Page 1

e

P

Pags.


NUESTRA PORTADA

Toros de lidia con encaste de Albaserrada, de la ganadería Española de Victorino Martín. Fotografía tomada por: Juan Manuel Lomillos Pérez

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 8 Número 4 octubre-diciembre, 2017. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Microbiología Animal, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 04-2016-060913393200-203. ISSN: 2448-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de éste número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Microbiología Animal, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en octubre de 2017.

DIRECTORIO FUNDADOR John A. Pino EDITOR EN JEFE EDITORES ADJUNTOS Arturo García Fraustro Oscar L. Rodríguez Rivera Alfonso Arias Medina

Microbiología: Epidemiología: Parasitología: Reproducción: Genética: Nutrición:

Apicultura: Socioeconomía: Forrajes y Pastizales: Inocuidad: Inmunología:

EDITORES POR DISCIPLINA Elizabeth Loza Rubio Juan Carlos Saiz Calahorra Elisa Rubí Chávez Ramón Molina Barrios Ma. Cristina Schneider Guillermina Ávila Ramírez Emmanuel Camus Héctor Jiménez Severiano José J. Hernández Ledesma Juan Hebert Hernández Medrano Sergio Román Ponce Mauricio A. Elzo Armando Partida de la Peña José L. Romano Muñoz Alejandro Placencia Jorquera Juan Ku Vera Yolanda B. Moguel Ordóñez Fernando Cervantes Escoto Adolfo Alvarez Macías Alfredo Cesín Vargas Javier F. Enríquez Quiroz Alfonso Hernández Garay James A. Pfister Jesús Vázquez Navarrete Sergio Rodríguez Camarena

INIFAP INIA UNAM IT Sonora PAHO UNAM CIRAD INIFAP Consultor UNAM INIFAP Univ. Florida INIFAP INIFAP UABJ UADY INIFAP UA Chapingo UAM-X UNAM INIFAP CP USDA INIFAP INIFAP

México España México México EE.UU. México Francia México EE.UU. México México EE.UU. México México México México México México México México México México EE.UU. México México

TIPOGRAFÍA Y FORMATO Nora del Rocío Alfaro Gómez Indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters.com/). Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com) I


REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es

trimestral en formato bilingüe Español o Inglés. El costo total por publicar es de $ 5,600.00 por manuscrito editado. Se publica en formato digital en acceso abierto, por lo que autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos se debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Microbiología Animal, Km 15.5 Carretera MéxicoToluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 38718700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cienc.. Pecu. is published quarterly in original lenguaje Spanish or English. Total fee charges are US $ 300.00 per article.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to: Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Microbiología Animal, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II


REVISTA MEXICANA DE CIENCIAS PECUARIAS REV. MEX. CIENC. PECU.

ARTÍCULOS

VOL. 8 No. 4

OCTUBRE-DICIEMBRE-2017

CONTENIDO

Pág.

Valor nutritivo de subproductos de cártamo para cerdos en finalización Nutritive value of safflower coproducts for finishing pigs Gerardo Mariscal-Landín, Ericka Ramírez Rodríguez, José Antonio Cuarón Ibarguengoytia ................................ 331

Acondicionamiento de becerros previo a la recría bajo pastoreo en trópico seco: efectos sobre el peso corporal y la condición sanitaria Conditioning around weaning of calves grazing in the dry tropic: effects upon body weight and health condition Rafael Guarneros Altamirano, Erasmo Gutiérrez Ornelas, Hugo Bernal Barragán, Ramiro Avalos Ramírez, Epigmenio Castillo Gallegos, Emilio Olivares Sáenz ........................................................................................ 341

Efecto del residual de estiércol avícola o residual de fertilizante mineral en el rendimiento y la calidad de camelina (Camelina sativa L. Crantz) Effect of residual poultry manure or residual mineral fertilizer on yield and quality of camelina (Camelina sativa L. Crantz) Rosario Miralles de Imperial Hornedo, María Mar Delgado Arroyo, Ángela García Manso, María Isabel González Gullón, José Valero Martín Sánchez ............................................................................. 353

Cambios de la fracción hidrosoluble de huevo de gallinas alimentadas con harina de camarón almacenado a diferentes tiempos y temperaturas Changes in the water soluble fraction of eggs from hens fed with shrimp meal stored at different times and tempertures María E. Carranco-Jáuregui, Silvia Carrillo-Domínguez, Benjamín Fuente-Martínez, Ernesto Ávila-González, María de Lourdes Solano ............................................................................................................................. 365

Kisspeptina en becerras prepúberes: I. Influencia de la edad en la respuesta de LH, FSH y GH a kisspeptina-10 y su asociación con IGF-I, leptina y estradiol Kisspeptin in prepubertal heifers. I Effects of age on the response of LH, FSH and GH to kisspeptin-10 and its association with IGF-I, leptin and estradiol Mónica Alamilla Rodríguez, René Carlos Calderón Robles, Jorge Víctor Rosete Fernández, Karla Rodríguez Hernández, Héctor Raymundo Vera Ávila, Jesús Alejandro Arreguín Arévalo, Terry M. Nett, Carlos Guillermo Gutiérrez Aguilar, Everardo González Padilla, Margarita Gómez-Chavarín, Alejandro Villa Godoy ........................ 375

Caracterización molecular de Escherichia coli resistente a antibióticos aislada de mastitis bovina en Michoacán, México Molecular characterization of antibiotic resistant Escherichia coli isolated from bovine mastitis in Michoacán, México Rafael Jiménez Mejía, Luis Fernando Gudiño Sosa, José Antonio Aguilar López, Pedro Damián Loeza Lara ........ 387

III


Secuencias de cultivo alternativas para incrementar el potencial forrajero y productividad del agua Alternative crop sequences for increasing the forage potential and water productivity David Guadalupe Reta Sánchez, J. Santos Serrato Corona, Héctor Mario Quiroga Garza, Arturo Gaytán Mascorro, Uriel Figueroa Viramontes ....................................................................................... 397

REVISIÓN BIBLIOGRÁFICA Avances sobre nutrición y fertilidad en ganado lechero: Revisión Advances on nutrition and fertility in dairy cattle: Review Pedro Meléndez, Julián Bartolomé ................................................................................................................ 407

NOTAS DE INVESTIGACIÓN Dinámica poblacional de tallos de ovillo (Dactylis glomerata L.) solo y asociado con ballico perenne (Lolium perenne L.) y trébol blanco (Trifolium repens L.) Tiller population in orchard grass (Dactylis glomerata L.) grown alone and associated with perennial ryegrass (Lolium perenne L.) and white clover (Trifolium repens L.) Adelaido Rafael Rojas García, Joel Ventura Ríos, Alfonso Hernández-Garay, Santiago Joaquín Cancino, María de los Ángeles Maldonado Peralta, Iván Reyes Vázquez ........................................................................ 419

Eficiencia en el uso del agua de variedades de alfalfa (Medicago sativa L.) con sistema de riego subsuperficial Water efficiency of alfalfa varieties (Medicago sativa) with subsurface irrigation system Ricardo A. Sánchez Gutiérrez, Miguel Servin Palestina, Héctor Gutiérrez Bañuelos, Alfonso Serna Pérez ............ 429

Macro-mineral concentrations in soil and forage in three grassland sites at Zacatecas Concentration de macro minerales en el suelo y forraje de tres sitios en Zacatecas M. Márquez-Madrid, H. Gutiérrez-Bañuelos, R. Bañuelos-Valenzuela, A. Muro-Reyes, R. David Valdez-Cepeda ...................................................................................................... .437

Accuracy of genomic values predicted using deregressed predicted breeding values as response variables Exactitud de valores genómicos predichos utilizando como variable de respuesta valores genéticos predichos ajustados Fernanda Ramírez-Flores, Rufino López-Ordaz, Joel Domínguez-Viveros, José Guadalupe García-Muñiz, Agustín Ruíz-Flores ..................................................................................................................................... 445

Osteocondrosis en el toro de lidia y evaluación de su efecto sobre la movilidad del animal Osteochondrosis in fighting bulls and evaluation of its effect on the animal mobility Juan Manuel Lomillos Pérez, Marta Elena Alonso de la Varga ......................................................................... 453

IV


Actualización: enero, 2016

NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros. 6.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo.

3.

El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Arial a 12 puntos, a doble espacio. Asimismo se deberá remitir una carta de presentación firmada por todos los autores, aceptando el orden de co-autoría, remitiéndola en forma digitalizada como archivo complementario; en ella se indicará el responsable de la correspondencia con la Revista, indicando dirección (no apartado postal), teléfono y dirección electrónica.

4.

5.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos Literatura citada Cuadros y gráficas

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes).

2.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

7.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8.

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente:

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o

a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se

V


divide en secciones encabezamientos:

que

llevan

Reglas básicas para la Literatura citada

estos

Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista).

b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes). En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año.

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc.

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus.

12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como referencias, aunque pueden insertarse en el texto (entre paréntesis).

Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”). I)

VI

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.


Sólo número sin indicar volumen.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10. III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis. XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

No se indica el autor. IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

Suplemento de revista. V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988. XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Publicaciones electrónicas XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Autor de capítulo. IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Memorias de reuniones. X)

XI)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13. VII


13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales.

J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s) P probabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las gráficas y figuras se deberán elaborar en Word, Power Point, Corel Draw y enviadas en archivo aparte (nunca insertarlas como imágenes en el texto). Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados. 18. Abreviaturas de uso frecuente: cal cm °C DL50 g ha h i.m. i.v.

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s) hectárea (s) hora (s) intramuscular (mente) intravenosa (mente)

vs

versus

xg

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s). 19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

VIII


Update: January, 2016

INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts).

2.

All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt.

3.

Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias�. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

4.

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

5.

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

6.

Title page Abstract Text Acknowledgments References Tables and Graphics 7.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

8.

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

9.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts: Introduction Materials and Methods Results Discussion Conclusions and implications In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

b) Technical Notes. They should be brief and be

evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which should be published as a note in the opinion of the editors. The text will contain the same

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

IX


information presented in the sections of the research article but without section titles.

e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to

summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. References. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

Key rules for references a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one.

III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given

b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article).

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

Organization, as author

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the names(s), the number of the edition, the country, the printing house and the year.

VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

X


In press

responsables de establecimientos destinados al sacrificio de animales. México. 1996.

VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Books and other monographs

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Author(s) VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003.

Conference paper X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols. 13. Final version. This is the document in which the authors have incorporated all the corrections and modifications asked for by the editors. Graphs and figures should be submitted separately in Microsoft Word, MS Power Point, or Corel Draw. Figures must not be inserted as images within the text. In Tables do not use internal horizontal or vertical lines.

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989. XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

Organization as author

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines.

XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas

XI


mm min ng

millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v. J kg km L log Mcal MJ m ¾l ¾m mg ml

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s) mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s)

vs

versus

xg

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XII


Rev Mex Cienc Pecu 2017;8(4):331-340

http://dx.doi.org/10.22319/rmcp.v8i4.4639

Valor nutritivo de subproductos de cártamo para cerdos en finalización Nutritive value of safflower coproducts for finishing pigs Gerardo Mariscal-Landína*, Ericka Ramírez Rodrígueza, José Antonio Cuarón Ibargüengoytiaa

RESUMEN Para determinar en subproductos de cártamo la digestibilidad aparente del tracto total (DATT) de materia seca (MS), proteína cruda (PC) y energía (En); y las digestibilidades aparente ileal (DAI) y estandarizada ileal (DEI) de aminoácidos (AA), se realizaron dos experimentos. En el primero se utilizaron cinco cerdos de 50 ± 3.5 kg bajo un diseño en cuadro latino 5 x 5. Se evaluaron dos subproductos de cártamo (SPC, pasta), en dos presentaciones: molida y sin moler. Se formuló una dieta testigo de caseína y cuatro experimentales de subproductos de cártamo y caseína. En el segundo se utilizaron ocho cerdos de 35.0 ± 2.5 kg canulados a nivel ileal. Se emplearon los subproductos molidos para fabricar tres dietas: una testigo de caseína y dos experimentales de subproductos de cártamo (pasta y SPC) y caseína. En el primer periodo los animales consumieron las dietas experimentales (cuatro cerdos por tratamiento); en el segundo todos consumieron la dieta testigo. Los resultados mostraron que fue mayor la DATT (P<0.05) de PC de la pasta (87.4 en promedio); intermedia en el SPC sin moler (83.7) e inferior en el SPC molido (76.0). La DATT de En fue mayor (P<0.05) en los SPC (64.5 en promedio) que en la Pasta (57.5 en promedio). La DAI y DEI de PC y AA de ambos subproductos fue similar (P>0.05) entre ellos. Se concluye que el contenido de energía digestible de los subproductos de cártamo es bajo (1,419 a 1,738 kcal/kg) y la DEI de los AA fue similar entre ellos. PALABRAS CLAVE: Cártamo, Energía, Aminoácidos, Digestibilidad, Cerdos.

ABSTRACT To determine the apparent total tract digestibility (ATTD) of dry matter (DM), crude protein (CP) and energy (E). And the apparent and standardized ileal digestibility (AID, SID) of amino acids (AA) in safflower coproducts, two experiments were conducted. In the first five pigs of 50 ± 3.5 kg under a latin square design 5 x 5 two safflower coproducts (byproduct, meal) were evaluated using two presentations each: Ground and unground. Five diets were formulated: control (casein) and four experimental (safflower coproducts and casein). In the second experiment, eight pigs of 35.0 ± 2.5 kg cannulated at the ileal level were used. The ground meals were used to fabricate three diets: a reference (casein) and two experimental (safflower coproducts and casein). In the first experimental period, the pigs consumed the experimental diets (four pigs per treatment); in the second period, all pigs consumed the reference diet. The digestibility was analyzed according to a completely randomized design. The ATTD of CP was higher (P<0.05) on meal (87.4 in average); intermediate in by product unground (83.7) and lower in by product ground (76.0). The ATTD was higher (P<0.05) in by product (64.5 in average) than from Meal (57.7 in average). The AID and SID of CP and AA were similar (P>0.05) among coproducts. It is concluded that the SM digestible energy content is low (1.419 to 1.738 kcal/kg) and the SID of AA was similar among safflower coproducts. KEY WORDS: Safflower meal, Energy, Amino acids, Digestibility, Pigs.

Recibido el 12 de enero de 2016. Aceptado el 31 de mayo de 2016. a

Centro Nacional de Investigación en Fisiología Animal – INIFAP, km 1 Carretera a Colón, Ajuchitlán Querétaro, México.

* Autor de correspondencia: mariscal.gerardo@inifap.gob.mx

331


Gerardo Mariscal-Landín, et al. / Rev Mex Cienc Pecu 2017;8(4):331-340

INTRODUCCIÓN

lechones y cerdos en crecimiento-finalización. Por eso el peso inicial de los cerdos utilizados fue de 50 ± 3.5 kg, ya que al momento de realizar las mediciones su peso estaría cercano a los 60 kg que es el peso recomendado por esos autores. El periodo experimental tuvo una duración de 10 días (cinco de adaptación a la dieta y cinco de colecta de excretas).

El cártamo (Carthamus tinctorius L.) es una oleaginosa que se ha usado tradicionalmente como fuente de pigmentos, aceite y proteína(1,2). Sin embargo, su alto contenido de fibra ha limitado su uso en aves y cerdos(2,3), siendo más utilizada en la alimentación de rumiantes(4-6). El cártamo es un cultivo adaptado a condiciones áridas o semi-áridas, por lo que representa una alternativa interesante para la diversificación en áreas donde otras fuentes de aceites son limitantes(7). Con respecto al cártamo como fuente de proteína para cerdos, no existen reportes en la literatura sobre la digestibilidad estandarizada a nivel ileal (DEI) de su proteína y aminoácidos (AA); lo que aunado a su alto contenido de fibra limita su inclusión en la formulación de raciones. La DEI es el valor de digestibilidad que se utiliza para formular dietas porque tiene la propiedad de ser aditiva(8-10). Por lo anterior el objetivo del presente trabajo fue determinar la DEI de la proteína y aminoácidos de dos subproductos de cártamo, para generar los coeficientes de digestibilidad estandarizada; información necesaria que permitirá utilizar los subproductos de cártamo de manera racional en la formulación de alimentos para cerdos en crecimiento.

El trabajo consistió en la evaluación de dos subproductos de cártamo: una muestra cumplió con la norma oficial mexicana “NMX-Y-176-SCFI-2008. Alimentos para animales, pasta de cártamo, especificaciones de calidad: declaratoria de vigencia en el Diario Oficial de la Federación, noviembre 19, 2008” y se le denominó Pasta, y otra con menor contenido de proteína y mayor de fracciones de fibra que se denominó Subproducto (SPC) (Cuadro 1). Las dos muestras se seleccionaron como representativas Cuadro 1. Composición química porcentual de los subproductos de cártamo

MATERIAL Y MÉTODOS Los dos experimentos se realizaron en la granja experimental del CENID-Fisiología, el manejo de los animales y los procedimientos experimentales respetaron en todo momento los lineamientos de la International “Guiding principles for biomedical research involving animals”(11), así como los de la Norma Oficial Mexicana para la producción, cuidado y uso de los animales de laboratorio(12), como fue constatado por un Comité Interno.

Experimento 1. Digestibilidad aparente del tracto total (DATT) Se utilizaron cinco cerdos machos castrados de la línea “Genetiporc” (Fertilis 25 x G Performance 8), alojados en corraletas individuales. Noblet y van Milgen(13) mencionan que la ED desde un punto de vista práctico se puede determinar en cerdos de 60 kg, porque el valor obtenido se puede aplicar a los

Materia seca Proteína Extracto etéreo FDN FDA Energía bruta, Mcal/kg

Pasta 93.49 27.97 2.00 47.17 35.97 4.4

Subproducto 92.85 15.41 0.30 70.51 53.36 4.3

Acido aspártico Ácido glutámico Alanina Arginina Fenilanina Glicina Histidina Isoleucina Leucina Lisina Serina Treonina Tirosina Valina

2.14 3.58 1.00 2.09 1.00 1.18 0.63 0.77 1.30 0.70 1.08 0.74 0.56 0.88

1.19 2.72 0.54 1.11 0.52 0.76 0.39 0.46 0.78 0.42 0.55 0.35 0.27 0.56

Calcio Fósforo

1.41 0.38

0.70 0.38

FDN= fibra detergente neutra; FDA= fibra detergente ácida.

332


VALOR NUTRITIVO DE SUBPRODUCTOS DE CÁRTAMO PARA CERDOS EN FINALIZACIÓN

de los dos tipos de subproductos de cártamo existentes en el mercado nacional reportados en un trabajo previo (datos no publicados). Cada subproducto de cártamo en dos diferentes presentaciones físicas: molido (a través de una criba de 3 mm), y sin moler. Se formularon cinco dietas (Cuadro 2) las cuales aportaban 160 g PC/kg. Se elaboró una dieta testigo utilizando caseína como proteína de referencia, y las cuatro dietas experimentales con uno de los dos subproductos de cártamo en cada una de sus presentaciones (molido y sin moler) y caseína como única fuente de proteína.

marcó con óxido férrico a razón de 3/kg de alimento y la presencia de excremento marcado indicó el final del periodo de colecta. Las muestras colectadas se conservaron a -20 °C.

La primer comida del periodo experimental (comida de la mañana del día 6) se marcó con óxido férrico a razón de 3 g/kg de alimento. Las excretas marcadas mostraron el inicio del periodo de su colecta, dos veces por día. El alimento de la mañana del día 11 (sexto día del periodo experimental) se

Se utilizaron ocho cerdos machos castrados de la línea “Genetiporc” (Fertilis 25 x G Performance 8), con un peso de 35.0 ± 2.5 kg al momento de la cirugía, a los cuales se les implantó una cánula “T” en el íleon terminal(16). Después de la cirugía los cerdos se alojaron individualmente en jaulas

Los datos de la DATT de la materia seca, proteína y energía de los subproductos de cártamo se analizaron según un diseño en cuadro latino 5 x 5(14) empleando el procedimiento GLM del paquete estadísticos SAS(15).

Experimento 2. Digestibilidad aparente ileal (DAI)

Cuadro 2. Dietas del experimento de digestibilidad aparente del tracto total (%)

Ingrediente

Caseína

Subproductos de cártamo Pasta Subproducto Sin moler Molido Sin moler Molido

Caseína Subproductos de cártamo Pasta Pasta molida Subproducto Subproducto molido Almidón de maíz Azúcar Fibra Aceite de maíz Carbonato de calcio Ortofosfato Sal Vitaminas Minerales Óxido de titanio

17.80

62.44 5.00 9.00 3.00 0.90 0.88 0.50 0.16 0.07 0.25

38.77 5.00 3.64 2.88 0.90 0.88 0.50 0.16 0.07 0.25

38.77 5.00 3.64 2.88 0.90 0.88 0.50 0.16 0.07 0.25

17.11 5.00

66.70 17.11 5.00

1.23 0.90 0.88 0.50 0.16 0.07 0.25

1.23 0.90 0.88 0.50 0.16 0.07 0.25

TOTAL

100.00

100.00

100.00

100.00

733 2.16

571 1.69

1594 1.77

Tamaño de partícula, µm: Media Desviación estándar

7.20

7.20

7.20

7.20

39.75 39.75 66.70

333

100.00 916 1.82


Gerardo Mariscal-Landín, et al. / Rev Mex Cienc Pecu 2017;8(4):331-340

metabólicas localizadas en un corral con temperatura controlada a 19 ± 2 °C. Se utilizaron cerdos de ese peso, ya que Messad et al(17) mencionan que el peso de los animales afecta los coeficientes de digestibilidad ileal, siendo diferentes los coeficientes en los animales con pesos inferiores a 25 kg; no existiendo diferencias en los coeficientes de DEI determinados en animales con diferente peso pero que pertenezcan al mismo grupo (mayores de 25 kg). El periodo posoperatorio duró 21 días, durante el cual los cerdos consumieron una dieta de crecimiento con 160 g de PC/kg, proporcionada dos veces al día (0800 y 1800 h). La cantidad ofrecida se incrementó diariamente hasta que los cerdos alcanzaron su consumo previo a la cirugía. En la elaboración de las dos dietas experimentales se emplearon los mismos subproductos de cártamo (Pasta, Subproducto) previamente molidos (a través de una criba de 3 mm) y caseína; además, se preparó una dieta testigo utilizando caseína como proteína de referencia (Cuadro 3).

según el método propuesto por Furuya y Kaji(10) empleando los valores de pérdidas endógenas reportadas por Mariscal-Landín y Reis de Souza(19). Los datos de la DAI de las dietas experimentales (caseína-Subproductos de cártamo) y la DAI y DEI de los subproductos de cártamo se analizaron de acuerdo a un diseño completamente al azar(14), empleando el procedimiento GLM del paquete estadístico SAS(15); existiendo cuatro repeticiones por dieta (tratamiento).

Alimentación El manejo alimenticio fue similar en los dos experimentos; los cerdos se alimentaron dos veces al día (0008 y 0018 h) a razón de 2.5 veces su requerimiento de ED de mantenimiento, el cual se estimó en 460 KJ de ED/kg de PV0.75(20), el agua se proporcionó a libertad a través de un bebedero de chupón. En ambos experimentos las vitaminas y minerales se adicionaron a las dietas para proporcionar o exceder los requerimientos recomendados por el NRC(21), el óxido de titanio se incluyó a razón de 2.5 g/kg como marcador de digestibilidad.

La digesta ileal se colectó en bolsas de plástico (11 cm de largo x 5 cm de ancho); a las bolsas se les agregaron 10 ml de una solución de HCl 0.2 M con el objeto de bloquear toda actividad bacteriana. Las bolsas se fijaron a la cánula con una liga a las 0800 h del día uno y se colectó la digesta ileal durante 12 h continuas durante los días de muestreo. Conforme se colectó la digesta ileal, ésta se transfirió a un contenedor para proceder inmediatamente a congelarla a –20 °C hasta su liofilización.

Cuadro 3. Dietas del experimento de digestibilidad ileal (%) Subproductos de cártamo Ingrediente

Los dos periodos tuvieron una duración de siete días (cinco de adaptación a la dieta y dos de colecta ileal). En el periodo experimental (primer periodo) los ocho cerdos se alimentaron con una de las dos dietas experimentales (cuatro cerdos por tratamiento); en el segundo periodo (no experimental, utilizado para conocer la digestibilidad de la proteína y aminoácidos de la caseína en cada cerdo), los ocho cerdos se alimentaron con la dieta testigo (dieta a base de caseína); y su digestibilidad únicamente se utilizó para estimar la DAI de los subproductos de cártamo utilizando el método de diferencia(18), y posteriormente se estimó la DEI

334

Caseína

Pasta Subproducto

Caseína Subproductos de cártamo: Pasta molida SPC molido Almidón de maíz Azúcar Fibra Aceite de maíz Carbonato de calcio Ortofosfato Sal Vitaminas Minerales Titanio

19.00

13.11

14.89

61.24 5.00 9.00 3.00 0.90 0.88 0.50 0.16 0.07 0.25

56.13 5.00

20.00 54.35 5.00

3.00 0.90 0.88 0.50 0.16 0.07 0.25

3.00 0.90 0.88 0.50 0.16 0.07 0.25

TOTAL

100.00

100.00

100.00

20.00


VALOR NUTRITIVO DE SUBPRODUCTOS DE CÁRTAMO PARA CERDOS EN FINALIZACIÓN

Preparación de muestras y análisis químicos

en el ingrediente ensayo, DAIde es la digestibilidad (Ileal o del tracto total) aparente de la dieta ensayo, DAIdt es el coeficiente de digestibilidad (Ileal o del tracto total) aparente de la dieta basal, Nit es el nivel de contribución de un nutrimento del ingrediente testigo a la dieta ensayo (en proporción decimal), y Nie es el nivel de contribución de un nutrimento del ingrediente ensayo a la dieta ensayo (en proporción decimal).

Las excretas se secaron en estufa de aire forzado a 55 °C durante 48 h y las muestras de digesta ileal se liofilizaron. Posteriormente, las muestras secas de excremento y de digesta liofilizada se molieron a través de una malla de 1 mm en un molino de laboratorio (Arthur H. Thomas Co. Philadelphia, PA). Los siguientes análisis se realizaron en las dietas experimentales y en las muestras de digesta ileal y excremento: MS y PC de acuerdo a los métodos 934.01 y 976.05 del AOAC(22), óxido de titanio según Myers(23). La preparación de las muestras para la determinación de AA se realizó según el método 994.12 del AOAC(22), el cual consiste en hidrolizar las muestras a 110 °C durante 24 h en HCl 6M. Los análisis de AA se realizaron por medio de cromatografía en fase reversa según el método descrito por Henderson et al(24) en un HPLC de marca Hewlett Packard, modelo 1100. El tamaño de partícula en los subproductos de cártamo (molidos y sin moler) se determinó según el método reportado por Baker(25), empleando las mallas 4, 10, 16, 35 y 120.

Para estimar la digestibilidad estandarizada ileal (DEI) se utilizó la fórmula propuesta por Furuya y Kaji(10): DEI = DAI + (Endógeno ⁄Consumido) × 100 Donde DEI es la digestibilidad estandarizada ileal de un nutrimento, DAI es la digestibilidad aparente ileal de un nutrimento, Endógeno es la cantidad endógena excretada del nutrimento en mg/kg de materia seca consumida (en el cálculo se utilizó el endógeno reportado por Mariscal-Landín y Reis de Souza(19)), Consumido es la cantidad de nutrimento consumido en miligramos por kilo de materia seca consumida.

Análisis de los datos La DAI y DATT de la proteína y aminoácidos de las dietas experimentales se calcularon empleando la siguiente ecuación(26):

RESULTADOS El tamaño de partícula de los subproductos de cártamo sin moler fue de: SPC 1,594 µm; pasta 733 µm; de los subproductos de cártamo molidos fue: SPC 916 µm; pasta 571 µm (Figura 1).

DAI/DATT = 1 − [(ID × AF)⁄(AD × IF)] Donde DAI/DATT es la digestibilidad aparente (leal o del tracto total) de un nutrimento en la dieta, ID es la concentración del indicador en la dieta (mg/kg de MS), AF es la concentración del nutrimento en la digesta ileal o excremento (mg/kg de MS), AD es la concentración del nutrimento en la dieta (mg/kg de MS), IF es la concentración del indicador en la digesta ileal o excremento (mg/kg de MS).

Figura 1. Porcentajes de tamaño de partículas de los subproductos de cártamo

Para estimar en los subproductos de cártamo la DAI de la materia seca, proteína y aminoácidos, así como la DATT de la materia seca, proteína y energía, se empleó el método de diferencia, utilizando como ingrediente basal a la caseína, según el método propuesto por Fan y Sauer(18): DAImp/DATTmp = [DAIde – (DAIdt × Nit)]/Nie Donde DAImp/DATTmp es la digestibilidad (Ileal o del tracto total) aparente de un nutrimento

335


Gerardo Mariscal-Landín, et al. / Rev Mex Cienc Pecu 2017;8(4):331-340

Cuadro 4. Digestibilidad aparente del tracto total. Experimento 1

Criterio Materia seca Proteína Energía

Caseína 93.0a 97.5a 92.2a

Subproductos de cártamo Proteína Energía Energía, kcal

Subproductos de cártamo Pasta Subproducto Sin moler Molida Sin moler Molida

EEM

77.5c 90.8b 76.7b

79.2bc 91.5b 77.7b

79.0bc 91.1b 76.3b

79.8b 87.3c 76.2b

0.59 0.48 0.62

86.8a 56.4b 1419b

87.9a 58.6b 1529b

83.7b 64.6a 1738a

76.0c 64.5a 1731a

0.87 1.05 51

EEM= Error estándar de la media. abc Valores en la misma línea con diferente literal difieren (P<0.05).

Experimento 1. Digestibilidad del tracto total

caseína solo sirvió para estimar la digestibilidad de la proteína de los subproductos de cártamo (SPC y pasta). En el Cuadro 5 se observa que la dieta del SPC tuvo una mayor digestibilidad ileal (P<0.05) de la materia seca, proteína, lisina, valina, fenilalanina, ácido glutámico y serina que la dieta de pasta. En los otros aminoácidos aunque no se observaron

La materia seca, proteína y energía fueron más digestibles (P<0.05) en la dieta de caseína que en las dietas de subproductos de cártamo y caseína (Cuadro 4). La digestibilidad de la materia seca fue mayor (P<0.05) en la dieta del SPC molido (79.8 %) que en la pasta sin moler (77.5 %); las otras dos dietas, SPC sin moler (79.0 %) y pasta molida (79.2 %) tuvieron una digestibilidad similar (P>0.05) a ambas dietas. La digestibilidad de la proteína de la dieta de SPC molido (87.3 %) fue menor (P<0.05) a las de las otras dietas (91.1 % en promedio). La DATT de la energía de las dietas caseína-subproductos de cártamo fue similar en todas ellas (76.7 %) e inferior (P<0.05) a la de la dieta de caseína (92.2 %).

Cuadro 5. Digestibilidad aparente ileal de las dietas. Experimento 2 Ingrediente

Al estimar la digestibilidad de las materias primas se observó una mayor digestibilidad (P<0.05) de la proteína de pasta de cártamo (molida y sin moler, 87.9 y 86.8 % respectivamente); intermedia en el SPC sin moler (83.7 %) e inferior en el SPC molido (76.0 %). La digestibilidad de la energía fue mayor (P<0.05) en el SPC molido y sin moler (64.5 y 64.6 % respectivamente) que en la pasta molida y sin moler (58.6 y 56.4 % respectivamente). Esta condición propició que el SPC tuviera en promedio 240 kcal más de energía digestible (1,734) que la pasta (1,494) (P<0.05).

Experimento 2. Digestibilidad Ileal Solo se muestran las digestibilidades de las dietas experimentales, ya que la digestibilidad de

Subproductos de cártamo Pasta Subproducto

Materia seca Proteína

83.1b 83.2b

87.4a 87.7a

1.20 1.27

Ácido aspártico Ácido glutámico Alanina Arginina Fenilalanina Glicina Histidina Isoleucina Leucina Lisina Serina Tirosina Treonina Valina

85.3 89.0b 71.0 81.5 91.7b 86.9 90.6 86.9 91.7 91.8b 76.8b 87.4 82.7 86.2b

88.1 92.1a 76.5 85.1 93.0a 93.2 92.2 90.2 93.1 94.2a 84.7a 90.2 87.0 89.7a

1.19 0.83 2.62 1.97 0.64 3.22 0.91 0.74 0.61 0.64 1.75 2.03 1.61 0.78

EEM= error estándar de la media. ab Valores en la misma línea con diferente literal, difieren (P<0.05).

336

EEM


VALOR NUTRITIVO DE SUBPRODUCTOS DE CÁRTAMO PARA CERDOS EN FINALIZACIÓN

diferencias significativas entre dietas, la DAI fue numéricamente mayor en la dieta del SPC que en la dieta de pasta.

un cerdo en crecimiento-finalización. Las proteínas de reserva representan la mayor proporción de las proteínas presentes en la pasta de las semillas de oleaginosas, y son en realidad una mezcla de varios tipos de proteínas (albúminas, globulinas y glutelinas)(29), las cuales son solubles en agua y en alcohol, lo que favorece su digestión. Las proteínas de las semillas de oleaginosas son similares entre sí, todas están compuestas de cuatro fracciones: 2s (proteína de bajo peso molecular), 7s (proteína de peso molecular medio), 11s (proteína de alto peso molecular) y de 15 a 18s (polímeros de proteína). La fracción 10 a 12s es la más abundante en la proteína de cártamo(30); tiene un alto peso molecular y se caracteriza por tener un alto contenido de amino ácidos aromáticos, ácidos y un bajo contenido de lisina. También se caracterizan por tener una baja proporción de α hélice y ser ricas en la estructura de lámina β; y por contener carbohidratos(30). La presencia de láminas β y de carbohidratos ha sido asociada a una menor digestibilidad de las proteínas(31). La digestibilidad ileal estandarizada obtenida en este trabajo es similar a la reportada por Farran et al(3) en gallos. Es importante remarcar que

La DAI y la DEI de la proteína y aminoácidos de los subproductos de cártamo (SPC y pasta), Cuadro 6, fue similar (P>0.05) entre ellos, aunque numéricamente fue mayor en el SPC. La DEI de la proteína fue de 78.6 y 92.2 % para el SPC y para la pasta respectivamente. La DEI de los aminoácidos fue de 75.3 y 81.9 para el SPC y para la pasta respectivamente. DISCUSIÓN La semilla de cártamo contiene entre 14 y 19 % de proteína, 27 a 35 % de aceite, 40 a 45 % de FDN, 30 a 32 % de FDA y de 30 a 34 % de FC(27,28), por eso al extraer el aceite queda un subproducto con un contenido de proteína que varía de 19 a 29 % de proteína, la cual se caracteriza por ser deficiente en lisina y en treonina, ya que solamente aporta alrededor del 50 % del requerimiento de lisina, y alrededor del 90 % del requerimiento de treonina de

Cuadro 6. Digestibilidad aparente y estandarizada Ileal de los subproductos de cártamo

Pasta Proteína Ácido aspártico Ácido glutámico Alanina Arginina Fenilalanina Glicina Histidina Isoleucina Leucina Lisina Serina Tirosina Treonina Valina

70.6 77.1 66.9 51.0 80.2 84.5 80.0 81.1 63.7 80.6 74.3 39.5 45.8 71.1 63.3

Subproductos de cártamo DAI Subproductos Pasta 84.2 81.1 75.7 53.8 89.4 84.8 89.7 83.3 70.5 82.0 75.3 52.5 50.6 79.6 70.5

78.6 81.4 71.9 59.1 84.1 88.7 86.7 84.5 73.0 86.6 79.2 49.1 54.1 83.2 72.5

EEM= error estándar de la media. DAI = Digestibilidad aparente a nivel ileal. DEI = Digestibilidad estandarizada a nivel ileal.

337

DEI Subproductos 92.2 86.0 79.8 63.3 94.0 89.9 96.2 86.8 80.3 88.4 80.4 64.3 61.4 95.6 79.7

EEM 5.15 4.40 4.34 2.47 4.69 3.73 4.69 4.58 5.26 4.54 6.49 8.47 9.80 7.31 4.84


Gerardo Mariscal-Landín, et al. / Rev Mex Cienc Pecu 2017;8(4):331-340

no existe información de la digestibilidad estandarizada ileal de la proteína y aminoácidos de cártamo con los cuales se puedan comparar los resultados. En el único trabajo encontrado(3), no se observó una mejoría de la digestibilidad verdadera de los aminoácidos al eliminar la cáscara del subproducto de cártamo, con excepción de tirosina y lisina. Esto es debido a que la cáscara de cártamo está compuesta principalmente de fibra insoluble (celulosa, y la mayoría de las hemicelulosas)(32), la cual se caracteriza por tener un bajo efecto sobre la digestibilidad ileal de la proteína y aminoácidos(33-37). También se caracteriza porque disminuye el tiempo de permanencia de la digesta a nivel del tubo digestivo posterior (ciego y colon)(32,33), lo que limita la fermentación de la materia orgánica por las bacterias intestinales, reduciendo la digestibilidad total de la proteína y la energía(33,35,38), por lo que aumenta la cantidad de bolo fecal, disminuyendo de esa manera la digestibilidad de la materia seca(33,38), como se observó en este trabajo.

formulación de raciones (en el que se considera la digestibilidad ileal estandarizada de los aminoácidos), los datos provistos aquí habilitan la incorporación de los subproductos de cártamo en dietas para cerdos al proporcionar los coeficientes de DEI de los aminoácidos y la DATT de la energía. CONCLUSIONES E IMPLICACIONES La digestibilidad ileal de la proteína y aminoácidos de los dos subproductos de cártamo (SPC y Pasta) fue similar; los valores promedio de los coeficientes de digestibilidad estandarizada a nivel ileal de los aminoácidos fueron de 78.6, similares a otras fuentes proteicas. Sin embargo, el contenido de energía digestible de ellos fue bajo 1,419 (Pasta) y 1,738 (SPC) kcal/kg. AGRADECIMIENTOS Se agradece al INIFAP por su apoyo financiero al proyecto “Incorporación de las oleaginosas con mayor potencial en México, para la solución de una problemática fundamental en los mercados agrícola, industrial y pecuario” Proyecto SIGI Número 11311419345. Así como a la Química Jasmín Ruíz Jiménez, por los análisis de aminoácidos; a la MVZ Yamily Ramírez por los análisis de laboratorio, y a los MVZ Julio César Baltazar Vázquez y Víctor Balderrama Pérez por el cuidado de los animales.

La menor digestibilidad de la proteína del SPC molido, pudo deberse a que por la molienda varió el contenido de proteína de las diferentes fracciones. Por lo que al haber sido ofrecido el alimento en forma de harina, la proteína pudo haberse estratificado y el animal haber consumido una mayor proporción de fracciones grandes, las cuales tienen una mayor proporción de proteína ligada a la fibra como la proteína extensina(39-41); una menor digestibilidad de la proteína en las fracciones pequeñas en relación a las fracciones grandes también fue observada en la pasta de soya(42). La digestibilidad de la proteína de los subproductos de cártamo (SPC y pasta) fue similar a la reportada para la pastas de canola y girasol(21,43,44), y granos secos de destilería(45); aunque la digestibilidad de la energía y el contenido de energía digestible de los subproductos de cártamo (SPC y Pasta) fue menor a la reportada para esas materias primas(21,43,45).

LITERATURA CITADA

El conjunto de resultados obtenidos en el presente trabajo, permiten pensar en el uso de los subproductos de cártamo en dietas para cerdos en las últimas etapas de producción o en el pie de cría, ya que el contenido de fibra permitido en esas raciones es mayor en ese tipo de animales(13). Actualmente, en un contexto moderno de

338

1.

Bozan B, Temelli F. Chemical composition and oxidative stability of flax, safflower and poppy seed and seed oils. Bioresour Technol 2008;99:6354-6359.

2.

Heuzé V, Tran G, Chapoutot P, Bastianelli D, Lebas F, Renaudeau D. Safflower (Carthamus tinctorius) seeds and oil meal. A programme by INRA, CIRAD, AFZ, FAO. 2012.

3.

Farran M, Barbour G, Usayran N, Kayouli C. Metabolizable energy and amino acid digestibility of decorticated extruded safflower meal. Poult Sci 2010;89:1962-1966.

4.

Thomas VM, Katz RJ, Auld DL, Peterson CL. Value of mechanically extracted rape and safflower oilseed meals as protein supplements for growing lambs. Anim Feed Sci Technol 1984;11:269-277.

5.

Dschaak CM. Production performance and profiles of milk fatty acids of lactating dairy cows fed whole safflower seed containing high fat and low fiber [Master thesis]. Logan: Utah State University; 2009.


VALOR NUTRITIVO DE SUBPRODUCTOS DE CÁRTAMO PARA CERDOS EN FINALIZACIÓN

6.

Alizadeh A, Alikhani M, Ghorbani G, Rahmani H, Rashidi L, Loor J. Effects of feeding roasted safflower seeds (variety IL-111) and fish oil on dry matter intake, performance and milk fatty acid profiles in dairy cattle. J Anim Physiol Anim Nutr 2012;96:466-473.

7.

Smith JR. El cártamo. Historial, desarrollo, características, procesamiento y usos. A&G 2002;47:175-181.

8.

Mariscal-Landín G, Reis de Souza TC, Hernández DAA, Escobar GK. Pérdidas endógenas de nitrógeno y aminoácidos en cerdos y su aplicación en la estimación de los coeficientes de digestibilidad ileal de la proteína y aminoácidos de las materias primas. Téc Pecu Méx 2009;47:371-388.

9.

Stein HH, Pedersen C, Wirt AR, Bholke RA. Additivity of values for apparental and standardized ileal digestibility of AA in mixed diets fed to growing pigs. J Anim Sci 2005;83:2387-2395.

24. Henderson JH, Ricker RD, Bidlingmeyer BA, Woodward C. Rapid, accurate and reproducible HPLC analysis of amino acids. Amino acid analysis using Zorbax Eclipse AAA columns and the Agilent 1100 HPLC. Agilent technologies 2000(Part No.5980-1193E):10 pag. www.agilent.com/chem/supplies. 25. Baker S, Herrman T. Evaluating particle size. Manhattan: Kansas State University; 2002. 26. Stein HH, Fuller MF, Moughan PJ, Sève B, Moshentin R, Jansman AJM, et al. Deffinition of apparent, true and standardized ileal digestibility of amino acids in pigs. Livest Sci 2007;109:282-285. 27. Mahdi M, Ahmad H. Nutritional evaluation of full-fat Safflower seed for broiler chickens. Ital J Anim Sci 2010;9:268-272. 28. Golkar P, Arzani A, Rezaei A. Genetic variation in safflower (Carthamus tinctorious L.) for seed quality-related traits and intersimple sequence Repeat (ISSR) markers. Int J Mol Sci 2011;12:2664-2677.

10. Furuya S, Kaji Y. Additivity of the apparent and true digestible amino acid supply in barley, maize, wheat or soya bean based diets for growing pigs. Anim Feed Sci Technol 1991;32:321-331.

29. Jahan-Mihan A, Luhovyy B, El Khoury D, Anderson G. Dietary proteins as determinants of metabolic and physiologic functions of the gastrointestinal tract. Nutrients 2011;3:574-603.

11. CIOMS. International guiding principles for biomedical research involving animals. In: Organization WH editor. Council for International Organizations of Medical Sciences ed. Geneva; 1985.

30. Prakash V, Rao M. Structural similarities among the high molecular weight protein fractions of oilseeds. J Biosci 1988;13:171-180.

12. Diario Oficial de la Federación. Especificaciones técnicas para la producción, cuidado y uso de los animales de laboratorio. Norma Oficial Mexicana NOM-062-ZOO-1999. Diario Oficial de la Federación 2001 (miércoles 2 de agosto).

31. Crevieu-Gabriel I. Digestion de protéines végétales chez les monogastriques. Example des protéines de pois. INRA Prod Anim 1999;12:147-161.

13. Noblet J, van Milgen J. Energy value of pig feeds: effect of pig body weight and energy evaluation system. J Anim Sci 2004;82(ESuppl):E229-E238.

32. Le Gall M, Montagne L, Meunier-Salaün MC, Noblet J. Valeurs nutritives des fibres, conséquences sur la santé du porcelet et le bien-être de la truie. INRA Prod Anim 2009;22:17-24.

14. Steel RGD, Torrie JH. Principles and procedures of statistics. A Biometrical approach. 2nd ed. New York: McGraw-Hill; 1980.

33. Bach Knudsen KE. The nutritional significance of "dietary fibre" analysis. Anim Feed Sci Technol 2001;90:3-20.

15. SAS version 9.2. Statistical Analysis Systems Institute User’s guide. Statistical Analysis Systems Institute User’s guide. 9.2 ed. Cary NC, USA: SAS Institute Inc.; 2008.

34. Li S, Sauer WC, Hardin RT. Effect of dietary fibre level on amino acid digestibility in young pigs. Can J Anim Sci 1994;74:327-333.

16. Reis de Souza TC, Mar BB, Mariscal LG. Canulación de cerdos posdestete para pruebas de digestibilidad ileal: Desarrollo de una metodología. Téc Pecu Méx 2000;38:143-150.

35. Dégen L, Halas B, Babinszky L. Effect of dietary fibre on protein and fat digestibility and its consequences on diet formulation for growing and fattening pigs: A review. Acta Agric Scand Sect A. Anim Sci 2007;57:1-9.

17. Messad F, Létourneau-Montminy MP, Charbonneau E, Sauvant D, Guay F. Prediction of standardized ileal digestibility and essential amino acid content of ingredients in swine: A meta-analysis. Anim Feed Sci Technol 2015;207:204-221.

36. Mariscal-Landín G, Reis de Souza TC, Ramírez RE. Effects of corn gluten feed inclusion at graded levels in a corn-soybean diet on the ileal and fecal digestibility of growing pigs. J Anim Sci Biotechnol 2014;5:40.

18. Fan MZ, Sauer WC. Determination of apparent ileal amino acid digestibility in barley and canola meal for pigs with the direct, difference, and regression methods. J Anim Sci 1995;73:23642374.

37. Mariscal-Landín G, Reis de Souza TC, Bayardo UA. Neutral detergent fiber increases endogenous ileal losses but has no effect on ileal digestibility of amino acids in growing pigs. Anim Sci J 2017;88:322-330.

19. Mariscal-Landín G, Reis de Souza TC. Endogenous ileal losses of nitrogen and amino acids in pigs and piglets fed graded levels of casein. Arch Anim Nutr 2006;60:454-466.

38. Souffrant WB. Effect of dietary fibre on ileal digestibility and endogenous nitrogen losses in the pig. Anim Feed Sci Technol 2001;90:93-102.

20. INRA. L'alimentation des animaux monogastriques: porc, lapin, volailles. Paris, France: Institut National de la Recherche Agronomique; 1984.

39. Sun T, Li S, Ren H. Profilin as a regulator of the membrane-actin cytoskeleton interface in plant cells. Front Plant Sci 2013;4:512.

21. NRC. Nutrient requirements of swine. Tenth Rev ed. Washington, DC: The National Academy Press; 1998.

40. Williamson MP. The structure and function of proline-rich regions in proteins. Biochem J 1994;297:249-260.

22. AOAC. Official methods of analysis. 17 th ed. Arlington, VA. USA: Assoc Offic Ana Chem; 2000.

41. Bjergegaar C, Sørensen H, Sørensen S. Dietary fibres-important parts of high quality food and feeds. J Anim Feed Sci 1997;6:145161.

23. Myers WD, Ludden PA, Nayigihugu V, Hess BW. Technical Note: A procedure for the preparation and quantitative analysis of samples for titanium dioxide. J Anim Sci 2004;82:179-183.

42. Messerschmidt U, Eklund M, Rist VTS, Rosenfelder P, Spindler HK, Htoo JK, et al. Effect of particle size and heat treatment of soybean

339


Gerardo Mariscal-Landín, et al. / Rev Mex Cienc Pecu 2017;8(4):331-340

meal on standardized ileal digestibility of amino acids in growing pigs. J Anim Sci 2013;90(Suppl 4):119-121.

44. Mariscal LG, Ávila E, Tejada I, Cuarón IJA, Vásquez C. Tablas del contenido de aminoácidos totales y de los coeficientes de digestibilidad verdadera para aves y cerdos. Querétaro, México: INIFAP; 1997.

43. INRA. Tables de composition et de valeur nutritive des matières premières destinées aux animaux d'élevage. Porcs, volailles, bovins, ovins, caprins, lapins, chevaux, poissons. Paris, France: Institut National de la Recherche Agronomique; 2002.

45. Almeida F, Htoo J, Thomson J, Stein H. Amino acid digestibility of heat damaged distillers dried grains with solubles fed to pigs. J Anim Sci Biotechnol 2013;4:44.

340


Rev Mex Cienc Pecu 2017;8(4):341-351

http://dx.doi.org/10.22319/rmcp.v8i4.4643

Acondicionamiento de becerros previo a la recría bajo pastoreo en trópico seco: efectos sobre el peso corporal y la condición sanitaria Conditioning around weaning of calves grazing in the dry tropic: effects upon body weight and health condition Rafael Guarneros Altamiranoa, Erasmo Gutiérrez Ornelasb, Hugo Bernal Barragánb*, Ramiro Avalos Ramírezb, Epigmenio Castillo Gallegosc, Emilio Olivares Sáenzb RESUMEN Se realizaron tres experimentos (2 en época seca y 1 en época de lluvias) utilizando 96 becerros (Simmental X Cebú) para evaluar el efecto del acondicionamiento realizado durante 112 días (del día 28 predestete al día 84 posdestete). En cuatro períodos de 28 días cada uno, se evaluó peso y condición corporal de los animales, nitrógeno ureico (NU) y glucosa (GS) en suero sanguíneo, así como la incidencia de enfermedades (IE) de becerros en pastoreo. Resultados de peso corporal, ganancia de peso (GDP) acumulativa, NU y GS se evaluaron con ANOVA en un diseño factorial de 2 tratamientos x 2 sexos; IE se analizó con Ji-cuadrada. No hubo diferencia de peso (P=0.552) ni de CC (P=0.891) de las vacas debido a tratamientos. No hubo interacción acondicionamiento x sexo (P= 0.853) ni efecto de sexo (P=0.586) sobre el crecimiento de becerros (media=357 g/día). El acondicionamiento originó mejor GDP (507 vs 281 g/día; P=0.001) en la época seca y menor IE (P=0.001) que el tratamiento testigo. En época de lluvias el acondicionamiento incrementó 31 % el crecimiento en 112 días respecto al testigo (370 vs 281 g/día; P=0.026). Las concentraciones de NU (P=0.425) y GS (P=0.270) fueron similares entre tratamientos. En conclusión, el acondicionamiento de becerros mejoró la GDP posdestete, redujo la incidencia de enfermedades en becerros, y la disminución de peso y condición corporal en sus madres, durante la época seca. PALABRAS CLAVE: Acondicionamiento de becerros, Ganancia de peso, Trópico seco, Pastoreo.

ABSTRACT Three experiments (two in the dry season and one in the rainy season) were conducted utilizing 96 Simmental x Zebu calves, with the aim to evaluate the effect of preconditioning during 112 d starting at d 28 preweaning. In four periods of 28 d each, body weight and body condition score of the animals, blood urea nitrogen (BUN) and glucose (SG) in serum, as well as disease frequency in grazing calves were evaluated. Data of BW, cumulative body weight gain (BWG) BUN, and SG were analyzed with ANOVA in a 2 treatments x 2 sex factorial arrangement; morbility was analyzed by Ji square. BW (P=0.552) and BCS (P=0.891) of nursing cows did not vary due to treatments. Interaction conditioning x sex was not significant ( P=0.853), and sex did not influenced growth of calves (mean=357 g/d). Conditioning led to better BWG (507 vs 281 g/d; P=0.001) in the dry season and less morbility (P=0.001) than the control group. During the rainy season preconditioning increased 31 % the cumulative BWG in 112 d compared to control (370 vs 281 g/d; P=0.026). Concentrations of BUN (P=0.425) and SG (P=0.270) were similar between treatments. In conclusion, preconditioning of calves improved BWG postweaning, reduced morbility and loss of weight and BCS of lactating cows during the dry season. KEY WORDS: Pre-weaning, Conditioning of calves, Body weight gain, Dry tropics.

Recibido el 4 de enero de 2016. Aceptado el 19 de abril de 2016. a

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), Campo Experimental Las Huastecas, Altamira, Tamaulipas, México.

b

Universidad Autónoma de Nuevo León, Facultad de Agronomía y Facultad de Medicina Veterinaria y Zootecnia. México. Nuevo León, México.

c

Universidad Nacional Autónoma de México, Facultad de Medicina Veterinaria y Zootecnia, Martínez de la Torre, Veracruz, México.

*

Autor para correspondencia: hubernal05@gmail.com

341


Rafael Guarneros Altamirano, et al. / Rev Mex Cienc Pecu 2017;8(4):341-351

INTRODUCCIÓN

becerros mantenidos en el trópico seco durante las épocas seca y de lluvias. Además, evaluar los cambios de peso y la condición corporal de las madres de estos becerros.

En México, la ganadería bovina productora de carne se conforma, principalmente, de tres segmentos: sistema vaca-becerro(1), el repasto de los becerros después del destete y la finalización del ganado en corral. Generalmente, en el trópico ocurre el destete a los siete meses de edad, cuando los becerros pesan entre 140 y 160 kg(2,3). Durante el paso del destete al repasto, los becerros sufren cambios en el régimen de alimentación, en su manejo y ambiente, que les provocan estrés(4), dando esto como resultado bajos aumentos de peso y presencia de enfermedades(5).

MATERIAL Y MÉTODOS

Descripción del área de estudio Se trabajó en dos ranchos comerciales ubicados en Aldama, Tamaulipas, con clima semicálido subhúmedo, A(C)w1(17), con una temperatura promedio de 28 °C y una precipitación pluvial de 800 mm/año. Dos experimentos (Exp 1 y 3) se realizaron durante dos períodos de sequía (enero a mayo 2012 y 2013) en el rancho “Don Enrique”, ubicado en el km 37 de la carretera Aldama-Barra del Tordo interior 7, a 23°03’23.64” N y 97°49’11.00” O y a una altitud de 15 msnm. En el rancho “Laguna Colorada”, ubicado en el km 23 de la carretera Estación Manuel-Aldama interior 19, a 23°00’32.88” N y 98°10’07.60” O y a 232 msnm, se evaluó el efecto del acondicionamiento durante el período de lluvias del 2012 (Exp 2).

El acondicionamiento de los becerros previo al destete(6) consiste en la aplicación de vitaminas liposolubles, suplementación alimenticia, la realización de diferentes prácticas de manejo que ayudan al control de parásitos internos y externos, así como la inmunización contra diferentes enfermedades(7,8), que ayudan a disminuir el estrés, reducen la incidencia de enfermedades y mejoran el comportamiento de los animales en su desarrollo(9,10). La información generada en México sobre el acondicionamiento predestete de becerros resalta la inmunización e identificación en el becerro(11) y la suplementación predestete(12,13), aunque falta información sobre su efecto en la fase posdestete.

Las temperaturas mínima, máxima y promedio fueron 14.2, 31.4, y 25.9 °C (Exp 1), 14.2, 33.0 y 27.7 °C (Exp 2), y 9.4, 35.0, y 30.5 °C (Exp 3). La precipitación registrada fue de 212.7, 436, y 102.5 mm (Exp 1, 2 y 3, respectivamente).

El contenido de nitrógeno ureico en la sangre puede ser utilizado como indicador de la eficiencia de utilización del nitrógeno ingerido por los animales(14). El nivel y tipo de suministro energético pueden influir sobre el contenido de glucosa sanguínea y en los datos productivos de animales rumiantes(15).

Manejo animal Se utilizaron 96 becerros lactantes de aproximadamente seis meses de edad, de la cruza Simmental x Cebú, nacidos en invierno de 2012 y 2013 (época seca) y verano de 2012 (época de lluvias). En cada experimento los becerros se identificaron en forma individual, asignándose aleatoriamente 16 animales (7 machos y 9 hembras) a cada uno de los dos tratamientos: T1= testigo sin acondicionamiento; T2= becerros acondicionados durante un período de 112 días (28 días antes del destete a 84 días después del destete).

Considerando que en México no se cuenta con protocolos para promover un mejor comportamiento del becerro, previo a su entrada al repasto(12,16) y con ello aprovechar el potencial existente en las regiones tropicales del país, el objetivo del presente estudio fue evaluar el efecto del acondicionamiento en becerros Simmental x Cebú antes del destete, y la suplementación posdestete, sobre la ganancia diaria de peso en el período de recría y sobre las concentraciones séricas de glucosa y nitrógeno ureico, así como la incidencia de enfermedades en

El acondicionamiento consistió en la aplicación de las siguientes prácticas: desparasitación vía subcutánea (s.c.) con ivermectina (Dectiver Premium, Lapisa) a razón de 1 ml/50 kg de peso corporal; 2 ml de vitaminas A, D3, y E por vía

342


ACONDICIONAMIENTO DE BECERROS PREVIO A LA RECRÍA BAJO PASTOREO EN TRÓPICO SECO

intramuscular (i.m.); aplicación de 5 ml/animal vía s.c. de la bacterina Ultrabac 7/Sumobac (Pfizer Animal Health) para prevenir enfermedades del complejo clostridial (Clostridium chavoei, C. septicum, C. novyi, C. sordellii, C. perfingens Tipos C&D, así como Haemophilus somnus), y aplicación s.c. de 5 ml/animal de vacuna contra rinotraqueitis viral bovina, diarrea viral bovina, pneumonías (PI3) y virus respiratorio sincicial bovino. Los animales se bañaron por inmersión en Flumetrina (Bayticol) a una dosis de 1 L/1000 L de agua, para el control de garrapata. Al grupo acondicionado también se le suplementó con un concentrado de 35 % de PC y 2.85 Mcal EM/kg MS, elaborado a base de 75 % de pasta de soya, 17 % de sorgo molido, 5 % de melaza y 3 % de sal mineralizada, ofrecido a razón de 20 g/kg PV0.75/día, desde el día 28 antes del destete hasta el día 84 posdestete(18). El mismo concentrado se utilizó para las épocas de lluvia y de sequía.

pastos al azar de acuerdo con la metodología descrita por Bobadilla et al(21), utilizando un cuadrante de 0.5 m2 y cortando el forraje disponible hasta una altura de 5 cm, en las praderas correspondientes a cada tratamiento, para analizar en laboratorio el valor nutricional de los pastos ahí presentes(22, 23). A cada animal se le extrajeron dos muestras de sangre, mediante punción de la vena coccígea. Para la determinación de glucosa (GS), la sangre se obtuvo utilizando un tubo Vacutainer monojection de 10 ml, con 15% de EDTA (K3). El plasma sanguíneo se analizó inmediatamente después de haber obtenido la muestra, para determinar glucosa, usando un equipo marca Accu-Chek performa (Roche, México), con tiras reactivas y chip de codificación. La muestra para analizar nitrógeno ureico (UN) en sangre, se obtuvo en tubos BD Vacutainer® serum (STERILE Interior). El suero se separó de la muestra coagulada por centrifugación a 2,000 rpm, y se congeló a -20 °C hasta su análisis. La determinación del UN fue llevada a cabo por el método de valoración colorimétrica de Berthelot modificado (fenol-hipoclorito) (Randox, México). La absorbancia a 600 nm de longitud de onda se determinó en un espectrofotómetro SP-830 plus Modelo SM110215 (Barnstead, Iowa, USA).

En la fase predestete el suplemento se ofreció diariamente al lote de animales del T2 en comederos móviles tipo “creep feeding”(19), y después del destete, se ofreció en comederos abiertos con, al menos, 1 m de espacio de comedero por animal, ajustando cada 14 días la cantidad de suplemento ofrecido por animal/día, de acuerdo al peso vivo estimado con base en el registro anterior de peso y la ganancia diaria proyectada para el periodo en cuestión.

La incidencia de enfermedades se determinó diariamente en cada grupo e individualmente en las fechas de pesaje, mediante la inspección y evaluación clínica o identificación de animales enfermos, que fueran diagnosticados con flujo nasal y fiebre (temperatura mayor de 37.5 °C), apatía, cojera o tristeza(24), procediendo a tratarlos con antibiótico (Fluvicina, 2 Millones UI/animal/24 h) y antipirético (Dipirona, 5 ml/animal/24 h) durante 2 o 3 días.

Los registros de peso de los animales (becerros y vacas), así como la toma de muestras sanguíneas se realizaron a las 0700 h, previo ayuno de 14 a 16 h, al iniciar los experimentos (a los 28 días antes del destete), así como el día de destete (día 0) y a los días 28, 56, 84 y 112 posdestete. Se evaluó la condición corporal (CC) a las vacas al inicio y a los 28 días de acuerdo con la metodología descrita previamente(20). Los dos grupos de animales (no acondicionados y acondicionados) se colocaron con sus madres en diferentes praderas hasta ser destetados, a los siete meses de edad aproximadamente. Después del destete, los grupos de estudio continuaron separados en potreros con buena disponibilidad de pastos Guinea (Panicum maximum) y Estrella Africana (Cynodon plecstostachyus). En las fechas antes señaladas se colectaron cinco muestras de

Análisis económico La información económica recabada para los animales acondicionados fue de tres rubros de gastos: control o manejo sanitario, suplemento alimenticio y mano de obra. Se consideraron los costos del desparasitante, vacunas, vitaminas y material utilizado, que dio un total de $23.09 MN/animal. El suplemento se consumió en su

343


Rafael Guarneros Altamirano, et al. / Rev Mex Cienc Pecu 2017;8(4):341-351

totalidad (no hubo rechazo) y se registrĂł un consumo promedio de 106.27 kg. El suplemento tuvo un costo de $7.17/kg, que multiplicado por el consumo, dio un costo de $761.95/animal. El costo de mano de obra ($130.18/animal) se calculĂł considerando el pago mensual del personal en cada unidad de producciĂłn (vaqueros y caporales) para el nĂşmero de animales que manejaron durante los cinco meses que durĂł el estudio. Para los animales no acondicionados solo se considerĂł el gasto de mano de obra ($130.18/animal), pues no se tuvieron gastos de manejo sanitario ni suplementaciĂłn. Para los cĂĄlculos econĂłmicos se considerĂł el precio ponderado a nivel nacional al mes de mayo de 2015, de $40.26/kg, publicado por la SecretarĂ­a de EconomĂ­a(25).

comparaciĂłn de medias mediante la prueba de t de Student(27). La frecuencia de animales enfermos de las vĂ­as respiratorias en el hato experimental en las diferentes ĂŠpocas y tratamientos se analizĂł mediante la prueba de Ji-cuadrada. RESULTADOS

Peso y condiciĂłn corporal de las vacas El peso de las vacas al inicio y al destete fue similar entre tratamientos (Cuadro 1). En los experimentos 1 y 3, durante los 28 dĂ­as previos al destete, las pĂŠrdidas de peso de las vacas madres de becerros sin acondicionamiento fueron entre 15 y 17 kg de peso, mientras que las madres de los becerros acondicionados y suplementados solo perdieron entre 5 y 7 kg, (P>0.05). En el Exp 2 (ĂŠpoca de lluvias), durante los 28 dĂ­as previos al destete, las madres de becerros incrementaron su peso en 20.6 kg (testigo) o 28.3 kg (acondicionados)

AnĂĄlisis estadĂ­stico El anĂĄlisis estadĂ­stico de los datos experimentales para cada perĂ­odo se realizĂł mediante un arreglo factorial 2 x 2 (dos niveles de acondicionamiento y dos sexos), teniendo un total de 16 unidades experimentales (animales) para cada tratamiento.

Cuadro 1. Peso (kg) y condiciĂłn corporal (CC) de las madres de becerros con y sin acondicionamiento durante 28 dĂ­as previos al destete

Se evaluaron las variables: ganancia total de peso, ganancia diaria de peso (GDP) acumulada en cuatro perĂ­odos: 1 (desde 28 dĂ­as antes del destete hasta el destete), 2 (desde 28 dĂ­as antes del destete hasta 28 dĂ­as posdestete), 3 (desde 28 dĂ­as antes del destete hasta 56 dĂ­as posdestete) y 4 (desde 28 dĂ­as antes del destete hasta 84 dĂ­as posdestete, es decir durante los 112 dĂ­as del experimento). La concentraciĂłn de glucosa (GS) y de nitrĂłgeno ureico (NU) en sangre, se evaluaron para cada muestreo por separado (al inicio, al destete, a los 28, 56 y 84 dĂ­as posdestete). Por este motivo no se incluyĂł el factor perĂ­odo en el modelo utilizado:

Variables

Acondicionamiento Sin Con

Exp 1, ĂŠpoca seca 2012 Peso inicial 456.10 CC inicial 4.00 Peso al destete 440.30 CC al destete 3.60 Cambio de peso -15.80 Cambio de CC -0.40

Yij= đ?&#x153;&#x2021;+ T +S + T x S + đ?&#x153;&#x20AC;(a) Donde Yijk= variable dependiente; Îź= media general; T= efecto del i-ĂŠsimo tratamiento; S= efecto del j-ĂŠsimo sexo; T x S= efecto de la interacciĂłn del i-ĂŠsimo tratamiento y el j-ĂŠsimo sexo; đ?&#x153;&#x20AC;(a)= error. Se utilizĂł el software SPSS para Windows versiĂłn 17(26). Cuando existiĂł efecto significativo (P<0.05) para alguna de las variables, se realizĂł la

344

EEM

P

441.60 4.01 434.30 3.75 -7.30 -0.25

16.90 0.17 16.60 0.12 6.29 0.16

0.543 0.987 0.797 0.389 0.342 0.495

Exp 2, ĂŠpoca de lluvias 2012 Peso inicial 460.90 422.00 CC inicial 4.34 3.93 Peso al destete 481.50 450.30 CC al destete 3.97 3.73 Cambio de peso +20.60 +28.30 Cambio de CC -0.37 -0.25

16.47 0.16 21.21 0.16 19.72 0.24

0.104 0.088 0.302 0.298 0.784 0.623

Exp 3, ĂŠpoca seca 2013 Peso inicial 512.70 CC inicial 3.68 Peso al destete 484.60 CC al destete 3.47 Cambio de peso -16.60 Cambio de CC -0.21

48.97 0.13 18.34 0.12 5.37 0.13

0.584 0.745 0.738 0.507 0.122 0.346

498.10 3.62 493.20 3.59 -4.90 -0.03


ACONDICIONAMIENTO DE BECERROS PREVIO A LA RECRÍA BAJO PASTOREO EN TRÓPICO SECO

(EEM ± 19.72 kg; P= 0.784). Considerando los tres experimentos, la CC de las vacas no disminuyó entre el inicio de la prueba y el destete debido a los tratamientos evaluados.

los becerros acondicionados pesaron más que los becerros del tratamiento testigo (P=0.019, y P=0.006, para el Exp 1; P= 0.048, y P=0.006, para el Exp 3). En el Exp 2, realizado en época de lluvias, los becerros acondicionados y del grupo testigo tuvieron pesos similares al inicio, y a los días 0, 28, 56 y 84 posdestete.

Peso de los becerros No hubo interacción de sexo x tratamiento, ni efecto de sexo sobre el peso de los becerros a los 84 días posdestete, por lo que se presentan únicamente los resultados del efecto del acondicionamiento sobre las variables evaluadas. En los Exp 1 y 3, realizados en las épocas secas, se registraron pesos similares entre tratamientos al destete y a los 28 días posdestete (Figura 1). A los 56 y 84 días posdestete,

Ganancia diaria de peso (GDP) No se detectó interacción significativa entre acondicionamiento x sexo, ni efecto del sexo para GDP. Sin embargo, sí hubo efecto del acondicionamiento (T2), sobre el aumento de peso acumulado durante todo el período de evaluación (Figura 2).

Figura 1. Peso corporal (kg) de becerros con acondicionamiento (líneas azules) y sin acondicionamiento (líneas rojas) en tres experimentos

Figura 2. Aumento diario de peso acumulativo (g/día) de becerros con acondicionamiento (barras azules) y sin acondicionamiento (barras rojas) en tres experimentos

200 190

1200

y = -0.0016x 2 + 0.6787x + 144.85 R² = 0.9727

I

180

1069*

191.2*

Acondicionado

I

1000

177.9*

170

800

160

122.1

139.5

120.8

Acondicionado

y = -0.0009x 2 + 0.3419x + 131.23 R² = 0.999

110

0

170

56

día -28 a 0

84

700

173.7

600

II

571

500

165.3 160.1 y = -0.0019x 2 + 0.3861x + 150.23 R² = 0.9989

148.8 137.9

Acondicionado

414

372*

401

366* 312

273*

200 132.8

100

130 Acondicionado

Testigo

0

120 -28

0

28

56

día -28 a 0

84

día -28 a 28

260 y = 0.0013x 2 + 0.4959x + 201.44 R² = 0.9978

III

250

800 252.9*

233.3*

230

600

215.1 218.7

199.3

190

300

y = -0.0006x 2 + 0.2629x + 200.36 R² = 0.9668

187.9

Testigo 581*

541*

486

400

210.7

209.8

192.6

Acondicionado

III 551*

500

203.3

210

día -28 a 84

Aumento de peso acumulado (g/día)

700

240

220

día -28 a 56

Período

Días respecto a destete (día 0)

180

Testigo

300

140

200

día -28 a 84

513*

400

150

día -28 a 56

Aumento de peso acumulado (g/día)

169.5

160

día -28 a 28

Período

166.4

161.5

150.1

293*

0

28

y = -0.0023x 2 + 0.4836x + 148.5 R² = 0.9939

322*

314*

Testigo

180

II

618*

200

100 -28

323*

400

131.7

120

Testigo

600

153.4

147.8

130

665*

633*

157.5

151.5

150 140

Aumento de peso acumulado (g/día)

307

239*

216*

233*

200 100

170

Acondicionado

Testigo

0

160 -28

0

28

56

día -28 a 0

84

día -28 a 28

día -28 a 56

día -28 a 84

Período

Días respecto a destete (día 0)

I= época seca 2012, pesos periodo 3 (P=0.019), pesos periodo 4 (P=0.0004). II= época de lluvias 2102 (P>0.05). III= época seca 2013, pesos periodo 3 (P=0.048), pesos periodo 4 (P=0.006).

I= época seca 2012 (P<0.001). II= época de lluvias 2012, aumentos de pesos entre periodos 1 y 2 (P<0.05), aumentos de pesos entre los periodos 1 y 4 (P=0.019). III= época seca 2013, aumentos de peso periodos 1 y 4 (P<0.001).

345


Rafael Guarneros Altamirano, et al. / Rev Mex Cienc Pecu 2017;8(4):341-351

Valor nutricional de los pastos

En el Exp 1 la GDP acumulada para el T2 fue mayor (P=0.001) durante todos los períodos. En el Exp 2, realizado en época de lluvias, la GDP de los becerros acondicionados fue mejor respecto al grupo testigo solo al considerar los 112 días del período experimental (P=0.019). En el Exp 3, la GDP para los períodos 1 (P=0.001), 3 (P=0.001) y 4 (P= 0.001), fue mejor en los becerros acondicionados que en el grupo testigo T1, mientras que en el período 2 la GDP fue similar entre tratamientos (486 vs 307 g/d; P= 0.075).

El forraje ofrecido en las parcelas pastoreadas por los becerros acondicionados a lo largo de los tres experimentos, tuvo un contenido de proteína similar al ofrecido a los becerros del grupo testigo (Figura 3). Solamente las muestras del pasto del día +56 del Exp 1, así como del día +28 del Exp 3, tuvieron contenido de proteína mayor al del pasto consumido por los becerros del tratamiento testigo. El contenido de fibra detergente neutro del pasto fue ligeramente

Figura 3. Contenido de proteína (A, B, C) y de FDN (D, E, F) de pastos consumidos por los becerros acondicionados (rojo) y testigo (azul) en los tres experimentos

A

D 78

12

Proteína (%, MS)

FDN (%, MS)

76

10

Testigo

Acondicionado

74

8

72

6 70

4

68 Testigo

2 0

-40

-20

Acondicionado

66 64

0

20

40

60

80

100

-40

B

-20

0

20

40

60

80

100

E 73.5

7

Proteína (%, MS)

FDN (%, MS)

73

6

72.5

5

Testigo

72

Acondicionado

71.5

4

71

3

70.5 70

2

69.5

1

69

0

-40

-20

Testigo

Acondicionado

68.5

0

20

40

60

80

100

-40

C

-20

0

20

40

60

80

100

F 78

10

FDN (%, MS)

9

77

Proteína (%, MS)

8

76

7

75

6 5

74

4

73

3

72

2 Testigo

1

71

Acondicionado

Testigo

-20

Acondicionado

70

0 -40

0

20

40

60

Días con respecto a destete (día 0)

80

-40

100

-20

0

20

40

60

Días con respecto a destete (día 0)

Experimento 1: A y D. Experimento 2: B y E. Experimento 3: C y F.

346

80

100


ACONDICIONAMIENTO DE BECERROS PREVIO A LA RECRÍA BAJO PASTOREO EN TRÓPICO SECO

superior para los becerros del grupo testigo en varios periodos de los Exp 1 y 2, así como al día +28 del Exp 3.

Cuadro 3. Concentración de glucosa sanguínea de becerros sin y con acondicionamiento pre y pos destete (mg/dl) Variable

Sin

Nitrógeno ureico y glucosa Considerando los tres experimentos, no hubo interacción entre el acondicionamiento x sexo. En general, no hubo diferencias entre sexos (P= 0.092), a excepción del día 56 posdestete en el Exp 2, cuando el contenido de nitrógeno ureico de los machos fue menor (P=0.027) al de las hembras (10.2 vs 12.0 mg/dl). En los Exp 1 y 2 la concentración de nitrógeno ureico fue similar entre tratamientos (Cuadro 2) en la mayoría de las etapas; solamente al finalizar el período 2 del Exp 1, el N ureico de los becerros testigo fue mayor al de los becerros acondicionados (P= 0.006). En el Exp 3, al finalizar los períodos 3 y 4, las concentraciones séricas de N ureico de los becerros acondicionados fueron más altas (P=0.041) que las del grupo testigo. Cuadro 2. Concentración de nitrógeno ureico en la sangre de becerros sin (Testigo) y con (Acondicionados) acondicionamiento pre y pos destete (mg/dl) -

Testigo Acondicionados

Acondicionamiento

EEM

Exp 1, época seca 2012 Al inicio 17.4 Periodo 1 22.2 Periodo 2 21.2a Periodo 3 24.7 Periodo 4 19.4

16.0 20.9 19.4b 26.5 15.5

0.92 1.44 0.35 1.80 2.14

0.267 0.517 0.006 0.970 0.149

Exp 2, época lluvias 2012 Al inicio 16.0 Periodo 1 15.1 Periodo 2 18.3 Periodo 3 11.0 Periodo 4 10.2

14.4 17.5 18.4 11.5 9.8

1.20 2.60 2.52 0.76 0.73

0.350 0.470 0.975 0.648 0.686

Exp 3, época seca 2013 Al inicio 18.0 Periodo 1 20.0 Periodo 2 26.2 Periodo 3 16.6b Periodo 4 26.1b

20.6 18.3 29.1 23.2a 30.0a

0.91 1.13 1.17 1.32 1.39

0.064 0.271 0.085 0.001 0.041

Con

EEM

P

Exp 1, época seca 2012 Al inicio 72.0 Periodo 1 48.8 Periodo 2 68.8 Periodo 3 88.0 Periodo 4 69.2

60.3 50.2 70.2 78.1 76.0

3.80 3.00 3.10 3.99 4.69

0.036 0.740 0.740 0.084 0.307

Exp 2, época lluvias 2012 Al inicio 73.5 Periodo 1 67.8 Periodo 2 71.2b Periodo 3 72.3 Periodo 4 56.2

76.8 70.2 79.9a 73.2 57.8

1.75 3.83 3.06 3.67 3.13

0.185 0.641 0.046 0.860 0.711

Exp 3, época seca 2013 Al inicio 65.8 Periodo 1 59.3 Periodo 2 71.2 Periodo 3 68.5 Periodo 4 68.1

70.8 61.4 72.7 72.4 70.4

2.46 2.68 2.40 1.81 2.54

0.156 0.590 0.655 0.140 0.538

EEM= error estándar de la media. ab (P<0.05).

P

El contenido de glucosa sérica no mostró interacción significativa en acondicionamiento x sexo. Tampoco hubo efecto del sexo. El acondicionamiento no ocasionó diferencias en el contenido de glucosa; excepto un contenido de glucosa sérica mayor de los becerros acondicionados (P=0.046) al finalizar el periodo 2 del Exp 2 (Cuadro 3).

Incidencia de enfermedades En los Exp 1 y 3, los becerros acondicionados tuvieron menos incidencia de enfermedades que los becerros del grupo testigo (P=0.001; Cuadro 4). En el Exp 2, la incidencia de animales enfermos fue similar entre ambos tratamientos durante los 112 días que duró el estudio.

Análisis económico En los Exp 1 y 3 los becerros acondicionados originaron un beneficio económico 63 y 71 % mayor,

EEM= error estándar de la media. ab (P<0.05).

347


Rafael Guarneros Altamirano, et al. / Rev Mex Cienc Pecu 2017;8(4):341-351

En el destete de becerros, el cambio a una dieta sin leche, así como diferentes factores de estrés físico y psicológico asociados(28), pueden afectar el comportamiento animal, así como su resistencia a algunas enfermedades infecciosas(29,30). Diversas modalidades de destete se han probado, tratando de reducir efectos dañinos para los becerros(10,31). Con el destete temprano, a 90 días, y a 150 días, la ganancia diaria de peso fue respectivamente de 875 y 995 g/día (P<0.05)(31). El acondicionamiento a becerros incrementó en 131 g el aumento diario de peso con respecto a los no acondicionados(10). En los experimentos realizados en época de sequía, los aumentos de peso de los animales acondicionados fueron 208 y 246 g/día mayores a los del grupo testigo, respectivamente. En época de lluvias, los pesos fueron similares. Los incrementos de peso obtenidos en el presente estudio fueron similares a los reportados en condiciones tropicales(2,3). Probablemente el contenido de proteína menor del pasto colectado en el Exp 2 respecto a los Exp 1 y 3 (Figura 3B vs 3A y 3C), pudo haber sido causa de que los becerros acondicionados no hubieran tenido mayor GDP en el Exp 2 (época de lluvias del 2012). El acondicionamiento de becerros registrado durante la época de sequía tuvo un efecto benéfico mayor, debido probablemente a que la suplementación compensó adecuadamente la reducida calidad nutritiva y digestibilidad de los pastos. La suplementación de becerros con un concentrado con 35 % de proteína cruda (PC), a razón de 20 g de suplemento/kg de peso metabólico (Ej. 900 g de suplemento/día aportan 315 g de PC/día para un becerro de 160 kg peso vivo, y 1,160 g de suplemento/día aportan 406 g de PC/día para un

Cuadro 4. Número y proporción (%) de becerros enfermos y sanos sin y con acondicionamiento pre y pos destete Variable

Acondicionamiento Sin Con

Exp 1, época seca 2012 Animales enfermos Animales sanos

10 (62.5) 6 (37.5)

2 (12.5) 0.001 14 (87.5)

Exp 2, época lluvias 2012 Animales enfermos Animales sanos

7 (43.8) 9 (56.2)

3 (18.8) 0.250 13 (81.2)

Exp 3, época seca 2013 Animales enfermos Animales sanos

11 (68.8) 5 (31.2)

5 (31.2) 0.001 11 (68.2)

P

respectivamente, que los del grupo testigo (Cuadro 5). En cambio, en el experimento 2, realizado en la época de lluvias, el beneficio económico del acondicionamiento fue incluso 27 % menor al del grupo testigo. En este análisis el mayor rubro de los costos variables fue el de la suplementación. El consumo promedio del suplemento por animal fue de 100.6, 99.2, y 127.2 kg, respectivamente para los Exp 1, 2 y 3. DISCUSIÓN En el presente trabajo, el acondicionamiento de los becerros tuvo efectos benéficos sobre el aumento del peso corporal, la salud de los animales y los ingresos económicos, en comparación con los becerros del grupo testigo, especialmente durante la época seca del año.

Cuadro 5. Análisis del costo de tratamientos y utilidad neta (miles de pesos mexicanos) de becerros sin y con acondicionamiento pre y pos destete (n=16 por tratamiento) Variable

Experimento 1 Acondicionamiento Sin Con

Precio inicio 82.68 Precio final 104.99 Incremento de precio 22.31 Costo de tratamientos 2.21 Utilidad neta 20.10

83.57 130.86 47.29 14.47 32.82

Experimento 2 Acondicionamiento Sin Con 92.53 113.55 21.01 2.21 18.80

90.89 118.88 27.99 14.31 13.69

La utilidad neta fue calculada como la diferencia del incremento de precio y el costo de los tratamientos, en cada experimento.

348

Experimento 3 Acondicionamiento Sin Con 131.82 149.68 17.86 2.21 15.65

128.60 173.09 44.49 17.71 26.78


ACONDICIONAMIENTO DE BECERROS PREVIO A LA RECRÍA BAJO PASTOREO EN TRÓPICO SECO

becerro de 225 kg de peso vivo), permite tener ganancias diarias de peso superiores a 500 g/día en becerros(32). Considerando el consumo, el contenido de proteína cruda del suplemento proporcionado, así como el contenido de proteína del forraje disponible en cada experimento, se estimó que el consumo de materia seca de forraje necesario para llenar las necesidades de proteína de los becerros(33), debió ser 3,370 g/d en el Exp 1; 3,600 g/d en el Exp 2, y 3,585 g/d en el Exp 3. Considerando además las tasas de degradabilidad ruminal de la proteína de los diferentes componentes dietarios(33), se estimó que el concentrado suplementado tuvo 70 % de proteína degradable. En ese caso, el aporte de proteína degradable suplementada varió de 220 g/d (Exp 1) a 280 g/d (Exp 3). Se estima que la degradabilidad de la proteína de la dieta en los tres experimentos fuera de 64 % en promedio, lo cual fue suficiente para satisfacer los requerimientos de proteína degradable en el rumen para becerros en crecimiento(33).

tropicales en los meses de lluvias, principalmente, en animales adultos(35). En el presente estudio el NU y la GS tuvieron valores considerados normales, sin efecto de los tratamientos probados, por lo que estas variables tienen poca asociación con los cambios de peso de los becerros. Algunos parásitos pueden afectar a becerros en las primeras etapas de vida(36,37,38). La carga parasitaria registrada en el presente estudio osciló entre 100 y 300 huevos de parásitos gastroentéricos (ej. Strongyloides spp.)/g de heces (HPG). Una desparasitación interna de los becerros con carga parasitaria mayor a 200 HPG durante la lactancia, puede mejorar en 6.5 % la ganancia diaria de peso respecto a los no desparasitados(29,39). La incidencia de enfermedades se incrementó en los animales del grupo testigo, principalmente en los Exp 1 y 3, en los que el acondicionamiento sirvió como una medida preventiva contra algunas enfermedades de la región. En México hacen falta estudios que cuantifiquen el impacto de la incidencia de animales enfermos en esta fase de vida. En este país, apenas en el 2012 se confirmó la presencia de diarrea viral bovina en bovinos alojados en corral de finalización(40). El acondicionamiento apoya al sistema inmunológico del becerro y le permite recuperar su salud y expresar su potencial genético y su status nutricional(37). Una eventual presencia de estrés podría originar en los becerros no acondicionados un incremento en la presencia de enfermedades infecciosas(30), como se observó en el presente estudio. El análisis económico realizado determinó el beneficio económico del acondicionamiento, expresado en términos de la diferencia entre los ingresos y los costos asociados a las prácticas zootécnicas realizadas. En la época de lluvias (Exp 2), el acondicionamiento redujo en 27.2 % el beneficio económico, respecto al de los becerros del grupo testigo. En cambio, durante la época de sequía, el acondicionamiento mejoró la utilidad neta en 63.2 % (Exp 1) y en 71.1 % (Exp 3).

Las concentraciones séricas de glucosa y nitrógeno ureico (NU) en becerros pueden variar durante la fase de crecimiento, debido a diversos factores fisiológicos(3). Sin embargo, en el presente estudio, la concentración solamente varió en algunos períodos de los experimentos en la época de sequía. Concentraciones inferiores a 7.0 mg/dl de sangre indican bajos contenidos de proteína degradable en la dieta, mientras que valores superiores a 19.6 mg/dl indican una situación inversa(34). En los tres experimentos se presentaron niveles normales de NU (entre 9.8 y 30.0 mg dl-1). En otro estudio(35), se reportaron valores de NU inferiores a los mínimos obtenidos en las dos épocas de sequía evaluadas en este trabajo (15 mg/dl), pero similares a los obtenidos en la época de lluvias del presente estudio, cuando, debido al valor energético y proteico de los pastos, los becerros utilizaron la proteína consumida para un mejor crecimiento, tal y como se observa en los aumentos de peso de los becerros que no fueron suplementados en el Exp 2, comparados con los de los Exp 1 y 3.

CONCLUSIONES E IMPLICACIONES

No hubo diferencias en la concentración de glucosa en sangre en los tres experimentos realizados, mientras que otros autores han registrado valores inferiores de glucosa en áreas

Se concluye que el acondicionamiento pre-pos destete de becerros en el trópico seco, es una buena opción en el sistema vaca-becerro, principalmente

349


Rafael Guarneros Altamirano, et al. / Rev Mex Cienc Pecu 2017;8(4):341-351

durante la época seca, al evitar una reducción excesiva del peso y la condición corporal de las madres, y para mejorar la ganancia de peso y reducir la incidencia de enfermedades en los becerros y, consecuentemente, mejorar el ingreso del productor. Debido a la diversidad climática y de los sistemas productivos ganaderos, la realización de este tipo de estudios en otras regiones de México, puede aportar más información para incrementar la adopción de estas prácticas zootécnicas a mayor escala.

10. Mathis CP, Löest A, Carter B. Preconditioning beef calves. New Mexico State University and the U.S. Department of Agriculture cooperating. Las Cruces, N.M.; Circular 637:1-8. 2008.

AGRADECIMIENTOS

14. Kohn RA, Dinneen MM, Russek-Cohen E. Using blood urea nitrogen to predict nitrogen excretion and efficiency of nitrogen utilization in cattle, sheep, goats, horses, pigs, and rats. J Anim Sci 2005;83:879-889.

11. Ávila GJ, Mena ST. Cuidado vaca-becerro ganado de carne y doble propósito. Congreso Nacional de Buiatría. AMMVZBAC. Monterrey, N.L. 2010;10-18. 12. Ibarra FFA, Moreno CY, Martín RMH, Moreno MS, Denogean BF, Baldenegro CA, León MFL. El destete precoz como una herramienta para incrementar la rentabilidad en los ranchos ganaderos de Sonora, México. Rev Mex Agronegocios 2011;15(28):531-542. 13. Gamboa-Mena JV, Magaña-Magaña MA, Rejón-Ávila M, Pech MVC. Eficiencia económica de los sistemas de producción de carne bovina en el municipio de Tizimín, Yucatán. Trop Subtrop Agroecosyst 2005;5:79-84.

Al personal del INIFAP (CIR-Noreste), por el apoyo en la realización de este estudio. Así como al cuerpo directivo, académico y personal de los laboratorios de la Facultad de Medicina Veterinaria y Zootecnia, y la Facultad de Agronomía de la UANL.

15. Cooke RF, Arthington JD, Staples CR, Thatcher WW, Lamb GC. Effects of supplement type on performance, reproductive, and physiological responses of Brahman-crossbred females. J Anim Sci 2007;85:2564-2574. 16. Zorrilla RJM. El caso México. En: Zorrilla RJM et al editores. Memoria Internacional: Escenarios futuros de la ganadería bovina para carne en México. Guadalajara, Jalisco. 2012:25-30.

LITERATURA CITADA 1.

Aban JA, Delgado R, Magaña JG, Segura JC. Factores que afectan el porcentaje de gestación a 120 días posparto en vacas cebú y cruzas con europeo en el sureste de México. Rev. AIA 2008;12(1):45-56.

2.

Galli IO, Monje AR, Vittone S, Sampedro D, Busto C. Destete precoz: en Cría vacuna: Manual para la toma de decisiones y ejecuciones de la técnica. Serie Manual de la Cría vacuna, INTA EEA Concepción del Uruguay 2005;2:1-28.

3.

Coppo JA, Coppo NB, Revidatti MA, Capellari A. Early weaning promotes improvement of blood nutritional indicators in half-bred zebu cows. Liv Res Rural Develop 2002;4:5. Article #42. Retrieved June 29, 2017, from http://www.lrrd.org/lrrd14/5/copp145.htm.

4.

Rodríguez QJI, Hernández CHE, Pérez GF, González GH, García SE, Pérez MA. Desarrollo de becerros en praderas durante la época de sequía en el Valle de la Paz, Baja California Sur. Reunión Anual Asociación Mexicana de Producción Animal, Cd. Victoria, Tamaulipas 2001:288-291.

17. García E. Modificaciones al sistema de clasificación climática de Köppen (para adaptarlo a las condiciones de la República Mexicana). Instituto de Geografía Universidad Nacional Autónoma de México. México, 1981. 18. Horn GW, McCollum, FT. Energy supplementation of grazing ruminants. Proc Grazing Livest Nutrition Conf 1987:125-136. 19. Lardy GP, Maddock TD. Creep feeding nursing beef calves. Veter Clinics North Amer: Food Anim Practice 2007;23(1):21-28. 20. Herd DB, Sprott LR. Body condition, nutrition and reproduction of beef cows. Texas farmer collection. Texas A&M University System. 1998. 21. Bobadilla HAR, Castrejón PFA, Melgarejo VLG, Meraz RE. Manual de prácticas de producción y aprovechamiento de forrajes. Departamento Nutrición Animal y Bioquímica. UNAM. 2009:33-53. 22. AOAC. Official methods of analysis. 17th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 2000.

5.

Boyles SL, Loerch SC, Lowe GD. Effects of weaning management strategies on performance and health of calves during feedlot receiving. Prof Anim Sci 2007;23(6):637-641.

23. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and non-starch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74:3583-3597.

6.

Lalman D, Hutson A, Shearhart W, Ward C, McKinley S. Preconditioning reduces sickness and death loss in weaned calves. J Anim Sci 2005;83:201-205.

7.

Pritchard RH, Mendez JK. Effects of preconditioning on pre- and post-shipment performance of feeder calves. J Anim Sci 1990;68:28-34.

24. Cano CJP. Manual de prácticas de clínica de los bovinos 1ra. ed: Ávila GJ, et al editors. Fac. Med. Vet. y Zoot. UNAM (1994). http://www.fmvz.unam.mx/fmvz/licenciatura/coepa/archivos/Man uales/22_CLI NICA_BOVINOS.pdf. Consultado 5 nov, 2014.

8.

Galyean ML, Perino LJ, Duff GC. Interaction of cattle health/immunity and nutrition. J Anim Sci 1999;77:1120-1134.

9.

Dhuyvetter K, Bryant AM, Blasi DA. Case study: Preconditioning beef calves: Are expected premiums sufficient to justify the practice? Prof Anim Sci 2005;502-514.

25. Secretaría de Economía. Cuadro Comparativo Anual Nacional Pecuario. Bovinos: Ganado en Pie: Novillo. Sistema Nacional de Información e Integración de Mercados. 2015. http://www. economia- sniim.gob.mx/2010prueba/Cuadro-AnualConsPec.asp?per =A&xedo=S&x=36&y=16. Consultado 5 Jul, 2015 26. SPSS. Statistical Package for Social Sciences. User’s Manual (Release 17.0). Chicago. IL, USA: IBM Corp. 2008.

350


ACONDICIONAMIENTO DE BECERROS PREVIO A LA RECRÍA BAJO PASTOREO EN TRÓPICO SECO

27. Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co; 1980.

34. Cabrera NA, Elorza MP, Daniel RI. Efecto de tres suplementos proteicos sobre la ganancia de peso en becerros cebú/suizo que pastan en zacate Estrella de África (Cynodon plectostachyus). Rev UDO Agrícola 2005;5(1):103-106.

28. Grandin T. Assessment of stress during handling and transport. J Anim Sci 1997;75:249-257.

35. Marston TT, Lusby KS, Wettemann RP, Purvis HT. Effects of feeding energy or protein supplements before or after calving on performance of spring-calving cows grazing native range. J Anim Sci 1995;73:657-664.

29. Lucas AS, William S, Swecker DS, Lindsay GS, Elvinger FC, Zajac AM. The effect of weaning method on coccidial infections in beef calves. Vet Parasitol 2007;145:228-233.

36. Daugschies A, Najdrowski M. Eimeriosis in cattle: Current understanding. J Vet Med 2005;Series B, 52(10):417-427.

30. Burke NC, Scaglia G, Boland HT, Swecker WS Jr. Influence of twostage weaning with subsequent transport on body weight, plasma lipid peroxidation, plasma selenium, and on leukocyte glutathione peroxidase and glutathione reductase activity in beef calves. Vet Immunol Immunopath 2009;127:365-370.

37. Brumbaugh GW. The immune system and recovery from sickness in cattle. The range beef cow Symp. Fort Collins, Co. 2007. http://beef.unl.edu/c13eabc6-48e9-45b8-8732-18682f9b38d6.pdf. Accessed Jun 29, 2017.

31. Blanco M, Villalba D, Ripoll G, Sauerwein H, Casasús I. Effects of early weaning and breed on calf performance and carcass and meat quality in autumn-born bull calves. Livest Sci 2009;120:103-115.

38. Ariasa RA, Maderb TL, Escobara PC. Factores climáticos que afectan el desempeño productivo del ganado bovino de carne y leche. Arch Med Vet 2008;40:7-22.

32. Balbuena O. Suplementación de destetes durante su primer invierno y de la vaquilla para primer servicio en el NEA. Seminario de Pasturas y suplementación estratégica en ganado bovino. Universidad Nacional de Asunción, Paraguay. 2002. http://www. produccionanimal.com.ar/informacion_tecnica/suplementacion/38suplementacion_destete_y_vaquilla.pdf. Accesado Jun 29, 2017.

39. Hersom MJ, Myer RO, Carter JN. Influence on weaning weights of nursing beef cattle calves de-wormed 90 days prior to weaning. Livest Sci 2011;136:270-272. 40. Ramírez R, Chavarría B, López A, Rodríguez LE, Nevárez AM. Presencia del virus de la diarrea viral bovina y su asociación con otros cuadros patológicos en ganado en corral de engorda. Vet Méx 2012;43(3):225-234.

33. NRC. Nutrient requirements of beef cattle, 7th rev. ed. Washington, DC: National Academy Press; 1996.

351


Rev Mex Cienc Pecu 2017;8(4):353-363

http://dx.doi.org/10.22319/rmcp.v8i4.4196

Efecto del residual de estiércol avícola o residual de fertilizante mineral en el rendimiento y la calidad de camelina (Camelina sativa L. Crantz) Effect of residual poultry manure or residual mineral fertilizer on yield and quality of camelina (Camelina sativa L. Crantz) Rosario Miralles de Imperial Hornedoa, María Mar Delgado Arroyoa, Ángela García Mansoa, María Isabel González Gullóna, José Valero Martín Sáncheza* RESUMEN El interés por el cultivo de camelina [Camelina sativa (L.) Crantz] para alimentación animal y biocombustible se está incrementando. Se condujo un ensayo en invernadero y tiestos con camelina cv. Calena después de un primer cultivo de cebada (Hordeum vulgare L.), con el fin de estudiar el efecto de la fertilización residual de gallinazas y mineral en el rendimiento y la calidad del grano. Los tratamientos aplicados en el cultivo anterior de cebada fueron: gallinaza o fertilizante mineral, N-P-K en dosis 0, 1, 1.5 y 2 (0, 60, 90,120 unidades fertilizantes de nitrógeno). Las variables estudiadas fueron: peso seco de biomasa aérea, peso seco de grano, peso de 1,000 granos, porcentaje de nitrógeno en biomasa aérea, porcentaje de nitrógeno en grano, porcentaje de proteína bruta en grano y porcentaje de grasa bruta en grano. Los tratamientos y dosis fueron significativamente diferentes. La interacción tratamiento*dosis fue significativa (P<0.05) para las variables estudiadas excepto para peso grano y peso de 1,000 granos. Para la gallinaza y el mineral los valores más altos en peso de grano se obtuvieron con dosis de 1 y 1.5, con rendimientos equivalentes en grano de 1,547 kg/ha y 1,504 kg/ha, para proteína bruta en grano fueron para dosis 1.5 en ambos tratamientos con 455.08 y 478.72 kg/ha y para grasa bruta del grano fueron los más altos, para dosis de 1 y 1.5 con 481.27 y 454.06 kg/ha. En general, la camelina tuvo una buena respuesta a la fertilización residual con fertilización a partir de la gallinaza o mineral en rendimiento y calidad de grano. PALABRAS CLAVE: Aceite, Cultivo, Fertilización, Gallinaza, Proteína.

ABSTRACT The growing interest in camelina (Camelina sativa L. Crantz) is increasing for animal nutrition and for biofuel. A trial was carried out in a greenhouse with camelina cv. ‘Calena’ cultivated in pots in order to evaluate the effect of residual poultry manure and mineral fertilization after a crop of barley (Hordeum vulgare L.) and to determine the grain’s yield and quality. The treatments applied to the first culture of barley were two: poultry manure or mineral fertilizer N-P-K, at rates of 0, 1, 1.5 and 2 (0, 60, 90, 120 nitrogen fertilizing units). The variables analyzed were the following: dry weight of: seed and aerial biomass and 1,000 seeds; percentages of Kjeldhal nitrogen in: seed, and aerial biomass; percentages of: crude protein and oil content. Treatment type and rates were significant. Treatment*rate interaction was significant (P<0.05) for the analyzed variables except for weight of seed and weight of 1,000 seeds. For the laying hen or mineral the highest values in terms of grain weight were obtained with rates 1 and 1.5, with grain yields equivalent of 1,547 and 1,504 kg/ha, respectively. In terms of crude protein grain the highest values were obtained with rate 1.5 for both treatments, with protein yield equivalent of 455.08 and 478.72 kg/ha and in terms of oil content seed the highest values were obtained with rates 1 and 1.5 with oil content yield of 481.27 and 454.06 kg/ha. In general, camelina had a good response to residual poultry manure or mineral fertilizer in yield and quality of grain. KEY WORDS: Crop, Poultry manure, Fertilization, Oil, Protein.

Recibido el 4 de junio de 2016. Aceptado el 20 de diciembre de 2016. a

Departamento de Medio Ambiente. Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA). España.

*Autor de correspondencia: vmartin@inia.es

353


Rosario Miralles de Imperial Hornedo, et al. / Rev Mex Cienc Pecu 2017;8(4):353-363

INTRODUCCIÓN

omega 3 y omega 6, alcanzándose un producto diferenciado dentro del mercado.

La camelina (Camelina sativa L. Crantz) de la familia Brassicaceae, aunque es un antiguo cultivo que se conocía desde la época de los romanos(1) es una planta cuyo cultivo se está incrementando estos últimos años en España(2) y otros países europeos como Rumania(3,4), Dinamarca(5), Noruega(6) y en países de América del norte y del sur como Estados Unidos(7), Canadá(8,9,10) y Chile(1,11).

La cantidad y características de la gallinaza dependen de la edad, la dieta y la salud de las aves, así como de las prácticas de gestión agrícola. Las estimaciones de excretas por 1,000 aves al día (basadas en el promedio de peso diario vivo durante el ciclo de producción de las aves), se sitúan en torno a 120 kg para las gallinas ponedoras, y 80 kg para los pollos de carne(17). La cantidad y composición de la gallinaza depende de las diferentes prácticas de producción avícola y es fundamental para una gestión eficiente y ambientalmente responsable de estos subproductos para la fertilización del suelo.

Esta extensa implantación por todo el mundo es debida a sus buenas características y variadas potencialidades, ya que posee una facilidad de cultivo y recolección sin necesidad de maquinaria especializada, y por sus posibilidades tanto en alimentación animal(12) y alimentación humana(5), por su alto contenido en ácidos grasos poliinsaturados omega 3, omega 6 y aminoácidos(13); también por su bajo contenido en glucosilonatos(6), así como también para el uso de su aceite como biocombustible para aviones(4), por el alto contenido de aceite en sus semillas.

Una característica importante del cultivo de la camelina es que puede fácilmente formar parte en las rotaciones de secano y regadío, y aprovechar la fertilización residual del cultivo anterior. La información del efecto residual de la aplicación de la gallinaza en una rotación de cultivos y su aprovechamiento en un cultivo posterior es limitada.

Por todo ello, en los últimos años existe un renovado interés de este cultivo y se ha venido estudiando su respuesta a la aplicación de fertilizantes nitrogenados en distintas dosis y el efecto en su rendimiento, contenido en nitrógeno y calidad del grano(8,14).

Con el objetivo de evaluar el efecto residual de la aplicación de la excreta de la gallina de postura y compararlo con una fertilización mineral, aplicados ambos tratamientos fertilizantes a un cultivo anterior de cebada, se planteó un ensayo en invernadero y tiestos o recipientes con camelina cv. ‘Calena’ en siembra otoñal para estudiar el efecto de estos residuales en su rendimiento y en varios parámetros de calidad.

La aplicación de estiércoles de granjas avícolas como fertilizante orgánico para los cultivos es una práctica idónea para una agricultura sostenible, se aprovecha su contenido en nutrientes disponibles y el aporte de su materia orgánica supone una mejora para el suelo cultivado, pero siempre que se controlen las dosis aplicadas de estos estiércoles para obtener mejoras en los rendimientos y calidad de los cultivos, y a su vez sean ambientalmente correctas, evitando la contaminación de los mantos acuíferos y los suelos. La aplicación de la gallinaza como fertilizante a los cultivos ha sido estudiada estos últimos años en ensayos de invernadero y macetas en maíz(15) y sorgo forrajero(16) .

MATERIAL Y MÉTODOS Los tiestos con suelos y el residual de gallinaza o residual de fertilizante mineral que se reutilizaron en el presente ensayo, provenían de un primer ensayo que se realizó en cultivo de cebada (Hordeum vulgare L.) en un invernadero localizado en Madrid capital. Los contenedores eran de polipropileno flexible de 26 L de capacidad y 0.3 m de profundidad. Se rellenaron con 26 kg de suelo procedente de la finca del INIA de “La Canaleja” (Madrid), que previamente se habían mezclado con las dosis de gallinaza de gallina ponedora estabulada o de fertilizante mineral. El tiesto lleno de suelo y

Además la utilización de la gallinaza para fertilizar, permite el cierre de ciclo, al usar el grano de la camelina en la alimentación de las gallinas, y así obtener huevos de composición diferente en

354


RESIDUAL DE FERTILIZANTE MINERAL EN EL RENDIMIENTO Y LA CALIDAD DE CAMELINA (CAMELINA SATIVA L. CRANTZ)

gallinaza o suelo y fertilizante mineral alcanzó una altura media de 0.27 m. La superficie resultante de tiesto una vez lleno fue de 0.1 m2 (diámetro 0.38 m). Las características del suelo utilizado se presentan en la Cuadro 1. Los tratamientos fertilizantes aplicados al cultivo de cebada fueron: excreta de gallina ponedora (GP) y fertilizante mineral (FM). Las gallinazas utilizadas en el ensayo provenían de la granja avícola de la finca “El Encín” (Madrid), cuyas características se presentan en el Cuadro 2; su contenido de metales pesados no sobrepasa los límites máximos establecidos por la legislación sobre productos fertilizantes(18).

Cuadro 1. Características del suelo (materia seca)

Para el cálculo del abonado del cultivo de cebada se tuvieron en cuenta sus necesidades de nutrientes, las características del suelo y zona de procedencia de dicho suelo, y para una producción estimada de grano de 2,000 kg/ha se necesitarían aportar 60 kg nitrógeno. Para la superficie del tiesto de 0.1 m2 en que se iban a desarrollar seis plantas de cebada se necesitaría aplicar 0.6 g de N por

tiesto, ésta sería la dosis 1 (d1), que sería la que cubriría las necesidades de N. Las dosis 1.5 (d 1.5) y dosis 2 (d2) eran 1.5 veces y 2 veces las aplicadas con d1, luego habría que aportar 0.9 y 1.2 g de N por tiesto respectivamente. Para cubrir las necesidades de N por tiesto con la dosis 1 de gallinaza (GP-d1) se aplicaron 24.5 g, con la dosis 1.5 de gallinaza (GP-d 1.5) fueron 36.75 g y con la

Parámetro pH 1:2,5 H2O Conductividad eléctrica 1:5 H2O dSm-1 Carbono orgánico oxidable, % Nitrógeno Kjeldahl, % Relación C/N Materia orgánica oxidable, % N-NH4+, mg/kg N-NO3-, mg/kg Fósforo (Olsen), mg/kg Potasio (acetato amónico), mg/kg

Suelo 7.44 0.22 0.84 0.09 9.33 1.45 2.71 2.27 21 392

Cuadro 2. Características de la gallinaza de gallina ponedora (materia seca) Parámetro Gallinaza pH 7.9 -1 CE*, dSm 10.2 Humedad, % 65.47 Sólidos totales, % 36.88 Sólidos fijos, % 11.81 Sólidos volátiles, % 25.07 N Kjeldahl, % 3.97 N-NH4+, mg/kg 22,862 N-NO3-, mg/kg 265 C orgánico oxidable, % 30.38 P, mg/kg 13,556 K, mg/kg 26,632 Ca, mg/kg 114,555 Mg, mg/kg 7,091 Na, mg/kg 4,658 Concentración de metales pesados (mg kg-1 de la gallinaza y límites máximos de metales pesados** para productos fertilizantes elaborados con residuos orgánicos Metal pesado Cd Cr Cu Pb Ni Zn Gallinaza 0 9 41.1 0 4.8 189.1 **Clase A 0.7 70 70.0 45 25.0 200.0 **Clase B 2.0 250 300.0 150 90.0 500.0 **Clase C 3.0 300 400.0 200 100.0 1000.0 *CE= conductividad eléctrica. **BOE. 2013. Real Decreto 506/2013 de 28 de junio sobre productos fertilizantes.

355


Rosario Miralles de Imperial Hornedo, et al. / Rev Mex Cienc Pecu 2017;8(4):353-363

dosis 2 de gallinaza (GP-d2) se añadieron 49 g. El fertilizante mineral (FM) utilizado en el ensayo fue un N-P-K, 15-15-15, y se aplicó por tiesto: 4 g para la dosis 1 (FM-d1), 6 g para la dosis 1.5 (FM-d1.5) y 8 g para la dosis 2 (FM- d2). Para las dosis 0 (d0), testigo sin fertilización, fueron 0 g tanto con GP como FM. Las equivalencias de estas dosis a nivel agronómico se pueden ver en el Cuadro 3.

características de estos suelos se presentan en el Cuadro 4. A mediados de octubre de 2014 en los mismos tiestos y suelos con el residual de gallinaza o de fertilizante mineral y sus respectivas dosis en que se había realizado el cultivo de cebada, se procedió a sembrar la camelina como segundo cultivo. La

En el primer cultivo de cebada la siembra se efectuó a mediados de noviembre de 2014 y la recolección se realizó en los primeros días de julio de 2014. Después de la recolección del cultivo de la cebada y tras un periodo de descanso (tres meses), de estos suelos sin añadir fertilizantes de nuevo, se procedió a la toma de muestras de los mismos para su análisis previo a la siembra del cultivo de camelina, para así conocer las características físicoquímicas de estos suelos iniciales con el residual de la excreta de gallina ponedora o el residual de fertilizante mineral y sus respectivas dosis (d0, d1, d 1.5 y d2) para el desarrollo de la camelina. Las

Cuadro 3. Fertilización aplicada en los cultivos Cultivo

Dosis

Cebada

Camelina

Fertilizante kg/ha

d0 d1 d1.5 d2 d0 d1 d1.5

Gallinaza 0 2,450 2,675 4,900 0 0 0

Fertilizante mineral 0 400 600 800 0 0 0

d2

0

0

Cuadro 4. Características de los suelos iniciales STd0

SGPd1

pH, 1:2.5 H2O

7.58

7.48

CE, 1:5 H2O dSm-1

0.1040

C orgánico oxidable, % Mat. org. oxid, %

SGPd2

SFMd1

SFMd1.5

SFMd2

7.62

7.63

7.58

7.52

7.43

0.1031

0.1165

0.1041

0.1173

0.1250

0.1046

0.8918

0.8323

0.8624

0.7914

0.8706

0.8865

0.8555

1.5339

1.4287

1.4834

1.3612

1.4974

1.5248

1.4714

0.005

0.1083

0.109

0.109

0.103

0.109

0.113

8.49

7.69

8.37

7.26

8.45

8.13

7.57

N-NH4+, mg/kg

3.95

4.33

6.88

3.70

3.2

1.4

0.6

N-NO3-, mg/kg

11.59

13.53

18.93

18.03

22.3

14.12

13.87

P (Olsen), mg/kg

18

52

52

50

51

55

50

K (acetato amónico), mg/kg

252

248

255

239

261

263

266

Nitrógeno Kjeldahl, % Relación C/N

SGPd1.5

Suelo testigo gallinaza dosis 0 (STd0), suelo + gallinaza dosis1 (SGPd1), suelo + gallinaza dosis1.5 (SGPd1.5), suelo + gallinaza dosis 2 (SGPd2), suelo + fertilizante mineral dosis1 (SFMd1), suelo + fertilizante mineral dosis1.5 (SFMd1.5), suelo + fertilizante dosis 2 (SFMd2). CE= conductividad eléctrica.

356


RESIDUAL DE FERTILIZANTE MINERAL EN EL RENDIMIENTO Y LA CALIDAD DE CAMELINA (CAMELINA SATIVA L. CRANTZ)

siembra fue superficial, a 1 cm de profundidad debido al pequeño tamaño de la semilla. Se sembraron seis semillas por tiesto (de 0.1 m2 de superficie), que corresponderían a una densidad de siembra equivalente de 600,000 plantas/ha. Las características de las semillas de siembra fueron: peso de 1,000 semillas 1.2 g, contenido en aceite expresado en porcentaje de grasa bruta 37.5 % y proteína bruta 25.19 %.

alimentación animal y como materia prima para la obtención de biocarburantes. En el material vegetal: biomasa aérea y grano, se determinó su contenido en nitrógeno por el método Kjeldahl(20). La proteína bruta en el grano (%PBG) fue el resultado de multiplicar el porcentaje de nitrógeno en grano (%NG) por un factor fijo de 6.25 (N Kjeldahl * 6.25). En el grano, sobre materia vegetal seca, se determinó el contenido en aceite como porcentaje de grasa bruta (%GBG), por el método Soxhlet(21).

El diseño experimental fue totalmente al azar, con arreglo factorial de doble entrada (tratamiento fertilizante, dosis) con tres repeticiones por tratamiento: residual de excreta de gallina ponedora o residual de fertilizante mineral y dosis (0, 1, 1.5 y 2). El número total de tiestos fue de 24.

Las siete variables estudiadas fueron: peso seco de biomasa aérea g tiesto-1, peso seco de grano g tiesto-1, peso de 1,000 granos, porcentajes de nitrógeno en biomasa aérea, de nitrógeno en grano, de proteína bruta en grano y de grasa bruta en grano.

Durante el tiempo de duración del ensayo se regaron los tiestos según las necesidades hídricas del cultivo, en función de la climatología y por debajo de la capacidad de retención de humedad (CRH) que fue de 4,000 ml (100 % CRH). Mientras duró el ensayo se mantuvo cada tiesto al 60 % de su CRH.

Para el estudio estadístico de las variables mencionadas se realizó una comprobación de la normalidad de los datos, y posteriormente se procedió a realizar un análisis de varianza (ANOVA) factorial de doble entrada [tratamiento (residual de gallinaza de gallina ponedora (GP) y residual de fertilizante mineral (FM) y dosis (d0, d1 y d1.5)], y un estudio de interacciones para evaluar la influencia tratamiento*dosis para las variables evaluadas. Los datos se analizaron con el programa Statgraphics Centurión. Para la separación de medias se utilizó el test de rango múltiple de Duncan. Cuando el ANOVA mostró que la interacción fue significativa, se estudió la comparación de medias para las diferentes dosis dentro de cada tratamiento.

La recolección de la camelina se efectuó cuando alcanzó su madurez fisiológica y el 80 a 90 % de sus silicuas tenían un color entre amarillo y marrón(19), y fue a finales de abril de 2015. Se cortaron las seis plantas de camelina que se habían desarrollado por tiesto. Se separaron la parte aérea del sistema radical. El cuello de la planta fue el punto de corte. Para obtener el peso seco (rendimiento biológico) de estos materiales, se procedió a su secado en estufa a 70 ºC hasta peso constante. Se evaluaron sobre este material vegetal, el peso de la biomasa aérea (incluyó tallos, hojas, y las cubiertas de las silicuas), y el peso del grano. También se controló el peso de 1,000 granos, ya que en la familia Brassicaceae es un carácter genético.

RESULTADOS Y DISCUSIÓN Los resultados obtenidos en la mayoría de los parámetros estudiados mostraron diferencias significativas entre los tratamientos, siendo un caso de fertilización residual tras un cultivo previo, lo que hace más interesante estas diferencias. Respecto a la producción de camelina se encontraron aumentos frente al testigo, que fueron desde 100 a 300 kg/ha y variaciones en proteína bruta y grasa bruta del grano que fueron entre 0.3 a 2.2 y 0.3 a 2.47 % respectivamente, datos que se comentan más detalladamente a continuación y que tienen unos

Los parámetros evaluados en planta de camelina fueron: producción de grano, peso de biomasa aérea (PBA) y peso de 1,000 granos (P1000G); contenido en nitrógeno en biomasa aérea (%NBA) y en grano (%NG), y para valorar la calidad del grano se controló su contenido en proteína bruta y en grasa bruta (contenido en aceite), para así evaluar el posible doble uso de esta semilla en

357


Rosario Miralles de Imperial Hornedo, et al. / Rev Mex Cienc Pecu 2017;8(4):353-363

efectos importantes en los costes/beneficios y manejo del cultivo.

La interacción de tratamiento*dosis, fue significativa para PBA y no significativa para P1000 y PG (Figura 1). Para las variables %NBA, %NG, %PBG y %GBG, la interacción fue significativa para todas (Figura 2).

Se realizó el análisis de varianza para todas las variables estudiadas para comprobar las posibles interacciones (Cuadro 5).

Cuadro 5. Análisis de varianza de las variables estudiadas Variable Peso biomasa aérea Peso grano Peso de 1,000 granos Nitrógeno biomasa aérea, % Nitrógeno en grano, % Proteína bruta en grano, % Grasa bruta en grano, %

Tratamiento * NS NS NS * * *

Dosis * * * * * * *

Tratamiento*dosis * NS NS * * * *

NS= no significativo, *= significativo (P<0.05).

Figura 1. Interacción tratamiento (gallinaza o fertilizante mineral) * dosis (0, 1, 1,5 y 2), para peso de grano (rendimiento por tiesto), peso de 1,000 granos y peso de biomasa aérea, de camelina

358


RESIDUAL DE FERTILIZANTE MINERAL EN EL RENDIMIENTO Y LA CALIDAD DE CAMELINA (CAMELINA SATIVA L. CRANTZ)

Figura 2. Interacción tratamiento (gallinaza o fertilizante mineral) * dosis (0, 1, 1,5 y 2), para porcentaje de nitrógeno Kjeldhal de: grano y biomasa aérea de camelina y para porcentaje de: proteína bruta y grasa bruta en grano de camelina

En el Cuadro 6 se presenta la comparación de dosis dentro de cada tratamiento para las variables que presentaron interacción. Las dosis fueron significativas (P<0.05) en las variables peso biomasa aérea y % N en biomasa aérea para gallinaza y para mineral también, alcanzándose los mayores valores para el caso de peso de biomasa área de 44.49 g en la dosis 1 para gallinaza y de 47.51 g en la dosis 1.5 para fertilizante mineral, mientras que para el caso del N en biomasa aérea los mayores valores se alcanzaron en la dosis 1, siendo de 0.94 y 1.21 % para ambos tratamientos respectivamente. Estos resultados se ajustan a la Ley de los rendimientos menos que proporcionales, de los rendimientos menguantes o de Mitscherlich(22) que dice: cuando se suministran dosis crecientes de abonos, los aumentos de cosecha obtenidos son cada vez menores a medida que las dosis aumentan. En el

caso del primer cultivo de cebada la dosis idónea fue d1, siendo las siguientes dosis superiores a la idónea, y después de dicho cultivo la cantidad de nutrientes residuales en el suelo (iniciales en el cultivo de camelina) continuó cumpliendo dicha ley. La variable %PBG fue solo significativa en el tratamiento de fertilización mineral, llegando a un valor máximo de 31.82 % en la dosis 1.5, mientras que para %GBG sólo fue significativa para el tratamiento de gallinaza, alcanzando un valor máximo de 32.35 % en la dosis 2, datos que concuerdan con los resultados obtenidos por otros autores(10,14), que observaron cómo al utilizar una fertilización mineral y al aumentar las dosis de fertilización, se produjo un aumento de la proteína en grano y una disminución del contenido en grasa bruta. Esta disminución en grasa bruta también se

359


Rosario Miralles de Imperial Hornedo, et al. / Rev Mex Cienc Pecu 2017;8(4):353-363

Cuadro 6. Comparación de dosis de gallinaza de gallina o fertilizante mineral para las diferentes variables Dosis tiesto

abc

Peso biomasa aérea (g)

N biomasa aérea (%)

N grano (%)

Proteína bruta grano (%)

Gallinaza ±0.18 29.66a ±0.18 29.36a ±0.18 29.94a ±0.18 29.65a Fertilizante mineral

Testigo 1 1.5 2

38.85a 44.49b 39.13a 36.42a

±3.36 ±3.36 ±3.36 ±3.36

0.64a 0.94b 0.84b 0.87b

±0.16 ±0.16 ±0.16 ±0.16

4.75a 4.7a 4.79a 4.74a

Testigo

38.85a

±3.93

0.64a

±0.15

4.75a

±0.22

1 1.5 2

39.81a 47.51b 41.51a

±3.93 ±3.93 ±3.93

1.21b 0.75a 0.73a

±0.15 ±0.15 ±0.15

5.07b 5.09b 5.02b

±0.22 ±0.22 ±0.22

Grasa bruta grano (%)

±0.99 ±0.99 ±0.99 ±0.99

29.88a 31.11b 31.27bc 32.35c

±1.22 ±1.22 ±1.22 ±1.22

29.66a

±1.37

29.88a

±1.51

31.67b 31.82b 31.35b

±1.37 ±1.37 ±1.37

29.58a 30.19a 29.55a

±1.51 ±1.51 ±1.51

Valores de cada columna seguidos de letras diferentes indican diferencias significativas entre dosis (P<0.05).

± Error estándar.

observó en el presente ensayo con la fertilización mineral en comparación con los valores obtenidos para gallinaza. Siendo los mayores valores para %PBG con el tratamiento de gallinaza de 29.94 % frente al 31.82 % en el tratamiento de fertilización mineral, mientras que para el %GBG, con el tratamiento de gallinaza fueron de 32.35 vs 30.19 % en fertilización mineral (P<0.05). Dichas diferencias se pueden observar en las gráficas de interacción de ambas variables (Figura 2).

para estudiar el efecto de la fertilización nitrogenada (0, 75, 150 y 300 kg nitrógeno/ha), observaron una correlación negativa entre el contenido en aceite y la fertilización nitrogenada. En el presente ensayo se observa un efecto positivo entre el contenido en aceite (expresado como grasa bruta) y la fertilización con gallinaza. Según se muestra en el Cuadro 7 los mayores valores obtenidos en el peso 1,000 granos variaron entre 1.02 g para el testigo y 1.13 para la dosis 1, valores próximos a los obtenidos en ensayos en tiestos para estudiar el efecto de la fertilización con nitrógeno con cv. Calena, observando efectos

Estos efectos también fueron observados por otros autores(8,11), los cuales en ensayos de campo con camelina en localidades del centro sur de Chile

Cuadro 7. Promedios de rendimientos agrícolas equivalentes en kg/ha, en grano Tratamiento-Dosis

Peso 1,000 granos (g)

Peso grano (g/tiesto)

Peso grano (kg/ha)

PBG (%)

PBG (kg/ha)

GBG (%)

GBG (kg/ha)

GP- d0 GP- d1 GP- d1.5 GP- d2 FM- d0 FM- d1 FM- d1.5 FM- d2

1.02 1.1 1.06 1.07 1.02 1.13 1.11 1.12

12.52 15.47 15.20 14.68 12.52 13.98 15.04 14.53

1252 1547 1520 1468 1252 1398 1504 1453

29.66 29.36 29.94 29.65 29.66 31.67 31.83 31.35

371.34 454.19 455.08 435.26 371.34 442.75 478.72 455.52

29.88 31.11 31.27 32.35 29.88 29.58 30.19 29.55

374.10 481.27 473.74 474.90 374.10 413.52 454.06 429.36

Proteína bruta (% PBG) y grasa bruta (% GBG), obtenidos en camelina con fertilización residual de: gallinaza de gallina ponedora (GP): dosis 0 (d0), dosis 1 (d1), dosis 1.5 (d1.5) y dosis 2 (d2) o de fertilizante mineral (FM): d0, d1, d1.5 y d2.

360


RESIDUAL DE FERTILIZANTE MINERAL EN EL RENDIMIENTO Y LA CALIDAD DE CAMELINA (CAMELINA SATIVA L. CRANTZ)

siembra, etc. En experiencias de cultivo en campo con camelina cv. Calena en el Bajo Aragón de España, en secano con siembra otoñal, obtuvieron rendimientos bajos en grano de 500 kg/ha debido a la escasa precipitación; o en ensayos de campo(4) en una localidad de Rumania con dos fechas de siembra y tres cultivares de camelina, cv. Camelia, cv. Lindo y cv. Calena, obtuvieron rendimiento en grano para cv. Calena en siembra otoñal de 1,083 kg/ha y en siembra primaveral de 800 kg/ha. Este ensayo de camelina se realizó en siembra otoñal y los rendimientos equivalentes fueron superiores a los obtenidos por estos autores, aunque en ensayos(9) en parcelas en el este de Canadá con dos líneas de camelina CDI005 y CDI1007 para evaluar el efecto de la fertilización con nitrógeno en distintas dosis y azufre combinado, el óptimo de dosis de N fue entre 120 (dosis equivalente a la dosis 2 del primer cultivo) y 160 kg/ha. Estos autores obtuvieron unos rendimientos medios en grano para CDI005 y CDI1007 de 1,638 y 1,911 kg/ha y en rendimiento en aceite de 591 y 715 kg/ha respectivamente, y otros(6) que aplicaron estiércoles de pollo de engorde en forma de pellets en ensayos de campo en Apelsvoll, Noruega en cultivo de camelina y distintos niveles de fertilización de nitrógeno 0, 40, 80 y 120 kg nitrógeno/ha, obtuvieron rendimientos medios de grano de 1,504, 1,858, 1,928, 1,996 kg/ha respecto a cada dosis de fertilizante. En el presente ensayo, se obtuvieron rendimientos máximos equivalentes de 1,547 kg/ha con el residual de gallinaza en dosis 1 (cuando se aplicó al suelo la gallinaza en el primer cultivo, equivalía esta dosis 1 a 60 kg nitrógeno/ha), valor inferior a los obtenidos por esos autores(6).

positivos en el peso de 1,000 granos y obtuvieron pesos entre 1.04 y 1.17 g(23). En ensayos en campo(3) con esta misma variedad y sin fertilización, obtuvieron para peso de 1,000 granos valores de 1.378 y 1.373 g en las parcelas no regadas y 1.390 y 1.381 g en las regadas; estos pesos obtenidos en campo fueron superiores a los obtenidos en tiestos de este ensayo, al tener la planta condiciones más idóneas para su desarrollo; aunque otros autores(1) en ensayos también de campo con camelina en localidades del centro sur de Chile con distintas fechas de siembra y tres cultivares (cv. Gold of Pleasure, cv. Suneson y cv. Blaine Creek), obtuvieron para peso de 1,000 semillas valores entre 1.08 y 1.49 g. En el caso de la variable peso grano se encontraron diferencias significativas entre el testigo (dosis 0) y el resto de las dosis, siendo la dosis 1 con gallinaza donde se obtuvieron los valores más elevados. Se realizó un estudio sobre los promedios de rendimientos agrícolas equivalentes en kg/ha, para peso del grano, proteína bruta y grasa bruta (Cuadro 7). Estos rendimientos equivalentes en grano, proteína bruta y grasa bruta se calcularon teniendo en cuenta el peso de grano obtenido para la superficie del tiesto de 0.1 m2 y se extrapoló a una hectárea. Se puede observar que los mayores rendimientos en grano se obtuvieron para gallinaza en dosis 1 y para fertilizante mineral dosis 1.5 que fueron de 1,547 y 1,504 kg/ha respectivamente, datos que igual que para la biomasa se ajustan a la Ley de Mitscherlich(22); en este parámetro la mejor dosis en fertilizante mineral después del primer cultivo fue para la dosis 1.5. Para proteína bruta se obtuvieron los mayores rendimientos con gallinaza en dosis 1.5 y fertilizante mineral en dosis 1.5 que fueron de 455.08 y 478.72 kg/ha respectivamente. Para grasa bruta se obtuvieron los mayores rendimientos con gallinaza dosis 1 y fertilizante mineral dosis 1.5 que fueron de 481.27 y 454.06 kg/ha respectivamente.

En cuanto a rendimientos del cultivo, los resultados son intermedios y concordantes con ensayos(3) que realizaron en campo cerca de Bucarest con camelina cv. Calena y siembra a finales de julio, como segundo cultivo después de triticale, sin aplicar fertilización mineral, donde obtuvieron rendimientos en las parcelas sin riego entre 494.2 y 800.5 kg/ha y en las regadas entre 1,104.3 y 1,203 kg/ha. En el presente ensayo los rendimientos para grano con residual de gallinaza fluctuaron entre 1,547 kg/ha para d1 y 1,468 kg para d2 y con residual de mineral entre 1,398 kg para d1 y 1453

Con los rendimientos equivalentes descritos en este trabajo, se pueden comparar con los de otros autores(2), aunque se obtuvieron resultados diferentes debido al lugar del ensayo, época de

361


Rosario Miralles de Imperial Hornedo, et al. / Rev Mex Cienc Pecu 2017;8(4):353-363

AGRADECIMIENTOS

kg para d2. Sin fertilización el rendimiento equivalente en grano fue de 1,252 kg/ha.

Este estudio se realizó gracias al proyecto RTA2011-00047-00-00 financiado por el INIAFEDER. Los autores agradecen a Jesús García su colaboración en las tareas de invernadero y recolección de datos.

Se observó una disminución en el porciento de grasa bruta con la dosis 1 y 2 de fertilizante mineral respecto al testigo dosis 0, pero también se obtuvo un mayor rendimiento en grano con la fertilización mineral en las tres dosis ensayadas respecto al testigo, resultados que también observaron en ensayos de campo en el norte de Wyoming, USA(7) con camelina para determinar el efecto de la aplicación de nitrógeno en dosis de 0, 28, 56 y 112 kg nitrógeno/ha, en el rendimiento, proteína y contenido en aceite del grano, donde observaron un incremento en el rendimiento y proteína con la fertilización nitrogenada y un descenso en el contenido en aceite respecto al tratamiento sin fertilización, pero consideraron que esta disminución se compensaba con el incremento en el rendimiento en grano obtenido.

LITERATURA CITADA

CONCLUSIONES E IMPLICACIONES El cultivo de camelina cv. Calena en siembra otoñal obtuvo los mejores resultados con el tratamiento residual de gallinaza de gallina ponedora con la dosis 1 en cuanto a rendimiento en biomasa aérea y grano y en el peso de 1,000 granos. En cuanto a calidad del grano: para contenido en proteína bruta se obtuvo el mayor valor con mineral dosis 1.5 y respecto a contenido en aceite (grasa bruta) se obtuvo el mayor valor con gallinaza dosis 2. En general, la fertilización mineral residual sería la idónea en camelina si buscamos mayor porcentaje de proteína bruta y la residual de gallinaza si queremos mayor contenido en aceite (grasa bruta). La camelina podría ir en una rotación de cultivos como segundo cultivo, sin fertilizar, y aprovechar la fertilización orgánica (gallinaza de gallina ponedora) o fertilización mineral del cultivo anterior, abaratando costos de cultivo al no tener que fertilizar. La respuesta de la camelina a la fertilización residual orgánica y mineral fue en general positiva en las siete variables estudiadas. Para validar estos ensayos en tiestos e invernadero, se recomienda repetir estas experiencias en condiciones de campo.

362

1.

Berti M, Wilckens R, Fischer S, Solis A, Johson B. Seeding date influence on camelina seed yield, yield components and oil content in Chile. Ind Crop Prod 2011;(34):1358-1365.

2.

Gutiérrez López M, Albalat Borrás A. El cultivo de la camelina en Aragón. Primeras experiencias de su cultivo en el Bajo Aragón.Tierras-Agricultura 2013;(208):72-79.

3.

Dobre P, Jurcoane S, Matei F., Stelica C, Farcas N, Moraru AC. Camelina sativa as a double crop using the minimal tillage system. Rom Biotech Lett 2014;19(2):9190-9195.

4.

Toncea I. The seed yield potential of camelina- first Romanian cultivar of (Camelina sativa L. Crantz). Rom Agric Res 2014;(31):17-23.

5.

Zubr J. Camelina oil in human nutrition. Agro Food Ind Hi Tec 2009;20(4):22-28.

6.

Henriksen BIF, Lundon AR, Presttlokken E, Abrahamsen U, Eltun R. Nutrient supply for organic oilseed crops, and quality of potential organic protein feed for ruminants and poultry. Agron Res 2009;(7 Special issue II):592-598.

7.

Sintim HY, Zheljazkov VD, Obour AK, Garcia y Garcia A, Foulke TK. Influence of nitrogen and sulphur application on camelina performance under dryland conditions. Ind Crop Prod 2015;(70):253-259.

8.

Malhi SS, Johnson EN, Hall LM, May WE, Phelps S, Nybo B. Effect of nitrogen fertilizer application on seed yield, N uptake, and seed quality of Camelina sativa. Can J Soil Sci 2014;(94):35-47.

9.

Jiang Y, Caldwell CD, Falk KC. Camelina seed quality in response to applied nitrogen, genotype and environment. Can J Plant Sci 2014;94(5):971-980.

10.

Urbaniak SD, Caldwell CD, Zheljazkov VD, Lada R, Luan L The effect of cultivar and applied nitrogen on the performance of Camelina satica L. in the Maritime Provinces of Canada. Can J Plant Sci 2008;8(1):111-119.

11.

Solis A, Vidal I, Paulino L, Johnson BL, Berti MT. Camelina seed yield response to nitrogen, sulphur, and phosphorus fertilizer in south Central Chile. Ind Crop Prod 2013;(44):132-138.

12.

DOUE. Reglamento (UE) nº 575/2011 de la Comisión de 16 de junio de 2011 relativo al Catálogo de materias primas para piensos. Diario Oficial de la Unión Europea. Luxemburgo. 2011;159:25-65.

13.

Zubr J. Qualitative variation of Camelina sativa seed from different locations. Ind Crop Prod 2003;(17):161-169.

14.

Johnson JMF, Gesch RW. Calendula and camelina response to nitrogen fertility. Ind Crop Prod 2013;(43):684-691.


RESIDUAL DE FERTILIZANTE MINERAL EN EL RENDIMIENTO Y LA CALIDAD DE CAMELINA (CAMELINA SATIVA L. CRANTZ)

15.

Miralles de Imperial R, Martín JV, Rodríguez C, Calvo R, Delgado MM. La aplicación de gallinazas en sorgo forrajero como cultivo energético. Rev Int Contam Ambie 2011;27(3):171-179.

20.

Ministerio de Agricultura, Pesca y Alimentación. Métodos Oficiales de Análisis. Ministerio de Agricultura, Pesca y Alimentación, Madrid, España. Tomo III, 1994.

16.

Miralles de Imperial R, Martín JV, Calvo R, Delgado MM. Evaluación de nutrientes lixiviados bajo cultivo de maíz por aporte de granjas avícolas. ITEA 2007;108(3):376-392.

21.

Ministerio de Agricultura, Pesca y Alimentación. Métodos Oficiales de Análisis. Ministerio de Agricultura, Pesca y Alimentación. Madrid. Tomo I. 1993.

17.

Williams CM, Barker JC, Sims JT. Management and utilization of poultry wastes. Rev Environ Contam Toxicol 1999;(162):105-157.

22.

Saña Vilaseca J, Moré Ramos JC, Cohí R. La gestión de la fertilidad de los suelos. Ministerio de Agricultura, Pesca y Alimentación. Madrid. 1996.

18.

Boletín Oficial del Estado. Real Decreto 506/2013, de 28 de junio, sobre productos fertilizantes. BOE 2013;(164):51119-51207.

23.

19.

Martinelli T, Galasso I. Phenological growth stages of Camelina sativa according to the extended BBCH scale. Ann Appl Biol 2011;(158):87-94.

Lošák T, Hlusek J, Martinec J, Vollmann J, Peterka J, Filipcik R, et al. Effect of combined nitrogen and sulphur fertilization on yield and qualitative parameters of Camelina sativa (L.) Crtz. (false flax). Acta Agriculturae Scandinavica Section B, Soil Plant Sci 2011;(61):313-321.

363


Rev Mex Cienc Pecu 2017;8(4):365-373

http://dx.doi.org/10.22319/rmcp.v8i4.4183

Cambios de la fracción hidrosoluble de huevo de gallinas alimentadas con harina de camarón almacenado a diferentes tiempos y temperaturas Changes in the water soluble fraction of eggs from hens fed with shrimp meal stored at different times and temperatures María E. Carranco-Jáureguia*, Silvia Carrillo-Domíngueza, Benjamín Fuente-Martínezb, Ernesto ÁvilaGonzálezb, María de Lourdes Solanoa RESUMEN El objetivo de este estudio fue determinar el efecto de las condiciones de almacenamiento, sobre la fracción hidrosoluble del huevo de gallinas alimentadas con una dieta convencional y una dieta con 20 % de harina de cabezas de camarón (HCC). Noventa (90) gallinas Isa-Brown de 32 semanas de edad se distribuyeron en dos tratamientos: Testigo y HCC. Durante cuatro semanas de ensayo se evaluaron las variables productivas. Los huevos recolectados (n= 250) para este estudio, se almacenaron por 15 y 30 días, a 20° y 4 °C, tomando como referencia huevos recién puestos (sin almacenar). Los parámetros estudiados fueron peso de huevo, Unidades Haugh, pH, proteína, aminoácidos indispensables y vitaminas hidrosolubles. Los resultados se analizaron utilizando un diseño factorial 2x2x3 y las diferencias entre medias se compararon mediante la prueba de Tukey. Los resultados obtenidos mostraron que los índices de calidad de la fracción hidrosoluble de huevo se vieron afectadas significativamente ( P<0.05) por el tiempo y la temperatura de almacenamiento, y diferencias (P<0.05) solo en proteína por el efecto de la inclusión de HCC. A temperatura ambiente (20 °C) y mayor tiempo de almacenamiento (30 días), provocó una disminución en la calidad interna del huevo de acuerdo a los resultados de este estudio. Por lo tanto, se concluye que tanto la temperatura como el tiempo son uno de los principales factores que llegan a influir en la calidad de la fracción hidrosoluble del huevo durante el almacenamiento. PALABRAS CLAVE: Harina, Camarón, Calidad de huevo, Almacenamiento.

ABSTRACT The objective of this study was to determine the effect of storage conditions on the water soluble fraction in eggs from hens fed with a conventional diet and a 20 % shrimp by-products meal (SBPM). Ninety (90) Isa-Brown laying hens 32 wk age were distributed in two treatments: Control and SBPM. The productive variables were evaluated during 4 wk. Eggs (n= 250) collected for this study, were stored at 15 and 30 d/ 20° and 4 °C, taking as reference fresh eggs (not stored). The parameters studied were egg weight, Haugh Units, pH, crude protein, essential amino acids and water soluble vitamins. The results were analyzed using a 2x2x3 factorial design and the differences between means were compared using the Tukey test. The data obtained showed that the quality indexes of the water soluble fraction of egg were significantly affected (P<0.05) by the time and the temperature of storage and differences (P<0.05) in protein alone due to the effect of SBPM inclusion. At room temperature (20 °C) and longer storage time (30 d), a decrease in internal egg quality was observed according to the results of this study. Therefore, it is concluded that both temperature and time are one of the main factors influencing the eggs quality of the water-soluble fraction of the egg during storage. KEY WORDS: Shrimp heads meal, Egg quality, Storage.

Recibido el 11 de mayo de 2016. Aceptado el 25 de abril de 2017. a

Depto. Nutrición Animal Dr. Fernando Pérez-Gil Romo, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, Vasco de Quiroga No. 15, Col. Belisario Domínguez Sección XVI, Ciudad de México. México. b

Centro de Experimentación, Investigación y Extensión en Producción Avícola, UNAM, Ciudad de México, México.

*Autor para correspondencia: rexprimero@hotmail.com

365


María E. Carranco-Jáuregui, et al. / Rev Mex Cienc Pecu 2017;8(4):365-373

INTRODUCCIÓN

propuesta por los autores mencionados(4) sufren modificaciones durante condiciones estandarizadas de almacenamiento. Por lo tanto el objetivo de esta investigación fue determinar los cambios físicos y químicos de la fracción hidrosoluble, de huevos provenientes de gallinas cuya dieta incluyó 20 % de harina de cabezas de camarón, almacenados a 0, 15 y 30 días/4° y 20 °C.

En México las cabezas de camarón (Litopenaeus spp) son un subproducto natural que no tiene utilidad a nivel industrial, ya que se desperdician alrededor del 33 %, por lo que se considera un contaminante. Desde el año 1990 a la fecha, se han buscado alternativas para el uso de este subproducto de la industria pesquera, para utilizarse como fuente de proteína animal en dietas acuícolas(1-3). Por las características de la harina de cabezas de camarón (HCC), en cuanto a su contenido de proteína (45 a 55 %), se ha utilizado en la avicultura. Los huevos provenientes de aves alimentadas con esta harina han mostrado un ligero incremento de los componentes de la parte hidrosoluble del huevo, en comparación con los huevos provenientes de una dieta convencional(4,5).

MATERIAL Y MÉTODOS El estudio se realizó en el Departamento de Nutrición Animal Dr. Fernando Pérez-Gil Romo, del Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán y en el CEIEPAv (Centro de Enseñanza, Investigación y Extensión en Producción Avícola) de la Facultad de Medicina Veterinaria y Zootecnia (UNAM). Se utilizaron 30 kg de harina de cabezas de camarón (HCC) procedentes de Proteínas Marinas y Agropecuarias S.A. de C.V. (Guadalajara, Jalisco, México). La harina de HCC se guardó en bolsas de plástico negras y se congelaron a -20 °C hasta su utilización. A esta harina se le realizaron los siguientes análisis de acuerdo con las técnicas estandarizadas publicadas por AOAC(11): proteína cruda (Método 976.05), cenizas (Método 942.05), extracto etéreo (Método 920.39), minerales (Métodos Cap. 4-40), perfil de aminoácidos (HPLC) (Manual Waters Acc-QTAG, Manual No. WAT052874, abril 1993) y energía bruta por bomba calorimétrica Parr.

La Unión Nacional de Avicultores(6) reporta un consumo de huevo en México per capita anual de 22 kg (305 huevos/persona/año aproximadamente). Siendo el huevo un alimento completo, de bajo costo y versátil en su preparación, éste no llega al consumidor, fresco, es decir, recién puesto por la gallina, sino que se almacena a tiempos y temperaturas diversas. La Norma Oficial Mexicana(7) define a un huevo fresco aquel que no excede los 15 días después de la puesta. Durante este periodo la cámara de aire se incrementa debido a la pérdida de agua y se presenta una modificación en el pH, siendo los principales factores la temperatura, el tiempo y la humedad relativa los que afectan la calidad del huevo durante el almacenamiento(8). Este cambio, más el efecto de los compuestos provenientes de nuevas materias primas que se adicionen a la dieta de aves, pueden repercutir en la calidad física y química del huevo(9,10). De acuerdo con los resultados publicados por otros autores(4) quienes trabajaron con HCC en niveles de inclusión de 10, 15, 20 y 25 %, indican que el mejor nivel fue el del 20 %, reportando un huevo de buena calidad. Niveles superiores provocaron una modificación en las características sensoriales (olor y sabor) del huevo, por lo cual se consideró adecuado trabajar con 20 % de inclusión, para determinar si las propiedades físicas y composición química de la parte hidrosoluble del huevo proveniente de gallinas alimentadas con una dieta convencional y la dieta

Preparación de dietas y ensayo con aves Las dietas se formularon por medio del programa NUTRION 5 Básico/Nutrion 5 PRO, sistema computarizado para la formulación de alimentos balanceados (Guadalajara, Jal. México) Nutrion WindowsTM (Versión 5.0 Pro), cubriendo las necesidades nutrimentales establecidas por el National Research Council (NRC)(12) para gallinas ponedoras, y con base en los aminoácidos totales. El procedimiento utilizado en este estudio fue aprobado por el Subcomité Institucional para el Cuidado y uso de Animales Experimentales (SICUAE), Facultad de Medicina Veterinaria y Zootecnia de la Universidad Nacional Autónoma de México(13). Noventa (90) gallinas Isa-Brown de 32 semanas de edad se distribuyeron al azar en dos

366


CAMBIOS DE LA FRACCIÓN HIDROSOLUBLE DE HUEVO DE GALLINAS

tratamientos de 45 gallinas cada uno y con cinco repeticiones: T1= Testigo y T2= 20% HCC. El agua y el alimento se proporcionaron a libre acceso por cuatro semanas que duró el experimento. Durante este tiempo se midieron las variables productivas (peso y masa del huevo, consumo de alimento y conversión alimenticia). Al finalizar las cuatro semanas, se recolectaron 250 huevos/tratamiento y se almacenaron de la siguiente manera: día 0 (50 huevos); 15 días/20 °C (50 huevos) y 15 días/4 °C (50 huevos); 30 días/20 °C (50 huevos) y 30 días/4 °C (50 huevos).

Los resultados de los análisis físicos y químicos de la fracción hidrosoluble del huevo se analizaron de acuerdo a un diseño factorial 2x2x3 siendo los factores: tratamiento, tiempo y temperatura. Para la comparación entre medias se utilizó la prueba Tukey con un nivel de confianza del 95%, SPSS versión 11.0 para Windows (SPSS Inc, Chicago IL, USA). El modelo utilizado fue Yijk = μ + αi + βj +ᵞk (αβ)ij + (αᵞ)ik + (βᵞ)jk +(αβᵞ)ijk + Єijk(l) Donde Yijk= variable de respuesta; μ= media; αi= efecto del i-esimo tratamiento; βj= efecto del j-esimo tiempo; ᵞk= efecto del k-esimo temperatura; (αβ)ij= efecto de la interacción del tratamiento y tiempo; (βᵞ)jk= efecto de la interacción del tiempo y la temperatura; (αβᵞ)ijk= interacción del

Experimento 1. A los huevos frescos y almacenados 15 y 30 d/20 y 4 °C se les determinó peso de huevo y Unidades Haugh (UH), utilizando un equipo automatizado para estas mediciones (Technical Service and Supplies, Inc., England, UK). Este sistema consta de un microprocesador (QCM+) conectado a una balanza digital y un micrómetro para la medición de altura de albúmina. El QCM+ recopila los datos de los instrumentos en línea y muestra una lectura, la cual es transferida a una computadora equipada con el software de calidad de huevo. Las UH se calcularon a partir de la altura de albúmina y peso de huevo por el mismo procesador.

Cuadro 1. Composición química de la harina de cabezas de camarón*

Experimento 2. Las muestras de huevo del

Experimento 1, conforme fueron cumpliendo las condiciones de tiempo de almacenamiento, se mezclaron (yema y albúmina), se midió el pH utilizando un potenciómetro HANNA Instrument pH210, Microprocesor pH Meter y posteriormente se liofilizaron. Al huevo liofilizado se le realizaron los análisis de proteína cruda, vitaminas hidrosolubles y aminoácidos indispensables.

Análisis estadístico Los resultados de las variables productivas se analizaron mediante un diseño completamente al azar (ANOVA) y las diferencias entre medias por la prueba de Tukey con un nivel de confianza del 95 %, con el programa SPSS versión 11.0 para Windows (SPSS Inc, Chicago IL, USA). El modelo utilizado fue: Yij = μ + τi + Єij Donde Yij= variable de respuesta; μ= media general; τi= efecto del i-esimo tratamiento; Єij= error experimental.

Humedad, g/100 g Cenizas, g/100 Extracto etéreo, g/100 g Proteína cruda, g/100 g Carbohidratos totales, g/100 g Energía bruta, Kjoules/g Calcio, mg/100 g Sodio, mg/100 g Magnesio, mg/100 g

9.02 ± 0.01 32.82 ± 0.03 0.96 ± 0.03 39.64 ± 0.26 26.58 10.19 ± 0.37 4.58 ± 0.15 10.45 ± 0.28 14.02 ± 0.21

Aminoácidos** Isoleucina Leucina Lisina Metionina Cistina Fenilalanina Tirosina Alanina Ácido aspártico Glutamina Treonina Glicina Prolina Serina Valina Arginina Histidina

4.12 ± 0.02 6.85 ± 0.02 10.12 ± 0.03 1.58 ± 0.02 2.02 ± 0.01 4.35 ± 0.01 4.18 ± 0.01 6.55 ± 0.01 9.25 ± 0.02 14.95 ± 0.01 3.85 ± 0.03 7.81 ± 0.02 5.25 ± 0.02 3.46 ± 0.01 5.36 ± 0.03 3.75 ± 0.01 6.82 ± 0.01

*Se reporta la media y desviación estándar de 6 repeticiones. ** (g/100 g de proteína).

367


María E. Carranco-Jáuregui, et al. / Rev Mex Cienc Pecu 2017;8(4):365-373

tratamiento, el tiempo y la temperatura; Єijk(l)= error experimental.

Cuadro 2. Dietas experimentales suplementadas con harina de cabezas de camarón

RESULTADOS

Composición química de la harina de cabezas de camarón (HCC) En el Cuadro 1 se presentan los resultados del análisis químico aproximado, siendo las fracciones más abundantes proteína cruda (PC) (39.64 %), cenizas (32.82 %), Mg (14.02 mg/100 g) y Na (10.45 mg/100 g). Con base a la composición química y de aminoácidos de la harina se formularon las dietas experimentales (Cuadro 2).

Variables productivas Al analizar los promedios, se encontró que no hay una diferencia significativa (P>0.05) para las variables productivas entre los tratamientos, indicando que la inclusión de HCC no causó problemas. Carranco et al(4) mencionan que las inclusiones mayores al 20 % de HCC presentaron diferencias (P<0.05) en consumo de alimento, posiblemente debido al contenido de sal o que hayan detectado algún olor o sabor desagradable (pescado) (Cuadro 3).

Ingredientes (g/kg)

Testigo

Harina de cabezas de camarón

Sorgo Harina de cabezas de camarón Carbonato de calcio Pasta de soya Fosfato de calcio 1821 Aceite vegetal Sal Premezcla de vitaminasa L-Lisina HCl DL-Metionina Secuestrante de micotoxinas L-Treonina Pigmento amarillob Cloruro de colina 60% Bacitracina zinc Pigmento rojoc Antioxidante Total

673.957 0.000 107.159 182.800 11.931 10.000 3.626 2.500 2.426 2.249 1.000 0.703 0.500 0.500 0.300 0.200 0.150 1000

648.857 200.000 82.920 37.371 13.233 9.770 3.048 2.500 0.000 0.000 1.000 0.000 0.500 0.500 0.300 0.000 0.000 1000

Análisis calculado Energía metabolizable, kcal/kg 2750 Proteína cruda, % 15.00 Metionina, % 0.456 Metionina + cistina, % 0.690 Calcio total, % 4.178 Fósforo disponible, % 0.340 Sodio, % 0.150 Lisina, % 0.860 Treonina, % 0.620 Triptófano, % 0.191

Perfil de aminoácidos No se presentaron diferencias estadísticas (P>0.05) en los resultados de aminoácidos tanto en huevo testigo como con HCC, así como en tiempos ni temperaturas (Cuadro 4).

Peso de huevo, proteína cruda (PC), pH y unidades Haugh (UH) En el Cuadro 5 se presentan los resultados de las respuestas entre la adición de HCC, temperatura y tiempo, encontrándose diferencias en peso de huevo a 4°C/15 días, para PC sólo se presentaron

2750 15.10 0.495 0.984 3.450 0.340 0.150 2.268 1.041 0.177

a Vitamina A, 12,000 UI; D3, 2,500 UIP; E, 30 UI; K, 2 mg; B1, 2.25 mg; B2, 7.5 mg; B6, 3.4 mg; B12, 0.02 mg; ácido D-pantoténico, 12.5 mg; biotina, 0.125 mg; ácido fólico, 1.5 mg. b Xantofilas amarillas de la flor de Cempazuchil (15 ppm). c Xantofilas rojas (cantaxantina, 10 ppm).

Cuadro 3. Variables productivas de gallinas alimentadas con harina de cabezas de camarón (HCC) Testigo HCC

Producción huevo (%) 88.35 ± 6.26

Peso huevo (g) 64.20 ± 1.30

Conversión alimenticia 2.07 ± 0.11

Consumo alimento ave/día/g 118 ± 2.54

83.02 ± 7.78

64.24 ± 2.12

2.11 ± 0.14

112.8 ± 5.56

(P>0.05).

368


CAMBIOS DE LA FRACCIÓN HIDROSOLUBLE DE HUEVO DE GALLINAS

Cuadro 4. Promedios de la composición de aminoácidos esenciales (g/100 g de proteína) en huevo almacenados a diferentes tiempos y temperaturas Días

Isoleucina

Leucina

Lisina

Metionina

Fenilalanina

Treonina

Valina

Arginina

Histidina

Testigo 20°C

4°C

20°C

4°C

0 15 30 0 15 30

20.23 ± 0.15 19.86 ± 0.021 19.82 ± 0.014 20.23 ± 0.15 20.04 ± 0.014 19.96 ± 0.021

32.55 ± 0.007 31.93 ± 0.021 31.18 ± 0.014 32.55 ± 0.007 32.46 ± 0.014 32.16 ± 0.014

24.56 ± 0.02 23.86 ± 0.021 23.52 ± 0.021 24.56 ± 0.02 24.26 ± 0.021 24.22 ± 0.035

12.54 ± 0.007 12.43 ± 0.021 12.36 ± 0.021 12.54 ± 0.007 12.48 ± 0.021 12.43 ± 0.028

21.54 ± 0.00 21.13 ± 0.021 21.03 ± 0.014 21.54 ± 0.00 21.22 ± 0.014 21.19 ± 0.028

16.88 ± 0.00 16.72 ± 0.014 16.66 ± 0.014 16.88 ± 0.00 16.77 ± 0.007 16.73 ± 0.028

24.54 ± 0.01 23.97 ± 0.028 23.76 ± 0.014 24.54 ± 0.01 24.51 ± 0.014 24.26 ± 0.014

24.57 ± 0.01 24.32 ± 0.014 24.03 ± 0.028 24.57 ± 0.01 24.48 ± 0.00 24.36 ± 0.021

8.87 ± 0.007 8.76 ± 0.014 8.63 ± 0.021 8.87 ± 0.007 8.78 ± 0.014 8.76 ± 0.014

0 15 30 0 15 30

21.42 21.12 19.96 21.42 21.23 21.20

33.23 ± 0.02 32.46 ± 0.021 31.99 ± 0.021 33.23 ± 0.02 32.93 ± 0.021 32.84 ± 0.014

25.86 ± 0.02 25.20 ± 0.014 25.06 ± 0.021 25.86 ± 0.02 25.53 ± 0.028 25.42 ± 0.021

Harina de camarón 13.83 ± 0.01 22.05 ± 0.01 13.44 ± 0.01 21.92 ± 0.021 13.24 ± 0.042 24.56 ± 0.021 13.83 ± 0.01 22.05 ± 0.01 13.56 ± 0.021 21.96 ± 0.021 13.46 ± 0.021 21.96 ± 0.014

17.25 ± 0.01 16.58 ± 0.038 16.53 ± 0.028 17.25 ± 0.01 17.14 ± 0.028 17.02 ± 0.021

25.66 ± 0.02 25.28 ± 0.014 25.14 ± 0.028 25.66 ± 0.02 25.46 ± 0.028 25.10 ± 0.021

25.88 ± 0.007 25.60 ± 0.014 25.36 ± 0.028 25.88 ± 0.007 25.79 ± 0.021 25.78 ± 0.014

9.94 ± 0.01 9.71 ± 0.007 9.36 ± 0.021 9.94 ± 0.01 9.86 ± 0.021 9.76 ± 0.021

± 0.02 ± 0.021 ± 0.021 ± 0.02 ± 0.028 ± 0.014

(P>0.05).

diferencias entre tiempos de almacenamiento y UH; se encontraron diferencias significativas en tiempo, temperatura y dietas (P<0.05).

Cuadro 5. Respuesta de la adición de harina de cabezas de camarón la temperatura y el almacenamiento de huevo sobre el peso, proteína cruda, pH y Unidades Haugh

Dieta

Testigo Temperatura

Harina de camarón Temperatura

20 °C

20 °C

4 °C

Promedio

64.28 61.35 64.24 63.29a

64.28 59.96 63.23 62.49b

64.03ª 61.05b 63.80a

Proteína cruda (%) 48.8 48.8 50.9 50.0 50.3 49.7 47.3 50.1 48.6 48.7a 49.7a 49.7a

50.0 50.6 50.2 50.3a

49.6ª 50.1b 49.0a

7.50 8.70 9.25 8.48a

7.50 8.85 9.40 8.58ª

7.42c 8.77b 9.32ª

78.32 58.90 43.95 60.39b

78.32 65.24 65.81 69.79a

77.23ª 61.14b 53.93c

4 °C

El Cuadro 6 muestra el efecto de la temperatura y tiempo sobre el peso, PC, pH y UH del huevo. Se reportan diferencias (P<0.05) a 30 días de almacenamiento y las temperaturas para las variables estudiadas; sin embargo se observa que los mejores resultados fueron para el huevo almacenado a 4 °C.

Peso huevo (g) Días de almacenamiento 0 15 30 Tiempo x Temp EEM= 0.27 0 15 30 Tiempo x Temp EEM= 0.27 0 15 30 Tiempo x Temp EEM= 0.06 0 15 30 Tiempo x Temp EEM= 1.56

64.16 62.77 63.87 63.60a

7.35 8.70 9.25 8.43a

64.49 60.10 63.87 62.82b

pH 7.35 8.85 9.40 8.53a

Unidades Haugh 76.14 76.14 50.84 69.57 41.52 64.44 56.17c 70.05a

El efecto de la dieta y el tiempo de almacenamiento del huevo sobre peso, PC, pH y UH se presentan en el Cuadro 7, observándose que para el peso de huevo y PC hubo diferencias significativas (P<0.05) tanto en días de almacenamiento como en las dietas, teniendo los valores más bajos a los 30 días de almacenamiento; sin embargo aunque se presentó un aumento en el pH, no hubo diferencias significativas, y en UH se presentaron diferencias (P<0.05) sólo entre dietas. DISCUSIÓN En el presente trabajo los valores obtenidos para la composición química de HCC resultaron ser menores a los reportados por Charley(14) para harina de otro crustáceo (cangrejo 47.2 %) y por Castro et al(15) quienes informan un contenido de 39.9 % para el crustáceo langostilla. En cuanto a la cantidad

Valores con diferente letra en fila o columna son diferentes (P<0.05). Tiempo x Temp= promedio de días de almacenamiento por temperatura. EEM= error estándar de la media. abc

369


María E. Carranco-Jáuregui, et al. / Rev Mex Cienc Pecu 2017;8(4):365-373

Cuadro 6. Efecto de la temperatura y el tiempo de almacenamiento del huevo sobre el peso, proteína cruda, pH y unidades Haugh Temperatura 0

Cuadro 7. Efecto de la dieta y el tiempo de almacenamiento del huevo sobre el peso, proteína cruda, pH y unidades Haugh

Días de almacenamiento 15 30 Promedio

Dieta

Peso huevo (g) 20 °C 4 °C EEM=0.08

64.07ª 64.07ª

63.86a 64.20a

60.03b 62.06ª

62.65b 63.44a

Testigo Camarón EEM=0.12

48.0b

49.2b

50.1ª

50.2ª

Testigo Camarón EEM=0.19

9.25ª 9.40ª

8.45b

42.73d 65.12b

58.27b 69.92ª

Proteína cruda (%) 20 °C 4 °C EEM=0.19 20 °C 4 °C EEM=0.04

49.9ª 49.9ª pH 7.42ª 7.42ª

49.8ª 50.4ª

77.23ª 77.23ª

Proteína cruda (%) 48.8c 50.1ab 50.9ª 50.2ab

48.7c 49.4bc

49.2b 50.2ª

9.32ª 9.32ª

8.48ª 8.53ª

52.98ª 54.88ª

63.11b 65.09ª

pH 8.70ª 8.85ª

Testigo Camarón EEM=0.04

8.55ª

Unidades Haugh 20 °C 4 °C EEM=1.1

Días de almacenamiento 0 15 30 Promedio Peso huevo (g) 63.87b 64.32ab 61.43c 63.21a ab bc 64.28ª 63.73 60.65 62.89ª

54.87c 67.41b

Testigo Camarón EEM=1.1

Valores con diferente letra en fila o columna son diferentes (P<0.05). EEM= error estándar de la media.

7.35ª 7.50ª

8.77ª 8.77ª

Unidades Haugh 76.14ª 60.21a 78.32a 62.07ª

Valores con distinta letra en fila o columna son diferentes (P<0.05). EEM= error estándar de la media.

abcd

ab

de cenizas, la HCC mostró un valor similar (32.82 %) a lo reportado por otros autores que va de 28.9 hasta 33 %(16-18), lo cual se puede explicar por el medio ambiente en el que viven estos crustáceos, ricos en minerales. El extracto etéreo resultó estar presente en muy pequeñas cantidades en HCC (0.96 %), valor similar a lo reportado por Charley(14) de 0.80 % para harina de camarón. Para otros crustáceos se reportan contenidos de cenizas entre 4.9 y 7.29 %, explicándose esta variabilidad probablemente a la temporada y sitio geográfico de captura. La energía bruta obtenida en este estudio fue de 10.19 Kjoules/g en HCC, valores similares a los de la harina de carne (11.36 Kjoules/g), que también ha sido empleada como ingrediente en dietas para gallinas ponedoras(18).

serina 3.46 %. Por su parte Quintero(20), publicó valores mayores para los aminoácidos reportados en este estudio, a excepción de histidina (6.82 %), valina (5.36 %) y lisina (10.12 %), mayores en este estudio. De acuerdo a la formulación de dietas para las aves(12), sólo fue necesario adicionar a la dieta testigo los aminoácidos metionina, treonina y lisina, a diferencia de las dietas elaboradas con HCC, que fueron buena fuente de lisina (10.12 %) y metionina (1.58 %). Como lo menciona Huyghebaert(21), una vez puesto el huevo y durante su almacenamiento, se presentan varios cambios bioquímicos, físicos y mecánicos propios de los constituyentes del huevo. Algunos de estos son el aumento de volumen de la cámara de aire, la licuefacción de la albúmina densa y el debilitamiento de la membrana vitelina que separa la yema y la albúmina(22). A esto, cabe citar que los factores que pueden afectar la calidad interna del huevo son la línea genética, edad de la gallina, así como el tiempo y condiciones de almacenamiento del huevo(23) .

Con respecto a los aminoácidos indispensables para las aves, la mayoría se encuentran en cantidades superiores comparada a lo reportado por otros autores(19), a excepción de la arginina (3.72 %) y serina (2.67 %) reportada por estos autores, y que en este estudio para HCC arginina fue de 3.75 % y

370


CAMBIOS DE LA FRACCIÓN HIDROSOLUBLE DE HUEVO DE GALLINAS

En peso de huevo se observó una pérdida de éste a los 30 días de almacenamiento en ambas temperaturas. Esto se debe a que el tiempo de almacenamiento va a disminuir el valor de la gravedad específica al ser provocada por la deshidratación interna del huevo. Para conocer esta gravedad específica se llega a aplicar el principio de Arquímides, que menciona que la masa de un cuerpo dividido por su volumen es igual a su peso específico, y que en huevo se reporta entre 1.02 a 1.04(24) .

las aves. A través de diversos análisis de laboratorio se pueden evaluar los cambios que sufren las muestras, tanto frescas, así como durante su almacenamiento, específicamente en las características físicas (peso del huevo y UH) y químicas (proteína, pH, aminoácidos y vitaminas), mismas que van a incidir en la calidad y preferencia por parte del consumidor. Según lo reportado por Grobas y Mateos(27), los componentes hidrosolubles del huevo muestran escasa variación al modificar los ingredientes de la dieta del ave, sin embargo, estos autores no consideran los cambios debidos a las condiciones y tiempo de almacenamiento.

El pH en el huevo recién puesto tiene un valor aproximado de 7.31 y se eleva a 8.53 después de 24 h a 20 °C, alcanzando valores de 9.38 después de 10 días(25) . En este trabajo, el pH de huevo fresco fue de 7.35 y 7.50 y fue aumentando conforme pasó el tiempo de almacenamiento tanto en testigo como con HCC a los 15 y 30 d/20 y 4 °C (8.7-9.25; 8.859.40 y 8.7-9.25; 8.85-9.40 respectivamente), lo cual concuerda con lo señalado por Li-Chan et al(2), quienes encontraron que en huevo fresco (en el momento de la postura) el pH oscilaba entre 7.6 y 8.5. Estos mismos autores encontraron valores de pH de 9.18 a 3 días de puesta a 3 °C y después de 21 días un pH de 9.4.

En la gallina, más significativo que la cantidad total de proteína, lo es el consumo diario de aminoácidos necesarios para producir la proteína del huevo. Los de importancia para el ave fueron cuantificados en HCC. Se han considerado como aminoácidos limitantes en las dietas para aves metionina, lisina y treonina, en HCC los contenidos de estos fueron suficientes, de tal forma que no fue necesario adicionarlos a la dieta, a diferencia de la testigo donde se añadieron para cubrir las necesidades del ave. Por lo tanto, la disminución de alguno de ellos afecta negativamente la producción de albúmina en el huevo, además de disminuir con el tiempo, el tamaño del huevo. La calidad de proteína está relacionada con la información genética de esta especie animal, misma que es considerada de un alto valor biológico, y como referencia para otro tipo de alimentos para consumo humano(28). De ahí la importancia que la dieta del ave lleve los niveles adecuados de los aminoácidos indispensables para mantener la calidad biológica y comercial del huevo.

El pH del huevo (principalmente de la albúmina) es un factor importante en el control de las propiedades reológicas de geles formados durante el tratamiento térmico (80 °C). Éste depende del equilibrio entre el dióxido de carbono disuelto, iones bicarbonato e iones de carbono que se rigen por la presión parcial del dióxido de carbono del medio ambiente exterior, aumentando las concentraciones de iones bicarbonato a medida que el carbonato disminuye(2). Conforme aumenta el pH en el huevo durante el almacenamiento, disminuye la elasticidad del gel, la penetración de la fuerza y el índice de viscosidad. Esto traerá como consecuencia que las propiedades funcionales de la albúmina, como gelificación, coagulación, emulsión, formación de espuma, viscosidad y capacidad de retención de agua, se vean afectadas por factores como la fuerza iónica, pH, temperatura, tensión superficial, entre otros, haciendo más frágil a la albúmina(26).

La Norma Mexicana: Productos avícolas-huevo fresco de gallina-especificaciones de métodos de prueba(7), establece las características físicas y especificaciones que debe cumplir el “huevo fresco clasificado de gallina” que se produce o comercializa dentro del territorio nacional. En esta norma se reconocen cinco categorías en el huevo fresco de gallina, las cuales están determinadas por su peso y tamaño y se deben aplicar a todas las clasificaciones de consumo (extra grande= mayor a 64 g; grande= 60-64 g; mediano= 55-60 g; chico= 50-55 y canica menor a 50 g). De acuerdo a las categorías

Tanto la calidad física como química del huevo son importantes, más aún cuando se incorporan nuevos ingredientes en la formulación en la dieta de

371


María E. Carranco-Jáuregui, et al. / Rev Mex Cienc Pecu 2017;8(4):365-373

anteriores, tanto el huevo testigo como con HCC el peso promedio del huevo fue de 63 g y al final (30 d/20° y 4°C) fue de 60 g, permaneciendo en la categoría de huevo grande.

espacial de las capas de la misma y de la yema(2). Los mecanismos responsables de este cambio son complejos y no muy definidos, pero todos implican alteraciones de las proteínas como: 1) destrucción parcial del complejo lisozima-ovomucina debido a una inactivación de la lisozima; 2) destrucción de los enlaces electrostáticos entre los grupos amino de los residuos lisina de la lisozima y los grupos carboxilo del ácido siálico de la ovomucina cuando el pH se eleva; 3) disociación de las subunidades de la ovomucina, principalmente de las β, lo que se ve favorecido por el paso de iones divalentes desde la clara a la yema durante la conservación del huevo; 4) modificación de la estructura de la ovomucina, especialmente la subunidad β, lo que modifica el tipo de complejo lisozima-ovomucina, debido al aumento de pH y, 5) degradación parcial de los enlaces oglicosídicos, lo que produce la solubilización de la ovomucina-β, por la liberación de hexosas, hexosaminas y ácido siálico mediante un proceso de β-eliminación alcalina(2).

Desrosier(28), observó que a los 15 días se presenta una pérdida de peso de huevo de 5 a 6 % y a 30 días hasta de 10 % sin importar el método de conservación. Otros autores reportan que a los 15 d/7.2 °C se presenta una pérdida del 1.4 %, mientras que a 22 °C fue de 2.9 %, pero en refrigeración a 30 días fue del 3.1 %. Posiblemente los resultados reportados por estos autores y los de este estudio se deban a una pérdida de agua por evaporación, y esto es en función de la duración del almacenamiento, temperatura, superficie y porosidad del cascarón, así como la humedad relativa del medio ambiente. La evaporación es función lineal del tiempo de conservación y se traduce en una pérdida de peso y aumento en la cámara de aire(26,29). Así mismo, en la misma Norma Mexicana(7) se menciona la clasificación del huevo fresco de gallina para plato en los siguientes grados, conforme a las especificaciones: la escala de las unidades Haugh (UH) va de 0 a 110, y la interpretación de la misma es un auxiliar para determinar el tiempo de postura: a menor valor, mayor es el envejecimiento de éste. Por lo tanto esta clasificación será: México Extra mayor a 60 UH; México 1 de 61-70 UH; México 2 de 31-60 UH; Fuera de clasificación menor a 30 UH. En general, tanto en huevo testigo como el de HCC (76.1, 78.3 y 81.9 UH a 20 °C respectivamente) se clasificaron como huevo Extra grande (> 5.5 mm altura de albúmina y >70 UH, para huevo recién puesto) disminuyendo para 15 y 30 días a 4 °C, clasificándose como huevo Grande (>4.2 mm y 6170 UH) y a 30 días/20 °C como huevo Mediano (>3.0 mm y 31-60 UH).

Los fenómenos mencionados se relacionan con la liberación de anhídrido carbónico desde el interior del huevo, tendiendo a equilibrar su concentración con la tensión parcial con el aire circundante, dando como resultado un aumento en el pH. Las modificaciones se aceleran notablemente cuando el huevo se almacena a temperatura ambiente(29). Lo anterior se presentó en los huevos almacenados a 20 °C por 15 y 30 días; al abrirlos se pudo observar que la yema se desplazó de su posición original (centro), se encogió, se aplanó y la membrana celular (vitelina) se rompió con facilidad. Todos estos cambios están asociados a las alteraciones generadas en las proteínas presentes en la albúmina. Cabe destacar que aunque no hubo diferencias en la composición de las vitaminas hidrosolubles, cobra importancia cuando se considera el etiquetado de nutrimentos de los alimentos(30).

En este estudio se presentó una disminución en las UH por efecto de la dieta, el tiempo y la temperatura de almacenamiento, siendo más notable en el huevo almacenado a 30 días/20°C. Esto se puede entender al presentarse una disminución de la calidad de la albúmina, reflejada en las UH, manifestándose por la licuefacción de la albúmina densa que tiene como consecuencia la pérdida de la estructura interna y de la organización

CONCLUSIONES E IMPLICACIONES De acuerdo a los resultados obtenidos en este trabajo se concluye la importancia que tienen la temperatura y el tiempo de almacenamiento en la conservación de la calidad de huevo, ya que se

372


CAMBIOS DE LA FRACCIÓN HIDROSOLUBLE DE HUEVO DE GALLINAS

Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación, México. 1999.

observaron los cambios físicos, químicos y mecánicos de los componentes internos del huevo desde la puesta hasta los 30 días de almacenado el huevo, siendo estos cambios irreversibles aun cuando las condiciones sean las óptimas. Se recomienda llevar a cabo este mismo ensayo con más tiempo de duración y llevar a cabo el análisis de digestibilidad de la proteína y aminoácidos de la harina de cabezas de camarón.

14. Charley H. Tecnología de alimentos. Procesos químicos y físicos en la preparación de alimentos., México: Limusa; 2004. 15. Castro GM, Carrillo DS, Pérez-Gil RF, Calvo CC. Composición química de la langostilla y procesos tecnológicos. En: AureolesGamboa D, Balart EF editores. La langostilla: biología, ecología y aprovechamiento. Centro de Investigaciones Biológicas del Noroeste, S.C. México. 1995. 16. Cruz-Suárez LE, Ricque-Marie D, Martínez-Vega JA, Wesche-Eveling P. Evaluation of two shrimp by-product meals as protein sources in diets for Penaeus vannamei. Aquaculture 1993;115:53-62. 17. FAO. Joint FAO/WHO Codex Alimentarius Commission. Codex alimentarius. Food & Agriculture Org. 1994.

LITERATURA CITADA 1.

Casas VM, Ponce D. Estudio del potencial pesquero y acuícola de Baja California Sur. SEMARNAP, Gob. Edo. BCS, FAO, INAPESCA, UABCS, CIB, CICIMAR y CET del MAR. México, Vol. I. 1999.

2.

Li-Chan EC, Powrie D, Nakai S. The chemistry of eggs and egg products. In: Yoshinori M editor. Egg bioscience and technology. New Jersey, USA: John Wiley and Sons; 2008.

3.

Goddard JS, Perret JSM. Co-drying fish silage for use in aquafeeds. Anim Feed Sci Tech 2005;118:337-342.

4.

Carranco JM, Calvo CC, Arellano ML, Pérez-Gil RF, Ávila GE, Fuente MB. Inclusión de la harina de cabezas de camarón Penaeus sp. en raciones para gallinas ponedoras. Efecto sobre la concentración de pigmento rojo en yema y calidad de huevo. Interciencia 2003;28:328-333.

5.

18. Andrade DR, Torres GR, Montes MEJ, Chávez BMM, Naar OV. Elaboración de un sazonador a base de harina de cabezas de camarón de cultivo (Penaeus sp). Rev Fac Química Farmacéutica, Colombia. 2007;14:109-113. 19. Toma RB, Meyers S. Isolation and chemical evaluation of protein from shrimp cannery effluent. J Agric Food Chem 1975;23:632-635. 20. Quintero HE. Ingredientes para alimentos acuícolas - Parte I. American Soybean Association, 2009. 21. Huyghebaert G. Fisiología de la puesta con énfasis en la calidad de la cáscara. Selecciones avícolas. Abril 2006. 22. Berardinelli A, Ragni L, Giunchi A, Gradari P, Guarnieri A. Physicalmechanical modifications of eggs for food-processing during storage. Poult Sci 2008;87:2117-2125.

Carranco JM, Sanginés G, Morales B, Carrillo D, Ávila G, Fuente M, et al. Shrimp head meal in laying hen rations and its effects on fresh and stored egg quality. Interciencia 2006;31:822-827.

6.

UNA. Unión Nacional de Avicultores. 2015 http://www.una.org.mx Consultado 22 Feb, 2016.

línea].

23. Estrada MM, Galeano LF, Herrera MR, Restrepo LF. Efecto de la temperatura y el volteo durante el almacenamiento sobre la calidad del huevo commercial. Rev Colomb Cienc Pecu 2010;23:183-190.

7.

NMX. Norma Mexicana FF-079-SCFI. Productos avícolas. Huevo fresco de gallina. Especificaciones y métodos de prueba. Secretaría de Economía. México. 2004.

24. Zalapa RA. Correlación gráfica entre el peso del huevo, la altura de la clara y las Unidades Haugh. 2016. www.researchgate.net/publication/290523405. Consultado 20 Dic, 2016.

8.

Buba W, Dafwang II, Olugbemi TS, Opoola E, Iyiola-Yunji AO, Okafor EC. Effects of local storage methods on egg internal quality parameters during cold season. J Amin Prod Res 2013;25:45-51.

9.

Ahn DU, Sell J, Chamruspollet M, Jeffrey M. Effect of dietary conjugated linolenic acid on the quality characteristics of chicken eggs during refrigerated storage. Poult Sci 1999;78:922-928.

[en

25. Scott TA, Silversides FG. The efect of storage and strain of hen on egg quality. Poult Sci 2000;79:1725-1729. 26. Croguennec T, Nau F, Brulé G. Influence of pH and salts on egg white gelation. J Food Sci 2002;67:608-614. 27. Grobas S, Mateos G. Influencia de la nutrición sobre la composición nutricional del huevo. XII Curso de Especialización FEDNA. 1996.

10. Guerra M. Factores que afectan la calidad del huevo. Agricultura 2000;(4):38-40.

28. Desrosier NW. Elementos de tecnología de alimentos. 10ª reimpresión. México, DF: Compañía Editorial Continental SA; 1994.

11. AOAC. Official methods of analysis, Ass. Off. Agric. Chem. 17th rev. ed. Washington DC, USA. 2000.

29. Arias JL, Fernández MS, Nys Y. Importancia de la calidad del huevo. 2007. www.tecnovet.uchile.cl/CDA/tecnovet_articulo.htm. Consultado 29 Jun, 2015.

12. National Research Council, (NRC). Nutrient requirement of poultry. 9th ed, Washington DC: Academy Press. Newsletter. 1994.

30. Naber EC, Squires M. Vitamin profiles of eggs as indicators of nutritional status in the laying hen: diet to egg transfer and commercial flock survey. Poult Sci 1993;72:1046-1053.

13. NOM. Norma Oficial Mexicana 062-ZOO. Especificaciones técnicas para la producción, cuidado y uso de los animales de laboratorio.

373


Rev Mex Cienc Pecu 2017;8(4):375-385

http://dx.doi.org/10.22319/rmcp.v8i4.4644

Kisspeptina en becerras prepúberes: I. Influencia de la edad en la respuesta de LH, FSH y GH a kisspeptina-10 y su asociación con IGF-I, leptina y estradiol Kisspeptin in prepubertal heifers. I Effects of age on the response of LH, FSH and GH to kisspeptin-10 and its association with IGF-I, leptin and estradiol Mónica Alamilla Rodrígueza, René Carlos Calderón Roblesb, Jorge Víctor Rosete Fernándezb, Karla Rodríguez Hernándezc, Héctor Raymundo Vera Ávilad, Jesús Alejandro Arreguín Arévaloe, Terry M. Nette, Carlos Guillermo Gutiérrez Aguilarf, Everardo González Padillaf, Margarita Gómez-Chavaríng, Alejandro Villa Godoya* RESUMEN El objetivo fue evaluar la respuesta de LH, FSH y GH a kisspeptina-10 (KISS) en becerras prepúberes de distintas edades, y su asociación con IGF-I, E2 y leptina circulantes. A 21 becerras de 4, 7 y 11 meses de edad se les aplicó una inyección i.v. de 5 µg de KISS/kg de peso. En suero obtenido de la yugular (cada 15 min, 4 h pre hasta 4 h post-KISS) se cuantificó LH, FSH y GH. En nueve muestras (tres pre y seis post-KISS) se determinó IGF-I, leptina y estradiol (E2). En todas las becerras aumentó la LH post-KISS, con un valor máximo (6.1±1.3a, 7.2±1.3a, 11.6+1.3b ng/ml) y duración de respuesta (64.3±20a, 92±20b, 132.9+20c min) que aumentó (P<0.05) con la edad. Para FSH, 71.4, 100 y 100 % de las becerras de 4, 7 y 11 meses respondieron a KISS-10; situación que para GH fue 71.4, 85.7 y 100 %, respectivamente. La magnitud de la respuesta de FSH y GH a KISS fue similar entre edades. Las becerras de 11 meses tuvieron las máximas concentraciones de IGF-I y E2 y las menores de leptina. Se concluye que KISS-10 evoca un aumento de LH en becerras de 4 a 11 meses, cuya magnitud de respuesta se asocia con la edad, con el incremento en sangre periférica de IGF-I y E2 y con la disminución de leptina sérica; en contraste, la respuesta de GH y FSH a KISS-10 no es afectada por la edad ni por las variaciones en IGF-I, E2 y leptina. PALABRAS CLAVE: Kisspeptina, Becerras prepúberes, LH, FSH, GH.

ABSTRACT To evaluate effects of age on the response of LH, FSH and GH to kisspeptin-10 (KISS) in prepubertal heifers and its association with circulating levels of IGF-I, estradiol (E2) and leptin, 21 heifer calves that were 4, 7 or 11 mo old, received an iv injection of KISS (5 μg/kg). LH, FSH and GH were quantified in blood serum taken every 15 min (4 h pre- and 4 h post-KISS-10). In three preand six post-KISS samples, IGF-I, leptin and E2 were determined. All heifers responded to KISS with an LH increment but the response magnitude differed among groups since maximum value was higher (P<0.05) in 11 mo (11.6+1.3 ng/ml) than in 7 mo (7.2±1.3 ng/ml) and 4 mo (6.1±1.3 ng/ml) old calves. Duration of response differed (P<0.05) among ages (11 mo=132.9+20 mina; 7 mo=92±20 mina,b; 4 mo=64.3±20 minb). For FSH, all and 11 mo calves responded to KISS but only 71.4 % of 4 mo did. In GH, 71.4 % of 4 mo and 85.7 % of 7 mo calves responded to KISS whereas 100 % of 11 mo animals responded. FSH and GH did not differ among age groups. The 11 mo heifers had the highest IGF-I and E2 but the lowest leptin levels. In conclusion, KISS evokes LH increments in all calves 4 to 11 mo old, but the response increases with age in association with high circulating IGF-I and E2 and low leptin. The response of FSH and GH to KISS is not influenced by age or variations in circulating IGF-I, E2 or leptin. KEY WORDS: Kisspeptin, Prepubertal heifers, LH, FSH, GH.

Recibido el 16 de febrero de 2016. Aceptado el 21 de junio de 2016. a

Departamento de Fisiología y Farmacología, Facultad de Medicina Veterinaria y Zootecnia (FMVZ), Universidad Nacional Autónoma de México (UNAM). Circuito Exterior S/N, Edificio 2, Cubículo 2314, Tel. 52 55 56 22 59 80. Ciudad Universitaria, 04510, Coyoacán, Ciudad de México, México. b Sitio Experimental Las Margaritas, INIFAP, Hueytamalco, Puebla, México. c Campo Experimental La Laguna, INIFAP, Matamoros, Coahuila, México. d CENID Fisiología y Mejoramiento Animal, INIFAP. Querétaro, México. e Animal Reproduction and Biotechnology Laboratory, Colorado State University, Fort Collins, CO, USA. f Departamento de Reproducción, FMVZ, UNAM. Coyoacán, Ciudad de México, México. g Instituto de Investigaciones Biomédicas, UNAM, Ciudad de México, México. *Autor de correspondencia: aavillagodoy@gmail.com

375


Mónica Alamilla Rodríguez, et al. / Rev Mex Cienc Pecu 2017;8(4):375-385

INTRODUCCIÓN

gonadotropinas, en respuesta a una aplicación de KISS-10. En ratas prepúberes(14), la inyección del péptido provoca un aumento en la LH sérica que varía con la edad. En becerras de siete meses de edad, una aplicación de KISS-10 (5 µg/kg) evoca un aumento en la LH y hormona del crecimiento (GH) circulantes(15). En contraste, en becerras de cinco meses(16) de edad la misma dosis de KISS-10 no altera la liberación de GH pero induce la liberación de LH y de FSH, esta última no estudiada en las becerras de 7 meses(15); por tanto se desconoce si la KISS puede o no estimular la liberación de LH en becerras prepúberes mayores de 7 o menores de 5 meses de edad. Asimismo, se ignora si la liberación de FSH y GH posterior a la administración de KISS puede ser diferente en becerras prepúberes de edad variable dentro de este rango, de menor o de mayor edad. La edad a la pubertad está estrechamente asociada con el peso(17,18) y la composición corporal(19); sin embargo, las concentraciones sanguíneas de metabolitos y hormonas relacionados con estas variables presentan interacciones complejas(17,19,20), por lo que las señales de origen metabólico que conducen hacia el inicio de la pubertad no se conocen con exactitud. El factor de crecimiento similar a la insulina-I (IGF-I)(19,20) y la leptina(21) aumentan en sangre periférica antes de la pubertad, pero su perfil de liberación con relación al inicio de la misma difiere(22,23). El IGF-I circulante(19) aumenta antes que la leptina(23) durante las etapas de crecimiento acelerado de los animales y la deposición de grasa en el tejido adiposo(19,21,22) que anteceden el inicio de la pubertad. Tanto el IGF-I(23) como la leptina(24), señalizan el estado nutricional y el grado de madurez de los individuos y ejercen varias funciones en la actividad reproductiva. Los ovarios también participan en el proceso de la pubertad, ya que se observa un incremento prepuberal simultaneo en la frecuencia de pulsos de LH, el diámetro del folículo ovárico dominante y las concentraciones circulantes de E2(25,26). Por lo anterior, el tema central del presente trabajo fue evaluar el efecto de la edad en becerras prepúberes sobre el patrón de liberación de LH, FSH y GH en respuesta a la KISS-10 exógena. La hipótesis de trabajo fue que una aplicación intravenosa de KISS10 a becerras prepúberes induce un aumento de LH, FSH y GH cuyas características varían con la edad de

En las hembras bovinas, la presentación temprana de la pubertad tiene especial importancia en la fertilidad(1,2) y productividad de por vida(3). En los sistemas de producción de carne y leche de bovino en el trópico, las vaquillas presentan la pubertad tardíamente y por ello tienen su primer parto entre los tres y cuatro años de edad(4), cuando el ideal zootécnico desde el punto de vista de productividad es de aproximadamente dos años(5). La tardía edad y bajo peso al primer parto de las vaquillas de trópico, determinan una baja producción de becerros y de leche durante su vida(6). Consecuentemente es importante conocer los mecanismos fisiológicos reguladores de la pubertad y los factores que los afectan, lo cual potencialmente conducirá al desarrollo de nuevas estrategias de manejo para reducir la edad a la pubertad de las vaquillas, mejorar la eficiencia reproductiva y la rentabilidad de las unidades de producción ganadera. Se ha establecido(7) que la pubertad es precedida por un incremento progresivo en la secreción pulsátil de la hormona liberadora de las gonadotropinas (GnRH), siendo este cambio el componente clave de control para iniciar la pubertad(8). Varios grupos de investigadores señalan a la kisspeptina como el elemento estimulador preponderante que gobierna la actividad de las neuronas productoras de GnRH(9). A su vez, la kisspeptina es el principal intermediario entre las sustancias señalizadoras de origen somático y ambiental que modulan la función reproductiva y las neuronas productoras de GnRH, determinando tanto la liberación tónica como la secreción fásica de las gonadotropinas hipofisiarias(10). La kisspeptina (KISS) o kisspeptinas es una familia de péptidos que, según el número de aminoácidos, son denominados como: KISS-54, -14, -13 y -10(11). Algunos autores(11,12) consideran a las neuronas productoras de KISS como integradoras de señales que actúan modulando el tono de operación de los ejes somatotrópico y gonadal. En ratas(12) y cerdas prepúberes(13), la concentración sérica de la hormona luteinizante (LH) y hormona folículo estimulante (FSH) aumentan de seis a ocho veces, simulando una oleada preovulatoria de dichas

376


KISSPEPTINA EN BECERRAS PREPÚBERES. I INFLUENCIA DE LA EDAD

los animales y sus concentraciones circulantes de E2, IGF-I y leptina.

condición anovulatoria de las becerras (progesterona sérica <1 ng/ml). El día de la administración de KISS-10, a través de la cánula se tomaron muestras de sangre cada 15 min durante 8 h, cuatro previas y cuatro posteriores a la aplicación de KISS-10. En el suero de las muestras obtenidas cada 15 min se determinaron las concentraciones de LH, FSH y GH, y en el suero obtenido de muestras de sangre tomadas antes (muestras 1, 2 y 3) y después de la aplicación de KISS-10 (muestras 18 a 20 y 26 a 28), se cuantificaron E2, leptina e IGF-I.

MATERIAL Y MÉTODOS

Animales y manejo general Los procedimientos aplicados fueron aprobados por el Subcomité Institucional para el Cuidado de Animales en Experimentación (Programa de Posgrado, Facultad de Medicina Veterinaria y Zootecnia, UNAM). Se utilizaron 21 becerras de raza Holstein y Suizo Pardo, las cuales se alojaron individualmente en corrales de 2.5 x 4.5 m, con piso de cemento, área techada (2.5 x 2.7 m), comederos y bebederos. Para la adaptación al manejo, las becerras se introdujeron a los corrales un mes antes del experimento. La alimentación consistió en forraje picado a libertad (heno de avena; 95 % MS, 6.5 % PC y 2.42 Mcal de EM/kg), 4 kg de concentrado proteínico (93.8 % MS, 16.53 % PC y 2.43 Mcal de EM/kg) y sales minerales y agua a libertad. Los animales se asignaron de acuerdo con su edad a tres grupos homogéneos desde el punto de vista de la raza: 4 meses (4.8 ± 0.15 meses; media+ee); 7 meses (7.5 ± 0.15 meses) y 11 meses (11.4 ± 0.15 meses). Un día antes del experimento, el peso corporal promedio de los animales en los grupos de 4, 7 y 11 meses de edad fue 106.3 ± 6.7, 114.3 ± 6.7 y 139.4 ± 6.7 kg respectivamente; mientras que la condición corporal fue, en el mismo orden de 2.2 ± 0.2, 2.3 ± 0.20 y 2.3 ± 0.20, en una escala del 1 al 5(27).

Análisis de laboratorio La progesterona se determinó mediante estuches de radioinmunoanálisis (RIA; Coat a Count, Diagnostic Product Corporation, DPC, Los Ángeles, CA, EUA); la sensibilidad fue de 0.02 ng/ml, con un coeficiente de variación (CV) intraensayo de 6.15 %. La leptina se cuantificó mediante estuches multiespecies (RIA, Linco Research Inc. Sigma, St. Louis, MO, EUA); en dos ensayos, la sensibilidad fue de 1.0 ng/ml y el CV interensayo e intraensayo fue de 6.93 % y 2.63 % respectivamente. El IGF-I se determinó mediante estuches comerciales (ELISA, Alpco Immunoassays, Salem, NH, EUA); en dos ensayos la sensibilidad fue de 0.9 ng/ml, mientras que el CV intraensayo fue de 3.66 % e interensayo de 3.79 %. Las concentraciones de E2 se determinaron mediante RIA con un antisuero altamente específico para E2-17β, marcado con 125I, previamente descrito(28); su sensibilidad fue de 0.21 pg/ml y el CV intraensayo de 9.18 %. LH, FSH y GH se cuantificaron por RIA; los procedimientos fueron validados y descritos anteriormente(29,30,31). En tres ensayos de LH, el límite mínimo y máximo fue de 0.27 ng/ml y 57.91 ng/ml; los valores medios de los controles bajo, medio y alto fueron respectivamente de 2.3, 14.55 y 33.88 ng/ml; mientras que los correspondientes CV fueron: intraensayo de 5.31, 1.07 y 8.10 %, e interensayo de 9.64, 6.56 y 8.70 %. En el caso de FSH la sensibilidad fue de 0.0479 ng/ml, el CV intraensayo fue de 6.34 % y el CV interensayo de 10.12 %. En dos ensayos de GH el límite mínimo y máximo fue de 1.6 y 87.42 ng/ml respectivamente, mientras que los valores medios de los controles bajo y alto fueron respectivamente de 2.22 y 4.63 ng/ml; por su parte, los CV intraensayo fueron en el primer ensayo de 4.56 y 5.21 %,

El día del experimento, a cada becerra se le aplicó un bolo i.v. de 5 µg de KISS-10 (3.75 nmol) por kilo de peso corporal. En el presente estudio se usó KISS-10 bovina (YNWNSFGLRY-NH2; Proimmune, Oxford, UK) diluida en solución salina fisiológica (1:125) y administrada i.v. a través de un catéter insertado en una de las venas yugulares. Antes de cateterizar, la zona peri-yugular fue rasurada y se aplicó analgesia en un área de 5x5 cm (lidocaína al 2%, 2 mg/cm2). El catéter fue utilizado para el muestreo sanguíneo que se describe posteriormente.

Muestras y mediciones Durante el mes previo a la aplicación de KISS10, se tomaron muestras de sangre cada tercer día por punción de la vena coccígea para comprobar la

377


Mónica Alamilla Rodríguez, et al. / Rev Mex Cienc Pecu 2017;8(4):375-385

interacciones y el error experimental. La proporción de animales que mostró respuesta de LH, FSH y GH a KISS-10 se analizó mediante pruebas de tablas de contingencias (χ2). Para los datos relacionados con la concentración media de IGF-I, leptina y E2, así como para VMAX y DUR del incremento de LH, FSH y GH, se utilizó un ANDEVA de una vía para modelos de efectos fijos(32), en el cual se incluyó únicamente el efecto de edad de las becerras. La separación de medias se realizó por el procedimiento de medias de cuadrados mínimos (LSMEANS). Además, mediante el procedimiento CORR(32) se examinaron las correlaciones del VMAX de LH, FSH y GH determinados en los animales que respondieron a KISS-10, entre ellas y con el valor medio de las concentraciones de IGF-I, E2 y leptina, así como con la edad, peso corporal y CC de las becerras. También se determinó la correlación de IGF-I, E2 y leptina, entre ellas y con las variables de tipo zoométrico.

mientras que en el segundo fueron de 3.67 y 4.38 %. Los CV interensayo fueron 10.31 y 9.45 %.

Variables de respuesta Para cada animal, se consideró como respuesta de LH, FSH y GH inducida por la administración de KISS-10, cuando al menos en dos muestras consecutivas la concentración hormonal posterior a KISS-10 fue mayor al promedio más dos desviaciones estándar (DE) de la concentración basal de la hormona, y que posteriormente, en al menos una muestra, la concentración de la hormona descendiera a valores similares a la media de la concentración basal más dos DE. La concentración basal para cada animal, fue la media de los tres valores hormonales más bajos del periodo de muestreo previo a la aplicación de KISS-10. Con relación al incremento de LH, FSH y GH inducido por KISS-10 se generaron dos variables: Duración de la respuesta (DUR) y valor máximo (VMAX). La DUR fue el periodo comprendido entre la primera muestra que excedió al promedio más dos DE de la concentración basal, y la primera muestra cuya concentración descendió a un valor menor o igual a la concentración basal. VMAX fue la concentración máxima de cada hormona durante el período posterior a la aplicación de KISS-10, dentro del segmento considerado como respuesta. Con respecto a IGF-I, leptina y E2, la variable de respuesta de cada una de ellas fue la media de la concentración obtenida en las nueve muestras analizadas.

RESULTADOS Los niveles séricos de progesterona en todas las muestras colectadas durante el mes de adaptación fueron <1 ng/ml, indicando la condición prepuberal Figura 1. Respuesta de LH (media ± ee) en becerras de 4 (rombo blanco), 7 (círculo gris) y 11 (cuadro negro) meses de edad, a una aplicación intravenosa de KISS-10 (flecha; 5 µg/kg)

Diseño y análisis estadísticos El diseño base fue un completamente al azar para modelos unifactoriales de efectos fijos (edad de las becerras). Para ello, de un total de 67 becerras bloqueadas por edad, se tomaron al azar siete de cada grupo (4, 7 y 11 meses), mismas que constituyeron la muestra experimental. Para el análisis del perfil de los datos provenientes de las muestras sanguíneas colectadas a intervalos de 15 min (LH, FSH y GH), se utilizó un ANDEVA para diseños de medidas repetidas en tiempo(32); en este caso, el modelo estadístico incluyó los efectos de edad, muestra, periodo (pre y post KISS-10), sus

a,b,c

378

Distintas literales indican diferencia entre medias (P<0.01).


KISSPEPTINA EN BECERRAS PREPÚBERES. I INFLUENCIA DE LA EDAD

Cuadro 1. Valor máximo y duración de la respuesta de LH, FSH y GH (media ± ee) y proporción de becerras que respondieron a kisspeptina-10 Hormona / Variable de

Edad de las becerras (meses)

Respuesta

4

7

11

LH Animales con respuesta, % Valor máximo, ng/ml Duración, min FSH Animales con respuesta, % Valor máximo, ng/ml Duración, min GH Animales con respuesta, % Valor máximo, ng/ml Duración, min

100 (7/7)* 6.10 ± 1.3

a

100 (7/7) 7.23 ± 1.3

100 (7/7) b

11.62 ± 1.3b

64.29 ± 20.05c

92.14 ± 20.05cd

132.86 ± 20.05d

71.4 (5/7) 1.5 ± 0.3

100 (7/7) 1.2 ± 0.3

100 (7/7) 2.0 ± 0.3

81.0 ± 23.4

85.7 ± 19.8

147.9 ± 19.8

71.4 (5/7) 28.6 ± 7.7 105.0 ± 29.7

85.7 (6/7) 36.7 ± 7.0 87.5 ± 27.1

100 (7/7) 36.83 ± 6.5 143.6 ± 25.1

*En paréntesis (animales que respondieron/animales expuestos). Distintas literales dentro de variable de respuesta indican diferencias entre grupos de edad ( a,b P<0.01; c, d P<0.05).

de todas las becerras del experimento. Así mismo, durante el periodo previo a la aplicación de KISS-10 las concentraciones séricas de las hormonas

estudiadas no difirieron entre los grupos de becerras de 4, 7 y 11 meses de edad (P>0.05). Todas las becerras respondieron a KISS-10 con un incremento de LH. Las concentraciones séricas promedio de LH (Figura 1) aumentaron (P<0.01) por efecto del tratamiento de KISS-10, independientemente de la edad de las becerras. Sin embargo, VMAX de LH fue mayor (P<0.01) en las becerras de 11 meses de edad (Figura 1; Cuadro 1); por su parte, la DUR de LH solo fue mayor (P<0.05) en los animales de 11 meses con respecto a los de 4 meses.

Figura 2. Respuesta de FSH (media ± ee) en becerras de 4 (rombo blanco), 7 (círculo gris) y 11 (cuadro negro) meses de edad a una inyección intravenosa de KISS-10 (flecha; 5 µg/kg)

Con relación a FSH, 71.4, 100 y 100 % de las becerras de 4, 7 y 11 meses respectivamente, respondieron a KISS-10; situación que para GH fue 71.4, 85.7 y 100 %, respectivamente (Cuadro 1). No hubieron diferencias (P>0.05) adjudicables a la edad de los animales en ninguna de las características de la respuesta de FSH (Figura 2; Cuadro 1) y GH (Cuadro 1) a KISS-10. El patrón de FSH post KISS10 fue similar al de LH, en el sentido de que en los animales donde se registró respuesta, ésta se inició dentro de la primera hora, y finalizó durante el transcurso de la segunda o tercer hora posterior a la aplicación del péptido. En cuanto a la respuesta de GH a KISS-10 (Figura 3), no se observó un patrón

(P>0.05).

379


Mónica Alamilla Rodríguez, et al. / Rev Mex Cienc Pecu 2017;8(4):375-385

Figura 3. Perfil de GH en becerras representativas de cuatro tipos de respuesta a una aplicación intravenosa de KISS-10 (flecha). A: respuesta durante la mayor parte del periodo posterior a KISS-10. B: respuesta tardía, registrada durante las últimas horas (2 a 4) del periodo post KISS-10. C: respuesta temprana, durante las primeras 2 horas post KISS-10. D: sin respuesta

* Difiere de la media de las muestras colectadas antes de la aplicación de KISS-10 (P<0.05).

Figura 4. Concentraciones de estradiol, IGF-I y leptina en

definido de liberación como en el caso de las gonadotropinas. Al respecto, se observó que algunas becerras no respondieron (14.3 %), otras mostraron un incremento de GH durante todo el periodo de muestreo posterior a KISS-10 (9.5 %), unas más respondieron durante las primeras dos horas (23.8 %), mientras que otras becerras mostraron la respuesta durante las últimas dos horas de muestreo post KISS-10 (52.4 %).

suero (media + ee) de becerras prepúberes de diferentes edades. Para cada hormona, distintas literales indican diferencia entre medias (a, b P<0.05

Las concentraciones séricas de IGF-I (Figura 4) fueron mayores (P<0.05) en las becerras de 11 meses; en cambio, los niveles de E2 fueron mayores (P<0.05) únicamente en las becerras de 11 con respecto a las de 4, pero no difirieron de las de 7 meses. Por su parte, los niveles séricos de leptina fueron menores en las becerras de 11 meses. Dentro de cada grupo de edad, las muestras de suero previas a KISS-10 no difirieron (P>0.05) de las colectadas después de la aplicación del péptido en cuanto a IGF-I, leptina y E2 se refiere. Los coeficientes de correlación (Cuadro 2) indicaron una asociación entre la edad y el peso (P<0.05), sin embargo la CC presentó una correlación positiva únicamente con el peso de las becerras (P<0.01) mas no con la edad. La VMAX de LH estuvo

380


KISSPEPTINA EN BECERRAS PREPÚBERES. I INFLUENCIA DE LA EDAD

Cuadro 2. Coeficientes de correlación entre los valores máximos de LH, FSH y GH registrados durante el periodo de respuesta a KISS-10, la edad de las becerras, las variables zoométricas y las concentraciones séricas de IGF-I, leptina y estradiol Variable Edad Peso

Edad

Peso

Condición corporal

LH

FSH

GH

IGF-I

Leptina

Estradiol

1

0.454*

0.066

0.447*

0.236

0.105

0.006

-0.148

0.389*

1

0.707**

0.521*

0.131

0.137

0.614**

-0.327

0.655**

1

0.147

-0.047

0.455*

0.556**

-0.014

0.307

1

0.667**

0.211

-0.085

-0.116

0.399*

1

0.091

0.411*

-0.095

-0.185

1

-0.001

0.322

-0.002

1

-0.323

0.533*

1

-0.238

Condición corporal LH FSH GH IGF-I Leptina Estradiol

1

* (P<0.05); ** (P<0.01).

correlacionada significativamente (P<0.05) con edad, peso, E2 y con VMAX de FSH (P<0.01). Por su parte, VMAX de FSH no se correlacionó (P>0.05) con ninguna de las variables analizadas, con excepción de la citada VMX de LH y con IGF-I (P<0.05), mientras que VMAX de GH solamente lo hizo con CC (P<0.05). Leptina no estuvo asociada (P>0.05) con ninguna de la variables examinadas. Por el contrario, IGF-I mostró una correlación con peso, CC (P<0.01) y VMAX de FSH (P<0.05), mientras que E2 se asoció con peso (P<0.01), edad, CC, VMAX de LH e IGF-I (P<0.05).

aumento en la secreción de GnRH, observación que permite sugerir que el mecanismo mediante el cual las becerras de 11 meses son más sensibles a KISS que animales más jóvenes, podría deberse a un aumento en la expresión de los receptores de GnRH en los gonadotropos conforme se aproximan a la pubertad. Independientemente del mecanismo que determina el nivel de respuesta de LH a KISS-10, la información aquí producida indica que existen agentes señalizadores que cambian con la edad, modulando la respuesta a KISS-10; algunos de ellos podrían ser E2 e IGF-I, cuyas concentraciones circulantes fueron mayores en las becerras que mostraron la máxima respuesta de LH. Entre las evidencias que soportan la posible intervención de E2 se puede mencionar un trabajo realizado in vivo(35) en el que vacas ovariectomizadas, inyectadas con KISS-10 y E2, aumentaron las concentraciones plasmáticas de LH, en comparación con vacas en similar condición ovárica e inyectadas únicamente con el péptido. Otras evidencias a favor de esta idea fueron generadas en hembras de roedores y ovinos(36,37), las cuales muestran que la acción de E2, es a través de sus receptores ERα presentes en las neuronas productoras de KISS encargadas de regular la liberación fásica de GnRH y consecuentemente de LH, lo que concuerda con los

DISCUSIÓN El 100 % de las becerras respondió a la administración de KISS-10 con un incremento de LH, observación que no es posible comparar con datos derivados de investigaciones previas, ya que en los estudios efectuados en hembras prepúberes de ratas(33), cerdas(13) y becerras(15,16), no se indica la proporción de animales que respondió a KISS-10. En este trabajo, la magnitud de la respuesta de LH a KISS-10 difirió con la edad, lo que concuerda con datos generados en ratas(34), ya que también en ellas la KISS induce una mayor liberación de LH cuando los animales están cercanos a la pubertad, sin un

381


Mónica Alamilla Rodríguez, et al. / Rev Mex Cienc Pecu 2017;8(4):375-385

datos presentados en este trabajo, que indican que la KISS-10 estimuló un incremento fásico de LH sin alterar su frecuencia de pulsos. Un mecanismo adicional del E2 podría ser a nivel de los gonadotropos, ya que en hembras adultas de ovinos, ratas y papiones, así como en becerros lactantes(9), dichas células aumentan la liberación de LH en respuesta a KISS-10, al adicionar E2 al medio de cultivo. Lo anteriormente discutido permite sugerir la existencia de un mecanismo de interacción positiva entre E2 y KISS a tres niveles: en las neuronas productoras de KISS, en las neuronas productoras de GnRH y en los gonadotropos.

tanto en ratas(44) como en niñas(45) y becerras(46). No obstante, concordando con nuestra observación, en un trabajo(47) se determinó que la leptina exógena no acelera la pubertad en becerras ni incrementa la secreción de LH espontánea o estimulada por GnRH exógena. En ése(47) y en otros estudios efectuados en bovinos y ovinos(48,49,50), se propuso que la respuesta del eje gonadotrópico a leptina depende del estado metabólico de los animales, de su balance de energía o de la calidad y cantidad de alimentos que consumen. El presente trabajo se suma a aquéllos que ponen en duda la intervención de la leptina como modulador de los efectos de KISS en la pubertad. De hecho, en un estudio reciente, se informó que las becerras que presentaron una oleada preovulatoria de LH y la formación de un cuerpo lúteo en respuesta a KiSS-10 fueron las que presentaron las menores concentraciones de leptina(39).

En cuanto a la posibilidad de que IGF-I funja como indicador de un ambiente metabólico favorable para el inicio de la pubertad en becerras, se ha documentado que en dichos animales aumenta el IGF-I circulante unos días antes o al momento de la primera ovulación(17,19), mientras que en ratonas la administración de IGF-I adelanta la pubertad(38). De manera similar a la propuesta para E2, la acción del IGF-I podría ser la de potenciar el efecto de la KISS-10 en la secreción fásica de LH, mas no en la secreción tónica, ya que existen evidencias de ello en primates no humanos(38), en roedores(12) y en becerras prepúberes(39). El IGF-I podría actuar en al menos dos niveles: directamente en las neuronas productoras de GnRH(40) y en los gonadotropos(41). Los hallazgos de que el IGF-I circulante atraviesa la barrera hematoencefálica en ratas y que se acumula en el núcleo anteroventralperiventricular y la eminencia media(42), le da significancia fisiológica a la acción del IGF-I en hipotálamo y adenohipófisis para modular la secreción fásica de LH inducida por KISS-10. Finalmente la mayor respuesta de LH a KISS-10 en becerras de 11 meses, pudo ser el resultado de una acción conjunta de IGF-I y E2, como fue demostrado en ratas prepúberes(43).

No se registraron efectos de edad en la respuesta de FSH a KISS-10, quizá porque el patrón de liberación de esta hormona depende además de la GnRH, de la actividad de otros factores tales como la activina(51,52), la inhibina y la folistatina(52,53). Los datos aquí presentados permiten sugerir que el nivel de regulación de los factores antes citados sobre la pulsatilidad de FSH no varía entre los 4 y los 11 meses de edad, por lo que el efecto de KISS-10 en la secreción de FSH es similar en becerras prepúberes que se encuentran dentro de dicho rango. Lo anterior es apoyado por trabajos de análisis longitudinal en niñas, en las que se determinó la ausencia de variaciones consistentes o significativas en concentraciones séricas de inhibina, activina y folistatina(54). Con respecto a la respuesta de GH a KISS-10, no se detectaron diferencias atribuibles a la edad. Al respecto, se ha documentado en niñas que las variaciones en cuanto a la tasa de crecimiento e inicio de la pubertad, se deben en parte a los efectos individuales de los estrógenos, la GH, el IGF-I y otros efectores no evaluados en el presente estudio, tales como el cortisol y las hormonas tiroideas(55); así mismo se ha propuesto que además de las interacciones de IGFI y E2, existe una acción permisiva(56) de la leptina para que la influencia de las demás hormonas involucradas en el inicio de la pubertad, ejerzan sus

Los datos aquí generados respecto a que los menores niveles de leptina se observaron en las becerras con la mayor respuesta de LH, así como la ausencia de correlación de leptina con las variables zoométricas y hormonales examinadas, resultaron sorprendentes en vista de reportes previos relacionados con los incrementos en leptina circulante observados al aproximarse la pubertad,

382


KISSPEPTINA EN BECERRAS PREPÚBERES. I INFLUENCIA DE LA EDAD

AGRADECIMIENTOS

acciones tanto independientes como conjuntas. También se ha observado que los niveles séricos de GH, IGF-I e insulina varían entre individuos prepúberes por influencia de su genética, de la dieta que reciben y su estado nutricional(55,56). Con relación a la respuesta de GH a KISS-10 en animales prepúberes, en la literatura únicamente se encontraron tres trabajos: dos en becerras y uno en cerdas; en estas últimas, la KISS-10 no indujo un aumento de las concentraciones séricas de GH(13); en cuanto a las becerras, los resultados son contrastantes, ya que mientras unos autores(15) demostraron una marcada respuesta de GH a las KISS-10, otros(16) no la detectaron; por lo tanto los resultados aquí obtenidos se suman a los reportados en becerras que respondieron a KISS-10, sin aportar elemento alguno que aclare por qué algunos animales responden y otros no. Como fue el caso de LH y FSH, aparentemente este es el primer trabajo donde se registra la proporción de hembras prepúberes que responden a KISS-10 con una respuesta de GH.

Nuestro agradecimiento a la Dirección General de Asuntos del Personal Académico, UNAM, por los apoyos otorgados a través de los proyectos PAPIITIN205510 “Participación de la KISS en la pubertad en vaquillas” y PAPIIT-IN218814 “Estudio de los núcleos hipotalámicos kisspeptidérgicos durante el inicio de la pubertad en hembras bovinas”. Así mismo a la Dra. Clara Murcia Mejía por la realización de los radioinmunoanálisis, al Dr. José Gerardo Perera Marín por su asesoría en el laboratorio y la iodación de LH y FSH; a la Dra. Susana Rojas Maya por los ensayos de ELISA. El trabajo de campo fue arduo y expresamos nuestra gratitud al personal del SE Las Margaritas.

LITERATURA CITADA

CONCLUSIONES E IMPLICACIONES La primera conclusión es que una aplicación i.v. de KISS-10 en la dosis empleada es suficiente para evocar un aumento significativo de LH en todas las becerras de 4 a 11 meses de edad; sin embargo, la magnitud de la respuesta de LH parece depender de otros agentes señalizadores que varían con la edad de las hembras bovinas prepúberes. Debido a que se registró una mayor concentración sérica de IGF-I y E2 en las becerras con mayor respuesta de LH, también se concluye que dichos elementos pueden ser algunos de los efectores implicados en la magnitud de respuesta de LH a la KISS-10. Otra conclusión es que ni la edad ni la variación en las concentraciones séricas de IGF-I, E2 y leptina están asociadas con la magnitud de respuesta de GH y FSH a KISS-10. Una implicación de los resultados del presente estudio, es que el uso potencial de KISS ya sea con fines terapéuticos o de manejo para resolver problemas asociados con anovulación o pubertad tardía en becerras, puede ser acompañando el tratamiento de KISS-10 con IGF-I, E2 o ambos, para incrementar la respuesta del eje gonadotrópico.

1.

Byerley DJ, Staigmiller RB, Berardinelli JG, Short RE. Pregnancy rates of beef heifers bred either on pubertal or third estrus. J Anim Sci 1997;65:645-650.

2.

Lin CY, McAllister AJ, Batra TR, Lee AJ, Roy GL, Vesely JA, et al. Effects of early and late breeding of heifers on multiple lactation performance of dairy cows. J Dairy Sci 1988;71:2735-2743.

3.

Perry GA. Harnessing basic knowledge of factors controlling puberty to improve synchronization of estrus and fertility of heifers. J Anim Sci 2012;90:1172-1182.

4.

Mukasa-Mugerwa E. A review of reproductive performance of female Bos indicus (Zebu) cattle. FAO-ILCA Monograph No. 6, Chapter 4 Measures of reproductive performance 1989. http://www.fao.org/Wairdocs/ILRI/x5442E/x5442e06.htm#4.1%2 0age%20at%20first%20calving. Consultado 17 Mar, 2016.

5.

Hoffman PC. Optimum body size of Holstein replacement heifers. J Anim Sci 1997;75:836-845.

6.

Deresz F, Jaume CM, de Carvalho MR, González CA. The effect of body weight at calving on milk production and reproductive performance of FriesianxZebu heifers. Animal Production 1987;45:325-333.

7.

Terasawa EI, Fernandez DL. Neurobiological mechanisms of the onset of puberty in primates. Endocrine Rev 2001;22:111-151.

8.

Ebling FJP. The neuroendocrine timing of puberty. Reproduction 2005;129:675-683.

9.

Abbara A, Radnasabapathy R, Jayasena CN, Dhillo W. The effects of kisspeptin on gonadotropin release in non-human mammals. Chapter 4. In: Kauffman AS, Smith JT. Kisspeptine signaling in reproductive biology. New York, Heidelberg, Dordrecht, London: Springer; 2013:429-434.

10. Smith JT. The role of kisspeptine and gonadotrophin inhibitory hormone in the seasonal regulation of reproduction in sheep. Domest Anim Endocrinol 2012;43:75-84. 11. Mead E, Maguire JJ, Kuc RE, Davenport AP. Kisspeptins: a multifunctional peptide system with a role in reproduction, cancer

383


Mónica Alamilla Rodríguez, et al. / Rev Mex Cienc Pecu 2017;8(4):375-385

and the cardiovascular system. British J Pharmacol 2007;151:11431153.

26. Gasser CL, Grum DE, Mussard ML, Fluharty FL, Kinder JE, Day ML. Induction of precocious pubertyin heifers I: Enhanced secretion of luteinizing hormone. J Anim Sci 2006;84:2035–2041.

12. Navarro VM, Tena-Sempere M. Neuroendocrine control by kisspeptins: role in metabolic regulation of fertility. Nat Rev Endocrinol 2012;8:40-53.

27. Edmonson AJ, Lean IJ, Weaver LD, Farver T, Webster G. A body condition scoring chart for Holstein dairy cows. J Dairy Sci 1989;72:68-78.

13. Lents CA, Heidorn NL, Barb CR, Ford JJ. Central and peripheral administration of kisspeptin activates gonadotropin but not somatotropin secretion in prepubertal gilts. Reproduction 2008;135:879-887.

28. England BG, Niswender GD, Midgley AR. Radioimmunoassay of estradiol-17β without chromatography. J Clin Endocrinol Metab 1974;38(1):42-50.

14. Castellano JM, Navarro VM, Fernández-Fernández R, Castaño JP, Malagón MM, Aguilar E, et al. Ontogeny and mechanisms of action for the stimulatory effect of kisspeptin on gonadotropin-releasing hormone system of the rat. Mol Cell Endo 2006;257:75–83.

29. Nett TM, Akbar AM, Phemister RD, Holst PA, Reichert JR, Niswender GD. Levels of luteinizing hormone, estradiol and progesterone in serum during the estrous cycle and pregnancy in the Beagle bitch. Proc Soc Exp Biol Med 1975;148:134-139.

15. Kadokawa H, Matsui M, Hayashi K, Matsunaga N, Kawashima C, Shimizu T, et al. Peripheral administration of kisspeptin-10 increases plasma concentrations of GH as well as LH in prepubertal Holstein heifers. J Endocrinol 2008;196:331-334.

30. L’Hermite M, Niswender GD, Reichert Jr, LE, Midgley Jr, AR. Serum follicle-stimulating hormone in sheep as measured by radioimmunoassay. Biol Reprod 1972;6:325-332. 31. Powell M, Keisler DH. A potential strategy for decreasing milk production in the ewe at weaning using a growth hormone release blocker. J Anim Sci 1995;73:1901-1905.

16. Ezzat AA, Saito H, Sawada T, Yaegashi T, Yamashita T, Hirata TI, et al. Characteristics of the stimulatory effect of Kisspeptin-10 on the secretion of luteinizing hormone, follicle-stimulating hormone and growth hormone in prepubertal male and female cattle. J Reprod Dev 2009;55:650-654.

32. SAS. Statistical Analysis System Institute. 2002 Inc, Cary, NC, USA. 33. Navarro VM, Castellano JM, Fernández-Fernández R, Tovar S, Roa J, Mayen A, et al. Effects of Kiss-1 peptide, the natural ligand of GPR54, on follicle-stimulating hormone secretion in the rat. Endocrinology 2005;146:1689-1697.

17. Jones EJ, Armstrong JD, Harvey RW. Changes in metabolites, metabolic hormones, and luteinizing hormone before puberty in Angus, Bradford, Charolais and Simmental heifers. J Anim Sci 1991;60:1607-1615. 18.

34. Navarro VM, Castellano JM, Fernández-Fernández R, Barreiro ML, Roa J, Sánchez-Criado JE, et al. Developmental and hormonally regulated messenger ribonucleic acid expression of KiSS-1 and its putative receptor, GPR54, in rat hypothalamus and potent luteinizing hormone-releasing activity of kiss-1 peptide. Endocrinol 2004;145:4565-4574.

Archbold H, Shalloo L, Kennedy E, Pierce KM, Buckley F. Influence of age, body weight and body condition score before mating start date on the pubertal rate of maiden Holstein–Friesian heifers and implications for subsequent cow performance and profitability. Animal 2012;6(07):1143-1151.

35. Whitlock BK, Daniel JA, Wilborn RR, Rodning SP, Maxwell HS, Steele BP, Sartin JL. Interaction of estrogen and progesterone on kisspeptin-10-stimulated luteinizing hormone and growth hormone in ovariectomized cows. Neuroendocrinology 2008;88:212-215.

19. Yelich JV, Wettemann RP, Marston TT, Spicer LJ. Luteinizing hormone, growth hormone, insulin-like growth factor-I, insulin and metabolites before puberty in heifers fed to gain at two rates. Domest Anim Endocrinol 1996;13:325-338.

36. Clarkson J, Boon WC, Simpson RE, Herbison AE. Postnatal development of an estradiol-kisspeptin positive feedback mechanism implicated in puberty onset. Endocrinol 2009;150:3214-3220.

20. Velazquez MA, Spicer LJ, Wathes DC. The role of insulin-like growth factor-I (IGF-I) in female bovine reproduction. Domest Anim Endocrinol 2008;35:325-342. 21. Garcia MR, Amstalden M, Williams SW, Stanko RL, Morrison CD, Keisler DH, et al. Serum leptin and its adipose gene expression during pubertal development, the estrous cycle, and different seasons in cattle. J Anim Sci 2002;80:2158-2167.

37. Smith JT, Rao A, Pereira A, Caraty A, Millar RP, Clarke IJ. Kisspeptin is present in ovine hypophysial portal blood but does not increase during the preovulatory luteinizing hormone surge: evidence that gonadotropes are not direct targets of kisspeptin in vivo. Endocrinol 2008;149:1951-1959.

22. León HV, Hernández-Cerón J, DH, Gutierrez, CG. Plasma concentrations of leptin, insulin-like growth factor-I, and insulin in relation to changes in body condition score in heifers. J Anim Sci 2004;82:445-451.

38. DiVall SA, Williams TR, Carver SE, Koch L, Brüning JC, Kahn CR, Wondisford F, Radovick S, Wolfe A. Divergent roles of growth factors in the GnRH regulation of puberty in mice. J Clin Invest 2010;120:2900-2909.

23. Zulu VCh, Nakao T, Sawamuka Y. Insulin-growth like factor I as a possible hormonal mediator nutritional regulation of reproduction in cattle. J Vet Med Sci 2002;64(8):657-665.

39. Santos ER, Calderón RRC, Vera ARH, Perera-Marín G, Arreguín AJA, Nett TM, et al. Hormona luteinizante y actividad ovárica en respuesta a kisspeptina-10 y su asociación con IGF-1 y leptina en becerras pre-púberes. Rev Mex Cienc Pecu 2014;5(2):181-200.

24. Zieba DA, Amstalden M, Maciel MN, Keisler DH, Raver N, Gertler A, Williams GL. Divergent effects of leptin on luteinizing hormone and insulin secretion are dose dependent. Experimental Biol Med 2003;228:325-333.

40. Hiney J.K, Srivastava V, Nyberg CL Ojeda SR, Dees WL. Insulin-like growth factor-1 (IGF-1) of peripheral origin acts centrally to accelerate the initiation of female puberty. Endocrinol 1996;137:3717-3727.

25. Gasser CL, Burke CL, Mussard ML, Behlke EJ, Grum DE, Kinder JE, Day ML. Induction of precocious puberty in heifers II: Advanced ovarian follicular development. J Anim Sci 2006;84:2042–2049.

41. Adam CL, Gadd TS, Findlay PA, Wathes DC. IGF-I stimulation of luteinizing hormone secretion, IGF-binding proteins (IGFBPs) and

384


KISSPEPTINA EN BECERRAS PREPĂ&#x161;BERES. I INFLUENCIA DE LA EDAD

expression of mRNAs for IGFs, IGF receptors and IGFBPs in the ovine pituitary gland. J Endocrinol 2000;166:247-254.

49. Iqbal J, Pompolo S, Considine RV, Clarke IJ. Localization of leptin receptor-like immunoreactivity in the corticotropes, somatotropes, and gonadotropes in the ovine pituitary gland. Endocrinol 2000;141:1515-1520.

42. Reinhardt RR, Bondy CA. Insulin-like growth factors cross the blood brain barrier. Endocrinol 1994;135:1753-1761.

50. Dyer CJ, Simmons JM, Matteri RL, Keisler DH. Leptin receptor mRNA is expressed in ewe anterior pituitary and adipose tissues and is differentially expressed in hypothalamic regions of well-fed and feed-restricted ewes. Domest Anim Endocrinol 1997;14:119-128.

43. Hiney JK, Srivastava V, Dearth RK, Dees WL. Influence of estradiol on insulin-like growth factor-1-induced luteinizing hormone secretion. Brain Res 2004;1013:91-97. 44. Nagatani S, Guthikonda P, Foster DL. Appearance of a nocturnal peak of leptin secretion in the pubertal rat. Hormones Behav 2000;37:345-352.

51. Coss D, Mellon PL, Thackray VG. A FoxL in the Smad house activin regulation of FSH. Trends Endocrinol Metab 2010;21:562-568. 52. Phillips JD. Activins, inhibins and follistatins in the large domestic species. Domest Anim Endocrinol 2005;28:1-16.

45. Martos-Moreno GA, Barrios V, Soriano-GuillĂŠn L, Argente J. Relationship between adiponectin levels, acylated ghrelin levels, and short-term body mass index changes in children with diabetes mellitus type 1 at diagnosis and after insulin therapy. Eur J Endocrinol 2006;155:757-761.

53. Thackray VG, Mellon PL, Coss D. Hormones in synergy: Regulation of the pituitary gonadotropin genes. Mol Cell Endocrinol 2010;314:92-203.

46. Garcia MR, Amstalden M, Morrison CD, Keisler DH, Williams GL. Age at puberty, total fat and conjugated linoleic acid content of carcass, and circulating metabolic hormones in beef heifers fed a diet high in linoleic acid beginning at four months of age. J Anim Sci 2003;81:261-268.

54. Foster CM, Phillips DJ, Wyman T, Evans LW, Groome NP, Padmanabhan V. Changes in serum inhibin, activin and follistatin concentrations during puberty in girls. Human Reprod 2000;15(5):1052-1057.

47. Maciel MN, Zieba DA, Amstalden M, Keisler DH, Neves JP, Williams GL. Chronic administration of recombinant ovine leptin in growing beef heifers: Effects on secretion of LH, metabolic hormones, and timing of puberty. J Anim Sci 2004;82:2930-2936.

55. Rogol AD, Roemmich JN, Clark PA. Growth at Puberty. J Adolesc Health 2002;31:192-200. 56. Cheung CC, Thornton JE, Nurani SD, Clifton DK, Steiner RA. A reassessment of leptin's role in triggering the onset of puberty in the rat and mouse. Neuroendocrinol 2001;74:12-21.

48. Zieba DA, Amstalden M, Williams GL. Regulatory roles of leptin in reproduction and metabolism: A comparative review. Domest Anim Endocrinol 2005;29:166-185.

385


Rev Mex Cienc Pecu 2017;8(4):387-396

http://dx.doi.org/10.22319/rmcp.v8i4.4251

Caracterización molecular de Escherichia coli resistente a antibióticos aislada de mastitis bovina en Michoacán, México Molecular characterization of antibiotic resistant Escherichia coli isolated from bovine mastitis in Michoacán, México Rafael Jiménez Mejía*, Luis Fernando Gudiño Sosa, José Antonio Aguilar López, Pedro Damián Loeza Lara

RESUMEN En el presente estudio se describen los patrones de resistencia a antibióticos de E. coli aislada de mastitis bovina, así como la presencia de genes de virulencia y de resistencia. A partir muestras de leche obtenidas de vacas con mastitis se aislaron e identificaron a nivel bioquímico y molecular cepas de E. coli, a las cuales se les analizó el perfil de resistencia a antibióticos y mediante PCR se investigó la presencia de genes de virulencia, de resistencia a antibióticos beta-lactámicos, tetraciclina, estreptomicina y quinolonas; así como la presencia de integrones clase 1. El análisis genético reveló que 11.8 % de los aislados de E. coli presentaron el gen de virulencia que codifica para la intimina (eaeA). Por otro lado, todas las E. coli fueron resistentes a uno o más antibióticos, con alta frecuencia de resistencia para tetraciclina, ampicilina y cefalotina. Además, el 73.5 % fueron resistentes a tres o más antibióticos. De 11 genes de resistencia analizados, se confirmó la presencia de siete, distribuidos en el 79.4 % de los aislados bacterianos. De los cuales, blaCTX-M se encontró en 16 aislados, tetB en 11, tetA, strA y strB en 9, qnrB en cuatro y blaTEM en un solo aislado. También, en el 5.9 % de los aislados de E. coli se identificó la presencia de integrones clase 1. En conclusión, se encontraron elevados índices de resistencia en las E. coli aisladas de mastitis bovina. Estas bacterias contienen genes de virulencia relacionados a patógenos de humano; también llevan genes de resistencia a beta-lactámicos, tetraciclina, estreptomicina y quinolonas. PALABRAS CLAVE: Mastitis bovina, E. coli, Resistencia a los antibióticos, Genes de virulencia, PCR.

ABSTRACT In the present study the antibiotic resistance patterns of E. coli isolated from bovine mastitis, as well as the presence of Extended-spectrum β-lactamases (ESBL), tetracycline, streptomycin, and quinolone resistance genes were analyzed. From mastitic cows, milk samples were obtained, of which E. coli were isolated and identified biochemically and confirmed at the molecular level. Genetic analysis revealed that 11.8 % of the E. coli contained a virulence gene encoding intimin (eaeA). All E. coli were resistant to one or more antibiotics, with higher rates of resistance to tetracycline, ampicillin, and cephalothin. In addition, 73.5 % of E. coli were resistant to three or more antibiotics. Of eleven resistance genes analyzed, seven were detected in 79.4 % of the bacterial isolates. Of these, blaCTX-M was found in 16 isolates, tetB in 11, tetA, strA and strB in nine, qnrB in four, and blaTEM in one isolate. About 5.9 % of the E. coli isolates carried class 1 integron integrase gene. In conclusion, a high prevalence of antibiotic resistance in E. coli isolated from bovine mastitis was identified. The bacteria also harbor a virulence gene related to human pathogens and genes conferring resistance to beta-lactam antibiotics, tetracycline, streptomycin, and quinolones. KEY WORDS: Bovine mastitis, E. coli, Antibiotic resistance, Virulence genes, PCR.

Recibido el 17 de agosto de 2016. Aceptado el 22 de noviembre de 2016. Universidad de La Ciénega del Estado de Michoacán de Ocampo. Avenida Universidad # 3000. Colonia Lomas de la Universidad. 59103 Sahuayo, Michoacán. México. *Autor de correspondencia: rjimenez@ucienegam.edu.mx

387


Rafael Jiménez Mejía, et al. / Rev Mex Cienc Pecu 2017;8(4):387-396

INTRODUCCIÓN

como promotores de crecimiento en animales, ha favorecido el desarrollo de resistencia bacteriana, que puede ser transmitida a patógenos de animales o humanos(11). Por esto, el ganado bovino es considerado un reservorio importante de bacterias que llevan genes de resistencia para antibióticos beta-lactámicos de espectro extendido, tetraciclinas, quinolonas, aminoglucósidos, entre otros(10). Por lo anterior, la mastitis bovina es considerada un problema de salud pública debido a la contaminación de la leche con bacterias patógenas resistentes a los antibióticos(12).

La mastitis bovina es una enfermedad compleja con alta prevalencia a nivel mundial, por lo que ésta continua siendo un problema para la industria lechera, debido a las pérdidas económicas por la reducción en la producción de leche, desecho del producto, descarte temprano de animales enfermos y servicios veterinarios(1). Se han asociado a la enfermedad diversas especies de microorganismos, sin embargo, solo un grupo reducido de especies bacterianas son los agentes causales más comunes de la enfermedad, que de acuerdo con su origen se clasifican como patógenos contagiosos o ambientales(2). Los primeros, son aquellos adaptados a sobrevivir dentro de la glándula mamaria y pueden causar infecciones asintomáticas. Los principales miembros de este grupo son Staphylococcus aureus, Streptococcus agalactiae y Mycoplasma spp(2,3). Por otro lado, los patógenos ambientales son oportunistas y no están adaptados a sobrevivir en la glándula mamaria. Este grupo incluye a Streptococcus spp no agalactiae, Enterococcus spp, Staphylococus coagulasanegativos y bacterias coliformes. De estos últimos el patógeno más importante es Escherichia coli(2,3).

Entre los principales mecanismos de resistencia bacteriana a los antibióticos se encuentran la producción de beta-lactamasas de espectro extendido (BLEE), especialmente en bacterias Gram negativas. Las principales familias de BLEE son las de tipo CTX-M, TEM, CMY, SHV y OXA(13,14). De acuerdo con lo anterior, se ha observado incremento en la detección de beta-lactamasas en bacterias de origen animal(12). También, la resistencia a antibióticos en bacterias Gram negativas incluye la presencia de sistemas de expulsión, como los codificados por los genes tetA-G, asociados con resistencia a tetraciclina(15). De igual forma, la resistencia puede ser debida a la presencia de enzimas que modifican e inactivan a los antibióticos, como aquellas que confieren resistencia a estreptomicina codificada por los genes strA-strB(16). Frecuentemente los genes de resistencia están asociados a plásmidos conjugativos e integrones, que son los principales elementos involucrados en la diseminación de la resistencia a antibióticos entre bacterias Gram negativas(17).

Generalmente, E. coli es considerada una bacteria no patógena que habita en el intestino de humano y animales. No obstante, se han descrito varios patotipos clasificados como patógenos intestinales o extraintestinales(4). Para el caso de E. coli causante de mastitis, a la fecha no se han identificado cepas o factores de virulencia específicos, pero se ha propuesto que forman un nuevo patotipo denominado Mammary Pathogenic E. coli (MPEC)(5). Sin embargo, se ha observado gran diversidad tanto genética como en los factores de virulencia entre esas bacterias(6,7). De estos últimos factores, muchos son comunes con los patotipos de humanos e incluyen toxinas, adhesinas, producción de cápsula, la habilidad para resistir el complemento sérico y sistemas de adquisición de hierro(7-9).

La región occidente de Michoacán, México, es una zona productora de leche muy importante, sin embargo, a la fecha no hay información sobre los principales patógenos causantes de la mastitis bovina, así como de los perfiles fenotípicos y genotípicos de su resistencia a los antibióticos. Por tanto, el objetivo del presente trabajo fue estudiar los patrones de resistencia a los antibióticos de E. coli aisladas de mastitis bovina, analizar la prevalencia de genes de virulencia y de resistencia para beta-lactámicos, tetraciclina, estreptomicina y quinolonas, así como su asociación con integrones clase 1.

Entre las estrategias para el control de la mastitis, la principal es la terapia con antibióticos, aunque frecuentemente el tratamiento falla debido a la creciente resistencia bacteriana a dichos compuestos(10). Además, el uso indiscriminado de antibióticos para el tratamiento de infecciones y

388


CARACTERIZACIÓN MOLECULAR DE ESCHERICHIA COLI RESISTENTES A ANTIBIÓTICOS AISLADAS DE MASTITIS BOVINA

MATERIAL Y MÉTODOS

coli

Detección de mastitis y toma de muestras

Análisis molecular de los aislados de E.

Para confirmar la identidad de los aislados se amplificaron fragmentos de los genes uidA y lacZ con los primers uidA-F/uidA-R y lacZ-F/lacZ-R, respectivamente (Cuadro 1). Las amplificaciones por PCR se realizaron de acuerdo a la metodología descrita(20). Por otro lado, mediante PCR multiplex con los primers enlistados en el Cuadro 1, se analizó la presencia de genes de virulencia característicos de las dos principales variantes de E. coli patógenas de humanos, E. coli enteropatógena (EPEC) y E. coli enterohemorrágica (EHEC). Los genes analizados fueron eaeA, que codifica para la intimina y es común a EPEC y EHEC, bfpA, que codifica para la pilina del pilus tipo IV de EPEC y stx2, que codifica para la toxina Shiga tipo 2 de EHEC. Las reacciones de PCR se realizaron como se describió previamente(21).

Este trabajo se desarrolló durante 2013, como parte de un programa regional para el estudio de la mastitis en el occidente de Michoacán, México. En el estudio se incluyeron nueve establos con un tamaño de 7 a 64 vacas. La mastitis se detectó mediante la aplicación de la prueba de California (PC) (Sanfer, México), siguiendo las instrucciones del fabricante. La PC se realizó en los cuatro cuartos de cada vaca, y de los cuartos que dieron positivo a la prueba se colectó una muestra de 30 ml de leche en tubos estériles. Previo a la colecta de la muestra, los cuartos se desinfectaron con algodón humedecido con alcohol al 70 %, desechando los primeros chorros de leche. Las muestras colectadas se transportaron a 4 °C en hielo al laboratorio y se procesaron el mismo día.

Aislamiento de E. coli

Para la detección de los genes de resistencia en E. coli, los extractos de ADN total se utilizaron para amplificar por PCR fragmentos de los genes blaTEM, blaSHV, blaCTX-M, blaCMY y blaOXA(22). También, se amplificaron los genes de resistencia a tetraciclina tetA y tetB con primers descritos previamente(22,23), así como genes de resistencia a estreptomicina strA y strB(24) y de resistencia a quinolonas qnrA y qnrB(25). Los genes se seleccionaron debido a los altos índices de resistencia de las E. coli a los antibióticos beta-lactámicos, tetraciclina y estreptomicina. Además, los genes de resistencia se han asociado frecuentemente a integrones clase 1, por lo cual se analizó la presencia del gen que codifica para la integrasa intI1(26). Las características de las secuencias de los primers se enlistan también en el Cuadro 1. En general, las mezclas de reacción para las amplificaciones se realizaron en un volumen de 25 µl conteniendo: 1X de Master mix (Promega, USA), 0.5 µM de cada primer y 1 µl de extracto total de ADN. Las reacciones de PCR se realizaron en un termociclador C1000 (Bio-Rad, México). La amplificación se inició con un ciclo de desnaturalización a 95 °C por 5 min seguido de 35 ciclos a las siguientes temperaturas: desnaturalización a 95 °C por 40 seg, alineamiento a la temperatura indicada en el Cuadro 1 para cada par de oligonucleótidos por

De cada una de las muestras se inocularon 100 µl en agar MacConkey (Difco, USA) y se incubaron por 24 h a 37 °C. A partir de las muestras en que se observó crecimiento, se seleccionó al azar una colonia fermentadora de lactosa para su análisis, la cual fue estriada en agar Eosina Azul de Metileno (Difco, USA) y se le realizó tinción de Gram. De estas últimas se seleccionaron 34 colonias típicas de E. coli y se identificaron bioquímicamente de acuerdo a la literatura(18). Las principales pruebas que se realizaron fueron fermentación de glucosa y lactosa, así como producción de gas y H2S en agar Kligler con Hierro, IMViC (indol, rojo de metilo, VogesProskauer y citrato), oxidasa, catalasa, ureasa y producción de fluorescencia en medio EC-MUG.

Extracción de ADN El ADN se preparó a partir de 500 µl de un cultivo de toda la noche. Las células se centrifugaron a 13,000 rpm por 2 min. Después, el sobrenadante se descartó y las células se resuspendieron en 1 ml de agua destilada estéril y se llevaron a ebullición por 10 min. La mezcla resultante se centrifugó por 5 min a 13,000 rpm y el sobrenadante se utilizó directamente como DNA molde o se almacenó a -20 °C hasta su uso(19).

389


Rafael Jiménez Mejía, et al. / Rev Mex Cienc Pecu 2017;8(4):387-396

40 seg, extensión a 72 °C por 1 min y un ciclo final de extensión a 72 °C por 5 min. Los fragmentos amplificados se separaron por electroforesis en geles

de agarosa al 1%, se tiñeron con bromuro de etidio y se visualizaron en un fotodocumentador Gel Doc Universal Hood II (Bio-Rad, México).

Cuadro 1. Oligonucleótidos usados con su temperatura de alineamiento (Tm) y el fragmento amplificado esperado Nombre

Secuencia 5' → 3'

lacZ-F

ATGAAAGCTGGCTACAGGAAGGCC

lacZ-R

GGTTTATGCAGCAACGAGACGTCA

uidA-F

AAAACGGCAAGAAAAAGCAG

uidA-R

ACGCGTGGTTACAGTCTTGCG

TEM-F

ATAAAATTCTTGAAGACGAAA

TEM-R

GACAGTTACCAATGCTTAATC

SHV-F

TTATCTCCCTGTTAGCCACC

SHV-R

GATTTGCTGATTTCGCTCGG

OXA-F

TCAACTTTCAAGATCGCA

OXA-R

GTGTGTTTAGAATGGTGA

CTX-M-F

CGCTTTGCGATGTGCAG

CTX-M-R

ACCGCGATATCGTTGGT

CMY-F

GACAGCCTCTTTCTCCACA

CMY-R

TGGAACGAAGGCTACGTA

qnrA-F

ATTTCTCACGCCAGGATTTG

qnrA-R

GATCGGCAAAGGTTAGGTCA

qnrB-F

GATCGTGAAAGCCAGAAAGG

qnrB-R

ACGATGCCTGGTAGTTGTCC

strA-F

CTTGGTGATAACGGCAATTC

strA-R

CCAATCGCAGATAGAAGGC

strB-F

ATCGTCAAGGGATTGAAACC

strB-R

GGATCGTAGAACATATTGGC

tetA-F

GGCCTCAATTTCCTGACG

tetA-R

AAGCAGGATGTAGCCTGTGC

tetB-F

CCTCAGCTTCTCAACGCGTG

tetB-R

GCACCTTGCTCATGACTCTT

bfpA-F

GGAAGTCAAATTCATGGGGGTAT

bfpA-R

GGAATCAGACGCAGACTGGTAGT

stx2-F

ATCCTATTCCCGGGAGTTTACG

stx2-R

GCGTCATCGTATACACAGGAGC

eae-F

TCAATGCAGTTCCGTTATCAGTT

eae-R

GTAAAGTCCGTTACCCCAACCTG

IntI1-F

GGGTCAAGGATCTGGATTTCG

IntI1-R

ACATGCGTGTAAATCATCGTCG

390

Tm (°C)

Fragmento amplificado (pb)

Referencia

58

264

(20)

58

147

(20)

50

1080

(22)

50

795

(22)

57

591

(22)

52

550

(22)

50

1000

(22)

52

516

(25)

53

469

(25)

53

548

(24)

53

509

(24)

56

372

(23)

56

633

(22)

55

305

(21)

55

587

(21)

55

501

(21)

62

483

(26)


CARACTERIZACIÓN MOLECULAR DE ESCHERICHIA COLI RESISTENTES A ANTIBIÓTICOS AISLADAS DE MASTITIS BOVINA

Pruebas de resistencia a los antibióticos

concentraciones mínimas inhibitorias (CIM) fueron ≥16 µg/ml para tetraciclina, ≥25 µg/ml para kanamicina y ≥32 µg/ml para estreptomicina.

Las pruebas de susceptibilidad se realizaron por ensayos de difusión en disco en agar Mueller-Hinton (Difco, USA), para lo cual se preparó una suspensión bacteriana equivalente a la turbidez del tubo 0.5 de la escala de McFarland (1-2 x 108 UFC/ml). Después, se distribuyeron 200 μl de la suspensión bacteriana sobre la superficie del agar Müeller-Hinton (Difco, USA). Posteriormente, se colocaron los multidiscos para Gram negativos II (Bio-Rad, México), con los siguientes antibióticos a las cantidades indicadas: amikacina (30 µg), ampicilina (10 µg), levofloxacina (5 µg), cefalotina (30 µg), cefotaxima (30 µg), ceftriaxona (30 µg), cloramfenicol (30 µg), gentamicina (10 µg), netilmicina (30 µg), nitrofurantoina (300 µg), cefepima (30 µg) y trimetoprim-sulfametoxazol (25 µg). Las zonas de inhibición se midieron, y de acuerdo a las instrucciones del fabricante los aislados se clasificaron como resistentes (R), intermedios (I) o sensibles (S). La resistencia a tetraciclina, kanamicina y estreptomicina (Sigma Aldrich, México) se analizó mediante el método de microdilución y se interpretó de acuerdo a los criterios del CLSI(27). Los aislados se clasificaron como resistentes si las

RESULTADOS De acuerdo a la PC, la prevalencia de mastitis subclínica en el área estudiada fue de 49 %, ya que 148 de 302 vacas dieron positivo a la prueba en al menos uno de los cuartos. En total se colectaron 120 muestras de leche de las vacas con mastitis, 28 no se pudieron obtener por dificultades técnicas durante la toma de muestras. De las muestras colectadas, en 51 (42.5 %) se obtuvo crecimiento en agar MacConkey, de éstas se seleccionó una colonia representativa fermentadora de lactosa y se confirmó como Gram negativa. Treinta y cuatro (66.7 %) colonias fermentadoras de lactosa se identificaron bioquímicamente como E. coli y en todas ellas se amplificaron fragmentos de los genes uidA y lacZ (Figura 1A). Además, en 4/34 (11.8 %) aislados de E. coli, se detectó el gen de virulencia para la intimina (eaeA), pero en ningún aislado se identificaron los genes de virulencia bfpA o stx2 (Figura 1B).

Figura 1. Confirmación molecular de E. coli y detección de genes de virulencia. A) M, marcador de ADN 1 Kb plus; 1, control positivo para lacZ/uidA (EPEC); 2-10, aislados representativos positivos para lacZ/uidA genes. B) M, marcador de ADN 1 Kb plus; 1, control positivo para eaeA/bfpA (EPEC); 2, control positivo para eaeA/stx2 (EHEC); 3, aislado negativo para eaeA/stx2/bfpA; 4 y 5, aislados representativos positivos para eaeA

391


Rafael Jiménez Mejía, et al. / Rev Mex Cienc Pecu 2017;8(4):387-396

Cuadro 2. Perfiles de susceptibilidad a los antibióticos de las 34 E. coli aisladas de mastitis bovina Antibiótico Amikacina (Ak) Ampicilina (Am) Levofloxacina (Lev) Cefalotina (Cf) Cefotaxima (Ctx) Ceftriaxona (Cro) Cloranfenicol (Cl) Gentamicina (Ge) Netilmicina (Net) Nitrofurantoína (Nf) Cefepima (Fep) Trimetoprima-Sulfametoxazol (Stx) Tetraciclina (Te) Kanamicina (Km) Estreptomicina (Stp)

Cuadro 3. Patrones de resistencia de las E. coli Perfil de resistencia*

Número de aislados (%) Resistentes Intermedios Sensibles 2 (5.9) 26 (76.5) 2 (5.9) 25 (73.5) 3 (8.8) 4 (11.8) 4 (11.8) 4 (11.8) 4 (11.8) 12 (35.3) 2 (5.9) 1 (2.9) 30 (88.2) 4 (11.8) 13 (38.2)

7 (20.6) 6 (17.6) 1 (2.9) 6 (17.6) 22 (64.7) 16 (47) 9 (26.4) 2 (5.9) 1 (2.9) 18 (52.9) 3 (8.8) 0 (0) 0 (0) 0 (0) 0 (0)

Te AmCf AmTe CfTe KmTe AmCfGe AmCfNf AmGeTe CfStpTe KmStpTe AmCfNetTe AmCfNfTe AmCfStpTe AmCfNetTe AmCfNetStpTe AmCfNfStpTe AmCfClNfTe AmCfLevStpTe AmCfCroNfStpTe AmCfGeNetStpTe AmCfKmNfStpTe AkAmCfCtxFepNfTe AmCfCroCtxFepNfTe AmCfClCroCtxGeStpTe AkAmCfClCroNfStpTe AmCfClKmLevStpSxtTe

25 (73.5) 2 (5.9) 31 (91.2) 3 (8.8) 9 (26.5) 14 (41.2) 21 (61.8) 28 (82.4) 29 (85.3) 4 (11.8) 29 (85.3) 33 (97) 4 (11.8) 30 (88.2) 21 (61.8)

Perfiles de resistencia a los antibióticos Los ensayos de susceptibilidad a los antimicrobianos de las E. coli (n= 34) revelaron que todas fueron resistentes a uno o más antibióticos (Cuadro 2). Los compuestos a los cuales mostraron mayores índices de resistencia fueron a tetraciclina (88.2 %), ampicilina (76.5 %) y cefalotina (73.5 %). Índices de resistencia menores que van de 38.2 al 2.9 % se observaron en los restantes 12 antibióticos. Además, se observó resistencia intermedia principalmente para cefotaxima (64.7 %), nitrofurantoína (52.9 %) y ceftriaxona (47 %). Por otro lado, se observaron altos índices de susceptibilidad para trimetoprimsulfametoxazol (97 %), levofloxacina (91.2 %), kanamicina (88.2 %), cefepima (85.3 %), netilmicina (85.3 %), gentamicina (82.4 %), amikacina (73.5 %), cloranfenicol y estreptomicina (61.8 %), respectivamente. Se observaron 26 patrones de resistencia distintos entre los 34 aislados de E. coli, siendo los patrones observados con mayor frecuencia, los de resistencia a tetraciclina y ampicilina-cefalotina-nitrofurantoínatetraciclina con cuatro aislados cada uno. Adicionalmente, 25 (73.5 %) aislados se clasificaron como multirresistentes, ya que toleraron tres o más

No. de aislados (%) 4 (11.8) 1 (2.9) 2 (5.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 4 (11.8) 2 (5.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9)

*Abreviaciones, Ak amikacina, Am ampicilina, Lev levofloxacina, Cf cefalotina, Ctx cefotaxima, Cro ceftriaxona, Cl cloranfenicol, Ge gentamicina, Net netilmicina, Nf nitrofurantoína, Fep cefepima, Sxt trimetoprima-sulfametoxazol, Te tetraciclina, Km kanamicina, Stp estreptomicina.

antibióticos diferentes, de los cuales, 12 (35.3 %) presentaron resistencia de 5 a 8 antibióticos (Cuadro 3).

Presencia de genes de resistencia e integrones clase 1 en E. coli De los 11 genes de resistencia analizados, se logró detectar la presencia de 7 en 27 (79.4 %) E. coli (Figura 2A). El más frecuente fue blaCTX-M presente en 16 (47 %) aislados, seguido por tetB en 11 (32.3 %), tetA, strA, strB en 9 (26.5%), respectivamente; qnrB en 4 aislados y blaTEM en 1 (2.9 %) aislado (Cuadro 4). Adicionalmente, los

392


CARACTERIZACIÓN MOLECULAR DE ESCHERICHIA COLI RESISTENTES A ANTIBIÓTICOS AISLADAS DE MASTITIS BOVINA

Figura 2. Amplificación por PCR de genes de resistencia y de integrasa tipo 1. A) M, marcador de ADN 1 Kb plus; 1 y 2, aislados positivos para blaCTX-M; 3, aislado positivo para blaTEM; 4 y 5, aislados positivos para qnrB; 6 y 7, aislados positivos para tetB; 8 y 9, aislados positivos para tetA; 10, aislado positivo strA; 11, aislado positivo para strB. B) M, marcador de ADN 1 Kb plus; 1 y 2, aislados positivos para intI1

Cuadro 4. Perfil de genes de resistencia detectados en E. coli Genes de resistencia

los genes strA, strA, tetA, tetB y qnrB; mientras que el arreglo tetB-strA-strB se encontró en cuatro aislados y blaTEM-tetA-strA-strB en un aislado. Sin embargo, de las 34 E. coli, solo dos (5.9 %) aislados multirresistentes contienen el gen de la integrasa para integrones clase 1 (Figura 2B). De los cuales, uno presentó el gen tetB, mientras que en el segundo se identificó el arreglo blaCTX-M-tetA-strAstrB.

No. de aislados (%)

Ninguno blaCTX-M

7 (20.6) 6 (17.6)

tetA tetB blaCTX-M, qnrB

3 (8.8) 3 (8.8) 1 (2.9)

blaCTX-M, tetA

1 (2.9)

blaCTX-M, tetB

2 (5.9)

DISCUSIÓN

blaCTX-M, qnrB, tetA

2 (5.9)

blaCTX-M, strA, strB, tetA

2 (5.9)

blaCTX-M, strA, strB, tetB

2 (5.9)

blaTEM, qnrB, strA, strB, tetA

1 (2.9)

La mastitis bovina es la enfermedad más importante del ganado bovino a nivel mundial. Su prevalencia, tipo de microorganismos causales y sus características son variables de un lugar a otro. E. coli es un patógeno ambiental importante causante de mastitis; cuando esta bacteria infecta la glándula mamaria se muestran síntomas de inflamación, reducción en la producción y cambios físico-químicos en la leche(28).

tetB, strA, strB Total

4 (11.8) 34 (100)

Las E. coli aisladas en este trabajo pertenecen a 34 muestras distintas, lo cual representa un 28.3 % de muestras positivas para esta bacteria. Datos similares en la frecuencia de aislamiento de E.

genes de resistencia identificados se presentaron solos (12 aislados) o en diferentes combinaciones (15 aislados). De estos últimos, 10 aislados positivos para blaCTX-M presentaron seis arreglos distintos con

393


Rafael Jiménez Mejía, et al. / Rev Mex Cienc Pecu 2017;8(4):387-396

coli han sido reportados(29), donde el 27.2 % de las

presentó resistencia a ampicilina (47.1 %), kanamicina (37.1 %) y estreptomicina (32.9 %)(7). Mientras que otros autores han encontrado altos índices de resistencia a ampicilina (98.4 %), estreptomicina (40.3 %) sulfisoxazol (34.1 %) y tetraciclina (24.8 %), además de otros antibióticos(37). Asimismo, 64.7 % de las E. coli analizadas en este estudio fueron multirresistentes, ya que fueron resistentes a tres o más antibióticos. Datos similares se han reportado(10), donde el análisis de 70 aislados de E. coli resistentes a los antibióticos mostró que el 62.8 % fueron multirresistentes.

muestras colectadas de vacas con mastitis fueron positivas para E. coli. Además, en cuatro de las E. coli se detectó el gen de virulencia de la intimina, aunque no se detectaron los genes bfpA o sxt2. Lo anterior sugiere que esas bacterias pueden ser E. coli enteropatógena atípicas (aECEP) o E. coli enterohemorrágica (ECEH) con otra variante del gen stx(4). Sin embargo, el repertorio de genes de virulencia analizado en este trabajo fue limitado y se requieren más estudios para estudiar el catálogo completo de genes en las E. coli causantes de mastitis. En este sentido, se sabe que el ganado bovino es un reservorio importante de variantes de E. coli patógenas de humano, y varios estudios han reportado que los patotipos de humano también están asociados con mastitis bovina(30-32). Por ejemplo, se han identificado diferentes arreglos de los genes stx1, stx2 y eaeA en E. coli aislada de mastitis bovina(30). También se han descrito aislados de E. coli asociados a mastitis que tienen el gen eaeA sólo o en combinación con otros genes de virulencia, pero esos aislados fueron negativos para stx1 o stx2(32). Aunque muchos de los genes identificados en E. coli aislada de mastitis bovina no son específicos para la enfermedad, se ha sugerido que esos y otros elementos aun no identificados pueden ser responsables de la mastitis(6). En este sentido, varios estudios se han enfocado en la asociación de factores de virulencia específicos de E. coli causante de mastitis, pero no lo han logrado(6,33,34).

La resistencia bacteriana a los antibióticos es debida a la presencia de genes que le confieren la capacidad de tolerar esos compuestos a través de mecanismos como expulsión, modificación, entre otros. Asimismo, el ganado bovino se considera un reservorio de E. coli, las cuales frecuentemente tienen genes de resistencia a antibióticos que se pueden diseminar a través de los alimentos de origen animal(11). De acuerdo con lo anterior, en este estudio se encontraron genes que codifican para beta-lactamasas, tetraciclina y estreptomicina en el 79.4 % de las E. coli aisladas de mastitis bovina y todas ellas presentaron resistencia o resistencia intermedia a esos antibióticos. Lo anterior demuestra que en el área de estudio de este trabajo, el ganado bovino es reservorio de bacterias resistentes a los antibióticos, con la alta prevalencia de genes de resistencia a los antibióticos y que aunado a la presencia de genes de virulencia, representa un riesgo a la salud por la contaminación de la leche. Otros autores han encontrado genes para BLEE en el 26 y 1.5 % de enterobacterias aisladas de excremento y leche de vacas con mastitis, respectivamente. En ese trabajo, se detectaron los genes blaCTX-M, blaSHV y blaTEM en 92, 5.5 y 2.2 % de las bacterias positivas para BLEE(38). Además, diversos estudios han encontrado que E. coli multirresistentes causantes de mastitis contienen los genes blaCTX-M y blaTEM(39,40).

Normalmente, para el control de la mastitis bovina se emplea la terapia con antibióticos; sin embargo, muchas veces el tratamiento falla debido al incremento en la resistencia bacteriana a los antimicrobianos(10). En este sentido, las E. coli aisladas de mastitis bovina han desarrollado resistencia a los antibióticos comúnmente usados en medicina veterinaria para tratar la enfermedad(35). En este estudio se encontraron elevados niveles de resistencia para tetraciclina (88.2 %), ampicilina (76.5 %) y cefalotina (73.5 %), principalmente. Lo anterior puede estar relacionado con el hecho de que esos compuestos pertenecen a los principales grupos de antibióticos usados para el tratamiento de infecciones en ganado o se utilizan como promotores de crecimiento animal(36). En este sentido, se ha encontrado que E. coli aislada de mastitis bovina

También, el análisis genético de los determinantes de resistencia a tetraciclina y estreptomicina en E. coli aislada de mastitis bovina, reveló que todas contenían uno o más genes de resistencia a esos compuestos en diferentes

394


CARACTERIZACIÓN MOLECULAR DE ESCHERICHIA COLI RESISTENTES A ANTIBIÓTICOS AISLADAS DE MASTITIS BOVINA

combinaciones(37). Además, en 33 E. coli analizadas en este trabajo presentaron al menos un plásmido grande (>50 kb, datos no mostrados), sugiriendo que los genes de resistencia pueden estar asociados con estos. De acuerdo con lo anterior se ha asociado a plásmidos >35 kb con la presencia y movilización de genes de resistencia a antibióticos(41). Además, dos aislados presentaron integrones clase 1, cuya presencia se correlaciona comúnmente con aislados multirresistentes, sugiriendo que los genes pueden estar asociados a esos elementos. La asociación de genes de resistencia con integrones ha sido observada en otros estudios de E. coli causante de mastitis con altos índices de resistencia a los antibióticos(42).

LITERATURA CITADA 1.

Seegers H, Fourichon C, Beaudeau F. Production effects related to mastitis and mastitis economics in dairy cattle herds. Vet Res 2003;34(5):475-491.

2.

Thompson-Crispi K, Atalla H, Miglior F, Mallard BA. Bovine mastitis: Frontiers in immunogenetics. Front Immunol 2014;5:1-10.

3.

Contreras GA, Rodríguez JM. Mastitis: comparative etiology and epidemiology. J Mammary Gland Biol Neoplasia 2011;16(4):339356.

4.

Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol 2004;2(2):123-140.

5.

Shpigel NY, Elazar S, Rosenshine I. Mammary pathogenic Escherichia coli. Curr Opin Microbiol 2008;11(1):60-65.

6.

Blum SE, Leitner G. Genotyping and virulence factors assessment of bovine mastitis Escherichia coli. Vet Microbiol 2013;163(34):305-312.

7.

Liu Y, Liu G, Liu W, Ali T, Chen W, Yin J, et al. Phylogenetic group, virulence factors and antimicrobial resistance of Escherichia coli associated with bovine mastitis. Res Microbiol 2014;165(4):273277.

CONCLUSIONES E IMPLICACIONES

8. Blum SE, Heller ED, Sela S, Elad D, Edery N, Leitner G. Genomic and phenomic study of mammary pathogenic Escherichia coli. PLoS One. 2015;10(9):1-24.

Se aislaron e identificaron E. coli asociadas a mastitis bovina y resistentes a antibióticos; aunque en baja frecuencia, éstas contienen genes de virulencia relacionados con patógenos entéricos de humano. También presentaron genes responsables de la resistencia a compuestos beta-lactámicos, tetraciclina, estreptomicina y quinolonas. Hasta donde se sabe, ésta es la primera vez que se determina la presencia de dichos genes de resistencia a antibióticos en E. coli asociada a mastitis bovina en México. Aunque se requieren más estudios para caracterizar el repertorio de genes de virulencia y de resistencia e investigar su movilidad por su posible asociación con plásmidos conjugativos. El estudio de las principales características de las bacterias patógenas asociadas a mastitis bovina, en el futuro podría contribuir a mejorar la situación de la enfermedad en los hatos ganaderos del estado, así como los riesgos a la salud asociados.

9.

Hogan J, Larry Smith K. Coliform mastitis. Vet Res 2003;34(5):507519.

10. Saini V, McClure JT, Léger D, Keefe GP, Scholl DT, Morck DW, et al. Antimicrobial resistance profiles of common mastitis pathogens on Canadian dairy farms. J Dairy Sci 2012;95(8):4319-4332. 11. Phillips I, Casewell M, Cox T, De Groot B, Friis C, Jones R, et al. Does the use of antibiotics in food animals pose a risk to human health? A critical review of published data. J Antimicrob Chemother 2004;53(1):28-52. 12. Li XZ, Mehrotra M, Ghimire S, Adewoye L. beta-Lactam resistance and beta-lactamases in bacteria of animal origin. Vet Microbiol 2007;121(3-4):197-214. 13. Jacoby GA, Munoz-Price LS. The new beta-lactamases. N Engl J Med 2005;352(4):380-391. 14. Bush K, Jacoby GA. Updated functional classification of betalactamases. Antimicrob Agents Chemother 2010;54(3):969-976. 15. Nguyen F, Starosta AL, Arenz S, Sohmen D, Dönhöfer A, Wilson DN. Tetracycline antibiotics and resistance mechanisms. Biol Chem 2014;395(5):559-575. 16. Sunde M, Norström M. The genetic background for streptomycin resistance in Escherichia coli influences the distribution of MICs. J Antimicrob Chemother 2005;56(1):87-90.

AGRADECIMIENTOS

17. Gillings MR. Integrons: past, present, and future. Microbiol Mol Biol Rev 2014;78(2):257-277.

Se agradece a Carlos Cervantes y Jesús Silva los comentarios al presente trabajo. Este trabajo fue financiado en parte por el apoyo del programa de desarrollo profesional docente (PRODEP), Fortalecimiento de Cuerpos Académicos (proyecto IDCA-11106) y por la Universidad de La Ciénega del Estado de Michoacán de Ocampo (UCEM).

18. Scheutz F, Strockbine N. Escherichia. Bergey's Manual of Systematics of Archaea and Bacteria. 2015:1-49. 19. Madico G, Akopyants NS, Berg DE. Arbitrarily primed PCR DNA fingerprinting of Escherichia coli O157:H7 strains by using templates from boiled cultures. J Clin Microbiol 1995;33(6):1534-1546. 20. Horakova K, Mlejnkova H, Mlejnek P. Specific detection of Escherichia coli isolated from water samples using polymerase

395


Rafael Jiménez Mejía, et al. / Rev Mex Cienc Pecu 2017;8(4):387-396

chain reaction targeting four genes: cytochrome bd complex, lactose permease, beta-D-glucuronidase, and beta-Dgalactosidase. J Appl Microbiol 2008;105(4):970-976.

32. Suojala L, Pohjanvirta T, Simojoki H, Myllyniemi AL, Pitkälä A, Pelkonen S, et al. Phylogeny, virulence factors and antimicrobial susceptibility of Escherichia coli isolated in clinical bovine mastitis. Vet Microbiol 2011;147(3-4):383-398.

21. Vidal M, Kruger E, Durán C, Lagos R, Levine M, Prado V, et al. Single multiplex PCR assay to identify simultaneously the six categories of diarrheagenic Escherichia coli associated with enteric infections. J Clin Microbiol 2005;43(10):5362-5365.

33. Fernandes JB, Zanardo LG, Galvão NN, Carvalho IA, Nero LA, Moreira MA. Escherichia coli from clinical mastitis: serotypes and virulence factors. J Vet Diagn Invest 2011;23(6):1146-1152.

22. Ahmed AM, Shimamoto T. Molecular characterization of multidrugresistant avian pathogenic Escherichia coli isolated from septicemic broilers. Int J Med Microbiol 2013;303(8):475-483.

34. Kaipainen T, Pohjanvirta T, Shpigel NY, Shwimmer A, Pyörälä S, Pelkonen S. Virulence factors of Escherichia coli isolated from bovine clinical mastitis. Vet Microbiol 2002;85(1):37-46.

23. Guillaume G, Verbrugge D, Chasseur-Libotte M, Moens W, Collard J. PCR typing of tetracycline resistance determinants (Tet A-E) in Salmonella enterica serotype Hadar and in the microbial community of activated sludges from hospital and urban wastewater treatment facilities in Belgium. FEMS Microbiol Ecol 2000;32(1):77-85.

35. Suojala L, Kaartinen L, Pyörälä S. Treatment for bovine Escherichia coli mastitis - an evidence-based approach. J Vet Pharmacol Ther 2013;36(6):521-531. 36. Dibner JJ, Richards JD. Antibiotic growth promoters in agriculture: history and mode of action. Poult Sci. 2005;84(4):634-643. doi: 10.1093/ps/84.4.634.

24. Gebreyes WA, Altier C. Molecular characterization of multidrugresistant Salmonella enterica subsp. enterica serovar Typhimurium isolates from swine. J Clin Microbiol 2002;40(8):2813-2822.

37. Srinivasan V, Gillespie BE, Lewis MJ, Nguyen LT, Headrick SI, Schukken YH, et al. Phenotypic and genotypic antimicrobial resistance patterns of Escherichia coli isolated from dairy cows with mastitis. Vet Microbiol 2007;124(3-4):319-328.

25. Robicsek A, Strahilevitz J, Sahm DF, Jacoby GA, Hooper DC. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob Agents Chemother 2006;50(8):2872-2874.

38. Geser N, Stephan R, Hächler H. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL) producing Enterobacteriaceae in food producing animals, minced meat and raw milk. BMC Vet Res 2012;8(1):1-9.

26. Mazel D, Dychinco B, Webb VA, Davies J. Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob Agents Chemother 2000;44(6):1568-1574.

39. Pehlivanoglu F, Turutoglu H, Ozturk D. CTX-M-15-Type ExtendedSpectrum Beta-Lactamase-Producing Escherichia coli as causative agent of bovine mastitis. Foodborne Pathog Dis 2016;13(9):477482.

27. CLSI. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Ninth ed. Approved Standard M07A9. Clinical and Laboratory Standards Institute. 2012. 28. Blum SE, Heller ED, Leitner G. Long term effects of Escherichia coli mastitis. Vet J 2014;201(1):72-77.

40. Timofte D, Maciuca IE, Evans NJ, Williams H, Wattret A, Fick JC, et al. Detection and molecular characterization of Escherichia coli CTXM-15 and Klebsiella pneumoniae SHV-12 β-lactamases from bovine mastitis isolates in the United Kingdom. Antimicrob Agents Chemother 2014;58(2):789-794.

29. Momtaz H, Safarpoor Dehkordi F, Taktaz T, Rezvani A, Yarali S. Shiga toxin-producing Escherichia coli isolated from bovine mastitic milk: serogroups, virulence factors, and antibiotic resistance properties. Scient World J 2012;2012:1-9.

41. Freitag C, Michael BG, Kadlec K, Hassel M, Schwarz S. Detection of plasmid-borne extended-spectrum β-lactamase (ESBL) genes in Escherichia coli isolates from bovine mastitis. Vet Microbiol 2017;200:151-156.

30. Kobori D, Rigobelo EC, Macedo C, Marin JM, Avila FA. Virulence properties of Shiga toxin-producing Escherichia coli isolated from cases of bovine mastitis in Brazil. Revue d'élevage et de medcine vétérinaire des pays tropicaux 2004;57(1-2):15-20.

42. Wang GQ, Wu CM, Du XD, Shen ZQ, Song LH, Chen X, et al. Characterization of integrons-mediated antimicrobial resistance among Escherichia coli strains isolated from bovine mastitis. Vet Microbiol 2008;127(1-2):73-78.

31. Lira WM, Macedo C, Marin JM. The incidence of Shiga toxinproducing Escherichia coli in cattle with mastitis in Brazil. J Appl Microbiol 2004;97(4):861-876.

396


Rev Mex Cienc Pecu 2017;8(4):397-406

http://dx.doi.org/10.22319/ rmcp.v8i4.4645

Secuencias de cultivo alternativas para incrementar el potencial forrajero y productividad del agua Alternative crop sequences for increasing the forage potential and water productivity David Guadalupe Reta Sáncheza*, J. Santos Serrato Coronab, Héctor Mario Quiroga Garzaa, Arturo Gaytán Mascorroa, Uriel Figueroa Viramontesa RESUMEN La intensificación de la producción de forraje durante el período otoño-invierno puede incrementar la productividad de los sistemas de producción. El objetivo de este estudio fue determinar el potencial forrajero y productividad del agua (PA) de secuencias de cultivo alternativas con doble cosecha en otoño-invierno. El estudio se realizó durante los ciclos 2012-2013 y 2013-2014 en Matamoros, Coahuila, México. Se compararon las secuencias alternativas canola-triticale-maíz, canola-cebada-maíz, canolacártamo-maíz y canola-triticale-mijo perla con las secuencias convencionales avena-maíz-maíz y avena-sorgo-sorgo. Se determinó la composición química del forraje, los rendimientos de materia seca (MS), nutrientes y PA en la producción de MS, proteína cruda (PC) y energía neta para lactancia (ENL). Las secuencias alternativas mostraron mayores rendimientos (11.4-53.3 %) y valores superiores de PA (23.1-58.9 %) en la producción de PC (P<0.05), además de ahorros en lámina de riego anual de 5.7 a 36.0 cm al compararse con la secuencia convencional avena-maíz-maíz. Las mejores secuencias alternativas fueron las que incluyeron canola en otoño, cebada o triticale en invierno, y maíz en primavera, debido a su mayor rendimiento y PA en PC ( P<0.05); además, sus valores de PA para MS (1.92-2.05 kg m-3) y ENL (12.22-13.64 MJ m-3) fueron similares (P>0.05) o mayores (P<0.05) a los de la secuencia avena-maíz-maíz con 1.65-1.99 kg m-3 para MS y 11.09-13.72 MJ m-3 para ENL. Los resultados indican que las secuencias alternativas con doble cosecha en otoño-invierno pueden mejorar la eficiencia de producción de forraje. PALABRAS CLAVE: Materia seca, Nutrientes, Composición química, Brassica napus L., Carthamus tinctorius L., Pennisetum

glaucum (L.) R. Br.

ABSTRACT Intensification of forage production during fall-winter season may improve productivity of cropping systems. The objective of this study was to determine the forage potential and water productivity (WP) of alternative crop sequences with double-crop during fall-winter season. The study was conducted during 2012-2013 y 2013-2014 cycles in Matamoros, Coahuila, México. The alternative crop sequences canola-triticale-corn, canola-barley-corn, canola-safflower-corn and canola-triticale-pearl millet were compared with the conventional crop sequences oat-corn-corn and oat-sorghum-sorghum. Forage chemical composition, dry matter (DM) and nutrient yields, and WP values for DM, crude protein (CP) and net energy for lactation (NEL) production were determined. Alternative crop sequences showed higher yields (11.4-53.3 %) and superior WP values (23.1-58.9 %) in CP production (P<0.05), besides they had water savings from 5.7 to 36 cm as compared with the conventional crop sequence oat-corn-corn. The best alternative sequences were those with the incorporation of canola in fall, barley or triticale in winter, and corn in spring, due to their higher yield and WP in CP (P<0.05). In addition, their WP values for DM (1.92-2.05 kg m-3) and NEL (12.22-13.64 MJ m-3) were similar (P>0.05) or higher (P<0.05) to those for the sequence oat-corn-corn, with 1.65-1.99 kg m-3 for DM and 11.09-13.72 MJ m-3 for NEL. The results show that alternative crop sequences with double-crop during fall-winter season can improve the efficiency of forage production. KEY WORDS: Dry matter, Nutrients yields, Chemical composition, Brassica napus L., Carthamus tinctorius L., Pennisetum

glaucum (L.) R. Br.

Recibido el 11 de octubre de 2016. Aceptado el 15 de febrero de 2017. a Campo Experimental La Laguna. Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. México. b Facultad de Agricultura y Zootecnia, Universidad Juárez del Estado de Durango. México. *Autor de correspondencia: dretasan@yahoo.com

397


David Guadalupe Reta Sánchez, et al. / Rev Mex Cienc Pecu 2017;8(4):397-406

INTRODUCCIÓN

MATERIAL Y MÉTODOS

La producción de leche de bovino en la Comarca Lagunera de México es una de las principales actividades económicas. La producción del forraje utilizado para cubrir las necesidades nutricionales del ganado se realiza bajo irrigación, lo cual constituye una limitante debido a la escasez de agua en la región. El cambio climático global también afecta negativamente la producción de forraje debido al incremento continuo de la temperatura y la ocurrencia de periodos de sequía más prolongados, situación que es altamente probable se agrave en las próximas décadas(1).

El estudio se realizó en el Campo Experimental La Laguna del Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), localizado en Matamoros, Coahuila, México (25° 32’ N, 103° 14’ O y 1,150 msnm), en un suelo de textura arcillosa. El sitio experimental tiene suelos profundos (>1.8 m), con valores de disponibilidad de agua de 150 mm m-1(5) y un contenido de C orgánico de 0.75 %(6). Se evaluaron seis secuencias de cultivos, cuatro de ellas con especies alternativas y dos con las usadas comúnmente, las cuales se consideraron como tratamientos testigo. Las secuencias con especies alternativas fueron: 1) canola-triticale-maíz (Cn-Tcl-Mz); 2) canola-cebada-maíz (Cn-Cb-Mz); 3) canola-cártamo-maíz (Cn-Ctm-Mz); 4) canolatriticale-mijo perla (tres cortes) (Cn-Tcl-MP). Las secuencias testigos fueron: 5) avena-maíz-maíz (AvMz-Mz); y 6) avena-sorgo-sorgo (Av-Sr-Sr). Se utilizó un diseño experimental de bloques completos al azar con cuatro repeticiones. Las parcelas experimentales fueron de 7 m de ancho por 6 m de longitud. La parcela útil en todos los cultivos fue de 15 m2. La preparación del terreno para cada cultivo consistió de un paso de arado a 0.30 m de profundidad, seguido de doble rastreo y nivelación con escrepa.

En la Comarca Lagunera, las principales secuencias con especies anuales son maíz-maízavena y sorgo-sorgo-avena; de estas secuencias la de mayor productividad es la primera de ellas, con rendimientos de 40 t ha-1 de MS, 3,689 kg ha-1 de PC y de 234,104 MJ ha-1 de ENL, con una lámina de riego anual de 2 m(2). Con estos patrones de cultivo se produce una gran parte del forraje requerido por el ganado lechero en la región; sin embargo, la baja disponibilidad de agua, la salinidad en el suelo, alta temperatura ambiental y un número limitado de cultivos forrajeros(3), condiciona la búsqueda de nuevas estrategias para la producción de forraje con especies forrajeras alternativas, y el desarrollo de nuevos sistemas de producción con potencial para incrementar la productividad del agua (PA), considerando ésta como la producción de MS y nutrientes por m3 de agua aplicada.

La canola se sembró en seco en los ciclos 20122013 y 2013-2014; en el primero la siembra se realizó el 26 de septiembre de 2012 en las secuencias de cultivo 1, 2, 3 y 4. En el segundo ciclo, la canola se sembró el 25 de septiembre de 2013 en las secuencias 1, 2 y 3; mientras que en la secuencia 4, la siembra se realizó el 5 de octubre de 2013. La siembra se efectuó con una sembradora ‘Brillion’, utilizando 12 kg ha-1 de semilla del híbrido ‘Hyola 401’. A los 15 días después de la siembra (dds) se realizó un aclareo de plantas dejando una densidad de población de 150 plantas m-2. Se aplicó manualmente una fertilización de 200 kg N ha-1 y 60 kg ha-1 de P2O5, utilizando sulfato de amonio y fosfato mono amónico. Antes de la siembra se aplicaron 75 kg N ha-1 y todo el fósforo, incorporando el fertilizante con un paso de rastra; en el primer riego de auxilio se aplicaron 125 kg N ha-1.

Las especies alternativas canola (Brassica napus L.), cártamo (Carthamus tinctorius L.)(3) y mijo perla [Pennisetum glaucum (L.) R. Br](4), por

sus características de precocidad y buena calidad de forraje, junto con especies convencionales como triticale (X Triticosecale Wittmach), cebada (Hordeum vulgare L.) y maíz (Zea mays L.), pueden ser utilizadas para desarrollar sistemas de producción con doble cosecha en otoño-invierno y una en primavera, y así concentrar la producción de forraje en períodos del año donde la temperatura y evapotranspiración son menores. El objetivo de este estudio fue determinar el potencial forrajero y productividad del agua (PA) de secuencias de cultivo alternativas con doble cosecha en otoño-invierno.

398


SECUENCIAS DE CULTIVO ALTERNATIVAS PARA INCREMENTAR EL POTENCIAL FORRAJERO Y PRODUCTIVIDAD DEL AGUA

En canola se aplicó el riego de siembra y un sobre riego seis días después, con 12 y 6 cm de lámina, respectivamente. Durante el ciclo se dieron dos riegos de auxilio a los 30 y 51 dds, con láminas de 13 cm cada uno. La cosecha se realizó a los 7172 dds en el primer ciclo; en el segundo se efectuó a los 72 dds en las secuencias 1, 2 y 3, mientras que en la secuencia de cultivo 4 se cosechó a los 89 dds; en todos los casos cuando la canola alcanzó la fase de floración completa (4.4)(7).

lechoso-masoso a los 106 dds, en tanto que el cártamo se cosechó en la fase de inicio de botón floral, a los 91 dds. En la estación de primavera, el maíz y el sorgo en los testigos (secuencias de cultivo 5 y 6) se sembraron en suelo húmedo el 26 de marzo de 2013 y 2014, utilizando el híbrido de maíz 'Garst 8285' y el sorgo 'Silo Miel'. En maíz se realizó un aclareo de plantas a los 20 dds, dejando una densidad de población de 100 mil plantas ha-1 (37 kg ha-1), mientras que en sorgo se utilizaron 15 kg de semilla ha-1. En las secuencias alternativas se sembraron maíz y mijo perla en suelo húmedo el 29 de abril de 2013. En 2014 el maíz en las secuencias de cultivo 1, 2 y 3 se sembró el 14 de abril, mientras que el mijo perla en la secuencia de cultivo 4 se estableció el 6 de mayo, utilizando la variedad ‘Tifleaf 3’. En la siembra de ambos cultivos, tanto en los testigos como en las secuencias alternativas, se utilizó una distancia entre surcos de 0.76 m. La densidad de población del maíz en las secuencias alternativas fue igual a la utilizada en el maíz del testigo (secuencia 5), mientras que en mijo perla se utilizó una densidad de siembra de 20 kg ha-1.

La avena, en las secuencias de cultivo 5 y 6 se sembró el 26 de octubre en 2012 y 30 de octubre en 2013 con una sembradora de granos pequeños a una densidad de 140 kg ha-1. Se utilizó la variedad ‘Cuauhtémoc’. El método y dosis de fertilización utilizados fueron iguales a los de la canola. Se aplicó el riego de siembra y un sobre riego 11 dds, con 13 y 6 cm de lámina, respectivamente. Durante el desarrollo del cultivo se aplicaron tres riegos de auxilio a los 40, 70 y 92 dds, con 13 cm de lámina cada uno. La cosecha se realizó a los 117 dds, cuando la avena alcanzó la fase de espigado e inicio de formación del grano. En los ciclos 2012-2013 y 2013-2014, la siembra de invierno se realizó en seco con una sembradora para granos pequeños en las parcelas donde se cosechó la canola. Las especies sembradas fueron triticale (secuencias 1 y 4), cebada (secuencia 2) y cártamo (secuencia 3) el 18 y 20 de diciembre de 2012 y 2013, respectivamente. Se utilizó la variedad ‘Río Nazas’ de triticale, ‘San Marcos’ de cebada y ‘Gila’ de cártamo. La densidad de siembra en triticale fue de 140 kg ha-1, en cebada de 120 kg ha-1 y en cártamo de 90 kg ha-1. En cártamo se realizó un aclareo de plantas a los 25 dds, dejando una densidad de población de 100 plantas m-2. En los tres cultivos, los métodos y dosis de fertilización utilizados fueron iguales a los mencionados para canola y avena.

En los dos ciclos de evaluación el maíz y sorgo se fertilizaron con 250 kg N y 80 kg P2O5 ha-1, utilizando sulfato de amonio y fosfato mono amónico como fuentes. El total de fósforo se aplicó en la siembra; mientras que el N se aplicó el 25 % en la siembra, el 50 % en el primer riego de auxilio y el 25 % en el segundo. En mijo perla se aplicó en la siembra 80 kg N ha-1 y 100 kg P2O5, posteriormente se fertilizó con 90 kg N ha-1 en el primer riego de auxilio y 80 kg N ha-1 en el riego de auxilio después del primer corte. El número y calendario de riegos fue el mismo en los dos ciclos de evaluación. Se aplicaron el riego de presiembra y cuatro de auxilio en maíz y sorgo, a los 35, 51, 68 y 85 dds. En mijo perla fueron cinco riegos para los tres cortes, dos para el primero y el segundo, y uno para el tercero. Los riegos se dieron a los 39, 60, 80, 101 y 119 dds. La cosecha de maíz en todos los tratamientos se realizó en la etapa de un tercio de la línea de leche del grano a los 101 dds; mientras que en sorgo se efectuó en grano lechoso. En mijo perla los cortes se realizaron a los 79, 115 y 144 dds en la etapa de antesis.

En triticale y cebada se aplicaron tres riegos de auxilio a los 46, 69 y 91 dds; en cártamo se aplicaron dos riegos de auxilio a los 46 y 69 dds. La cosecha del triticale se realizó cuando el grano estaba en estado lechoso a los 109 dds en la secuencia de cultivo 1, mientras que en la secuencia de cultivo 4 se realizó a los 91 dds en la misma etapa del desarrollo. La cebada se cosechó en la fase de grano

399


David Guadalupe Reta Sánchez, et al. / Rev Mex Cienc Pecu 2017;8(4):397-406

En la estación de verano, en los testigos (secuencias 5 y 6) se establecieron el maíz y el sorgo el 15 y 18 de julio de 2013 y 2014, respectivamente. En maíz se utilizó el híbrido ‘Garst 8285’ con una densidad de siembra de 100 mil semillas ha-1. La siembra se realizó en suelo seco, aplicando el riego de siembra el mismo día. A los 15 dds se realizó un aclareo de plantas, dejando una densidad de población de 90 mil plantas ha-1, ya que existe una menor respuesta a la densidad de población en verano. En sorgo se desarrolló el rebrote del mismo establecido en primavera. El distanciamiento entre surcos, dosis y método de fertilización en maíz y sorgo fueron iguales a los utilizados en la estación de primavera. En ambos cultivos se aplicaron cuatro riegos de auxilio a los 24, 42, 58 y 77 dds con una lámina de riego de 13 cm cada uno. La cosecha se realizó a los 99 dds cuando el grano alcanzó la etapa de un tercio de la línea de leche, y el sorgo durante la etapa de grano lechoso.

porcentaje de MS. En composición química del forraje, se determinó fibra detergente ácido (FDA) y fibra detergente neutro (FDN)(8); N con el método Kjeldahl(9) y el contenido de ENL de acuerdo con las metodologías del Consejo Nacional de Investigación(10). Con estos datos se calcularon los rendimientos de PC y ENL ha-1, multiplicando el contenido de estos nutrientes en el forraje con el rendimiento de MS en cada cultivo y secuencia. Se midió el volumen de agua aplicada en cada secuencia de cultivo, aforando el caudal de agua en las compuertas de los tubos instalados para el riego y considerando el tiempo de riego en cada parcela experimental. La productividad del agua (PA) en las secuencias se estimó con el cociente del rendimiento de MS, PC y ENL entre el volumen total del agua aplicada. Se hicieron análisis de varianza para los datos de rendimiento, productividad del agua en la producción de materia seca y nutrientes de las secuencias de cultivo (P<0.05). El análisis estadístico de todas las variables es presentado por ciclo, ya que las condiciones climáticas en los dos ciclos del estudio fueron diferentes. Para comparar las medias se utilizó la prueba de la diferencia mínima significativa protegida de Fisher (P<0.05). Los datos se analizaron con el programa estadístico SAS(11).

En los cultivos de avena, canola, cebada, triticale y cártamo se realizó el control del pulgón verde (Acyrthosiphon pisum Harris) con Dimetoato 40 EC® (Dimetoato; 0,0-dimetil S-metilcarbamoilmetil fosforoditioato) a una dosis de 1.0 L ha-1; en cada ciclo, se realizó una aplicación a los 50-55 dds. El control de plagas en maíz, sorgo y mijo perla se realizó con dos aplicaciones de insecticidas en cada ciclo de crecimiento; a los 20 dds se aplicó Lorsban 480® (Clorpirifos etil; 0,0-dietil 0-3,5,6- trichloropyridin-2-il fosforotioato) en dosis de 1 L ha -1 para el control de gusano cogollero (Spodoptera frugiperda). Posteriormente, a los 60 dds se aplicó agromectin 1.8 C.E.® (Abamectina; Avermectina B1aC48H72O14 + Avermectina B1bC47H70O14) en dosis de 1.0 L ha-1 para el control de araña roja (Tetranychus spp). En todos los cultivos establecidos en las secuencias de cultivo la maleza se controló en forma manual y con azadón.

RESULTADOS Y DISCUSIÓN

Características estudio

del

clima

durante

el

Durante las estaciones de otoño e invierno se registraron temperaturas máximas y mínimas menores con relación a las estaciones de primavera y verano, en las cuales se alcanzaron las mayores temperaturas durante el ciclo, además de la mayor evaporación potencial (Cuadro 1). La comparación entre los ciclos 2012-2013 y 2013-2014 indica que las temperaturas medias de máximas y mínimas en primavera y verano, respectivamente, fueron mayores en el primer ciclo. La precipitación fue mayor en el segundo ciclo (337.8 mm) que en el primero (254.6 mm), además mostró una mejor distribución, ya que las lluvias ocurrieron en las cuatro estaciones del año.

En la cosecha se determinó en cada cultivo y secuencia de cultivo el rendimiento de forraje fresco, y en una muestra por parcela (1 m2) se obtuvo el porcentaje de materia seca (MS) y la composición química del forraje. Estas plantas se secaron en una estufa de aire forzado a 60 °C hasta peso constante. El rendimiento de MS, se estimó mediante el producto del rendimiento de forraje fresco por el

400


SECUENCIAS DE CULTIVO ALTERNATIVAS PARA INCREMENTAR EL POTENCIAL FORRAJERO Y PRODUCTIVIDAD DEL AGUA

Ciclo de crecimiento química del forraje

y

composición

especie forrajera convencional producida durante las estaciones de otoño e invierno presentó concentraciones de 115.2 g kg-1 de PC, 584.1 g kg-1 de FDN y 5.70 MJ kg-1 MS de ENL. Al comparar la avena con el forraje de los cultivos alternativos de otoño-invierno, canola y cártamo, estos últimos presentaron mayores contenidos de PC (171.3 a 184.2 g kg-1) y menores concentraciones de FDN (407.1 a 493.4 g kg-1). El contenido de ENL en canola

La duración del ciclo de crecimiento y la composición química del forraje de las especies incluidas en las secuencias de cultivo se presentan en el Cuadro 2. Las especies de otoño-invierno canola, cártamo, cebada y triticale fueron más precoces (72-106 días) que el testigo avena (117 días). En composición química la avena como

Cuadro 1. Período de crecimiento (Pcrec) por estación y factores climáticos durante el desarrollo de las especies establecidas en las secuencias de cultivo evaluadas en los ciclos 2012-2013 y 2013-2014 Temperatura media (°C) Máxima Mínima 2012-2013

Precipitación acumulada (mm)

Evaporación potencial (mm)

9.6

28.8

551.9

25.4

7.2

0

636.1

104

33.8

17.5

29.6

657.3

103

32.2

19.7

196.2

557.5

Fecha de siembra

Cosecha

Pcrec (días)

Otoño

26 sept

25 ene

121

25.9

Invierno

18 dic

8 abr

111

Primavera

27 mar

9 jul

10 jul

21 oct

Verano

2013-2014 Otoño

25 sept

24 ene

121

24.5

9.7

148.2

574.3

Invierno

20 dic

8 abr

109

25.4

7.9

37.8

608.2

Primavera

26 mar

11 jul

107

33.0

18.3

73.6

646.2

16 jul

24 oct

100

32.6

19.4

78.2

545.8

Verano

Cuadro 2. Período de crecimiento (Pcrec) y parámetros de la composición química del forraje de cada especie incorporada en las secuencias de cultivo evaluadas en los ciclos 2012-2013 y 2013-2014 Especies

Pcrec (días)

Parámetros de la composición química PC (g kg-1)

FDN (g kg-1)

FDA (g kg-1)

ENL (MJ kg-1 MS)

Avena

117

115.2‡

584.1

356.8

5.70

Canola

72

184.2

407.1

340.0

5.90

Cebada

106

96.7

536.7

343.8

5.83

Triticale

110

115.4

595.8

360.4

5.67

Cártamo

95

171.3

493.4

399.8

5.24

101

68.3

465.5

233.7

7.02

99

69.4

415.1

209.5

7.31

Sorgo primavera

106

59.0

552.1

354.3

5.74

Sorgo verano

100

52.4

591.9

408.2

5.13

Mijo Perla

140

127.7

617.1

376.2

5.48

Maíz primavera Maíz verano

PC= proteína cruda; FDN= fibra detergente neutro; FDA= fibra detergente ácido; ENL= energía neta para lactancia. ‡ ‡ Valores promedio de las parcelas con cada especie evaluada en los ciclos 2012-2013 y 2013-2014.

401


David Guadalupe Reta Sánchez, et al. / Rev Mex Cienc Pecu 2017;8(4):397-406

(5.90 MJ kg-1 MS) fue similar al de la avena; mientras que en cártamo la concentración (5.24 MJ kg-1 MS) fue menor.

bovino lechero, se ha encontrado que su forraje no afectó la producción de leche ni su composición química(16,17). En el presente estudio, los resultados de la composición química de ambos forrajes sugieren que son de buena calidad; sin embargo, es necesario realizar estudios adicionales de consumo y respuesta del ganado lechero para corroborarlo.

En la estación de invierno, el triticale cosechado en grano lechoso presentó una composición química similar a la obtenida en avena; mientras que en cebada cosechada en la etapa de grano lechosomasoso se obtuvieron menores contenidos de PC (96.7 g kg-1), de FDN (536.7 g kg-1) y de FDA (343.8 g kg-1) y un mayor contenido de ENL (5.83 MJ kg-1 MS) que en avena (Cuadro 2).

En la estación de invierno, el contenido de PC en los forrajes de triticale (115.4 g kg-1) y cebada (96.7 g), fue similar a otro estudio realizado en la región(18), 107.0 g en triticale y 104.5 g en cebada, ambas especies cosechadas en la fase de grano lechoso masoso. También comparados con el estudio antes citado, el valor de FDN en el presente estudio en triticale (595.8 g kg-1) fue similar (619.9 g); mientras que en cebada, el contenido de FDN fue mayor (655.4 g) al obtenido en el presente estudio (536.7 g).

En primavera-verano, el maíz registró mayores contenidos de ENL (7.02 a 7.31 MJ kg-1 MS) y PC (68.3 a 69.4 g kg-1), además de menores valores de FDN (415.1 y 465.5 g kg-1) que el sorgo, el cual registró concentraciones de 5.13 a 5.74 MJ kg-1 MS en ENL, de 52.4 a 59.0 g kg-1 en PC y de 552.1 a 591.9 g kg-1 en FDN. El mijo perla cosechado en la etapa de antesis presentó una concentración de PC mayor (127.7 g kg-1) a las observadas en maíz y sorgo, pero con un mayor contenido de FDN (617.1 g kg-1) y menor valor de ENL (5.48 MJ kg-1 MS) (Cuadro 2).

Las características de composición química del forraje en las especies convencionales maíz y sorgo presentaron valores similares o mejores (Cuadro 2) que los encontrados en estudios previos en la región(2,13). Los contenidos de PC fueron bajos, similares a los reportados previamente, de 62.7 a 85.0 g kg-1 en maíz y de 52.6 a 65.3 g en sorgo. En FDN, las concentraciones fueron menores a las obtenidas anteriormente en maíz (488.0 a 649.2 g kg-1) y sorgo (641.3 a 708.4 g), lo cual indica una mejor composición química del forraje en el presente estudio.

Al comparar la composición química del forraje de canola y cártamo con el de la avena, se obtuvieron resultados similares a los observados en estudios previos realizados en la región. En estos trabajos se observó consistentemente una mejor composición química del forraje de canola, con una mayor concentración de PC (159.3 a 240.3 g kg-1) y menor contenido de FDN (390.1 a 466.0 g kg-1) que el obtenido en el forraje de avena, la cual presentó valores de PC de 99.0 a 134.0 g kg-1 y de FDN de 620.0 a 687.4 g kg-1 (2,12,13).

Ciclo de crecimiento y requerimientos de agua en secuencias de cultivo

En otros estudios también se han encontrado ventajas en la composición química del forraje de cártamo respecto a la obtenida en avena, con mayor contenido de PC (175.2 a 185 g kg-1) y menor concentración de FDN (393.0 a 455 g kg-1). Sin embargo, también se han detectado desventajas en el contenido de ENL, ya que en cártamo cosechado en inicio de yema floral, se han observado valores menores (4.52 a 5.82 MJ kg-1 MS) a los de la avena(3,14,15).

Como resultado de la mayor precocidad de las especies alternativas de otoño-invierno, el ciclo de crecimiento de tres de las nuevas secuencias (268282 días) fue más corto que el de los testigos (319324 días); la excepción fue la secuencia que incluyó mijo perla, que tuvo un mayor periodo de crecimiento que los testigos. Además, debido a que dos de las especies en las secuencias alternativas se desarrollaron durante otoño e invierno, las temperaturas medias y los valores de evaporación potencial durante el ciclo, además de las láminas de

En trabajos realizados sobre la utilización de canola y cártamo en la alimentación del ganado

402


SECUENCIAS DE CULTIVO ALTERNATIVAS PARA INCREMENTAR EL POTENCIAL FORRAJERO Y PRODUCTIVIDAD DEL AGUA

riego requeridas por estas secuencias, fueron menores respecto a los testigos (Cuadro 3).

agua (5.7 a 12.8 cm) debido a los mayores requerimientos de agua del mijo perla con los tres cortes durante las estaciones de primavera y verano (Cuadro 3).

Las secuencias alternativas, con doble cosecha en otoño-invierno y maíz en primavera, presentaron un ahorro de agua anual entre 23.8 y 29.3 cm el primer ciclo, y entre 24.0 y 36.0 cm en el segundo, debido al menor requerimiento de agua de los cultivos alternativos de otoño-invierno. En la secuencia Cn-Tcl-Mp se obtuvo un menor ahorro de

Rendimientos de secuencias de cultivo En el Cuadro 4 se presentan los rendimientos de MS, PC y ENL obtenidos en las secuencias de cultivo evaluadas. Entre las secuencias tradicionales,

Cuadro 3. Período de crecimiento (Pcrec), temperatura media (Tmed), evaporación del tanque evaporímetro (Ep) y lámina de riego aplicada (LR) en seis secuencias de cultivo evaluadas durante los ciclos 2012-2013 y 2013-2014 Secuencias de cultivo Av-Mz-Mz Av-Sr-Sr Cn-Tcl-Mz Cn-Cb-Mz Cn-Ctm-Mz Cn-Tcl-Mp

Fechas de

Tmed (°C)

Ep (cm)

LR (cm)

Inicio

Final

Pcrec (días)

2012-2013

26/10/2012

21/10/2013

319

22.3

178.1

204.8

2013-2014

30/10/2013

24/10/2014

322

22.1

176.7

204.2

2012-2013

26/10/2012

21/10/2013

324

22.4

178.1

200.5

2013-2014

30/10/2013

17/10/2014

321

22.1

172.9

199.5

2012-2013

26/09/2012

05/08/2013

281

21.3

158.5

179.2

2013-2014

25/09/2013

24/07/2014

282

21.1

155.1

179.5

2012-2013

26/09/2012

05/08/2013

276

21.3

158.5

181.0

2013-2014

25/09/2013

24/07/2014

279

21.1

153.1

180.2

2012-2013

26/09/2012

05/08/2013

269

21.2

158.5

175.5

2013-2014

25/09/2012

15/07/2014

268

20.8

145.8

168.2

2012-2013

26/09/2012

20/09/2013

327

22.0

183.6

192.0

2013-2014

05/10/2013

19/09/2014

334

21.2

182.1

198.5

Ciclo

Av= avena; Mz= maíz; Sr= sorgo; Cn= canola; Tcl= triticale; Cb= cebada; Ctm= cártamo; Mp= mijo perla.

Cuadro 4. Rendimientos de materia seca (MS), proteína cruda (PC) y energía neta para lactancia (ENL) en seis secuencias de cultivo evaluadas durante los ciclos 2012-2013 y 2013-2014 Rendimientos Secuencias de cultivo

MS (kg

ha-1)

PC (kg ha-1)

ENL (MJ ha-1)

2012-2013

2013-2014

2012-2013

2013-2014

2012-2013

2013-2014

Av-Mz-Mz

35,969 bc

42,814 a

2,945 d

3,274 d

242,107 ab

295,524 a

Av-Sr-Sr

44,070 a

39,220 b

3,059 d

2,507 e

244,099 ab

215,848 c

Cn-Tcl-Mz

34,853 bc

38,841 b

3,574 c

3,993 b

221,446 bc

253,488 b

Cn-Cb-Mz

37,608 b

38,132 b

3,740 bc

3,646 c

249,521 a

245,128 b

Cn-Ctm-Mz

33,790 c

34,577 c

3,870 b

3,937 b

210,895 c

226,371 c

Cn-Tcl-Mp

34,077 c

31,660 d

4,516 a

4,443 a

183,422 d

184,456 d

Av= avena; Mz= maíz; Sr= sorgo; Cn= canola; Tcl= triticale; Cb= cebada; Ctm= cártamo; Mp= mijo perla. abcd Medias

con la misma letra no son estadísticamente diferentes (DMS 0.05).

403


David Guadalupe Reta Sánchez, et al. / Rev Mex Cienc Pecu 2017;8(4):397-406

Av-Mz-Mz registró los mejores rendimientos de MS y nutrientes (P<0.05). El primer ciclo, la secuencia tradicional Av-Sr-Sr obtuvo el mayor rendimiento de MS (44,070 kg ha-1) (P<0.05), sin embargo, su rendimiento de PC (3,059 kg ha-1) y ENL (244,099 MJ ha-1) fueron similares (P>0.05) a la secuencia AvMz-Mz, que produjo rendimientos de 35,969 kg, 2,945 kg y 242,107 MJ ha-1 de MS, PC y ENL, respectivamente. En el segundo ciclo, los rendimientos de MS (42,814 kg), PC (3,274 kg) y ENL (295,524 MJ ha-1) en la secuencia Av-Mz-Mz fueron superiores (P<0.05) a los obtenidos por Av-Sr-Sr, debido a un menor rendimiento de MS del sorgo en el verano (15,070 kg) respecto al obtenido en la misma estación del primer ciclo (21,803 kg). Además, el rendimiento de MS del maíz en primavera (20,145 kg) fue mayor al obtenido en la estación de primavera del ciclo anterior (15,101 kg).

MS, PC y ENL de 89.1 a 90.7 %, 111.4 a 127.0 % y 82.9 a 103 %, respectivamente. Esta respuesta en ambas secuencias alternativas se debió principalmente a los altos rendimientos de MS obtenidos por triticale y cebada en invierno (9,127 - 11,851 kg), además de que los rendimientos de MS de canola en otoño (6,709 - 7,163 kg) no fueron muy variables durante los dos ciclos del estudio. Las secuencias de cultivo Cn-Ctm-Mz y Cn-TclMp fueron sobresalientes en la producción de PC (3,937-4,443 kg ha-1), pero disminuyeron sus rendimientos de 19.2 a 26.0 %, y 23.4 a 37.6 % en la producción de MS y ENL, respectivamente (P<0.05); esto debido a los menores rendimientos de MS del cártamo (7,033 a 7,760 kg) en invierno y mijo perla (15,106 a 16,555 kg) en primaveraverano, además del menor contenido de ENL de ambos cultivos, respecto a los cereales de grano pequeño en invierno, y del maíz en primaveraverano (Cuadro 2).

La fluctuación entre ciclos en el rendimiento de MS de maíz y sorgo modificó la comparación del potencial forrajero de las secuencias alternativas con el potencial de las secuencias convencionales, principalmente en la producción de MS y energía. En la producción de PC, las secuencias alternativas mostraron ventajas (P<0.05) en los dos ciclos del estudio (Cuadro 4), debido principalmente a la mayor concentración de este nutriente en las especies alternativas en relación a las convencionales.

Productividad del agua La PA en las secuencias alternativas respecto a la obtenida en las secuencias convencionales Av-MzMz y Av-Sr-Sr fue variable en los dos ciclos del estudio. En el primer ciclo la PA para MS, PC y ENL en las secuencias alternativas con doble cosecha en otoñoinvierno y una en primavera, fue igual (P>0.05) o superior (P<0.05) a la de los testigos debido a un menor rendimiento de MS en el maíz de la secuencia tradicional, obteniendo la mayor ventaja en la producción de PC (37.8 - 61.5 %) (Cuadro 5).

Los mejores resultados en rendimientos de MS y nutrientes se obtuvieron en aquellas secuencias que incluyeron cebada y triticale en invierno, las cuales obtuvieron en relación a Av-Mz-Mz, rendimientos de

Cuadro 5. Productividad del agua (PA) en la producción de materia seca (MS), proteína cruda (PC) y energía neta para lactancia (ENL) en seis secuencias de cultivo evaluadas durante los ciclos 2012-2013 y 2013-2014 Secuencias de cultivo

MS (kg m-3)

PC (kg m-3)

ENL (MJ m-3)

2012-2013

2013-2014

2012-2013

2013-2014

2012-2013

2013-2014

Av-Mz-Mz

1.65 b

1.99 ab

0.135 d

0.152 c

11.09 b

13.72 a

Av-Sr-Sr

2.06 a

1.86 c

0.143 d

0.119 d

11.38 b

10.25 c

Cn-Tcl-Mz

1.92 a

2.00 a

0.197 c

0.206 a

12.22 b

13.05 ab

Cn-Cb-Mz

2.05 a

1.96 abc

0.204 bc

0.187 b

13.64 a

12.59 b

Cn-Ctm-Mz

1.90 a

1.89 bc

0.218 ab

0.215 a

11.88 b

12.38 b

Cn-Tcl-Mp

1.71 b

1.49 d

0.226 a

0.209 a

9.20 c

8.66 d

Av= avena; Mz= maíz; Sr= sorgo; Cn= canola; Tcl= triticale; Cb= cebada; Ctm= cártamo; Mp= mijo perla. abcd Medias

con la misma letra no son estadísticamente diferentes (DMS 0.05).

404


SECUENCIAS DE CULTIVO ALTERNATIVAS PARA INCREMENTAR EL POTENCIAL FORRAJERO Y PRODUCTIVIDAD DEL AGUA

La secuencia de cultivo con mijo perla registró una PA superior (P<0.05) a los testigos en la producción de PC (58.0 a 67.4 %), sin embargo, en PA para MS, sus valores fueron iguales (P>0.05) a la secuencia con maíz e inferiores en 17.0 % a la de la secuencia de cultivo con sorgo (P<0.05). En la producción de ENL, la secuencia de cultivo con mijo perla mostró valores inferiores (P<0.05) en 17.0 % respecto a la secuencia con maíz y de 19.2 % en relación a la secuencia con sorgo.

secuencias alternativas fueron debido al menor requerimiento de agua y el mayor contenido de PC de las especies alternativas canola, cártamo, mijo perla, triticale y cebada respecto a las especies convencionales. CONCLUSIONES E IMPLICACIONES Las secuencias de cultivo alternativas con doble cosecha en otoño-invierno y la incorporación de especies forrajeras como canola, cártamo, triticale, cebada y mijo perla presentaron ventajas en potencial forrajero y productividad del agua respecto a las secuencias de cultivo tradicionales en la región. Las mejores secuencias alternativas incluyeron canola en otoño, cebada o triticale en invierno, y maíz en primavera, debido principalmente a los altos rendimientos de los cultivos de invierno. Estas secuencias alternativas, con menores valores de temperatura media y de evaporación potencial durante el ciclo, presentaron un menor requerimiento de agua, mayor rendimiento de proteína cruda y mayor productividad del agua en la producción de materia seca y proteína cruda. Sin embargo, también presentaron desventajas en los rendimientos de materia seca y energía neta para lactancia.

En el segundo ciclo, con un mayor rendimiento de MS en el maíz de la secuencia tradicional, el mejor testigo fue Av-Mz-Mz, con valores de PA de 1.99 kg m-3, 0.152 kg m-3 y 13.72 MJ m-3 en la producción de MS, PC y ENL, respectivamente. El testigo Av-SrSr registró menores valores (P<0.05) de PA de MS, PC y ENL en comparación al testigo con maíz, alcanzando disminuciones de 6.5, 21.7 y 25.3 %, respectivamente (Cuadro 5). En todas las secuencias alternativas, el valor de PA para la producción de PC fue superior (23.0 a 41.4 %) a la obtenida por el mejor testigo Av-Mz-Mz (P<0.05). Con excepción de la secuencia que incluyó mijo perla, el resto de las secuencias alternativas presentaron una PA mayor (P<0.05) o similar (P>0.05) al testigo en la producción de MS. En la producción de ENL, sólo la secuencia Cn-Cb-Mz fue superior (P<0.05) al patrón testigo Av-Mz-Mz en el primer ciclo; mientras que en el segundo, únicamente la secuencia Cn-Tcl-Mz presentó valores iguales al testigo Av-Mz-Mz; las otras secuencias alternativas presentaron pérdidas (P<0.05) entre 8.2 y 36.9 %.

AGRADECIMIENTOS Este estudio fue financiado por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias.

Los valores de PA obtenidos por las secuencias convencionales en el presente estudio fueron similares o mayores a los observados en el testigo Av-Mz-Mz en otros estudios realizados en la región, en los cuales se observaron valores de 1.81 a 2.0 kg m-3, 0.12 a 0.18 kg m-3 y de 11.46 a 13.05 MJ m-3 para la producción de MS, PC y ENL, respectivamente(2,13). Estos resultados corroboran las ventajas de las secuencias alternativas observadas en el presente estudio, sobre todo en la producción de PC; los valores de PA obtenidos en este nutriente (0.187 a 0.226 kg m-3) fueron iguales o superiores a los reportados en los estudios anteriores(2,13). Las ventajas observadas en PA en las

LITERATURA CITADA

405

1.

Sanderson MG, Hemming DL, Betts RA. Regional temperature and precipitation changes under high-end (≤4 °C) global warming. Philosophical Transactions of the Royal Society 2011;369:85-98.

2.

Reta SDG, Figueroa VU, Faz CR, Núñez HG, Gaytán MA, Serrato CJS, Payán GJA. Sistemas de producción de forraje para incrementar la productividad del agua. Rev Fit Mex 2010;33 (Núm. Esp. 4):83-87.

3.

Reta SDG, Serrato CJS, Figueroa VR, Cueto WJA, Berumen PS, Santamaría CJ. Cultivos alternativos con potencial de uso forrajero en la Comarca Lagunera. Libro Técnico núm. 3. INIFAP-CIRNOCCELALA. 2008.

4.

Rajaram V, Nepolean T, Senthilvel S, Varshney RK, Vadez V, Srivastava RK, et al. Pearl millet (Pennisetum glaucum (L) R. Br.) consensus linkage map constructed using four RIL mapping


David Guadalupe Reta Sánchez, et al. / Rev Mex Cienc Pecu 2017;8(4):397-406

populations and newly developed EST-SSRs. BMC Genomics 2013;14:159.

en comparación con cultivos tradicionales en el ciclo de invierno. AGROFAZ 2012;12:125-130.

5.

Santamaría CJ, Reta SDG, Faz CR, Orona CI. Reducción del rendimiento potencial en maíz forrajero en calendarios con tres y cuatro riegos. Terra Latinoamericana 2008;26:235-241.

13. Reta SDG, Figueroa VU, Serrato CJS, Quiroga GHM, Gaytán MA, Cueto WJA. Potencial forrajero y productividad del agua en patrones de cultivos alternativos. Rev Mex Cienc Pecu 2015;6:153-170.

6.

Santamaría CJ, Reta SDG, Chávez GJFJ, Cueto WJA, Romero PRJI. Caracterización del medio físico en relación a cultivos forrajeros alternativos para la Comarca Lagunera. Libro Técnico Núm. 2. INIFAP- CIRNOC-CELALA. 2006.

14. Danieli PP, Primi R, Ronchi B, Ruggeri R, Rossini F, Del Puglia S, Cereti CF. The potential role of spineless safflower (Carthamus tinctorius L. var. inermis) as fodder crop in central Italy. Italian J Agr 2011;6:19-22.

7.

Harper FR, Berkenkamp B. Revised growth-stage key for Brassica campestris and B. napus. Canadian J Plant Sci 1975;55:657-658.

8.

Goering HK, Van Soest PJ. Forage fiber analysis (apparatus, reagents, procedures, and some applications). Handbook 379. USDA-ARS, Washington, DC; 1970.

15. Reta SDG, Serrato CJS, Gaytán MA, Quiroga GHM, Orozco HG, Payán GJA. Potencial forrajero del cártamo en respuesta al distanciamiento entre surcos en la Comarca Lagunera. AGROFAZ 2014;14:65-71.

9.

16. Landau S, Friedman S, Brenner S, Bruckental I, Weinberg ZG, Ashbell G, et al. The value of safflower (Carthamus tinctorius) hay and silage grown under Mediterranean conditions as forage for dairy cattle. Livest Prod Sci 2004;88:263-271.

Bremner JM. Nitrogen-total. In: Sparks DL editor. Methods of soil analysis. Madison, WI: SSSA Book Ser 5; 1996:1085-1121.

17. Kincaid RL, Johnson KA, Michal JJ, Huisman AC, Hulbert SH, Pan WL. Case study: production of silage containing biennial canola and peas for use as forage in a dairy ration. Profess Anim Scient 2012;28:120-124.

10. NRC, National Research Council. Nutrient requirements of dairy cattle. Washington, DC: National Academy Press; 2001. 11. SAS Institute. SAS user’s guide. Statistics, version 6.0. 4th. Ed. Cary, NC; 1990.

18. Núñez HG, Faz CR, Martínez RJG. Sistemas de producción de triple cosecha anual de forraje para la región Lagunera. AGROFAZ 2007;7:1-12.

12. Cruz CJJ, Núñez HG, Faz CR, Reta SDG, Serrato MHA. Potencial forrajero y eficiencia de uso del agua de canola (Brassica napus L.)

406


Rev Mex Cienc Pecu 2017;8(4):407-417

http://dx.doi.org/10.22319/rmcp.v8i4.4160

Avances sobre nutrición y fertilidad en ganado lechero: Revisión Advances on nutrition and fertility in dairy cattle: Review Pedro Meléndeza*, Julián Bartoloméb

RESUMEN En esta revisión se analizan los últimos antecedentes sobre la relación entre la nutrición y fertilidad en ganado lechero. Se establece la importancia de los niveles sanguíneos de glucosa en el postparto temprano y su relación con la fisiología de algunas hormonas tales como la insulina, IGF-I y somatotrofina. Se resalta la importancia de la inmunosupresión de la vaca durante el periparto y su relación con el exceso de tejido adiposo que establece un estado pro-inflamatorio característico asociado con la aparición de enfermedades metabólicas y reproductivas, que afectan el rendimiento productivo y la fertilidad del ganado lechero. PALABRAS CLAVE: Nutrición, Fertilidad, Preparto, Postparto, Enfermedades.

ABSTRACT In this review, new advances on the relationship between nutrition and fertility in dairy cattle are presented. The importance of glucose levels in the early postpartum and its relationship to the physiology of some hormones such as insulin, IGF-I and somatotropin are established. The importance of immunosuppression around parturition and its relationship with the excess of adipose tissue that institutes a characteristic pro-inflammatory state is highlighted. Immunosuppression is associated with the onset of metabolic and reproductive diseases affecting productivity and fertility of the dairy herd. KEY WORDS: Nutrition, Fertility, Periparturient diseases, Postpartum, Prepartum.

Recibido el 13 de abril de 2016. Aceptado el 21 de junio de 2016. a Department of Veterinary Medicine & Surgery. University of Missouri, Estados Unidos. b Facultad de Medicina Veterinaria. Universidad Nacional de la Pampa. Argentina. *Autor de correspondencia: melendezp@missouri.edu

407


Pedro Meléndez, et al. / Rev Mex Cienc Pecu 2017;8(4):407-417

INTRODUCCIÓN

80 L/día. Desafortunadamente, la capacidad de consumo de alimento de esta vaca es limitada como para cubrir este nivel de producción y el animal debe recurrir a sus reservas corporales(4,5). Al mismo tiempo, el animal debe priorizar aquellos procesos fisiológicos vitales. En este caso, los procesos reproductivos son secundarios para el animal cuando se trata de producir leche(6). Los efectos de una nutrición inadecuada puede afectar la condición corporal (CC), aumentar la incidencia de anestro y disminuir las TC(7-10).

Los pilares fundamentales de cualquier sistema de producción animal son la nutrición, reproducción, sanidad, bienestar animal, genética y recursos humanos. Ellos se interrelacionan íntimamente y determinan la eficiencia productiva y la rentabilidad del sistema. La relación entre la nutrición y la fertilidad ha sido ampliamente estudiada en todo el mundo y aun continua siendo un área de considerable investigación. Una adecuada fertilidad no se verá expresada si la nutrición y el manejo alimentario son sub-óptimos. En esta revisión se abordarán algunos aspectos básicos y generales que caracterizan esta relación en el ganado bovino lechero. Particular énfasis se indicará cuando haya diferencias marcadas entre hatos manejados en confinamiento o en base a pastoreo.

Los sistemas de producción en base a pastoreo se establecen en regiones donde las condiciones ambientales permiten buen crecimiento de praderas, y el costo de oportunidad por el uso de la tierra es bajo. En este escenario, el manejo nutricional de las vacas a pastoreo se va a ver influenciado principalmente por la carga animal. El desafío es lograr la carga animal óptima que logre la mayor producción por vaca y por hectárea, sin afectar los procesos reproductivos, la salud y el bienestar de las vacas(11,12). La evaluación de los sistemas productivos se debe basar más en los sólidos (kilogramos) que los litros de leche producidos (litros o kilogramos), ya que la adición de agua a la leche tiene un costo adicional. Por ejemplo, una vaca que produce 500 kg de grasa en un volumen de 5,000 kg de leche, va a ser más eficiente que una vaca que produce la misma cantidad de grasa en 7,500 kg de leche. Esto es debido a que la segunda vaca requiere sintetizar 120 kg adicionales de lactosa (2,500 kg de leche x 48 g de lactosa)(12). Debido a que la disponibilidad y el valor nutritivo de la pradera varía a través del año, el manejo reproductivo de la vaca lechera se deberá acomodar a las características de crecimiento y calidad de la pradera a través del año(13).

Conceptos básicos La fertilidad es un concepto amplio y complejo y sus indicadores son muy variados y relativos de interpretar. El indicador más certero, que abarca a la mayoría de ellos, es la tasa de preñez (TP) cada 21 días, y refleja el riesgo de una vaca de preñarse en 21 días. Puede estimarse multiplicando la tasa de detección de celos por la tasa de concepción (TDC x TC). Este indicador es ideal para sistemas continuos y con inseminación artificial (IA), y más difícil de interpretar en hatos que usan monta natural y que además concentran sus pariciones, típico de sistemas de pastoreo. Una nutrición óptima se verá reflejada en una mayor TP siempre y cuando el bienestar del animal y el manejo general sea el adecuado(1). El manejo nutricional se debe enfocar hacia una óptima producción de leche, sin descuidar la sanidad y la fertilidad del animal. Cuando se alimenta solo para optimizar la producción de leche, la fertilidad se puede ver deteriorada. Esta relación inversa ha sido reportada en forma consistente(2,3).

Efecto de los nutrientes esenciales sobre la producción de leche y fertilidad Los aspectos nutricionales a considerar para optimizar la producción de leche y la fertilidad del ganado lechero son la energía, la fibra, la proteína, los minerales, las vitaminas y el agua de bebida.

Debido al avanzado progreso genético, las vacas lecheras en la actualidad pueden incluso llegar a producir cantidades de leche inimaginables para el ser humano. En la raza Holstein, por ejemplo, se han reportado producciones de hasta más de 15,000 kg de leche por lactancia o 50 kg de leche/vaca/día en promedio, con producciones al pico de lactancia de

La energía es un concepto abstracto, pero que se puede entender analizando las reservas corporales a través del depósito de tejido graso en

408


AVANCES SOBRE NUTRICIÓN Y FERTILIDAD EN GANADO LECHERO: REVISIÓN

zonas anatómicas estratégicas, tales como la base de la cola, la zona de la pelvis y los procesos transversales de las vértebras lumbares y costillas del animal. Estas reservas grasas se conocen como CC, y su estimación se ha utilizado como una herramienta simple que permite evaluar la nutrición energética del animal. La más utilizada es la escala de 1 a 5 con incrementos de ¼ de punto, siendo el valor 1 un animal emaciado y el valor 5 un animal extremadamente obeso(14). Durante el ciclo productivo la vaca lechera debe parir con una CC de 3.25 a 3.5 y no bajar a menos de 2.5 a los 60 a 90 días en leche. Si el animal pierde más de una unidad entre el parto y los 100 días en leche, verá comprometida su fertilidad(15,16). La pérdida en CC durante el postparto es un fenómeno normal, debido a que los requerimientos son mayores a los aportes ofrecidos por la dieta y al nivel de consumo de alimento del animal. Así, la vaca debe recurrir a sus reservas corporales para suplir la deficiencia dietaria y de consumo de alimentos. No obstante si la CC al parto es extremadamente baja el animal no podrá expresar su máximo potencial productivo, y si es excesivamente alta (obesidad) el animal tendrá problemas de distocia, menor consumo de alimento y mayor incidencia de enfermedades metabólicas tales como hígado graso y cetosis(13,17-21). Después del pico de producción, la leche empieza a disminuir en forma paulatina, y el animal es capaz de consumir mayores cantidades de alimento. Así, la vaca comienza a recuperar la CC que se perdió durante el postparto. Si la vaca se ha preñado se debe secar a los siete meses de gestación, para dar un descanso y preparación de dos meses a la glándula mamaria para la siguiente lactancia. El animal debería ser secado con una CC 3.0 a 3.25 y recuperar en 2 meses ¼ de CC necesaria para llegar con una condición al parto de 3.25 a 3.5. El animal nunca debe perder CC durante el periodo seco. En el caso de buscar recuperar CC durante el periodo seco en vacas que se secan muy delgadas (CC ≤ 2.75) se recomienda la aplicación de un bolo intraruminal de liberación lenta de monensina(1,22). Además, durante los últimos 21 días de gestación se debe empezar la adaptación del animal a las condiciones de producción y dietas altamente energéticas que recibirá después del parto(15,23,24).

La proteína es un nutriente que debe ser considerado tanto en cantidad como en calidad. Una vaca requiere proteína tanto degradable como no degradable en el rumen. La proteína es esencial para la producción de leche, ya que el animal requiere de aminoácidos esenciales para la síntesis de caseína y otras proteínas menores de la leche(25). Tanto la deficiencia como un exceso de proteína tienen un impacto negativo en la fertilidad del ganado bovino lechero. Una deficiencia va a afectar dramáticamente la producción de leche, pero también la fertilidad del animal. Un exceso de proteína también ha demostrado ser detrimental para la fertilidad de las vacas en producción(26,27). Todo exceso de proteína es finalmente eliminado vía excremento o convertido en urea en el hígado del animal. La urea puede ser reciclada hacia el rumen del animal y reutilizada para la síntesis de proteína microbiana. No obstante, el exceso de urea podría ser tóxico para el ambiente uterino y oviducto, afectando tanto los gametos como el embrión, con la consiguiente reducción en fertilidad. Un exceso relativo de proteína también puede ocurrir cuando la dieta es deficiente en energía. Esto se va a traducir en mayores producciones de amonio ruminal y urea en el cuerpo del animal, produciendo el mismo efecto negativo mencionado(28). El tópico sobre el exceso de urea y su impacto negativo en fertilidad ha sido muy controvertido. En algunos estudios se ha demostrado que valores de nitrógeno ureico en leche (46 % de la urea) mayores a 16 a 19 mg/dl, sobre todo en los meses de verano, se han asociado con fertilidad reducida(26); no obstante otros estudios no han encontrado esta asociación negativa(29). Últimamente se ha dilucidado que la correlación fenotípica entre el nitrógeno ureico en leche y la fertilidad es casi cero, e incluso la correlación genotípica entre ambas características es levemente positiva, sugiriendo que niveles elevados de urea en leche se asocian a niveles elevados de fertilidad en el ganado lechero(30). Por lo tanto, independientemente de la asociación entre urea y reproducción, la nutrición proteica debe ser balanceada en calidad y cantidad, incluyendo el balance aminoacídico, y debe ir acompañada de un aporte energético suficiente para optimizar la síntesis proteica microbiana a nivel ruminal(31).

409


Pedro Meléndez, et al. / Rev Mex Cienc Pecu 2017;8(4):407-417

Los minerales son importantes componentes estructurales, de enzimas, y cofactores que permiten que el organismo funcione en forma adecuada, incluyendo los procesos reproductivos. Los minerales se requieren en cantidades absolutas y el principal obstáculo es conocer el porcentaje del mineral consumido que es absorbido y utilizado por parte del animal. En general los microminerales son más difíciles de balancear en condiciones prácticas de manejo nutricional y por ende se manejan en forma de premezclas, tanto añadidas a la dieta total como en comederos especiales donde el animal consume a voluntad(25). Los micro minerales con cierto rol directo en los procesos reproductivos son el Zn, Se, Cu, Co y Mn. En caso de deficiencias o excesos se han reportado casos de abortos, mortalidad embrionaria, anestro, y quistes ováricos(32,33). Al igual que los minerales, las vitaminas son nutrientes esenciales que se requieren en cantidades pequeñas. Las vitaminas A, D y E deben ser aportadas en la dieta porque el animal no las sintetiza; en cambio las vitaminas del complejo B y la vitamina C pueden ser producidas por los microorganismos del rumen, y por lo tanto, solo requieren ser aportadas en situaciones extremas de producción de leche(25). Las vitaminas A y E son muy importantes para los procesos reproductivos (retención de membranas fetales, mortalidad embrionaria, repetición de calores, etc.), sobre todo relacionado al estrés oxidativo que ocurre durante el periparto(23,34). En general las vitaminas son ofrecidas en forma de premezclas en conjunto con los minerales. También se pueden inyectar si esto es necesario(25). Aunque la energía, fibra y proteína se encuentren balanceadas y aportadas adecuadamente, la respuesta productiva del animal, salud y fertilidad no serán óptimas si descuidamos los minerales y las vitaminas. De este punto se desprende que quizás el método que más se adecua a aportar una dieta balanceada en todos los nutrientes, son las dietas completas ofrecidas por un carro mezclador. Si la dieta se prepara debidamente y se ofrece en forma homogénea, el animal podrá consumir todos los nutrientes sin poder seleccionar a su gusto. Desafortunadamente, en sistemas pastoriles, los concentrados ofrecidos en la sala de ordeño o sobre los forrajes en comederos, no permiten un consumo homogéneo de todos los nutrientes, lo cual puede

desfasar la fermentación ruminal y a ciertos disturbios digestivos, tales como acidosis ruminal, deficiencia en la síntesis de proteína microbiana, indigestiones simples, etc.(35) Es por esto que el sistema ideal para animales a pastoreo, sería suplementación con una ración completa antes o después del ordeño, sobre todo en otoño e invierno, mínima cantidad de concentrado en sala y luego la pradera para complementar lo que falta. A pesar de existir una asociación negativa entre producción de leche y fertilidad, se debe enfatizar que no es una relación de causa y efecto, y por ende hay situaciones en que hatos bien manejados pueden presentar niveles productivos extremadamente altos (42 a 44 L promedio por vaca al día) con TP sobre el 20 %(3,36). En un estudio de California, EE.UU.(37), se analizaron más de 6,400 vacas en producción y se observó que aquellas vacas en el cuartil inferior de producción (32 kg/día) presentaron una menor probabilidad de estar ciclando a los 65 días postparto que vacas que se encontraban en el cuartil 2 (39 kg/día), 3 (43,6 kg/día) y 4 (50 kg/día) de producción de leche, por lo tanto se concluyó que los factores de manejo pueden ser más limitantes para la fertilidad de vacas lecheras contemporáneas que su nivel genético per se. Las vacas de alta producción son más susceptibles a desórdenes de tipo metabólico y enfermedades durante el periparto(1). Estas enfermedades se asocian a mayores pérdidas de CC durante el postparto, y elevados niveles de ácidos grasos no esterificados (NEFA) al parto. Estas son vacas que presentan una marcada inmunosupresión, con mayores incidencias de retención de membranas fetales, metritis, mastitis, hipocalcemia e hipomagnesemia, cetosis, desplazamientos del abomaso e hígado graso. Además son animales que se tardan más en normalizar su ciclicidad postparto, con una TC reducida y por ende una tasa de preñez disminuida(3,13,16,28,38-42). Aquellas vacas que logran adaptarse en forma exitosa desde su estado preparto al proceso de lactancia y que pueden evitar desbalances metabólicos y fisiológicos, van a ser capaces de sostener una alta producción de leche y lograr una fertilidad y salud adecuada. Por lo tanto aquellas vacas de alta producción y que presentan problemas

410


AVANCES SOBRE NUTRICIÓN Y FERTILIDAD EN GANADO LECHERO: REVISIÓN

de fertilidad, se puede atribuir a un balance energético negativo más severo, debido a un inadecuado manejo del periodo de transición o a un incremento en la incidencia de enfermedades del periparto(21,43,44).

y 20 %, respectivamente(44,45). En concordancia con estos resultados, en un estudio realizado en el sur de Chile(46), las vacas que fueron sometidas a un pastoreo más intensivo y menor suplementación de concentrado, presentaron mayores concentraciones de NEFA y perdieron más CC que vacas que consumieron menos forraje y fueron suplementadas con más concentrado. Por otra parte, en un estudio llevado a cabo en Irlanda(11), en hatos con partos de parición de primavera, tanto la probabilidad de IA como de concepción se asociaron en forma positiva con el mínimo valor de CC (nadir) alcanzado durante el postparto, y la CC durante la época de montas o IA. Por lo tanto, una CC adecuada al parto (3.0 a 3.5) y una pérdida de CC postparto de menos de 0.5 puntos se asocian con un mejor rendimiento reproductivo y fertilidad en ganado lechero a pastoreo(12,17).

En el caso de los sistemas a pastoreo, donde el objetivo es hacer coincidir requerimientos con aportes de la pradera, un 90 % del rebaño debería parir en un periodo de 12 semanas a finales de invierno y principios de primavera. Este es el típico sistema mono estacional neozelandés, que también se lleva a cabo en muchos países de Latinoamérica. Para lograr el objetivo planteado se debe lograr que: (i) todas las vacas hayan parido antes de iniciarse la época de servicio; (ii) ≥70 % de las vacas estén ciclando al inicio del servicio; (iii) ≥90 % de las vacas deberían entrar en un programa de IA a tiempo fijo (IATF) en los primeros 21 días del periodo de servicio; (iv) la TP para las primeras seis semanas debería ser ≥70 % y para las 12 semanas de ≥90 %; (v) la duración del servicio ≤12 semanas. Bajo este escenario, claramente las vacas deben recuperar prontamente su ciclicidad postparto y tener una alta probabilidad de establecer y mantener la preñez después de la monta o IA(12,15).

Efecto del estatus metabólico postparto sobre la reproducción El estado metabólico postparto, algunas hormonas y ciertos factores de crecimiento tienen un rol fundamental sobre los procesos reproductivos de la vaca lechera. Concentraciones en sangre reducidas de insulina, IGF-I, leptina y glucosa y concentraciones en sangre elevadas de BHB, NEFA y glucocorticoides se han asociado con un rendimiento reproductivo reducido y una mayor presencia de enfermedades en ganado lechero(15,39,43). Sin embargo, se ha dilucidado que al seleccionar genéticamente por fertilidad, no hay una asociación directa con una mejora en el balance energético postparto de la vaca, a pesar de haberse encontrado diferencias en algunos metabolitos y hormonas, sugiriendo que el estado metabólico intrínseco dentro de la vaca es más importante que las diferencias observadas en su balance energético postparto(3,10,12). Así, se ha visto en ganado lechero que el IGF-I comienza a disminuir dos semanas antes del parto, y se acompaña con una disminución de la insulina e incrementos en los niveles de la hormona de crecimiento. Esta última, se asocia con una serie de cambios metabólicos en la vaca lechera, incluyendo una reducción en la sensibilidad de los tejidos a la insulina, incremento en la gluconeogénesis hepática y reducción del uso de glucosa en los tejidos, exceptuando la glándula mamaria(43,47).

Signos generales de nutrición inadecuada Balance energético y condición corporal. El balance energético postparto es uno de los factores más significativos que influyen el estado reproductivo de los hatos lecheros. En general las vacas durante el postparto temprano pierden entre un 30 a 40 % de su CC, pero en casos extremos pueden llegar a perder hasta un 80 % de las reservas corporales bajo situaciones de un mal manejo nutricional(12,15). En general, las vacas manejadas bajo pastoreo son más delgadas, ya que pierden más CC durante el postparto que vacas manejadas bajo confinamiento y alimentadas con raciones completas. Esta conclusión se corrobora con estudios llevados a cabo en la Universidad de Florida en hatos a pastoreo, donde la incidencia de vacas con ≥0.7 mM de NEFA y ≥0.96 mM de betahydroxi-butirato (BHB) durante el periodo postparto fue de 20 y 35.4 % respectivamente, siendo que en hatos confinados los valores no sobrepasaron el 15

411


Pedro Meléndez, et al. / Rev Mex Cienc Pecu 2017;8(4):407-417

Es bien sabido que el balance energético negativo en el postparto de la vaca lechera se asocia a una reducción en los pulsos de GnRH y LH, afectando el crecimiento, maduración y ovulación del folículo. Por otro lado, las vacas de alta producción tienen un mayor flujo sanguíneo y un metabolismo hepático más acelerado, que determina una desaparición más rápida de las hormonas reproductivas, afectando la calidad del ovocito y desarrollo del embrión. Además, la reducción en los niveles de estradiol deprimen la expresión del celo y los de progesterona (P4) se asocian a mayor mortalidad embrionaria(48-50).

hipoglicemia a nivel hipotalámico se ve potenciado por altos niveles de estrógenos, indicando que el efecto “feedback” (-) per se de los estrógenos sobre la liberación de LH se potencia con niveles bajos de glucosa sanguínea(43). Durante la lactancia temprana, aquellas vacas con un elevado mérito genético para características de fertilidad, presentaron mayores concentraciones de glucosa circulante que vacas con menor mérito genético(10). Esta asociación se ha corroborado en un estudio, donde se reporta que las concentraciones de glucosa plasmática fueron mayores durante la primera semana postparto en aquellas vacas que se preñaron a la primera IA, comparado con aquéllas que fallaron al primer servicio(52).

El rol de la glucosa La glucosa ha tenido un especial interés en los últimos años como un metabolito clave en los procesos reproductivos de la vaca lechera. Una vaca lechera típica Holstein americana de alto mérito genético que produce 70 kg de leche al pico de lactancia, requiere de 5 kg de glucosa al día. Los rumiantes permanecen en un constante estado de gluconeogénesis a nivel hepático, ya que la mayoría de los carbohidratos son fermentados a ácidos grasos volátiles (AGV) en el rumen y el propionato es la base fundamental para la producción de glucosa a nivel del hígado. No obstante, los AGV solo aportan el 85 % de la glucosa requerida y el resto debe provenir de algunos aminoácidos, lactato y glicerol, que está disponible cuando los NEFA son liberados a circulación. Además, la vaca cuenta con otros mecanismos tales como un estado temporal de insulino-resistencia, permitiendo solo a los tejidos que son independientes de insulina a utilizar la glucosa, como es la glándula mamaria. En este sentido, la vaca en postparto permanece en un estado de bajos niveles de glucosa, bajos niveles de insulina, IGF-I, y altos niveles de NEFA y BHB(1,5,15,51,52).

También se ha observado que la glucosa es crítica para una adecuada maduración del ovocito, afectando la expansión del cumulo, la maduración nuclear, la división celular y el subsecuente desarrollo del blastocito(54-56). Lo mismo se ha observado con un elevado nivel de NEFA sanguíneo que pueden afectar negativamente la fisiología del ovario, el folículo y el futuro embrión(43,57). El efecto beneficioso de la glucosa en el postparto temprano sobre la reproducción, solo se puede analizar como una asociación y no como mecanismo de causa y efecto. Esto se debe a que la glucosa se relaciona a muchos mecanismos metabólicos y hormonales que pueden enmascarar su efecto per se sobre la fertilidad. De hecho, los niveles de glucosa al momento de la primera IA ya no se asocian a las respuestas reproductivas de la vaca(43,52).

El rol de la insulina Las concentraciones sanguíneas de insulina en ganado lechero se encuentran reducidas en animales con balance energético negativo, tanto en vacas a pastoreo como confinadas y en vacas bajo estados de subnutrición(12). En la medida que la lactancia progresa, los niveles de insulina incrementan y los de la hormona de crecimiento disminuyen(58). El eje somatotrófico, que incluye a la hormona de crecimiento, sus receptores y el IGF-I se encuentra desacoplado en vacas de alta producción durante el postparto temprano, por lo tanto el hígado no responde a los efectos de la

En ganado a pastoreo, los niveles de glucosa sanguínea también son menores en vacas de mayor producción que en vacas de menor producción(53). La glucosa es fundamental para la producción y liberación de GnRH a nivel hipotalámico. Se ha demostrado que al inhibir la glicolisis a nivel neuronal, resulta en una menor frecuencia de los pulsos de LH producto de una inhibición en la síntesis de GnRH. Además, el efecto negativo de la

412


AVANCES SOBRE NUTRICIÓN Y FERTILIDAD EN GANADO LECHERO: REVISIÓN

El rol de la leptina

hormona de crecimiento y por ende se produce una menor cantidad de IGF-I. Este desacoplamiento se entiende en el contexto del proceso de la “partición de nutrientes” que permite una mayor producción de leche, afectando la reproducción en forma negativa(43). En el caso de hatos con parición continua durante el año, se puede tolerar cierta ineficiencia reproductiva, debido a que la vaca puede tener muchas más oportunidades de ser cubierta y obtener una preñez. Sin embargo, en hatos a pastoreo con parición estacional, una baja TC va a aumentar el número de animales eliminados que no se preñan durante la temporada de servicios establecida(47,59).

Esta hormona proteica de 167 aminoácidos, producida esencialmente por los adipocitos, juega un rol fundamental en la modulación nutricional y metabólica de los tejidos. La leptina se ha llegado a asociar a mayores concentraciones séricas de gonadotrofinas. Durante el postparto temprano los niveles sanguíneos de leptina se encuentran reducidos debido al balance energético negativo y movilización grasa que ocurre en este periodo. No obstante el rol de la leptina en la regulación de los procesos reproductivos en ganado lechero aún no se ha dilucidado por completo(12).

El rol de los NEFA, BHB y triglicéridos hepáticos

La insulina también juega un rol fundamental en la esteroidogénesis ovárica, estimulando receptores tanto a nivel de células de la granulosa, como de los tejidos tecales y del estroma ovárico. Durante la lactancia temprana, también se ha visto que las vacas seleccionadas genéticamente por una alta fertilidad presentan mayores concentraciones de insulina en comparación a vacas con un mérito genético inferior. Consecuentemente, la insulina estimula la síntesis de IGF-I en vacas lecheras durante el inicio de la lactancia(12,43,58).

La típica movilización grasa postparto se traduce en mayores concentraciones de NEFA. Los NEFA son captados por el hígado, los cuales son parcial o totalmente oxidados a nivel mitocondrial o re-esterificados en los hepatocitos a triglicéridos. Un exceso de NEFA a nivel hepático resulta en una acumulación neta de triglicéridos hepáticos, debido a la exportación disminuida de triglicéridos en la forma de lipoproteínas de muy baja densidad, clásica en bovinos. La oxidación parcial de los NEFA acompañada con bajos niveles de glucosa sanguínea, se traduce en una mayor síntesis de cuerpos cetónicos, principalmente BHB, debido a la falta de oxaloacetato a nivel de ciclo de Krebs. Tanto los niveles elevados en sangre de NEFA, como de BHB y la acumulación excesiva de triglicéridos en el hígado se asocia a alta/baja infertilidad(5,15). Esta asociación negativa se puede deber a una mayor incidencia de enfermedades del periparto que experimentan las vacas con altos niveles de NEFA. Un estudio llevado a cabo en la zona central de Chile reportó que vacas con altos niveles de NEFA al parto tuvieron mayor incidencia de retención de membranas fetales y mastitis, y éstas a su vez están asociadas con infertilidad y mortalidad embrionaria en el ganado lechero(39,62). De la misma forma, en un estudio llevado a cabo en el sur de Chile se observó que la suplementación con cebada en vacas a pastoreo resultó en menor concentración de BHB y mayor de glucosa durante el postparto, los cuales son factores determinantes para una buena

El rol del IGF-I El IGF-I es estructuralmente similar a la proinsulina y es un potente péptido/hormona proteica de tipo anabólica, la cual refleja el estado nutricional de un animal(58). El IGF-I afecta el crecimiento y maduración folicular, demostrando estar íntimamente asociado a la tasa de concepción tanto en animales en confinamiento como animales a pastoreo(2,60). Vacas con concentraciones de IGF-I durante la primera semana postparto >25 ng/ml y durante el primer servicio >50 ng/ml tuvieron 11 y 5 veces más probabilidades de preñarse, respectivamente, que aquellas vacas con una menor concentración(61). Vacas a pastoreo seleccionadas genéticamente por alta/baja fertilidad, presentaron mayores concentraciones de IGF-I. En este contexto, tanto la insulina como el IGF-I son indicadores metabólicos críticos para la fertilidad postparto de la vaca lechera. Ambas péptidos/hormonas proteicas se encuentran reducidas en vacas con balance energético negativo severo(43).

413


Pedro Meléndez, et al. / Rev Mex Cienc Pecu 2017;8(4):407-417

fertilidad del ganado en el primer tercio de lactancia(63).

como el riñón o grasa intra-abdominal mesentérica y omental, juega un rol inmunológico, y mecánico protectivo fundamental. Una vez estimulado, el adipocito libera NEFA y citoquinas proinflamatorias. Así, la obesidad y el envejecimiento se asocian con activación inmunitaria del tejido graso y liberación de citoquinas, tales como el factor de necrosis tumoral, la interleuquina 1 y 6, alteración de la sensibilidad a la insulina y lipolisis. Este estado se conoce como inflamación sistémica “esteril“ (no infeccioso), con desregulación metabólica y lipotoxicidad. Vacas obesas al parto presentarán no solo mayor incidencia de problemas metabólicos, sino también problemas de tipo inflamatorioinfeccioso(68,69).

En el caso de vacas postparto a pastoreo que presentaron valores de NEFA ≥0.7 mM tuvieron una menor probabilidad de estar ciclando a los 50 días postparto y de preñarse a la primera IA posparto(64). Lo mismo se ha reportado en hatos manejados bajo estabulación total(45,65). Así, se observó que por cada 0.1 mM de aumento en el BHB sanguíneo a la semana 1 y 3 postparto, la proporción de vacas preñadas se redujo en un 2 y 3 %, respectivamente(20). Por otro lado, también se reportó que la TP de un ciclo de 21 días se redujo en un 0.9 % en aquellos hatos que presentaron más de un 15 % de las vacas muestreadas con valores de NEFA ≥0.7 mM durante el periodo posparto(45).

El rol del calcio y la salud uterina postparto

Tanto los NEFA como el BHB inducen a inmunosupresión a través de la reducción en la fagocitosis y la capacidad oxidativa de los neutrófilos. También se ha observado que estos dos metabolitos se asocian a un retardo de la involución uterina y mayor incidencia de metritis, relacionado a una alteración de la expresión de genes claves en la recuperación del endometrio(18,41,66).

El rol del calcio ionizado sobre la musculatura lisa y estriada es fundamental para un adecuado proceso de transición(70). En un estudio estadounidense se observó que un 25 % de las vacas primíparas y más de un 50 % de las vacas multíparas, experimentan un estado de hipocalcemia subclínica (Ca total <8.0 mg/dl) durante las primeras 48 h posparto(71). Estos niveles deprimidos de calcio afectan la contractibilidad del miometrio y la actividad fagocitaria y bactericida de los neutrófilos, con un mayor riesgo de desarrollarse retención de membranas fetales y metritis puerperal(38,70,72).

El rol del sistema inmune El sistema inmune de la vaca en transición se deprime en forma inherente al parto, sobre todo cuando se alcanza un máximo nivel de estrés, que es el proceso de parto del animal. Sin embargo, bajos ciertas situaciones, esta depresión puede ser mucho más severa y por ende puede significar el desarrollo de enfermedades infecciosas típicas del periparto, tales como la mastitis, metritis y neumonías(23,67).

Mecanismos que ligan el metabolismo con los procesos reproductivos Son dos los procesos fundamentales que se deben reestablecer adecuadamente durante el postparto, para lograr una fertilidad satisfactoria y que se asocian íntimamente a los mecanismos metabólicos de la vaca: el restablecimiento de la ciclicidad posparto y la involución del útero(15,41,43).

Los factores de tipo metabólico que se han asociado a una mayor depresión del sistema inmune de la vaca periparto son el exceso de las concentraciones plasmáticas de NEFA y cuerpos cetónicos durante el postparto. Junto con aquello, se sabe hoy en día que el tejido adiposo además de almacenar energía tiene un rol mecánico, regenerativo, endocrino e inmunológico bien determinado(67,68). El tejido adiposo bajo la epidermis y sobre todo el que rodea a órganos vitales, tales

Existe una asociación directa entre los niveles de insulina y del IGF-I con el momento del inicio de la ciclicidad posparto. En el ovario, tanto la insulina como el IGF-I promueven la proliferación, diferenciación y sobrevida de las células foliculares, y a su vez estas hormonas se asocian directamente con los niveles sanguíneos de glucosa. Además, estos metabolitos se relacionan con un adecuado

414


AVANCES SOBRE NUTRICIÓN Y FERTILIDAD EN GANADO LECHERO: REVISIÓN

CONCLUSIONES

nivel de gonadotrofinas a nivel hipofisario y GnRH a nivel hipotalámico, las cuales ejercen su efecto positivo sobre las estructuras del ovario(43,58). Por otro lado, el estatus metabólico y hormonal del posparto temprano se asocia a una inmunosupresión típica que afecta los procesos involutivos del útero. En un posparto normal, el útero se debe contraer en forma adecuada y la mucosa uterina se debe infiltrar adecuadamente de tejido linfoide, para establecer una limpieza de los tejidos placentarios y patógenos presentes en el útero. Sin embargo, las células inmunes son dependientes de los niveles sanguíneos de glucosa; y niveles sanguíneos excesivos de NEFA y BHB afectan tanto los procesos de fagocitosis y quimiotaxis, como la capacidad oxidativa para destruir bacterias(43,67). También se ha observado que los neutrófilos en el posparto contienen menos glicógeno y menor actividad celular inmune(73).

El éxito reproductivo depende de la coordinación de una serie de eventos fisiológicos, que incluyen la restauración del útero, reanudación de la ciclicidad postparto, desarrollo de un folículo y ovocito viable, ovulación, fertilización, y adecuado desarrollo embrionario y fetal para llegar a un proceso normal de parto. Dentro de estos complejos mecanismos, los niveles sanguíneos de insulina, IGF-I, glucosa, NEFA y BHB posparto son fundamentales. Por otro lado, un adecuado nivel de hormonas reproductivas (GnRH, LH, FSH, estrógenos y progesterona) son imprescindibles dentro de estos mecanismos reproductivos.

LITERATURA CITADA

Ya establecida la fecundación del oocito, el embrión debe proceder a su implantación, y la vaca debe llevar adelante el reconocimiento temprano de la preñez, que ocurre alrededor del día 17 postfecundación. Es bien sabido que los niveles sanguíneos de P4 durante la primera semana post concepción se asocian positivamente con un establecimiento exitoso de la preñez. La P4 es fundamental para la actividad del histótrofo a nivel de mucosa uterina. Si este tejido glandular no se desarrolla en forma adecuada, debido a bajos niveles de P4, el embrión se desarrolla en forma más lenta, lo que resulta en una menor producción de interferón tau, compuesto esencial para un adecuado reconocimiento de la presencia del embrión en el útero. En vacas de alta producción, con una mayor filtración hepática de hormonas esteroidales, se presentan niveles más bajos de P4 durante el periodo posparto(50,56,74). Por otro lado, se ha visto que los embriones y fetos de vacas lactantes contienen menos niveles de glucosa que aquellos fetos de la misma edad gestacional pero de vacas no lactantes. Si los niveles de glucosa se observan reducidos en vacas preñadas y lactantes, es lógico pensar que el estado de preñez se verá afectado si los niveles de glucosa son menores a los normales(43).

1.

Melendez P, Risco CA. Reproduction, events and management pregnancy: Periparturient disorders. Reference module in food sciences. First ed. Elsevier Academic Press; 2016.

2.

Lucy MC. Loss in high-producing dairy cattle: Where will it end? J Dairy Sci 2001;84:1277–1293.

3.

Berry DP, Friggens NC, Lucy M, Roche JR. Milk production and fertility in cattle. Annu Rev Anim Biosci 2016;15:269-290.

4.

Drackley JK. Biology of dairy cows during the transition period: The final frontier? J Dairy Sci 1999;82:2259-2273.

5.

Drackley JK, Overton TR, Douglas GN. Adaptations of glucose and long-chain fatty acid metabolism in liver of dairy cows during the periparturient period. J Dairy Sci 2001;84(E. Suppl):E100-E112.

6.

Bell AW. Regulation of organic nutrient metabolism during transition from late pregnancy to early lactation. J Anim Sci 1995;73:2804-2819.

7.

Castro N, Kawashima C, van Dorland HA, Morel I, Miyamoto A, Bruckmaier RM. Metabolic and energy status during the dry period is crucial for the resumption of ovarian activity postpartum in dairy cows. J Dairy Sci 2012;95:5804-5812.

8.

Kawashima C, Matsui M, Shimizu T, Kida K, Miyamoto A. Nutritional factors that regulate ovulation of the dominant follicle during the first follicular wave postpartum in high-producing dairy cows. J Reprod Develop 2012;58:10-16.

9.

Cardoso FC, LeBlanc SJ, Murphy MR, Drackley JK. Prepartum nutritional strategy affects reproductive performance in dairy cows. J Dairy Sci 2013;96:5859-5871.

10. Moore SG, Fair T, Lonergan P, Butler ST. Genetic merit for fertility traits in Holstein cows: IV. Transition period, uterine health and resumption of cyclicity. J Dairy Sci 2014;97:2740-2752. 11. Buckley F, O’Sullivan K, Mee JF, Evans RD, Dillon P. Relationships among milk yield, body condition, cow weight, and reproduction in spring calved Holstein-Friesians. J Dairy Sci 2003;86:2308-2319. 12. Butler ST. Nutritional management to optimize fertility of dairy cows in pasture-based systems. Animal 2014;8,s1:15–26.

415


Pedro Meléndez, et al. / Rev Mex Cienc Pecu 2017;8(4):407-417

13. Roche JR, Meier S, Heiser A, Mitchell MD, Walker CG, Crookenden MA, et al. Effects of precalving body condition score and prepartum feeding level on production, reproduction, and health parameters in pasture-based transition dairy cows. J Dairy Sci 2015;98:71647182.

30. Mucha S, Strandberg E. Genetic analysis of milk urea nitrogen and relationships with yield and fertility across lactation. J Dairy Sci 2011;94:5665-5672. 31. Patton RA, Hristov AN, Lapierre H. Protein feeding and balancing for amino acids in lactating dairy cattle. Vet Clin North Am Food Anim Pract 2014;30:599-621.

14. Ferguson JD, Galligan DT, Thomsen N. Principal descriptors of body condition score in Holstein cows. J Dairy Sci 1994;77:2695-2703.

32. Wilde D. Influence of macro and micro minerals in the periparturient period on fertility in dairy cattle. Anim Reprod Sci 2006;96:240-249.

15. Drackley JK, Cardoso FC. Prepartum and postpartum nutritional management to optimize fertility in high-yielding dairy cows in confined TMR systems. Animal 2014;8,s1:5-14.

33. Swecker WS Jr. Trace mineral feeding and assessment. Vet Cl North Am Food Anim Prac 2014;30:671-688.

16. Akbar H, Grala TM, Vailati Riboni M, Cardoso FC, Verkerk G, McGowan J, et al. Body condition score at calving affects systemic and hepatic transcriptome indicators of inflammation and nutrient metabolism in grazing dairy cows. J Dairy Sci 2015;98:1019-1032.

34. Abuelo A, Hernández J, Benedito JL, Castillo C. The importance of the oxidative status of dairy cattle in the periparturient period: revisiting antioxidant supplementation. J Anim Physiol Anim Nutr (Berl) 2015;99:1003-1016.

17. Roche JR, Macdonald KA, Burke CR, Lee JM, Berry DP. Associations among body condition score, body weight, and reproductive performance in seasonal-calving dairy cattle. J Dairy Sci 2007;90:376-391.

35. Oelberg TJ, Stone W. Monitoring total mixed rations and feed delivery systems. Vet Clin North Am Food Anim Prac 2014;30:721744.

18. Wathes DC, Fenwick M, Cheng Z, Bourne N, Llewellyn S, Morris DG, et al. Influence of negative energy balance on cyclicity and fertility in the high producing dairy cow. Theriogenology 2007;68:S232S241.

36. Pinedo P, Melendez P, Paudyal S, Arias F, Krauss R, Lopez H, Luco A, Vergara, C. Association between disease occurrence and fertility of dairy cows in three geographic regions of Chile. Theriogenology 2016;86:817-823.

19. Peter AT, Vos PL, Ambrose DJ. Postpartum anoestrus in dairy cattle. Theriogenology 2009;71:1333–1342.

37. Santos JE, Rutigliano HM, Sá Filho MF. Risk factors for resumption of postpartum estrous cycles and embryonic survival in lactating dairy cows. Anim Reprod Sci 2009;110:207-221.

20. Walsh SW, Williams EJ, Evans AC. A review of the causes of poor fertility in high milk producing dairy cows. Anim Reprod Sci 2011;123:127-138.

38. Meléndez P, Donovan GA, Risco CA, Goff JP. Plasma mineral and energy metabolite concentrations in dairy cows fed an anionic prepartum diet that did or did not have retained fetal membranes after parturition. Am J Vet Res 2004;65:1071-1076.

21. Wathes DC. Mechanisms linking metabolic status and disease with reproductive outcome in the dairy cow. Reprod Domest Anim 2012;47:s4 304-312.

39. Melendez P, Marin MP, Robles J, Rios C, Duchens M, Archbald L. Relationship between serum nonesterified fatty acids at calving and the incidence of periparturient diseases in Holstein dairy cows. Theriogenology 2009;72:826-833.

22. Melendez P, Goff JP, Risco CA, Archbald LF, Littell R, Donovan GA. Pre-partum monensin supplementation improves body reserves at calving and milk yield in Holstein cows dried-off with low body condition score. Res Vet Sci 2007;82:349-357.

40. Esposito G, Irons PC, Webb EC, Chapwanya A. Interactions between negative energy balance, metabolic diseases, uterine health and immune response in transition dairy cows. Anim Reprod Sci 2014;144:60-71.

23. Goff JP. Major advances in our understanding of nutritional influences on bovine health. J Dairy Sci 2006;89:1292-1301. 24. Dubuc J, Duffield TF, Leslie KE, Walton JS, LeBlanc SJ. Risk factors and effects of postpartum anovulation in dairy cows. J Dairy Sci 2012;95:1845-1854.

41. LeBlanc SJ. Reproductive tract inflammatory disease in postpartum dairy cows. Animal 2014;8,s1:54-63. 42. Somers JR, Huxley J, Lorenz I, Doherty ML, O'Grady L. The effect of lameness before and during the breeding season on fertility in 10 pasture-based Irish dairy herds. Ir Vet J 2015;68:14-20.

25. National Research Council. Nutrient requirements of dairy cattle, 7th revised ed. Washington, DC: National Academy Press; 2001. 26. Melendez P, Donovan A, Hernandez J. Milk urea nitrogen and infertility in Florida Holstein cows. J Dairy Sci 2000;83:459-463.

43. Lucy MC, Butler ST, Garverick HA. Endocrine and metabolic mechanisms linking postpartum glucose with early embryonic and foetal development in dairy cows. Animal 2014;8,s1:82-90.

27. Sinclair KD, Garnsworthy PC, Mann GE, Sinclair LA. Reducing dietary protein in dairy cow diets: implications for nitrogen utilization, milk production, welfare and fertility. Animal 2014;8:262-274.

44. Ribeiro ES, Lima FS, Greco LF, Bisinotto RS, Monteiro APA, Favoreto M, et al. Prevalence of periparturient diseases and effects on fertility of seasonally calving grazing dairy cows supplemented with concentrates. J Dairy Sci 2013;96:5682-5697.

28. Melendez P, Donovan A, Hernandez J, Bartolome J, Risco C, Staples C, Thatcher W. Milk, plasma, and blood urea nitrogen concentrations, dietary protein, and fertility in dairy cattle. J Am Vet Med Assoc 2003;223:628-634.

45. Ospina PA, Nydam DV, Stokol T, Overton TR. Association between the proportion of sampled transition cows with increased nonesterified fatty acids and beta-hydroxybutyrate and disease incidence, pregnancy rate, and milk production at the herd level. J Dairy Sci 2010;93:3595-3601.

29. Cheng Z, Oguejiofor CF, Swangchan-Uthai T, Carr S, Wathes DC. Relationships between circulating urea concentrations and endometrial function in postpartum dairy cows. Animals 2015;5:748-773.

46. Schöbitz J, Ruiz-Albarrán M, Balocchi OA, Wittwer F, Noro M, Pulido RG. Effect of increasing pasture allowance and concentrate

416


AVANCES SOBRE NUTRICIÓN Y FERTILIDAD EN GANADO LECHERO: REVISIÓN

supplementation on animal performance and microbial protein synthesis in dairy cows. Arch Med Vet 2013;45:247-258.

60. Patton J, Kenny DA, McNamara S, Mee JF, O'Mara FP, Diskin MG, Murphy JJ. Relationships among milk production, energy balance, plasma analytes, and reproduction in Holstein-Friesian cows. J Dairy Sci 2007;90:649-658.

47. Lucy MC, Verkerk GA, Whyte BE, Macdonald KA, Burton L, Cursons RT, Roche JR, Holmes CW. Somatotropic axis components and nutrient partitioning in genetically diverse dairy cows managed under different feed allowances in a pasture system. J Dairy Sci 2009;92:526-539.

61. Taylor VJ, Cheng Z, Pushpakumara PG, Beever DE, Wathes DC. Relationships between the plasma concentrations of insulin-like growth factor-I in dairy cows and their fertility and milk yield. Vet Rec 2004;155:583-588.

48. Wiltbank MC, Souza AH, Carvalho PD, Bender RW, Nascimento AB. Improving fertility to timed artificial insemination by manipulation of circulating progesterone concentrations in lactating dairy cattle. Reprod Fert Develop 2011;24:238-243.

62. Pinedo PJ, Melendez P, Villagomez-Cortes JA, Risco CA. Effect of high somatic cell counts on reproductive performance of Chilean dairy cattle. J Dairy Sci 2009;92:1575-1580. 63. Pulido RG, Berndt S, Orellana P, Wittwer F. Effect of source of carbohydrate in concentrate on the performance of high producing dairy cows during spring grazing. Arch Med Vet 2007;39:19-26.

49. Wiltbank MC, Souza AH, Carvalho PD, Cunha AP, Giordano JO, Fricke PM, et al. Physiological and practical effects of progesterone on reproduction in dairy cattle. Animal 2014;8,s1:70-81.

64. Ribeiro ES, Cerri RL, Bisinotto RS, Lima FS, Silvestre FT, Greco LF, et al. Reproductive performance of grazing dairy cows following presynchronization and resynchronization protocols. J Dairy Sci 2011;94:4984-4996.

50. Crowe MA, Diskin MG, Williams EJ. Parturition to resumption of ovarian cyclicity: comparative aspects of beef and dairy cows. Animal 2014;8,s1:40-53. 51. Melendez P, Risco CA. Management of transition cows to optimize reproductive efficiency in dairy herds. Vet Cl North Am Food Anim Prac 2005;21:485-501.

65. Chapinal N, Leblanc SJ, Carson ME, Leslie KE, Godden S, Capel M, Santos JE, Overton MW, Duffield TF. Herd-level association of serum metabolites in the transition period with disease, milk production, and early lactation reproductive performance. J Dairy Sci 2012;95:5676-5682.

52. Garverick HA, Harris MN, Vogel-Bluel R, Sampson JD, Bader J, Lamberson WR, et al. Concentrations of nonesterified fatty acids and glucose in blood of periparturient dairy cows are indicative of pregnancy success at first insemination. J Dairy Sci 2013;96:181188.

66. Ster C, Loiselle MC, Lacasse P. Effect of postcalving serum nonesterified fatty acids concentration on the functionality of bovine immune cells. J Dairy Sci 2012;95:708-717.

53. Snijders SE, Dillon PG, O'Farrell KJ, Diskin MG, Wylie AR, O'Callaghan D, et al. Genetic merit for milk production and reproductive success in dairy cows. Anim Reprod Sci 2001;65:1731.

67. Sordillo LM. Nutritional strategies to optimize dairy cattle immunity J Dairy Sci 2016;99:1-16. 68. Tchkonia T, Thomou T, Zhu Y, Karagiannides I, Pothoulakis C, Jensen MD, Kirkland JL. Mechanisms and metabolic implications of regional differences among fat depots. Cell Metab 2013;17:644656.

54. Leroy JL, Rizos D, Sturmey R, Bossaert P, Gutierrez-Adan A, Van Hoeck V, et al. Intrafollicular conditions as a major link between maternal metabolism and oocyte quality: a focus on dairy cow fertility. Reprod Fert Develop 2011;24:1-12.

69. Sordillo LM, Raphael W. Significance of metabolic stress, lipid mobilization, and inflammation on transition cow disorders. Vet Clin North Am Food Anim Pract 2013;29:267-278.

55. Leroy JL, Vanholder T, Van Knegsel AT, Garcia-Ispierto I, Bols PE. Nutrient prioritization in dairy cows early postpartum: mismatch between metabolism and fertility? Reprod Domest Anim 2008;43,s2:96-103.

70. Goff JP. Calcium and magnesium disorders. Vet Clin North Am Food Anim Pract 2014;30:359-381.

56. Lonergan P, Forde N. Maternal-embryo interaction leading up to the initiation of implantation of pregnancy in cattle. Animal 2014;8,s1:64-69.

71. Reinhardt TA, Lippolis JD, McCluskey BJ, Goff JP, Horst RL. Prevalence of subclinical hypocalcemia in dairy herds. Vet J 2011;188:122-124.

57. Van Hoeck V, Sturmey RG, Bermejo-Alvarez P, Rizos D, GutierrezAdan A, Leese HJ, et al. Elevated non-esterified fatty acid concentrations during bovine oocyte maturation compromise early embryo physiology. PLoS One 2011;6:e23183.

72. Kimura K, Reinhardt TA, Goff JP. Parturition and hypocalcemia blunts calcium signals in immune cells of dairy cattle. J Dairy Sci 2006;89:2588-2595. 73. Galvão KN, Flaminio MJ, Brittin SB, Sper R, Fraga M, Caixeta L, et al. Association between uterine disease and indicators of neutrophil and systemic energy status in lactating Holstein cows. J Dairy Sci 2010;93:2926-2937.

58. Lucy MC. Functional differences in the growth hormone and insulinlike growth factor axis in cattle and pigs: implications for postpartum nutrition and reproduction. Reprod Domest Anim 2008;43:31-39.

74. Lonergan P. Influence of progesterone on oocyte quality and embryo development in cows. Theriogenology 2011;76:1594 1601.

59. Cabrera VE. Economics of fertility in high-yielding dairy cows on confined TMR systems. Animal 2014;8:211-221.

417


Rev Mex Cienc Pecu 2017;8(4):419-428

http://dx.doi.org/10.22319/ rmcp.v8i4.4646

Dinámica poblacional de tallos de ovillo (Dactylis glomerata L.) solo y asociado con ballico perenne (Lolium perenne L.) y trébol blanco (Trifolium repens L.) Tiller population in orchard grass (Dactylis glomerata L.) grown alone and associated with perennial ryegrass (Lolium perenne L.) and white clover (Trifolium repens L.) Adelaido Rafael Rojas Garcíaa, Joel Ventura Ríosa, Alfonso Hernández-Garaya*, Santiago Joaquín Cancinob, María de los Ángeles Maldonado Peraltac, Iván Reyes Vázqueza RESUMEN El objetivo de esta investigación fue evaluar la densidad de tallos del pasto ovillo en monocultivo, y asociado con ballico perenne y trébol blanco en diferentes proporciones. Los tratamientos consistieron de las siguientes asociaciones: 20-70-10, 70-2010, 100-00-00, 40-40-20 % de pasto ovillo (Ov), ballico perenne (Ba) y trébol blanco (Tr), respectivamente. Los tratamientos se distribuyeron en un arreglo de bloques al azar con tres repeticiones. La asociación 70-20-10 de Ov-Ba-Tr es la que presenta mayor densidad de tallos de Ov, con un promedio de 3,750 tallos m-2, y la menor densidad de tallos fue en el Ov en monocultivo (100-0000), con un promedio de 2,400 tallos m-2 (P<0.05). La población de tallos en Ba fue baja en todas las asociaciones, en promedio de 225 tallos m-2. La mayor densidad de tallos en pasto Ov-Ba se presentó en otoño e invierno. Independientemente de la asociación en la estación de primavera se encontró mayor peso por tallo con 0.30 y 0.42 g tallo-1, en Ov y Ba y menor en invierno con 0.13 y 0.14 g tallo-1, en Ov y Ba, respectivamente. En conclusión, la dinámica de población de tallos de pasto ovillo tendió a mantenerse; en contraste, en pasto ovillo solo y ballico perenne disminuyó la población de tallos. PALABRAS CLAVE: Población de tallos, Peso de tallos, Otoño, Invierno.

ABSTRACT The objective of this research was to evaluate tiller population of orchard grass seeded with perennial ryegrass and white clover in different proportions and single. Treatments consisted of the associations: 20-70-10, 70-20-10, 100-00-00, 40-40-20 % of orchard grass (OG), perennial ryegrass (RG) and white clover (WT) respectively. Treatments were distributed in a randomized complete block with three replications. The association 70-20-10 of OG-RG-WT had greatest tiller density of OG with an average of 3,750 tiller m-2, and the lowest in 100-00-00 with an average of 2,400 tiller m-2 (P<0.05). There were few tiller in perennial ryegrass in all associations, with an average of 225 tiller m-2. Two highest peaks in the tiller population in OG and RG were found in autumn and winter. Regardless of the association, in the spring season more weight per tiller was found with 0.30 and 0.42 g tiller-1, OG and RG and less in winter with 0.13 and 0.14 g tiller-1, OG and RG, respectively. In conclusion, all associations in population dynamics of OG tiller tended to be maintained; in contrast, on single OG and RG tended to decrease. KEY WORDS: Tiller population, Tiller weight, Fall, Winter.

Recibido el 5 de abril de 2016. Aceptado el 24 de junio de 2016. a Recursos Genéticos y Productividad Ganadería. Campus Montecillo. Colegio de Postgraduados. Km. 36.5 Carretera México – Texcoco. México. b División de Estudios de Posgrado, Facultad de Ingeniería y Ciencias, Universidad Autónoma de Tamaulipas. Ciudad Victoria, Tamaulipas. México. c Recursos Genéticos y Productividad Fisiología Vegetal. Campus Montecillo. Colegio de Postgraduados. Texcoco. México. *Autor de correspondencia: hernan@colpos.mx

419


Adelaido Rafael Rojas García, et al. / Rev Mex Cienc Pecu 2017;8(4):419-428

En gramíneas o Poaceas, la unidad básica de crecimiento es el tallo, en su conjunto, por unidad de superficie forman una población, por lo tanto una pradera puede ser vista como una población de tallos(1). Un aumento en la población de tallos significa mayor persistencia y producción de forraje(2). En una pradera, la densidad de tallos por unidad de superficie es continuamente variable según las condiciones ambientales, estación del año y manejo(3-7). La producción de forraje en una pradera puede ser dividida en dos componentes: el número de tallos por unidad de área y el peso individual por tallo(4). Por ende, la persistencia y producción de las especies forrajeras depende del balance entre la formación y protección de nuevos tallos.

favorezcan simultáneamente una alta producción, utilización y persistencia de las especies forrajeras(13). La presente investigación tuvo como objetivo evaluar las tasas de aparición, muerte, sobrevivencia y dinámica poblacional de tallos, así como el peso por tallo de ovillo y ballico perenne asociados con trébol blanco, y el ovillo en monocultivo. El experimento se realizó de septiembre de 2012 a septiembre de 2014, en el Campo Experimental del Colegio de Postgraduados, Campus Montecillo, Texcoco, Estado de México, ubicado a 19º 29’ N y 98º 53’ O, a 2,240 msnm. El clima es templado subhúmedo, con precipitación media anual de 636 mm y régimen de lluvias en verano con temperatura media anual de 15.2 ºC(14). El suelo es Typic ustipsamments franco arenoso, con pH 7 a 8, y 2.4 % de materia orgánica(15).

El conocimiento de la densidad y peso de los tallos proporciona una referencia esencial para el manejo de praderas. La intensidad y frecuencia de pastoreo, modifican la tasa de aparición y muerte de tallos y, con ello, incrementan la densidad y productividad de la pradera(3,8). Diferentes investigadores, al evaluar praderas mixtas de leguminosas y gramíneas y en monocultivo, obtuvieron mayor compensación tamaño/densidad de tallos en las asociaciones, manteniéndose constante durante el año en comparación con praderas puras o de una especie sola(9). En praderas de ballico perenne (Lolium perenne L.) se reportó la mayor densidad de tallos en la estación de invierno y verano independientemente de la frecuencia de pastoreo(10). En asociaciones de gramíneas y leguminosas registraron el mayor peso por tallo de ballico perenne y pasto ovillo (Dactylis glomerata L.) en verano (0.38 g tallo-1) y la mayor densidad de tallos en invierno con 9,961 y 10,423 tallos m-2, respectivamente(11). Otros investigadores(12) reportaron la mayor densidad de tallos en pasto ovillo en invierno con 8,000 tallos m2 disminuyendo en primavera, manteniéndose constante hasta verano con un una densidad de 4,421 tallos m-2 y aumentando en otoño.

Las praderas se establecieron en febrero de 2010; las gramíneas se sembraron en hileras a 30 cm, mientras que la leguminosa se sembró en forma perpendicular con una distancia de 30 cm; la densidad de siembra fue diferente en cada asociación, dependiendo del porcentaje de cada especie, tomando como base para el pasto ovillo, ballico perenne y trébol blanco en monocultivo a 20, 30 y 5 kg ha-1, respectivamente. Las praderas no se fertilizaron, y en las estaciones con poca o nula precipitación se proporcionaron riegos a capacidad de campo cada dos semanas. Antes de iniciar la investigación, se realizó una cosecha de homogenización del forraje, mediante un pastoreo con ovinos, cosechando aproximadamente a 5 cm sobre el nivel del suelo; para su mejor manejo las parcelas estuvieron delimitadas mediante un cerco eléctrico. Posteriormente, los pastoreos se realizaron cada 4 semanas en primavera-verano y cada 5 y 6 semanas durante otoño e invierno, respectivamente, de acuerdo a lo recomendado por otros autores al evaluar praderas de ovillo y ballico perenne(16,17). Los tratamientos consistieron de las siguientes asociaciones: 20-70-10, 70-20-10, 40-40-20 % de pasto ovillo (Ov), ballico perenne (Ba) y trébol blanco (Tr), respectivamente y el pasto ovillo en monocultivo (100-00-00), Los cuatro tratamientos se distribuyeron en 12 parcelas experimentales de 9 x 8 m en un arreglo de bloques al azar con tres repeticiones.

En México existen pocos estudios sobre dinámica poblacional de tallos y componentes del rendimiento en asociaciones de gramíneas con leguminosas. Evaluar dichos componentes y su variación durante el año, genera información importante para la toma de decisiones que

420


DINÁMICA POBLACIONAL DE TALLOS DE OVILLO, SOLO Y ASOCIADO

Dinámica poblacional de tallos

TMT =

Para determinar los cambios en la densidad de tallos, así como sus tasas de aparición y muerte, al inicio del experimento, en cada unidad experimental se colocaron dos aros de PVC de 10.4 cm de diámetro, los cuales delimitaban un macollo; cuando las praderas eran integradas por la asociación de las dos especies de pastos, cada aro registraba una especie. Todos los tallos presentes dentro del aro se marcaron con anillos de cable de un mismo color, que se consideraron como población inicial. Posteriormente, cada mes, durante dos años, los tallos nuevos se marcaron con anillos de color diferente; se usó un color diferente para cada generación, y los tallos muertos se contaron y se les retiró el anillo.

La tasa de sobrevivencia de tallos (TST) se obtuvo de manera indirecta mediante la ecuación: TST = 100 − TMT

Peso por tallo Un día antes de cada pastoreo, se cosecharon a ras de suelo 10 tallos de pasto ovillo y 10 de ballico perenne, se secaron en una estufa de aire forzado a 55 oC, hasta que alcanzaron un peso constante, y posteriormente se registró su peso. El peso promedio de tallo se obtuvo al dividir el peso de la muestra de tallos entre el número de tallos.

Datos climáticos

Los valores población, tasa de aparición y muerte de tallos se multiplicaron por el número de plantas por metro cuadrado; éstas se contaron un día después de cada pastoreo en un cuadro fijo de 1 m2, establecido al azar en cada parcela y repetición, las cuales están reportadas en una primera fase de investigación(18). Con los datos anteriores se estimó: densidad poblacional de tallos (DPT; tallos m-2), tasas de aparición (TAT) y muerte (TMT), utilizando las siguientes fórmulas(4): TAT =

No. de tallos muertos (100) (DPT del muestreo anterior) (T2 − T1)

En el periodo experimental la temperatura máxima promedio osciló entre 21 y 26 ºC, la mínima promedio mensual entre 3 y 10 ºC. La temperatura máxima se presentó en primavera de ambos años, con un promedio de 26 ºC; la mínima ocurrió en otoño e invierno con 5.7 y 3.6 °C, respectivamente. La precipitación acumulada en el primer año fue de 424.81 mm, en primaveraverano de 2013 se presentó la mayor precipitación con 378.28 mm (89 %). La precipitación acumulada del segundo año fue de 332.8 mm, obteniendo la mayor precipitación en primavera y verano de 2014 con 289.78 mm (87 %) (Figura 1).

No. de tallos nuevos (100) (DPT del muestreo anterior) (T2 − T1)

Figura 1. Temperaturas media por estación, máxima, mínima, precipitación acumulada y riegos a capacidad de campo durante el periodo de estudio (http://www.cm.colpos.mx/ meteoro/)

421


Adelaido Rafael Rojas García, et al. / Rev Mex Cienc Pecu 2017;8(4):419-428

Análisis estadístico

(P<0.05) entre años, en el primer año fue de 0.95 y el segundo año 0.47 tallos (Cuadro 1).

Los datos obtenidos en las variables de los cuatro tratamientos se organizaron de forma estacional y anual para su análisis de varianza, conforme un diseño de bloques al azar con tres repeticiones, mediante el procedimiento PROC MIXED del programa Statistical Analysis System(19); la comparación de medias se estimó por LSMEANS mediante la prueba “t” de “Student” a una significancia ajustada (P<0.05).

La tasa de muerte de tallos fue disminuyendo conforme se incrementó la edad de la pradera. En el primer año fue mayor (P<0.05) comparada con el segundo año (0.71 y 0.56 tallos 100 tallos-1 d-1, respectivamente). Entre estaciones también existieron diferencias estadísticas, teniendo en las cuatro estaciones del primer año y otoño del segundo año en donde hubo mayor tasa de muerte de tallos, en promedio 0.71, y la menor en verano del segundo año con un promedio de 0.36 tallos. La tasa de sobrevivencia de ovillo fue diferente, conforme pasó el tiempo fue aumentando, teniendo en promedio del primer año la menor tasa y el segundo año la mayor con 99.3 y 99.4 tallos, respectivamente (P<0.05). Todas las asociaciones obtuvieron la mayor tasa de sobrevivencia en el primer año con 99.3 tallos, mientras que en el

En pasto ovillo se encontraron diferencias (P<0.05) en las tasa de aparición de tallos debido a efecto de las estaciones del año, presentándose la mayor tasa de aparición en las estaciones de otoño, invierno y primavera del primer año, con un promedio de 1.01 tallos 100 tallos-1 d-1, mientras que la menor se presentó en el verano del segundo año con 0.21 tallos. También se registraron diferencias

Cuadro 1. Tasa de aparición, muerte y sobrevivencia de tallos de ovillo (Ov) solo y asociado con ballico perenne (Ba) y trébol blanco (Tr) Asociación Ov-Ba-Tr

2012 Otoño

2013

Invierno

Primav.

Verano

2014

Otoño Invierno

Primav.

Promedio Verano

Año 1

Año 2

Tasa de aparición de tallos (tallos 100 tallos-1 d-1) 20-70-10 70-20-10 100-00-0 40-40-20 Promedio

1.26 1.25 a 0.87 a 0.61 b 0.99 a a

1.50 1.08 a 1.14 a 0.83 a 1.13 a a

0.72 b 1.13 a 1.06 a 0.73 b 0.91 a

0.71 b 0.85 b 0.95 a 0.65 b 0.79 b

0.60 c 0.95 b 0.50 b 0.95 a 0.75 b

0.11 d 0.61 c 0.58 b 1.02 a 0.58 c

0.16 bc 0.24 d 0.51 b 0.48 c 0.34 d

0.14 bc 0.08 e 0.21 c 0.44 c 0.21 e

1.00 A 1.10 A 1.00 A 0.70 B 0.95 a

0.25 C 0.47 B 0.45 B 0.72 A 0.47 b

0.23 d 0.42 c 0.36 c 0.46 d 0.36 c

0.71 A 0.73 A 0.75 A 0.65 B 0.71 a

0.45 B 0.60 A 0.61 A 0.59 A 0.56 b

99.8 a 99.6 a 99.6 a 99.5 a 99.6 a

99.3 A 99.3 A 99.2 B 99.3 A 99.3 b

99.6 A 99.4 B 99.4 B 99.4 B 99.4 a

Tasa de muerte de tallos (tallos 100 tallos-1 d-1) 20-70-10 70-20-10 100-00-0 40-40-20 Promedio

0.52 b 0.71 b 0.83 a 0.83 a 0.72 a

0.76 a 0.64 b 0.64 b 0.52 c 0.64 a

0.85 a 0.76 a 0.73 b 0.54 c 0.72 a

0.73 a 0.82 a 0.82 a 0.74 a 0.77 a

0.62 b 0.77 a 0.79 a 0.63 b 0.70 a

0.47 c 0.68 ab 0.6 b 0.65 b 0.6 b

0.48 c 0.53 bc 0.70 b 0.62 b 0.58 b

Tasa de sobrevivencia de tallos (tallos 100 tallos-1 d-1) 20-70-10 70-20-10 100-00-0 40-40-20 Promedio

99.5 a 99.3 b 99.2 b 99.2 b 99.3 b

99.2 b 99.4 ab 99.4 a 99.5 a 99.4 ab

99.2 b 99.2 b 99.3 ab 99.5 a 99.3 b

99.3 b 99.2 b 99.2 b 99.3 b 99.2 b

99.4 ab 99.2 b 99.2 b 99.4 ab 99.3 b

99.5 a 99.3 b 99.4 a 99.4 ab 99.4 ab

Primav.= primavera. abc= Medias con la misma literal minúscula en una misma hilera, no son diferentes (P<0.05). ABC= Medias con la misma literal mayúscula en una misma columna, no son diferentes (P<0.05).

422

99.5 a 99.5 a 99.3 ab 99.4 ab 99.4 ab


DINÁMICA POBLACIONAL DE TALLOS DE OVILLO, SOLO Y ASOCIADO

segundo año la asociación 20-70-10 de Ov-Ba-Tr obtuvo la mayor tasa de sobrevivencia con 99.6 tallos

que la alta tasa de muerte de tallos registrada en el primer año de evaluación, se debió a la mayor tasa de crecimiento individual de cada tallo, lo que sombreó a los tallos pequeños, presentes en los estratos inferiores de la pradera, incrementando la mortalidad de los mismos(1).

Varios investigadores reportan en tasa de aparición de tallos para pasto ovillo diferencias entre asociaciones durante el invierno, y presentando dos picos más altos en primavera y otoño(11,20). La velocidad de crecimiento de las plantas forrajeras depende de los factores ambientales, particularmente el clima, por lo que las variaciones observadas en tasa de aparición y muerte de tallos, podría deberse a los cambios drásticos en la calidad de la luz, la temperatura óptima de crecimiento de la especie, y a la disminución progresiva en la biomasa verde conforme crece la pradera(8). Esto ocasiona que la tasa de formación de tallos se reduzca como resultado de una respuesta fotomorfogénica y el sombreado de las capas inferiores de la pradera. Por otro lado, cuando varias especies se encuentran en su máximo potencial de crecimiento, el componente más importante del rendimiento de forraje es el peso por tallo(21), por lo

En la tasa de aparición, muerte y sobrevivencia de tallos de ballico perenne se encontraron diferencias (P<0.05). La tasa de aparición de tallos del primer año fue menor al segundo año, 0.66 y 0.84 tallos 100 tallos-1 d-1, respectivamente. En la asociación 20-70-10 de Ov-Ba-Tr tendió a aumentar la tasa de aparición de tallos, en promedio fue de 0.61 y 1.19 tallos para el primer y segundo año, respectivamente. Las asociaciones 70-20-10 y 4040-20 de Ov-Ba-Tr fueron caso contrario, ya que la tasa de aparición de tallos tendió a disminuir conforme transcurrió el tiempo (Cuadro 2). Existen reportes en ballico perenne(11) con la mayor tasa de aparición en abril y noviembre (primavera y otoño), similares a lo registrado en esta investigación, ya que en otoño de ambos años, se encontraron las

Cuadro 2. Tasa de aparición, muerte y sobrevivencia de tallos de ballico perenne (Ba) asociado con ovillo (Ov) y trébol blanco (Tr) Asociación Ov-Ba-Tr

2012 Otoño

2013

Invierno

Primav.

Verano

2014

Otoño Invierno

Primav.

Promedio Verano

Año 1

Año 2

Tasa de aparición de tallos (tallos 100 tallos-1 d-1) 20-70-10 70-20-10 40-40-20 Promedio

0.75 b 0.98 a 0.92 a 0.88 ab

0.80 b 0.95 a 0.98 a 0.78 b

0.54 c 0.67 b 0.60 b 0.60 c

0.34 c 0.59 c 0.56 b 0.49 d

1.20 a 0.84 ab 0.96 a 1.00 a

1.02 a 0.78 b 0.56 b 0.78 b

1.18 a 0.72 b 0.37 c 0.75 b

1.35 a 0.76 b 0.43 bc 0.84 ab

0.61 B 0.79 A 0.58 B 0.66 b

1.19 A 0.77 B 0.58 C 0.84 a

0.90 a 0.68 b 0.40 c 0.66 bc

0.61 B 0.76 A 0.76 A 0.71 a

0.78 A 0.71 A 0.55 B 0.68 b

99.1 b 99.3 b 99.6 a 99.3 b

99.4 A 99.2 B 99.2 B 99.2 b

99.2 B 99.4 A 99.4 A 99.3 a

Tasa de muerte de tallos (tallos 100 tallos-1 d-1) 20-70-10 70-20-10 40-40-20 Promedio

0.56 bc 0.83 a 0.82 a 0.73 ab

0.83 a 0.86 a 0.84 a 0.84 a

20-70-10 70-20-10 40-40-20 Promedio

99.4 99.2 c 99.2 b 99.3 b

99.2 99.1 c 99.2 b 99.2 c

0.61 b 0.75 ab 0.78 a 0.71 ab

0.44 c 0.63 b 0.62 b 0.56 c

0.62 b 0.68 b 0.52 c 0.60 c

0.85 a 0.74 ab 0.77 a 0.78 a

0.77 a 0.76 ab 0.53 c 0.68 b

Tasa de sobrevivencia de tallos (tallos 100 tallos-1 d-1) ab

b

99.4 ab 99.3 b 99.2 b 99.3 b

99.6 a 99.4 a 99.4 ab 99.4 a

99.4 ab 99.3 b 99.5 a 99.4 a

99.2 b 99.3 b 99.2 b 99.2 c

Primav= primavera. abc= Medias con la misma literal minúscula en una misma hilera, no son diferentes (P<0.05). ABC= Medias con la misma literal mayúscula en una misma columna, no son diferentes (P<0.05).

423

99.2 b 99.2 c 99.5 a 99.3 b


Adelaido Rafael Rojas García, et al. / Rev Mex Cienc Pecu 2017;8(4):419-428

mayores tasas de aparición de tallos. En otra investigación(22) al evaluar ballico perenne a diferentes frecuencias e intensidades de pastoreo, registraron la mayor tasa de aparición de tallos en otoño. En praderas puras de ballico perenne(10), reportaron las mayores tasas de aparición de tallos en verano e invierno, las cuales duplicaron a las de otoño y primavera.

La asociación 20-70-10 de Ov-Ba-Tr registró la menor tasa de muerte de tallos de ballico perenne en el primer año, y no se presentaron diferencias estadísticas entre las otras asociaciones; en el segundo año la menor tasa de muerte de tallos se presentó en la asociación 40-40-20 (Cuadro 2). En promedio la tasa de muerte de tallos fue mayor en el primer año que en el segundo (P<0.05). Durante el primer año de evaluación la tasa de muerte de tallos fue similar entre estaciones; en el segundo año, la tasa de muerte fue mayor en invierno, seguida de primavera, verano, y la menor en otoño.

Figura 2. Cambios mensuales en la densidad de tallos de ovillo (Ov) asociado con ballico perenne (Ba) y trébol blanco (Tr) en diferentes proporciones: a) 20 % de ovillo (20-70-10), b) 70 % de ovillo (70-20-10), c) 100 % de ovillo (100-00-00) y d) 40 % de ovillo (40-40-20)

La tasa de sobrevivencia de tallos de ballico perenne aumentó del primer al segundo año de 99.2 a 99.3 tallos 100 tallos-1 d-1 (P<0.05). En verano del primer año y otoño del segundo se encontró la mayor tasa de sobrevivencia con un promedio de 99.4 tallos y en la estación de invierno de ambos años con un promedio de 99.2 tallos la menor tasa de sobrevivencia. En otra investigación en asociaciones con ballico perenne, se reporta variación en la tasa de mortalidad de tallos, siendo en octubre cuando se presentó la mayor mortalidad, y lo atribuyen principalmente a la presencia de heladas(11). Otros autores(22) obtuvieron en praderas de ballico perenne en monocultivo, la mayor tasa de muerte en verano (septiembre) y lo atribuyen a la competencia por luz y nutrientes, así como a la defoliación de tallos reproductivos que son la fuente de nutrientes de los tallos jóvenes. En las Figuras 2 y 3 se muestran la densidad de tallos a lo largo del periodo experimental. De noviembre a marzo se registró la mayor densidad de tallos, independientemente la asociación y año (Figura 2). La asociación 70-20-10 de Ov-Ba-Tr fue la que presentó mayor densidad de tallos de ovillo con un promedio de 3,750 tallos m-2, mientras que la pradera con ovillo en monocultivo (100-00-00) registró la menor densidad de tallos a lo largo de la investigación, con un promedio de 2,400 tallos m-2; además en este tratamiento la densidad de tallos tendió a disminuir conforme aumentó el tiempo. En promedio todas las asociaciones presentaron menor densidad de tallos de abril a septiembre (primavera- verano), y se le puede atribuir a la

424


DINÁMICA POBLACIONAL DE TALLOS DE OVILLO, SOLO Y ASOCIADO

mayor temperatura registrada en esas estaciones, ya que los tallos tienden a tener mayor peso (Cuadro 3) y área foliar y, por lo tanto, sombrean a los nuevos tallos, aumentando su mortalidad(5). Otro factor que afectó el comportamiento de los tallos fueron las competencias inter e intra-especifica por nutrientes, agua, luz y espacio(23), ya que las plantas no rebrotan en una pradera como individuos aislados, sino como una población usualmente densa, donde la vegetación que los rodea ejerce una influencia muy fuerte sobre las características inherentes de cada especie, por medio de la competencia(24). Otros autores, en el valle de México, reportan en ovillo asociado con las mismas especies(11) y en monocultivo(12) datos similares a lo encontrado en esta investigación.

Figura 3. Cambios mensuales en la densidad de tallos de ballico perenne (Ba) asociado con ovillo (Ov) y trébol blanco (Tr) en diferentes proporciones: a) 70 % de ballico perenne (20-70-10), b) 20 % de ballico perenne (70-20-10) y c) 40 % de ballico perenne (40-40-20)

En ballico perenne la dinámica poblacional de tallos presentó una gran variación en su comportamiento, dependiendo del porcentaje inicial en la asociación (Figura 3). Al igual que en el pasto ovillo, todas las asociaciones presentaron la mayor densidad poblacional de tallos en los meses con la temperatura mínima (otoño - invierno). La asociación 70-20-10 de Ov-Ba-Tr tuvo la mayor densidad de tallos de ballico perenne con un promedio de 260 tallos m-2, mientras que en la asociación 40-40-20 de Ov-Ba-Tr se registró la menor densidad, en promedio 190 tallos m-2, y se presentó una marcada disminución en los últimos Cuadro 3. Peso de tallos de ovillo (Ov) y ballico perenne (Ba) asociados con trébol blanco (Tr) Asociación Ov-Ba-Tr 20-70-10 70-20-10 100-00-0 40-40-20 Promedio 20-70-10 70-20-10 40-40-20 Promedio

2012 Otoño 0.19 0.28 a 0.13 a 0.22 b 0.20 b c

0.20 bc 0.23 b 0.14 c 0.19 bc

2013

Invierno 0.14 0.18 b 0.09 a 0.12 c 0.13 c c

0.16 c 0.16 c 0.12 c 0.14 c

Primav.

Verano

Otoño

2014 Invierno

Pasto ovillo (g tallo-1) 0.18 c 0.13 c 0.25 ab 0.18 b a 0.13 0.09 a c 0.13 0.12 c 0.17 bc 0.13 c

0.35 0.39 a 0.14 a 0.39 a 0.31 a

0.23 0.20 b 0.12 a 0.30 ab 0.21 b

0.43 a 0.44 a 0.42 a 0.43 a

Ballico perenne (g tallo-1) 0.21 b 0.19 bc 0.16 c b bc 0.22 0.20 0.16 c b c 0.28 0.11 0.09 c 0.23 b 0.16 c 0.13 c

a

b

Primav= primavera. abc= Medias con la misma literal minúscula en una misma hilera, no son diferentes (P<0.05). ABC= Medias con la misma literal mayúscula en una misma columna, no son diferentes (P< 0.05).

425

Primav.

Promedio Verano

Año 1

Año 2

0.33 a 0.34 a 0.13 a 0.34 a 0.28 a

0.23 b 0.22 b 0.12 a 0.31 ab 0.22 b

0.23 A 0.26 A 0.12 B 0.25 A 0.21 a

0.21 A 0.24 A 0.11 B 0.22 A 0.19 b

0.41 a 0.42 a 0.41 a 0.41 a

0.22 bc 0.22 b 0.24 b 0.22 b

0.25 0.25 0.24 0.24

0.24 A 0.25 A 0.21 C 0.23


Adelaido Rafael Rojas García, et al. / Rev Mex Cienc Pecu 2017;8(4):419-428

relacionándolo con la mayor temperatura, similar a lo encontrado en esta investigación(11).

meses del segundo año de evaluación. La poca densidad de tallos que presentó esta especie se puede atribuir a la edad de la pradera, ya que al inicio de la investigación llevaba tres años desde la siembra(18). Otro factor que pudo afectar la disminución en densidad de tallos fue la temperatura promedio máxima registrada durante primavera (26 o C; Figura 1), la cual superó considerablemente a la temperatura óptima de crecimiento de ballico perenne que es de 18 oC(25). Al respecto, algunos autores(4,26) han consignado que las altas temperaturas ocasionan reducción en el crecimiento y tasa de acumulación de forraje, por influencia directa de una menor tasa de aparición y expansión foliar(20,27). Varios investigadores reportan en ballico perenne mayor densidad de tallos en los meses con la temperatura mínima(11,28).

El ballico perenne no presentó diferencias estadísticas en el peso por tallo en promedio por año, y tampoco entre asociaciones en el primer año. Sin embargo, sí registró diferencias (Cuadro 3) entre asociaciones en el segundo año de evaluación siendo 20-70-10 y 70-20-10 de Ov-Ba-Tr, donde se registró el mayor peso por tallo con un promedio de 0.24 g tallo-1, mientras que el menor peso lo obtuvo la asociación 40-40-20 de Ov-Ba-Tr con 0.21 g (P<0.05). En primavera de ambos años se presentó el mayor peso por tallo de ballico perenne con un promedio de 0.42 g, mientras que el menor peso lo presentan principalmente las estaciones de invierno y otoño de ambos años con un promedio de 0.15 g (P<0.05).

El peso por tallo de pasto ovillo solo y asociado con ballico perenne y trébol blanco fue mayor (P<0.05) en el primer año de evaluación (0.21 vs 0.19 g tallo-1) en comparación con el segundo año (Cuadro 3). En primavera e invierno de ambos años se encontró el mayor y menor peso por tallo de pasto ovillo con promedios de 0.29 y 0.13 g tallo-1 (P<0.05). En las praderas de pasto ovillo en monocultivo (100-00-00) se presentó el menor peso por tallo (0.11 g tallo-1), mientras que en las asociaciones en promedio fue de 0.23 g tallo-1 (P<0.05).

El mayor y menor peso por tallo de ballico perenne al igual que en pasto ovillo es variable dependiendo de la asociación, temperatura máxima y mínima, mayor y menor horas luz registradas en el tiempo que transcurrió la investigación (Figura 1). Otros autores(22) en ballico perenne mencionan un mayor peso por tallo que en esta investigación, con 2.2 y 1.8 g tallo-1 en verano e invierno, respectivamente; sin embargo, era el primer año de evaluación, y en esta investigación llevaba tres años desde la siembra, por lo tanto la persistencia de ballico perenne disminuyó notablemente(18) y por consecuencia el peso por tallo. Otros autores, trabajando en praderas de ballico perenne en monocultivo(10) y asociado con ovillo y trébol blanco(11) reportaron durante primavera- verano mayor peso por tallo y en otoño e invierno el menor, similar a lo encontrado en esta investigación.

El mayor peso por tallo en las asociaciones se le puede atribuir a que existe un mayor aprovechamiento de recursos, ya que al estar asociado con la leguminosa y al poseer bacterias del género Rhizobium, fijan nitrógeno atmosférico al suelo y mediante simbiosis es aprovechado por las gramíneas, lo que ocasiona mayor rendimiento, peso por tallo y calidad, en comparación con la gramínea en monocultivo(29). Estos resultados son similares a los encontrados por diferentes investigadores, quienes evaluaron el pasto ovillo asociado con ballico perenne y trébol blanco(30-33) y en monocultivo(12,14,17), obteniendo en primavera y verano el mayor forraje producido, lo cual está estrechamente correlacionado con el mayor peso por tallo. En asociaciones se han registrado mayores pesos por tallo de pasto ovillo en verano,

La tasa de aparición y muerte de tallos en ambas gramíneas tendieron a disminuir; en contraste, la tasa de sobrevivencia aumentó conforme pasó el tiempo. La densidad poblacional de tallos de ballico perenne fue menor que la población de tallos de ovillo, y fue disminuyendo conforme aumentó la edad de la pradera. El mayor y menor peso por tallo en las dos gramíneas se presentó durante las estaciones de primavera e invierno; sin embargo, también en estas estaciones se observó menor y mayor densidad de tallos,

426


DINÁMICA POBLACIONAL DE TALLOS DE OVILLO, SOLO Y ASOCIADO

14. García E. Modificaciones al sistema de clasificación climática de Koppen. 4a ed. Ciudad de México: Universidad Nacional Autónoma de México; 2004.

dando como resultado una compensación tamaño/densidad. Se recomienda utilizar las asociaciones 70-20-10 y 40-40-20 de Ov-Ba-Tr, ya que obtuvieron mayor peso y densidad de tallos de ovillo.

15. Ortíz SC. Colección de monolitos. Depto. Génesis de suelos. Edafología, IRENAT. Colegio de Postgraduados. Montecillo, Texcoco, Estado de México. 1997. 16. Velasco ZME, Hernández-Garay A, González HVA. Curvas estacionales de crecimiento del ballico perenne. Rev Fitotecnia Mex 2002;(25):97-106.

LITERATURA CITADA 1.

Matthew C. Seasonal patterns of rood, tiller and leaf production in a Grassland Ruanui ryegrass sward. Proc N Z Grass Assoc 1996;(58):73-76.

17. Velasco ZME, Hernández-Garay A, González HVA, Pérez PJ, Vaquera HH, Galvis SA. Curva de crecimiento y acumulación estacional del pasto ovillo (Dactylis glomerata L.). Téc Pecu Méx 2001;39(1):1-14.

2.

Matthew C, Lemaire G, Sackville-Hamilton NR, Hernández-Garay A. A modified selfthinning equation to describe size/density relationships for defoliated swards. Annals Botany 1995;76(6):579587.

18. Rojas GAR, Hernández-Garay A, Quero CAR, Guerrero RJD, Ayala W, Zaragoza RJL, Trejo LC. Persistencia de Dactylis glomerata L. solo y asociado con Lolium perenne L. y Trifolium repens L. Rev Mex Cienc Agr 2016;7(4):885-895.

3.

Hodgson J. Grazing management. Science into practice. Harlow, England: Longman Scientific and Technical; 1990.

19. SAS. Institute. SAS/STAT® 9.2. User´s Guide Release. Cary, NC: SAS Institute Inc. USA. 2009.

4.

Hernández-Garay A, Hodgson J, Matthew C. Effect of spring grazing management on perennial ryegrass/White clover pastures. 2. Tiller and growing point densities and population dynamics. N Z J Agr Res 1997;40(1):37-50.

20. Durand JL, Schaufele R, Gastal F. Grass leaf elongation rate as a function of developmental stage and temperature: Morphological analysis and modeling. Annals Botany 1999;83(5):577-588.

5.

Hernández-Garay A, Matthew C, Hodgson J. Tiller size/density compensation in perennial ryegrass miniature swards subject to differing defoliation heights and a proposed productivity index. Grass Forage Sci 1999;54(4):347-356.

6.

Lemaire, G. Ecophysiology of grasslands: Dynamic aspects of forage plant population in swards. In: Proc XVII Int Grass Cong. Brazilian Soc Anim Husb Sociedade Brasileira de Zootecnia. Sao Paulo, Brasil. 2001:29-37.

7.

Pérez BMT, Hernández-Garay A, Pérez PJ, Herrera HJG, Bárcena GR. Respuesta productiva y dinámica de rebrote del ballico perenne a diferentes alturas de corte. Téc Pecu Méx 2002;40(3):251-263.

8.

Matthew C, Val Loo ER, Tom ER, Dawson LA, Care DA. Understanding shoot and root development. Proc XIX Int Grass Cong. Sao Paulo, Brasil. 2001.

9.

Duchini PG, Guzatti GC, Ribeiro Filho HMN, Sbrissia AF. Tiller size/density compensation in temperate climate grasses grown in monoculture or in intercropping systems under intermittent grazing. Grass Forage Sci 2013;(69):655-665.

21. Hernández-Garay A, Matthew C, Hodgson J. The influence of defoliation height on dry-matter partitioning and CO2 exchange of perennial ryegrass miniature swards. Grass Forage Sci 2000;55(4):372-376. 22. Garduño VS, Pérez PJ, Hernández-Garay A, Herrera HJG, Martínez HPA, Joaquín TBM. Rendimiento y dinámica de crecimiento estacional de ballico perenne, pastoreado con ovinos a diferentes frecuencias e intensidades. Téc Pecu Méx 2009;47(2):189-202. 23. Chapman DF, Lemaire G. Morphogenetic and structural determinants of plant regrowth after defoliation. Proc XVII Int Grassland Cong. New Zealand and Australia 1993:95-104. 24. Sanderson MA, Elwinger GF. Plant density and environment effects on orchardgrass–white clover mixtures. Crop Sci 2002;42(6):20552063. 25. Brock JL, Tilbrook JC. Effect of cultivar of white clover on plant morphology during the establishment of mixed pastures under sheep grazing. N Z J Agr Res 2000;43(3):335-343. 26. Duru M, Ducrocq H. Growth and senescence of the successive grass leaves on a tiller. Ontogenic development and effect of temperature. Annals Botany 2000;85(5):635-643.

10. Velasco ZME, Hernández-Garay A, González HVA. Cambios en componentes del rendimiento de una pradera de ballico perenne, en respuesta a la frecuencia de corte. Rev Fitotecnia Mex 2007;30(1):79-87.

27. Horrocks R, Vallentine JF. Harvested forages. Oval Road, London, USA: Academic Press; 1999. 28. Ganderats FS, Hepp KC. Mecanismos de crecimiento de Lolium perenne, Festuca arundinacea y Dactylis glomerata en la zona intermedia de Aysén. Agr Téc 2003;63(2):259-265.

11. Castro RR, Hernández-Garay A, Ramírez RO, Aguilar BG, Enríquez QJF, Mendoza PSI. Crecimiento en longitud foliar y dinámica de población de tallos de cinco asociaciones de gramíneas y leguminosa bajo pastoreo. Rev Mex Cienc Pecu 2013;4(2):201-215.

29. Nyfeler D, Huguenin-Elie O, Suter M, Frossard E, Lüscher A. Grasslegume mixtures can yield more nitrogen than legume pure stands due to mutual stimulation of nitrogen uptake from symbiotic and non-symbiotic sources. Agr Ecosys Environ 2011;140:155-163.

12. Hernández GFJ, Hernández-Garay A, Ortega JE, Enríquez QJF, Velázquez MM. Comportamiento productivo del pasto ovillo (Dactylis glomerata L.) en respuesta al pastoreo. Agronomía Mesoamericana 2015;26(1):33-42.

30. Castro RR, Hernández-Garay A, Vaquera HH, Hernández PGJ, Quero CAR, Enríquez QJF, Martínez HPA. Comportamiento productivo de asociaciones de gramíneas con leguminosas en pastoreo. Rev Fitotecnia Mex 2012;35(1):87-95.

13. Hodgson J, Da Silva SC. Options in tropical pasture management. Proc Ann Meet Brazilian Soc Anim Sci. Recife, Brazil. 2002:180202.

427


Adelaido Rafael Rojas García, et al. / Rev Mex Cienc Pecu 2017;8(4):419-428

blanco (Trifolium repens L.). Rev Mex Cienc Pecu 2015;6(3):337347.

31. Moreno CMA, Hernández-Garay A, Vaquera HH, Trejo LC, Escalante EJA, Zaragoza RJL, Joaquín TBM. Productividad de siete asociaciones y dos praderas puras de gramíneas y leguminosas en condiciones de pastoreo. Rev Fitotec Mex 2015;38(1):101108.

33. Rojas GAR, Hernández-Garay A, Ayala W, Mendoza PSI, Joaquín SC, Vaquera HH, Santiago HMA. Comportamiento productivo con praderas con distintas combinaciones de ovillo (Dactylis glomerata L.), ballico perenne (Lolium perenne L.) y trébol blanco (Trifolium repens L.). Rev Fac Cienc Agr. Universidad Nacional de Cuyo. Mendoza. Argentina. 2016 [en prensa].

32. Flores SEJ, Hernández-Garay A, Guerrero RJD, Quero CAR, Martínez HPA. Productividad de asociaciones de pasto ovillo (Dactylis glomerata L.), ballico perenne (Lolium perenne L.) y trébol

428


Rev Mex Cienc Pecu 2017;8(4):429-435

http://dx.doi.org/10.22319/rmcp.v8i4.4255

Eficiencia en el uso del agua de variedades de alfalfa (Medicago sativa L.) con sistema de riego subsuperficial Water use efficiency of alfalfa varieties (Medicago sativa) with subsurface irrigation system Ricardo A. Sánchez Gutiérreza*, Miguel Servin Palestinaa, Héctor Gutiérrez Bañuelosb, Alfonso Serna Péreza

RESUMEN Se realizó un estudio con el objetivo de evaluar la eficiencia del agua de riego en la producción de materia seca y proteína cruda en cinco variedades de alfalfa y dos sistemas de riego, en Zacatecas. La siembra se realizó el 2 de febrero del 2012 bajo un diseño de bloques completamente al azar con arreglo de parcelas divididas y tres repeticiones. Los sistemas de riego evaluados fueron goteo sub-superficial (RGS) e inundación en melgas; y las variedades Silverado, Júpiter, 58n57, Excelente, y Gigante. El análisis estadístico fue en un diseño de parcelas divididas mediante el paquete estadístico SAS. La producción de materia seca (PMS) no se afectó por el sistema de riego (P>0.05), con una media para el total de cinco cortes de 15,561 y 14,121 kg ha-1 para los sistemas RGS e inundación; respectivamente. En cuanto a variedades solamente se encontraron diferencias ( P<0.05) en el tercer corte para PMS, sobresaliendo Gigante y Júpiter con 4,638 y 4,263 kg ha-1; respectivamente. No hubo interacción entre riego*variedad (P>0.05). Los sistemas de riego no afectaron el porcentaje de proteína cruda y la producción de proteína cruda del forraje. El sistema RGS redujo en 44 % el volumen de agua aplicada en comparación al riego por inundación. Además en el mismo sentido incrementó la eficiencia del agua de riego en la producción de materia seca y proteína cruda del forraje en 49.2 y 50.9 % respectivamente. PALABRAS CLAVE: Alfalfa, Proteína cruda, Materia seca, Eficiencia hídrica.

ABSTRACT A study was carried out to evaluate the efficiency of irrigation water in the production of dry matter and crude protein in five varieties of alfalfa and two irrigation systems in Zacatecas. Planting date was on February 2012. Split plot design was used. Irrigation systems evaluated were subsurface drip (SSD) and basin flooding; and also the alfalfa varieties: Silverado, Jupiter, 58n57, Excellent and Giant. Statistical analysis performed was split plot using the SAS statistical package. The dry matter production (DMP) was not affected by the irrigation system (P>0.05), with an average for the total of five cuts of 15,561 and 14,121 kg ha-1 for SSD and basin flooding systems; respectively. As for varieties only differences (P<0.05) were found in the third cut to DMP, standing out Giant and Jupiter with 4,638 and 4,263 kg ha; respectively. There was no interaction between irrigation*variety (P>0.05). Irrigation systems did not affect the percentage of crude protein and crude protein production of forage. The SSD system reduced by 44 % the volume of water applied compared to the basin flooding. Moreover in the same way increased the efficiency of irrigation water in the production of dry matter and crude protein forage by 49.2 and 50.9 % respectively. KEY WORDS: Alfalfa, Crude protein, Dry matter, Water efficiency.

Recibido el 23 de agosto de 2016. Aceptado el 21 de marzo de 2017. a

Campo Experimental Zacatecas. INIFAP. Km. 24.5 Carretera Zacatecas-Fresnillo, 98500 Calera de V.R. Zacatecas, México.

b

Facultad de Medicina Veterinaria, Universidad Autónoma de Zacatecas. México.

*Autor de correspondencia: sanchez.ricardo@inifap.gob.mx

429


Ricardo A. Sánchez Gutiérrez, et al. / Rev Mex Cienc Pecu 2017;8(4):429-435

La alfalfa (Medicago sativa L.) es una leguminosa que se siembra en climas templados húmedos, áridos y semiáridos del mundo, para la alimentación de rumiantes productores de carne y leche. En el estado de Zacatecas, la alfalfa está posicionada dentro de las cadenas agrícolas con mayor importancia económica(1), e incrementó la superficie sembrada de 8,600 a 13,500 ha de 2000 a 2014(2). Su producción se lleva a cabo bajo condiciones de riego, específicamente con agua subterránea. Moreno et al(3) mencionaron que este cultivo demanda 15,000 m3 ha-1 de agua de riego, lo que representa, de acuerdo con la superficie sembrada actual, un volumen importante que incide en el abatimiento de los acuíferos. Esta leguminosa se adapta a diferentes ambientes, fija nitrógeno al suelo y produce forraje de excelente calidad nutricional. Pero su eficiencia en el uso del agua es menor que otras especies forrajeras anuales(4), por lo que es necesario incrementarla mediante el uso de tecnología.

la variedad adecuada(11). En cultivares o genotipos de alfalfa, varios investigadores reportan que el medio ambiente es un factor que influye en la producción y calidad del forraje, por lo que se deben seleccionar materiales que se adapten a las condiciones de manejo, suelo y clima de la región productora(12,13). En Zacatecas existe poca información sobre sistemas de riego y variedades de alfalfa que pudieran ser alternativas para incrementar el uso eficiente del agua de riego. Por lo que se realizó este estudio con el objetivo de evaluar la eficiencia del agua de riego en la producción de materia seca y proteína cruda en cinco variedades de alfalfa y dos sistemas de riego en el estado de Zacatecas. El experimento se estableció en los terrenos del Campo Experimental Zacatecas (INIFAP), localizado en las coordenadas geográficas de 102o 39’ O y 23o 36’ N a 2,192 msnm. El suelo es Kastanozem, color pardo o rojo y con horizontes de acumulación de carbonatos de calcio, franco areno arcilloso, materia orgánica de 1 a 2 %, pH 7.5 y profundidad 0.8 m. El clima es semiárido y la mayor concentración de lluvias se registra en julio y agosto. El promedio histórico de la precipitación acumulada durante el ciclo de cultivo (febrero a octubre) es de 340 mm. En 2012 la precipitación estuvo por debajo de lo esperado, ya que solamente se acumuló el 59.7 % (203 mm). Por otro lado la evapotranspiración fue superior un 12.5 % al promedio para el período de cultivo(14), acumulando un total de 1,469.7 mm (Figura 1).

Con la escasez de agua para el uso agrícola se han desarrollado estrategias para reducir la cantidad de agua aplicada a los cultivos, sin afectar el rendimiento, que incluyen el desarrollo de sistemas de riego más eficientes, programas de riego intermitentes y variedades resistentes al estrés hídrico(5). El riego por goteo subsuperficial (RGS) es una de las técnicas de irrigación más modernas y efectivas actualmente, ya que permite la aplicación de láminas de riego pequeñas a una mayor frecuencia y además reduce pérdidas de agua por evaporación directa, escurrimiento y percolación(6,7). La alfalfa establecida con RGS bajo condiciones de estrés hídrico ha mostrado habilidad para producir mejores rendimientos que otras leguminosas forrajeras en condiciones similares(8). Harmoney et al(9) mencionaron que aplicando láminas de riego mediante RGS con un volumen del 70 o 85 % de la evapotranspiración, no se afecta el rendimiento ni la calidad del forraje. Otros autores han encontrado que es posible someter al cultivo a estrés hídrico a partir de inicio de floración, y reducir la aplicación de agua de riego hasta un 50 % del consumo hídrico de la planta, sin afectar la producción y calidad de semilla(10).

La siembra se realizó con una sembradora tipo brillion el 2 de febrero del 2012 bajo un diseño de bloques completamente al azar con arreglo de parcelas divididas y tres repeticiones. La densidad de siembra fue de 30 kg ha-1 con una dosis de fertilización de 40-100-00 N-P-K respectivamente. Los tratamientos de la parcela grande fueron riego por inundación y riego por goteo subsuperficial (RGS); en la parcela chica se evaluaron variedades de diferentes compañías semilleras, utilizadas por productores de la región, Silverado, Jupiter, 58n57, Excelente y Gigante. En riego por gravedad se diseñaron melgas de 13 m de ancho por 50 m de largo y se dieron dos riegos por corte con tubería multicompuerta de 150 mm de diámetro. El riego se

Para hacer eficiente el uso del agua de riego con RGS, se deben de considerar factores como el tipo de suelo, prácticas de manejo y la elección de

430


EFICIENCIA EN EL USO DEL AGUA DE VARIEDADES DE ALFALFA CON SISTEMA DE RIEGO SUBSUPERFICIAL

aplicó con un gasto uniforme por compuerta, y se concluyó una vez que el manto del agua llegó hasta el otro extremo de la melga; de esta forma se aplicaron riegos que variaron de 12 a 15 cm de lámina. La lámina de riego aplicada por parcela y evento se estimó con un medidor volumétrico instalado al inicio de la tubería de riego, dividiendo el volumen de agua registrado sobre el número de parcelas regadas. La lámina de riego total aplicada en cada corte mediante riego por inundación se muestra en la Figura 2.

Para RGS se utilizó cintilla calibre 10 mil con un gasto por emisor de 1 L h-1 y una separación entre emisores de 0.20 m. La cintilla se colocó a una profundidad de 0.20 m con una separación entre líneas regantes de 0.80 m. El RGS se realizó con una frecuencia de tres días, utilizando la metodología de tanque evaporímetro tipo A descrito en el capítulo 4 de manual N° 56 de la FAO(15). Para obtener la evapotranspiración del cultivo se consideró un 80 % de la evapotranspiración de referencia (ETo). El volumen de riego aplicado para cada parcela y

Figura 1. Precipitación mensual y evapotranspiración del año 2012 en el Campo Experimental Zacatecas (INIFAP) 100

250

80

200

70 60

150

50 40

100

30 20

50

10 0

0

P2012

Phistórica

Evpo2012

Evpohistórica

Figura 2. Gasto de agua en el sistema de riego por goteo sub-superficial (RGS) e inundación

Lamina Riego (cm)

35.00 30.00 25.00 20.00 15.00 10.00 5.00 0.00 RGS Inundacion

2do corte 17.22 26.65

3er corte 20.33 31.76

431

4to corte 14.15 27.74

5to corte 11.93 28.11

Evapotranspiración (mm)

Precipitación (mm)

90


Ricardo A. Sánchez Gutiérrez, et al. / Rev Mex Cienc Pecu 2017;8(4):429-435

tratamiento se validó nuevamente con el medidor instalado al inicio de la tubería de riego. Es importante mencionar que el tanque evaporímetro de donde se obtuvieron los datos de evaporación se encontraba a 600 m de la parcela experimental.

Los análisis estadísticos se realizaron para un diseño experimental de bloques al azar, en arreglo de parcelas divididas utilizando el procedimiento Proc Mixed(17). Las medias se separaron mediante la prueba DMS al 5 % de probabilidad, también mediante el paquete estadístico SAS.

El primer corte se descartó por motivo de estandarización de las parcelas. Al segundo corte se realizaron los muestreos en cada unidad experimental, en donde la parcela útil constó de 2 m2 y se determinaron las siguientes variables:

Producción de proteína cruda (Kpc). Se obtuvo multiplicando los pares correspondientes de PMS por PC.

Los resultados de producción de materia seca evaluados en ambos sistemas de riego, no presentaron diferencias (P>0.05) tanto en cada corte como en la sumatoria (Cuadro 1). En PMS de variedades solamente se encontraron diferencias (P<0.05) en el tercer corte, sobresaliendo Gigante y Júpiter con 4638 y 4263 kg ha-1; respectivamente. No hubo interacción entre riego*variedad. Los rendimientos de forraje obtenidos son ligeramente mayores a los reportados para ambos sistemas de riego en Coahuila, con volumen promedio de agua de riego por corte de 2,500 m3 y 1,494.6 m3 para riego por inundación y RGS, respectivamente(18). Sin embargo, con el RGS se logró reducir en 44 % el volumen de agua aplicado (Figura 2). En Zacatecas la superficie con potencial para alfalfa bajo condiciones de riego es mayor a 700,000 ha(19) por lo que el RGS es una alternativa para reducir el volumen de agua que se aplica en riego por inundación.

Eficiencia del agua de riego en la producción de materia seca (EMS) y proteína cruda (EPC). Se dividió la PMS y Kpc entre la lámina de riego aplicada por cada uno de los sistemas de riego evaluados.

En porcentaje de proteína cruda del forraje y producción de proteína cruda total no se observaron diferencias (P>0.05) entre los tratamientos de riego (Cuadro 2). En el corte 3 y 5 las variedades

Producción de materia seca (PMS). Se calculó a partir de la producción de forraje verde de las parcelas y el porcentaje de materia seca de las muestras. En la parcela se estimó la producción de forraje verde y se obtuvo una muestra de 0.5 kg en peso verde para llevarla a una estufa a 600 C hasta llegar a peso constante, y así determinar el porcentaje de materia seca. Porcentaje de proteína cruda (PC). Las muestras con las que se determinó la materia seca se procesaron en un molino Willy con criba de 1 mm, y posteriormente se determinó PC mediante el método de Dumas por combustión(16).

Cuadro 1. Producción de materia seca de cinco variedades de alfalfa y dos sistemas de riego en Zacatecas, México (kg/ha) RGS Inundación V1 V2 V3 V4 V5 Riego*variedad

Corte 2

Corte 3

Corte 4

Corte 5

4255.3 ± 242 3802.2 ± 242 3707.7 ± 327 4507.8 ± 327 4037.0 ± 327 4196.6 ± 327 3694 ± 327 0.533

4317.9 ± 179 3994.2 ± 179 4092.2 ± 189 b 4638.6 ± 189 a 3879.5 ± 189 b 4263.1 ± 189 ab 3906.8 ± 189 b 0.0696

3379.9 ± 150 3075.9 ± 150 3215.2 ± 174 3314.3 ± 174 3071.4 ± 174 3048.0 ± 174 3490.2 ± 174 0.5966

3697.3 ± 253 3248.4 ± 249 3427.5 ± 252 3127.9 ± 275 3454.1 ± 252 3517.7 ± 252 3841.1 ± 254 0.1294

15561 ± 545 14121 ± 531 14443 ± 634 15362 ± 703 14442 ± 634 15025 ± 634 14933 ± 634 0.548

RGS= riego goteo subsuperficial; V1= Silverado; V2=Júpiter; V3=58n57; V4=Excelente; V5=Gigante. ab Valores con distinta literal son diferentes (P<0.05).

432


EFICIENCIA EN EL USO DEL AGUA DE VARIEDADES DE ALFALFA CON SISTEMA DE RIEGO SUBSUPERFICIAL

presentaron diferencias (P<0.05) de porcentaje de proteína cruda. La variedad Silverado fue la que acumuló el menor porcentaje con 19.6 siendo diferente (P<0.05) a las demás, que la superaron en un 20 % y estadísticamente fueron similares. Las variedades Júpiter, Excelente, Gigante y 58n57 sobresalieron (P<0.05) en la producción de proteína cruda total con rendimientos mayores a 3,000 kg. No se presentaron interacciones en riego*variedad. Las medias de proteína cruda concuerdan con los reportados en cuatro variedades de alfalfa en el Estado de México y con once variedades evaluadas en Yucatán(20,21). La proteína cruda del forraje de

alfalfa representa un parámetro importante para la alimentación animal, por lo tanto, las variedades Júpiter, Excelente y Gigante y tienen potencial de una mejor respuesta en los sistemas de producción. Con el riego por goteo sub-superficial se obtuvo la mayor (P<0.05) eficiencia en el uso de agua, la productividad fue de 2.44 kg MS m-3 y 0.51 kg PC m-3 de agua aplicada (Figura 3). Los resultados concuerdan con los obtenidos en la región Lagunera de México, donde la eficiencia del uso de agua con RGS con separación de 0.80 m por cintilla fue de 2.14 kg MS m-3, mientras que la eficiencia con riego

Cuadro 2. Porcentaje de proteína cruda y producción de proteína cruda (KpcT) para cinco variedades de alfalfa y dos sistemas de riego en Zacatecas, México RGS Inundación V1 V2 V3 V4 V5 Cort*variedad

Corte 2

Corte 3

Corte 4

Corte 5

19.2 ± 0.44 18.9 ± 0.44 18.3 ± 0.59 19.1 ± 0.59 19.0 ± 0.59 18.8 ± 0.59 19.9 ± 0.59 0.939

21.4 ± 0.80 22.6 ± 0.80 20.1 ± 0.94 b 23.3 ± 0.94 a 22.2 ± 0.94 a 22.5 ± 0.94 a 22.2 ± 0.94 a 0.6135

22.1 ± 0.75 22.8 ± 0.75 21.4 ± 0.64 22.6 ± 0.64 22.8 ± 0.64 22.6 ± 0.64 22.7 ± 0.64 0.59

21.1 ± 0.27 21.7 ± 0.25 20.3 ± 0.40 c 22.5 ± 0.45 a 21.3 ± 0.40 abc 21.7 ± 0.40 ab 21.2 ± 0.40 bc 0.698

Media

KpcT

20.9 ± 0.21 21.5 ± 0.21 20.0 ± 0.28 b 21.8 ± 0.28 a 21.3 ± 0.28 a 21.5 ± 0.28 a 21.5 ± 0.28 a 0.7389

3261.9 ± 120 3035.9 ± 117 2887.9 ± 129 b 3358.9 ± 142 a 3071.1 ± 129 ab 3222.9 ± 129 a 3203.7 ± 129 ab 0.5131

RGS= riego goteo subsuperficial; V1= Silverado; V2=Júpiter; V3=58n57; V4=Excelente; V5=Gigante. ab Valores con distinta literal son diferentes (P<0.05).

Figura 3. Eficiencia del agua en materia seca (EMS) y proteína cruda (EPC) de alfalfa con riego por goteo subsuperficial (RGS) e inundación 3

Kg m-3

2.5

a

2 1.5

b

1 a

0.5

b

0

EMS

EPC RGS

ab

Inundación

(P<0.05).

433


Ricardo A. Sánchez Gutiérrez, et al. / Rev Mex Cienc Pecu 2017;8(4):429-435

por inundación fue de 1.3 kg(22). Estos resultados de eficiencia de uso de agua en materia seca son similares a tratamientos de déficit hídrico, en donde la humedad del suelo fue de alrededor del 75 al 85 % de la capacidad de campo(6,23). También con estos niveles de irrigación la alfalfa mantiene la misma proteína cruda en comparación a ensayos que mantuvieron el 100 % de humedad a capacidad de campo(9). Con el RGS es posible maximizar la eficiencia en el uso del agua de riego, logrando obtener mayores cantidades de forraje seco y kilogramos de proteína cruda con un menor volumen de agua aplicado.

valores variaron de 1.9 a 2.6 kg m-3(23). La baja eficiencia se pudiera atribuir a que la precipitación del año 2012 fue inferior a los promedios históricos, y se consideró como un año con sequía severa(24), por lo que las variedades fueron menos eficientes. En otros estudios en donde se utilizaron algunas de estas variedades para la producción de materia seca, la variedad Júpiter reportó mejores rendimientos comparada con otras 16 variedades(20,25). Sin embargo, Jupiter al igual que 58n57, Excelente y Gigante, sobresalieron en EPC. El uso de estas variedades manejadas con un sistema de riego subsuperficial son una alternativa para hacer más eficiente el recurso agua en los sistemas de producción animal; también, contrarrestaría el abatimiento de los mantos acuíferos. Se recomienda continuar con la investigación en estas variedades por más de dos años bajo el sistema RGS para determinar el comportamiento productivo en las diferentes estaciones del año.

La eficiencia del uso del agua en la producción de materia seca (EMS) de las variedades evaluadas fue similar (P>0.05) (Figura 4). Los kilogramos producidos por metro cúbico de agua aplicado fueron desde 1.78 a 1.88. En la eficiencia del agua de riego en la producción de proteína cruda (EPC) se observaron diferencias (P<0.05) entre las variedades. Silverado presentó los valores más bajos con 0.35 kg de proteína cruda. Tanto en EMS como en EPC no se presentaron interacciones entre riego*variedad. Las variedades fueron ligeramente menores en EMS comparado con variedades en Wyoming bajo un 75 % de déficit hídrico, cuyos

El riego por goteo subsuperficial mejora la eficiencia en el uso de agua, disminuyendo un 44 % el volumen de agua de riego aplicada en comparación al riego por inundación, además de que logra mantener la misma producción de materia seca y proteína cruda del forraje de alfalfa.

Figura 4. Eficiencia del agua en materia seca (EMS) y proteína cruda (EPC) en cinco variedades de alfalfa evaluadas 2 1.8 1.6 1.4

kg m-3

1.2

1

EMS

0.8

EPC

0.6 0.4 0.2

a

b

a

ab

a

0

V1

V2

V3

Variedades ab

(P<0.05).

434

V4

V5


EFICIENCIA EN EL USO DEL AGUA DE VARIEDADES DE ALFALFA CON SISTEMA DE RIEGO SUBSUPERFICIAL

Las variedades de alfalfa evaluadas presentaron semejante eficiencia del uso de agua en la producción de materia seca; sin embargo, Jupiter, 58n57, Excelente y Gigante sobresalieron en la eficiencia del agua para la producción de proteína cruda.

12. Julier B, Huyghe Ch, Ecalle Ch. Within- and among-cultivar genetic variation in alfalfa: forage quality, morphology, and yield. Crop Sci 2000;(40):365-369.

LITERATURA CITADA

15. Allen R, Pereiras LS, Raeks D, Smith M. Evapotranspiración del cultivo. Guías para la determinación de los requerimientos de agua de los cultivos. Roma, Italia: FAO; 2006.

1.

13. Humphries AW, Hughes SJ. Preliminary evaluation of diverse Lucerne (Medicago sativa spp) germplasm to identify new material for livestock and cropping based farming system in Australia. Aus J Agri Res 2006;(57):1297-1306. 14. Medina GG, Ruiz CA. Estadísticas climatológicas básicas del estado de Zacatecas (Periodo 1961-2003). 1ª ed. México: INIFAP; 2004.

Sánchez TBI, Zegbe DJA, Rumayor RAF, Moctezuma LG. Estructura económica competitiva del sector agropecuario de Zacatecas: un análisis para agrocadenas. Rev Mex Agro 2013;(33):552-563.

2.

Servicio de Información Agroalimentario y Pesquera (SIAP). Anuario estadístico de la producción agrícola. 2014.

3.

Moreno DL, García AD, Faz CR. Producción y utilización de la alfalfa en zona norte de México. Campo Experimental La Laguna. CIRNOC. INIFAP. Libro técnico No. 2. 2000.

4.

Hirth JR, Haines PJ. Ridley AM, Wilson KF. Lucerne in crop rotation on the Riverine Plains 2. Biomass and grain yields, water use efficiency, soil nitrogen, and profitability. Aust J Agric Res 2001;(52):279-293.

5.

Howell TA. Enhacing water use efficiency in irrigate agriculture. Agr J 2001;93(2):281-289.

6.

Ismail SM, Alarshadi MH. Maximizing productivity and water use efficiency of alfalfa under precise subsurface drip irrigation in arid regions. Irrig Drain 2013(62):57-66.

16. AOAC. Oficial Methods of Analysis. 16th ed Assoc. Off Anal Chem, Arlington, VA. 1996. 17. SAS. User Guide. Statistical Analysis System. Inc. Cary, NC. versión 9.1. 2006. 18. Godoy AC, Pérez GA, Torres EC, Hermosillo LJ, Reyes JI. Uso de agua producción de forraje y relaciones hídricas en alfalfa por riego por goteo subsuperficial. Agrociencia 2003;37(2):107-115. 19. Medina GG, Salinas GH, Rubio AF. Potencial productivo de especies forrajeras en el estado de Zacatecas. 1er ed. Zacatecas, México. 2001. 20. Camacho GJL, García MJG. Producción y calidad de forraje de cuatro variedades de alfalfa asociada con trébol blanco, ballico perenne, festuca alta y pasto ovillo. Vet Mex 2003;34(2):149-177.

7.

Alam M, Trooein TP, Dumler TJ, Rogers DH. Using subsurface drip irrigation for alfalfa. J Am W Res Ass 2002;38(6):1715-1721.

21. Urbano D, Davila C. Evaluación del rendimiento y composición química de once variedades de alfalfa (Medicago sativa) bajo corte en la zona alta del estado de Mérida, Venezuela. Rev Fac Agron 2003;(20):97-107.

8.

Brown HE, Moot DJ, Pollock KM. Herbage production, persistence, nutritive characteristics and water use of perennial forages grown over 6 years on a Wakanui silt loam. N Z J Agr Res 2005;(48):423439.

22. Montemayor TJA, Aguirre AHW, Olague RJ, López AR, Rivera GM, Preciado RP, et al. Uso del agua en alfalfa (Medicago sativa) por riego por goteo subsuperficial. Rev Mex Cienc Pecu 2010;1(2):145156.

9.

Harmoney KR, Lamm FR, Johnson SK, Aboukheira AA. Reducing water inputs with subsurface drip irrigation may improve alfalfa nutritive value. Forage Graz 2013:1-8.

23. Carter C, Garcia GA, Islam MA, Hansen K. Effect of deficit irrigation on water use and water use efficiency of alfalfa. ASSABE Meet Pres 2013:1-14.

10. Shock CC, Feibert EBG, Saunders LD, Klauzer J. Deficit irrigation for optimum alfalfa seed yield and quality. Agronomy J 2007;99(4):992-998.

24. Medina GG, Ramirez CNYZ, Baez GAD. Reporte agrometeorológico, septiembre 2012. Folleto informativo. Zacatecas, México. 2012. 25. Morales AJ, Jiménez VJL, Velasco VVA, Villegas AY, Enríquez JR, Hernández GA. Evaluación de 14 variedades de alfalfa con fertirriego en la Mixteca de Oaxaca. Téc Pecu Méx 2006;44(3):277288.

11. Almarshadi MH, Ismail SM. Effects of precision irrigation on productivity and water use efficiency of alfalfa under different irrigation methods in arid climates. J Appl Sci Res 2011;7(3):299-308.

435


Rev Mex Cienc Pecu 2017;8(4):437-443

http://dx.doi.org/10.22319/rmcp.v8i4.4197

Macro-mineral concentrations in soil and forage in three grassland sites at Zacatecas Concentración de macro minerales en el suelo y forraje de tres sitios en Zacatecas M. Márquez-Madridab, H. Gutiérrez-Bañuelosa, R. Bañuelos-Valenzuelaa, A. Muro-Reyesa, R. David Valdez-Cepedabc* ABSTRACT Mineral concentration in forage is an important factor for extensive livestock production. Therefore, a study was performed in order to evaluate the soil mineral contents and their relationships with forage mineral concentrations taking into account three grassland sites located at Zacatecas state, México. Soil organic matter (OM) content and pH as well as soil and forage contents of Ca, P, Mg, Na and K were estimated. Soil OM contents were not different (P>0.05) among sites averaging 2.99 %. Soil pH of site 2 was higher (P0.05) than those of sites 1 and 3. Soil of site 2 had higher P, Ca and Mg concentrations than the minimum contents used as references. Soil contents of Na and K were lower than the reference contents suggesting deficiencies in all three sites. Considering requirements for growing cattle, P, Ca and Na were at insufficient levels in forage from all three sites. Significant correlations (r Pearson) suggest a positive effect of soil P content on forage P and Mg concentrations. Soil P content could affect forage Ca concentration and Ca:P ratio. Other correlations suggest soil Ca negative effects on forage Ca concentration and Ca:P ratio. KEY WORDS: Phosphorus, Calcium, Magnesium, Sodium, Potassium.

RESUMEN La concentración de los minerales en el forraje es un factor importante en la ganadería extensiva. Por consiguiente, un estudio se realizó para evaluar los contenidos de minerales en el suelo y sus relaciones con las concentraciones de los minerales en el forraje, al involucrar tres sitios de pastizales en el estado de Zacatecas, México. Se estimó el contenido de materia orgánica (MO) y el pH del suelo, así como las concentraciones de Ca, P, Mg, Na y Mg en suelo y forraje. Los contenidos de MO en el suelo no fueron diferentes (P>0.05) entre sitios con un promedio de 2.99 %. El pH del suelo del sitio 2 fue mayor (P0.05) que el pH de los suelos de los sitios 1 y 3. Las concentraciones de P, Ca y Mg en el suelo del sitio 2 fueron mayores que los contenidos de referencia. Los contenidos de Na y K en los suelos de los tres sitios fueron menores que los valores de referencia, lo cual sugiere deficiencias. Al considerar los requerimientos del ganado vacuno en crecimiento, P, Ca y Na estuvieron a niveles de insuficiencia en el forraje de los tres sitios. Correlaciones significativas (r Pearson) sugieren un efecto positivo del P en el suelo sobre P y Mg en el forraje. El P del suelo puede afectar al Ca y a la proporción Ca:P del forraje. Otras correlaciones sugieren efectos negativos del Ca en el suelo sobre el Ca y la proporción Ca:P en el forraje. PALABRAS CLAVE: Fósforo, Calcio, Magnesio, Sodio, Potasio.

Recibido el 20 de julio de 2016. Aceptado el 20 de marzo de 2017. a

Universidad Autónoma de Zacatecas, Unidad Académica de Medicina Veterinaria y Zootecnia, Programa de Doctorado en Ciencias Pecuarias. CP 98500. Calera de V.R., Zacatecas, México. E-mails: ac10279@chapingo.mx (MM-M), gtzbahector@hotmail.com (HG-B), apozolero@hotmail.com (RB-V), amurey@hotmail.com (AM-R). b

Universidad Autónoma Chapingo, Centro Regional Universitario Centro-Norte. CP 98053. Km 24.5 Carretera Zacatecas-Fresnillo. Morelos, Zacatecas, México.

c

Universidad Autónoma de Zacatecas, Unidad Académica de Matemáticas. Paseo la Bufa, Calzada Solidaridad. CP 98060. Zacatecas, Zac., México.

*Corresponding Author: name. E-mail: vacrida@hotmail.com

437


Ricardo David Valdez-Cepeda, et al. / Rev Mex Cienc Pecu 2017;8(4):437-443

Mineral elements are essential nutrients for animals and have effects on livestock performance(1). In fact, minerals represent 5 % of the body weight(1). Most of this weight corresponds to seven macro-minerals or macronutrients, which play important roles in the animal body. For instance, Calcium (Ca) and phosphorus (P) are structural components of bones and teeth(2). Potassium (K) is important in acid-base balance, regulation of osmotic pressure, water balance, muscle contractions, nerve impulse transmission and certain enzyme reactions(2). Magnesium (Mg) activates more than 300 enzymes(3). Sodium (Na) and Chlorine (Cl) are involved in maintaining osmotic pressure, controlling water balance, and regulating acid-base balance(2). Sulfur (S) is a component of methionine, cysteine, B-vitamins, and other organic compounds(2). Therefore, ensuring an adequate supply of mineral nutrients to livestock is essential for maintaining their growth, health and reproduction(4). In that context, forage nutrient target values have been proposed to provide growing cattle and lactating cow requirements(1,2).

grasslands, dominant species belong to perennial and yearly grasses of the genus Bouteloua, Aristida, Lycurus and Muhlenbergia(9). Then, knowledge on such a topic might be useful to make decisions towards improving the use of the resources involved in the production system, mainly during summer and early autumn when there is maximum forage yield due to rainfall distribution. Therefore, the aim of this research work was to evaluate the soil mineral contents and their relationships with forage mineral concentrations taking into account three grassland sites located at Zacatecas state, México. A fieldwork was carried out during the end of the rainy season (October, 2013) throughout three beef cattle sites within the territory of Zacatecas state, Mexico. All three sites were managed under the called cow-calf production system. Site 1 is located between the coordinates 23º 40’ and 23º 39’ N, and between 103º 28’ and 103º 27’ W at an altitude of about 2,250 m; it corresponds to an open medium size grassland; this site is within an area of 406 ha, which maintained 45 animal units during all year. Site 2 is between 23º 18’ and 23º 17’ N, and between 102º 46’ and 102º 47’ W at an altitude of about 2,110 m; this site belongs to an open medium size shrub-grassland associated with cactus; it is within an area of 482 ha, which maintained 35 animal units during the four seasons. Site 3 is allocated between 23º 29’ and 23º 27’ N, and between 103º 42’ and 103º 4’ W at 2,240 m; it corresponds to an open medium size grassland within an area of 170 ha, which maintained 32 animal units during summer and autumn. Climate of all three sites is classified as semi-dry (BS1kw), with annual mean temperature and yearly mean rainfall of 16 to 18 °C and 400 to 500 mm, respectively(10). In all three sites, dominant grass species included Bouteloua gracilis (blue grama), Bouteloua curtipendula (Sideoats grama), Lycurus phleoides (common wolf tail), Aristida arizonica (Arizona threeawn grass) and Aristida divaricata (poverty three awn), Muhlenbergia porter (bush muhly), and Microchloa kunthii (Kunth’s smallgrass).

There is widely recognized that the main source of minerals for animals is forage. Forage is plant material (mainly plant leaves and stems) eaten by grazing livestock. Forage yield and its mineral composition varies among grassland areas and perhaps within each of them. Forage yield and its mineral composition depend on soil and climate factors, botanical composition, and plants age, among other issues. For instance, low availability of P and Na could be the primary reason for mineral deficiencies in grazing animals(5). That is, grasslands could provide insufficient quantities of macronutrients to meet animal requirements(6). There is known insufficiency of at least one of the macronutrients may affect animal growth, and its health and reproductive functions(7). This type of situations may be improved through mineral supplementation(2,4). Nonetheless, many managers of grasslands do not know current forage composition and its relationships with limitative factors. This is the case of Zacatecas state, Mexico ranchers. This state has 494,203 ha of natural grasslands(8), which are mainly managed under the called cow-calf production system. Along these

For surface soil (0 to 15 cm) samples collection using Rodríguez and Rodríguez(11) procedure. Each site was divided in four sections. A total of 40 samples were collected from each section. Then,

438


MACRO-MINERAL CONCENTRATIONS IN SOIL AND FORAGE IN THREE GRASSLAND SITES AT ZACATECAS

these 40 samples were mixed to obtain a composite sample. So, four composite soil samples belonged to each site. As a result and taking into account the three sites, 12 composite soil samples were obtained.

at 600 °C during 8 h. Hydrochloric and nitric acids were used to degrade resultant ash. Calcium, K, Mg, and Na concentrations were obtained by an atomic absorption spectrophotometry (Varian, AA240FS)(19). Phosphorus concentration was determined by spectrophotometry (UV/VIS Lambda 2, Perkin Elmer). Relationship K/(Ca+Mg) was calculated in miliequivalents, mEq(20).

Forage samples were taken following the same sections used for soil sampling. In other words, each site was divided in four sections. Forage samples were collected from each site using the “hand plucking” simulation technique(12). As a result, four forage samples belonged to each site, obtaining a total of 12 forage samples.

Soil and forage samples were randomly collected at field. Measured variables were soil available P, Ca, Mg, Na, and K contents, and soil pH and organic matter content (OM). In addition, forage concentrations of these macronutrients (P, Ca, Mg, Na, and K) were measured. Soil mineral contents were contrasted with soil reference contents pointed out by McDowell(21) for P, Ca and K, and Rhue and Kidder(22) for Mg and Na. In addition, estimated forage mineral mean concentrations were compared with cattle mineral requirements(1,2).

All 12 composite soil samples were dried at 60 °C during 48 h, and sieved through a 2 mm screen. Afterwards, soil pH was determined through a pH meter using a supernatant suspension of a mixed soil to water ratio of 1:2. Available P was measured by means of two different techniques: if pH was alkaline, Olsen et al(13) method was performed by using 0.5M of NaHCO3 adjusted at 8.5 pH; and when pH was acid, the other technique(14) was carried out by using a extraction solution of HCl and NH4F. Cations Ca, Mg, K and Na were extracted by shaking 3 g of air-dried soil in 30 mL of 1M NH4OAc for 30 min; extracts were centrifuged(15), and the supernatant was decanted and analyzed by spectrometry(16,17). Organic matter of soil was determined through organic carbon content using Walkley and Black approach(18).

Soil and forage variables were analyzed under a completely random design. The analyses of variance were performed using the General Lineal Model(23) and the factor site as main effect. The Tukey test (P≤0.05) was used to compare mean effects of sites, that is, Ho: site 1=site 2=site 3. In addition, Pearson correlation coefficients (r, P≤0.05) were computed to identify the degree of linear relationships between soil and forage variables trough the PROC CORR in the Statistical Analysis System(23).

All 12 forage samples were dried at 60 °C during 48 h and ground through a 1 mm screen in a Wiley mill. Ash was determined by tissue incineration

Soil OM contents varied from 2.83 to 3.15 % averaging 2.99 % (Table 1). OM contents from soils

Table 1. Mineral mean concentrations, pH and organic matter (OM) in soil samples collected from three native rangelands (Sites) used for beef cattle in Zacatecas state, Mexico 1 P, mg kg-1u Ca, mg kg-1 Mg, mg kg-1 Na, mg kg-1 K, mg kg-1 pH OM, %

5.58 a 41.95 a 28.93 a 5.45 a 27.75 a 6.35 a 3.15 a

Site 2 92.90 b 83.20 b 53.93 b 4.38 a 17.03 a 8.33b 3.00 a

3 4.40 a 23.65 a 23.88 a 1.10 a 16.80 a 6.13 a 2.83 a

Mean Standard Error 13.10 7.73 4.28 0.85 2.58 0.30 0.22

P <0.001 <0.001 <0.001 0.076 0.137 <0.001 0.863

Soil content suggesting deficienciesw <10 <70 <30 <62 <59 5.8-7.5 1.8-3.5

P, Ca and K(21), and Mg and Na(22) contents suggesting deficiencies; ideal pH interval for most of the plants and organic matter content range (%) for non-volcanic soils(11). For soil samples from the sites 1 and 3, P was determined by means of the Bray y Kurtz(14) approach; and for soil samples from the site 2, the Olsen et al(13) procedure was used. ab Means with different letters within each row indicate difference among sites (P<0.05). w u

439


Ricardo David Valdez-Cepeda, et al. / Rev Mex Cienc Pecu 2017;8(4):437-443

of the three sites are within the range linked to plant nutrient deficiencies. Soil OM contents were not different among the three sites. Thus, these three sites have soils with medium OM content as pointed out by others(11). The OM values of the mentioned range are higher than that reported by Echavarría et al(24) for the case of a natural grassland composed by thorny bushes and cacti in the Zacatecas state, Mexico. This difference could be due to yearly produced forage in the three sites is not entirely used by livestock, then, surplus forage should be incorporated into the soil, whereas the grassland of the cited case was under overgrazing condition.

could be limitative factors of plant growth in the sites 1 and 3, which reinforce the result on soil pH. Contents of Na and K in soils from all three sites are lower than those reported as soil reference levels suggesting deficiencies. Moreover, soil Na and K concentrations were not statistically different among all sites under study. Therefore, soil Na and K concentrations suggest both macro-minerals could be limitative nutrients of plant growth in all three sites. Notably, P, Ca, Mg and Na concentrations in forage from all three sites were strongly lower (P≤0.05) than those considered as requirements for growing cattle and lactating cows, except Mg content in forage from the site 2 for growing cattle case (Table 2). These results suggest P, Ca, Mg and Na deficiencies in foraging plants from all three sites. In addition, K/Ca+Mg index in forage from all three sites was lower than the references for growing cattle and lactating cows. On the other hand, forage from sites 1 and 2 shown higher K concentrations than requirements for growing cattle and lactating cows. In addition, Ca:P ratio in forage from the site 2 did not surpass the reference value for both growing cattle and lactating cow. Ca:P ratio in forage from the site 1 was higher than the reference value for growing cattle, and Ca:P ratio in forage from the site 3 was higher than both growing cattle and lactating cow reference values.

Values of pH corresponding to soils of the sites 1 and 3 are within the range linked to plant nutrient deficiencies but that to soil of the site 2 is higher than the upper limit of such a range. Soil pH of site 2 was higher (P0.05) than those of sites 1 and 3. Remarkably, values of soil pH <6.5 were estimated for the sites 1 and 3; then, this soil condition could diminish P, Ca and Mg absorption by plants(11). On the other hand, soil pH=8.33 could be too alkaline for most plants in the site 2 case. This situation explains, in part, why soil of the site 2 soil had higher available P than soils of the sites 1 and 3. Concentrations of P, Ca and Mg from soil of the site 2 were higher than the soil reference content. On the other hand, those from soils of the sites 1 and 3 were lower than the target. In addition, soil P, Ca and Mg mean contents were strongly different (P≤0.001) among sites. Therefore, soil P, Ca and Mg

The evidenced P deficiency in all three sites agrees with a marginal P deficiency for range

Table 2. Forage mineral concentrations at native rangelands (Sites) used for beef cattle in Zacatecas state, Mexico Site Mineral P, % Ca, % Mg, % Na, % K, % Ca:P K/Ca+Mg, mEqv

1 0.17ab 0.21a 0.07ª 0.05ª 0.72ª 1.34ab 1.20a

2 0.23b 0.18a 0.10b 0.04ª 0.72ª 0.80b 1.04ª

3

Mean Standard Error

0.10a 0.23a 0.08ª 0.04ª 0.57ª 2.47ª 0.81ª

0.0177 0.0103 0.0063 0.0055 0.0394 0.2590 0.0848

Mineral minimum requirements for growing and lactation beef cattle(1,2). potential, mEq(20). ab Means within a row with different superscript differ (P<0.05). w

v Tetany

440

Reference value (Requirement)w p 0.002 0.075 0.022 0.664 0.236 0.008 0.176

Growing cattle 0.25 0.30 0.10 0.06–0.08 0.60 1.1 <2.2

Lactating cow 0.25 0.30 0.20 0.10 0.70 2 <2.2


MACRO-MINERAL CONCENTRATIONS IN SOIL AND FORAGE IN THREE GRASSLAND SITES AT ZACATECAS

forages (foliage from trees and cacti) from seven locations within the territory of Durango State, Mexico(25). It is noteworthy the results on P may be considered as similar to findings of other research(26), who reported P contents of 0.13 % for a grassland in Durango state, Mexico. Those agreements can be explained because the sites of our study and that grassland are within the Chihuahua Desert.

reference values, there persist a risk of grass tetany or hypomagnesaemia occurrence in lactating cows grazing, especially at the sites 1 and 3 because of the forage having Ca and Mg at insufficiency levels. Soil pH was positively correlated with P and Mg concentrations in forage and negatively correlated with Ca content and Ca:P ratio in forage (Table 3). These results suggest as pH increase, P and Mg contents in forage tend to be higher, and Ca content and Ca:P ratio in forage tend to be lower. The alkaline soil pH could explain P, Ca and Mg high availability in the site 2 case.

Concentrations of Ca in forage from all three sites and those corresponding to requirements are lower than that (0.57 %) found by Murillo et al(26). This disagreement is unexplained because in that work did not report soil Ca content and botanical composition. In addition, the case of the resulting Mg deficiency in forage from all three sites is similar to other report(27) in the case of oats and ryegrass in Northwestern Florida, United States of America.

Soil available P content showed significant (P≤0.05) positive linear correlations with P and Mg concentrations in forage as well as negative linear correlations with Ca concentration and Ca:P ratio in forage. These correlations suggest positive effects of soil P content on P and Mg concentrations in forage, and indicate negative effects of soil P content on Ca concentration and Ca:P ratio in forage. These results could be explained because of the restricted quantity of available P in the soil from the sites 1 and 3 (Table 1) and to the fact that Ca fixes P at the interchange sites in alkaline soils.

Concentrations of Na and K in forage from all three sites and those considered as requirements are lower than those reported elsewhere (i.e. Na =0.15 %(26) and K=1.1 %(28) in forage) for grasslands at Durango state, Mexico. It is not easy explaining those disagreements because they did not report soil K and Na contents and botanical composition.

Available Ca in the soil was positively correlated (P≤0.05) with P and Mg concentrations in forage and negatively with Ca concentration and Ca:P ratio in forage. Those correlations indicate positive effects of soil Ca on P and Mg concentrations in forage, and suggest soil Ca negative effects on Ca concentration and Ca:P ratio in forage. These results suggest plants prefer to take up calcium phosphates and

Concentrations of P and Mg as well as the Ca:P ratio showed strong differences (P≤0.05) among sites. On the other hand, differences of Ca, Na, K, and the K/Ca+Mg index among sites were not significant (P>0.05). Nonetheless, due that K/Ca+Mg values did not surpass both mentioned

Table 3. Pearson correlation coefficients (r) between soil and forage variables Plant (%) P P

Ca

Soil (mg kg-1) Mg

r p

0.758 0.004

0.845 0.001

0.752 0.005

Ca

r p

-0.590 0.043

-0.706 0.010

-0.750 0.005

Mg

r p

0.740 0.006

0.609 0.036

r p

-0.608 0.036

-0.772 0.003

Ca:P

Na NS -0.719 0.008

NS -0.700 0.011

NS= Not significant.

441

-0.601 0.039 NS

-0.601 0.039

pH 0.804 0.002

0.751 0.005 -0.654 0.021


Ricardo David Valdez-Cepeda, et al. / Rev Mex Cienc Pecu 2017;8(4):437-443

many Ca ions were fixed as its availability increased, whereas soils could had have a low potential to fix natural P. This late idea is supported by Gagnon et al(29) finding in the case of alkaline soils.

affect forage Ca concentration and Ca:P ratio. Other important correlations indicate positive effects of soil Ca on forage P and Mg concentrations, and suggest soil Ca negative effects on Ca concentration and Ca:P ratio in forage. The lack of correlation between soil available Mg content and Mg concentration in forage suggest soil available Mg content could be a limitative factor as pointed out ut supra, that is, it is at insufficiency levels in the soil, especially in the sites 1 and 3. Moreover, available Na in soil of the three sites was at insufficiency level. Then, the evidenced nutrient insufficiencies can be improved through increasing nutrient forage concentrations by means of soil or foliar fertilization, or including these minerals in food intake.

Soil available Mg content showed a significant (P≤0.05) positive linear correlation with P concentration in forage and negative correlations with Ca concentration and Ca:P ratio in forage. These results mean P concentration in forage increased as soil available Mg content did, whereas Ca concentration and Ca:P ratio in forage decreased as soil available Mg increased. However, due to the lack of correlation between soils available Mg content and Mg concentration in forage, there appear soil available Mg content could be a limitative factor as pointed out ut supra, that is, it is at insufficiency levels in the soil, especially in the sites 1 and 3.

ACKNOWLEDGEMENTS Thanks to “Centro de Investigaciones en Recursos Naturales y Medio Ambiente” of the “Universidad Autónoma Chapingo”, which partially supported the research project through the grant number 147302001.

Available Na in the soil was negatively correlated with Ca concentration and Ca:P ratio in forage. These relationships suggest that whereas available Na increased in the soil, Ca concentration and Ca:P ratio in forage diminished. However, due to available Na in soil is at insufficiency level, there remains the idea on improving this situation throughout inclusion of such a mineral in food intake.

CITED LITERATURE

In general, results suggest current situation of P and Ca insufficiencies in forage could affect growth of cattle and food use efficiency(1). Consequently, these problems should be solved through increasing P and Ca concentrations by means of soil or foliar fertilization or including these minerals in food intake. In general, soil of the site 2 showed better conditions for plant growth than those of the sites 1 and 3. Nonetheless, Na and K in soil could be limitative nutrients of plant growth in all three sites. Macro-minerals P, Ca and Na in forage from all three sites were at insufficient levels for growing cattle and lactating cows. Concentration of Mg in forage from sites 1 and 3 were at insufficient levels, and K in forage was at insufficient level in the site 3, mainly for growing cattle. Significant correlations suggest a positive effect of soil P content on forage P and Mg concentrations, and indicate soil P content may

442

1.

McDowell LR, Arthington JD. Minerales para rumiantes en pastoreo en regiones tropicales. 4ª ed. Universidad de Florida, Gainesville, Florida, USA; 2005.

2.

National Research Council (NRC). Nutrient requirements of beef cattle. Seventh rev ed. Washington, DC, USA: National Academy Press; 2000.

3.

Wacker WEC. Magnesium and man. Cambridge, Mass., USA: Harvard University Press; 1980.

4.

Jones GB, Tracy BF. Evaluating seasonal variation in mineral concentration of cool‐season pasture herbage. Grass Forage Sci 2013;70:94-101.

5.

Suttle NF. Mineral nutrition of livestock. Cabi. 2010.

6.

Grings EE, Haferkamp MR, Heitschmidt RK, Karl MG. Mineral dynamics in forages of the Northern Great Plains. J Range Manage 1996;49:234-240.

7.

Spears JW. Minerals in forages. In: Fahey GC editor. Forage quality, evaluation, and utilization. Madison, WI, USA: ASA, CSSA; 1994:281-317.

8.

Instituto Nacional de Estadística y Geografía. Anuario estadístico y geográfico de Zacatecas. Instituto Nacional de Estadística y Geografía. Aguascalientes, Ags. México. 2014.

9.

Trejo HR. Respuesta de dos zacates de un pastizal semiárido a diferentes intensidades y épocas de utilización [tesis licenciatura]. Saltillo, Coahuila, México. Universidad Autónoma Agraria Antonio Narro; 2005.


MACRO-MINERAL CONCENTRATIONS IN SOIL AND FORAGE IN THREE GRASSLAND SITES AT ZACATECAS

10. García E. Modificaciones al sistema de clasificación climática de Kôppen. Instituto de Geografía, Universidad Nacional Autónoma de México. México, DF. 1988.

21. McDowell LR. Detection of mineral status of grazing ruminants. In: McDowell LR editor. Nutrition of grazing ruminants in warm climates. Florida. USA: Academic Press, Inc; 1985:339-357.

11. Rodríguez H, Rodríguez J. Métodos de análisis de suelo y plantas. Criterios de Interpretación. 2da ed. México: Trillas; 2011.

22. Rhue RD, Kidder D. Analytical procedures used by the IFAS extension soil laboratory and the interpretation of results. Soil Sci Dept. Univ of Florida, Gainesville. USA. 1983.

12. Wayne CC. Collection forages samples representative of ingested material of grazing animals for nutritional studies. J Anim Sci 1964;23:265-270.

23. Statistical Analysis System (SAS) Institute Incorporation. SAS/STAT User’s Guide. SAS Publishing, Cary, NC, USA. 2001.

13. Olsen SR, Cole CV, Watanabe FS, Dean LA. Estimation of available phosphorus in soils by extraction with sodium bicarbonate. USA Department of Agriculture, Circular No. 939. 1954.

24. Echavarría FG, Serna A, Bañuelos R. Influencia del sistema de pastoreo con pequeños rumiantes en un agostadero del semiárido zacatecano: II. Cambios en el suelo. Rev Mex Cienc Pecu 2007;45:177-194.

14. Bray RH, Kurtz LT. Determination of total, organic, and available forms of phosphorus in soils. Soil Sci 1945;59:39-46.

25. Guerrero-Cervantes M, Ramírez RG, González-Rodríguez H, CerrilloSoto A, Juárez-Reyes A. Mineral content in range forages from north Mexico. J Applied Anim Res 2012;40(2):102-107.

15. Thomas GW. Exchange cations. In: Page AL, et al. editors. Methods of soil analysis. Part 2. Chemical and microbiological properties. 2nd ed. Madison, WI, USA: ASA, SSSA; 1982:159-165.

26. Murillo OM, Herrera E, Carrete FO, Ruiz O, Serrato JS. Chemical composition, in vitro gas production, ruminal fermentation and degradation patterns of diets by grazing steers in native range of North Mexico. Asian-Aust J Anim Sci 2012;25:1395-1403.

16. Fassel VA, Kniseley RN. Inductively coupled plasma optical emission spectroscopy. Anal Chem 1974;46(13):1110A-1120A. 17. Dahlquist RL, Knoll JW. Inductively coupled plasma-atomic emission spectrometry: Analysis of biological materials and soils for major trace, and ultra-trace elements. Appl Spectroscopy 1978;32(1):1-30.

27. Spann AJ, Carter JN, McDowell LR, Wilkinson NS, Myer RO, Maddox MK, Brennan M. Forage mineral concentrations and mineral status of beef cattle grazing cool season pastures in Northwestern Florida, emphasizing magnesium. Communications in soil science and plant analysis, 2010;41(4):472-481.

18. Walkley A, Black I. An examination of the degtjareff method and a proposed modification of the chromic matter and a proposed modification of the chromic acid titration method. Soil Sci 1934;34:29-38.

28. Murillo OM, Herrera E, Reyes O, Gurrola JN, Ríos FG. Spatiotemporal variations in nutritive quality and mineral contents of diets by grazing steers in native range. J Anim Vet Adv 2011;10:674-678.

19. Fick KR, McDowell LR, Miles P, Wilkinson NS, Funk DJ, Conrad JH. Métodos de análisis de minerales para tejidos de plantas y animales. 2da ed. Florida, USA: Universidad de Florida; 1979.

29. Gagnon B, Demers I, Ziadi N, Chantigny MH, Parent L-E, Forge TA, Buckley KE. Forms of phosphorus in composts and in compostamended soils following incubation. Canadian J Soil Sci 2012;92:711-721.

20. Grunes DL, Welch RM. Plant contents of magnesium, calcium and potassium in relation to ruminant nutrition. J Anim Sci 1989;67:3485-3494.

443


Rev Mex Cienc Pecu 2017;8(4):445-451

http://dx.doi.org/10.22319/rmcp.v8i4.4237

Accuracy of genomic values predicted using deregressed predicted breeding values as response variables Exactitud de valores genómicos predichos utilizando como variable de respuesta valores genéticos predichos ajustados Fernanda Ramírez-Floresa, Rufino López-Ordaza, Joel Domínguez-Viverosb, José Guadalupe García-Muñiza, Agustín Ruíz-Floresa* ABSTRACT Highly accurate predicted genetic values must be obtained at an early age to promote rapid genetic progress. The objectives of this study were to compare accuracies (R2) of genomic values (GVs) and to estimate genetic correlation between true genetic values and genomic values obtained using predicted breeding values (EBV) and deregressed EBV (DEBV) as response variables. A first population, effective population size 800 and 100 generations, was simulated using the QMSim program to generate linkage disequilibrium. Thereafter, 20 males and 200 females were used to generate a second 14-generation population, with 6,400 individuals per generation and its corresponding phenotype and genotype in SNP terms. Generations 7 to 14 of the second population were used in several combinations as training (PEn) and evaluation (PEv) subpopulations. GVs, their accuracies, and genetic correlations were obtained using the GenSel and ASREML programs. When PEn was the largest, the mean R2 of GV was the highest, 0.77 ± 0.01. The closer PEn was to PEv, the higher the R2, and correspondingly, the lower the predicted error variance. The trends for R2 and PEV held true for both EBV and DEBV used as response variables. Genetic correlation estimates between true genetic values and GVs varied from 0.41 to 0.53 in the two scenarios studied. They decreased when PEn and PEv were farther apart. There were only slight advantages of using DEBVs as response variables over using EBVs. KEY WORDS: Genomic evaluation, Deregressed predicted genetic value, Genomic predicted value, Accuracy, Genetic correlation.

RESUMEN Los valores genéticos de individuos en una población deben obtenerse de forma precisa y a edad temprana para promover un progreso genético rápido. Los objetivos de este estudio fueron comparar las exactitudes (R2) de valores genómicos predichos (GBV) y estimar la correlación genética entre los valores genéticos verdaderos (TGV) y los GBV, utilizando los valores genéticos estimados (EBV) y EBV ajustados (DEBV) como variables respuesta. Una primera población de 100 generaciones con tamaño efectivo 800 se simuló con el programa QMSim para generar desequilibrio de ligamiento. Posteriormente, se utilizaron 20 machos y 200 hembras por generación en una segunda población de 14 generaciones, con 6,400 individuos por generación y sus correspondientes fenotipos y genotipos en términos de SNP. Las generaciones 7 a 14 de la segunda población se usaron como subpoblaciones de entrenamiento (PT) y evaluación (PE). Los GBV, sus exactitudes y correlaciones genéticas se obtuvieron utilizando los programas GenSel y ASREML. Cuando la PT fue la más grande, R2 media fue la más alta, 0.77 ± 0.01. Cuanto más cercana es PT a PE, mayor R2, y menor la varianza del error de predicción (PEV). Las tendencias para R2 y PEV se mantuvieron tanto para EBV como para DEBV utilizadas como variables de respuesta. Los estimadores de correlación genética entre TGV y GBV variaron de 0.41 a 0.53 en los dos escenarios estudiados. La R2 disminuyó cuando PT y PE estuvieron más separadas. Hubo ligeras ventajas de utilizar DEBV como variables de respuesta en lugar de EBV. PALABRAS CLAVE: Evaluación genómica, Valor genético predicho ajustado, Valor genómico predicho, Correlación genética.

Recibido el 30 de agosto de 2016. Aceptado el 2 de noviembre de 2016. a

Posgrado en Producción Animal, Departamento de Zootecnia, Universidad Autónoma Chapingo, Carretera México-Texcoco km 38.5. Chapingo, 56230 Estado de México. México.

b

Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahua. Chihuahua, Chihuahua. México.

*

Autor de correspondencia: arf@correo.chapingo.mx

445


Fernanda RamĂ­rez-Flores, et al. / Rev Mex Cienc Pecu 2017;8(4):445-451

Genetic improvement depends on genetic variation, selection intensity, generation interval, and accuracy of estimated breeding values (EBV). In the genetic evaluation of animals, it is important to maximize EBV accuracy. An increase in EBV accuracy for selection of candidate animals will spur genetic progress. Among other advantages, the use of genomic selection allows an increase in the accuracy of genetic values(1), especially at a young age(2). Three technological breakthroughs have boosted wide-spread DNA information use in animal breeding(3): the development of genomic selection technology, the discovery of massive numbers of genetic markers (SNPs), and high throughput costeffective genotyping technology. Although the advantages of genomic selection have been observed most notoriously in dairy cattle(4), in general, the use of genomic selection can be expected to yield improvements in genetic progress of up to 10 % in any species(4).

are used as the response variable. Second, when using EBVs as the response variable, the degree of double count in the GVs decreases, particularly when the reliabilities of the genetic values are low. However, DEBVs are not always the best choice for use as the response variable in genomic evaluation. Simulated dairy cattle(6) and jumping horse(8) data were used to compare EBVs and DEBVs as response variables. Both groups of authors found only slight advantages to using DEBVs, instead of conventional EBVs, as response variables. The objectives of this study were to compare the accuracy of genomic values and to estimate the genetic correlation between true genetic values and genomic values obtained using predicted breeding values (EBV) and deregressed EBV (DEBV) as response variables for four training populations and four evaluation generations. The methodology for simulating the training (PEn) and evaluation (PEv) populations used in this study was described previously(9). Briefly, two populations using the QMSim program(10) were simulated. The first, to obtain linkage disequilibrium, had 800 individuals as the effective population size and 100 generations. The second population, where PEn and PEv originated, had 14 discrete generations, each of which was generated randomly using 20 males and 200 females, a panel of 53,010 SNPs (each evenly separated by 100 centiMorgans) randomly placed in 30 chromosomes, and 540 QTLs with effects coming from a gamma distribution(11). Both SNPs and QTLs were regarded as biallelic with random starting frequencies. Genotypes and phenotypes of 6,400 individuals were simulated; the heritability used was 0.4 and only additive effects were considered. Genotypic and phenotypic information was generated using the QMSim program(10). The four PEn comprised generations 10 (n= 1,000); 9 and 10 (n= 1,400); 8 to 10 (n= 1,800); and 7 to 10 (n= 2,200); as well as their phenotypes and the corresponding EBVs and DEBVs. The four PEv comprised generations 11 to 14.

In genomic evaluation, response variables can be individual phenotypes, repeated observations, records on close family members such as progeny, EBVs or their deregressed counterparts from genetic evaluations(5,6). According to these authors, using deregressed EBV (DEBV), an accuracy of up to 2.76 times higher than with records of a single individual can be obtained. With average daily gain and feed conversion ratio of swine data, obtained accuracies were 18 to 39 % higher, depending on the trait evaluated, when DEBVs were used as response variables instead of EBVs(7). These authors concluded that DEBV is the preferred response variable, whereas the choice of statistical method was less critical when they analyzed purebred swine data. The increase of 18 to 39 % in reliability is worthwhile, since the reliabilities of the genomic breeding values directly affect the returns from genomic selection(7). Deregressed EBVs, with the parent average removed, produce more exact predicted genomic values (GV) for two reasons(5). First, DEBVs, when used as the response variable, result in fewer double counts than when EBVs are used because the DEBVs exclude information from the individualâ&#x20AC;&#x2122;s ancestors. If both the offspring and its parents are genotyped, the degree of double count decreases when DEBVs

In a first step, the EBVs were predicted with a single-trait animal model including the random effect of animal, the fixed effects of sex of the individual, and generation. The ASREML program(12) was used at this stage. The DEBVs were then obtained

446


ACCURACY OF GENOMIC VALUES PREDICTED USING DEREGRESSED PREDICTED BREEDING VALUES AS RESPONSE VARIABLES

following methodology of Garrick et al(5). Weight (wi) for the ith animal was obtained using the following equation(5):

equations. The evaluation populations were generations 11 to 14. The Bioinformatics to Implement Genomic Selection (BIGS) platform (http://bigs.ansci.iastate.edu/) platform was used for the analysis.

wi=(1–h2)/[(c+(1–r2)/r2)h2] Where c is the lack of fit of the prediction equation, or the genetic part not explained by the markers(5); the value assumed was c=0.1; heritability of the trait, h2, was assumed to be 0.4; and r2 was the reliability of the DEVGs for the ith animal.

The genomic values and their corresponding accuracies were obtained by summing all the SNP effects, using kthe following equation:

 z uˆ

ij j

GVni =

Deregression of EBVs adjusts for ancestral information, it removes shrinkage present in EBV, and by taking parental contribution into account, DEBVs can be regarded as equivalent to the information provided by the records of each sire and its progeny(13).

j 1

Where GVni is the genomic value for the ith individual; zij is the genotype of the jth marker on the ith individual, and uˆj is the a posteriori mean of SNP effect for the jth marker. Accuracies (R2) of GVs were obtained as the square of the correlation between GVs and the true genetic values(6,13,15). Criteria for comparing the two alternatives of analysis were R2 and GV prediction error variance (PEV). Additionally, as another criterion for comparing the two response variables studied, the genetic correlation estimates was used between the true genetic values and the predicted GVs from the two alternatives of genomic analysis(6). These estimates were obtained using ASREML(12).

In a second step, the predicted genetic values (EBVs) obtained using ASREML and their corresponding DEBVs were used as response variables to predict the GVs. A weighted genomic analysis was carried out using the BayesC function of the Gen-Sel program(14). A 41,000-round long chain was used. The last 1,000 samples were used to obtain the a posteriori mean estimates of marker effects and variances. The first 40,000 iterations were regarded as the burn-in period; was fixed at 0.95. The genomic analysis used animals of generations 7 to 10 to obtain the prediction

An important aspect in genetic improvement is the response to selection, and this depends on selection accuracy(16). Table 1 shows the means and

Table 1. Mean ± standard deviation for accuracy (R2) and prediction error variance (PEV) of genomic values obtained using deregressed predicted genetic values as response variables, four training populations, and four generations of evaluation Training population Evaluation generation R2 11 12 13 14 PEV 11 12 13 14

10

9 and 10

8 to 10

7 to 10

0.52±0.04 0.39±0.04 0.32±0.05 0.28±0.06

0.67±0.03 0.55±0.03 0.49±0.04 0.45±0.04

0.73±0.03 0.63±0.03 0.58±0.03 0.54±0.04

0.77±0.01 0.68±0.03 0.64±0.03 0.60±0.03

0.05±0.003 0.06±0.004 0.07±0.005 0.07±0.006

0.05±0.003 0.06±0.004 0.07±0.005 0.08±0.006

0.04±0.003 0.06±0.004 0.06±0.005 0.07±0.006

0.04±0.003 0.05±0.004 0.06±0.005 0.07±0.005

447


Fernanda Ramírez-Flores, et al. / Rev Mex Cienc Pecu 2017;8(4):445-451

corresponding standard deviation for R2 and PEV of GVs obtained from the different combinations of PEn and PEv when the response variable was DEBV. The highest R2, 0.77 ± 0.01, was observed for the largest training population (generations 7 to 10, n= 2,200 individuals) and 11 was the generation under evaluation. In contrast, the lowest mean for R2, 0.28 ± 0.06, was observed for the combination of the smallest training population and the farthest evaluation population being evaluated, generation 14. These results are within the range of R2 values reported by Hassani et al(17), who found 0.49 (±1 SNP) to 0.75 (±100 SNPs) using whole-genome training for single QTL with a 50 K SNP panel and BayesC0.

reference population. The increase in R2 of GVs when PEn and PEv are closely related, can be explained by more precise genomic relationships, improving in this way the connectedness between these populations and more distant populations. Accordingly, another research group(23) concluded that accuracy of GVs deteriorated as the relationship between animals in the PEn and those under selection decreased. One implication of this is that PEn has to be regularly updated to keep the marker effect estimates in sync with new generations of the breeding population(2). On the other hand, as expected, the trend for R2 held true for PEV, but in the opposite direction. The greater the population size and the closer relationship between PEn and PEv, the lower PEV. Pszczola et al(15) mentioned that PEV can be calculated as the connectedness between the reference population and the animals under evaluation. This may explain the increase in PEV as PEn and PEv became farther apart. Greater connectedness reduces bias, and thus genetic evaluation improves(24). The observed trend for PEV held true for both EBV and DEBV response variables.

Two clear trends can be observed for R2 in Table 1. First, as PEn and PEv moved farther apart, R2 decreased. Second, as the size of PEn decreased, R2 became smaller. These results are similar to those reported by other research groups(18-21), who concluded that the closer the relationship between individuals in PEn and those in PEv, the higher the R2 of GVs. Similarly, using both simulated and real sheep data, Genomic Best Linear Unbiased Prediction was compared with two pedigree based methods(22). It was found that both empirical and estimated accuracy of GVs were different for several degrees of relationship. These authors concluded that R2 of GVs is proportional to the genetic relationship of animals under selection to the

Table 2 shows the means and their corresponding standard deviations for R2 and PEV for the combinations of PEn and PEv when the response variable was EBV. In general, R2 values were only slightly lower than those observed when DEBVs were used as response variables. The trends

Table 2. Mean ± standard deviation for accuracy (R2) and prediction error variance (PEV) of genomic values obtained using predicted genetic values as response variables, four training populations, and four generations of evaluation Training population Evaluation generation R2 11 12 13 14 PEV 11 12 13 14

10

9 and 10

8 to 10

0.48±0.04 0.38±0.05 0.32±0.05 0.28±0.06

0.65±0.03 0.55±0.03 0.49±0.03 0.45±0.04

0.71±0.02 0.62±0.03 0.58±0.03 0.54±0.04

0.76±0.02 0.68±0.02 0.64±0.03 0.60±0.03

0.05±0.003 0.05±0.004 0.06±0.004 0.06±0.005

0.05±0.003 0.06±0.004 0.07±0.005 0.07±0.006

0.04±0.003 0.06±0.004 0.06±0.004 0.07±0.005

0.04±0.003 0.05±0.004 0.06±0.004 0.06±0.005

448

7 to 10


ACCURACY OF GENOMIC VALUES PREDICTED USING DEREGRESSED PREDICTED BREEDING VALUES AS RESPONSE VARIABLES

observed for the decrease in R2 and the increase in PEV when DEBVs were response variables, as size of PEn diminished and the distance between PEn and PEn augmented, held true for EBVs used as response variables. These results are similar to those obtained by other authors(25,26,27), who found that size of PEn affected R2 of GVs. The results of the present study and those obtained by other groups of researchers agree with what could be theoretically expected(1,28). These authors developed predictive equations for accuracy of predicted genomic values, which depend on size of PEn, effective population size of the breed, heritability of the trait, and length of genome.

enhance genomic selection accuracy only when the unknown genotypes can be predicted with high accuracy. The results obtained by these authors varied from 0.57 to 0.96, from 0.48 to 0.88, and from 0.33 to 0.72 for heritabilities of 0.30, 0.05, and 0.01, respectively, under different sizes of the reference population, and different numbers of animals with known or predicted genotypes. The small difference in GV accuracy that we obtained in our study when EBVs or DEBVs were the response variables agree with reports by other researchers. However, these results are opposite to those observed by Ostersen et al(7), who found 18 to 39 % higher accuracies for feed conversion ratio and daily gain when they used DEBVs instead of EBVs as response variables. The estimation methodologies they used were GBLUP, Bayesian Lasso, and MIXTURE, where the marker effects are assumed to follow a normal distribution, double exponential, and a mixture of two normal distributions, respectively. The three alternatives of analysis yielded similar reliabilities of the GVs for the two traits analyzed.

The results of a study with two multi-breed beef cattle populations and Angus and Hereford purebred populations(13) used to obtain the GVs and corresponding R2 for six growth and carcass traits showed that accuracies were lower for prediction equations trained in a single breed. These results were attributed to the smaller number of records derived from a single breed in the training populations. The R2 range was 0.01 ± 0.10 to 0.65 ± 0.07, although the authors also reported a negative estimate, -0.10 ± 0.15.

Contrary to our results, Ricard et al(8) did not find substantial advantages to genomic values obtained using deregressed EBVs as response variables or the GBLUP and BayesC alternatives of analysis compared with conventional BLUP predictions. They followed a specific deregression procedure that included not only the individual’s own performance, but also the performance of several relatives (not just offspring), in addition to the genotyped sample. This regression procedure was easy to implement from EBVs, reliabilities, and pedigrees. Unfortunately, accuracy of genomic evaluation, measured by cross validation in several validation samples, was not enough to suggest its use in current breeding plans for the jumping horse population studied. However, the authors mention that this conclusion is related only to accuracy, and the potential benefits of a higher selection intensity, reduced generation intervals, and low inbreeding in the long run should be considered when genomic selection in horses is planned. In dairy cattle similar results were reported(6). The authors compared two response variables, EBVs and daughter yield deviations (DYD) on simulated dairy data under eight scenarios of heritability, number of daughters

The results of this work, regardless of whether DEBV or EBV were used as response variables, are similar to those obtained by Saatchi et al(23). These authors evaluated different training populations of Hereford cattle; accuracy estimates ranged from 0.15 to 0.52, with 0.30 on average when trained on old animals and validated on young animal populations. The results obtained in our study may be explained by the fact that genomic prediction on closely related individuals is based on relationship; genomic relationships are more accurate when the relationships between PEn and PEv populations are close(3). On the other hand, prediction on distant individuals requires DL between QTL and markers(29). The R2 results are lower than those reported by Pszczola et al(30). These authors found that the inclusion of animals with predicted genotypes in the reference population did not significantly increase accuracies of GVs for juvenile animals. They attributed the lack of significance to the low accuracy of predicted genotypes and concluded that inclusion of non-genotyped animals is expected to

449


Fernanda Ramírez-Flores, et al. / Rev Mex Cienc Pecu 2017;8(4):445-451

per sire, and number of genotyped sires. They found that DYDs yielded slightly lower reliabilities than EBVs. The average differences in GV accuracy of between EBVs and DYDs were 0.009 for h2= 0.30, and 0.035 when h2= 0.05.

generations in the training population also need to be better determined. Moreover, since our study used simulated information, it does not entirely correspond to real production system conditions. The advantage of using deregressed predicted genetic values as the response variable, instead of conventional predicted genetic values, was very slight with any combination of training population size and evaluation generation. Regardless of the response variable used, predicted genetic value or deregressed predicted genetic value, larger training population were associated with higher genomic values accuracy.

Table 3 presents the genetic correlation estimates between true genetic values and the GVs r(TBV,GV) obtained using DEBVs and EBVs as response variables. A slight advantage of using DEBVs, range 0.43 to 0.53, instead of EBVs, range 0.41 to 0.51, held constant throughout all training population sizes. Also, genetic correlation estimates decreased as PEn and PEv separated. The r(TBV,GV) estimates of the present study are higher than those observed by Alarcón-Zúñiga et al(9), range 0.29 to 0.40, using the same dataset but different models for the genomic analysis. Genetic correlation estimates between direct genomic values and phenotypes from k-fold validation in Red Angus, Angus, Hereford, Simmental and Limousin ranged from 0.32 to 0.85 for birth weight, weaning weight, milk yield, rib eye muscle area, marbling, direct calving ease, and maternal calving ease(21,31). Similarly, genetic correlation estimates between true genetic values and GVs for marbling, using data sets with different proportions of available information, ranged from 0.256 to 0.859 (32). Guo et al(6) found genetic correlation estimates between GVs and conventional parent average ranging from 0.457 to 0.688 using three statistical models and eight combinations of heritability and number of daughters per sire.

Prediction error variance was low and similar with any combination of training population size and evaluation generation, regardless of the response variable used. The genetic correlation estimates between true genetic values and genomic values obtained using DEBV as the response variable were slightly higher than those between true genetic values and genomic values obtained using EBV as the response variable. ACKNOWLEDGEMENTS The authors thank CONACYT for the financial support for the Master of Science studies in Animal Production of the first author.

Some limitations of our work are that a distance between training and evaluation populations needs to be more specific, and size and number of

CITED LITERATURE

Table 3. Genetic correlation estimates between true genetic values and genomic values obtained using deregressed predicted genetic values (DEBV) or predicted genetic values (EBV) as response variables, with four training populations Response variable Training population

DEBV

EBV

10

0.53

0.51

9 y 10

0.51

0.50

8 a 10

0.48

0.47

7 a 10

0.43

0.41

450

1.

Goddard ME. Genomic selection: Prediction of accuracy and maximization of long term response. Genetica 2009;136:245-257.

2.

Knol EF, Nielsen B, Knap PW. Genomic selection in commercial pig breeding. Anim Front 2016;6:15-22.

3.

Meuwissen TB. Hayes B, Goddard M. Genomic selection: A paradigm shift in animal breeding. Anim Front 2016;6:6-14.

4.

Ibanez-Escriche N, Simianer H. Animal breeding in the genomic era. Anim Front 2015;5:4-5.

5.

Garrick DJ, Taylor JF, Fernando R. Deregressing estimated breeding values and weighting information for genomic regression analyses. Genet Sel Evol 2009;41:55-62.

6.

Guo G, Lund MS, Zhang Y, Su G: Comparison between genomic predictions using daughter yield deviation and conventional estimated breeding value as response variables. J Anim Breed Genet 2010;127:423-432.


ACCURACY OF GENOMIC VALUES PREDICTED USING DEREGRESSED PREDICTED BREEDING VALUES AS RESPONSE VARIABLES

7.

Ostersen T, Christensen OF, Henryon M, Nielsen B, Su G, Madsen P. Deregressed EBV as the response variable yield more reliable genomic predictions than traditional EBV in pure-bred pigs. Genet Sel Evol 201;43:38-43.

quantity and strength of relationship between training set and validation set on accuracy of genomic estimated breeding values. Afr J Biotech 2010;9:438-442.

8.

Ricard A, Danvy S, Legarra A. Computation of deregressed proofs for genomic selection when own phenotypes exist with an application in French show-jumping horses. J Anim Sci 2013;91:1076-1085.

21. Saatchi M, McClure MC, McKay SD, Rolf MM, Kim J, Decker JE, et al. Accuracies of genomic breeding values in American Angus beef cattle using K-means clustering for cross-validation. Genet Sel Evol 2011;43:40-55.

9.

Alarcón-Zúñiga B, Ramírez-Flores F, Ruíz-Flores A, RamírezValverde R, Saavedra-Jiménez LA, Zepeda-Batista JL. Comparación de la exactitud de valores genómicos de animales predichos a través del análisis con dos modelos alternativos. Agrociencia 2015;49:613-622.

22. Clark SA, Hickey JM, Daetwyler HD, van der Werf JHJ. The importance of information on relatives for the prediction of genomic breeding values and the implications for the makeup of reference data sets in livestock breeding schemes. Genet Sel Evol 2012;44:412.

10. Sargolzaei M, Schenkel FS. QMSim: a large-scale genome simulator for livestock. Bioinformatics 2009;25:680-681.

23. Saatchi M, Ward J, Garrick DJ. Accuracies of direct genomic breeding values in Hereford beef cattle using national or international training populations. J Anim Sci 2013;91:1538-1551.

11. Weller JI, Shlezinger M, Ron M. Correcting for bias in estimation of quantitative trait loci effects. Genet Sel Evol 2005;37:501-522.

24. Kennedy BW. Bias and mean square error from ignoring genetic groups in mixed model sire evaluation. J Dairy Sci 1981;64:689697.

12. Gilmour AR, Gogel, BJ, Cullis, BR, Thompson R. ASREML User Guide Release 3.0 VSN International Ltd, Hemel Hempstead, HP1 1ES, UK. http://www.vsni. co.uk. 2009. Consulted Jan 31, 2014.

25. Meuwissen THE, Hayes BJ, Goddard ME. Prediction of total genetic value using genome-wide dense marker maps. Genetics 2001;157:1819-1829.

13. Weber KL, Thallman RM, Keele JK, Snelling WM, Bennet GL, Smith TPL, et al. Accuracy of genomic breeding values in multibreed beef cattle populations derived from deregressed breeding values and phenotypes. J Anim Sci 2012;94:4177-4190.

26. Calus, MPL, Veerkamp RF. Accuracy of breeding values when using and ignoring the polygenic effect in genomic breeding value estimation with a marker density of one SNP per cM. J Anim Breed Genet 2007;124:362-368.

14. Fernando R, Garrick DJ. GenSel – user manual for a portfolio of genomic selection related analyses, create 9.1. http://bigs.ansci.iastate.edu/bigsgui/ReleaseNotes/Version9_1Rele aseNotes.1.pdf. 2009. Accessed Jan 15, 2013.

27. Muir WM. Comparison of genomic and traditional BLUP-estimated breeding value accuracy and selection response under alternative trait and genomic parameters. J Anim Breed Genet 2007;124:342355.

15. Pszczola M, Strabel T, Mulder HA, Calus MPL. Reliability of direct genomic values for animals with different relationships within and to the reference population. J Dairy Sci 2012;95:389-400.

28. Daetwyler HD, Pong-Wong R, Villanueva B, Woolliams JA. The impact of genetic architecture on genome-wide evaluation methods. Genetics 2010;185:1021-1031.

16. Pszczola M, Strabel T, van Arendonk JAM, Calus MPL. The impact of genotyping different groups of animal son accuracy when moving from traditional to genomic selection J Dairy Sci 2012;95:54125421.

29. Daetwyler HD, Kemper KE, van der Werf JHJ. Hayes BJ. Components of the accuracy of genomic prediction in a multi-breed sheep population. J Anim Sci 2012;90:3375-3384.

17. Hassani S, Saatchi M, Fernando RL, Garrick DJ. Accuracy of prediction of simulated polygenic phenotypes and their underlying quantitative trait loci genotypes using real or imputed wholegenome markers in cattle. Genet Sel Evol 2015;47:99-109.

30. Pszczola M, Mulder HA, Calus MPL. Effect of enlarging the reference population with (un)genotyped animals on the accuracy of genomic selection in dairy cattle. J Dairy Sci 2011;94:431-441.

18. Habier D, Fernando RL, Dekkers JCM. The impact of genetic relationship information on genome-assisted breeding values. Genetics 2007;177:2389-2397.

31. Saatchi M, Schnabel RD, Rolf MM, Taylor JF, Garrick DJ. Accuracy of direct genomic breeding values for nationally evaluated traits in US Limousin and Simmental beef cattle. Genet Sel Evol 2012;44:38.

19. Habier D, Tetens J, Seefried F-R, Lichtner P, Thaller G. The impact of genetic relationship information on genomic breeding values in German Holstein cattle. Genet Sel Evol 2010;52:5-16.

32. Spangler ML, Bertrand JK, Rekaya R. Combining genetic test information and correlated phenotypic records for breeding value estimation. J Anim Sci 2007;85:641-649.

20. Saatchi M, Miraei-Ashtiani SR, Nejati Javaremi A, MoradiShahrebabak M, Mehrabani-Yeghaneh H. The impact of information

451


Rev Mex Cienc Pecu 2017;8(4):453-462

http://dx.doi.org/10.22319/rmcp.v8i4.4301

Osteocondrosis en el toro de lidia y evaluación de su efecto sobre la movilidad del animal Osteochondrosis in fighting bulls and evaluation of its effect on the animal mobility Juan Manuel Lomillos Péreza*, Marta Elena Alonso de la Vargaa

RESUMEN La osteocondrosis es un proceso degenerativo de las superficies articulares. Es una enfermedad descrita ampliamente en el caballo, con escasas referencias bibliográficas en bovino y prácticamente inexistentes en la raza de lidia. El objetivo de este trabajo fue informar sobre la prevalencia de osteocondrosis en toros y novillos, estudiar sus posibles causas y analizar la repercusión de esta patología en la movilidad del animal durante la lidia. Para ello se han estudiado 120 animales de la raza bovina de lidia, de 3, 4 y 5 años, lidiados en diferentes plazas de toros. Durante el faenado de las reses posterior a la lidia se realizó un estudio macroscópico de las articulaciones carpo-metacarpianas, estudiándose la presencia de lesión en las caras articulares implicadas y su grado de gravedad. Paralelamente se grabó la lidia de cada animal para el análisis de su movilidad y evaluación del síndrome de caída. Los resultados reflejan una lesión del cartílago articular en mayor o menor grado en aproximadamente el 80 % de los animales estudiados, apareciendo en el 63 % de los casos sobre la cara medial de la articulación y mayoritariamente de forma bilateral. Se observa una influencia negativa en la tasa de caídas manifestadas por el toro durante la lidia, lo que hace necesario nuevas investigaciones y estudios dirigidos a determinar sus posibles causas: factores genéticos, nutricionales y los inadecuados protocolos de entrenamiento entre otras. PALABRAS CLAVE: Toro, Lidia, Caída, Osteocondrosis.

ABSTRACT Osteochondrosis is a degenerative process of the joint surfaces. It is a disease of animal development widely described in the horse, with few references in cattle and virtually non-existent in the fighting bulls. The aim of this study was to record the prevalence of osteochondrosis in bulls and steers considering their possible causes and analysing the impact of this disease on the mobility of the animal during the fight. One hundred and twenty (120) fighting bulls, 3, 4 and 5 yr old fought at different bullrings were studied. During the dressing of cattle after fighting a macroscopic study of the carpal-metacarpal joint was performed, for studying the presence of injury in the joint faces involved and their severity. Alongside the fight, each animal was video recorded in order to analyse his mobility and evaluation of the falling syndrome. The results reflect articular cartilage damage in varying degrees in about 80 % of the animals studied, appearing in 63 % of cases on the medial aspect of the joint and mostly bilaterally. A negative influence was observed in the rate of falls expressed by the bull during the fight, and further research will be recommended and studies aimed at determining possible causes: nutritional alterations and inadequate training protocols. KEY WORDS: Bull, Fight, Falls, Osteochondrosis.

Recibido el 19 de octubre de 2016. Aceptado el 2 de marzo de 2017. a Departamento de Producción Animal. Facultad de Veterinaria de León. Universidad de León. Campus de Vagazana s/n 24071 León, España. *Autor de correspondencia: jmlomp@unileon.es

453


Juan Manuel Lomillos Pérez, et al. / Rev Mex Cienc Pecu 2017;8(4):453-462

La osteocondrosis es un trastorno degenerativo del cartílago(1) descrito en humanos, en cerdos(2), perros(3), gatos(4), y caballos(6,7,8). Es considerada como la causa más importante de debilidad en los miembros posteriores en los cerdos(9), y causa frecuente de cojeras en caballos jóvenes de deporte(5) y en perros(10).

bajo el término de “síndrome de caída” ha sido estudiado por distintos autores(19), sin identificar una causa única sino un problema multifactorial, donde intervienen factores predisponentes, como la dotación genética, las características del transporte, las exigencias físicas de la lidia, la falta de gimnasia funcional, deficiencias alimenticias, etc. y otros factores determinantes, como circulatorios, nerviosos, metabólicos, endocrinos, etológicos o lesiones(20). En este último grupo entraría el padecimiento de osteocondrosis, el cual ha sido estudiado en este trabajo. El objetivo del mismo fue informar sobre la afectación de esta patología en los cartílagos articulares de carpo y metacarpo de machos de la raza bovina de lidia, y analizar la posible repercusión de esta lesión en la movilidad del animal durante la lidia.

La etiología de la osteocondrosis ha sido objeto de investigación en los últimos años, sin embargo, no existe consenso sobre la definición de la enfermedad y su patogenia, en particular sobre la formación de las lesiones primarias. Sin embargo, la información obtenida actualmente refleja procesos degenerativos y regenerativos secundarios, en lugar de los procesos primarios(11). La lesión primaria de osteocondrosis articular se define como una “necrosis isquémica focal del cartílago de crecimiento, iniciado por la falta de aporte sanguíneo de los canales del cartílago”(12). Se trata de un fallo focal de osificación endocondral, es decir, una zona del cartílago de crecimiento que no puede someterse a la calcificación de la matriz o invasión vascular, y por tanto no se convierte en hueso(13).

Se estudiaron 120 animales de la raza bovina de lidia, machos de 3 años (n= 24), 4 años (n= 58) y 5 años (n= 38), lidiados en cuatro diferentes plazas de toros. Durante el faenado de las reses posterior a la lidia, se realizó un estudio macroscópico de las articulaciones carpometacarpianas, mediante el cual se identificó la presencia de lesiones, evaluando las superficies articulares de los huesos distales carpales (Ossa carpi) C2-3, y superficie articular proximal del hueso metacarpiano (Ossa metarcarpalia) M3-4. Se midió a su vez el diámetro y profundidad de las lesiones, tomando fotografías de cada muestra recogida.

En casos más avanzados, el cartílago persistente es suave y rojizo, y la médula ósea subyacente es edematosa e hiperémica. La lesión se caracteriza histológicamente por un área focal de necrosis que se limita al cartílago de crecimiento y no implica el cartílago articular que cubre el hueso subcondral subyacente. La bibliografía clasifica la enfermedad en tres grados de lesión, de menor a mayor gravedad: osteocondrosis latente, caracterizada por la presencia de un área focal de necrosis del cartílago que se limita al cartílago epifisario; osteocondrosis manifiesta, con la presencia de un fallo focal de osificación endocondral, visible en el examen macroscópico; y osteocondrosis disecante en los estados avanzados, donde se forma una fisura en la zona de necrosis del cartílago y se extiende a través del cartílago articular(12).

Previamente se obtuvo información sobre la edad del animal, su peso, y las duraciones tanto del periodo de alimentación intensiva como de la fase de entrenamiento físico previos a la lidia. La caracterización de las lesiones se realizó siguiendo los criterios y metodología descritos en trabajos anteriores(18,21,22) que clasifican las lesiones en 4 grados: Normal (I): cuando las caras o superficies articulares no mostraban alteraciones macroscópicamente. Leve (II): cuando la lesión fue menor del 20 % de la superficie articular y la escoriación es superficial. Moderada (III): cuando la lesión superó el 20 % de la superficie articular, con pérdida focal del cartílago. Grave (IV): erosión profunda con afectación ósea.

La osteocondrosis ha sido señalada por diferentes autores como una de las causas predisponentes en el desarrollo de caídas de la raza bovina de lidia(14-18). El padecimiento de pérdidas transitorias de la estación y del equilibrio, englobado

454


OSTEOCONDROSIS EN EL TORO DE LIDIA Y EVALUACIÓN DE SU EFECTO SOBRE LA MOVILIDAD DEL ANIMAL

Paralelamente se grabó la lidia de cada animal para el análisis de su movilidad y la posible claudicación de los animales durante la misma. Para la valoración del síndrome de caída se utilizó la metodología descrita por Alonso et al(19), que consideran seis tipos diferentes en virtud de la gravedad de la claudicación evidenciada por el animal:

Figura 1. Porcentajes de acuerdo al grado de lesión en toros de lidia

lesión grave n=19 15.8%

Tipo 1. Caracterizado por una locomoción irregular, así como por el contacto momentáneo de la cara dorsal de la pezuña o la zona articular del menudillo con el suelo.

sin lesión n=36 30.0%

lesión moderada n=26 21.7%

Tipo 2. Se caracteriza por la flexión momentánea durante el apoyo de la articulación carpo-metacarpo o tarso-metatarso, existiendo o no contacto de dichas articulaciones con el suelo.

lesión leve n=39 32.5%

Tipo 3. Se produce cuando hay un contacto transitorio con el suelo, durante menos de 10 seg, bien del esternón, papada o cabeza, o bien del corvejón, flanco o nalga, según se trate de las extremidades torácicas o pélvicas respectivamente.

Se encontraron lesiones en el 70 % de los animales muestreados (84 individuos), generalmente de forma bilateral en el 78.3 % de los individuos afectados, siendo más graves las lesiones encontradas en la parte medial de la articulación (Figura 1). Se registraron 36 animales (30 %) sin ninguna lesión articular (grado I), 39 animales (32.5 %) con lesiones leves (grado II), 26 individuos (21.7 %) con lesiones moderadas (grado III) y 19 animales (15.8 %) con lesiones graves (grado IV).

Tipo 4. Tiene lugar cuando el animal adopta una posición de decúbito lateral total o esternoabdominal, siempre que su duración sea inferior a 20 seg; igualmente se llega a este tipo de caída cuando en una de tipo 3 el contacto con el suelo tiene una duración superior a 10 seg e inferior a 20. Tipo 5. A esta variedad de caída se llega cuando el decúbito del animal (caída de tipo 4), o el contacto con el suelo que origina el tipo 3, se prolongan más allá de los 20 seg, pero sin llegar a los 120.

El alto porcentaje de aparición de las lesiones en los animales muestreados evidencia que la osteocondrosis es una lesión a tener muy en cuenta en esta raza de bovinos. El hecho de que se haya observado de forma bilateral en el 78.3 %, podría apuntar a una causa sistémica, tal y como lo describen diversos autores en cerdos(13), en perros(23) y en humanos(24,25).

Tipo 6. Se produce este tipo cuando el decúbito tiene una duración superior a 120 seg. A su vez se consideró interesante analizar el momento de presentación de las caídas, es decir, la distribución de las caídas por tercio de lidia en función del tipo de lesión. Por último se elaboró un análisis de correlación entre el peso, la edad y los tiempos de cebo y de entrenamiento con el tipo de lesión. Para el análisis se utilizó el paquete estadístico SPSS para Windows © (versión 15.0). Se realizó un análisis descriptivo, un análisis de correlación y el correspondiente ANOVA.

El estudio macroscópico de las articulaciones (Figura 2), mostró una lesión más acusada en la superficies articular de M3-4, en comparación con la cara distal de C2-3, donde es menos evidente. Las lesiones leves, (grado II) están bien delimitadas, por un engrosamiento moderado de los bordes, en su mayoría hiperémicos, el fondo de la lesión, suele

455


Juan Manuel Lomillos Pérez, et al. / Rev Mex Cienc Pecu 2017;8(4):453-462

nacarada a roja (hiperemia) con ulceración muy evidente. Se observaron restos de desprendimiento cartilaginoso y colgajos sobre dichas lesiones. La dimensión de las lesiones tenía una media de 0.6 cm de diámetro y 3 mm de profundidad.

Figura 2. Imágenes de los diferentes grados de lesión (I, II, III y IV)

Las lesiones graves (grado IV), estaban muy bien definidas, con bordes redondeados, de forma simétrica y en ambas caras de las superficies articulares correspondientes. De coloración blanquecina y roja (hiperemia); el fondo de las lesiones presentaron una coloración rojiza mostrando en su totalidad el hueso subcondral; el diámetro de las lesiones fue 1.3 cm de media con una profundidad media de 3 mm.

Grado I – sin lesión

La localización de las lesiones observadas coinciden con las lesiones descritas en la raza de lidia por otros autores(15,16). Lesiones similares han sido descritas anteriormente en perros(26), en ganado bovino de raza Brahman(27), en caballos de Pura Raza Inglés(5,28) y en cerdos(12,13), todas ellas observadas en animales con una historia clínica compatible con osteocondrosis y evidenciadas en la necropsia.

Grado II – leve

Sin embargo, respecto al grado de lesión, se encontró un porcentaje menor de animales afectados en comparación con anteriores trabajos con ganado de lidia(16,17,18). Mientras Dávila(18) observó un 80 % de novillos lesionados, en el presente estudio se encontró la lesión en el 70 % de los individuos. En el caso de los toros (animales de 4 y 5 años) el 73.96 % de los animales mostraron grado de lesión, ligeramente inferior a las encontradas por Mas et al(16): 86.86 % y Dávila(18): 86.5 %. Los resultados de este estudio tampoco coincidieron con ninguno de los trabajos realizados con ganado bravo en cuanto al grado de lesión más frecuente en los animales de 4 y 5 años. En el presente estudio, la lesión leve fue la más común (32.5 %) mientras que para Dávila(18) fue la grave (51 %) y Mas et al(17) por su parte señalan un 45.3 % de lesiones graves.

Grado III – moderada

Grado IV - grave

Analizando los animales por edades (Figura 3) se observa una tendencia al agravamiento de las lesiones observadas a medida que aumenta la edad. Durante los 3 y 4 años de vida las lesiones son fundamentalmente leves (29.2 % y 39.7 % respectivamente), mientras que en animales de 5 años la lesión más frecuente fue la moderada, con un aumento significativo de las lesiones graves. Esto

tener una coloración blanquecina y cuando la lesión muestra un proceso agudo, se observa un fondo hiperémico. Las lesiones moderadas (grado III) mostraron una pérdida de continuidad total de la superficie articular, más acentuada en M3-4, con un borde bien definido, que van desde la coloración blanquecina-

456


OSTEOCONDROSIS EN EL TORO DE LIDIA Y EVALUACIÓN DE SU EFECTO SOBRE LA MOVILIDAD DEL ANIMAL

Igualmente en caballos, se ha observado que un aumento de la insulina y una disminución de la tiroxina circulantes, causadas por las dietas altas en energía, conducen a un fallo de la maduración del cartílago articular e hipertrofia de los condrocitos(31,32). Según esta hipótesis, los condrocitos bajo la influencia de la insulina y la disminución de los niveles de tiroxina persisten como núcleos de cartílago; estos, posteriormente se necrosan cuando son sometidos a factores biomecánicos en la zona de transición entre el cartílago y hueso, produciendo lesiones similares a la osteocondrosis en los cerdos(32). Sin embargo, estas teorías que podrían aplicarse al cebo del toro de lidia, se contradicen, debido a que la morfología de las lesiones encontradas está caracterizada por la conformación de áreas bien delimitadas de necrosis en el cartílago epifisario(33).

Figura 3. Grado de lesiones en toros de lidia de acuerdo a la edad (%)

sugiere que las lesiones podrían agravarse con la edad, que viene acompañada de una alimentación intensiva, generando un aumento exponencial de la grasa y la musculatura y por tanto del peso del animal, lo que podría influir de forma directa en la formación de lesiones.

Complementariamente, la genética podría jugar un papel importante predisponente en base a las diferencias observadas en la prevalencia de la osteocondrosis entre diferentes razas de ganado porcino(34), perros(35) y caballos(28), por lo que el componente hereditario se postula como un factor a estudiar.

De hecho, en la descripción de su etiología multifactorial(13,29), se incluyen estos factores además de la heredabilidad, las características anatómicas, los traumatismos y un defecto en la vascularización del cartílago epifisario.

Se analizó el número de animales que padecen cada uno de los seis tipos de claudicación (Cuadro 1), observando que el 85 % de los animales (n= 102) mostró algún signo o manifestación del síndrome. Por otro lado, en ninguno de ellos se apreciaron caídas de tipo 5 y 6. Se comprobó la existencia de una mayor tasa de caídas tipo 1 y 2 en los animales con lesiones de grado IV con respecto al resto de animales.

En perros se ha informado que un rápido crecimiento aumenta la incidencia de enfermedades óseas, incluyendo la osteocondrosis(30), teoría que se podría aplicar al crecimiento acelerado del toro de lidia durante los 10-12 meses previos a la lidia a través del cebo intensivo al que es sometido.

Cuadro 1: Tipo de caídas que presenta cada animal en función del grado de lesión y porcentaje de individuos que las presentan Grado de lesión

n

Caída tipo 1

Caída tipo 2

Caída tipo 3

Caída tipo 4

Caída total

I II III IV Total % n P

36 39 26 19 120

0.9 ±1.5a 1.1 ±1.3a 1.2 ±1.6a 1.4 ±1.4b 1.3 ±1.5 32.50 39 **

0.9 ±1.0a 0.9 ±0.9a 1.4 ±1.5b 1.3 ±0.8b 1.2 ±1.3 37.50 45 **

0.6 ±0.8 0.6 ±1.0 0.9 ±1.3 0.8 ±1.7 0.8 ±1.1 23.33 28

0.2 ±0.4 0.1 ±0.3 0.2 ±0.4 0.1 ±0.3 0.2 ±0.4 5.83 7

2.5 ±2.1 3.2 ±2.5 3.1 ±2.9 3.8 ±1,2 3.2 ±2.6 -

** = P<0.001.

457


Juan Manuel Lomillos Pérez, et al. / Rev Mex Cienc Pecu 2017;8(4):453-462

Este porcentaje total de animales con falta de fuerza fue inferior al registrado por Alonso et al(19), que fue del 99.56 %, con toros valorados con el mismo método (software) en las temporadas 19911993, datos que se explican por la alta prevalencia en los años 90 del síndrome de caída(36). Esta disminución del 14.56 % en la tasa de caídas confirma la tendencia de disminución señalada anteriormente por Bartolomé(37), presumiblemente gracias a la gran mejora experimentada en los últimos años del manejo alimentario y sanitario del ganado bravo. Aun así las caídas persisten y es un gran problema a solucionar.

este estudio, sólo el 29.16 % de los animales presentaron estos tipos de claudicación, porcentaje menor al 66.57 % señalado por Alonso et al(19), pero próximo a los señalados por los trabajos anteriormente citados(39,40,41). Si se toma en cuenta el número de caídas de cada grupo de animales en función de las lesiones encontradas, se observó un mayor porcentaje en los individuos con lesiones grados III y IV, evidenciándose en el caso de las caídas del tipo 1 y 2 (los tipos más frecuentes: 70 %) para las cuales se encontró diferencias estadísticamente significativas entre los grupos de animales con lesiones de grado III y IV y el resto de animales, lo que pone de manifiesto un efecto negativo de la osteocondrosis en la movilidad del animal.

El porcentaje de caída que se registró en el presente estudio está muy por encima del que describen otros autores(38-42). Tal divergencia podría ser explicada no sólo por las fechas o años considerados sino también, por la diferente metodología de evaluación utilizada, que no se basa en el uso de vídeo ni un programa (software) especializado, y no tiene en cuenta las caídas más leves de los animales.

En cuanto a la distribución de la incidencia de caída por tercios en función del grado de lesión (Cuadro 2), el tercio de muleta es la parte de la lidia donde más caídas desarrollan los animales, siendo significativamente más numerosas las claudicaciones sufridas por los individuos con lesiones grado II, III y IV en comparación con los animales sanos (grado I).

Las variedades de claudicación de tipo 1 y 2 pueden pasar inadvertidas para cualquier espectador, y para todo aquel que no esté pendiente de las extremidades del toro durante su lidia y visualice, de forma repetida, los comportamientos pregrabados pues, estas caídas leves, no suponen una interrupción apreciable del normal discurrir del espectáculo. Las más graves (caídas tipo 3, 4, 5 y 6) sí suponen un problema evidente para la lidia, causando interrupciones que deslucen la faena. En

Esta mayor aparición de caídas en la muleta (58.60 %), se encuentra en la misma línea del trabajo de Alonso et al(19), donde las manifestaciones de caída se agravan y aumentan de frecuencia a medida que transcurren los diferentes tercios de la lidia, llegando en la muleta al 50 % de las claudicaciones.

Cuadro 2. Caídas en cada una de las diferentes fases de la lidia en función del grado de lesión y porcentaje de individuos que las presentan Grado de lesión

n

I II III IV t % n

36 39 26 19 120

Caídas INICIO 0.2 ±0.4 0.4 ±0.6 0.3 ±0.7 0.3 ±0.5 0.3 ±0.6 8.33 10

Caídas VARAS 0.7 ±1.0 0.6 ±0.9 0.7 ±1.1 0.5 ±0.6 0.7 ±1.0 22.50 27

BAND= banderillas. ab (P<0.05).

458

Caídas BAND 0.3 ±0.5 0.4 ±0.8 0.2 ±0.6 0.3 ±0.5 0.3 ±0.6 10.00 12

Caídas MULETA 1.2 ±1.4a 1.9 ±2.1b 2.1 ±2.3b 1,8 ±1.8b 1.8 ±2.1 75.83 91

Caída total 2.5 ±2.1 3.2 ±2.5 3.5 ±2.9 3.2 ±1,9 3.2 ±2.7 -


OSTEOCONDROSIS EN EL TORO DE LIDIA Y EVALUACIÓN DE SU EFECTO SOBRE LA MOVILIDAD DEL ANIMAL

Los animales en los primeros tercios se mueven a mayor velocidad que en fases sucesivas, y en un modelo de ejercicio tipo intermitente, recuperan fuerzas durante los amplios descansos entre desplazamientos(43). En cambio, durante el tercer tercio, el de mayor duración, el toro alterna desplazamientos en serie de largo recorrido con pequeños descansos que no le permiten recuperar. Este tipo de movimiento de cabeza baja, durante el 45.6 % del tiempo de la duración del tercio, predispone al animal a sufrir caídas de tipo 1, 2 y 3(44). Además, el animal acumula en este momento un estado elevado y progresivo de fatiga, evidenciado por la abertura de la boca y el aumento de la frecuencia respiratoria(44).

previo a la lidia. Como consecuencia del mismo, se produce una mayor fricción en las articulaciones y la lesión podría aumentar en superficie y gravedad. Por su parte Lomillos(48) obtuvo una correlación positiva con el peso y las caídas del toro durante la lidia, lo cual concuerda con los resultados del presente estudio y la hipótesis de otros autores(17), consistente en que un mayor peso del animal lo predispone a sufrir osteocondrosis. Este sobrepeso a su vez genera una mayor presión sobre las articulaciones y ésta, durante los desplazamientos en la lidia provoca un dolor más fuerte ocasionando mayor número de caídas en el ruedo.

El análisis de las frecuencias de caída por grupos refleja diferencias entre los animales sin lesión (grado I) y los lesionados (grados II, III y IV) en el número de caídas totales en el tercio de muleta, siendo éstas significativamente mayores en los animales con lesión articular. Resultados que fortalecen la teoría de la osteocondrosis como una de las causas predisponentes del síndrome de caída de la raza de lidia(14,15).

Por su parte la edad y los meses de cebo se correlacionan positivamente con el padecimiento de lesiones de grado II y III. Esto se puede explicar con el hecho que los animales de mayor edad (4 y 5 años) son los que siguen un periodo de acabado con una alimentación más intensiva y un entrenamiento que va de 3 a 9 meses, y reflejan una mayor incidencia de este tipo de lesiones. Por el contrario los animales lidiados de menor edad (novillos de 3 años) no siguen una alimentación tan forzada ni protocolos de entrenamiento.

Por último, el análisis de correlación del peso de los animales con los diferentes grados de lesión del cartílago articular (Cuadro 3) revela una correlación negativa del mismo con la ausencia de lesión (grado I). Diversos autores(45,46,47) opinan que la caída del toro de lidia, es debida al desarrollo incompleto del aparato locomotor del animal debido a una subnutrición en los primeros años de crecimiento. Por otro lado, se han observado lesiones de osteocondrosis ya desde los primeros 12 meses de vida(18). Esas lesiones tempranas podrían ir paulatinamente intensificándose con la edad y a medida que el peso aumenta con el cebo intensivo

El cambio de una alimentación básicamente extensiva, hacia una alimentación intensiva pre-lidia basada en dietas ricas en carbohidratos durante el último año de vida del animal, conlleva a desequilibrios nutricionales como lo son una suplementación de calcio-fósforo, una deficiencia de cobre, un excesivo aporte de zinc y una deficiencia de vitamina C, A, D, y biotina, propuestos como factores etiológicos de la osteocondrosis(49). Además este cebo intensivo desemboca en un aumento repentino de la grasa y masa muscular, que no va acompañado de un crecimiento esquelético, lo cual puede afectar a la movilidad del animal. De acuerdo

Cuadro 3. Correlación lineal del grado de lesión con el peso, la edad y la duración de cebo y entrenamiento para el conjunto de los animales Grado de lesión: Peso, kg Edad, meses Alimentación intensiva, meses Entrenamiento, meses

I

II

III

IV

-0.229* -0.079 0.084 -0.150

0.031 0.231* 0.257* 0.043

-0.057 0.102* 0.152* 0.255*

-0.031 -0.176 0.043 0.183*

*= P<0.05.

459


Juan Manuel Lomillos Pérez, et al. / Rev Mex Cienc Pecu 2017;8(4):453-462

con ello, en los resultados del presente estudio se observa que la duración de la fase de alimentación intensiva se correlaciona positivamente con las lesiones de grado II y III.

fracturas osteocondrales, particularmente en los seres humanos, su papel en el desarrollo inicial de osteocondrosis parece ser limitada, como lo demuestra la falta de una historia que incluye un impacto único y traumático en la mayoría de los animales y humanos(23,24,25). Una lesión traumática continua, como es el entrenamiento, podría explicar el hecho de que las lesiones se localizan en los sitios de predilección específica (menudillo) y, generalmente aparecen de forma bilateral.

Igualmente, la correlación positiva que se observa entre los meses de entrenamiento de los animales y la aparición de lesiones de grado III y IV (las más severas), hace pensar que la gimnasia funcional podría influir en el agravamiento de las lesiones que podrían haberse iniciado durante el periodo de alimentación intensiva. Este entrenamiento suele practicarse durante los seis meses anteriores a la lidia, y se basa generalmente en forzar a los animales a realizar un ejercicio intenso de carrera durante 30 min, tres veces por semana, lo que implica una mayor fricción en las articulaciones y podría agravar la lesión, incluso producir una cojera(48). Los traumatismos han sido una de las causas más ampliamente citadas como causa de osteocondrosis en todas las especies(1,13) y en sintonía con ello se puede pensar que el entrenamiento es a menudo una fuente de traumas en las articulaciones de los toros y novillos. Generalmente la gimnasia se realiza en los caminos que comunican los diferentes cercados de la ganadería, y el terreno no está adaptado al esfuerzo intenso que realizan los animales, siendo pisos duros. En ocasiones el ganadero prepara el “corredero” con tierra blanda, lo cual tampoco soluciona el problema con los riesgos de distensiones articulares(48). La localización de la lesión tiende a estar situada en puntos de estrés biomecánico local, como es el caso de la articulación del menudillo, además, el aumento del estrés parece incrementar la prevalencia y la gravedad de las lesiones macroscópicas(1), como es el caso de todos los movimientos de animales por la finca para los distintos manejos.

CONCLUSIONES E IMPLICACIONES Se identifica la osteocondrosis como una lesión común en los machos de la raza de lidia, con una incidencia del 70 % de los animales muestreados, de forma bilateral en el 78.3 % de los individuos afectados, siendo más graves las lesiones encontradas en la cara medial de la articulación. El 85 % de los animales manifestaron caídas de diferente grado, apreciando una mayor tasa de caídas tipo 1 y 2 sufridas por los animales con lesiones de grado IV frente a las experimentadas por el resto de animales, siendo el tercio de muleta la parte de la lidia donde más caídas desarrollan los animales, significativamente más numerosas en los individuos con lesión, debido al mayor esfuerzo de locomoción que desarrolla el animal en esta fase. En base a los resultados del análisis de correlación y la literatura consultada se puede inferir que existen varios factores que podrían predisponer la presentación de lesiones del cartílago articular, como son el aumento de peso debido al cebo intensivo previo a la lidia, la duración del mismo y del protocolo de entrenamiento seguido. LITERATURA CITADA

De igual forma, el efecto traumático del entrenamiento podría desembocar en la conversión de una lesión articular subclínica a una osteocondrosis manifiesta o desecante(48), la severidad del trauma por lo general es mínima, y a menudo incluye sólo las fuerzas que intervienen en la ambulación normal. Así, aunque los traumatismos graves se han documentado como causa de

460

1.

Bohndorf K. Osteochondritis (osteochondrosis) dissecans: a review and new MRI classification. Eur Radiol 1998;(8):103–112.

2.

Dewey C. Diseases of the nervous and locomotor systems. In: Diseases of swine. Straw B, et al. editors, 8th ed. Oxford, UK: Blackwell Science; 1999:861–883.

3.

Morgan JP, Wind A, Davidson AP. Enfermedades articulares y óseas hereditarias del perro. República Argentina: Editorial Intermédica; 2001.

4.

Ralphs, SC. Bilateral stifle osteochondritis dissecans in a cat. J Am Anim Hosp Assoc 2005;(41):78–80.


OSTEOCONDROSIS EN EL TORO DE LIDIA Y EVALUACIÓN DE SU EFECTO SOBRE LA MOVILIDAD DEL ANIMAL

5.

McIlwraith, CW. Diseases of joints, tendons, ligaments, and related structures. In: Adams’ lameness in horses, Stashak TS editor. 5th ed. Baltimore USA: Lippincott Williams & Wilkins; 2002:459–644.

6.

Jensen R, Park RD, Lauerman LH, Braddy PM, Horton DP, Flack, DE, et al. Osteochondrosis in feedlot cattle. Vet Pathol 1981;(18):529–535.

7.

22. Fernández FJ, Ortuño S, Recas EA. Osteocondrosis metacarpiana del toro de lidia: primeros resultados comparativos entre los estudios del 2000 y 2009. Symp Toro Lidia, Zafra (España). 2011:99-100. 23. Peterson RK, Savoie FH, Field, LD. Osteochondritis dissecans of the elbow. Instr Course Lect 1999;(48):393-398.

Trostle SS, Nicoll RG, Forrest LJ, Markel MD. Clinical and radiographic findings, treatment, and outcome in cattle with osteochondrosis: 29 cases (1986-1996). J Am Vet Med Assoc 1997:211(12):1566-1570.

8.

Tryon KA, Farrow CS. Osteochondrosis in cattle. Vet Clin North Am Food Anim Pract 1999;15(2):265-274.

9.

Jørgensen B, Andersen S. Genetic parameters for osteochondrosis in Danish Landrace and Yorkshire boars and correlations with leg weakness and production traits. Anim Sci 2000;(71):427–434.

24. Robertson W, Kelly BT, Green DW. Osteochondritis dissecans of the knee in children. Curr Opin Pediatr 2003;(15):38-44. 25. Blitz NM, Yu JH. Freiberg’s infraction in identical twins: a case report. J Foot Ankle Surg 2005;(44):218-221. 26. Leighton RL. Historical perspectives of osteochondrosis. Vet Clin North Am Small Anim Pract 1998;(28):1-16. 27. Hill BD, Sutton RH, Thompson H. Investigation of osteochondrosis in grazing beef cattle. Rockhampton Veterinary Laboratory, Queensland. Aust Vet J 1998;76(3):171-175.

10. Harari J, Osteochondrosis. Vet Clin North Am Small Anim Pract 1998;(28):87–94.

28. Grøndale, AM, Dolvik NI. Heritability estimations of osteochondrosis in the tibiotarsal joint and of bony fragments in the palmar/plantar portion of the metacarpo- and metatarsophalangeal joints of horses. J Am Vet Med Assoc 1993;(203):101–104.

11. Bertone AL, Bramlage LR, McIlwraith CW, Malemud CJ. Comparison of proteoglycan and collagen in articular cartilage of horses with naturally developing osteochondrosis and healing osteochondral fragments of experimentally induced fractures. Am J Vet Res 2005;(66):1881–1890.

29. Schenck RC, Goodnight JM. Osteochondritis dissecans. J Bone Joint Surg Am 1996;(78):439-456.

12. Ytrehus B, Carlson CS, Ekman S. Etiology and pathogenesis of osteochondrosis. Vet Pathol 2007;(44)429–448.

30. Richardson DC, Zentek J. Nutrition and osteochondrosis. Vet Clin North Am Small Anim Pract 1998;(28):115-135.

13. Ekman S, Carlson CS. The pathophysiology of osteochondrosis. Vet Clin North Am Small Anim Pract 1998;(28):17–32.

31. Shingleton WD, Mackie EJ, Cawston TE, Jeffcott LB. Cartilage canals in equine articular/epiphyseal growth cartilage and a possible association with dyschondroplasia. Equine Vet J 1997;(29):360-364.

14. Urquía JJ, Morales J, Durán JM, Carpintero CM, Fernández C, Flores, B, et al. Consideraciones sobre el estudio de la osteocondrosis de la articulación carpo-metacarpiana en el toro de lidia. IV Symposium Nacional del Toro de Lidia. Zafra. 1999:255-258.

32. Jeffcott LB, Henson FM. Studies on growth cartilage in the horse and their application to aetiopathogenesis of dyschondroplasia (osteochondrosis). Vet J 1998;156:177-192.

15. Dávila U, Méndez JL, Aja S, Calva B, Sierra MA, Téllez JR, Méndez A. Osteocondrosis, alteración patológica influyente en la caída del toro de lidia. Congreso Mundial Taurino de Veterinaria. Murcia (España). 2008:219-223.

33. Carlson CS, Cullins LD, Meuten DJ. Osteochondrosis of the articularepiphyseal cartilage complex in young horses: evidence for a defect in cartilage canal blood supply. Vet Pathol 1995;(32):641–647. 34. Van der Wal PG, Van der Valk PC, Goedegebuure SA, Van Essen G. Osteochondrosis in six breeds of slaughter pigs. II. Data concerning carcass characteristics in relation to osteochondrosis. Vet Q 1980;(2):42-47.

16. Mas A, Martínez-Gomariz F, Sanes JM, Gutiérrez C, Motas M, Pallarés FJ. Estudio macroscópico y estructural de la osteocondrosis en la articulación carpometacarpiana en el toro de lidia. Symp Toro Lidia, Zafra (España). 2011:185-188.

35. LaFond E, Breur GJ, Austin CC. Breed susceptibility for developmental orthopedic diseases in dogs. J Am Anim Hosp Assoc 2002;(38):467-477.

17. Mas A, Martínez-Gomariz F, Sanes JM, Sánchez C, Reyes JA, Gutiérrez C, Seva JI. Estudio estadístico de la relación de la edad y el peso con la aparición de osteocondrosis carpometacarpiana y síndrome de la caída en el toro de lidia. Symp Toro Lidia, Zafra (España). 2011:189-193.

36. Castejón FJ. Incoordinación motora y caída del ganado bravo durante la lidia. Bol Inf SYVA. 1985:40-44.

18. Dávila U. Osteocondrosis en el toro de lidia [tesis doctoral]. Córdoba, España: Universidad de Córdoba; 2013.

37. Bartolomé DJ. La acidosis del toro de lidia [tesis doctoral]. León, España. Universidad de León; 2009.

19. Alonso ME, Sánchez JM, Robles R, Zarza AM, Gaudioso VR. Relation entre la fréquence de la chute et différents paramètres hematologiques chez le toreau de combat. Revue de Medecine Vétérinaire 1997;(148)12:999-1004.

38. Jordano D, Gómez-Cárdenas G. Investigaciones sobre la caída de los toros de lidia. Arch Zootec 1954:3(9):3-52. 39. García-Belenguer S. Estudio de degeneraciones musculares en ganado bravo y su relación con la fuerza exhibida por los animales durante la lidia [tesis doctoral]. Zaragoza, España: Universidad de Zaragoza; 1991.

20. Martínez P. Lesiones anatómicas producidas en el toro por los trebejos empleados en la lidia [tesis doctoral]. Córdoba, España: Universidad de Córdoba; 1997.

40. Purroy A, García-Belenguer. La falta de fuerza en el toro bravo. El Campo 1992;(125):49-56.

21. Martínez-Gomariz, F, Mas A, Vázquez JM, Gil F, Seva JI, Sánchez C, et al. Estudio artroscópico de la osteocondrosis carpometacarpiana del toro de lidia. VII Congreso Mundial Taurino de Veterinaria. Cáceres (España) 2011:175-180.

41. Alonso R, Hebrero C, Pizarro M. La caída del toro bravo y su posible relación con el encaste, el peso y la edad. Rev Prof Vet 2006(66):32-34.

461


Juan Manuel Lomillos Pérez, et al. / Rev Mex Cienc Pecu 2017;8(4):453-462

45. Mármol M. La caída del toro de lidia. Ganadería 1967(292):533535.

42. Aceña MC. Estudio de la respuesta de estrés en el toro bravo y su relación con la fuerza y la adaptación muscular al ejercicio durante la lidia [tesis doctoral]. Zaragoza, España: Universidad de Zaragoza; 1993.

46. Molina J. La caída de los toros de lidia. Ganadería 1968(307):3539.

43. Paniagua FJ. Tiempos de lidia y de ejercicio del toro. Congreso Mundial Taurino de Veterinaria. Córdoba. 1997:143-145.

47. Ruiz L. ¿Por qué se caen los toros? Ganadería 1971(333):141-143. 48. Lomillos JM. Uso de nuevas tecnologías para el estudio de la raza de lidia [tesis doctoral]. León, España: Universidad de León; 2012.

44. García-Scheider JMN. Développement et validation d´une nouvelle méthode quantitative et objective d´evaluation du comportement et des dépenses énergétiques du taureau Brave au cours de la corrida [these doctorel]. Toulouse, France: Université Paul-Sabatier de Toulouse; 2008.

49. Nakano T, Aherne FX. Involvement of trauma in the pathogenesis of osteochondritis dissecans in swine. Can J Vet Res 1988;(52):154155.

462


e

P

Pags.

Rmcp Vol 8, Núm (4), 2017 para issuu