RMCP Vol. 13 Núm. 1 (2022): Enero-Marzo [versión en español]

Page 1

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 13 Núm. 1, pp. 1-322, ENERO-MARZ0-2022

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 13 Núm. 1, pp. 1-322, ENERO-MARZO-2022


REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 13 Numero 1, Enero-Marzo 2022. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 042021-051209561700-203. ISSN: 2428-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en abril de 2022. Yegua Criollo Colombiana en prueba de desempeño en piso; Medellín, Colombia. Fotografía: Eduar Roldán Montador y Equuslab

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, Dr. Alfonso Juventino Chay Canul, Universidad Autónoma de Tabasco, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Maurcio A. Elzo, Universidad de Florida Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, Universidad Autónoma del Estado de Hidalgo, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México Dr. Jorge Alberto López García, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. José Juan Hernández Ledezma, Consultor privado Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

I


REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

total por publicar es de $ 7,280.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 425.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II


REVISTA MEXICANA DE CIENCIAS PECUARIAS

REV. MEX. CIENC. PECU.

VOL. 13 No. 1

ENERO-MARZO-2022

CONTENIDO Contents ARTÍCULOS Articles Pág. Efectos del genotipo, tamaño de la camada y el sexo sobre las características de la canal y el perfil de ácidos grasos en corderos de pelo Effects of genotype, litter size and sex on carcass characteristics and fatty acid profile in hair lambs Oscar Elías Cruz-Sánchez, José Herrera-Camacho, Ricardo A. García-Herrera, Lorena Aguayo-Ulloa, Víctor M. Moo-Huchin, Aldenamar Cruz- Hernández, Armando Gómez- Vázquez, Ulises Macias-Cruz, Alfonso J. Chay-Canul…………………………………………………………………………………………………………….1 Performance of lambs fed total feed silage based on cactus pear Rendimiento de corderos alimentados con ensilaje como alimento total a base de nopal Juscelino Kubitschek Bevenuto da Silva, Gherman Garcia Leal de Araújo, Edson Mauro Santos, Juliana Silva de Oliveira, Fleming Sena Campos, Glayciane Costa Gois, Tiago Santos Silva, Alex Gomes da Silva Matias, Ossival Lolato Ribeiro, Alexandre Fernandes Perazzo, Anderson de Moura Zanine ............………………………………………………………………………………………………………….19 Comparación en la calidad de huevos obtenidos en un sistema de producción en corrales al aire libre y los producidos en un sistema de jaula Comparison in the quality of eggs obtained in an outdoor pen production system and those produced in a cage system Samantha Romo, Daniela López, Néstor Ledesma, Carlos Gutiérrez, Antonio Quintana, Lucía Rangel …………………………………………………………………………………………………………………….…32 Using grapeseed meal as natural antioxidant in slow-growing Hubbard broiler diets enriched in polyunsaturated fatty acids Uso de harina de semilla de uva como antioxidante natural en dietas de pollos de engorda Hubbard de crecimiento lento enriquecidas con ácidos grasos poliinsaturados Margareta Olteanu, Tatiana Dumitra Panaite, Raluca Paula Turcu, Mariana Ropota, Petru Alexandru Vlaicu, Monica Mitoi …………………………………………………………………………………………………………..43

III


Factores asociados a indicadores de crianza de reemplazos bovinos durante el periodo de lactancia en unidades lecheras de pequeña escala Factors associated with indicators of calf rearing during the lactation period in small-scale dairy farms Fernando Villaseñor González, Eliab Estrada Cortés, Lilia del Rocío Montes Oceguera, Héctor Raymundo Vera Ávila, Luis Javier Montiel Olguín, Héctor Jiménez Severiano, Mario Alfredo Espinosa Martínez …………………………………………………………………………………………………………….…64 Impacto económico y productivo de una mezcla herbal con derivados de colina en la producción de conejos Economic and productive impact of an herbal mixture with choline derivatives on rabbit production Minerva Jaurez-Espinosa, Pedro Abel Hernández-García, Amada Isabel Osorio-Terán, Germán David Mendoza-Martínez, Juan José Ojeda-Carrasco, María Zamira Tapia-Rodríguez, Enrique EspinosaAyala ……………..……………………………………………………………………………………………………………….…82 Características de la canal y perfil de ácidos grasos de la carne de corderos criollos suplementados con semilla de algodón y maíz Carcass characteristics and fatty acid profile of the meat of Creole lambs supplemented with cottonseed and corn Emiro Suárez Paternina, Libardo Maza Ángulo, Wilson Barragán Hernández, Lorena Aguayo Ulloa, Oscar Vergara Garay…………………………………………………………………………………………….………………97 Correlación entre variables ante mortem y post mortem en canales de ovinos producidos en México Correlation between ante-mortem and post-mortem variables in sheep carcasses produced in Mexico Lizbeth Esmeralda Robles Jiménez, José Armando Partida de la Peña, Miguel Enrique Arechavaleta Velasco, Ignacio Arturo Domínguez Vara ……………………………………………………………..………………115 Financial performance and opportunistic commercialization of beef production systems in southern Brazil Desempeño financiero y comercialización oportunista de los sistemas de producción de carne de res en el sur de Brasil Amir Gil Sessim, Maria Eugênia Andrighetto Canozzi, Gabriel Ribas Pereira, Eduardo Madeira Castilho, Júlio Otávio Jardim Barcellos ....................................................................................127 Modelos de negocio para la producción de ovinos en el nororiente y centro del Estado de México Business models for sheep production in the Northeast and center of the State of Mexico Judith Calderón-Cabrera, Vinicio Horacio Santoyo-Cortés, Enrique Genaro Martínez-González, Víctor Herminio Palacio-Muñoz…………………………………….………………………………………………………145

IV


Effect of early age at first calving on longevity, number of days in production and lifetime milk yield of Holstein and Brown Swiss dairy cows in Honduras Efecto de la edad al primer parto sobre la longevidad, el número de días en producción y la producción de leche durante la vida productiva de las vacas lecheras Holstein y Pardo Suizo en Honduras Karen Alessa Copas Medina, Manuel Valladares Rodas, Juan José Baeza Rodríguez, Juan Gabriel Magaña Monforte, José Candelario Segura Correa ………………………………………………………..………163 Efecto de la viscosidad en el medio para la criopreservación espermática de gallo (Gallus gallus) Effect of viscosity on the medium for rooster (Gallus gallus) sperm cryopreservation José Antonio Herrera Barragán, José Manuel Huitrón, Juan José Pérez-Rivero, Adrián Guzmán Sánchez, Alejandro Ávalos Rodríguez, Ana María Rosales Torres, Ricardo Camarillo Flores ….……175 Antimicrobial residues found in poultry commercialized in retail stores from the Metropolitan Area of Guadalajara, Jalisco Residuos de antimicrobianos encontrados en aves de corral comercializadas en tiendas minoristas de la zona Metropolitana de Guadalajara, Jalisco Delia Guillermina González-Aguilar, Maritza Alejandra Ramírez-López, Iyari Ximena Uribe-Camberos, Jeannette Barba-León …………………………………………………………………………………..……………………187 Determinación serológica del virus de leucosis enzoótica bovina (VLEB) en el municipio de Paipa, Boyacá (Colombia) Serological determination of enzootic bovine leukosis virus (EBLV) in the municipality of Paipa, Boyacá (Colombia) Jorge Alejandro Jiménez Sánchez, Diana María Bulla-Castañeda, Adriana María Díaz-Anaya, Diego José García-Corredor, Martin Orlando Pulido-Medellín ……………………………………………………………200 Hematological, biochemical, and endocrine parameters in acute response to increasingintensity exercise in Colombian Paso horses Parámetros hematológicos, bioquímicos y endocrinos en la respuesta aguda al ejercicio de intensidad creciente en caballos de Paso colombianos Angélica María Zuluaga Cabrera, Maria José Casas Soto, José Ramón Martínez Aranzales, Viviana Elena Castillo Vanegas, Nathalia María del Pilar Correa Valencia, María Patricia Arias Gutiérrez ...211 Efecto del comportamiento higiénico sobre la resistencia a la cría calcárea (Ascosphaera apis) en colonias de abejas africanizadas (Apis mellifera) Effect of hygienic behavior on resistance to chalkbrood disease (Ascosphaera apis) in Africanized bee colonies (Apis mellifera) Carlos Aurelio Medina-Flores, Luis Abdelmir Medina Medina, Ernesto Guzmán-Novoa ……………….225

V


Producción y calidad nutritiva de Tithonia diversifolia (Hemsl.) A. Grey en tres épocas del año y su efecto en la preferencia por ovinos Pelibuey Production and nutritional quality of Tithonia diversifolia (Hemsl.) A. Grey in three seasons of the year and its effect on the preference by Pelibuey sheep Vicky Tatiana Vargas Velázquez, Ponciano Pérez Hernández, Silvia López Ortiz, Epigmenio Castillo Gallegos, Cristino Cruz Lazo, Jesús Jarillo Rodríguez ……………………………………………………..………240 NOTAS DE INVESTIGACIÓN Technical notes Efecto del aceite de orégano en las propiedades fisicoquímicas, texturales y sensoriales del queso panela Oregano essential oil in panela-type cheese: its effects on physicochemical, texture and sensory parameters Niriel Sánchez-Zamora, Mónica Dinorah Cepeda-Rizo, Katty Lorena Tamez-Garza, Beatriz Adriana Rodríguez-Romero, Sugey Ramona Sinagawa-García, Alejandro Isabel Luna Maldonado, Emmanuel Flores-Girón, Gerardo Méndez-Zamora ………………………………………………………………………………..258 Efecto de la nisina en la inhibición del crecimiento de Staphylococcus areus y en las propiedades sensoriales del queso costeño Effect of nisin on the inhibition of the growth of Staphylococcus areus and on the sensory properties of coastal cheese Beatriz Alvarez Badel, Maria Alejandra Doria Espitia, Vanesa Hodeg Peña, Mónica María Simanca Sotelo, Yenis Pastrana Puche, Claudia Denise De Paula…………………………………………………….……272 El huevo de traspatio: ventana de oportunidad de ingresos en comunidades del Municipio de Texcoco, Estado de México Backyard eggs: an income opportunity window in communities in Texcoco, Mexico Juan Hernández Ortiz, Olga Jacqueline Galicia Rojano, Enrique Melo Guerrero, Ramón Valdivia Alcalá, Luis Manuel Valenzuela Núñez……………………………………………………………………………..……287 Rendimiento y digestibilidad de forraje de cultivares de Urochloa spp. a tres edades de rebrote en épocas de lluvias y seca Forage yield and digestibility of Urochloa spp. cultivars at three regrowth ages in the rainy and dry seasons in Ecuador Jonathan Raúl Garay Martínez, Benigno Estrada Drouaillet, Juan Carlos Martínez González, Santiago Joaquín Cancino, Hernán Patricio Guevara Costles, Marco Vinicio Acosta Jácome, Eugenia Guadalupe Cienfuegos Rivas……………………………………………………………………………………297 Incubación, pre-lisis y post-purificación en el rendimiento y pureza de ácidos nucleicos extraídos de sangre de cabras domésticas contenida en tarjetas FTA Incubation, pre-lysis and post-purification on the yield and purity of nucleic acids extracted from blood of domestic goats contained in FTA cards Carolina Sancho-Blanco, Esteban J. Jiménez-Alfaro, Ramón Molina-Bravo, Rodolfo UmañaCastro………………………………………………………………………………………………………………………………311

VI


Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

6.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes). Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo. El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

4.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

5.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

7.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8.

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

VII


Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

referencias, aunque pueden insertarse en el texto (entre paréntesis).

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés. 12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus. Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

VIII


I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

XI)

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

IX


XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

xg

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50 g

vs

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s)

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

X


Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

4.

5.

6.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts). All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt. Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias”. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

7.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

8.

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

9.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary works and may show partial or final results of research. The text of the article must include the following parts:

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

b) Technical Notes. They should be brief and be

evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which

XI


should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of the research article but without section titles.

names(s), the number of the edition, the country, the printing house and the year. e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Key rules for references a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one. b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article). c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10. III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

XII


Organization, as author VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

In press VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000. Books and other monographs

Author(s) VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Organization as author XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984. XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996. XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988. XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Conference paper X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003. XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003. XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003. 12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

13. Final version. This is the document in which the authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII


14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m µl µm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v. J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

vs

versus

xg

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIV


https://doi.org/10.22319/rmcp.v13i1.5727 Artículo

Efectos del genotipo, tamaño de la camada y el sexo sobre las características de la canal y el perfil de ácidos grasos en corderos de pelo

Oscar Elías Cruz-Sánchez a José Herrera-Camacho b Ricardo A. García-Herrera a Lorena Aguayo-Ulloa c Víctor M. Moo-Huchin d Aldenamar Cruz- Hernández a Armando Gómez- Vázquez a Ulises Macias-Cruz e Alfonso J. Chay-Canul a*

a

Universidad Juárez Autónoma de Tabasco. División Académica de Ciencias Agropecuarias, Carr. Villahermosa-Teapa, km 25, CP 86280. Villahermosa, Tabasco, México. b

Universidad Michoacana de San Nicolás de Hidalgo. Instituto de Investigaciones Agropecuarias y Forestales. Michoacán, México. c

Corporación Colombiana de Investigación Agropecuaria-AGROSAVIA. Centro de Investigación Turipaná. Córdoba, Colombia. d

Tecnológico Nacional de México, Instituto Tecnológico de Mérida. Yucatán. México.

e

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas. Baja California, México.

*Autor de correspondencia: alfonso.chay@ujat.mx; alfonsochay2@gmail.com

1


Rev Mex Cienc Pecu 2022;13(1):1-18

Resumen: El efecto del genotipo (Pelibuey vs Katahdin), tipo de parto (simple vs dobles) y sexo (machos vs. hembras) sobre las características de la canal y de sus cortes, además del perfil de ácidos grasos del lomo fueron evaluados en 66 corderos sacrificados al destete. El rendimiento de la canal y del costillar fue mayor (P<0.05) en la raza Pelibuey. El peso al sacrificio, peso de canal y rendimiento del costillar fue mayor (P<0.01) en crías de parto simple, mientras que el rendimiento de paleta y pierna fue menor (P< 0.01) que en crías de parto doble. La proporción del tejido blando de los diferentes cortes fue mayor (P<0.05), pero el de hueso fue menor (P< 0.05) en crías de parto simple que las de parto doble. Las hembras tuvieron mayor (P<0.05) proporción de tejido blando y menor proporción de hueso (P<0.01) que los machos. Las concentraciones de C18:1n7 y C20:4n-6 fueron mayores (P< 0.05) en la raza Pelibuey que, en la Katahdin, mientras que los C22:5n-3 y C22:6n-3 fueron menores. El porcentaje de ácidos grasos monoinsaturados fue mayor (P<0.05) en la carne de crías de partos simples, en tanto que el de los ácidos grasos poliinsaturados totales y n-3 fue mayor (P<0.05) en crías de partos dobles. Las características de la canal, la composición tisular de los cortes comerciales y el perfil de ácidos grasos en ovinos de pelo sacrificados al destete mostraron más cambios por el tipo de parto que por el genotipo o el sexo. Palabras clave: Características de la canal, Canales de ovino, Corderos, Cortes primarios, Composición tisular, Ácidos grasos.

Recibido: 10/07/2020 Aceptado: 13/04/2021

Introducción La carne de ovino en México se consume mayormente en forma de barbacoa, se estima un consumo per cápita anual de 600-1000 g, por lo que corderos y corderas de engorda, así como ovejas y sementales adultos de desecho, son utilizados indistintamente para la elaboración de este platillo típico del centro del país(1,2,3). No obstante, en la actualidad existe un sector pequeño de la población mexicana que demanda platillos gourmet con carne de alta calidad, procedente preferentemente de corderos jóvenes(2,3). Uno de los productos más apetecidos en países del Mediterráneo como España, es el cordero lechal, que procede de ovinos lactantes con canales ultra-livianas y que se caracteriza por tener una carne considerada tradicionalmente como de gran calidad sensorial y muy apreciada localmente(4). Sin embargo, la comercialización de cortes primarios o canales provenientes de corderos jóvenes, menores de tres meses, no ha sido usual en México(5). No obstante, lo anterior y 2


Rev Mex Cienc Pecu 2022;13(1):1-18

dado el surgimiento de este mercado, resulta muy pertinente definir el tipo de corderos que ofrece mejor calidad de canal, carne y cortes de venta, considerando tanto el sexo y tipo de parto, como el genotipo. En corderos de engorda, las características de la canal y la calidad de la carne varían por factores genéticos, el tipo de parto y el sexo, así como algunos factores de manejo que afectan la alimentación, la edad y el peso al sacrificio(4-11). Estos factores también influyen en el rendimiento de los cortes comerciales y el perfil de ácidos grasos de la carne procedente de los corderos(7,8). Todas estas diferencias en canal y carne se deben a que dichos factores causan variaciones metabólicas, endocrinas y en la expresión de genes, las cuales conllevan a que los corderos varíen en su crecimiento, así como en la formación de tejido muscular y tejido graso en el cuerpo(3). Varios estudios han documentado el impacto que tienen los factores genéticos y ambientales en el crecimiento pre-destete de los corderos de pelo(12-16); sin embargo, pocos se han enfocado al estudio de las características de la canal, la composición tisular de los cortes comerciales y el perfil de los ácidos grasos de la carne. Recientemente, algunos autores(5,17) reportaron que las características y composición tisular de la canal están influenciados por el tipo de parto de los corderos Blackbelly × Pelibuey, siendo las canales de corderos procedentes de parto simple más pesadas y con mayor contenido de tejidos blandos que las canales de corderos de parto múltiple. No obstante, no se encontró información respecto al efecto del genotipo y sexo sobre la composición de la canal en corderos faenados al destete. Los ovinos de pelo están ampliamente distribuidos en las regiones tropicales y subtropicales de México y, en general, del continente americano, lo cual se debe a que no presentan estacionalidad reproductiva y se adaptan fácilmente a climas cálidos(18), por lo que se emplean para la producción de carne para abasto, pero actualmente se está promoviendo su uso para la producción de cortes finos dirigidos a un mercado selecto que demanda carne de cordero joven(19). Por lo tanto, el objetivo del presente estudio fue evaluar los efectos del genotipo, el tipo de parto y el sexo sobre las características de la canal, la composición tisular de los cortes comerciales y el perfil de los ácidos grasos de la carne en corderos de pelo lactantes.

Material y métodos Localización del experimento El estudio se llevó a cabo en el rancho “El Rodeo”, localizado a 17º 84’ LN y 92º 81’ LO, en el municipio de Villahermosa, Tabasco, México. El clima en la región es tropical húmedo, con una temperatura promedio de 27 ºC y una precipitación pluvial de 2,550 mm anuales(20). Todo el manejo de los animales se realizó de acuerdo con las normas mexicanas que 3


Rev Mex Cienc Pecu 2022;13(1):1-18

describen los lineamientos para producción, cuidado y uso de animales de laboratorio (NOM062-ZOO-1992), así como la matanza de ellos (NOM-033-ZOO-1995).

Animales y manejo experimental Se utilizaron 66 crías nacidas de 49 ovejas multíparas (edad= 2-3 años), peso vivo [PV] = 45.6 ± 6.8 kg y condición corporal= 2.2 ± 0.7 unidades(21) de las razas Pelibuey (n= 28) y Katahdin (n= 21). Del total de crías 39 fueron de raza Pelibuey (21 machos y 18 hembras) y 27 Katahdin (15 machos y 12 hembras), 31 de parto simple y 36 de parto doble, 36 machos y 30 hembras. Al parto, las crías se identificaron y se alojaron en corraletas individuales con sus madres donde permanecieron hasta el día 56 en el que se destetaron y faenaron. Las corraletas se ubicaron bajo un cobertizo construido con láminas galvanizadas, sin paredes y con piso de cemento. Cada corraleta se equipó con bebedero y un comedero diseñado para que las crías no tuvieran acceso al alimento de la madre. La alimentación de las ovejas consistió en una dieta integral formulada para aportar 12 MJ de EM/kg de materia seca y 15 % de proteína cruda. La dieta se formuló con 50 % de heno de pasto estrella (Cynodon nlemfuensis), 30 % de maíz molido, 10 % de harina de soya, 5 % de melaza y 5 % de minerales. Las ovejas se pesaron semanalmente con el objetivo de ajustar la cantidad de alimento ofrecido de acuerdo con el peso vivo (PV) para garantizar un rechazo diario de alrededor del 15 %. El alimento se ofreció diariamente a las 0800 y 1500 h en una proporción 50:50. La disponibilidad de agua fue ad libitum y diariamente se revisó en forma visual el estado de salud de todos los animales. En el caso de las crías, la alimentación dependió solamente del consumo de la leche provista por la oveja, diariamente se supervisó el consumo de leche de las crías, por lo que cuando alguna oveja se rehusaba a amamantarlas, la madre se sujetaba para que su cría pudiera mamar.

Características de la canal y cortes comerciales Los corderos se destetaron a los 56 días post-parto, se pesaron para obtener el peso vivo al sacrificio (PVS) y se faenaron según los lineamientos de la norma mexicana para el sacrificio humanitario (NOM-033-ZOO-1995). A los corderos se les quitó la piel, cabeza, patas y vísceras. Se calculó el contenido del tracto gastrointestinal por diferencia entre el peso lleno y vacío. El peso del contenido gastrointestinal se restó al PVS para obtener el peso vivo vacío (PVV). Una vez obtenida la canal, se registró su peso en caliente (PCC) y luego de 24 h de refrigeración aproximadamente a 2 °C se registró su peso en frío (PCF). Los rendimientos en canal caliente (RCC% = PCC / PVS × 100) y canal fría (RCF% = PCF / PVS × 100), así como el rendimiento verdadero (RV = PCC/PVV × 100) también fueron calculados. Para la determinación de la composición regional, las canales se cortaron por la línea media dorsal 4


Rev Mex Cienc Pecu 2022;13(1):1-18

y a partir de la media canal izquierda se obtuvieron los siguientes cortes: cuello, paleta, pierna, lomo y costillar, de acuerdo con la metodología descrita previamente(3). Se registró el peso de la media canal, así como de cada corte y se calculó el porcentaje de cada uno de ellos. Finalmente, para obtener el rendimiento cárnico (composición), cada corte se diseccionó separando y registrando el peso de tejido blando en conjunto (músculo, grasa, aponeurosis, tendones, nervios y vasos) y hueso(22,23). El peso del tejido blando y hueso de cada corte primario, así como de la media canal fueron expresados como un porcentaje del peso de cada corte y de la media canal izquierda, respectivamente.

Determinación de ácidos grasos En 24 corderos seleccionados, 12 de cada genotipo y de los cuales fueron seis hembras y seis machos, así como seis provenientes de parto simple y seis de parto doble, se determinó la composición de ácidos grasos del músculo Longissimus dorsi utilizando un cromatógrafo de gases Perkin Elmer Auto system (Perkin-Elmer, Norwalk, CT, USA), equipado con un detector de ionización de flama (FID). Los esteres metílicos de los ácidos grasos (EMAGs) fueron preparados de acuerdo con la metodología descrita previamente(24) y fueron inyectados (1.0 µl) en una columna capilar BPX–70 (60 m × 0.25 mm ID). Las temperaturas del detector e inyector fueron de 260 °C y 240 °C, respectivamente. El programa de temperatura de la columna fue de 140 a 240 °C con un incremento de 4 °C por minuto, utilizando nitrógeno (1.0 ml/min) como gas acarreador(25,26). Se utilizó una mezcla de estándares EMAGs para la identificación (por comparación de tiempos de retención) de los picos del cromatograma de las muestras. Se determinó el área de los picos y se obtuvo el porcentaje de EMAGs mediante el porcentaje de área por normalización directa. Los resultados fueron expresados como porcentaje del área de cada pico normalizado del total de EMAGs identificados.

Análisis estadístico La información sobre las características de la canal y del perfil de los ácidos grasos de la carne se sometió a un análisis de varianza bajo un diseño completamente al azar con arreglo factorial 2×2×2, donde el modelo incluyó los efectos fijos de genotipo (Pelibuey o Katahdin), tipo de parto (simple o doble), sexo (macho o hembra) y las posibles interacciones entre factores. Se realizó un análisis de medias con la prueba de Tukey entre niveles de cada factor principal y se consideró un valor de significancia de P<0.05. Los análisis se realizaron con PROC GLM de SAS(27).

5


Rev Mex Cienc Pecu 2022;13(1):1-18

Resultados Genotipo Se obtuvieron diferencias significativas (P<0.05) en los rendimientos centesimales de las canales (P<0.05) entre ambas razas, pero no se encontraron diferencias (P>0.05) en las variables de PVS, PVV, PCC y PCF. Las canales de los corderos Pelibuey tuvieron mayores (P<0.01) RCC (+3.82 pp), RCF (+3.41 pp) y RV (+4 pp) que los corderos Katahdin (Cuadro 1). Los corderos Pelibuey también lograron un mayor (P<0.01) rendimiento del costillar (+2.44 pp), pero menor (P<0.05) rendimiento del cuello comparado con los Katahdin (-1.83 pp). No se encontraron diferencias significativas en la paleta y ni el lomo, y solo una tendencia (P= 0.08) a un incremento en el rendimiento de la pierna en los corderos Katahdin. Los rendimientos, cárnico de la canal completa y de los cortes primarios no fueron afectados (P= 0.11) por el genotipo (Cuadro 2). En el Cuadro 3 se muestra el perfil de ácidos grasos de la carne, respecto del total de ácidos grasos identificados. Se observaron diferencias significativas (P<0.01) entre razas en un ácido graso monoinsaturado y tres poliinsaturados. La carne (M. Longissimus) de las crías Pelibuey presentó mayores proporciones de ácido vaccénico (C18:1n-7) y araquidónico (C20:4n-6) y menores proporciones de DPA (C22:5n3) y DHA (C22:6n-6) que la carne de crías de la raza Katahdin. Las proporciones totales de ácidos grasos saturados (TS), monoinsaturado (TM) y poliinsaturados (AGPIn-3, AGPIn-6 y AGPITotales) no fueron afectadas (P>0.05) por efecto de la raza, solo el contenido total de ácidos grasos saturados mostró una tendencia (P= 0.07) a aumentar en la carne de la raza Katahdin comparada con la carne de la raza Pelibuey.

Tipo de parto Se obtuvieron diferencias significativas (P<0.01) para el tipo de parto en los pesos de la canal, pero no en sus rendimientos centesimales (RCF, RV). Los corderos de parto simple alcanzaron mayor PVS (+2.94 kg), PVV (+2.75 kg), PCC (+1.59 kg) y PCF (+1.58 kg) comparado con los de partos doble (Cuadro 1). Solo hubo una tendencia (P=0.08) al incremento del RCC en las crías de parto simple en comparación con las de parto doble. Los rendimientos de la paleta y la pierna fueron mayores (P<0.01) en corderos de parto doble, pero el rendimiento de costillar fue mayor (P<0.01) en corderos de parto simple (Cuadro 1). El tipo de parto también modificó (P<0.01) el rendimiento cárnico de la media canal, del costillar, lomo y pierna (Cuadro 2). Los corderos de parto simple obtuvieron mayor proporción de tejido blando en la media canal que los de parto doble (P<0.01). Las proporciones del tejido blando y hueso del costillar, lomo y pierna fueron mayores (6.11 pp, +7.26 pp y +4.99 pp, respectivamente, P<0.01) en corderos de parto simple comparado con los corderos de parto doble. Se observaron diferencias significativas (P≤0.05) en el 6


Rev Mex Cienc Pecu 2022;13(1):1-18

porcentaje de un ácido graso saturado, dos monoinsaturados y cinco poliinsaturados (Cuadro 3). La carne de cordero de parto simple comparada con la carne de cordero de parto doble presentó menor contenido de ácido palmítico (C16:00) y elídico (C18:1n-9), pero mayor contenido de ácido vaccénico (C18:1n-7), linoleico (C18:2n-6), dihomo gamma linolénico (C20:3n-6), araquidónico (C20:4n-6) y DPA (C22:5n-3). El tipo de parto tuvo un efecto (P<0.05) en el porcentaje total de ácidos grasos monoinsaturados (TM), AGPIn-3, y AGPITotales. La proporción TM fue mayor (P>0.01) en la carne de corderos de parto simple comparado con la de partos doble; resultados opuestos fueron observados para el total de AGPIn-3 y AGPITotales, donde el porcentaje mayor (P<0.05) se presentó en la carne de ovinos de parto doble (Cuadro 3).

Sexo El sexo no afectó (P≥0.08) PVS, PVV, las características de la canal y tampoco el rendimiento de los cortes comerciales (Cuadro 1), pero si afectó (P=0.04) la composición del costillar, siendo mayor el porcentaje de tejido blando y menor el de hueso en hembras que en machos (Cuadro 2). El perfil de ácidos grasos no fue modificado (P>0.05) por efecto del sexo (Cuadro 3).

Discusión Características de la canal y rendimiento cárnico En México, solo unos pocos estudios(5,17) han reportado el efecto del número de crías y tipo de parto de las ovejas sobre las características y composición de la canal de corderos recién destetados, por lo que la literatura es escasa. Los resultados del presente estudio confirman hallazgos preliminares respecto al efecto del tipo de parto sobre el PCC; incluso, con una diferencia de pesos más amplia(5,17). Adicionalmente, el presente trabajo indica que en corderos de pelo faenados al destete (56 días), el genotipo también tiene un efecto sobre las principales variables de calidad cuantitativa de la canal y sus cortes. Los partos simples originaron mayores pesos de los corderos al destete y de las canales de los corderos de los partos dobles, con diferencias hasta de +2.94 kg para el PVS y +1.58 kg para el PCF, sin diferencia en los rendimientos de la canal. Sin embargo, la raza no originó diferencias en los pesos, pero sí en los rendimientos, en donde el RV del Pelibuey fue 4 puntos mayor que en el Katahdin. Un estudio con información tomada de registros productivos de un rebaño Pelibuey(28) no encontró diferencias en el peso al destete entre el tipo de parto, pero sí en la ganancia diaria de peso. En dicho trabajo, al igual que en el presente estudio, no se encontraron diferencias significativas en el peso al destete entre machos y hembras(5); sin embargo, si se mencionan varias inconsistencias(29). Algunos autores también han reportado que bajo condiciones de manejo intensivas en la raza Pelibuey, el tipo de nacimiento del 7


Rev Mex Cienc Pecu 2022;13(1):1-18

cordero afecta su peso al destete (PD) y ganancia diaria de peso (GDP), mientras que el sexo del cordero afecta su desarrollo desde el nacimiento hasta los 180 días(30). No obstante, en estos estudios solo se consideran los efectos principales, sin considerar la influencia de la interacción entre ambos factores(31). En los rumiantes, el crecimiento prenatal es influenciado por diversos factores, destacando el nivel de nutrición materna y la capacidad funcional de la placenta(17); mientras que el crecimiento postnatal puede ser limitado por la nutrición materna y por factores ambientales(32). Otros autores(33) reportan que animales provenientes de nacimientos simples tienen mayor potencial de crecimiento que los de nacimiento doble. Este hecho, con base en lo descrito en estudios previos(34), estaría relacionado con la competencia por la leche materna, dado que los corderos de parto doble tienen una menor ingesta de leche. En este sentido, la obtención de partos dobles permite una mayor eficiencia en la producción de carne ovina, pero los corderitos alcanzan el peso al sacrificio a mayor edad que los de parto simple(35). En estudios previos(17), se observó un incremento de PCC en corderos de parto simple, sin diferencias en el PVS o RC. Estas diferencias entre el peso de la canal de corderos de nacimiento sencillo y múltiple pueden deberse al peso de la masa muscular por un mayor consumo individual de leche en la etapa de lactancia(17). En corderos lactantes de la raza Canaria sacrificados entre los 48 y 51 días de edad, se evaluó el efecto de la variedad (Canaria de pelo vs Canaria de Lana) y el sexo sobre las características de la canal(36), en promedio, dichos animales pesaron 9.13 kg al sacrificio, obtuvieron canales de 4.5 kg y un RCF de 49.06 %, pero no se observaron diferencias significativas en ninguna variable debidas a la raza o al sexo. Respecto al rendimiento de los cortes, las crías de parto doble tuvieron un mayor rendimiento de la paleta y la pierna, pero el costillar tuvo un mayor rendimiento en corderos de parto simple. Con respecto al genotipo, el cuello tuvo mayor rendimiento en la raza Katahdin y el costillar en la Pelibuey. En ambos casos, resulta difícil explicarlo. Otros autores(37), que compararon corderos de lana vs corderos de pelo, y machos vs hembras, solo obtuvieron diferencias para ambos factores en la paleta. En la composición de la canal y sus cortes las diferencias en el rendimiento cárnico más destacadas para este tipo de producto (canales ultra-livianas) se originaron por el tipo de parto, donde las crías provenientes de parto simple alcanzaron valores más altos de tejido blando en canal y cortes donde el lomo fue el corte con mayor rendimiento cárnico. Al respecto, otros autores(28) valorando el rendimiento cárnico en corderos de canales con similares características encontraron diferencias en los kilos de tejido blando de la canal, pero no en el rendimiento cárnico de la canal propiamente, el cual fue menor al del presente estudio. Con relación a los cortes, sólo encontraron diferencias en el peso del tejido blando de la pierna. Los parámetros físicos de la calidad de la carne están influenciados por el sexo, al respecto, en estudios previos(38) se evaluó la cantidad de músculo y de carne en machos y 8


Rev Mex Cienc Pecu 2022;13(1):1-18

hembras de raza Texel, observando un aumento en la proporción del músculo, siendo mayor que la de grasa para variables ajustadas al mismo peso de la canal en machos. Es preciso mencionar que el presente estudio no diferencia el tipo de tejido (músculo, grasa, nervios, vasos, etc), por lo que el análisis de estos resultados debe ser tomado con cautela cuando se comparan con los de otros autores. Las diferencias atribuidas al tipo de parto podrían estar asociadas con un aumento tanto del músculo como de la grasa. En el caso del sexo, los mayores rendimientos cárnicos de algunos cortes en hembras, podrían estar asociados con un mayor depósito graso; sin embargo, otros autores no encontraron diferencias debidas al sexo sobre la grasa total(37).

Composición de ácidos grasos de la carne Con respecto a los ácidos grasos saturados, estudios previos realizados en cabras(39) encontraron un efecto significativo de la raza en la concentración de los ácidos grasos C17:0 y C18:0, de los cuales este último fue el de mayor proporción, alcanzando valores superiores al 14.5 %. En el caso del ácido palmítico, éste presentó un comportamiento similar al observado en el presente estudio, es decir, su concentración no fue afectada por el genotipo; sin embargo, la concentración oscilo entre 26.32 y 27.32 %, valores que fueron superiores a los reportados para los corderos en el presente trabajo. Respecto al genotipo, estudios previos(36), muestran que la concentración de este ácido graso en cortes de chivatos (12 kg de PV) sí se afectó de manera significativa, observándose valores que oscilaron entre 14.59 y 15.88 %, los cuales fueron menores a los obtenidos en el presente trabajo. Evaluando la composición de ácidos grasos en corderos de pelo y una raza de lana sacrificados a diferentes pesos (10, 16 y 25 kg), encontraron diferencias en varios ácidos grasos saturados, mayormente por efecto del peso al sacrificio, el cual también influyó significativamente sobre el total de ácidos grasos saturados (TS); también encontraron diferencias significativas por efecto del sexo; sin embargo, estas diferencias no se vieron reflejadas en el TS(40). En dicho estudio, la concentración de ácido palmítico fue superior a la del presente estudio, pero la del esteárico fue inferior en machos. Solo el ácido palmítico fue significativamente superior en hembras, por lo que no hubo efecto del genotipo ni el peso. Respecto a la concentración total de ácidos grasos monoinsaturados (TM), se observó una diferencia de casi 5 pp por efecto del tipo de parto sobre el TM, siendo mayor en la carne de corderos provenientes de parto simple. Esta diferencia básicamente se debe a la alta concentración de ácido oleico (C18:1n-9) en la carne de corderos de parto simple (+4.81 pp), la cual anularía la pequeña diferencia del ácido vaccénico en la carne de corderos de parto doble (+0.32 pp). El ácido oleico fue el ácido graso de mayor concentración en la carne (30.86-35.67 %), lo que concuerda con lo observado en estudios previos realizados en cabritos y corderos lactantes(36), así como en corderos lactantes de pelo y lana(40). Al respecto, también se señala que dicho ácido graso disminuiría el contenido de colesterol LDL en 9


Rev Mex Cienc Pecu 2022;13(1):1-18

sangre, además de contribuir (junto con otros ácidos grasos) a la firmeza de la carne y su estabilidad oxidativa, e influir sobre la jugosidad, sabor y color. Ni el genotipo, ni el sexo tuvieron un efecto sobre el TM; sin embargo, la raza Pelibuey presentó una mayor concentración de ácido vaccénico que la Katahdin. Contrariamente a lo observado en el presente trabajo, otros estudios(36), reportaron un efecto importante del genotipo sobre la concentración de grasas monoinsaturadas, registrando valores que oscilaron entre 30.92 a 32.45 %, que son menores a los observados en el presente estudio. Por otra parte, investigaciones previas(41) determinaron que la concentración de grasa monoinsaturada en el músculo Longissimus lumborum no fue afectada por el genotipo de los corderos. Resultados similares fueron obtenidos en otros estudios(42), donde la concentración de grasas monoinsaturadas no fue afectada por los genotipos ovinos estudiados (Churra y Assaf, 39.16 vs 40.67 %, respectivamente). Las mayores diferencias se detectaron en seis ácidos grasos poliinsaturados (AGPIs) debidas al tipo de parto y al genotipo. Sólo el tipo de parto afectó la cantidad de AGPIn-3 más AGPITotales, siendo esta última más elevada que lo registrado por otros autores(42). No se detectaron diferencias en este tipo de ácidos grasos entre machos y hembras. Estudios realizados previamente(40) demostraron que el efecto de la raza, el peso y el sexo influyeron en los AGPITotales. Al respecto señalaron que las razas magras (razas de pelo) tienen relativamente una mayor proporción de AGPITotales que otras razas menos magras, y que a medida que se incrementa el peso de sacrificio disminuye esta proporción. Esto concuerda con los hallazgos del presente estudio con respecto al tipo de parto, ya que este factor determinó una diferencia de peso al sacrificio la cual coincide con lo señalado por dichos autores, quienes indican que a medida que aumenta el peso de sacrificio (mayor en crías de parto simple), disminuye la proporción de AGPITotales. Así, los ácidos grasos poliinsaturados con mayores concentraciones en las crías de parto doble fueron el linoleico (C18:2n-6) y el araquidónico (C20:4n-6), y los de menor concentración fueron DPA (C22:5n-3) y el C20:3n6. Los resultados respecto al efecto del genotipo son menos concluyentes debido a que no hubo una diferencia marcada que afectara la concentración de AGPITotales; sin embargo, la raza Pelibuey tuvo mayores concentraciones de araquidónico y menores concentraciones de DPA y DHA que la raza Katahdin; por otra parte, se ha encontrado que el genotipo no afecta la concentración total de AGPITotales en el M. Longissimus de ovejas(41); contrario a lo reportado por otros autores(42), quienes si encontraron un efecto del genotipo sobre la concentración de AGPITotales en tejido intramuscular de corderos de la raza Churra (30.75 %) y Assaf (28.96 %). La concentración total de AGPIn-6 en los cortes de carne de cordero, no se vio afectada por el genotipo, el sexo o el tipo de parto, la misma tendencia se observó en la concentración de AGPIn-3, excepto que para este tipo de ácidos grasos la concentración total se vio afectada por el tipo de parto, observando una media superior en canales de corderos de parto doble. En contraste con lo encontrado en esta investigación, otros autores(42) al analizar la 10


Rev Mex Cienc Pecu 2022;13(1):1-18

concentración de ácidos omega 6 en la grasa intramuscular de corderos de las razas Churra y Assaf, reportaron un efecto significativo del genotipo sobre este tipo de ácidos grasos de 26.64 vs 24.29 %, respectivamente para cada raza. Cuando se analizó el efecto del genotipo, el sexo y el tipo de parto de la cría, sobre la concentración de AGPIn-6, el araquidónico (20:4n-6) fue afectado por el genotipo, observándose una proporción mayor en corderos de la raza Pelibuey respecto a la Katahdin. Por otro lado, las concentraciones de ácido linóleico (18:2n-6), dihomo-g –linolénico (20:3n6) y araquidónico (20:4n-6) fueron afectadas por el tipo de parto, observándose una proporción superior cuando los corderos fueron de parto doble. En la concentración particular de los ácidos grasos omega 6, de manera similar a lo observado en el presente trabajo, en estudios previos(42) se ha observado un efecto significativo del genotipo sobre los valores de 20:4n-6 en grasa intramuscular de corderos de razas Churra y Assaf (5.57 vs 4.75 %), adicionalmente y contrario a lo determinado en este estudio, se ha observado(43) una mayor concentración (P<0.05) de C18:2n6 en corderos de raza Churra que en Assaf (19.38 vs 17.97 %, respectivamente). Cuando se analizó el efecto del genotipo, sexo y tipo de parto de la cría, sobre la concentración de AGPIn-3, solamente los ácidos grasos C22:5n-3 y C22:6n3 fueron afectados por el genotipo, observando una concentración mayor en los corderos de raza Katahdin. Otros estudios(41,43) demostraron que la biohidrogenación ruminal puede originar bajos niveles en el perfil lipídico y la falta de diferencia en la deposición de grasa intramuscular de animales alimentados con diferentes niveles energéticos.

Conclusiones e implicaciones Las características de la canal y el rendimiento de cortes comerciales en ovinos de pelo sacrificados al destete, presentaron cambios de acuerdo con el genotipo y el tipo de parto, pero no por el sexo. El rendimiento cárnico de la media canal y de cada corte comercial fue definido, principalmente, por el tipo de parto, con mínimos cambios debidos al genotipo o sexo. En general, las crías Pelibuey presentaron mayor rendimiento en canal que las crías Katahdin, aun cuando obtuvieron peso vivo vacío y de canal similares; esto podría estar asociado con un mayor rendimiento de costilla en las crías Pelibuey. De acuerdo con el tipo de parto, las crías nacidas en parto sencillo tuvieron mayor peso al sacrificio y de canal, así como mayor rendimiento de costilla, sin embargo, no se reflejó en un mayor rendimiento de la canal. El tipo de parto fue el principal factor que modificó el perfil de ácidos grasos, produciéndose carne más saludable para el humano en las crías nacidas en parto doble, ya que dicha carne tuvo mayor proporción de ácidos poliinsaturados comparada con la carne de crías de parto simple.

11


Rev Mex Cienc Pecu 2022;13(1):1-18

Literatura citada: 1. González-Garduño R, Salinas-Hernández RM, Garduza-Arias G, Reyes-Montes R. Componentes corporales en ovinos de pelo para abasto en el sureste mexicano. Zootec Trop 2014;32(1):23-32. 2. Aguilar-Hernandez E, Chay-Canul AJ, Gomez-Vazquez A, Magaña-Monforte JG, RíosRincón FG, Cruz-Hernandez A. Relationship of ultrasound measurements and carcass traits in Pelibuey ewes. J Anim Plant Sci 2016;26(2):325-330. 3. Ruiz-Ramos J, Chay-Canul AJ, Ku-Vera JC, Magaña-Monforte JG, Gómez-Vázquez AG, Cruz-Hernandez A, González-Garduño R, Ayala-Burgos AJ. Carcass and non-carcass components of Pelibuey ewe subjected to three levels of metabolizable energy intake. Ecosistemas Rec Agropec 2016;3(7):21-31. 4. Sañudo C. Conferencia calidad de la canal y de la carne en los ovinos: factores que la determinan. Rev Arg Prod Anim 2006;26(2):155-167. 5. García-Osorio IC, Oliva-Hernández J, Hinojosa-Cuéllar JF. Composición tisular de la canal de corderos lactantes Blackbelly x Pelibuey. Ecosistemas Rec Agropec 2016;3(8):203-213. 6. Wood JD, Richardson RI, Nute GR, Fisher AV, Campo MM, Kasapidou E, Sheard PR, Enser M. Effect of fatty acids on meat quality: a review. Meat Sci 2004;66(1):21-32. 7. Juárez D, Horcada I, Alcalde A, Valera C, Mullen M, Molina A. Estimation of factors influencing fatty acid profiles in light lambs. Meat Sci 2007;79(2):203-210. 8. Hopkins DL, Stanley DF, Martin LC, Toohey ES, Gilmour AR. Genotype and age effects on sheep meat production 3. Meat quality. Aust J Exp Agric 2007;47(10):1155-1164. 9. Partida JA, Braña D, Martínez L. Desempeño productivo y propiedades de la canal de ovinos Pelibuey y sus cruzas con Suffolk o Dorset. Téc Pecu Méx 2009;47(3):313-322. 10. Macías-Cruz U, Álvarez-Valenzuela FD, Rodríguez-García J, Correa-Calderón A, Torrentera-Olivera NGG, Molina-Ramírez L, Avendaño-Reyes L. Crecimiento y características de canal en corderos Pelibuey puros y cruzados F1 con razas Dorper y Katahdin en confinamiento. Arch Med Vet 2010;42(3):147-154. 11. Guerrero A, Valero MV, Campo MM, Sañudo C. Some factors that affect ruminant meat quality: from the farm to the fork. Review. Acta Sci Anim Sci 2010; 35(4):335–347. https://doi.org/10.4025/actascianimsci.v35i4.21756.

12


Rev Mex Cienc Pecu 2022;13(1):1-18

12. Macías-Cruz U, Álvarez-Valenzuela FD, Olguín-Arredondo HD, Molina-Ramírez L, González-Reyna A, Avendaño-Reyes L. Pelibuey ewe productivity and subsequent preweaning performance using hair-sheep breeds under a confinement system. J Appl Anim 2009;36(2):255-260. 13. Magaña-Monforte JG, Huchin-Cab M, Ake-López RJ, Segura-Correa JC. A field study of reproductive performance and productivity of Pelibuey ewes in Southeastern Mexico. Trop Anim Health and Prod 2013;45(8):1771-1776. 14. Sánchez-Dávila F, Bernal-Barragán H, Padilla-Rivas G, del Bosque-González AS, Vázquez-Armijo JF, Ledezma-Torres RA. Environmental factors and ram influence litter size, birth, and weaning weight in Saint Croix hair sheep under semi-arid conditions in Mexico. Trop Anim Health Prod 2015;47(5):825-831 doi: 101007/s11250015-0795-6. 15. Nasrat MM, Segura-Correa JC, Magaña-Monforte JG. Breed genotype effect on ewe traits during the pre-weaning period in hair sheep under the tropical Mexican conditions. Small Ruminant Res 2016;137(1):157-161. 16. Chay-Canul AJ, Aguilar-Urquizo E, Parra-Bracamonte GM, Piñeiro-Vazquez AT, Sanginés-García JR, Magaña-Monforte JG, et al. Ewe and lamb pre-weaning performance of Pelibuey and Katahdin hair sheep breeds under humid tropical conditions. Ital J Anim Sci 2019;18(1):850-857. 17. García-Osorio IC, Oliva-Hernández J, Osorio-Arce MM, Torres-Hernández G, HinojosaCuéllar JF, González-Garduño R. Influencia del tipo y número de parto de la oveja sobre la eficiencia de crecimiento y características de la canal de corderos Blackbelly x Pelibuey. Ecosistemas Rec Agropec 2017;4(10):51-63. 18. Chay-Canul AJ, Magaña-Monforte JG, Chizzotti ML, Piñeiro-Vázquez ÁT, Canul-Solís JR, Ayala-Burgos AJ, Ku-Vera JC, et al. Requerimientos energéticos de ovinos de pelo en las regiones tropicales de Latinoamérica. Revisión. Rev Mex Cienc Pecu 2016;7(1):105-125. 19. Hernández-Marín JA, Valencia-Posadas M, Ruíz-Nieto JE, Mireles-Arriaga AI, CortezRomero C, Gallegos-Sánchez J. Contribución de la ovinocultura al sector pecuario en México. Agroproductividad 2017;10(3):87-93. 20. García, E. Modificaciones al sistema de clasificación climática de Köppen (Para adaptarlo a las condiciones de la República Mexicana). Segunda edición. Instituto de Geografía de la Universidad Nacional Autónoma de México. México, D.F. 1973. 21. Russel AJF, Doney JM, Gunn RG. Subjective assessment of body fat in live sheep. J Agric Sci 1969;72(3):451-454. 13


Rev Mex Cienc Pecu 2022;13(1):1-18

22. Martínez A, Bores R, Castellanos A. Zoometria y prediccíon de la composición corporal de la borrega Pelibuey. Téc Pecu Méx 1987;25(1):72-84. 23. Cantón JGC, Velázquez AM, Castellanos RA. Body composition of pure and crossbed Blackbelly sheep. Small Ruminant Res 1992;7(1):61-66. 24. Kramer JKG, Cruz-Hernández C, Deng Z, Zhou J, Jahreis G, Dugan ME. Analysis of conjugated linoleic acid and trans 18:1 isomers in synthetic and animal products. Am J Clin Nutr 2004;79(Supl 6):1137-1145. 25. Velasco S, Cañeque V, Pérez C, Lauzurica S, Díaz MT, Huidobro F. Fatty acid composition of adipose depots of suckling lambs raised under different production systems. Meat Sci 2001;59(3):325-333. 26. Moo-Huchin V, Estrada-Mota I, Estrada-León R, Cuevas-Glory L, Sauri-Duch E. Chemical composition of crude oil from the seeds of pumpkin (Cucurbita spp.) and mamey sapota (Pouteria sapota Jacq.) grown in Yucatan, Mexico. CyTA-Journal of Food 2013;11(4):324-327. 27. SAS, Statistical Analysis System. SAS V. 93 SAS Institute Inc, 2010. Cary, NC, USA. 28. Hinojosa-Cuéllar J, Oliva-Hernández J, Torres-Hernandez G, Segura-Correa JC, ArandaIbáñez E, González-Camacho J. Factores que afectan el crecimiento predestete de corderos Pelibuey en el trópico húmedo de México. Universidad y Ciencia 2012;28(2):163-171. 29. Oliva-Hernández J, Garcia-Osorio IC, Hinojosa-Cuéllar J. Crecimiento predestete de corderos de pelo en el trópico húmedo de México. In Berumen AC, et al, editores. Avances de la investigación sobre producción de ovinos de pelo en México 2017:45-57. https://www.researchgate.net/publication/321307604_Avances_de_la_investigacion_s obre_produccion_de_ovinos_de_pelo_en_Mexico. 30. Macedo R, Arredondo V. Efecto del sexo y del tipo de nacimiento y lactancia sobre el crecimiento de ovinos Pelibuey en manejo intensivo. Arch Zootec 2008;57(218):219228. 31. Ríos-Utrera A, Calderón-Robles R, Lagunes-Lagunes J, Oliva-Hernández J. Ganancia de peso predestete en corderos Pelibuey y sus cruces con Blackbelly, Dorper y Katahdin. Nova Scientia 2014;6(2):272-286. 32. Bell AW, Bauman DE, Currie WB. Regulation of nutrient partitioning and metabolism during pre and postnatal growth. J Anim Sci 1987;65(Supl 2):186-212.

14


Rev Mex Cienc Pecu 2022;13(1):1-18

33. Barros NN, Vasconcelos VR, Wanderi AE, Araújo MRA. Eficiência bioeconômica de cordeiros F1 Dorper x Santa Inês para produção de carne. Pesqui Agropecu Bras 2005; 40(8):825-831. 34. Silva FLR, Araújo AM. Características de reprodução e de crescimento de ovinos mestiços Santa Inês, no Ceará. Rev Bras Zootec 2010;29:1712-1720. 35. Carneiro RM, Pires CC, Müller L, Kippert CJ, Costa ML, Colomé LM, Osmari EK. Ganho de peso e eficiência alimentar de cordeiros de parto simples e duplo desmamados aos 63 dias e não desmamados. Rev Bras Agrocienc 2004 10:227-230. 36. Horcada A, Campo MM, Polvillo O, Alcalde MJ, Cilla I, Sañudo C. A comparative study of fatty acid profiles of fat in commercial Spanish suckling kids and lambs. Span J Agric Res 2014;12(2):427-435 doi.org/10.5424/sjar/2014122-4566. 37. Camacho Á, Capote J, Mata J, Argüello A, Viera JJ, Bermejo LA. Effect of breed (wool and hair) and sex on the carcass quality of suckling lambs under intensive management. Rev Bras Zootec (2013);42(12):892-898. 38 Johnson PL, McEwan JC, Dodds KG, Purchas RW, Blair HT. Meat quality traits were unaffected by a quantitative trait locus affecting leg composition traits in Texel sheep. J Anim Sci 2005;83(12):2729-2747. 39. Esteves GIF, Peripolli V, Costa Jr JBG, Tanure BC, Menezes MA, Souza RJ, et al. Effects of genetic group, pregnancy and age on carcass traits, meat quality 25 and fatty acid profile in female sheep. Rev Colom Cienc Pecu 2019;32(1):21-33. 40. Camacho A, Torres A, Capote J, Mata J, Viera J, Bermejo LA, Argüello A. Meat quality of lambs (hair and wool) slaughtered at different live weights. J Appl Anim Res 2017;45(1):400-408. 41. Coutinho MAS, Morais MG, Coelho RG, Alves FV, Fernandes HJ, Ítavo CCBF, Comparin MAS, Ribeiro CB. Lipid profile and cholesterol in meat cuts of ewe lambs fed different levels of concentrate. Semina: Ciénc Agrár 2014;35(6):3355-3366. 42. Mateo J, Caro I, Carballo DE, Gutiérrez-Méndez N, Arranz JJ, Gutiérrez-Gil B. Carcass and meat quality characteristics of Churra and Assaf suckling lambs. Animal 2017;12(5):1093-1101. 43. Sañudo C, Arribas MMC, Silva-Sobrinho AG. Qualidade da carcaça e da carne ovina e seus fatores determinantes. In: Silva Sobrinho, AG, et al. Produção de carne ovina. Jaboticabal: Funep, 2008;171-228.

15


Rev Mex Cienc Pecu 2022;13(1):1-18

Cuadro 1: Peso al sacrificio, características de la canal y rendimiento de cortes primarios (medias ± EE) debidos a los efectos del genotipo, tipo de parto y sexo en corderos lactantes de 56 días de edad Caracterís ticas Pelibuey PVS, kg 10.73 ± 0.35 PVV, kg 9.63 ± 0.32 PCC, kg 5.43 ± 0.19 PCF, kg 5.17 ± 0.18 RCC, % 50.58 ± 0.52 RCF, % 48.03 ± 0.78 RV, % 56.38 ± 0.49 Cortes comerciales (%) Cuello 7.01 ± 0.22 Paleta 18.97 ± 0.27 Costillar 24.90 ± 0.40 Lomo 12.98 ± 0.32 Pierna 35.90 ± 0.38

Raza Katahdin 11.11 ± 0.42 9.91 ± 0.38 5.22 ± 0.22 4.96 ± 0.21 46.76 ± 0.61 44.62 ± 0.93 52.38 ± 0.58 8.84 ± 0.27 19.34 ± 0.33 22.46 ± 0.48 12.69 ± 0.38 36.98 ± 0.45

P 0.49 0.57 0.46 0.44 <0.01 <0.01 <0.01

Tipo de parto Simple Doble 12.39 ± 0.40 9.45 ± 0.37 11.15 ± 0.36 8.40 ± 0.33 6.12 ± 0.21 4.53 ± 0.20 5.85 ± 0.20 4.27 ± 0.19 49.37 ± 0.59 47.96 ± 0.54 47.20 ± 0.89 45.44 ± 0.83 54.88 ± 0.56 53.87 ± 0.52

P <0.01 <0.01 <0.01 <0.01 0.08 0.15 0.19

<0.01 0.40 <0.01 0.57 0.08

7.80 ± 0.25 18.48 ± 0.31 24.80 ± 0.46 13.25 ± 0.37 35.65 ± 0.43

0.47 <0.01 <0.01 0.11 0.01

8.06 ± 0.23 19.83 ± 0.29 22.57 ± 0.42 12.43 ± 0.34 37.22 ± 0.40

Machos 11.02 ± 0.37 9.82 ± 0.33 5.29 ± 0.19 5.10 ± 0.19 48.17 ± 0.54 46.52 ± 0.81 53.97 ± 0.51

Sexo Hembras 10.82 ± 0.41 9.72 ± 0.36 5.36 ± 0.21 5.03 ± 0.21 49.16 ± 0.60 46.12 ± 0.90 54.79 ± 0.56

P 0.73 0.83 0.83 0.79 0.22 0.74 0.29

8.09 ± 0.23 19.45 ± 0.29 23.51 ± 0.42 12.39 ± 0.33 36.47 ± 0.39

7.77 ± 0.26 18.87 ± 0.32 23.86 ± 0.46 13.29 ± 0.37 36.41 ± 0.44

0.37 0.19 0.58 0.08 0.91

PVS= peso vivo al sacrificio, PVV= peso vivo vacío, PCC= peso de canal caliente, PCF= peso de canal fría, RCC= rendimiento en canal caliente, RCF= rendimiento en canal fría, RV= rendimiento verdadero.

116


Rev Mex Cienc Pecu 2022;13(1):1-18

Cuadro 2: Rendimiento cárnico de la canal y los cortes primarios (medias ± EE) debidos a los efectos de genotipo, tipo de parto y sexo en corderos lactantes de 56 días de edad Raza Tipo de parto Sexo Variable (%) Pelibuey Katahdin P Simple Doble P Machos Hembras P Media canal Tejidos blandos Hueso Cuello Tejidos blandos Hueso Paleta Tejidos blandos Hueso Costillar Tejidos blandos Hueso Lomo Tejidos blandos Hueso Pierna Tejidos blandos Hueso

69.99 ± 0.65 69.99 ± 0.78 0.99 29.75 ± 0.55 29.65 ± 0.65 0.91

72.51 ± 0.75 67.97 ± 0.69 <0.01 27.81 ± 0.62 32.00 ± 0.57 <0.01

69.19 ± 0.68 70.79 ± 0.75 0.12 30.20 ± 0.57 29.20 ± 0.63 0.24

62.90 ± 1.50 66.40 ± 1.79 0.14 36.07 ± 5.89 43.21 ± 7.02 0.44

65.37 ± 1.71 63.33 ± 1.58 0.26 34.65 ± 6.73 36.62 ± 6.22 0.38

65.77 ± 1.56 63.52 ± 1.73 0.34 34.35 ± 6.13 35.93 ± 6.80 0.37

69.46 ± 1.34 67.82 ± 1.60 0.11 30.53 ± 0.62 32.26 ± 0.74 0.74

69.77 ± 1.53 69.30 ± 1.42 0.82 30.14 ± 0.71 30.65 ± 0.66 0.07

67.54 ± 1.40 71.43 ± 1.55 0.06 32.59 ± 0.65 28.60 ± 0.72 0.11

64.85 ± 0.94 65.82 ± 1.12 0.55 34.88 ± 0.94 33.88 ± 1.12 0.50

68.44 ± 1.07 62.33 ± 0.99 <0.01 31.56 ± 1.07 37.68 ± 0.99 <0.01

63.70 ± 0.98 66.90 ± 1.08 0.04 36.83 ± 0.97 32.94 ± 1.08 0.04

75.98 ± 1.20 77.90 ± 1.43 0.31 23.87 ± 1.27 21.69 ± 1.52 0.28

80.56 ± 1.37 73.30 ± 1.27 <0.01 19.45 ± 1.45 26.71 ± 1.34 <0.01

76.06 ± 1.25 77.62 ± 1.39 0.35 24.02 ± 1.33 22.54 ± 1.47 0.22

71.68 ± 0.87 71.16 ± 1.04 0.70 27.75 ± 1.04 28.27 ± 1.24 0.75

73.92 ± 1.00 68.93 ± 0.92 <0.01 25.97 ± 1.19 30.95 ± 1.10 <0.01

72.26 ± 0.91 70.99 ± 1.01 0.22 27.74 ± 1.09 28.98 ± 1.21 0.48

17 1


Rev Mex Cienc Pecu 2022;13(1):1-18

Cuadro 3: Perfil de ácidos grasos de la carne de corderos de pelo (medias ± EE) debido a los efectos del genotipo, tipo de parto y sexo en corderos lactantes de 56 días de edad Genotipo (G) Tipo Sexo (S) Ácido graso Pelibuey Katahdin P Simple Doble P Machos Hembras P 10:00 12:00 14:00 15:00 16:00 18:00 20:00 16:1n-9 16:1n-7 18:1n-9 18:1n-7 18:2n-6 20:2n-6 20:3n-6 20:4n-6 16:4n-3 22:5n-3 22:6n-3 TS TM AGPIn-6 AGPIn-3 AGPITotales

0.07 ± 0.02 0.42 ± 0.09 3.13 ± 0.66 0.383 ± 0.03 21.15 ± 1.0 14.03 ± 1.08 0.26 ± 0.06 0.40 ± 0.07 1.05 ± 0.19 33.90 ± 1.03 2.14 ± 0.09 10.24 ± 0.81 1.44 ± 0.18 0.52 ± 0.05 7.79 ± 0.54 2.06 ± 0.18 0.79 ± 0.10 0.19 ± 0.04 39.46 ± 1.61 37.50 ± 1.10 20.00 ± 1.46 3.04 ± 0.29 23.04 ± 1.73

0.09 ± 0.01 0.50 ± 0.09 3.79 ± 0.63 0.37 ± 0.03 22.09 ± 0.95 16.65 ± 1.02 0.27± 0.06 0.33 ± 0.06 1.01 ± 0.18 32.63 ± 0.97 1.64 ± 0.09 9.20 ± 0.76 1.57 ± 0.17 0.56 ± 0.04 5.74 ± 0.51 2.09 ± 0.17 1.10 ± 0.09 0.32 ± 0.03 43.78 ± 1.52 35.62 ± 1.04 17.08 ± 1.38 3.52 ± 0.27 20.60 ± 1.64

0.39 0.58 0.47 0.84 0.51 0.11 0.94 0.48 0.88 0.38 <0.01 0.36 0.62 0.52 0.02 0.91 0.04 0.02 0.07 0.23 0.17 0.25 0.32

0.09 ± 0.02 0.39 ± 0.10 3.40 ± 0.69 0.37 ± 0.04 23.11 ± 1.05 14.60 ± 1.13 0.19 ± 0.06 0.39 ± 0.07 1.23 ± 0.20 35.67 ± 1.07 1.73 ± 0.10 8.55 ± 0.84 1.30 ± 0.19 0.47 ± 0.05 5.71 ± 0.57 1.82 ± 0.19 0.75 ± 0.10 0.22 ± 0.04 42.14 ± 1.68 39.02 ± 1.15 16.03 ± 1.52 2.79±0.30 18.83±1.81

0.07 ± 0.01 0.54 ± 0.09 3.52 ± 0.59 0.39 ± 0.03 20.14 ± 0.90 16.08 ± 0.97 0.35 ± 0.05 0.34 ± 0.06 0.83 ± 0.17 30.86 ± 0.92 2.05 ± 0.08 10.90 ± 0.72 1.71 ± 0.16 0.62 ± 0.04 7.82 ± 0.49 2.34 ± 0.16 1.14 ± 0.09 0.28 ± 0.03 41.10 ± 1.44 34.09 ± 0.98 21.04 ± 1.30 3.77 ± 0.26 24.81 ± 1.55

0.49 0.27 0.90 0.65 0.05 0.34 0.08 0.62 0.16 <0.01 0.03 0.05 0.13 0.03 0.01 0.05 0.01 0.26 0.64 <0.01 0.17 0.03 0.02

0.09 ± 0.02 0.51 ± 0.09 3.58 ± 0.66 0.38 ± 0.03 20.74 ± 1.0 16.87 ± 1.10 0.22 ± 0.06 0.41 ± 0.07 1.03 ± 0.19 32.57 ± 1.03 1.84 ± 0.09 9.41 ± 0.81 1.66 ± 0.18 0.53 ± 0.05 6.63 ± 0.54 2.32 ± 0.18 0.95 ± 0.10 0.25 ± 0.04 42.39 ± 1.61 35.85 ± 1.10 18.23 ± 1.46 3.53 ± 0.29 21.75 ± 1.73

0.07 ± 0.02 0.42 ± 0.09 3.34 ± 0.62 0.37 ± 0.03 22.50 ± 0.95 13.82 ± 1.02 0.32 ± 0.06 0.33 ± 0.06 1.03 ± 0.18 33.96 ± 0.97 1.94 ± 0.09 10.04 ± 0.76 1.35 ± 0.17 0.55 ± 0.04 6.90 ± 0.51 1.83 ± 0.17 0.94 ± 0.09 0.25 ± 0.03 40.85 ± 1.52 37.26 ± 1.04 18.85 ± 1.38 3.04 ± 0.27 21.89 ± 1.64

0.46 0.51 0.80 0.84 0.22 0.06 0.23 0.38 0.97 0.34 0.46 0.58 0.25 0.78 0.72 0.07 0.98 0.98 0.50 0.37 0.76 0.24 0.96

Los ácidos grasos se presentan como porcentaje (%) del total de ácidos grasos. Solo los ácidos grasos que se encuentran en niveles superiores a 0.05% se presentan. TS= total de saturados; TM= total monoinsaturados; AGPIn-6= ácidos grasos poliinsaturados n-6; AGPIn-3= ácidos grasos poliinsaturados n-3; AGPITotales= ácidos grasos poliinsaturados totales.

218


https://doi.org/10.22319/rmcp.v13i1.5849 Artículo

Rendimiento de corderos alimentados con ensilaje como alimento total a base de nopal

Juscelino Kubitschek Bevenuto da Silva a Gherman Garcia Leal de Araújo b Edson Mauro Santos a Juliana Silva de Oliveira a Fleming Sena Campos b Glayciane Costa Gois c* Tiago Santos Silva d Alex Gomes da Silva Matias c Ossival Lolato Ribeiro e Alexandre Fernandes Perazzo f Anderson de Moura Zanine f

a

Universidade Federal da Paraiba (UFPB), Centro de Ciências Agrárias, Paraiba, Brazil.

b

Empresa Brasileira de Pesquisa Agropecuária (Embrapa Semiárido), Rodovia BR-428, Km 152, s/n – Zona Rural, 56302-970, Pernambuco, Brazil. c

Universidade Federal do Vale do São Francisco (UNIVASF), Campus de Ciências Agrárias, Pernambuco, Brazil. d

Instituto Federal de Educação, Ciência e Tecnologia do Sertão Pernambucano (IF Sertão), Pernambuco, Brazil. e

Universidade Federal do Recôncavo Bahiano (UFRB), Ciências Agrárias, Ambientais e Biológicas, Bahia, Brazil. f

Universidade Federal do Maranhão (UFMA), Centro de Ciências Agrárias e Ambientais, Maranhão, Brazil.

19


Rev Mex Cienc Pecu 2022;13(1):19-31

*Autor de correspondencia: glayciane_gois@yahoo.com.br

Resumen: Este estudio tuvo como objetivo evaluar la ingesta, digestibilidad aparente, balance hídrico, balance de nitrógeno y rendimiento productivo en corderos alimentados con ensilaje de nopal asociado con forrajes tropicales. En el experimento se utilizaron 40 corderos machos cruzados intactos, con un peso corporal inicial de 18.85 ± 1.2 kg. El diseño experimental fue completamente al azar, con 5 tratamientos y 8 repeticiones. Los tratamientos consistieron en dietas con diferentes proporciones de pasto buffel y salvado de trigo como fuentes de fibra detergente neutro (FDN), en ensilaje de alimento total (EAT) a base de nopal: EAT1 - 279 g/kg de pasto buffel; EAT2 - 240 g/kg de pasto buffel y 17 g/kg de salvado de trigo; EAT3 - 198 g/kg de pasto buffel y 34 g/kg de salvado de trigo; EAT4 - 108 g/kg de pasto buffel y 74 g/kg de salvado de trigo; EAT5 – 118 g/kg de salvado de trigo. La ingesta más baja de FDN se encontró en corderos que consumieron EAT5 (402 g/día). La digestibilidad aparente de los carbohidratos no fibrosos fue mayor para EAT5, mientras que la digestibilidad aparente de FDN de EAT5 y EAT4 fue mayor que la de EAT1. Las dietas promovieron una ganancia diaria de peso promedio de 180.8 g/día. En condiciones experimentales, el uso de nopal forrajero y concentrado en forma de raciones mixtas totales de ensilaje conduce a una mayor ingesta de proteína cruda, carbohidratos no fibrosos, extracto etéreo y mayor digestibilidad de carbohidratos no fibrosos y fibra detergente neutro, sin embargo, todas las dietas fueron viables en la alimentación de ovinos confinados, proporcionando ganancias de hasta 198 g/d según la formulación de la dieta. Palabras clave: Ingesta, Conservación de alimentos, Balance hídrico, Ganancia de peso.

Recibido: 13/11/2020 Aceptado: 13/04/2021

Introducción El nopal (Opuntia fícus-indica Mill.) es un cultivo con gran potencial para las regiones áridas y semiáridas, ya que es un cultivo que tiene una característica fisiológica especial en cuanto a la absorción, uso y pérdida de agua, estando bien adaptado al suelo y a las condiciones climáticas del semiárido, soportando largos periodos de sequía, el nopal se caracteriza por ser el principal alimento suministrado a los rebaños, independientemente de la época del año(1).

20


Rev Mex Cienc Pecu 2022;13(1):19-31

El nopal es una especie forrajera con un alto potencial de producción de materia seca (10-20 t/ha) al año en condiciones secas. Tiene una excelente palatabilidad, alto valor energético (66 -74 % de nutrientes digeribles totales), alta digestibilidad (69-78 %), y es rico en agua (80 % de materia natural)(2), lo que contribuye al suministro de agua de calidad para el animal. El uso de ensilajes de nopal en dietas de pequeños rumiantes ya está siendo estudiado en Túnez, México, Zimbabue y Brasil(3). Miranda-Romero et al(4) observaron que el cordero finalizado alimentado con ensilaje de nopal tuvo una mayor ingesta de materia seca (1.1 kg/d en comparación con cordero alimentado con ensilaje de maíz (0.7 kg/día). Moura et al(5), al evaluar la inclusión del nopal en la dieta de los corderos, observaron que el aumento del nopal en la composición de las dietas promovió una mayor ganancia diaria en relación con la dieta control (sin nopal). Silva et al(6), al evaluar la ingesta de agua de corderos alimentados con dietas a base de ensilajes de nopal, encontraron que los corderos que ingirieron ensilaje de nopal tuvieron una mayor ingesta de materia seca (1,480 kg/día) y una mayor ingesta de agua vía alimento (2,724 kg/día) en relación con los animales que recibieron ensilaje de maíz. Sin embargo, el uso de nopal en la dieta de pequeños rumiantes debe asociarse con la complementación de otros ricos en fibra y mediante la adición de una fuente de proteínas, manteniendo condiciones normales en el rumen y permitiendo una sincronización adecuada entre el suministro de energía y nitrógeno para los microorganismos ruminales, considerando el alto contenido de carbohidratos solubles en el nopal(7). El pasto buffel (Cenchrus ciliares) podría ser utilizado como fuente de fibra para dietas basadas en forraje (368 g/kg de FDN), ya que es un pasto también adaptado a regiones áridas y semiáridas(8). Otra opción para integrar dietas a base de nopal para la producción de ensilaje de alimento total es el uso de coproductos con una alta cantidad de fibra detergente neutro, como es el caso del salvado de trigo, que tiene valores promedio de 394 g/kg de FDN(9). En situaciones en las que el suministro de forraje es limitado, debido al déficit hídrico común en las regiones áridas y semiáridas, el uso de este coproducto podría permitir económicamente confinar a los corderos alimentados con alimento de nopal debido a su bajo costo. Por lo tanto, se puede utilizar como fuente de fibra en la sustitución de pastos forrajeros. Hasta donde se sabe, los estudios sobre la asociación del ensilaje de nopal con salvado de trigo y heno de pasto buffel en la dieta de corderos confinados son escasos y deberían explorarse mejor. Por lo tanto, el presente estudio tuvo como objetivo evaluar la ingesta, digestibilidad aparente, balance hídrico, balance de nitrógeno y rendimiento productivo en corderos alimentados con ensilaje de nopal asociado con forrajes tropicales.

21


Rev Mex Cienc Pecu 2022;13(1):19-31

Material y métodos Descripción del lugar de estudio El experimento se llevó a cabo en el Campo Experimental de Caatinga, en la Unidad de Metabolismo Animal, perteneciente a la Corporación Brasileña de Investigación Agrícola, Embrapa Semiárido, ubicado en el municipio de Petrolina - PE, Brasil. La precipitación media anual es de 433 mm, la humedad relativa de 36.73 %, y las temperaturas medias anuales, máximas y mínimas, rondan los 32 a 26.95 ºC. Esta investigación fue evaluada y aprobada por el Comité de Ética en el Uso de Animales (CEUA) de Embrapa Semiárido, con número de protocolo 0004/2016.

Animales, tratamientos y dietas experimentales

En el experimento se utilizaron 40 corderos machos cruzados intactos, con un peso corporal inicial de 18.85 ± 1.2 kg. Los animales fueron previamente identificados, pesados, tratados contra endoparásitos y ectoparásitos y distribuidos en corrales individuales (1.00 × 1.20 m), equipados con comederos y bebederos para las dietas y el suministro de agua, donde permanecieron durante 66 días, precedido de 10 días para la adaptación. El diseño experimental fue completamente al azar, con cinco tratamientos y ocho repeticiones. Las dietas se formularon en forma de ensilaje de alimento total, compuesto de nopal (Opuntia fícus-indica Mill.) variedad Redonda, pasto buffel (Cenchrus ciliares), salvado de trigo, harina de soya, maíz molido y urea (Cuadro 1). Los tratamientos consistieron en dietas con diferentes proporciones de pasto buffel y salvado de trigo como fuentes de fibra detergente neutro (FDN), en ensilaje de alimento total (EAT) a base de nopal: EAT1 - 279 g/kg de pasto buffel; EAT2 - 240 g/kg de pasto buffel y 17 g/kg de salvado de trigo; EAT3 - 198 g/kg de pasto buffel y 34 g/kg de salvado de trigo; EAT4 - 108 g/kg de pasto buffel y 74 g/kg de salvado de trigo; EAT5 – 118 g/kg de salvado de trigo en base de materia seca (MS). Las dietas se balancearon para permitir una ganancia diaria de peso promedio de 200 g/día, de acuerdo con las recomendaciones del NRC(10) (Cuadro 2).

22


Rev Mex Cienc Pecu 2022;13(1):19-31

Cuadro 1: Composición química de los ingredientes utilizados en las dietas experimentales Ingredientes Fracción Nopal Pasto Salvado Harina Maíz Urea (g/kg MS) buffel de trigo de soya molido Materia seca* 144 623 886 896 892 980 Materia mineral 112 101 52.3 66.5 19.2 1.7 Proteína cruda 51.2 60.2 169 472 90.3 2822 Extracto etéreo 19.0 17.4 32.1 21.1 51.2 0 a Fibra detergente neutro 269 683 433 133 133 0 Fibra detergente ácido 193 479 153 92.3 44.5 0 Lignina 63.7 201 60.8 12.8 11.1 0 Celulosa 337 327 111 80.9 37.6 0 Hemicelulosa 192 123 339 55.5 97.8 0 Carbohidratos totales 837 834 717 442 845 0 Carbohidratos no fibrosos 552 86.9 302 282 715 0 MS= Materia seca; *en g/kg Materia natural; a= corregido para cenizas y proteínas.

Cuadro 2: Composición química de las dietas experimentales Dietas experimentales Ingredientes (g/kg) EAT1 EAT2 EAT3 EAT4 EAT5 Nopal 553 571 590 633 681 Pasto buffel 279 240 198 108 0 Salvado de trigo 0 17 34 74 118 Harina de soya 48 50 51 51 53 Maíz molido 116 119 124 132 147 Urea 4 3 3 2 1 Composición química (g/kg MS): Materia seca* 383 399 411 431 449 Materia mineral 70.5 88.1 82.8 79.4 71.1 Proteína cruda 134 136 142 141 139 Extracto etéreo 11.6 18.6 20.4 22.7 25.7 FDNap 511 435 433 439 338 Fibra detergente ácido 392 268 255 215 141 Lignina 63.9 43.1 40.7 40.2 29.3 Celulosa 328 225 214 175 111 Hemicelulosa 136 215 209 232 280 Carbohidratos totales 784 757 755 757 764 Carbohidratos no fibrosos 318 356 356 340 438 Energía metabolizable, Kcal/día 23.1 24.1 24.5 24.3 25.5 EAT1= 279 g/kg de pasto buffel; EAT2= 240 g/kg de pasto buffel y 17 g/kg de salvado de trigo; EAT3= 198 g/kg de pasto buffel y 34 g/kg de salvado de trigo; EAT4= 108 g/kg de pasto buffel y 74 g/kg de salvado de trigo; EAT5= 118 g/kg de salvado de trigo; MN= Materia natural; MS= Materia seca; FDNap= Fibra detergente neutro corregida para cenizas y proteínas *en g/kg materia natural.

23


Rev Mex Cienc Pecu 2022;13(1):19-31

El pasto buffel utilizado provino de un pasto establecido, cosechado a 65 días de edad, con 75 cm de altura, cortado a una altura de 15 cm sobre el nivel del suelo. La cosecha se realizó manualmente. El nopal cosechado a los 12 meses de edad después del corte de uniformidad. Los materiales fueron procesados en una picadora de forraje estacionaria (PP-35, Pinheiro máquinas, Itapira, São Paulo, Brasil) a un tamaño de partícula promedio de aproximadamente 2.0 cm. Los materiales fueron homogeneizados, según los tratamientos, y fueron ensilados en silos de tambor de plástico de 200 L (89 x 59 x 59 cm) con tapa removible sellada con un anillo metálico. Las dietas se suministraron dos veces al día a las 0830 h y 1530 h y el agua se proporcionó ad libitum. Las sobras se recogieron y pesaron para determinar la ingesta y ajustar la ingesta de materia seca con el fin de permitir un 10 % de sobras del total ofrecido. Se recogieron muestras de los alimentos suministrados y las sobras semanalmente para su posterior análisis de laboratorio.

Ingesta y digestibilidad de nutrientes La ingesta de materia seca (IMS) se obtuvo por la diferencia entre la MS total de la dieta consumida y la MS total presente en las sobras de cada animal. La ingesta de nutrientes se determinó como la diferencia entre el total de nutrientes presentes en la dieta consumida y el total de nutrientes presentes en las sobras, en base de MS total. La prueba de digestibilidad se realizó en el tercio final del periodo de rendimiento productivo, con una duración de 5 días de colecta precedida de 5 días de adaptación. Los animales se distribuyeron en jaulas de metabolismo provistas de comederos y bebederos. Las heces se muestrearon utilizando bolsas de recolección fijadas a los animales, que se adhirieron a los animales antes del periodo de muestreo. Las bolsas se pesaron y vaciaron dos veces al día (0800 h y 1500 h) y se recolectó una submuestra del 10 % de la cantidad total para su posterior análisis, que se almacenó a -20 °C.

Balance de nitrógeno La orina se recolectó y pesó una vez al día en baldes de plástico que contenían 100 ml de ácido sulfúrico (H2SO4) al 20 % para evitar la volatilización del nitrógeno y se muestreó (10 % del total excretado) para determinar el contenido de nitrógeno. El balance de nitrógeno (BN) fue calculado de acuerdo con Silva y Leão(11).

Balance hídrico La ingesta de agua se evaluó diariamente. El agua se pesó antes de ser suministrada en baldes y se pesó de nuevo 24 h más tarde. Se distribuyeron tres baldes que contenían agua en el cobertizo cerca de las jaulas de los animales para determinar la evaporación diaria. El balance hídrico fue evaluado según Church(12). La producción de agua

24


Rev Mex Cienc Pecu 2022;13(1):19-31

metabólica se estimó a partir del análisis químico de las dietas y se calculó multiplicando el consumo de carbohidratos, proteínas y extracto etéreo digerible por los factores 0.60, 0.42 y 1.10, respectivamente(12).

Desempeño del crecimiento Los corderos se pesaron al principio, cada 15 días, y al final del periodo experimental, después de un periodo de privación de alimento sólido de 12 h (con acceso a agua) para obtener el peso inicial (PI), peso final (PF), ganancia total de peso (GTP; GTP= peso final - peso inicial) y ganancia diaria de peso (GDP; GDP= GTP/días en confinamiento). Al final del periodo experimental, se calculó la conversión alimenticia (CA) mediante la siguiente ecuación: CA = IMS promedio / GDP promedio.

Análisis de laboratorio Las muestras de dietas, sobras y heces se secaron previamente en un horno de ventilación forzada a 55 °C durante 72 h y se molieron a partículas de 1 mm (Wiley Mill, Marconi, MA-580, Piracicaba, Brasil). Todos los análisis químicos se realizaron utilizando los procedimientos descritos por el método de la AOAC(13) para materia seca (MS, método 967.03), materia mineral (MM, método 942.05), proteína cruda (PCr, método 981.10), extracto etéreo (EE; método 920.29) y fibra detergente ácido (FDA; método 973.18). El contenido de fibra detergente neutro corregida para cenizas y proteínas (utilizando alfa-amilasa termoestable) (FDNap)(14). La lignina (LIG) se determinó tratando el residuo de fibra detergente ácido con ácido sulfúrico al 72 %(15). La hemicelulosa (HEM) se calculó mediante la siguiente ecuación: HEM = FDN - FDA. Para carbohidratos totales (CT), se utilizó la ecuación(16): CT= 100 - (%PCr +%EE +%Cenizas). El contenido de carbohidratos no fibrosos (CNF) se calculó según lo propuesto por Hall(17) para dietas que contienen urea, debido a su presencia en la dieta suministrada: CNF = 100 - [(PCr- (%urea PCr + %urea)) + % FDNap + %EE + %cenizas]. El coeficiente de digestibilidad aparente (CDA) de los nutrientes se calculó según lo descrito por Silva y Leão(11).. Los nutrientes digeribles totales (NDT) se estimaron con base en los datos de digestibilidad aparente y calculados de acuerdo con Weiss et al(18). Los NDT de las dietas se convirtieron en energía digestible (ED) y metabolizable (EM) utilizando las ecuaciones descritas por el Consejo Nacional de Investigación(19).

Análisis estadístico Los análisis estadísticos se realizaron utilizando el software Statistical Analysis System version (SAS University), utilizando el GLM, con un nivel de significancia del 5 %, según la prueba de Tukey.

25


Rev Mex Cienc Pecu 2022;13(1):19-31

Resultados Las dietas dieron lugar a diferencias para las ingestas de PCr (P=0.012), con valores medios más bajos para EAT1, con menor porcentaje de ensilaje de nopal en su composición, sin diferir de las dietas EAT2, EAT3 y EAT4 (Cuadro 3). La ingesta más baja de CNF fue mostrada por los animales que recibieron la dieta EAT1, sin diferir de la dieta EAT2 (P=0.006). La dieta EAT1 también proporcionó a los animales una menor ingesta de EE a comparación de las otras dietas evaluadas (P=0.023). Se observaron mayores ingestas de MO, EE y EM para EAT5; esta misma dieta promovió una menor ingesta de FDN (P<0.05). Cuadro 3: Ingesta, digestibilidad de materia seca y nutrientes y rendimiento productivo de corderos alimentados con ensilaje como alimento total que contiene nopal Dietas experimentales Valor Variables EAT1 EAT2 EAT3 EAT4 EAT5 EEM P Ingesta (g/d): Materia seca Materia seca, %PC Materia orgánica Proteína cruda Carbohidratos no fibrosos Extracto etéreo Fibra detergente neutro Energía metabolizable, Kcal/día Digestibilidad (g/kg): Materia seca Proteína cruda Carbohidratos no fibrosos Materia orgánica Extracto etéreo Fibra detergente neutro Rendimiento productivo (kg): Peso inicial Peso final Ganancia total de peso Ganancia diaria, g/día Conversión alimenticia abc

958 30.2 867b 128b 305c 11.1d 490a 2.22b

950 30.2 891b 129ab 339bc 17.6c 463a 2.29b

1071 33.0 982b 150ab 382b 21.8bc 449ab 2.55ab

1047 33. 2 984b 147ab 357b 23.8b 414bc 2.62ab

1189 33.4 1005a 165a 521a 30.6a 402c 3.04a

0.06 0.06 37.3 4.37 17.8 0.15 25.8 71.9

0.067 0.089 0.016 0.012 0.006 0.023 0.019 0.028

692 818 758c 869 771 522ab

643 832 780c 846 842 542ab

690 833 796bc 853 849 535ab

642 817 830ab 866 860 578a

697 788 853a 846 874 580a

13.6 13.8 37.5 27.4 27.9 35.3

0.414 0.170 0.001 0.131 0.072 0.001

20.8 31.8 11.0 183 5.23

21.5 31.6 10.1 168 5.97

21.9 31.7 10.9 169 6.63

19.9 31.1 11.2 186 6.43

22.1 34.0 11.9 198 6.16

0.27 0.36 0.19 0.02 0.36

0.295 0.551 0.598 0.596 0.613

EEM= Error estándar de la media; Medias seguidas de letras diferentes difieren estadísticamente según la prueba de Tukey al nivel de 5 % de probabilidad.

26


Rev Mex Cienc Pecu 2022;13(1):19-31

El CDA de CNF (P=0.001) fue menor en EAT1, aumentando gradualmente con el aumento del nivel de ensilaje de nopal en las dietas (Cuadro 3). Las dietas EAT4 y EAT5 tuvieron un CDA más alto de FDN en comparación con EAT1 (P=0.001). El CDA de MS, PCr, MO y EE no mostró diferencias entre el rendimiento del EAT (P>0.05). No se detectaron diferencias para las variables de rendimiento productivo (P>0.05). El EAT no tuvo un efecto significativo en el consumo, la excreción y el balance hídrico (P>0.05; Cuadro 4). El EAT1 presentó valores medios más bajos para los contenidos de ingesta de nitrógeno (P=0.027), nitrógeno excretado vía heces (P=0.001) y nitrógeno excretado vía orina (P=0.003). No hubo efecto de las dietas para el nitrógeno absorbido, el nitrógeno retenido y el balance de nitrógeno (P>0.05). Cuadro 4: Balance hídrico y balance de nitrógeno de corderos alimentados con ensilaje de alimento total que contiene nopal Dietas experimentales Valor Variables EAT1 EAT2 EAT3 EAT4 EAT5 EEM P Balance hídrico (L/día): Ingesta de agua vía bebedero Ingesta de agua vía alimento Agua metabólica Ingesta total de agua Agua excretada vía heces Agua excretada vía orina Excreción total de agua Agua retenida Balance hídrico, % Balance de nitrógeno (g/día): Ingesta de nitrógeno Nitrógeno en heces Nitrógeno en orina Nitrógeno absorbido Nitrógeno retenido Balance de nitrógeno, % ab

2.37

2.05

2.12

2.03

2.32

0.38

0.058

1.52 0.50 4.0 0.55 1.03 1.58 2.09 39.1

1.42 0.53 3.48 0.51 0.88 1.29 1.82 37.2

1.53 0.53 3.44 0.62 0.93 1.36 1.89 39.0

1.38 0.61 3.41 0.61 0.89 1.50 2.12 43.6

1.19 0.61 3.51 0.45 1.07 1.63 2.24 46.8

0.06 0.04 0.12 0.03 0.08 0.42 0.33 3.19

0.055 0.115 0.149 0.447 0.348 0.358 0.219 0.224

20.5b 2.50c 2.48b 18.0 15.5 75.3

20.7ab 2.68bc 3.20a 18.0 14.8 71.1

24.0ab 2.66bc 3.19a 21.4 18.1 74.1

23.6ab 2.92b 3.16a 20.6 17.2 72.9

26.4a 3.38a 3.22a 23.0 18.7 74.0

2.78 0.30 0.36 1.60 1.85 3.69

0.027 0.001 0.003 0.068 0.214 0.549

EEM= Error estándar de la media. Medias seguidas de letras diferentes difieren estadísticamente según la prueba de Tukey al nivel de 5 % de probabilidad

27


Rev Mex Cienc Pecu 2022;13(1):19-31

Discusión La ingesta de materia seca de los ensilajes de alimento total mostró valores más altos que los recomendados por el NRC(10), que sugiere la ingesta de 820g/animal/día. Por tanto, es evidente que no hubo limitaciones en la IMS (Cuadro 3), lo que indica que los ensilajes bajo estudio presentaron una fermentación deseable y una alta aceptabilidad por parte de los animales, por lo tanto, no se notó el efecto de llenado ni un efecto limitante en la demanda de energía. Siguiendo la misma tendencia, se verificó que los valores en %PC son adecuados para ovinos, que deben presentar una IMS de 3 a 5 % según el NRC(10). La ingesta de materia seca es un factor importante en el rendimiento de ovinos en confinamiento, siendo considerada el punto determinante del suministro de nutrientes necesarios para cumplir con los requisitos de mantenimiento y ganancia de peso de los animales(20). Aunque las dietas tuvieron una IMS similar, los animales no alcanzaron la ganancia diaria esperada de 200 g, obteniendo una GDP de 180.8 g. La ingesta de proteínas crudas por parte de corderos alimentados con ensilajes de alimento total fue superior a la recomendada por el NRC(10). En relación con la EM, los corderos alimentados con EAT3, EAT4 y EAT5 presentaron un consumo superior a las 2390 kcal/día recomendadas por el NRC(10), para animales de esta categoría (Cuadro 3). El aumento en las ingestas de EE y CNF puede explicarse por el aumento en el contenido de dichos nutrientes en las dietas, asociado con una IMS similar entre los corderos. De acuerdo con el NRC(10), niveles adecuados de ingesta de energía para ovinos jóvenes son necesarios para que los animales se desarrollen y alcancen su potencial, y el requerimiento de mantenimiento de estos corderos se logra con menor ingesta en comparación con corderos con mayor peso y cuando se buscan mayores ganancias, para ello es esencial balancear el alimento y no solo cumplir con la calidad sino también con la cantidad de los nutrientes ofrecidos a los animales(20). Por tanto, todas las dietas permitieron maximizar el consumo por parte de los animales, que no se vieron afectados por la limitación física debido al exceso de fibra o la alta concentración de energía. Además, la mayor IEM observada para los animales que consumieron EAT5 debe dilucidarse por el aumento de los niveles de CNF, la reducción de los niveles de FDN y FDA que se produjo proporcionalmente al aumento en la adición de nopal y salvado de trigo en la producción de ensilaje de alimento total. Todos los ensilajes presentaron una concentración de FDN superior al 25 % y CNF inferior al 44 % en materia seca, como lo recomienda el NRC(19). Sin embargo, el EAT4 y EAT5 mostraron valores más bajos de FDN del pasto buffel, así como el EAT5, que tuvo un valor de FDA más bajo (Cuadro 2). El mayor coeficiente de digestibilidad de carbohidratos no fibrosos y FDN observado para EAT5 y EAT4, probablemente se deba a la mayor proporción de nopal y salvado

28


Rev Mex Cienc Pecu 2022;13(1):19-31

de trigo en las dietas. El nopal y el salvado de trigo tienen una menor concentración de lignina que el pasto buffel (Cuadro 1), favoreciendo la digestibilidad de estas dietas. Según Raffrenato et al(21), la lignina tiene menos digestibilidad en la pared celular de las gramíneas que en los granos porque la lignina es una barrera importante para que las bacterias ruminales se muevan hacia la célula vegetal, reduciendo la digestión de la pared celular de las gramíneas. Este efecto puede explicar el hecho de que EAT1 es menos digerible, ya que la FDN de este ensilaje tuvo mayores proporciones de pasto buffel, mientras que la FDN de EAT5 tuvo mayores proporciones de salvado de trigo (Cuadro 3). Los animales tuvieron un consumo medio de 2.178 L de agua/día, superior al recomendado por el NRC(10), que sugiere 0.800 L de agua/d para cordero. Alrededor del 37.7 % de la ingesta total de agua provino de las dietas suministradas, lo que demuestra la importancia de la conservación del forraje en forma de ensilaje, con el objetivo de aumentar el suministro de agua para los animales criados en regiones con altos déficits de agua. Como EAT4 y EAT5 mostraron mayores cantidades de salvado de trigo (Cuadro 1), también mostraron niveles más altos de proteína no degradable en el rumen que proporcionaron mayores pérdidas de N fecal que EAT1 (Cuadro 4). El balance positivo de nitrógeno indica que los animales no necesitaron desplazar las reservas de proteína corporal para satisfacer sus necesidades nutricionales y que la dieta fue suficiente para aumentar la ingesta de nitrógeno.

Conclusiones e implicaciones En condiciones experimentales, el uso de nopal forrajero y concentrado en forma de raciones mixtas totales de ensilaje conduce a una mayor ingesta de proteína cruda, carbohidratos no fibrosos, extracto etéreo y mayor digestibilidad de carbohidratos no fibrosos y fibra detergente neutro, sin embargo, todas las dietas resultaron viables en la alimentación de ovinos confinadas, proporcionando ganancias de hasta 198 g/día según la formulación de la dieta. Agradecimientos

Agradecemos el financiamiento externo del Consejo Nacional de Desarrollo Científico y Tecnológico (CNPq), con el proceso número 435819/2018-6. Conflicto de intereses Los autores declaran que no tienen intereses contrapuestos.

29


Rev Mex Cienc Pecu 2022;13(1):19-31

Literatura citada: 1. Paula TA, Véras ASC, Guido SI, Chagas JCC, Conceição MG, Gomes RN, et al. Concentrate levels associated with a new genotype of cactus (Opuntia stricta [Haw]. Haw.) cladodes in the diet of lactating dairy cows in a semi-arid region. J Agric Sci 2019;156(10):1251-1258. https://doi.org/10.1017/S002185961900011X 2019 v.1. 2. Oliveira JPF, Ferreira MAF, Alves AMSV, Melo ACC, Andrade IB, Urbano SA, et al. Carcass characteristics of lambs fed spineless cactus as a replacement for sugarcane. Asian-Austral J Anim Sci 2018;31(4):529-536. https://doi.org/10.5713/ajas.17.0375. 3. Pereira GA, Santos EM, Oliveira JS, Araújo GGL, Paulino RS, Perazzo AF, et al. Intake, nutrient digestibility, nitrogen balance, and microbial protein synthesis in sheep fed spineless-cactus silage and fresh spineless cactus. Small Ruminant Res 2021;194(e106293):1-8. https://doi.org/10.1016/j.smallrumres.2020.106293. 4. Miranda-Romero LA, Vazquez-Mendoza P, Burgueño-Ferreira JA, Aranda-Osorio G. Nutritive value of cactus pear silages for finishing lambs. J Prof Assoc Cactus Dev 2018;20(1):196-215. http://www.jpacd.org/jpacd/article/view/37. 5. Moura MSC, Guim A, Batista AMV, Maciel MV, Cardoso DB, Lima Júnior DM, et al. The inclusion of spineless cactus in the diet of lambs increases fattening of the carcass. Meat Sci 2020;160(e107975):1–8. https://doi.org/10.1016/j.meatsci.2019.107975. 6. Silva TS, Araújo GGL, Santos EM, Oliveira JS, Campos FS, Godoi PFA, et al. Water intake and ingestive behavior of sheep fed diets based on silages of cactus pear and tropical forages. Trop Anim Health Prod 2021;53(e224):1-7. https://doi.org/10.1007/s11250-021-02686-3. 7. Matias AGS, Araújo GGL, Campos FS, Moraes SA, Gois GC, Silva TS, et al. Fermentation profile and nutritional quality of silages composed of cactus pear and maniçoba for goat feeding. J Agric Sci 2020;158(4):304–312. https://doi.org/10.1017/S0021859620000581. 8. Carvalho GGP, Rebouças RA, Campos FS, Santos EM, Araújo GGL, Gois GC, et al. Intake, digestibility, performance, and feeding behavior of lambs fed diets containing silages of different tropical forage species. Anim Feed Sci Techn 2017;228(1):140-148. https://doi.org/10.1016/j.anifeedsci.2017.04.006. 9. Silva KB, Oliveira JS, Santos EM, Cartaxo FQ, Guerra RR, Souza AFN, et al. Ruminal and histological characteristics and nitrogen balance in lamb fed diets containing cactus as the only roughage. Trop Anim Health Prod 2020;52(2):637645. https://doi.org/10.1007/s11250-019-02051-5.

30


Rev Mex Cienc Pecu 2022;13(1):19-31

10. NRC. Nutrient requirements of small ruminants: Sheep, goats, cervids, and new world camelids. National Research Council. The National Academy Press, Washington, DC; 2007. 11. Silva JFC, Leão MI. Fundamentos de nutrição de ruminantes. Livroceres: Piracicaba;1979. 12. Church DC. Digestive physiology and nutrition of ruminants: Digestive physiology. 2nd ed. O & B Books Publishing, Corvallis;1976. 13. Aoac - Association of Official Analytical Chemists. Official methods of analysis of AOAC International. Ed., Latimer Jr., G.W. 20th ed. Washington, DC; 2016. 14. Mertens DR. Gravimetric determination of amylase-treated neutral detergent fiber in feeds with refluxing in beaker or crucibles: collaborative study. J AOAC Int 2000;285(6):1217-1240. https://pubmed.ncbi.nlm.nih.gov/12477183/. 15. Silva DJ, Queiroz AC. Análise de alimentos: métodos químicos e biológicos. Editora UFV, Viçosa; 2002. 16. Sniffen CJ, O’Connor JD, Van Soest PJ. A net carbohydrate and protein system for evaluating cattle diets: II. Carbohydrate and protein availability. J Anim Sci 1992;70(11):3562–3577. https://www.ncbi.nlm.nih.gov/pubmed/1459919. 17. Hall MB. Challenges with non-fiber carbohydrate methods. J Anim Sci 2003;81(12):3226–3232. https://doi.org/10.2527/2003.81123226x. 18. Weiss WP. Energy prediction equations for ruminant feeds. In: Cornell Nutrition Conference Feed Manufactures, 61, Ithaca. Proc Ithaca: Cornell University, 1993:176-185. 19. NRC. Nutrient requirements of dairy cattle. National Research Council. 7th ed. Washington, DC: The National Academy Press; 2001. 20. McGrath J, Duval SM, Tamassia LFM, Kindermann M, Stemmler RT, Gouvea VN, et al. Nutritional strategies in ruminants: A lifetime approach. Res Vet Sci 2018;116(1):28-39. https://doi.org/10.1016/j.rvsc.2017.09.011. 21. Raffrenato E, Fievisohn R, Cotanch KW, Grant RJ, Chase LE, Van Amburgh ME. Effect of lignin linkages with other plant cell wall components on in vitro and in vivo neutral detergent fiber digestibility and rate of digestion of grass forages. J Dairy Sci 2017;100(10):8119-8131. https://doi.org/10.3168/jds.2016-12364.

31


https://doi.org/10.22319/rmcp.v13i1.5300 Artículo

Comparación en la calidad de huevos obtenidos en un sistema de producción en corrales al aire libre y los producidos en un sistema de jaula

Samantha Romo a Daniela López a Néstor Ledesma a Carlos Gutiérrez a Antonio Quintana a Lucía Rangel a*

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Av. Universidad 300, 04510, Ciudad de México. México.

* Autor de correspondencia: eliana@unam.mx

Resumen: México es el principal consumidor de huevo a nivel mundial con más de 23.22 kg de huevo per capita al año. En años recientes se han diversificado los sistemas de producción con la introducción de sistemas que promueven el bienestar animal. El presente estudio se realizó con el objetivo de comparar la calidad de los huevos producidos en un sistema de corral al aire libre contra los de un sistema semi-tecnificado en jaula. Se evaluaron las características físicas internas y externas de los huevos a los 3 y a los 15 días de la puesta. Los resultados del presente estudio mostraron que el huevo producido en un sistema de corral al aire libre posee menor limpieza (P<0.001), y menor calidad (P<0.005) que el de los huevos producidos en el sistema de jaula, de acuerdo a la clasificación de la Norma mexicana de “Productos avícolas -huevo fresco de gallina- especificaciones y métodos de prueba” (NMX-FF-127SCFI-2016). Finalmente, el tiempo de almacenamiento disminuyó significativamente la 32


Rev Mex Cienc Pecu 2022;13(1):32-42

calidad del huevo producido en el sistema de corral al aire libre (P<0.001), pero no la de los huevos provenientes del sistema convencional en jaula. En conclusión, bajo las condiciones del presente trabajo, la calidad del huevo proveniente de sistemas convencionales es mejor que la del huevo producido en sistemas de corral al aire libre, especialmente después de 15 días de almacenamiento. Estos resultados sugieren que se requieren más estudios que evalúen los efectos de las prácticas de manejo, la medicina preventiva y las condiciones medioambientales de los sistemas libres de jaulas, sobre la salud animal y la calidad final del huevo. Palabras clave: Huevo, Calidad, Producción en jaula, Producción libre de jaula.

Recibido: 21/03/2019 Aceptado: 30/03/2021

Introducción En México la avicultura representa el 63.3 % de la producción pecuaria, de los cuales el 34.9 % es de pollo para plato, el 28.2 % de huevo, y el 0.2 % restante representa la producción de pavos(1). México es el principal consumidor de huevo a nivel mundial con más de 22.3 kg (360 a 370 huevos) per cápita, y es el cuarto lugar entre los países con mayor producción, por debajo de China, Estados Unidos e India. En el año 2017 la producción de huevo en México fue de 2,718,476 t, con un valor de $49,505 millones de pesos siendo los principales estados productores Jalisco con el 55 % de la producción y Puebla con el 15 %(1). A medida que la avicultura ha evolucionado hacia producciones a gran escala, se han desarrollado sistemas de crianza intensivos convencionales, donde las aves se mantienen confinadas, permitiendo tener un mayor número de animales en un espacio reducido, así como una mayor mecanización y tecnificación(2). En los últimos años se ha puesto interés en el bienestar de los animales de producción, y para mejorarlo se ha sugerido el uso de sistemas alternos o no convencionales en los que los animales se encuentren libres(3). El consumo de productos generados bajo estos sistemas va en aumento en todo el mundo, principalmente en la Unión Europea, los Estados Unidos y el Japón(4). En México la producción de huevo en sistemas en corral al aire libre, o de pastoreo, ha tenido un incremento lento, ya que un sector de la población de la clase socioeconómica media alta busca una mejor alimentación consumiendo productos que se comercializan como naturales y de mayor calidad(5). Adicionalmente, las empresas del sector alimentario están comprometidas con el bienestar animal, incluso empresas como Alsea, Bimbo, CMR

33


Rev Mex Cienc Pecu 2022;13(1):32-42

(Corporación Mexicana de Restaurantes) y Marriot International han manifestado que para el año 2025 requieren que sus insumos provengan de sistemas de producción libres de jaula(6). Los parámetros productivos del sistema libre de jaulas no son comparables con los de la producción intensiva. Ya que si bien, el requerimiento de instalaciones es menor, la baja densidad de población por metro cuadrado incrementa el costo por ave. Adicionalmente, los gastos por la mano de obra y la alimentación son mayores, pues las aves al tener más espacio elevan el gasto energético y requieren un mayor consumo de alimento para cubrir sus necesidades de mantenimiento y producción. Así, el costo de producción por kilogramo de huevo en el sistema libre de jaulas se encuentra entre un 50 y un 70 % por arriba del de las producciones intensivas, por lo tanto, la competencia de estos sistemas radica en la calidad del producto final y no en el precio de venta(7,8). Cuando se habla de calidad de huevo, se hace referencia a ciertas propiedades físicas internas y externas que influyen en la aceptación del producto por parte del consumidor. Según la NMX-FF-127-SCFI-2016(9) el huevo se clasifica en cuatro categorías de calidad que son México extra, México 1, México 2 y fuera de clasificación. Las categorías de clasificación de México tienen equivalentes a la clasificación usada en los Estados Unidos (Cuadro 1). La calidad interna tiende a disminuir desde que el huevo es puesto, y se ve afectada por la edad o frescura, enfermedades en la parvada, manipulación, temperatura y humedad de almacenamiento(10,11). Para medir la frescura del huevo se utilizan las Unidades Haugh (UH), que relacionan el peso total del huevo con la altura de la albúmina, estas unidades disminuyen conforme envejece el producto(9,10). Cuadro 1: Clasificación Mexicana del huevo según la norma NMX-FF-127-SCFI-2016 (9), y sus equivalentes en Estados Unidos (EUA) y en las Unidades Haugh (UH)

México Extra México 1 México 2

EUA AA A B

UH > 79 55 a 78 31 a 54

Fuera de clasificación

C (fuera de clasificación)

< 31

En calidad externa se evalúa la forma del huevo, la limpieza en la que no debe presentar manchas de sangre, de excremento o de polvo, mientras que el cascarón no debe tener alteraciones como arrugas o estrías, ni perforaciones, grietas o roturas(10). El objetivo de este trabajo fue comparar la calidad de los huevos producidos en un sistema de corrales al aire libre contra los producidos en un sistema en jaula. Se evaluaron las características físicas de calidad, internas y externas, a los 3 y a los 15 días de la puesta. La

34


Rev Mex Cienc Pecu 2022;13(1):32-42

hipótesis del trabajo fue que la calidad del huevo de gallina producido en un sistema de corrales al aire libre es mejor que la de aquellos que provienen del sistema de producción en jaula, sin importar el tiempo de almacenamiento.

Material y métodos Se utilizaron gallinas Leghorn en su primer ciclo de postura, alimentadas con el mismo concentrado, elaborado en la FMVZ. Las muestras se tomaron de dos centros de la Facultad de Medicina Veterinaria y Zootecnia, de la Universidad Nacional Autónoma de México, ambos con casetas de ambiente natural con colección manual de huevo, dos veces por día. El huevo del sistema en jaulas (n= 60) provino del Centro de enseñanza, Investigación y Extensión en Producción Avícola, localizado en Tláhuac, CDMX, en el altiplano mexicano; mientras que los huevos producidos en el sistema en corral al aire libre (n= 60) se produjeron en el Centro de Enseñanza, Investigación y Extensión Agro Silvo Pastoril, localizado en Chapa de Mota Edo. de México. La producción tradicional se lleva a cabo en jaulas tipo California de 40 cm de frente por 45 cm de profundidad para tres gallinas, mientras que la producción en corral al aire libre es en piso de tierra con ponederos de lámina y perchas de madera, a razón de un nido para cinco gallinas, y disponiendo en total de 1 m2 para cuatro gallinas. Para este estudio la recolección del huevo se realizó el mismo día en ambos centros por la tarde y los huevos se trasladaron inmediatamente a la Facultad para su identificación y almacenamiento hasta el día del análisis. En el caso de las muestras de la producción en corral al aire libre únicamente se incluyeron huevos que se localizaran en los nidos. Treinta (30) huevos de cada sistema fueron evaluados a los tres días de la puesta, mientras que los 60 huevos restantes fueron almacenados en refrigeración a 4 ºC, con 60 % de humedad, para evaluarlos a los 15 días de la puesta. Los parámetros evaluados fueron: peso en gramos, largo y ancho en milímetros, grosor del cascarón en milímetros, limpieza de cascarón (determinando 4 categorías (0) limpio, (1) poco sucio, (2) medianamente sucio y (3) muy sucio), color de la yema mediante el abanico colorimétrico de Roche. Para medir la frescura del huevo se utilizaron las Unidades Haugh (UH), las cuales disminuyen conforme envejece el producto(9,10). Estas UH se calculan con la fórmula UH = 100 X log [(AA-(1.7 X PH) + 7.57], en la que AA es la altura de la albumina en mm y PH es el peso del huevo en gramos. Con las evaluaciones anteriores los huevos se clasificaron de acuerdo con la norma oficial mexicana (NMX-FF-127-SCFI-2016) en México Extra, México 1, México 2 y sin clasificación.

35


Rev Mex Cienc Pecu 2022;13(1):32-42

Para el efecto del tipo de producción sobre la limpieza del huevo y el color de la yema se empleó la prueba de suma de rangos de Wilcoxon. La diferencia entre unidades Haugh por efecto del tipo de producción se analizó con T de Student, mientras que las características externas del huevo se evaluaron mediante un análisis de varianza. Para analizar el efecto del tiempo de almacenamiento sobre el porcentaje de huevos en las diferentes categorías de la clasificación mexicana se utilizó una Ji-cuadrada.

Resultados Los huevos producidos en el sistema de producción en jaula fueron más pesados que aquellos producidos en el sistema de corral al aire libre (62.3 vs 58.5; P<0.01). No hubo diferencias (P>0.05) significativas en el ancho (23.8  3.7 mm) y el largo (28.6  4.8 mm) del huevo, ni en el grosor del cascaron (0.37  0.008 mm) tampoco efecto de las características físicas externas de los huevos por efecto del tipo de producción. Cuando se evaluó la limpieza del huevo se encontró que ésta fue significativamente mejor (P<0.001) en el huevo producido en un sistema de jaula, ya que el 91.5 % del huevo producido bajo este sistema se clasificó como limpio, contra un 45.8 % del huevo de corral al aire libre. Adicionalmente, en el sistema de jaula no hubo huevos en las categorías de medianamente sucio y muy sucio, mientras que en el sistema en corral al aire libre un 10.2 % de los huevos se clasificaron como medianamente sucio y muy sucio (P<0.001) (Figura 1). Figura 1: Porcentaje de huevo Limpio, Poco sucio, Medianamente sucio y Muy sucio , de acuerdo al sistema de producción (jaula o corral al aire libre)

Los porcentajes de todas las categorías de limpieza muestran diferencias (P<0.001) entre los tipos de producción.

36


Rev Mex Cienc Pecu 2022;13(1):32-42

Dentro de las características físicas internas el color de la yema no fue diferente entre producciones (P>0.05), ni se afectó por el tiempo de almacenamiento. No se encontraron diferencias entre tratamientos en la altura de la albúmina al día 3 post-ovoposición (P>0.05), sin embargo, el tiempo de almacenamiento del huevo sí la afectó, disminuyéndola. significativamente (P<0.01), y esta reducción fue mayor en los huevos puestos en corral libre de jaula (interacción: tipo de producción por tiempo de almacenamientos, P<0.001) (Cuadro 2). Cuadro 2: Características de frescura del huevo producido en un sistema de corral al aire libre o en jaulas tipo california, y efecto del tiempo de almacenamiento (3 o 15 días) Tipo de producción Error Jaula Corral al aire libre estándar Días de 3 15 3 15 almacenamiento Altura de la 4.6 a 3.9 b 5.3 a 2.6 c 0.2 albúmina, mm Unidades Haugh ab

63.9 a

54.0 a

69.4 a

36.4 b

3.1

Literales diferentes dentro de la misma variable de calidad del huevo indican diferencias significativas (P<0.01).

La frescura del huevo, medida en unidades Haugh, disminuyó con el tiempo de almacenamiento (P<0.001). Sin embargo, el tiempo de almacenamiento afectó más (interacción P<0.05) al huevo de gallinas libres, de tal modo que a más días de almacenamiento menores fueron las unidades Haugh (Cuadro 2). Cuando se evaluó la calidad del huevo se encontró que el huevo producido en jaula fue de mejor calidad (P<0.005), y esta calidad se preservó mejor (P<0.001) con el tiempo de almacenamiento (Figura 2). El 100 % de los huevos producidos en jaula tuvieron clasificaciones México 1 y México 2 a los 3 y a los 15 días de almacenamiento, mientras que, en el huevo producido en corral al aire libre, del 90 % de los huevos que se encontraban en la categoría de México 1 al día 3, solamente el 6.7 % se mantuvo en ella a los 15 días, el porcentaje de huevos en la categoría México 2 se incrementó de 3.3 % a 43.3 %, y 36.7 % de los huevos salió de clasificación.

37


Rev Mex Cienc Pecu 2022;13(1):32-42

Figura 2: Clasificación de calidad del huevo, después de 3 ▄ 15 ▄ días de almacenamiento, donde: MX-E = México extra, MX-1 = México 1, MX-2 = México 2, SC = sin clasificación

Panel A = producción en jaula; panel B = producción en corral al aire libre.

Discusión Los resultados del presente estudio muestran que el huevo producido en sistemas de jaula posee mejor calidad después de 15 días de almacenamiento, cuando se compara con el huevo obtenido en un sistema en corral al aire libre. La tendencia actual al consumo de alimentos producidos en sistemas similares a los de vida libre, ha favorecido el incremento de sistemas de producción de huevo con gallinas libres, y uno de los argumentos es que la calidad del huevo es mejor(12). Sin embargo, en estudios realizados para determinar diferencias en la calidad de huevo de acuerdo con los sistemas de alojamiento de las ponedoras, se han encontrado resultados muy variables y poco consistentes(13). El presente estudio demuestra que la calidad inicial del huevo no difiere, pero la producción en sistemas en corral al aire libre afecta negativamente la calidad cuando el huevo se almacena por 15 días, aún después de estandarizar la estirpe y la dieta de las gallinas. Las características internas y externas del huevo en ambos sistemas fueron similares en el huevo fresco (3 días después de la postura). Sin embargo, después de 15 días de almacenamiento una mayor proporción de huevos provenientes del sistema en corral al aire libre se clasificaron en la categoría México 2, e incluso hubo huevos fuera de clasificación, lo que indica una disminución en la calidad del huevo con el tiempo. Dentro de los factores asociados a la disminución de la calidad interna del huevo (Unidades Haugh) se encuentra la pérdida de agua y CO₂(14,15,16), en consecuencia, el pH del huevo se incrementa (cambia a 38


Rev Mex Cienc Pecu 2022;13(1):32-42

básico), lo que da como resultado una clara acuosa debido a la pérdida de estructura de la proteína de la albumina densa(14,17,18). Estudios previos han reportado que dichos cambios comienzan a observarse a partir de los 5 días de almacenamiento, lo cual incluso afecta el sabor del huevo(10). Lo anterior explicaría la disminución de las UH después de 15 días de almacenamiento que se encontró en este estudio. Otro factor que también puede afectar la calidad interna del huevo es la temperatura ambiente(19,20,21). En este estudio los huevos de ambos sistemas se almacenaron en el mismo lugar y la temperatura de almacenamiento fue igual durante los 15 días posteriores; sin embargo, es posible que haya existido una variación en la misma desde el momento de la postura hasta el traslado al laboratorio. Los sistemas de producción en jaula pueden tener sistemas de aire controlado, que evitan variaciones de temperatura, lo cual no se observa en producciones en corral al aire libre(22). Así, se ha observado que la calidad de la albúmina se afecta si los huevos no son recolectados inmediatamente en una caseta con temperatura ambiental elevada(23,24). Adicionalmente, en los sistemas en corral al aire libre las gallinas tienen la disponibilidad de nidos con cama, que pueden retrasar la pérdida de calor del huevo(23,25), lo cual no ocurre en el sistema de jaula, ya que el huevo sale hacia la banda de recolección inmediatamente después de la puesta, favoreciendo el descenso de su temperatura en menor tiempo. Los resultados del presente trabajo muestran una interacción entre el sistema de producción y el tiempo de almacenamiento, este segundo afectando más negativamente la calidad para el sistema de corral al aire libre. Por otro lado, el intervalo entre recolecciones de huevo en sistema de jaula es menor que en sistemas en corral al aire libre, por lo que el huevo pasa menor tiempo en el sitio de producción(25). Datos aportados por Macindoe(16) indican que las Unidades Haugh se disminuyen considerablemente a mayor intervalo entre las recolecciones del huevo. Sin embargo, los resultados mostraron que la calidad del huevo proveniente del sistema en corral al aire libre es menor aún cuando el tiempo de recolección no fue diferente entre sistemas. Por último, el huevo de jaula presentó un porcentaje de limpieza mayor que la del huevo proveniente del sistema en corral al aire libre. Lo anterior se atribuye a que, en este último sistema, una parte de los huevos es puesto en el piso y la otra en nidos comunitarios, lo que implica el contacto de los huevos con superficies sucias. Además, se ha demostrado que los huevos producidos en sistemas libres de jaula presentan mayor contaminación bacteriana con estafilococos, estreptococos y E.coli(24,26). Lo anterior puede explicar la reducción de la calidad observada en este estudio cuando los huevos se conservaron por 15 días, ya que un mayor número de bacterias en el cascarón incrementa el riesgo de contaminación y por ende disminuye la calidad interna(23,24). Estos resultados demuestran que la calidad del huevo producido en un sistema en corral al aire libre es menor a la de los huevos producidos en los sistemas convencionales, y 39


Rev Mex Cienc Pecu 2022;13(1):32-42

concuerdan con lo sugerido por Wells y Belyavin(24), quienes mencionan que los huevos producidos en condiciones libres de jaula no presentan ventajas reales al consumidor en cuanto a composición y propiedades físicas del huevo. Ellos incluso sugieren que los huevos de sistemas en corral al aire libre tienen menor calidad microbiológica, por lo que consideran que las modificaciones en las características del huevo no son los argumentos que deban utilizarse para sustentar el cambio de los sistemas de producción tradicionales. Adicionalmente, debe evaluarse el costo beneficio, ya que en general en los sistemas de pastoreo la mortalidad es mayor y el costo de producción más alto por el menor número de huevos producidos y comercializados.

Conclusiones e implicaciones En conclusión, se puede decir que ambos sistemas de producción tienen ventajas y desventajas; sin embargo, la calidad del huevo proveniente de sistemas convencionales es mejor que la del huevo producido en sistemas en corral al aire libre. Se requieren más estudios que evalúen los efectos de las prácticas de manejo, la medicina preventiva y las condiciones medioambientales del sistema en corral al aire libre, sobre la salud animal y la calidad final del huevo. Literatura citada: 1.

UNA. Unión nacional de Avicultores Compendio de indicadores económicos del sector avícola. Dirección de estudios económicos. México. 2018. www.una.org.mx. Consultado 18 Ene, 2018.

2.

FAO. Organización de las Naciones Unidas para la Alimentación y Agricultura. México. 2015.

3.

Sauveur B. El huevo para consumo: Bases productivas. El alojamiento de las gallinas ponedoras y de las aves reproductoras: características. España. 1993:214-260.

4.

SADER (Secretaria de Agricultura y Desarrollo Rural) México. 2018.

5.

Díaz VA, Pérez HA, Hernández AJ. Caracterización del consumidor de productos orgánicos en la ciudad de Toluca. Méx. Sociedad Mexicana de Administración Agropecuaria A. C. Torreón México. Rev Mex Agroneg 2015;(36):1178-1187.

6.

Muñoz D. Gallinas libres… huevos caros. El financiero. México, 2016. http://www.elfinanciero.com.mx/empresas/gallinas-libres-huevos-caros. Consultado 17 Feb, 2018.

7.

Appleby MC, Hueghes BO, Elson HA. Poultry production systems: Behaviour management and welfare. UK: CAB International; 1992.

40


Rev Mex Cienc Pecu 2022;13(1):32-42

8.

Quintana JA. AVITECNIA: Manejo de las aves domésticas más comunes, 4 ed. México: Trillas; 2011.

9.

NMX-FF-127-SCFI-2016. Productos Avícolas -huevo fresco especificaciones y métodos de http://sitios1.dif.gob.mx/alimentacion/docs/NMX-FF-127-SCFI2016_Huevo_fresco.pdf . Consultado 14 Oct, 2020.

de

gallinaprueba.

10. Coutts JA, Wilson GC. Manual práctico de calidad de huevo. 1ͣ ed. Reino Unido: 5M Publishing; 2007. 11. Pedroza RH. Manual de prácticas de laboratorio de inocuidad y calidad de los alimentos de origen animal. 2ᵅ ed. México: Universidad Autónoma de México; 2013. 12. Raigón MD, García M, Esteve P. Valoración de la calidad del huevo de granja ecológica e intensiva. Escuela Universitaria de Ingeniería Técnica Agrícola. 2007. Universidad Politécnica de Valencia. www.institutohuevo.com. Consultado 14 Abr, 2018. 13. Yenice G, Kaynar O, Ileriturk M, Hira F, Hayirli A. Quality of eggs in different production systems. Food technology and economy, engineering and physical properties. 2016;34:370-376. 14. Pérez-Cobos PF. Calidad interna del huevo y su conservación. Gallego SA, et al. Cordinadores. Lecciones sobre el huevo, Madrid: Instituto de estudios del huevo; 2002: 57-74. 15. Feddern V, Celant De Prá M, Mores R, Silveira N, Coldebella A, Abreu P. Egg quality assessment at different storage conditions, seasons and laying hen strains. Ciencia y Agrotecnologia, 2017;41:322-333. 16. Macindoe, R.N. Egg quality, collection and storage. Poultry Intern 1981; May:162-168. 17. Scott TA, Silversides FG. The effect of storage and strain of hen on egg quality. Poultry Sci 2000;79:1725–1729. 18. Castelló JA. Producción de huevos 2ᵅ ed. España: Real Escuela de Avicultura; 2010. 19. Torre C, Fonseca M, Quintana J. El huevo mitos realidades y beneficios. 2ͣ ed. México: Instituto Nacional Avícola; 2008. 20. Kashimori A. The illustrated egg handbook. 1ͣ ed. Cambringe, UK: Nabel/DSM; 2017. 21. Yeasmin A, Azhar K, Hishamuddin O, Awis QS. Effect of storage time and temperature on the quality characteristics of chicken eggs. J Food, Agr Environ 2014;12:87-92.

41


Rev Mex Cienc Pecu 2022;13(1):32-42

22. Moreno AJC. Reproducción e incubación en avicultura. 1ͣ ed. España: Real Escuela de Avicultura; 2003. 23. Buxade CC. La gallina ponedora sistemas de explotación y técnicas de producción. 1ͣ ed. España: Mundi-Prensa; 2000. 24. Wells RG, Belyavin CG. Egg quality-current problems and recent advance. 1ͣ ed. England: Poultry science symposium 1989. 25. Nys Y, Bain M, Van IF. Improving the safety quality of egg and egg products volume 2: Eggs safety and nutritional quality, England: Woodhead Publishing; 2011. 26. Ledvinka Z, Zita L, Klesalová L. Egg quality and some factors influencing it: a review. Scientia Agr Bohemica 2012;43:46-52.

42


https://doi.org/10.22319/rmcp.v13i1.5388 Artículo

Uso de harina de semilla de uva como antioxidante natural en dietas de pollos de engorda Hubbard de crecimiento lento enriquecidas con ácidos grasos poliinsaturados

Margareta Olteanu a* Tatiana Dumitra Panaite a Raluca Paula Turcu a,b Mariana Ropota a Petru Alexandru Vlaicu a,b Monica Mitoi c

a

National Research-Development Institute for Animal Biology and Nutrition (INCDBNA), Calea Bucuresti, no. 1, Balotesti, 077015, Ilfov, Romania. b

University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Bd, District 1, Bucharest, Romania. c

Institute of Biology Bucharest, 296, Splaiul Independentei, 060031, Romania.

* Autor de correspondencia: margaretaolteanu@yahoo.com

Resumen: El propósito del estudio fue evaluar el efecto de la harina de semilla de uva, adicionada a la dieta de pollos de engorda Hubbard de crecimiento lento alta en ácidos grasos poliinsaturados (AGPI) por la harina de linaza de la dieta. El ensayo de alimentación de 7 semanas utilizó 80 polluelos (14 d), asignados a dos grupos: control (C) y E, con 4 repeticiones de 10 polluelos/grupo. La dieta basal fue similar para ambos grupos durante ambas etapas de alimentación. La dieta para el grupo E se complementó con 3 % de harina de semilla de uva. Se sacrificaron seis pollos de cada grupo al final del ensayo de alimentación, y se recogieron 43


Rev Mex Cienc Pecu 2022;13(1):43-63

muestras de sangre, carne de pechuga y pierna. El colesterol sérico fue significativamente menor en el grupo E (110.85 mg/dL) que en el grupo C (146.82 mg/dl). La concentración de AGPI fue significativamente mayor en el grupo E que en el grupo C, tanto en la pechuga (31.34 %, en comparación con el 27.73 % de ésteres metílicos totales de ácidos grasos EMAG) como en la pierna (32.44 %, en comparación con el 30.06 % de EMAG totales). La concentración de colesterol fue significativamente menor en el grupo E (42.52 mg) que en el grupo C (60.91 mg/100 g de muestra fresca) en la pierna. Después de 7 días de refrigeración, el valor de peróxido fue significativamente menor en el grupo E (8.11 meq) que en el grupo C (8.79 meq/kg de grasa) en la carne de pechuga, mientras que la acidez de la grasa fue significativamente menor en el grupo E (40.82 mg de KOH) que en el grupo C (43.99 mg de KOH/g de grasa) en la pierna. El 3 % de harina de semilla de uva de la dieta, utilizada como antioxidante natural, en las dietas de pollos de engorda enriquecidas con AGPI, tuvo efectos positivos en los parámetros sanguíneos y la calidad de la carne. Palabras clave: Pollo de engorda, Hubbard, Harina de linaza, Harina de semilla de uva, Ácidos grasos.

Recibido: 21/05/2019 Aceptado: 12/05/2021

Introducción Hay muchos factores que influyen en la calidad de la carne de pollos de engorda, entre ellos la composición genética, el bienestar animal, los factores previos al sacrificio y los cambios post mortem de los músculos(1). Hoy en día, la carne de pollos de engorda híbridos de crecimiento lento se volvió más conocida por su textura y sabor agradables, menos jugosa, ajustándose a las preferencias actuales de los consumidores(2,3). En Europa, estos híbridos se están adaptando más rápido a los sistemas de producción alternativos, estando disponibles varias líneas, aunque el rendimiento de crecimiento de los híbridos de crecimiento lento es menos eficiente que el de los híbridos de rápido crecimiento(2,3). Se encontró que los contenidos de ácidos grasos tienen efectos tanto peligrosos como benéficos para la salud humana según el tipo de grasas y el consumo de carne(4). Además, la preocupación de los consumidores por alimentos altos en omega-3 (AGPI ω-3) en su dieta diaria aumentó debido a su efecto benéfico en la salud humana(5,6,7).

44


Rev Mex Cienc Pecu 2022;13(1):43-63

Los alimentos de origen animal pueden enriquecerse en AGPI alimentando a los animales con dietas cuyos ingredientes sean altos en AGPI. Algunos de los ingredientes de alimento altos en AGPI son la linaza(8,9) y la harina de linaza(10-13), la harina de camelina(14,15) y la harina de colza(16-19). El lino es una planta oleaginosa en la que la relación ω-6 / ω-3 es inferior a la unidad (0.436 %), por lo tanto, el lino, en todas sus formas (semillas, aceite y harina) es un ingrediente de alimento viable que puede aumentar el nivel de AGPI de las dietas(8). Sin embargo, el aumento de los niveles de AGPI hace que los alimentos sean propensos a la oxidación, por lo que las dietas deben complementarse con antioxidantes(20). Los subproductos de bodega, el orujo de uva, las semillas de uva y pieles de uva, las tortas de semilla de uva o las harinas de semilla de uva, tienen altos niveles de polifenoles, fuentes de antioxidantes naturales. La abundancia de polifenoles activos en estos subproductos es de verdadero interés para la nutrición animal, ya que pueden ser utilizados como antioxidantes naturales, reemplazando a los sintéticos(21,22). Las tortas o harinas de semilla de uva resultan de la extracción en frío o la extracción química del aceite. La concentración de polifenoles oscila entre 0.642 mg equivalentes de ácido gálico, en las tortas, 3.186 mg equivalentes de ácido gálico, en el orujo de uva y 90.41 mg equivalentes de ácido gálico/g de muestra en la harina de semilla de uva. La capacidad antioxidante oscila entre 8.554 mM equivalentes de Trolox, en el orujo de uva, 6.241 mM equivalentes de Trolox, en tortas y 493.07 mM equivalentes de Trolox/g de muestra, en la harina de semilla de uva(11,23,24). La literatura cuenta con varios estudios sobre el uso de subproductos de bodega, como el orujo de uva(25,26,27) o harina de semilla de uva(28,29) en la alimentación de pollos de engorda y sobre sus efectos benéficos en el rendimiento de los pollos de engorda, la digestibilidad de proteínas y aminoácidos, los parámetros sanguíneos y la calidad de la carne, debido a la mayor concentración de AGPI y la menor peroxidación lipídica. Los estudios realizados hasta el momento han demostrado que la inclusión de subproductos de bodega en la alimentación animal, como antioxidantes naturales, es una buena estrategia para mejorar la estabilidad oxidativa de los productos de origen animal, satisfaciendo así el requisito del consumidor de alimentos de origen animal de alta calidad(30,31). Dentro de este contexto, el propósito del presente estudio fue evaluar el efecto de 3 % de harina de semilla de uva, subproducto de bodega, adicionada a la dieta de pollos de engorda Hubbard alta en ácidos grasos poliinsaturados debido al 2 % de harina de linaza en la dieta, en el rendimiento de los pollos, el perfil energético del plasma sanguíneo, en los niveles de ácidos grasos y colesterol y en los índices de degradación de la carne de pollo.

45


Rev Mex Cienc Pecu 2022;13(1):43-63

Material y métodos El ensayo de alimentación se llevó a cabo en las instalaciones experimentales del Instituto Nacional de Desarrollo de la Investigación para la Biología y Nutrición Animal (IBNABalotesti, Rumania) en un protocolo (núm. 5122/03.08.2017) aprobado por la Comisión de Ética del instituto de acuerdo con la Directiva de la UE 2010/63/UE y la ley rumana sobre protección animal.

Animales y diseño experimental

El ensayo de alimentación de 7 semanas se realizó en 80 polluelos de engorda Hubbard (14 días), criados en el suelo, sobre virutas de madera (10 cm de grosor). Los polluelos se pesaron individualmente y se asignaron a dos grupos (40 polluelos/grupo), teniendo el peso inicial promedio de 233.6 ± 5.53 g. Cada grupo tuvo cuatro repeticiones de 10 polluelos cada una. Los polluelos tuvieron libre acceso al alimento y al agua. Se tuvo un régimen de luz de 23 h, la temperatura fue de 22 a 23 °C, y la humedad relativa fue de 60 a 70 % durante todo el período experimental, según la Guía de manejo para pollos de engorda Hubbard CLASSIC(32). El diseño experimental fue monofactorial, completamente aleatorizado. Tuvo dos tratamientos, C (0 %) y E (3 %) con harina de semilla de uva aplicada para las dos fases, crecimiento (14-28 días) y finalización (28-63 días), de acuerdo con los requisitos de alimentación de la línea de crecimiento lento Hubbard híbrida (Cuadro 1). Ambas dietas (C y E) se enriquecieron con ácidos grasos poliinsaturados utilizando 2 % de harina de linaza. La harina de linaza y la harina de semilla de uva se compraron a 2E Prod SRL, Rumania. Hubo un solo lote de dieta / grupo para cada período: crecimiento y finalización. El rendimiento de crecimiento de los pollos: ingesta promedio diaria de alimento (g/pollo/día), peso inicial (g), peso final (g), se monitoreó durante todo el período experimental (14-63 días). Se calculó la ganancia promedio diaria de peso (g/pollo/día) y la relación de conversión alimenticia (g de alimento/g de pollo), en base a repeticiones de aves.

46


Rev Mex Cienc Pecu 2022;13(1):43-63

Cuadro 1: Formulación de alimentos compuestos y análisis químico Crecimiento (14– 28 días)

Finalización (29– 63 días)

C

E

C

E

49.92 15.00 4.00 19.85 2.00 4.40 1.32 1.73 0.34 0.15 0.24 0.05 1.00 100

44.14 15.00 4.00 22.00 2.00 3.00 5.00 1.50 1.62 0.34 0.15 0.20 0.05 1.00 100

44.26 16.00 4.00 24.00 2.00 5.00 1.30 1.70 0.34 0.15 0.20 0.05 1.00 100

47.00 10.00 3.80 24.00 2.00 3.00 5.46 1.40 1.60 0.34 0.15 0.20 0.05 1.00 100

90.18 21.80 5.44 4.59 1.33 0.43 0.91 0.81 1.47 2.15

90.16 21.87 6.06 4.93 1.34 0.41 0.91 0.81 1.68 3.09

90.00 19.12 6.97 4.64 0.99 0.38 0.91 0.81 1.36 2.01

90.11 19.20 7.40 4.61 1.13 0.39 0.92 0.82 1.56 2.82

Ácidos grasos (% de AGPI totales) Ácidos grasos saturados (AGS) 11.04 Ácidos grasos monoinsaturados (AGMI) 23.62 Ácidos grasos poliinsaturados (AGPI) 65.33 Ácido α-linolénico (AAL) 4.35 Ácidos grasos poliinsaturados omega-3 (ω-3) Ácidos grasos 4.46 poliinsaturados omega-6 (ω-6) 60.87 13.18 Energía metabolizable calculada (Mj / kg de MS)**

10.43 21.06 68.51 4.90 5.01 63.50 13.20

12.89 23.87 63.10 5.76 5.89 57.21 13.39

12.30 22.16 65.47 6.34 6.47 59.00 13.40

Maíz Trigo Gluten de maíz Harina de soya Harina de lino Harina de semillas de uva Aceite de girasol Fosfato monocálcico Carbonato de calcio Sal Metionina Lisina Colina Premezcla* Total Resultados del análisis químico (% de MS) Materia seca Proteína cruda Extractos de éter Fibra cruda Lisina Metionina Calcio Fósforo total Concentración de polifenoles totales (mg EAG/g) Capacidad antioxidante (mM TE/g)

*Contenido por kg de dieta: vitamina A: 11000 UI; vitamina D3: 2000 UI; vitamina E: 27 UI mg; vitamina K3: 3 mg; vitamina B1: 2 mg; vitamina B2: 4 mg; ácido pantoténico: 14.85 mg; ácido nicotínico: 27 mg; vitamina B6: 3 mg; vitamina B7: 0.04 mg; vitamina B9: 1 mg; vitamina B12: 0.018 mg; vitamina C: 20 mg; manganeso: 80 mg; hierro: 80 mg; cobre: 5 mg; zinc: 60 mg; cobalto: 0.37 mg; yodo: 1.52 mg; selenio: 0.18 mg. **La energía metabolizable se calculó a partir de la composición química

47


Rev Mex Cienc Pecu 2022;13(1):43-63

Muestreo y análisis químico

Se colectaron muestras de harina de linaza y harina de semilla de uva antes de la preparación de los alimentos y se determinó su composición química. Se colectaron muestras de los alimentos compuestos de crecimiento y finalización y se analizó su composición química básica, calcio, fósforo, lisina, metionina, perfil de ácidos grasos, concentración de polifenoles y capacidad antioxidante. Al final del período experimental (63 d de edad del pollo), se seleccionaron al azar seis pollos por grupo. Se recogieron muestras de sangre (n= 6), después de lo cual se sacrificaron los pollos, en tubos Vacutainer de 6 ml, en anticoagulante de heparina-litio. Las muestras de sangre se centrifugaron a 3,000 rpm, durante 20 min, a +22 °C. El plasma se almacenó a -80 °C hasta que se analizó. Se formaron seis muestras individuales de carne de pechuga y seis muestras individuales de carne de pierna. Cada muestra se dividió en tres. Se analizaron los ácidos grasos y el colesterol de una parte, una muestra se refrigeró (+4 °C) durante 7 d y posteriormente se analizaron los índices de degradación de la grasa (valor de peróxido y acidez de la grasa), y la tercera parte se congeló (-18 °C) durante un mes y posteriormente se analizaron los índices de degradación de la grasa (valor de peróxido y acidez de la grasa). La composición química básica de la harina de linaza, de la harina de semilla de uva y de los alimentos compuestos se determinó utilizando métodos estandarizados de acuerdo con el Reglamento (CE) núm. 152/2009. La materia seca (MS) se determinó mediante el método gravimétrico utilizando una balanza Sartorius (Gottingen, Alemania) y un armario de secado BMT, ECOCELL Blueline Comfort (Nuremberg, Alemania). La proteína cruda (PC) se determinó mediante el método Kjeldahl utilizando un sistema semiautomático KJELTEC auto 2300 – Tecator (Suecia). Los extractos de éter (EE) se determinaron mediante la extracción en disolventes orgánicos utilizando un sistema SOXTEC-2055 FOSS – Tecator (Suecia). La fibra cruda (FC) se determinó por el método con filtración intermedia utilizando un sistema FIBERTEC 2010 – Tecator (Suecia). La ceniza se determinó mediante el método gravimétrico utilizando un horno Caloris CL 1206. El calcio (Ca) se determinó por el método titrimétrico según la SR ISO 6491-1:2006. El fósforo (P) se determinó fotométricamente, según el Reglamento (CE) núm. 152/2009, utilizando el espectrofotómetro Jasco V-530. La lisina y la metionina de los alimentos compuestos se determinaron por el método de cromatografía líquida, de acuerdo con el Reglamento (CE) núm. 152/2009, utilizando un HPLC Finningan Surveyor Plus (Thermo-Electron Corporation, Waltham, EE. UU.), equipado con detector PDA (Photo Diode Array Detector, en español: Detector de Matriz de

48


Rev Mex Cienc Pecu 2022;13(1):43-63

Fotodiodos). Los aminoácidos se separan en una columna Hypersil BDS C18 con gel de sílice (250 × 4.6 mm), tamaño de partícula 5 μm, con fase inversa y una temperatura de +45 °C. Los resultados se expresaron en g de aminoácidos / 100 g de MS. Concentración de polifenoles y capacidad antioxidante de la harina de semilla de uva y los alimentos compuestos. Las muestras de harina de semilla de uva y las muestras de los alimentos compuestos se extrajeron primero en metanol acidificado (metanol: ácido clorhídrico = 80:20). La concentración de polifenoles en los extractos de metanol se determinó por el método espectrofotométrico(33), utilizando un espectrofotómetro UV-VIS Thermo Scientific. Los resultados se expresaron como mg equivalentes de ácido gálico /g de muestra (mg EAG/g de muestra). La capacidad antioxidante en los extractos de metanol se determinó por el método DPPH(34), utilizando un espectrofotómetro UV-VIS Analytik Jena Specord 250 Plus con carrusel termostático. Los resultados se expresaron en mM equivalentes de Trolox /g de muestra (mM ET/g de muestra). Perfiles metabólicos del plasma sanguíneo. Los parámetros bioquímicos sanguíneos se determinaron a partir de las muestras de plasma, utilizando un analizador bioquímico (Analyzer Chemistry Mindray BS - 130) con kits ACCENT - 200, de acuerdo con las instrucciones del fabricante. Perfil de ácidos grasos de los ingredientes del alimento, de los alimentos compuestos y de las muestras de carne. Se extrajo la grasa de las muestras de carne (pechuga y pierna), luego se saponificó por reflujo hirviendo en una solución de metanol acidificado (2 % de H2SO4 en metanol), para obtener los ésteres metílicos de ácidos grasos (EMAG). Los ésteres metílicos de ácidos grasos se añadieron al hexano y se concentraron en rotavapor. Las muestras resultantes se analizaron por el método de cromatografía de gases, según la SR CEN ISO/TS 17764-2:2008, utilizando un cromatógrafo Perkin Elmer-Clarus 500, equipado con un sistema para inyección en la columna capilar, con fase estacionaria de alta polaridad (BPX70: diámetros internos de 60m x 0.25mm y película de 0.25μm de grosor); o fases de cianopropil de alta polaridad, que tienen una resolución similar para diferentes isómeros geométricos (THERMO TR-EMAG: 120m x 0.25mm DI x película de 0.25μm). Nivel de colesterol en las muestras de carne. Para la saponificación de las muestras de carne, se inició con un método descrito por Dihn et al(35), adaptado en el laboratorio del estudio. Las muestras de carne (pechuga y pierna) se saponificaron por reflujo hirviendo en una solución de metanol e hidróxido de potasio (5 % de KOH en metanol), seguido de extracción en éter de petróleo, concentración en rotavapor y adición de cloroformo. Las muestras resultantes se analizaron por el método de cromatografía de gases, según la AOAC International(36), utilizando un cromatógrafo Perkin Elmer-Clarus 500, con inyector en columna (relación de división, aproximadamente 1:100), con calentador de columna programable; detector de

49


Rev Mex Cienc Pecu 2022;13(1):43-63

ionización de llama (DIL) y columna de separación capilar HP-5 (30m, 0.32mm DI, película de 0.1 μm) AGILENT. El valor de peróxido para las muestras de carne se determinó con el método yodométrico de acuerdo con la SR EN ISO 3960: 2017. Los resultados se expresaron en miliequivalentes/kg de grasa (meq/kg de grasa). La acidez de la grasa para las muestras de carne se determinó con el método volumétrico de acuerdo con la ISO 660:2009. Los resultados se expresaron en mg de hidróxido de potasio/g de grasa (mg de KOH/g de grasa).

Análisis estadístico

Los efectos de los tratamientos se analizaron mediante análisis de varianza unidireccional utilizando el procedimiento GLM del software Minitab(37) con el tratamiento como efecto fijo, según el modelo Yi = Ti + ei, donde Yi fue la variable dependiente, Ti es el tratamiento y ei es el error. Cuando la prueba F general fue significativa, las diferencias entre las medias se declararon significativas en P< 0.05 utilizando la prueba de comparación de Tukey.

Resultados Caracterización de la harina de linaza y la harina de semilla de uva

La harina de linaza, utilizada como ingrediente de alimento alto en ácidos grasos poliinsaturados (AGPI), tuvo: 344.4 g/kg de proteína, 109.7 g/kg de grasa y 20.20 MJ/kg de energía bruta. El perfil de ácidos grasos fue: 11.21 g de ácidos grasos saturados (AGS), 20.00 g de ácidos grasos monoinsaturados (AGMI), 68.73 g de ácidos grasos poliinsaturados (AGPI), de los cuales 53.35 g de AGPI ω-3, y 15.37 g de AGPI ω-6 / 100 g de EMAG, con una relación ω-6 / ω-3 de 0.29. El Cuadro 2 muestra la composición química básica, el perfil de ácidos grasos, la concentración de polifenoles y la capacidad antioxidante de la harina de semilla de uva utilizada como antioxidante natural en dietas altas en AGPI.

50


Rev Mex Cienc Pecu 2022;13(1):43-63

Cuadro 2: Contenido de los principales nutrientes de la harina de semilla de uva Especificación

Harina de semilla de uva

Materia seca, % Proteína cruda, % de MS Extractos de éter, % de MS Energía bruta, MJ/kg Concentración de polifenoles totales, mg EAG/g Capacidad antioxidante, mM ET/g Ácidos grasos (% de EMAG totales): AGS AGMI AGPI ω-3 ω-6

918.5 129.0 72.2 18.55 26.65 148.35 12.30 20.39 67.14 0.68 66.45

AGS= ácidos grasos saturados; AGMI= ácidos grasos monoinsaturados; AGPI= ácidos grasos poliinsaturados; ω-3- ácidos grasos poliinsaturados omega 3; ω-6- ácidos grasos poliinsaturados omega 6.

Caracterización de los alimentos compuestos

Los alimentos compuestos se desarrollaron en base a la composición química de los ingredientes del alimento, siendo isonitrogénicos e isocalóricos para cada fase de alimentación, de acuerdo con los requisitos de alimentación del híbrido Hubbard (Cuadro 1). Debido a la inclusión de 3 % de harina de semilla de uva, el alimento compuesto del grupo E tuvo una mayor concentración de polifenoles de 1.68 mg EAG (fase de crecimiento), 1.56 mg EAG (fase de finalización) respectivamente, en comparación con el alimento compuesto del grupo C, 1.47 mg EAG (fase de crecimiento), 1.36 mg EAG/g de dieta (fase de finalización) respectivamente. También se determinaron resultados más altos con respecto a la capacidad antioxidante del alimento compuesto del grupo E de 3.09 mM ET (fase de crecimiento) y 2.82 mM ET (fase de finalización), en comparación con el grupo C, que tuvo 2.15 mM ET (fase de crecimiento) y 2.01 mM ET/g de dieta (fase de finalización).

Rendimiento de las aves

El Cuadro 3 muestra el efecto del uso de un alimento compuesto con 3 % de harina de semilla de uva en el rendimiento de crecimiento de los pollos de engorda. Los valores para todo el

51


Rev Mex Cienc Pecu 2022;13(1):43-63

período experimental (14-63 días) fueron más altos para el grupo E que para el grupo C, para el peso final y la relación de conversión alimenticia. No se registraron muertes. Cuadro 3: Efecto del alimento compuesto con harina de semilla de uva en el rendimiento de pollos de engorda: 14-63 días (valores medios) Ítems C E EEM Valor P Ingesta promedio diaria de alimento, 114.2a 119.5a 3.89 0.497 g/pollo/día Peso inicial, g 233.3a 233.7a 3.88 0.962 a a Peso final, g 2545 2728.5 48.03 0.056 Ganancia promedio diaria de peso diario, 47.18a 50.70a 1.04 0.090 g/pollo/día Relación de conversión de alimentación, g 2.42a 2.35a 0.29 0.913 de alimento/g de ganancia Tasa de mortalidad, % 0.00 0.00 a-b

C= Control; E= Control + 3 % de harina de semilla de uva; EEM= Error estándar de la media. Los valores medios dentro de una fila que tienen diferentes superíndices son diferentes (P<0.05).

Perfil metabólico del plasma sanguíneo

El perfil metabólico del plasma sanguíneo, recogido a los 63 d de edad de los pollos (Cuadro 4), muestra un perfil energético significativamente (P<0.05) más bajo en el grupo E que en el grupo C. Así, la glucemia disminuyó en un 16.88 %, el colesterol en un 24.50 %, y los triglicéridos en un 34.90 %, en el grupo E, en comparación con el grupo C, siendo las diferencias estadísticamente significativas (P<0.05). Cuadro 4: Efecto del alimento compuesto con harina de semilla de uva en el perfil metabólico del plasma sanguíneo en pollos de engorda de 63 d de edad (valores medios) Ítems

C

E

Glucemia, mg/dl

271.03a

225.28b

a

b

Colesterol, mg/dl Triglicéridos, mg/dl a-b

146.82 49.93a

110.85 32.50b

EEM

Valor P

7.30 5.99 2.95

<0.0001 <0.0001 <0.0001

C= Control; E= Control + 3 % de harina de semilla de uva: EEM= Error estándar de la media. Los valores medios dentro de una fila que tienen diferentes superíndices son diferentes (P<0.05).

52


Rev Mex Cienc Pecu 2022;13(1):43-63

Concentración de ácidos grasos en la carne de pollos de engorda

La concentración de AGPI en las muestras de carne de pechuga (Cuadro 5) fue significativamente (P<0.05) mayor en el grupo E, que en el grupo C, en un 13.02 %. La concentración de AGPI ω-3, y de AGPI ω-6 aumentó en un 15.00 %, y en un 12.84 %, en el grupo E, en comparación con el grupo C (P<0.05). La concentración del ácido alfa linolénico (AAL) en la carne de pechuga fue de 1.89 g, en el grupo E, y de 1.82 g / 100 g de EMAG totales, en el grupo C (P>0.05). La concentración de AGPI en las muestras de carne de pierna (Cuadro 5) fue significativamente (P<0.05) mayor en el grupo E, que en el grupo C, en un 7.91 %. La concentración de AGPI ω–3 también fue mayor en el grupo E, que en el grupo C, en un 9.66 %, pero la diferencia no fue significativa (P>0.05). La concentración de AAL en la carne de pierna fue de 2.56 g en el grupo E, significativamente (P<0.05) superior a 1.97 g / 100 g de EMAG totales, en el grupo C. Cuadro 5: Efecto del alimento compuesto con harina de semilla de uva en la concentración de ácidos grasos en las muestras de carne de pollos de engorda (valores medios) Ácidos grasos (% de EMAG totales)

Carne de pechuga C

E

Carne de pierna Valor

EEM

a

a

P

C

E

EEM

a

b

Valor P

AGS AGMI AGPI, de los cuales:

32.48 39.09a

32.33 35.83b

0.21 0.54

0.736 < 0.001

30.97 38.40a

29.29 38.01a

0.33 0.29

0.027 0.517

27.73a

31.34b

0.62

0.0002

30.06a

32.44b

0.62

0.049

AAL

1.82a

1.89a

0.03

0.276

1.97a

2.56b

0.11

0.002

a

b

3.22 28.03b

0.08 0.55

0.003 0.0002

a

3.00 27.06a

a

3.29 29.14b

0.11 0.52

0.205 0.044

8.73a

0.13

0.475

9.02a

8.85a

0.19

0.656

ω-3 ω-6

2.80 24.84a

Relación ω-6 / ω-3 8.92a

EMAG=ésteres metílicos de ácidos grasos; C=Control; E= Control + 3 % de harina de semilla de uva; EEM= Error estándar de la media. AGS–ácidos grasos saturados; AGMI-ácidos grasos monoinsaturados; AGPI-ácidos grasos poliinsaturados; AAL-ácido α-linolénico; ω-3 -ácidos grasos poliinsaturados omega-3; ω-6- ácidos grasos poliinsaturados omega-6; a-b Los valores medios dentro de una fila que tienen diferentes superíndices son diferentes (P<0.05).

Nivel de colesterol en la carne de pollos de engorda

La concentración de colesterol en las muestras de carne de pechuga (Cuadro 6) fue menor en el grupo E, tratado con 3 % de harina de semilla de uva, que en el grupo C, pero la diferencia 53


Rev Mex Cienc Pecu 2022;13(1):43-63

no fue estadísticamente significativa (P>0.05). Para la carne de pierna, la concentración de colesterol fue un 30.2 % menor en el grupo E, en comparación con el C (P<0.05). Cuadro 6: Efecto del alimento compuesto con harina de semilla de uva en el nivel de colesterol en las muestras de carne de pollos de engorda (valores medios), (mg / 100 g de carne fresca) Carne de pechuga

Carne de pierna

C

E

EEM

Valor P

C

E

EEM

Valor P

44.28a

36.49a

2.05

0.052

60.91a

42.52b

3.76

0.006

a-b

C= Control; E= Control + 3 % de harina de semilla de uva; EEM= Error estándar de la media. Los valores medios dentro de una fila que tienen diferentes superíndices son diferentes (P<0.05).

Índices de degradación de grasa en la carne de pollos de engorda

En cuanto a los índices de degradación de grasa (Cuadro 7), el valor de peróxido de las muestras de carne de pechuga, determinado después de 7 días de refrigeración a +4 °C, fue de 8.11 meq/kg de grasa, en los grupos E, significativamente (P<0.05) inferior a 8.79 meq, en el grupo C. Sin embargo, después de un mes de congelación (-18 °C), sus valores fueron similares (P>0.05). La acidez de la grasa fue menor en el grupo E que en el grupo C, tanto después de 7 días de refrigeración (+4 °C) como después de un mes de congelación (-18 °C), pero la diferencia no fue estadísticamente significativa (P>0.05). El valor de peróxido de las muestras de carne de pierna (Cuadro 7) determinado después de 7 días de refrigeración (+4 °C), y después de un mes de congelación (-18 °C), fue similar en ambos grupos (P>0.05). Sin embargo, la acidez de la grasa después de 7 días de refrigeración (+4 °C), 40.82 mg de KOH / g de grasa, en el grupo E, fue significativamente (P<0.05) inferior a 43.99 mg de KOH / g de grasa, en el grupo C. Después de un mes de congelación (-18 °C), la disminución de la acidez de la grasa en el grupo E no fue significativa (P>0.05), en comparación con el grupo C.

54


Rev Mex Cienc Pecu 2022;13(1):43-63

Cuadro 7: Efecto del alimento compuesto con harina de semilla de uva en los índices de degradación de grasa en las muestras de carne de pollos de engorda (valores medios) Ítems Carne de pechuga Período Valor de peróxido, meq/kg de grasa Acidez de la grasa, mg de KOH/g de grasa Valor de peróxido, meq/kg de grasa Acidez de la grasa, mg de KOH/g de grasa

Día 7refrigeración

1 mescongelación

C

E

EEM

Valor P

8.79a

8.11b

0.12

0.0002

36.42a

36.44a

0.01

0.955

5.08a

5.15a

0.02

0.161

20.89a

20.30a

0.37

0.442

11.25a

11.10a

0.13

0.589

43.99a

40.82b

0.52

<0.0001

6.39a

6.23a

0.04

0.043

24.23a

23.72a

0.26

0.410

Carne de pierna Valor de peróxido, meq/kg de grasa Acidez de la grasa, mg de KOH/g de grasa Valor de peróxido, meq/kg de grasa Acidez de la grasa, mg de KOH/g de grasa a-b

Día 7refrigeración

1 mescongelación

C= Control; E= Control + 3 % de harina de semilla de uva; EEM= Error estándar de la media. Los valores medios dentro de una fila que tienen diferentes superíndices son diferentes (P<0.05).

Discusión Los resultados sobre la harina de linaza utilizada como ingrediente de alimento alto en AGPI están de acuerdo con los de Panaite et al(11), quienes reportaron valores de: 32.99 % de proteína, 9.42 % de grasa, 19.31 MJ / kg de energía bruta, 11.07 g de AGS, 18.71 g de AGMI, 70.23 g de AGPI, de los cuales, 42.93 g de AGPI ω-3 y 27.30 g de AGPI ω-6 / 100 g de EMAG, y una relación ω-6 / ω-3 de 0.64. La concentración de polifenoles y la capacidad antioxidante de la harina de semilla de uva, utilizada como antioxidante natural, coinciden con las de Turcu et al(29), quienes estudiaron el efecto de 2 % de harina de semilla de uva proporcionada a pollos de engorda Ross 308 y reportaron 28.08 mg EAG/g de muestra, y 145.83 mM equivalentes de Trolox/g de muestra, capacidad antioxidante. La eficiencia de los antioxidantes naturales depende de su

55


Rev Mex Cienc Pecu 2022;13(1):43-63

composición química que, a su vez, depende de la variedad de uvas, el tipo de suelo, los factores agroclimáticos y las técnicas de vinificación(38). El uso de 2 % de harina de linaza, alta en AGPI, en los alimentos compuestos para pollos de engorda Hubbard, produjo valores cercanos del perfil de ácidos grasos tanto en la fase de crecimiento como en la de finalización. Como se esperaba, el uso de 3 % de harina de semilla de uva como antioxidante natural, en la formulación para el grupo E, aumentó la concentración de polifenoles y la capacidad antioxidante, en comparación con la formulación de alimento para el grupo C, en ambas etapas. Así, la concentración de polifenoles fue un 14.28 % superior y la capacidad antioxidante fue un 43.72 % superior para la etapa de crecimiento, y un 14.70 % y un 40.29 % superior, respectivamente, para la etapa de finalización. Estos resultados concuerdan con los reportados por Vlaicu et al(28), quienes estudiaron el efecto de 2 % de harina de semilla de uva administrada a pollos de engorda Ross 308 (etapa de crecimiento) y reportaron una concentración 54.31 % mayor de polifenoles. El rendimiento de los pollos de engorda durante todo el período experimental muestra que el uso de harina de semilla de uva en la formulación de los alimentos compuestos para el grupo E no tuvo efectos adversos en los pollos, las diferencias con respecto al grupo de control no fueron estadísticamente significativas (P>0.05). Los valores del perfil energético del plasma sanguíneo (glucemia, colesterol, triglicéridos) (Cuadro 4) fueron significativamente (P<0.05) más bajos en el grupo E que en el grupo de control. El colesterol en sangre más bajo podría deberse al contenido de flavonoides de la harina de semilla de uva, que inhibe la formación de micelios dentro del intestino delgado, reduciendo así la absorción del colesterol intestinal(39). Los resultados aquí observados sobre el perfil sanguíneo concuerdan con los reportados por Abu Hafsa e Ibrahim(40), quienes evaluaron el efecto del polvo de semilla de uva en la dieta (0; 10; 20 y 40 g/kg) proporcionado a pollos de engorda Cobb 500. Reportaron disminuciones en los siguientes parámetros sanguíneos: glucosa, de 188.42 mg/dl en el grupo C, a 151.39 mg/dl, en el grupo con 40 g de polvo de semilla de uva; colesterol, de 122.46 mg/dl, en el grupo C, a 95.88 mg/dL, en el grupo con 40 g de polvo de semilla de uva; triglicéridos de 67.46 mg/dL, en el grupo C, a 60.75 mg/dl, en el grupo con 40 g de polvo de semilla de uva. Khodayari y Habib(26) estudiaron el efecto de varios niveles de orujo de uva en la dieta (0, 2, 4 y 6 %) administrados a pollos de engorda Ross 308, en el rendimiento de los pollos, la peroxidación lipídica y los parámetros bioquímicos de la sangre, e informaron la disminución de los triglicéridos en sangre de 52.00 mg/dL, en el grupo C, a 35.33 mg/dl, en el grupo con un 6 % de orujo de uva en la dieta. El colesterol en sangre disminuyó de 163.33 mg/dl, en el grupo C, a 129.33 mg/dl, en el grupo con un 6 % de orujo de uva en la dieta. El hecho de que este estudio revelara valores más bajos de glucemia, colesterol y triglicéridos en sangre en el grupo E, muestra un mejor estado de salud de esos pollos, en comparación

56


Rev Mex Cienc Pecu 2022;13(1):43-63

con el grupo testigo, debido a la harina de semilla de uva añadida, como antioxidante, a la dieta alta en ácidos grasos poliinsaturados. La carne de pollo de engorda mejorada en AGPI, particularmente en AGPI ω-3, ha establecido efectos benéficos para la salud del consumidor(4). Kamboh y Zhu(41) muestran cambios en la proporción de ácidos grasos (disminución de AGS y aumento de AGPI), cuando las dietas de pollos de engorda se trataron con bioflavonoides. La diferencia significativa (P<0.05) de la concentración de AGPI de la carne de pechuga en el grupo E, puede explicarse por el hecho de que la harina de semilla de uva de la dieta, debido a sus propiedades antioxidantes dadas por el contenido de polifenoles y flavonoides, ralentizó las reacciones de degradación lipídica(42,43). Otro trabajo(44) mostró los efectos positivos de los subproductos de bodega en la prevención de la oxidación de los AGPI de la carne de pollo de engorda. Estudiaron el uso de un extracto de semillas de uva y cebolla, solo o en combinación con vitamina E, en las formulaciones dietéticas para pollos de engorda Ross expuestos al calor, e informaron valores más altos de AGPI en la carne de pechuga de pollo, en comparación con el grupo de control. También se reportó la concentración significativamente (P<0.05) mayor de AGPI ω-3 en la carne de pechuga del grupo E, reportada en el presente estudio(29). Mediante la adición de un 2 % de harina de linaza y un 2 % de harina de semilla de uva a la dieta de pollos de engorda Ross 308, la concentración de AGPI ω-3 fue un 11.14 % mayor en el grupo experimental que en el grupo de control. La concentración de AGPI en la carne de pierna fue significativamente (P<0.05) diferente en el grupo E que en el grupo C. Al igual que para las muestras de carne de pechuga, para la muestra de carne de pierna también, esto puede explicarse por el hecho de que la harina de semilla de uva de la dieta, por sus propiedades antioxidantes dadas por el contenido de polifenoles y flavonoides, ralentizó las reacciones de degradación lipídica(42,43). También se reportaron concentraciones de AGPI significativamente (P<0.05) más altas en un 19.38 % y un 20.02 %, en comparación con el grupo de control, en los grupos de pollos de engorda Ross 308 tratados con 2 % y 4 % de harina de semilla de uva, respectivamente(28). Otros equipos de investigadores(27) estudiaron el efecto de otro subproducto de bodega, el orujo de uva, proporcionado a pollos de engorda en cantidades de: 0 %, 5 % y 10 %, reportando aumentos de la concentración de AGPI en la carne de pierna de pollo, de 37.0 g, en el grupo C, a 47.4 g, en el grupo tratado con 5 % de orujo de uva, y a 53.1 g / 100 g de ácidos grasos totales, en el grupo tratado con un 10 % de orujo de uva. El ácido alfa linolénico (AAL) es un ácido graso esencial porque no puede ser sintetizado por el organismo, siendo el alimento la fuente principal. En este estudio, la concentración de AAL en las muestras de carne de pierna de pollo de engorda fue significativamente (P<0.05) mayor en el grupo E que en el grupo C, como también informaron Chamorro et al(27), quienes utilizaron orujo de uva en las formulaciones de la dieta para pollos de engorda Cobb. 57


Rev Mex Cienc Pecu 2022;13(1):43-63

Como se sabe, el colesterol es un componente de las grasas, que desempeña un papel importante en la formación de hormonas y en el metabolismo de las vitaminas. La síntesis de colesterol en el hígado puede modificarse mediante la adición de derivados de grasas animales. Recientemente, la educación e investigación en seguridad alimentaria aumentó la conciencia del consumidor sobre los efectos del colesterol de los alimentos en la salud(4). La nutrición puede ser utilizada para modificar el perfil de los ácidos grasos, para disminuir la proporción ω-6 / ω-3, y el nivel de colesterol(10). El nivel de colesterol en las muestras de carne de pechuga y pierna de pollo de engorda fue menor en el grupo E, tratado con harina de semilla de uva. Sin embargo, solo para la carne de pierna, la disminución fue estadísticamente significativa: 30.19 %, puede deberse al alto contenido de lípidos en la carne de pierna. Estos resultados contrastan con los reportados por Yong et al(45), quienes estudiaron el efecto de agregar 0; 0.25 y 0.5 % de harina de uva a las dietas de pollos de engorda en el nivel de colesterol en la carne de pollo. Observaron que el contenido de colesterol de la carne de muslo y pechuga no fue afectado significativamente por la suplementación con harina de uva. El efecto antioxidante del extracto de semilla de uva fue investigado por Farahat et al(46), quienes lo utilizaron en concentraciones de 125 ppm a 2,000 ppm, en dietas de pollos de engorda, y reportaron valores más bajos de colesterol total que en los pollos tratados con antioxidante sintético, BHT. Los índices de degradación lipídica mostraron valores más bajos en la carne de pechuga y pierna del grupo E, tanto después de 7 días de refrigeración como después de un mes de congelación. Sin embargo, la disminución fue significativa solo para los 7 días de refrigeración: el valor de peróxido de la muestra de carne de pechuga fue un 7.73 % menor, en comparación con el grupo C, y la acidez de la grasa de la carne de pierna fue un 7.21 % menor, en comparación con el grupo C. Olteanu et al(47) informaron efectos similares, es decir, valores más bajos de acidez de grasa después de 7 días de refrigeración de las muestras de carne de Cobb 500, tratadas con un 2 % de harina de semilla de uva añadida a las formulaciones de la dieta alta en AGPI, pero las diferencias con respecto al grupo de control no fueron estadísticamente significativas. Los datos disponibles de la literatura incluyen información diversa sobre la capacidad de la harina de uva para ralentizar los procesos de peroxidación lipídica de la carne de pollo de engorda. Chamorro et al(27) estudiaron el efecto del orujo de uva de la dieta, y reportaron un aumento de la estabilidad oxidativa de la carne de pierna de pollo de engorda después de 1 y 4 días de refrigeración, con el aumento del orujo de uva en la dieta por niveles decrecientes de MDA. Los resultados obtenidos mostraron diferencias significativamente menores (P<0.05) de 0.217 μg (C) a 0.112 μg (5 % de OU) y 0.114 μg/g de carne (10 % de OU) después de 4 días de refrigeración. Kasapidou et al(48) concluyeron que el orujo de uva en la dieta (2.5 % y 10 %) no influyó en la oxidación lipídica de las muestras de carne de pollo de engorda (pechuga y muslo) durante 2-5 días de refrigeración. Además, se encontró que los antioxidantes mejoraron la calidad de la carne de codorniz japonesa y retrasaron la rancidez oxidativa(49). 58


Rev Mex Cienc Pecu 2022;13(1):43-63

Los resultados obtenidos en este estudio muestran que la harina de semilla de uva, un subproducto de bodega con un precio más bajo, puede ser utilizada como antioxidante natural y no tóxico en las dietas de pollos de engorda, reemplazando a los antioxidantes sintéticos como el hidroxitolueno butilado (BHT) y el hidroxianisol butilado (BHA)(45).

Conclusiones e implicaciones La inclusión de 3 % de harina de semilla de uva, como antioxidante natural, en las dietas de pollos de engorda Hubbard altas en ácidos grasos poliinsaturados no afectó el rendimiento de los pollos. La calidad alimenticia de la carne de pollo (pechuga y pierna) mejoró por los niveles más altos de AGPI totales y AGPI omega-3, y por el nivel más bajo de colesterol. El estado de salud de los pollos también mejoró por las concentraciones más bajas de colesterol y triglicéridos en la sangre. Estos resultados destacan las propiedades antioxidantes del aditivo vegetal de la industria vitivinícola. La harina de semilla de uva añadida a las dietas de pollo altas en ácidos grasos poliinsaturados permitió la producción de alimentos inocuos de impacto benéfico en la salud humana. Agradecimientos Este estudio fue financiado por el Ministerio de Investigación e Innovación de Rumania a través del Programa 1 – Desarrollo de Investigación-Desarrollo Nacional, Subprograma 1.2 – Desempeño Institucional – Proyectos que financian la excelencia en I + D, Contrato núm. 17 PFE/ 17.10.2018 y el proyecto PN 1641_02.04, Contrato 24 N / 2016, programa NUCLEUS. Literatura citda: 1. Tougan PU, Dahouda M, Salifou CFA, Ahounou SGA, Kpodekon MT, Mensah GA, et al. Conversion of chicken muscle to meat and factors affecting chicken meat quality. A review. IJAAR 2013;3(8):1-20. 2. Fanatico AC, Pillai PB, Emmert JL, Gbur EE, Meullenet JF, Owens CM. Sensory attributes of slow-and fast-growing chicken genotypes raised indoors or with outdoor access. Poult Sci J 2007;86(11):2441–2449. 3. Napolitano F, Castellini C, Naspetti S, Piasentier E, Girolami A, Braghieri A. Consumer preference for chicken breast may be more affected by information on organic production than by product sensory properties. Poult Sci J 2013;92(3):820–826. 4. Attia YA, Al-Harthi MA, Korish MM, Shiboob MM. Fatty acid and cholesterol profiles, hypocholesterolemic, atherogenic, and thrombogenic indices of broiler meat in the retail market. Lipids Health Dis 2017;16:40:1-11.

59


Rev Mex Cienc Pecu 2022;13(1):43-63

5. Colussi G, Catena C, Novello M, Bertin N, Sechi LA. Impact of omega-3 polyunsaturated fatty acids on vascular function and blood pressure: relevance for cardiovascular outcomes. Nutr Metab Cardiovasc Dis 2017;27(3):191-200. 6. Tortosa-Caparrós E, Navas-Carrillo D, Marín F, Orenes-Piñero E. Anti-inflammatory effects of omega 3 and omega 6 polyunsaturated fatty acids in cardiovascular disease and metabolic syndrome. Crit Rev Food Sci Nutr 2017;57(16):3421-3429. 7. Shahidi F, Ambigaipalan P. Omega-3 polyunsaturated fatty acids and their health benefits. Annu Rev Food Sci Technol 2018;9:345-381. 8. Criste RD, Panaite TD, Ciurescu G, Ropota M, Rachieru D. Effects of moderate (5%) levels of linseed in layer diets. Arch C Zootech 2009;12(3):11-21. 9. Ahmad S, Ahsan-ul-Haq YM, Kamran Z, Sohail MU. Effect of feeding whole linseed as a source of polyunsaturated fatty acids on performance and egg characteristics of laying hens kept at high ambient temperature. Braz J Poultr Sci 2013;15(1):21-25. 10. Mridula D, Kaur D, Nagra SS, Barnwal P, Gurumayum S, Kumar SK. Growth performance and quality characteristics of flaxseed-fed broiler chicks. J Appl Anim Res 2015;43(3):345–351. 11. Panaite TD, Criste RD, Ropota M, Criste V, Vasile G, Olteanu M, et al. Determination of the feeding value of food industry by-products. Sci Papers Anim Sci Series 2016;66 (21):106-111. 12. Kumar F, Tyagi PK, Mir NA, Biswas AK, Dev K, Tyagi PK, et al. Optimizing of time duration of flaxseed meal feeding for optimum growth performance, carcass characteristics, and cost economics of broiler chicken meat production. Indian J Poult Sci 2018;53(1):44-48. 13. Leung H, Arrazola A, Torrey S, Kiarie E. Utilization of soy hulls, oat hulls, and flax meal fiber in adult broiler breeder hens. Poult Sci J 2018;97(4):1368-1372. 14. Pekel AY, Kim JI, Chapple C, Adeola O. Nutritional characteristics of camelina meal for 3-week-old broiler chickens. Poult Sci J 2015;94(3):371–378. 15. Woyengo TA, Patterson R, Slominski BA, Beltranena E, Zijlstra RT. Nutritive value of cold-pressed camelina cake with or without supplementation of multi-enzyme in broiler chicken. Poult Sci J 2016;95(10):2314–2321. 16. Thacker P, Widyaratne G. Effects of expeller pressed camelina meal and/or canola meal on digestibility, performance and fatty acid composition of broiler chickens fed wheat– soybean meal-based diets. Arch Anim Nutr 2012;66(5):402–415.

60


Rev Mex Cienc Pecu 2022;13(1):43-63

17. An BK, Jung JH, Oh ST, Kang CW, Lee KW, Lee SR. Effects of diets with graded levels of canola meal on the growth performance, meat qualities, relative organ weights, and blood characteristics of broiler chickens. Braz J Poultr Sci 2016;18(2):351-356. 18. Ashayerizadeh A, Dastar B, Shams Shargha M, Sadeghi Mahoonak AR, Zerehdaranc S. Effects of feeding fermented rapeseed meal on growth performance, gastrointestinal microflora population, blood metabolites, meat quality, and lipid metabolism in broiler chickens. Livestock Sci 2018;216:183-190. 19. Recoules E, Lessire M, Labas V, Duclos MJ, Combes-Soia L, Lardic L, et al. Digestion dynamics in broilers fed rapeseed meal. Sci Rep 2019;9:3052. 20. Ren Y, Perez TI, Zuidhof MJ, Renema RA, Wu J. Oxidative stability of omega-3 polyunsaturated fatty acids enriched eggs. J Agric Food Chem 2013;61(47):1159511602. 21. Radovanovic A, Radovanovic B, Jovancicevic B. Free radical scavenging and bacterial activities of southern Serbian red wines. Food Chem 2009;117(2):326–331. 22. Granato D, Castro IA, Katayama FCU. Assessing the association between phenolic compounds and the antioxidant activity of Brazilian red wines using chemometrics. LWT - Food Sci Technol 2009;43(10):1542–1549. 23. Deng Q, Penner MH, Zhao Y. Chemical composition of dietary fiber and polyphenols of five different varieties of wine grape pomace skins. Food Res Int 2011;44(9):2712– 2720. 24. Olteanu M, Criste RD, Panaite TD, Ropota M, Mitoi M, Varzaru I, et al. Study of the feeding value and antioxidant capacity of winery by-products, potential natural antioxidants for farm animal diet formulations. Arch Zootech 2014;17(2):55-69. 25. Sossidou EN, Kasapidou E, Dotas V, Ioannidis I. Mitlianga P. Effect of grape pomace supplementation on broiler performance and eating quality. The 64th Annual Meeting of the European Federation of Annim Scie 2013;26-30 august, Nantes, France. 26. Khodayari F, Habib AS. The Effect of Red Grape pomace on Performance. Lipid peroxidation (MDA) and some serum biochemical parameters in broiler. Adv Biomed Res 2014;5(3):82-87. 27. Chamorro S, Viveros A, Rebole A, Rica BD, Arija I, Brenes A. Influence of dietary enzyme addition on polyphenol utilization and meat oxidation of chicks fed grape pomace. J Food Res Int 2015;73:197-203.

61


Rev Mex Cienc Pecu 2022;13(1):43-63

28. Vlaicu PA, Panaite TD, Dragotoiu D, Ropota M, Bobe E, Olteanu M, et al. Feeding quality of the meat from broilers fed with dietary food industry by-products (flaxseed, rapeseeds and buckthorn meal, grape pomace). Sci Papers Series D Anim Sci 2017;LX: 123-130. 29. Turcu RP, Olteanu M, Criste RD, Ropota M, Panaite TD, Soica C, et al. The effect of using grape seeds meal as natural antioxidant in broiler diets enriched in fatty acids, on meat quality. J Hygienic Eng Design 2018;25:14-20. 30. Brenes A, Viveros A, Chamorro S, Arija I. Use of polyphenol-rich grape by-products in monogastric nutrition. A review. Anim Feed Sci Tech 2016; 211:1–17. 31. Chamorro S, Romero C, Brenes A, Sánchez-Patán F, Bartolomé B, Viveros A, Arijad I. Impact of a sustained consumption of grape extract on digestion, gut microbial metabolism and intestinal barrier in broiler chickens. Food Funct 2019;10:1444-1454. 32. HUBBARD CLASSIC – Broiler Management, www.hubbardbreeders.com. 33. Mihailović V, Matić S, Mišić D, Solujić S, Stanić S, Katanić J, et al. Chemical composition, antioxidant and antigenotoxic activities of different fractions of Gentiana asclepiadea L. roots extract. EXCLI J 2013;12:807-823. 34. Marxen K, Vanselow KH, Lippemeier S, Hintze R, Ruser A, Hansen UP. Determination of DPPH radical oxidation caused by methanolic extracts of some microalgal species by linear regression analysis of spectrophotometric measurements. Sensors 2007;7(10):2080-2095. 35. Dinh TTN, Thompson LD, Galyean ML, Brooks JC, Patterson KY, and Boylan LM. Cholesterol content and methods for cholesterol determination in meat and poultry. Compr Rev Food Sci 2011;10(5):269-289. 36. AOAC. Official methods of analysis. 99410: Cholesterol in food. 20th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 2016. 37. GLM procedure of Minitab software, version 16, Minitab® Statistical Software. 38. Pintać D, Majkića T, Torović L, Orčića D, Beara I, Simina N, et al. Solvent selection for efficient extraction of bioactive compounds from grape pomace. Ind Crops Prod 2018;111:379–390. 39. Vermeer MA, Mulder TPJ, Molhuizen HOF. Theaflavins from black tea, especially theaflavin-3-gallate, reduce the incorporation of cholesterol into mixed micelles. J Agric Food Chem 2008;56(24):12031-12036.

62


Rev Mex Cienc Pecu 2022;13(1):43-63

40. Abu Hafsa SH, Ibrahim SA. Effect of dietary polyphenol-rich grape seed on growth performance, antioxidant capacity and ileal microflora in broiler chicks. J Anim Physiol Anim Nutr 2018;102(1):268–275. 41. Kamboh AA, Zhu WY. Effect of increasing levels of bioflavonoids in broiler feed on plasma anti-oxidative potential, lipid metabolites, and fatty acid composition of meat. Poult Sci J 2013;92(2):454–461. 42. Brenes A, Viveros A, Goni I, Centeno C, Sayago-Ayerdy SG, Arija I. Effect of grape pomace concentrate and vitamin E on digestibility of polyphenols and antioxidant activity in chickens. Poult Sci J 2008;87(2):307-316. 43. Goñi I, Brenes A, Centeno C, Viveros A, Saura-Calixto F, Rebole A, Arija I, Estevez R. Effect of dietary grape pomace and vitamin e on growth performance, nutrient digestibility and susceptibility to meat lipid oxidation in chickens. Poult Sci J 2007;86 (3):508–516. 44. Mazur-Kusnirek M, Antoszkiewicz Z, Lipiński K, Kaliniewicz J, Kotlarczyk S, Żukowski P. The effect of polyphenols and vitamin E on the antioxidant status and meat quality of broiler chickens exposed to high temperature. Arch Anim Nutr 2019;73(2):111-126. 45. Yong HI, Kim HJ, Jung S, Jayasena DD, Bae YS, Lee SK. et al. Effect of dietary supplementation of wild grape on the antioxidative potential of the breast and leg meat of broilers. Korean J Food Sci Anim Resour 2013;33(1):83-88. 46. Farahat MH, Abdallah FM, Ali HA, Hernandez-Santana A. Effect of dietary supplementation of grape seed extract on the growth performance, lipid profile, antioxidant status and immune response of broiler chickens. Animal 2017;11(5):771777. 47. Olteanu M, Criste RD, Panaite TD, Ropota M, Vlaicu PA, Turcu RP. Bioproductive parameters and fatty acids profile of the meat from broilers treated with flax meal and grape seeds meal. Sci Papers Anim Sci Biotech 2017;50(1):15-21. 48. Kasapidou E, Sossidou EN, Zdragas A, Papadaki C, Vafeas G, Mitlianga P. Effect of grape pomace supplementation on broiler meat quality characteristics. Europ Poult Sci 2016;80. doi:10.1399/eps.2016.135. 49. Attia YA, Abd El-Hamid E. Abd El-Hamid, Nagadi SA, Oliveira MC, Bovera F, Habiba HIA. Dietary distilled fatty acids and antioxidants improve nutrient use and performance of Japanese male quails. Anim Sci Pap Rep 2019;1(37):65-74.

63


https://doi.org/10.22319/rmcp.v13i1.5932 Artículo

Factores asociados a indicadores de crianza de reemplazos bovinos durante el periodo de lactancia en unidades lecheras de pequeña escala

Fernando Villaseñor González a Eliab Estrada Cortés a Lilia del Rocío Montes Oceguera b Héctor Raymundo Vera Ávila c Luis Javier Montiel Olguín d Héctor Jiménez Severiano d Mario Alfredo Espinosa Martínez d*

a

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Campo Experimental Centro-Altos de Jalisco. Km 8, Carr. Libre Tepatitlán-Lagos de Moreno, Av. Biodiversidad No. 2470. Tepatitlán de Morelos, Jalisco, México. b

Universidad de Guadalajara-CU Altos. Jalisco, México.

c

Universidad Autónoma de Querétaro. Facultad de Ciencias Naturales. Querétaro, México.

d

INIFAP-Centro Nacional de Investigación Disiciplinaria en Fisiología y Mejoramiento Animal. Querétaro, México.

*Autor de correspondencia: espinosa.mario@inifap.gob.mx

Resumen: El objetivo fue evaluar el impacto de factores asociados al manejo de la madre y la calidad del calostro sobre la crianza de reemplazos bovinos durante la lactancia, en el sistema de producción de leche a pequeña escala. En 13 unidades de producción se obtuvo información del crecimiento corporal, la alimentación con calostro e información asociada a la madre de 64


Rev Mex Cienc Pecu 2022;13(1):64-81

220 becerras Holstein. Las variables de interés fueron: morbilidad, concentración de inmunoglobulinas en el calostro (CIC; <110 mg/ml), concentración de proteína sérica (CPS; <6.6 g/dl), ganancia diaria de peso (GDP; <0.650 kg/día) y ganancia diaria de altura (GDA; <0.222 cm/día). Los factores de estudio fueron: peso corporal al nacimiento (PCN; <42 kg), altura al nacimiento (AN; <82 cm), calostro consumido el primer día (CCPD; <4 l), calostro consumido el primer día/kg de PV (CPDPV), condición corporal al parto (CCP; <3), duración del periodo seco (DPS; >68 días), vacas primíparas (VP) y vacas sin dieta de reto (VSDR). Para determinar el impacto de los factores de estudio sobre los eventos de interés, se obtuvo la razón de momios a partir de análisis de regresión logística múltiple. Los factores identificados para morbilidad fueron CCPD y VP (P<0.1). Los factores para CIC fueron la DPS y VSDR (P<0.1), mientras que para la GDP lo fue VSDR (P<0.1). Finalmente, los factores para GDA fueron VSDR, PCN, AN y CPDPV (P<0.1). Estos resultados sugieren que la nutrición de la madre durante la gestación tardía tiene un impacto importante sobre la salud y el desarrollo corporal de las becerras durante la lactancia. Estudios adicionales deberán determinar los efectos a largo plazo. Palabras clave: Calostro, Becerras, Morbilidad, Crecimiento.

Recibido: 29/01/2021 Aceptado: 05/07/2021

Introducción La fase más crítica para la sobrevivencia de una becerra lechera se presenta en sus primeras semanas de vida, y los eventos ocurridos en este periodo pueden afectar su desempeño productivo y reproductivo en el futuro(1,2,3). En sistemas altamente tecnificados y de producción a pequeña escala, los mayores índices de morbilidad y mortalidad en las becerras se presentan entre el nacimiento y el destete debido, principalmente, a problemas de diarreas y neumonías(3,4,5). Estudios generados en el sistema tecnificado reportan durante la etapa de lactancia tasas de mortalidad y morbilidad de hasta el 6 y 38 %, respectivamente(6,7,8). Algunos factores de riesgo asociados a esta mortalidad y morbilidad en las becerras son la baja calidad del calostro(9), una administración tardía del calostro(10), distocia y condición corporal de la madre previo al parto(11), bajo peso al nacimiento, una baja concentración de IgG en suero, enfermedades durante el periodo previo al destete y un bajo consumo de grasa en la dieta líquida(12). Sin embargo, en el sistema de producción de leche a pequeña escala en México, las condiciones productivas y de manejo son diferentes a las de los sistemas

65


Rev Mex Cienc Pecu 2022;13(1):64-81

tecnificados; existe una menor eficiencia en el proceso de crianza(4), los niveles de producción de leche son menores(13), el manejo nutricional es deficiente(14) y el desempeño reproductivo está por debajo de lo óptimo(15). Estas diferencias permiten cuestionar, si los factores de riesgo reportados en el sistema tecnificado impactan de la misma manera los indicadores de crianza en el sistema de producción a pequeña escala. La determinación de estos factores en este último sistema, permitiría implementar o diseñar estrategias específicas para establos bajo este sistema de producción, con la finalidad de mejorar la crianza de becerras. Por lo tanto, el objetivo de este estudio fue identificar factores asociados a indicadores de la crianza de becerras, en los sistemas de producción de leche a pequeña escala. La hipótesis de trabajo es que existen factores de riesgo individuales de las becerras, de la madre y del calostro, asociados con el desempeño de las becerras durante la etapa de lactación en este sistema de producción

Material y métodos Ubicación

El estudio fue realizado en la región de Los Altos de Jalisco Sur (20º 52’ N), en los municipios de Valle de Guadalupe, San Ignacio Cerro Gordo y Tepatitlán de Morelos. En esta región se mantiene un clima templado subhúmedo, con una temperatura promedio anual de 17.8 ºC y una precipitación promedio anual de 817 mm(16).

Captura de información

Durante un periodo de nueve meses, se obtuvo información generada de 220 becerras Holstein de 13 unidades de producción de leche con características del sistema familiar de la región de Los Altos de Jalisco. La selección de establos fue por una muestra por conveniencia con los siguientes criterios de selección: mano de obra como soporte operativo principal de la unidad de producción, producción de leche como objetivo primario del establo, un rango de vientres en producción entre 10 y 100 y niveles medio-bajo de tecnificación. Con estos criterios, las unidades cumplieron con las características de establos familiares de la región(17,18). Con apoyo de un médico veterinario zootecnista, con años de experiencia de trabajo en práctica clínica en la región, y familiarizado por su participación en estudios previos con la toma de muestras, mediciones y captura de información necesaria, las becerras se monitorearon desde el nacimiento hasta el destete (71.6 ± 1.1 días), obteniendo diferentes

66


Rev Mex Cienc Pecu 2022;13(1):64-81

indicadores de crecimiento: peso al nacimiento, peso al destete, altura al nacimiento y altura al destete. A partir de estos valores se estimó la ganancia diaria de peso al destete (GDP) y la ganancia diaria de altura al destete (GDA). Para estimar el peso corporal, se empleó una cinta métrica específica para becerras Holstein (Dairy Calf Tape, Coburn Co., Whitewater WI), midiendo su circunferencia torácica por detrás de las escápulas, mientras que, para registrar la altura a la cruz, se empleó una regla somatométrica (Nasco, Whitewater WI). Por otro lado, se registró información sobre eventos asociados al parto de las madres de las becerras, duración del periodo seco, condición corporal al parto, número de parto y si la madre recibió dieta de reto previo al parto (recibían concentrado en las 2 a 3 semanas previas al parto, independientemente de su composición nutricional). Para estimar la condición corporal al parto, se consideró una escala de 1 a 5, donde un valor de 1 corresponde a un animal en estado de emaciación y un valor de 5 a un animal obeso(19). Adicionalmente, se registró el consumo de calostro por la becerra en la primera toma y el primer día, el tiempo transcurrido desde el nacimiento y hasta la primera toma de calostro, la calidad del calostro (mg/ml) y la cantidad de proteína sérica (g/dl) en las becerras a las 48 h de nacida. Para determinar la calidad del primer calostro posparto, una muestra de aproximadamente 250 ml fue colectada y colocada en baño María a una temperatura de 22 ºC; una vez alcanzada esta temperatura, el calostro se depositó en una probeta y mediante un calostrómetro (Biogenics, Mapleton OR) se hizo la lectura de la cantidad de inmunoglobulinas presentes (mg/ml). La concentración de proteína sérica total en la becerra, como indicadora de falla de transferencia de inmunidad pasiva se determinó en una muestra de sangre obtenida de la vena yugular a las 48 h de nacida; la muestra se centrifugó a 2,500 rpm durante 15 min y el suero obtenido se mantuvo en congelación (-20 ºC) hasta su análisis por refractometría. Para ello, mediante una pipeta Pasteur se tomó una gota del suero que fue mantenido a temperatura ambiente (22 ºC) y se depositó en el prisma de un refractómetro portátil (Danoplus, Mod. RETK-70), con compensación automática de temperatura y un rango de lectura de 0-12 g/dl, procurando cubrir completamente la superficie y evitando la formación de burbujas de aire que pudieran distorsionar la lectura de los resultados. El refractómetro se enfocó a una fuente de luz y la lectura obtenida fue registrada. Previo a su uso, el refractómetro se calibró empleando agua destilada y ajustando el tornillo calibrador, de acuerdo a instrucciones del fabricante.

67


Rev Mex Cienc Pecu 2022;13(1):64-81

Eventos de interés

Los eventos de interés seleccionados fueron: morbilidad (becerra enferma al menos en una ocasión en el periodo del nacimiento al destete). Se monitorearon las becerras para signos de enfermedad por el técnico participante, así como por información proporcionada por el productor. Entre los signos considerados estuvieron cojera, dificultad para desplazase, postración, pérdida de apetito, deshidratación, fiebre, tos, descargas nasales u oculares, letargia y una consistencia anormal en las heces, sin considerar la duración de estos signos, ni la severidad de los mismos. Adicionalmente, los restantes eventos de interés fueron la concentración de inmunoglobulinas en el primer calostro menor a 110 mg/ml, concentración de proteína sérica menor a 6.6 g/dl, GDP menor a 0.650 kg/día y GDA menor a 0.222 cm/día. Los valores límite para los diferentes eventos de interés se establecieron con base al cuartil superior de su distribución(15), con excepción de ganancia diaria de peso al destete.

Factores de estudio

Para el evento morbilidad, los factores considerados fueron: calostro consumido en el primer día menor a 4 l vs mayor o igual a 4 l, calostro consumido/kg de peso vivo (PV) en el primer día <0.105 vs >0.105 kg, peso corporal al nacimiento menor a 42 kg vs mayor o igual a 42 kg, altura al nacimiento menor a 82 cm vs mayor o igual a 82 cm, condición corporal de la madre al parto menor a 3 vs mayor o igual a 3, número de parto (primer parto vs más de un parto) y ofrecimiento de dieta de reto a la madre (NO vs SI). Para el evento concentración de proteína sérica menor a 6.6 g/dl, los factores analizados fueron: calostro consumido en el primer día, calostro consumido/kg de PV en el primer día, peso al nacimiento, altura al nacimiento, condición corporal de la madre al parto, número de parto, duración del periodo seco menor a 68 días vs mayor o igual a 68 días y ofrecimiento de dieta de reto a la madre. Para el evento GDP menor a 0.650 kg/día y GDA <0.222 cm/día, los factores analizados fueron: calostro consumido en el primer día, calostro consumido/kg de PV en el primer día, peso al nacimiento, altura al nacimiento, condición corporal de la madre al parto, número de parto y ofrecimiento de dieta de reto a la madre. Los valores límite para los diferentes factores de estudio se establecieron con base al cuartil superior de su distribución(15).

68


Rev Mex Cienc Pecu 2022;13(1):64-81

Análisis estadístico

Los análisis estadísticos se realizaron empleando el paquete estadístico SAS 9.3 (SAS Institute Inc., Cary, NC). Inicialmente, se obtuvieron valores descriptivos para las variables consideradas en el estudio y la frecuencia de los mismos. Para construir los modelos múltiples, primeramente, se utilizaron modelos de regresión logística simples con el procedimiento LOGISTIC entre cada una de las variables independientes (factores de estudio) y cada evento de interés. Factores con significancia P≤0.35 fueron retenidos para diseñar los modelos múltiples(20). Posteriormente, se realizaron análisis de correlación simple entre factores de estudio para prevenir colinealidad en los modelos múltiples con el procedimiento FREQ. Cuando los límites de confianza de los coeficientes de correlación no incluyeron al 0 (indicando que existe una asociación positiva o negativa), ambos factores no formaron parte del mismo modelo. Para obtener los modelos con mayor parsimonia, se utilizó la opción backward del procedimiento LOGISTIC para eliminar del modelo factores de estudio no significativos a un valor de P>0.1(20). Finalmente, se obtuvieron las razones de momios (OR) a partir de los análisis de regresión logística como una medida de asociación entre los eventos de interés y los factores de estudio(21).

Resultados Indicadores de desempeño

El peso y altura al nacer de las becerras superó ligeramente los 40 kg y los 80 cm, respectivamente, con una ganancia diaria de peso al destete de 503 g (Cuadro 1). Los litros consumidos de calostro en la primera toma y el primer día fueron 2.36 y 4.09, respectivamente, transcurriendo más de 4 h en promedio, para realizar la primera toma de calostro. El contenido de inmunoglobulinas en el calostro correspondió a una buena calidad, aunque con un rango amplio de valores; esta última situación fue similar a lo observado en el contenido de proteína sérica y en la duración del periodo seco. La condición corporal al parto promedió 2.8.

69


Rev Mex Cienc Pecu 2022;13(1):64-81

Cuadro 1: Estadísticas descriptivas de variables asociadas a la crianza y el manejo periparto de vacas Holstein Cuartil Cuartil Variable n Promedio±DE Mínimo Máximo inferior superior Peso corporal al 207 40.39±2.99 29.00 39.00 42.00 52.00 nacimiento, kg Ganancia de peso al 220 0.503+0.23 0.001 0.397 0.644 1.027 destete, kg/día Altura al nacimiento, 207 80.28+3.38 66.00 78.00 82.00 89.00 cm Ganancia de altura al 220 0.168+0.08 0.002 0.122 0.222 0.351 destete, cm/día Calostro consumido 115 2.36+0.93 0.50 2.0 3.0 5.00 en primera toma (l) Calostro consumido el 207 4.09+0.51 1.00 4.00 4.00 5.50 primer día (l) Calostro consumido 115 0.058±0.002 0.012 0.048 0.071 0.125 /kg PV, primera toma (kg) Calostro 213 0.102±0.00 0.026 0.095 0.105 0.139 consumido/kg PV, primer día (kg) Tiempo a la primera 119 4.24+3.31 0.35 2.0 6.0 18.00 toma de calostro, h Inmunoglobulinas en 133 81.56+33.74 10.00 85 110 165.00 calostro, mg/ml Proteína sérica, g/dl 141 5.64+1.32 1.00 4.95 6.60 9.00 Condición corporal al 207 2.80+0.40 2.00 2.50 3.00 4.00 parto Duración del periodo 132 66.54+20.14 31.00 57 68 179.00 seco, días Número de partos 215 1.71+0.45 1 1 2 9 DE= Desviación estándar; PV= peso vivo.

Con excepción de la morbilidad (29.9 %), el resto de los eventos tuvo una prevalencia superior al 70 % (Cuadro 2). El 53 % de las becerras enfermas se asociaron a la presentación de diarrea, mientras que el 24.2 % se asociaron a problemas respiratorios sugerentes de neumonía y el 22.7 % mostró algún otro signo de enfermedad o alteración. De los factores en estudio, el consumo de calostro en el primer día menor a 4 L fue el de menor prevalencia (4.3 %), mientras que el peso corporal al nacimiento menor a 42 kg, la altura al nacimiento

70


Rev Mex Cienc Pecu 2022;13(1):64-81

menor a 82 cm, la condición corporal al parto menor a 3 y el consumo de calostro en el primer día <105 kg/kg PV, tuvieron prevalencias superiores al 60 % . Cuadro 2: Prevalencias de los eventos de interés y potenciales factores de riesgo para crianza de becerras, incluidos en los análisis de regresión logística Variable % Eventos de interés: Morbilidad 29.95 Concentración de inmunoglobulinas en calostro <110 mg/ml 74.36 Concentración de proteína sérica <6.6 g/dl 75.00 Ganancia de peso al destete <0.650 kg/día 74.88 Ganancia de altura al destete <0.222 cm/día 74.40 Factores de estudio: Peso corporal al nacimiento <42 kg 69.08 Altura al nacimiento <82 cm 63.29 Consumo de calostro en el primer día <4 l 4.35 Calostro consumido /kg PV, primer día (kg) 65.70 Condición corporal al parto <3 63.29 Duración del periodo seco >68 días 26.92 Vacas de primer parto 28.99 Vacas sin dieta de reto 51.56 PV= peso vivo.

Asociación de los factores de estudio sobre los eventos de interés

Los análisis de regresión logística simple (Cuadro 3), muestran que para el evento morbilidad, los cuatro factores de estudio con una P<0.35 que fueron incluidos en los análisis múltiples fueron el calostro consumido el primer día (P=0.025), el calostro consumido el primer día por kg de peso vivo (P=0.174), el número de parto (P=0.008) y la dieta de reto (P=0.223). Para el evento concentración de inmunoglobulinas menor a 110 mg/ml, los únicos factores de estudio considerados fueron la duración del periodo seco (P=0.063) y la dieta de reto (P=0.005). Para la concentración de proteína sérica menor a 6.6 g/dl como indicador de falla de transferencia de inmunidad pasiva, el único factor considerado fue el peso al nacimiento (P=0.178). Para la ganancia de peso al destete menor a 0.650 kg/día, tres factores fueron considerados, el número de parto (P=0.280). la dieta de reto (P=0.004) y el calostro consumido el primer día por kg de PV (P=0.340), mientras que los factores calostro consumido el primer día (P=0.329), calostro consumido el primer día por kg de PV (P=0.004), peso al nacimiento (P=0.067), altura al nacimiento (P=0.001), número de parto

71


Rev Mex Cienc Pecu 2022;13(1):64-81

(P=0.105) y la dieta de reto (P=0.008), se consideraron para el evento ganancia de altura al destete menor a 0.222 cm/día. Cuadro 3: Factores asociados a diferentes eventos. Análisis con modelos simples Evento de interés Factor de riesgo P (OR) Morbilidad

Calostro consumido el primer día (<4 vs >4 l) Calostro consumido/kg PV, primer día (<0.105 vs >0.105) Número de parto (primípara vs multípara) Dieta de reto (sin dieta vs con dieta) Concentración de Duración del periodo seco (>68 vs <68 inmunoglobulinas <110 días) mg/ml Dieta de reto (sin dieta vs con dieta) Concentración de proteína Peso al nacimiento (<42 vs >42 kg) sérica <6.6 g/dl Ganancia de peso al destete Número de parto (primípara vs <0.650 kg/día multípara) Dieta de reto (sin dieta vs con dieta) Calostro consumido/kg PV, primer día (<0.105 vs >0.105) Ganancia de altura al destete Calostro consumido el primer día (<4 vs <0.222 cm/día >4 l) Calostro consumido/kg PV, primer día (<0.105 vs >0.105) Peso al nacimiento (<42 vs >42 kg) Altura al nacimiento (<82 vs >82 cm) Número de parto (primípara vs multípara Dieta de reto (sin dieta vs con dieta)

0.025 (5.071) 0.174 (1.571) 0.008 (2.358) 0.223 (0.675) 0.063 (4.385) 0.005 (5.665) 0.178 (1.727) 0.280 (1.495) 0.004 (0.372) 0.340 (1.395) 0.329 (2.849) 0.004 (0.385) 0.067 (0.499) 0.001 (0.266) 0.105 (0.579) 0.008 (0.400)

P=valor de probabilidad; OR=razón de momios; PV=peso vivo.

Los efectos significativos de los modelos múltiples para cada evento de interés, mostrados en el Cuadro 4, indican que, para morbilidad, los dos factores que se mantuvieron fueron el consumo de calostro para un primer modelo (P=0.023) y el número de parto para el segundo modelo (P=0.010). Para la concentración de inmunoglobulinas menor a 110 mg/ml, los factores que se mantuvieron fueron la duración del periodo seco (P=0.062) y la dieta de reto (P=0.005). Para la ganancia de peso al destete menor a 0.650 kg/día sólo lo fue la dieta de reto (P=0.004). Para la ganancia de altura al destete menor a 0.222 cm/día los factores que se mantuvieron en cuatro modelos fueron la dieta de reto para el primero de ellos (P=0.008),

72


Rev Mex Cienc Pecu 2022;13(1):64-81

el peso al nacimiento (P=0.055) y la dieta de reto para el segundo (P=0.005), la altura al nacimiento (P=0.005) y la dieta de reto (P=0.017) para el tercer modelo y la dieta de reto y el consumo de calostro en el primer día/kg de PV (P=0.003).

Cuadro 4: Factores no colineales identificados mediante análisis multivariado para diferentes eventos Variable Modelo Factor OR (IC 95%) P Morbilidad 1 Consumo de calostro en el primer día <4l 5.224 (1.257-21.711) 0.023 >4l Referencia 2 Número de parto Primípara 2.395 (1.231-4.660) 0.010 Multípara Referencia Concentración de 1 Duración del periodo inmunoglobulinas seco <110 mg/ml > 68 0.214 (0.043-1.079) 0.062 < 68 Referencia Dieta reto Sin dieta 0.170 (0.049-0.588) 0.005 Con dieta Referencia Ganancia de peso al 1 Dieta reto destete <0.650 Sin dieta 0.372 (0.187-0.736) 0.004 kg/día Con dieta Referencia 1 Dieta reto Sin dieta 0.400 (0.204-0.785) 0.008 Con dieta Referencia 2 Peso al nacimiento < 42 kg 0.469 (0.216-1.017) 0.055 > 42 kg Referencia Ganancia de altura Dieta reto al destete <0.222 Sin dieta 0.377 (0.190-0.747) 0.005 cm/día Con dieta Referencia 3 Altura al nacimiento < 82 cm 0.253 (0.110-0.585) 0.001 > 82 cm Referencia Dieta reto Sin dieta 0.430 (0.214-0.860) 0.017 Con dieta Referencia

73


Rev Mex Cienc Pecu 2022;13(1):64-81

4

Dieta de reto Sin dieta Con dieta Calostro consumido/kg PV en primer día <0.105 >0.105

0.368 (0.183-0.739) Referencia

0.005

2.882 (1.449-5.735) Referencia

0.003

OR= razón de momios; IC= intervalo de confianza; P= valor de probabilidad.

Discusión El peso y altura promedio de las becerras al nacimiento fueron similares a los descritos para este sistema de producción(4), aunque ligeramente inferiores a los publicados para becerras de otros sistemas(8,22,23). Por otra parte, el promedio observado en la ganancia de peso al destete fue inferior a lo recomendable(24) y mostró resultados contrastantes a lo publicado por otros autores(8,23,25). Esto podría deberse, al menos en parte, a las diferentes condiciones de manejo de las unidades de producción, duración de periodos de lactancia y tipo de alimentación (sustitutos vs leche), entre otros. El consumo promedio de calostro en la primera toma y el total del primer día fueron inferiores a lo descrito por otros autores(8,23). Aún considerando el consumo de calostro por kilo de peso vivo en la primera toma, no se logró cubrir el 10 al 12 % recomendado para las primeras h(26), lográndolo sólo después del primer día. Un alto porcentaje de becerras consumió menos de 4 L de calostro en el primer día, mientras que el tiempo transcurrido a la primera toma de calostro es mayor a lo registrado en otros estudios(8,27). A pesar de las deficiencias observadas en el consumo de calostro, parece ser que la protección lograda por las becerras, medida en proteína sérica total, fue adecuada(27), quizá como resultado de la alta calidad del calostro ofrecido(24), que es superior a lo observado en hatos de un mayor tamaño y tecnificación(23). En estos últimos, se ha descrito que sólo un 23 % de los calostros cubren estándares de calidad(9). Es probable que las menores producciones de leche de las vacas del sistema a pequeña escala(13), permitan que la concentración de inmunoglobulinas en el calostro sea mayor, al evitar su dilución(28). De esta manera, aunque la primera toma de calostro en becerras bajo el sistema de producción de leche a pequeña escala pudiera ser menor a lo sugerido(26), la calidad del mismo permitiría garantizar una protección efectiva. Sin embargo, se debe tomar en cuenta la amplia variación de resultados observada tanto en la concentración de inmunoglobulinas en el calostro, como en la cantidad de proteína sérica.

74


Rev Mex Cienc Pecu 2022;13(1):64-81

La baja condición corporal al parto de las vacas y el alto porcentaje que se ubicó con menos de 3 puntos de condición corporal, puede ser resultado de condiciones deficientes de alimentación que existen en los hatos(14,15,29), lo cual se refleja en el bajo porcentaje de vacas que recibieron dieta de reto. Para el evento de morbilidad, el análisis múltiple indicó que aquellas becerras que consumieron menos de 4 L de calostro el primer día, tuvieron 5.2 veces más probabilidades de enfermarse en comparación a las que consumieron mayores cantidades. De esta manera, esto debe tomarse en cuenta, aún y cuando las lecturas de proteína sérica total promedio muestren buenos resultados. Adicionalmente, la mayor probabilidad de enfermarse de las becerras que fueron hijas de madres de primer parto vs multíparas, similar a lo descrito por otros autores(30), puede deberse a que el calostro de las primeras contiene menor cantidad de inmunoglobulinas o su calidad puede ser inferior a la de vacas con un mayor número de partos(31,32,33). Debido a las altas tasas de morbilidad registradas para este sistema de pequeña escala, se debe poner especial atención en la alimentación ofrecida a la becerra el primer día y procurar las mejores condiciones de alojamiento, en especial cuando las becerras provienen de madres de primer parto. Tomando en cuenta que un bajo consumo de calostro podría poner en riesgo la salud de una becerra, garantizar su calidad también es una prioridad. El no consumir una dieta de reto disminuyó la probabilidad de tener un calostro de calidad inferior (<110 mg/ml), mostrando así un efecto protector. Aunque el ofrecimiento de concentrado previo al parto, que coincide con la formación de calostro(26), pudo favorecer una mayor producción inicial, esto pudo causar una dilución en el contenido de inmunoglobulinas. Esto es algo similar a lo que se ha observado en la especie ovina(34), donde ovejas restringidas tuvieron un menor volumen de calostro, pero un mayor contenido de inmunoglobulinas, en comparación a las ovejas consumiendo el 100 % de sus requerimientos nutricionales. Sin embargo, no se han observado diferencias en la calidad del calostro debido al consumo de concentrado o un mayor consumo de energía metabolizable previo al parto de vacas(35,36). El segundo factor asociado a la concentración de inmunoglobulinas que se mantuvo en el análisis multivariado fue el periodo seco; a una mayor duración de este periodo, disminuyó la probabilidad de que existiera una baja concentración de inmunoglobulinas en el calostro, en comparación a periodos menores a 68 días. Existe poca información comparable disponible; aunque se ha descrito que un periodo seco de 40 días en vacas no mostró diferencias en la concentración de inmunoglobulinas en el calostro, en comparación a 60 días(37). Es probable que un mayor periodo seco, el cual llegó a ser de hasta 179 días para los animales de este estudio, permitan su mayor recuperación corporal y esto favorezca la concentración de inmunoglobulinas en el calostro; esto deberá ser analizado en estudios posteriores. El no ofrecer una dieta de reto a la madre disminuyó la probabilidad de que la becerra tuviera una baja ganancia de peso y altura al destete (es decir, tuvo un efecto protector). Al respecto, 75


Rev Mex Cienc Pecu 2022;13(1):64-81

no se observaron diferencias en el peso o ganancia de peso de becerras cuyas madres recibieron concentrado o no, previo al parto(35). Una limitante de este estudio es no haber registrado la cantidad y la composición nutricional de la dieta de reto ofrecida a las vacas, lo cual pudo dar una mayor orientación sobre los resultados obtenidos. Algunas alteraciones nutricionales durante la vida in útero de las crías, podrían afectar su desempeño desde el nacimiento(38), por lo que es probable que una menor nutrición de la vaca durante la fase final de gestación, provoque en la becerra mecanismos compensatorios que favorezcan su crecimiento inicial después de nacer, como se ha observado en otras fases de crecimiento(39). Sólo algunos estudios han descrito los efectos favorables que la nutrición en la gestación tardía puede tener sobre el crecimiento de las crías(40), lo que puede deberse en parte a que la mayoría de los trabajos generalmente se limitan a obtener indicadores en las crías al nacimiento(41), sin evaluar su desempeño posterior. Adicionalmente, se observó en uno de los modelos que consumir calostro en una cantidad menor a 0.105 kg/kg de PV en el primer día, aumentó casi 3 veces el riesgo de tener un menor crecimiento en las becerras. Es probable que componentes del calostro, como hormonas, factores de crecimiento y nutrientes, los cuales pueden estar en mayor cantidad en el primer calostro, favorezcan el crecimiento de las becerras(26). Desafortunadamente, la altura y su ganancia al destete, no se incluyen en los estudios con la frecuencia que lo hace el peso corporal. Aunque existe una mayor ganancia de peso al destete en becerras con un mayor consumo de calostro(42), en otro estudio no se observó lo mismo para la altura al destete(43). Sin embargo, el diseño consideró el uso de calostro de buena calidad y en cantidades apropiadas, aún para el grupo de menor consumo de calostro (10 vs 15 y 20 % del peso corporal), lo que pudo disminuir la posibilidad de observar diferencias entre grupos.

Conclusiones e implicaciones En conclusión, los factores asociados a la crianza de becerras identificados fueron calostro consumido el primer día, vacas primíparas, duración del periodo seco, vacas sin dieta de reto, peso corporal al nacimiento y altura al nacimiento. El factor con mayor impacto sobre el desempeño de las becerras durante la lactancia fue vacas sin dieta de reto, por impactar positivamente a los eventos de interés concentración de inmunoglobulinas en el calostro, ganancia diaria de peso y ganancia diaria de altura al destete. Este resultado es interesante por las posibles implicaciones prácticas que se pudieran desprender, por ejemplo, recomendar no brindar dieta de reto a vacas bajo este sistema de producción. Sin embargo, es necesario llevar a cabo estudios complementarios para analizar el efecto a largo plazo sobre el desempeño de las becerras más allá de la etapa de lactación y las repercusiones productivas y de salud de las madres.

76


Rev Mex Cienc Pecu 2022;13(1):64-81

Agradecimientos

Estudio financiado con fondos fiscales asignados al proyecto SIGI 23335132549 titulado “Suplementación nutricional en periodos críticos de la crianza de becerras, para mejorar su desempeño productivo en sistemas familiares/semitecnificados de producción de leche” del Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias.

Conflicto de interés

Los autores declaran no tener algún conflicto de interés de tipo financiero o personal asociado a este estudio. Literatura citada: 1. Ghoraishy SH, Rokouei M. Impact of birth weight of Iranian Holstein calves on their future milk production and reproductive traits. J Livest Sci Technol 2013;1:41-46. 2. Raboisson D, Delor F, Cahuzac E, Gendre C, Sans P, Allaire G. Perinatal, neonatal, and rearing period mortality of dairy calves and replacement heifers in France. J Dairy Sci 2013;96:1-12. 3. Aghakeshmiri F, Azizzadeh M, Farzaneh N, Gorjidooz M. Effects of neonatal diarrhea and other conditions on subsequent productive and reproductive performance of heifer calves. Vet Res Commun 2017;41:107-112. 4. Espinosa MMA, Estrada CE, Barretero HR, Rodríguez HE, Escobar RMC. Crianza de becerras para sistemas familiares/semitecnificados de producción de leche. Folleto para productores No. 1, 1ª ed. Ajuchitlán, Querétaro, México. INIFAP CENID Fisiología y Mejoramiento Animal. 2014. 5. Johnson KF, Chancellor N, Burn CC, Wathes DC. Prospective cohort study to assess rates of contagious disease in pre-weaned UK dairy heifers: management practices, passive transfer of immunity and associated calf health. Vet Rec 2017;4(1):e000226. 6. Lora I, Gottardo F, Contiero B, Dall AB, Bonfanti L, Stefani A, Barberio A. Association between passive immunity and health status of dairy calves under 30 days of age. Prev Vet Med 2018;152:12-15. 7. Svensson C, Linder A, Olsson SO. Mortality in Swedish dairy calves and replacement heifers. J Dairy Sci 2006;89:4769-4777.

77


Rev Mex Cienc Pecu 2022;13(1):64-81

8. Urie NJ, Lombard JE, Shivley CB, Kopral CA, Adams AE, Earleywine TJ, et al. Preweaned heifer management on US dairy operations: Part I. Descriptive characteristics of preweaned heifer raising practices. J Dairy Sci 2018;101(9):1-17. 9. Phipps AJ, Beggs DS, Murray AJ, Mansell PD, Stevenson MA, Pymant MF. Survey of bovine colostrum quality and hygiene on northern Victorian dairy farms. J Dairy Sci 2016;99:8981-8990. 10. Zitzmann R, Pfeiffer M, Söllner-Donat S, Donat K. Risk factors for calf mortality influence the occurrence of antibodies against the pathogens of enzootic bronchopneumonia. Tierarztl Prax Ausq G Grosstiere Nutzliere 2019;47(3):151-165. Abstract. 11. Mee JF, Grant J, Sánchez-Miguel C, Doherty M. Pre-calving and calving management practices in dairy herds with a history of high or low bovine perinatal mortality. Animals 2013;3(3):866-881. 12. Urie NJ, Lombard JE, Shivley CB, Kopral CA, Adams AE, Earleywine TJ, Olson JD, Garry FB. Preweaned heifer management on US dairy operations: Part V. Factors associated with morbidity and mortality in preweaned dairy heifer calves. J Dairy Sci 2018;101:1-16. 13. Sánchez GRA, Zegbe DJA, Gutiérrez BH. Tipificación de un Sistema integral de lechería familiar en Zacatecas, México. Rev Mex Cienc Pecu 2015;6(3):349-359. 14. Vera AHR, Hernández AL, Espinosa GJA, Ortega RL, Díaz AE, Román PH, et al. Producción de leche de bovino en el sistema familiar. Libro técnico. 1a ed. México, INIFAP CIRGOC;2009. 15. Montiel-Olguín LJ, Estrada-Cortés E, Espinosa-Martínez MA, Mellado BM, HernándezVélez JO, Martínez-Trejo G, et al. Risk factors associated with reproductive performance in small-scale dairy farms in Mexico. Trop Anim Health Prod 2019;51(1):229-236. 16. IIEG. Instituto de Información Estadística y Geográfica de Jalisco. Altos Sur Diagnóstico de la Región Agosto 2019. Gobierno de Jalisco. 2019. 17. Martínez-González JC, Castillo-Rodríguez SP, Villalobos-Cortés A, HernándezMeléndez J. Sistemas de producción con ruminates en México. Cienc Agropec 2017;26:132-152. 18. Montiel-Olguín LJ, Ruíz-López FJ, Mellado M, Estrada-Cortés E, Gómez-Rosales S, Elton-Puente JE, Vera-Avila HR. Body condition score and milk production on conception rate of cows under a small-scale dairy system. Anim 2019;9(10):800.

78


Rev Mex Cienc Pecu 2022;13(1):64-81

19. Edmonson AJ, Lean J, Weaver LF, Farver T, Webster G. A body condition scoring chart for Holstein dairy cows. J Dairy Sci 1989;72:68-78. 20. Potter TJ, Guitian J, Fishwick J, Gordon PJ, Sheldon IM. Risk factors for clinical endometritis in postpartum dairy cattle. Theriogenology 2010;74(1):127–134. 21. Szumilas M. Explaining odds ratios. J Can Acad Adolesc Psychiatry 2010;19(3):227229. 22. Bazeley KJ, Barrett DC, Williams PD, Reyher KK. Measuring the growth rate of UK dairy heifers to improve future productivity. The Vet J 2016;212:9-14. 23. Shivley CB, Lombard JE, Urie NJ, Haines DM, Sargent R, Kopral CA, et al. Preweaned heifer management on US dairy operations: Part II. Factors associated with colostrum quality and passive transfer status of dairy heifer calves. J Dairy Sci 2018;101:1-14. 24. Akins M. Dairy heifer development and nutrition management. Vet Clin Food Anim Pract 2016;32:303-317. 25. Davis Rincker LE, VandeHaar MJ, Wolf CA, Liesman JS, Chapin LT, Weber Nielsen MS. Effect of intensified feeding of heifer calves on growth, pubertal age, calving age, milk yield, and economics. J Dairy Sci 2011;94:3554-3567. 26 Godden SM, Lombard JE, Woolums AR. Colostrum management for dairy calves. Vet Clin North Am Food Anim Pract 2019;35:535-556. 27. Vogels Z, Chuck GM, Morton JM. Failure of transfer of passive immunity and agammaglobulinaemia in calves in south-west Victorian dairy herds: prevalence and risk factors. Aust Vet J 2013;91:150-158. 28. Elizondo-Salazar JA. Alimentación y manejo del calostro en el ganado de leche. Agronomía mesoamericana 2007;18(2):271-281. 29. Estrada CE, Espinosa MMA, Barretero HR, Rodríguez HE, Escobar RMC. Manejo del ganado bovino adulto en establos familiares/semitecnificados de producción de leche. Folleto para productores Num. 1, 1ª ed. Tepatitlán de Morelos, Jalisco, México. INIFAPCampo Experimental Centro Altos de Jalisco. 2014. 30. Swali A, Wathes DC. Influence of primiparity on size at birth, growth, the somatotrophic axis and fertility in dairy heifers. Anim Reprod Sci 2007;102(1-2):122-136. 31. Dunn A, Ashfield A, Earley B, Welsh M, Gordon A, Morrison SJ. Evaluation of factors associated with immunoglobulin G, fat, protein, and lactose concentrations in bovine colostrum and colostrum management practices in grassland-based dairy systems in Northern Ireland. J Dairy Sci 2017;100(3):2068-2079.

79


Rev Mex Cienc Pecu 2022;13(1):64-81

32. Reschke C, Schelling E, Michel A, Remy-Wohlfender F, Meylan M. Factors associated with colostrum quality and effects on serum gamma globulin concentrations of calves in swiss dairy herds. J Vet Intern Med 2017;31:1563-1571. 33. Sutter F, Borchardt S, Schuenemann GM, Rauch E, Erhard M, Heuwiesser W. Evaluation of 2 different treatment procedures after calving to improve harvesting of high-quantity and high-quality colostrum. J Dairy Sci 2019;102(10):9370-9381. 34. Swanson TJ, Hammer CJ, Luther JS, Calson DB, Taylor JB, Caton JS et al. Effects of gestational plane of nutrition and selenium supplementation on mammary development and colostrum quality in pregnant ewe lambs. J Anim Sci 2008;86:2415-2423. 35. Dunn A, Ashfield A, Earley B, Welsh M, Gordon A, McGee M, Morrison SJ. Effect of concentrate supplementation during the dry period on colostrum quality and effect of colostrum feeding regimen on passive transfer of immunity, calf health, and performance. J Dairy Sci 2017;100:1-14. 36. Hare KS, Wood KM, Fitzsimmons C, Penner B. Oversupplying metabolizable protein in late gestation for beef cattle: effects on postpartum ruminal fermentation, blood metabolites, skeletal muscle catabolism, colostrum composition, milk yield composition, and calf growth performance. J Anim Sci 2019;97:437-455. 37. Shoshani E, Rozen S, Doekes JJ. Effect of a short dry period on milk yield and content, colostrum quality, fertility, and metabolic status of Holstein cows. J Dairy Sci 2014;97:1-14. 38. Van Eetvelde M, Opsomer G. Innovative look at dairy heifer rearing: effect of prenatal and post-natal environment on later performance. Reprod Dom Anim 2017;52(Suppl. 3):30-36. 39. Choi YJ, Han IK, Woo JH, Lee HJ, Jang K, Myung KH, Kim YS. Compensatory growth in dairy heifers: the effect of a compensatory growth pattern on growth rate and lactation performance. J Dairy Sci 1997;80:519-524. 40. Larson DM, Martin JL, Adams DC, Funston RN. Winter grazing system and supplementation during late gestation influence performance of beef cows and steer progeny. J Anim Sci 2009;87(3):1147-1155. 41. Gao F, Liu YC, Zhang ZH, Zhang CZ, Su HW, Li SL. Effect of prepartum maternal energy density on the growth performance, immunity, and antioxidation capability of neonatal calves. J Dairy Sci 2012;95(8):4510-4518.

80


Rev Mex Cienc Pecu 2022;13(1):64-81

42. Abuelo A, Cullens F, Hanes A, Brester JL. Impact of 2 versus 1 colostrum meals on failure of passive immunity, pre-weaning morbidity and mortality, and performance of dairy calves in a large dairy herd. Anim 2021;11(3):782. 43. Moura SFL, Miqueo E, da Silva MD, Manzoni TT, Brito RN, Vieira SMS, Machado BCM. Thermoregulatory responses and performance of dairy calves fed different amounts of colostrum. Anim 2021;11:703.

81


https://doi.org/10.22319/rmcp.v13i1.5939 Artículo

Impacto económico y productivo de una mezcla herbal con derivados de colina en la producción de conejos

Minerva Jaurez-Espinosa a Pedro Abel Hernández-García b Amada Isabel Osorio-Terán b Germán David Mendoza-Martínez c Juan José Ojeda-Carrasco b María Zamira Tapia-Rodríguez b Enrique Espinosa-Ayala b*

a

Universidad Autónoma del Estado de México. Centro Universitario UAEM Amecameca. Doctorado en Ciencias Agropecuarias y Recursos Naturales. México. b

Universidad Autónoma del Estado de México. Centro Universitario UAEM Amecameca, km 2.5 carretera Amecameca - Ayapango, 56900, Amecameca, Estado de México. México. c

Universidad Autónoma Metropolitana–Xochimilco. Departamento Producción Agrícola y Animal. Cd. de México, México.

* Autor de correspondencia: enresaya1@hotmail.com; eespinosaa@uaemex.mx

Resumen: El uso, así como el efecto productivo y económico de compuestos herbales en producción cunícola ha sido poco estudiado, por tal motivo el objetivo fue evaluar el efecto de una mezcla poliherbal rica en conjugados de colina a base de Trachyspermum ammi, Achyranthes aspera, Azadirachta indica y Citrullus colocynthis, sobre la respuesta económica y productiva de conejos para carne. Para lo cual se utilizaron 40 conejos Nueva Zelanda X California (30 días de edad), los cuales fueron aleatorizados en cinco grupos (0.0, 200, 400, 600 y 800 mg kg-1 de MS poliherbal, BioCholina®), el experimento tuvo una duración de 34 días. Se evaluó la 82


Rev Mex Cienc Pecu 2022;13(1):82-96

respuesta productiva, calidad de la carne e indicadores económicos. Se utilizó un diseño completamente al azar con un arreglo de polinomios ortogonales para determinar efectos lineales y cuadráticos, con un nivel de significancia de P<0.05. Los resultados en cuanto a los parámetros productivos fueron similares entre tratamientos, excepto consumo de alimento (P=0.006) y conversión alimenticia (P=0.005) con un efecto linealmente a mayor concentración del poliherbal. La inclusión del poliherbal incrementó pH en carne (lineal, P=0.004) y coordenada b* (lineal, P=0.009), se observó que el tratamiento con 200 mg presentó los mejores indicadores económicos mejorando en 9 unidades porcentuales la razón ingresos-egresos. Se concluye que la adición de mezclas poliherbales a base de conjugado de colina natural no mejoró las variables productivas, sin embargo, se marca una tendencia económica favorable con la adición de 200 mg kg-1 de MS. Palabras clave: Análisis económico, Conjugados de colina, Fitoaditivos, Nutracéuticos, Calidad carne.

Recibido: 10/02/2021 Aceptado: 26/04/2021

Introducción La producción animal presenta retos productivos y económicos que deben ser atendidos mediante métodos y técnicas que no representen riesgos a la salud, es por ello que se plantea el uso de aditivos naturales considerados fitobióticos (fitogénicos) que se puedan incluir en la dieta de animales en producción(1), con la intención de mejorar el rendimiento productivo, calidad de la canal y generen indicadores económicos aceptables(2). Dentro de estos aditivos se incluyen las hierbas, aceites esenciales y extractos(3), los cuales contienen compuestos bioactivos (metabolitos secundarios) como alcaloides, fenoles, terpenoides, esteroides, taninos, saponinas, compuestos fenólicos (flavonoides, flavones, isoflavones), antocianinas, lignanos, estilbenos, cumarinos, carotenoides (tetraterpenos), quinonas, entre otros(4). Dichos metabolitos ejercen diversas funciones como, agentes antimicrobianos, antiparasitarios, antioxidantes, inmunoestimulantes(5), antifúngicos, antiinflamatorios, antiulcerosos, antivirales, anticancerígenos y en producción animal se comportan como estimulantes del apetito y promotores del crecimiento(6), ya que pueden actuar sobre el metabolismo de la microbiota intestinal, inhibiendo la replicación de microorganismos patógenos específicos, así como también estimular la producción de enzimas digestivas endógenas, que benefician la salud(7,8). Existen diversos reportes donde se demuestra el uso de mezclas herbales ricas en derivados de colina en producción animal, donde se ha evaluado la respuesta en la función hepática y

83


Rev Mex Cienc Pecu 2022;13(1):82-96

productiva en pollos de engorda(9), el impacto sobre fermentación ruminal en corderos(8,10), estrés oxidativo y cambios bioquímicos en vacas lecheras(11), expresión genética y efecto inmunoestimulante en becerras(1), analitos sanguíneos en corderos como indicadores del metabolismo lipídico(12). Los derivados de colina (conjugada) son nutrientes esenciales para crecimiento y rendimiento productivo de los animales; esto debido a que la colina interviene en diversas funciones celulares. Las formas utilizables de colina son la fosfatidilcolina, lisofosfatidilcolina y esfingomielina, que son solubles en lípidos (componentes de todas las membranas celulares y tienen un papel central en el metabolismo de los lípidos y la señalización celular), la colina libre y los metabolitos de colina, acetilcolina (ACho), betaína, glicerofosfocolina y fosfocolina que son solubles en agua(13); así mismo, actúa como donante del grupo metilo, después de oxidarse a betaína, para convertir la homocisteína en metionina en la vía de transmetilación en el hígado para evitar la acumulación de grasa(14). Debido a las múltiples funciones y beneficios, la colina natural es una alternativa para la producción animal como aditivo ante la utilización de cloruro de colina sintético u otras aditivos con efectos secundarios y altos costos de la adición(15), por tal motivo, la mezcla poliherbal Biocholine® (fuente de fosfatidilcolina de baja higroscopicidad) integrado por las plantas Trachyspermum ammi, Achyranthes aspera, Azadirachta indica, Citrullus colocynthis y Andrographis paniculata(16) puede ser una alternativa productiva y económicamente rentable. Es por ello que el objetivo del presente estudio fue evaluar el impacto económico y productivo de la adición de una mezcla poliherbal en conjugados de colina adicionada a la dieta de conejos.

Material y métodos Animales y dieta La investigación se condujo bajo los lineamientos aprobados por el Comité Académico del Departamento de Ciencia Animal de Ética, Bioseguridad y Bienestar Animal del Centro Universitario UAEM Amecameca de la Universidad Autónoma del Estado de México. El experimento se condujo en el área metabólica cunícola. Se utilizaron 40 gazapos destetados (30 días de edad), raza California X Nueva Zelanda (506.52 ± 120.47 g), los cuales se asignaron en jaulas individuales en cinco tratamientos (n= 8); con niveles de adición de la mezcla poliherbal a 0.0, 200, 400, 600 y 800 mg kg-1 de materia seca (MS) (BioCholina Powder®, Technofeed México), aditivo compuesto por Trachyspermum ammi, Achyranthes aspera, Azadirachta indica, Citrullus colocynthis y Andrographis paniculata), la cual contiene 16 g kg-1 de conjugados totales de colina(16),

84


Rev Mex Cienc Pecu 2022;13(1):82-96

siendo los cinco grupos homogéneos en cuanto al peso, el cual fue considerado como peso inicial (P>0.05). La dieta experimental se formuló para cumplir con los requerimientos nutricionales de conejos en engorda(17) (Cuadro 1), sin embargo, los requerimientos de colina se mantuvieron por debajo (1,130 mg kg-1). La fórmula poliherbal se adicionó al alimento balanceado formulado, se mezcló y posteriormente se pelletizó para ofrecerlo a los conejos ad libitum, al igual que el agua limpia y potable. El experimento duró 34 días, con siete días de adaptación, las dietas de los tratamientos fueron isoenergéticas e isoproteícas. Se determinaron las siguientes variables productivas, peso inicial (0d), peso final (34d) y ganancia diaria de peso, así como el registro del alimento ofrecido y rechazado, para obtener consumo voluntario en base húmeda y su posterior ajuste a materia seca; además se obtuvo la conversión alimenticia (kilos de alimento para obtener un kilogramo de peso vivo). Cuadro 1: Ingredientes (g kg-1), mezcla poliherbal (mg kg-1 de alimento) y composición química de las dietas experimentales Mezcla poliherbal (mg kg-1 MS) Ingredientes

Testigo

200

400

600

800

Salvado de trigo

33

33

33

33

33

Maíz en grano

19

19

19

19

19

Heno de avena

19

19

19

19

19

Pasta de soya (44% CP)

17

17

17

17

17

Heno de alfalfa

9

9

9

9

9

Aceite vegetal

2

2

2

2

2

Saccharomyces cerevisae

1

1

1

1

1

Mezcla poliherbal

0.0

200

400

600

800

Proteína cruda, %

17.9

17.9

17.9

17.9

17.9

Energía digestible, Mcal kg-1 MS 2.85

2.85

2.85

2.85

2.85

Fibra cruda, %

12.6

12

12

12

12

Fibra neutro detergente, %

31.3

31.3

31.3

31.3

31.3

Fibra ácido detergente, %

15.9

15.9

15.9

15.9

15.9

Colina, mg kg-1 MS

1127

1130

1133.2

1136.4

1139.6

NCR, 1977.

85


Rev Mex Cienc Pecu 2022;13(1):82-96

Recolección y análisis de muestras A los 65 días de edad de los conejos se realizó la matanza, con previo ayuno de 24 h. El manejo de las canales fue siguiendo la metodología propuesta por Peiretti y Mineri(18). Durante la matanza se registró el peso de la canal caliente, del tracto gastrointestinal incluyendo bazo y tejido mesentérico, hígado y riñones (órganos abdominales), además de corazón y pulmones (torácicos). Las canales se almacenaron a 4 °C por 24 h y se pesaron nuevamente para obtener peso de la canal fría; para realizar las medidas de calidad de carne se diseccionó el músculo Longissimus dorsi en su porción lumbar(19).

Calidad de carne Los análisis se realizaron en el músculo Longissimus dorsi a las 24 h postmortem; las mediciones se realizaron por duplicado en cada una de las variables. El pH se tomó al nivel de la 5a vértebra lumbar con un potenciómetro de penetración (Hanna instruments H199163)(20). Las mediciones de color se tomaron con un colorímetro (Konica Minolta, tricromático) y las lecturas se reportaron como: L* (luminosidad), a*(rojo), b* (amarillo), se utilizaron para obtener C* (croma) y H* (Hue)(21). La capacidad de retención de agua (CRA) se realizó a través de pérdida de agua por goteo y por presión(22) y también la pérdida de agua por cocción(23). Para determinar el impacto económico se consideró el costo de gazapo, costo de cada ingrediente de la dieta, incluyendo la mezcla herbal por dosis de tratamiento, con precios del año 2020; todos estos como egresos de la actividad. Para los ingresos se calculó con base en el mercado local el precio de venta de animales en pie y canal; una vez obtenidos los ingresos y egresos se obtuvo la utilidad (ingresos–egresos) en pie, en canal caliente y fría; finalmente se calcularon las razones ingresos egresos (ingresos-egresos) la cual permitió conocer la tasa de retorno en unidades porcentuales, donde se indica que una tasa ingresos-egresos inferior a 1 representa pérdidas, igual a 1 indica que no hubo utilidades, mientras que tasa mayores a 1 son indicativas de utilidades. Todos los valores económicos se indican en dólares estadounidense a un tipo de cambio de $1USD a $20.03MX con fecha del 10 de febrero de 2021.

Análisis estadístico Los resultados se analizaron con un diseño completamente al azar, utilizando el software R(24), empleando peso inicial como co-variable para las variables productivas y utilizaron polinomios ortogonales para obtener efectos lineales y cuadráticos para evaluar los efectos del aditivo poliherbal(25) con un nivel de significancia P<0.05.

86


Rev Mex Cienc Pecu 2022;13(1):82-96

Resultados La adición de la mezcla poliherbal, no mostró efectos significativos (P>0.05) en peso final, ganancia diaria de peso, peso de canal caliente y fría (Cuadro 2). En contraste, se observa un efecto lineal en el consumo de alimento (P=0.006) y conversión alimenticia (P=0.005). Cuadro 2: Prueba productiva y características de la canal de conejos adicionados con una mezcla poliherbal (g) Mezcla poliherbal (mg kg-1 MS)

P-valor EEM

Item

0.0

200

400

600

800

Lineal

Cuadrático

Peso inicial

513.0

516.5

513.8

498.0

481.1

25.92

0.52

0.71

Peso final *

1444.3

1505.5

1461.5

1443.6

1429.3

38.25

0.44

0.38

Ganancia diaria de peso

27.7

30.0

28.3

27.2

26.3

1.85

0.32

0.41

Consumo alimento *

82.9

87.6

88.6

89.3

91.1

3.22

0.006

0.55

Conversión alimenticia

3.01

2.97

3.18

3.2

3.4

0.12

0.005

0.52

Peso canal caliente *

777.3

845.6

794.4

773.1

769.6

59.51

0.63

0.61

Peso canal fría *

749.7

816.1

764.7

743.0

739.7

58.88

0.61

0.62

Tracto gastrointestinal

340.2

338.5

348.0

335.5

288.7

26.29

0.14

0.19

Corazón y pulmones

22.5

20.7

23.1

22.7

20.8

2.17

0.84

0.70

Hígado

35.5

35.5

39.0

35.8

35.2

2.24

0.68

0.21

Riñones

12.6

12.6

13.0

12.7

12.5

0.92

0.95

0.75

EEM= error estándar de la media. * El peso inicial se consideró como co-variable (P<0.05)

Con respecto al peso de la canal caliente y fría, así como de peso del tracto gastrointestinal, hígado, riñones y órganos torácicas (corazón y pulmones) no se observó efecto significativo (P>0.05).

87


Rev Mex Cienc Pecu 2022;13(1):82-96

Los resultados sobre calidad de la carne se presentan en el Cuadro 3, en donde se puede observar que el pH mostró un efecto lineal (P=0.004) y cuadrático (P=0.009) en los grupos adicionados con la mezcla poliherbal. En cuanto a las coordenadas tricromáticas de la carne, no se observaron efectos (P>0.0.5) en L*, a* y ángulo Hue, no así para b* y croma que presentaron efecto lineal (P= 0.009 y 0.03), en la capacidad de retención de agua no se observaron diferencias significativas (P>0.05). Cuadro 3: Características de calidad del músculo Longissimus dorsi obtenido de conejos alimentados con una mezcla poliherbal Mezcla poliherbal (mg kg-1MS) P-valor EEM Item 0 200 400 600 800 Lin Cuad pH

5.5

5.6

5.8

5.6

5.8

0.06

0.004

0.09

L*

51.3

54.3

51.9

57.0

53.5

1.45

0.12

0.31

a*

3.8

4.2

4.0

4.3

4.8

0.53

0.20

0.74

b*

3.0

4.3

3.5

4.7

4.6

0.42

0.009

0.59

Croma

4.9

6.1

5.4

6.4

6.7

0.58

0.03

0.99

Ángulo Hue

180.6

180.7

180.7

180.8

180.7

0.063

0.13

0.22

Pérdida por goteo, %

3.7

3.5

3.8

4.0

3.9

0.016

0.15

0.99

Pérdida por cocción, %

33.9

34.9

33.6

34.4

34.1

0.002

0.39

0.50

Pérdida por presión, %

20.3

17.5

20.9

20.0

20.0

0.000

0.86

0.81

EEM= error estándar de la media; Lin= lineal, Cuad= cuadrático. L*: luminosidad; a*: tiende a rojo; b*: tiende a amarillo

En el análisis económico (Cuadro 4) se observó incremento de costos a medida que aumentaba la adición de la mezcla poliherbal, tanto en costos por alimento como por animal, encontrando en el tratamiento testigo los menores costos, esto derivado del costo del aditivo. En cuanto a ingresos por animal vivo, en canal caliente y fría, se obtuvo que el tratamiento con adición de 200 mg kg-1 presentaron mayores ingresos, situación que se relaciona con la respuesta productiva, ya que en este grupo fue el de mayor peso. Con respecto a la utilidad y la razón ingresos egresos, se observó que la adición de 200 mg kg-1 se obtiene el máximo valor, alcanzando la mayor rentabilidad en la canal fría, siendo 88


Rev Mex Cienc Pecu 2022;13(1):82-96

esta de 1.38 (por cada unidad de egreso se recupera la unidad y se obtiene una utilidad de 0.38 unidades). Cuadro 4: Análisis económico de conejos alimentados con una mezcla poliherbal Mezcla poliherbal (mg kg-1MS) Ítem

0

200

400

600

800

Costo alimento, $

0.7688

0.8152

0.8272

0.8362

0.8557

Costo por animal, $

2.7658

2.8122

2.8242

2.8332

2.8527

Ingresos por animal en pie, $

3.2755

3.4767

3.3180

3.2026

3.0908

Ingresos por canal caliente, $

3.4927

3.7993

3.5696

3.4737

3.4578

Ingresos por canal fría, $

3.5556

3.8706

3.6270

3.5242

3.5082

Utilidad por animal en pie, $

0.5097

0.6645

0.4937

0.3694

0.2381

Utilidad canal caliente, $

0.7264

0.9885

0.7453

0.6405

0.6055

Utilidad canal fría, $

0.7898

1.0584

0.8027

0.6909

0.6555

Razón ingresos-egresos animal en pie

1.18

1.24

1.17

1.13

1.08

Razón ingresos-egresos canal caliente

1.26

1.35

1.26

1.23

1.21

Razón ingresos-egresos canal fría

1.29

1.38

1.28

1.24

1.23

Discusión Respuesta productiva De acuerdo con los resultados obtenidos, no se presentaron efectos significativos sobre consumo de alimento y ganancia diaria de peso por la adición de mezclas poliherbales, a pesar de que estos aditivos son considerados como aditivos fitogénicos con la característica de estimular la producción de enzimas digestivas como la tripsina y la amilasa, con capacidad para optimizar la absorción de nutrientes y en consecuencia mejorar respuestas productivas y de la canal(6), sin embargo en este estudio, no se observaron dichos beneficios, situación similar a lo presentado por otros autores(12), en un estudio realizado en corderos alimentados conjugados de colina a dosis de 0 y 4 g día-1 no se encontró una mejor respuesta en el tratamiento adicionado con respecto al testigo sobre peso final (28.63 – 28.68 kg) ni ganancia diaria de peso (106.44 – 107.98 kg). Del mismo modo en dos trabajos realizados en conejos empleando diversas plantas no observaron mejoras en los parámetros productivos a pesar de

89


Rev Mex Cienc Pecu 2022;13(1):82-96

ser plantas ricas en metabolitos secundarios(26,27), ya que se refiere que los metabolitos presentes no son suficientes para modificar la microbiota ni las condiciones del tracto gastrointestinal. Por otro lado, la relación entre conversión alimenticia y el aumento de peso, no se vieron afectados por las dosis de mezclas poliherbales, valores que concuerdan con lo reportado por otro trabajo(10), investigación en la que se presentó efecto lineal (P= 0.07) en conversión pero no así en ganancia de peso (P>0.10) en corderos en crecimiento, utilizando una fórmula poliherbal, así como también en los resultados de Selvam et al(28) en pollos alimentados con una mezcla herbal (0.0, 500 y 1,000 g-1 t-1 de alimento) y obtener valores en tratamiento testigo de 1.58 y los grupos de adición de 1.47 y 1.48. La adición de mezclas poliherbales mostró un efecto positivo sobre las variables de consumo alimenticio y ganancia diaria de peso, ya que los conejos con el peso corporal más bajo se encontraron en el grupo testigo (27.7 g día-1), el cual es deficiente en colina con 1,130 mg día-1, cuando el requerimiento mínimo es de 1,130 mg kg-1 MS. Al respecto investigaciones donde han inducido experimentalmente la deficiencia de colina, han observado retardo en el crecimiento, anemia, distrofia muscular y muerte(29), situación que se confirma en este experimento. Si bien el mecanismo activo de cloruro de colina aún no está claro, el exceso de colina ha mostrado afectar de manera negativa el rendimiento animal; una de las hipótesis que pueden explicar los resultados obtenidos es que al sobrepasar la capacidad de metabolizar la colina a nivel celular, se produce una acumulación de fosfocolina, situación que podría estar ocurriendo en los tratamientos con 600 y 800 mg (27.2 y 26.3 g día-1 respectivamente) que están sobre el requerimiento necesario para conejos en esta etapa de crecimiento(16). Un experimento realizado en codornices a dosis de 1,000, 1,500, 2,000 y 2,500 mg kg-1 de colina mostraron una mayor ganancia de peso entre los días 7 al 21 de edad (1.95, 2.10, 2.98, 2.48 g), así como una mejor conversión (5.29, 5.44, 3.68, 4.35); tal situación contrasta con lo observado en la presente investigación, probablemente a que la adición de mezclas poliherbales pudo haber modificado la fisiología digestiva, actuando sobre el microbioma cecal, ya que el sistema digestivo del conejo está adaptado a la fermentación de las células epiteliales vegetales en el ciego(30), mientras que en las aves no se dan estos procesos de fermentación digestiva. Si bien en este estudio no se realizaron análisis hematológicos para conocer el funcionamiento hepático por la adición mezclas poliherbales, diversas investigaciones han observado la variación de la respuesta al emplear fórmulas herbales; en una investigación(31), encontraron que el peso del hígado no tuvo relación en la producción de enzimas específicas (ALT y AST), al no mostrar cambios entre los grupos, cuando se adicionó colina (1,000 mg 90


Rev Mex Cienc Pecu 2022;13(1):82-96

kg-1) como agente lipotrópico en pollos en engorda, así mismo(9) observaron una disminución de las concentraciones séricas de AST, en pollos en engorda alimentados con colina (1 g kg-1) y lectina (0.5 g kg-1). Cabe hacer mención que el uso de diversas plantas interviene en el metabolismo de los lípidos y del colesterol(32), situación que modifica el metabolismo general del animal y por ende la respuesta productiva, es posible que las plantas que integran a la fórmula poliherbal tengan efectos sobre los lípidos y estos a su vez puedan modificar la absorción de nutrientes.

Calidad de la carne De acuerdo con los resultados obtenidos de pH, se encontraron diferencias significativas entre los tratamientos adicionados con mezclas poliherbales en comparación con el testigo (P<0.05), al presentar valores que van de 5.5 para el testigo y 5.8 como máximo para los grupos adicionados. Estos resultados concuerdan con lo reportado por otros(33) donde encontraron valores de pH de 5.8 para carne de conejos alimentados con diferentes partes de la planta Tithonia tubaeformis. El pH óptimo a las 24 hs postmortem para músculos glucolíticos como lo es el músculo Longissimus dorsi del conejo, se encuentran entre 5.3 y 6.0(32); este parámetro es uno de los indicadores más importantes para evaluar la calidad de carne, al asociarse con la apariencia, color (reacciones químicas de la mioglobina) y absorción de agua(34). Los parámetros obtenidos de la variable b* de color de la carne, están por debajo (entre 3 y 4.7) de lo reportado(35) en conejos alimentados con flavonoides contenido en alfalfa, a dosis de 0.0, 400, 800, 1,200 mg kg-1 y encontrar valores que oscilan entre 6.1, y 6.6. Así como lo mencionado por Selvam et al(28) donde reportaron valores de 8.34 y 10.16 para la variable b de conejos alimentados con diferentes partes de la planta Tithonia tubaeformis. La coordenada b* que representa el pigmento amarillo en carne, dicho valor se vio afectado en los tratamientos con la adición de la mezcla poliherbal, lo cual podría deberse a una serie de reacciones de pardeamiento no enzimáticas que ocurren en los productos de oxidación de lípidos y aminas en los grupos de cabeza de fosfolípidos o la amina en la proteína(36). Así mismo la presencia de compuestos antioxidantes como fenoles y flavonoides contenidos en las mezclas poliherbales podrían ser responsables de las diferencias de color observadas. Los resultados obtenidos en este experimento en cuanto al color, indican una carne con una ligera coloración que tiende a marrón y es no exudativa, situación que no es deseable ya que la carne de conejo es pálida no exudativa(37). En diversos trabajos(26,27) que involucraron el uso de plantas en la alimentación de conejos, se observó que la incorporación en bajos niveles de plantas con alto potencial antioxidantes y con compuestos fenólicos, no tienen la capacidad de modificar la calidad de la carne,

91


Rev Mex Cienc Pecu 2022;13(1):82-96

situación similar a lo reportado en este experimento, esto debido a que los volúmenes adicionados son reducidos.

Impacto económico La adición de 200 mg kg-1 MS de la fórmula poliherbal generó el mayor peso vivo y la mejor conversión alimenticia en este experimento, tal situación se vio reflejada en los indicadores económicos; al adicionar esta dosis se obtuvieron las mayores utilidades y razones ingresos egresos, ya que se puede indicar que fue la dosis óptima para estos animales. En un estudio(38) se observó que la adición de plantas con potencial inmunoestimulante generó beneficios económicos en la producción de conejos, situación similar a lo reportado en esta investigación; tal efecto se puede deber a que las fórmulas poliherbales contienen gran cantidad de metabolitos, y estos generan modificaciones benéficas en el tracto gastrointestinal, o bien en la absorción de nutrientes, situación que genera mejores conversiones alimenticias. En el mismo sentido, en un estudio realizado en ganado lechero se observó que la adición de una fórmula poliherbal rica en colina mejoró los indicadores económicos, debido a que se mejoró la producción de leche y se disminuyó el número de eventos de patologías(39).

Conclusiones e implicaciones La adición de mezclas poliherbales a base de conjugado de colina natural, no mejoró las variables productivas; sin embargo, se marca una tendencia económica favorable con la adición de 200 mg/kg de materia seca, debido a un efecto positivo en la conversión alimenticia. Se recomienda seguir investigando el uso de colina natural en conejos, a dosis menores de 200 mg kg-1, ya que en esta investigación los posibles beneficios se encontraron en este grupo, así como mantener los requerimientos recomendados de la colina para un óptimo almacenamiento de vitaminas, evitar ineficiencias en la absorción o metabolismo dietético, y garantizar el estado fisiológico de los conejos. Literatura citada: 1. Díaz GC, Méndez OET, Martínez GD, Gloria TA, Hernández GPA, Espinosa AE, et al. Influence of a Polyherbal Mixture in Dairy Calves: Growth Performance and Gene Expression. Front Vet Sci 2021;7:623710. 2. Madhupriya V, Shamsudeen P, Manohar GR, Senthilkumar S, Soundarapandiyan V, Moorthy M. Phyto feed additives in poultry putrition: A review. Int J Sci Environ Technol 2018;7(3):815-822.

92


Rev Mex Cienc Pecu 2022;13(1):82-96

3. Salajegheh A, Salarmoini M, Afsharmanesh M, Salajegheh MH. Growth performance, intestinal microflora, and meat quality of broiler chickens fed lavender (Lavandula angustifolia) powder. J Liv Sci Technol 2018;6(1):31-38. 4. Irchhaiya DR. Anumalik Y, Nitika G, Swadesh K, Nikhil G, Santosh K, et al. Metabolites in plants and its classification. World J Pharmacy Pharmaceut Sci 2015;4(1):287-305. 5. Syahidah A, Saad CR, Daud HM, Abdelhadi YM. Status and potential of herbal applications in aquaculture: A review. Iran J Fisher Sci 2015;14(1):27-44. 6. Dalle-Zotte, A, Celia C, Szendrő Z. Herbs and spices inclusion as feedstuff or additive in growing rabbit diets and as additive in rabbit meat: A review. Livest Sci 2016;189:8290. 7. Soliman WSED. Trial on using of some herbal extracts as promising immunoprophylaxis feed additives in cultured Oreochromis niloticus. Egyp J Vet Sci 2017;48(2):53-60. 8. Razo OPB, Mendoza MGD, Silva GV, Osorio TAI, González SJF, Hernández GPA, et al. Polyherbal feed additive for lambs: effects on performance, blood biochemistry and biometry. J Appl Anim Res 2020;48(1):419-424. 9. Khosravinia H, Chethen PS, Umakantha B, Nourmohammadi R. Effects of lipotropic products on productive performance, liver lipid and enzymes activity in broiler chickens. Poultry Sci J 2015;3(2):113-120. 10. Ortega ANI, Mendoza GD, Martínez GJA, Bárcena GR, Buendía RG. Impact of a Polyherbal mixture (Withania somnifera, Ocimum sanctum, Tinospora cordifolia and Emblica officinalis) on lamb growth and ruminal fermentation. Int J Agri Biol Sci 2020;32(12):864-870. 11. Koujalagi S, Chhabra S, Randhawa SNS, Singh R, Randhawa CS, Kashyap N. Effect of herbal bio choline supplementation on oxidative stress and biochemical parameters in transition dairy cows. Pharma Innov J 2018;7(4):842-847. 12. Rodríguez-Guerrero V, Lizarazo AC, Ferraro S, Suárez N, Miranda LA, Mendoza GD. Effect of herbal choline and rumen-protected methionine on lamb performance and blood metabolites. S Afri J Anim Sci 2018;48(3):427-434. 13. De Veth MJ, Artegoitia VM, Campagna, SR, Lapierre H, Harte F, Girard CL. Choline absorption and evaluation of bioavailability markers when supplementing choline to lactating dairy cows. J Dairy Sci 2016;99(12):9732-9744. 14. Khose KK, Manwar SJ, Gole MA, Ingole RS, Rathod PR. Efficacy of herbal choline as a replacement of synthetic choline chloride in diets on growth performance of broilers. J Lives Res 2018;8(10):313-322. 93


Rev Mex Cienc Pecu 2022;13(1):82-96

15. Calderano AA, Nunes RV, Rodrigueiro RJB, César RA. Replacement of choline chloride by a vegetal source of choline in diets for broilers. Ciên Anim Bra 2015;16(1):37-44. 16. Martínez-Aispuro JA, Mendoza GD, Cordero-Mora JL, Ayala-Monter MA, SánchezTorres MT, Figueroa-Velasco JL, Gloria-Trujillo A. Evaluation of an herbal choline feed plant additive in lamb feedlot rations. Rev Bra Zoot 2019;48. 17. NRC. Nutrient Requirements of Rabbits. National Academy of Sciences, Washington, DC. 1977. 18. Peiretti PG, Meineri G. Effects on growth performance, carcass characteristics, and the fat and meat fatty acid profile of rabbits fed diets with chia (Salvia hispanica L.) seed supplements. Meat Sci 2008;80(4):1116-1121. 19. Blasco A. Ouhayoun J. Harmonization of criteria and terminology in rabbit meat research. Revised proposal. World Rabbit Sci 1996;4(2):93-100. 20. Hajji H, Joy M, Ripoll G, Smeti S, Mekki I, Gahete FM, Atti N. Meat physicochemical properties, fatty acid profile, lipid oxidation and sensory characteristics from three North African lamb breeds, as influenced by concentrate or pasture finishing diets. J Food Compos Anal 2016;48:102-110. 21. Wang W, Chen J, Zhou H, Wang L, Ding S, Wang Y, Li, A. Effects of microencapsulated Lactobacillus plantarum and fructooligosaccharide on growth performance, blood immune parameters, and intestinal morphology in weaned piglets. Food Agric Immunol, 2018;29(1):84-94. 22. Celi P, Cowieson AJ, Fru-Nji F, Steinert RE, Kluenter AM, Verlhac V. Gastrointestinal functionality in animal nutrition and health: new opportunities for sustainable animal production. Anim Feed Sci Tech 2017;234:88-100. 23. Liu H, Li K, Mingbin L, Zhao J, Xiong B. Effects of chestnut tannins on the meat quality, welfare, and antioxidant status of heat-stressed lambs. Meat Sci 2016;116:236-242. 24. Mirman D. Growth curve analysis and visualization using R. Chapman & Hall/CRC. The R Series. CRC Press. Boca Raton, FL, USA. 2014. 25. Steel RG, Torrie JH, Dickey DA. Principles and procedures of statistics. A biometrical approach. 2011. 26. Ayala MM, Zepeda BA, Soto SS. Dietary supplementation effects with Ruta graveolens on performance, carcass traits and meat quality on rabbits. Rev Mex Cien Pecu 2020; 11(4):1220-1230.

94


Rev Mex Cienc Pecu 2022;13(1):82-96

27. Zepeda BA, Martínez MA, Simental SS. Carcass and meat quality of rabbits fed Tithonia tubaeformis weed. Rev Bras Zootec 2019;48. 28. Selvam R, Saravanakumar M, Suresh S, Chandrasekeran CV, Prashanth DS. Evaluation of polyherbal formulation and synthetic choline chloride on choline deficiency model in broilers: implications on zootechnical parameters, serum biochemistry and liver histopathology. Asian-Australasian J Anim Sci 2018;31(11):1795. 29. Halls AE. Nutritional requirements for rabbits. Nutreco Canada Inc. Canada 2010. Accessed Jan 4, 2021 https://www.researchgate.net/profile/Rana-Al-Difaie/post/Whatthe-nutrient-requirement-for-rabbit-duringpregnancy/attachment/59d64eb079197b80779a7fc8/AS%3A493952089899008%4014 94778763533/download/nutritional-requirements-of-rabbits.pdf. 30. Fortun-Lamothe L, Boullier S. A review on the interactions between gut microflora and digestive mucosal immunity. Possible ways to improve the health of rabbits. Livestock Sci 2007;107(1):1-18. 31. Javed I, Iqbal Z, Rahman ZU, Khan FH, Muhammad F, Aslam B, Ali L. Comparative antihyperlipidaemic efficacy of Trachyspermum ammi extracts in albino rabbits. Pakistan Vet J 2006;26(1):23. 32. Rezaeipour V, Aghayar F, Bozorgnia A, Norozi M, Zakaria H. Effects of feeding strategies and supplemental lipotropic factors on growth performance, ascites-related indices, serum metabolites and meat quality in broiler chickens reared at high altitude. JAPS, J Anim Plant Sci 2019;29(1):25-32. 33. Zepeda BA, Martínez MA, Simental SS. Carcass and meat quality of rabbits fed Tithonia tubaeformis weed. Rev Bras de Zootec 2019;48:1-10. 34. Hulot F, Ouhayoun J. Muscular pH and related traits in rabbits: a review. World Rabbit Sci 1999;7(1). 35. Kozioł K, Maj D, Bieniek J. Changes in the color and pH of rabbit meat in the aging process. Med Weter 2015;71(2):104-108. 36. Dabbou S, Gasco L, Rotolo L, Pozzo L, Tong JM, Dong XF, Gai F. Effects of dietary alfalfa flavonoids on the performance, meat quality and lipid oxidation of growing rabbits. Asian-Australasian J Anim Sci 2018;31(2):270. 37. Wang Z, He Z, Li H. The effect of repeated freeze-thaw cycles on the meat quality of rabbit. World Rabbit Sci 2018;26(2):165-177.

95


Rev Mex Cienc Pecu 2022;13(1):82-96

38. Pulido HS, Espinosa AE, Hernández GPA, Mendoza MGD. Análisis productivo y económico de la adición de fórmula poliherbal en conejos en finalización. En: Herrera CJ, et al. Avances de la investigación sobre producción animal y seguridad alimentaria en México. Ed. Universidad Michoacana de San Nicolás de Hidalgo. 2018:991-995. 39. Ortega ANI, Mendoza MGD, Bárcena GR, Hernández GPA, Espinosa AE, Martínez GJA, Gloria TA. Economic impact of polyherbal mixtures containing choline, lysine and methionine on milk production and health of dairy cows. Emirates J Food Agric 2020;864-870.

96


https://doi.org/10.22319/rmcp.v13i1.5342 Artículo

Características de la canal y perfil de ácidos grasos de la carne de corderos criollos suplementados con semilla de algodón y maíz

Emiro Suárez Paternina a,b* Libardo Maza Ángulo b Wilson Barragán Hernández a Lorena Aguayo Ulloa a Oscar Vergara Garay b

a

Corporación Colombiana de Investigación Agropecuaria - AGROSAVIA. Centro de Investigación Turipaná. Km 13 vía Montería-Cereté. Montería. Colombia. b

Universidad de Córdoba, Facultad de Medicina Veterinaria y Zootecnia. Grupo de investigación en Producción Animal Tropical, Montería. Colombia.

*Autor de correspondencia: esuarez@agrosavia.co

Resumen: El objetivo fue evaluar las características de la canal y perfil de ácidos grasos (AG) de la carne de corderos criollos suplementados con semilla de algodón (SA) y maíz molido (MM). Se utilizaron 24 machos con 90 días y 16 ± 2 kg de peso inicial. Los corderos se asignaron a cuatro tratamientos, T0: pastoreo; T1: pastoreo + 25%-SA + 75%-MM; T2: pastoreo + 50%SA + 50%-MM y T3: pastoreo + 75%-SA + 25%-MM, bajo un diseño completo aleatorizado. Posterior a 127 días de suplementación, los animales se sacrificaron y se pesó la canal caliente y fría. Se tomaron 200 g del músculo Longissimus dorsi para evaluar la proporción de AG en cada animal mediante cromatografía de gases. Se desarrolló un análisis de varianza para determinar el efecto de la dieta. Los animales suplementados presentaron un peso promedio de 32.15 kg, siendo mayor (P<0.05) al registrado por los corderos del T0 (23.3 kg). De igual forma, se observó un mayor rendimiento promedio de las canales de los

97


Rev Mex Cienc Pecu 2022;13(1):97-114

corderos que recibieron suplementación (48.2 vs 39.5 %). Los AG palmítico y esteárico aumentaron en la carne de animales suplementados (P≤0.05), especialmente en aquellos alimentados con la dieta T2. La suplementación con SA y MM alteró positivamente (P≤0.05) la proporción de los ácidos monoinsaturados (AGM) y polinsaturados (AGP). Los tratamientos no influyeron en (P>0.05) la relación AGM:AGS y el índice de aterogenicidad. Sin embargo, la dieta afectó (P<0.05) la relación AGP:AGS y AG deseables. La suplementación con SA y MM influyó positivamente el peso a la matanza, el rendimiento en canal y el perfil de ácidos grasos en los corderos. Palabras clave: Ovinos, Suplementos energéticos-proteicos, Biohidrogenación.

Recibido: 12/04/2019 Aceptado: 09/04/2021

Introducción En Colombia, las gramíneas son la principal fuente de alimento de los ovinos en virtud de su bajo costo de producción (con relación a los alimentos balanceados), representando la forma más práctica y económica de alimentación(1). Sin embargo, a pesar de su importancia, su productividad se ve afectada debido a las fuertes variaciones climáticas a través del año, las cuales se manifiestan con períodos de lluvias intensas y períodos prolongados de sequía, con duración aproximada de cuatro a cinco meses, ocasionando limitaciones en la producción ganadera, principalmente por la disminución en la disponibilidad y calidad nutricional de los forrajes, lo cual conduce a un bajo desempeño de los animales y afecta la calidad del producto final. En este sentido, es válido incorporar tecnologías que conlleven a mejorar los parámetros productivos de la ovinocultura en la región, por lo tanto, la utilización de subproductos agroindustriales energéticos-proteicos, puede mejorar la calidad nutricional de la dieta e incrementar las ganancias de peso, calidad y conformación de las canales de los ovinos. La semilla de algodón ha sido ampliamente referenciada como un subproducto agroindustrial de alto valor nutricional para la alimentación de rumiantes, la cual se caracteriza por contener altas concentraciones de lípidos, proteína y fibra(2). Sin embargo, su calidad nutricional se ve afectada por el contenido de gossipol, por lo que su inclusión en las dietas debe regularse(3). La semilla de algodón y sus subproductos son fuentes alternativas de alimentos, lo que puede disminuir el costo de la dieta de los animales(4). Estos productos tienen altas concentraciones

98


Rev Mex Cienc Pecu 2022;13(1):97-114

de ácidos grasos, con un importante efecto en mayor ganancia de peso, mayor deposición de grasa en la canal y cambios en el perfil de ácidos grasos de la carne, lo que puede influir en su aceptabilidad por el consumidor y el impacto en la salud humana(5). Por otro lado, la composición de ácidos grasos y las concentraciones de colesterol en la carne han recibido una creciente atención, debido a su relación con la salud humana y calidad del producto(6). Por lo que, la tendencia ha sido un menor consumo de las llamadas grasas saturadas, ya que éstas conllevan a un mayor riesgo de obesidad, cáncer y enfermedades cardiovasculares. En este contexto, la carne de cordero posee un alto contenido de ácidos grasos saturados y también, en menor cantidad, ácidos grasos poliinsaturados. Estos últimos juegan un papel importante en el desarrollo del cerebro y la retina y previenen enfermedades como la inmunodeficiencia, la carcinogénesis, la aterosclerosis, la hipertensión, la obesidad y las enfermedades cardiovasculares(7). Por lo tanto, es fundamental potenciar estos ácidos grasos saludables, como la serie n-3 (los llamados omega 3), y el grupo de isómeros posicionales y geométricos del ácido linoleico (los ácidos grasos CLA) en la carne. En la última década, se vienen utilizando estrategias nutricionales para modificar las concentraciones de los diferentes ácidos grasos en la musculatura de los animales, una de ellas es el uso de semillas de oleaginosas, por su alta concentración en ácidos grasos poliinsaturados(8). Trabajos con dietas para corderos al destete han evidenciado un aumento en la concentración de ácidos grasos de cadena larga en músculo y grasa en corderos engordados de manera intensiva, mejorándose además el color de la grasa subcutánea(9). Por su parte, Peng et al(10) mencionan que es posible tener productos cárnicos de mejor calidad en cuanto a la composición de ácidos grasos benéficos a través de la suplementación con semillas oleaginosas, lo que proporcionaría opciones más saludables para el consumo de estos productos. Dada la creciente importancia del sector ovino en Colombia, se hace necesario realizar este tipo de investigaciones, por lo cual, el objetivo de este estudio fue evaluar las características de la canal y el perfil de ácidos grasos de carne de corderos alimentados con semilla de algodón y maíz molido.

Material y métodos El experimento se desarrolló en la Granja Experimental de la Facultad de Medicina Veterinaria y Zootecnia, de la Universidad de Córdoba sede Berástegui, municipio de Ciénaga de Oro, Córdoba-Colombia. La zona, se encuentra clasificada como bosque húmedo

99


Rev Mex Cienc Pecu 2022;13(1):97-114

tropical, ubicado a 8º52’ N y 75º54’ O, altura a 18 msnm, temperatura promedio de 28 ºC, humedad relativa de 85 % y precipitación anual de 1,340 mm. El área utilizada en pastoreo fue 10,000 m2, establecida en un 70 % en pasto Estrella (Cynodon nlemfluensis Vanderyst) y en un 30 % de pasto Angleton (Dichantium aristatum (Poir.) C.E. Hubb.), la cual se dividió en 13 potreros de 713 m2 con el fin de establecer un sistema rotacional de 2 días de ocupación y 24 días de descanso. Los ovinos salían a pastoreo en horas de la mañana (0800 h) y retornaban al aprisco en horas de la tarde (1600 h), donde eran separados por tratamiento para el ofrecimiento del suplemento. Se emplearon 24 corderos criollos con peso inicial de 16 ± 2 kg y una edad de tres meses, los cuales se suplementaron durante 127 días, con dietas isoenergéticas e isoproteicas basadas en semilla de algodón (SA) y maíz molido (MM). El nivel de suplementación correspondió, en base seca, al 1% del peso vivo de los animales. La inclusión de la semilla de algodón y maíz molido en base seca variaron para así conformar los tratamientos a evaluar: T1) Pastoreo, T2) Pastoreo + 25% SA + 75% MM, T3) Pastoreo + 50% SA + 50% MM y T4: Pastoreo + 75% SA + 25% MM. Las dietas experimentales fueron formuladas de acuerdo con el NRC(11) atendiendo los requerimientos de proteína y energía metabolizable para una ganancia diaria de peso promedio de 160 g. Durante el ensayo se realizaron ajustes según el incremento de peso de los animales. La calidad nutricional del forraje y suplementos se determinó de muestras compuestas. Las muestras de forraje se colectaron a través del método de simulación de pastoreo (hand plucking) por cada muestra de forraje se colectaron 500 g por muestra, las cuales se secaron en estufa de ventilación forzada a 60 °C por 48 h, posteriormente se molieron con un molino tipo Willey, mediante la utilización de una malla de un milímetro. El procesamiento de las muestras se realizó en el Laboratorio de Nutrición Animal de Agrosavia C.I. Turipaná, en donde se determinó proteína cruda (método Kjeldalh), fibra en detergente neutro (FDN), fibra en detergente ácido (FDA) según el método de la Association of Official Analytical Chemists(12) y la digestibilidad in situ de la materia seca (DISMS) según la técnica de la bolsa de nylon(13). La composición nutricional de las dietas fue estimada de acuerdo con el Sistema de Nutrición para Pequeños Rumiantes (SRNS) (Cuadro 1). De igual forma, se determinó la composición de ácidos grasos de la pastura y fuentes alimenticias utilizadas (Cuadro 2).

100


Rev Mex Cienc Pecu 2022;13(1):97-114

Cuadro 1: Composición nutricional de las dietas utilizadas en la alimentación de los corderos Composición nutricional de las dietas Componente (T0) (T1) (T2) (T3) Pastura 25SA:75 MM 50SA:50 MM 75SA:25 MM PC, % 13.0 14.8 15.6 15.0 EM, Mcal/kg 2.1 2.3 2.3 2.3 FDN, % 56.4 48.6 51.9 55.2 EE, % 2.4 3.6 4.9 6.1 Digestibilidad, % 48.0 56.2 58.6 59.0 SA= semilla de algodón; MM= maíz molido; PC= proteína cruda, EM= energía metabolizable, FDN= fibra detergente neutro, EE= extracto etéreo. T0= pastoreo, T1= pastoreo + 25% semilla de algodón (SA)+ 75% maíz molido (MM), T2= pastoreo + 50% SA + 50% MM y T3= pastoreo + 75% SA + 25% MM.

Cuadro 2: Perfil de ácidos grasos (%) para la pastura, semilla de algodón y maíz molido, empleados en la alimentación de los corderos Ácidos grasos Saturados C12:0 (Láurico) C14:0 (Mirístico) C16:0 (Palmítico) C18:0 (Esteárico) C20:0 (Araquídico) C22:0 (Behénico) C24:0 (Lignocérico) Monoinsaturado C18:1.9 (Oleico) Poliinsaturados C18:2 (Linoleico) C18:3 (Linolénico) AGS AGM AGP

Pastura

Semilla de algodón

Maíz molido

0.010 0.005 0.490 0.085 0.030 0.025 0.030

0.004 0.170 5.560 0.770 0.090 0.050 0.030

0.001 0.260 0.050 0.010 0.010

0.135

4.370

0.660

0.875 2.800 0.675 0.135 3.675

18.780 0.100 6.674 4.370 18.880

1.740 0.050 0.331 0.660 1.790

AGS= ácidos grasos saturados, AGM= ácidos grasos monoinsaturados, AGP= ácidos grasos poliinsaturados.

Para determinar el consumo de materia seca (CMS) fue necesario estimar el volumen de heces y la digestibilidad del alimento, para lo cual se utilizó oxido de cromo (Cr2O3) como marcador externo y la fibra detergente ácida indigerible como marcador interno (FDAi). Para la estimación de la producción de heces, el Cr2O3 fue dosificado diariamente vía oral durante 15 días. La dosificación se realizó mediante cápsulas de gelatina de 1 g, a las 0700 h. En los últimos cinco días de la dosificación, se realizó la colecta de heces directamente de la ampolla 101


Rev Mex Cienc Pecu 2022;13(1):97-114

rectal dos veces al día a las 0800 y 1600 h. Las muestras fecales se homogenizaron para formar una muestra compuesta por animal. Posteriormente, las muestras se secaron en una estufa de ventilación forzada a 60 °C durante 48 h y se molieron utilizando una malla de 1 mm. Para la determinación de la concentración del Cr2O3 en las heces se utilizó la metodología de digestión por microondas (3051) propuesta por la Agencia de Protección Ambiental de los Estados Unidos(14). La producción fecal estimada en gramos de materia seca por día (g MS.día-1), se obtuvo mediante el cociente de las dosis del marcador, dividido por la concentración del marcador en las heces(15). Posterior a 45 días de haberse iniciado el experimento, se tomaron 3 g de muestras compuestas de pasto, suplementos alimenticios y heces de cada animal para determinar la FDAi. Las muestras se empacaron por triplicado en bolsas de nylon de 5 x 12 cm, las cuales se fijaron a la cánula mediante nylon de 10 cm de longitud. Las bolsas ya sujetas a la cadena se remojaron tres veces en un balde con agua limpia y luego se introdujeron en el rumen de un bovino macho fistulado con una dieta basada en pastoreo, donde permanecieron durante 144 h. Al final las bolsas se retiraron y se lavaron con agua limpia. Las bolsas se secaron a 60 oC durante 24 h, se retiraron los residuos correspondientes a las repeticiones de cada muestra, para luego ser sometidas durante una hora en solución en detergente ácido y lavadas con agua caliente y acetona; una vez secadas las muestras el residuo se consideró como la FDAi(16). Con base en la FDAi se estimó la digestibilidad de la MS utilizando la ecuación (Ec.1)(17). DMS = 100 – 100 x (% de marcador en la MS del alimento) x (tasa de recuperación del marcador en las heces) / (% del marcador en la MS de las heces) (Ec. 1). El CMS se determinó en función de la producción fecal y la digestibilidad estimada con el marcador interno (Ec. 2). Para ello, se utilizó la ecuación establecida por Ramírez et al(15). Consumo voluntario (g/d) =

(Producción fecal, g MS/ d) 𝐷𝑖𝑔 𝑀𝑆

[1−( 100 )]

(Ec.2).

Posterior a 127 días de evaluación, los animales se transportaron en camión hasta una planta de matanza y procesado privada adaptada y autorizada por la autoridad competente para el sacrificio de ovinos (registro INVIMA 007OC), ubicada en el municipio de Cereté (Colombia). Previo a la matanza, los ovinos se sometieron a ayuno por un período de 12 h con acceso a agua. Se siguieron los protocolos técnicos establecidos por la planta que incluyen matanza utilizando una pistola de perno cautivo para el aturdimiento de los ovinos. Posteriormente, se determinó el peso de la canal caliente (PCC) y luego de permanecer 24 h a 4 ºC, el peso de canal fría (PCF). Se calculó el rendimiento de canal en caliente y frío como la relación entre el PCC, PCF y el peso vivo (PV) en ayuno.

102


Rev Mex Cienc Pecu 2022;13(1):97-114

De cada canal, se obtuvieron 200 g de músculo Longissimus dorsi obtenido de la media canal izquierda de cada animal, entre la decimoprimera y decimotercera costilla. Los lípidos totales se extrajeron por duplicado mediante el procedimiento de extracto etéreo; para tal fin se pesaron 2 g de muestra y se lavó con un solvente en un equipo Golfish® para la extracción de grasa con éter de petróleo por un tiempo de 5 h. El contenido de lípidos totales se determinó gravimétricamente por diferencia de peso en los vasos de extracción. La metilación de los ácidos grasos se realizó sobre 50 a 60 mg del extracto lipídico agregándole 500 μl de KOH 1N en metanol con agitación; posteriormente se agregaron 700 μl de xileno para permitir la separación completa de los esteres metílicos de los ácidos grasos en dos fases; de la fase oleosa (xileno) se tomaron 100 μl y se le adicionaron 50 μl de xileno creando una dilución de la cual se inyectó una alícuota de 5μl en un cromatógrafo de gases marca Agilent Technologies modelo 6890N®, acoplado a un detector de ionización de llama (FID) equipado con una columna DB-225 y un autoinyector Split/Splitless. Las condiciones de operación fueron las siguientes: el volumen de inyección fue de 2 µl (a 250 °C), el gas portador fue helio (1 ml/min), y la temperatura del detector se mantuvo constante a 220 °C. Se inició con una temperatura de 70 °C y se programó una rampa de calentamiento por intervalos de tiempo hasta alcanzar una temperatura de 220 °C con incremento de 2 °C por minuto. La identificación de los ácidos grasos (AG) se basó en la comparación de tiempos de retención del patrón y el área bajo la curva de los picos. Los AG se cuantificaron usando el software de estación de trabajo Galaxie (Varian Inc., Palo Alto, California, EE.UU.). Una vez identificados los ácidos grasos, se establecieron la sumatorias total de ácidos grasos saturados (AGS), monoinsaturados (AGM), poliinsaturados (AGP) y calculada la relación AGM:AGS, AGP:AGS. Los ácidos grasos deseables (AGD) se calcularon teniendo en cuenta los ácidos monoinsaturados, poliinsaturados y esteárico(18). Asimismo, para determinar el potencial de obstrucción de las arterias se estableció el índice de aterogenicidad mediante la ecuación propuesta por Ulbrich y Southgate(19), IA=(C12:0+4*C14:0+C16:0)/ AG insaturados. Se utilizó un diseño completamente aleatorizado con cuatro tratamientos y seis repeticiones para evaluar el efecto de los porcentajes de inclusión de la SA y MM sobre las características de la canal y el perfil de ácidos grasos de la carne de ovinos. El modelo matemático que describió el diseño fue: Yij = ɥ + Tj + eij Donde. Yij, es la variable respuesta; µ es la media general; Tj es el efecto del j-esimo tratamiento; e, es el error aleatorio de la i-esima replica que recibió el j-esimo tratamiento, distribuido N (0,1) y 2 constante. 103


Rev Mex Cienc Pecu 2022;13(1):97-114

Se realizó análisis de varianza (ANOVA), previo cumplimiento de los supuestos de normalidad y homogeneidad de los datos, para lo cual se utilizó la prueba de Shapiro Wilk y Levene, respectivamente. Para el análisis de los datos se utilizó el procedimiento GLM del paquete de análisis estadístico SAS(20). Las medias de tratamiento se compararon utilizando la prueba de Tukey con un nivel de significancia de P≤0.05. Para la realización de este estudio se contó con el aval del Comité de Ética de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad de Córdoba.

Resultados La suplementación con semilla de algodón y maíz molido influyó la ingestión de materia seca de los ovinos. El consumo observado en los animales del tratamiento 75SA:25 MM, fue de 1.4 kg.d-1 con diferencia (P≤0.05) al obtenido por los animales del tratamiento testigo, los cuales presentaron consumos medios de 0.514 kg.d-1. Sin embargo, no se observaron diferencias del consumo en los animales que recibieron suplementación 25SA:75MM, 50SA:50MM y 75SA:25MM (Cuadro 3). Cuadro 3: Consumo promedio de materia seca y de nutrientes de ovinos criollos suplementados con semilla de algodón y maíz molido (T0) (T1) (T2) (T3) Variables p Pastura 25SA:75 MM 50SA:50 MM 75SA:25 MM CMST, kg.día-1 0.514 b 0.788 ab 1.020 ab 1.400 a 0.0366 -1 b b ab a CMSF, kg.día 0.514 0.463 0.695 1.070 0.0021 -1 Suplemento, kg.día 0.325 0.325 0.325 -1 CPB, kg.día 0.121 0.160 0.169 0.178 -1 CEM, Mcal.día 1.960 2.530 2.440 2.360 SA= semilla de algodón; MM= maíz molido; CMST= consumo de materia seca total, CMSF= consumo de materia seca de forraje, CPB= consumo de proteína bruta, CEM= consumo de energía metabolizable. ab Letras diferentes en las filas difieren estadísticamente según la prueba de Tukey (P≤0.05).

El peso vivo a la matanza difirió (P≤0.05), al igual que el PCC, PCF, siendo las canales de los animales del tratamiento testigo las menos pesadas. De igual forma, se encontraron diferencias (P≤0.05) para el RCF, presentando los animales del tratamiento 50SA:50MM, los mayores rendimientos con un 45.17 % superando en 5.6, 3.8 y 3.0 unidades porcentuales a los rendimientos registrados en las canales de los tratamientos pastura, 25SA:75MM, y 75SA:25MM, respectivamente (Cuadro 4).

104


Rev Mex Cienc Pecu 2022;13(1):97-114

Cuadro 4: Características de la canal de ovinos criollos suplementados con semilla de algodón y maíz molido (T0) (T1) (T2) (T3) Variable p R2 CV (%) Pastura 25SA:75 MM 50SA:50 MM 75SA:25 MM PVM 23.30 b 32.03 a 31.78 a 32.65 a 0.0063 0.80 12.7 b a a a PCC, kg 11.00 15.26 16.03 15.40 0.0098 0.68 13.7 b a a a PCF, kg 9.51 13.54 14.48 13.90 0.0052 0.71 14.1 b ab a ab RCF, % 39.51 41.33 45.17 42.14 0.0290 0.62 5.5 SA= semilla de algodón; MM= maíz molido; PVM= peso vivo a la matanza, PCC= peso canal caliente, PCF= peso canal fría, RCF= rendimiento canal fría. ab Letras diferentes en las filas difieren estadísticamente según la prueba de Tukey (P≤0.05).

A pesar de que no hubo diferencia en el peso a la matanza entre los animales que recibieron suplementación, el tratamiento 75SA:25MM resultó ser el más económico, ya que empleó US$10.4 en la compra del suplemento, a diferencia de los tratamientos 25SA:75MM y 50SA:50MM, los cuales incurrieron en un gasto en la suplementación de US$13.1 y US$11.6, respectivamente. La viabilidad del tratamiento 75SA:25MM se debió a un menor costo de la semilla de algodón y al mayor nivel de inclusión implementado. Se encontró efecto significativo (P≤0.05) de las dietas evaluadas sobre la proporción de los AGM. El tratamiento 50SA:50MM, presentó la mayor concentración con un 10.14 % seguido de los tratamientos 25SA:75MM y 75SA:25MM con 9.0 y 7.44 %, respectivamente, mientras que el tratamiento testigo fue el que registró la menor proporción 3.29 % (Cuadro 5). Se identificaron diferencias (P≤0.05) en la proporción de AGP. Los tratamientos 25SA:75MM, 50SA:50MM y 75SA:25MM registraron la mayor abundancia 1.52 %, con relación al tratamiento testigo (0.78 %). La proporción de ácido graso linoleico (C18:2), varió de 0.5 % en el tratamiento testigo a 1.47 % en el tratamiento 75SA:25MM (P≤0.05). En lo que respecta al ácido graso linolénico (C18:3) no se detectaron diferencias (P>0.05) entre tratamientos, con un valor medio de 0.2 %.

105


Rev Mex Cienc Pecu 2022;13(1):97-114

Cuadro 5: Perfil de ácidos grasos (%) en la carne de ovinos criollos suplementados con semilla de algodón y maíz molido (T1) (T2) (T3) (T0) CV Ácidos grasos 25SA:75 50SA:50 75SA:25 p R2 Pastura (%) MM MM MM Saturados 4.67 b 11.70 ab 13.51 a 10.78 ab 0.017 0.46 39.4 C10:0 (Cáprico) 0.01 0.02 0.03 0.03 0.230 0.24 56.6 C12:0 (Láurico) 0.01 0.03 0.03 0.02 0.234 0.27 77.5 C14:0 (Mirístico) 0.15 0.45 0.50 0.36 0.128 0.54 49.7 b ab a ab C16:0 (Palmítico) 1.82 5.16 6.05 4.71 0.075 0.59 43.6 b ab a ab C18:0 (Esteárico) 2.63 6.00 6.83 5.60 0.058 0.61 35.6 C20:0 (Araquídico) 0.03 0.04 0.05 0.04 0.698 0.10 43.7 C22:0 (Behénico) 0.01 . 0.02 0.01 0.247 0.43 28.1 C24:0(Lignocérico) 0.02 . . 0.02 0.667 0.11 32.9 b ab a ab Monoinsaturados 3.29 9.02 10.14 7.44 0.043 0.53 48.9 b ab a ab C18:1 (Oleico) 3.29 9.02 10.14 7.44 0.043 0.53 48.9 b ab a a Poliinsaturados 0.78 1.42 1.57 1.59 0.013 0.48 28.5 b a a a C18:2 (Linoleico) 0.50 1.19 1.39 1.47 0.004 0.77 25.4 C18:3 (Linolénico) 0.28 0.23 0.17 0.12 0.185 0.50 55.0 AGM:AGS 0.72 0.75 0.73 0.69 0.745 11.7 a b b ab APS:AGS 0.20 0.12 0.12 0.15 0.015 0.47 24.7 b ab a ab AGD 6.71 16.45 18.54 14.64 0.028 0.42 41.4 IA 0.45 0.51 0.53 0.50 0.182 0.30 9.86 SA= semilla de algodón; MM= maíz molido; P= probabilidad, R2= coeficiente de determinación, CV= coeficiente de variación. AGM/AGS= monosinsaturados:saturados, AGP/AGS= poliinsaturados:saturados, AGD= ácidos grasos deseables, IA= índice de aterogenicidad. ab Letras diferentes en las filas difieren estadísticamente según la prueba de Tukey (P≤0.05).

Para la relación de los ácidos grasos monoinsaturados y poliinsaturados no se observaron diferencias (P>0.05) entre los tratamientos, con valores medios de 0.72; sin embargo para la relación AGP:AGS el análisis detectó efecto significativo (P≤0.05), registrando el tratamiento testigo la mayor relación (Cuadro 5). El índice de aterogenicidad (IA) de la carne de cordero osciló entre 0.45 a 0.53, sin diferencias (P>0.05) entre las dietas evaluadas.

Discusión De acuerdo con los resultados expuestos en el Cuadro 3, los mayores consumos observados en los animales que recibieron suplementación pueden ser atribuidos a una mayor calidad nutricional de la dieta (Cuadro 1), la cual generó probablemente un mayor aporte de energía 106


Rev Mex Cienc Pecu 2022;13(1):97-114

y de proteína, mejorando así el ambiente ruminal y favoreciendo la tasa de pasaje de la materia orgánica ingerida. Estos resultados son consistentes con la tendencia estadística observada en el consumo de forraje, en la cual se observa que los animales que se mantuvieron en los tratamientos 50SA:50MM y 75SA:25MM incrementaron su consumo de forraje en 1.21 y 2.08 veces más, comparados con los animales sin suplementar. En general, el nivel de consumo de materia seca y de nutrientes hallado en los animales que recibieron suplementación fue adecuada para ovinos de 30 kg de peso vivo(11). Resultados semejantes a los de este estudio fueron reportados por Cunha et al(21), quienes valoraron la inclusión de semilla de algodón en un 20, 30 y 40 % en la dieta para ovinos Santa Inés notificaron consumos medios de 1.23, 1.12 y 1.19 kg.día-1, respectivamente. De igual forma, De Sousa(22) al evaluar la inclusión de semilla de algodón en un 7, 14, 21 y 28 % en la alimentación de ovinos en confinamiento, observó que el consumo tuvo un comportamiento lineal decreciente conforme se aumentó el aporte de semilla de algodón, reportando valores medios de 1.12, 1.16, 1.02 y 0.82 kg.día-1, respectivamente, consumos ligeramente superiores a los encontrados en el presente estudio. La reducción en el CMS de ovinos suplementados con semilla de algodón está directamente relacionada al nivel de inclusión en la dieta y a su relación con el contenido de extracto etéreo, generalmente superior al 6 % en la dieta(23). Al respecto Junior et al(24) reportaron disminución en el consumo de ovinos Santa Inés x Dorper a partir del 21.55 % de inclusión de semilla de algodón en la dieta, con un porcentaje de EE de 4.89 %, efecto contrario fue observado en el presente estudio, particularmente en el tratamiento 75SA:25MM, en donde la inclusión de semilla de algodón representó el 17.4 % del consumo total de materia seca con un aporte del 6.1 % de EE, dichos niveles no afectaron la digestibilidad de la materia orgánica ingerida. En este sentido, Cunha et al(21) indican que la inclusión de semilla de algodón hasta en un 25 y 30 % de la ración total, no afecta la digestibilidad de la fibra, lográndose mantener consumos adecuados. Los resultados alcanzados en este estudio demuestran que el aporte de energía y proteína a partir del suplemento es utilizado con mayor eficiencia para las ganancias de peso, viéndose reflejado en un mayor peso vivo y rendimientos cárnicos. Con base en esta afirmación, la respuesta animal puede verse influenciada por el tipo de alimento(25). Por lo tanto, el bajo desempeño expuesto por los animales que recibieron solo pastura pueden ser explicado por el bajo consumo de proteína y energía que en el caso de este tratamiento el aporte de estos nutrientes fue dado por las gramíneas pastoreadas. Al respecto Calsamiglia(26), afirma que cuando los ovinos consumen sólo forrajes y el valor nutricional de los mismos es de baja calidad, la ingestión de nutrientes puede resultar inadecuada para obtener niveles de producción aceptables. Los valores medios de PV, PCC, PCF y RCF obtenidos en este estudio son superiores a los reportados por Viana(27), quien evaluando la sustitución de concentrado por la semilla de algodón en un 40 % en la dieta de ovinos Santa Inés reportó valores de 32.4, 13.05, 12.71 kg y 42.64 %, respectivamente para PV, PCC, PCF y RCF. 107


Rev Mex Cienc Pecu 2022;13(1):97-114

Asimismo, a los obtenidos por Pires et al(28), los cuales registraron PCC y PCF de 13.0 y 12.5 kg en ovinos Santa Inés puros; pero similares a los publicados por Yamamoto et al(29), quienes evaluaron diferentes fuentes de aceites vegetales en ovinos Santa Inés y Dorset x Santa Inés, reportando valores PCC y PCF 14.56 y 14.18 kg para Santa Inés y 14.45 y 14.14 kg para el cruce entre Dorset x Santa Inés, respectivamente. Las concentraciones de AGS en el músculo Longissimus dorsi presentó diferencias (P≤0.05) entre los tratamientos evaluados (Tabla 5). En este sentido, el tratamiento testigo registró la menor proporción de AGS (P≤0.05), con relación a las proporciones de AGS de la carne de los tratamientos con suplementación. Las mayores concentraciones de AGS observadas en la carne de los animales que recibieron suplementación (T1, T2 y T3) pueden estar relacionadas con la composición nutricional de las dietas que consumieron, ya que se observó un mayor aporte de AGS. Madruga et al(30) manifestaron que la alimentación con semilla de algodón contribuye a incrementar la proporción de AGS en la carne de ovinos debido a su alta concentración de extracto etéreo. Dentro de los AGS, el ácido palmítico (C16:0) y el ácido esteárico (C18:0), fueron influenciados (P≤0.05) por las dietas evaluadas. Los ácidos grasos mirístico (C14:0) y palmítico (C16:0) son considerados hipercolesterolémicos; sin embargo, el esteárico (C18:0) a pesar de que es un ácido graso saturado y que representa entre 10 y 20 % de las grasas producida por lo rumiantes, no tiene esta propiedad(30). El ácido esteárico presentó las mayores (P≤0.05) proporciones en los tratamientos que recibieron semilla de algodón con relación al tratamiento testigo, resultados interesantes considerando el ácido esteárico es precursor del ácido oleico (C18:1), que es un ácido abundante en la carne de corderos(31). El porcentaje del ácido mirístico (C14:0) no difirió (P>0.05) entre los tratamientos, lo cual es conveniente cuando se piensa en los beneficios de la salud humana, ya que este es un ácido hipercolesterolémico. Sin embargo, para la proporción del ácido palmítico (C16:0) ésta fue mayor (P≤0.05) en los tratamientos suplementados. Para algunos investigadores(30,32), las altas concentraciones de ácidos hipercolesterolémicos pueden conducir a aumentos de la síntesis de colesterol y promover la acumulación de lipoproteínas de baja densidad, que representan un factor de riesgo para la aparición de enfermedades cardiovasculares. Las concentraciones halladas en el presente estudio son menores a las señaladas en otros trabajos(22,33), donde evaluaron porcentajes de inclusión de semilla de algodón entre un 15 y 30 % en la dieta de ovinos Santa Inés, y reportaron concentraciones de ácidos hipercolesterolémicos 71 % superiores a los alcanzados en este estudio. El contenido de los ácidos grasos monoinsaturados (oleico C18:1) varió entre los diferentes tratamientos, siendo influenciado (P≤0.05) por las dietas. Asimismo, la proporción de los ácidos grasos poliinsaturados (sumatoria de C18:2, linoleico y C18:3, linolénico) también fueron afectados (P≤0.05) por las dietas, presentando los tratamientos con suplementación las mayores proporciones. Con relación a estos resultados, Madruga et al(30) reportaron 108


Rev Mex Cienc Pecu 2022;13(1):97-114

valores superiores a los del presente estudio; sin embargo, estos autores no encontraron diferencias en las concentraciones de ácidos grasos monoinsaturados y poliinsaturados al evaluar la inclusión de semilla de algodón en un 20, 30 y 40 en la dieta de ovinos Santa Inés, lo cual contrasta con los resultados obtenidos en esta investigación, en donde la inclusión de la semilla de algodón produjo un aumento significativo de las concentraciones de los ácidos grasos monoinsaturados y poliinsaturados a favor de los tratamientos que recibieron semilla de algodón. El aumento de los ácidos grasos insaturados es benéfico para la salud humana, por ser hipocolesterolémicos, ya que tienden a disminuir el colesterol en sangre(34,35). En este estudio se observó un aumento (P≤0.05) en las proporciones de ácidos grasos monoinsaturados y poliinsaturados en la carne de los animales vinculados a los tratamientos con suplementación. Los factores que pudieron haber contribuido a estos resultados, están relacionados con el contenido nutricional de las fuentes alimenticias utilizadas, las cuales generaron un aumento de ácidos grasos monoinsaturados y poliinsaturados en la carne. Otra justificación a los resultados obtenidos puede ser a que la dieta de los tratamientos que recibieron suplementación presentó una mayor digestibilidad, lo cual, promovió posiblemente una mayor tasa de pasaje del material orgánico ingerido, con lo que se pudo generar una biohidrogenación incompleta a nivel ruminal. Al respecto, Bauman et al(36) afirman que dietas con mayor proporción de concentrados aumentan la tasa de pasaje en rumen. Por su parte, Vargas et al(37) indicaron que, en dietas con mayor proporción de ácido linoleico en comparación con ácido linolénico, contribuyen a mayor acumulación y tasa de pasaje de ácido linoleico por escape al proceso de biohidrogenación total. Estos mismos autores indican que la acumulación de ácido linoleico, debido a su menor tasa de biohidrogenación, contribuye a incrementar la tasa de pasaje de ácidos grasos de configuración trans (ácido linoleico conjugado y ácido vaccénico) como producto del proceso incompleto de biohidrogenación. Lo anterior sugiere que las dietas que incluyeron semilla de algodón pudieron afectar el proceso de biohidrogenación, como lo sugiere la tendencia a menor proporción de ácido graso esteárico y oleico en el tratamiento que recibió 75SA:25MM comparado con los demás tratamientos suplementados. Esto pudo generar una acumulación y mayor tasa de pasaje de ácido linoleico y posiblemente sus productos intermedios de biohidrogenación, al evidenciar una mayor participación de este ácido graso en el músculo de los corderos suplementados, versus el tratamiento testigo. Es importante resaltar que el ácido linoleico es considerado un ácido graso esencial para los humanos, cuya única fuente es la dieta(38). La relación AGP:AGS, hallada en este estudio estuvieron dentro del rango 0.15 a 0.25 propuesto para animales criados a pastoreo(39,40). De acuerdo con Jakobsen(41), se debe reducir la ingestión de grasas ricas en colesterol y ácidos grasos saturados y aumentar el consumo de ácidos grasos monoinsaturados y poliinsaturados, ya que, contribuyen a reducir los riesgos 109


Rev Mex Cienc Pecu 2022;13(1):97-114

de obesidad, cáncer y enfermedades cardiovasculares. Las grasas que presentan una baja relación de AGP:AGS son consideradas no favorables, ya que pueden inducir un incremento de colesterol en la sangre(42). Los ácidos grasos deseables en los tratamientos suplementados fueron superiores en un 60 % (P≤0.05) con relación al tratamiento testigo, estos resultados pueden deberse posiblemente al efecto de la dieta, ya que los tratamientos que recibieron semilla de algodón y maíz molido realizaron un mayor aporte de AGM y AGP, lo cual generó incrementos significativos en las proporciones de estos ácidos en la carne. Este efecto se considera adecuado dado a que los AGM y AGP reducen los niveles de lipoproteínas de baja densidad y consecuentemente el riesgo de padecer obesidad, cáncer y enfermedades cardiovasculares(42,43). Sin embargo, los resultados encontrados en este estudio son inferiores a los reportados en la literatura(31,42,43), debido posiblemente a los mayores niveles de inclusión de semilla de algodón evaluados en la dieta de ovinos Santa Inés, los cuales oscilaron entre un 15 y 40 %. Con relación al índice de aterogenicidad (IA), este indica el potencial de estímulo de agregación plaquetaria, y sugiere que, a valores bajos de IA, mayor es la cantidad de ácidos grasos antiaterogénicos y mayor es el potencial de prevención de la aparición de enfermedades cardiovasculares(41). Los resultados hallados en este estudio están dentro de los valores recomendados por Ulbricht y Southgate(19), los cuales proponen un valor ideal de <1.0 para carne de cordero.

Conclusiones e implicaciones La suplementación con semilla de algodón y maíz molido promovió un mayor peso a la matanza y rendimiento en canal, asimismo, logró aumentar las concentraciones de los ácidos grasos monoinsaturados y poliinsaturados en la carne de ovinos. A pesar de que no se observó disminución en la digestibilidad y consumo de materia seca en los tratamientos que recibieron suplementación con semilla de algodón, se recomienda adelantar más estudios para determinar el máximo nivel de inclusión de esta materia prima en las dietas para pequeños rumiantes. Bajo las condiciones de este estudio se recomienda suplementar a razón del 1 % del peso vivo y utilizar la semilla de algodón y maíz en las proporciones 75:25, ya que desde el punto económico resultó ser la dieta con los menores costos.

Agradecimientos A la Universidad de Córdoba por la financiación del proyecto de investigación (Código 11901) y a la Facultad de Medicina Veterinaria y Zootecnia. Asimismo, al Departamento

110


Rev Mex Cienc Pecu 2022;13(1):97-114

Administrativo de Ciencia, Tecnología e Innovación COLCIENCIAS y al fondo de regalías del departamento de Sucre por la beca otorgada al primer autor. Literatura citada: 1.

Socarrás ZM, Fandiño R, Miranda Á, Fernández RG. Manejo de ovinos de pelo en el trópico. Valledupar, Colombia: Corporación Colombiana de Investigación Agropecuaria, Corpoica; 2009.

2.

Osti NP, Pandey SB. Use of whole cotton seed and cotton seed meal as a protein source in the diet of ruminant animals: Prevailing situation and opportunity. 6th National Workshop on Livestock and Fisheries Research. Khumaltar, Nepal. 2006:111-119.

3.

Akande KE. Major antinutrients found in plant protein sources: their effect on nutrition. Pak J Nutr 2010;9(8):827-832.

4.

Paim TP, Louvandini H, Mcmanus CM, Abdalla AL. Uso de subprodutos do algodão na nutrição de ruminantes. Ciênc Vet Tróp 2010;(13):24–37.

5.

Calkins CR, Hodgen JM. A fresh look at meat flavor. Meat Sci 2007;(77):63-80.

6.

Linares M Gallo C. Perfil de ácidos grasos de carne de ovino y caballo criados bajo un sistema de producción extensiva. Rev Investig Vet 2013;24(3):257-263.

7.

Bhattacharya A, Banu J, Rahman M, Causey J, Fernandes G. Biological effects of conjugated linoleic acids in health and disease. J Nutr Biochem 2007;17(12):789-810.

8.

Zhang RH, Mustafa AF, Zhao X. Effects of feeding oilseeds rich in linoleic and linolenic fatty acids to lactating ewes on cheese yield and on fatty acid composition of milk and cheese. Anim Feed Sci Technol 2006;(127):220–233.

9.

Berthelot V, Bas P, Pottier E, Normand J. The effect of maternal linseed supplementation and/or lamb linseed supplementation on muscle and subcutaneous adipose tissue fatty acid composition of indoor lambs Effects on methane production, rumen fermentation, and milk production. Meat Sci 2012;(90):548–557.

10. Peng YS, Brown MA, Wua JP, Liu Z. Different oilseed supplements alter fatty acid composition of different adipose tissues of adult ewes. Meat Sci 2010;(85):542–549. 11. NRC, National Research Council. Nutrient Requirements of Small Ruminants: Sheep, Goats, Cervids, and New World camelids. Washington; DC, USA: National Academic Press; 2007. 12. AOAC, Association of Official Analytical Chemists. Official Methods of Analysis. XIII ed. Washington; DC, USA; 2002.

111


Rev Mex Cienc Pecu 2022;13(1):97-114

13. Orskov ER, Howell FD, Mould F. The use of nylon bag technique for the evaluation of feedstuff. Trop Anim Prod 1980;15(3):195-213. 14. EPA. Method 3051A, Microwave assisted acid digestion of sediments, sludges, soil and oil; 2007. 15. Ramírez-Pérez AH, Buntinx SE. Tapia-Rodríguez CY, Rosiles R. Effect of breed and age on the voluntary intake and the micromineral status of non-pregnant sheep. 1. Estimation of voluntary intake. Small Ruminant Res 2000;(37):223–229. 16. Ferreira MA, Valadares FSC. Avaliação de indicadores em estudos com ruminantes: digestibilidade. Rev Bras Zootec 2009;38(8):1568-1573. 17. Correa H, Pabón M, Sánchez M, Carulla J. Efecto del nivel de suplementación sobre el uso del nitrógeno, el volumen y la calidad de leche en vacas Holstein de primero y segundo tercio de lactancia en el trópico alto de Antioquia. Livest Res Rural Develop 2011;23(4). http://www.lrrd.org/lrrd23/4/corr23077.html. 18. Landim LA, Cardoso M, Castanheira M, Fioravanti M, Louvandini H, Mcmanus C. Fatty acid profile of hair lambs and their cross-breds slaughtered at different weights. Trop Anim Health and Prod 2011;(43):1561-1566. 19. Ulbricht TL, Southgate DA. Coronary heart disease: seven dietary factors. Lancet 1991;(338): 985–992. 20. SAS. SAS/STAT User’s Guide (Release 9.1.3). Cary NC, USA: SAS Inst. Inc. 2007. 21. Cunha MGG, Carvalho FRR, Véras ASV, Batista AMY. Desempenho e digestibilidade aparente em ovinos confinados alimentados com dietas contendo níveis crescentes de caroço de algodão integral. Rev Bras Zootec 2008;37(6):1103-1111. 22. De Sousa AR. Caroço de algodão moído na alimentação de cordeiros (as) em confinamento [tese mestrado]. Piracicaba, Brasil: Escola Superior de Agricultura Luiz de Queiroz; 2014. 23. Palmquist DL. Digestibility of cotton lint ber and whole oilseeds by ruminal microorganisms. Anim Feed Sci Technol 1995;56(3):231-242. 24. Junior JR, Carvalho DMG, De Souza JG, Cabral LS, Da Silva JJ, Riveiro MD, Arnoldo TRQ, De Oliveira AS, Soares JQ. Caroço de algodão em dietas sem volumoso para cordeiros confinados. Semina: Ciênc Agrárs 2015;36 (4):2727-2738. 25. Piona MNM, Cabral LS, Zervoudakis JT, Abreu JG, Galati RL, Caetano GGG, Silva AR. Niveis de Caroço de algodão na dieta de cordeiros confinados. Rev Bras Saúde Prod Anim 2012;13(1):110-122.

112


Rev Mex Cienc Pecu 2022;13(1):97-114

26. Calsamiglia SE. La suplementación en los ovinos. Memorias IV Congreso Nacional Ovinos, Querátaro, Mexico. 1998:64-75. 27. Viana GP. Desempenho e avaliação da carcaças de ovinos Santa Inês suplementados com caroço de algodão e seus co-produtos [PhD Dissertation]. Brasilia, Brasil: Universidade de Brasilia; 2011. 28. Pires CC, Galvani BD, Carvalho S, Cardoso RA, Gasperin BG. Características da carcaça de cordeiros alimentados com dietas contendo diferentes níveis de fibra em detergente neutro. Rev Bras Zootec 2006;35(5):2058-2065. 29. Yamamoto SM, Macedo FAF, Zundt M. Fontes de óleo vegetal na dieta de cordeiros em confinamento. Rev Bras Zootec 2005;34(2):703-710. 30. Madruga SM, Vieira LTR, Cunha GMG, Filho PMJ, Queiroga RC, Sousa HW. Efeito de dietas com níveis crescentes de caroço de algodão integral sobre a composição química e o perfil de ácidos graxos da carne de cordeiros Santa Inês. Rev Bras Zootec 2008;37(8):1496-1502. 31. Diaz MT, Álvarez I, De La Fuente J, Saňudo C, Campo MM, Oliver MA, Fontifurnols M, Montossi F, San Julián R, Nute GR, Caňeque V. Fatty acid composition of meat from typical lamb production systems of Spain, United Kingdom, Germany and Uruguay. Barking Meat Sci 2005;71(2):256-263. 32. Moloney AP, Mooney MT, Kerry JP, Troy DJ. Producing tender and flavor some beef with enhanced nutritional characteristics. Nutrition Society. Cork, Ireland. 2001:221229. 33. Pérez LH. Milho, amido ou caroço de algodão associados a glicerina bruta em dietas para ovinos [PhD Dissertation]. Jaboticabal, Brasil: Universidade Estadual Paulista; 2015. 34. Williams CM. Dietary fatty acids human health. Annal de Zootec 2000;49(3):165-180. 35. Valsta LM, Tapanainen H, Männistö S. Meat fats in nutrition. Meat Sci 2005;70(3):525530. 36. Bauman DE, Baumgard LH, Corl BA, Griinari JM. Biosynthesis of conjugated linoleic acid in ruminants. 91st American Society of Animal Science. Indianapolis, Indiana, USA. 1999:1-15. 37. Vargas JA, Olivera-Angel M, Ribeiro CV, Daza C, Edgar E. In vitro rumen biohydrogenation kinetics of mixed linoleic and alfa-linolenic acids. Rev Colomb Cienc Pecu 2018;31(3):213-222.

113


Rev Mex Cienc Pecu 2022;13(1):97-114

38. Wood JD, Enser M, Fisher AV, Nute GR, Sheard PR, Richardson RI. Fat deposition, fatty acid composition and meat quality: A review. Meat Sci 2008;78(4):343–358. 39. Lee J, Kannan G, Eega K, Kouakou B, Getz W. Nutritional and quality characteristics of meat from goats and lambs finished under identical dietary regime. Small Ruminant Res 2008;74:255- 259. 40. Dierking R, Kallenbach R, Grün I. Effect of forage species on fatty acid content and performance of pasture finished steers. Meat Sci 2010;85:597-605. 41. Jakobsen K. Dietary modifications of animal fats: status and future perspectives. Fett Lipid 1999;101(12):475-483. 42. Arruda PCL, Pereira ES, Pimentel PG, Bomfim MAD, Mizubuti IY, Ribeiro ELA, Fontenele RM, Regadas JGL. Perfil de ácidos graxos no Longissimus dorsi de cordeiros Santa Inês alimentados com diferentes níveis energéticos. Semina: Ciênc Agrár 2012; 33(3):1229-1240. 43. Paim TDP, Viana P, Brandão E, Amador S, Barbosa T. Carcass traits and fatty acid profile of meat from lambs fed different cottonseed by-products. Small Ruminant Res 2014;116:71-77.

114


https://doi.org/10.22319/rmcp.v13i1.5986 Artículo

Correlación entre variables ante mortem y post mortem en canales de ovinos producidos en México

Lizbeth Esmeralda Robles Jiménez a José Armando Partida de la Peña b* Miguel Enrique Arechavaleta Velasco b Ignacio Arturo Domínguez Vara a

a

Universidad Autónoma del Estado de México, Facultad de Medicina Veterinaria y Zootecnia, Estado de México, México. b

Instituto Nacional de investigaciones Forestales, Agrícolas y Pecuarias, Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal, km 1 Carretera a Colón, Ajuchitlán, Querétaro, México.

Autor de correspondencia: partida.jose@inifap.gob.mx

Resumen: El objetivo del trabajo fue estimar las correlaciones del área del ojo de chuleta (AOCh) y el espesor de la grasa subcutánea dorsal (EGSD) con variables morfométricas en canales ovinas producidas en México. Se emplearon 750 canales ovinas que se agruparon por genotipo (pelo, lana y cruzados pelo ˣ lana), sexo (machos y hembras) y sistema de producción (intensivo y semiintensivo). Se determinó la normalidad de la distribución y se realizaron análisis de correlación simple para estimar el grado de asociación entre las variables. En los genotipos de pelo el AOCh se correlacionó con el peso de la canal tanto caliente como fría (r=0.42**; n=328; P<0.001 en machos y r=0.48**; n=91 P<0.001 en hembras), pero en las hembras también tuvo relevancia el perímetro (r=0.52**; n=91; P<0.001) y anchura de la grupa (r=0.48**; n=91; P<0.001). En los animales de pelo, el EGSD se correlacionó con el peso a la matanza (r=0.36**; n=328; P<0.001 en machos y r=0.57**; n=91; P<0.001 en hembras). En los machos de lana el AOCh mostró correlación alta con la longitud de la canal (r=0.61**; 115


Rev Mex Cienc Pecu 2022;13(1):115-126

n=116; P<0.001) y el perímetro de la grupa (r=0.50**; n=116; P<0.001), en tanto que el EGSD se correlacionó con la profundidad interna del tórax (r=0.50**; n=116; P<0.01) y su perímetro (r=0.45**; n=116; P<0.001). En las cruzas de pelo ˣ lana, el AOCh tuvo la mayor correlación con la anchura del tórax (r=0.47**; n=215; P<0.001) y el peso de la canal caliente (r=0.43**; n=215; P<0.001) mientras que el EGSD solo tuvo una correlación baja con el peso a la matanza (r=0.19**; n=215; P<0.001). Palabras clave: Ovinos, Canales, Correlación, Área del ojo de chuleta, Espesor de grasa.

Recibido: 29/04/2021 Aceptado: 16/08/2021

Introducción En México la producción de carne ovina ha mantenido un crecimiento promedio anual del 4.7 % durante los últimos veinticinco años, pasando de 29,887 t de carne en canal en 1995 a 64,758 t en el año 2020(1,2). En la actualidad, se registra una población de casi 9.5 millones de cabezas y, con base en el crecimiento de los últimos cinco años, se tiene una expectativa de producir 65,891 t de carne en canal a fines del año 2021, con un valor estimado en 6,500 millones de pesos(3). No obstante el buen desempeño que ha mostrado la ovinocultura nacional, México no posee un sistema oficial de clasificación de canales ovinas y solo cuenta con una norma (NMX-FF-106-SCFI-2006)(4) que se aplica en forma ocasional. Tampoco se tienen estándares de calidad que definan los atributos de las canales ovinas producidas, ni existen precios diferenciales basados en la calidad del producto final; solo se cuenta con información que relaciona variables medibles in vivo con las propiedades de la canal en la raza Pelibuey y en algunas de sus cruzas(5,6,7,8), así como en cruzamientos de hembras Katahdin(9,10) y Hampshire(11) con machos de razas cárnicas. Desde hace algunos años se dispone en el mundo de métodos no invasivos para estimar la composición y calidad de la canal(12), como el ultrasonido, la tomografía axial computarizada, los rayos X y la tomografía por emisión de positrones(13,14,15); no obstante, la mayoría de esos métodos son muy costosos y poco prácticos(16). También, se han realizado algunos estudios para determinar la relación que existe entre algunos componentes corporales con el peso y rendimiento de la canal(17), así como la relación entre la conformación corporal y el peso vivo utilizando medidas zoométricas(18,19), pero los resultados obtenidos están limitados a grupos genéticos muy específicos y no permiten predecir aspectos de calidad en la canal. Por todo lo anterior, el objetivo del presente estudio fue estimar el grado de asociación existente entre variables ante mortem y post mortem con parámetros indicativos de calidad, como el área del

116


Rev Mex Cienc Pecu 2022;13(1):115-126

ojo de chuleta y el espesor de la grasa subcutánea dorsal en canales ovinas producidas de manera comercial en México.

Material y métodos Se evaluaron 750 animales procedentes de los estados de México (60), Hidalgo (50), Veracruz (36), Zacatecas (38), Puebla (30), Jalisco (40), Coahuila (60), Sinaloa (187), San Luis Potosí (40), Guanajuato (30), Querétaro (64), Tabasco (35), Chiapas (45) y Yucatán (35) que fueron faenados de acuerdo con la NOM-ZOO-1995 Sacrificio Humanitario de los Animales Domésticos y Silvestres(20). Los animales se finalizaron en los sistemas de producción intensivo (totalmente estabulado con alimentación balanceada a libertad) y semiintensivo (pastoreo con suplementación estratégica) y sacrificados en el rastro TIF o municipal más cercano a las explotaciones que se permitió acceso a sus instalaciones y se proporcionó información previa a la matanza. Se identificaron 11 razas puras de las cuales sobresalieron: Katahdin 11.0 %, Pelibuey 5.1 %, Rambouillet 5.0 %, Suffolk 3.4 %, Dorper 2.8 % y más de diez cruzamientos de los que los más representativos fueron: Pelibuey ˣ Katahdin 16.3 %, Pelibuey ˣ Dorper 9.6 %, Katahdin ˣ Suffolk 9.0 %, Katahdin ˣ Charollais 5.8 %, Katahdin ˣ Dorper 5.4 %. Para el análisis de los datos se identificó el sexo, la raza y el sistema de producción de cada uno de los animales. Utilizando la metodología descrita por Partida et al(21), se tomaron registros del peso a la matanza, peso de la canal en caliente y en frío, rendimiento de la canal caliente y fría, longitud interna de la pierna (distancia más caudal del periné y el punto más distal del borde medial de la superficie articular tarso-metatarsiana), longitud de la canal (distancia máxima entre el borde anterior de la sínfisis isquio-pubiana y el borde anterior de la primera costilla, en su punto medio), perímetro de la grupa (a nivel de los trocánteres de ambos fémures), ancho de la grupa (anchura máxima entre los trocánteres de ambos fémures), ancho del tórax (anchura máxima entre las costillas a nivel de la 6ª vertebra torácica), perímetro torácico (circunferencia de la canal sobre las costillas a la altura de la 6ª vertebra torácica) y profundidad interna del tórax (distancia máxima entre el esternón y el dorso de la canal a nivel de la 6ª vértebra torácica) de cada uno de los animales. Asimismo, se calculó el índice de compacidad de la canal (peso de la canal fría en kg / longitud interna de la canal en cm), se midió el área del ojo de chuleta (en la zona de corte a nivel de la 13a costilla) y el espesor de la grasa subcutánea dorsal (también en la zona de corte sobre la 13a costilla), variables que están relacionadas con la calidad de la canal(22). Todos los animales se clasificaron de acuerdo con su grupo genético (pelo, lana y cruzados pelo ˣ lana), sexo (machos y hembras) y sistema de producción (intensivo y semiintensivo). A partir de esta clasificación se formaron los cuatro grupos de animales siguientes: machos de pelo producidos bajo el sistema semiintensivo (n= 328), hembras de pelo producidas en

117


Rev Mex Cienc Pecu 2022;13(1):115-126

el sistema semiintensivo (n= 91), machos de lana producidos en el sistema intensivo (n= 116) y machos cruzados producidos en el sistema semiintensivo (n= 215). Inicialmente, se realizaron análisis dentro de cada grupo para determinar si la distribución de las variables incluidas en el estudio se ajustaban a una distribución normal, para esto se utilizaron las pruebas de Kolmogorov-Smirnov y Shapiro-Wilk(23), y posteriormente se realizaron análisis de correlación lineal simple para estimar el grado de asociación existente entre las variables in vivo y post mortem con el área del ojo de chuleta y el espesor de la grasa subcutánea dorsal. Los análisis estadísticos se efectuaron utilizando el paquete estadístico JMP ver. 4.0(24).

Resultados y discusión Los análisis de Kolmogorov-Smirnov y Shapiro-Wilk mostraron que la distribución de las variables incluidas en el estudio se ajustó a una distribución normal. En el grupo de machos de pelo producidos bajo el sistema semiintensivo, se obtuvo una correlación positiva y altamente significativa entre el área del ojo de chuleta (AOCh) y el peso a la matanza (r= 0.38**; n= 328; P<0.001), el peso de la canal caliente (r= 0.42**; n= 328; P<0.001) y el peso de la canal fría (r= 0.42**; n= 328; P<0.001), con promedios de 43.34 ± 6.22; 21.46 ± 3.15 y 20.90 ± 3.04 kg respectivamente para las variables mencionadas. En este grupo, el espesor de la grasa subcutánea dorsal (EGSD), también se correlacionó en forma positiva y altamente significativa con el peso a la matanza (r= 0.36**; n= 328; P<0.001) y con la profundidad interna del tórax (r= 0.34**; n= 91; P<0.001) (Cuadro 1). Cuadro 1: Correlación del área del ojo de chuleta y el espesor de la grasa subcutánea con diferentes variables de la canal en machos de pelo del sistema semiintensivo (n= 328) Variable PM PCC PCF RCC RCF PG AG PIT ICC s 0.38* AOCh 0.42** 0.42** 0.15** 0.16 0.27** 0.28** 0.15** 0.24** * EGSD

0.36* *

0.23* *

0.26** -8.08

0.11

0.25** 0.20** 0.34** 0.17**

PM= peso a la matanza; PCC= peso canal caliente; PCF= peso canal fría; RCC= rendimiento canal caliente; RCF= rendimiento canal fría; PG= perímetro de la grupa; AG= ancho de la grupa; PIT= profundidad interna del tórax; ICC= Índice de compacidad de la canal. AOCh = área del ojo de chuleta; EGSD= espesor grasa subcutánea dorsal.

En el grupo de hembras de pelo producidas bajo el sistema semiintensivo, el AOCh mostró coeficientes de determinación altamente significativos con el peso de la canal caliente (r=

118


Rev Mex Cienc Pecu 2022;13(1):115-126

0.48**; n= 91; P<0.001) y el peso de la canal fría (r= 0.49**; n= 91; P<0.001), así como con el perímetro de la grupa (r= 0.52**; n = 91; P<0.001), el ancho de la grupa (r= 0.48**; n= 91; P<0.001) y el índice de compacidad de la canal (r= 0.43**; n= 91; P<0.001). Por su parte, el EGSD mostró el coeficiente de determinación más alto con el peso a la matanza (r = 0.57**; n= 91; P<0.001) (Cuadro 2). Cuadro 2: Correlación del área del ojo de chuleta y el espesor de la grasa subcutánea con diferentes variables de la canal en hembras de pelo del sistema semiintensivo (n= 91) Variables

PM

PCC

PCF

RCC

RCF

PG

AG

PIT

ICC

AOCh

0.32*

0.48**

0.49**

0.34*

0.36**

0.52**

0.48**

0.34*

0.43**

EGSD

0.57**

0.03

0.02

0.36**

0.34**

0.31*

0.09

-0.11

-0.05

PM= peso a la matanza; PCC= peso canal caliente; PCF= peso canal fría; RCC= rendimiento canal caliente; RCF= rendimiento canal fría; PG= perímetro de la grupa; AG= ancho de la grupa; PIT= profundidad interna del tórax; ICC= Índice de compacidad de la canal. AOCh = área del ojo de chuleta; EGSD= espesor grasa subcutánea dorsal.

La relación entre el AOCh y el peso de la canal, tanto caliente como fría, que se observó en los machos y las hembras de pelo producidos bajo el sistema semiintensivo, es coincidente con lo que se reporta en la literatura desde hace algún tiempo(25,26,27), y se explica por la analogía que hay entre el tamaño corporal y las dimensiones de cada uno de los componentes que forman la canal (crecimiento alométrico). No obstante, algunos autores han indicado que el peso vivo puede presentar ciertas deficiencias como indicador de la composición corporal, debido a que no se puede hacer la distinción entre diferentes estados de madurez del animal(28). En este estudio, evidentemente hubo variación en la edad de los animales y en su grado de madurez, pero no fue proporcionada esa información por los productores antes ni al momento de la matanza. Se sabe que el AOCh es un buen estimador de la proporción de músculo existente en la canal de diferentes especies domésticas(29,30); de hecho, se han obtenido correlaciones muy elevadas (r= 0.96) entre el peso de la canal fría y su proporción de músculo cuando se han evaluado grupos genéticos extremadamente homogéneos como, por ejemplo, corderos lactantes de la raza Manchega, los cuales fueron manejados y alimentados bajo las mismas condiciones(31). Lo anterior muestra que el peso de la canal podría ser útil y práctico para estimar el AOCh y la proporción de músculo en la canal, puesto que su pesaje es una medición fácil y rápida. De acuerdo con los resultados, la variable que presentó mayor correlación con el EGSD fue el peso a la matanza, tanto en hembras como en machos de pelo. Esto también se ha observado en algunos estudios que usaron ultrasonido para medir la cobertura grasa en la canal ovina(32,33,34). De igual forma, en ovinos de la raza Texel (con 20 kg de peso vivo) se reportó una correlación (r= 0.33; 186 P<0.05) entre el peso a la matanza 119


Rev Mex Cienc Pecu 2022;13(1):115-126

y el EGSD(35). Asimismo, otros autores que emplearon corderos de la raza Awassi, observaron una correlación entre el EGSD y el peso a la matanza, la cual se incrementó (r= 0.71 a r= 0.83) al aumentar el peso corporal de 30 a 40 kg y diferenciar el sexo dentro del modelo(34). En cuanto al grupo de machos de lana criados en el sistema intensivo, el AOCh tuvo una correlación positiva con la longitud de la canal (r= 0.61**; n= 116; P<0.001) y el perímetro de la grupa (r= 0.58**; n= 116; P<0.001), en tanto que en EGSD dorsal se correlacionó positivamente con el rendimiento en canal caliente (r= 0.42**; n= 116; P<0.001), el perímetro del tórax (r= 0.45**; n= 116; P<0.001) y la profundidad interna de éste (r= 0.50**; n= 116; P<0.001) (Cuadro 3). Cuadro 3: Correlación del área del ojo de chuleta y el espesor de la grasa subcutánea con diferentes variables de la canal en ovinos machos de lana del sistema intensivo (n= 116) Variables RCC

RCF

PG

PT

LP

LC

PIT

ICC

AOCh

-0.14

-0.01

0.58**

-0.08

-0.07

0.61**

-0.1

-0.20*

EGSD

0.42**

0.29**

-0.25*

0.45**

0.33**

-0.25*

0.50**

0.30**

RCC= rendimiento canal caliente; RCF= rendimiento canal fría; PG= perímetro de la grupa; PT= perímetro del tórax; LP= longitud de pierna; LC= longitud de canal; PIT= profundidad interna del tórax; ICC= Índice de compacidad de la canal. AOCh= área del ojo de chuleta; EGSD= espesor grasa subcutánea dorsal.

Las altas correlaciones del AOCh con la longitud de la canal, también han sido reportadas por otros autores(31), quienes emplearon borregos lactantes de las razas Manchega y Churra Tensina para predecir la composición de la canal, y observaron que la longitud de ésta fue la variable mejor correlacionada (r= 0.869 y r= 0.31, respectivamente para cada una de las razas) con el peso del músculo y concluyeron que la longitud de la canal tiene una correlación positiva con la totalidad de carne aprovechable, debido a que las canales más largas presentan cuartos traseros con mayor longitud, los cuales tienen un importante aporte al rendimiento cárnico. Lo anterior, indica que a mayor longitud y anchura de la canal, mayor cantidad de carne se podría obtener de la misma, ya que el área del ojo de chuleta ha mostrado una estrecha correlación con la cantidad total de músculo presente en la canal(36); incluso, en Australia los ovinocultores seleccionan a los ovinos más largos porque aseguran que son los que producirán mayor cantidad de carne(37). Al examinar las variables que presentaron una correlación con el espesor de la grasa subcutánea en los ovinos de lana, se observó que el perímetro torácico y la profundidad interna del tórax fueron las variables que mejor correlación mostraron (r= 0.45; n= 116; P>0.001 y r= 0.50; n= 116; P>0.001, respectivamente), lo que es coincidente con los

120


Rev Mex Cienc Pecu 2022;13(1):115-126

resultados de otros autores(16), quienes al caracterizar una nueva raza lanar, indicaron que el costillar es el corte mejor correlacionado con la cantidad de grasa subcutánea en corderos, pues el costillar fue la región de la canal con mayor depósito de tejido adiposo(38). No obstante, otros autores que evaluaron ovinos de raza Manchega, determinaron que también existe una correlación alta (r= 0.70) entre la anchura del tórax y la cantidad de músculo existente en la canal(31). En el grupo de machos cruzados producidos en el sistema semiintensivo, se obtuvieron las mayores correlaciones del AOCh con la anchura del tórax (r= 0.47**; n= 215; P<0.001) y el peso de la canal caliente (0.43**; n= 215; P<0.001), mientras que el EGSD solo mostró una correlación baja con el peso a la matanza (r= 0.19**; n= 215; P<0.001) (Cuadro 4). Cuadro 4: Correlación del área del ojo de chuleta y el espesor de la grasa subcutánea con diferentes variables de la canal en ovinos machos cruzados (pelo ˣ lana) del sistema semiintensivo (n=215) Variables

Peso a la matanza

Peso canal Peso caliente canal fría

Ancho del tórax

Longitud de la pierna

AOCh

0.37**

0.43**

0.39**

0.47**

0.40**

EGSD

0.19**

0.14

0.12

0.06

-0.05

AOCh= área del ojo de chuleta; EGSD= espesor grasa subcutánea dorsal.

También en los machos cruzados (pelo ˣ lana) se mantuvo la relación entre el AOCh y el peso de la canal, lo que coincide con lo observado en los otros dos grupos del sistema semiintensivo, lo que puede ser debido a la mayor participación de razas de pelo como la Pelibuey y la Katahdin en este tipo de sistema productivo(21). Por su parte, la correlación del AOCh con la anchura del tórax podría estar más asociada con la participación de razas cárnicas como la Dorper, la cual se caracteriza por sus dimensiones de perímetro y anchura del tórax, derivadas del mejoramiento genético que se ha enfocado a la selección de animales con el tronco más ancho. En la actualidad, los productores buscan animales con mayor espesor del tronco, porque son los que presentan una mayor cantidad de músculo en la canal(37). En general y a pesar de la fuerte variación existente en las canales ovinas producidas en el país, el peso de la canal podría ser una variable útil y práctica para estimar la proporción de músculo que la compone; adicionalmente, el pesaje de la canal es una medición fácil, rápida y económica. No obstante lo anterior, es conveniente obtener ecuaciones de predicción para cada uno de los genotipos autóctonos, de manera que se minimicen los errores que conlleva la aplicación de ecuaciones que fueron calculadas para otros genotipos y rangos de peso(39).

121


Rev Mex Cienc Pecu 2022;13(1):115-126

Conclusiones e implicaciones Bajo las condiciones en las que se realizó el presente estudio y a pesar de la alta heterogeneidad que existe en las canales ovinas producidas en México, se observó que en machos y hembras de pelo del sistema semiintensivo, así como en las cruzas de pelo por lana de ese mismo sistema, el peso de la canal tanto en caliente como en frío, se correlacionó con el área del ojo de chuleta, el cual es un buen estimador de la proporción de músculo en la canal. Asimismo, en los machos y hembras de pelo del sistema semiintensivo el peso a la matanza se correlacionó con el espesor de la grasa subcutánea dorsal, que nos indica el grado de finalización del animal. Contrariamente, en los machos de lana del sistema intensivo, las mediciones de longitud de la canal y el perímetro de la grupa presentaron las mejores correlaciones con el área del ojo de chuleta, que se sabe es un fiel estimador de la muscularidad de la canal. En general, se puede concluir que las mejores correlaciones entre los parámetros estudiados están asociadas con las características corporales del animal y con las particularidades de la canal, las cuales son originadas por el genotipo del animal. Esto implica que las mediciones sobre el animal vivo o su canal, podrían ser de gran utilidad para que los productores y procesadores tengan una mejor idea de la calidad de la carne que ofrecen al mercado. Agradecimientos Los autores agradecen al CONACYT por el financiamiento de este trabajo y por la beca para la realización de estudios de maestría en ciencias del primer autor. Conflicto de interés Los autores de este trabajo declaran que no existe conflicto de interés de ningún tipo. Literatura citada: 1. SIACOM. Servicio de Información Agroalomentaria de Consulta. https://nube.siap.gob.mx/index.php/s/AQROGZKKqEek6wh. Consultado 22 Abr, 2021. 2. SIAP. Sistema de Información Agroalimentaria y Pesquera. Resumen Nacional Producción, Precio, Valor, Animales sacrificados y Peso. http://infosiap.siap.gob.mx/anpecuario_siapx_gobmx/ResumenNacional.do;jsessionid =169DC54CFE6DCBA023DC67653184405E. Consultado 22 Abr, 2021.

122


Rev Mex Cienc Pecu 2022;13(1):115-126

3. SNIIM. Sistema Nacional de Información e Integración de Mercados. SNIIM - Sistema Nacional de Información de Mercados. Secretaría de Economía Precios de Frutas, Hortalizas, Vegetales, Carnes, Pescados, Pecuarios, Pesqueros (economiasniim.gob.mx). Consultado 22 Abr, 2021. 4. NMX-FF-106 SCFI-2006. Norma Mexicana para la Clasificación de Carne Ovina en Canal. Productos Pecuarios. Publicada en el Diario Oficial de la Federación el 21 de agosto de 2006. 5. Gutiérrez J, Rubio MS, Méndez RD. Effects of crossbreeding Mexican Pelibuey sheep with Rambouillet and Suffolk on carcass traits. Meat Sci 2005;70:1-5. doi.org/10.1016/i.meatsc.2004.10.017. 6. Bautista-Diaz E, Salazar-Cuytun R, Chay-Canul A, García-Herrera R, Piñero-Vázquez A, Magaña-Monforte J, et al. Determination of carcass traits in Pelibuey ewes using biometric measurements. Small Ruminant Res 2017;147:115-119. doi.org/10.1016/j.smallrumres.2016.12.037. 7. Partida PJA, Braña BD, Martínez RL. Desempeño productivo y propiedades de la canal en ovinos Pelibuey y sus cruzas con Suffolk o Dorset. Téc Pecu Méx 2009;47(3):313322. 8. Aguilar-Hernández E, Chay-Canul A, Gómez-Vázquez A, Magaña-Monforte J, RíosRincón F, Cruz-Hernández A. Relationship of ultrasound measurements and carcass traits in Pelibuey ewes. J Anim Plant Sci 2016;26(2):325-330. 9. Vázquez SET, Partida PJA, Rubio LMS, Méndez MD. Comportamiento productivo y características de la canal en corderos provenientes de la cruza de ovejas Katahdin con machos de cuatro razas cárnicas especializadas. Rev Mex Cienc Pecu, 2009;2(3):247258. 10. Partida PJA, Vázquez E, Rubio MS. Méndez MD. Effect of breed sire on carcass traits and meat quality of Katahdin lambs. J Food Res 2012;1(4):141-149. 11. López VMM, De la Cruz CL, Partida PJA, Torre HG, Becerril PC, Buendía RG, Jiménez BMR, Alfar RRH. Efecto de la raza paterna en las características de la canal de corderos en un sistema de producción comercial en Hidalgo, México. Rev Mex Cienc Pecu 2016;7(4):441-453. 12. Scholz AM, Bünger L, Kongsro J, Baulain U, Mitchell AD. Non-invasive methods for the determination of body and carcass composition in livestock: dual-energy X-ray absorptiometry, computed tomography, magnetic resonance imaging, and ultrasound: invited review. Animal 2015;9:1250-1264.

123


Rev Mex Cienc Pecu 2022;13(1):115-126

13. Lambe N, Navajas E, BüngerL, Fisher A, Roehe R, Simm G. Prediction of lamb carcass composition and meat quality using combinations of post-mortem measurements. Meat Sci 2009;81:711-719. doi:10.1016/j.meatsci.2008.10.025. 14. Navajas EA, Glasbey CA, Mclean KA, Fisher AV, Charteris AJL, Lambe, NR, Bünger L, Simm G. “Science: In vivo Measurements of muscle volume by automatic image analysis of spiral computed tomography scans. Anim Sci 2006;82(4):545-553. doi:10.1079/ASC200662. 15 . Ripoll G, Joy M, Alvarez-Rodríguez J, Sanz A, Teixeira A. Estimation of light lamb carcass composition by in vivo real-time ultrasonography at four anatomical locations 1. J Anim Sci 2009;87(4):1455-1463. doi: 10.2527/jas.2008-1285. 16. Camacho A, Perez V, Mata J, Bermejo LA. Ecuaciones predictoras de la composición tisular de la canal en dos razas ovinas canarias. Arch de Zootec 2011;60:1125-1135. 17. González GR, Salinas HRM, Garduza AG, Reyes MF. Componentes corporales en ovinos de pelo para abasto en el sureste mexicano. Zootec Trop 2014;32(1):23-32. 18. Vilaboa AJ, Bozzi R, Díaz RP, Bazzi L. Conformación corporal de las razas ovinas Pelibuey, Dorper y Katahdin en el estado de Veracruz, México. Zootec Trop 2010;28(3)321-328. 19. Pulgarón BPP, Castro AR, Yglesias RO. Relación entre el peso y las medidas corporales al nacimiento en hembras y machos ovinos de la raza Pelibuey. Engormix ovinos 2012. https://www.engormix.com/ovinos/foros/relacion-entre-peso-medidas-t14793/. Consultado 28 Abr, 2021. 20. NOM-033-ZOO-1995: Sacrificio Humanitario de los Animales Domésticos y Silvestres. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Publicada en el Diario Oficial de la Federación el 16 de julio de 1995. 21. Partida PJA, Ríos RFG, De la Cruz CL, Domínguez VIA, Buendía RG. Caracterización de las canales ovinas producidas en México. Rev Mex Cienc Pecu 2017;8(3):269-277. http://dx.doi.org/10.22319/rmcp.v8. 22. Cañeque V, Sañudo AC. Estandarización de las metodologías para la evaluar la calidad del producto (animal vivo, canal, carne y grasa) en los rumiantes. Monografías INIA: Serie Ganadera No. 3 Madrid, España. 2005. 23. Field A. Regression. Discovering Statistics Using SPSS. 3º ed. SAGA. 2009. 24. SAS. JMP. (Statistical Discovery Software), Ver 4.0 (academy); Cary N. C. USA Inst. Inc. 2002.

124


Rev Mex Cienc Pecu 2022;13(1):115-126

25. Delfa R, González C, Teixeira A. Use of cold carcass weight and fat depth measurements to predict carcass composition of raza Aragonesa. Small Ruminant Res 1996;20:267274. 26. Safari E, Hopkins DL, Fogarty NM. Diverse lamb genotypes 4. Predicting the yield of saleable meat and high value trimmed cuts from carcass measurements. Meat Sci 2001;58:207-214. 27. Carrasco S, Ripoll G, Panea B, Álvarez-Rodríguez J, Joy M. Carcass tissue composition in light lambs: Influence of feeding system and prediction equations. Livest Sci 2009; 126:112-121. doi:http://dx.doi.org/10.1016/j.livsci.2009.06.006. 28. Cavanauh CR, Jonas E, Hobbs M, Thomson PC, Tamman I, Raadsma HW. Mapping Quantitative Trait Loci (QTL) in sheep. III. QTL for carcass composition traits derived from CT scan and aligned with a meta-assembly for sheep and cattle carcass QTL. Genet Select Evol 2010;42:36. 29. Silva SR, Gudes CM, Santos VA, Lourenco Al, Azevedo JM, Dias-da Silva A. Sheep carcass composition estimated from Longissimus thoracis et lumborum muscle volume measured by in vivo real-time ultrasonography. Meat Sci 2007;76(4):708-714. doi: 10.1016/j.meatsci.2007.02.009. 30. Morais MG, Biava MB, Bertholini RC, Walker CC, Fernandes HJ, Duarte LSAR, Brandão FÍCC, Dias FGL. Models predict the proportion of bone, muscle, and fat in ewe lamb carcasses from in vivo measurements of the 9th to 11th rib section and of the 12th rib. Semina: Ciências Agrárias 2016;37(2):1081-1090. doi:10.5433/16790359.2016v37n2p1081. 31. Díaz MT, Cañeque V, Lauzurica S, Velasco S, Ruiz de Huidobro F, Perez C. Prediction of suckling lamb carcass composition from objective and subjective carcass measurements. Meat Sci 2004;66:895-902. doi.10.1016/j.meatsci.2003.08.013. 32. Leeds TD, Mousel MR, Notter DR, Zerby HN, Moffet CA, Lewis GS. B-mode real-time ultrasound for estimating carcass measures in live sheep: Accuracy of ultrasound measures and their relationships with carcass yield and value. J Anim Sci 2008;86:32033214. doi: 10.2527/jas.2007-0836. 33. Orman A, Calışkan UG, Dikmen S, Ustuner H, Oğan M, Calışkan C. The assessment of carcass composition of Awassi male lambs by real-time ultrasound at two different live weights. Meat Sci, 2008;80:1031-1036. doi:10.1016/j.meatsci.2008.04.022. 34. Orman A, Caliskan GU, Dikmen S. The assessment of carcass traits of Awassi lambs by real-time ultrasound at different body weights and sexes. J Anim Sci 2010;88(10):34283438. doi:10.2527/jas.2009-2431.

125


Rev Mex Cienc Pecu 2022;13(1):115-126

35. Wolf BT, Jones DA, Owen MG. In vivo prediction of carcass composition and muscularity in purebred Texel lambs. Meat Sci 2006;74(2):416-423. doi:10.1016/j.meatsci.2006.02.019. 36. Williams AR. Ultrasound applications in beef cattle carcass research and management. J Anim Sci 2002;80:183-188. doi:10.2527/animalsci2002.80E-Suppl_2E183x. 37. Anderson F, Pannier L, Pethick DW, Gardner GE. Intramuscular fat in lamb muscle and the impact of selection for improved carcass lean meat yield. Animal. 2015.1081-1090. doi: 10.1017/S1751731114002900. 38. Yakan A, Ünal N. Meat production traits of a new sheep breed called Bafra in Turkey 1. Fattening, slaughter, and carcass characteristics of lambs. Trop Anim Health and Produc 2010;42(4):751-759. doi 10.1007/s11250-009-9483-8. 39. Lauz FOG, Diniz RF, Teixeira CRA. Francieli FV, Benetti M. Measurement of rib-eye area by the method of digital images. R Bras Zootec 2012;4(3). doi.http://dx.doi.org/10.1590/51516-35982012000300047.

126


Rev Mex Cienc Pecu 2022;13(1):127-144

https://doi.org/10.22319/rmcp.v13i1.5888 Artículo

Desempeño financiero y comercialización oportunista de los sistemas de producción de carne de res en el sur de Brasil

Amir Gil Sessim a* Maria Eugênia Andrighetto Canozzi b Gabriel Ribas Pereira a Eduardo Madeira Castilho c Júlio Otávio Jardim Barcellos a

Federal University of Rio Grande do Sul – UFRGS. Faculty of Agronomy, Department of Animal Science. Porto Alegre, RS, Brazil. a

b

Instituto Nacional de Investigación Agropecuária (INIA). Estación Experimental INIA. Programa Producción de Carne y Lana. La Estanzuela, Colonia, Uruguay. Federal University of Pelotas – UFPEL. Faculty of Agronomy, Department of Animal Science. Pelotas, RS, Brazil. c

*Autor de correspondencia: amirsessim@hotmail.com

Resumen: Este estudio compara el desempeño técnico y financiero de diferentes sistemas de producción de ganado para carne y evalúa la comercialización oportunista practicada en estos sistemas. Se evaluaron datos de cuatro unidades de producción ubicadas en el sur de Brasil: vaca-cría en pastos nativos (VCPN; 1,155 ha; 1,529 animales); vaca-cría con agricultura (VCA; 1,008 ha; 1,313 animales); recría-engorda (URE; 360 ha; 435 animales); y engorda (UE; 205 ha; 168 animales) así como un sistema integrado que simula los parámetros físicos y económicos de las cuatro unidades (SIA; 2,728 ha; 3,445 animales). Las cuatro unidades independientes fueron consideradas como de comercialización oportunista y el SIA como no oportunistas. El mayor rendimiento se obtuvo para URE (297 kg/ha), seguido de SIA (114 kg/ha), UE (98 kg/ha), VCPN (87 kg/ha) y VCA (83 kg/ha). La VCPN fue la más económicamente eficiente, considerando el margen bruto por kilogramo (MB/kg) (US$ 0.93). El valor del MB/kg del SIA 127


Rev Mex Cienc Pecu 2022;13(1):127-144

(US$ 0.74) fue un 37 % superior en comparación con la suma del promedio de las cuatro unidades (US$ 0.54), y el SIA tuvo los costos totales de producción por kg más bajos (22.5 %). Se llegó a la conclusión de que cada unidad independiente podría aumentar el MB/kg (37 %) y el MB/ha (3.8 %) y utilizar crías en una unidad de recría-engorda para su posterior venta. Por lo tanto, la integración de los sistemas de producción de carne de res aumenta el margen bruto de las empresas, presentando una ventaja comercial rentable para los empresarios rurales a través de la comercialización no oportunista.

Palabras clave: Producción Animal, Economía, Ingreso bruto, Integración, Costo de Producción.

Recibido: 03/12/2020 Aceptado: 07/06/2021

Introducción El aumento de la demanda mundial de carne, especialmente de carne de res, ha mantenido altos los precios del ganado desde 2011(1). En estas condiciones de mercado, las mejoras en el manejo de la producción de carne de res podrían producir beneficios económicos importantes. Sin embargo, los ganaderos deben evitar los procesos de comercialización oportunistas, que son comunes en la producción de ganado brasileño para carne(2-3). La comercialización oportunista surge cuando los ganaderos realizan transacciones comerciales en momentos que creen que son los más ventajosos; no obstante, estas oportunidades no siempre se presentan de manera oportuna y esto puede conducir a una reducción en el margen económico para el sistema. En sistemas independientes dentro de la misma empresa agrícola, estos eventos ocurren con más frecuencia. La rentabilidad del ganado para carne está estrechamente relacionada con los costos y la eficiencia de la producción. Sin embargo, muchos ganaderos administradores no tienen un conocimiento preciso de los costos de su granja, lo que compromete la gestión del sistema(4). Por el contrario, la intensificación de la producción, a través de una actividad de gestión eficiente, se ha generalizado durante la última década, lo que ha resultado en logros económicos interesantes(5). Por lo tanto, un conocimiento más preciso de los costos de producción es un requisito previo para el establecimiento de sistemas eficientes de ganado para carne. La integración de diferentes actividades dentro del mismo segmento del sistema de producción puede aumentar la rentabilidad. Por ejemplo, este aumento podría lograrse mediante el intercambio de información y recursos, la reducción de los costos de

128


Rev Mex Cienc Pecu 2022;13(1):127-144

transacción y producción, el aumento del poder adquisitivo y el aumento de la productividad(6). De hecho, muchos administradores han estado utilizando software de simulación y bases de datos para aumentar la eficiencia y la rentabilidad en los sistemas de ganado para carne(7-8). Así, la producción y la gestión financiera se han convertido en factores clave para la viabilidad económica de los sistemas de producción de carne de res, y su desempeño práctico es fundamental para que los ganaderos decidan la mejor estrategia para lograr mejores resultados económicos. No obstante, existen dudas con respecto al desempeño financiero y la rentabilidad de las etapas de la producción de alimentos, ya sea que se realicen como un solo sistema o por separado, y no existe un estudio conciso que ayude a la toma de decisiones. Por lo tanto, el objetivo fue evaluar el desempeño técnico y financiero y la comercialización oportunista de un sistema integrado en comparación con las unidades de producción independientes de diferentes sistemas de producción de carne de res.

Material y métodos Los datos se recolectaron de diferentes sistemas de producción representativos del sur de Brasil. Todos los análisis se realizaron utilizando hojas de cálculo para comparar los parámetros físicos del ganado y los resultados económicos entre las unidades de producción, como se describió anteriormente(9-10). Es importante señalar que el sistema de producción es el término más apropiado y moderno para referirse a las granjas, considerando que están representadas únicamente por la producción animal, únicamente por la producción vegetal o por la integración entre ambas producciones. Se evaluaron registros de cuatro unidades de producción ubicadas en la misma empresa ganadera en Dom Pedrito, Rio Grande do Sul, Brasil (latitud 30° 58’ 33.885” S y longitud 54° 40’ 11.657” O) entre julio de 2014 y junio de 2015. Las unidades ganaderas cuentan con su propia comercialización y no están integradas como un sistema. Las unidades ganaderas se encuentran en el Bioma Pampeano, una región caracterizada por un predominio de pastos naturales con gran biodiversidad y una alta capacidad de producción forrajera(11). La precipitación anual en la región es de entre 1,250 y 1,600 mm; durante el presente estudio, la precipitación media fue de 1,345 mm(12). Las unidades de producción (Cuadro 1) fueron: vaca-cría en pastos nativos (VCPN); vaca-cría con agricultura (VCA); unidad de recría-engorda (URE); y unidad de engorda (UE). Se simuló una unidad adicional, el sistema integrado de actividades (SIA), para representar las cuatro unidades (VCPN, VCA, URE y UE) en un solo sistema que opera sinérgicamente.

129


Rev Mex Cienc Pecu 2022;13(1):127-144

Cuadro 1: Caracterización de los sistemas de producción de ganado para carne en el sur de Brasil VCPN VCA URE UE SIA Zona de producción de carne de res, ha 1,155 1,008 360 205 2,728 Área de pastos cultivados, % 8 41 46 12 Tamaño promedio anual del rebaño, cabeza 1,529 1,313 435 168 3,445 Carga media anual, UA/ha 0.85 0.7 0.8 0.7 0.76 Empleados, Núm. 4 7 1 1 13 VCPN= unidad de vaca-cría en pasto nativo; VCA= unidad de vaca-cría con agricultura; URE = unidad de recría-engorda; UE= unidad de engorda, SIA; sistema integrado de actividades, UA= unidad animal.

Para generar los datos del SIA, se obtuvo el área de producción y los animales del sistema mediante la suma de cuatro unidades independientes. Sin embargo, la producción y los ingresos del sistema se consideraron solo por la venta de novillos de la URE y vacas de desecho de la VCPN y UE. Para los costos, se consideró la suma de los costos de las cuatro unidades independientes, excepto la compra de animales y sus transacciones de la URE y UE, así como los costos de las transacciones de crías de la VCPN y VCA. Así, el SIA se consideró como un ciclo completo que vende novillos y vacas de desecho de su propia producción. La comercialización de las cuatro unidades independientes se realizó de acuerdo con la actividad comercial del propietario. Por lo tanto, se consideró que las unidades independientes se condujeron mediante comercialización oportunista. En contraste, se consideró que el SIA comercializaba animales al final de su ciclo productivo, independientemente de una mejor oportunidad de comercialización para animales que no eran el producto final (novillo y vaca de desecho). Por lo tanto, el SIA se consideró como un sistema de comercialización no oportunista.

Alimentación animal La alimentación animal se basó en las características del pasto natural del Bioma Pampeano, compuesto por pasto (Poaceae) como Paspalum, Axonopus, Panicum y leguminosas (Fabaceae) como Adesmia, Lathyrus y Trifolium(13) . Además, los pastos se sobresembraron con residuos de soya anual de invierno en el área cultivada de la unidad de VCA. Los animales fueron colocados en las unidades de VCA y URE con un pasto de ryegrass cultivado. En la unidad de URE, se reservó un área exclusiva para el ganado durante los pastos de invierno (Figura 1). Se ofreció suplementación mineral y agua ad libitum para todos los animales en todas las unidades.

130


Rev Mex Cienc Pecu 2022;13(1):127-144

Figura 1: Cronograma del uso de recursos forrajeros de julio de 2014 a junio de 2015 en unidad de vaca-cría en pasto nativo (VCPN), unidad de vaca-cría con agricultura (VCA), unidad de recría-engorda (URE), unidad de engorda (UE) y sistema integrado de actividades (SIA)

Manejo reproductivo La temporada de apareamiento fue entre noviembre y enero, incluyendo la inseminación artificial a tiempo fijo (vacas), la inseminación artificial (novillas) y la monta natural en todas las hembras que no quedaron preñadas de los procedimientos de inseminación. El destete ocurrió en abril, cuando todas las crías alcanzaron los 180 d de edad. Las novillas se mantuvieron en las unidades hasta el primer apareamiento a los 24 meses. Antes de implementar el manejo reproductivo activo, las novillas se seleccionaron en función de un peso corporal mínimo (PC) de 300 kg. Las vacas primíparas que no se ajustaron a los estándares de la raza, con una puntuación de condición corporal (PCC) inferior a 3 (en una escala de 1 a 5)(14), y las vacas no preñadas se evaluaron mediante ecografía.

Caracterización de los sistemas de producción El diagrama de flujo de producción muestra cómo funcionan los sistemas y cada unidad se describe en la Figura 2.

131


Rev Mex Cienc Pecu 2022;13(1):127-144

Figura 2: Diagrama de flujo de producción de vaca-cría en pasto nativo (VCPN), vacacría con agricultura (VCA), recría-engorda (URE) y engorda (UE) en ganado para carne

Vaca-cría en pastos nativos (VCPN): comprendía animales Braford. En esta unidad, todos los terneros se vendieron con una media de 160 kg/PC, generalmente entre abril y mayo. Además, entre junio y noviembre se vendieron vacas de desecho, con una media de 450 kg/PC. Vaca-cría con agricultura (VCA): esta unidad fue similar a la unidad de VCPN, pero incluyó un 8 % de pasto de ryegrass cultivado (Lolium multiflorum) y animales Angus. Esta unidad de VCA comercializó todos los terneros entre abril y mayo (media, 160 kg/PC). Además, las novillas que no cumplieron con el mínimo de 300 kg/PC para el apareamiento a los 24 meses y las vacas de desecho se destinaron a la comercialización inmediatamente después del diagnóstico de preñez, incluso cuando estaban flacas. Unidad de recría-engorda (URE): esta unidad recibió machos Angus y Braford de la VCPN y VCA. La crianza de las crías comenzó en abril cuando los animales tenían 7 meses de edad (media, 160 kg/PC) en pasto de ryegrass y terminó a fines de febrero en pastos nativos (promedio, 340 kg/PC). Posteriormente, los animales se mantuvieron en

132


Rev Mex Cienc Pecu 2022;13(1):127-144

pastos nativos y cultivados y se vendieron para su sacrificio cuando alcanzaron un mínimo de 440 kg/PC. Los animales que no alcanzaron los 440 kg/PC en septiembre se mantuvieron en pastos cultivados y se comercializaron en noviembre. Unidad de engorda (UE): Las vacas de desecho Angus de la unidad de VCA se incluyeron en la UE, que comenzó en abril con las vacas con un promedio de 390 kg/PC, hasta septiembre cuando se vendieron para el sacrificio a los 460 kg/PC. Todas las vacas se mantuvieron en pastos nativos durante el período de engorda, excepto de mayo a julio, cuando los animales se asignaron a un pasto de avena (Avena strigosa). Sistema integrado de actividades (SIA): esta unidad incluyó animales Angus y Braford para todas las actividades utilizadas en los sistemas de producción. Los terneros se destetaron cuando tenían 7 meses de edad (media, 160 kg/PC), se mantuvieron en pastos de ryegrass de abril a noviembre y permanecieron en pastos nativos hasta marzo. En abril, los novillos regresaron al pasto de ryegrass, donde permanecieron hasta alcanzar los 440 kg/PC, luego se sacrificaron. Las hembras se mantuvieron en pastos nativos de septiembre a abril y se destinaron para la engorda en pastos de avena de mayo a julio. Las ventas se realizaron entre junio y noviembre al alcanzar 460 kg/PC (vacas multíparas), 450 kg/PC (primíparas) y 420 kg/PC (novillas) (Figura 3). Figura 3: Diagrama de flujo de producción del sistema integrado de actividades

133


Rev Mex Cienc Pecu 2022;13(1):127-144

Además, se desarrolló un diagrama de flujo para la estructura del rebaño utilizado en este estudio, sus unidades de producción media anual y el SIA (Cuadro 2). Cuadro 2: Estructura anual del rebaño de los sistemas de producción de ganado para carne en el sur de Brasil VCPN VCA URE UE SIA Categoría Cabeza Cabeza Cabeza Cabeza Cabeza (%) (%) (%) (%) (%) Vacas 612 (40) 594 (45) 0 0 1,206 (35) reproductoras Crías 459 (30) 420 (32) 0 0 879 (25) Hembras 1-2 años 245 (16) 240 (19) 0 0 485 (14) Machos 1-2 años 15 (1) 29 (2) 350 (80) 0 394 (11.5) Machos 2-3 años 0 0 85 (20) 0 85 (2.5) Vacas desechadas 168 (11) 0 0 168 (100) 336 (10) Toros 30 (2) 30 (2) 0 0 60 (2) Total 1,529 (100) 1,313 (100) 435 (100) 168 (100) 3,445 (100) VCPN= unidad de vaca-cría en pasto nativo; VCA= unidad de vaca-cría con agricultura; URE= unidad de recría-engorda; UE= unidad de engorda; SIA= sistema integrado de actividades.

Análisis técnico y financiero La tasa de destete se calculó con base en los datos de producción, definida como la relación entre el número de crías destetadas y el número total de vacas expuestas al apareamiento en un año anterior, y la proporción de crías destetadas por hectáreas. La productividad estimada se definió como la relación de kilogramos producidos por hectárea. Además, se obtuvieron los costos de cada unidad y se clasificaron como fijos (CF: US$) o variables (CV: US$). Los costos de las asociaciones, uniones e impuestos federales, que inicialmente no estaban estratificados, se dividieron entre las unidades de producción de acuerdo con el área disponible para el ganado. El monto total de los gastos de asistencia técnica, la electricidad y oficina comercial se dividieron proporcionalmente entre las áreas de ganadería y agricultura. Sólo se consideró el monto pagado relacionado con la ganadería para calcular los costos de cada unidad en los sistemas de producción de carne de res. El valor medio de cada unidad (US$/kg) durante el período de estudio se utilizó como precio de venta: US$ 2.26 (crías), US$ 1.59 (vacas con bajo peso), US$ 1.62 (vacas desechadas) y US$ 1.73 (novillos). También se calcularon las ventas totales de estas categorías y los ingresos totales (IT) de cada unidad de producción. A partir de los costos e ingresos, se calculó el costo total (CT), la suma del CF y CV, y el margen bruto (MB, la diferencia entre IT y CT). Se recolectaron datos de las unidades de producción durante un año y la información sobre los costos de producción se corrigió a los valores promedio de los últimos 5 años 134


Rev Mex Cienc Pecu 2022;13(1):127-144

como se practica en el mercado y se ajustaron por el Índice General de Precios (IGP). Los datos se obtuvieron en reales brasileños (R$) y se convirtieron a dólares estadounidenses (US$). Para observar la consistencia de los resultados de este estudio, se realizó un análisis de sensibilidad, con nueve escenarios diferentes para el MB/ha y MB/kg entre el SIA y la suma de medias de las cuatro unidades independientes (MCUI). En este análisis, los precios utilizados para los costos de producción y los kilogramos comercializados fueron los precios corrientes dentro de un intervalo de disminución del 10 % y de aumento del 10 %(15).

Resultados Los parámetros físicos del ganado para carne producido por cada unidad mostraron que la URE presentó una productividad de 341, 358, 303 y 260 % superior a la VCPN, VCA, UE y SIA, respectivamente. La mayor proporción de mano de obra en los costos de producción se registró en la unidad de VCA (50.3 %), seguida del SIA (42 %), VCPN (39.5 %), UE (9.2 %) y URE (5.6 %) (Cuadro 3). La compra de animales (67.7 %) y la alimentación de los animales (19.3 %) fueron los principales costos en la URE. En la UE, la compra de animales (82.3 %) y la mano de obra (9.2 %) fueron los principales costos. Cuadro 3: Parámetros físicos y costos de producción según el tipo de actividad productiva de los sistemas de producción de ganado para carne en el sur de Brasil VCPN VCA URE UE SIA Parámetros físicos Productividad, 87 83 297 98 114 kg/ha GDP, kg/d 0.49 0.4 0.7 0.65 0.58 Tasa de 0.4 (75) 0.42 (71) 0 0 0.32 (73) destete/ha, (%) Costos de producción Costos fijos (CF) US$ (%) US$ (%) US$ (%) US$ (%) US$ (%) 1,045.71 2,297.89 997.13 (0.7) 197.58 (0.1) 57.46 (0.05) Impuestos (0.9) (0.7) 48,832.09 75,269.52 11,345.16 9,651.29 145,098.06 Mano de obra (39.5) (50.3) (5.6) (9.2) (42) 49,877.80 76,266.65 11,542.74 9,708.75 147,395.95 Subtotal CF (40.4) (51) (5.7) (9.25) (42.7) Costos variables US$ (%) US$ (%) US$ (%) US$ (%) US$ (%) (CV) Alimentación de 36,896.37 36,850.23 39,138.35 3,622.97 116,507.91 animales (29.8) (24.6) (19.3) (3.5) (33.7)

135


Rev Mex Cienc Pecu 2022;13(1):127-144

Compra animales

de 8,490.00 (6.9) 4,346.55 Gastos variables (3.5) 15,242.11 Reproducción (12.3) 8,345.46 Sanidad animal (6.7) Transacción

446.84 (0.4)

73,767.33 Subtotal CV (59.7) 123,645.13 Total (CF + CV) (100)

8,490.00 (5.7) 4,105.77 (2.7) 14,948.12 (10) 8,542.13 (5.7) 418.84 (0.3) 73,383.09 (49) 149,649.74 (100)

137,285.72 (67.7) 2,251.29 (1.1) 0 5,372.98 (2,6) 7,225.56 (3.6) 191,273.89 (94.3) 202,816.63 (100)

86,342.76 (82.3)

16,980.00 (4.9) 10,930.56 226.95 (0.35) (3.2) 30,190.23 0 (8.7) 22,612.39 351.82 (0.3) (6.5) 4,546.36 893.68 (0.3) (4.3) 95,090.86 198,114.77 (90.75) (57.3) 104,799.61 345,510.72 (100) (100)

VCPN= unidad de vaca-cría en pasto nativo; VCA= unidad de vaca-cría con agricultura, URE= unidad de recría-engorda; UE= unidad de engorda; SIA= sistema integrado de actividades; GDP= ganancia diaria promedio.

La URE (563.4 US$/ha) y la UE (511.2 US$/ha) tuvieron los mayores costos de producción por hectárea (Figura 4a). La unidad de VCA tuvo el costo de producción por kg más alto (US$ 1.65), mientras que las unidades de VCPN (0.93 US$/kg) y SIA (1.85 US$/kg) tuvieron el más bajo y el segundo más bajo costo de producción por kg/PC, respectivamente. Además, también hubo una reducción en el costo/kg del 22.5 % al comparar el costo medio/kg de las cuatro unidades independientes (US$ 1.20) con el del SIA (US$ 0.93). Figura 4: a) Costo de producción (US$/ha y US$/kg). b) Margen bruto (US$/ha y US$/kg)

Unidad de vaca-cría en pasto nativo (VCPN), unidad de vaca-cría con agricultura (VCA), unidad de recría-engorda (URE), unidad de engorda (UE) y sistema integrado de actividades (SIA).

El MB presentó la mayor variación entre las unidades de URE (251.5 US$/ha) y VCA (17.25 US$/ha). Además, hubo una diferencia del 114 % al comparar la URE (251.5 US$/ha) y VCPN (117.3 US$/ha), las unidades con el MB más alto. Sin embargo, la VCPN (US$ 0.93) mostró los mejores resultados para el MB/kg, seguido de SIA 136


Rev Mex Cienc Pecu 2022;13(1):127-144

(US$ 0.74) y URE (US$ 0.53). Además, al comparar el MB/ha y MB/kg de la MCUI (US$ 96.58; US$ 0.54) y SIA (US$ 100.28; US$ 0.74), se observó que el SIA mostró un mejor resultado, arrojando un aumento del 3.7 % y 37 % en el MB/ha y MB/kg, respectivamente (Figura 4b). La simulación de los escenarios con diferentes costos de producción y kilogramos comercializados mostró que el SIA presentó resultados superiores para el MB/kg y MB/ha en nueve y seis escenarios, respectivamente (Cuadro 4).

Discusión La mayor productividad de la URE puede explicarse por la mayor GDP (0.7 kg/día) de los animales utilizados, que es una consecuencia del largo período de alimentación con ryegrass (240 días). El largo período de pasto cultivado se debió al clima del sur de Brasil, donde la temperatura promedio y los niveles de pluviométricos son favorables para el cultivo de ryegrass. Tecnologías como los pastos cultivados son capaces de aumentar considerablemente las tasas de producción en los sistemas de pastos para el ganado para carne, especialmente en períodos de menor suministro de alimentos como el invierno(16-18). Se reportó mayor productividad (356 kg/ha) en la recría-engorda con pastos cultivados de invierno y verano(19) en comparación con los sistemas de pastos cultivados utilizados en la URE. La decisión del administrador de cultivar pastos implica aumentar la complejidad del sistema y los costos de producción, sin embargo, como se muestra en nuestros resultados, esto puede aumentar la productividad. No obstante, el administrador debe evaluar si habrá un beneficio económico para el sistema al implementar este tipo de tecnología. Un estudio de simulación(8) reportó una productividad similar a la de la unidad de VCPN en un sistema vaca-cría (87 kg/ha). La menor productividad de la unidad de VCA (83 kg/ha) en este estudio se justifica por el bajo peso corporal de las vacas desechadas, que se venden magras con 340 kg por decisión del productor de no engordarlas. Además, el resultado de la VCA es consecuencia de los cambios en el sistema de producción causados por la venta de vacas con bajo peso. Originalmente, esta unidad fue designada para comercializar crías y vacas adultas que no lograron una mayor productividad. En línea con la productividad de la VCA reportada aquí, se reportó una productividad de 79 kg/ha para vacas con bajo peso después del destete de un sistema vaca-cría en el sur de Brasil(20). La baja productividad de la UE (98 kg/ha) puede explicarse por el reducido número de animales que se vendieron para sacrificio. Esto ocurrió debido a la relativamente baja GDP (0.4 kg/día), que no cumplió con los requisitos del mercado. La baja carga animal se debió a la reducción del 46 % en el área ganadera total por la reasignación al cultivo de soya entre septiembre y mayo. La decisión de mantener menos animales para la

137


Rev Mex Cienc Pecu 2022;13(1):127-144

engorda fue tomada por el granjero como medida de precaución; por lo tanto, el ganado podría asignarse a un área de pastoreo natural para sostener la carga total. En el SIA, el reducido número de animales de engorda impidió una mayor producción en términos de kg/ha, pero ofreció mejores tasas de producción. La alta proporción de mano de obra en los costos de producción de la unidad de VCA (50.3 %) se debió a una baja relación trabajador-animal (1/188). La menor proporción fue consecuencia de la mayor complejidad de la unidad en comparación con la URE y UE, y la necesidad de recursos humanos calificados debido al mayor nivel de tecnología empleada dentro de la unidad en comparación con la VCPN. Curiosamente, se reportó que la mano de obra representó hasta el 64 % de los costos totales debido al bajo costo de las nuevas tecnologías utilizadas para los sistemas vaca-cría(7). Por el contrario, en los sistemas de ciclo completo, la mano de obra representa solo el 25 % de los costos totales debido a los mayores costos de alimentación de los animales y a la mayor relación trabajador-animal (1/302)(21). Además, utilizar el porcentaje del costo total para evaluar la mano de obra puede ser engañoso debido a las diferentes características de cada sistema, lo que puede resultar en grandes variaciones en los costos. Los menores costos de compra de los animales de la UE (15 % de los costos totales) en comparación con los de los animales de la URE se debieron a la mayor proporción de los costos de alimentación de la UE en sus costos totales de producción. Un estudio realizado en Brasil informó sobre dos sistemas de recría-engorda en los que el 43 % y el 61 % de los costos totales estuvieron asociados con la compra de animales, lo que dio lugar a mayores costos de alimentación en un 30 % y un 9 %, respectivamente(22). Según los autores, la superioridad de un sistema relacionado con los costos de compra de animales fue una consecuencia de la diferencia en los costos de alimentación entre cada sistema. En 2015, el costo del ganado (por kg) de los sistemas vaca-cría en el sur de Brasil fue de US$ 1.26, superior a la VCPN (US$ 0.85) e inferior a la VCA (US$ 1.65)(23). De hecho, debido a los altos costos del manejo de los pastos, la URE fue más barata (US$ 1.2) que los sistemas de recría-engorda en pastos similares en el sur de los Estados Unidos (US$ 3.02)(19). Los bajos costos de producción presentados por el SIA reflejaron los menores costos fijos debido a la integración de actividades. Además, la reducción del 22.5 % en el costo de producción entre las unidades independientes y el SIA indica claramente que el SIA es económicamente más prometedor entre las actividades evaluadas. Esta diferencia fue por los menores costos de compra de animales porque el sistema integrado no compró animales para la cría y la engorda: el sistema produjo sus propias crías para la cría y vacas de desecho para la engorda. Los resultados superiores del MB/kg para la VCPN, en comparación con las unidades de URE y SIA, indican que la VCPN es la unidad económicamente más eficiente. Esta diferencia fue consecuencia del mayor volumen de ventas y mejor precio recibido por 138


Rev Mex Cienc Pecu 2022;13(1):127-144

kg/PC vendido (US$ 0.10 y 0.04 superior a las unidades de SIA y URE, respectivamente). La diferencia en el precio de mercado estuvo vinculada al momento en que se comercializaron los animales: las crías vendidas de la VCPN, los novillos de la URE vendidos durante el período de precios bajos y los novillos y vacas de desecho de las unidades del SIA vendidos durante los períodos de precios más bajos de la carne de res al por menor. En contraste, un estudio mostró una reducción en los márgenes económicos por el bajo nivel de tecnología empleada en el sistema, el valor de la tierra y la baja productividad(10). Por lo tanto, los buenos resultados económicos dependen de una comprensión de estos cambios en el mercado(24). Además, otros autores identificaron que el sistema de engorda tenía la mayor productividad, pero encontraron que el sistema vaca-cría era el más rentable(8). Para estos autores, los resultados pueden estar relacionados con los requisitos de venta durante los períodos secos y, por lo tanto, con el aumento de los costos de alimentación no compensados por el precio pagado por kilogramo. En una simulación del sistema de recría-engorda de pastoreo se encontraron solo pequeños márgenes de beneficio utilizando animales para sacrificio a los 18 meses(19). Esto fue el resultado del alto costo de los pastos utilizados para la engorda de los animales. En un sistema de ciclo completo, en la misma área como la utilizada en este estudio, se reportaron valores más altos para el MB/ha y MB/kg en US$ 291.9 y US$ 2.1 respectivamente, en comparación con nuestro SIA debido a la inclusión de los costos de oportunidad de la tierra y la depreciación de las instalaciones rurales en los costos finales de los sistemas de producción(21). Los valores del MB pueden explicarse por la venta de vacas con bajo peso (unidad de VCA) y el bajo número de vacas de desecho (UE) obtenida por el menor precio recibido durante las ventas. Después de todo, el momento de las ventas de vacas de desecho tiene un impacto económico importante(25). Un estudio con mayor tecnología empleada en la producción y alimentación de animales en comparación con el presente estudio, reportó valores medios del MB/ha para sistemas vaca-cría (US$ 518/ha) y de engorda (US$ 451/ha)(8). Lo que deja claro que la razón principal del bajo MB fue la baja inversión en tecnología de alimentación de los animales (VCPN) o en un mejor control en las otras etapas de producción, como el momento de compra y venta de los animales (VCA y UE). El MB/ha y el MB/kg del SIA son superiores a los de la MCUI en un 3.8 % y un 37 %, respectivamente, lo que muestra que la integración de las actividades con la comercialización no oportunista es crucial para mejorar los indicadores económicos. Estas mejoras son impulsadas principalmente por menores costos de compra de animales y un mejor uso de la mano de obra(6). En este estudio, la integración de los sistemas de producción de carne de res mejoró el margen económico al reducir los costos de transacción del ganado y permitir un mejor uso de los recursos humanos. Por lo tanto, los análisis detallados de la producción y los datos financieros son esenciales para garantizar la viabilidad económica de los sistemas de producción de carne de res.

139


Rev Mex Cienc Pecu 2022;13(1):127-144

Los valores del SIA son mejores que los valores de la MCUI para el MB/kg en todos los escenarios y para el MB/ha en seis de los nueve escenarios simulados, lo que demuestra que los resultados encontrados en este estudio son consistentes y pueden repetirse en diferentes situaciones. Las MCUI mostraron valores de MB/ha más altos que el SIA en tres escenarios debido a la diferencia generada por la simulación entre los precios de los insumos y los kilogramos comercializados, lo que reduce la importancia de la participación de los costos para la compra de animales utilizados en el cálculo del MB. Si los valores de variación utilizados fueran del 5 %, lo que representa un desafío menor para la consistencia de los datos presentados, los resultados serían mejores para el SIA en todos los casos. Por lo tanto, esto muestra que la comercialización oportunista no es benéfica para los sistemas de producción de ganado para carne. Aunque no se aborda en el estudio, al tratarse de sistemas de producción reales, se podría recomendar otra toma de decisiones para mejorar los estándares productivos y económicos de las granjas. Entre ellas, el uso de tecnologías externas al sistema, como el uso de creep-feed para aumentar el peso de las crías al destete. Otra estrategia que podría plantearse es el arrendamiento de zonas de producción para la engorda de vacas de desecho o incluso para mejorar la cría de terneros. Se enfatiza que existen varias posibilidades fuera del entorno productivo de una granja que pueden ayudar a mejorar los resultados, pero para ello es necesaria una buena planificación y el manejo adecuado de la producción para alcanzar los objetivos trazados de manera eficiente.

Conclusiones e implicaciones El conocimiento de todos los costos e ingresos potenciales de los diferentes sistemas de producción de ganado para carne son esenciales para obtener el mejor rendimiento financiero. Las unidades de producción independientes pueden lograr mejores resultados económicos cuando se integran en un sistema de ciclo completo utilizando las crías en recría-engorda para su venta futura. Esto se debe a una comercialización no oportunista, que reduce los costos de compra de animales y sus transacciones, y un mejor uso de los recursos humanos en un sistema integrado. Estos hallazgos también demuestran que la caracterización detallada de los sistemas ganaderos es necesaria para una evaluación precisa de su viabilidad económica. Por lo tanto, este debería ser el punto de partida para mejoras de la eficiencia del sistema de producción de carne de res.

140


Rev Mex Cienc Pecu 2022;13(1):127-144

Cuadro 4: Simulación del margen bruto (MB) por hectárea y kilogramo con un aumento o disminución del 10 % y precios reales de los costos de producción y kilogramos comercializados en el sur de Brasil (US$) Kilogramos Costos de producción comercializados -10% Reales +10% MB/ha MB/kg MB/ha MB/kg MB/ha MB/kg SIA MCUI SIA MCUI SIA MCUI SIA MCUI SIA MCUI SIA MCUI -10% 84.85 81.52 0.63 0.46 77.59 65.63 0.57 0.37 70.32 49.74 0.52 0.28 Reales 107.54 112.47 0.79 0.63 100.28 96.58 0.74 0.54 93.02 80.69 0.69 0.46 +10% 130.23 143.43 0.96 0.81 122.97 127.53 0.91 0.72 115.71 111.64 0.85 0.63 SIA= sistema integrado de actividades; MCUI= media de cuatro unidades independientes.

141


Rev Mex Cienc Pecu 2022;13(1):127-144

Agradecimientos Este estudio fue apoyado por el Consejo Brasileño de Desarrollo Científico y Tecnológico (Proyecto CNPq Núm. 133454/2014-2) y la Coordinación para el Perfeccionamiento del Personal de Educación Superior/CAPES, Brasil (Proyecto CAPES/PNPD Núm. 2842/2010). Literatura citada: 1.

United States Department of Agriculture – USDA. Livestock and poultry: world markets and trade. 2018 https://downloads.usda.library.cornell.edu/usdaesmis/files/73666448x/mg74qq69r/j6731729p/livestock_poultry.pdf Accessed Jan 17, 2019.

2.

Euclides FK. Supply chain approach to sustainable beef production from a Brazilian perspective. Livest Prod Sci 2004;90:53-61.

3.

Oliveira TE, Gianezini M, Peripoli V, Barcellos JOJ. Marketing alliances and differentiation strategies in the beef supply chain in Brazil. Rev Ibero-Am de Est 2015;14:40-50.

4.

Bravo UBE, Solís D, López VHM, Maripani JF, Thiam A, Rivas T. Technical efficiency in farming: A meta-regression analysis. J Prod Anal 2007;27:57-72.

5.

Ash A, Hunt L, Mc Donald C, Scanlan J, Bell L, Cowley R, et al. Boosting the productivity and profitability of northern Australian beef enterprises: Exploring innovation options using simulation modelling and systems analysis. Agric Syst 2015;139:50-65.

6.

Schroede TC, Kovanda J. Beef alliances: motivations, extent, and future prospects. Vet Clin North Am Food Anim Pract 2003;2:397-417.

7.

Åby BA, Aass L, Sehested E, Vangen O. A bio-economic model for calculating economic values of traits for intensive and extensive beef cattle breeds. Lives Sci 2012;143:259-269.

8.

Nasca J, Feldkamp CR, Arroquy JI, Colombatto D. Efficiency and stability in subtropical beef cattle grazing systems in the northwest of Argentina. Agric Syst 2015;133:85-96.

9.

Ruviaro CF, Costa JS, Florindo TJ, Rodrigues W, Medeiros GIB, Vasconcelos BS. Economic and environmental feasibility of beef production in different feed management systems in the Pampa biome, southern Brazil. Ecol Indic 2016;60:930939.

10. Siqueira TTS, Duru M. Economics and environmental performance issues of a typical Amazonian beef farm: a case study. J Clean Prod 2016;112:2485-2494.

142


Rev Mex Cienc Pecu 2022;13(1):127-144

11. Carvalho PCF, Batello C. Access to land, livestock production and ecosystem conservation in the Brazilian Campos biome: the natural grasslands dilemma. Livest Sci 2009;120:158-162. 12. Instituto Nacional de Meteorologia (INMET). 2016. http://www.inmet.gov.br Consultado: 10 Ago, 2016. 13. Carvalho PCF. Pasture country profile: Brazil. In: Plant production and protection division. Food and Agriculture Organization 2006 http://www.fao.org Accessed Jan 11, 2019. 14. Lowman BG, Scott NA, Somerville SH. Condition scoring of cattle. In: Agric Anim Prod, East Scotland Coil 1976;6. 15. Pang H, Makarechian M, Basarab JA, Berg RT. Structure of a dynamic simulation model for beef cattle production systems. Can J Anim Sci 1999;79:409-417. 16. Braz SP, Urquiaga S, Alves BJR, Jantalia CP, Guimarães APP, Santos SC, Pinheiro EFM, Boddey RM. Soil carbon stocks under productive and degraded pastures in the Brazilian Cerrado. Soil Sci Soc Am J 2019;77:914-928. 17. Dill MD, Emvalomatis G, Saatkamp H, Rossi JA, Pereira GR, Barcellos JOJ. Factors affecting adoption of economic management practices in beef cattle production in Rio Grande do Sul state, Brazil. J Rural Stud 2015;52:21-28. 18. Silva RO, Barioni LG, Hall JAJ, Matsuura MF, Albertini TZ, Fernandes FA, Moran D. Increasing beef production could lower greenhouse gas emissions in Brazil if decoupled from deforestation. Nat Clim Change 2016;6:493–497. 19. Scaglia G, Rodriguez J, Gillespie J, Bhandari B, Wang JJ, Mc Millin KW. Performance and economic analyses of year-round forage systems for forage-fed beef production in the Gulf Coast. J Anim Sci 2014;92:5704-5715. 20. Vaz RZ, Lobato JFP, Restle J. Analysis of the economic efficiency of cow-calf systems with different ages of weaning. Biosci J 2014;6:1837-1845. 21. Oaigen RP, Barcellos JOJ, Christofari LF, Neto JB, Oliveira TE, Prates ER. Internal competitiveness in beef cattle activity in the State of Rio Grande do Sul. Ciênc Rural 2011;6:1002-1007. 22. Pini TRM, Alencar SAS, Lucas LS, Brumatti RC, Franco GL, Mourão GB, Silva SL. Economic analysis of beef cattle production systems. B Indústr Anim 2014;71:4757. 23. Escola Superior de Agricultura Luiz de Queiroz-Centro de estudos avançados em economia aplicada (ESALQ-CEPEA). Production costs in livestock. 2016 http://cepea.esalq.usp.br/boi. Consultado 13 Jun, 2016.

143


Rev Mex Cienc Pecu 2022;13(1):127-144

24. Mc Hugh N, Fahey AG, Evans RD, Berry DP. Factors associated with selling price of cattle at livestock marts. Animal 2010;8:1378-1389. 25. Turner BL, Rhoades RD, Tedeschi LO, Hanagriff RD, Mc Cuistion KC, Dunn BH. Analyzing ranch profitability from varying cow sales and heifer replacement rates for beef cow-calf production using system dynamics. Agric Syst 2013;114:6-14.

144


https://doi.org/10.22319/rmcp.v13i1.5816 Artículo

Modelos de negocio para la producción de ovinos en el nororiente y centro del Estado de México

Judith Calderón-Cabrera a Vinicio Horacio Santoyo-Cortés a Enrique Genaro Martínez-González a* Víctor Herminio Palacio-Muñoz a

a

Universidad Autónoma Chapingo. Centro de Investigaciones Económicas Sociales y Tecnológicas de la Agroindustria y la Agricultura Mundial (CIESTAAM). Km 38.5 Carretera México-Texcoco, C.P. 56230, Chapingo, Estado de México, México.

*Autor de correspondencia: enriquemartinez@ciestaam.edu.mx

Resumen: La ovinocultura es importante debido a la creciente demanda y los beneficios que genera. Sin embargo, para impulsar su productividad se requieren conocer sus características empresariales. El objetivo de la investigación fue explicar el entorno en el cual se desarrolla la producción y definir los principales modelos de negocio, para precisar sus perspectivas de desarrollo. Se aplicó una entrevista semiestructurada a 32 empresas. Para analizar el perfil del productor y la unidad de producción se usó estadística descriptiva y para tipificar las empresas dependiendo de su modelo de negocio se utilizó un análisis clúster. Se encontró que, debido a la cercanía con grandes centros urbanos, la producción se ubica en una zona periurbana con alta demanda por recursos como tierra y agua, participa en una cadena comercial de circuito corto y los productores realizan la actividad de manera complementaria. Bajo este contexto, se identificaron tres modelos de negocio: i) el tradicional, que ofrecen animales sin atributos diferenciados, sin realizar mejoras productivas y comerciales, que desarrollan la actividad de manera inercial y sin perspectivas de mejora; ii) el intermedio, que muestra mayor disposición a aplicar conocimientos técnicos, comerciales y gerenciales,

145


Rev Mex Cienc Pecu 2022;13(1):145-162

debido a la escolaridad de sus productores; y iii) el especializado, en donde se realiza un mejor manejo productivo, ofreciendo productos de alto valor. Se concluye que para impulsar la productividad es necesario tomar en cuenta el modelo de negocio y el entorno, pues solo una vez que se atiendan las necesidades del mercado, los productores mejorarán su competitividad. Palabras clave: Ovinocultura, Borregos, Empresas familiares, Entorno.

Recibido: 24/09/2020 Aceptado: 13/04/2021

Introducción Los sistemas de producción pecuarios son dinámicos y se encuentran influenciados por factores externos e internos, los cuales generan diversidad, por lo que para establecer estrategias de desarrollo se requiere diferenciarlos. En este sentido, la tipificación ha sido una de las herramientas más utilizadas para contar con modelos diferenciados(1). Esta herramienta agrupa a los sujetos de estudio de la forma más homogénea posible, mediante alguna variable o el uso de métodos estadísticos multivariados como el análisis clúster, factorial o de componentes principales(2). Debido a la importancia de la producción de ovinos en México, existen investigaciones que han generado tipologías mediante la aplicación de estadística multivariada, con base en el perfil del productor(1,3), el manejo productivo(4), la estructura de la unidad de producción(2,5,6) o el nivel de participación familiar(7); con el fin de caracterizar los sistemas productivos y ser un punto de referencia en el diseño de estrategias. Dichas características se basan en factores internos de las empresas; sin embargo, existen factores externos que afectan la viabilidad y existencia de éstas, por lo que se requiere analizarlos en conjunto con el Modelo de Negocio (MN). El MN permite entender como las elecciones que se realizan afectan la competitividad, además de que facilita la planeación de estrategias para aprovechar las condiciones del entorno, haciendo uso eficiente de los recursos(8,9). Este análisis relaciona los recursos y actividades que realizan, con el propósito de satisfacer las necesidades de los clientes, considerando su red de valor para crear, proporcionar y capturar valor(10,11), siendo útil para cualquier empresa que ofrece su producto al mercado, pues le permite entender a los clientes y su relación con ellos, el proceso, los recursos y capacidades necesarias para satisfacerlos y hacer más eficientes los canales de comercialización.

146 145


Rev Mex Cienc Pecu 2022;13(1):145-162

Osterwalder y Pigneur(12)presentan el MN integrado por nueve componentes: i) propuesta de valor, como eje central y que hace que un cliente elija a una empresa u otra, a través de ofrecer satisfacer sus necesidades; ii) asociaciones clave, que comprende a los actores que contribuyen al funcionamiento del MN (proveedores, instituciones y organizaciones); iii) actividades clave, que se deben realizar para que se pueda ofrecer la propuesta de valor; iv) recursos clave, ya sea físicos, económicos, intelectuales o humanos; v) relaciones con el cliente; vi) canales de distribución; vii) segmento de mercado; viii) ingresos; y ix) costos en los que se incurren. Este análisis describe las bases sobre las cuales las empresas crean, proporcionan y captan valor, reflejando la manera en cómo funcionan y se adaptan al entorno(12). Independientemente de la escala de producción, todas poseen un MN, ya que toman decisiones sobre su oferta y la organización de actividades y recursos para cubrirla(13). Por lo que el análisis ha sido empleado en diversos campos, no siendo la excepción el sector agroalimentario(14,15,16), utilizándolo para entender la relación con los clientes y las estrategias implementadas ante un entorno dado. La producción de ovinos se concentra en el centro del país, donde es una actividad importante para la ganadería familiar, por su fácil manejo y su capacidad para aprovechar el forraje, además de ser promovida ampliamente por el gobierno(17,18,19), por valorizar la mano de obra familiar(20). No obstante, debido a las regiones y los recursos con los que se cuenta se tiene una gran diversidad. El principal estado productor es el Estado de México, que en 2019 aportó el 15 % de la oferta nacional con 17,992 t de ovinos en pie(21); esta entidad posee una ventaja debido a su cercanía con los grandes centros de consumo de barbacoa(22), principal forma de consumo de la carne de ovino. Pese a la importancia de la actividad, existe escasa información sobre las características empresariales de los ovinocultores que destinan su producción al mercado, por lo que el objetivo fue explicar el entorno empresarial (asociaciones, actividades y recursos), así como las relaciones con los clientes y canales de distribución en el cual se desarrollan y definir los principales MN, mediante el análisis de la estructura de las empresas, para precisar sus perspectivas de desarrollo.

Material y métodos La investigación se realizó en 14 municipios del nororiente y centro del Estado de México (Figura 1), que representaron en promedio el 28% de la oferta estatal en el período de 2010 a 2019: Temoaya, Acambay, Jocotitlán, Ixtlahuaca, Atlacomulco, Jilotepec, Morelos, El Oro, Toluca, Lerma, Metepec, Timilpan, Tianguistenco y Xalatlaco, reportando una producción de 4,557 t de ovinos en pie en 2019, con un valor de más de 175 millones de pesos(21).

147 145


Rev Mex Cienc Pecu 2022;13(1):145-162

Los municipios fueron seleccionados con base en la ubicación de las unidades de producción de los miembros de la Asociación Ganadera Local de Ovinocultores del Valle de México (AGLOVM), pertenecientes a la entidad federativa y productores inscritos en el programa de buenas prácticas pecuarias del Comité de Fomento y Protección Pecuaria del Estado de México (CFPPEM). Figura 1: Municipios que conforman la región de estudio

Identificación de productores y colecta de información Se aplicó una entrevista semiestructurada a 32 productores de ovinos, elegidos mediante muestreo dirigido, durante los meses de junio y julio de 2019. La selección se basó en la orientación de su producción hacia el mercado y su objetivo productivo (carne o pie de cría), contando con al menos 15 cabezas en su rebaño. Dichos productores eran miembros de la AGLOVM o productores inscritos en el programa de buenas prácticas pecuarias del CFPPEM. En el cuestionario se recabó la siguiente información, agrupada en tres grupos:  Perfil del productor: edad, escolaridad, porcentaje de ingresos provenientes de la ovinocultura, actividades complementarias y experiencia en la actividad.  Características de la unidad de producción: antigüedad, ubicación, objetivo productivo, instalaciones, forma de financiamiento, inversiones, compra de insumos, inventario del rebaño, raza, peso y precio de los animales vendidos, mortalidad, edad y peso al destete, subsidios recibidos, número de trabajadores, integración familiar, sucesión empresarial y problemática. 145 148


Rev Mex Cienc Pecu 2022;13(1):145-162

 MN: clientes y su relación con ellos, asociaciones clave, canales de comercialización, promoción de productos, actividades y recursos clave para llevar a cabo su producción.

Análisis estadístico Las variables sobre el perfil del productor y la unidad de producción fueron analizadas a través de estadística descriptiva para el caso de variables cuantitativas y tablas de proporción para el caso de variables cualitativas. Derivado de este análisis se identificaron las variables por componente del MN y se seleccionaron las 10 con mayor variación y que impactan en los resultados productivos; las cuales se emplearon para realizar un análisis clúster jerárquico. Las respuestas fueron codificadas en 0 para respuestas negativas y 1 en caso de ser afirmativa (Cuadro 1). Cuadro 1: Variables binomiales utilizadas para construir el clúster jerárquico Respuestas Componente Variable afirmativas del MN (%) Asociaciones Pertenece a alguna organización o asociación formal de 28.1 clave productores de ovinos La edad al destete es menor a 2 meses 31.2 El porcentaje de mortalidad es menor a 5% 53.1 Realiza alguna actividad para atraer a clientes (asistir a Actividades 40.6 ferias o eventos pecuarios, redes sociales) clave Ha realizado alguna inversión en su unidad de producción en el último año (ampliación o 46.9 mantenimiento) La mayoría de los trabajadores permanentes son 65.6 miembros de la familia (hijos, esposa o hermanos) Las instalaciones de su corral son adecuadas para la Recursos producción (cuentan con piso de concreto, techo, evitan 53.1 clave las inclemencias del tiempo y depredadores) Posee una marca o logotipo su unidad de producción 34.38 Ha recibido algún subsidio relacionado con la 44.7 ovinocultura Canales Realiza la entrega de su animal a pie de corral 68.7 MN= modelo de negocio.

Cabe resaltar que, en el análisis clúster solo se utilizaron algunas variables relacionadas con cuatro de los componentes del MN, el resto se usó para el análisis y descripción. El clúster jerárquico utilizó la medida de similitud de Dice y Sorensen, apropiada para variables

145 149


Rev Mex Cienc Pecu 2022;13(1):145-162

binarias y como método de aglomeración la media ponderada(23). Una vez obtenido el dendrograma se clasificaron los tipos de empresas, determinando el punto de corte a través de un análisis cualitativo. Además, se realizó un análisis de varianza con la prueba de Scheffé, para las variables cuantitativas que describen al productor y a la unidad de producción. Una vez determinados los tipos de empresas se analizó su MN con base en los componentes del lienzo propuesto por Osterwalder y Pigneur(12).

Resultados Características generales de las empresas ovinas Las empresas son propiedad de productores con una edad promedio de 50 años, dedicándose a la ovinocultura por tradición familiar, ya que fue heredada por sus padres o abuelos. Sin embargo, a pesar de esto, solo el 9 % contempla un acuerdo de sucesión empresarial que permita a las siguientes generaciones continuar, a pesar de que consideran a la actividad con un potencial alto para generar ingresos. Estos productores obtienen en promedio de la ovinocultura un tercio de sus ingresos y el resto lo reciben de la agricultura, el comercio o la prestación de servicios. El 53 % de las empresas posee instalaciones adecuadas, mientras que el resto cuenta con instalaciones rústicas para albergar el rebaño, las cuales no protegen a los animales de las inclemencias del tiempo o de depredadores. No obstante, cualquiera que sea el tipo de instalación, se construyó con recursos propios, sin recibir ningún apoyo, a excepción de los subsidios para equiparse de maquinaria o adquirir animales (56 % afirmó haberlo recibido). Respecto a las inversiones realizadas en la empresa durante el último año, se tiene que el 53 % no ha incurrido en ningún gasto, 22 % ha hecho alguna mejora de mantenimiento y solo el 25 % ha ampliado. Además, los productores no realizan gastos para promocionarse y atraer clientes. El principal objetivo de estas empresas es la producción de animales para carne (75 %), que se comercializan a pie de corral con un peso promedio de 53 kg. El 53 % vende a clientes ocasionales en su unidad de producción, a un precio de 46.6 pesos el kg; sin embargo, existe una minoría que vende directamente al consumidor final (6 %). Asimismo, existen otras que dirigen su producción a la cría de sementales o pies de cría de raza pura, por lo que el 28 % pertenece a una organización de productores de ovinos, debido a que, para venderlos se requiere de un registro de pureza, que acredite los antecedentes genealógicos del animal. Las 32 empresas manejan en promedio 108 animales de cara negra, como Dorper, Suffolk y Hampshire, de los cuales 66 son vientres. Las unidades de producción se localizan en terrenos 150 145


Rev Mex Cienc Pecu 2022;13(1):145-162

propios, ubicados al lado de la vivienda, lo que facilita la participación de la familia tanto de manera permanente como temporal; por ejemplo, del total de trabajadores permanentes el 48 % es miembro de la familia y el 52 % no pertenece a ella, y del total de trabajadores temporales el 53 % se conforma por miembros de la familia, los cuales prestan su mano de obra a cambio de bienes que se adquieren para la familia, principalmente alimentos, ropa y calzado.

Características de los grupos y su denominación Debido a que las empresas analizadas no son homogéneas entre sí, es necesario tomar en cuenta aspectos relacionados con la estructura de la empresa. En este sentido, surgen tres tipos (Figura 2), agrupados de acuerdo con sus asociaciones clave, canales de comercialización, actividades y recursos clave. Los grupos se denominaron como tradicionales, intermedios y especializados, con base en los objetivos de cada empresa. Las unidades de producción de los tradicionales son las que tienen mayor antigüedad (34 años), con un rebaño promedio de 117 cabezas y sus dueños poseen un nivel de escolaridad básico de 7 años. Las empresas intermedias son propiedad de dueños con un nivel de escolaridad medio superior (12 años), tienen el menor número de animales, 52 cabezas en promedio y sus unidades de producción no son tan antiguas (10 años). Mientras que las empresas especializadas tienen un mayor rebaño, compuesto por 179 cabezas, una antigüedad de 18 años en promedio y sus dueños poseen el mayor grado de escolaridad de los tres grupos (Cuadro 2), con un nivel superior al menos. Figura 2: Grupos resultantes del análisis clúster jerárquico

151 145


Rev Mex Cienc Pecu 2022;13(1):145-162

Entre los grupos las variables que difieren son la escolaridad, la antigüedad de la empresa, el número de cabezas y el porcentaje de trabajadores miembros de la familia (P<0.05), siendo los tradicionales e intermedios los que poseen una mayor participación familiar (Cuadro 2). Cuadro 2: Perfil de los productores y estructura de la unidad de producción por modelo de negocio Tradicionales Intermedias Especializadas Variables (n=6) (n=15) (n=11) a Edad del productor, años 52.0 52.3ª 47.1ª a Experiencia, años 27.7 16.5ª 11.6a Escolaridad, años 7.0a 11.9b 16.7c Ingresos percibidos de la actividad, % 45.0a 25.0a 37.7a Antigüedad de la empresa, años 34.0b 10.5a 18.3a,b Tamaño del rebaño, cabezas 117.2ª,b 51.7a 179.2b Trabajadores permanentes miembros 66.7b 65.0b 13.6ª de la familia, % abc

Valores con diferente literal dentro de la fila, son diferentes (P<0.05).

Modelos de negocio De acuerdo con la tipología, se construyó el modelo que resume las principales diferencias entre los MN, reflejando la manera en cómo las empresas llevan a cabo su negocio. Cuadro 3: Modelos de negocio Componente

Tradicionales (n=6)

Intermedias (n=15)

Asociaciones clave Actividades clave

CFPPEM SEDAGRO

CFPPEM SEDAGRO Inversión en nutrición de corderos y borregas lactantes

Parámetros productivos

Destete a los 3.5 meses con un peso de 28.5 kg Prolificidad de 1.0 Mortalidad del 10.7 % Mano de obra familiar

Destete a los 3.2 meses con un peso de 23.6 kg Prolificidad de 1.2 Mortalidad del 11.0 % Mano de obra familiar

Recursos clave

152 145

Especializadas (n=11) CFPPEM AGLOVM Inversión en instalaciones y nutrición de acuerdo con la etapa productiva. Promoción del producto Destete a los 2.2 meses con un peso de 23.8 kg Prolificidad de 1.2 Mortalidad del 7.3 % Marca o logotipo


Rev Mex Cienc Pecu 2022;13(1):145-162

Superficie cultivable Experiencia

Superficie cultivable

Superficie cultivable Infraestructura Animales de raza Escolaridad Segmento de Compradores Compradores Compradores mercado ocasionales ocasionales, ocasionales, Restaurantes, Restaurantes, Barbacoyeros, Barbacoyeros, Acopiadores Acopiadores regionales regionales, Gobierno del Estado de México Canal de Lleva el animal hasta Entrega a pie de corral Entrega a pie de corral comercialización el cliente Relación con Comunicación Comunicación Comunicación clientes personal personal telefónica Ingresos anuales 102,520 MXN por 47 101,058 MXN por 40 192,270 MXN por 74 por la venta de animales animales animales animales para carne Propuesta de Animales con un peso Animales con un peso Animales con un buen valor promedio que cumplen promedio que cumplen rendimiento en carne, con el estándar del con el estándar del buen porte y genética mercado local mercado local

Discusión El entorno y sus consecuencias en las empresas Se encontró que la ovinocultura es una actividad pecuaria que se hereda de generación en generación y que adquiere importancia, debido al impacto que tiene en la economía familiar y a la cercanía con los principales centros de consumo, como lo señala un estudio realizado en el Estado de México(22). Por este motivo, es una de las actividades pecuarias que recibe más apoyos por parte del Estado; en el caso de los encuestados el 94 % manifestó haber recibido algún tipo de subsidio (maquinaria, animales o asesoría técnica), con la finalidad de incrementar su productividad y mejorar el bienestar familiar. Es así como, por su fácil manejo y baja inversión, brinda estabilidad en los hogares. En este sentido, se encontró que la familia juega un rol importante en el desarrollo y rentabilidad, por lo que el porcentaje de trabajadores de este tipo es considerable.

145 153


Rev Mex Cienc Pecu 2022;13(1):145-162

Por otra parte, la ovinocultura se desarrolla en un entorno de crecimiento poblacional y de hábitos de consumo de carne peculiares, por lo que el principal objetivo es la producción de carne, con animales de cara negra debido a su mayor aceptación en el centro del país, lo que concuerda con el estudio realizado sobre las canales nacionales, donde las razas Suffolk, Hampshire y Dorset prevalecen(24). El primer aspecto beneficia el crecimiento en la demanda, pero amenaza la producción debido a la transformación de las zonas rurales a periurbanas, situación que consideran como el segundo problema más importante que limita su actividad; en donde se compite por recursos como tierra, agua y mano de obra, entrando en conflicto con otras actividades que brindan un mayor beneficio. El segundo aspecto, se refiere a que la producción es destinada principalmente a la elaboración de barbacoa, que se consume tradicionalmente los fines de semana en puestos y eventos sociales, reduciendo su consumo a ocasiones especiales, debido al precio elevado de venta. Bajo este escenario, la competitividad de una empresa no solo depende de sus aspectos internos, sino de factores del entorno, que al no poderse controlar directamente se requieren analizar, para tomar las mejores decisiones. En el caso de las empresas analizadas, estos factores son: el apoyo gubernamental, el crecimiento urbano, la tradición de la producción y los hábitos de consumo. A pesar de que todas se desarrollan en este entorno, se tiene que cada MN lo aprovecha de manera diferente.

Modelos de negocio identificados y sus perspectivas Modelo de negocio tradicional La ovinocultura provee a sus productores casi la mitad de sus ingresos, el resto lo obtienen de actividades agrícolas o ganaderas, sin embargo, este flujo de ingresos no es continuo, como lo indican Hernández et al(4), pues solo venden sus animales cuando necesitan dinero. Los productores tienen un nivel de escolaridad básico, por lo que es normal la existencia de deficiencias en los principales parámetros de productividad, como en el peso al destete, dato similar fue reportado por Vázquez et al(2) en el clúster de unidades de producción familiar de subsistencia, donde la edad al destete es superior a los tres meses, con un peso de 17.6 kg. Con base en esta característica las decisiones se toman de manera simple y se basa en la experiencia del productor, como lo señalan algunos autores en el nor-poniente de Tlaxcala, donde las decisiones técnicas se basan en la experiencia y ésta puede determinar el nivel de adopción de tecnología(25). Estas empresas no ven a la actividad como un negocio rentable, sino como una manera de emplear sus recursos (mano de obra familiar y superficie cultivable), con el fin de generar una estabilidad económica en la familia. En este sentido, los resultados son el reflejo del

154 145


Rev Mex Cienc Pecu 2022;13(1):145-162

desinterés por incurrir en gastos adicionales, pues solo mantienen la unidad de producción por usos y costumbres. El rebaño es atendido por la familia, mujeres y niños principalmente, considerando su mano de obra como un recurso clave que se emplean mientras consiguen otra actividad que les genere mayor beneficio o vendan la tierra. A pesar de que la producción les genera ganancias, pues no incurren en gastos de infraestructura, mano de obra, ni alimentación, conservando así los 102,520 pesos que perciben por la venta de animales finalizados. Estas empresas se dedican a la producción de ovinos para carne por tradición de la región y porque sus padres o abuelos les heredaron la actividad; compitiendo con otros productores locales respecto al precio, pues no cuentan con otro atributo que los diferencie. Sus clientes son compradores ocasionales, que llegan a la unidad de producción sin la necesidad de establecer una relación formal con anterioridad, quienes ocupan el animal para autoconsumo. Debido al tipo de cliente y la propuesta de valor que se ofrece, el precio recibido es menor al de los otros modelos, 44 pesos por kg en pie, cifra igual a la reportada en la Ciudad de México(5), pues el cliente no se encuentra fidelizado y busca los mejores precios para la negociación; además, no muestra disposición a pagar por características relacionadas con el bienestar animal (que comprenden las condiciones bajo las cuales vive y muere el borrego) o la raza, pero sí castiga el precio por una edad mayor al año o por hembras de desecho. Un estudio realizado en el sur del Estado de México señala que este precio puede ser explicado en parte porque el productor desconoce las necesidades del cliente, así como los momentos adecuados para producir y comercializar(19). En relación con el apoyo gubernamental, este MN recibe asesorías por parte de instituciones, como el CFPPEM y la Secretaría de Desarrollo Agropecuario (SEDAGRO); sin embargo, son ocupadas para resolver problemas sanitarios existentes, en lugar de ocuparlas para un manejo preventivo, que maximice la productividad. Lo anterior, debido al nivel de escolaridad y el desinterés por incurrir en gastos adicionales. Este mismo desinterés se visualiza en que ninguna de las empresas ha recibido apoyo para la adquisición de animales que genéticamente mejoren su rebaño, lo que se puede justificar por el desinterés en incurrir en gastos adicionales, ya que, en el caso de recibirlos, caerían de forma forzada en realizar inversiones, debido a la alimentación y el manejo específico que requieren. Derivado de estas características, el MN encuentra limitaciones para su continuidad en las siguientes generaciones, pues a pesar de que los productores heredaron esta actividad, no la visualizan como un negocio redituable, sino como una forma de emplear su patrimonio, mientras venden la tierra o le dan otro uso. Adicionalmente, presentan incertidumbre en la 145 155


Rev Mex Cienc Pecu 2022;13(1):145-162

sucesión empresarial y el sucesor desconoce el rol que desempeñará, influyendo esto en la baja inversión. Al mismo tiempo, debido al crecimiento poblacional y el cambio de zonas rurales a periurbanas, los productores se enfrentan a problemas que reducen los incentivos para continuar, ya sea por el costo de oportunidad o la inseguridad.

Modelo de negocio intermedio En este MN, los productores perciben de la actividad menos de un tercio de sus ingresos y el resto lo obtienen de la agricultura, la ganadería y el comercio, lo que difiere con lo encontrado en el municipio de Villa Victoria en el Estado de México, donde señalan que perciben el 40 %(26). Poseen una escolaridad de nivel medio superior inconcluso, y a pesar de ser el grupo con menor rebaño, muestran interés por intensificar su producción, invirtiendo en la nutrición de sus borregas lactantes y corderos, diferenciando el alimento que le suministran, pues reconocen que son etapas cruciales. Cabe señalar que este MN coincide con el tradicional, en donde a menor número de animales, la participación de la familia es mayor y tanto las mujeres como los niños prestan su mano de obra. Del total de trabajadores permanentes el 65 % es miembro de la familia, situación que es favorecida por el fácil manejo de los animales y por la valorización de la mano de obra; estos resultados concuerdan con lo publicado en la Producción ovina mexicana, donde se analizó a los productores inscritos en el PROGAN, en México, los autores concluyen que el cuidado del rebaño está a cargo de niños, mujeres y ancianos, especialmente en aquellas unidades con menor rebaño, debido a que estos miembros de la familia son los que permanecen en las zonas rurales(20). Esta participación reduce los costos que generaría contratar mano de obra, incrementando así la ganancia que se percibe. A pesar de la participación familiar, estas empresas no solo ven a la ovinocultura como una opción para valorizar su mano de obra y hacer uso de la superficie cultivable, sino como un negocio, pues invierten en mejorar su manejo productivo, lo cual es un indicador de competitividad, a través de una de las actividades que da rápidos resultados, según se señala en el estudio de las problemáticas y oportunidades de los ovinocultores de Nueva Zelanda(27). Estos productores invierten en la nutrición de corderos y borregas lactantes, para mejorar su peso. Lo anterior se debe al nivel educativo de sus dueños, el cual les permite ser más receptivos e incorporar nuevas prácticas. Sin embargo, aún no desarrollan estrategias comerciales para mejorar su proceso de venta o agregar valor. Se dedican a la producción de ovinos para carne, debido a que heredaron esta actividad. Los ovinos son comercializados localmente, entregando a pie de corral y sus clientes son compradores ocasionales, acopiadores regionales, restauranteros o barbacoyeros, que 156 145


Rev Mex Cienc Pecu 2022;13(1):145-162

compran a 46.7 pesos el kilo en pie, en promedio, precio mayor al obtenido por los tradicionales, ya que se relacionan con otros actores. Respecto al apoyo gubernamental, estas empresas reciben asesoría de instancias gubernamentales (CFPPEM y SEDAGRO) y han sido beneficiarios de subsidios para mejorar la genética y productividad de su rebaño, al menos una vez en los últimos cinco años, a través de vientres y sementales certificados, accediendo así a mejores ganancias. Sin embargo, a pesar de que este MN muestra un mejor aprovechamiento del entorno, al igual que el MN tradicional, presenta la incertidumbre que genera la sucesión empresarial, en donde solo el 27 % cuenta con planes para el retiro y en el 36 % de los casos, el sucesor está consciente del rol que desempeñará en el futuro, heredando la unidad de producción; hechos que limitan las inversiones. No obstante, muestran buenas perspectivas de desarrollo, pues la mayoría visualiza a su empresa en crecimiento en los próximos cinco años, por lo que con acciones proactivas que mejoren su competitividad, como el mejoramiento genético, la nutrición de acuerdo con la etapa productiva y la búsqueda de clientes que ofrezcan mejores precios, la existencia y viabilidad es posible. Aunque para lograr esto se requiere cambiar el paradigma del productor, como lo sugiere Michalk et al, para los países en desarrollo que desean mejorar su productividad; orientando su empresa a satisfacer las necesidades del mercado(28).

Modelo de negocio especializado Los productores perciben más de un tercio de sus ingresos de la producción y el resto lo obtienen del sector terciario de la economía, prestando servicios profesionales, ya que poseen un nivel académico mayor a los otros grupos, lo cual permite mejorar su productividad e impacta en la estructura de su MN, facilitando la incorporación de buenas prácticas pecuarias. Según Camacho Ronquillo et al(29), en la actualidad estas empresas han incrementado y muestran buenas perspectivas, ya que adoptan nuevas tecnologías con la finalidad de contribuir a la oferta nacional y mejorar su rentabilidad. Este grupo es probable que siga el comportamiento de los principales exportadores de carne de ovino, aportando una mayor producción mediante el uso eficiente de sus recursos y no por medio del incremento del rebaño, incorporando conocimientos técnicos y gerenciales que permitan hacer lo mismo con menos recursos. Lo anterior, acompañado de tecnologías, que incrementen la prolificidad, combinando factores genéticos y nutricionales en la gestación y en el crecimiento de los corderos, aumentando el peso y la productividad(27,28,30,31). Al igual que en el estudio sobre la contribución de la ovinocultura en México(18), se encontró que cada vez más productores dejan de ver a la ovinocultura como una actividad de traspatio

157 145


Rev Mex Cienc Pecu 2022;13(1):145-162

y la visualizan como un negocio con alto potencial, es así como poseen en promedio más de 100 vientres y realizan la actividad aprovechando la tradición de consumo y la producción. Estas empresas no son familiares, pero poseen una marca que les permite crear una reputación. Ofrecen dos tipos de productos, animales para carne y para reproducción, productos de alto valor que se diferencian dentro del mercado, aprovechando su valor genético. Sin embargo, la competencia por el suelo y la falta de promoción del consumo de carne les dificulta el crecimiento. Estas empresas reconocen la importancia de la mejora genética en su nivel de competitividad y siguen la tendencia mundial sobre el uso de tecnologías genéticas, que mejoran el crecimiento y la calidad del canal, que pretenden revolucionar la producción, que se encuentra amenazada por la escases de recursos, según lo indican algunos autores que investigaron las preferencias y tendencias de la producción ovina, en los últimos años se han desarrollado investigaciones sobre el mejoramiento ovino, a través de la selección genómica, con la finalidad de obtener mejores pesos y calidad en canal(32). Por el lado de la demanda, sus clientes son dos, los que buscan animales para carne y los que los solicitan para reproducción. Los primeros adquieren el animal a 48 pesos el kg en pie, en promedio. Estos clientes son acopiadores, barbacoyeros y restauranteros, con los cuales se comunican vía telefónica, debido a que se ha tratado con ellos con anterioridad. Sin embargo, también venden a clientes ocasionales, entregando a pie de corral. Por otra parte, los animales para reproducción son vendidos con registros de pureza, destinando principalmente su oferta al gobierno del Estado. Los ovinos se encuentran en instalaciones adecuadas, disminuyendo algunos problemas sanitarios que se presentan en unidades de producción rústicas, las cuales fueron construidas con recursos propios. Incorporan técnicas productivas, reproductivas, genéticas y nutricionales, que mejoran su productividad. Con la finalidad de hacer eficiente sus actividades y no solo reciben asesoría técnica de instancias gubernamentales, sino que contratan asesoría que les instruye en el manejo preventivo del rebaño, al menos tres veces al año. Asimismo, han sido beneficiarios de animales subsidiados, en los últimos cinco años. Dichos animales han sido proveídos por el gobierno del Estado de México. El MN les ha permitido enfrentar la problemática que aqueja la cadena de valor, pues han incursionado en aspectos comerciales, genéticos y organizativos, ya que se encuentran agremiados a una asociación de ovinocultores y realizan una búsqueda intensiva de clientes, a través de redes sociales y eventos. Cabe señalar que este grupo tiene incentivos para mejorar su rentabilidad, pues incurren en mayores costos (mano de obra, alimentación, manejo productivo, genética, promoción y certificación en algunos casos) y requieren recuperar su inversión.

158 145


Rev Mex Cienc Pecu 2022;13(1):145-162

Se espera que este MN permanezca en el largo plazo, incorporando técnicas productivas, comerciales y gerenciales, abordadas de manera integral, pues este tipo de empresas muestra interés por conocer los factores que afectan su actividad, buscando de manera continua aprovechar las oportunidades que les brinda el entorno y la creciente demanda de carne de ovino.

Conclusiones e implicaciones Los productores de ovinos analizados se enfrentan a factores de su entorno que afectan su crecimiento e inciden en su viabilidad, como la transformación de las áreas rurales a periurbanas y los hábitos de consumo. Bajo este contexto, se pueden distinguir tres tipos de MN: tradicionales, intermedios y especializados (18.7 %, 46.9 % y 34.4 %, respetivamente), que se diferencian significativamente en la escolaridad, la antigüedad de la unidad de producción, el tamaño del rebaño y el porcentaje de trabajadores miembros de la familia y que perciben a la ovinocultura de manera diferente. Distinguiéndose principalmente por aspectos comerciales, desde la forma de relacionarse con los clientes, el precio de venta, hasta la manera de entregar su producto; recursos, que les permiten reducir gastos, como la mano de obra familiar y superficie cultivable; y actividades clave, que mejoran el peso de los animales y reducen su mortalidad. Así, las tradicionales son empresas que emplean sus recursos disponibles para generar una estabilidad económica en la familia, pero muestran una tendencia a cambiar de uso de suelo en el mediano plazo, por actividades que les generen un mayor beneficio; las intermedias, si bien realizan algunas actividades para mejorar la alimentación del rebaño, solo podrán desarrollarse realizando acciones proactivas que mejoren su productividad y las empresas especializadas, con el mayor número de cabezas, muestran buenas perspectivas, ya que sus elecciones les han permitido dirigirse a un segmento de mercado que ofrece mejores precios, coordinando sus asociaciones, actividades y recursos, para satisfacer las necesidades de sus clientes. En los tres tipos, un reto adicional para la continuidad es lograr una sucesión generacional exitosa. Literatura citada: 1. Coronado-Minjarez AM, Figueroa-Rodríguez KA, Figueroa-Sandoval B, GarcíaHerrera JE, Ramírez-López A. Caracterización y clasificación de los productores del Altiplano Oeste Potosino, México: Una propuesta de tipología multidimensional. Agric Soc Desar 2019;16:373–397. doi:10.1017/CBO9781107415324.004.

145 159


Rev Mex Cienc Pecu 2022;13(1):145-162

2. Vázquez-Martínez I, Jaramillo-Villanueva JL, Bustamante-González A, Vargas-López S, Calderón-Sánchez F, Torres-Hernández G, et al. Estructura y tipología de las unidades de producción ovinas en el centro de México. Agric Soc Desar 2018;15:85–97. doi:10.22231/asyd.v15i1.750. 3. Estévez-Moreno LX, Sánchez-Vera E, Nava-Bernal G, Estrada-Flores JG, GómezDemetrio W, Sepúlveda WS. The role of sheep production in the livelihoods of Mexican smallholders: Evidence from a park-adjacent community. Small Ruminant Res 2019;178:94–101. doi:10.1016/j.smallrumres.2019.08.001. 4. Hernández Valenzuela D, Sánchez Vera E, Gómez Demetrio W, Martínez García CG. Caracterización productiva y socioeconómica del sistema de producción ovina, en un área natural protegida de México. Rev Mex Cienc Pecu 2019;10(4):951–965. 5. Herrera Haro JG, Álvarez Fuentes G, Bárcena Gama R, Núñez Aramburu JM. Caracterización de los rebaños ovinos en el sur de Ciudad de México, México. Acta Univ 2019;29:1–15. doi:10.15174/au.2019.2022. 6. Nuncio-Ochoa G, Nahed T, Díaz Hernández B, Escobedo Amezcua F, Salvatierra Izaba EB. Caracterización de los sistemas de producción ovina en el estado de Tabasco. Agrociencia 2001;35(4):469–477. 7. Vázquez Martínez I, Vargas López S, Zaragoza Ramírez JL, Bustamante González A, Calderón Sánchez F, Rojas Álvarez J, et al. Tipología de explotaciones ovinas en la Sierra Norte del estado de Puebla. Téc Pecu Méx 2009;47(4):357–369. 8. Calderón Cabrera J. Modelos de negocio en producción de ovinos para carne en el Estado de México [tesis maestría]. Chapingo. Estado de México, México. Universidad Autónoma Chapingo. 2020. 9. Vargas Del Ángel MÁ, Muñoz Rodríguez M, López Tirado Q. Modelos de negocio de dos líderes latinos en carne bovina. Rev Glob Negocios 2015;3(1):69–82. 10. Belussi F, Orsi L, Savarese M. Mapping business model research: A document bibliometric analysis. Scand J Manag 2019;35:101048. doi:10.1016/j.scaman.2019.101048. 11. Ricart JE. Modelo de negocio: el eslabón perdido en la dirección estratégica. Universia Bus Rev 2009:12–25. 12. Osterwalder A, Pigneur Y. Generación de modelos de negocio. 1a ed. Clark T, editor. Barcelona, España; 2010. doi:10.1016/S0737-6782(96)90159-9. 13. Fjeldstad ØD, Snow CC. Business models and organization design. Long Range Plann. 2018;51(1):32–39. doi:10.1016/j.lrp. 2017.07.008. 145 160


Rev Mex Cienc Pecu 2022;13(1):145-162

14. Cortés-Morales GV, Santoyo-Cortés VH, Altamirano-Cárdenas JR, Olivares-Gutiérrez R. Modelos de negocio de empresas de horticultura protegida en Texcoco, México. Agroproductividad 2018;11(9):105–110. 15. Coutiño-Puchuli V, Santoyo-Cortés VH, Flores-Verduzco JJ, Muñoz-Rodríguez M. Análisis comparativo de dos organizaciones de pequeños productores de café de Oaxaca, México. Rev Tur Econ Neg 2017;3:41–57. 16. Vargas-Del Ángel MÁ, Muñoz-Rodríguez M, Santoyo Cortés HV. Estrategias de diferenciación en cuatro modelos de negocio de carne bovina. Rev Glob Neg 2015;3(2):29–48. doi:10.1007/BF00991534. 17. Orona Castillo I, López Martínez JD, Vázquez Vázquez C, Salazar Sosa E, Ramírez Ramírez ME. Análisis microeconómico de una unidad representativa de producción de carne de ovino en el Estado de México bajo un sistema de producción semi intensivo. Rev Mex Agroneg 2014;34:720–728. 18. Hernández-Marín JA, Valencia-Posadas M, Ruíz-Nieto JE, Mireles-Arriaga AI, CortezRomero C, Gallegos-Sánchez J. Contribución de la ovinocultura al sector pecuario en México. Agroproductividad 2017;10(3):87–93. 19. Mondragón-Ancelmo J, Hernández-Martínez J, Rebollar-Rebollar S, Mohamed Salem AZ, Rojo-Rubio R, Domínguez-Vara IA, et al. Marketing of meat sheep with intensive finishing in southern State of Mexico. Trop Anim Health Prod 2014;46:1427–1433. doi:10.1007/s11250-014-0659-5. 20. Cuéllar Ordaz JA, Tórtora Pérez J, Trejo González A, Román Reyes P. La producción ovina mexicana: particularidades y complejidades. México: Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán; 2012. http://repositorio.unan.edu.ni/2986/1/5624.pdf. 21.

SIAP. Anuario estadístico de la producción https://nube.siap.gob.mx/cierre_pecuario/. 2021. Consultado Mar 5, 2021.

ganadera.

22. Martínez-González EG, Muñoz-Rodríguez M, García-Muñiz JG, Santoyo-Cortés VH, Altamirano Cárdenas JR, Romero-Márquez C. El fomento de la ovinocultura familiar en México mediante subsidios en activos: lecciones aprendidas. Agron Mesoam 2011;22(2):367–377. 23. Pérez C. Técnicas de análisis multivariante de datos: Aplicaciones con SPSS. (Capella I, ed.). Madrid, España: Pearson Prentice Hall; 2004.

161 145


Rev Mex Cienc Pecu 2022;13(1):145-162

24. Partida de la Peña JA, Ríos Rincón FG, De la Cruz Colín L, Domínguez Vara IA, Buendía Rodríguez G. Caracterización de las canales ovinas producidas en México. Rev Mex Cienc Pecu 2017;8(3):269–277. 25. Rodríguez-Galaviz JR, Vargas-López S, Zaragoza-Ramírez JL, Bustamante-González, A, Ramírez-Bribiesca E, Guerrero-Rodríguez JD, et al. Evaluación territorial de los sistemas de producción ovina en la región nor-poniente de Tlaxcala. Rev Mex Cienc Pecu 2011;2(1):53–68. 26. Espejel García A, Barrera Rodríguez AI, Cuevas Reyes V, Ybarra Moncada MC. Gestión de conocimiento y uso de innovaciones en sistemas agropecuarios: una aplicación en la cadena ovinos. Rev Mex Cienc Agríc 2017;8(7):1661–1666. 27. McCoard SA. Issues and opportunities to capitalize on increased litter size in hill country sheep farming systems: A New Zealand perspective. Anim Front 2017;7(3):32–37. doi:10.2527/af.2017-0126. 28. Michalk DL, Kemp DR, Badgery WB, Wu J, Zhang Y, Thomassin PJ. Sustainability and future food security: A global perspective for livestock production. L Degrad Dev 2019;30:561–573. doi:10.1002/ldr.3217. 29. Camacho RJC, Hernández HJE, Villarreal EBOA, Franco GFJ, Camacho Becerra CA. Análisis económico de la engorda de ovinos en una granja integral en el estado de Puebla, México. Rev Mex Agronegocios 2018;42:819-826. 30. Morris ST, Kenyon PR. Intensive sheep and beef production from pasture: A New Zealand perspective of concerns, opportunities and challenges. Meat Sci 2014;98:330– 335. doi:10.1016/j.meatsci.2014.06.011. 31. OCDE-FAO. Carne. En: OCDE-FAO Perspectivas Agrícolas 2019‑2028. Roma; 2019:175–189. doi:10.1787/7b2e8ba3-es. 32. Montossi F, Font-i-Furnols M, del Campo M, San Julián R, Brito G, Sañudo C. Sustainable sheep production and consumer preference trends: Compatibilities, contradictions, and unresolved dilemmas. Meat Sci 2013;95(4):772–789. doi:10.1016/j.meatsci.2013.04.048.

145 162


https://doi.org/10.22319/rmcp.v13i1.5444 Artículo

Efecto de la edad al primer parto sobre la longevidad, el número de días en producción y la producción de leche durante la vida productiva de las vacas lecheras Holstein y Pardo Suizo en Honduras

Karen Alessa Copas Medina a Manuel Valladares Rodas b Juan José Baeza Rodríguez c Juan Gabriel Magaña Monforte a José Candelario Segura Correa a*

a

Universidad Autónoma de Yucatán. Campus de Ciencias Biológicas y Agropecuarias. Km 15.5 carretera Mérida-Xmatkuil. 97315. Mérida, Yucatán, México. b

Asociación de Agricultores y Ganaderos de Oriente, Danlí, El Paraíso, Honduras.

c

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias. Campo Experimental Mocochá, Yucatán, México.

*Autor de correspondencia: jose.segura@correo.uady.mx

Resumen: El objetivo fue determinar el efecto de la edad al primer parto sobre la longevidad, el número de días productivos y la producción de leche durante toda la vida de las vacas Holstein y Pardo Suizo en la sabana tropical de Honduras. La información se recolectó de tres granjas lecheras con vacas Holstein (n= 1,391) y cuatro granjas con vacas Pardo Suizo (n= 480), nacidas entre 1993 y 2013, manejadas bajo sistemas intensivos. El modelo estadístico que describió las variables de interés incluyó el efecto de la granja, el grupo de edad al primer parto, el período de nacimiento, la estación de nacimiento y la interacción granja x período y

163


Rev Mex Cienc Pecu 2022;13(1):163-174

el error residual. Se encontraron efectos de la granja, período, el grupo de edad al primer parto y la interacción granja x período en las variables de respuesta. Un efecto favorable de las vacas que tuvieron su primer parto a una edad más temprana en el número de días de producción y la producción de leche durante toda la vida, y un aumento en la longevidad, tanto en vacas Holstein como en vacas Pardo Suizo (P<0.05). En conclusión, las vacas que parieron a una edad temprana tuvieron más días productivos en la granja y produjeron más leche durante su vida productiva. Por lo tanto, hacer que las novillas paran a una edad temprana podría ser una estrategia de manejo para aumentar la productividad en la granja. Sin embargo, se debe tener en cuenta el peso al primer parto y los aspectos fisiológicos del animal. Palabras clave: Efectos ambientales, Producción de leche, Longevidad, Vida productiva, Trópico.

Recibido: 05/07/2019 Aceptado: 23/04/2021

Introducción El sector lácteo en Honduras tiene una producción anual de aproximadamente 650 millones de litros de leche, lo que representa el 28 % de la producción total de Centroamérica. Sin embargo, la producción de leche bajo sistemas intensivos de producción enfrenta algunas dificultades en su desarrollo, ya que las razas lecheras, como las vacas Pardo Suizo y Holstein, tienen problemas para adaptarse a climas cálidos-húmedos(1). Bajo ambientes templados, el manejo, la nutrición, el año y la temporada de parto, así como la raza, se citan entre las principales fuentes de variación que afectan el desempeño del ganado lechero(2). Existe cierta información sobre la producción de leche por lactancia de vacas Holstein y Pardo Suizo en condiciones tropicales(3,4,5). No obstante, no se han publicado artículos sobre la producción de leche durante toda la vida de ganado lechero especializado en condiciones tropicales. Los factores ambientales y de manejo tienen una influencia directa en la reproducción, e indirecta en la calidad y cantidad de alimento para las vacas. Las diferencias en la fertilidad y la producción de leche entre los años y la temporada de parto se deben en gran medida a la disponibilidad de nutrientes de la pradera, pero también son una consecuencia del manejo(3,6). Hay informes en los trópicos que indican un bajo desempeño reproductivo y productivo del ganado Pardo Suizo, como lo indica la edad promedio al primer parto de más de 34 meses(7). El tiempo entre el nacimiento y el primer parto representa un tiempo durante el cual la hembra

164


Rev Mex Cienc Pecu 2022;13(1):163-174

es improductiva y, en consecuencia, no genera ningún ingreso a la granja. Por lo tanto, se ha sugerido, reducir la edad al primer parto para disminuir el costo de producción de los reemplazos. Además, se ha reportado, en condiciones no tropicales, que la edad al primer parto favorece la vida productiva y la producción de leche durante toda la vida por vaca(8,9). El rango de edad deseable para que una vaca tenga su primer parto es de 23 a 25 meses, para asegurar una mayor vida productiva, así como una mayor producción de leche(10). Además, una edad general al primer parto para todas las granjas no sería adecuada, ya que esta debe estar en función del manejo y la alimentación en las diferentes granjas. Por lo tanto, el objetivo de este estudio fue determinar el efecto del grupo de edad al primer parto sobre la longevidad, la vida productiva y la producción de leche durante toda la vida de las vacas lecheras Holstein y Pardo Suizo mantenidas en el trópico de Honduras.

Material y métodos Se estudiaron siete (7) granjas, tres con ganado Holstein y cuatro con ganado Pardo Suizo. Las granjas pertenecían a los departamentos de Francisco Morazán, ubicados en la zona centro oriente de Honduras, Comayagua en la región central, y Cortés y Santa Bárbara en la región noroeste. Todas las granjas estaban en condiciones de sabana tropical. Los promedios de temperatura, humedad y precipitación para las regiones central oriente, central y noroeste fueron de 24.9 °C, 70 % y 1,186 mm; 26.5 ºC, 68 % y 1,212 mm; y 26 ºC, 75 % y 1,300 mm, respectivamente.

Descripción de las granjas Las granjas lecheras estuvieron bajo sistemas de producción intensiva en confinamiento total durante la temporada seca y se dio de comer un alimento comercial más maíz y sorgo, mientras que en la temporada de lluvias se utilizó el pastoreo rotacional intensivo de animales. El manejo en las granjas fue similar en la estación seca, y varió solo en el tipo de pasto que se forrajeó y la estrategia de suplementación. El propósito de las granjas era la producción de leche y la venta de animales de las razas Holstein y Pardo Suizo. Las vacas de las granjas eran progenie de madres inseminadas con semen de toros de Estados Unidos y Canadá. La tierra en las granjas se sembró con maíz y sorgo para la producción de ensilaje y, en menor medida, para el establecimiento de Cynodon nlemfluensis, Brachiaria híbrido, Hyparrhenia rufa, Digitaria eriantha, pasto Panicum maximum, como forrajes de pastoreo.

165


Rev Mex Cienc Pecu 2022;13(1):163-174

Manejo En general, en las siete granjas aquí estudiadas, las hembras se criaron en sus propias granjas hasta el peso de servicio y se mantuvieron como reemplazo de vacas viejas. Las hembras sin signos clínicos de enfermedad que mostraron estro se mantuvieron en el hato, utilizando el peso corporal al servicio como único criterio de selección. Esas hembras se mantuvieron en un esquema de reproducción continua; donde se les dio servicio mediante inseminación artificial. Los animales que no lograron quedar preñados después de cuatro servicios recibieron monta natural. Las vacas se dividieron en dos grupos de manejo. El grupo de vacas secas se mantuvo bajo un esquema de pastoreo rotacional y se le dio 3 kg/día de un alimento comercial que contenía un 18 % de proteína cruda. El grupo de vacas en producción se mantuvo bajo un esquema de alimentación dependiendo de la producción de leche. Este consistió en proporcionar a la vaca 0.5 kg/L de leche producida, y se ofreció a través de una ración integral compuesta por forraje, silo de maíz y harina de soya, tres veces al día. En invierno, a las vacas se les dio una ración integral con ensilaje de maíz o sorgo y se les dejó pastar. La salud de los hatos se mantuvo a base de vacunas contra pierna negra, ántrax y pasteurelosis cada 6 meses y contra la rinotraqueitis infecciosa bovina y la diarrea viral bovina una vez al año. Todos los animales fueron desparasitados cada 6 meses con ivermectinas y eprinomectina para el control de parásitos internos y recibieron baños periódicos, de septiembre a diciembre, para el control de parásitos externos. La producción de leche se midió diariamente. Se capturaron datos de 1993 a 2013 en el software VAMP® y el software Ganadero SG® y posteriormente se trasladaron a una hoja de cálculo (Excel, 2013). La información utilizada fue la identificación de granjas, animales, toros y madres, el año de nacimiento de la vaca, la producción de leche durante toda la vida y las fechas de nacimiento, primer parto y sacrificio o muerte de las vacas. Los datos del año de nacimiento de la vaca se agruparon en cuatro períodos, de 1993 a 2003 (se inició la recopilación de registros productivos y reproductivos), 2004 y 2005 (se comenzó a utilizar la inseminación artificial y se mejoró la alimentación), período 2006 a 2008 y período 2009 a 2013 (período en que se mejoró aún más la alimentación y se establecieron prácticas sanitarias formales). Se establecieron dos estaciones de nacimiento de la vaca de acuerdo con la temperatura y la precipitación de la región (estación seca de diciembre a mayo y estación lluviosa de junio a noviembre). Además, las vacas se clasificaron en cuatro grupos de edad al primer parto: <2.5, 2.5 a <3, 3 a <3.5 y > 3.5 años.

166


Rev Mex Cienc Pecu 2022;13(1):163-174

Los datos de las vacas Holstein (n= 1,391) y Pardo Suizo (n= 480) se utilizaron para calcular la longevidad, como el número de días desde el nacimiento hasta la muerte o sacrificio de la vaca. El número de días en producción durante toda la vida para Holstein y Pardo Suizo (n= 1,009; n= 437, respectivamente) fue el tiempo que la vaca permaneció en el hato, desde el primer parto hasta la muerte o sacrificio; y la producción de leche durante toda la vida (n= 950, n= 478) fue el total de kg de leche producida por la vaca durante su vida útil.

Análisis estadístico Los datos se analizaron por raza (Holstein y Pardo Suizo). Inicialmente se utilizó un modelo estadístico que incluyó los efectos fijos de la granja, el período de nacimiento, la estación de nacimiento, el grupo de edad al primer parto y las interacciones simples. Sin embargo, los resultados preliminares indicaron que, a excepción de la interacción granja x período, en la raza Holstein, las interacciones no fueron significativas. El modelo estadístico final fue: Yijklm = μ + Hi + Perj + ENk + GEPPl + H x Perij + ɛijklm Donde: Yijklm = Longevidad, número de días en producción durante toda la vida o producción de leche durante toda la vida; μ = Media general; Hi = Efecto de la i-ésima granja; Perj = Efecto del j-ésimo período de nacimiento; ENk = Efecto de la k-ésima estación de nacimiento; GEPPl = Efecto del l-ésimo grupo de edad al primer parto; H x Perij = Interacción granja x período; ɛijklm = efecto residual, NID (0, 𝜎 2 ). Todos los análisis estadísticos fueron realizados utilizando el procedimiento GLM del programa SAS(11).

Resultados y discusión Holstein Las medias aritméticas para la longevidad, el número de días en producción y la producción de leche durante toda la vida para las vacas Holstein fueron 2,715 días (89.3 meses), 1,223 días (40.2 meses) y 13,400 kg de leche, respectivamente. La longevidad media en este estudio es mayor que el promedio de 70 meses reportado para vacas Holstein en condiciones subtropicales templadas en Etiopía(12), y mucho mayor que la media de 57.2 meses reportada

167


Rev Mex Cienc Pecu 2022;13(1):163-174

bajo clima árido frío en vacas Holstein iraníes(13). Las diferencias entre los estudios se deben en parte a factores de manejo, que se espera que varíen entre las granjas. Por ejemplo, la edad media al primer parto de las vacas en Irán fue de 26.8 meses(13) y para este estudio de 35.3 meses. La longevidad aumentó linealmente con la edad al primer parto de la vaca, similar a los resultados de un estudio en Holstein coreano(14), donde se observó que el primer parto a la edad de madurez adecuada proporciona una buena condición corporal para toda la vida, como lo observaron también otros autores en otros países y bajo condiciones climáticas y de manejo diferentes(8,15). Con respecto al número de días en producción durante toda la vida o vida productiva en la granja, la media aquí encontrada (40.2 meses) es mayor que el valor medio de 20.3 meses reportado para Holstein en condiciones templadas en México(16) y de 36.7 meses bajo clima subtropical templado en Etiopía(12). Una larga vida productiva es un componente importante de la rentabilidad del ganado lechero, ya que disminuye el costo de reemplazo. La media de la producción de leche durante toda la vida fue de 13,400 kg por vaca, que difieren de los reportados en los Estados Unidos de América con medias de 32,861 kg y 28,086 kg(17,18). Sin embargo, la media, aquí obtenida, es más alta que las reportadas en Israel (10,786 kg)(19) y Egipto (10,694 kg)(20). La mejora del manejo reproductivo a través de una mejor detección del estro, tiempo de inseminación adecuado, alimentación adecuada, buenas prácticas sanitarias y la disminución de la tasa de sacrificio involuntario de las vacas a una edad temprana son importantes para la eficiencia reproductiva óptima y la producción de leche durante toda la vida(12). El grupo de edad al primer parto, y los otros factores incluidos en el modelo (granja, período del año e interacción granja x período, excepto la estación de nacimiento de la vaca) tuvieron un efecto significativo (P<0.05) en los rasgos aquí evaluados. Las medias de mínimos cuadrados por grupo de edad al primer parto se muestran en el Cuadro 1. La longevidad de las vacas aumentó con el aumento de la edad al primer parto (2,819 a 3,651 días), en parte porque, por definición, el rasgo edad al primer parto está contenida en ella.

168


Rev Mex Cienc Pecu 2022;13(1):163-174

Cuadro 1: Medias de mínimos cuadrados y errores estándar por grupo de edad al primer parto para longevidad (L), número de días productivos durante toda la vida (NDPV) y producción de leche durante toda la vida (PLV) de vacas Holstein en Honduras Grupo de edad (años) <2.5 2.5 a <3 3 a 3.5 >3.5 a, b, c

L (días) N Media 767 2819c 437 3177b 107 3289b 80 3651a

EE 38.83 44.73 76.00 96.72

NDPV (días) N Media 482 1380ª 368 1399a 88 1239ab 71 1080b

EE 42.22 48.41 81.78 99.86

PLV (kg) N Media 384 14290ª 393 14396a 100 13141ab 73 10840b

EE 476 555 938 1214

Literales distintas por columna significan diferencia significativa (P<0.05).

Las vacas que parieron a >3.5 años de edad tuvieron menos días en producción y produjeron menos leche que las que parieron a una edad más temprana. El efecto de la edad al primer parto en vacas Holstein en la longevidad o el número de días en producción ha sido reportado en condiciones templadas(13,21). En Bélgica(22), se encontró que las vacas que parieron por primera vez entre los 22 y los 26 meses de edad tuvieron más días productivos durante su vida, que las menores de 22 y mayores de 26 meses de edad. En realidad, no hay investigaciones realizadas para los rasgos de por vida de las vacas Holstein en sistemas intensivos de producción en condiciones tropicales de Honduras. Potocnik et al(21) mencionan que el riesgo relativo de sacrificar una vaca, aumenta con el aumento de la edad al primer parto, lo que indica que las vacas que paren a una edad más avanzada también tuvieron algunos otros problemas, probablemente asociados con el éxito reproductivo. Resultados similares se reportaron en México(16). El efecto más obvio de reducir la edad al parto y aumentar el número de días productivos durante toda la vida, es que las vacas paren temprano, comienzan a producir antes(23). Parece que la forma más efectiva de evaluar el beneficio de reducir la edad al primer parto es tener en cuenta la producción de leche durante toda la vida de las vacas. Algunos autores(24) observaron que la producción de leche en segundas y mayores lactancias no se vio afectada por la edad temprana al primer parto, e indicaron que la producción de leche y el número de días productivos durante toda la vida podrían tener un gran impacto en la rentabilidad de la granja. Meyer et al(23) encontraron que las vacas que parieron por primera vez a 23.3 meses produjeron el doble de leche que las vacas que parieron por primera vez a los 30.3 meses de edad. Sin embargo, en Bélgica, se reportó(22) que las vacas que parieron por primera vez entre los 22 y los 26 meses de edad tuvieron más producción de leche durante toda la vida, que las vacas que parieron a menos de 22 y las que parieron después de los 26 meses de edad. Por lo tanto, esos autores concluyen que la edad al primer parto es un factor importante para garantizar una buena producción de leche durante toda la vida y vacas eficientes capaces de producir más leche en menos tiempo.

169


Rev Mex Cienc Pecu 2022;13(1):163-174

Pardo Suizo Las medias no ajustadas para la longevidad, el número de días productivos durante toda la vida y la producción de leche durante toda la vida fueron 2,586 d (85.1 meses), 1,664 d (54.7 meses) y 14,226 kg de leche, respectivamente. En cuanto a la longevidad, el resultado obtenido para la raza Pardo Suizo en este estudio es mayor al reportado en los Estados Unidos, donde se observó una longevidad de 60 meses(25). Muchos y variables factores podrían ser las razones de las diferencias de los resultados del presente estudio y de EE. UU.; entre ellos: fracaso para concebir, intervalos entre partos más largos, problemas de conformación, otros criterios de sacrificio, etc. Un reporte sobre vacas Pardo Suizo americanas en Chiapas, México, estimó una longevidad de 141 meses; siendo este valor mayor al encontrado en este estudio(26). En Suiza, se reportó una longevidad promedio de 16 años para vacas Pardo Suizo(27); y en el mismo país, Vukasinovic et al(28) reportaron una media de 29.5 meses para los datos no censurados. Las diferencias entre los estudios pueden deberse a que la longevidad y la vida productiva son variables complejas, que dependen de los efectos fijos analizados; principalmente debido a la edad al primer parto y el manejo(29). La producción de leche durante toda la vida obtenida en este estudio difiere de la encontrada en Egipto, en vacas Pardo Suizo y otras razas lecheras en clima subtropical, donde se obtuvo una media de 10,118 kg de producción de leche(20). En Suiza, y también en Pardo Suizo, se estimó un número medio de días productivos de 4,888 y 14,893 kg de producción de leche (27) . Las diferencias entre los países podrían atribuirse al clima y a las diferentes condiciones de manejo. La granja, el período de nacimiento de la vaca, el grupo de edad al primer parto y la interacción granja x período tuvieron un efecto sobre la longevidad, el número de días productivos y la producción de leche durante toda la vida (P<0.05). Sin embargo, las estaciones no parecen ser una fuente importante de variación (P>0.05). Las medias de mínimos cuadrados por grupo de edad se muestran en el Cuadro 2. La longevidad media de las vacas Pardo Suizo que parieron por primera vez a una edad más temprana fue más corta que la de las vacas que parieron por primera vez a una edad mayor. Sin embargo, de manera similar a lo que se encontró para Holstein, las vacas Pardo Suizo que parieron a una edad más temprana tuvieron más días en producción y más producción de leche durante toda la vida en comparación con las vacas que parieron a una edad posterior (P<0.05).

170


Rev Mex Cienc Pecu 2022;13(1):163-174

Cuadro 2: Medias de mínimos cuadrados y error estándar por factor para longevidad (L), número de días productivos durante toda la vida (NDPV) y producción de leche durante toda la vida (PLV) de ganado Pardo Suizo en Honduras Grupo de edad (años) <2.5 2.5 a <3 3 a 3.5 >3.5 abc

L (días) N Media 134 2410b 182 2516ab 87 2785a 77 2718ab

EE 71.16 68.58 94.65 104.0

NDPV (días) N Media 123 1639ª 164 1564ab 78 1646a 72 1230b

EE 70.96 67.94 92.75 102.5

PLV (kg) N Media 134 15979a 182 13388b 86 12874bc 76 10411c

EE 763 735 1014 1114

Literales distintas por columna significan diferencia significativa (P<0.05).

El efecto de la edad al primer parto de vacas Pardo Suizo sobre la longevidad y el número de días productivos durante toda la vida ha sido reportado en condiciones ambientales templadas(13). Sin embargo, esta es la primera investigación sobre la vida útil y la productividad de las vacas Pardo Suizo en condiciones tropicales. El efecto más obvio de la reducción de la edad al primer parto en Holstein es el efecto sobre el número de días productivos durante toda la vida, porque las vacas que paren a una edad temprana entran a la producción antes(23) y comienzan a pagar su costo de crecimiento. Como se muestra en el Cuadro 2, a medida que el grupo de edad al primer parto aumentaba, la producción de leche durante toda la vida disminuía. Por lo tanto, hacer que las novillas paran a una edad temprana podría ser una estrategia de manejo para aumentar la productividad en la granja. Sin embargo, se deben tener en cuenta el peso al primer parto y los aspectos reproductivos, como la detección del estro y el fracaso para concebir del animal.

Conclusiones e implicaciones Los resultados de este estudio apoyan la idea de mejores prácticas de manejo para reducir la edad al primer parto, ya que, bajo las condiciones de este estudio, las vacas Holstein y Pardo Suizo, que parieron a una edad temprana (< 36 meses), se mantuvieron productivas durante más tiempo en la granja y tuvieron más producción de leche durante toda su vida. Agradecimientos El autor agradece a los productores de leche de Honduras por proporcionar los registros productivos para este estudio. Los primeros autores agradecen al CONACYT de México por la beca de doctorado.

171


Rev Mex Cienc Pecu 2022;13(1):163-174

Conflicto de interés Los autores declaran que no tienen ningún conflicto de interés. Literatura citada: 1.

Faye B, Konuspayeva G. The sustainability challenge to the dairy sector– The growing importance of non-cattle milk production worldwide. Int Dairy J 2012;24(2):50-56.

2. M’hamdi N, Bouallegue M, Frouja S, Ressaissi Y, Kaur Brar S, Hamouda B. Effects of environmental factors on milk yield, lactation length and dry period in Tunisian Holstein cows. InTechOpen 2012;8:153-164. 3. Estrada-León R, Magaña JG, Segura JC. Genetic parameters for some reproductive traits of Brown Swiss cows in the tropics of Mexico. J Anim Vet Adv 2006;7(2):124-129. 4.

Echeverri M, Galeano-Vasco L, Cerón-Muñoz M, Márquez-Girón SM. Efecto de las variables climatológicas sobre la producción de leche de vacas Holstein. Livest Res Rural Develop 2015;27(7):Article #246.

5. Sierra-Montoya E, Cerón-Muñoz MF, Ruiz-Cortés ZT. Parámetros reproductivos y su relación con producción y calidad de leche en hatos del trópico alto. Livest Res Rural Develop 2017;29(7):Article #170. 6. WingChing-Jones R, Pérez R, Salazar E. Condiciones ambientales y producción de leche un hato de ganado Jersey en el trópico húmedo: el caso del módulo lechero. Agronomía Costarricense 2008;32(1):87-94. 7. Magaña JG, Segura JC. Estimates of breed and heterosis effects for some reproductive traits of Brown Swiss and Zebu-related breeds in South-eastern Mexico. Liv Res Rural Develop 2001;13(5):Article #49 8. Pirlo G, Miglior F, Speroni M. Effect of age at first calving on production traits and on difference between milk yield returns and reading costs in Italian Holsteins. J Dairy Sci 2000;83:603–608. 9. Eastham NT, Caots A, Cripps P, Richardson H, Smith R, Oikonomou G. Association between age at first calving and subsequent lactation performance in UK Holstein and Holstein-Friesian dairy cows. PloS ONE 2018;13(6):eo197764. 10. Richardson H. What age is the right age? The Journal for Holstein UK and British Friesian Breeders, August 2011;42–44. 11. SAS. SAS / STAT User’s Guide (Version 9.3, 4th Ed.) SAS Inst. Inc., Cary, NC. 2010.

172


Rev Mex Cienc Pecu 2022;13(1):163-174

12. Berihulay H, Mekasha Y. Breeding efficiency and lifetime production performance of Holstein-Friesian dairy cows at Alage dairy farm, South Western Ethiopia. Livest Res Rural Develop 2016;28(9):Article #157. 13. Nilforooshan MA, Edriss MA. Effect of age at first calving on some productive and longevity traits in Iranian Holsteins of the Isfahan Province. J Dairy Sci 2004;87:21302135. 14. Do C, Wasana N, Cho K, Choi Y, Choi T, Park D, Lee D. The Effect of age at first calving and calving interval on productive life and lifetime profit in Korean Holsteins. Asian-Australas J Anim Sci 2013;26(11):1511-1517. 15. Haworth G., Tranter WP, Chuck J, Cheng Z, Wathes DC. Relationship between age at first calving and first milk yield, and lifetime productivity and longevity in dairy cows. Vet Rec 2008;162(20):643-647. 16. Abadía-Rojas JR, Ruíz-López FJ, Vega-Murillo VE, Montaldo HH. Análisis genético para vida productiva en ganado Holstein de México. Rev Mex Cienc Pecu 2016;7(1):114. 17. Tsuruta S. Misztal I, Lawlor TJ. Changing the definition of productive life in US Holsteins: effect on genetic correlations. J Dairy Sci 2005;88:1156-1165. 18.

Heins B, Hansen L, Vriest A. Survival, lifetime production, and profitability of Normande × Holstein, Montbéliarde × Holstein, and Scandinavian Red × Holstein crossbreds versus pure Holsteins. J Dairy Sci 2012;95:1011-1021.

19. Weller J, Ezra E. Environmental and genetic factors affecting cow survival of Israeli Holsteins. J Dairy Sci 2015;98:676–684. 20.

El-Tarabany M, Roushdy E, El-Tarabany A. Production and health performance of Holstein, Brown Swiss and their crosses under subtropical environmental conditions. Anim Prod Sci 2016;57(6):1137-1143

21. Potočnik K, Gantner V, Krsnik J, Štepec M, Logar B, Gorjanc G. Analysis of longevity in Slovenian Holstein cattle. Acta Agric Slov 2011;98(1):93-100. 22. Froidmont E, Mayeres P, Picron P, Turlot A, Planchon V, Stilmant D. Association between age at first calving, year and season of first calving and milk production in Holstein cows. Animal 2013;7(4):665-672. 23. Meyer MJ. Everett RW, Van Amburgh ME. Reduced age at first calving: Effects on lifetime milk production, longevity and profitability. Kansas Agricultural Experiment Station Research Reports 2004; Vol. 10: Issue 2. htpps://doi.org/10.4148/23785977.3172. 173


Rev Mex Cienc Pecu 2022;13(1):163-174

24. Lin CY, McAllister AJ, Batra TR, Lee AJ, Roy GL, Vesely JA, Wauthy JM, Winter KA. Effects of early and late breeding of heifers on multiple lactation performance of dairy cows. J Dairy Sci 1988;71:2735-2743. 25. Garcia-Peniche TB, Cassell BG, Misztal I. Effects of breed and region on Longevity traits through five years of age in Brown Swiss, Holstein, and Jersey cows in the United States. J Dairy Sci 2006;89:3672–3680. 26. Domínguez-Olvera DA, Herrera JG, Caamal I, Dorantes J. Indicadores económicos en función de la longevidad verdadera de vacas Suizo Americano en hatos de las regiones centro y frailesca en Chiapas. Ciencia e Innovación 2018;1(1):167-176. 27.

Bielfeldt JC, Tölle K, Badertscher R, Krieter J. Longevity of Swiss Brown cattle in different housing systems in Switzerland. Livest Sci 2006;101:134–141.

28. Vukasinovic N, Moll J, Kunzi N. Analysis of productive life in Swiss Brown cattle. J Dairy Sci 1997;80:2572-2579. 29. Caraviello DA, Weigel KA, Gianola D. Prediction of longevity breeding values for US Holstein sires using survival analysis methodology. J Dairy Sci 2004;87:3518–3525.

174


https://doi.org/10.22319/rmcp.v13i1.5917 Artículo

Efecto de la viscosidad en el medio para la criopreservación espermática de gallo (Gallus gallus)

José Antonio Herrera Barragán a José Manuel Huitrón b Juan José Pérez-Rivero *a Adrián Guzmán Sánchez a Alejandro Ávalos Rodríguez a Ana María Rosales Torres a Ricardo Camarillo Flores c

a

Universidad Autónoma Metropolitana-Xochimilco. Departamento de Producción Agrícola y Animal. Calz. del Hueso 1100. Villa Quietud, Coyoacán. 04960. CDMX, México. b

Universidad Autónoma Metropolitana-Xochimilco. Agropecuarias. CDMX, México.

Maestría

en

Ciencias

c

Universidad Autónoma Metropolitana-Iztapalapa. Maestría en Biología de la Reproducción Animal. CDMX, México.

*Autor de correspondencia: jjperez1_1999@yahoo.com

Resumen: En semen de mamíferos, se ha demostrado que la viscosidad influye de manera negativa para su conservación. En semen de aves los estudios sobre las características físicas de los eyaculados son limitados, particularmente la viscosidad no ha sido estudiada. Los medios para la criopreservación, no consideran la viscosidad para mantener la viabilidad espermática. Por lo cual, el objetivo de este estudio fue evaluar el efecto de la viscosidad en el medio para mantener su viabilidad post descongelación. Se determinó los parámetros de evaluación básica, de maduración y reacción acrosomal evaluando la

175


Rev Mex Cienc Pecu 2022;13(1):175-186

presencia y distribución de Ca2+ mediante la co-incubación con clortetraciclina. Se realizaron 25 evaluaciones de pool seminal, criopreservados en medio Lake suplementado con 6 % de dimetilacetamida y con 0 % (Testigo), 10 %, 30 % y 45 % de ficoll, para ajustar la viscosidad del medio a condiciones similares a las del semen y del líquido oviductal y a un grado mayor de viscosidad. La movilidad espermática fue menor (P0.05) en alícuotas con mayor porcentaje de ficoll. El porcentaje de espermatozoides vivos fue similar (P>0.05) en el testigo y todas las alícuotas con diferente porcentaje de ficoll. La maduración espermática presentó un mayor (P0,05) porcentaje de espermatozoides no capacitados cuando se utilizó 10% de ficoll. De manera inversa el porcentaje de espermatozoides con reacción acrosomal fue menor (P0,05) también cuando se utilizó 10 % de ficoll. Los resultados de este estudio demuestran que variaciones en el grado de viscosidad del medio, pueden mantener o incrementar la viabilidad espermática post descongelación. Palabras clave: Acrosoma, Capacitación espermática, Congelación, Gallus g, Semen.

Recibido: 30/12/2020 Aceptado: 22/04/2021

Introducción En la actualidad la avicultura de especies domésticas no se puede concebir sin la aplicación de conocimientos y tecnologías innovadoras de reproducción asistida; esto incluye la criopreservación del semen y la inseminación artificial (IA)(1). Una de las mayores dificultades para lograrlo es mantener la viscosidad del líquido seminal, la cual puede verse disminuida al mezclar el semen con un diluyente para su conservación, lo que puede contribuír a la pérdida de espermatozoides en el oviducto durante la IA(2). La viscosidad del líquido seminal es atribuida a la presencia de mucopolisacáridos, glucosaminoglicanos y proteínas, ésta ha sido estudiada en diferentes especies animales como los camélidos, elefantes y ungulados salvajes, donde los cambios en la viscosidad del semen representan un problema para su conservación y para la IA(3-6). Desde el punto de vista anatómico y fisiológico, dentro del oviducto de las aves existen tubos de almacenamiento espermático, los cuales provén un microambiente específico para mantener la viabilidad de los espermatozoides y su capacidad fertilizante de manera prolongada (7,8). En las aves, cuando los espermatozoides se encuentran dentro de los tubos de almacenamiento son inmóviles, por lo que su metabolismo es basal, dando como resultado un consumo bajo de ATP(9). Sin embargo, estos poseen mitocondrias activas,

176


Rev Mex Cienc Pecu 2022;13(1):175-186

las cuales proporcionan energía para la activación de su movilidad y capacitación espermática(10). Cuando los espermatozoides eyaculados realizan la reacción acrosomal, son capaces de penetrar la membrana perivitelina que rodea al ovocito y realizar la fertilización(11). Se ha mencionado que los espermatozoides de aves “no necesitan” un proceso de capacitación espermática para poder llevar a cabo la fertilización(11). Durante la criopreservación, los procedimientos de enfriamiento, adición de agentes crioprotectores, congelado y descongelado contribuyen a un proceso de criocapacitación(12,13), el cual se evidencia por la continuidad en la maduración espermática, y reduce su capacidad de fertilización al momento de ser utilizados para la inseminación artificial. Considerando que en otras especies es importante mantener la viscosidad del líquido seminal, para mantener la viabilidad espermática post descongelación durante los procesos de IA y que esta no ha sido estudiada en gallos, el objetivo del presente trabajo fue evaluar el efecto de la viscosidad en el medio de criopreservación, para mantener la viabilidad espermática determinada por sus parámetros de maduración espermática post descongelación.

Material y métodos Uso de animales Se realizó de acuerdo con la Norma Oficial Mexicana 062-ZOO-1999. “NORMA Oficial Mexicana NOM-062-ZOO-1999, Especificaciones técnicas para la producción, cuidado y uso de los animales de laboratorio”(14). Se utilizaron cinco gallos Lohmann Brown lite (Gallus gallus) a los que se proporcionó alimento balanceado con 18% de proteína y agua ad libitum, y alojamiento individual en jaulas metálicas de 70 x70 x 90 cm, provistas de bebedero y comedero.

Obtención de semen Se obtuvieron 25 muestras de semen de cada gallo, por masaje dorso-ventral(15). El semen se recolectó de la cloaca por aspiración con una micropipeta SL10-1000, (RANIN™, USA). Las muestras se mezclaron para obtener 25 grupos, los cuales fueron diluidos en medio Lake compuesto por fructosa 0.6%, glutamato de sodio 1.92%, acetato de magnesio 0.08%, acetato de sodio 0.51%, citrato de potasio 0.128%, pH de 7.2 y osmolaridad de 330 mOms (L)(16) y fueron adicionados de dimetilacetamida (DMA) al 6 % como crioprotector.

177


Rev Mex Cienc Pecu 2022;13(1):175-186

En cada grupo seminal, se determinó su concentración espermática por microscopía y con el uso de una cámara de Neubauer(1), para realizar seis alícuotas de 100 µl, con 100 x 106 espermatozoides, a las cuales se les añadió ficoll (F) para lograr diferentes niveles de viscosidad del semen. Se consideró como grupo testigo a una alícuota del semen eyaculado (S). El grupo (S+L+ ficoll 10% +DMA) fue diluido de manera convencional y se le adicionó F al 10% para lograr menor viscosidad comparado con el grupo testigo. Al grupo (S+L+ ficoll 30% +DMA) se le agregó F al 30% para lograr viscosidad similar comparado con el grupo testigo y al grupo (S+L+ ficoll 45% +DMA) se le adiciono F al 45% para lograr mayor viscosidad comparado con el grupo testigo.

Obtención de líquido oviductal Se introdujo una sonda de polipropileno (5 FR) 1 cm en la cloaca de cinco gallinas Lohmann Brown lite, se administraron 0.5 ml de SSF estéril, los cuales se aspiraron con una jeringa de 3 ml, las muestras se mezclaron para realizar un grupo.

Determinación de la viscosidad Se depositaron 50 µl de semen de cada grupo o líquido oviductal, en un refractómetro, para observar el grado de densidad (°Brix), para realizar su conversión a g/ml, se utilizó la tabla de conversión de °Brix a gravedad específica del National Institute of Standards and Technology (NIST). Con un viscosímetro Cannon- Manning Semi-Micro (Tamaño 50, Instrumento Cannon, PA), se determinó la viscosidad cinemática de cada muestra en mm²/s (cSt) multiplicando el tiempo de flujo en segundos por la constante del viscosímetro (Co= 0.003812). Para obtener la viscosidad en mPa*s (cP), el resultado se multiplicó por la viscosidad cinemática en mm²/s (cSt) y por la densidad en g/ml.

Criopreservación seminal Posteriormente se congelaron alícuotas diluidas y adicionadas con los diferentes porcentajes de ficoll, en pajillas de 0.25 ml con 100 x 106 espermatozoides. Se inició con alícuotas a 25 °C que fueron enfriadas a una curva de 1.6 °C por min, enseguida se mantuvieron en vapor de nitrógeno (-70 °C) por 10 min; finalmente se sumergieron en nitrógeno líquido (-196 °C) para criopreservarse por 30 días. La descongelación de cada pajilla fue a 37.5 °C por 30 seg(17).

178


Rev Mex Cienc Pecu 2022;13(1):175-186

Evaluación espermática básica En semen fresco y post descongeladas, se determinó la movilidad progresiva mediante microscopía óptica (400X) para estimar el porcentaje de espermatozoides con un movimiento progresivo vigoroso en una alícuota de 15 µl a 37.5 °C. La viabilidad y morfología espermática se determinaron en una preparación sobre un porta objetos, con 10 µl de la alícuota con espermatozoides y 3 µl de tinción vital azul de eosina (1% de eosina y 5% de nigrosina), se evaluaron doscientas células en cada preparación, con un microscopio de contraste de fase (400X). La morfología se evaluó con un aumento de 100X(1,18).

Maduración y reacción acrosomal espermática Alícuotas de 50 µl de semen perteneciente a todos los grupos con una concentración de 5 x 106 espermatozoides, se incubaron con clortetraciclina (CTC) 0.9 M en obscuridad a 38 ° C(19,20). Mediante microscopia de fluorescencia (495 nm excitación y 520 nm emisión) se evaluaron los espermatozoides para determinar su nivel de maduración, determinando la proporción de espermatozoides no capacitados, capacitados y con reacción acrosomal(17).

Análisis estadístico Se verificó la normalidad de los datos mediante una prueba de Jack-Vera; de manera posterior se realizó un análisis de Kruskal-Wallis para los diferentes tratamientos y variables. Se realizó una prueba de Tukey para identificar la diferencia de medias, todas las pruebas estadísticas se realizaron con un nivel de significancia de P<0.05. Se utilizó el programa estadístico PAST(21).

Resultados Densidad y viscosidad Los parámetros de densidad y viscosidad que se determinaron en los medios de criopreservación mostraron valores diferentes, los cuales se presentan en el Cuadro 1.

179


Rev Mex Cienc Pecu 2022;13(1):175-186

Cuadro 1: Densidad y viscosidad seminal y en los medios de criopreservación (n=25) Densidad Gravedad Viscosidad Viscosidad °Brix específica (mm2/s) *mPa*s Semen (S) 7.0 1.028 3.1440 3.2320 S+L+ ficoll (10%) +DMA 17.0 1.070 2.0279 2.1698 S+L+ ficoll (30%) +DMA 28.0 1.120 3.1601 3.5393 S+L+ ficoll (45%) +DMA 30.2 1.130 5.4092 6.1123 S= Semen; L= Lake; DMA= dimetilacetamida.

Evaluación espermática básica post descongelación Los espermatozoides descongelados con diferentes porcentajes de ficoll, mostraron cambios en la movilidad; entre menos viscosidad en el medio, se presenta mayor movilidad acercándose a la del semen eyaculado (P0,05). Los porcentajes de espermatozoides vivos, no mostraron cambios significativos entre el semen eyaculado y los espermatozoides descongelados (P>0.05). Por otro lado, conforme aumenta la viscosidad del medio, la morfología normal de los espermatozoides descongelados mejora (P0,05) (Cuadro 2). Cuadro 2: Porcentajes de evaluación básica en espermatozoides criopreservados con diferentes condiciones de viscosidad (n=10) Porcentaje de espermatozoides (X±EE) Viscosidad Movilidad Viabilidad Morfología *mPa*s 3.2320 46.1 + 0.7a 74.2 + 2.9 a 86.1 + 1.0 a 2.1698 32.8 + 0.7b 72.4 + 2.9 a 86.7 + 1.0 a 3.5393 10.9 + 0.7 c 70.5 + 2.9 a 93 + 1.0 b 6.1123 5.1 + 0.7 d 70 + 2.9 a 91.2 + 1.0 b abcd

Valores con diferente literal en columnas difieren (P<0.05).

Maduración espermática y reacción acrosomal El porcentaje de espermatozoides no capacitados, fue mayor en el grupo adicionado con ficoll al 10% comparado con el resto de los tratamientos (P0,05) como se muestra en la Figura 1. Los porcentajes de espermatozoides con capacitación espermática no presentaron diferencias estadísticas entre los tratamientos y el semen eyaculado (P>0.05). El porcentaje de espermatozoides con reacción acrosomal, encontrados fue mayor en los tratamientos adicionados con 30% y 45% de ficoll comparándolos con el tratamiento con 10% de ficoll (P0.05) y similar con el semen eyaculado (P>0.05).

180


Rev Mex Cienc Pecu 2022;13(1):175-186

Figura 1: Parámetros de maduración espermática post descongelación en medios con diferente viscosidad

181


Rev Mex Cienc Pecu 2022;13(1):175-186

Discusión El contenido y características del plasma seminal es diferente en cada especie; una de estas diferencias físicas es la viscosidad, la cual se produce a partir de proteínas que ayudan a mantener la viabilidad espermática durante varios días, hasta que el espermatozoide llegue al sitio de fertilización(22). En el semen de camélidos, la viscosidad elevada, es atribuida a la Mucina 5B(23,24). Por otro lado en gallos y pavos, no hay estudios relacionados con la viscosidad del semen, pero se ha demostrado que en el plasma seminal de las aves se encuentran hasta 822 proteínas en el caso del gallo y 607 en el pavo(9,22). En este trabajo se determinó que la viscosidad del semen de gallo fue de 3.23 mPa*s. Los mecanismos que prolongan la vida del espermatozoide en los túbulos de almacenamiento espermáticos son desconocidos, pero se piensa que incluyen supresión reversible de la respiración y la movilidad espermática, así como estabilización de la membrana y mantenimiento del acrosoma(25). Si bien no existe diferencia estadística demostrable en este trabajo, el porcentaje de espermatozoides vivos fue mayor en semen criopreservado con menor viscosidad. El incremento de viscosidad disminuyó la movilidad de los espermatozoides; sin embargo, conservaron su viabilidad. En otro estudio(26), utilizaron diferentes concentraciones de goma arábiga para aumentar la viscosidad del medio para criopreservar semen de caballo, y reportaron mejor viabilidad espermática post descongelación. La capacitación espermática es necesaria para iniciar la reacción acrosomal, la cual ocurre in vivo en el tracto genital de la hembra, donde participan diferentes señales que originan una desestabilización de la membrana, hiperactivación espermática que facilita la reacción acrosomal(27). Se ha utilizado DMA al 5% y glicerol para congelar espermatozoides de gallo, encontrando en ambos tratamientos reducción de la movilidad de los espermatozoides criopreservados, así como su capacidad fertilizante; sin embargo este efecto fue menor en el grupo tratado con DMA(28). Si bien en este trabajo se utilizó una concentración ligeramente superior del 6% de DMA, y los espermatozoides criopreservados redujeron su movilidad, este efecto es atribuido al incremento de la viscosidad del medio, encontrando la viabilidad espermática superior al 70 %. Se observó también que en los parámetros de descapacitación de los espermatozoides descongelados, son mayores del 30 %, manteniéndose estadísticamente iguales (P>0.05) a diferencia de los espermatozoides con inclusión del 10% de ficoll, en donde hubo un incremento importante, llegando a porcentajes superiores al 50 %. Así el porcentaje de espermatozoides capacitados, se mantienen de manera homogénea por arriba del 30 %, independientemente de la inclusión de ficoll.

182


Rev Mex Cienc Pecu 2022;13(1):175-186

En espermatozoides descongelados, se observó que la inclusión de 10% de ficoll, disminuyó el porcentaje de reacción acrosomal por debajo del 20 %, comparándolos con las otras inclusiones (30% y 45%), en donde los porcentajes fueron superiores al 40 %. Hay que considerar que la criopreservación es un proceso de estrés térmico y osmótico que hace que la viabilidad y movilidad del espermatozoide decrezca. En diferentes especies el proceso de congelamiento espermático hace que el estímulo de inducir a la reacción acrosomal sea mayor(29), al comparar el proceso de reacción acrosomal mediante la criopreservación con diferentes crioprotectores, sugieren en sus resultados que el proceso para que se lleve a cabo la reacción acrosomal es muy sensible al estrés osmótico y a los cambios rápidos agua/solutos en el gallo, demostrando que utilizando crioprotectores como el DMA hay una menor inducción a la reacción acrosomal.

Conclusiones e implicaciones En resultados del presente trabajo, se evidencia que la viscosidad es un factor físico que influye en la conservación espermática en semen de gallo; se determinó que los parámetros de viscosidad convenientes son 2.1698 mPa*s y 3.2320 mPa*s. La viscosidad conserva los parámetros de viabilidad y morfología espermática en post criopreservación, evitando que exista un gasto energético en el espermatozoide por medio de la disminución de la movilidad. Se demostró que se reduce la reacción acrosomal espontánea en los espermatozoides descongelados y aumenta la descapacitación espermática, lo cual evidenció que es un estado fisiológico reversible, con lo cual el espermatozoide puede conservarse intacto hasta llegar al sitio de fertilización.

Agradecimientos A la Dra. Cindy Gabriela Hernández, por su ayuda durante el uso del laboratorio de Bioquímica de la Reproducción de la Universidad Autónoma Metropolitana-X.

Conflicto de interés Se declara que no existe ningún tipo de conflicto de interés. Literatura citada: 1. Herrera JA, Quintana JA, López M, Betancourt M, Fierro R. Individual cryopreservation with dimethyl sulfoxide and polyvinylpyrrolidone of ejaculates and pooled semen of three avian species. Arch Androl 2005;51(5):353-360. doi: 10.1080/014850190944401.

183


Rev Mex Cienc Pecu 2022;13(1):175-186

2. Bootwalla S. Froman D. Effect of extender viscosity on the insemination dose for chickens. Poult Sci 1988;67(8):1218-1221. doi: 10.3382/ps.0671218. 3. Adams G, Ratto M, Collins C, Bergfelt D. Artificial insemination in South American camelids and wild equids. Theriogenology 2009;71(1):166-175. doi: 10.1016/j.theriogenology.2008.09.005. 4. Bravo P, Alarcon V, Baca L, Cuba Y, Ordonez C, Salinas J, Tito, F. Semen preservation and artificial insemination in domesticated South American camelids. Anim Rep Sci 2013;136(3):157-163. doi: 10.1016/j.anireprosci.2012.10.005. 5. El-Bahrawy K, Rateb S, Khalifa M, Monaco D, Lacalandra G. Physical and kinematic properties of cryopreserved camel sperm after elimination of semen viscosity by different techniques. Anim Rep Sci 2017;187(sn):100-108. doi: 10.1016/j.anireprosci.2017.10.011. 6. Holt W. Germoplasm cryopreservation in elephants and wildt ungulates. In: Cryobanking the genetic resource. Wildlife conservation for the future? Watson PF, Holt W, editors. CRC Press. 2001:319-348. 7. Baskt M, Wishart G, Brillard J. Oviductal sperm selection, transport, and storage in poultry. Poult Sci Rev 1994;5(3):117-143. 8. Blesbois E, Brillard J. Specific features of in vivo and in vitro sperm storage in birds. Animal 2007;1(10):1472-1481. doi: 10.1017/S175173110700081X. 9. Baskt M, Bauchan G. Lectin staining of the uterovaginal junction and sperm-storage tubule epithelia in broiler hens. Poult Sci 2016;95(4):948-955. doi.org/10.3382/ps/pev440. 10. Santiago-Moreno J, Esteso M, Villaverde-Morcillo S, Toledano-Diaz A, Castano C, Velázquez R, et al. Recent advances in bird sperm morphometric analysis and its role in male gamete characterization and reproduction technologies. Asian J Androl 2016;18(6):882-888. doi: 10.4103/1008-682X.188660. 11. Lemoine M, Grasseau I, Brillard J, Blesbois E. A reappraisal of the factors involved in vitro initiation of the acrosome reaction in chicken spermatozoa. Reproduction 2008;136(4):391. doi:10.1530/REP-08-0094. 12. Longobardi V, Albero G, De Canditiis D, Salzano A, Natale A, Balestrieri A, Neglia G, Campanile G, Gasparrini B. Cholesterol-loaded cyclodextrins prevent cryocapacitation damages in buffalo (Bubalus bubalis) cryopreserved sperm. Theriogenology 2017;89(sn):359–364. doi: 10.1016/j.theriogenology.2016.09.048 13. Laffaldano N, Di Iorio M, Cerolini S, Manchisi A. Overview of turkey semen storage: focus on cryopreservation. Annals Anim Sci 2016;16(4):961-974. https://doi.org/10.1515/aoas-2016-0026.

184


Rev Mex Cienc Pecu 2022;13(1):175-186

14. Norma Oficial Mexicana NOM-062-ZOO-1999. Especificaciones técnicas para la producción, cuidado y uso de los animales de laboratorio. 15. Burrows W, Quinn J. The collection of spermatozoa from the domestic fowl and turkey. J Poult Sci 1937;16(1):19-24. https://doi.org/10.3382/ps.0160019. 16. Lake P. The principles and practice of semen collection and preservation in birds. In: Symposia of the Zoological Society of London. 1978;43:31–49. 17. Camarillo R, Jiménez I, Guzmán A, Rosales A, Rodríguez F, Pérez-Rivero J, Herrera J. Oviductal proteins effect in rooster spermatic cryopreservation. CryoLetters 2019; 40(6): 352-356. http://www.cryoletters.org/Abstracts/vol_40_6_2019.htm. 18. Fischer DH, Failing SK, Meinecke‐Tillmann S, Wehrend A, Lierz M. Viability assessment of spermatozoa in large falcons (Falco spp.) using various staining protocols. Reprod Dom Anim 2020;55(10):1383-1392. https://doi.org/10.1111/rda.13785. 19. Lemoine M, Mignon S, Grasseau I, Magistrini M, Bleisbois E. Ability of chicken spermatozoa to undergo acrosome reaction after liquid storage or cryopreservation. Theriogenology 2011;75(1):122-130. doi: 10.1016/j.theriogenology.2010.07.017. 20. Herrera JA, Calderón G, Guzmán A, Vargas AK, Ávalos A, Rosales A. Evaluation of two diluents for the storage of fresh and cryopreserved eyaculado of Harris hawk (Parabuteo unicinctus). Autrals J Vet Sci 2017;49(1):39-43. doi.org/10.4067/s071981322017000100039. 21. Hammer Ø, Harper D, Ryan P. PAST: Paleontological statistics software package for education and data analysis. Paleontología Electrónica 2001;4(1):1-9. 22. Donoghue A, Wishart G. Storage of poultry semen. Anim Rep Sci 2000;62(1-3):213232. doi: 10.1016/s0378-4320(00)00160-3. 23. Skidmore J. The use of some assisted reproductive technologies in old world camelids. Anim Rep Sci 2019; 207(sn):138-145. doi: 10.1016/j.anireprosci.2019.06.001. 24. Al-Bulushi S, Manjunatha B, Bathgate R, Rickard J, De Graaf S. Liquid storage of dromedary camel semen in different extenders. Anim Rep Sci 2019; 207(sn):95-106. https://doi.org/10.1016/j.anireprosci.2019.06.008. 25. Lemoine, M. Potential involvement of several signaling pathways in initiation of the chicken acrosome reaction. Biol Rep 2009;81(4):657–665. doi: 10.1095/biolreprod.108.072660. 26. Ali M, Musa M, Alfadul S, Al-Sobayel K. Effect of gum arabic on stallion sperm survival during cold storage and post freezing. Mac Vet Rev 2018;41(1):21-31. https://doi.org/10.1515/macvetrev-2017-0026.

185


Rev Mex Cienc Pecu 2022;13(1):175-186

27. Lemoine M, Grasseau I, Brillard JP, Blesbois E. A reappraisal of the factors involved in in vitro initiation of the acrosome reaction in chicken spermatozoa. Reproduction 2008;136(4):391-399. doi: 10.1530/REP-08-0094. 28. Abouelezz F, Sayed M, Santiago-Moreno J. Fertility disturbances of dimethylacetamide and glycerol in rooster sperm diluents: Discrimination among effects produced pre and post freezing-thawing process. Anim Rep Sci 2017;184(sn):228-234. DOI: 10.1016/j.anireprosci.2017.07.021. 29. Mocé E, Grasseau I, Blesbois E. Cryoprotectant and freezing-process alter the ability of chicken sperm to acrosome react. Anim Rep Sci 2010;122(3-4):359-366. doi: 10.1016/j.anireprosci.2010.10.010.

186


https://doi.org/10.22319/rmcp.v13i1.5943 Artículo

Residuos de antimicrobianos encontrados en aves de corral comercializadas en tiendas minoristas de la zona Metropolitana de Guadalajara, Jalisco

Delia Guillermina González-Aguilar a Maritza Alejandra Ramírez-López a Iyari Ximena Uribe-Camberos a Jeannette Barba-León a*

a

Universidad de Guadalajara. Departamento de Salud Pública. Camino Ramón Padilla Sánchez No. 2100 Nextipac, 45200, Zapopan, Jalisco. México.

* Autor de correspondencia: jeannette.barba@academicos.udg.mx

Resumen: La mayor demanda de producción de grandes cantidades de carne y productos animales para el consumo humano ha promovido el uso indiscriminado de antimicrobianos. El aumento del uso de estas sustancias en la producción de aves de corral tiene consecuencias negativas en la Salud Pública debido a que la acumulación de residuos de antimicrobianos en los órganos y tejidos de las aves de corral podría llegar al consumidor. La presencia de residuos de antimicrobianos puede causar problemas de hipersensibilidad en los seres humanos, o la aparición de patógenos resistentes a los antimicrobianos. El propósito de este trabajo fue evaluar la presencia de residuos de antimicrobianos en riñón y tejido muscular de las aves de corral, comercializados en cuatro municipios de la Zona Metropolitana de Guadalajara, Jalisco. Los resultados muestran que las muestras de riñón tuvieron un mayor número de resultados positivos en comparación con el tejido muscular. Los inhibidores de la vía del folato (sulfametazina) fueron los antimicrobianos con mayor número de resultados positivos en las muestras de riñón. En contraste, en el tejido muscular, los β-Lactámicos (penicilina) fueron los antimicrobianos con mayor número de muestras positivas. En cuanto al análisis

187


Rev Mex Cienc Pecu 2022;13(1):187-199

de los resultados por municipios, se observó que uno de ellos mostró un mayor número de muestras positivas para todas las clases de antimicrobianos evaluados. Este trabajo muestra la presencia de residuos de antimicrobianos en los riñones y tejidos musculares de las aves de corral, comercializados en sitios minoristas. Por lo tanto, es necesario aumentar los esfuerzos para monitorear y controlar el uso de antimicrobianos en las granjas avícolas. Palabras clave: Residuos de antibióticos, Carne de aves de corral, Jalisco, Venta al por menor.

Recibido: 16/02/2021 Aceptado: 15/06/2021

Introducción La industria avícola en México es una de las más productivas en términos de producción de carne(1). El aumento de la demanda de carne de aves de corral ha incrementado el uso de antimicrobianos en su producción; ya sea para controlar enfermedades animales o como promotores del crecimiento(2). En Europa, se estima que aproximadamente el 80 % de los pollos recibe al menos una vez un tratamiento antimicrobiano durante su crecimiento, con una media de 172 mg/kg desde la eclosión hasta el sacrificio(3). Uno de los riesgos para la salud humana, asociado con el uso de antimicrobianos durante la producción avícola intensiva, es la presencia de residuos de antimicrobianos en la carne consumida. La presencia de residuos de antimicrobianos en la carne puede promover riesgos para la salud de los consumidores, como toxicidad, enfermedades inmunopatológicas, reacciones alérgicas, efectos cancerígenos, entre otras enfermedades(4,5). Además, la presencia e ingestión de residuos de antimicrobianos puede promover la aparición de patógenos resistentes a los medicamentos(6). Según el Centro para el Control y la Prevención de Enfermedades (CDC, por sus siglas en inglés), la aparición de patógenos resistentes a los antimicrobianos, como Campylobacter y Salmonella, es uno de los mayores desafíos de Salud Pública de este siglo(6,7). Se ha informado que el abuso de antimicrobianos y su uso inadecuado, en relación con la dosis aplicada y el período de aplicación de no antimicrobianos a los animales antes de su sacrificio (período de abstinencia), es la principal causa de acumulación de residuos de antimicrobianos en los órganos y tejidos de las aves de corral(4,5). Al respecto, los residuos de antimicrobianos pueden localizarse con diferentes concentraciones en varios tejidos, situación que depende de la clase de antimicrobiano y de su vía de administración(8). Además

188


Rev Mex Cienc Pecu 2022;13(1):187-199

del estudio de la presencia de residuos de antimicrobianos en tejidos destinados al consumo humano, varios estudios utilizan el riñón como matriz muestral, ya que es el órgano responsable de excretar la mayoría de los medicamentos(9). Se ha informado que la mayoría de los antimicrobianos, como los β-lactámicos, las tetraciclinas, la estreptomicina, la sulfametazina y el cloranfenicol, se excretan en la orina como fármacos originales o como un metabolito derivado(10). Por lo tanto, en este estudio se analizó la presencia de penicilina, sulfametazina y estreptomicina como indicador del uso de estos antimicrobianos durante la producción de las aves de corral analizadas. La evidencia científica muestra que las clases de antimicrobianos comúnmente utilizados en la industria avícola en el mundo son aminoglucósidos (estreptomicina)(11), β-lactámicos (penicilina)(12), antagonistas de la vía del folato (sulfonamidas-sulfametazina), quinolonas (ciprofloxacina) y tetraciclinas(13). La toxicidad de cada una de estas clases es diferente, por ejemplo, los aminoglucósidos son hepatotóxicos y ototóxicos, los inhibidores de la vía del Folato tienen efectos teratogénicos y pueden causar problemas en el tracto urinario. Por otro lado, el β-Lactámico provoca neurotoxicidad en los casos en que la función renal está alterada o existen lesiones cerebrales preexistentes. Además, las tres clases de antimicrobianos causan la interrupción de la flora intestinal(5). En México, estas tres clases están catalogadas como medicamentos sujetos a monitoreo en aves de corral(14). Por ello, este estudio probó la presencia de tres residuos de antimicrobianos en riñón y tejido muscular de aves de corral en cuatro municipios de la Zona Metropolitana de Guadalajara (ZMG). Los residuos de antimicrobianos evaluados en este estudio son representativos de las tres clases de antimicrobianos monitoreados en México.

Material y métodos Toma de muestras Se adquirió un total de 177 riñones y 177 tejidos musculares, correspondientes a la parte baja de la espalda (rabadilla) de un número igual de canales de aves de corral, en tiendas minoristas de cuatro municipios de la ZMG. Las muestras se colectaron al azar, de febrero a junio de 2018. Los municipios analizados fueron Guadalajara (A) con 43 muestras evaluadas por cada tejido analizado (43 muestras de riñón y 43 muestras musculares), Tlaquepaque (B) con 40 muestras, Tonalá (C) con 44 muestras y Zapopan (D) con 50 muestras. El número de muestras por municipio se calculó con el software Win Episcope v 2.0, considerando una confianza del 95 % y un error del 5 %. Las muestras de riñón y tejido muscular fueron transportadas en hieleras al Laboratorio de Inocuidad de Alimentos del Departamento de Salud Pública del Centro Universitario de Ciencias Biológicas y Agropecuarias, Universidad de Guadalajara, para su análisis.

189


Rev Mex Cienc Pecu 2022;13(1):187-199

Procesamiento de muestras Todas las muestras de riñón y tejido muscular colectadas fueron diseccionadas por triplicado con un punzón estéril de 8 mm, en condiciones asépticas. La presencia de residuos de antibióticos se evaluó mediante el método de difusión de placas de agar de Bacillus subtilis (6 log10 UFC)(15,16), utilizando agar MacConkey. El agar se hizo con tres pH diferentes, donde cada pH permite probar una clase diferente de antimicrobiano. Se utilizó medio con pH 6 para evaluar la presencia de residuos β-Lactámicos y se añadió con penicilina (0.10 U.I.); el medio con pH 7 se utilizó para analizar los residuos de los inhibidores de la vía del folato, y se agregó con sulfadiazina (0.5 μg); el medio con pH 8 se utilizó para detectar residuos de aminoglucósidos, y se agregó con estreptomicina (0.5 μg). Cada una de las muestras obtenidas del riñón y tejido muscular se colocaron en placas, correspondientes a cada uno de los antimicrobianos evaluados, como se muestra en la Figura 1. Se utilizó un cuadrado de 6 mm de papel de filtro estéril (Whatman 4) como control negativo. Las placas se incubaron a 37 + 1 °C/24 h. La presencia de residuos de antimicrobianos se evaluó en función del diámetro de la zona de inhibición formada en la placa de crecimiento de B. subtilis. La medición se realizó con un vernier que iba desde el borde exterior de la muestra hasta el punto final de la zona de inhibición. Las zonas de inhibición iguales o superiores a 2 mm se consideraron positivas; las zonas de inhibición menores de 2 mm pero iguales o superiores a 1 mm se consideraron sospechosas y las zonas de inhibición menores de 1 mm se consideraron negativas(15). Figura 1: Esquema de la colocación de las muestras en las placas antimicrobianas. M: músculo, K: riñón

190


Rev Mex Cienc Pecu 2022;13(1):187-199

Análisis estadístico Los datos fueron analizados con el software GraphPad Prism 8.4.2. Se utilizó la prueba de Mann Whitney, la prueba de Kruskal-Wallis y la prueba de comparaciones múltiples post hoc de Dunn. Una P<0.05 se consideró una diferencia estadísticamente significativa.

Resultados Se evaluaron muestras de riñón y tejido muscular de 177 canales de pollo para detectar residuos de antimicrobianos de penicilina (pH 6), sulfametazina (pH 7) y estreptomicina (pH 8) utilizando el ensayo de difusión de placas de agar de B. subtilis. El 33.3 % (59/177) de las muestras analizadas fueron positivas a la presencia de cualquiera de los residuos de antimicrobianos evaluados, donde el 22.6 % (40/177) de las muestras procedían de muestras de riñón y el 10.7 % (19/177) procedían de tejido muscular (P<0.05) (Cuadro 1). En cambio, el 44.1 % (78/177) de las muestras se clasificaron como sospechosas, mientras que el 37.3 % (66/177) correspondió a riñón y el 6.8 % (12/177) a tejido muscular (P<0.05). El 40.1 % (71/177) de las muestras de riñón y el 82.5 % (146/177) de las muestras de tejido muscular fueron negativas. El municipio B fue el de mayor porcentaje de muestras positivas reportadas (18.0 %), seguido del municipio D (7.4 %) y el municipio A (6.8 %). En cuanto a los resultados sospechosos, el municipio D mostró el mayor número de muestras en esta categoría (22.1 %), seguido por el municipio B (10.1 %) y el municipio A (7.9 %). El municipio C fue el que mostró el menor número de muestras positivas (1.2 %) y sospechosas (4.0 %). Cuadro 1: Presencia de residuos de antimicrobianos en las aves de corral vendidas en las tiendas minoristas de la Zona Metropolitana de Guadalajara Muestras Muestras Muestras Muestras Municipio (n) resistentes (%)* sospechosas (%) negativas (%) Órgano M R M R M R A 43 2.3 4.5 1.7 6.2 20.3 13.6 B 40 5.6 12.4 1.1 9.0 15.8 1.1 C 44 0.6 0.6 0.0 4.0 24.3 20.3 D 50 2.3 5.1 4.0 18.1 22.0 5.1 Total 177 *El porcentaje mostrado se calculó en base al total de muestras de tejido muscular (M) y riñón (R) analizadas.

El análisis de las muestras positivas por el tipo de residuos analizados mostró un número similar de muestras positivas en riñones (P>0. 05) (Figura 2). En cambio, la penicilina fue el residuo que mostró el mayor número de muestras positivas en músculo (8/177), seguido de la estreptomicina (6/177) y la sulfametazina (5/177) (P>0.05). En cuanto al número de 191


Rev Mex Cienc Pecu 2022;13(1):187-199

muestras sospechosas, se observó que el riñón volvió a ser el órgano con mayor número de muestras sospechosas, siendo la penicilina el residuo con mayor número de resultados positivos (30/177), seguido de la estreptomicina (21/177) y la sulfametazina (15/177). Curiosamente, las muestras musculares reportaron menos resultados sospechosos de sulfametazina (6/177), penicilina (4/177) y estreptomicina (2/177). El análisis estadístico de muestras sospechosas mostró diferencias estadísticamente significativas entre el tipo de muestras (K vs M) (P<0.05). Por el contrario, no se encontraron diferencias estadísticamente significativas por clase de residuo de antimicrobiano (P>0.05). Figura 2: Muestras positivas y sospechosas por antimicrobiano evaluado

El gráfico muestra en blanco el número de muestras positivas para cada uno de los antimicrobianos analizados. El número de muestras sospechosas por antimicrobiano analizado se muestra en gris. ABCDE Letras mayúsculas diferentes indican diferencias estadísticamente significativas (P<0.05).

El análisis de los resultados de los residuos de antimicrobianos por localidad mostró que el municipio B es el que tiene el mayor número de muestras positivas para los tres residuos evaluados en ambos tipos de muestras evaluadas (K y M). El análisis estadístico mostró diferencias estadísticamente significativas para el número de muestras positivas a residuos de ampicilina en tejido renal entre los municipios B, C y D (P<0.05). Para sulfametazina, se observaron diferencias estadísticamente significativas entre los municipios B y C (P<0.05). Finalmente, para residuos de estreptomicina, las diferencias se observaron en los municipios A, B y C (P<0.05) (Figura 3a). En cuanto al número de muestras sospechosas en riñón, se encontró que el municipio D fue el que tuvo el mayor número de muestras reportadas para los tres residuos evaluados en comparación con el resto de los municipios (P<0.05). Se observó un patrón similar para el tejido muscular, donde el municipio B fue el que tuvo el mayor número de muestras que reportaron los tres residuos evaluados (P>0.05) y el municipio D fue el que tuvo el mayor número de muestras sospechosas de residuos de

192


Rev Mex Cienc Pecu 2022;13(1):187-199

sulfametazina y estreptomicina (P>0.05) (Figura 3b). Curiosamente, en los tejidos musculares, el municipio C no reportó muestras positivas o sospechosas de residuos de sulfametazina y estreptomicina y solo reportó una muestra positiva a residuos de ampicilina. Figura 3: Muestras positivas y sospechosas evaluadas por antimicrobiano y municipio

El gráfico muestra en blanco el número de muestras positivas para cada uno de los antimicrobianos analizados. El número de muestras sospechosas por antimicrobiano analizado se muestra en gris. * indican diferencias estadísticamente significativas (P<0.05), entre las barras indicadas por las puntas de flecha.

193


Rev Mex Cienc Pecu 2022;13(1):187-199

Discusión Varias investigaciones han reportado las implicaciones de la presencia de residuos de antimicrobianos en tejidos de animales destinados al consumo humano, tanto en la salud humana como en el desarrollo de resistencia a medicamentos en patógenos zoonóticos. Actualmente, la Organización Mundial de la Salud indica que, para prevenir y controlar la propagación de la resistencia a los antimicrobianos, el sector agrícola debe administrar antibióticos a los animales solo bajo supervisión veterinaria, evitando el uso de antibióticos como promotores del crecimiento o para prevenir enfermedades en animales sanos. Se recomienda el uso de vacunas en animales destinados al consumo, con el fin de reducir la necesidad del uso de antibióticos. Asimismo, se recomienda mejorar la higiene en los puntos de control a lo largo de la cadena de producción(17). Se ha informado que la aparición de patógenos zoonóticos resistentes a múltiples clases de antimicrobianos puede propagarse del animal a los alimentos, causando enfermedades transmitidas por los alimentos difíciles de tratar en los seres humanos, lo que resulta en un impacto sanitario, médico y socioeconómico significativo(18). El uso inadecuado y excesivo de antimicrobianos en las aves de corral, evidenciado por la presencia de residuos de antimicrobianos en órganos como el riñón y/o los tejidos, promueve que la microbiota de las aves de corral, o los patógenos zoonóticos presentes en los animales, obtengan y transmitan genes de resistencia a los antimicrobianos por presión selectiva. En los consumidores, la presencia de residuos de antimicrobianos en los alimentos puede afectar a su salud de dos formas principales: (1) promoviendo reacciones alérgicas y tóxicas, debido a la exposición prolongada a bajos niveles de residuos o (2) debido a una posible aparición y propagación de resistencia a los antimicrobianos en la microbiota del hospedero o en patógenos que causan una infección difícil de tratar(19). Al respecto, en Vietnam se encontró una relación entre los residuos de antimicrobianos presentes en la carne de aves de corral procedente de mercados y supermercados, y cepas de Salmonella no tifoidea (SNT) obtenidas de las mismas muestras. El estudio consistió en el análisis de 119 muestras, donde se encontró la presencia de 10 residuos de antimicrobianos. Las clases de inhibidores de la vía del Folato, tetraciclinas y macrólidos fueron las que mostraron el mayor número de resistencia a SNT. La prevalencia de SNT fue del 71.8 %, siendo los serotipos más comunes Kentucky, Corvallis, Agona y ST2024. A partir de los aislados de Salmonella recuperados, se observó que la resistencia bacteriana y la presencia de residuos de antimicrobianos en la carne de aves de corral correspondían a las clases de tetraciclinas e inhibidores de la vía del Folato. Los resultados mostrados en el estudio de Vietnam enfatizan que existe una correlación entre la presencia de residuos de antimicrobianos en los tejidos de las aves de corral y el aislamiento de bacterias patógenas resistentes(20).

194


Rev Mex Cienc Pecu 2022;13(1):187-199

Este estudio muestra la presencia de residuos en riñones y tejidos musculares de tres clases diferentes de antimicrobianos, β-Lactámico (penicilina), inhibidores de la vía del Folato (sulfametazina) y Aminoglucósidos (estreptomicina), procedentes de aves de corral comercializadas en cuatro municipios de la ZMG (Cuadro 1). El porcentaje de muestras positivas (33.3 %) encontradas en este estudio es mayor al encontrado en la carne de res cruda en Erbil, Irak (10,8 %)(21) y en aves de corral en Shanghai, China (22.2 %)(19) y es inferior al reportado en alimentos avícolas (47.3 %) en Fujian, China(22). Los resultados obtenidos en este estudio comparados con los obtenidos en Irak y China muestran que, a pesar de la existencia de regulaciones y programas de control de residuos de antimicrobianos, su vigilancia y control no es eficiente. Ya sea por falta de infraestructura y pruebas diagnósticas para identificar residuos de antimicrobianos en los órganos y tejidos de las aves de corral o por falta de experiencia para detectar estos residuos. Los resultados obtenidos mostraron que los inhibidores de la vía del Folato fueron los que tuvieron el mayor número de muestras positivas reportadas en riñón, seguidos por los residuos de β-Lactámicos y Aminoglucósidos. En contraste, en las muestras musculares, el residuo que reportó el mayor número de muestras positivas fue el β-Lactámico, seguido de Aminoglucósidos e inhibidores de la vía del Folato. Los resultados observados contrastan con los resultados reportados en China, donde la Tetraciclina es el residuo de antimicrobiano con mayor incidencia en aves de corral(22). Asimismo, los resultados de este estudio están de acuerdo con los reportados en Pakistán y Nigeria, donde los residuos de inhibidores de la vía del Folato (sulfonamidas) fueron la clase de antibióticos con mayor incidencia en aves de corral(23,24). Parece que la presencia de residuos de antimicrobianos pertenecientes a las clases de inhibidores de la vía del Folato y Tetraciclinas depende del antimicrobiano utilizado con frecuencia en cada país. La presencia de residuos de antimicrobianos en México, China y África muestra la falta de recursos económicos que permitan la adquisición de insumos y capacitación técnica para llevar a cabo un programa adecuado de control de residuos de antimicrobianos. En México, aunque existen regulaciones gubernamentales para los programas de control de residuos de antimicrobianos, estos sólo se llevan a cabo en plantas de sacrificio cuyo producto se destina a productos de exportación, descuidando el consumo local. Por otro lado, estudios han reportado que las muestras de riñón positivas a residuos de antimicrobianos son mayores a las encontradas en músculo, debido a que el período de abstinencia en la aplicación del antimicrobiano se refleja más rápidamente en el músculo que en el riñón(25). Por esta razón, un resultado positivo en el riñón no debe considerarse un indicador de la calidad del tejido muscular(25). Al respecto, se ha reportado que los residuos de aminoglucósidos permanecen en el riñón durante períodos más prolongados de tiempo, incluso meses, debido a su afinidad con la corteza renal(26). En cuanto a los resultados del número de muestras positivas a múltiples clases de antibióticos, como las observadas en los municipios A, B y D, los resultados obtenidos son similares a los reportados en China y Holanda(22,27). En China, se reportó que el 28.8 % de las muestras 195


Rev Mex Cienc Pecu 2022;13(1):187-199

positivas fueron positivas a dos o más residuos de antibióticos, donde el residuo de tetraciclina fue encontrado con mayor frecuencia, seguido de los residuos de inhibidores de la vía del Folato(22). Adicionalmente, las diferencias observadas en este estudio respecto a los hallazgos obtenidos para los municipios A, B y D se deben posiblemente al origen de los pollos de engorda que procesa cada planta de sacrificio. Los resultados obtenidos sugieren que los animales sacrificados en las plantas de los municipios A y D proceden de granjas que realizan algún programa de control operativo. Por el contrario, los resultados observados en el municipio B sugieren que los pollos de engorda provienen de granjas donde no existe un control adecuado en la administración y suspensión de tratamientos antimicrobianos previos al sacrificio.

Conclusiones e implicaciones Los resultados obtenidos muestran que las aves de corral analizadas llegan a las plantas de sacrificio con presencia de residuos antimicrobianos en riñón y músculo. La presencia de antimicrobianos analizados en pollos de engorda sugiere abuso en su administración. Dado que no se dispone de estudios de trazabilidad de los animales recibidos en cada matadero analizado en este estudio, es necesario realizar estudios que monitoreen las diferentes clases de antimicrobianos y dosis administradas a las aves de corral. Sin embargo, los resultados de este estudio solo reflejan un problema local en Jalisco, México y los datos de este estudio no reflejan necesariamente la situación en el país. Asimismo, la falta de estudios de evaluación de riesgo humano dentro de las poblaciones mexicanas dificulta el análisis del riesgo de exposición a antimicrobianos, debido a la ingestión de carne de ave, tanto a nivel local como nacional. Agradecimientos Los autores agradecen a Kevin Brian Magallon Carrizales y Sergio Arturo Córdova Ramírez por su apoyo técnico. Declaración de interés en competencia Todos los autores declaran que no hay conflictos de intereses. Literatur citada: 1.

CEDRSSA. Centro de Estudios para el Desarrollo Rural Sustentable y la Soberanía Alimentaria. La importancia de la industria avícola en México. 2019. http://www.cedrssa.gob.mx/files/b/13/47Industria_Avicola_M%C3%A9xico.pdf. Consultado Mayo 19, 2021.

196


Rev Mex Cienc Pecu 2022;13(1):187-199

2.

Hedman HD, Vasco KA, Zhang L. A review of antimicrobial resistance in poultry farming within low-resource settings. Animals 2020;10(8).

3.

De Briyne N, Atkinson J, Pokludova L, Borriello SP. Antibiotics used most commonly to treat animals in Europe. Vet Rec 2014;175(13).

4.

Muaz K, Riaz M, Akhtar S, Park S, Ismail A. Antibiotic residues in chicken meat: global prevalence, threats, and decontamination strategies: A review. J Food Prot 2018;81(4):619-627.

5.

Vishnuraj M, Kandeepan G, Rao K, Chand S, Kumbhar V. Occurrence, public health hazards and detection methods of antibiotic residues in foods of animal origin: A comprehensive review. Cogent Food & Agriculture 2016;2(1235458):1-8.

6.

Golden CE, Mishra A. Prevalence of Salmonella and Campylobacter spp. in alternative and conventionally produced chicken in the United States: A systematic review and Meta-Analysis. J Food Prot 2020;83(7):1181-1197.

7.

CDC. Centers for Disease Control and Prevention. CDC. Antibiotic resistance threats in the United States, 2019. https://www.cdc.gov/drugresistance/pdf/threats-report/2019ar-threats-report-508.pdf. Accessed May 19, 2021.

8.

Van Boeckel TP, Brower C, Gilbert M, Grenfell BT, Levin SA, Robinson TP, et al. Global trends in antimicrobial use in food animals. Proc Natl Acad Sci USA 2015;112(18):5649-5654.

9.

Ezenduka EV. Screening of antimicrobial residues in poultry meat in Enugu metropolis, Enugu State, South East Nigeria. Vet Ital 2019;55(2):143-148.

10. Wu Q, Zhu Q, Shabbir MA, Sattar A, Peng DP, Tao YF, et al. The search for a microbiological inhibition method for the rapid, broad-spectrum and high-throughput screening of six kinds of antibiotic residues in swine urine. Food Chem 2021;339. 11. Pikkemaat MG, Rapallini M, Zuidema T, Elferink JWA, Oostra-van Dijk S, Driessenvan Lankveld WDM. Screening methods for the detection of antibiotic residues in slaughter animals: comparison of the European Union Four-Plate Test, the Nouws Antibiotic Test and the Premi (R) Test (applied to muscle and kidney). Food Additives & Contaminants 2011;28(1):26-34. 12. Hakem A, Titouche Y, Houali K, Yabrir B, Malki O, Chenouf N, et al. Screening of antibiotics residues in poultry meat by microbiological methods. University of Agricultural Sciences and Veterinary Medicine 2013;70(1). 13. Karmi M. Detection and presumptive identification of antibiotic residues in poultry meat by using FPT. Global J Pharmacol 2014;8(2):160-165. 197


Rev Mex Cienc Pecu 2022;13(1):187-199

14. SENASICA. Servicio Nacional de Sanidad IyCA. Tabla de Límites Máximos de Residuos, 2020. https://www.gob.mx/senasica/documentos/limites-maximos-deresiduos-toxicos-y-contaminantes?state=published. Consultado Mayo 19, 2021. 15. Bogaerts RWF. A standardized method for the detection of residues of antibacterial substances in fresh meat. Fleischwirtschaft 1980;60:672-674. 16. Gondová Z, Kožárová I, Poláková Z, Mad’arová M. Comparison of four microbiological inhibition tests for the screening of antimicrobial residues in the tissues of foodproducing animals. Ital J Anim Sci 2014;13(4):729-735. 17. World Health Organization. Antimicrobial resistance. 2020. https://www.who.int/newsroom/fact-sheets/detail/antimicrobial-resistance. Accessed May 19, 2021. 18. Madoroba E, Kapeta D, Gelaw AK. Salmonella contamination, serovars and antimicrobial resistance profiles of cattle slaughtered in South Africa. Onderstepoort J Vet Res 2016;83(1). 19. Wang HX, Ren LS, Yu X, Hu J, Chen Y, He GS, et al. Antibiotic residues in meat, milk and aquatic products in Shanghai and human exposure assessment. Food Control 2017;80:217-225. 20. Nhung NT, Van NTB, Cuong NV, Duong TTQ, Nhat TT, Hang TTT, et al. Antimicrobial residues and resistance against critically important antimicrobials in nontyphoidal Salmonella from meat sold at wet markets and supermarkets in Vietnam. Int J Food Microbiol 2018;266:301-309. 21. Al-Mashhadany DA. Detection of antibiotic residues among raw beef in Erbil City (Iraq) and impact of temperature on antibiotic remains. IJFS 2019;8(1):6-10. 22. Yang Y, Qiu WQ, Li YX, Liu LJ. Antibiotic residues in poultry food in Fujian Province of China. Food Addit Contam Part B-Surveill 2020;13(3):177-184. 23. Oyedeji AO, Msagati TAM, Williams AB, Benson NU. Determination of antibiotic residues in frozen poultry by a solid-phase dispersion method using liquid chromatography-triple quadrupole mass spectrometry. Toxicol Rep 2019;6:951-956. 24. Rabia A, Sidrah S. Identification and quantification of antimicrobial activity in commercially available chicken meat in a large urban centre in Pakistan. CRFS 2020;3:173-177. 25. Rahimi Z, Shahbazi Y, Ahmadi F. Comparative screening of chloramphenicol residue in chicken tissues using four plate test and premi (R) test methods. J Pharm Sci 2018;24(2):157-162.

198


Rev Mex Cienc Pecu 2022;13(1):187-199

26. Tajik H, Malekinejad H, Razavi-Rouhani SM, Pajouhi MR, Mahmoudi R, Haghnazari A. Chloramphenicol residues in chicken liver, kidney and muscle: A comparison among the antibacterial residues monitoring methods of four plate test, ELISA and HPLC. Food Chem Toxicol 2010;48(8-9):2464-2468. 27. Pikkemaat MG, Rapallini M, Oostra-van DS, Elferink JWA. Comparison of three microbial screening methods for antibiotics using routine monitoring samples. Anal Chim Acta 2009;637(1-2):298-304.

199


https://doi.org/10.22319/rmcp.v13i1.5675 Artículo

Determinación serológica del virus de leucosis enzoótica bovina (VLEB) en el municipio de Paipa, Boyacá (Colombia)

Jorge Alejandro Jiménez Sánchez a Diana María Bulla-Castañeda a Adriana María Díaz-Anaya a Diego José Garcia-Corredor a Martin Orlando Pulido-Medellin a*

a

Universidad Pedagógica y Tecnológica de Colombia. Facultad de Ciencias Agropecuarias. Grupo de Investigación en Medicina Veterinaria y Zootecnia – GIDIMEVETZ. Avenida Central del Norte 39 - 115, Tunja (Boyacá) - Colombia.

*Autor de correspondencia: martin.pulido@uptc.edu.co

Resumen: La leucosis enzoótica bovina (LEB) es una infección económicamente importante del ganado lechero, causada por el virus de la leucemia enzoótica bovina (VLEB). El método habitual de propagación de la infección por VLEB es la transmisión horizontal, a través de la exposición directa e indirecta de animales susceptibles a los linfocitos infectados de la sangre o de la leche. Tras la infección los animales aparentan estar clínicamente sanos durante los primeros años postinfección, pero entre el 30 y 70 % de los animales pueden desarrollar linfocitosis persistente y del 0.1 a 10 % de los bovinos sufren de linfosarcoma. Esta infección se detecta mediante pruebas serológicas, generalmente por el ensayo por inmunoabsorción ligado a enzimas (ELISA). El objetivo de la presente investigación fue determinar la seroprevalencia de VLEB en hembras bovinas del municipio de Paipa (Boyacá). El estudio epidemiológico fue observacional descriptivo de corte (transversal) con muestreo aleatorio simple, en donde se recolectaron 1000 muestras de suero las cuales fueron procesadas mediante la técnica de ELISA indirecta implementando el kit comercial SERELISA® BLV Ab Mono Blocking. Se determinó una seroprevalencia de 31.1 % (311/1000) encontrando asociación estadística significativa entre la raza, la edad y la seropositividad al virus.

200


Rev Mex Cienc Pecu 2022;13(1):200-210

Palabras clave: Enfermedades de los Bovinos, Leucosis, Seroprevalencia, ELISA.

Recibido: 27/04/2020 Aceptado: 07/04/2021

Introducción La LEB o también conocida como Leucosis Viral Bovina (LVB), es una enfermedad infecciosa persistente causada por un retrovirus que pertenece al género Deltaretrovirus y ataca al ganado bovino, principalmente animales productores de leche(1,2). Los bovinos son la única especie que se infecta de forma natural con el VLEB, aunque es posible infectar experimentalmente ovinos, caprinos, equinos, ciervos, conejos, ratas, cobayos, gatos, entre otros(3). El virus afecta principalmente a los linfocitos B, éste se transmite por vía horizontal y vertical, siendo la primera la más importante fuente de contagio(4), la cual es causada principalmente por artrópodos como la mosca del caballo (tábanos) y por la ingestión de calostro de una vaca infectada. Además, puede presentarse por infección iatrogénica, la cual se da por medio de instrumentos quirúrgicos o mangas contaminadas con sangre infectada que queda como residuo de una palpación rectal(5). La enfermedad no se propaga con rapidez entre hatos; sin embargo, dentro de los hatos afectados la seropositividad puede ser hasta del 80 %. El periodo de incubación habitual es de 4 a 5 años. La infección es rara en los animales menores de 2 años y su máxima frecuencia se presenta entre los 4 a 8 años de edad(3). Los animales infectados con el virus generalmente no presentan signos visibles, sin embargo la exoftalmia es el signo más específico de la enfermedad, en la cual se produce la degeneración del tejido retro ocular y de las estructuras internas del ojo(6,7). Otros síntomas característicos de la enfermedad son inapetencia, pérdida de peso, debilidad general y, en ocasiones, manifestaciones neurológicas. Los ganglios linfáticos superficiales pueden verse inflamados y se pueden palpar bajo la piel o mediante un examen rectal(8). Es una enfermedad que afecta la producción de leche. Se ha demostrado que los animales infectados con el VLEB presentan disminución en la producción de leche que oscila entre el 2.5 al 5 % respecto al hato(9-12). Sumado a esto se presenta mayor susceptibilidad a la aparición de otras enfermedades como mastitis, diarrea y neumonías(7). Si bien, más de 20 países han eliminado con éxito el VLEB a través de programas de control, la prevalencia del virus puede ser hasta del 90 % en áreas endémicas como Europa del Este, América del Sur y varios países asiáticos(13).

201


Rev Mex Cienc Pecu 2022;13(1):200-210

En Colombia la enfermedad es considerada de declaración obligatoria (Resolución ICA 3714 de 2015)(14). Sin embargo, no existe un programa para prevenir la diseminación del VLEB en bovinos, el cual ayudaría a prevenir la presentación de la enfermedad, contribuyendo a la mitigación del impacto económico de la misma(15). En el caso de la LEB los animales positivos al virus y los que presentan linfocitosis persistente, solamente pueden ser diagnosticados a través de técnicas en el laboratorio, mientras que los animales que presentan linfosarcoma, pueden ser fácilmente diagnosticados por el médico veterinario en campo(16). En Boyacá se han realizado pocas investigaciones sobre la enfermedad(8), lo que evidencia la falta de información acerca de ésta en la zona. A su vez en el municipio de Paipa, se desconoce la seroprevalencia del virus y la relación que existe con su manifestación en la producción lechera, condición que se considera de gran relevancia, ya que este es un municipio de perfil económico agroindustrial con un sector ganadero fuerte, y una marcada tendencia al crecimiento. Teniendo en cuenta lo anterior, el objetivo de la presente investigación fue determinar la seroprevalencia del VLEB en el municipio de Paipa, Boyacá.

Material y métodos Ubicación geográfica El estudio se realizó en Paipa (Boyacá), municipio colombiano situado en el centrooriente de Colombia. Se encuentra en la provincia de Tundama del departamento. Según los datos del censo de 2005, cuenta con una población de 27,274 habitantes. En la estructura económica regional, el municipio participa ampliamente con diversos productos en cada uno de los sectores económicos. En el sector primario se maneja la agricultura, la ganadería y la minería. Dentro de la agricultura se cultivan avena, cebada, maíz, trigo, papa y legumbres y en la ganadería se obtienen productos como la leche y la carne(17).

Tamaño de la muestra Según el Censo Pecuario Nacional realizado por el Instituto Colombiano Agropecuario (2019)(18), en el municipio de Paipa se registró una población bovina de 22,975 cabezas de ganado en donde 16,968 de estos individuos fueron hembras. Teniendo en cuenta esta información se determinó una muestra de 1,000 hembras bovinas, a partir de la siguiente fórmula obtenida a través del programa estadístico OpenEpi, versión 3: [EDFF*Np(1-p)]/ [(d2/Z21-α/2*(N-1) + p*(1-p)]; donde: d= límites de confianza como % de 100 (absoluto +/-%) = 3%; n= tamaño de la población (22,975); p= Frecuencia % hipotética del factor del resultado en la población = 50%+/-3; Z1-α/2= valor de Z de dos lados, 1.96 para un intervalo de confianza del 95%; α= probabilidad de cola, p. Ej., 0.05 para un intervalo de confianza del 95%; efecto de diseño (para encuestas en grupo-EDFF).

202


Rev Mex Cienc Pecu 2022;13(1):200-210

Variables evaluadas Se evaluaron las variables monta e inseminación artificial, tipo de ordeño implementado en cada finca, raza y edad de los animales muestreados.

Toma y procesamiento de muestras Las muestras de sangre se obtuvieron de hembras mayores a 2 años de edad y pertenecientes a las razas Ayrshire, Holstein, Jersey y Normando; previo a la toma de la muestra de sangre se desinfectó el área con alcohol para facilitar la toma y evitar la contaminación de la misma. Mediante punción en la vena coccígea utilizando aguja calibre 16 y 18 de 3 pulgadas se extrajeron 7 ml de sangre implementando el sistema de tubos al vacío (tipo Vacutainer tapa roja o amarilla). Estos tubos fueron rotulados, refrigerados en cavas de icopor y transportados al laboratorio de Parasitología Veterinaria de la Universidad Pedagógica y Tecnológica de Colombia (Uptc), en donde se centrifugaron a 2,500 rpm por 10 min para separar las células del suero. Luego con una pipeta Pasteur se transfirió el suero a un tubo eppendorf para el almacenamiento a -20 °C(19). Las muestras se procesaron con la técnica de ELISA indirecta utilizando el kit comercial SERELISA® BLV Ab Mono Blocking (Zoetis, Estados Unidos) con una sensibilidad del 97 % y especificidad del 98 %, siguiendo las instrucciones del fabricante.

Análisis estadístico El estudio epidemiológico fue observacional descriptivo de corte (transversal) con muestreo aleatorio simple, en donde la población blanco estuvo conformada por bovinos de raza lechera del municipio de Paipa, mientras que la población de estudio fueron hembras bovinas de razas Holstein, Ayrshire, Jersey y Normando que tenían dos años o más. Los datos obtenidos se procesaron en el programa estadístico IBM SPSS Statistics 19. Se realizó la prueba de Ji-cuadrada para determinar si existía relación entre la presencia de anticuerpos contra el VLEB y las variables evaluadas (P≤0.05), en donde las categorías de referencia para la edad fue el grupo etario de 2-3 años y para la raza fue la Ayrshire. Las variables que presentaron significancia estadística en donde el valor de P fue ≤0.05 se analizaron mediante regresión logística.

Consideraciones éticas El estudio se realizó bajo las condiciones de la Ley 576 del 2000 y la Ley 84 de 1989 de la República de Colombia. Se obtuvo consentimiento informado por parte de los propietarios de los bovinos antes de la recolección de las muestras.

203


Rev Mex Cienc Pecu 2022;13(1):200-210

Resultados Se determinó una seroprevalencia de 31.1 % para VLEB (311/1000) en hembras del municipio de Paipa. La raza Jersey fue la que presentó la seroprevalencia más alta (39.2 %), seguido de la raza Holstein, Ayrshire y Normando, con 38.1, 36.7 y 11.3 % respectivamente. En cuanto a los grupos etarios evaluados, se determinó que las hembras entre los 3 y 4 años presentan la seroprevalencia más alta (36.7 %), seguido por los individuos de más de 4 años y el grupo de bovinos de 2 a 3 años, con 23.4 y 21 % respectivamente. Así mismo, la raza y edad de los individuos muestreados presentaron diferencias significativas (P≤0.05). En cuanto a la edad, el grupo etario de 3 a 4 años presentaron asociación estadística significativa (P=0.000; P≤0.05). Con respecto a la raza, las hembras de la raza Normando presentaron asociación significativa (P= 0.000; P≤0.05), además al presentar un valor de OR<1 se puede considerar que estos bovinos presentan menor susceptibilidad a presentar anticuerpos contra el VLEB (Cuadro 1). Cuadro 1: Análisis de la edad y la raza como factores de riesgo asociados a las infecciones por VLBE Variable Parámetro OR IC P-valor 2-3 años Edad 3- 4 años 2.106 1.466 – 3.025 0.000 > 4 años 1.111 0.688 – 1.794 0.667 Ayrshire Holstein 1.065 0.748 – 1.517 0.726 Raza Jersey 1.111 0.759 – 1.626 0.587 Normando 0.220 0.138 – 0.351 0.000 Los resultados se presentan como “Odds Ratio” (OR) no ajustados e intervalo de confianza (IC) del 95%.

De 651 hembras preñadas mediante monta natural, el 32.6 % (212) fueron seropositivas al VLEB, mientras que, de 525 vacas preñadas por inseminación artificial, el 30.8 % (162) presentaron anticuerpos contra el virus. Sin embargo, ninguna de estas variables presentó asociación estadística significativa con la presentación de la enfermedad (P>0.05). En cuanto a las características del ordeño implementadas en las explotaciones, de las hembras sometidas a ordeño manual, el 30.5 % (210/688) fueron seropositivas a la enfermedad, mientras que, de los bovinos ordeñados de forma mecánica, el 31.7 % (91/446) presentaron anticuerpos contra el virus. Finalmente cabe resaltar que no se presentó asociación estadística entre la seropositividad a la enfermedad y el tipo de ordeño implementado (P≥0.05).

204


Rev Mex Cienc Pecu 2022;13(1):200-210

Discusión Son diversos los estudios realizados en LEB a nivel nacional. Se han reportado prevalencias del 24.9 % en la región Andina, 14.4 % para el Caribe, 15.3 % en el Piedemonte Llanero y del 1.5 % en Córdoba mediante la técnica de inmunodifusión(20). Por otro lado, implementando la técnica de ELISA en Pasto la prevalencia encontrada fue del 19.8 %(21), 15 % en Yopal(22), 13.5 % en Toca (Boyacá)(8), 16.32 % y 16.07 % en Patía y Mercaderes (Cauca)(23). Finalmente, mediante pruebas moleculares se estableció la distribución departamental de la enfermedad por animal y granja evaluada en Cundinamarca (69 y 90 %), Boyacá (71 y 94 %), Antioquia (73 y 100 %), Meta (85 y 100 %), Nariño (14 y 75 %) y Cesar (17 y 75 %)(24). A nivel internacional las prevalencias son variables, tras la implementación de la técnica ELISA se han establecido valores de 14.6 % en Chile(25), 92.7 % y 46.38 % en Perú(1,26), 5.6 % en Ecuador(27), del 11 al 100 % en Tailandia(28). Cabe resaltar que la variación en los resultados puede darse por la cantidad de animales muestreados y las técnicas implementadas para el diagnóstico de la enfermedad. Sumado a esto, se debe tener en cuenta la forma de transmisión del virus, la cual puede darse a través de la leche y objetos que se encuentren contaminados con linfocitos infectados, por lo que las prácticas sanitarias y de manejo implementadas en cada hato muestreado, podrían influir en la transferencia del virus de un animal a otro(6). Con respecto a las razas, en el presente estudio se encontró mayor seroprevalencia en la raza Jersey. Esto difiere de los resultados obtenidos por Romero et al en el 2015(29), en donde esta raza presentó una prevalencia de 11.9 %. Así mismo, durante este estudio se encontraron diferencias estadísticas significativas entre esta variable y la presentación de anticuerpos contra el virus, resultados que concuerdan con los reportados por Hernandez et al (30) quienes afirman que existe una fuerte dependencia entre el grupo racial y la seropositividad medida por ELISA (P<0.01). Sin embargo, lo anterior no coincide con lo reportado por otros investigadores(31), quienes determinan que no hay una asociación entre la variable raza y la presencia de LEB. Por otro lado, la raza Normando tiene menores posibilidades de presentar la enfermedad con respecto a los individuos de las demás razas, lo que indica que actúa como un factor de protección frente al VLEB. Esto se podría presentar en primera medida debido a que los individuos de esta raza cuentan con características raciales que los hacen menos susceptibles a diferentes patologías y además, al no ser considerada como un biotipo racial específico para la producción de leche, tiene menores posibilidades de presentar el virus, ya que se debe tener en cuenta que las razas lecheras son más susceptibles a la presencia de la enfermedad como lo reportan otros estudios(7,10,32). Sumado a lo anterior, es importante resaltar que el estudio desarrollado por Hernández et al(30) indica un fuerte efecto racial sobre la dinámica de la infección con el VLEB, en

205


Rev Mex Cienc Pecu 2022;13(1):200-210

donde el ganado criollo como el Harton del Valle presentó una menor tasa de infección con el virus, los animales que se infectaron desarrollaron menos linfocitosis, tuvieron una respuesta inmune más alta y mantuvieron una carga proviral más baja en comparación con la raza Holstein. En cuanto a la edad, se presentaron diferencias estadísticas significativas, lo que concuerda con lo afirmado por Betancur y Rodas(31), quienes identificaron una mayor frecuencia de infección dependiendo del intervalo de edad. Así mismo, Hernández et al(30) establecieron que la presencia del VLEB depende de la edad del animal; las hembras entre 3 y 4 años de edad, presentaron la seroprevalencia más alta, tras la implementación de técnicas moleculares y ELISA determinaron que los animales mayores de 4 años presentaron porcentajes de infección más altos, observándose una marcada reducción de las prevalencias en animales más jóvenes. De esta manera se puede establecer que existe mayor susceptibilidad al virus a medida que aumenta la edad del animal, lo que podría explicarse por la existencia de exposición acumulada al virus al mantenerse el contacto con animales infectados(31,33). Sumado a esto, Gutiérrez et al(34) indican que la inmunidad pasiva en animales jóvenes puede alterar los porcentajes de infección medidos por ELISA en un hato con alta prevalencia del VLEB. Por otro lado, los factores de riesgo que predisponen a la presencia de la enfermedad pueden estar dados principalmente por el manejo y las prácticas que se llevan a cabo en cada una de las fincas, siendo éste un aspecto a tener en cuenta para prevenir la presentación de la enfermedad y controlar su propagación(8,22). A pesar que en el presente estudio no se encontró asociación estadística significativa con las variables reproductivas evaluadas, se estableció que existe una alta seroprevalencia del virus en hembras que son preñadas con monta natural (32.6 %). Lo anterior se debe a que la transmisión horizontal se da principalmente debido a la presencia de linfocitos infectados en fluidos biológicos como el semen(35). Además, Bonifas y Ulcuango(27) determinaron que la monta directa contribuye a la propagación de la infección por la utilización de toros positivos a LEB. Sumado a esto el examen rectal es una ruta potencial de transmisión del virus, pero la transmisión está relacionada con otros factores, como el número de palpaciones con un guante común, el nivel de contaminación del guante con linfocitos infectados y la edad de los animales(36). Al relacionar la enfermedad con el tipo de ordeño de las explotaciones, no se encontraron diferencias estadísticas significativas entre esta variable y la enfermedad. Sin embargo, el 30.5 y 31.7 % de los bovinos sometidos a ordeño manual y mecánico respectivamente, fueron seropositivos al VLEB. Estudios previos, han reportado que en las ganaderías de producción de leche al presentar diferentes tipos de ordeño, se requiere mayor intervención durante este proceso, facilitando la diseminación iatrogénica de partículas virales a través de leche, equipos o manos de los operarios, generando que las hembras sean más propensas a la presentación de la enfermedad(5,37,38,39).

206


Rev Mex Cienc Pecu 2022;13(1):200-210

Conclusiones e implicaciones Se determinó alta seroprevalencia del VLEB en hembras bovinas del municipio de Paipa (Boyacá), encontrándose asociación estadística con la raza y la edad de los individuos evaluados. Se considera que el diagnóstico precoz de la enfermedad permitirá establecer programas eficaces de control de la misma, previniendo la propagación del virus en la región. Sumado a esto, se requiere investigación futura que permita comparar las influencias de cada factor de riesgo (tipo de descorne, implementación de agujas hipodérmicas, modo de implementación de mangas de palpación, tamaño de los hatos, entre otras) responsable de la transmisión dentro del hato, contribuyendo así a la probabilidad de que la enfermedad llegue a tener bajas proporciones epidémicas a futuro. Conflicto de intereses Los autores del presente artículo declaran que no existe ningún tipo de conflicto de intereses, ni ninguna relación económica, personal, política, interés financiero, ni académico que pueda influir en el juicio de los mismos. Literatura citada: 1. Sandoval MR, Delgado CA, Ruiz GL, Ramos CO. Determinación de la Seroprevalencia del Virus de la Leucemia Bovina en Lima, Perú. Rev Investig Vet del Perú 2015;26(1):152–158. 2. Vásconez-Hernández A, Sandoval-Valencia P, Puga-Torres B, De La Cueva-Jácome F. Seroprevalencia de leucosis enzoótica bovina en animales entre 6 a 24 meses en las provincias de Manabí, Pichincha y Chimborazo - Ecuador. La Granja 2017;26(2):131–141. 3.Buitrago-Mejia JA, Salzar-Torres LM. Virus de Leucosis Bovina (VLB): Una revisión. Sinergia 2018;3:130–151. 4.Algorta-Turini A, Alvarez-Albanell JP, De Brun-Mnéndez ML. Transmisión de la Leucosis Bovina Enzoótica en un campo de recría de ganado lechero en el sur del Uruguay [tesis doctorado]. Uruguay: Universidad de la República; 2014. 5.Gutiérrez G, Rodríguez SM, De Brogniez A, Gillet N, Golime R, Burny A, et al. Vaccination against δ-retroviruses: The bovine leukemia virus paradigm. Viruses 2014;6(6):2416–2427. 6.Nekouei O, VanLeeuwen J, Sanchez J, Kelton D, Tiwari A, Keefe G. Herd-level risk factors for infection with bovine leukemia virus in Canadian dairy herds. Prev Vet Med 2015;119(3–4):105–113.

207


Rev Mex Cienc Pecu 2022;13(1):200-210

7.Úsuga-Monroy C, Echeverri JJ, López-Herrera A. El componente racial influencia la resistencia a la infección con el virus de la leucosis bovina. Rev Fac Med Vet Zootec 2018;65(2):130–139. 8.Pulido-Medellín M, González-Ariza W, Bayona H, Chavarro-Tulcán G. Determinación de Leucosis Enzoótica Bovina mediante las claves hematológicas de Göttingen y Elisa en Boyacá, Colombia. Rev Fac Ciencias Vet 2017;58(1):10–16. 9.Baruta DA, Ardoino SM, Brandan JL, Sosa RE, Mariani EL, Albretch EM. Leucosis Enzoótica Bovina. Cienc Vet 2011;13(1):9–16. 10.Cadavid G. Impacto del virus de la leucosis bovina en la producción de leche. [tesis maestría]. Palmira, Colombia, Universidad Nacional de Colombia, Sede Palmira, 2012. 11.Erskine RJ, Bartlett PC, Byrem TM, Render CL, Febvay C, Houseman JT. Association between bovine leukemia virus, production, and population age in Michigan dairy herds. J Dairy Sci 2012;95(2):727–734. 12. Apaza J. Seroprevalencia de la Leucosis Viral Bovina (LVB) en vacunos de la raza Brown Swiss en tres asociaciones del distrito de Paucarcolla [tesis licenciatura]. Puno, Perú: Universidad Nacional del Altiplano; 2019. 13. Polat M, Takeshima S, Aida Y. Epidemiology and genetic diversity of bovine leukemia virus. Virol J 2017;14(209):1–16. 14. ICA. Resolución 3714 de 2015. Por la cual se establecen las enfermedades de declaración obligatoria en Colombia. 2015. https://www.ica.gov.co/getattachment/3188abb6-2297-44e289e63a5dbd4db210/2015R3714.aspx . 15. Tsutsui T, Kobayashi S, Hayama Y, Yamamoto T. Fraction of bovine leukemia virusinfected dairy cattle developing enzootic bovine leukosis. Prev Vet Med 2016;124:96–101. 16. Monge-Rojas CR, Elizondo-Salazar JA. La leucosis enzoótica bovina: un asesino silencioso. Nutr Anim Trop 2019;13(1):38–54. 17. Alcaldía Municipal P. Descripción Paipa, Boyacá. 2019. http://www.paipaboyaca.gov.co/MiMunicipio/Paginas/Economia.aspx. 18. ICA. Censo Pecuario Nacional año 2019 [Internet]. 2019. Disponible en: ttps://www.ica.gov.co/areas/pecuaria/servicios/epidemiologia-veterinaria/censos2016/censo-2018. 19. Figueredo M, Pompei A, Martini M. Manual veterinario de toma y envío de muestras. 2017.

208


Rev Mex Cienc Pecu 2022;13(1):200-210

20. Orjuela J. NM, Betancourt L. Salud y productividad en bovinos de la costa norte de Colombia. 2009. http://www.fao.org/3/u5700T07.htm. 21. Benavides-Benavides B, Cedeño-Quevedo DA, Serrano-de La Cruz MF. Epidemiological study of bovine leukemia virus in dairy cows in six herds in the municipality of Pasto, Nariño. Rev Lasallista Investig 2013;10(1):18–26. 22. Bautista RNA, Nova RYA, Pulido-Medellín MO, Andrade-Becerra RJ. Determinación serológica de leucosis bovina enzoótica en novillas de levante y vacas adultas de la vereda Morichal, Yopal, Casanare. Cienc Agric 2013;10(1):31–37. 23. Alvira HC, Velasco JA. Prevalencia del virus de la leucosis bovina (VLB) en los municipios de Patía y Mercaderes [tesis licenciatura]. Popayán, Cauca, Colombia, Universidad del Cauca; 2019. 24. Corredor-Figueroa AP, Salas S, Olaya-Galán NN, Quintero JS, Fajardo Á, Soñora M, et al. Prevalence and molecular epidemiology of bovine leukemia virus in Colombian cattle. Infect Genet Evol 2020;80:104171. 25. Grau MA, Monti G. Prevalencia serológica predial e intrapredial para el virus de la leucosis bovina (VLB) en lecherías de las regiones de Los Ríos y de Los Lagos de Chile. Arch Med Vet 2010;42(2):87–91. 26. Orellana MA. Determinación del status sanitario de Leucosis Bovina mediante la seroprevalencia a través de ELISA competitivo en un hato lechero en la provincia de Carchi [tesis licenciatura]. Florencia, Caquetá, Colombia: Universidad de la Amazonía; 2019. 27. Bonifas N, Ulcuango F. Prevalencia de Leucosis Bovina en la Comunidad Santo Domingo No1, Cayambe-Ecuador 2012. Rev Ciencias la Vida 2015;22(2):33–39. 28. Lee E, Kim E, Ratthanophart J, Vitoonpong R, Kim B, Cho I, Song J, Lee K, Shin Y. Infection, genetics and evolution molecular epidemiological and serological studies of bovine leukemia virus (BLV) infection in Thailand cattle. Infect Genet Evol 2016;41:245–254. 29. Romero JJ, Dávila G, Beita G, Dolz G. Relación entre el estado serológico a leucosis bovina enzoótica y parámetros reproductivos en hatos lecheros especializados de Costa Rica. Agron Costarric 2015;39(2). 30. Hernandez D, Muñoz J, Álvarez L. Dinámica de la leucosis bovina en el ganado criollo Hartón del Valle en infección natural. Arch Zootec 2016;65(251):365–373. 31. Betancur HC, Rodas GJ. Seroprevalencia del virus de la Leucosis Viral Bovina en animales con trastornos reproductivos de Montería. Rev MVZ Córdoba 2008;13(1):1197–1204.

209


Rev Mex Cienc Pecu 2022;13(1):200-210

32. Andreolla AP, Scheer Erpen LM, Frandoloso R, Kreutz LC. Development of an indirect ELISA based on recombinant capsid protein to detect antibodies to bovine leukemia virus. Brazilian J Microbiol 2018;49:68–75. 33. Carrero-Rojas JL, Arévalo-Martínez F, Tarazona-Suárez A, Cepeda BM. Prevalencia de la seropositividad a la leucosis bovina mediante la técnica diagnóstica de ELISA indirecta en hatos lecheros situados en Mesa de los Santos, Santander. Spei Domus. 2009;5(11):6–11. 34. Gutiérrez G, Alvarez I, Politzki R, Lomónaco M, Dus Santos MJ, Rondelli F, Fondevila N, Trono K. Natural progression of Bovine Leukemia Virus infection in Argentinean dairy cattle. Vet Microbiol 2011;151(3–4):255–263. 35. Monti GE, Frankena K, De Jong MCM. Transmission of bovine leukaemia virus within dairy herds by simulation modelling. Epidemiol Infect 2007;135(5):722–732. 36. Radostits OM, Gay CC, Hinchcliff KW, Constable PD. Veterinary medicine: A textbook of the diseases of cattle, horses, sheep, pigs and goats. New York: Elsevier Saunders; 2006. 37. Úsuga-Monroy C, Echeverri J, López-Herrera H. Diagnóstico molecular del virus de leucosis bovina en una población de vacas Holstein, Colombia. Arch Zootec 2015;64(248):383–388 38. Chamizo PEG. Leucosis Bovina Enzootica: Revisión. Rev Electron Vet 2005;6(7):1– 25. 39. Hernández-Herrera DY, Posso-Terranova AM, Benavides JA, Muñoz-Flórez JE, Giovambattista G, Álvarez-Franco LA. Bovine leukosis virus detection in Creole Colombian breeds using nested-PCR. Acta Agronómica 2011;60(4):311–317.

210


https://doi.org/10.22319/rmcp.v13i1.5882 Artículo

Parámetros hematológicos, bioquímicos y endocrinos en la respuesta aguda al ejercicio de intensidad creciente en caballos de Paso colombianos

Angélica María Zuluaga Cabrera a* Maria José Casas Soto b José Ramón Martínez Aranzales a Viviana Elena Castillo Vanegas c Nathalia María del Pilar Correa Valencia a María Patricia Arias Gutierrez d

a

Grupo de Investigación CENTAURO, Escuela de Medicina Veterinaria, Universidad de Antioquia, Medellín, Colombia. b

Normandía Centro Equino, Rionegro, Colombia.

c

Laboratorio Clínico Veterinario Vitalab. Rionegro, Colombia.

d

Universidad CES, Facultad de Medicina Veterinaria y Zootecnia, Medellín, Colombia.

*

Autor de correspondencia: angelica.zuluaga@udea.edu.co

Resumen: El presente estudio tuvo como objetivo describir los parámetros hematológicos, bioquímicos y endocrinos en la respuesta aguda al ejercicio de intensidad creciente en caballos de Paso colombianos (CPC). Se realizó una prueba estandarizada de ejercicio de campo en 11 CPC adultos no entrenados de ambos sexos. Las variables de interés se midieron antes y después de la prueba (esto es, hematocrito, proteínas plasmáticas totales, creatina quinasa, creatinina, nitrógeno ureico en sangre —NUS, aspartato aminotransferasa, gamma glutamil transpeptidasa, triglicéridos, colesterol, fosfatasa alcalina, cortisol, insulina, niveles de

211


Rev Mex Cienc Pecu 2022;13(1):211-224

azúcar en sangre). Se encontró evidencia de activación de la respuesta simpática-adrenérgica, descrita para otras razas y disciplinas deportivas ecuestres (esto es, hemoconcentración, cambio negativo en el volumen plasmático, ligero aumento de la creatinina y NUS). Además, se encontró evidencia de movilización y uso de fuentes de energía como glucosa y triglicéridos. En conclusión, el ejercicio de intensidad creciente realizado durante una prueba de campo estandarizada produjo un cambio negativo en el volumen plasmático y la activación de la clásica respuesta simpática-adrenérgica en los CPC. Palabras clave: Patología clínica, Equino, Contracción esplénica, Entrenamiento.

Recibido: 25/11/2020 Aceptado: 08/06/2021

Introducción Las pruebas estandarizadas de ejercicio en cinta de correr o de campo han permitido identificar las respuestas y adaptaciones fisiológicas al ejercicio del caballo. Su caracterización e interpretación se convertirían más tarde en índices de entrenamiento(1,2). Los parámetros hematológicos y bioquímicos se incluyen dentro del grupo de variables de interés a evaluar a partir de dichas pruebas de ejercicio. Sin embargo, lo reportado al respecto en caballos puede diferir según la intensidad y duración del ejercicio(3,4). Además, algunos hallazgos no son considerados como respuestas o adaptaciones fisiológicas, sino como trastornos inducidos por el ejercicio, incluyendo hemólisis y linfopenia(5). En caballos de Paso colombianos (CPC), no hay suficientes reportes para confirmar los cambios esperados durante el ejercicio en animales de esta raza. Debido a la creciente demanda de acompañamiento profesional en el entrenamiento de CPC, se volvió importante describir los parámetros hematológicos, bioquímicos y endocrinos en la respuesta aguda al ejercicio de intensidad creciente para la raza.

Material y métodos Consideraciones éticas Los procedimientos realizados en los animales de estudio fueron aprobados por el Comité de Ética para la Experimentación con Animales (CEEA) de la Universidad de Antioquia (Ley #122, 5 de febrero de 2018). 212


Rev Mex Cienc Pecu 2022;13(1):211-224

Ubicación del estudio El estudio se llevó a cabo en instalaciones ubicadas en una zona de vida de bosque montano bajo muy húmedo(6) (2,130 msnm), con una temperatura ambiental entre 12 y 18 °C, y una humedad relativa del 96 %.

Animales Se eligieron a conveniencia once (11) CPC adultos no entrenados. Se incluyeron nueve hembras no preñadas y dos machos no castrados, con una media de 6.6 ± 4.8 (2.5 a 16) años de edad, 371 ± 30 kg de peso y 7/9(7) de condición corporal. Los animales estaban clínicamente sanos en el examen físico, con un plan de salud completo y actualizado (vacunas y desparasitación) al momento de las mediciones. En cuanto a las condiciones de manejo, los animales estuvieron bajo alojamiento completo y se alimentaron con heno de pasto pangola (Digitaria eriantha; 2.5 kg/d en promedio), forraje verde (Pennisetum purpureum; 30 kg/d en promedio), alimento comercial balanceado (2 kg/d en promedio), sal mineral formulada para caballos (100 g/d) y agua ad libitum.

Prueba de ejercicio de campo Se realizó una prueba estandarizada de ejercicio de campo y estuvo compuesta por cuatro etapas con intensidad creciente, considerando también momentos de reposo y recuperación. La frecuencia cardíaca (FC) se midió utilizando un monitor de referencia Ambit 3 vertical (Suunto®, Finlandia). El protocolo utilizado(8) controló la intensidad del ejercicio en cada etapa (calentamiento, de 58 a 65 % de la FC máxima + intensidad moderada, de 65 a 75 % de la FC máxima + intensidad alta, de 75 a 85 % de la FC máxima + intensidad máxima, ≥ 85 % de la FC máxima).

Definición de los parámetros hematológicos, bioquímicos y endocrinos Se recolectó una muestra de sangre venosa en un tubo con EDTA para la medición de hematocrito (HTC) y proteínas plasmáticas totales (PPT) durante los momentos de reposo y al final de cada etapa de la prueba de ejercicio. El porcentaje de cambio en el volumen plasmático se determinó por la concentración de albúmina en el momento de reposo y al final de la prueba de ejercicio(9). Además, se tomaron muestras tanto en un tubo con EDTA como en uno seco, en los momentos de reposo y de máxima intensidad para el comportamiento del conteo sanguíneo completo [CSC; esto es, concentración total de eritrocitos, leucocitos, neutrófilos, linfocitos, basófilos, monocitos, eosinófilos, bandas, plaquetas, hemoglobina, concentración de

213


Rev Mex Cienc Pecu 2022;13(1):211-224

hemoglobina corpuscular media (CHCM), fibrinógeno], y química sanguínea (esto es, creatina quinasa (CQ), creatinina, nitrógeno ureico en sangre (NUS), aspartato aminotransferasa (AST), gamma glutamil transpeptidasa (GGT), triglicéridos, colesterol, fosfatasa alcalina (FA)], hormonas (esto es, cortisol, insulina) y niveles de glucosa en sangre.

Análisis estadísticos

Los resultados descriptivos de los datos no paramétricos se reportaron como mediana (ME), rango intercuartílico (RIC), desviación estándar (DE) y coeficiente de variación (CV) para cada variable. Se utilizó la prueba de rango con signo de Wilcoxon o la prueba u para muestras pareadas (alternativa no paramétrica a la prueba t) con un nivel de confianza del 95 % para comparar el rango medio de dos muestras relacionadas o pareadas para cada caballo en el estudio y para cada variable de interés. Para todos los análisis se utilizó el software estadístico Stata 16.0 (StataCorp, 2020, College Station, Texas, EE. UU.).

Resultados Hematocrito, proteínas plasmáticas totales y volumen plasmático El comportamiento del HTC durante la prueba de ejercicio fue consistente y homogéneo entre los animales de estudio, como lo demuestran los valores bajos de la DE para todas las variables (Cuadro 1). Por otro lado, las PPT mostraron ligeros cambios durante cada etapa de la prueba de ejercicio. La albúmina se analizó por separado y, dados los valores de las PPT, sus valores fueron relativamente homogéneos. El cambio medio del volumen plasmático fue de -4.65 ± 8.16 L, aunque tres de los animales registraron un cambio positivo.

214


Rev Mex Cienc Pecu 2022;13(1):211-224

Cuadro 1: Resultados descriptivos de los valores de hematocrito, proteínas plasmáticas totales y albúmina en cada etapa de la prueba de ejercicio de campo realizada en los caballos Paso colombianos de estudio Proteínas plasmáticas totales (g/dl)

Hematocrito (%) Momento/ Etapa Reposo

ME (RIC)

DE

CV

ME (RIC)

DE

CV

Albúmina (g/dl) ME (RIC)

DE

CV

37.9 (36.4 - 4.52 0.11 6.52 (6.0 - 6.6) 0.42 0.07 3.42 (3.30 - 0.18 0.05 43.8) 3.47) Calentamiento 42.0 (37.0 - 4.62 0.11 6.62 (6.34 - 0.41 0.06 3.51 (3.44 - 0.28 0.08 42.5) 7.05) 3.94) Intensidad 48.0 (46.0 - 5.09 0.11 6.96 (6.25 - 0.46 0.07 3.63 (3.57 - 0.36 0.10 moderada 52.6) 7.06) 4.15) Intensidad alta 49.7 (47.0 - 4.60 0.09 7.14 (6.32 - 0.49 0.07 3.69 (3.60 - 0.23 0.06 53.9) 7.25) 3.99) Intensidad 51.4 (50.3 - 3.67 0.07 7.03 (6.49 - 0.48 0.07 3.65 (3.63 - 0.18 0.05 máxima 54.8) 7.13) 4.00) Recuperación 41.5 (41.0 - 2.81 0.07 6.77 (6.07 - 0.49 0.07 3.60 (3.49 - 0.24 0.07 44.9) 7.13) 3.94) ME= media; RIC= rango intercuartilico; DE= desviación estándar; CV= coeficiente de variación. Valor de referencia para hematocrito(10)= 32 - 47%; valor de referencia para proteínas plasmáticas totales(11)= 5.2 - 7.9 g/dl; valor de referencia para albúmina(11)= 2.6 - 3.7 g/dl.

Parámetros hematológicos En los parámetros hematológicos antes y después de la prueba de ejercicio, hubo cambios en el fibrinógeno (P= 0.004), la concentración total de leucocitos (P= 0.0475) y las bandas (P= 0.0002) (Cuadro 2). Cuadro 2: Parámetros hematológicos con resultados estadísticos significativos, medidos antes y después de la prueba de ejercicio de campo realizada en los caballos de Paso colombianos de estudio Parámetro hematológico Momento ME (RIC) DE CV Valor de ref. (10)

Concentración total de leucocitos, 103/mm3

Antes Después Antes Después

200 (200 – 600) 200 (200 – 500) 8.2 (7.1 – 10.5) 9.3 (8 – 12.2)

Concentración total de bandas, 103/mm3

Antes Después

0.0 (0.0 – 0.08) 0.09 0.0 (0.0 – 0.08) 0.06

Fibrinógeno, mg/dl

214.9 206.7 1.91 2.26

0.58 100 - 500 0.58 0.21 5.2 - 12.1 0.23 1.95 0 - 14 2.5

ME= media; RIC= rango intercuartílico; DE= desviación estándar; CV= coeficiente de variación.

215


Rev Mex Cienc Pecu 2022;13(1):211-224

Parámetros bioquímicos Los parámetros bioquímicos no fueron diferentes (P>0.05) para las etapas mencionadas, con excepción de la FA. Sin embargo, algunas enzimas mostraron una mayor actividad en relación con la concentración fisiológica (esto es, CQ, AST), como se presenta en el Cuadro 3. Cuadro 3: Parámetros bioquímicos medidos antes y después de la prueba de ejercicio de campo realizada en los caballos de Paso colombianos de estudio Valor de Parámetro bioquímico Momento ME (RIC) DE CV ref. 250 (196 - 293) 56.01 0.224 90 - 270(12) 279 (247 - 337) 79.11 0.263 Creatinina, mg/dl 1.54 (1.44 - 1.62) 0.150 0.098 1.2 - 1.9(11) 1.71 (1.62 - 1.99) 0.316 0.175 Nitrógeno ureico en 22.48 (20.37 2.35 0.105 8 - 27(12) sangre, mg/dl 24.45) Después 23.7 (22.54 2.487 0.103 26.7) Aspartato Antes 294 (263 - 341) 56.01 0.186 226 - 366(11) aminotransferas, U/L Después 61.73 0.189 320 (270 - 356) Gamma glutamil Antes 15 (11.31 - 23.92) 5.49 0.338 4.3 - 13.4(11) transpeptidasa, U/L Después 18 (16 - 24.51) 6.55 0.322 Triglicéridos, mg/dl Antes 26.12 (15.5 23.35 0.707 11 - 52(12) 35.8) Después 0.280 54.3 (35.1 - 63.9) 14.26 Colesterol, mg/dl Antes 114.1 (90.05 23.10 0.213 51 - 109(12) 123.6) Después 102.25 (58.3 40.60 0.393 131.15) Fosfatasa alcalina, U/L Antes 343.21 (320.7 139.06 0.365 109 - 315(12) 541) a Después 335.05 (321.9 131.90 0.335 488.18) b ME= media; RIC= rango intercuartílico; DE= desviación estándar; CV= coeficiente de variación. ab Diferencia significativa cuando se comparó cada parámetro antes y después de la prueba de ejercicio, según el análisis de rango con signo de Wilcoxon (P<0.05). Creatina quinasa, U/L

Antes Después Antes Después Antes

Parámetros endocrinos (hormonas y glucemia) El Cuadro 4 muestra los perfiles hormonales y los niveles de glucosa en sangre obtenidos durante el estudio, que fueron similares (P>0.05) para las etapas mencionadas.

216


Rev Mex Cienc Pecu 2022;13(1):211-224

Cuadro 4: Comportamiento de cortisol, insulina y glucosa antes y después de la prueba de ejercicio de campo realizada en los caballos de Paso colombianos de estudio Parámetro endocrino Cortisol, μg/dl

Insulina, UI/ml

Glucosa, mg/dl

ab

Momento

ME (RIC)

DE

CV

Antes

7.91 (2.21 - 14.39)

6.781

0.780

Después

7.04 (5.19 - 9.61)

7.318

0.773

Antes

40.98 (19.16 - 55.96)

50.84

1.067

Después

26.47 (22.92 - 54.56)

18.60

0.535

Antes

101 (85 - 153)a

35.69

0.313

Después

134 (101 - 162)b

37.89

0.286

Valor de referencia 3.0 - 13(13)

4.52 -33.53(14)

71 - 130(14)

ME= media, RIC= rango intercuartílico; DE= desviación estándar; CV= coeficiente de variación. Diferencia significativa cuando se comparó cada parámetro antes y después de la prueba de ejercicio, según el análisis de rango con signo de Wilcoxon (P>0.05).

Discusión Las respuestas agudas al ejercicio, tanto hematológicas, bioquímicas y endocrinas, han sido escasamente reportadas en CPC. Por lo tanto, los cambios fisiológicos agudos que ocurren durante el ejercicio en esta raza no se reconocen actualmente. Esta situación representa una desventaja para los profesionales que participan en los procesos de acondicionamiento deportivo, ya que los obliga a trabajar con base en referencias que no corresponden al contexto de los CPC. Por otro lado, la ausencia de dicha información permite la interpretación errónea de los hallazgos en los análisis de sangre, aunque algunas de las variaciones hematológicas y bioquímicas proporcionan una perspectiva significativa de las condiciones patológicas que ocurren por el ejercicio intenso(15). Además, es importante considerar que las respuestas hematológicas, bioquímicas y endocrinas por sí mismas no describen la capacidad atlética del caballo; de hecho, no se ha encontrado que parámetros como el HTC estén correlacionados con indicadores metabólicos, por ejemplo, el umbral anaeróbico(16). Es pertinente aclarar que los valores de referencia considerados para el presente estudio se contrastaron con estudios previos realizados en animales de la misma raza. Lo anterior corresponde a los valores de hemoleucograma(10), cortisol y concentración de insulina(12-14). Las otras variables se contrastaron con la literatura(11,12). El HTC se midió y no se calculó, a pesar de utilizar equipos automatizados. El ejercicio es un evento de estrés fisiológico, por esta razón se espera que el HTC aumente, principalmente en intensidad moderada, alta y máxima, como ocurrió en los animales del presente estudio, superando los valores de referencia para el reposo durante las etapas 217


Rev Mex Cienc Pecu 2022;13(1):211-224

mencionadas. El comportamiento observado para el HTC se explica por la contracción esplénica y la pérdida de agua durante el ejercicio, lo que refleja la hemoconcentración. Se necesitan de 30 a 60 segundos para que se produzca la liberación esplénica de eritrocitos en presencia de un aumento de la epinefrina circulante. Durante la recuperación, el secuestro de eritrocitos y leucocitos por el bazo dura aproximadamente 5 min, aunque su reserva completa puede tardar hasta 30 min(15). Así, el retorno del HTC a su valor en reposo o durante el calentamiento se explica por este fenómeno, además de la recuperación del volumen sanguíneo. En vista del hecho de que el HTC es muy afectado por la respuesta adrenérgica durante el ejercicio (para establecer policitemia por deshidratación), se recomienda incluir la concentración total de eritrocitos en el análisis y compararla con el HTC y la concentración de PPT. En este grupo de caballos se encontraron ambos eventos (hemoconcentración por liberación esplénica y disminución del volumen plasmático), como consecuencia de la deshidratación. Las PPT y la albúmina mostraron un comportamiento creciente durante el ejercicio y se encontró que estaban incrementados (dentro del rango de referencia) debido a la pérdida de agua antes mencionada. La concentración de proteínas plasmáticas en reposo y durante el ejercicio es el resultado de la interacción de numerosos factores, como el grado de filtración entre los espacios intra y extravascular, las demandas metabólicas, el control neuroendocrino, el estado nutricional y el balance hídrico(17). El cambio de volumen plasmático encontrado en el presente estudio puede estar relacionado con el movimiento de fluidos entre los diferentes compartimentos, dado el aumento de la presión hidrostática generado por el aumento de la presión arterial y venosa durante el ejercicio. Además, podría estar relacionado con la secreción de péptido natriurético, a medida que aumenta la intensidad del ejercicio(15). En humanos, se ha informado que el volumen plasmático puede disminuir debido a la hemoconcentración o incluso aumentar debido a la hemodilución, dependiendo del tipo de ejercicio realizado. La disminución del volumen plasmático es mayor durante el ejercicio de alta intensidad(18,19), y la magnitud de la sudoración e hidratación durante el ejercicio también puede determinar su disminución(20). En el presente estudio, se observó una reducción en el volumen plasmático al final de la prueba de ejercicio, cuando los caballos mostraron sudoración profusa. Esto corrobora que, al igual que en los humanos, el ejercicio de alta intensidad y la sudoración reducen este parámetro. Un estudio previo reportó un aumento de 5.12 % en el volumen plasmático en caballos de resistencia que compitieron en una carrera de 80 km, hidratados con 30 L de una solución con cloruro de sodio y cloruro de potasio, mientras que, en caballos hidratados (con 10 L de 218


Rev Mex Cienc Pecu 2022;13(1):211-224

la misma solución), se observó una disminución en el volumen plasmático de -2.34 %(21). En este estudio, el cambio en el volumen plasmático fue del -4.65 %, lo que se esperaba, ya que los caballos no se hidrataron hasta el final de la prueba de ejercicio y se completó el muestreo. Las fuerzas de Starling explican estos hallazgos basándose en los cambios en las presiones hidrostática y oncótica en los compartimentos vascular e intersticial. Durante la actividad física, se produce una redistribución del gasto cardíaco. El flujo sanguíneo al sistema musculoesquelético activo y al tejido de la piel aumenta, y el aumento de la presión hidrostática capilar favorece el paso de agua e incluso proteínas al compartimento intersticial. Estos eventos explican cómo el movimiento de fluidos afecta el volumen plasmático durante el ejercicio(19). El leucograma obtenido de los animales en el presente estudio fue significativamente diferente cuando se compararon los valores obtenidos en las etapas de reposo y recuperación. Los leucocitos muestran alteraciones transitorias en respuesta al aumento del tono simpático. Cuando se almacena con glóbulos rojos en el bazo, la contracción esplénica puede conducir a un aumento en el recuento de aproximadamente un 30 %(15). Sin embargo, su aumento no es un indicador de condición física, sino que es la relación neutrófilos:linfocitos (10:1) con un desplazamiento hacia la izquierda, es un signo de agotamiento, estrés o sobreentrenamiento. En los caballos del presente estudio, se encontraron bandas en tres de los animales, sin cambios en la relación neutrófilos:linfocitos. No se consideró un hallazgo patológico, ya que los valores estaban dentro del rango de referencia, y no se acompañó de otros cambios en el leucograma o en el examen clínico. Además, valores en torno al 50 % del total de neutrófilos se secuestran en los lechos capilares del bazo y se conocen como pool marginal o reserva esplénica. Los neutrófilos marginados pueden ser movilizados bajo ciertas condiciones, incluyendo ejercicio, estrés, transporte y administración de corticosteroides exógenos o catecolaminas, causando variaciones en el leucograma(22). Dentro de los valores bioquímicos aquí analizados, se encontró que el fibrinógeno en algunos animales era notable. Debe tenerse en cuenta que el fibrinógeno es una proteína de fase aguda, considerada como un indicador no específico de inflamación(23). Se presume que algunos de los animales en el presente estudio experimentaron algún proceso relacionado con la inflamación en curso que no se reflejó en el examen clínico, ni pudo estar relacionado con los valores de leucocitos. Se entiende que el aumento de fibrinógeno está relacionado con procesos inflamatorios de origen infeccioso o no infeccioso, por lo que la relación albúmina:globulina puede aclarar el origen de dicho aumento. Además, el fibrinógeno sintetizado en el hígado en respuesta a un proceso inflamatorio puede permanecer aumentado, incluso cuando las lesiones se resolvieron hace varios días, registrando un pico entre 5 y 7 d después de la lesión. Por lo tanto, el fibrinógeno es un indicador de inflamación con hemoconcentración ausente.

219


Rev Mex Cienc Pecu 2022;13(1):211-224

Los análisis de bioquímica sanguínea de los animales en el presente estudio demostraron que el esfuerzo impreso en la prueba es suficiente para aumentar la actividad bioquímica muscular. Es recomendable añadir una medición posrecuperación para comprobar si el restablecimiento del volumen sanguíneo altera la concentración de analitos relacionados o si estos permanecen elevados como indicadores de lesión muscular. El tiempo elegible posterior a la prueba para detectar daños subyacentes debe anticiparse con base en el analito. En caballos de carrera, se sabe que 3 d después de una competencia, algunos valores hemáticos y bioquímicos aún no han regresado a su rango de referencia(24). La creatinina tiende a aumentar durante el ejercicio, debido a un mayor uso de fosfocreatina y gluconeogénesis, y una disminución de la tasa de filtración glomerular(15), siendo un indicador confiable del metabolismo muscular y la función renal. El mayor uso de fosfocreatina evidencia el trabajo de alta y máxima intensidad que los caballos de estudio experimentaron. El NUS no mostró una tendencia específica. Esto se esperaba de este parámetro ya que el NUS es el resultado del ciclo de la urea y el metabolismo de los productos nitrogenados obtenidos de la dieta. Además, se puede reabsorber en el túbulo contorneado proximal en aproximadamente un 30 %, por lo tanto, no es un buen indicador de funcionalidad ni es un buen índice de metabolismo a observar después del ejercicio. La CQ es la enzima encargada de hidrolizar la reacción que produce ADP y fosfocreatina a partir de ATP. Su aumento se asocia principalmente con un aumento de la permeabilidad celular debido a la acidosis o un aumento en el uso de ATP por parte del sistema musculoesquelético. El pico de su producción ocurre de 4 a 12 h después del evento que lo desencadena. Los animales en el presente estudio registraron un aumento en la concentración sanguínea de esta enzima; sin embargo, ningún animal registró un aumento relacionado con lesiones. No obstante, no se tomaron muestras durante el pico de liberación descrito, lo que limita la inferencia de esta enzima. A pesar de estar presente en varios órganos, el AST se utiliza como un marcador de lesión celular en el hígado o el sistema musculoesquelético. Su aumento debe ser de 5 a 100 veces mayor que el valor de referencia para ser útil desde el punto de vista clínico(15). Esto refuerza la premisa de que la prueba de ejercicio de campo aplicada a los animales del presente estudio no constituye una actividad nociva para el sistema musculoesquelético en caballos sanos sin entrenamiento previo. El análisis bioquímico también permitió el reconocimiento de las fuentes de energía que los caballos utilizaron para este tipo de esfuerzo. Se observó una mayor movilización de glucosa y triglicéridos. Durante el ejercicio, la glucólisis y la lipólisis se activan para obtener energía

220


Rev Mex Cienc Pecu 2022;13(1):211-224

para la contracción muscular(15,25), especialmente en condiciones aeróbicas, como ocurrió en el calentamiento y otras etapas de la prueba de ejercicio aquí utilizada. Es recomendable incluir la cuantificación de bilirrubina para verificar la presencia de ruptura de eritrocitos debido a la fragilidad de la membrana que puede ocurrir debido a cambios en el pH sanguíneo derivados del ejercicio. De ahí la importancia de acompañar este análisis con la medición de la CHCM. En el presente estudio, no se midió la bilirrubina, sin embargo, la CHCM se mantuvo dentro del rango de referencia. La actividad hormonal durante el ejercicio está relacionada con los requerimientos energéticos del cuerpo. La activación de respuestas endocrinas específicas es altamente dependiente de la intensidad y duración del ejercicio, que intentan preservar la vida del animal a través del uso de múltiples mecanismos metabólicos para proporcionar energía adicional para la contracción muscular(26). La glucogenólisis y la gluconeogénesis se activan durante el ejercicio, en parte, por la liberación de cortisol, hormona de crecimiento y catecolaminas(27), mientras que la secreción de insulina disminuye por la liberación de catecolaminas durante el ejercicio(15). En contraste, otros autores encontraron que el ejercicio no influye en la secreción de insulina(28). De acuerdo con los resultados del presente estudio, se encontró que esta hormona estuvo elevada antes y después de la prueba de ejercicio de campo. Por lo tanto, no se deben descartar trastornos metabólicos en los animales de estudio, que tenían “sobrepeso” en el momento de la prueba, de acuerdo con la evaluación de la condición corporal (7/9 en promedio). Los estímulos físicos y psicógenos asociados con el ejercicio inducen la síntesis y secreción de hormona adrenocorticotrópica (HACT), β-endorfinas y cortisol. Además, la vasopresina, liberada durante la actividad física, mejora la secreción de HACT. La medición del cortisol debe basarse en el ritmo circadiano y la raza, como se informó para los CPC(13). En caballos sin atletismo adecuado, los niveles séricos elevados de cortisol afectan la función de los leucocitos(15). Sin embargo, esta condición permanecerá mientras el ejercicio sea extenuante. Contrariamente a lo esperado, en el caso de los CPC de estudio, la concentración sérica de cortisol se mantuvo dentro de los intervalos de referencia, incluso después de la prueba de ejercicio, aunque con una concentración plasmática suficiente para explicar los efectos hiperglucémicos e hiperlipémicos observados. Los futuros estudios sobre la medicina deportiva de los CPC deben proponer la identificación de los cambios fisiológicos desencadenados por el esfuerzo físico, y así determinar el punto de partida para la detección de patologías o como punto de comparación tras la aplicación de un entrenamiento prescrito.

221


Rev Mex Cienc Pecu 2022;13(1):211-224

Conclusiones e implicaciones El ejercicio de intensidad creciente realizado por los CPC en el presente estudio produjo pérdida de agua, como lo demuestra el cambio en el volumen plasmático, con la consiguiente hemoconcentración, y el ligero aumento tanto de creatinina como de NUS. Las diferencias significativas observadas en el leucograma y el fibrinógeno aparentemente se produjeron por factores individuales de algunos animales. Por lo tanto, no se puede concluir si la prueba de ejercicio produce realmente respuestas fisiológicas en este sentido. Además, se encontró evidencia de respuesta anticipada al estrés a partir del valor de cortisol, en ausencia de lesión muscular. Los CPC considerados en el estudio fueron sospechosos de síndrome metabólico equino, aunque no fueron diagnosticados por ello. Estos factores deben tenerse en cuenta a la hora de interpretar las respuestas agudas y las adaptaciones derivadas del entrenamiento físico en caballos de esta raza. Agradecimientos A Normandía Centro Equino y Mervequus por permitir la experimentación con sus animales y a la estrategia de sostenibilidad del Grupo de Investigación CENTAURO (Universidad de Antioquia, Medellín, Colombia) y la Universidad CES (Medellín, Colombia) por el apoyo financiero. Conflicto de intereses Los autores declaran que no tienen conflicto de intereses. Literatura citada: 1. Fraipont A, Van Erck E, Ramery E, Fortier G, Lekeux P, Art T. Assessing fitness in endurance horses. Can Vet J 2012;53(3):311-314. 2. De Mare L, Boshuizen B, Plancke L, De Meeus C, De Bruijn M, Delesall C. Standardized exercise tests in horses: current situation and future perspectives. Vlaams Diergeneeskd Tijdschr 2017;86(2):63-72. 3. Lekeux P, Art T, Linden A, Desmecht D, Amory H. Heart rate, hematological and serum biochemical responses to show jumping. In: Persson SGB et al. ICEEP Publications: Equine exercise physiology 3. 1991:385-390. 4. Zobba R, Ardu M, Niccolini S, Cubeddu F, Dimauro C, Bonelli P, et al. Physical, hematological, and biochemical responses to acute intense exercise in polo horses. J Equine Vet Sci 2011;31(9):542-548.

222


Rev Mex Cienc Pecu 2022;13(1):211-224

5. Masini A, Tedeschi D, Baragli P, Sighieri PC, Lubas G. Exercise-induced intravascular haemolysis in standardbred horses. Comp Clin Path 2003;12:45-48. 6. Holdridge LR, Grenke WC, Hatheway WH, Liang T, Tosi JA. Forest environments in tropical life zones: a pilot study, Pergamon Press; 1971. 7. Henneke DR, Potter GD, Kreider JL, Yeates BF. Relationship between condition score, physical measurements and body fat percentage in mares. Equine Vet J 1983;15(4):371372. 8. Arias MP, Maya JS, Arango L. Efectos de dos protocolos de entrenamiento sobre el lactato sanguíneo en caballos de paso fino. Rev Med Vet Zoot 2019;66(3):219-230. 9. Van Beaumont W, Strand JC, Petrofsky JS, Hipskind SG, Greenleaf JE. Changes in total plasma content of electrolytes and proteins with maximal exercise. J Appl Physiol 1973;34(1):102-106. 10. Castillo CA, Tobón M, Cano CA, Mira J, Suárez AP, Vásquez EM. Valores hematológicos en caballos criollos colombianos del valle de Aburrá. In: Corporación Universitaria Lasallista editores. Perspectivas y avances de investigación de la serie Lasallista investigación y ciencia. 1st ed. Caldas, Antioquia, CO: Delasalle; 2010:245262. 11. Kaneko J, Harvey J, Bruss M. Clinical biochemistry of domestic animals. 6th ed. David, USA: Academic Press; 2008. 12. Southwood L. Practical Guide to Equine Colic. 1st ed. Iowa; USA: Wiley-Blackwell; 2013. 13. Zuluaga AM, Martínez JR. Serum cortisol concentration in the Colombian creole horse. Rev Colomb Cienc Pecu 2017;30(3):231-238. 14. Rosas M. Diagnóstico de síndrome metabólico equino y su asociación con signos clínicos de laminitis en el caballo criollo colombiano en la sabana de bogotá [master thesis]. Bogotá, DC: Universidad de la Salle; 2017. 15. Boffi F. Fisiología del ejercicio en equinos, 1st ed. Buenos Aires, Argentina: Intermédica; 2007. 16. Valette JP, Barrey E, Wolter R. Multivariate analysis of exercise parameters measured during an incremental treadmill test. In: Persson SGB et al. ICEEP Publications: Equine exercise physiology 3. 1991:337-342.

223


Rev Mex Cienc Pecu 2022;13(1):211-224

17. Mesa-Rojas MC. Análisis del comportamiento de los parámetros hematológicos en caballos que compiten en carreras de enduro a 2640 M.S.N.M. [undergraduate thesis]. Bogotá, DC: Universidad de La Salle; 2016. 18. Sawka MN, Convertino VA, Eichner ER, Schnieder SM, Young AJ. Blood volume: importance and adaptations to exercise training, environmental stresses, and trauma/sickness. Med Sci Sports Exerc 2000;32(2):332-348. 19. Sanchis-Gomar F, Lippi G. Physical activity - an important preanalytical variable. Biochem Med 2014;24(1):68-79. 20. Mora-Rodríguez R, Fernández VE, Hamouti N, Ortega JF. Skeletal muscle water and electrolytes following prolonged dehydrating exercise: Fluid losses in exercising skeletal muscle. Scand J Med Sci Sports 2014;25(3):274-282. 21. Sampieri F, Schott HC, Hinchcliff KW, Gero RJ, Cunilleras JE. Effects of oral electrolyte supplementation on endurance horses competing in 80 km rides. Equine Vet J 2006;38(36):19-26. 22. McKenzie EV. Hematology and serum biochemistry of the equine athlete. In: Kenneth H, Andris K, Raymond G editors. Equine sports medicine and surgery. 2nd ed. USA: Elsevier Health Science; 2014:921-929. 23. Polla BS, Cossarizza A. Stress proteins in inflammation. EXS 1996;77:375-391. 24. Bos A, Compagnie E, Lindner A. Effect of racing on blood variables in Standardbred horses. Vet Clin Pathol 2018;47(34):625-628. 25. Bayly WM, Allen JR, Gollnick PD. Equine exercise physiology I: energy production and substrate utilization. Equine Vet Sci 1984;4(3):114-118. 26. Hinchcliff KW, Geor RJ, Kaneps AJ. Equine exercise physiology: the science of exercise in the athletic horse, Elsevier Saunders; 2008. 27. López-Chicharro JL, Fernández-Vaquero A. Fisiología del ejercicio, Ed. Panamericana, 3ª ed. Buenos Aires, Paris. 2006. 28. Noble GK, Sillence MN. Diurnal rhythm and effects of feeding, exercise and recombinant equine growth hormone on serum insulin concentrations in the horse. Equine Vet J 2013;45(6):745-750.

224


https://doi.org/10.22319/rmcp.v13i1.5907 Artículo

Efecto del comportamiento higiénico sobre la resistencia a la cría calcárea (Ascosphaera apis) en colonias de abejas africanizadas (Apis mellifera)

Carlos Aurelio Medina-Flores a* Luis Abdelmir Medina Medina b Ernesto Guzmán-Novoa c

a

Universidad Autónoma de Zacatecas. Unidad Académica de Medicina Veterinaria y Zootecnia, Zacatecas, México. b

Universidad Autónoma de Yucatán. Departamento de Apicultura, Campus de Ciencias Biológicas y Agropecuarias. Carretera Mérida-Xmatkuil Km. 15.5, Mérida, Yucatán, Mexico. c

School of Environmental Sciences, University of Guelph, Guelph, Canada.

* Autor de correspondencia: carlosmedina@uaz.edu.mx

Resumen: El objetivo fue evaluar el comportamiento higiénico (CH) de abejas melíferas (Apis mellifera) africanizadas y su impacto en la resistencia a la ascosferosis causada por Ascosphaera apis. Se evaluó el CH y la población de abejas adultas y de cría de 50 colonias. Además, colonias con alto (>95 %) y bajo (<50 %) CH fueron inoculadas con A. apis y en ellas se determinó el número de crías con signos de ascosferosis (momias) durante 17 días, datos que se correlacionaron con su grado de CH. También se evaluó la susceptibilidad a A. apis de larvas de colonias con alto y bajo CH en un medio ambiente común, para separar efectos ambientales de genotípicos. El grado de CH entre colonias varió significativamente (CV>36 %), con 20 % de las colonias mostrando alto CH (95 %) y éste no se correlacionó con la población de abejas adultas y cría. Las colonias con alto CH tuvieron un número significativamente menor de momias que las colonias con bajo CH y hubo una correlación negativa entre el CH y el número de momias (r= -0.63, P= 0.02). Además, las larvas de 225


Rev Mex Cienc Pecu 2022;13(1):225-239

colonias con alto o bajo CH fueron igualmente susceptibles al hongo. Estos resultados sugieren que el CH y la susceptibilidad de las larvas no están asociados y que el principal mecanismo de protección contra A. apis en poblaciones de abejas africanizadas es el CH. Por ello, la selección de colonias con alto comportamiento higiénico podría contribuir a mejorar la salud y productividad de las abejas melíferas. Palabras clave: Apis mellifera, Ascosphaera apis, Cría calcárea, Comportamiento higiénico, Susceptibilidad de larvas, Abejas africanizadas, Yucatán.

Recibido: 18/12/2020 Aceptado: 29/04/2021

Introducción La cría calcárea, ascosferosis o cría de cal, es una enfermedad ocasionada por el hongo Ascosphaera apis, que al reproducirse y esporular en las larvas de abejas melíferas (Apis mellifera) provoca su momificación (momias blancas y negras), reduce el tamaño poblacional de sus colonias, y en algunas regiones puede provocar pérdidas elevadas de la producción de miel(1,2). Ante la presencia de A. apis y otros problemas sanitarios de las crías, las abejas melíferas pueden responder con mecanismos de resistencia conductuales y fisiológicos(3,4). Un importante mecanismo conductual es el comportamiento higiénico (CH), que consiste en la capacidad de las obreras de detectar, desopercular y remover del interior de las celdas a la cría que se encuentra enferma o muerta(5,6). La evaluación del nivel de CH de una colonia de abejas se basa en sacrificar crías dentro de celdas operculadas por punción(7) o congelamiento(8) y determinar el porcentaje de remoción en un periodo corto de tiempo por parte de las obreras. Se ha reportado que las colonias con muy alto CH (95 % de remoción de la cría muerta en 24 a 48 h) muestran cierto grado de resistencia a la cría calcárea(9,10) y loque americana(11-13), y existen algunas evidencias de resistencia de colonias altamente higiénicas contra el ácaro parasitario Varroa destructor(14) y el virus de las alas deformes(15). También se ha argumentado que mecanismos fisiológicos asociados a la inmunidad celular y humoral de las abejas pudieran conferirles resistencia contra la ascosferosis(4). Por lo anterior, no es claro cual es la contribución e importancia relativa del CH a la resistencia de las abejas contra la cría calcárea, particularmente en poblaciones de abejas africanizadas. Se ha reportado que el CH brinda protección contra el hongo A. apis en colonias de abejas africanizadas cruzadas con europeas de Sudamérica(10). Sin embargo, se desconoce si esto

226


Rev Mex Cienc Pecu 2022;13(1):225-239

también sucede en poblaciones de abejas africanizadas en otros países. Además, la relación entre la expresión del CH y la susceptibilidad de la cría en abejas africanizadas infectadas con el hongo A. apis no ha sido estudiada. Generar dicha información sería de gran utilidad para diseñar estrategias de control contra la enfermedad, como por ejemplo, establecer programas de crianza selectiva. En México en particular, se sabe que en ciertas regiones la prevalencia de cría calcárea puede rebasar el 50 %, sobre todo en zonas húmedas(16), y que esta enfermedad puede interactuar con otras y hacer colapsar las colonias de abejas(17). Además, en México no se han estudiado las relaciones del CH con la ascosferosis y la susceptibilidad de larvas de abejas africanizadas al hongo. Por lo anterior, el objetivo de este estudio fue evaluar el grado de CH de colonias de abejas africanizadas y su impacto en la resistencia y susceptibilidad de estos insectos a la cría calcárea.

Material y métodos Lugar de estudio Este estudio fue llevado a cabo en apiarios experimentales del Departamento de Apicultura del Campus de Ciencias Biológicas y Agropecuarias de la Universidad Autónoma de Yucatán, en Xmatkuil, Mérida, Yucatán, México (20° 52' 3.00" N, 89° 37' 29.15" O). Esta región presenta un clima cálido-subhúmedo con lluvias en verano (Awo), con precipitación pluvial anual de 985 mm, temperatura anual de 26.8 ºC y humedad relativa anual de 78 %(18).

Comportamiento higiénico y población de abejas Los estudios se llevaron a cabo en 50 colonias de abejas comerciales a las que se realizó un análisis morfométrico con el propósito de confirmar que eran africanizadas(19). Las colonias se encontraban alojadas en colmenas tipo Langstroth, distribuidas en cinco apiarios y tenían diferentes condiciones poblacionales y de reservas de alimento, pero sin signos clínicos de enfermedades. Las poblaciones de abejas de las colonias se determinaron tanto para el área de cría operculada como para la cantidad de abejas adultas. Para determinar el área de cría de cada colonia, dos operadores estimaron el porcentaje de la superficie de ambos lados de cada panal ocupada por cría operculada. La superficie porcentual de las áreas de cría se convirtió a cm2, considerando el área que tiene un panal tipo Langstroth en ambos lados (1,760 cm2). Además, se registró el número de panales cubiertos con abejas y se multiplicó por el número de abejas que ocupan un panal Langstroth en la cámara de cría por ambos lados (2,430 abejas)(20). Las mediciones se realizaron por las tardes (> 1700 h) cuando la

227


Rev Mex Cienc Pecu 2022;13(1):225-239

mayoría de las abejas se encontraban en el interior de las colmenas y en todas las mediciones participaron los mismos operadores. El CH de las colonias se evaluó en dos ocasiones. Las dos evaluaciones se realizaron durante el mes de julio cuando no existen floraciones importantes en el área y se hicieron con un intervalo de 14 días. Para estimar el nivel de CH de cada colonia, se seleccionó un panal con cría operculada con pupas de 3 a 4 días de edad, identificadas por el cuerpo de color blanco y ojos color púrpura(21), la etapa más adecuada para determinar el CH(22). Se colocó un cilindro de lámina galvanizada (8 cm diámetro x 10 cm altura) sobre un área compacta de cría operculada y se vertieron 300 ml de N2 líquido para sacrificar por congelamiento a las pupas en el interior de las celdas. Al evaporarse el N2 se removió el cilindro y se fotografiaron las áreas congeladas y el panal se introdujo nuevamente en la colonia que estaba siendo evaluada. Los panales con la cría sacrificada de las colonias experimentales se inspeccionaron 48 h después del anterior procedimiento y las áreas congeladas fueron fotografiadas nuevamente para registrar el número de pupas muertas que fueron removidas, y así poder determinar el porcentaje de remoción de la cría muerta. Las evaluaciones se realizaron 48 h posteriores al congelamiento debido a que es tiempo suficiente para limitar la reproducción y propagación de un agente infeccioso, lo que es menos estricto que a las 24 h y permite identificar la expresión del CH en colonias no seleccionadas para esta característica y apareadas naturalmente. Las colonias que en las dos pruebas desopercularon y removieron el 95 % de la cría congelada o más, fueron clasificadas como altamente higiénicas (alto CH) mientras que las colonias que removieron 50 % o menos de la cría congelada fueron consideradas como de bajo CH(8,12). Posteriormente, se seleccionaron 10 colonias que presentaron un alto CH y 10 colonias que presentaron un bajo CH con la finalidad de evaluar su resistencia relativa a la ascosferosis.

Efecto del comportamiento higiénico sobre la ascosferosis Las 20 colonias con alto y bajo CH seleccionadas del experimento anterior fueron reubicadas en un apiario aislado y sus reinas fueron marcadas con tinta indeleble en el tórax para su identificación. Las poblaciones de abejas de ambos grupos de colonias fueron homogenizadas tomando como base a la colonia que contaba con menor cantidad de abejas, área de cría, reservas de miel y polen. Por ello, al inicio del experimento las 20 colonias tenían aproximadamente la misma cantidad de panales cubiertos con abejas adultas (8), cría operculada (3), cría abierta (2), miel (2) y polen (1). Adicionalmente, se corroboró que ninguna colonia seleccionada presentara signos clínicos de cría calcárea (momias presentes en los panales, piso, o piquera). Para obtener el hongo A. apis, inicialmente se identificaron momias negras (hongo esporulado) de colonias ajenas al experimento. Este signo clínico es patognomónico de la

228


Rev Mex Cienc Pecu 2022;13(1):225-239

ascosferosis por lo que existe la certeza de obtener el hongo a partir de dichas momias. Adicionalmente, se observaron al microscopio los esporocistos del hongo en muestras de momias(23). Para inducir la infección de A. apis en cría de las colonias experimentales se siguió el protocolo de Flores et al(24). Se maceraron tres momias por mililitro de agua destilada. Cada una de las 20 colonias experimentales se inoculó con 6 ml del macerado diluido en 120 ml de jarabe de sacarosa (1:1), que fue suministrado a cada colonia por medio de alimentadores tipo Boardman. Además, dos panales conteniendo larvas jóvenes (cría abierta) en al menos 80 % de su superficie, así como las abejas presentes en esos panales, se asperjaron con 6 ml del mismo macerado diluido en 14 ml de jarabe de sacarosa (1:1), suministrando 5 ml del inóculo por cada lado de cada panal. Las colonias se revisaron para registrar el número de momias blancas y negras presentes en las celdas de los panales en los días 3, 5, 7, 9, 12 y 17, post-exposición(25).

Susceptibilidad de larvas de colonias de alto y bajo CH a la ascosferosis Con la finalidad de evaluar si las diferencias en número de momias en los panales entre colonias con alto y bajo CH del experimento anterior se debió en alguna medida a diferencias en la susceptibilidad de sus larvas al hongo A. apis, se utilizaron larvas de cinco colonias de cada tipo seleccionadas al azar para inocularlas y permitir su desarrollo en un medio ambiente común. De cada colonia se cortó con un cuchillo, una sección de panal (7 x 7 cm) conteniendo un promedio de 264  3.4 larvas de 3 a 4 días de edad. Inmediatamente después se armaron bastidores, cada uno conteniendo una sección procedente de una colonia con alto CH y otra de una colonia con bajo CH, estas secciones y cinco colonias receptoras que tenían un bajo CH, fueron inoculadas con el hongo A. apis como se describió antes. Cada panal ensamblado de esta manera se colocó en el centro de la cámara de cría de una colonia receptora con la finalidad de dar a las larvas el mismo ambiente de nido, y que la probabilidad de ser removidas por el CH de las abejas de las colonias receptoras fuera similar para ambos tipos de larvas. Hacer cohabitar larvas y abejas en el mismo nido de cría se ha usado exitosamente en el pasado para separar efectos ambientales de genotípicos en estudios de diversos comportamientos de las abejas, incluyendo el CH(26-29). Se registró el número de momias de cría calcárea en las secciones de panal los días 5, 9 y 13, post-exposición del hongo.

Análisis estadísticos Se obtuvieron medidas de tendencia central y de dispersión para los datos de las evaluaciones de CH y de las condiciones poblacionales de las 50 colonias. También se realizaron pruebas de correlación de Pearson entre los datos de la primera y segunda prueba del CH, así como entre los del CH y los de la población de abejas, las áreas de cría y el número de momias registradas en los panales. El porcentaje de CH, las áreas de cría y la población de abejas de las colonias con alto y bajo CH que se seleccionaron para las pruebas del efecto del CH sobre

229


Rev Mex Cienc Pecu 2022;13(1):225-239

la cría calcárea, así como la proporción de larvas clínicamente afectadas por la ascosferosis de los dos tipos de colonias que se usaron en el experimento de susceptibilidad, se analizaron con pruebas t de Student. El número de momias de las colonias con alto y bajo CH y el efecto del tiempo en esta variable se analizaron por medio de varianza de medidas repetidas y de pruebas de comparación de medias de Newman-Keuls. Antes de los análisis, los valores porcentuales del CH y de crías momificadas (prueba de susceptibilidad) se transformaron a raíz cuadrada del arcoseno y el número de momias a logaritmo, para garantizar una distribución normal de los datos. Los análisis estadísticos se realizaron en el programa SAS(30).

Resultados Comportamiento higiénico y población de abejas El Cuadro 1 muestra el grado de CH y las condiciones poblacionales de las 50 colonias, así como la variación para estos parámetros. Claramente, hubo un amplio rango y variabilidad para el grado de CH entre las colonias evaluadas (CV>36 %). Sin embargo, es de destacar que el 20 % de ellas tuvieron un alto CH (95 %), el 30 % tuvieron un bajo CH (50 %) y el 50 % registraron un nivel intermedio de CH (51-94 % de remoción de cría congelada). La población de abejas adultas también fue muy variable (CV>37 %), pero no así la cantidad de cría en las colonias (CV<18 %). Hubo una correlación positiva y significativa entre el nivel de CH de la primera y la segunda evaluación (r= 0.60, P= 0.0001), por lo que la prueba de congelamiento de pupas mostró repetitividad. Por otro lado, no se encontró relación del nivel de CH con el número de abejas adultas (r= - 0.03, P= 0.84) o con el área de cría operculada de las colonias (r= 0.02, P= 0.87), por lo que se presume que estos factores no influyeron significativamente en el grado de CH de las colonias. Cuadro 1: Valores medios y de dispersión del comportamiento higiénico, población estimada de abejas y áreas de cría en dos pruebas a 50 colonias de abejas melíferas Comportamiento higiénico (%) Media 66.12 Error estándar 0.48 Coeficiente de variabilidad, % 36.2 Valor mínimo 12.5 Valor máximo 100 Rango 87.5 Estadístico descriptivo

230

Áreas de cría (cm2) 9,574.4 33.8 17.5 5,820 12,320 6,500

Población de abejas adultas 32,683 245.43 37.5 9,720 53,460 43,740


Rev Mex Cienc Pecu 2022;13(1):225-239

Efecto del comportamiento higiénico sobre la ascosferosis Las colonias con alto y bajo grado de CH que fueron seleccionadas para las pruebas de resistencia relativa a la cría calcárea, difirieron significativamente en su nivel de CH (t= 8.71, P0.0001), pero no difirieron en cuanto a población de abejas adultas (t= 0.10, P= 0.75) o de cría (t= 2.02, P= 0.17). Los niveles medios de CH fueron 31 ± 0.81 y 97 ± 0.20 %, para las colonias con bajo y alto CH, respectivamente. Después de ser expuestas a A. apis, la manifestación clínica de la cría calcárea (presencia de momias en los panales) se observó a los tres días post-exposición, y aunque la cantidad de cría afectada fue similar en ambos grupos de colonias hasta el día cinco post-exposición, las colonias de alto CH tuvieron significativamente menos momias blancas (F1,76= 32.1, P<0.0001) y negras (F1,76= 10.8, P<0.001) en los panales que las colonias de bajo CH. Además, el número de momias blancas y negras en los panales de ambos grupos de colonias disminuyó significativa y progresivamente entre los días 9 y 17 post-exposición (F 4,76 = 3.2, P= 0.01 y F4,76 = 2.6, P= 0.03, respectivamente), pero no hubo efecto de interacción entre el grado de CH y los días post-exposición del hongo en momias blancas (F4,76= 0.7, P= 0.61) y negras (F4,76= 0.95, P= 0.45; Figuras 1 y 2). Figura 1: Número (media ± EE) de momias blancas registradas en los panales de las colonias con alto (■) y bajo (▲) comportamiento higiénico (CH) después de la inoculación con el hongo A. apis 50 45

M omias blancas en panal

CH alto

40 a

CH bajo a

35

a

30

a

25 20 a

a

a

15 10 5

b

a

b a

a

0 3

5

7

9

12

17

Días después de la inoculación de A. apis ab

Diferentes literales indican diferencias significativas (P0.05) basadas en un análisis de varianza de medidas repetidas y la prueba de comparación de medias de Newman-Keuls, previa transformación de los datos a logaritmo. Se muestran valores sin transformar. 231


Rev Mex Cienc Pecu 2022;13(1):225-239

Figura 2: Número (media ± EE) de momias negras registradas en los panales de las colonias con alto (■) y bajo (▲) comportamiento higiénico (CH) después de la inoculación con el hongo A. apis 30

CH alto

M omias negras en panal

25

CH bajo

20 a

15

a

10

a a

a

5

a a

0

b b

a

a

3

a

5

7

9

12

17

Días después de la inoculación de A. apis ab

Diferentes literales indican diferencias significativas (P0.05) basadas en un análisis de varianza de medidas repetidas y la prueba de comparación de medias de Newman-Keuls, previa transformación de los datos a logaritmo. Se muestran valores sin transformar.

Además de lo anterior, se encontró una correlación negativa y significativa entre el nivel de CH y el número de momias totales de las colonias inoculadas con A. apis para las pruebas de resistencia a cría calcárea (r= -0.63, P= 0.02). Este resultado indica que, a mayor CH, hubo menor número de momias en los panales de las colonias, por lo que este comportamiento parece conferir resistencia a las abejas melíferas contra la ascosferosis.

Susceptibilidad de larvas de colonias con alto y bajo CH a la ascosferosis Con relación a la susceptibilidad de las larvas provenientes de colonias con alto y bajo CH al hongo A. apis, se encontró que la proporción de momias en los panales no fue diferente estadísticamente entre ambos grupos de larvas durante todo el periodo de evaluación (Cuadro 2). Además, no hubo correlación significativa entre el nivel de CH de las colonias donadoras de larvas y el porcentaje de momias encontrado en los panales post-exposición de las larvas con A. apis (r = 0.21, P= 0.55).

232


Rev Mex Cienc Pecu 2022;13(1):225-239

Cuadro 2: Porcentaje (media  EE) de larvas de colonias con alto y bajo comportamiento higiénico (CH) que manifestaron clínicamente la ascosferosis post-exposición con A. apis Días post-exposición con A. apis 5 9 13

Alto CH (n= 5)

Bajo CH (n= 5)

t

P

6.54  0.77 5.32  3.24 1.34  1.81

5.32  0.33 4.14  1.60 1.46  1.01

3.93 0.21 1.30 0.80 1.91 0.54

Los valores t y P fueron obtenidos del análisis de datos del porcentaje de crías momificadas transformados a la raíz cuadrada del arcoseno.

Discusión Las evaluaciones del CH y fortaleza de población de las colonias de abejas africanizadas estudiadas mostraron amplia variación como se esperaba, pero no mostraron correlación, lo que sugiere que es posible identificar colonias de abejas que varían en su CH independientemente de su fortaleza. Estos resultados coinciden con lo reportado en trabajos previos(10,12,31). Además, la prueba de N2 usada para medir el CH mostró alta correlación entre repeticiones, lo que indica que es confiable como previamente se había demostrado(32), y permite la categorización de colonias con diferentes grados de expresión para este comportamiento. La frecuencia (20 %) de colonias que expresaron un alto grado de CH se encuentra dentro de los rangos mostrados por colonias de abejas europeas y africanizadas (10-31.5 %) en otras regiones(12,33-35). Y esta baja frecuencia pudiera ser incrementada a partir de criar reinas de colonias con alto CH, permitiendo su libre fecundación, como lo han demostrado en la práctica, Spivak y Reuter(12) y Bigio et al(31). Lo anterior se basa en que parte de la variabilidad del CH es de origen genético(36,37), que el CH es un comportamiento altamente heredable(38-41) y que éste se hereda principalmente por vía materna(28). Las colonias seleccionadas por su alto CH tuvieron significativamente menos crías con signos clínicos de la ascosferosis en los panales que las colonias seleccionadas por su bajo CH. Esto presumiblemente se debió a que removieron mayor cantidad de cría enferma de los panales que las colonias con bajo CH, y que lo hicieron progresivamente conforme pasó el tiempo de evaluación. Estos resultados coinciden con los de estudios realizados en colonias con abejas de origen europeo(42,43) y con los de un estudio realizado en colonias de abejas africanizadas cruzadas con europeas(10). La detección de larvas infectadas por A. apis depende de la percepción de compuestos volátiles por parte de las abejas(44-46), habiendo variación en los umbrales de detección de estos compuestos en las obreras. Abejas de estirpes seleccionadas para alto CH son más sensibles y reaccionan al olor de estos compuestos con mayor frecuencia que abejas no seleccionadas para este comportamiento(47). También se ha sugerido que la eficiencia del CH contra la cría calcárea depende de la detección temprana de las larvas infectadas por el hongo previo a su momificación y esporulación, lo que limita 233


Rev Mex Cienc Pecu 2022;13(1):225-239

la propagación de la infección en la colonia(10). El retiro oportuno de las crías enfermas reducen el riesgo de esporulación y diseminación del hongo(9). Lo anterior pudiera explicar por qué en las colonias con alto CH hubo un número significativamente menor de momias blancas y negras en los panales en comparación con las colonias con bajo CH. Esta conclusión se refuerza con los resultados del análisis de correlación que mostró que, a mayor grado de CH, disminuyó significativamente el número de crías infectadas con A. apis en los panales de las colonias de abejas estudiadas. Se ha especulado que la resistencia de las abejas a enfermedades de la cría depende de la interacción de factores de resistencia fisiológica como la respuesta inmune ante diferentes patógenos, la actividad antimicrobiana de la microbiota y alimentos larvales, así como del CH y otros mecanismos de defensa(48,49). En este estudio se analizó por primera ocasión la susceptibilidad de larvas a A. apis en un ambiente de nido común y se encontró que las larvas provenientes de colonias con alto y bajo CH fueron igualmente susceptibles a la ascosferosis. Por ello, los resultados del presente estudio permiten inferir que el nivel de expresión del CH y la susceptibilidad de las larvas a A. apis no están asociados, y apoyan la hipótesis de que aunque diversos factores y mecanismos pudieran contribuir a la resistencia de las abejas contra la ascosferosis(50), el CH es el más importante de ellos. Por lo anterior, se sugiere que los esfuerzos para el desarrollo de colonias resistentes a enfermedades de la cría como la ascosferosis, sean enfocados a la selección de colonias con alto CH. La frecuencia de colonias con alto CH provenientes de programas de mejoramiento genético es superior a la encontrada en poblaciones no seleccionadas(12) y se ha reportado que esta conducta se asocia a una mayor producción de miel(12,34,51) y a una mayor resistencia a enfermedades(9,12-15,36); esto último es coincidente con los resultados del presente estudio. Favorablemente, la selección y reproducción de reinas de colonias con alto CH parece ser suficiente para incrementar la frecuencia de colonias con elevado CH en las poblaciones de abejas(31,39,41), debido a que el CH se hereda principalmente a través de la madre(28), por lo que la implementación de programas de selección y reproducción de reinas cuyas colonias expresen un alto CH, contribuiría a mejorar la salud y productividad de las colonias.

Conclusiones e implicaciones Se concluye que el grado de CH entre colonias es variable, y que la población de abejas y crías no influyen significativamente en el grado de CH de las colonias. La frecuencia de colonias con alto CH en la población de abejas africanizadas analizada permitiría seleccionar genotipos para incrementar el grado de CH de las poblaciones de abejas en programas de mejoramiento genético. Las colonias con alto CH tuvieron mayor control de la ascosferosis que las colonias con bajo CH. La susceptibilidad de las larvas a la ascosferosis y el CH no parecen ser factores asociados. Estos resultados sugieren que el principal mecanismo de

234


Rev Mex Cienc Pecu 2022;13(1):225-239

protección contra A. apis en poblaciones de abejas africanizadas es el CH. Futuras investigaciones son necesarias para estudiar la inmunidad humoral y celular de las abejas contra A. apis, así como los mecanismos para su identificación y factores asociados, a fin de que sean integrados a programas de selección y mejoramiento genético con la finalidad de mejorar la sanidad y producción de poblaciones de abejas melíferas. Literatura citada: 1. Gilliam M, Vandenberg JD. Fungi. In: Morse RA, Flottum K. Honey bee pest predators and diseases. 3a ed. AI Root Co. Medina USA; 1997:82-99. 2. Zaghloul OA, Mourad AK, El MK, Nemat FM, Morsy ME. Assessment of losses in honey yield due to the chalkbrood disease, with reference to the determination of its economic injury levels in Egypt. Commun Agric Appl Biol 2005;70(4):703-714. 3. Evans JD, Aronstein K, Chen YP, Hetru C, Imler JL, Jiang H, Hultmark D. Immune pathways and defense mechanisms in honey bees Apis mellifera. Insect Mol Biol 2006;15(5):645-656. https://doi.org/10.1111/j.1365-2583.2006.00682.x. 4. Larsen A, Reynaldi FJ, Guzmán-Novoa E. Bases del sistema inmune de la abeja melífera (Apis mellifera). Revisión. Rev Mex Cienc Pecu 2019;10(3):705-728. https://doi.org/10.22319/rmcp.v10i3.4785. 5. Boecking O, Drescher W. Apis mellifera removes Varroa jacobsoni and Tropilaelaps clareae from sealed brood cells in the topics. Am Bee J 1992;132(11):732-734. 6. Arathi HS, Ho G, Spivak M. Inefficient task partitioning among nonhygienic honeybees, Apis mellifera L., and implications for disease transmission. Anim Behav 2006;72:431438. https://doi.org/10.1016/j.anbehav.2006.01.018. 7. Newton DC, Ostasiewski, NL. A simplified bioassay for behavioral resistance to American foulbrood in honey bees (Apis mellifera L.). Am Bee J 1986;126:278-281. 8. Spivak M, Downey DL. Field assays for hygienic behavior in honey bees (Hymenoptera: Apidae). J Econ Entomol 1998;91(1):64-70. https://doi.org/10.1093/jee/91.1.64. 9. Spivak M, Gilliam M. Hygienic behaviour of honey bees and its application for control of brood diseases and Varroa. Part II. Studies on hygienic behaviour since the Rothenbuhler era. Bee World 1998;79(4):169-186. https://doi.org/10.1080/0005772X.1998.11099408. 10. Invernizzi C, Rivas F, Bettucci L. Resistance to chalkbrood disease in Apis mellifera L. (Hymenoptera: Apidae) colonies with different hygienic behaviour. Neotrop Entomol 2011; 40(1):28-34. http://dx.doi.org/10.1590/S1519-566X2011000100004.

235


Rev Mex Cienc Pecu 2022;13(1):225-239

11. Danka RG, Villa JD. Preliminary observations on the susceptibility of Africanized honey bees to American foulbrood. J Apic Res 1994;33(4): 243-245. https://doi.org/10.1080/00218839.1994.11100878. 12. Spivak M, Reuter GS. Performance of hygienic honey bee colonies in a commercial apiary. Apidologie 1998;29:291-302. 13. Palacio MA, Figini EE, Ruffinengo SR, Rodriguez EM, Hoyo ML, Bedascarrasburne EL. Changes in population of Apis mellifera L. selected for the hygienic behavior and its relation to brood disease tolerance. Apidologie 2000;31:471-478. https://doi.org/10.1051/apido:2000139. 14. Ibrahim A, Spivak M. The relationship between hygienic behavior and suppression of mite reproduction as honey bee (Apis mellifera) mechanisms of resistance to Varroa destructor. Apidologie 2006;37(1):31-40. https://doi.org/10.1051/apido:2005052. 15. Schöning C, Gisder S, Geiselhardt S, Kretschmann I, Bienefeld K, Hilker M, Genersch E. Evidence for damage-dependent hygienic behaviour towards Varroa destructorparasitised brood in the western honey bee, Apis mellifera. J Exp Biol 2012;215(2):264271. https://doi: 10.1242/jeb.062562. 16. Tapia-González J, Alcazar-Oceguera G, Macías-Macías J, Contreras-Escareño F, TapiaRivera J, Petukhova T, Guzmán-Novoa E. Ascosferosis en abejas melíferas y su relación con factores ambientales en Jalisco, México. Rev Mex Cienc Pecu 2020;11(2):468-478. https://doi.org/10.22319/rmcp.v11i2.4926. 17. Medina LM, Vicario-Mejía E. The presence of Varroa jacobsoni mite and Ascosphaera apis fungi in collapsing and normal honey bee (Apis mellifera L.) colonies in Yucatan, Mexico. Am Bee J 1999;139(10):794-796. 18. García E. Modificaciones al sistema de clasificación climática de Köppen, 5th. Ed. Universidad Nacional Autónoma de México (UNAM), México. 2004:90. http://www.publicaciones.igg.unam.mx/index.php/ig/catalog/view/83/82/251-1 Consultado: 25 Nov, 2020. 19. Nielsen DI, Ebert PR, Hunt GJ, Guzman-Novoa E, Kinee SA, Page RE. Identification of Africanized honey bees (Hymenoptera: Apidae) incorporating morphometrics and an improved PCR mitotyping procedure. Ann Entomol Soc Am 1999;92:167-174. 20. Delaplane KS, van der Steen J, Guzman-Novoa E. Standard methods for estimating strength parameters of Apis mellifera colonies. J Apic Res 2013;52(1):1-12. https://doi.10.3896/IBRA.1.52.1.03. 21. Jay CS. Colour changes in honeybee pupae. Bee World 1962;43(4):115-117.

236


Rev Mex Cienc Pecu 2022;13(1):225-239

22. Message D, Goncalves LS. Efeito das condições climáticas a da colônia no comportamento higiênico em abelhas Apis mellifera (africanizadas). Anais do 5o Congresso Brasileiro de Apicultura (Minas Gerais) 1980:55. 23. Guzmán-Novoa E, Zozaya-Rubio JA, Anguiano-Báez JR, Vázquez-Valencia I. Técnicas de diagnóstico de laboratorio de las enfermedades y parásitos de las abejas. En: GuzmánNovoa E, Correa-Benítez A editores. Patología, diagnóstico y control de las principales enfermedades y plagas de las abejas melíferas. México: Editorial Yire; 2015:141-166. 24. Flores JM, Gutierrez I, Puerta F. A comparison of methods to experimentally induce chalk brood disease in honey bees. Span J Agric Res 2004;2(1):79-83. 25. Spivak M, Gilliam M. Facultative expression of hygienic behaviour of honey bees in relation to disease resistance. J Apic Res 1993:32(3/4):147-157. 26. Winston ML, Katz SJ. Longevity of cross-fostered honey bee workers (Apis mellifera) of European and Africanized races. Can J Zool 1981;59(8):1571-1575. 27. Guzman-Novoa E, Gary NE. Genotypic variability of components of foraging behavior in honey bees (Hymenoptera: Apidae). J Econ Entomol 1993;86(3):715-721. 28. Unger P, Guzman-Novoa E. Maternal effects on the hygienic behavior of Russian x Ontario hybrid honeybees (Apis mellifera L.). J Hered 2010;101(1):91-96. https://doi.org/10.1093/jhered/esp092. 29. Gashout HA, Guzman-Novoa E, Goodwin PH, Correa-Benítez A. Impact of sublethal exposure to synthetic and natural acaricides on honey bee (Apis mellifera) memory and expression of genes related to memory. J Insect Physiol 2020;121:104014. https://doi.org/10.1016/j.jinsphys.2020.104014. 30. SAS. SAS User ́s Guide: Statistics (version 9 ed.). Cary NC, USA: SAS Inst. Inc. 2002. 31. Bigio G, Schurch R, Ratnieks FLW. Hygienic behaviour in honey bees (Hymenoptera: Apidae): effects of brood, food, and time of the year. J Econ Entomol 2013;106(6):22802285. http://dx.doi.org/10.1603/EC13076. 32. Espinosa-Montaño LG, Guzmán-Novoa E, Sánchez-Albarrán A, Montaldo HH, CorreaBenítez A. Estudio comparativo de tres pruebas para evaluar el comportamiento higiénico en colonias de abejas (Apis mellifera L.) Vet Méx 2008;39(1):39-54. 33. Oldroyd BP. Evaluation of Australian commercial honey bees for hygienic behaviour, a critical character for tolerance to chalkbrood. Aust J Exp Agric 1996;36:625-629.

237


Rev Mex Cienc Pecu 2022;13(1):225-239

34. Medina-Flores CA, Guzmán-Novoa E, Aréchiga FCF, Gutiérrez BH, Aguilera SJI. Producción de miel e infestación con Varroa destructor de abejas africanizadas (Apis mellifera) con alto y bajo comportamiento higiénico. Rev Mex Cienc Pecu 2014;5(2):157-170. 35. Gerdts J, Dewar RL, Finstrom MS, Edwards T, Angove M. Hygienic behaviour selection via freeze-killed honey bee brood not associated with chalkbrood resistance in eastern Australia. PloS one 2018;13(11):e0203969. https://doi.org/10.1371/journal.pone.0203969. 36. Arechavaleta-Velasco ME, Guzman-Novoa E. Relative effect of four characteristics that restrain the population growth of the mite Varroa destructor in honey bee (Apis mellifera) colonies. Apidologie 2001;32:157-174. 37. Lapidge KL, Oldroyd BP, Spivak M. Seven suggestive quantitative trait loci influence hygienic behavior of honey bees. Naturwissenschaften 2002;89(12):565-568. https://doi.org/10.1007/s00114-002-0371-6 38. Harbo JR, Harris JW. Heritability in honey bees (Hymenoptera: Apidae) of characteristics associated with resistance to Varroa jacobsoni (Mesostigmata:Varroidae). J Econ Ent 1999; 92(2):261-265. https://doi.org/10.1093/jee/92.2.261. 39. Boecking O, Bienefeld K, Drescher W. Heritability of the Varroa-specific hygienic behaviour in honey bees (Hymenoptera: Apidae). J An Breed Genet 2000;117(6):417– 24. https://doi.org/10.1046/j.1439-0388.2000.00271.x. 40. Stanimirovic Z, Stevanovic J, Mirilovic M, Stojic V. Heritability of hygienic behaviour in grey honey bees (Apis mellifera carnica). Acta Vet (Beograd) 2008;58(5-6):593-601. https://doi.org/10.2298/AVB0806593S. 41. Pernal SF, Sewalem A, Melathopoulos AP. Breeding for hygienic behaviour in honeybees (Apis mellifera) using free-mated nucleus colonies. Apidologie 2012;43(4):403-16. 42. Gilliam M, Taber S, Richardson VG. Hygienic behavior of honey bees in relation to chalkbrood disease. Apidologie 1983;14(1):29-39. 43. Gilliam M, Taber S, Lorenz BJ, Prest DB. Factors affecting development of chalkbrood disease in colonies of honey bees, Apis mellifera, fed pollen contaminated with Ascosphaera apis. J Invert Pathol 1988;52:314-325.

238


Rev Mex Cienc Pecu 2022;13(1):225-239

44. Swanson JAT, Torto SA, Kells KA, Mesce HH. Tumlinson JH, Spivak M. Odorants that induce hygienic behavior in honeybees: identification of volatile compounds in chalkbrood-infected honey bee larvae. J Chem Ecol 2009;35:1108-1116. https://doi.org/10.1007/s10886-009-9683-8. 45. Zhao HX, Liang Q, Lee JH, Zhang XF, Huang WZ, Chen HS, Luo YX. Behavioral responses of Apis mellifera adult workers to odors from healthy brood and diseased brood. Sociobiol 2015;62(4):564-570. 46. McAfee A, Chapman A, Iovinella I, Gallagher-Kurtzke Y, Collins TF, Higo H, Foster LJ. A death pheromone, oleic acid, triggers hygienic behavior in honey bees (Apis mellifera L.). Sci Rep 2018;8(1):5719. https://doi.org/10.1038/s41598-018-24054-2. 47. Masterman R, Ross R, Mesce K, Spivak M. Olfactory and behavioral response thresholds to odors of diseased brood differ between hygienic and non-hygienic honey bees (Apis mellifera L.). J Comp Physiol A 2001;187(6):441-452. https://doi.org/10.1007/s003590100216 48. Guzman-Novoa E, Morfin N. Disease resistance in honey bees (Apis mellifera L.) at the colony and individual levels. In: Moo-Young M. editor. Comprehensive Biotechnology. 3rd ed. Amsterdam, The Netherlands: Elsevier BV; 2019;4:811-817. https://dx.doi.org/10.1016/B978-0-444-64046-8.00254-8. 49. Spivak M, Danka RG. Perspectives on hygienic behavior in Apis mellifera and other social insects. Apidologie 2020:1-16. https://doi.org/10.1007/s13592-020-00784-z. 50. Evison SE, Fazio G, Chappell P, Foley K, Jensen AB, Hughes WO. Innate expression of antimicrobial peptides does not explain genotypic diversity in resistance to fungal brood parasites in the honey bee. Apidologie 2016;47(2):206-215. 51. Wielewski P, de Toledo VAA, Nunes ME, Costa-Maia FM, Faquinello P, Lourenco DAL, et al. Relationship between hygienic behavior and Varroa destructor mites in colonies producing honey or royal jelly. Sociobiology 2012;59(1):251-274.

239


https://doi.org/10.22319/rmcp.v13i1.5906 Artículo

Producción y calidad nutritiva de Tithonia diversifolia (Hemsl.) A. Grey en tres épocas del año y su efecto en la preferencia por ovinos Pelibuey

Vicky Tatiana Vargas Velázquez a Ponciano Pérez Hernández a Silvia López Ortiz a Epigmenio Castillo Gallegos b Cristino Cruz Lazo b Jesús Jarillo Rodríguez b*

a

Colegio de Postgraduados. Campus Veracruz. México.

b

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Centro de Enseñanza, Investigación y Extensión en Ganadería Tropical, Km 5.5 carretera federal Martínez de la Torre-Tlapacoyan, 93600, Tlapacoyan, Veracruz, México.

* Autor de correspondencia: jjarillo@unam.mx

Resumen: Se determinó producción, calidad nutritiva y preferencia de T. diversifolia por ovinos Pelibuey a diferentes edades, en tres épocas del año. Se midió la producción de materia seca (MS) y calidad nutritiva de forraje cada 14 días, desde el corte hasta 84 días de edad. Se tomaron muestras de hoja y tallo para determinar proteína cruda (PC), fibra detergente neutro (FDN) y fibra detergente ácida (FDA). Se utilizaron ocho ovinos Pelibuey adultos para determinar su preferencia por el follaje de T. diversifolia a los 42, 56 y 70 días de rebrote. La producción de MS total fue similar en otoño e invierno y ambas mayores que primavera. En otoño a los 56 días y en invierno a los 70 días después del corte, la producción de MS fue 9 t ha-1, mientras que en primavera a los 84 días fue cercana a las 3 t ha-1. El incremento o decremento de los componentes morfológicos de la biomasa a través del tiempo fue distinto entre las épocas evaluadas y mostró un comportamiento 240


Rev Mex Cienc Pecu 2022;13(1):240-257

curvilíneo en el tiempo, dentro de cada época. La PC aumentó en forma lineal con la edad de corte. En otoño e invierno hubo mayor porcentaje de FDN y FDA. Las plantas de 42 días tuvieron menor porcentaje de FDA. El rendimiento de MS y la calidad nutritiva de T. diversifolia difiere según la época del año y la edad de rebrote. La edad de corte de la planta afectó su preferencia por los ovinos Pelibuey (P=0.0091), fue mayor por el follaje de 42 días, seguido por 56 y 70 días. Palabras clave: Ovinos en pastoreo, Cynodon nlemfuensis, Trópico, Recursos forrajeros.

Recibido: 19/12/2020 Aceptado: 29/04/2021

Introducción La alimentación de los ovinos en el trópico mexicano se basa en el pastoreo de gramíneas con bajo valor de proteina cruda (PC), alto en de fibra detergente neutro (FDN), y de fibra detergente acida (FDA), y baja digestibilidad de la materia seca (MS)(1,2,3); esto provoca baja productividad, particularmente en los ovinos en crecimiento que producen ganancias de peso menores a 70 g día-1(4,5). La calidad de la dieta de los ovinos podría mejorarse con el uso de arbustos y árboles forrajeros conocidos por tener altos contenidos de PC (1430 %), menor FDN (28.4 - 51.9 %) y FDA (19.5 - 37.5), y mayor digestibilidad (4880 %); la complementación de la dieta con follajes de este tipo de plantas mejora el consumo de los pastos(2,6), la digestibilidad de la MS(7,8), y generan beneficios al ambiente(9). Una especie arbustiva con potencial forrajero es Tithonia diversifolia (Hemsl.) A. Gray, de la familia Asterácea, que produce hasta 19.5 t de MS ha-1 año-1(10), e incrementar con fertilización, puede contener de 11.7 a 30 % PC(11,12,13), degradabilidad en rumen de 50 a 90 %(14), bajos contenidos de FDA (24.1 a 48.9 %) y FDN (14.8 a 55.9 %), niveles aceptables de compuestos secundarios como fenoles (30.5 %) y taninos (5.7 %)(15,16), por lo que su uso puede mejorar la productividad y la rentabilidad de las unidades de producción, sin afectar la calidad de los productos(17,18). Además, el uso de T. diversifolia mejora el reciclaje de nutrientes(19), previene la erosión de los suelos(20) y se utiliza en sistemas de corte y acarreo, como banco de forraje o pastoreo en sistemas silvopastoriles(13,20). El objetivo fue evaluar la cantidad de MS producida de T. diversifolia, la calidad nutritiva a cuatro edades de corte, en las épocas de otoño, invierno y primavera; y la preferencia de los ovinos por follaje por esta especie en distintas edades de rebrote.

241


Rev Mex Cienc Pecu 2022;13(1):240-257

Material y métodos Ubicación de la investigación y descripción del sitio experimental El estudio se realizó en el Centro de Enseñanza, Investigación y Extensión en Ganadería Tropical de la FMVZ-UNAM; ubicado en el municipio de Tlapacoyan, a 2002’ N y 97 06’ O, a 151 msnm. El clima en la región es Af(m)w”(e), cálido húmedo(21) con 23.5 °C de temperatura media anual y 1,991 mm anuales de precipitación pluvial. Se distinguen tres épocas del año: lluvias de julio a octubre, nortes de noviembre a febrero (otoño e invierno), y seca de marzo a junio (primavera; Figura 1). El suelo en el sitio es de tipo ultisol; ácidos de baja fertilidad y de color café rojizo, subyace inmediatamente tepetate que origina una capa subterránea semipermeable al agua que provocan encharcamientos temporales. Figura 1: Temperatura y precipitación pluvial mensual del sitio experimental

Fases de la investigación La investigación se realizó en tres fases. La primera fase se realizó en el mes de julio, para establecer una parcela de 158 x 55 m (8,715 m2) de T. diversifolia. La segunda se llevó a cabo de octubre de 2018 a junio de 2019, para evaluar el rendimiento de materia seca y el valor nutritivo de la MS en tres épocas del año (otoño, invierno y primavera). En la tercera etapa, del 13 de marzo al 01 de abril del 2019 se realizó una prueba de preferencia por ovinos de forraje de T. diversifolia a tres edades.

242


Rev Mex Cienc Pecu 2022;13(1):240-257

Fase 1. Establecimiento de Tithonia diversifolia Se estableció una parcela con T. diversifolia utilizando estacas de 20 a 30 cm de longitud, sembradas a 60 x 60 cm de distancia para una densidad de 27,778 plantas ha-1. Las plantas permanecieron sin riego ni fertilización, solo se realizó control manual de arvenses. Fase 2. Evaluacion de rendimiento y el valor nutritivo de materia seca de Tithonia diversifolia Se realizaron muestreos de forraje en cada época: otoño (9 de octubre al 21 de diciembre de 2018); invierno (6 de enero al 2 de abril del 2019) y primavera (28 de marzo al 20 de junio del 2019). En cada época, se realizó un corte de uniformización de plantas a 50 cm de altura 14 días previo a los muestreos. Se seleccionaron 52 plantas y de éstas, se asignaron cuatro de forma aleatoria a cada una de seis edades de corte (14, 28, 42, 56, 70 y 84 días). Los muestreos de forraje se planearon para realizarse cada 14 días hasta que las plantas llegaran a su punto de mejor momento de condición forrajera; las plantas alcanzan ese punto antes del inicio de la floración(13), por lo cual, se hicieron observaciones de la fenología para que el último corte coincidiera con los primeros indicios de floración. En cada muestreo, las plantas se cortaron a 5 cm de altura sobre la superficie del suelo. El material de cada planta se pesó y se separó en hojas, tallos, flores y material muerto, y se secaron en estufa de aire forzado a 60 oC durante 72 h. Se determinó la concentración de PC en hojas(22), FDN, FDA por el método de la bolsa de filtro (ANKOM2000; Ankom Technology, NY, USA). Fase 3. Prueba de preferencia Para la prueba de preferencia se utilizó planta completa de T. diversifolia a los 42, 56 y 70 días de edad de rebrote, las plantas se podaron del 12 al 16 de enero para la edad de 70 días, del 16 al 30 de enero para 56 días, y del 30 de enero al 13 de febrero para 42 días. Se utilizaron ocho ovinos adultos de raza Pelibuey, con un peso promedio de 52 kg y edad aproximada de 14 meses; estos animales tenían el hábito de consumo de T. diversifolia desde el destete, y bajo pastoreo de C. nlemfuensis. El experimento se realizó durante un periodo de 20 días; los primeros 10 días fueron de adaptación(23); en este periodo, los animales permanecieron en potreros de C. nlemfuensis (6 x 5 m) las 24 h del día y se trasladaron al corral diariamente de 1200 a 1230 h para acostumbrarlos al manejo. Del día 11 al 20 se realizó la prueba de preferencia; diariamente se ofrecieron 600 g de forraje verde picado (de planta completa) de T. diversifolia equivalentes a 77.1, 84.6 y 91.7 g MS de 42, 56 y 70 días, respectivamente. El follaje se ofreció durante 15 min (de 1200 a 1215 h), simultáneamente en un comedero con sus separaciones respectivas. La preferencia por la edad de forraje de T. diversifolia se estimó mediante el consumo de follaje de cada edad de rebrote que se obtuvo con base en la cantidad de MS ofrecida menos la MS residual durante los 15 min en que se ofertó. Una muestra por edad ofrecida se colectó diariamente para determinar MS, PC, FDN, FDA y lignina.

243


Rev Mex Cienc Pecu 2022;13(1):240-257

Análisis estadísticos

Por ser la edad una variable continua, con los datos de biomasa producida a las distintas edades de rebrote se realizó un análisis de tendencias mediante polinomios ortogonales, con el fin de determinar si los efectos de primero a quinto grado de edad de la planta eran significativos o no. Asimismo, se compararon entre sí las épocas y se compararon las respuestas lineales, cuadráticas y logarítmicas, entre épocas. Se graficaron las medias de cuadrados mínimos y sus errores estándar (y) contra la edad de rebrote (x) para cada época y determinar el tipo de crecimiento que presentó la planta en las diferentes épocas, resultando una curva sigmoidea para otoño e invierno y una de tipo exponencial para primavera. En las dos primeras, se ajustaron a los datos con el siguiente modelo logístico: 𝑎 𝑏 𝑐 1+( ) 𝑥 Dónde: a, es el valor asintótico o máximo rendimiento de MS (kg ha-1); b, son los días al valor a/2; y c, es una constante que determina la pendiente. Para la época de primavera se usó la ecuación de crecimiento exponencial clásica que es: 𝑦 = 𝑎𝑒 𝑐∗𝑥 Dónde: a, es el valor del rendimiento de MS cuando x = 0, y c es la tasa de crecimiento relativo (kg kg-1 día-1). Para ajustar estos modelos se utilizó GraphPad Prism© v 7.05. Para determinar la preferencia de los ovinos por alguna de las tres edades de rebrote de T. diversifolia se utilizó un modelo generalizado mixto (procedimiento GLM) para un diseño completamente al azar y el modelo incluyó el efecto de tratamiento (edad), día y la interacción tratamiento*día; se utilizó el procedimiento GLM y la prueba de medias LSMEANS del Statistical Analysis System Version 9.3.

Resultados Rendimiento de materia seca (RMS) En RMS total (kg día-1), los efectos principales de edad, época y su interacción fueron significativos, sin embargo, los efectos principales de la edad de rebrote y la época, pierden relevancia por sí mismos, al interactuar entre sí (P<0.001), la respuesta de la edad depende de la época. Solo se encontró efecto de primer orden de la edad (P<0.001), en tanto que los efectos de segundo a quinto orden no fueron significativos (Cuadro 1). Con respecto a la época, otoño e invierno fueron similares entre sí (P=0.4036) y ambas superaron a la primavera (P<0.0005 y P<0.0001, respectivamente). El efecto lineal de la edad fue diferente entre invierno y primavera (P<0.0214) y entre otoño y primavera (P<0.0001). Por su parte, el efecto cuadrático solo difirió entre otoño y primavera 244


Rev Mex Cienc Pecu 2022;13(1):240-257

(P<0.0001), sucediendo lo mismo con el efecto cúbico (P<0.0001). Todo esto sugiere una respuesta curvilínea del RMS que difiere parcialmente entre las épocas. Cuadro 1: Comparaciones de los efectos de primero a quinto orden de la edad de rebrote de acuerdo a la época del año Contraste

Estimador

Error estándar

Valor de t

Pr > |t|

………………………………………………Edad …………………………………………… Lineal 55635.00 6039.16 9.21 <.0001 Cuadrático

-10024.00

6604.19

-1.52

0.1421

Cúbico

-17372.00

9677.15

-1.80

0.0852

Cuártico

1416.64

3814.71

0.37

0.7136

Quíntico

-4228.24

11416.00

-0.37

0.7143

……………………………………………… Época ………………………………………… Invierno vs otoño

-765.59

900.39

-0.85

0.4036

Invierno vs primavera

3529.51

880.92

4.01

0.0005

Otoño vs primavera

4295.11

148.15

28.99

<.0001

………………………………………… Lineal x Época ……………………………………… Invierno vs otoño

-4649.11

18453.00

-0.25

0.8032

Invierno vs primavera

44443.00

18061.00

2.46

0.0214

Otoño vs primavera

49092.00

3104.37

15.81

<.0001

……………………………………… Cuadrático x Época …………………………………… Invierno vs otoño

11108.00

20214.00

0.55

0.5877

Invierno vs primavera

-20541.00

19775.00

-1.04

0.3093

Otoño vs primavera

-31649.00

3314.05

-9.55

<.0001

………………………….……………… Cúbico x Época ……………………………………… Invierno vs otoño

-13391.00

29590.00

-0.45

0.6549

Invierno vs primavera

-43049.00

28956.00

-1.49

0.1501

Otoño vs primavera

-29658.00

4924.77

-6.02

<.0001

……………………………………… Cuártico x Época ……………………………………… Invierno vs otoño

-4077.04

11670.00

-0.35

0.7299

Invierno vs primavera

-3243.43

11419.00

-0.28

0.7788

Otoño vs primavera

833.61

1927.01

0.43

0.6692

……………………………………… Quíntico x Época ……………………………………… Invierno vs otoño

23420.00

35010.00

0.67

0.5099

Invierno vs primavera

18496.00

34233.00

0.54

0.5940

Otoño vs primavera

-4923.63

5559.25

-0.89

0.3846

El RMS a la edad de rebrote en cada época, como se observa en la Figura 2, otoño e invierno presentaron un comportamiento muy similar y el modelo logístico se ajustó adecuadamente (R2>0.9) a los datos. Por su parte, el modelo exponencial en primavera también presento una R2>0.9. 245


Rev Mex Cienc Pecu 2022;13(1):240-257

Figura 2: Relación entre días de rebrote y contribución porcentual a la composición botánica de los componentes flor, material muerto, tallo y hoja de Thitonia diversifolia en el trópico húmedo del estado de Veracruz

Componentes morfológicos de la planta

La prueba de efectos fijos tipo III reveló que la edad de rebrote, la época y la interacción de ambos fueron significativos en los modelos de los porcentajes de hoja, tallo, material muerto y flor que componen la MS de las plantas. Al igual que en el RMS, la respuesta al efecto de la edad dependió de la época (P<0.0001). Por ese motivo, también se hicieron las comparaciones entre sí, de los efectos lineales, cuadráticos, cúbicos, hasta de quinto orden, de las épocas (Cuadro 2). La mayoría de los contrastes fueron altamente significativos (P<0.0001), lo que indicó que la composición morfológica de la planta cambió en cada época, y que dicho cambio fue curvilíneo. El incremento (o decremento) 246


Rev Mex Cienc Pecu 2022;13(1):240-257

en la cantidad de hojas (Figura 2, Cuadro 3) por ejemplo, solo coincidió en incrementos cúbicos entre invierno y primavera (P=0.3662), e incrementos cuartico y quintico entre otoño y primavera (P=0.9221 y P =0.4229, respectivamente).

Cuadro 2: Probabilidades de las comparaciones entre épocas de los efectos de primer a quinto orden de la edad de rebrote sobre los porcentajes de hoja, tallo y material muerto (MM) de Tithonia diversifolia Contraste

Componente morfológico Hoja

Tallo

MM

Flor

Invierno vs otoño

…………………… Lineal …………………… <.0001 <.0001 0.3362

<.0001

Invierno vs primavera

0.0085

0.3349

<.0001

0.7830

Otoño vs primavera

<.0001

<.0001

0.0007

<.0001

………………… Cuadrático………………… Invierno vs otoño

<.0001

0.0318

<.0001

<.0001

Invierno vs primavera

0.0017

0.0019

<.0001

0.7939

Otoño vs primavera

<.0001

<.0001

0.0979

<.0001

…………………... Cúbico …………………… Invierno vs otoño

<.0001

<.0001

<.0001

<.0001

Invierno vs primavera

0.3662

0.0002

0.0011

0.8614

Otoño vs primavera

<.0001

<.0001

<.0001

<.0001

………………... Cuártico ………………….. Invierno vs otoño

<.0001

0.0006

0.0930

<.0001

Invierno vs primavera

<.0001

0.0010

0.0004

0.9286

Otoño vs primavera

0.9221

<.0001

<.0001

<.0001

…………………... Quíntico ………………….. Invierno vs otoño

<.0001

0.0283

<.0001

<.0001

Invierno vs primavera

0.0002

0.0002

0.6374

0.9747

Otoño vs primavera

0.4229

0.1098

<.0001

<.0001

247


Rev Mex Cienc Pecu 2022;13(1):240-257

Cuadro 3: Parámetros y estadísticos de ajuste de los polinomios de segundo y tercer grado, empleados para ver el efecto de la edad de rebrote (14, 28, 42, 56 y 84 días) sobre el porcentaje de los componentes morfológicos de la planta de Tithonia diversifolia Época

Parámetros B0 B1

B2

B3

Estadísticos de ajuste GL Sy.x R2

Otoño Invierno Primavera

171.0 108.1 135.0

-4.476 -1.519 -2.237

0.033850 0.006833 0.013040

-------------

1.997 6.097 14.210

0.9948 0.9579 0.8489

2 3 3

Otoño Invierno Primavera

-55.330 -4.246 -11.670

5.238 1.303 0.735

-0.099310 -0.006961 -0.001491

0.000601 ---------

1.946 5.142 10.450

0.9923 0.9640 0.8463

2 2 2

Otoño Invierno Primavera

-20.180 -4.641 -23.300

1.166 0.2684 1.502

-0.009266 -0.000417 -0.011550

-------------

9.300 1.481 5.314

0.4480 0.9419 0.8244

3 3 3

-4.369 0.1303 0.002447 ----5.18 0.8560 3 Otoño 0.1462 -0.01007 0.0001332 ----0.07136 0.7857 3 Invierno 1.982E-15 0.6153 3 Primavera 3.418E-15 -2.82E-16 3.222E-18 ----B0 = ordenada al origen (intercepto); B1, B2, B3= coeficientes de regresión de primero, segundo y tercer orden, respectivamente; Sy.x= desviación estándar del residual; R2= es la ajustada por el número de parámetros en la ecuación.

Congruente con el decremento de hojas e incremento de tallos con la edad, la cantidad de material muerto (Figura 2, Cuadro 3) también se incrementó, mostrando un comportamiento curvilíneo que difiere en algunos contrastes (Cuadro 2) pero con una tendencia a incrementarse en las tres épocas. La presencia de flores solo se observó en el otoño y a partir del día 42.

Composición química de MS de hojas

El contenido de PC aumentó en forma lineal a medida que aumento la edad de corte (Cuadro 4), con valores que fueron de 18.3 ± 2.9 a 21.3 ± 1.8 % para la edad de 42 y 84 días, respectivamente. La concentración de FDN, FDA y lignina aumentaron de 42 a 56 días y se mantuvieron de 70 a 84 días. El mayor porcentaje de FDA y lignina se registró en las épocas de otoño e invierno y el menor durante la primavera; con respecto a la edad, hubo mayor porcentaje en las plantas de 56 días de edad y menor en 84 días.

248


Rev Mex Cienc Pecu 2022;13(1):240-257

Cuadro 4: Contenido (%) de proteína cruda, fibra detergente neutro, fibra detergente ácida y lignina de T. diversifolia en diferentes épocas del año Edad (días)

PC

FDN

FDA

Lignina

17.0 21.7 19.7

47.5 52.0 46.3

35.0 37.7 33.3

22.3 23.7 20.2

21.3 19.6 18.1 20.9

48.9 51.7 48.0 41.4

34.5 38.5 34.5 24.2

21.4 25.1 22.9 12.6

31.8 32.1 39.3 44.6

18.9 18.8 22.9 28.5

8.0 11.6 13.4 18.7

42.6±6.6

28.3±6.8

17.4±5.2

Otoño 42 56 70 84 Invierno 42 56 70 84 Primavera 42 16.1 56 17.3 70 22.0 84 23.5 Promedio ± desviación estándar 19.8±2.4

PC= proteína cruda, FDN= fibra detergente neutro, FDA= fibra detergente ácido FDA.

Preferencia de Tithonia diversifolia por ovinos En la prueba de preferencia, el consumo (promedio ± EE) de MS de T. diversifolia a 42, 56 y 70 días de rebrote fue de 62.6 ± 2.1; 42.7 ± 3.1; 34.7 ± 3.7 g MS día-1, respectivamente (P<0.0001) y fue superior el consumo de follaje de 42 días (P<0.05). Al analizar los consumos diarios de materia seca, se observó una interacción marginal de la edad de rebrote x el día de prueba (P=0.06), que hizo que los consumos variaran a través de los días. En los primeros dos días, el consumo de follaje aumentó en las tres edades de corte. Mientras que del día 2 al 4 en la edad de 42 días disminuyó el consumo 49.1 %, de 56 y 70 días de rebrote disminuyó 25.7 y 45.3 %, respectivamente. Sin embargo, a partir de cuarto día en la edad de 42 el consumo aumento y a la edad de 56 el consumo se mantiene. Después del día 5, el consumo se mantuvo sin grandes fluctuaciones en las tres edades del follaje.

Discusión Rendimiento de materia seca Se ha reportado que con valores de precipitación pluvial menores a 50 mm/mes el rendimiento de MS de T. diversifolia, se puede reducir hasta en 90 %(24), porque es una 249


Rev Mex Cienc Pecu 2022;13(1):240-257

planta que responde ampliamente a la humedad(23,25). Los resultados obtenidos en el presente estudio son similares a los obtenidos en otras investigaciones(26). En las tres épocas, el rendimiento aumentó lentamente en las primeras semanas después del corte (Figura 2); en otoño a los 56 días y en invierno a los 70 días después del corte, las plantas alcanzaron un rendimiento cercano a las 9.0 t MS ha-1, mientras que, en primavera, a los 84 días la producción era cercana a 3 t MS ha-1. La estabilización del crecimiento entre los 56 y 70 días rebrote en otoño e invierno, está dada por la prefloración, tal como otros autores lo han mencionado(11,13,27), quienes recomiendan cosechar el forraje entre los 50 y 60 días de rebrote, cuando su contenido de proteína y FDN son mayores. Lo anterior muestra que en las condiciones agroecológicas donde se realizó la investigación, otoño e invierno son las épocas con las condiciones óptimas para el crecimiento de T. Diversifolia. Esta menor producción de MS en primavera fue efecto de una menor precipitación pluvial y altas temperaturas (Figura 1), que incluso proviene desde invierno(28); los mismos autores recomiendan una frecuencia de corte de 60 días en época de lluvias y 80 días en época de secas. Otros(29), también recomiendan realizar el aprovechamiento de forraje de 45 a 60 días de reposo en época de lluvias y 70 a 90 días en la época poco lluviosa. Se considera en cortes de 70 a 90 días, una buena producción de MS y calidad nutritiva de la misma(26). El ajuste al logístico de otoño e invierno y al exponencial de primavera obedecen a la disponibilidad de humedad proveniente de la precipitación pluvial registrada en cada época, mientras que en otoño e invierno se observa una precipitación de 164.7 mm y de 74.6 mm, en primavera fue 112.7 mm con una temperatura de 22.4 en otoño, 20.6 en invierno y 27.3 en primavera; sin embargo, la precipitación en primavera fue mínima durante el año de evaluación, aunado a la más baja precipitación observada en el invierno, lo cual podría explicar la menor producción de MS. La cantidad de materia seca en el presente estudio (9 t ha-1 de MS para otoño e invierno) es similar a las 9.1 t ha-1 con 20,000 plantas/ha y corte a 40 cm(30), pero menores a la informada por otros(31), lo cual además de la menor precipitación recibida en el presente ensayo, también podría relacionarse con el uso de plantas jóvenes en primavera debido a que su siembra se realizó en julio de 2018, y a esta edad tienen menor cantidad de ramas y consecuentemente menor rendimiento de materia seca total, además de la disponibilidad de precipitación pluvial recibida. En Colombia, la producción fue de aproximadamente 30 a 70 t ha-1 por corte de forraje verde, dependiendo de la densidad de siembra, suelos y estado vegetativo(32). Por otro lado, citan una producción anual de 13.52 t MS ha-1 anual, con diferencias significativas entre el periodo lluvioso (9.1 t MS ha-1 anual) y el periodo menos lluvioso (4.42 t MS ha-1 anual)(25). Otros autores(7) mencionan que, si los cortes se realizan a menor edad, por ejemplo, entre 30 y 60 días de rebrote la producción de MS es mayor a la que se obtuvo con cortes a 90 y 110 días de edad de la planta(25). El rendimiento de 3 t MS ha-1 en primavera, es menor a las 3.5 t MS ha-1 a los 60 días de edad reportada(28) en época seca, y a las 4.42 t MS ha-1 anual(25). 250


Rev Mex Cienc Pecu 2022;13(1):240-257

Componentes morfológicos de la biomasa Aunque el cambio en RMS de hojas fue curvilíneo, la tendencia fue a un decremento de hojas en el tiempo (Figura 2; Cuadro 3), con un ligero incremento hacia el final de la primavera; esto se debe a que las plantas experimentan un segundo periodo de crecimiento con la presencia de lluvias en las últimas cosechas, en el mes de junio normalmente se registra la presencia de las primeras lluvias de la temporada. El efecto de la edad en la cantidad de tallos que varía entre épocas es razonable y se explica primeramente por la edad de las plantas, ya que a medida que las plantas crecen la proporción hoja-tallo disminuye, las plantas acumulan más tallo como estructura de soporte; este hecho puede variar entre las épocas por efecto de las variables climáticas, principalmente de la precipitación pluvial que induce un crecimiento rápido y proporcional entre hojas y tallos, mientras que en el estiaje primavera e invierno (época con temperaturas más bajas) las plantas pueden limitar el crecimiento de hojas o presentar senescencia de hojas disminuyendo la relación hoja:tallo(33). La tendencia en la aparición de materia muerta es esperada a edades mayores de las plantas lo cual es natural, pero también puede haber disminución de este material en el transcurso del periodo de crecimiento porque las hojas senescentes se desprenden o porque hay repuntes de crecimiento que cambian las relaciones entre los componentes de las plantas(29,34). Como se observa con la disminución de hoja en otoño hasta los 56 días y con el incremento de tallo a la misma edad. La presencia de flores se observó desde los 42 a 70 días de rebrote en otoño, este incremento observado al inicio de otoño y decremento al final de la misma época, se asocian con la disminución de la temperatura al inicio y final de otoño, respectivamente y que continua en el invierno, similares resultados reportan otros autores(11,13,34). Así como también se reporta un ligero decremento a mayor edad de rebrote en primavera y otoño asociado a un aumento de la temperatura(25). La capacidad forrajera de Tithonia diversifolia y su calidad nutricional, están determinados entre otros factores por el estado fenológico(34), sin embargo, al evaluar el corte de T. diversifolia en distintos estados fenológicos (pre-floración, floración y después de la floración), se ha reportado, que los rendimientos son más altos, después de la floración(35). Por lo anterior, se recomienda 42 días como momento más adecuado para cosechar el forraje durante el otoño, sin causar daño al cultivo en el estado de prefloración y con mayor preferencia por los ovinos Pelibuey. Asimismo, la presencia de flores observada en otoño a partir del día 42, coincide con lo indicado en otros estudios(29,36). Algunos autores sugieren el corte de 50 días con una producción de biomasa verde de 3.5 t MS ha-1 (13,25,29). Sin embargo, otros autores recomiendan, a los 60 días con 7.2 t MS ha1 año(7,28) o 70 días(36), en cambio, en ramoneo la recuperación de la planta requiere periodos más prolongados, 60 a 90 días según el clima(29,30). Aunque, opuesto a la 251


Rev Mex Cienc Pecu 2022;13(1):240-257

cantidad de hojas en el tiempo, la cantidad de tallos tiende a incrementarse con el aumento de la edad de rebrote(11,24); todos los incrementos en rendimiento son diferentes entre las épocas, excepto la similitud del efecto lineal entre invierno y primavera. Se puede observar que existen diferencias en la edad de corte para mejor rendimiento, esto se relaciona con condiciones climáticas de cada región por lo que se podría sugerir es que el corte se realice en prefloración o inicio de floración(34,35).

Composición química El contenido de PC aumentó en forma lineal a medida que aumento la edad de corte, estos datos son similares a los reportados en Cuba al estudiar 29 materiales de T. diversifolia(26). Se ha encontrado 14.1 % PC a 56 días de rebrote en planta completa(10), y también 29.79 y 17.27 % PC, a 30 y 60 días de edad, respectivamente(7). Los valores de FDN y FDA registrados en el presente estudio, son similares a los reportados por otros autores (32.62 a 41.83 %), en diferentes cultivares de T. diversifolia(26) y los de FDA (14.8 a 18.92 %) son ligeramente menores a los del presente ensayo. Se han reportado valores elevados de FDN (53.81 %) y FDA (48.18 %)(10) entre otros (36), pero se realizaron con planta completa, a edades mayores de 56 días y con altura de corte menor (30 cm) a la del presente ensayo. No obstante, el valor de FDN del T. diversifolia del presente ensayo es menor al compararlo con lo reportado en Digitaria eriantha(37), y similar al reportado en Leucaena leucocephala(38) bajo pastoreo. El contenido de FDN y FDA registrados, puede explicar por qué T. diversifolia es una planta con alto porcentaje de degradabilidad que la hace muy apetecible por los ovinos(36). El porcentaje de FDA y lignina muestra tendencia a incremento a los 56 días en otoño e invierno y decremento durante la primavera, esto podría relacionarse con la presencia de floración en el otoño, mientras que en invierno además tenga efecto la disminución de humedad y baja de temperatura.

Preferencia de Tithonia diversifolia por ovinos Los ovinos prefirieron el forraje de 42 días de edad, seguido por el de 56 y el de 70 días, lo que indica que a mayor edad menor consumo; esto puede deberse a una mejor calidad nutricia a los 42 días, por su mayor contenido de PC y menor contenido de fibra como también ya se ha reportado(23), además que a menor edad de la planta la proporción de hoja es mayor y los tallos más tiernos, lo que genera una relación hoja-tallo mayor(38). Después del día 5, el consumo fue mayor y se mantuvo sin grandes fluctuaciones en las tres edades del follaje. Lo anterior, confirma la observación de que los ovinos requieren de 6 a 8 días para estabilizar su consumo de T. diversifolia(23). La tendencia en la interacción (edad x día) de 42 días de rebrote en el día 4 de la prueba, podría ser debido a diferentes factores como la edad de la planta, pero también de la

252


Rev Mex Cienc Pecu 2022;13(1):240-257

época(39) y del suelo donde se encuentra la planta cosechada, como se reporta en T. diversifolia y Gliricidia sepium(40).

Conclusiones e implicaciones El rendimiento de materia seca y la calidad nutritiva de T. diversifolia difiere según la época del año, es mayor en otoñó e invierno que en primavera, por lo cual, bajo las condiciones agroecológicas que imperan en la zona, se recomienda utilizar el follaje a los 42 días de rebrote en otoño, a los 70 días en invierno y después de los 84 días en primavera. Los ovinos consumen el follaje de esta especie a cualquier edad ofrecida entre 42 y 84 días de edad, sin embargo, ellos prefieren el follaje más joven que tiene mayor calidad nutritiva. La cosecha de plantas a los 42 días para satisfacer la preferencia de los ovinos implica sacrificar el rendimiento de biomasa a una edad tan temprana. Este dilema requiere investigaciones más precisas para conocer el consumo voluntario y la ganancia de peso de los ovinos cuando se incrementa la edad del follaje ofrecido. El rendimiento potencial, el alto valor nutritivo y la preferencia mostrada por los ovinos, hacen que esta planta tenga un alto potencial forrajero para la alimentación de esta especie y otros rumiantes en condiciones tropicales. Es necesaria una mayor profundización en la investigación de T. diversifolia para evaluar diferentes densidades de plantación en las épocas climáticas que se presentan y su relación con el rendimiento, calidad nutricia, respuesta animal y al ambiente. Agradecimientos y conflicto de interés Los autores manifiestan no tener conflicto de intereses de ningún tipo. Literatura citada: 1. Góngora-Pérez RD, Góngora-González FS, Magaña-Magaña AM, Lara PEL. Caracterización técnica y socioeconómica de la producción ovina en el estado de Yucatán, México. Agron Mesoam 2010;(21):131-144. 2. Ramírez-Rivera U, Sanginés-García JR, Escobedo-Mex JG, Cen-Chuc F, Rivera-Lorca JA, Lara-Lara PE. Effect of diet inclusion of Tithonia diversifolia on feed intake, digestibility and nitrogen balance in tropical sheep. Agrofor Syst 2010;(80):295-302. 3. Archiméde A, Eugéne M, Marie-Magdeleine C, Boval M, Martín C. Comparison of methane production between C3 and C4 grasses and legumes. Anim Feed Sci Technol 2011;(166-167):59-64. 4. Sanginés-García JR, Ku-Vera CJ, González-Valencia C, Ramón-Ugalde PJ. Ewe production in a pasture of star Grass (Cynodon nlenfuensis) fertilized with swine lagoon effluent. Small Ruminant Res 2003;(49):135-139.

253


Rev Mex Cienc Pecu 2022;13(1):240-257

5. Izaguirre F, Martínez TJJ, Jiménez FJO, Posada CS, García CCG, Martínez PC. Respuesta reproductiva y productiva de borregas Pelibuey a la suplementación con hojas de Caulote (Guazuma ulmifolia), Guaje (Leucaena leucocephala) y Yaite (Gliricidia sepium) en condiciones de trópico húmedo. Livest Res Rural Dev 2011;23(10):1-10. 6. Castañeda-Serrano RD, Piñeros-Varón R, Vélez-Giraldo A. Foliage of tropical arboreal species in feedenig ovines (Ovis aries): Intake, digestibility and balance nitrogen. Biol Scient Mus Hist Nat Univ Caldas 2018;22(1):58-68. 7. Lezcano Y, Soca M, Ojeda F, Roque E, Fontes D, Montejo IL, Santana H, Martínez J, Cubillas N. Caracterización bromatológica de Tithonia diversifolia (Hemsl.) A. Gray en dos etapas de su ciclo fisiológico. Pastos y Forrajes 2012;(35):275-282. 8. Molina IC, Donney´s GC, Montoya S, Rivera JE, Villegas G, Chará J, Barahona R. La inclusión de Leucaena leucocephala reduce la producción de metano de terneras Lucerna alimentadas con Cynodon plectostachuys y Megathyrsus maximus. Livest Res Rural Dev 2015;27(5):96. 9. Sandoval-Pelcastre AA, Ramírez-Mella MN, Rodríguez-Ávila NL, CandelariaMartínez B. Árboles y arbustos tropicales con potencial para disminuir la producción de metano en rumiantes. Revisión. Trop Subtrop Agroecosyst 2020;23(33):1-16. 10. Gallego-Castro LA, Mahecha-Ledesma L, Angulo-Arizala J. Calidad nutricional de Tithonia diversifolia Hemsl. A Gray bajo tres sistemas de siembra en el trópico alto. Agron Mesoam 2017;28(1):213-222. 11. Verdecia DM, Ramírez JL, Leonard I, Álvarez Y, Bazán Y, Bodas R, Andrés S, Álvarez J, Giráldez F, López S. Calidad de la Tithonia diversifolia en una zona del Valle del Cauco. Rev Electrón Vet 2011;12(5):1-13. 12. Botero-Londoño JM, Gómez-Carabalí A, Botero-Lodoño MA. Yield, agronomic parameters and nutritional quality of Tithonia diversifolia in response to different fertilization levels. Rev Mex Cienc Pecu 2019;10(3):789-800. 13. Mejía-Díaz E, Mahecha-Ledezma L, Angulo-Arizala J. Thitonia diversifolia especie para ramoneo en sistemas silvopastoriles y métodos para estimar su consumo. Agron Mesoam 2017;28(1):289-302. 14. La OO, González H, Orozco A, Castillo Y, Ruíz O, Estrada A, Castro B. Composición química, degradabilidad in situ y digestibilidad in vitro de ecotipos de T. diversifolia de interés para la alimentación de rumiantes. Rev Cuba Cienc Agríc 2012;46(1):4753. 15. Cardona-Iglesias JL, Mahecha-Ledezma L, Angulo-Arizala J. Arbustivas forrajeras y ácidos grasos: estrategias para disminuir la producción de metano entérico en bovinos. Agron Mesoam 2016;28(1):273-288.

254


Rev Mex Cienc Pecu 2022;13(1):240-257

16. Rivera JE, Chará J, Gómez-Leyva JF, Ruíz T, Barahona R. Variabilidad fenotípica y composición fitoquímica de Tithonia diversifolia A. Gray para la producción animal sostenible. Livest Res Rural Dev 2018;(30):200. 17. González-Castillo JC, von-Hessberg CMH, Narvaéz-Solarte W. Características botánicas de T. diversifolia (Asterales : asterácea) y su uso en la alimentación animal. Bol Cient Mus His Nat 2014;18(2):45-58. 18. Gómez-Gurrola A, Del Sol García G, Sanginés-García L, Loya-Olguín L, BenítezMeza A, Hernández-Ballesteros A. Rendimiento en canal de corderos de pelo, alimentados con diferentes proporciones de Tithonia diversifolia y Pennisetum spp. Ábanico Veterinario 2017;7(2):34-42. 19. Olabode OS, Sola O, Akanbi WB, Adesina GO, Babajide PA. Evaluation of Tithonia diversifolia (Hemsl.) Gray for soil improvement. World J Agr Sci 2007;3(4):503507. 20. Argüello-Rangel J, Mahecha-Ledezma L, Angulo-Arizala J. Arbustivas forrajeras: importancia en las ganaderías de trópico bajo Colombiano. Agron Mesoam 2019;30(3):899-915. 21. García E. Modificaciones al sistema de clasificación climática de Koópen. 4a. ed. México: Ed. Limusa; 1987. 22. A.O.A.C. Official Methods of Analysis of the Association of Official Agricultural Chemists. 12 th ed. Published by the Association of Official Agricultural Chemists. Washington, D.C. 1975. 23. García DE, Medina MG, Clavero T, Humbría J, Baldizán A, Domínguez C. Preferencia de árboles forrajeros por cabras en la zona baja de los andes Venezolanos. Rev Cient FCV LUZ 2008;(18):549-555. 24. Navas-Panadero N, Montaña V. Comportamiento de Tithonia diversifolia bajo condiciones de bosque húmedo tropical. Rev Invest Vet Perú 2019;30(2):721-732. 25. Castillo-Mestre R, Betancourt-Bagué T, Toral-Pérez OC, Iglesias-Gómez JM. Influencia de diferentes marcos de plantación en el establecimiento y la producción de Tithonia diversifolia. Pastos y Forrajes 2016;39(2):89-93. 26. Ruíz TE, Alonso J, Febles GJ, Galindo JL, Savón LL, Chongo BB, Torres V, Martínez Y, La OO, Gutiérrez D, Crespo GJ, Cino DM, Scull I, González J. Tithonia diversifolia: I. Estudio integral de diferentes materiales para conocer su potencial de producción de biomasa y calidad nutritiva. Avances en Investigación Agropecuaria 2016;20(3):63-82. 27. Partey TS. Effect of pruning frequency and pruning heigth on the biomass production of Tithonia diversifolia (Helms.) A. Gray. Agrofor Syst 2011;(83):181-187.

255


Rev Mex Cienc Pecu 2022;13(1):240-257

28. Ruíz TE, Febles G, Díaz H. Distancia de plantación, frecuencia y altura de corte en la producción de biomasa de Tithonia diversifolia colecta 10 durante el año. Rev Cub Cienc Agríc 2012;46(4):423-426. 29. Alonso J, Achan G, Santos LDT, Sampaio RA. Comportamiento productivo de Tithonia diversifolia en pastoreo con reposos diferentes en ambas épocas del año. Livest Res Rural Dev 2015;27(6):Article 15. 30. Holguín S, Ortiz A, Velasco A, Mora J. Evaluación multicriterio de 44 introducciones de Tithonia diversifolia (Hemsl.) A. Gray en Candelaria, Valle del Cauca. Rev Med Vet Zootec 2015;62(2):57-72. 31. Alonso J, Ruíz T, Achang G, Santos L, Sampaio R. Producción de biomasa y comportamiento animal en pastoreo con Tithonia diversifolia a diferentes distancias de plantación. Livest Res Rural Dev 2012;(24):Article1#60. http://www.Irrd.org/Irrd24/9/lazo24160.htm 32. Ríos CI, Salazar A. Botón de oro (Tithonia diversifolia Hemsl Gray) una fuente proteica alternativa para el trópico. Livest Res Rural Dev 1995;6(3):Article #25. 33. Buchanam-Wollaston V, Earl S, Harrison E, Mathas E, Navabpour S, Pague T, Pink D. Review. The molecular analysis of leaf senescence –a genomics approach. Plant Biotech J 2003;(1):3-22. 34. Londoño CJ, Mahecha LL, Angulo AJ. Desempeño agronómico y valor nutritivo de Tithonia diversifolia (Hemsl) A Gray para la alimentación de bovinos. Rev Colombiana Cienc Anim 2019;11(1). 35. De Souza,OFJ. Influência do espaçamento e da época de corte na produção de biomassa e valor nutricional de Tithonia diversifolia HEMSL.) Gray. Dissertação [Mestrado]. – Faculdade de Ciências Agrárias, Universidade de Marília, Unimar, Brasil. 2007. 36. Zavala Y, Rodríguez JC, Cerrato M. Concentración de carbono y nitrógeno a seis frecuencias de poda en Tithonia diversifolia y Morus alba. Tierra Tropical 2007;3(2):149-159. 37. Azuara-Morales I, López-Ortiz S, Jarillo-Rodríguez J, Pérez-Hernández P, OrtegaJiménez E, Castillo-Gallegos E. Forage availability in a silvopastoral system having different densities of Leucaena leucocephala under Voisin grazing management. Agrofor Syst 2020;(20):1-11. 38. García-Ferrer L, Bolaños-Aguilar ED, Ramos-Juárez J, Arce MO, Lagunes-Espinoza LC. Rendimiento y valor nutritivo de leguminosas forrajeras en dos épocas del año y cuatro edades de rebrote. Rev Mex Cienc Pecu 2015;6(4):453-468.

256


Rev Mex Cienc Pecu 2022;13(1):240-257

39. Cabrera-Carrión JL, Jaramillo-Jaramiillo C, Dután-Torres F, Cun-Carrión J, García PA, Rojas de Astudillo L. Variación del contenido de alcaloides, fenoles, flavonoides y taninos en Moringa oleífera Lam. en función de su edad y altura. Bioagro 2017;29(1):53-60. 40. Santacoloma VLE, Granados JE. Interrelación entre el contenido de metabolitos secundarios de las especies Gliricidia Sepium y Tithonia diversifolia y algunas propiedades fisicoquímicas del suelo. Revista de Investigación Agraria y Ambiental 2012;3(1):53-62.

257


https://doi.org/10.22319/rmcp.v13i1.5567 Nota de investigación

Efecto del aceite de orégano en las propiedades fisicoquímicas, texturales y sensoriales del queso panela

Niriel Sánchez-Zamora a Mónica Dinorah Cepeda-Rizo a Katty Lorena Tamez-Garza a Beatriz Adriana Rodríguez-Romero a Sugey Ramona Sinagawa-García a Alejandro Isabel Luna Maldonado a Emmanuel Flores-Girón b Gerardo Méndez-Zamora a*

a

Universidad Autónoma de Nuevo León. Facultad de Agronomía. Francisco Villa s/n, ExHacienda El Canadá. 66050, General Escobedo, Nuevo León, México. b

Universidad Autónoma Chapingo, Departamento de Ingeniería Agroindustrial. Estado de México, México.

* Autor de correspondencia: gerardo.mendezzm@uanl.edu.mx; mezage@hotmail.com

Resumen: Los aceites esenciales obtenidos de plantas están siendo usados en la industria alimentaria debido a su efectividad antimicrobiana, antioxidante y sensorial. En esta investigación se evaluó el efecto del aceite esencial de orégano (AEO) en la elaboración del queso panela (QP) sobre sus propiedades fisicoquímicas, texturales y sensoriales en 15 días. Tres tratamientos se establecieron: testigo (QP1), AEO en 0.05 g/L (QP2) y 0.10 g/L de leche (QP3). El pH de los quesos fue mayor (P<0.05) al día 1 y menor al día 15, y la acidez menor

258


Rev Mex Cienc Pecu 2022;13(1):258-271

en QP2 al día 1 y en QP3 al día 4. La luminosidad al día 1 fue mayor (P<0.05) en QP2 y menor en QP1. La dureza aumentó (P<0.05) en QP1 y disminuyó en QP2 al día 1 y 8. El pH, acidez y textura del queso se mantienen con 0.05 g AEO/L, y con 0.1 g AEO/L leche mejora la aceptación sensorial. Palabras clave: Esencial, Calidad, Color, Leche, Atributos.

Recibido: 18/12/2019 Aceptado: 12/05/2021

La producción de queso fresco tipo panela en México ha aumentado en los últimos años. En el 2018 se reportó una producción nacional de 51.34 mil toneladas de queso panela, las cuales generaron $2.96 millones, y en 2019 la producción fue de 52.10 mil toneladas y un valor económico de $3.07 millones(1). La leche y sus derivados son importantes por el aporte nutrimental en la mayoría de los humanos, siendo el queso uno de los productos básicos en la dieta de la población. El queso panela es un producto de consumo popular en México, de color blanco y forma tronco-cónica invertida(2), características similares al queso feta Griego(3). No obstante, los quesos pueden presentar procesos bioquímicos como la lipólisis y proteólisis, y elevada actividad de agua, que los hace susceptibles a la oxidación y deterioro microbiológico, disminuyendo su vida de anaquel(4). Además, el queso se considera un alimento muy perecedero y debe ser almacenado a una temperatura menor de 5 °C(5). Alternativas para incrementar la vida de anaquel en quesos frescos han sido los carbonatos, citratos, gomas, sorbatos y propionatos(6), que reducen la actividad del agua, regulan la acidez, estabilizan y conservan el queso. Sin embargo, en la actualidad el consumidor busca quesos sin conservadores o libres de productos químicos que puedan afectar su salud, por lo que aditivos naturales como los aceites esenciales (AE) de plantas aromáticas podrían ser una opción en la conservación. Las propiedades antioxidantes y antimicrobianas del aceite esencial de orégano (AEO) retardan la oxidación de los alimentos, manteniendo sus propiedades fisicoquímicas y mejoran su vida útil, lo que causa una aceptación de los consumidores(4). A la fecha, los estudios en quesos o productos lácteos con el uso de AE como agente conservante son escasos(7). Los AEO y romero demuestran un efecto positivo contra la oxidación lipídica y fermentación de quesos preparados con una base de crema(7); además, la adición de AEO en el queso cottage orgánico disminuyó el proceso de deterioro de los parámetros de calidad durante el almacenamiento, lo que indica su uso como conservador natural en los alimentos perecederos(4).

259


Rev Mex Cienc Pecu 2022;13(1):258-271

Por lo anterior, el objetivo de esta investigación fue evaluar el efecto del aceite esencial de orégano (AEO; Lippia berlandieri Schauer) durante la elaboración del queso panela sobre sus propiedades fisicoquímicas, texturales y sensoriales en 15 días de almacenamiento a 4 °C. Un diseño completamente al azar de tres tratamientos (queso panela; QP) se empleó en este estudio, donde el AEO fue usado en concentraciones de 0.05 y 0.10 g de AEO/L de leche en la elaboración de queso panela: QP1= queso panela testigo (sin AEO); QP2= queso panela + 0.05 g AEO/L leche; y QP3= queso panela + 0.10 g AEO/L leche. El AEO fue adquirido de la empresa Natural Solutions SMI (Jiménez, Chihuahua, México). La composición del AEO se determinó por cromatografía de gases (PerkinElmer Clarus 600 and SQ8 GC/MS; PerkinElmer Inc., Waltham, MA, USA) de acuerdo al método de Vazquez y Dunford(8), siendo los constituyentes principales 60.0 % carvacrol, 16.1 % cimeno, 5.4 % terpineno y 3.4 % timol. El AEO se emulsificó con Tween20 en una relación 50:50 (AEO:emulsificante) para incorporarlo en la leche. El establecimiento de esta relación AEO:emulsificante se obtuvo a partir de pruebas preliminares: el AEO se mezcló con el emulsificante y se agitó manualmente durante 3 min; la mezcla se almacenó a 26 °C durante 10 días, considerando inestabilidad de la emulsión cuando se observó una capa cremosa, aceitosa o gotas de aceite. La norma general para los aditivos alimentarios(9) se consideró para establecer el límite máximo (80 mg/kg) del Tween 20 (monalaurato de sorbitán polioxietinelado (2)) en los quesos no madurados (número 01.6.1; nota 38-sobre la base de la mezcla que se ha de descremar). Cada tratamiento involucró dos réplicas de queso por tratamiento y periodo (1, 4, 8 y 15 días; 24 quesos totales). Para cada queso se usaron 3.5 l de leche comercial pasteurizada (Comercializadora de Lácteos y Derivados, S.A. de C.V.), con una composición (g/100 ml): 3.12 proteína, 3.32 grasa, 4.80 carbohidratos, 0.046 Na y 0.116 Ca. Las variables estudiadas se evaluaron cuatro veces por cada réplica (n= 8 periodo/tratamiento) a los días 1, 4, 8 y 15. La elaboración del queso panela se realizó de acuerdo al proceso establecido por Villegas de Gante y Santos Moreno(10). La leche comercial de cada réplica fue ajustada a una temperatura de 34 °C, el CaCl2 (15 g/100 L leche; disuelto en agua purificada) se adicionó lentamente a la leche con agitación constante. La adición del AEO emulsificado en QP2 y QP3 se realizó después de la incorporación del CaCl2, mezclándolo lentamente durante 2 min. Después, el cuajo (CUAMIXM.R., CHR HANSEN de México S.A. de C.V., CDMX, México; 15 mL/100 L leche; diluido en agua purificada) se adicionó a la leche lentamente con agitación constante durante 1 min y se dejó reposar durante 40 min para el cuajado de la leche. Enseguida, la cuajada se cortó en cubos (1 cm3), reposando 5 min y se agitó lentamente elevando la temperatura a 38 °C por 2 min, y después de reposar 5 min, la masa de queso se obtuvo mediante un desuerado parcial (2/3 del suero fue retirado). Así, el salado (600 g de NaCl/100 L leche) se efectuó, incorporando la sal lentamente con agitación constante y lenta.

260


Rev Mex Cienc Pecu 2022;13(1):258-271

Posteriormente, el moldeado por autoprensado se realizó en moldes cilíndricos de plástico, volteando el queso cada 30 min, dos veces por cada lado. Finalmente, el queso se pesó, empacó al vació, se codificó (réplica/tratamiento/periodo) y se refrigeró a 4 °C hasta su evaluación a los 1, 4, 8 y 15 días. Las variables fisicoquímicas evaluadas fueron los pesos de los quesos (PQ), la pérdida de peso (%PPQ), pH, acidez titulable y color. El PQ fue determinado en los 24 quesos (ocho quesos/tratamiento; considerado como el tiempo cero); durante el almacenamiento, los quesos fueron distribuidos aleatoriamente. Posteriormente, los pesos de los quesos se tomaron a los días 1, 4, 8 y 15 para calcular el %PPQ [(PQinicial–PQfinal)/PQinicial))*100]. El pH se determinó con un electrodo de punción (Orion 3 star ThermoFisher Scientific, Pittsburgh, PA, U.S.A.) en 50 g de queso (cuatro puntos) en cada una de las réplicas de cada tratamiento. La acidez titulable (AT) se determinó de acuerdo al método establecido de Sanz et al(11) con modificaciones en la preparación de la muestra: 1 g de QP fue macerado totalmente en 10 g de agua destilada, posteriormente 9 g de la mezcla fueron tomados, colocándoles tres gotas de fenolftaleína y titulados con NaOH (0.1 M). La siguiente fórmula se utilizó para calcular la AT (g ácido láctico por 100 g de producto) = (V × 0.9)/m; donde V es el volumen (ml) de 0.1 M hidróxido de sodio, m es la masa (en gramos) de la muestra y 0.9 es el factor de conversión del ácido láctico. Los parámetros de color: luminosidad (L*), tendencia al rojo (a*), tendencia al amarillo (b*), ángulo de Hue y Chroma (Chro; saturación) se midieron con un colorímetro CR-400 (Konica Minolta®, Tokyo, Japón), basado en al sistema CIE Lab(12). Cada una de las pruebas se realizó ocho veces en cada tratamiento por periodo. La fuerza de corte (FzaC) y el análisis del perfil de textura (APT) se realizaron en cuatro muestras de queso/réplica de cada tratamiento/periodo (n= 8 muestras/tratamiento/periodo) con un texturómetro (TA.XT.Plus, Stable Micro Systems Serrey, England) a los días 1, 8 y 15. En la FzaC una navaja Warner-Bratzler de 3 mm con triángulo invertido se usó para realizar el corte en muestras rectangulares estandarizadas a 1 cm ancho, 1 cm alto y 3.5 cm largo. Las condiciones de prueba fueron velocidad pre-prueba 1.0 mm seg-1, durante prueba 2.0 mm seg-1 y post-prueba de 10.0 mm seg-1. La FzaC se obtuvo del punto máximo de la curva generada. En el APT, las muestras (8 ºC) se estandarizaron a 1.5 cm de altura y 2.5 cm de diámetro, sometidas a una compresión del 50 % de su altura usando un pistón cilíndrico (75 mm diámetro). Las condiciones de prueba fueron velocidad pre-prueba de 2 mm seg-1, en prueba 2 mm seg-1 y post-prueba 5 mm seg-1, con un tiempo de 5 seg entre ciclos. Curvas de deformación fueron obtenidas de dos ciclos de compresión para obtener los parámetros de dureza (Newton; N), adhesividad (g seg-1), elasticidad (mm), cohesividad (adimensional), gomosidad (g), masticabilidad (g mm-1) y resistencia (adimensional), definidos de acuerdo a Bourne(13), e implementados por Lobato-Calleros et al(14) y Salinas-Valdés et al(15).

261


Rev Mex Cienc Pecu 2022;13(1):258-271

Una evaluación sensorial afectiva por atributos se realizó a los días 1, 4, 8 y 15 con 20 panelistas (n= 20 por periodo) semientrenados y consumidores habituales de queso. Cada consumidor recibió aleatoriamente cuatro cubos de queso de 1 cm3 a 8 °C, colocados en vasos de plástico transparentes codificados con tres dígitos aleatorios. Los atributos evaluados fueron color blanco, olor, sabor, blandura y aceptabilidad global. Una escala hedónica de 5 puntos se usó en la evaluación, donde 5 me gusta mucho, 4 me gusta, 3 ni me gusta ni me disgusta, 2 me disgusta y 1 me disgusta mucho(16,17). El arreglo de los datos fue mediante un diseño completamente al azar y analizados con el procedimiento GLM de SAS(18) considerando el siguiente modelo estadístico: yij = µ + Ƭi + δj + (Ƭδ)ij + Ԑij; Donde: yijk = variables fisicoquímicas, textura y sensoriales evaluadas a través del tiempo; µ = media general; Ƭi = efecto del i-ésimo tratamiento (QP1, QP2 y QP3); δj = efecto del j-ésimo día de evaluación (1, 4, 8 y 15 días); (Ƭδ)ij = efecto de la interacción entre el i-ésimo tratamiento y el j-ésimo día; Ԑijk = error aleatorio distribuido en forma normal con media y varianza [Ԑij ~ N (µ, σ2)]. Del análisis de varianza obtenido, un valor de probabilidad menor a 0.05 (P<0.05) fue considerado para rechazar la hipótesis nula (H0; igualdad de tratamientos, días e interacción; α= 0.05). Cuando existió efecto de los factores fijos y la interacción, las medias se compararon con la instrucción adjust = tukey(18). La pérdida de suero, el pH y la acidez titulable (AT) son parámetros usados para evaluar la calidad de los quesos en conservación. El Cuadro 1 muestra la variación del peso, pH y AT de quesos formulados con leche tratada con 0.05 (QP2) y 0.10 (QP3) g AEO a los 15 d de conservación. El efecto de la interacción de los tratamientos con el tiempo (días) sobre peso, pH y AT fueron diferentes (P<0.05). El peso de QP2 fue mayor al día 1 y QP3 al día 15. Al día 1, los valores de pH incrementaron (P<0.05) y al día 15 decrecieron (P<0.05). El %PPQ no fue diferente (P>0.05) entre tratamientos y días. La liberación de agua durante la producción comercial de queso es conocida como sinéresis, y depende del pH, temperatura, sal, composición de la leche y los pre-tratamientos(19). El queso panela almacenado a 4 °C pierde agua (lactosuero) que es considerada como sinéresis. En consecuencia, la pérdida de peso se afecta cuando son tratados con algún aditivo. Esto pudo apreciarse en las diferencias del peso de los QP, los cuales fueron menores en QP1 en el tiempo (15 días). Asimismo, el %PPQ presentó una tendencia en el tiempo (δj; P=0.0592) pero no así en tratamientos (Ƭi; P=0.2553). Estos resultados mostraron que la adición de AEO no modifica la sinéresis en los quesos (%PPQ) durante su almacenamiento.

262


Rev Mex Cienc Pecu 2022;13(1):258-271

Cuadro 1: Comportamiento del peso, pH y acidez titulable en quesos elaborados con leche tratada con aceite de orégano en 15 días de almacenamiento Variables2 Tratamientos (Ƭi)1 /Días (δj) Peso (g) %PPQ pH AT 1 día QP1 183.50b;AB 5.39 6.41A 0.016a;BC QP2 223.00a;A 3.88 6.42A 0.014a;C QP3 199.50b;AB 5.91 6.42A 0.016a;BC 4 días QP1 204.00a;AB 5.78 6.32B 0.019a;B QP2 202.00a;AB 5.40 6.31B 0.018a;B QP3 184.50a;AB 5.87 6.36AB 0.014a;C 8 días QP1 179.50a;AB 6.03 6.28B 0.028a;B QP2 196.00a;AB 5.55 6.29B 0.025a;B QP3 177.00a;AB 5.60 6.31B 0.029a;B 15 días QP1 173.00a;B 7.80 5.68C 0.044a;A QP2 177.00a;AB 6.81 5.73C 0.040a;A QP3 182.00a;AB 5.70 5.66C 0.029b;B EEM 6.14 0.68 0.01 0.002 P-value Ƭi 0.0094 0.2553 0.2858 0.0109 δj 0.0013 0.0592 < 0.0001 < 0.0001 (Ƭδ)ij 0.0383 0.3793 0.0124 0.0025 1

QP1= queso panela control (sin AEO); QP2= queso panela + 0.05 g AEO/L leche; y QP3= queso panela + 0.10 g AEO/L leche. EEM= error estándar de la media; Ƭi= efecto del i-ésimo tratamiento; δj= efecto del jésimo día de evaluación (1, 4, 8 y 15 días); (Ƭδ)i=: efecto de la interacción entre el i-ésimo tratamiento y el jésimo día. 2 %PPQ= pérdida del peso quesos; AT= acidez titulable (g ácido láctico/100 g producto). a-b Medias en la misma columna, entre tratamientos y en diferentes tiempos con diferentes superíndices difieren significativamente (P<0.05). A-C Medias en la misma columna, para todos los tratamientos y días con diferentes superíndices difieren significativamente (P<0.05).

263


Rev Mex Cienc Pecu 2022;13(1):258-271

El pH de los QP disminuyó (P<0.05) a través del tiempo, siendo más ácidos para el día 15. Contrariamente, la AT fue mayor (P<0.05) al día 15, y ésta fue menor (P<0.05) en el QP3 (0.10 g de AEO) y mayor (P<0.05) en el QP1. El pH en el centro del queso panela se encuentra entre 6.4 y 5.94 del día 1 al 15(2); estos valores son similares a los obtenidos del QP1 al QP3 a los 15 días. El descenso del pH es debido a la producción de ácido láctico por las bacterias y contribuyen con el aroma y textura(3). Esto podría explicar la disminución del pH de QP1, QP2 y QP3 debido al ácido láctico producido a los 4, 8 y 15 días. La acidez titulable (AT) fue similar en los días 1 y 4 (valores más bajos) y a través del tiempo fue aumentando. En un estudio realizado por Buriti et al(20) en quesos frescos con Lactobacillus acidophilus a los 1, 7, 14 y 21 días indicó que el incremento de la AT es un proceso natural causado por la producción continua de ácido láctico y ácidos orgánicos. Esto explica los valores altos obtenidos de AT a los 15 días en los QP. En este contexto, el carvacrol y timol son componentes bioactivos del AEO que desintegran la membrana externa de las bacterias y aumenta la permeabilidad de la membrana citoplásmica haciendo que la célula muera(21). Los aceites esenciales comúnmente exhiben mayores propiedades inhibitorias contra bacterias Gram-positivas que Gram-negativas debido a la barrera de lipopolisacáridos en la membrana externa de bacterias Gramnegativas(21). Estas inferencias explican los valores altos de AT obtenidos al día 15 y los menores en el QP3, debido al efecto del AEO (timol y carvacrol) como inhibidor de bacterias ácido lácticas durante el almacenamiento. La evolución del color de los quesos panela con aceite de orégano se aprecia en el Cuadro 2. El efecto de los tratamientos durante el tiempo ((Ƭδ)ij) no fue significativo (P>0.05) en el color de los quesos. El efecto del tratamiento fue significativo (P<0.05) en la luminosidad (L*). En el día1, QP1 fue menos (P<0.05) luminoso y QP2 más (P<0.05) luminoso. Después L* fue igual en los tratamientos a los días 4, 8 y 15. El efecto del tiempo (1, 4, 8 y 15 días) sobre a*, b*, Hue y Chroma fue altamente significativo ((Ƭδ)ij; P<0.001). En este sentido, los resultados en a* fueron los esperados (cerca de cero) porque el queso es de color blanco y no hay una tendencia a verde o a rojo. Por otro lado, los incrementos de los valores de b* indican que los pigmentos presentes en el AEO como los monoterpenos fenólicos (carvacrol)(22) y la maduración influyeron sobre b* (tendencia a amarillo). En consecuencia, los valores del índice de saturación y tonalidad del queso fueron afectados y variaron al día 15 (b* > a*).

264


Rev Mex Cienc Pecu 2022;13(1):258-271

Cuadro 2: Evaluación del color de quesos elaborados con leche tratada con aceite de orégano en 15 días de preservación 1 Variables de color2 Tratamientos (Ƭi) /Días (δj) L* a* b* Hue Chroma 1 día QP1 99.61b -0.41 9.78 91.24 9.78 QP2 100.00a -0.31 9.28 92.15 9.28 ab QP3 99.99 -0.34 9.36 92.23 9.34 4 días QP1 99.48a 0.06 9.51 89.58 9.51 a QP2 99.83 -0.06 9.19 90.44 9.20 a QP3 99.79 0.01 9.23 89.84 9.24 8 días QP1 99.88a -0.14 10.23 90.81 10.23 a QP2 100.00 -0.23 10.11 91.55 10.11 a QP3 100.00 -0.23 10.48 91.49 10.48 15 días QP1 99.54a 0.03 9.84 89.65 9.84 a QP2 99.98 -0.04 10.05 90.08 10.05 a QP3 99.88 0.26 9.86 88.25 9.88 EEM 0.13 0.10 0.17 0.71 0.17 P-value Ƭi 0.0008 0.4944 0.3255 0.2965 0.3340 δj 0.0844 < 0.0001 < 0.0001 < 0.0001 < 0.0001 (Ƭδ)ij 0.9110 0.5553 0.2466 0.6935 0.2377 1

QP1= queso panela control (sin AEO); QP2= queso panela + 0.05 g AEO/L leche; y QP3= queso panela + 0.10 g AEO/L leche. EEM= error estándar de la media; Ƭi= efecto del i-ésimo tratamiento; δj= efecto del jésimo día de evaluación (1, 4, 8 y 15 d); (Ƭδ)ij= efecto de la interacción entre el i-ésimo tratamiento y el jésimo día. 2 L*= luminosidad; a*= tendencia al color rojo; b*= tendencia al color amarillo; Hue: ángulo Hue; Chroma= índice de saturación. a-b Medias en la misma columna, entre tratamientos y en diferentes tiempos con diferentes superíndices difieren significativamente (P<0.05).

El análisis de textura de los quesos panela tratados con aceite de orégano se presentan en el Cuadro 3. El efecto de la interacción de tratamientos con días fue significativo ((Ƭδ)ij; P<0.05) sobre cohesividad y resistencia. Los valores de estas variables al día 1 fueron los más altos (P<0.05) para QP2 y al día 8 resultaron menores (P<0.05) en QP1. El efecto de los tratamientos fue significativo (Ƭi; P<0.05) sobre FzaC, dureza, gomosidad y masticabilidad. A los días 1 y 8, QP1 presentó la mayor FzaC y dureza, mientras que en QP2 fueron los valores más bajos. A los 15 días, QP2 presentó la FzaC más baja (P<0.05) y QP3 la menor (P<0.05) dureza. La gomosidad y masticabilidad en el tiempo (1, 8 y15 días) fueron mayores

265


Rev Mex Cienc Pecu 2022;13(1):258-271

en QP1 que en QP2. En un queso fresco estudiado por Lobato-Calleros et al(23) en queso fresco a los 3 días presentó dureza, elasticidad y cohesividad parecidos al QP en el día 1, debido a la reducción del contenido graso en la formulación, provocando que más zonas proteicas no sean interrumpidas en la estructura del queso y refleja más dureza(23). El aumento de la fracción proteica ha sido asociado con un incremento en la firmeza de los quesos y un esfuerzo elevado para la deformación, donde los glóbulos grasos ocluidos en la matriz de caseínas, ocupan un espacio intersticio determinado y actúan como un extensor de la red(23). Esto puede explicar la menor dureza de los quesos con AEO medidos al día 8 y 15. También esto implica que el AEO ocupe los espacios intersticios en la red proteica del queso que mantiene la suavidad del producto a través del tiempo. En otro estudio(24) en quesos bajos en grasa a los 2 días sobre dureza y cohesividad, sus valores fueron similares al QP3. Por otro lado, los cambios proteolíticos y fisicoquímicos del QP a los 15 días demostraron los valores altos de dureza y masticabilidad(2). Los resultados del presente estudio indican que la adición de AEO (QP2 y QP3) redujo los valores de textura porque el testigo (QP1) obtuvo los valores altos a los 8 y15 días. Adicionalmente, en el estudio de Salinas-Valdés et al(15) se indicó que las proteínas contribuyen con la dureza de los quesos porque representan la fase sólida continua del producto. Inclusive, la proteólisis y lipólisis en los quesos durante su almacenamiento son controlados por aditivos naturales con propiedades antioxidantes y antimicrobianas como el AEO; por lo tanto, retardan el deterioro y conservan la textura del producto.

266


Rev Mex Cienc Pecu 2022;13(1):258-271

Cuadro 3: Comportamiento del análisis de textura en quesos elaborados con leche tratada con aceite de orégano en 15 días de almacenamiento Tratamiento FzaC Dureza Adhesividad Elasticidad Gomosidad Masticab (Ƭi)1 Cohesividad Resistencia 2 -1 (kgf) (N) (g s ) (mm) (g) (g mm-1) /Días (δj) 1 día QP1 0.8109a 5.48a -7.99 0.86 0.71a;A 3.91a 3.40a 0.33a;AB QP2 0.6891b 4.23c -6.12 0.87 0.75a;A 3.20b 2.81b 0.38a;A QP3 0.7389b 5.14b -2.13 0.86 0.73a;A 3.76b 3.24b 0.36a;AB 8 días QP1 0.8700a 9.57a -11.71 0.85 0.65a;B 6.16a 5.29a 0.27b;C QP2 0.7779ab 7.50c -9.59 0.78 0.68a;AB 4.92b 4.09b 0.31a;B QP3 0.8905a 8.98b -9.51 0.85 0.66a;B 5.94b 5.09b 0.29a;BC 15 días QP1 0.8674a 9.20a -7.78 0.85 0.70a;A 6.41a 5.48a 0.32a;B QP2 0.8131ab 8.33b -11.01 0.86 0.65a;B 5.40b 4.67b 0.28b;BC QP3 0.8191ab 7.98c -12.05 0.86 0.68a;B 5.44b 4.72b 0.31a;B EEM 0.0295 0.48 1.78 0.024 0.012 0.28 0.26 0.013 P-value Ƭi 0.0018 0.0038 0.6939 0.5144 0.7314 0.0004 0.0009 0.2148 δj 0.0002 < 0.0001 0.0014 0.1840 < 0.0001 < 0.0001 < 0.0001 < 0.0001 (Ƭδ)ij 0.3163 0.4020 0.0786 0.2415 0.0032 0.4002 0.4047 0.0334 1

QP1= queso panela control (sin AEO); QP2= queso panela + 0.05 g AEO/L leche; y QP3= queso panela + 0.10 g AEO/L leche. EEM= error estándar de la media; Ƭi= efecto del i-ésimo tratamiento; δj= efecto del j-ésimo día de evaluación (1, 4, 8 y 15 d); (Ƭδ)ij= efecto de la interacción entre el i-ésimo tratamiento y el j-ésimo día. 2 FzaC: fuerza de corte (kgf); Masticab= masticabilidad. a-c Medias en la misma columna, entre tratamientos y en diferentes tiempos con diferentes superíndices difieren significativamente (P<0.05). A-C Medias en la misma columna, para todos los tratamientos y días con diferentes superíndices difieren significativamente (P<0.05).

1 267


Rev Mex Cienc Pecu 2022;13(1):258-271

Los atributos sensoriales de los alimentos cambian durante el almacenamiento de los alimentos. El efecto de los tratamientos en cada día (1, 4, 8 y 15 días) fue diferente (P<0.05) para olor, sabor, blandura y aceptabilidad global (Cuadro 4). De hecho, QP1 fue el más aceptado (P<0.05) y QP2 el menos (P<0.05) aceptado. Los efectos tratamientos, días y su interacción no afectaron (P>0.05) la preferencia del color blanco del queso. El AEO produce un mal sabor y un fuerte olor que ha limitado su uso como conservador en los alimentos pero mejoran su seguridad y vida útil(25). Además, los aceites esenciales tienen un aroma intenso y su uso en altas concentraciones para compensar su interacción con los componentes de los alimentos podría provocar defectos sensoriales(21). Lo anterior explica la menor aceptación de los atributos de los quesos elaborados con AEO (QP2 y QP3), que a partir del olor, sabor, blandura y aceptabilidad global presentaron las menores preferencias. Cuadro 4: Atributos sensoriales de quesos elaborados con leche tratada con aceite de orégano en 15 días de conservación Tratamiento Atributos sensoriales2 (Ƭi)1 Aceptabilidad Color blanco Olor orégano Sabor Blandura /Días (δj) global 1 día QP1 4.60 4.25a 4.40a 4.45a 4.32a QP2 4.60 3.60b 3.00b 4.05b 3.30b QP3 4.50 3.90ab 3.50b 4.30ab 3.50b 4 días QP1 4.40 4.10a 4.35a 4.50a 4.35a a b b QP2 4.50 3.70 2.80 4.00 3.40b QP3 4.50 4.05a 3.45b 4.35ab 3.80b 8 días QP1 4.70 4.25a 4.70a 4.55a 4.60a QP2 4.60 3.60b 2.85b 4.25a 3.10b QP3 4.70 3.85ab 3.30b 4.35a 3.45b 15 días QP1 4.60 4.30a 4.35a 4.45a 4.35a QP2 4.35 3.65a 2.90b 3.90a 3.05b QP3 4.45 3.75a 3.40b 3.90a 3.70ab EEM 0.14 0.19 0.23 0.19 0.21 P-value Ƭi 0.8154 0.0001 < 0.0001 0.0055 < 0.0001 δj 0.2381 0.9695 0.9387 0.2793 0.7909 (Ƭδ)ij 0.8935 0.9108 0.9178 0.9163 0.6979 1

QP1= queso panela control (sin AEO); QP2= queso panela + 0.05 g AEO/L leche; y QP3= queso panela + 0.10 g AEO/L leche. EEM= error estándar de la media; Ƭi= efecto del i-ésimo tratamiento; δj= efecto del j-

268 1


Rev Mex Cienc Pecu 2022;13(1):258-271 ésimo día de evaluación (1, 4, 8 y 15 d); (Ƭδ)ij= efecto de la interacción entre el i-ésimo tratamiento y el jésimo día. 2 Escala hedónica 5 puntos, 5= me gusta mucho; 4= me gusta; 3= ni me gusta ni me disgusta; 2= me disgusta; 1= me disgusta mucho. a-b Medias en la misma columna, entre tratamientos y en diferentes tiempos con diferentes superíndices difieren significativamente (P<0.05).

El uso de 0.05 g AEO/L leche puede ser usado en el procesamiento y conservación de queso panela sin afectar las características fisicoquímicas, texturales y sensoriales. En la fuerza de corte y dureza, 0.1 g AEO/L leche presentó los valores bajos (más suaves) hasta el día 8, pero en el día 15 QP3 fue el más suave. Sensorialmente, el queso sin AEO y con 0.1 g AEO/L leche fueron los más aceptados en olor, sabor y blandura. Con los resultados obtenidos es posible usar alternativas naturales para procesar y conservar quesos frescos controlando los niveles de aceite esencial en la materia prima.

Conflictos de interés

Los autores declaran no tener conflictos de interés.

Agradecimientos

Se agradece a la Facultad de Agronomía, Universidad Autónoma de Nuevo León, por permitir el uso de los Laboratorios para la realización del estudio. También agradecer a la empresa Natural Solutions SMI (Jiménez, Chihuahua, México) por la donación del aceite esencial de orégano. Literatura citada: 1.

INEGI. Instituto Nacional de Estadística y Geografía. México en Cifras: Banco de Información Económica (BIE). https://www.inegi.org.mx/app/indicadores/?tm=0#divFV644629. Consultado: Nov 25, 2019.

2.

Guerra-Martínez JA, Montejano JG, Martín-del-Campo ST. Evaluation of proteolytic and physicochemical changes during storage of fresh Panela cheese from Queretaro, Mexico and its impact in texture. CyTA-J Food 2012;10(4):296-305.

269 2


Rev Mex Cienc Pecu 2022;13(1):258-271

3.

González-Córdova AF, Yescas C, Ortiz-Estrada ÁM, de la Rosa-Alcaraz MA, Hernández-Mendoza A, Vallejo-Cordoba B. Invited review: Artisanal Mexican cheeses. J Dairy Sci 2016;99(5):3250-3262.

4.

Asensio CM, Grosso NR, Juliani HR. Quality preservation of organic cottage cheese using oregano essential oils. LWT-Food Sci Tech 2015;60(2):664-671.

5.

Teng D, Wilcock A, Aung M. Cheese quality at farmer’s markets: observation of vendor practices and survey of consumer perceptions. Food Control 2003;15:579-587.

6.

CXS 221-2001. Norma de grupo para el queso no madurado, incluido el queso fresco. Enmendada en 2018. http://www.fao.org/fao-who-codexalimentarius/codex-texts/liststandards/es/. Consultado: Nov 25, 2019.

7.

Olmedo RH, Nepote V, Grosso NR. Preservation of sensory and chemical properties in flavoured cheese prepared with cream cheese base using oregano and rosemary essential oils. LWT-Food Sci Tech 2013;53:409-417.

8.

Vazquez SR, Dunford TN. Bioactive components of Mexican oregano oil as affected by moisture and plant growth. J Essent Oil Res 2005;17(6):668-671.

9.

CODEX STAN 192. Norma general para los aditivos alimentarios. Revisión 2019. http://www.fao.org/fao-who-codexalimentarius/codex-texts/list-standards/es/. Consultado: Feb 24, 2021.

10. Villegas de Gante A, Santos Moreno A. Manual básico para elaborar productos lácteos. 2nd ed. México, DF: Trillas SA de CV; 2016. 11. Sanz T, Salvador A, Jiménez A, Fiszman SM. Yogurt enrichment with functional asparagus fibre. Effect of fibre extraction method on rheological properties, colour, and sensory acceptance. Eur Food ResTechnol 2008;227:1515-1521. 12. CIE. 1976. International Commission on http://www.cie.co.at/. Consultado: Nov 25, 2019.

Illumination.

Colorimetry.

13. Bourne MC. Food texture and viscosity: Concept and measurement. Geneva, New York. 2002. 14. Lobato-Calleros C, Ramos-Solís L, Santos-Moreno A, Rodríguez-Huezo ME. Microstructure and texture of panela type cheese-like products: use of low methoxyl pectin and canola oil as milk-fat substitutes. Rev Mex Ing Quim 2006;5:71-79.

3270


Rev Mex Cienc Pecu 2022;13(1):258-271

15. Salinas-Valdés A, De la Rosa Millán J, Serna-Saldívar SO, Chuck-Hernández C. Yield and textural characteristics of panela cheeses produced with dairy-vegetable protein (soybean or peanut) blends supplemented with transglutaminase. J Food Sci 2015;80(12):S2950-S2956. 16. Anzadúa-Morales A. La evaluación sensorial de los alimentos en la teoría y la práctica. Zaragoza, España: Acribia; 1994. 17. Meilgaard M, Civille GV, Carr TB. Sensory evaluation techniques. In: Meilgaard M, Civille GV, Carr TB editors, Affective tests consumer tests and in-house panel acceptance tests. 4th ed. Boca Raton, Florida, USA: CRC Press. 2006:231-251. 18. SAS 9.1.3 Software. Institute Inc., Cary, North Carolina, USA. 2006. 19. Pearse MJ, Mackinlay AG. Biochemical aspects of syneresis: a review. J Dairy Sci 1989; 72:1401-1407. 20. Buriti F, Jaliana S, Susana S. Incorporation of Lactobacillus acidophilus in Minas fresh cheese and its implications for textural and sensorial properties during storage. Int Dairy J 2005;15:1279-1288. 21. Burt S. Essential oils: their antibacterial properties and potential applications in foods-a review. Int J Food Microbiol 2004;94:223-253. 22. Khorshidian N, Yousefi M, Khanniri E, Mortazavian A. Potential application of essential oils as antimicrobial preservatives in cheese. Innov Food Sci Emerg Technol 2018;45:62-72. 23. Lobato-Calleros C, Reyes-Hernández J, Beristain CI, Hornelas-Uribe Y, SánchezGarcía JE, Vernon-Carter EJ. Microstructure and texture of white fresh cheese made with canola oil and whey protein concentrate in partial or total replacement of milk fat. Food Res Int 2007;40(4):529-537. 24. Lobato-Calleros C, Lozano-Castañeda I, Vernon-Carter EJ. Textura y microestructura de quesos tipo panela bajos en grasa y en colesterol: diferentes metodologías. Ing Agric Biosist 2009;1(1):39-48. 25. Calo J, Crandall P, O'Bryan C, Ricke S. Essential oils as antimicrobials in food systemsa review. Food Control 2015;54: 111-119.

271 4


https://doi.org/10.22319/rmcp.v13i1.5741 Nota de investigación

Efecto de la nisina en la inhibición del crecimiento de Staphylococcus areus y en las propiedades sensoriales del queso costeño

Beatriz Alvarez Badel a* Maria Alejandra Doria Espitia a Vanesa Hodeg Peña a Mónica María Simanca Sotelo a Yenis Pastrana Puche a Claudia Denise De Paula a

a

Universidad de Córdoba. Departamento de Ingeniería de alimentos, Sede Berástegui, Vía Cereté – Ciénega de Oro, Córdoba, Colombia.

*Autor de correspondencia: bealvarez@correo.unicordoba.edu.co

Resumen: Se evaluó el efecto de la adición de nisina en queso costeño obtenido en la ciudad de Montería – Córdoba, Colombia, sobre la inhibición del crecimiento de Staphylococcus aureus y sobre las características sensoriales del queso. Se obtuvieron muestras de queso costeño en 9 comercializadoras de la ciudad y se aisló S. aureus, se determinó la concentración mínima inhibitoria (CMI) con nisina; se elaboró queso costeño con la adición de nisina a 0, 500 y 625 UI/kg. Se realizó el recuento de S. aureus, a las 0 y 24 h de almacenamiento; se estableció un diseño completamente al azar con 57 unidades experimentales. Se realizó una prueba triangular con panel de 40 catadores para determinar diferencias sensoriales entre el queso costeño tradicional y con adición de nisina. Se determinó que el queso costeño presentó contaminación por S. aureus; dichas cepas fueron inhibidas con una CMI de nisina de 500 UI/ml. Los recuentos de S. aureus en queso costeño adicionado con nisina presentaron diferencias significativas (P≤0.05) con el testigo; se observó que después de 24 h la nisina

272


Rev Mex Cienc Pecu 2022;13(1):272-286

redujo de 2.3 ciclos logarítmicos para concentración de 500 UI/kg y 1.9 ciclos logarítmicos para 625 UI/kg. El queso costeño adicionado con 500 UI de nisina/kg no presentó diferencias (P≥0.05) en las propiedades sensoriales con relación al testigo. Se concluye que la nisina a 500 UI/ml inhibe al S. aureus aislado del queso costeño comercializado en la ciudad de Montería- Córdoba. Palabras clave: Bacteriocinas, Concentración mínima inhibitoria, S. aureus.

Recibido: 22/07/2020 Aceptado:12/05/2021

La inocuidad de los alimentos engloba acciones encaminadas a garantizar la máxima seguridad posible de los alimentos. Se puede definir inocuidad como la garantía de que el alimento no genere peligros biológicos, físicos o químicos al consumidor, la ausencia de sustancias peligrosas, la certeza de ausencia de efectos adversos o lo contario al riesgo(1). Dentro de los riesgos biológicos en los alimentos se encuentra la presencia de microorganismos patógenos; uno de ellos es Staphylococcus aureus, bacteria Gram positiva de la flora normal del hombre, con capacidad de desarrollarse en muchos alimentos (carnes rebanadas, leche y derivados, salsas, conservas, productos de panaderías, cremas de huevos, entre otros) y producir la intoxicación estafilocócica con una ingesta mínima de 100 ng de toxina(2). El queso costeño es un alimento autóctono de la Costa Caribe colombiana; es un producto artesanal realizado a partir de leche no pasteurizada, con coagulación enzimática, prensado, no madurado, ni acidificado, de color blanco, que se somete a un salado en seco y se elabora bajo mínimas condiciones sanitarias; por ser un producto de la canasta básica de la región, se incrementa el riesgo de intoxicación alimentaria(3). La Norma Técnica Colombiana NTC 750, estipula los criterios microbiológicos para dicho producto, y establece que el recuento de S. aureus coagulasa positiva debe encontrarse en un rango de 100 a 1,000 UFC/g(4). Se han encontrado valores no aceptables de Staphylococcus coagulasa positiva en el 41.4 % de las muestras de queso costeño expedido en Montería-Córdoba(5). Estudios con queso costeño expendido en Valledupar-Cesar demostraron la presencia de S. aureus en el 75 % de los quesos costeños blandos y 25 % de los quesos semiduros estudiados(6). Una de las alternativas utilizadas para inhibir a S. aureus es el uso de la nisina, un conservante alimentario permitido por FDA, por su categoría GRAS (Generally Recognized As Safe). La nisina es una sustancia polipeptídica producida por diferentes cepas de Lactococcus lactis y Streptococcus lactis. Actúa frente a las bacterias Gram positivas, es estable en pH ácido y

273


Rev Mex Cienc Pecu 2022;13(1):272-286

ligeramente termosensible. Se conoce como E234 y es empleada en la industria alimentaria, principalmente en la elaboración de quesos(7). Los quesos son la matriz alimentaria donde se ha estudiado con más frecuencia, especialmente S. aureus es el tercer microorganismo más estudiado(8). Para cuantificar la actividad in vitro de un antimicrobiano frente a un cultivo bacteriano se utilizan técnicas de dilución en caldo o agar, como la concentración mínima inhibitoria (CMI), en donde se preparan una serie de tubos o placas con caldo o agar, respectivamente, a los cuales se les agrega el antimicrobiano estudiado en distintas concentraciones, luego se inoculan cada uno de los tubos o las placas con una suspensión estandarizada del microorganismo en estudio. La lectura e interpretación de la CMI corresponde a la mínima concentración de bactericida en donde no se observa desarrollo (turbidez) y se expresa en μg/ml(9). El objetivo de esta investigación fue evaluar el efecto de la nisina a través de la técnica de concentración mínima inhibitoria sobre S. aureus aislado del queso costeño comercializado en queseras oficialmente registradas en el municipio de Montería – Córdoba, Colombia. Aislamiento e identificación de S. aureus. Se visitaron las empresas expendedoras de queso costeño en la ciudad para obtener muestras de 250 g de queso y se trasladaron al Laboratorio de Microbiología de Alimentos de la Universidad de Córdoba, Colombia. Se obtuvieron diluciones seriadas y se sembraron por duplicado en superficie en placas con agar sal y manitol por 24 a 48 h a 37 ºC(10). Se realizaron pruebas confirmativas a las colonias características de S. aureus, por tinción de Gram, prueba de catalasa y coagulasa(11). Se aplicó técnica de PCR en tres de las cepas obtenidas(12). Se almacenaron a temperatura de 2 a 4 °C. Se activaron con caldo nutritivo y siembra en agar Baird Parker (BPA). Determinación de CMI de la nisina sobre las cepas de S. aureus aislado de queso costeño. Se realizó una escala de McFarland como patrón de turbidez para estandarizar la densidad en preparaciones de microorganismos. La escala de 0.5 fue preparada con ácido sulfúrico (0.18 M) y una solución acuosa de cloruro de bario (0,048 M) equivalente a 1.5 x 108 UFC/m y una densidad óptica de 0.08 a 0.12 a 625 nm(13). En tubos con 5 ml de caldo Mueller Hilton (MH) se adicionaron tres colonias de S. aureus, se incubaron a 37 °C durante 1 h. Se realizaron mediciones de absorbancia y turbidez. Los tubos que presentaron la medida de absorbancia y turbidez dentro del rango establecido se consideraron estandarizados en la escala 0,5 McFarland con aproximadamente 1.5 x 108 células/ml(14). Posteriormente se preparó una solución madre de nisina (NISIN(z) Qiqihaer Heilongjiang Province China del Laboratorio Amtech Biotech, HS Code 2941909090), diluyendo 1.0 g de nisina en 100 ml de HCl al 0,02 N, esta solución contenía 1.0 x 104 UI/ml con pH cercano a 2.0, y se ajustó el pH a 3.21 con NaOH al 0.5 N. Esta solución se diluyó con caldo Mueller Hinton (MH) para conseguir concentraciones de 100, 200, 500, 1,000, 1,500, 2,000 y 2,500 274


Rev Mex Cienc Pecu 2022;13(1):272-286

UI/ml(15). Como testigo se utilizó caldo MH. A cada uno de los tubos se le agregaron 10 µl del inóculo preparado con S. aureus, y se incubaron a 37 °C por 24 h con agitación a 182 rpm. Para realizar la curva de letalidad, se realizó el procedimiento con las concentraciones de ½ CMI, CMI, 2xCMI y 4xCMI; se sembró por triplicado el contenido de los tubos en placas de agar Baird Parker a diferentes tiempos de incubación (0, 2, 4, 8, 20 y 24 h) y se realizó el recuento de número de colonias; se elaboró una gráfica recuento bacteriano (UFC/ml) vs el tiempo de exposición (horas)(11). La gráfica exhibe una cinética exponencial de primer orden, cuya fórmula es 𝑁𝑇 = 𝑁0 𝑒 −𝐾𝑇 , mediante la aplicación de logaritmos se transforma en 𝐿𝑛𝑁𝑇 = 𝐿𝑛𝑁0 − 𝐾𝑇, se obtiene la tasa de letalidad (K). Despejando la ecuación anterior se puede calcular el tiempo que tarda la población del microorganismo en reducirse a la mitad, conocido como tasa de letalidad: T1/2 = ln2/K(16). Evaluación de diferentes concentraciones de nisina en la elaboración de queso costeño. Para la elaboración de queso costeño se realizó el siguiente proceso(17). A la leche filtrada se le analizó el pH (potenciometría), acidez(18) y recuento de S. aureus(11). Se calentó la leche a 34 ± 1 ºC y se adicionó CaCL2 (20 g/100 L de leche) y se adicionó cuajo liquido Milkset (1.0 ml /10.0 L de leche). La cuajada se cortó en cuadros de 1 a 2 cm y se dejó en reposo por 5 min. Se separó el suero por gravedad y se adicionó sal directamente a 2.5 %. La cuajada salada se separó en tres lotes de 500 g y se adicionó nisina distribuida de forma homogénea (625, 500 y 0.0 UI/kg). El material se llevó al molde y se prensó. De cada uno de los lotes se tomaron muestras, las que se almacenaron a 4 ± 2 °C y se realizó el recuento de S. aureus por triplicado a 0 y 24 h de acuerdo al procedimiento señalado por Silva et al(11). Se utilizó un diseño completamente al azar con 57 unidades experimentales. Los datos se analizaron a través de software estadístico R Project versión 3.1.1. Se realizó un análisis de varianza y una vez comprobadas diferencias estadísticas entre los tratamientos se realizó una prueba de rangos múltiples de Duncan (P<0.5), con el fin de determinar si existían diferencias significativas entre los recuentos de S. aureus de las muestras de queso sin nisina y los elaborados con las concentraciones ensayadas de nisina. Aplicación de prueba triangular a los quesos costeño tradicional y elaborado con nisina. Se utilizaron 40 catadores no entrenados, con edades comprendidas entre los 19 y 45 años; se evaluó si existían diferencias sensoriales significativas entre los quesos costeño y costeño adicionado con nisina a 500 UI/kg; concentración máxima permisible de acuerdo con la Norma Estándar para quesos del Codex Alimentarius(19). Para la evaluación sensorial de los quesos se presentó un grupo de tres muestras, donde dos eran iguales entre sí y se le pedía al catador seleccionar la muestra diferente. Se tabuló el número de aciertos obtenidos por los catadores y se compararon con el cuadro: número mínimo de juzgamientos correctos para

275


Rev Mex Cienc Pecu 2022;13(1):272-286

establecer significancia en distintos niveles de probabilidad para la prueba triangular (una cola, P = 1/3)(20). Aislamiento, selección e identificación de S. aureus a partir de queso costeño. En todas las muestras de queso costeño estudiadas se aisló S. aureus. En total se encontraron 18 cepas con colonias características de S. aureus (redondas, rodeadas de una zona amarilla brillante). Las cepas asiladas caracterizadas de acuerdo con su morfología celular, colonial, y bioquímica correspondieron a S. aureus; en los resultados obtenidos por PCR se identificaron que tres cepas estudiadas contenían los genes que codifican para la enterotoxina de S. aureus. Determinación de la CMI sobre cepas de S. aureus aislado de queso costeño. Se determinó que la concentración de 500 UI/ml inhibió al S. aureus, ya que luego de 24 h de incubación no se observó turbidez, contrario a lo ocurrido en los tubos con concentraciones de 100 y 200 UI/ml. Se amplió el rango de concentraciones de estudio entre 500 y 1125 UI/ml, y se observó inhibición a 625 UI/ml. Curva de letalidad. En la Figura 1 se presentan las curvas de letalidad para S. aureus expuesto a cuatro concentraciones de nisina; se observa que en las concentraciones de nisina iguales o superiores a la CMI los recuentos disminuyen logarítmicamente, evidenciando la acción de la nisina sobre el microorganismo, pero con la concentración de 250 UI/ml, los recuentos en el tiempo se mantienen constantes, lo que sugiere que la nisina a esa concentración no inhibe al S. aureus. A través de la curva se logra visualizar la dinámica sobre la relación entre la concentración de nisina y su actividad bactericida, por lo que es necesario graficar el logaritmo del número de células sobrevivientes (UFC/ml) versus el tiempo. Figura 1: Curva de letalidad de Staphylococcus aureus en relación con la concentración de nisina en agar Baird Parker 350000 300000

UFC/mL

250000 200000

250UI/mL

150000

500UI/mL 1000UI/mL

100000

2000UI/mL

50000 0 0

5

10

15

20

Tiempo en horas

276

25

30


Rev Mex Cienc Pecu 2022;13(1):272-286

La Figura 2 permite apreciar el tiempo en que la concentración es bactericida, es decir el tiempo en el que el descenso de UFC es de tres ciclos logarítmicos con respecto al tiempo inicial(21). El tiempo en que la concentración alcanzó su mayor acción bactericida; para 500 UI/ml fue de 20 h. Por medio de los resultados se puede afirmar que a las 24 h de incubación la nisina a una concentración de 500 UI/ml logró una disminución significativa de la carga bacteriana de 3.7log (UFC/ml). Figura 2: Número de células sobrevivientes (Log UFC/g) vs el tiempo en horas 14 12

Log UFC/mL

10 8

Control

6

500UI/mL 1000UI/mL

4

2000UI/mL

2

0 0

5

10

15

20

25

30

Tiempo en horas

También se observa que los recuentos disminuyeron proporcionalmente con el tiempo de incubación. En el cuadro 1 se presentan las pendientes de cada ecuación obtenida, la cual corresponde a la tasa de letalidad (UFC/hora). Se infiere que a mayor concentración mayor es la velocidad de muerte del microrganismo. Cuadro 1: Tasa de letalidad y tiempo de reducción de la población de Staphylococcus aureus para las concentraciones de nisina evaluadas Nisina (UI/ml) 500 1000 2000

K (UFC/horas) 0.154 0.184 0.205

T1/2 (horas) 4.50095572 3.76710424 3.38120576

Evaluación de diferentes concentraciones de nisina en la elaboración de queso costeño. En la leche utilizada en la elaboración de los quesos se midieron valores promedios de pH de 6.8 y acidez de 0.16 % (ácido láctico), los cuales estaban de acuerdo a los parámetros establecidos en la normatividad colombiana; en cambio, los recuentos de S. aureus superaron a 10,00 UFC/ml(22).

277


Rev Mex Cienc Pecu 2022;13(1):272-286

En el Cuadro 2 se muestran los promedios de los recuentos en UFC/g para los tratamientos evaluados; en los lotes con concentración de 625 y 500 UI/kg de nisina se presentó un recuento menor de S. aureus respecto a los resultados del tercer lote, tratamiento sin nisina. Los recuentos del tercer lote se encontraron por encima del límite máximo permisible 103 UFC/g de S. aureus a las 0 y 24 h; representando un riesgo de intoxicación alimentaria. El análisis de varianza estableció que existían diferencias significativas (P<0.05), en cada uno de los tratamientos estudiados para los dos tiempos de almacenamiento evaluados, es decir que las concentraciones de nisina aplicadas en el queso costeño afectaron significativamente los recuentos de S. aureus. Cuadro 2: Comparación de medias para el promedio del recuento de Staphylococcus aureus en los lotes de queso costeño a las cero y 24 horas de almacenamiento Medias de recuento (UFC/g) ± S D Tratamiento nisina (UI/kg)

Cero horas

625

69.9 ± 49.1

a

11.1 ±9.2

a

15.9

500

658 ±254

ab

64.4 ±53.6

a

9.8

Sin nisina

1669 ±609

c

2403±738

b

abc

24 horas

Reducción (B/A,%)

Las letras diferentes indican que las medias difieren entre sí (P<0.05).

En el Cuadro 2 se observa que todos los tratamientos aplicados a las cero horas difieren entre sí, evidenciando que la adición de nisina a una concentración de 625 UI/kg logró la mayor disminución de la carga de S. aureus en el queso costeño. En los recuentos a las 24 h se encontraron diferencias (P<0.05) entre los recuentos de las muestras de queso sin nisina y de queso con nisina a 625 y a 500 UI//kg, lo que sugiere que las dos concentraciones de nisina tienen efecto similar en la inhibición de S. aureus. En la Figura 3 se presenta los valores promedios de las poblaciones de S. aureus en cada una de las muestras de queso costeño analizadas durante el almacenamiento y la diferencia en ciclos logarítmicos. En las muestras de queso costeño sin nisina el recuento del microorganismo aumentó a medida que transcurrió el tiempo de almacenamiento. La diferencia entre los recuentos de S. aureus del control con el tratamiento de 500 UI/kg son 3.62 ciclos logarítmicos.

278


Rev Mex Cienc Pecu 2022;13(1):272-286

Log UFC/kg

Figura 3: Promedio del recuento de Staphylococcus aureus para las concentraciones de nisina y testigo en los tiempos de almacenamiento 9 8 7 6 5 4 3 2 1 0 0 Horas 24 Horas

625 UI/kg 4.3 2.4

500 UI/kg 6.5 4.2

Control 7.4 7.8

Resultado de la prueba sensorial. Los resultados obtenidos por el grupo de catadores en la prueba triangular indican que no existieron diferencias (P<0.05) entre el queso costeño elaborado de forma tradicional y al que se le agregó 500 UI de nisina, lo que sugiere que la nisina no produce ninguna alteración de las propiedades sensoriales apreciables en el producto. La presencia S. aureus en las muestras de quesos costeños estudiados, reveló que la población cordobesa consumidora de este producto se encuentra expuesta al riesgo de intoxicación alimentaria; la presencia de este microorganismo en el queso costeño se puede relacionar con la falta de pasteurización y malas prácticas higiénicas en la manipulación, distribución y venta de dicho producto. En Colombia se reportaron 881 brotes de enfermedades transmitidas por alimentos en el año 2018, en las cuales, el queso estuvo presente en el 19.4 % de los brotes. En los casos donde se identificó el agente etiológico, 12 % resultó ser S. aureus(23). Estudios de queso costeño expedido en el departamento de Córdoba han catalogado al producto como no apto para el consumo humano por la significativa carga microbiológica observada, y lo asociaron a las deficiencias higiénicas en la manipulación del producto y a los defectos de las instalaciones existentes en los locales donde se comercializan(5). En la mayoría de los locales visitados en el estudio se observaron condiciones insuficientes en la distribución, almacenamiento y venta del producto; sólo en pocos establecimientos se conservaba el producto en refrigeración. Es muy probable que esas condiciones afectaban directamente la calidad microbiológica del queso costeño. Por ello se ha sugerido revisar la aplicación de buenas prácticas de manufactura en su procesamiento, ya que la contaminación por S. aureus en quesos artesanales puede originarse de la piel, boca o fosas nasales de los manipuladores del alimento, de la leche cruda, de las condiciones de proceso y ambientales(24). Estudios previos han evaluado la calidad higiénica de quesos artesanales realizados con leche cruda en diversas localidades, y todos han asociado la presencia de S. 279


Rev Mex Cienc Pecu 2022;13(1):272-286

aureus, con una baja calidad higiénica(25-28). Es claro que en los quesos artesanales donde no se utilizaban cultivos iniciadores, S. aureus no tenía flora competidora, como las bacterias ácido lácticas, y presentaba un riesgo significativo para la producción de toxinas si los recuentos iniciales son suficientemente altos(29). En el presente estudio la concentración de nisina requerida para inhibir a S. aureus, fue de 500 UI/ml; diversos estudios con quesos artesanales concuerdan con estos resultados. En Brazil evaluaron el efecto de la nisina en queso artesanal de Araxá (Minas Gerais) contaminado con S. aureus, reportando mayor inhibición con concentraciones de nisina de 400 y 500 UI/ml en 10 días de almacenamiento(30); también reportaron que las concentraciones de 100 UI/ml redujeron un ciclo logarítmico en el recuento del microorganismo en 60 días de almacenamiento, sin cambiar atributos como el color y la textura(31). Han relacionado reducciones de 2 ciclos logarítmicos en el recuento de S.aureus en cuajada y suero de queso fresco de Minas Gerais elaborado con leche que contenía 500 UI/ml de nisina. En el queso redujo 1.5 ciclos logarítmicos en 30 días de almacenamiento refrigerado, y en la leche alargó 8 h la fase de latencia en el crecimiento del S. aureus(32). Estudios con queso costeño elaborado con leche pasterizada inocularon cepas de S. aureus ATCC 29213 encontrando CMI de nisina de 500 UI/ml(33). El efecto antibacteriano de la nisina, se ha explicado como una despolarización de la membrana citoplasmática, la que consiste en una acción dual sobre la membrana de los microorganismos, primero le forma poros y también actúa como un detergente que la desestabiliza(34). Este efecto se realiza en tres pasos, inicia con la interacción de su carga positiva con la carga negativa de la pared celular, seguido se une a una molécula transportadora de peptidoglucano del citoplasma a la pared celular (llamada lípido II), impidiendo su síntesis y, por último, las moléculas de nisina se unen al lípido II para fijarse y unirse a la membrana celular y formar poros, ocasionando la muerte celular(7). La curva de letalidad microbiana sigue un comportamiento exponencial, con una cinética de primer orden porque existe linealidad entre el logaritmo de los supervivientes en relación con el tiempo de tratamiento. La pendiente de la curva simboliza la velocidad a la que mueren las células y es medida en UFC/tiempo. Es posible determinar el modelo matemático que mejor estime la pendiente, y determinar las UFC en cada tiempo y concentración; este modelo representa de manera óptima los datos obtenidos y permite comparar las diferentes cinéticas que presentan los antimicrobianos y antibióticos(35). Ya se han descrito parámetros cinéticos y modelos matemáticos para la inactivación de poblaciones microbianas en procesos térmicos, de presión y electromagnéticos(36). También se han descrito estos modelos de crecimiento, supervivencia o inactivación para diversos microorganismos expuestos a antimicrobianos naturales en diversas matrices alimentarias, y se ha generado información pertinente a través de ellos, como la duración de la fase de retraso, el tiempo de generación, densidad de población máxima y tasa de crecimiento exponencial(37). Específicamente se han 280


Rev Mex Cienc Pecu 2022;13(1):272-286

enunciado que el modelo primario describe la inhibición de S. aureus en diversos tipos de carne(38). Aunque existen antecedentes de investigaciones en queso costeño pasteurizado adicionado con nisina para inhibir a S. aureus, en este estudio se prefirió utilizar leche cruda para elaborar el queso costeño; se ha relacionado a la pasteurización con la destrucción de las enzimas, disminución del contenido de minerales y eliminación de microorganismos propios del área geográfica que proporcionan diferenciación del color y textura propios del queso, inclusive poseen potencial probiótico(39). En la leche se observó recuento inicial por encima de la norma colombiana, la presencia de S. aureus en productos lácteos indica contaminación por manipulación o enfermedad en el bovino por mastitis(40). En la evaluación de las diversas concentraciones de nisina adicionadas en queso costeño, se observaron recuentos menores en la población de S. aureus, en los dos tiempos estudiados, a medida que la concentración de nisina aumentaba corroborando la relación inversa entre la concentración de nisina y el tiempo de reducción la población del microorganismo. Se registraron diferencias significativas en los recuentos de S. aureus en el tiempo cero demostrando el poder antimicrobiano de la nisina desde el momento de la adición. Estudios de viabilidad de S. aureus expuesto a la nisina durante 1 a 24 h evidenciaron que ocurre una reducción significativa de la población (P<0.01) dentro de la primera hora de exposición a la nisina(41). El estudio en queso artesanal de Araxá (Minas Gerais-Brasil) evidencia este mismo comportamiento de S. aureus en leche adicionada con nisina, el cual tuvo mayor inhibición a las 8 h y a la vez, fue dependiente de la cantidad de nisina agregada en las diversas matrices(31). El queso costeño como matriz alimentaria con un contenido considerable de sal favoreció el efecto antimicrobiano de la nisina, por lo contrario, la presencia de lípidos lo interfirió, probablemente por su comportamiento anfipático(42). La mayor acción bactericida al principio pudiera estar relacionado con los siguientes factores: la rápida difusión de la nisina al aplicarse directamente al alimento(43), la resistencia microbiana adquirida o adaptativa que desarrolla el microorganismo en el tiempo en que se exponen al antimicrobiano(44), y la degradación que puede sufrir la nisina en el tiempo por las enzimas propias del alimento(45). Las muestras de queso costeño adicionado con nisina a 625 UI//kg y a 500 UI/kg, presentan una reducción significativa de 2.3 y 1.9 unidades logarítmicas respectivamente en 24 h. Aunque las dos concentraciones estudiadas inhiben a S. aureus, se debe utilizar en la industria 500 UI/kg de producto que es la concentración permitida por el Codex Alimentarius(18). La evaluación sensorial del producto es de suma importancia porque evidencia que no se perciben cambios organolépticos (P0.05) en el queso costeño adicionado con nisina 500 UI/kg respecto al queso tradicional; resultados similares fueron encontrados por Araujo et 281


Rev Mex Cienc Pecu 2022;13(1):272-286

al(46) al adicionar 5 mg/kg de nisina en queso costeño. La nisina al ser una sustancia GRAS puede utilizarse en el producto de consumo humano de forma segura para la salud, con la tranquilidad de un menor recuento microbiano de S. aureus y la aceptación sensorial del producto por parte del consumidor. Este estudio se evidencia una alta prevalencia de S. aureus en las muestras de queso costeño comercializadas en Montería – Córdoba, Colombia. Las cepas de S. aureus aisladas de queso costeño fueron inhibidas por el antimicrobiano nisina a una concentración de 500 UI/ml, el cual alcanzó su mayor acción bactericida a las 20 h de incubación, logrando una disminución de 3.7 Log (UFC/ml). La velocidad en que el microorganismo murió fue de 0.154 UFC/h con un tiempo de reducción de la población de 4.5 h. Las propiedades sensoriales del queso costeño elaborado con una concentración de nisina de 500 UI/kg de producto no presentaron diferencias significativas (P>0.05) con respecto al queso costeño elaborado de forma tradicional. Literatura citada: 1.

Hassauer C, Roosen J. Toward a conceptual framework for food safety criteria: Analyzing evidence practices using the case of plant protection products. Saf Sci 2020;127:104683.

2.

Andrade FP, Medeiros BT, Barbosa TW, Silva ME. Fatores que propiciam o desenvolvimento de Staphylococcus aureus em alimentos e riscos atrelados a contaminação: uma breve revisão. Rev Ciênc Méd Biol 2019;18:8993.

3.

Arteaga MR, Hernández HL, Peñate CD. Elaboración de un queso procesado tipo untable obtenido a partir de queso costeño. Inf Tecnol 2020;31:187-194.

4.

ICONTEC. Instituto Colombiano de Normas Técnicas. NTC 750. Norma Técnica Colombiana sobre productos lácteos: Queso, 1-15, Colombia. 2009.

5.

Ruíz RA, Menco NY, Chams LM. Valoración microbiológica de queso costeño artesanal y evaluación higiénico-locativa de expendios en Córdoba, Colombia. Rev Salud Pública 2017;19:311-317.

6.

Acosta IP, José GG. Staphylococcus aureus procedentes de quesos costeños de Valledupar; susceptibilidad a antibióticos y perfil plasmídico. Rev Méd Risaralda 2019;25:14-14.

7.

Sánchez MA, Salgado MT, San-Miguel Á, Pachón Jesús, Rodríguez E, Pastor MR, Cabrero P. Nisina (N 234), aditivo utilizado como conservante en alimentos. Gac Med Bilbao 2019;116:166-173.

282


Rev Mex Cienc Pecu 2022;13(1):272-286

8.

Cano D, Gómez MA, Oviedo V, Rios LA. Nisina como conservante de alimentos: revisión sistemática de la literatura. Hechos Microbiol 2015;6:52-64.

9.

Yolanda H, Krajaejun T. Review of methods and antimicrobial agents for susceptibility testing against Pythium insidiosum. Heliyom 2020;6e03737.

10. Abdel-Hameid AA, Saad NM, Valero A, Mahmoud S. Incidence of enterotoxigenic Staphylococcus aureus in milk and Egyptian artisanal dairy products. Food Control 2019;104:20–27. 11. Silva N, Taniwaki MH, Junqueira VCA, Silveira NFA, Okazaki MM, Gomes RAR. Microbiological examination methods of food and water: a laboratory manual. 2nd ed. London, UK: Taylor & Francis Group; 2019. 12. Løvseth A, Loncarevic S, Berdal KG. Modified multiplex PCR method for detection of pyrogenic exotoxin genes in staphylococcal isolates. J Clin Microbiol 2004;42:3869– 3872. 13. Shehu HA, Mukhtar AG, Adetoyinbo II, Ojo AO, Mus’ab UA. Phytochemical screening and antibacterial activities of cassia fistula leaf extracts on some selected pathogens. Int J Pharmacon Phytochem Res 2020;9:1779-1783. 14. ASM. American Society for Microbiology. Kirby-bauer disk diffusion susceptibility test protocol. 2016. 15. Marvdashti LM, Yavarmanesh M, Koocheki A. Controlled release of nisin from polyvinyl alcohol - Alyssum homolocarpum seed gum composite films: Nisin kinetics, Food Biosci 2019;28:133-139. 16. Zhao X, Chen L, Zhao L, He Y, Yang H. Antimicrobial kinetics of nisin and grape seed extract against inoculated Listeria monocytogenes on cooked shrimps: Survival and residual effects. Food Control 2020;115:1-13. 17. Pardo ME, Almanza F. Guía de procesos para la elaboración de productos lácteos. 1era ed. Bogotá, Colombia: Convenio Andrés Bello (CAB). 2005. 18. ICONTEC. Instituto Colombiano de Normas Técnicas. NTC 4978. Leche y productos lácteos. Determinación de la acidez titulable (Método de referencia). 2001. 19. FAO - OMS. Organización de las Naciones Unidas para la Alimentación y la Agricultura - Organización Mundial de la Salud. Codex Alimentarius. Leche y productos lácteos. Segunda ed. Roma. 2011. 20. Lawless HT, Heymann H. Sensory evaluation of food. Principles and practices. 2nd ed. New York, USA: Springer; 2010.

283


Rev Mex Cienc Pecu 2022;13(1):272-286

21. Ramírez L, Marin D. Metodologías para evaluar “in vitro” la actividad antibacteriana de compuestos de origen vegetal. Scientia et Technica 2009;15:263-268. 22. MINSALUD. Ministerio de Salud y Protección Social. Decreto 616 del 2006. Reglamento Técnico sobre los requisitos que debe cumplir la leche para el consumo humano que se obtenga, procese, envase, transporte, comercialice, expenda, importe o exporte en el país. Bogotá, 2006. 23. INS. Instituto Nacional de Salud. Boletín Epidemiológico Semana 52. ETAS. 2018. 24. Martínez A, Ribot A, Riverón Y, Remón-Díaz D, Alelí Y, Jacsens L, Uyttendaele M. Staphylococcus aureus in the production chain of artisan fresh cheese. Rev Salud Anim 2019;41:2224-4700. 25. Mehramuz B, Taghizadeh S, Kafil HS, Zonouzaq GY, Khiabani MS, Sheikhsaran E, Mokarram RR, Dehghani L. High rate of contamination with Staphylococcus aureus in traditional Koozeh cheeses. A molecular typing approach. Ann Ig 2020;32:178-185. 26. Ferreira G, De Santa Helena AA, Madeira JT, Andrade JS, Mangiavacchi BM, Blanco PR, Neres A. Occurrence of Escherichia coli and Staphylococcus aureus in artisanal minas fresh cheeses produced in the rural area of the Baixada Fluminense region, Province of Rio de Janeiro, Brazil. WJPPS 2020;9:492-503. 27. Ganz K, Yamamoto E, Hardie K, Hum C, Hussein H, Locas A, Steele M. Microbial safety of cheese in Canada. J Food Microbiol 2020;321:1-7. 28. Silva TJ da, Silva AC da, Matos LG de, Silva M da, Camargo CH, Cobo R, Mores VL, Cirone NC. Enterotoxigenic potential and molecular typing of Staphylococcus sp. isolated from organic and conventional fresh minas cheese in the state of São Paulo, Brazil. Int Dairy J 2020;102:1-8. 29. Donnelly C. Review of controls for pathogen risks in Scottish artisan cheeses made from unpasteurised milk. Food Standards Scotland. Inbhe Bidh Alba. Report v 4.7. 2018. 30. Sobral D. Efeito da nisina na contagem de Staphylococcus aureus e nas características do Queijo Minas Artesanal da Região de Araxá. [Tesis doctoral]. Viçosa, Minas Gerais, Brazil: Universidad Federal de Viçosa; 2012. 31. Sobral D, Soares M, Martins VA, Bueno RG, Jacinto JC, Fernandes A, Machado GM. Nisin reduces the Staphylococcus aureus count without changing the characteristics of Artisanal Minas Cheese from Araxá. Rev Inst Laticínios Cândido Tostes, 2019;74:185196.

284


Rev Mex Cienc Pecu 2022;13(1):272-286

32. Felicio BA, Pinto MS, Oliveira FS, Lempk MW, Pires ACS, Lelis CA. Effects of nisin on Staphylococcus aureus count and physicochemical properties of Minas frescal cheese. J Dairy Sci 2015;98:4364–4369. 33. Campo MC. Determinación del efecto de una bacteriocina adicionada en queso costeño sobre Staphylococcus aureus [tesis Bacteriología] Montería, Córdoba, Colombia: Universidad de Córdoba; 2010. 34. López MC. Aplicación de bacteriocinas para la bioprotección de alimentos [tesis doctoral] Andalucía, España: Universidad de Jaén. 2017. 35. Rodríguez MR. Variabilidad de la inactivación microbiana y de la fase de latencia de los microorganismos supervivientes a un proceso de acidificación [tesis doctoral] Madrid, España: Universidad Complutense de Madrid. 2016. 36. FDA. Food and Drug Administration. Kinetics of microbial inactivation for alternative food processing technologies. Overarching principles: kinetics and pathogens of concern for all technologies. J Food Sci 2000;65:1-118. 37. Jaiswal AK, Jaiswal S. Modelling the effects of natural antimicrobials as food preservatives. In: Taylor M. Handbook of natural antimicrobials for food safety and quality. 1rst ed. Cambridge, UK: Woodhead Publishing Limited;2014:259-284. 38. Ha J, Lee J, Lee S, Kim S, Choi Y, Oh H, Kim Y, Lee Y, Seo Y, Yoon Y. Mathematical models to describe the kinetic behavior of Staphylococcus aureus in Jerky. Food Sci Anim Resour 2019;39:371-378. 39. Serpa JG, Pérez TI, Hernández EJ. Effect of pasteurization and starter cultures on physicochemical and microbiological properties of costeño cheese. Rev Fac Nac Agron 2016;69:8007-8014. 40. INS. Instituto Nacional de Salud. Identificación de riesgos biológicos asociados al consumo de leche cruda bovina en Colombia. 2011. 41. Jensen C, Li H, Vestergaard M, Dalsgaard A, Frees D, Leisner J. Nisin damages the septal membrane and triggers DNA condensation in Methicillin-Resistant Staphylococcus aureus. Front Microbiol 2020;11:1007. 42. Heredia-Castro PY, Hérnández-Mendoza A, González-Córdova AF, Vallejo-Cordoba B. Bacteriocinas de bacterias ácido lácticas: mecanismos de acción y actividad antimicrobiana contra patógenos en quesos. Interciencia 2017;42:340-346. 43. Coronado EP, Espitia R. Estudio del efecto de una película antimicrobiana en la vida útil del queso costeño [tesis Ingeniería de alimentos]. Berástegui, Colombia: Universidad de Córdoba; 2015. 285


Rev Mex Cienc Pecu 2022;13(1):272-286

44. Serra MÁ. La resistencia microbiana en el contexto actual y la importancia del conocimiento y aplicación en la política antimicrobiana. Rev Habanera Cienc Médi 2017;16:402-419. 45. FAO. Food and Agriculture Organization of the United Nations. Disposiciones sobre la ciclotetraglucosa (sin1504 i), El jarabe de ciclotetraglucosa (sin 1504 ii) y la nisina (sin 234). Programa conjunto FAO/OMS sobre normas alimentarias Comité del Codex sobre aditivos alimentarios. 47.ª reunión. Xi'an, China, 23 – 27 de marzo de 2015. 46. Araujo D, Ávila L, Jiménez Y. Nisina: una bioalternativa para la reducción de las intoxicaciones alimentarias en el caribe colombiano. Lasirc 2020;1:59-64.

286


https://doi.org/10.22319/rmcp.v13i1.5784 Nota de investigación

El huevo de traspatio: ventana de oportunidad de ingresos en comunidades del Municipio de Texcoco, Estado de México

Juan Hernández Ortiz a Olga Jacqueline Galicia Rojano a Enrique Melo Guerrero b* Ramón Valdivia Alcalá a Luis Manuel Valenzuela Núñez c

a

Universidad Autónoma Chapingo. División de Ciencias Económico Administrativas. Km. 38.5 Carretera México – Texcoco, 56230. Chapingo Texcoco, Estado de México. México. b

Universidad Autónoma del Estado de Hidalgo. Instituto de Ciencias Agropecuarias, Hidalgo, México. c Universidad Juárez del Estado de Durango. Facultad de Ciencias Biológicas, Laboratorio de Biología y Ecología Forestal. Durango, México.

*Autor de correspondencia: emelogro@yahoo.com.mx

Resumen: El objetivo de la investigación fue determinar la disposición a pagar por huevo de traspatio en cuatro localidades del municipio Texcoco, México, a través del Método de Valoración Contingente. Se aplicó una encuesta a 126 jefes de familia y se analizaron los datos mediante un Modelo Logit binomial. El 70 % estuvo dispuesto a pagar un sobre precio del 25 % por el consumo de este producto, con relación al huevo comercial. Las variables más significativas fueron, preocupación por la salud, consumo de frutas y verduras, ingreso mensual y edad. Los resultados revelan la posibilidad de establecer un mejor precio para el huevo de traspatio actual, superior al huevo comercial, lo que representa un aporte a la avicultura familiar de traspatio en la región de estudio. 287


Rev Mex Cienc Pecu 2022;13(1):287-296

Palabras clave: Disposición a pagar, Huevo de traspatio, Logit binomial, Valoración contingente.

Recibido: 28/08/2020 Aceptado: 22/04/2021

El huevo es uno de los productos agropecuarios más importantes en la alimentación humana, debido, entre otras cosas, a su alto índice proteico y disponibilidad en el mercado(1,2). En México, es la fuente de proteína más barata y completa del sector agropecuario(2), que se ha convertido en la proteína de origen animal más accesible(3). En 2012 este país registró un consumo de 20.8 kg, el mayor per cápita de huevo en el mundo(2) y para 2016, la cifra aumentó a 23.1 kg, lo que representó una tasa de crecimiento media anual de 1.5 % de 1994 a 2016(4). De acuerdo con información de la Unión Nacional de Avicultores para 2020, el consumo se mantuvo en los 23 kg per cápita(5), conservando también el primer lugar a nivel mundial. Este comportamiento se encuentra asociado al incremento en la pobreza y al abaratamiento del precio de esta fuente de proteína, como resultado de un incremento en las mejoras tecnológicas, selección genética, nutrición y sanidad de las gallinas de postura(1,6,7) Sin embargo, el incremento en el consumo de huevo en México presenta un límite de consumo saludable, por lo que el crecimiento en la demanda total para los próximos años dependerá únicamente del crecimiento poblacional. Se espera que esta situación afecte a los pequeños y medianos productores, quienes no podrán competir con los costos de producción de las grandes empresas, por lo que una alternativa es la diferenciación del producto(8). Actualmente existen nichos de mercado para huevo diferenciado, por ejemplo, con mayor contenido de nutrientes, (ácidos grasos, omega 3, vitaminas y minerales, principalmente); asociados al sistema de producción como los vegetarianos, los orgánicos, de pastura, de granjas de libertad de movimiento, entre otros. En algunos casos, el sobreprecio de estos productos llega a ser el triple del huevo genérico o comercial(8). El huevo de traspatio, conocido también como de gallina criolla o de rancho, puede considerarse como producto diferenciado; se produce bajo sistema tradicional a través de gallinas criollas (Gallus gallus domesticus), las cuales son una mezcla indeterminada de razas de diferentes orígenes, adaptadas a condiciones rusticas a través del manejo extensivo en los traspatios(9); su alimentación consiste en pastoreo libre o semi pastoreo, complementado en algunos casos con granos, desperdicios de cocina y residuos de cosecha y prácticamente libre de uso de químicos(10,11). Este método de producción brinda al producto ciertas características organolépticas, al tiempo que se percibe como más saludable(9), y comparte algunas

288


Rev Mex Cienc Pecu 2022;13(1):287-296

características con el huevo orgánico; sin embargo este último cuenta con un proceso de certificación(12). El huevo de traspatio es un producto de la avicultura familiar, principalmente en el medio rural y áreas periurbanas y representa un apoyo al sustento familiar. En México, más del 80 % de las familias rurales mantienen gallinas en sus traspatios(13) y aunque el huevo se destina principalmente al autoconsumo, cuando se tienen excedentes se vende en mercados locales o entre familiares y vecinos a precios por encima del huevo comercial(8,9). La existencia de un sobreprecio en los productos naturales o ecológicos, no sólo depende de sus costos de producción y elaboración más altos, sino también del mayor nivel de utilidad que representa para los consumidores, quienes los perciben como de mayor calidad, benéficos para la salud o respetuosos con el medio ambiente(14,15). Por lo anterior, la hipótesis central de investigación es que el huevo de traspatio tiene un valor superior al establecido en el mercado por contar con características similares al huevo orgánico, que se traduce en una disposición a pagar (DAP) un sobreprecio por su consumo en relación con el precio del huevo comercial, en función de la edad, número de integrantes por unidad familiar, nivel de ingreso, preocupación por el cuidado de la salud y el consumo de frutas y verduras. El objetivo de esta investigación fue determinar la disposición a pagar un sobreprecio por el huevo de traspatio en cuatro localidades del municipio de Texcoco, Estado de México, a través del método de valoración contingente, con la finalidad de generar información útil para los avicultores de traspatio y proponer un mejor precio de venta al público. La investigación se realizó en el oriente del Estado de México, en las localidades de San Bernardino, San Miguel Coatlinchán, Montecillos y San Luis Huexotla del municipio de Texcoco, en las que aún es posible encontrar avicultura de traspatio. Se aplicó el método de valoración contingente (MVC), el cual se basa en la construcción de un mercado hipotético a través de la aplicación de encuestas, donde los individuos expresan su disponibilidad a pagar, respecto a un determinado beneficio del producto. Se empleó el formato tipo referéndum, el más utilizado por MVC(16), en el cual el individuo debe decidir si está dispuesto a pagar o no una suma determinada, en este caso por el producto diferenciado, donde la variable dependiente del modelo es la utilidad del individuo (U) y las variables independientes son el consumo de huevo de traspatio (Q), el ingreso (Y) y un vector de variables (S): U = f (Q, Y, S). La utilidad inicial (U0), corresponde a un estado de no consumo de huevo de traspatio (Q0), mejorable hasta (U1) a través de su consumo (Q1), para lo cual se debe pagar una cantidad adicional (P) que proviene del ingreso disponible (Y). Si el usuario acepta pagar “P” para 289


Rev Mex Cienc Pecu 2022;13(1):287-296

mantener el escenario propuesto, debe cumplirse que: V1(Q = 1, Y- P; S) – V0(Q = 0, Y; S)> e0 – e1(16) Donde los términos e0 y e1 se asumen variables aleatorias independientes e idénticamente distribuidas. El cambio en la utilidad del usuario, será igual a la diferencia entre las utilidades final e inicial; para acceder a la situación final se debe pagar cierta cantidad de dinero propuesta por el entrevistador. El modelo logístico general se expresa: Prob(Si)=Prob(V1-V0>η)=prob(α–βP)>η)=

1 1+exp(−α+βP)

Para calcular la DAP se utilizó un modelo logit binomial estimado por máxima verosimilitud a través del programa NLOGIT versión 4.1, con la finalidad de estimar los parámetros de las variables que explican la disposición a pagar de los entrevistados. El modelo econométrico usado fue el siguiente: PrOb(Si)= α + β1(SPrec) + β2(CSal) + β3(FVer) + β4(Edd) + β5(IntF) + β6(Ing) + ε Donde, la variable dependiente binaria PrOb(Si), representa la probabilidad de responder Sí a la pregunta de disponibilidad a pagar por el producto diferenciado, la cual depende del sobreprecio hipotético a pagar (SPrec), la preocupación por el cuidado de la salud (CSal), el consumo de frutas y verduras en el hogar [(FVer) como indicador de hábitos alimenticios saludables], la edad del entrevistado (Edd), el número de integrantes de la familia (IntF) y el nivel de ingreso (Ing). ε representa el error no observable. Las variables explicativas se obtuvieron directamente de la encuesta, la cual se llevó a cabo durante el mes de julio de 2018, obteniéndose un total de 126 entrevistas válidas, a través del muestreo aleatorio con población infinita. Se usaron cinco niveles de precios: $ 25, $27, $29, $31 y $33; el primero correspondió al precio del huevo de traspatio en la región vigente al momento de la encuesta, mientras que el precio del huevo comercial en el mercado local era de $23 pesos por kilo. La metodología empleada consistió en tres etapas: diseño del cuestionario, aplicación de la encuesta y análisis de datos con métodos econométricos. Para el diseño del cuestionario se siguieron las recomendaciones de investigaciones sobre preferencias de consumo y disposición a pagar a través de métodos de valoración de preferencias reveladas(17,18). El cuestionario estuvo organizado en tres apartados(19), en el primero se hicieron preguntas cerradas sobre el conocimiento y percepción de los productos a valorar, en este caso sobre el huevo de traspatio (producto natural obtenido sin el uso de químicos) que comparte algunas características con el huevo orgánico; en el segundo se planteó la pregunta sobre

290


Rev Mex Cienc Pecu 2022;13(1):287-296

disponibilidad a pagar y en el tercero sobre las características socioeconómicas. La pregunta sobre la DAP fue la siguiente: “De acuerdo con su nivel de ingresos, gastos y preferencias, ¿Estaría usted dispuesto a pagar ___ MXN por un kilogramo de huevo de traspatio, el cual de acuerdo al manejo productivo comparte algunas características con productos orgánicos (sin llegar a serlo), y es producido en diferentes localidades del municipio de Texcoco, Estado de México?” Del total de entrevistados, tres cuartas partes eran mujeres, con una edad media de 48 años con nivel de escolaridad de 9.0 (secundaria), valor menor al promedio municipal de 9.7 para Texcoco y al del Estado de México de 9.1(19). Cerca de la mitad de los entrevistados pertenecen al nivel de ingresos de 2,500 a 3,000 MXP y la tercera parte percibía entre 3,000 y 5,000 MXP mensuales; por lo que, de acuerdo al Consejo Nacional para la Evaluación de la Política Social (CONEVAL)(20) más de la mitad de los entrevistados se encuentran en condiciones de pobreza alimentaria. En cuanto a la percepción de los entrevistados sobre los atributos del huevo de traspatio, se encontró que la mayoría manifestó no tener conocimiento con respecto a los productos naturales libres de químicos, una tercera parte asumía una idea al respecto y menos del 10 % tenía conocimiento claro; sin embargo, al explicarles las características de este tipo de productos y al hecho de que el huevo de traspatio puede cumplir con varias características de un producto orgánico, el 70 % señaló estar dispuesto a pagar algún sobre precio por su consumo. Los resultados muestran un comportamiento similar al de una investigación sobre disponibilidad a pagar por tortilla orgánica(15), en la cual se encontró que si bien, únicamente el 28 % de los entrevistados conocían el producto orgánico a valorar, al explicarles en que consistían, tres cuartas partes estuvieron dispuestos a pagar un sobre precio por el producto. Por otra parte, casi dos terceras partes de los entrevistados, señaló que en algún momento de su dieta consumió huevo de traspatio; de estos, el 79 % calificó la calidad del producto de buena a muy buena y el 21 % como regular. Un resultado importante fue que poco más de la cuarta parte (28 %) de las personas que consumen huevo de gallina criolla, lo produce en sus traspatios y el 88 % de quienes lo compran, lo hacen en casa de un familiar o amigo. Asimismo, se encontró que si el precio del huevo de traspatio fuera igual al huevo comercial, el 83 % de los encuestados se inclinaría por la compra del primero, mientras que el 17 % preferiría el comercial. Estas preferencias en el consumo por parte de los individuos entrevistados son congruentes con el comportamiento encontrado en localidades rurales, donde las personas prefieren el huevo de traspatio sobre el huevo industrializado(12). Con respecto a los indicadores de bondad de ajuste se observó que el R2 de McFadden fue de 0.187, aceptable para este modelo, cercano al valor recomendado para este tipo de investigaciones (0.20 a 0.40) y que equivale a una R2 de 0.70–0.90 para el caso de la regresión 291


Rev Mex Cienc Pecu 2022;13(1):287-296

por mínimos cuadrados ordinarios(16,21). Para la prueba de dependencia se utilizó la verosimilitud restringida y la no restringida y se obtuvo un valor de 28.41 que representa una prueba de dependencia de χ2 aceptable, con la cual se rechaza la hipótesis de que las pendientes del modelo son iguales a cero (P≤0.05). Las variables más significativas (P≤ 0.05) fueron el nivel de ingresos, el consumo de frutas y verduras y la edad. La variable con menor significancia estadística fue el número de integrantes de la familia (Cuadro 1). Cuadro 1: Resultados econométricos del modelo logit binomial Variable Etiqueta Coeficiente Error estándar Constante Const 1.836551 3.0493 Sobre precio SPrec -0.168070* 0.0909 Consumo de frutas y verduras FVer 1.088604** 0.5008 Cuidado de la salud CSal 0.969891* 0.5656 Edad Edd 0.369013** 0.0172 Integrantes de la familia IntF -0.148933 0.1468 Ingreso Ing 0.791453** 0.3498 χ2= 28.41933; Logaritmo de verosimilitud restringida= -75.92961; Logaritmo de verosimilitud no restringida= -61.7199; McFadden pseudo R-cuadrada= 0.1871426 ***P≤0.001, ** P≤0.005 y * P≤0.01.

De acuerdo a las pruebas de predicción del modelo, se obtuvo un valor de 79.20 %, lo que indica que el modelo es adecuado para obtener la disposición a pagar por huevo de traspatio, por lo que a partir de los coeficientes de las variables del Cuadro 2, se construyó el siguiente modelo:

Variable

Cuadro 2: Efectos marginales y elasticidades de las variables Efecto marginal Elasticidad

Prec CSal FVer Edd IntF

-0.02993 0.19998 0.22056 0.00657 -0.02652

-1.12987373 0.21867067 0.22050975 0.39705464 -0.13837615

Ing

0.14094

0.34052117

DAP= 1.836 – 0.168Prec + 1.088FruyVer + 0.969CSal + 0.369Edd – 0.148 IntF + 0.791Ing

El coeficiente de la variable precio presentó signo negativo, lo que indica que a medida que el precio del huevo de traspatio se incremente, los consumidores mostraran menor disposición a pagar el sobreprecio. Por el contrario, las variables relacionadas con los buenos hábitos alimenticios de los entrevistados y su preocupación por mantener una buena salud mostraron un coeficiente positivo, que refleja su disposición a pagar un sobreprecio por el 292


Rev Mex Cienc Pecu 2022;13(1):287-296

huevo de traspatio. Este resultado es congruente con los hallazgos de investigaciones sobre disponibilidad a pagar por productos orgánicos que demostraron que las variables relacionadas con el estilo de vida, suelen influir más que las variables socioeconómicas(15,22,23). Los valores que toman en cuenta las personas en sus decisiones de consumo(24), son, en orden de importancia, las relacionadas a la salud, la nutrición, el cuidado del medio ambiente y la preocupación por el bienestar animal. El coeficiente de la variable Edad mostró signo positivo; indica que a mayor edad de los entrevistados, su disposición a pagar por el huevo de traspatio también es mayor; los resultados concuerdan con los reportados en otras investigaciones sobre disponibilidad a pagar(14,25), lo que demuestra que el comportamiento del consumidor está afectado por la edad cuando se adquieren productos diferenciados(14,15). De igual forma, la variable ingreso mostró una relación positiva, que indica que a mayor nivel de ingreso de los entrevistados se tiene mayor disposición a pagar por el consumo de huevo de traspatio. Toda vez que las condiciones económicas suelen cambiar constantemente, se calcularon los efectos marginales y las elasticidades de la DAP para cada variable explicativa del modelo econométrico (Cuadro 2). Las elasticidades de las variables relacionadas con el estilo de vida (cuidado de la salud y consumo de frutas y verduras) indican que, al incrementarse el valor de cada una de estas variables en uno por ciento, cuando el resto de las variables permanece constante, la probabilidad de la disposición a pagar aumenta 0.21 y 0.22 por ciento respectivamente. Para el caso de la variable precio la relación es inversa e indica que, al incrementarse el precio del huevo de traspatio en un punto porcentual, la probabilidad de la DAP disminuye en 1.12 %. El resto de las variables se interpreta de la misma manera. Para el cálculo de la disposición a pagar se estimó la DAP para cada entrevistado, de acuerdo con la siguiente formula(26): DAP =

α + β2(CSal) + β3(FVer) + β4(Edd) + β5(IntF) + β6(Ing) β1(SPrec)

A partir de la expresión anterior se estimó que la disponibilidad a pagar por huevo de traspatio en las comunidades estudiadas fue de $28.75 pesos, con un intervalo de confianza de ($27.5 ≤ 𝜇 ≥ $29.9) MXP y 95% de confiabilidad. Lo que representa un sobreprecio del 25 % en relación con el precio del huevo comercial de $23 MXP, y 15 % en comparación con el precio del huevo de traspatio de $25 MXP, al momento de la encuesta. Al respecto, investigaciones similares sobre disponibilidad a pagar por productos diferenciados reportaron sobre precios de 16 % para carne de conejo orgánico en Iztapalapa(27) y para tortilla orgánica en Puebla(15), México. Asimismo, en la región de Santiago de Chile el sobre precio para manzanas orgánicas fue de 30 %(28); de 53 % para lechuga en Texcoco, México(29); y de 88 % para una variedad de col en Thailandia(30); este mayor o menor 293


Rev Mex Cienc Pecu 2022;13(1):287-296

porcentaje depende de los productos estudiados, el nivel educativo y el estrato socioeconómico de la población analizada, entre otros factores. Se concluye que la mayor parte de los encuestados manifestó estar dispuesto a pagar un sobre precio por el huevo de traspatio con respecto al huevo comercial debido al interés por el cuidado de la salud, el consumo de frutas y verduras, el ingreso mensual y la edad. Se pudo apreciar que las variables relacionadas con los hábitos alimenticios y conciencia sobre el cuidado de la salud fueron de mayor importancia que las características socioeconómicas. Se pudo visualizar un nicho de mercado de huevo de traspatio para aquellas personas mayores de edad y con mayor nivel de ingresos. Literatura citada: 1. Torre MM, Fonseca PM, Quintana LJ. El huevo mitos, realidades y beneficios. México, DF.: Trillas; 2012. 2. Cruz-Jiménez S, García MR, Mora JSF, García RCS. El mercado de huevo para plato en México, 1960-2012. Agr Soc Des 2016;13:385-399. 3. Luis-Rojas S, García-Sánchez RC, García-Mata R, Arana-Coronado OA, GonzálezEstrada A. Metodología Box - Jenkins para pronosticar los precios de huevo blanco pagados al productor en México. Agro 2019;53:911-925. 4. UNA Unión Nacional de Avicultores. Compendio de Indicadores Económicos del Sector Avícola. México: UNA; 2016. 5. UNA. Unión Nacional de Avicultores Situación de la Avicultura Mexicana: Expectativas 2021. https://una.org.mx/industria/# Consultado 8 Abr, 2021. 6. Li Y, Luo C, Wang J, Guo F. Effects of different raising systems on growth performance, carcass, and meat quality of medium-growing chickens. J Appl Anim Res 2017;45(1): 326-330. 7. Khawaja T, Khan SH, Mukhta N, Ali MA, Ahmed T, Ghafa A. Comparative study of growth performance, egg production, egg characteristics and haematobiochemical parameters of Desi, Fayoumi and Rhode Island Red chicken. J Appl Anim Res 2012;40 (4):273-283. 8. Mendoza RY, Brambila PJJ, Arana CJJ, Sangerman-Jarquin DM, Molina GJN. El mercado de huevo en México: tendencia hacia la diferenciación en su consumo. Rev Mex Cien Agr 2016;7(6):1455-1466.

294


Rev Mex Cienc Pecu 2022;13(1):287-296

9. Juárez-Caratachea A, Gutiérrez-Vázquez E, Segura-Correa J, Santos-Ricalde R. Calidad del huevo de gallinas criollas criadas en traspatio en Michoacán, México. Trop Subtrop Agro 2010;12:109-115. 10. Juárez, CA, Pérez TJ. Comportamiento de la parvada de gallinas en condiciones naturales del medio rural. Cien Nic 2003;35:73-80. 11. Gutiérrez-Triay M, Segura-Correa JC, López-Burgos L, Santos-Flores J, Santos-Ricalde RH, Sarmiento-Franco L, et al. Características de la avicultura de traspatio en el municipio de Tetiz, Yucatán, México. Trop Subtr Agro 2007;7:217-224. 12. Del Ángel-Coronel OA, Torres-rivera JA, Ortíz-Rubio LS, Aguas-Hernández MF. Evaluación sensorial, parámetros fisicoquímicos y preferencias de consumo de huevo de gallina de traspatio, orgánico e industrializado en la región cafetalera central de Veracruz, México. Rev Plan Cont Mic 2016;2(3):21-31. 13. Santos R, Hau CE, Belmar R, Armendariz I, Cetina R, Sarmiento L, Segura J. Socioeconomic and technical characteristics of backyard animal husbandry in two rural communities of Yucatan, Mexico. J Agr Rur Dev Trop Subt 2004;105:165-174. 14. Trujillo-Murillo J, Hernández-Ortiz J, Martínez-Damián MA. Disposición a pagar por productos orgánicos en Texcoco, Estado de México. REMEXCA 2019;10(7):16851691. 15. Jaramillo Villanueva JL. Preferencias del consumidor y disposición a pagar por el consumo de tortilla de maíz orgánico. Est Soc: Rev Alim Cont Des Reg 2016;25(47): 143-161. 16. Tudela JW, Damián MA, Valdivia R, Romo JL, Portillo M, Ventura R. Valoración económica de los beneficios de un programa de recuperación y conservación en el Parque Nacional Molino de Flores, México. RChSCFA 2011;17(2):231-244. 17. Mitchell RC, Carson RT. Using surveys to value public goods: The contingent valuation method. Washington, USA: Resources for the Future. 1989. 18. Melo-Guerrero E, Rodríguez-Laguna R, Martínez-Damián MA, Hernández-Ortiz J, Razo-Zárate R. Basic considerations for the application of discrete choice experiments: a review. Rev Mex Cienc For 2020;11(59):1-26. 19. CONEVAL. Consejo Nacional de Evaluación de la Política de Desarrollo Social Informe Anual Sobre la Situación de Pobreza y Rezago Social. http://www.dof.gob.mx/SEDESOL/Mexico_099.pdf Consultado 18 Ago, 2020.

295


Rev Mex Cienc Pecu 2022;13(1):287-296

20. CONEVAL. Consejo Nacional para la Evaluación de la Política Social. http://www.coneval.gob.mx/Informes/Coordinacion/Pobreza_2012/COMUNICADO_ PRENSA_003_MEDICION_2012.pdf. 2012 Consultado 14 Ago, 2020. 21. Melo-Guerrero E, Hernández-Ortiz J, Aguilar LA, Rodríguez Laguna R, Martínez DMA, Valdivia AR, Razo ZR. Experimentos de elección para el manejo del Parque Nacional Los Mármoles, México. RChSCFA 2020;26(2):257-272. 22. Gil JM, Gracia A, Sánchez M. Market segmentation and willingness to pay for organic products in Spain. Int Food Agrib Mana Rev 2000;3:207-226. 23. Roitner-Schobesberger B, Darnhofer I, Somsook S, Volg CR. Consumer perceptions of organic foods in Bangkok, Thailand. Food Pol 2008;33(2):112-121. 24. Shaw D, Grehan E, Shiu E, Hassan L, Thomson J. An exploration of the values in ethical consumer decisión making. J Cons Behav 2005;4:185-200. 25. Medina A, Escalera M, Vega MA. La edad como factor del comportamiento del consumidor de productos orgánicos. Europ Scient J 2014;10(7):21-36. 26. Hanemann M. Welfare evaluations in contingent valuation experiments with discrete responses. Am J Agric Econ 1984;66(1):332-341. 27. Cerda A, García L, Tolosa F, García V. Preferencias y disposición para pagar por manzanas orgánicas en la Región Metropolitana de Santiago de Chile. Rev Fac Agron 2014;31(2):274-289. 28. Jaramillo VJL, Vargas LS, Guerrero RJD. Preferencias de consumidores y disponibilidad a pagar por atributos de calidad en carne de conejo orgánico. Rev Mex Cienc Pecu 2015;6(2):221-232. 29. Trujillo-Murillo J, Hernández-Ortiz J, Martínez-Damián MA. Disposición a pagar por productos orgánicos en Texcoco, Estado de México. REMEXCA 2019;10(7):16851691. 30. Sriwaranum Y, Gan Christopher, Lee M, Cohen DA. Consumers’ willingness to pay for organic products in Thailand. Int J Soc Econ 2009;42(5):480-510.

296


https://doi.org/10.22319/rmcp.v13i1.5265 Nota de investigación

Rendimiento y digestibilidad de forraje de cultivares de Urochloa spp. a tres edades de rebrote en épocas de lluvias y seca

Jonathan Raúl Garay Martínez a Benigno Estrada Drouaillet b Juan Carlos Martínez González b Santiago Joaquín Cancino b* Hernán Patricio Guevara Costles c Marco Vinicio Acosta Jácome d Eugenia Guadalupe Cienfuegos Rivas b

a

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Campo Experimental Las Huastecas. Tamaulipas, México. b

Universidad Autónoma de Tamaulipas. Facultad de Ingeniería y Ciencias. Tamaulipas, México. c

Escuela Superior Politécnica de Chimborazo. Riobamba, Ecuador.

d

Universidad Tecnológica Equinoccial, Campus Santo Domingo-Escuela de Ingeniería Agropecuaria, Vía Chone Km. 4 ½ y Av. Italia. 230101. Santo Domingo, Ecuador.

* Autor de correspondencia: sjoaquin@docentes.uat.edu.mx

Resumen: El trópico húmedo ecuatoriano tiene potencial para la producción ganadera y los cultivares de Urochloa pueden ser una opción para la producción de alimento, pero se deben considerar las condiciones ambientales y de manejo, ya que estas determinarán el rendimiento y valor 297


Rev Mex Cienc Pecu 2022;13(1):297-310

nutritivo del forraje. Se evaluó el rendimiento de materia seca total (MST; t ha-1), componentes morfológicos (%; hoja, tallo, material muerto e inflorescencia) y la digestibilidad in situ de la MS (DISMS; g kg-1) en cinco cultivares de Urochloa: Mulato II, Marandú, Xaraés, Piatá y Señal (testigo), a tres edades de rebrote (4, 6 y 8 semanas), durante las épocas de lluvias (ELL) y seca (ESE). Los datos se analizaron dentro de cada época con un diseño de bloques completos al azar en arreglo de parcelas divididas. Durante la ELL no hubo diferencia (P>0.05) en MST, entre cultivares evaluados. Durante la ESE Marandú presentó menor rendimiento que Xaraés (0.92 vs 1.21 t ha-1). La proporción de componentes morfológicos fue diferente entre cultivares (P<0.05) y las hojas fueron el componente que más contribuyó al rendimiento. La DISMS se redujo de 64 a 56 % y de 60 a 56 %, cuando el forraje se cosechó a 4 y 8 semanas durante la ELL y ESE, respectivamente. Los cultivares evaluados mostraron rendimientos aceptables de MST, 2.6 y 1.0 t ha-1 y DISMS, 602 y 574 g kg-1, durante la ELL y ESE, respectivamente; por lo que pueden ser una alternativa forrajera para la ganadería del trópico húmedo de Ecuador. Palabras clave: Brachiaria híbrido, Brachiaria brizantha, Brachiaria decumbens, Época de lluvias, Época seca, Composición morfológica, Valor nutritivo.

Recibido: 25/02/2020 Aceptado: 22/12/2020

En los sistemas pecuarios, mayormente en rumiantes, esta actividad se basa en el uso de forrajes como fuente de alimento de bajo costo en sistemas de producción extensivos y como complemento en los sistemas intensivos(1). La productividad de la ganadería en las zonas tropicales de Ecuador está limitada por el bajo rendimiento de forraje de las praderas, en su mayoría constituidas por especies de Urochloa (Sin. Brachiaria): U. humidicola y U. decumbens; las cuales presentan problemas relacionados con bajo rendimiento de forraje y valor nutritivo; además, son susceptibles al efecto dañino de especies de Aeneolamia spp. y hongos foliares como Rhizoctonia solani, las cuales reducen significativamente el rendimiento de forraje(2).

Para aumentar la producción pecuaria se han seleccionado cultivares de Urochloa por su adaptación a suelos con deficiente fertilidad y niveles tóxicos de aluminio, resistencia a plagas y enfermedades y mayor rendimiento y valor nutricional del forraje(3). De esta manera, se han liberado al mercado diferentes cultivares de este género como opciones para superar las problemáticas observadas en las gramíneas mencionadas(4). Se ha reportado que la producción anual de materia seca (MS) en U. híbrido cv. Mulato II y U. brizantha cv. Xaraés 298


Rev Mex Cienc Pecu 2022;13(1):297-310

oscila entre 25 y 30 t ha-1(5,6,7); mientras que en U. decumbens es de 11 a 19 t ha-1(8). En este sentido, en evaluaciones de U. decumbens, U. híbrido cv. Mulato I, U. humidicola(9,10,11), U. brizantha cv. Marandú y U. híbrido cv. Mulato II(12) se encontraron similitudes en la producción de MS total, sin embargo, se observaron diferencias en la composición morfológica; algunos genotipos con mayor producción de hojas (Mulato I y II), correlacionado con mayor contenido de proteína cruda(13). El híbrido Mulato II supera significativamente en calidad del forraje a otras braquiarias comúnmente utilizadas (U. brizantha y U. humidicola), debido a que presenta hasta 67 % de digestibilidad de la MS(14); mientras que la digestibilidad en Xaraés y U. decumbens, es de 58 y 43 %, respectivamente(15).

La composición genética determina la capacidad productiva de cualquier especie forrajera(2); pero los factores ambientales (condiciones climáticas) y el manejo de la pradera modifican la expresión del comportamiento forrajero y su valor nutritivo(16,17). En este sentido, se recomienda que antes de introducir un nuevo material forrajero, se debe evaluar el comportamiento agronómico de manera controlada y determinar si representan una opción viable para la ganadería en la región(11). Por lo anterior, el objetivo de este estudio fue evaluar el rendimiento de forraje, composición morfológica y digestibilidad in situ del forraje de cultivares de Urochloa spp. a tres edades de rebrote, durante las épocas de lluvias y seca en condiciones de trópico húmedo del Ecuador.

El estudio se realizó en condiciones de temporal de diciembre 2011 a noviembre de 2012. El sitio experimental se encuentra en la Granja “El Oasis” perteneciente a la Escuela de Ingeniería Agropecuaria de la Universidad Tecnológica Equinoccial, Campus Santo Domingo, Ecuador. Las coordenadas geográficas son: 00° 13’ 19.70’’ S y 79° 15’ 39.00’’ O (406 msnm). El suelo del lugar se clasifica como Andisol, con pH de 5.9 y 2.2 % de materia orgánica. Presenta contenidos de 41.0, 6.5, 6.3 y 42.0 mg kg-1 de NH4, P, S y Fe, respectivamente; además, 0.3, 8.3 y 2.9 cmol kg-1 de K, Ca y Mg, respectivamente. La clasificación climática según Köppen es de clima tropical monzónico (Am), que se caracteriza por presentar dos épocas o estaciones bien definidas, la lluviosa de enero a junio y la seca de julio a diciembre. La precipitación pluvial y la temperatura media mensual (máxima y mínima) registrados durante el período de evaluación y la precipitación promedio mensual del año 2000 al 2012 se observan en la Figura 1.

299


Rev Mex Cienc Pecu 2022;13(1):297-310

Figura 1: Variables climáticas durante el periodo experimental, considerando la época de lluvias (enero a junio) y seca (julio a diciembre)

Los factores en estudio incluyeron: 1) tres cultivares de U. brizantha (Marandú, Piatá y Xaraés), el híbrido Mulato II (U. ruziziensis X U. brizantha) y como testigo, U. decumbens; 2) edad de rebrote, 4, 6 y 8 semanas. Los genotipos se cosecharon en cada edad de rebrote durante la época de lluvias (13 de marzo al 12 de mayo, Tmin=20.8 C, Tmax=28.6 C y precipitación acumulada de 1,733 mm) y seca (07 de septiembre al 03 de noviembre, Tmin=19.2 C, Tmax=28.1 C y precipitación acumulada de 39 mm).

Para la siembra (17 de diciembre de 2011) se utilizó semilla comercial; para garantizar la emergencia de al menos una planta, se depositaron tres semillas en bolsa negras de polietileno, con capacidad aproximada de 2 kg de suelo (del mismo sitio experimental). A las siete semanas posteriores a la siembra (4 de febrero de 2012), las plantas se trasplantaron a parcelas de 5×5 m (25 m2), donde quedaron distribuidas a 0.5 m de distancia entre plantas y surcos (40,000 plantas ha-1). El área útil dentro de cada parcela fue de 9 m2, donde estuvieron 7 surcos de 3 m (con 7 plantas cada uno), de los cuales se seleccionaron tres al azar para cosecharlos en cada una de las edades de rebrote. Al momento del trasplante todas las parcelas se fertilizaron con 120, 60, 70, 60, y 50 kg ha-1 de N (Urea, FERTISA S. A., Ecuador), P2O5 (DAPHOS, Tecnifertpac S. A., Ecuador), K2O (Muriato de potasio, FERTISA S. A., Ecuador), Mg (óxido de magnesio, Interfilk S. A., Ecuador) y SO4 (Sulfato de amonio, FERTISA S. A., Ecuador), respectivamente.

300


Rev Mex Cienc Pecu 2022;13(1):297-310

Para iniciar con la evaluación durante la época de lluvias (17 de marzo de 2012), a las seis semanas después del trasplante, se realizó un corte de uniformidad a 15 cm sobre el nivel del suelo. Al finalizar la época de lluvias, se permitió que las parcelas se recuperaran para evitar el traslape entre las dos épocas y no tener efectos confundidos por época, y se realizó otro corte de uniformización para iniciar la evaluación durante la época seca (07 de septiembre de 2012). Durante cada muestreo se cosechó a 15 cm sobre el nivel del suelo todo el forraje presente en 3 m (siete plantas) y se pesó en una balanza de precisión (Modelo PB3002-S, Mettler Toledo®, Suiza) al momento del corte (materia verde). Las muestras se secaron en estufa de aire forzado (Modelo 100-800, Memmert,) a 65 °C por 48 h para estimar el contenido de materia seca (MS). Se seleccionaron dos submuestras de aproximadamente 0.2 y 1.0 kg: la primera se separó en componentes morfológicos (hoja, tallo, material muerto e inflorescencia); la segunda, se utilizó para análisis químicos y digestibilidad in situ.

Las variables evaluadas incluyeron: rendimiento de materia seca total (MST; t ha-1) y MS de los componentes morfológicos (%): hoja (MSh), tallo (MSt), material muerto (MSmm) e inflorescencia (MSi). El contenido (g kg-1) de fibra detergente neutro (FDN), y ácido (FDA) y lignina (Lig) de la MST se determinó mediante analizador de fibra ANKOM (ANKOM 200/220®) y los protocolos de ANKOM Technology(18). La digestibilidad in situ de la MS (DISMS; g kg-1) se determinó mediante la técnica de Vanzant et al(19). Para la DISMS, las muestras de los cultivares de Urochloa se molieron a tamaño de partícula de 2 mm y se colocaron 4 g de muestra (MS) en bolsas de nailon de 15×7 cm con tamaño de poro de 50 ± 10 µm, atadas a cadena metálica. Las muestras se incubaron por 48 h en tres vacas Holstein (560 ± 23 kg) con cánula ruminal, que se encontraban alimentándose en praderas de Lolium perenne y tuvieron agua a libre acceso. Las muestras se retiraron y se lavaron con agua corriente del grifo hasta que el efluente se tornó claro. Posteriormente, se secaron en estufa de aire forzado a 65 °C por 48 h y se pesaron en balanza analítica (Mettler Toledo PB3002S®, Suiza).

Los datos se analizaron por época, con el procedimiento GLM de SAS(20), en diseño completamente al azar con cuatro repeticiones y arreglo de parcelas divididas, la parcela grande fue el cultivar y la parcela pequeña la edad de rebrote. Las medias de los tratamientos se compararon con la prueba de Tukey (α=0.05).

Durante la época de lluvias, la edad de rebrote influyó positivamente en el rendimiento de forraje (P<0.05), aumentó de 1.14 a 4.23 t MS ha-1 por corte, cuando el forraje se cosechó a 4 y 8 semanas, respectivamente. El cultivar Marandú presentó el menor rendimiento de MST (0.79 t ha-1) a las 4 semanas de rebrote (P<0.05); mientras que a las semanas 6 y 8, la MST fue similar (P>0.05) entre los cultivares. Este comportamiento propició que no se observaran 301


Rev Mex Cienc Pecu 2022;13(1):297-310

diferencias (P˃0.05) en rendimiento de MST (2.64 t ha-1) promedio de las edades de rebrote entre los cultivares evaluados. Durante la época seca, se observó que, el cultivar Marandú presentó los valores menores (P<0.05) de MST en comparación con Xaraés (0.92 vs 1.21 t ha-1; Cuadro 1). Así mismo, se observó que el rendimiento de forraje disminuyó 60 % durante la época seca (2.64 vs 1.05 t ha-1).

Cuadro 1: Rendimiento de materia seca total (t ha-1) de cinco cultivares de Urochloa a tres edades de rebrote durante la época de lluvias (marzo-mayo) y seca (septiembre-noviembre) Época de lluvias Cultivar

Época seca

Edad de rebrote (semanas)

Edad de rebrote (semanas) Promedio

4 Señal

6

8

Promedio

4

0.88 bc 2.71 a 4.22 a 2.60

6

8

a 0.41 a

0.77 ab 1.98 ab 1.05 ab

Marandú 0.79 c

2.55 a 3.90 a 2.41

a 0.43 a

0.71 b

1.62 b

Mulato II 1.28 a

2.32 a 4.17 a 2.59

a 0.28 b

0.64 b

1.92 ab 0.95 ab 1.97 ab 1.10 ab

Piatá

1.16 ab 2.31 a 4.39 a 2.62

a 0.40 ab 0.94 a

Xaraés

1.58 a

a 0.41 a

Promedio 1.14 C

2.80 a 4.47 a 2.95 2.54 B 4.23 A

0.83 ab 2.39 a

0.92 b

1.21 a

0.38 C 0.78 B 1.98 A

Dentro de cada época, los tratamientos con diferentes literales en una columna (a, b, c) y en una fila (A, B, C) son estadísticamente diferentes (Tukey; α=0.05).

El comportamiento observado en acumulación de MST fue similar a lo reportado en otro estudio, donde se evaluaron diferentes cultivares de Urochloa humidicola (Rendle) Schweick durante la época seca, con precipitación promedio de 50 mm y no encontraron diferencias en el rendimiento de MST entre cultivares(10). Al respecto, factores climáticos como precipitación y temperatura influyen de manera significativa en la producción de biomasa forrajera(21,22) y el rendimiento puede disminuir hasta 50 % durante la época de mínima precipitación(23); como se muestra en este estudio, donde una fluctuación de cerca de 1700 mm de precipitación entre las dos épocas ocasionó reducción en la biomasa cercana a 60 % en la MST.

Dentro de cada época, la composición morfológica varió entre genotipos (P<0.05). Durante la época de lluvias, el pasto Señal presentó las proporciones mayores de MSt en todas las edades de rebote evaluadas. Mientras que la MSmm se presentó en la octava semana de rebrote, con 9 % en Señal, 6 % en Mulato II y 3 % en Marandú, sin embargo, no se presentó en los cultivares Piatá y Xaraés. Para la MSi, el cultivar Piatá mostró 3.2 % en la octava 302


Rev Mex Cienc Pecu 2022;13(1):297-310

semana y fue diferente a Señal que presentó 0.6, 1.2 y 3.5 % de MSi en la semana 4, 6 y 8, respectivamente (Figura 2A).

Figura 2: Proporción de los componentes morfológicos de cinco cultivares de Urochloa, a tres edades de rebrote durante las épocas de lluvias (A) y seca (B)

Mul: Mulato II, Mar: Marandú, Xar: Xaraés, Pia: Piatá, Señ: Señal. Dentro de cada edad de rebrote, las barras representan diferencia estadística (Tukey, α=0.05).

Durante la época seca, hubo menor diferenciación de los componentes morfológicos de la planta. La proporción de MSh a las 4 semanas fue menor en Señal (90 %), ya que fue el único cultivar que presentó MSt (10 %). No se observó presencia de MSmm en ningún cultivar y la MSi solo se presentaron en Señal a las 8 semanas (2 %; Figura 2B). En ambas épocas, la MS de hoja mostró la mayor contribución al rendimiento de la MST, seguida de tallo, material muerto e inflorescencia.

La época y la edad de rebrote determinaron el comportamiento en la producción y composición morfológica de los cultivares evaluados. Los cambios observados durante la 303


Rev Mex Cienc Pecu 2022;13(1):297-310

época de lluvias son resultado de una mayor velocidad de recambio de tejido y crecimiento activo de los pastos, principalmente por la disponibilidad de humedad(24). Sin embargo, durante la época seca, la disminución en la tasa de crecimiento(9) redujo la contribución de los tallos al rendimiento de forraje y causó que las hojas fueran el componente que más aportó al rendimiento de la MST durante esta época (Figura 2).

Durante la época de lluvias la digestibilidad in situ de la MS (DISMS) solo fue diferente (P<0.05) a las cuatro y seis semanas de rebrote entre los cultivares evaluados (Cuadro 2). Por otra parte, en la época seca solo se observaron diferencias (P<0.05) entre los cultivares en la semana 6 y 8. La reducción en la DISMS de la semana 4 a la 8 fue de 15.9 % (86 g kg-1) en la época de lluvias, mientras que, en la época seca fue 5.7 % (34 g kg-1). Al respecto, se ha reportado un comportamiento similar en U. decumbens, Marandú y Xaraés, donde la digestibilidad in situ promedio fue superior durante la época de lluvias (650 vs 620 g kg-1)(21). Lo anterior, podría deberse a que las plantas bajo condiciones de estrés tienden a producir metabolitos secundarios (conjugados de fenilpropanoides con aminas) que se incorporan a la pared celular vegetal para aumentar su rigidez(25,26) y, como consecuencia, disminuye la digestibilidad de la MS.

Cuadro 2: Digestibilidad in situ (g kg-1) de cinco cultivares de Urochloa a tres edades de rebrote durante la época de lluvias y seca Época de lluvias Cultivar

Época seca

Edad de rebrote (semanas)

Edad de rebrote (semanas) Promedio

4 Señal

638

6 ab 581 b

8

Promedio

4

6

8

533 a

584 b

598 a 549 b

553 ab 567 bc

621 ab 576 a

622 a

609 a 598 a

609 a

605 a

590 a 571 ab 563 a

574 b

Marandú 670

a

Mulato II 649

ab 646 a

580 a

625 a

Piatá

647

ab 586 b

565 a

599 ab 595 a 557 b

584 a

579 b

Xaraés

615

b

533 a

579 b

500 b

543 c

Promedio 644

589 b

A 604 B 558 C

588 a 541 b

596 A 563 B 562 B

Dentro de cada época, los tratamientos con diferente letra en una columna (a, b, c) y en una fila (A, B, C) son estadísticamente diferentes (Tukey; α=0.05).

De manera independiente a la época, todos los genotipos presentaron una digestibilidad de la MST >540 g kg-1). Los cultivares con mayor DISMS fueron Mulato II y Marandú; mientras que Señal (U. decumbens) presentó la menor. Se han reportado resultados similares, donde 304


Rev Mex Cienc Pecu 2022;13(1):297-310

concluyen que U. decumbens presenta menor digestibilidad que U. brizantha (430 vs 580 g kg-1, respectivamente)(15); debido a que U. brizantha desarrolla fibras con menor contenido de lignina y menor espesor de pared celular en comparación con U. decumbens(27). La disminución de la DISMS con relación al período de rebrote se debe principalmente a la maduración de la planta y, por tanto, al aumento del contenido de lignina ligada a hemicelulosa y celulosa(28), lo que disminuiría la acción de los microrganismos del rumen y podría reducir la digestibilidad del forraje(29).

En ambas épocas, el contenido de fibra detergente neutro (FDN), fibra detergente ácido (FDA) y lignina (Lig) fue diferente (P<0.05) entre cultivares y edades de rebrote (Cuadro 3). Durante la época de lluvias, Xaraés presentó el mayor contenido de FDN, FDA y Lig (P<0.05). Durante la época seca, Señal presentó 25 % más Lig (P<0.05) que Mulato II (79 vs 63 g kg-1). En ambas épocas, los contenidos de fibras (FDN y FDA) incrementaron al aumentar la edad de rebrote de cuatro a ocho semanas. En la época de lluvias, el aumento (P<0.05) fue 3.7, 6.1 y 30.7 % (25, 24 y 17 g kg-1, respectivamente), mientras que en la época seca fue 4.8, 12.3 y 26.9 % (32, 44 y 17 g kg-1, respectivamente) para la FDN, FDA y Lig, respectivamente. Al respecto, el incremento en los componentes de las paredes celulares y reducción en la digestibilidad de la MS se debe principalmente a la madurez de la planta(16) y las características intrínsecas de cada genotipo(2,30).

Cuadro 3: Contenido de fibra detergente neutro (FDN), fibra detergente ácido (FDA) y lignina (Lig) en cinco cultivares de Urochloa, a tres edades de rebrote durante las épocas de lluvias y seca Época de lluvias Cultivar

Época seca

Edad de rebrote (semanas)

Edad de rebrote (semanas) Promedio

4

6

8

Promedio 4

6

8

FDN (g kg-1) Señal

659 ab 681 a

691 b

677 c

Marandú

669 ab 683 a

692 b

682 bc 656 ab 678 a

691 ab 675 a

Mulato II

649 b

660 a

660 c

656 d

619 b

661 a

669 b

650 b

Piatá

678 ab 683 a

712 a

691 ab 682 a

686 a

696 a

688 a

Xaraés

694 a

718 a

702 a

680 a

696 a

687 a

Promedio

670 B 680 B 695 A

693 a

646 ab 670 a

685 a

696 a

658 C 675 B 690 A

FDA (g kg-1)

305

671 a


Rev Mex Cienc Pecu 2022;13(1):297-310

Señal

387 b

381 b

409 bc 392 b

Marandú

399 b

397 ab 410 b

402 b

346 bc 391 a

402 ab 380 c

Mulato II

360 c

375 b

375 c

331 c

374 b

380 b

Piatá

395 b

388 ab 427 ab 403 b

379 a

393 a

399 ab 390 ab

Xaraés

417 a

422 a

377 a

403 a

411 a

Promedio

392 B 393 B 416 A

388 c

445 a

428 a

352 b

394 a

414 a

387 bc

361 d

397 a

357 C 391 B 401 A

Lig (g kg-1) Señal

70

a

77

b

92

b

80

b

68

a

77

a

91

a

Marandú

64

a

69

cd 78

c

70

cd 62

a

67

a

84

ab 71

ab

Mulato II

61

a

62

d

71

c

64

d

57

a

63

a

69

c

b

Piatá

63

a

70

bc 83

b

72

bc 63

a

68

a

79

bc 70

ab

Xaraés

70

a

91

a

103 a

88

a

64

a

68

a

78

bc 70

ab

Promedio

65

C 74

63

C 69

B 85

A

B 80

79

63

a

A

Dentro de cada época, los tratamientos con diferente letra en una columna (a, b, c, d) y en una fila (A, B, C) son estadísticamente diferentes (Tukey; α=0.05).

Los contenidos de FDN y FDA obtenidos en el presente estudio a las seis semanas en ambas épocas de evaluación, son similares a los reportados en otro estudio: Marandú (680 y 396 g kg-1), Xaraés (700 y 400 g kg-1) y Piatá (670 y 370 g kg-1) a los 40 días de rebrote(31). Por otra parte, los valores de lignina obtenidos en este estudio fueron superiores a los reportados en otra investigación para Marandú (45 g kg-1) y Piatá (43 g kg-1) a los 40 días posteriores al inicio de rebrote(31). Con respecto al efecto de época y edad de rebrote sobre los componentes de las paredes celulares se ha mencionado que, a 24 días de rebrote, durante la época de lluvias en U. decumbens y U. brizantha cv. Xaraés presentaron menores contenidos FDN (610 vs 690 y 690 vs 710 g kg-1, respectivamente) y FDA (230 vs 340 y 430 vs 510 g kg-1, respectivamente)(21). Durante la época de lluvias, el cultivar Xaraés tuvo los mayores contenidos de FDN, FDA y lignina con la menor digestibilidad de la MST; mientras que el cultivar Mulato II tuvo los menores valores en los componentes de las paredes celulares y la mayor DISMS. Al respecto, se ha indicado que la lignina es un componente antinutricional, porque interfiere con el aprovechamiento de la energía digestible(29). Esto se debe a qué, en gramíneas, a diferencia de las leguminosas, la lignina está ligada en mayor proporción a la hemicelulosa y a la celulosa(32), lo cual impide la acción microbiana y, por tanto, origina menor digestibilidad del forraje(28). Así mismo, cuando la planta es sometida a estrés por altas temperaturas, para protegerse utiliza un mecanismo estructural que consiste en incrementar la pared celular (principalmente lignina), lo cual reduce la digestibilidad del forraje(25). 306


Rev Mex Cienc Pecu 2022;13(1):297-310

La escasez de precipitación afectó negativamente a todas las variables evaluadas. La edad de rebrote afectó significativamente el rendimiento, composición morfológica, contenido de fibras y digestibilidad in situ de la materia seca. Los cultivares evaluados mostraron producción de materia seca por corte aceptable durante la época de lluvias y seca, a pesar de que las praderas eran de reciente establecimiento. Los valores de digestibilidad in situ en los cultivares Mulato II y Marandú se mantuvieron a través del tiempo. La disponibilidad de forraje es crítica en el trópico húmedo de Ecuador, principalmente al final de la época seca y los cultivares Mulato II, Marandú y Xaraés podrían ser una alternativa por su aporte de materia seca y digestibilidad de materia seca.

Agradecimientos

Agradecimientos al Consejo Nacional de Ciencia y Tecnología (CONACYT) por la beca de investigación y estancia (266100, 290618) del primer autor en Ecuador. A la Escuela Superior Politécnica de Chimborazo (Ecuador), a la Escuela de Ingeniería Agropecuaria de la Universidad Tecnológica Equinoccial, Campus Santo Domingo (Ecuador) y a la Facultad de Ingeniería y Ciencias de la Universidad Autónoma de Tamaulipas (México) por las facilidades proporcionadas para hacer posible esta investigación.

Literatura citada: 1. Martínez-González JC, Castillo-Rodríguez S, Villalobos-Cortés A, Hernández-Meléndez J. Sistemas de producción con rumiantes en México. Ciencia Agropecuaria 2017;(26):132-152. 2. Miles JW. Mejoramiento genético en Brachiaria: objetivos, estrategias, logros y proyecciones. Pasturas Trop 2006;28(1):26-30. 3. Lascano C, Pérez R, Plazas C, Medrano J, Pérez O, Argel PJ. Cultivar Toledo-Brachiaria brizantha (Accesión CIAT 26110); gramínea de crecimiento vigoroso para intensificar la ganadería colombiana. 1ra ed. Cali, Colombia: Centro Internacional de Agricultura Tropical; 2002. 4. Pizarro EA, Hare MD, Mutimura M, Changjun B. Brachiaria hybrids: potential, forage use and seed yield. Trop Grassl-Forrajes Trop 2013;1(1):31-35. 5. Guiot JD, Meléndez F. Producción anual de forraje de cuatro especies de Brachiaria en Tabasco. En: Universidad Veracruzana editor. XVI Reunión Científica Tecnológica Forestal y Agropecuaria. Veracruz. 2003:126-128.

307


Rev Mex Cienc Pecu 2022;13(1):297-310

6. Peters M, Franco LH, Schmidt A, Hincapié B. Especies forrajeras multipropósito: opciones para productores de Centroamérica. 1ra ed. Cali, Colombia: Centro de Investigación Agrícola Tropical; 2003. 7. Argel PJ. Cultivar mulato II (Brachiaria híbrido CIAT 36087). Gramínea de alta calidad y producción forrajera, resistente a salivazo y adaptada a suelos tropicales ácidos bien drenados. En: González C, Madrid N, Soto E, editores. Desarrollo sostenible de la ganadería doble propósito. 1ra ed. Maracaibo, Venezuela: Ediciones Astro Data SA.; 2008:347-362. 8. Enríquez JF, Meléndez N, Bolaños ED, Esqueda VA. Producción y manejo de forrajes tropicales. 1ra ed. D.F., México: Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias; 2011. 9. Cruz PI, Hernández A, Enríquez JF, Mendoza SI, Quero AR, Joaquín BM. Desempeño agronómico de genotipos de Brachiaria humidicola (Rendle) Schweickt en el trópico húmedo de México. Rev Fitotec Mex 2011;34(2):123-131. 10. Reyes-Purata A, Bolaños-Aguilar ED, Hernández-Sánchez D, Aranda-Ibañez EM, Izquierdo-Reyes F. Producción de materia seca y concentración de proteína en 21 genotipos del pasto Humidícola Brachiaria humidícola (Rendle) Schweick. Universidad y Ciencia 2009;25(3):213-224. 11. Rojas-Hernández S, Olivares-Pérez J, Jiménez-Guillén R, Gutiérrez-Segura I, AvilésNova F. Producción de materia seca y componentes morfológicos de cuatro cultivares de Brachiaria en el trópico. Rev Avan Inv Agrop 2011;15(1):3-8. 12. Maia GA, Costa KAP, Severiano EC, Epifanio PS, Neto JF, Ribeiro MG, et al. Yield and chemical composition of Brachiaria forage grasses in the offseason after corn harvest. Am J Plant Sci 2014;(5):933-941 13. Pérez JA, García E, Enríquez JF, Quero AR, Pérez J, Hernández A. Análisis de crecimiento, área foliar específica y concentración de nitrógeno en hojas de pasto “mulato” (Brachiaria híbrido, cv.). Téc Pecu Méx 2004;42(3):447-458. 14. Betancourth M, Avila P, Ramirez G, Lascano C. Milk yield of cows grazing Brachiaria pastures managed with high grazing pressure. In: Lascano CE editor. Annual report 2005. Tropical grasses and legumes: optimizing genetic diversity for multipurpose use (Project IP5). 1rst ed. Cali, Colombia: Centro Internacional de Agricultura Tropical; 2006:3-5.

308


Rev Mex Cienc Pecu 2022;13(1):297-310

15. Avellaneda-Cevallos J, González-Muñoz S, Pinos-Rodríguez J, Hernández-Garay A, Montañez-Valdez O, Ayala-Oseguera J. Enzimas fibrolíticas exógenas en la digestibilidad in vitro de cinco ecotipos de Brachiaria. Agron Mesoam 2007;18(1):1117. 16. Lara C, Oviedo LE, Betancur CA. Efecto de la época de corte sobre la composición química y degradabilidad ruminal del pasto Dichanthium aristatum (Angleton). Zootecnia Trop 2010;28(2):275-281. 17. Fagundes JL, da Fonseca DM, Gomide JA, Junior DN, Vitor CMT, de Morais RV, et al. Acúmulo de forragem em pastos de Brachiaria decumbens adubados com nitrogênio. Pesq Agropec Bras 2005;40(4):397-403. 18. ANKOM Technology. Operator´s manual. ANKOM Technology. 1rst ed. New York, USA: ANKOM Technology; 2006. 19. Vanzant E, Cochran R, Titgemeyer E. Standardization of in situ techniques for ruminant feedstuff evaluation. J Anim Sci 1998;76(10):2717-2729. 20. SAS. SAS/STAT® 9.2 User’s Guide. 1rst ed. Cary, North Carolina, USA: SAS Institute, Inc.; 2008. 21. Cuadrado C, Torregroza HL, Jiménez N. Comparación bajo pastoreo con bovinos machos de ceba de cuatro especies de gramíneas del género Brachiaria. Rev MVZ Córdoba 2004;9(2):438-443. 22. Thornton PK, van de Steeg J, Notenbaert A, Herrero M. The impacts of climate change on livestock and livestock systems in developing countries: A review of what we know and what we need to know. Agr Syst 2009;101(3):113-127. 23. Benítez D, Fernández JL, Ray J, Ramírez A, Torres V, Tandrón I, et al. Factores determinantes en la producción de biomasa en tres especies de pastos en sistemas racionales de pastoreo en el Valle del Cauto, Cuba. Rev Cubana Cienc Agríc 2007;41(3):231-235. 24. Castro R, Hernández A, Ramírez O, Aguilar G, Enríquez JF, Mendoza SI. Crecimiento en longitud foliar y dinámica de población de tallos de cinco asociaciones de gramíneas y leguminosa bajo pastoreo. Rev Mex Cienc Pecu 2013;4(2):201-215. 25. Del Pozo PP. Bases ecofisiológicas para el manejo de pastos tropicales. Pastos 2002;32(2):109-137. 26. Sepúlveda-Jiménez G, Porta-Ducoing H, Rocha-Sosa M. La participación de los metabolitos secundarios en la defensa de las plantas. Rev Mex Fitopatol 2003;21(3):355363. 309


Rev Mex Cienc Pecu 2022;13(1):297-310

27. Mauri J, Techio VH, Davide LC, Pereira DL, Sobrinho FS, Pereira FJ. Forage quality in cultivars of Brachiaria spp.: association of lignin and fibers with anatomical characteristics. Aust J Crop Sci 2015;9(12):1148-1153. 28. Lazzarini I, Detmann E, Sampaio CB, Paulino MF, Filho SCV, Souza MA, et al. Intake and digestibility in cattle fed low-quality tropical forage and supplemented with nitrogenous compounds. Rev Bras Zoot 2009;38(10):2021-2030. 29. Church DC, Pond WG, Pond KR. Fundamentos de nutrición y alimentación de animales. 2da ed. D.F., México: Limusa; 2007. 30. Valles B, Castillo E, Bernal H. Rendimiento y degradabilidad ruminal de materia seca y energía de diez pastos tropicales cosechados a cuatro edades. Rev Mex Cienc Pecu 2016;7(2):141-158. 31. Costa KAP, Assis RL, Guimarães KC, Severiano EC, Assis JM, Crunivel WS, et al. Silage quality of Brachiaria brizantha cultivars ensiled with different levels of millet meal. Arq Bras Med Vet Zoo 2011;63(1):188-195. 32. Cornu A, Besle JM, Mosoni P, Brene E. Lignin-carbohidrate complexes in forages: structure and consequenses in the ruminal degradation of cell-wall carbohydrates. Reprod Nutr Dev 1994;34(5):385-398.

310


https://doi.org/10.22319/rmcp.v13i1.5890 Nota de investigación

Incubación, pre-lisis y post-purificación en el rendimiento y pureza de ácidos nucleicos extraídos de sangre de cabras domésticas contenida en tarjetas FTA

Carolina Sancho-Blanco a Esteban J. Jiménez-Alfaro b Ramón Molina-Bravo c Rodolfo Umaña-Castro a*

a

Universidad Nacional, Costa Rica. Campus Omar Dengo, Facultad de Ciencias Exactas y Naturales, Escuela de Ciencias Biológicas, Laboratorio de Análisis Genómico (LAGEN). Costa Rica. b

Universidad Nacional, Costa Rica. Facultad de Ciencias de la Tierra y el Mar, Escuela de Ciencias Agrarias. Costa Rica. c

Universidad Nacional, Costa Rica. Facultad de Ciencias de la Tierra y el Mar, Escuela de Ciencias Agrarias, Laboratorio de Biología Molecular. Costa Rica.

*Autor de correspondencia: rodolfo.umana.castro@una.ac.cr.

Resumen: Técnicas moleculares requieren extracciones de ácidos nucleicos en cantidad y pureza adecuadas. Este trabajo describe un modelo lineal generalizado (GLM) de un factor ajustado con efectos fijos sobre el rendimiento de ácido nucleico (ng/μl) y la pureza (A260/A280 y A260/A230), para cinco métodos de extracción de ADN utilizando tarjetas FTA con sangre de cabra (Capra aegagrus hircus). Se ensayaron dos métodos comerciales basados en columnas de sílice (Invitrogen y Macherey Nagel; MN), método resina quelante (Chelex), método CTAB y el método de fenol-cloroformo-alcohol isoamílico (PCI). Adicionalmente, para MN, se evaluó una etapa de incubación con tampón PBS (Phosphate Buffered Saline) en alta 311


Rev Mex Cienc Pecu 2022;13(1):311-322

temperatura previa a la lisis y una etapa de purificación posterior a la extracción utilizando un modelo de efecto fijo de dos factores con interacción. Las concentraciones de ADN y las proporciones de pureza fueron variables; la concentración más alta se obtuvo con el kit MN (170.45 ng/μl), pero con deficiencias en la pureza (0.32 de A260/A230, 0.34 de A260/A280). A pesar de esto, todos los métodos de extracción generaron productos PCR con cebadores específicos D-loop (ADNmt). El efecto combinado de las etapas de pre-incubación y postpurificación arrojó valores de pureza satisfactorios (1.89 para A260/A230 y 1.65 para A260/A280), así como relaciones de concentración (476.78 ng/μl) con baja variabilidad. En conclusión, la concentración y pureza del ADN de muestras de sangre mejora considerablemente cuando se usa un kit comercial en combinación con incubación previa a la lisis y purificación posterior a la extracción. Estos ácidos nucleicos se sugieren para uso en potenciales aplicaciones moleculares a posteriori. Palabras clave: ADN, Columnas de sílice, CTAB, Fenol-cloroformo, Chelex, PCR, Rumiantes menores.

Recibido: 07/12/2020 Aceptado: 05/05/2021

La sangre es comúnmente utilizada para estudios clínicos e investigaciones, al ser una fuente importante de ADN genómico (ADNg) en su fracción de glóbulos blancos(1). Para aplicaciones en zootecnia y veterinaria se recolecta y almacena en tarjetas FTA (Whatman® FTA® Cards), debido a la simplicidad en el transporte y almacenamiento de las muestras por un tiempo prolongado(2) y posteriormente empleada en una variedad de aplicaciones genómicas, tales como los marcadores moleculares y la secuenciación de próxima generación(3). Existen diferentes técnicas de extracción de ADN, con distintos resultados e implicaciones relacionados a los costos, insumos y riesgos para el usuario. La extracción de ADN mediante kits comerciales a través de columnas de sílice o de celulosa, suelen ser procedimientos fáciles de usar y de costos moderados (0.40 a 0.44 dólares)(4), requieren menos tiempo, cantidad de reactivos y representan un menor riesgo para el operador, en comparación con los métodos tradicionales que utilizan sales (cloruro de sodio, sales de guanidina), resinas (Chelex) y compuestos orgánicos (fenol, cloroformo). Los métodos tradicionales permiten la extracción de ácidos nucleicos a un menor costo (0.27 dólares), sin embargo, suelen presentar mayores tiempos de ejecución, limitando la cantidad de muestras que se pueden procesar(5,6).

312


Rev Mex Cienc Pecu 2022;13(1):311-322

La extracción por medio de Fenol-cloroformo-alcohol isoamílico (PCI) es un método comúnmente utilizado, basado en compuestos orgánicos. Éste permite la obtención de una gran cantidad de ADNg(7), en tanto el fenol inactiva cualquier potencial nucleasa y remueve proteínas contaminantes del ADN(8), este proceso involucra numerosos pasos con sustancias tóxicas y corrosivas, e incubaciones prolongadas(6). La resina Chelex, es un agente quelante que purifica compuestos a través del intercambio de iones, involucra generalmente procedimientos simples y rápidos, no incluyen solventes orgánicos y no requiere transferencias múltiples de tubo a tubo, sin embargo, reporta la obtención de ADN en cantidad y calidad reducida(3). El método de bromuro de cetiltrimetilamonio (CTAB), ha sido ampliamente utilizado para la extracción de ADN en tejido vegetal, semillas(9,10), tejidos animales(5,11), al igual que el método PCI usa químicos peligrosos y requiere de numerosos pasos que aumentan su tiempo de ejecución, afectando su aplicabilidad a gran escala(5,12). Los principales parámetros analizados después de una extracción de ácidos nucleicos son la pureza, la concentración y la integridad. La pureza y concentración suelen ser evaluados mediante espectrofotometría UV-VIS y fluorometría. El perfil de absorbancia medido por espectrofotometría permite la detección de contaminantes como proteínas, sales y polisacáridos. Por otra parte, la electroforesis en geles de agarosa es un método común para evaluar la integridad del ADN, ya sea del ADN directamente (llamativa banda de ADN de alto peso molecular) o mediante la visualización de productos PCR a partir de los ácidos nucleicos extraídos(13). El objetivo del presente estudio fue comparar cinco métodos de extracción a partir de muestras de sangre caprina mantenidas en FTA-cards, de acuerdo con la concentración y la pureza del ADN resultante. Además, en el método más promisorio de extracción, se evaluó el efecto de una pre-incubación con PBS antes de la lisis celular y la post-purificación del eluido con solventes orgánicos. Se muestrearon 57 caprinos lecheros (Capra aegagrus hircus) ubicados en las Regiones Central, Caribe, Norte, Chorotega y Pacífico Central de Costa Rica. La colecta de sangre se llevó a cabo siguiendo el protocolo de Berumen et al(14), colocando aproximadamente 200 µl de sangre en una tarjeta Whatman FTA® (Flinders Technology Associates, UK). Las tarjetas se almacenaron a temperatura ambiente (TA), en un lugar fresco (libre de humedad), a oscuridad y dentro de bolsas herméticas de plástico. Se utilizaron cinco métodos de extracción: dos de ellos fueron kits comerciales PureLink™ (Invitrogen, USA) y NucleoSpin® Blood (Mackerey Nagel, Alemania); los cuales se llevaron a cabo siguiendo el protocolo del fabricante. El ADN fue resuspendido en 100 µl de agua doble desionizada libre de nucleasas. El tercer método utilizado fue el de CTAB de Lodhi et al, adaptado(15), el cuarto fue por medio de resina Chelex-100 (Bio Rad Laboratories, Inc, USA) y el último método fue por medio de fenol/cloroformo/isoamil-alcohol (PCI). Se 313


Rev Mex Cienc Pecu 2022;13(1):311-322

utilizó aproximadamente un cuarto del círculo de la tarjeta FTA en todas las extracciones realizadas con los diferentes métodos. Adicionalmente, previo al tratamiento con el buffer de lisis (propio de cada uno de los protocolos evaluados), se probó en todos los métodos de extracción el efecto de añadir una incubación adicional (pre-incubación), con 200 µl de PBS, Herrero et al(16) durante 1 h a 42°C, realizando una agitación por inversión cada 10 min. Una vez finalizada la incubación con PBS, se procedió con cada uno de los protocolos de extracción. Se utilizaron tres réplicas por individuo para un total de 174 repeticiones. En la extracción de ADN a partir de resina Chelex una vez finalizada la hora de incubación con PBS, se agregó 500 µl de resina Chelex®-100 al 10 % y se incubó a 70 °C con proteinasa K (Thermo Scientific, USA), durante 1 h. Posteriormente, las muestras fueron centrifugadas a 14,000 rpm a 4 °C, se aisló un volumen aproximado de 70 µl de sobrenadante y se transfirió a un tubo nuevo. Se precipitó la muestra adicionando 70 µl de acetato de sodio (NaOAc) 3M (Ambion, USA) y 180 µl de etanol al 96% (Sigma-Aldrich, Alemania) y se incubó durante 20 min a -20 °C. Posteriormente, se centrifugó a 14,000 rpm durante 15 min. Se retiró el sobrenadante y se realizaron dos lavados al pellet resultante con 200 µl de etanol al 70%, dejando secar completamente a 42 ºC por 5 min empleando un concentrador Savant™ DNA SpeedVac™ (Thermo Scientific, USA). Finalmente se agregaron 50 µl de buffer TE y se incubó a 37 °C por 30 min para facilitar su resuspensión. En la extracción de ADN a partir del método CTAB finalizada la incubación con PBS, se adicionaron 750 µl de buffer de lisis (20 mM Na-EDTA, Tris-HCl, pH 8.0 con HCl, 1.4 M NaCl, 2.0% (m/v) PVP y 0.2% (v/v) beta-mercaptoetanol), 8 µl de proteinasa K (20 mg/ml) (Thermo Scientific, USA) y se incubó a 70 °C durante 1 h. Posteriormente se agregaron 750 µl de cloroformo:octanol (24:1) mezclando por inversión. Se centrifugó a 13,000 rpm por 5 min a TA y se transfirió 300 µl de sobrenadante a un tubo nuevo, adicionando un volumen de isopropanol frío (-20 °C). Se realizó una incubación a -20 ºC durante 20 min y se centrifugó a 13,000 rpm a 4 °C durante 10 min. Se descartó el sobrenadante y se secó la muestra completamente a 42 °C por 5 min con el uso de un concentrador SpeedVac (Thermo Scientific, USA). El botón se resuspendió en 50 µl de buffer TE y se incubó a 37 °C por 30 min. En la extracción de ADN con PCI(17), posterior a la incubación con PBS, se realizó una incubación a 70 °C con 600 μl de buffer STES (0.5 M NaCl, 0.2 M Tris-Hcl, 0.01 M EDTA y 0.1% SDS) y 8 μl de proteinasa K (20 mg/ml). Posteriormente, se adicionaron 600 μl de PCI (fenol:cloroformo:alcohol isoamílico 25:24:1) y se centrifugó a 10,000 rpm durante 10 min a TA. Posteriormente, se aisló la fase superior (acuosa) y se agregó una mezcla cloroformo/alcohol isoamílico (24:1) (USB Corporation, USA) en una proporción 1:1. Los tubos se centrifugaron a 10,000 rpm durante 1 min, la fase superior se aisló y se agregaron 100 μl de NaOAc 3M (pH 5.2) y 750 μl de etanol absoluto (Sigma-Aldrich, Alemania). Se incubó 20 min a -20 ºC y se centrifugó a 14,000 rpm durante 10 min a 4 ºC para recuperar 314


Rev Mex Cienc Pecu 2022;13(1):311-322

los ácidos nucleicos. Se eliminó el sobrenadante y el botón de ADN precipitado, se lavó con 500 μl de etanol al 70%, luego se centrifugaron a 18,000 rpm durante 2 min a TA y se removió el sobrenadante por decantación. El botón se secó completamente a 42 °C por 5 min en un bloque térmico. Una vez que el alcohol se evaporó, se resuspendió el ADN con 100 μl de agua doble desionizada libre de nucleasas y se incubó a 37 °C por 30 min. Todas las muestras de ADN genómico extraído fueron evaluadas mediante movilización electroforética en geles de agarosa al 1% (buffer TBE 0.5%), a 80 V, 400 mA por 45 min. La pureza (coeficientes A260/A280 y A260/A230) y la concentración de las muestras se obtuvieron mediante espectrofotometría de microvolúmenes UV-visible NanoDrop 2000™ (Thermo Scientific, USA). Una vez realizadas todas las extracciones, se seleccionó el método que arrojó las mayores cantidades de ADN recuperado (ng/µl), y se le realizó una purificación adicional mediante fenol-cloroformo(17) con un volumen inicial de 100 µl. Se agregaron 50 µl de fenol (pH 8.0) y 50 µl de cloroformo:alcohol isoamílico (24:1) (USB Corporation, USA). Se centrifugó a 12,000 rpm por 15 min a TA. Se tomó la fase acuosa y se transfirió a otro tubo. Se agregó 1/10 de volumen de NaOAc 3M (pH 5.2) (Ambion, USA) y 2.5 volúmenes de etanol absoluto frío (Sigma-Aldrich, Alemania) y se mezcló por inversión. Se incubó a -20 °C por 20 min y se centrifugó durante 10 min a 12,000 rpm. Se eliminó el sobrenadante y se resuspendió en 70 µl con agua doble desionizada libre de nucleasas. Se evaluó la integridad del ADN total y el posible efecto de inhibición por contaminantes traza del método de extracción por medio de una PCR tiempo final (volumen final: 20 µl), por triplicado y compuesta por 1X de PCR Master Mix (Thermo Scientific, USA), 0.8 µM de cada cebador y 1 µl ADN total (pero no con concentraciones equivalentes). La selección de las muestras fue aleatoria. Se amplificó la región D-loop del ADN mitocondrial (ADNmt) caprino utilizando los cebadores DAF (5´TTCTTCAGGGCCATCTCATC3´) y DGR (3´GCGGATGCATGGTGAAAT5´)(18), sintetizados por MACROGEN (Corea). La PCR fue realizada bajo las siguientes condiciones de ciclado: 94 °C por 3 min (desnaturalización inicial), 35 ciclos de: 94 °C por 30 seg (desnaturalización), 55 °C por 30 seg (alineamiento), 72 °C por 45 seg (extensión) y finalmente 72 °C por 10 min como extensión final. Los productos de PCR se resolvieron por electroforesis en gel de agarosa al 1.5% (TBE 1X), 80 V, 400 mA durante 60 min en solución tampón TBE 1X (pH 8.0, Invitrogen, USA). El análisis estadístico fue realizado en PROC GLM de SAS. Se ajustó un modelo de efecto fijo de una vía para la comparación de los cinco métodos y un modelo de efecto fijo de dos vías con interacción para la evaluación de la incubación y la purificación mediante una prueba de Levene, buscando evidencia de homogeneidad de varianza. Se realizaron las pruebas de comparaciones múltiples entre los tratamientos empleando el procedimiento de

315


Rev Mex Cienc Pecu 2022;13(1):311-322

Tukey. En todos los casos se consideraron significativos los valores del estadístico asociado con α<0.05. Los resultados obtenidos en este estudio arrojaron que los cinco protocolos de extracción realizados (Invitrogen, MN, Chelex, CTAB y PCI) difirieron en pureza (A260/A230 y A260/A280) y cantidad del ADN (ng/µl). Al evaluar la concentración mediante la absorbancia a 260 nm, las mayores concentraciones y medida de dispersión se obtuvieron con los métodos MN (170.45 ng/µl ± 74.82) e Invitrogen (29.70 ng/µl ± 25.31). En cuanto a los protocolos con solventes orgánicos, el CTAB mostró los mejores valores de rendimiento de ADN extraído, seguido por Chelex y por último el de PCI (10.35 ng/µl, 2.96 ng/µl y 2.23 ng/µl, respectivamente) (Cuadro 1). Cuadro 1: Medición de razones A260/A230, A260/A280 y cuantificación de ADN (ng/µl) obtenido por espectrofotometría Nanodrop de muestras sanguíneas de cabras sometidas a cinco métodos de aislamiento de ácidos nucleicos A260/A230 A260/A280 ADN (ng/µl) Método n Media DE Media DE Media DE Invitrogen CTAB

9 10

0.38a 0.14b

0.09 0.02

0.45a 0.74a

0.22 0.09

29.70b 10.35c

25.31 8.30

PCI

17

0.37a

0.22

1.23b

0.53

2.23d

1.39

10

a

0.15

1.17

c

0.69

e

0.34

a

Chelex MN

36

0.26

0.32ª

0.02

0.02

2.96

2.04

170.45

a

74.82

n= número de muestras analizadas; DE= desviación estándar; CTAB= bromuro de hexadeciltrimetilamonio; PCI= fenol-cloroformo-alcohol isoamílico; MN= Mackerey Nagel. abcde Letras diferentes corresponden a diferencias significativas (α<0.05). Las letras diferentes por columna corresponden a diferencias significativas con α<0.05.

Con respecto a la contaminación debida a proteínas (A260/A280), no se encontraron diferencias significativas entre los métodos comerciales, mientras que en los protocolos de solventes orgánicos se detectaron diferencias estadísticas entre los tres, siendo PCI el que mejor rendimiento mostró seguido de Chelex y CTAB (1.23, 1.17 y 0.74), respectivamente. Los valores de pureza asociados a los coeficientes de A260/A280 se encontraron por debajo de 1.8 en todas las extracciones, siendo los métodos comerciales los que mostraron valores más bajos MN (0.34) e Invitrogen (0.45). Además, todas las razones A260/A230 mostraron valores muy inferiores a 1.5. Sin embargo, los valores más bajos de A260/A230 correspondieron a los ADN extraídos mediante CTAB (0.14), seguido del método Chelex (0.26) (Cuadro 1). A pesar de ello, la concentración de ADN y los coeficientes de pureza no afectaron la obtención de amplificaciones parciales de la región D-loop a partir de una PCR (294 pb, accesiones genbank: MW514310 y MW514311), ya que se generaron amplicones para todas las muestras analizadas, independientemente del método de extracción utilizado (Figura 1).

316


Rev Mex Cienc Pecu 2022;13(1):311-322

Figura 1: Amplificación parcial del gen D-loop mitocondrial por medio de PCR de los cinco diferentes métodos de extracción de ADN a partir de sangre de Capra aegagrus hircus

Carriles 1 y 11: marcador de tamaño molecular (1Kb Thermo Fisher Scientific). 2-4: amplificaciones de muestras extraídas por método PCI. 5-7: método Chellex. 8-10: método CTAB 12-14: método MN. 15-17: método Invitrogen. 18: control negativo (mezcla de reacción sin ADN).

Con base en el rendimiento promisorio de la concentración de ADN obtenida por el método MN, y la ejecución de pasos adicionales como supuesto de una mejoría en rendimiento y calidad de los ácidos nucleicos, se observó que la incubación-purificación aumentó significativamente la concentración de ADN (476.78 ng/µl), así como la pureza de las extracciones realizadas (Cuadro 2, Figura 2). La magnitud de la diferencia entre las medias de la concentración de los ácidos nucleicos, a partir del método sin modificación (170.45 ng/µl) respecto a incubación-purificación fue de 306.33 ng/µl, mientras que cuando únicamente se purificó, el incremento fue de 80.63 ng/µl, y finalmente de 10.53 ng/µl cuando solo se incubó. Por otro lado, la pureza reflejada en los coeficientes A260/A230 y A260/A280 para el método MN presentó una mejora (1.89 y 1.65, respectivamente) en cuanto a los valores obtenidos de no incubación – no purificación (0.32 y 0.34, respectivamente).

317


Rev Mex Cienc Pecu 2022;13(1):311-322

Cuadro 2: Efecto de la preincubación con PBS previo a la lisis celular y post-purificación del eluido con fenol:cloroformo en la extracción ADN con el método MN a partir de sangre contenida en tarjetas FTA ADN (ng/µl) A260/A230 A260/A280 n Media DE Media DE Media DE a a a Incubación-Purificación 36 1.89 0.21 1.65 0.20 476.78 164.37 b b b Incubación 36 0.33 0.03 0.35 0.03 180.98 62.40 c a c Purificación 36 2.02 0.16 1.66 0.13 251.08 126.47 d c d No Incubación-No 36 0.32 0.02 0.34 0.02 170.45 74.82 Purificación abcde

n= número de muestras analizadas; DE= desviación estándar. Las letras diferentes corresponden a diferencias significativas (α<0.05).

Figura 2: Distribución de las concentraciones de ácidos nucleicos (ng/µl) de acuerdo con las modificaciones realizadas al protocolo MN

Incb= solo incubación; Incb-Purf= incubación y purificación combinadas como modificaciones en el método; No(Incb-Purf)= sin incubación y sin purificación; Purf= solo purificación. Líneas horizontales en las cajas representan la mediana, las líneas verticales representan los límites superior e inferior, los rombos dentro de las cajas, la media y los círculos fuera de las cajas, representan valores atípicos por debajo o por encima de la media.

Resultados preliminares en cuanto a la concentración de ADN obtenido en los métodos sin un paso de pre-incubación de la tarjeta (2 a 170 ng/µl), podrían indicar que los glóbulos blancos retenidos en la tarjeta FTA no se liberaron del soporte sólido o no ocurrió la digestión óptima de la membrana celular. Por ello, la adición de un paso de purificación junto con un paso pre-incubación en el método MN, generó aumentos significativos en cuanto a los

318


Rev Mex Cienc Pecu 2022;13(1):311-322

rendimientos de la extracción en términos de concentración y pureza. Por otro lado, otros autores, al igual que en esta investigación, reportaron poca variabilidad y desviaciones pequeñas en la concentración del ADN al usar un kit comercial(19). Los resultados de este trabajo mostraron que todas las extracciones realizadas presentaron valores de pureza A260/A280 por debajo de lo recomendado (1.8 a 2.0)(20). Sin embargo, a pesar de estos valores no óptimos (proteínas residuales y contaminantes traza) obtenidos en los cinco métodos de extracción de ADN, no se observó inhibición de las reacciones enzimáticas por PCR. Aplicaciones moleculares más sensibles tales como secuenciación Sanger, genotipado PCR-RFLP, microarreglos o NGS, podrían verse afectadas por la presencia de sales, solventes orgánicos, EDTA, nucleasas y proteínas contaminantes que se acarrean en los ADN aislados(21-24). Los bajos valores obtenidos con el coeficiente A260/A230 en muestras extraídas a partir de los kits comerciales pudo deberse a compuestos con absorción a 230 nm actuando como contaminantes traza, los cuales incluyen sales caotrópicas como el tiocianato de guanidina(25), EDTA, detergentes no iónicos como Triton™ X-100 y Tween®, proteínas, aminoácidos(20,25), fenol, polisacáridos y otras partículas sólidas flotantes como las fibras de sílice. En el caso de la extracción de ADN basado en protocolos con solventes orgánicos (PCI y CTAB), valores de A260/A230 por debajo de lo esperado pudo deberse a factores como errores al separar la fase acuosa de la interfase o al acarreo de contaminantes como fenol, cloroformo en los pasos sucesivos en la extracción. En el caso de las resinas de intercambio iónico (Chelex), los valores inferiores pudieron deberse a contaminación por proteínas(26). Los resultados demuestran las limitaciones de extraer ADN a partir de tarjetas FTA que retienen muestras de sangre de caprinos, para su uso en aplicaciones genómicas posteriores. Sin embargo, se obtuvieron resultados positivos en el aislamiento y purificación del ADN total utilizando el kit comercial NucleoSpin® Blood de Mackerey Nagel (MN) para análisis moleculares en rumiantes menores, con la salvedad de la ejecución de procedimientos adicionales que aseguren la calidad y pureza de los ácidos nucleicos para uso en técnicas con requerimientos de alta concentración e integridad del ADN.

Agradecimientos

Esta investigación se realizó en el marco del proyecto de investigación “Caracterización genómica de caprinos lecheros y ovinos de carne costarricenses, para la identificación de individuos promisorios como base de un programa de mejoramiento genético” SIA 0178-16.

319


Rev Mex Cienc Pecu 2022;13(1):311-322

Conflictos de interés Los autores declaran no tener ningún conflicto de interés. Literatura citada: 1. Guha P, Das A, Dutta A, Chaudhuri T. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples. Clin Lab Anal 2018;32(1):22181. 2. Osorio J, Pachajoa H, Hurtado P. Concentración y pureza del ADN de muestras sanguíneas en papel Whatman FTA almacenadas entre 1 a 3 años. Rev Estomat Salud 2013;21(1):35-38. 3. Stowell L, Bentley E, Gagne R, Gustafson K, Rutledge L, Ernest H. Optimal DNA extractions from blood on preservation paper limits conservation genomic but not conservation genetic applications. J Nat Conserv 2018;46(1):89-96. 4. Poh J, Ken-En GS. Comparison of customized spin-column and salt-precipitation fingerprick blood DNA extraction. Biosci Rep 2014;34(5):629-634. 5. Schiebelhut LM, Abboud SS, Gómez LE, Swift HF, Dawson MN. A comparison of DNA extraction methods for high-throughput DNA analyses. Mol Ecol Resour 2016;17(4):721-729. 6. Montgomery GW, Sise JA. Extraction of DNA from sheep white blood cells. NZ J Agr Res 1990;33(3):437-441. 7. Ghaheri M, Kahrizi D, Yari K, Babaie A, Suthar RS, Kazemi E. Comparative evaluation of four DNA extraction protocols from whole blood sample. Cell Mol Biol 2016;62(3):120-124. 8. Di Prieto F, Ortenzi F, Tilio M, Concetti F, Napolioni V. Genomic DNA extraction from whole blood stored from 15- to 30-years at 20° C by rapid phenol chloroform protocol: A useful tool for genetic epidemiology studies. Mol Cell Probes 2011;(1):44-48. 9. Siegel, CS, Stevenson FO, Zimmer EA. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa. Appl Plant Sci 2017;5(2): 1600109 10. Demeke T, Jenkins GR. Influence of DNA Extraction Methods, PCR inhibitors and quantification methods on real-time PCR assay of biotechnology-derived traits. Anal Bioanal Chem 2010;396(6):1977-1990.

320


Rev Mex Cienc Pecu 2022;13(1):311-322

11. Chakraborty S, Saha A, Neelavar A. Comparison of DNA extraction methods for nonmarine molluscs: is modified CTAB DNA extraction method more efficient than DNA extraction kits?. 3Biotech 2020;10(2):69. 12. Boesenberg-Smith KA, Pessarakli MD, Wolk DM. Assessment of DNA yield and purity: an overlooked detail of PCR troubleshooting. Clin Microbiol Newsl 2012;34(1):1-6. 13. Quinet C, Czaplicki G, Dion E, Dal Pozzo F, Kurz A, Saegerman C. First results in the use of bovine ear notch tag for bovine viral diarrhoea virus detection and genetic analysis. PloS one 2016;11(10):e0164451. 14. Berumen A, Palomera CL, Ojeda N. Manual de prácticas de la asignatura de clínica de ovinos y caprinos. Tabasco, México: Universidad Juárez Autónoma de Tabasco; 2010. 15. Lodhi MA, Guang-Ning Y, Norman FW, Bruce IR. A simple and efficient method for DNA extraction from grapevine cultivars, Vitis species. Plant Mol Biol Rep 1994;12(1):6-13. 16. Herrero L, Ávila R, Corrales E, Hun L. Procedimientos en virología médica. 1 era ed. San José, Costa Rica: Universidad de Costa Rica; 2004. 17. Sambrook J, Russell DW. Purification of nucleic acids by extraction with phenol: chloroform. Cold Spring Harbor Protocols. 2006; pdb-prot4455. 18. Kumar D, Singha SP, Singh R, Nagappa SK. A Highly specific PCR assay for identification of goat (Capra hircus) meat. Small Ruminant Res 2011;97(1-3):76-78. 19. Ríos-Sánchez E, Calleros E, González-Zamora A, Rubio J, Martínez OC, Martínez A, Hernández S, Pérez-Morales R. Análisis comparativo de diferentes métodos de extracción de DNA y su eficiencia de genotipificación en población mexicana. Acta Univ 2016;26(4):56-65 20. Neill MO, McPartlin JMc, Arthure K, Riedel S, McMillan ND. Comparison of the TLDA with the Nanodrop and the reference Qubit system. J Phys Conf Ser 2011;307(1): 012047. 21. Caboux E, Lallemand C, Ferro G, Hémon B, Mendy M, Biessy C, et al. Sources of preanalytical variations in yield of DNA extracted from blood samples: analysis of 50,000 DNA samples in EPIC. PLoS one 2012;7(7):e39821. 22. Psifidi A, Dovas CI, Bramis G, Lazou T, Russel CL, Arsenos G, et al. Comparison of eleven methods for genomic DNA extraction suitable for large-scale whole-genome genotyping and long-term DNA banking using blood samples of eleven methods for genomic DNA extraction suitable for large-scale whole-genome genotyping and longterm DNA banking using blood samples. PLoS one 2015;10(1):e0115960. 321


Rev Mex Cienc Pecu 2022;13(1):311-322

23. Koshy L, Anju AL, Harikrishnan S, Kutty VR, Jissa VT, Kurikesu I, et al. Evaluating genomic DNA extraction methods from human whole blood using endpoint and realtime PCR assays. Mol Biol Rep 2016;44(1):97-108. 24. Li Q, Wang X, Li X, He X, Wan Q, Yin J, et al. Obtaining high-quality blood specimens for downstream applications: a review of current knowledge and best practices. Biopreserv Biobank 2018;16(6):411-418. 25. Koetsier G, Cantor E. A practical guide to analyzing nucleic acid concentration and purity with microvolume spectrophotometer. New England Biolabs Inc 2019;1-8. 26. Singh UA, Kumari M, Iyengar S. Method for improving the quality of genomic DNA obtained from minute quantities of tissue and blood samples using Chelex 100 resin. Biol Proced Online. 2018;20(1):12.

322


Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 13 Núm. 1, pp. 1-322, ENERO-MARZO-2022

ISSN: 2448-6698

CONTENIDO CONTENTS Pags. Efectos del genotipo, tamaño de la camada y el sexo sobre las características de la canal y el perfil de ácidos grasos en corderos de pelo

Effects of genotype, litter size and sex on carcass characteristics and fatty acid profile in hair lambs Oscar Elías Cruz-Sánchez, José Herrera-Camacho, Ricardo A. García-Herrera, Lorena Aguayo-Ulloa, Víctor M. Moo-Huchin, Aldenamar Cruz- Hernández, Armando Gómez- Vázquez, Ulises Macias-Cruz, Alfonso J. Chay-Canul ………………….……………………………………………………………………………………………………........……………….....…...1 Rendimiento de corderos alimentados con ensilaje como alimento total a base de nopal Juscelino Kubitschek Bevenuto da Silva, Gherman Garcia Leal de Araújo, Edson Mauro Santos, Juliana Silva de Oliveira, Fleming Sena Campos, Glayciane Costa Gois, Tiago Santos Silva, Alex Gomes da Silva Ma�as, Ossival Lolato Ribeiro, Alexandre Fernandes Perazzo, Anderson de Moura Zanine …………………………...................................................19

Comparación en la calidad de huevos obtenidos en un sistema de producción en corrales al aire libre y los producidos en un sistema de jaula

Comparison in the quality of eggs obtained in an outdoor pen production system and those produced in a cage system Samantha Romo, Daniela López, Néstor Ledesma, Carlos Gu�érrez, Antonio Quintana, Lucía Rangel ………………………….....……..…....……..…......……..…....……..…....……..…....……..…....…...…..….....……..…………….32

Using grapeseed meal as natural antioxidant in slow-growing Hubbard broiler diets enriched in polyunsaturated fatty acids

Uso de harina de semilla de uva como antioxidante natural en dietas de pollos de engorda Hubbard de crecimiento lento enriquecidas con ácidos grasos poliinsaturados Margareta Olteanu, Ta�ana Dumitra Panaite, Raluca Paula Turcu, Mariana Ropota, Petru Alexandru Vlaicu, Monica Mitoi ..........……..…….……………….….....…...……….....…….....…….....…….....…..…….......…….…43

Factores asociados a indicadores de crianza de reemplazos bovinos durante el periodo de lactancia en unidades lecheras de pequeña escala

Factors associated with indicators of calf rearing during the lactation period in small-scale dairy farms Fernando Villaseñor González, Eliab Estrada Cortés, Lilia del Rocío Montes Oceguera, Héctor Raymundo Vera Ávila, Luis Javier Mon�el Olguín, Héctor Jiménez Severiano, Mario Alfredo Espinosa Mar�nez ……….…......…………..…………..…………………………………………………………………………………………………………………….……..…..64

Impacto económico y productivo de una mezcla herbal con derivados de colina en la producción de conejos

Economic and productive impact of an herbal mixture with choline derivatives on rabbit production Minerva Jaurez-Espinosa, Pedro Abel Hernández-García, Amada Isabel Osorio-Terán, Germán David Mendoza-Mar�nez, Juan José Ojeda-Carrasco, María Zamira Tapia-Rodríguez, Enrique Espinosa-Ayala…………………………….……………………………………………………………………………………………………………………………………….…...………..82

Características de la canal y perfil de ácidos grasos de la carne de corderos criollos suplementados con semilla de algodón y maíz

Carcass characteristics and fatty acid profile of the meat of Creole lambs supplemented with cottonseed and corn Emiro Suárez Paternina, Libardo Maza Ángulo, Wilson Barragán Hernández, Lorena Aguayo Ulloa, Oscar Vergara Garay……………………………………………………………………………………………..……………...……….......97

Correlación entre variables ante mortem y post mortem en canales de ovinos producidos en México

Correlation between ante-mortem and post-mortem variables in sheep carcasses produced in Mexico Lizbeth Esmeralda Robles Jiménez, José Armando Par�da de la Peña, Miguel Enrique Arechavaleta Velasco, Ignacio Arturo Domínguez Vara …………......……………………………………………………………………..…..115

Financial performance and opportunistic commercialization of beef production systems in southern Brazil

Desempeño financiero y comercialización oportunista de los sistemas de producción de carne de res en el sur de Brasil Amir Gil Sessim, Maria Eugênia Andrighe�o Canozzi, Gabriel Ribas Pereira, Eduardo Madeira Cas�lho, Júlio Otávio Jardim Barcellos………………………………………..…….....…….....…….....…….....….………………….127

Modelos de negocio para la producción de ovinos en el nororiente y centro del Estado de México

Business models for sheep production in the Northeast and center of the State of Mexico viruses in bulls, and their relationship with the presence of the viruses in semen Judith Calderón-Cabrera, Vinicio Horacio Santoyo-Cortés, Enrique Genaro Mar�nez-González, Víctor Herminio Palacio-Muñoz……………….…………………………………………………………………………………………......145

Effect of early age at first calving on longevity, number of days in production and lifetime milk yield of Holstein and Brown Swiss dairy cows in Honduras

Efecto de la edad al primer parto sobre la longevidad, el número de días en producción y la producción de leche durante la vida productiva de las vacas lecheras Holstein y Pardo Suizo en Honduras Karen Alessa Copas Medina, Manuel Valladares Rodas, Juan José Baeza Rodríguez, Juan Gabriel Magaña Monforte, José Candelario Segura Correa ……………………………………...……….....…….....…….....……...163

Efecto de la viscosidad en el medio para la criopreservación espermática de gallo (Gallus gallus)

Effect of viscosity on the medium for rooster (Gallus gallus) sperm cryopreservation José Antonio Herrera Barragán, José Manuel Huitrón, Juan José Pérez-Rivero, Adrián Guzmán Sánchez, Alejandro Ávalos Rodríguez, Ana María Rosales Torres, Ricardo Camarillo Flores ……..………..…..…175

Antimicrobial residues found in poultry commercialized in retail stores from the Metropolitan Area of Guadalajara, Jalisco

Residuos de antimicrobianos encontrados en aves de corral comercializadas en tiendas minoristas de la zona Metropolitana de Guadalajara, Jalisco Delia Guillermina González-Aguilar, Maritza Alejandra Ramírez-López, Iyari Ximena Uribe-Camberos, Jeanne�e Barba-León ………….....…….....…….………………………………………………....……………………………....187

Determinación serológica del virus de leucosis enzoótica bovina (VLEB) en el municipio de Paipa, Boyacá (Colombia)

Serological determination of enzootic bovine leukosis virus (EBLV) in the municipality of Paipa, Boyacá (Colombia) Jorge Alejandro Jiménez Sánchez, Diana María Bulla-Castañeda, Adriana María Díaz-Anaya, Diego José García-Corredor, Mar�n Orlando Pulido-Medellín ……...………………………………………………………..……200

Hematological, biochemical, and endocrine parameters in acute response to increasing-intensity exercise in Colombian Paso horses

Parámetros hematológicos, bioquímicos y endocrinos en la respuesta aguda al ejercicio de intensidad creciente en caballos de Paso colombianos Angélica María Zuluaga Cabrera, Maria José Casas Soto, José Ramón Mar�nez Aranzales, Viviana Elena Cas�llo Vanegas, Nathalia María del Pilar Correa Valencia, María Patricia Arias Gu�errez ………………………………………………….....…….....…….....……....………………………………………………………………………………………………………..……..211

Efecto del comportamiento higiénico sobre la resistencia a la cría calcárea (Ascosphaera apis) en colonias de abejas africanizadas (Apis mellifera)

Effect of hygienic behavior on resistance to chalkbrood disease (Ascosphaera apis) in Africanized bee colonies (Apis mellifera) Carlos Aurelio Medina-Flores, Luis Abdelmir Medina Medina, Ernesto Guzmán-Novoa…………………………………………………………………….…………………………..….…………………………………………………....…………….…..225

Producción y calidad nutritiva de Tithonia diversifolia (Hemsl.) A. Grey en tres épocas del año y su efecto en la preferencia por ovinos Pelibuey

Production and nutritional quality of Tithonia diversifolia (Hemsl.) A. Grey in three seasons of the year and its effect on the preference by Pelibuey sheep Vicky Ta�ana Vargas Velázquez, Ponciano Pérez Hernández, Silvia López Or�z, Epigmenio Cas�llo Gallegos, Cris�no Cruz Lazo, Jesús Jarillo Rodríguez …………………………………………………………………………….240

NOTAS DE INVESTIGACIÓN Efecto del aceite de orégano en las propiedades fisicoquímicas, texturales y sensoriales del queso panela

Oregano essential oil in panela-type cheese: its effects on physicochemical, texture and sensory parameters Niriel Sánchez-Zamora, Mónica Dinorah Cepeda-Rizo, Ka�y Lorena Tamez-Garza, Beatriz Adriana Rodríguez-Romero, Sugey Ramona Sinagawa-García, Alejandro Isabel Luna Maldonado, Emmanuel Flores-Girón, Gerardo Méndez-Zamora ………………… ………..…………...………..…………………………………………………………………………………………………………………....…..258

Efecto de la nisina en la inhibición del crecimiento de Staphylococcus areus y en las propiedades sensoriales del queso costeño

Effect of nisin on the inhibition of the growth of Staphylococcus areus and on the sensory properties of coastal cheese Beatriz Alvarez Badel, María Alejandra Doria Espi�a, Vanesa Hodeg Peña, Mónica María Simanca Sotelo, Yenis Pastrana Puche, Claudia Denise De Paula……………………..…………..….......……………………........272

El huevo de traspatio: ventana de oportunidad de ingresos en comunidades del Municipio de Texcoco, Estado de México

Backyard eggs: an income opportunity window in communities in Texcoco, Mexico Juan Hernández Or�z, Olga Jacqueline Galicia Rojano, Enrique Melo Guerrero, Ramón Valdivia Alcalá, Luis Manuel Valenzuela Núñez………………………....……………………………………..…………...………..…………..287

Rendimiento y digestibilidad de forraje de cultivares de Urochloa spp. a tres edades de rebrote en épocas de lluvias y seca

Forage yield and digestibility of Urochloa spp. cultivars at three regrowth ages in the rainy and dry seasons in Ecuador Jonathan Raúl Garay Mar�nez, Benigno Estrada Drouaillet, Juan Carlos Mar�nez González, San�ago Joaquín Cancino, Hernán Patricio Guevara Costles, Marco Vinicio Acosta Jácome, Eugenia Guadalupe Cienfuegos Rivas………………………...............……………………………………………………………………………………………….........………..297

Incubación, pre-lisis y post-purificación en el rendimiento y pureza de ácidos nucleicos extraídos de sangre de cabras domésticas contenida en tarjetas FTA

Incubation, pre-lysis and post-purification on the yield and purity of nucleic acids extracted from blood of domestic goats contained in FTA cards Carolina Sancho-Blanco, Esteban J. Jiménez-Alfaro, Ramón Molina-Bravo, Rodolfo Umaña-Castro…………………………………………………..…………………………….....…………………………………………….................………..311

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 13 Núm. 1, pp. 1-322, ENERO-MARZ0-2022

Performance of lambs fed total feed silage based on cactus pear

Rev. Mex. Cienc. Pecu. Vol. 13 Núm. 1, pp. 1-322, ENERO-MARZO-2022