RMCP Vol. 14 Núm. 1 (2023): Enero-Marzo [versión en español]

Page 1

Edición Bilingüe Bilingual Edition ISSN: 2448-6698 Re vista Mex i c a n a de C i enc ias P ecu aria s Rev. Mex. Cienc. Pecu. Vol. 14 Núm. 1, pp. 1-259, ENERO-MARZO-2023 Rev. Mex. Cienc. Pecu. Vol. 14 Núm. 1, pp. 1-259, ENERO-MARZO-2023

REVISTA MEXICANA

DE CIENCIAS

PECUARIAS Volumen 14 Numero 1, Enero-Marzo 2023. Esunapublicación trimestral deacceso abierto, revisadapor pares yarbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx

Distribuida por el Centro de Investigación Regional Sureste, Calle 6 No. 398 X 13, Avenida Correa Racho, Col. Díaz Ordaz, Mérida Yucatán, C.P. 97130.

Editor responsable: Arturo García Fraustro Reservas de Derechos al Uso Exclusivo número 04-2022-033116571100-102. ISSN: 2448-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR).

Responsable de la última actualización de este número: Arturo García Fraustro, Campo Experimental Mocochá, Km. 25 Antigua Carretera Mérida–Motul, Mocochá, Yuc. C.P. 97454 http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en diciembre de 2022.

DIRECTORIO

EDITOR EN JEFE

Arturo García Fraustro

EDITORES ADJUNTOS

Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA

Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México

Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, Dr. Alfonso Juventino Chay Canul, Universidad Autónoma de Tabasco, México

Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos

Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México

Dr. Javier F. Enríquez Quiroz, INIFAP, México

Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México

Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México

Dr. James A. Pfister, USDA, Estados Unidos

Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México

Dr. Sergio Iván Román-Ponce, INIFAP, México

Dr. Jesús Fernández Martín, INIA, España

Dr. Maurcio A. Elzo, Universidad de Florida

Dr. Sergio D. Rodríguez Camarillo, INIFAP, México

Dra Nydia Edith Reyes Rodríguez, Universidad Autónoma del Estado de Hidalgo, México

Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México

Dra. Elizabeth Loza-Rubio, INIFAP, México

Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España

Dr. José Armando Partida de la Peña, INIFAP, México

Dr. José Luis Romano Muñoz, INIFAP, México

Dr. Jorge Alberto López García, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México

Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México

Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México

Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México

Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY

Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. José Juan Hernández Ledezma, Consultor privado Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México

Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México

Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

I
Macho semental de venado cola blanca manejado en cautiverio en la Facultad de Ciencias Biológicas de Córdova, Ver. Fotografía: Ricardo Serna Lagunes y Norma Mora Collado

REVISTA MEXICANA DE CIENCIAS PECUARIAS

La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria.

Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados.

Todas las contribucionesserán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es

trimestral en formato bilingüe Español e Inglés. El costo total porpublicares de $ 7,280.00 másIVA pormanuscrito ya editado.

Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente.

El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx.

La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, Campo Experimental Mocochá, Km. 25 Antigua Carretera Mérida–Motul, Mocochá, Yuc. C.P. 97454; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET

Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx

Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research.

The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products.

All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 425.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged.

Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No.215 x67 y69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, Campo Experimental Mocochá, Km. 25 Antigua Carretera Mérida–Motul, Mocochá, Yuc. C.P. 97454; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx.

Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org) .

VISIT OUR SITE IN THE INTERNET

Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II

REVISTA MEXICANA DE CIENCIAS PECUARIAS

REV. MEX. CIENC. PECU. VOL. 14 No. 1 ENERO-MARZO-2023

CONTENIDO Contents

ARTÍCULOS

Articles Pág.

Identification of candidate genes and SNPs related to cattle temperament using a GWAS analysis coupled with an interacting network analysis

Identificación de genes candidatos y SNP relacionados con el temperamento del ganado utilizando un análisis GWAS junto con un análisis de redes interactuantes

Francisco Alejandro Paredes-Sánchez, Ana María Sifuentes-Rincón, Edgar Eduardo Lara-Ramírez, Eduardo Casas, Felipe Alonso Rodríguez-Almeida, Elsa Verónica Herrera-Mayorga, Ronald D. Randel ...........................................................................................1

Efecto de la consanguinidad y selección sobre los componentes de un índice productivo en ratones bajo apareamiento estrecho

Effect of consanguinity and selection on the components of a productive index, in mice under close mating

Dulce Janet Hernández López, Raúl Ulloa Arvizu, Carlos Gustavo Vázquez Peláez, Graciela Guadalupe Tapia Pérez ..................................................................................... …............23

Variabilidad genética en biomasa aérea y sus componentes en alfalfa bajo riego y sequía

Genetic variability in aerial biomass and its components in alfalfa under irrigation and drought Milton Javier Luna-Guerrero, Cándido López-Castañeda .............. ……………………………………….39

Estimación de masa de forraje en una pradera mixta por aprendizaje automatizado, datos del manejo de la pradera y meteorológicos satelitales

Estimation of forage mass in a mixed pasture by machine learning, pasture management and satellite meteorological data

Aurelio Guevara-Escobar, Mónica Cervantes-Jiménez, Vicente Lemus-Ramírez, Adolfo Kunio Yabuta-Osorio, José Guadalupe García-Muñiz ……………………………………………………………….61

Thymol and carvacrol determination in a swine feed organic matrix using Headspace SPME-GC-MS

Determinación de timol y carvacrol en una matriz orgánica de alimento para cerdo utilizando Headspace SPME-GC-MS

Fernando Jonathan Lona-Ramírez, Nancy Lizeth Hernández-López, Guillermo González-Alatorre, Teresa del Carmen Flores-Flores, Rosalba Patiño-Herrera, José Francisco Louvier-Hernández …….78

III

Cambios en el recuento de cuatro grupos bacterianos durante la maduración del Queso de Prensa (Costeño) de Cuajinicuilapa, México

Changes in the count of four bacterial groups during the ripening of Prensa (Costeño) Cheese from Cuajinicuilapa, Mexico

José Alberto Mendoza-Cuevas, Armando Santos-Moreno, Beatriz Teresa Rosas-Barbosa, Ma. Carmen Ybarra-Moncada, Emmanuel Flores-Girón, Diana Guerra-Ramírez ………………………..…94

Detección molecular de un fragmento del virus de lengua azul en borregos de diferentes regiones de México

Molecular detection of a fragment of bluetongue virus in sheep from different regions of Mexico

Edith Rojas Anaya, Fernando Cerón-Téllez, Luis Adrián Yáñez-Garza, José Luis Gutiérrez-Hernández, Rosa Elena Sarmiento-Salas, Elizabeth Loza-Rubio ...........................……110

Insulin-like growth factor 1 (IGF-1) concentrations in synovial fluid of sound and osteoarthritic horses, and its correlation with proinflammatory cytokines IL-6 and TNF

Concentraciones del factor de crecimiento similar a la insulina 1 (IGF-1) en el líquido sinovial de caballos sanos y osteoartríticos, y su correlación con las citoquinas proinflamatorias IL-6 y TNFα Fernando García-Lacy F., Sara Teresa Méndez-Cruz, Horacio Reyes-Vivas, Victor Manuel DávilaBorja, Jose Alejandro Barrera-Morales, Gabriel Gutiérrez-Ospina, Margarita Gómez-Chavarín, Francisco José Trigo-Tavera .......................................................…………………………………………122

Uso de células estromales mesenquimales derivadas de la gelatina de Wharton para el tratamiento de uveítis recurrente equina: estudio piloto

Use of Wharton's jelly-derived mesenchymal stromal cells for the treatment of equine recurrent uveitis: a pilot study María Masri-Daba, Montserrat Erandi Camacho-Flores, Ninnet Gómez-Romero, Francisco Javier Basurto Alcántara .................................................................................………………………………137

Escala de la producción y eficiencia técnica de la ganadería bovina para carne en Puebla, México

Scale of production and technical efficiency of beef cattle farming in Puebla, Mexico José Luis Jaramillo Villanueva, Lissette Abigail Rojas Juárez, Samuel Vargas López ……………….…154

Regresión cuantil para predicción de caracteres complejos en bovinos Suizo Europeo usando marcadores SNP y pedigrí

Quantile regression for prediction of complex traits in Braunvieh cattle using SNP markers and pedigree

Jonathan Emanuel Valerio-Hernández, Paulino Pérez-Rodríguez, Agustín Ruíz-Flores ……………….172

Análisis de crecimiento estacional de una pradera de trébol blanco (TrifoliumrepensL) Seasonal growth analysis of a white clover meadow (TrifoliumrepensL.)

Edgar Hernández Moreno, Joel Ventura Ríos, Claudia Yanet Wilson García, María de los Ángeles Maldonado Peralta, Juan de Dios Guerrero Rodríguez, Graciela Munguía Ameca, Adelaido Rafael Rojas García....................................................................................…………….190

IV

REVISIONES DE LITERATURA Reviews

Aspects related to the importance of using predictive models in sheep production. Review

Aspectos relacionados con la importancia del uso de modelos predictivos en la producción ovina. Revisión Antonio Leandro Chaves Gurgel, Gelson dos Santos Difante, Luís Carlos Vinhas Ítavo, João Virgínio Emerenciano Neto, Camila Celeste Brandão Ferreira Ítavo, Patrick Bezerra Fernandes, Carolina Marques Costa, Francisca Fernanda da Silva Roberto, Alfonso Juventino Chay-Canul ......................................204

NOTAS DE INVESTIGACIÓN Techcnical notes

Preferencia de ocho plantas por Odocoileusvirginianusen cautiverio Preference for eight plants among captive white-tailed deer Odocoileusvirginianusin Veracruz, Mexico Hannia Yaret Cueyactle-Cano, Ricardo Serna-Lagunes, Norma Mora-Collado, Pedro Zetina-Córdoba, Gerardo Benjamín Torres-Cantú .....................................………………...............228

Rendimiento y valor nutricional de brásicas forrajeras en comparación con forrajes tradicionales

Yield and nutritional value of forage brassicas compared to traditional forages

David Guadalupe Reta Sánchez, Juan Isidro Sánchez Duarte, Esmeralda Ochoa Martínez, Ana Isabel González Cifuentes, Arturo Reyes González, Karla Rodríguez Hernández …….............237

Genetic characterization of bovine viral diarrhea virus 1b isolated from mucosal disease

Caracterización del virus de la diarrea viral bovino subtipo 1b aislado de un caso de la enfermedad de las mucosas

Roberto Navarro-López, Juan Diego Perez-de la Rosa, Marisol Karina Rocha-Martínez, Marcela Villarreal-Silva, Mario Solís-Hernández, Eric Rojas-Torres, Ninnet Gómez-Romero ...........248

V

Actualización: marzo, 2020

NOTAS AL AUTOR

La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437.

1. Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o inextensoen Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes).

2. Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo.

3. El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

4. Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

5. Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

6. Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

Página del título Resumen en español Resumen en inglés Texto

Agradecimientos y conflicto de interés Literatura citada

7. Página del Título Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8. Resumenenespañol.Enlasegundapáginasedebe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9. Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto.Lastrescategorías detrabajosquesepublican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente:

a)Artículoscientíficos.Deben serinformesdetrabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

VI

Introducción Materiales y Métodos Resultados Discusión

Conclusiones e implicaciones Literatura citada

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección.

b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés.

12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

referencias, aunque pueden insertarse en el texto (entre paréntesis).

ReglasbásicasparalaLiteraturacitada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después decada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) dela revista yfinalmente el número de páginas (esto en caso de artículo ordinario de revista).

Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año.

Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año.

Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el IndexMedicus

Revistas

Artículoordinario,convolumenynúmero. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “etal.”).

VII

I) Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Sólonúmerosinindicarvolumen.

II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Noseindicaelautor.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplementoderevista.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización,comoautor.

VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

Enprocesodepublicación.

VII)Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

Libros y otras monografías Autortotal.

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Autordecapítulo.

IX) Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memoriasdereuniones.

X) Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI) Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH etal.editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

Tesis.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis ybabesiosisbovinasen becerrosmantenidosen una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

Organizacióncomoautor.

XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural.Curso deactualización técnicapara la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

XVIII)SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicacioneselectrónicas

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

VIII

XXII)Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismossin necesidaddeleer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales.

14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro.

15. Unavez recibidala versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas.

16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista.

17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

18. Abreviaturas de uso frecuente: cal caloría (s) cm centímetro (s) °C grado centígrado (s) DL50 dosis letal 50% g gramo (s)

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnmmetros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales vs versus xg gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

IX

INSTRUCTIONS FOR AUTHORS

Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437.

1. Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or inextensoin a Congress or any other type of Meeting will not be accepted (except for Abstracts).

2. All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt.

3. Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias”. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

4. Tofacilitatepeer review allpagesshouldbenumbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

5. Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

6. Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

Title page Abstract Text

Acknowledgments and conflict of interest Literature cited

7. Title page. It should only contain the title of the work, which shouldbe concise but informative; aswell as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

8. Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value andthe main conclusionsshouldbe elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

9. Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a)ResearchArticles. They should originate in primary works and may show partial or final results of research. The text of the article must include the following parts:

Introduction

Materials and Methods Results Discussion

Conclusions and implications

Literature cited

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

b) Technical Notes. They should be brief and be evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which

Updated: March, 2020
X

should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of the research article but without section titles.

c) Reviews. The purpose of these papers is to summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; andc) Financial relationships that could bethe source of a conflict of interest.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc.

11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Keyrulesforreferences

a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followedbytheinitialsof thefirst and middlename(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one.

b. The title of the paper should be written in full, followedbythe abbreviated titleof the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article).

c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

names(s), the number of the edition, the country, the printing house and the year.

e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, thedegreeobtained, followed bythenameof the City, State, and Country, the University (not the school), and finally the year.

Examples

The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

Journals

Standard journal article (List the first six authors followed by etal.)

I) Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issuewithnovolume

II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Noauthorgiven

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journalsupplement

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

XI

Organization,asauthor

VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

Inpress

VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treatedarea bycattle. JRangeManage[in press] 2000.

Books and other monographs

Author(s)

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Chapterinabook

IX) Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Conferencepaper

X) Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI) Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH etal.editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

Thesis

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis ybabesiosisbovinasen becerrosmantenidosen una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

Organizationasauthor

XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural.Curso deactualización técnicapara la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

XVII)AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Electronicpublications

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003.

XXII)Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003.

12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

13. Final version. This is the document in which the authors have already integrated the corrections and modifications indicatedbythe Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box

XII

14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines.

16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations:

cal calorie (s) cm centimeter (s) °C degree Celsius DL50 lethal dose 50% g gram (s) ha hectare (s) h hour (s) i.m. intramuscular (..ly) i.v. intravenous (..ly) J joule (s) kg kilogram (s) km kilometer (s) L liter (s) log decimal logarithm Mcal mega calorie (s)

MJ mega joule (s) m meter (s) µl micro liter (s) µm micro meter (s) mg milligram (s) ml milliliter (s) mm millimeter (s) min minute (s) ng nanogram (s) P probability (statistic) p page

CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units vs versus xg gravidity

The full term for which an abbreviation stands should precede its first use in the text.

18. Scientific names and other Latin terms should be written in italics.

XIII

https://doi.org/10.22319/rmcp.v14i1.6077

Artículo

Identificación de genes candidatos y SNP relacionados con el temperamento del ganado utilizando un análisis GWAS junto con un análisis de redes interactuantes

FranciscoAlejandro Paredes-Sánchez a

Ana María Sifuentes-Rincón b*

Edgar Eduardo Lara-Ramírez c

Eduardo Casas d

FelipeAlonso Rodríguez-Almeida e

Elsa Verónica Herrera-Mayorga f

Ronald D. Randel g

a UniversidadAutónoma de Tamaulipas, IA-UAMM. Mante, México.

b Instituto Politécnico Nacional. Centro de Biotecnología Genómica. Laboratorio de BiotecnologíaAnimal, Blvd. Del Maestro esq. Elías Piña. Col. Narciso Mendoza s/n. Cd. Reynosa, Tam. México.

c Instituto Mexicano del Seguro Social, Unidad de Investigación Biomédica de Zacatecas, Zacatecas, México.

d United States Department ofAgriculture. NationalAnimal Disease Center, Iowa, USA.

e UniversidadAutónoma de Chihuahua. Facultad de Zootecnia y Ecología, Chihuahua, México.

f Universidad Autónoma de Tamaulipas. IBI-UAMM, Mante, México.

g TexasA&M University. AgriLife Research. Texas, USA.

*Autor de correspondencia: asifuentes@ipn.mx

1

Resumen:

El objetivo de este estudio fue identificar en animales de raza Angus y Brangus con temperamento extremo, medido como velocidad de salida, regiones genómicas y genes candidatos asociados con el temperamento bovino. La población fue genotipada con el chip Genomic Profiler HD 150K y después del análisis de asociación del genoma completo, los SNP rs133956611 (P= 2.65 E-06) y rs81144933 (P= 9.58 E-06) se asociaron con el temperamento. El análisis de mapeo de las regiones cercanas al SNP rs81144933 identificó los genes SNCA (alfa-sinucleína) y MMRN1 (multimerin-1) a 222.8 y 435.9 Kb corriente abajo, respectivamente, mientras que para los loci rs133956611 se identificó el gen GPRIN3 (familia GPRIN- miembro 3) a 245.7 Kb corriente arriba, los tres genes se encuentran en el cromosoma BTA6. El análisis de las interacciones proteína-proteína de SNCA permitió la identificación de los genes APP (proteína precursora de β-amiloide), PARK7 (deglicasa asociada al parkinsonismo), UCHL1 (ubiquitina C-terminal hidrolasa L1), PARK2 (parkinaRBR-E3-ubiquitina-proteína-ligasa), y genes de la familia SLC como candidatos a estar asociados con el temperamento bovino. Todos estos genes candidatos ysu interacción fueron resecuenciados, lo que permitió el descubrimiento de nuevos SNP en los genes SNCA y APP. De estos, los SNP localizados en los intrones 5, 8 y 11 del gen APP afectan a los motivos del sitio de empalme. Estos resultados indican que el SNCA y sus genes interactuantes son candidatos para estar relacionados con el temperamento bovino.

Palabras clave: Ganado de carne, Comportamiento, BTA6, Genes candidatos, Temperamento.

Recibido: 18/10/2021

Aceptado: 16/08/2022

Introducción

El temperamento es un rasgo económicamente relevante que afecta el bienestar de los animales y los rasgos relacionados con la productividad. El temperamento bovino se considera el rasgo más importante de la personalidad de un animal y comprende una amplia gama de comportamientos, desde la docilidad hasta el miedo y el nerviosismo o la falta de respuesta, los intentos de escape y el comportamiento agresivo, en el que se observan diversos parámetros como la actividad locomotora general y la reactividad al estrés. El temperamento es afectado por la edad, la experiencia, el sexo, el manejo, los efectos maternos, los factores ambientales, la genética, la especie y la raza(1,2). Hasta la fecha, varios enfoques genómicos intentaron identificar regiones genómicas y genes en los que los

Rev Mex Cienc Pecu 2023;14(1):1-22 2

polimorfismos de un solo nucleótido (SNP, del inglés single nucleotide polymorphisms) subyacentes están asociados con el temperamento, un rasgo fenotípico complejo.

El mapeo de locus de rasgo cuantitativo (QTL, del inglés quantitative trait locus) descubrió la primera evidencia de regiones genómicas asociadas con rasgos de comportamiento en razas lecheras(3,4). La detección de QTL en el genoma condujo a la propuesta de genes candidatos bajo la región genómica abarcada por el QTL, que podrían ser potencialmente responsables de las diferencias en la expresión de rasgos. La identificación de genes candidatos con base en su función y posible implicación en el temperamento bovino ha sido una estrategia para la búsqueda de SNP. Garza-Brenner et al(5) seleccionaron un grupo de 19 genes que participan en la vía de la dopamina y la serotonina, y a través de un análisis de interacciones proteína-proteína (IPP), identificaron cuatro nuevos genes candidatos interactuantes (POMC, NPY, SLC18A2 y FOSFBJ), de los cuales POMC, SLC18A2 y DRD3, HTR2A (seleccionados con base en su función) revelaron SNP asociados con la velocidad de salida (VS) y puntuación en corral (PC), que son mediciones del temperamento bovino en una población de ganado Charolais. El mismo grupo encontró que las variaciones en estos genes (DRD3, HTR2A y POMC) tuvieron un efecto sobre el crecimiento bovino (peso al nacer) en una población de ganado Charolais, mostrando que las variaciones identificadas no solo tuvieron un efecto sobre el temperamento bovino sino también sobre los rasgos de peso vivo(6). Del mismo modo, con el objetivo de evaluarla relación potencialde dos de estos SNP en los genes DRD3 y HTR2A con el temperamento bovino y las características de crecimiento, y la eficiencia alimenticia, se analizó una población de ganado Angus, Brangus y Charolais con evaluaciones de temperamento; los resultados indicaron que no hubo asociación con VS yPC, pero el SNP en el gen HTR2A se asoció con la eficiencia alimenticia en el ganado Brangus(7) .

Los estudios de asociación del genoma completo (GWAS, del inglés genome-wide association studies), basados en tecnologías de genotipado de polimorfismo de un solo nucleótido (SNP, del inglés single nucleotide polymorphisms) de alto rendimiento, son un enfoque relativamente reciente aplicado a estudios genéticos del temperamento del ganado y han permitido la identificación de diferentes grupos de genes candidatos. Lindholm-Perry et al(8) analizaronunapoblacióndelasrazas Angus, Hereford,Simmental, Limousin,Charolais, Gelbvieh y Red Angus para identificar regiones genómicas y genes asociados con la velocidad de vuelo (VV); determinaron regiones cromosómicas en BTA 9 y 17 asociadas e identificaron dentro de ellas tres genes GRIA2, GLRB y QKI asociados con SNP cercanos. Valente et al(9) evaluaron una población de Nellore utilizando la VS para evaluar su temperamento. Los genes NCKAP5, PARK2, DOCK1, ANTXR1, CPE y GUCY1A2 se detectaron como candidatos potenciales para el rasgo de interés. Finalmente, Dos Santos et al(10) utilizaron una población Guzerat en la que se midió la reactividad como indicador del temperamento. Los genes POU1F1, DRD3, VWA3A, ZBTB20, EPHA6, SNRPF y NTN4 se propusieron como genes candidatos responsables de la expresión del rasgo.

Rev Mex Cienc Pecu 2023;14(1):1-22 3

En un contexto relacionado, la resecuenciación específica del exoma de regiones específicas utilizando tecnologías de secuenciación de nueva generación (SNG) se ha convertido en una técnica poderosa que permite la identificación de SNP. Este método puede capturar eficientemente toda la variación en las regiones de interés. Los efectos potenciales pueden ser evaluados en un estudio de asociación, que proporciona una herramienta efectiva para encontrar SNP que afectan a un rasgo determinado(11). Sin embargo, debido a las diferencias en el fenotipado del temperamento en estudios anteriores (es decir, cada estudio utiliza diferentes técnicas para evaluar el temperamento bovino, la puntuación en corral, la velocidad de salida, la reactividad, que evalúan diferentes aspectos del temperamento bovino), no es posible vincular la información para esos genes identificados como candidatos, o encontrar un proceso biológico representativo, interacciones proteína-proteína entre estos genes, o una ruta biológica en la que estos genes convergen para visualizar cómo el conjunto de genes explica el temperamento bovino. Así, la información genómica a menudo permanece aislada y necesita ser integrada. Por lo tanto, el objetivo fue identificar regiones genómicas ygenes candidatos asociados con el temperamento en el ganado de carne a través de la integración de una estrategia GWAS, análisis de interacción proteína-proteína y SNP obtenidos mediante resecuenciación específica del exoma.

Material y métodos

Descripción de los animales y fuentes de muestras biológicas

Se obtuvieron datos y muestras de pelo del biobanco ubicado en el Laboratorio de Biotecnología Animal CBG-IPN y procedían de una población bovina (n= 104) de toros jóvenes Angus (AN, n=63) y Brangus (BR, n=41), con una edad promedio y peso corporal de 273 ± 38 días y 272 ± 38 kg, respectivamente, analizados durante dos pruebas centralizadas de rendimiento de eficiencia alimenticia basadas en la ingesta residual de alimento (IRA) en el norte de México. El registro de datos y el manejo de los animales han sido previamente descritos por Garza-Brenner et al(7). Brevemente, los animales fueron alimentados en un corral de engorda durante un período de 70 días con un período de adaptación previo al ensayo de 20 días, pesados al principio y al final de la prueba con intervalos de 14 días en los que se realizaron las mediciones del temperamento bovino.

De la población, se realizó un GWAS utilizando un enfoque de genotipado selectivo siguiendo la estrategia de las colas de la distribución fenotípica del temperamento bovino medida por la velocidad de salida (VS) porque facilita la detección de diferencias fenotípicas entre alelos(12). El genotipado selectivo se logró seleccionando un grupo de los animales más tranquilos (n= 17; 10-AN y 7-BR) y más temperamentales (n= 17; 9-AN y 8-BR) con base en los valores de VS de la población de estudio. El temperamento se evaluó mediante

Rev Mex Cienc Pecu 2023;14(1):1-22 4

mediciones de la VS después de un estímulo del muestreo de pelo en una manga midiendo la velocidad de desplazamiento de más de 1.83 m (6 pies) con un sensor infrarrojo (FarmTek Inc., North Wylie, TX, EE. UU.). La velocidad se calculó como VS= distancia (m)/tiempo (s)(13,14). Se definieron los grupos de temperamento contrastantes con base en las mediciones de VS de los animales. Los animales con mediciones de VS ≤1.9 m/s se clasificaron como tranquilos, y aquellos con puntuaciones de VS ≥2.4 m/s se clasificaron como temperamentales(14,15)

Para identificar SNP informativos en genes candidatos, se utilizaron 91 animales. Se seleccionó un total de 91 animales como población de descubrimiento de SNP: 18 (9 dóciles; 9 temperamentales) de la raza Angus, 68 (44 dóciles; 24 temperamentales) de la raza Brahman, y 5 (2 dóciles; 3 temperamentales) de la raza Charolais. A partir de muestras de cabello y muescas en las orejas, se realizó la extracción de ADN utilizando el kit de extracción GenElute™ (Sigma, St. Louis, Missouri, Estados Unidos).

Análisis GWAS y descubrimiento de genes

Se genotiparon treinta y cuatro (34) animales utilizando el chip GeneSeek Genomic Profiler HD 150K (Neogen, Lincoln, NE). El análisis de asociación e identificación de regiones genómicas asociadas con el temperamento bovino se realizaron con el software PLINK 1.9(16). Serealizóun control decalidaddelos genotipos paraidentificaranimalessin genotipo asignado o con una baja tasa de genotipado (MIND >0.1). También se evaluó la frecuencia de los alelos y se eliminaron los SNP con umbrales más bajos (MAF <0.01). El umbral de significancia se estableció en P < 3 × 10-5. Se construyó un gráfico de Manhattan utilizando qqman: un paquete de R para la visualización de los resultados de GWAS(17). Las posiciones de SNP significativos se identificaron utilizando el genoma bovino de Bos taurus (UMD 3.1.1) y el software Map Viewer disponible en el Centro Nacional para la Información Biotecnológica (NCBI, por sus siglas en inglés). Los genes más cercanos a los SNP significativos (dentro de ~ 350 kb) también se identificaron con Map Viewer.

Análisis de vías e interacciones proteína-proteína

Para la identificación de las vías génicas, se realizó un enriquecimiento de términos de Ontología Génica (GO) y un análisis de red de interacciones proteína-proteína (IPP) en el navegador de genomas Ensembl(18), la base de datos Gene Ontology(19) y la base de datos STRING(20), respectivamente.

Rev Mex Cienc Pecu 2023;14(1):1-22 5

Resecuenciación de genes candidatos

Con el objetivo de identificar SNP en las regiones codificantes y del gen SNCA y sus genes interactuantes, identificados a través del análisis de interacciones proteína-proteína (IPP), estos genes se resecuenciaron en la población de descubrimiento de SNP. Como parte de la estrategia de secuenciación, además de los exones, también se analizaron regiones no codificantes (140 pb antes y después de cada gen-exón). Así, se diseñó un panel personalizado utilizando el software Design Studio (https://designstudio.illumina.com) (Illumina, San Diego, CA, Estados Unidos) para el Ensayo Genético de ADN AmpliSeq, en el que se incluyeron las regiones codificantes y los límites de los genes APP, PARK7, SLC6A2, SNCA, UCHL1, PARK2, SLC18A2 y POMC, utilizando el genoma UMD 3.1.1 de Bos Taurus como referencia.

La cuantificación de ADN se realizó en todos los pasos utilizando el kit de ensayo Qubit dsDNA HS en el fluorómetro Qubit 3.0 (Thermo Scientific, Massachusetts, Estados Unidos).

Las bibliotecas se prepararon utilizando la guía de referencia para paneles personalizados AmpliSeq (Documento # 1000000036408 v04) de Illumina, siguiendo las instrucciones para 2 grupos y para 49-96 pares de iniciadores por grupo. La calidad y cuantificación de las bibliotecas se realizó utilizando el equipo Bioanalyzer 2100 (Agilent, California, Estados Unidos) con el kit Agilent DNA 1000. La secuenciación (extremo pareado; longitud de lectura 126 pb) se realizó con el Sistema de Secuenciación MiniSeq™.

Análisis bioinformático de datos de secuenciación

Las lecturas de secuencia generadas por el Sistema de Secuenciación MiniSeq™ se alinearon con el genoma de referencia UMD 3.1.1 de Bos taurus utilizando el alineador BurrowsWheeler (BWA-MEM) v0.(21). Las lecturas se procesaron utilizando Picard v1.135 (http://broadinstitute.github.io/picard) y se limpiaron marcando y eliminando lecturas duplicadas para generar archivos BAM. Las variaciones se identificaron utilizando el flujo de trabajo del formato de llamada de variante genómica (GVCF, del inglés genomic variant call format) con HaplotypeCaller(22). Los SNP se generaron en archivos VCF y se filtraron utilizando los siguientes criterios: confianza de variante normalizada por profundidad (QD) <2.0, calidad de mapeo (MQ) <40.0, sesgo de hebra (FS) >60.0, HaplotypeScore >13.0, MQRankSum <−12.5 y ReadPosRank-Sum <−8.0(23) .

Predicción del efecto de SNP no codificantes en sitios de empalme

Para estudiar el efecto de los 58 SNP identificados en las secuencias no codificantes de la secuenciación específica del exoma de los genes SNCA y APP, se utilizó la interfaz web online ESE finder3.0 (http://krainer01.cshl.edu/cgi-bin/tools/ESE3)(24); las secuencias de

Rev Mex Cienc Pecu 2023;14(1):1-22 6

SNCA NC_037333.1 y APP: NC_037328.1 se utilizaron como entrada, introduciéndolas intrón por intrón (<5,000 pb) sin y con mutaciones, según la ubicación de los SNP. Este proceso permitió determinar si los SNP formaban parte de un motivo del sitio de empalme donante (5') o aceptor (3'); el programa asigna una puntuación a la secuencia de entrada de acuerdo con la pérdida de la secuencia de consenso, de modo que se predice que las puntuaciones por encima de un valor umbral predeterminado (donante: 6.67; aceptor: 6.632) actuarán como un sitio de empalme, lo que permite analizar si los SNP afectan a los motivos de los sitios de empalme.

Resultados

La Figura 1 muestra un gráfico de Manhattan con los resultados del análisis GWAS de los SNP evaluados por su asociación con el temperamento en el ganado Brangus y Angus. Rs133956611 y rs81144933 se asociaron con un temperamento dócil (Cuadro 1). Los genes SNCA (alfa-sinucleína; GenID 282857) y MMRN1 (multimerin 1; GenID 516574) se encuentran aproximadamente a 222.8 y 435.9 Kb corriente arriba, respectivamente, de rs81144933; mientras que el gen GPRIN3 (miembro 3 de la familia GPRIN; GenID 517995) se identificó a 245.7 Kb corriente abajo de rs133956611.

Figura 1: Gráfico de Manhattan de -log10 (valores P) para la asociación del genoma completo con la velocidad de salida

Rev Mex Cienc Pecu 2023;14(1):1-22 7
Análisis GWAS e identificación de genes candidatos junto con análisis de interacciones proteína-proteína

Cuadro 1: SNP asociados con el temperamento bovino en ganado Angus y Brangus

CHR ID de rs Posición pb

Frecuencia T D Valor-P

6 rs133956611 36,676,986 0.14 0.67 9.2 E-06 6 rs81144933 36,655,249 0.20 0.70 3.48 E-05

T= temperamental; D= dócil.

La línea horizontal corresponde a un umbral significativo de P=3× 10-5. Utilizando los genes identificados, se procedió a realizar un análisis IPP consultando la base de datos STRING(20) Para MMRN1, el análisis IPP mostró interacciones con genes como F5 y VWF, involucrados en el proceso de coagulación (Figura 2), en la base de datos Gene Ontology (GO), MMRN1 está anotado con el término GO: 0007596, llamado coagulación sanguínea. Para GPRIN3, el motor de búsqueda mostró interacciones entre el proceso de fosforilación codificado por los genes LOC790121 y OR6N1 con proteínas que están involucradas principalmente en el ensamblaje citoesquelético y la modulación de la neurotransmisión (Figura 3). La base de datos GO mostró que este gen fue anotado con el término GO:0031175, proceso biológico llamado desarrollo de proyección neuronal, progresión de una proyección neuronal desde su formación hasta la estructura madura.

Figura 2: Interacciones proteína-proteína reportadas para MMRN1 bovina en la base de datos STRING

Rev Mex Cienc
8
Pecu 2023;14(1):1-22

Figura 3: Interacciones proteína-proteína reportadas para GPRIN3 bovina en la base de datos STRING

Finalmente, se encontró que la proteína SNCA, algunos términos GO identificados (GO: 0045920, GO: 004241 y GO: 0014059) están involucrados en la regulación, síntesis y secreción de dopamina. Curiosamente, el gen SNCA se asoció con los términos asociados con el comportamiento, incluidos los relacionados con el “comportamiento de vuelo” y las respuestas de los animales (a través de saltar, pararse o caminar) a estímulos internos y externos (términos GO: 0007610, GO: 0007629, GO: 0007628, GO: 0007630, respectivamente).

El análisis de IPP indicó que SNCA interactúa con las proteínas APP (proteína precursora de β-amiloide), PARK7 (deglicasa asociada al parkinsonismo) y UCHL1 (ubiquitina C-terminal hidrolasa L1) (P= 5.88e-06) involucradas en el comportamiento locomotor adulto. Además, el término GO:0008344 revela fuertes interacciones de SNCA con genes pertenecientes a una familia de transportadores de neurotransmisores (SLC6A) en la red (Figura 4).

Rev Mex Cienc Pecu 2023;14(1):1-22 9

Figura 4: Interacciones proteína-proteína reportadas para SNCA bovino en la base de datos STRING

Nodos rojos anotados con el término GO:0008344, comportamiento locomotor adulto (valor p 5.88E-06). Nodos verdes anotados con el término GO:0043005, proyección neuronal (valor p 0.000966). Nodos azules anotados con el ID de vía 05012 KEGG, enfermedad de Parkinson (valor p 6.49E-11).

Con base en su papel funcional reportado, GPRIN3 y, en particular, los genes SNCA podrían considerarse como genes candidatos asociados con el temperamento del ganado, el análisis del gen MMRN1 no indica implicaciones obvias para este rasgo, sin embargo, su identificación podría ser importante para un análisis posterior.

Variación genética en genes candidatos

De acuerdo con los resultados del análisis de IPP, inferimos que los genes APP, PARK7, SLC6A2, UCHL1, PARK2, SLC18A2 y POMC fueron candidatos asociados con el temperamento bovino (Cuadro 2). Se resecuenciaron para descubrir la variación genética para explicar potencialmente el temperamento del ganado. Se encontraron cincuenta y ocho (58) SNP en las regiones no codificantes de los genes SNCA y APP. Se identificaron tres SNP en los intrones 2 y 3 del gen SNCA, y se identificaron 55 SNP en los intrones 1, 5, 8, 11, 13, 14 y 17 del gen APP (Cuadro 3). Quince de los 58 SNP eran exclusivos de la raza Angus, 1 en el gen SNCA y el resto en el gen APP. Los SNP restantes (n= 43) fueron informativos (polimórficos) en las razas Brahman y Charolais, a diferencia de la raza Angus en la que no eran informativos (monomórficos). Las frecuencias alélicas y el patrón de distribución de los SNP variaron según la raza.

Rev Mex Cienc Pecu 2023;14(1):1-22 10

Cuadro 2: Funciones y procesos biológicos asociados con genes SNCA interactuantes

Gen Descripción

PARK7

No hay información en ganado. En humanos, protege las neuronas dopaminérgicas contra el daño oxidativo y la degeneración; inhibe indirectamente la agregación de α-sinucleína(25); por lo tanto,se ha demostrado que las mutaciones en este gen causan la enfermedad de Parkinson(26) .

SLC6A2

No hay información en ganado. En humanos, controla la acción de la norepinefrina que apoya la excitación, el estado de ánimo, la atención y las reacciones al estrés; por lo tanto, se ha asociado con dimensiones temperamentalesdelapersonalidad(búsquedadenovedad,evitacióndedaños, dependencia de la recompensa y persistencia)(27) .

UCHL1

No hay información en ganado. En humanos, se expresa abundantemente en las neuronas e interactúa con APP, y los SNP; este gen se ha implicado en los trastornos neurodegenerativos enfermedad de Parkinson y enfermedad de Alzheimer(28)

PARK2

SLC18A2

En ganado se ha asociado con el temperamento (velocidad de vuelo)(9) y en humanos en las funciones de las neuronas dopaminérgicas debido a las mutaciones en este gen asociado a la enfermedad de Parkinson(29) .

En ganado se ha asociado con el temperamento (puntuación en corral) (GarzaBrenner et al(5) . Participa en el transporte de dopamina, previniendo su acumulación y muerte neuronal dopaminérgica; por lo tanto, es un factor de riesgo para la enfermedad de Parkinson(30) .

POMC

En ganado se ha asociado con el temperamento (puntuación en corral)(5) . POMC es el precursor de la hormona corticotrópica (ACTH), que aumenta la expresión del factor neurotrófico derivado del cerebro (FNDC) responsable de la proliferación, diferenciación y supervivencia de las neuronas; por lo tanto, se ha implicado en la enfermedad de Parkinson(31) .

De los 58 SNP identificados en las regiones no codificantes de los genes SNCA y APP, tres SNP formaron parte de un motivo del sitio de empalme de acuerdo con los umbrales establecidos (donante: 6.67; aceptor: 6.632), como se muestra en el Cuadro 4; los SNP identificados se localizaron en los intrones 5, 8 y 11. Todos los motivos del sitio de empalme eran del tipo aceptor, es decir, estaban ubicados en el extremo 3'. El SNP g. 9770593 (C/T) no añadió ni abolió ningún motivo del sitio de empalme, sino que sólo aumentó el valor de la puntuación, mientras que los SNP g. 9806689 (G/T) y g. 9845821 (C/G) añadieron y abolieron los motivos del sitio de empalme, respectivamente.

Rev Mex Cienc Pecu 2023;14(1):1-22 11

Discusión

Los estudios genómicos dirigidos a la exploración del temperamento del ganado son aún escasos, principalmente debido a la complejidad biológica del sistema, las diferencias en la medición del temperamento (objetivo/subjetivo) y las diferencias entre las razas de ganado estudiadas. En este trabajo, se utilizaron los GWAS como una herramienta exploratoria para encontrar genes candidatos asociados con VS, contrastando por temperamento un grupo de animales Angus y Brangus. El GWAS permitió identificar una región genómica en BTA6 que alberga tres genes candidatos asociados con VS [SNCA (GenID 282857), MMRN1 (GenID 516574) y GPRIN3 (GenID: 517995)]. Para estos genes, Chen et al(32) reportaron una expresión elevada de GPRIN3 en el cerebro humano, y la información de UniProtKB(33) indica que la proteína GPRIN3 puede estar involucrada en el crecimiento de neuritas. Sin embargo, los datos de la literatura (con respecto a la función y los genes interactuantes) apoyan fuertemente el gen SNCA bovino como un nuevo candidato asociado con el temperamento del ganado(9,34)

El gen SNCA es una proteína altamente conservada que es abundante en el cerebro de los humanos y otras especies como ratas, ratones y monos(35); se encuentra en las neuronas, especialmente en los terminales presinápticos(36). La función molecular de SNCA es bastante ambigua, y con base en su estructura, propiedades físicas y socios interactuantes, se han propuesto varias hipótesis sobre su función normal en humanos. Por ejemplo, se cree que está involucrado en la regulación de la liberación y el transporte de dopamina(34). En consecuencia, en humanos juega un papel importante en los trastornos neurodegenerativos. Según Giasson et al(37), los agregados de proteína SNCA en humanos causan lesiones cerebrales que son características de las sinucleinopatías neurodegenerativas. El gen SNCA está asociado, en la Enciclopedia de genes y genomas de Kioto (KEGG, por sus siglas en inglés)(38), con vías biológicas de enfermedades neurodegenerativas como la enfermedad de Alzheimer (ko05010) y la enfermedad de Parkinson (ko05012). Ambas enfermedades son trastornos cerebrales importantes en humanos. La enfermedad de Parkinson se caracteriza por síntomas relacionados con la locomoción (temblor involuntario, rigidez muscular e inestabilidad postural), así como depresión y psicosis, e implica la pérdida progresiva de neuronas dopaminérgicas, presentándose la característica principal como la aparición de cuerpos de inclusión llamados cuerpos de Lewy, cuyo componente principal es SNCA(37) .

Aunque las alteraciones patológicas relacionadas con esas enfermedades humanas no se pueden extrapolar a este modelo de estudio, este vínculo biológico proporciona alguna evidencia para apoyar los hallazgos porque la comprensión de la relación entre genotipo y fenotipo en humanos se derivó de animales modelo con mutaciones en genes ortólogos. Las especies animales grandes, como perros, cerdos, ovejas y vacas, han sido algunos de los animales modelo más importantes, principalmente porque son más similares a los humanos

Rev Mex Cienc Pecu 2023;14(1):1-22 12

que los ratones (tamaño, genética y fisiología similares). Así, los descubrimientos en humanos pueden servir como referencia para inferir efectos sobre el temperamento bovino(39) .

Conectando redes genéticas para explicar el temperamento del ganado

A pesar de los escasos intentos de identificar genes y regiones genómicas subyacentes a la arquitectura genética del temperamento, hasta ahora no ha habido reportes que conecten las redes genéticas asociadas con este rasgo complejo.

El análisis delas interacciones proteína-proteína del gen SNCA permitióidentificar yanalizar seis genes adicionales, de los cuales dos miembros génicos de la familia SLC (SLC18A2 y SLC6A4) ya han sido identificados por Garza-Brenner et al(5) como genes interactuantes en una red proteína-proteína basada en genes relacionados con la dopamina y la serotonina. Estos autores también encontraron un SNP localizado en el gen SLC18A2 que causa un cambio en la secuencia de aminoácidos de alanina a treonina, con efectos significativos sobre el temperamento medidos por las puntuaciones en corral. Además, el análisis IPP incluyó genes de la familia PARK (PARK2 y PARK7), que codifican proteínas de ubiquitina ligasa, incluida la parkina RBR E3. El gen PARK2 fue identificado por Valente et al(9) como un gen candidato asociado con el temperamento en el ganado Nellore; los autores utilizaron la VS como prueba para evaluar el temperamento bovino. Múltiples estudios han utilizado la estrategia GWAS para identificar genes que están vinculados a fenotipos de temperamento bovino(8-10), pero en ninguno de estos casos ha sido posible establecer interacciones entre los genes identificados, y la información de cada estudio parece ser aislada e independiente, impidiendo la clarificación de la arquitectura genética del temperamento a partir de la información disponible hasta la fecha. Además, el conjunto de genes candidatos no parece estar asociado con un proceso biológico representativo que sugiera la participación en el temperamento. La identificación de SNCA en el presente trabajo permite conectar los resultados de Valente et al(9) y Garza-Brenner et al(5), mostrando que los genes identificados através de diferentes estrategias(GWAS yanálisis de redes de interacción proteína-proteína) presentan una conexión importante. De acuerdo con estos resultados, se exploró la variación genética de estos genes en el ganado con énfasis en sus secuencias codificantes, y los resultados revelaron una alta conservación de las secuencias exónicas en los siete genes analizados. En humanos,se ha reportado una baja variación genética entre genes como SNCA y UCHL1(40) .

Curiosamente, y según reportes anteriores, se encontró una alta variación genética en las regiones no codificantes de los genes bovinos SNCA y APP. La función exacta del gen de la proteína (APP) precursora de beta amiloide (A4) es desconocida, pero se ha asociado con la suavidaddelacarne en cerdos(41),puedeparticipar en laformación deneuronas yes conocida

Rev Mex Cienc Pecu 2023;14(1):1-22 13

por su participación en la enfermedad de Alzheimer(42). Debido a que los pacientes con enfermedad de Alzheimer muestran la presencia y acumulación de proteínas SNCA y APP, se ha propuesto que pueden estar relacionadas de alguna manera. Roberts et al(43) han demostradoquelasobreexpresiónde SNCA aumentalosnivelesde APP, yciertasmutaciones en SNCA aumentan el procesamiento de APP, por lo que el descubrimiento de mutaciones en las regiones codificantes de estos genes podría tener un impacto funcional en ellos y, por lo tanto, en el temperamento bovino.

Se ha documentado que en aproximadamente el 21 % de los genes bovinos se produce empalmealternativo(44).El análisis in silico identificó tres APP-SNP con el potencial de tener un efecto funcional en el proceso de empalme de pre-ARNm y, por lo tanto, la expresión del temperamento bovino. Hasta donde se sabe, no se han reportado diferentes isoformas del gen APP bovino, pero se ha reportado que los motivos del sitio de empalme en genes bovinos están altamente conservados en relación con los humanos(44). Los genes humano y bovino para APP son ortólogos, conel mismonúmerodeaminoácidos (770) yunasecuenciaidéntica de aminoácidos. En humanos, se han identificado 8 isoformas diferentes del gen APP debido al empalme alternativo en los exones 7, 8 y 15, que termina la expresión del gen APP en las neuronas, resultando en la implicación de un papel fundamental en la enfermedad de Alzheimer(45). Aquí se identificaron 3 SNP que afectan, agregan y abolen los motivos del sitio de empalme en el gen APP, en los intrones 5, 8 y 11, por lo que probablemente podrían afectar el producto final y tener un efecto en la expresión del temperamento bovino.

Enel presenteestudio, seutilizólaestrategiadefenotipocontrastantepararealizarun análisis GWAS exploratorio para identificar genes candidatos para el temperamento en el ganado, e incluso con la limitación del tamaño de muestra pequeño, los presentes resultados que muestran una conexión entre SNCA yel temperamento son consistentes con estudios GWAS más grandes. Adicionalmente, el acoplamiento de estos resultados con un análisis IPP permitió establecer conexiones entre diferentes genes que fueron previamente identificados dentro de la asociación al aparato locomotor. El mapeo fino de los genes candidatos predijo que el GWAS y los genes IPP confirmaron la existencia de SNP con el potencial de afectar el temperamentobovino. El presenteestudioproporcionainformación valiosaquecontribuye a los aún escasos esfuerzos por describir la arquitectura genética del temperamento del ganado, y muestra que esta estrategia analítica es apropiada para su aplicación en estudios con un tamaño de muestra limitado, especialmente en países donde el fenotipado para este rasgo complejo es limitado.

Conclusiones e implicaciones

Una región genómica BTA6 (36,655,249-36,676,986 pb) vecina al gen SNCA se asoció con el rasgo de temperamento en las razas Angus y Brangus. Se identificaron seis genes,

Rev Mex Cienc Pecu 2023;14(1):1-22 14

Pecu 2023;14(1):1-22

vinculados a SNCA, como potencialmente asociados con el temperamento. De ellos, el gen APP albergó tres SNP con un efecto potencial sobre el proceso de empalme de pre-ARNm y la expresión del temperamento bovino.

Agradecimientos

Esta investigación fue financiada por becas de investigación financiadas por CONACYT e IPN (proyecto 294826, SIP 20171674) y apoyo financiero parcial de CONARGEN, A.C. para financiar las pruebas de eficiencia alimenticia. Los autores también desean reconocer a los diferentes propietarios de rebaños y al personal técnico del complejo Palomas UGRCH, que recolectaron y proporcionaron los datos y muestras utilizados en este estudio. La mención del nombre comercial, productos patentados o equipos especificados no constituye una garantía por parte del USDA y no implica la aprobación para la exclusión de otros productos que puedan ser adecuados. El USDA es un empleador con igualdad de oportunidades.

Literatura citada:

1. Buchenauer D. Genetics of behaviour in cattle. In: Fries R Ruvinsky A, editors. The genetics of cattle. CABI Publishing, Wallingford;1999:365–390.

2. Mormède P. Molecular genetics of behaviour: research strategies and perspectives for animal production. Livest Prod Sci 2005;93(1):15–21.

3. Schmutz SM, Stookey JM, Winkelman-Sim DC, Waltz CS, Plante Y, Buchanan FC. A QTL study of cattle behavioural traits in embryo transfer families. J Hered 2001; 92(3):290–292.

4. Hiendleder S, Thomsen H, Reinsch N, Bennewitz J, Leyhe-Horn B, Looft C, et al. Mapping of QTL for body conformation and behavior in cattle. J Hered 2003; 94(6):496–506.

5. Garza-Brenner E, Sifuentes-Rincón AM, Randel RD, Paredes-Sánchez FA, ParraBracamonte GM, Arellano-Vera W, et al Association of SNPs in dopamine- and serotonin-pathway genes and their interacting genes with temperament traits in Charolais cows. J Appl Genetics 2016;58(3):363–371.

6. Garza-Brenner E, Sifuentes-Rincón AM, Rodríguez-Almeida FA, Randel RD, ParraBracamonte GM, Arellano-Vera W. Influence of temperament-related genes on live weight traits of Charolais cows. R Bras Zootec 2020:49:e20180121.

Rev Mex Cienc
15

Pecu 2023;14(1):1-22

7. Garza-Brenner E, Sifuentes-Rincón AM, Rodríguez Almeida FA, Randel RD, ParraBracamonte GM, Arellano Vera W. Influence of genetic markers on the feeding behavior of yearling bulls. Rev Colomb Cienc Pecu 2019;32(1):14-20.

8. Lindholm-Perry AK, Kuehn LA, Freetly HC, Snelling WM. Genetic markers that influence feed efficiency phenotypes also affect cattle temperament as measured by flight speed. Anim Genet 2014;46(1):60-64.

9. Valente TS, Baldi F, Sant´Anna AC, Albuquerque LG, Da Costa MJRP. Genome-wide association study between single nucletide polymorphismos and flight speed in Nellore cattle. PLoS One 2016;11(6):1-18.

10. Dos Santos FC, Campolina PMG, De Souza PA, Ávila PMF, Ventura RV, Rosse IC, et al Identification of candidate genes for reactivity in Guzerat (Bos indicus) cattle: a Genome-Wide Association Study. Plos One 2017;12(1):1-15.

11. Jiang L, Liu X, Yang J, Wang H, Jiang J, Liu L, et al. Targeted resequencing of GWAS loci reveals novel genetic variants for milk production traits. BMC Genomics 2014;15(1):1105.

12. Kurz JP, Yang Z, Weiss RB, Wilson DJ, Rood KA, Liu GE, Wang Z. A genome-wide association study for mastitis resistance in phenotypically well-characterized Holstein dairy cattle using a selective genotyping approach. Immunogenetics 2019;71(1):35-47.

13. Burrow HM. Measurements of temperament and their relationships with performance traits of beef cattle. Anim Breed 1997;65(7):477–495.

14. Curley KOJr, Paschal JC, Welsh THJr, Randel RD. Exit velocity as a measure of cattle temperament is repeatable and associated with serum concentration of cortisol in Brahman bulls. J Anim Sci 2006;84(11):3100-3103.

15. Burrow HM. Effect of intensive handling of zebu crossbred weaner calves on temperament. Proc Assoc Advmt Anim Breed Genet 1991;9:208-211.

16. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, Bender D. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 2007;8(3):559-575.

17. Turner SD. qqman: an R package for visualizing GWAS results using Q-Q and manhattan plots. bioRxiv 2014;3(25):005165.

18. Zerbino DR, Achuthan P, Akanni W, Amode MR, Barrell D, Bhai J. Ensembl 2018. Nucleic Acids Res 2018;46(D1):754–761.

Rev Mex Cienc
16

Pecu 2023;14(1):1-22

19. Mi H, Huang X, Muruganujan A, Tang H, Mills C, Kang D, Thomas PD. PANTHER version14: moregenomes, anewPANTHER GO-slim andimprovements inenrichment analysis tools. Nucleic Acids Res 2019;47(D1):D419-D426

20. Szklarczyk D,Morris JH,Cook H,KuhnM, Wyder S,SimonovicM, et al.TheSTRING database in 2017: quality-controlled protein-protein association networks, made broadly accessible. Nucleic Acids Res 2017;45(D1):362-368.

21. Li H, Durbin R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 2009;25(14):1754–1760.

22. Van der Auwera GA, Carneiro MO, Hartl C, Poplin R, Del Angel G, LevyMoonshine A, et al From FastQ data to high-confidence variant calls: the genome analysis toolkit best practices pipeline. Curr Protoc Bioinf 2013;43(1110):11101–111033.

23. Choi JW, Liao X, Stothard P, Chung WH, Jeon HJ, Miller SP, et al. Whole-genome analyses of Korean native and Holstein cattle breeds by massively parallel sequencing. PLoS One 2014;9(7):e101127.

24. Cartegni L, Wang J, Zhu Z, Zhang MQ, Krainer AR. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acid Res 2003;31(13):3568-3571.

25. Dolgacheva LP, Berezhnov AV, Fedotova EI, et al. Role of DJ-1 in the mechanism of pathogenesis of Parkinson's disease. J Bioenerg Biomembr 2019;51(3):175–188.

26. He L, Lin S, Pan H, Shen R, Wang M, Liu Z, et al. Lack of association between DJ-1 gene promoter polymorphism and the risk of parkinson’s disease. Front Aging Neurosci 2019;11(24):1-11.

27. Narita SI, Kazuhiko N, Kenta N, Maki Y, Eiji O, Nobuyo I. Analysis of association between norepinephrine transporter gene polymorphisms and personality traits of NEOFFI in a Japanese population. Psychiatry Investig 2015;12(3):381-387.

28. Rydning SL, Backe PH, Sousa MML, Iqbal Z, Øye AM, Sheng Y, et al. Novel UCHL1 mutations reveal new insights into ubiquitin processing. Hum Mol Genet 2017;26(6):1031-1040.

29. BakhitYH, IbrahimMO, AminM,MirghaniYA,HassanMA. In silico analysisofSNPs in PARK2 and PINK1 genes that potentially cause autosomal recessive Parkinson disease. Adv Bioinformatics 2016;9313746:1-5.

30. Brighina L, Riva C, Bertola F, Saracchi E, Fermi S, Goldwurm S, et al. Analysis of vesicular monoamine transporter 2 polymorphisms in Parkinson's disease. Neurobiol Aging 2013;34(6):1712.e9-13.

Rev Mex Cienc
17

Pecu 2023;14(1):1-22

31. Shadrina M, Nikopensius T, Slominsky P, Illarioshkin S, Bagyeva G, Markova E, et al. Association study of sporadic Parkinson's disease genetic risk factors in patients from Russia by APEX technology. Neurosci Lett 2006;405(3):212-6.

32. Chen LT, Gilman AG, Kozasa T. A Candidate target for G protein action in brain. J Biol Chem 1999;274(38):26931–26938.

33. Chen C, Huang H, Wu CH. Protein bioinformatics databases and resources. Methods Mol Biol 2017;1558:3-39.

34. Siddiqui IJ, Pervaiz N, Abbasi AA. The Parkinson disease gene SNCA: Evolutionary and structural insights with pathological implication. Sci Rep 2016;6(1):24475.

35. Deng H, Yuan L. Genetic variants and animal models in SNCA and Parkinson disease. Ageing Res Rev 2014;15:161-76.

36. Campêlo CLDC, Silva RH. Genetic variants in SNCA and the risk of sporadic Parkinson’s disease and clinical outcomes: A review. Parkinsons Dis 2017;4318416:111.

37. Giasson BI, Duda JE, Murray IVJ, Chen Q, Souza JM, Hurtig HI, et al. Oxidative damage linked to neurodegeneration by selective alpha-synuclein nitration in synucleinopathy lesions. Science 2000;290(5493):985-989.

38. Kanehisa M, Furumichi M, Tanabe M, Sato Y, Morishima K. KEGG: New perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Res 2017;45(D1):353-361.

39. Pinnapureddy AR, Stayner C, McEwan J, Baddeley O, Forman J, Eccles MR. Large animal models of rare genetic disorders: sheep as phenotypically relevant models of human genetic disease. Orphanet J Rare Dis 2015;10:107-115.

40. Dong N, Zhang X, Liu Q. Identification of therapeutic targets for Parkinson's disease via bioinformatics analysis. Mol Med Rep 2017;15(2):731-735.

41. Lobjois V, Liaubet L, San Cristobal M, Glénisson J, Fève K, Rallières J. A muscle transcriptome analysis identifies positional candidate genes for a complex trait in pig. Anim Genet 2008;39(2):147-162.

42. Masters CL, Simms G, Weinman NA, Multhaup G, McDonald BL, Beyreuther K. Amyloid plaque core protein in Alzheimer disease and Down syndrome. Proc Natl Acad Sci USA 1985;82(12):4245-4249.

43. Roberts HL, Schneider BL, Brown DR. α-Synuclein increases β-amyloid secretion by promoting β-/γ-secretase processing of APP. PLoS One 2017;12(2):e0171925.

Rev Mex Cienc
18

Rev Mex Cienc Pecu 2023;14(1):1-22

44. Chacko E, Ranganathan S. Genome-wide analysis of alternative splicing in cow: Implications in bovine as a model for human diseases. BMC Genomics 2009;10(3):S11.

45. Sandbrink R, Masters CL, Beyreuther K. APP gene family. Alternative splicing generates functionally related isoforms. Ann N Y Acad Sci 1996;777:281-287.

19

Rev Mex Cienc Pecu 2023;14(1):1-22

Cuadro 3: SNP identificados por secuenciación específica del exoma en cada población de los genes APP, PARK7, SLC6A2, SNCA, UCHL1, PARK2, SLC18A2 y POMC

Gen Posición (pb) Región Alelos

Frecuencia Angus

Brahman Charolais

Ref Alt Ref Alt Ref Alt Ref Alt

36297353 Intrón 3 G A 0.9924 0.0076 1.0 0.0

36297374 Intrón 3 A G 0.8500 0.1500 1.0 0.0 36297422 ¥ Intrón 2 T A 0.5000 0.5000 APP

SNCA

9674371 Intrón 1 T C 0.9717 0.0283 1.0 0.0 9674423 Intrón 1 A C 0.9403 0.0597 1.0 0.0 9674429 Intrón 1 T A 0.9478 0.0522 1.0 0.0 9674430 ¥ Intrón 1 T A 0.9722 0.0278 9674431* Intrón 1 A T 0.9706 0.0294 0.9925 0.0075 1.0 0.0 9674437 Intrón 1 T C 1.0000 0.0 0.9000 0.1000 9674448 Intrón 1 T C 0.9921 0.0079 1.0 0.0 9674451 Intrón 1 A G 0.9921 0.0079 0.9000 0.1000 9674455* Intrón 1 G A 0.6071 0.3929 0.0093 0.9907 0.5000 0.5000 9770586* Intrón 5 A G/T 0.6944 0.3056/0.0 0.8772 0.0395/0.0833 0.8000 0.2000/0.0 9770593 Intrón 5 C T 0.3507 0.6493 1.0 0.0 9770633 Intrón 5 G A 0.5373 0.4627 1.0 0.0 9803985* Intrón 8 C T 0.9722 0.0278 0.0944 0.9056 1.0 0.0 9803991* Intrón 8 A G 0.9722 0.0278 0.0909 0.9091 1.0 0.0 9806624* Intrón 8 A G 0.9167 0.0833 0.0574 0.9426 0.8000 0.2000 9806672 Intrón 8 T C 0.9769 0.0231 0.8000 0.2000 9806689 Intrón 8 G T 0.9851 0.0149 1.0 0.0 9845631 Intrón 11 C A 1.0000 0.0000 0.8000 0.2000 9845821 Intrón 11 C G 0.7177 0.2823 1.0 0.0 9845862 ¥ Intrón 11 G T 0.8750 0.1250 9845934 Intrón 11 G A 0.9844 0.0156 1.0 0.0 9845944 Intrón 11 G A 0.8750 0.1250 1.0 0.0 9845966 Intrón 11 G A 0.9692 0.0308 1.0 0.0 9845980 Intrón 11 A G 0.8056 0.1944 1.0 0.0 9863873* Intrón 13 T C 0.9722 0.0278 0.0522 0.9478 1.0 0.0 9863960 Intrón 13 T C 0.0818 0.9182 1.0 0.0

20

9863974¥ Intrón 13 T C 0.6666 0.3333

9863983¥ Intrón 13 T C 0.0 1.0

9863984¥ Intrón 13 G T 0.0 1.0

9866489 Intrón 13 G A 0.8433 0.1567 1.0 0.0

9866528 Intrón 13 A G 0.9925 0.0075 1.0 0.0

9866542¥ Intrón 13 A G 0.9722 0.02

9866545 Intrón 13 C T 0.8433 0.1567 1.0 0.0

9866552¥ Intrón 13 T C 0.9118 0.08

9866569 Intrón 13 C T 0.8624 0.1376 1.0 0.0

9879860 Intrón 13 T C 0.7881 0.2119 1.0 0.0

9880018 Intrón 13 C A 0.5694 0.4306 1.0 0.0

9880025 Intrón 13 G T 0.7787 0.2213 1.0 0.0

9889605¥ Intrón 14 C G 0.6250 0.3750

9889627 Intrón 14 G A 0.9462 0.0538 1.0 0.0 9889677* Intrón 14 G T 0.0 1.0 0.9925 0.0075 0.0 1.0 9889687¥ Intrón 14 T C 0.4167 0.5833

9891054¥ Intrón 14 C T 0.5833 0.4167

9891056¥ Intrón 14 T C 0.5000 0.5000 9891124¥ Intrón 14 G T 0.4000 0.6000

9891130¥ Intrón 14 A G 0.4063 0.5938 9891155¥ Intrón 14 T G 0.4063 0.5938

9918483 Intrón 17 C T 0.9841 0.0159 1.0 0.0 9918506* Intrón 17 A G 0.1389 0.8611 0.9250 0.0750 0.2000 0.8000 9918508 Intrón 17 C T 0.9655 0.0345 1.0 0.0 9918512 Intrón 17 C T 0.9914 0.0086 1.0 0.0 9931517 Intrón 17 C G 0.9924 0.0076 1.0 0.0 9931524 Intrón 17 C G 0.9924 0.0076 1.0 0.0 9931525 Intrón 17 T G 0.9924 0.0076 1.0 0.0 9931529 Intrón 17 C T 1.0000 0.0000 0.9000 0.1000

* Variaciones presentes en las tres poblaciones. ¥ Variaciones específicas en la población Angus.

Rev Mex
Pecu 2023;14(1):1-22 21
Cienc

Rev Mex Cienc Pecu 2023;14(1):1-22

Cuadro 4: Resultados del buscador ESE para SNP no codificantes identificados en los genes SNCA y APP

El nucleótido SNP se resalta en negritas en la secuencia. TS: tipo salvaje. M: secuencia con SNP no codificante. ↑ indica una puntuación mayor en comparación con la secuencia de tipo salvaje.

22
Gen Posición Intrón SNP Secuencia del sitio Donante/aceptor Puntuación APP 9770593 5 C TS CTCTCCCCTCGTCAGTGCTGTAGTTCAGGT aceptor 6.74720 T M CTTTCCCCTCGTCAGTGCTGTAGTTCAGGT aceptor 7.11480 ↑ 9806689 8 G TS ------ ------ -----T M CTTTGGATTTGCCAGGCACACTCACCTCCA aceptor 6.81380 ↑ 9845821 11 C TS CTCCTTCCACAACAGAAGGCGCTATTTTAA aceptor 6.71530 G M ------ ------ ------

https://doi.org/10.22319/rmcp.v14i1.6073

Artículo

Efecto de la consanguinidad y selección sobre los componentes de un índice productivo, en ratones bajo apareamiento estrecho

Dulce Janet Hernández López a

Raúl Ulloa Arvizu a

Carlos Gustavo Vázquez Peláez a Graciela Guadalupe Tapia Pérez a*

a Universidad Nacional Autónoma de México, Departamento de Genética y Bioestadística de la Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México. *Autor de correspondencia: tapiadoctora@gmail.com

Resumen:

Con objeto de examinar la influencia de la depresión endogámica en algunas características productivas del ratón de laboratorio, se reanalizaron 871 registros provenientes de 20 generaciones en una línea con cruza consanguínea estrecha con selección a un índice productivo (CNHS) comparando con una línea sin selección, con cruzamiento endogámico (n= 135). Se calcularon los coeficientes de endogamia (F) para cada generación. Entodos los componentes del índice(vidareproductiva, estrospostparto fértiles y tamaño de camada), se compararon las dos líneas, en las 15 generaciones disponibles de la no seleccionada, por método de mínimos cuadrados, agrupando cada cinco generaciones. La seleccionada, se analizó en las 20 generaciones, para diferencias intergeneracionales con el mismo método. La depresión endogámica se estimó en todas lasgeneracionesconunaregresiónlinealdeconsanguinidad(expresadaen10%)entodos los componentes. Se observó diferencia significativa (P<0.01) entre líneas en las variables analizadas. Los estros post parto fértiles de la línea seleccionada se mantuvieron constantes, hubo un decremento de 0.331 en la no seleccionada (P<0.01). El índice productivo se mantuvo estable (aumentó 0.071) en la seleccionada, en la no seleccionada disminuyó (0.39) hasta desaparecer (G15). La depresión endogámica impactó en la vida reproductiva de ambas, decreció 4.741 días en la seleccionada vs. 7.718 días en la no seleccionada(P<0.01).Enlanoseleccionadaafectóenmortalidadaldesteteycicloestral,

23

la selección al índice contrarrestó ese impacto, probablemente debido a la selección de genes que favorecen el desarrollo gonadal de los ratones.

Palabras clave: Ratones, Selección, Vida reproductiva, Número de estros, Depresión endogámica.

Recibido: 05/10/2021

Aceptado: 16/08/2022

Introducción

En la actualidad se han desarrollado un gran número de líneas de ratones genéticamente diferentes, que tienen propósitos de investigación particulares. Las líneas consanguíneas fueron el prototipo de las líneas genéticamente estandarizadas, que permitieron elaborar experimentos eliminando la variabilidad de origen genético. Aunque la genómica, proporciona a los laboratorios las herramientas necesarias para producir ratones con las características que demanda la investigació, cuando se ha fijado una característica, se necesita de un riguroso proceso de selección y apareamiento dirigido para mantener la viabilidad de la línea, que generalmente conlleva a depresión endogámica(1,2) .

La base genética de este fenómeno está relacionada con tres hipótesis a saber, dominancia parcial (mayor expresión de alelos recesivos deletéreos, sobredominancia (superioridad de heterocigotos sobre ambos tipos de homocigotos) y epistasis (mayor probabilidad de combinaciones genéticas favorables para heterocigotos)(3)

Los criadores de animales domésticos de razas puras utilizan la endogamia para fijar rasgos genéticos deseables dentro de una población o para intentar eliminar los rasgos deletéreos, la depresión por endogamia puede afectar los ingresos económicos de los criadores(4). Los estudios en ratones al ofrecer un mayor número de generaciones en menor tiempo ayudan a comprender la depresión endogámica, en poblaciones donde se busca seleccionar alguna característica.

En el ratón, se observó una reducción de 7.2 % en el tamaño de camada por cada 10 % deincrementoen consanguinidad,bajoapareamientoconsecutivodehermanoscompletos sin selección(2) y, con el mismo incremento de consanguinidad en cruzas entre medios hermanos sin selección, el decremento fue de 6.22% en el tamaño de camada(5)

La depresión fue menos severa en líneas bajo selección dirigida que en líneas sin selección(6), esto fue observado cuando se seleccionó para tamaño de camada en ratones, encontrando que la reducción en la aptitud reproductiva fue significativamente menor en las líneas consanguíneas bajo selección, comparada con la de las líneas consanguíneas sin

Rev Mex Cienc Pecu 2023;14(1):23-38 24

selección; lo anterior se explica porque gracias a la selección, hay un aumento de los genes relacionados con la mejor aptitud reproductiva, que contrarresta la depresión endogámica causante de la reducción de dicha aptitud(7) Se ha visto que el comportamiento de una línea consanguínea seleccionada para tamaño de camada es similar al de una no consanguínea, seleccionada para la misma característica. En un estudio, la consanguinidad permitió superar el límite de selección para tamaño de camada grande, cuando en la línea seleccionada se accedió a un cruzamiento consanguíneo(8) .

El número de crías destetadas por hembra por semana (CDHS), es un índice productivo que se mide durante y al término de la vida reproductiva en cada pareja de ratones. Se utiliza en las colonias fundadoras de algunas compañías de animales de laboratorio(9,10) A pesar de que se recomienda seleccionar a los ratones provenientes de familias con más alto CDHS para mantener líneas de laboratorio, mediante cruzamiento consanguíneo estrecho con características fijadas(11), en la literatura hay poca información del efecto de esa selección en ratones endogámicos acerca de las variables incluidas en él.

Por lo que el objetivo de este estudio fue evaluar el efecto de la endogamia sobre los componentes de un índice productivo, en el modelo animal de ratón de laboratorio, durante 20 generaciones de selección con cruza consanguínea estrecha, así como evaluar si la selección puede afectarse en su avance, por el efecto de la depresión endogámica, en las características que lo constituyen.

Material y métodos

El presente trabajo es un estudio retrospectivo, transversal, comparativo y observacional. Se reanalizaron 871 registros de un bioterio, que fueron tomados durante cinco años en ratones con selección continua y cruza consanguínea estrecha (hermano con hermana) donde hubo cinco líneas seleccionadas a un índice productivo: (CDHS) en 20 generaciones (n= 871). Los datos, recabados entre 1989-1994, se habían analizado con el objetivo de la obtención de heredabilidad realizada, para el índice productivo, una descripción detallada se puede ver en Tapia-Pérez(12) .

Para esteestudiose añadióunalínea de la mismacepa contemporánea, del propio bioterio (n= 135), con cruza consanguínea estrecha sin selección hasta la generación 15; después de esta generación las parejas dejaron de ser fértiles.

Los animales se alojaron en jaulas de policarbonato tipo caja de zapatos, la cual ofrece un áreade375cm, contapatipoCambridgedeaceroinoxidable yfiltrodepoliésterrígido tipo Kraft; se proporcionó alimento ad libitum, agua potable filtrada por ósmosis reversible acidificada a un pH de 2.5. El aire se filtraba, y se mantuvo una temperatura de 18 a 26 °C. La identificación de los animales fue individual, primero, por medio de muescas en las orejas, y los registros por medio de tarjetas en cada jaula. Estas tarjetas después se resumieron en carpetas de registro llamadas AER (Análisis de Eficiencia

Rev Mex Cienc Pecu 2023;14(1):23-38 25

Reproductiva), a partir de las cuales se calculó el índice CDHS cada tres generaciones, o cuando se detectaron líneas divergentes (esto podría darse en la cuarta generación en cada línea seleccionada), para obtener y seleccionar la sublínea con el promedio más alto, que además contara con crías de tercer parto, con cuando menos dos hembras y dos machos para cría. Cabe hacer notar que aquellas parejas estériles (no se registró gestación), infértiles (se registró gestación, pero no parto) o que canibalizaron a sus crías tuvieron un valor CDHS de cero, que fue incluido para obtener el promedio dado que se consideran resultado de la depresión endogámica. En cuanto a la línea no seleccionada, el manejo fue similar; esta línea fue la única que continuó activa de las cinco que comenzaron al mismo tiempo de las seleccionadas, las otras cuatro se perdieron en la segunda generación. El manejo reproductivo en ambas líneas fue bajo un método monogámico intensivo, es decir, se colocaron en la misma jaula un macho con una hembra y permanecieron juntos toda su vida reproductiva (165 ± 3.6 días). Los apareamientos se iniciaron cuando los animales alcanzaron la madurez sexual (8-10 semanas).

Las parejas seleccionadas para reproducción se formaron aleatoriamente, una hembra y un macho hermanos completos, provenientes del tercer parto de sus padres, tanto en la generación de selección (3 o 4) como en las anteriores. En cada generación se mantuvo un promedio de ocho parejas por línea.

Descripción de variables

Las variables que se analizaron fueron: VR: vida reproductiva, medida como los días totales en reproducción. EPPF: número total de estros post parto fértiles en la VR. Se considera un estro post parto fértil cuando la hembra tiene un parto en el primer estro, dentro de 35 o menos días del anterior(yaqueseasume un períododegestación de21días,conunaimplantación dentro de 5 días, si ésta se lleva a cabo cuando la madre aún está lactando una camada previa, se puede dar en 14 días máximo, así: 21 + 14 =35)(9) .

CNAC: número total de crías nacidas en la VR.

CDEST: número total de crías destetadas en la VR.

CNPP: crías nacidas por parto = �������� ������������ (PARTOS: número de partos totales en la VR).

CDPP: crías destetadas por parto = ���������� ������������ .

CDHS: (Índice de eficiencia productiva) es el número de crías destetadas por hembra por semana = ���������� ���� ×7

Porcentaje de mortalidad al destete = �������� �������� �������� ��100.

Análisis estadístico

Para el análisis estadístico, la línea seleccionada corresponde al conjunto de las cinco líneas con selección a CDHS dividida en: línea seleccionada durante 15 generaciones (S15G) n= 733 , la misma línea seleccionada en las 20 generaciones (S20G) n= 871 y

Rev Mex Cienc Pecu 2023;14(1):23-38 26

línea no seleccionada, que permaneció hasta la generación 15 (NS15G) n=135, ya que en ésta quedaron cinco parejas, de las cuales solo una llegó al tercer parto y las crías no eran suficientes para hacer las cruzas.

Se agrupó la información de cinco generaciones en cada línea, para todas las variables, de manera que, los datos analizados en cada nivel corresponden a los de cinco generaciones sucesivas. Se agruparon de esta forma para observar el resultado de la selección en la quinta generación, debido a que, como se explicó, se seleccionaba mínimo cada tres generaciones o cuando se detectaban líneas divergentes, que podría darse hasta en cuatro generaciones. El nivel 1 contiene la suma de las generaciones de 1 a 5; el nivel 2, de 6 a 10 yel nivel 3 de 11 a 15 de S15G yNS15G, mientras que el nivel 4 únicamente corresponde a S20G, en las generaciones de 16 a 20.

Se realizaron pruebas de normalidad de las variables mencionadas por el método de Kolmogorov-Smirnov.

El modelo lineal general utilizado para comparar S15G y NS15G fue (Modelo 1): �������� = ��+���� + ���� +(����)���� +��������

Donde �������� es la suma de cinco generaciones sucesivas de las parejas, para cada variable cuantitativa; ���� es el efecto del i-ésimo grupo de selección (i=1,2); ���� es el efecto de la generación agrupada cada cinco generaciones (j=1,2,3); (����)���� el efecto de la interacción entre el grupo de selección y la generación agrupada; �������� el error aleatorio (��~��0,���� 2).

El modelo de análisis para S20G (Modelo 2), sólo incluyó el efecto de la generación agrupada gi, (i=1,2,3,4): ������ = ��+ ���� +������

Donde ������ es la suma de 5 generaciones sucesivas de las parejas, para cada variable cuantitativa, en la iésima generación; ������ el error aleatorio (��~��0,���� 2).

Ambos modelos se analizaron por el método de cuadrados mínimos. El coeficiente de consanguinidad se calculó para cada animal, con el Programa Computacional Pedigree Viewer©, desarrollado por Brian Kinghorn(13), que utiliza el método desarrollado por Wright (1922)(14)

Rev Mex Cienc Pecu 2023;14(1):23-38 27

La depresión por endogamia media (�� ̂ 1) y su error estándar (e.e.), de CDHS se estimaron por el método de cuadrados mínimos con los coeficientes de consanguinidad (Fi)de cada generación, en unidades de 10 % para las líneas S15 y NS15 (i=1,2,3, …,15) y S20 (i=1,2,3, ..., 20), con el siguiente modelo de regresión lineal simple (Modelo 3). �� ̂ �� =��0 ̂ + ��1 ̂ ���� + ���� Donde �� ̂ i Es el promedio de cada componente del índice en la generación i-ésima; �� ̂ �� es la estimación del intercepto; ���� ̂ es la depresión por endogamia media, Fi es el coeficiente de consanguinidad (10%); ���� es el error aleatorio (���� ~��µ,���� 2).

Dado que el aumento de la consanguinidad se consideró en unidades de 10 %, las depresiones endogámicas se relacionaron con esta medida, que se eligió para poder comparar los resultados de este estudio con otros artículos de ratones donde se calcula de esa forma.

Los modelos se analizaron con el paquete estadístico, IBM SPSS Versión 22(15) , los porcentajes de mortalidad al destete, de S15G y NS15G, en cada una de las tres generaciones agrupadas, se analizaron mediante la prueba de Ji-cuadrada, con el programa MedCalc ® en línea(16) Se consideró el valor P≤0.05 como significativo y P≤0.01 como altamente significativo

Resultados

Modelos lineales

Modelo 1

Se observó un efecto de grupo de selección (si) altamente significativo (P<0.01) en todas las variables. En cuanto a la interacción (sg)ij, en las variables EPPF, CNAC, CDEST y CDHS fue altamente significativo (P<0.01), en VR y CDPP el efecto de la interacción resultó significativo (P<0.05), lo que no sucedió en la variable CNPP (P>0.05) (Cuadro 1).

Rev Mex Cienc Pecu 2023;14(1):23-38 28

Cuadro 1: Medias mínimo cuadráticas (M) y errores estándar (EE) de la interacción (sg)ij, en cinco generaciones agrupadas, para S15G y NS15G

LÍNEA GA F(%) EST EPPF VR CNAC CDEST CNPP CDPP CDHS

S15GA 1 a 5 50 M 1.74a 165.2a 20.35a 17.77a 4.77a 4.16a 0.66a (n=733) EE 1.58 3.52 8.16 7.65 1.59 0.54 0.029

6 a 10 82.6 M 2.18a 129.5b 19.01a 16.09a 4.62a 3.92a 0.598a EE 1.62 3.44 10.33 10.29 2. 06 2.27 0.029

11 a 15 93.9 M 2.1a 146.2a 21.06a 19.31a 5.01a 4.60a 0.687a EE 1.5 3.32 9.78 9.61 1.92 2.00 0.028

NS15GB 1 a 5 50 M 2.65a 146.7a 17.16a 13.63a 3.76a 2.96a 0.59a (n=135) EE 1.63 6.64 7.52 7.164 1.26 1.49 0.055

6 a 10 82.6 M 1.32b 99.67b 7.76b 4.64b 3.04a 1.45b 0.12b EE 1.41 7.74 4.37 4.85 1.45 1.70 0.064

11 a 15 93.9 M 0.3c 99.75b 7.85b 6.15b 3.87a 2.88a 0.20b EE 0.66 8.36 5.26 5.59 1.57 2.10 0.069 P(SG) <0.01 0.047 <0.01 0.01 0.482 0.048 <0.01

GA= generaciones agrupadas. F= consanguinidad obtenida en 5 generaciones. EST= estadístico. EPPF= número de estros post parto fértiles. VR= vida reproductiva de la pareja en días. CNAC= número total de crías nacidas en la VR. CDEST= número total de crías destetadas en la VR. CNPP= crías nacidas por parto. CDPP= crías destetadas por parto. CDHS= número de crías destetadas por hembra por semana. A,B literales diferentes denotan diferencias altamente significativas entre los grupos de selección si (P<0.01).

P(SG) es la significancia calculada por el modelo, .abc literales distintas denotan diferencias significativas (P<0.05) intergeneracionales, dentro de línea.

Las medias de los EPPF de S15G subieron 0.44 estros y se mantuvieron (P>0.05), mientras que las medias de NS15G decrecieron 2.4 estros promedio, de 1 a 5 hasta las generaciones 11 a 15 (P<0.05) (Cuadro 1 y Figura 1). La vida reproductiva (VR), disminuyó en S15G, en las generaciones 6 a 10 casi 36 días (P<0.05), después se recuperó, aunque no al nivel de las primeras cinco generaciones, mientras que en NS15G se mantuvo 47 días más baja que en las primeras cinco generaciones (P<0.05). Tanto el número de crías nacidas y destetadas, en el total de vida reproductiva de las parejas, los valores más bajos se observaron en las generaciones 6 a 10 en ambas líneas; sin embargo, sólo NS15G mostró diferencias significativas (P<0.05) con una disminución de 9.4 y 9 crías respectivamente. Tanto CNPP como CDPP, se obtuvieron como promedio de todos los partos en la vida reproductiva de la hembra, agrupados cada cinco generaciones y fueron más bajos en NS15G, el pico más bajo se observó entre las generaciones 6 a 10 en ambas, pero sólo fue significativo en NS15G en las CDPP con una disminución de 0.7 crías destetadas (P<0.05) (Cuadro1).

Rev Mex Cienc Pecu 2023;14(1):23-38 29

Figura 1: Medias y desviaciones estándar de número de estros post parto fértiles (EPPF) con la consanguinidad agrupada cada cinco generaciones (1 a 5, 6 a 10 y 11 a 15)

S15G y NS15G, son las líneas con selección y sin selección para CDHS en las 15 generaciones de la última.

El índice (CDHS), se mantuvo estable a través de todas las generaciones acumuladas (P>0.05) en S15G, mientras que NS15G tiene una caída abrupta de las generaciones 1-5 a 6-10 (-0.47 crías) (P<0.05), con una leve recuperación en las siguientes cinco generaciones agrupadas (0.08 crías) (P<0.05); después se pierde debido a una gran mortalidad (Cuadro 1 y Figura 2).

Figura 2: Medias y desviaciones estándar del número de crías destetadas por hembra por semana (índice de eficiencia productiva) (CDHS) con la consanguinidad agrupada cada 5 generaciones (1 a 5, 6 a 10 y 11 a 15)

S15G y NS15G, son las líneas con selección y sin selección para CDHS en las 15 generaciones de la última.

Rev Mex Cienc Pecu 2023;14(1):23-38 30

Modelo 2

Cuando seanalizóS20G,seobservó el picomás bajo enlas generaciones6 a 10(P<0.05), en casi todos los componentes, mientras que EPPF y el índice CDHS no mostraron cambios significativos intergeneracionales (P>0.05) (Cuadro 2).

Cuadro 2: Medias mínimo cuadráticas (M) y errores estándar (EE) de cinco generaciones agrupadas, para S20G

GA F(%) EST EPPF VR CNAC CDEST CNPP CDPP CDHS

1 a 5 50 M 1.59a 165.2a 18.64a 16.29a 4.77a 4.17a 0.616a EE 0.12 3.58 0.81 0.76 0.14 0.14 0.031

6 a 10 82.6 M 1.79a 130.0b 15.26b 12.92b 4.63a 3.92b 0.598a EE 0.12 3.49 0.78 0.74 0.14 0.15 0.030

11 a 15 93.9 M 1.78a 146.7c 17.64ab 16.17a 5.01a 4.59a 0.687a EE 0.11 3.38 0.76 0.71 0.13 0.14 0.029

16 a 20 97.4 M 1.80a 133.9bc 17.26ab 15.17ab 5.18b 4.49ab 0.675a EE 0.11 3.39 0.76 0.72 0.14 0.14 0.029

GA= generaciones agrupadas. F= consanguinidad agrupada en 5 generaciones. EST= estadístico. EPPF= número de estros post parto fértiles. VR= vida reproductiva de la pareja en días. CNAC= número total de crías nacidas. CDEST= número total de crías destetadas en la VR. CNPP= Crías nacidas por parto. CDPP= crías destetadas por parto. CDHS= número de crías destetadas por hembra por semana. abc Literales distintas denotan diferencias significativas (P<0.05) intergeneracionales-

Modelo 3. Depresión endogámica

Hubo un efecto altamente significativo (P<0.01) de depresión endogámica en S15G, en la VR, CNPP y CDPP, mientras que CNAC, CDEST, EPPF y CDHS no fue significativo (P>0.05); en NS15G, las características EPPF, VR, CNAC, CDEST y CDHS mostraron un efecto altamente significativo (P<0.01) de la depresión endogámica, sin embargo, en CNPP y CDPP, fue no significativo (P>0.05) (Cuadro 3).

Rev Mex Cienc Pecu 2023;14(1):23-38 31

Mortalidad al destete

El porcentaje de mortalidad por parto al destete, con respecto a CNPP tuvo un comportamiento similar en ambas líneas, con un pico máximo en las generaciones 6 a 10, sin embargo, la línea no seleccionada mantuvo una mortalidad más alta que la seleccionada (52.30 %) teniendo una diferencia con la seleccionada del 36.8 (P<0.01) (Figura 3). La sobrevivencia por parto (100 – % mortalidad por parto) entonces, decae en las generaciones de las 6 a la 10 en la línea no seleccionada 31 % (78.47 - 47.7 %) y la seleccionada 2.37 % (87.22 - 84.85 %) manteniéndose más alta en la línea con selección.

Figura 3: Mortalidad por parto al destete, en porcentaje respecto a las CNPP, con la consanguinidad agrupada en 5 generaciones

S15G y NS15G, son las líneas con selección y sin selección para CDHS en las 15 generaciones de la última.

Discusión

En la literatura se encuentran pocos trabajos de selección sobre fertilidad a largo plazo y su efecto en la depresión endogámica en ratones; en un estudio de selección de tamaño de camada al primer parto que comenzó en 1972, evitando los cruzamientos entre hermanos completos, medios hermanos o primos, después de 124 generaciones de selección se encontró una consanguinidad de 0.64 en una de sus líneas, lo que llevó a ésta a una mayor depresión endogámica (-0.39), con un menor número de crías vivas en el primer parto, por cada 10 % de consanguinidad(17) . Los resultados del presente trabajo coinciden con aquél, cuando se obtuvo el promedio de las crías nacidas vivas por parto (CNPP) en la línea con selección, el efecto de la depresión endogámica fue de -0.466, un poco más alto que aquél, debido a que en ese trabajo sólo se midió el primer parto. El número de crías nacidas por parto, en el grupo NS15G, mostró un efecto no significativo de la consanguinidad (P>0.05) (Cuadro 3), lo que pareciera contrario a lo esperado; la explicación es que el número de partos en la vida reproductiva de las parejas fue

Rev Mex Cienc Pecu 2023;14(1):23-38 33

disminuyendo conforme aumentaban las generaciones y al promediar el tamaño de camada al parto y al destete (de toda la VR de cada pareja) con estos, parece que se hubiera mantenido constante (�� ̂ 1= 0.028). Otra diferencia es que la consanguinidad en dichoestudioesmenor,aunqueelnúmerodegeneracionesdeselecciónesde124,durante ese tiempo (1972 a 2007), hubo varios cambios en la dirección de la selección en ese trabajo, pero se trató de evitar las cruzas endogámicas(17). No se encontró en la literatura, algún trabajo con selección a tamaño de camada de toda la vida reproductiva con cruza endogámica, sin embargo, en un estudio con selección a un índice combinando tamaño de camada con peso al nacimiento, pero con cruzamientos abiertos (no endogámicos) durante 150 generaciones, se obtuvieron tamaños de camada en la vida reproductiva de una pareja, de 17.6 crías nacidas y 20.2 crías en promedio(18), muy similares al promedio de CNAC al inicio de este estudio. La disminución de este promedio en las generaciones siguientes en el presente trabajo, se debe muy probablemente a la depresión endogámica, que en la línea no seleccionada fue de -1.705 crías por cada 10 % de consanguinidad (P<0.01). Cabe hacer notar que en las características CNAC y CDEST, originalmente utilizadas para obtener el CDHS (en toda la VR de cada pareja), hubo un efecto altamente significativo (P<0.01) de depresión endogámica en NS15G lo que no ocurre en la S15G (Cuadros 1,2,3). En aquel estudio, se observó un aumento en los niveles de testosterona en los machos, mientras que, en las hembras, hubo una elevación de progesterona en una de sus líneas; éstas mostraron un mayor número de ovocitos por ciclo, pero una mayor pérdida de embriones, y una disminución de la vida reproductiva, en comparación con la línea sin selección. Estos resultados coinciden con el presente trabajo, ya que también se obtuvo una disminución en la vida reproductiva en S1G y S20G (Cuadros 1,2).

En el presente estudio se reveló, que el número de EPPF tiene una disminución constante a lo largo de las generaciones estudiadas en NS15G, con un decremento de 0.331 estros post parto fértiles por cada 10 % de aumento en la consanguinidad (P<0.01), en comparación con S15G que se mantiene casi constante (P>0.05) (Cuadro 3); este comportamientoseobservatambiénenCDHS(elíndiceproductivo)conunadisminución marcada en NS15G de las generaciones 1 - 5 a 6 - 10, con una ligera recuperación en las últimas cinco; la depresión endogámica fue de -0.062 (P<0.01) crías destetadas por hembra por semana por cada 10 % de aumento en consanguinidad, vs -0.001 (P>0.05) en S15G. Un estudio mostró que una deleción de Kiss1r en las neuronas del eje GnRH interrumpelaseñalde kisspeptina,laproteínaqueinducelasecrecióndeGnRH (hormona liberadora de gonadotropina); esto resulta en infertilidad debida a hipogonadismo, probablemente la consanguinidad tuvo un efecto negativo en este mecanismo, a través de la interrupción de esta señal(19) en los ratones S15G; en el presente trabajo no se midieron los efectos en los machos. Algo muy parecido se encontró en cerdos bajo selección para prolificidad, cuando ésta se hizo con índices de familias, ya que se vio un aumento en la depresión endogámica de tres veces más a la esperada sin selección yuna disminución de la respuesta a la selección(20)

La VR, se vio afectada por la consanguinidad tanto en S15G, con una disminución de 4.741 días, en NS15G disminuyó casi tres días más (7.718 días) (P<0.01 en ambas)

Rev Mex Cienc Pecu 2023;14(1):23-38 34

(Cuadro 3), en un estudio donde hubo selección para mayor tiempo de vida en ratones, se encontró que el aumento estuvo relacionado con mutaciones, que aumentaban los niveles de la hormona del crecimiento en el eje GH/IGF-1(21), que podría estar relacionada con una disminución en el tiempo de vida de los ratones, como sucedió en las líneas seleccionadas para un índice involucrando tamaño de camada y peso al nacer, sin consanguinidad(18) en el presente trabajo disminuyó en ambas líneas ya que el objetivo de selección fue distinto.

La mortalidad postparto es más alta en NS15G, desde las primeras cinco generaciones de cruzamiento consanguíneo estrecho, comparada con S15G, resultado similar al obtenido por Sallah(5), tanto en la línea seleccionada, como la no seleccionada, con apareamiento entre medios hermanos, donde, la mayor mortalidad se dio en las generaciones intermedias. Charlesworth(22) explica esto bajo dos hipótesis: 1) la de dominancia, donde la endogamia aumenta la frecuencia de los individuos que expresan los efectos de mutaciones deletéreas o 2) sobredominancia, donde los homocigóticos tendrían una menor aptitud por falta de alelos, con ventaja heterocigótica que mantendrían equilibrando la selección a frecuencias intermedias en los heterocigóticos.

Como resultado de lo anterior, el número de crías al destete por parto en NS15G, cae significativamente en las generaciones 6 a 10 (1.51 crías), con una recuperación en las siguientes generaciones acumuladas, mientras que, en el número de crías al nacimiento por parto, se mantiene en todas las generaciones (P<0.05) (Cuadro 1) (Figura 3). Un estudio reciente(23) reveló que, en camadas con menos de cuatro crías al nacimiento, en ratones sin selección, existe una mayor mortalidad al destete, y en el presente estudio la línea NS15G presentó menos de cuatro crías al nacer como promedio en las primeras cinco generaciones.

El resultado en estas características era presumible, ya que por un lado se puede esperar una alta depresión endogámica cuando se realiza cruza consanguínea estrecha (hermano, hermana) y, por otro lado, debido a la baja heredabilidad (0.024 a 0.063), del índice productivo(12), sólo se puede esperar un progreso de reproducción limitado; un resultado similar se obtuvo en el tamaño de camada con una consanguinidad de 0.61 en ocho generaciones de selección con consanguinidad en cruzas entre medios hermanos (5) .

Estos resultados, conllevan a reflexionar si en un programa de selección en animales domésticos, aun evitando cruzamientos entre hermanos, generaciones más adelante se pudieran llegar a dar entre parientes, y esto induzca una endogamia, con los efectos contraproducentes que aquí se vieron.

En un programa de mejoramiento de ganado Holstein, se encontró que con 1 % de incremento en consanguinidad, la producción de leche en 305 días disminuyó 36.3 kg en promedio, en vacas de 4 a 5 años, y 2.42 kg de grasa(24). Recientemente, se evaluó la implementación de selección genómica, en la pérdida de diversidad genética en ganado Holstein yJerseyenNorteAmérica,debidaalaconsanguinidad; sus resultados mostraron

Rev Mex Cienc Pecu 2023;14(1):23-38 35

un incremento de endogamia de 1.19 a 2.06 % por generación, en un período de 10 años en ganado Holstein, y advirtieron sobre la necesidad de implementar medidas para evitar la endogamia en este tipo de programas(25) En la población Holstein de México, se encontró que, con niveles menores al 5 % de consanguinidad, no se detectó en grasa ni en proteína de la leche, ningún efecto, sin embargo, cuando la consanguinidad aumentó a más de 5 %, se encontró una disminución en la producción de leche de 260 kg por lactación, además de una pérdida en la producción de grasa de 11 kg y de 10 kg en proteína con respecto al promedio de los grupos con menos de 5 %(26) .

Conclusiones e implicaciones

Como muestran los resultados de NS15G para un índice productivo (número de crías por hembrapor semana),ladepresión por consanguinidadafectó a sus distintos componentes, especialmente en las características reproductivas, que se pudieron regular en gran medida mediante una selección simultánea de éstas, probablemente debido a un mantenimiento de genes que favorecieron el desarrollo gonadal en las hembras y machos. El trabajo es relevante porque no se había analizado la selección de un índice productivo en ratones en sus diferentes componentes, de una forma integral, además de mostrar que, en un programa de selección con consanguinidad simultánea, se favorece la fijación de alelos deseables en el sostenimiento de los ciclos reproductivos y la sobrevivencia de las crías.

Literatura citada:

1. Silver LM. Mouse genetics: Concepts and applications. 1st ed. Oxford, United UKA: Oxford University; 2001.

2. Falconer DS, MackayTFC. Introduction to quantitative genetics. 4th ed.Harlow, UKA: Longman; 1996.

3. Curik I, Sölkner J, Stipic N. The influence of selection and epistasis on inbreeding depression estimates. J Anim Breed Genet 2001;118:247-262. https://doi.org/10.1046/j.1439-0388.2001.00284.x.

4. Leroy G. Inbreeding depression in livestock species: review and meta-analysis. Anim Genet 2014;45 (5):618-628.

5. Sallah BI, Seeland G. Einfluss von Inzucht und selektion auf die Fruchtbarkeit und das Wachstum der Maus. Arch. Tierz. Dummerstorf 2001;44(6): 671– 676.

6. Bohren BB. Designing artificial selection experiments for specific objectives. Genetics 1975; 80(1):205-220.

7. De la Fuente LF, San Primitivo F. Selection for large and small litter size of the first three litters in mice. Gênet Sêl Evo 1985;(17):251-264.

Rev Mex Cienc Pecu 2023;14(1):23-38 36

8. Eklund J, Bradford GE. Genetic analysis of a strain of mice plateaued for litter size. Genetics 1977;(85):529-542.

9. Festing FWM. Inbred strains in biomedical research. 1ra ed. London, UKA: Palgrave; 1979.

10. Hubrecht R, Kirkwood J. Handbook on care and management of laboratory animals. 8a ed. London, UKA: UFAW; 2010.

11. Benavides FJ, Guénet JL. Manual de genética de roedores de laboratorio: Principios básicos y aplicaciones. 1ra ed. Madrid, España: Universidad de Alcalá; 2003.

12.Tapia-PérezG.Respuestaalaselecciónparael númerodecríasdestetadasporsemana en líneas congénicas y singénicas de ratones de laboratorio [tesis maestría]. México, CDMX: Universidad Nacional Autónoma de México; 1995.

13. Kinghorn B, Kinghorn S. Pedigree Viewer, Ver 5.0. The University of New England 2010. https://bkinghor.une.edu.au/pedigree.htm Accessed Jan 10, 2021.

14. Wright S. Coefficients of inbreeding and relationship. The American Naturalist 1992; (56):330-338.

15. IBM SPSS Statistics for Windows, Ver 22.0. Armonk, New York: IBM Corp. 2013.

16. MedCalc Software Ltd. Comparison of proportions calculator, Ver 20.022. https://www.medcalc.org/calc/comparison_of_proportions.php Accessed Dec 22, 2021

17. Hinrichs D, Meuwissen THE, Odegard J, Holt M, Vangen O, Woolliams JA.Analysis of inbreeding depression in the first litter size of mice in a long-term selection experiment with respect to the age of the inbreeding. Heredity 2007;(99):81-88. https://doi.org/10.1038/sj.hdy.6800968.

18. Langhammer M, Michaelis M, Hoeflich A, Sobczak A, Schoen J, Weitzel JM. Highfertility phenotypes: two outbred mouse models exhibit substantially different molecular and physiological strategies warranting improved fertility. Reproduction 2014;147(4):427-133. https://doi.org/10.1530/REP-13-0425.

19.NovairaHJ, Momodou LS,HoffmanG,KooY, KoC,WolfeA,Radovik S.Disrupted kisspeptin signaling in GnRH neurons leads to hypogonadotrophic hypogonadism. Molecular Endocrinology 2014; 28 (2): 225–238. https://doi.org/10.1210/me.20131319

20. Toro M, Silio L, Rodrigañez J, Dobao M. Inbreeding and family index selection for prolificacy in pigs. Anim Sci 1988; 46(1): 79-85. https://doi:10.1017/S0003356100003135

Rev Mex Cienc Pecu 2023;14(1):23-38 37

21. Junnila RK, List EO, Berryman DE, Murrey JW, Kopchick JJ. The GH/IGF-1 axis in ageing and longevity. Nat Rev Endocrinol 2013;9(6):366-376. doi: 10.1038/nrendo.2013.67.

22.Charlesworth D,WillisJ.Thegenetics ofinbreedingdepression. Nat RevGenet 2009; (10):783–796.

23. Morello GM, Hultgren J, Capas-Peneda S, Wiltshire M, Thomas A, Wardle-Jones H, et al. High laboratory mouse pre-weaning mortality associated with litter overlap, advanced dam age, small and large litters. PloS one 2020;15(8):e0236290. https://doi.org/10.1371/journal.pone.0236290

24. Doekes HP, Veerkamp RF, Bijma P, De Jong G, Hiemstra SJ, Windig JJ. Inbreeding depression due to recent and ancient inbreeding in Dutch Holstein–Friesian dairy cattle. Genet Sel Evol 2019;51(54). https://doi.org/10.1186/s12711-019-0497-z.

25. Makanjuola BO, Miglior F, Abdalla EA, Maltecca C, Schenkel FS, Baes CF. Effect of genomic selection on rate of inbreeding and coancestry and effective population size of Holstein and Jersey cattle populations. J Dairy Sci 2020;103(6):5183-5199. https://doi.org/10.3168/jds.2019-18013

26. García-Ruíz A, Martínez-Marín GJ, Cortes-Hernández J, Ruíz-López FJ. Niveles de consanguinidad y sus efectos sobre la expresión fenotípica en ganado Holstein. Rev Mex Cienc Pecu 2021;12(4):996-1007. https://doi.org/10.22319/rmcp.v12i4.5681.

Rev
38
Mex Cienc Pecu 2023;14(1):23-38

https://doi.org/10.22319/rmcp.v14i1.6129

Artículo

Variabilidad genética en biomasa aérea y sus componentes en alfalfa bajo riego y sequía

a Colegio de Postgraduados. Postgrado en Recursos Genéticos y Productividad. Carretera México-Texcoco km. 36.5, Montecillo, Texcoco, Estado de México, México.

*Autor de correspondencia: clc@colpos.mx

Resumen:

La sequía disminuye el rendimiento de biomasa aérea (BM) y sus componentes, y la calidad del forraje en alfalfa. Se estudió la variación genética en BM y sus componentes en 10 variedades de alfalfa bajo riego (R) y sequía (S) en invernadero. Se utilizó un diseño experimental de bloques completos al azar, con cuatro repeticiones en R y cuatro en S. La unidad experimental fue una planta individual en un tubo de PVC. La siembra se realizó el 15 de marzo de 2017 y el trasplante en los tubos, 20 días después de la siembra. Se aplicó la dosis de fertilización 60-140-00 a 44, 240 y420 ddt (días después del trasplante). La S redujo (P≤0.01) la BM, el rendimiento de materia seca de hojas (RMSH), número de tallos (NT) y la eficiencia en el uso de la radiación (EUR). Las plantas en S no recuperaron su capacidad productiva después de experimentar el déficit hídrico, aún después del riego de recuperación. La S también disminuyó (P≤0.01) la varianza fenotípica para la BM y sus componentes; la varianza aditiva fue mayor (P≤0.01) que la varianza de dominancia para todos los caracteres en R y S. La BM, relación H:T, altura de planta (AP), NT y EUR tuvieron mayor (P≤0.01) heredabilidad en R y S Las variedades Genex, Atlixco, Júpiter y Milenia fueron las más productivas (P≤0.01) en S, y podrían utilizarse para la producción de forraje en áreas con escasez de agua o como líneas parentales, para el mejoramiento del rendimiento de forraje en los programas de selección.

39

Palabras clave: Análisis de componentes principales, Componentes de varianza, Heredabilidad, Invernadero.

Recibido: 22/12/2021

Aceptado: 22/06/2022

Introducción

En México, la alfalfa (Medicago sativa L.) para forraje se cultiva principalmente bajo condiciones de riego yconsume grandes volúmenes de agua. En las regiones con sistemas de irrigación, un dosel vegetal de alfalfa en su pico de máximo desarrollo puede consumir una cantidad de agua de 10 mm día-1(1) . En estas condiciones de cultivo, la caída en la cantidad de precipitación durante largos periodos de tiempo disminuye la capacidad de almacenamiento de agua en el subsuelo y, por tanto, la disponibilidad de riego. Así mismo, cuando la sequía se prolonga, la escasez de agua para riego es más severa y los cultivos de alfalfa pueden experimentar algún grado de estrés hídrico, que se puede reflejar en una disminución significativa del rendimiento y calidad del forraje(2) .

En un futuro próximo, el recurso hídrico estará menos disponible para la producción de forraje de alfalfa, debido a la incidencia de frecuentes periodos de sequía, cambio climático y mayores demandas ocasionadas por el incremento en la población humana(3) . Una forma de satisfacer la demanda en la producción de forraje de alfalfa será a través de la obtención denuevas variedades con tolerancia asequía,alta capacidaddeajusteosmóticoeintercambio gaseoso, alta eficiencia en el uso del agua (p. ej. mayor cantidad de materia seca por unidad deaguatranspiradao evapotranspirada) ycapacidadproductiva(3) Laalfalfaestá considerada como una especie resistente a sequía, pero su rendimiento de biomasa aérea puede fluctuar considerablemente bajo condiciones de déficit hídrico; en estas condiciones la alfalfa tiene algunas ventajas agronómicas en comparación con otros cultivos anuales, al poseer un sistema de raíces que le permite explorar capas del suelo más profundas, para absorber agua ytolerarenmayor gradolasequía; ademásdereducirlaconductanciaestomática yminimizar la tasa transpiratoria(4)

La reacción más común a un déficit hídrico del suelo es el incremento en la proporción del peso seco de biomasa radical/peso seco de biomasa aérea, como resultado de una mayor reducción en el crecimiento de los órganos aéreos que en el crecimiento de las raíces bajo sequía El incremento en el cociente raíz/parte aérea implica aumentos mayores en la densidadderaíces conrespecto alabiomasa aérea, loqueenconsecuenciaserefleja enmejor capacidad para mantener el estatus hídrico de la planta bajo una demanda evapotranspiratoria

Rev Mex Cienc Pecu 2023;14(1):39-60 40

dada(5) . La sequía también reduce el rendimiento de biomasa aérea y sus componentes, tasas relativadecrecimiento,transpiración yelongación deltallo,contenidodeclorofila,contenido relativo de agua, y peso seco y diámetro de raíces(6), y concentración de proteína cruda y carbohidratos hidrosolubles(7) .

Por otra parte, las variedades de alfalfa resistentes a sequía exhiben alta concentración de carbohidratos hidrosolubles en los órganos de almacenamiento bajo condiciones de estrés hídrico severo. Esta situación se combina con una estrategia de conservación del agua que implica menor evapotranspiración en las fases iniciales del estrés por sequía, debido a un desarrollo limitado del sistema radical que resulta en mayor cantidad de humedad disponible, para su utilización bajo condiciones severas de estrés hídrico(8). Las tasas de acumulación de biomasa en las raíces y órganos aéreos de las plantas fueron más altas en praderas de dos años de edad y la acumulación de biomasa aérea fue más alta y mantuvo las mejores condiciones de humedad en el suelo en praderas de cuatro años, una vez que el cultivo alcanzó el máximo desarrollo del sistema radical y cobertura de la superficie del suelo(9) . El germoplasma tolerante a sequía muestra menor grado de marchitamiento bajo condiciones iniciales de déficit hídrico, más plantas con el dosel vegetal verde bajo condiciones de estrés hídrico severo y más tallos por planta en condiciones de estrés o condiciones favorables de humedad(3). No obstante, la existencia de una amplia variabilidad genética en caracteres morfológicos y fisiológicos asociados con la resistencia a sequía, es difícil lograr la combinación de caracteres adaptativos a ambientes específicos en una misma variedad con amplia adaptación a ambientes vulnerables a sequía(8) .

El mejoramiento genético de la resistencia a sequía y el rendimiento de biomasa aérea y sus componentes requiere especial atención en caracteres con alta heredabilidad, aptitud combinatoriageneral,efectosgenéticosaditivos, efectosgenéticosmaternos, bajainteracción genotipo*ambiente y facilidad para la selección. En el análisis de la variación genética de una población de la misma especie, la varianza genética aditiva es la más importante porque es la principal determinante de las propiedades genéticas observables en la población y de la respuesta a la selección(10). La varianza aditiva es la única que puede estimarse directamente a partir de las observaciones hechas en la población y puede utilizarse en la estimación de la heredabilidad, que representa la confiabilidad del valor fenotípico como indicación del valor reproductivo que es el que determina su influencia en la siguiente generación(10). La similitud observada en los valores de heredabilidad, para los caracteres medidos en la planta bajo riego y sequía, puede utilizarse como un indicativo de la efectividad en la selección de nuevas progenies, independientemente del ambiente de selección(10) La heredabilidad en sentido amplio (H2) mide la contribución del genotipo a la varianza fenotípica total (���� 2); teóricamente puede variar en un rango de cero, cuando no hay variación genética presente a 1, cuando toda la variación observada es genotípica en origen(11) .

Rev Mex Cienc Pecu 2023;14(1):39-60 41

La selección por resistencia a sequía puede lograrse incrementando la eficiencia en el uso del agua, índice de severidad de la sequía, media de productividad, media harmónica, media geométrica, índice de tolerancia al estrés, índice modificado de tolerancia al estrés, índice de superioridad e índice de tolerancia abiótica en condiciones de déficit hídrico(12) . La selección por componentes morfológicos del rendimiento de biomasa aérea puede lograrse incluyendo el número de tallos secundarios y diámetro de la corona por planta en los criterios de selección(13) Otros componentes del rendimiento de la biomasa aérea con heredabilidad moderada a alta que podrían utilizarse exitosamente en la selección, para incrementar el rendimiento son la tasa absoluta de crecimiento, eficiencia en el uso de la radiación, número de tallos, relación H:T y altura de planta, además de la presencia de efectos genéticos maternos favorables al rendimiento de biomasa aérea(14) La selección de nuevas variedades con resistencia a sequía y alto rendimiento de biomasa aérea y sus componentes puede lograrse, al identificar los caracteres genéticos con mayor heredabilidad y contribución a la productividad del genotipo. El objetivo de la presente investigación fue estudiar la variabilidad genética en la producción de biomasa aérea y sus componentes, en variedades comerciales de alfalfa bajo riego y sequía en condiciones de invernadero.

Material y métodos

Un experimento se llevó a cabo en condiciones de riego y sequía en invernadero con estructura metálica y vidrio transparente sin encalado, y con sistema de ventilación mecánica en el Colegio de Postgraduados, Montecillo, Texcoco, Estado de México (19° 29´ N, 98° 53´ O y altitud de 2,250 msnm) en el periodo 2017-2019. La localidad se caracteriza por tener un clima templado subhúmedo con verano fresco largo (Cb (wo) (w) (i´)g), precipitación media anual de 637 mm y lluvia invernal menor a 5%; temperatura media anual con fluctuaciones de 12 a 18 °C y oscilación térmica entre 5 y 7 °C(15) . El material genético utilizado incluyó las siguientes variedades comerciales de alfalfa: San Miguel, Oaxaca, Atlixco, Aragón, Victoria, Genex, Júpiter, Milenia, San Isidro y Cuf 101, con porcentaje de germinación mayor a 95 %. Se utilizó un diseño experimental de bloques completos al azar con cuatro repeticiones y dos tratamientos de humedad edáfica (riego y sequía). La unidad experimental fue una planta individual trasplantada en una bolsa cilíndrica de polietileno dentro de un tubo de PVC de 1 m de alto y 4” de diámetro, para favorecer la expresión del potencial genético de las características morfológicas de la variedad. La siembra se realizó el 15 de marzo de 2017, al colocar cinco semillas de cada variedad en celdillas individuales de cajas para almacigo. A los 20 días después de la siembra (dds), se seleccionó la plántula más vigorosa de cada celdilla y se trasplantó en forma individual en los tubos de PVC. Los tubos de PVC se llenaron con suelo seco de textura franco-arenosa, densidad aparente de 1.12 T m3 y pH de 7.3; 18.8 y 0.22 % de materia orgánica y nitrógeno total; 176.3 mg kg-1 y 2,420 mg kg-1 de fósforo y potasio; 54.6 Cmol(+) kg-1 y 0.53 dS m-1 de capacidad de intercambio catiónico y conductividad eléctrica; y 52 y 38.2 % de capacidad de campo (CC) y porcentaje

Rev Mex Cienc Pecu 2023;14(1):39-60 42

de marchitamiento permanente (PMP) (Laboratorio Central Universitario, Universidad Autónoma Chapingo, Chapingo, México, 2016). Se aplicó la dosis de fertilización 60-14000 a los 44 días después del trasplante (ddt), al utilizar urea y superfosfato de calcio triple como fuentes de nitrógeno y fósforo, diluidos en el agua de riego; una segunda y tercera fertilización se hizo a los 240 y 420 ddt con la misma dosis de fertilizante. Se utilizaron dos tratamientos de humedad del suelo: riego, donde el contenido hídrico edáfico se mantuvo cercano a CC desde la fecha de trasplante (20 dds) hasta los 406 ddt (R1) y desde los 406 ddt hasta la conclusión de experimento (798 ddt) (R2), y sequía, donde la aplicación de agua a lasplantas se suspendió enunprimer periodo por61días[345a406 ddt; marzoamayo2018; (S1)] y un segundo periodo por 68 días [620-688 ddt; noviembre 2018 a febrero 2019; (S2)]. El riego de recuperación (RR) se aplicó a las plantas al término de los tratamientos de S1 (406 ddt, RR1) y S2 (688 ddt, RR2).

Se hicieron cortes en la parte aérea de la planta cada cinco semanas en el periodo otoñoinvierno y cada cuatro semanas en el periodo primavera-verano, a una altura de 5 cm sobre el nivel del suelo. En cada corte se midió la altura de planta (AP, cm) desde la superficie del suelo hasta la última hoja expuesta en el tallo más alto con una regla graduada a 5 mm; además, se contó el número total de tallos (NT) y se determinó la relación hoja:tallo (H:T) en una submuestra de cuatro tallos secundarios, al dividir el peso seco de las hojas (PSH) entre el peso seco del tallo (PST), obtenido después de un periodo de secado de 48 h a una temperatura de 65 °C (H:T = PSH / PST). El rendimiento de materia seca total (RMST, g) o biomasa aérea (BM) se calculó al sumar el peso seco de hojas y tallos secundarios de la submuestra utilizada para determinar la relación H:T, y el peso seco de las hojas y tallos secundarios de la muestra remanente de la planta. El rendimiento de materia seca de hojas (RMSH, g) se representó por el peso seco de hojas. La eficiencia en el uso de la radiación (EUR, g MS MJ-1) se calculó al dividir el RMST entre la radiación solar acumulada diariamente (datos obtenidos de la estación meteorológica de la Universidad Autónoma Chapingo) durante el periodo transcurrido entre cortes subsecuentes(16) . La temperatura máxima y mínima del aire en el invernadero se registró diariamente con un termómetro de máxima y mínima de columna de mercurio, marca Taylor modelo 5458P, colocado junto a las plantas a una altura de 2 m sobre el nivel del piso. La temperatura máxima durante el estudio varió de 19 a 40 °C y la mínima de -4 a 15 °C, con un promedio de 32 y 8.5 °C. El contenido hídrico en el suelo se determinó mediante el método gravimétrico cada tercer día con una balanza electrónica marca Tor-Rey, modelo PCR Series. En riego el contenido hídrico del suelo se mantuvo cercano a CC, al agregar agua en cada pesada durante el experimento, mientras en sequía las plantas se condujeron de la misma forma que en riego, excepto, en los periodos en los que se suspendió la aplicación de agua [345 a 406 (S1) y 620688 (S2) ddt] y sólo se registró, la disminución en el peso del suelo en cada tubo de PVC (datos no mostrados).

Rev Mex Cienc Pecu 2023;14(1):39-60 43

La varianza fenotípica (σ�� 2) y sus componentes se estimaron para las variables medidas en todosloscortesenriego(R1 yR2)ysequía(S1 yS2),bajoelmodeloestadísticosiguiente(17,18):

Yijk = µ + FCi + R(FC)ij + Gk + G*FCik + Eijk

Donde, Yijk es el valor de la variable de repuesta; µ es la media general; FCi es el efecto de la fecha de corte; R(FC)ij es el efecto de las repeticiones dentro de la fecha de corte; Gk es el efecto de los genotipos; G*FCik es el efecto de la interacción entre los genotipos y las fechas de corte; Eijk es el error experimental.

Las estimaciones de la varianza fenotípica ysus componentes se hicieron bajo el supuesto de equilibrio de Hardy-Weinberg, equilibrio de ligamiento y ausencia de epistasis(17,19) . Los valores de la varianza fenotípica (σ�� 2) y sus componentes, y la heredabilidad (h2) se obtuvieron a partir de los valores de las esperanzas de los cuadrados medios del análisis de varianza fenotípica y sus componentes de la manera siguiente: σ�� 2 = σ�� 2 + σe 2 + σ��∗���� 2

Donde, σ�� 2 es la varianza aditiva (σA 2= (M1 – M2)/r*f), σe 2 es la varianza ambiental (σ�� 2 = M3) y σ��∗���� 2 es la varianza de la interacción de genotipos*fechas de corte (σ��∗���� 2 = (M2 – M3)/r); M1, M2 y M3 representan las esperanzas de los cuadrados medios, f representa la fecha de corte y r representa al número de repeticiones(17) .

La heredabilidad en sentido estricto (h2) se calculó de acuerdo con la siguiente ecuación: h2 = (σ�� 2) / (σ�� 2). Donde, σ�� 2 es la varianza aditiva y σ�� 2 es la varianza fenotípica.

La varianza de dominancia (���� 2) se estimó(17) al utilizar la varianza aditiva (����) entre familias de medios hermanos(20): ���� 2 = 3 4 ���� 2 +���� 2 y ���� 2 = 1 4 ���� 2

Donde, ���� 2 es la varianza genética y el valor de ���� 2 se obtiene de la siguiente forma(20):

Rev Mex Cienc Pecu 2023;14(1):39-60 44

La heredabilidad en sentido estrecho o estricto (h2) se calculó bajo el supuesto de que las variedades utilizadas es una muestra aleatoria y representativa de la variabilidad genética de la alfalfa, y al considerar que esta es una especie alógama(17). De esta manera, el componente de varianza obtenido de la esperanza matemática del cuadrado medio del factor variedades es un estimador de la varianza aditiva(21) .

Los datos obtenidos se analizaron con el procedimiento GLM(22), versión para Windows 10, con un diseño completamente al azar en arreglo factorial. Las medias de los tratamientos de humedad edáfica, los genotipos y los genotipos dentro de los tratamientos de humedad edáfica se compararon con la diferencia mínima significativa honesta (DMSH, P<0.05) de acuerdo, al modelo siguiente:

Yij = µ + Ti + Gj + T*Gjj + Eij Donde, Yij es elvalor de la variable de respuesta; µ es la media general; Ti representa los tratamientos de humedad del suelo; Gj representa los genotipos; T*Gjj representa la interacción entre los tratamientos de humedad edáfica y los genotipos; Eij es el error experimental(23) .

Resultados y discusión

Los tratamientos de humedad edáfica fueron diferentes (P≤0.01) en rendimiento de materia seca total y materia seca de hojas en los cortes realizados entre los 406 y 798 ddt; diferencias (P≤0.01) en la relación H:T a los 406, 434, 462, 490 y686 ddt; diferencias (P≤0.01) en altura de planta a los 406, 434, 462, 686,742,770 y798 ddt; y diferencias (P≤0.01) en número de tallos yeficiencia en el uso de la radiación entre los 406 y 798 ddt (Cuadro 1). Las variedades mostraron diferencias (P≤0.01) en rendimiento de materia seca total, relación H:T, altura de planta y eficiencia en el uso de la radiación en todos los cortes realizados entre los 112 y 798 ddt; diferencias (P≤0.01) en rendimiento demateriasecade hojas ynúmero detallos entodos los cortes, excepto en los cortes efectuados a los 245, 406, 434, 553 y 588, y 140 ddt. La interacción tratamientos de humedad del suelo*variedades mostró diferencias (P≤0.01) en

Rev Mex Cienc Pecu 2023;14(1):39-60 45 ���� 2 = 1 4 ���� 2

rendimiento de materia seca total a los 112, 140, 210, 406 y 746 ddt y diferencias (P≤0.05) a los 175, 315, 434 y 770 ddt; diferencias (P≤0.01) en rendimiento de materia seca en hojas alos 112,140 y210 ddt, ydiferencias(P≤0.05) alos 175,742 y770ddt; diferencias (P≤0.01) en la relación H:T a los 112, 140, 175, 210, 245, 280, 315, 406, 434, 490, 686, 770 y 798 ddt, diferencias (P≤0.05) a los 588 ddt; diferencias (P≤0.01) en altura de planta a los 112, 245, 280, 490, 742 y 798 ddt, y diferencias (P≤0.05) a los 112, 210, 315 y 406 ddt; diferencias (P≤0.01) en número de tallos a los 175, 315 y 434 ddt, y diferencias (P≤0.05) a los 140, 245, 462, 518 y 686 ddt; y diferencias (P≤0.01) en eficiencia en el uso de la radiación a los 140, 210, y 742 ddt, y diferencias (P≤0.05) a los 112, 175, 315, 434 y 770 ddt.

La comparación del rendimiento de materia seca y sus componentes en riego vs. sequía mostró que el déficit hídrico del suelo en S1 y S2 redujo (P≤0.01) el rendimiento de materia seca total y materia seca en hojas, número de tallos y eficiencia en el uso de la radiación desde los 406 hasta los 798 ddt; las plantas en sequía no recuperaron su capacidad productiva después de experimentar el déficit hídrico en S1 y S2 con respecto a las plantas en riego (R1 y R2), aún después de los riegos de recuperación (RR1 y RR2) (Figura 1). La relación H:T en las plantas bajo sequía fue más alta (P≤0.01) que en riego (R1 yR2), yestas diferencias entre riego y sequía fueron más notorias durante la aplicación de la sequía (S1 y S2). La altura de planta en S1 y S2 fue menor (P≤0.01) que en riego (R1 y R2) y posteriormente recuperó su capacidad de crecimiento con respecto a su comportamiento en riego. La sobrevivencia de la alfalfaatravésdeperiodosdedéficithídrico encondicionesdecampodependedeladuración e intensidad de la sequía, el genotipo, el tipo de suelo (capacidad hídrica del suelo y profundidad del sistema radical) y el ambiente (salinidad y temperatura); su sobrevivencia a periodos cortos (2-3 semanas) sin riego se refleja en su alta capacidad de recuperación al recibir riego nuevamente y producir rendimientos normales en los años subsecuentes(24) . La mayor capacidad de recuperación de la alfalfa al recibir agua después de experimentar periodos de déficit hídrico(24) , puede deberse a que las plantas que crecen en condiciones de campo tienen mayor acceso a la humedad y nutrientes en el perfil del suelo, a diferencia de las plantas que crecen en condiciones de invernadero en macetas o tubos de PVC, donde las raíces de las plantas crecen en un ambiente limitado en volumen de suelo, humedad y nutrientes; lo que se refleja en una reducción en la acumulación de biomasa aérea debida a una disminución en la conductancia estomática, transpiración y asimilación(3) Los altos valores en la relación H:T en sequía, pudieron deberse a una menor partición de asimilados al tallo con respecto a la hoja; las plantas sometidas a estrés hídrico muestran algunos cambios morfológicos en respuesta al déficit hídrico, al reducir la pérdida o aumentar la absorción de agua para mantener el estatus hídrico del tejido(25) La altura de planta fue la única característica morfológica que mostró capacidad de recuperación después de la aplicación de agua (RR1 y RR2), al alcanzar valores similares a los observados en las plantas bajo riego; el déficit hídrico del suelo afecta diferentes características morfológicas de las plantas como altura de planta, diámetro del tallo, número, tamaño y área de las hojas, producción demateriaseca,partición de asimilados, producción de flores yfrutos, ymadurez

Rev Mex Cienc Pecu 2023;14(1):39-60 46

fisiológica

(25) .

Figura 1: Rendimiento de materia seca total (a) y materia seca de hojas (b), relación hoja:tallo (c), altura de planta (d), número de tallos (e) y eficiencia en el uso de la radiación (f) en 18 cortes en riego (R1 y R2) y sequía (S1 y S2), promedio de 10 variedades de alfalfa

Montecillo, Texcoco, Estado de México [R1= Riego de recuperación en R1; R2=Riego de recuperación en R2; *(P≤0.05); **(P≤0.01); ns (no significativo)].

Por otro lado, en riego (R1 yR2) se observó una amplia variabilidad (P≤0.01) entre genotipos para rendimiento de materia seca total (Figuras 2a y 3a), relación H:T (Figuras 2c y 3c), altura de planta (Figuras 2d y 3d) y eficiencia en el uso de la radiación (Figuras 2f y 3f) en todos los cortes en R1 (112 a 434 ddt) y R2 (462 a 798 ddt). Las variedades Genex, Atlixco, Júpiter, Oaxaca, San Miguel y Milenia produjeron mayor (P≤0.01) rendimiento de materia

Rev Mex Cienc Pecu 2023;14(1):39-60 47

seca total que las otras variedades en todos los cortes en R1 (Figura 2a), y sólo las variedades Genex, Atlixco, Júpiter y Milenia mostraron alto (P≤0.01) rendimiento de materia seca total en R2 (Figura 3a). El alto rendimiento de materia seca total en las variedades Genex, Atlixco, Júpiter, Oaxaca, San Miguel y Milenia (Figura 2a) estuvo acompañado de alto (P≤0.01) rendimiento de materia seca de hojas (Figura 2b), altura de planta (Figura 2d), número de tallos (Figura 2e) y eficiencia en el uso de la radiación (Figura 2f) en R1. El alto (P≤0.01) rendimiento de materia seca total de las variedades Genex, Atlixco, Júpiter y Milenia (Figura 3a) también estuvo acompañado por un alto (P≤0.01) rendimiento de materia seca de hojas (Figura 3b), altura de planta (Figura 3d), número de tallos (Figura 3e) y eficiencia en el uso de la radiación (Figura 3f) en R2. Las variedades Victoria, Aragón y San Isidro (Figura 2c), y Aragón y San Isidro (Figura 3c) mostraron mayor (P≤0.01) relación H:T que las otras variedades en R1 y R2 En un estudio con 11 cultivares de alfalfa en condiciones de riego en invernadero, se determinó que las variedades BCB, ALF y AFR mostraron mayor rendimiento de materia seca total, materia seca de raíces, tasa de elongación del tallo, contenido relativo de agua y diámetro de raíces que las otras variedades de alfalfa(6) . Las variedades F 1412-02, F 1535-03, Roxana y F 2007-08 y F 1414-02, F 1711-05, F 1715-05 y F 2010-08 sobresalieron entre un grupo de 74 genotipos en condiciones de riego en invernadero, al producir mayor rendimiento de materia seca total, altura de planta y número de tallos que el resto de las variedades(4) .

Rev Mex Cienc Pecu 2023;14(1):39-60 48

Figura 2: Rendimiento de materia seca total (a) y materia seca de hojas (b), relación hoja tallo (c), altura de planta (d), número de tallos (e) y eficiencia en el uso de la radiación (f) en nueve cortes en riego (R1), para 10 variedades de alfalfa

R1= Riego en el periodo de corte de 112 a 406 ddt.

Rev Mex Cienc Pecu 2023;14(1):39-60 49

Figura 3: Rendimiento de materia seca total (a) y materia seca de hojas (b), relación hoja tallo (c), altura de planta (d), número de tallos (e) y eficiencia en el uso de la radiación (f) en nueve cortes en riego (R2), para 10 variedades de alfalfa

R2= Riego en el periodo de corte de 462 a 798 ddt.

En sequía también se observó una variabilidad amplia (P≤0.01) entre genotipos para rendimiento de materia seca total (Figuras 4a y 5a), relación H:T (Figuras 4c y 5c), altura de planta (Figuras 4d y 5d) y eficiencia en el uso de la radicación (Figuras 4f y 5f) en todos los cortes en S1 (112 a 406 ddt) y S2 (462 a 798 ddt). Las variedades Genex, Atlixco, Júpiter, Oaxaca, San Miguel y Milenia produjeron mayor (P≤0.01) rendimiento de materia seca total que las otras variedades en todos los cortes en S1 (Figura 4a), y sólo las variedades Genex, Atlixco, Júpiter y Milenia mostraron alto (P≤0.01) rendimiento de materia seca total en S2

Rev Mex Cienc Pecu 2023;14(1):39-60 50

(Figura 5a). El rendimiento alto de materia seca total de las variedades Atlixco, Júpiter, Oaxaca, San Miguel y Milenia (Figura 4a) estuvo acompañado de mayor (P≤0.01) rendimiento de materia seca de hojas (Figura 4b), altura de planta (Figura 4d), número de tallos (Figura 4e) y eficiencia en el uso de la radiación (Figura 4f) en R1. En R2 el mayor (P≤0.01) rendimiento de materia seca total de las variedades Genex, Atlixco, Júpiter y Milenia (Figura 5a) también estuvo acompañado de alto (P≤0.01) rendimiento de materia seca de hojas (Figura 5b), altura de planta (Figura 5d), número de tallos (Figura 5e) y eficiencia en el uso de la radiación (Figura 5f). Las variedades Milenia, Victoria, Cuf-101, Aragón ySanIsidro(Figura4c), yVictoria,Aragón ySan Isidro(Figura5c)mostraronmayor (P≤0.01) relación H:T que las otras variedades en R1 y R2 Otros estudios en diferentes variedades de alfalfa bajo sequía en invernadero, detectaron genotipos que reducen menos la elongación del tallo, tasa relativa de crecimiento y biomasa aérea con respecto a riego, además de mantener mayor capacidad del crecimiento de las raíces, contenido relativo de agua, contenido de clorofila y eficiencia en el uso del agua(6). La variedad Gold Queen produjo mayor rendimiento de materia seca y carbohidratos hidrosolubles, y fue más resistente a sequía que la variedad Suntory en condiciones de campo; la sequía disminuyó el contenido de proteína cruda y aumentó la fracción de fibra en respuesta a la deficiencia hídricaenlasdos variedades dealfalfa(7) . Los genotipos Amerist (EE.UU.),Sardi10 ySiriver (Australia), y Melissa (Francia) mostraron mayor tolerancia a sequía que otras variedades de alfalfa, debido a que produjeron hojas más delgadas, acumularon más prolina y potasio, y mantuvieron una mayor eficiencia en el uso del agua en condiciones de deficiencias hídricas(26) . Las variedades Aragón y San Isidro mostraron consistentemente altos valores promedio para la relación H:T en riego y sequía; esta característica morfológica de la planta es altamente apreciada como un estimador de la calidad del forraje y puede ser utilizada para mejorar el rendimiento, y calidad de la materia seca en líneas, familias de medios hermanos o clones en poblaciones amplias, al considerar sus altos valores heredabilidad en sentido estrecho (h2=0.75)(27) .

Rev Mex Cienc Pecu 2023;14(1):39-60 51

Figura 4: Rendimiento de materia seca total (a) y materia seca de hojas (b), relación hoja tallo (c), altura de planta (d), número de tallos (e) y eficiencia en el uso de la radiación (f) en nueve cortes en sequía (S1), para 10 variedades de alfalfa

S1= Sequía en el periodo de cortes de 112 a 406 ddt.

Rev Mex Cienc Pecu 2023;14(1):39-60 52

Figura 5: Rendimiento de materia seca total (a) y materia seca de hojas (b), relación hoja tallo (c), altura de planta (d), número de tallos (e) y eficiencia en el uso de la radiación (f) en nueve cortes en sequía (S2), para 10 variedades de alfalfa

S2= Sequía en el periodo de cortes de 462 a 798 ddt.

Lavarianzafenotípicapararendimientototaldemateriaseca ymateriasecadehojas,relación H:T, altura de planta, número de tallos y eficiencia en el uso de la radiación en riego (R1 y R2) fue mayor (P≤0.05) que en sequía (S1 y S2). La varianza fenotípica para el rendimiento total de materia seca y sus componentes fue mayor (P≤0.05) que los demás componentes de varianza en riego y sequía. No obstante, la varianza ambiental contribuyó en mayor proporción (P≤0.05) a la varianza fenotípica que la varianza genética en ambos; riego y sequía. La varianza genética aditiva fue mayor (P≤0.05) que la varianza genética de

Rev Mex Cienc Pecu 2023;14(1):39-60 53

dominancia para todos los caracteres medidos en las plantas en riego y sequía. La varianza de la interacción fue menor que las varianzas fenotípica, ambiental y genética aditiva, para todos los caracteres medidos en las plantas en riego y sequía (Cuadro 2). En alfalfa autotetraploide se obtuvieron resultados similares al estimar los componentes de varianza; la varianza de dominancia fue mucho menor que la varianza aditiva para el rendimiento de materia seca ysus componentes(28). La varianza aditiva fue significativamente mayor de cero y la varianza genética, para el rendimiento de materia seca total fue principalmente aditiva enunapoblaciónF1 dealfalfaencondicionescontroladasdecrecimiento(29).Laheredabilidad (h2) fue de baja para rendimiento de materia seca de hojas a moderada para el rendimiento de materia seca total, relación H:T, altura de planta, número de tallos y eficiencia en el uso de la radiación en riego y sequía (Cuadro 2). Estos valores de heredabilidad son similares a los obtenidos para la biomasa aérea y altura de planta en alfalfa anual (Medicago sativa subesp. falcata) en condiciones de campo(28) , y podrían ser útiles en el mejoramiento del rendimiento de materia seca de alfalfa con el apoyo de la selección genómica(27) .

Cuadro 2: Parámetros genéticos estimados para rendimiento de materia seca total (RMST) y materia seca de hojas (RMSH), relación hoja:tallo (H:T), altura de planta (AP), número de tallos (NT) y eficiencia en el uso de la radiación (EUR) en riego (R1 y R2), y sequía (S1 y S2), promedio de 10 variedades de alfalfa

Parámetros genéticos RMST RMSH H:T AP NT EUR Riego R1 y R2

Varianza fenotípica (���� 2) 3.6 (0.7) 0.5 (0.1) 0.01 (0.001) 86.4 (7.6) 16.0 (1.6) 0.021 (0.001)

Varianza genotípica (���� 2) aditiva (���� 2) 1.2 (0.4) 0.1 (0.05 0.005 (0.0003) 31.6 (1.2) 4.5 (0.8) 0.01 (0.001) de dominancia (���� 2) 0.3 0.02 0.001 7.9 1.1 0.002 de interacción (����∗���� 2 ) 0.7 0.06 0.002 12.3 2.5 0.002

Varianza ambiental (���� 2) 1.7 (0.4) 0.4 (0.08) 0.004 (0.0008) 42.6 (6.9) 9.0 (1.6) 0.01 (0.001)

Heredabilidad (h2) 0.3 (0.04) 0.2 (0.04) 0.4 (0.04) 0.4 (0.03) 0.3 (0.04) 0.4 (0.04) Sequía S1 y S2

Varianza fenotípica (���� 2) 1.5 (0.2) 0.2 (0.03) 0.01 (0.001) 61.6 (5.8) 11.5 (0.8) 0.015 (0.007)

Varianza genotípica (���� 2) aditiva (���� 2) 0.5 (0.02) 0.04 (0.004) 0.004 (0.0003) 20.4 (2.0) 4.1 (0.3) 0.046 (0.005) de dominancia (���� 2) 0.1 0.01 0.001 5.1 1.0 0.001 de interacción (����∗���� 2 ) 0.2 0.04 0.004 13.7 1.8 0.002

Varianza ambiental (���� 2) 0.8 (0.2) 0.1 (0.03) 0.001 (0.0003) 27.5 (4.9) 5.5 (0.8) 0.008 (0.2) Heredabilidad (h2) 0.3 (0.04) 0.2 (0.04) 0.4 (0.03) 0.3 (0.04) 0.4 (0.04) 0.3 (0.04)

El análisis de componentes mayores (CP1 y CP2) identificó dos componentes que explican la mayor proporción de la variación total (75.8 %) mostrada en el experimento. El CP1 explicó el 56.2 % de la variación y tuvo correlación positiva con el rendimiento de materia seca total (r= 0.52), rendimiento de materia seca de hojas (0.50), número de tallos (r= 0.42), eficiencia en el uso de la radiación (r= 0.40) y altura de planta (r= 0.34), y correlación negativa con la relación H:T (r= -0.19). El CP2 explicó sólo el 19.6 % de la variabilidad observada y tuvo correlación positiva con la relación H:T (r= 0.78) y rendimiento de materia

Rev Mex Cienc Pecu 2023;14(1):39-60 54

seca de hojas (r=0.31), y correlación negativa con altura de planta (r= -0.49) (Figura 6). Adicionalmente, el rendimiento de materia seca total se relacionó positivamente con el número de tallos y el rendimiento de materia seca de hojas, y negativamente con altura de planta; la altura de planta se relacionó negativamente con la relación H:T. La variabilidad observada para rendimiento de materia seca y sus componentes en el presente estudio fue similar a la observada en un grupo de 27 poblaciones, y cultivares de alfalfa en condiciones decampo, donde el CP1 contribuyó con el 58.2 %dela variabilidad total ymostróasociación positiva con rendimiento de materia seca y verde, vigor, hábito de crecimiento, regeneración de la planta y ancho del foliolo central(30). Otros resultados en alfalfa con riego y secano en campo mostraron un CP1 con 54.3 % de la variabilidad total y asociación positiva con el diámetro de raíces laterales y número de raíces laterales o ramificadas(31). Es interesante señalar la similitud en los valores observados para el CP1 y la variabilidad entre genotipos en estos estudios, y los caracteres de la planta que tuvieron mayor asociación positiva con dicho componente, sobre todo con el rendimiento de materia seca total.

Figura 6: Plano biplot del rendimiento de materia seca vs. rendimiento de materia seca total (RMST), rendimiento de materia seca de hojas (RMSH), relación H:T (H:T), número de tallos (NT), altura de planta (AP) y eficiencia en el uso de la radiación (EUR)en riego (R1 y R2) y sequía (S1 y S2), en promedio de 10 variedades de alfalfa en condiciones de invernadero

Rev Mex Cienc Pecu 2023;14(1):39-60 55

Conclusiones e implicaciones

La sequía disminuyó el rendimiento de materia seca total y sus componentes, y las plantas bajo condiciones de déficit hídrico edáfico no recuperaron su capacidad productiva después de experimentar las deficiencias hídricas del suelo, aún después del riego de recuperación. En contraste, la relación H:T fue más alta en las plantas en sequía que en riego y la altura de planta fue el único componente del rendimiento que recuperó su capacidad de crecimiento después del riego de recuperación. El déficit hídrico edáfico también redujo la varianza fenotípica para el rendimiento de materia seca total ysus componentes; la varianza ambiental fue mayor que la varianza genética en riego y sequía. La varianza aditiva fue mayor que la varianza de dominancia para todos los caracteres medidos en riego y sequía. El rendimiento de materia seca total, relación H:T, altura de planta, número de tallos y eficiencia en el uso de la radiación tuvieron mayor heredabilidad en riego y sequía. El rendimiento de materia seca de hojas, número de tallos, eficiencia en el uso de la radiación y altura de planta, se relacionaron positivamente con el rendimiento de materia seca total. Las variedades más productivas podrían utilizarse para la producción de forraje en áreas con escasez de agua y/o como líneas parentales para el mejoramiento del rendimiento de forraje en los programas de selección. Futurotrabajo deinvestigación enestetema,requiereconfirmaciónencondiciones de campo.

Literatura citada:

1. Guitjens JC. Alfalfa. In: Stewart BA, Nielsen DR, editors. Irrigation of agricultural crops. American Society of Agronomy, Inc. Madison, Wisconsin USA; Monograph Number 30 in the series of Agronomy; 1990:537-596.

2. Lauriault L, Marsalis M, Contreras-Govea F, Angadi S. Managing alfalfa during drought. Cooperative Extension Service, College of Agricultural and Environmental Sciences, New Mexico State University Las Cruces, New Mexico; 2009 (Circular 646):4.

3. Luna-Guerrero MJ, López-Castañeda C, Quero-Carrillo AR, Herrera-Haro JG, OrtegaCerrilla ME, Martínez-Hernández PA. Water relations and gas exchange in lucerne under drought conditions. Rev Mex Cienc Agríc 2020; Special Publication Number 24:81-92.

4. Petcu E, Schitea M, Drăgan L, Bǎbeanu N. Physiological response of several alfalfa genotypes to drought stress. Rom Agric Res 2019;36:107-118.

5. Blum A. Crop responses to drought and the interpretation of adaptation. Plant Grow Reg 1996;20:135–148.

Rev Mex Cienc Pecu 2023;14(1):39-60 56

Pecu 2023;14(1):39-60

6. Anower MR, Boe A, Auger D, Mott IW, Peel MD, Xu L, Kanchupati P, Wu Y. Comparative drought response in eleven diverse alfalfa accessions. J Agron Crop Sci 2017;203:1-13.

7. Liu Y, Wu Q, Ge G, Han G, Jia Y. Influence of drought stress on alfalfa yields and nutritionalcomposition.BMCPlantBiology2018;18(13):1-9.doi:10.1186/s12870-0171226-9.

8. AnnicchiaricoP,Pecetti L, Tava A.Physiological andmorphological traits associated with adaptation of lucerne (Medicago sativa) to severely drought-stressed and to irrigated environments. Ann Appl Biol 2013; 162:27–40. doi:10.1111/j.17447348.2012.00576.x.

9. Huang Z, Liu Y, Cui Z, Fang Y, He H, Liu BR, Wu GL Soil water storage deficit of alfalfa (Medicago sativa) grasslands along ages in arid area (China). Field Crop Res 2018;221:1-6.

10. Falconer DS. Introducción a la genética cuantitativa. México: Cía. Editorial Continental, SA de CV: 1984.

11.HillJ,BeckerHC,TigerstedtPMA.Quantitativeandecologicalaspects ofplantbreeding. London: Chapman & Hall; 1998.

12. Bellague D, Hammedi-Bouzina MM, Abdelguerfi A. Measuring the performance of perennial alfalfa with drought tolerance indices. Chil J Agric Res 2016;76(3):273-284. doi:10.4067/ S0718-58392016000300003.

13.Márquez-Ortiz JJ, Lamb JFS,Johnson LD, Barnes DK, Stucker RE.Heritabilityof crown traits in alfalfa. Crop Sci 1999;39:38-43.

14. Luna-Guerrero MJ, López-Castañeda C, Hernández-Garay A. Genetic improvement of aerial alfalfa biomass and its components: half-sib family selection. Rev Mex Cienc Pecu 2020;11(4):1126-1141. doi.org/10.22319/rmcp.v11i4.5344.

15. García E. Modificaciones al sistema de clasificación climática de Köppen. Serie Libros Núm. 6, Instituto de Geografía, UNAM. México, DF; 2004.

16. Luna-Guerrero MJ, López-Castañeda C, Hernández-Garay A, Martínez-Hernández PA, Ortega-Cerrilla ME. Evaluación del rendimiento de materia seca y sus componentes en germoplasma de alfalfa (Medicago sativa L.). Rev Mex Cienc Pecu 2018;9(3):486-505. doi.org/10.22319/rmcp.v9i3.4440.

17. Molina-Galán JD. Introducción a la genética de poblaciones y cuantitativa (algunas implicaciones en genotecnia). México, DF: AGT Editor, SA; 1992.

Rev Mex Cienc
57

Mex Cienc Pecu 2023;14(1):39-60

18. Márquez-Sánchez F, Sahagún-Castellanos J. Estimation of genetic variances with maternal half-sib families. Maydica 1994;39(3):197-201.

19. Melendres-Martínez JI, Valdivia-Bernal R, Lemus-Flores C, Medina-Torres R, GarcíaLópez M, Ortiz-Caton M, et al. Estimación de parámetros genéticos de maíz bajo mejoramientoporselecciónrecíprocarecurrente.RevMexCiencAgríc2018;9(7):13271337.

20. Galicia-Juárez M. Varianza genética y mapeo molecular de rendimiento y calidad nutricional en familias de medios hermanos en Medicago sativa [tesis maestría]. Texcoco, México: Colegio de Postgraduados; 2012.

21.HillJ,BeckerHC,TigerstedtPMA.Quantitativeandecologicalaspects ofplantbreeding. London: Chapman & Hall; 1998.

22. SAS (Statistical Analysis System), Version 9.4 para Windows. SAS Institute Inc., Cary, NC, USA; 2012.

23. Hinkelmann K, Kempthorne O. Design and analysis of experiments. Volume 1: Introduction to experimental design. USA: A John Wiley and Sons, Inc; 2008.

24. Orloff S, Putnam D, Bali K. Drought strategies for alfalfa. Agriculture and Natural Resources, UC, USA. Publication 8522; 2015:1-9 (http://anrcatalog.ucanr.edu/).

25. Anjum SA, Ashraf U, Zohaib A, Tanveer M, Naeem M, Ali I, Tabassum T, Nazir U. Growth and developmental responses of crop plants under drought stress: a review. Zemdirbyste-Agriculture 2017;104(3):267-276. doi:10.13080/z-a.2017.104.034.

26. Benabderrahim MA, Hamza H, Haddad M, Ferchichi A. Assessing the drought tolerance variability in Mediterranean alfalfa (Medicago sativa L.) genotypes under arid conditions. Plant Biosystems 2015; 149 (2):395-403. doi.org/10.1080/11263504.2013.850121.

27. Annicchiarico P. Alfalfa forage yield and leaf/stem ratio: narrow-sense heritability, genetic correlation, and parent selection procedures. Euphytica 2015;205(2):409–420. doi:10.1007/s10681-015 1399-y.

28. Riday H, Brummer EC. Narrow sense heritability and additive genetic correlations in alfalfa subsp. falcata. J Iowa Academy Sci 2007;114(1-4):28-34.

29. Bowley SR, Christie BR. Inheritance of dry matter yield in a heterozygous population of alfalfa. Can J Plant Sci 1981;61:313-318.

58
Rev

Rev Mex Cienc Pecu 2023;14(1):39-60

30. Tucak M, Popović S, Ćupić T, Šimić G, Gantner R, Meglić V. Evaluation of alfalfa germplasm collection by multivariate analysis based on phenotypic traits. Rom Agric Res 2009;26:47-52.

31. Odorizzi A, Basigalup D, Arolfo V, Balzarini M. Análisis de la variabilidad de caracteres de raíz en poblaciones de alfalfa (Medicago sativa L.) con alto número de raíces laterales. AgriSci 2008;25(2):65-73.

59

Rev Mex Cienc Pecu 2023;14(1):39-60

Cuadro 1: Factores de variación, grados de libertad (GL) y significancia del rendimiento de materia seca total (RMST) y materia seca de hojas (RMSH), relación hoja:tallo (H:T), altura de planta (AP), número de tallos (NT) y eficiencia en uso de la radiación (EUR) en riego (R1) y sequía (S1) (112-434 ddt), y en R2 y S2 (462-798 ddt)

Característica GL 112 140 175 210 245 280 315 406 434 462 490 518 553 588 686 742 770 798 RMST (g MS planta-1)

A 1 ns ns ns ns ns ns ns ** ** ** ** ** ** ** ** ** ** **

B 9 ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** **

A*B 9 ** ** * ** ns ns * ** * ns ns ns ns ns ns ** * ns RMSH (g MS planta-1)

A 1 ns ns ns ns ns ns ns ** ** ** ** ** ** ** ** ** ** **

B 9 ** ** ** ** ns ** ** ns ns ** * ** ns ns * ** ** **

A*B 9 ** ** * ** ns ns ns ns ns ns ns ns ns ns ns * * ns Relación H:T

A 1 ns ns ns ns ns ns ns ** ** ** ** ns ns ns ** ns ns ns

B 9 ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** **

A*B 9 ** ** ** ** ** ** ** ** ** ns ** ns ns * ** ns ** **

AP (cm)

A 1 ns ns ns ns ns ns ns ** ** ** ns ns ns ns ** ** ** ** B 9 ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** **

A*B 9 ** * ns * ** ** * * ns ns ** ns ns ns ns ** ns ** NT

A 1 ns ns ns ns ns ns ns ** ** ** ** ** ** ** ** ** ** **

B 9 ** ns ** ** ** ** ** * ** ** ** ** ** ** ** ** ** **

A*B 9 ns * ** ns * ns ** ns ** * ns * ns ns * ns ns ns EUR (g MS MJ-1)

A 1 ns ns ns ns ns ns ns ** ** ** ** ** ** ** ** ** ** ** B 9 ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** **

A*B 9 * ** * ** ns ns * ns * ns ns ns ns ns ns ** * ns

A=Tratamientos de humedad edáfica (Riego=R1 y R2, y Sequía=S1 y S2); B=Genotipos; A*B Interacción tratamientos de humedad edáfica*genotipos; *(P≤0.05); **(P≤0.01); ns (no significativo). S1 (345-406 ddt) y S2 (620-688 ddt).

60

https://doi.org/10.22319/rmcp.v14i1.6162

Artículo

Estimación de masa de forraje en una pradera mixta por aprendizaje automatizado, datos del manejo de la pradera y meteorológicos satelitales

Aurelio Guevara-Escobar a

Mónica Cervantes-Jiménez a*

Vicente Lemus-Ramírez b

Adolfo Kunio Yabuta-Osorio b

José Guadalupe García-Muñiz c

a Universidad Autónoma de Querétaro Facultad de Ciencias Naturales. 76230 Juriquilla, Santiago de Querétaro, Querétaro, México.

b Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Centro de Enseñanza, Investigación y Extensión en Producción Animal en Altiplano CEIEPAA. Querétaro, México.

c Universidad Autónoma Chapingo Departamento de Zootecnia, Posgrado enProducción Animal. Estado de México, México.

* Autor de correspondencia: monica.cervantes@uaq.mx

Resumen:

Medir la masa de forraje (MF) en la pradera, antes del pastoreo, es fundamental para determinar la asignación diaria de forraje en sistemas pastoriles de producción animal. La MF se estima por corte de forraje en áreas conocidas, utilizando ecuaciones alométricas, o con el uso de sensores de percepción remota (PR); sin embargo, la exactitud y practicidad de los distintos métodos para estimar la MF, es variable. El objetivo fue obtenermodelospredictivosusandovariablesambientales ydelmanejodelapraderapara predecir la MF. Se ajustaron modelos de regresión para estimar la MF con base en variables del manejo de la pradera (MP) o mediciones obtenidas por PR, como reflectancia, temperatura del aire y lluvia. Por tres años se estudió una pradera mixta pastoreada con bovinos productores de carne. Con 80 % de datos se modeló por mínimos

61

cuadrados ordinarios (OLS) o por algoritmos de aprendizaje automatizado (ML). El 20 % restante de los datos se utilizó para validar los modelos usando el coeficiente de determinación y el sesgo promedio entre valores estimados y observados. El modelo base de estudio fue la relación entre la altura de la pradera antes del pastoreo y la MF de este modeloseajustó usando OLS; la r2 fue0.43.Cuando seajustaron modelos queincluyeron variables del MP, la r2 fue 0.45 para OLS y 0.63 para ML. Al ajustar modelos con variables de MP yPR, lar2 fue 0.71 para OLS y0.96 para ML. Los ensambles de modelos ajustados con ML redujeron el sesgo de estimados de MF de la pradera examinada. En general, los modelos de ML representaron mejor la relación entre altura de la pradera antes del pastoreo yMF que los de modelos de OLS, al ajustarlos con variables de manejo de la pradera y con información de PR. Los modelos de ML pueden usarse como herramienta para la toma de decisiones diaria en sistemas productivos pastoriles.

Palabras clave: Alfalfa, Forraje, Lluvia, Temperatura, Sensores remotos.

Recibido: 08/03/2022

Aceptado: 18/07/2022

Introducción

Laproducciónanimal en pastoreodependedelatasadeacumulación dela masadeforraje (MF), así como de la asignación oportuna de una carga animal adecuada para aprovechar la MF; otros aspectos importantes son la calidad nutricia y la estacionalidad en la tasa de acumulación de la MF. El manejo rentable de una pradera a través del pastoreo directo implica, entre otras cosas, implementar un manejo del pastoreo sin comprometer el rebrote de la cubierta vegetal, así como conocer de forma precisa la MF en la pradera antes y después del pastoreo(1). Tradicionalmente, la MF se mide directamente con cortes de forraje en cuadrantes de área conocida, distribuidos de manera espacialmente representativa y en un número suficiente que represente la variabilidad de la cubierta vegetal en la pradera(2,3). El corte de cuadrantes es laborioso y por eso se han desarrollado métodos y dispositivos para la estimación indirecta de la MF(4-6). La altura del dosel de la pradera, medida con una regla graduada (sward stick) es útil para representar la MF, aunque la relación puede ser diferente en función de la composición botánica, densidad del dosel de la pradera y estación del año(7-9) . La altura del forraje comprimido medida con un plato de aluminio (rising plate meter), estima la MF considerando la densidad del dosel y es una práctica muy común a nivel de granja en países como Nueva Zelanda(2) La relación entre altura del dosel y MF en praderas de pasto ballico y trébol blanco es bien conocida y de aplicación rutinaria en Nueva Zelanda(10); para praderas con otras especies forrajeras como la alfalfa, se necesita más investigación para determinar la relación entre altura del dosel y MF(8) .

Rev Mex Cienc Pecu 2023;14(1):61-77 62

La percepción remota por satélites orbitales (PR) mide la reflectancia espectral, la proporción de la energía incidente reflejada por la superficie terrestre en distintas longitudes de onda; estas mediciones se han asociado a los procesos de actividad de la vegetación(11). Con la información de PR también es posible estimar variables ambientales como la temperatura, la precipitación pluvial, y otras(12). La amplia disponibilidad y acceso libre de productos de PR es una oportunidad para explorar la dinámicade los cultivos yestablecer relaciones conparámetrosproductivos, como laMF. Las series de tiempo disponibles para distintos productos de PR permiten hacer estudios retrospectivos, lo cual es valioso para evaluar prácticas de manejo de praderas y estudios regionales de pastizales.Sin embargo, laescala espacialdemediciónes gruesaen algunos sensores PR y es una desventaja importante en estos estudios

Recientemente se han incorporado al análisis de regresión una variedad de algoritmos de aprendizaje automatizado o machine learning (ML) y son una alternativa a la regresión por mínimos cuadrados ordinarios (OLS). La fotosíntesis en ecosistemas, nombrada productividad primaria bruta y la productividad primaria neta (descontando las perdidas por respiración) se han modelado con enfoques empíricos o mecanísticos, desde modelos OLS hasta aquellos que simulan los procesos ecofisiológicos a nivel global a partir de PR(13). La productividad primaria neta incluye la partición fotosintética hacia la biomasa aérea y de raíces y por eso no refleja la MF disponible para el pastoreo. Lang et al(14) estimaron la producción del pastizal árido usando mediciones de sensores PR de lluvia, reflectancia espectral obtenida del satélite Landsat 7 y un algoritmo ML con random forest. Utilizando Redes Neurales, otro algoritmo de tipo ML, Chen et al(15) relacionaron la reflectancia espectral medida por el satélite Sentinel-2 y la MF en granjas lecheras de Tasmania en Australia. En estos estudios el coeficiente de determinación (r2) en distintos modelos fue entre 0.6 y 0.7. Conceptualmente, es importante incorporar las condiciones de humedad, a corto o mediano plazo para explicar la capacidad de carga del pastizal(16) , ya que el agua es el principal recurso limitante de las plantas en los ambientes áridos y semiáridos. Las condiciones de disponibilidad de agua para las plantas se pueden representar por la precipitación pluvial ocurrida (P), el agua disponible en el suelo o el déficit de vapor en la atmósfera. Sin embargo, para explicar la MF no sólo es importante la P ocurrida en el periodo de acumulación de la MF (mes en que se midió la MF), sino las condiciones de humedad ocurridas en meses precedentes.

En el presente trabajo se examinó la relación entre la MF y la altura del forraje como un punto de partida para comparar otros modelos que usen variables meteorológicas obtenidas por PR o en conjunto con variables representativas de las condiciones de manejo de la pradera (MP); como son los periodos de descanso y ocupación del área de pastoreo o la misma altura del forraje. En particular, se exploró la utilidad de los modelos para predecir la MF en función de condiciones precedentes de lluvia y temperatura en distintas ventanas temporales; por ejemplo, la P acumulada en el mes anterior, en dos meses o tres meses antes de la medición de la MF. El objetivo fue obtener un modelo predictivo de la MF que pueda incorporarse en la planeación del pastoreo. Con este

Rev Mex Cienc Pecu 2023;14(1):61-77 63

propósito se usaron tres años de mediciones de una pradera mixta de alfalfa y pasto, pastoreada con ganado productor de carne.

Material y métodos

Sitio

El trabajo se efectuó en el Centro de Enseñanza, Investigación yExtensión en Producción Animal en el Altiplano, a cargo de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Nacional Autónoma de México. El sitio se ubica a 20° 36’ 13.88” N, 99° 55’ 02.91” O y altitud de 1,913 msnm. El clima es seco extremoso tipo Ganges sin canícula, BS1 0w(e)g, de acuerdo con los registros climatológicos históricos (1951 a 2006) de la estación meteorológica 22025; la más cercana al sitio donde los promedios anuales de precipitación y temperatura son 458 mm y 23.5 °C(17)

La pradera se estableció en 2004 con una mezcla de 50 % alfalfa (Medicago sativa) y gramíneas como pasto ovillo (Dactylis glomerata), festuca alta (Festuca arundinaceae) y ballico perenne (Lolium perenne). La superficie de pastoreo fue de 19 ha dividida en 16 secciones de igual dimensión y delimitadas a través de cerco eléctrico móvil. Con riego por aspersión bajo la modalidad de pivote central se regó la pradera; no se contó con registros de la lámina o de calendario de riego. El grupo de pastoreo se conformó por 88 vientres de la raza Limousin y sus crías. El tiempo de ocupación en cada división se estableció con base en la estimación de la MF, el análisis químico proximal de muestras de MF yel requerimiento de materia seca (MS) del grupo de pastoreo en turno. El manejo reproductivo fue principalmente con inseminación artificial y pariciones distribuidas a lo largo del año.

Datos

De 2008 a 2010 se obtuvieron 399 observaciones de MF antes del pastoreo del área asignada.CadaobservacióndeMFcorrespondióal inicio deunciclode pastoreodel hato. Las observaciones se consideraron unidades experimentales y cada una consistió de ocho mediciones aleatorias obtenidas con la técnica del marco metálico modificada, para proteger el rebrote de la alfalfa se cortó el forraje a 10 cm de altura en un área de 0.25 m2(18). Las muestras de forraje se deshidrataron en una estufa de aire forzado durante 48 h para determinar el contenido de MS y el dato se expresó en kg MS ha-1. En cada ciclo de pastoreo, se registró la altura de la pradera (A_pradera), la fecha de pastoreo (Dia_pastoreo yMes_pastoreo), el tiempo de ocupación (T_ocupación), días de descanso del área de pastoreo desde el pastoreo anterior (D_descanso), mes del inicio del crecimiento en el ciclo anterior (Mes_ini_crec) y tasa de acumulación de MS promedio mensual (TAF, kg MS ha-1 d-1). Estas variables se denominaron en conjunto como variables de manejo de la pradera (MP).

Rev Mex Cienc Pecu 2023;14(1):61-77 64

Usando la Application for Extracting and Exploring Analysis Ready Samples del Land Processes Distributed Active Archive Center de la National Aeronautics and Space Administration (NASA), se solicitó el producto MCD43A4 versión 6(19). El producto MCD43A4 se genera a partir de las mediciones que efectúan los sensores del ModerateResolution Imaging Spectroradiometer (MODIS) a una resolución espacial de 500 m2 Este producto consiste en siete bandas de reflectancia ajustada por la Bidirectional Reflectance Distribution Function y producido diariamente, los cuales son un promedio móvil de los 16 días contiguos. Se descargaron los datos de ocho pixeles contiguos correspondientes al polígono de coordenadas: 99.93 O, 20.60 N a 99.92 O, 20.61 N. El espectro de radiación (nm) cubierto por las bandas uno a la siete es (b1-b7): 620-670, 841-876, 459-479, 545-565, 1230-1250, 1628-1652 y 2105-2155. Los datos de P fueron del producto 3IMERG versión 6 de la misión Global Precipitation Measurement de la NASA obtenidos a través del portal Giovanni (https://giovanni.gsfc.nasa.gov/giovanni). El dato P (mm) fue el acumulado mensual para la coordenada 99.92 O, 20.60 N; la resolución espacial del 3IMERG es de 10 km2. A través del portal Giovanni también se obtuvo el producto MODIS MOD11A2 versión 6 de temperatura de superficie diaria durante el día (LST_d) y la noche (LST_n).

Para MODIS se determinó la buena calidad de acuerdo con los datos de calidad adjuntos a los productos respectivos. En el lenguaje R(20), se generó un código para encontrar las fechas demedición del MCD43A4máscercanas a lafechademedición dela MF.Usando Qgis v3.16.4(21) y una imagen satelital de Google Maps(22) como plantilla guía, se determinó una capa vectorial correspondiente área de riego por pivote central; el círculo comprendió diferente área de los pixeles muestreados del MCD43A4. Para cada banda de reflectancia se obtuvo el promedio correspondiente al vector usando la función extract del paquete raster.

Generación de variables

La reflectancia en las bandas b2 y b1 se asocian a la capacidad de la vegetación para absorber luz fotosintéticamente activa y existen distintos índices para representar dicha actividad de la vegetación. Se calculó el índice normalizado de la vegetación (NDVI) y el índice mejorado de la vegetación (EVI) usando las bandas espectrales del producto MCD43A4:

Con la serie de tiempo de P se calcularon las siguientes variables: la P acumulada en el mes anterior (P_lag_1), la P acumulada en los dos meses anteriores (P_lag_2) y así sucesivamentehastalaP acumuladaenseis meses anteriores: (P_lag_3,P_lag_4,P_lag_5 y P_lag_6). Para LST_d y LST_n se calculó el promedio del mes anterior (LST_x_avg_1), de los dos meses anteriores (LST_x_avg_2) o de los tres meses

Rev Mex Cienc Pecu
65
2023;14(1):61-77
�������� = ��2 ��1 ��2+��1 1) ������ =25 (��2 ��1) (��2+2.4��1+1) 2)

anteriores (LST_x_avg_3), donde x representa el indicativo d o n, para día o noche. Estas variables representaron el ambiente prevalente antes de medir la MF.

Modelación

El modelo base para comparación fue la regresión lineal simple entre MF y A_pradera. Se exploraron cuatro escenarios de modelación según el tipo de algoritmo: ML u OLS y el tipo de variables disponibles para la modelación: sólo usando variables explicativas de origen PR (ML_PR y OLS_PR) o variables PR y además las de MP (ML_PR_MP y OLS_PR_MP). Los modelos se entrenaron con el 80 % de las observaciones elegidas al azar y se reservó el 20 % para su evaluación. La evaluación del modelo es un concepto de caja negra sobre la relevancia del resultado del modelo(23). Los procedimientos estadísticos se efectuaron en el lenguaje R, el nombre de los paquetes se indica donde es pertinente. Se ajustó un modelo de regresión ortogonal (major axis regression) entre valores observados y valores predichos usando el paquete smatr 3, dado que los valores observados de MF se miden con error(24). Se calculó el coeficiente de determinación (r2), la raíz del cuadrado medio del error (RMSE), los criterios de información de Akaike (AIC) ybayesiano(BIC),ladevianza yelsesgo.Estosindicadorescuantitativos,asícomo la evaluación gráfica son técnicas comúnmente usadas para evaluar modelos matemáticos con fines predictivos(25) .

En el caso de OLS, se usó el valor de inflación de varianza (VIF) para identificar multicolinealidad utilizando las funciones stepAIC y vif(26); 10.0 fue el valor máximo permitido de VIF para retener variables en el modelo de regresión múltiple OLS. El nivel de significancia se fijó en 0.05 para los análisis paramétricos y del cumplimiento de sus supuestos estadísticos de la regresión OLS.

Se generó el modelo ML con la función h2o.automl del paquete H2O(27), éste produce un conjunto de modelos con diferentes realizaciones de algoritmos: deep learning (DL), feedforward artificial neural network (NN), general linear models (GLMs), gradientboosting machine (GBM), extreme gradient-boosting (XGBoost), default distributed random forest (DRF) y extremely randomized trees (XRT). Cada modelo individual se puede usar para predecir la respuesta, pero también para generar dos tipos de ensamble de modelos: uno es a partir de todos los algoritmos usados en los modelos generados, y el segundo tipo de ensamble sólo considera los mejores modelos de cada clase o familia de algoritmos; ambos tipos de ensamble generalmente producen mejores predicciones que los modelos individuales(23) .

La función h2o.automl se ejecutó veinte veces con los siguientes parámetros: a) max_runtime_secs = 500 el tiempo máximo de ejecución antes de entrenar un ensamble final de modelos, b) nfolds = 15, número de pliegues para evaluación cruzada (k-folds), c) seed = un valor entero aleatorio con valor entre 1 y 50; cada una de las ejecuciones usó un valor semilla elegido al azar, d) nthreads = 50, el número de hilos de procesamiento disponibles, e) max_mem_size = 100GB, la memoria RAM disponible en Gigabytes. El

Rev Mex Cienc Pecu 2023;14(1):61-77 66

tiempo aproximado de ejecución fue de 50 min en un equipo con doble procesador Xeon 2680 v4 de 14 núcleos y doble hilo cada uno y 128 GB de memoria RAM.

Con la función h2o.explain, se obtuvo la importancia de las variables en los modelos ML individuales y figuras de dependencia(27). Se utilizó la devianza como estadístico de bondad de ajuste para ordenar los modelos generados. El aprendizaje automatizado tiene dos elementos para el aprendizaje supervisado: la pérdida de entrenamiento y la regularización. La tarea de entrenamiento intenta encontrar los mejores parámetros para el modelo mientras minimiza la función de pérdida de entrenamiento; esta función es el cuadrado medio del error u otras. El término de regularización controla la complejidad del modelo, ayudando a reducir el sobreajuste. El sobreajuste se hace evidente cuando el modelo funciona con precisión durante el entrenamiento, pero la precisión disminuye durante la evaluación del modelo. Un buen modelo necesita un ajuste extenso de parámetros ejecutando el algoritmo varias veces para explorar el efecto en la regularización ylaprecisióndelaevaluación cruzada(28).Enestainvestigación,lafunción delapérdidadeentrenamientofueladevianza,queesunageneralizacióndeverosimilitud de la suma de cuadrados del error; los valores más bajos o negativos indican un mejor desempeño del modelo(29)

Resultados y discusión

El promedio de MF de la pradera fue de 2,134 kg MS ha-1 con un patrón estacional de menor producción en invierno y mayor en verano (Figura 1a). La MF fue diferente entre los tres años 2,121, 1,770 y 2,392 kg ha-1 para 2008 a 2010 (P<0.05). La lluvia fue de 636, 382 y 552 mm, respectivamente. La mayor cantidad de lluvia fue de julio a septiembre; para el año 2010 fue atípico el mes de febrero con 151 mm (Figura 1b) y posiblemente impactando positivamente la MF a partir de marzo en ese año. La lluvia registrada por el producto IMERG en 2008 y 2010 fue superior a la registrada por la estación climatológica más cercana al sitio del estudio; este estimado de lluvia se consideró acertado porque este producto ha mostrado buena concordancia con registros terrestres de precipitación(30). El comportamiento estacional de la MF sugirió un efecto importante de la lluvia, aun tratándose de una pradera irrigada. Abril y mayo fueron los meses con mayor LST_d promedio (Figura 1c). La diferencia entre la LST_d y LST_n fue mayor en los meses de abril a mayo (28.5 y 27.3 °C) y menor en julio a septiembre (17.3, 16.4 y 15.6 °C); lo cual indica la característica extremosa del clima durante la primavera en el sitio de estudio. Estas condiciones ambientales también se reflejaron en cambios estacionales en el manejo de la pradera en los días de descanso, la altura del forraje y la TAF (Figura 2).

Rev Mex Cienc Pecu 2023;14(1):61-77 67

Figura 1: Variables ambientales y producción de masa de forraje de pradera mixta de alfalfa y pastos templados pastoreada con ganado de carne: a) masa de forraje (MF), b) lluvia (P) y c) temperatura de superficie (LST) diurna (●) y nocturna (○)

Figura 2: Manejo de pradera mixta de alfalfa y pastos templados pastoreada con ganado de carne durante 2008 (●), 2009 (○) y 2010 (■): a) Días de descanso antes del pastoreo, b) tasa de acumulación de forraje (TAF) del periodo, c) altura del forraje

En la regresión MA el intercepto fue numéricamente cercano a 0 en el escenario ML_PR_MP y su pendiente fue igual a 1, un modelo con pendiente igual a 1 e intercepto igual a 0 indica buen ajuste. El valor menor del RMSE, AIC, BIC y devianza sugirieron una mejor representación de la MF con el escenario ML_PR_MP (Cuadro 1). En el análisis de devianza la comparación entre dos o más modelos será válida si se ajustan al mismo conjunto de datos, este requisito no se cumplió porque los valores predichos de MF fueron inherentemente distintos para cada modelo generado. La diferencia de devianzas se distribuye aproximadamente como X2 con grados de libertad iguales a la diferencia en el número de parámetros entre los modelos(14), siendo esta diferencia 0 para el caso de los modelos de regresión lineal simple usados para representar la relación entre valores estimados y predichos en cada escenario de modelación. Por estas dos razones la elección del mejor modelo se basó únicamente en el valor numérico de las medidas de

Rev Mex Cienc Pecu 2023;14(1):61-77 68

bondad de ajuste. El peor modelo fue la regresión lineal entre MF y A_pradera, no solo en función de las medias de bondad de ajuste sino también en la representación gráfica de los valores estimados vs observados (Figura 3).

Cuadro 1: Medidas de bondad de ajuste entre valores observados y estimados de MF resultantes de escenarios de modelación usando algoritmos de mínimos cuadrados ordinarios (OLS) o aprendizaje automatizado (ML) en combinación con variables explicativas referentes al manejo de la pradera (MP) únicamente o en conjunto con variables de sensores remotos (MP_PR) OLS_A_pradera OLS_PR OLS_PR_PM ML_PR ML_PR_PM

r2 0.40 0.49 0.67 0.70 0.97

RMSE 361.0 341.0 269.0 259.0 78.0

AIC 734.0 724.0 686.0 691.0 542.0

BIC 738.0 728.0 690.0 695.0 546.0 Devianza 8079684.0 6874194.0 4377078.0 4003784.0 363954.0

Sesgo -3.4 47.1 16.5 -35.1 -1.3

IC 2.5 % -95.9 -39.2 -52.7 -43.5 -21.2

IC 97.5 % 89.0 133.5 85.7 96.4 18.6

MA intercepto -1799.0 -2044.0 -594.0 -735.0 27.0

IC 2.5 % -3386.0 -3395.0 -1137.0 -1257.0 62.0 IC 97.5 % -831.0 -1162.0 -162.0 -316.0 112.0

MA pendiente 1.9 2.0 1.3 1.4 1.0

IC 2.5 % 1.4 1.6 1.1 1.2 0.9

IC 97.5 % 2.6 2.7 1.6 1.6 1.0

r2= coeficiente de determinación; RMSE= raíz del cuadrado medio del error; AIC= criterio de información de Akaike; BIC= criterio de información de Bayesiano; MA= regresión ortogonal (major axis regression); IC= intervalo de confianza.

Rev Mex Cienc Pecu 2023;14(1):61-77 69

Figura 3: Evaluación entre valores observados y estimados de MF usando algoritmos de mínimos cuadrados ordinarios (OLS) o aprendizaje automatizado (ML)

a) OLS, variable predictora altura del forraje; b) escenario OLS_PR; c) escenario OLS_PR_MP; d) escenario ML_PR; e) escenario ML_PR_MP. Coeficiente de determinación (r2), raíz del cuadrado medio del error (RMSE), sesgo y su intervalo de confianza (IC) al 95%.

Las variables TAF y A_pradera de MP fueron las más importantes (Cuadro 2), tanto en los modelos ML como OLS; la variable D_descanso tuvo mucho menor importancia (Cuadro 2). Las variables PR más importantes fueron: LST_n, P, P_lag_3 o P_lag_5, LST_d_avg_3 o LST_n_avg_3; indicando la relevancia de las condiciones ambientales de precipitación y temperatura no sólo del mes en curso, sino de las condiciones precedentes a la medición de la MF. La reflectancia (b1 – b7) y los índices de la vegetación se incorporaron en modelos ML, pero el procedimiento stepwise no los eligió para el OLS. Comparadas con TAF y A_pradera, las variables de reflectancia fueron de bajaimportanciaenlos escenariosPR_MP del ML. Las bandas espectralesdereflectancia fueron más importantes que el EVI y NDVI; este hallazgo coincide con el estudio de MF para praderas mixtas de clima templado(15). Aunque se consideró adecuada la predicción de la biomasa fresca en praderas de Brachiaria con base en el NDVI con r2 =0.73(31)

Rev Mex Cienc Pecu 2023;14(1):61-77 70

Cuadro 2: Variables importantes incluidas en los escenarios usando dos posibles algoritmos: mínimos cuadrados ordinarios (OLS) o aprendizaje automatizado (ML) y dos tipos de variable explicativa: sólo sensores remotos (PR) o variables del manejo de la pradera y las PR (PR_MP)

Aprendizaje automatizado (ML) Mínimos cuadrados ordinarios (OLS)

Sensores remotos (PR)

Variable

Sensores remotos (PR)_Manejo de la pradera (MP) PR PR_MP

LST_d_avg_3 0.081 0.023 0.036 0.027 LST_n_avg_3 0.064 0.017 LST_d 0.036 0.036 LST_n 0.161 0.007 0.060 b1 0.027 0.008 b2 0.034 0.014 b3 0.028 0.003 b4 0.033 0.004 b5 0.044 0.008 b6 0.048 0.010 b7 0.096 0.008 P 0.058 0.008 0.048 P_lag_3 0.099 0.023 P_lag_5 0.270 NDVI 0.001 EVI 0.018 0.001 A_pradera 0.303 0.231 Mes_ini_crec 0.006 0.020 D_descanso 0.101 0.072 TAF 0.417 0.368

Para los modelos ML la suma de la importancia es 1, para los modelos OLS la suma de la importancia es igual a la r2 .

La dependencia parcial que existió entre la predicción de MF y el valor de algunas de las variables de mayor importancia en algunos modelos ML se muestra en la Figura 4, en el escenario ML_PR y en la Figura 5 para el ML_PR_MP. Los ensambles de modelos ML tuvieron menor devianza en comparación con algún algoritmo ML en los dos escenarios y por tanto se consideraron mejores representaciones de la MF. Las figuras de dependencia parcial indican cómo la variable explicativa influye en las predicciones de uno de los modelos oensambles, después de estandarizar el efecto de otras variables. Para modelos de regresión lineal (como el modelo GLM obtenido por ML), la figura es una línea recta con pendiente igual al parámetro del modelo(32). La MF dependió directa y

Rev Mex Cienc Pecu 2023;14(1):61-77 71

proporcionalmente de las variables TAF, A_pradera y D_descanso en diferentes modelos incluso para un modelo GLM (línea rosa), pero para las variables P_lag_3 y LST_d la dependencia difirió entre el modelo GLM y los modelos ML, particularmente el modelo de tipo DL (línea verde obscura) que fue el mejor modelo ML individual (Figura 5). La interpretación de las figuras se mejora con el histograma de frecuencia de las observaciones, en función del valor de la variable. Donde hubo menor frecuencia de datos se interpretó que la dependencia no fue soportada por suficiente evidencia. Un ejemplo de esta situación fue la dependencia de LST_n en la Figura 4 donde el modelo de tipo DL tiene un ascenso abrupto, pero los dos últimos intervalos de clase del histograma tienen pocas observaciones.

Figura 4: Dependencia parcial de la MF y: A) promedio mensual de la temperatura de superficie nocturna (LST_n), B) precipitación acumulada en los tres meses anteriores (P_lag_3), C) banda de reflectancia b7 del producto MCD43A4 de MODIS, D) promedio mensual de la temperatura de superficie diurna en los tres meses anteriores (LST_d_avg_3)

Las barras grises son la frecuencia de datos según intervalos de clase de la variable. Se presentan solo modelos de menor devianza (valor entre paréntesis) obtenidos por aprendizaje automatizado en el escenario usando solo variables medidas con sensores remotos (ML_PR).

Rev Mex Cienc Pecu 2023;14(1):61-77 72

Figura 5: Dependencia parcial de la MF y: A) tasa de acumulación de forraje (TAF), B) altura del forraje (A_pradera), C) días de descanso de la pradera (D_descanso), D) promedio mensual de la temperatura de superficie diurna (LST_d)

Las barras grises son la frecuencia de datos según intervalos de clase de la variable. Se presentan solo modelos de menor devianza (valor entre paréntesis) obtenidos por aprendizaje automatizado en el escenario usando variables medidas con sensores remotos y del manejo de la pradera (ML_PR_MP).

El escenario ML_PR_MP incluye la variable TAF y esto podría ser una limitante para la aplicación práctica del modelo. Para aclarar este aspecto se construyó un modelo ML sin esta variable y usando los mismos datos de entrenamiento, resultando en una r2 de 0.76, RMSE de 232.2 y sesgo de –35.6 (IC –94.4 a 23.1), siendo mejor que el obtenido en el escenarioML_PR (datos nomostrados).Esteresultadotienedos aspectos de importancia: otras variables disponibles para la modelación pueden sustituir a una variable identificada como la más importante y segundo, es posible incurrir en una solución de óptimo local, aun cuando el algoritmo ML explora un espacio de solución con diferentes parámetros de optimización. Una alternativa posible sería aumentar el número de veces de ejecución de la función h2o.automl e incrementar el valor de la constante max_runtime_secs

A pesar de la resolución espacial gruesa de los sensores remotos MODIS y GPM (250 m2 y 10 km2) se estimó la MF adecuadamente en el escenario ML_PR (Figura 3d), siendo que la r2= 0.70 de este modelo se encontró dentro del rango reportado recientemente en la literatura para modelos ML que estiman la biomasa con datos PR(14,15) o la productividad primaria bruta(33). Un modelo con base en datos PR únicamente resulta

Rev Mex Cienc Pecu 2023;14(1):61-77 73

atractivo para el manejo de pastizales de gran área. Cuando las variables PR se usaron en combinación con variables del manejo de la pradera sencillas de medir (A_pradera) o registrar (D_descanso y Mes_ini_crec) la estimación fue muy buena (Figura 3e); la r2= 0.97 fue parecida a la estimación de biomasa con datos PR de resolución espacial de 30 m fueder2=0.96(5). Lapredicción delamasadeforrajeobtenidaconmediciones dealtura de forraje, mejoró cuando se incorporaron variables del manejo de la pradera y datos meteorológicos locales en un algoritmo ML de random forest (r2= 0.82), este enfoque se juzgó práctico para los productores, con excepción del costo de los instrumentos meteorológicos(2)

A pesar de ser una pradera irrigada, la lluvia antecedente de corto plazo fue información importante para los modelos OLS y ML. En un estudio reciente identificaron que la variación espacio-temporal de productividad primaria bruta no sólo se explicó por bandas de reflectancia del MCD43A4 de MODIS, sino que también se relacionó con el déficit de presión de vapor(33). Similar al resultado de esos autores, aquí resultó útil incluir otras bandas de reflectancia además de la b1, b2 e índices de la vegetación como el NDVI y el EVI. Desde el punto de vista práctico, el modelo del escenario ML_PR_MP se consideró muy factible de implementar ya que usó mediciones rutinarias del manejo de la pradera y los datos de sensores remotos de la NASA que son de acceso público.

La producción animal en pastoreo es sostenible cuando se garantiza un consumo de alimento que satisfaga las necesidades de nutrientes. En el manejo del pastoreo esto depende de ajustar la carga animal en función de la etapa fenológica de la planta, de la MF antes y después del pastoreo y del forraje que se decida dejar como remanente en la pradera. Para el ganado bovino productor de carne, la MF antes del pastoreo adecuada, se puede establecer en 2,500 kg ha-1 y la MF después del pastoreo alrededor de los 1,200 kg ha-1(10); aunque estos umbrales dependerán de la etapa reproductiva y fisiológica del animal, la época del año y diferentes estrategias de manejo de la pradera para el racionamiento del alimento, el control fenológico o el balance en la composición botánica(34). Por estas razones es importante que el modelo predictivo de MF ajuste bien en los extremos de su rango y con excepción del escenario ML_PR_MP, existió una sobreestimación de la MF cuando fue inferior a 1,500 kg ha-1 aproximadamente (Figura 3).

La masa de forraje en la pradera tiene una variabilidad espacial dada por diferencias en humedad, fertilidad, deposición de excretas, alteraciones en la comunidad vegetal por el pastoreo selectivo y otros factores. El método de cortes de forraje en cuadrantes es limitado para representar y capturar esta variabilidad espacial en la pradera y por eso el método estadístico de muestreo es importante. Los sensores a bordo de vehículos aéreos no tripulados o drones son una alternativa para capturar la variabilidad en la reflectancia de la vegetación en la escala espacial de centímetros, pero debe considerarse el costo del equipo multiespectral, el procesamiento de datos y la limitante operativa para cubrir el territorio(35),ademásdelanecesidaddeunafunción decalibraciónparalamasadeforraje.

Rev Mex Cienc Pecu 2023;14(1):61-77 74

Conclusiones e implicaciones

La predicción de la MF tuvo menor sesgo con modelos de ML que con modelos OLS, sobre todo cuando se incorporaron en los modelos variables de sensores remotos y de manejo de la pradera. Los ensambles de ML tuvieron menor devianza que algunos de los modelos individuales de ML. El uso de variables PR predice la MF de manera semejante que la relación A_pradera vs. MF, aunque el modelo ML tuvo menor sesgo. Los modelos exploradostendránqueprobarseenotrascondicionesdepraderaparatenerunaaplicación espacial, poder representar ecosistemas y valorar el servicio ambiental de captura de carbono. En la escala local de granja, estos modelos tendrán aplicación para el uso cotidiano en la planeación de la presupuestación forrajera o evaluación retrospectiva del manejo del pastoreo de la pradera. En estos casos el resultado presentado aquí tiene una aplicación promisoria.

Agradecimientos

El estudio fue producto del apoyo para estancia sabática del primer autor por parte de la Universidad Autónoma de Querétaro.

Literatura citada:

1. Sheath GW, Hay RJM, Giles KH. Managing pastures for grazing animals. In: Nicol, AM, editor. Livestock feeding on pasture. NZ Soc Anim Prod occasional publication. 1987;65–74.

2. Murphy D, O’Brien B, Hennessy D, Hurley M, Murphy M. Evaluation of the precision of the rising plate meter for measuring compressed sward height on heterogeneous grassland swards. Precis Agric 2021;22(3):922–946.

3. Radcliffe J. Cutting techniques for pasture yields on hill country. Proc NZ Grassland Association. 1971;33:91–104.

4. Jáuregui JM, Delbino FG, Bonvini MIB, Berhongaray G. Determining yield of forage crops using the Canopeo mobile phone app. J NZ Grassl 2019;41–46.

5. Marsett RC, Qi J, Heilman P, Biedenbender SH, Watson MC, Amer S, et al. Remote sensing for grassland management in the arid southwest. Rangel Ecol Manag 2006;59(5):530–540.

6. O’Donovan M, Dillon P, Rath M, Stakelum G. A comparison of four methods of herbage mass estimation. Ir J Agric Food Res 2002;17–27.

7. Mills A, Smith M, Moot DJ. Relationships between dry matter yield and height of rotationally grazed dryland lucerne. J NZ Grassl 2016;(78):185–196.

Rev Mex Cienc Pecu 2023;14(1):61-77 75

8. MootDJ,YangX,TaHT,BrownHE,TeixeiraEI, SimRE, et al.Simplifiedmethods for on-farm prediction of yield potential of grazed lucerne crops in New Zealand. NZ J Agric Res 2021;65(4-5)1–19.

9. Robertson S. Mass to height relationships in annual pastures and prediction of sheep growth rates. Anim Prod Sci 2014;54(9):1305–1310.

10. Nicol AM, Nicoll GB. Pastures for beef cattle. In: Nicol, AM. editor. Feeding livestock on pasture. Society of Animal Production. Lincoln, New Zealand. 1987;119–131.

11. Zhang Y, Ye A. Would the obtainable gross primary productivity (GPP) products stand up? A critical assessment of 45 global GPP products. Sci Total Environ 2021;783:146965.

12. Jiao W, Wang L, McCabe MF. Multi-sensor remote sensing for drought characterization: current status, opportunities and a roadmap for the future. Remote Sens Environ 2021;256:112313.

13. Anav A, Friedlingstein P, Beer C, Ciais P, Harper A, Jones C, et al. Spatiotemporal patterns of terrestrial gross primary production: A review. Rev Geophys 2015;53(3):785–818.

14. Lang M, Mahyou H, Tychon B. Estimation of rangeland production in the arid oriental region (Morocco) combining remote sensing vegetation and rainfall indices: challenges and lessons learned. Remote Sens 2021;13(11):2093.

15. Chen Y, Guerschman J, Shendryk Y, Henry D, Harrison MT. Estimating pasture biomass using sentinel-2 imagery and machine learning. Remote Sens 2021;13(4):603.

16. Hacker R, Smith W. An evaluation of the DDH/100 mm stocking rate index and an alternative approach to stocking rate estimation. Rangel J 2007;29(2):139–148.

17. CICESE C de IC y de ES de E. Base de datos climatológica nacional (CLICOM). [Internet]. Tequisquiapan, Querétaro; 2021. Estación 22025: Consultada 6 Mar, 2021. http://clicom-mex.cicese.mx/.

18. Hodgson J. Grazing management. Science into practice. Longman Group UK Ltd. 1990.

19. Schaaf C, Wang Z. MCD43A4 MODIS/Terra+ Aqua BRDF/Albedo Nadir BRDF AdjustedRefDailyL3 Global 500m V006. NASA EOSDIS LandProcesses DAAC. 2015.

20. R Development Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing. 2009. https://www.r-project.org

Rev Mex Cienc
76
Pecu 2023;14(1):61-77

21. QGIS.org. QGIS Geographic Information System. QGIS Association. 2021. http://www.qgis.org

22. Google maps. Mapa satelital. México; 2021.

23. Pasquel D, Roux S, Richetti J, Cammarano D, Tisseyre B, Taylor JA. A review of methods to evaluate crop model performance at multiple and changingspatial scales. Precis Agric 2022;23:1489–1513.

24. Warton DI, Duursma RA, Falster DS, Taskinen S. smatr 3-an R package for estimation and inference about allometric lines. Methods Ecol Evol 2012;3(2):257–259.

25. Tedeschi LO. Assessment of the adequacy of mathematical models. Agric Syst 2006;89(2):225–247.

26. Hall P, Gill N, Kurka M, Phan W, Bartz A. Machine learning interpretability with H2O driverless AI. Bartz A. Editor. California, U.S.: H2O.ai Inc.; 2019.

27. LeDell E, Poirier S. H2o automl: Scalable automatic machine learning. In 2020. https://www.automl.org/wp-ontent/uploads/2020/07/AutoML_2020_paper_61.pdf.

28. Mitchell R, Frank E. Accelerating the XGBoost algorithm using GPU computing. PeerJ Comput Sci 2017;3:e127.

29. McElreath R. Statistical rethinking: A bayesian course with examples in R and STAN. Boca Raton, FL. U.S.: CRC Press; 2020.

30. WangJ,PetersenWA,WolffDB.Validationofsatellite-basedprecipitation products from TRMM to GPM. Remote Sens 2021;13(9):1745.

31. Bretas IL, Valente DS, Silva FF, Chizzotti ML, Paulino MF, D’Áurea AP, et al Prediction of aboveground biomass and dry‐matter content in Brachiaria pastures by combining meteorological data and satellite imagery. Grass Forage Sci 2021;76(3):340–352.

32. FriedmanJH.Greedyfunctionapproximation:agradientboostingmachine.AnnStat 2001;1189–1232.

33. Joiner J, Yoshida Y. Satellite-based reflectances capture large fraction of variability in global gross primary production (GPP) at weekly time scales. Agric For Meteorol 2020;291:108092.

34. Griffiths W, Dodd M, Kuhn-Sherlock B, Chapman D. Management options to recover perennial ryegrass populations and productivity in run-out pastures. NZGA: Research and Practice Series. 2021;17.

35. Ahmad A, Ordonez J, Cartujo P, Martos V. Remotely piloted aircPARt (RPA) in agriculture: A pursuit of sustainability. Agronomy 2021;11(1):7.

Rev Mex Cienc Pecu
77
2023;14(1):61-77

https://doi.org/10.22319/rmcp.v14i1.5394

Artículo

Determinación de timol y carvacrol en una matriz orgánica de alimento para cerdo utilizando Headspace SPME-GC-MS

Fernando Jonathan Lona-Ramírez a

Nancy Lizeth Hernández-López a

Guillermo González-Alatorre a

Teresa del Carmen Flores-Flores a

Rosalba Patiño-Herrera a

José Francisco Louvier-Hernández a*

a Tecnológico Nacional de México en Celaya. Departamento de Ingeniería Química. Guanajuato, México.

*Autor de correspondencia: francisco.louvier@itcelaya.edu.mx

Resumen:

En los últimos años, el aceite esencial de orégano se ha utilizado como aditivo en alimentos para animales debido a sus propiedades antifúngicas y antibacterianas, así como sustituto sintético de antibióticos. Es deseable desarrollar un método rápido y efectivo de cuantificación de timol y carvacrol en una matriz orgánica de alimento para cerdo. En este trabajo se realiza una comparación de rendimiento entre la técnica de extracción con disolvente Soxhlet utilizando éter de petróleo y acetato de etilo y la técnica de microextracción en fase sólida en el espacio de cabeza (HS-SPME). Se realizó un diseño de experimentos 24 para definir los parámetros de HS-SPME: temperatura de equilibrio de 40 °C, temperatura de extracción de 40 °C, fuerza iónica de 0.57 M y tiempo de extracción de 40 min. El método HS-SPME es más eficiente para la extracción de timol y carvacrol de una matriz orgánica. Los límites de los valores de detección y cuantificación utilizando la extracción Soxhlet con acetato de etilo fueron de 3.7 y 12.5 μl-1 para timol y de 1.4 y 4.7 μg

78

l-1 para carvacrol, respectivamente; mientras que el LDD y el LDC para HS-SPME fueron de 0.9 y 3.1 μg L-1 para timol y de 0.6 y 1.9 μg L-1 para carvacrol, respectivamente. El método de microextracción en fase sólida en el espacio de cabeza tiene el potencial de control de calidad en la industria para compuestos activos presentes en el aceite esencial de orégano como aditivo en una matriz orgánica.

Palabras clave:Aceiteesencial, Timol, Carvacrol,Orégano, Origanum,HS-SPME-GC-MS.

Recibido: 17/08/2020

Aceptado: 02/09/2021

Introducción

Las personas utilizan especias herbales como potenciadores del sabor de los alimentos y ayudas medicinales desde la antigüedad(1), principalmente por su actividad biológica. El orégano es una de las hierbas más importantes, que es el nombre común de una amplia variedad de géneros y especies de plantas en todo el mundo, pero generalmente se le conoce como Origanum en la familia Lamiaceae (Labiatae)(2) o Lippia graveolens en la familia Verbenaceae.El aceiteesencialdeorégano(AEO) hasido utilizado como aditivo alimentario debido a su actividad antimicrobiana atribuida a su alto contenido de monoterpenos como el timol y el carvacrol, el último generalmente reconocido como un aditivo alimentario seguro(3-6). Debido a la prohibición de los antibióticos por parte de la Comisión Europea, el AEO ha recibido una mayor atención por parte de la industria avícola y porcina para mejorar las defensas naturales y fortalecer los organismos de los animales con resultados favorables(7-10). El AEO se puede incorporar al alimento para cerdo mezclando el aceite y la matriz orgánica. Sin embargo, se requiere un método de cuantificación confiable para el control de calidad.

El timol y el carvacrol(11) muestran actividad antibacteriana(4,12), antioxidante(13) y fungicida(3,4) y son dos de los principales componentes del AEO. Por lo tanto, pueden servir como marcadores para la cuantificación. El método de control de calidad comienza con una extracción con disolvente de los compuestos volátiles de la matriz del alimento; sin embargo, los disolventes orgánicos no son respetuosos con el medio ambiente ni aceptables para el procesamiento de alimentos. Algunas otras tecnologíasde extracción, como laextracción con dióxido de carbono supercrítico, requieren equipos de alto costo y condiciones operativas de alta presión(14,15). Por lo tanto, es deseable desarrollar un método rápido y efectivo de cuantificación de timol y carvacrol dentro de una matriz orgánica de alimento para cerdo. Se propone la técnica de microextracción en fase sólida en el espacio de cabeza (HS-SPME, del

Rev Mex Cienc Pecu 2023;14(1):78-93 79

inglés headspace solid-phase microextraction) junto con el método de cromatografía de gases-espectroscopía de masas (GC-MS, del inglés gas chromatography-mass spectroscopy) ya que HS-SPME es una técnica efectiva, no costosa y respetuosa con el medio ambiente para la detección y cuantificación de compuestos volátiles(16,17) .

Hasta donde se sabe, esta técnica no ha sido utilizada para la detección de timol y carvacrol en una matriz orgánica adicionada con AEO, sino sólo para cuantificar estos compuestos activos en aceite puro(18-20). Este trabajo comparó una técnica de extracción con disolvente utilizando éter de petróleo o acetato de etilo en un extractor Soxhlet(21) con una técnica HSSPME de la matriz de harina de alimento para cerdo para cuantificar el timol y el carvacrol del extracto utilizando unsistemaGC-MS.Seutilizónitrosopiperidina(NPIP)como estándar interno para absorber las variaciones de señal debidas al método de extracción y al propio equipo(22) y calcular el límite de detección (LDD) y el límite de cuantificación (LDC) para evaluar la efectividad de la técnica de extracción. Finalmente, se realizó un diseño de experimentos utilizando el software R(23) y RStudio(24)

Material y métodos

Reactivos

El timol (100.0 %), el carvacrol (99.9 %), la nitrosopiperidina (99.9 %) y el cloruro de sodio se obtuvieron de Sigma Aldrich (St. Louis, EE. UU.). El éter de petróleo y el acetato de etilo de grado analítico (ACS) se obtuvieron de Fermont (Monterrey, México). Se utilizó agua tridestilada de MERCK en los experimentos de HS-SPME. El gas portador utilizado para GC-MS fue helio ultra alta pureza (grado 5.0) de Praxair. Las fibras de poliacrilato (PA) para SPME seobtuvierondeSigmaAldrich. Unaindustrialocal proporcionó laharinade alimento para cerdo adicionada con AEO.

Método cromatográfico

Para la detección e identificación se utilizó un cromatógrafo de gases Agilent modelo 7890A junto con un espectrómetro de masas modelo 5975C con un ion de polo positivo, un solo cuadrupolo con fuente de ionización por impacto electrónico (IE). Una columna capilar HPINNOWax (30 m, 0.25 mm DI y película de polietilenglicol de 0.5 μm de grosor; Alltech) se utilizó para la separación de compuestos. La temperatura de la línea de transferencia se fijó en 250 °C y el puerto inyector GC en 260 °C en modo splitless. La temperatura del horno se fijó inicialmente en 60 °C durante 3 min, luego se elevó a 250 °C a una velocidad de 20 °C por minuto y se mantuvo allí durante 3 min. El MS se programó tanto en modo de escaneo como en modo SIM, con un tiempo de retardo de disolvente de 8 min. El modo de escaneo se estableció de 20 a 300 m/z, mientras que el modo SIM se estableció en 114 m/z (iones

Rev Mex Cienc Pecu 2023;14(1):78-93 80

característicos de nitrosopiperidina) durante el intervalo de tiempo de 8 a 11.5 min e inmediatamente se cambió para seguir las señales de 135 y 150 m/z (ion característico de timol y carvacrol) hasta el final del análisis.

Preparación de muestras

Una industria local proporcionó las muestras de harina de alimento para cerdo adicionado con aceite esencial de orégano durante el proceso de elaboración. Las muestras se almacenaron en bolsas de plástico herméticas hasta su uso. En este trabajo se utilizaron dos técnicas diferentes para extraer timol y carvacrol: (i) extracción con disolvente utilizando un aparato de destilación Soxhlet, y (ii) HS-SPME utilizando una fibra de PA. Se utilizaron tres disolventes diferentes: acetato de etilo y éter de petróleo para la extracción Soxhlet y agua desionizadaparalatécnicaHS-SPME.Seagregaron5.0mg L-1 deNPIP acadamuestracomo estándar interno.

Extracción con disolvente Soxhlet

Se colocó una muestra de 10 g de alimento para cerdo en un aparato de extracción Soxhlet con 130 ml de disolvente (ya sea acetato de etilo o éter de petróleo). La mezcla se calentó hasta que se completaron cinco ciclos, luego se almacenó una alícuota de este extracto para su análisis. Inmediatamente se añadió un disolvente nuevo fresco para realizar otros cinco ciclos utilizando la misma muestra, y se tomó otra alícuota de extracto. Se realizó un tercer paso de destilación con más disolvente fresco, y se tomó una tercera alícuota. Así, cada muestra (10 g de alimento para cerdo) se sometió a extracción tres veces utilizando dos disolventes diferentes.

Además, se utilizaron dos métodos de cuantificación utilizando (a) una curva de calibración estándar externa y(b)un métododeadiciónestándar. Lacurvade calibraciónparael estándar externo se realiza utilizando concentraciones conocidas para timol y carvacrol (2, 4, 6, 8 y 10 mg L-1). Para el método de adición estándar, se mezclaron 0.5 ml de alícuota de extracto con 0.5 ml de disolvente con diferentes concentraciones de timol y carvacrol (2, 4, 6, 8 y 10 mg L-1). En todos los casos, la cantidad de muestra inyectada en el GC fue de 1.0 μl.

Microextracción en fase sólida en el espacio de cabeza

La técnica HS-SPME involucra algunos parámetros como el tiempo de equilibrio (teq), la temperatura de equilibrio (Teq), el tiempo de extracción (text), la temperatura de extracción (Text) y la fuerza iónica (I). El tiempo y la temperatura de equilibrio son el tiempo y la temperatura a la que se deja que la muestra alcance el equilibrio entre la fase sólida (matriz de alimento para cerdo) y el espacio de cabeza del vial. El tiempo de extracción y la

Rev Mex Cienc Pecu 2023;14(1):78-93 81

temperatura de extracción corresponden al tiempo yla temperatura a la que la microfibra está en contacto con el espacio de cabeza que adsorbe compuestos volátiles. La fuerza iónica es una medida de la concentración de iones en una solución ymodifica el equilibrio del sistema. Es necesario determinar el efecto de estos parámetros sobre la señal obtenida en GC-MS. Para evaluar este efecto, se agregaron estándares de timol y carvacrol en agua (junto con 5 mg L-1 de NPIP como el estándar interno) para formar una solución de 10 mg L-1 .

Para la cuantificación de timol y carvacrol en alimento para cerdo, se agregó una muestra de 0.5 g de alimento en polvo para cerdo a viales de vidrio de 15 ml con septum de PTFE/silicona con el contenido requerido de NaCl y 10 ml de agua con diferentes concentracionesdetimol ycarvacrolpararealizarelanálisisdelatécnicadeadiciónestándar. Las curvas de calibración estándar externas no fueron posibles de realizar en el HS-SPME debido a las interacciones entre los compuestos volátiles de la matriz del alimento en polvo para cerdo en la fase gaseosa y la fibra durante la extracción. El área relativa entre timol o carvacrol y el estándar agregado (NPIP) se calculó y se utilizó como variable de respuesta para evaluar el rendimiento del método de extracción.

Diseño de experimentos

Se realizó un análisis factorial 24 para evaluar el efecto de la temperatura de equilibrio (4050 °C), la temperatura de extracción (40-50 °C), el tiempo de extracción (20-40 min) y la fuerza iónica (0.57-2.28 mol L-1 de NaCl). El tiempo de equilibrio se fijó en un tiempo suficientemente largo para asegurar el equilibrio (Cuadro 1).

Cuadro 1: Valores de los niveles de los factores para el diseño del experimento Factor Nivel bajo -1 Nivel alto +1

Temperatura de equilibrio, Teq (°C) 40 50

Temperatura de extracción, Text (°C) 40 50

Tiempo de extracción, text (min) 20 40

Fuerza iónica, I (mole L-1) 0.57 2.28

Un diseño factorial de experimentos 24 con una sola réplica consiste en 16 corridas experimentales. El análisis de varianzas del modelo completo (factores principales y todas las combinaciones de interacción posibles) no da residuales, Fo y valores P ya que el grado de libertad del error es igual a cero y no hay estimación del error interno. Por lo tanto, las interacciones insignificantes de tres y cuatro órdenes se utilizan para estimar el error. Además, después de evaluar el ANOVA de los efectos principales y las interacciones de dos factores, se definen los factores significativos y se realiza otro análisis ANOVA teniendo en

Rev Mex Cienc Pecu 2023;14(1):78-93 82

cuenta solo los factores que son significativos. A continuación, se evalúa un modelo de regresión y se trazan las gráficas de residuales y de contorno utilizando R-studio.

Resultados

Identificación del espectro de masas de timol y carvacrol

Se colocó una muestra de 0.5 g de alimento en polvo para cerdo en un vial con 10 ml de agua y NPIP como estándar interno. Se realizó un proceso HS-SPME para identificar la presencia de timol y carvacrol, como se muestra en la Figura 1. Los espectros del modo de escaneo se analizaron con la biblioteca de espectro de masas NUST/EPA/NIH para su confirmación con una concordancia del 90 % entre el espectro experimental yteórico. Los tiempos de retención del estándar interno, timol y carvacrol fueron de 10.3, 12.3 y 12.5 min, respectivamente. El tiempo de retención se obtiene siguiendo su respectivo ion característico: 144 para NPIP, 135 para timol y 150 para carvacrol. Es importante tener en cuenta que la columna HP-Innowax fue apropiada para una buena separación entre el timol y el carvacrol debido a su naturaleza isomérica.

Figura 1: Cromatogramas de alimento en polvo para cerdo utilizando acetato de etilo y HS-SPME

Curvas de calibración

Para fines de comparación, se realizaron tres metodologías diferentes para la cuantificación de timol y carvacrol: (a) extracción Soxhlet utilizando disolventes orgánicos y calibración con un estándar externo, (b) extracción Soxhlet usando disolventes orgánicos y calibración por adición estándar, y(c) HS-SPME con agua como disolvente y calibración usando adición

Rev Mex Cienc Pecu 2023;14(1):78-93 83

estándar. El uso de un estándar externo y una adición estándar está destinado a la comparación de sensibilidad.

La Figura 1 muestra la comparación de cromatogramas SIM utilizando la extracción HSSPME ySoxhlet con disolvente de acetato de etilo. Para la técnica HS-SPME, la sensibilidad aumenta casi nueve veces en comparación con la técnica de extracción con disolvente, incluso utilizando menos cantidad de muestra durante el proceso de microextracción, lo que demuestra la efectividad y ventaja de la metodología de HS-SPME.

La señal obtenida [área relativa = (área de timol o de carvacrol) / (área del estándar interno)] y su desviación estándar relativa (DER) para todos los experimentos del diseño factorial se muestra en la Figura 2. Hay siete experimentos con una DER <15 % para ambos analitos, pero solo dos con una DER <5.5 %, experimentos #1 y #12. Una señal alta es deseable, por lo que se identificaron cuatro experimentos con un área relativa alta. Los experimentos #4, #12 y #16 muestran una combinación de señal alta (área relativa) con valores de dispersión (DER) bajos. Todos estos experimentos se realizaron a un contenido de sal de 0.57 M y tiempo de extracción de 40 min, pero con temperatura de extracción y temperatura de equilibrio de 40 y 50 °C. Es interesante notar que la fuerza iónica (contenido de sal) y el tiempo de extracción son los factores en común, y son factores significativos como se observará más adelante.

Figura 2: Área relativa y dispersiones (desviación estándar relativa) para timol y carvacrol para cada experimento del diseño factorial para mejorar los parámetros del proceso

En la Figura 3 se pueden observar las curvas de calibración para: (a) el uso de timol y carvacrol como estándares externos para la técnica de extracción Soxhlet; (b) el uso de NPIP

Rev Mex Cienc Pecu 2023;14(1):78-93 84

como estándar añadido para la técnica de extracción Soxhlet; y (c) el uso de NPIP como estándar añadido para la técnica HS-SPME. No es posible utilizar estándares externos para la técnica SPME. Cabe destacar que la señal del área relativa es del orden de decenas para el carvacrol, ya sea con estándar externo o estándar de adición, mientras que la señal del área relativa para el timol está en el orden de unidades para estándares externos y de adición. Pero para HS-SPME la señal del área relativa es del orden de cientos tanto para el timol como para el carvacrol, lo que confirma nuevamente el aumento de la sensibilidad de un orden de magnitud (dos órdenes para el timol) de esta técnica.

Figura 3: Curvas de calibración de estándares externos de extracción Soxhlet (a), extracción Soxhlet con curvas de adición estándar (b) y HS-SPME con curvas de adición estándar (c), para cuantificación de carvacrol y timol

Los valores del área relativa (eje y) son mayores para la técnica HS-SPME en comparación con la técnica de extracción Soxhlet. Extracción Soxhlet utilizando acetato de etilo y HS-SPME utilizando agua como disolventes.

Rev Mex Cienc Pecu 2023;14(1):78-93 85

Discusión

Diseño de experimentos

El Cuadro 2 muestra el análisis de varianza para los efectos principales y las interacciones de dos factores para la cuantificación de carvacrol y timol, y es posible observar que solo el tiempo de extracción y el contenido de sal, así como la interacción entre ellos, son significativos para ambos analitos. El Cuadro 3 muestra el análisis de varianza considerando solo los factores de fuerza iónica, el tiempo de extracción y la interacción fuerza iónicatiempo de extracción para carvacrol y timol. Considerando sólo los factores e interacciones significativas, el modelo de regresión para la extracción HS-SPME de carvacrol es: �������������������������������� =13.9782+9.0768��+1.3297�������� 0.6242��×��������

Con un R2 de 0.8558, que significa que el 85.6 % de la variabilidad de los datos se explica por el modelo con una gráfica de residuos distribuidos aleatoriamente (no se muestra). Una gráfica de contorno en la Figura 4 muestra que cuando el tiempo de extracción está en un nivel alto, hay un fuerte efecto negativo del contenido de sal, lo que significa que el área relativadecarvacrolesmayorcuandoel contenidodesalesmenor;además,cuandoeltiempo de extracción está en un nivel bajo, todavía hay un efecto negativo del contenido de sal, pero más débil que en el nivel alto del tiempo de extracción. Considerando sólo los factores e interacciones significativas, el modelo de regresión para la extracción HS-SPME de timol es: ������������������������ = 9.5790+5.5841��+ 0.8329�������� 0.4008��×��������

Con un R2 de 0.8401, que significa que el 84 % de la variabilidad de los datos se explica por el modelo con una gráfica de residuos distribuidos aleatoriamente (no se muestra). Una gráfica de contorno en la Figura 5 muestra que cuando el tiempo de extracción está en un nivel alto, hay un fuerte efecto negativo del contenido de sal, lo que significa que el área relativa de timol es mayor cuando el contenido de sal es menor; además, cuando el tiempo de extracción está en un nivel bajo, todavía hay un efecto negativo del contenido de sal, pero más débil que en el nivel alto de tiempo de extracción. Esto es lo mismo para el timol y el carvacrol, la única diferencia es que el carvacrol muestra una señal del área relativa 1.5 veces mayor que el timol.

Rev Mex Cienc Pecu 2023;14(1):78-93 86

Cuadro 2: ANOVA de los efectos principales e interacciones de dos factores para el diseño del experimento

Carvacrol

Timol GL Suma de cuadrados Media cuadrática F0 Valor P GL Suma de cuadrados Media cuadrática F0 Valor P

Teq (°C) 1 0.6 0.6 0.016 0.90550 1 0.2 0.2 0.011 0.92026

Text (°C) 1 1.4 1.4 0.038 0.85218 1 0.7 0.7 0.042 0.84494

I (M) 1 1089.2 1089.2 29.208 0.00293 1 484.9 484.9 30.822 0.00261

text (min) 1 310.1 310.1 8.315 0.03444 1 109.7 109.7 6.974 0.04593

Teq x Text 1 39.0 39.0 1.046 0.35339 1 28.3 28.3 1.798 0.23760

Teq x I 1 13.7 13.7 0.368 0.57070 1 6.6 6.6 0.416 0.54715

Teq x text 1 3.6 3.6 0.096 0.76966 1 0.1 0.1 0.006 0.94100

Text x I 1 2.8 2.8 0.075 0.79541 1 1.4 1.4 0.089 0.77805

Text x text 1 65.0 65.0 1.742 0.24407 1 33.1 33.1 2.105 0.20652

text x I 1 455.8 455.8 12.222 0.01736 1 187.9 187.9 11.941 0.01813

Residuos 5 186.5 37.3 5 78.7 15.7

GL= grados de libertad.

El Cuadro 3 muestra el análisis de la varianza evaluado solo con los factores significativos del DOE, es decir, los factores de fuerza iónica, tiempo de extracción e interacción fuerza iónica-tiempo de extracción.

Cuadro 3: ANOVA de los factores significativos para el diseño de experimento Carvacrol Timol GL Suma de cuadrados Media cuadrática F0 Valor P GL Suma de cuadrados Media cuadrática F0 Valor P

I (M) 1 1089.2 1089.2 41.83 <0.001 1 484.9 484.9 39.065 <0.001 text (min) 1 310.1 310.1 11.91 0.00480 1 109.7 109.7 8.839 0.01163 text x I 1 455.8 455.8 17.50 0.00127 1 187.9 187.9 15.134 0.00215

Residuos 12 312.5 26.0 12 148.9 12.4 GL= grados de libertad.

Para elegir los mejores parámetros operativos, siempre se deben seleccionar un tiempo de extracción alto y un contenido de sal bajo. Dado que los otros dos factores no son significativos, se puede trabajar a cualquier temperatura de equilibrio y temperatura de extracción; por lo tanto, se decidió trabajar a bajas temperaturas de equilibrio y extracción por razones económicas.

Rev Mex Cienc Pecu 2023;14(1):78-93 87

Cuadro 4: Cuadro de efectos para el diseño del experimento Carvacrol Timol Efecto Valor T Valor P Efecto Valor T Valor P

Fuerza iónica, M -16.502 -6.467 <0.001 -11.0102 -6.250 <0.001

Tiempo de extracción, min 8.804 3.451 0.00480 5.2372 2.973 0.01163

text x I -10.674 -4.183 0.00127 -6.853 -3.890 0.00215

Para ambos analitos, un aumento en el contenido de sal (o fuerza iónica) resulta en una disminución en el área relativa, probablemente porque la solución está cerca de la saturación. Además, un tiempo de extracción alto (text) beneficia la señal del área relativa lo que está en buen acuerdo con el concepto de que la extracción aumenta a medida que aumenta el tiempo de extracción.

El Cuadro 5 muestra el contenido de timol y carvacrol en el alimento en polvo para cerdo al comparar las dos técnicas de extracción y los disolventes utilizados. El contenido total de timol ycarvacrol para cada disolvente se calcula sumando la cantidad medida de cada una de las tres extracciones consecutivas. En cuanto a la extracción con disolvente Soxhlet, el éter de petróleo no fue eficiente en la extracción de timol y carvacrol del alimento en polvo para cerdo, como lo indica la baja cuantificación obtenida de ambos componentes, pero especialmente para el timol. El éter de petróleo extrajo de 52 a 55 % menos de timol y de 19 a 22 % menos de carvacrol que el acetato de etilo. Curiosamente, existe una capacidad de extracción selectiva de ambos disolventes para el timol sobre el carvacrol. Una vez más, la técnica HS-SPME muestra una capacidad de extracción mejorada tanto para el timol como para el carvacrol, y se extraen sin selectividad.

Cuadro 5: Comparación del contenido total de timol y carvacrol en alimento concentrado para cerdo medido por diferentes técnicas de extracción

Técnica Extracción Soxhlet HS-SPME Método estándar Adición estándar Estándar externo Adición estándar

Disolvente Acetato de etilo Éter de petróleo Acetato de etilo Éter de petróleo Agua Analito Timol Carvacrol Timol Carvacrol

Timol Carvacrol Timol Carvacrol Timol Carvacrol

Primer extracto, mg L-1 4.25 0.67 1.99 0.48 4.03 0.58 1.92 0.40 - -

Rev Mex Cienc Pecu 2023;14(1):78-93 88

Segundo extracto, mg L-1 0.63 0.16 0.33 0.18 0.79 0.15 0.24 0.16 - -

Contenido total, mg L-1 4.88 0.82 2.32 0.67 4.82 0.73 2.16 0.56 3.25 4.17

Contenido en alimento para cerdo, mg kg-1

63.45 10.71 30.22 8.66 62.60 9.43 28.12 7.30 65.00 83.40

El método de calibración también muestra algunas diferencias. La calibración con un estándar externo muestra un valor de concentración que es 9 % menor en promedio que el que utiliza la calibración de adición estándar; el método de adición estándar tiene una incertidumbre mejorada, pero es un método costoso ya que el estándar debe agregarse a cada muestra.

Figura 4: Gráfico de contorno para la resistencia iónica y el tiempo de extracción para la extracción de carvacrol utilizando HS-SPME

LatécnicaHS-SPME muestralamayorconcentración detimol ycarvacrol.El contenidototal de timol concuerda con el contenido total de timol obtenido por extracción Soxhlet con acetato de etilo de aproximadamente 63-65 mg/kg; sin embargo, el contenido total de carvacrol es muy diferente. La cuantificación de carvacrol por HS-SPME tiene un valor de 83.40mg/kg,mientrasquelacuantificaciónutilizandoextracciónSoxhletconacetatodeetilo

Rev Mex Cienc Pecu 2023;14(1):78-93 89

es de 10.71 mg/kg, que es ocho veces menor que el resultado de HS-SPME. Esto podría estar relacionado con el comportamiento estérico del timol y el carvacrol (estereoisómeros) y las interacciones con el material de fibra (poliacrilato).

Figura 5: Diagrama de contorno para la resistencia iónica y el tiempo de extracción para la extracción de timol utilizando HS-SPME

Validación de métodos

Los límites de detección (LDD) y cuantificación (LDC) se estimaron para evaluar el rendimiento de los métodos de extracción y se calcularon utilizando el ruido y la señal de referencia, definidos como tres veces la relación señal/ruido para LDD y diez veces para el LDC(16). La Figura 3 muestra las curvas de calibración para cada componente (timol y carvacrol) para los tres diferentes disolventes utilizados. Los valores de LDD y LDC utilizando la extracción Soxhlet con acetato de etilo fueron de 3.7 y 12.5 μl-1 para el timol y 1.4 y 4.7 μg L-1 para el carvacrol, respectivamente. La técnica HS-SPME da mejores resultados para ambas sustancias ya que los valores de LDD y LDC fueron de 0.9 y 3.1 μg L-1 para el timol y 0.6 y 1.9 μg L-1 para el carvacrol, respectivamente. La linealidad de los datos se estimó a través del coeficiente de correlación lineal, donde el valor más bajo encontrado fue 0.9892.

Conclusiones e implicaciones

El aceite esencial de orégano se identifica positivamente en el alimento concentrado para cerdo utilizando compuestos volátiles característicos timol y carvacrol utilizando dos métodos de extracción diferentes: Soxhlet y HS-SPME. Entre los disolventes orgánicos para

Rev Mex Cienc Pecu 2023;14(1):78-93 90

la extracción Soxhlet, el éter de petróleo no fue adecuado ya que solo extrajo alrededor del 50 y el 10 % del contenido total de timol y carvacrol, respectivamente (en relación con la cuantificación de HS-SPME). Además, en cuanto al uso de acetato de etilo en la extracción Soxhlet, este disolvente fue capaz de extraer todo el timol, pero no el carvacrol, mostrando algún tipo de selectividad. Para la técnica HS-SPME, se realizó un diseño factorial de experimentos 24 para evaluar los parámetros del proceso y obtener la mayor relación S/N posible. Las condiciones adecuadas son temperaturade equilibrio (Teq)de40 °C,temperatura de extracción (Text) de 40 °C, fuerza iónica (I) de 0.57 M y tiempo de extracción (text) de 40 min. HS-SPME mostró un rendimiento de extracción nueve veces mejor en comparación con la extracción Soxhlet, incluso con cantidades de muestra más pequeñas, con un límite de detección y cuantificación de 0.9 y 3.1 μg L-1 para timol, y 0.6 y 1.9 μg L-1 para carvacrol, respectivamente. Los resultados muestran que el método HS-SPME es más eficiente para la extracción de timol y carvacrol de una matriz orgánica y tiene el potencial de una técnica de control de calidad en la industria alimentaria para cuantificar los compuestos activos del aceite esencial de orégano cuando se utiliza como aditivo para una matriz orgánica como el alimento para cerdo.

Agradecimientos

Al CONACYT(ConsejoNacionaldeCiencia yTecnología)porel apoyofinancierootorgado al doctorando Fernando Jonathan Lona Ramírez (número de beca: 344837) y al Tecnológico Nacional de México (TecNM) por la beca de investigación número 5267.14-P para la realización de este estudio. A Alimentos Aicansa SA por proporcionar muestras de alimento para cerdo con AEO como aditivo.

Conflicto de intereses

Los autores declaran no tener conflicto de intereses.

Literatura citada:

1. Sánchez-Ruíz JF, Tejeda-Rosales ME, Sánchez-Tejeda JF, Sánchez-Tejeda MG. Pharmacy, medicine and herbolary in the Florentine Codex. Rev Mex Cienc Farm 2012;43(3):55-66.

2. Kintzios SE. Oregano. In: Peter KV editor. Handbook of herbs and spices Vol. 2. Cambridge, UK: Woodhead; 2004:215-229.

3. Ahmad A, Khan A, Akhtar F, Yousuf S, Xess I, Khan LA, Manzoor N. Fungicidal activity of thymol and carvacrol by disrupting ergosterol biosynthesis and membrane integrity against Candida. Eur J Clin Microbiol Infect Dis 2011;30(1):41-50.

Rev Mex Cienc Pecu 2023;14(1):78-93 91

Pecu 2023;14(1):78-93

4. LioliosCC,GortziO,LalasS,TsaknisJ,Chinou I. Liposomalincorporationofcarvacrol and thymol isolated from the essential oil of Origanum dictamnus L. and in vitro antimicrobial activity. Food Chem 2009;112(1):77-83.

5. MarcheseA, Orhan IE., DagliaM, BarbieriR, Di LorenzoA,Nabavi SF,Gortzi O, Izadi M, Nabavi SM. Antibacterial and antifungal activities of thymol: A brief review of the literature. Food Chem 2016;210:402-414.

6. Pesavento G, Calonico C, Bilia AR, Barnabei M, Calesini F, Addona R, et al Antibacterial activity of Oregano, Rosma-rinus and Thymus essential oils against Staphylococcus aureus and Listeria monocytogenes in beef meatballs. Food Control 2015;54:188-199.

7. Bozkurt M, Bintaş E, Kırkan Ş, Akşit H, Küçükyılmaz K, Erbaş G, et al. Comparative evaluation of dietary supplementation with mannan oligosaccharide and oregano essential oil in forced molted and fully fed laying hens between 82 and 106 weeks of age. Poult Sci 2016;95(11):2576-2591.

8. Franciosini MP, Casagrande-Proietti P, Forte C, Beghelli D, Acuti G, Zanichelli D, et al. Effects of oregano (Origanum vulgare L.) and rosemary (Rosmarinus officinalis L.) aqueous extracts on broiler performance, immune function and intestinal microbial population. J Appl Anim Res 2016;44(1):474-479.

9. Scocco P, Forte C, Franciosini MP, Mercati F, Casagrande-Proietti P, Dall’Aglio C, et al. Gut complex carbohydrates and intestinal microflora in broiler chickens fed with oregano (Origanum vulgare L.) aqueous extract and vitamin E. J Anim Physiol Anim Nutr (Berl) 2017;101(4):676-684.

10. Zeng Z, Zhang S, Wang H, Piao X. Essential oil and aromatic plants as feed additives in non-ruminant nutrition: a review. J Anim Sci Biotechnol 2015;6:7.

11. Russo M, Galletti GC, Bocchini P, Carnacini A. Essential oil chemical composition of wild populations of italian oregano spice (Origanum vulgare ssp. hirtum (Link) Ietswaart):  A preliminaryevaluation of their use in chemotaxonomyby cluster analysis. 1. Inflorescences. J Agric Food Chem 1998;46(9):3741-3746.

12. de Oliveira Nóbrega R, de Castro Teixeira, AP, Araújo de Oliveira W, de Oliveira Lima E, Oliveira Lima I. Investigation of the antifungal activity of carvacrol against strains of Cryptococcus neoformans. Pharm Biol 2016;54(11):2591-2596.

13. Safaei-Ghomi J, Ebrahimabadi AH, Djafari-Bidgoli Z, Batooli H. GC/MS analysis and in vitro antioxidant activity of essential oil and methanol extracts of Thymus caramanicus Jalas and its main constituent carvacrol. Food Chem 2009;115(4):15241528.

Rev Mex Cienc
92

Pecu 2023;14(1):78-93

14. Díaz-Maroto MC, Pérez-Coello MS, Cabezudo MD. Supercritical carbon dioxide extraction of volatiles from spices: Comparison with simultaneous distillation–extraction. J Chromatogr A 2001;947(1):23-29.

15. Hossain MB, Barry-Ryan C, Martin-Diana AB, Brunton NP. Optimisation of accelerated solvent extraction of antioxidant compounds from rosemary (Rosmarinus officinalis L.), marjoram (Origanum majorana L.) and oregano (Origanum vulgare L.) using response surface methodology. Food Chem 2011;126(1):339-346.

16. Lona-Ramirez FJ, Gonzalez-Alatorre G, Rico-Ramírez V, Perez-Perez, MCI, CastrejónGonzález EO. Gas chromatography/mass spectrometry for the determination of nitrosamines in red wine. Food Chem 2016;196:1131-1136.

17. Méndez-Pérez D, González Alatorre G, Botello Álvarez E, Escamilla Silva E, Alvarado JFJ. Solid-phase microextraction of N-nitrosodimethylamine in beer. Food Chem 2008; 107(3):1348-1352.

18. Adams A, Kruma Z, Verhé R, De Kimpe N, Kreicbergs V. Volatile profiles of rapeseed oil flavored with basil, oregano, and thyme as a function of flavoring conditions. J Am Oil Chem Soc 2011;88(2):201-212.

19. Karami-Osboo R, Miri R, Asadollahi M, Jassbi AR. Comparison between head-space spmeandhydrodistillation-gc-msofthevolatilesof Thymus daenensis.JEssentOilBear Pl 2015;18(4):925-930.

20. Stashenko EE, Martínez JR. Sampling volatile compounds from natural products with headspace/solid-phase micro-extraction. J Biochem Biophys Methods 2007;70(2):235242.

21. Pothier J, Galand N, El Ouali M, Viel C. Comparison of planar chromatographic methods (TLC, OPLC, AMD) applied to essential oils of wild thyme and seven chemotypes of thyme. II Farmaco 2001;56(5-7):505-511.

22. Pawliszyn J. Solid phasemicroextraction: Theoryandpractice.NewYork, USA: WileyVCH; 1997.

23. R Core Team. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing, 2021. http://www.R-project.org/

24. RStudio Team. RStudio: Integrated Development Environment for R. Boston, Massachusetts, USA: RStudio. PBC; 2020. http://www.rstudio.com/

Rev Mex Cienc
93

https://doi.org/10.22319/rmcp.v14i1.6121

Artículo

Cambios en el recuento de cuatro grupos bacterianos durante la maduración del Queso de Prensa (Costeño) de Cuajinicuilapa, México

José Alberto Mendoza-Cuevas a

Armando Santos-Moreno a

Beatriz Teresa Rosas-Barbosa b

Ma. Carmen Ybarra-Moncada a Emmanuel Flores-Girón a Diana Guerra-Ramírez c* a Universidad Autónoma Chapingo. Departamento de Ingeniería Agroindustrial. Carretera México-Texcoco km 38.5, Texcoco, Estado de México. México

b Universidad de Guadalajara. Centro Universitario de Ciencias Biológicas y Agropecuarias, Zapopan, Jal. México.

c Universidad Autónoma Chapingo. Departamento de Preparatoria Agrícola. Texcoco, Estado de México. México. * Autor de correspondencia: guerrard@correo.chapingo.mx

Resumen:

El Queso de Prensa, también llamado Costeño es elaborado artesanalmente a partir de leche cruda de vaca en la región de la Costa Chica del estado de Guerrero. Con el fin de conocer las características de los quesos artesanales mexicanos, el objetivo de esta investigación fue analizarlos cambios en el recuento debacterias mesófilasaerobias (BMA), microorganismos coliformes totales (CT), bacterias ácido lácticas (BAL) y estafilococos coagulasa positivos (ECP),durantela maduración (5,30,60 y90días) dequesos deprensa,elaborados por cuatro diferentes queserías (A, B, C y D) de Cuajinicuilapa, Guerrero, México. Una porción (25 g)

94

de cada muestra de queso se homogeneizó con diluyente de peptona (225 ml) yse prepararon diluciones desde 10 -1 a 10 -6 con las que se sembraron placas 3M TM PetrifilmTM . Después de incubar a diferentes condiciones, según el tipo de microorganismo, se hicieron recuentos de BMA, CT, BAL y ECP. Los resultados mostraron que conforme avanzó el tiempo de maduración del Queso de Prensa, la carga microbiana disminuyó: BMA de 4 a 2, CT de 6 a 3, BAL de 6 a 2 y ECP de 5 a 2 log10 UFC g-1 Los cambios en los recuentos de los grupos bacterianos estudiados, pueden ser atribuidos a las transiciones fisicoquímicas y microbiológicas propias de la maduración del queso y a las características de la microbiota presente en cada una de las queserías. Los resultados de esta investigación aportan elementos para la caracterización microbiana de los quesos artesanales mexicanos.

Palabras clave: Bacterias ácido lácticas, Bacterias mesófilas aerobias, Estafilococos coagulasa positivos, Leche cruda, Microbiota, Microorganismos coliformes totales, Quesos artesanales.

Recibido: 14/12/2021 Aceptado: 02/09/2022

Introducción

Alrededor del mundo, el queso además de ser una rica fuente de nutrientes es un alimento esencial utilizado en la gastronomía local de diferentes sociedades(1,2). Actualmente se conocen alrededor de 1,833 variedades de quesos ubicados en 74 países(3); dicha diversidad está determinada por los procesos tecnológicos empleados para su elaboración, tales como origen de la leche, relación grasa-proteína, tipos de cultivos y de agentes coagulantes; la forma, el tamaño del queso y las condiciones de maduración(4,5,6) .

La maduración del queso consiste en su almacenado, bajo ciertas condiciones de temperatura y humedad, durante un periodo de tiempo que puede oscilar de 3 a 7 días, hasta 2 años(5,7) . El proceso de maduración, además de impartir características sensoriales, es un método de conservación(5,6,8). En esta etapa se presentan cambios bióticos y abióticos que repercuten de forma directa sobre la microbiota presente en el queso(5,7,9) .

En su mayoría, los quesos artesanales son elaborados a partir de leche cruda, con fermentación espontánea, procesos de fabricación no tecnificados y tiempos de maduración variados(5,7,10) .

Rev Mex Cienc Pecu 2023;14(1):94-109 95

En México existen alrededor de 40 quesos artesanales(7), entre ellos se encuentran quesos madurados como el Cotija de la Sierra JalMich, el queso Añejo de Zacazonapan, el queso Maduro de Veracruz, el queso Chihuahua y el queso artesanal de la región de Ojos Negros de Baja California, de los cuales se han publicado algunos aspectos de su microbiología(1114) .

El queso de prensa (QP), se elabora con leche de vaca, sin pasteurizar, cuajo líquido comercial y sal; pasa por una etapa de prensado cuya duración varia a criterio del fabricante de 1 a 3 días, posteriormente se deja madurar por periodos de hasta tres meses. El queso así obtenido tiene variaciones de color entre blanco y amarillo(15) Generalmente tiene forma rectangular o circular, su consistencia es firme, y su peso es de 1 a 14 kg por pieza (Figura 1)(15)

Figura 1: Queso de Prensa en formas rectangular y cilíndrica

El QP es elaborado desde hace más de 100 años en el suroeste de México, principalmente en la región de la Costa Chica del estado de Guerrero en los municipios de Cuajinicuilapa y Ometepec, así como en el municipio de Pinotepa Nacional, en la costa del estado de Oaxaca(15). De acuerdo con el INEGI(16), el clima de la región Costa Chica es cálido subhúmedo y sus temperaturas oscilan de 22 a 28 °C.

Actualmente se realizan estudios para identificar las características de los quesos artesanales de México(7,15) , el objetivo de esta investigación fue analizar los cambios que ocurren en el recuento de bacterias mesófilas aerobias, microorganismos coliformes totales, bacterias ácido lácticas yestafilococos coagulasa positivos, durante la maduración (5, 30, 60 y90 días) de los quesos de prensa elaborados por cuatro queserías (A, B, C y D) de Cuajinicuilapa, Guerrero, México.

Rev Mex Cienc Pecu 2023;14(1):94-109 96

Material y métodos

Muestras de queso

Se analizaron muestras de QP producido de forma artesanal en el municipio de Cuajinicuilapa, Guerrero, México (16°28′18′ N, 99°24′55′ O), en julio de 2018. Con base a un muestreo dirigido, se seleccionaron como unidades de muestreo, cuatro queserías que en adelante se nombrarán A, B, C y D. En cada quesería se adquirieron cuatro quesos recién elaborados, de 1 kg de peso. Las muestras se trasladaron al municipio de San Marcos, Guerrero (16°47′46′ N, 99°23′05′ O) a un espacio con características similares a aquellas de las queserías de Cuajinicuilapa. En este lugar, las muestras de los quesos (cuatro de cada quesería) se dejaron madurar durante 5,30,60 y90días. Concluido el tiempo demaduración, cada lote se trasladó, en bolsas de polietileno, dentro de hieleras con refrigerante, al laboratorio. Las muestras se conservaron en refrigeración a 4 °C hasta su análisis. El tiempo máximo de maduración fue 90 días, debido a que después de ese período los sabores se intensifican y los consumidores locales lo evitan porque prefieren sabores más suaves.

Preparación de la muestra

Cada una de las muestras de queso (25 g) se mezcló con 225 ml de diluyente de peptona, la mezcla se homogeneizó durante 2 min (Vortex VWR symphony D S41 ®, VWR International) y se hicieron diluciones desde 10-1 hasta 10-6 mediante la transferencia de 1 ml de la muestra a frascos viales que contenían 9 ml de diluyente de peptona(17)

Recuento de microorganismos

Se utilizaron los siguientes medios de cultivo (3M Placas PetrifilmTM): recuento de aerobios (AC No. de catálogo 6400), recuento de coliformes (CT No. de catálogo 6410), bacterias ácido lácticas (No. de catálogo 6461) y staph express para estafilococos coagulasa positivos (No. de catálogo 6493); en cada una de las placas se colocó 1 ml de la dilución correspondiente(18-21) .

Todos los recuentos se hicieron por duplicado. Para BMA se sembraron las diluciones 10-3 y 10-4 y el medio se incubó a 35 ± 2 °C durante 48 ± 3 h(18). Los microorganismos CT fueron investigados a partir de las diluciones 10-2 y 10-3, incubándose a 35 ± 1 °C durante 24 ± 2 h(19). La determinación de BAL se hizo inoculando los medios con diluciones desde 10-3 a 10-6 e incubando a 35 ± 2 °C durante 48 ± 3 h(20). El estudio de ECP se llevó a cabo a partir de las diluciones 10-2 a 10-4 y una incubación de 37 ± 1 °C durante 24 ± 3 h(21) .

Rev Mex Cienc Pecu 2023;14(1):94-109 97

Una vez completado el tiempo de incubación se revisó el crecimiento yse contaron las placas que contenían entre 15 y 300 colonias, se obtuvo la media de las dos repeticiones y este promedio se multiplicó por el inverso de la dilución con que fue inoculada la placa(22) . El resultado del recuento se reportó como log10 del número de unidades formadoras de colonias por gramo (log10 UFC g-1)(23) .

Análisis estadístico

El análisis estadístico se fundamentó en un diseño con medias repetidas y asignación de tratamientos completamente al azar, ensayados a través del tiempo, cuyo modelo probabilístico corresponde a: �������� =��+���� +���� +(����)���� +�������� (24)

Donde: ��+���� +���� +(����)���� Eslamediadeltratamiento i enelmomento k,quecontienelosefectos del tratamiento, tiempo, y la interacción tiempo × tratamiento; �������� es el error aleatorio asociado a la medición en el momento k sobre j asignado al tratamiento i.

El efecto de los tratamientos (queserías A, B, C y D) se evaluó a través del tiempo de maduración (5, 30, 60 y 90 días) con cuatro repeticiones, generando 64 unidades experimentales, cada una constituida de 25 g de queso.

Las variables respuesta evaluadas fueron: cuenta total de bacterias mesófilas aeróbicas (BMA), coliformes totales (CT), bacterias ácido lácticas (BAL) y estafilococos coagulasa positivos (ECP). Los datos se analizaron mediante un modelo mixto(24,25) cuyo efecto aleatorio correspondeal tiempodemaduración yel efecto fijo alasqueserías. Paraidentificar el efecto de los tratamientos se aplicó el método de Tukey-Kramer (P<0.05). Los análisis se llevaron a cabo en el paquete SAS versión 9.1 (SAS Institute, Inc., Cary, NC, EUA).

Resultados y discusión

Duranteeltiempodemaduración,seobservóunadisminuciónenelrecuento delosdiferentes microorganismos. Los recuentos más altos de todos los grupos microbianos se alcanzaron a los cinco días de maduración mientras que los valores mínimos se registraron a los 90 días (Cuadro 1).

Rev Mex Cienc Pecu 2023;14(1):94-109 98

Rev Mex Cienc Pecu 2023;14(1):94-109

Cuadro 1: Recuento de grupos bacterianos, log10 UFC g-1, durante la maduración del Queso de Prensa elaborado en cuatro queserías (A, B, C y D) de Cuajinicuilapa, Guerrero, México

Grupo

bacteriano

Bacterias mesófilas aerobias (log10 UFC g-1)

Tiempo (días) Queserías A B C D

5 6.3143 ±0.2973 Cc 4.6802 ±0. 2973 Ba 5.8948 ±0.2973 Cb 5.9077 ±0.2973 Cb 30 5.1156 ±0.2973 Bb 4.3884 ±0. 2973 Ba 4.4981 ±0.2973 Ba 5.1043 ±0.2973 Bb 60 4.0021 ±0.2973 Ab 3.1505 ±0. 2973 Aa 4.4047±0.2973 Bbc 4.6703±0.2973 ABc 90 4.3178 ±0.2973 Ab 2.5638 ±0. 2973 Aa 2.4005 ±0.2973 Aa 4.3597 ±0.2973 Ab

Coliformes totales (log10 UFC g-1)

5 4.1093 ±0.1002 Cb 2.1505 ±0.1002 Aa 2.4203 ±0.1002 Aa 4.7211 ±0.1002 Db 30 3.7726 ±0.0541 Cc 2.8838 ±0.0541 Ba 3.7916 ±0.0541 Cc 3.0878 ±0.0541 Cb 60 2.3138 ±0.2854 Bb 2.3763 ±0.2854 ABb 2.2698 ±0.2854 Ab 1.5753 ±0.2854 Ba 90 <1 ±0.0440 Aa 2.3451 ±0.0440 Ab 2.0753 ±0.0440 Ab <1 ±0.0440 Aa

Bacterias ácido lácticas (log10 UFC g-1)

Estafilococos coagulasa positivos (log10 UFC g-1)

5 6.5457 ±0.0651 Dc 5.9454 ±0.0651 Cb 5.5084 ±0.0651 Ba 6.7366 ±0.0651 Cc 30 5.8336 ±0.0651 Cb 5.8231 ±0.0651 Cb 5.1193 ±0.0651 Ba 6.1241 ±0.0651 Cb 60 3.5524 ±0.0651 Ba 3.7918 ±0.0651 Ba 3.1945 ±0.0651 Aa 5.0914 ±0.0651 Bb 90 <1 ±0.0651 Aa <1 ±0.0651 Aa 3.2258 ±0.0651 Ab 4.2394 ±0.0651 Ac

5 5.6562 ±0.0540 Cb 3.7456 ±0.0540 Ba 5.6918 ±0.0540 Cb 5.8746 ±0.0540 Cb 30 3.6276 ±0.3811 Bb 2.2500 ±0.3811 Aa 3.7271 ±0.3811 Bb 3.8389 ±0.3811 Bb 60 2.6945 ±0.0438 Aa 2.7143 ±0.0438 Aa 2.7311 ±0.0438 Aa 2.8063 ±0.0438 Aa 90 2.5951 ±0.0524 Aa 2.4203 ±0.0524 Aa 2.6945 ±0.0524 Aa 2.5951 ±0.0524 Aa

Medias con letra minúscula en filas y medias con letra mayúscula en columna, seguidas de diferente letra, indican significancia estadística (Tukey, P<0.05).

99

Bacterias mesófilas aerobias

Enlos conteosdeBMA,sepresentarondiferencias significativas (P<0.05)entrelasqueserías (Cuadro 1). El decremento gradual de BMA del día 5 al 90 fue próximo a 2 log10 UFC g-1 , para las queserías A, B y D; mientras que para la quesería C fue de 3.49 log10 UFC g-1

La mayoría de los valores de BMA encontrados en el QP están dentro del rango de 4 a 9 logaritmos UFC g-1 , reportado para quesos elaborados a partir de leche cruda y madurados por 60 o más días(26). Dado que el proceso de maduración de los quesos conlleva la multiplicación de los microrganismos presentes, lo esperado en este tipo de productos son concentraciones de BMA de 4 a 9 logaritmos (104 a 109 UFC g-1), sin que esto implique un deterioro del alimento o sugiera condiciones no sanitarias ocurridas durante su elaboración o almacenamiento(26,27,28). En la región de Ojos Negros en el estado de Baja California a partir de un estudio que incluyó quesos madurados de 22 queserías, elaborados con leche cruda se reporta que las BMA se encontraron en un rango de 4.6 a 7.2 log10 UFC g-1(14) .

En estudios sobre la maduración del queso Cotija artesanal, salado y madurado a temperaturas de 14 °C a 32 °C, Chombo(11) reporta las siguientes variaciones en las BMA: 8.3, 7.0, 3.5 y4.7 log10 UFC g-1, en los días 8, 30, 60 y90, en tanto que Magallón(29) encontró 5.3 y 1.8 log10, en los días 30 y 90, respectivamente. Los recuentos encontrados en el QP a los 30 y 90 días son muy próximos a los reportados para el queso Cotija que se madura en rangos de temperatura similares a las del QP.

El decremento de las BMA fue común en los quesos de las cuatro queserías (Cuadro 1), lo cual refleja cierta homogeneidad en los procesos de fabricación y las condiciones de maduración de los quesos. La diferencia estadística (P<0.05) entre queserías sugiere variaciones cuantitativas o cualitativas en la microbiota del queso generadas por la leche y los microambientes propios de cada quesería. Cabe destacar que, entre el día 5 y el 60, se observa que las BMA de los quesos de la quesería A descienden 2.31 log10 UFC g-1 , sin embargo, entre el día 60 y 90 permanecen sin cambios; en tanto que las BMA de los quesos de la quesería C, del día 60 al 90 presentan una reducción de 2 log10 UFC g-1 .

El desarrollo de BMA en los quesos de la quesería A muestra capacidades de adaptación y sobrevivencia de las bacterias, en tanto que el decremento de BMA en los quesos de la quesería C exhibe una pérdida de viabilidad con la liberación de enzimas que contribuyen a la generación de sabores y texturas(5) . Ello sugiere que es conveniente investigar la relación de las características organolépticas del queso de prensa, entre queserías y entre diferentes concentraciones de BMA a través del tiempo de maduración, así como la relación de las BMA con la vida útil del queso a temperatura ambiente. Por otro lado, los estudios de BMA son útiles como etapa inicial en la búsqueda de cultivos iniciadores a partir de quesos

Rev Mex Cienc Pecu 2023;14(1):94-109 100

artesanales. Las variaciones en la concentración de sal y la humedad pudieron influir en la sobrevivencia de las BMA. Los resultados sugieren que, en los quesos de las queserías A y D existen bacterias adaptadas para sobrevivencia a largo plazo. En tanto que en los de las queserías B y C pueden estar presentes bacterias de sobrevivencia corta, y por tanto pueden contribuir más rápidamente a la producción de sabores, olores y texturas (agradables o desagradables)(5). Otra posibilidad es que, la reducción de BMA en los quesos de las queserías B y C se deba a la presencia de sustancias con acción antimicrobiana, originadas por el metabolismo de microorganismos, o por los cambios bioquímicos que ocurren en el queso, derivados de la proteólisis de la caseína para dar origen a péptidos con actividad antimicrobiana(5,30)

Bacterias coliformes totales

Los recuentos de coliformes totales en los quesos mostraron diferencias significativas (P<0.05) entre queserías durante el periodo de maduración (Cuadro 1). Los recuentos mayores se encontraron en el día 5 (4.72 log10 UFC g-1) ylos menores en el día 90 (<1 log10). El queso al ser una muestra sólida, obstaculiza un recuento directo, por lo que es necesario hacer una dilución inicial que conduce a que el nivel mínimo de detección sea 10 UFC g-1 , por ello la ausencia de crecimiento se reportó como < 1 log10.

Se observaron dos dinámicas diferentes, los quesos de las queserías A y D presentaron las mayores cargas iniciales deCT,quea los 30 díasdemaduración disminuyeron hasta alcanzar 3.72 a 3.10 log10 UFC g-1 , respectivamente (Cuadro 1). En los quesos de las queserías B y C, los CT mostraron niveles iniciales de 2 logaritmos, que se elevaron durante el primer mes y se mantuvieron con ligeras variaciones para coincidir en el día 90 con valores muy próximos entre ellas.

La dinámica de los CT en los quesos de las queserías A y D han sido reportadas en quesos maduros y está caracterizada por una disminución progresiva de los coliformes conforme avanza la maduración(31) lo cual se atribuye a la disminución del pH debidoa la fermentación de la lactosa(32) . En quesos madurados como el Cheddar, los coliformes mueren a una tasa de 0.3 log10 UFC g-1 por semana y en el Gouda a 0.7 log10 por semana(33) . Por lo anterior, la dinámica observada en los quesos de las queserías B y C es atípica, porque entre los días 5 al 30, ocurre un aumento de 0.73 y 1.37 log10, respectivamente, seguido en los días 60 a 90 por disminuciones muy pequeñas, 0.03 y 0.19 log10, respectivamente (Cuadro 1). Esto sugiere que hay aspectos comunes entre las dos queserías que favorecen la selección de bacterias que persisten durante la maduración, tales como la calidad del agua y de la leche, el personal o variantes en los procesos de elaboración o limpieza.

Rev Mex Cienc Pecu 2023;14(1):94-109 101

Los niveles aceptados de coliformes totales en quesos madurados son menores a 100 UFC/g (< 2 log10 UFC g-1)(34), valores que fueron alcanzados entre los días 60 y 90 (Cuadro 1) en las queserías A yD. De acuerdo con Metz(32) ,los quesos elaborados con leche cruda de buena calidad, bajo condiciones sanitarias higiénicas, aplicando buenas prácticas de manufactura y madurados adecuadamente, tendrán bajos niveles de bacterias coliformes totales, coliformes fecales, enterococos, Enterobacteriaceae y Escherichia coli

La actividad de los organismos coliformes en los quesos puede afectar negativamente sus características sensoriales(28,35). Sin embargo, se ha observado que ciertos géneros de coliformes contribuyen positivamente en la textura y características sensoriales del producto; además de que algunas cepas de Hafnia contribuyen a la acumulación de aromas, y generación de sabores(32,35,36) La persistencia de coliformes sugiere la posibilidad de la participación de dichos microorganismos en las características organolépticas de los quesos de las queserías B y C aspecto que no ha sido abordado en los estudios de quesos mexicanos.

Bacterias ácido lácticas

Durante el periodo de maduración, las cuentas de BAL de los quesos de las queserías estudiadas mostraron diferencias significativas (P<0.05) (Cuadro 1). En este grupo microbiano se registraron los mayores recuentos de todo el estudio. En el día 5 los recuentos oscilaron entre 5.50 y 6.73 log10 UFC g-1, estos valores fueron disminuyendo a partir del día 30. Del día 5 al 60 las reducciones fueron de 2.99, 2.15, 2.31 y 1.77 log10, para los quesos de las queserías A, B, C y D, respectivamente.

Durante la maduración de los quesos artesanales españoles Casar de Cáceres, Afuega´l Pitu y Cabrales se reportaron descensos en el recuento de lactococos de 2 a 3 log10 UFC g-1 entre el día 0 y el 60, en tanto que en el queso “La Serena” solo hubo una reducción menor a un logaritmo, hecho que se atribuye a que este queso tuvo un bajo contenido de sal durante las primeras semanas de maduración(5) Lo anterior sugiere que las reducciones observadas en el QP del día 5 al 60 están acordes a lo que ocurre con las bacterias ácido lácticas homofermentativas en quesos elaborados artesanalmente con microbiota autóctona(5) . Las concentraciones de BAL encontradas en el QP del día 60 al 90 son menores a las reportadas en quesos madurados de Europa, que presentan valores de 7 a 9 log10 UFC g-1(5,37,38) .

Con diferencias en el tipo de ganado y áreas geográficas, el queso Cotija y el QP comparten temperaturas, procesos de fabricación y maduración. En el queso Cotija se han encontrado incrementos ydecrementos pequeños en recuentos de BAL; un estudio reporta 2.6 log10 UFC g-1 en el día 30 con aumento a 2.9 log10 en el día 90(29), otro estudio señala 5.9 log10 en el día 60, que disminuye a 5.0 log10 en el día 90(11). Los datos anteriores sugieren que, tanto en el QP como en el Cotija, los recuentos de BAL tienden a ser menores que en otros quesos

Rev Mex Cienc Pecu 2023;14(1):94-109 102

madurados; esto podría tener una explicación por las temperaturas en que son madurados lo cual favorece una mayor pérdida de humedad que genera valores de actividad de agua y de relación humedad/sal que son inhibitorios para las BAL(5) .

Estafilococos coagulasa positivos

Los recuentos ECP de los quesos de las queserías estudiadas exhibieron diferencias significativas (P<0.05) durante el periodo de maduración (Cuadro 1). A partir del día 5 y hasta el 60, en los quesos de las queserías A, C y D se observó un decremento continuo de los ECP, seguido de una estabilización del día 60 al 90. En la quesería B hubo un decremento del día 5 al 30 seguido de un incremento del día 30 al 60 y una estabilización del día 60 al 90 (Figura 2). Las tasas de muerte de ECP (promedio de decremento log10 UFC g-1 dividido entre semana de maduración)(39) en los quesos de las queserías A y C fueron de 0.30 log10 y de 0.23 y 0.31 log10 en las queserías B y D, respectivamente.

Figura 2: Antagonismo y cambio en la concentración de bacterias ácido lácticas (BAL) respecto a estafilococos coagulasa positivos (ECP)

Para quesos elaborados con leche cruda, los límites aceptados de estafilococos coagulasa positivos son de 104 a 105 UFC g-1, que equivale a 4-5 log10 UFC g-1(40) , límites que fueron excedidos en el día 5 en las queserías A, C y D pero que se retornó a ellos en el día 30 y permanecieron hasta el día 90 (Cuadro 1). Los recuentos de ECP mayores a 4 log10 muestran la necesidad de aplicar medidas correctoras en la higiene del proceso de recolección de la leche, de fabricación del queso y la selección de materias primas(40) . Valores de 105 UFC g-1 o mayores conducen a investigar la presencia de toxina estafilocócica en los quesos(40), pues al ser termoestable puede persistir aún cuando los estafilococos hayan muerto. Generalmente

Rev Mex Cienc Pecu 2023;14(1):94-109 103

se necesitan concentraciones de 106 UFC g-1 para producir toxina suficiente (un nanogramo por gramo de queso) para causar un brote de enfermedad(5) .

Reducciones de Staphyloccocus aureus de 1 a 3 logaritmos han sido reportadas en diferentes quesos(41,42,43), cifras que coinciden con las reducciones de ECP durante la maduración del QP.

La tasa de muerte de S. aureus en Queso Manchego elaborado con leche cruda del día 1 al 60 es de 0.404 log10 UFC g-1(39) , las tasas de muerte de ECP en las queserías A, C y D (0.49, 0.50 y0.52)estuvieronpróximasaestevalorloquesugierequeeldecrementofueel esperado para este tipo de quesos (quesos de pasta prensa madurados). No se identificaron factores que expliquen la menor tasa de muerte observada en la quesería B (0.36).

El desarrollo y supervivencia de S. aureus son afectados por factores tales como: cambios fisicoquímicos ocurridos durante el proceso de la maduración, metabolitos secundarios generados por BAL, así como a la composición del producto, el periodo de almacenamiento y la temperatura(44,45) . Staphyloccocus aureus es inhibido por BAL mediante la competición de nutrientes, producción de ácido láctico, peróxido de hidrógeno y producción de sustancias antimicrobianas(46) , lo anterior puede explicar la disminución de ECP en los primeros 30 días de maduración, período en que los niveles de BAL fueron mayores (Figura 2). Entre el día 30 y 60 las condiciones de almacenamiento a temperatura ambiente pudieron aumentar la pérdida de humedad lo que cambia relación humedad/sal siendo inhibitoria para BAL(5) , esto favorece a S. aureus, lo que pudiera explicar su ligero aumento en la quesería B y la suspensión de su descenso en las queserías A, C y D.

Conclusiones e implicaciones

El queso de prensa es un queso elaborado artesanalmente madurado en clima cálido subhúmedo con participación de bacterias ácido lácticas autóctonas, cuyas concentraciones son menores a las reportadas para quesos europeos, pero semejantes a aquellas reportadas en elquesoCotija.Lasdiferenciasestadísticasdelos recuentosmicrobianos adiferentestiempos muestranloscambiosquevanocurriendoconformeavanzalamaduracióndel queso. Entanto que las diferencias estadísticas entre las queserías sugieren la existencia de microbiomas propios de cada quesería, los cuales pudieran ser capaces de generar variantes del QP entre los diferentes productores artesanales, aun cuando tengan procesos de producción similares. Los cambios en los recuentos de los grupos bacterianos estudiados pueden ser atribuidos a cambios fisicoquímicos ysucesionesenlaspoblacionesbacterianas propias delamaduración del queso y a las características de la microbiota presente en cada una de las queserías. Es conveniente explorar si la vida útil de este queso se prolonga más allá de los 90 días. El hallazgo de coliformes que persisten durante la maduración muestra la necesidad de

Rev Mex Cienc Pecu 2023;14(1):94-109 104

investigar si se trata de un caso excepcional, y las bacterias de este grupo contribuyen a las características agradables del queso o están relacionadas con su deterioro. Los datos de reducción y sobrevivencia de estafilococos coagulasa positivos generados en esta investigación pueden servir de referencia para iniciar y evaluar programas de mejora en este tipo de queserías. Si bien esta investigación comprendió cuatro queserías del principal municipio productor del QP, la información generada puede servir de referencia para la caracterización de este queso artesanal.

Agradecimientos y conflictos de intereses

Este trabajo de investigación fue posible gracias a la beca otorgada por el Consejo Nacional de Ciencia y Tecnología para los estudios de Maestría del primer autor. También agradecemos los comentarios hechos al manuscrito por los Doctores Angélica Luis Juan Morales y Ricardo Alaniz de la O. Ninguno de los autores tiene conflicto de intereses con respecto a la presente publicación.

Literatura citada:

1. Cidón CD, Canut E. Quesos españoles, ases en la mesa, comodines en la cocina. 1a ed. Madrid, ESP: Everest; 2003.

2. Yescas C, Santacruz J. Quesos mexicanos. 1a ed. México, Distrito Federal: Larousse; 2013.

3. Cheese.com specialty cheeses. Alphabetical list, find over 1833 specialty cheeses from 74 countriesintheworld´s greatestcheeseresource.https://www.cheese.com/alphabetical/. Accessed Jan 26, 2021.

4. KongoJM, MalcataFX.Cheese: Types ofcheeses -soft. In: CaballeroB, ToldráF, Pinglas PM, editors. Encyclopedia of food and health. 1rst ed. Oxford, GB: Academic Press; 2015:768–773.

5. Fox PF, Guinee TP, Cogan TM, McSweeney PLH. Fundamentals of cheese science. 2nd ed. New York, USA: Springer; 2017.

6. Santiago-López L,Aguilar-ToaláJE,Hernández-MendozaA,Vallejo-Cordoba B, Liceaga AM, González-Córdova AF. Invited review: Bioactive compunds produced during cheese ripening and health effects associated with aged cheese consumption. J DairySci 2018;101(5):3742–3757.

7. Villegas GA, Santos MA, Cervantes EF. Los quesos mexicanos tradicionales. 1a ed. Texcoco, MEX: Universidad Autónoma Chapingo; 2016.

Rev Mex Cienc Pecu 2023;14(1):94-109 105

8.Alejo-MartínezK,Ortiz-HernándezM,Recino-MetelinBR,González-CortésN, JiménezVera R. Tiempo de maduración y perfil microbiológico del queso de poro artesanal. ReIbCi 2015;2(5):15–24.

9. Sánchez-Valdés JJ, Colín-Navarro V, López-González F, Avilés-Nova F, Castelán-Ortega OA, Estrada-Flores JG. Diagnóstico de la calidad sanitaria en las queserías artesanales del municipio de Zacazonapan, Estado de México. Salud Publ Mex 2016;58(4):461–467.

10. Vasek O, Cardozo M, Fusco AJ. Producción artesanal de quesos. Sistema de transformación agroalimentario en la región correntina (Argentina). IV Congreso internacional de la red SIAL. Mar del Plata, provincia de Buenos Aires.2006:1–32.

11. Chombo-Morales P, Kirchmayr M, Gschaedler A, Lugo-Cervantes E, VillanuevaRodríguez S. Effects of controlling ripening conditions on the dynamics of the native microbial population of Mexican artisanal Cotija cheese assessed by PCR-DGGE. LWT-Food Sci Technol 2016;65:1153–1161.

12. Ramírez-Rivera EJ, Ramón-Canul LG, Torres-Hernández G, Herrera-Corredor JA, Juárez-Barrientos JM, Rodríguez-Miranda J, et al. Tipificación de quesos madurados de cabra producidos en la zona montañosa central del estado de Veracruz, México. Agrociencia 2018;52(1):15–34.

13. Sánchez-Gamboa C, Hicks-Pérez L, Gutiérrez-Méndez N, Heredia N, García S, NevárezMoorillón GV. Microbiological changes during ripening of Chihuahua cheese manufactured with raw milk and its seasonal variations. Foods 2018; 7(9):153.https:// www.mdpi.com/2304-8158/7/9/153. Accessed Jan 30, 2021.

14. Silva-Paz LE, Medina-Basulto G. E., López-Valencia G, Montaño-Gómez MF, VillaAngulo R, et al. Caracterización de la leche y queso artesanal de la región de Ojos Negros, Baja California, México. Rev Mex Cienc Pecu 2020;11(2):553-564. https://cienciaspecuarias.inifap.gob.mx/index.php/Pecuarias/article/view/5084. Consultado 30 Ene, 2021.

15. Sandoval-Alarcón F. Caracterización y análisis de la productividad del queso de prensa de la Costa Chica de Guerrero y Oaxaca [tesis maestría]. Texcoco, Estado de México: Universidad Autónoma Chapingo; 2016.

16. INEGI. Instituto Nacional de Estadística y Geografía. Guerrero, Clima. Recuperado de:http://www.cuentame.inegi.org.mx/monografias/informacion/gro/territorio/clima.as px?tema=me&e=12. Consultado 02 Sep, 2020.

Rev Mex Cienc
106
Pecu 2023;14(1):94-109

17. Romero-Castillo PA, Leyva-Ruelas G, Cruz-Castillo JG, Santos-Moreno A. Evaluación de la calidad sanitaria de quesos crema tropical mexicano de la región de Tonalá, Chiapas. Rev Mex Ing Quím 2009;8(1):111–119.

18. 3M México. Placas Petrifilm™ para el recuento de aerobios AC, guía de interpretación. Ciudad de México, México: 3M. 2017.

19. 3M México. Placas Petrifilm™ para el recuento coliformes, guía de interpretación. Ciudad de México, México: 3M. 2017.

20. 3M México. Placas para el recuento de bacterias ácido lácticas 3M® Petrifilm®, guía de interpretación. Ciudad de México, México: 3M. 2017.

21. 3M México. Placas Petrifilm™ Staph Express para recuento de Staphylococcus aureus, guía de interpretación. México DF, México: 3M. 2009.

22. Camacho A, Giles M, Ortegón A, Palao M, Serrano B, Velázquez O. Técnicas para el análisis microbiológico de alimentos, cuenta en placa de bacterias. 2a ed. México, DF, México: Facultad de Química.; 2009. http://depa.fquim.unam.mx/amyd/archivero/TecnicBasicas-Cuenta-en-placa_6527.pdf. Consultado 2 Sep, 2020.

23. FAO, WHO. Statistical aspects of microbiological criteria related to foods, a risk managers guide. 1st ed. Rome, ITA: Food and Agriculture Organization of the United Nations; 2016.

24. Little RC, Milliken GA, Stroup WW, Wolfinger RD, Schabenberger O. SAS® for mixed models. 2nd ed. Cary, North Carolina, USA: SAS Institute Inc; 2006

25. Stroup WW, Milliken GA, Claassen EA, Wolfinger RD. SAS® for mixed models: Introduction and basic applications. 3rd ed. Cary, North Carolina, USA: SAS Institute Inc; 2018.

26. Brooks JC, Martinez B, Stratton J, Bianchini A, Kroksrom R, Hutkins R. Survey of raw milk cheeses for microbiological quality and prevalence of foodborne pathogens. Food Microbiol 2012;31(2):154–158.

27. ICMSF. International Commission on Microbiological Specifications for Foods. Microorganismos de los alimentos 1. Técnicas de análisis microbiológico. 2da ed. Zaragoza, ESP: Acribia; 2000.

28. Fernández-Escartín E. Microbiología e inocuidad de los alimentos. 2da ed. Querétaro, MEX: Universidad Autónoma de Querétaro; 2008.

Rev Mex Cienc
107
Pecu 2023;14(1):94-109

29. Flores-Magallón R, Oliva-Hernández AA, Narváez-Zapata AA. Characterization of microbial traits involved with the elaboration of the Cotija cheese. Food Sci Biotechnol 2011;20(4):997–1003.

30. López-Expósito I, Miralles B, Amigo L, Hernández-Ledesma B. Health effects of cheese components with a focus on bioactive peptides. In: Frias J, Martinez-Villaluenga C, Peñas E, editors. Fermented foods in health and disease prevention. 1st ed. London, UK: Academy Press; 2017:239–273.

31. Asperger H, Brandl E. The significance of coliforms as indicator organisms in various types of cheese. Antonie van Leeuwenhoek 1983;48:635–639.

32. Metz M, Sheehan J, Feng PCH. Use of indicator bacteria for monitoring sanitary quality of raw milk cheeses – A literature review. Food Microbiol 2020;85(2020): 103283. https://www.sciencedirect.com/science/article/abs/pii/S0740002018311213?via%3Dih ub Accesed Jan 30, 2021.

33. Fox PF, Guinee TP, Cogan TM, McSweeney PLH. Fundamentals of cheeses science. 1st ed. Gaithersburg, Maryland, USA: Aspen Publisher 2000.

34.NACMCF. National Advisory Committe on Microbiological Criteria for Foods. NACMCF-Report-Process-Control-061015 (1) response to questions posed by the Department of Defense regarding microbiological criteria as indicators of process control or insanitary conditions, Washington DC, USA: United States Department of Agriculture; 2015. https://www.fsis.usda.gov/sites/default/files/media_file/202007/NACMCF-Report-Process-Control-061015.pdf . Accesed Aug 07, 2021.

35.Martin NH,TrmčićA, HsiehTH,BoorKJ,Wiedmann,M. Theevolvingroleofcoliforms as indicators of unhygienic processing conditions in dairy foods. Front Microbiol 2016;7:1549. https://www.frontiersin.org/articles/10.3389/fmicb.2016.01549/full. Accessed Aug 07, 2021.

36. Trmčić A, Chauhan K, Kent DJ, Ralyea RD, Martin NH, Boor KJ, et al Coliform detection in cheese is associated with specific cheese characteristics but no association was found with pathogen detection. J Dairy Sci 2016;99(8):6105–6120.

37. Khalid NM, Marth EH. Lactobacili – their enzymes and role in ripening and spoil age of cheese- A review. J Dairy Sci 1990;73(10):2669–2684.

38. Tavaria FK, Reis PJM, Malcata FX. Effect of dairy farm and milk refrigeration on microbiological and microstructural characteristics of matured Serra da Estrella cheese. Int Dairy J 2006;16(8):895–902.

Rev Mex Cienc
108
Pecu 2023;14(1):94-109

39. Nuñez M, Bautista L, Medina M, Gaya P. Staphylococcus aureus, thermostable nuclease and staphylococcal enterotoxins in raw ewes' milk Manchego cheese. J Appl Bacteriol 1988;65(1):29–34.

40. Commission Regulation (EC) No. 2073/2005 of 15 November 2005 on microbiological criteria of foodstuffs L338. Official Journal of the European Union 2005 L338: 1–26. https://eur-lex.europa.eu/legal-content/EN/ALL/?uri=CELEX%3A32005R2073 Accessed Sep 2, 2020.

41. Kirdar SS, Yurdakul O, Kalit S, Kalit M. Microbiological changes throughout ripening of Keş cheese. J Cent Eur Agric 2018;19(1):61–71.

42 Cardoso VM, Dias RS, Soares BM, Clementino LA, Araújo CP, Rosa CA. The influence of ripening period length and season on the microbiological parameters of a traditional Brazilian cheese. Braz J Microbiol 2013;44(3):743–749.

43. Çolaklar M, Taban BM, Aytaç SA, Barbaros H, Gürsoy A, Akçelik N. Application of bacteriocin-like inhibitory substances (BLIS)- Producing probiotic strain of Lactobacillus plantarum in control of Staphylococcus aureus in White-Brined cheese production. J AgrSci 2019;25(2019):401–408.

44. Bellio A, Astegiano S, Traversa A, Bianchi DM, Gallina S, Vitale N, et al. Behaviour of Listeria monocytogenes and Staphylococcus aureus in sliced, vacuum-packaged raw milk cheese stored at two different temperatures and time periods. Int Dairy J 2016; 57:15–19.

45. Stecchini MA, Sarais I, de Bertoldi M. The influence of Lactobacillus plantarum culture inoculation on the fate Staphylococcus aureus and Salmonella typhimurium in Montasio cheese. Int J Food Microbiol 1991;14(2):99–109.

46. Haines WC, Harmon LG. Effect of selected lactic acid bacteria on growth of Staphylococcus aureus and production of enterotoxin. Appl Microbiol 1973;25(3):436–441.

Rev Mex Cienc
109
Pecu 2023;14(1):94-109

https://doi.org/10.22319/rmcp.v14i1.6014

Artículo

Detección molecular de un fragmento del virus de lengua azul en borregos de diferentes regiones de México

Edith Rojas Anaya a

Fernando Cerón-Téllez b

Luis Adrián Yáñez-Garza c

José Luis Gutiérrez-Hernández b

Rosa Elena Sarmiento-Salas c

Elizabeth Loza-Rubio b*

a Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias (INIFAP). Centro Nacional de Recursos Genéticos. México.

b INIFAP. Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad (CENID-SAI), Campus Ciudad de México. Carretera México-Toluca Km 15.5, Colonia Palo Alto. 05110. Alcaldía Cuajimalpa de Morelos. Ciudad de México. México.

c Universidad Nacional Autónoma de México, FMVZ. México.

*Autor de correspondencia: eli_rubio33@hotmail.com; loza.elizabeth@inifap.gob.mx

Resumen:

La enfermedad de la lengua azul (LA) afecta diferentes especies de rumiantes silvestres y domésticos. En México, la enfermedad producida por el virus de la lengua azul (VLA), aún es reconocida como exótica, a pesar de que, en diferentes ocasiones se han detectado anticuerpos. El objetivo fue establecer técnicas moleculares usando un gen sintético que incluye los genes NS1 y NS3 como control positivo para establecer el diagnóstico del VLA en muestras de ovinos de diferentes regiones del país, mediante técnicas moleculares. Se obtuvieron 320 muestras totales de sangre completa de ovinos. Las muestras obtenidas se

110

evaluaron mediante RT-PCR punto final y RT-PCR en tiempo real estableciendo las condiciones por el grupo de trabajo. Se encontraron 12 muestras positivas de ovinos a la detección de NS1; estas muestras se secuenciaron obteniendo un fragmento de 101 pares de bases. Al realizar el alineamiento se obtuvieron identidades con secuencias reportadas en el GenBankcon fragmentos deNS1 desde89 %(p=1e-12)a98%(p=4e-13), correspondientes alos serotipos 10,11 y12. Deestasmuestras, seobtuvierondos muestras positivasdeovinos mediante el PCR tiempo real (PCR-tr), uno proveniente de Chiapas (raza Chiapas) y el otro de Tamaulipas (raza Suffolk). Los resultados de la PCRtr fueron corroborados por la CPASENASICA. Este trabajo, aporta por primera vez en México, la importancia de usar un gen sintético como control positivo, para realizar la detección en laboratorios oficiales BSL-2, lo cual en una emergencia sanitaria es de suma importancia.

Palabras clave: Lengua azul, Ovinos, Diagnóstico, Gen sintético, Genes NS1 y NS3.

Recibido: 01/07/2021

Aceptado: 31/08/2022

Introducción

El virus de lengua azul (VLA) pertenece al género Orbivirus y familia Reoviridae, es causante de la enfermedad de la lengua azul (ELA) afectando rumiantes tanto domésticos comosilvestres(1) .Elvirusposeeun genomaARNdedoblecadena (dsRNA)sentidonegativo conformado por 10 segmentos(2) . Es un virus sin envoltura, de cápside icosahédrica, con un diámetro aproximado de 90 nm. El genoma codifica para las proteínas estructurales que conforman la cápside externa e interna o core (VP1 - VP7), y las cuatro proteínas no estructurales, denominadas no estructurales (NS) que están involucradas en la replicación, maduración o salida del virión de las células infectadas). Los genes no estructurales son altamente conservados a través del género(3,4) . El gen NS1 codifica para una proteína del mismo nombre, la cual se expresa en mayor cantidad durante la replicación del VLA y es la proteína citoplasmática más abundante. Por otro lado, el gen NS3 codifica para la proteína NS3 que tiene función de viroporina, relacionada con la lisis celular(3,4) . Debido a lo anterior, los dos genes sehan utilizadocomo blancoen ensayos tamiz paralaidentificación de VLA(5) . El virus se transmite por medio de la picadura de mosquitos del género Cullicoides spp; por lo anterior, la presentación de la enfermedad está asociada a la diseminación de dicho vector, aunque se ha informado de otros vectores como las garrapatas(6); se sabe que el virus puede permanecer viable durante toda la vida del vector.

Rev Mex Cienc Pecu 2023;14(1):110-121 111

Actualmente, se han descrito 28 serotipos diferentes de VLA en todo el mundo(7) y el virus está distribuido prácticamente en todos los países que se dedican a la ganadería bovina y ovina. La enfermedad de la lengua azul (ELA) se puede presentar tanto en forma subclínica yclínica, especialmenteenovinos, yaqueenbovinos lamayoríadelasveces es asintomática. En los países en donde la enfermedad es endémica causa severas pérdidas económicas a los productores(8) El nombre “lengua azul” fue atribuido por africanos que observaron cianosis en la lengua de algunos animales, aunque este signo no se observa en todos los animales infectados, ya que los signos varían entre especies y es dependiente de la cepa Las lesiones como hiperemia y edema de los labios y cara; erosiones y úlceras orales y la típica cianosis en lengua son debidas a la infección de las células endoteliales que permiten aumento de la permeabilidad celular(9)

La Organización Mundial de Salud Animal (OIE)(10) clasifica a la enfermedad de lengua azul como un padecimiento de declaración obligatoria, por lo que el diagnóstico oportuno es importante. El grado de severidad de la enfermedad depende del serotipo, la cepa del virus, la especie, la edad y el estado inmunológico del animal, siendo los más afectados las ovejas y los venados cola blanca(11); en los ovinos el periodo de incubación del VLA es de seis a ocho días, sin embargo el ganado bovino rara vez muestra signos clínicos, pero mantienen una viremia prolongada(12) . Los cérvidos también pueden ser infectados por un orbivirus estrechamente relacionado responsable de la enfermedad hemorrágica epizoótica(13) . La ELA no es contagiosa y solo se transmite a través de insectos Culicoides, la distribución está asociada por tanto a la prevalencia del vector. En América del Norte se han identificado hasta cinco serotipos, sin embargo, solamente en Estados Unidos se ha informado de la presencia de siete(14) . La presentación del virus en América está asociado principalmente a la presencia de dos especies del vector C. sonorensis y C. insignis(15) . En cuanto a México, a pesar de que la enfermedad es considerada exótica; en los años 80s se informó serología positiva al virus tanto en ovinos como bovinos en diferentes regiones del país(16,17) . Por otro lado, en el año2015sepublicó ladetección de un fragmento genomaviral en tres especies deCulicoides (C. variipennis, C. sonorensis y C. occidentalis)(18) . Para poder definir los veintiocho serotipos del VLA hasta ahora descritos se utiliza el gen VP2(7) .

Finalmente, en el mes de febrero de 2021 se realizó la notificación de lesiones orales de ovinos por la Secretaria de Desarrollo Agropecuario, Pesca y Acuacultura (SEDPA) de Oaxaca en el Municipio de San Pedro Mixtepec. La CPA detectó dos muestras positivas al virus de lengua azul, utilizando la técnica de RT-PCR y la notificación se hizo en el Boletín Informativo de la CPA AVISE(19)

La ELA es de notificación obligatoria a la OIE, principalmente porque los nuevos brotes implican restricciones de circulación y comercio, lo que provoca graves pérdidas económicas. No obstante, a nivel mundial se implementa una vigilancia activa para detectar lainfecciónporVLAmediantediferentespruebas comoel aislamientodelvirusuotraprueba

Rev Mex Cienc Pecu 2023;14(1):110-121 112

de detección o serología(11) . El método de detección por excelencia es el aislamiento del virus en cultivos celulares permisivos, para posteriormente realizar el análisis genético del virus, que permita determinar el serotipo presente en la muestra del animal afectado. En las zonas endémicas del virus, se recomienda el control de los vectores para impedir la diseminación, además de programas de vacunación. En Estados Unidos y Europa, se han empleado vacunas vivas atenuadas El objetivo de este trabajo fue establecer técnicas moleculares utilizando un gen sintético como control positivo que incluyera los genes NS1 y NS3, para posteriormente evaluar muestras de ovinos, de diferentes regiones del país.

Material y métodos Muestras

Se realizó un muestreo por conveniencia de ovinos aparentemente sanos, obteniendo 3 ml de sangre completa con anticoagulante (heparina) de 320 individuos, provenientes de cinco estadosdelpaís(Chiapas,Coahuila,EstadodeMéxico,Morelos yTamaulipas). Lasmuestras seobtuvieronduranteelveranodel2016al2018.Elmuestreoserealizóenmachos yhembras reproductoras de entre uno y cinco años. El total de muestras analizadas se encuentran descritas en el Cuadro 1.

Cuadro 1: Muestras de sangre obtenidas de ovinos en cinco Estados de la República Mexicana y analizadas para la detección molecular del virus de lengua azul por RT-PCR Estado Especie Sexo Raza Total Chiapas

Rev Mex Cienc Pecu 2023;14(1):110-121 113
Ovinos H Criollo 20 M Criollo 5 S/D S/D 66 Coahuila Ovinos H Cruza 70 Dorper 37 Suffolk 13 Ovinos H Blackbelly 1 Criollo 29 Pelibuey 1 Morelos Ovinos S/D S/D 62
Tamaulipas Ovinos H Pelibuey 8 Dorset 4 Suffolk 4 Total 320 H= hembra; M= macho; S/D= sin dato.

Gen sintético

Debido a que la ELA se considera exótica en México, se diseñó un gen sintético para posteriormente ser usado como control positivo, con la finalidad de no utilizar al virus inactivado o material genético del mismo en un laboratorio BSL2. Para lo anterior, fueron insertados en el vector pUC57 (GeneScript, USA), dos fragmentos del genoma viral, uno correspondiente al gen NS1 (354 pb) y otro correspondiente al gen NS3 (300 pb) tomando como base las secuencias del BTV-11 reportadas en el GenBank (KF986511 y KM580467, respectivamente). Para su uso como control positivo en los ensayos moleculares, la concentración del plásmido fue ajustado a 100ng/µl.

Extracción de material genético

El ARN viral fue extraído a partir de 250 l de la muestra de sangre utilizando Trizol LS® Reagent (Ambion, USA), siguiendo las instrucciones del fabricante con algunas modificaciones en el protocolo. El ARN obtenido se almacenó a -70 °C hasta su uso.

Ensayos moleculares

Gen constitutivo. Con la finalidad de verificar la calidad del ARN obtenido, se amplificó mediante RT-PCR un fragmento del gen constitutivo GAPDH utilizando los iniciadores y condiciones reportados por González-Arto M, et al(20) . Como plantilla se utilizó ADN complementario sintetizado a partir del ARN viral utilizando el kit MMLV Retrotranscriptase (Invitrogen, USA).

Detección de un fragmento del gen NS3. El ARN extraído de las muestras fue utilizado como plantilla para la detección de un fragmento del gen NS3 de los orbivirus utilizando un par de iniciadores y la sonda recomendados en el Manual de la OIE10 La RT-PCRtr se llevó a cabo mediante un protocolo de amplificación en un solo paso establecido en el laboratorio utilizando el kit iTaq universal probe one step (Bio-Rad, USA).

Detección de un fragmento gen NS1. Con la finalidad de corroborar la presencia del genoma del VLA en las muestras positivas a la RT-PCR en tiempo real, se estableció un protocolo para la detección de un fragmento del gen NS1, utilizando iniciadores descritos en el Manual de la OIE(10) . Para lo anterior se utilizó el Kit iProof HF Master Mix (Bio-Rad, USA). Los productos de amplificación de positivos a dicho protocolo se purificaron en geles de agarosa y fueron secuenciados por el método de Sanger en la Unidad de Síntesis y Secuenciación del IBT-UNAM.

Rev Mex Cienc Pecu 2023;14(1):110-121 114

Secuenciación. Los resultados de la secuenciación fueron analizados con la herramienta BLAST del NCBI. Las secuencias obtenidas fueron comparadas con 29 secuencias reportadas en el Gene Bank del virus de lengua azul y con la secuencia AM745001.1 del virus de la fiebre epizoótica hemorrágica como outgroup. El alineamiento fue realizado utilizando el“Multiple alignment program for amino acid or nucleotide sequences”(MAFFT ver 7, AIST). Se realizó el análisis filogenético utilizando métodos bayesianos (Markov Chain Monte Carlo) yel alineamiento se llevó a cabo con Mesquite en el software Mr. Bayes (Open source)

Resultados

Como un ensayo de evaluación de la calidad del material genético se llevó a cabo la amplificación de un fragmento de aproximadamente 400 pb del gen GAPDH ovino, como se describe previamente. Todas las muestras utilizadas para la detección de un fragmento genoma viral fueron positivas a la amplificación de GAPDH por RT-PCR, lo que indica que el material genético estaba íntegro y en buen estado para su uso en los ensayos de RT-PCR (Figura 1)

Figura 1: RT-PCR para la amplificación del gen constitutivo GAPDH Ovino

Carril 1, Marcador de tamaño de fragmento 50pb (Low Mass ladder); Carril 2-7, muestras de ovino. Los productos de amplificación se corrieron en un gel de agarosa al 1.5%.

En cuanto al ensayo de detección de un fragmento del gen NS1 mediante el RT-PCR punto final,seobtuvolaidentificacióndedicho gen en12 muestrasdesangredeovinos proveniente de los estados de Chiapas, Coahuila y Tamaulipas. Con la finalidad de armonizar los métodos, se decidió utilizar iniciadores sugeridos por la OIE, como se describe previamente. El análisis de las secuencias obtenidas mostró en el alineamiento identidad con secuencias

Rev Mex Cienc Pecu 2023;14(1):110-121 115

reportadas en el GenBank con el fragmento del NS1 desde 89 % (p= 1e-12) a 98 % (p= 4e13), correspondientes a los serotipos 10, 11 y 12.

Los resultados de la inferencia filogenética se observan en la Figura 2 en donde se muestra el agrupamiento de las muestras primordialmente con los serotipos 10 y 11. Los resultados positivos se corroboraron por el método de RT-PCR en tiempo real en dos de las muestras una de Chiapas y otra de Tamaulipas; como se ha mencionado el RT-PCRtr utiliza el gen NS3.

Figura 2: Inferencia filogenética de muestras de ovinos positivas al gen NS1 del virus de lengua azul

El dendograma fue obtenido utilizando el alineamiento de 100 pb del gen NS1 de las secuencias de las muestras positivas en este estudio y de 30 secuencias obtenidas del GenBank pertenecientes a los serogrupos 10, 11 y 12. Las muestras positivas de ovinos mediante el RT-PCR en punto final están identificadas como: OT=Ovinos Tamaulipas: OT1, OT2, OT3, OT4, OT5. OC=Ovinos Chiapas: OC1, OC2, OC3, OCF10, OCF39, OC5, OC4. Las razas están indicadas por color: Criollo Pelibuey Suffolk y Dorper Las muestras fueron tomadas entre 2016 y 2017. Como outgroup se utilizó la secuencia del virus de la fiebre epizoótica hemorrágica (AM745001) indicado con .

El resultado positivo a la detección por RT-PCRtr fue corroborado por el laboratorio de CPA del SENASICA y notificado al SIVE. En dicho laboratorio se utiliza de igual manera la detección de un fragmento del gen NS3, como control positivo se utiliza ARN viral que se obtiene a partir de sobrenadante de cultivos celulares infectados con el virus que

Rev Mex Cienc Pecu 2023;14(1):110-121 116

posteriormente se inactivan (comunicación personal CPA). Con respecto a los ensayos realizados en colaboración con el laboratorio oficial, para corroborar los resultados de los animales que resultaron positivos, el control sintético propuesto en este trabajo mostró que podría utilizarse sin problema en cualquier laboratorio BSL2 para realizar la detección del virus en laboratorios oficiales BSL2.

Discusión

Como se ha mencionado, la ELA en diferentes hospederos puede ser subclínica y por tanto la detección del agente causal en poblaciones ovinas puede ser compleja(21) . Por lo anterior, para este estudio en el muestreo fueron considerados animales clínicamente sanos, donde el estado de la viremia en los animales y los signos pueden o no ser observados, dependiendo de la carga viral o de los subtipos de los que se trate. Adicionalmente, se consideró para el muestreo Entidades Federativas del país en zonas donde el vector transmisor del virus está presente con un clima idóneo para su desarrollo(22), así como que los borregos estuvieran cercanos a explotaciones de ganado bovino, ya que esta especie puede ser portadora sana del virus.

Respecto al diagnóstico del agente causal de la ELA, el método recomendado es por aislamiento del virus en cultivo celular o huevos embrionados(23) , sin embargo, se han desarrollado diferentes versiones de RT-PCR que pueden emplearse para detectar el VLA específicamente el serogrupo de los Orbivirus y para determinar el serotipo del VLA. Estos enfoques moleculares son mucho más rápidos que los métodos virológicos e inmunológicos tradicionales, que pueden tardar hasta cuatro semanas en suministrar información sobre serogrupos y serotipos, actualmente, existen ensayos dirigidos principalmente para las proteínas VP1, NS1, NS2, VP6 y NS3. Ninguna de estas proteínas tiene relación con la serotipificación del virus, y son fuertemente conservadas entre serotipos de VLA, algunas, como el caso de NS3 tiene mayor grado de conservación entre Orbivirus. Y, por tanto, estos ensayos carecen de potencial para clasificar los aislados(24) .

Adicionalmente, cada técnica tiene un rango de detección del virus o del genoma, por ejemplo, Bonneau et al(25) informanqueel ensayo deRT-PCR es capaz dedetectar el genoma desde 3 hasta 122 días. Por lo que, es de relevancia hacer la recomendación de realizar muestreos y campañas de vigilancia no solo en rumiantes, sino además en los posibles vectores que están reportados como transmisores del virus.

En México, la ELA es considerada como exótica, sin embargo, este estatus debería ser reconsiderado tomando en cuenta las diferentes notificaciones realizadas desde los años 80s a la fecha en diferentes regiones del país; esto permitiría evaluar la presencia del virus en diferentes hospederos y vectores utilizando varios métodos. En 1981 con el trabajo de

Rev Mex Cienc Pecu 2023;14(1):110-121 117

Moorhead et al(26) , se determinó la presencia de anticuerpos por inmunoprecipitación en ovinos sacrificados en el rastro encontrando 8.5 % de positividad en suero. Posteriormente, Vilchis et al (1986)(27) utilizando inmunodifusión demostraron 27.4 % de seropositividad en los animales muestreados. Stott et al(28) informaron seropositividad de 6 %, 35 % y 60 % en tres estudios independientes en ganado de diferentes estados del país. La publicación científica más reciente fue informada por Lozano-Rendón JA y su grupo de trabajo(17) donde se demostró un 14.4 % en la detección molecular del gen NS1 del VLA en vectores Culicoides en estado de Nuevo León.

En cuanto a los resultados presentados en esta investigación se detectó un 3.75 % de positividad en las muestras de ovinos clínicamente sanos, utilizando el mismo gen NS1 que Lozano-Rendón et al(15); sin embargo, este estudio se realizó en el vector, en donde la probabilidad de demostrar la presencia del virus es mayor que en los ovinos, en donde el tiempo de viremia es más corto. Dicho gen NS1, como ya se ha mencionado, es uno de los más conservados, entre los diferentes serotipos de VLA(29) . Los resultados de la detección de un fragmento del genoma viral en muestras de ovino en este estudio coinciden con lo notificado este año por la CPA(19) .

Por otro lado, el porcentaje de detección es similar a lo descrito en los reportes más antiguos en donde se utilizan muestras de rumiantes. Los resultados informados en el presente trabajo, así como los presentados por otros autores, hacen manifiesta la necesidad de cambiar el estatus de la enfermedad, así como de implementar sistemas de vigilancia del virus, tanto en los vectores, como en los principales hospederos del virus, sean animales domésticos, como silvestres.

Conclusiones e implicaciones

Se presenta como una alternativa el uso de un control positivo sintético que evitaría el uso de ARN viral, que solo puede ser utilizado en laboratorio BSL3 de las instancias ofíciales del país. Con el uso del control positivo sintético se aumentaría la red de laboratorios capaces de implementar la técnica de detección viral y por tanto determinar el estatus real de la enfermedad en el país.

Agradecimientos

Los autores agradecen la colaboración del M en C Roberto Navarro López, Dra. Marcela Villarreal Silva, MC Mariana García Plata y al MVZ Martín García Osorio por su colaboración en corroborar resultados en el Laboratorio de CPA-SENASICA. La presente investigación fue financiada por el proyecto INIFAP No. 12583634008 y la ficha validada 914545716.

Rev Mex Cienc Pecu 2023;14(1):110-121 118

Literatura citada:

1. Qing-Long G, Wang Q, Yang XY, Li DL, Zhao B, Ge GY, et al. Seroprevalence and risk factors of the bluetongue virus in cattle in China from 1988 to 2019: A comprehensive literature review and meta-analysis. Front Vet Sci 2021;7:550381 doi: 10.3389/fvets.2020.550381.

2. Maclachlan NJ. Bluetongue: History, global epidemiology, and pathogenesis. Prev Vet Med 2011;102(2):107– 111.

3. Chacko N, Mohanty NN, Biswas SK, Chand K, Yogisharadhya R, et al. A coiled-coil motif in non-structural protein 3 (NS3) of bluetongue virus forms an oligomer. Virus Genes 2015;51(2):244–251 doi 10.1007/s11262-015-1230-9.

4. Roy P. Bluetongue virus proteins and particles and their role in virus entry, assembly and release. Adv Virus Res 2015;64:69–123. doi.org/10.1016/S0065-3527(05)64004-3.

5. Schwartz-Cornil PP, Mertens V, Contreras B, Hemati F, Pascale E, Breard et al. Bluetongue virus: virology, pathogenesis and immunity. Vet Res 2008;39(5):46. doi: 10.1051/vetres:2008023.

6. Sperlova A, Zendulkova D. Bluetongue: a review. Vet Med 2011;56:430–452.

7. Bumbarov V, Golender N,Jenckel M, WernikeK,Beer M, Khinich E, ZaleskyO,Erster O. Characterization of bluetongue virus serotype 28. Transb Emer Dis 2020;67(1):171–182. doi.org/10.1111/tbed.133338.

8. Maclachlan NJ, Drew CP, Drew CP, Darpel KE, Worwa G. The pathology and pathogenesis of bluetongue. J Comp Pathol 2009;141:1-16. doi.org/10.1016/j.jcpa.2009.04.003.

9. Drew CP, Heller MC, Mayo C, Watson JL, Maclachlan NJ. Bluetongue virus infection activatesbovinemonocyte-derivedmacrophages andpulmonaryarteryendothelialcells. Vet Immunol Immunopathol 2010;136(3–4):292–296. doi:10.1016/j.vetimm.2010.03.006.

10. OIE. Enfermedades, infecciones e infestaciones de la Lista de la OIE en vigor en 2019. http://www.oie.int/es/sanidad-animal-en-el-mundo/enfermedades-de-la-lista-de-la-oie2018/. Consultado 16 Nov, 2019.

11. Rojas JM, Rodríguez-Martín D, Martín V, Sevilla N. Diagnosing bluetongue virus in domestic ruminants: current perspectives. Vet Med Res Report 2019;10:17–27.

Rev Mex Cienc Pecu
119
2023;14(1):110-121

12. Barratt-Boyes SM, Maclachlan NJ. Dynamics of viral spread in bluetongue virus infected calves. Vet Microbiol 1994;40(3–4):361–371. doi.org/10.1016/03781135(94)90123.

13. Falconi C, López-Olvera JR, Gortázar C. BTV infection in wild ruminants, with emphasis on red deer: a review. Vet Microbiol 2011;151(3-4)209-219. doi.org/10.1016/j.vetmic.2011.02.011.

14. Drolet S, Rijn P, Howerth E, Beer M, Mertens P. A review of knowledge gaps and tools for Orbivirus research. Vector-borne Zoon Dis 2015;15(6): 339-347. doi: 10.1089/vbz.2014.1701.

15. Gay GC. Orbiviruses: A gap analysis. Vector Borne Zoonotic Dis- 2015;15(6):333-334. doi:10.1089/vbz.2015.28999.cgg.

16. Suzan VM, Misao O, Romero EA, Yosuke M. Prevalence of bovine herpesvlrus-1, paraenfluenza-3, bovine rotavirus, bovine viral diarrhoea, bovine adenovirus 7, bovine leukemia virus and bluetongue virus antibodies in cattle in Mexico. Jpn J Vet Res 1983;31(3-4): 125-132.

17. Vilchis C, GayJ, Batalla D. Determinación de anticuerpos contra el virus de lengua azul en ovinos por la técnica de inmunodifusión. Tec Pecu Méx 1986;51:116-121.

18. Lozano-Rendón JA, Contreras-Balderas AJ, Fernández-Salas I, Zarate-Ramos J, Avalos-Ramírez R. Molecular detection of bluetongue virus (BTV) and epizootic hemorrhagic disease virus (EHDV) in captured Culicoides spp. in the northeastern regions of Mexico. Afr J Microbiol Res 2015;9(45):2218-2224.

19. Boletín Informativo de la CPA. AVISE. No 9 Febrero, 2021. https://issuu.com/boletinavise/docs/boletin_avise_ed09_febrero

20. Gonzalez-Arto M, Hamilton dos STR, Gallego M, Gaspar-Torrubia E, Aguilar D, Serrano-Blesa E, et al. Evidence of melatonin synthesis in the ram reproductive tract. Andrology 2016;4(1):167-171. doi: 10.1111/andr.12117.

21. Celma CC, Bhattacharya B, Eschbaumer M, Wernike K, Beer M, Roy P. Pathogenicity study in sheep using reverse-genetics-based reassortant bluetongue viruses Vet Microbiol 2014;174(1-2):139-47. doi: 10.1016/j.vetmic.2014.09.012.

22. SIAP. Producción por Estado. 2016. http://infosiap.siap.gob.mx/anpecuario_siapx_gobmx/apecnal.jsp?id=5.

23. McHolland LE, Mecham JO. Characterization of cell lines developed from field populations of Culicoides sonorensis (Diptera: Ceratopogonidae). J Med Entomol 2003;40(3):348-51. doi: 10.1603/0022-2585-40.3.348.

Rev Mex Cienc
120
Pecu 2023;14(1):110-121

Pecu 2023;14(1):110-121

24. Maan S, Maan NS, Belaganahalli MN, Potgieter AC, Kumar V, Batra K, et al. Development and evaluation of Real Time RT-PCR assays for detection and typing of Bluetongue Virus. PLoS ONE 2016;11(9): e0163014. doi: 10.1371/journal.pone.0163014

25. Bonneau KR, DeMaula CD, Mullens BA, Maclachlan NJ. Duration of viraemia infectious to Culicoides sonorensis in bluetongue virus-infected cattle and sheep. Amsterdam: Elsevier Scientific Publishing Co; 2002.

26. Moorhead JR. Estudio de la presencia de anticuerpos precipitantes contra el virus de la Lengua Azul en ovinos y bovinos sacrificados en el Rastro de Ferrería de la Ciudad de México, DF [tesis]. Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Autónoma de México;1981.

27. Vilchis CM, Gay GJ, Batalla D. Determinación de anticuerpos contra el virus de lengua azul en ovinos por la técnica de inmunodifusión. Tec Pecu Méx 1986;51:116-121.

28. Stott JL, Blanchard-Channell M, Osburn BI, Riemann HP, Obeso RC. Serologic and virologic evidence of bluetongue virus infection in cattle and sheep in Mexico. Am J Vet Res 1989;50(3):335–340.

29. Mertens PP, Diprose J, Maan S, Singh KP, Attoui H, et al. Bluetongue virus replication, molecular and structural biology. Vet Italiana 2004;40(4):426-437.

Rev Mex Cienc
121

https://doi.org/10.22319/rmcp.v14i1.6241

Artículo

Concentraciones del factor de crecimiento similar a la insulina 1 (IGF-1) en el líquido sinovial de caballos sanos y osteoartríticos, y su correlación con las citoquinas proinflamatorias IL-6 y TNFα

Fernando García-Lacy F. a

Sara Teresa Méndez-Cruz b

Horacio Reyes-Vivas b

Victor Manuel Dávila-Borja c

Jose Alejandro Barrera-Morales d

Gabriel Gutiérrez-Ospina e

Margarita Gómez-Chavarín f*

Francisco José Trigo-Tavera g

a UniversidadNacionalAutónomadeMéxico.FacultaddeMedicina Veterinaria yZootecnia. Departamento de Medicina, Cirugía y Zootecnia para Équidos. Ciudad de México. México.

b Instituto Nacional de Pediatría Laboratorio de Bioquímica Genética. Ciudad de México. México.

c Instituto Nacional de Pediatría Laboratorio de Oncología Experimental. México.

d SEDENA. Centro Ecuestre de Alto Rendimiento. Ciudad México. México.

e Universidad Nacional Autónoma de México. Departamento de Fisiología. Instituto de Investigaciones Biomédicas. Ciudad de México. México.

f Universidad Nacional Autónoma de México Facultad de Medicina. Departamento de Fisiología. Ciudad de México. Mexico.

g UniversidadNacionalAutónomadeMéxico.FacultaddeMedicinaVeterinaria yZootecnia. Departamento de Patología. Ciudad de México. México.

122

*Autor de correspondencia: margaritachavarin@gmail.com

Resumen: El factor de crecimiento similar a la insulina I (IGF-1) es el factor de crecimiento conocido más importante para la reparación del cartílago en caballos. Promueve la mitosis de los condrocitos, la expresión de colágeno II y la producción de matriz extracelular. La osteoartritis (OA) es la condición musculoesquelética más común que causa cojera y bajo rendimiento en caballos deportivos. Se evaluó clínica y radiográficamente un total de 11 caballos cojos, y se confirmó que todos sufrían una cojera metacarpofalángica frontal mediante una prueba de flexión positiva, un bloqueo nervioso en 4 puntos bajos yun bloqueo intraarticular. La proteína total, IGF-1, IL-6 y TNFα se determinaron por ELISA, lo que demostró cambios y diferentes correlaciones entre la condición clínica, los cambios radiográficos y el grado de inflamación. Todos los caballos con dolor asociado a las articulaciones y, por lo tanto, asociado a la cojera, mostraron un aumento significativo de la proteína total (P<0.0001) y la concentración de IGF-1 (P<0.05). Las concentraciones de IL6 yTNFαentreloscontrolesylos caballoscojosmostrarondiferenciassignificativas(P<0.01 y P<0.001 respectivamente). Los caballos con menos cambios radiográficos mostraron la mayor expresión de IGF-1 en el líquido sinovial, y los caballos con condiciones de OA más crónicas tuvieron niveles de expresión de IGF-1 muy similares a los de las articulaciones de control. En todas las articulaciones cojas, se identificó por medio de Western blot una isoforma de IGF-1 más ligera (~ 7.5 kDa) que estaba relacionada con la inflamación y es el peso molecular del péptido maduro, y todas las articulaciones de control expresaron una isoforma más pesada (~ 12 kDa). Este hallazgo podría conducir a una nueva investigación para secuenciar y apuntar a la isoforma que no se expresa durante un proceso inflamatorio dentro de una articulación, y para tener una mejor comprensión de su papel en la articulación del caballo.

Palabras clave: Factor de crecimiento similar a la insulina 1 (IGF-1), Caballo, Osteoartritis (OA), Cojera

Recibido: 21/05/2022

Aceptado: 07/09/2022

Rev Mex Cienc Pecu 2023;14(1):122-136 123

Introducción

El factor de crecimiento similar a la insulina I (IGF-1, del inglés insulin-like growth factor I) es el factor de crecimiento conocido más importante para la reparación del cartílago en caballos, ya que estimula la síntesis de proteoglicanos y, por lo tanto, la matriz extracelular (MEC), y promueve la mitosis de los condrocitos. Tiene una importante actividad promotora del crecimiento no solo en el cartílago articular, sino en varios tejidos, principalmente en el músculo, los huesos y el cerebro. Activa la vía de las proteínas quinasas activadas por mitógenos (MAPK, del inglés mitogen-activated protein kinase), que tiene varios efectos en la promoción de: la supervivencia, crecimiento, proliferación celular, protección contra la hipoxia, regulación de la inflamación en lesiones musculares y en placas de crecimiento óseo(1-4) . También tiene un papel clave en el desarrollo del cerebro, junto con el estradiol, regulando una variedad de eventos neuroplásticos y de desarrollo(5). En estructura, es muy similar a la insulina. Cuando se instila insulina en una articulación, se mejora la expresión de IGF-1 en el líquido sinovial(6)

Las lesiones del cartílago articularnormalmente se reparanporsustitución confibrocartílago, loqueconducealapérdidadelafuncióndelaarticulaciónqueresultaenosteoartritis(OA)(7) La cojera es la razón más frecuente por la cual se requieren clínicos equinos por parte de los propietarios de caballos, y la OA representa más del 60 % de todos los casos de cojera en caballos deportivos(8). El principal problema en la OA es la inflamación, que condiciona un desequilibrio entre catabolismo y anabolismo en el cartílago articular. En este tejido en particular, el único componente celular está constituido por condrocitos, que son responsables de la síntesis de MEC, con el fin de mantener una función adecuada del cartílago.

Existe evidencia con respecto a la eficacia exógena del IGF-1 in vitro, que mejora la síntesis de proteoglicanos mediante condrocitos estimulados. Otras terapias, como el trasplante de condrocitos de condrocitos maduros y neonatales, las estrategias de terapia génica para aumentar la expresión de IGF-1 por condrocitos transfectados, requieren anestesia general, un procedimiento quirúrgico y, por lo tanto, equipo y personal especializado(9) .

En un estudio piloto realizado por los autores en el que se obtuvieron 13 muestras de líquido sinovial de diferentes articulaciones (articulaciones interfalángicas distales, articulaciones metacarpofalángicas,articulacionesdelhombro,articulacionestarsometatarsianas ybabillas) de caballos con cojera asociada grado AAEP (American Association of Equine Practitioners): 2/5, sin cambios radiográficos, pero una respuesta positiva en la prueba de flexión de 1 min. Por ELISA, se encontró un aumento significativo de IGF-1 y una correlación positiva entre los niveles de proteína total e IGF-1 en el líquido sinovial (datos no mostrados). En este estudio se obtuvieron muestras de líquido sinovial de 21 caballos con

Rev Mex Cienc Pecu 2023;14(1):122-136 124

diferentes grados de OA (confirmados por bloqueo intraarticular y cambios radiográficos) en la articulación metacarpofalángica (AMCF), donde el IGF-1 y la proteína total se correlacionaron positivamente en caballos con OA aguda, y negativamente en caballos con OA crónica y marcada remodelación ósea. En caballos con cambios leves o no radiográficos (OA aguda), el IGF-1 se correlacionó negativamente con la interleucina-6 (IL-6) y el factor de necrosis tumoral alfa (TNFα, del inglés tumor necrosis factor alpha). Curiosamente, fue posible encontrar por Western blot, al menos dos isoformas funcionales de IGF-1 expresadas en líquido sinovial, una presente solo en caballos de control, y la otra en caballos cojos.

Hasta donde se sabe, no hay información con respecto a las fluctuaciones de IGF-1 en la OA que ocurre de forma natural. No hay estudios in vivo con respecto a los niveles del IGF-1 durante la OA. Tal vez este documento puede ayudar a los clínicos a comprender el papel del IGF-1 para esta condición particular y podría usarse como línea base para estudios adicionales sobre la concentración de IGF-1 y su posible uso como tratamiento alternativo.

Material y métodos

Se obtuvieron muestras de líquido sinovial de caballos Warmblood y Thoroughbred (n=11) de dos disciplinas diferentes: caballos de salto (Warmblood) (n=8) y caballos de carrera (Thoroughbred) (n=3) con una edad media de 10.5 años y un peso medio de 520 kg. Las muestras de control (Ctrl) se obtuvieron de dos caballos castrados, Warmblood de 5 y7 años. No había más caballos de control disponibles para el estudio, ya que todos estaban sanos, no fue fácil obtener el consentimiento de los propietarios para tomar muestras de sus articulaciones. Se realizó una evaluación completa de cojera y una evaluación radiográfica en todos los caballos de control para ser incluidos en este estudio. Ninguno de ellos mostró signos de cojera en las extremidades delanteras y fueron negativos a las pruebas de flexión pasiva y activa (30 seg). Además, ninguno de ellos presentó cambios radiográficos asociados con patología articular en la articulación metacarpofalángica.

Evaluación de cojera

Se realizó una evaluación clínica en todos los caballos incluidos en este estudio, con el fin de encontrar evidencia de cojera asociada con la articulación metacarpofalángica de las extremidades delanteras. La evaluación consistió en la observación estática, la palpación y la respuesta de flexión pasiva; evaluación dinámica de caminar y trotar en línea recta y lanzarse sobre una superficie dura y blanda. Todos los caballos incluidos mostraron una cojera de 2 y 3/5 (AAEP), con una prueba de flexión positiva (1 min). Adicionalmente, todos los caballos fueron positivos a bloqueo 4 puntos bajos (nervios palmares laterales y mediales y nervios metacarpianos laterales y mediales), utilizando 2 y 1.5 ml respectivamente de mepivacaína al 2 % (Carbocaine, Zoetis Inc.) y bloqueo intraarticular adicional de la articulación

Rev Mex Cienc Pecu 2023;14(1):122-136 125

metacarpofalángica, utilizando un volumen de 6 ml de mepivacaína al 2 % (Carbocaine, Zoetis Inc.) como sedescribió anteriormente(10).Cualquier caballo negativo aestos bloqueos, fue excluido del estudio.

Recolección de líquido sinovial

Todas las muestras de líquido sinovial se obtuvieron de las articulaciones metacarpofalángicas articulaciones AMCF de caballos cojos, utilizando una técnica aséptica en el abordaje palmaro-lateral como se describió anteriormente y 5 d después del bloqueo intraarticular (IA)(10). Se obtuvieron muestras de caballos sanos y se utilizaron como controles (n=4).

Evaluación radiográfica

Todos los caballos seleccionados se evaluaron radiográficamente desde la AMCF, utilizando cuatro vistas estándar (dorso-palmar, latero-medial, dorsolateral palmaro-medial y dorsomedial palmaro-lateral) con el fin de evaluar la condición radiológica de todos los caballos. Se determinaron tres diferentes grados de cambios radiológicos asociados con la condición clínica del caballo (Cuadro 1).

Cuadro 1: Grado de severidad y su relación con los hallazgos clínicos y radiográficos en los caballos incluidos en este estudio Grado Hallazgos radiográficos y clínicos

I De ningún cambio a cambios menores asociados con dolor articular y cojera: irregularidad y pérdida de homogeneidad normal de la cresta sagital de MTCIII.

II Cambios moderados asociados con dolor articular y cojera: sobrehuesos (osteofitos) en P1 y MTCIII.

III Cambios severos asociados con cojera severa y disminución del rango de movimiento: lisis supracondilar o subcondral, osteofitos y formación de hueso nuevo con reacción perióstica y pérdida de espacio articular. (Modificado de: Verwilghen D et al., 2009)(11) .

Determinación de la concentración de proteínas

La concentración de proteína total de todas las muestras de líquido sinovial se obtuvo mediante el uso del kit de ensayo de proteínas BCA (Pierce BCA Protein Assay Kit cat. 23225), de acuerdo con las instrucciones del fabricante. Para cada muestra la concentración final fue de 100 μg/50 μl para el procedimiento de ELISA.

Rev Mex Cienc Pecu 2023;14(1):122-136 126

Análisis de concentración de IGF-1

La determinación de la concentración de IGF-1 en muestras de líquido sinovial de los caballos de control yosteoartríticosserealizócon 50μl utilizandounkit deELISA comercial (Horse IGF1 ELISA kit, #MBS017382, MyBio-Source®) siguiendo las instrucciones del fabricante.

Concentración de interleucina 6 (IL-6)

Se realizó una determinación cuantitativa de IL-6 en el líquido sinovial de todas las muestras utilizando un kit de ELISA comercial (Horse interleukin-6 ELISA kit, cat. #: CSBE16634Hs), que es una técnica de inmunoensayo sándwich, donde las placas se recubren con un anticuerpo IL-6 específico de caballo, luego, se agrega un anticuerpo conjugado con biotina específico para IL-6 y luego peroxidasa de rábano picante (HRP, del inglés horseradish peroxidase) conjugada con avidina. El protocolo se realiza siguiendo las instrucciones del fabricante.

Concentración del factor de necrosis tumoral alfa (TNFα)

La determinación de la concentración del TNFα en muestras de líquido sinovial de los caballos de control y osteoartríticos se realizó con 100 μl utilizando un kit de ELISA comercial (Equine TNFα ELISA kit, cat #: ESS0017 Invitrogen) siguiendo las instrucciones del fabricante.

Análisis de Western Blot

Se sometieron cantidades iguales de proteína (100 μg por carril) a un SDS-PAGE al 16 % (90V durante 30 min y 120 V durante 3.5 h). Se utilizó el marcador Precision Plus Protein Dual Color Standards, que contenía diez proteínas recombinantes preteñidas (10 a 250 kD), incluyendo ocho bandas teñidas de azul y dos bandas de referencia rosas (25 y 75 kD). Después de la electroforesis, los geles se transfirieron utilizando un sistema de transferencia semiseco (271mA durante 15 min) a membranas de PVDF (0.45uM) (Bio-Rad), que se bloquearon utilizando leche descremada al 4 % diluida en PBS (pH 7.4) y se incubaron en un agitador a 37 °C, 120 rpm durante 2 h. Después del bloqueo, las membranas se lavaron 3 veces (durante 5 min cada una) utilizando PBS que contenía Tween-20 al 0.05 %. Como anticuerpo primario, se utilizó un anti-IGF-1 policlonal de cabra (1:1000) (Sta. Cruz #Sc1422), se incubó en un agitador primero a 37 °C, 120 rpm durante 2 h, y se dejó durante la noche a 4 °C; las membranas se lavaron nuevamente como se describió, y como anticuerpo secundarioseutilizóun IgGpoliclonal anti-cabra (1:5000)(Millipore#AP180B), yseincubó en un agitador a 37 °C, 120 rpm durante 2 h y se realizó un lavado final de las membranas.

Rev Mex Cienc Pecu 2023;14(1):122-136 127

Las proteínas se detectaron mediante el uso de un método de quimioluminiscencia mejorada y se visualizaron utilizando un sistema de imágenes de alta resolución (Bio-Rad ChemiDoc). Las membranas se incubaron a una dilución 1:1 de luminol y peroxidasa utilizando (Merck Millipore, Luminata # WBLUF0500), y se expusieron a varios tiempos, donde el tiempo óptimo de exposición fue de 35 segundos.

Resultados

Seexaminóuntotal de45 caballos, delos cualessolo seincluyeron 11caballos (22muestras) en este estudio y 2 caballos (4 muestras) como testigos. Todos los caballos variaron entre sí en grados de cojera y cambios radiográficos, y todos respondieron positivamente a la prueba de flexión digital, bloqueo de 4 puntos bajos y bloqueo intraarticular (IA) de la articulación del menudillo. Seis articulaciones se calificaron como grado I, cinco articulaciones se calificaron como grado II y 8 articulaciones fueron grado III (Figura 1).

Figura 1: Radiografías representativas de caballos calificados con varios grados

Concentración de IGF-1

Todos los caballos con dolor asociado a las articulaciones, cojera y menos cambios radiográficos, mostraron un aumento significativo de la concentración de IGF-1 (P<0.05) (Figura 2). Todas las muestras se repitieron por pares y se leyeron tres veces en un período de 5, 10 y 15 min sin diferencia entre las mediciones (datos no mostrados) y los valores de regresión lineal y curva estándar fueron: P<0.001; r2=0.9931.

Rev Mex Cienc Pecu 2023;14(1):122-136 128
Grado 1 (A) Vista latero-medial con una irregularidad leve del aspecto proximal-dorsal de la cresta sagital (flecha); Grado II (B) Vista oblicua palmaro-medial dorsolateral con un osteofito visible en el aspecto dorsomedial proximal de P1 (flecha); y Grado III (C) Vista dorso-palmar donde un quiste óseo subcondral en el aspecto proximal de la primera falange en el surco sagital con áreas de esclerosis ósea (flecha).

Análisis de IL-6 y TNFα

Las concentraciones de IL-6 entre los controles y los caballos cojos también mostraron una diferencia significativa (P<0.01). Las concentraciones de TNFα entre los controles y los caballos cojos mostraron diferencias aún más significativas en términos de concentración (P<0.001), siendo mayores en los caballos cojos con cambios más severos en las articulaciones afectadas (Grado III). Se realizó un análisis de correlación de Pearson que demostró una correlación positiva entre las concentraciones de proteína total e IGF-1 (r=1), que se observó en caballos de grado I y II, mientras que en el grado III esta correlación es negativa o inversamente proporcional. En otras palabras, cuanto peores fueron los cambios que tuvo una articulación (como se observó en caballos de grado III), se observó menor concentración de IGF-1 en el líquido sinovial.

Figura 2: A) Determinación de IGF-1 entre caballos de control (sanos) y cojos, que muestra una diferencia significativa (P<0.05)*. B) Las concentraciones de IL-6 entre los controles y los caballos cojos también mostraron una diferencia significativa (P<0.01)**.

C) Concentraciones de TNFα entre los controles y los caballos cojos que muestran diferencias significativas en la concentración (P<0.001)***.

Análisis de Western blot

Los caballos con menos cambios radiográficos demostraron una mayor concentración de IGF-1 en concordancia con los resultados de ELISA para IGF-1 (Grado I y II). Los caballos concambios radiográficosmásseveros yunestadocrónicodelacondiciónpatológica(Grado III) fueron los que tuvieron las concentraciones más bajas de IGF-1 tanto en ELISA como en el análisis WB. Curiosamente, con este análisis se pudo identificar en todas las muestras dos

Rev Mex Cienc Pecu 2023;14(1):122-136 129
I G F1 ( n g / m l ) CaballosTestigoCaballosconClaudicación 0 10 20 30 * CaballosTestigoCaballosconClaudicación 0 2 4 6 8 I L6 ( p g / m l ) ** CaballosTestigoCaballosconClaudicación 0 2000 4000 6000 8000 T N F  ( p g / m l ) *** A B
C

bandas diferentes, una de ~12 kDa que se observó solo en caballos testigos (normales) sin patología articular, y otra de ~7.5 kDa vista en todos los caballos cojos (Figura 3).

Figura 3: Fotografía representativa del análisis Western blot para IGF-1, demostrando una diferencia de peso molecular entre muestras de líquido sinovial que indica la existencia de dos isoformas diferentes presentes en articulaciones normales y durante un proceso inflamatorio

1: Marcador de proteínas (marcando 10 kDa); 2: Muestras de un caballo testigo y un caballo con OA; 3: Caballo testigo; 4 y 5: Dos muestras diferentes de caballos con OA.

Discusión

Los caballos deportivos estánexpuestos acargas excesivasensus articulaciones yestructuras de tejidos blandos. La articulación que puede experimentar OA traumática depende de la disciplina en la que se desempeñe el caballo. Existe evidencia con respecto a intervenciones como las inyecciones articulares en las fases agudas de la enfermedad que pueden ayudar a modificar su curso y prevenir daños mayores mientras el caballo todavía está desempeñándose(12) .

Las cargas de impacto debidas al ejercicio son las responsables de dañar el cartílago articular al agrietar primero la superficie, y dependiendo de la fuerza aplicada y del tiempo que se esté aplicando, se produce la profundidad y, por tanto, la severidad del desarrollo de la enfermedad (OA). Se ha comprobado que la caracterización de las consecuencias mecánicas de las lesiones por impacto en el cartílago articular desarrolla daños, al estresar continua y directamente las estructuras articulares(13) .

Cuando se produce inflamación, los condrocitos migran al sitio de la lesión en un intento de regenerar el defecto formando grupos de células o clústeres con la capacidad de sintetizar MEC de novo. Dado que el componente celular (condrocitos) del cartílago articular es solo

Rev Mex Cienc Pecu 2023;14(1):122-136 130
10 kDA Marcador PM Caballo Testigo y con OA Caballo Testigo Caballos con OA

el 1-2 % de todo el tejido, no pueden reparar el área dañada, porque su capacidad para sintetizar la MEC es superada por la actividad de la metaloproteasas de la matriz (MMP, del inglés matrix metalloprotease) que degrada la MEC ya dañada agravando la condición al aumentar la necrosis y activando la inflamación local mediante la liberación de componentes intracelulares que actúan como patrones moleculares asociados al daño (DAMP, del inglés damage-associated molecular patterns) y citoquinas proinflamatorias como prostaglandinas (PG), óxido nitroso (NO), interleucina-1 (IL-1), interleucina-6 (IL-6), factor de necrosis tumoral alfa (TNFα) y sustancia P. Particularmente, el TNFα inhibe la expresión de IGF-1 al aumentar el catabolismo de MEC y bloquear la vía AKT a través de la activación de la vía JNK. Si el defecto del cartílago llega al hueso subcondral, el cartílago se repara formando un cartílago articular de baja calidad llamado fibrocartílago(2,4,7)

Los factores que contribuyen a la cascada de inflamación, aparte de las citoquinas, incluyen vesículas extracelulares, que desempeñan un papel importante en la promoción de la inflamación articular y también están involucradas en la apoptosis y la degradación de la MEC. Estas vesículas son exosomas, microvesículas y vesículas apoptóticas, que son liberadas a la cavidad articular (en el líquido sinovial), y tienen una relación íntima con la comunicación célula-célula durante el proceso inflamatorio(7,8,14) .

El objetivo de este estudio fue comparar la concentración de IGF-1 en el líquido sinovial de caballos sanos (testigo) y caballos con diferentes grados de cojera y patología articular (OA) en la AMCF. Se planteó la hipótesis de que entre más severas y crónicas fueran las condiciones de la articulación, se encontrarían niveles más altos de IGF-1 en el líquido sinovial, debido a que la alta demanda de la articulación para reparar el defecto era mayor que en los caballos con cambios leves. La razón detrás de la hipótesis era: que, todavía no había datos disponibles con respecto a las concentraciones de IGF-1 ysu correlación con una condición clínica particular en caballos, por lo que se realizó un estudio piloto, donde se recolectaron un total de 13 muestras de líquido sinovial de diferentes articulaciones de diferentes caballos. Todos estos caballos eran caballos saltadores de altorendimientoconuna prueba de flexión positiva de las articulaciones muestreadas (no se realizó ninguna evaluación radiográfica en ninguno de estos caballos). Lo que se encontró fue un aumento significativo de la proteína total, con una correlación positiva (correlación de Pearson, P=0.0229) en los niveles de IGF-1 en el líquido sinovial en comparación con las muestras de testigo (líquido sinovial obtenido de caballos sanos). Esto dio suficiente información para plantear la hipótesis de que los caballos con signos clínicos más severos y una patología articular más crónica tendrían niveles más altos de IGF-1 en comparación con los caballos testigo

Curiosamente, con los resultados obtenidos, esta hipótesis fue refutada. Se encontró que los caballos con cambios radiográficos más severos y, por lo tanto, las condiciones inflamatorias

Rev Mex Cienc Pecu 2023;14(1):122-136 131

dentro de la articulación más crónicas fueron los que demostraron una disminución en las concentraciones de IGF-1, muy similar a la que tenían los caballos testigo.

Se observaron resultados similares en estudios en los que las lesiones inducidas experimentalmente en el cartílago articular en caballos producen un pico agudo de expresión de ARNm de igf-1, y a las cuatro semanas tienden a disminuir. Cuando el IGF-1 disminuye, predomina el TGF-β y es responsable de la formación de hueso nuevo y la activación de linfocitos quiescentes a Th17(7)

Elfactordecrecimientosimilaralainsulina1(IGF-1)equinohasidoampliamenteestudiado, existen varios estudios donde su importancia en la proliferación, crecimiento ysupervivencia celular, reparación y producción de matriz extracelular está bien documentada, aunque no hay suficientes estudios sobre las diferentes isoformas y su funcionalidad(15). Se sabe que el ARNm sufre modificaciones postranscripcionales (empalme alternativo) lo que genera diferentes isoformas junto con modificaciones postraduccionales. Los propéptidos IGF-1 estáncodificadospormúltiplestranscripcionesempalmadasalternativamente,incluyendolos péptidos de extensión C-terminal llamados péptidos E y los péptidos señal N-terminal. Cuando una proteína inmadura tiene péptido señal, el péptido maduro y el péptido E se llama pre-proIGF-1, y cuando el péptido señal se elimina dejando solo el péptido maduro y el péptido E, se llama pro-IGF-1. Estos péptidos E controlan la biodisponibilidad del IGF-1 maduro, al unirse a la MEC debido a su carga altamente positiva, impidiendo su circulación sistémica y, por lo tanto, su uso local. También modulan la reentrada de IGF-1 maduro a la célula en una línea celular del músculo murino(1) .

En humanos, se han identificado tres isoformas diferentes de IGF-1 [IGF-1Ea, IGF-1Eb e IGF-1Ec, también conocido como factor de crecimiento mecano o MGF (del inglés mecanogrowth factor)],ysehapropuestoquetienendiversasfuncionesenlareparaciónmuscular(16) .

Nixon et al(17) describieron el gen igf1 que consiste en 5 exones con 4 secuencias de intrones, que sufren modificaciones postranscripcionales y postraslacionales, donde las proteínas traducidas resultantes del empalme alternativo del exón 4 forman una transcripción de propéptidos máspequeña (105aminoácidos)llamadaPre-proIGF-1Aque consisteenpéptido señal (codificado por los exones 1 y 2), péptido maduro (codificado por los exones 2 y 3), y un péptido E C-terminal (codificado por los exones 3 y5); ycuando el exón 4 no se empalma alternativamente, se traduce una transcripción más grande formando Pre-proIGF1B (111 aminoácidos)(17). Hasta donde se sabe, éste fue el último trabajo de investigación publicado sobre modificaciones postranscripcionales y postraslacionales y empalme alternativo de ARNm de IGF-1 en caballos. Se realizó un análisis bioinformático del gen igf1 sometido a diferentes tipos de empalme alternativo, que según Le et al(18) son: salto de exón, retención de intrones, exones mutuamente excluyentes y sitios alternativos donante 5’ o aceptor 3’. Este análisis reveló que el ARNm de IGF-1 consistía no de 5, sino de 4 exones y 3 intrones,

Rev Mex Cienc Pecu 2023;14(1):122-136 132

que los transcriptos forman 4 isoformas: variante 1 (exones 1-3), variante 2 (exones 2 y 3), variante 3 (exones 1-3, una retención de intrones de 93 pb y el exón 4) y variante 4 (exones 2-4)(18) .

El análisis de Western blot demostró la presencia de al menos dos isoformas funcionales diferentes de IGF-1, donde la observada en todos los caballos normales es más pesada (~ 12 kDa) que la observada en todos los caballos con diferentes grados de OA (7.5 kDa). Probablemente la más ligera es la forma madura de IGF-1, aunque las técnicas de secuenciación deaminoácidos debenllevarsea caboparaconfirmarestaafirmación. Coneste resultado, se puede suponer que la expresión de estas dos diferentes isoformas funcionales depende de la inflamación.

Esto podría conducir a una nueva línea de investigación que puede enfocarse en determinar mediante técnicas avanzadas de secuenciación las isoformas exactas de IGF-1, y en apuntar a la sobreexpresión de la isoforma que no está presente cuando hay un proceso inflamatorio de la articulación, y su papel en la reparación de defectos del cartílago.

El cartílago articular no se regenera por sí mismo, ya que es el único tejido conectivo en mamíferos que no tiene ni vasos sanguíneos y linfáticos, ni nervios(19). Por lo tanto, es prácticamente imposible regenerarse después de una lesión, por lo que se repara mediante sustitución con tejido fibroso, lo que genera un cartílago fibroso de baja calidad llamado fibrocartílago. Ha habido varios tratamientos para mejorar la regeneración del cartílago, en humanos, el trasplante de aloinjerto osteocondral ha demostrado ser eficaz en la mejora de la función y la reparación general con la supervivencia del injerto de hasta el 80 % de los pacientes que se habían sometido a tratamiento quirúrgico previo: microfractura, desbridamiento del cartílago, forage, condroplastia de abrasión, injertos osteocondrales y periósticos, reinserción de colgajo del cartílago, entre otros(7,17,20) .

Los anestésicos locales y los esteroides han sido ampliamente utilizados por los practicantes en el campo, por razones diagnósticas y terapéuticas respectivamente. Sin embargo, se ha demostrado que el uso excesivo de estos componentes daña el cartílago articular. La inyección intraarticular que utiliza anestésicos locales y esteroides ha generado una creciente preocupación sobre la inducción de toxicidad potencial para los condrocitos y sinoviocitos. Sherman et al(21) realizaron una comparación interesante de lidocaína, bupivacaína, acetato de betametasona, acetato de metilprednisolona y acetónido de triamcinolona en un modelo canino. Encontraron que in vitro, lidocaína al 1 y 0.5 %, bupivacaína al 0.2 y 0.25 %, acetato de betametasona y acetato de metilprednisolona fueron severamente condrotóxicos y sinoviotóxicos en comparación con bupivacaína y triamcinolona al 0.625 %(21)

Rev Mex Cienc Pecu 2023;14(1):122-136 133

Conclusiones e implicaciones

Por esta razón, en cuanto al tratamiento, el objetivo principal es tener alternativas que puedan ser utilizadas en campo por los médicos, que puedan proporcionar una alternativa distinta a los esteroidesquetambiénpuedamejorarlareparación del cartílagosin lanecesidaddeponer al caballo bajo anestesia general, y aun así tener un efecto que conduzca a que los caballos tengan una carrera deportiva duradera. Este artículo proporciona información importante que puede servir como base para futuras investigaciones sobre las isoformas de IGF-1 y su papel en la reparación del cartílago.

Agradecimientos

Los autores desean agradecer a todo el personal del CEAR, SEDENA, QFB Alberto Enrique Fernández Molina y MVZ Jorge Rodríguez Lezama. Fernando García Lacy es estudiante de doctorado en el Doctorado en Ciencias de la Producción y Salud Animal de la Facultad de MedicinaVeterinaria yZootecniadelaUniversidadNacionalAutónomade México yrecibió unabecadelCONACYT.Eltrabajoreportadoenestemanuscritoespartedesutesisdoctoral.

Conflictos de intereses

Los autores declaran que no hay conflictos de intereses.

Literatura citada:

1. Pfeffer LA, Brisson BK, Hanquin L, Barton ER. The Insulin-like Growth Factor (IGF-1) E-peptides modulate cell entry to mature IGF-1 protein. Mol Biol Cel 2009;20:38103817.

2. Choukair D, Hügel U, Sander A, Uhlmann L, Tönshoff B. Inhibition of IGF-1-related intracellular signaling pathways by proinflammatory citokines in growth plate chondrocytes. Ped Res 2014;76(3):245-251.

3. Liu Q, Guan JZ, Sun Y, Le Z, Zhang P, Yu D, et al. Insulin-like growth factor 1 receptormediated cell survival in hypoxia depends on the promotion of autophagyvia supression of the PI3K/Akt/mTOR signaling pathway. Mol Med Rep 2017;15:2136-2142.

4. Tonkin J, Temmerman L, Sampson RD, Gallego-Colon E, Barberi L, Bilbao D, et al. Monocyte/Macrophage-derivedIGF-1orchestratesmurineskeletal muscleregeneration and modulates autocrine polarization. Am Soc Gene Cell Ther 2015;23(7):1189-1200.

5. García-Segura LM, Arévalo MA, Azcoitia I. Interactions of estradiol and insulin-like growth factor-I signaling in the nervous system: New advances. Prog Brain Res 2010;181:251-272.

Rev Mex Cienc Pecu 2023;14(1):122-136 134

Pecu 2023;14(1):122-136

6- García-Lacy F, Gutiérrez-Olvera L, Bernad M, Fortier L, Trigo-Tavera FJ, GómezChavarín M, et al. Pharmacokinetic analysis of intraarticular injection of insulin and its effect on IGF-1 expression in synovial fluid of healthy horses. Rev Mex Cienc Pecu 2022;13(2):391-407.

7. Fortier LA, Balkman CE, Sandell LJ, Ratcliffe A, Nixon A. Insulin-like growth factor-1 gene expression patterns during spontaneous repair of acute articular cartilage injury. J Orth Res 2001;19:720-728.

8. Frisbie D. Future directions in treatment of joint disease in horses. Vet Clin Equine 2005;21:713-724.

9. Aguilar IN, Trippel SB, Shuiliang S, Bonassar LJ. Comparison of efficacy of endogenous and exogenous IGF-I in stimulating matrix production and mature chondrocytes Cartilage 2015;6(4):264-272.

10. Moyer W, Schumacher J, Schumacher J. A guide to equine joint injection and regional anesthesia. Yardley, PA: Veterinary Learning Systems, USA. 2007.

11. Verwilghen D, Busoni V, Gangl M, Franck T, Lejeune JP, Vanderheyden L, et al. Relationship between biochemical markers and radiographic scores in the evaluation of the osteoarticular status of Warmblood stallions. Res Vet Sci 2009;87(2):319-328.

12. Chu CR, Beynnon BD, Buckwalter JA, Garrett WE Jr, Katz JN, Rodeo SA. Closing the gap between benck and nedside research for early arthritis therapies (EARTH): report from the AOOSSM/NIH U-13Post-joint injuryosteoarthritis conference II. AmJ Sports Med 2011;39(7):1569-1578.

13. Bonnevie ED, Delco ML, Fortier LA, Alexander PG, Tuan RS, Bonassar LJ. Characterization of tissue response to impact loads delivered using a hand-held instrument for studying articular cartilage injury. Cartilage 2015;6(4):226-232. 14. Buzas EI, Gyrgöry B, Nagy G, Falus A, Gay S. Emerging role of extracellular vesicles in inflammatory diseases. Nat Rev Reumatol 2014;10(6):3563-3564. 15. www.uniprot.com. . https://www.afternic.com/forsale/uniprot.com?utm_source=TDFS&utm_medium=sn_ affiliate_click&utm_campaign=TDFS_Affiliate_namefind_direct8&traffic_type=CL3 &traffic_id=Namefind. 16. Phillipou A, Papageorgiou E, Bogdanis G, Halapas A, Sourla A, Maridaki M, et al Expression fo IGF-1 isoforms after exercise-induced muscle damage in humans: Characterization of the MGF E peptide actions in vitro. In vivo 2009;23:567-576.

Rev Mex Cienc
135

17. Nixon AJ, Brower-Toland BD, Sandell LJ. Primary nucleotide structure of predominant and alternate splice forms of equine insulin-like growth factor I and their gene expression patterns in tissues. AJVR 1999;60(10):1234-1241.

18. Le, KQ, Prabhakar B, Hong, WJ. et al. Alternative splicing as a biomarker and potential target for drug discovery. Acta Pharmacol Sin 2015;36:1212–1218.

19. Geneser F. Tejido esquelético. Cap 12, Geneser F. Histología. 3rd ed. Madrid, España: Editorial Médica Panamericana; 2001.

20. Briggs DT, Sadr KN, Pulido PA, Bugbee WD. The use of osteochondral allograft transplantation for primary treatment of cartilage lesions in the knee. Cartilage 2015;6(4):203-207.

21. Sherman SL, Khazai RS, James CH, Stoker AM, Flood DL, Cook JL. In vitro toxicity of local anesthetics and corticosteroids on chondrocyte and synoviocyte viability and metabolism. Catilage 2015;6(4):233-240.

Rev Mex Cienc Pecu
136
2023;14(1):122-136

https://doi.org/10.22319/rmcp.v14i1.6273

Artículo

Uso de células estromales mesenquimales derivadas de la gelatina de Wharton para el tratamiento de uveítis recurrente equina: estudio piloto

María Masri-Daba a*

Montserrat Erandi Camacho-Flores b

Ninnet Gómez-Romero c,d

Francisco Javier Basurto Alcántara c

a UniversidadNacionalAutónomadeMéxico.FacultaddeMedicina Veterinaria yZootecnia. Departamento de Medicina, Cirugía y Zootecnia para Équidos. Ciudad de México, México.

b UniversidadNacional AutónomadeMéxico.FacultaddeMedicinaVeterinaria yZootecnia. Posgrado en Ciencias de la Producción y de la Salud Animal. Ciudad de México, México.

c UniversidadNacionalAutónomadeMéxico.FacultaddeMedicina Veterinaria yZootecnia. Departamento de Microbiología e Inmunología. Ciudad de México, México

d Comisión México-Estados Unidos para la prevención de fiebre Aftosa yotras enfermedades exóticas de los animales. Ciudad de México, México.

*Autor de correspondencia: masri@unam.mx

Resumen:

Lauveítis recurrente equina(URE) es unaenfermedad queafectadel 2 al 25 %delos equinos a nivel mundial, de los cuales el 56 % se quedan ciegos; por lo tanto, es considerada la causa más común de ceguera en caballos. La URE es un padecimiento espontáneo inmunomediado caracterizado por eventos recurrentes de inflamación intraocular. Actualmente, no existe tratamiento para los caballos con esta enfermedad. Las células estromales mesenquimales (CEM) derivadas de diversos tejidos, como la gelatina de Wharton (GW), han demostrado su capacidad de modular la respuesta inmune al regular negativamente el proceso inflamatorio. El objetivo del presente estudio piloto fue el evaluar el efecto del uso de CEM

137

derivadas de GW como tratamiento para la URE. La GW se obtuvo y procesó con base en metodologías previamente descritas para la obtención de CEM. Los caballos involucrados en este estudio recibieron una dosis de 5x106 CEM en la zona subpalpebral. Se evaluó la concentración de interleucinas (IL) (IL-1, IL-2, IL-10, IFN- y TNF) en muestras de lágrima obtenidas antes de la inoculación del tratamiento, 30 min después y 7 días post inoculación. No se observaron cambios significativos en la concentración de IL que sugieran la disminución de ILproinflamatorias. Sin embargo, los caballos con UREtratados con CEM mostraron una respuesta positiva a la terapia, evidenciada por la disminución en la signología de la URE. Los resultados obtenidos sugieren que el tratamiento de la URE con CEM derivadas de GW es una alternativa segura con resultados prometedores.

Palabras clave: Gelatina de Wharton, Células estromales mesenquimales, Uveítis recurrente equina, Terapéutica

Recibido: 27/06/2022 Aceptado: 01/08/2022

Introducción

Las células estromales mesenquimales (CEM) se caracterizan por su capacidad de diferenciación en diversos linajes celulares; por lo tanto, pueden estar involucradas en la regeneración de tejidos dañados. Otra característica importante de las CEM es que tienen propiedades antinflamatorias y regulan la respuesta inmune al producir un conjunto de factores inmunomoduladores como la interleucina 6 (IL-6), prostaglandina E2 (PEG2) y óxido nítrico(1,2) . La secreción de estos factores inhibe la proliferación de linfocitos T activados, disminuye la secreción de citocinas proinflamatorias e incrementan la población de linfocitos T reguladores (LTreg)(2,3,4) .

En equinos, las CEM pueden obtenerse a partir de médula ósea, tejido adiposo, membrana amniótica, sangre de cordón umbilical y tejido de cordón umbilical de potro conocido como gelatina de Wharton (GW)(5) La GW es el tejido conjuntivo mucoso primitivo del cordón umbilical que se encuentra entre el epitelio amniótico y los vasos umbilicales; consiste en una sustancia con base en ácido hialurónico y sulfato de condroitina con una alta concentración de CEM(6) Debido a sus características moleculares, como la ausencia en la expresión de moléculas de histocompatibilidad I y II, estas células tienen una ventaja única para su aplicación de forma autóloga y alogénica(7) Particularmente, la GW es considerada una fuente importante de CEM, tanto en humanos como en otras especies, con gran potencial

Rev Mex Cienc Pecu 2023;14(1):137-153 138

en la terapéutica de diversas condiciones inflamatorias e inmunomediadas, como la uveítis recurrente equina (URE).

La URE, también conocida como ceguera lunar, es una enfermedad reconocida como la principal causa de ceguera en caballos. Se ha reportado una prevalencia en EUA que va del 2al25%delosequinos(8) Secaracterizaporepisodiosrecurrentesdeinflamaciónintraocular o niveles bajos de inflamación persistente, que predomina en el iris, cuerpo ciliar y coroides(9) Esta enfermedad tiene una presentación aguda que incluye signos como miosis, presión intraocular disminuida y adherencias en el iris; mientras que la presentación crónica deriva en el desarrollo de cataratas, glaucoma y ceguera.

Los factores desencadenantes o etiológicos de la URE permanecen desconocidos; sin embargo, se ha reportado que componentes genéticos, así como infecciones por Leptospira interrogans podrían estar implicados en el desarrollo de dicha condición(8,10) . De manera subsecuente, los signos que se presentan en la URE son el resultado de la activación de linfocitos T, específicamente Th1 y Th17, causando destrucción del tracto uveal del ojo(11,12,13) . Actualmente, no existe cura para la URE; por consiguiente, el tratamiento se enfoca en disminuir la inflamación con el objetivo de preservar la visión, limitar la recurrencia de episodios y reducir el dolor utilizando antinflamatorios y midriáticos(14) .

Se ha demostrado que el uso de CEM en enfermedades inmunitarias de perros, gatos y caballos puede inducir el cambio de subconjuntos de linfocitos T proinflamatorios a linfocitos T reguladores(15,16,17) . Por lo tanto, el uso de CEM derivadas de la GW en el tratamiento de la URE es una alternativa prometedora. Este artículo describe la obtención, cultivo, caracterización y diferenciación de CEM derivadas de la GW del cordón umbilical de potros al parto y su utilización preliminar en caballos con URE.

Material y métodos

Obtención y cultivo de CEM

Se recolectaron CEM de GW a partir de 26 partos en pradera de yeguas pura sangre inglés (PSI) de entre 5 a 20 años La toma de cordones umbilicales se realizó hasta la expulsión de la placenta. El manejo y procesamiento de los cordones umbilicales se realizó bajo condiciones de esterilidad en la Unidad de Ingeniería de Tejidos, Terapia Celular y Medicina Regenerativa de Instituto Nacional de Rehabilitación

Brevemente, se realizó la toma de un fragmento de 15 a 20 cm de cada cordón aún envuelto en amnios, posteriormente se realizaron dos lavados con solución yodada intercalados con lavados de solución salina fisiológica (SSF) esterilizada. Después se realizaron cortes de 5

Rev Mex Cienc Pecu 2023;14(1):137-153 139

cm aproximadamente y se conservaron a 4 ºC en solución bufferada de fosfatos (PBS) con penicilina (10,000 U/ml) anfotericina B (25 µg/ml) y estreptomicina (10,000 µg/ml) para su procesamiento en el laboratorio. De manera subsecuente, se separó la GW del tejido del cordón umbilical y se depositó en una caja de Petri con PBS en donde se realizaron cortes para facilitar la digestión enzimática. Esta última se llevó a cabo en 10 ml de solución de medio de Eagle modificado por Dulbecco (DMEM) con colagenasa (0.8 mg/ml) en incubación a 37 ºC por 1 h. Una vez transcurrido el tiempo de incubación, las células se centrifugaron a 700 xg por 7 min a 37 ºC, se decantó el sobrenadante y las células se resuspendieron en DMEM suplementado con suero fetal bovino (SFB) al 10% y 1% de penicilina,anfotericinaByestreptomicina(10,000U/ml;25µg/ml;10,000µg/ml).Elcultivo primario se mantuvo en botellas de cultivo celular de 25cm2 incubadas con CO2 al 5% a 37 ºC y se realizaron tres pases una vez que se alcanzó una confluencia del 80 %.

Caracterización de CEM

Las células obtenidas antes del tercer pase se sometieron a evaluación de fenotipo de superficie para corroborar su perfil mesenquimal por medio de citometría de flujo. Se utilizaron 2.5x105 células contenidas en tubos de poliestireno de fondo redondo resuspendidas en 1 ml de PBS. Para el marcaje de las células, éstas se incubaron por 1h con anticuerpos primarios específicos para detección de CD90 (FITC Mouse Anti-Human CD90 Clone 5E10 555595), CD73 (APC Mouse Anti-Human CD73 Clone AD2560847), CD105 (PEMouseAnti-Human CD105Clone266560839),CD45(FITCMouseAnti-HumanCD45 Clone G44-26 555478), CD34 (PE Mouse Anti-Human CD166 Clone 34 559263), CD14 (PerCP Mouse Anti-Human CD14 Clone MφP9 340585) y MHC-II (APC Mouse AntiHuman HLA-DR Clone G46-6 559866) Posteriormente, las células se sometieron a dos lavados yse analizaron utilizando el citómetro de flujo FACS Calibur Becton and Dickinson

Diferenciación de CEM

Se cultivaron CEM de GW en placas de 12 pozos a una densidad de 5x104 utilizando DMEM suplementado con 5% de SFB y 1% de antibiótico, bajo las mismas condiciones de cultivo que se mencionaron previamente. Después de 48 h el medio de cultivo se reemplazó por medio adipogénico, osteoblástico y condrogénico como se describe a continuación. Para la inducción del linaje adiposo, después de 48 h de incubación el medio de cultivo celular se reemplazó por medio de diferenciación formulado con DMEM suplementado con 0.5% de SFB, dexametasona (1 mM), 3-isobutil-metilxantina (0.5 mM), insulina (10%), indometacina (50 mM) y penicilina (10,000 U/ml) anfotericina B (25 µg/ml) y estreptomicina (10,000 µg/ml). Se realizaron cambios de medio cada tercer día por 21 días. Finalmente, se evaluó la diferenciación de las células utilizando la tinción rojo Nilo.

Rev Mex Cienc Pecu 2023;14(1):137-153 140

La diferenciación de las CEM a linaje osteoblástico se realizó mediante el uso de medio de cultivo DMEM suplementado con SFB 1%, yadicionado con dexametasona (100 nM), ácido ascórbico (0.05mM),10 mM/Lde -glicerofosfato yBMP-7 (10ng/ml).Delamismaforma, se realizaron cambios de medio de cultivo cada tercer día por 21 días y la diferenciación osteogénica se evaluó por medio de la tinción Von Kossa

El linaje condrogénico se obtuvo al utilizar medio de cultivo DMEM adicionado con insulina (10 %), ácido ascórbico (1 mg/ml), factor transformante de crecimiento  (TGF-) (10 ng/ml), piruvato de sodio (1%) y proteína morfogénica ósea 2 (BMP-2) (100 ng/ml). La evaluación de diferenciación se llevó a cabo con la tinción azul de Alcián.

Caballos

Para este estudio se incluyeron un total de 15 caballos PSI de 2 a 7 años. Como grupo testigo se utilizaron 12 caballos clínicamente sanos. Como parte del grupo experimental se consideraron 3 caballos con al menos un episodio de URE con signos característicos como: miosis, hiperpigmentación del iris, blefaroespasmo, edema corneal, flama acuosa, hipopión, hifema, epífora, fotofobia, fibrina en la cámara anterior, hiperemia conjuntival e inyección escleral. Los caballos utilizados en este estudio se sometieron a un examen físico general y oftalmológico completo estricto que consistió en la evaluación de reflejo de amenza, respuesta pupilar, reflejo consensual, prueba de Schirmer, sensiblidad corneal, tinción de flouresceína, prueba Jones, tinción rosa de bengala y observación de fondo de ojo.

Toma de muestra lagrimal e inoculación CEM

Una vez que se conformaron los grupos testigo y experimentales se realizó la sedación de los caballos utilizando xilacina intravenosa a una dosis de 0.3 a 0.5 mg/kg. Posteriormente, se llevó a cabo la toma de 100 l de lágrima, realizando la toma con capilar estéril sin aditivos; la muestra se depositó en viales estériles y se conservaron a temperatura de ultracongelación a -80 ºC hasta su uso.

Utilizando una jeringa de insulina se realizó la colecta del inóculo, PBS y 5x106 CEM para seis caballos del grupo testigo, así como para los tres caballos con URE del grupo experimental; ambos, en un volumen de hasta 200 l. Esta parte del procedimiento se llevó a cabo en condiciones de esterilidad.

Previo a la aplicación del inóculo se realizó la asepsia del área con alcohol, evitando el contacto directo con el ojo. Se introdujo una aguja 25G en la zona subpalpebral para posteriormente conectar la jeringa y realizar la inoculación del contenido. La toma de la

Rev Mex Cienc Pecu 2023;14(1):137-153 141

segunda y tercera muestra de lágrima se realizaron 30 min y una semana post inoculación respectivamente.

Evaluación de interleucinas en muestras de lágrima

Se realizó la evaluación de las interleucinas IL-1, IL-2, IL-10, IFN- y TNF en las muestras de lágrima obtenidas antes y después de la aplicación del tratamiento, por medio de inmunoensayo enzimático (ELISA) de tipo multiplex, con la finalidad de determinar si hay cambios en el patrón de interleucinas detectadas.

Para la prueba de ELISA multiplex se utilizó el kit Milliplex MAP Kit: Equine Cytokine/Chemokine Magnetic Bead Panel, siguiendo las indicaciones del fabricante en el equipo Luminex (Bio-Plex 200, Bio-Rad Laboratories, EU). Brevemente, se adicionaron 200 l de buffer de lavado a cada uno de los 96 pozos de la placa, se cubrió la placa y se incubó en agitación por 10 min a 20 ºC; al concluir este tiempo se desechó el contenido de los pozos quitando el excedente al voltear la placa realizando pequeños golpes sobre una cama de toallas absorbentes. Después se adicionaron 25 l del estándar y testigos en los pozos correspondientes. A los pozos de las muestras se les agregaron 25 l de “Assay buffer”. Posteriormente se agregaron 25 l de solución matriz a todos los pozos y25 l de la muestra delágrimaalospozoscorrespondientes.Porúltimo,seagregaron25 ldelamezcladeperlas a cada uno de los pozos de la placa, la cual se incubó por 18 h en agitación a 4 ºC cubierta con papel aluminio.

Una vez transcurrido el tiempo de incubación se desechó el contenido total de la placa y se realizaron tres lavados de ésta. Posteriormente, se adicionaron 25 l de anticuerpos de detección de interleucinas en todos los pozos, se selló la placa e incubó en agitación a temperatura ambiente por 1 h. Después se agregaron 25 l de estreptavidina-ficoeritrina a todos los pozos, se selló la placa e incubó en agitación a temperatura ambiente por 30 min. Una vez finalizado este paso, se decantó nuevamente el contenido y se hicieron tres lavados. A cada uno de los pozos se adicionaron 150 l de “Seath Fluid” y por 5 min se mantuvo en agitación a temperatura ambiente. Finalmente, se realizó la lectura de la placa para la estimación de concentración de las interleucinas detectadas en las muestras de lágrima correspondiente a los tres tiempos de toma de muestra.

Análisis estadístico

Para el análisis de los resultados de la concentración de interleucinas, se utilizó estadística no paramétrica de acuerdo con los resultados obtenidos de las pruebas de homogeneidad de varianza (análisis de residuos) y de distribución normal (prueba Shaphiro-Wilk) incluidos en el programa estadístico Prism 8.0 (GraphPad, Software Inc., USA).

Rev Mex Cienc Pecu 2023;14(1):137-153 142

De manera particular, se utilizó la prueba U de Mann Whitney para comparar la concentración de citocinas entre los medios empleados (PBS y CEM) en el grupo control. Posteriormente, se retomó esta prueba para comparar la concentración de citocinas entre el grupo testigo y el experimental. Adicionalmente, se realizó la prueba de Kruskal Wallis seguida de la prueba de comparación múltiple de Dunn para determinar posibles cambios la concentración de citocinas en los diferentes tiempos evaluados (basal, 30 min y 7 días) en ambos grupos. En todos los casos se consideró un valor de P<0.05 como significativo.

Resultados

Obtención y cultivo de CEM

Los cultivos primarios de CEM obtenidos a partir de GW inicialmente mostraban una morfología redondeada y se agruparon en cúmulos de hasta 100 m. Una vez adheridas, a partir de 120 h adquirieron la morfología fibroblastoide (Figura 1).

Figura 1: Cultivo primario de células estromales mesenquimales obtenidas a partir de la gelatina de Wharton

a) Se observa la morfología redondeada (flecha blanca) de las CEM y la formación de cúmulos celulares (flecha negra); b) adherencia y obtención de morfología fibroblastoide de CEM (flecha negra); c) confluencia de 80% del monoestrato de CEM con morfología característica.

Caracterización de CEM

Por medio de citometría de flujo se llevó a cabo la identificación de marcadores positivos de superficie de CEM. Se deben de expresar los marcadores CD90, CD73 y CD105, mientras que los marcadores negativos son CD14, CD34, CD45 y MHC-II. En la Figura 2 se muestra la caracterización del fenotipo de las CEM obtenidas a partir de GW. Se muestra la falta de expresión de marcadores CD45, CD34 y CD14; mientras que se evidenció la expresión de los marcadores positivos CD73 y CD90. Por otro lado, las muestras de CEM evaluadas mostraron expresión disminuida del marcador CD105.

Rev Mex Cienc Pecu 2023;14(1):137-153 143

Figura 2: Fenotipo de CEM cultivadas

Análisis de citometría de flujo de expresión de proteínas de cultivo de CEM derivada de GW marcadas con anticuerpos anti CD45 (verde), CD34 (turquesa), CD14 (rosa), CD73 (rojo) y CD90 (azul). El histograma en color morado indica la intensidad de la flourescencia de las CEM marcadas con el anticuerpo testigo. Los histogramas abiertos indican reactividad positiva con el anticuerpo indicado.

Diferenciación de CEM

Las CEM fueron tratadas con tres formulaciones de medio de cultivo para evaluar su diferenciación a linaje celular adiposo, osteoblástico y condrogénico. La diferenciación se evaluó por medio de tinciones celulares (Figura 3); se muestra imágenes representativas de: a) adipocitos teñidos con rojo Nilo para detectar vacuolas de ácidos grasos dentro de las células; b) osteoblastos teñidos con Von Kossa para identificar depósitos de calcio; c) condrocitos detectados con la tinción azul de Alcián, se visualiza la tinción de mucopolisacáridos en la matriz extracelular de dicho tejido.

Rev Mex Cienc Pecu 2023;14(1):137-153 144

Figura 3: Diferenciación de CEM a linaje a) adiposo, b) osteoblástico y c) condrogénico

Evaluación de caballos con URE

Caballo 1. Warmblood,retinto macho castrado de 12 años.Presentó signos deuveitis e inició tratamiento con betametasona, ciclosporina A y lágrima artificial. Posteriormente inició el protocolo de tratamiento con CEM y se inyectó únicamente el ojo izquierdo, a lo largo de la semana, no se observaron cambios clínicos.

Caballo 2. Frisón, macho entero de 15 años. Presentó un cuadro agudo de uveitis en el ojo izquierdo, contaba con tratamiento previo de prednisolona y ciclosporina A. Mostró signos como dolor, edema, vascularización, epífora y blefaroespasmo. (Figura 4). Una semana post tratamiento con CEM, clínicamente presentó mejora, todos los signos anteriores disminuyeron ligeramente y mostraba mejor estado anímico.

Figura 4: Caballo 2

a) Se muestra el blefaroespasmo y epífora, b) se muestra el edema y vascularización; los márgenes palpebrales se ven verdes debido a la tinción previa con fluoresceína. c) Se muestra disminución en blefaroespasmo del ojo izquierdo d) Se muestra disminución del edema.

Rev Mex Cienc Pecu 2023;14(1):137-153 145

Caballo 3. Apaloosa, macho entero, de 21 años. Presentó un cuadro agudo, pero no recibió tratamiento alguno. Ambos ojos presentaban miosis, epífora, edema y neovascularización corneal, inyección escleral y conjuntival, ambos ojos fueron tratados con CEM yse mantuvo por una semana con un midriático tópico. A los siete días ambos ojos se encontraron midriáticos, sin dolor, menor epífora, edema e inyección conjuntival y escleral. Tres días posterior a la segunda visita inició tratamiento médico, pero ya presentaba aún menor edema y se le observó mucho más cómodo (Figura 5)

Figura 5: Caballo 3

a) y b) se muestra cuadro con signos agudos de uveitis de ambos ojos, observándose edema, neovascularización e hiperemia conjuntival. c) y d) Se muestra disminución del edema e hiperemia.

Evaluación de interleucinas en muestras de lágrima

La comparación entre los medios empleados (PBS y CEM) para el grupo testigo no mostró diferencias en ninguna de las interleucinas medidas. No obstante, al comparar la concentración de éstas en diferente tiempo (basal, 30 min y 7 días), se encontró que la concentración de IL-1⍺ con el uso de PBS como vehículo, mostró diferencias estadísticamente significativas entre la medición basal y la realizada 7 días después (Cuadro 1)

Debido a que no se encontraron diferencias estadísticamente significativas entre ambos medios aplicados al grupo testigo, las mediciones se consideraron dentro de un solo grupo y se contrastaron con los datos obtenidos en el grupo experimental. Al respecto, no se

Rev Mex Cienc Pecu 2023;14(1):137-153 146

encontraron diferencias estadísticamente significativas en la concentración de IL’s en cualquiera de los tres tiempos utilizados, al comparar el grupo testigo con el grupo experimental tratado.

Discusión

En el campo de la medicina regenerativa el interés en investigaciones sobre las CEM ha incrementado durante la última década. Estas células, también conocidas como células mesenquimales progenitoras, tienen la capacidad de promover regeneración tisular, modular la respuesta inmunitaria y regular el proceso inflamatorio(18) . Asimismo, son consideradas como poblaciones celulares con la habilidad de auto renovarse y diferenciarse en diversos tiposdecélulasdetejido conectivo(19) .Enconsecuencia,tienenelpotencialdeactuarensitios de inflamación al sintetizar interleucinas involucradas en la modulación de este proceso(20) . De manera específica, estudios previos han descrito el efecto inmunomodulador de las CEM en caballos; adicionalmente, se ha demostrado que las CEM derivadas de equinos, en comparación con las de otras especies, poseen mayor capacidad de inhibir la proliferación de linfocitos T activados y disminuir la producción de IFN- y TNF(1,3) Así mismo, se ha reportado que el uso de CEM equinas como tratamiento, induce apoptosis de linfocitos y disminuye la expresión del receptor de IL-2 (CD25) en linfocitos T CD4+ .

Actualmente, en medicina equina son principalmente utilizadas para tratamientos de enfermedades del aparato locomotor, heridas en piel, síndrome metabólico equino, asma, laminitis, problemas neurológicos y oftalmológicos(21) . Dentro de estos últimos, la URE es considerada la principal causa de ceguera en equinos y se describe como una enfermedad inflamatoria autoinmune con características similares a la uveítis humana(22) . Los caballos que padecen URE se caracterizan por un fenotipo inflamatorio de linfocitos Th1 (CD4+ IFN); por lo tanto, los datos descritos sugieren que el uso de CEM es una alternativa adecuada en el tratamiento delaURE,así como deotras enfermedades inmunomediadas(23) Demanera conjunta, se han documentado beneficios terapéuticos a nivel ocular en equinos y otras especies(24,25,26)

Particularmente, se ha comprobado que la aplicación de CEM en conejos con daño en superficie corneal, acelera el proceso de cicatrización en la córnea, disminuye el estrés oxidativo y suprime la producción de interleucinas proinflamatorias; lo anterior, resulta en disminución en la opacidad de la córnea y neovascularización de la zona afectada(27) . En ratas, el uso de CEM en el tratamiento de quemaduras corneales y reconstrucción de la superficie corneal ha dado resultados positivos (25) .

Por otro lado, su uso en equinos como tratamiento de queratitis inmunomediada ha dado resultados promisores, en donde se observó que 3 de 4 caballos sometidos a esta terapia

Rev Mex Cienc Pecu 2023;14(1):137-153 147

tuvieron resultados positivos evidenciados por la disminución en la opacidad, irregularidad yvascularización en lasuperficie corneal; además demantenerlaenfermedad corneal estable hasta por un año después del tratamiento con CEM. Por lo tanto, es considerada como una nueva alternativa de terapia inmunomoduladora para este padecimiento(24) . De la misma forma, en otro estudio sobre queratitis inmunomediada equina, se reportó una respuesta satisfactoria a la inoculación de CEM en la arteria oftálmica y aplicación tópica subconjuntival tres veces al día por tres semanas(28)

En el presente estudio se evaluaron parámetros que indicaran los beneficios en el tratamiento de URE al administrar por vía subpalpebral de CEM. Una vez que se aplicó el tratamiento con CEM derivadas de GW en caballos con URE, se analizaron muestras de lágrimas para evaluar el patrón de interleucinas presentes en dicha muestra antes y después del tratamiento (30 min y 7 días posteriores). Sin embargo, no se mostraron cambios significativos a nivel de concentración de interleucinas en los diferentes tiempos evaluados, en donde se esperaba una disminución de interleucinas proinflamatorias y aumento de interleucinas antiinflamatorias. Ya que se ha descrito que en caballos con URE mantienen una concentración alta de IL-10, IL-1, IFN-, IL-6 e IL-17 en lágrima(23) .

Estos resultados, pueden estar asociados a la vía de administración; en donde la inoculación de CEM por vía subpalpebral muestra una menor eficacia para la resolución del padecimiento, probablemente al llegar de manera desproporcionada al sitio de acción (ojo), y por consiguiente una baja capacidad de afectar el proceso inflamatorio a dicho nivel, dosis inadecuada, frecuencia en la aplicación del tratamiento y etapa de la enfermedad, ya que la mayoría de los reportes indican una mejoría significativa al aplicar el tratamiento en la fase aguda de la enfermedad(23) Por otro lado, la ausencia de detección de IL proinflamatorias en las muestras de lágrima puede deberse a que el pico de concentración se da en periodos de la enfermedad diferentes a los evaluados en este estudio.

Estos hallazgos son útiles al momento de elegir la vía de administración para el tratamiento con CEM. Si bien, se han descrito casos de éxito al utilizar la vía subconjuntival, es necesario llevar a cabo la evaluación y comparación de vías de administración adicionales que puedan proporcionar mejores resultados en términos de eficacia a corto y largo plazo. En contraste, se ha descrito que la administración de CEM por vía intravenosa es completamente segura sin embargo, se desconoce si se obtienen mejores resultados(29) . Por consiguiente, es necesario realizar más estudios que permitan establecer las condiciones necesarias para el tratamiento de la URE, y así, su resolución.

De manera subsecuente, en los tres pacientes con URE que formaron parte del presente estudio piloto, se evaluó el efecto del tratamiento con CEM administradas por vía subpalpebral. El caballo 1 no se observaron cambios clínicos que indicaran mejoría. En contraste, el caballo 2 mostró mejoría de los signos clínicos presentados (dolor, edema,

Rev Mex Cienc Pecu 2023;14(1):137-153 148

vascularización, epífora y blefaroespasmo), incluso mejora en el estado de ánimo a los 7 días delapost aplicación del tratamiento.Enel caso del caballo3, hubomejoríadealgunos signos clínicos como menor epífora, dismunución del edema e inyección conjuntival y escleral, así como mejoría en su estado de ánimo.

Dos de los tres caballos tratados mostraron mejoría y disminución de los signos clínicos de URE 7 díaspost tratamiento. El obtenerresultados positivos al aplicarCEMdeGW deorigen equino resalta la importancia de hacer más estudios que permitan establecer un tratamiento uniforme y el desarrollo de un protocolo de aplicación de CEM eficiente que favorezcan la obtención de mejores resultados. Por ejemplo, opciones del tratamiento que promuevan una respuesta longeva y que la eficacia del tratamiento se potencialice al realizar varias o un número específico de aplicaciones con una dosis de CEM estandarizada, así como su coaplicación con terapia inmunosupresiva a nivel local(30)

Conclusiones e implicaciones

En este estudio piloto se describe el uso CEM derivadas de GW de forma experimental para el tratamiento de URE; si bien, se presentaron algunas limitaciones como el número de animalesanalizadosque nospermitanllegara conclusionesfirmes,laobtenciónderesultados positivos en las respectivas presentaciones clínicas sin generar efectos adversos, reafirma el uso de CEM como una alternativa viable al tratamiento de URE. A pesar de obtener resultados prometedores, se requiere hacer estudios controlados del tratamiento con CEM que permitan demostrar y confirmar los beneficios que proporciona para la URE.

Financiamiento

El financiamiento del estudio fue otorgado por el Programa de Apoyo a Proyectos de Investigación e Innovación tecnológica (PAPIIT) Proyecto No. IN228919 “Uso de células troncales alógenas para el tratamiento de uveítis recurrente equina” de la Facultad de Medicina Veterinaria y Zootecnia-Universidad Nacional Autónoma de México.

Conflictos de interés

Los autores declaran que no existe ningún conflicto de interés con respecto a la publicación del presente artículo.

Rev Mex Cienc Pecu 2023;14(1):137-153 149

Rev Mex Cienc Pecu 2023;14(1):137-153

Cuadro 1: Medición de interleucinas por técnica mediana y rango (<Nivel de cuantificación)

Grupo control (n=12)

Grupo experimental (n=3) Basal 30 minutos 7 días Basal 30 minutos 7 días Mediana Rango Mediana Rango Mediana Rango Mediana Rango Mediana Rango Mediana Rango

IL-1α 43.27 38.7153.20 41.62 36.9551.00 38.71* 36.1746.36 40.39 38.3145.32 41.26 35.1943.78 38.31 36.1739.06

IFN-γ 33.94 7.450175.3 18.52 3.900186.6 28.3 3.900341.5 93.12 25.2297.09 45.18 11.1795.31 108.3 14.78329.7

IL-2 1.323 0.453410.75 0.781 0.1316 -14.56 0.8325 0.3679 - 30.42 1.383 0.5992 - 1.729 0.8926 0.42291.611 1.516 0.93072.082

IL-10 19.52 6.70970.25 19.43 7.69446.30 17.84 6.70952.23 18.59 10.3419.46 12.43 7.85714.38 14.89 11.4928.56

TNFα 14.63 2.20056.80 2.998 2.20052.03 25.61 2.20070.88 11.53 2.20019.22 2.797 2.20015.64 13.86 8.01517.99

Se muestra que IL-1⍺ (*) detectada 7 días pos-tratamiento mostró una disminución significativa en comparación con la medición basal (P=0.0356). Los valores son reportados en pg/ml.

150

Literatura citada:

1. Carrade DD, Lame MW, Kent MS, Clark KC, Walker NJ, Borjesson DL. Comparative analysis of the immunomodulatory properties of equine adult-derived mesenchymal stem cells. Cell Med 2012;4(1):1-11. doi: 10.3727/215517912X647217.

2. Martínez‐Montiel MDP, Gómez‐Gómez GJ, Flores AI. Therapy with stem cells in inflammatory bowel disease. World J Gastroenterol 2014;20:1211‐1227.

3. Carrade Holt DD, Wood JA, Granick JL, Walker NJ, Clark KC, Borjesson DL. Equine mesenchymal stem cells inhibit T cell proliferation through different mechanisms depending on tissue source. Stem Cells Dev 2014;23:1258‐1265.

4. Le Blanc K, Davies LC. Mesenchymal stromal cells and the innate immune response. Immunol Lett 2015;168:140‐146.

5. Iacono E, Rossi B, Merlo B. Stem cells from foetal adnexa and fluid in domestic animals: an update on their features and clinical application. Reprod Dom Anim 2015; 50:353–64. doi: 10.1111/rda.12499.

6. Weiss ML, Troyer DL. Stem cells in the umbilical cord. Stem Cell Rev 2016;2:155–162.

7. Iacono E, Pascucci L, Rossi B, Bazzucchi C, Lanci A, Ceccoli M, et al. Ultrastructural characteristics and immune profile of equine MSCs from fetal adnexa. Reproduction 2017;154:509–519. doi: 10.1530/REP-17–0032.

8. Gilger BC, Hollingsworth SR. Diseases of the uvea, uveitis, and recurrent uveitis. In: Gilger BC, editor. Equine ophthalmology. Hoboken, NJ: John Wiley & Sons, Inc. 2016: 369–415. doi: 10.1002/9781119047919.ch8.

9. Gilger BC, Deeg C. Chapter 8‐Equine recurrent uveitis. Gilger BC editor. Equine Ophthalmology, 2nd ed. Saint Louis, MO: W.B. Saunders; 2011:317‐349.

10. SauvageAC,MonclinSJ,ElansaryM, HansenP,GrauwelsMF.Detectionofintraocular Leptospira spp. by real-time polymerase chain reaction in horses with recurrent uveitis in Belgium. Equine Vet J 2019;51:299–303.

11. Deeg CA. Ocular immunology in equine recurrent uveitis. Vet Ophthalmol 2008;11(Suppl 1):61‐65.

12. Deeg CA, Ehrenhofer M, Thurau SR, Reese S, Wildner G, Kaspers B. Immunopathology of recurrent uveitis in spontaneously diseased horses. Exp Eye Res 2002;75:127‐133.

Rev Mex Cienc
151
Pecu 2023;14(1):137-153

13. Gilger BC, Malok E, Cutter KV, Stewart T, Horohov DW, Allen JB. Characterization of T‐lymphocytes in the anterior uvea of eyes with chronic equine recurrent uveitis. Vet Immunol Immunopathol 1999;71:17‐28

14. Gilger BC, Michau TM. Equine recurrent uveitis: new methods of management. Vet Clin North Am Equine Pract 2004;20:417–27. doi: 10.1016/j.cveq.2004.04.010.

15. Kol A, Walker NJ, Nordstrom M, Borjesson DL. Th17 pathway as a target for multipotent stromal cell therapy in dogs: Implications for translational research. PLoS One 2016;11:e0148568.

16. Arzi B, Mills-Ko E, Verstraete FJM, Kol A, Walker NJ, BadgleyMR, et al. Therapeutic efficacy of fresh, autologous mesenchymal stem cells for severe refractory gingivostomatitis in cats. Stem Cells Transl Med 2016;5:75–86.

17. Holt DDC, Wood JA, Granick JL, Walker NJ, Clark KC, Borjesson DL. Equine mesenchymal stem cells inhibit T cell proliferation through different mechanisms depending on tissue source. Stem Cells Dev 2014;23:1258–1265.

18. Stewart MC, Stewart AA. Mesenchymal stem cells: characteristics, sources, and mechanisms of action. Vet Clin North Am Equine Pract 2011;27(2):243-61. doi: 10.1016/j.cveq.2011.06.004.

19. Madrigal M, Rao KS, Riordan NH. A review of therapeutic effects of mesenchymal stem cell secretions and induction of secretory modification by different culture methods. J Transl Med 2014;12:260.

20. Meirelles LS, Fontes AM, Covas DT, Caplan AI. Mechanisms involved in the therapeutic properties of mesenchymal stem cells. Cytokine Growth Factor Rev 2009;20(5-6):419-27. doi: 10.1016/j.cytogfr.2009.10.002.

21. CequierA,Sanz C,RodellarC,Barrachina L. The usefulness ofmesenchymal stem cells beyond the musculoskeletal system in horses. Animals (Basel). 2021;11(4):931. doi:10.3390/ani11040931.

22. Malalana F, Stylianides A, McGowan C. Equine recurrent uveitis: Human and equine perspectives. Vet J 2015;206(1):222-9. doi: 10.1016/j.tvjl.2015.06.017.

23. Saldinger LK, Nelson SG, Bellone RR, Lassaline M, Mack M, Walker NJ, Borjesson DL. Horses with equine recurrent uveitis have an activated CD4+ T-cell phenotype that can be modulated bymesenchymal stem cells in vitro. Vet Ophthalmol 2020;23(1):160170. doi: 10.1111/vop.12704.

Rev Mex Cienc
152
Pecu 2023;14(1):137-153

24. Davis AB, Schnabel LV, Gilger BC. Subconjunctival bone marrow-derived mesenchymal stem cell therapy as a novel treatment alternative for equine immunemediated keratitis: A case series. Vet Ophthalmol 2019;22(5):674-682. doi: 10.1111/vop.12641.

25. Jiang TS, Cai L, Ji WY, Hui YN, Wang YS, Hu D, Zhu J. Reconstruction of the corneal epithelium with induced marrow mesenchymal stem cells in rats. Mol Vis 2010;14;16:1304-16.

26. Dodi PL. Immune-mediated keratoconjunctivitis sicca in dogs: current perspectives on management. Vet Med (Auckl) 2015;30;6:341-347. doi: 10.2147/VMRR.S66705.

27. Cejkova J, Trosan P, Cejka C, Lencova A, Zajicova A, Javorkova E, Kubinova S, Sykova E, Holan V. Suppression of alkali-induced oxidative injury in the cornea by mesenchymal stem cells growing on nanofiber scaffolds and transferred onto the damaged corneal surface. Exp Eye Res 2013;116:312-23. doi: 10.1016/j.exer.2013.10.002.

28. Marfe G, Massaro-Giordano M, Ranalli M, Cozzoli E, Di Stefano C, Malafoglia V, Polettini M, Gambacurta A. Blood derived stem cells: an ameliorative therapy in veterinary ophthalmology. J Cell Physiol 2012;227(3):1250-1256. doi: 10.1002/jcp.22953.

29. Kol A, Wood JA, Carrade HDD, Gillette JA, Bohannon-Worsley LK, Puchalski SM, et al. Multiple intravenous injections of allogeneic equine mesenchymal stem cells do not induce a systemic inflammatory response but do alter lymphocyte subsets in healthy horses. Stem Cell Res Ther 2015;6(1):73. doi: 10.1186/s13287-015-0050-0.

30. Zhang J, Huang X, Wang H, Liu X, Zhang T, Wang Y, Hu D. The challenges and promises of allogeneic mesenchymal stem cells for use as a cell-based therapy. Stem Cell Res Ther 2015;6:234. doi: 10.1186/s13287-015-0240-9.

Rev Mex Cienc Pecu
153
2023;14(1):137-153

https://doi.org/10.22319/rmcp.v14i1.5537

Artículo

Escala de la producción y eficiencia técnica de la ganadería bovina para carne en Puebla, México

José Luis Jaramillo Villanueva a*

Lissette Abigail Rojas Juárez a

Samuel Vargas López a

a Colegio de Postgraduados Campus Puebla. Boulevard Forjadores de Puebla No. 205, Santiago Momoxpan, Municipio de San Pedro Cholula, 72760, Puebla, México.

*Autor de correspondencia: jaramillo@colpos.mx

Resumen:

El objetivo de este estudio fue estimar el grado de eficiencia técnica e identificar los factores de ineficiencia de la producción de bovinos de carne en la Sierra Norte de Puebla México. Los datos se generaron mediante encuesta a una muestra estadística de 180 unidades de producción bovina (UPB). La eficiencia técnica se estimó usando la Frontera de Producción Estocástica y la explicación de la ineficiencia se estimó con un modelo de regresión lineal múltiple. Los resultados indican que el tamaño de la UPB está correlacionada positivamente con la eficiencia; el grupo de UPB pequeños mostró una eficiencia media de 0.72, los medianosde0.75 ylosgrandesde0.85. Loscostosdealimentación ydemanodeobrapueden reducirse, mientras se mantiene el mismo nivel de producción. Las variables explicativas significativas (P≤0.05) de la ineficiencia son la escolaridad, la asistencia técnica, la experiencia y la gestión administrativa

Palabras clave: Ganado bovino, Eficiencia técnica, Escala de producción, Frontera de producción.

Recibido: 04/10/2019

Aceptado: 17/09/2020

154

Introducción

De acuerdo con datos oficiales(1), México produjo en 2017, 3.5 millones de toneladas de ganado en pie y 1.9 millones de toneladas de carne de res. El consumo nacional para 2019 se ubicó en 1.83 millones de toneladas. La producción nacional, en los últimos 15 años, muestra una tasa media de crecimiento (TMC) de 1.6 %, mientras que la demanda creció a una TMC de 0.21, que refleja una caída en el consumo, explicada por el aumento de los precios(2) . Al respecto, el consumo per cápita pasó de 18 kg en 2007 a 15.1 en 2017. No obstante, en 2017 las importaciones sumaron 136 mil toneladas(3) .

En México la producción no especializada de carne de bovino presenta dificultades para ser rentable, especialmente la que realizan las unidades de producción bovina (UPB) pequeñas y medianas, que obtienen tasas de rentabilidad negativas o muy bajas(4) . Este tipo de UPB fue de un millón en 2018. De acuerdo a la Encuesta Nacional Agropecuaria 2014(5), 62 % de las UPB tienen de 1 a 10 cabezas, 26 % de 11 a 35, 9.9 % de 36 a 120, y 1.6 % más de 120 cabezas. Por lo anterior, aproximadamente el 88 % de las UPB son pequeñas. Dada la importancia de este sector y del ganado para generar ingreso familiar, se hace necesario apoyar su desarrollo a través del análisis de los factores técnico-económicos que tienen una mayor incidencia en su productividad(6)

Un factor que afecta negativamente la rentabilidad económica de los pequeños ganaderos es la baja productividad y eficiencia técnica a nivel de UPB(7). Otro factor importante es la tasa de crecimiento de los insumos, que es mayor a la del precio del producto(8) . Por lo anterior, los retos que plantea la problemática descrita pueden afrontarse a través del mejoramiento de la eficiencia productiva de las UPB. La eficiencia productiva puede mejorar la rentabilidad de las UPB a través de la disminución de costos y mayor oferta al mercado.

Eficiencia productiva(9) se define como la situación en la que una unidad de producción ganadera (UPG) que produce un solo producto, puede mejorar su producción sólo si aumenta el uso de al menos uno de sus insumos. La literatura sobre eficiencia se enfoca en dos aspectos; medición de la eficiencia técnica y económica y las fuentes de ineficiencia. Los estudios de eficiencia se han realizado en una gran variedad de actividades productivas agropecuarias; granos(10); vegetables(11), lácteos(12), y café(13). En el mundo, pocos estudios han abordado la eficiencia en ganado bovino de carne;(14,15,16). En estos se encontró que existen desviaciones significativas de la frontera de producción eficiente.

En México, Morales-Hernández et al (17) realizaron el único estudio disponible de eficiencia de la producción de carne de bovino en México. Encontraron que para pequeños productores, al aumentar los factores de producción en una proporción determinada, la producción crece menos que proporcionalmente. En cambio para los grandes, al incrementar los factores en

Rev Mex Cienc Pecu 2023;14(1):154-171 155

una determinada proporción la producción creció en mayor proporción. No se necesita aumentar la cantidad de alimento ni la superficie de pastizal para incrementar la cantidad total de carne, pero sí el número de animales.

El estudio de la eficiencia de las UPB y las fuentes de ineficiencia son, por lo tanto, importantes desde el punto de vista práctico y político. Por un lado, los ganaderos podrían utilizar esta información para mejorar la productividad de su explotación. Por otro lado, los formuladores de políticas podrían focalizar las intervenciones para mejorar el ingreso del productor(18)

El objetivo de este estudio fue abordar esta brecha en el conocimiento mediante la estimación del grado de eficiencia, e identificar los factores de ineficiencia de la producción de bovinos de carne en la Sierra Norte de Puebla, México, desde una perspectiva econométrica

Material y métodos

Para el presente estudio, se seleccionaron, siete municipios de la Sierra Norte de Puebla (Cuadro 1). El área de estudio se ubicó en las coordenadas 19° 59' 10'' y 20° 34' 20'' N; 97° 19' 97'' y 97° 47' 98'' O. La altitud tuvo un rango de 1,000 a 1,700 msnm. El clima es cálido húmedo con abundantes lluvias todo el año, excepto el municipio de Xicotepec que presenta un clima semicálido húmedo. La vegetación está compuesta por pastizal (35 %), selva (13 %) y bosque (6 %)(19) . Estos municipios contribuyen con 32.1 % de la producción de ganado bovino a nivel estatal(3) .

La metodología constó de cuatro etapas: la primera, fue el conocimiento de la región, donde se llevó a cabo el reconocimiento de la zona, y se realizaron entrevistas a productores líderes y a técnicos para conocer aspectos generales de la ganadería; la segunda, fue el diseño del muestreo, de tipo aleatorio simple, con distribución proporcional, según el número de productores de cada municipio. La población utilizada corresponde a 60,020 UPB, la confiabilidad fue 95 % y precisión de 7.5 % de la media del tamaño del hato, lo que resultó en tamaño de muestra de 180 UPB. La tercera etapa consistió en el diseño, prueba y aplicación de cuestionarios, distribuidos proporcionalmente en los municipios del estudio (Cuadro 1). La cuarta etapa fue el análisis estadístico de datos derivados del cuestionario, los que se organizaron en variables sociodemográficas, tecnólogicas, y económicas.

Rev Mex Cienc Pecu 2023;14(1):154-171 156

Cuadro 1: Distribución del tamaño de muestra Municipio Población (N) Participación (%) Muestra (n)

Francisco Z. Mena 6791 11.31 54

Venustiano Carranza 11898 19.82 36

Tenampulco 3909 6.51 27

Pantepec 17919 29.86 20

Xicotepec 4734 7.89 18

Jalpan 8860 14.76 14

Ayotoxco de Guerrero 5909 9.85 12

Total 60020 100 180

La caracterización económica de las unidades de producción ganaderas con las variables mencionadas es de gran utilidad para los productores, ya que les permite conocer el comportamiento de su empresa ypueden tomar decisiones en sus actividades para minimizar costos, mejorar la productividad yrentabilidad de la misma. Por ello, es importante distinguir entre costos contables y costos económicos.

La perspectiva contable de los costos hace hincapié en los gastos erogados, los costos históricos y la depreciación. Los costos económicos representan el costo de oportunidad de los factores de la producción. Una forma de diferenciar entre estos dos planteamientos consiste en analizar cómo se definen los costos de diversos factores (trabajo, capital o servicios empresariales) y los costos contables o monetarios, que son los costos en que incurre la unidad de producción por la compra de insumos yactivos a precios de Mercado(20)

Para fines de esta investigación, los costos totales (CT) son el resultado de la suma de costos fijos (CF) y costos variables (CV) (CT = CF + CV). Los costos fijos son aquellos cargos que asume la unidad de producción independientemente de su nivel de producción, incluyendo la opción de cero producciones. Los costos variables son aquellos que cambian en función del nivel de producción de la UPP. Los costos totales incluyen: el costo de la mano de obra total, con base a la suma de mano de obra eventual (chapeo y aplicación de fertilizante), y la mano de obra permanente (comúnmente conocido como el pago del vaquero y del flotante), que requieren anualmente para el manejo de ganado; costo de los insumos (alimentos, medicamentos y otros); y el costo de maquinaria y equipo (incluyendo tasa de depreciación de cada activo considerando un valor de 10 % anual).

Rev Mex Cienc Pecu 2023;14(1):154-171 157

El fundamento para definir los estratos del tamaño del hato fue la segmentación de unidades pecuarias de SAGARPA(21), que consideran un estrato A conformado por 20 cabezas o menos, el estrato B de 21 a 50 cabezas, y el estrato C conformado por un hato mayor a 50 cabezas. Lo anterior, para atender de forma diferenciada a las UPG. Una vez formados los grupos se procedió al análisis econométrico; la estimación de la frontera estocástica de producción y la estimación de un modelo explicativo de la ineficiencia.

Modelo de frontera estocástica

El supuesto de una producción de naturaleza estocástica significa que el nivel de producción de una unidad de producción está limitado superiormente por una frontera estocástica, la cual puede modelarse como en la Ecuación 1: (x), Yf

Donde el término de error está compuesto por dos partes; una perturbación aleatoria v, simétrica que se supone idéntica e independientemente distribuido con media 0, y u es un término de error no negativo, que se distribuye independientemente de v, siguiendo una distribución de una cola(22) . El componente aleatorio representa sucesos que no son controlables por la UPG (fenómenos climáticos, sociales, económicos y políticos), mientras queurecogeladistancia decadaempresaasufronteraestocástica,representandouna medida de ineficiencia técnica(23) . Por tanto, la Frontera de Producción Estocástica (FPE) es descrita por la Ecuación 2: *() Yfxv  (2) En el caso de las FPE, el índice de eficiencia técnica para la empresa i puede calcularse con la Ecuación 3: () i i i

Y ET fxv   (3)

La FPE es propuesta por primera vez en los años 1970 del siglo pasado(24,25) donde consideraron(24) el caso en que u se distribuye semi-normal, es decir (0,) u uN  y v normal. Las implicaciones a nivel conceptual de que la FP sea estocástica son muy importantes para la interpretación de la ineficiencia. Como dice Schmidt(24), “el agricultor cuya cosecha es devastadapor lasequíao una tormentaes desafortunado con nuestra medida, pero ineficiente con la medida habitual” . Una importante limitación de las primeras estimaciones de FPE es que solamente se calculaba la eficiencia media de la muestra, no siendo posible obtener una medida de la eficiencia de cada empresa. Desarrollos posteriores(26)lograron encontrar una medida de la eficiencia individual utilizando la distribución condicional de u en ε. El índice de eficiencia técnica para cada empresa i es:   1 exp(|)ii ETEu 

La medida más utilizadade la ET es la razón delaproducción observada yla correspondiente producción de frontera estocástica, como en Ecuación 5:

Rev Mex Cienc Pecu 2023;14(1):154-171 158
  vu  
(1)
 (4)

Esta medida de eficiencia técnica toma un valor entre cero y uno. Mide el producto de la iésima UPG en relación con el producto que podría producir una UPG totalmente eficiente utilizando el mismo vector de insumos. El primer paso para calcular la ET es estimar los parámetros del modelo de frontera de producción estocástica:

Estimación de los parámetros

Debido a que el modelo 9.2 incluye términos aleatorios; el error simétrico (vi) y una variable aleatoria no negativa (ui), el método de estimación seleccionado incluye supuestos sobre ambos términos. Cada vi se distribuye independiente de cada ui y ambos están no correlacionados con las variables explicativas. Adicionalmente, el componente de ruido vi se asume con propiedades idénticas a las del modelo clásico de regresión lineal. El componente de ineficiencia tiene propiedades similares excepto que tiene una media diferente de cero (ui ≥0), por lo que no se pueden usar Mínimos Cuadrados Ordinarios. Una solución es hacer algunas suposiciones de distribución con respecto a los dos términos de error y estimar el modelo utilizando el método de máxima verosimilitud (ML).

Modelo Half-Normal

Estimadores ML se obtuvieron(24) bajo los siguientes supuestos: vi = iidN(0,s v 2) y ui = iidN + (0,s u 2). Lo anterior indica que las vi son variables aleatorias normales distribuidas de manera independiente e idéntica con medias y varianzas cero y las ui son variables aleatorias semi-normales distribuidas de manera independiente e idéntica con parámetro de escala. Es decir, la función de densidad de probabilidad (pdf) de cada ui es una versión truncada de una variable aleatoria normal que tiene media cero y varianza 2 . u  La función log-verosimilitud se parametrizó(24) para este modelo medio normal en términos de

Rev Mex Cienc Pecu 2023;14(1):154-171 159 ´ exp() exp() exp(exp() iiii Ii iiii qxvu TEu xvxv      (5)
and /0. vuuv   Si

2 11 2 2 11 11 In(|,,)In In 222 i i ii Ly              (6) Donde, y es un vector de producto; In iiiii vuqx   es
x  es
222222
0
no hayefectos de ineficiencia técnica ytodas las desviaciones de la frontera se deben al ruido. Usando esta parametrización, la función de máxima verosimilitud es representada en la Ecuación 6:
el término de error compuesto; y ()
una función de distribución acumulada (cdf) de la variable aleatoria normal estándar evaluada en x.

El análisis empírico se basa en la estimación de una función de producción Cobb-Douglas en la que tanto el producto como los insumos se expresan en forma logarítmica (Ecuación 7), por lo que los coeficientes estimados se interpretan como elasticidades(27) .

Ln(Yi ) = b0 +b1Ln(SUP) +b2Ln(MO) +b3Ln(ACT) +b4Ln(SAN) +b5Ln(ALIM) + e (7)

En este modelo, la variable dependiente (Yi) es el valor de la producción ganadera de las UPG. Las variables explicativas son; SUPGAN, es la superficie ganadera, en hectáreas propiedad de la UPB

MO, es el costo de la mano de obra utilizada en la producción. ACT, es el valor de los activos; valor de maquinaria, equipo, e instalaciones productivas utilizados en la actividad ganadera.

SAN, es los gastos en sanidad; insumos y servicios veterinarios. ALIM, es el costo de alimentación; costo de mantenimiento de pradera y alimentación suplementaria.

Modelo de eficiencias individuales

El modelo estimado de eficiencias individuales (Ecuación 7) considera como variable dependiente las medidas de ineficiencia estimadas en la primera etapa. Las variables explicativas son un conjunto de variables que hipotéticamente afectan el desempeño de la UPG(6). La literatura reporta como variables explicativas más comunes la edad del jefe de la UPG, su nivel de escolaridad, la experiencia en la actividad objeto del estudio, características de la UPG, administración, y factores ambientales, entre los más citados(28-31) El modelo de regresión múltiple fue el descrito en Ecuación 8: Ui = d0 +d1Ln(Edad) +d2Ln(Escol) +d3Ln(Exper) +d4Ln(Admon) +d5Ln(AT) +J i (8) Donde: Edad, es la edad del jefe de la UPG; Escol es el nivel de escolaridad (en años) del jefe de la UPG; Exper, son los años de experiencia en la actividad ganadera; Admon es una variable dummy que toma el valor de cero si la UPG no tiene un sistema de administración y uno si cuentan con un sistema de administración; AT es servicio de asistencia técnica, cero si no recibieron asistencia técnica y uno si recibieron el servicio. Las variables de modelo de frontera estocástica y del modelo de ineficiencia individuales se presentan en el Cuadro 2.

Rev Mex Cienc Pecu 2023;14(1):154-171 160

Cuadro 2: Variables usadas en el modelo producción de frontera estocástica Conceptos Frecuencia Porcentaje

Género del jefe Mujer 22 12.0 Hombre 162 88.0

Escolaridad del jefe de la UPG Primaria 69 37.3 Secundaria 63 34.1 Media Superior 33 17.8 Profesional 20 10.8

Administración No llevan sistema 114 61.6 Llevan sistema 71 38.4

Asistencia técnica No recibieron 124 67.0 Si recibieron 55 33.0 Nivel tecnológico Bajo 94 50.8 Medio 45 24.3 Alto 46 24.9

Estratos (número de unidades animal (U.A)) 20 o menos 89 48.1 21 a 50 60 32.4 50 o mayor 36 19.5

Variable Media Desviación estándar

Edad del jefe (a) 56.0 13.4 Experiencia 22.2 13.3 Unidades animal 62.5 88.6 Superficie pradera, ha 64.9 129.4 Costo mano de obra, $ 37,837 19,354 Sanidad, $ 10,680 3,292 Costos alimentación, $ 125,477 72,226 Activos; depreciación anual, $ 35,260 10,500 Ingreso neto, $ 83,488 20,824 Beneficio costo (B/C) 1.31 0.26

Resultados y discusión

Los dueños de las UPB de la región Sierra Norte de Puebla tienen edad promedio de 56 años y rango de 25 a 86 años. El promedio de escolaridad es 8 años; poco menos de la mitad de productores tienen estudios de primaria terminada, 28.6 % terminó la secundaria y 29.2 % culminó estudios de bachillerato. Las características anteriores son similares a las reportadas

Rev Mex Cienc Pecu 2023;14(1):154-171 161

previamente(32) para la población rural del estado de Puebla. La experiencia de los productores en la producción de ganado bovino fue de 27 años, y han recibido asistencia técnica en temas de alimentación, sanidad animal y capacidad de carga.

La mitad de las UPG (50.8 %) se dedican exclusivamente a la producción de ganado bovino en pie, 22.2 % se sustenta con otras actividades comerciales (arrendamientos, negocios y transportes), 16.8 % se apoya en actividades agrícolas y frutícolas (café, plátano, maíz, naranja, frijol y vainilla), y 10.3 % reporta otras actividades no agropecuarias. El porcentaje del ingreso de los hogares que es generado por actividades productivas no agropecuarias fue de 55 %, resultado similar al reportado en estudios previos(33)

El tamaño promedio del hato fue de 73 cabezas, con un mínimo de 4 y un máximo de 657, lo que evidencia una gran heterogeneidad entre las unidades productoras, dificultando las condiciones para competir y lograr un mejor proceso productivo(34). La superficie promedio que detentan las UPG para el pastoreo fue de 64 ha y el valor de sus activos fue de $135,261 (vehículos, molino, bodega, ordeñadora, silo, corral, bebedero, comedero y báscula). Los ingresos promedios anuales reportados fueron de $83,666, equivalente al 10 % del hato, por el concepto de venta de becerros a destete y animales de desecho. En la estructura de costos, la alimentación representó 60 % del costo total de producción, la mano de obra contratada y familiar 18 %, costos fijos y depreciación de activos 17 % y 5 % fue el costo de la sanidad.

Resultados del modelo econométrico

Los resultados del modelo de frontera estocástica, utilizando la muestra completa, se presentan en Cuadro 3. Las variables resultaron con el signo esperado, de acuerdo a la teoría económica. El signo positivo se refiere a que al aumentar el uso del factor productivo aumenta la producción, en tanto que la magnitud del coeficiente da cuenta de la importancia relativa de cada variable independiente para explicar la dependiente.

Rev Mex Cienc Pecu 2023;14(1):154-171 162

Cuadro 3: Resultados del ajuste del modelo de frontera estocástica

Variable explicativa Coeficiente EE Estadístico t [95% intervalo de confianza] Sup. de pastos (SUP) 0.025 0.015 1.71* -0.023 0.073 Mano de obra (MO) 0.263 0.068 3.89** 0.430 0.696 Valor de activos (ACT) 0.365 0.046 7.87** 0.456 0.274 Sanidad (SAN) 0.411 0.081 5.07** 0.152 0.670 Alimentación (ALIM) 0.195 0.016 11.82** 0.053 0.327 Intercepto -1.777 0.498 -3.57** -2.753 -0.802 sig2v -3.481 0.287 -12.13 -4.044 -2.919 sig2u -2.607 0.369 -7.06 -3.331 -1.884 sigma_v 0.175 0.025 0.132 0.232 sigma_u 0.272 0.050 0.189 0.390 sigma2 0.105 0.021 0.063 0.146 lambda y lambda2 1.370/1.88 0.072 1.408 1.688 gamma: 22 / us   0.74 EE= error estándar; * y** significativo al 10 y 5 % respectivamente.

Las variables MO, ACT, SAN, y ALIM son significativas al 5 % Superficie ganadera (SUPGAN)fueencontradasignificativa también(30) cuandoestudiaronlos factoresquetienen influencia en la eficiencia técnica en el sudeste de Kenya en 2013; un aumento del 10 % en la superficie ganadera resultó en 29 % de aumento en la producción ganadera. La variable MO fue encontrada significativa por varios autores(31,35,36) . En un estudio en Botswana(36) realizado con cuatro estratos de productores, encontraron que al aumentar 10 % la cantidad de mano de obra, aumenta en 15 y 18 %, respectivamente la ganancia de los productores. La variable ACT no ha sido identificada como significativa en los estudios revisados. En el presente estudio, ACT tiene un efecto positivo en la producción de las UP ganaderas, de acuerdo alo esperado por lateoríaeconómica(20) . LavariableSAN yALIM fueronreportadas también como significativa(14,30,31) .

Respecto al ajuste del modelo (7), la frontera de producción estocástica estimada presentó una distribución normal de los residuos (test de Shapiro-Wilks), no correlación serial de los errores (Durbin-Watson), no heterocedasticidad de la varianza y no presenta problemas de autocorrelación ni multicolinealidad. En los valores obtenidos del modelo ajustado general (Cuadro 3), se determinó que la producción ganadera presenta rendimientos crecientes de escala (La sumatoria de los coeficientes es mayor que la unidad). Para confirmar este resultado, serealizólapruebaparalos retornos de escala,dondeseobtuvo un valorde P=0.03 < 0 05, esto hace que se rechace la existencia de retornos constantes a escala(6)

En lo que se refiere a las ineficiencias del modelo 8, se observó que los parámetros de varianza de la función de máxima verosimilitud (MV) son estimados a partir del modelo total

Rev Mex Cienc Pecu 2023;14(1):154-171 163

de varianza definido como: 222 svu   y el valor estimado en el modelo para la varianza total 2 () s  resultó en 0.105. Mientras que el valor de lambda (%) resultó en 1.370, lo que muestra que la varianza de las eficiencias es mayor que la varianza de las perturbaciones aleatorias en 88% 2 (1)  y el valor de gamma obtenido de la relación entre las varianzas

  establece que el 73.9 % de la varianza total es explicada por la varianza de las ineficiencias.

Los resultados del modelo de frontera estocástica para cada estrato de productores ganaderos se muestran en el Cuadro 4. Similar al modelo general, los modelos para cada estrato estimado mostraron distribución normal de los residuos, no correlación serial de los errores, no heterocedasticidad de la varianza y no auto correlación. Las variables SUPGAN, MO, ACT, SAN, y ALIM son significativas al 5 % en los estratos dos y tres.

Cuadro 4: Resultados del modelo de Frontera Estocástica para los estratos de UPG Estrato 1 Estrato 2 Estrato 3

Variable Coeficiente Valor de Z Coeficiente Valor de Z Coeficiente Valor de Z SUP 0.094 1.85 0.027 2.27 0.073 3.31 MO 0.121 1.76 0.086 2.17 0.163 4.55 ACT 0.116 3.33 0.204 3.83 0.210 4.33 SAN 0.118 2.18 0.158 3.55 0.194 8.95 ALIM 0.654 13.64 0.607 14.07 0.670 2.35 Constante 0.641 1.08 0.752 1.59 -1.267 -2.96 /lnsig2v -3.704 -24.7 -4.206 -23.02 -37.972 -0.06 /lnsig2u -13.129 -0.07 -13.419 -0.07 -2.339 -9.92 sigma_v 0.157 0.122 0.000 sigma_u 0.001 0.001 0.310 sigma2 0.025 0.015 0.096 lambda 0.009 0.010 5.460

En el estrato 1 fue significativa solo SAN, y ALIM. Una posible explicación es que los pequeños productores tienen pastos de menor calidad, sin manejo agronómico, utilizan mano de obra familiar, poco especializada, y el valor de sus activos es muy bajo, reflejo de UPG poco tecnificadas. La variable alimentación es la que tiene mayor peso en explicar la producción de las UPG para los tres estratos. El valor de los activos tiene dos veces más peso relativo en los estratos dos ytres que en el uno, lo que significa que estas UPG no solo tienen mayor inversión en activos, sino que es moderna ygenera mayor productividad. Los modelos para el estrato 2 y 3 presentan rendimientos crecientes a escala, no así el modelo del estrato 1 que tiene rendimientos decrecientes a escala. Al respecto(37) , en un estudio en Estados Unidos de América, encontró que a medida que aumenta el tamaño de la UPG aumenta la ET, lo que mostró evidencia de economías de escala. Posible explicación para el resultado

Rev Mex Cienc Pecu 2023;14(1):154-171 164
22 / us

del estrato 1 es que los pequeños productores tienen bajo nivel de capitalización, mano de obra poco calificada, y dado que tienen poca superficie de pastos, hacen un uso intensivo, sobre explotando el recurso(38,39) .

Distribución de frecuencias de la eficiencia técnica (ET) por estrato de las UPG

El rango de ET para los productores bovinos estuvo entre 0.50 y 0.95. Del total de las 185 UPG, 29 % tiene valores entre 0.50 y 0.70, 63 % entre 0.71 y 0.90, y solo 8 % valores de ET mayores a 0.90. Se observa en el Cuadro 5 que el estrato 3 presenta la mayor parte de los valores de 0.91 o más. Al respecto(40) , encontraron que las UPG con mayor número de unidades animal y mayor superficie ganadera presentaron los valores mayores de eficiencia técnica.

Cuadro 5: Distribución de frecuencias (porcentajes) de la eficiencia técnica (ET) por estratos de las UPG

Estratos (no de cabezas) ET (0.50 - 0.70)

ET (0.71-0.90)

ET (> 0.91)

Promedio

Estrato 1 (20 o menos) 47.2 22.2 13.3 0.712 Estrato 2 (21 a 50) 41.5 33.3 0.0 0.751 Estrato 3 (Mayor a 50) 11.3 44.4 86.7 0.844 General 100.0 100.0 100.0 0.789

Resultados de las ineficiencias individuales

El Cuadro 6 presenta los resultados del modelo de las ineficiencias individuales de acuerdo a la Ecuación (8) Las variables significativas, a diferentes niveles de significancia, y con un coeficientenegativo, fueron Escol, Exper,AdmonyAT.El signo negativo delos coeficientes indica una relación inversa entre el valor de la variable explicativa y el valor de la ineficiencia Al respecto, investigaciones previas(28,30,36) han reportado resultados que sustentan a los resultados de este trabajo. Se encontró que más años de escolaridad reduce la ineficienciaenvaloresmuysimilaresalosreportadosenestainvestigación.Deformasimilar, para el caso de la variable Admon(6,14,41) encontraron una relación inversa entre llevar un sistema de administración e ineficiencia. Para AT(28,30,41) reportaron que el recibir este servicio se contribuye a reducir la ineficiencia de las UPG. En el presente estudio Edad no es significativa, resultado apoyado por lo encontrado en la literatura(30) .

Rev Mex Cienc Pecu 2023;14(1):154-171 165

Cuadro 6: Modelo explicativo general de la ineficiencia

Variable explicativa Coeficiente Error estándar Valor de t Intervalo

Edad (Edad) 0.02 0.0212 1.1 -0.042 – 0.042 Escolaridad (Escol) -0.23 0.0635 3.6 0.010 – 0.635 Experiencia (Exper) -0.12 0.0739 1.7 -0.012 – 0.024 Administración (Admon) -0.23 0.0824 2.5 -0.001 - 0.048 Asistencia técnica (AT) -0.22 0.0136 14.9 0.176 - 0.230 Constante -0.47 0.799 -0.6 -0.626 – (-0.310) Ajuste (R2)/R2 ajustada 0.7929 / 0.7859 Heterocedasticidad (Cook-Weisberg)

Prob> Ji2=0.000 Normalidad: (ShapiroWilk) 0.00002 Factor Inflación varianza 1.59

Los resultados anteriores sugieren que reducir la ineficiencia deberá abordarse brindando servicios públicos de asistencia técnica, actividad que en México está en niveles muy bajos desde la década de los noventas Al respecto, en un estudio sobre uso de innovaciones pecuarias en Sinaloa(7) reportaron que solo 3 % de las UP reciben servicios de asistencia técnica, y de estos, las UPG representan sólo 19.3 % La capacitación en la gestión de la UPG, incluyendo servicios administrativos, también deberá ser un aspecto central, además de los temas tecnológicos de la ganadería.

Resultados del modelo de la ineficiencia técnica por estratos de UPG

El Cuadro 7 reporta los resultados del modelo deineficiencia técnica por estratos de las UPG. Paraelestrato1,Edad yExpersonsignificativas, noasíEscol,Admón yAT.Losproductores de este estrato presentan baja escolaridad, de 6 años en promedio, tienen experiencia, y la mayoríanollevansistemasadministrativos ynorecibenningúntipodeserviciosdeasistencia técnica. Para el estrato 2 Escol, Exper y AT son significativos. Se observó, que los años de escolaridad aumentan de forma importante para los productores de este estrato. Finalmente, para el estrato 3, cuatro variables son significativas. Cabe resaltar que los valores de los coeficientes están en el rango de 0.13 a 0.28, lo que evidencia un efecto importante de estas variables para reducir la ineficiencia. Por lo que mejorar los sistemas administrativos y la calidad de la asistencia técnica son aspectos que pueden llevar a estas UPG a ser altamente eficientes(14,30,41)

Rev Mex Cienc Pecu 2023;14(1):154-171 166

Cuadro 7: Resultados del modelo de la ineficiencia técnica por estratos de UPG

Estrato 1 Estrato 2 Estrato 3

Variable Coef. t EE Coef. t EE Coef. t EE

Edad -0.066 -2.15* 0.031 0.017 0.42 0.041 0.065 1.38 0.047 Escol -0.001 -0.03 0.007 -0.184 -2.08* 0.088 -0.142 -2.59* 0.055 Exper -0.027 -2.30* 0.012 -0.126 -2.09* 0.060 -0.197 -4.28* 0.046 Admón 0.033 1.63 0.020 0.017 0.81 0.020 -0.281 -5.73* 0.049 AT 0.108 1.42 0.076 -0.150 -7.34* 0.020 -0.134 -5.56* 0.024 Constante -0.238 -2.10 0.113 -0.481 -2.97 0.162 -0.700 -3.89* 0.179 R2/R2 Adj. 0.7935 / 0.7884 0.8027 / 0.7904 0.8214 / 0.7945 D-W 0.0719 0.0005 0.0247 Normalidad 0.01219 0.69848 0.17108 FIV 1.4 1.23 1.7 EE= error estándar; D-W= Durbin-Watson; FIV= factor de inflación de la varianza.

Conclusiones e implicaciones

La producción de bovinos en pie en la región de estudio se realiza con un grado alto de eficiencia, sin embargo, existe un margen importante para mejorar, especialmente en los pequeños productores. Los productores más eficientes tienen mayor escolaridad, reciben servicios de asistencia técnica, utilizan sistema de administración, detentan mayor superficie de pastos, mayor número de cabezas y utilizan mejores sistemas de sanidad animal. Los costos de mano de obra, sanidad, alimentación y activos pueden reducirse manteniendo el mismo nivel de producción. Los pequeños productores, que son el subsector más grande en número, pueden mejorar su producción atendiendo aspectos de alimentación y sanidad, con las demás variables constantes. El uso de servicios de asistencia técnica disminuye la ineficiencia, a través de hacer un uso más intensivo y adecuado de la tecnología pecuaria disponible. Por lo anterior, es recomendable hacer extensivos y permanentes estos servicios a todos los ganaderos, especialmente a los pequeños. La relación positiva entre tamaño del hato y eficiencia productiva puede estar relacionada con los beneficios de economías de escala, para el caso de medianos y grandes productores, por lo que el financiamiento para aumentar el hato puede generar ganancias de producción y eficiencia.

Literatura citada:

1. SIAP. Sistema de Información Agroalimentaria y Pesca. 2017. Avance mensual de la producción pecuaria. Consultado 13 marzo, 2019. http://infosiap.siap.gob.mx/repoAvance_siap_gb/pecConcentrado.jsp.

2. FIRA. Fideicomisos Instituidos en Relación con la Agricultura 2017. Panorama Agroalimentario. Panorama Agroalimentario Carne de bovino 2017.pdf Consultado 22 enero, 2019.

Rev Mex Cienc Pecu 2023;14(1):154-171 167

Mex Cienc Pecu 2023;14(1):154-171

3. SIAP. Sistema de Información Agroalimentaria y Pesca. 2018. Cosechando números del Campo; carne de bovino. http://www.numerosdelcampo.sagarpa.gob.mx/publicnew/productosPecuarios/cargarP agina/1 Consultado 24 Ene, 2019.

4. Jaramillo-Villanueva JL, Escobedo-Garrido JS, Carranza-Cerda I. Oportunidades estratégicas para el desarrollodel sectoragropecuario enPuebla, sistemas de producción y procesos de agregación de valor. 1ra ed. México: Plaza y Valdés SA de CV. 2017.

5. ENA. Encuesta Nacional Agropecuaria. 2015. Existencias de ganado bovino según rangos de edad por entidad federativa. https://www.inegi.org.mx/programas/ena/2014/default.html#Tabulados. Consultado 22 Ene, 2019.

6. Veloso-Contreras F, Cabas-Monje J, Velasco-Fuenmayor J, Vallejos-Cartes R, Gil-Roig JM. Eficiencia técnica de los pequeños productores bovinos de la región centro sur de Chile. Revista Científica 2015;25(2):99-106.

7. Cuevas RV, Baca del Moral J, Cervantes EF, Espinosa GJA, Aguilar ÁJ, Loaiza MA. Factores que determinan el uso de innovaciones en la ganadería de doble propósito en Sinaloa, México. Rev Mex Cienc Pecu 2013;4(1):31-46.

8. Ayala-Garay AV, Rivas-Valencia P, Cortes-Espinoza L, De la O-Olán M, EscobedoLópez D, Espitia-Rangel E. La rentabilidad del cultivo de amaranto (Amaranthus spp.) en la región centro de México. CIENCIA ergo-sum 2014;21(1):47-54.

9.KoopmansTC. Ananalysisofproductionasanefficient combinationof activities.Activity Analysis of Production and Allocation 1951;(13):33-97.

10. Martey E, Wiredu AN, Etwire PM, Kuwornu JK. The impact of credit on the technical efficiency of maize-producing households in Northern Ghana. Agric Finance Rev 2019;79(3):304-322.

11. Wiboonpongse A, Sriboonchitta S, Rahman S, Calkins P, Sriwichailumphun T. Joint determination of the choice of planting season and technical efficiency of potato in northern Thailand: A comparison of Greenes versus Heckmans sample selection approach. Afr J Bus Manag 2012;6(12):4504-4513.

12. Cabrera VE, Solís D, del Corral J. The effect of traditional practices in the efficiency of dairy farms in Wisconsin. South J Agric Econ Association Annual Meeting Orlando FL, February 6-9; 2010.

Rev
168

Pecu 2023;14(1):154-171

13. Cárdenas G, Vedenov DV, Houston JE. Analysis of production efficiency of Mexican coffee-producing districts. AAEA Annual Meetings, Selected Paper #134280 Providence, RI July 2005.

14. Otieno DJ, Hubbard LJ, Ruto E. Determinants of technical efficiency in beef cattle production in Kenya. Selected Paper prepared for presentation at the International Association of Agricultural Economists (IAAE) Triennial Conference Foz do Iguacu Brazil August 2012;18-24.

15. Iraizoz B, Bardaji I, Rapun M. The Spanish beef sector in the 1990s: impact of the BSE crisis on efficiency and profitability. Appl Econ 2005;37(4):473-484.

16. Trestini S. Technical efficiency of Italian beef cattle production under a heteroscedastic non-neutral production frontier approach. Paper presented at the 10th Joint Conference J Food Agric Environ, Duluth Minnesota 2006 August:27-30

17. Morales-Hernández JL, González-Razo FDJ, Hernández-Martínez J. Función de producción de la ganadería de carne en la zona sur del Estado de México. Rev Mex Cienc Pecu 2018;9(1):1-13.

18. Solís D, Bravo-Ureta B, Quiroga R. Technical efficiency among peasant farmers participating in natural resource management programs in Central America. J Agric Econ 2009;60:202-219.

19. INEGI. Instituto Nacional de Estadística, Geografía. 2009. Censo Agropecuario 2007. http://www.inegi.org.mx/est/contenidos/proyectos/Agro/ca2007/Resultados_Ejidal/def ault.aspx. Consultado 18 Jun, 2019.

20. Nicholson W. Teoría microeconómica. Principios básicos y ampliaciones Novena edición Cengage Learning 2012;212-224.

21. SINIIGA. Sistema Nacional de Identificación Individual de Ganado. 2012. Estratificación por UPs y vientres bovinos, 32. Veracruz, México. http://ugrnv.com.mx/web/wp-content/uploads/2012/06/Siniiga%20Presentacion.pdf. Consultado 17 Jun, 2019.

22.Alvarez PA. Lamedición delaeficiencia ylaproductividad.Primera ed. Madrid, España: Ediciones Pirámide; 2001.

23. Greene WH. Simulated likelihood estimation of the normal-gamma stochastic frontier function. J Product Anal 2003;19(2):179–190.

24. Aigner DJ, Lovell K, Schmidt P. Formulation and estimation of stochastic frontier production function models. J Econom 1977;6(1):21–37.

Rev
169
Mex Cienc

25. Meeusen W, Van Den Broeck J. Efficiency estimation from Cobb-Douglas production functions. Int Econ Rev 1977;18(2):435–444.

26. JondrowJ,Lovell CK,Materov IS,Schmidt P.Ontheestimation oftechnical inefficiency in the stochastic frontier production function model. J Econom 1982;19(2-3):233-238.

27. Kumbhakar SC, Lovell CAK. Stochastic Frontier Analysis. Cambridge University Press. Cambridge, New York, Melbourne 2003. http://dx. doi. org/10.1017/cbo9781139174411.

28. Velasco FJ, Ortega SL, Sánchez CE, Urdaneta F. Análisis de sensibilidad del nivel tecnológico adoptado en fincas ganaderas de doble propósito del Estado Zulia, Venezuela. Rev Cient 2010;20(1):67-73.

29. Melo-Becerra LA, Orozco-Gall AJ. Technical efficiency for Colombian small crop and livestock farmers: A stochastic metafrontier approach for different production systems. J Product Anal 2017;47(1):1-16.

30. Kibara MJ, Kotosz B. Tecnnical efficiency estimation in the livestock industry: Case study of the southern rangelands of Kenya. Challenges in National and International Economic Policies 2018;97-114.

31. LatruffeL, BalcombeK,DavidovaS,ZawalinskaK.Determinantsoftechnicalefficiency of crop and livestock farms in Poland. Appl Econ 2004;36(12):1255-1263.

32. INEGI. Instituto Nacional de Estadística, Geografía. 2018. Censos y Conteos de Población y Vivienda. https://www.inegi.org.mx/programas/ccpv/2010/. Consultado 17 Ene, 2019.

33. Mora-Rivera J, Martínez-Domínguez M, Jaramillo-Villanueva JL, Chávez-Alvarado MA. Participación en el sector no agropecuario en el México rural: una perspectiva de género. R Bras Est Pop Belo Horizonte 2017;34(2):367-389.

34. Escalante S, Roberto I, Catalán H. Situación actual del sector agropecuario en México: perspectivas y retos. Economía Informa 2008; 350. http://www.economia.unam.mx/publicaciones/econinforma/pdfs/350/01escala nte.pdf.Consultado22May,2019.

35. Rakipova AN, Gillespie JM, Franke DE. Determinants of technical efficiency in Louisiana beef cattle production. J ASFMRA 2003;99-107.

36. Bahta S, Baker D. Determinants of profit efficiency among smallholder beef producers in Botswana. Int Food Agribusiness Manag Rev 2015;18(3):107-130.

Rev Mex Cienc
170
Pecu 2023;14(1):154-171

37. Sabasi D, Shumway CR, Astill GM. Off‐farm work and technical efficiency on US dairies. Agric Econ 2019;1-15.

38. Perfetti JJ, Balcázar A, Hernández A, Leibovich J. Políticas para el desarrollo de la agricultura en Colombia. Fedesarrollo, Sociedad de Agricultores de Colombia (SAC), Incoder, Finagro, Banco Agrario. 2013.

39. Cano CG, Vallejo C, Caicedo E, Amador JS, Tique EY El mercado mundial del café y su impacto en Colombia. Borradores de Economía 2012;710

40. Qushim B, Gillespie JM, Bhandari BD, Scaglia G. Technical and scale efficiencies of US grass-fed beef production: whole-farm and enterprise analyses. J Agric Appl Econ 2018;50(3):408-428.

41.CeyhanV,HazneciK.Economicefficiencyofcattle-fatteningfarmsin Amasyaprovince, Turkey. J Anim Vet Adv 2010;9(1):60-69.

Rev Mex Cienc Pecu
171
2023;14(1):154-171

https://doi.org/10.22319/rmcp.v14i1.6182

Artículo

Regresión cuantil para predicción de caracteres complejos en bovinos Suizo Europeo usando marcadores SNP y pedigrí

Jonathan Emanuel Valerio-Hernández a

Paulino Pérez-Rodríguez b*

Agustín Ruíz-Flores a

a Universidad Autónoma Chapingo. Posgrado en Producción Animal. Carretera Federal México-Texcoco Km 38.5, 56227, Texcoco, Estado de México, México.

b Colegio de Postgraduados. Socio Economía Estadística e Informática. Carretera Federal México-Texcoco Km 36.5, 56230, Texcoco, Estado de México.

*Autor para correspondencia: perpdgo@colpos.mx

Resumen:

Los modelos de predicción genómica generalmente suponen que los errores se distribuyen como variables aleatorias normales, independientes e idénticamente distribuidas con media cero e igual varianza. Esto no siempre se cumple, además puede haber fenotipos distantes de la media poblacional, los que usualmente se eliminan al realizar la predicción. La regresión cuantil (QR) afronta aspectos estadísticos como alta dimensionalidad, multicolinealidad y distribución fenotípica diferente de la normal El objetivo de este trabajo fue comparar QR utilizando información de marcadores y pedigrí con los métodos alternativos tales como mejor predicción lineal insesgada genómica (GBLUP) y mejor predicción lineal insesgada genómica en un solo paso (ssGBLUP) para analizar los pesos al nacimiento (PN), destete (PD) y al año (PA) de bovinos Suizo Europeo y datos simulados con diferente grado de asimetría y proporción de datos atípicos. La capacidad predictiva de los modelos se evaluó mediante validación cruzada. El desempeño predictivo de QR tanto sólo con información de marcadores como con marcadores más pedigrí, con el conjunto de datos reales, fue mejor que las metodologías GBLUP y ssGBLUP para PD y PA. Para PN GBLUP y ssGBLUP

172

fueron mejores, sin embargo, solo se utilizaron los cuantiles 0.25, 0.50 y 0.75, y la distribución dePNno fueasimétrica. Enel experimento dedatos simulados,lascorrelaciones entre efectos de marcador “verdadero” y efectos estimados, así como las correlaciones de señales “verdaderas” y estimadas fueron más altas cuando se usó QR comparado con GBLUP. Las ventajas de QR fueron másnotorias con distribución asimétricadelos fenotipos y con mayor proporción de datos atípicos, como fue el caso del conjunto de datos simulados Palabras clave: Regresión cuantil, GBLUP, ssGBLUP.

Recibido: 30/03/2022

Aceptado: 04/08/2022

Introducción

La motivación principal del método de regresión cuantil (QR) reside en que la mayoría de los modelos para evaluación genética asumen normalidad, lo que no siempre se cumple. Otro problema es que en ocasiones registros fenotípicos muy alejados del promedio de la población se consideran como errores de registro o datos atípicos y por consiguiente se eliminandelosanálisis,vistodesdeelpuntodevistagenómicoseestáperdiendoinformación valiosa de marcadores asociados a ciertas regiones de ADN con fuerte influencia en características de interés.

Con el método QR se obtienen resultados robustos y una visión amplia de las variables explicativas sobre las dependientes(1) . Los datos generados a partir de experimentos ómicos frecuentemente son complejos y de gran dimensión, por consiguiente existe un desafío estadístico para extraer información biológica relevante del gran volumen de datos(2,3) . El uso de un enfoque sólido como QR hace que la inferencia sea menos sesgada y esté menos sujeta a falsos positivos(2) . En estudios recientes que utilizan QR, se describen aplicaciones diversas como estudios de asociación genética(4) , genética de poblaciones(5), expresión génica(6,7) y selección genómica(8–10) .

Uno de los primeros estudios donde se utilizó QR para predecir el mérito genético individual lo presentaron Nascimento et al(11), quienes utilizaron datos simulados encontrando ventajas al usar QR frente a metodologías convencionales. El mismo año(12) se publicaron resultados usandoQR paraajustar curvas de crecimiento con datos decerdos ymarcadores moleculares; no solo ajustaron con éxito las curvas de crecimiento sino que identificaron marcadores de importancia asociados con la característica estudiada. Otro trabajo similar del mismo equipo de investigadores fue presentado por Nascimento et al(13), pero con datos de frijol

Rev Mex Cienc Pecu 2023;14(1):172-189 173

Recientemente Pérez-Rodríguez et al(10) extendieron el modelo de regresión cuantil para incluir información de pedigrí a través del uso de la matriz de relaciones genéticas aditivas, mejorando aún más la habilidad predictiva de los modelos y al mismo tiempo identificando las proporciones de las varianzas atribuidas a marcadores, relaciones entre individuos y el residual, lo cual permite obtener de manera precisa una partición de la varianza fenotípica.

El objetivo del presente estudio fue estudiar el poder predictivo del modelo de regresión cuantil utilizando datos simulados y datos reales (pesos al nacimiento, destete y al año) de bovinos SuizoEuropeo yseconsideraronlos modelos: 1)QR con información demarcadores moleculares SNP (QRM), 2) QR incluyendo simultáneamente información de marcadores moleculares y genealógica derivada del pedigrí (QRH); 3) GBLUP el cual al igual que QRM solo incluyó información de marcadores moleculares, y 4) evaluación genómica en un solo paso (ssGBLUP) que incluyó información de marcadores y pedigrí.

Material y métodos

Genotipos

Se utilizó información de 300 animales (236 hembras, 64 machos) nacidos de 2001 a 2016 en ocho hatos ubicados en el Este, Centro y Oeste de México. Se recolectaron muestras de pelo para su genotipado por la compañía GeneSeek (Lincoln, https://www.neogen.com/, NE, EE. UU.), utilizando el panel GeneSeek® Genomic Profiler Bovine LDv.4, con 30,000 y 50,000 marcadores SNP, 150 animales con cada Chip. La genotipación se realizó en dos ocasiones distintas, inicialmente 150 individuos con el Chip de 30K y posteriormente otro grupo de 150 individuos con el Chip de 50K ya que el Chip de 30K no estuvo disponible en ese momento. Se utilizaron los SNP en común entre los chips de 30K y 50K (12,835 SNP). Secalcularonlas proporcionesdevalores faltantes para cadamarcador yparacadaindividuo. El promedio de valores faltantes por individuo fue 2.09 % con una desviación estándar de 7.50 %. La tasa de llamada promedio (proporción no faltante para cada marcador) fue 97.90 % con una desviación estándar del 4.66 %. Se eliminaron los marcadores con una tasa de llamada inferior al 95 %. Los genotipos se recodificaron como AA= 0, AB= 1 y BB= 2, de donde se obtuvo una matriz con 300 filas (individuos) y 12,835 columnas (marcadores) cuyas celdas toman valores en el conjunto {0,1,2, }, donde “ ” denota un valor faltante. Para los 12,835 marcadores en común de los dos chips, los valores faltantes se imputaron al azar, generando muestras de la distribución ����������������(2,��) donde �� es la frecuencia del alelo mayor, calculado a partir de los genotipos de marcadores observados. Se eliminaron los marcadores monomórficos o aquellos con frecuencia de alelos menores (MAF) menor que 0 04. Después del control de calidad, 9,628 de los 12,835 SNP en común entre los dos chips estuvieron disponibles para análisis adicionales.

Rev Mex Cienc Pecu 2023;14(1):172-189 174

Fenotipos

La información fenotípica y de pedigrí de la población de ganado Suizo Europeo se obtuvo de la base de datos de la Asociación Mexicana de Criadores de Ganado Suizo de Registro. Los registros de pesos al nacer (PN), al destete (PD) y al año (PA) se utilizaron para el análisis. Laedicióndelos fenotiposfuesimilarparaPN,PD yPA,sedescartaronlosregistros de animales no relacionados genéticamente con aquellos genotipados o con información faltante para hato, edad de la madre y manejo. Los grupos contemporáneos (GC) se definieron al eliminar los animales en GC de 2 individuos o con varianza igual a cero. Para PN los GC se definieron combinando los efectos del hato (8 hatos), año (1998 a 2016) y temporada de nacimiento; las temporadas de nacimiento se definieron considerando el calendario juliano, de 80 a 171 días, primavera; de 172 a 264 días, verano; de 265 a 354 días, otoño; de 355 a 366 días y de 1 a 79 días, invierno. Después de la edición de datos para PN se obtuvieron 330 registros. Para PD y PA los GC se definieron combinando los efectos del hato (6 hatos), año (de 1998 a 2016), temporada de nacimiento (igual que PN) y manejo. En el caso de PD los grupos de manejo se definieron de tres formas: terneros alimentados con lechedesu madre; lechedesu madremásalimentobalanceado; ylechedesu madre ynodriza más alimentación balanceada. Para PA los grupos de manejo se definieron de tres maneras: animales en pastoreo; animales en pastoreo con concentrado alimenticio; y animales estabulados con alimentación equilibrada. La edición de datos de PD y PA finalizó con 267 y 232 registros para análisis posteriores. En el Cuadro 1 se presenta un resumen del número de animales genotipados, y fenotipados para PN, PD y PA. La Figura 1 muestra las gráficas de violín para PN, PD y PA, la media muestral está representada por el punto rojo y la mediana muestral por la línea horizontal dentro del recuadro, de la gráfica es claro que las variables respuestas presentan una distribución asimétrica y los círculos con relleno sólido en la misma sugieren la presencia de datos atípicos.

Cuadro 1: Número de animales genotipados y fenotipados para el análisis de los pesos al nacer, al destete y al año de una población de ganado Suizo Europeo Grupo Peso al nacer Peso al destete Peso al año

Genotipado 300 300 300

Genotipado y fenotipado 232 218 191

Fenotipados en QRM y GBLUP 232 218 191 Fenotipados en QRH y ssGBLUP 330 267 232

QRM=Regresión cuantil usando información de marcadores, QRH=Regresión cuantil usando información de marcadores y pedigrí, GBLUP=Mejor predictor lineal insesgado genómico, ssGBLUP=Evaluación genómica en un solo paso.

Rev Mex Cienc Pecu 2023;14(1):172-189 175

Figura 1: Gráficas de violín de peso al nacimiento (PN), al destete (PD) y al año (PA) en una población de bovinos Suizo Europeo

La media muestral está representada por el punto rojo y la mediana muestral por la línea horizontal dentro del recuadro

Modelos

Modelo de regresión cuantil con marcadores (QRM)

El modelo para regresión cuantil es: ���� =��+���� ����+����, donde ���� es el valor del fenotipo del i-ésimo animal; �� es un intercepto; ���� �� =(����1,…,������) representa la i-ésima fila de la matriz de marcadores, ��=(��1,…,����)�� es el vector de coeficientes de regresión asociados con marcadores y ���� son variables aleatorias independientes tales que su cuantil �� ∈(0,1) es cero La estimación de los coeficientes de regresión para un cuantil de interés �� fijo se obtiene al resolver el problema de minimización siguiente: ������{∑ ���� �� ��=1 (���� �� ���� ����)+��∑ |����| �� ��=1 }, donde ∑ |����| �� ��=1 es la suma de los valores absolutos de los coeficientes de regresión; �� es el parámetro de penalización que controla la intensidad de la regularización; y ����(⋅) es la función definida como(1):

Rev Mex Cienc Pecu 2023;14(1):172-189 176

����(����)={��×���� Si���� ≥0 (1 ��)×���� Si���� <0, donde ���� =���� −��−���� ����. Después de estimar los parámetros del modelo, los valores de cría estimados mediante marcadores (GEBV) se obtienen mediante la siguiente expresión: ��������(��)=�� ̂ ��(��)=∑ �������� ̂ ��(��) �� ��=1 , donde �� ̂ ��(��) es el efecto del j-ésimo marcador, definido por la relación funcional obtenida para el cuantil de interés. El modelo QR puede extenderse para incluir otros términos, en particular para las características de crecimiento, se utiliza el siguiente modelo: ���� =��+���� ����+���� ����+���� ����+����, donde ���� es el valor del fenotipo de la característica analizada (PN, PD o PA) del i-ésimo animal, �� es un intercepto; ���� �� =(����1, ,������) la i-ésima fila de la matriz de incidencia para los efectos fijos (sexo, edad de la madre, manejo), ��=(��1,...,����)�� los coeficientes de regresión para los efectos fijos, ���� �� =(����1,...,������) la i-ésima fila de la matriz de incidencia para efectos aleatorios de grupo contemporáneo (54, 43 y 37 para PN, PD y PA), ��= (��1, ,����)�� efectos aleatorios de grupo contemporáneo, el resto de los términos como se describieron anteriormente.

GBLUP

El modelo está dado por: ���� =��+���� ����+���� ����+���� ����+����, donde ���� �� =(����1,..,������) es la i-ésima fila de la matriz que conecta fenotipos con genotipos, ��=(��1, ,����)�� es el vector de efectos aleatorios para animales. Las varianzas genéticas aditiva, de grupo contemporáneo y residual se asumen ������(��)=������ 2 , ������(��)=�������� 2 , y ������(��)=������ 2, respectivamente. La matriz de relaciones genómicas, ��, se calcula como lo describen Lopez-Cruz et al(14) y Pérez-Rodríguez et al(15); brevemente, G = WW’/p, donde W es la matriz de marcadores estandarizada y centrada (cada marcador centrado restando la media de frecuencia de alelo y estandarizado, dividiendo por la desviación estándar de la muestrade la frecuencia dealelos), p es el número total demarcadores, ���� variablesaleatorias normales e independientes con distribución normal con media 0 y varianza ���� 2 .

Modelo de regresión cuantil en un solo paso (QRH)

Estemétodoseconsidera unaextensióndelmodelodecuantilesparaunamatrizderelaciones construida utilizando matrices de relaciones para animales genotipados y no genotipados y de los cuales se tiene disponible un pedigrí. La matriz que resulta se conoce en la literatura como matriz H(16,17), esta matriz está dada por: �� 1 =�� 1 +[�� �� �� ���� 1 ������ 1],

Rev Mex Cienc Pecu 2023;14(1):172-189 177

donde, Agg es una submatriz de A para animales genotipados, Ga = βG + α; �� y �� se obtienen al resolver el sistema de ecuaciones: {������(��������(��))��+�� =������(��������(������)) ������(��)��+�� =������(������)

El modelo QRH está dado por: ���� =��+���� ����+���� ����+���� ����+����, donde ������(��)=���� 2�� , el resto de los términos como se describieron previamente.

Modelo de regresión GBLUP en un solo paso (ssGBLUP)

El modelo ssGBLUP es equivalente al modelo GBLUP descrito anteriormente con la diferencia de que se reemplaza la matriz de relaciones genómicas G por la matriz de relaciones genéticas extendida H, se asume que ������(��)=������ 2 .

Validación cruzada

La capacidad predictiva de los modelos se evaluó mediante validación cruzada, la cual se realizó de la siguiente manera. El conjunto de datos se dividió en cinco grupos del mismo tamaño {��1,��2, ,��5}, 80 % de los datos se usaron para entrenamiento del modelo, el 20 % restante para validación. Por ejemplo, {��2} se usa como grupo de validación y el conjunto {��1,��3, ,��5} para entrenamiento del modelo. Los modelos se ajustaron utilizando el conjunto de entrenamiento, y el modelo ajustado se utilizó para obtener predicciones para el conjunto de validación. Este procedimiento se repitió cinco veces y se obtuvieron predicciones para cada grupo. Las correlaciones entre fenotipos observados y predichos se calcularon y promediaron para los conjuntos de prueba(18) . Note que debido a que se trata de valores reales, no se conocen los valores de crías verdaderos, sino solamente se tienen los fenotipos observados, el modelo ajustado proporciona predicciones para valores de cría y las predicciones de otros efectos fijos y ambientales, con lo cual se obtiene una predicción del fenotipo mismo que se contrasta con el valor verdadero del fenotipo.

Simulación

Con la finalidad de evaluar el poder predictivo del modelo QR frente a GBLUP se realizó además una simulación de datos asimétricos con presencia de datos atípicos; la simulación del presente trabajo es análoga a la utilizada por Pérez-Rodríguez et al(10) . La idea principal es resaltar que el modelo de regresión por cuantiles funciona de manera adecuada en la presencia de observaciones atípicas, varianzas no homogéneas y variables respuesta con respuestas con distribución asimétrica. En el contexto de selección, por ejemplo, no es poco usual contar con distribuciones asimétricas para los fenotipos debido al proceso mismo, ya que, si se selecciona para alguna característica Y, ysi existe además de esto otra característica

Rev Mex Cienc Pecu 2023;14(1):172-189 178

de interés O, entonces la distribución condicional de Y |O>o(19) es asimétrica. En el contexto de selección genómica es también usual encontrar subconjuntos de observaciones que difieren significativamente del resto y estas observaciones podrían considerarse como atípicas. Montesinos-López et al(20) propusieron un modelo con errores Laplace y mostraron que predice de manera adecuada aun en presencia de datos atípicos, el modelo propuesto es un caso especial del modelo de regresión cuantil que se estudia en el presente trabajo. Se consideraron los 9,628 SNP resultantes del control de calidad descrito anteriormente para 300 animales, la simulación de los datos se realizó considerando el modelo lineal: ���� =��+∑ ���������� 9,628 ��=1 +����, donde �� =1, ,300, con �� =39 para PN, se supuso que los errores vienen de una distribución normal sesgada (������) con media 0, varianza ��2 (parámetro de escala ��) e índice de asimetría ��1, es decir ����~������(0,��,��1), con �� =√1 ℎ2, se consideró ℎ2 con un valor de 0.35, ��1 =√2 ����3 (4 �� 1)(1 2��2 �� ) 3/2 , �� ∈{0.950,0.975,0.999} lo que lleva a diferentes grados de sesgo positivo. Solo se consideraron valores positivos de ��1, ya que el sesgo negativo se obtiene simplemente cambiando el signo de las ���� ′ �� y por lo tanto las conclusiones obtenidas para el caso de sesgo positivo serán también válidas para el caso negativo(21,22) Se fijaron 50 marcadores con efecto diferente de cero simulándolos de una distribución normal con media 0 y varianza √1 ℎ2⁄50, el resto de los marcadores se establecieron en 0; las posiciones de los marcadores muestreados se tomaron al azar. Para introducir datos atípicos en los fenotipos, se generó cierta proporción de los residuos de ����~������(0,3,��1) al azar, se consideraron dos proporciones, 5 y 10 %, por lo que se tomaron muestras de una mezcla de dos componentes de distribuciones normales sesgadas. Se generaron seis conjuntos de datos, tres diferentes coeficientes de asimetría 0.950, 0.975, 0.999 con sus dos alternativas de proporción de datos atípicos 5 % y 10 %. La distribución normal asimétrica se ha utilizado en predicción genómica(22) y también se ha sugerido su uso en selección canalizada(23). Una vez generados los datos se ajustó el modelo QRM con �� = {0.25,0.50,0.75} para compararlo con GBLUP. La selección de los cuantiles se realizó de acuerdo a Nascimento et al(11) quienes consideran estas tres posibilidades cuando la distribución de los fenotipos es asimétrica �� ∈{0.25,0.75} o bien cuando la distribución es simétrica ��0.50, pues nuestro interés fundamental en este trabajo se centró en la modelación de datos posiblemente asimétricos y con la presencia de valores atípicos. La selección de los parámetros también se realizó por conveniencia computacional ya que el ajuste del modelo se realiza mediante el uso de técnicas de cómputo intensivas basadas en cadenas de Markov Monte Carlo como se menciona en la sección de software y ajuste de los modelos. Para cada análisis se calculó la correlación entre los ��′�� verdaderos y estimados, la correlación entre las señales verdaderas ���� y estimadas ���� ̂ y el componente de varianza asociado con los residuos para cada modelo, el cual es una forma de evaluar la bondad de ajuste de los modelos. También se consideró el Criterio de Información de Desviación (DIC), éste se

Rev Mex Cienc Pecu 2023;14(1):172-189 179

puede usar para seleccionar modelos candidatos; los modelos con menor DIC se prefieren contra modelos de mayor DIC(24) .

Software y ajuste de los modelos

Los modelos de regresión por cuantiles se ajustaron usando una estrategia computacional similar a la descrita por Pérez-Rodríguez et al(10). Las adaptaciones de los algoritmos para incluirefectosfijos yaleatoriosnopresentan grandificultadcomputacional. Los códigos para el ajuste de los modelos se desarrollaron en los lenguajes de programación R(25) y C. Los códigos para el ajuste de los modelos fueron organizados de tal forma que puedan ser ejecutados fácilmente desde el software estadístico R y están disponibles solicitándolos al primer autor del presente estudio. En todos los casos se seleccionaron tres cuantiles, �� = {025,050,075} Los modelos GBLUP y ssGBLUP se ajustaron con la librería de R BGLR(26) .

Resultados

Datos reales

Los Cuadros 2, 3 y 4 muestran los resultados del experimento realizado con datos de PN, PD y PA de una población de bovinos Suizo Europeo, evaluados bajo dos escenarios 1) solo con información de marcadores, y 2) información de marcadores y pedigrí. De manera general las correlaciones entre valores observados y predichos más altas se obtuvieron con QR, excepto para PN donde las correlaciones de GBLUP y ssGBLUP fueron más altas que las obtenidas con QRM y QRH, sin embargo, las correlaciones de QRM �� =0.75 y QRH �� = 0.75 fueron cercanas a las obtenidas con GBLUP y ssGBLUP (0.7902 vs 0.7924), (0.6981 vs 0.7055), respectivamente. Los valores de MSE más bajos se obtuvieron con QRM �� = 075 y QRH �� =075en la característica de PD, mientras que en las características PN y PA los valores más bajos se obtuvieron con GBLUP y ssGBLUP. Los componentes de varianza asociados con el error obtenidos con QRM y QRH fueron menores que los obtenidos con GBLUP y ssGBLUP. Los valores de DIC más bajos de manera general se obtuvieron con QRM �� =0.75 y QRH �� =0.75, excepto para PN con el escenario de solo marcadores, donde el DIC más bajo se obtuvo con QRM �� =025.

Rev Mex Cienc Pecu 2023;14(1):172-189 180

Cuadro 2: Promedios de la correlación Pearson y la desviación estándar (entre paréntesis) entre los valores fenotípicos observados (��) y valores fenotípicos predichos (�� ̂), cuadrado medio del error, componentes de varianza asociados al error (���� 2 , ���� 2) y criterio de información de desviación (DIC) para peso al nacimiento Modelo Cor(��,�� ̂) MSE ���� �� o ���� �� DIC

QRM ��=�� ���� 0.7521 3.9973 2.7260 513.5014 (0.0753) (1.6108) (1.9762) (531.5701)

QRM ��=��.���� 0.5619 7.3249 8.6297 970.7680 (0.1501) (0.4561) (0.2660) (6.9791)

QRM ��=��.���� 0.7902 3.6535 2.4268 716.4237 (0.0766) (0.0943) (0.4829) (35.7161)

GBLUP 0.7924 2.3269 3.0035 803.0675 (0.0874) (0.2063) (0.5578) (31.9814)

QRH ��=��.���� 0.6713 3.5026 2.3645 872.3949 (0.1329) (1.2848) (1.9670) (432.0737)

QRH ��=��.���� 0.6816 2.9988 2.7372 659.1450 (0.1253) (0.7769) (1.8239) (1079.8674)

QRH ��=��.���� 0.6981 4.1405 2.8610 1077.2027 (0.1140) (0.6187) (0.8666) (60.6781)

ssGBLUP 0.7055 2.4463 3.2641 1189.4282 (0.1191) (0.2204) (0.4244) (26.5023)

Cor(��,�� ̂ )= correlación entre fenotipos observados y predichos, MSE=cuadrados medios del error, ���� 2 o ���� 2=componentes de varianza asociados al error, DIC=criterio de información de desviación

Cuadro 3: Promedios de la correlación Pearson y la desviación estándar (entre paréntesis) entre los valores fenotípicos observados (��) y valores fenotípicos predichos (�� ̂), cuadrado medio del error, componentes de varianza asociados al error (���� 2 , ���� 2) y criterio de información de desviación (DIC) para peso al destete Modelo Cor(��,�� ̂) MSE ���� �� o ���� �� DIC

QRM ��=��.���� 0.5661 476.5293 419.4138 1550.5339 (0.2212) (17.4612) (23.3216) (13.9644)

QRM ��=�� ���� 0.5695 357.7328 396.8138 1576.8871 (0.2307) (8.9681) (47.7433) (21.5826)

QRM ��=�� ���� 0.5493 175.1298 67.9660 737.2216 (0.2196) (47.6181) (82.0807) (1150.7340)

GBLUP 0.5677 294.5807 376.7794 1583.2355 (0.2377) (36.6279) (24.1379) (16.2187)

QRH ��=��.���� 0.4816 644.1278 551.5150 1962.1296 (0.0672) (50.8464) (64.8091) (20.9916)

QRH ��=��.���� 0.4797 366.5940 356.9005 1537.7760 (0.0274) (56.8604) (238.5303) (903.3492)

QRH ��=�� ���� 0.3918 216.1753 5.9471 -706.1573

Rev Mex Cienc Pecu 2023;14(1):172-189 181

(0.0544) (53.2417) (11.7834) (2034.7757)

ssGBLUP 0.4712 303.0404 421.8316 1982.3314 (0.0502) (37.6933) (55.2774) (21.9229)

Cor(��,�� ̂ )= correlación entre fenotipos observados y predichos, MSE=cuadrados medios del error, ���� 2 o ���� 2=componentes de varianza asociados al error, DIC=criterio de información de desviación.

Cuadro 4: Promedios de la correlación Pearson y la desviación estándar (entre paréntesis) entre los valores fenotípicos observados (��) y valores fenotípicos predichos (�� ̂), cuadrado medio del error, componentes de varianza asociados al error (���� 2 , ���� 2) y criterio de información de desviación (DIC) para peso al año

Modelo Cor(��,�� ̂) MSE ���� �� o ���� �� DIC

QRM ��=��.���� 0.5421 1037.6529 953.6807 1487.1104 (0.1350) (175.2648) (261.8652) (35.8873)

QRM ��=��.���� 0.5341 868.3651 964.4477 1524.0511 (0.1355) (34.0429) (113.1832) (12.4648)

QRM ��=��.���� 0.5115 938.8244 700.7849 1284.0829 (0.1290) (241.2205) (465.2109) (402.9787)

GBLUP 0.5330 725.7579 924.8388 1526.7596 (0.1389) (71.3999) (90.0089) (11.6346)

QRH ��=��.���� 0.5306 1277.9493 1172.2877 1850.7122 (0.1411) (44.0948) (108.7991) (17.2025)

QRH ��=��.���� 0.5098 894.4148 1061.3157 1883.6773 (0.1700) (35.3996) (129.4702) (15.4422)

QRH ��=��.���� 0.5027 915.1871 666.8830 1706.4933 (0.1748) (162.7629) (413.5046) (209.8455)

ssGBLUP 0.4712 778.6416 1071.3096 1891.9029 (0.0502) (84.9871) (128.2878) (17.5592)

Cor(��,�� ̂ )= correlación entre fenotipos observados y predichos, MSE=cuadrados medios del error, ���� 2 o ���� 2=componentes de varianza asociados al error, DIC=criterio de información de desviación.

Datos simulados

Los resultados del ejercicio de simulación donde se compara QR con GBLUP bajo diferentes grados de asimetría y proporciones de datos atípicos se muestran en el Cuadro 5. En la columna 2 se registran las correlaciones entre los efectos de marcador “verdaderos” y los efectos de marcador estimados, las correlaciones obtenidas con QR fueron más altas que las obtenidas con GBLUP. La columna 3 muestra las correlaciones entre las “señales verdaderas” y las estimadas, las correlaciones más altas se obtuvieron con QR. La columna 4 registra la estimación de los componentes de varianza asociados al error y la columna 5 los valores de DIC, los valores más bajos en ambas columnas se obtuvieron con QR �� =075

Rev Mex Cienc
182
Pecu 2023;14(1):172-189

Cuadro 5: Promedios de la correlación Pearson y desviación estándar (entre paréntesis) entre efectos de marcador “verdaderos y estimados, señales “verdaderas” y estimadas, componentes de varianza asociados al error y valores de DIC para datos simulados con diferentes grados de asimetría y proporción de valores atípicos

Modelo Cor(��,�� ̂ ) Cor(����,���� ̂ ) ���� �� o ���� �� DIC

��=�� ����, 5% datos atípicos

QR ��=�� ���� 0.0784 0.4963 0.6821 620.5455 (0.0034) (0.0336) (0.1806) (49.3305)

QR ��=�� ���� 0.0766 0.4643 0.6644 665.8219 (0.0042) (0.0493) (0.0703) (16.3032)

QR ��=�� ���� 0.0606 0.4269 0.1438 290.6870 (0.0132) (0.0386) (0.1421) (148.9695)

GBLUP 0.0722 0.4910 0.7375 691.6503 (0.0064) (0.0398) (0.0723) (19.9391)

��=�� ����, 10% datos atípicos

QR ��=��.���� 0.0614 0.4369 0.4683 407.6496 (0.0183) (0.0329) (0.4030) (330.6304)

QR ��=��.���� 0.0728 0.4579 0.7947 706.7931 (0.0045) (0.0420) (0.1063) (20.5797)

QR ��=�� ���� 0.0574 0.4061 0.4482 381.4644 (0.0092) (0.0399) (0.3225) (474.7138)

GBLUP 0.0654 0.4556 0.8717 731.9104 (0.0057) (0.0314) (0.0890) (21.8563)

��=��.������, 5% datos atípicos

QR ��=��.���� 0.0773 0.4835 0.5578 582.4254 (0.0087) (0.0562) (0.2523) (83.0548)

QR ��=��.���� 0.0771 0.4689 0.6369 662.0337 (0.0074) (0.0515) (0.0868) (23.8018)

QR ��=��.���� 0.0598 0.4169 0.2398 219.1691 (0.0128) (0.0450) (0.2033) (444.5060)

GBLUP 0.0703 0.4804 0.7316 692.6392 (0.0056) (0.0333) (0.0831) (24.0645)

��=��.������, 10% datos atípicos

QR ��=�� ���� 0.0731 0.4386 0.8739 677.0858 (0.0081) (0.0789) (0.1077) (23.5472)

QR ��=��.���� 0.0734 0.4529 0.8154 711.2935 (0.0078) (0.0615) (0.0845) (14.9809)

QR ��=��.���� 0.0541 0.3945 0.3628 385.6030 (0.0056) (0.0583) (0.2572) (393.1935)

GBLUP 0.0640 0.4491 0.8913 736.7880 (0.0077) (0.0517) (0.0654) (14.8343)

��=��.������, 5% datos atípicos

QR ��=�� ���� 0.0615 0.5286 0.1535 205.6973

Rev Mex Cienc Pecu 2023;14(1):172-189 183

(0.0144) (0.0271) (0.1657) 277.5807

QR ��=�� ���� 0.0741 0.5514 0.4860 614.2282 (0.0037) (0.0167) (0.0663) 15.7647

QR ��=�� ���� 0.0467 0.4855 0.0166 -271.4761 (0.0112) (0.0150) (0.0192) 288.4509

GBLUP 0.0737 0.5428 0.5305 625.9703 (0.0030) (0.0121) (0.0353) 11.3632

��=�� ������, 10% datos atípicos

QR ��=��.���� 0.0768 0.4807 0.7817 650.8593 (0.0080) (0.0687) (0.0888) 22.8417

QR ��=�� ���� 0.0696 0.4630 0.6154 511.5287 (0.0148) (0.0600) (0.3369) 412.6645

QR ��=�� ���� 0.0507 0.3967 0.0204 -160.1660 (0.0031) (0.0505) (0.0127) 213.0462

GBLUP 0.0659 0.4649 0.7876 709.7240 (0.0065) (0.0418) (0.0528) 14.8566

Cor(��,�� ̂ )= correlación entre efectos de marcador “verdaderos” y estimados, Cor(����,���� ̂ )= correlación entre señales “verdaderas” y estimadas, ���� �� o ���� ��=componentes de varianza asociados al error, DIC=criterio de información de desviación.

Discusión

En este estudio se compararon las metodologías de análisis QR con GBLUP y ssGBLUP. Esta comparación se hizo con fenotipos simulados con diferentes grados de asimetría y proporciones de datos atípicos y datos reales de pesos al nacimiento, al destete y al año.

Datos reales

Las correlaciones de fenotipos observados y predichos obtenidos de la validación cruzada con datos reales fueron más altas al usar QRM yQRH en las características de PD yPA Para PN las correlaciones más altas se obtuvieron con GBLUP y ssGBLUP; sin embargo, en este estudio solo se probaron tres cuantiles 0.25, 0.50 y 0.75, hay evidencia en otros estudios donde QR es mejor que GBLUP como en el caso del trabajo de Nascimento et al(4), quienes compararon QR con modelos como BLASSO, BayesB y RR-BLUP. Estos autores encontraron una ganancia en la capacidad predictiva de QR frente a RR-BLUP de 15.15 %, cabe señalar que matemáticamente RR-es equivalente a GBLUP, además de que los conjuntos de datos usados en este experimento presentaron asimetría.

Los valores del cuadrado medio del error (MSE) miden el promedio de los errores al cuadrado, es decir, la diferencia entre el estimador y lo que se estima, por lo que se prefieren valores bajos; los promedios de MSE de QRM yQRH fueron menores que los obtenidos con GBLUP y ssGBLUP únicamente para PD. El estimador de la varianza residual es un

Rev Mex Cienc
184
Pecu 2023;14(1):172-189

indicativo de que tan bien o mal se ajusta el modelo a los datos observados, se prefieren valoresbajos;loscomponentesdevarianzadel errormenoresseobtuvieron conQRM yQRH para las tres características analizadas. Finalmente, el valor de DIC se usa para seleccionar modelos candidatos y al igual que MSE y los componentes de varianza del error se prefieren valores bajos. Los valores de DIC más bajos se obtuvieron con QRM �� =0.75 y QRH �� = 0.75, excepto en el escenario de solo marcadores y PN, donde el DIC más bajo se obtuvo con QRM �� =0.25 El cuadrado medio del error, la varianza residual y el DIC son valores queayudaa escogerel modelo demejorajuste. Al examinar estos valores de maneraconjunta se observa que QRM y QRH son mejores en algunos de ellos mientras que en otros no, es decir, QR presenta un desempeño igual o superior a GBLUP y ssGBLUP; aunque debe resaltarse que solo se probaron tres cuantiles y que QR presenta ventajas al usarse en datos asimétricos y datos atípicos, para este caso solo había datos atípicos y las distribuciones no fueron asimétricas. Mendes et al(27) compararon QR con el método bayesiano del LASSO (BLASSO), estos autores reportaron un aumento de 6.7 y 20.0 % en la precisión y consideraron los cuantiles 0.15 y0.45 en la evaluación del rendimiento de la canal yel grosor del tocino, respectivamente, sin embargo, las características evaluadas en su estudio fueron asimétricas.

En el análisis de datos reales, una limitación del presente estudio es el tamaño de muestra, lo cual puede impactar la variabilidad de los parámetros estimados con los modelos y en consecuencia la variabilidad de las predicciones, sin embargo, todos los modelos se ajustaron utilizando la misma información ypor tanto la comparación de la capacidad predictiva de los modelos se considera razonable, lo ideal sería contar con tamaños de muestra grandes, pero por cuestión de limitaciones económicas esto no siempre es posible. Por otro lado, actualmente es muy común utilizar modelos de predicción en el que el número de registros fenotípicos es más pequeño que el número de predictores (SNPS), es decir �� ≪��, aun bajo este contexto numerosos estudios han mostrado que los métodos bayesianos proveen herramientas sofisticadas que permiten derivar predicciones razonables siempre ycuando los parámetros de regularización sean seleccionados de manera adecuada por ejemplo utilizando métodos de validación cruzada(28–30) .

Datos simulados

En el experimento de datos simulados las correlaciones entre efectos de marcador “verdadero” y efectos estimados, así como las correlaciones de señales “verdaderas” y estimadas fueron más altas cuando se usó QR comparado con GBLUP. Estos resultados son similares a los obtenidos por otros investigadores(10) , quienes simularon datos con tres diferentes coeficientes de asimetría 0.75, 0.95, 0.999 con 5 % y 10 % de datos atípicos y encontraron que las correlaciones obtenidas con QR fueron más altas que las obtenidas con la regresión de cresta bayesiana (BRR), además, este patrón fue más evidente con una mayor

Rev Mex Cienc Pecu 2023;14(1):172-189 185

asimetría y proporción de datos atípicos. En este estudio se realizaron simulaciones con coeficientes de asimetría de 0.950, 0.975, 0.999 y los cuantiles con los que se obtuvieron correlaciones más altas variaron entre 0.25 y 0.50; la ventaja de QR es que se puede probar diferentes cuantiles obteniendo mejores resultados dependiendo del cuantil utilizado, esta ventajaen lacapacidaddepredicción deefectos demarcadores yseñalesha sido aprovechada por otros investigadores(4), quienes no encontraron ninguna asociación de rasgo usando el modelo tradicional GWAS de SNP único, pero, cuando usaron QR con cuantiles extremos como 0.1 el modelo fue capaz de encontrar hasta 7 SNP asociados con las características estudiadas.

Los coeficientes de varianza del error indican qué tan bien se ajusta el modelo propuesto a los datos estudiados, entre más pequeño sea este valor, el ajuste es mejor, el DIC es otro valor que se usa para comparar modelos candidatos Los modelos con un DIC más pequeño se prefieren a los modelos con un DIC mayor(24) . Los estimadores de varianza residual y los valores de DIC más bajos se obtuvieron con QR �� =0.75, quizá esto se deba a que en la simulación se usaron coeficientes de asimetría altos 0.950, 0.975, 0.999, por consiguiente, se espera que un cuantil que se ajuste mejor sea el más alto, en este caso 0.75.

QR tuvo un desempeño igual o mejor que GBLUP y ssGBLUP para predecir características de crecimiento PN, PD y PA, las ventajas de este método son más notorias cuando los datos están más sesgados y presentan mayor proporción de datos atípicos como en el caso del experimento de simulación

Conclusiones e implicaciones

El desempeño predictivo de QR tanto sólo con información de marcadores como con marcadores más pedigrí, con el conjunto de datos reales, fue mejor que las metodologías GBLUP y ssGBLUP para PD y PA. Para PN GBLUP y ssGBLUP fueron mejores; sin embargo, solo se utilizaron los cuantiles 0.25, 0.50 y 0.75, y la distribución de PN no fue asimétrica.Enel experimentodedatossimulados,lascorrelacionesentreefectosdemarcador “verdadero” y efectos estimados, así como las correlaciones de señales “verdaderas” y estimadas fueron más altas cuando se usó QR comparado con GBLUP. Las ventajas de QR fueron más notorias con distribución asimétrica de los fenotipos y con mayor proporción de datos atípicos, como fue el caso del conjunto de datos simulados.

Agradecimientos

AlConsejoNacionaldeCiencia yTecnología,México,porel apoyofinancieroparaelprimer autor durante sus estudios de doctorado Los autores también agradecen a la Asociación Mexicana de Criadores de Ganado Suizo de Registro por permitir el uso de sus bases de datos, a los criadores cooperantes por su amable cooperación en este estudio

Rev Mex Cienc Pecu 2023;14(1):172-189 186

Conflictos de interés

Los autores declaran que no existen conflictos de interés.

Literatura citada:

1. Koenker R, Bassett G. Regression quantiles. Econometrica 1978;46(1):33. https://doi.org/10.2307/1913643

2. Briollais L, Durrieu G. Application of quantile regression to recent genetic and -omic studies. Hum Genet 2014;133(8):951–966. https://doi.org/10.1007/s00439-014-1440-6

3. Wang L, Wu Y, Li R. Quantile regression for analyzing heterogeneity in ultra-high dimension. J Am Stat Assoc 2012;107(497):214-222. https://doi.org/10.1080/01621459.2012.656014

4. Nascimento M, Nascimento ACC, Silva FF, Barili LD, Do Vale NM, Carneiro JE, Cruz CD, Carneiro PCS, Serão NVL. Quantile regression for genome-wide association study of flowering time-related traits in common bean. PLoS One 2018;13(1):1-14. https://doi.org/10.1371/journal.pone.0190303.

5. Fisher E, Schweiger R, Rosset S. Efficient construction of test inversion confidence intervals using quantile regression. J Comput Graph Stat 2016;29:140-148, http://arxiv.org/abs/1612.02300

6. Logan JAR, Petrill SA, Hart SA, Schatschneider C, Thompson LA, Deater-Deckard K, de Thorne LS, Bartlett C. Heritability across the distribution: An application of quantile regression. Behav Genet 2012;42(2):256–267. https://doi.org/10.1007/s10519-0119497-7

7. Vinciotti V, Yu K. M-quantile regression analysis of temporal gene expression data. Stat Appl Genet Mol Biol 2009;8(1). https://doi.org/10.2202/1544-6115.1452.

8. Gianola D, Cecchinato A, Naya H, Schön CC. Prediction of complex traits: Robust alternatives to best linear unbiased prediction. Front Genet 2018;9:195. https://doi.org/10.3389/fgene.2018.00195.

9. Oliveira GF, Nascimento ACC, Nascimento M, Sant’Anna IdeC, Romero JV, Azevedo CF, Bhering LL, Moura ETC. Quantile regression in genomic selection for oligogenic traits in autogamous plants: A simulation study. PLoS One 2021;16(1):1-12. https://doi.org/10.1371/journal.pone.0243666

10. Pérez-Rodríguez P, Montesinos-López OA, Montesinos-López A, Crossa J. Bayesian regularized quantile regression: A robust alternative for genome-based prediction of skewed data. Crop J 2020;8(5):713-722. https://doi.org/10.1016/j.cj.2020.04.009

Rev Mex Cienc
187
Pecu 2023;14(1):172-189

Pecu 2023;14(1):172-189

11. Nascimento M, e Silva FF, de Resende MDV, Cruz CD, Nascimento ACC, Viana JMS, Azebedo CF,Barroso LMA. Regularizedquantileregression appliedto genome-enabled prediction of quantitative traits. Genet Mol Res 2017;16(1). https://doi.org/10.4238/GMR16019538

12. Barroso LMA, Nascimento M, Nascimento ACC, Silva FF, Serão NVL, Cruz, CD, et al. Regularized quantile regression for SNP marker estimation of pig growth curves, J. Anim Sci Biotechnol 2017;8:59. https://doi.org/10.1186/s40104-017-0187-z.

13. Nascimento AC, Nascimento M, Azevedo C, Silva F, Barili L, Vale N, et al. Quantile regression applied to genome-enabled prediction of traits related to flowering time in the common bean. Agronomy 2019;9(12):1-11. https://doi.org/10.3390/agronomy9120796.

14 López-Cruz M, Crossa J, Bonnett D, Dreisigacker S, Poland J, Jannink JL, Singh RP, Autrique E, de los Campos G. Increased prediction accuracy in wheat breeding trials using a Marker × Environment interaction genomic selection model. G3 Genes Genom Genet 2015;5(4):569–582. https://doi.org/10.1534/g3.114.016097.

15. Pérez-Rodríguez P, Crossa J, Rutkoski J, Poland J, Singh R, Legarra A, et al. Single-step genomic and Pedigree Genotype × Environment interaction models for predictingwheat lines in international environments. Plant Genome 2017;10(2). https://doi.org/10.3835/plantgenome2016.09.0089

16. Christensen O, Lund M. Genomic relationship matrix when some animals are not genotyped. Genet Sel Evol 2010;42(2):1-8. http://www.gsejournal.org/content/42/1/2.

17 Aguilar I, Misztal I, Johnson DL, Legarra A, Tsuruta S, Lawlor TJ. Hot topic: A unified approach to utilize phenotypic, full pedigree, and genomic information for genetic evaluation of Holstein final score. J Dairy Sci 2010;93(2):743-752. https://doi.org/10.3168/jds.2009-2730.

18 Crossa J, Pérez P, de los Campos G, Mahuku G, Dreisigacker S, Magorokosho C. Genomic selection and prediction in plant breeding. J Crop Improv 2011;25(3):239-261. https://doi.org/10.1080/15427528.2011.558767.

19. Arnold BC, Beaver RJ. Hidden truncation models. Shankhya. Indian J Stat 2000;62(1):23–35. http://www.jstor.org/stable/25051286. Accessed Jul 6,2022.

20. Montesinos-López A, Montesinos-López OA, Villa-Diharce ER, Gianola D, Crossa J. A robust Bayesian genome-based median regression model. Theor Appl Genet 2019;132(5):1587-1606. https://doi.org/10.1007/s00122-019-03303-6.

Rev Mex Cienc
188

Pecu 2023;14(1):172-189

21. Pérez-Rodríguez P, Villaseñor-Alva JA. On testing the skew normal hypothesis. J Stat Plan Inference 2010;140(11):3148-3159. https://doi.org/10.1016/j.jspi.2010.04.013

22. Pérez-Rodríguez P, Acosta-Pech R, Pérez-Elizalde S, Cruz CV, Espinosa JS, Crossa J. A Bayesian genomic regression model with skew normal random errors. G3 Genes|Genom|Genet 2018;8(5):1771–1785. https://doi.org/10.1534/g3.117.300406.

23. Domínguez-Viveros J. Parámetros genéticos en la varianza residual de variables de comportamiento en toros de lidia. Arch Zoot 2020;69(267):354–358. https://doi.org/10.21071/az.v69i267.5354.

24. Spiegelhalter DJ, Best NG, Carlin BP, van der Linde A. Bayesian measures of model complexity and fit. J R Stat Soc: Series B Stat Methodol 2002;64(4):583–639. https://doi.org/10.1111/1467-9868.00353

25. R Core Team. R: A language and environment for statistical computing. R Foundation for statistical computing 2021. Vienna, Austria. https://www.R-project.org/

26. Pérez P, de los Campos G. Genome-wide regression and prediction with the BGLR statistical package. Genetics 2014;198(2):483-495. https://doi.org/10.1534/genetics.114.164442.

27. Mendes dos Santos P, Nascimento ACC, Nascimento M, Fonseca e Silva F, Azevedo CF, Mota RR, et al Use of regularized quantile regression to predict the genetic merit of pigs for asymmetric carcass traits. Pesqui Agropecu Bras 2018;53(9):1011–1017. https://doi.org/10.1590/S0100-204X2018000900004.

28. Gianola D. Priors in whole-genome regression: The Bayesian alphabet returns. Genetics 2013;194(3):573-596 https://doi.org/10.1534/genetics.113.151753

29.delosCamposG,HickeyJM,Pong-WongR,DaetwylerHD,CalusMPL.Whole-genome regression and prediction methods applied to plant and animal breeding. Genetics 2013;193(2):327-345. https://doi.org/10.1534/genetics.112.143313

30. Ferragina A, de los Campos G, Vazquez AI, Cecchinato A, Bittante G. Bayesian regression models outperform partial least squares methods for predicting milk components and technological properties using infrared spectral data. J Dairy Sci 2015;98(11):8133-8151. https://doi.org/10.3168/jds.2014-9143.

Rev Mex Cienc
189

https://doi.org/10.22319/rmcp.v14i1.5187

Artículo

Análisis de crecimiento estacional de una pradera de trébol blanco (Trifolium repens L)

Edgar Hernández Moreno a

Joel Ventura Ríos b

Claudia Yanet Wilson García c

María de los Ángeles Maldonado Peralta d*

Juan de Dios Guerrero Rodríguez e

Graciela Munguía Ameca a

Adelaido Rafael Rojas García d

a Colegio de Postgraduados - Campus Montecillo. km 36.5 Carretera México-Texcoco, 56250, Texcoco, Estado de México, México.

b Universidad Autónoma Agraria Antonio Narro Departamento de Producción Animal Saltillo Coahuila, México.

c Universidad Autónoma Chapingo. Sede San Luis Acatlán. San Luis Acatlán, Guerrero, México.

d Universidad Autónoma de Guerrero. Facultad de Medicina Veterinaria y Zootecnia N° 2. Cuajinicuilapa, Guerrero, México.

e Colegio de Postgraduados – Campus Puebla, México.

*Autor de correspondencia: mmaldonado@uagro.mx

190

Resumen:

El objetivo del presente estudio fue evaluar un análisis de crecimiento del trébol blanco (Trifolium repens L) y determinar el momento óptimo de cosecha por estación. El experimento se realizó en el Colegio de Postgraduados, Campus Montecillo, Texcoco, México. Se utilizaron 24 parcelas de 3.7 X 1.7 m, distribuidas en un diseño completamente al azar, con ocho tratamientos y tres repeticiones por estación. Los tratamientos consistieron en cortes semanales sucesivos, durante un ciclo de rebrote de ocho semanas, en cada estación del año. Al inicio del estudio se realizó un corte de uniformización y se determinó el forraje residual. Las variables evaluadas fueron:acumulación demateriaseca, composición botánica y morfológica e índice de área foliar del trébol blanco. La mayor acumulación de forraje (P<0.05) se presentó en la octava semana en primavera (2,688 kg MS ha-1). La producción de hoja fue mayor (p < 0.05) en primavera, otoño e invierno. El mayor índice de área foliar se alcanzó en la octava semana en primavera (3.0; P< 0.05). Se recomienda aprovechar la pradera de trébol blanco en la sexta semana para primavera-verano y séptima semana en otoño e invierno.

Palabras clave: Análisis de crecimiento, Trifolium repens L, Acumulación de materia seca, Composición botánica.

Recibido: 11/12/2021

Aceptado: 06/07/2022

Introducción

En la zona centro de México, el trébol blanco (Trifolium repens L), ballico perenne (Lolium perenne L), pasto ovillo (Dactylis glomerata L) y alfalfa (Medicago sativa L) sembradas en 171,520 hectáreas son las especies forrajeras que mejor desempeño han demostrado bajos condiciones de pastoreo en praderas puras o mixtas(1,2,3) Sin embargo, por su composición química, persistencia debido a su hábito de crecimiento rastrero, adaptabilidad a las zonas templadas, el trébol blanco es la especie de mayor importancia agronómica entre las casi 300 especies del género Trifolium(4) Aunado a esto, también puede mejorar la fertilidad del suelo por el aporte de nitrógeno de hasta 450 kg N ha-1 mediante fijación simbiótica(5,6,7) .

En México, los patrones de producción de forrajes son influenciados por las variaciones de clima, siendo la temperatura y la precipitación los principales factores(8), por lo que es importante conocer los patrones estacionales de crecimiento de las especies forrajeras más utilizadas en cada una de las regiones ecológicas del país(9). En trabajos previos, mencionan

Rev Mex Cienc Pecu 2023;14(1):190-203 191

que las estrategias de manejo de una pradera, intensidad y frecuencia mediante corte o pastoreo pueden modificar la composición botánica, rendimiento, y calidad nutricional(10,11) . La severidad en el uso de la pradera puede modificar las reservas de carbohidratos en la planta, la cual afecta el patrón de crecimiento, disminuyendo el número de tallos, numero de rebrotes y numero de hojas en la planta(12) .

Evaluar el crecimiento estacional de una pradera pura o mixta, ayuda a entender el comportamiento de las plantas y asociación de diferentes especies, ya que el balance entre la tasa de crecimiento y perdida de tejido varia con la estación a lo largo del año(9). El rendimiento de materia seca, tasa de crecimiento del cultivo, índice de área foliar, composición botánica y morfológica, radiación interceptada, altura de la planta, relación hoja: tallo, componente hoja: no hoja; son variables estructurales que ayudan a entender el comportamiento de una pradera, y deben ser consideradas para entender la respuesta bajo un sistema de corte o pastoreo(13,14) .

En un estudio realizado por Moreno et al(15) , reportaron que el trébol blanco asociado con gramíneas con riego produjo en promedio 1,581 kg MS ha-1 (P<0.05) en su primer año de evaluación.MientrasqueMaldonado et al(3) reportaronunincrementodel376%(equivalente a 7,532 kg MS ha-1) en su cuarto año de evaluación bajo praderas mixtas con riego debido a su crecimiento estolonífero y a la persistencia en la pradera. En otra investigación(9) el mayor índice de área foliar se presentó a la semana cinco en verano (P 0.05) y la hoja fue el mayor componenteenprimavera.Existenpocasinvestigacionesdeanálisisdecrecimientodeltrébol blanco en México. El objetivo del presente estudio fue evaluar análisis de crecimiento del trébol blanco (Trifolium repens L.) para definir el momento fisiológico óptimo de pastoreo en cada estación del año

Material y métodos

El estudio se realizó en una pradera de trébol blanco en el campo experimental del Colegio de Postgraduados, en Montecillo, Texcoco, Estado de México, a 19º 29’ LN y 98º 53’ LO a unaalturade2,240msnm. Lasiembraalvoleoserealizóenfebrerode2009 conunadensidad de semilla pura viable de 6 kg ha-1 El clima del lugar es templado subhúmedo, con precipitación media anual de 636.5 mm, y un régimen de lluvias en verano (de junio a octubre) y temperatura promedio anual de 15.2 ºC(16). El suelo del lugar es franco-arenoso, ligeramente alcalino (pH 7.8) con 2.4 % de materia orgánica(17)

A mediados de cada estación del año 2012, se realizó un pastoreo de uniformidad y posteriormente se realizó un análisis de crecimiento y los tratamientos fueron: análisis de crecimiento de ocho semanas para primavera-verano y nueve semanas para otoño-invierno, ya que por las bajas temperaturas crece más lento el forraje Como defoliadores se utilizaron

Rev Mex Cienc Pecu 2023;14(1):190-203 192

ovinos hasta dejar forraje remanente de aproximadamente 5 cm sobre el nivel del suelo y para un mejor manejo se estableció cerco eléctrico en las parcelas experimentales.

Las parcelas fueron distribuidas en un diseño completamente al azar con tres repeticiones. Se trazaron 24 parcelas de 3.7 x 1.7 m, donde se distribuyeron los tratamientos aleatoriamente. Durante el periodo de estiaje, las praderas se regaron por gravedad a capacidad de campo; 16 riegos cada dos semanas con 32 mm aproximadamente por cada uno dando un total de 512 mm de agua y no fueron fertilizadas las praderas

Datos climáticos

Los promedios mensuales de temperatura a la intemperie (máxima y mínima) y la precipitación mensual durante el periodo de estudio, se obtuvieron de la estación agrometeorológica del Colegio de Postgraduados, situada a 100 m del sitio experimental (Figura 1). La temperatura máxima mensual oscilo de 22.1 a 30.2 °C, mientras tanto, la temperatura mínima fue de -2.6 a 11 °C. La mayor temperatura se presentó en primavera, registrándose la máxima en el mes de abril que fue de 30.2 °C, la temperatura más baja se registró en invierno con -2.6 en el mes de diciembre. La precipitación acumulada de marzo del 2012 a abril del 2013 fue de 312.3 mm, de los cuales el 70 % se presentó en los meses de junio, julio, agosto y septiembre del 2012 acumulando una precipitación de 220 mm.

Figura 1: Temperatura media mensual máxima y mínima y precipitación acumulada por mes durante el periodo de estudio (marzo 2012 - abril 2013)

Rev Mex Cienc Pecu 2023;14(1):190-203 193
0 10 20 30 40 50 60 70 80 90 100 0 5 10 15 20 25 30 35 Mar Abr May Jun Jul Ago Sep Oct Nov Dic Ene Feb Mar Abr Precipitación (mm) Temperatura (ºC) Precipitación (mm) Temp. Máxima (ºC)

Acumulación de materia seca

Después del pastoreo de uniformización, se cortaron tres cuadros de 0.25 m2 a una altura de 5 cm a partir del suelo en cada parcela experimental durante ocho semanas. El forraje cosechado en cada cuadrante se lavó y se secó en bolsas de papel etiquetadas en una estufa de aire forzado a 55 °C durante 72 h para estimar la cantidad de materia seca por hectárea en las diferentes edades de rebrote.

Composición botánica y morfológica

Para conocer la composición botánica del forraje, se colectó una submuestra del forraje que se tomó para rendimiento de materia seca de aproximadamente un 20 %(11) y se separó en los siguientes componentes: material muerto, malezas, pastos y trébol blanco. Los componentes morfológicos de trébol blanco se separaron (hoja, peciolo, estolón y flor). Cada componente separado se secó en una bolsa de papel etiquetada y permaneció en una estufa de aire forzado a 55 °C durante 72 h para determinar su peso seco.

Índice de área foliar

Para determinar el índice de área foliar, se separaron las hojas de cinco estolones por repetición de cada semana y se colocaron en un integrador de área foliar (LI 3100 LI-COR Inc.) donde se obtuvieron las lecturas en cm2 de área foliar. Estas lecturas en conjunto con el número de estolones por metro cuadrado permitieron estimar el índice de área foliar por medio de la siguiente fórmula:

IAF= AF * DT

Donde: IAF= índice de área foliar; AF= área foliar por tallo; y DT= densidad de estolones (m-2).

Análisis estadístico

Los datos se analizaronporlos procedimientos GLMdeSAS(18),paraundiseño experimental completamente al azar, donde los tratamientos fueron las semanas de evaluación con tres repeticiones por estación y un análisis de regresión para cada variable Los promedios se compararon con la prueba de Tukey (α= 0.05).

Rev Mex Cienc Pecu 2023;14(1):190-203 194

Resultados y discusión

Acumulación de materia seca

En la Figura 2 se muestran los resultados del rendimiento de materia seca acumulada, el cual se incrementó con la edad de rebrote, alcanzándose el máximo rendimiento de materia seca enlaoctavasemanadelaprimavera(2,688kgMS ha-1; P<0.05),séptimasemanaenelverano (2,241 kg MS ha-1; P<0.05), octava semana para el otoño (1,781.3 kg; P<0.05) y sexta semana en el invierno (1,643 kg; P<0.05). La biomasa acumulada en la primavera fue superior en 20 % (447 kg MS ha-1), 51 % (907 kg) y64 % (1,045 kg), comparado con verano, otoño e invierno, respectivamente (P<0.05) La hoja para primavera, otoño e invierno fue en aumento conforme incremento las semanas de rebrote y fue mayor que el peciolo, sin embargo, en verano hubo mayor rendimiento de peciolo y menor la hoja Durante el periodo de evaluación en el invierno (3 de marzo del 2013), se presentó una helada intensa, misma que coincidió con la sexta semana de rebrote la cual limito el rendimiento de biomasa para dicho muestreo aumentando drásticamente el material muerto.

Por su parte, Gutiérrez et al(9) al evaluar el trébol blanco en el altiplano de México mencionan una acumulación de forraje conforme se incrementó la edad de la planta en todas las estaciones alcanzando el máximo rendimiento para las estaciones de primavera, otoño e invierno en la octava semana con 2,953, 1,592, 1,791 kg MS ha-1, respectivamente y en verano en la séptima semana con 1,971 kg MS ha-1 (P<0.05).

Moreno et al(15) al establecer el trébol blanco con asociaciones de gramíneas ballico perenne (Lolium perenne) ypasto ovillo (Dactylis glomerata L.) encontraron un rendimiento máximo del trébol blanco de 513 kg MS ha-1 en su primer año de muestreo. Sin embargo, Maldonado et al(3) en estasmismas asociaciones,peroensu tercer ycuartoañodeproducción,registraron un incrementosignificativoenel rendimientodetrébol blanco obteniendo enpromedio 7,220 kg MS ha-1. Estos mismos autores mencionan que el trébol blanco con el tiempo domina en la pradera por ser una especie de habito de crecimiento estolonífero el cual le permite un rápido crecimiento ante las gramíneas que son amacolladas. En otro estudio(19), reportaron que el 65 % del rendimiento anual se presentó en primavera y verano, 23 % en invierno y otoño fue la estación que presento el menor valor con 12 % (P<0.05).

De acuerdo con diferentes autores(18,20) , el trébol blanco requiere de 18 hasta 30 °C con una óptima de 24 °C y precipitaciones de 750 mm para un mejor desempeño. En la primavera estas temperaturas se alcanzaron (Figura 1) yfavorecieron el crecimiento de la pradera como resultado del incremento del área foliar por planta, y probablemente por el aumento de las tasas de aparición y elongación de hojas(19) . Por el contrario, en el invierno el rendimiento de materia seca fue bajo, al respecto, diferentes autores(3,12,21), argumentan que las bajas

Rev Mex Cienc Pecu 2023;14(1):190-203 195

temperaturas limitan el crecimiento y la tasa de acumulación de forraje, por su influencia directa en una menor tasa de aparición y expansión foliar.

Composición botánica y morfológica

En base a los componentes morfológicos yestimando el rendimiento de biomasa acumulada, la morfología de la planta fue variable (P<0.05). El mayor porcentaje de hoja se produjo en la tercera semana en primavera con el 68 %, de igual forma en verano se produjo el mayor porcentaje de hoja de la primer a la tercera semana con 46 a 40 %, disminuyendo drásticamente en la cuarta semana con 30 % (P<0.05). En otoño donde se encontró el mayor porcentaje de hoja con 70 % en la primera semana manteniéndose hasta la séptima semana (59 %) para después disminuir. En el caso de invierno el mayor porcentaje de hoja fue en la quinta semana (60 %; Figura 3).

Por otro lado, el mayor aporte del peciolo se presentó en verano con el 38 % (P<0.05), mientras que en primavera se reportó el mayor porcentaje de estolón y solo fue mayor en las dos primeras semanas de crecimiento con un promedio de 20 % (P<0.05). En lo que corresponde a pastos en la estación de verano se encontró la mayor cantidad con un promedio de 15 %. La maleza y flor fue mínima la aportación en todas las estaciones y semanas de rebrote con un promedio de 3 %.

La estación de invierno fue la que reportó mayor material muerto y a partir de la séptima semana existió un aumento drástico con el 100 %, ya que existió una disminución de temperatura (Figura 1) heladas ocasionando la muerte del trébol blanco. Al respecto Brock and Tilbrock(8) mencionan que todas las plantas tienen una temperatura optima de crecimiento y cuando éstas sobrepasan o disminuyen drásticamente puede haber muerte celular, lo cual ocasionó el aumento drástico de material muerto. Por otra parte, a medida que se incrementó la edad en la planta, el material muerto también fue en aumento (P<0.05); debido a la madures de las hojas senescentes de los estratos inferiores(9)

La gran proporción de hojas con respecto al peciolo y estolón, indican que es un forraje de alta calidad, ya que esto permite ser un forraje de mayor digestibilidad, aunado a ello, como se demostró en todas las etapas de evaluación, el contenido de flor fue mínimo (P>0.05), lo cual indica que es un forraje que no es precoz y permite elevar su valor nutricional en las primerassemanas.Comosehademostrado,elvalorforrajerodeestaleguminosaseencuentra cuando se asocia con gramíneas, ya que el rendimiento total por unidad de superficie se incrementa, alcanzando las 14 t MS ha-1, sin embargo, estas cualidades también pueden verse afectadas por la estación en el año(19,22) .

Rev Mex Cienc Pecu 2023;14(1):190-203 196

Aunado aesto el trébol blanco bajo condicionesde pastoreoes menossusceptiblealapérdida de meristemos apicales por el arreglo horizontal de las hojas y los primordios foliares, que permiten captar de manera eficiente la radiación solar en comparación con las gramíneas(8,14) .

Índice de área foliar

El índice de área foliar (IAF), permite estimar la capacidad fotosintética de una planta por unidad de área y ayuda a entender la capacidad de asimilar la energía solar y transformarla en rendimiento de materia seca(23). El mayor IAF, se reportó durante la primavera y otoño con 3.0 y 2.6, respectivamente, en la semana ocho, mientras, que en verano e invierno el mayor índice se obtuvo en la semana cinco con 2.6 (P<0.05) Por otra parte, en todas las estaciones existió una alta relación entre el IAF y las semanas de rebrote teniendo en primavera la mayor r2 con 0.97 y en menor en verano con una r2 con 0.83 (Figura 4)

Durante la primavera y verano, debido a las condiciones de temperaturas de 22 a 30 °C y mayor precipitación en los meses de junio, julio, agosto y septiembre se obtuvo el 70 % del total de la precipitación acumulada en el periodo experimental, ayudó al mayor crecimiento delaplanta yaprovechó los procesos bioquímicosydefotosíntesis parasu óptimo desarrollo Sin embargo, en el otoño e invierno las condiciones no fueron favorables, ya que las bajas temperaturas oscilaron de -2 a 11 °C ayudaron a que en el invierno hubiera menor recambio de tejido afectando el crecimiento ydesarrollo de la planta, mostrando el menor IAF y menor rendimiento de biomasa acumulada.

En un ensayo donde evaluaron el trébol blanco(9) el mayor índice de área foliar se obtuvo en la estación de primavera con 3.0 en la octava semana, posteriormente para verano fue en la cinco con un índice de 1.7, y para las estaciones de otoño e invierno fue en la octava semana con un valor de 1.4 y 1.6, respectivamente resultados que concuerdan a los de esta investigación. En un estudio dirigido por Zaragoza et al(1), reportaron para el cultivo de alfalfa el mayor IAF (P<0.05) en la semana cinco de primavera (3.5), verano (2.8) y otoño (2.0) y sexta semana en invierno (1.9), sin embargo, los valores fueron diferentes al evaluar el pasto ovillo, ya que el mayor IAF (P<0.05) se presentó en la semana seis de rebrote en primavera (2.3), verano (1.4) y otoño (1.1) y séptima en invierno (1.0). En otras investigaciones en alfalfa(23,24) reportaron comportamientos similares a lo obtenido en este experimento, ya que los valores más altos de IAF (P<0.05) se registraron en primaveraverano con 3.3 y 4.9, respectivamente.

El IAF es variable para cada cultivo, y depende de las condiciones ambientales presentes Matthew et al(14) señala que el IAF es óptimo, cuando la producción neta de forraje está en un punto máximo, y a la vez se alcanza el mayor IAF, no obstante, el IAF puede verse

Rev Mex Cienc Pecu 2023;14(1):190-203 197

afectado indirectamente, por las bajas temperaturas, por el tipo de cultivo y por la hora de muestreo.

Conclusiones e implicaciones

Durante primavera hubo mayor rendimiento de biomasa acumulada y menor las estaciones deotoñoeinvierno.Amedidaqueseincrementólaedadderebrote,elrendimientodemateria seca fue en aumento. Se recomienda aprovechar la defoliación de la pradera en la semana seis para primavera y verano, semana siete en otoño e invierno en base a que obtuvo en esos momentos adecuado rendimiento de materia seca, mayor componente hoja y menor material muerto, por tanto, optimiza los nutrientes del forraje.

Literatura citada:

1. Zaragoza EJ, Hernández GA, Pérez PJ, Herrera HJG, Osnaya GF, Martínez HPA, González MSS, et al. Análisis de crecimiento estacional de una pradera asociada alfalfapasto ovillo. Téc Pecu Méx 2009;47(2):173-188.

2. Parfitt RL, Couper J, Parquinson R, Schon NL, Stevenson BA. Effect of nitrogen fertilizer on nitrogen pools and soil communities under grazed pastures. NZ J Agr Res 2012;55(3):217-233.

3. MaldonadoPMÁ,Rojas GAR,Torres SN, HerreraPJ, Joaquín CS,VenturaRJ,Hernández GA, Hernández GFJ. Productivity of orchard grass (Dactylis glomerata L.) alone and associated with perennial ryegrass (Lolium perenne L.) and white clover (Trifolium repens L.). Rev Brasi Zootec 2017;46(12):890-895.

4. Randazzo CP, Rosso BS, Pagano EM. Identificación de cultivares de trébol blanco (Trifolium repens L.) mediante SSR. J Basic Appl Gen 2013;24(1):19-26.

5. Black AD, Laidlaw AS, Moot DJ, O’Kiely P. Comparative growth and management of white and red clovers. Irish J Agric Food Res 2009;48(2):149-166.

6. Phelan P, Keogh B, Casey A, Necpalova M, Humphreys. The effects of treading by dairy cows on soil properties and herbage production for three white clover‐based grazing systems on a clay loam soil. Grass Forage Sci 2012;68(4):548-563.

7. Unkovich M. Nitrogen fixation in Australian dairy systems: review and prospect. Crop Past Sci 2012;(63):787-804

8. Brock JL, Tilbrook JC. Effect of cultivar of white clover on plant morphology during the establishment of mixed pastures under sheep grazing. NZ J Agric Res 2000;43(3):335343.

Rev Mex Cienc
198
Pecu 2023;14(1):190-203

Pecu 2023;14(1):190-203

9. Gutiérrez-Arenas AF, Hernández-Garay A, Vaquera-Huerta H, Zaragoza-Ramírez JL, Luna-Guerrero MJ, Reyes-Castro S, Gutiérrez-Arenas DA. Análisis de crecimiento estacional de trébol blanco (Trifolium repens L.). Agroproductividad 2018;11(5):62-68.

10. Olivo CJ, Ziech MF, Meinerz GR, Agnolin CA, Tyska D, Both JF. Valor nutritivo de pastagens consorciadas com diferentes espécies de leguminosas. Rev Brasi Zoot 2009;38(8):1543-1552.

11. Rojas GAR, Hernández GA, Ayala W, Mendoza PSI, Joaquín CS, Vaquera HH, Santiago OMA. Comportamiento productivo de praderas con distintas combinaciones de ovillo (Dactylis glomerata L.), ballico perene (Lolium perenne L.) y trébol blanco (Trifolium repens L.). Rev Fac Cienc Agra 2016;48(2):57-68.

12. Rojas GAR, Hernández GA, Rivas JMA, Mendoza PSI, Maldonado PMA. Joaquín CS. Dinámica poblacional de tallos de pasto ovillo (Dactylis glomerata L.) yballico perenne (Lolium perenne L.) asociados con trébol blanco (Trifolium repens L.). Rev Fac Cienc Agra 2017;49(2):35-49.

13. Rojas GAR, Torres SN, Joaquín CS,Hernández-GarayA, Maldonado PMA, Sánchez SP. Componentes del Rendimiento en diferentes variedades de alfalfa (Medicago sativa L.). Agrociencia 2017;51(7):697-708.

14. Matthew C, Lemaire G, Sackville-Hamilton NR, Hernández-Garay A. A modified selfthinning equation to describe size/density relationships for defoliated swards. Ann Botany 1995;76(6):579–587.

15. Moreno CMA, Hernández-Garay A, Vaquera HH, Trejo LC, Escalante EJA, Zaragoza RJL. Joaquín TBM. Productividad de siete asociaciones y dos praderas puras de gramíneas yleguminosas en condiciones de pastoreo. Rev Fito Mex 2015;(38):101-108.

16. García E. Modificaciones al sistema de clasificación climática de Koppen. 4ed. Universidad Nacional Autónoma de México. México, DF. 2004;217.

17. Ortiz SC. Colección de Monolitos. Depto. Génesis de suelos. Edafología, IRENAT. Colegio de Postgraduados. Montecillo, Texcoco, Estado de México. 1997.

18.SAS,Institute.2009.SAS/STAT® 9.2.UseGuideRelease.Cary,NC:SAS Institute.USA.

19. Castro RR, Hernández GA, Pérez PJ, Hernández GJ, Quero CAR, Enríquez QJF. Comportamiento productivo de cinco asociaciones gramíneas-leguminosas bajo condiciones de pastoreo. Rev Fito Mex 2012;35(1):87-95.

20. Lane LA, Ayres JF, Lovett JV. The pastoral significance, adaptive characteristics, and grazing value of white clover (Trifolium repens L.) in dryland environments in Australia: a review. Austr J Exper Agric 2000;40(7):1033-1046.

Rev Mex Cienc
199

2023;14(1):190-203

21. Hernández GA, Hodgson J, Matthew C. Effect of spring grazing management on perennial ryegrass/white clover pastures. 1. Tissue turnover and herbage accumulation. NZ J Agr Res 1997;40:25-35.

22. Karsten HD, Carlassare M. Describing the botanical compositions of a mixed species northeastern U. S. Pasture rotationally grazed by cattle. Crop Sci 2002;(42):882-889.

23. Rojas GAR, Hernández GA, Joaquín CS, Maldonado PMA, Mendoza PSI, Álvarez VP. Joaquín TBM. Comportamiento productivo de cinco variedades de alfalfa. Rev Mex Cienc Agríc 2016;7(8):1855-1866.

24. Álvarez-Vázquez P, Hernández-Garay A, Mendoza-Pedroza SI, Rojas-García AR, Wilson-García CY, Alejos-de la Fuente JI. Producción de diez variedades de alfalfa (Medicago sativa L.) a cuatro años de establecida. Agrociencia 2018;52:841-851.

200
Rev Mex Cienc Pecu

Rev Mex Cienc Pecu 2023;14(1):190-203

Primavera

trébol hoja trébol peciolo material muerto materia seca total kg MS ha1

Intervalo de cosecha

Otoño

trébol hoja trébol peciolo material muerto materia seca total Polinómica (trébol hoja) kg MS ha1

0 7 14 21 28 35 42 49 56 63

Intervalo de cosecha

2500

Verano

trébol hoja trébol peciolo material muerto materia seca total kg MS ha1

2000

1500

1000

500

0

Figura 2: Curvas de crecimiento de trébol blanco y por componente morfológico durante un ciclo de crecimiento de 8 y 9 semanas 0 7 14 21 28 35 42 49 56

3000 7 14 21 28 35 42 49 56

Intervalo de cosecha

Invierno

2500

trébol hoja trébol peciolo material muerto materia seca total kg MS ha1

2000

1500

1000

500

0

3000 7 14 21 28 35 42 49 56 63

Intervalo de cosecha

201

Rev Mex Cienc Pecu 2023;14(1):190-203

Figura 3: Composición botánica y morfológica del trébol blanco durante un ciclo de crecimiento de 8 y 9 semanas. mm= material muerto

202

Figura 4: Índice de área foliar de trébol blanco durante un ciclo de crecimiento

Primavera= 4.67/(1+0.11*exp(-0.0619t)) r= 0.97 Otoño= 3.13/(1+26.85*exp(-0.0666t)) r= 0.98 Verano= 0.03+0.11t-0.00152 r= 0.83 Invierno= 1.70/(1+18.91*exp(-0.1142t)) r= 0.96

203
Rev Mex Cienc Pecu 2023;14(1):190-203

https://doi.org/10.22319/rmcp.v14i1.6126

Revisión bibliográfica

Aspectos relacionados con la importancia del uso de modelos predictivos en la producción ovina. Revisión

Antonio Leandro Chaves Gurgel a*

Gelson dos Santos Difante a

Luís Carlos Vinhas Ítavo a

João Virgínio Emerenciano Neto b

Camila Celeste Brandão Ferreira Ítavo a

Patrick Bezerra Fernandes a

Carolina Marques Costa a

Francisca Fernanda da Silva Roberto c

Alfonso Juventino Chay-Canul d

a Universidade Federal de Mato Grosso do Sul, Faculdade de Medicina Veterinária e Zootecnia. Avenida Senador Filinto Müler, 2443 - Pioneiros, 79074-460, Campo Grande, Mato Grosso do Sul, Brasil.

b Universidade Federal do Rio Grande do Norte, Unidade Acadêmica Especializada em Ciências Agrárias. Macaíba, Rio Grande do Norte, Brasil.

c Universidade Federal da Paraíba, Centro de Ciências Agrárias. Areia, Paraíba, Brasil.

d Universidad Juárez Autónoma de Tabasco, División Académica de Ciencias Agropecuarias. Villahermosa, Tabasco, México.

* Autor de correspondencia: antonioleandro09@gmail.com

Resumen:

Los sistemas de producción ovina se enfrentan a numerosos desafíos, que hacen de la toma de decisiones un proceso lleno de riesgos e incertidumbres. En este sentido, la modelación es una herramienta útil, ya que permite a los tomadores de decisiones evaluar

204

el comportamiento de las variables y sus interrelaciones, además de utilizar información previa o relacionada para predecir resultados y simular diferentes escenarios. El advenimiento de los modelos de predicción ha permitido monitorear el peso de un animal y determinar el mejor momento para su venta. Además, permite a los productores estimar los pesos de la canal y los principales cortes comercializables antes del sacrificio. Toda esta información está directamente asociada a la rentabilidad y el éxito de la actividad productiva. Por lo tanto, en vista de las diferentes aplicaciones de los modelos matemáticos en los sistemas de producción, esta revisión de la literatura examina los conceptos en los estudios de modelación y la importancia de utilizar modelos de predicción en la producción de ovinos de carne. Además, aborda la aplicación práctica de los estudios de modelación en la predicción de la ingesta de materia seca y los rasgos de la canal de ovinos de carne a través de variables correlacionadas.

Palabras clave: Mediciones biométricas, Canal, Predicción de ingesta, Ecuaciones matemáticas, Cría de ovinos de carne, Pastizal tropical.

Recibido: 22/12/2021

Aceptado: 22/06/2022

Introducción

La cría de ovinos para la producción de carne en Brasil se ha expandido en la última década debido a la mayor demanda de este tipo de carne en el mercado. Así, los productores han buscado formas de establecer sistemas de producción capaces de generar eficientemente carne de calidad a un bajo costo(1,2,3). Sin embargo, la productividad de estos animales en Brasil es aún incipiente debido a deficiencias en el manejo genético y nutricional, bajo financiamiento, sistemas de manejo inadecuados de las diversas etapas de crianza y baja capacidad para organizar adecuadamente la cadena de producción(4) . Otro dato relevante es que más del 50 % de la producción ovina se lleva a cabo en pastizales naturales sin manejo(4). Estas peculiaridades hacen que el proceso de toma de decisiones en los sistemas de producción ovina esté lleno de riesgos e incertidumbres.

Apesardeserunacaracterísticainherentealossistemasdeproducciónanimal,losriesgos (probabilidaddeocurrenciadeunevento)puedenserminimizados através delaadopción de herramientas que ayuden a la toma de decisiones(5). En este sentido, la falta de conocimiento resultará en la imposibilidad de estimar el riesgo (incertidumbre). Cierta información dentro y fuera del sistema de producción es esencial para reducir las incertidumbres asociadas con la toma de decisiones(6) Fuera del sistema de producción, el productor tiene poco control sobre las acciones que afectan la rentabilidad de la producción. En contraste, las acciones dentro de la granja tendrán un impacto directo en el éxito de la actividad.

Rev Mex Cienc Pecu 2023;14(1):204-227 205

En este contexto, una metodología adecuada para el análisis de la toma de decisiones requiere información precisa sobre el problema, así como eficiencia en el manejo del sistema, para que se puedan alcanzar los objetivos planeados(7). La modelación es una herramienta que puede ayudar al proceso de toma de decisiones, ya que permite a los tomadores de decisiones evaluar el comportamiento de las variables y sus interrelaciones, además de utilizar información previa o relacionada para predecir resultados y simular diferentes escenarios(8) .

El uso de modelos matemáticos permite a los productores estimar alguna información importante que sería difícil de obtener en términos prácticos, por ejemplo, la ingesta de hierba utilizando variables correlacionadas(9). La modelación también permite monitorear el peso de un animal y determinar el mejor momento para su venta(10,11). Además, permite a los productores estimar el peso de la canal y los principales cortes antes del sacrificio(12,13). Toda esta información está directamente asociada a la rentabilidad y el éxito de la actividad productiva.

Así, debido a las diferentes aplicaciones de los modelos matemáticos en los sistemas de producción, esta revisión bibliográfica examina los conceptos en los estudios de modelación y la importancia de utilizar modelos predictivos en la producción de ovinos de carne.

Modelos matemáticos

El uso de modelos matemáticos se ha convertido en una herramienta indispensable para los hacedores de políticas públicas y los científicos(14). Pool(15) sugirió que el acto de modelar se convertiría en un tercer dominio de la ciencia, uniéndose a los dominios tradicionales de la teoría y la experimentación. En este sentido, decisiones políticas importantes, como el efecto del calentamiento global en la biología terrestre(16,17), lasalud pública y el manejo de las pandemias(18), han llegado a depender en gran medida de los estudios de modelación. Además, los investigadores han comenzado a utilizar la modelación en los campos más diversos de la ciencia, por ejemplo, medicina(19) , economía(20), física(21), química(22), ingeniería(23), derecho(24), ciencia animal(25,26), y muchos otros.

Hay varios conceptos para los modelos matemáticos. Hamilton(14) los definió como la expresión de la teoría, que proporciona la posibilidad de comparar la teoría con los datos obtenidos en el entorno físico. Para Tedeschi(25), los modelos son representaciones matemáticas de mecanismos que gobiernan fenómenos naturales que no son completamente conocidos, controlados o comprendidos. Más recientemente, Tedeschi y Méndez(8) postularon que los modelos matemáticos son representaciones aritméticas del comportamiento de dispositivos reales yprocesos de la vida. Todos estos autores también consideraron que los modelos son una abstracción y una representación de la realidad(8,14,25) .

Rev Mex Cienc Pecu 2023;14(1):204-227 206

El uso o no uso de las matemáticas define si el modelo es predictivo o descriptivo, respectivamente. Los modelos descriptivos abordan teóricamente el desempeño de las variables y sus interrelaciones. En contraste, los modelos predictivos están dirigidos a utilizar información previa para predecir resultados o simular diferentes escenarios(8). Al respecto, Tedeschi yMéndez(8) clasificaronlos modelos matemáticos(predictivos)entres clases principales: en un contexto temporal, los modelos pueden clasificarse como estáticos o dinámicos; en un contexto natural, como empíricos o mecanicistas; y, en un contexto conductual, como deterministas y estocásticos.

Los modelos dinámicos son aquellos que describen los cambios que se han producido y las respuestas obtenidas en función del tiempo. Los modelos no lineales utilizados para describir el crecimiento animal tienen un carácter dinámico(27,28). Los modelos estáticos, por otro lado, son aquellos que generan una respuesta para un instante fijo, es decir, no incluyen el tiempo como variable(8). Sin embargo, Tedeschi y Méndez(8) advierten que el concepto de estático versus dinámico depende de la escala de tiempo utilizada, ya que un fenómeno biológico puede ser mejor representado por un modelo dinámico cuando ocurren cambios diarios, pero cuando los años se usan como una variante de tiempo, un modelo estático puede funcionar mejor que un modelo dinámico, ya que los cambios diarios son irrelevantes para la variable de interés.

Los modelos empíricos se obtienen a partir de datos observacionales. Estos modelos se aplican en estudios experimentales que evalúan las relaciones dosis-respuesta, por ejemplo, el efecto de las tasas de nitrógeno en el contenido de proteína cruda de plantas forrajeras. Así, es posible estimar la concentración de una proteína bruta (variable Y) a cualquier tasa de nitrógeno (variable X) mediante el ajuste de regresiones polinómicas(29) Los modelos mecanicistas, por otro lado, consideran los mecanismos conceptuales subyacentes ylacombinacióndeelementosdediferentesnivelesjerárquicos.Elpropósito principal deestos modelos es explicarcómo unelemento enunnivel superiorsecomporta o responde a una gama de elementos en un nivel inferior. Este tipo de modelo puede ejemplificarse mejor en la modelación de la dinámica de acumulación de hierba de una planta forrajera dada(30). En este caso, el modelo mecanicista busca explicar la secuencia de acciones de los factores abióticos a nivel de moléculas, células, tejidos, órganos, macollos, plantas, matas y el dosel forrajero.

Los modelos estocásticos son aquellos que asocian un riesgo o probabilidad con la decisión. La estocasticidad se asocia con una falta de comprensión del fenómeno biológico. En consecuencia, una mayor comprensión del fenómeno se traduciría en un modelomenosestocástico.UnejemplodemodeloestocásticofuedesarrolladoporNadalRoig et al(5) para abordar decisiones tácticas, planificar la producción, aumentar la flexibilidad y mejorar la coordinación y la producción general de cerdos bajo la incertidumbre asociada con el precio de venta de los animales. Los autores concluyeron que el modelo estocástico era eficiente en la predicción del mejor escenario para el sistemadeproducción.Además,debido alaincertidumbredemercadodelpreciodeventa

Rev Mex Cienc Pecu 2023;14(1):204-227 207

para los cerdos, la versión estocástica condujo a resultados más precisos y realistas que la versión determinista.

En contraste, los modelos deterministas no asocian ninguna probabilidad con una estimación dada(8). Por lo tanto, siempre que el modelo se ejecute sin cambios en las variables de entrada, se obtendrá la misma información de salida. Un ejemplo del uso de este tipo de modelo fue propuesto por el NRC(31) para estimar la ingesta de materia seca por ovinos. Según el NRC(31) , la ingesta de materia seca (kg/día) por ovinos está determinada por las siguientes variables de entrada: peso corporal adulto (kg), peso corporal y peso estándar de referencia, que correspondería a un animal adulto. Si es hembra, debe considerarse no preñada y no lactante, con una puntuación corporal de 2.5 en una escalade1 a5, yque ya haya experimentadouncrecimiento esqueléticocompleto. De esta manera, cada vez que el modelo se ejecute utilizando la misma información de entrada, la ingesta predicha será la misma. Sin embargo, el modelo no da ninguna probabilidad de que la ingesta predicha verdaderamente se observe.

Independientemente del tipo de modelo, su estructura básica se compone de variables, parámetros y constantes, pero no todos los modelos exhiben estos tres componentes simultáneamente. Las variables, dependientes o independientes, se cambian según el individuo; los parámetros varían según el modelo, y las constantes no varían en ninguna situación. En este sentido, dos procesos son comúnmente utilizados para la creación de modelos: 1) Establecer ideas y conceptos a través de un estudio a profundidad de la literatura y luego crear parámetros para las variables del modelo, o 2) Analizar datos experimentales que expliquen un fenómeno biológico y luego combinarlos en una ecuación(25). En ambas situaciones, el análisis estadístico adecuado para evaluar el ajuste de los modelos es un paso indispensable.

Evaluación de modelos matemáticos

Existen diferencias conceptuales entre los términos ‘validación’, ‘verificación’ y ‘evaluación’ de modelos matemáticos(14,25). Sin embargo, el término ‘validación del modelo’ fue frecuentemente cuestionado por los investigadores(25,32). Debido a que los modelos son considerados una abstracción de la realidad y una aproximación del sistema real(8,14,25), es imposible probar que todos los componentes del modelo realmente predecirán el comportamiento de un sistema biológico. Tedeschi(25) propuso los términos ‘evaluación’ o ‘prueba’ para indicar el grado de robustez del modelo con base en criterios preestablecidos. El autor también destacó que los modelos matemáticos no pueden demostrarse como válidos, excepto si son adecuados para el propósito para el que están destinados, bajo ciertas condiciones.

En los estudios de modelación, se debe seguir un protocolo para definir el mejor modelo de predicción para el objetivo establecido. Por lo tanto, el proceso requiere primero una revisión extensa de la literatura sobre el tema abordado. Después de que se logra una comprensión teórica del fenómeno a modelar, el siguiente paso es ajustar, evaluar y

Rev Mex Cienc Pecu 2023;14(1):204-227 208

comparar los modelos definidos y, finalmente, interpretar los resultados y hacer inferencias sobre la aplicación de los modelos seleccionados. Por lo tanto, se entiende que la evaluación es un paso fundamental en el ajuste de modelos de predicción(25), ya que este paso define si el modelo es adecuado para su propósito previsto. Según Hamilton(14) , laevaluacióndelmodeloesunacomparacióndelosdatospredichossobrelosobservados, que utiliza herramientas estadísticas para apoyar las conclusiones.

La exactitud y la precisión son dos conceptos importantes cuando se evalúan modelos matemáticos. La exactitud indica la proximidad de los valores medios predichos a los observados. La precisión, por otro lado, es la capacidad del modelo para predecir valores consistentemente(25). Por lo tanto, un modelo exacto, pero no preciso (situación 1 en la Figura 1) estima un valor promedio cercano al valor promedio verdadero, pero con una desviación estándar alta. En contraste, un modelo con baja exactitud y alta precisión (situación 4 en la Figura 1) predice una media diferente de los datos observados, pero denota una desviación estándar baja en las predicciones. En las situaciones 2 y 4 (Figura 1) los modelos son igualmente exactos, pero solo el modelo 2 muestra las características de exactitud y precisión, ya que los puntos se distribuyen de forma compacta en el centro del objetivo.

Figura 1: Representación esquemática de conceptos de precisión y exactitud (Adaptado(25))

La primera y más simple evaluación de la bondad de ajuste de los modelos (precisión y exactitud) es el análisis de momentos de los datos predichos y observados. En este tipo de evaluación, se espera que un buen modelo estime los valores medios, máximos y mínimos, así como la varianza de los datos yla desviación estándar cercanos a los valores observados(33). El valor del coeficiente de correlación de Spearman también se ha utilizado inicialmente para evaluar la clasificación de los valores de datos predichos y observados. Este coeficiente evalúa si el valor predicho más alto es también el valor

Rev Mex Cienc Pecu 2023;14(1):204-227 209

observado más alto, creando así una clasificación entre todos los datos(34) .

La regresión lineal entre los valores observados y predichos se utiliza comúnmente para evaluar modelos. La hipótesis de que los datos predichos son iguales a los datos observados se evalúa mediante la ecuación de regresión Y = β0 + β1 × X, donde Y es el valor observado; β0 y β1 representan el intercepto y la pendiente de la ecuación de regresión, respectivamente; y X es el valor predicho por las ecuaciones. Los valores predichos por el modelo se trazan en el eje X, mientras que los valores observados se trazan en el eje Y(25).. En este formato de gráfico, los puntos de datos ubicados por encima y por debajo de la línea de igualdad indican sobreestimación o subestimación por el modelo, respectivamente(26)

Para evaluar la hipótesis (β0= 0 y β = 1), Dent y Blackie(35) sugirieron evaluar simultáneamente si el intercepto es diferente de cero y la pendiente es diferente de uno. Para este propósito, se utilizó la prueba F simultánea para la identidad de los parámetros de regresión predichos por los datos observados(36). Sin embargo, Tedeschi(25) advirtió que la prueba F es válida sólo para modelos deterministas y no debe ser utilizada para modelos estocásticos. Además, debido a la suposición de que los datos son independientes, lo que no siempre se observa en un estudio de modelación, la prueba F simultánea puede resultar en errores de aceptación o rechazo de la hipótesis evaluada(36) .

Después de obtener la regresión lineal, es posible calcular el coeficiente de determinación de la ecuación (R2). El coeficiente de determinación indica el porcentaje de variación en Y que se explica por X. Por lo tanto, R2 evalúa la proximidad de los datos a la línea de regresión ajustada. Cabe destacar que la interpretación del valor R2 es a menudo errónea(33). Cuando se usa de forma aislada, esta información no es un buen indicador de la calidad del modelo, ya que R2 mide la precisión y no la exactitud de la ecuación. Aunado a esto está el hecho de que un alto coeficiente de determinación no implica necesariamente que exista una relación lineal entre los datos predichos y observados, ya que la relación puede ser curvilínea(25)

Otra forma de evaluar la ecuación de regresión es mediante el error cuadrático medio (ECM), que evalúa la precisión de la regresión lineal ajustada utilizando la diferencia entre los valores observados y los valores estimados por la regresión. Analla(37) recomendó el ECM como el mejor criterio para seleccionar el modelo con el mejor ajuste al comparar varios modelos. Cabe señalar que aunque se utilizan varios métodos para evaluar la idoneidad de la ecuación de regresión, su uso puede generar resultados ambiguos cuando los datos no muestran la distribución normal y en los casos en que los errores residuales son bajos(25). En este contexto, se realizan algunas evaluaciones adicionales.

El ECM es similar al error de predicción cuadrático medio (EPCM). La diferencia fundamental entre los dos parámetros es que el EPCM es la diferencia entre los valores observados y los valores predichos por el modelo, mientras que el ECM, como se vio

Rev Mex Cienc Pecu 2023;14(1):204-227 210

anteriormente, es la diferencia entre los valores observados y los valores estimados por la regresión. Tedeschi(25) consideró al EPCM la medida más común y confiable para determinar la exactitud predictiva de un modelo; sin embargo, el autor advirtió que su confiabilidad disminuirá a medida que disminuya el número de observaciones. Además, el autor destacó que el EPCM no proporciona ninguna información sobre la precisión del modelo y que una desventaja del EPCM es que las desviaciones se ponderan por sus valores al cuadrado, lo que elimina los datos negativos, dando así mayor énfasis a valores más grandes.

Bunke y Droge(38) propusieron una descomposición del EPCM que tiene en cuenta la fuente de variación de los parámetros. Por este fraccionamiento, el EPCM se divide en error medio, error sistemático y error aleatorio. Cuando la mayoría de los errores se atribuyen al error medio, significa que hay una deficiencia en la colocación de la línea de igualdad, que se puede corregir con un factor de corrección aditivo. El error sistemático, por otro lado, indica una falla en el desplazamiento de la línea, que puede corregirse con una corrección multiplicativa.

El coeficiente de determinación (CD) del modelo, que muestra la proporción de la varianza total de los valores observados que se explica por los datos predichos, se ha utilizado durante mucho tiempo para evaluar modelos matemáticos. Sin embargo, el CD ha sido reemplazado por el coeficiente de correlación de concordancia (CCC) en estudios de variables continuas(39,40). El CCC evalúa simultáneamente la exactitud y precisión de las ecuaciones, lo que lo convierte en una medida poderosa. El valor del CCC se obtiene mediante una ecuación de dos componentes: 1) coeficiente de correlación, que mide la precisión; y 2) factor de corrección de sesgo, que indica la exactitud(41)

Se utilizan numerosas técnicas estadísticas para evaluar la precisión y exactitud de los modelos. Sin embargo, ninguna técnica utilizada aisladamente es capaz de evaluar adecuadamente el desempeño del modelo(25). Por lo tanto, la mejor manera de evaluar el desempeñopredictivo de unmodeloes asociarlo conunconjuntodemétodosestadísticos. Es importante enfatizar que esta revisión aborda los principales métodos utilizados en los estudios de modelación que predicen la ingesta de materia seca y los rasgos de la canal de ovino(39,40,42). Una discusión adicional sobre la evaluación de modelos desde un punto de vista estadístico fue presentada por Neter et al(33) y Tedeschi(25) .

Aplicación de modelos predictivos en la producción de ovinos de carne

Debido a las diversas aplicaciones de los modelos matemáticos en los sistemas de producción ovina, esta revisión de literatura abordará la aplicación de estudios de modelación en la predicción de la ingesta de materia seca por ovinos en pastoreo, así como el peso corporal y los rasgos de la canal de ovino a través de mediciones biométricas. Esta información es difícil de obtener en condiciones prácticas; sin embargo,

Rev Mex Cienc Pecu 2023;14(1):204-227 211

está directamente asociada con la rentabilidad y el éxito de la actividad productiva. Se destaca que las posibilidades de utilizar la modelación en la producción ovina son lo más diversas posible y sería difícil resumir toda esta información en una sola revisión.

Predicción de la ingesta de materia seca por ovinos en pastoreo

En el caso de los animales de corral de engorda, las características químicas y físicas de los ingredientes que componen las dietas y sus interacciones tienen un gran efecto sobre la ingesta de materia seca (IMS)(43,44). En resumen, la demanda energética del animal define el consumo de dietas con alta densidad calórica(45). Por otro lado, cuando el animal esalimentadocondietasdebajo valornutricionalybajadensidadenergética,lacapacidad física del tracto gastrointestinal determina el potencial de la IMS(46). En este sentido, Mcdowell(47) mencionó que la ingesta de hierba está influenciada principalmente por el tamaño corporal, ya que el tamaño del animal se correlaciona positivamente con los requerimientos nutricionales de mantenimiento(42,43,45), seguido de la densidad energética y la tasa de digestión de la dieta. Además, el autor observó que la IMS se correlaciona positivamente con la digestibilidad de la materia orgánica.

El contenido de fibra detergente neutro (FDN) de una dieta o hierba es un parámetro eficiente para expresar la acción de estos dos mecanismos para controlar la ingesta de materia seca, ya que está positivamente relacionado con el efecto de llenado ruminal e inversamente relacionado con la concentración de energía de la dieta(48) .

Los factores relacionados con los animales, como la raza, el sexo, la edad, el peso corporal, la etapa fisiológica (crecimiento, preñez o lactancia) y la composición corporal influyen en los requerimientos de nutrientes y la ingesta de los ovinos(45). Mertens(48) sugirió que la ingesta de nutrientes depende de factores importantes relacionados con el manejo de la alimentación (disponibilidad de alimento, área lineal del comedero, accesibilidad al alimento, frecuencia de suministro, forma física y procesamiento), además de las condiciones ambientales y el bienestar animal relacionados con la concentración de energía de la dieta(48)

En cuanto a los animales en pastoreo, además de todos los factores antes mencionados que actúan sobre la ingesta de materia seca, las complejas interacciones entre las características del animal y el pastizal afectan la tasa de ingesta de nutrientes(49). Se sabe que el comportamiento de alimentación es la forma más eficiente de demostrar las interacciones entre la estructura del pastizal y la ingesta de forraje(50) .

Según una visión mecanicista, la IMS diaria para ovinos en pastoreo es el resultado del tiempo dedicado por el animal a buscar yaprehender la hierba y la tasa de ingesta durante este período(50), que, a su vez, es el producto de la velocidad de bocado y el peso del bocado. La velocidad y el peso de un bocado cambian cuando se cambia la cantidad de hierba por bocado (volumen del bocado). El volumen del bocado es sensible a las oscilaciones en la profundidad del bocado y la densidad aparente de la hierba, que a su

Rev Mex Cienc Pecu 2023;14(1):204-227 212

vez estádeterminadapor laalturadel dosel ylamasadelahierba (Figura2). La estructura del pastizal (masa de la hierba, altura, etc.) también cambia el tiempo que el animal pasa en la actividad de pastoreo(51,52)

Figura 2: Representación esquemática del comportamiento alimenticio de los animales en pastoreo (Adaptado53)

Para ejemplificar la relación entre la estructura del pastizal, el comportamiento de alimentación y la ingesta, uno simplemente debe imaginar una situación con limitaciones en el suministro de hierba. En esta circunstancia, hay una reducción en el tamaño del bocado, mientras que el tiempo de pastoreo y la velocidad de bocado aumentan(52). Por lo tanto, hasta cierto punto, es posible obtener una ingesta constante de hierba en pastizales con diferentes doseles. Sin embargo, si la asignación de hierba es demasiado baja, el aumento en el tiempo de pastoreo no podrá mantener la ingesta debido a la reducción en la tasa de ingesta(54)

Así, debido a la existencia de varios factores que influyen en la IMS de ovinos en pastoreo, la modelación de este parámetro se vuelve muy compleja. Por esta razón, la mayoría de los modelos de predicción de IMS de ovinos se obtienen de experimentos realizados en condiciones de corral de engorda(31,42,43,45). Esto puede llevar a inconsistencias si se utilizan para predecir la IMS de los ovinos en pastoreo, ya que no consideran las características del pastizal y las interacciones entre el animal y la planta forrajera.

Rev Mex Cienc Pecu 2023;14(1):204-227 213

La mayoría de los modelos utilizados para predecir la ingesta por parte de animales en pastoreo son mecanicistas, centrándose en el proceso digestivo y la selectividad de la ingestión en condiciones de pastoreo, y consideran principalmente la altura del pastizal o la cantidad de hierba extraída(50,55). Pittroff y Kothmann(56) realizaron un análisis comparativo de modelos cuantitativos que predecían la ingesta de alimento por ovinos y observaron que alrededor del 55 % de las ecuaciones tomaron en cuenta algún rasgo del pastizal, con predominio de la disponibilidad de hierba. Los investigadores concluyeron que existe un marco conceptual débil en el desarrollo de los modelos.

De los modelos presentados en la revisión de Pittroff y Kothmann(56), el desarrollado por Freer et al(57) se centró más en las características del pastizal. La ecuación predice la ingesta por ovinos como el producto de la ingesta potencial de alimento (Imax) y la proporción de ese potencial (ingesta relativa) que el animal puede obtener de la cantidad disponible de alimento. La Imax se definió como la cantidad ingerida (kg/d de MS) cuando a los animales se les permite el acceso sin restricciones al alimento con una digestibilidad de MS de al menos el 80 %, que depende del peso estándar de un animal adulto (peso estándar de referencia) y de la relación entre el peso corporal y el peso estándar de referencia (ecuación 1). Cabe destacar que, en el caso de las gramíneas tropicales, apenas se alcanza la digestibilidad mínima del 80 %(58,59,60)

(1) Imax= 0.04 × PER × Z × (1.7 - Z)

Donde PER= peso estándar de referencia; Z= tamaño relativo del animal, larelación entre el peso corporal y el peso estándar de referencia.

La ingesta relativa se describió como el producto de dos atributos del alimento: disponibilidad relativa e ingestibilidad relativa. Para los animales en pastoreo, la disponibilidad relativa se predice principalmente a partir de la masa de la hierba, mientras que la ingestibilidad relativa se predice a partir de la digestibilidad del pasto recolectado por simulación de pastoreo (arranque manual)(57)

Parasimularladinámica deingestadelos rumiantes durante el pastoreo, Baumont et al(50) desarrollaronun modelo teóricodeunatasadeingestaquecombinalaestructuradel pasto y la decisión del animal de pastar o realizar otras actividades. Los autores definieron la ingesta de materia seca como la suma de las tasas de ingesta instantánea, que, a su vez, se determinan en función de las tasas de ingesta potencial en los horizontes de pastoreo, las preferencias que determinan las proporciones seleccionadas en ambos horizontes de pasto y los niveles de saciedad del animal (ecuación 2).

(2) TI= (PREFi

×

TIPi) + (PREFi+1× TIP + 1) / NS

Donde TI= tasa de ingesta (g MS/min); PREFi y PREFi + 1= preferencia relativa determinada a partir de un submodelo de decisión de pastoreo que define cómo el animal distribuye la ingesta entre el horizonte más alto disponible (i) y el siguiente horizonte

Rev Mex Cienc Pecu 2023;14(1):204-227 214

disponible (i + 1), de acuerdo con las preferencias relativas PREFi y PREFi+1; NS= nivel de saciedad; TIPi= tasa de ingesta potencial (g MS/min) obtenida del tiempo que tarda el animal en realizar el bocado y el peso de ese bocado en el horizonte más alto disponible (i), y el siguiente horizonte disponible.

McCall(61) propuso un modelo para estimar la ingesta de hierba en pastizales donde el ballico perenne es la especie forrajera predominante. El autor modeló la IMS real de ovinos en pastizal en función de la ingesta máxima multiplicada por el factor de corrección (ecuación 3). El factor de corrección se obtiene de la asignación de hierba y la ingesta potencial del animal (ecuaciones 4 y 5). La asignación de hierba se estimó cosechando el forraje contenido dentro de marcos metálicos de 1 m2

(3) IH= Imax × M

(4) M= A × EXP (-1.016 × EXP (1.0308 × AHM)

(5) A= 1-1.42 × (-0.00198 × MH),

Donde IH= ingesta de hierba (kg/día); Imax= ingesta máxima de hierba (kg/día); M= factor de corrección; EXP= exponencial (2.7182); AHM= asignación de hierba dividida por la ingesta máxima; y MH= masa herbácea menos material muerto (kg/ha).

Medeiros(62) utilizó el modelo propuesto por McCall(61) para estimar la ingesta de ovinos en Cynodon spp. bajo diferentes intensidades de pastoreo en un sistema de pastoreo continuo y concluyó que el modelo de McCall(61) sobreestimó la ingesta de los animales. Esta sobreestimación indicada por Medeiros podría deberse al tipo de hierba ya que McCall trabajó con un pasto C3 que es más digerible que el C4 con el que Medeiros trabajó. Por lo tanto, Medeiros(62) sugirió reemplazar la asignación de hierba verde (hoja + tallo) en la ecuación con una asignación de hoja verde. Sólo entonces la ingesta estimada fue estadísticamente igual a la observada.

De manera similar, Gurgel et al(9) evaluaron diferentes modelos que predecían la IMS en pastizales tropicales utilizando el factor de ajuste propuesto por McCall(61) y concluyeron que las ecuaciones no predicen con exactitud la IMS de ovinos de carne ygeneran valores sobreestimados en pastizales de clima tropical. Los autores propusieron que la estimación de la IMS para corderos en pastizales tropicales debería considerar el siguiente modelo (ecuación 6): (6) IMS (% PV)= 7.16545 - 0.21799 × PV + 0.00273 × PV2 - 0.00688 × TP + 0.000007 × TP2 + 0.00271 × AHV

Donde IMS= ingesta de materia seca (% PV); PV= peso vivo (kg); TP= tiempo de pastoreo (min/día); y AHV= asignación de hierba verde (kg MS/100 kg PV), que corresponde a la asignación de hierba menos material muerto.

Rev Mex Cienc Pecu 2023;14(1):204-227 215

Por lo tanto, los modelos propuestos para un clima templado no estiman correctamente la ingesta de hierba por parte de ovinos en pastizales tropicales. De esta manera, son necesarios estudios para estimar la ingesta de ovinos en regiones tropicales, especialmente en sistemas que adoptan el pastizal como fuente primaria de nutrientes, ya que esta información es de fundamental importancia para la planeación nutricional.

Predicción del peso corporal y rasgos de la canal de ovinos a través de mediciones biométricas

El peso corporal es una de las principales piezas de información que guía la toma de decisiones en los sistemas de producción debido a su relación directa con los requerimientos nutricionales de los animales(31). Además, el monitoreo de la curva de crecimiento de los rumiantes permite identificar las fases en las que el animal es más capaz de convertir el alimento consumido en tejido corporal y el mejor momento para su venta(10,11,63) .

El crecimiento de los animales se evalúa utilizando equipos de medición directa, como básculas ganaderas. Sin embargo, debido a las condiciones en las que operan los sistemas tradicionales de producción ovina(4) , la determinación directa del peso corporal de los animales a menudo representa un desafío para los productores debido al alto costo de adquirir y mantener las básculas(64,65,66,67). En la mayoría de los casos, esto hace que los productores comercialicen animales con base en puntuaciones visuales, lo que conduce a errores en la estimación del peso corporal y afecta la rentabilidad de los sistemas de producción(68) .

La estimación del peso corporal por métodos indirectos puede ser una alternativa de fácil adopción y de bajo costo. En este sentido, las mediciones biométricas son una opción viable para predecir el peso corporal debido a la correlación entre estos rasgos y el peso corporal de los animales(65,69). Este método consiste en desarrollar modelos matemáticos que permiten a los productores estimar el peso corporal utilizando algunas mediciones biométricas (Figura 3) a partir de análisis de regresión lineal y múltiple. Estas medidas corporales se pueden obtener con una vara para medir caballos y una cinta métrica(12,41) , instrumentos fáciles de manejar y económicos que no requieren un mantenimiento periódico sofisticado.

Las principales mediciones biométricas (Figura 3) evaluadas en ovinos son las siguientes(70): altura de la cruz (AC) – desde el punto más alto de la cruz hasta el suelo (1); altura de la grupa (AG) – la distancia vertical desde el punto más alto de la grupa hasta el suelo (2); longitud del cuerpo (LC) – desde la articulación escapulohumeral hasta la parte caudal del isquion (3); ancho del pecho (AP) – la medida entre las puntas de las escápulas (4); ancho de la grupa (NG) – la distancia entre las tuberosidades isquiáticas (5); circunferencia del corazón (CC) – tomada alrededor de la cavidad torácica (6); circunferencia abdominal (CA) – tomada alrededor de la cavidad abdominal (7); longitud

Rev Mex Cienc Pecu 2023;14(1):204-227 216

de la pierna (LP) – tomada de la tuberosidad isquiática al suelo (8); y la circunferencia de la pierna (CP) – tomada alrededor de la parte media del muslo (9).

Figura 3: Principales mediciones biométricas realizadas en ovinos

Altura de la cruz (1); altura de la grupa (2); longitud del cuerpo (3); ancho del pecho (4); ancho de la grupa (5); circunferencia del corazón (6); circunferencia abdominal (7); longitud de la pierna (8); circunferencia de la pierna (9).

Se realizaron algunos estudios para desarrollar ecuaciones lineales y múltiples para estimar el peso corporal de ovinos a partir de mediciones biométricas(65,66,71,72,73). Los autores concluyeron que la CC es la medición biométrica más importante para predecir el peso corporal del animal (Cuadro 1). En contraste, Canul-Solís et al(66) utilizaron el NG para estimar el peso corporal de ovinos Pelibuey. Sin embargo, cuando se utiliza más de una medida, la capacidad predictiva de las ecuaciones aumenta(68,69,73,74)

Rev Mex Cienc Pecu 2023;14(1):204-227 217
1 2 3 4 6 7 8 9 5

Cuadro 1: Ecuaciones para predecir el peso corporal (PC) de ovinos utilizando mediciones biométricas (cm)

Autor Raza Ecuación R2

Chay-Canul et al(65) Pelibuey PC (kg) = -47.97 + 1.07 × CC 0.86

Canul-Solís et al(66) Pelibuey PC (kg) = - 19.17 + 3.46 × NG 0.96

Málková et al(68) Charolais; Kent; Cruza PC = (kg) = -3.997 + 0.225 × CC 0.78

Málková et al(68) Charolais; Kent; Cruza PC(kg)= -4.672+0.243×CHC+0.198 × CC 0.80

Gurgel et al(69) Santa Inés PC (kg) = 0.45 × CC - 0.58× CA + 0.005 × CA2 + 0.002 ×AG2 0.88

Kumar et al(71) Harnali PC (kg) = -63.72 + 1.23 × CC 0.87

Worku(73) Kebeles; ArsiBale PC (kg) = -39.51 + 0.91× CC 0.71

Worku(73) Kebeles; ArsiBale PC (kg) = 45.77 + 0.59 × CC + 1.99 × CHC + 0.30 × PP + 0.5 × AG 0.81

Grandis et al(74) Texel

PC = (kg) -107.16 + 1.40 × CC + 0.60 × AC 0.88

CC= circunferencia del corazón, NG= ancho de la grupa; CHC= circunferencia del hueso de la caña; CA= circunferencia abdominal; AG= altura de la grupa; PP= profundidad del pecho; AC= altura de la cruz.

Otra forma de utilizar las mediciones biométricas para predecir el peso corporal de los ovinos es a partir del volumen corporal, que se obtiene mediante la fórmula utilizada para calcular el volumen de un cilindro, incluyendo las mediciones de CC y LC(75):

Radio (cm)= CC / 2π, Volumen corporal (dm3)= (π × r2 × LC) / 1000, donde, r= radio de la circunferencia (cm); π= 3.1416; CC= circunferencia del corazón (cm); y LC= longitud del cuerpo (cm).

Salazar-Cuytun et al(67) compararon tres ecuaciones (lineal, cuadrática y exponencial) para evaluarlarelación entreel volumen yel peso corporal encorderos yovejasPelibuey. Los autores observaron un coeficiente de correlación de 0.89 entre el volumen y el peso corporal. Además, se encontró que el modelo cuadrático tuvo el mejor desempeño, de acuerdo con la evaluación de idoneidad. Le Cozler et al(76) reportaron que el volumen corporal está fuertemente correlacionado con el peso en vacas Holstein lactantes.

Además de ser un método eficiente para estimar el peso corporal, las mediciones biométricas se utilizan para predecir los rasgos de la canal ovina(12,40,77). Determinar el rendimiento de la canal o los cortes principales antes del sacrificio es una información valiosa para los sistemas de producción, ya que permite al productor estimar el ingreso bruto de la granja. En este sentido, el uso de mediciones biométricas tomadas antes del

Rev Mex Cienc Pecu 2023;14(1):204-227 218

sacrificio es de mayor interés en condiciones de producción comercial debido al bajo costo adicional para los productores(40,78,79) .

Debido a que está directamente relacionado con la remuneración del productor, el peso de la canal ha sido la variable más predicha por las mediciones biométricas, con un peso al sacrificio que explica del 47.0 al 99.0 % de la variación en el peso de la canal de los rumiantes(79,80).Sin embargo, cuandolasmedicionesbiométricas seutilizanenasociación con el peso corporal en ecuaciones lineales y múltiples para predecir el peso de la canal, hay un aumento en el coeficiente de determinación(40). Al respecto, Gurgel et al(81) mostraron que las medidas de AP, CP y NG, junto con el peso corporal, explicaron el 91.0 % de la variación en el peso de la canal de corderos Santa Inés finalizados en pastizalestropicales.Para los corderosPelibuey, Bautista-Díaz et al(78) recomendaronuna ecuación para estimar el peso de la canal que se asocia con las medidas de LC, CC y CA y el ancho abdominal (R2= 0.89). En la predicción del peso de la canal caliente de corderos Morada Nova, Costa et al(12) recomendaron una ecuación sin utilizar el peso corporal como variable independiente. Según los autores, las medidas de LC, AC, AP, CA y las puntuaciones de condición corporal son las más importantes para predecir el peso de la canal de los ovinos estudiados (R2= 0.80).

La carne de ovino se vende principalmente en forma de medias canales o canales enteras. Sin embargo, una forma de añadir valor a la carne es vendiéndola a través de cortes obtenidos seccionando la canal(82). Así, la canal se divide inicialmente en los cortes principales de hombro, cuello, lomo, pierna y costilla, que son más pequeños y facilitan la comercialización, la conservación en el hogar y la preparación para consumo(3,82,83)

Las mediciones biométricas están altamente correlacionadas con los cortes principales de la canal(2). Por lo tanto, se desarrollaron estudios para evaluar la hipótesis de que las mediciones biométricas serían eficientes para predecir el rendimiento de estos cortes. Shehata(13) desarrolló modelos de regresión para predecir el peso de los cortes principales de la canal de corderos Barki a partir de mediciones biométricas y encontró que la CC explicaba el 67.0 % de la variación en el peso de la pierna, y cuando la CC se asoció con la LC, este valor aumentó a 72.0 %. Además, Shehata(13) observó que la CC y la LC estiman con precisión los pesos de los cortes de asado de lomo, hombro y lomo picado. Abdel-Moneim(84) señaló a la LC como una variable eficiente para predecir el peso del hombro de ovinos Barki.

La aplicación de mediciones biométricas no se limita a predecir el peso de la canal y los cortes principales. Cuandoseutilizanenecuaciones, estasmedicionesestimanlacantidad de grasa interna y recortes de la canal, el área del “ribeye” y el rendimiento de componentes que no son de la canal, músculos, huesos y tejido adiposo(12,40,77). Por lo tanto, el monitoreo de las mediciones biométricas es una herramienta de manejo que puede ayudar a los sistemas de producción a aumentar los ingresos y acortar el tiempo necesario para que los animales alcancen el peso de sacrificio.

Rev Mex Cienc Pecu 2023;14(1):204-227 219

Cabe destacar que, en su mayor parte, estas mediciones se realizan en animales finalizados en corrales de engorda y en ovinos de lana, lo que no representa la realidad de los sistemas de producción en las regiones tropicales, ya que las gramíneas forrajeras tropicales son la base alimenticia de pequeños y grandes rumiantes y son responsables de la mayor parte de la carne producida en los trópicos. Por lo tanto, se deben desarrollar estudios de modelación para estimar el peso y los rasgos de la canal de ovinos de pelo finalizadosenpastizalestropicalesatravésdemedicionesbiométricas,teniendoencuenta que el genotipo, el sexo, la edad, el sistema de cría y la salud pueden cambiar los rasgos y la composición de la canal(85,86)

Conclusiones e implicaciones

A pesar de su baja tasa de adopción, la modelación tiene un gran potencial para ayudar en la toma de decisiones en la producción de ovinos de carne. La modelación es una herramienta capaz de predecir la ingesta de materia seca, el peso corporal, el peso de la canal y los principales cortes comercializables de ovino con alta precisión y exactitud, a través de mediciones correlacionadas. Estas ecuaciones pueden ser utilizadas por investigadores, productores, técnicos y la industria cárnica, facilitando así la planeación de la actividad. Sin embargo, se justifica una mayor investigación para aumentar las bases de datos para que las ecuaciones se puedan aplicar en los escenarios más diversos. Además, se necesitan más estudios para predecir la ingesta de hierba utilizando información más fácil de obtener en condiciones prácticas de producción.

Literatura citada:

1. Trindade TFM, Difante GS, Emerenciano Neto JV, Fernandes LS, Araújo IMM, Véras ELL, et al Biometry and carcass characteristics of lambs supplemented in tropical grass pastures during the dry Season. Biosci J 2018;34(1):172-179.

2. Gurgel ALC, Difante GS, Emerenciano Neto JV, Costa MG, Dantas JLS, et al. Supplementation of lamb ewes with different protein sources in deferred marandu palisadegrass (Brachiaria brizantha cv.Marandu)pasture. ArqBrasMedVet Zootec 2020;72(5):1901-1910.

3. Araújo CGF, Costa MG, Difante GS, Emerenciano Neto JV, Gurgel ALC, et al Carcass characteristics, meat qualityand composition of lambs finished in cultivated pastures. Food Sci Technol 2021; Ahead of Print: 1-6.

4. Hermuche PM, Maranhão RLA, Guimarães RF, Carvalho Júnior OA, Gomes RAT, PaivaSR,McmanusC.DynamicsofsheepproductioninBrazil. IntJGeoinformatics 2013;2(3):665-679.

5. Nadal-Roiga E, Plà-Aragonèsa EM, Pagès-Bernausa A, Albornoz VM. A two-stage stochastic model for pig production planning in vertically integrated production systems. Comput Electron Agric 2021;176:e105615.

Rev Mex Cienc Pecu 2023;14(1):204-227 220

Pecu 2023;14(1):204-227

6. Calvano MPCA, Brumatti RC, Barros JC, Garcia MV, Martins KR, Andreotti R. Bioeconomic simulation of Rhipicephalus microplus infestation in different beef cattle production systems in the Brazilian Cerrado. Agric Syst 2021;194:e103247, 2021.

7. Calvano MPCA, Brumatti RC, Garcia MV, Barros JC, Andreotti A. Economic efficiency of Rhipicephalus microplus control and effect on beef cattle performance in the Brazilian Cerrado. Exp Appl Acarol 2019;79:459-471.

8. Tedeschi LO, Menendez HM. Mathematical modeling in animal production. In: Bazer FW, Lamb GC, Wu G editors. Animal agriculture sustainability, challenges and innovations. 1rst ed. Cambridge: Academic Press; 2020:431-453.

9. Gurgel ALC, Difante GS, Emerenciano NJV, Santana JCS, Fernandes PB, Santos GT, et al. Prediction of dry matter intake by meat sheep on tropical pastures. Trop Anim Health Prod 2021;53:e479.

10. Silva FL, Alencar MM, Freitas AR, Packer IU, Mourão GB. Curvas de crescimento em vacas de corte de diferentes tipos biológicos. Pesqui Agropecu Bras 2011;46(3):262-271.

11. Sousa JER, Façanha DAE, Bermejo LA, Ferreira JB, Paiva RDM, Nunes SF, Souza MSM. Evaluation of non-linear models for growth curve in Brazilian tropical goats. Trop Anim Health Prod 2021;53:e198.

12. Costa RG, Lima AGVDO, Ribeiro NL, Medeiros AND, Medeiros GRD, Gonzaga Neto S, Oliveira RL. Predicting the carcass characteristics of Morada Nova lambs using biometric measurements. Rev Bras Zootec 2020;49:e20190179.

13. Shehata MF. Prediction of live body weight and carcass traits by some live body measurements in Barki lambs. Egyptian J Anim Prod 2013;50(2):69-75.

14. Hamilton MA. Model validation: an annotated bibliography. Commun Stat - Theory Methods1991;20(7):2207-2266.

15. Pool R. Is it real, or is it Cray?. Science 1989;244(4811):1438-1440.

16. Devi S, Mishra RP. A mathematical model to see the effects of increasing environmental temperature on plant–pollinator interactions. Modelo Earth Syst Environ 2020;6:1315-1329.

17. Mandal S, Islam MS, Biswas MHA, Akter S. A mathematical model applied to investigatethepotentialimpact ofglobal warmingonmarineecosystems. Appl Math Model 2022;101:19-37.

18. Dover DC, Kirwin EM, Hernandez-Ceron N, Nelson KA. Pandemic Risk Assessment Model (PRAM): a mathematical modeling approach to pandemic influenza planning. Epidemiol Infect 2016;144:3400-3411.

Rev Mex Cienc
221

19. Waters SL, Schumacher LJ, Haj AJE. Regenerative medicine meets mathematical modelling: developing symbiotic relationships. Regen Med 2021;6:e24.

20. Brandt AR.Reviewofmathematicalmodelsoffutureoilsupply:Historical overview and synthesizing critique. Energy 2010;35:3958-3974.

21. Madadelahi M, Acosta-Soto LF, Hosseini S, Martinez-Chapa SO, Madou MJ. Mathematical modeling and computational analysis of centrifugal microfluidic platforms: a review. Lab Chip 2020;20:1318-1357.

22. Yu PY, Craciun G. Mathematical analysis of chemical reaction systems. Isr J Chem 2018;58:733-741.

23. Shamsi M, Mohammadi A, Manshadia MKD, Sanati-Nezhad, A. Mathematical and computational modeling of nano-engineered drug delivery systems. J Control Release 2019;307:150-165.

24. Eriksson K. The accuracy of mathematical models of justice evaluations. J Math Sociol 2012;36:125-135.

25. Tedeschi LO.Assessment oftheadequacyofmathematical models. AgricSyst 2006; 89:225-247.

26. Zanetti D, Prados LF, Menezes ACB, Silva BC, Pacheco MVC, Silva FAZ, et al. Prediction of water intake to Bos indicus beef cattle raised under tropical conditions. J Anim Sci 2019;97:1364-1374.

27. Richards FJ. A flexible growth function for empirical use. J Exp Bot. 1959;10:290301.

28. Fernandes HJ, Tedeschi LO, PaulinoMF, Detmann E,Paiva LS,Valadares SC,Silva AG, Azevêdo JAG. Evaluation of mathematical models to describe growth of grazing young bulls. Rev Bras Zootec 2012;41:367-373.

29. Leite RG, Cardoso AS, Fonseca NVB, Silva MLC, Tedeschi LO, Delevatti LM, et al. Effects of nitrogen fertilization on protein and carbohydrate fractions of Marandu palisadegrass. Sci Rep 2021;11:e14786.

30. Brunetti HB, Boote KJ, Santos PM, Pezzopane JRM, Pedreira CGS, Lara MAS, et al Improving the CROPGRO Perennial Forage Model for simulating growth and biomass partitioning of guineagrass. Agron J 2021;113:1-16.

31. NRC. National Research Council. Nutrient requirements of small ruminants: sheep, goats, cervids and new world camelids. Washington, DC, USA: National Academy Press; 2007.

32. Oreskes N, Shrader-Frechette K, Belitz K. Verification, validation, and confirmation of numerical models in the earth sciences. Science 1996;263:641-646.

Rev Mex Cienc
222
Pecu 2023;14(1):204-227

Pecu 2023;14(1):204-227

33. Neter J, Kutner MH, Nachtsheim CJ, Wasserman W. Applied linear statistical models. New York, USA: McGraw-Hill Publishing Co.; 1996.

34. Agresti, A. Categorical data analysis. New Jersey, USA: John Wiley & Sons. 2002.

35. Dent JB, Blackie MJ. Systems simulation in agriculture. London: Applied Science; 1979.

36. Mayer DG, Stuart MA, Swain AJ. Regression of real-world data on model output: an appropriate overall test of validity. Agric Syst 1994;45:93-104.

37. Analla M. Model validation through the linear regression fit to actual versus predicted values. Agric Syst 1998;57:115-119.

38. Bunke O, Droge B. Estimators of the mean squared error of prediction in linear regression. Technometrics 1984;26:145-155.

39. Morais MG, Menezes BB, Ribeiro CB, Walker CC, Fernandes HJ, Souza ARDL, et al. Models predict the proportion of bone, muscle, and fat in ewe lamb carcasses from in vivo measurements of the 9th to 11th rib section and of the 12th rib. Semin Cienc Agrar 2016;37:1081-1090.

40. Bautista-Díaz E, Mezo-Solis JA, Herrera-Camacho J, Cruz-Hernández A, GomezVazquez A, Tedeschi LO, et al. Prediction of carcass traits of hair sheep lambs using body measurements. Animal 2020;10:e1276.

41. King TS, Chinchilli VM. A generalized concordance correlation coefficient for continuous and categorical data. Stat Med 2001;20:2131-2147.

42. Cabral LS, Neves EMO, Zervoudakis JT, Abreu JG, Rodrigues RC, Souza AL, Oliveira IS. Nutrients requirements estimative for sheep in Brazilian conditions. Rev Bras Saúde Prod Anim 2008;9:529-542.

43. Vieira PAS, Pereira LGR, Azevêdo JAG, Neves ALA, Chizzotti ML, Santos RD, et al. Development ofmathematical models to predictdrymatterintakein feedlot Santa Ines rams. Small Ruminant Res 2013;122:78-84.

44. Allen MS. Effects of diet on short-term regulation of feed intake by lactating dairy cattle. J Dairy Sci 2000;83:1598-1624.

45. Oliveira AP, Pereira ES, Pinto AP, Silva AMA, Carneiro MSS, Mizubuti IY, et al Estimativas dos requisitos nutricionais e utilização do modelo Small Ruminant Nutrition System para ovinos deslanados em condições semiáridas. Semin Cienc Agrar 2014;35:1985-1998.

46. Romera AJ, Gregorini P, Beukes PC. Technical note: a simple model to estimate changes in dietary composition of strip-grazed cattle during progressive pasture defoliation. J Dairy Sci 2010;93:3074-3078.

Rev Mex Cienc
223

Pecu 2023;14(1):204-227

47. McDowell LR. Nutrient requirements of ruminants. In: McDowell LR. Nutrition of grazing ruminants in warm climates. Cambridge: Academic Press 1985:21-36.

48. Mertens DR. Regulation of forage intake. In: Fahey Junior GC. Forage quality, evaluation and utilization. Am Soc Agron 1994:450-492.

49. Carvalho PCF. Harry Stobbs Memorial Lecture: Can grazing behavior support innovations in grassland management?. Trop Grassl-Forrages 2013;1:137-155.

50. Baumont R, Cohen-Salmão D, Prache S, Sauvant D. A mechanistic model of intake and grazing behaviour in sheep integrating sward architecture and animal decisions. Anim Feed Sci Technol 2004;112:5-28.

51. Bremm C, Carvalho PC, Fonseca L, Amaral GA, Mezzalira JC, Perez NB, et al. Diet switching by mammalian herbivores in response to exotic grass invasion. Plos One 2016;11:e0150167.

52. Gonçalves RP, Bremm C, Moojen FG, Marchi D, Zubricki G, Caetano LAM, et al Grazing down process: The implications of sheep's ingestive behavior for sward management. Livest Sci 2018;214:202-208.

53. Hodgson J. Grazing management. Science into practice. Longman Group UK Ltd., 1990.

54. Guzatti GC, Duchini PG, Sbrissia AF, Mezzalira JC, Almeida JGR, Carvalho PCF, Ribeiro-Filho HMN. Changes in the short-term intake rate of herbage by heifers grazing annual grasses throughout the growing season. Grassl Sci 2017;63:255-264.

55. Gregorini P, Beukes PC, Romera AJG, Hanigan MD. A model of diurnal grazing patterns and herbage intake of a dairy cow, MINDY: Model description. Ecol Model 2013;270:11-29.

56. Pittroff W, Kothmann MM. Quantitative prediction of feed intake in ruminants: I. Conceptual and mathematical analysis of models for sheep. Livest Prod Sci 2001;71:131-150.

57. Freer M, Moore AD, Donnelly JR. GRAZPLAN: Decision support systems for Australian grazing enterprises II. The animal biology model for feed intake, production and reproduction and the Graz Feed DSS Agric Syst 1997;54:77-126.

58. Leal ES, Ítavo LCV, Valle CB, Ítavo CCBF, Dias AM, Difante GS, et al Influence of protodioscin content on digestibility and in vitro degradation kinetics in Urochloa brizantha cultivars. Crop Pasture Sci 2020;72:278-284.

59. Ítavo LCV, Ítavo CCBF, Valle CB, Dias AM, Difante GS, Morais MG, et al Brachiaria grasses in vitro digestibility with bovine and ovine ruminal liquid as inoculum. Rev Mex Cienc Pecu 2021;12:1045-11060.

Rev Mex Cienc
224

Pecu 2023;14(1):204-227

60. Euclides VPB, Montagner DB, Araújo AR, Pereira MA, Difante GS, Araújo IMM, et al. Biological and economic responses to increasing nitrogen rates in Mombaça guinea grass pastures. Sci Rep 2022;12:1937.

61. Mccall DG. A systems approach to research planning to North Island hill country. [Doctoral thesis]. New Zealand, DF: Massey University; 1984.

62. Medeiros HR. Avaliação de modelos matemáticos desenvolvidos para auxiliar a tomada de decisão em sistemas de produção de ruminantes em pastagens. [Doctoral thesis]. Brazil, SP: Universidade de São Paulo; 2003.

63. Gurgel ALC, Difante GS, Emerenciano NJV, Fernandes HJ, Itavo LCV, Itavo CCBF, et al Evaluation of mathematical models to describe lamb growth during the pre-weaning phase. Semin Cienc Agrar 2021;42:2119-2126.

64. Conrado VDC, Arandas JKG, Ribeiro MN. Modelos de regressão para predição do peso da raça Canindé através de medidas morfométricas. Arch Zootec 2015;64:277280.

65. Chay-Canul AJ, García-Herrera RA, Salazar-Cuytún R, Ojeda-Robertos NF, CruzHernández A, Fonseca MA, Canul-Solís JR. Development and evaluation of equations to predict body weight of Pelibuey ewes using heart girth. Rev Mex Cienc Pecu 2019;10:767-777.

66. Canul-Solis J, Angeles-Hernández JC, García-Herrera RA, Razo-Rodríguez D, LeeRangleHA,Piñeiro-Vázquez AT, et al Estimationofbodyweight in hairewes using an indirect measurement method. Trop Anim Health Prod 2020;52:2341-2347.

67. Salazar-Cuytun R, Garcia-Herrera RA, Munoz-Benitez AL, Ptacek M, PortilloSalgado R, Bello-Perez EV, Chay-Canul AJ. Relationship between bodyvolume and body weight in Pelibuey ewes. Trop Subtrop Agroecosyst 2021;24:e125.

68. Málková A, Ptáček M, Chay-Canul A, Stádník L. Statistical models for estimating lamb birth weight using body measurements. Ital J Anim Sci 2021;20:1063-1068.

69. Gurgel ALC, Difante GS, Emerenciano NJV, Santana JCS, Dantas JLS, Roberto FFS, et al. Use of biometrics in the prediction of body weight in crossbred lambs. Arq Bras Med Vet Zootec 2021;73:261-264.

70. Oliveira DP, Oliveira CAL, Martins ENM, Vargas Junior FM, Barbosa-Ferreira M, Seno LO, et al Morphostructural characterization of female and young male of naturalized Sul-mato-grossenses “Pantaneiros” sheep. Semin Cienc Agrar 2014;35: 73-986.

71. Kumar S, Dahiya SP, Malik ZS, Patil CS. Prediction of body weight from linear body measurements in sheep. Indian J Anim Res 2018;52:1263-1266.

Rev
225
Mex Cienc

72. Huma ZE, Iqbal F. Predicting the body weight of Balochi sheep using a machine learning approach. Turk J Vet Anim Sci 2019;43:500-506.

73. Worku A. Body weight had highest correlation coefficient with heart girth around the chest under the same farmers feeding conditions for Arsi Bale sheep. Int J Food Sci Technol 2019;5:6-12.

74. Grandis FA, Fernandes Junior F, Cunha LFC, Dias CBA, Ribeiro ELA, Constantino C, et al. Relação entre medidas biométricas e peso corporal em ovinos da raça Texel. Vet Zootec 2018;25:1-8.

75. Paputungan U, Hendrik MJ, Utiah W. Predicting live weight of Indonesian LocalBali cattle using body volume formula. Livest Res Rural Dev 2018;30:8

76. Le Cozler Y, Allain C, Xavier C, Depuille L, Caillot A, Delouard JM, et al. Volume and surface area of Holstein dairy cows calculated from complete 3D shapes acquired using a high-precision scanning system: Interest for body weight estimation. Comput Electron Agric 2019;165:e104977.

77. Gomes MB, Neves MLMW, Barreto LMG, Ferreira MA, Monnerat JPIS, Carone GM, Morais JSASC. Prediction of carcass composition through measurements in vivo and measurements of the carcass of growing Santa Inês sheep. Plos One 2021;16:1-17.

78. Bautista-Díaz E, Salazar-Cuytun R, Chay-Canul AJ, Herrera RAG, Piñeiro-Vázquez ÁT, Monforte JGM, et al Determination of carcass traits in Pelibuey ewes using biometric measurements. Small Ruminant Res 2017;147:115-119.

79. Alves AAC, Pinzon AC, Costa RM, Silva MSS, Vieira EHM, Mendonça IB, et al. Multiple regression and machine learning based methods for carcass traits and saleable meat cuts prediction using non-invasive in vivo measurements in commercial lambs. Small Ruminant Res 2019;171:49-56.

80. Castilhos AM, Francisco CL, Branco RH, Bonilha SFM, Mercadante MEZ, Meirelles PRL, et al. In vivo ultrasound and biometric measurements predict the empty body chemical composition in Nellore. J Anim Sci 2018;96:1678-1687.

81. Gurgel ALC, Difante GS, Emerenciano Neto JV, Araujo CGF, Costa MG, Itavo LCV, et al Prediction of carcass traits of Santa Inês lambs finished in tropical pastures through biometric measurements. Animal 2021;11:e2329.

82. Costa RG, Ribeiro NL, Cavalcante ITR, Roberto FFS, Lima PR. Carne de caprinos e ovinos do Nordeste: Diferenciação e agregação de valor. Rev Cient Prod Anim 2019;21:25-33.

83. Oliveira JPF, Ferreira MA, Alves AMSV, Melo ACC, Andrade IB, Urbano SA, et al Carcass characteristics of lambs fed spineless cactus as a replacement for sugarcane. Asian Australas J Anim Sci 2018;31:529-536.

Rev Mex Cienc
226
Pecu 2023;14(1):204-227

84. Abdel-Moneim AY. Body and carcass characteristics of Ossimi, Barki and Rahmani ram lambs raised under intensive production system. Egypt J Sheep Goats Sci 2009;4:1-16.

85. Ekiz B, Yilmaz A, Ozcan M, Kocak O. Effect of production system on carcass measurements and meat quality of Kivircik lambs. Meat Sci 2012;90:465-471.

86. Hopkins DL, Mortimer SI. Effect of genotype, gender and age on sheep meat quality and a case study illustrating integration of knowledge. Meat Sci 2014;98:544-555.

Rev Mex Cienc Pecu 2023;14(1):204-227 227

https://doi.org/10.22319/rmcp.v14i1.5123

Nota de investigación

Preferencia de ocho plantas por Odocoileus virginianus en cautiverio

Hannia Yaret Cueyactle-Cano a

Ricardo Serna-Lagunes a*

Norma Mora-Collado a

Pedro Zetina-Córdoba b

Gerardo Benjamín Torres-Cantú a

aUniversidadVeracruzana.FacultaddeCienciasBiológicas yAgropecuariasregiónOrizabaCórdoba, Calle Josefa Ortiz de Domínguez s/n Peñuela. Amatlán de Los Reyes, Veracruz, México.

b Universidad Politécnica de Huatusco. México.

*Autor de correspondencia: rserna@uv.mx

Resumen:

En vida libre, Odocoileus virginianus consume plantas con alto beneficio energético, pero en cautiverio, no se cuenta con una alimentación diversa que aumente su capacitad productiva. El objetivo fue evaluar el consumo y preferencia de ocho plantas por un grupo de venados en cautiverio con base en una prueba de cafetería. El experimento se desarrolló durante cinco días consecutivos con tres repeticiones, con un descanso de 15 días entre repetición, y consistió en ofrecer 1 kg de material vegetal de cada planta, se registró su consumo y se evaluó con un análisis de varianza y una prueba de Tukey; además, de cada planta, se estimaron sus características fisicoquímicas y bromatológicas y se relacionaron con el consumo mediante un análisis de regresión por mínimos cuadrados parciales. El consumo fue significativamente mayor en cuatro plantas: Zapoteca acuelata, Bidens pilosa, Pennisetum purpureum y Parthenium hysterophorus ysu preferenciaestuvo determinadapor el contenido de fibra, proteína, °Brix y pH. Diversificar la alimentación de los venados en

228

Unidades de Manejo para la Conservación de la Vida Silvestre (UMA) podría incrementar su productividad

Palabras clave: Análisis bromatológico, Dieta, Cervidae, Consumo.

Recibido: 23/10/2019

Aceptado: 20/08/2021

En el Continente Americano, el venado cola blanca (Odocoileus virginianus; Artiodactyla: Cervidae), se distribuye en bosques prístinos canadienses, bosques de coníferas, bosques xerófilos en EE U.U., en la mayoría de los bosques en México y parte de Sudamérica(1) En México,estaespecietienevalor cinegético(2) ysu aprovechamiento sedesarrolla enUnidades de Manejo para la Conservación de la Vida Silvestre (UMA) como trofeo, carne, piel, pie de cría, ornamenta, entre otros subproductos(3) .

En vida silvestre, O. virginianus forrajea una diversidad de partes de plantas como brotes, frutos, hojas, corteza y semillas y fracciones vegetales de la planta con alto valor nutricional; esto le confiere al venado un comportamiento de herbívoro seleccionador oportunista(4); en bosques tropicales caducifolios, O. virginianus se enfrenta a la estación de secas, cuando disminuye la abundancia de plantas y merma su calidad nutricional(5); provocando deficiencias en su desarrollo como un peso menor al estándar, propensos a enfermedades y limitando su reproducción(4) . En cautiverio, la alimentación de O. virginianus está basada en alimento para ovinos, alimento comercial para venado y alfalfa(6); en consecuencia, se obtienen partos sencillos en lugar de gemelares, las crías presentan bajo peso al nacer, con periodos entre partos más prolongados(7) .

Los venados adultos requieren de 5.5 a 9 % de proteína cruda para un adecuado desarrollo fisiológico(8,9) y puede estar relacionado con la ontogenia(9) , ya que cervatos en cautiverio requieren entre el 13 y 20 % de proteína para un adecuado crecimiento; mientras que, para el óptimo desarrollo de astas requieren entre el 15 a 18 % de proteína(9) Para el pre-empadre, empadre, gestación, lactancia e incrementar el número de crías, las hembras requieren entre el 11 y 18 % de proteína(10) Estudiar las opciones para diversificar la alimentación de O. virginianus en UMA, es imperante para complementar su nutrición y mejorar las características productivas de los venados(11). Si se relaciona la preferencia alimenticia de plantas, la cantidad de nutrientes contenidos en ellas y los requerimientos de un animal de peso determinado, se puede estimar su comportamiento productivo(11)

Rev Mex Cienc Pecu 2023;14(1):228-236 229

El contenidonutricionaldelas plantas queconsumen los venados en vidalibresehaestimado con diversas metodologías(12,13), pero en venados en cautiverio, no ha sido evaluado. Las pruebas de cafetería permiten cuantificar y entender cómo los animales modifican su comportamiento en la ingesta de plantas para equilibrar su necesidad nutricional, pues el consumo de una o varias plantas por el venado, permite corroborar su preferencia nutricional ante una amplia selección de plantas ofrecidas(14) En este sentido, el objetivo del estudio fue determinar la preferencia de O. virginianus en cautiverio sobre ocho plantas dispuestas con base en una prueba de cafetería

Este estudio se realizó en la UMA “El Pochote” (registro Secretaría de Medio Ambiente y Recursos Naturales: UMA-IN-CR-0122-VER/og), ubicada en el municipio de Ixtaczoquitlán, Veracruz, México (coordenadas: 18°52´13.70” N y97° 02’ 59.97” O, a 1,137 msnm), donde predomina un clima semicálido húmedo (Cwa) con abundantes lluvias en verano, temperatura anual que oscila entre los 18 a 24 °C y con precipitación media anual de 1,900 a 2,600 mm y cuenta con relictos de bosque tropical subperennifolio y vegetación secundaria alrededor de la UMA.

En el experimento se utilizaron tres venados machos ytres hembras de dos años, sanos y con condiciones corporales similares. Durante cinco días consecutivos a las 0900, en comederos independientes distribuidos al azar dentro del corral, se les proporcionó 1 kg de material fresco (hojas, brotes y ramas verdes) de cada una de las ocho plantas seleccionadas (Cuadro 1). Este procedimiento se repitió en tres ocasiones, dejando 15 días de descanso entre repetición; para disminuir la subjetividad de los venados, ya que tienden a repetir comportamientos; cada día, se cambió la posición de los comederos con las plantas. Al paso de 2 h, los comederos y el material vegetal sobrante fue retirado del corral y se cuantificó el consumo con la ecuación: Consumo= gramos de material ofrecido – gramos de material rechazo. En resumen, la evaluación de la preferencia se realizó por 15 días de evaluación (3 repeticiones de 5 días), con 45 días de intervalo entre las tres repeticiones, lo que resulta una evaluación real de 60 días.

Rev Mex Cienc Pecu 2023;14(1):228-236 230

Cuadro 1: Descripción del consumo de ocho plantas por venado cola blanca O. virginianus en cautiverio

Especie Media Desviación estándar Error estándar Coeficiente de variación Mínimo Máximo

Bidens pilosa 999.6 0.69 0.4 0.07 998.8 1000

Bursera simaruba 516 112.93 65.2 21.89 393 615

Fetusca sp 594.4 44.39 25.63 7.47 559 644.2

Pennisetum purpureum 975.67 23.86 13.78 2.45 949 995 Phartenium hysterophorus 966.27 33.00 19.05 3.45 928.8 991 Saccharum officinarum 797.47 10.71 6.18 1.34 787 808 Vachelia farnesiana 616.4 43.99 25.4 7.14 587.2 667

Zapoteca acuelata 1000 0 0 0 1000 1000

Se tomaron tres muestras de 100 g de material mezclado de cada planta y se incineraron durante2h a600°C.Seestimó el contenido demateriaorgánica, cenizas,°Brix,pH yacidez; la proteína cruda se obtuvo por el método de Kjeldahl (N x 6.25) y extracto etéreo en un extractor Soxhtel(15) . Los datos del consumo, del análisis bromatológico y los fisicoquímicos se analizaron con estadística descriptiva y de tendencia central. Un análisis de varianza (ANOVA) y una prueba de medias con Tukey (α=0.05) fue aplicada para determinar cuál de las ocho plantas presentó mayor consumo por los venados. Finalmente, se aplicó un análisis de regresión por mínimos cuadrados parciales (PLS), donde la variable dependiente fue el consumo de cada planta, las variables categóricas fueron las ocho plantas ofrecidas y las variables predictoras fueron las características bromatológicas y fisicoquímicas de cada planta. Estos análisis se realizaron con el software Infostat versión 2017.

Los valores del consumo promedio de las repeticiones de las plantas evaluadas se presentan en el Cuadro 1, de las cuales, Bursera simaruba presentó el mayor coeficiente de variación. El ANOVA indicó que cuatro plantas: Zapoteca aculeata (zapoteca), Bidens pilosa (amozoquelite) Parthenium hysterophorus (escobilla amarga) y Pennisetum purpureum (zacate gigante) presentaron un consumo significativamente mayor (coeficiente de correlación: R²= 0.96, coeficiente de variación: CV= 5.94; P<0.05; Cuadro 2), que superó estadísticamente en el consumo de las demás plantas evaluadas (Tukey: diferencia mínima significativa = 135.68 g, Error= 2204.01, gl= 16; Figura 1), esto es consistente con los coeficientesdevariación, yaquesoloalgunasplantastuvieronmayorpreferenciadeconsumo por los venados Las características bromatológicas y fisicoquímicas de las plantas se

Rev Mex Cienc Pecu 2023;14(1):228-236 231

presentan en el Cuadro 3, presentando variaciones debido a los valores registrados en la proteína, fibra y °brix. El análisis de regresión por mínimos cuadrados parciales (PLS) explicó el 61.7 % de la correlación entre la preferencia de consumo de las plantas V. farnesiana, B. pilosa, Z. acuelata y S. officinarum, lo cual está relacionado a su contenido de fibra, proteína y °Brix (Figura 2).

Cuadro 2: Resultados del ANOVA sobre consumo de plantas silvestres por O. virginianus

Fuente de variación Suma de cuadrados Grados de libertad Cuadrado medio F P-valor Especie de planta 883335.23 7 126190.75 54.77 <0.0001 Error 36864.08 16 2304.01 Total 920199.31 23

Figura 1: Resultados de la prueba de medias de Tukey, para determinar la(s) especie(s) de plantas de mayor consumo por O. virginianus

Rev Mex Cienc Pecu
232
2023;14(1):228-236

Cuadro 3: Características bromatológicas y fisicoquímicas promedio de las plantas consumidas por O. virginianus

Especie de planta Humedad (%) Proteína (%) Grasa (%) Fibra (%) Cenizas (%) pH Brix (°) Acidez

Bidens pilosa 48.937 18.15 4.728 23.94 1.505 5.5 7.8 0.224

Bursera simaruba 58.437 8.88 3.484 6.03 1.902 5.3 2.7 0.352 Phartenium hysterophorus 63.174 16.02 6.475 39.04 2.202 6.0 2.4 0.032

Saccharum officinarum 63.510 11.19 4.555 17.03 1.164 4.6 6.8 0.256 Vachellia farnesiana 48.016 18.1 0.474 29.04 2.245 5.0 4.5 0.192

Pennisetum purpureum 48.795 14.1 3.011 46.4 2.438 6.0 3.1 0.032

Zapoteca aculeata 41.771 20.5 5.224 22.06 0.352 4.5 9.3 0.64

Festuca sp. 32.375 15.02 6.873 48.02 1.432 4.3 7.8 0.16

Figura 2: Relación de caracteres bromatológicos y fisicoquímicos de las plantas consumidas por O. virginianus

Rev Mex Cienc Pecu 2023;14(1):228-236 233

En este estudio, los venados consumieron en mayor cantidad a dos plantas de porte herbáceo y una gramínea; venados en vida silvestre consumen mayormente arbustivas y arbóreas, el consumo de herbáceas varía en función de la estación del año y las gramíneas las consumen en menor proporción durante todo el año(16); también prefieren especies arbustivas todo el año y las herbáceas sólo en la época de lluvia(17) . El consumo voluntario de una variedad de plantas de porte arbustivo, herbáceo y gramíneas reflejó la necesidad nutricional de los venados(18,19), ya que estos consumieron aquellas plantas con mejores características bromatológicas y fisicoquímicas(20) , como carbohidratos (°Brix) y fibra, ambas importantes en proceso de digestibilidad(21)

En venados, se requieren niveles de proteína del 15 %(21) en machos y del 13 % en hembras para alcanzar el peso superior al promedio(22). En machos jóvenes, se requiere entre el 13 a 16 % de proteína para un crecimiento óptimo y con un 20 % de proteína se potencializa su actividad reproductiva(22) . En este estudio, las plantas cubrieron las necesidades de proteína requeridaporlosvenados deacuerdoconsuontogenia,porloquediversificarlaalimentación mejoraría algunos indicadores productivos.

Las plantas Z. aculeata, B. pilosa, P. purpureum, P. hysterophorus y S. officinarum fueron preferidas por O. virginianus, esto amplía las opciones para diversificar la alimentación de este cérvido en UMA. Diversificar la alimentación en venados con plantas con diferente composición bromatológicas y fisicoquímicas, tiene implicaciones en el comportamiento productivo y reproductivo de los venados.

Agradecimientos

Al proyecto “Caracterización de recursos zoogenéticos de las altas montañas, Veracruz: aplicación de la filogeografía y modelación ecológica (PRODEP: 511-6/18-9245/PTC-896) por el financiamiento. A María del Rosario Dávila, por la ayuda en el desarrollo del análisis bromatológico y fisicoquímico.

Literatura citada:

1. Ortega S, Mandujano S, Villarreal J, Di Mare MI, López-Arévalo H, Molina M, CorreaViana M. Managing White-tailed deer: Latín América. In: Hewitt DG editor. Biology and management of White-tailed deer. Boca Ratón, Fl, USA: CRC Press. 2011:565-585.

2. Mandujano S, Delfín-Alfonso CA, Gallina S. Comparison of geographic distribution models of white-tailed deer Odocoileus virginianus (Zimmermann, 1780) subspecies in Mexico: biological and management implications. Therya 2010;1:41-68.

Rev Mex Cienc Pecu 2023;14(1):228-236 234

3. Gallina S, Mandujano S, Bello J, López-Fernández H, Weber M. White-tailed deer Odocoileus virginianus (Zimmermann, 1780). In: Barbanti DJM, González S editors. Neotropical Cervidology: Biology and Medicine of Latin American Deer. FUNEP/IUCN. 2009:101-118.

4. Ramírez-Lozano RG. Nutrición del venado cola blanca. Universidad Autónoma de Nuevo León. Monterrey, Nuevo León, México. 2004.

5. Arceo G, Mandujano S, Gallina S, Pérez-Jiménez LA. Diet diversity of white-tailed deer (Odocoileus virginianus) in a tropical dry forest in México. Mamm 2005;69:159-168.

6. Fulbright TE, Ortega-Santos JA. Ecología y manejo de venado cola blanca. Texas A&M University Press. 2007.

7. Henke SE, Demaris S, Pfister JA. Digestive capacity and diets of White-tailed deer and exotic ruminants. J Wild Management 1998;52:595-598.

8. Holter JB, Hayes HH, Smith SH. Protein requirement of yearling white-tailed deer. J Wild Management 1979;1979:872-879.

9.SmithSH,HolderJB, HayesHH,SilverH.Proteinrequirementsofwhitetaileddeerfawns. J Wild Management 1975;39:582-589.

10. Jones PD, Strickland BK, Demarais S, Wang G, Dacus DC. Nutrition and ontogeny influence weapon development in a long-lived mammal. Canad J Zool 2018;99:1-8.

11. Plata FX, Ebergeny S, Resendiz JL, Villarreal O, Bárcena R, Viccon JA, Mendoza GD. Palatabilidad y composición química de alimentos consumidos en cautiverio por el venado cola blanca de Yucatán (Odocoileus virginianus yucatanensis). Archiv Med Vet 2009;41:123-129.

12. Miller R, Kaneene JB, Fitzgerald SD, Schmitt SM. Evaluation of the influence of supplemental feeding of white-tailed deer (Odocoileus virginianus) on the prevalence of bovine tuberculosis in the Michigan wild deer population. J Wild Dis 2003;39:84-95.

13. Champagne E, Moore BD, Côté SD, Tremblay JP. Spatial correlations between browsing on balsam fir by white‐tailed deer and the nutritional value of neighboringwinter forage. Ecol Evol 2018;8(5):2812-2823.

14. Hartley A, Jones GE. Process oriented supplier development: building the capability for change. Inter J Purch Mat Management 1997;33:24-29.

15. AOAC. Official Methods of Analysis. Association of Official Analytical Chemists. 15th ed. Washington, DC, USA. 1990.

Rev Mex Cienc
235
Pecu 2023;14(1):228-236

16. Gallina S. White-tailed deer and cattle diets in La Michilia, Durango, Mexico. J Range Management 1993;46:487-492.

17. Granados D, Tarango L, Olmos G, Palacio J, Clemente F, Mendoza G. Dieta y disponibilidad de forraje del venado cola blanca Odocoileus virginianus thomasi (Artiodactyla: Cervidae) en un campo experimental de Campeche, México. Rev Biol Trop 2014;62:699-710.

18. Ramírez GR, Quintanilla JB, Aranda J. White-tailed deer food habits in northeastern Mexico. Small Ruminant Res 1997;25:141-146.

19. López-Pérez E, Serrano-Aspeitia N, Aguilar-Valdés BC, Herrera-Corredor A. Composición nutricional de la dieta del venado cola blanca (Odocoileous virginianus ssp. mexicanus) en Pitzotlán, Morelos. Rev Chap serie Cienc Forest Amb 2012;18:219229.

20. Aguilera-Reyes U, Sánchez-Cordero V, Ramírez-Pulido J, Monroy-Vilchis O, GarcíaLópez GI, Janczur M. Hábitos alimentarios del venado cola blanca Odocoileus virginianus (Artiodactyla: Cervidae) en el Parque Natural Sierra Nanchititla, Estado de México. Rev Biol Trop 2013;61:243-253.

21. Clemente F, Riquelme E, Mendoza GD, Bárcena R, González S, Ricalde R. Digestibility of forage diets of white-tailed deer (Odocoileous virginianus, Hays) using different ruminal fluid inocula. J Appl Anim Res 2005;27:71-76.

22. Ullrey DE, Youatt WG, Johnson HE, Fay LD, Bradley BL. Protein requirement of whitetailed deer fawns. J Wild Management 1967;31:679-685.

Rev Mex Cienc
236
Pecu 2023;14(1):228-236

https://doi.org/10.22319/rmcp.v14i1.6225

Nota de investigación

Rendimiento y valor nutricional de brásicas forrajeras en comparación con forrajes tradicionales

David Guadalupe Reta Sánchez a*

Juan Isidro Sánchez Duarte b

Esmeralda Ochoa Martínez b

Ana Isabel González Cifuentes c

Arturo Reyes González b

Karla Rodríguez Hernández b

a Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Campo Experimental Delicias. Km. 2 Carretera Delicias-Rosales. 33000, Centro, Cd. Delicias, Chihuahua, México.

b INIFAP. Campo Experimental La Laguna. Matamoros, Coahuila, México.

c Universidad Juárez del Estado de Durango. Facultad de Agricultura y Zootecnia. Gómez Palacio, Durango, México.

*Autor de correspondencia: reta.david@inifap.gob.mx

Resumen:

El alto valor nutritivo de las brásicas puede incrementar la productividad en los sistemas de producción de forrajes tradicionales. El objetivo del estudio fue comparar el valor nutricional y el rendimiento de materia seca (MS) y nutrientes entre brásicas forrajeras y especies tradicionales de otoño-invierno Las brásicas forrajeras fueron Winfred, Hunter y rábano Graza ylos forrajestradicionales fueron avena,triticale,cebada,trigo yel trébol Alejandrino. El estudio se realizó en Matamoros, Coahuila, México en el ciclo 2018-2019, bajo un diseño experimentaldebloquescompletosalazarconcuatrorepeticiones.Sedeterminólacapacidad

237

de rebrote, la composición nutricional del forraje y los rendimientos de MS y nutrientes. Todas las especies presentaron capacidad de rebrote, con tres cortes en trébol Alejandrino en 154 días, y con dos cortes en brásicas (150-154 días) y cereales (133-144 días). Las brásicas presentaron similar composición nutricional al trébol Alejandrino y mejor al de los cereales, principalmente por su mayor contenido de energía neta para lactancia (ENL; 6.57 a 7.32 MJ kg-1 MS). Los rendimientos de MS de las brásicas fueron similares a los observados en los forrajes tradicionales; sin embargo, por su alta composición nutricional las brásicas fueron iguales o superiores en producción de proteína cruda (PC) (1,608 a 2,986 kg ha-1) y ENL (62,819 a 84,044 MJ ha-1) a los forrajes tradicionales. En general, las brásicas forrajeras pueden incrementar el rendimiento de nutrientes respecto a los cereales y al trébol Alejandrino, especialmente en la producción de ENL (27.5 a 47.3 %).

Palabras clave: Cultivos alternativos, Materia seca, Rebrote, Proteína cruda, Energía.

Recibido: 30/04/2022

Aceptado: 11/07/2022

La producción intensiva de leche de vaca es una de las principales actividades económicas en La Comarca Lagunera, México. El forraje requerido por el ganado se produce en un sistema de producción donde los principales cultivos son maíz, sorgo, alfalfa, avena y triticale. La producción de estos cultivos enfrenta problemas de escasez de agua, salinidad en elsuelo yelevadastemperaturas ambientales(1),condicionesqueseagravaránenlaspróximas décadas debido al cambio climático(2) . Esta situación obliga a buscar nuevas opciones de cultivos que permitan incrementar el valor nutricional y los rendimientos de materia seca y nutrientes. Una alternativa es incrementar la producción de forraje en otoño-invierno utilizando especies con capacidad de rebrote, y buenas características nutricionales y de producción.

En la Comarca Lagunera los cereales en otoño-invierno se producen con uno o dos cortes en las etapas de embuche o inicio de espigado, los cuales generalmente son ensilados. Las brásicas forrajeras que incluyen especies de canola, colza, nabos, colinabo, col y rábano son una alternativa viable para la región debido a su potencial de producción, calidad nutritiva, además de su capacidad de rebrote(3,4) y ensilaje de su forraje(5,6) Las brásicas producen de 8,000 a 15,000 kg ha-1 de materia seca (MS) en un período de 80 a 150 días después de la siembra (dds). Esto significa que sus rendimientos de MS pueden ser iguales o superiores a los cereales forrajeros de otoño-invierno(3,7) El principal beneficio de las brásicas es su capacidad de producir forraje con alto valor nutritivo durante un periodo relativamente largo, ya que con la edad no disminuye marcadamente el contenido de proteína cruda (PC) ni la

Rev Mex Cienc Pecu 2023;14(1):237-247 238

digestibilidad de la MS(8) . El contenido de PC en el forraje de brásicas varía de 134 a 255 g kg-1; la digestibilidad de la MS fluctúa de 85 a 93%(8,9); el contenido de fibra detergente neutra (FDN) alcanza valores de 199 a 516 g kg-1(9,10); y presenta altas concentraciones de energía (ENL) (1.79 a 1.87 Mcal kg-1 MS)(11) . En estudios realizados con vacas lecheras estabuladas, se indica que el forraje de brásicas puede ser usado en la dieta de vacas lecheras sin efectos en la producción y composición de leche(12,13). Otros estudios muestran efectos positivos del forraje de brásicas con incrementos en la producción de leche, sin efectos negativos en la salud de las vacas(14,15) Además, en estudios donde la inclusión de forraje de brásicas no afectó la producción y composición de leche, se observó un aumento en la rentabilidad cuando se reemplazaron ensilados de pastos y concentrados comerciales por brásicas forrajeras(15,16) También se reporta que el uso de forraje de brásicas tiene un efecto ambiental favorable, debido a la menor producción de metano respecto a rumiantes alimentados con dietas basadas en pastos(11,17) El objetivo del estudio fue comparar el valor nutricional y el rendimiento de materia seca (MS) y nutrientes entre brásicas forrajeras y especies tradicionales durante el ciclo de otoño-invierno.

El estudio se llevó a cabo en el Campo Experimental La Laguna (CELALA) del Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), localizado en Matamoros, Coahuila, México (103° 13’ 42’’ O y 25° 31’ 41’’ N, a una altura de 1,100 msnm). El suelo del sitio experimental es de textura franco arcillosa, con una profundidad mayor a 1.8 m, valores de disponibilidad de agua de 150 mm m-1(18), contenido de carbono orgánico de 0.75 % y un pH de 8.14(1). La preparación del terreno consistió en realizar un barbecho, doble rastreo y nivelación del terreno con láser. Antes de la siembra cada parcela experimental se fertilizó manualmente con sulfato de amonio y fosfato monoamónico granulares en dosis de 50 kg N y 80 kg P2O5, respectivamente.

La siembra se realizó en forma manual el 12 de octubre de 2018, en esta fecha también se aplicó el riego de siembra con una lámina de riego de 15 cm. Ocho días después de sembrar se aplicó un sobre riego con una lámina de 6 cm para facilitar la emergencia de plántulas. Las especies y cultivares evaluados fueron los siguientes: avena (Avena sativa L.), variedad Cuauhtémoc; triticale (x Triticosecale Wittmack), variedad Río Nazas; cebada (Hordeum vulgare L.), variedad Narro 95; trigo (Triticum aestivum L.), variedad AN265; trébol Alejandrino (Trifolium alexandrinum L.), variedad Multicut; brásica cultivar Winfred (Brassica oleracea L. x Brassica rapa L.); cultivar Hunter (Brassica rapa L. x Brassica napus L.) y rábano forrajero cultivar Graza (Raphanus sativus L. x Brassica oleracea L., Raphanus maritimus L.). Durante el ciclo de producción se aplicaron seis riegos de auxilio con una lámina total de 75 cm en avena, triticale, trigo, trébol, y brásica Hunter; mientras que, en cebada, brásica Winfred y rábano Graza se aplicaron cinco riegos de auxilio con una lámina de 63 cm. También se completó la dosis de fertilización nitrogenada (250 kg ha-1), con 55 kg ha-1 a los 33 dds, 90 kg ha-1 después del primer corte en cada especie entre los 77 y 112 dds, y 55 kg ha-1 antes del segundo corte entre los 112 y 135 dds.

Rev Mex Cienc Pecu 2023;14(1):237-247 239

Se utilizó un diseño experimental de bloques completos al azar con cuatro repeticiones. La parcela experimental fue de 20 surcos a 0.18 m de separación y 6 m de longitud. La parcela útil para determinar el rendimiento de forraje fue de 14.4 m2, cosechando 16 surcos centrales de 5 m de longitud. En la cosecha se determinaron los rendimientos de forraje fresco y de MS. El contenido de MS se obtuvo en una muestra al azar de 0.72 m2, muestreando dos de los surcos centrales de cada parcela de 2 m de longitud. Las plantas muestreadas se secaron a 60 °C en una estufa de aire forzado hasta alcanzar peso constante.

El rendimiento de MS se determinó multiplicando el rendimiento de forraje fresco por el contenido de MS de cada parcela. En los cereales se realizaron dos cosechas en la etapa de embuche; el trébol se cosechó en tres ocasiones en la etapa vegetativa, mientras que los cultivares de brásica yrábano se realizaron dos cosechas en la etapa vegetativa Se determinó semanalmente el índice de área foliar (IAF) en todas las parcelas del experimento. Para ello se utilizó un ceptómetro AccuPAR modelo Lp-80 PAR/LAI (Decagon Devices, Inc., Pullman, WA, USA). Se tomaron tres lecturas por parcela entre las 1200 y 1400 h tiempo solar. Se realizaron tres mediciones arriba y tres abajo del dosel, en forma paralela a la superficie del suelo. El sensor se colocó a un ángulo de 45° respecto a los surcos.

Las plantas muestreadas para la determinación del contenido de MS también se usaron para analizar el valor nutritivo del forraje. Las muestras secas se molieron en un molino Wiley® (Thomas Scientific, Swedesboro, NJ, USA) con una malla de 1 mm. El contenido de nitrógeno en cada muestra se determinó mediante el método de combustión Dumas número 990.03 de AOAC en el cual se utilizó el equipo Thermo Scientific Flash 2000, y el resultado se multiplicó por 6.5 para obtener el porcentaje de proteína cruda (PC)(19) . La fibra detergente neutra (FDN) y la fibra detergente ácida (FDA) se obtuvieron de acuerdo a Goering y Van Soest(20). El contenido de energía neta para lactancia (ENL) se estimó siguiendo la metodología propuesta por Weiss et al(21) . Los rendimientos de PC y ENL por hectárea se determinaron multiplicando los contenidos de PC y ENL por el rendimiento de MS por hectárea estimado para cada parcela experimental.

Para la evaluación de la capacidad de rebrote se analizaron los datos de rendimiento de MS e IAF por cosecha, utilizando el procedimiento MIXED para medidas repetidas de SAS (P≤0.05)(22) Para los rendimientos de MS, PC y ENL, los datos de las dos o tres cosechas en cada cultivo se sumaron para realizar el análisis estadístico. Para los datos del valor nutrimental del forraje, se obtuvo una media ponderada de cada parámetro evaluado en las cosechas realizadas, considerando los rendimientos de MS. Se realizaron análisis de varianza (P≤0.05) para las variables de la composición nutricional y rendimientos de MS y nutrientes. Las medias de estos parámetros se compararon con la prueba de la diferencia mínima significativa protegida de Fisher (P≤0.05). El análisis de la información se efectuó con el programa estadístico SAS(22) .

Rev Mex Cienc Pecu 2023;14(1):237-247 240

Todas las especies evaluadas tuvieron capacidad de rebrote, pero el trébol Alejandrino fue superior con tres cortes en 156 días. El resto de las especies produjeron dos cortes; donde las especies alternativas brásica Winfred, brásica Hunter y el rábano Graza requirieron el total del período disponible (150 a 154 días); mientras que los cereales produjeron los cortes entre los 133 y 144 días. Este comportamiento de los cereales permite iniciar más temprano la preparación del terreno para el siguiente cultivo en el ciclo de primavera. Sin embargo, si esto no es tan importante en el sistema de producción, la cosecha más tardía de los cultivos alternativos no representa una desventaja en el uso del agua de riego, ya que estos cultivos requirieron menor o igual lámina de riego que el utilizado en los cereales (63 a 75 cm de lámina de agua).

La capacidad de rebrote de los híbridos de brásica y el rábano forrajero para la producción de dos o tres cosechas en este estudio, también ha sido observada en otros trabajos, donde se indica que pueden realizarse varios pastoreos en estos cultivos(3,4) . Su buena capacidad de rebrote se observa en la poca o nula reducción del IAF en el rebrote y los mayores rendimientos de MS en rebrotes respecto a la primera cosecha en brásica Winfred, brásica Hunter y rábano Graza (Cuadro 1).

Cuadro 1: Ciclo de crecimiento, recuperación del rendimiento de materia seca (RdMS) e índice de área foliar (IAF) en el rebrote después del primer corte en cultivos tradicionales y alternativos evaluados en el ciclo otoño-invierno 2018-2019

Tratamientos Ciclo (días) RdMS (kg ha-1) IAF Corte 1 Corte 2 Corte 3 Corte 1 Corte 2 Corte 3 Avena Cuauhtémoc 144 4694 a 6550 a - 6.08 a 4.48 b -

Triticale Río Nazas 141 3718 b 5684 a - 4.20 a 3.55 aCebada Narro 95 133 4089 a 5697 a - 5.98 a 5.76 aTrigo AN265 144 4779 a 6534 a - 5.64 a 2.92 bTrébol Alejandrino 156 3924 a 4183 a 2094 b 3.65 b 6.19 a 3.10 b

Brásica Winfred 150 4586 b 7430 - 7.20 a 6.26 bBrásica Hunter 154 3391 a 5178 - 5.82 a 6.30 aRábano Graza 154 4483 a 5999 - 6.44 b 8.03 aab Medias seguidas en cada línea con distinta letra son significativamente diferentes (Tukey-Kramer P≤0.05). La capacidad de rebrote observada en cultivos tradicionales está acorde a lo observado comúnmente en otros estudios realizados en la Comarca Lagunera. En trébol Alejandrino, se ha reportado que la variedad Multicut produce hasta 13.1 t ha-1 de MS en seis cortes(23). En cereales como triticale, avena y cebada se ha observado que presentan buena capacidad para

Rev Mex Cienc Pecu 2023;14(1):237-247 241

rebrotar(24,25) condosatrescortes(26).Generalmenteseobservamayorcapacidadengenotipos invernales, seguidos de facultativos ymenor en primaverales(27,28) . En el presente estudio, los cultivares primaverales de avena Cuauhtémoc, triticale Río Nazas y cebada Narro 95 presentaron similar capacidad de rebrote al observado en el trigo facultativo AN265, el cual presentó una menor recuperación de IAF, debido a su ciclo de crecimiento más tardío. Esto representa una desventaja en un sistema de producción intensivo de forraje, ya que el trigo AN265 no alcanzó su máximo crecimiento en el rebrote, como si lo lograron los cereales primaverales.

Delos cultivos tradicionales,el trébol Alejandrino presentó la mejor composiciónnutricional del forraje, con menores concentraciones de FDN (417 g kg-1) y FDA (289 g kg-1), así como mayores contenidos de PC (286 g kg-1) y ENL (6.44 MJ kg-1 MS) con respecto a los valores observados en todos los cereales. Entre los cereales, el triticale Río Nazas fue sobresaliente por su menor contenido de FDA (372 g kg-1), y mayores concentraciones de ENL (5.52 MJ kg-1 MS) y PC (189 g kg-1) (Cuadro 2).

Cuadro 2: Composición nutricional de cultivos tradicionales y alternativos evaluados en el ciclo otoño-invierno de 2018-2019 Tratamientos PC (g kg-1) FDN (g kg-1) FDA(g kg-1) ENL (MJ kg-1 MS)

Avena Cuauhtémoc 148.7 d 612.3 a 395.8 c 5.27 e Triticale Río Nazas 189.1 c 606.6 a 372.2 d 5.52 d Cebada Narro 95 204.7 c 567.3 b 488.7 a 4.27 g Trigo AN265 165.1 d 628.6 a 418.7 b 5.02 f Trébol Alejandrino 286.4 a 417.1 d 288.6 e 6.44 c Brásica Winfred 248.8 b 431.3 d 239.5 f 6.99 b Brásica Hunter 187.8 c 277.0 e 210.4 g 7.32 a Rábano Graza 198.4 c 456.6 c 280.7 e 6.57 c PC= proteína cruda; FDN= fibra detergente neutro; FDA= fibra detergente ácido; ENL= energía neta para lactancia; MS= materia seca †Medias seguidas en cada columna con distinta letra son significativamente diferentes (DMS P≤0.05)

Los cultivos alternativos brásicas y rábano presentaron mejor composición nutricional que la observada en los cereales, debido a su alto contenido de PC, menor concentración de fibras y mayor contenido de ENL. En concentración de PC, la brásica Winfred (249 g kg-1) superó a los cereales (149 a 205 g); mientras que la brásica Hunter (188 g) y el rábano Graza (198 g) obtuvieron valores similares o mayores a los observados en los cereales. En el trébol Alejandrino, el contenido de PC (286 g kg-1) fue mayor al observado en los cultivos alternativos, mientras que en concentración de ENL, la brásica Winfred y el rábano Graza (6.57 a 6.99 MJ kg-1 MS) fueron superiores al obtenido en el trébol Alejandrino (Cuadro 2)

Rev Mex Cienc Pecu 2023;14(1):237-247 242

Los resultados de la composición nutricional del presente estudio en el forraje de brásicas y rábano se encontraron en el rango típico observado en brásicas forrajeras de otros trabajos, las cuales se caracterizaron principalmente por sus altos contenidos de PC (134 a 255 g kg-1)(8,9) y ENL (7.49 a 7.82 MJ kg-1 de MS)(11) . Sin embargo, en este estudio se observaron mayores contenidos de FDA y FDN en la brásica Winfred y el rábano Graza a los obtenidos en estudios previos, con valores de FDA de 118 a 217 g kg-1 yde 166 a 334 g en FDN(10,11,29) Se ha indicado que estas concentraciones de FDN no cumplen con los valores mínimos para el correcto funcionamiento del rumen en vacas (350 g)(30). En el presente estudio, los valores de FDN en la brásica Winfred (431 g) y el rábano Graza (457 g) fueron mayores a 350 g, y similares a los observados en el trébol Alejandrino (417 g); mientras que en la brásica Hunter (277 g), los valores de FDN sí fueron menores a esta cantidad El alto contenido de ENL en el forraje de las brásicas Hunter y Winfred, el rábano Graza y el trébol Alejandrino se asoció a los menores contenidos de FDA yFDN, en relación a los valores observados en los cereales cosechados en la etapa de embuche.

Los cultivos alternativos brásica Winfred y rábano Graza fueron sobresalientes en rendimiento de MS (12,016 a 10,482 kg ha-1). Estos rendimientos fueron similares a los obtenidos por el trébol Alejandrino (10,201 kg) y a los mejores cereales, avena Cuauhtémoc, cebada Narrro 95 y trigo AN265 (9,786 a 11,313 kg). En producción de nutrientes, sólo el trébol Alejandrino obtuvo rendimientos de PC (2,871 kg) similares a los de la brásica Winfred (2,986 kg), el resto de los cultivos obtuvieron rendimientos de PC inferiores (1,608 a 2,082 kg). En rendimiento de ENL, la brásica Winfred (84,044 MJ) superó a todos los otros cultivos evaluados (de 41,689 a 68,722 MJ ha-1) (Cuadro 3).

Cuadro 3: Rendimientos de materia seca (MS), proteína cruda (PC) y energía neta para lactancia (ENL) en cultivos tradicionales y alternativos evaluados en el ciclo otoño-invierno 2018-2019

Tratamientos MS (kg ha-1) PC (kg ha-1) ENL (MJ ha-1)

Avena Cuauhtémoc 11244 ab 1672 b 59442 bc

Triticale Río Nazas 9402 bc 1781 b 52074 cd

Cebada Narro 95 9786 abc 1996 b 41689 d

Trigo AN265 11313 ab 1854 b 57045 bc

Trébol Alejandrino 10201 abc 2871 a 65923 bc

Brásica Winfred 12016 a 2986 a 84044 a

Brásica Hunter 8569 c 1608 b 62819 bc

Rábano Graza 10482 abc 2082 b 68722 b

abc Medias seguidas en cada columna con distinta letra son significativamente diferentes (DMS P≤0.05)

Los rendimientos de MS obtenidos en las brásicas con dos cortes son similares a los mejores rendimientos reportados en otros estudios en brásicas (10,134 a 14,000 kg ha-1)(31,32) Este

Rev Mex Cienc Pecu 2023;14(1):237-247 243

nivel de rendimiento en brásicas, y sus mayores contenidos de PC y ENL con respecto a los cereales resultó en mayores rendimientos de estos nutrientes por hectárea. Con relación al trébol Alejandrino con un alto contenido de PC, las brásicas obtuvieron rendimientos de PC similares por su alto rendimiento de MS; sin embargo, en rendimientos de ENL la brásica Winfred fue superior a todas las especies como resultado de un efecto combinado de un alto contenido de ENL (Cuadro 2) y una alta producción de MS (Cuadro 3).

Un aspecto a resaltar en el estudio fue la capacidad de las brásicas forrajeras de producir rendimientos de MS y nutrientes similares o mayores a los obtenidos con especies tradicionales, con láminas de riego (63 a 75 cm) menores o iguales a las utilizadas en los cultivos tradicionales. Estos resultados son importantes en un sistema de producción de forraje como el de la Comarca Lagunera, que presenta escasez de agua para riego.

En conclusión, las brásicas forrajeras presentan el potencial para incrementar la productividad en la producción de forraje en otoño-invierno, debido a su alto valor nutritivo, buena capacidad de rebrote y su alta producción de MS y nutrientes. De las especies evaluadas, la brásica Winfred fue sobresaliente respecto a los cultivos tradicionales debido principalmente por su mayor contenido y producción de ENL (27.5 a 47.3 %).

Literatura citada:

1. Santamaría CJ, Reta SDG, Chávez GJFJ, Cueto WJA, Romero PRJI. Caracterización del medio físico en relación a cultivos forrajeros alternativos para la Comarca Lagunera. Libro Técnico Núm. 2. INIFAP-CIRNOC-CELALA. México; 2006.

2. Andrade VM, Montero MJ. Nuevas proyecciones de cambio de precipitación y temperatura para el siglo XXI en el Norte de México. Herrera E, López M, Carrillo J editores. Memorias del segundo congreso cambio climático del Estado de Chihuahua. Primera ed. 2014:26-35.

3. Bell LW, Watt LJ, Stutz RS. Forage brassicas have potential for wider use in drier, mixed crop-livestock farming systems across Australia. Crop Pasture Sci 2020;71(10):924943. https://doi.org/10.1071/cp20271.

4. Umami N, Prasojo YS, Haq MS. Morphological characteristics and biomass production Brassica rapa var. Marco during the dry season. Anim Prod 2022;24(1):31-36. https://doi.org/10.20884/1.jap.2022.24.1.107.

5. Sánchez DJI, Serrato CJS, Reta SDG, Ochoa ME, Reyes GA. Assessment of ensilability and chemical composition of canola and alfalfa forages with or without microbial inoculation. Indian J Agric Res 2014;48(6):421-428 https://doi.org/10.5958/0976058x.2014.01325.0.

Rev Mex Cienc Pecu 2023;14(1):237-247 244

Pecu 2023;14(1):237-247

6. Kilic U, Erisek A, Garipoğlu AV, Ayan I, Onder H. The effects of different forage types on feed values and digestibilities in some brassica fodder crops. Turkish J Agric Natural Sci 2021;8(1):94-102. https://doi.org/10.30910/turkjans.747031

7. Watt LJ, Bell LW, Cocks BD, Swan AD, Stutz RS, Toovey A, De Faveri J. Productivity of diverse forage brassica genotypes exceeds that of oats across multiple environments within Australia´s mixed farming zone. Crop & Pasture Sci 2021;72(5):393-406. https://doi.org/10.1071/CP21034.

8. Villalobos LA, Brummer JE. Forage brassicas stockpiled for fall grazing: yield and nutritive value. Crop Forage Turfgrass Management 2015;1(1):1-6. https://doi.org/10.2134/cftm2015.0165.

9. Dillard SL, Billman ED, Soder KJ. Assessment of forage brassica species for dairy and beef-cattle fall grazing systems. Appl Anim Sci 2020;36(2):157-166. https://doi.org/10.15232/aas.2019-01921

10. Omokanye A,Hernández G, LardnerHA,Al-Maqtari B, Singh Gill K, LeeA.Alternative forage feeds for beef cattle in Northwestern Alberta, Canada: forage yield and nutritive value of forage brassicas and forbs. J Appl Anim Res 2021;49(1):203-210. https://doi.org/10.1080/09712119.2021.1933990

11. Dillard SL, Roca-Fernández AI, Rubano MD, Elkin KR, Soder KJ. Enteric methane production and ruminal fermentation of forage brassica diets fed in continuous culture. J Anim Sci 2018;96(4):1362-1374. doi: 10.1093/jas/sky030

12. Keim JP, Castillo M, Balocchi O, Pulido R,Pacheco D, Muetzel S. Brief communication: milk production responses and rumen fermentation of dairy cows supplemented with summer brassica crops. NZ J Anim Sci Prod 2018;78:122-124.

13. Vargas-Bello-Pérez E, Geldsetzer-Mendoza C, Ibáñez RA, Rodríguez JR, AlvaradoGillis C, Keim JP. Chemical composition, fatty acid profile and sensory characteristics ofchanco-stylecheesefromearlylactationdairycowsfedwinterBrassicacrops.Animal 2021;11(1):107. https://doi.org/10.3390/ani11010107.

14. Williams SRO, Moate PJ, Deighton MH, Hannah MC, Wales WJ, Jacobs JL. Milk production and composition, and methane emissions from dairy cows fed lucerne hay with forage brassica or chicory. Anim Prod Sci 2016;56(3):304-311. https://doi.org/10.1071/AN15528

15. Keim JP, Daza J, Beltrán I, Balocchi OA, Pulido RG, Sepúlveda-Varas P, Pacheco D, Berthiaume R. Milk production responses, rumen fermentation, and blood metabolites ofdairycows fedincreasing concentrations of forage rape (Brassica napus ssp. biennis). J Dairy Sc 2020;103(10):9054-9066. https://doi.org/10.3168/jds.2020-18785

Rev Mex Cienc
245

16. Castillo-Umaña M, Balocchi O, Pulido R, Sepúlveda-Varas P, Pacheco D, Muetzel S, Berthiqume R, Keim JP. Milk production responses and rumen fermentation of dairy cows supplemented with summer brassicas. Animal 2020;14(8):1684-1692. https://doi.org/10.1017/S175173112000021X

17. Sun XZ. Invited review: glucosinolates might result in low methane emissions from ruminants fed brassica forages. Frontiers in Vet Sci 2020;7:588051. https://doi.org/10.3389/fvets.2020.588051.

18. Santamaría CJ, Reta SDG, Orona CI. Reducción del rendimiento potencial de maíz forrajeroencalendarioscontres ycuatroriegos. TerraLatinoamericana2008;26(3):235241.

19. AOAC (Association of Official Agricultural Chemists). Official methods of analysis. Dumas method (99003). 15th edition Washington DC, USA. 2005.

20. Goering HK, Van Soest PJ. Forage fiber analysis Apparatus, reagents, procedure and some applications Agric Handbook 379 ARS. Washington, DC, USDA; 1970.

21. Weiss WP, Conrad HR, St-Pierre NR. A theoretically-based model for predicting total digestible nutrient values of forages and concentrates. Anim Feed Sci Technol 1992;39(1-2):95-110. https://doi.org/10.1016/0377-8401(92)90034-4.

22. SAS Institute. The SAS system for windows, release 93. Cary, NC: Statistical Analysis Systems Inst; 2011.

23. Núñez HG, Quiroga GHM, Márquez OJ de J, de Alba AA. Producción ycalidad de trébol de Egipto (Trifolium alexandrinum L.) para ganado lechero en el Norte y Centro de México. Agrociencia 1997;31(2):157-164.

24. Keles G, Ates S, Coskun B, Koc S. Re-growth yield and nutritive value of winter cereals. In: Proc 22nd Int Grassland Cong. 2013.

25. Wilson GCY, López ZNE, Ortega CME, Ventura RJ, Villaseñor MHE, Hernández GA. Acumulación de forraje, composición morfológica e intercepción luminosa en dos variedades de avena. Interciencia 2018;43(9):630-636.

26. Zamora VVM, Lozano del RAJ, López BA, Reyes VMH, Díaz SH, Martínez RJM, Fuentes RJM. Clasificación de triticales forrajeros por rendimiento de materia seca y calidad nutritiva en dos localidades de Coahuila. Téc Pecu Mex 2002;40(3):229-242.

27. Lozano del RAJ, Rodríguez SA, Díaz SH, Fuentes RJM, Fernández BJM, Fernando NMJM, Zamora VVM. Producción de forraje y calidad nutritiva en mezclas de triticale (X Triticosecale Wittmack) y ballico anual (Lolium multiflorum L.) en Navidad, N.L. Téc Pecu Méx 2002;40(1):17-35.

Rev Mex Cienc
246
Pecu 2023;14(1):237-247

Pecu 2023;14(1):237-247

28. Ye CWE, Díaz SH, Lozano del RAJ, Zamora VVM, Ayala OMJ. Agrupamiento de germoplasma de triticale forrajero por rendimiento, ahijamiento y gustosidad. Téc Pecu Méx 2001;39(1):15-29.

29. Villalobos L, Brummer J. Evaluation of Brassicas for fall forage. In: Proc Western States Alfalfa and Forage Symp, Reno, NV, December, 2013. UC Cooperative Extension, Plant Science Department University of California, Davis, CA 95616.

30. Kolver ES. Nutrition guidelines for the high producing dairy cow. Proc Ruakura Farmers Conference; 2002.

31. Stewart AV, Moorhead AJ. The development of a fodder radish suitable for multiple grazing. Agronomy NZ 2004;34:1-7.

32. McGrath S, Sandral G, Holman B, Friend M. Lamb growth rates and carcass characteristics of White Dorper and crossbred lambs grazing traditional and novel pastures during spring in souther Australia. Anim Prod Sci 2020;61(11):1151-1159. https://doi.org/10.1071/AN18769

Rev
Cienc
247
Mex

https://doi.org/10.22319/rmcp.v14i1.6200

Nota de investigación

Caracterización del virus de la diarrea viral bovino subtipo 1b aislado de un caso de la enfermedad de las mucosas

Roberto Navarro-López a

Juan Diego Perez-de la Rosa b

Marisol Karina Rocha-Martínez b

Marcela Villarreal-Silva a

Mario Solís-Hernández a

Eric Rojas-Torres a

Ninnet Gómez-Romero a*

aComisiónMéxico-EstadosUnidosparalaprevencióndefiebreAftosa yotrasenfermedades exóticas de los animales, Carretera México-Toluca Km 15.5 Piso 4 Col. Palo Alto. Cuajimalpa de Morelos. 05110. Ciudad de México. México. b Centro Nacional de Servicios de Constatación en Salud Animal (CENAPA), Morelos, México. *Autor de correspondencia: ninnet.gomez.i@senasica.gob.mx; ninna_gr@hotmail.com

Resumen:

El virus de la diarrea viral bovina (VDVB) genera pérdidas significativas en la producción de bovinos. Se reporta sobre un caso fatal de la enfermedad de las mucosas en un toro de dos años. Para la detección del agente causal, se analizaron muestras de lesiones, de sangre completa y de heces mediante el RT-PCR, PCR, ELISA y aislamiento viral. Se obtuvo amplificación positiva por RT-PCR en muestras de sangre para el virus de la diarrea viral bovina (VDVB). El aislamiento viral de las muestras de las lesiones confirmó que el VDVB fue el agente causal de las manifestaciones clínicas. Una caracterización genética basada en

248

el análisis filogenético de tres secuencias parciales identificó la presencia del subgenotipo 1b del VDVB en las muestras analizadas. El animal muestreado manifestaba signos clínicos indicandoqueteníalaenfermedaddelasmucosas, locualsugierequesufríadeunainfección persistente (IP) por VDVB. Este hallazgo resalta la importancia de establecer programas de control de VDVB basados en probar la presencia de IP en el ganado de México.

Palabras clave: Virus diarrea viral bovina, Ganado, Enfermedad de las mucosas, infección persistente, México.

Recibido: 18/04/2022

Aceptado: 18/07/2022

La diarrea viral bovina (DVB) sigue siendo una de las enfermedades endémicas más comunes en el ganado bovino y otros rumiantes en todo el mundo. Esta enfermedad provoca impactos económicos significativos en la industria ganadera debido a sus efectos negativos sobre la reproducción y las condiciones de salud en el ganado(1,2). La causa de la DVB es un virus de ARN monocatenario y de cadena positiva denominado virus de la diarrea viral bovina (VDVB); pertenece a la familia Flaviviridae dentro del género Pestivirus. En la actualidad, el VDVB se clasifica en tres especies: Pestivirus A (virus de la diarrea viral bovina 1, VDVB-1); Pestivirus B (virus de la diarrea viral bovina 2, VDVB-2); y Pestivirus H (pestivirus tipo HoBi). Cada especie se segrega en subgenotipos(3). El Pestivirus A se subdivide en hasta 21 subgenotipos (del 1a hasta el 1u), y el Pestivirus B y el Pestivirus H se subdividen en cuatro subgenotipos cada uno (del a hasta el d)(4) .

También las cepas de VDVB se clasifican en biotipos citopáticos (CP) y no citopáticos (NCP) según su efecto sobre la replicación y los cambios morfológicos que inducen en el cultivo celular. Esta clasificación es relevante porque la citopatogenicidad in vitro no se relaciona con la citopatogenicidad in vivo. Las cepas NCP son predominantes en el campo y están involucradas en la mayoría de los casos de infección natural y de infecciones persistentes. Las cepas CP son poco comunes y se aíslan casi exclusivamente de una forma mortal de DVB llamada enfermedad de las mucosas (EM)(5)

La infección por VDVB se caracteriza por manifestaciones clínicas que incluyen trastornos respiratorios, gastrointestinales y reproductivos. Las fallas reproductivas como los abortos, la momificación, la muerte fetal, los defectos congénitos y el nacimiento de animales persistentemente infectados (PI) generan grandes pérdidas económicas(6)

Rev Mex Cienc Pecu 2023;14(1):248-259 249

Los animales PI son de particular preocupación porque pueden, por medio de la infección transplacentaria con una cepa de VDVB NCP, infectar a un embrión durante los primeros 125 días de gestación. Los animales nacidos de una madre con una PI adquieren una tolerancia inmunológica hacia la cepa de VDVB infectante y desarrollan una infección persistente. Por lo tanto, en un ternero con una PI congénita no se inducirá una respuesta inmune por anticuerpos o células T contra el virus(7) Los animales PI son una fuente permanente del VDVB, ya que eliminan de por vida al virus en secreciones corporales como las nasales, orales, leche, orina, heces y en semen. Por lo tanto, juegan un papel esencial en la patogénesis y epidemiología de la DVB(8)

Los terneros nacidos con una PI parecen animales normales, aunque a veces son débiles. Sin embargo, se caracterizan por tasas de crecimiento reducidas, ysufren de la inmunosupresión y de tasas altas de mortalidad(2) Tanto la tasa de mortalidad como la de morbilidad incrementan en los animales con una PI debido a un aumento en su susceptibilidad a otras enfermedades. Mueren comúnmente por la neumonía o la EM. La mayoría de los terneros PI mueren por la EM entre los 6 y los 24 meses de edad(9,10). Sin embargo, hay reportes de bovinos PI que alcanzan los 3, 5 y hasta 7 años, lo que implica un período largo de diseminación viral(2,11,12) .

La EM es una condición fatal esporádica restringida al ganado PI. Ocurre cuando el VDVB NCP causante de la PI muta a una CP como resultado de un evento de recombinación, o cuando el animal PI tiene una coinfección con una cepa CP del VDVB antigénicamente homóloga (13,14) . Por lo tanto, se pueden encontrar ambos biotipos de manera consistente en animales con EM(15,16) . Un cuadro de EM resulta en la muerte del animal dentro de las dos semanas posteriores al inicio de los signos clínicos. Las principales lesiones que se encuentran en casos de EM son erosiones y ulceraciones extensas a lo largo del tracto gastrointestinal(17) . Sin embargo, existen reportes de animales con EM que manifestaron un inicio tardío (varios meses después de la infección inicial) de los signos(18). Otros signos clínicos incluyen la anorexia, la fiebre, la deshidratación, la diarrea, la dermatitis, la necrosis del tejido linfoide, y un mal estado corporal(19) .

El presente reporte describe el inicio de EM en un toro de dos años de edad con signos clínicos severos; es posible que este sea la primera descripción de una IP en ganado en México. Se recibió la notificación del animal en junio del 2021. Al momento del reporte, el curso del cuadro tenía 15 días e involucraba signos clínicos como la anorexia, la depresión, el ptialismo, diarrea hemorrágica severa, la deshidratación, secreción nasal y ulceración profunda y extensa en el hocico, las narinas, los labios, las encías y el paladar duro (Figuras 1, 2 y 3). El animal afectado pertenecía a una granja tradicional de traspatio ubicada en Texcoco, Estado de México, México. La granja tenía cuatro bovinos, cuatro caballos, seis perros y tres cerdos, aparentemente sanos al momento del informe. Antes del evento, no se había registrado manifestaciones clínicas similares en bovinos, o cualquier otro animal

Rev Mex Cienc Pecu 2023;14(1):248-259 250

doméstico, en otras fincas en el áreacircundante.Según el propietario,nohubomovilización deanimalesentrelas fincas cercanas, yno seintrodujeronnuevos animales enla granja antes que el animal comenzara con la signología clínica.

Figura 1: Toro de dos años de edad con enfermedad de las mucosas en donde se muestran lesiones erosivas en la descarga nasal, y ulcerizacíon extensiva en el hocico y las narinas

Figura 2: Lesiones erosivas en los labios y las encías

Rev Mex Cienc Pecu 2023;14(1):248-259 251

Figura 3: Erosiones superficiales en el paladar duro

Se colectaron muestras de las lesiones cutáneas, muestras de sangre y de heces. Estas se remitieron para diagnóstico al Laboratorio de Inmunología, Biología Celular yMolecular de la Comisión México-Estados Unidos para la Prevención de la Fiebre Aftosa y Otras Enfermedades Exóticas de los Animales (CPA). El reporte de caso fue identificado con el número CPA-0861-21. Para el diagnóstico diferencial se consideraron las principales enfermedades vesiculares del ganado bovino, como son la fiebre aftosa (FA), la estomatitis vesicular (EV), la fiebre catarral maligna (FCM) y la DVB. No se detectó ni la FA ni la EV mediante RT-PCR, ELISA o el aislamiento del virus por cultivo celular. De igual forma, el virus del FCM no fue detectado por PCR.

El VDVB se aisló de las muestras de las lesiones y se obtuvo una amplificación positiva de las muestras de sangre completa mediante RT-PCR. El aislado de VDVB fue remitido al Laboratorio de Biología Molecular del Centro Nacional de Servicios de Diagnóstico en Salud Animal (CENASA) para su secuenciación parcial. Se secuenciaron la 5'UTR, Npro y E2 del VDVB, las cuales se depositaron en GenBank (números de acceso OM812936, OM812937 y OM812938, respectivamente) Se realizó un análisis filogenético basado en las regiones 5'UTR, Npro y E2. Las secuencias parciales de 5'UTR (360 pb), Npro (504 pb) y E2 (1,482 pb) obtenidas en este estudio se compararon con las cepas de referencia de VDVB para caracterizar el aislado de VDVB Para las secuencias 5'UTR y Npro se infirió la historia evolutiva utilizando el método de máxima verosimilitud con un modelo de sustitución de dos parámetros de Kimura(20), mientras para la E2 se usó un modelo de sustitución de tres parámetros de Tamura(21). Ambos modelos se implementaron con el MEGA7 software

Rev Mex Cienc Pecu 2023;14(1):248-259 252

usando 1,000 “bootstraps” de arranque cada una (Figura 4). Se modelaron las diferencias de velocidad evolutiva entre los sitios con una distribución gamma discreta con dos categorías; algunos sitios no mostraron variación evolutiva para las secuencias Npro y E2.

Figura 4: Árbol filogenético basado en las secuencias de las regiones 5'UTR (a), Npro (b) y E2 (c)

Rev Mex Cienc Pecu 2023;14(1):248-259 253

Se llevó a cabo la inferencia filogenética por medio del programa MEGA 7 siguiendo el método de verisimilitud máxima. Se hicieron 1,000 réplicas de “bootstraps”. Las secuencias de referencias se identifican por su número de acceso de GenBank. Las secuencias de nucleótidos identificadas en el presente estudio se identifican con el símbolo "".

La DVB continúa siendo una enfermedad de preocupación significativa para la industria ganadera por su impacto económico asociado principalmente con los trastornos reproductivos(2) Dependiendo de la etapa de gestación en la que se adquiere la infección por una cepa NCP del VDVB puede resultar en el nacimiento de terneros PI inmunotolerante. Estos animales son constantemente virémicos, y el VDVB se propaga a través de la mayoría delos órganos del animal pero sin que sedesarrollenlesiones aparentes(22).Enconsecuencia, el ganado PI mantiene la replicación y excreción viral de por vida en todas las secreciones corporales(23). Por lo tanto, el ganado PI representa la principal fuente de transmisión y mantenimiento del VDVB dentro y entre hatos. Los VDVB NCP también pueden transmitirse por medio de ganado con una infección aguda y por fómites como material quirúrgico y de manejo contaminado, la revisión rectal, los sueros bovinos utilizados en la transferencia de embriones y producción de vacunas, el semen infectado y las vacunas contaminadas(24-27) .

Las infecciones por VDVB afectan de manera directa la fertilidad de los animales PI. Los toros PI pueden producir semen de calidad aceptable, pero de fertilidad baja asociada con anomalías en los espermatozoides y baja motilidad(28) . En hembras PI la función ovárica

Rev Mex Cienc Pecu 2023;14(1):248-259 254

disminuye por medio de la hipoplasia y la reducción de las ovulaciones(29) . Así mismo, toros y vacas PI pueden engendrar crías PI aparentemente normales, los cuales recirculan el VDVB en animales susceptibles en el hato(30) .

La exposición continua de animales sanos al VDVB que viene de un animal con una IP puede perpetuar las infecciones por VDVB(31). Como consecuencia, puede surgir la infertilidaddel rebaño, lainmunosupresión ylageneración deternerosPI(32) Lasinfecciones agudas con los VDVB NCP comprometen la fertilidad del rebaño al producir un crecimiento folicular retardado y reducido(33), la ovitis intersticial difusa (34), y fallas en la concepción al impedir la implantación del embrión(22) También puede generar la muerte embrionaria antes del día 79 de gestación en vacas preñadas, o malformaciones congénitas entre los días 79 y 150(35)

Enáreas dondeseimplementanmedidas adecuadas parael control del VDVB,laprevalencia estimada de animales con una IP está entre el 1-2%(1) . El presente caso es de importancia ya que no hay reportes de brotes de EM o su presencia en la población bovina mexicana. Además, se desconoce la proporción actual de terneros PI en el país. Actualmente, información limitada sobre caracterización genética y prevalencia del VDVB en México se ha comenzado a analizar (36) .

El presente caso describe la presentación de EM causado por el VDVB-1b en un toro de carne en el que predominaron las lesiones ulcerativas en el tracto gastrointestinal. El VDVB1b se define actualmente como la cepa más común en el campo. De hecho se considera el subgenotipo predominante a nivel mundial, seguido por el 1a y 1c(4) . Al VDVB-1b lo han descrito como la cepa más prevalente en terneros PI(37) . La presente identificación del subgenotipo 1b del VDVB coincide con un estudio previo que describe el VDVB-1b como un virus endémico que circula en el ganado bovino mexicano, junto con el 1a, 1c y 2a(38) . En conjunto con el presente caso de estudio, estos estudios representan un acercamiento inicial al VDVB en México.

El DVB sigue siendo una enfermedad no regulada en el país y no existen estrategias de control o medidas de prevención al nivel oficial En consecuencia, los protocolos de vacunación se basan en procedimientos voluntarios y las medidas de seguimiento y de bioseguridad se implementan en función al conocimiento del DVB de los productores Se confirmó que el toro evaluado en este caso clínico estaba infectado con el VDBV-1b además de manifestar signos sugiriendo un caso de EM. El toro detectado como positivo a VDVB pertenece a una granja donde se aplican escasas medidas sanitarias, las cuales no incluyen un protocolo de vacunación contra el VDVB.

Escenarios como la anterior son comunes en México, lo cual resalta la falta de medidas de control contra el DVB en el país. El presente caso de estudio confirmó la presencia del

Rev Mex Cienc Pecu 2023;14(1):248-259 255

VDVB-1b en bovinos mexicanos y coincide con estudios anteriores(38) . El animal estudiado mostraba un cuadro grave de EM, destacando la importancia por subdiagnóstico de animales PI y, desde luego, el estado epidemiológico del VDVB. Informes sobre casos de DVB impulsarán el desarrollo de estrategias de control que permitan a los productores detectar el VDVB yeliminaralos terneros PIdesus rebaños. Lavacunación es unelemento vital dentro de una estrategia de control del VDVB; sin embargo, se debe de escoger la vacuna más adecuada para brindar protección contra el VDVB circulante. Por ejemplo, en México ya se agregó el VDVB-1b como antígeno en una vacuna comercial Aunque la vacunación es importanteenel control del DVB, debedeformarpartede programasamplios para el control de DVB. El hallazgo de VDVB-1b en un toro no vacunado demuestra el papel crucial de la bioseguridad y la vigilancia de enfermedades para mitigar los efectos de las infecciones por VDVB en las poblaciones de ganado.

Conflictos de interés

Los autores declaran que no tienen ningún conflicto de interés en cuanto a la autoría y la publicación del presente manuscrito.

Literatura citada:

1. Houe H. Epidemiological features and economical importance of bovine virus diarrhoea virus (BVDV) infections. Vet Microbiol 1999;64(2-3):89-107. doi: 10.1016/s03781135(98)00262-4. Erratum in: Vet Microbiol 2003;93(3):275-6.

2. Houe H. Economic impact of BVDV infection in dairies. Biologicals 2003;31(2):13743. doi: 10.1016/s1045-1056(03)00030-7.

3. SmithDB,MeyersG,BukhGJ,GouldEA,MonathT,Scott-MuerhoffA, et al.Proposed revision to the taxonomy of the genus Pestivirus, family Flaviviridae. J General Virol 2017;98(8), 2106–2112. https://doi.org/10.1099/jgv.0.000873.

4. Yesilbag K, Alpay G, Becher P. Variability and global distribution of subgenotypes of bovine viral diarrhea virus. Viruses 2017;9(6):128. doi: 10.3390/v9060128.

5. Neill J. Molecular biology of bovine viral diarrhea virus. Biologicals 2013;41:2–7. doi: 10.1016/j.biologicals.2012.07.002.

6. Houe H, Lindberg A, Moenning V. Test strategies in bovine viral diarrhea virus control and eradication campaigns in Europe. J Vet Diagn Invest 2006;18(5):427-36. doi: 10.1177/104063870601800501.

Rev Mex Cienc
256
Pecu 2023;14(1):248-259

7. Meyers G, Thiel HJ. Molecular characterization of pestiviruses. Adv Virus Res 1996; 47:53-118. doi: 10.1016/s0065-3527(08)60734-4.

8. Brodersen BW. Bovine viral diarrhea virus infections: manifestations of infection and recent advances in understanding pathogenesis and control. Vet Pathol 2014;51(2):45364. doi: 10.1177/0300985813520250.

9. Odeón AC, Leunda MR, Faverín C, Boynak N, Vena MM, Zabal O. In vitro amplification of BVDV field strains isolated in Argentina: effect of cell line and culture conditions. Rev Argent Microbiol 2009;41:79–85.

10. Uzal FA, Platnner BL, Hostetter JM. Alimentary system in pathology of domestic animals. In: Maxie, MG, editor. Jubb, Keneddy and Palmers pathology of domestic animals.;6th ed. St. Louis, Missouri: Academic Press Inc; 2016:122–130.

11. Brock KV, Grooms DL, Ridpath JF, Bolin SR. Changes in levels of viremia in cattle persistently infected with bovine viral diarrhea virus. J Vet Diagn Invest1998;10:22-26.

12. Bedekovic T, Lemo N, Lojkic I, Cvetnicz Z, Cac Z, Madic J. Bovine viral diarrhoea: A seven year old persistently infected cow - a case report. Veterinarski Arch 2012;82 (6):637-643.

13. Brownlie J. The pathways for bovine virus diarrhoea virus biotypes in the pathogenesis of disease. Arch Virol Suppl 1991;3:79-96. doi: 10.1007/978-3-7091-9153-8_10.

14. Tautz N, Thiel HJ. Cytopathogenicity of pestiviruses: cleavage of bovine viral diarrhea virus NS2-3 has to occur at a defined position to allow viral replication. Arch Virol 2003;148(7):1405-12. doi: 10.1007/s00705-003-0106-9.

15. Bolin SR, McClurkin AW, Cutlip RC, Coria MF. Severe clinical disease induced in cattle persistently infected with noncytopathic bovine viral diarrhea virus by superinfection with cytopathic bovine viral diarrhea virus. Am J Vet Res 1985;46(3):573-6.

16. Kummerer B, Tautz MN, Becher P, Thiel H, Meyers G. The genetic basis for cytopathogenicity of pestiviruses. Vet Microbiol 2000;77(1-2):117-28. doi: 10.1016/s0378-1135(00)00268-6.

17. Baker JC. The clinical manifestations of bovine viral diarrhea infection. Vet Clin North Am Food Anim Pract 1995;11(3):425-45. doi: 10.1016/s0749-0720(15)30460-6.

18. FritzemeierJ, Haas L, LieblerE, MoennigV, Greiser-Wilke I. Thedevelopmentofearly vs. late onset mucosal disease is a consequence of two different pathogenic mechanisms. Arch Virol 1997;142(7):1335-50. doi: 10.1007/s007050050164.

Rev Mex Cienc
257
Pecu 2023;14(1):248-259

Pecu 2023;14(1):248-259

19. Wilhelmsen CL, Bolin SR, Ridpath JF, Cheville NF, Kluge JP. Lesions and localization of viral antigen in tissues of cattle with experimentally induced or naturally acquired mucosal disease, or with naturally acquired chronic bovine viral diarrhea. Am J Vet Res 1991;52(2):269-75.

20. Kimura M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Molec Evol 1980;16:111-120.

21. Tamura K. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G + C-content biases. Molec Biol Evol 1992;9:678-687.

22. Fray MD, Paton DJ, Alenius S. The effects of bovine viral diarrhoea virus on cattle reproduction in relation to disease control. Anim Reprod Sci 2000;60-61:615-27. doi: 10.1016/s0378-4320(00)00082-8.

23. Kameyama K, Konishi M, Tsutsui T, Yamamoto T. Survey for detecting persistently infected cattle with bovine viral diarrhea in Japan J Vet Med Sci 2016;78(8):1329–31.

24. Gunn HM. Role of fomites and flies in the transmission of bovine viral diarrhoea virus. Vet Rec 1993;132(23):584-5. doi: 10.1136/vr.132.23.584.

25. Brock KV, Redman DR, Vickers ML, Irvine NE. Quantitation of bovine viral diarrhea virus in embryo transfer flush fluids collected from a persistently infected heifer. J Vet Diagn Invest 1991;3(1):99-100. doi: 10.1177/104063879100300127

26. Lang-Ree JR, Vatn T, Kommisrud E, Loken T. Transmission of bovine viral diarrhoea virus by rectal examination. Vet Rec 1994;135(17):412-3. doi: 10.1136/vr.135.17.412.

27. Gómez-Romero N, Velázquez-Salinas L, Ridpath JF, Verdugo-Rodríguez A, BasurtoAlcántara FJ. Detection and genotyping of bovine viral diarrhea virus found contaminating commercial veterinary vaccines, cell lines, and fetal bovine serum lots originating in Mexico. Arch Virol 2021;166(7):1999-2003. doi: 10.1007/s00705-02105089-9.

28. Revell SC, Chasey D, Drew TD, Edwards S. Some observations on the semen of bulls persistentlyinfected with bovine virus diarrhoea virus. Vet Rec 1988;123(5):122-5. doi: 10.1136/vr.123.5.122.

29. Grooms DL, Ward LA, Brock KV. Morphologic changes and immunohistochemical detection of viral antigen in ovaries from cattle persistently infected with bovine viral diarrhea virus. Am J Vet Res 1996;57(6):830-3.

30. Meyling A, Jensen AM Transmission of bovine virus diarrhoea virus (BVDV) by artificial insemination (AI) with semen from a persistently-infected bull. Vet Microbiol 1988;17(2):97-105. doi: 10.1016/0378-1135(88)90001-6.

Rev Mex Cienc
258

31. Roeder PL, Harkness JW. BVD virus infection: prospects for control. Vet Rec 1986;118(6):143-7. doi: 10.1136/vr.119.6.143.

32. Hamers C, Lecomte C, Kulcsar G , Lambot M, Pastoret PP. Persistently infected cattle stabilise bovine viral diarrhea virus leading to herd specific strains. Vet Microbiol 1998;61(3):177-82. doi: 10.1016/s0378-1135(98)00185-0.

33. Grooms DL, Brock KV, Pate JL, Day ML. Changes in ovarian follicles following acute infection with bovine viral diarrhea virus. Theriogenology. 1998;49(3):595-605. doi: 10.1016/s0093-691x(98)00010-7.

34. Ssentongo YK, Johnson RH, Smith JR. Association of bovine viral diarrhoea-mucosal disease virus with ovaritis in cattle. Aust Vet J 1980;56(6):272-3. doi: 10.1111/j.17510813.1980.tb05722.x.

35. Windsor P. Abnormalities of development and pregnancy. Noakes ED, et al, editors. England, Vet Rep Obst (Tenth ed), W.B. Saunders, 2019; ISBN 9780702072338, https://doi.org/10.1016/B978-0-7020-7233-8.00009-4.

36. Gómez-Romero N, Ridpath JF, Basurto-Alcántara FJ, Verdugo-Rodríguez A. Bovine viral diarrhea virus in cattle from Mexico: Current Status. Front Vet Sci 2021;8:673577. doi: 10.3389/fvets.2021.673577.

37. Fulton RW, Whitley EM, Johnson BJ, Ridpath JF, Kapil S, Burge LJ, Cook BJ, Confer AJ. Prevalence of bovine viral diarrhea virus (BVDV) in persistently infected cattle and BVDV subtypes in affected cattle in beef herds in south central United States. Can J Vet Res 2009;73(4):283-91.

38. Gómez-Romero N, Basurto-Alcántara FJ, Verdugo-Rodríguez A, Bauermann FV, Ridpath JF, Genetic diversity of bovine viral diarrhea virus in cattle from Mexico. J Vet Diagn Invest 2017;29(3):362-365. doi: 10.1177/1040638717690187.

Rev Mex Cienc
259
Pecu 2023;14(1):248-259

Rev. Mex. Cienc. Pecu. Vol. 14 Núm. 1, pp. 1-259, ENERO-MARZO-2023

CONTENIDO CONTENTS

ARTÍCULOS / ARTICLES

Pags.

Identification of candidate genes and SNPs related to cattle temperament using a GWAS analysis coupled with an interacting network analysis Identificación de genes candidatos y SNP relacionados con el temperamento del ganado utilizando un análisis GWAS junto con un análisis de redes interactuantes Francisco Alejandro Paredes-Sánchez, Ana María Sifuentes-Rincón, Edgar Eduardo Lara-Ramírez, Eduardo Casas, Felipe Alonso Rodríguez-Almeida, Elsa Verónica Herrera-Mayorga, Ronald D. Randel......……………………………………………………………………........………………... 1

Efecto de la consanguinidad y selección sobre los componentes de un índice productivo en ratones bajo apareamiento estrecho Effect of consanguinity and selection on the components of a productive index, in mice under close mating Dulce Janet Hernández López, Raúl Ulloa Arvizu, Carlos Gustavo Vázquez Peláez, Graciela Guadalupe Tapia Pérez………………………........ 23

Variabilidad genética en biomasa aérea y sus componentes en alfalfa bajo riego y sequía Genetic variability in aerial biomass and its components in alfalfa under irrigation and drought Milton Javier Luna-Guerrero, Cándido López-Castañeda 39

Estimación de masa de forraje en una pradera mixta por aprendizaje automatizado, datos del manejo de la pradera y meteorológicos satelitales Estimation of forage mass in a mixed pasture by machine learning, pasture management and satellite meteorological data Aurelio Guevara-Escobar, Mónica Cervantes-Jiménez, Vicente Lemus-Ramírez, Adolfo Kunio Yabuta-Osorio, José Guadalupe García-Muñiz 61

Thymol and carvacrol determination in a swine feed organic matrix using Headspace SPME-GC-MS Determinación de timol y carvacrol en una matriz orgánica de alimento para cerdo utilizando Headspace SPME-GC-MS Fernando Jonathan Lona-Ramírez, Nancy Lizeth Hernández-López, Guillermo González-Alatorre, Teresa del Carmen Flores-Flores, Rosalba Patiño-Herrera, José Francisco Louvier-Hernández 78

Cambios en el recuento de cuatro grupos bacterianos durante la maduración del Queso de Prensa (Costeño) de Cuajinicuilapa, México Changes in the count of four bacterial groups during the ripening of Prensa (Costeño) Cheese from Cuajinicuilapa, Mexico José Alberto Mendoza-Cuevas, Armando Santos-Moreno, Beatriz Teresa Rosas-Barbosa, Ma. Carmen Ybarra-Moncada, Emmanuel Flores-Girón, Diana Guerra-Ramírez….... 94

Detección molecular de un fragmento del virus de lengua azul en borregos de diferentes regiones de México Molecular detection of a fragment of bluetongue virus in sheep from different regions of Mexico Edith Rojas Anaya, Fernando Cerón-Téllez, Luis Adrián Yáñez-Garza, José Luis Gu�érrez-Hernández, Rosa Elena Sarmiento-Salas, Elizabeth Loza-Rubio 110

Insulin-like growth factor 1 (IGF-1) concentrations in synovial fluid of sound and osteoarthritic horses, and its correlation with proinflammatory cytokines IL-6 and TNFα Concentraciones del factor de crecimiento similar a la insulina 1 (IGF-1) en el líquido sinovial de caballos sanos y osteoartríticos, y su correlación con las citoquinas proinflamatorias IL-6 y TNFα Fernando García-Lacy F., Sara Teresa Méndez-Cruz, Horacio Reyes-Vivas, Victor Manuel Dávila- Borja, Jose Alejandro Barrera-Morales, Gabriel Gu�érrez-Ospina, Margarita Gómez-Chavarín, Francisco José Trigo-Tavera……..….... 122

Uso de células estromales mesenquimales derivadas de la gelatina de Wharton para el tratamiento de uveítis recurrente equina: estudio piloto Use of Wharton&#39;s jelly-derived mesenchymal stromal cells for the treatment of equine recurrent uveitis: a pilot study María Masri-Daba, Montserrat Erandi Camacho-Flores, Ninnet Gómez-Romero, Francisco Javier Basurto Alcántara………………… 137

Escala de la producción y eficiencia técnica de la ganadería bovina para carne en Puebla, México Scale of production and technical efficiency of beef cattle farming in Puebla, Mexico José Luis Jaramillo Villanueva, Lisse�e Abigail Rojas Juárez, Samuel Vargas López…………………………………….... 154

Regresión cuantil para predicción de caracteres complejos en bovinos Suizo Europeo usando marcadores SNP y pedigrí Quantile regression for prediction of complex traits in Braunvieh cattle using SNP markers and pedigree Jonathan Emanuel Valerio-Hernández, Paulino Pérez-Rodríguez, Agus�n Ruíz-Flores…………………… 172

Análisis de crecimiento estacional de una pradera de trébol blanco (Trifolium repens L) Seasonal growth analysis of a white clover meadow (Trifolium repens L.) Edgar Hernández Moreno, Joel Ventura Ríos, Claudia Yanet Wilson García, María de los Ángeles Maldonado Peralta, Juan de Dios Guerrero Rodríguez, Graciela Munguía Ameca, Adelaido Rafael Rojas García....................................................................................…………………………………………………………….……………...... 190

REVISIONES DE LITERATURA / REVIEWS

Aspects related to the importance of using predictive models in sheep production. Review Aspectos relacionados con la importancia del uso de modelos predictivos en la producción ovina. Revisión Antonio Leandro Chaves Gurgel, Gelson dos Santos Difante, Luís Carlos Vinhas Ítavo, João Virgínio Emerenciano Neto, Camila Celeste Brandão Ferreira Ítavo, Patrick Bezerra Fernandes, Carolina Marques Costa, Francisca Fernanda da Silva Roberto, Alfonso Juven�no Chay-Canul……....……....……....……....……....……....……....……....……....……....……....……....……....... 204

NOTAS DE INVESTIGACIÓN / TECHNICAL NOTES

Preferencia de ocho plantas por Odocoileus virginianus en cautiverio

Preference for eight plants among captive white-tailed deer Odocoileus virginianus in Veracruz, Mexico Hannia Yaret Cueyactle-Cano, Ricardo Serna-Lagunes, Norma Mora-Collado, Pedro Ze�na-Córdoba, Gerardo Benjamín Torres-Cantú..……..………………..………..………..………..……….........………...……....…. 228

Rendimiento y valor nutricional de brásicas forrajeras en comparación con forrajes tradicionales Yield and nutritional value of forage brassicas compared to traditional forages David Guadalupe Reta Sánchez, Juan Isidro Sánchez Duarte, Esmeralda Ochoa Mar�nez, Ana Isabel González Cifuentes, Arturo Reyes González, Karla Rodríguez Hernández...........................…………. 237

Genetic characterization of bovine viral diarrhea virus 1b isolated from mucosal disease Caracterización del virus de la diarrea viral bovino subtipo 1b aislado de un caso de la enfermedad de las mucosas Roberto Navarro-López, Juan Diego Perez-de la Rosa, Marisol Karina Rocha-Mar�nez, Marcela Villarreal-Silva, Mario Solís-Hernández, Eric Rojas-Torres, Ninnet Gómez-Romero........................…………. 248

Revista Mexicana
Ciencias Pecuarias
de