 kg ha-1 de hidrogel, respectivamente. Un comportamiento similar se registró a los 30 cm de profundidad, con tasas de -0.09 (R2= 0.99), -0.13 (R2= 0.97) y -0.13 (R2= 0.95) en los tratamiento de 20, 10 y 0 kg ha-1 de hidrogel, respectivamente (Figura 2). El hidrogel posee propiedades de retención y liberación lenta de agua en el suelo, ya sea en condiciones de irrigación instantánea o prolongada, además de conservar la humedad en la rizósfera de los cultivos(14); sin embargo en este estudio, las propiedades del hidrogel no se observaron en los muestreos posteriores a los 15 días después 708


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

del escurrimiento registrado. Estos resultados no coinciden con lo reportado por otros investigadores, quienes encontraron un mayor contenido de humedad del suelo al aplicar hidrogel en plantas de Zea mays, lo cual incrementó significativamente la biomasa y optimizó el uso de agua por el cultivo(15). Otros autores destacan que las aplicaciones de hidrogel en pasto buffel en climas áridos, mejoraron la emergencia de plántula, altura de planta, peso de materia seca y cobertura vegetal(7), lo cual puede estar asociado a que los hidrogeles mejoran significativamente la capacidad de absorción de agua fácilmente extraíble (RAW, por sus siglas en inglés) de los suelos; aunque la eficacia del gel en mejorar la retención de agua, varía de acuerdo al tipo de suelo(16).

Figura 2: Abatimiento de humedad a 15 cm (A) y 30 cm (B) de profundidad del suelo con diferentes contenidos de hidrogel y diferentes fechas de muestreo

1

La capacidad del hidrogel de retener el agua en el suelo, se asocia a la constante hidratación, condición que no se presentó en el sitio de estudio, debido a las bajas precipitaciones registradas durante el año. La ocurrencia de precipitaciones para zonas áridas y semiáridas es poco homogénea y variable en el tiempo. Respecto al uso de cobertura vegetal a base de rastrojo de maíz, el contenido de humedad en ambas profundidades del suelo, se mantuvo superior (P≤0.05) en 3.2 % en cada fecha de evaluación con respecto a donde no se adicionó el residuo de cosecha (Figura 3). La humedad aprovechable para este tipo de suelo es 18 %, dado que la CC es 33 % y el PMP de 15 %. El contenido de humedad edáfica registró valores de 16 % en el tratamiento sin aplicación de

709


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

rastrojo a 45 y 60 DDE, muy próximos al PMP; en cambio, donde se aplicó el rastrojo, el suelo siempre mantuvo contenidos de humedad superiores a 18.0 %, con una tasa de abatimiento de humedad exponencial negativa de -0.12 (R2=0.99) y -0.18 (R2=0.98) en la profundidad de 15 cm y 30 cm, respectivamente. En tanto que, el tratamiento sin rastrojo registró tasas de -0.13 (R2=0.99) y -0.14 (R2=0.97) a los 15 y 30 cm de profundidad, respectivamente. En promedio, el tratamiento con rastrojo de maíz registró 3.7 y 3.1 % más contenido de humedad, con respecto al testigo a los 15 y 30 cm de profundidad, respectivamente.

Figura 3: Abatimiento de humedad a 15 cm (A) y 30 cm (B) de profundidad del suelo con y sin cobertura a base de rastrojo de maíz en diferentes fechas de muestreo

1

Los anteriores resultados coinciden con estudios que usaron mantillo o residuo de cosecha en la producción de soya y sorgo de secano, y obtuvieron un mayor contenido de humedad en el suelo al aplicar mantillo en ambos cultivos, principalmente en años con precipitaciones irregulares(17). Adicionalmente, se indica que la incorporación de mantillo o rastrojos a los cultivos, representa una práctica cultural importante, ya que desempeña un papel esencial en la conservación de humedad en el suelo; las coberturas orgánicas e inorgánicas, en promedio registraron un contenido más alto de humedad edáfica para la capa activa del suelo (0-40 cm) en tres años de evaluación, con un 18 % de humedad en campo con cobertura de paja, mientras que el tratamiento sin cobertura obtuvo 16.2 % de humedad(18) . La aplicación combinada de paja y mantillo e incorporación de paja al primer perfil de suelo, mejoró la retención de agua del suelo en 2.1 a 10.4 % y la salinidad de la capa superficial disminuyó 5.4 a 23.0 %(19). 710


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Sobrevivencia de plántula

B. curtipendula y C. gayana tuvieron una supervivencia superior al 84 %, seis semanas después del trasplante, sin diferencias estadísticas entre ambas especies. El alto porcentaje de sobrevivencia, pudiera estar asociados al método de siembra en trasplante, ya que el método simple de siembra directa de semilla en campo, es sólo del 10 % y en algunos casos 50 %(10). Se han encontrado valores superiores al 95 % de establecimiento en pasto buffel al utilizar el método del trasplante, por lo que es considerado un método de siembra altamente efectivo aún en suelos con limitada fertilidad natural(10). El porcentaje de sobrevivencia de los pastos fue de 89.3 y 76.4 % al aplicar 20 kg ha-1 y 10 kg ha-1, respectivamente, sin diferencia estadística entre ambos, con una mejor tendencia de respuesta en la dosis de 20 kg ha-1, al diferenciarse estadísticamente del testigo. El porcentaje de sobrevivencia fue mayor (P<0.05) al aplicar el rastrojo de maíz (89.9 %), respecto cuando no se aplicó (81.2 %) (Cuadro 1). Al no aplicar la cobertura vegetal, el porcentaje de sobrevivencia de especies forestales se reduce significativamente, hasta un 66.7 %(20). La aplicación de rastrojo como cobertura vegetal en los cultivos, mejora la retención de humedad del suelo al reducir la evaporación, además de crear un microclima (temperatura y humedad) adecuado para la germinación de la semilla, supervivencia y desarrollo del cultivo en su fase inicial(21).

Cuadro 1: Porcentaje de sobrevivencia por especie de pasto, diferentes dosis de hidrogel y cobertura vegetal a base de rastrojo de maíz Especie de pasto/dosis de retenedor de humedad

Porcentaje de sobrevivencia

B. curtipendula [Michx.] Torr C. gayana Kunth Hidrogel (kg ha-1): 0 10 20 Rastrojo de maíz (t ha-1): 0 10 ab

87.03 a ±1.3 84.12 b ±1.1 72.93 b ±0.9 76.42 b ±1.5 88.64 a ±1.2 81.21 b ±1.4 89.94 a ±1.6

Cifras con diferentes letras dentro de una misma columna y en cada factor de variación, son diferentes (P<0.05).

711


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Número de macollos, altura de planta e índice de clorofila

No hubo efecto de interacción entre la cobertura con rastrojo de maíz y las dosis de hidrogel utilizadas en ninguna de las características de desarrollo y crecimiento de la planta. En un análisis estadístico por factor de variación por separado, tampoco el hidrogel mostró efecto en ninguna de las variables antes citadas. La cobertura vegetal a base de rastrojo de maíz a dosis de 10 t ha-1 mejoró significativamente (P≤0.05) todas las variables: la altura de planta registró 37.2 cm, 3.8 macollos e índice de clorofila con 121.5 en el pasto introducido; el pasto nativo reportó valores de altura de 31.9 cm, 7.1 macollos e índice de clorofila de 98.5. El pasto introducido fue superior 55.5 % en altura, 16.6 % en macollos y 23.3 % en el índice de clorofila con respecto al pasto nativo (Cuadro 2).

Cuadro 2: Características morfométricas en dos especies de pasto en diferentes dosis de hidrogel y cobertura vegetal a base de rastrojo de maíz Dosis de retenedor Número de macollos de humedad BC CG 0 10 20

5.6a ±1.0 5.7a ±0.9 5.9a ±1.1

0

4.4b ±0.9

10

7.1a ± 0.8

Altura de planta (cm) BC

Hidrogel (kg ha-1) 3.5a 26.9a ±0.8 ±4.8 a 3.6 27.7a ±0.9 ±5.2 3.2a ±0.9

27.2a ±4.3

Rastrojo de maíz (t ha-1) 3.0b 22.6b ±0.7 ±2.6 3.8a ±0.8

31.9a ±3.3

ICC

CG

BC

CG

33.1a ±4.8 34.9a ±4.6

98.6a ±5.3 95.9a ±4.7

114.3a ±5.1 113.2a ±5.7

32.6a ±3.6

97.8a ±4.3

109.8a ±6.2

29.5b ±3.1

84.4b ±6.4

107.8b ±6.7

37.2a ±3.4

98.5a ±5.9

121.5a ±7.4

ICC= índice de contenido de clorofila; BC= B. curtipendula [Michx.] Torr.; CG= C. gayana Kunth. ab Cifras con diferente letra dentro de una misma columna y en cada factor de variación (hidrogel y rastrojo de maíz), son diferentes (P<0.05).

712


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Estos resultados coinciden con los reportados por algunos autores(22), quienes indican que la adición de mantillo o cobertura vegetal, sobre una leguminosa, influyó significativamente sobre algunos atributos agronómicos como el crecimiento de las plantas, el rendimiento y la calidad nutricional del cultivo. Se ha encontrado que la aplicación de mantillo o paja en suelos salinos, aumentó significativamente el crecimiento de la planta, rendimiento de forraje en el pasto guinea(23). Otros autores(24), reportaron que la incorporación de mantillo al suelo para establecimiento de gramíneas, obtuvo resultados significativamente superiores en relación a tratamientos sin adición de paja, al tener mayor cantidad de vegetación de gramíneas y biomasa.

Contenido de materia seca aérea y radical de planta

El efecto del rastrojo estuvo relacionado con un mayor contenido de humedad edáfica y distribuida de forma más uniforme, lo cual permitió un rendimiento superior (P≤0.05) de biomasa en C. gayana de 73.2 g planta-1 y en B. curtipendula de 57.2 g planta-1, respecto a no aplicar rastrojo; en promedio en cada una de las evaluaciones efectuadas, la dosis de rastrojo se asoció a rendimiento superiores de 24.9 % en el pasto nativo y 25.6 % en el pasto introducido, respecto del testigo (Cuadro 3). En cambio, en las dosis de hidrogel, la producción de biomasa aérea solo mostró diferencias (P≤0.05) a los 30 DDE al aplicar 10 kg (14.7 g planta-1) y 20 kg (13.3 g planta-1), sin diferencia estadística en la primera dosis con el testigo (11.0 g) en B. curtipendula, En el caso de C. gayana, se obtuvieron 25.6 y 24.3 g en las dosis de 20 y 10 kg ha-1, respectivamente, con diferencia estadística respecto al testigo (17.5 g). En las dos evaluaciones posteriores, se dejó de mostrar el efecto citado, lo cual puede estar relacionado al efecto de dilución identificado en el contenido de humedad en el suelo. La adición de rastrojo, incrementó significativamente (P≤0.05) la biomasa de la raíz, al obtener el mayor peso al término del ciclo vegetativo en pasto nativo (25.5 g) e introducido (32.6 g). El incremento promedio de biomasa de la raíz en la dosis de rastrojo fue de 43.1 % en nativo y 38.3 % en el introducido, con respecto a no aplicar la cobertura vegetal, en las tres evaluaciones realizadas (Cuadro 4).

713


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 3: Producción de biomasa aérea en peso seco de dos especies de pastos en diferentes dosis de hidrogel y rastrojo de maíz Dosis de retenedor de humedad

0

Peso seco de biomasa aérea de planta (g) 30 DDE 45 DDE 60 DDE BC CG BC CG BC CG Hidrogel (kg ha-1) b 11.0 17.5b 45.1ª 57.9a± 53.3ª 68.0a ± 1.7 ± 3.3 ± 6.0 5.5 ± 7.1 ± 7.0

10

13.3ab ± 2.2

24.3ª ± 4.1

42.8ª ± 5.9

56.0a ± 5.8

51.5ª ± 6.3

66.8ª ± 7.6

20

14.7ª ± 2.0

25.6ª ± 4.9

44.7ª ± 5.3

56.9ª ± 4.2

51.6ª ± 6.2

67.7ª ± 5.8

52.3b ± 2.7 61.1ª ± 2.8

47.2b ± 4.4 57.2ª ± 4.5

61.1b ± 2.8 73.2ª ± 3.2

Rastrojo de maíz (t ha-1) 12.3b 20.4b 39.8b ± 2.1 ± 1.6 ± 3.3 16.1ª 28.6ª 48.8ª ± 0.9 ± 1.9 ± 3.9

0 10

DDE= días después del primer escurrimiento; BC= B. curtipendula [Michx.] Torr.; CG= C. gayana Kunth. ab Cifras con diferente letra dentro de una misma columna y en cada factor de variación (hidrogel y rastrojo de maíz), son diferentes (P<0.05).

Cuadro 4: Producción de biomasa en peso seco de raíz de dos especies de pastos en diferentes dosis de hidrogel y rastrojo de maíz Dosis de retenedor de humedad

0 10 20

0 10

ab

Peso seco de biomasa radical de planta (g) 30 DDE 45 DDE 60 DDE BC CG BC CG BC CG Hidrogel (kg ha-1) 5.0b 9.1b 19.5a ± 0.5 ± 1.2 ± 4.8 6.6a 11.7a 17.7a ± 1.0 ± 2.2 ± 3.3

24.3a ± 4.3 24.6a ± 3.7

22.9a ± 4.5 21.7a ± 3.2

29.0a ± 4.3 29.5a ± 4.1

6.3a 11.9a 19.0a ± 0.8 ± 2.1 ± 3.5 Rastrojo de maíz (t ha-1) 4.7b 9.2b 15.5b ± 1.8 ± 1.1 ± 2.4

25.5a ± 3.7

22.5a ± 3.6

28.9a ± 3.6

20.9b ± 1.5

19.4b ± 1.9

25.3b ± 1.3

7.3a ± 0.6

28.2a ± 1.2

25.5a ± 2.3

32.6a ± 1.6

13.9a ± 1.4

22.1a ± 2.2

DDE= días después del primer escurrimiento; BC= B. curtipendula [Michx.] Torr.; CG= C. gayana Kunth. Cifras con diferente letra dentro de una misma columna y en cada factor de variación (hidrogel y rastrojo de maíz), son diferentes (P<0.05).

714


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Estos resultados coinciden con estudios que identificaron una mayor cantidad de biomasa al aplicar mantillo o rastrojo sobre la superficie del suelo(24). Otros autores(23), obtuvieron aumentos significativamente mayores en el rendimiento de forraje en pasto guinea al adicionar paja al suelo. El hidrogel, ha mostrado un uso más eficiente del agua, lo cual mejora el crecimiento de plantas(25); sin embargo, este efecto no fue sostenido en el tiempo de evaluación. Respecto a los pastos introducidos, donde se indica que ofrecen ventajas a las variedades nativas, tales como su rápida adaptación y crecimiento(26), se señala que la principal ventaja de estos pastos es la producción de biomasa, la cual es superior en comparación a algunas especies nativas(27), lo cual coincide con este estudio.

Conclusiones e implicaciones

El pasto nativo (B. curtipendula) tiene mejores ventajas con respecto a la variedad introducida (C. gayana) en fases fenológicas iniciales, mediante una mayor capacidad germinativa y mayor velocidad de germinación; sin embargo, el pasto introducido registró una mayor altura, mejor amacollamiento y un mayor índice de clorofila, y como consecuencia una mayor producción de biomasa. La aplicación de rastrojo incrementó en un 16.9 % el contenido de humedad del suelo, lo cual incrementó significativamente la producción de biomasa aérea. Las dosis de hidrogel sólo influyeron en un mejor porcentaje de establecimiento y un mayor contenido de humedad edáfica durante los primeros 15 días de realizado el trasplante, sin ningún efecto posterior durante la fase de crecimiento y desarrollo de los pastos.

Agradecimientos

Al personal técnico y científico del Centro Nacional de Investigación Disciplinaria en Relaciones Agua Suelo Planta Atmósfera del INIFAP en Gómez Palacio, Dgo. por el apoyo técnico. 715


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Literatura citada: 1.

Velásquez VMA, Alba AA, Gutiérrez LR, García EG. Prácticas de restauración de suelos para la conservación del agua. Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. CIRNOC. Zacatecas. Folleto Técnico No. 46. 2012.

2.

Asner PG, Elmore JA, Olander PL, Martin ER, Harris TA. Grazing systems, ecosystem responses, and global change. Annu Rev Environ Resour 2004;29:261-299.

3.

Cornelis W M. Hydroclimatology of wind erosion in arid and semiarid environments. In: Dryland ecohydrology. D´Odorico, Porporato A, editors. Netherlands: Springer; 2006:141-161.

4.

Kéfi S, Rietkerk M, Alados LC, Pueyo Y, Papanastasis PV, ElAich A, Ruiter PC. Spatial vegetation patterns and imminent desertification in Mediterranean arid ecosystems. Nature 2007;449(7159):213-217.

5.

Pinedo AC, Hernández QNS, Melgoza CA, Rentería VM, Vélez SVC, Morales NC, et al. Diagnóstico actual y sustentabilidad de los pastizales del estado de Chihuahua ante el cambio climático. Cuerpo Académico de Recursos Naturales y Ecología (UACHCA16). Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahua. Chihuahua, México. 2003.

6.

Chávez RE, González CG, González BJL, López DA. La evapotranspiración en la cuenca baja y media del río Nazas. En: Oswald SU. Retos de la investigación del agua en México. Cuernavaca, Mor. México. UNAM, Centro Regional de Investigaciones Multidisciplinarias. 2011.

7.

Cruz MA, Pedroza SA, Trejo CR, Sánchez CI, Samaniego GJA, Hernández SJR. Captación de agua de lluvia y retención de humedad edáfica en el establecimiento de buffel (Cenchrus ciliaris L.). Téc Pecu Mex 2016;7(2):159-172.

8.

IMTA (Instituto Mexicano de Tecnología del Agua). Extractor rápido de información climatológica (ERIC III). 2.0. México, D.F. Servicio Meteorológico Nacional. 2009.

9.

SNF Inc. Water retainers for soils and substrates. http://snf.com.au/downloads/ Aquasorb_E.pdf Consultado 10 Nov, 2016.

10. González DJR, Gómez MS, López DA. El trasplante garantiza establecer zacates forrajeros en suelos salinos y arcillosos [resumen]. Congreso Internacional de Manejo de Pastizales. Durango. Dgo. 2015:464. 716


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

11. SAS. Institute Statistical Analysis System. The SAS System for Windows Version 9.3. North Carolina, USA: SAS Institute Inc. Cary; 1976. 12. Carrillo SSM, Arredondo MT, Huber-Sannwald E, Flores RJ. Comparación en la germinación de semillas y crecimiento de plántulas entre gramíneas nativas y exóticas del pastizal semiárido. Tec Pecu Mex 2009;47(3):299-312. 13. Esqueda CMH, Melgoza CA, Sosa CM, Carrillo RR, Jiménez CJ. (2012). Emergencia y sobrevivencia de gramíneas con diferentes secuencias de humedad-sequía en tres tipos de suelo. Tec Pecu Mex 2012;43(1):101-115. 14. Barón CA, Barrera RIX, Boada ELF, Rodríguez NG. Evaluación de hidrogeles para aplicaciones agroforestales. Rev Ing Invest 2007;27(3):35-44. 15. Dorraji SS, Golchin A, Ahmadi S. The effects of hydrophilic polymer and soil salinity on corn growth in sandy and loamy soils. Clean–Soil, Air, Water 2010;38(7):584-591. 16. Narjary B, Aggarwal P, Singh A, Chakraborty D, Singh R. Water availability in different soils in relation to hydrogel application. Geoderma 2012;(187-188):94-101. 17. Obalum SE, Igwe CA, Eze OM. Soil moisture dynamics under rainfed sorghum and soybean on contrasting tillage–mulch seedbeds in a mineral sandy loam at derived savanna of south-eastern Nigeria. Arch Agron Soil Sci 2012;58(11):1205-1227. 18. Taparauskienė L, Miseckaitė O. Effect of mulch on soil moisture depletion and strawberry yield in Sub-Humid area. Pol J Environ Stud 2014;23(2):475-482. 19. Zhao Y, Pang H, Wang J, Huo L, Li Y. Effects of straw mulch and buried straw on soil moisture and salinity in relation to sunflower growth and yield. Field Crop Res 2014;161:16-25. 20. Nissen J, Ovando C. Efecto de un hidrogel humectado aplicado a las raíces de Nothofagus obliqua (MIRB.) OERST. y Nothofagm dombeyi (MIRB.) OERST. durante su trasplante. Agro Sur 1999;27(2):48-58. 21. Julca OA, Meneses FL, Blas SR, Bello AS. La materia orgánica, importancia y experiencia de su uso en la agricultura. Idesia (Arica) 2006;24(1):49-61. 22. Ravisankar N, Balakrishnan M, Ambast SK, Srivastava RC, Bommayasamy N, Subramani T. Influence of irrigation and crop residue mulching on yield and water productivity of table purpose groundnut (Arachis hypogaea) in humid tropical island. Legume Res: An Intern J 2014;37(2):195-200.

717


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

23. Kusmiyati F, Sumarsono S, Karno K, Pangestu E. Effect of mulch and mixed cropping grass-legume at saline soil on growth, forage yield and nutritional quality of guinea grass. J Indonesian Trop Anim Agric 2013;38(1):72-78. 24. Beggy HM, Fehmi JS. Effect of surface roughness and mulch on semi-arid revegetation success, soil chemistry and soil movement. Catena 2016;143:215-220. 25. El-Hady OA, Safia MA, Abdel KAA. Sand-Compost-Hydrogel mix for low cost production of tomato seedlings. Egypt J Soil Sci 2002;42:767-782. 26. Velázquez MM, Hernández GFJ, Cervantes BJF, Gámez VHG. Establecimiento de pastos nativos e introducidos en zonas áridas de México. San Luis Potosí, SLP México. Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. CIR-Noreste. 2015. 27. Loredo OC, Beltrán LS. Establecimiento y manejo de pasto Klein en el altiplano potosino. San Luis Potosí, SLP México. Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. CIR-Noreste. Folleto técnico No. 24. 2001.

718


http://dx.doi.org/ 10.22319/rmcp.v9i4.4192 Artículo

Kisspeptina en becerras prepúberes: 2. Respuesta de LH, FSH y GH a distintas dosis de kisspeptina-10 y su asociación con IGF-I y leptina circulantes Kisspeptin in prepuberal heifers: 2. Response of LH, FSH and GH to different doses of kisspeptin-10 and its association with circulating IGF-I and leptin

Alejandro Villa Godoya* Rubén Santos Echeverríaab Jorge Víctor Rosete Fernándezc René Carlos Calderón Roblesc Gerardo Perera Marína Jesús Alejandro Arreguín Arevalod Terry M. Nettd

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Tel. +52 55 3270-6805. Av. Universidad 3000, Ciudad de México 04510, México. b

INIFAP, CIR Pacífico Sur. Campo Experimental Iguala, Iguala, Guerrero, México.

c

INIFAP, CIR Golfo Centro. Sitio Experimental Las Margaritas, Puebla, México.

d

Universidad Estatal de Colorado. Departamento de Ciencias Biomédicas, Colorado, USA.

* Autor de correspondencia: aavillagodoy@gmail.com


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Resumen: En becerras prepúberes, la kisspeptina-10 (KISS-10) estimula la liberación de hormona luteinizante (LH) y hormona foliculoestimulante (FSH), pero su acción en la hormona del crecimiento (GH) es inconsistente. La hipótesis fue que en becerras prepúberes la magnitud de liberación de LH, FSH y GH en respuesta a KISS-10 es determinada por la dosis y las concentraciones endógenas de IGF-I y leptina. Se usaron 20 becerras prepúberes (100-232 kg de peso y 7-11 meses de edad), mismas que recibieron un bolo i.v. de 5 o 50 µg de KISS10/kg de peso. Ambas dosis de KISS-10 indujeron un incremento de LH y FSH, más no de GH. La dosis de 50 µg de KISS-10 indujo un área bajo la curva de LH y una duración del incremento de FSH mayores (P<0.05) que la dosis de 5 µg. IGF-I se relacionó negativamente con el aumento de LH en respuesta a la dosis de 50 µg (P<0.05), pero no estuvo asociado con la respuesta de LH a la dosis de 5 µg de KISS-10. La magnitud del incremento de FSH y las concentraciones de GH posteriores a KISS-10 no fueron alteradas por las concentraciones de IGF-I (P>0.05). De la misma forma, las concentraciones de leptina no determinaron (P>0.05) la magnitud del incremento de LH y FSH ni las concentraciones de GH pos tratamiento. En conclusión, la GH no respondió a ninguna dosis, pero la FSH y la LH fueron sensibles al aumento de dosis de KISS-10. Además, la magnitud de respuesta de LH a KISS-10 fue determinada por las concentraciones endógenas de IGF-I, pero no de leptina. Palabras clave: Kisspeptina-10, Becerras prepúberes, LH, FSH, GH, IGF-I, Leptina.

Abstract: In prepubertal heifers, kisspeptin-10 (KISS-10) stimulates the release of the luteinizing hormone (LH) and the follicle-stimulating hormone (FSH) but the growth hormone (GH) response is inconsistent. The hypothesis of this study was that in prepubertal heifers, the release of LH, FSH and GH in response to KISS-10 is determined by dose and by endogenous levels of IGF-I and leptin. Twenty heifer calves (100-232 kg of body weight and 7-11 mo of age) received an i.v. injection of 5 or 50 µg of KISS-10/kg of body weight (low and high dose, respectively). The high dose of KISS-10 induced a greater (P<0.05) response of LH (area under the curve) and FSH (duration) than the low dose. IGF-I was negatively associated (P<0.05) to LH in response to the high dose of KISS-10 but IGF-I was not associated with LH in calves treated with the low dose (P>0.05). The magnitude of FSH response as well as GH serum concentrations after KISS-10 were not altered by IGF-I levels (P>0.05). Similarly, leptin concentrations were not associated (P>0.05) with the magnitude of LH and FSH response or GH concentrations after KISS-10. In conclusion, GH did not respond to any dose of KISS-10 but FSH and LH were sensitive to an increment in the KISS-10 dose. Additionally, the magnitude of response of LH to KISS-10 was determined by endogenous levels of IGF-I but it was not associated with levels of leptin. Key words: Kisspeptin-10, Prepubertal heifers, LH, FSH, GH, IGF-I, Leptin. 720


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Recibido 26/05/2016 Aceptado 02/02/2018

Introducción

La kisspeptina (KISS) o metastina es una familia de péptidos hipotalámicos (KISS-54, -14, 13 y -10), que está involucrada en el control neuroendocrino de la reproducción, y ha sido implicada en la integración del control metabólico de la reproducción en rumiantes(1,2). El sistema mencionado ha sido propuesto como un activador de las neuronas productoras de la hormona liberadora de las gonadotropinas (GnRH) durante la maduración puberal(3). De hecho, la aplicación i.v. de un solo bolo de KISS-10 estimula en becerras la secreción tanto de la hormona luteinizante (LH) como de la hormona folículo estimulante (FSH)(4,5,6). Si bien estos efectos de la KISS en el eje gonadotrópico han sido observados de manera unánime en todas las especies estudiadas, de manera menos contundente se ha informado su influencia en el eje somatotrópico, ya que bajo algunas condiciones experimentales, la administración de KISS-10 estimula la liberación de la hormona de crecimiento (GH) en becerras prepúberes(4,6) y vacas lecheras ovariectomizadas(7); sin embargo en otros estudios con becerras prepúberes(5), cabras en diestro(8), borregas ovariectomizadas(9) y vacas secas y lactantes(10), la KISS-10 administrada por vía endovenosa no ejerció estímulo alguno en la GH. Durante la maduración puberal, el sistema kisspeptidérgico es sometido a un patrón complejo de activación, que parece incluir al menos dos procesos: un incremento del tono endógeno de KISS(11,12), y una mayor sensibilidad de las neuronas GnRH-érgicas a las acciones estimuladoras de la KISS(13). Esto fue confirmado en becerras prepúberes, en las que la administración endovenosa de 5 µg de KISS-10/kg de peso cada dos horas durante tres días, -imitando su liberación pulsátil endógena-, fue capaz de inducir incrementos consistentes de LH en todas las becerras. Este formato de aplicación de KISS-10 indujo la ovulación seguida de formación de un cuerpo lúteo, únicamente en las becerras con las mayores concentraciones sanguíneas del factor de crecimiento parecido a la insulina I (IGF-I) y las menores de leptina(14). No obstante, se desconoce en becerra prepúberes, si la dosis de KISS-10 y las concentraciones endógenas de IGF-I y leptina influyen en la magnitud de respuesta de LH inducida por KISS-10 y, si esta influencia es extensiva para la FSH y la GH. La hipótesis del presente estudio fue que en becerras prepúberes, la liberación de LH, FSH y GH en respuesta

721


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

a la KISS-10 exógena es determinada por la dosis y por las concentraciones endógenas de IGF-I y leptina.

Material y métodos

Los procedimientos aplicados en el presente trabajo fueron aprobados por el Subcomité Institucional para el Cuidado de Animales en Experimentación (Programa de Posgrado, Facultad de Medicina Veterinaria y Zootecnia, UNAM). El experimento se efectuó en el Centro Experimental Las Margaritas, ubicado a 19º 51’ 03” N y 97º 12’ 48” O, a 500 msnm.

Tratamientos

Se utilizaron 20 becerras prepúberes, Suizo Pardo por Cebú o Holstein por Cebú, de 100 a 232 kg de peso corporal y de 7 a 11 meses de edad. Las becerras se estratificaron por edad y peso, y con base en esos criterios se asignaron aleatoriamente para recibir un bolo i.v. de 5 (n= 10; 4 Holstein por Cebú y 6 Suizo Pardo por Cebú) o 50 (n= 10; 4 Holstein por Cebú y 6 Suizo Pardo x Cebú) µg de KISS-10 por kilo de peso (3.75 o 37.50 nmol/kg de peso). Para determinar el tamaño de la muestra se utilizó un calculador en línea(15) y se consideraron los valores medios, la desviación estándar (DE) y el intervalo de confianza de los datos de LH, FSH, GH, IGF-I y leptina, uno a la vez, publicados previamente en becerras prepúberes(6). El tamaño de muestra requerido varió de 6 a 8 animales, dependiendo de la hormona. En el presente trabajo se usó KISS-10 bovina (YNWNSFGLRY-NH2; Proimmune, Oxford, UK) diluida en solución salina fisiológica (1:125) y administrada a través de un catéter (Sonda Kortex calibre 5 FR y longitud 90 cm; K-733, Trokar S.A de C.V) insertado en una de las venas yugulares, como se describió anteriormente(14). Este mismo catéter se utilizó para la toma de muestras de sangre de acuerdo al protocolo que se describe posteriormente.

722


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Manejo general y registro de medidas corporales

Las becerras se alojaron individualmente en corrales de 2.5 x 4.5 m, con piso de cemento, área techada (2.5 x 2.7 m), comederos y bebederos. Para la adaptación al manejo, las becerras se enjaquimaron y se introdujeron a los corrales un mes antes del experimento. Durante ese periodo, los animales se sometieron a sujeción con soga al cerco del comedero (2 h/día), de tal manera que pudieron ingerir alimento y agua a libre acceso; además se les sometió a cepillado del pelo con el fin de amansarlos y acostumbrarlos a la presencia de personas. La alimentación diaria consistió en forraje picado a libertad (heno de avena; 95 % MS, 6.5 % de proteína cruda y 2.42 Mcal de EM/kg), 4 kg de concentrado proteínico (93.8 % MS, 16.53 % de proteína cruda y 2.43 Mcal de EM/kg) y sales minerales a libertad. La asignación de alimento se calculó para lograr una ganancia diaria promedio de al menos 0.6 kg/animal/día, objetivo que se cumplió, ya que durante el periodo de adaptación, las vaquillas del grupo de 5 μg de KISS-10 ganaron 0.634 ± 0.081 kg/animal/día y las del grupo de 50 μg registraron 0.631 ± 0.085 kg/animal/día. El peso corporal (PESO) de los animales se registró a su llegada a los corrales de experimentación y cada siete días hasta la administración de KISS-10; a partir de estos registros se determinó la ganancia diaria de peso promedio (GDP) previa al tratamiento. El día de la administración de KISS-10, además del PESO, tres observadores previamente capacitados evaluaron la condición corporal de las vaquillas y el promedio constituyó la variable analizada (CC; escala de 1 a 9 puntos). Además, se determinó el grosor de la grasa dorsal (GRASA) y la profundidad del músculo Longissimus dorsi (MUS), medidos entre las costillas 12 y 13, en el costado izquierdo del animal mediante ultrasonografía(16), utilizando un aparato Kaixin 5000 (Xuzhou Kaixin Electronic Instrument Co. Jiangsu, China) y transductor lineal de 3.5 MHz.

Muestras de sangre y medición de hormonas

Cada tercer día, desde dos semanas antes de iniciar el estudio hasta la aplicación de KISS10, se obtuvieron muestras de sangre por punción de la vena coxígea y colección en tubos Vacutainer® sin aditivo. Las muestras se procesaron para obtención de suero (refrigeración

723


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

por 3 h y posterior centrifugación a 1,500 xg por 15 min). El suero se congeló a -20 °C hasta determinar por radioinmunoanálisis (RIA) la concentración de progesterona (P4). La concentración de P4 se utilizó como confirmación del estado prepuberal (P4 < 1 ng/ml en todas las muestras) de las becerras. Además, se colectaron muestras de sangre cada 15 min, iniciando 6 h antes y finalizando 6 h después de la administración de KISS-10; un muestreo similar de 6 h se realizó 24 h después de la administración de KISS-10. El suero de estas muestras se obtuvo y almacenó como ya se indicó. En estas muestras se determinó LH, FSH y GH por RIA. En las tres muestras previas a la aplicación de KISS-10 (muestras -2, -1 y 0) y en alícuotas de las muestras colectadas cada hora a partir de la aplicación de KISS-10, se determinó leptina e IGF-I mediante RIA. El RIA para LH se realizó siguiendo el procedimiento descrito(17). La hormona utilizada como referencia en la curva patrón fue NIH oLH-S24 y los coeficientes de variación (CV) intra e inter-ensayo fueron 6.22 y 11.53 %, mientras que la cantidad mínima detectable fue 33.22 pg/ml. Para FSH(18), la hormona utilizada como referencia en la curva patrón fue la NIH-oFSH S12. Los CV intra e inter-ensayo fueron 7.13 y 14.19 %; y la cantidad mínima detectable fue 35.95 pg/ml. En la cuantificación de GH(19), la hormona utilizada como referencia fue la AFP11182B. Los CV intra e inter-ensayo fueron 4.8 y 9.2 % y la cantidad mínima detectable fue 0.14 ng/ml. En todos los casos se incluyó una curva estándar por triplicado y las muestras se analizaron por duplicado. Los RIA para IGF-I y P4 fueron en fase sólida (IGF-I RIACT® y PROG-CTRIA® de CisBio Bioassay, Sorgues, France), y para leptina el RIA fue de fase líquida (XL-85K de Linco Research Inc, St. Charles, MO, USA). La sensibilidad y los CV intra-ensayo para IGF-I, P4 y leptina fueron: 16 ng/ml y 5.1 %, 0.15 ng/ml y 8.8 % y 1.00 ng/ml y 3.8 %, respectivamente.

Variables de respuesta y análisis de datos

Se consideró que ocurrió un incremento de LH, FSH y GH inducido por KISS-10 cuando la concentración hormonal, después de la administración de KISS, superó en dos o más muestras consecutivas al promedio más dos desviaciones estándar de la concentración hormonal registrada en cada animal a las -2, -1 y 0 h de la aplicación de KISS-10 (concentración basal). Para poder conocer las diferencias entre tratamientos a través del tiempo (-0.5 a 6 h con relación a la aplicación de KISS-10), en los datos de LH, FSH y GH

724


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

se realizó un análisis de varianza (ANDEVA) con mediciones repetidas, usando para ello el procedimiento MIXED de SAS(20), en cuyo modelo se incluyó la dosis, el tiempo y su interacción; en este modelo, el animal se anidó en el tratamiento y se usó como un efecto aleatorizado, mismo que fue el objeto de mediciones repetidas en una estructura de covarianza. Con el fin de evaluar las diferencias en la magnitud de la respuesta hormonal inducida por la dosis de KISS-10, se determinó el promedio, valor máximo (Vmax), amplitud (Amp), área bajo la curva (AUC) y duración de las concentraciones hormonales que superaron el umbral descrito. La Amp fue la diferencia entre Vmax y la concentración basal. Para estimar el AUC se usó la regla del trapecio y esta variable se reportó como unidades arbitrarias. Todas las variables fueron sujetas a un análisis de distribución normal (Shapiro-Wilk y métodos gráficos). Las variables que no se aproximaron a la distribución normal (P<0.1), se transformaron mediante raíz cuadrada (GRASA), logaritmo natural (FSH, GH) o logaritmo base 10 (LH) para asegurar la normalidad en la distribución de los datos. Así mismo, se verificó mediante la prueba de Barttlet la homogeneidad de la varianza en todas las variables. Únicamente los datos de leptina mostraron heteroscedasticidad aún después de su transformación (P<0.05); por lo tanto se analizaron mediante la prueba de Kruskal-Wallis. El análisis de las diferencias de la secreción de LH, FSH y GH en respuesta al tratamiento de KISS-10, fue mediante t de Student. La relación entre la concentración sérica de IGF-I y leptina con la respuesta de LH, FSH y GH a KISS-10 se analizó mediante regresión lineal. Durante el periodo previo al tratamiento (-6 a 0 h) y un día posterior al mismo (24 a 30 h) se determinó la concentración media y número de pulsos de LH; el criterio para determinar un pulso de LH se definió previamente(21). En estos periodos de muestreo se determinó también la concentración media de las hormonas FSH y GH. Con el fin de determinar diferencias entre grupos experimentales y periodos de muestreo se realizó un ANDEVA para diseño en parcelas divididas(20).

Resultados

Al inicio del estudio, todas las becerras fueron prepúberes, ya que en ninguna de ellas se registró una concentración sérica de P4 ≥ a 1 ng/ml, y el número de pulsos de LH en las muestras tomadas antes de la aplicación de KISS-10 fue similar (P>0.05) en ambos grupos (Cuadro 1), oscilando entre 0 y 2 eventos cada 6 h. Ambos grupos experimentales fueron

725


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

homogéneos (P>0.05) en cuanto a los valores registrados (media ± e.e.) para la dosis de 5 μg y de 50 μg, mismas que fueron respectivamente: PESO (170.4 ± 11.1 y 166.2 ± 10.8 kg), CC (6.6 ± 0.34 y 7.0 ± 0.31 puntos), GRASA (2.49 ± 0.22 y 2.67 ± 0.26 mm) y MUS (30.28 ± 2.41 y 28.88 ± 2.22 mm). No se detectaron diferencias (P>0.05) entre tratamientos de las concentraciones séricas previas a KISS-10 tanto de IGF-I (5 μg: 163.06 ± 20.68; 50 μg: 150.41 ± 20.02 ng/ml) como de leptina (5 μg: 2.56 ± 0.24; 50 μg: 3.32 ± 1.11 ng/ml). Tampoco se detectaron diferencias (P>0.05) en las concentraciones de dichas hormonas en las muestras posteriores a KISS-10 (IGF-1, 5 μg: 148.62 ± 21.48; 50 μg: 138.55 ± 18.77 ng/ml. Leptina, 5 μg: 2.73 ± 0.35; 50 μg: 3.28 ± 1.09 ng/ml). No obstante lo anterior, la concentración sérica de IGF-I, pero no la de leptina, estuvo asociada positivamente con el PESO de las becerras (IGF-I: R= 0.80, P=0.032; leptina: R= 0.31, P=0.18).

Cuadro 1: Características del incremento de LH y FSH inducido por una inyección intravenosa de 5 o 50 µg de kisspeptina-10/kg de peso corporal en becerras prepúberes (media ± error estándar) LH

Basal, ng/ml Media, ng/ml Valor máximo, ng/ml Amplitud, ng/ml AUC, u. arbitrarias Duración, min ab

FSH

5 µg/kg (n=10)

50 µg/kg (n=10)

5 µg/kg (n=10)

50 µg/kg (n=10)

0.45±0.10 2.94±0.23 7.22±0.60 6.74±0.63 352.5±37.8a 135.0±20.9

0.32±0.10 2.87±0.23 5.51±0.60 5.18±0.63 510.5±37.8b 178.5±20.9

0.78±0.06 1.41±0.14 1.84±0.33 1.59±0.32 116.4±26.8 63.0±10.5a

0.77±0.06 1.33±0.14 1.75±0.33 1.55±0.32 159.2±26.8 109.5±10.5b

AUC= área bajo la curva. Literales distintas entre dosis difieren (P<0.05).

KISS-10 indujo un aumento de LH y FSH, mas no de GH (Figura 1). El aumento de LH y FSH inducido por KISS-10 (concentración máxima/concentración basal) fue en promedio de 16.6 y 2.29 veces respectivamente. A partir de la primera muestra de sangre, es decir a los 15 min post KISS-10, tanto en LH (5 μg: 5.9 ± 1.1; 50 μg: 3.7 ± 0.3) como en FSH (5 μg: 1.75 ± 0.4; 50 μg: 1.49 ± 0.4) se registró un aumento (P<0.01) con relación a la concentración basal más dos desviaciones estándar (LH: 0.941; FSH: 1.20 ng/ml). En comparación con la dosis de 5 µg, la dosis de 50 µg de KISS-10 indujo una mayor liberación de LH (P<0.05), evidenciada por una AUC mayor (Cuadro 1). Así mismo, la duración del incremento de FSH fue mayor (P<0.05) para la dosis de 50 µg de KISS-10/kg. El resto de las características del incremento de LH y de FSH inducido por KISS-10 fueron similares entre dosis (P>0.05).

726


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Figura 1: Media ± EEM de las concentraciones séricas de LH, FSH y GH en respuesta a un bolo intravenoso de 5 o 50 µg de kisspeptina-10/kg de peso corporal en becerras prepúberes La flecha indica el momento de la aplicación de kisspeptina-10. 5μg/kg 7

*

6

LH (ng/ml)

50μg/kg

*

5

* *

4 3 2 1 0 -1

0

1

2

3

4

5

6

4

5

6

4

5

6

Tiempo (h)

2.0

FSH (ng/ml)

1.8 1.6

1.4 1.2 1.0 0.8 0.6

-1

0

1

2

3

Tiempo (h)

35

GH (ng/ml)

30 25 20 15 10 5 0 -1

0

1

2

3

Tiempo (h)

*Indica diferencia entre dosis de kisspeptina-10 (P<0.05).

La magnitud del aumento de LH inducido por 5 o 50 µg de KISS-10/kg de peso fue modulada por IGF-I, más no por leptina. El IGF-I se relacionó negativamente con el AUC de LH en becerras tratadas con la dosis de 50 µg de KISS-10 (P<0.05; Figura 2); en cambio, el IGF-I no se relacionó en ningún sentido con el AUC del incremento de LH inducido por la dosis

727


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

de 5 µg de KISS-10/kg de peso (P>0.05). Ninguna otra variable de LH y FSH o las concentraciones de GH posteriores a KISS-10 se asoció (P>0.05) con la concentración de IGF-I o leptina.

Figura 2: Relación entre la concentración sanguínea del factor de crecimiento similar a la insulina I (IGF-I) y el área bajo la curva (AUC) de LH en respuesta a 5 (A) o 50 (B) µg de kisspeptina-10/kg de peso en becerras prepúberes (B) y=0.580x + 269.3 R2= 0.130 P=0.306

1000

500

LH (AUC)

5 µg/kg

1500

unidades arbitrarias

LH (AUC)

unidades arbitrarias

(A)

50 µg/kg

1500

y= -2.675x + 876.4 R2= 0.623 P= 0.006

1000

500

0

0 0

50

100

150

200

250

300

0

50

100

150

200

250

300

IGF-I (ng/ml)

IGF-I (ng/ml)

Los puntos representan valores individuales (n=10); la línea continua corresponde a la línea de regresión y las líneas punteadas corresponden al intervalo de confianza al 95 %.

Poco antes (-6 a 0 h) y un día después del tratamiento con KISS-10 (24 a 30 h), el número de pulsos de LH y la concentración media de LH, FSH y GH fueron similares (P>0.05), independientemente de la dosis de KISS-10 aplicada (Cuadro 2). En estos periodos de muestreo, no se detectaron diferencias significativas atribuibles a la dosis de KISS-10 o a su interacción con el periodo de muestreo.

Cuadro 2: Media ± EEM de la frecuencia de pulsos de LH y la concentración media de LH, FSH y GH antes y después del tratamiento de kisspeptina-10 (KISS-10) en becerras prepúberes (n=20) Variable

Pre KISS-10 (-6 a 0 h)

Pos KISS-10 (24 a 30 h)

LH, pulsos/6 h LH, ng/ml FSH, ng/ml GH, ng/ml

0.68±0.14 0.40±0.07 0.77±0.05 9.99±1.39

0.83±0.14 0.34±0.07 0.76±0.05 12.84±1.39

728

P= 0.361 0.297 0.698 0.112


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Discusión

Se ha establecido(22) que la pubertad es precedida por un incremento progresivo en la frecuencia de la secreción pulsátil de la hormona liberadora de las gonadotropinas (GnRH), siendo este cambio el componente clave de control para iniciar la pubertad(23). Existen evidencias que señalan a la KISS como el elemento estimulador preponderante en la actividad de las neuronas productoras de GnRH(24). A su vez, las neuronas sintetizadoras de KISS son las principales estructuras que sirven como intermediarias entre las señales de origen somático y ambiental que modulan las funciones de las neuronas productoras de GnRH, determinando tanto la liberación tónica como la secreción fásica de las gonadotropinas hipofisiarias(25). En el presente estudio se observó que el eje gonadotrópico de las becerras prepúberes es sensible a KISS-10, ya que después de aplicar dicho péptido por vía endovenosa en dosis de 5 µg/kg de peso corporal, aumentaron el promedio, la Vmax, y la AUC de LH y FSH circulantes. En estudios previos, la KISS-10 administrada como bolo i.v. en la dosis antes indicada indujo un incremento de LH en hembras bovinas prepúberes(4,5,6) y adultas ovariectomizadas(7) y de FSH en becerras prepúberes(5,6). En esos trabajos, el incremento de las gonadotropinas inició a partir de los 30 min pos-tratamiento, mientras que en el aquí presentado, independientemente de la dosis de KISS-10, hubo un aumento a los 15 min post KISS-10 tanto en la LH como en la FSH con relación a su concentración basal, por lo que se confirma el marcado efecto regulador de la KISS en la actividad del eje gonadotrópico de las becerras prepúberes. Al examinar los protocolos de la toma de muestras de sangre en los estudios antes citados y en el presente, es posible afirmar que la respuesta de LH y FSH a una sola aplicación i.v. de KISS-10 no ocurre antes de los 15 min post aplicación, ya que se colectaron muestras cada 5(7), 10(5) y 15(4,6) minutos después de la inyección del péptido, sin haber detectado un aumento de dichas hormonas antes del tiempo arriba señalado; consecuentemente, una implicación derivada de estos datos es que en futuros estudios con similar formato de aplicación de KISS-10, es factible ahorrar recursos al no colectar muestras a intervalos menores de 15 min, sin perder información valiosa con relación a la secreción de LH y FSH. Otra contribución del presente trabajo es la generación de evidencias de que los mecanismos fisiológicos reguladores de la liberación de LH y FSH son sensibles al aumento de dosis de KISS-10 en becerras prepúberes, y que esta sensibilidad, aparentemente, es afectada por el IGF-I endógeno, ya que en becerras con bajas concentraciones de IGF-I, la dosis de 50 µg de

729


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

KISS-10 indujo una respuesta de LH mayor que con la dosis de 5 µg, pero esta diferencia no se detectó en becerras con altas concentraciones de IGF-I. Lo anterior indica que: a) la KISS10 es capaz de activar a edades tempranas el sistema GnRH/LH, y b) el IGF-I, mismo que estuvo asociado positivamente con el peso corporal de los animales, modula la magnitud de la respuesta de LH a diferentes dosis de KISS-10. Considerando la respuesta diferenciada de LH a KISS-10 en becerras con diferentes concentraciones de IGF-I, se sugiere que KISS-10 en dosis de 50 µg podría estar superando factores inhibidores o activando factores estimulantes de la liberación de GnRH, y consecuentemente de las gonadotropinas a nivel hipotalámico o hipofisiario. Dichos factores están presentes y activos en el primer caso, o ausentes/inactivos en el segundo caso, es decir cuando las becerras prepúberes tienen bajas concentraciones de IGF-I. En cuanto a la posibilidad de que IGF-I funja como indicador de un ambiente metabólico favorable para el inicio de la pubertad en becerras; se ha documentado que en dichos animales aumenta el IGF-I circulante unos días antes o al momento de la primera ovulación(26,27), mientras que en ratonas la administración de IGF-I adelanta la pubertad(28). La acción del IGF-I podría ser la de potenciar el efecto de KISS-10 exógena en la secreción fásica de LH, mas no en la secreción tónica, ya que existen evidencias de ello en primates no humanos(28), en roedores (29) y en becerras prepúberes(6,14). El IGF-I podría actuar en al menos dos niveles: directamente en las neuronas productoras de GnRH(30) y en los gonadotropos(31). Los hallazgos de que el IGF-I circulante atraviesa la barrera hematoencefálica en ratas y que se acumula en el núcleo anteroventral-periventricular y la eminencia media(32), le da significancia fisiológica a la acción del IGF-I en hipotálamo y adenohipófisis para modular la secreción fásica de LH inducida por KISS-10. En el estudio que aquí se informa, la variación de la leptina sérica no estuvo asociada con la respuesta de LH, FSH o GH a KISS-10. En cierta manera, dicho fenómeno se esperaba, ya que las evidencias obtenidas en roedores indican que la disminución de leptina circulante o de su capacidad de acción, ya sea por restricción alimenticia, por inmunoneutralización o bien en animales con resistencia a leptina, no altera los efectos de KISS-10 en la liberación de LH(33,34). No obstante no se pueden descartar del todo los efectos de la leptina en la regulación del inicio de la pubertad, ya que evidencias producidas en ovinos apoyan una regulación directa de la leptina sobre las neuronas kisspeptidérgicas del núcleo arcuato y área preóptica del hipotálamo, así como interacciones recíprocas de éstas con neuronas productoras tanto del neuropéptido Y como de la proopiomelanocortina, sustancias implicadas en el control metabólico de la reproducción(1,2). En general se acepta que si bien hay evidencias del efecto de leptina en las neuronas kisspeptidérgicas, lo más probable es que la mayor parte de sus efectos en el establecimiento de la pubertad sean indirectos con respecto al sistema KISS(29). En el presente trabajo, como en otros efectuados con becerras prepúberes(5,6), la administración de 5 µg de KISS-10/kg de peso indujo la liberación de FSH. Sin embargo, la secreción máxima de esta gonadotropina no presentó un aumento adicional al incrementar la

730


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

dosis de KISS-10, lo cual coincide parcialmente con los resultados obtenidos en cerdas prepúberes(35); pero sí indujo una respuesta más duradera, es decir que el incremento de FSH en respuesta a una dosis de 50 µg de KISS-10 se mantuvo elevado por más tiempo, comparado con una dosis de 5 µg (Figura 1-B). La diferencia de respuesta de LH y FSH a KISS-10 puede estar asociada al control que ejercen varios factores además de la GnRH sobre su patrón de liberación(36). La información existente indica que tanto E2 como P4, leptina, IGF-I, ghrelina y varios neurotransmisores, entre los que destacan glutamato, ácido γ-aminobutírico y los opioides hipotalámicos, ejercen sus efectos en el patrón de secreción de LH y FSH a través del sistema KISS-GnRH(37). No obstante existen evidencias de la mayor dependencia de la LH a las acciones de la GnRH que la de la FSH(38). En la regulación de la síntesis y liberación de FSH participan la activina(39), la inhibina y la folistatina(40), consecuentemente los efectos de una dosis mayor de KISS-10 a la que es capaz de evocar la liberación de GnRH y por ende de las gonadotropinas hipofisiarias, no genera una mayor respuesta de FSH pero sí de LH. No se puede descartar que el efecto de KISS-10 sobre la mayor duración de la respuesta de FSH se pueda deber a su más prolongada vida media (120 a 170 min) que la de LH (40 a 60 min)(41). Con respecto a la respuesta de GH circulante a la KISS-10 en becerras prepúberes, algunos autores determinaron que la aplicación del péptido en dosis de 5 µg/kg indujo un aumento de GH(4); por el contrario otros investigadores no detectaron respuesta alguna(5), mientras que algunos más, encontraron que unas becerras responden a la KISS-10 pero otras no(6). En el presente estudio, la dosis de 5 µg de KISS-10 no evocó una respuesta por parte de GH, consecuentemente los resultados aquí reportados apoyan los hallazgos de Ezzat et al(5), sin proporcionar una evidencia que indique el o los mecanismos que pueden interferir o, en su caso, apoyar los efectos de la KISS en el eje somatotrópico, por lo tanto este tópico permanece controversial. En el presente estudio, una dosis diez veces mayor de KISS-10 a la que evocó una respuesta de GH en otros trabajos(4,6), no indujo un aumento en la GH circulante, lo que concuerda con Lents et al(35), en cuya investigación emplearon cerdas prepúberes y dosis de KISS-10 mayores a las aquí utilizadas. En otros experimentos efectuados con cabras en diestro(8), borregas ovariectomizadas(9) y vacas secas o lactantes(10), tampoco se observó que la KISS-10, administrada en forma de un bolo i.v., indujera la liberación de GH. En oposición a lo anterior y en concordancia con los resultados de un estudio previo(4), un incremento de GH en respuesta a KISS-10 se observó cuando el citado neuropéptido se administró a vacas ovariectomizadas presensibilizadas con esteroides ováricos(7) y a borregas adultas en anestro estacional y sometidas a un tratamiento prolongado de KISS-10(42). Lo anterior sugiere que los niveles circulantes de estradiol podrían determinar o modular los efectos de KISS en la liberación de GH. En el presente estudio, la baja pulsatilidad de la LH de las becerras y los bajos niveles sanguíneos de progesterona al momento del tratamiento, sugieren una limitada actividad ovárica, y posiblemente reducidos niveles de estradiol en sangre, razón que podría explicar

731


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

la falta de respuesta del eje somatotrópico. Con relación a la intervención de GH en las funciones del eje gonadotrópico, existen evidencias de que la sobreexpresión de GH en ratonas transgénicas acorta el intervalo del nacimiento a la pubertad(43); no obstante, la aplicación de somatotropina bovina recombinante (rbST) a becerras Holstein prepúberes, retrasa la edad a la primera ovulación bajo condiciones de alimentación adecuadas, pero no tiene efecto si las hembras son sobrealimentadas(44). De manera similar, la rbST aumenta la tasa de concepción en vacas lecheras después de los 100 días posparto, una vez que están en balance positivo de energía, pero no tiene efecto en vacas lecheras con menos de 100 días en leche, en vacas de razas cárnicas ni en vaquillas lecheras(45). Algunas revisiones permiten concluir que la GH ejerce numerosas acciones en la reproducción de las hembras, pero en general sus efectos son pro-gonadales cuando se encuentra en concentraciones fisiológicas; en contraste, en niveles farmacológicos o cuando se presentan concentraciones circulantes excesivas por causas patológicas, la GH es antigonadal(46). Si bien hay evidencias del vínculo entre KISS y el eje somatotrópico, hasta el momento no se ha establecido un mecanismo de relevancia fisiológica con respecto a la regulación de la secreción de GH por parte de KISS(47). La generalidad de los autores proponen que las acciones positivas de GH en la pubertad y otras funciones reproductivas son efectuadas principalmente a través del IGF-I(48); no obstante algunos de sus efectos son ejercidos sin la intervención de dicho factor(49). Debido a que en este trabajo no se encontraron efectos de KISS-10 en la secreción de GH, no se profundizará más en ese aspecto; sin embargo, debido a que en algunos trabajos efectuados en bovinos(4,6) la KISS-10 incrementó la liberación de GH, sería recomendable determinar las condiciones fisiológicas y de desarrollo en las que KISS evoca un aumento de GH de manera simultánea al de las gonadotropinas hipofisiarias, ya que potencialmente en esas situaciones la KISS exógena podría ser más efectiva en la inducción de la ovulación y el mejoramiento de otras funciones reproductivas. Finalmente, es adecuado puntualizar que la secreción de LH, FSH y GH antes y 24 h después del tratamiento de KISS-10 fue similar en los animales de ambos tratamientos, lo cual exime a la KISS-10 administrada periféricamente de un efecto residual a nivel del generador de pulsos de GnRH o de los reguladores hipotalámicos de la GH; por lo tanto la KISS-10 exógena podría influir en la liberación de GnRH más que en su síntesis.

732


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Conclusiones e implicaciones

El eje gonadotrópico, mas no el somatotrópico, es altamente sensible a la KISS exógena, puesto que la KISS-10 indujo incrementos de LH y FSH más no de GH. Además, a diferencia de la FSH, la sensibilidad de los mecanismos de liberación de la LH en respuesta a KISS es mayor al aumentar la dosis de KISS-10; dicha sensibilidad está inversamente relacionada con los niveles endógenos de IGF-I. La variación en las concentraciones circulantes de leptina no estuvo asociada con la magnitud de respuesta de LH y FSH inducida por KISS-10 o en la concentración de GH posterior a su aplicación, por lo tanto, otra conclusión es que el IGF-I más no la leptina modula los efectos de KISS-10 en el eje gonadotrópico.

Agradecimientos

Esta investigación fue parcialmente apoyada por: DGAPA-PAPIIT-UNAM, proyecto IN205510: “Participación de la KISS en el inicio de la pubertad en vaquillas” y proyecto IN218814: “Estudio de los núcleos hipotalámicos kisspeptidérgicos durante el inicio de la pubertad en hembras bovinas”. Se agradece la colaboración del personal del Sitio Experimental Las Margaritas. Igualmente a las Dras. Clara Murcia Mejía y Susana Rojas Maya por su gran apoyo en la cuantificación de las hormonas aquí estudiadas.

Literatura citada 1.

Backholer K, Smith JT, Rao A, Pereira A, Iqbal J, Ogawa S, Li K, Clarke IJ. Kisspeptin cells in the ewe brain respond to leptin and communicate with neuropeptide Y and proopiomelanocortin cells. Endocrinology 2010;151:2233–2243.

2.

Amstalden M, Alves BRC, Liu S, Cardoso RC, Williams GL. Neuroendocrine pathways mediating nutritional acceleration of puberty: insights from ruminant models. Frontiers in Endocrinol 2011;2:1-7.

733


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

3.

Pinilla L, Aguilar E, Dieguez C, Millar RP, Tena-Sempere M. Kisspeptins and reproduction: physiological roles and regulatory mechanisms. Physiology Rev 2012;92:1235-1316.

4.

Kadokawa H, Matsui M, Hayashi K, Matsunaga N, Kawashima C, Shimizu T, et al. Peripheral administration of kisspeptin-10 increases plasma concentrations of GH as well as LH in prepubertal Holstein heifers. J. Endocrinology 2008;196:331-334.

5.

Ezzat AA, Saito H, Sawada T, Yaegashi T, Yamashita T, Hirata TI, et al. Characteristics of the stimulatory effect of Kisspeptin-10 on the secretion of luteinizing hormone, follicle-stimulating hormone and growth hormone in prepubertal male and female cattle. J Reprod Dev 2009;55:650-654.

6.

Alamilla RM, Calderón RRC, Rosete FJV, Rodríguez HK, Vera AHR, ArreguínArévalo JA, et al. Kisspeptina en becerras prepúberes: I. Influencia de la edad en la respuesta de LH, FSH y GH a kisspeptina-10 y su asociación con IGF-I, leptina y estradiol circulantes. Rev Mex Cienc Pecu 2017;8:375-385.

7.

Whitlock BK, Daniel JA, Wilborn RR, Rodning SP, Maxwell HS, Steele BP, et al. Interaction of estrogen and progesterone on kisspeptin-10-stimulated luteinizing hormone and growth hormone in ovariectomized cows. Neuroendocrinology 2008;88:212-215.

8.

Hashizume T, Saito H, Sawada T, Yaegashi T, Ezzat AA, Sawai, et al. Characteristics of stimulation of gonadotropin secretion by kisspeptin-10 in female goats. Anim Reprod Sci 2010;118:37–41.

9.

Whitlock BK, Daniel JA, Wilborn RR, Maxwell HS, Steele BP, Sartin JL. Interaction of kisspeptin and the somatotropic axis. Neuroendocrinology 2010;92:178-88.

10. Whitlock BK, Daniel JA, Wilborn RR, Maxwell HS, Steel BP, Sartin JL. Effect of kisspeptin on regulation of growth hormone and luteinizing hormone in lactating dairy cows. J Anim Sci Biotech 2011;2(3):131-140. 11. Redmond JS, Baez-Sandoval GM, Spell KM, Spencer TE, Lents CA, Williams GL, Amstalden M. Developmental changes in hypothalamic Kiss1 expression during activation of the pulsatile release of luteinising hormone in maturing ewe lambs. J Neuroendocrinol 2011;23:815–822. 12. Nestor CC, Briscoe AMS, Davis SM, Valent M, Goodman RL, Hileman SM. Evidence of a role for kisspeptin and neurokinin B in puberty of females sheep. Endocrinology 2012;153:2756–2765.

734


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

13. Han SK, Gottsch ML, Lee KJ, Popa SM, Smith JT, Jakawich SK, et al. Activation of gonadotropin-releasing hormone neurons by kisspeptin as a neuroendocrine switch for the onset of puberty. J Neurosci 2005;25:11349-11356. 14. Santos ER, Calderón RRC, Vera AHR, Perera MG, Arreguín AJA, Nett TM, et al. Secreción de hormona luteinizante y actividad ovárica en respuesta a KISS-10 administrada en forma repetida y su asociación con IGF-I y leptina séricos en becerras pre-púberes. Rev Mex Cien Pecu 2014;5(2):181-200. 15. National Statistics Service, Government of Australia. Sample size calculator. http://www.nss.gov.au/nss/home.nsf/pages/Sample+size+calculator. 2017. 16. Williams AR. Ultrasound applications in beef cattle carcass research and management. J Anim Sci 2002;80(Suppl 2):183-188. 17. Niswender GD, Reichert Jr LE, Midgley Jr AR, Nalbandov AV. Radioimmunoassay for bovine and ovine luteinizing hormone. Endocrinology 1969;84:1166–1173. 18. L’Hermite M, Niswender GD, Reichert Jr LE, Midgley Jr AR. Serum folliclestimulating hormone in sheep as measured by radioimmunoassay. Biol Reprod 1972;6:325–332. 19. Powell M, Keisler DH. A potential strategy for decreasing milk production in the ewe at weaning using a growth hormone release blocker. J Anim Sci 1995;73:1901–1905. 20. SAS. Statistical Analysis System Institute Inc, Cary, NC, USA. 2002. 21. Arreguin-Arevalo JA, Nett TM. A non-genomic action of estradiol as the mechanism underlying the acute suppression of secretion of luteinizing hormone in ovariectomized ewes. Biol Reprod 2006;74(1):202–208. 22. Terasawa EI, Fernandez DL. Neurobiological mechanisms of the onset of puberty in primates. Endocrine Rev 2001;22:111-151. 23. Ebling FJP. The neuroendocrine timing of puberty. Reproduction 2005;129:675-683. 24. Abbara A, Radnasabapathy R, Jayasena CN, Dhillo W. The effects of kisspeptin on gonadotropin release in non-human mammals. Chapter 4. In: Kauffman AS, Smith JT. Kisspeptine signaling in reproductive biology. NY, USA: Springer; 2013. 25. Smith JT. The role of kisspeptine and gonadotrophin inhibitory hormone in the seasonal regulation of reproduction in sheep. Domestic Anim Endocrinol 2012;43:75-84.

735


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

26. Jones EJ, Armstrong JD, Harvey RW. Changes in metabolites, metabolic hormones, and luteinizing hormone before puberty in Angus, Bradford, Charolais and Simmental heifers. J Anim Sci 1991;60:1607-1615. 27.

Yelich JV, Wettemann RP, Marston TT, Spicer LJ. Luteinizing hormone, growth hormone, insulin-like growth factor-I, insulin and metabolites before puberty in heifers fed to gain at two rates. Dom Anim Endocrinol 1996;13: 325–338.

28. DiVall SA, Williams TR, Carver SE, Koch L, Brüning JC, Kahn CR, et al. Divergent roles of growth factors in the GnRH regulation of puberty in mice. J Clin Invest 2010;120: 2900-2909. 29. Navarro VM, Tena-Sempere M. Neuroendocrine control by kisspeptins: role in metabolic regulation of fertility. Nat Rev Endocrinol 2012;8:40-53. 30. Hiney J.K, Srivastava V, Nyberg CL Ojeda SR, Dees WL. Insulin-like growth factor-1 (IGF-1) of peripheral origin acts centrally to accelerate the initiation of female puberty. Endocrinology 1996;137:3717-3727. 31. Adam CL, Gadd TS, Findlay PA, Wathes DC. IGF-I stimulation of luteinizing hormone secretion, IGF-binding proteins (IGFBPs) and expression of mRNAs for IGFs, IGF receptors and IGFBPs in the ovine pituitary gland. J Endocrinol 2000;166:247-254. 32. Reinhardt RR, Bondy CA. Insulin-like growth factors cross the blood brain barrier. Endocrinology 1994;135:1753-1761. 33. Navarro VM, Fernández-Fernández R, Castellano JM, Roa J, Mayen A, Barreiro ML, et al. Advanced vaginal opening and precocious activation of the reproductive axis by KiSS-1 peptide, the endogenous ligand of GPR54. J Physiology 2004;561:379–386. 34. Castellano J, Navarro V, Fernandez-Fernandez R, Nogueiras R, Tovar S, Roa J, et al. Changes in hypothalamic KiSS-1 system and restoration of pubertal activation of the reproductive axis by kisspeptin in undernutrition. Endocrinology 2005;146:3917-3925. 35. Lents CA, Heidorn NL, Barb CR, Ford JJ. Central and peripheral administration of kisspeptin activates gonadotropin but not somatotropin secretion in prepubertal gilts. Reproduction 2008;135:879-887. 36. Thackray VG, Mellon PL, Coss D. Hormones in synergy: Regulation of the pituitary gonadotropin genes. Mol Cell Endocrinol 2010;314:92-203. 37. Lomniczi A, Ojeda SR. The emerging role of epigenetics in the regulation of female puberty. Endocr Dev 2016;29:1-16.

736


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

38. Foster CM, Phillips DJ, Wyman T, Evans LW, Groome NP, Padmanabhan V. Changes in serum inhibin, activin and follistatin concentrations during puberty in girls. Human Reprod 2000;15(5):1052-1057. 39. Coss D, Mellon PL, Thackray VG. A FoxL in the Smad house activin regulation of FSH. Trends Endocrinol Metab 2010;21:562-568. 40. Phillips JD. Activins, inhibins and follistatins in the large domestic species. Domest Anim Endocrinol 2005;28:1–16. 41. Donovan BT, Gledhill B. Half-live of FSH and LH in the ferret. Acta Endocrinol (Copenh) 1984;105:14-18. 42. Sébert ME, Lomet D, Ben Saïd S, Monget P, Briant C, Scaramuzzi RJ, Caraty A. Insights into the mechanism by which kisspeptin stimulates a preovulatory LH surge and ovulation in seasonally acyclic ewes: Potential role of estradiol. Dom Anim Endocrinol 2010;38:289–298. 43. Cecim M, Kerr J, Bartke A. Effects of bovine growth hormone (bGH) transgene expression or bGH treatment on reproductive functions in female mice. Biol Reprod 1995;52:1144-1148. 44. Radcliff RP, Vandehaar MJ, Skidmore AL, Chapin LT, Radke BR, Lloyd JW, Stanisiewski EP, Tucker HA. Effects of diet and bovine somatotropin on heifer growth and mammary development. J Dairy Sci 1997;80:1996-2003. 45. Starbuck MJ, Inskeep EK, Dailey RA. Effect of a single growth hormone (rbST) treatment at breeding on conception rates and pregnancy retention in dairy and beef cattle. Anim Reprod Sci 2006;93:349-359. 46. Hull KL, Harvey S. Growth hormone: roles in female reproduction. J Endocrinol 2001;168:1-23. 47. Daniel JA, Foradori CD, Whitlock B, Sartin JL. Reproduction and beyond, kisspeptin in ruminants. J Anim Sci Biotech 2015;6:23-27. 48. Boswell HB. Normal pubertal physiology in females. Chapter 2, Dietrich JE editor. Female Puberty: A comprehensive guide for clinicians, doi: 10.1007/978-1-4939-09124_2, Springer Science+Business Media, New York, USA, 2014. 49. Hull KL, Harvey S. GH as a co-gonadotropin: the relevance of correlative changes in GH secretion and reproductive state. J Endocrinol 2002;172:1-19.

737


http://dx.doi.org/ 10.22319/rmcp.v9i4.4527 Artículo

Variaciones en las respuestas termoregulatorias de ovejas de pelo durante los meses de verano en un clima desértico Variations in the thermoregulatory responses of hair ewes during the summer months in a desert climate

Ulises Macías-Cruza* Miguel A. Gastéluma Leonel Avendaño-Reyesa Abelardo Correa-Calderóna Miguel Melladob Alfonso Chay-Canulc Carlos F. Arechigad

a

Universidad Autónoma de Baja California, Instituto de Ciencias Agrícolas, Mexicali, Baja California, México. b

Universidad Autónoma Agraria Antonio Narro, Departamento de Nutrición Animal, Saltillo, Coahuila, México. c

Universidad Juárez Autónoma de Tabasco, División Académica de Ciencias Agropecuarias, Villahermosa, Tabasco, México. d

Universidad Autónoma de Zacatecas, Unidad Académica de Medicina Veterinaria y Zootecnia, Zacatecas, México.

*Autor de correspondencia: ulisesmacias1988@hotmail.com

Resumen: Se confinaron 10 ovejas multíparas Katahdin × Pelibuey, color blanco, no gestantes y no lactantes, para evaluar las variaciones diurnas de variables fisiológicas y concentración


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

de algunos metabolitos sanguíneos a través de los meses calientes de verano (junioseptiembre), en una región desértica del noroeste de México. Las concentraciones de metabolitos se midieron a las 6 y 18 h y las variables fisiológicas a las 0, 6, 12 y 18 h durante cuatro días de cada mes (mediciones semanales). Los promedios para temperatura ambiental e índice de temperatura-humedad durante el verano fueron 33.6 ºC y 78.6 unidades, respectivamente, siendo agosto el mes más caliente. No cambió (P>0.05) el peso vivo y la condición corporal a través de los meses de verano. La temperatura rectal en agosto fue menor (P<0.05) entre 0 y 12 h, y mayor (P<0.05) a las 18 h comparado con los otros meses. La frecuencia respiratoria descendió (P<0.05) a las 6 h en todos los meses, pero a las 0 y 18 h fue mayor (P<0.05) en agosto que en los otros meses. Se observaron mayores (P<0.05) concentraciones de glucosa y menores (P<0.05) concentraciones de colesterol y triglicéridos en junio y julio con relación a agosto y septiembre. Se concluye que las ovejas de pelo mantienen homeotermia durante los meses de verano en regiones desérticas por cambiar el ritmo diurno de sus variables fisiológicas y metabolitos, de acuerdo con la intensidad del estrés calórico de cada mes. Palabras clave: Ovinos de pelo, Estrés calórico, Homotermia, Adaptación fisiológica.

Abstract: Ten (10) multiparous hair ewes from white genotype, non-pregnant and non-lactating, were confined in order to determine diurnal variations of physiological variables and some blood metabolite concentrations through hot summer months (June to September) in an desert region of the northwest Mexico. While blood metabolite concentrations were measured at 6 and 18 h, physiological variables were evaluated at 0, 6, 12 and 18 h during 4-d in each month (weekly measurements). Temperature and temperature-humidity index monthly averages during the study were 33.6 oC and 78.6 units, respectively, being August the hottest month. Live weight and body condition did not change (P>0.05) across the summer months. Compared with other months, rectal temperatures in August were lower (P<0.05) between 0 and 12 h, and then increased (P<0.05) at 18 h. Respiration frequency decreased (P<0.05) at 6 h in all the months, but at 0 and 18 h this was higher in August than in other months. Higher (P<0.05) glucose concentration and lower (P<0.05) cholesterol and triglyceride concentration were observed in June and July than in August and September. In conclusion, under desert climatic conditions, hair ewes had the ability to maintain homeothermy during all summer warm months because they changed their diurnal rhythms of physiological and metabolic variables according to the intensity of the heat stress in each month. Key words: Hair sheep, Heat stress, Homeothermy, Physiological adaptation.

Recibido: 13/06/2017 Aceptado: 19/01/2018

739


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Introducción

La mayor parte del noroeste de México se caracteriza por ser una región árida, con un clima muy seco, donde la presencia de lluvias es escasa y los veranos son muy calientes(1). Las temperaturas que se registran en esta región llegan a ser superiores a 50 ºC en el verano, por lo cual se considera que los animales domésticos se encuentran en un ambiente de estrés por calor durante los meses de esta época(2). Las elevadas temperaturas de verano tienen un impacto negativo en la capacidad productiva y reproductiva de los ovinos, ya que su prioridad es activar mecanismos de termorregulación para mantener la homotermia(3). Los ovinos de raza de pelo como Pelibuey, Dorper, Katahdin o sus cruzas tienen una alta capacidad para adaptarse a las condiciones climáticas del noroeste de México, de tal manera que durante el verano estas razas han mostrado la capacidad de termorregular su cuerpo(4) sin comprometer drásticamente la actividad reproductiva(5) y la ganancia de peso en la finalización(6). Algunos estudios han elucidado que los ovinos de pelo pueden adaptarse fácilmente a condiciones de estrés térmico porque, a diferencias de las razas de lana, reducen la producción de calor metabólico(7), respiran más lento y profundo(8), y las células mononucleares presentan más viabilidad por tener mayores concentraciones de la proteína del choque calórico HSP 70(9). Adicionalmente, un estudio reciente indicó que las ovejas de pelo mantienen condiciones de normotermia durante los veranos cálidos del noroeste de México, debido a la activación de mecanismos adaptativos fisiológicos, los cuales favorecen la pérdida de calor corporal a través de la piel durante las horas menos calientes del día (vías no evaporativas), e incrementan drásticamente la frecuencia respiratoria (FR; vía evaporativa) cuando el gradiente de temperatura rectal (TR) y ambiental es pequeño(10). Cabe mencionar que gran parte del conocimiento generado para comprender cómo los ovinos de pelo se adaptan al estrés térmico, se ha desarrollado usando cámaras termoambientales y aplicando estrés térmico de tipo agudo. Sin embargo, bajo condiciones naturales de verano en las regiones áridas, el estrés calórico al que son expuestos los animales es crónico e intenso, con variaciones en las temperaturas ambientales de acuerdo con la hora del día y mes. Así, en junio y septiembre se presentan temperaturas ambientales que generan condiciones de estrés calórico menos intensas a las observadas en julio y agosto(5). Estas variaciones en las temperaturas diurnas y mensuales a través del verano, pueden llevar a ciertos ajustes fisiológicos y metabólicos específicos que permitan un uso más eficiente de la energía metabolizable consumida(3). Por lo tanto, el objetivo de este estudio fue determinar la variación en las constantes fisiológicas y en

740


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

algunos metabolitos sanguíneos a través de los meses calientes del verano en ovejas de pelo mantenidas bajo condiciones áridas del noroeste de México.

Material y métodos

El estudio se condujo durante el verano de 2013 en la Unidad Experimental Ovina del Instituto de Ciencias Agrícolas, de la Universidad Autónoma de Baja California (UABC), localizada en el Valle de Mexicali, Baja California, México (32º 24´ LN y 115º 22´ LO). La región se caracteriza por tener un clima desértico cálido (Bwh), con temperaturas extremas en verano (40.5 ºC) e invierno (7.4 ºC), y escasa precipitación pluvial, la cual se concentra principalmente en diciembre (85 mm anuales)(1).

Animales y manejo

Se utilizaron 10 ovejas multíparas Katahdin × Pelibuey, color blanco, no gestantes y no lactantes, con un peso vivo (PV) inicial de 53.5 ± 4.1 kg y una condición corporal (CC) de 3.2 ± 0.2 unidades (escala 1-5). En el mes de mayo, un mes antes de iniciar las mediciones experimentales, las ovejas fueron vitaminadas y desparasitadas, así como adaptadas a convivir en un mismo corral (5 × 6 m), el cual estaba equipado con comederos en el centro, bebedero y sombra (1.2 m2/animal) de lámina galvanizada a una altura de 2.5 m. Las paredes de los corrales estaban construidas de malla de acero para facilitar el flujo de aire. La alimentación antes y durante el periodo experimental consistió de una dieta de mantenimiento, que contenía paja de trigo y heno de alfalfa picado en una proporción 50:50. Tanto la dieta como el agua limpia se ofrecieron ad libitum a las 0700 y 1700 h todos los días. La composición de la dieta fue 90 % de materia seca, 10 % de proteína cruda y 1.8 Mcal de energía metabolizable/kg de materia seca.

741


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Tratamientos y mediciones

Los tratamientos consistieron en cada uno de los meses de verano (junio, julio, agosto y septiembre), en los cuales se hicieron mediciones de PV y CC, así como de variables climáticas, fisiológicas y metabólicas. Una vez por mes (día 14) se registró individualmente PV y CC (escala de 5 puntos)(11). Las variables climáticas se midieron diariamente, mientras que las variables fisiológicas y metabólicas se evaluaron a intervalos siete días en cada mes (cuatro días de muestreo/mes). Las variables climáticas y fisiológicas se determinaron en horarios de 0000 - 0100 h (medianoche), 0600 - 0700 h (mañana), 1200 - 1300 h (mediodía) y 1800 - 1900 h (tarde), mientras que las metabólicas se midieron solamente en la mañana y la tarde de acuerdo con los horarios previos. Las variables climáticas como temperatura (T, oC) y humedad relativa (HR, %) se obtuvieron de la estación meteorológica universitaria perteneciente a UABC. El índice de temperatura-humedad (ITH) se calculó usando la siguiente fórmula(12): ITH = 0.81 x T + HR (T – 14.4) + 46.4. Las variables fisiológicas evaluadas fueron TR, FR y temperatura de capa de pelo en diferentes regiones del cuerpo (cabeza, flanco derecho, vientre, paleta y anca). La TR se midió introduciendo por el recto un termómetro digital (Delta Track, CA®, USA), la FR contando el número de respiraciones por minuto (rpm) y la temperatura de capa de pelo tomando fotos con una cámara termográfica (Fluke Ti10, USA) a una distancia de 2.0 m del cuerpo del animal. Posteriormente, las fotos se descargaron en la computadora para obtener las temperaturas de las áreas corporales especificadas previamente usando el software Fluke SmartView® 3.9. Adicionalmente, se colectaron muestras sanguíneas de la vena yugular en tubos vacutainer de 10 ml, las cuales se centrifugaron a 3,500 xg durante 15 min, a una temperatura de 10 ºC. Después se separó el suero en viales de 2 ml y se almacenó a -20 ºC hasta la determinación de metabolitos séricos (glucosa, colesterol y triglicéridos) con un analizador automático de química sanguínea (Modelo DT-60, Johnson & Johnson, USA).

Análisis estadístico

Toda la información se sometió a análisis de varianza usando el procedimiento MIXED y se hizo la comparación de medias usando la opción PDIFF del programa SAS(13). Se utilizó un diseño completamente al azar (DCA) considerando cada mes como tratamiento para PV y CC. En las variables fisiológicas y metabólicas se utilizó un DCA con mediciones repetidas en el tiempo, donde mes, hora del día y la interacción mes × hora

742


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

del día se consideraron como efectos fijos. Se indicaron diferencias estadísticas cuando P<0.05.

Resultados Los resultados de las condiciones climáticas se encuentran en el Cuadro 1. Las variables climáticas presentaron una variación diurna similar en todos los meses de verano. Las medias de T e ITH fueron bajas a medianoche (31 ºC y 76 unidades) y en las mañanas (27 ºC y 74 unidades), y aumentaron a mediodía (37 ºC y 82 unidades) y en las tardes (39 ºC y 82 unidades). Los meses de julio y agosto fueron los más calientes, pero septiembre fue el mes más húmedo; en consecuencia, los ITH de esos tres meses se ubicaron entre 78.4 y 80.4 unidades. El ITH en junio fue ligeramente menor (76.8 unidades) que en los otros meses. Los resultados de PV y CC por efecto de mes se muestran en la Figura 1, y ambas variables de estado corporal no cambiaron (P>0.05) a través de los meses de verano.

Cuadro 1: Condiciones climáticas prevalecientes durante los meses de verano en la región desértica del noroeste de México Junio Medianoche Mañana Mediodía Tarde Promedios Medianoche Mañana Mediodía Tarde Promedios Medianoche Mañana Mediodía Tarde Promedios

Meses de verano Julio Agosto

Temperatura, oC 28.85 ± 1.06 32.98 ± 1.05 33.07 ± 0.97 26.23 ± 1.46 27.60 ± 0.68 27.77 ± 0.29 36.55 ± 1.22 38.53 ± 1.14 39.58 ± 1.33 38.94 ± 1.45 40.58 ± 1.11 41.45 ± 0.99 32.64 ± 5.12 34.92 ± 4.20 35.50 ± 4.43 Humedad relativa, % 15.64 ± 1.79 31.30 ± 2.41 23.55 ± 3.53 39.02 ± 1.46 37.51 ± 1.59 63.08 ± 1.67 17.05 ± 2.08 20.54 ± 3.60 25.02 ± 2.85 12.24 ± 0.65 15.49 ± 1.06 16.57 ± 0.68 20.99 ± 8.03 26.21 ± 10.61 32.05 ±11.84 Índice de temperatura-humedad, unidades 73.99 ± 0.84 75.69 ± 0.73 77.25 ± 0.44 71.81 ± 0.77 73.62 ± 1.05 77.05 ± 0.17 80.15 ± 0.72 82.32 ± 0.32 83.29 ± 0.70 81.34 ± 1.20 82.09 ± 0.86 84.03 ± 0.79 76.82 ± 3.87 78.43 ± 2.92 80.40 ± 2.48

743

Septiembre 29.30 ± 0.80 26.65 ± 0.31 34.00 ± 1.02 36.38 ± 1.11 31.58 ± 3.97 48.00 ± 1.79 65.53 ± 1.00 39.17 ± 3.14 25.15 ± 1.47 44.46 ± 10.00 76.97 ± 0.64 75.74 ± 0.38 81.28 ± 0.40 81.01 ± 0.82 78.75 ± 2.23


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

60 58 56 54 52 50 48 46 44 42 40

PV

5.0

CC

4.5 4.0

3.5 3.0

CC (1-5 unidades)

PV, kg

Figura 1: Cambios de peso vivo (PV) y condición corporal (CC) a través de los meses de verano en ovejas de pelo (P<0.05)

2.5 Junio

Julio

Agosto

Septiembre

Meses de verano

Los resultados de TR y FR por efecto de la interacción mes x hora del día se presentan en la Figura 2. Las TR y FR cambiaron (P<0.05) principalmente en agosto con relación a los otros meses de verano. Comparado con los otros meses, la TR disminuyó (P<0.05) en agosto desde medianoche hasta mediodía y aumentó (P<0.05) por la tarde. La FR permaneció alta (P<0.05) en agosto desde la tarde hasta medianoche y disminuyó (P<0.05) a mediodía sin diferencias en la mañana con relación a los otros meses.

Figura 2: Temperatura rectal (TR) y frecuencia respiratoria (FR) durante los meses de verano en ovejas de pelo (*P<0.05 indica diferencia entre meses en cada hora del día) 40

Junio

Julio

Agosto

*

*

39

TR, oC

Septiembre

*

*

38 37 36 00:00

140

06:00 Junio

12:00

Julio

Agosto

120

FR, rpm

100 80

Septiembre

18:00

*

* * *

60 40 20 0 00:00

06:00

12:00 Horas del día

744

18:00


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Los resultados de temperatura en la capa de pelo de las diferentes regiones corporales evaluadas se presentan en las Figuras 3 y 4. Las temperaturas de las diferentes áreas corporales fueron más altas (P<0.05) a mediodía y más bajas (P<0.05) entre medianoche y las mañanas en todos los meses de verano. Sin embargo, la temperatura de la cabeza no se afectó (P>0.05) a medianoche ni en la mañana en ninguno de los meses de evaluados, pero las temperaturas del flanco derecho, paleta y anca fueron más elevadas (P<0.05) a medianoche en agosto, así como en las mañanas en los meses de junio y agosto, en comparación con los otros meses. A mediodía las temperaturas de todas las regiones corporales fueron mayores (P<0.05) en septiembre y menores (P<0.05) en julio, pero en la tarde fueron mayores (P<0.05) en agosto y menores (P<0.05) en septiembre.

Tcab, oC

Figura 3: Temperatura de la cabeza (Tcab) y del flanco derecho (TFD) durante los meses de verano en ovejas de pelo (*P<0.05 indica diferencia entre meses en cada hora del día) Junio

44 42 40 38 36 34 32 30 28 26

TFD, oC

Agosto

Septiembre

* *

00:00 44 42 40 38 36 34 32 30 28 26

Julio

Junio

06:00

12:00

Julio

Agosto

*

18:00 Septiembre

* *

00:00

*

06:00

12:00 Horas del día

745

18:00


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Tpal, oC

Figura 4: Temperatura de la paleta (Tpal) y el anca (Tanca) durante los meses de verano en ovejas de pelo (*P<0.05 indica diferencia entre meses en cada hora del día) 44 42 40 38 36 34 32 30 28 26

Junio

Tanca, oC

Agosto

*

Septiembre

* * *

00:00 44 42 40 38 36 34 32 30 28 26 24

Julio

Junio

06:00

12:00

Julio

Agosto

*

18:00 Septiembre

* *

00:00

*

06:00

12:00

18:00

Hora del día

Los resultados de concentraciones de metabolitos séricos se muestran en el Cuadro 2. La interacción entre mes y hora del día no afectó (P>0.05) la concentración de los metabolitos. Los niveles de glucosa fueron mayores (P<0.05) en junio y julio que en agosto y septiembre, aunque resultados contrarios (P<0.05) fueron observados para las concentraciones de colesterol y triglicéridos entre estos meses. Por otra parte, las concentraciones de todos los metabolitos fueron menores (P<0.05) en las mañanas que en las tardes.

Cuadro 2: Variaciones en las concentraciones de metabolitos en suero a través de los meses de verano en ovejas de pelo (mg dl-1) Variables Meses: Junio Julio Agosto Septiembre Hora del día: Mañana Tarde ab

Glucosa

Colesterol

Triglicéridos

60.90 ± 1.09a 62.12 ± 1.09ª 52.95 ± 1.09b 54.05 ± 1.09b

70.65 ± 3.38a 73.25 ± 3.38a 85.05 ± 3.38b 94.89 ± 3.38b

30.33 ± 2.20a 40.05 ± 2.20b 48.65 ± 2.20c 51.00 ± 2.20c

54.90 ± 0.78ª 57.11 ± 0.78b

76.67 ± 2.40ª 85.25 ± 2.40b

38.90 ± 1.57a 46.12 ± 1.57b

Superíndices diferentes dentro de columna y factor de estudio indican diferencias (P<0.05).

746


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Discusión

La zona de confort térmica para los ovinos de pelo se encuentra entre los 15 y 30 ºC(14) y un ITH de <74 unidades es clasificado como ausencia de estrés calórico en dichos ovinos(15). En este estudio, el promedio mensual de la T y el ITH en los meses de verano varió de 31.6 a 35.5 ºC y de 76.8 a 80.4 unidades, respectivamente, lo cual demuestra que las ovejas estuvieron de manera general en condiciones de estrés calórico. Cabe mencionar que la T en las mañanas fue <30 ºC en todos los meses, situación que pudo favorecer el alivio temporal diario de las ovejas en las condiciones de hipertermia(15). El tipo de estrés calórico que prevaleció durante el estudio varió de moderado (junio, julio y septiembre) a severo (agosto)(16,17). En las tardes de agosto, el estrés calórico llegó a ser de tipo emergente (≥ 84 unidades). Las condiciones ambientales de estrés calórico promueven ajustes fisiológicos en los ovinos para disipar la carga de calor corporal(3). En el noroeste de México, se han reportado incrementos en la TR, FR y consumo de agua, así como una ligera disminución en el consumo de alimento y estado corporal por efecto de las condiciones de estrés calórico de verano en ovinos de raza de pelo(4,6,10). También en otros estudios se han observado cambios en el ritmo circadiano de las variables fisiológicas en ovinos adaptados que fueron sometidos a estrés calórico crónico de larga duración(18), tal como sucedió en este trabajo. Las variaciones circadianas en las constantes fisiológicas, a través del día, son consideradas como mecanismos adaptativos que desarrollan algunos animales para ser más eficientes en el uso de la energía de mantenimiento, así como para disipar la carga de calor corporal y evitar la deshidratación(19). En el presente estudio, se detectaron variaciones en la TR, FR y temperaturas de capa de pelo en todos los meses de verano, de acuerdo con los cambios en la T y el ITH observados a través del día. Estos hallazgos coinciden con otras investigaciones donde las variables fisiológicas aumentaron con el incremento en la T a través del día, tanto bajo condiciones de estrés calórico como de termoneutralidad(10,15,17). En agosto, que fue el mes más caliente en todos los horarios de muestreo, los valores medios de las constantes fisiológicas difirieron en algunos horarios con respecto a los observados en los otros meses. Comparado con el resto de los meses, en agosto se observó 20 % menos FR a mediodía, pero en la tarde y a medianoche aumentó en 10 y 66 % (ausencia de radiación solar), respectivamente. Esto puede ser un mecanismo de adaptación que presentan las ovejas de pelo para reducir las pérdidas de agua corporal y evitar la deshidratación en condiciones de estrés calórico intenso. El aumento en la FR implica la evaporación de una elevada cantidad de agua, y si la FR aumenta de manera

747


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

desmedida en horas de alta radiación solar, la tasa de evaporación de agua corporal es más elevada que cuando el aumento se da en horas de menor radiación solar(19). Cabe mencionar que el patrón de variación de la temperatura corporal interna en agosto (basado en resultados de TR) fue un factor importante para que se presentara el mecanismo adaptativo mencionado. La menor temperatura interna de 0 a 12 h en agosto comparado con los otros meses en los mismos horarios, pudo favorecer que las ovejas toleraran una mayor carga de calor corporal con un menor aumento en la FR a mediodía del mes de agosto, justamente en las horas del día con mayor radiación solar. Un estudio previo en ovinos de pelo ya había sugerido la presencia de dicho mecanismo(10), por lo cual estos resultados lo confirman. En animales ungulados adaptados al calor extremo de las regiones desérticas(19,20), así como en ovejas de lana de la raza Merino Australiano(21) y en cabritos(22) mantenidos en estrés calórico crónico, también ya se había observado dicho mecanismo. El intercambio de calor entre el cuerpo y el ambiente a través de la piel, también juega un papel importante en la termorregulación de ovinos de pelo estresados por calor(3,10). Una temperatura de la piel mayor a la ambiental indica pérdidas de calor corporal, pero cuando es menor la temperatura de la piel se asume que hay una ganancia de calor ambiental(3). En este estudio, se observaron predominantemente en agosto, mayores temperaturas en la paleta, anca y flanco derecho en los horarios de medianoche, mañana y tarde con relación a los otros meses; sin embargo, solamente en las mañanas de agosto hubo disipación de calor corporal a través de la piel en las distintas regiones corporales; en la tarde hubo ganancia de calor corporal y a medianoche se presentó un equilibrio entre la temperatura corporal y la ambiental. Cabe mencionar que julio fue el segundo mes más caliente, pero las temperaturas del pelo no mostraron incrementos tan marcados a través de los horarios como se observó en agosto. No obstante, cuando se compararon las temperaturas del pelo con las ambientales en cada horario dentro del mes de julio, se evidenció que las ovejas perdieron calor solamente por las mañanas en la cabeza y paleta, y en los otros horarios mostraron estar principalmente ganando calor ambiental por las diferentes regiones corporales. Las temperaturas de la capa de pelo mostraron en junio y septiembre que las pérdidas de calor corporal se presentan de medianoche a mediodía, pero no por las tardes. En general, los resultados de termografía infrarroja evidenciaron que las pérdidas de calor corporal a través de la piel, son efectivas en ovinos de pelo principalmente en los meses menos calientes de verano en regiones desérticas del noroeste de México. Comparado con los otros meses, se esperaba que la menor TR observada en agosto de 0 a 12 h, fuera explicada por un aumento en las pérdidas de calor corporal a través de la piel en horas de la noche y la mañana, tal como se reportó en un estudio previo realizado en el mismo sitio experimental durante el verano(10). Sin embargo no fue así, dado que solo en las mañanas de agosto hubo disipación de carga de calor corporal. En consecuencia, esto sugiere que junto con el aumento de la FR, posiblemente en agosto hubo mecanismos metabólicos que ayudaron a reducir la temperatura corporal durante las horas de la noche y la mañana. Es posible que una reducción en la producción de calor

748


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

metabólico sea parcialmente responsable de los resultados de la TR de agosto. Algunos estudios han encontrado que las concentraciones de hormonas tiroideas disminuyen por efecto del estrés calórico cuando los ajustes fisiológicos son incapaces de mantener homeotermia en rumiantes(3,7). El metabolismo energético en las ovejas de pelo varió a través de los meses de verano, posiblemente como una respuesta a la acumulación de calor corporal. Los efectos del estrés calórico sobre las concentraciones de metabolitos en ovinos son variados, y muchos factores tanto inherentes al animal, como relacionados con la alimentación y el tipo de estrés calórico, podrían estar influyendo. En este estudio se determinó que permanecieron altos los niveles de glucosa en los primeros dos meses de verano y después disminuyeron en los otros dos meses finales, sin que esta caída en las concentraciones de glucosa fuera considerada drástica (~9 %). Esto coincide con otros estudios donde reportaron que la concentraciones sanguíneas de glucosa decrecen a un pequeño nivel por efecto del estrés calórico en ovinos, independientemente del consumo de alimento(23,24,25). El hecho de que los niveles de glucosa no caigan súbitamente se debe a que dicho metabolito es una fuente de energía regulada homeostáticamente(24). Posiblemente, la glucosa sérica fue menor en agosto y septiembre debido a una disminución en las reservas de glucógeno en hígado, producto del desgaste energético que implica mantener la tasa respiratoria alta durante periodos prolongados(10). El incremento de la FR es el ajuste fisiológico que mayor gasto de energía tiene, lo cual es debido a la gran cantidad de músculos que se contraen dentro y alrededor del tracto respiratorio(25). Otra causa puede ser el aumento en los niveles séricos de insulina debidos al estrés calórico crónico, ya que la insulina favorece la entrada de mayor cantidad de glucosa a las células, promoviendo su disminución en la circulación sanguínea(26). Las variaciones en las concentraciones séricas de colesterol y triglicéridos mostraron ser inversas a las de glucosa a través de los meses de verano. Esto sugiere que, en ovinos de pelo, el metabolismo lipídico se activa en condiciones de estrés calórico crónico de larga duración como un posible mecanismo para compensar la disminución en la disponibilidad de glucosa, o bien, es un mecanismo alterno para promover el ahorro de glucosa en condiciones de hipertermia crónica. Baumgard y Rhoads(26) mencionan que condiciones de estrés calórico en rumiantes pueden promover la presencia de mecanismos ahorradores de glucosa, siendo el único mecanismo conocido hasta ahora el aumento de lactato sanguíneo para ser usado como fuente de energía en tejidos capaces de oxidarlo. Por otra parte, se desconoce el origen del colesterol y triglicéridos que promovió el aumento de estos metabolitos en el suero en los meses de agosto y septiembre para las ovejas del estudio. La lipolisis del tejido graso no es el origen de estos metabolitos lipídicos porque PV y CC de las ovejas se mantuvo constante a través de los meses de verano. De hecho, numéricamente, el PV aumentó en promedio 1.7 kg y la CC 0.2 unidades en los meses de agosto y septiembre comparados con los meses de junio y julio. Probablemente, el exceso de colesterol y triglicéridos en la segunda mitad del verano tengan su origen en la síntesis endógena del hígado como consecuencia de un aumento en los niveles sanguíneos de insulina. Se ha reportado que la insulina activa genes lipogénicos a nivel del hígado,

749


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

principalmente aquellos que codifican con enzimas ligadas a la biosíntesis de colesterol(27). Si bien, la insulina no fue medida en este estudio, los resultados de PV y CC sugieren que las ovejas de pelo tuvieron altos niveles de esta hormona. Estudios previos han demostrado que un aumento en los niveles de insulina sanguínea favorece la ganancia de masa corporal y evita la movilización de reservas corporales en ovinos estresados por calor, ya que dicha hormona metabólica detiene la lipólisis y estimula la lipogénesis(24,26). Por otra parte, las concentraciones de los metabolitos séricos mostraron una variación diurna en las ovejas utilizadas, lo que sugiere alteraciones de corto plazo en su metabolismo energético para evitar hipertermia. El aumento en los niveles de glucosa, colesterol y triglicéridos por la tarde, se atribuyó parcialmente al incremento de la FR que se presentó en esa parte del día durante todos los meses de verano(28). También, las fluctuaciones en el consumo de alimento a través del día podrían explicar estas variaciones diurnas en los metabolitos sanguíneos ligados al metabolismo energético(29).

Conclusiones e implicaciones

Se concluye que las ovejas de pelo presentaron diferencias en sus constantes fisiológicas a través de los meses del verano bajo condiciones desérticas del noroeste de México, las cuales mostraron ser acordes con las variaciones de la temperatura ambiental. Asimismo, el metabolismo energético se ajustó a los diferentes tipos de estrés calórico que experimentaron las ovejas a través de los meses de verano. Un mecanismo adaptativo fisiológico para evitar la deshidratación fue activado en agosto que fue el mes más cálido. Lo anterior implica que las ovejas de pelo se adaptan bien a la agresión térmica de los veranos cálidos en las regiones desérticas.

Agradecimientos

Este estudio fue financiado en el marco de la convocatoria de apoyo a nuevos PTC, PROMEP 2010. Este trabajo forma parte de la investigación desarrollada por el segundo autor durante sus estudios de doctorado en el ICA-UABC, quien también agradece al CONACYT por la beca de manutención otorgada. 750


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Literatura citada 1.

INEGI. Anuario estadístico y geográfico de Baja California. 2014. http://www.datatur.sectur.gob.mx/ITxEF_Docs/BCN_ANUARIO_PDF.pdf. Consultado 6 Jun, 2017.

2.

Rzedowski J. Vegetación de México. 1.a ed digital. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad, México; 2006. http://www.biodiversidad.gob.mx/publicaciones/librosDig/pdf/VegetacionMx_Con t.pdf. Consultado 6 Jun, 2017.

3.

Marai IFM, El-Darawany AA, Fadiel A, Abdel-Hafez MAM. Physiological traits as affected by heat stress in sheep - A review. Small Ruminant Res 2007;71(1-3):1-12.

4.

Macías-Cruz U, Gastélum MA, Álvarez FD, Correa A, Díaz R, Meza-Herrera CA, et al. Effects of summer heat stress on physiological variables, ovulation and progesterone secretion in Pelibuey ewes under natural outdoor conditions in an arid region. Anim Sci J 2016;87(3):354-360.

5.

Gastélum-Delgado MA, Avendaño-Reyes L, Álvarez-Valenzuela FD, CorreaCalderón A, Meza-Herrera CA, Mellado M, et al. Comportamiento de estro circanual en ovejas Pelibuey bajo condiciones áridas del Noroeste de México. Rev Mex Cienc Pecu 2015;6(1):109-118.

6.

Macías-Cruz U, Avendaño-Reyes L, Álvarez-Valenzuela FD, Torrentera-Olivera NG, Meza-Herrera CA, Mellado M, et al. Crecimiento y características de canal en corderos tratados con clorhidrato de zilpaterol durante primavera y verano. Rev Mex Cienc Pecu 2013;4(1):1-12.

7.

Ross TT, Goode L, Linnerud AC. Effects of high ambient temperature on respiration rate, rectal temperature, fetal development and thyroid gland activity in tropical and temperate breeds of sheep. Theriogenology 1985;24(2):259-269.

8.

Correa MPC, Cardoso MT, Castanheira M, Landim AV, Dallago BSL, Louvandini H, et al. Heat tolerance in three genetic groups of lambs in central Brazil. Small Ruminant Res 2012;104(1-3):70-77.

9.

Romero RD, Montero PA, Montaldo HH, Rodríguez AD, Hernández CJ. Differences in body temperature, cell viability and HSP-70 concentrations between Pelibuey and Suffolk sheep under heat stress. Trop Anim Health Prod 2013;45(8):1691-1696.

10. Macías-Cruz U, López-Baca MA, Vicente R, Mejía A, Álvarez FD, Correa-Calderón A, et al. Effects of seasonal ambient heat stress (spring vs. summer) on physiological

751


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

and metabolic variables in hair sheep located in an arid region. Int J Biometeorol 2016;60(8):1279-1286. 11. Russel AJF, Doney JM, Gunn RJ. Subjective assessment of body fat in live sheep. J Agric Sci 1969;72(3):451-454. 12. Hahn GL. Dynamic responses of cattle to thermal heat loads. J Dairy Sci 1999;82 (Suppl 2):10-20. 13. SAS, SAS/STAT. User’s guide statistics (released 9.2). Inc. Cary, NC, USA; SAS Inst. Inc. 2004. 14. Baêta FC, Souza CF. Ambiência em edificações rurais: conforto animal. 2.a ed. Viçosa, MG: Universidade Federal de Viçosa; 2010. 15. Seixas L, de Melo CB, Tanure CB, Peripolli V, McManus C. Heat tolerance in Brazilian hair sheep. Asian-Australas J Anim Sci 2017;30(4):593-601. 16. Hahn GL, Gaughan JB, Mader TL, Eigenberg RA. Thermal indices and their applications for livestock environments. Livestock energetics and thermal environment management, (Am Soc Agric Biol Engineers, St. Joseph). 2009. 17. Seixas L, de Melo CB, Menezes AM, Ramos AF, Paludo GR, Peripolli V, Tanure CB, Costa Junior JBG, McManus C. Study on environmental indices and heat tolerance tests in hair sheep. Trop Anim Health Prod 2017:49(5):975-982. 18. Kalyan De, Kumar D, Singh AK, Sahoo A, Naqvi SMK. Seasonal variation of physiological response in ewes of farmers flock under semi-arid tropical environment. Biol Rhythm Res 2013;45(3):397-405. 19. Cain IIIJW, Krausman, PR, Rosenstock S, Turner JC. Mechanisms of thermoregulation and water balance in desert ungulates. Wildlife Soc B 2006;34(3):570-581. 20. Taylor CR, Lyman CP. Heat storage in running antelopes: independence of brain and body temperatures. Am J Physiol 1972;222(1):114-117. 21. Alhidary IA, Shini S, Al Jassim RAM, Gaughan JB. Physiological responses of Australian Merino wethers exposed to high heat load. J Anim Sci 2012;90(1):212220. 22. Al-Tamimi HJ. Thermoregulatory response of goat kids subjected to heat stress. Small Ruminant Res 2007;71(1-3):280-285. 23. Mahjoubi E, Amanlou H, Mirzaei-Alamounti HR, Aghaziarati N, Hossein YM, Noori GR, Yuan K, Baumgard. The effect of cyclical and mild heat stress on productivity and metabolism in Afshari lambs. J Anim Sci 2014;92(3):1007-1014.

752


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

24. Mahjoubi E, Hossein YM, Aghaziarati N, Noori GR, Afsarian O, Baumgard. The effect of cyclical and severe heat stress on growth performance and metabolism in Afshari lambs. J Anim Sci 2015;93(4):1632-1640. 25. Indu S, Sejian V, Naqvi MK. Impact of simulated heat stress on growth, physiological adaptability, blood metabolites and endocrine responses in Malpura ewes under semiarid tropical environment. Anim Prod Sci 2015;55(6):766-776. 26. Baumgard LH, Rhoads RP. Effects of heat stress on postabsorptive metabolism and energetics. Annu Rev Anim Biosci 2013;1(7):17-27. 27. Morigny P, Houssier M, Mouisel E, Langin D. Adipocyte lipolysis and insulin resistance. Biochimie 2016;125:259-266. 28. Marai IFM, El-Darawany AA, Fadiel A, Abdel-Hafez MAM. Reproductive performance traits as affected by heat stress and its alleviation in sheep. Trop Subtrop Agroecosys 2008;8(3):209-234. 29. Shehab-El-Deen MAMM, Fadel MS, Soom AV, Saleh SY, Maes D, Leroy JLMR. Circadian rhythm of metabolic changes associated with summer heat stress in highproducing dairy cattle. Trop Anim Health Prod 2010;42(6):1119-1125.

753


http://dx.doi.org/ 10.22319/rmcp.v9i4.4365 Artículo

Identificación molecular y frecuencia de patógenos aislados de mastitis bovina en establos de la Península de Baja California, México Molecular identification and frequency of isolated pathogens from bovine mastitis in dairy herds from Baja California Peninsula, Mexico

Jennifer Brisuela Raygosaa Javier Palacios Torresa, Gilberto López Valenciaa, Sawako Hori-Oshimaa, José Carlomán Herrera Ramíreza, Lourdes Carolina Pujol Manríqueza, Carlos Eliud Angulo Valadezb, Tomás Benjamín Rentería Evangelistaa, Gerardo Enrique Medina Basultoa*

a

Universidad Autónoma de Baja California, Mexicali, Instituto de Investigaciones en Ciencias Veterinarias. Tel: +52 (686)-563-69-06, Ext.131. Km. 3.5 carretera a San Felipe S/N. Fracc. Laguna Campestre. 21386. Baja California, México. b

Centro de Investigaciones Biológicas del Noroeste, La Paz, Baja California Sur, México.

*Autor de correspondencia: gerardom@uabc.edu.mx


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Resumen: La mastitis bovina es una enfermedad de alto impacto económico para la industria lechera, y algunos de los agentes etiológicos que la provocan también son de interés en el ámbito de salud pública. El objetivo de este estudio fue identificar las especies bacterianas aisladas de casos de mastitis bovina, provenientes de siete establos lecheros ubicados en la Península de Baja California. Se tomaron 316 muestras de leche de igual número de cuartos, pertenecientes a 186 vacas en producción que a la prueba de California tuvieron reacción positiva. Se obtuvieron 182 aislados bacterianos de 163 cuartos pertenecientes a 106 vacas y se identificaron por PCR y secuenciación, dando un total de 20 especies diferentes. Además, se obtuvieron las frecuencias relativas, siendo los agentes causales más frecuentes: Staphylococcus aureus (58.8 %), Streptococcus agalactiae (13.2 %), Staphylococcus chromogenes (8.8 %), Escherichia coli (2.2 %) y Streptococcus uberis (2.2 %). El 6.13 % (10/163) de los cuartos con aislamiento presentaron infección mixta, siendo la combinación más frecuente S. aureus con S. agalactiae 30 % (3/10). Estos resultados indican una alta frecuencia y diversidad de patógenos de carácter contagioso y ambiental que provocan mastitis en ganado lechero en la región de estudio, siendo algunos de importancia para la salud pública. Los resultados observados, muestran que las causas de la mastitis son diversas, por lo que es indispensable mejorar las medidas de control y prevención, pero también establecer el diagnóstico de rutina para lograr controlar la mastitis. Palabras clave: Mastitis bovina, Identificación molecular, Staphylococcus spp., Streptococcus spp.

Abstract: Bovine mastitis is a disease of high economic impact for the dairy industry and some of the etiological agents that cause it are also of interest in the field of public health. The purpose of study was to identify the bacterial causes of bovine mastitis from seven dairy farms located in the Baja California Peninsula. A total of 316 milk samples were collected from the same number of quarters belonging to 186 cows in production that tested positive for California Mastitis test. It was obtained 182 bacterial isolates from 163 quarters belonging to 106 cows and were identified by PCR, giving a total of 20 different species. Isolates were identified using specific oligonucleotides for the major mastitis pathogens and with universal oligonucleotides for the 16S ribosomal DNA gene with subsequent sequencing for those that did not amplify with the specific oligonucleotides and relative frequencies were obtained. The most frequent causal agents were: Staphylococcus aureus (58.8 %), Streptococcus agalactiae (13.2 %), Staphylococcus chromogenes (8.8 %), Escherichia coli (2.2 %) and Streptococcus uberis (2.2 %). A mixed infection was found in 6.13 % (10/163) of the quarters, being the most frequent combination S. aureus plus S. agalactiae 30 %

755


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

(3/10). These results indicate a high frequency and diversity of contagious and environmental pathogens causing mastitis in dairy cattle in the region of study, being some of importance for public health. The results show that the causes of mastitis are diverse, so it is essential to improve control and prevention measures, but also to establish a routine diagnosis to control mastitis. Key words: Bovine mastitis, Molecular identification, Staphylococcus spp., Streptococcus spp.

Recibido: 13/02/2017 Aceptado: 09/11/2017

Introducción

La mastitis bovina es una inflamación de uno o varios cuartos mamarios que se debe con mayor frecuencia a una infección intramamaria (IIM)(1). La severidad de la inflamación se puede clasificar como subclínica o clínica. La mastitis subclínica es difícil de detectar debido a la ausencia de cualquier signo visible, pero tiene un alto impacto económico(2). El costo de esta enfermedad se ha estimado hasta en 320 dólares por vaca por lactación, siendo aproximadamente el 70 % de estas pérdidas por la reducción en la producción de leche(3). Un método eficaz en campo para detectar mastitis subclínica en un establo es la prueba de California para mastitis (CMT) basada en la cantidad de células somáticas presentes en la leche(4). Se han identificado más de 135 especies de bacterias causantes de mastitis(5), las cuales se clasifican como microorganismos contagiosos y ambientales de acuerdo a su reservorio primario y al modo de transmisión(6). Los patógenos contagiosos incluyen Streptococcus agalactiae, Staphylococcus aureus, Mycoplasma spp., Corynebacterium bovis y Staphylococcus coagulasa negativos (SCN)(7). Los patógenos contagiosos sobreviven en la ubre de la vaca, donde la leche es la principal fuente de infección primaria para las vacas sanas, y ocurre durante la ordeña(8). Los patógenos ambientales se encuentran comúnmente en los corrales y bebederos e incluyen especies como Escherichia coli, Klebsiella spp. y Streptococcus spp., entre otras. La combinación de alta humedad y materia fecal

756


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

incrementa el riesgo de exposición de la ubre a patógenos ambientales(1). Al identificar la especie que está provocando esta condición, se puede deducir y reducir la fuente de infección, diseñar programas de prevención y control, y orientar una estrategia terapéutica. Por otra parte, la leche y los productos lácteos elaborados con leche proveniente de vacas con mastitis, pueden provocar enfermedades en los seres humanos que los consumen(9); de hecho, algunas especies bacterianas aisladas de vacas con mastitis se consideran zoonóticas, tales como S. aureus, Streptococcus spp., E. coli, Leptospira spp., Mycobacterium bovis, Trueperella pyogenes, Campylobacter jejuni, Yersinia pseudotuberculosis(10) y Pasteurella multocida(11). En Baja California (BC) existe una población de 43,300 bovinos de leche con una producción de 158 millones de litros anuales, en tanto en Baja California Sur (BCS) existen 14,200 bovinos de leche con una producción de 42 millones de litros anuales(12); sin embargo, no se han realizado investigaciones documentadas sobre los agentes que provocan mastitis bovina, a pesar de su importancia nacional en la producción de leche y el hecho de que la prevalencia de mastitis es relativamente alta(13). Considerando todo lo anterior, en el presente trabajo se identificaron las especies bacterianas aisladas de vacas en producción con mastitis, mediante técnicas moleculares, y se determinó su frecuencia relativa en siete establos lecheros participantes, ubicados en las principales zonas productoras de la Península de Baja California, México.

Material y Métodos

Ubicación del estudio

Se muestrearon siete establos lecheros tecnificados representativos de las principales regiones productoras de leche; cuatro del estado de Baja California y tres del estado de BCS (Figura 1), los cuales se identificaron con la letra A hasta la letra G (A-D, Baja California; E-G, Baja California Sur), con un total de 1,302 vacas en lactación (Cuadro 1).

757


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Figura 1: Distribución de los establos muestreados en la zona de estudio

*Los círculos con contorno en puntos indican las principales cuencas lecheras de la península, los círculos con contorno contínuo representan los establos muestreados.

Cuadro 1: Identificación de establos, número de animales en lactación y su procedencia Establo A B C D E F G

Vacas en producción 46 600 371 218 24 10 33

758

Municipio

Estado

Mexicali Mexicali Ensenada Tecate Comondú Comondú La Paz

Baja California Baja California Baja California Baja California Baja California Sur Baja California Sur Baja California Sur


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Criterio de inclusión y recolección de muestras

Se tomaron muestras de leche siguiendo la metodología del Consejo Nacional de Mastitis de los Estados Unidos(14) de los cuartos afectados de todas las vacas en producción que tuvieron grado 2 o mayor a la prueba de California (CMT) utilizando el reactivo Mastitest® (México).

Cuestionario sobre prácticas de ordeña

Se recabó información relevante de cada establo mediante la aplicación de un cuestionario, con énfasis en el protocolo de ordeña que incluyó: uso de guantes, cambio de toallas de papel o tela por cuarto, pre-sello, post-sello y secuencia de ordeña.

Análisis bacteriológico

Se cultivó 0.1 ml de cada muestra de leche en cajas de Petri agar Columbia con sangre de bovino al 5% y se incubó a 35 °C por 24 a 48 h(1). La muestra con al menos 10 UFC (unidades formadoras de colonia) con una misma morfología se consideró cultivo positivo a IIM(15), la muestra con distintas especies bacterianas con al menos 10 UFC cada una, se consideró IIM mixta, y la muestra que tuviera menos de 10 UFC se consideró cultivo negativo(1). Para determinar diferencias entre los aislados se consideró morfología colonial, tipo de hemólisis, tinción Gram y prueba de catalasa(16). Finalmente, los aislados obtenidos se cultivaron en 5 ml de caldo Todd Hewitt e incubados a 35 °C por 12 h a 200 rpm, y se hicieron tres alícuotas de 1 ml con glicerol al 10% para su almacenamiento a -80 °C y posterior identificación molecular.

759


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Análisis estadístico

De acuerdo a los datos obtenidos, se utilizó el software Statistix 9®, incluyendo la estimación de Ji cuadrada de Pearson para establecer la asociación entre las proporciones de muestras de leche que tuvieron cultivo positivo entre los dos estados y entre establos, además, se calculó la magnitud de asociación (odds ratio, OR) con un intervalo de confianza de 95% estableciendo un valor de P<0.05 para indicar significancia estadística.

Extracción de ADN

Se extrajo ADN utilizando el juego de reactivos DNeasy Blood & Tissue (Qiagen®, USA). Se realizó la extracción como recomienda el proveedor, adicionando 5 µl de lisostafina de S. staphylolyticus 1 mg/ml para lisar bacterias del género Staphylococcus y 10 µl de mutanolisina de Streptomyces globisporus ATCC 21553 a 1,000 U/ml para lisar bacterias del género Streptococcus. Una vez obtenido el ADN se revisó su integridad por electroforesis en gel de agarosa al 1% y se cuantificó por espectrofotometría A260nm/A280nm (Genesys 10uv Thermo Spectronic, MA USA) y se almacenó a -20 °C.

Identificación molecular

Se realizó PCR a los aislados obtenidos siguiendo dos metodologías; en la primera se identificaron S. aureus, S. agalactiae, Streptococcus dysgalactiae, Streptococcus

760


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

parauberis y Streptococcus uberis, mediante la técnica de PCR punto final y en la segunda se identificaron E. coli, y cinco SCN: S. chromogenes, S. haemolyticus, S. epidermidis, S. sciuri y S. simulans, mediante la técnica de PCR Multiplex también en tiempo final. En ambos casos, se utilizaron protocolos previamente publicados por otros autores y sin modificaciones(17,18). Por último, los productos de PCR se analizaron por electroforesis en gel de agarosa 1.5% en buffer TAE 1X (Ph 8.0; 0.04 M Tris-acetato, 0.001 M EDTA), teñidos con 0.5 μg de bromuro de etidio/ml y corridos a 120 V por 1 h. Se utilizó un marcador de peso molecular de 100 pb (Promega, EUA.) y el gel se visualizó y fotografió en un sistema de fotodocumentación (UVP, ALE.). A los aislados que no pudieron identificarse por las pruebas de PCR mencionadas, se les realizó PCR punto final del gen ribosomal 16S, de acuerdo a Negoro et al(19) y se mandaron a secuenciar utilizando esos mismos oligonucleótidos mediante el método de secuenciación de ciclo (terminación de cadena dideoxi/secuenciación de ciclo), en un equipo ABI 3730XL (Quimera, Biolabs, México). Las secuencias obtenidas se introdujeron en la base de datos online GenBank NCBI (National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov) en el programa BLAST® para compararlas con las secuencias depositadas y determinar la especie, el criterio fue que la secuencia tuviera un mínimo de 98.5 % de identidad en comparación con la secuencia tipo o cepa de referencia, como ya fue descrito(20).

Resultados

Se colectaron 316 muestras de leche de 186 vacas con mastitis subclínica. Se aislaron bacterias en el 51.5 % (163/316) de las muestras, correspondientes a 106 animales (Cuadro 2). Se determinó que existe una diferencia estadísticamente significativa entre las proporciones de las muestras de leche que tuvieron cultivo positivo en Baja California (130/270) y BCS. (33/46), presentándose 2.7 veces más probabilidad de que una muestra tomada en BCS tenga cultivo positivo, que una muestra tomada de establos en Baja California (P=0.003, IC 95%, 1.3-5.4). A nivel establo, el establo G, tiene 20 veces más probabilidad de que una muestra de leche tenga cultivo positivo con respecto al tomado como referencia.

761


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 2: Frecuencia y magnitud de asociación (OR) entre las muestras que presentaron aislamiento, tomando como referencia el establo con menor proporción de aislamientos Establo A B C D E F G Total

Muestras CMT+ (n) 27 46 104 93 6 17 23 316

Muestras con aislamiento 13 23 26 68 2 11 20 163 (51.5%)

Muestras sin aislamiento 14 23 78 25 4 6 3 153 (48.5%)

OR

95% IC

P

2.8 3.0 Referencia 8.2 1.5 5.5 20

1.1-6.7 1.4-6.2

0.02 0.002

4.3-15.4 0.2-8.67 1.8-16.3 5.5-72.8

0 1 0.001 0

CMT= prueba de California para mastitis.

Durante el proceso de ordeña, ninguno de los establos cumplía completamente con buenas prácticas de ordeña para evitar infecciones intramamarias; sin embargo, por lo menos cumplían con alguna de ellas. Así, se observó, que por ejemplo el establo D, cumplía con la mayoría de las buenas prácticas analizadas en el estudio, sin embargo la proporción de aislados por muestra positiva a mastitis fue alta. En el establo C, se observó una baja proporción de aislados, aún a pesar que no llevaban a cabo todas las buenas prácticas durante la ordeña; aunque se llevaba una secuencia al ordeñar, dejando a las vacas enfermas a lo último, lo que sugiere que el ordeñar las vacas con mastitis al final, puede ser un factor importante para evitar la diseminación de la enfermedad. Los establos E, F y G, llevaban a cabo pocas actividades para evitar la diseminación de la mastitis, observándose en los establos F y G una alta proporción de aislamientos (Cuadro 3).

Cuadro 3. Protocolo de ordeña por establo Actividad Uso de guantes Cambio de toallas de papel o tela Pre-sello Post-sello Secuencia de ordeña

A + + + -

762

B + + -

C + + +

D + + + + -

E + -

F + -

G +


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

Las especies aisladas mĂĄs frecuentes fueron: S. aureus 59 % (107/182), S. agalactiae 13 % (24/182), S. chromogenes 9 % (16/182), E. coli 2 % y S. uberis 2 % (4/182) (Cuadro 4).

Cuadro 4: Especies identificadas y su frecuencia relativa Especies

Numero de aislados (%)

S. aureus* S. agalactiae* S. chromogenes* E. coli S. uberis

107 (58.8) 24 (13.2) 16 (8.8) 4 (2.2) 4 (2.2)

S. saprophyticus* S. dysgalactiae Streptococcus suis P. multocida Klebsiella pneumoniae Proteus vulgaris Bacillus cereus S. agnetis* Pseudomonas aeruginosa Enterobacter hormaechei Klebsiella oxytoca Proteus mirabilis Enterococcus faecium Bacillus licheniformis Bacillus altitudinis

3 (1.6) 3 (1.6) 3 (1.6) 3 (1.6) 3 (1.6) 2 (1.1) 2 (1.1) 1 (0.5) 1 (0.5) 1 (0.5) 1 (0.5) 1 (0.5) 1 (0.5) 1 (0.5) 1 (0.5)

Total de aislados

182 (100) *Especies contagiosas

El 83 % de los aislados (151/182) fueron clasificados como especies contagiosas, en tanto el resto fueron especies ambientales (Cuadro 5). De la misma manera, el 91.2 % de los aislados fueron bacterias Gram positivas y el resto Gram negativas.

763


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 5: Frecuencia relativa de las especies contagiosas y ambientales aisladas por establo (%) Establo Especies

Contagiosas Ambientales

A

B

11 (68.75) 5 (31.25)

17 (74.0) 6 (26.0)

C 24 (85.7) 4 (14.3)

D

E

F

68 (90.65) 7 (9.35)

1 (50.0) 1 (50.0)

9 (64.3) 5 (35.7)

G 21 (87.5) 3 (12.5)

Total 150 (83.0) 30 (17.0)

Del total de cuartos con cultivo positivo, el 6.1 % (10/163) presentaron una infección mixta. Las combinaciones más frecuentes fueron S. aureus con S. agalactiae (30 %) y S. aureus con S. chromogenes (20 %). El 70 % de las infecciones mixtas fueron provocadas por combinaciones entre agentes contagiosos.

Discusión

En el presente trabajo se obtuvo cultivo positivo en el 51.5 % de las muestras, en tanto, en un estudio realizado en Egipto(5), se obtuvieron aislados en el 96 % de sus muestras; la discrepancia en estos datos, además de las condiciones medioambientales, se puede deber a que en el trabajo mencionado se pre-incubaron las muestras hasta por 24 h a 37 ºC y no se utilizó un criterio para considerar un cultivo positivo, lo que pudo predisponer al elevado porcentaje de aislamiento que tuvieron por muestra. Una razón por la cual en el presente estudio solo se obtuvo aislamiento bacteriológico en el 51.5 % de las muestras, pudo ser que en los casos de cultivos negativos, la mastitis fue provocada por microorganismos no cultivables mediante los métodos de rutina aquí utilizados (p. ej. Mycoplasma spp, Mycobacterium bovis, Leptospira spp. y Brucella spp.), o debido a causas no infecciosas, tales como traumatismo, altas temperaturas o estrés en los animales. En los establos muestreados en Baja California Sur se encontró que existe más riesgo de que una muestra positiva a CMT tenga cultivo positivo con respecto a los establos muestreados en Baja California, lo cual se puede deber a las medidas deficientes en el protocolo de ordeña en dichos establos, o a una mayor frecuencia de bacterias no cultivables en los establos muestreados en el estado de Baja California.

764


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Todas las especies identificadas en el presente estudio, excepto S. suis y Enterobacter hormaechei, se han aislado de casos de mastitis en investigaciones realizadas en otras partes del mundo y, en algunos casos los resultados han sido muy similares; así por ejemplo en un estudio realizado en Suecia en establos pequeños y tecnificados(21), del 31 % de los cuartos se aisló S. aureus, seguido por SCN con 27 %, S. dysgalactiae 15 %, S. uberis 14 % y E. coli 4.8 %. En otro estudio(5), los cuatro agentes principales fueron los mismos, sólo que E. coli fue el agente más frecuente con 25.5 %, seguido de S. aureus con 14.8 % y SCN y S. agalactiae, ambos con 12.7 %; el 15 % de las muestras provenían de vacas con mastitis clínica donde generalmente las bacterias coliformes son las principales causales. En un estudio realizado en establos familiares de Guanajuato, México(22), también se identificaron especies bacterianas aisladas de mastitis mediante secuenciación del gen 16S rDNA, de 11 muestras de leche, de ellas, cinco muestras presentaron SCN, dos muestras presentaron Streptococcus spp. y una S. aureus, mostrando resultados muy similares a los del presente trabajo. En los establos muestreados en Baja California Sur, se encontró que no post-sellaban, lo que pudo favorecer una alta incidencia de agentes ambientales con respecto a los establos muestreados en Baja California, lo cual concuerda con lo encontrado en un estudio realizado en Guerrero, México(23), en donde el 97.5 % de los aislados fueron Enterobacterias, presentando los establos malas condiciones de higiene tanto en los corrales como en el protocolo de ordeña, ya que no pre-sellaban, post-sellaban, ni secaban pezones. En el establo D, fue muy alta la proporción de S. aureus, aun llevando buenas prácticas de ordeña; sin embargo, no contaban con un protocolo en el que se contemplara primero ordeñar a las vacas sanas y después a las enfermas, lo que pudo provocar la diseminación de la enfermedad por el equipo o material utilizados. El establo A, de donde se aisló S. suis en dos animales, se encuentra ubicado a 30 m de un área de producción porcina, lo que sugiere que algún trabajador o material pudo haber actuado como diseminador. Al igual que S. suis, las demás especies que pueden provocar enfermedades en humanos transmitidas por ingestión de leche contaminada(24,25,26) que se aislaron en este estudio fueron: S. aureus, S. agalactiae, B. cereus, E. coli, P. aeruginosa, Klebsiella spp, P. mirabilis y Enterobacter hormaechei. En el presente estudio se observó una baja frecuencia de infecciones mixtas (6.1 %), siendo S. aureus con S. agalactiae la más común (30 %). En un estudio similar(5), se observaron infecciones mixtas en un 35.8 % de los cuartos con aislamiento, donde la combinación más común fue S. aureus con E. coli (18 %). En ambos estudios las dos especies aisladas más frecuentes, presentaron la mayoría de las combinaciones implicadas en las infecciones mixtas.

765


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Conclusiones e implicaciones

El presente trabajo es el primer reporte en Baja California, en el cual se hayan aislado e identificado, agentes etiológicos por medio de técnicas moleculares a partir de muestras de leche de vacas con mastitis, lo cual permitió la identificación de 20 especies bacterianas, 12 de las cuales no habían sido reportadas en México. Nueve de las especies identificadas son consideradas zoonóticas, lo cual representa un riesgo para el personal que está en contacto directo con los animales o que consume leche y subproductos no pasteurizados en la región. En general, las prácticas durante la ordeña fueron deficientes en los establos participantes, lo cual se vio reflejado en una alta diversidad y proporción de casos de mastitis debidas a agentes contagiosos, por lo que es importante su implementación y la identificación de agentes etiológicos, para llevar a cabo las medidas de control y prevención acordes al tipo de agente presente en cada caso, y así disminuir la incidencia de esta enfermedad.

Agradecimientos

A los productores de los establos muestreados por su participación y accesibilidad, A CONACyT por el apoyo a becarios de posgrado, a las Convocatorias internas de investigación de la UABC y al apoyo técnico de parte de Gerardo Felipe, Fernanda Bermúdez, Elizama Ponce, Tomás Cárdenas y José Luis Rodríguez.

Literatura citada 1.

Ferguson JD, Azzaro G, Gambina M, Licitra G. Prevalence of mastitis pathogens in Ragusa, Silicy, from 2000 to 2006. J Dairy Sci 2007;90(12):5798-5813.

2.

Viguier C, Arora S, Gilmartin N, Welbeck K, O’Kennedy R. Mastitis detection: current trends and future perspectives. Trends Biotechnol 2009;27(8):486-493.

766


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

3.

Zhao X, Lacasse P. Mammary tissue damage during bovine mastitis: Causes and control. J Anim Sci 2008;86(1):57-65.

4.

Lam TJ, Olde R, Sampimon OC, Smith H. Mastitis diagnostics and performance monitoring: a practical approach. Irish Vet J 2009;62(Suppl 1):34-39.

5.

Sayed HR, Salama SS, Soliman TR. Bacteriological evaluation of present situation of mastitis in dairy cows. Global Veterinaria 2014;13(5):690-695.

6.

Ruegg PL. Managing mastitis and producing quality milk. In: Wiley-Blackwell. Dairy production medicine. 1rst ed. Chichester, West Sussex, UK: John Wiley & Sons, Inc; 2011:207-232.

7.

Quinn PJ, Markey BK, Carter ME, Donnelly WJ, Leonard FC. Microbiología y enfermedades infecciosas veterinarias. 1a ed. Zaragoza, España: Acribia; 2002.

8.

Valero-Leal K, Valbuena E, Chacón F, Olivares Y, Castro G, Briñez W. Patógenos contagiosos y ambientales aislados de cuartos mamarios con mastitis subclínica de alto riesgo en tres fincas del estado Zulia. Rev Cientif FCV-LUZ 2010;20(5):498-505.

9.

Sztachańska M, Barański W, Janowski T, Pogorzelska J, Zduńczyk S. Prevalence and etiological agents of subclinical mastitis at the end of lactation in nine dairy herds in North-East Poland. Pol J Vet Sci 2016;19(1):119-124.

10. McDaniel CJ, Cardwell DM, Moeller RB, Gray GC. Humans and cattle: A review of bovine zoonoses. Vector-Borne Zoonot 2014;14(1):1-19. 11. Kotton CN, Weinberg AN. Zoonoses. In: Mandell D, et al. Principles and practice of infectious diseases. 7th ed. London, England: Churchill Livingstone; 2010. 12. SIAP. Servicio de Información Agroalimentaria y Pesquera. Población ganadera bovino leche 2013. México. 2016. 13. Palacios TJ, Brisuela RJ, Oshima S, López VG, Herrera RJC, Rentería ETB, et al. Identificación y perfil de resistencia a antibióticos de S. aureus en casos de mastitis bovina en establos lecheros de la Península de Baja California. Reunión internacional sobre producción de carne y leche en climas cálidos. 2016:320-323. 14. Oliver SP, Gonzalez RN, Hogan JS, Jayarao BM, Owens WE. Microbiological procedures for the diagnosis of bovine udder infection and determination of milk quality. 4th ed. Wisconsin, USA: National Mastitis Council Inc; 2004. 15. Abrahmsén M, Persson Y, Kanyima BM, Båge R. Prevalence of subclinical mastitis in dairy farms in urban and peri-urban areas of Kampala, Uganda. Trop Anim Health Prod 2014;(46):99-105.

767


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

16. MacFaddin JF. Pruebas bioquímicas para la identificación de bacterias de importancia clínica. 3a. ed. Buenos Aires, Argentina: Médica Panamericana; 2003. 17. Riffon R, Sayasith K, Khalil H, Dubreuil P, Drolet M, Lagacé J. Development of a rapid and sensitive test for identification of major pathogens in bovine mastitis by PCR. J Clin Microbiol 2001;39(7):2584-2589. 18. Shome BR, Das-Mitra S, Bhuvana M, Krithiga N, Velu D, Shome R, et al. Multiplex pcr assay for species identification of bovine mastitis pathogens. J Appl Microbiol 2011;(111):1349-1356. 19. Negoro E, Iwasaki H, Tai K, Ikegaya S, Takagi K, Kishi S, et al. Utility of PCR amplification and DNA microarray hybridization of 16S rDNA for rapid diagnosis of bacteremia associated with hematological diseases. Int J Infect Dis 2012;(17):e271e276. 20. Bou G, Fernández-Olmos A, García C, Sáez-Nieto JA, Valdezate S. Métodos de identificación bacteriana en el laboratorio de microbiología. Enferm Infec Micr Cl 2011;29(8):601-608. 21. Persson Y, Nyman AJ, Grönlund-Andersson U. Etiology and antimicrobial susceptibility of udder pathogens from cases of subclinical mastitis in dairy cows in Sweden. Acta Vet Scan 2011;(53):36. 22. León-Galván MF, Barboza-Corona JE, Lechuga-Arana AA, Valencia-Posadas M, Aguayo DD, Cedillo-Pelaez C, et al. Molecular detection and sensitivity to antibiotics and bacteriocins of pathogens isolated from bovine mastitis in family dairy herd of central Mexico. Biomed Res Int 2015;(2015):615153. 23. Olivares-Pérez J, Kholif AE, Rojas-Hernández S, Elghandour YMMM, Salem MAZ, Zaragoza BA. Prevalence of bovine subclinical mastitis, its etiology and diagnosis of antibiotic resistance of dairy farms in four municipalities of a tropical region of Mexico. Trop Anim Health Pro 2015;(47):1497-1504. 24. CDC. Centers for Disease Control and Prevention. Estimates of Foodborne Illness in the United States. USA. 2011. 25. Dhanashekar R, Akkinepalli S, Nellutla A. Milk-borne infections. An analysis of their potential effect on the milk industry. GERMS 2012;2(3):101-9. 26. Jackson EE, Flores JP, Fernández-Escarín E. Reevaluation of a suspected Cronobacter sakazakii outbreak in Mexico. J Food Prot 2015;78(6):1191-1196.

768


http://dx.doi.org/ 10.22319/rmcp.v9i4.4508 Artículo

Immunolocalization of VirB11 protein in the Anaplasma marginale outer membrane and its reaction with bovine immune sera Inmunolocalización de la proteína VirB11 en la membrana externa de Anaplasma marginale y su reacción con sueros inmunes de bovino

América Ivette Barrera Molinaa,b Raquel Cossío Bayúgarb José A. Gutiérrez-Pabelloa Ángel Tolentino Tello Lópezc Jesús Francisco Preciado de la Torreb Sergio Darío Rodríguez Camarillob*

a

Universidad Nacional Autónoma de México. UNAM-FMVZ. Av. Universidad 3000, Edificio A, Delegación Coyoacán, Col. Ciudad Universitaria, 04510 Ciudad de México, México. b

INIFAP-Centro de Nacional de Investigación Disciplinaria en Parasitología Veterinaria. Tel: 52 800 088 2222 ext.80409 +52 777 3192850 ext. 125. CIVAC, Carr. Cuernavaca Cuautla No 8534, Col. Progreso, 62550, Jiutepec, Mor. México. c

Instituto Nacional de Salud Pública (INSP). Cuernavaca, Mor. México.

Autor de correspondencia: rodriguez.sergio@inifap.gob.mx

Abstract Type IV secretion system is composed by a group of proteins associated with substrate transfer between bacteria and eukaryotic organisms. VirB11 is a protein of this system and,


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

in A. marginale it induces partial protection in cattle immunized with external membrane fragments of the rickettsia. The objectives of this study were: to determine the conservation rate of VirB11 among different Mexican isolates and to corroborate its cellular localization on the outer membrane of A. marginale. Nucleotide and amino acid sequence alignment of virB11 from nine Mexican isolates showed 100 % identity. Bovine sera from both naturally and experimentally infected cattle reacted against a multiple antigenic peptide (MAP-VirB11) designed based on a B-type epitope present in VirB11. In addition, MAP-VirB11-rabbit immune sera reacted with native VirB11 by ELISA and western blot in rickettsial extracts and on the surface of bovine infected erythrocytes by indirect immunofluorescence and the localization of VirB11 protein was determined on the outer surface of A. marginale initial bodies. Key words: Anaplasma marginale, Type 4 secretion system, Multiple antigenic peptide, MAP, VirB11.

Resumen: El sistema de secreción tipo IV es un grupo de proteínas asociadas a la transferencia de sustratos entre bacterias y organismos eucariontes. VirB11 es una proteína de este sistema y en A. marginale induce protección parcial en bovinos inmunizados con fragmentos de membrana externa de la rickettsia. Los objetivos del presente trabajo fueron, determinar el índice de conservación de la proteína VirB11 entre diferentes aislados de México y, corroborar su localización celular en la membrana externa de A. marginale. El alineamiento de las secuencias de nucleótidos de virB11 de nueve aislados mexicanos mostró un 100 % de identidad. Sueros de bovinos infectados de manera natural y experimental, reaccionaron contra un péptido antigénico múltiple (MAP-VirB11) diseñado a partir de un epítopo tipo B presente en VirB11. Adicionalmente, sueros de conejos inmunizados con MAP-VirB11 reaccionaron con VirB11 nativa por ELISA y western blot en extractos de la rickettsia y en la superficie de eritrocitos infectados de bovinos por inmunofluorescencia indirecta y, se logró determinar la localización de la proteína VirB11 sobre la superficie exterior de cuerpos iniciales de A. marginale. Palabras clave: Anaplasma marginale, Sistema de Secreción 4, Péptido antigénico múltiple (MAP), MAPVirB11.

Received 03/06/2017 Accepted 03/08/2017

770


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Introduction

Bovine anaplasmosis causes annual economic losses estimated in up to be over $300 million per year, whereas in Latin America those losses were calculated to be approximately $800 million(1,2). The causal agent is the intraerythrocytic rickettsia Anaplasma marginale(3) and is biologically transmitted by Rhipicephalus and Dermacentor ticks(4,5). To date, there are no commercial vaccines available. Wide antigenic diversity and genetic variability are the two major obstacles in the design of immunogens(6). Major surface membrane proteins (MSP’s) induced immunity is curtailed by wide genetic diversity and variability of the rickettsia (7-10). Type four secretion system (T4SS), VirB7, VirB9, VirB10, ViB11 and VirD4 proteins, together with some outer membrane proteins (OMP’s) of A. marginale have been evaluated for their immunogenic potential(11) and have been considered better alternatives to MSP’s candidates. VirB11 shows an ATPase-like enzymatic activity in Agrobacterium tumefaciens and maintains an ATP-binding Walker-A domain, essential for its ATPase activity(12). Immunization with cross-linked A. marginale membrane fragments induced an antibody response against several T4SS proteins including VirB11; this immunization also induced a T cell response against the membrane fragments and their respective recombinant proteins(13). It is not yet known however if antibodies generated by natural or experimental infection recognize these proteins, or whether the protein is exposed on the outer surface of the membrane of A. marginale. Studies of antigenic presentation and immune response have generated deep interest in antigenic peptide-based tools as a newer strategy for inducing immunity. In this sense, multiple antigenic peptides (MAP’s) are highlighted as they allow the combination of epitopes of interest in the same molecular construction, which favors an increase in the sensitivity and specificity of the immune response(14). Based on the importance attributed to VirB11, this work was focused in verifying if the gene is conserved in Mexican strains of A. marginale, its identification and location on the outer surface of initial bodies and testing if antibodies induced by natural or experimental infection react with a multiple antigenic peptide containing one B-cell epitope.

771


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Material and methods

Infected cattle

Five 12-mo old Bos taurus-cross steers were purchased from a local breeder in the Municipality of Cuauhtémoc, west-central Chihuahua State, Mexico which is classified as tick-free by the Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria (http://www.gob.mx/senasica/documentos/34495). These steers were certified free of tuberculosis and brucellosis by federally certified laboratories. The animals were kept tickfree, and were free of A. marginale as certified by endpoint nPCR for msp5 gene. The CENID-PAVET laboratories and stalls are located on the outskirts, within the city limits of the small urban area of Progreso, in the Jiutepec Municipality of the state of Morelos, central Mexico. The quarters are free of ticks. Tick treatment is required for animals entering these quarters and all animals housed in outdoor stalls are periodically sprayed for fly control. All animals used in these experiments were housed at the Cattle Isolation Unit of the CENIDPAVET, a tick and fly-proof confinement stall, which includes a double door, screened windows and an electronic indoor insect killer. Steers 1 – 5 were infected under non-life-threatening conditions for this experiment and are maintained as antibody donors for the following A. marginale strains as follows: Steer 1, Yautepec Mor.; steer 2, with Veracruz, Tizimín, and Yautepec strains; steers 3, 4, and 5 were infected with Tlapacoyan-1, Tlapacoyan-2 and Pt. de Ixtla strains, respectively. Steers 6 and 7 acquired infection under natural conditions and harbor Tlapacoyan-1 and Tlapacoyan-2 strains respectively; infected blood and serum samples from these two steers are kept under storage at -70 ºC.

772


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Microorganisms

Nine Mexican A. marginale strains from different locations were used according to their differences in repeats in the Msp1a repeats(15) as observed in Table 1.

Table 1: Mexican strains from which virB11 was sequenced Msp1a variable repeats

Numeric ID

Denomination according to municipality and State

Mex-28-037-01

Soto la Marina, Tamaulipas

Mex-28-037-02

Guayaboso, Tamaulipas

28 29 74 29 M F

Mex-14-010-01

Atitalaquia, Hidalgo

Mex-31-096-01

Tizimín, Yucatán

TCBBCB

Mex-31-089-01

Ticul, Yucatán

FMM

Mex-30-184-03

Tlapacoyan-2, Veracruz

73    

Mex-30-130-01

Playa Vicente, Veracruz

TCBBCBC

Mex-01-001-01

Aguascalientes, Aguascalientes

4 9 10 11 9

Mex-17-017-01

Puente de Ixtla, Morelos

12 13 14

57 13 18 57 13 18

Anaplasma marginale strains were selected as for their geographic origin and differences in Msp1a repeats

Purification of Anaplasma marginale initial bodies

A. marginale initial bodies were purified from frozen bovine infected blood as described(15) with modifications, briefly: once initial bodies were extruded form the erythrocytes, the material was separated through a 30 ml preformed linear 0-60% sucrose density gradient. 1.5 ml of the homogenized pellet was carefully layered on top of the preformed gradient and centrifuged at 7,000 xg for 30 min in a fixed angle rotor. After centrifugation, the intermediate phase containing the initial bodies (IB) was carefully recovered. IB were suspended in Puck’s saline in 30 mL tubes and centrifuged at 15,000 xg for 15 min at 4°C, twice in order to remove the sucrose. The supernatant was then removed and the pellet was 773


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

suspended in 500 μl of Puck’s saline. The protein in the samples was quantitated by the Bradford method(16), using bovine serum albumin (BSA) as standard. The IB were used immediately or stored at -70 °C, until use.

Cloning and sequencing of A. marginale virB11 gene

virb11 gene was amplified by PCR from genomic DNA (UltraClean® BloodSpin®DNA, MOBIO Laboratories Inc) obtained from cryopreserved (-70 ºC) blood, using Primers (F5’ GTGTTGTGTGCGCATATG 3’, R5’ CATTGCCTTGTGAACATTTAGTG 3’) under the following amplification program: 95 °C for 5 min, followed by 30 cycles at 95 °C for 45 sec, 56 °C for 1 min, 72 °C for 45 sec, with a final extension step at 72 °C for 10 min, using GoTaq® Green Master Mix 2X commercial mix (Promega, Madison, WI, USA). PCR products were separated by electrophoresis on 1% agarose gels and, as reference, the 1 kb Plus DNA Ladder (Invitrogen) weight marker was used; the image was captured with a KODAK Gel Logic 1500 System Picture system. PCR products were purified using a Wizard® SV Gel and PCR Clean-Up System commercial kit, and resuspended in 50 μl of water. One (1) μl of the product of each gene was cloned in a cloneJET PCR Cloning Kit (8878 Thermo-Scientific), and the mixture used for the transformation of competent Top10 E. coli cells. Plasmids from each gene were sequenced using T7 promoter forward and reverse primers, respectively. Sequencing was performed at the Biotechnology Institute, UNAM.

Bioinformatics analysis

The comparative identity among sequenced PCR products was determined with ClustalW(17), using the putative virB11 gene of the A. marginale St. Maries strain as reference. The consensus sequences for each gene were translated into amino acids and used in the bioinformatics analysis. The prediction of the exposed extracellular domains was made with TMHMM program(18). The ProtScale program was used for prediction of hydrophobic 774


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

regions(19) and the presence of linear type B epitopes was predicted with BCEPred, ABCPred and IEDB(20,21) programs all available on-line.

Multiple antigenic peptide (MAP) design

Based on the analysis of linear Type B epitopes a multiple antigenic peptide was designed considering the highest scores for the following characteristics: antigenicity, hydrophobicity, flexibility, surface exposure and synthesis ease such as, sequence size and solubility of the present amino acids. MAPVirB11 was designed as a tetramer and its synthesis was commercially commissioned to American Peptide Company, Inc. (Fischer Scientific, USA).

MAPVirB11 is recognized by IgG of cattle infected with A. marginale by ELISA

MAPVirB11 tetramer antigenicity against A. marginale immune bovine sera was tested by indirect ELISA in 96-well microtiter plates (Corning 3595) coated with 100 μL/well of MAPVirB11 at a 10 μg/mL concentration, in carbonate buffer solution (CBS) pH 9.6; incubated overnight at 4 °C. Plates were washed three times with PBS pH 7.2 /0.05% Tween 20 (PBS/Tween), and blocked with 7% skim milk in PBS/Tween for 1 h at 37 °C; the contents was discarded, wells were washed, and probed with 100 μL/well of A. marginale immune bovine sera serially diluted from 1/25, up to 1/100. Antigen-antibody reaction was made visible by probing with anti-bovine IgG alkaline phosphatase conjugate (PhosphataseConjugated AffiniPure Goat Anti-Bovine, Jackson ImmunoResearch, Laboratories, Inc.) diluted at 1/5000. The plates were read on a BioRad iMark™ Microplate Absorbance Reader #1681135 at 405 nm.

775


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Preparation of anti-MAP-VirB11 rabbit polyclonal monospecific serum

New Zealand rabbits were subcutaneously immunized weekly on five occasions at 7 d intervals; with 50 μg of MAPVirB11 tetramer diluted in 1 mL PBS and emulsified in 1 mL Montanide™ ISA 70 adjuvant. Before the first immunization (T0) serum was used as negative control for each rabbit. Serum samples were obtained on T0, and each immunization time T1, T2, T3, T4 and T5. Rabbit anti MAPVirB11 antibody specificity was determined by ELISA, as described above with modifications. 96-well microtiter plates (Corning 3595) were coated with 100 μL of MAPVirB11 with a concentration of 10 μg/mL in carbonate buffer. Rabbit serum samples were serially diluted from 1/25 to 1/100 in 0.05% PBS Tween. To detect the Ag-Ac reaction, was made visible with Anti-IgG-Rabbit Gtx Rbt IgG2 Alkaline Phosphate (Alka Phos) conjugate (Chemicon International; Cat. No. AP307P) was used and read as described.

Identification of native VirB11 in A. marginale by Western blot

Twenty (20) μg of total initial body (IB) protein of Tlapacoyan-2, A. marginale, were run on denaturing and reductive SDS-PAGE gels with a 3%/15% pre-separation/separation phases. Electrophoresis was performed at 150 V, at constant voltage for one hour. One replicate gel was washed for one hour in distilled water and stained in Coomassie GelCode ™ Blue Solution (Thermo Fisher Scientific). The second replicate was transferred to a 0.45 μm pore (Immobilon®-P Millipore) PVDF membrane on a semi-dry system at 15 volts for 15 min. At the end of the transference, the membrane was blocked for 2 h with 5% skim milk in Tris buffered solution (TBS) pH 7.5 and washed three times with TBS-0.05% Tween (TBS Tween). The membrane was incubated at room temperature with a 1:100 dilution of T5 rabbit serum in TBS Tween for 2 h; after three washes the membrane was incubated with the Anti-IgG-Rabbit Gtx Rbt IgG2 Alka Phos diluted 1:5000 in PBS_0.05% Tween-20 for 2 h; (Chemicon International). The bands were detected by incubating the membrane with alkaline phosphatase substrate (BCIP / NBT SIGMA) for 5 to 20 min.

776


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Rabbit monospecific polyclonal anti-MAPVirB11 antibodies react with bovine infected erythrocytes by immunofluorescence

Antigen slides prepared from a 15% rickettsemic steer (Puente de Ixtla strain), were air-dried and stored at -70 ºC. Ten (10) μL of rabbit T0 and T5 anti MAPVirB11, at a 1:50 dilution in PBS (pH 7.2), were placed on an antigen slide and incubated for 60 min as described (22). Antigen slides were incubated at 37 °C for 30 min and washed three times with PBS, then, incubated with FITC-anti-rabbit antibody conjugate (Jackson Immuno Research Laboratories, Inc.). Slides were washed three times with PBS pH 7.4 and air-dried at room temperature and examined by epifluorescent microscopy.

Cell localization of VIRB11 in A. marginale by transmission electron microscopy

Density gradient-purified A. marginale initial bodies from Yautepec Strain (see supplemental material for extraction and purification of initial bodies) were placed on copper grids coated with Formvar 200 mesh (Senna Science) and incubated for 1 h at room temperature. After incubation, grids were washed three times with TBS and incubated with anti-MAP-VirB11 primary rabbit antibodies and a pre-immunization control serum in a 1:5 TBS dilution for 1 h. Grids were washed again three times for three minutes each, and incubated for 1 h with Sigma-Aldrich gold-labeled conjugated anti-rabbit secondary antibody (particle size of 10 nm). Grids were negatively stained with uranyl acetate and observed under a microscope at 4K, 8K and 20K (MET Microscopic, ZEISS, Libra 120 model with camera Gatan Multiscan Camera, 794 Model).

777


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Results

Bioinformatics analysis

At amplification, each virB11 PCR product of the six Mexican A. marginale isolates showed an approximate 1,000 bp, molecular weight, consistent to that reported for the St. Marie strain. Nucleotide sequence alignments of nine Mexican isolates, showed 100 % identity among them (Table 2).

Table 2: virB11 gene was amplified and sequenced in nine Mexican A. marginale isolates St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

GTGTTGTGTGCGCATATGACAGCAGGATACGCAGCGTTAGAAACATACTTGGAGCCCCTG GTGTTGTGTGCGCATATGACAGCAGGATACGCAGCGTTAGAAACATACTTGGAGCCCCTG GTGTTGTGTGCGCATATGACAGCAGGATACGCAGCGTTAGAAACATACTTGGAGCCCCTG GTGTTGTGTGCGCATATGACAGCAGGATACGCAGCGTTAGAAACATACTTGGAGCCCCTG GTGTTGTGTGCGCATATGACAGCAGGATACGCAGCGTTAGAAACATACTTGGAGCCCCTG GTGTTGTGTGCGCATATGACAGCAGGATACGCAGCGTTAGAAACATACTTGGAGCCCCTG GTGTTGTGTGCGCATATGACAGCAGGATACGCAGCGTTAGAAACATACTTGGAGCCCCTG GTGTTGTGTGCGCATATGACAGCAGGATACGCAGCGTTAGAAACATACTTGGAGCCCCTG GTGTTGTGTGCGCATATGACAGCAGGATACGCAGCGTTAGAAACATACTTGGAGCCCCTG GTGTTGTGTGCGCATATGACAGCAGGATACGCAGCGTTAGAAACATACTTGGAGCCCCTG ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

CAGAGCATATTCGCGGAGGATGGGGTCAATGAGATCTCGATCAACAGAGAATGCGAGGTA CAGAGCATATTCGCGGAGGATGGGGTCAATGAGATCTCGATCAACAGAGAATGCGAGGTA CAGAGCATATTCGCGGAGGATGGGGTCAATGAGATCTCGATCAACAGAGAATGCGAGGTA CAGAGCATATTCGCGGAGGATGGGGTCAATGAGATCTCGATCAACAGAGAATGCGAGGTA CAGAGCATATTCGCGGAGGATGGGGTCAATGAGATCTCGATCAACAGAGAATGCGAGGTA CAGAGCATATTCGCGGAGGATGGGGTCAATGAGATCTCGATCAACAGAGAATGCGAGGTA CAGAGCATATTCGCGGAGGATGGGGTCAATGAGATCTCGATCAACAGAGAATGCGAGGTA CAGAGCATATTCGCGGAGGATGGGGTCAATGAGATCTCGATCAACAGAGAATGCGAGGTA CAGAGCATATTCGCGGAGGATGGGGTCAATGAGATCTCGATCAACAGAGAATGCGAGGTA CAGAGCATATTCGCGGAGGATGGGGTCAATGAGATCTCGATCAACAGAGAATGCGAGGTA ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

TGGGTAGAGAACAGGGGCGATATACGGTGTGAGAGGATTGAAAGTCTAACTCTGTCGCAT TGGGTAGAGAACAGGGGCGATATACGGTGTGAGAGGATTGAAAGTCTAACTCTGTCGCAT TGGGTAGAGAACAGGGGCGATATACGGTGTGAGAGGATTGAAAGTCTAACTCTGTCGCAT TGGGTAGAGAACAGGGGCGATATACGGTGTGAGAGGATTGAAAGTCTAACTCTGTCGCAT TGGGTAGAGAACAGGGGCGATATACGGTGTGAGAGGATTGAAAGTCTAACTCTGTCGCAT TGGGTAGAGAACAGGGGCGATATACGGTGTGAGAGGATTGAAAGTCTAACTCTGTCGCAT TGGGTAGAGAACAGGGGCGATATACGGTGTGAGAGGATTGAAAGTCTAACTCTGTCGCAT TGGGTAGAGAACAGGGGCGATATACGGTGTGAGAGGATTGAAAGTCTAACTCTGTCGCAT TGGGTAGAGAACAGGGGCGATATACGGTGTGAGAGGATTGAAAGTCTAACTCTGTCGCAT TGGGTAGAGAACAGGGGCGATATACGGTGTGAGAGGATTGAAAGTCTAACTCTGTCGCAT ************************************************************

St. Maries ----- CTAAAAGCACTCGGCAGGTTGGTAGCACAAGCAACCGAGCAGAAATTGAGTGAGGAAACG Soto la Marina - CTAAAAGCACTCGGCAGGTTGGTAGCACAAGCAACCGAGCAGAAATTGAGTGAGGAAACG Guayaboso ------ CTAAAAGCACTCGGCAGGTTGGTAGCACAAGCAACCGAGCAGAAATTGAGTGAGGAAACG

778


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

CTAAAAGCACTCGGCAGGTTGGTAGCACAAGCAACCGAGCAGAAATTGAGTGAGGAAACG CTAAAAGCACTCGGCAGGTTGGTAGCACAAGCAACCGAGCAGAAATTGAGTGAGGAAACG CTAAAAGCACTCGGCAGGTTGGTAGCACAAGCAACCGAGCAGAAATTGAGTGAGGAAACG CTAAAAGCACTCGGCAGGTTGGTAGCACAAGCAACCGAGCAGAAATTGAGTGAGGAAACG CTAAAAGCACTCGGCAGGTTGGTAGCACAAGCAACCGAGCAGAAATTGAGTGAGGAAACG CTAAAAGCACTCGGCAGGTTGGTAGCACAAGCAACCGAGCAGAAATTGAGTGAGGAAACG CTAAAAGCACTCGGCAGGTTGGTAGCACAAGCAACCGAGCAGAAATTGAGTGAGGAAACG ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

CCTTTGCTGTCGGCTTCTTTGCCCAACGGCTTCCGCGTGCAGGTGGTGTTTCCCCCCGCT CCTTTGCTGTCGGCTTCTTTGCCCAACGGCTTCCGCGTGCAGGTGGTGTTTCCCCCCGCT CCTTTGCTGTCGGCTTCTTTGCCCAACGGCTTCCGCGTGCAGGTGGTGTTTCCCCCCGCT CCTTTGCTGTCGGCTTCTTTGCCCAACGGCTTCCGCGTGCAGGTGGTGTTTCCCCCCGCT CCTTTGCTGTCGGCTTCTTTGCCCAACGGCTTCCGCGTGCAGGTGGTGTTTCCCCCCGCT CCTTTGCTGTCGGCTTCTTTGCCCAACGGCTTCCGCGTGCAGGTGGTGTTTCCCCCCGCT CCTTTGCTGTCGGCTTCTTTGCCCAACGGCTTCCGCGTGCAGGTGGTGTTTCCCCCCGCT CCTTTGCTGTCGGCTTCTTTGCCCAACGGCTTCCGCGTGCAGGTGGTGTTTCCCCCCGCT CCTTTGCTGTCGGCTTCTTTGCCCAACGGCTTCCGCGTGCAGGTGGTGTTTCCCCCCGCT CCTTTGCTGTCGGCTTCTTTGCCCAACGGCTTCCGCGTGCAGGTGGTGTTTCCCCCCGCT ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

TGCGAGGGTGATAAAGTCGTATTTTCCATAAGAAAGCCATCGACGGTGCAGTTGTCGCTC TGCGAGGGTGATAAAGTCGTATTTTCCATAAGAAAGCCATCGACGGTGCAGTTGTCGCTC TGCGAGGGTGATAAAGTCGTATTTTCCATAAGAAAGCCATCGACGGTGCAGTTGTCGCTC TGCGAGGGTGATAAAGTCGTATTTTCCATAAGAAAGCCATCGACGGTGCAGTTGTCGCTC TGCGAGGGTGATAAAGTCGTATTTTCCATAAGAAAGCCATCGACGGTGCAGTTGTCGCTC TGCGAGGGTGATAAAGTCGTATTTTCCATAAGAAAGCCATCGACGGTGCAGTTGTCGCTC TGCGAGGGTGATAAAGTCGTATTTTCCATAAGAAAGCCATCGACGGTGCAGTTGTCGCTC TGCGAGGGTGATAAAGTCGTATTTTCCATAAGAAAGCCATCGACGGTGCAGTTGTCGCTC TGCGAGGGTGATAAAGTCGTATTTTCCATAAGAAAGCCATCGACGGTGCAGTTGTCGCTC TGCGAGGGTGATAAAGTCGTATTTTCCATAAGAAAGCCATCGACGGTGCAGTTGTCGCTC ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan ----Playa Vicente -Aguascalientes Puente -----------------------

GATGATTATGAAAAAATGGGTGCGTTCTCCCATGTGGCCCAGCAGGGCCGCAAGGCTATG GATGATTATGAAAAAATGGGTGCGTTCTCCCATGTGGCCCAGCAGGGCCGCAAGGCTATG GATGATTATGAAAAAATGGGTGCGTTCTCCCATGTGGCCCAGCAGGGCCGCAAGGCTATG GATGATTATGAAAAAATGGGTGCGTTCTCCCATGTGGCCCAGCAGGGCCGCAAGGCTATG GATGATTATGAAAAAATGGGTGCGTTCTCCCATGTGGCCCAGCAGGGCCGCAAGGCTATG GATGATTATGAAAAAATGGGTGCGTTCTCCCATGTGGCCCAGCAGGGCCGCAAGGCTATG GATGATTATGAAAAAATGGGTGCGTTCTCCCATGTGGCCCAGCAGGGCCGCAAGGCTATG GATGATTATGAAAAAATGGGTGCGTTCTCCCATGTGGCCCAGCAGGGCCGCAAGGCTATG GATGATTATGAAAAAATGGGTGCGTTCTCCCATGTGGCCCAGCAGGGCCGCAAGGCTATG GATGATTATGAAAAAATGGGTGCGTTCTCCCATGTGGCCCAGCAGGGCCGCAAGGCTATG ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Puente -----------------------

GACGTAAACAAGCAGCTTAGTGAGCTCCTGGATAGCGGGGATATCAAATCTTTCATAGAG GACGTAAACAAGCAGCTTAGTGAGCTCCTGGATAGCGGGGATATCAAATCTTTCATAGAG GACGTAAACAAGCAGCTTAGTGAGCTCCTGGATAGCGGGGATATCAAATCTTTCATAGAG GACGTAAACAAGCAGCTTAGTGAGCTCCTGGATAGCGGGGATATCAAATCTTTCATAGAG GACGTAAACAAGCAGCTTAGTGAGCTCCTGGATAGCGGGGATATCAAATCTTTCATAGAG GACGTAAACAAGCAGCTTAGTGAGCTCCTGGATAGCGGGGATATCAAATCTTTCATAGAG GACGTAAACAAGCAGCTTAGTGAGCTCCTGGATAGCGGGGATATCAAATCTTTCATAGAG GACGTAAACAAGCAGCTTAGTGAGCTCCTGGATAGCGGGGATATCAAATCTTTCATAGAG GACGTAAACAAGCAGCTTAGTGAGCTCCTGGATAGCGGGGATATCAAATCTTTCATAGAG GACGTAAACAAGCAGCTTAGTGAGCTCCTGGATAGCGGGGATATCAAATCTTTCATAGAG ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ----------

CTTGCGGTGCTGAGCAAAAAAAACATAATCGTCAGTGGAGGTACGTCCACTGGGAAAACT CTTGCGGTGCTGAGCAAAAAAAACATAATCGTCAGTGGAGGTACGTCCACTGGGAAAACT CTTGCGGTGCTGAGCAAAAAAAACATAATCGTCAGTGGAGGTACGTCCACTGGGAAAACT CTTGCGGTGCTGAGCAAAAAAAACATAATCGTCAGTGGAGGTACGTCCACTGGGAAAACT CTTGCGGTGCTGAGCAAAAAAAACATAATCGTCAGTGGAGGTACGTCCACTGGGAAAACT CTTGCGGTGCTGAGCAAAAAAAACATAATCGTCAGTGGAGGTACGTCCACTGGGAAAACT

779


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Tlapacoyan-2 --Playa Vicente -Aguascalientes Puente -----------------------

CTTGCGGTGCTGAGCAAAAAAAACATAATCGTCAGTGGAGGTACGTCCACTGGGAAAACT CTTGCGGTGCTGAGCAAAAAAAACATAATCGTCAGTGGAGGTACGTCCACTGGGAAAACT CTTGCGGTGCTGAGCAAAAAAAACATAATCGTCAGTGGAGGTACGTCCACTGGGAAAACT CTTGCGGTGCTGAGCAAAAAAAACATAATCGTCAGTGGAGGTACGTCCACTGGGAAAACT ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

ACGTTCACAAACGCGGCGCTGCGGGTCATCCCAAAGGATGAAAGGATAATAACGGTGGAA ACGTTCACAAACGCGGCGCTGCGGGTCATCCCAAAGGATGAAAGGATAATAACGGTGGAA ACGTTCACAAACGCGGCGCTGCGGGTCATCCCAAAGGATGAAAGGATAATAACGGTGGAA ACGTTCACAAACGCGGCGCTGCGGGTCATCCCAAAGGATGAAAGGATAATAACGGTGGAA ACGTTCACAAACGCGGCGCTGCGGGTCATCCCAAAGGATGAAAGGATAATAACGGTGGAA ACGTTCACAAACGCGGCGCTGCGGGTCATCCCAAAGGATGAAAGGATAATAACGGTGGAA ACGTTCACAAACGCGGCGCTGCGGGTCATCCCAAAGGATGAAAGGATAATAACGGTGGAA ACGTTCACAAACGCGGCGCTGCGGGTCATCCCAAAGGATGAAAGGATAATAACGGTGGAA ACGTTCACAAACGCGGCGCTGCGGGTCATCCCAAAGGATGAAAGGATAATAACGGTGGAA ACGTTCACAAACGCGGCGCTGCGGGTCATCCCAAAGGATGAAAGGATAATAACGGTGGAA ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

GACTCTAGAGAAATAGCGCTAGACCACCCCAACAGGGTACATCTATTGGCATCCAAGGGC GACTCTAGAGAAATAGCGCTAGACCACCCCAACAGGGTACATCTATTGGCATCCAAGGGC GACTCTAGAGAAATAGCGCTAGACCACCCCAACAGGGTACATCTATTGGCATCCAAGGGC GACTCTAGAGAAATAGCGCTAGACCACCCCAACAGGGTACATCTATTGGCATCCAAGGGC GACTCTAGAGAAATAGCGCTAGACCACCCCAACAGGGTACATCTATTGGCATCCAAGGGC GACTCTAGAGAAATAGCGCTAGACCACCCCAACAGGGTACATCTATTGGCATCCAAGGGC GACTCTAGAGAAATAGCGCTAGACCACCCCAACAGGGTACATCTATTGGCATCCAAGGGC GACTCTAGAGAAATAGCGCTAGACCACCCCAACAGGGTACATCTATTGGCATCCAAGGGC GACTCTAGAGAAATAGCGCTAGACCACCCCAACAGGGTACATCTATTGGCATCCAAGGGC GACTCTAGAGAAATAGCGCTAGACCACCCCAACAGGGTACATCTATTGGCATCCAAGGGC ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla ----------------

GGCCAGGGGCGCGCTAAGGTCTCTACTCAAGATCTTATAGAGGCCTGCTTGCGTCTTCGT GGCCAGGGGCGCGCTAAGGTCTCTACTCAAGATCTTATAGAGGCCTGCTTGCGTCTTCGT GGCCAGGGGCGCGCTAAGGTCTCTACTCAAGATCTTATAGAGGCCTGCTTGCGTCTTCGT GGCCAGGGGCGCGCTAAGGTCTCTACTCAAGATCTTATAGAGGCCTGCTTGCGTCTTCGT GGCCAGGGGCGCGCTAAGGTCTCTACTCAAGATCTTATAGAGGCCTGCTTGCGTCTTCGT GGCCAGGGGCGCGCTAAGGTCTCTACTCAAGATCTTATAGAGGCCTGCTTGCGTCTTCGT GGCCAGGGGCGCGCTAAGGTCTCTACTCAAGATCTTATAGAGGCCTGCTTGCGTCTTCGT GGCCAGGGGCGCGCTAAGGTCTCTACTCAAGATCTTATAGAGGCCTGCTTGCGTCTTCGT GGCCAGGGGCGCGCTAAGGTCTCTACTCAAGATCTTATAGAGGCCTGCTTGCGTCTTCGT GGCCAGGGGCGCGCTAAGGTCTCTACTCAAGATCTTATAGAGGCCTGCTTGCGTCTTCGT ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

CCAGATAGAATAATTGTTGGGGAGCTCAGGGGGGCTGAGGCGTTTAGCTTTCTCAGAGCC CCAGATAGAATAATTGTTGGGGAGCTCAGGGGGGCTGAGGCGTTTAGCTTTCTCAGAGCC CCAGATAGAATAATTGTTGGGGAGCTCAGGGGGGCTGAGGCGTTTAGCTTTCTCAGAGCC CCAGATAGAATAATTGTTGGGGAGCTCAGGGGGGCTGAGGCGTTTAGCTTTCTCAGAGCC CCAGATAGAATAATTGTTGGGGAGCTCAGGGGGGCTGAGGCGTTTAGCTTTCTCAGAGCC CCAGATAGAATAATTGTTGGGGAGCTCAGGGGGGCTGAGGCGTTTAGCTTTCTCAGAGCC CCAGATAGAATAATTGTTGGGGAGCTCAGGGGGGCTGAGGCGTTTAGCTTTCTCAGAGCC CCAGATAGAATAATTGTTGGGGAGCTCAGGGGGGCTGAGGCGTTTAGCTTTCTCAGAGCC CCAGATAGAATAATTGTTGGGGAGCTCAGGGGGGCTGAGGCGTTTAGCTTTCTCAGAGCC CCAGATAGAATAATTGTTGGGGAGCTCAGGGGGGCTGAGGCGTTTAGCTTTCTCAGAGCC ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes -

ATAAATACTGGGCACCCGGGTTCCATCTCAACCTTGCATGCAGACACGCCTAGAATGGCT ATAAATACTGGGCACCCGGGTTCCATCTCAACCTTGCATGCAGACACGCCTAGAATGGCT ATAAATACTGGGCACCCGGGTTCCATCTCAACCTTGCATGCAGACACGCCTAGAATGGCT ATAAATACTGGGCACCCGGGTTCCATCTCAACCTTGCATGCAGACACGCCTAGAATGGCT ATAAATACTGGGCACCCGGGTTCCATCTCAACCTTGCATGCAGACACGCCTAGAATGGCT ATAAATACTGGGCACCCGGGTTCCATCTCAACCTTGCATGCAGACACGCCTAGAATGGCT ATAAATACTGGGCACCCGGGTTCCATCTCAACCTTGCATGCAGACACGCCTAGAATGGCT ATAAATACTGGGCACCCGGGTTCCATCTCAACCTTGCATGCAGACACGCCTAGAATGGCT ATAAATACTGGGCACCCGGGTTCCATCTCAACCTTGCATGCAGACACGCCTAGAATGGCT

780


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Pte de Ixtla --- ATAAATACTGGGCACCCGGGTTCCATCTCAACCTTGCATGCAGACACGCCTAGAATGGCT --------------- ************************************************************ St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

GTAGAGCAGCTGAAACTTATGGTAATGCAAGCGAGTCTAGGGTTGCCGCCAGACCAAATA GTAGAGCAGCTGAAACTTATGGTAATGCAAGCGAGTCTAGGGTTGCCGCCAGACCAAATA GTAGAGCAGCTGAAACTTATGGTAATGCAAGCGAGTCTAGGGTTGCCGCCAGACCAAATA GTAGAGCAGCTGAAACTTATGGTAATGCAAGCGAGTCTAGGGTTGCCGCCAGACCAAATA GTAGAGCAGCTGAAACTTATGGTAATGCAAGCGAGTCTAGGGTTGCCGCCAGACCAAATA GTAGAGCAGCTGAAACTTATGGTAATGCAAGCGAGTCTAGGGTTGCCGCCAGACCAAATA GTAGAGCAGCTGAAACTTATGGTAATGCAAGCGAGTCTAGGGTTGCCGCCAGACCAAATA GTAGAGCAGCTGAAACTTATGGTAATGCAAGCGAGTCTAGGGTTGCCGCCAGACCAAATA GTAGAGCAGCTGAAACTTATGGTAATGCAAGCGAGTCTAGGGTTGCCGCCAGACCAAATA GTAGAGCAGCTGAAACTTATGGTAATGCAAGCGAGTCTAGGGTTGCCGCCAGACCAAATA ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

GTAAGTTACATTACCAACATAGTAGACGTAATTATACAGCTGAAAAGGGAGTCTGGAGGG GTAAGTTACATTACCAACATAGTAGACGTAATTATACAGCTGAAAAGGGAGTCTGGAGGG GTAAGTTACATTACCAACATAGTAGACGTAATTATACAGCTGAAAAGGGAGTCTGGAGGG GTAAGTTACATTACCAACATAGTAGACGTAATTATACAGCTGAAAAGGGAGTCTGGAGGG GTAAGTTACATTACCAACATAGTAGACGTAATTATACAGCTGAAAAGGGAGTCTGGAGGG GTAAGTTACATTACCAACATAGTAGACGTAATTATACAGCTGAAAAGGGAGTCTGGAGGG GTAAGTTACATTACCAACATAGTAGACGTAATTATACAGCTGAAAAGGGAGTCTGGAGGG GTAAGTTACATTACCAACATAGTAGACGTAATTATACAGCTGAAAAGGGAGTCTGGAGGG GTAAGTTACATTACCAACATAGTAGACGTAATTATACAGCTGAAAAGGGAGTCTGGAGGG GTAAGTTACATTACCAACATAGTAGACGTAATTATACAGCTGAAAAGGGAGTCTGGAGGG ************************************************************

St. Maries ----Soto la Marina Guayaboso -----Atitalaquia ---Tizimin -------Ticul ---------Tlapacoyan-2 --Playa Vicente -Aguascalientes Pte de Ixtla -----------------

GTGCGGCACGTCGCGGAGATTATGTTCACTAAATGTTCACAAGGCAATGATTAA GTGCGGCACGTCGCGGAGATTATGTTCACTAAATGTTCACAAGGCAATGATTAA GTGCGGCACGTCGCGGAGATTATGTTCACTAAATGTTCACAAGGCAATGATTAA GTGCGGCACGTCGCGGAGATTATGTTCACTAAATGTTCACAAGGCAATGATTAA GTGCGGCACGTCGCGGAGATTATGTTCACTAAATGTTCACAAGGCAATGATTAA GTGCGGCACGTCGCGGAGATTATGTTCACTAAATGTTCACAAGGCAATGATTAA GTGCGGCACGTCGCGGAGATTATGTTCACTAAATGTTCACAAGGCAATGATTAA GTGCGGCACGTCGCGGAGATTATGTTCACTAAATGTTCACAAGGCAATGATTAA GTGCGGCACGTCGCGGAGATTATGTTCACTAAATGTTCACAAGGCAATGATTAA GTGCGGCACGTCGCGGAGATTATGTTCACTAAATGTTCACAAGGCAATGATTAA ******************************************************

The computational inference analyzes of the consensus sequences showed two hydrophobic regions, absence of signal peptide and the probable external localization on the membrane, according to the amino acid analysis.

781


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

VirB11 protein type B epitope analysis and selection of relevant epitope

B type epitope analysis showed that VFSIRKPSTVQLSD amino acid sequence filled the criteria for immunogenicity, ease of synthesis and used for tetramer design. This sequence is located at the 107 to 122 positions, within the hydrophobic extramembranal region of the protein. This peptide sequence showed the highest scores as a linear type B epitope in the BCpred, ACBpred and IEDB prediction programs (Table 3).

Table 3. Conserved linear type B epitopes in VirB11 protein sequence as predicted by ABCpred, CBpred and IEDB tools Type B epitopes VAQATEQKLSEETP VFSIRKPSTVQLSLD (MAPVirB11) VAQQGRKAMDVNK LASKGGQGRAKVST IVSGGTSTGKTTF

Position

Amino acids

68 107 132 216 170

15 15 13 13 13

Sera of cattle naturally or experimentally infected with A. marginale reacts with MAPVirB11

Serum samples of seven cattle naturally or experimentally infected with A. marginale gave a response above the negative control absorbance value, some reaching â&#x2030;Ľ2 OD values at ELISA (Figure 1A). The serum from a susceptible animal, serologically and PCR negative to A. marginale was included as negative control, which showed a 0.5 OD value. In order to confirm these results, the sera from bovines 1 and 3, were tested by western blot (Figure 1B). Both sera reacted with a 6 kDa band, which coincides with the molecular weight of MAP-VirB11.

782


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

Figure 1: A) MAP-VirB11 reacts with bovine immune serum in ELISA: Sera from seven A. marginale-infected bovines were tested. The description of the animals is as above in Materials and Methods; B) Infected bovines serum reacts with Map-VirB11 in western blot. MAP-VirB11 was separated by SDS-PAGE and blotted onto PVDF membrane and probed with 1). A. marginale negative bovine serum; 2) Bovine 1 serum or 3) Bovine 3 serum. C) Rabbit T5 anti-MAP-VirB11 reacts with native de VirB11; purified A. marginale initial bodies were separated on a 15% polyacrylamide gel and transferred to a PVDF membrane and probed with: 1, non-immune rabbit serum; 2, immune Rabbit T5 serum.

Rabbit specific anti MAP-VirB11 antibody react with A. marginale native VirB11

Rabbit anti-MAPVirB11 antibodies reacted with MAPVirB11 in an ELISA (data not shown). All three sera reacted with similar OD values â&#x2030;Ľ 0.3 to 0.5, which were higher than the one obtained for the control serum; the negative control had an OD value less than 0.1. In order to verify the rabbit immune serum specificity, rabbit antibodies were tested by western blot against the tetramer and proteins of the purified initial bodies. Figure 1C shows (lane 2) recognition of a 40 kDa band by T5 immune sera from the same rabbit whereas T0 non immune serum shows no signal.

783


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

Rabbit immune anti-MAPVirB11 serum reacts with intraerythrocytic A. marginale by immunofluorescence

Preimmune (T0) and immune sera (T5) were used to test if the immune anti MAPVirB11 antibodies reacted with intra-erythrocytic A. marginale in a direct immunofluorescence assay. Blood-smears of both non-infected (Figure 2A and 2B) and erythrocytes infected with Tlapacoyan-2 strain (2C and 2D). Smears were probed with both T0 (2A and 2C) and T5 (2B and 2D) immune sera. Figure 2D shows typical intraerythrocytic A. marginale bodies by direct fluorescence, in contrast to T0 serum, which shows no reaction (Figure 2C).

Figure 2: Recognition of intraerythrocytic A. marginale by rabbit immune serum antiMAPVirB11 by direct immunofluorescence. Pre-immune rabbit serum was tested against A) non-infected erythrocytes or; B) infected erythrocytes; T5 rabbit anti-MAPVirB11 immune serum was tested against C) non-infected erythrocytes, and D) infected erythrocytes (100X magnification).

A

B

C

D

784


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

Cellular localization of VirB11 protein in A. marginale by transmission electron microscopy (TEM)

In order to determine the location of VirB11 native protein in A. marginale, purified initial bodies were probed with rabbit pre-immune T0 and immune T5 anti-MAPVirB11 sera and a second anti-rabbit IgG antibody coupled with colloidal gold. Figure 3B shows that T5 rabbit antiMAPVirB11 antibodies recognized the VirB11 native protein on the surface of A. marginale, located within an associated region on the outer side of the rickettsial membrane (indicated by arrows). This recognition can be observed in more detail in Figures 3B1 and 3B2. Figure 3A shows the initial body of A. marginale probed with pre-immune serum as negative control. Additionally, it was evaluated the T5 rabbit anti-MAP antibodies against E. coli, which is not known to express the VirB11 protein (Figure 3C). No recognition was observed in this case (Figures 3 C1), which is evidence of the anti-MAPVirB11 specificity (Figure 3B).

Figure 3: Rabbit anti-MAPVirB11 immune serum reacts with the outer membrane of A. marginale initial bodies by Transmission electron microscopy. A) Pre-immune rabbit serum incubated with A. marginale initial bodies, (A1 4K and A2 8K; B) MAPVirB11 specific rabbit serum incubated with A. marginale initial bodies (B1 and B2 are magnification views from image B); C) MAPVirB11 specific rabbit serum incubated with E. coli as control (C1 is a magnification view from image C). A

B

C

785


Revista Mexicana de Ciencias Pecuarias Volumen 9 NĂşmero 4

2018

Discussion

The publication of the complete genome sequence of the St. Maries strain of A. marginale(23), opened a new era in the search for potential vaccine candidates against A. marginale. The possibility of these antigens to be used as immunogens under homologous challenge/vaccination conditions has been promising, however, immunity has not yet met the expectations under conditions of heterologous challenge as a consequence of the variability of the selected antigens and lack on information in a broader array of A. marginale strains. VirB11 a component of T4SS, has been attributed an ATPase function in other organisms. Multiple alignment analysis of nine VirB11 nucleotide and amino acid sequences from Mexican strains showed 100 % identity (Figure 1) among themselves and with those reported in GenBank for the VirB11 of several strains including the St. Maries strain. The bioinformatic analysis also indicated that the protein was exposed on the outer surface of the membrane. Furthermore, 6 hydrophilic linear type B epitopes identified are conserved in all strains and exposed in the extracellular domain (Table 1); from these, we selected VFSIRKPSTVQLSLD amino acid sequence, which showed the highest weight of the aforementioned characteristics for the synthesis of MAP-VirB11. In order to verify the possibility that infected animals produce antibodies against this protein, serum samples from naturally and experimentally infected cattle with A. marginale reacted, in an antigen-antibody recognition assay, against MAPVirB11 epitope (Figure 2A). This result is consistent with previous reports(24) where bovines immunized with experimentally cross-linked membrane fragments from initial bodies of St. Maries strain induced an antibody response against VirB11 and other proteins of the same complex. In order to determine the antigenicity of MAPVirB11, it was important to prove that the specific rabbit antibodies against MAP-VirB11 could recognize the native protein. This was corroborated; monospecific polyclonal rabbit antibodies induced by immunization with MAPVirB11 reacted in a specific manner when tested by ELISA. Similarly, sera from infected cattle reacted with a 6 kDa band, corresponding to the weight of MAPVirB11 by western blot (Figure 2B). An important condition for a protein or peptide, to be considered as a potentially useful immunogen, is that it has to be exposed in the outer membrane of the rickettsia. Antibodies belonging to one rabbit immunized with MAPVirB11 and evaluated by indirect immunofluorescence, allowed us to identify A. marginale in the marginal zone of the infected

786


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

erythrocytes; confirming that the antibodies induced by peptide inoculation, were capable of reacting with native VirB11 present in A. marginale (Figure 2). Through the use of transmission electron microscopy and the same rabbit serum previously evaluated in WB and IFI assays, we identified the location of the VirB11 protein on the rickettsia; noting the labeling presence on a membrane section that was covering the periphery of the initial bodies of A. marginale, which in turn were extracted from infected erythrocytes (Figure 3). This evidence indicates that the protein is exposed on the Anaplasma outer surface, and is likely to be associated with the invasion process or survival within the erythrocyte(25). This finding is in agreement with similar results regarding the localization of the VirB9 in A. phagocytophilum and its possible participation in the invasion mechanism of this organism in human neutrophils(26). Our strategy of selecting MAP’s within the immunogen design allowed us to direct the immune response and induced the molecular recognition towards one of the most interesting antigens of A. marginale. This highly versatile tool provided a specific response and a higher sensitivity in the detection system, placing it in a superior category compared to previous strategies. These findings show that MAP’s may be considered in the design of future diagnostic and immunization tools, for controlling of bovine anaplasmosis.

Conclusions and implications

It was demonstrated the presence of linear epitopes of the VirB11 protein conserved among nine Mexican strains of A. marginale, using bioinformatic analyses. Also, a tetramer peptide (MAP’s) designed based on the B-type epitope amino acid VFSIRKPSTVQLSLD VirB11 sequence; sera from infected cattle recognized this tetramer. Furthermore, specific rabbit anti-tetramer antibodies recognized VirB11 native protein in A. marginale-infected erythrocytes both by immunofluorescence and transmission electron microscopy. All this evidence, suggests that VirB11 may have potential as an important target of the bovine immune system. This study also demonstrated the usefulness of a tetramer (MAP) for diagnosis and generation of the immune response against native proteins of interest. Clearly, further studies are required to evaluate the ability of these molecular constructs in the control the A. marginale infection in cattle.

787


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Ethics Statement

Two month-old New Zealand rabbits were kept in the Laboratory Animal Facility of the National Institute of Public Health, Cuernavaca, Mor., under the guidelines of the Institutional Committee for the Care and Use of Experimental Animals (SICUAE) of the National Autonomous University of Mexico, under Protocol No. DC-2013/1-3.

Competing interests/Funding Sources

The Mexican National Council for Science and Technology (CONACyT), and the National Institute for Research on Agriculture, Forestry and Livestock (INIFAP) funded this work under agreements No. 168167 and SIGI 1320382022 respectively. The funding sources provided financial support for the conduction of the research and preparation of the manuscript. The content of the manuscript however is the authors’ sole responsibility, solely to acknowledge this fact. This work is part of the requirements for graduation of the first author América Ivette Barrera Molina

Cited Literature: 1.

Kocan KML, de la Fuente J, Guglielmone AA, Meléndez RD. Antigens and alternatives for control of Anaplasma marginale infection in cattle. Clin Microbiol Rev 2003;16(4):698-712.

788


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

2.

Rodríguez-Vivas RI, Grisi L, Pérez de León AA, Silva Villela H, de Jesús Torres-Acosta JF, Fragoso Sánchez H, et al. Potential economic impact assessment for cattle parasites in Mexico. Rev Mex Cienc Pecu 2017;8(1):61-74.

3.

Rodríguez CSD, García OMA, Rojas REE, Cantó AGJ, Preciado TJF, Rosario CR, et al., Anaplasma marginale Yucatan (Mexico) Strain. Assessment of low virulence and potential use as a live vaccine. Ann N Y Acad Sci 2008;1149:98–102.

4.

Kocan KM, de la Fuente J, Blouin, EF, Coetzee JF, Ewing SA, The natural history of Anaplasma marginale. Vet Parasitol 2010;167:95–107.

5.

Ueti MW, Reagan JO, Knowles DP, Scoles GA, Shkap V, Palmer GH. Identification of midgut and salivary glands as specific and distinct barriers to efficient tick-borne transmission of Anaplasma marginale. Infect Immun 2007;75:2959–2964.

6.

Palmer GH, Knowles DP, Rodriguez JL, Gnad DP, Hollis LC, Marston T, et al. Stochastic transmission of multiple genotypically distinct Anaplasma marginale strains in a herd with high prevalence of Anaplasma infection. J Clin Microbiol 2004;42(11):5381–5384.

7.

Palmer GH, McGuire TC. Immune serum against Anaplasma marginale initial bodies neutralizes infectivity for cattle. J Immunol 1984;133:1010-1015.

8.

De la Fuente J, Van Den Bussche RA, Prado TM, Kocan KM. Anaplasma marginale msp1α genotypes evolved under positive selection pressure but are not markers for geographic isolates. J Clin Microbiol 2003;41:1609-1616.

9.

Brayton KA, Kappmeyer LS, Herndon DR, Dark MJ, Tibbals DL, Palmer GH, et al. Complete genome sequencing of Anaplasma marginale reveals that the surface is skewed to two superfamilies of outer membrane proteins. Proc Natl Acad Sci USA 2005;102:844–849.

10. Castañeda-Ortiz EJ, Ueti MW, Camacho-Nuez M, Mosqueda JJ, Mousel MR, Johnson WC, et al. Association of Anaplasma marginale strain superinfection with infection prevalence within tropical regions. PLoS One 2015;10(5):e0129415; Correction: PLoS One. 2015;10(5):e0129415. 11. Sutten EL, Norimine J, Beare PA, Heinzen RA, Lopez JE, Morse K, et al. Anaplasma marginale type IV secretion system proteins VirB2, VirB7, VirB11, and VirD4 are immunogenic components of a protective bacterial membrane vaccine. Infect Immun 2010;78:1314–1325.

789


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

12. González-Pedrajo B, Dreyfus G, Sistemas de secreción de proteínas en las bacterias Gram negativas: Biogénesis flagelar y translocación de factores de virulencia. Mensaje Bioquim 2003;27:45–63. 13. Sutten EL, Norimine J, Beare PA, Heinzen RA, Lopez JE, Morse K, et al. Anaplasma marginale type IV secretion system proteins VirB2, VirB7, VirB11, and VirD4 are immunogenic components of a protective bacterial membrane vaccine. Infect Immun 2010;78:1314–1325. 14. Apostolopoulos V. Vaccine delivery methods into the future. Vaccines (Basel) 2016;4(2):9. DOI:https://doi.org/10.3390/vaccines 402009. 15. Jiménez Ocampo R, Rodríguez Camarillo SD, Rosario R, Orozco Vega LE, de la Fuente J. Anaplasma marginale: análisis de las secuencias del fragmento variable del gen msp1 α y del gen msp4 de cuatro nuevas cepas mexicanas. Téc Pecu Méx 2008;46(1):69–78. 16. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Ann Biochem 1976;72:248-254. 17. Eddy SR. Multiple alignment using hidden Markov models. Proc Int Conf Intell Syst Mol Biol 1995;3:114-120. 18. Möller S, Croning MD, Apweiler R. Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics 2001;17(7):646-653. 19. Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, et al. Protein Identification and analysis tools on the ExPASy Server; In: John M. Walker editor. The proteomics protocols handbook. USA: Humana Press; 2005:571-607 20. Saha S, Raghava GPS. BcePred: Prediction of continuous B-cell epitopes in antigenic sequences using physico-chemical properties. In: Nicosia G, et al. editors. ICARIS, LNCS 3239. Germany: Springer; 2004:197-204. 21. Saha S, Raghava GP. Prediction of continuous B-cell epitopes in an antigen using recurrent neural network. Proteins 2006;65(1);40–48. 22. Oliveira B, Araújo R, Melo V, Madruga C, Soares C, Kessler R. et al. Development of enzyme-linked immunosorbent assays based on recombinant MSP1a and MSP2 of Anaplasma marginale; Mem Inst Oswaldo Cruz, 2005;100(7):765-769. 23. Brayton KA, Kappmeyer LS, Herdon DR, Dark MJ, Tibbals DL, Palmer GH, et al. Complete genome sequencing or Anaplasma marginale reveals that the surface is skewed to two superfamilies of outer membrane proteins. Proc Natl Acad Sci 2005;102(3):844-849.

790


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

24. Sutten EL, Norimine J, Beare PA, Heinzen RA, Lopez JE, Morse K, et al. Anaplasma marginale type IV secretion system proteins VirB2, VirB7, VirB11, and VirD4 are immunogenic components of a protective bacterial membrane vaccine. Infect Immun 2010;78:1314–1325. 25. Gillespie JJ, Phan IQH, Driscoll TP, Guillotte ML, Lehman SS, Rennoll-Bankert KE, et al. The Rickettsia type IV secretion system: Unrealized complexity mired by gene family expansion. Pathog Dis 2016;74(6):ftw058. 26. Niu H, Rikihisa Y, Yamaguchi M, Ohashi N. Differential expression of VirB9 and VirB6 during the life cycle of Anaplasma phagocytophilum in human leucocytes is associated with differential binding and avoidance of lysosome pathway. Cell Microbiol 2006;8(3):523–534.

791


http://dx.doi.org/ 10.22319/rmcp.v9i4.4468 Artículo

Uso de nisina y quitosano para la inhibición de Staphylococcus aureus resistente a antibióticos y asociado a mastitis bovina Use of nisin and chitosan for the inhibition of antibiotic resistant Staphylococcus aureus bovine mastitis-associated

Mónica Sánchez-Cejaa Ma. Teresa Arceo-Martíneza Ma. Guadalupe Sandoval-Floresb Patricia Nayeli Alva-Murilloc Rafael Jiménez-Mejíab Pedro Damián Loeza-Larab*

a

Universidad Michoacana de San Nicolás de Hidalgo. Centro Multidisciplinario de Estudios en Biotecnología-Facultad de Medicina Veterinaria y Zootecnia. Morelia, Michoacán, México. b

Universidad de La Ciénega del Estado de Michoacán de Ocampo. Licenciatura en Genómica Alimentaria, Avenida Universidad No. 3000, Colonia Lomas de la Universidad. 59103. Sahuayo, Michoacán, México. c

Universidad de Guanajuato, Departamento de Biología, División de Ciencias Naturales y Exactas, Guanajuato, Gto, México.

*Autor de correspondencia: pdloeza@ucienegam.edu.mx


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Resumen: En este trabajo se describen los patrones de resistencia a antibióticos de aislados de Staphylococcus aureus obtenidos de vacas con mastitis, así como su susceptibilidad in vitro a nisina, quitosano y al compósito nisina/quitosano. A partir de muestras de leche obtenidas de vacas enfermas se aislaron e identificaron 53 S. aureus, a los cuales se les analizó el perfil de resistencia a antibióticos. Los resultados evidenciaron una alta frecuencia de resistencia hacia el grupo de los beta-lactámicos, principalmente a penicilina, dicloxacilina y ampicilina. Asimismo, se detectó multirresistencia en algunos aislados, ya que mostraron tolerancia a 3 o 4 grupos de antibióticos, destacando los aislados AMC-9 (resistente a tres grupos) y AMC23 (resistente a cuatro grupos). También se resalta que todos los aislados fueron susceptibles a levofloxacina. Por otra parte, se analizó la susceptibilidad in vitro de los aislados a nisina, quitosano y al compósito nisina/quitosano, mediante la determinación de la concentración mínima inhibitoria. Los resultados indican que el 100 % de los aislados fue susceptible a quitosano y al compósito nisina/quitosano y el 47.1 % a la nisina. El efecto del quitosano y del compósito nisina/quitosano sobre los aislados multirresistentes AMC-9 y AMC-23 fue bactericida. Estos resultados revelan el potencial de los compuestos antimicrobianos quitosano y nisina/quitosano para ser utilizados como agentes terapéuticos contra la mastitis bovina. Palabras clave: Staphylococcus aureus, Mastitis bovina, Resistencia, Nisina, Quitosano.

Abstract: This study describes the antibiotic resistance patterns of Staphylococcus aureus isolates from cows with mastitis, as well as their in vitro susceptibility to nisin, chitosan and the nisin/chitosan composite. From milk samples obtained from sick cows, 53 S. aureus isolated were identified, the profile of antibiotic resistance was analyzed. The results showed a high frequency of resistance to beta-lactams group, mainly penicillin, dicloxacillin and ampicillin. In addition, multiresistance was detected in some isolates, since they showed tolerance to 3 or 4 different groups of antibiotics, highlighting the isolates AMC-9 (resistant to three groups) and AMC-23 (resistant to four groups). It is also noted that all isolates were susceptible to levofloxacin. On the other hand, the in vitro susceptibility of the isolates to nisin, chitosan and the nisin/chitosan composite was analyzed determining the Minimum Inhibitory Concentration (MIC). The results indicated 100 % of the isolates were susceptible to chitosan and to the nisin/chitosan composite and 47.1 % to nisin. The effect of chitosan and nisin/chitosan composite on the multi-resistant isolates AMC-9 and AMC-23 was bactericidal. These results show the potential of the antimicrobial compounds chitosan, nisin/chitosan to be used as therapeutic agents against bovine mastitis. Key words: Staphylococcus aureus, Bovine mastitis, Resistance, Nisin, Chitosan.

793


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Recibido 24/04/2017 Aceptado 24/01/2018

Introducción

La mastitis, una respuesta inflamatoria de la glándula mamaria ocasionada usualmente por bacterias, es probablemente la más costosa de las enfermedades infecciosas que afecta a las vacas lecheras. Ésta impacta de manera negativa el bienestar del ganado y la calidad de la leche producida, la cual generalmente presenta anormalidades, lo que genera pérdidas económicas para los ganaderos y para la industria láctea(1). El principal patógeno contagioso responsable de las infecciones clínicas y subclínicas de las vacas lactantes es la bacteria Gram positiva Staphylococcus aureus(2,3), la cual es capaz de invadir el tejido mamario y sobrevivir dentro de las células hospederas, ocasionando infecciones persistentes y recaídas frecuentes(4,5). La administración intramamaria de antibióticos ha sido el método más común para tratar la mastitis bovina(6). Sin embargo, los tratamientos se han visto comprometidos en numerosas ocasiones, principalmente en aquéllas en las que está involucrado S. aureus, ya que éste tiene la capacidad de evadir el efecto de los antibióticos(7). Asimismo, diferentes estudios han demostrado un incremento importante en la frecuencia de aislados de S. aureus resistentes a antibióticos(8,9), lo que finalmente resulta en infecciones recurrentes y crónicas en el ganado. El incremento en la emergencia de S. aureus resistente a antibióticos se debe al uso inadecuado de estos compuestos en el tratamiento de infecciones, así como su utilización como promotores del crecimiento en animales de granja. Lo anterior cobra mayor importancia debido a que la selección de resistencia a una clase de antibiótico puede conducir a resistencia-cruzada a otro tipo(10). Para el caso de la mastitis bovina, estos compuestos son utilizados en los hatos lecheros como inyecciones intramamarias para tratar a la mastitis clínica y subclínica, por lo que el monitoreo de la emergencia de S. aureus resistentes es particularmente importante, ya que ello resulta sustancial para la salud pública(11). Las dificultades para controlar a S. aureus han hecho necesaria la búsqueda de nuevas alternativas terapéuticas. El uso de péptidos antimicrobianos (PAMs) como la nisina y polisacáridos biodegradables como el quitosano, representan opciones atractivas(12,13). La nisina es un péptido de 34 aminoácidos producido por Lactococcus lactis, el cual posee actividad antimicrobiana sobre un amplio rango de bacterias Gram positivas(12), además de 794


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

que es considerada como segura por la FAO(14). Por su parte, el quitosano (poly β-[1-4]-Nacetyl-D-glucosamina) es un biopolímero lineal producido por la desacetilación química de la quitina, la cual se encuentra en el exoesqueleto de crustáceos e insectos. Adicionalmente, el quitosano es considerado un policatión con propiedades antibacterianas importantes, no es tóxico, es biodegradable y compatible con el ambiente, por lo que es reconocido como seguro por la FAO(15,16). La Ciénega de Chapala, Michoacán, México, es una de las regiones más importantes del estado en cuanto a producción de leche se refiere (en 2015 produjo 73,641 L, lo que representó el 21 % de la producción estatal), la cual está formada principalmente por hatos de lechería familiar(17). En la actualidad, aunque existe información sobre las principales bacterias asociadas a la mastitis bovina en la región, la información sobre sus perfiles de resistencia a antibióticos es escasa, además de que no existen datos sobre la susceptibilidad de patógenos contagiosos, como S. aureus, a nisina, quitosano y al compósito nisina/quitosano. Por lo tanto, el objetivo del presente trabajo fue analizar los perfiles de resistencia a antibióticos de aislados de S. aureus obtenidos de vacas con mastitis y determinar su susceptibilidad in vitro a nisina, quitosano y al compósito nisina/quitosano.

Material y métodos

Detección de mastitis y obtención de muestras de leche

La detección de la enfermedad y la obtención de leche se realizaron de julio de 2012 a agosto de 2014, como parte de un programa regional para el estudio de la mastitis bovina en La Ciénega de Chapala, Michoacán, México. Se analizaron 363 animales en ordeña pertenecientes a 30 hatos lecheros de los municipios de Venustiano Carranza y Marcos Castellanos. La mastitis se detectó mediante la Prueba de California (PC), siguiendo las instrucciones del fabricante (Sanfer®, México). La PC se realizó en los cuatro cuartos de cada animal y a partir de los cuartos infectados, se colectó una muestra de leche (30 ml) en tubos (Falcon®) estériles. Dichas muestras fueron mantenidas a 4 °C y transportadas al laboratorio de Biología Molecular de la Universidad de La Ciénega del Estado de Michoacán de Ocampo, en donde fueron procesadas. Previo a la colecta de las muestras, los cuartos se desinfectaron con algodón que contenía alcohol al 70 %, desechando los dos primeros chorros de leche.

795


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Aislamiento e identificación de S. aureus

De las muestras de leche colectadas se tomaron alícuotas de 100 µl, las cuales se inocularon en cajas Petri que contenían agar de sal y manitol (BD Bioxon®, México) y se incubaron a 37 °C durante 24 h. Los aislados de S. aureus obtenidos fueron adicionalmente identificados mediante pruebas bioquímicas como tinción de Gram, ensayo de catalasa y coagulasa (BD Bioxon®, México) y reducción de telurito y actividad lipolítica en cajas Petri con agar baird parker (Dibico®, México). Posteriormente, los aislados se caracterizaron molecularmente mediante la amplificación de un fragmento del gen nuc, el cual codifica para la nucleasa termoestable de S. aureus, con los siguientes oligonucleótidos 5´(18) GACTATTATTGGTTGATCCACCTG-3´ y 5´-GCCTTGACGAACTAAAGCTTCG-3´ . Para las amplificaciones por PCR se utilizó ADN genómico de S. aureus obtenido mediante la técnica de Pospiech y Neumann(19). Las reacciones de PCR se realizaron en un termociclador C1000 (Bio-Rad, México), bajo una desnaturalización inicial de 5 min a 95 °C, seguido de 25 ciclos a las siguientes temperaturas: desnaturalización a 95 °C por 1 min, alineamiento a 54 °C por 30 seg, extensión a 72 °C por 5 min. Los fragmentos amplificados se separaron por electroforesis en geles de agarosa al 1 %, se tiñeron con bromuro de etidio y se visualizaron en un fotodocumentador Gel Doc Universal Hood II (Bio-Rad, México). Como control positivo se utilizó la cepa certificada de S. aureus subsp. aureus ATCC (27543), la cual fue aislada de un caso clínico de mastitis bovina y amablemente proporcionada por el Dr. Joel Edmundo López-Meza del CMEB-FMVZ-UMSNH. Los aislados se identificaron con las letras AMC y AVC, correspondientes a Marcos Castellanos y Venustiano Carranza, Michoacán, respectivamente, seguidas de un número arábigo.

Ensayos de resistencia-susceptibilidad a antibióticos

Los ensayos de resistencia-susceptibilidad a antibióticos se realizaron mediante el método de difusión en disco sobre cajas Petri con agar Mueller-Hinton (BD Bioxon®, México)(20). Se utilizaron multidiscos para Gram positivos (II) (Bio Rad®, México) con los siguientes antibióticos: ampicilina 10 µg, cefalotina 30 µg, cefotaxima 30 µg, cefepime 30 µg, cefuroxima 30 µg, dicloxacilina 1 µg, eritromicina 15 µg, gentamicina 10 µg, levofloxacina

796


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

5 µg, penicilina 10 U, tetraciclina 30 µg y trimetoprim-sulfametoxazol 25 µg. Las cajas Petri se incubaron a 37 °C durante 24 h. Después de ese tiempo, los halos de inhibición se midieron y se interpretaron de acuerdo a los criterios establecidos por el CLSI(21), los aislados se clasificaron como susceptibles, intermedios y resistentes. Se tomó el criterio de multirresistencia de Srinivasan et al(22), quienes consideran una cepa multirresistente como aquélla que resiste a tres o más grupos distintos de antibióticos.

Preparación de nisina, quitosano y del compósito nisina/quitosano

La nisina proveniente de L. lactis subsp. lactis, se obtuvo de Sigma-Aldrich®, México y se solubilizó en HCl 0.02 M. Se preparó una solución stock a una concentración de 10 mg/ml, la cual se esterilizó por filtración, con membranas de 0.22 m de tamaño de poro (Millipore®, USA)(12,23). El quitosano de bajo peso molecular se adquirió de SigmaAldrich®, México. Se preparó una solución stock a una concentración de 20 mg/ml, la cual se disolvió en ácido acético (J.T. Baker®, México) al 1 %, durante 12 h. Posteriormente, el pH de la solución se ajustó a 5.5 con NaOH (Meyer®, México) 1 N. Finalmente, la solución se esterilizó a 120 °C, 20 psi, 15 min(24). El compósito nisina/quitosano se preparó de la siguiente manera: una vez preparadas y esterilizadas ambas soluciones, la concentración correspondiente de nisina se disolvió en la solución de quitosano a temperatura ambiente (25 ± 2 °C). Dicho compósito se agitó vigorosamente por 5 min y se utilizó en los ensayos antibacterianos correspondientes.

Determinación de la concentración mínima inhibitoria (CMI) de nisina y quitosano

La CMI de la nisina y del quitosano se determinó para todos los aislados bacterianos. Lo anterior se realizó mediante el método de dilución en caldo Mueller-Hinton (BD Bioxon®, México)(25,26), con algunas modificaciones. Tubos con caldo Mueller-Hinton conteniendo un

797


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

inóculo de cada uno de los aislados de S. aureus ajustado a la turbidez del tubo 0.5 de la escala de McFarland, fueron asépticamente mezclados con nisina hasta alcanzar concentraciones de 1.0, 1.25, 1.5, 1.75, 2.0, 2.25, 2.5, 2.75 y 3.0 mg/ml. El mismo procedimiento se realizó para el quitosano. Posteriormente, los tubos se incubaron a 37 °C, con agitación constante (160 rpm). La concentración más baja sin crecimiento visible se consideró como la CMI para cada aislado, luego de 24 h de incubación (20,27). Como testigos se utilizaron tubos con caldo Mueller-Hinton que contenían HCl 0.02 M y ácido acético al 1 % (pH 5.5). Los experimentos se realizaron por triplicado.

Determinación de la CMI del compósito nisina/quitosano

La CMI del compósito nisina/quitosano también se determinó para todos los aislados(20,27). Lo anterior se realizó bajo la metodología descrita previamente en Rodríguez-Núñez et al(26) con las modificaciones descritas en el ensayo anterior. Asimismo, se evaluaron concentraciones inferiores a la CMI de los compuestos por separado (2.0, 2.25, 2.5 y 2.75 mg/ml para la nisina y 1.0, 1.25, 1.5 y 1.75 mg/ml para el quitosano) para observar un posible efecto aditivo del compósito. Posteriormente, los tubos se incubaron a 37 °C, con agitación constante (160 rpm). Como control se utilizaron tubos con caldo Mueller-Hinton que contenían HCl 0.02 M y ácido acético al 1 % (pH 5.5). Los experimentos se realizaron por triplicado.

Determinación del efecto de la nisina, quitosano y del compósito nisina/quitosano

El efecto bactericida o bacteriostático de la nisina y el quitosano solos y en combinación, se determinó sobre dos bacterias multirresistentes seleccionadas. Lo anterior se realizó de acuerdo a Felicio et al(14) y Mirdamani et al(28) con algunas modificaciones. Tubos con caldo Mueller-Hinton conteniendo un inóculo de cada uno de los dos aislados de S. aureus ajustado a la turbidez del tubo 0.5 de la escala de McFarland, se mezclaron asépticamente con la CMI de la nisina, quitosano y del compósito nisina/quitosano. Posteriormente, los tubos se incubaron a 37 °C, con agitación constante (160 rpm). A continuación, el efecto de los

798


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

compuestos sobre la viabilidad de S. aureus se examinó a las 4, 8, 24, 32, 47, 52 y 72 h, mediante la siembra y conteo de células viables (UFC/ml) incubadas a 37 °C en agar MuellerHinton. Las UFC/ml de S. aureus se transformaron a logaritmos. Los experimentos se realizaron por triplicado.

Resultados

Identificación de aislados de S. aureus y evaluación de resistenciasusceptibilidad a antibióticos En un programa regional para el estudio de la mastitis en La Ciénega de Chapala, Michoacán, 363 vacas en ordeña pertenecientes a 30 hatos lecheros fueron analizadas. De acuerdo a la PC, 50.4 % (183) de las vacas mostraron mastitis subclínica. Muestras de leche de estas vacas fueron colectadas y utilizadas para el aislamiento de S. aureus, obteniéndose un total de 53 aislados, los cuales se identificaron mediante pruebas microscópicas y bioquímicas (fermentación de manitol, tinción de Gram, catalasa, coagulasa y reducción de telurito y actividad lipolítica). Asimismo, la identidad se confirmó por PCR, mediante la amplificación de un fragmento del gen nuc, que codifica para la nucleasa termoestable de S. aureus (Figura 1).

Figura 1: Amplificaciones representativas del fragmento del gen nuc (~ 218 pb) 1

2

3

4

~ 218 pb

Carril 1) Marcador de tamaño molecular 1 kb DNA ladder. Carril 2) Control positivo, S. aureus ATCC 27543. Carril 3) Aislado AMC-9. Carril 4) Aislado AMC-23.

799


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Los resultados de resistencia-susceptibilidad mostraron comportamientos variables de los 53 aislados frente a los antibióticos evaluados (Cuadro 1). Los compuestos hacia los cuales mostraron mayores índices de resistencia fueron a penicilina (92.4 %), dicloxacilina (67.9 %) y ampicilina (60.3 %) (beta-lactámicos). Índices de resistencia menores que van de 5.6 a 33.9 % se observaron en los 9 antibióticos restantes. Asimismo, se observó resistencia intermedia hacia cefuroxima (24.5 %), eritromicina (24.5 %) y ampicilina (20.7 %). Además, se obtuvieron altos índices de susceptibilidad hacia levofloxacina (100 %), trimetroprimasulfametoxazol (94.3 %) y gentamicina (88.6 %). Por otra parte, se observaron 34 patrones de resistencia distintos entre los 53 aislados de S. aureus, siendo los de resistencia a ampicilina-dicloxacilina-penicilina los de mayor frecuencia con 7 aislados. Finalmente, 7 (13.2 %) aislados se clasificaron como multirresistentes, ya que toleraron a tres o más antibióticos de grupos diferentes, de los cuales 5 (71.4 %) presentaron resistencia de 7 a 9 antibióticos (Cuadro 2).

Cuadro 1: Perfiles de susceptibilidad a antibióticos de los aislados de S. aureus asociados a mastitis bovina Número de aislados (%) Antibiótico

Resistentes

Intermedios

Susceptibles

Ampicilina

32 (60.3)

11 (20.7)

10 (18.8)

Cefalotina

18 (33.9)

4 (7.5)

31 (58.4)

Cepefima

11 (20.7)

6 (11.3)

36 (67.9)

Cofotaxima

11 (20.7)

10 (18.8)

32 (60.3)

Cefuroxima

12 (22.6)

13 (24.5)

28 (52.8)

Dicloxacilina

36 (67.9)

3 (5.6)

14 (26.4)

Eritromicina

16 (30.1)

13 (24.5)

24 (45.2)

Gentamicina

3 (5.6)

3 (5.6)

47 (88.6)

Levofloxacina

0 (0)

0 (0)

53 (100.0)

Penicilina

49 (92.4)

1 (1.8)

3 (5.6)

Tetraciclina

10 (18.8)

6 (26)

37 (69.8)

Trimetroprima-sulfametoxazol

3 (5.6)

0 (0)

50 (94.3)

800


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 2: Patrones de resistencia a antibióticos de los aislados de S. aureus Antibióticos

No. de aislados

DC AM, PE DC, FEP DC, GM DC, PE FEP, PE PE, TE AM, DC, PE AM, FEP, PE CF, CXM, PE CF, DC, PE DC, CTX, PE AM, CF, DC, PE AM, DC, E, PE AM, DC, PE, TE AM, E, FEP, PE CTX, CXM, FEP, PE CF, DC, E, PE DC, E, PE, SXT CF, DC, E, PE DC, E, GM, PE AM, CF, DC, E, PE AM, CF, CXM, DC, PE AM, CF, CTX, DC, PE AM, CTX, DC, FEP, PE CTX, DC, FEP, PE, TE AM, CTX, CXM, DC, PE AM, CF, CXM, DC, E, PE AM, CF, CXM, DC, E, PE, TE AM, CF, CTX, CXM, DC, FEP, PE AM, CF, CTX, CXM, DC, E, FEP, PE AM, CF, CTX, CXM, E, FEP, PE, SXT AM, CTX, CXM, E, FEP, PE, SXT, TE AM, CF, CTX, CXM, DC, E, FEP, GM, PE

1 5 1 1 2 1 4 7 1 1 1 1 2 1 2 1 1 2 1 1 1 2 1 1 1 1 1 1 2 1 1 1 1 1

AM ampicilina, CF cefalotina, FEP cefepima, CTX cefotaxima, CXM cefuroxima, DC dicloxacilina, E eritromicina, GM gentamicina, LEV levofloxacina, PE penicilina, TE tetraciclina, SXT trimetoprima-sulfametoxazol.

801


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Concentración mínima inhibitoria

La nisina mostró efecto antibacteriano en las concentraciones estudiadas, solo en 28 de los 53 aislados de S. aureus, así como en la cepa ATCC, en los cuales las CMI variaron entre 1.75 y 3.0 mg/ml. En el resto de los aislados se observó crecimiento aún a la concentración más alta de nisina utilizada en este estudio (3.0 mg/ml) (Cuadro 3). Por otra parte, el quitosano mostró efecto antibacteriano en los 53 aislados y la cepa de referencia de S. aureus ATCC. En estos casos las CMI oscilaron entre 1.5 y 2.5 mg/ml. De igual forma, el compósito nisina/quitosano mostró efecto antibacteriano importante sobre los 53 aislados y la cepa control, cuyas CMI fluctuaron entre 1.5/1.25 y 3.0/2.0 mg/ml, respectivamente. Para este último tratamiento, destacó que las CMI se redujeron en todos los casos en un rango de 0.25 a 0.5 mg/ml, en comparación con las de los compuestos cuando se utilizaron solos.

Cuadro 3: Concentración mínima inhibitoria (CMI) de la nisina, quitosano y del compósito nisina/quitosano sobre los aislados de S. aureus (mg/ml) Aislados de S. aureus AMC-7 AMC-9 AMC-10 AMC-12 AMC-13 AMC-14 AMC-18 AMC-21 AMC-22 AMC-23 AMC-25 AMC-26 AMC-28 AMC-30 AMC-31 AMC-34 AMC-35

CMI nisina

CMI quitosano

CMI nisinaquitosano

ND ND ND 3.0 3.0 3.0 3.0 ND ND ND 3.0 ND ND ND ND ND ND

2.0 2.0 2.0 2.0 2.0 2.0 2.0 1.75 2.0 2.0 2.0 2.0 2.5 2.0 1.75 2.0 2.5

2.75-1.75 2.75-1.75 2.75-1.75 2.75-1.75 2.75-1.75 2.75-1.75 2.75-1.75 2.5-1.25 2.75-1.5 2.5-1.25 2.75-1.75 2.75-1.75 3.0-2.0 2.5-1.75 2.5-1.25 2.5-1.5 2.5-1.5

802


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

AMC-36 AMC-37 AMC-38 AMC-43 AMC-44 AMC-48 AMC-50 AMC-51 AMC-61 AMC-73 AMC-76 AMC-78 AMC-84 AMC-85 AMC-96 AMC-97 AMC-101 AMC-107 AMC-108 AMC-109 AVC-1 AVC-2 AVC-3 AVC-5 AVC-6 AVC-7 AVC-9 AVC-10 AVC-11 AVC-12 AVC-13 AVC-14 AVC-16 AVC-17 AVC-18 AVC-24 ATCC-27543

3.0 3.0 ND ND 3.0 3.0 ND ND 3.0 3.0 ND 3.0 3.0 2.0 3.0 ND 3.0 3.0 ND ND 3.0 3.0 ND ND ND 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 ND 3.0 3.0 1.75

2.0 2.0 2.5 2.0 1.75 2.0 1.75 2.0 2.0 2.0 2.0 1.75 2.0 2.0 2.0 2.5 2.5 2.0 2.5 2.0 2.5 2.5 2.0 2.0 2.5 2.0 2.0 2.5 2.0 2.0 2.5 2.0 2.5 2.0 2.5 2.5 1.5

2018

2.5-1.5 2.5-1.5 2.75-1.75 2.75-1.75 2.5-1.25 2.75-1.75 2.75-1.5 2.75-1.75 2.75-1.75 2.5-1.5 2.5-1.5 2.5-1.25 2.75-1.75 1.5-1.5 2.75-1.75 2.75-1.75 2.75-1.75 2.5-1.5 3.0-2.0 2.5-1.5 2.5-1.5 2.5-1.5 2.75-1.75 2.75-1.75 2.75-1.75 2.5-1.5 2.75-1.75 2.75-1.75 2.5-1.5 2.75-1.75 2.75-1.75 2.75-1.75 2.75-1.75 2.75-1.75 2.75-1.75 2.75-1.75 1.5-1.25

ND= No determinada a la mayor concentración evaluada en este trabajo (3.0 mg/ml). Los valores representan la media de tres réplicas.

803


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Efecto bactericida

Se seleccionaron dos aislados multirresistentes (AMC-9 y AMC-23) para determinar el efecto antibacteriano de la nisina y el quitosano solos y en mezcla. En lo que se refiere al aislado AMC-9, la adición de la nisina (3.0 mg/ml) no mostró efecto inhibitorio, ya que, como lo muestra el Cuadro 4, el conteo de UFC/ml fue similar al testigo durante las 72 h que duró el experimento. Por su parte, tanto la adición del quitosano (2.0 mg/ml) como del compósito nisina/quitosano (2.75/1.75 mg/ml), mostró un efecto bactericida, ya que desde las 4 h el conteo de UFC disminuyó a cero en ambos tratamientos, manteniéndose así hasta las 72 h. Con relación al aislado AMC-23, la adición de la nisina (3.0 mg/ml) no mostró efecto inhibitorio, ya que el conteo de UFC/ml también fue similar al testigo, durante el experimento. De la misma manera que en el experimento anterior, tanto la adición del quitosano (2.0 mg/ml), como del compósito nisina/quitosano (2.5/1.25), mostraron un efecto bactericida, ya que desde las 4 h el conteo de UFC/ml disminuyó a cero en ambos tratamientos, manteniéndose así hasta las 72 h.

Cuadro 4: Reducción logarítmica de S. aureus por nisina, quitosano y el compósito nisina/quitosano (Log UFC/ml) S. aureus AMC-9

S. aureus AMC-23

Tiempo h/ tratamiento

0

7.45±0.13

7.45±0.13

4

8.21±0.18

0

0

8

8.71±0.06

0

24

9.18±0.20

32 47

N/Q

N/Q

8.50±0.46

8.50±0.46

8.61±0.16 8.80±0.18

0

0

0

8.88±0.12 8.95±0.03

0

0

0

0

9.24±0.28 9.08±0.02

0

0

9.40±0.06

0

0

9.31±0.16 9.43±0.07

0

0

9.28±0.07

0

0

9.34±0.08 9.50±0.03

0

0

52

9.46±0.09

0

0

9.30±0.20 9.30±0.03

0

0

72

8.20±0.10

0

0

8.71±0.48 9.28±0.01

0

0

Testigo*

7.45±0.13 7.90±0.57 8.50±0.46

ϯNisina:

3 mg/ml. 2 mg/ml. Nisina/quitosano: 2.75/1.75 mg/ml. Nisina/quitosano: 2.5/1.25 mg/ml. *Log UFC/ml promedio de AMC-9 y AMC-23. Los datos representan el promedio de 3 réplicas ± la desviación estándar. ¶Quitosano:

804


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Discusión

En este estudio se detectó una alta frecuencia de aislamientos resistentes a los antibióticos del grupo de los beta-lactámicos, principalmente a penicilina, dicloxacilina y ampicilina, los cuales son los antibióticos más utilizados en la región para el control de la mastitis, lo que sugiere que existe el riesgo de selección positiva de cepas resistentes(29). Estos resultados podrían deberse a que no existen programas de monitoreo de la resistencia a antibióticos en la región, lo que permitiría la adopción de medidas para evitar que la resistencia vaya en aumento. De la misma manera, la falta de protocolos de buenas prácticas de higiene durante la ordeña podría contribuir en los resultados observados. Todo lo anterior impacta de manera negativa en la economía del productor y en la salud pública, ya que, además de que la producción de leche disminuye, ésta es de menor calidad, debido a los residuos de antibióticos que contiene(30). Resultados similares han sido reportados en otras regiones del estado y del país. Se ha observado resistencia a penicilina, ceftazidima, dicloxacilina y ampicilina en aislados de S. aureus obtenidos de vacas lecheras mantenidas en traspatio en la región de Morelia, Michoacán(20). Asimismo, existen reportes de resistencia a penicilina y ampicilina de S. aureus asociado a mastitis bovina, aislado de granjas lecheras del estado de Guanajuato(31). Los resultados de la determinación de la CMI de la nisina muestran solo una susceptibilidad del 47.1 % de los aislados de S. aureus hacia este péptido antimicrobiano, lo que llama la atención, ya que éste no es utilizado en los hatos de la región como una alternativa terapéutica contra la mastitis bovina. Sin embargo, se ha reportado que S. aureus posee un alto potencial para el desarrollo de resistencia natural a la nisina en condiciones in vitro. Dicho reporte muestra que las bacterias con baja susceptibilidad presentan un fenotipo llamado colonias variantes pequeñas(32). Estas variantes se caracterizan por tener una tasa de crecimiento lenta, disminuyen su potencial transmembranal y alteran su metabolismo para resistir la acción del péptido(33). Sin embargo, se requiere trabajo adicional para analizar el mecanismo de baja susceptibilidad de aislados de S. aureus a la nisina. En relación al quitosano adicionado solo, éste mostró un efecto antibacteriano importante, ya que inhibió el crecimiento de todos los aislados de S. aureus (susceptibilidad del 100 %). Este resultado coincide con estudios que muestran que este compuesto tiene la capacidad de unirse a la superficie celular de bacterias Gram positivas, alterar la interacción entre la pared y la membrana celular y provocar un desbalance osmótico, lo que la lleva a muerte celular. Asimismo, este resultado es importante, ya que muestra el potencial de esta biomolécula, la

805


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

cual ha sido ampliamente estudiada como agente antimicrobiano en diferentes formas (biopelículas, soluciones y compósitos)(34). En este sentido, el compósito nisina/quitosano mostró un efecto antibacteriano importante, ya que inhibió a todos los aislados de S. aureus asociados a mastitis bovina (100 % de susceptibilidad). Adicionalmente, en este resultado se destaca que el efecto del compósito nisina/quitosano fue superior al de ambos compuestos adicionados solos, ya que las CMI del compósito disminuyeron entre 0.25 y 0.5 mg/ml para ambos compuestos. Este efecto podría deberse a que ambos poseen mecanismos de acción distintos, lo que podría haber mejorado la actividad antibacteriana al ser mezclados(35,36). Asimismo, la encapsulación del péptido podría haber mejorado su estabilidad y su protección de degradación proteolítica, lo que se reflejó en el efecto antimicrobiano(37). Los resultados anteriores son importantes porque muestran el potencial antibacteriano del compósito sobre aislados de S. aureus asociados a mastitis bovina, mismos que podrían ser utilizados en el tratamiento de la enfermedad. Asimismo, en este trabajo se muestra que el efecto del quitosano y del compósito nisina/quitosano sobre los aislados multirresistentes AMC-9 y AMC-23 es bactericida. Lo anterior, confirma la efectividad del quitosano y del compósito observada durante la determinación de las CMI. Se han reportado datos similares sobre el efecto del quitosano, los cuales muestran un efecto bactericida de la molécula sobre bacterias Gram positivas, lo cual depende de su peso molecular, nivel de desacetilación y concentración(37).

Conclusiones e implicaciones

Se identificaron aislados de S. aureus asociados a mastitis bovina de la región de La Ciénega de Chapala, Michoacán, observándose una alta frecuencia de aislamientos resistentes a los antibióticos del grupo de los beta-lactámicos. Los resultados de este estudio sugieren que el quitosano y la formación del compósito nisina/quitosano podrían tener el potencial tecnológico para ser utilizados en terapias de tratamiento contra la mastitis bovina, ya que inhibieron en un 100 % a los aislados de S. aureus; además de que, tanto la nisina como el quitosano son considerados compuestos GRAS (Generalmente Reconocidos como Seguros), por lo que podrían ser utilizados tanto en la formulación de selladores de pezones como de infusiones intramamarias. Sin embargo, es necesario ampliar las investigaciones hacia el posible efecto de los compuestos sobre bacterias Gram negativas asociadas a la enfermedad

806


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

y realizar investigaciones in vivo, así como estudios de citotoxicidad para considerar a estos compuestos como agentes terapéuticos de la mastitis bovina.

Agradecimientos

Este trabajo fue financiado por el Programa de Desarrollo Profesional Docente (PRODEP), Fortalecimiento de Cuerpos Académicos (Proyecto IDCA-11106) y por la Universidad de La Ciénega del Estado de Michoacán de Ocampo (UCEMICH).

Literatura citada: 1.

Hillerton JE, Berry EA. Treating mastitis in the cow-a tradition or an archaism. J Appl Microbiol 2005;98:1250-1255.

2.

Kerro-Dego O, van Dijk JE, Nederbragt H. Factors involved in the early pathogenesis of bovine Staphylococcus aureus mastitis with emphasis on bacterial adhesion and invasion. A review. Vet Q 2002;24:181-198.

3.

Díaz-Murillo V, Medina-Estrada I, López-Meza JE, Ochoa-Zarzosa A. Defensin thionin from Capsicum chinense has immunomodulatory effects on bovine mammary epithelial cells during Staphylococcus aureus internalization. Peptides 2016;78:109118.

4.

Almeida RA, Matthews KR, Cifrian E, Guidry AJ, Oliver SP. Staphylococcus aureus invasion of bovine mammary epithelial cells. J Dairy Sci 1996;79:1021-1026.

5.

Buzzola FR, Alvarez LP, Tuchscherr LP, Barbagelata MS, Lattar SM, Calvinho L, Sordeli DO. Differential abilities of capsulated and noncapsulated Staphylococcus aureus isolates from diverse agr groups to invade mammary epithelial cells. Infect Immun 2007;75:886-891.

807


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

6.

Barlow J. Mastitis therapy and antimicrobial susceptibility: a multispecies review with a focus on antibiotic treatment of mastitis in dairy cattle. J Mammary Gland Biol Neoplasia 2011;16:383-407.

7.

Bouchard DS, Rault L, Berkova N, Loir YL, Even S. Inhibition of Staphylococcus aureus Invasion into bovine mammary epithelial cells by contact with live Lactobacillus casei. J Appl Microbiol 2013;79:877-885.

8.

Holmes MA, Zadoks RN. Methicillin resistant Staphylococcus aureus in human and bovine mastitis. J Mammary Gland Biol Neoplasia 2011;16:373-382.

9.

Sakwinska O, Morisset D, Madec JY, Waldvogel A, Moreillon P, Haenni M. Link between genotype and antimicrobial resistance in bovine mastitis-related Staphylococcus aureus strains, determined by comparing Swiss and French isolates from the Rhone Valley. J Appl Microbiol 2011;77:3428-3432.

10. Piddock LJV. Does the use of antimicrobial agents in veterinary medicine and animal husbandry select antibiotic resistant bacteria that infect man and compromise antimicrobial chemotherapy? J Antimicrob Chemother 1996;38:1-3. 11. Haran KP, Godden SM, Boxrud D, Jawahir S, Bender JB, Sreevatsana S. Prevalence and characterization of Staphylococcus aureus, including Methicillin-Resistant Staphylococcus aureus, isolated from bulk tank milk from Minnesota dairy farms. J Clin Microbiol 2012;50:688-695. 12. Tong Z, Zhang Y, Ling J, Ma J, Huang L, Zhang L. An in vitro study on the effects of nisin on the antibacterial activities of 18 antibiotics against Enterococcus faecalis. Plos One 2014;9:1-9. 13. Goy RC, Morais STB, Assis OBG. Evaluation of the antimicrobial activity of chitosan and its quaternized derivative on Escherichia coli and Staphylococcus aureus growth. Rev Bras Farmacog 2016;26:122-127. 14. Felicio BA, Pinto MS, Oliveira FS, Lempk MW, Pires ACS, Lelis CA. Effects of nisin on Staphylococcus aureus count and physicochemical properties of Minas Frescal cheese. J Dairy Sci 2015;98:1-6. 15. Zhang H, Li R, Liu W. Effects of chitin and its derivative chitosan on postharvest decay of fruits: A review. Int J Mol Sci 2011;12:917-934. 16. López-Mata MA, Ruiz-Cruz S, Silva-Beltrán NP, Ornelas-Paz JJ, Zamudio-Flores PB, Burruel-Ibarra SE. Physicochemical, antimicrobial and antioxidant properties of chitosan films incorporated with carvacrol. Molecules 2013;18:13735-13753.

808


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

17. SIAP. Servicio de Información Agroalimentaria y Pesquera: http://infosiap.siap.gob.mx/anpecuario_siapx_gobmx/indexmpio.jsp. Consultado 26 Ene, 2017. 18. Brakstad OG, Aasbakk K, Maeland JA. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol 1992;30:1654-1660. 19. Pospiech A, Neumann B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet 1995;11:217-218. 20. Ochoa-Zarzosa A, Loeza-Lara PD, Torres-Rodríguez F, Loeza-Ángeles H, MascotChiquito N, Sánchez-Baca S, et al. Antimicrobial susceptibility and invasive ability of Staphylococcus aureus isolates from mastitis from dairy backyard systems. Anton Leeuw J 2008;94:199-206. 21. CLSI. Performance standards for antimicrobial susceptibility testing. 27th ed. M02-A12, M07-A10, and M11-A8. Clinical and Laboratory Standards Institute. 2017. 22. Srinivasan BV, Rajamohan G, Pancholi P, Stevenson K, Tadesse D, Patchanee P, et al. Genetic relatedness and molecular characterization of multidrug resistant Acinetobacter baumannii in central Ohio, USA. Ann Clin Microbiol Antimicrob 2009;8:1-21 23. Hammou FB, Skali SN, Idaomar M, Abrini J. The antimicrobial effect of Origanum compactum essential oil, nisin and their combination against Escherichia coli in tryptic soy broth (TSB) and in sheep natural sausage casings during storage at 25 and 7° C. Afr J Biotechnol 2011;10:15998-16005. 24. Liu J, Tiang S, Meng X, Xu Y. Effects of chitosan on control of postharvest diseases and physiological responses of tomato fruit. Postharvest Biol Technol 2007;44:300-306. 25. Zohri M, Alavidjeh MS, Haririan I, Ardestani MS, Ebrahimi SES, Sani HT, et al. A comparative study between the antibacterial effect of nisin and nisin-loaded chitosan/alginate nanoparticles on the growth of Staphylococcus aureus in raw and pasteurized milk samples. Probiotics Antimicro Prot 2010;2:258-266. 26. Rodríguez-Núñez JR, López-Cervantes J, Sánchez-Machado DI, Ramírez-Wong B, Torres-Chávez P, Cortez-Rocha MO. Antimicrobial activity of chitosan-based films against Salmonella typhimurium and Staphylococcus aureus. Int J Food Sci Tech 2012;47:2127-2133. 27. Andrews JM. Determination of minimum inhibitory concentrations. J Antimicrob Chemother 2001;48:5-16.

809


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

28. Mirdamani S, Aghaghazvini S, Ehsani MR, Falahpour M, Tafreshi SH. Inhibitory efficacy of Lactococcus lactis on food borne pathogens and food spoilage bacteria. J Biotechnol 2008;136:48. 29. Szweda P, Schielmann M, Frankowska A, Kot B, Zalewska M. Antibiotic resistance in Staphylococcus aureus strains isolated from cows with mastitis in Eastern Poland and analysis of susceptibility of resistant strains to alternative nonantibiotic agents: lysostaphin, nisin and polimyxin B. J Med Vet Sci 2014;76:355-362. 30. Bedolla CC, Ponce de León MER. Pérdidas económicas ocasionadas por la mastitis bovina en la industria lechera. Redvet 2008;19:1-26. 31. León-Galván MF, Barboza-Corona JE, Lechuga-Arana AA, Valencia-Posadas M, Aguayo DD, Cedillo-Pelaez C, et al. Molecular detection and sensitivity to antibiotics and bacteriocins of pathogens isolated from bovine mastitis in family dairy herds of central Mexico. Biomed Res Int 2015;ID 615153. 32. Blake KL, Randall ChP, O’Neill AJ. In vitro studies indicate a high resistance potential for the lantibiotic nisin in Staphylococcus aureus and define a genetic basis for nisin resistance. Antimicrob Agents Chemother 2011;55:2362-2368. 33. Andersson DI, Hughes, D, Kubicek-Sutherland JZ. Mechanisms and consequences of bacterial resistance to antimicrobial peptides. Drug Resist Update 2016;26:43-57. 34. Kong M, Chen XG, Xing K, Park HJ. Antimicrobial properties of chitosan and mode of action: A state of the art review. Int J Food Microbiol 2010;144:51-63. 35. Cotter PD, Hill C, Ross RP. Bacteriocins: Developing innate immunity for food. Nat Rev Microbiol 2005;3:777-788. 36. Piras AM, Maisetta G, Sandreschi S, Gazzarri M, Bartoli C, Grassi L, Esin S, Chiellini F, Batoni G. Chitosan nanoparticles loaded with the antimicrobial peptide temporin B exert a long-term antibacterial activity in vitro against clinical isolates of Staphylococcus epidermidis. Frontiers Microbiol 2015;6:1-10. 37. Tareq A, Alam M, Raza S, Sarwar T, Fardous Z, Alamgir Z, et al. Comparative study of antibacterial activity of chitin and chemically treated chitosan prepared from shrimp (Macrobrachium Rosenbergii) shell waste. J Virol Microbiol 2013; ID 369217.

810


http://dx.doi.org/ 10.22319/rmcp.v9i4.4534 Artículo

Caracterización y tipificación de explotaciones de dehesa asociadas a cooperativas: un caso de estudio en España Characterization and typification of dehesa farms associated to cooperatives: a case study in Spain

Francisco Maroto-Molinaa* Augusto Gómez-Cabreraa José E. Guerrero-Ginela Ana Garrido-Varoa José A. Adame-Silesa Dolores C. Pérez-Marína

a

Universidad de Córdoba. Departamento de Producción Animal. ETSIAM. CN IV, km 396, Córdoba, España.

* Autor de correspondencia: g02mamof@uco.es

Resumen: El objetivo fue caracterizar y tipificar un grupo de explotaciones de dehesa asociadas a una cooperativa de cebo, sacrificio y comercialización de terneros, analizando los sistemas de producción de las distintas tipologías de explotaciones. Se realizaron 114 encuestas, en las que se recolectó información sobre la mano de obra, la base animal, la base territorial y el manejo del ganado vacuno en las explotaciones. Se utilizaron estadísticos descriptivos y análisis multivariantes para definir las relaciones entre las variables y establecer tipologías de explotaciones. En general, las explotaciones disponen de una superficie pequeña (224 ha), predominando la tierra en propiedad (73 %) y la mano de obra familiar (61 %). La mayoría


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

de las explotaciones combinan varias especies ganaderas, destacando las asociaciones vacuno-porcino ibérico (53 %) y vacuno-ovino-porcino ibérico (25 %). La intensificación de la producción es habitual, como se refleja en la superficie cultivada anualmente (47 % de la tierra arable) y en la carga ganadera (0.73 unidades de ganado mayor/ha). Se observa una gran variabilidad entre explotaciones. Se establecieron cuatro tipologías en función de su tamaño, sus estrategias de diversificación de la producción y sus prácticas de manejo. La tipología más numerosa es la formada por las explotaciones más pequeñas (122 ha). La mayoría de las explotaciones grandes de la zona no participan en la cooperativa, o la han abandonado, porque tienen más facilidad que las pequeñas en seguir una estrategia de venta o cebo de los terneros a título individual. Palabras clave: Ganadería extensiva, Diversificación, Intensificación, Cadena de valor.

Abstract: The objective was to characterize and typify a group of dehesa farms associated to a cooperative dedicated to the fattening, slaughtering and trading of beef cattle, by studying the production systems of the different farm typologies. One hundred and fourteen (114) farms were surveyed, collecting data on the characteristics of labor, herd, territorial basis and cattle management. Descriptive statistics and multivariate analyses were used to understand the relationships among variables and to define farm typologies. In general, farms are smallsized (224 ha), land-owned (73 %) and family-run (61 %). Most farms have several livestock species, highlighting beef cattle-Iberian pig (53 %) and beef cattle-sheep-Iberian pig (25 %) associations. Production intensification is widespread, as reflected in the average rate of cultivated area (47 % of arable land) and stocking rate (0.73 livestock units/ha). There is an important variability among farms. Four (4) farm typologies were stablished varying on farm size, production diversification strategies and management practices. The most numerous typology is that of the smallest farms (122 ha). Large farms are not associated to the cooperative, or have left it, because they have better possibilities for fattening and trading of calves at individual level than small farms. Key words: Extensive livestock farming, Diversification, Intensification, Value chain.

Recibido 22/06/2017 Aceptado 20/12/2017

812


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Introducción

La dehesa es un ecosistema propio de los ambientes mediterráneos de la Península Ibérica, que se caracteriza por presentar un estrato arbóreo ralo de especies esclerófilas, fundamentalmente encinas (Quercus ilex L.) y alcornoques (Quercus suber L.), y un estrato inferior de terófitos, originado en la actividad humana de transformación del bosque esclerófilo original(1). La dehesa tiene un uso múltiple, agrícola, ganadero y forestal, si bien en las dehesas de encinas predomina el uso ganadero(2). La dehesa ha sido reconocida como un sistema de Alto Valor Natural, pues provee de servicios ecosistémicos y favorece la conservación de la biodiversidad(3); la ganadería extensiva juega un papel fundamental en la conservación y manejo de estos sistemas(4) y en la fijación de la población rural(5). Debido a la diversidad y complejidad de los sistemas de producción ganadera extensiva, numerosos estudios científicos han caracterizado y tipificado las explotaciones de dehesa. Milán et al(6) encuestaron 130 explotaciones de vacuno de razas autóctonas con un tamaño medio de 125 vacas y 548 ha, diferenciando cuatro tipologías de explotaciones en función del tamaño, la productividad de la mano de obra, el grado de especialización y el grado de intensificación. También se muestreó el 10 % de las explotaciones de vacuno ecológico de las dehesas de Andalucía, encontrando un tamaño medio de 99 vacas y 524 ha(7). García et al(8) encuestaron 206 explotaciones de dehesa, que agruparon en tres tipologías en base a las características de las fincas y el nivel de intensificación. Los estudios revisados analizan los sistemas de producción tradicionales, y mayoritarios, en los que los animales se producen en la dehesa, pero se ceban y sacrifican en otras explotaciones, en muchos casos lejos de las zonas de origen(9). En los últimos años han aparecido cooperativas de ganaderos dedicadas al cebo, sacrificio y comercialización en común. Estas cooperativas son habituales en el sector ovino(10), pero en el caso de las ganaderías de vacuno de carne son poco frecuentes. Las cooperativas son importantes para la supervivencia de las explotaciones(11,12), pues permiten a los ganaderos avanzar en la cadena de valor. Sin embargo, las características de los sistemas de producción de las explotaciones que deciden asociarse en estas cooperativas han sido poco estudiadas. El objetivo del presente trabajo fue caracterizar y tipificar un grupo de explotaciones de dehesa asociadas a una cooperativa de cebo, sacrificio y comercialización de terneros, analizando los sistemas de producción de las distintas tipologías de explotaciones que se asocian en estas cooperativas.

813


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Material y métodos

a) Área de estudio

El área de estudio se localiza en el sur de España y comprende dos comarcas de la provincia de Córdoba: Los Pedroches y Valle del Guadiato. Esta área, caracterizada por la abundancia de dehesas de encinas, comprende unos 6,100 km2 con una densidad de población baja de 14 habitantes/km2. El clima es mediterráneo con veranos secos y cálidos e inviernos templados, siendo la temperatura media anual de 15 ºC. La altitud varía de 500 msnm en la zona noroeste a 800 msnm en el sureste. La precipitación media anual es de 550 mm, llegando a 900 mm en la zona más alta. Las explotaciones estudiadas están asociadas a una cooperativa que asume el cebo de los terneros (desde aproximadamente los 250 kg de peso vivo hasta los 550 kg, en el caso de los machos, y los 450 kg en el de las hembras), su sacrificio y la comercialización de las canales o piezas. Los ganaderos reciben un pago individualizado por ternero que depende de los ingresos por la venta de su canal, que a su vez depende del peso y la conformación de la misma, y de los costes asociados a su cebo, que son función del tiempo que cada animal ha pasado en el cebadero cooperativo hasta alcanzar el peso de sacrificio.

b) Origen de los datos

Los datos usados se obtuvieron mediante una encuesta a los ganaderos. Los datos hacen referencia al año 2011, si bien para los parámetros con variabilidad interanual, como el peso de los terneros a la entrada en el cebadero comunitario, se utilizó la media de los años 20092011. El cuestionario se diseñó partiendo de una revisión bibliográfica de estudios de caracterización de explotaciones(6,7,8), e incluye datos cuantitativos y cualitativos sobre los siguientes aspectos: mano de obra; base animal incluyendo las diferentes especies ganaderas que comparten el territorio; base territorial; y manejo de la alimentación, la reproducción y la sanidad en el caso del vacuno, por ser ésta la producción integrada en el sistema

814


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

cooperativo. Además, se registró la localización geográfica de cada explotación. No se utilizaron datos económicos debido a la ausencia de registros fiables a nivel de explotación individual. La carga ganadera se calculó mediante la metodología más habitual en los estudios de caracterización de explotaciones de dehesa(13,14), que consiste en estandarizar la carga de cada especie, a unidades de ganado mayor (UGM). Los factores de conversión usados fueron: 1 UGM para vacunos mayores de 24 meses; 0.6 UGM para el resto de vacunos; 1 UGM para equinos; 0.15 UGM para ovinos y caprinos; 0.5 UGM para porcinos reproductores; y 0.3 para porcinos en pastoreo. En las dehesas de encinas es habitual la producción de cerdos ibéricos, que se alimentan de bellotas y pasto durante la fase de acabado o montanera (octubre a marzo). Las cerdas reproductoras, destinadas a la producción de lechones, pueden localizarse en las dehesas o en explotaciones intensivas fuera de las mismas. En el primer caso, las cerdas suelen alojarse en cercados de un tamaño relativamente pequeño, por lo que su presión sobre el sistema pastoral es baja(8). Debido a ello, algunos autores optan por excluir las cerdas reproductoras del cálculo de la carga ganadera. En este estudio se ha optado por calcular dos valores de carga ganadera, incluyendo y excluyendo los reproductores porcinos, con el objetivo de enriquecer la discusión de los resultados. Se realizaron encuestas a todas las explotaciones asociadas a la cooperativa, recogiéndose 114 encuestas válidas, lo que supone un 80 % del total.

c) Análisis estadístico

Se calcularon los promedios, o frecuencias de las clases, las desviaciones y las correlaciones bivariadas para todas las variables disponibles. A continuación, se realizó un análisis multivariante de los datos, consistente en un análisis factorial seguido de un análisis de conglomerados. Se utilizó el paquete estadístico SPSS v18. El análisis factorial permite analizar la estructura de las correlaciones existentes entre un gran número de variables, definiendo una nueva serie de variables independientes, conocidas como factores, con una pérdida de información mínima. Debido a la existencia de variables cualitativas, se usó el análisis de correspondencias múltiples (ACM), siendo el porcentaje de varianza explicada, el criterio que define el número de factores a extraer. Las variables cuantitativas se dividieron en tres clases en base a los valores del primer y el tercer cuartil. Los datos de la variable transformada representan las frecuencias de las observaciones por debajo del primer cuartil, entre el primer y el tercer cuartil, y por encima del tercer cuartil,

815


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

tal y como sugieren Solano et al(15). Las variables binarias se transformaron en variables ordinales, definidas como el número de técnicas de gestión de la alimentación, la reproducción o la sanidad, respectivamente, que usa cada explotación. La selección de las variables incluidas en el ACM se basó en los siguientes criterios: que sean variables discriminativas, es decir, que tengan un coeficiente de variación alto, que no tengan una correlación muy alta con otras variables, y que sean relevantes en cuanto a la descripción del sistema de producción. A continuación, se realizó un análisis de conglomerados con el fin de agrupar las observaciones con características similares. Se utilizó el método de Ward, que minimiza las diferencias intragrupo, usando la distancia euclídea como medida de similitud. Las variables usadas en el análisis de conglomerados fueron los factores obtenidos en el ACM. El análisis de varianza de un factor (ANOVA) y la prueba de Waller-Duncan se usaron para estudiar la significación de las diferencias entre las medias de las variables cuantitativas para cada grupo. En el caso de las variables cualitativas se usó la prueba Ji-cuadrada.

Resultados

a) Caracterización general de las explotaciones

Los Cuadros 1 y 2 presentan los estadísticos descriptivos de las variables cuantitativas y cualitativas para el conjunto de las explotaciones. Los altos valores de la desviación estándar de algunas variables sugieren la coexistencia de distintas tipologías de explotaciones. La mayoría de los titulares de explotación son hombres, siendo la forma jurídica más habitual la de persona física. La edad media de los ganaderos es alta, con sólo 11 % de los ganaderos por debajo de los 40 años. La mano de obra es fundamentalmente familiar. Casi el 40 % de los ganaderos obtiene más de la mitad de sus rentas de actividades no relacionadas con la ganadería. De estos, la mitad trabaja en el sector servicios, destacando los comerciales y los veterinarios, y un tercio reciben una pensión de jubilación. La mitad de los ganaderos es usuario de nuevas tecnologías: internet y correo electrónico. Se observa una correlación significativa entre el uso de estas herramientas y la edad del ganadero (R= -0.29).

816


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 1: Estadísticos descriptivos de las variables cuantitativas Variables Edad ganadero, años Nº vacas Nº vacas raza3/Nº vacas, % Nº toros Nº toros raza3/Nº toros, % Nº novillas Nº novillas raza3/Nº novillas, % Nº derechos nodriza4 Nº derechos nodriza4/Nº hembras, % Nº vacas por toro Nº novillas por vaca Nº ovejas Nº cabras Nº cerdas reproductoras Nº cerdos montanera Nº equinos UGM totales UGM vacuno/UGM totales, % UGM ovino/UGM totales, % UGM porcino/UGM totales, % Superficie pastos naturales en propiedad, ha Superficie pastos naturales arrendada, ha Superficie cultivo en propiedad, ha Superficie cultivo arrendada, ha Superficie cultivada cada año, ha Superficie total, ha Superficie pastos naturales/superficie total, % Superficie cultivo/superficie total, % Superficie en propiedad/superficie total, % Superficie arrendada/superficie total, % Superficie cultivada cada año/superficie cultivo, % UGM/superficie total (sin cerdas reproductoras) UGM/superficie total (con cerdas reproductoras) Nº cerdos montanera/superficie total Duración cubrición vacas, meses Nº terneros destetados por año Nº terneros destetados por vaca Nº vacas desechadas por año Nº vacas desechadas/Nº vacas, % Peso terneros entrada cebadero, kg 1 La

Nº 1 112 114 114 114 114 114 114 114 114 114 114 32 3 58 46 7 114 114 114 114 114 114 114 114 60 114 114 114 114 114 60 114 114 46 37 97 97 91 91 99

Media 53.4 55.4 26.4 2.6 98.7 10.2 35.5 40.5 62.7 22.4 0.22 257.1 120.0 119.4 204.7 25.6 132.1 57.2 7.2 33.9 97.3 24.9 67.0 35.0 33.1 224.1 55.1 44.9 72.8 27.2 46.7 0.52 0.73 0.80 6.6 43.0 0.83 4.3 9.3 260.1

DE 12.5 57.5 40.6 2.6 10.4 10.3 47.7 42.6 30.5 10.7 0.19 280.0 113.6 109.8 376.2 17.1 152.2 25.1 15.0 23.5 274.9 61.0 108.9 103.2 33.6 313.4 42.2 42.2 36.8 36.8 37.2 0.21 0.39 0.43 1.2 38.0 0.17 3.4 4.7 36.1

ACM2

media y la desviación estándar (DE) se refieren sólo a aquellas explotaciones que disponen de un dato distinto de cero para la variable en cuestión. 2 Variables incluidas en el análisis de correspondencias múltiples. 3 Animales de razas foráneas especializadas, Charolais o Limousin. 4 Derechos de pago a vacas nodrizas de la Política Agraria Común (16). UGM= unidades de ganado mayor.

817

* *

* * * * * * * *

* * * * *


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 2: Porcentaje de explotaciones en cada clase de las variables cualitativas Variables

Nº datos1

Clases

%

Sexo ganadero

82

Forma jurídica

114

Agricultor título principal3 Otras actividades

114 45

Tipo mano de obra

114

Usuario TIC Evolución prevista rebaño

114 114

Presencia ovino Presencia caprino Presencia porcino reproductor Presencia porcino montanera Presencia equinos Monta dirigida5 Cubrición estacional Diagnóstico gestación Aporte concentrados antes destete Aporte concentrados después destete Oficialmente indemne tuberculosis6 Oficialmente indemne brucelosis6 Plan vacunación vacas Plan vacunación terneros Plan desparasitación vacas Plan desparasitación terneros

114 114 114 114 114 71 114 114 114 114 114 114 114 114 114 114

Hombre Mujer Persona física Sociedad civil privada Comunidad de bienes Sociedad limitada Sí/No4 Agricultura Industria Servicios Jubilado Familiar Mixta Contratada Sí/No4 Aumentar Mantener Decrecer Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4 Sí/No4

68 32 72 14 8 6 61 14 0 50 36 61 26 13 51 22 68 10 28 3 51 40 6 30 32 14 58 75 91 94 83 46 75 52

1 El

ACM2

porcentaje se refiere sólo a aquellas explotaciones que disponen de un dato distinto de cero para la variable en cuestión. 2 Variables incluidas en el análisis de correspondencias múltiples. 3 Ganaderos con más del 50 % de las rentas procedentes de la actividad agraria. 4 En las variables dicotómicas el porcentaje se refiere a las respuestas afirmativas. 5 Control de la paternidad utilizando un único toro para cada lote de vacas. 6 Calificación sanitaria oficial de acuerdo a la legislación española (17). TIC= usuarios de las tecnologías de la información y la comunicación.

818

*

* * * * * * * * * *


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

La superficie total media de las explotaciones es de 224 ha, aunque se observa una gran variabilidad. La tasa de superficie en propiedad es alta, pues el 57 % de los ganaderos no arriendan tierras y sólo en el 25 % de los casos la superficie arrendada es superior al 50 % del total. En el 29 % de las explotaciones toda la superficie corresponde a pastos naturales, en los que el ganado aprovecha la vegetación espontánea. En el 25 % toda la superficie se cultiva con especies forrajeras mediante un sistema de parcelas rotacionales. El resto de las explotaciones combinan superficie de pastos naturales y superficie de cultivo. Se observa que las dehesas con un bajo porcentaje de superficie de cultivo (<20 %) se encuentran mayoritariamente en la zona noroccidental de las comarcas estudiadas, donde, además de una menor precipitación anual, se encuentran los suelos más pobres. El 84 % de los ganaderos explota varias especies conjuntamente, destacando las asociaciones vacuno-porcino ibérico, y vacuno-ovino-porcino ibérico; si bien en algún caso existen otras especies como las cabras y los caballos. Los hatos de vacuno tienen un tamaño medio de 55 vacas y los de ovino de 257 ovejas. En el caso del porcino ibérico, las explotaciones que sólo cuentan con reproductores, el 37 % del total, tienen un censo medio de 139 cerdas; las que sólo producen cerdos de montanera, el 26 %, tienen una media de 182 cerdos; y las que cuentan con ambos tipos de animal, tienen en promedio 64 cerdas reproductoras y 247 cerdos de montanera. La carga ganadera es alta, con un promedio de 0.52 UGM/ha o 0.73 UGM/ha si se consideran las cerdas reproductoras, y presenta una correlación significativa con la superficie total (R= -0.24). La alimentación del ganado se basa en el pastoreo libre y el aporte de suplementos en épocas desfavorables, normalmente en la época estival. Los forrajes cultivados, se consumen en fresco o bien conservados en forma de heno. En conjunto, el 45 % de la superficie de las explotaciones encuestadas es cultivable, de la cual el 47 % se rotura y siembra cada año. Se observa una correlación significativa entre el porcentaje de tierra cultivable de la explotación y el porcentaje de las UGM correspondiente al ovino (R= -0.35). Como se ha explicado, las dehesas con menos superficie de cultivo se encuentran en la zona de suelos más pobres, donde la vegetación natural suele alcanzar un porte bajo, siendo más adecuada para el ovino que para el vacuno. En el caso del vacuno, la mayor parte de los ganaderos aporta concentrados a los terneros durante o tras la lactación para prepararlos para la fase de cebo intensivo. Los terneros se envían al cebadero comunitario con un peso medio de 260 kg. Las técnicas de manejo reproductivo del ganado vacuno más frecuentes son la monta libre y la cubrición continua. No obstante, casi un tercio de las explotaciones separan los toros y las vacas durante unos meses al año para evitar partos de finales de primavera y verano. Se observa una correlación significativa entre el uso de la cubrición estacional y el número de vacas (R= 0.28). En cuanto a la base genética, el 65 % de las vacas procede de cruces de razas autóctonas con toros Charolais o Limousin, mientras que la práctica totalidad de los toros son de pura raza 819


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

(Cuadro 3). Cabe destacar que sólo el 21 % de las vacas descritas como de pura raza por los ganaderos entrevistados están inscritas en el correspondiente Libro Genealógico, mientras que en el caso de los toros este valor es del 94 %. En el área de estudio, los ganaderos suelen producir sus propias novillas de reposición, pero los toros son comprados a otras explotaciones para evitar problemas de consanguinidad. Dado que la mayoría de las explotaciones sólo tienen toros Charolais o Limousin, los ganaderos suelen considerar que las novillas son de pura raza después de uno o varios cruces de absorción. El número de novillas presentes por vaca es 0.22, lo que corresponde a una tasa de reposición en torno al 15 %, entendiendo como novillas las hembras de reposición entre 6 y 24 meses de edad. El número medio de vacas por toro es 22, aunque este dato es muy variable. Se observa una correlación significativa entre el número de vacas y el número de vacas por toro (R= 0.23), ya que incluso en los hatos con pocas nodrizas suele haber al menos un toro, pues no se utiliza la inseminación artificial. El uso de otras técnicas de control reproductivo, como el diagnóstico de gestación, es también minoritario. En promedio, los ganaderos declaran destetar 0.83 terneros por vaca y año. Se observa una correlación significativa de este índice con el porcentaje de vacas de razas autóctonas en el rebaño (R= 0.27). Esta correlación no indica necesariamente que las vacas autóctonas tengan una mejor productividad, pues multitud de factores pueden estar influyendo. Por ejemplo, los ganaderos de la zona tienden a percibir a las vacas Charolais o Limousin como más valiosas que las autóctonas, siendo más reacios a eliminarlas cuando detectan problemas reproductivos.

Cuadro 3: Composición racial de los rebaños Razas y cruces Rubia de Aquitania Charolais Limousin Negra andaluza Retinta Simmental Braunvieh x Charolais Braunvieh x Limousin Charolais x Limousin Holstein x Charolais Pajuna x Braunvieh Retinta x Charolais Retinta x Limousin Retinta x Braunvieh Desconocido x Charolais o Limousin 1Los

% Animales Vacas Toros 0.0 12.8 14.2 1.8 4.9 0.0 1.1 0.9 18.5 0.2 0.7 3.5 5.7 0.2 35.6

1.7 45.3 47.3 1.0 3.7 0.3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.7

% Explotaciones1 Vacas Toros 0.0 18.4 20.2 0.9 9.6 0.0 1.8 0.9 14.0 0.9 0.9 5.3 6.1 0.9 49.1

0.9 57.9 68.4 0.9 7.0 0.9 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 1.8

porcentajes no suman 100 porque algunas explotaciones usan varias razas o cruces.

820


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

En el aspecto sanitario, casi todas las explotaciones disponen de la máxima calificación sanitaria respecto a brucelosis y tuberculosis(17). El 75 % de las mismas dispone de planes de vacunación y desparasitación de las nodrizas, no así de los terneros. Las enfermedades más frecuentes son la diarrea viral bovina y la parainfluenza en adultos, y la diarrea neonatal en terneros, si bien su prevalencia es baja.

b) Análisis de correspondencias múltiples

Se obtuvieron cinco factores que explican el 69.91 % de la varianza. El primer factor (F1) explica el 17.13 % de la varianza y representa el tamaño de la explotación; las variables que más contribuyen en este primer eje son superficie total, nº vacas, nº cerdos en montanera y nº cerdas reproductoras. También son importantes las variables relativas al uso de técnicas de gestión reproductiva y a la carga ganadera. El segundo factor (F2) explica el 17.06 % de la varianza y se refiere a la importancia relativa del ovino. Las variables más importantes en este caso son nº ovejas, UGM ovino/UGM totales, UGM vacuno/UGM totales y superficie arrendada/superficie total. El tercer factor (F3) explica el 12.96 % de la varianza y se corresponde con la importancia relativa del porcino reproductor en las explotaciones. El nº cerdas reproductoras y la carga ganadera son las variables con una mayor contribución en este eje. Les siguen las variables UGM vacuno/UGM totales y superficie cultivo/superficie total. El cuarto factor (F4) explica el 11.74 % de la varianza y representa la presión sobre el sistema pastoral, siendo la variable más importante la carga ganadera excluyendo las cerdas reproductoras. Destaca también en este eje la variable nº derechos nodriza/nº hembras. El quinto factor (F5) explica el 11.02 % de la varianza y representa el nivel de intensificación. Las variables con mayor peso son las relativas al uso de técnicas de gestión reproductiva y al manejo sanitario, así como el porcentaje de vacas de razas especializadas en el rebaño y el porcentaje de superficie de cultivo.

c) Tipologías de explotaciones

El análisis de conglomerados jerárquicos permite establecer cuatro tipologías de explotaciones. Los valores medios de las variables cuantitativas para cada tipología se

821


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

presentan en el Cuadro 4 y el porcentaje de explotaciones en cada clase de las variables cualitativas en el Cuadro 5.

Cuadro 4: Promedio de las variables cuantitativas para cada tipología Variables Edad ganadero, años Nº vacas Nº vacas raza1/Nº vacas, % Nº toros Nº toros raza1/Nº toros, % Nº novillas Nº novillas raza1/Nº novillas, % Nº derechos nodriza2 Nº derechos nodriza2/Nº hembras, % Nº vacas por toro Nº novillas por vaca Nº ovejas Nº cabras Nº cerdas reproductoras Nº cerdos montanera Nº equinos UGM totales UGM vacuno/UGM totales, % UGM ovino/UGM totales, % UGM porcino/UGM totales, % Superficie pastos naturales en propiedad, ha Superficie pastos naturales arrendada, ha Superficie cultivo en propiedad, ha Superficie cultivo arrendada, ha Superficie cultivada cada año, ha Superficie total, ha Superficie pastos naturales/superficie total, % Superficie cultivo/superficie total, % Superficie en propiedad/superficie total, % Superficie arrendada/superficie total, % Superficie cultivada cada año/superficie cultivo, % UGM/Superficie total (sin cerdas reproductoras) UGM/Superficie total (con cerdas reproductoras) Nº cerdos montanera/superficie total Duración cubrición vacas, meses Nº terneros destetados por año Nº terneros destetados por vaca Nº vacas desechadas por año Nº vacas desechadas/Nº vacas, % Peso terneros entrada cebadero, kg

1 54.9 40.1ab 25.1 2.0ab 98.6 8.1ab 30.4 29.6ab 64.2 21.9 0.22 98.8a 40.0 61.5a 89.5a 16.8 74.9a 67.6b 2.3a 28.9a 50.2a 12.7a 46.6a 12.5a 23.4a 122.0a 50.7 49.3 81.1b 18.9a 46.7 0.55a 0.71ab 0.82a 6.5 32.2a 0.84b 3.5ab 9.9 258.6

1 Animales

Grupos 2 3 53.4 51.7 64.2b 31.4a 31.9 16.7 2.8b 1.4a 100.0 95.8 15.0bc 3.4a 52.9 27.8 49.4bc 20.5a 54.1 56.7 24.6 22.5 0.26 0.14 213.3ab 280.0b 160.0 252.1b 40.6a 35.0a 137.5ab 31.0 212.0b 99.6a 34.6a 35.6a a 2.9 37.2b 60.6b 21.8a 91.1ab 25.2a 23.6a 74.0b a 82.5 25.4a a 57.8 49.3a a 31.8 17.0a b 255.0 173.8ab 61.0 65.9 39.0 34.1 66.1b 27.8a 33.9a 72.2b 55.5 30.6 0.38a 0.55a 1.05b 0.63a a 0.12 0.78a 6.2 61.6b 20.3a 0.81b 0.74a 5.3b 1.9a 8.3 8.9 264.0 264.9

4 55.4 124.3c 31.0 5.5c 100.0 16.6c 52.3 66.9c 54.1 22.0 0.14 170.0ab 76.0a 203.6b 205.9b 66.9b 2.0a 31.1a 144.8b 33.8ab 182.0b 64.6a 75.5b 425.1c 47.7 52.3 76.4b 23.6a 34.7 0.49a 0.51a 0.53a 7.3 113.3c 0.94c 11.4c 11.0 260.1

P valor 0.83 0.00 0.78 0.00 0.76 0.00 0.23 0.00 0.41 0.82 0.24 0.00 0.58 0.00 0.00 0.31 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.01 0.00 0.00 0.59 0.59 0.00 0.00 0.57 0.02 0.00 0.05 0.41 0.00 0.06 0.00 0.63 0.93

de razas foráneas especializadas, Charolais o Limousin. de pago a vacas nodrizas de la Política Agraria Común (16). UGM= unidades de ganado mayor. a,b,c Letras distintas en la misma fila señalan diferencias significativas (P<0.05). 2 Derechos

822


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 5: Porcentaje de explotaciones en cada clase de las variables cualitativas para cada tipología Variables Sexo ganadero

Grupos 2 3 78 87 22 13 53 66 29 17 12 0 6 17 65 92 0 0 0 0 60 100 40 0 59 84 23 8 18 8 41 17 23 33 65 42 12 25 18a 92b

Presencia ovino

Clases Hombre Mujer Persona física Sociedad civil privada Comunidad de bienes Sociedad limitada Sí/No2 Agricultura Industria Servicios Jubilado Familiar Mixta Contratada Sí/No2 Aumentar Mantener Decrecer Sí/No2

1 67 33 80 9 9 2 55 4 0 54 42 65 23 12 57 18 75 7 17a

4 60 40 63 5 0 12 63 50 0 0 50 25 63 12 63 25 63 12 13a

P valor 0.60

Presencia caprino Presencia porcino reproductor

Sí/No2 Sí/No2

1a 45a

0a 100b

17b 42a

0a 25a

0.02 0.00

Presencia porcino montanera

Sí/No2

39a

6a

33a

88b

Presencia equinos Monta dirigida3 Cubrición estacional

Sí/No2

0.00

Sí/No2

6 28 29a

12 46 29a

0 20 0a

0 38 75b

0.50 0.60 0.01

Diagnóstico gestación

Sí/No2

13

12

0

38

0.11

Aporte concentrados antes destete Aporte concentrados después destete

Sí/No2 Sí/No2

55 72

71 76

50 83

50 88

0.62 0.71

Oficialmente indemne tuberculosis4

Sí/No2

91

94

92

88

0.96

Oficialmente indemne Plan vacunación vacas

Sí/No2 Sí/No2

91 87

94 88

100 58

100 75

0.59 0.08

Plan vacunación terneros

Sí/No2

57b

29a

17a

25a

0.01

Plan desparasitación vacas

Sí/No2

75

76

67

75

0.93

Plan desparasitación terneros

Sí/No2

51

65

33

50

0.43

Forma jurídica

Agricultor título principal1 Otras actividades

Tipo mano de obra Usuario TIC Evolución prevista rebaño

Sí/No2

brucelosis4

a,b Letras distintas en la misma fila señalan diferencias significativas (P<0.05). con más del 50% de las rentas procedentes de la actividad agraria. 2En las variables dicotómicas el porcentaje se refiere a las respuestas afirmativas. 3Control de la paternidad utilizando un único toro para cada lote de vacas. 4Calificación sanitaria oficial de acuerdo a la legislación española (17). 1Ganaderos

823

0.19

0.12 0.37

0.16 0.06 0.38 0.00


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

El grupo 1 está constituido por 69 explotaciones (61 %) con una media de 122 ha y 40 hembras reproductoras. Se caracterizan por la coexistencia de varias especies ganaderas, destacando la asociación vacuno-porcino ibérico. La tasa de tierra en propiedad y la carga ganadera son altas. El grupo 2 incluye 17 explotaciones (15 %) con una media de 255 ha y 64 vacas. El ganado principal de estas explotaciones es el porcino reproductor, dedicado a la producción de lechones para el cebo intensivo o la montanera en otras explotaciones. Las explotaciones de este grupo se sitúan mayoritariamente en la zona noroeste del área de estudio, con los suelos más pobres y la densidad de arbolado más baja. Por ello, la carga ganadera excluyendo las cerdas reproductoras es la menor de todos los grupos y, en aquellas explotaciones en las que hay cerdos en montanera, el número de cerdos/ha también es menor que en el resto de grupos. El grupo 3 está compuesto de 12 explotaciones (11 %) con una media de 174 ha y 31 vacas. La ganadería principal en estas explotaciones es el ovino. El cerdo ibérico también está presente, siendo la media del número de cerdas reproductoras muy inferior a la media del número de cerdos en montanera, debido a que en estas explotaciones las reproductoras se usan fundamentalmente para producir los lechones que se cebarán en montanera en la propia explotación. La productividad del vacuno en términos de terneros destetados por vaca y año es la más baja de todos los grupos, y las prácticas de manejo son las menos tecnificadas: cubrición anual y escaso uso de los planes de vacunación. La tasa de tierras arrendadas es la más alta de todos los grupos. El grupo 4 lo componen 8 explotaciones (7 %) con una media de 425 ha y 124 vacas. El vacuno es la actividad más importante en este caso, si bien el cerdo ibérico de montanera está presente en la mayoría de las explotaciones, siendo el número de cerdos/ha bajo. La carga ganadera total es la más baja de todos los grupos. El manejo reproductivo del vacuno es intensivo, siendo habitual el uso de la monta dirigida, la cubrición estacional e, incluso, el diagnóstico de gestación. El porcentaje de mano de obra familiar es el más bajo. El análisis de conglomerados ha identificado 8 explotaciones (7 %) que no forman parte de los grupos definidos anteriores, constituyendo cada una de ellas un grupo diferente. Se trata de cuatro explotaciones de más de 1,000 ha, dos explotaciones de entre 500 y 1,000 ha, y dos explotaciones con menos de 100 ha; todas ellas con diferentes tipos de ganado, de manejo y de régimen de propiedad.

824


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Discusión

Se observó una gran diversidad en las características y los sistemas de producción de las explotaciones estudiadas. La aproximación censal y micro usada en este trabajo, encuestando casi todas las explotaciones existentes en un área pequeña, no es habitual en los estudios de caracterización y tipificación de explotaciones ganaderas(18), pero ha resultado adecuada para registrar la variabilidad existente(19,20), permitiendo identificar incluso las tipologías de explotaciones menos habituales en el área de estudio, cuya probabilidad de ser incluidas en un muestreo estratificado es baja. No obstante, si bien existen explotaciones muy diversas, en la zona destaca cuantitativamente la tipología, identificada como grupo 1. Los trabajos basados en muestreos suelen encontrar tipologías de explotaciones con un tamaño similar, ya que las explotaciones se seleccionan con el objetivo de maximizar la variabilidad. En áreas pequeñas esto puede distorsionar la percepción de la importancia relativa de las diferentes tipologías. Varios estudios han concluido que el tamaño es uno de los factores que mejor explican la variabilidad entre explotaciones(6,8). El tamaño medio de las explotaciones encuestadas es mucho menor que el descrito en estudios previos para el suroeste de España(6), para Extremadura(21,22) y para Andalucía(7). En el área de estudio, las características de los sistemas de propiedad y herencia de la tierra determinan un tamaño de las explotaciones de dehesa menor que en otras zonas de España y Portugal, donde la superficie promedio es de 500 a 600 ha. No obstante, Castillo(23) registró, con datos de 2002, una superficie promedio de las explotaciones de dehesa de Los Pedroches asociadas al cebadero cooperativo que supera en 100 ha a la superficie promedio observada en este estudio, siendo además el número de vacas aproximadamente el doble. Este dato, junto al bajo porcentaje de las explotaciones encuestadas que superan las 300 ha (grupo 4), parece indicar que las explotaciones de mayor tamaño y carácter empresarial de la zona, o bien no se han asociado, o bien han dejado de participar en el sistema cooperativo. Este tipo de explotaciones tienen más facilidad para seguir una estrategia de venta o cebo de los terneros a título individual, tanto desde el punto de vista técnico como financiero, siendo las ventajas de la integración cooperativa menos evidentes para estos ganaderos. La diversificación de las especies ganaderas explotadas es otro factor de variabilidad entre explotaciones. La importancia relativa de las distintas especies puede tener un efecto importante en la sostenibilidad de los sistemas productivos, tanto desde el punto de vista económico como medioambiental(24). El peso del vacuno en las explotaciones encuestadas, pese a disponer de un sistema cooperativo de cebo, sacrificio y comercialización, es menor que el descrito por otros autores(8,21), debido a la importancia del porcino. El cerdo ibérico es

825


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

el ganado más rentable de la dehesa por los altos precios de mercado de sus productos(25). La abundancia de dehesas de encinas e industrias cárnicas en las comarcas estudiadas favorece que el cerdo ibérico de montanera esté presente en el 40 % de las explotaciones. Además, cuando las características físicas de las fincas no son adecuadas para la montanera debido a la baja densidad de arbolado (grupo 2), la estrategia de los ganaderos para mejorar la rentabilidad suele ser producir lechones, en instalaciones intensivas o pequeños cercados, que puedan ser engordados como cerdos de montanera en otras explotaciones o, si las condiciones de mercado son favorables, que puedan cebarse en base a pienso compuesto en su propia explotación. La tercera especie ganadera de importancia en la zona es el ovino. La oveja es el animal que mejor aprovecha los pastos de la dehesa, pero el coste de la mano de obra asociada a su manejo ha llevado a su sustitución paulatina por el vacuno, que está más adaptado al pastoreo libre y es menos susceptible al ataque de depredadores(26,27). No obstante, en algunas explotaciones (grupo 3) el ovino aún es la especie ganadera más importante. La presencia del ovino en las dehesas suele asociarse en la literatura científica a la existencia de pagos acoplados de la Política Agraria Común(4). No obstante, en este estudio se observa la influencia de otros factores, relativos a las características socioeconómicas y culturales de las explotaciones, cuya importancia se ha destacado en estudios recientes(28). Se observa una correlación con el sistema de tenencia de la tierra, teniendo las explotaciones del grupo 3 un porcentaje de superficie arrendada muy superior al resto, mayor al 70 %. La incertidumbre sobre la continuidad de la actividad ganadera en una finca arrendada es mayor que en una finca en propiedad, siendo los rebaños de ovino más flexibles que los de vacuno, tanto en lo que se refiere a su traslado entre fincas como a su capacidad de crecer o menguar en número de cabezas. Otros estudios también han registrado esta correlación entre ovino y arrendamiento, si bien no la han discutido explícitamente(21). Por otro lado, el perfil de los ganaderos de ovino puede definirse como “tradicional”; el promedio de usuarios de las tecnologías de la información y la comunicación (TIC) es el menor de todos los grupos, mientras que el porcentaje de agricultores a título principal y el porcentaje de mano de obra familiar son los más altos, si bien las diferencias entre grupos no son estadísticamente significativas. El nivel de intensificación de la producción también es un factor de variabilidad entre explotaciones, tanto en lo referente a la carga ganadera como al manejo. Los valores de carga ganadera observados son, en general, muy superiores a los tradicionales en los sistemas de dehesa(2) y a los reportados por otros autores(6,7,27). Las mayores cargas corresponden a las explotaciones del grupo 2 debido a la existencia de cerdas reproductoras. En cuanto a la carga sobre el sistema pastoral, no existen diferencias significativas entre tipologías, pero se observa una correlación negativa con la superficie total de la explotación. La superficie reducida es uno de los factores de intensificación de las explotaciones encuestadas. La estrategia de los ganaderos cuando el terreno es limitado suele ser aumentar el tamaño de los rebaños, aún a costa de una mayor dependencia de recursos externos(29).

826


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

El manejo de la alimentación es más intensivo que el descrito en estudios previos, destacando el uso agrícola de las dehesas. Las explotaciones cultivan anualmente casi el 50 % de la superficie cultivable de la que disponen, estando este valor en torno al 10 % en otros estudios(6,22). No se observan diferencias entre grupos en el porcentaje de tierra cultivada anualmente, pero existe una correlación con el peso relativo del vacuno, ya que las vacas requieren de más alimentación suplementaria en épocas de escasez de pastos que las ovejas, sobre todo cuando no son de razas autóctonas. La alimentación de los terneros también se ha intensificado, ya que la mayoría de los ganaderos les aportan concentrados antes y, sobre todo, después del destete. Los ganaderos son conscientes de que acostumbrar a los terneros al consumo de pienso antes de su entrada en el cebadero cooperativo tiene un efecto positivo en la fase de cebo y, por ende, en su beneficio económico. En cuanto a la reproducción, un factor importante son las razas explotadas. El porcentaje de explotaciones con vacas autóctonas es menor que el observado por otros autores(6,21,22). Aunque dichos estudios citan la importancia creciente del ganado Charolais y Limousin, en ningún caso reportan una presencia tan abundante como la observada en el área de estudio. Muchos ganaderos consideran que las vacas autóctonas son superiores a las de razas especializadas en las condiciones de la dehesa en cuanto a aprovechamiento de los recursos, intervalo entre partos y peso de los terneros al destete, momento en que se venden los terneros en los sistemas tradicionales. Sin embargo, la participación en el cebadero cooperativo supone avanzar en la cadena de valor, y ello favorece la elección de razas especializadas, o sus cruces con las autóctonas, debido a su mayor velocidad de crecimiento y conformación de la canal(30), aspectos de gran importancia en las fases de cebo y sacrificio, y que suponen un mayor pago por cada ternero individual. Los cambios de genética se suelen realizar mediante cruces por absorción con toros de razas especializadas, lo que da lugar a la coexistencia de animales con diferentes grados de cruzamiento tanto en las explotaciones como en el cebadero(30). En lo que se refiere al uso de técnicas de gestión reproductiva, el manejo puede considerarse extensivo, siendo la cubrición estacional y el diagnóstico de gestación menos habituales que en otros estudios(6). En este caso se observan diferencias significativas entre tipologías de explotaciones. En las explotaciones del grupo 4, que tienen los rebaños de vacuno más grandes, el uso de ambas técnicas es más habitual. En estas explotaciones, los partos de verano suponen mayores necesidades de mano de obra, fundamentalmente contratada, y de alimentación suplementaria, por lo que los ganaderos suelen optar por evitar las montas durante algunos meses al año, aún a costa de aumentar las posibilidades de que algunas vacas queden vacías. Por el contrario, los ganaderos del resto de grupos, que tienen rebaños de vacas de menor tamaño y más mano de obra familiar, prefieren minimizar el número de vacas vacías haciendo uso de la cubrición continua. Cabe señalar que la cubrición estacional acentúa la estacionalidad de las entradas de terneros en el cebadero cooperativo (Figura 1), lo cual puede suponer problemas logísticos y de comercialización.

827


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Figura 1: Número terneros entregados a cebadero por mes

En lo referente al manejo sanitario, la situación de las explotaciones encuestadas es, en general, buena. Solamente se observan diferencias significativas entre grupos en la vacunación de los terneros. Esta práctica es más habitual en las explotaciones del grupo 1, donde el vacuno es la producción más importante. En las del grupo 4, si bien el vacuno también es la especie más importante, la vacunación de los terneros es poco frecuente, posiblemente debido a que, dado que el número de terneros producidos es grande, la vacunación es un coste importante y el impacto de las posibles bajas es menor.

Conclusiones e implicaciones

En el caso estudiado, las explotaciones asociadas a la cooperativa de cebo, sacrificio y comercialización de terneros presentan algunas características poco habituales en los sistemas de dehesa, destacando el pequeño tamaño y la importancia de la mano de obra familiar. Son este tipo de explotaciones las que presentan una mayor dependencia de las cooperativas para avanzar en la cadena de valor, ante las dificultades que les supone afrontar

828


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

el cebo y la comercialización de forma individual. Pese a su proximidad geográfica y su integración en un modelo de comercialización común, las explotaciones presentan sistemas de producción diversos. La superficie disponible, el sistema de propiedad y el potencial productivo de las fincas (precipitación y calidad del suelo) determinan la variabilidad entre explotaciones, destacando las diferencias en las estrategias de diversificación de la producción y en los sistemas de manejo. Las explotaciones presentan, en general, un nivel de intensificación elevado; el aumento de la carga ganadera y la sustitución de razas autóctonas por animales especializados con mayores necesidades de suplementación son factores de intensificación destacados.

Agradecimientos

Este trabajo ha sido financiado por el Ministerio de Agricultura, Pesca, Alimentación y Medio Ambiente (20130020000783) y la Comisión Europea (LIFE 11/BIO/ES/000726). Los autores agradecen los comentarios de los revisores anónimos para la mejora del manuscrito original.

Literatura citada: 1.

Gastó J, Calzado C, Carbonero MD, de Pedro E, Fernández P, Garrido A, Gómez A, et al. Sostenibilidad de las dehesas: documento de reflexión. Dos Torres, España: GDR Los Pedroches; 2010.

2.

Plieninger T, Wilbrand C. Land use, biodiversity conservation, and rural development on the dehesas of Cuatro Lugares, Spain. Agrofor Syst 2001;51:23-34.

3.

Ferraz MI, Azeda C, Pinto T. Management of montados and dehesas for High Nature Value: an interdisciplinary pathway. Agrofor Syst 2016;90(1):1-6.

4.

Bernués A, Ruiz R, Olaizola A, Villalba D, Casasús I. Sustainability of pasture-based livestock farming in the European Mediterranean context: synergies and trades-off. Livest Sci 2011;139:44-57.

829


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

5.

Kristjanson P, Krishna A, Radeny M, Kuan J, Quilca G, Sánchez A, León C. Poverty dynamics and the role of livestock in the Peruvian Andes. Agric Syst 2007;94:294-308.

6.

Milán MJ, Bartolomé J, Quintanilla R, García MD, Espejo M, Herráiz PL, Sánchez JM, Piedrafita J. Structural characterization and typology of beef cattle farms of Spanish wooded rangelands (dehesas). Livest Sci 2006;99:197-209.

7.

Perea J, García A, Acero R, Valerio D, Rodríguez V. Caracterización productiva del vacuno ecológico en Andalucía. Arch Zootec 2007;56 (1):517-521.

8.

García A, Perea J, Acero R, Angón E, Toro P, Rodríguez V, Gómez G. Caracterización estructural de los sistemas ganaderos de las dehesas andaluzas. Arch Zootec 2010;59:577-588.

9.

Escribano AJ, Gaspar P, Mesías FJ, Escribano M. The role of level of intensification, productive orientation and self-reliance in extensive beef cattle farms. Livest Sci 2016;193:8-19.

10. Gaspar P, Escribano M, Pulido F, Rodríguez A, Mesías FJ, Pulido AF. El papel de la gestión cooperativa en la mejora del funcionamiento técnico-económico de las explotaciones ovinas. Arch Zootec 2016;65(251):333-339. 11. Theuvsen L, Franz A. The role and success factors of livestock trading cooperatives: lessons from German pork production. IAMA 2007;10(3):90-112. 12. Horrillo A, Escribano M, Mesías FJ, Elghannam A, Gaspar P. Is there a future for organic production in high ecological value ecosystems? Agrofor Syst 2016;143:114125. 13. Martín M, Espejo M, Plaza J, López T. Cálculo de la carga ganadera en la dehesa. In: Martín M, Campos P editors. Conservación y desarrollo de las dehesas portuguesa y española. Ministerio de Agricultura, Pesca y Alimentación, España: 1987:239-257. 14. Escribano M, Pulido F, Rodríguez A, Mesías FJ. Determination of energetic resources that cover cattle food needs in dehesa systems. Arch Zootec 1996;45:379-393. 15. Solano C, Bernués A, Rojas F, Joaquín N, Fernández W, Herrero M. Relationships between management intensity and structural and social variables in dairy and dualpurpose systems in Santa Cruz. Agric Syst 2000;65:159-177. 16. DOUE. Council Regulation (EC) No. 73/2009 of 19 January 2009 establishing common rules for direct support schemes for farmers under the Common Agricultural Policy and establishing certain support schemes for farmers.

830


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

17. BOE. Real Decreto 2611/1996, de 20 de diciembre, por el que se regulan los programas nacionales de erradicación de enfermedades de los animales. 18. Madry W, Mena Y, Roszkowska B, Gozdowski D, Hryniewski R, Castel JM. An overview of farming system typology methodologies and its use in the study of pasturebased farming systems: a review. Span J Agric Res 2013;1 (2):316-326. 19. Carmona A, Nahuelhual L, Echevarría C, Báez A. Linking farming systems to landscape change: an empirical and spatially explicit study in southern Chile. Agric Ecosyst Environ 2010;139:40-50. 20. Castel JM, Madry W, Gozdowski D, Roszkowska B, Dabrowski M, Lupa W, Mena Y. Family dairy farms in the Podlaise province, Poland: farm typology according to farming system. Span J Agric Res 2010;8:946-961. 21. Gaspar P, Mesías FJ, Escribano M, Rodríguez A, Pulido F. Economic and management characterization of dehesa farms: implications for their sustainability. Agrofor Syst 2007;71:151-162. 22. Horrillo A, Mesías FJ, Gaspar P, Escribano M. La explotación de vacuno ecológico en sistemas de dehesa del SO de España: análisis de parámetros técnicos. Arch Zootec 2015;64: 307-310. 23. Castillo M. Eficiencia técnica de la producción de vacuno de carne en la dehesa. REEAP 2006;212:139-154. 24. Rook AJ, Dumont B, Isselstein J, Osoro K, Wallis MF, Parente G, Mills J. Matching type of livestock to desired biodiversity outcomes in pastures, a review. Biol Conserv 2004;119(2):137-150. 25. Gaspar P, Mesías FJ, Escribano M, Pulido F. Sustainability in Spanish extensive farms (dehesas): an economic and management indicator-based evaluation. Rangeland Ecol Manag 2009;62:153-162. 26. Ortuño SF, Fernández JL. Perspectivas económicas de las producciones ganaderas extensivas en las áreas desfavorecidas ante la liberalización de los mercados. Rev Esp Econ Agr 1995;174:165-188. 27. Escribano M, Rodríguez A, Mesías FJ, Pulido F. Niveles de cargas ganaderas en la dehesa extremeña. Arch Zootec 2002;51:315-326. 28. Torralba M, Oteros E, Moreno G, Plieninger T. Exploring the role of management in the coproduction of ecosystem services from Spanish wooded rangelands. Rangeland Ecol Manag 2017 [in press].

831


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

29. Plieninger T, Modolell J, Konold W. Land manager attitudes toward management, regeneration and conservation of Spanish holm oak savannas (dehesas). Landscape Urban Plan 2004;66:185-198. 30. Maroto F, Santos R, Gómez J, Gómez A. Caracterización de la variabilidad intrarracial de los parámetros productivos de añojos cebados en el sur de España. Panea B, et al editores. XVI Jornadas AIDA Producción Animal; 2015:39-41.

832


http://dx.doi.org/ 10.22319/rmcp.v9i4.4546 Nota de investigación

Frecuencia de Neospora caninum en bovinos doble propósito en fincas del estado Guárico, Venezuela Frequency of Neospora caninum in double purpose cattle on herds at the State of Guárico, Venezuela

Juan Carlos Pinilla Leónab * Natalia Da Silva Borgesb

a

Universidad de Santander. Facultad de Ciencias Exactas, Naturales y Agropecuarias, Programa de Medicina Veterinaria, Campus de Bucaramanga, Lagos de Cacique, Bucaramanga, Santander, Colombia. b

Universidad Rómulo Gallegos. Facultad de Agronomía, Departamento de Producción Animal. San Juan de Los Morros, Venezuela.

* Autor de correspondencia: j.pinilla@mail.udes.edu.co

Resumen: Se condujo una investigación con el propósito de determinar la frecuencia de Neospora caninum en bovinos de doble propósito. Se colectaron 890 muestras de sangre distribuidas en cuatro grupos etarios: 0–6 meses, 6–12 meses, 12–24 meses y >24 meses. La presencia de anticuerpos se determinó mediante un kit de ELISA indirecto, y los resultados se clasificaron en positivos y negativos. La seroprevalencia general fue de 21 % en bovinos, y 76.6 % en las fincas evaluadas. Al referir los resultados al grupo etario no se encontró asociación estadística (P>0.05); sin embargo, el riesgo de ser seropositivo incrementa con la edad, indicando la alta probabilidad de transmisión horizontal de N. caninum en el rebaño. Igualmente no hubo asociación estadística con respecto al sexo (P>0.05). Con relación al estatus reproductivo, se encontró asociación estadística (P<0.05) con respecto al aborto. Aunque todos los grupos resultaron positivos, las vacas con historia de aborto mostraron mayor seroconversión, lo que 833


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

indica que el riesgo de aborto aumenta con niveles crecientes de anticuerpos contra el parásito. Del total de fincas positivas (76.6), se observó mayor seroconversión (100) en las que tenían mayor cantidad de perros (> 7 perros), y este resultado indica que a mayor cantidad de perros, mayor prevalencia de N. caninum, ya que los perros son la principal fuente de transmisión horizontal. Se concluye que existe circulación antigénica de N. caninum asociada a abortos en bovinos del estado Guarico, y que pudiera ser controlada mejorando las condiciones sanitarias de las explotaciones. Palabras clave: Explotaciones, Ganado vacuno, Parásitos, Prevalencia, Protozoarios.

Abstract: It was carried out an investigation to determine the frequency of Neospora caninum in double purpose cattle. Blood samples (n= 890) were collected in four age groups: 0-6 mo, 6-12 mo, 12-24 mo and >24 mo. The presence of antibodies was determined by an indirect ELISA kit, and the results were classified as positive and negative. The seroprevalence was 21 % in cattle, and 76.6 % in the herds evaluated. Regarding to the age group, no statistical association was found (P>0.05); however, the risk of being seropositive increased with age, indicating the high probability of horizontal transmission of N. caninum in the herd. There was no statistical association with respect to sex (P>0.05). Regarding reproductive status, a statistical association (P<0.05) was found with respect to abortion. Although all the groups were positive, cows with a history of abortion showed higher seroconversion, indicating that the risk of abortion increased with increasing levels of antibodies against the parasite. From the total positive farms (76.6 %), higher seroconversion (100 %) were observed in those with the highest number of dogs (>7 dogs), and this result indicates that a higher number of dogs, a higher prevalence of N. Caninum, since dogs are the main source of horizontal transmission. It is concluded that there is antigenic circulation of N. caninum associated to abortions in double purpose cattle of the State of Guarico, and that could be controlled improving the sanitary conditions of the herds. Key words: Cattle, Explotations, Parasites, Prevalence, Protozoans.

Recibido 03/07/2017 Aceptado 23/01/2018

834


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

La Neosporosis es una enfermedad parasitaria causada por un Apicomplexa denominado Neospora caninum, protozoo intracelular obligado que ocasiona aborto en bovinos(1). El ciclo biológico es indirecto, señalando al perro como hospedero definitivo(1); sin embargo, los coyotes, lobos y zorros también han sido identificados como hospederos definitivos(2). Como hospederos intermediarios se han señalado a bovinos, ovinos, caprinos, equinos, venados, perro, otros mamíferos e inclusive las aves de corral(3). El impacto económico de la neosporosis bovina se debe a que el aborto es el principal signo clínico, ya que las vacas infectadas pueden presentar abortos sucesivos con un alto riesgo de transmitir en forma vertical la infección a su descendencia, por lo cual son consideradas no aptas para la reproducción, lo que amerita el reemplazo de animales de alto valor genético y zootécnico por vientres sanos negativos a este parásito(4,5). Diversos estudios sobre neosporosis bovina, han demostrado la presencia del parásito en las fincas y su estrecha relación con la presencia de abortos, causando grandes pérdidas económicas(6,7). Los abortos frecuentes se convierten en el principal problema de las ganaderías presentándose de forma esporádica, endémica o epidémica con origen infeccioso o no infeccioso, por lo que a veces resulta difícil determinar el agente causal(8). La neosporosis bovina ha sido señalada en Europa, África, Australia, Nueva Zelanda y América(9). Los estudios serológicos sobre neosporosis bovina en Venezuela demuestran que la enfermedad está distribuida en varios estados y regiones ganaderas, con niveles variables de frecuencia serológica, afectando varios tipos de razas(10,11,12). En los estados Yaracuy y Lara se reportó 17.09 y 44 % de frecuencia en bovinos doble propósito y leche, respectivamente(13,11), y alta ocurrencia de abortos en vacas lecheras(11). En el año 2012, se determinó 17.23 % de seropositividad por medio de la técnica de Elisa en ganado doble propósito del estado Lara, y no se encontraron diferencias significativas entre la frecuencia serológica con respecto al sexo y al grupo etario, sugiriendo que en los rebaños estudiados, las infecciones por N. caninum son predominantemente transmitidas por vía transplacentaria(14). Por su parte, en el estado Falcón se encontró 20.6 % de frecuencia serológica en fincas de doble propósito(15). En Venezuela, específicamente en el estado Guárico, no existe información científica sobre el comportamiento epidemiológico de este protozoario. Por lo tanto, y en virtud de su alto impacto enconómico sobre la ganadería bovina, este trabajo de investigación se realizó con la finalidad de determinar la frecuencia serológica de Neospora caninum en bovinos doble propósito en fincas ganaderas ubicadas en el estado Guárico, Venezuela. El estudio se realizó en la localidad de San José de Tiznados, municipio Ortíz del estado Guárico (9°26′00″ N 67°33′00″ O). La ganadería y producción de cereales son la principal actividad económica de la región. Las características climatológicas de la zona son de tipo tropical lluvioso de sabana, con estación seca y altas temperaturas. San José de Tiznados se encuentra ubicado a 200 msnm, temperatura media anual de 28 °C, la precipitación anual de 1,000 a 1,500 mm, observándose una marcada distribución de las lluvias en dos periodos, 835


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

uno seco que se acentúa entre los meses de noviembre a abril y uno lluvioso que va de mayo a octubre. La vegetación está representada en el bosque seco tropical(16). Se diseñó un muestreo aleatorio, de tipo descriptivo y corte transversal. Para el estudio se seleccionaron 30 fincas de doble propósito de manera aleatoria y sistemática, según censo de vacunación contra la fiebre aftosa del departamento de epidemiología del Instituto Nacional de Seguridad Agrícola Integral(17). Para el momento del estudio en ninguna de las fincas se habían aplicado vacunas contra N. caninum. El cálculo del tamaño de la muestra se hizo empleando la fórmula del muestreo aleatorio simple(18), para lo cual se estableció un margen de error del 20 % de la prevalencia, un nivel de confianza del 95 % y una prevalencia esperada del 15 % en base a estudios previos realizados en Venezuela(15,20), obteniéndose un tamaño de muestra de 544 animales, de la siguiente manera: n= Z2 * p * q / e2, entonces n= 1,962 * 15 * 85 / (20 * 15/ 100)2 = 544 animales. Sin embargo, el tamaño de la muestra se llevó hasta 890 animales, ya que se contaba con suficientes recursos para el momento de la investigación. La selección de los animales en cada finca se hizo mediante muestreo aleatorio simple y de manera proporcional a la cantidad de animales existentes en cada explotación, y se estratificaron en cuatro grupos de edades(14): becerros/as (0–6 meses), mautes/as (6–12 meses), novillos/as (12–24 meses) y adultos (>24 meses). Para el análisis de la frecuencia se consideró el sexo, estatus reproductivo y la presencia de perros en las fincas. Las muestras de sangre se tomaron directamente de la vena yugular, utilizando tubos Vacutainer® sin anticoagulante, y se transportaron en cavas refrigeradas hasta el laboratorio, para su procesamiento. Todas las muestras se centrifugaron a 7,000 rpm por 5 min para la obtención de suero. Se determinó la presencia de anticuerpos anti-Neospora caninum mediante un kit comercial para el ensayo de inmunoabsorción enzimático de ELISA indirecto (INgezim N. caninum del laboratorio Ingenasa). El procesamiento de las muestras se realizó en el laboratorio de investigación en Parasitología de la Universidad “Rómulo Gallegos”. El procedimiento se realizó de acuerdo a las instrucciones del fabricante. La frecuencia serológica se determinó dividiendo el total de casos positivos / total de animales evaluados * 100. Los resultados obtenidos se analizaron mediante estadísticos descriptivos y test de Ji-cuadrada para determinar asociaciones estadísticas entre los valores de frecuencia serológica y grupos etarios, sexo y presencia de perros en fincas. Para los cálculos se utilizó el programa estadístico Statistix ver 8.0(19). Se determinó una frecuencia serológica individual de 21 % en el municipio Ortíz del estado Guárico, encontrando animales seropositivos en 23/30 (76.6 %) de las fincas examinadas. Los resultados obtenidos coinciden con lo señalado en otros estudios(10) donde determinaron 14.09 % de seroprevalencia en vacas de 13 estados de Venezuela, así como 11.3 % en vacas procedentes de fincas doble propósito y 86.7 % de fincas seropositivas(20). Igualmente, los

836


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

resultados obtenidos coinciden con lo reportado por León et al(12) quienes señalaron 13 y 17 % en ganaderías doble propósito del estado Guárico y sur del estado Aragua, respectivamente. Igualmente, en otros estudios se demostró 17.09 % de seroprevalencia en bovinos y 74.51 % en las fincas examinadas del estado Yaracuy(13), así como 17.23 y 20.6 % de seropositividad en ganado doble propósito de los estados Lara y Falcón, respectivamente(14,15). Los resultados obtenidos en este estudio difieren con lo reportado en México y Paraguay, donde se encontraron valores de seroprevalencia a N. caninum de 16 a 59 % y 35.7 %, respectivamente, así como 44 % de seropositividad en vacas del estado Lara, Venezuela(11). El estudio serológico sobre neosporosis bovina en el municipio Ortiz del estado Guárico demuestra que la enfermedad está ampliamente distribuida en el municipio y fincas evaluadas, lo cual hace necesario implementar medidas de control y prevención. En el Cuadro 1 se muestra la comparación entre la frecuencia de muestras analizadas según el grupo etario y sexo de los animales. Al referir los resultados al grupo etario, se encontró 14.3 % de frecuencia en becerros, 17.8 % en mautes, 19.5 % en novillos y 23.5 % en adultos, lo que demuestra que la seropositividad aumentó de manera proporcional con la longevidad de los animales, no existiendo asociación estadísitca entre la frecuencia serológica y la edad de los animales. Esto puede deberse a la infección postnatal de los bovinos con fuentes contaminadas con ooquistes esporulados del protozoario. Estos resultados coinciden con lo reportado por otros(14,15,21), quienes señalaron que el riesgo de ser seropositivo incrementa con la edad, indicando la alta probabilidad de transmisión horizontal de N. caninum en el hato. La seroprevalencia ligeramente mayor en animales más viejos sugiere que está produciéndose infección postnatal superpuesta a la transmision congénita.

Cuadro 1: Comparación entre la seroprevalencia a N. caninum según grupo etario y sexo

Grupo etario (meses) 0 – 6 (becerros) 6 – 12 (mautes) 12 – 24 (novillos) > 24 (adultos) Total Sexo Hembras Machos Total

N° animales muestreados

N° animales seropositivos

%

84 95 235 476 890

12 17 46 112 187

14.3 17.8 19.5 23.5 21.0

702 188 890

148 39 187

21.1 20.7 21.0

P>0.05.

837

Estadístico de prueba

X2: 4.01 P = 0.26

X2: 0.01 P = 0.9


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Aunque ambos sexos resultaron seropositivos, no se encontró asociación estadística (P>0,05) entre la seroprevalencia a N. caninum y el sexo (Cuadro 1). Los resultados obtenidos coinciden con lo reportado por Gharekhani et al(24) quienes no encontraron diferencias estadísiticas con respecto al sexo. Probablemente, las diferencias hormonales juegan un papel importante en la susceptibilidad del huésped a la infección por N. caninum, ya que la excreción de estrógenos aumenta la producción de anticuerpos y los andrógenos suprimen las respuestas inmunes de las células T y B, y por lo tanto, la inmunidad contra la infección en vacas puede disminuir(25). Por otro lado, las hembras representan la fuente de transmision transplacentaria de N. caninum a su descendencia, ya que determinan la presencia y persistencia de la infección, así como la característica endémica de la neosporosis bovina, ocurriendo la transmisión de vacas infectadas a hijas e incluso la perpetuidad de la infección en futuras gestaciones(1,5,26). Se observaron diferentes grados de positividad, con respecto al estatus reproductivo (Cuadro 2). Aunque todos los grupos resultaron seroprevalentes a la infección por el protozoario, las vacas con historia de aborto mostraron mayor seroconversión (71.1 %, P<0.05). Los resultados obtenidos coinciden con lo demostrado en otros trabajos(6,7) donde señalaron la presencia de N. caninum y su relación con abortos en ganado lechero; sin embargo, los resultados difieren con lo reportado por Pulido et al(27), quienes no encontraron relación estadística entre la presencia de N. caninum y abortos en vacas. A pesar de la alta presencia de anticuerpos contra N. caninum en vacas con historia de abortos, es importante señalar que existen otros agentes infecciosos como brucelosis, leptospirosis, virus de la rinotraqueítis infecciosa bovina, diarrea viral bovina, etc, que no fueron considerados en el diagnóstico diferencial del estudio, y que deberían ser incluidas en futuras investigaciones. Las vacas seropositivas son más propensas a abortar que las vacas seronegativas, como ha sido demostrado en muchos estudios, y el riesgo de aborto aumenta con niveles crecientes de anticuerpos específicos de N. caninum en animales individuales(1). En nuestro estudio se determinó que el porcentaje de abortos fue 2.4 veces mayor en los individuos seropositivos comparado con los seronegativos (71.1 y 28.9 %, respectivamente). Estos resultados coinciden con lo demostrado por otros investigadores(27) quienes señalaron que el porcentaje de abortos fue tres veces mayor en animales seropositivos comparados con los negativos. Diferentes estudios han descrito una asociación significativa entre la presencia de la infección y el aborto, con un riesgo 2 a 3.5 veces superior en vacas seropositivas que en las seronegativas(22,23,29). Las vacas congénitamente infectadas tienen hasta 7.4 veces más probabilidades de abortar que una vaca no infectada, además permanecen infectadas de por vida. A pesar de esto, se ha descrito que el riesgo de abortar parece disminuir en las gestaciones siguientes, sin afectar la fertilidad de la vaca(30).

838


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Cuadro 2: Comparación entre la seroprevalencia a Neospora caninum según estatus reproductivo de las vacas N° animales muestreados

N° animales seropositivos

%

Vacas vacías

130

26

20.0

Vacas preñadas

251

35

13.9

Vacas repetidoras

50

19

38.0

Vacas con HA

45

32

71.1

Total

476

112

23.5

2

X : 76.15. P<0.05. HA= historia de aborto.

Otras alteraciones reproductivas como las repeticiones de celo también han sido asociadas con la seropositividad a N. caninum(31,32); sin embargo, los factores que favorecen la probabilidad de que una vaca seropositiva aborte son por lo general desconocidos(32). La relación del estrés y las prácticas de manejo, condiciones climáticas, coinfecciones, edad, etc; pueden desempeñar un papel importante en la reactivación de infecciones latentes(1). En un estudio encontraron una fuerte asociación entre el nivel de anticuerpos en la vaca y la ocurrencia de lesiones histopatológicas en fetos abortados consistentes con la infección por N. caninum(33). Durante el presente estudio se observó la presencia de perros en todas las fincas visitadas. La mayor frecuencia serológica en animales de mayor edad (23.5 %) sugiere que la transmisión horizontal está probablemente contribuyendo a la prevalencia en otros grupos etarios, y que los perros al convivir con el ganado podrían servir como posible fuente de infección por medio de la excreción de ooquistes(34); sin embargo, muestras de perros no fueron examinadas durante este estudio. En el Cuadro 3 se muestra la seroprevalencia a N. caninum de acuerdo a la cantidad de perros presentes en las fincas. Se observaron diferentes grados de positividad, lo que refleja que hubo asociación estadística (P<0.05) con respecto al número de perros presentes. Del total de fincas positivas (76.6 %), se observó mayor seroconversión (100 %) en las que tenían mayor cantidad de perros (> 7 perros), y este resultado indica que a mayor cantidad de perros, mayor seroprevalencia de N. caninum. En la mayoría de los estudios epidemiológicos, la presencia de perros de granja ha sido un factor de riesgo para la seropositividad en bovinos(1), ya que los perros son hospederos definitivos y principal fuente de transmission horizontal de N. caninum. Los ganaderos han reportado la infección postnatal en aquellas fincas donde los perros defecan en los comederos, ensilaje de maíz o heno, mientras que no hay evidencias de infeccion donde no hay perros. Igualmente, se observó infección postnatal con mayor frecuencia en fincas donde los perros se alimentaron con placenta bovina, descargas uterinas y calostro o leche, a diferencia de los rebaños testigo(35). 839


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Esto sugiere que estos materiales pueden representar una fuente de infección para los perros, es decir, pueden facilitar que los perros se infecten con N. caninum. Otros estudios no encontraron una asociación entre los perros y el aborto en los rebaños bovinos(36,37,38). Sin embargo, debido a que los abortos asociados a N. caninum no siempre están vinculados a la transmisión horizontal sino que también ocurren en las vacas infectadas crónicamente, no se puede esperar que haya siempre una asociación positiva entre la presencia o el número de perros y el aborto bovino. Uno de los estudios que identificaron una asociación positiva entre la presencia de perros en las fincas y el aborto asociado a N. caninum había analizado selectivamente los factores de riesgo para el aborto epidémico. Debido a que el aborto epidémico, posiblemente es causado por la transmisión horizontal mediada por ooquistes, se espera la identificación de la presencia de potenciales hospederos definitivos, es decir, perros de finca, como un factor de riesgo(1).

Cuadro 3: Comparación entre la seroprevalencia a N. caninum en fincas de doble propósito según la cantidad de perros Fincas muestreadas

Fincas seropositivas

%

< 3 perros

5

2

40.0 a

4 y 6 perros

9

5

55.5 a

> 7 perros

16

16

100.0 b

30

23

76.6

Total 2

X : 12.43. a,b P<0.05.

De acuerdo a los resultados obtenidos en este estudio, se determinó una frecuencia serológica individual de 21 % en bovinos doble propósito y 76.6 % en las fincas examinadas, lo que demuestra que la infección está ampliamente distribuida en el municipio Ortíz del estado Guarico, lo cual hace necesario implementar medidas de control y prevención. El incremento de la seropositividad con la edad de los animales, así como la presencia de gran cantidad de perros en las explotaciones, presumen la probabilidad de transmisión horizontal de N. caninum en los bovinos y fincas examinadas. Sin embargo, habría que formular modelos experimentales para comprobar científicamente tal aseveración. Aunque el riesgo de aborto estuvo asociado con niveles crecientes de anticuerpos específicos de N. caninum en las vacas examinadas (71.1 %), también se deben considerar otros agentes infecciosos como causantes de aborto en ganado bovino.

840


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Agradecimientos

Al Programa de Medicina Veterinaria de la Facultad de Ciencias Exactas, Naturales y Agropecuarias de la Universidad de Santander por su valiosa colaboración y apoyo en la ejecución de este trabajo.

Literatura citada: 1.

Dubey JP, Schares G, Ortega-Mora L. Epidemiology and control of neosporosis and Neospora caninum. Clin Microbiol Rev 2007;20(2):323-367.

2.

Gondim L, McAllister M, Pitt W, Zemlicka D. Coyotes (Canis latrans) are definitive hosts of Neospora caninum. Int J Parasitol 2004;34:159-161.

3.

Moore D, Odeón A, Venturini M, Campero C. Neosporosis bovina: conceptos generales, inmunidad y perspectivas para la vacunación. Rev Arg Microbiol 2005;37:217-228.

4.

Björkman C, Johansson O, Syenlud S, Holmdahl J, Uggla A. Neospora species infection in a herd of dairy cattle. J Am Vet Med Assoc 1996;208(9):144-146.

5.

Hietala S, Thurmond M. Postnatal Neospora caninum transmission and transient serologic responses in two dairies. Int J Parasitol 1999;29:1669-1676.

6.

Oviedo T, Betancur C, Mestra A, González M, Reza L, Calonge K. Estudio serológico sobre neosporosis en bovinos con problemas reproductivos en Montería, Córdoba, Colombia. Rev MVZ Córdoba 2007;12(1):929-933.

7.

López G, Restrepo B, Restrepo M, Lotero M, Murillo V, Chica A, Cano J, Giraldo J. Estudio para evidenciar la presencia de Neospora caninum en bovinos de la hacienda San Pedro en el municipio de Fredonia. Rev MVZ CES 2007;2(1):7-20.

8.

Neverauskas CE, Nasir A, Reichel MP. Prevalence and distribution of Neospora caninum in water buffalo (Bubalus bubalis) and cattle in the Northern territory of Australia. Parasitol Int 2015;64(5):392-396.

841


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

9.

2018

Dubey JP. Neosporosis in cattle: biology and economic impact. J Am Vet Med Assoc 1999;214:1160-1163.

10. García F. La neosporosis como factor limitante emergente de la eficiencia reproductiva en rebaños bovinos [resumen]. Congreso Nacional de Ciencias Veterinarias. Maracay, Venezuela. 2005:147. 11. Obando C, Bracamonte M, Montoya A, Cadenas. Neospora caninum en un rebaño lechero y su asociación con el aborto. Rev Cien FCV-LUZ 2010;20(3):235-239. 12. León E, Guillén A, Aragort W, García F, Morales G, Pino L, Sandoval E, Balestrini C. Limitantes parasitológicas en rebaños doble propósito del Municipio San José de Guaribe (estado Guárico) y Sur del estado Aragua. En: Espinoza F, Dominguez C, editores. I Simposio Tecnologías Apropiadas para la Ganadería de los Llanos de Venezuela. Valle de la Pascua, Venezuela 2007:177-194. 13. Escalona J, García F, Mosquera O, Vargas F, Corro A. Factores de riesgo asociados a la prevalencia de Neosporosis bovina en el municipio Bolívar del estado Yaracuy, Venezuela. Zoot Trop 2010;28(2):201-211. 14. Suárez C, Maldonado J. Seropositividad a Neospora caninum en unidades de producción bovina del estado Lara, Venezuela. Zoot Trop 2012;30(1):35-41. 15. Fernández JG, García F. Diagnóstico serológico de neosporosis bovina en fincas de la región de Tucacas, estado Falcón, Venezuela. Zoot Trop 2013;31(4):291-298. 16. Ministerio del Ambiente y Recursos Naturales Renovables (MARNR). Anuario climatológico. MARNR. Estado Guarico. 2014. 17. INSAI. Instituto Nacional de Seguridad Agrícola Integral. Censo de Vacunación contra la Fiebre Aftosa. Departamento de Epidemiología. 2015. 18. OPS. Organización Panamericana de la Salud. Nota Técnica No. 18. Procedimientos para estudios de prevalencia en enfermedades crónicas por muestreo. Buenos Aires 1979. 19. Statistix 8. Analytical Software for Windows. USA. 2008. 20. Lista-Alves D, Palomares-Naveda R, García F, Obando C, Arrieta D, Hoet A. Serological evidence of Neospora caninum in dual-purpose cattle herds in Venezuela. Vet Parasitol 2006;136:347-349. 21. Bartels C, Arnaiz J, Ruiz A, Björkman C, Frössling J, Von Blumröder D. Supranational comparison of Neospora caninum seroprevalences in cattle in Germany, the Netherlands, Spain and Sweden. Vet Parasitol 2006;137:17-27.

842


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

22. Waldner C, Janzen E, Henderson J, Haines D. Outbreak of abortion associated with Neospora caninum infection in a beef herd. JAVMA 1999;215:1485-1490. 23. Davison H, Otter A, Trees A. Significance of Neospora caninum in British diary cattle determined by estimation of seroprevalence in normally calving cattle and aborting cattle. Int J Parasitol 1999;29(8):1189-1194. 24. Gharekhani J, Esmaeilnejad B, Rezaei H, Yakhchali M, Heidari H, Azhari M. Prevalence of anti-Neospora caninum antibodies in Iranian goats. Annals Parasitol 2016;62(2):111–114. 25. Gharekhani J, Heidari H. Serology based comprehensive study of Neospora infection in domestic animals in Hamedan province, Iran. J Ad Vet An Res 2014;1:119-124. 26. Hall C, Reichel M, Ellis J. Neospora abortions in dairy cattle: diagnosis, mode of transmission and control. Vet Parasitol 2005;128:231-241. 27. Pulido M, Díaz A, Andrade R. Asociación entre variables reproductivas y anticuerpos anti Neospora caninum en bovinos lecheros de un municipio de Colombia. Rev Mex Cien Pecu 2017;8(2):167-174. 28. Mazuz ML, Fish L, Reznikov D, Wolkomirsky R, Leibovitz B, Savitzky I, Golenser J, Shkap V. Neosporosis in naturally infected pregnant dairy cattle. Vet Parasitol 2014;205(1-2):85-91. 29. Sager H, Fischer I, Furrer K, Strasser M, Waldvogel A, Boerlin P, Audigé L, Gottstein B. A Swiss case-control study to assess Neospora caninum-associated bovine abortions by PCR, histopathology and serology. Vet Parasitol 2001;102(1-2):1-15. 30. López-Gatius F, García-Ispierto I, Santolaria P, Yániz JL, López-Béjar M, Norgareda C, Almería S. Relationship between rainfall and Neospora caninum-associated abortion in two dairy herds in a dry environment. J Vet Med 2005;52:147-15. 31. Sierra R, Esparza L, Parra M, Vasquez Z, Vazquez C. Factores de riesgo asociados a la seroprevalencia de anticuerpos a Neospora caninum en ganado lechero de Aguascalientes, México. Rev Mex Cienc Pecu 2011;2(1):15-24. 32. Bruhn F, Daher D, López E, Barbieri J, Da Rocha C, Guimarães A. Factors associated with seroprevalence of Neospora caninum in dairy cattle in southeastern Brazil. Trop Anim Health Prod 2013;45(5):1093-1098. 33. De Meerschman F, Speybroeck N, Berkvens D, Rettigner C, Focant C, Leclipteux T, Cassart D, Losson B. Fetal infection with Neospora caninum in dairy and beef cattle in Belgium. Theriogenology 2002;58:933–945.

843


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

34. Chaparro J, Olivera M, Ramírez N, Villar D, Fernandez J, Londoño J, Palacio L. Neospora caninum serostatus in dairy cattle of the Northern plains of Antioquia, Colombia. Rev MVZ Córdoba 2016;21(3):5577-5583. 35. Dijkstra T, Barkema H, Eysker M, Hesselink J, Wouda W. Natural transmission routes of Neospora caninum between farm dogs and cattle. Vet Parasitol 2002;105:99-104. 36. Mainar-Jaime R, Thurmond M, Berzal-Herranz B, Hietala S. Seroprevalence of Neospora caninum and abortion in dairy cows in northern Spain. Vet Rec 1999;145:7275. 37. Fischer I, Furrer K, Audige´ L, Fritsche A, Giger T, Gottstein B, Sager H. Von der Bedeutung der bovinen Neosporose beim Abortgeschehen in der Schweiz. Schweiz Arch Tierheilkd 2003;145:114-12. 38. Romero J, Perez E, Dolz G, Frankena K. Factors associated with Neospora caninum serostatus in cattle of 20 specialized Costa Rican dairy herds. Prev Vet Med 2002;53:263-273.

844


http://dx.doi.org/ 10.22319/rmcp.v9i4.4651 Nota de investigación

Niveles de fumonisinas en rastrojo de maíz para consumo equino en el estado de Jalisco Levels of fumonisins in corn stover for equine consumption in Jalisco State

Waldina Patricia Reyes-Velázqueza* Claudia Nayeli Anguiano-Sevillab Rubén Anguiano-Estrellab Luis Alfonso Jiménez-Ortegac Pablo Torres-Moránd Federico Rojoe

a

Universidad de Guadalajara. Departamento de Salud Pública, Centro Universitario de Ciencias Biológicas y Agropecuarias (CUCBA). México. b c

Universidad de Guadalajara. Departamento de Producción Animal, CUCBA, México.

Universidad de Guadalajara. Licenciatura Ciencia de los Alimentos, CUCBA, México.

d

Universidad de Guadalajara. Departamento de Desarrollo Rural Sustentable, CUCBA. México. e

Asesor Científico. Río Cuarto, Córdoba, Argentina.

*Autor de correspondencia: waldinareyes2@gmail.com


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Resumen: A partir de casos confirmados de leucoencefalomalacia equina en el municipio de Juchitlán (estado de Jalisco), esta investigación tuvo como objetivo determinar la presencia y niveles de fumonisinas en el alimento. El área de estudio incluyó a los principales municipios en donde se concentra la población equina de Jalisco, teniendo en común el uso de prácticas similares en el manejo de la alimentación y conservación del alimento. Las determinaciones analíticas se realizaron mediante inmunoensayo de tipo competitivo y cromatografía de líquidos de alta resolución. Se detectó contaminación con fumonisinas en el 100 % de muestras analizadas de todos los municipios, los niveles fueron de 0.23 a 19.18 mg/kg. Se observó diferencia entre municipios (P<0.001); la mayor concentración se observó en Ahualulco de Mercado (media: 12.83 mg/kg) y la menor en Concepción de Buenos Aires (media: 0.27 mg/kg). Del total de muestras analizadas, 62 % superaron el límite máximo recomendado para equinos. Palabras clave: Fumonisinas, Rastrojo de maíz, Equinos.

Abstract: The objetive was to determine the presence and levels of fumonisins in feed from confirmed cases of equine leukoencephalomalacia from the Municipality of Juchitlán (Jalisco State). The field study included the 13 main municipalities where one of the biggest equine population in Jalisco is concentrated. They have a similar feeding management practices and feed preservation. The analytical determinations were performed by competitive type immunoassay and high-resolution liquid chromatography. Contamination with fumonisins was detected in 100 % of analyzed samples; levels were from 0.23 to 19.18 mg/kg. There was a difference between localities (P<0.001); the highest concentration was observed in Ahualulco de Mercado (mean: 12.83 mg/kg) and the lowest concentration in Concepción de Buenos Aires (mean: 0.27 mg/kg). Of the total samples analyzed, 62 % exceeded the recommended limit for horses. Key words: Fumonisins, Corn stover, Equine.

Recibido 02/10/2017 Aceptado 02/02/2018

846


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Las fumonisinas son metabolitos secundarios producidos por hongos filamentosos principalmente de las especies Fusarium verticillioides y F. proliferatum. Estas micotoxinas fueron caracterizadas en 1988 como diésteres de ácido tricarboxílico y aminopentol de cadena larga(1). La contaminación natural de fumonisinas en alimentos se reporta con frecuencia en cereales como maíz y productos derivados para consumo humano y animal(2). Condiciones ambientales estresantes favorecen la síntesis de fumonisinas, entre las cuales se describen sequía y temperaturas superiores a 30 °C durante el crecimiento de la planta, así como el almacenamiento inadecuado(3). Entre las fumonisinas descritas destacan la FB1 y FB2 por los efectos tóxicos en humanos y animales. Estudios epidemiológicos asocian la FB1 con el desarrollo de cáncer de esófago en humanos(4). El Centro de Investigaciones contra el Cáncer las clasifica como agentes probablemente cancerígenos dentro del grupo 2B(5). En equinos el consumo de alimentos contaminados con fumonisinas ocasiona el síndrome de leucoencefalomalacia equina (LEME), trastorno caracterizado por signos neurotóxicos como ceguera, ataxia, delirio, postración y convulsiones antes de morir(6). El examen post-mortem muestra lesiones en encéfalo y tallo cerebral; además el estudio histopatológico permite observar pérdida de la arquitectura cerebral y necrosis de la materia blanca(7). A nivel mundial se han reportado numerosos brotes de LEME, con tasas de mortalidad del 85 %(7-10). En el estado de Jalisco se presentan brotes de LEME con alta frecuencia, ocasionando grandes pérdidas económicas y afectivas; sin embargo, esta información no ha sido publicada en revistas científicas. En México, desde el año 1998(9) a la fecha no existen datos públicos que permitan conocer la magnitud de este trastorno. La Agencia de Administración de Alimentos y Medicamento de los Estados Unidos proporciona una guía sobre los niveles máximos recomendados de fumonisinas en alimentos de humanos y animales. En equinos se considera como límite máximo recomendado 5 mg/kg (ppm) en no más del 20 % de la dieta(11). En México el rastrojo de maíz es un subproducto destinado principalmente a la alimentación de rumiantes, sin embargo, frente a la escases de forrajes utilizados en la alimentación de equinos, como henos derivados de leguminosas (alfalfa) o de granos (avena), en algunas regiones del estado de Jalisco se destina el rastrojo de maíz como fuente de fibra en alto porcentaje de inclusión. Un estudio previo en la zona de los Altos mostró contaminación con FB1 en rastrojo de maíz blanco y amarillo, donde el 68 % de las muestras analizadas fueron positivas con nivel máximo de 1.96 mg/kg(12). Este estudio fue llevado a cabo en el año 2012 cuando una serie de casos confirmados de LEME fueron divulgados en el ámbito local por médicos veterinarios del municipio de Juchitlán. En base a esta información, el objetivo del trabajo fue determinar la presencia y niveles de contaminación con fumonisinas en el ingrediente principal de la dieta. El estudio se extendió hacia los principales municipios donde se concentra la población equina del estado de Jalisco.

847


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

Reseña de los casos. Tres (3) equinos machos pertenecientes a las razas Español (473 y 485 kg de peso corporal) y Criollo (464 kg de peso corporal) con edades de 3, 7 y 4 años, respectivamente se diagnosticaron por presentar LEME. Los animales recibían un promedio de 9 kg de ración por día con un ingesta mínima de rastrojo de maíz de 3.6 kg/día (40 % de inclusión). El cuadro clínico observado en los animales incluyó ataxia, ceguera, sudoración profusa, hiperexcitabilidad y convulsiones antes de morir (en un lapso de 48 h). Los estudios clínicos incluyeron examinación neurológica, análisis de biometría hemática y líquido cefalorraquídeo, todos dentro de los valores normales. Otras causas como traumas y mieloencefalitis equina protozoaria (MEP) se descartaron mediante estudios de rayos X y la técnica de Western Blot, resultando negativos en todos los casos. Por otra parte, en los mismos ranchos evaluados se detectó la presencia de otros caballos que comenzaron con síntomas leves aunque dentro del mismo cuadro. A diferencia, estos animales recibieron cuidados especiales con una dieta diferente, logrando lentamente su recuperación. Recolección de muestras de alimento y municipios evaluados. Se obtuvieron 39 muestras de rastrojo de maíz (tres muestras de 500 g/municipio) a partir de los comederos en los ranchos ubicados en los municipios de Ahualulco de Mercado, Ameca, Autlán de Navarro, Concepción de Buenos Aires, Chiquilistlán, Cocula, Cuautitlán, El Grullo, Juchitlán, San Agustín, Tamazula de Gordiano, Tlajomulco de Zuñiga y Unión de Tula del Estado de Jalisco. Todas las muestras se mantuvieron en almacenamiento a 13 % humedad y se molieron a un tamaño de partícula de 1 mm para su conservación en frascos de polietileno. Las muestras se analizaron por duplicado mediante la técnica de inmunoensayo enzimático de tipo competitivo (RomerLabs), y las muestras positivas que superaron el límite recomendado para equinos(11), se confirmaron mediante la técnica de cromatografía de líquidos de alta resolución (HPLC). Las determinaciones analíticas se efectuaron en el área de micotoxicología del laboratorio de Residuos Tóxicos II, Departamento de Salud Pública, CUCBA, Universidad de Guadalajara. A partir de las muestras recolectadas se obtuvo una submuestra representativa por cuarteo para obtener dos muestras analíticas de 20 g, las cuales se mezclaron con 100 ml de metanol al 70% durante 3 min en licuadora (Oster Modelo 4655013). Los extractos se filtraron en papel Whatman No.1 y se ajustó el pH a un rango entre 6 y 8; posteriormente se diluyó cada extracto en una relación 1:20 con agua desionizada. El inmunoensayo (ELISA) se desarrolló conforme al protocolo descrito por el fabricante. Inicialmente, se realizó la mezcla del conjugado con los estándares de fumonisinas (0, 0.25, 0.5, 1.0, 2.5 y 5.0 ppm) o extractos de las muestras. Luego de transferir a los pocillos recubiertos con anticuerpos, la incubación se realizó durante 15 min. Posteriormente se descartó su contenido y se procedió a lavar en forma repetida. La incubación con el sustrato enzimático se realizó durante 5 min. Al detener la reacción, la cuantificación se realizó inmediatamente por lectura de la absorbancia a 450 nm con un filtro de referencia a 630 nm empleando un equipo STAT FAX 3200 (Technology Inc). El desempeño de inmunoensayo fue satisfactorio acorde a las características indicadas por el fabricante (coeficiente de

848


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

regresión > 0.99). Durante la puesta a punto de la metodología, se comparó un mismo set de muestras positivas que fueron analizadas por HPLC (high performance liquid chromatography). Los resultados indicaron una fuerte correlación entre técnicas, siendo las muestras positivas por ELISA ratificadas por los resultados del HPLC. Respecto al HPLC, la confirmación de las muestras positivas se realizó mediante la metodología propuesta por Shephard et al(13) modificada por Doko et al(14). Una alícuota de 50 µl del extracto se derivatizó con 200 µl de una solución de optaldialdehído (OPA) y 20 µl fueron inyectados al sistema. La solución derivatizante se preparó disolviendo 40 mg de OPA en 1 ml de metanol, 5 ml de tetraborato de Na 0.1 M y 50 µl de 2-mercaptoetanol. Las fumonisinas derivatizadas se analizaron empleando un sistema de detección de fluorescencia/HPLC fase reversa. El equipo HPLC consiste de un sistema isocrático con detector de fluorescencia Agilent 1100 (Palo Alto, CA, USA) y PC marca HP con el software ChemStation (Revisión A.10.01). Se empleó una columna C18 (150 x 4.6 mm, 5 µm de tamaño de partícula; Supelcosil LC-ABZ, Supelco) conectada a una pre-columna Supelguard LC-ABZ. Como fase móvil se utilizó metanol-fosfato de sodio dihidrogenado 0.1 M (75:25, pH 3.35 ajustado con ácido ortofosfórico) a flujo de 1.5 ml/min. Las longitudes de excitación y emisión fueron 335 y 440 nm, respectivamente. La cuantificación se realizó midiendo la altura de los picos comparados con la curva de calibración a partir de soluciones testigo de FB1 y FB2 (SIGMA). Para llevar a cabo el análisis estadístico, los niveles de fumonisinas en el alimento en cada muestra de rastrojo y procedente de cada municipio se transformaron logarítmicamente debido a que los mismos presentaron heterocedasticidad. La comparación de medias se realizó mediante la prueba de LSD de Fisher a un nivel de significancia de 0.001 utilizando el programa Minitab v. 14.0. En relación a las condiciones ambientales, durante el desarrollo de este estudio se obtuvieron registros de temperatura y lluvias durante los años 2011 (siembra y cosecha del maíz) y 2012 (acopio). La consulta de los mismos se realizó mediante el acceso al portal de datos del Servicio Meteorológico Nacional(15). Durante el estudio se detectó que el 100 % de los ranchos evaluados utilizaban el rastrojo de maíz en una proporción entre 40 y 50 % de la dieta. Los demás ingredientes utilizados fueron en promedio maíz rolado (10 %) y concentrados a base de cereales (40-50 %). El total de muestras analizadas presentó niveles detectables de fumonisinas (FB1 + FB2), los cuales fluctuaron entre 0.23 a 19.18 mg/kg (Cuadro 1). El análisis estadístico mostró diferencia significativa entre los municipios evaluados (P<0.001), observándose la mayor concentración en Ahualulco de Mercado (media: 12.83 mg/kg) y la menor en Concepción de Buenos Aires (media: 0.27 mg/kg). El 62 % de los municipios bajo estudio presentaron niveles de fumonisinas que superaron el valor recomendado. Las mayores concentraciones en el rastrojo y su relación con el valor máximo recomendado por la FDA (5 mg/kg) superó

849


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

en algunos municipios dicho límite en diferente proporción, de mayor a menor se destaca: Ahualulco de Mercado (19.18 mg/kg; 3.8 veces), El Grullo (10.91 mg/kg; 2.2 veces), Tlajomulco de Zuñiga (6.32 mg/kg; 1.3 veces), Unión de Tula (5.44 mg/kg; 1.1 veces), Autlán de Navarro y Cocula (5.02 mg/kg; en el límite del valor máximo recomendado)(11).

Cuadro 1: Niveles de fumonisinas totales (mg/kg) en el rastrojo de maíz obtenido de ranchos a partir de los principales municipios del estado de Jalisco en 2012 Localidad Ahualulco de Mercado Ameca Autlán de Navarro Concepción de Buenos Aires Chiquilistlán Cocula Cuautitlán El Grullo Juchitlán San Agustín Tamazula de Gordiano Tlajomulco de Zuñiga Unión de Tula

Media ± DE 12.83 ± 6.35 a 1.55 ± 0.46 d 3.15 ± 1.66 cd 0.27 ± 0.04 f 0.30 ± 0.03 f 4.68 ± 0.35 abc 0.78 ± 0.17 ef 7.90 ± 2.22 ab 0.36 ± 0.02 f 2.97 ± 0.32 bcd 1.29 ± 0.91 ef 3.71 ± 2.61 cd 3.69 ± 1.44 bcd

Rango 6.48 - 19.18 1.04 - 1.98 1.58 - 5.02 0.23 - 0.30 0.27 - 0.33 4.33 - 5.02 0.60 - 0.95 5.95 - 10.91 0.34 - 0.38 2.65 - 3.29 0.32 - 2.45 0.35 - 6.32 2.00 - 5.44

DE= desviación estándar. Las literales indican diferencia estadística entre localidades (P<0.001).

Debido a la naturaleza endófita de las especies de Fusarium en maíz, la producción de fumonisinas puede ocurrir en etapas tempranas del cultivo y la maduración del grano. En el reporte de las condiciones climáticas durante 2011 se observa de forma general que existieron condiciones adecuadas de temperatura y humedad para el cultivo, y eventualmente también para el desarrollo de especies de Fusarium, entre ellas toxicogénicas. En los meses de mayo a noviembre de 2011, la temperatura promedio fue 22.1 °C (rango de 14.7 a 29.5 °C) y las precipitaciones fluctuaron entre 0.2 y 203.8 mm. En relación al año 2012, la temperatura promedio fue de 20.4 °C (rango de 12.7 a 28.1 °C) y la precipitación pluvial entre 0.1 a 202.2 mm(15). Las investigaciones relacionadas con brotes en campo de LEME en caballos reportan variaciones importantes en los niveles detectados de fumonisinas en los alimentos asociados. Destacan los observados en algunas regiones de Estados Unidos de Norteamérica, durante

850


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

1989 y 1990 se presentaron 45 casos de LEME asociados al consumo de alimentos elaborados principalmente con grano de maíz parcialmente molido. Las concentraciones de FB1 fueron de <1 a 126 g /g, la mayoría de las muestras con niveles superiores a 10 g/g(8). En Brasil se presentaron casos de LEME asociados a la detección de fumonisinas en niveles de 0.2 a 38.5 g/g, destaca la presencia del rastrojo de maíz como uno de los ingredientes en la alimentación de los caballos afectados(16); mientras que en otro reporte observado en Sao Paulo, dos casos de LEME se asociaron con niveles de FB1 de 0.12 y 0.02 g/g respectivamente(7). En México sólo se ha publicado un brote de LEME que ocasionó la muerte de 100 burros en el estado de Oaxaca, 14 muestras del alimento consumido presentaron niveles de fumonisinas de 0.67 a 13.3 g/g(9). En Argentina, Brasil y Uruguay se han diagnosticado casos de LEME en caballos y mulas asociados con el consumo de maíz (mezclas de granos, mazorcas, pajas, etc.) además de subproductos contaminados. Por otra parte, en otro estudio realizado en Brasil, se encontró que los brotes de LEME estaban asociados al consumo de 1 kg de maíz por día o dietas conteniendo al menos 20 % de maíz; en animales de diferentes edades con morbilidad de 4 a 100 % y mortalidad cercana al 100 %(17,18). En este estudio, los niveles de contaminación por fumonisinas que se reportan se obtuvieron del principal ingrediente encontrado en la dieta (rastrojo de maíz). Se considera que existe la posibilidad de que los animales en todos los ranchos hayan estado expuestos a niveles fluctuantes de fumonisinas. Dado que las micotoxinas exhiben una distribución heterogénea en el alimento, la muestra analítica obtenida del comedero representa una evidencia de que existió exposición a fumonisinas. Por otra parte, las especies toxicogénicas de Fusarium infectan una diversidad de cereales que forman parte de los concentrados alimenticios. Por esta razón, otros ingredientes en la dieta podrían haber incrementado el nivel de exposición. En el municipio de Juchitlán, el hallazgo de fumonisinas directamente del rastrojo de maíz en el comedero (media 0.36 ± 0.02 mg/kg) junto con los signos clínicos neurológicos e histopatológicos se confirma el diagnóstico de LEME. Estos resultados de fumonisinas se encuentran dentro del rango de valores informados en otros estudios(7,8,16). En relación a los niveles de fumonisinas en rastrojo de maíz detectado en los 13 municipios, los resultados fueron similares a los reportados previamente en alimentos de equinos. Entre estos, destacan los realizados en Rio de Janeiro (Brasil) en cinco ranchos de caballos donde los niveles de fumonisinas detectados fueron de 0.1 a 7.49 g/g, ninguno de los niveles promedio excedió el límite recomendado(19). En Alemania se detectó FB1 en concentrados, peletizados, maíz, avena y cebada; los resultados mostraron contaminación en 94 % de las muestras analizadas, los niveles fueron de 2 a 2200 g/kg, y las mayores concentraciones se observaron en muestras de maíz y alimento peletizado(20). La temperatura y estrés hídrico son los principales factores que influyen en el desarrollo de especies de Fusarium; sin embargo, el impacto de estos factores climáticos depende de otras

851


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

variables, tales como infecciones fúngicas adicionales, sequía o factores del huésped(3). Durante el desarrollo del maíz, dos períodos resultan críticos en la contaminación de los granos con fumonisinas, uno de ellos es la floración y otro el secado de los granos durante la maduración de la mazorca. Los estudios identifican que baja disponibilidad de agua (aw) y elevadas temperaturas están asociadas a la presencia de fumonisinas durante la floración. En cambio, lluvias o altas temperaturas pueden desencadenar también la síntesis de fumonisinas durante la cosecha(21). La temperatura óptima para el crecimiento de F. verticillioides es de 25 °C con marcada reducción a los 15 °C o por efecto de la aw. Se ha demostrado que la disminución del aw en F. verticillioides incrementa la expresión del gen FUM1 que codifica para la síntesis de fumonisinas(21,22). No obstante, esta asociación no es directa, ya que existen evidencias de que la producción de fumonisinas ocurre bajo diversas condiciones. En Uganda, elevada humedad y prácticas agrícolas inadecuadas se asociaron con mayores niveles de fumonisinas(23). Según los datos recolectados por esta investigación, los registros de temperatura y precipitaciones en el estado de Jalisco durante 2011 y 2012 resultaron potencialmente favorables para la ocurrencia y proliferación de especies de Fusarium productoras de fumonisinas. Se concluye que el rastrojo de maíz destinado al consumo de equinos presentó niveles de fumonisinas asociado a casos de LEME confirmados durante 2012. Las concentraciones presentes en los diferentes municipios del estado de Jalisco permitieron identificar a Ahualulco de Mercado, Autlán de Navarro, Cocula, El Grullo, Tlajomulco de Zuñiga y Unión de Tula como zonas de riesgo de presentación de casos de LEME.

Literatura citada: 1.

Gelderbrom WC, Marasas WFO, Vleggar R, Thiel PG, Cawood ME. Fumonisins: isolation, chemical characterisation and biological effects. Mycopathologia 1992;(117):11-16.

2.

Deepa N, Sreenivasa MY. Fumonisins: A review on its global occurrence, epidemiology, toxicity and detection. J Vet Med Res 2017;4(6):1093-1102.

3.

Marin P, Magan N, Vázquez C, González-Jaén MT. Differential effect of environmental conditions on the growth and regulation of the fumonisin biosythetic gene FUM1 in the maize producer Fusarium verticillioides and Fusarium proliferatum. Microbiol Ecol 2010;(73):303-311.

852


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

4.

Alizadeh AM, Roshamdel G, Roudbarmohammadi S, Roudbary M, Sohanaki H, Ghiasian SA, et al. Fumonisin B1 contamination of cereals and risk of esophageal cancer in a high risk area in northeastern Iran. Asian Pacific J Cancer Prev 2012;(13):26252628.

5.

IARC. International Agency for Research on Cancer. Some traditional herbal medicines, some mycotoxins, naphthalene and styrene. Monographs on the evaluation of carcinogenic risks to humans. Lyon 2002;(82):33.

6.

Caloni F, Cortinovis C. Effects of fusariotoxins in the equine species. Vet J 2010;(186):157-161.

7.

Vendruscolo CP, Frias NC, de Carvalho CB, de Sá LMR, Belli CB, Baccarin RYA. Leukoencephalomalacia outbreak in horses due to consumption of contaminated hay. J Vet Intern Med 2016;(30):1879-1881.

8.

Ross PF, Rice LG, Reagor JC, Osweiler GD, Wilson TM, Nelson HA, et al. Fumonisin B1 concentrations in feeds from 45 confirmed equine leukoencephalomalacia cases. J Vet Diagn Invest 1991;(3):238-241.

9.

Rosiles MR, Bautista J, Fuentes VO, Ross F. An outbreak of equine leukoencephalomalacia at Oaxaca, Mexico, associated with fumonisin B1. J Vet Med Series A 1998;45(5):299-302.

10. Giannitti F, Sain SD, Pacin AM, Barrandeguy M, Larrere C, Ortega J, Uzal FA. Equine leukoencephalomalacia (ELEM) due to fumonisins B1 and B2 in Argentina. Pesq Vet Bras 2011;31(5):407-412. 11. FDA, Food and Drug Administration, Center for Food and Applied Nutrition. Guidance for Industry. Fumonisin levels in human foods and animal feeds 2001. https://www.fda.gov/Food/GuidanceRegulation/GuidanceDocumentsRegulatoryInfor mation/ucm109231.htm 12. Arias S, Patricio SM, Theumer M, Rubinstein H, Reyes-Velázquez WP. Ocurrencia natural de fumonisinas en rastrojo de maíz procedente de diferentes variedades e híbridos en el estado de Jalisco [resumen]. Semana de la Investigación Científica, CUCBA. Universidad de Guadalajara 2010:146. 13. Shephard GC, Sydenham EW, Thiel PG, Gelderblom WCA. Quantitative determination of fumonisins B1 and B2 by high-performance liquid chromatography with fluorescence detection. J Liq Chromatogr 1990;(13):2077-2080.

853


Revista Mexicana de Ciencias Pecuarias Volumen 9 Número 4

2018

14. Doko B, Rapior S, Visconti A, Schjoth J. Incidence and levels of fumonisins contamination in maize genotypes grown in Europe and Africa. J Agric Food Chem 1995;(43):429-434. 15. CONAGUA. Comisión Nacional del Agua. Servicio Meteorológico Nacional. Reporte Anual 2011 y 2012. 16. Sydenham EW, Marasas WFO, Shephard GS, Thiel PG, Hirooka EY. Fumonisin concentrations in Brazilian feeds associated with field outbreaks of confirmed and suspected animal mycotoxicosis. J Agric Food Chem 1992;(40):994-997. 17. Riet-Correa F, Rivero R, Odriozola E, Adrien ML, Medeiros RMT, Schild AL. Mycotoxicoses of ruminants and horses. J Vet Diagn Invest 2013;25(6):692-708. 18. Rivero R, Collazo S, Ugarte E, Nan F, Mazzolini Y, Matto C. Leukoencephalomalacia in equine on the West Coast of Uruguay. Veterinaria (Montevideo) 2013;49(189):3139. 19. Keller KM, Queiroz BD, Keller LAM, Ribeiro JMM, Cavaglieri LR, González ML, et al. The mycobiota and toxicity of equine feeds. Vet Res Commun 2007;(31):1037-1045. 20. Liessener K, Curtui V, Bletrich R, Märtinbauer E, Usleber E. Mycotoxins in horse feed. Mycotoxin Res 2010;(23):26-30. 21. Santiago R, Cao A, Butron A. Genetic factors involved in fumonisin accumulation in maize kernels and their implication in maize agronomic management and breeding. Toxins 2015;7(8):3267-3296. 22. Jurado M, Marín P, Magan N, Gonzalez-Jaén MT. Relationship between solute and matric potential stress, temperature, growth and FUM1 gene expression in two Fusarium verticillioides strains from Spain. Applied and Environm Microbiol 2008;74(7):20322036. 23. Atukwase A, Kaaya AN, Muyanja C. Factors associated with fumonisin contamination of maize in Uganda. J Sci Food Agric 2009;(89):2393–2398.

854


Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 9 Núm. 4, pp. 614-854, OCTUBRE-DICIEMBRE-2018

ISSN: 2448-6698

Pags. Análisis de pedigrí en la determinación de la diversidad genética de poblaciones bovinas para carne mexicanas

Pedigree analysis for determination of genetic diversity in mexican beef cattle populations Rodolfo Ramírez-Valverde, Antonio R. Delgadillo-Zapata, Joel Domínguez-Viveros, Jorge Á. Hidalgo-Moreno, Rafael Núñez-Domínguez, Felipe A. Rodríguez-Almeida, Claudia Reyes-Quiroz, José G. García-Muñiz.................................................................................................................................................. 614

Construcción de un índice de selección para rasgos de comportamiento en toros de lidia

Building of a selection index for behavioral traits in fighting bulls Joel Domínguez-Viveros, Felipe Alonso Rodríguez-Almeida, Nicolás Callejas-Juárez, Nelson Guadalupe Aguilar-Palma, Juan Ángel Ortega-Gu�érrez...............................636

Épocas de nacimiento basadas en un índice climático para el ajuste de modelos estadísticos para peso vivo de ganado bovino en México Birth seasons based on a climatic index for statistical model fitting of live weight of bovine cattle in México Jessica Beatriz Herrera-Ojeda, Gaspar Manuel Parra-Bracamonte, Nicolás López-Villalobos, José Fernando Vázquez-Armijo, Karlos Edmundo Orozco Durán, Juan Gabriel Magaña-Monforte, Juan Carlos Mar�nez-González, Francisco Joel Jahuey-Mar�nez............................................................................................................... 646

Modelos para programación y optimización de agua de riego en avena forrajera

Models for irrigation timing and optimization in oats for forage Miguel Servin Pales�na, Ricardo Alonso Sánchez Gu�érrez, Orlando Ramírez Valle, Manuel Antonio Galindo Reyes, Héctor Gu�érrez Bañuelos.....................................667

Secuencias de cultivo alternativas para incrementar el potencial forrajero y productividad del agua

Alternative crop sequences for increasing the forage potential and water productivity David Guadalupe Reta Sánchez, J. Santos Serrato Corona, Héctor Mario Quiroga Garza, Arturo Gaytán Mascorro, Uriel Figueroa Viramontes..........................................685

Uso de retenedores de humedad edáfica en la sobrevivencia y crecimiento de dos especies de pastos Bouteloua curtipendula [Michx.] Torr. y Chloris gayana Kunth

Use of soil moisture retainers on the survival and growing of two grass species Bouteloua curtipendula [Michx.] Torr. and Chloris gayana Kunth Luis Gerardo Yáñez-Chávez, Aurelio Pedroza-Sandoval, Mar�n Mar�nez-Salvador, Ignacio Sánchez-Cohen, Francisco Guadalupe Echavarría-Cháirez, Miguel Agus�n Velásquez-Valle, Armando López-Santos................................................................................................................................................................................ 702

Kisspeptina en becerras prepúberes: 2. Respuesta de LH, FSH y GH a distintas dosis de kisspeptina-10 y su asociación con IGF-I y leptina circulantes

Kisspeptin in prepuberal heifers: 2. Response of LH, FSH and GH to different doses of kisspeptin-10 and its association with circulating IGF-I and leptin Alejandro Villa Godoy, Rubén Santos Echeverría, Jorge Víctor Rosete Fernández, René Carlos Calderón Robles, Gerardo Perera Marín, Jesús Alejandro Arreguín Arevalo, Terry M. Ne�............................................................................................................................................................................................ 719

Variaciones en las respuestas termoregulatorias de ovejas de pelo durante los meses de verano en un clima desértico

Variations in the thermoregulatory responses of hair ewes during the summer months in a desert climate Ulises Macías-Cruz, Miguel A. Gastélum, Leonel Avendaño-Reyes, Abelardo Correa-Calderón, Miguel Mellado, Alfonso Chay-Canul, Carlos F. Arechiga.........................738

Identificación molecular y frecuencia de patógenos aislados de mastitis bovina en establos de la Península de Baja California, México

Molecular identification and frequency of isolated pathogens from bovine mastitis in dairy herds from Baja California Peninsula, Mexico Jennifer Brisuela Raygosa, Javier Palacios Torres, Gilberto López Valencia, Sawako Hori-Oshima, José Carlomán Herrera Ramírez, Lourdes Carolina Pujol Manríquez, Carlos Eliud Angulo Valadez, Tomás Benjamín Rentería Evangelista, Gerardo Enrique Medina Basulto ...................................................................................................... 754

Immunolocalization of VirB11 protein in the Anaplasma marginale outer membrane and its reaction with bovine immune sera

Inmunolocalización de la proteína VirB11 en la membrana externa de Anaplasma marginale y su reacción con sueros inmunes de bovino América Ive�e Barrera Molina, Raquel Cossío Bayúgar, José A. Gu�érrez-Pabello, Ángel Tolen�no Tello López, Jesús Francisco Preciado de la Torre, Sergio Darío Rodríguez Camarillo................................................................................................................................................................................................................. 769

Uso de nisina y quitosano para la inhibición de Staphylococcus aureus resistente a antibióticos y asociado a mastitis bovina

Use of nisin and chitosan for the inhibition of antibiotic resistant Staphylococcus aureus bovine mastitis-associated Mónica Sánchez-Ceja, Ma. Teresa Arceo-Mar�nez, Ma. Guadalupe Sandoval-Flores, Patricia Nayeli Alva Murillo, Rafael Jiménez-Mejía, Pedro Damián Loeza-Lara........792

Caracterización y tipificación de explotaciones de dehesa asociadas a cooperativas: un caso de estudio en España

Characterization and typification of dehesa farms associated to cooperatives: a case study in Spain Francisco Maroto-Molina, Augusto Gómez-Cabrera, José E. Guerrero-Ginel, Ana Garrido-Varo, José A. Adame-Siles, Dolores C. Pérez-Marín..........................................811

Frecuencia de Neospora caninum en bovinos doble propósito en fincas del estado Guárico, Venezuela

Frequency of Neospora caninum in double purpose cattle on herds at the State of Guárico, Venezuela Juan Carlos Pinilla León, Natalia Da Silva Borges........................................................................................................................................................................................... 833

Niveles de fumonisinas en rastrojo de maíz para consumo equino en el estado de Jalisco Levels of fumonisins in corn stover for equine consumption in Jalisco state

Waldina Patricia Reyes-Velázquez, Claudia Nayeli Anguiano-Sevilla, Rubén Anguiano-Estrella, Luis Alfonso Jiménez-Ortega, Pablo Torres-Morán, Federico Rojo............845

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 9 Núm. 4, pp. 614- 854, OCTUBRE-DICIEMBRE-2018

CONTENIDO CONTENTS

Rev. Mex. Cienc. Pecu. Vol. 9 Núm. 4, pp. 614-854, OCTUBRE-DICIEMBRE-2018

RMCP Vol9, Num.(4) 202018  
RMCP Vol9, Num.(4) 202018  
Advertisement