RMCP Vol.12 Num. 4 (2021): October-December [english version] by Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 4, pp. 996-1337, OCTUBRE-DICIEMBRE-2021

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 4, pp. 996-1337, OCTUBRE-DICIEMBRE-2021

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 12 Numero 4, OctubreDiciembre 2021. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 042021-051209561700-203. ISSN: 2428-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en febrero de 2022. Cabras Criollas Cubanas de la Granja 26 de Julio, ubicada en Jiguaní, Granma, Cuba. Fotografía: Manuel Alejandro La O Arias.

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, Dr. Alfonso Juventino Chay Canul, Universidad Autónoma de Tabasco, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Maurcio A. Elzo, Universidad de Florida Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, Universidad Autónoma del Estado de Hidalgo, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México Dr. Jorge Alberto López García, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. José Juan Hernández Ledezma, Consultor privado Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

total por publicar es de $ 7,280.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 425.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

REVISTA MEXICANA DE CIENCIAS PECUARIAS

REV. MEX. CIENC. PECU.

VOL. 12 No. 4

OCTUBRE-DICIEMBRE-2021

CONTENIDO Contents ARTÍCULOS Articles

Pág.

Niveles de consanguinidad y sus efectos sobre la expresión fenotípica en ganado Holstein Inbreeding levels and their effects on phenotypic expression in Holstein cattle Adriana García-Ruiz, Gustavo Javier Martínez-Marín, José Cortes-Hernández, Felipe de Jesús Ruiz-López ……………………………………………………………………………………………………………………..…996 Contribución de los datos genómicos en la definición de la composición racial de bovinos doble propósito Contribution of genomic data in defining the breed composition of dual-purpose cattle Jaime Anibal Rosero Alpala, Wilson David Rangel Garcia, Adonai Rojas Barreto, William Orlando Burgos-Paz………………………………………………………………………………………………………………………1008 Relaciones entre estacionalidad, características corporales y leptina en el inicio de la pubertad en vaquillas Bos taurus taurus y Bos taurus indicus en el trópico mexicano Relationships between seasonality, body characteristics and leptin at the beginning of puberty in Bos taurus taurus and Bos taurus indicus heifers in the Mexican tropics Carlos Hernández-López, René Carlos Calderón-Robles, Alejandro Villa-Godoy, Ángel Ríos-Utrera, Sergio Iván Román-Ponce, Everardo González-Padilla……………………………………………………….…1025

Brachiaria grasses in vitro digestibility with bovine and ovine ruminal liquid as inoculum

Digestibilidad in vitro de gramíneas Brachiaria con líquido ruminal bovino y ovino como inóculo Luis Carlos Vinhas Itavo, Camila Celeste Brandão Ferreira Ítavo, Cacilda Borges do Valle, Alexandre Menezes Dias, Gelson dos Santos Difante, Maria da Graça Morais, Claudia Muniz Soares, Camila da Silva Pereira, Ronaldo Lopes Oliveira ………………………………………………………1045 Grape pomace silage Vitis labrusca L. cv. Isabel) on the intake and digestibility of nutrients, nitrogen balance and ingestive behavior of lambs Ensilado de orujo de uva (Vitis labrusca L. cv. Isabel) en la digestibilidad de nutrientes, balance de nitrógeno y comportamiento ingestivo de corderos Fernando Luiz Massaro Junior, Valter Harry Bumbieris Junior, Ediane Zanin, Elzânia Sales Pereira, Mikael Neumann, Sandra Galbeiro, Odimari Pricila Prado Calixto, Ivone Yurika Mizubuti……….…1061

III

Efectividad del aceite de canola en dietas de cerdos para mejorar el perfil lipídico de la carne Effectiveness of canola oil in pig diets to improve the lipid profile of meat Soni-Guillermo, Eutiquio, José Luis Figueroa-Velasco, María Teresa Sánchez-Torres-Esqueda, José Luis Cordero-Mora, Aleida Selene Hernández-Cázares, José Alfredo Martínez-Aispuro, José M. Fernando Copado-Bueno, María Magdalena Crosby-Galván……………………………………………….….1083 The soil-plant interface in Megathyrsus maximus cv. Mombasa subjected to different doses of nitrogen in rotational grazing La interfaz suelo-planta en Megathyrsus maximus cv. Mombasa sometida a diferentes dosis de nitrógeno en pastoreo rotacional Caryze Cristine Cardoso Sousa, Denise Baptaglin Montagner, Alexandre Romeiro de Araújo, Valéria Pacheco Batista Euclides, Gelson dos Santos Difante, Antonio Leandro Chaves Gurgel, Daniele Lopes de Souza…………………………………………………………………………………………………….1098 Relación entre la resistencia a antibióticos y la producción de biofilm de aislados de Staphylococcus aureus provenientes de mastitis bovina Relationship between antibiotic resistance and biofilm production of Staphylococcus aureus isolates from bovine mastitis Jaquelina Julia Guzmán-Rodríguez, Estefanía Salinas-Pérez, Fabiola León-Galván, José Eleazar Barboza-Corona, Mauricio Valencia-Posadas, Fidel Ávila-Ramos, José Antonio Hernández-Marín, Diana Ramírez-Sáenz, Abner Josué Gutiérrez-Chávez……………………………………………………………1117 Usefulness of Fourier transform infrared (FTIR) spectroscopy to detect Trichinella spiralis (Owen, 1835) muscle larvae in ham and sausages made from the meat of an experimentally infected pig Utilidad de la espectroscopia infrarroja con transformada de Fourier (IRTF) para detectar larvas musculares de Trichinella spiralis (Owen, 1835) en jamón y salchichas hechas de carne de un cerdo infectado experimentalmente Jorge Luis de la Rosa Arana, Jesús Benjamín Ponce Noguez, Tzayhri Gallardo Velázquez, Nydia Edith Reyes Rodríguez, Andrea Paloma Zepeda Velázquez, Ana Berenice López Lugo, Alejandro Pablo Sánchez Paredes, Pablo Martínez Labat, Fabián Ricardo Gómez de Anda………………………1133 Frecuencia de anticuerpos séricos contra los virus de la rinotraqueitis infecciosa bovina y diarrea viral bovina en toros, y su relación con la presencia de los virus en semen Frequency of serum antibodies against infectious bovine rhinotracheitis and bovine viral diarrhea viruses in bulls, and their relationship with the presence of the viruses in semen Jorge Víctor Rosete Fernández, Guadalupe A. Socci Escatell, Abraham Fragoso Islas, Juan Prisciliano Zárate Martínez, Sara Olazarán Jenkins, Lorenzo Granados Zurita, Ángel Ríos Utrera …………………………………………………………………………………………………………………..………………….1151

Variabilidad en el contenido de polifenoles, actividad biológica y antihelmíntica de extractos metanol:agua de las hojas de Gymnopodium floribundum Rolfe Variability in polyphenol content, biological and anthelmintic activity of methanol:water extracts from the leaves of Gymnopodium floribundum Rolfe Guadalupe Isabel Ortíz-Ocampo, Carlos Alfredo Sandoval-Castro, Gabriela Mancilla-Montelongo, Gloria Sarahi Castañeda-Ramírez, José Israel Chan Pérez, Concepción Capetillo Leal, Juan Felipe de Jesús Torres-Acosta………………………………………………………………………………………….…1168 Análisis morfométrico y molecular (ADNmt) de abejas melíferas (Apis mellifera L.) en el estado de Tabasco, México Morphometric and molecular analysis (mtDNA) of honeybees (Apis mellifera L.) in the state of Tabasco, Mexico Juan Florencio Gómez Leyva, Omar Argüello Nájera, Pablo Jorge Vázquez Encino, Luis Ulises Hernández Hernández, Emeterio Payró de la Cruz…………………………………………………………….…1188 Factores epizootiológicos de las estrongilosis gastrointestinales en cabras Criollas Cubanas: bases para un manejo integrado Epizootiological factors of gastrointestinal strongyloses in Cuban Creole goats: bases for integrated management Manuel Alejandro La O-Arias, Francisco Guevara-Hernández, Luis Alfredo Rodríguez- Larramendi, Luis Reyes-Muro, José Nahed-Toral, Hernán Orbelin Mandujano-Camacho, René PintoRuiz…………………………………………………………………………………………………………………………………1208

REVISIONES DE LITERATURA Reviews Linfadenitis caseosa: factores de virulencia, patogénesis y vacunas. Revisión Caseous lymphadenitis: virulence factors, pathogenesis and vaccines. Review Maria Carla Rodríguez Domínguez, Roberto Montes de Oca Jiménez, Jorge Antonio Varela Guerreo……………………………………………………………………………………………………………………………1221 NOTAS DE INVESTIGACIÓN Technical notes Comparación de ecuaciones para ajustar curvas de crecimiento de vacas Holstein, Jersey y Jersey x Holstein en pastoreo Comparison of equations to fit growth curves of Holstein, Jersey and Jersey x Holstein cows in a grazing system Sonia Contreras Piña, José Guadalupe García Muñiz, Rodolfo Ramírez Valverde, Rafael Núñez Domínguez, Citlalli Celeste González Ariceaga…………………………………………………………………..…1250

Efecto de la aplicación intrauterina de ozono sobre la migración de neutrófilos y la endometritis subclínica en ganado lechero Effect of intrauterine application of ozone on neutrophil migration and subclinical endometritis in dairy cattle Jessica Bárbara González-Aguado, Elisa Ochoa-Estrada, Héctor Raymundo Vera-Ávila, Ma. de Jesús Chávez-López, Mario Alfredo Espinosa-Martínez, Germinal Jorge Cantó-Alarcón, Claudia Gutiérrez-García, Luis Javier Montiel-Olguín……………………………………………………………..1264 Análisis in silico de la expresión génica en células de granulosa de folículos preovulatorios en dos especies de bovinos In silico analysis of gene expression in granulosa cells of preovulatory follicles in two species of bovines Jesús Alfredo Berdugo-Gutiérrez, Ariel Marcel Tarazona-Morales, José Julián Echeverry-Zuluaga, Albeiro López-Herrera ………………………………………………………………………………………………………1276 Digestibilidad ileal estandarizada de la proteína y aminoácidos de la pasta de ajonjolí en cerdos en crecimiento Standardized ileal digestibility of protein and amino acids of sesame meal in growing pigs Tércia Cesária Reis de Souza, Araceli Aguilera Barreyro, Gerardo Mariscal Landín……………………1292 Prevalencia de diversos serovares de Leptospira interrogans en vacas no vacunadas en los estados de Puebla, Tabasco y Veracruz, México Prevalence of various Leptospira interrogans serovars in unvaccinated cows in the states of Puebla, Tabasco and Veracruz, Mexico Jorge Víctor Rosete Fernández, Ángel Ríos Utrera, Juan P. Zárate Martínez, Guadalupe A. Socci Escatell, Abraham Fragoso Islas, Francisco T. Barradas Piña, Sara Olazarán Jenkins, Lorenzo Granados Zurita………………………………………………………………………………………………………………1305 Detection of porcine reproductive and respiratory syndrome in porcine herds of Baja California, Mexico Detección del virus del síndrome reproductivo y respiratorio en piaras porcinas de Baja California, México Sergio Daniel Gómez-Gómez, Gilberto López-Valencia, José Carlomán Herrera-Ramírez, Enrique Trasviña-Muñoz, Francisco Javier Monge-Navarro, Kattya Moreno-Torres, Issa Carolina GarcíaReynoso, Gerardo Enrique Medina-Basulto, Miguel Arturo Cabanillas-Gámez …………………………1317

Ataxia enzoótica por deficiencia de cobre en ciervo rojo (Cervus elaphus) cautivo en Colima, México Enzootic ataxia due to copper deficiency in captive red deer ( Cervus elaphus) in Colima, Mexico Luis Jorge García-Márquez, Rafael Ramírez-Romero, Julio Martínez-Burnes, Alfonso LópezMayagoitia, Johnatan Alberto Ruíz-Ramírez, Edgar Iván Loman-Zúñiga, Fernando ConstantinoCasas…………………………………………………………………………………………………………………………….1326

Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes). Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo. El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

VII

Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

referencias, aunque pueden insertarse en el texto (entre paréntesis).

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés. 12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus. Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

VIII

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

XI)

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50 g

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s)

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts). All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt. Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias”. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts:

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

b) Technical Notes. They should be brief and be evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which

should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of the research article but without section titles.

names(s), the number of the edition, the country, the printing house and the year. e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to

summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Key rules for references a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one. b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article). c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10. III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

XII

Organization, as author VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

In press VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000. Books and other monographs

Author(s) VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Organization as author XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984. XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996. XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988. XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Conference paper X)

XI)

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003. XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003. XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003. 12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

13. Final version. This is the document in which the authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII

14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m µl µm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v. J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

versus

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIV

https://doi.org/10.22319/rmcp.v12i4.5681 Article

Inbreeding levels and their effects on phenotypic expression in Holstein cattle

Adriana García-Ruiz a Gustavo Javier Martínez-Marín a José Cortes-Hernández b Felipe de Jesús Ruiz-López a*

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal, Km. 1 carretera Ajuchitlán-Colón, 76280, Ajuchitlán, Querétaro, México. b

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México.

*Corresponding author: ruiz.felipe@inifap.gob.mx

Abstract: The objective of the present study was to calculate the inbreeding levels in the Holstein population of Mexico and to evaluate their effect on the production of milk, fat, protein and final conformation points. The pedigree information was made up of 326,238 animals, to which inbreeding was calculated through the modified recursive algorithm (INBUPGF90). Inbreeding trends of animals born from 1990 to 2018 were obtained through a regression analysis, and the effect of inbreeding on productive characteristics was evaluated with an analysis of variances, for which phenotypic information from 68,779 animals was included. Six groups were formed according to the level of inbreeding (1= <1%, 2= ≥1 and <2%, 3= ≥2 and <3%, 4= ≥3 and <4%, 5= ≥4 and <5%, and 6≥ 5%). The results showed that, for each percentage point of increase in inbreeding, the production of milk, fat and protein decrease by 88, 3.16 and 2.57 kg (P<0.0001). At low levels of inbreeding (<5%), no effect on fat and protein production was detected. However, when inbreeding increased to more than 5 %, the 996

Rev Mex Cienc Pecu 2021;12(4):996-1007

loss in production was 12 kg of fat and 9 kg in protein. It was also observed that the animals with the lowest average conformation have low levels of inbreeding (<1%) and the highest levels did not show significant differences between them, which confirms that functional conformation is less sensitive to the effects of inbreeding than other characteristics of economic interest. It is recommended to promote selection programs based on optimal contributions to maximize genetic gains and control inbreeding levels. Key words: Inbreeding, Inbreeding depression, Phenotypic expression.

Received: 04/05/2020 Accepted: 19/04/2021

Introduction Inbreeding is caused by the crossing of related animals(1) and represents the probability that, at any locus of an individual, there are identical genes by descent(2). This affects the modification of the expression of genotypes, a phenomenon known as inbreeding depression. In livestock species, inbreeding depression increases the risk that individuals suffer from some genetic diseases, decrease their fertility(3) and that their productive and health aptitude is affected(4); in addition, it can affect the performance of any characteristic under selection(5). Some of the genetic explanations for the causes of inbreeding depression are the effects of overdominance, incomplete dominance, epistasis and genotype-by-environment interaction(1,2). The hypothesis that supports the effects of overdominance indicates that inbreeding increases the frequency of homozygotes, which reduces the frequency of heterozygotes and the expression of their superiority. The hypothesis of incomplete dominance states that an increase in inbreeding is reflected in a greater frequency of homozygotes and with this, the presence of recessive deleterious alleles reduces(6), which are eliminated from populations after a few generations. This is the mechanism that is considered to have the greatest frequency and effect on populations(7).

The third hypothesis proposes a gene interaction (epistasis), which under conditions of inbreeding, creates unfavorable combinations of genes and, consequently, the productive potential of animals reduces(5,7). The genotype-by-environment interaction is another factor that can explain inbreeding depression since the more heterozygous an individual is, the less sensitive they are to environmental stress compared to homozygous individuals. This

997

Rev Mex Cienc Pecu 2021;12(4):996-1007

interaction primarily affects fitness-related traits(5). The mechanisms of genetic action described above have a low impact when measuring the effects in individual loci, but in polygenic characters the performance of the individual can be significantly decreased(8,9). In dairy cattle, globalization, technological advancement and the innovation of genetic tools have intensified the selection process, which has caused an increase in the mating of related animals, causing a decrease in the diversity of genetic material(10) that is directly associated with an increase in inbreeding rates and a decrease in animal performance. In Holstein cattle, an increase in the percentage of inbred animals has been estimated over the years and although inbreeding rates have not presented drastic changes (approximately 0.11 to 0.21 % per year, which corresponds to an average increase from 0.59 to 0.96 % per generation)(11,12), the decrease in the generation interval has promoted a decrease in inbreeding per generation(13), this being greater in males than in females due to the selection pressure exerted on few sires used intensively(14). In the livestock field, high inbreeding levels have caused significant losses in the production of milk(15) and its components (fat and protein)(16), in longevity(15,17), in characters of conformation(16) and fertility(18), causing significant economic losses for farmers(5,16). The objective of the present study was to calculate the inbreeding levels in the Holstein population of Mexico, both females and males, and to evaluate their effect on the levels of production of milk, fat, protein and final conformation points.

Material and methods The pedigree information used to estimate inbreeding levels consisted of 326,238 animals of the Holstein breed registered by the Holstein Association of Mexico. To estimate the inbreeding index, a modified recursive algorithm was used, which, in the case of unknown ancestors, incorporates as an inbreeding value the average of the animals born in the same year, an algorithm implemented in the INBUPGF90 program developed by Aguilar and Misztal(19); which has as a principle the method suggested by Wright (1922), which, through the following equation, considers the probability that the gametes of the father and mother carry the same genes: 𝐹𝑥 = ((1/2)^(𝑛𝑠 + 𝑛𝑑 + 1))(1 + 𝐹𝑎) where: 𝐹𝑥=inbreeding coefficient of the animal 𝑥, 𝑛𝑠= number of generations from the father of the animal to the common ancestor, 𝑛𝑑= number of generations from the mother of the animal to the common ancestor, 𝐹𝑎 = inbreeding coefficient of the common ancestor.

998

Rev Mex Cienc Pecu 2021;12(4):996-1007

Subsequently, inbreeding trends by year of birth (from 1990 to 2018) were obtained through a linear regression analysis. The analysis included a total of 321,466 records; of which, 91 % were females. To animals born in the period under study, production information (milk, fat and protein) adjusted to 305 days and the score of final conformation points obtained in the first round were included. Animals that did not have productive records were removed from the study. Finally, the database was made up of a total of 68,779 animals. The productive and conformation information was collected by the production control system of the Holstein Association of Mexico. In order to evaluate the general effect of inbreeding and year of birth on the characteristics studied (milk, components and conformation), linear regression analyses were performed. To determine at what level of inbreeding, effects on the characters of economic importance are observed, females were classified into 6 groups, determined by the level of inbreeding expressed as a percentage. Group 1 included animals with <1%, group 2 those with ≥1 and <2%, group 3 those with ≥2 and <3%, group 4 those with ≥3 and <4%, group 5 those with ≥4 and <5%, and group 6 those with a level ≥5%. Through an analysis of variance, the comparison of means of the productive characteristics and of final conformation points was made for each of the groups formed by the level of inbreeding. To evaluate the trends of the effect of inbreeding by class, orthogonal contrasts were performed. The comparison of means and contrast test were performed with the LSMEANS-GLM procedure and regressions through the REG procedure, both with the SAS® 9.3 package (20).

Results and discussion The mean and standard deviation of inbreeding for animals born from 1990 to 2018 in the Holstein population of Mexico was 2.60 ± 2.57, with a rate of increase per year of 0.07 (P<0.001), being lower for males (0.05) than for females (0.07) (Figure 1). The trend by sex differs from that observed in the North American Holstein population, where the rate of inbreeding is lower in females than in males(21), a trend that can be explained by the greater selection pressure exerted on the latter specimens. In the Holstein population of Mexico, the lower rate of inbreeding of males could be explained by the selective importation of sires (which turn out to be little inbred) from various populations, especially the North American one. The rate of change of inbreeding presented in males of the population under study in the decade from 1990 to 2000 coincides with those calculated in Holstein populations of France, the Netherlands and the United States (0.12)(11), and is approximately half of that reported in Holstein cattle of Canada (0.26)(22), as well as males and females of the United States (0.22 and 0.21)(21) for the same decade.

999

Rev Mex Cienc Pecu 2021;12(4):996-1007

Figure 1: Inbreeding trends by sex in the Holstein population of Mexico

For the two decades that followed, the rate of change in the study population was lower (0.03 from 2000 to 2009 and of 0.06 from 2010 to 2018) (Table 1). The low rate of inbreeding from 2000 to 2009 in females (0.03) and the zero increase in males can be explained by the efficient implementation of selection programs based on the optimal genetic contributions of future generations, which consider the estimated genetic values and genetic relationships between selected individuals(23). Table 1: Rate of change in inbreeding by time period of the Holstein population of Mexico, classified by sex Periods of year of birth Holstein population of Mexico 1990-1999 2000-2009 2010-2018 Females 0.17 0.03 0.05 Males General population

0.12 0.17

0.00 0.03

0.25 0.06

The use of selection programs based on optimal contributions in Mexico has been promoted mainly by artificial insemination companies, which provide direct service to farmers. The crossbreeding strategies employed in selection programs based on optimal contributions and the globalization of artificial insemination companies could explain the introduction of genetic material from other countries that had not been used in Mexico. According to pedigree information, from 1996 to 2000, daughters of sires from Italy, Spain, France, Belgium and Australia began to be born; event to which the decrease in inbreeding in the following decades can be attributed. In the study period, the same pattern of behavior was

1000

Rev Mex Cienc Pecu 2021;12(4):996-1007

observed in the Holstein population of Canada and the United States, in which the rate of inbreeding increased in the 90s and decreased in the early 2000s(21,24). However, the rates of inbreeding of other populations were higher compared to the Holstein population of Mexico; for example, the Canadian Holstein population showed an increase of 0.08 per year, from 2000 to 2009 and of 0.23 from 2010 to 2016(22,24); while the Holstein population of the United States showed increases of 0.11 and 0.27 for the same decades(21). In Mexico, as in the United States and Canada, the same behavior was observed, since inbreeding increased between two and three times in the 2010s (from 0.03 to 0.06, from 0.11 to 0.27 and from 0.08 to 0.23, respectively), compared to the previous decade, although the difference between Mexico and Canada or the United States remained. The increase in inbreeding of sires used in Mexico in the 2010s was very noticeable and may be due to the use of sires that were selected through genomic selection, since the introduction of this technological tool has decreased the presence of recessive deleterious genes, but at the same time, has affected the diversity of haplotypes in the genome of dairy cattle populations(25). This increase coincides with that observed in other North American populations in the same years(21,24). In various populations, it has been shown that inbreeding can cause a decrease in the efficiency of characters of economic importance(3,26). In the Holstein population of Mexico, it was found that, for every percentage point of increase in inbreeding, the production of milk, fat and protein decrease by 88, 3.16 and 2.57 kg (P<0.0001). In the Holstein population of the United States, a lower loss for milk production (73 kg) than that found in the present study was found, and lower for fat (-1.08 kg) and protein (-0.97 kg)(27). In the analysis of the effect of the level of inbreeding on the production of milk, fat and protein, as well as final conformation points (Table 2), the results show that animals with a higher level of inbreeding (group 6, with inbreeding level ≥5%) are statistically different from animals with a lower percentage, with differences between the extreme classes of -444 kg, -17 kg and -11 kg of milk, fat and protein, respectively. These results are consistent with those found by Maiwashe et al(28), who mention that the production of milk and its components are affected by the increase in inbreeding coefficients, being reflected in the average annual performance of the population. In the population studied, it was observed that, for milk production, there are three statistically different classes, those with <3% (groups 1, 2 and 3), those from 3 to <5% (groups 4 and 5) and ≥5% (group 6), implying for the latter a decrease of 260 kg per lactation compared to the average of groups 4 and 5. The effect of inbreeding on the composition of milk (fat and protein) at low levels (<5%) does not have a negative effect. However, when the inbreeding exceeds 5%, the loss in production of fat is 11 kg, and in protein 10 kg. It is also important to mention that the trends in the effect of inbreeding on productive characteristics were not linear in any of them (Table 2), suggesting the idea that there are threshold values of inbreeding for it to be expressed in deterioration of the productive 1001

Rev Mex Cienc Pecu 2021;12(4):996-1007

potential of animals(3,18). Contrary to what was observed in the productive characters, the animals with the lowest levels of inbreeding (<1%) were those that presented the lowest average in final conformation points and the highest levels (>1%) showed no significant differences between them, which suggests that the functional conformation is less sensitive to the effect of inbreeding. Studies conducted on Holstein cattle of Ireland showed that inbreeding does not have large negative effects on all conformation characters, and those that are affected show detriments at high levels (>12.5 %)(18). Table 2: Comparison of means of milk, fat, protein (kg) production and final conformation points by level of inbreeding of animals Group

Level of inbreeding

Number of animals

Milk

Fat Δ¶

Protein

Δ¶

1 2 3 4 5 6

<1% ≥1 y <2% ≥2 y <3% ≥3 y <4% ≥4 y <5% ≥ 5%

21,734 11,656 11,184 9,211 6,410 8,604

11,699a 11,754a 11,636a 11,519b 11,511b 11,255c

384a 380a 379a 376a 378a 367b

344a 343a 340a 339a 343a 333b

Δ¶

Final points Δ¶ 79.59a 80.33b 80.30b 80.22b 80.38b 80.41b

Means with unequal superscripts present significant statistical differences (P<0.001). Linear (Δ) and quadratic (¶) significant trends, (P≤0.05).

With the results obtained in the present study, the negative effects that inbreeding can have when it is at levels higher than 5 % were shown and that the introduction of genetic selection tools can modify the inbreeding levels in a positive way in the expression of some characteristics, such as those of conformation, in those associated with the longevity and lifetime production of the animal(29), but at the same time it may affect the expression of others(27); so it would be important to promote selection programs based on optimal contributions of animals to maximize genetic gains and control inbreeding levels at rates below 1 % per generation(30). It is important to mention that the effects of inbreeding are not limited to productive or conformation characteristics, its effects on reproductive characteristics also affect the profitability of milk-producing companies. Smith et al(4) found that an increase of one percentage point of inbreeding can increase by 0.55 d the age at first calving, decrease the productive life of the animals by 6 d and the production by 4.8 d. Mc Parland et al(18) showed a negative effect of high levels of inbreeding (up to 12.5 %) on the reproductive performance of animals, observing a 2 % increase in the incidence of dystocia, 1 % more in the incidence of stillbirth, an increase of 8.8 d in the calving interval and 2.5 d in the age at first calving, a 1.68 % decrease in the pregnancy rate, when females go from a inbreeding level of 6.25 to 12.5 %(3).

1002

Rev Mex Cienc Pecu 2021;12(4):996-1007

The estimation of inbreeding coefficients is an important indicator of the optimal use of genetic resources, since it evaluates the presence of loci that can affect the productive performance of animals within a population. Its calculation from the pedigree information has turned out to be a tool to be considered in the selection process and has allowed to evaluate its effect on phenotypic expression in various populations. Also, the use of molecular tools can significantly help to know the details at the molecular level that inbreeding entails(1), to provide the possibility of predicting early rates of genetic improvement and thus minimize the effects associated with high levels of inbreeding(31). However, in genomic selection programs, the widespread use of sires has led to a reduction in genetic diversity within populations with high productive performance(12), so it is necessary to establish optimal contribution selection schemes based on genomic values that maintain low to moderate levels of inbreeding, especially in the selection of breeding animals(23,32). Recent studies suggest the incorporation of the estimation of the inbreeding coefficient in genetic value prediction procedures; for example, include it as a covariate or consider it in the inverse of the additive relationship matrix in the estimation of genetic values of the BLUP evaluations, as well as in the estimation of their reliability, since, if not included, the variance of the prediction error can increase, or the reliability can be over or underestimated(33).

Conclusions and implications The results obtained show that low levels of inbreeding do not affect the phenotypic expression of productive characters and that their effect on the productive characteristics studied is not linear. Levels above 5 % are associated with the decrease in characteristics of economic interest such as the production of milk, fat and protein. In addition, the increase in inbreeding in the population will increase the probability that lethal genes or genetic diseases associated with recessive genes can be expressed within the population. On the other hand, the way in which the genetic improvement industry is structured has promoted that it is the animals high in inbreeding who show the most functional conformation, which can have desirable repercussions for farmers. Therefore, it is recommended to design comprehensive genetic improvement programs that include technology, reproductive, health and productive life characters to control the level of inbreeding of the population and that consequently the expression of productive characteristics is not compromised.

1003

Rev Mex Cienc Pecu 2021;12(4):996-1007

Acknowledgments and funding source

Project funded by INIFAP-CENIDFyMA with the name “Study of inbreeding and its effect on productive and reproductive characteristics in Holstein cattle” with No SIGI: 11513634465. Project partially funded by Holstein of Mexico A.C.

Conflict of interest

The authors declare that there are no conflicts of interest. Literature cited: 1. Kristensen TN, Pedersen KS, Vermeulen CJ, Loeschcke V. Research on inbreeding in the ‘omic’ era. Trends Ecol Evol 2010;25(1):44-52. 2. Ferenčaković M, Sölkner J, Curik I. Estimating autozygosity from high-throughput information: effects of SNP density and genotyping errors. Genet Sel Evol 2013;45(1):42. 3. González-Recio O, De Maturana EL, Gutiérrez JP. Inbreeding depression on female fertility and calving ease in Spanish dairy cattle. J Dairy Sci 2007;90(12):5744-5752. 4. Smith LA, Cassell BG, Pearson RE. The effects of inbreeding on the lifetime performance of dairy cattle. J Dairy Sci 1998;81(10):2729-2737. 5. Leroy G. Inbreeding depression in livestock species: review and meta‐analysis. Animal Genetics 2014;45(5):618-628. 6. Roff DA. Inbreeding depression: tests of the overdominance and partial dominance hypotheses. Evolution 2002;56(4):768-775. 7. Charlesworth B, Charlesworth D. The genetic basis of inbreeding depression. Genet Res 1999;74(3):329–340. 8. Dekkers JCM, Gibson JP, Bijma P, Van Arendonk JAM. Design and optimisation of animal breeding programmes. Technical notes. Wageningen University, Netherlands; 2000:1-16.

1004

Rev Mex Cienc Pecu 2021;12(4):996-1007

9. Marie J, Charpentier E, Williams C. Inbreeding depression in ring-tailed lemurs (Lemur catta): genetic diversity predicts parasitism, immunocompetence, and survivorship. Conserv Genet Resour 2008;9(6):1605-1615. 10. Lori AS. The effect of inbreeding on lifetime performance of dairy cattle. Master thesis. Blacksburg, Virginia, USA: Faculty of the Virginia Polytechnic Institute and State University; 1997. 11. Danchin-Burge C, Hiemstra SJ, Blackburn H. Ex situ conservation of Holstein-Friesian cattle: comparing the Dutch, French and USA germplasm collections. J Dairy Sci 2011; 94(8):4100-4108. 12. García-Ruiz A, Cole JB, VanRaden PM, Wiggans GR, Ruiz-López FJ, Van Tassell CP. Changes in genetic selection differentials and generation intervals in US Holstein dairy cattle as a result of genomic selection. PNAS 2016;113(28):E3995-E4004. 13.VanRaden PM, Olson KM, Wiggans GR, Cole JB, Tooker ME. Genomic inbreeding and relationships among Holsteins, Jerseys, and Brown Swiss. J Dairy Sci 2011;94(11):5673-5682. 14. Miglior F, Burnside EB, Dekkers JC. Non-additive genetic effects and inbreeding depression for somatic cell counts of Holstein cattle. J Dairy Sci 1995;78(5):1168-1173. 15. Thompson JR, Everett RW, Hammerschmidt NL. Effects of inbreeding on production and survival in Holsteins. J Dairy Sci 2000;83(8):1856-1864. 16. Croquet C, Mayeres P, Gillon A, Vanderick S, Gengler N. Inbreeding depression for global and partial economic indexes, production, type, and functional traits. J Dairy Sci 2006;89(6):2257-2267. 17. Sewalem A, Kistemaker GJ, Miglior F, Van Doormaal BJ. Analysis of inbreeding and its relationship with functional longevity in Canadian dairy cattle. J Dairy Sci 2006; 89(6):2210-2216. 18. Mc Parland S, Kearney JF, Rath M, Berry DP. Inbreeding effects on milk production, calving performance, fertility, and conformation in Irish Holstein-Friesians. J Dairy Sci 2007; 90(9):4411-4419. 19. Aguilar I, Misztal I. Technical Note: Recursive algorithm for inbreeding coefficients assuming nonzero inbreeding of unknown parents. J Dairy Sci 2008;91(4):1669-1672. 20. SAS. SAS/STAT 9.3. User's Guide: Mathematical Programming Examples. Cary NC, USA: SAS Inst. Inc. 2012.

1005

Rev Mex Cienc Pecu 2021;12(4):996-1007

21. CDCB. Council of Dairy Cattle Breeding. Trend in inbreeding coefficients of Cows for Holstein or Red & White. Bowie, MD, USA 2020. https://queries.uscdcb.com/eval/summary/inbrd.cfm. Accessed Apr 6, 2020. 22. Stachowicz K, Sargolzaei M, Miglior F, Schenkel FS. Rates of inbreeding and genetic diversity in Canadian Holstein and Jersey cattle. J Dairy Sci 2011;94(10):5160-5175. 23. Weigel KA. Controlling inbreeding in modern breeding programs. J Dairy Sci 2001;84:E177-E184. 24. CDN. Canadian Dairy Network. Inbreeding Update. Guelph, Ontario, Canadá 2020. https://www.cdn.ca/document.php?id=529. Accessed Apr 8, 2020. 25. Makanjuola BO, Miglior F, Abdalla EA, Maltecca C, Schenkel FS, Baes CF. Effect of genomic selection on rate of inbreeding and coancestry and effective population size of Holstein and Jersey cattle populations. J Dairy Sci 2020;103(6):5183-5199. 26. Biémont C. Inbreeding effects in the epigenetic era. Nature Reviews Genetics 2010;11(3):234-234. 27. Wiggans GR, VanRaden PM, Zuurbier J. Calculation and use of inbreeding coefficients for genetic evaluation of United States dairy cattle. J Dairy Sci 1995;78(7):1584-1590. 28. Maiwashe A, Nephawe K, Theron H. Estimates of genetic parameters and effect of inbreeding on milk yield and composition in South African Jersey cows. S Afr J Anim Sci 2008;38(2):119-125. 29. Vollema AR, Groen AF. Genetic correlations between longevity and conformation traits in an upgrading dairy cattle population. J Dairy Sci 1997;80(11):3006-3014. 30. Granleese T, Clark SA, Swan AA, Van der Werf JH. Increased genetic gains in sheep, beef and dairy breeding programs from using female reproductive technologies combined with optimal contribution selection and genomic breeding values. Genet Sel Evol 2015;47(1):1-13. 31. Howard JT, Pryce JE, Baes C, Maltecca C. Invited review: Inbreeding in the genomics era: Inbreeding, inbreeding depression, and management of genomic variability. J Dairy Sci 2017;100(8):6009-6024. 32. Clark SA, Kinghorn BP, Hickey JM, Van der Werf JH. The effect of genomic information on optimal contribution selection in livestock breeding programs. Genet Sel Evol 2013;45(1):1-8.

1006

Rev Mex Cienc Pecu 2021;12(4):996-1007

33. Aguilar I, Fernandez EN, Blasco A, Ravagnolo O, Legarra A. Effects of ignoring inbreeding in model‐based accuracy for BLUP and SSGBLUP. J Anim Breed Genet 2020;37(4):356-364.

1007

https://doi.org/10.22319/rmcp.v12i4.5690 Article

Contribution of genomic data in defining the breed composition of dual-purpose cattle

Jaime Anibal Rosero Alpala a* Wilson David Rangel Garcia a Adonai Rojas Barreto a William Orlando Burgos-Paz b

Corporación Colombiana de Investigación Agropecuaria-AGROSAVIA, Centro de Investigación La Libertad, km 17 vía Puerto López, Villavicencio, Meta, Colombia. b

Corporación Colombiana de Investigación Agropecuaria - AGROSAVIA, Centro de Investigación Tibaitatá, Mosquera, Cundinamarca, Colombia.

*Corresponding author: jroseroa@agrosavia.co

Abstract: Animal heterosis is key in obtaining more productive animals and better adapted to the tropics. However, inadequate genetic management leads to the obtaining of mosaics of breeds that includes the loss of the productive potential of the herd. The objective of this study was to define the breed composition of dual-purpose crossbred cattle in the piedmont plains, department of Meta-Colombia. A total of 126 crossbred (CRO) individuals from six herds were evaluated by a phenotypic (APP) and a genotypic (GBA) approach. For GBA, the control breeds associated with Bos taurus taurus and Bos taurus indicus were included, for this they were genotyped with a GeneSeek GGP-LD chip of 26K of SNP and analyzed by principal component analysis (PCA) and Bayesian probabilistic assignment of ADMIXTURE. The breed groups generated by APP varied with respect to GBA. Molecular analysis detected seven (k=7) genetic groups in the breed composition of the study animals. The three breeds with the highest participation in the breed composition of crossbred individuals were: Holstein, Gyr, Brahman with 23.4, 21.4, and 21 % respectively, while the remaining, Blanco Orejinegro, Brown Swiss, Normande and Jersey did not exceed 13 %. Unlike APP, the GBA approach effectively allowed the identification of the breed composition of crossbred cattle and provided key

1008

Rev Mex Cienc Pecu 2021;12(4):1008-1024

information for the development of mating programs that seek to improve productive indicators, and in turn tend to the adaptation of animals, an essential requirement for dualpurpose bovine systems. Key words: Genotyping, Crossbred, Variability, Genetics.

Received: 13/05/2020 Accepted: 29/03/2021

Introduction The dual-purpose bovine system in Colombia accounts for approximately 35 % (8.2 million head) of the total bovine population(1). Similar to other regions of Latin America, this system is based on obtaining animals from the crossing of breeds with some degree of productive advantage in a particular environment, and that confers greater productivity(2). Contrary to what is obtained under subtropical conditions, bovine production systems, in general in tropical regions, have not achieved the expected success(3) and as a resource to improve production, the selection of local and exotic breeds of the genera Bos taurus taurus, Bos taurus indicus and crosses between them is carried out(4) to make efficient use of heterosis, paternal or maternal as used, and to increase the efficiency of beef or milk production systems(5). However, not all crosses can confer the expected advantages and the incorrect application of zootechnical guidelines can accelerate the presence of adaptation and production problems. It is necessary to consider the implications of a multibreed herd, where its breed composition is partially known or completely unknown, and where non-additive genetic effects delineate the expression of the animal phenotype(6). In this regard, the situation in Colombia requires special attention because in addition to a predominant tropical condition, the use of a wide range of breeds and crosses, the lack of productive records and the indiscriminate use of breeders without knowledge of the origin or management result in an erroneous perception of animals that are more productive and better adapted to the conditions where they are exploited(4,6). In this case, the availability of information on the genealogical structure or co-ancestry between individuals allows managing diversity and having control over inbreeding(7) and the use of molecular markers, particularly SNP (Single Nucleotide Polymorphism), has

1009

Rev Mex Cienc Pecu 2021;12(4):1008-1024

demonstrated the effectiveness of genomic analysis in determining the breed composition in beef(8) and milk(9) crossbred herds with deficient genealogical information. In fact, the contribution of molecular analyses has made it possible to identify whether the origin of B. taurus taurus or B. taurus indicus of chromosomal sequence of cattle may have effects on characteristics of productive interest(10). Therefore, the objective of this study was to quantify the contribution of genomic information in determining the breed composition of crossbred cattle of the dual-purpose system predominant in the Colombian Piedmonte LLanero region, as a support tool in the definition of management and selection strategies in crossbred herds of the region.

Material and methods Location

This study was carried out in animals present in six herds of three dairy routes in the subregion of Piedemonte Llanero in the department of Meta-Colombia. This subregion is characterized by temperatures ranging between 23 and 30 °C, relative humidity between 76 and 78 % and altitudes at sea level between 300 and 700 m asl(11). The crossbred (CRO) herds in each defined municipality were named by acronyms as follows: ACA: herd of the municipality of Acacías, CLN: herd of the municipality of Castilla La Nueva, CUM: herd of the municipality of Cumaral, MES: herd of the municipality of Mesetas, SJA: herd of the municipality of San Juan de Arama and VLL: herd of the municipality of Villavicencio.

Phenotypic assessment

Initially, in each selected herd (conformed by an average of 70 animals), the productive information was consolidated through a basic survey to identify the productive criteria and objectives of use of the breeds present. Subsequently, the breed classification of a group of representative animals was carried out, of which heifers and cows of up to third calving were included. For this purpose, about 21 animals per herd were selected, for a total of 126 animals, to generate a classification by their Apparent phenotypic predominance –APP(12), where the wide range of crosses between the breeds of origin B. taurus taurus and B. taurus indicus, used in the herds of the dual-purpose production system. APP classify the animals as follows: animals with predominance B. taurus taurus

1010

Rev Mex Cienc Pecu 2021;12(4):1008-1024

(PREDTAU): without hump, without dewlap and without umbilical fold, short and hairy ears, spotted hair or not, black, red and brown skin, horned or not. Animals with predominance B. taurus indicus (PREDCEB): with hump, dewlap and highly developed umbilical fold, long and hairless ears, solid, gray, black, ash or red color. With intermediate predominance B. taurus taurus x B. taurus indicus (PREDINTER): with hump, dewlap and umbilical fold, long and slightly hairy ears, rarely spotted, almost always with horns.

Genotypic breed assignment

The genotypic breed assignment-GBA was obtained from genotypic information from 126 animals (21 per herd), previously selected (by APP) and sampled under the recommendations of a reduced extreme sampling(13), thus ensuring the comparison between APP and GBA database. For molecular assessment, a blood sample was collected from each animal by puncture in the coccygeal vein and transported to Molecular Genetics Laboratory at Tibaitatá Research Center of AGROSAVIA for subsequent genotyping. DNA extraction was performed using the commercial UltraClean ® Blood DNA Isolation kit (MoBio Laboratories Inc.) and the genotyping of single nucleotide polymorphisms (SNPs) distributed in the bovine genome was performed with the GeneSeek® GGP-LD chip of 26K SNPs under the recommendations of the manufacturer.

Database cleansing and statistical analysis

The information derived from the phenotypic evaluation allowed generating frequency table based on breed components observed in the evaluated herds. The molecular information was prepared for population analysis in order to identify genetic groups. Therefore, initially, SNP markers with unknown position and those located on sex chromosomes were excluded. Likewise, SNPs that were not detected in more that 5 % of the individuals, SNPs that deviated from the Hardy-Weinberg equilibrium (P<0.01) and SNPs that presented an MAF <0.01 were excluded from the analysis. After carrying out the cleansing, 24,266 SNPs of the 126 samples were used, with which the genetic analyses were carried out. With the molecular information, the genetic structure of the CRO population was initially determined through principal component analysis (PCA), that is, from the genotypic data the genetic relationships between individuals were evaluated and possible agglomerations were sought with respect to genetic groups established in APP and the control breeds used in GBA. For this purpose, PRCOMP command of STATS library for R(14) was used. To

1011

Rev Mex Cienc Pecu 2021;12(4):1008-1024

identify the genetic relationships and possible introgression events, the probabilistic assignment of individuals to genetic groups was used, for this, the maximum likelihood algorithm was used, which, based on models, estimates the ancestry and calculates the probability of the observed genotypes using ancestry proportions and population allele frequencies of the population, algorithm implemented in ADMIXTURE(15). To determine the presence of k genetic groups in the population, from k= 2 to k= 10 genetic groups were analyzed, and the most probable k value was identified by the lowest error value in the cross-validation software with the default options of the program, and the author’s recommendations(15). Finally, by the algorithm described above(15), allele frequencies of SNPs in crossbred population (CRO, n= 126) were compared with respect to the control breeds, where an approximate number of 20 samples was used, looking for symmetry with the number of samples taken per herd (21 samples). To do this, a database of SNPs of the seven control breeds was used, provided by Molecular Genetics Laboratory at Tibaitatá Research Center of AGROSAVIA and corresponded to the breeds: Brahman (BRA, n=18), Holstein (HOL, n=29), Blanco Oreijnegro (BON, n=19), Gyr (GYR, n=18), Brown Swiss (BRO, n=20), Jersey (JER, n= 20) and Normande (NOR, n=20), for considering their apparent use in the formation of the crossbreeding of cattle of the dual-purpose system and thus establish the genetic groups with greater precision.

Results Phenotypic assessment

From information provided by producers, it was found that predominant breed groups were crosses with Gyr (22.45 %), Zebu (18.36 %), Holstein (16.32 %), Brown Swiss (10.20 %), Normande (4.76 %) and Jersey (4.08 %). In most cases, the producers responded that the apparent breed composition of their herds was due to the breed of breeding bull used in recent mating years. The remaining 23.80 % of the crosses refer to individuals with possible Creole and undefined breed groups. On the other hand, in the CRO herds with the APP approach, 34 % of the animals were classified as PREDCEB, 37 % as PREDTAU and the remaining 29 % as PREDINTER. At the level of the herds, the proportions of the groups by phenotype were variable among themselves, although a slight similarity was observed between SJA and CUM (Figure 1), which, despite being in distant regions, show similar genetic compositions due to their management and productive orientation.

1012

Rev Mex Cienc Pecu 2021;12(4):1008-1024

Figure 1: Percentage of contribution by phenotypic groups in the evaluated herds

PREDCEB= animals with predominance Bos taurus indicus, PREDTAU= animals with predominance Bos taurus taurus, PREDINTER= animals with intermediate predominance Bos taurus taurus x Bos taurus indicus, ACA= herd of the municipality of Acacías, CLN= herd of the municipality of Castilla La Nueva, CUM= herd of the municipality of Cumaral, MES= herd of the municipality of Mesetas, SJA= herd of the municipality of San Juan de Arama and VLL= herd of the municipality of Villavicencio.

Genotypic breed assignment

First, with the genotypic information, the genetic relationship between the samples was established by principal component analysis for the three genetic groups PREDTAU, PREDINTER and PREDCEB (Figure 2). The first principal component (PC1) explained 6.52 % of the total variance, associated with the differentiation of the genetic components Bos taurus taurus and Bos taurus indicus. The groups by APP proposed PREDTAU, PREDCEB and PREDINTER did not show the expected genetic separation for the CRO population and on the contrary, all individuals in the groups were dispersed throughout the first component. On the other hand, the second principal component explained 2.9 % of the variation, where a group of individuals assessed by APP as PREDTAU separated from the differentiation axis observed in PC1 (Figure 2). In the PCA graphs, a high dispersion was observed in animals with phenotype Bos taurus taurus and Bos taurus indicus, which may be associated with a genetic variability of the populations greater than the phenotypic variation. However, the spatial projection of the animals differentiated by PC2 is an indicator of how the allele frequencies distinguish animals with predominance of a phenotype, which makes it mandatory to use control breeds for their better definition.

1013

Rev Mex Cienc Pecu 2021;12(4):1008-1024

Figure 2: Principal component analysis (PCA) among individuals for dual-purpose crossbred cattle and their apparent phenotypic predominance (APP)

PREDCEB= animals with predominance Bos taurus indicus, PREDTAU= animals with predominance Bos taurus taurus, PREDINTER= animals with intermediate predominance Bos taurus taurus x Bos taurus indicus.

In order to establish possible breeds that conform the genetic group of the CRO group, seven control breeds were included and their relationship was assessed by PCA (Figure 3). Figure 3: Principal component analysis (PCA) with the inclusion of control breed groups in the dual-purpose crossbred (CRO) cattle population

BON= Blanco Orejinegro, BRA= Brahman, GYR= Gyr, HOL= Holstein, JER= Jersey, NOR= Normande, PAR= Brown Swiss (BRO), MEZ= crossbred (CRO).

1014

Rev Mex Cienc Pecu 2021;12(4):1008-1024

The PC1 explained 13.38 % of total variation associated with the differentiation between animals of the group of breeds B. taurus indicus (BRA and GYR) located on the right side and group of breeds B. taurus taurus (HOL, JER, BRO, BON and NOR) located on the left side (Figure 3). In fact, the spatial projection of crossbred individuals presents a broad spectrum between these two groups of breeds as initially observed in the APP. The second principal component PC2 explained 3.14 % of variation. It is evident that the group of breeds B. taurus taurus presents greater variability than group B. taurus indicus, it is highlighted that the breed JER shows the greatest separation between breeds B. taurus taurus and only a small group of CRO animals would appear in the spectrum towards this breed (Figure 3). The third component-PC3, 2.77 % of the variation was explained by this component, HOL and BRO breeds are shown as the most distant groups from each other and in the spectrum, it covers a part of crossbred animals of this study and animals of BON and NOR breeds. The second approach to define existing genetic groups used Bayesian probabilistic assignment implemented in ADMIXTURE, where it was determined that the smallest error in cross-validation corresponded to 7 (k= 7) genetic groups, taking this value as adequate to explain genetic composition in the CRO population of this study, associated with genetic groups BRA, GYR, BON, HOL, BRO, JER and NOR (Figure 4), here, each individual is represented by a vertical line, and the colors represent the fraction of assignment to each genetic group.

Figure 4: Population structure of genotypes of the dual-purpose crossbred (CRO) population and control breeds

BON= Blanco Orejinegro, BRA= Brahman, GYR= Gyr, HOL= Holstein, JER= Jersey, NOR= Normande, PAR= Brown Swiss (BRO), MEZ= Crossbred (CRO).

The HOL, GYR and BRA breeds had the highest breed proportion in the CRO population. The ADMIXTURE analysis made it possible to determine more clearly the breed composition of the study herd compared to the PCA analyses. However, certain herds exceptionally showed abundant breed compositions for certain breeds, such as BON.

1015

Rev Mex Cienc Pecu 2021;12(4):1008-1024

Table 1 shows breed composition by herd, based on information generated from the ADMIXTURE analysis. The contribution of HOL, GYR and BRA breeds to composition of CRO was found to be 23.47 %, 21.43 % and 21.05 % respectively. Other breeds such as BON (12.41 %) and BRO (10.15 %) contributed to a lesser extent, and the NOR and JER breeds showed the lowest contribution of all control breeds with 6.51 and 4.96 % respectively. HOL, GYR and BRA breeds were predominant in the phenotypic and molecular observations of CRO population, but the estimation of their contribution to the gene pool of crossbred population improved considerably when molecular analyses were u sed. Table 1: Percentages of breed conformation of dual-purpose crossbred (CRO) cattle with respect to control breeds Herd* ACA CLN CUM MES SJA VLL Overall total

BRO 10.99 9.70 19.12 12.93 7.03 3.04 10.15

GYR 23.41 36.07 15.52 18.14 22.58 14.58 21.43

JER 2.84 4.08 10.04 3.36 5.94 2.87 4.96

BRA 16.65 14.39 18.96 28.92 18.12 25.76 21.05

BON 6.33 3.58 8.54 5.62 6.29 41.07 12.41

HOL

NOR

32.18 28.05 22.38 25.05 28.02 9.41 23.47

7.59 4.13 5.42 5.98 12.01 3.29 6.51

BRO= Brown Swiss, GYR= Gyr, JER= Jersey; BRA= Brahman, BON= Blanco Orejinegro, HOL= Holstein, NOR= Normande. *Herd: ACA= crossbred herd of the municipality of Acacías, CLN= crossbred herd of the municipality of Castilla La Nueva, CUM= crossbred herd of the municipality of Cumaral, MES= crossbred herd of the municipality of Mesetas, SJA= crossbred herd of the municipality of San Juan de Arama, VLL= crossbred herd of the municipality of Villavicencio

Similarly, the use of molecular markers allowed quantifying the proportion of other breeds whose contribution by phenotype is less predictable. For example, the high presence of the Colombian Creole breed BON was identified in VLL (41.07 %); presence of the BRO breed in CUM (19.12 %), MES (12.93 %) and ACA (10.99 %), while NOR stood out in SJA (12.01 %) and JER in CUM (10.04 %) as shown in Table 1.

Apparent phenotypic predominance (APP) vs Genotypic breed assignment (GBA)

When the three genetic groups generated by the apparent phenotypic predominance-APP (PREDTAU, PREDCEB and PREDINTER) were compared with the breed compositions generated by the genotypic breed assignment-GBA, it was found that the animals assigned to the PREDTAU group (37 % of the study population) presented a wide 1016

Rev Mex Cienc Pecu 2021;12(4):1008-1024

variation of their breed composition obtained by GBA. The breed groups used as controls in GBA, in the breeds, they ranged from a minimum of 0.1 % to a maximum of 80 %, the highest assignment value was found in the BON breed, followed by BRO and HOL, however, the GYR breed also showed a considerable proportion (Table 2).

Table 2: Maximum individual genotypic breed assignment (GBA), with respect to the breed groups assigned by apparent phenotypic predominance (%) APP groups* BRO

GYR

JER

BRA

BON

HOL

NOR

PREDCEB 35.78 PREDINTER 44.42 PREDTAU 65.16

84.27 60.41 65.40

34.57 15.39 53.46

71.66 58.34 52.73

18.34 88.07 80.01

53.34 56.09 64.86

14.26 34.84 33.49

BON= Blanco Orejinegro, GYR= Gyr, NOR= Normande, BRA= Brahman, JER= Jersey, HOL= Holstein, BRO= Brown Swiss. *APP= apparent phenotypic predominance, PREDCEB= with predominance Bos taurus indicus, PREDTAU= with predominance Bos taurus taurus, PREDINTER= with intermediate predominance Bos taurus taurus x Bos taurus indicus.

For their part, animals cataloged in PREDCEB (34 % of the study population) showed a variability in breed composition, mainly for the breeds related to the Bos taurus indicus group, with values ranging from a minimum of 0.1 % to a maximum of 84.2 %, the maximum assignments in the GYR and BRA breed stood out, and even the considerable assignment found for HOL stands out (Table 2). For animals grouped in PREDINTER (29 % of the study population), whose predominant breed assignment presents greater difficulty, they showed great variability for both Bos taurus indicus breeds and Bos taurus taurus breeds according to GBA. Breed assignment values ranged from 0.1 % to 88 % for BON and HOL breeds and relevant assignment values in GYR and BRA breeds (Table 2). In this way, the discrepancies between the phenotypic and genotypic assignment of individuals were evident.

Discussion Phenotypic assessment

The information derived from visits to farms and provided by producers gives an idea of constant environmental, health and economic situations that transform day by day the livestock farming in Colombia. In CRO, the abundant proportion found of breeds historically associated with milk production (e.g. Holstein and Brown Swiss) and more recently Gyr breed recognized for its capacity for milk production, rusticity and fertility

1017

Rev Mex Cienc Pecu 2021;12(4):1008-1024

throughout tropical and subtropical areas(16) are directly associated with the finding of more productive animals with adaptation to the environment. As has been established, a proportion greater than 50 % of B. taurus taurus, especially by Holstein, Brown Swiss and Jersey dairy breeds, is associated with higher milk production and a lower reproductive response in tropical environments, while a higher proportion of B. taurus indicus, especially of Brahman and Gyr breeds, is associated with a higher adaptation and higher reproductive rates than B. taurus taurus, without ignoring the factors clearly related to animal management(17,18). Under this premise, producers have promoted the crossbreeding of animals, but without an orientation of animal resource management, without technical criteria and sometimes without knowledge of the breed purity of breeders(19). As a result of these practices, in this study, it was observed that the total ignorance of crossbreeding can reach up to a 23.8 % of the animals in their herds. Groups generated by APP showed some symmetry between the PREDTAU, PREDCEB and PREDINTER groups, only a slight deviation was observed in PREDTAU (+3 %). This makes evident the intention of the producer to maintain the breed proportions between the genetic groups established by APP, to better use the hybrid vigor between the most common breeds B. taurus taurus and B. taurus indicus for milk production and at the same time of beef in a traditional dual-purpose system. The APP approach was an initial approach to the understanding of the various crosses of defined breeds(12), and obeys breed characterization protocols, which provide information to genotypic analyses based on molecular markers(20). The wide range of crosses and the predominance of the phenotype B. taurus indicus found in CRO is well argued in the constant search to complement the components of higher milk production generally given by dairy breeds of genus B. taurus taurus, such as Holstein, Brown Swiss, among others, and take advantage of the adaptation of animals B. taurus indicus or existing creoles of herds of the dual-purpose system in the Orinoquia(21). Principal component analysis shows the high genetic variability of the population and that it reduces the correspondence with the proposed APP groups. This translates into a wide margin of error when designing the mating strategy, where more accurate genotypic or genealogical information of the ancestors that conform each individual, and therefore in each herd, is required(22). Similarly, the principal component analysis with control breeds showed the high degree of crossbreeding between B. taurus taurus and B. taurus indicus. The considerable number of control breeds used in this study show the complex genetic relationship in dual-purpose herds in the study region and may be an indicator of what happens in the genetic management of dual-purpose herds in Colombia. Other studies present the same characteristic, such as those reported for crossbred herds in East Africa, where the studied population showed a similar spectrum of crossbreeding between Bos taurus taurus and Bos taurus indicus but without the presence of the Gyr breed(23).

1018

Rev Mex Cienc Pecu 2021;12(4):1008-1024

Genotypic breed designation

The relatively low definition of population structure obtained by principal components for CRO population clearly evidences crossbreeding events. These results are due to genealogical monitoring, limited use of records and crossings without clear orientation. In fact, a relationship in the cline of individuals is observed in projection of PC1 (Figures 2). Allele frequency of CRO animals is expected to be intermediate with respect to animals Bos taurus taurus and Bos taurus indicus(10). However, production systems tend to form crossed animals without control of breed proportions, guided to the search a greater degree of adaptation to the environmental conditions of the region, reproductive efficiency and milk production(18,19). When known genetic groups were included in the analyses (Figure 3), it was possible to project the genetic structure of populations and it allowed establishing the composition of CRO, with the location at the extremes of genetic groups B. taurus taurus being evident, made up of breeds: HOL, JER, BRO, NOR and BON and genetic group B. taurus indicus made up of the breeds: GYR, BRA, since the production system is focused on looking for better cataloged animal for milk and beef production. The wide variability observed in principal component analyses (PC1; Figure 3) coincides with the distribution observed in studies with dual-purpose crossbred herds in Africa(23). The abundant proportion of the breeds HOL, GYR and BRA found in the study population through ADMIXTURE analyses evidences to use of breeding bulls of origin B. taurus taurus with greater affinity for milk production (Holstein) and of origin B. taurus indicus (Brahman and Gyr) with affinity for beef and milk production(24). However, there are herds with particular cases where the contribution B. taurus taurus can come from other breeds of European origin such as Brown Swiss, Normande, Jersey and Creole breeds such Blanco Orejinegro, even despite their apparent lower tolerance to the warm tropics, certain local breeds can meet the hybridization needs with B. taurus indicus breeds(25). The predominant breed proportions may vary by herd, region or country, depending on the availability of breeders (seminal material and live animals), orientation and herd base(8) as evidenced by studies in crossbred herds in East Africa, where the largest composition of herds was given by Holstein, Friesian (Tanzania and Ethiopia) and Ayrshire (Kenya) breeds, while the Nelore breed was common to all three countries(23). Diversity in the management of dual-purpose cattle herds in Colombia has generally been associated with extensive management, with limited record of productive information of animals, which has further undermined problems to establish biotypes or crosses that provide greater heterosis and therefore the best productive performance(24,26), in this sense, genotypic approaches are decisive to know the breed composition and to cement bases for understanding of productive and adaptive performance of herd.

1019

Rev Mex Cienc Pecu 2021;12(4):1008-1024

Proposed phenotypic grouping (PPG) vs Genotypic breed assignment (GBA)

The proposed phenotypic grouping (PPG) partially helped the breed designation of 71 % of the animals in the PREDTAU and PREDCEB groups, therefore, it could be used as a guiding tool in the management of crossings or a strategy for genetic improvement(27). However, the orientation of the 29 % of animals classified as PREDINTER is complex, requiring the animals to have a defined phenotype B. taurus taurus and B. taurus indicus. The wide range observed in PREDTAU (0.1 to 80 %), PREDCEB (0.1 to 84.2 %) and PREDINTER (0.1 to 88 %) for the individual breed assignment made visible how the GBA approach favors the correct definition of breed composition, even when detecting a considerable proportion for the Gyr breed (65.4 %) in PREDTAU, a group where the proportion of breeds B. taurus indicus is presumed to be minimal, or HOL (53.3 %) in PREDCEB, where a minimum portion of B. taurus taurus breeds is expected. On the other hand, the portion that presents the greatest difficulty, such as PREDINTER, revealed that both genetic groups B. taurus taurus (BON and HOL) and B. taurus indicus (GYR and BRA) reached maximum values greater than 50 %. As suggested by studies in Brangus animals and in terminal crosses between Angus, Charolais and Hereford, the genotypic approach contributed precision to correct definition of maximum composition for the Angus breed(22) and terminal crosses(28). Consideration of an APP classification requires that animals exhibit the phenotypic traits of breeds, or that they show a phenotypic structure with combined traits. However, although individuals present a similar phenotype, it is possible to find allele differences associated with other characteristics of interest, such as carcass yield, milk production, beef and milk quality(29). A wide divergence between the APP and GBA methods was observed when they were compared with each other, a wide and varied range of genetic contribution (determined by GBA) of various breeds was found (0.1 % to 88.9 %), which exposes the erroneous interpretations to which the management of a herd has been submerged when this is limited to the perspective of their appearance, contrary to what happens in hybridizations oriented by genealogical information, as is the case of animals for beef production, seeking balance in genetic compositions and better exploiting hybrid vigor(22). Likewise, it is known that not all phenotypic changes can be attributed to genetic changes. Some differences in hair color can be attributed to non-genetic factors such as age, intensity of solar radiation or by the combination of genetic and non-genetic factors(28). This is the reason why it is possible to observe differences in phenotypic and genotypic correspondence, and it is here that genotypic evaluations gain great value for their contribution in the accuracy of determinations and an additional tool for orientation of mating schemes more in line with reality(22,25) and that contribute to improving productive indicators by cutting time to achieve the objectives of the producer, by allowing the latter to early identify and select animals whose breed composition diverges

1020

Rev Mex Cienc Pecu 2021;12(4):1008-1024

from the established goals, in other words, making the productive system more profitable(22). The definition of breeds that contribute the most to composition of crossbreeding in each herd gives an idea of orientation it has received, therefore, it is the faithful indicator of productive indicators in a herd whose focus include milk and beef production(23). Previous reports suggest that genotypic predictions have allowed effectively correcting erroneous assignments based on genealogical information of crossbred cattle(9). On the other hand, genotypic breed assignment incorporates elements of demography of populations and allows defining management and conservation strategies both in terms of population(30) and in management of allele frequencies for genes of productive interest associated with growth, carcass quality, milk quality, reproduction and adaptation to the tropics(9,25).

Conclusions and implications The knowledge of the producers and the APP approach (PREDTAU, PREDCEB and PREDINTER) contributed to partially elucidate the breed composition of a crossbred herd of dual-purpose cattle and on the genetic management that a herd has in search of a balance between the genetic groups B. taurus taurus and B. taurus indicus. However, a wide range of errors was observed under this methodology, so a portion of herd could be misassigned in a certain group and trigger the well-known crossbreeding without orientation. The GBA approach allowed to effectively identifying 7 genetic groups in conformation of CRO herds, thus clearly allowing strengthening conventional methods based on phenotypic assessments, such as APP, to define breed composition of dualpurpose crossbred cattle. The GBA has the capacity to guarantee a wide accuracy in predictions of individual and herd breed composition, with which it could contribute in a safe and profitable way to development of directed mating or crossing strategies that guarantee better use of hybrid vigor with a balance between and that consider their adaptation, recognizing the tropical conditions where this production system is developed, such as the Piedemonte.

Acknowledgments and conflict of interest

The authors thank the Colombian Corporation for Agricultural Research-AGROSAVIA attached to the Ministry of Agriculture and Rural Development of Colombia-MADR for funding this research. To the dual-purpose cattle producers who were part of the project and Molecular genetics Laboratory of the Tibaitatá Research Center for the genomic analyses. This work was part of the project “Integral and participative strategies for

1021

Rev Mex Cienc Pecu 2021;12(4):1008-1024

technological strengthening of the dual-purpose bovine system of Piedmonte Llanero (Phase 1)”. Literature cited: 1. Federación Colombiana de Ganaderos- FEDEGAN. Cifras de referencia del sector ganadero colombiano.2018. https://www.fedegan.org.co/estadisticas/documentosde-estadistica. 2. Ortega LE, Ward RW, Andrew CO. Technical efficiency of the dual-purpose cattle system in Venezuela. J Agr Appl Economy 2007;39:719-733. 3. Pariacote FA. Perspectivas de mejoramiento genético del bovino criollo. En Duran C, Campos R, editores. Perspectivas de conservación: Mejoramiento y utilización de recursos genéticos criollos y colombianos en los nuevos escenarios del mejoramiento animal. Palmira-Valle del Cauca. UN-Palmira. 2008:17-30. 4. Vergara GOD, Flórez MJM, Hernández PMJ, Yaguna GCJ, Manco JC, Barrios RTE, Rico CJ. Efectos raciales, de heterosis y parámetros genéticos para peso al nacer en una población multirracial de ganado de carne en Colombia. Livest Res Rural Develop 2014;26(58). 5. Echeverry ZJ, Salazar RVE, Múnera D. El cruzamiento como estrategia para mejorar la rentabilidad de hatos lecheros. Revista Lasallista de Investigación. 2006, 3 (juliodiciembre):<http://www.redalyc.org/articulo.oa?id=69530209> ISSN 1794-4449. Consultado 25 Abr, 2019. 6. Elzo MA. Evaluación Multirracial de Bovinos en Colombia: desde la genética a la genómica. Departamento de Ciencias Animales, Universidad de Florida, Gainesville, FL. Estados Unidos. 2011. 7. Frankham R, Ballou JD, Briscoe DA. Introduction to conservation genetics. Cambridge, UK: Cambridge University Press; 2002. 8. Gorbach DM, Makgahlela ML, Reecy JM, Kemp SJ, Baltenweck I, Ouma R, et al. Use of SNP genotyping to determine pedigree and breed composition of dairy cattle in Kenya. J Anim Breed Genet 2010;127:348–351. 9. Akanno EC, Chen L, Abo-Ismail MK, Crowley JJ, Wang Z, Li C, Basarab J, et al. Genomic prediction of breed composition and heterosis effects in Angus, Charolais and Hereford crosses using 50K genotypes. Can J Anim Sci 2017;97:431–438. 10. Bolormaa S, Hayes BJ, Hawken RJ, Zhang Y, Reverter A, Goddard ME. Detection of chromosome segments of zebu and taurine origin and their effect on beef production and growth. J Anim Sci 2011;89(7):2050-60. 11.Otero AE, Mosquera AL, Silva CG, Guzmán VJC. El Piedemonte. La Orinoquia de Colombia. Bogotá: Banco de Occidente 2014. ISBN 95896774968.

1022

Rev Mex Cienc Pecu 2021;12(4):1008-1024

12.Villasmil IW, Aranguren-Méndez JA. Clasificación fenotípica en vacas mestizas. En: González-Stagnaro C, Soto-Belloso E, editores. Manual de Ganadería Doble Propósito. Maracaibo-Venezuela: Ediciones Astro Data, S.A; 2005;8(1):283-290. 13. Li Y, Levran O, Kim J, Zhang T, Chen X, Suo Ch. Extreme sampling design in genetic association mapping of quantitative trait loci using balanced and unbalanced casecontrol samples. Sci Rep 2019;9:15504. https://doi.org/10.1038/s41598-019-51790w. 14. R Core Team R: A language and environment for statistical computing. R Foundation for Statistical Computing 2014: Vienna, Austria. http://www.R-project.org/. 15. Alexander DH, Novembre J, Lange K. Fast model-based estimation of ancestry in unrelated individuals. Genome Res 2009;19(9):1655-1664. 16. Neves HHR, Carvalheiro R, Fries LA, Queiroz SA. Uso combinado de sêmen sexado e acasalamento dirigido sobre uma população de bovinos de corte submetida a seleção: estudo de simulação. Rev Brasileira Zoot 2009;38:2368-2374. 17. Perdomo-Carrillo D, Perea F, Soto-Belloso E, Piña-Monsalve J, Moratinos-López P, Martínez-López M, Perea-Brugal M. Efecto de la raza paterna sobre el desempeño productivo de un rebaño de vacas mestizas doble propósito en Venezuela. Maskana 2017;8:141-143. https://publicaciones.ucuenca.edu.ec/ojs/index.php/maskana/article/view/1509 18. Zambrano R, Santos H, Contreras R, Moreno A, Chirinos Z. Características productivas de un rebaño mestizo bovino doble propósito comercial en Venezuela. Actas Iberoam Conserv Anim 2013;3:15-19. 19. Galeano AP, Manrique C. Estimación de parámetros genéticos para características productivas y reproductivas en los sistemas doble propósito del trópico bajo colombiano. Rev Facultad Med Vet Zoot 2010;57(II):119-131. 20. FAO. Food and Agriculture Organization of the United Nations. Phenotypic characterization of animal genetic resources. FAO Animal Production and Health Guidelines. Rome. 2012. 21.Salamanca-Carreño A, Vélez TM, Bentez MJ. Efectos no genéticos sobre la reproducción en vacas mestizas con predominio Bos indicus en el municipio de Arauca, Colombia. Rev Invest Vet Perú 2017;28(1):101-109. https://doi.org/10.15381/rivep.v28i1.11749. 22. Wang Y, Wu X-L, Li Z, Bao Z, Tait RG Jr, Bauck S, Rosa GJM. Estimation of genomic breed composition for purebred and crossbred animals using sparsely regularized admixture models. Front Genet 2020;11:576.

1023

Rev Mex Cienc Pecu 2021;12(4):1008-1024

23. Strucken EM, Al-Mamun HA, Esquivelzeta-Rabell C, Gondro C, Mwai OA, Gibson JP. Genetic tests for estimating dairy breed proportion and parentage assignment in East African crossbred cattle. Genet Sel Evol 2017;49(1):67. doi.org/10.1186/s12711-017-0342-1. 24. Cortés H, Aguilar C, Vera R. Sistemas bovinos doble propósito en el trópico bajo de Colombia. Modelo de simulación. Arch Zootec 2003;52:25-34. 25. Ahmad SF, Panigrahi M, Chhotaray S, Pal D, Parida S, Bhushan B, Gaur GK, et al. Revelation of genomic breed composition in a crossbred cattle of India with the help of Bovine 50K BeadChip. Genomics. 2020; 112(2):1531-1535. doi: 10.1016/j.ygeno.2019.08.025. Epub 2019 Aug 28. PMID: 31472242. 26. Ramírez-Toro EJ, Ocampo-Gallego RJ, Burgos-Paz WO, Elzo MA, MartínezSarmiento RA, Cerón-Muñoz MF. Estimación poligénica y genómico-poligénica para características de crecimiento en ganado Blanco Orejinegro (BON). Livest Res Rural Develop 2019;31:30. 27. Aranguren-Méndez J, Román R, Villasmil-Ontiveros Y. Evaluación genética de la ganadería mestiza doble propósito en Venezuela. XX Reunión ALPA, XXX Reunión APPA-Cusco-Perú. Arch Latinoam Prod Anim 2007:15(Supl 1):241-250. 28. Akanno EC, Chen L, Abo-Ismail MK, Crowley JJ, Wang Z, et al. Genomic prediction of breed composition and heterosis effects in Angus, Charolais, and Hereford crosses using 50K genotypes, Can J Anim Sci 2017;97(3):431-438. 29. Orgogozo V, Morizot B, Martin A. The differential view of genotype-phenotype relationships. Front Genet 2015;6:179. 30. Gobena M, Elzo MA, Mateescu RG. Population structure and genomic breed composition in an Angus–Brahman crossbred cattle population. Front Genet 2018; 9:90. https://doi.org/10.3389/fgene.2018.00090.

1024

https://doi.org/10.22319/rmcp.v12i4.5796 Article

Relationships between seasonality, body characteristics and leptin at the beginning of puberty in Bos taurus taurus and Bos taurus indicus heifers in the Mexican tropics

Carlos Hernández-López a René Carlos Calderón-Robles b Alejandro Villa-Godoy c Ángel Ríos-Utrera d Sergio Iván Román-Ponce e Everardo González-Padilla c*

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal. Querétaro, México. b

INIFAP. Campo Experimental Las Margaritas, Puebla, México.

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México. d

INIFAP. Campo Experimental La Posta. Veracruz, México.

INIFAP. Campo Experimental La Campana. Chihuahua, México.

* Corresponding author: ever@unam.mx

1025

Rev Mex Cienc Pecu 2021;12(4):1025-1044

Abstract: The study analyzed, in two years, the effects of breed [Brahman (BHM; n= 65); Braunvieh (BR; n= 56)], supplementation with Zilpaterol® (ZIL; treated or control), season of birth (spring or autumn) and their interactions on body surface (BS), age (APB), body weight (WPB), body condition (BC), long dorsal muscle (DM) depth, dorsal fat (DF) thickness and serum leptin concentration (LEP) at puberty (PB) of 121 heifers. At PB, BMHs were heavier and older than BRs (376.8 ± 7.4 vs 302.0 ± 6.6 kg; 588.1 ± 14.7 vs 445.5 ± 12.5 days). ZIL increased APB, WPB, BC and DM, but did not affect DF and LEP. BHMs had 18 % more BS than BRs. However, the difference in WPB/BS was only 6.4 %. When metabolic weight (MW) was used as a proportion of BS (MW/BS) instead of WPB, the difference between BHM and BR disappeared (P>0.05). The DF was 63.7 % higher in BHM than in BR. Those born in spring started PB with 24.4 % less DF than those born in autumn. Most of the BHM heifers (73.8 %) started PB in the months when light hours were increasing (P<0.05), while in BRs, the beginning of PB was uniformly distributed throughout the year, regardless of the length of light hours; this effect was present in the two years of study. It is concluded that the establishment of puberty is a multifactorial phenomenon; seasonality affects BHM and BR differently and, apparently, BS is an important factor, probably associated with efficiency in energy use. This paper reiterates the importance of dorsal fat and documents, for the first time, MW/BS and its association with the establishment of puberty. Key words: Puberty, Body surface, Seasonality, Tropical cattle, Leptin.

Received: 04/09/2020 Accepted: 03/09/2021

Introduction

Among the most important determinants for the establishment of puberty in heifers for beef production are age(1), height and body weight(2), with marked differences between breeds. In tropical conditions, production systems with Bos taurus taurus, Bos taurus indicus cattle and their crosses are currently common, and the overall production and productivity of the beef production system depends on the reproductive performance of breeding herds. The prepubertal stage of heifers is a cost factor and age at first calving is an important indicator of the reproductive performance of the herd. Zebu heifers (Bos taurus indicus) require more age and weight to reach puberty than Bos taurus taurus(3). This fact has been highlighted as

1026

Rev Mex Cienc Pecu 2021;12(4):1025-1044

a limiting factor for the reproductive success of Bos taurus indicus breeds(4). Age at puberty is closely related to the weight and body composition of animals(5). There are complex interactions between different hormones for the establishment of puberty(6) and the importance of leptin is highlighted for its association with fat accumulation, since it participates in the regulation of food intake, and is a good dynamic indicator of body condition and nutritional status in ruminants(7). Circulating concentrations of leptin have been reported to increase during pubertal development in heifers(8). The available information suggests that there is a critical level of fat required for the start of reproductive activity(9) and that there may be differences in this critical fat limit between breeds(10), implying that conditions must exist to regulate the accumulation of excess energy in the form of body fat. Although several factors are known to affect the establishment of puberty in heifers, there is little literature on the interactions between these and, particularly, on the differences between B. taurus taurus and B. taurus indicus, especially if it is consider the seasonality factor, which is associated with Zebu cattle(3,11,12). Based on the above, the present study aimed to determine the association between some markers of body composition, the internal environment of animals and those of the external environment, with the establishment of puberty in B. taurus taurus and B. taurus indicus heifers, fed individually to have similar weight gains, born in different seasons of the year, with a different body composition, induced during their growth.

Material and methods Localization

The study was carried out in the Las Margaritas experimental station, dependent on INIFAP, located in Hueytamalco, Puebla, Mexico, at 19º 51’ 03” NL and 97º 12’ 48” WL, at 500 m asl. The climate is semi-warm humid subtropical Af(c), with average annual temperature of 20.8 °C, average annual rainfall of 3,000 mm and relative humidity of 90 %.

Treatments

The study was repeated for two years; in total, 121 heifers from two seasons of birth were used: 24 Braunvieh (BR) and 33 Brahman (BHM) born in spring (May 4 ± 36 d), and 32 BR and 32 BHM born in autumn (October 27 ± 35 d). Half of the heifers of each breed and

1027

Rev Mex Cienc Pecu 2021;12(4):1025-1044

season-year received one of two treatments: 1) with the β-agonist Zilpaterol hydrochloride (ZIL, Zilpaterol®); 0.15 mg/kg from 220 to 300 kg of body weight and 0.25 mg/kg from 301 kg of body weight until the first ovulation, mixed in the concentrate, and 2) without β-agonist (control). PB for this study was defined as the first ovulation that preceded the first estrous cycle with the formation of a corpus luteum of normal duration (≥ 12 ≤ 17 d), corresponding to a regular estrous cycle (21 ± 4 d)(13).

General handling

The heifers entered the study at around seven months of age. They were housed individually in pens of 4 × 6 m, with cement floor, asbestos roof (4 × 3 m), feeder and water trough. For their adaptation to handling and sampling routine, heifers were introduced to pens approximately 30 d before the study, halter broken (2 h/day) and brushed manually. The feed consisted of free access to fresh chopped cane (Saccharum sinense) and commercial concentrate (18 % crude protein and 70 % TDN), in amounts adjusted individually after each weighing of the heifers to obtain similar weight gains between animals. For practical reasons, it was decided to name all females indistinctly “heifers” from the beginning until their exit from the experiment.

Estimation of development parameters and body composition

The animals were weighed every 14 days, after removal of feed and water for 18 h. Every 21 days, the body condition (1 to 9; 1= very thin, 9= obese)(14) was recorded, which was rated independently by three people, and the average of these ratings was used as a response variable. Body surface was measured every 48 days, with a counter adapted to a roller instrument to measure the surface of the trunk (odometer); in addition, a tape measure was used to determine the surface of limbs, head, ears and tail. To ensure the reproducibility of the measurements, the odometer was validated by independent measurement of 10 animals, by three people on three occasions in the same day. The intraclass correlation coefficient of the individual measures and the means were 0.96 and 0.98 (P<0.0001), respectively, and a reliability of 0.98 in Cronbach’s Alpha(15) was obtained. The area measured with the odometer was established with the circumference of the tires, the distance between them and the number of turns. To calculate the body surface (BS), the following formula was used: BS= 2 (a + l + m + e) + t + h, where: a= area measured with the odometer, l= leg area, m= forelimb area, e= ear area,

1028

Rev Mex Cienc Pecu 2021;12(4):1025-1044

t= tail area and h= head area. The general measurements, made with tape measure, were entered into an Excel database and validated in the same way as the odometer, obtaining an intraclass correlation coefficient of 0.99 for the individual measures and the average (P<0.0001). The thickness of the dorsal fat (DF) and the depth of the long dorsal muscle (DM) were measured, obtaining images with an ultrasound (equipped with a 3.5 MHz transducer) on the left side of the back, 12 cm from the midline, at the level of the twelfth rib, after hair removal of the area and application of gel(16). The measurements were made every 14 days, coinciding with the weightings of the animals throughout the study. DM measurements correspond only to heifers of the second year of experimentation.

Blood collection and hormone measurement

At the beginning of the study, to confirm the prepubertal state of the heifers by means of serum progesterone, a blood sample was collected from each animal for five consecutive days, by puncture of the jugular vein with needle and vacuum tubes without anticoagulant. Subsequently, samples were collected four times a week until each heifer reached 230 kg of body weight. From that moment, the sampling was daily until the end of the study, which was when the beginning of puberty (PB) was determined, confirmed with the identification of the first ovulation by ultrasound. The samples were processed to obtain serum, which was frozen at -20 °C until the progesterone (P4) concentration was determined by radioimmunoassay (RIA). The P4 concentration was used as confirmation of the prepubertal state (values < 1 ng/ml) of the heifers. Serum leptin concentration (LEP) was assessed with ruminant-specific RIA(17). Serum leptin concentrations were quantified from samples taken four times a week from the start of the experiment. Once the beginning of PB was identified, the last 12 samples prior to the first ovulation were selected, from which the average value of the serum leptin concentration at puberty was obtained; the data obtained were only from the heifers of the second year of experimentation.

Ultrasonography of ovarian structures

Once the hand could be inserted through the rectum of the heifers, approximately at 230 kg and 10 mo of age, ultrasonographic images of the ovaries were taken to identify the first ovulation; initially, twice a week and then daily. For this, a Sonovet equipment was used, with a 7.5 MHz rectal transducer and a video recorder. The first ovulation was considered the first day that luteal tissue was detected preceded by the sudden disappearance of the dominant follicle, the foregoing corroborated with serum P4.

1029

Rev Mex Cienc Pecu 2021;12(4):1025-1044

Variables

The response variables were the values at PB of: age (APB; days), body weight (WPB; kg), metabolic weight (MW; body weight elevated to the power 0.75; kg), BS (m2), body condition (BC; points), DF (cm), DM (cm), body weight between body surface (WPB/BS; g/cm2), metabolic weight between body surface (MW/BS; g/cm2) and serum leptin concentration (LEP; ng/ml). The variables WPB/BS and MW/BS were generated to know how many grams of metabolically active tissue there were for each square centimeter of skin, which is an organ that participates in the regulation of body temperature and can act as a heat energy diffuser.

Statistical analyses Data were analyzed by analysis of variance and Pearson’s correlation. The design was a completely randomized one with a 2×2×2 factorial arrangement. The preliminary statistical model included the main effects of breed (BD), season of birth (SB) and treatment (with or without β-agonist), the double and triple interactions between these effects, the body weight of entry to the experiment as a covariate and, as a block, the group of entry to the experiment (animals grouped according to the date and exact year of study) nested in BD x SB. The final statistical model included the main effects and the block. In addition, for APB and BC, the model included body weight at the start of the experiment; the BD x SB interaction was only included in the definitive BC analysis. To analyze LEP, an analysis of covariance of serum leptin concentrations was performed on the days from the start of the study to the start of PB, including the fixed effects of BD, SB and treatment. The differences between means were determined with the PDIFF option, all this with the GLM procedure of SAS (18). A homogeneity test was performed with a Chi-square to observe the effect of seasonality at the PB of the heifers, using the categorical variables BD and SB, with respect to the light hours (increasing or decreasing) at PB.

Results Correlations between variables Regardless of the breed of heifers, a high correlation between WPB and APB (r= 0.86; P<0.01) was found, as well as between BS and APB (r= 0.84; P<0.01). Likewise, BS was 1030

Rev Mex Cienc Pecu 2021;12(4):1025-1044

correlated with WPB and MW (r= 0.90; P<0.01). For LEP and WPB, a low correlation was observed (r= 0.28; P<0.01), as well as for LEP and BS (r= 0.37; P<0.01). An intermediate correlation was observed for the variables MW/BS and DF (r= 0.52; P<0.01). The covariate weight of the heifers at the beginning of the experiment was only significant for APB (P<0.01) and BC (P<0.05). An effect of the BD x SB interaction on BC (P<0.05) was found. In addition, there was a linear relationship (P<0.01) of LEP with respect to the days elapsed until PB, with 35 pg/ml more LEP for each day that puberty approached.

Effect of breed on variables related to puberty At PB, BHM heifers were 74.8 kg heavier than BRs (P<0.0001), an age-related difference, as BHM required 142.6 d more than BRs for PB to occur (P<0. 0001; Table 1). BHM heifers had 0.64 m² (18 %) more BS than BRs (P<0.0001), while the WPB/BS ratio was 6.4 % higher (P<0.001) in BHMs; this difference disappeared when the comparison was made based on MW/BS. BHM heifers showed 0.4 % more (P<0.05) BC than BRs (7.72 vs 7.69 points) at PB. The most obvious difference was in DF, where BHMs showed 64 % more DF at PB than BRs (P<0.0001). Coinciding with the above, BHM heifers had 20 % more (P<0.0001) LEP at PB than BRs. Table 1: Least squares means and standard errors for puberty response variables, for breed and treatment effects Variable WPB, kg

MW, kg APB, days BS, m2 WPB/BS, g/cm2 MW/BS, g/cm2 BC, 1 to 9 DM, cm* DF, cm LEP, ng/ml*

Breed Brahman 376.77 ± 7.42a 85.34 ± 1.29a 588.13 ± a 14.71 4.22 ± 0.07a 8.99 ± 0.11a

Treatment Braunvieh Control 301.97 ± 320.47 ± b a 6.59 6.25 b 72.32 ± 1.15 75.57 ± 1.09a 445.51 ± 490.29 ± b a 12.48 11.96 b 3.58 ± 0.06 3.79 ± 0.05a b 8.45 ± 0.10 8.48 ± 0.09a

Zilpaterol 358.27 ± 6.42b 82.09 ± 1.12b 543.35 ± b 12.42 4.00 ± 0.06b 8.97 ± 0.10b

Average 339.37 ± 6.78 78.83 ± 1.18 516.82 ± 13.08 3.90 ± 0.06 8.72 ± 0.10

2.05 ± 0.02a

2.03 ± 0.02a

2.01 ± 0.02a

2.07 ± 0.02b

2.04 ± 0.02

7.72 ± 0.06a 5.86 ± 0.10a 2.39 ± 0.07a 3.30 ± 0.10a

7.69 ± 0.05b 4.69 ± 0.10b 1.46 ± 0.06b 2.75 ± 0.09b

7.56 ± 0.05a 4.95 ± 0.09a 1.95 ± 0.06a 2.95 ± 0.09a

7.86 ± 0.05b 5.60 ± 0.09b 1.91 ± 0.06a 3.09 ± 0.09a

7.71 ± 0.06 5.28 ± 0.10 1.93 ± 0.06 3.02 ± 0.09

WPB=body weight; MW= metabolic weight; APB= age; BS= body surface; WPB/BS= body weight between body surface; MW/BS= metabolic weight between body surface; BC= body condition; DM= depth of the long dorsal muscle; DF= thickness of dorsal fat; LEP= serum leptin concentration. *Results of the second year. a,b Means with different literal between columns of each fixed effect in each of the response variables indicate difference (P<0.05).

1031

Rev Mex Cienc Pecu 2021;12(4):1025-1044

Effect of treatment on variables related to the beginning of puberty

Treatment with ZIL had a significant (P<0.01) effect on WPB; animals that received ZIL required 37.8 kg more body weight to begin PB. As for APB, they took 53 d longer than the untreated ones (P<0.05); in addition, their BS and WPB/BS were 7.0 (P<0.001) and 6.0 % higher (P<0.05), respectively. The BC and DM at PB of the animals supplemented with ZIL was 4.0 % and 13.1 % higher (P<0.001) than that of those in the control group, respectively. On the contrary, there was no significant (P>0.05) difference between the two groups with respect to DF and LEP.

Effect of the season of birth on variables related to the beginning of puberty

Heifers born in spring had 0.42 cm less DF than heifers born in autumn (P<0.05). For LEP, at PB, 0.46 ng/ml more was found in heifers born in autumn than in those born in spring (P<0.001). BS was higher in those born in spring, while WPB/BS and MW/BS were lower (P<0.05) in heifers born in spring (Table 2). Table 2: Least squares means and standard errors for puberty response variables, for the season of birth effect Season of birth Variable Spring Autumn WPB, kg 342.49 ± 6.55a 336.25 ± 7.44a MW, kg 79.38 ± 1.14a 78.28 ± 1.29a a APB, days 533.19 ± 12.42 500.46 ± 14.51a BS, m2 4.04 ± 0.06a 3.75 ± 0.06b 2 a WPB/BS, g/cm 8.46 ± 0.10 8.98 ± 0.11b MW/BS, g/cm2 1.97 ± 0.02a 2.10 ± 0.02b a BC, 1 to 9 7.68 ± 0.09 7.73 ± 0.06a a DM, cm* 5.32 ± 0.10 5.23 ± 0.10a DF, cm 1.72 ± 0.06a 2.14 ± 0.07b a LEP, ng/ml* 2.79 ± 0.10 3.25 ± 0.09b WPB= body weight; MW= metabolic weight; APB= age; BS= body surface; WPB/BS= body weight between body surface; MW/BS= metabolic weight between body surface; BC= body condition; DM= depth of the long dorsal muscle; DF= thickness of dorsal fat; LEP= serum leptin concentration. *Results of the second year. a,b Means with different literal between columns of each fixed effect in each of the response variables indicate difference (P<0.05).

1032

Rev Mex Cienc Pecu 2021;12(4):1025-1044

Effect of breed x season of birth interaction on body condition

BR heifers born in spring had lower BC than BR heifers born in autumn and BHMs born in spring (P<0.05) but were similar to BHMs born in autumn (Figure 1). Figure 1: Least squares means and standard errors for body condition (BC) at puberty, by breed and season of birth

BHM= Brahman, BR= Braunvieh. Different literals (a,b) between means indicate difference (P<0.05).

It was observed that 48 of the 65 BHM heifers started PB in the months in which light hours increased (December 22 to June 21) and the other 17 heifers did so in the months in which light hours decreased (June 22 to December 21) (P<0.05). On the contrary, BR heifers began PB regardless of the trend of change of the photoperiod, as 30 of them began PB when light hours increased and another 26 did so when light hours decreased (P>0.05).

Discussion The present study provides relevant information on the relationships between markers of body composition, the internal environment of animals and those of the external environment with the establishment of puberty in heifers. The relationship of the establishment of PB with body characteristics such as the amount of fat and BS is highlighted; for the latter, the difference shown between breeds (17.8 %) reduced when incorporating WPB/BS (6.4 %) in the analysis, but disappeared when considering MW/BS (<1 %; P>0.05), which suggests that

1033

Rev Mex Cienc Pecu 2021;12(4):1025-1044

more than BS itself, the important indicator is the relationship of body mass with BS, regardless of breed, despite the clear and significant (P<0.05) differences at PB in the rest of the variables studied between BHM and BR. To a large extent, the differences in several body characteristics between BHM and BR at PB could be associated with the fact that PB in BHM occurred with 4.6 mo more in age, a period in which they continued to grow and modify their body composition, however, there was no difference in the MW/BS ratio at PB, which suggests that this is an important parameter; if it is not a trigger, it is at least indicative that there is an energy balance that allows covering the demand for vital functions, thermoregulation, locomotion, growth, and there is a surplus to be allocated for reproductive processes(19). The treatment with zilpaterol to half of the animals to induce a different body composition between them and those of the control group allowed observing that, despite the differences at PB in terms of the variables weight, age and body characteristics, due to the treatment, DF and LEP did not show differences between the ZIL and control groups, which highlights the importance of body composition and, in particular, the amount of body fat for the establishment of PB. It has been reported that in the growth and composition of the carcass, there is a large variation between B. taurus taurus(20,21) and B. taurus indicus(22). Likewise, there are differences in the distribution of body fat between breeds; dairy breeds deposit a higher proportion of their fat internally and a smaller proportion subcutaneously than beef breeds(23). These differences, regardless of environmental factors, apparently participate in the maturation processes so that individuals are chronologically different between breeds(24), with the consequent variation in age at first calving, which is a variable of economic importance. The estimated age at the PB of Zebu cattle in the tropics and subtropics ranges widely between 16 and 40 mo(25) and, consequently, the age at first calving is also very variable due to the effect of environmental variables, with the access of feed to the animals standing out, which in grazing conditions depends on conditions such as rainfall, the quality and fertility of soils and forage species in use, particularly in tropical conditions, so that the study of physiological phenomena, such as the establishment of puberty and seasonal effects on reproductive processes, require the control of variables such as quantity and quality of feeding, which can confuse the results. For that reason, for this work the animals were individually fed so that they all had a similar daily gain. The overall average daily weight gain was 560 ± 121 g/d. At PB, BHM heifers were heavier and older than BR; in fact, those 142 d of difference implied that BHM had on average 74.8 kg more (in congruence with the average weight gain of the heifers during the study), however, due to the difference in BS, there was no difference in MW/BS between the two breeds. A correlation of 0.96 (P<0.01) between WPB and BS was observed. Other researchers(26-28) have reported that B. taurus indicus heifers require 1034

Rev Mex Cienc Pecu 2021;12(4):1025-1044

greater weight and age to begin PB than B. taurus taurus heifers. In addition, it has been described(29) that, in Nelore heifers, a good post-weaning feeding is an effective method to accelerate PB. Among B. taurus indicus breeds, Nelore, which is the one that apparently has fewer flaps and folds of skin and, therefore, less body surface, has had greater popularity in Brazil, apparently, due to its better productive performance, particularly, greater precocity to begin PB(29) and lower age at first calving(30,31); however, no studies that specifically linked these reproductive characteristics to the BS of animals were found. The importance of the relationship between body surface and mass in the energy cost of maintenance of animals has been recognized and considered for more than a century; in fact, among the initial studies on basal metabolism, it was discussed that BS was as important or more important than body mass(32). In studies conducted with rodents, canines, cattle and humans, it was observed that BS is a variable that allows the most accurate prediction of metabolic rate(33). Therefore, it was considered as the variable that allowed, with greater precision, the comparison between animal species of different sizes in quantitative metabolism studies(34), which promoted the development of instruments for its measurement(35). No studies specifically designed to associate the BS of cattle with some productive characteristics were found; in previous studies(36,37), the BS of dairy cows and its relationship with body weight were measured, for the use of a formula based on “Kleiber’s Law” in bioenergetics studies. It has been estimated that at a higher BS, the loss of body heat by radiation, convection and evaporation(38) increases, conditions that imply an energy cost. It has been evaluated that from birth, as the body mass of the animal increases with growth, its relative proportion to body surface also increases, and the relative dissipation of body thermal energy reduces, gradually allowing more energy available for physiological processes and the storage of surpluses. Among those physiological processes not fundamental to sustain the life of the individual is reproduction, which becomes feasible once the energy available in the organism guarantees the processes indispensable for life and other priorities such as locomotion. This requires a balance between the energy that is consumed and processed and that which accumulates in tissues, to then be transformed into work or dissipated into the environment as caloric energy; in the latter function, skin and respiration play a central role in cattle(19). In the case of B. Taurus indicus cattle, their greater adaptation to hot climates, such as tropical ones, is due to their superior ability to regulate body temperature during heat stress conditions, derived from a lower metabolic rate and greater ability to dissipate heat through the skin(39). It should be remembered that animals that have a higher proportion of Zebu genes show smaller size of their thoracic and abdominal organs, such as rumen weight and length of intestines than B. taurus taurus animals(40,41). It has been observed that the basal metabolic rate in B. taurus indicus x B. taurus taurus is less than in B. taurus taurus. In one study, the

1035

Rev Mex Cienc Pecu 2021;12(4):1025-1044

rate of heat produced per unit body surface of non-lactating and fasting cows was 57 MCal/m2 for Red Sindhi x Holstein and 100 MCal/m2 for Holstein(42). From a practical point of view, a larger skin surface in Zebu, on the one hand, confers advantages (heat dissipation and resistance to thermal stress), but, apparently, it is associated with lower efficiency in the use of food energy(38), growth rate(39) and accumulation of energy in the form of body fat(43,44), which is an important factor for PB, as reiterated in the results of this work, where, despite the use of zilpaterol, which promoted faster growth, puberty was reached at an older age, with greater weight and musculature in the treated heifers, but with similar DF between controls and treated. Supplementation with β-agonist ZIL caused APB to increase, and the control heifers to be younger at PB. The administration of ZIL modifies the distribution of nutrients, so that animals grow faster and gain more weight, but this gain is leaner(45,46). For the beginning of PB, not only is absolute weight gain of heifers important but also body mass composition(47-49), as subtle or acute changes in metabolic state are likely to begin physiological events leading to puberty(5,50). Hence, although those treated with ZIL reached with more weight and APB, they were not different from those of the control group in DF, despite the fact that the latter were lighter and with less DM, which was one of the assumptions of the study on the effect of β-agonists in the distribution of nutrients, causing decreased lipogenesis and increased muscle accretion, as observed by several authors, who have reported that ZIL supplementation increased DM and decreased DF in cows(51), heifers(52) and steers(53). The available information indicates that a minimum of body fat is required to trigger reproductive processes such as PB in heifers(9) and a minimum of BC(54). In a study(55) conducted on Nelore heifers, high correlations (from 0.82 to 0.93) between BC and DF were found, and it was stated that with BC, DF can be predicted in B. taurus indicus cattle at different stages of the production cycle. In a study with B. taurus taurus cows(56), it was observed that an increase in BC tended to be accompanied by an increase in the size of adipocytes in subcutaneous adipose tissue. It was observed that B. taurus indicus animals needed more fat accumulation than B. taurus taurus to begin PB, which can be induced by feeding higher energy diets. In this study, in both breeds these relationships were modified by the use of β-agonist ZIL; since the heifers treated were more muscular and had higher BC and more DM at PB, as expected(5), but there was no difference with those of the control group in DF at PB. It is evident that in BHM, above the internal markers related to weight and body composition, a seasonality effect associated with light changes prevailed; therefore, an effect of BD on APB and differences between breeds in the months of occurrence of PB were observed. The seasonality effect was manifested in that BR heifers started PB homogeneously throughout 1036

Rev Mex Cienc Pecu 2021;12(4):1025-1044

the year, but 73.8 % of BHM heifers started PB in the months when light hours were increasing and only 26.2 % did so when light hours decreased (P<0.05). In fact, the effect of seasonality is manifested on other variables, as shown in Table 2, where the differences in variables that was found as critical for the beginning of PB, such as MW/BS, DF and LEP, remained in animals born in different seasons. The observation of the effect of seasonality on PB in BHM coincides with that described by other authors(3), who observed that BHM heifers only started puberty in a period from February to May (days in which light hours increase), unlike Brown Swiss heifers that began puberty throughout the year. This effect was attributed to the susceptibility of BHM heifers to the environmental effects determined by the seasons of the year (seasonality). These observations coincide with results of other studies with Zebu females(11,12,57), where a seasonal trend in the postpartum reproductive activity of cows was observed, even under controlled feeding conditions. The photoperiod seems to influence the beginning of puberty. In an experiment with dairy heifers, supplemental lighting (16 h of light/day) during the winter improved growth rates and reduced age to puberty(58). Similarly, with B. taurus taurus heifers, supplemental lighting (18 h of light/day), after 22 or 24 wk of age, reduced the age to puberty in heifers born from February to July. These photoperiod effects were accompanied by changes in ovarian development(59). The same author(60) points out that heifers with a genetic propensity to reach puberty at an early age may be affected by the season of birth differently than those who reach puberty at older ages. Compared to BR heifers, BHM heifers were more susceptible to environmental signals from the change of light hours, which probably triggered the neuroendocrine processes associated with the beginning of PB, a situation that should be considered in the planning of reproductive management programs for cattle in herds with a diverse breed composition. The effect of the season of birth influenced that heifers born in autumn had higher DF and higher levels of LEP at PB than those born in spring, but there were no differences (P>0.05) in APB between seasons of birth under the conditions of this study. Interaction of BD x SB on BC was observed at puberty, where BR heifers born in spring showed lower BC than BR heifers born in autumn and BHMs born in spring. Based on general averages (not shown here, they can be consulted in a previous study(61)), apparently, the heifers of lower APB (BHMs born in spring and BRs born in autumn) reached with greater BC (Figure 1), although the differences in this variable were minimal. In this regard, several authors have suggested that there is a phenomenon of compensation of age with weight for the establishment of PB(49,62,63). It has been reported that in Bos taurus taurus cows(56), there is a positive correlation of leptin with body weight and BC; in addition, an increase in BC tended to be accompanied by an increase in the size of adipocytes in subcutaneous adipose tissue. In the present study, LEP at PB was different between breeds; BHM heifers showed higher LEP than BRs. This 1037

Rev Mex Cienc Pecu 2021;12(4):1025-1044

difference in LEP between breeds may be due to the fact that the BHMs were the ones that also presented the greatest age and amount of DF at PB, since the circulating levels of leptin are directly associated with body adiposity(64,65). So far there is no evidence of an abrupt transition in prepubertal plasma concentrations of leptin at puberty or that circulating concentrations may be a critical trigger for PB in fast-growing heifers, but apparently a minimum of circulating leptin is required for PB in heifers with normal or restricted growth rates(66).

Conclusions and implications It is concluded that body mass as a proportion of BS appears to have an important role in the beginning of PB in heifers and that a minimum mass of metabolically active tissues per unit of BS and a minimum of fat accumulation are required for the beginning of PB to be triggered, regardless of the breed in question. The establishment of puberty is a complex phenomenon, which depends on the interaction between variables and internal markers of animals and other factors in their environment, such as changes in light hours, which affect Zebu heifers. The observations derived from this work allow speculating that the late puberty of BHM heifers may be associated with a higher BS compared to BR heifers and confirms the effect of changes in light hours on reproductive phenomena in Zebu females, even when the indirect effect of seasonality is eliminated through controlled feeding. This work documents for the first time the relationship of body mass, as a proportion of body surface, with the establishment of puberty in cattle.

Conflict of interest

The authors declare that there is no conflict of interest in the presentation of this work. Literature cited: 1. Day ML, Nogueira GP. Management of age at puberty in beef heifers to optimize efficiency of beef production. Anim Front 2013;3:6-11. 2. Manthey AK, Anderson JL, Perry GA, Keisler DH. Feeding distillers dried grains in replacement of forage in limit-fed dairy heifer rations: Effects on metabolic profile and onset of puberty. J Dairy Sci 2017;100:1-12.

1038

Rev Mex Cienc Pecu 2021;12(4):1025-1044

3. Calderón RRC, Villa-Godoy A, Lagunes LJ. Determinación ultrasonográfica de la primera ovulación: asociación con la primera ovulación de ciclos estrales regulares en vaquillas Cebú y Suizo Pardo mantenidas en el trópico. Téc Pecu Méx 1996;34(2):79-88. 4. Moriel P, Piccolo M, Lancaster PA, Lamb GC, Vendramini J, Arthington JD. Effects of post-weaning plane of nutrition and estrus synchronization on reproductive performance of influenced beef heifers. J Anim Sci 2017;95(4):3523-3531. 5. Hall JB, Staigmiller RB, Bellows RA, Short RE, Moseley WM, Bellows SE. Body composition and metabolic profiles associated with puberty in beef heifers. J Anim Sci 1995;73(11):3409-3420. 6. Gonzalez-Padilla E, Wiltbank JN, Niswender GD. Puberty in beef heifers. I. The interrelationship between pituitary, hypothalamic and ovarian hormones. J Anim Sci 1975;40(6):1091-1104. 7. Foote AP, Tait RG, Keisler DH, Hales KE, Freetly HC. Leptin concentrations in finishing beef steers and heifers and their association with dry matter intake, average daily gain, feed efficiency, and body composition. Domest Anim Endocrinol 2016;55:136-141. 8. Garcia MR, Amstalden M, Williams SW, Stanko RL, Morrison CD, Keisler DH et al. Serum leptin and its adipose gene expression during pubertal development, the estrous cycle, and different seasons in cattle. J Anim Sci 2002;80(8):2158-2167. 9. Pardo AM, Villareal EL, Papaleo MJ, Melucci OG, Santamaría S, Ferrario J et al. Sexual precocity and productivity of beef cattle female under grazing conditions. Anim Prod Sci 2018;59:757-766. 10. Johnston DJ, Barwick SA, Corbet NJ, Fordyce G, Holroyd RG, Williams PJ et al. Genetics of heifer puberty in two tropical beef genotypes in northern Australia and associations with heifer- and steer-production traits. Anim Prod Sci 2009;49:399-412. 11. Lozano DRR, Asprón PMA, González-Padilla E, Vásquez PCG. Estacionalidad reproductiva en vacas Bos indicus en el trópico mexicano. Téc Pecu Méx 1987;2(25):192-205. 12. Villagómez AME, Castillo RH, Villa-Godoy A, Román PH, Vázquez PC. Influencia estacional sobre el ciclo estral y el estro en hembras cebú mantenidas en clima tropical. Téc Pecu Méx 2000;38(2):89-103. 13. Evans ACO, Adams GP, Rawlings NC. Endocrine and ovarian follicular changes leading up to the first ovulation in prepuberal heifers. J Reprod Fertil 1994;100:187-194.

1039

Rev Mex Cienc Pecu 2021;12(4):1025-1044

14. Richards MW, Spitzer JC, Warner MB. Effect of varying levels of postpartum nutrition and body condition at calving on subsequent reproductive performance in beef cattle. J Anim Sci 1986;62:300-306. 15. SPSS Inc. PASW Statistics for Windows, Version 18.0. Chicago: SPSS Inc. 2009. 16. Perkins TL, Green RD, Hamlin KE. Evaluation of ultrasonic estimates of carcass fat thickness and longissimus muscle area in beef cattle. J Anim Sci 1992;70:1002-1010. 17. Delavaud C, Bocquier F, Chilliard Y, Keisler DH, Gertler A, Kann G. Plasma leptin determination in ruminants: Effect of nutritional status and body fatness on plasma leptin concentration assessed by a specific RIA in sheep. J Endocrinol 2000;165:519-526. 18. SAS. Statistical Analysis System Institute Inc, Cary, NC, USA. 2002. 19. Foster DL, Hileman SM. Puberty in sheep. Knobil and Neill´s Physiology of Reproduction. Fourth ed. 2015;1441-1485. 20. Alberti P, Panea B, Sanudo C, Olleta JL, Rpoll G, Ertbjerg P et al. Live weight, body size and carcass characteristics of young bulls of fifteen European breeds. Livest Sci 2008;114:19-30. 21. Clarke AM, Drennan MJ, McGee M, Kenedy DA, Evans RD, Berry DP. Intake, live animal scores/measurements and carcass composition and value of late-maturing beef and dairy breeds. Livest Sci 2009;126:57-68. 22. Thrift FA, Sanders JO, Brown AH, Herring AD, Riley DG, DeRouen SM. Preweaning, postweaning, and carcass trait comparisons for progeny sired by subtropically adapted beef sire breeds at various US locations. The Prof Anim Scientist 2010;26(5):451-473. 23. McGee M, Keane MG, Neilan R, Moloney AP, Caffrey PJ. Production and carcass traits of high dairy genetic merit Holstein, standard dairy genetic merit Friesian and Charolais x Holstein-Friesian male cattle. Irish J Agr Food Res 2005;44:215-231. 24. Black JL. Animal growth and its regulation. J Anim Sci 1988;66:1-22. 25. Nogueira GP. Puberty in South American Bos indicus (Zebu) cattle. Anim Reprod Sci 2004;82-83:361-372. 26. Reynolds WL, de Rouen TM, High Jr JW. The age and weight at puberty of Angus, Brahman and zebu cross heifers [abstract]. J Anim Sci 1963;22:243.

1040

Rev Mex Cienc Pecu 2021;12(4):1025-1044

27. Calderón RRC. Cambios dinámicos de las estructuras ováricas y su relación con la progesterona sérica en becerras peripúberes Bos taurus y Bos indicus, mantenidas en clima tropical [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1994. 28. Pereira GR, Barcellos JOJ, Sessim AG, Tarouco JU, Feijó FD, Neto JB et al. Relationship of post-weaning growth and age at puberty in crossbred beef heifers. Rev Bras Zootec 2017;46(5):413-420. 29. Nepomuceno DD, Pires AV, Ferraz MVC, Biehl MV, Gonçalves JRS, Moreira EM et al. Effect of pre-partum dam supplementation, creep-feeding and post-weaning feedlot on age at puberty in Nellore heifers. Livest Sci 2017;195:58-62. 30. Eler JP, Silva JVA, Ferraz JBS, Dias F, Oliveira NH, Evans JL et al. Genetic evaluation of the probability of pregnancy at 14 months for Nellore heifers. J Anim Sci 2002;80:951-954. 31. Nogueira GP, de Lucia RFS, Pereira FV, Cirilo PD. Precocious fertility in Nelore heifers [abstract]. Biol Reprod 2003;68(Suppl 1):382. 32. Richet C. La Chaleur Animale. Paris, 1889. 33. Kleiber M. Body size and metabolism. Hilgardia 1932;6:315-353. 34. Kleiber M. Body size and metabolic rate. Physiol Rev 1947;4(27): 511-541. 35. Mitchell HH. The effect of the amount of feed consumed by cattle on the utilization of its energy content. J Agric Res 1932;3(45):163-191. 36. Hogan AG, Skouby CI. Determination of the surface area of cattle and swine. J Agric Res 1923;19(25):419-430. 37. Elting ECA. Formula for estimating surface area of dairy cattle. J Agric Res 1926;33(3):269-280. 38. Berman A. Effects of body surface area estimates on predicted energy requirements and heat stress. J Dairy Sci 2003;86(11):3605-3610. 39. Hansen P. Physiological and cellular adaptations of zebu cattle to thermal stress. Anim Reprod Sci 2004;82-83:349-360. 40. Swett WW, Matthews CA, McDowell RE. 1961. Sindhi-Jersey and Sindhi-Holstein crosses: their external form and internal anatomy compared with those of purebred Jerseys and Holsteins. Tech Bull 1961. USDA 1236.

1041

Rev Mex Cienc Pecu 2021;12(4):1025-1044

41. McDowell RE, Wilk JC, Talbott CW. Economic viability of crosses of Bos taurus and Bos indicus for dairying in warm climates. J Dairy Sci 1996;79(7):1292-1303. 42. Johnston JE, Hamblin FB, Schrader GT. Factors concerned in the comparative heat tolerance of Jersey, Holstein, and Red Sindhi-Holstein (F1) cattle. J Anim Sci 1958;17:473-479. 43. Bucholtz DC, Manning J, Herbosa CG, Schillo KK, Foster DL. The energetics of LH secretion: a temporally-focused view of sexual maturation [abstract]. In: Annual Meeting of the Society for Neuroscience, Washington, D.C. 1993;23:349. 44. Frisch RE. Body weight, body fat and ovulation. Trends Endocrinol Metab 1991;2:191– 197. 45. Moloney AP, Beermann DH. Mechanisms by wich β-adrenergic agonists alter growth and body composition in ruminants. In: Enne G, et al, editors Residues of veterinary drugs and mycotoxins in animal products. Pers, Wageningen 1996;124-136. 46. Cônsolo NRB, Rodriguez FD, Goulart RS, Frasseto MO, Ferrari VB, Silva LFP. Zilpaterol hydrochloride improves feed efficiency and changes body composition in nonimplanted Nellore heifers. J Anim Sci 2015;93(10):4948-4955. 47. Maciel MN, Zieba DA, Amstalden M, Keisler DH, Neves J, Williams GL. Recombinant leptin prevents fasting-mediated reductions in pulsatile LH release and stimulates GH secretion in peripubertal heifers [abstract]. Proc Mid West Sect Am Soc Anim Sci 2003;66:263. 48. Arije GF, Wiltbank JN. Age and weight at puberty in Hereford heifers. J Anim Sci 1971;33:401-406. 49. González-Padilla E, Ruíz DR, Wiltbank JN. Inducción y sincronización del estro en vaquillas prepúberes mediante la administración de estrógenos y un progestágeno. Téc Pecu Méx 1975;(1):17-23. 50. Steiner RA, Cameron JL, McNeill TH, Clifton DK, Bremner WJ. Metabolic signals for the onset of puberty. In: Norman RL, editor. Neuroendocrine aspects of reproduction. Academic Press, New York 1983. 51. Lowe BK, Mckeith RO, Segers JR, Safko JA, Froetschel MA, Stewart Jr RL et al. The effects of zilpaterol hydrochloride supplementation on market dairy cow performance, carcass characteristics, and cutability. Prof Anim Scient 2012;28(2):150-157. 52. Rathmann RJ, Bernhard BC, Swingle RS, Lawrence TE, Nichols WT, Yates DA. Effects of zilpaterol hydrochloride and days on the finishing diet on feedlot performance, carcass characteristics, and tenderness in beef heifers. J Anim Sci 2012;90:3301-3311. 1042

Rev Mex Cienc Pecu 2021;12(4):1025-1044

53. Kononoff PJ, Defoor PJ, Engler MJ, Swingle RS, James ST, Deobald HM et al. Impact of a leptin single nucleotide polymorphism and zilpaterol hydrochloride on growth and carcass characteristics in finishing steers. J Anim Sci 2013;91(10):5011-5017. 54. Perry GA. Physiology and endocrinology symposium: harnessing basic knowledge of factors controlling puberty to improve synchronization of estrus and fertility in heifers. J Anim Sci 2012;90(4):1172-1182. 55. Ayres H, Ferreira RM, de Souza Torres-Júnior JR, Demétrio CGB, de Lima CG, Baruselli PS. Validation of body condition score as a predictor of subcutaneous fat in Nelore (Bos indicus) cows. Livest Sci 2009;123(2-3):175-179. 56. Locher L, Häussler S, Laubenthal L, Singh SP, Winkler J, Kinoshita A et al. Effect of increasing body condition on key regulators of fat metabolism in subcutaneous adipose tissue depot and circulation of nonlactating dairy cows. J Dairy Sci 2015;98(2):10571068. 57. Plasse D, Warnick AC, Koger M. Reproductive behavior of Bos indicus females in a subtropical environment. I. Puberty and ovulation frequency in Brahman and Brahman x British heifers. J Anim Sci 1968;27:94-100. 58. Peters RR, Chapin LT, Leining KB, Tucker HA. Supplemental lighting stimulates growth and lactation in cattle. Science 1976;199:911-912. 59. Hansen PJ, Kamwanja LA, Hauser ER. Photoperiod influences age at puberty of heifers. J Anim Sci 1983;57:985-992. 60. Hansen PJ. Seasonal modulation of puberty and the postpartum anestrus in cattle: A review. Livest Prod Sci 1985;12:309-327. 61. Hernández LC. Interacciones entre estacionalidad, características corporales y leptina en el establecimiento de la pubertad en vaquillas Bos taurus taurus y Bos taurus indicus [tesis maestría]. México, CDMX: Universidad Nacional Autónoma de México; 2018. 62. Greer RC, Whitman RW, Staigmiller RB, Anderson DC. Estimating the impact of management decisions on the occurrence of puberty in beef heifers. J Anim Sci 1983;56(1):30-39. 63. Ferreira VCP, Penna VM, Bergmann JAG, Torres RA. Interação genótipo-ambiente em algumas características produtivas de gado de corte no Brasil. Arq Bras Med Vet Zootec 2001;53:385-392. 64. Ehrhardt R. Development of a specific radioimmunoassay to measure physiological changes of circulating leptin in cattle and sheep. J Endocrinology 2000;166(3):519-528.

1043

Rev Mex Cienc Pecu 2021;12(4):1025-1044

65. Geary TW, McFadin EL, MacNeil MD, Grings EE, Short RE, Keisler DH. Leptin as a predictor of carcass composition in beef cattle. J Anim Sci 2003;81(1):1-8. 66. Chelikani PK, Ambrose DJ, Keisler DH, Kennelly JJ. Effects of dietary energy and protein density on plasma concentrations of leptin and metabolic hormones in dairy heifers. J Dairy Sci 2009;92(4):1430-1441.

1044

https://doi.org/10.22319/rmcp.v12i4.5294 Article

Brachiaria grasses in vitro digestibility with bovine and ovine ruminal liquid as inoculum

Luis Carlos Vinhas Itavo a* Camila Celeste Brandão Ferreira Ítavo a Cacilda Borges do Valle b Alexandre Menezes Dias a Gelson dos Santos Difante a Maria da Graça Morais a Claudia Muniz Soares a Camila da Silva Pereira a Ronaldo Lopes Oliveira c

Federal University of Mato Grosso do Sul, Faculty of Veterinary Medicine and Animal Science. Av. Senador Filinto Muller, 2443. Vila Ipiranga. CEP 79070-900 Campo Grande, MS, Brazil. b

Brazilian Corporation of Agricultural Research - Embrapa Beef Cattle. Campo Grande, MS. 79106-550, Brazil. c

Federal University of Bahia, Faculty of Veterinary Medicine. Salvador, BA 40170110, Brazil.

*Corresponding author: luis.itavo@ufms.br

Abstract: It was hypothesized that it is possible that inoculum from different ruminant species with different digestive abilities feeding from a certain forage may show different feed utilizations comparing to other ruminant species. Five Brachiaria grasses were evaluated: B. decumbens cv. Basilisk, B. decumbens access D70, B. humidicola cv. Tupi, B. 1045

Rev Mex Cienc Pecu 2021;12(4):1045-11060

humidicola cv. Common, and B. ruziziensis access R124, at two regrowth ages (21 and 42 d). Production, bromatological content, in vitro dry matter digestibility (ivDMD) and in vitro neutral detergent fiber digestibility (ivNDFD) were analyzed using bovine or ovine inoculums. The experiment used a 5 × 2 × 2 factorial design and found significant effects for grass variety and regrowth age. In addition, significant interactions from grass × age on dry matter, crude protein, neutral detergent fiber and acid detergent fiber of total sample and leaf blade were found. There were significant effect of grass variety and grass age on forage mass, leaf blade/stem ratio, leaf blade, stem, senescent material and growth. In vitro digestibility assays of inoculum source showed significant effect in some varieties. Due to differences in in vitro assays, it was recommended the use of speciesspecific inoculums for feed evaluations according to the animal it is intended for. Also, B. decumbens cv. Basilisk presented the best in vitro digestibility (ivDMD and ivNDFD) in bovine inoculum, whereas B. humidicola cv. Tupi had better in vitro digestibility (ivDMD and ivNDFD) in ovine inoculum. Key words: Brachiaria decumbens, Brachiaria humidicola, Brachiaria ruziziensis, digestibility, Rumen inoculum.

Received: 16/03/2019 Accepted: 22/02/2021

Introduction Brachiaria grasses are important because they enable ruminant production in acid soils of low fertility(1). This genus, mainly from tropical and subtropical Africa, is comprised of approximately 100 species, including B. decumbens, B. humidicola and B. ruziziensis, which are widely used as forage sources in tropical America. The evaluation and subsequent recommendation of a specific forage is determined by its ability to support grazing by certain animals of different species or categories and its nutritional value. One of the methods from which its nutritional value that can be inferred is to submit it to in vitro digestibility testing. In vitro is an alternative to in vivo and in situ techniques(2), requiring fewer animals, reducing costs and is a reliable method to evaluate feedstuff digestibility. Nutrient components are closely correlated with the digestibility of forages(3). Through bromatological analysis, it is possible to estimate nutrient components of forages, as well as the cellular content and structural components. These components include crude protein (CP), soluble content and neutral detergent fiber (NDF). 1046

Rev Mex Cienc Pecu 2021;12(4):1045-11060

The in vitro digestibility technique has been widely used in the analysis of different types of feedstuffs provided to ruminants. However, it can be affected by the inoculum source, as well as the previous diet from the donor animal, the fasting time of animal before sampling, and occasionally by flaws in the execution of the technique(4). It is possible that different ruminant species show different digestibility, and when being fed a certain forage they may show better-feed utilization than other ruminant species. Therefore, the aim of this research was to evaluate five Brachiaria grasses of two regrowth ages, submitted to in vitro digestibility assay using two different inoculums (bovine and ovine).

Material and methods Ethical considerations

This study was carried out in strict accordance with the recommendations of the Guide for the National Council for Animal Experiments Control of Brazil. The experiment was approved by the Committee on Ethics of Animal Experiments of the Federal University of Mato Grosso do Sul, Mato Grosso do Sul State, Brazil (Protocol Number: 367/2011).

Location and experimental field of Brachiaria spp. cultivars

This study was carried out at the Federal University of Mato Grosso do Sul in partnership with the Biotechnology Laboratory Applied to Animal Nutrition at Dom Bosco Catholic University and Embrapa Beef Cattle. Brachiaria grasses were evaluated in experimental plots at Embrapa Beef Cattle (latitude 20°27'S, longitude 54°37'W and 530 m altitude, located in Campo Grande, MS, Brazil). The type of soil in the study area was Dystrophic Purple Latosol alic. The climate according to Köppen & Geiger(5) classification is rainy tropical, AW subtype, characterized by a well-defined occurrence of a dry period during the colder months of the year (April–September) and a rainy season during the summer months (October– March) with an average annual rainfall of 1,469 mm and an average annual temperature of 23 °C. Forages were evaluated during two consecutive summers (December–February), which is the rainy season in the Brazilian Cerrado, due to the seasonality of the forages. The experimental area consisted of 20 plots (experimental units, four plots/cultivar), 1047

Rev Mex Cienc Pecu 2021;12(4):1045-11060

measuring 4.0 × 4.0 m (16 m2). The plots were cut at 5 cm above the ground in order to standardize them for evaluation. Five cultivars of Brachiaria grasses were evaluated in each plot: B. decumbens cv. Basilisk; B. decumbens access D70; B. humidicola cv. Tupi; B. humidicola cv. Common and B. ruziziensis access R124. Each plot was divided into two parts, to be cut with 21 and 42 d of regrowth. Forage samples were collected by cutting at 5 cm from the ground inside a square 0.5 × 0.5 m (0.25 m2) and sampled with five repetitions from the four plots of each cultivar, obtaining a composite sample from each forage.

Forage mass and growth determination

After forages were sampled, each was wrapped in a plastic bag and identified. In the laboratory they were weighed and divided into two parts: one to be processed as total sample and the other separated into leaf blade, stem and dead material(6). Forage mass was estimated by the square method, with the quantification of forage, on a dry matter basis, sampled inside the 0.5 × 0.5 m square converted to metric ton (1,000 kg) per hectare (t ha–1). The leaf blade/stem ratio was obtained by dividing the mass of the leaf blades by the mass of the stems(7). The vegetative canopy growth was determined at six different points in each experimental unit, which were marked for measurement according to the different growth ages evaluated(7).

Forage chemical composition

After sampling and separating into total sample, leaf blade, stem and dead material, materials were pre-dried at 55°C for 72 h and ground to 1 mm with a Wiley Mill (Tecnal, Piracicaba City, São Paulo, Brazil) then stored in hermetic plastic containers (ASS, Ribeirão Preto City, São Paulo, Brazil) until analysis. Dry matter (DM) content (Method 967.03, AOAC(8)) and CP content (Method 981.10, AOAC(8)) were determined. For the determination of the NDF and acid detergent fiber (ADF) content, the methodology of Van Soest et al(3) was used with modifications proposed in the ANKOM device manual (ANKOM Technology Corporation, Macedon, New York, USA).

1048

Rev Mex Cienc Pecu 2021;12(4):1045-11060

In vitro dry matter digestibility (ivDMD) and in vitro neutral detergent fiber digestibility (ivNDFD)

The total samples (all canopy structures) of the different varieties of Brachiaria grasses of two regrowth ages (21 and 42 d) were submitted to in vitro tests, incubated with bovine or ovine rumen liquid (inoculum). The bovine inoculum was collected from three Nellore × Angus crossbred cattle and the ovine inoculum from five Dorper × Suffolk crossbred sheep, already fitted with ruminal silicon cannula and adapted to forage diet. The in vitro digestibility of nutrients was determined according to the methodology of Tilley and Terry(9) adapted for the ANKOM Daisy system (ANKOM Technology Corp., Macedon, NY, USA) as described by Holden(10). Bags of non-woven fabric containing samples of Brachiaria grasses were placed on jars (with a limit of 30 bags per jar, two of them blanks) containing approximately 1.6 L of buffer solution(11). Bovine or ovine ruminal liquid (400 ml) was then added and purged CO2 in the jars. The jars remained incubated with shaking at a constant temperature of 39 °C for 48 h, after which 40 ml of HCl (6 N) and 8 g of pepsin were added to each jar and left for another 24 h. When the incubation was finished, the jars were drained and the bags washed with distilled water and dried at 105 ºC for 16 h. They were then weighed to determine the post-incubation DM and submitted to NDF analysis(3) with adaptation of ANKOM device manual (ANKOM Technology Corp., Macedon, NY, USA). The in vitro digestibility (ivD) coefficients for DM (ivDMD) and NDF (ivNDFD) were obtained through the equation: ivD (g/kg) = [(incubated nutrient, g) – (residual nutrient, g – blank, g)] / (incubated nutrient, g) × 1,000.

Statistical analysis

All data were analyzed using the statistical package SAS® (SAS® Inst. Inc., Cary, NC, USA), and the means were compared using Tukey’s test with a significance level of P<0.05, and tendency considered at P<0.10. To evaluate bromatological composition, production and regrowth of grasses, the following statistical model was used: Yijkl = µ + Ai + Gj + AGk + eijkl where µ is the general average, Ii is the effect of the i-th age (21, 42), Gj is the effect of the j-th grass (1,…, 5), IGk is the effect of interaction of i-th age with j-th grass, 1049

Rev Mex Cienc Pecu 2021;12(4):1045-11060

eijkl is the random error. To compare the values of ivD of DM and NDF carried out with different inoculums, the following statistical model was used: Yijkl = µ + Ii + Gj + IGk + eijkl where µ is the general average, Ii is the effect of the i-th rumen inoculum (1, 2), Gj is the effect of the j-th cultivar (1,…, 5), IGk is the effect of interaction of i-th rumen inoculum with j-th cultivar, eijkl is the random error.

Results Forage mass and growth determination

The forage mass and growth parameters are presented in Table 1. There was a significant effect (P<0.05) on forage mass from variety and age, leaf blade/stem ratio, leaf blade, stem, senescent material and growth. In addition, there was significant grass × age interaction (P≤0.0001) for all variables. The variety that presented the highest forage mass at 21 d was B. humidicola cv. Common, and at 42 d it was B. ruziziensis access R124 (8.86 and 12.81 g kg–1, respectively; P=0.0001). A lower leaf blade/stem ratio was observed in B. humidicola cv. Common at 21 and 42 d (0.51 and 0.30, respectively; P=0.0001) with similarity among the other grasses. However, the highest leaf blade/stem ratio at 21 d was observed in B. humidicola cv. Tupi (1.21 ratio; P=0.0001), whereas U. decumbens access D70 presented the highest ratio at 42 days of regrowth (1.51; P=0.0001). For stem results, B. humidicola cv. Common had significantly high values at 21 and 42 d of age (448.8 and 656.8 g kg–1, respectively; P=0.0001). In the production of senescent material in the studied varieties, the highest amount was observed for B. decumbens access D70 with 42 d of regrowth (684.8 g kg–1; P=0.0001), and at 21 d B. decumbens cv Basilisk had numerically the highest value, close to B. decumbens access D70 (389.0 and 385.7 g kg–1, respectively). In contrast, B. humidicola cv. Common and B. humidicola cv. Tupi had numerically the lowest senescent material at 21 d (220.2 and 276.3 g kg–1, respectively).

1050

Rev Mex Cienc Pecu 2021;12(4):1045-11060

The growth parameter was significant (P=0.00001) with highest growth shown by B. ruziziensis access R124 at 42 d (28.2 cm) and the lowest by B. humidicola cv. Common at 21d (11.6 cm).

Forage chemical composition

In relation to chemical composition, there was significant effect (P<0.05) from variety of grass and growth age on DM, CP, NDF and ADF in all sample types (total sample, leaf blade and stem; Table 2). Also, there was a significant grass × age interaction (P<0.05) for DM, CP, NDF and ADF in all samples, except DM and NDF from stem material, which showed no significant interaction (P>0.05), but a trend for NDF (P= 0.0985).

1051

Rev Mex Cienc Pecu 2021;12(4):1045-11060

Table 1: Forage mass, leaf blade/stem ratio (LB:S), stem, Senescent material and growth of different varieties of Brachiaria grasses at different cutting ages B. decumbens B. decumbens B. humidicola B. humidicola B. ruziziensis P-value CV cv. Basilisk access D70 cv. Common cv. Tupi access R124 (%) 21 d 42 d 21 d 42 d 21 d 42 d 21 d 42 d 21 d 42 d Grass Age G×A -1 Mass, t ha 6.18 4.58 6.13 5.75 8.86 8.21 7.69 5.21 7.31 12.81 36.54 0.0001 0.0001 0.0001 LB:S ratio 0.81 1.21 1.11 1.51 0.51 0.30 1.21 1.11 0.91 1.01 24.31 0.0001 0.0001 0.0001 Leaf blade, g 0.0001 0.0001 238.1 364.9 319.3 198.4 238.5 131.1 409.7 406.5 306.3 215.0 21.32 0.0001 kg-1 Stem, g kg-1 270.4 294.3 303.3 125.0 448.8 656.8 343.9 325.6 334.4 212.3 29.17 0.0001 0.0001 0.0001 Senescent, g 0.0001 0.0001 389.0 449.8 385.7 684.8 220.2 321.3 254.7 276.3 367.6 581.1 25.58 0.0001 -1 kg Growth, cm 20.7 24.2 15.1 17.1 11.6 18.2 12.1 14.1 20.7 28.2 25.90 0.0001 0.0001 0.0001 CV = Coefficients of variation (%).

1052

Rev Mex Cienc Pecu 2021;12(4):1045-11060

Table 2: Chemical composition of the total plant, leaf blade and steam samples of different Brachiaria grasses at different regrowth ages B. decumbens cv. Basilisk

B. decumbens access D70

B. humidicola cv. Common

B. humidicola cv. Tupi

B. ruziziensis access R124

21 d

42 d

21 d

42 d

21 d

42 d

21 d

42 d

21 d

42 d

480.6 925.9 47.53 743.8 498.4

324.7 940.4 67.8 702.3 483.8

398.4 922.7 54.9 798.0 541.5

444.3 943.6 49.4 669.3 505.8

564.6 907.2 42.6 772.5 510.8

402.9 939.3 47.2 701.9 497.5

433.2 902.7 31.3 769.4 557.7

398.3 929.9 58.3 572.8 425.5

424.8 922.5 61.9 710.4 542.9

0.19 0.29 9.01 9.20 3.29

0.0001 0.9431 0.0001 0.0001 0.0001

0.0001 0.0347 0.0001 0.0001 0.0001

0.0001 0.8609 0.0001 0.0465 0.0001

416.7 899.5 93.7 608.0 367.6

392.7 926.7 138.9 600.0 288.8

497.3 896.6 104.9 668.4 298.9

422.8 919.0 80.2 580.3 290.8

518.3 883.0 39.6 624.3 303.4

388.8 921.6 62.2 726.9 307.0

460.1 886.4 49.5 810.9 384.7

425.8 945.7 117.3 652.2 357.5

489.0 885.0 144.2 700.7 351.9

0.332 0.26 16.02 3.71 4.95

0.0001 0.8885 0.0001 0.0001 0.0001

0.0001 0.0007 0.0001 0.0001 0.0001

0.0009 0.8312 0.0001 0.0001 0.0001

402.8 924.7 36.9 804.1 457.1

421.0 931.5 55.5 766.9 412.9

464.1 926.2 44.6 788.5 442.7

383.8 948.0 31.3 821.3 445.3

449.1 934.9 48.7 811.9 442.1

336.1 939.0 31.2 822.4 432.1

415.8 932.0 31.7 884.6 476.7

406.2 924.7 50.1 774.4 484.4

463.0 921.4 49.5 821.99 486.1

0.33 0.34 5.08 1.32 2.69

0.0001 0.8324 0.0001 0.0001 0.0001

0.0001 0.4687 0.0214 0.0074 0.0119

0.1240 0.9986 0.0001 0.0985 0.0089

Total plant TDM 299.1 OM 941.2 CP 59.8 NDF 676.3 ADF 437.0 Leaf blade DM 378.9 OM 924.5 CP 102.3 NDF 513.0 ADF 305.1 Stem samples DM 353.4 OM 934.1 CP 37.6 NDF 798.2 ADF 463.0

CV= Coefficients of variation (%).

1053

CV (%)

P-value Grass

Age

P G×A

Rev Mex Cienc Pecu 2021;12(4):1045-11060

Comparing regrowth ages of total sample, forages at 21 d of regrowth showed lower values of DM, NDF and ADF (P<0.05); however, they presented higher CP values. As expected, CP from leaf blades was higher than from stem samples. The CP of leaf blades of B. ruziziensis R124 at 42 d of regrowth showed the highest amount (144.2 g kg–1; P<0.05) B. humidicola cv. Tupi presented higher NDF and ADF values for leaf blades at 42 d of regrowth (769.4 and 557.7 g kg–1, respectively; P<0.05). The highest stem NDF values were also presented by B. humidicola cv. Tupi (884.6 g kg–1; P<0.05). High ADF values were also observed for B. humidicola cv. Tupi and B. decumbens cv. Basilisk (384.7 and 367.6 g kg–1, respectively; P<0.05).

In vitro dry matter digestibility (ivDMD) and in vitro neutral detergent fiber digestibility (ivNDFD) There was no significant interaction (P>0.05) between inoculum and grasses. It was observed that ovine inoculum vs bovine inoculum resulted in higher ivDMD values for B. decumbens cv. Basilisk at 21 d (611.2 vs 571.9 g kg–1; P=0.0200), B. humidicola cv. Tupi at 21 d (631.8 vs 568.4 g kg–1; P=0.0370), and B. ruziziensis access R124 at 21 d (548.8 vs 613.4 g kg–1; P=0.0420; Table 3). When evaluating only bovine inoculum, B. humidicola cv. Tupi and B. ruziziensis access R124 at 42 d of regrowth showed the lowest ivDMD values (544.3 and 542.0 g kg–1, respectively; P=0.0078). When evaluating only ovine inoculum, B. ruziziensis access R124 at 42 d also presented the lowest ivDMD (535.0 g kg–1; P=0.0184). Table 3: In vitro dry matter digestibly (ivDMD) of different varieties of Brachiaria grasses at different regrowth ages incubated with bovine or ovine rumen liquid (g kg-1) Rumen inoculum CV Age P-value Bovine Ovine (%) 21 571.9 ABb 611.2 ABa 0.96 0.0200 B. decumbens cv. Basilisk AB ABC 42 612.9 575.5 1.48 0.0520 AB AB 21 583.4 599.2 2.85 0.1235 B. decumbens access D70 BC BC 42 558.6 550.7 2.12 0.1354 B B 21 515.9 574.3 2.86 0.0650 B. humidicola cv. Common ABC AB 42 593.2 598.8 1.30 0.1845 ABb ABa 21 568.4 631.8 2.09 0.0370 B. humidicola cv. Tupi C ABC 42 544.3 577.6 1.81 0.0820 ABb ABa 21 548.8 613.4 3.30 0.0420 B. ruziziensis access R124 C C 42 542.0 535.0 0.07 0.2002 CV, % 2.564 1.972 P-value 0.0078 0.0184 Mean values with different capital letters in the same column or lowercase letters superscript differ (P<0.05) based on Tukey’s test. CV= Coefficients of variation. 1054

Rev Mex Cienc Pecu 2021;12(4):1045-11060

Regarding the ivNDFD, as presented on Table 4, ovine resulted in higher values than bovine inoculum on B. humidicola cv. Common at 21 d of regrowth (420.3 vs 369.5 g kg–1; P=0.0040), and B. humidicola cv. Tupi at 42 d (490.8 vs 452.4 g kg–1; P=0.0270). However, on B. decumbens cv. Basilisk at 42 d, the opposite was seen: ovine inoculum resulted in lower ivNDFD values than bovine (413.9 vs 472.4 g kg–1; P=0.0150). Table 4: In vitro neutral detergent fiber digestibility (ivNDFD) of different varieties of Brachiaria grasses at different regrowth ages incubated with bovine or ovine rumen liquid (g kg-1) Rumen inoculum Age CV(%) P-value Bovine Ovine 21 436.8 A 439.1 9.75 0.3542 B. decumbens cv. Basilisk Aa b 42 472.4 413.9 1.64 0.0150 A 21 482.7 487.7 5.76 0.1423 B. decumbens access D70 A 42 445.7 412.5 4.87 0.2540 ABb a 21 369.5 420.3 0.84 0.0040 B. humidicola cv. Common A 42 443.4 458.7 1.30 0.1210 A 21 458.4 510.3 3.62 0.0970 B. humidicola cv. Tupi Ab a 42 452.4 490.8 1.35 0.0270 B 21 212.2 455.7 70.20 0.4080 B. ruziziensis access R124 A 42 427.6 424.0 15.53 0.0870 CV, % 25.333 4.622 P-value

0.0044

0.1562

Mean values with different capital letters in the same column or lowercase letters superscript differ (P<0.05) based on Tukey’s test. CV= Coefficients of variation.

There was no effect (P>0.05) on ivNDFD from cultivar and regrowth age when the samples were incubated with ovine inoculum; however, the highest values were observed for B. humidicola cv. Tupi at 21 and 42 d (510.3 and 490.8 g kg–1, respectively). When using bovine inoculum only the variety B. ruziziensis access R124 at 21 d presented ivNDFD values below the others (P=0.0044). At 21 d of regrowth the varieties that presented the higher values (P=0.0044) were B. decumbens cv. Basilisk, B. decumbens access D70, B. humidicola cv. Common and B. humidicola cv Tupi, B. decumbens access D70 being highlighted numerically, with the highest mean value. At 42 d B. decumbens cv. Basilisk, B. decumbens access D70, B. humidicola cv. Common, B. humidicola cv. Tupi and B. ruziziensis access R124 had statistically the highest values (P=0.0044), highlighting B. decumbens cv. Basilisk numerically with the highest mean.

1055

Rev Mex Cienc Pecu 2021;12(4):1045-11060

Discussion The stoloniferous habit of B. humidicola, with strong nodes branching into new plants, favors a high residue during the standard cut of forage for regrowth evaluation(12). The large root system results in more carbohydrate reserves for more vigorous regrowth, as observed at this study in the higher weight of leaf blade in B. humidicola cv. Tupi and stems in B. humidicola cv. Common (Table 1). It is possible that higher regrowth of leaves is due to the intense turnover of nutrients and an increase in CP in young leaves related to a thinner cell wall(13). However, high stem development in tropical grasses is also due to two other main factors: the low frequency of defoliation and flowering(14). In response to a need to expose the younger leaves to the upper canopy, where light is most abundant, a competition for light may occur between the tillers forcing them to elongate their stems(15,16). B. humidicola grasses presented less senescence material (Table 1), favoring the positive assessment of green leaves, which are of great importance in the nutritional value of a forage. The leaf blades of B. humidicola cultivars are morphologically thinner (0.5–0.8 cm width) than those of B. decumbens (average 1.5 cm width) and B. ruziziensis (1.0–1.5 cm width), providing less shade (less than 65 %). Therefore, they have lower senescence and/or death of the young tillers and old leaves, as previous reported in other studies(6,16,17). The expanding leaf blades, especially those intermediate in the tiller, run a higher path between their connection point with the meristematic region and the end of pseudo-stems and, consequently, reach full size(6). Comparing the ages of regrowth, the sampling dates did not affect significantly the vegetative growth (Table 1). Regarding forage production, it is possible to suggest that B. humidicola cv. Tupi showed the best performance, despite B. decumbens cv. Basilisk having an increased production of leaf blade, stem and senescent material but fewer leaf blades and higher senescent material than the others (P<0.05), which may interfere with nutrient content. Assessing chemical compositions of B. decumbens grasses, this study presented higher CP content at 21 d of regrowth, but at 42 d B. ruziziensis had high CP content (Table 2). Findings of a study(18) evaluating B. decumbens cv. Basilisk and B. ruziziensis cv. Kennedy reported higher CP content, but this may have been due to a different cutting height (10 cm vs 5 cm); when cutting closer to the ground more stem and senescent material may be present in the samples,– but, may also have been due to differences of soil fertility, and others edaphoclimatic conditions where plants were grown. Concerning the fibrous portion of the material, due to NDF consisting of cellulose, hemicellulose, lignin and silica and ADF being the fraction composed of cellulose, lignin and silica, even a slight change in those compounds will alter the NDF and ADF values(19). The NDF and ADF of the total sample from B. decumbens varieties found in this study were lower than observed in another study(20), which quoted values at 30 d of regrowth 1056

Rev Mex Cienc Pecu 2021;12(4):1045-11060

of 832.4 g kg–1 NDF and 462.1 g kg–1 ADF. A study with Brachiaria decumbens(13) obtained mean of 809.0 g kg–1 NDF and 475.0 g kg–1 ADF. These results are closer to our findings with the two B. decumbens varieties at 42 d of regrowth (B. decumbens cv Basilisk 743.8 g kg–1 NDF and 498.4 g kg–1 ADF; B. decumbens access D70 798.0 g kg–1 NDF and 541.5 g kg–1 ADF; Table 2). Plants with fewer structural carbohydrates (waste FDA) are more efficient at nutrient cycling and have beneficial effects on crop yields(21). Taking all bromatological composition parameters into account, at 21 d of regrowth B. ruziziensis access R124 showed the best combination of parameters, with less NDF and ADF (P<0.05) and one of highest values of CP content. However, at 42 d, the variety that had the best bromatological content combination was B. decumbens cv. Basilisk; even with not such a high CP value, it had lower ADF and NDF content and a lower proportion of ADF inside the NDF, which interferes directly with the digestion of a feedstuff and consequently its nutritional value. In vitro digestibility techniques using ovine and bovine inoculums have advantages for a rapid evaluation of feedstuffs, such as the physical and chemical uniformity of the fermentative containers and the convenience of keeping fewer fistulated animals; although they do not perfectly reproduce the process of digestion as do live animals. This could be observed when we compared the results from this study with others that analyzed the same forage in situ or in vivo(12,22,23,24). Furthermore, the ovine ruminal digestibility presented percentages that were 10 to 15 % higher than bovine ruminal fluid (Table 3). However, the prediction ability and applicability of in vitro techniques can depend on the degree of similarity between the technical and ruminant digestive process. In vitro systems use rumen fluid and a standard solution to simulate the anaerobic process of ruminal fermentation(25); the standard solution is typically a buffer solution simulating the saliva of ruminants(11). All grasses presented values higher than the 500 g kg–1 ivDMD, indicated by authors(26) to be a minimum value to qualify them as forage of good nutritional quality and to not compromise animal performance, even given the expected drop in microbial colonization of 0.1 to 0.2 % per day with the increase in the physiological age of the plant (13). As expected, the mean ivNDFD was lower than that of ivDMD (Tables 3 and 4). However, finding no significant difference (P>0.05) between regrowth ages in a few Brachiaria variety contradicts the results of Paciullo et al(27), who found that with the development of the plant during the rest period, metabolites arise from photosynthesis and are converted into structural components. Solubilization of hemicellulose may occur, expansion of the fiber possibly increasing the availability of fermentable substrates, thereby providing suitable conditions for microbial growth and consequently NDF digestibility. The reduction of intermolecular hydrogen bonds and the type of ester bond between the lignin and hemicellulose allows for its release and exposure to attack by rumen bacteria, aside from the possible presence of elevated, readily fermentable carbohydrate content(19). 1057

Rev Mex Cienc Pecu 2021;12(4):1045-11060

Finally, when analyzing the results of ivDMD and ivNDFD and considering the two inoculums, it was possible to observe that in bovine inoculum B. decumbens cv. Basilisk presented the best digestibility at both regrowth ages, while in ovine inoculum B. humidicola cv. Tupi had the best digestibility, also for both ages.

Conclusions and implications The source animal species for inoculum has an effect on in vitro digestibility tests. Therefore, is highly recommended to use a specific inoculum for grass evaluations according to the target species (cattle or sheep). From the obtained results, B. decumbens cv. Basilisk presented the best in vitro digestibility (ivDMD and ivNDFD) in bovine inoculum and also a good combination of nutrient content and increasing production of all its canopy components, whereas B. humidicola cv. Tupi had better in vitro digestibility (ivDMD and ivNDFD) in ovine inoculum and the best production.

Acknowledgments

The authors are grateful to the Universidade Federal de Mato Grosso do Sul; Conselho Nacional de Desenvolvimento Científico e Tecnológico - CNPq, (process n° 563988/2010-0); Fundação de Apoio ao Desenvolvimento do Ensino, Ciência e Tecnologia do Estado de Mato Grosso do Sul - FUNDECT (process 23/200.145/2011), and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior –CAPES (Financing Code 001). They also wish to thank the Brazilian Agricultural Research Center (Embrapa Beef Cattle) for providing the forages. Literature cited: 1. Fernandes LO, Reis RA, Paes JMV, Teixeira RMA, Queiroz DS, Paschoal JJ. Performance of Gir young bull maintained in" Brachiaria brizantha" pastures submitted to different management. Rev Bras Saúde e Produção Anim 2015;16(1):36–46. 2. Medeiros FF, Silva AMA, Carneiro H, Araújo DRC, Morais RKO, Moreira MN, et al. Fontes proteicas alternativas oriundas da cadeia produtiva do biodiesel para alimentação de ruminantes. Arq Bras Med Veterinária e Zootec 2015;67(2):519– 526. 3. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):3583–3597.

1058

Rev Mex Cienc Pecu 2021;12(4):1045-11060

4. Weiss WP. Estimation of digestibility of forages by laboratory methods. Forage Qual. Eval. Util. John Wiley & Sons, Ltd; 1994:644–681. 5. Köppen W, Geiger R. Handbuch der Klimatologie: Das geographische System der Klimate. Berlin: Borntraeger Science Publishers; 1936 vol. 35. 6. Machado LAZ, Fabrício AC, Assis PGG de, Maraschin GE. Estrutura do dossel em pastagens de capim-marandu submetidas a quatro ofertas de lâminas foliares. Pesqui Agropecuária Bras 2007;42(10):1495–1501. 7. Santos MER, da Fonseca DM, Silva GP, Pimentel RM, de Carvalho VV, da Silva SP. Estrutura do pasto de capim-braquiária com variação de alturas. Rev Bras Zootec 2010;39(10):2125–2131. 8. AOAC (Association of Official Analytical Chemists). Official Methods of Analysis 1990;1(Vol 1):552. 9. Tilley JMA, Terry RA. A two-stage technique for the in vitro digestion of forage crops. Grass Forage Sci 1963;18(2):104–111. 10. Holden LA. Comparison of methods of in vitro dry matter digestibility for ten feeds. J Dairy Sci 1999;82(8):1791–1804. 11. McDougall EI. Studies on ruminant saliva. 1. The composition and output of sheep’s saliva. Biochem J 1948;43(1):99–109. 12. Zorzi K, Detmann E, Queiroz AC de, Paulino MF, Mantovani HC, Bayão GF. In vitro degradation of neutral detergent fiber of high-quality tropical forage according to supplementation with different nitrogenous compounds. Rev Bras Zootec 2009;38(5):964–971. 13. Santos EDG, Paulino MF, Queiroz DS, Valadares Filho S de C, Fonseca DM da, Lana R de P. Avaliação de pastagem diferida de Brachiaria decumbens Stapf: 1. Características químico-bromatológicas da forragem durante a seca. Rev Bras Zootec 2004;33(1):203–213. 14. Barbosa RA, Nascimento Júnior D do, Euclides VPB, Silva SC da, Zimmer AH, Torres Júnior RA de A. Capim-tanzânia submetido a combinações entre intensidade e freqüência de pastejo. Pesqui Agropecuária Bras 2007;42(3):329–340. 15. Velásquez PAT, Berchielli TT, Reis RA, Rivera AR, Dian PHM, Teixeira IAMDA. Composição química, fracionamento de carboidratos e proteínas e digestibilidade in vitro de forrageiras tropicais em diferentes idades de corte. Rev Bras Zootec 2010;39(6):1206–1213. 16. Santos MER, Fonseca DM da, Euclides VPB, Nascimento Júnior D do, Queiroz AC de, Ribeiro Júnior JI. Características estruturais e índice de tombamento de

1059

Rev Mex Cienc Pecu 2021;12(4):1045-11060

Brachiaria decumbens cv. Basilisk em pastagens diferidas. Rev Bras Zootec 2009;38(4):626–634. 17. Paciullo DSC, De Carvalho CAB, Aroeira LJM, Morenz MJF, Lopes FCF, Rossiello ROP. Morphophysiology and nutritive value of signalgrass under natural shading and full sunlight. Pesqui Agropecu Bras 2007;42(4):573–579. 18. Moreira EA, Souza SM de, Ferreira AL, Tomich TR, Azevêdo JAG, Souza Sobrinho F de, et al. Nutritional diversity of Brachiaria ruziziensis clones. Ciência Rural 2018;48(2):1–8. 19. Rosa B, Reis RA, De Resende KT, Do Nascimento Kronka S, Jobim CC. Nutritive value of Brachiaria decumbens stapf cv. Basilisk hay submitted to anhydrous ammonia or urea treatment. Rev Bras Zootec 1998;27(4):815–822. 20. Moraes EHBK de, Paulino MF, Zervoudakis JT, Valadares Filho S de C, Moraes KAK de. Avaliação qualitativa da pastagem diferida de Brachiaria decumbens Stapf., sob pastejo, no período da seca, por intermédio de três métodos de amostragem. Rev Bras Zootec 2005;34(1):30–35. 21. Silva AM, Oliveira RL, Ribeiro OL, Bagaldo AR, Bezerra LR, Carvalho ST, et al. Valor nutricional de resíduos da agroindústria para alimentação de ruminantes. Comun Sci 2014;5(4):370–379. 22. Rodrigues ALP, Sampaio IBM, Carneiro JC, Tomich TR, Martins RGR. Degradabilidade in situ da matéria seca de forrageiras tropicais obtidas em diferentes épocas de corte. Arq Bras Med Veterinária e Zootec 2004;56(5):658–664. 23. Costa VAC, Detmann E, Valadares Filho SDC, Paulino MF, Henriques LT, Mantovani HC. Degradação in vitro da fibra em detergente neutro de forragem tropical de baixa qualidade em função de suplementação com proteína e/ou carboidratos. Rev Bras Zootec 2008;37(3):494–503. 24. Mutimura M, Ebong C, Rao IM, Nsahlai IV. Nutritional values of available ruminant feed resources in smallholder dairy farms in Rwanda. Trop Anim Health Prod 2015;47(6):1131–1137. 25. Goering HK, Van Soest PJ. Forage fiber analyses: apparatus, reagents, procedures, and some applications. Agr Res Serv. US Department of Agriculture; 1970. 26. Euclides VPB, Flores R, Medeiros RN, Oliveira MP de. Diferimento de pastos de braquiária cultivares Basilisk e Marandu, na região do Cerrado. Pesqui Agropecuária Bras 2007;42(2):273–280. 27. Paciullo DSC, Gomide JA, Queiroz DS, Silva EAM da. Chemical composition and in vitro digestibility of leaf blades and stems of forages grasses, according to level of insertion on grass tiller, age and season of growth. Rev Bras Zootec 2001;30(3):964– 74. 1060

https://doi.org/10.22319/rmcp.v12i4.5820 Article

Grape pomace silage (Vitis labrusca L. cv. Isabel) on the intake and digestibility of nutrients, nitrogen balance and ingestive behavior of lambs

Fernando Luiz Massaro Junior a Valter Harry Bumbieris Junior a* Ediane Zanin a Elzânia Sales Pereira b Mikael Neumann c Sandra Galbeiro a Odimari Pricila Prado Calixto a Ivone Yurika Mizubuti a

State University of Londrina, Department of Animal Science, Londrina, Paraná, Brazil, 86057-970. b

Ceará Federal University, Department of Animal Science, Ceará, Brazil.

State University of Central-West of Paraná, Department of Veterinary Medicine, Paraná, Brazil.

* Corresponding author: jrbumbieris@uel.br

Abstract: This study investigated the inclusion of grape pomace silage (GPS; 0, 10, 20 and 30%) were evaluated in diets of lambs on nutrient intake and digestibility, nitrogen balance and ingestive behavior. Four lambs of the Santa Inês breed with weight of 21.93 ± 0.87 kg and approximately seven months old, were housed in metabolic cages and distributed in a 4x4 latin square design. The treatments consisted of four diets with the inclusion of 0, 10, 20 and 30% GPS in diets. The nutrient intake was observed an increasing linear behavior for ether extract (EE) intake (P<0.05) according to the increase of EE in the 1061

Rev Mex Cienc Pecu 2021;12(4):1061-1082

diets, caused by content of EE of seeds in GPS. The diets did not differ in the digestibility coefficients of nutrients and nitrogen balance (P>0.05), with average digestibility of dry matter digestibility (DDM) of 678.6 ± 0.62 g kg-1 DM and average retention of 239.78 g kg-1 N ingested of N. The ingestive behavior the diets were influenced (P<0.05) by only the length of time that the animals remained idle in standing. This parameter showed a quadratic behavior with a maximum point estimated at 17.73 % of GPS (P=0.041). In conclusion, the use of GPS can be used until inclusion level of 30 % without negatively affecting the parameters evaluated. Key words: Byproducts of fruits, Behavior, Intake, Digestibility, Lambs, Silage.

Received: 02/10/2020 Accepted: 29/03/2021

Introduction The use of alternative feeds as byproducts that help supply ruminant animal demand for nutrients in times of low pasture supply, mainly during winter or drought periods, arouses the interest of researcher’s different areas, including feeds conserved. The primary sector annually generates tons of organic byproducts with excellent nutrient composition(1) that could be transformed into meat, milk, skin and wool by ruminants(2) and consequently can reduce threats of environmental pollution, since part of this byproduct is improperly stored or discarded in environment. Recent research has suggested partially replacing cereals grains by agricultural byproducts in feed animal(2,3,4), in order to promote more sustainable production. In addition, the use of byproducts of different fonts of raw material may contribute to meet consumer demand, regarding the sustainability of animal production systems and maintaining the integrity of the environment. The use of agricultural and industrial byproducts is present from the production of chemical products to animal feed(1,5). The grape destined for wine industry and juices, for example, generation quantities of byproducts, as pomace and seeds, which offer risks economic and environmental(6). However, this byproduct is an alternative source of fiber, have low commercial cost, chemical composition of quality(7) and has traditionally been incorporated in ewe diets and lambs(8,9,10). Recent study showed the viability for storage in the form of silage, with satisfactory amounts of residual sugars and fibers, which meet the desirable characteristics of feed conserved(11). It is also an alternative for ensure silage throughout the year and proper destination of this byproduct. The use of byproducts evens can contribute with small farms which haven’t areas of lands available for crops intended for the production of traditional silage, as whole corn and forages.

1062

Rev Mex Cienc Pecu 2021;12(4):1061-1082

The use of grape pomace in diets for lambs had showed results considerable on nutritional composition, performance, nutrient consumption and acceptability by animals(10,12,13). Although there are results in the performance of lambs with the inclusion of only grape pomace, the supply of this byproduct in the form of silage and the limitations of the respective levels of inclusion, related to the fiber content and ether extract of the seeds deserve to be investigated, since there is variety in the grape cultivars that can offer different effects qualitative on the silages and performance of animals. Based on this hypothesis, this work was carried out with the objective of evaluating the inclusion 0, 10, 20, 30 % of grape pomace silage (Vitis labrusca L. cv. Isabel) in diets of lamb and its effects on nutrient intake and digestibility, nitrogen balance and behavior ingestive.

Material and methods Experimental animal, handling and diets

The study was carried in the sheep metabolism shed the school farm and Laboratory Animal Nutrition of the State University of Londrina, Paraná, Brazil in the July of 2012. All procedures in this study were conducted according the Ethics Committee on Animal Experiments of this University and approved under the identification number (Protocol nº 78/10). Four lambs of the Santa Inês breed, male, castrated, with an average weight of 21.93 ± 0.87 kg and approximately seven months old with urine collecting fund, individual troughs for food and mineral supplement, as well as drinking fountain. The experimental design was a 4x4 Latin square, with four periods and four treatments. The animals underwent initial adaptation to the diets of 21 d, followed by 4 d for sample collection of feces, urine, and of the feed provided and leftovers in each period, and 1-d for behavioral data. The following collection periods were preceded by 10 d of adaptation for subsequent diets. The animals were weighed at the beginning and end of each period to adjust the intake and quantify the voluntary consumption of dry matter. The feed was given in two meals a day, and at 0730 h and 1630 h, adjusted daily in such a way that there was 15 % of the dry matter supplied, in order not to restrict consumption. The planting of the sorghum (Sorghum bicolor L., cv. AG 2002) was carried out on the school farm of the State University (FAZESC-UEL) located in Londrina, Paraná (23o20'10" south latitude and 51o09'15" west longitude, 610 m high). The sorghum used for silage production was cultivated under a no-tillage system with planting in the October of 2011. The cut whole plant occurred with 28 % DM in the month of May 2012 with second cut of the plant, after cutting the sorghum was stored in a bunker silo compacted with tractor in layers and covered with plastic canvas protected by a 15 cm layer of soil.

1063

Rev Mex Cienc Pecu 2021;12(4):1061-1082

The grape pomace byproduct cultivar Isabel (Vitis labrusca L.) collected from a homogeneous lot, directly from the juice industry (COROL, Rolândia, Paraná) after processing. The byproduct of Isabel grape (Vitis labrusca L.) and was largely composed of seeds (610 g kg-1 dry matter (DM)) peels and pulp residue (390 g kg-1 DM). At the time of collection in industry, the byproduct was 11% DM and was dehydrated outdoors, being turned three times a day, until reaching approximately 30% DM. After dehydration of byproduct was added 5 g kg-1 as fresh matter (FM) of urea as a chemical additive using manual mixing equipment. The ensiled mass of byproduct (grape pomace) was stored in February of 2012 in silos of the type plastic drums with a capacity of 100 to 200 liters with sealing lids. The storage time was five months in a covered shed until the date of opening the silos for beginning of the experiment. The chemical characteristics of grape pomace silage are represented in Table 1 and in this work about fermentative quality of grape pomace silage cv. Isabel (Vitis labrusca L.)(11). Four isoproteic (160.46 ± 0.21 g kg-1 DM of CP) and isoenergetic (674.85 ± 5.23 g kg-1 DM of total digestible nutrients (TDN)) diets were employed, and grape pomace silage (GPS) was included at 0, 10, 20, and 30% of the DM base maintaining the bulk concentrated ration of 55:45 (Table 1). Initially, a standard diet was formulated (treatment without the inclusion of GPS, 0 %) and from this diet the others were made, removing 10, 20 and 30 % of sorghum silage and including 10, 20 and 30% of GPS. Due to the differences in the composition of sorghum silage and GPS, the levels of corn and soybean meal were changed to obtain less variation in the protein and TDN contents of the diets. For each 10 % inclusion of GPS, the corn content was increased by 1 % and the soybean meal content reduced by 1 %.

1064

Rev Mex Cienc Pecu 2021;12(4):1061-1082

Table 1: Levels of ingredients and chemical composition of diets and ingredients (g/kg DM-1) Levels of GPS (%) -1 Ingredients, g kg 0 10 20 30 Sorghum silage 550.0 495.0 440.0 385.0 Grape Pomace silage 0.0 55.0 110.0 165.0 Corn grain 240.0 250.0 260.0 270.0 Soybean meal 210.0 200.0 190.0 180.0 Total 1000.0 1000.0 1000.0 1000.0 Chemical composition of diets DM 537.3 538.8 540.3 541.8 OM 940.9 943.4 945.8 948.3 CP 160.0 160.3 160.6 161.0 EE 21.2 25.1 29.0 32.9 NDF 454.4 451.6 448.8 446.0 ADF 264.3 269.2 274.1 279.0 TDN 662.7 670.8 678.9 687.0 Soybean Chemical composition of ingredients Corn meal SS3 GPS DM 885.6 897.9 278.6 305.9 OM 984.8 935.0 924.0 959.9 CP 90.1 505.9 58.4 139.8 EE 37.5 14.8 16.5 83.4 NDF 163.6 166.4 691.4 640.7 ADF 37.0 68.5 438.3 533.1 TDN 823.5 818.2 533.2 679.3 DIVDM 461.2 DM (Dry matter), OM (Organic matter), CP (Crude protein), EE (Ether extract), NDF (Fiber insoluble in neutral detergent), ADF (Fiber insoluble acid detergent), TDN (Total digestible nutrients), DIVDM (In vitro dry matter digestibility, GPS (Grape pomace silage), SS (Sorghum silage).

The TND contents of the ingredients used in the formulation of the diets were estimated according to the equations proposed by Kearl(14). For sorghum silage (SS) and grape pomace silage (GPS) the equation used was: %TND= - 21.9391 + (1.0538 x CP) + (0.9738 x NNE) + (3.0016 x EE) + (0.4590 x CF); where CP= crude protein, NNE= nonnitrogen extractives, EE= ether extract. For soybean meal: %TND = 40.3217 + (0.5398 x CP) + (0.4448 x NNE) + (1.4223 x EE) - (0.7007 x CF), where CF= crude fiber. Finally, for corn grain: %TND = 40.2625 + (0.1969 x CP) + (0.4028 x NNE) + (1.903 x EE) (0.1379 x CF).

1065

Rev Mex Cienc Pecu 2021;12(4):1061-1082

Intake, digestibility of nutrient, and nitrogen balance

Weighed the supplies and leftovers daily to adjust consumption, at the end of the adaptation period, for four consecutive days, samples of supplies were collected, leftovers directly in the trough, feces and urine were collected with the aid of a bag and bucket collector. The nutrient intake was estimated by subtracting nutrients from leftover nutrients. The percentage apparent digestibility was estimated to according Coelho and Leão(15) where: Apparent digestibility = ((Nutrients supplied (g) - Nutrients in leftovers (g)) / (Stool nutrients (g))) * 100. To determine the nitrogen balance the urine was collected and measured second Schneider and Flat(16). The samples of feces, urine and feed supplied and rejected were analyzed for the nitrogen contents and calculated nitrogen retention according to Decandia et al(17) being: N retained = N ingested - (fecal N + urinary N); N ingested = (N supplied - N left over). The samples of diets, ingredients, feed leftovers, feces and urine were collected and analyzed for dry matter (DM), organic matter (OM), crude protein (CP), nitrogen (N), ether extract (EE) according to the methodology of AOAC(18) described by Mizubuti et al(19), neutral detergent insoluble fiber (NDF), acid detergent insoluble fiber (ADF) assayed with a heat stable alpha amylase and corrected for ash according to the methodology of Van Soest(20) described by Detmann et al(21). Total carbohydrates (TCHO) and non-fibrous carbohydrates (NFC) were calculated according to the proposed equations(22). To determine the percentage of seeds, 500 g of the grape pomace was separated using a sieve and tweezers, in seeds and seedless portion. Subsequently, the portions were pre-dried for 72 h at 55 ºC in an oven with forced air circulation, crushed and analyzed for the final DM contents(18). The in vitro digestibility of DM was estimated using the two-stage digestion technique according to the technique proposed by Tilley and Terry(23) and adapted by Mizubuti et al(19).

Ingestive behavior

The ingestive behavior was evaluated during 24 consecutive hours by means of direct observations at 5 min intervals performed on the fifth day of each of the four periods of data collection of the experiment, totaling 288 observations per period according to the method of Martin and Bateson(24). A total of six trained observers made direct observations in pairs, during a period of 6 h of observation. One of the pairs took turns the observation period at dawn with rest during the day to complete the 24 h of observation. The observers were positioned strategically near the cages not to interfere with the behavior of animals. The artificial lighting was made of low incidence luminous flux lamps and fixed to the shed structure for the night

1066

Rev Mex Cienc Pecu 2021;12(4):1061-1082

observations. The ingestive behavior was observed after 7 d of adaptation of lambs to the cages, observers, artificial lighting in the night, and environment. The time spent in feeding, rumination lying down, rumination on foot, lying down and standing idle were observed according to the methodology by Johnson and Combs(25). The chewing and rumination parameters were measured in terms of the number of chewing and the chewing time of five ruminal bolus in each of the four periods evaluated during the 24 h of observation. The results concerning eating and rumination efficiency expressed as g DM h-1 and g NDF h-1, respectively, were calculated by dividing the DM and NDF intake by the total time spent eating or ruminating within a 24-h period and were obtained by means of the equations(26): IEDM = CDM / FCON, where IEDM= Dry matter intake efficiency (g/h), CDM= consumption of dry matter (g/d), FCON= Feed consumption time (hours); IENDF= CNDF/FCON, where IENDF = Intake efficiency of neutral detergent insoluble fiber (g/h), CFDN= Consumption of neutral detergent insoluble fiber (g/d); DMRE= CMS / (TRP + TRD), where DMRE= Dry matter rumination efficiency (g/h), SRT= Standing rumination time (hours/day), RTLD= Ruminating time lying down (h/d); RENDF = CDM / (SRT + RTLD), where ERNDF= Efficiency of rumination of neutral detergent insoluble fiber (g/h); TCT= FCON + SRT + RTLD, where TCT= Total chewing time (min/day).

Statistical analyses

The data were submitted to the Shapiro-Wilk and Bartlett tests, in order to verify the assumptions of normality test for distribution of errors and homogeneity of variance, respectively. Once these assumptions were met, the data were submitted to analysis of variance for digestibility of nutrient and nitrogen balance. The regression analysis (α= 0.05) was applicable for nutrient intake and ingestive behavior. The statistical package ExpDes of the statistical program R (Version 2013) was used to study the mean values by regression analysis, using "F" test (α= 0.05), following the model: Yijk = µ + 𝑇𝑖 + 𝛼𝑗 + 𝛽𝑘 + 𝑖𝑗𝑘 where: 𝐘𝐢𝐣𝐤 = is the value observed in the 𝑖 𝑡ℎ row and 𝑘 𝑡ℎ column for the 𝑗 𝑡ℎ treatment; 𝝁= is the general average; 𝑻𝒊= is the effect of the 𝑖 𝑡ℎ treatment; 𝛼𝑗= is the effect of the 𝑗 𝑡ℎ line; 𝜷𝒌= is the effect of the 𝑘 𝑡ℎ column; 𝒊𝒋𝒌= is a component of random error, associated with the 𝑖 𝑡ℎ row, 𝑘 𝑡ℎ column and 𝑗 𝑡ℎ treatment.

1067

Rev Mex Cienc Pecu 2021;12(4):1061-1082

Results and discussion In order to evaluate the DM and nutrient intake of the diets, it was observed that the inclusion of grape pomace silage influenced (P<0.05) in linearly increasing only the consumption of EE (Table 2). The EE in GPS was due to the higher density of the seeds (610 g kg-1 DM) in comparison to the bark and pulp (390 g kg-1 DM) constituting the grape pomace(11) and seeds, in turn, have a high oil concentration(27). Therefore, this behavior can be explained by the higher concentration of EE in the GPS and providing an increase in the concentration this nutrient in the diet, according to the increase of GPS levels inclusion. The increase in EE in diets and intake is often observed according to the increased level of inclusion of grape residues of up to 15 %, respectively(10,12,13). The maximum level of EE of 32.9 g kg-1 DM offered in the diet with 30 % of inclusion in this work, does not exceed the maximum limit 50 g kg-1 DM proposed by Palmquist and Mattos(28). The mean intake of DM (3.80 of live weight percentage), met the requirements of the animals and presented value higher than recommended in the NRC(29) is 3.51 % for the animal category analyzed with 30 kg and daily weight gain of 300 g/d. The FDNI recommended by Mertens(30 ) for ruminant animals should maintain an intake of NDF of around 1.2 % of their live weight, thus in this study the NDFI was 1.43 %, that could be related to the amount of fibrous fractions of diets of each treatment.

1068

Rev Mex Cienc Pecu 2021;12(4):1061-1082

Intake DM OM CP EE NDF TCHO NFC TDN DM OM CP EE NDF TCHO NFC TDN

Table 2: Nutrient intake (g kg-1) in diets for lambs containing grape pomace silage (GPS) Levels of GPS (%) Mean R2 0 10 20 30 g d-1 1226.3±54.78 1246.4±118.32 1242.6±83.63 1226.7±121.96 1235.5±10.50 1176.9±55.57 1197.5±114.50 1199.1±84.59 1183.4±114.21 1189.2±55.57 220.3±16.13 222.4±34.35 224.9±18.91 218.1±23.27 221.4±2.88 38.6±11.45 41.3±12.88 50.8±17.21 52.5±12.53 Ŷ=38.1+0.513x 0.92 468.8±28.97 463.5±35.23 462.1±51.56 451.9±62.72 461.6±6.13 918.0±34.93 933.8±87.90 923.5±71.42 912.9±102.95 922.0±8.95 477.9±44.25 470.3±63.03 461.3±32.72 460.9±43.95 467.6±8.11 864.4±69.13 855.6±69.38 876.0±76.31 854.6±70.62 862.7±9.93 -1 g kg of live weight 37.80±5.64 37.98±4.09 38.44±7.12 37.84±5.51 38.02±0.29 36.27±5.39 36.48±3.83 37.08±6.81 36.49±5.09 36.58±0.35 6.78±0.93 6.74±0.75 6.91±0.90 6.68±0.47 6.78±0.10 1.18±0.36 1.25±0.33 1.55±0.47 1.59±0.21 Ŷ=1.16+0.015x 0.9 14.39±2.56 14.19±1.94 14.39±3.59 14.01±2.91 15.25±0.18 28.31±4.34 28.50±3.51 28.62±5.88 28.22±4.84 28.41±0.18 14.59±0.90 14.31±1.88 14.24±2.37 14.21±1.96 14.34±0.18 26.61± 26.07± 27.09± 26.33± 26.53±0.44

1069

P-value

5.12 5.16 6.61 11.22 7.34 4.98 7.08 4.85

0.951 0.942 0.923 0.021 0.937 0.925 0.865 0.876

7.08 7.10 8.07 9.96 9.02 7.13 8.07 6.80

0.985 0.972 0.940 0.013 0.968 0.991 0.962 0.869

Rev Mex Cienc Pecu 2021;12(4):1061-1082

DM OM CP EE NDF TCHO NFC TDN DM OM CP EE NDF TCHO NFC TDN

g kg-1 of live weight0.75 90.10±10.78 90.83±8.70 86.46±10.30 87.25±8.18 16.16±1.82 16.13±1.89 2.82±0.83 2.99±0.83 34.28±5.04 33.89±3.86 67.48±8.28 68.13±7.38 34.87±1.44 34.24±4.27 63.46±8.16 62.35±4.89 % live weight 3.78±0.56 3.80±0.41 3.63±0.54 3.65±0.38 0.68±0.09 0.67±0.08 0.12±0.04 0.12±0.03 1.44±0.26 1.42±0.19 2.83±0.43 2.85±0.35 1.46±0.09 1.43±0.19 2.66±0.41 2.61±0.24

91.53±13.77 88.30±13.20 16.48±1.70 2.70±1.14 34.20±7.29 68.12±11.57 33.92±4.54 64.51±10.16

90.18±11.10 86.97±10.19 15.95±0.92 2.80±0.59 33.35±6.13 67.22±9.97 33.87±3.92 62.77±6.29

90.66±0.66 87.25±0.87 16.18±0.22 Ŷ=2.77+0.037x 33.93±0.42 67.74±0.46 34.23±0.46 63.27±0.94

3.84±0.71 3.71±0.68 0.69±0.09 0.15±0.05 1.44±0.36 2.86±0.59 1.42±0.24 2.71±0.51

3.78±0.55 3.65±0.51 0.67±0.05 0.16±0.02 1.40±0.29 2.82±0.48 1.42±1.18 2.63±0.33

3.80±0.03 3.66±0.04 0.68±0.01 Ŷ=0.116+0.002x 1.43±0.02 2.84±0.02 1.43±0.02 2.65±0.04

0.85

0.9

6.50 6.53 7.62 10.16 8.51 6.52 7.7 6.22

0.983 0.972 0.940 0.014 0.965 0.987 0.944 0.872

7.08 7.10 8.07 9.96 9.02 7.13 8.07 6.80

0.985 0.972 0.940 0.013 0.968 0.991 0.962 0.869

DM= (Dry matter), OM (Organic matter), CP (Protein crude), EE (Ether Extract) NDF (Neutral detergent Fiber), TCHO (Total carbohydrate), NFC (Non-fibrous carbohydrates), TDN (Total digestible nutrients), CV (Coefficient of variation) , R² (Coefficient of determination).

1070

Rev Mex Cienc Pecu 2021;12(4):1061-1082

These values of nutrient intake (Table 2) agrees with a study(10) that found values for DMI of 1,192, 1,144 and 1,127 g kg-1 for levels of 0, 10 and 20 % respectively, of inclusion of grape marc silage in diets for lambs, as well as other nutrients that are in the range for the interval observed by these authors on nutrient consumption. Some authors(12) found DMI of 1,445.8, 1,379 and 1,482.4 g d-1 of lambs feed with levels of 0, 5 and 10 % of wine grape pomace. Lambs fed with 10 % of wine grape pomace did not increase their DMI and had greater average daily gain that lambs in the both supplementation 0 and 5 %. Despite value DMI was higher than this study, the nutrient intake not was influenced for inclusion of grape pomace. No variations (P>0.05) were observed in the apparent digestibility of nutrients as a function of the increase in the GPS contents (Table 3). Factors such as the similarity in the NDF contents of the diets (Table 1), the absence of differences in DM consumption and the association between grape pomace silage and other foods, may be associated with the similarity between the digestibility of nutrients in the diets. Reduction in the digestibility of DM and nutrients was observed in sheep diets(31) by associating 50 % dehydrated grape residue to different energy sources, that according to the authors, the digestibility of the diets was affected by the low digestibility of the dehydrated grape residue of 30 % determined in vitro. It was also observed a significant reduction in the digestibility for the diets of red grape marc(32). These authors related the decrease of digestibility with the presence of tannins and the high lignin content in grape marc. However, the values found for nutrient digestibility of the present study (Table 3) are superior to the study by Zalikarenab et al(32). For DDM the average value was of 678.6 ± 0.62 g kg-1 DM also observed as higher as the value found by others(33) with DDM of 285 g kg-1 DM of when evaluating the digestibility of silage bagasse for ruminants. It is likely that the digestibility values of the diets observed in the present experiment are due to the better utilization of grape pomace silage by the animal, considering 461.2 g kg-1 DIVDM of the byproduct used (Table 1). However, it is worth mentioning that the digestibility values of the nutrients found in this work, refer to the grape pomace of the Isabel Vitis Labrusca L. variety(11) and because there are not yet studies with this variety in the lamb feed, it is not possible to draw comparisons between the results obtained. In addition, differences in digestibility may be related to variations between the byproducts used in the diets, in addition to the type of processing and additive used for conservation. According to Rogério et al(34) processing in the fruit agro industries results in a great variation in the chemical composition of the generated residues, being observed variations even between lots that have undergone the same type of processing.

1071

Rev Mex Cienc Pecu 2021;12(4):1061-1082

Variables DDM DOM DCP DEE DNDF DTCHO DNFC DTDN

Table 3: Apparent digestibility of nutrients (g kg DM-1) in diets containing levels of GPS Levels of GPS (%) Mean 0 10 20 30 675.5±4.62 671.9±2.08 686.2±1.26 680.7±3.72 678.6±0.62 696.1±4.20 691.0±1.79 704.5±1.23 699.4±3.58 697.8±0.57 696.4±4.67 695.9±4.69 701.8±4.08 684.5±3.03 694.7±0.73 870.7±4.34 861.8±3.69 909.2±2.43 901.0±3.28 885.7±2.30 621.9±5.98 559.6±4.96 590.0±4.54 559.0±5.43 582.6±2.99 658.3±8.76 681.4±1.55 693.2±1.64 690.8±3.82 680.9±1.59 747.3±4.63 800.5±3.54 794.3±2.30 818.8±3.80 790.2±3.04 700.6±2.66 690.3±1.94 705.8±2.33 701.1±2.26 699.5±0.65

CV (%) 4.25 3.71 4.63 2.46 5.89 6.06 4.03 1.08

P-value 0.901 0.897 0.890 0.057 0.114 0.116 0.083 0.640

DDM (Digestibility of dry matter), DOM (Digestibility of organic matter), DCP (Digestibility of crude protein), DEE (Digestibility of ether extract), DNDF (Digestibility of neutral detergent insoluble fiber), DTCHO (Digestibility of total carbohydrates) DNFC (Digestibility of non-fibrous carbohydrates), DTDN (Digestibility of total digestible nutrients). GPS (Grape pomace silage), CV (Coefficient of variation).

1072

Rev Mex Cienc Pecu 2021;12(4):1061-1082

Table 4: Absorption, excretion and nitrogen in lambs fed diets with inclusion of grape pomace silage (GPS) Inclusion levels of GPS (%) 0 10 20 30 Mean P-value

Variable Nitrogen ingested g d-1 Nitrogen fecal g d-1 g kg-1of N ingested Nitrogen urine g d-1 g kg-1of N ingested Nitrogen retain g d-1 g kg-1of N ingested

35.25±2.58

35.58±5.50

35.98±3.03

34.89±3.72

35.43±0.46

0.922

6.61

10.53±1.74 298.81±46.46

10.86±2.61 304.08±46.86

10.71±1.65 298.15±40.83

10.95±0.93 315.42±30.27

10.76±0.18 304.12±7.99

0.977 0.837

13.72 9.91

18.48±0.78 525.45±26.91

14.82±3.57 417.72±79.18

17.14±4.50 473.27±101.3

14.11±2.18 407.98±74.14

16.14±2.03 456.11±54.4

0.452 0.352

25.07 20.79

6.24±2.40 175.74±58.95

9.90±4.78 278.20±120.2

8.13±2.04 228.58±67.47

9.84±4.10 276.60±89.44

8.53±1.73 239.78±48.5

0.546 0.556

45.87 46.37

CV (Coefficient of variation), N (Nitrogen).

1073

Rev Mex Cienc Pecu 2021;12(4):1061-1082

The parameters of ingestion, fecal excretion, urinary excretion and nitrogen retention were not influenced (P>0.05) by the diets (Table 4), and possibly that the use of isoproteic diets and crude protein consumption were not influenced by diets, are the reasons for the similarity observed for the nitrogen balance between diets and similar CP levels. The positive balance of the nitrogen contents with mean values of 8.53 g d-1 of nitrogen retain and 239.78 g kg-1 nitrogen ingested may indicate, that there was retention of protein in the animal body, providing conditions so that no weight loss occurred and probably the protein requirements were met by the diets(35). The results of the present study indicated that the experimental diets had a balanced supply of protein and energy, which in turn may have improved the use of dietary protein. Evaluated diets with dehydrated grape residue and different levels of urea for lambs found average values of 22.62 g d-1, for retention of N(36). According to the authors, the high value can be explained by the fact that the animals are growing and required high amounts of protein for tissue formation. When replacing sorghum silage with dehydrated fruit coproducts, no difference was observed for nitrogen balance between diets(37). According to these authors, this fact indicates that the animals retained protein from the diet and the objective of the study was reached, besides these products are good alternative for use during feed shortage and potentially reduce feed costs. Despite the observed values for N retained in the present study, 8.53 g d-1, are lower than those observed elsewhere(36) showed no damage to the development of the animals. However, the values are close to retained N and higher for ingested, fecal and urine N, to those found by others(13) when they included grape residue in diets with 11% CP to feed lambs. N retention is closely linked to the balance and timing of degradation between carbohydrates and dietary proteins. According to some authors(15), higher nitrogen retentions are a reflection of the better balance between energy and protein characteristic of each food, allowing greater efficiency in protein utilization. The excretion of N via feces was less than the excretion described by Van Soest(38) for ruminants, 6 to 8 % of the ingested protein, since for consumption of CP 221.4 g d-1 obtained in this research, and losses fecal excretion of 13.3 g N d-1. It can be inferred that the amount of tannin present in the grape pomace did not cause damage to protein degradation or that the maximum amount of GPS, 16.5 % present in the diet with a 30 % inclusion, was not sufficient to cause this effect undesirable. Min et al(39) reported that the tannins can affect the digestion process by means of complex formation with enzymes and mainly with proteins, which would cause lower degradation, absorption and consequently higher excretion of protein via feces.

1074

Rev Mex Cienc Pecu 2021;12(4):1061-1082

DMI, g d-1 CNDF, g d-1 TCON, min d-1 TIL, min d-1 TLD, min d-1 TRS min d-1 TRD, min d-1 EIDM, g h-1 EINDF, g h-1 EDMR, g h-1 ERNDF, g h-1 TCT, min d-1

Table 5: Ingestive behavior of lambs fed with diet containing different levels of grape pomace silage (GPS) Levels of GPS (%) Mean R2 0 10 20 30 1226.3±54.78 1246.4±118.32 1242.6±83.63 1226.7±121.96 1235.5±10.50 468.8±28.97 463.5±35.23 462.1±51.56 452.0±62.72 461.60±6.13 237.5±81.45 270.0±83.77 276.3±79.41 255.0±33.42 259.7±17.27 315.0±20.21 342.5±94.65 351.3±74.99 320.0±76.70 Ŷ=A 0.98 493.8±119.8 395.0±86.70 437.5±61.98 468.8±73.30 435.3±42.59 30.0±26.46 21.2±15.48 22.5±23.27 16.3±8.54 22.5±5.68 363.8±40.72 411.3±36.83 352.5±38.62 380.0±32.40 376.9±25.55 388.1±102.3 341.9±82.00 337.1±102.1 346.1±42.92 355.29±23.47 181.2±47.78 159.6±38.28 157.4±47.66 161.6±20.04 164.92±10.96 237.0±15.72 202.8±18.16 234.9±29.10 221.6±21.84 224.09±15.75 110.7±7.34 94.7±8.48 109.7±13.59 103.5±10.35 104.61±7.35 631.3±105.0 702.5±65.89 651.3±64.21 651.3±40.29 659.06±30.45 -

P-value

5.12 11.22 26.23 4.59 15.23 113.5 12.85 20.67 20.67 20.61 20.61 9.57

0.951 0.942 0.854 0.041 0.295 0.894 0.414 0.749 0.751 0.717 0.717 0.481

DMI, Dry matter intake; CNDF, Consumption of neutral detergent insoluble fiber; TCON, Consumption time; TIL, Standing idle time; TLD, Idle time lying down; TRS, Ruminating time standing; TRD, Ruminating time lying down; EIDM, Efficiency of dry matter intake, EINDF, Efficiency of ingestion of neutral detergent insoluble fiber; EDMR, Efficiency of dry matter rumination; ERNDF, Rumination efficiency of neutral detergent insoluble fiber; TCT, Total chewing time; CV, Coefficient of variation; A= 313.9+4.64x-0.1147x2.

1075

Rev Mex Cienc Pecu 2021;12(4):1061-1082

The presence of tannins causes nitrogen partition, causing a lower proportion to be excreted in the urine, directing their excretion into the feces(40). This behavior was not observed in the present experiment, the urinary excretion of N 16.14 g d-1, was superior to the fecal excretion of N 10.76 g d-1. When the rate of protein degradation exceeds that of carbohydrate fermentation, a large amount of nitrogen compounds can be eliminated via urine(38).

There were no differences for intake of DM and NDF (Table 5), what can indicate that palatability was not negatively affected by the inclusion of silage GPS of cultivar Isabel Vitis Labrusca L. cultivar Isabel (P>0.05). Gao et al(13) when evaluating the inclusion of up to 15 % of grape residue in diets of lambs, found that the values lower for DM intake and NDF intake were increased with higher inclusion levels.

The time spent with consumption, rumination, idle time lying down and total chewing were not influenced (P>0.05) by the inclusion of GPS (Table 5). The absence of effects of diets on these parameters may be due to the similarity between the roughage and concentrated levels of the diets, as well as the levels of fiber, consumption and digestibility of DM and NDF. In addition to the moisture content, caused by the use of silage, it has facilitated the consumption of diets by animals, making the time spent on feeding easier.

The time spent on rumination is proportional to the cell wall content, particle size and effectiveness of the food fiber, with a greater need to process the fiber, as well as more time for feed consumption(38). Also regarding the influence of the NDF content on the ingestive behavior, Cardoso et al(41) evaluated diets with different NDF levels (25, 31, 37 and 43 %), observed no change in ingestive behavior and reported that variations in intake were observed in diets with NDF contents higher than those observed in the present experiment, or when there is greater amplitude between the fiber contents in the evaluated diets.

The time spent with ingestive behavior the diets influenced only the length of time that the animals remained idle in standing (Table 5). This parameter showed a quadratic behavior with a maximum point estimated at 17.73 % of GPS (P=0.041). Although there were no great variations in the NDF content and the NDF consumption was not influenced by the levels of grape pomace silage inclusion. Considering fiber content as a parameter, it is expected that the idle time will decrease as the NDF content in the diet increases, that is, the greater the need to process dietary fiber, the shorter the permanence of idle animals(42,43). As observed in the present study for the level 0 % of inclusion with the highest content NDF of 454.4 g kg-1 DM with the lower idle time of 315 min-1. This is due to the fiber characteristics of the sorghum silage(44), and in the present study it 1076

Rev Mex Cienc Pecu 2021;12(4):1061-1082

presented a lower ADF content and a higher NDF content than GPS and also in the diet (Table 1).

When considering the total fiber content through the sum of NDF and ADF (725 g kg-1 of fiber total) for level of inclusion of 30 % GPS, the value of 320 min d-1 of idle time may have been influenced by total content fiber. This is due to the fiber characteristics of the GPS(11), composed 610 g kg-1 of DM of seeds, 390 g kg-1 of DM pulp residue and husks. The seeds represented the highest proportion in silage and contributed to increase the levels of NDF and ADF in the diet at the level of 30% of inclusion (Table 1), which may have been demanded a greater need for rumination and less idle time between the levels of inclusion (Table 5). For confined lambs, the inclusion of GPS can keep them active and contribute to stress reduction and encourage rumination natural behavior. The efficiency of ingestion and rumination of DM and NDF were not influenced (P>0.05) by the treatments with the different levels of inclusion. This behavior can be justified by the consumption of DM and NDF (1,235.5 and 461.6 g d-1), respectively, which did not show significant variation (P>0.05) between treatments. According to several works(45,46) the ingestion and rumination efficiencies of DM and NDF are directly related to the consumption of DM and NDF, which may be influenced by particle size, quality and diet content.

Conclusions and implications Grape pomace silage can be used to feed lambs up to 30 % inclusion in diets containing 55 % roughage, without causing changes in nutrient intake and digestibility, as well as nitrogen balance and ingestive behavior. The grape pomace silage has favorable characteristics for use in diets for lambs, with silage being a good alternative for its storage, in addition to offering the correct destination for this byproduct.

Acknowledgments

We thank the postgraduate program in Animal Science of the State University of Londrina (Londrina, Paraná, Brazil), the Coordination of Improvement of Higher Education Personnel (CAPES; Brasília, DF, Brazil) and the Fundação Araucária (Paraná, Brazil) support.

1077

Rev Mex Cienc Pecu 2021;12(4):1061-1082

Conflicts of interest

The authors have no conflicts of interest to declare.

Literature cited: 1. Kodagoda KHGK, Marapana RAUJ. Utilization of fruit processing by-products for industrial applications: A review. Intern J Sci Nutr 2017;2:24-30. 2. Barreto FM, Lima POA, Souza CMSA, et al. Uso de coprodutos de frutas tropicais na alimentação de ovinos no semiárido do Brasil. Arch Zootec 2014;3:17-131. 3. Mazza PHS, Jaeger SMPL, Silva FL, et al. Effect of dehydrated residue from acerola (Malpighia emarginata DC.) fruit pulp in lamb diet on intake, ingestive behavior, digestibility, ruminal parameters and N balance. Livest Sci 2020;103938. 4. De Evan T, Cabezas A, De La Fuente J, et al. Feeding Agroindustrial byproducts to light lambs: influence on growth performance, diet digestibility, nitrogen balance, ruminal fermentation, and plasma metabolites. Animals 2020;10:4-600. 5. Eleonora N, Dobrei A, Dobrei A, et al. Grape pomace in sheep and dairy cows feeding. J Hort Forest Biotechnol 2014;18:146-150. 6. Zhang N, Hoadley A, Patel J, et al. Sustainable options for the utilization of solid residues from wine production. Waste Manag 2017;60:173–183. 7. Gülcü M, Uslu N, Özcan MM, et al. The investigation of bioactive compounds of wine, grape juice and boiled grape juice wastes. J Food Process Preserv 2019;43:e13850. 8. Baumgärtel T, Kluth H, Epperlein K, et al. A note on digestibility and energy value for sheep of different grape pomace. Small Ruminant Res 2007;67:302–306. 9. Calderón-Cortés JF, González-Vizcarra VM, Pétriz-Celaya Y, et al. Energy value of unfermented dried grape pomace as substitute of alfalfa hay in diets for growing lambs. Austral J Vet Sci 2018;63:59–63. 10. Chikwanha CO, Muchenjeb V, Noltec EJ, et al. Grape pomace (Vitis vinifera L. cv. Pinotage) supplementation in lamb diets: Effects on growth performance, carcass and meat quality. Meat Sci 2019;147:6-12.

1078

Rev Mex Cienc Pecu 2021;12(4):1061-1082

11. Massaro Junior FL, Bumbieris Junior VH, Zanin E, et al. Effect of storage time and use of additives on the quality of grape pomace silages. J Food Process Preserv 2020; e14373. 12. Zhao JX, Li Q, Zhang RX, et al. Effect of dietary grape pomace on growth performance, meat quality and antioxidant activity in ram lambs. Anim Feed Sci Technol 2018;236:76–85. 13. Gao X, Tang F, Zhang F, et al. Effects of the supplementation of distillers’ grape residues on ruminal degradability, whole tract digestibility and nitrogen metabolism in sheep. Arch Anim Nutr 2019;1–15. 14. Kearl LC. Nutrient requirements of ruminants in developing countries. Logan: Utah State University/ International Feedstuffs Institute, 1982. 15. Coelho Da Silva JF, Leão MI. Fundamentos de nutrição dos ruminantes. Piracicaba: Livroceres, São Paulo. 1979. 16. Schneider BH, Flat WP. The evaluation of feeds through digestibility experiments. Athens: The University of Georgia Press; 1975. 17. Decandia M, Sitzia M, Cabiddu A, Kababya D, Molle G. The use of polyethylene glycol to reduce the anti-nutritional effects of tannins in goat fed woody species. Small Ruminant Res 2000;38:2157-2164. 18. AOAC International. Association of Official Analytical Chemists. Official methods of analysis. 15th ed. Arlington, VA: AOAC International; 1990. 19. Mizubuti IY, Pinto AP, Pereira ES, et al. Métodos laboratoriais de avaliação de alimentos para animais. Londrina: EDUEL. 2009. 20. Van Soest PJ. User of detergents in the analyses of fibrous feeds. II. A rapid method for the determination of fibers and lignin. J Assoc Official Agricult Chemists1963; 46:829-835. 21. Detmann E, Souza MA, Valadares Filho SC, et al. Métodos para análise de alimentos: INCT: Ciência Animal. Visconde do Rio Branco: Suprema. 2012. 22. Sniffen CJ, O’connor JD, Van Soest PJ, et al. A net carbohydrate and protein availability. J Anim Sci 1992;70:3562-3577. 23. Tilley JMA, Terry RA. A two-stage technique for the in vitro digestion of forage crops. J British Grass Society 1963;18:104-111.

1079

Rev Mex Cienc Pecu 2021;12(4):1061-1082

24. Martin P, Bateson P. Measuring behavior. 2nd ed. Cambridge: Cambridge University Press; 1993. 25. Johnson TR, Combs DK. Effects of prepartum diet, inert rumen bulk, and dietary polyethylene glycol on dry matter intake of lactating dairy cows. J Dairy Sci 1991; 74:933-944. 26. Bürger PJ, Pereira JC, Queiroz AC, et al. Comportamento ingestivo em bezerros holandeses alimentados com dietas contendo diferentes níveis de concentrado. Rev Bras Zootec 2000;29:236- 242. 27. Shinagawa FB, Santana FC, Torres LRO, Mancini-Filho J. Grape seed oil: a potential functional food. Food Sci Technol 2015; 35:399-406. 28. Palmquist DL, Mattos WRS. Metabolismo de lipídeos. In: Berchielli, TT, et al. Nutrição de ruminantes. Jaboticabal: FUNEP, Cap.10, 2006:287-310. 29. NRC. Nutrient requirements of small ruminants: Sheep, goats, cervids, and new world camelids. 1th. Washington, DC: National Academy Pres; 2007. 30. Mertens DR. Predicting intake and digestibility using mathematical models of ruminal function. J Dairy Sci 1987;64:1548-1558. 31. Barroso DD, Araújo GGL, Silva D, Medina FT. Resíduo desidratado de vitivinícolas associado a diferentes fontes energéticas na alimentação de ovinos: consumo e digestibilidade aparente. Ciênc Agrotec 2006;30:67-773. 32. Zalikarenab L, Pirmohammadi R, Teimuriyansari A. Chemical composition and digestibility of dried white and red grape pomace for ruminants. J Anim Vet Adv 2007;9:1107-1111. 33. Pirmohammadi R, Golgasemgarebagh A, Azari MA. Effects of ensiling and drying of white grape pomace on chemical composition, degradability and digestibility for ruminants. J Anim Vet Adv 2007;6:1079-1082. 34. Rogério MCP, Costa HHA, Ximenes LJF, Neiva JNM. Utilização de subprodutos agroindustriais na alimentação de novilhas leiteiras. In: Produção de bovinos no nordeste do Brasil: desafios e resultados, Fortaleza: Banco do Nordeste do Brasil, Cap. 11,2011:263-297.

1080

Rev Mex Cienc Pecu 2021;12(4):1061-1082

35. Vasconcelos AM, Leão MI, Valadares Filho SC, et al. Parâmetros ruminais, balanço de compostos nitrogenados e produção microbiana de vacas leiteiras alimentadas com soja e seus subprodutos. Rev Bras Zootec 2010;39:425-433. 36. Menezes DR, Araújo GGL, Oliveira RL, et al. Balanço de nitrogênio e medida do teor de uréia no soro e na urina como monitores metabólicos de dietas contendo resíduo de uva de vitivinícolas para ovinos. Ver Bras Saúde Prod Anim 2006;4:169– 175. 37. Almeida SCJ, Figueiredo MD, Azevedo KK. Intake, digestibility, microbial protein production, and nitrogen balance of lambs fed with sorghum silage partially replaced with dehydrated fruit by-products. Trop Anim Health Prod 2019;51:619-627. 38. Van Soest PJ. Nutritional ecology of the ruminant. New York: Cornell University Press; 1994. 39. Min BR, Barry TN, Attwood GT, McNabb WC. The effect of condensed tannins on the nutrition and healt of ruminants fed fresh tempeate forages: a review. Anim Feed Sci Tech 2003;106:3-19. 40. Oliveira SG, Berchielli TT. Potencial da utilização de taninos na conservação de forragens e nutrição de ruminantes - revisão. Arch Vet Sci 2007;12:1-9. 41. Cardoso AR, Carvalho S, Galvani DB, Pires BD, Gasperin CC, Garziera B, Garcia RPA. Comportamento ingestivo de cordeiros alimentados com dietas contendo diferentes níveis de fibra em detergente neutro. Ciência Rural 2006;36:604-609. 42. Missio RL, Brandana IL, Alves Filho DC, et al. Comportamento ingestivo de tourinhos terminados em confinamento, alimentados com diferentes níveis de concentrado na dieta. Rev Bras Zootec 2010;39:1571-1578. 43. Hubner CH, Pires CC, Galvani DB. Comportamento ingestivo de ovelhas em lactação alimentadas com dietas contendo diferentes níveis de fibra em detergente neutro. Ciência Rural, 2008;38:1078-1084. 44. Henz EL, Silva LDF, Bumbieris Junior, VH, et al. Evaluation and characterization of triticale silage (x. Triticosecale wittmack) to replace Sorghum bicolor (L.) Moench (S. vulgare Pers.) silage as feed for beef cattle. Sem Ciências Agrar 2020;4:335-344.

1081

Rev Mex Cienc Pecu 2021;12(4):1061-1082

45. Carvalho GGP, Pires AJV, Silva RR, Ribeiro LSO, Chagas DMT. Comportamento ingestivo de ovinos Santa Inês alimentados com dietas contendo farelo de cacau. Rev Bras Zootec 2008;37:660-665. 46. Bastos VPM, Carvalho PGG, Pires AJV, et al. Ingestive behavior and nitrogen balance of confined Santa Ines lambs fed diets containing soybean hulls. Asian-Aust J Anim Sci 2014;27:24-29.

1082

https://doi.org/10.22319/rmcp.v12i4.5594 Article

Effectiveness of canola oil in pig diets to improve the lipid profile of meat

Soni-Guillermo, Eutiquio ad José Luis Figueroa-Velasco a María Teresa Sánchez-Torres-Esqueda a José Luis Cordero-Mora a Aleida Selene Hernández-Cázares b José Alfredo Martínez-Aispuro a José M. Fernando Copado-Bueno c María Magdalena Crosby-Galván a

Colegio de Postgraduados. Campus Montecillo. Programa de Ganadería. Km 36.5 Carretera México-Texcoco. 56230, Montecillo, Texcoco, Estado de México. México. b

Colegio de Postgraduados. Campus Córdoba. Congregación Manuel León, Municipio de Amatlán de los Reyes, Veracruz, México. c

Universidad Autónoma Chapingo. Departamento de Zootecnia. Texcoco, Estado de México, México. d

Benemérita Universidad Autónoma de Puebla. Programa Educativo de Ingeniería Agronómica y Zootecnia. Tlatlauquitepec, Puebla, México.

* Corresponding author: jlfigueroa@colpos.mx

1083

Rev Mex Cienc Pecu 2021;12(4):1083-1097

Abstract: The objective of this study was to determine the maximum level of inclusion of canola oil (CO) in diets for finishing pigs, to increase the content of oleic acid and unsaturated fatty acids and improve the Ω6:Ω3 ratio in meat, without affecting the productive performance, carcass characteristics and physicochemical characteristics of the meat. The treatments were: the gradual substitution of soybean oil (6 %) for CO in diets for pigs at finishing stage I and II (0, 2, 4 and 6 % of CO). The experimental units were 48 castrated pigs with initial live weight of 50.00 ± 4.5 kg, evaluated for four weeks at each stage. With the data obtained, an ANOVA was performed, and linear or quadratic trends were detected (P≤0.10). At finishing stage I, the average daily gain decreased with the inclusion of 2 % of CO, although the incorporation of 2 and 4 % of CO had no effect. At finishing stage II, a level between 2-4 % of CO reduced average daily feed intake and improved feed conversion (P≤0.05). The addition of CO did not modify the characteristics of the carcass and did not affect the physicochemical characteristics of the meat (P≥0.10). CO in the diet increased the concentration of monounsaturated fatty acids (MUFAs) and oleic acid (P≤0.05); it reduced linoleic acid (P≤0.03), polyunsaturated fatty acids (P≤0.07) and the Ω6:Ω3 ratio (P≤0.01). In conclusion, the addition of CO (2-6 %) in the diet of finishing pigs gradually increases the content of oleic acid and MUFAs, in addition, it improves the Ω6:Ω3 ratio in pork, without affecting the productive variables and the quality of the meat. Key words: Productive performance, Carcass characteristics, Fatty acid profile, Oleic acid.

Received: 15/01/2020 Accepted: 06/01/2021

Introduction The quantity and quality of the fat in diet affect human health(1). Low intake of saturated fatty acids (SFAs)(2), high consumption of monounsaturated fatty acids (MUFAs) and polyunsaturated fatty acids (PUFAs)(3) are related to aspects beneficial to human health. Likewise, the consumption of Ω3 fatty acids (FAs) represents potential benefits in health and prevention of certain diseases (4); however, human eating patterns have led to lower consumption, causing an inappropriate relationship with Ω6 FA(5). On the other hand, the consumption of oleic acid has shown positive effects on health, preventing human diseases(6,7). Due to the above, it is important to consume foods that improve the dietary fatty acid profile of people(8). The amount and composition of fatty acids in the pig diet reflects and changes the lipid composition in meat(9). In swine nutrition, typical feeding practices (cereal-soybean meal) give it a high ratio of

1084

Rev Mex Cienc Pecu 2021;12(4):1083-1097

PUFAs and a high Ω6:Ω3 FAs ratio to meat(10-13). To change the profile and improve the ratios between FAs, it is necessary to supply food components with a fat profile related to the objective pursued(14,15). The use of canola oil (CO) in the diet of pigs appears to be a good lipid source of MUFAs and PUFAs because it is composed mainly of oleic (59.8 %), linoleic (20.6 %), linolenic (8.49 %) fatty acids and an appropriate ratio of Ω6:Ω3 FAs(16). However, a higher proportion of MUFAs and PUFAs could have a negative influence on the technological properties of pork and its oxidative stability, as well as on the sensory characteristics(1). Some studies(17,18,19) have explored the possibility of using CO (2-4 %) in swine nutrition as a source of unsaturated FAs in meat, without affecting the productive performance and physicochemical characteristics of the meat. In general, it is observed that the inclusion of CO in the diet increases the content of oleic, linolenic acid and MUFAs, reduces the concentration of linoleic acid, PUFAs, and improves the Ω6:Ω3 ratio in meat. Considering that the profile of ingested fatty acids can alter the development of the adipose tissue of pig and be deposited directly in the body fat, the objective of this study was to determine the maximum level of inclusion of CO in diets for finishing pigs to increase the content of oleic acid, unsaturated fatty acids and improve the Ω6:Ω3 ratio in meat, without affecting the productive performance, carcass characteristics and physicochemical characteristics of the meat.

Material and methods The study was carried out at the Swine Unit of the Experimental Farm of the Colegio de Postgraduados, located in Montecillo, Municipality of Texcoco, State of Mexico, located at 98º 48’ 27” W and 19º 48’ 23” N and an altitude of 2,241 m asl, with a temperate subhumid climate with summer rains, average annual temperature of 15.2 °C and average annual rainfall of 644.8 mm(20).

Animals and experimental diets The treatments (Tr) consisted of the gradual substitution of soybean oil (6 %) for CO in diets for pigs in the finishing stages I (50-75 kg of weight) and II (75-100 kg of weight): 0, 2, 4 and 6 % of CO (Table 1). The experimental units were 48 castrated male hybrid (Landrace×Yorkshire×Pietrain) pigs (12 animals per treatment in both stages), with average initial live weight (ILW) of 50.00 ± 4.5 kg evaluated for four weeks in each stage, distributed in a completely randomized design. The pigs were housed in individual pens equipped with hoppertype feeder and nipple drinker. The diets were formulated with the Solver command(21), according

1085

Rev Mex Cienc Pecu 2021;12(4):1083-1097

to the requirements suggested by the NRC(22) for the two stages (Table 1). For the diet of pigs from 75 to 100 kg, ractopamine (10 mg kg-1) was added to all treatments, for which the concentration of nutrients recommended by the NRC(22) when using this additive was considered. Table 1: Experimental diets for finishing pigs Finishing I Finishing II (canola oil %) (canola oil %) Ingredient (%) 0 2 4 6 0 2 Sorghum 62.19 62.49 62.80 63.10 66.19 66.52 Soybean meal 14.53 14.48 14.44 14.40 10.08 10.01 Wheat bran 10.00 10.00 10.00 10.00 10.00 10.00 Soybean oil 6.00 4.00 2.00 0.00 6.00 4.00 Canola oil 0.00 2.00 4.00 6.00 0.00 2.00 Calcium carbonate 0.54 0.54 0.54 0.55 1.01 1.01 Orthophosphate 0.94 0.94 0.93 0.93 0.21 0.21 Sand 4.40 4.14 3.88 3.62 4.65 4.39 A, B Vitamins and minerals 0.35 0.35 0.35 0.35 0.35 0.35 Lysine 0.62 0.62 0.62 0.62 0.70 0.70 Methionine 0.04 0.04 0.04 0.04 0.09 0.09 Salt 0.30 0.30 0.30 0.30 0.30 0.30 Threonine 0.09 0.09 0.09 0.09 0.20 0.20 Tryptophan 0.00 0.00 0.00 0.00 0.22 0.22

ME (Mcal/kg) CP Arginine Lysine Methionine+Cystine Threonine Tryptophan Valine Total calcium Total phosphorus

Nutritional contribution (%) 3.30 3.30 3.30 3.30 14.87 14.88 14.89 14.90 0.77 0.77 0.77 0.77 0.85 0.85 0.85 0.85 0.41 0.41 0.41 0.41 0.52 0.52 0.52 0.52 0.15 0.15 0.15 0.15 0.66 0.66 0.66 0.66 0.64 0.64 0.64 0.64 0.45 0.45 0.45 0.45

3.30 13.50 0.64 0.93 0.42 0.57 0.16 0.56 0.64 0.30

4 66.84 9.94 10.00 2.00 4.00 1.01 0.21 4.13 0.35 0.70 0.09 0.30 0.20 0.22

6 67.17 9.87 10.00 0.00 6.00 1.01 0.20 3.87 0.35 0.70 0.09 0.30 0.20 0.22

3.30 13.50 0.64 0.93 0.42 0.57 0.16 0.56 0.64 0.30

Provided per kg of feed: vitamin A, 15,000 IU; vitamin D3, 2,500 IU; vitamin E, 37.5 IU; vitamin K, 2.5 mg; thiamine, 2.25 mg; riboflavin, 6.25 mg; niacin, 50 mg; pyridoxine, 2.5 mg; cyanocobalamin, 0.0375 mg; biotin, 0.13 mg; choline chloride, 563 mg; pantothenic acid, 20 mg; folic acid, 1.25 mg. B Provided per kg of feed: Fe, 150 mg; Zn, 150 mg; Mn, 150 mg; Cu, 10 mg; Se, 0.15 mg; I, 0.9 mg; Cr, 0.2 mg

1086

Rev Mex Cienc Pecu 2021;12(4):1083-1097

Response variables and carcass characteristics

The response variables studied in both experimental stages were: productive performance (average daily feed intake, ADFI; average daily gain, ADG; feed conversion, FC; fat free lean gain, FFLG; and final live weight, FLW) and carcass characteristics (backfat thickness, BT; lean meat percentage, %LM; Longissimus dorsi muscle area, LMA). DF and ALM were measured using realtime ultrasound (SonoVet 600, Medison, Inc., Cypress, California, USA) at the beginning and end of each stage. With these data and with the initial and final live weight, FFLG was calculated using the equation of the National Pork Producers Council(23).

Physicochemical characteristics At the end of the second experimental stage, five pigs per treatment (about 100 kg of live weight) were randomly selected and slaughtered. The slaughter was carried out at the slaughterhouse of the experimental farm, complying with the Official Mexican Standard NOM-033-SAG/ZOO-2014(24). A sample of leg (Biceps femoris) meat and a sample of loin (Longissimus dorsi) meat were obtained from each animal, and pH, color, water retention capacity and texture were measured. Meat samples were kept in refrigeration at 4 °C. Part of the samples were frozen until the determination of fatty acids. Color determination was measured at 24 h post mortem, using a portable colorimeter (Hunter Lab, Chroma meter CR-410, Konica Minolta Sensing, Inc. Japan). It was calibrated with the white color at three different points on the surface area of the leg and loin of the pig (in a meat sample 15 mm thick) to measure the variables luminosity (L*), red (a*) and yellow (b*)(25). The pH was measured directly in the leg (Biceps femoris) muscle and the loin (Longissimus dorsi) at 24 h post mortem with a portable puncture potentiometer (Model pH1100, Hanna® Mexico)(26). The water retention capacity (WRC)(26) was performed 24 h post mortem: 2 g of finely chopped leg and loin meat were weighed, placed in a centrifuge tube, samples were homogenized with 5 ml of a 0.6 M sodium chloride solution and stirred in a vortex (1,000 rpm) for one minute. The samples were left to stand for 30 min in a refrigerator at 4 °C and then centrifuged for 15 min at 3,500 g (Beckman J-MI centrifuge). The supernatant was decanted and measured in a graduated cylinder. The retained volume of distilled water is reported as the amount of water retained in 100 g of meat. Measurements were made in triplicate, average measurements were calculated and recorded.

1087

Rev Mex Cienc Pecu 2021;12(4):1083-1097

Texture determination was performed 24 h post mortem; leg and loin meat samples were taken, a TA-XT2 texture analyzer (Texture Technologies Corp., Scarsdale, NY) with a Warner-Bratzler razor were used. Cubes of raw meat of 1 cm3 were cut, placed with the muscle fibers transversely on the razor’s edge, using the record of the maximum force to cut and the known force(27). Measurements were made in triplicate, average measurements were calculated and recorded.

Fatty acid profile The fatty acid profile in meat was determined based on the method described by Folch et al (28). For the determination of the fatty acid profile, the standard HP® (Model 6890) chromatograph of Supelco 37 (Component FAME Mix Catalog N0.47885-U) methyl esters was used, with a Supelco column (SPTM- 2660 FUSED SILICA Capillary Column, 100 m x 0.25 mm x 0.2 μm film thickness). Helium was used as a carrier gas at 0.8 ml/min; the sample injection was 1 μl in 1:10 Split mode manually, with an initial temperature ramp of 140 °C by 1.00 degree min-1, with an increase to 3 °C min-1 at a temperature of 210 °C, and a decrease of 0.7 degrees min-1 and a final temperature of 235 °C. The total time to analyze each sample was 60 min.

Statistical analysis For the two experimental stages, a completely randomized design was used, with four treatments and twelve replicates in each, considering each pig as an experimental unit to evaluate the productive performance. For the fatty acid profile and physicochemical characteristics of the meat, five pigs from each treatment were randomly selected at the end of the second experimental phase. When the pigs were slaughtered, a leg and a loin sample were taken from each animal. The ShapiroWilk and Levene tests were used to verify the normal distribution and homogeneity of the variance of the variables. With the data obtained, an ANOVA was performed using the GLM procedure and to detect linear and quadratic trends in response to the inclusion of canola oil in the diet, orthogonal polynomials were used (P≤0.10)(29). ILW was used as a covariate for ADFI, ADG, FLW, FC and FFLG (P≤0.10). Whereas, for BT, LMA and %LM, their respective initial measurements were used as a covariate (P≤0.10).

Results The results of the productive response and carcass characteristics are shown in Table 2. In the finishing stage I (50-75 kg LW), ADG and FLW showed a quadratic trend (P=0.08), decreasing with the inclusion of 2 % of CO in the diet; the incorporation of 4 and 6 % of CO had no negative

1088

Rev Mex Cienc Pecu 2021;12(4):1083-1097

effect. The rest of the variables in the finishing stage I were not modified by the substitution of soybean oil for canola oil (P>0.10). For the finishing stage II, ADFI behaved quadratically (P=0.03), reducing with a level between 2 and 4 % of CO without affecting ADG and FLW, which led to the improvement of FC (P=0.05) with these same levels of CO. In the finishing stage II, backfat thickness decreased linearly (P=0.01), and the percentage of LM increased linearly (P=0.05) in response to the inclusion of CO in the diet. For the rest of the variables, there was no effect (P>0.10) when substituting soybean oil for CO in both stages. Table 2: Productive performance of finishing pigs fed four levels of canola oil in the diet Finishing stage I

Finishing stage II

Canola oil (%)

P-value

Canola oil (%)

P-value

2.66

2.47

2.54

2.59

0.10

0.77

0.24

3.06

2.82

2.92

3.08

0.09

0.72

0.03

0.71

0.63

0.69

0.67

0.02

0.53

0.08

0.84

0.85

0.81

0.03

0.55

0.52

FLW

73.41

70.95

72.62

72.30

0.58

0.52

0.08

96.20

96.14

96.51

95.32

0.85

0.54

0.52

FC FFLG, kg d-1

3.74

3.97

3.71

3.85

0.13

0.87

0.73

3.64

3.39

3.45

3.90

0.18

0.29

0.05

0.27

0.24

0.26

0.01

0.62

0.29

0.26

0.27

0.29

0.27

0.01

0.44

0.40

BT, mm

10.61

10.39

10.57

10.77

0.48

0.77

0.66

15.34

14.53

13.78

13.31

0.60

0.01

0.75

28.05

27.19

27.88

27.66

0.72

0.88

0.66

32.72

32.71

33.56

33.58

0.94

0.92

0.61

ADFI, kg

ADG, kg d-

LMA,

cm2

% LM 39.27 39.33 39.21 39.36 0.28 0.90 0.89 37.01 37.21 37.65 37.59 0.24 0.05 0.62 ADFI= average daily feed intake, ADG= average daily gain, FLW= Final live weight, FC= feed conversion, FFLG= fat free lean gain, BT=backfat thickness, LMA= Longissimus muscle area, LM= lean meat, SE= standard error of the mean, L= linear effect, Q= quadratic effect.

The results of the physicochemical characteristics of leg and loin meat are shown in Table 3. For color, WRC and texture, no significant differences (P>0.10) were found due to the effect of CO levels, with the exception of L* (P=0.03), which increased in loin meat when using 2-4 % of CO. In leg and loin, the pH tended to decrease (P=0.01) as the concentration of CO in the diet increased.

1089

Rev Mex Cienc Pecu 2021;12(4):1083-1097

Table 3: Physicochemical characteristics of the meat of finishing pigs 75-100 kg, fed four levels of canola oil Leg meat

Loin meat

Canola oil (%)

P-value

Canola oil (%)

P-value

6.74

5.43

5.44

5.70

0.10

0.01

6.64

5.63

5.49

5.69

0.20

0.01

45.38

46.54

46.20

47.52

1.60

55.98

58.84

56.24

54.10

1.71

19.78

19.56

19.40

0.52

0.64

17.24

16.86

17.62

16.84

0.51

0.92 0.84

0.03

19.44

0.41 0.89

0.96

a* b* WRC, ml/g Texture, g

4.36 0.89 1225

4.54 0.99 1318

4.00 0.86 1294

4.94 0.87 1443

0.53 0.13 155

0.62 0.96 0.38

0.49 0.84 0.86

6.04 0.89 1791

9.38 0.87 1406

5.80 0.88 1446

5.22 0.86 1445

1.21 0.15 222

0.28 0.95 0.34

0.70 0.12 0.83 0.39

L*= luminosity; a*= red index; b*= yellow index; WRC= water retention capacity, SE= standard error of the mean, L= linear effect, Q= quadratic effect.

Table 4 shows the results of the lipid profile of leg and loin meat. In both samples, myristic acid (P=0.01) and palmitic acid (P=0.06 and P=0.01 respectively) showed a quadratic trend, observing a reduction with 2 % of CO. In both leg and loin, the concentration of oleic acid increased linearly (P=0.01), and linoleic acid reduced (P=0.03 and P=0.01 respectively) in response to the increase in dietary CO. The linolenic acid content in meat was not modified (P>0.10); however, the Ω6:Ω3 ratio reduced linearly (P=0.01) in leg meat when substituting soybean oil for CO. The total SFAs in leg and loin reduced (P=0.06 and P=0.01 respectively) with 2 % of CO, although the other levels of CO did not modify the concentration of these fatty acids. In leg and loin, MUFAs increased linearly (P≤0.01) and PUFAs reduced (P=0.07 and P=0.01 respectively) linearly due to the effect of the inclusion of CO in the diet.

1090

Rev Mex Cienc Pecu 2021;12(4):1083-1097

Table 4: Fatty acid profile of the meat of finishing pigs, fed five levels of canola oil Leg meat Fatty acid

Loin meat

Canola oil (%)

P-value

Canola oil (%)

P-value

Myristic

1.99

1.28

1.41

1.79

0.19

0.56

0.01

2.04

1.35

1.51

1.93

0.19

0.84

0.01

Palmitic

24.80

22.37

23.25

23.22

0.65

0.18

0.06

26.17

23.17

24.56

24.39

0.54

0.09

0.01

Stearic

11.94

10.17

11.24

10.79

0.58

0.37

0.27

12.53

10.67

11.83

11.48

0.60

0.43

0.21

∑SFAs

38.73

33.82

35.9

35.8

1.14

0.23

0.06

40.74

35.19

37.9

37.8

1.07

0.17

0.01

Palmitoleic

3.07

3.09

2.67

3.17

0.26

0.92

0.34

3.28

3.31

3.49

3.40

0.20

0.55

0.78

Oleic

39.90

42.07

42.86

45.09

1.13

0.01

0.98

40.49

45.06

45.23

46.45

0.86

0.01

0.07

Eicosanoic

0.53

0.72

0.68

0.74

0.09

0.11

0.44

0.60

0.69

0.63

0.60

0.06

0.82

0.35

∑MUFAs

43.5

45.88

46.21

49.0

1.21

0.01

0.86

44.37

49.06

49.35

50.45

0.94

0.01

0.09

Arachidonic

1.08

1.35

1.28

1.03

0.10

0.79

0.12

0.84

0.93

0.76

0.93

0.13

0.86

0.73

Linoleic

14.75

16.36

14.41

11.63

1.07

0.03

0.05

12.26

12.84

10.39

8.94

1.02

0.01

0.31

Linolenic

1.38

1.83

1.59

1.73

0.15

0.22

0.27

1.33

1.42

1.15

1.21

0.15

0.30

0.87

Eicosadienoic

0.55

0.74

0.60

0.55

0.10

0.77

0.20

0.45

0.53

0.43

0.27

0.11

0.21

0.28

∑PUFAs

17.76

20.28

17.88

14.94

1.17

0.07

0.04

14.88

15.72

12.73

11.35

1.19

0.01

0.32

Ω6:Ω3

12.04

10.19

10.54

7.64

0.69

0.01

0.48

10.57

10.22

10.65

8.65

1.21

0.29

0.47

SFAs=saturated fatty acids, MUFAs= monounsaturated fatty acids, PUFAs= polyunsaturated fatty acids, L=linear effect, Q=quadratic effect

Discussion The quadratic behavior of ADG and FLW has no clear explanation, since the diets were formulated isoenergetic and isoprotein, assuming that the energy values and nutrients in general for each diet and oil source(22) were appropriate for the productive stage, and therefore a similar response would be expected in the productive variables. According to some authors(10,13,30), when evaluating different sources of fat (soybean, palm, olive and flax oil) in isocaloric diets for finishing pigs, they found no negative effect on the productive performance and carcass characteristics. The change in the lipid profile of the diet when substituting 2 % of soybean oil for CO was marginal, considering that in diets where the productive performance was not affected, substitution was 4 and 6 %, modifying the fatty acid profile to a greater degree. Therefore, a change in the productive response (negative or positive) would be expected when using a greater amount of CO in the diet. Unlike what was obtained in the present research, studies on pigs in the finishing stage(19,31,32) report that the inclusion of CO (4, 3, 2.5 and 3.5 % respectively in each of the studies) in substitution of other oils of vegetable origin (soybean or corn) or animal fat did not affect the productive parameters, as long as the concentration of nutrients in the diets was respected, emphasizing mainly energy. Moreover, when evaluating CO levels of 0, 5 and 10 %, there was a

1091

Rev Mex Cienc Pecu 2021;12(4):1083-1097

linear effect to improve feed consumption, weight gain and feed conversion in growing-finishing pigs, in addition, there was no effect on backfat thickness and LMA(33). In the present work it was assumed that, by not altering the general concentration of nutrients, but that of some fatty acids, the physicochemical characteristics of the meat could have minimal alterations. This assumption was supported by studies conducted with the addition of 2.5-4 % of CO in the diet of pigs on meat characteristics, where it is reported that the inclusion of CO had no negative effect(18,19,31). In fact, other researchers(16) found that the inclusion of 2 % of CO in the diet of pigs increased the pH, favored the sensory characteristics and the marbling of the meat, compared to diets without the addition of oil. Although the use of very high concentrations (10 %) of CO in the diet affected the marbling and color of the meat, it also reduced the firmness of fat(33), probably because that level of oil addition in the diet provides too many monounsaturated and polyunsaturated fatty acids, which are deposited in adipose and muscle tissue, which changes the characteristics of meat and fat. In the present investigation, the increase in CO reduced the pH, tending to reach the maximum and minimum pH values (5.4-5.8)(34). In this post-rigor interval of the meat, they indicate that the production of putrefaction compounds, such as biogenic amines, aldehydes, ketones and shortchain fatty acids, has not begun, since the pH depends on the time: post-mortem temperature relationship, consequently, chemical compounds that cause the pH to increase are generated(34). Also, the texture in leg and loin was not affected by the different treatments, probably because the long-chain polyunsaturated fatty acids were incorporated into the fatty tissue and not into the muscle tissue, since the hardness of the meat is due to the structures of the muscle fibers formed in a high percentage by proteins, therefore, polyunsaturated fatty acids did not affect the hardness of the meat as lipids were not significantly incorporated into the muscle fibers(35). Regarding the WRC variable, in the same way, it was not affected in leg and loin by the different treatments; this is probably explained because when adding long-chain polyunsaturated fatty acids to non-ruminant diets, there is an increase in the ratio of saturated to unsaturated fatty acids in the fat of the pig, since the higher the degree of unsaturation, the lower the quantity of electrical charges that can interact with water(36). The decrease in linoleic acids and PUFAs, and the increase in oleic acids and MUFAs as the level of CO increased, coincides with the results obtained in other studies when adding from 3 to 10 % of CO(3,19,33). In previous reports(3,19,31), they found no changes in the content of myristic acid and SFAs when substituting some type of oil for CO, contrary to what was found in the present study; however, the reduction of palmitic acid was observed when adding from 4 to 10 % of CO(3,33). Supplementation from 3-4 % of CO in substitution of soybean oil in diets for pigs in the finishing stage increased the content of oleic, linolenic acids and MUFAs, reduced the concentration of

1092

Rev Mex Cienc Pecu 2021;12(4):1083-1097

linoleic acid, PUFAs, total Ω6 and the Ω6:Ω3 ratio in meat fat(3,19). By adding 5 or 10 % of CO in diets for finishing pigs, oleic, linoleic, linolenic acids, MUFAs and PUFAs increased linearly, and palmitic acid in meat fat reduced compared to oil-free diets(33). CO (2.5 %) in diets for finishing pigs increases the content of oleic acid and MUFAs, reduces the amount of linoleic acid and PUFAs in body fat(31), increases the content of linolenic acid and improves the oxidative stability in meat(17,18,31) compared to corn oil. Another possible option to try to improve the lipid profile of pork would be to use different types of oil, since in some studies(19,37), they have found that the combination of CO (1-1.5 %) with flaxseed oil (1.5-2.3 %) has a favorable response in the fatty acid profile in meat, since they increase oleic, linolenic acids and MUFAs, decrease linoleic acids, PUFAs, total Ω6 and the Ω6:Ω3 ratio. The results of the present work show that the fatty acid profile in pork is modified depending on the content of FAs in the oil source of the diet; since CO and soybean oil have different fatty acid profiles(22) with a predominance of oleic and linoleic unsaturated fatty acids, respectively. In pigs, the fatty acid profile of the diet is reflected in the body fat, because part of the ingested fatty acids is deposited directly in the tissues(30,38,39). The degree of change of body fatty acids depends on the time and percentage of fat supplementation in the diet(40,41). Specific fatty acids have different rates or potential for change in body fat induced by the fat supplementation in the diet(12,19,38). In addition, the supply of fats in the diet reduces lipogenesis(42,43), therefore, an increase in the incorporation of the fatty acids of the diet into body fat.

Conclusions and implications The inclusion of canola oil (2-6 %) in the diet of pigs in the finishing stage is effective in proportionally increasing the oleic acid content, improving the Ω6:Ω3 ratio, reducing the content of saturated fatty acids and increasing monounsaturated fatty acids in meat. In addition, the use of up to 6 % canola oil in the diet does not affect the productive performance, carcass characteristics and positively stabilizes the pH of the meat. Acknowledgements and conflict of interest Thanks to the Colegio de Postgraduados for the funding of this work. The authors declare that they have no conflict of interest with respect to this work.

1093

Rev Mex Cienc Pecu 2021;12(4):1083-1097

Literature cited: 1.

Jasinska K, Kurek A. The effect of oil plants supplementation in pig diet on quality and nutritive value of pork meat. Anim Sci Pap Rep 2017;35(2):137-146.

Clarke R, Frost C, Collins R, Appleby P, Peto R. Dietary lipids and blood cholesterol: Quantitative meta–analysis of metabolic ward studies. Br Med J 1997;314(7074):112-117.

Vehovsky K, Stupka R, Zadinova K, Sprysl M, Okrouhla M, Lebedova N, et al. Effect of dietary rapeseed and soybean oil on growth performance, carcass traits, and fatty acid composition of pigs. R Bras Zootec 2019;48:e20180131.

Saini RK, Keum YS. Omega-3 and omega-6 polyunsaturated fatty acids: Dietary sources, metabolism, and significance- A review. Life Sci 2018;203:255-267.

Simopoulos AP. Evolutionary aspects of diet, the omega-6/omega-3 ratio and genetic variation: nutritional implications for chronic diseases. Biomed Pharmacother 2006;60(9):502-507.

Sales-Campos H, Reis SP, Crema PB, Santana SJ, Ribeiro CC. An overview of the modulatory effects of oleic acid in health and disease. Mini Rev Med Chem 2013;13(2):201-210.

Karacor K, Cam M. Effects of oleic acid. Medical Sci Discovery 2015;2(1):125-132.

Castellanos L, Rodriguez M. El efecto de omega 3 en la salud humana y consideraciones en la ingesta. Rev Chil Nutr 2015;42(1):90-95.

Skiba G, Polawska E, Sobol M, Raj S, Weremko D. Omega-6 and omega-3 fatty acids metabolism pathways in de body of pigs fed diets with different sources of fatty acids. Arch Anim Nutr 2015;69(1):1-16.

10. Teye GA, Sheard PR, Whittington FM, Nute GR, Stewart A, Wood JD. Influence of dietary oils and protein level on pork quality. 1. Effects on muscle fatty acid composition, carcass, meat and eating quality. Meat Sci 2006;73(1):157-165. 11. Apple JK, Maxwell CV, Galloway DL, Hamilton CR, Yancey JWS. Interactive effects of dietary fat source and slaughter weight in growing-finishing swine: II. Fatty acid composition of subcutaneous fat. J Anim Sci 2009;87(4):1423-1440. 12. Apple JK, Maxwell CV, Galloway DL, Hamilton CR, Yancey JWS. Interactive effects of dietary fat source and slaughter weight in growing-finishing swine: III. Carcass and fatty acid compositions. J Anim Sci 2009;87(4):1441-1454.

1094

Rev Mex Cienc Pecu 2021;12(4):1083-1097

13. Benz JM, Tokach MD, Dritz SS, Nelssen JL, DeRouchey JM, Sulabo RC, et al. Effects of choice white grease and soybean oil on growth performance, carcass characteristics, and carcass fat quality of growing-finishing pigs. J Anim Sci 2011;89(2):404-413. 14. Dugan ME, Vahmani P, Turner TD, Mapiye C, Juárez M, Prieto N, et al. Pork as a source of omega-3 (n-3) fatty acids. J Clin Med 2015;4(12):1999-2011. 15. Leikus R, Juskiene V, Juska R, Juodka R, Stankeviciene D, Nainiene R, et al. Effect of linseed oil sediment in the diet of pigs on the growth performance and fatty acid profile of meat. R Bras Zootec 2018;47:e20170104. 16. Kolacz R, Korniewicz A, Dobrzański Z, Bykowski P, Kolacz D, Korniewicz D. Effect of dietary fish and rapeseed oils on sensory and physicochemical characteristics of pigs M. Longissimus dorsi and fatty acid composition. J Anim Feed Sci 2004;13(143):143-152. 17. Corino C, Magni S, Pagliarini E, Rossi R, Pastorelli G, Chiesa LM. Effects of dietary fats on meat quality and sensory characteristics of heavy pig. Meat Sci 2002;60(1):1-8. 18. Pastorelli G, Magni S, Rossi R, Pagliarini E, Baldini P, Dirinck P, et al. Influence of dietary fat, on fatty acid composition and sensory properties of dry-cured Parma ham. Meat Sci 2003;65(1):571-580. 19. Bertol TM, De Campos RML, Ludke JV, Terra NN, De Figueiredo EAP, Coldebella A, et al. Effects of genotype and dietary oil supplementation on performance, carcass traits, pork quality and fatty acid composition of backfat and intramuscular fat. Meat Sci 2013;93(3):507516. 20. García E. Modificaciones al sistema de clasificación de Köppen. 5a ed. México DF: Instituto de Geografía, Universidad Nacional Autónoma de México; 2004. 21. Microsof Excel. Microsoft Corporation. 1985-2001. Redmond WA, USA. 2007. 22. NRC. National Research Council. Nutrient requirements tables and feed ingredient composition. Nutrient requirements of swine. 11th ed. Washington, DC, USA: National Academy Press; 2012. 23. Burson D, Berg E. Procedures for estimating pork carcass composition. Pork quality facts. Des Moines, IA, USA: National Pork Producers Council; 2001.

1095

Rev Mex Cienc Pecu 2021;12(4):1083-1097

24. SAGARPA. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Norma Oficial Mexicana NOM-033-SAG/ZOO-2014. Métodos para dar muerte a los animales domésticos y silvestres. México. 2014. En: https://www.dof.gob.mx/nota_detalle.php?codigo=5405210&fecha=26/08/2015 Consultado 26 Nov, 2019. 25. Mancini RA, Hunt M. Current research in meat color. Meat Sci 2005;71(1):100-121. 26. Braña VD, Ramírez RE, Rubio LMS, Sánchez EA, Torrescano UA, Arenas MML, et al. Manual de análisis de calidad en muestras de carne. 1er ed. Querétaro, México. Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal; 2011. 27. Guerrero LI, Ponce AE, Pérez ML. Curso práctico de tecnología de carnes y pescado. México DF: Universidad Metropolitana, Unidad Iztapalapa; 2002. 28. Folch J, Lees M, Sloane SGH. A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem 1957;226:497-509. 29. SAS. SAS/STAT User’s Guide (9.4) Cary NC, USA: SAS Inst. Inc. 2010. 30. Olivares A, Daza A, Rey AI, Lopez-Bote CJ. Interactions between genotype, dietary fat saturation and vitamin A concentration on intramuscular fat content and fatty acid composition in pigs. Meat Sci 2009;82(1):6-12. 31. Rossi R, Corino C. Influence of long-term nutrition with different dietary fats on fatty acid composition of heavy pigs backfat. Ital J Anim Sci 2002;1(1):7-16. 32. De Sousa RV, Ribeiro O, Zangeronimo MG, De Sousa VC, Da Silva MSF, Pereira LJ. Total cholesterol and its fractions in the blood of finishing pigs fed diets with different levels of canola oil. Acta Sci Vet 2013;41(1):1-6. 33. Myer RO, Lamkey JW, Walker WR, Brendemuhl JH, Coms GE. Performance and carcass characteristics of swine when fed diets containing canola oil and added copper to alter the unsaturated:saturated ratio of pork fat. J Anim Sci 1992;70(5):1417-1423. 34. Guerrero LI. Meat spoilage detection. In Nollet L, Toldrá F editors. Handbook of processed meat and poultry analysis. Boca Raton, Florida USA: CRC Pres; 2009:445-460. 35. Pérez MI, Larrea V, Quiles A, Llunch MA. Microstructure of muscle foods. In: Nollet L, Toldrá F, editors. Handbook of processed meat and poultry analysis. Boca Raton, Florida USA: CRC Pres; 2009:335-352.

1096

Rev Mex Cienc Pecu 2021;12(4):1083-1097

36. Lo Fiego DP, Macchioni P, Santero P, Pastorelli G, Corino CC. Effect of dietary conjugated linoleic acid (CLA) supplementation on CLA isomers content and fatty acid composition of dry-cured Parma ham. Meat Sci 2005;70(2):285-291. 37. Lisiak D, Grzeskowiak E, Borzuta K, Raj S, Janiszewski P, Skiba G. Effects of supplementary vegetable and animal fats on the slaughter values of fatteners, meat quality, and fatty acid profile in pigs. Czech J Anim Sci 2013;58(11):497-511. 38. Apple JK, Maxwell CV, Galloway DL, Hutchison S, Hamilton CR. Interactive effects of dietary fat source and slaughter weight in growing-finishing swine: I. Growth performance and Longissimus muscle fatty acid composition. J Anim Sci 2009;87(4): 1407-1422. 39. Juárez M, Dugan MER, Aldai N, Aalhus JL, Patience JF, Zijlstra RT, et al. Feeding coextruded flaxseed to pigs: Effects of duration and feeding level on growth performance and backfat fatty acid composition of grower-finisher pigs. Meat Sci 2010;84(3):578-584. 40. Romans JR, Wulf DM, Johnson RC, Libal GW, Costello WJ. Effects of ground flaxseed in swine diets on pig performance and on physical and sensory characteristics and omega-3 fatty acid content of pork: II. Duration of 15% dietary flaxseed. J Anim Sci 1995;73(7):1987-1999. 41. Kouba M, Enser M, Whittington FM, Nute GR, Wood JD. Effect of a high-linolenic acid diet on lipogenic enzyme activities, fatty acid composition, and meat quality in the growing pig. J Anim Sci 2003;81(8):1967-1979. 42. Allee GL, Baker DH, Leveille GA. Influence of level of dietary fat on adipose tissue lipogenesis and enzymatic activity in the pig. J Anim Sci 1971;33(6):1248-1254. 43. Smith DR, Knabe DA, Smith SB. Depression of lipogenesis in swine adipose tissue by specific dietary fatty acids. J Anim Sci 1996;74(5):975-983.

1097

https://doi.org/10.22319/rmcp.v12i4.5904 Article

The soil-plant interface in Megathyrsus maximus cv. Mombasa subjected to different doses of nitrogen in rotational grazing

Caryze Cristine Cardoso Sousa a Denise Baptaglin Montagner b Alexandre Romeiro de Araújo b Valéria Pacheco Batista Euclides b Gelson dos Santos Difante c Antonio Leandro Chaves Gurgel c* Daniele Lopes de Souza d

Federal University of Grande Dourados. Dourados Mato Grosso do Sul, Brazil.

Embrapa Beef Cattle. Av. Radio Maia, 830. Zona Rural, 79.106-550. Campo Grande, MS, Brazil. c

Federal University of Mato Grosso do Sul. Faculty of Veterinary Medicine and Animal Science. Campo Grande, Mato Grosso do Sul, Brazil. d

Dom Bosco Catholic University. Campo Grande, Mato Grosso do Sul, Brazil.

* Corresponding author: antonioleandro09@gmail.com

Abstract: This work aimed to evaluate the effects of three nitrogen (N) doses on the morphogenic and structural characteristics, root mass (RM) and distribution in the soil profile, and penetration soil resistance of Mombasa guineagrass pastures managed with rotational stocking. The experimental design used randomized blocks with three N doses (100, 200, and 300 kg ha-1) and three replicates. The criterion for interrupting the pastures’ regrowth was the height of 80 to 90 cm of the canopy (90–95 % of light interception by the canopy). The animals were removed from the paddocks when the canopy reached 50 % of the pregrazing height. Forage mass and accumulation, canopy morphogenic and structural 1098

Rev Mex Cienc Pecu 2021;12(4):1098-1116

characteristics, RM and distribution in the soil profile, and soil resistance to penetration were evaluated. In pastures fertilized with 200 and 300 kg ha-1 of N, the highest leaf appearance (0.090 and 0.081 leaves-1 tiller-1 d-1), elongation rates (2.82 and 2.61 cm tiller-1 d-1) and highest daily forage accumulation (113.8 and 106.6 kg ha-1d-1) were observed. Using 300 kg ha-1 of N promoted greater soil resistance to penetration at 10 cm of depth in the post-grazing (3.3 MPa). No effect of N doses was observed for RM (P>0.05). The pre- and post-grazing height control of animals in the paddocks therefore helped to maintain the pasture structure and avoid the soil compaction process. According to the results, it is concluded that 200 and 300 kg ha-1 of N fertilization is a strategy for intensifying pastures. Key words: Canopy height, Leaf appearance rate, Light interception, Root mass, Soil resistance.

Received: 18/12/2020 Accepted: 29/03/2021

Introduction Intensive grazing systems use cultivars with high forage production potential and good nutritional value that require investment in maintenance fertilization. Panicum maximum (Syn. Megathyrsus maximus) cv. Mombasa is the most used cultivar due to its high tillering and regrowth vigor after grazing(1,2). This cultivar also has a production potential that can exceed 27 t ha-1 yr(3,4) and achieves nutritional values compatible with individual gains above 700 g animal day-1(5). Due to its growth habit and productive potential, this cultivar should be managed using intermittent stocking. Furthermore, the rest period must be interrupted when the forage canopy intercepts 90 to 95 % of the incident light(6), and the animals’ removal must occur when 50 % of the forage has been grazed(4,7). Nitrogen (N) fertilization enhances a pasture’s production, as it acts directly on the morphogenic and structural characteristics of the forage plant(8). The N increases the leaves’ appearance and elongation rates and reduces the leaves’ life span, and the phyllochron still stimulates the sprouting of axillary buds, increasing the production of tillers(9,10). In this sense, morphogenesis study on fertilized pastures allows one to understand the physiological mechanisms of plant growth, as well as N’s role as a modulator, regulator, and enhancer of this process. Little research has been conducted on N’s effects on the root system of pastures, especially in the tropics. However, N has been proven to influence root growth in periods

1099

Rev Mex Cienc Pecu 2021;12(4):1098-1116

of higher rainfall(11), which can lead to a linear increase in root mass (RM)(12). Nitrogen fertilization increases a pasture’s productive capacity with a significant increase in the stocking rate(13,14), which can compromise the soil’s physical characteristics(15). Much regarding the effects of animal trampling that results from grazing pressure on the soil’s physical attributes—including soil compaction and soil penetration resistance (PR)—and root development remains to be investigated since a pasture’s longevity is based on the soil’s chemical, biological, and physical balance. This last factor determines the roots’ ability to develop and exploit soils to absorb water and nutrients. The following research questions were formulated for this work: How does N fertilization affect morphogenic and structural characteristics and forage accumulation? Will pastures that receive higher N doses be more compacted when the PR method evaluates them? Would correct pasture management (based on the 95% LI) associated with moderate grazing intensity be able to reduce the compaction effect on root development? In search of answers, the objective was to evaluate the effects of fertilization using three different N doses on the morphogenic and structural characteristics, RM and distribution in the soil profile, and soil penetration resistance of Mombasa guineagrass pastures managed with rotational stocking.

Material and methods Experiment location and edaphoclimatic monitoring The experiment was conducted at Embrapa Beef Cattle, Campo Grande, MS (20º27’S, 54º37’W and an altitude of 530 m) from November 2016 to April 2017. According to the Köppen classification, this region has a tropical savanna climate (Aw) with seasonal rainfall distribution. The Embrapa Beef Cattle weather station, located approximately 4 km from the experimental area, recorded the rainfall and minimum average, and maximum temperatures (Figure 1).

1100

Rev Mex Cienc Pecu 2021;12(4):1098-1116

Figure 1: The monthly average and historical precipitation and minimum, average, and maximum temperatures during the experimental period

The experimental area’s soil is classified as Red Latosol and has clay contents around 30 %(16). Before the experiment began, the soil was sampled in the 0–10, 0–20, and 20– 40 cm layers for chemical evaluation (Table 1). Based on the soil analysis results and the proposed production system, the pastures were fertilized in coverage with 80 kg ha-1 of P2O5 and 80 kg ha-1 of K2O in November 2016. Table 1: The chemical characteristics of the experimental area’s soil at depths of 0–10, 0–20, and 20–40 cm in pastures of Mombasa guineagrass fertilized Doses

N100

N200

N300

Depth (cm) 0–10 0–20 20–40 0–10 0–20 20–40 0–10 0–20 20–40

pH CaCl2 5.53 5.56 5.47 5.50 5.53 5.33 5.27 5.33 5.42

PMg dm-³ 4.34 3.89 1.47 5.89 4.64 1.87 4.06 3.85 1.33

MOg dm-³ 44.03 42.38 28.38 37.92 37.24 25.62 40.08 39.46 32.64

K Ca cmol dm-3 0.43 4.08 0.32 4.18 0.19 2.06 0.38 3.87 0.35 3.83 0.19 2.22 0.41 3.45 0.26 3.48 0.13 2.32

Ca+Mg

Al+H

1.18 1.15 0.97 1.17 1.18 1.42 1.10 1.08 0.97

5.27 5.33 3.23 5.03 5.02 3.63 4.55 4.57 3.28

0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

3.47 3.49 3.15 3.25 3.10 2.98 4.25 3.93 3.15

5.69 5.66 3.42 5.42 5.37 3.83 4.96 4.83 3.42

9.16 9.15 6.57 8.66 8.46 6.80 9.21 8.76 6.56

V % 62.17 61.88 51.96 62.54 63.39 56.36 53.93 55.22 52.33

N100 = 100 kg ha-1 yr-1 of N; N200 = 200 kg ha-1 yr-1 of N; and N300 = 300 kg ha-1 yr-1 of N.

Experimental design and conduction

The 13.5 ha experimental area was divided into three blocks of 4.5 ha each; each block was then divided into three 1.5 ha modules and these into six 0.25 ha paddocks. The experimental design used completely randomized blocks, with three treatments and three repetitions (modules). The treatments were Mombasa guineagrass pastures fertilized with doses of 100 (N100), 200 (N200), and 300 (N300) kg ha-1 of N.

1101

Rev Mex Cienc Pecu 2021;12(4):1098-1116

The N fertilization was divided into two applications for the N100 treatment and three applications for the N200 and N300 treatments. The first N dose was applied in November, along with P and K (80 kg ha-1 of P2O5 and 80 kg of K2O). The N source used was urea, applied until the end of March (rainy season) and only when the animals left the paddocks. The grazing method used was rotational stocking with a variable stocking rate (put-and-take). Canopy heights of 80 to 90 cm and 40 to 50 cm were adopted as preand post-grazing conditions(6), respectively, for all N doses evaluated. Fifty-four (54) crossbred steers of the Angus x Nellore breed, with the age and initial weight of 10 months and 300 kg, were used to lower the pastures, and performance evaluations were not performed for this experiment. The animals received mineral supplementation ad libitum.

Forage canopy estimated variables

The forage canopy height (cm), before and after grazing, was determined using a graduated ruler at 40 random points per paddock. The height of each point corresponded to the canopy height around the ruler, and the average of these points represented the average canopy height in each paddock. For the forage mass estimation, before and after grazing, a paddock from each module was chosen at random, and nine 1 m2 samples were cut close to the ground level in each grazing cycle(4). The same paddock was sampled throughout the experimental period. The samples were weighed and divided into two subsamples: One was dried at 65 ºC until constant weight to determine the total dry matter. The other was manually subdivided into leaf (leaf blade), stem (sheath and stem), and dead material, dried at 55 ºC until constant weight, and weighed. The percentage of each component was determined to estimate the leaf:stem ratio. The forage accumulation rate was calculated using the difference between the forage mass in the current pre-grazing and the previous post-grazing, considering only the green portion (leaf and stem), divided by the number of days between samples. The total forage accumulation during the experimental period was the sum of the forage accumulation of all grazing cycles. At the beginning of each paddock rest period, 10 tillers in each experimental unit were marked to determine morphogenic and structural characteristics. The tillers were marked in two paddocks per module, totaling 18 paddocks (six paddocks for each N dose evaluated). Measuring individual leaves and tillers allowed to evaluate the following factors: leaf appearance rate (LAR; leaves tiller-1 d-1), or the number of leaves per tiller divided by the number of days in the evaluation period; phyllochron (days), or the inverse of LAR; leaf elongation rate (LER; cm tiller-1 d-1), or the sum of leaf blade elongation divided by the number of days in the evaluation period; stem elongation rate (SER; cm tiller-1 d-1), or the sum of stem elongation divided by the number of days in the evaluation 1102

Rev Mex Cienc Pecu 2021;12(4):1098-1116

period; final leaf length (FLL; cm tiller-1), or the leaf blades’ fully expanded average length; leaf senescence rate (LSR; cm tiller-1 d-1), or the relationship between the sum of the leaf blades’ senescent lengths in the tiller and the number of days in the evaluation period; green leaves number (GLN), or the number of expanding and expanded leaves, disregarding the senescent leaves of each tiller; leaf life span (LLS; days), or the period of time from the leaf appearance until its death, estimated using the equation LLS = GLN x Phyllochron(17). The tiller population density (TPD) was estimated by counting tillers in three 1 m2 (number of tillers per m2) areas per experimental unit. The locations of these points were chosen to represent the average pasture condition at the time of the assessment. These areas were kept fixed and marked with a wooden stake and were changed only when they no longer represented the average pasture condition. Tillering counting was performed during the pre-grazing condition.

Soil estimated variables

The dry RM was evaluated by collecting eight samples from two paddocks of each module, using a cylindrical auger 4.8 cm wide and 10 cm high, from March 20 to 24, 2017. Four samples were collected under the tussocks and four outside the tussocks. Each sample was subsampled at depths of 0–10, 0–20, 20–30, and 30–40 cm. The samples of moist soil + root were packed in identified plastic bags. The soil + root samples were washed with running water using sieves with 2 and 1 mm screens, separating the soil from the RM. The roots were dried in an oven at 60 to 65 ºC for 72 h and then weighed to determine the dry matter content. To assess soil moisture, a soil sample deformed by an experimental module was collected(18). The soil moisture values were used to adjust the dry RM calculations (kg ha-1) and the root distribution in the soil profile. Soil penetration resistance (PR) was estimated using the Falker PenetroLOG - PLG 1020 (electronic soil compaction meter) from March 15 to April 17, 2017. The PR assessments were performed in 10 positions in the two central paddocks of each module before and after grazing. Additionally, on the same day that the PR assessments were completed, samples were collected to determine soil moisture at depths of 0–15, 15–30, 30–45, and 45–60 cm for later correction of the PR values(19).

1103

Rev Mex Cienc Pecu 2021;12(4):1098-1116

Statistical analysis

Statistical analysis of the forage mass and accumulation rate data was conducted using a mathematical model that contained the random block effect and the fixed effects of treatments, seasons, and the interactions between them. For all analyses, the mixed procedure available at the SAS Institute (1996) was used. The comparison of means was performed using the Tukey test, adopting a 5% probability. In the case of significant interactions, the comparison of means was performed using the probability of the difference and the Tukey test at 5%. Principal components (PCs) evaluated the data concerning the morphogenic and structural characteristics: the data set was standardized, which means that each descriptor presented zero mean and unit variation. This analysis allowed to reduce the space of the original variables in a smaller set, preserving the maximum of the data’s original variability. All statistical analyses were conducted using software R version 3.6.1. For RM and soil PR, a randomized block design in a split-plot arrangement was adopted. The residual effect of the N doses was allocated to the plot and the depths to the subplot. The following model was used: Yijk = μ + Di + Bj + αij + Pk + (D*P)ik + βijk Yijk= value observed in dose i, block j, and depth k; μ= overall average effect; Di= dose effect i (i = 100, 200, and 300); Bj= block effect j; αij= random error effect attributed to the parcel; Pk= depth effect k; (D*P)ik = the effect of the interaction between dose and depth; and βijk= random error assigned to the subplot. When significant according to the F test, the effect of doses was analyzed using the Tukey test and the effect of depths with the Scott-Knott test, both at 5% probability.

Results Morphogenic and structural characteristics

Fertilization with N200 and N300 promoted the highest LAR and LER compared to fertilization with N100 (Figure 2). The LSR was high in pastures fertilized with N100,

1104

Rev Mex Cienc Pecu 2021;12(4):1098-1116

and it was the same in pastures fertilized with N200 and N300 (Table 3). Moreover, pastures fertilized with N100 demonstrated the lowest SER, pastures fertilized with N300 the highest SER, and pastures fertilized with N200 an intermediate SER (Figure 2). Figure 2: The morphogenic and structural characteristics of the canopy of Mombasa guineagrass fertilized with nitrogen (N) doses

The values in parentheses indicate the standard error of the mean. SER= stem elongation rate; LAR= leaf appearance rate; LER= leaf elongation rate; LLS= leaf life span; LSR= leaf senescence rate; FLL= final leaf length; TPD= tiller population density; GLN= green leaves number; LAI= Leaf area index.

Pastures fertilized with N100 also had the lowest TPD, while pastures fertilized with N200 and N300 had the highest TPD (Figure 2). The FLL did not differ between the N doses. Pastures that received N100 revealed the lowest GLN per tiller, whereas pastures that received N300 revealed the highest; the N200 dose promoted intermediate GLN values. The leaf:stem ratio did not differ for the evaluated N doses. Finally, the phyllochron and LSR were higher in pastures fertilized with N100 and lower in pastures fertilized with N200 or N300 (Table 2).

1105

Rev Mex Cienc Pecu 2021;12(4):1098-1116

Table 2: Phyllochron and leaf senescence rate (LSR) averages in Mombasa guineagrass pastures fertilized with N doses N doses (kg ha-1) Variables 100 200 300 P-value a b b Phyllochron, days 18.6 11.3 12.9 0.0001 -1 -1 a b b LSR, cm tiller d 1.09 0.72 0.73 0.0001 ab Distinct lowercase letters on the same line differ according to the Tukey test (P>0.05). The PC analysis indicated that only two PCs explained 99 % of the variation in the data set. The first PC explained 84.2 % of the total data variation and aspects related to the tissues’ appearance (Figure 3). In this PC, the LAR was positively associated with the FLL, LER, GLN, and SER and negatively associated with the phyllochron, FLL, and LSR. In addition, the LAR, FLL, LER, GLN, and SER indicated a high association with the N200 and N300 doses. In the second PC, which explained 15.7 % of the data variation, a positive association between the phyllochron, LLS, GLN, FLL, and SER and a negative association between these variables and the LAR and LER were observed. In this PC, the phyllochron, LLS, GLN, FLL, and SER were associated with the N300 dose and the LAR and LER with the N200 dose. The LSR demonstrated neutrality by N doses. Figure 3: Biplot of the first principal component (x-axis) and the second principal component (y-axis)

FLL= final leaf length; Phil= filocron; LAR= leaf appearance rate; LER= leaf elongation rate; GLN= number of green leaves; LSR= leaf senescence rate; LLS= leaf life span; SER= stem elongation rate.

1106

Rev Mex Cienc Pecu 2021;12(4):1098-1116

Canopy height, forage mass, and accumulation rate

The pre- and post-grazing heights approximated the predetermined targets for the three N doses evaluated. The height averages were 81.6 (± 1.61) cm in the pre-grazing condition and 44.7 (± 1.21) cm in the post-grazing condition (when the animals left the paddocks). Mombasa guineagrass pastures fertilized with N300 revealed the highest daily forage accumulation rate (Table 3) and the shortest grazing and resting periods, whereas pastures fertilized with N100 revealed the longest grazing and resting periods. Those fertilized with N200 presented intermediate values. Table 3: The forage accumulation rate; pre- and post-grazing heights; and grazing and resting period averages in Mombasa guineagrass pastures fertilized with nitrogen (N) doses N doses (kg ha-1) Variables 100 200 300 P-value a ab b Grazing period, days 6.5 (0.16) 5.6 (0.16) 5.1 (0.14) 0.0001 a b c Rest period, days 30.9 (0.88) 27.5 (0.84) 24.6 (0.82) 0.0001 -1 -1 c b a FAR, kg ha d 86.2 (3.1) 106.6 (3.8) 113.8 (3.5) 0.0001 abc

FAR= Forage accumulation rate. Distinct lowercase letters on the same line differ (P<0.05); values in parentheses are the standard error of the mean.

The forage mass (5,670 ± 121 kg ha-1); leaf (67.9 ± 2.1 %), stem (17.3 ± 1.3 %), and dead material (14.8 ± 1.1 %); and leaf:stem ratio (3.9 ± 0.6) did not differ between the N doses in the pre-grazing. N doses also did not affect the forage mass and the percentages of leaf, stem and dead material in post-grazing, with average values and their standard errors of: 3,544 ± 109 kg ha-1, 67.9 ± 2.1 %, 31.1 ± 1.7, 41.5 ± 3.5 %, for forage mass, leaf, stem and dead material, respectively.

Mechanical penetration resistance of the soil and root mass

No interaction between the N doses and soil depths (P=0.1397) occurred for mechanical PR of the soil. Furthermore, the N doses had no effect on the PR (P=0.4693), with an average of 2.2 ± 0.16 MPa. However, in pre-grazing, a soil depth effect (P=0.0001) occurred on the PR. The highest PR was observed in the 10 cm layer (2.77 ± 0.06 MPa), followed by the 5–20 cm layers. Lower PRs were observed deeper in the soil. In post-grazing, an interaction between the N doses and soil depths (P=0.0001) did occur for PR (Table 4). Up to 10 cm of depth, a higher PR was observed in pastures fertilized with N300 compared to those fertilized with N100 and N200. In the 15 cm layer, the PR did not differ by N doses. Conversely, in the 20–35 cm layers, the PR was higher in 1107

Rev Mex Cienc Pecu 2021;12(4):1098-1116

pastures fertilized with N300 and lower in pastures fertilized with N200; those fertilized with N100 remained unaffected. After 40 cm of depth, no difference in PR between N levels was observed. Table 4: Mechanical penetration resistance (MPa) of the soil submitted to different nitrogen (N) doses in Mombasa guineagrass pastures during post-grazing N doses (kg ha-1) Depth (cm) 100 200 300 bA bA 5 2.5 2.5 3.4aA 10 2.7bA 2.7bA 3.3aA 15 2.2aB 2.2aB 2.7aB 20 2.5abA 2.1bB 2.9aB 25 2.4abB 1.9bC 2.6aB 30 2.2abB 1.7bC 2.4aC 35 2.1abB 1.6bD 2.2aD 40 1.9aC 1.6aD 2.0aD 45 1.8aC 1.5aD 1.8aE 50 1.6aD 1.5aD 1.7aE 55 1.6aD 1.4aD 1.6aE 60 1.5aD 1.4aD 1.5aE ab

Averages followed by distinct lowercase letters on the same line differ (P<0.05). AB Distinct uppercase letters in the same column differ (P<0.05). Standard error of the mean = 0.102.

No interaction effect between N doses and soil depths occurred for the RMs (P>0.05). In addition, no N dose effect was observed for the RMs under (2.70 ± 0.595 t/ha of DM) or outside (1.05 ± 0.230 t/ha of DM) the tussocks (P>0.05), which differed by the sampled layers (Figure 4). The largest RMs were observed in the 0–10 cm layer, followed by the 10–20 cm layer; the 20–30 and 30–40 cm layers had the lowest RMs, with no differences between them. The sum of all sampled layers revealed 10.82 t ha-1 of root DM in the space under and 4.22 t/ha of root MS outside the tussocks.

1108

Rev Mex Cienc Pecu 2021;12(4):1098-1116

Figure 4: Root mass inside and between Mombasa guineagrass tussocks fertilized with nitrogen doses

ab Different letters compare depths in the same position according to the tussock.

Discussion Nitrogen fertilization influences the morphogenic and structural characteristics of the canopy of Mombasa guineagrass(9,10,20). Indeed, different responses to the N doses used has been observed. For instance, high N doses led to increases in LAR and LER(9,10,21). Nitrogen also stimulates a systematic effect on leaf growth: as N nutrition increases, the LAR increases as well. Moreover, N increases cell production in growing leaves, altering cell division and expansion rates(22) and thus affecting the LER. Pastures fertilized with N100 therefore had a lengthier leaf elongation due to their lower supply of this nutrient. As N becomes more available to a plant, its LER increases, increasing its final leaf size and ultimately decreasing its useful life(23). Mombasa guineagrass pastures that received higher N doses (200 and 300 kg ha-1) reached the pre-grazing target of 80–90 cm more quickly than those that received a lower N dose (100 kg ha-1) due to their shorter phyllochron, or the time necessary for two consecutive leaves to appear. The higher N doses may have favored the recovery of the leaves’ photosynthetic apparatus of Mombasa guineagrass soon after defoliation, reducing the phyllochron and the time the pastures needed to recover. The reductions in LLS due to N fertilization necessitated adjusting grazing management practices to harvest the forage at the appropriate time, which the evolution of the LAR, LER, and LSR can determine. The different pastures’ grazing and rest periods resulted from adjusting the grazing management to achieve the appropriate forage use condition. Using N in fertilization strategies favors the growth and accumulation rate of forage by increasing the rates of enzymatic reactions and the metabolism of forage plants(23). As the forage accumulation increases, the leaf area index also increases, promoting the shading

1109

Rev Mex Cienc Pecu 2021;12(4):1098-1116

of leaves and tillers at the pasture base(24). In their search for light, the stems elongate, and the younger, more photosynthetically efficient leaves are exposed at the top of the canopy(20,25,26). Grazing management with pasture condition control enabled forage harvesting when the number of stems did not harm the canopy structure, since no variation between the leaf and stem percentages occurred in the pre-grazing, even with differences in the LAR, SER, and FLL (Figure 2) by the N doses evaluated. Since the canopy’s morphogenic characteristics influence its structural characteristics(27), the effects of the different N doses were observed in most structural variables. The LAR directly determines the TPD, as each new leaf that emerges represents a phytomer, which is formed by the leaf blade, ligule, sheath, node, internode, axillary buds, and roots(28). Each phytomer can generate a new tiller, whose appearance is regulated by the quantity and quality of the light that reaches the base of the canopy(29). The largest number of tillers is thus responsible for the largest forage production, observed in pastures fertilized with the highest N doses. Conversely, grazing management determines the canopy’s opening or closing, influencing tiller appearance and mortality rates(25). While green leaves per tiller is a genetically determined variable, an additional 0.73 leaves tiller-1 were observed in pastures fertilized with N300 and 0.52 leaves tiller-1 in pastures fertilized with N200 compared to those that received N100. Due to N’s effect on the LAR, the GLN also increased(30), expressing the maximum plant genetic potential. The FLL and leaf:stem ratio are responsive to defoliation intensity and can be classified as morphological mechanisms of escape that plants present in response to defoliation(29). In this experiment, the same pre- and post-grazing heights were used for all N doses applied, which determined the same grazing intensity, represented by 50 % utilization of the pre-grazing height. This grazing intensity is considered moderate(7) and may have contributed to the leaves’ length not differing by the N doses used. During the vegetative period, the N demand tends to be linearly associated with the LER so that luxury N uptake occurs only after a leaf has expanded completely and is originated predominantly through the translocation of the canopy’s bottom leaves(31). Fertilizations with 200 and 300 kg ha-1 yr-1 of N were most likely to satisfy the nutrient demand and promoted greater speeds of appearance and elongation of the plant’s shape and organs until the grazing frequency determined by height was reached. The N fertilization of tropical grasses increases the forage accumulation(32,33,34). It is thus essential to adjust the stocking rate for each N dose applied to allow grazing animals to consume the forage produced. In addition to the stocking rate, the grazing and rest periods differed by N doses, reflecting the different forage growth rates due to the availability of N for the plants. Pastures that received the lowest N dose (100 kg ha-1 yr-1) needed 6.3 more days of rest than those that received the highest N dose (300 kg) and 3.4 more than those that received the intermediate N dose (200 kg). 1110

Rev Mex Cienc Pecu 2021;12(4):1098-1116

Grazing management adjustments were made to maintain the pre- and post-grazing target heights, regardless of the N dose applied; the forage mass and the pasture components percentage were therefore similar for the three N doses applied. The grazing intensity was satisfactorily controlled, maintaining the canopy condition. Conversely, the different forage accumulation for the three N doses determined the grazing frequency, reflecting in the rest periods. The pre- and post-grazing height control allowed to use the increase in biomass accumulation that N fertilization provides. The highest N dose (300 kg ha-1 yr-1) delivered the highest forage accumulation, with shorter grazing and rest periods for the pastures. Greater forage accumulation thus demanded a higher stocking rate so that the post-grazing goal (40–50 cm) could be reached, which was reflected in the increased grazing pressure. The increases in stocking rate and grazing pressure that result from intensification (N fertilization) are strongly related to soil compaction in pastures(35,36) due to the pressure that the animals’ hooves exert. The intensity of this pressure depends on the body mass, the hoof area, and the kinetic energy exerted on the soils(15), increasing the soil density due to the loads and pressure applied. The PR is directly related to the stocking rate(37), which was a determining factor in increasing PR in the pastures that received N300 in the post-grazing period. Notably, in the soil’s superficial layers (0–10 cm), most grass roots are concentrated(38,39). A PR greater than 2.5 MPa at these depths can therefore limit the development of roots(37,40). Although pastures that received N300 indicated PR values above 2.5 MPa in layers 0–10 cm deep in the post-grazing period, the stocking rate that the different N fertilizations provided does not seem to have affected the RM. This finding indicates that the intermittent stocking method that uses the put-and-take technique, which involves using a variable number of animals for load adjustment(41), could efficiently control the grazing pressure, keeping it within what is considered ideal. In addition, pastures demonstrated excellent regrowth vigor and high forage accumulation despite the PR values that could be impeding the pastures’ development. Compaction reduces soil pores when larger pores are lost or reduced in size(42); however, grasses seem to adjust the diameter of their roots to fill porous spaces in their search for water and nutrients(43). The roots’ elongation during this search thus seems to have a soil unpacking function during the pastures’ regrowth, justifying the absence of N’s effect on the soil’s PR in the pre-grazing period. While some research suggests that a reduction in the RM of forage grasses occurs due to the increase in N doses, even in periods with greater rainfall(11,44), this research determined that the adopted management criterion (80–90 cm of pre-grazing and 40–50 cm of postgrazing heights) could guarantee the regrowth and the maintenance of the forage accumulation without compromising the root system. In fact, the remaining leaf area index (after grazing) has an important relationship with the RM so that more severe 1111

Rev Mex Cienc Pecu 2021;12(4):1098-1116

defoliation intensities can reduce RM and growth(12,45). In this experiment, the defoliation intensity was considered moderate (50 % of the plant’s aerial part was removed) and within the grazing resistance limits considered ideal for plant use(46), which means that the remaining leaf area index could guarantee the full reestablishment of the plant’s aerial and root parts.

Conclusions and implications Nitrogen fertilization influences the growth of Mombasa guineagrass pastures, as well as their morphogenic and structural characteristics. Such changes affect the penetration resistance of the roots to the soil, which can promote soil compaction if grazing management is not strategically controlled. Pre- and post-grazing height control is a management alternative that allows one to not only maintain the canopy structure but also avoid the compaction process, preserving the dry roots matter in the soil, regardless of the intensification level.

Acknowledgements

The Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) for the financial incentive –Financing Code 001. Support from the Universidade Federal da Grande Dourados (UFGD), Conselho Nacional de Desenvolvimento Científco e Tecnológico (CNPq) and the Embrapa Gado de Corte. Literature cited: 1.

Veras ELL, Difante, GS, Gurgel ALC, Costa ABG, Rodrigues JGR, Costa CM, et al. Tillering and structural characteristics of Panicum cultivars in the Brazilian Semiarid Region. Sustainability 2020;12(9):3849.

Montagner DB, Nascimento Júnior D, Vilela HH, Sousa BML, Euclides VPB, Silva SC, et al. Tillering dynamics in pastures of guinea grass subjected to grazing severities under intermittent stocking. R Bras Zootec 2012;41(3):544-549.

Da Silva SC, Bueno AAO, Carnevalli RA, Uebele MC, Bueno FO, Hodgson J, et al. Sward structural characteristics and herbage accumulation of Panicum maximum cv. Mombasa subjected to rotational stocking managements. Sci Agric 2009;66(1):8-19.

Euclides VPB, Carpejani GC, Montagner DB, Nascimento Junior D, Barbosa RA, Difante GS. Maintaining post-grazing sward height of Panicum maximum (cv. Mombasa) at 50 cm led to higher animal performance compared with post-grazing height of 30 cm. Grass Forage Sci 2018;73(1):174-182.

1112

Rev Mex Cienc Pecu 2021;12(4):1098-1116

Escarela CM, Pietroski M, Prado RM, Campos CSN, Caione G. Effect of nitrogen fertilization on productivity and quality of Mombasa forage (Megathyrsus maximum cv. Mombasa). Acta Agron 2017;66(1):42-48.

Alvarenga CAF, Euclides VPB, Montagner DB, Sbrissia AF, Barbosa RA, Araújo AR. Animal performance and sward characteristics of Mombasa guineagrass pastures subjected to two grazing frequencies. Trop Grassl-Forrajes Trop 2020; 8(1):1-10.

Fonseca L, Carvalho PCF, Mezzalira JC, Bremm C, Galli JR, Gregorini P. Effect of sward surface height and level of herbage depletion on bite features of cattle grazing Sorghum bicolor swards. J Anim Sci 2013;91(9):4357-4365.

Cruz P, Boval M. Effect of nitrogen on some morphogenetic traits of temperate and tropical perennial forage grasses. In: Lemaire G, et al, editors. Grassland ecophysiology and grazing ecology. 1rst ed. Wallingford, UK: CABI Publishing; 2000:151-168.

Braz TGS, Fonseca DM, Freitas FP, Martuscello JA, Santos MER, Santos MV. et al. Morphogenesis of Tanzania guinea grass under nitrogen doses and plant densities. R Bras Zootec 2011;40(7):1420-1427.

10. Martuscello JA, Silva LP, Cunha DNFV, Batista ACS, Braz TGS, Ferreira PS. Adubação nitrogenada em capim-massai: Morfogênese e produção. Cienc Anim Bras 2015;16(1):1-13. 11. Giacomini AA, Mattos WT, Mattos HM, Werner JC, Cunha EA, Carvalho DD. Crescimento de raízes dos capins aruana e tanzânia submetidos a duas doses de nitrogênio. R Bras Zootec 2005;34(4):1109-1120. 12 Gomide CAM, Paciullo DSC, Morenz MJF, Costa IA, Lanzoni CL. Productive and morphophysiological responses of Panicum maximum Jacq. cv. BRS Zuri to timing and doses of nitrogen application and defoliation intensity. Grassl Sci 2019; 65(2):93-100. 12. Costa MAT, Tormena CA, Lugão SMB, Fidalski J, Nascimento WG, Medeiros FM. Resistência do solo à penetração e produção de raízes e de forragem em diferentes níveis de intensificação de pastejo. R Bras Ci Solo 2012;36(1):993-1004. 14. Barbosa LF. Acúmulo de forragem e desempenho animal em pastos de capimmombasa sob doses de nitrogênio e pastejo intermitente [tesis maestría]. Brasil, MS: Universidade Federal da Grande Dourados; 2018. 15. Greewood KL, Mckenzie BM. Grazing effects on soil physical properties and the consequences for pastures: a review. Aust J Exp Agric 2001;41(8):1231-1250.

1113

Rev Mex Cienc Pecu 2021;12(4):1098-1116

16. EMBRAPA. Empresa Brasileira de Pesquisa Agropecuária. Sistema Brasileiro de Classificação de Solos. 3th ed. Rio de Janeiro, Brasil: Centro Nacional de Pesquisa de solo; 2013. 17. Lemaire G, Chapman D. Tissue flows in grazed plant communities. In: Hodgson J, Illius AW, editors. The ecology and management of grazing systems. 1rst ed. Wallingford, UK: CABI Publishing; 1996:3-29. 18. EMBRAPA. Empresa Brasileira de Pesquisa Agropecuária. Manual de métodos de análise de solo. 3th ed. Rio de Janeiro, Brasil: Centro Nacional de Pesquisa de solo; 2017. 19. Busscher WJ, Bauer PJ, Campa CR, Sojka RE. Correction of cone index for soil water content differences in a coastal plain soil. Soil Tillage Res 1997;43(3-4):205– 217. 20. Basso KC, Cecato U, Lugão SMB, Gomes JAN, Barbero LM, Mourão GB, et al. Morfogênese e dinâmica do perfilhamento em pastos de Panicum maximum Jacq. cv. IPR-86 Milênio submetido a doses de nitrogênio. Rev Bras Saúde Prod An 2010; 11(4):976-989. 21. Farias LN, Zanine AM, Ferreira DJ, Ribeiro MD, Souza AL, Geron LJV, et al. Effects of nitrogen fertilization and seasons on the morphogenetic and structural characteristics of Piatã (Brachiaria brizantha) grass. Rev Fac Cienc Agrar 2019; 51(2):42-54. 22. Gastal F, Lemaire GN. Uptake and distribution in crops: An agronomical and ecophysiological perspective. J Exp Bot 2002;53(370):789-799. 23. Vitor CMT, Fonseca DM, Cóser AC, Martins CE, Nascimento Júnior D, Ribeiro Júnior JI. Produção de matéria seca e valor nutritivo de pastagem de capim-elefante sob irrigação e adubação nitrogenada. R Bras Zootec 2009;41(3):565-573. 24. Brougham RW. Effect of intensity of defoliation on regrowth of pasture. Aust J Agric Res 1956;7(5):377-387. 25. Difante GDS, Nascimento Júnior D, Silva SC, Euclides VPB, Zanine AM, Adese B. Tillering dynamics of marandu palisadegrass submitted to two cutting heights and three cutting intervals. R Bras Zootec 2008;37(2):189-196. 26. Pereira LET, Paiva AJ. Geremia EV, Silva SC. Components of herbage accumulation in elephant grass cvar Napier subjected to strategies of intermittent stocking management. J Agric Sci 2014;152(6):954-966. 27. Difante GS, Nascimento Júnior D, Silva SC, Euclides VPB, Montagner DB, Silveira MCT, et al. Características morfogênicas e estruturais do capim-marandu submetido a combinações de alturas e intervalos de corte. R Bras Zootec 2011;40(5):955-963.

1114

Rev Mex Cienc Pecu 2021;12(4):1098-1116

28. Nelson CJ. Shoot morphological plasticity of grasses: leaf growth vs. tillering. In: Hodgson J, Illius AW, editors. The ecology and management of grazing systems. 1rst ed. Wallingford, UK: CABI Publishing; 1996:101-126. 29. Gastal F, Lemaire G. Defoliation, shoot plasticity, sward structure and herbage utilization in pasture: review of the underlying ecophysiological processes. Agriculture 2015;5(4):1146-1171. 30. Garcez Neto AF, Nascimento Junior D, Regazzi AJ, Fonseca DM, Mosquim PR, Gobbi KF. Respostas morfogênicas e estruturais de Panicum maximum cv. Mombasa sob diferentes níveis de adubação nitrogenada e alturas de corte. R Bras Zootec 2002; 31(5):1890-1900. 31. Lemaire G, Oosterom EV, Sheehy J, Jeuffroy MH, Massignam A, Rossato L. Is crop N demand more closely related to dry matter accumulation or leaf area expansion during vegetative growth? Field Crops Res 2007;100(1):91-106. 32. Alderman PD, Boote KJ, Sollenberger LE. Regrowth dynamics of “tifton 85” bermudagrass as affected by nitrogen fertilization. Crop Sci 2011;51(4):1716-1726. 33. Fagundes JL, Moreira AL, Freitas AWP, Augusto ZontaI; Henrichs R, Rocha FC, et al. Capacidade de suporte de pastagens de capim-tifton 85 adubado com nitrogênio manejadas em lotação contínua com ovinos. R Bras Zootec 2011;40(12):2651-2657. 34. Carvalho RM, Alves LC, PHM Rodrigues PHM, Souza WD, Ávila AB, Santos MER. Acúmulo de forragem e estrutura do dossel de Capim-Marandu diferido e adubado com nitrogênio. Bol Ind Anim 2017;74(1):1-8. 35. Bertol I, Almeida JA, Almeida EX, Kurtz C. Propriedades físicas do solo relacionadas a diferentes níveis de oferta de forragem de capim-elefante-anão cv. Mott. Pesq Agropec Bras 2000;35(5):1047-1054. 36. Leão TP, Silva AP, Macedo MCM, Imhoff S, Euclides VPB. Least limiting water range: A potential indicator of changes in near-surface soil physical quality after the conversion of Brazilian Savanna into pasture. Soil Tillage Res 2006;88(1–2):279285. 37. Leão TP, Silva AP, Macedo MCM, Imhoff S, Euclides VPB. Least limiting water range in the evaluation of continuous and short-duration grazing systems. R Bras Ci Solo 2004;28(3):415-422. 38. Beloni T, Piotto VC, Mari GC, Pinheiro AA, Tormena CA, Cecato U. Root system and resistance to penetration of Mombaça grass fertilized with nitrogen and irrigated. Semin Cienc Agrar 2016;37(5):3243-3252. 39. Gurgel ALC, Difante GS, Araujo AR, Montagner DB, Euclides VPB, Silva MGP. Carbon and nitrogen stocks and soil quality in an area cultivated with guinea grass under the residual effect of nitrogen doses. Sustainability 2020;12(22):3849. 1115

Rev Mex Cienc Pecu 2021;12(4):1098-1116

40. Imhoff S, Silva AP, Tormena CA. Aplicações da curva de resistência no controle da qualidade física de um solo sob pastagem. Pesq Agropec Bras 2000;35(7):14931500. 41. Allen VG, Batello C, Berretta EJ, Hodgson J, Kothmann M, Li X, et al. An international terminology for grazing lands and grazing animals. Grass Forage Sci 2011;66(1):2–28. 42. Dexter AR. Soil physical quality: Part I. Theory, effects of soil texture, density, and organic matter, and effects on root growth. Geoderma 2004;120(3-4):201–214. 43. Huot C, Zhou Y, Philp JNM, Denton MD. Root depth development in tropical perennial forage grasses is related to root angle, root diameter and leaf area. Plant Soil 2020;456(1-2):145-158. 44. Sarmento P, Rodrigues LRA, Lugão SMB, Cruz MCP, Campos FP, Ferreira ME, et al. Sistema radicular do Panicum maximum Jacq. cv. IPR-86 Milênio adubado com nitrogênio e submetido à lotação rotacionada. R Bras Zootec 2008;37(1):27-34. 45. Guo YJ, Han L, Li GD, Han JG, Wang GL, Li ZY, et al. The effects of defoliation on plant community, root biomass and nutrient allocation and soil chemical properties on semi-arid steppes in northern China. J Arid Environ 2012;(78):128134. 46. Da Silva S, Sbrissia A, Pereira L. Ecophysiology of C4 forage grasses-understanding plant growth for optimizing their use and management. Agriculture 2015;5(3):598625.

1116

https://doi.org/10.22319/rmcp.v12i4.5645 Article

Relationship between antibiotic resistance and biofilm production of Staphylococcus aureus isolates from bovine mastitis

Jaquelina Julia Guzmán-Rodríguez a,b Estefanía Salinas-Pérez b Fabiola León-Galván a,c José Eleazar Barboza-Corona a,c Mauricio Valencia-Posadas a,b Fidel Ávila-Ramos a,b José Antonio Hernández-Marín a,b Diana Ramírez-Sáenz d Abner Josué Gutiérrez-Chávez a,b*

Universidad de Guanajuato. Campus Irapuato-Salamanca. División de Ciencias de la Vida, Programa de Posgrado en Biociencias. Km. 9.0 Carr. Irapuato-Silao, El Copal, Irapuato, 36821, Guanajuato, México. b

Universidad de Guanajuato. Campus Irapuato-Salamanca. División de Ciencias de la Vida, Departamento de Medicina Veterinaria y Zootecnia. c.

Universidad de Guanajuato. Campus Irapuato-Salamanca. División de Ciencias de la Vida, Departamento de Alimentos. México. d

Consultoría en Biotecnología, Bioingeniería y Servicios Asociados, SA de CV. México.

*Corresponding author: ajgutierrez@ugto.mx

Abstract: The objective was to analyze the relationship between the antibiotic-resistance profile and the biofilm formation of S. aureus isolates from bovine mastitis. Thirty (30) isolates of S.

1117

Rev Mex Cienc Pecu 2021;12(4):1117-1132

aureus from cases of subclinical mastitis in dairy farms in semi-intensive production and backyard production systems, located in the states of Guanajuato and Michoacán, Mexico, were analyzed. An antibiogram was performed by the Kirbi-Bauer disc-diffusion method. Biofilm formation was determined by the violet crystal staining method. For the evaluation of antibiotic resistance genes and biofilm formation, genomic DNA was obtained from a colony for the identification of the genes: blaZ, mecA, tetK, tetM, gyrA and gyrB, and icaA and icaD. The results showed that 100 % of the isolates were resistant to penicillin and dicloxacillin, followed by cefotaxime (86.6 %), ampicillin and cephalotin (83.3 %) and ceftazidime (80.0 %), while a 36.6 % resistance to oxacillin was observed. It was identified that all isolates of S. aureus had the ability to form biofilm with a range between 20 to 98 %. It was also observed that isolates with a high multi-resistance presented a greater formation of biofilm, establishing a significant positive correlation. In conclusion, S. aureus isolates from bovine mastitis presented high levels of antibiotic resistance; as well as an important biofilm-forming capacity, demonstrating the existence of a positive correlation between these two factors. Key words: Antibiotics, Mastitis, DNA, Biofilm.

Received: 20/03/2020 Accepted: 12/03/2021

Introduction The processing of bovine milk is a sector of utmost importance in the livestock industry, in Mexico, a production of more than 12 million tons was estimated in 2019(1), which places it within the top ten milk-producing countries worldwide(1). One of the main goals of a dairy farm should be to have an efficient milk production and that it is healthy and free of contaminants, so it is essential that the mammary gland is healthy(2). In this sense, mastitis is the most common and costly disease in dairy cattle, since it affects the welfare of the cow and causes economic problems due to losses in production, decrease in quality and quantity of milk, premature elimination of the cow, cost of veterinary treatment and the discarding of milk due to antibiotic contamination(3,4). Staphylococcus aureus is a ubiquitous pathogen that causes a variety of infections in humans and animals and is one of the main causative agents of bovine mastitis(5,6). This Gram-positive bacterium produces chronic, persistent and recurrent infections, since it is able to overcome all the barriers of the host defense system, because it has a wide spectrum of virulence factors such as the production of enzymes, antigens, adhesins and toxins, among others(7). These

1118

Rev Mex Cienc Pecu 2021;12(4):1117-1132

virulence factors eventually confer on the bacterium multi-resistance to antibiotics and the formation of biofilms(8). The biofilm is a consortium of microorganisms that is embedded within a polymer matrix, consisting mainly of exopolysaccharides, proteins and nucleic acids, which allows the bacterium to adhere to a biotic or abiotic surface(9). The formation of biofilm is a life strategy for most bacteria, since it provides them with stability, performs catalytic functions, increases the chances of transfer of genetic material and resistance to antibiotics, participates in cellular communication processes and offers protection to survive adverse and variable environmental conditions; which contributes to its successful colonization in the host(10). Multi-resistance to antibiotics and the formation of biofilms are characteristics of virulence that are related to each other in an important way. In this sense, it is known that the biofilm formed by S. aureus significantly increases antibiotic resistance by inhibiting the penetration of the antimicrobial, which results in an increasingly serious situation in the therapeutic combat of this microorganism(11). Currently, this research group has a collection of isolates of S. aureus from bovine mastitis that were collected in the states of Guanajuato and Michoacán, Mexico, which have presented very high levels of multi-resistance to antibiotics (70 to 100 %)(12), which is consistent with the low efficiency in the therapies used in the production units of the region. Unfortunately, in Mexico so far, the ability of these bacteria that cause bovine mastitis to form biofilms, and its possible relationship with antibiotic resistance levels, have not been evaluated. Based on the above, the objective of this work was to analyze whether there is a correlation between the antibiotic-resistance profile and the biofilm formation of S. aureus isolates from bovine mastitis.

Material and methods Isolation of S. aureus Thirty (30) isolates of S. aureus from cases of subclinical mastitis of cows located in dairy farms located in localities in the states of Guanajuato and Michoacán, Mexico, which use semi-intensive production and backyard production systems, were analyzed. The sampling, isolation and characterization of the isolates was already reported by Varela et al (12) in 2018.

Antibiotic multi-resistance profile An antibiogram was performed by the Kirbi-Bauer disc-diffusion method(13), using Biorad® sensidiscs with the following antibiotics and concentrations: penicillin (PE) 6 μg, oxacillin (Oxa) 6 μg, dicloxacillin (DC) 30 μg, pefloxacin (PEF) 5 μg, cefuroxime (CXM) 30 μg, gentamycin (GE) 120 μg, cefotaxime (CTX) 30 μg, sulfamethoxazole + trimethoprim (SXT) 1.25 and 23.75 μg, tetracycline (TE) 30 μg, ampicillin (AM) 10 μg, erythromycin (E) 15 μg,

1119

Rev Mex Cienc Pecu 2021;12(4):1117-1132

ceftazidime (CAZ) 30 μg and cephalotin (CF) 30 μg. The results are reported as sensitive, intermediate and resistant based on the parameters established in Performance Standards for Antimicrobial Susceptibility Testing, 2019(14). Once the resistance profile was established, the 30 isolates were classified as described below: Group 1: High resistance (resistant to 1113 antibiotics), Group 2: Medium resistance (9-10 antibiotics), Group 3: Low resistance (48 antibiotics).

Biofilm formation To measure the biofilm-forming capacity of S. aureus isolates, the violet crystal staining protocol(11) was used, as described below: the bacterial isolate was cultured in LB medium and incubated 24 h at 37 ⁰C. The tests were performed on sterile plates of 96 wells and placed ≈ 1 x 106 CFUs in a final volume of 100 μL in each well. Isolates were incubated for 48 h at 37 °C. Once the incubation time had elapsed, the supernatant was discarded, the wells were washed with 100 μL of PBS solution (137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4 and 2 mM KH2PO4) and the wells were dried. Subsequently, 100 μL of violet crystal solution (0.5 % weight/volume) was added to each well and it was left to stand for 15 min. The dye was then removed, and it was washed twice with 100 μL of PBS. Then, 125 μL of 95 % ethanol (volume/volume) was added and it was vigorously resuspended to dissolve the dye. The absorbance reading was taken at 495 nm in an ELIREAD microelisa analyzer (Kontrolab®, Guidonia, Italy). Once the data were obtained, the percentage of biofilm formation was plotted using as 100 % the registered absorbance of the certified strain of S. aureus (ATCC 27543). Three independent experiments with three repetitions were conducted.

Analysis of resistance genes and biofilm formation To evaluate the presence of genes related to antibiotic resistance and biofilm formation, it was carried out from genomic DNA, which was obtained by chopping a bacterial colony from a fresh culture plate to later place it in the PCR reaction mixture. The oligonucleotides used in this study are shown in Table 1. The reaction was performed in a final volume of 20 μL containing 0.4 μM oligonucleotides, 200 μM deoxynucleotides triphosphates (Invitrogen, Carlsbad, California, United States), 2 mM magnesium chloride (Invitrogen, Invitrogen, Carlsbad, California, United States) and 1 U of Taq polymerase (Invitrogen, Invitrogen, Carlsbad, California, United States). The amplification conditions were as follows: initial denaturation temperature at 95 °C for 10 min, followed by 30 denaturing amplification cycles for 10 min at 94 °C, alignment for 1 min at the specific temperature of oligonucleotides (Table 1), polymerization for 30 sec at 72 °C, and a final extension cycle for 7 min at 72 °C. Amplicons (5 μL) were analyzed by 1 % agarose gel electrophoresis (weight/volume) and

1120

Rev Mex Cienc Pecu 2021;12(4):1117-1132

stained with ethidium bromide. It was considered positive for the gene, the presence of an amplification band corresponding to the size of the expected product. Table 1: Oligonucleotides (OLIG) used OLIG blaZ mecA tetK tetM gyrA gyrB icaA icaD nuc

Sequence 5´-TAAGAGATTTGCCTATGCTT-3´ 5´-TTAAAGTCTTACCGAAAGCAG-3´ 5´-GTAGAAATGACTGAACGTCCGATGA-3´ 5´-CCAATTCCACATTGTTTCGGTCTAA-3´ 5´-GTAGCGACAATAGGTAATAGT-3´ 5´-GTAGTGACAATAAACCTCCTA-3´ 5´-AGTGGAGCGATTACAGAA-3´ 5´-CATATGTCCTGGCGTGTCTA-3´ 5´-AATGAACAAGGTATGACACC-3´ 5´-ACGCGCTTCAGTATAACGC-3´ 5´-CAGCGTTAGATGTAGCAAGC-3´ 5´-CCGATTCCTGTACCAAATGC-3´ 5'-CCTAACTAACGAAAGGTAG-3´ 5'-AAGATATAGCGATAAGTGC-3' 5'-AAACGTAAGAGAGGTGG-3' 5'-GGCAATATGATCAAGATAC-3' 5´-GACTATTATTGGTTGATCCACCTG-3´ 5´-GCCTTGACGAACTAAAGCTTCG-3´

AT (°C)

SEP (bp)

377

310

360

158

222

250

1315

381

218

Reference Yang et al., 2016(29) Elhassan et al., 2015(27) Yang et al., 2016(29) Yang et al., 2016(29) Hashem et al., 2013(28) Hashem et al., 2013(28) Dhanawade, 2010(49) Dhanawade, 2010(49) Brakstad et al., 2002(50)

AT= alignment temperature; SEP= size of the expected product.

To analyze the genetic basis of bacterial resistance mechanisms, the presence of the blaZ and mecA genes for beta-lactam antibiotics was analyzed(15,16); tetK and, tetM for tetracyclines(16) and gyrA and gyrB for quinolones(17).

Statistical analysis Three independent experiments were carried out in which the absorbance produced by the staining of the formed biofilm was measured. The experiments were done in triplicate. The difference between the highest absorbance minus the largest amount of biofilm was obtained, this difference is defined in this study as absorbance. The 30 isolates of S. aureus were classified into three groups according to the level of antibiotic resistance: high, medium and low, of 10 isolates in each and were subsequently

1121

Rev Mex Cienc Pecu 2021;12(4):1117-1132

evaluated according to their absorbance. The results of the positive controls for each resistance level of each experiment were included in the analyses. The normality of the dependent variable absorbance was evaluated using the Chi-square goodness of fit test, resulting in normal (P>0.05). Data were analyzed with an analysis of variance (ANOVA) with a factorial design with a completely randomized arrangement. The model used is shown below: Yijk=μ + EXi + GRj + EXixGRj + eijk, where: Yijk= is the k-th observation of absorbance, of the i-th experiment and the j-th degree of resistance, μ=general mean as a constant parameter, EXi= i-th experiment, j=1, 2 and 3, GRj= j-th degree of resistance, i= 1, 2 and 3, GRixEXj= interaction between the i-th degree of resistance and the j-th experiment, eijk= experimental error. Additionally, the Spearman rank correlation between degree of resistance and absorbance was estimated.

Results and discussion Antibiotic-resistance profile of S. aureus isolates from bovine mastitis The results show that 100 % of the isolates are resistant to penicillin and dicloxacillin, in addition, 86.6, 83.3 and 80.0 % show resistance to ampicillin, cephalotin and ceftazidime, respectively; it was also observed that 36.6 % of the isolates are resistance to oxacillin. Overall, all isolates analyzed were resistant to at least 33.3 % of the antibiotics tested (Table 2).

1122

Rev Mex Cienc Pecu 2021;12(4):1117-1132

Table 2: Resistance profile of S. aureus isolates Isolate

Antibiotic PE OXA DC

PEF CXM GE CTX SXT TE AM E

CAZ CF

Group 3

Group 2

Group 1

1 2 3 4 5 6 7 8 9 10 Resistant isolates, % 100 90 100 100 100 70 100 80 90 100 70 90 100 1 2 3 4 5 6 7 8 9 10 Resistant isolates, % 100 70 100 20 90 20 80 20 50 90 60 80 90 1 2 3 4 5 6 7 8 9 10 Resistant isolates, % 100 30 100 30 40 0 80 0 30 60 0 70 60 Total, % 100.0 36.6 100.0 50.0 76.6 70.0 86.6 33.3 56.6 83.3 43.3 80.0 83.3 Color code: black= isolates resistant; gray= isolates intermediate resistant; white= isolates sensitive.

1123

Rev Mex Cienc Pecu 2021;12(4):1117-1132

Antibiotic resistance is a phenomenon that continues to increase and that significantly affects the health sector, both in human medicine and veterinary medicine, since it hinders the proper management of infectious diseases. Such is the case of bovine mastitis; S. aureus, as one of the main bacteria isolated from bovine mastitis, has high resistance rates. In recent years, globally, the selection of bacterial resistance mechanisms continues to increase(18). In this sense, in several countries where the resistance profile of S. aureus from bovine mastitis was analyzed, percentages of resistance to penicillin close to 100 %(19-23) were found, which coincides with the results reported here. Regarding the resistance presented to oxacillin, contrasting results were found, since studies carried out in countries such as India and China showed resistance levels from 48 to 84 %(21,24); however, in Germany, Japan and Colombia, the levels of resistance to oxacillin are minimal (2-7 %)(21,23,25), while these results show intermediate levels of resistance (33.3 %). In Mexico, studies reveal high levels of bacterial resistance to penicillin, amoxicillin and dicloxacillin (100 %)(26,27), which is consistent with what was reported in this study. Likewise, there is a significant increase in resistance to cephalotin, for example, in 2008 it was reported that 30 % of the strains of S. aureus studied had resistance(27); however, in this work resistance of up to 83 % was found. These variations may be due to the possible genetic variability of the isolates, climatological differences, as well as geographical discrepancies among other factors(28). Based on these differences, the need to carry out works such as the one presented here is highlighted, to define the virulence characteristics of S. aureus isolated from particular regions; to generate the necessary information that allows the implementation of more efficient treatments for subclinical bovine mastitis. The presence of the blaZ gene was observed in 100 % of the isolates analyzed, while only 36.6 % were positive for the mecA gene (Table 3). These results are consistent with what was previously reported, where the presence of these genes was shown in all the isolates analyzed(19,29). The presence of the tetK, tetM, gyrA and gyrB genes was expressed in a descending way according to the groups analyzed, which is consistent with the phenotype found in the antibiograms. This coherence between the phenotype and the genotype of bacterial resistance has already been demonstrated before(29,30), so that the resistance observed can be attributed to the presence and eventual expression of the genes analyzed(31).

1124

Rev Mex Cienc Pecu 2021;12(4):1117-1132

Table 3: Analysis of resistance genes and biofilm formation

Group 1

Isolates 1 2 3 4 5 6 7 8 9 10

Resistance genes blaZ mecA tetK + + + + + + + + + + + + + + + + + + + + + + -

gyrA + + + + + + + + + +

gyrB + + + + + + +

icaD + + + + + + + + +

100

+ + + + +

+ + + + + + + + -

+ + + +

+ + +

+ + + +

+ + + + + + + +

+ -

+ + + + -

+ + + + + -

+ +

+ + + +

+ + + + + + + + +

Presence of the gene % 100

Total, %

46.6

53.3

50.0

86.6

Group 2

Presence of the gene % 100

tetM + + + + + + +

Biofilm icaA + + + + + + + + +

1 2 3 4 5 6 7 8 9 10

+ + + + + + + + + +

Group 3

Presence of the gene % 100 1 2 3 4 5 6 7 8 9 10

+ + + + + + + + + +

100.0

1125

Rev Mex Cienc Pecu 2021;12(4):1117-1132

Biofilm formation of S. aureus isolated from bovine mastitis The analysis of biofilm formation showed that all isolates had the ability to form biofilm with a range from 20 to 98 %. Several studies around the world report that the strains of S. aureus analyzed have the capacity of biofilm formation (90 to 99 %)(32,33), which coincides with the present study. Because S. aureus has high levels of antibiotic resistance, it is necessary to analyze the virulence factors and characteristics of this bacterium in order to design more efficient control strategies. In this sense, it has already been reported that S. aureus has the ability to form biofilm(34), which may be related to the low effectiveness that conventionally used drugs have(35). To establish the possible relationship between resistance and biofilm formation in the 30 isolates from bovine mastitis, the following strategy was followed. First, the results of biofilm formation were analyzed according to the resistance level of the isolates (Figure 1); for which, these were ordered into three groups as described in the materials and methods section. In the analysis of variance of this study, only the effect of degree of resistance was significant (P<0.01), finding that the mean absorbance levels of the isolates were 1.34 (63.17 %), 0.77 (38.78 %) and 0.66 (26.28 %) for groups 1, 2 and 3, respectively. In the comparison of means, groups 1-3 were different (P<0.05) (Figure 1B). The estimated correlation between the degree of resistance and biofilm formation was positive (0.50) and significant (P<0.01) (Figure 2); in addition, these differences were analyzed microscopically, where the formation of biofilm in the isolates of group 1 were observed to be significantly increased compared to the other two groups (Figure 1A). Because the formation of biofilm by S. aureus induces the development of chronic and recalcitrant infections(32), the need to analyze how this virulence characteristic is related to other mechanisms, such as antibiotic resistance, stands out. With reference to the above, this relationship has been studied in both Gram-negative(36-39) and Gram-positive(40,41) bacteria; however, there are discrepancies in defining whether the correlation that occurs is positive(42,43,44) or negative(41). In this study, it was observed that isolates with a high multi-resistance present a greater formation of biofilm; establishing a positive correlation, which is consistent with most of the works reported in this regard(42,43,44). Finally, the presence of the icaA and icaD genes was analyzed, which are directly related to the formation of biofilm(45). Interestingly, it was found that there is a high frequency of both genes in the isolates (86.6 %), regardless of the degree of resistance they present (Table 3). Several authors agree with this result, since they report a frequency close to 100 % of one or both genes in biofilm-forming strains of S. aureus(46,47,48).

1126

Rev Mex Cienc Pecu 2021;12(4):1117-1132

Figure 1: Biofilm formation by S. aureus isolates. The violet crystal staining protocol was used to measure the formation of biofilm.

A) Representative images of the biofilm staining in the three groups (Group 1: High resistance, from 11 to 13 antibiotics; Group 2: Medium resistance, from 9 to 10 antibiotics and Group 3: Low resistance, from 4-8 antibiotics), visualized with light-field microscopy. B) The graph represents the percentage of biofilm formation of the three groups of isolates. The certified strain of S. aureus ATCC 27543 was used as a positive control, whose absorbance value was standardized as 100 %. The average of three independent experiments in triplicate ± their standard deviation is presented. (*) represents a statistically significant difference between groups (P≤0.001).

Figure 2: Relationship between the percentage of resistance and biofilm formation (%) of S. aureus isolates

1127

Rev Mex Cienc Pecu 2021;12(4):1117-1132

Conclusions and implications S. aureus isolates from bovine mastitis from the states of Guanajuato and Michoacán, Mexico, have high levels of antibiotic resistance; as well as an important biofilm-forming capacity. In addition, in the present work, the existence of a positive relationship between these two factors was demonstrated. These virulence characteristics may be directly associated with the low rate of clinical efficacy of treatments conventionally used on dairy farms. The variability of the results recorded in this study and other reports in various parts of the world highlight the need to conduct research on the virulence characteristics of microorganisms located in a specific geographical location and thereby establish management strategies for bovine mastitis in a comprehensive and efficient manner. Acknowledgements This research was funded by the University of Guanajuato through the 2018 Call (DAIPCIIC-077/2018) and by the Secretariat of Innovation, Science and Higher Education (MACFINN1042). Literature cited: 1. SIAP. Servicio de Información Agroalimentaria y Pesquera. Boletín de Leche. México. 2018. 2. Smith PB. Medicina interna de grandes animales. Serrales, DC (trad.). 4ta ed. Barcelona, España: Elsevier; 2010. 3. Taponen S, Liski E, Heikkilä AM, Pyörälä S. Factors associated with intramammary infection in dairy cows caused by coagulase-negative Staphylococci, Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, Corynebacterium bovis, or Escherichia coli. J Dairy Sci 2017;100(1):493–503. 4. Martínez-Sigales JM. Patología y clínica bovina recopilación de clases y relatos de la experiencia práctica de un veterinario de campo. Intermedica. Buenos Aires Argentina. 2016. 5. Gomes F, Henriques M. Control of bovine mastitis: Old and recent therapeutic approaches. Curr Microbiol 2016;72:377–382. 6. Monistero V, Graber HU, Pollera C, Cremonesi P, Castiglioni B, Bottini E, CeballosMarquez A. et al. Staphylococcus aureus isolates from bovine mastitis in eight countries: Genotypes, detection of genes encoding different toxins and other virulence genes. Toxins 2018;10:1-22.

1128

Rev Mex Cienc Pecu 2021;12(4):1117-1132

7. Dorneles EMS, Fonseca MDAM, Abreu JAP, Lage AP, Brito MAVP, Pereira CR, Brandão HM, Guimarães AS, Heinemann MB. Genetic diversity and antimicrobial resistance in Staphylococcus aureus and coagulase‐negative Staphylococcus isolates from bovine mastitis in Minas Gerais, Brazil. Microbiologyopen 2019;8:e736. 8. Thiran E, Di Ciccio PA, Graber HU, Zanardi E, Ianieri A, Hummerjohann J. Biofilm formation of Staphylococcus aureus dairy isolates representing different genotypes. J Dairy Sci 2018;101:1000–1012. 9. Raza A, Muhammad G, Sharif S, Atta A. Biofilm producing Staphylococcus aureus and bovine mastitis: A review. Mol Microbiol Res 2013;3(1):1-8. 10. Lister JL, Horswill AR. Staphylococcus aureus biofilms: recent developments in biofilm dispersal. Front Cell Infect Microbiol 2014;4:178:1-9. 11. Chen Y, Liu T, Wang K, Hou Ch, Cai S, Huang Y, Du Z, et al. Baicalein Inhibits Staphylococcus aureus biofilm formation and the quorum sensing system in vitro. Plos ONE 2016;11(4):e0153468. 12. Varela-Ortiz DF, Barboza-Corona JE, González-Marrero J, León-Galván MF, ValenciaPosadas M, Lechuga-Arana AA, Sánchez-Felipe CG. Antibiotic susceptibility of Staphylococcus aureus isolated from subclinical bovine mastitis cases and in vitro efficacy of bacteriophage. Vet Res Commun 2018;42:243–250. 13. Hudzicki J. Kirby-Bauer Disk diffusion susceptibility test protocol. Am Soc Microbiology. 2016. 14. CLSI. Performance standards for antimicrobial susceptibility testing. 20th ed. CLSI supplement M100 Wayne, PA: Clinical and Laboratory Standards Institute; 2019. 15. Yang Y, Jiang X, Chai B, Ma L, Li B, Zhang A, Cole JR, Tiedje JM, Zhang T. ARGsOAP: online analysis pipeline for antibiotic resistance genes detection from metagenomic data using an integrated structured ARG-database. Bioinformatics 2016;32(15):2346-2351. 16. Elhassan MM, Ozbak HA, Hemeg HA, Elmekki MA, Ahmed LM. Absence of the mecA gene in methicillin resistant Staphylococcus aureus isolated from different clinical specimens in Shendi City, Sudan. Bio Med Res Int 2015;ID895860:1-5. 17. Hashem RA, Yassin AS, Zedan HH, Amin MA. Fluoroquinolone resistant mechanisms in methicillin-resistant Staphylococcus aureus clinical isolates in Cairo, Egypt J Infect Dev Ctries 2013;7(11):796-803. 18. Chokshi A, Sifri Z, Cennimo D, Horng H. Global contributors to antibiotic resistance. J Glob Infect Dis 2019;11(1):36–42. 1129

Rev Mex Cienc Pecu 2021;12(4):1117-1132

19. Yang F, Zhang S, Shang X, Li H, Zhang H, Cui D, Wang X, et al. Short communication: Detection and molecular characterization of methicillin-resistant Staphylococcus aureus isolated from subclinical bovine mastitis cases in China. J Dairy Sci 2020;103:840–845. 20. Li T, Lu H, Wang X, Gao Q, Dai Y, Shang J, Li M. Molecular characteristics of Staphylococcus aureus causing bovine mastitis between 2014 and 2015. Front Cell Infect Microbiol 2017;7(127):1-10. 21. Cheng J, Qu W, Barkema HW, Nobrega DB, Gao J, Liu G, De Buck J, et al. Antimicrobial resistance profiles of 5 common bovine mastitis pathogens in large Chinese dairy herds. J Dairy Sci 2019;102:1–11. 22. Kadlec K, Entorf M, Peters T. Occurrence and characteristics of livestock-associated methicillin-resistant Staphylococcus aureus in quarter milk samples from dairy cows in Germany. Front Microbiol 2019;10:1295. 23. Thongratsakul S, Usui M, Higuchi H, Takahashi T, Sato T, Poolkhet Ch, Tamura Y. Prevalence and characterization of Staphylococcus aureus isolated in raw milk from cows in Hokkaido, Japan. Trop Anim Healt Prod 2020;52(4):1631-1637. 24. Mistry H, Sharma P, Mahato S, Saravanan R, Kumar PA, Bhandari V. Prevalence and characterization of oxacillin susceptible mecA-positive clinical isolates of Staphylococcus aureus causing bovine mastitis in India. Plos ONE 2016;11(9):e0162256. 25. Jiménez-Velásquez SC, Torres-Higuera LD, Parra-Arango GL, Rodríguez-Bautista JL, García-Castro FE, Patiño-Burbano RE. Perfil de resistencia antimicrobiana en aislamientos de Staphylococcus spp. obtenidos de leche bovina en Colombia. Rev Argent Microbiol 2020;52(2):121-130. 26. León-Galván MF, Barboza-Corona JE, Lechuga-Arana AA, Valencia-Posadas M, Aguayo DD, Cedillo-Pelaez C, Martínez-Ortega EA, Gutierrez-Chavez AJ. Molecular detection and sensitivity to antibiotics and bacteriocins of pathogens isolated from bovine mastitis in family dairy herds of Central Mexico. Bio Med Res Int 2015;2015:615153 1-9. 27. Ochoa-Zarzosa A, Loeza-Lara PD, Torres-Rodríguez F, Loeza-Ángeles H, MascotChiquito N, Sánchez-Baca S, López-Meza JE. Antimicrobial susceptibility and invasive ability of Staphylococcus aureus isolates from mastitis from dairy backyard systems. Antonie van Leeuwenhoek 2008;94:199–206. 28. Karzis J, Petzer IM, Donkin EF, Naidoo V, Etter EMC. Climatic and regional antibiotic resistance patterns of Staphylococcus aureus in South African dairy herds. Onderstepoort J Vet Res 2019;86(1):e1-e9.

1130

Rev Mex Cienc Pecu 2021;12(4):1117-1132

29. Yang F, Wang Q, Wang XR, Wang L, Li XP, Luo JY, Zhang SD, et al. Genetic characterization of antimicrobial resistance in Staphylococcus aureus isolated from bovine mastitis cases in Northwest China. J Integ Agr 2016;15(12):2842–2847. 30. Artursson K, Söderlund R, Liu L, Monecke S, Schelin J. Genotyping of Staphylococcus aureus in bovine mastitis and correlation to phenotypic characteristics. Vet Microbiol 2016;193:156-61. 31. Foster TJ. Antibiotic resistance in Staphylococcus aureus. Current status and future prospects. FEMS Microbiology Reviews 2017;41:430–449. 32. Avila-Novoa MG, Iñíguez-Moreno M, Solís-Velázquez OA, González-Gómez JP, Guerrero-Medina PJ, Gutiérrez-Lomelí M. Biofilm formation by Staphylococcus aureus isolated from food contact surfaces in the dairy industry of Jalisco, Mexico. Hindawi J Food Qual 2018;ID1746139:1-8. 33. Piechota M, Kot B, Frankowska-Maciejewska A, Gruhewska A, Wofniak-Kosek A. Biofilm formation by methicillin-resistant and methicillin-sensitive Staphylococcus aureus strains from hospitalized patients in Poland. BioMed Res Int 2018; ID4657396:17. 34. Archer NK, Mazaitis MJ, Costerton JW, Leid JG, Powers ME, Shirtliff ME. Staphylococcus aureus biofilms properties, regulation and roles in human disease. Virulence 2011;2(5):445-459. 35. Moormeier DE, Bayles KW. Staphylococcus aureus biofilm: A complex developmental organism. Mol Microbiol 2017;104(3):365–376. 36. Dumaru R, Baral R, Shrestha LB. Study of biofilm formation and antibiotic resistance pattern of gram‑negative Bacilli among the clinical isolates at BPKIHS, Dharan. BMC Res Notes 2019;12(1):38. 37. Qi L, Li H, Zhang Ch, Liang B, Li J, Wang Li, Du X, et al. Relationship between antibiotic resistance, biofilm formation, and biofilm-specific resistance in Acinetobacter baumannii. Front Microbiol 2016;7:483. 38. Bawankar SK. Correlation of antibiotic resistance and biofilm formation amongst uropathogenic E. coli. Indian J Appl Res 2018;8:4. 39. Cepas V, López Y, Muñoz E, Rolo D, Ardanuy C, Martí S, Xercavins M, et al. Relationship between biofilm formation and antimicrobial resistance in Gram-negative bacteria. Microb Drug Resist 2019;25:1.

1131

Rev Mex Cienc Pecu 2021;12(4):1117-1132

40. Vitale M, Galluzzo P, Bu PB, Carlino E, Spezia O, Alduina R. Comparison of antibiotic resistance profile and biofilm production of Staphylococcus aureus isolates derived from human specimens and animal-derived samples. Antibiotics 2019;8:97. 41. Zhang Y, Xu D, Shi L, Cai R, Li Ch, Yan H. Association between agr type, virulence factors, biofilm formation and antibiotic resistance of Staphylococcus aureus isolates from pork production. Front Microbiol 2018;9:1876. 42. Tahmasebi H, Dehbashi S, Jahantigh M, Arabestani MR. Relationship between biofilm gene expression with antimicrobial resistance pattern and clinical specimen type based on sequence types (STs) of methicillin‑resistant S. aureus. Mol Biol Rep 2020;47(2):1309-1320. 43. Lin Q, Sun H, Yao K, Cai J, Ren Y, Chi Y. The prevalence, antibiotic resistance, and biofilm formation of Staphylococcus aureus in bulk Ready-to-eat foods. Biomolecules 2019;9:524. 44. Kwon AS, Park GC, Ryuc SY, Limd DH, Lime DY, Choi CL, Park Y, Lima Y. Higher biofilm formation in multidrug-resistant clinical isolates of Staphylococcus aureus. Int J Antimicrob Agents 2008;32:68–72. 45. O’Gara JP. ica and beyond: biofilm mechanisms and regulation in Staphylococcus epidermidis and Staphylococcus aureus. FEMS Microbiol Lett 2007;270:179–188. 46. Castelani L, Pilon LE, Martins T, Rodrigues-Pozzi C, Rodriguez-Pozzi Arcaro J. Investigation of biofilm production and icaA and icaD genes in Staphylococcus aureus isolated from heifers and cows with mastitis. Anim Sci J 2015;86(3):340-4. 47. Gad GFM, El-Feky MH, El-Rehewy MS, Hassan MA, Abolella H, El-Baky RMA. Detection of icaA, icaD genes and biofilm production by Staphylococcus aureus and Staphylococcus epidermidis isolated from urinary tract catheterized patients. J Infect Dev Ctries 2009;3(5):342-351. 48. Kivanc SA, Arik G, Akova-Budak B, Kivanc M. Biofilm forming capacity and antibiotic susceptibility of Staphylococcus spp. with the icaA/icaD/bap genotype isolated from ocular surface of patients with diabetes. Malawi Med J 2018;30 (4):243-249. 49. Dhanawade NB, Kalorey DR, Srinivasan R, Barbuddhe SB, Kurkure NV. Detection of intercellular adhesion genes and biofilm production in Staphylococcus aureus isolated from bovine subclinical mastitis. Vet Res Commun 2010;34:81–89. 50. Brakstad OG, Aasbakk K, Maeland JA. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol 1992;30:1654–1660.

1132

https://doi.org/10.22319/rmcp.v12i4.5897 Article

Usefulness of Fourier transform infrared (FTIR) spectroscopy to detect Trichinella spiralis (Owen, 1835) muscle larvae in ham and sausages made from the meat of an experimentally infected pig

Jorge Luis de la Rosa Arana a Jesús Benjamín Ponce Noguez b Tzayhri Gallardo Velázquez c Nydia Edith Reyes Rodríguez b Andrea Paloma Zepeda Velázquez b Ana Berenice López Lugo d Alejandro Pablo Sánchez Paredes d Pablo Martínez Labat d Fabián Ricardo Gómez de Anda b*

Instituto de Diagnóstico y Referencia Inmunoparasitología. Ciudad de México. b

Epidemiológicos.

Laboratorio

Universidad Autónoma del Estado de Hidalgo. Instituto de Ciencias Agropecuarias, Área

Académica de Medicina Veterinaria y Zootecnia. Tulancingo de Bravo, Estado de Hidalgo, México. c

Instituto Politécnico Nacional. Escuela Nacional de Ciencias Bilógicas, Departamento de Biofísica. Ciudad de México. d

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán, laboratorio de Parasitología.

*Corresponding author: fabian_gomez9891@uaeh.edu.mx 1133

Rev Mex Cienc Pecu 2021;12(4):1133-1150

Abstract: The aim of this work was to determine the usefulness of Fourier transform infrared (FTIR) spectroscopy to detect muscle larvae of Trichinella spiralis (Owen, 1835) in ham and sausages made from the meat of an experimentally infected pig. It was searched for the muscle larvae (ML) by conventional methods (artificial digestion and trichinoscopy stained with Mayer´s hemalum stain) and by FTIR spectroscopy. In addition, the infective capacity of the larvae found in swine products was analyzed. The parasite load was 8.5 ± 3 mL/g in ham and 4.5 ± 1.4 mL/g in sausage (P<0.0001). The spectra of the pig products prepared with the meat of an uninfected pig were different in the range of 1,700 to 900 cm-1 with respect to the spectra of the products from infected pigs. In this region, glycogen is the most abundant chemical group (1,200 and 900 cm-1). The distance between classes between noninfested and infested products was 10.2 for ham and 5.52 for sausages (three is the minimum value to indicate class separation). The infective capacity of the larvae recovered from pig products decreased up to five times compared to that of the larvae obtained from experimentally infected mice. These results show that the FTIR spectroscopy is useful to determine the presence of T. spiralis larvae in the foods studied here. Further studies are needed to determine the influence of meat flavors on the detection of Trichinella by FTIR spectroscopy. Key words: Trichinella, Meat-inspection, Sausage, Diagnosis, Infrared-spectroscopy.

Received: 09/12/2020 Accepted: 30/03/2021

Introduction Trichinella spiralis (Owen, 1835) is a parasitic nematode of worldwide distribution that causes the foodborne zoonosis named trichinellosis. Since various human clinical cases and outbreaks are related to eating pork or pork products (sausages) insufficiently cooked that host viable larvae(1-5), the International Commission on Trichinellosis continuously issues recommendations for the inspection and treatment of meat intended for human consumption(6). In abattoirs, the artificial digestion using pepsin protease and hydrochloric acid is the standard assay for the detection of Trichinella larvae(7-9). Notwithstanding inspection of pigs in public slaughterhouses is mandatory, some pigs remain without any sanitary control and, after slaughtering, the meat or meat products are domestically sold

1134

Rev Mex Cienc Pecu 2021;12(4):1133-1150

without sanitary inspection. Thus, manufacturers exercise caution to improve the stability of raw pork meat using preservation techniques. However, the reproductive capacity of Trichinella muscle larvae has been reported not to be affected by, “wet-curing”, “adobado” (meat spiced with chili) or cold storage of raw meat(10). Sausages, in addition to being part of society's culinary customs, are also a way of preserving pork meat. There are some reports of human trichinellosis by ingestion of pork sausages(1,4,11,12) and, additionally, Forbes et al(13), reported that the larvae of T. nativa (Britov & Boev, 1972) maintained their infectivity in traditional northern raw and partially cooked sausages prepared with meat from experimentally infected seals. Since prepared sausages of unchecked pork could be a risk in the transmission of Trichinella, it is necessary to have diagnostic alternatives that can support the recommended techniques for meat inspection to make the definitive diagnosis of the parasite(7). An alternative method, currently used in food analysis, is the Fourier transform infrared (FTIR) spectroscopy with attenuated total reﬂectance (ATR) and soft independent modeling of class analogies (SIMCA). The usefulness of FTIR spectroscopy has been previously reported to detect adulterations in pork meat products(14,15). In recent times, someone of this research group developed the model for rat meat spiked with T. spiralis larvae and was able to detect three larvae in 10 g of rat meat; no interference was observed with antigens of Ascaris suum (Goeze, 1782) or Taenia solium (Linnaeeus, 1758)(16). In a subsequent experiment, it was possible to identify the T. spiralis muscle larvae in pigs infected with different infective doses, from 812 to 13,000 larvae/pig(17). However, the identification of larvae in meat products derived from infected pigs was awaiting. Thus, this work aimed to determine the usefulness of Fourier transform infrared (FTIR) spectroscopy to detect Trichinella spiralis muscle larvae in ham and sausages made from the meat of an experimentally infected pig.

Material and methods Parasite

The parasite Trichinella spiralis (MSUS/ME/92/CM-92) was maintained in Wistar rats. The parasite was isolated in Mexico from a naturally infected pig in the 1970 and was typified in the 1990(18). Each rat (250 g of body weight and 6 wk old), was infected orally with 23 muscle larvae (ML) per gram of body weight (equivalent to 6,000 ± 250 mL per rat). The experimental infection to obtain the larvae was approved by Comite de Etica y Cuidado de los Animales (CIECUA) of the Instituto de Ciencias Agropecuarias of the UAEH under the guidelines of Mexican regulation(19). Muscular larvae were isolated by artificial digestion

1135

Rev Mex Cienc Pecu 2021;12(4):1133-1150

with a solution of 0.5% pepsin (Sigma–Aldrich St. Louis, Mo; USA) in 0.2% hydrochloric acid. Afterward, larvae were counted at 100x magnification with bright field microscopy. The number of T. spiralis muscle larvae present in the sausages was also evaluated by artificial digestion.

Experimental infection

Two male York Landrace pigs (Sus scrofa domestica Linnaeus, 1758) of 4 wk old and 10 ± 0.2 kg were fed ad libitum with pelleted commercial food for the fattening stage (Agribrands Purina Mexico, Cuautitlán, Edo. Méx.). One pig was infected with 800 muscular larvae of T. spiralis, equivalent to a slight infection of 0.08 muscle larvae per gram of body weight; the other pig remained uninfected. The animals were maintained in separate corrals following the Mexican regulations(19,20). The animals were slaughtered using a penetrating captive bolt gun at 12 wk post-infection and three samples of 10 g were obtained from five anatomical regions (rib, loin, leg, masseter and diaphragm). The samples were subjected to artificial digestion or to compression between two glasses and observation at 40x magnification (trichinoscopy) to search for parasites. The leg meat was used to make the ham, and the meat of loin, rib, and shank was used to make the sausage called "salchicha" in México, often similar to hotdogs, frankfurters, or wieners.

Pork products

The ham and sausage were prepared without seasonings at the School of Veterinary Medicine (Facultad de Estudios Superiores Cuautitlán, Universidad Nacional Autónoma de México) according to traditional Mexican recipes and according to the Mexican regulation(21). The ham was prepared from leg meat (605 g) without fat, tendons or ligaments. The meat was placed in a mincer to reduce the size of the meat pieces. The brine was prepared using sodium phosphate (9.0 g), salt (13.3 g), sugar (4.2 g), cure salt (12.0 g), sodium erythorbate (1.99 g), monosodium glutamate (0.18 g) and carrageenan (4.2 g) dissolved in water (350 ml). Then, the meat was placed in a container and the brine was added, then the container was covered with adhesive plastic and put in cooling conditions at 4 oC for 24 h. The next day, the cured meat was placed inside a knotted sheath with thread from the end, eliminating as much as possible the air to accommodate the meat. The preparation was placed into a vacuum machine to remove any air presence and then tightly knot the free end of the sheath. The ham was cooked entirely submerged in water at 80 ± 1 oC for 50 min and then cooled for 5 min in ice water. The sausage was made with the meat of loin, rib and shank without tendons or

1136

Rev Mex Cienc Pecu 2021;12(4):1133-1150

ligaments. The meat (595 g) was minced twice with ice (110 g), salt (11 g) and salt of cure (1.7 g) to make an emulsion. At that point, pork fat (171.4 g) and ice (110 g) were added while the mincer was working. Subsequently, cornstarch (92.2 g) was slowly incorporated to form an emulsified paste. Without stopping the mincer, sodium erythorbate (1.3 g), ice (110 g) and sodium phosphate (5.2 g) were added. To prepare the sausage, the operation of the mincer was stopped, and the paste was placed at the bottom of the filler, which was fitted with a 1 cm diameter nozzle. The nozzle was covered with a layer of vegetable oil to insert the cellophane was knotted at the opposite end. Finally, the cellophane sheath was carefully filled, and it was split every 10 to 12 cm; each fraction was knotted. The sausage entirely submerged in water at 72 ± 1 oC for 20 min and then cooled for 5 min in ice water. Fresh samples were subjected to artificial digestion and trichinoscopy to determine the number of muscle larvae in the ham and sausage.

Detection of larvae in pork products stained with Mayer's hemalum

Samples 0.1 mm thick of ham and sausage (n= 20, each) were stained with Mayer's hemalum, as previously reported(22), but several modifications were made to the original method. Briefly, the samples were incubated in ether for 1 h at room temperature, then fixed in 10% formalin for 12 h. Afterward, they were stained with hemalum (Sigma Aldrich, St. Louis, MO, USA) for 15 min and subsequently the samples were dehydrated by consecutive passages through 70, 80, 90, 96 and 100% alcohol for 15 min each time. A final 20 min incubation in methyl salicylate was performed prior to mounting each slide with synthetic resin. The preparations were observed in light microscopy at 40X magnification, and the muscle larvae were counted.

Detection of Trichinella spiralis in pork products by FTIR spectroscopy

The ham and sausage spectra were obtained as previously described(16,17), using a FTIR spectrophotometer (Spectrum GX, Perkin Elmer Massachusetts, USA) equipped with a deuterated triglycine sulfate detector. The sampling station has an attenuated total reflection accessory (ATR) through which infrared radiation passes to a zinc selenide crystal. Onegram sample (n= 5) of each ham and sausage were placed on the sampling station. The samples were pressed on the surface of the glass to allow the infrared ray to pass through them and be reflected towards the spectrometer and, 64 readings (scans) were obtained from each analyzed sample. The spectra were acquired and processed with the Spectrum software version 3.01.00 (Perkin Elmer, Inc.). The spectra were scanned over a wave number range of

1137

Rev Mex Cienc Pecu 2021;12(4):1133-1150

4,000–650 cm-1, averaging 64 scans at a resolution of 4 cm-1. The analysis region was 1,700 to 900 cm-1.

Development of the SIMCA model

With the obtained spectra, the SIMCA model (Soft Modeling of Independent Classes Analogies) was elaborated for which 40 spectra of sausages infected and not infected with Trichinella spiralis larvae were used. The spectra were then subjected to Soft Independent Modeling of Class Analogy analysis (SIMCA) to determine the interclass distance between groups. The minimum value of the interclass distance must be greater than 3 so that the two analyzed populations are considered to be different(16,17).

Infective capacity of parasite

To determine the infective capacity of larvae recovered by artificial digestion of the infected ham and sausage, CD1 naive male mice (n= 10 per product) 5 wk old and 20 g, were orally infected with 50 ± 3 mL. In addition, five mice of the same age, sex, and weight were infected with an equal dose of militers obtained from a donor rat experimentally infected. At day 60 post-infection, mice were killed by cervical dislocation and then, submitted to artificial digestion to calculate the reproductive capacity index, i. e., the number of larvae recovered from carcasses divided by the number of larvae used to infect mice(10,23). The CIECUA approved the experimental infection protocol.

Statistical analysis

The parasite load in the experimentally infected pig was analyzed using the two-way ANOVA test followed by Bonferroni post-test. The parasite load in the pork products was analyzed by the unpaired Student´s T-test. The reproductive capacity index of larvae recovered from ham or sausage was analyzed with the one-way ANOVA test followed with the Tukey´s multiple comparison test. Analysis was performed with the GraphPad Prism version 6.01 for Windows (GraphPad Prism Software, version 6.01, La Jolla California USA).

1138

Rev Mex Cienc Pecu 2021;12(4):1133-1150

Results Experimental infection of pig

The parasite load was determined in five anatomical regions (rib, loin, leg, diaphragm and masseter; n= 3 samples of each region) by artificial digestion and trichinoscopy (Figure 1). Statistical differences were observed among anatomical regions (P<0.0001) but the results obtained with the two detection methods were similar (P=0.4494). It should be noted that the anatomical regions with high commercial demand have three times less parasitic load than the masseter and five times less than the diaphragm, two of the preferred sites of encystment of T. spiralis in pigs. Figure 1: Larval load of Trichinella spiralis in five anatomical regions of a pig experimentally infected

The graph shows the number of muscle larvae per gram of tissue (ML/g) obtained by artificial digestion (AD) or by trichinoscopy (T). A total of 3 samples, 10 g each one, was analyzed per anatomical region; the graph shows the average of 3 samples and their standard deviation.

1139

Rev Mex Cienc Pecu 2021;12(4):1133-1150

Detection of larvae in pork ham and sausages using standard methods

Detection of the muscle larvae in ham and sausages was carried out by artificial digestion and trichinoscopy. However, standard trichinoscopy did not allow to clearly identifying the parasites due to interference of the fat and starch contained in the products. Twenty ham samples (Figure 2, panels “a” and “b”), and 20 sausage samples (Figure 2, panels “c” and “d”) were stained with Meyer´s hemalum to enhance the sharpness of the larval observation. The muscle larvae and the nurse cell were observed as purple structures surrounded by noninfected cells, which were of pink coloration. The parasite load in ham was of 8.5 ± 3 ML/g (mean ± SD) while, in sausage, the parasite load was 4.5 ± 1.4 ML/g (P<0.0001; Student´s T-test, two-tails). Figure 2: Representative micrographs of Trichinella spiralis encysted larvae

Trichinella spiralis encysted larvae stained with Mayer's hemalum in homemade ham (panels a and b, 100x magnification) and sausage (panels c and d, 400x and 100x magnification, respectively) prepared with meat from an experimentally infected pig.

1140

Rev Mex Cienc Pecu 2021;12(4):1133-1150

Detection of larvae in pork ham and sausages using FTIR spectroscopy Figure 3 shows the FTIR spectra of ham (panel a) and sausage (panel b), obtained with 30 samples of each pork product. Spectrum differences between infected and non-infected pork products were observed in the range of 1,700 to 900 cm-1. Since each peak in the spectrum is related to functional chemical groups, all biological samples have a "fingerprint" spectrum related to their chemical composition. The soft independent modeling of class analogy (SIMCA) showed 100 % recognition rate and 100 % rejection rate. Spectra from non-infected ham or non-infected sausage were classified as normal pork product (100 % recognition) while, the spectra from infected ham or infected sausage were rejected (100 %) because the interclass distance between non-infected and infected pork products was of 10.2 for ham and 5.2 for sausage (Table 1). Figure 3: Representative spectra obtained by MID-FTIR-ATR for the detection of Trichinella spiralis muscular larvae in homemade ham and sausage from an experimentally infected pork

Panel (a) shows the spectra of infected and non-infected ham, while panel (b) shows the spectra of infected and non-infected sausage. Absorbance (A) is presented as a function of wavelength.

1141

Rev Mex Cienc Pecu 2021;12(4):1133-1150

Table 1: Interclass distance and percentages of recognition and rejection rates (SIMCA model) between T. spiralis ham and sausage infected and non-infected pigs Class Ham infected Ham non-infected Sausage infected Sausage non-infected

ID 10.2

Recognition rate (%) 100 (30/30)

Rejection rate (%) 100 (30/30)

100 (30/30)

5.52

Figure 4 shows the three-dimensional analysis of non- and infected pork products. Panel (a) shows the ham, and panel (b), the sausage. The three-dimensional image of non- and infected products seems to overlap because they share in common all the raw material for making the sausages, but they also have elements that are not shared (points within the figure), that is, components of Trichinella larva. Figure 4: Three-dimensional component analysis score plots

Score plots were generated by the optimized SIMCA models for the different of ham (panel a) and sausage (panel b) infected and non-infected with Trichinella spiralis

1142

Rev Mex Cienc Pecu 2021;12(4):1133-1150

Reproductive capacity

Only 2 out of 10 (20 %) mice administered with larvae recovered from ham were found to be infected, while in the group given larvae recovered from sausage, 3 mice out of 10 (30 %) were infected. Figure 5 shows that the reproductive capacity index (RCI) of larvae recovered from ham was 5.5 times lower than that of larvae recovered from infected rats. The RCI of larvae recovered from sausage was 3 times lower than that of larvae recovered from infected rats. Figure 5: Comparison of the reproductive capacity index of Trichinella spiralis larvae from pork products prepared with the meat of a pig experimentally infected

Differences among groups were evaluated with a 0.05 level of significance one-way ANOVA followed by Tukey's test for between-groups comparison (P<0.0001).

Discussion Although sanitary inspection of pigs is mandatory in public slaughterhouses, many products are prepared from "backyards" pigs and then marketed without health inspection. The search for Trichinella in pork products is complicated because diverse parts of the pig are used to make sausages, and it is known that these parasites do not distribute homogeneously in the different anatomical regions of their host(2,5); data obtained in this research confirm this

1143

Rev Mex Cienc Pecu 2021;12(4):1133-1150

observation. Pork is one of the main sources of protein for the Mexican population; in fact, it is the second most-consumed meat in the country and the main ingredient in many culinary recipes. Coincidentally, the regions with the highest economic demand (leg, loin, rib, shank, among others) are those with the lowest parasite load. However, there is no anatomical part of the pig that is not either exploited for consumption as a main food or combined with other elements; sausages are a good example because are usually prepared with fat, viscera or blood. Since scarce alternatives to search for parasites in pork products are available, here it was examined the utility of FTIR spectroscopy to detect Trichinella spiralis muscle larvae in ham and sausage of an experimentally infected pork. This technique had already been tested in Trichinella experimentally infected pigs(17), and no interference was observed with antigens of Ascaris suum or Taenia solium(16); therefore, the next step was to identify the diagnostic utility of FTIR spectroscopy in pork products. The infrared spectroscopy has already applied successfully for quality control, adulterant detection, and origin denomination of wine, honeybees, olive oil, spirit drinks and beer, dairy products, fish, beef meat, and clenbuterol, among others(24). Previous experiments have shown FTIR spectroscopy is capable of recognizing up to 3 larvae of Trichinella in 10 g of meat with a confidence limit of 99 %(16). Analysis of data reported here suggests that T. spiralis larvae were successfully identified in infected pork products. The spectra of non-infected ham and sausage showed the characteristic bands of fatty acids, proteins, and glycogens already reported(25,26), and the spectra of infected pork products were similar to those previously described in meat obtained from experimentally infected pigs(17). At this region, the carbohydrates, mainly glycogen, are the most abundant chemical group (1,200 and 900 cm-1) and, as a point of interest, it is known that once Trichinella establishes in skeletal muscle, the larva transforms the muscle cell into a nurse cell, and from this location, continuously releases excretory and secretory products or ESP. These products contribute to establishing parasitism(27) and are important in the induction and modulation of the host immune response(28). The ESP contains many functional proteins, which are glycoproteins, some of them bearing multi-antennary N-glycans caped with a monosaccharide named tyvelose(29). The results obtained in this work show that the FTIR spectroscopy could be an additional alternative to the inspection procedures established for the meat trade for human consumption. Previously, it has been shown that the SIMCA (soft independent modeling of class analogies) model is capable of differentiating between Trichinella and other worms such as Ascaris and Taenia(16). All three worms are frequently found in pigs, and are transmissible to humans; however, only Trichinella is microscopic (1.2 mm), while the others can be seen with the naked eye, the adult Ascaris worm measures more than 15 cm and the Taenia larva measures at least 0.5 cm. Therefore, it is desirable to have an alternative diagnostic method to avoid the transmission of Trichinella between pigs and humans. It is also desirable that these methodologies can be applied in epidemiological studies to know the prevalence and 1144

Rev Mex Cienc Pecu 2021;12(4):1133-1150

distribution of Trichinella. Although the product quantity to be analyzed for epidemiological surveillance purposes remains to be assessed, here there were obtained results with only 5 g for each pork product. As far as was known, there are many different types of seasoning frequently used to preserving and improving the flavor of meat, but there are scarce data about their spectroscopy. Thus, further studies should be done to determine if any seasoning could have a spectrum similar to that of Trichinella, which could cause the report of "false-positive" samples. Such a study is significant since it has been previously shown that some seasonings do not influence the infectivity of Trichinella(10). In contrast, the analysis of sausages by trichinoscopy and artificial digestion was complicated due to interference with fat and starch; some samples had to be stained to improve detection of the parasite. To the best of our knowledge, this is the first report in which Mayer´s hemalum staining is used as an aid in the identification and diagnosis of T. spiralis. It was took advantage of the contrast between the parasites and the non-infected myocyte to count the muscle larvae. The staining properties of the muscular larvae and the nurse cell have been widely described from hematoxylin-eosin stained histological sections(30) and Giemsa stained compressed muscle(31). Although in this work, sections of ham and sausage were stained to demonstrate the presence of muscle larvae, it seems that the use of dyes could be an alternative to support the intentional search of the larva in meat samples, where the nature of the product masks or conceals the presence of parasites. The results made evident that ham and sausage preparation limits the infective capacity of Trichinella larvae. Most probably, almost all larvae die during the preparation of pork products. Kotula et al(32) reported that the Trichinella muscle larvae are not infective in pork chops (2.54 cm thick) cooked to an internal temperature of 66 to 77 oC in a conventional oven. This internal temperature was reached after 35 to 43 min of cooking. Nowadays, the International Commission on Trichinellosis recognizes cooking as one of the three acceptable means to inactive Trichinella(33). Here, it was cooked the ham with water at 80 ± 1 oC for 50 min and the sausage at 72 ± 1 oC for 20 min. Difference in cooking time between ham and sausage consists in that meat of sausages are pre-cooked during 20 min (between 60 and 70 oC); thus, meat does not lose consistency or plasticity and the sausage can be assembled appropriately. According to culinary recipes, to prepare the food, sausages must have additional final cooking (boiled or fried) for 10 to 30 min; the results show that some larvae remained alive. This can be explained considering that heat inside the ham and sausage was not consistently distributed or, in the case of the sausage, it must be due to the cooking time was short. The results of the infective capacity show that the RCI obtained with the larvae recovered from the ham was lower than that obtained with the sausages.

1145

Rev Mex Cienc Pecu 2021;12(4):1133-1150

This data is important since there are several reports of human trichinellosis by ingestion of pork sausages(1, 34-37), turning sausages from meat without sanitary inspection into a probable source of Trichinella transmission. This information is also important because, in some countries, such as Mexico, the "salchicha" ranks first in the list of consumption of sausages in the country, followed by ham, “chorizo” and mortadella. In 2011, the consumption per capita in Mexico was of 7.8 kg and in 2017 was of 8.6 kg(38).

Conclusions and implications Here, it was successfully used FTIR spectroscopy for the detection of Trichinella spiralis muscle larvae in pork products (ham and sausage) and discrimination of non-infected products from those infected with the parasite. The usefulness of this methodology could be extended to detect other etiological agents. Implementing the method for the routine inspection of pork products would reduce the time of sample analysis (5 min), in comparison to 10-30 min for trichinoscopy and 1 to 3.5 h for artificial digestion. Other advantages are the amount of sample needed for the analysis, the sample processing without previous treatments, the rapid obtaining of results. Besides, the methodology is an environmentalfriendly process. However, limitations of this methodology are the cost of the equipment and the infrastructure necessary for its operation.

Acknowledgments

We thank the outstanding technical assistance of María-Teresa Corona-Souza and Seidy Zamora-Carrillo. Dr. Guillermo Osorio-Revilla for his support during the realization of this work. MSc Katia-Marleth Herrera-Aguirre and MSc Juan-Carlos Cruz-Tapia (native English speakers) for the English review of the manuscript. Jorge-Luis de-la-Rosa-Arana, Vicente Vega-Sánchez and Tzayhri Gallardo-Velazquez are fellows of the National System of Researchers (CONACYT, Mexico).

Conflicts of interest

None of the authors have a conflict of interest with respect to this publication.

1146

Rev Mex Cienc Pecu 2021;12(4):1133-1150

Literature cited: 1. Ruetsch C, Delaunay P, Armengaud A, Peloux-Petiot F, Dupouy-Camet J, Vallée I, et al. Inadequate labeling of pork sausages prepared in Corsica causing a trichinellosis outbreak in France. Parasite 2016;23:27. 2.

Ribicich M, Miguez M, Argibay T, Basso N, Franco A. Localization of Trichinella spiralis in muscles of commercial and parasitologic interest in pork. Parasite 2001;8(2 Suppl):S246-S248.

Pozio E, Pence DB, La Rosa G, Casulli A, Henke SE. Trichinella infection in wildlife of the southwestern United States. J Parasitol 2001;87(5):1208-1210.

Ortega-Pierres MG, Arriaga C, Yepez-Mulia L. Epidemiology of trichinellosis in Mexico, Central and South America. Vet Parasitol 2000;93(3-4):201-225.

Kapel CMO, Webster P, Gamble R. Muscle distribution of sylvatic and domestic Trichinella larvae in production animals and wildlife. Vet Parasitol 2005;132(1-2):101105.

Noeckler K, Pozio E, van der Giessen J, Hill DE, Gamble HR. International Commission on Trichinellosis: Recommendations on post-harvest control of Trichinella in food animals. Food Waterborne Parasitol 2019;14:e00041.

Nöckler K, Pozio E, Voigt W, Heidrich J. Detection of Trichinella infection in food animals. Vet Parasitol 2000;93(3-4):335-350.

Konecsni K, Scheller C, Scandett B, Buholzer P, Gajadhar A. Evaluation of the PrioCHECK™ Trichinella AAD Kit for the digestion and recovery of larva in pork, horse meat and wild meat. Vet Parasitol 2017;243:267-271.

Gajadhar AA, Konecsni K, Scandrett B, Buholzer P. Validation of a new commercial serine protease artificial digestion assay for the detection of Trichinella larvae in pork. Food Waterborne Parasitol 2018;10:6-13.

10. Medina-Lerena MS, Ramirez-Álvarez A, Kühne M, Gómez-Priego A, de-la-Rosa JL. Influence of different processing procedures on the reproductive capacity of Trichinella spiralis in pork meat. Trop Anim Health Prod 2009;41(4):437-442. 11. Potter ME, Kruse MB, Matthews MA, Hill RO, Martin RJ. A sausage-associated outbreak of trichinosis in Illinois. Amer J Public Health 1976;66(12):1194-1196. 12. Hill DE, Luchanscky A, Porto-Fett A, Gamble R, Fournet VM, Hawkins-Cooper DS, et al. Curing conditions to inactivate Trichinella spiralis muscle larvae in ready-to-eat pork sausage. Food Waterborne Parasitol 2017;6:1-8.

1147

Rev Mex Cienc Pecu 2021;12(4):1133-1150

13. Forbes LB, Measures L, Gajadhar A, Kapel C. Infectivity of Trichinella nativa in traditional northern (country) foods prepared with meat from experimentally infected seals. J Food Prot 2003;66(10):1857-1863. 14. Rohman A, Sismindari S, Erwanto Y, Che-Man YB. Analysis of pork adulteration in beef meatball using Fourier transform infrared (FTIR) spectroscopy. Meat Sci 2011;88(1):91–95. 15. Sari TNI, Guntarti A. Wild boar fat analysis in beef sausage using Fourier Transform Infrared method (FTIR) combined with chemometric. Indonesian J Med Health 2018;9(1):16-23. 16. Gómez-de-Anda F, Gallardo-Velazquez T, Osorio-Revilla G, Dorantes-Alvarez L, Calderón-Domínguez G, Nogueda-Torres B, et al. Feasibility study for the detection of Trichinella spiralis in a murine model using mid-Fourier transform infrared spectroscopy (MID-FTIR) with attenuated total reflectance (ATR) and soft independent modelling of class analogies (SIMCA). Vet Parasitol 2012;190(3-4):496-503. 17. Gómez-de-Anda F, Dorantes-Álvarez L, Gallardo-Velazquez T, Osorio-Revilla G, Calderón-Domínguez G, Martínez-Labat P, et al. Determination of Trichinella spiralis in pig muscles using mid-Fourier transform infrared spectroscopy (MID-FTIR) with attenuated total reflectance (ATR) and soft independent modeling of class analogy (SIMCA). Meat Sci 2012;91(3):240-246. 18. Martínez-Fernández AR, Arribas B, Bolás F. Freezing resistance of spanish Trichinella isolates (T. spiralis and T. britovi). In: Gamble R, et al editors. Proc Ninth Int Conf Trichinellosis. 1rst ed. Ciudad de México, México: CINVESTAV; 1997:99-105. 19. Norma Oficial Mexicana NOM-062-ZOO-1999, Especificaciones técnicas para la Producción, Cuidado y Uso de los Animales de Laboratorio. 20. Norma Oficial Mexicana NOM-194-SSA1-2004, Productos y servicios. Especificaciones sanitarias en los establecimientos dedicados al sacrificio y faenado de animales para abasto, almacenamiento, transporte y expendio. Especificaciones sanitarias de productos. 21. Norma Oficial Mexicana NOM-213-SSA1-2002, Productos y servicios. Productos cárnicos procesados. Especificaciones sanitarias. Métodos de prueba. 22. Cooper DW. The preparation of serial sections of platyhelminth parasites, with details of the materials and facilities required. Syst Parasitol 1988;12:211-229.

1148

Rev Mex Cienc Pecu 2021;12(4):1133-1150

23. de-la-Rosa JL, Álvarez N., Gómez-Priego A. Study of the reproductive capacity of Trichinella spiralis recovered from experimentally infected mice under-dosed with albendazole or mebendazole. Trop Biomed 2007;24(2):93-97. 24. Meza-Márquez OG, Gallardo-Velázquez T, Dorantes-Álvarez L, Osorio-Revilla G, dela-Rosa-Arana JL. FT-MIR and Raman spectroscopy coupled to multivariate analysis for the detection of clenbuterol in murine model. Analyst 2011;136:3355-3365. 25. Lewis PD, Lewis KE, Ghosal R, Bayliss S, Lloyd AJ, Wills J, et al. Evaluation of FTIR spectroscopy as a diagnostic tool for lung cancer using sputum. BMC Cancer 2010;10:640. 26. Rohman A, Sismindari, Erwanto Y, Che-Man YB. Analysis of pork adulteration in beef meatball using Fourier transform infrared (FTIR) spectroscopy. Meat Sci 2011;88(1):91-95. 27. Nagano I, Wu Z, Takahashi Y. Functional genes and proteins of TrichKinella spp. Parasitol Res 2009;104(2):197-207. 28. Bruschi F, Chiumiento L. Immunomodulation in trichinellosis: does Trichinella really scape the host immune system?. Endocr Metab Immune Disord Drug Targets 2012;12(1):4-15. 29. Morelle W, Haslam SM, Morris HR, Dell A. Characterization of the N-linked glycans of adult Trichinella spiralis. Mol Biochem Parasitol 2000;109(2):171-177. 30. Boonmars T, Wu Z, Nagano I, Takahashi Y. Trichinella pseudospiralis infection is characterized by more continuous and diffuse myopathy than T. spiralis infection. Parasitol Res 2005;97(1):13-20. 31. Ramírez-Melgar C, Gómez-Priego A, de-la-Rosa JL. Application of Giemsa stain for easy detection of Trichinella spiralis muscle larvae. Korean J Parasitol 2007;45(1):6568. 32. Kotula AW, Murrell KD, Acosta-Stein L, Lamb L, Douglass L. Destruction of Trichinella spiralis during cooking. J Food Sci 1983;48(3):765-768. 33. Gamble HR, Bessonov AS, Cuperlovic K, Gajadhar AA, van-Knapen F, Noeckler K., et al. International Commission on Trichinellosis: recommendations on methods for the control of Trichinella in domestic and wild animals intended for human consumption. Vet Parasitol 2000;93(3-4):393-408. 34. Potter ME, Kruse MB, Matthews MA, Hill RO, Martin RJ. A sausage-associated outbreak of trichinosis in Illinois. Am J Public Health 1976;66(12):1194-1196.

1149

Rev Mex Cienc Pecu 2021;12(4):1133-1150

35. Martínez-Marañón R. ¿Está aumentando la triquinosis en México? ¿Podría esto ser una consecuencia inesperada de nuestro "desarrollo"? Salud Publica Mex 1985;27(1):40-51. 36. Zamora-Chávez A, de-la-O-Cavazos ME, Bernal-Redondo RM, Berrones-Espericueta D, Vázquez-Antona C. Triquinosis aguda en niños. Brote epidémico intrafamiliar en la ciudad de México. Bol Med Hosp Infant Mex 1990;47(6):395-400. 37. Krivokapich SJ, Graciana MG, Gonzalez-Prous CL, Degese MF, Arbusti PA, Ayesa GE, et al. Detection of Trichinella britovi in pork sausage suspected to be implicated in a human outbreak in Mendoza, Argentina. Parasitol Int 2019;71:53-55. 38. Saldaña, M. Aumentan mexicanos su consumo de embutidos. EL UNIVERSAL 2018; (16/02/2018).https://www.eluniversal.com.mx/cartera/aumentan-mexicanos-suconsumo-de-embutidos. Consultado 12 Dic, 2020.

1150

https://doi.org/10.22319/rmcp.v12i4.5739 Article

Frequency of serum antibodies against infectious bovine rhinotracheitis and bovine viral diarrhea viruses in bulls, and their relationship with the presence of the viruses in semen

Jorge Víctor Rosete Fernández a Guadalupe A. Socci Escatell b Abraham Fragoso Islas a Juan Prisciliano Zárate Martínez c Sara Olazarán Jenkins a Lorenzo Granados Zurita d Ángel Ríos Utrera c*

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), Sitio Experimental Las Margaritas. Kilómetro 9.5 carretera Hueytamalco-Tenampulco, Hueytamalco, Puebla, México. b

INIFAP, CENID Salud Animal e Inocuidad. Ciudad de México, México.

INIFAP, Campo Experimental La Posta. Veracruz, México.

INIFAP, Campo Experimental Huimanguillo. Tabasco, México.

*Corresponding author: rios.angel@inifap.gob.mx

1151

Rev Mex Cienc Pecu 2021;12(4):1151-1167

Abstract: The objective was to estimate the frequency of serum antibodies against infectious bovine rhinotracheitis (IBRV) and bovine viral diarrhea (BVDV) viruses in unvaccinated bulls, as well as the relationship between the presence of antibodies in serum and the presence of these viruses in semen. Antibodies were detected by ELISA, while the presence of the viruses in semen by PCR. Logistic regression analyses were performed with the PROC GENMOD of SAS. The factors were: state, herd nested in state, and genotype of the bull (except for the presence of the viruses in semen). The degree of association between the presence of serum antibodies and the presence of the viruses in semen was measured by the phi (r) correlation. None of the three factors were significant (P>0.05). For IBRV, the frequency of serum antibodies by state ranged from 66 to 86 %, while by herd, it ranged from 28 to 90 %. For BVDV, the frequency of serum antibodies by state ranged from 58 to 76 %, while by herd, it ranged from 43 to 86 %. The presence of IBRV in semen, by state, ranged from 50 to 55 %, while by herd, it ranged from 33 to 80 %. No association (P>0.05) was found between the presence of antibodies in serum and the presence of IBRV (r=0.07) and BVDV in semen (r=0.16). The presence of serum antibodies suggests infection of bulls, but the presence of the viruses in semen suggests their transmission by sexual contact. Key words: Bulls, Infectious bovine rhinotracheitis, Bovine viral diarrhea, Antibodies, Antigens, Semen, Tropics.

Received: 20/07/2020 Accepted: 30/03/2021

Introduction Bovine viral diarrhea (BVD) is an acute and epizootic disease(1) because it causes a wide range of lesions and clinical manifestations, as well as

1152

Rev Mex Cienc Pecu 2021;12(4):1151-1167

considerable losses in beef and dairy cattle(2), with reproductive disorders being the ones with the greatest economic impact(3). Due to its pathogenesis, BVD has been considered the most complicated viral disease in cattle(4). There are two biotypes of the BVD virus (BVDV): the cytopathic (CP) and the non-cytopathic (NCP), according to their behavior in cell cultures(2,4,5). The common biotype in most (95 %) field isolates is NCP; the CP biotype is generated by mutations or rearrangements of the genome of the original paternal NCP strain. In addition, due to their genetic-antigenic characteristics, they are classified into two genotypes, which are BVDV-1 and BVDV-2, which are mostly NCP. These biotypes and genotypes are independent qualities of Pestiviruses(6). Each biotype has a specific role in a variety of clinical syndromes, such as chronic, acute, and congenital infections. BVDV-2 has been associated with outbreaks of severe acute infections and hemorrhagic syndrome(7). The main characteristic of this virus is its genetic and antigenic variability, since RNA viruses are characterized by their plasticity, which is due to the lack of an efficient exonuclease to correct poorly incorporated bases, causing a highfrequency base substitution (one error per 10,000 polymerized nucleotides). BVDV uses this strategy to survive, causing mutant strains that escape the host’s immune response. BVDV mainly infects cattle, a species for which it represents one of the most important pathogens, but it can also be found in sheep, goats(1), pigs, alpacas, llamas, camels, water buffaloes and wild ruminants(3). This peculiarity must be taken into account when implementing a control program, since Pestiviruses cross the species barrier(3). The great diversity of studies available indicates that BVD has a worldwide distribution(6,8-11), since the virus is of high morbidity and low mortality(12), in such a way that a persistently infected animal less than four months old is able to infect 90 % of its herd mates in housed conditions(13). For its part, infectious bovine rhinotracheitis (IBR) is a disease distributed in various regions of Mexico, since neutralizing antibodies against the IBR virus (IBRV) have been found since 1988 in cattle from Estado de México, Puebla

1153

Rev Mex Cienc Pecu 2021;12(4):1151-1167

and Yucatán, from cattle with respiratory signs that suggested the presence of the virus(14). In Tizimín, Yucatán, a seroprevalence of 5.33 %(15) was observed and, subsequently, in another study in cattle without a history of vaccination, a seroprevalence of 54.4 %(16) was found, which shows that IBRV is present and latent in the tropics, since its prevalence has been increasing, because it is highly contagious. IBR manifests itself in different ways and is transmitted by direct contact with nasal, ocular and genital secretions, as well as with fresh semen from infected bulls(17). This disease has been little studied in bulls, mainly in commercial herds from the Mexican tropics, because, although reproductive failures have been reported in cows, no action has been taken to identify health problems in bulls. Therefore, it is important to study it, since in most cows, the disease goes unnoticed because it does not cause death, having abortion as its main characteristic, affecting reproductive and productive parameters and significantly increasing economic losses(18), since there is less production of fattening calves and replacement heifers. Some studies have shown the presence of IBRV in frozen semen. In artificial insemination centers, isolates of this agent have been carried out in clinically healthy bulls(19), but little research has been done on the presence of this virus in the semen of bulls that reproduce by means of natural mounting in commercial herds from the Mexican tropics. In previous studies, it is recognized that infected bulls are a risk factor for the transmission of IBR, since its causative agent is transmitted by venereal route(20), reactivating the disease in the herd and keeping it infected, which explains the high antibody titers found in some studies in bulls destined for natural mounting(21). In herds where reproduction has been through natural mounting, prevalences of 74.0(22) and 69.5 %(23) have been found, revealing the participation of the male in the transmission of the disease, despite the fact that serological tests could be negative(21). In one study, it was observed that the fertility of bulls was not affected by IBR(24); therefore, it is a risk factor that should be considered when acquiring bulls for mounting without sanitary control, which undoubtedly contributes to worsening the situation of IBR in herds.

1154

Rev Mex Cienc Pecu 2021;12(4):1151-1167

Based on the above, the objective of the present work was to estimate the frequency of serum antibodies against BVD and IBR viruses in unvaccinated bulls, as well as the relationship between the presence of antibodies in serum and the presence of the viruses in semen.

Material and methods The study was conducted in 14 commercial herds located in the tropics and subtropics of Mexico in the states of Puebla, Tabasco and Veracruz. The herds are located in the area of influence of INIFAP’s experimental stations: Las Margaritas, in Puebla, Huimanguillo, in Tabasco, and La Posta, in Veracruz. The herds were selected based on a non-probabilistic convenience sampling, according to the farmers’ interest in participating in the present study. On the other hand, the sample size (n= 76) depended on the existing bulls in each participating herd. The bulls belonged to herds officially free of Brucella abortus and Mycobacterium bovis, which were destined for beef production and dual purpose. The genotype of the bulls was classified into zebu (Bos indicus), European (Bos taurus) and crossed (Bos taurus x Bos indicus). The blood samples were obtained from the coccygeal vein and kept between 4 and 6 °C in a cooler until reaching the laboratory of the corresponding experimental station, where they were centrifuged at 4,000 rpm for 10 min to obtain 3 ml of serum/bull. Serum samples were stored in polyethylene vials at -20 °C until the time of analysis. The serological diagnosis for the detection of antibodies against IBR and BVD viruses was made with the CIVTEST BOVIS IBR and CIVTEST BOVIS BVD/BD P80 kits (Laboratorios Hipra, S.A., Mexico), based on the ELISA test, whose sensitivity and specificity is 96.3 and 99.5 %, respectively. In both serological diagnostics, the reading was made at an optical density of 450 nanometers in an ELx800 spectrophotometer, BioTek brand (BioTek Instruments, Inc., USA). The semen samples (3 ml/bull) were obtained by means of electroejaculation and contained in polyethylene tubes; subsequently, they were kept between 4 1155

Rev Mex Cienc Pecu 2021;12(4):1151-1167

and 6 °C in a cooler. Upon arrival at the laboratory, the samples were kept in freezing at -20 °C until the time of analysis. These samples were analyzed by PCR to detect antigens of the viruses mentioned. From each semen sample already homogenized, 200 μl were taken for the extraction of nucleic acids by means of the commercial High Pure PCR Template Preparation Kit (Laboratorios Roche), under the protocol described by the manufacturer for whole blood samples, with the modification that, in the last step, the nucleic acids were eluted in 50 μl of bidistilled injectable water. DNA amplification for IBR virus detection was performed using a pair of primers that amplify 468 bp of the glycoprotein gI gene(25). The reaction mixture was carried out in a final volume of 25 μl with the following concentrations: 1X of 10X Buffer, 1.5 mM of MgCl2, 0.4 mM of dNTPs, 20 pmol of each primer, 1.25 U of Taq polymerase and 1.5 mcg of BSA. The amplification program consisted of 1 cycle at 95 °C for 1 min; 35 cycles at 95 °C for 1 min, 62 °C 1 min and 72 °C 1 min; and a final cycle at 72 °C for 7 min. Electrophoresis of the amplification products was carried out in 1.5 % agarose gels, stained with the GelRed reagent (Biotium). The visualization of the amplification products was done under UV light on a photodocumenter. For the detection of the BVD virus, the synthesis of cDNA and its amplification were carried out in a single step. A pair of primers that amplify a 191 bp fragment of the 5’ UTR region of the viral genome were used(26). The reaction was carried out in a final volume of 25 μl under the following conditions: 1X of 10X Buffer, 1.5 mM of MgCl2, 0.4 mM of dNTPs, 20 pmol of each primer, 1.25 U of Taq polymerase, 6 U of reverse Transcriptase and 1.5 mcg of BSA. The amplification program consisted of 1 cycle at 48 °C for 30 min, followed by 1 cycle at 95 °C for 10 min; 35 cycles at 94 °C for 1 min, 58 °C for 1 min, 72 °C for 1 min; and a final extension cycle of 72 °C for 7 min. Electrophoresis and visualization were performed in the same way as for the IBR virus. The frequencies of antibodies in serum, as well as the frequencies of antigens in semen, were treated as binary characteristics, so they were recorded as 1 when a bull tested positive for ELISA or PCR test, respectively; otherwise, as 0. The statistical model (binomial logistic regression model) to analyze antibody frequencies included the factors state of the Mexican Republic, herd

1156

Rev Mex Cienc Pecu 2021;12(4):1151-1167

nested in the state and genotype of the bull; to analyze the frequencies of antigens in semen, the statistical model only included state of the Mexican Republic and herd nested in the state of the Mexican Republic. Logistic regression analyses by characteristic were performed with the GENMOD procedure of the SAS package, using a logit link function for the binomial distribution. The convergence criterion applied in each statistical analysis was 10-8. The degree of association between the presence of antibodies in serum and antigens in semen of BVD and IBR viruses, as an indicator of the elimination of viruses through semen, was determined with the phi coefficient, also called the Mathews correlation coefficient, which is calculated for 2x2 contingency tables, positive (1) or negative (0) bulls for the presence of antibodies in serum, and positive (1) or negative (0) bulls for the presence of antigens in semen. The correlation coefficients, as well as the statistical significance for determining whether they were different from zero, were estimated with the CORR procedure of the SAS package.

Results and discussion None of the three adjustment factors affected (P>0.05) the frequency of serum antibodies against BVDV. The frequency of BVDV antigens in semen was not estimable, since a large proportion of the bulls were negative to the PCR test (97.4 %), resulting in the absence of variation in some of the adjustment factors included in the statistical model. The frequencies of serum antibodies against BVDV and their 95 % confidence intervals, by state and genotype, are shown in Tables 1 and 2, respectively; however, frequencies by herd are not presented. The frequency of serum antibodies against BVDV ranged from 58 to 76 % by state, from 43 to 86 % by herd, and from 54 to 79 % by genotype. No association (P>0.05) was found between the presence of antibodies in serum and the presence of BVDV in semen (r= 0.16).

1157

Rev Mex Cienc Pecu 2021;12(4):1151-1167

Table 1: Frequencies (± standard errors) of serum antibodies against bovine viral diarrhea virus and 95 % confidence intervals, by state State No. of bulls Frequency, % Interval Puebla 28 58 ± 11 36 - 77 Tabasco 26 59 ± 11 38 - 78 Veracruz 22 76 ± 11 49 - 92 (P>0.05).

Table 2: Frequencies (± standard errors) of serum antibodies against bovine viral diarrhea virus and 95 % confidence intervals, by genotype Genotype No. of bulls Frequency, % Interval Zebu 29 54 ± 13 29 - 77 Cross 33 60 ± 10 40 - 77 European 14 79 ± 14 43 - 95 (P>0.05).

The frequency of serum antibodies against BVDV estimated in the present study is relatively high and, consequently, of consideration. Therefore, knowing in advance that, in the herds evaluated, the reproduction was carried out by natural mounting, the bulls represent a risk factor in the transmission of BVD. On the other hand, although the frequency of BVDV antigens in semen could not be estimated using a statistical model, it is considered low, since a large proportion of bulls were negative to the PCR test (97.4 %), which suggests that not all bulls were eliminating the virus at the time of taking the semen sample, or, there is a possibility that only persistently infected (PI) bulls eliminated the virus, as the virus has been shown to replicate in the prostate and seminal vesicles in PI bulls and is not constantly eliminated(27,28,29). In another study in bulls from Peru, a relatively high frequency of serum antibodies was also observed (51.3 %), arguing a wide diffusion and viral activity among animals and emphasizing the risk of transmission through semen(29), so vaccination in females is important to prevent reproductive problems due to the risk of infection(27). The frequency of serum antibodies against BVDV found in this study suggests that the herds to which the bulls belong are infected and permanently exposed to reinfection, and as for the frequency of BVDV in semen, it was expected

1158

Rev Mex Cienc Pecu 2021;12(4):1151-1167

that this would be much higher, and that it would show a high correlation with the presence of antibodies in serum, but this did not happen probably because BVDV is not constantly eliminated through semen(29); however, even the minimal presence of BVDV in semen represents a risk factor at the time of natural mounting, as other authors have argued(28,30), and if it is frozen semen, it must be harmless, because infecting inseminated cows causes fertility problems(31-33), due to the risk of elimination of the virus, although not permanently in that ejaculated by PI bulls(28,29,34). This is demonstrated by a study in two-year-old bulls, with no history of BVD and inoculated nasally with BVDV(35), which eliminated the virus in semen for a period of up to seven months, and then it disappeared, which may explain why very few bulls eliminated the virus in semen in the present study, since it is not constantly eliminated(29,34,35). Even so, the detection of BVDV in serum or semen is important in sires for natural mounting or semen freezing, because by preventing the use of positive animals, the risk of transmission to females is minimized(28,30). Because BVD persists in infected animals, its transmission to healthy animals is facilitated(3,7,36,37), so vaccination is the appropriate control tool, as the elimination of PI animals is complicated and requires a lot of time. Therefore, the herds evaluated in this study should be vaccinated(27) to prevent reproductive problems(29). For the frequency of serum antibodies against IBRV, state, herd nested in state and genotype of the bull were also not important (P>0.05) adjustment factors. Tables 3 and 4 show the frequencies of serum antibodies against IBRV and their 95 % confidence intervals, by state and genotype of the bull, respectively; however, the frequencies by herd are not shown. The frequency of serum antibodies against this virus ranged from 66 to 83 % by state, from 28 to 90 % by herd, and from 54 to 84 % by genotype.

1159

Rev Mex Cienc Pecu 2021;12(4):1151-1167

Table 3: Frequencies (± standard errors) of serum antibodies against infectious bovine rhinotracheitis virus and 95 % confidence intervals, by state State No. of bulls Frequency, % Interval Puebla 34 83 ± 7 63 - 93 Tabasco 11 66 ± 18 29 - 90 Veracruz 29 70 ± 10 47 - 86 (P>0.05).

Table 4: Frequencies (± standard errors) of serum antibodies against infectious bovine rhinotracheitis virus and 95 % confidence intervals, by genotype Genotype No. of bulls Frequency, % Interval Zebu 33 79 ± 10 52 - 92 Cross 29 54 ± 13 30 - 76 European 12 84 ± 12 46 - 97 (P>0.05).

The presence of IBRV in semen was also not affected by the effects of state and herd; the corresponding frequency ranged from 50 to 55 % by state (Table 5) and from 33 to 80 % by herd (these frequencies are not presented). The presence of antibodies in serum and the presence of IBRV in semen were also not correlated (r=0.07; P>0.05). Table 5: Frequencies (± standard errors) for infectious bovine rhinotracheitis virus in semen and 95 % confidence intervals, by state State No. of bulls Frequency, % Interval Puebla

54.9 ± 12.5

31 - 77

Tabasco

50.0 ± 15.3

23 - 77

Veracruz

52.3 ± 10.4

33 - 71

(P>0.05).

The results of this study show a relatively high frequency of serum antibodies against IBRV. A similar (69.5 %) frequency was found in dual-purpose crossbred bulls from herds in the municipality of Tonalá, Chiapas(23), as well

1160

Rev Mex Cienc Pecu 2021;12(4):1151-1167

as in dual-purpose crossbred bulls for beef production from herds in the Eastern Mountain range of Puebla (76.0 %)(24) and bulls for beef production in Yucatán (54.4 %)(16). On the other hand, in bulls for beef production of herds from the Isthmus and the Coast of Oaxaca(38), lower frequencies were observed (31.6 and 27.9 %, respectively). In studies conducted in Colombian bulls, relatively high frequencies were observed, 85.5 % in Antioquia(20), 67.6 % in Urabá and 75.0 % in Valle del Cauca(39). Regarding the presence of IBRV in semen, the identification of the virus has been documented in bulls for natural mounting, as well as in bulls of artificial insemination centers(40), in which both viruses have been isolated from frozen semen straws of several commercial houses(41), evidencing that artificial insemination is also an important risk factor in the spread of IBR, since it is a pathogen frequently present in semen, associated with low quality of it. The virus is found more in the seminal plasma than in the cell fraction, so that its transmission has shown loss of fertility in cows(31). In this study, no association was found between the relatively high frequency of antibodies and the presence of IBRV in semen, in which there were only 53 % of bulls that eliminated the virus, in contrast to a previous study(40) in which of the total number of bulls seropositive to antibodies against the virus, 100 % eliminated it in semen. This may be due to factors that induce the excretion or reactivation of the virus, such as heat stress, handling stress, corticosteroid treatments, which cause immunosuppression, which allows the virus to replicate in epithelial cells and other tissues (ocular, for example), without reaching the reproductive organs; or, that the opposite happens, that the immune system is functioning perfectly, preventing the replication of the virus and, therefore, the virus is not in semen at the time of ejaculation(42-44). However, the detection of antibodies against IBRV and antigens in semen, together or separately, are effective in detecting the disease in bulls(45) and, therefore, in the herd. Finally, due to the high frequencies of antibodies in serum and IBRV in semen in this study and considering that the disease is also transmitted by sexual contact, it is important to note that a control campaign for IBR in Mexico is urgent, as has been done in Brazil(46).

1161

Rev Mex Cienc Pecu 2021;12(4):1151-1167

Conclusions and implications No association was found between the presence of antibodies in serum and the presence of the viruses in semen; nor were differences found between states in the frequency of serum antibodies against IBR and BVD viruses or in the frequency of IBRV antigens in semen. However, these frequencies were of considerable magnitude, so a control program through vaccination should be implemented. If a bull eliminates these viruses through semen, it can be considered persistently infected, which should also be considered before buying bulls, which should be free of BVD and IBR, tested with laboratory tests. Literature cited: 1. Obando RCA, Rodríguez JM. Diarrea viral bovina. En: González-Stagnaro C, Soto BE editores. Manual de ganadería doble propósito. 1ª ed. Maracaibo, Venezuela: Astro Data, S. A.; 2005:317-322. 2. Rondón I. Diarrea viral bovina: Patogénesis e inmunopatología. Rev MVZ Córdoba 2006;11(1):694-704. 3. Lértora WJ. Diarrea viral bovina: Actualización. Rev Vet FCV UNNE 2003;14(1):1-11. 4. Ramírez RR, Chavarría MB, López MA, Rodríguez TLE, Nevárez GAM. Presencia del virus de la diarrea viral bovina y su asociación con otros cuadros patológicos en ganado en corral de engorda. Vet Méx 2012;43(3):225-234. 5. Vargas DS, Jaime J, Vera JV. Perspectivas para el control del virus de la diarrea viral bovina (BVDV). Rev Colomb Cienc Pecu 2009;22:677-688. 6. Carter GR, Wise DJ, Flores EF. Flaviviridae. En: Carter GR, Wise DJ, Flores EF eds. Virología veterinaria. International Veterinary Information Service, Ithaca NY. 2005:251-262. 7. OIE. Office International des Epizooties. Diarrea Viral Bovina. Manual de la OIE Sobre Animales Terrestres. 2008:1-15. 1162

Rev Mex Cienc Pecu 2021;12(4):1151-1167

8. Bedekovic T, Lemo N, Barbic L, Cvetnic Z, Lojkic I, Benic M, et al. Influence of category, herd size, grazing and management on epidemiology of bovine viral diarrhoea in dairy herds. Acta Vet Brno 2013;82:125-130. 9. Chowdhury MMR, Afrin F, Saha SS, Jhontu S, Asgar MA. Prevalence and haematological parameters for bovine viral diarrhoea (BVD) in South Bengal areas in Bangladesh. The Bangladesh Vet 2015;32(2):48-54. 10. Handel IG, Willoughby K, Land F, Koterwas B, Morgan KL, Tanya VN, et al. Seroepidemiology of bovine viral diarrhoea virus (BVDV) in the Adamawa region of Cameroon and use of the SPOT test to identify herds with PI calves. Plos One 2011;6(7):e21620. 11. Luzzago C, Lauzi S, Ebranati E, Giammarioli M, Moreno A, Cannella V, et al. Extended genetic diversity of bovine viral diarrhea virus and frequency of genotypes and subtypes in cattle in Italy between 1995 and 2013. BioMed Res Int 2014:1-8. 12. Gasque GR. Diarrea Viral Bovina. 1ª Ed. México, D.F.: UNAM; 2008. 13. Houe H. Survivorship of animals persistently infected with bovine viral diarrhoea virus (BVDV). Pre Vet Med 1993;15:275-283. 14. Correa, G. Complejo reproductivo bovino. En: Correa, G. Enfermedades virales de los animales domésticos poligástricos. 5ª ed. Paradigmas. México, D.F. 1988:45-90. 15. Calderón VG, Alvarado IA, Vilchis MC, Aguilar SA, Batalla CD. Detección de seropositividad al virus de rinotraqueitis infecciosa bovina (IBR) en ganado del municipio de Tizimín, Yucatán, México. Téc Pecu Méx 1997;35(3):161-164. 16. Solis-Calderon JJ, Segura VM, Segura JC, Alvarado IA. Seroprevalence of and risk factors for infection bovine rhinotracheitis in beef cattle herds of Yucatan, Mexico. Prev Vet Med 2003;57(4):199-208.

1163

Rev Mex Cienc Pecu 2021;12(4):1151-1167

17. Nuotio L, Neuvonen E, Hyytiäinen M. Epidemiology and eradication of infectious bovine rhinotracheitis/infectious pustular vulvovaginitis (IBR/IPV) virus in Finland. Acta Vet Scand 2007;49(3):1-6. 18. Bracho CA, Jaramillo ACJ, Martínez, MJJ, Montaño HJA, Olguín BA. Comparación de tres pruebas diagnósticas para el aborto por rinotraqueitis infecciosa bovina en hatos lecheros. Vet Méx 2006;37:151163. 19. Martínez CPJ, Riveira SIM. Antecedentes, generalidades y actualización en aspectos de patogénesis, diagnóstico y control de la diarrea viral bovina (DVB) y rinotraqueitis infecciosa bovina [tesis licenciatura]. Bogotá D.C., Colombia: Pontificia Universidad Javeriana; 2008. 20. Ruiz J, Jaime J, Vera VJ. Prevalencia serológica y aislamiento del Herpesvirus Bovino-1 (BHV-1) en hatos ganaderos de Antioquia y del Valle del Cauca. Rev Colomb Cienc Pecu 2010;23:299-307. 21. Schroeder WH. IBR-IPV y Reproducción. En: Schroeder WH editor. Fisiopatología reproductiva de la vaca. 1ª ed. Bogotá, Colombia: Celsus; 1999:825-833. 22. Romero-Salas D. Enfermedades que causan abortos en la ganadería bovina. 1ª ed. Veracruz, Veracruz: Universidad Veracruzana; 2012. 23. De los Santos MC, Orantes MA, Sánchez B, Manzur A, Cruz JL, Ruiz JL, et al. Determinación de anticuerpos de IBR mediante la técnica de ELISA en la zona Paredón- Boca del Cielo, Tonalá, Chiapas. Quehacer Cient Chis 2013;8(1):31-34. 24. Soto JR. Prevalencia de anticuerpos a IBR, BVD, Leptospirosis y Neosporosis y su relación con la fertilidad en sementales bovinos productores de carne del subtrópico húmedo de puebla [tesis licenciatura]. Puebla, México: Benemérita Universidad Autónoma de Puebla; 2014.

1164

Rev Mex Cienc Pecu 2021;12(4):1151-1167

25. Deka D, Ramneek, Maiti NK, Oberoi MS. Detection of bovine herpesvirus-1 infection in breeding bull semen by virus isolation and polymerase chain reaction. Rev Sci Tech Off Int Epiz 2005;24(3):10851094. 26. Sandvik T, Paton DJ, Lowings PJ. Detection and identification of ruminant and porcine pestiviruses by nested amplification of 5’ untranslated cDNA regions. J Virol Methods 1997;64:43-56. 27. González-Altamiranda EA, Kaiser GG, Weber N, Leunda MR, Pecora A, Malacan DA, et al. Clinical and reproductive consequences of using BVDV-contaminated semen in artificial insemination in a beef herd in Argentina. Anim Reprod Sci 2012;133(3-4):146-152. 28. Givens MD, Waldrop JG. Bovine viral diarrhea virus in embryo and semen production systems. Vet Clin Food Anim 2004;20(1):21-38. 29. Cárdenas AC, Rivera GH, Araínga RM, Ramírez VM, De Paz MJ. Prevalencia del virus de la diarrea viral bovina y de animales portadores del virus en bovinos en la provincia de Espinar, Cusco. Rev Inv Vet Perú 2011;22(3):261-267. 30. Mishra N, Kalaiyarasu S, Mallinath KC, Rajukumar K, Khetan RK, Gautam S, et al. Identification of bovine viral diarrhoea virus type 2 in cattle bull semen from southern India and its genetic characterization. Current Sci 2018;114(3):666-670. 31. Dejucq N, Jégou B. Viruses in the mammalian male genital tract and their effect on reproductive system. Microbiol Mol Biol R 2001;65(2):208231. 32. Kirkland PD, McGowan MR, Mackintosh SG, Moyle A. Insemination of cattle with semen from a bull transiently infected with pestivirus. Vet Rec 1997;140:124-127. 33. Meyling A, Jensen AM. Transmission of bovine virus diarrhoea virus (BVDV) by artificial insemination (AI) with semen from a persistentlyinfected bull. Vet Microbiol 1998;17:97-105.

1165

Rev Mex Cienc Pecu 2021;12(4):1151-1167

34. Niskanen R, Alenius S, Belák K, Baule C, Belák S, Voges H, Gustafsson H. Insemination of susceptible heifers with semen from a non-viraemic bull with persistent bovine virus diarrhoea virus infection localized in the testes. Reprod Dom Anim 2002;37:171-175. 35. Givens MD, Heath AM, Carson RL, Brock KV, Edens MSD, Wenzel JGW, et al. Analytical sensitivity of assays used for detection of bovine viral diarrhea virus in semen samples from the Southeastern United States. Vet Microbiol 2003;96(2):145-155. 36. Edmondson MA, Givens MD, Walz PH, Gard JA, Stringfellow DA, Carson RL. Comparison of tests for detection of bovine viral diarrhea virus in diagnostic samples. J Vet Diagn Invest 2007;19:376-381. 37. Grooms DL. Reproductive consequences of infection with bovine viral diarrhea virus. Vet Clin North Am Food Anim Pract 2004;20:5-19. 38. Hernández BEG, Gutiérrez HJL, Herrera LE, Palomares REG, Díaz AE. Frecuencia de diarrea viral bovina, rinotraqueitis infecciosa bovina, leptospirosis y brucelosis, en las 2 regiones ganaderas más importantes de Oaxaca. En: González IDR, Posadas ME editores. XXXIX Congreso Nacional de Buiatría. 2015:87-92. 39. Peña MA, Góngora A, Jiménez C. Infectious agents affecting fertility of bulls, and transmission risk through semen. Retrospective analysis of their sanitary status in Colombia. Rev Colomb Cienc Pecu 2011;24:634646. 40. Oliveira MT, Campos FS, Dias MM, Velho FA, Freneau GE, Brito WMED, et al. Detection of bovine herpesvirus 1 and 5 in semen from Brazilian bulls. Theriogenology 2011;75:1139-1145. 41. Morán PE, Favier PA, Lomónaco M, Catena MC, Chiapparrone ML, Odeón AC, et al. Search for the genome of bovine herpesvirus types 1, 4 and 5 in bovine semen. Open Vet J 2013;3(2):126-130. 42. Gregersen JP, Wagner K. Persistent infection of the genital tract and excretion of the vaccine strain after live virus inmunization with bovine herpesvirus 1 (IBR/IPV virus). Zentralbl Veterinaermed B 1985;32:1-10.

1166

Rev Mex Cienc Pecu 2021;12(4):1151-1167

43. Alonzo P, Puentes R, Benavides U, Esteves PA, Silva AD, Roehe PM, et al. Infección natural de un toro con dos subtipos diferentes de herpesvirus bovino tipo 1. Veterinaria (Montevideo) 2011;48(184):5-10. 44. Duque D, Estévez JNR, Abreu AM, Moncada M, Durango J, Molina D. Aspectos sobre rinotraqueitis infecciosa bovina. J Agric Anim Sci 2014;3(1):58-71. 45. Jain L, Kanani AN, Kumar V, Joshi CG, Purohit JH. Detection of bovine herpesvirus 1 infection in breeding bulls by ELISA and PCR assay. Indian J Vet Res 2009;18(1):1-4. 46. Sá Filho MFL, Vieira LCM, Martins CA, Rodríguez PS. New approaches in superovulation programs and embryo transfer in Brazil. Curso Internacional de Biotecnologías Reproductivas en Ganadería Tropical. 2013:1-9.

1167

https://doi.org/10.22319/rmcp.v12i4.5894 Article

Variability in polyphenol content, biological and anthelmintic activity of methanol:water extracts from the leaves of Gymnopodium floribundum Rolfe

Guadalupe Isabel Ortíz-Ocampo a Carlos Alfredo Sandoval-Castro a Gabriela Mancilla-Montelongo b Gloria Sarahi Castañeda-Ramírez a José Israel Chan Pérez a Concepción Capetillo Leal a Juan Felipe de Jesús Torres-Acosta a*

Universidad Autónoma de Yucatán, Facultad de Medicina Veterinaria y Zootecnia. Km

15.5 Carretera Mérida-Xmatkuil, 97315, Mérida, Yucatán, México. b

CONACYT–Universidad Autónoma de Yucatán, Facultad de Medicina Veterinaria y Zootecnia. Km 15.5 Carretera Mérida-Xmatkuil, 97315, Mérida,Yucatán, México.

*Corresponding author: tacosta@correo.uady.mx

Abstract: The effect of the harvest month and age of the leaves of Gymnopodium floribundum on the content of polyphenolic compounds (total phenols (TP), total tannins (TT) and condensed tannins (CT)) of methanol:water extracts was determined. In addition, the biological activity of polyphenols measured as the ability to precipitate protein (PP), inhibit egg hatching (EH), and larval exsheathment (LEI) of Haemonchus contortus was determined. G. floribundum leaves were harvested in 4 mo of the year: December, March, June and September. Twenty-

1168

Rev Mex Cienc Pecu 2021;12(4):1168-1187

four methanol:water extracts (70:30) were obtained, 12 produced from leaves of varied age (VA) and 12 from 90-d-old leaves (A90). All extracts caused similar PP regardless of age and harvest month. EH inhibition was only significant for December VA extract (EC50 = 374.4 μg/mL; P<0.05). A90 leaf extracts showed a EC50 > 1,500 μg/mL in December, June and September. Although all extracts inhibited larval exsheathment (LEI), the lowest EC50 was that of the VA leaf extract of June (EC50 = 80.4 μg/mL; P<0.05). Incubation of extracts with polyvinylpolypyrrolidone (PVPP) limited LEI (P<0.05), but polyphenols only explained part of that activity. In conclusion, the CT content of G. floribundum leaf extracts depends on their age and harvest month. Polyphenols showed PP activity and were partially associated with LEI. However, polyphenols do not explain the activity against H. contortus eggs. Key words: Polyphenol, Anthelmintic, Haemonchus contortus, Protein Precipitation, Extracts, Tannins.

Received: 08/12/2020 Accepted: 10/05/2021

Introduction Sheep and goats that browse in the tropical deciduous forest (TDF) of Yucatan consume variable amounts of foliage from a wide variety of tannin-rich plant species(1). One of the most consumed species is Gymnopodium floribundum, which is a low-sized tree abundant in the TDF and has been studied for its content of secondary compounds (SC)(2). Among SCs reported for G. floribundum are the volatile compounds (E)-ocimene, 2-ethyl-1-hexanol and linalool present in its flowers(3). The leaves of this species contain other important SCs such as polyphenols, i.e. total phenols (TP), total tannins (TT) and condensed tannins (CT)(1,2). Polyphenols may be involved in the defense of plants against infections by phytopathogenic bacteria and fungi and also limit the consumption of the leaves by vertebrate and invertebrate herbivores(4,5,6). The latter could be related to the astringent properties of polyphenols. The capacity of polyphenols to limit leaf consumption by herbivores has also been described for small ruminants that graze in some ecosystems, causing low animal productivity(7). However, this effect of reducing consumption has not been found in small ruminants that browse in the TDF(8). On the contrary, sheep and goats that browse in the TDF seek to consume the foliage of different species of plants with high CT content possibly as a strategy to block excess nitrogen in their diet, favoring a better balance of nitrogen and energy, and reducing the need

1169

Rev Mex Cienc Pecu 2021;12(4):1168-1187

to eliminate nitrogen in the urine(2). This is because polyphenols have the capacity to precipitate protein (PP) in the diet(9,10). PP is the property of polyphenols to form complexes with proteins and other macromolecules that have carbonyl and amino groups, forming hydrogen bonds with macromolecules susceptible to autooxidation to form covalent bonds(5). It is unknown whether the PP activity of polyphenols varies throughout the year in G. floribundum leaves. On the other hand, recent studies have shown that extracts from the foliage of G. floribundum have anthelmintic (AH) activity in vitro against eggs and larvae of H. contortus(11,12), and polyphenols have been shown to be involved in such activity(12). In vitro AH activity was recently confirmed in in vivo studies using G. floribundum foliage in the diet of lambs infected with H. contortus(13). The latter allowed considering G. floribundum leaves as a food with nutraceutical potential that could be used in the control of gastrointestinal nematodes (GIN). However, variability in polyphenol content has been reported in the leaves of polyphenol-rich forage trees of the TDF, such as Acacia pennatula, Lysiloma latisiliquum and Psicidia piscipula(14). Likewise, G. floribundum leaves show variation in their polyphenol content, being greater in the rainy season (33.8 %), period of rapid leaf growth, and lower in the dry season (9.5 %), when the trees lose their foliage(2,13). Recently, an annual study on G. floribundum leaves confirmed that the leaf age and the harvest month affect their bromatological composition and polyphenol content(15). The above suggests that it is essential to study the variability of the content of bioactive compounds in plants to make rational use of these resources as nutraceuticals(6,16,17). So far there are no studies that identify the variability in the content of polyphenols and their biological activity in tropical trees. This study determined the effect of the harvest month and age of G. floribundum leaves on the content of polyphenolic compounds of methanol:water extracts and the biological activity of polyphenols measured as their capacity to precipitate protein (PP), inhibit egg hatching and inhibit larval exsheathment of H. contortus.

Material and methods Place of collection of Gymnopodium floribundum material

The study was carried out in the period between December 18, 2017 and December 21, 2018. It was performed in an experimental area of TDF of 12,000 m2 (50 x 240 m) located in the Faculty of Veterinary Medicine and Zootechnics of the Autonomous University of Yucatan, Mexico (20°51'93.2'' N and 89°37'11'' W, at 10 m asl). The experimental area has an AW0

1170

Rev Mex Cienc Pecu 2021;12(4):1168-1187

climate (warm subhumid with rains in summer). The soil type is classified as cambisol and luvisol. The average maximum temperature was 32 °C and the minimum 16 °C with an annual rainfall ranging from 984.4 mm to 1,092 mm, distributed from June to November(18).

Collection and production of extracts from Gymnopodium floribundum leaves

Vegetative material was harvested by hand quarterly on the following dates: (a) December 18-21, 2017 and 2018, (b) March 18-21, 2018, (c) June 18-21, 2018, and (d) September 1821, 2018. Three composite samples were formed in the different harvest months. Each sample was formed with all the leaves of four trees. Samples of leaves of varied age (VA) included the leaves of specimens not previously defoliated. Samples of 90-d-old leaves (A90) were obtained from the same specimens at 90 d postharvest. The fresh leaves of each sample were added methanol:water (70:30 v/v) and homogenized with a blender (Oster®, Mexico) for < 1 min, until a homogeneous particle size was achieved. Ascorbic acid was added to the mixture, and it was left to macerate for 24 h. Subsequently, the mixture was filtered using gauze and No. 50 large pore filter paper (Tequimec SDRL, Mexico). To obtain the extract, the solvent (methanol) was evaporated at 50 °C using reduced pressure (rotavapor Ika®, Germany). Chlorophyll and lipids were removed from the aqueous fraction using methylene chloride (1:1 v/v, 3-7 washes). Finally, the rest of the fraction was lyophilized, bottled and kept in refrigeration at 4 °C until use.

Determination of polyphenols in extracts

The quantity of total phenols (TP), total tannins (TT) and condensed tannins (CT) of each extract obtained, of each age and harvest month, was quantified. The Folin-Ciocalteu technique was used to determine TPs(19). The TT content was determined using the FolinCiocalteu technique + PVPP(19). The CT content of the extracts was determined by the vanillin test(20).

Production of Haemonchus contortus eggs and larvae

The eggs and infective larvae (L3) of H. contortus were obtained from donor animals artificially infected with H. contortus (Paraíso isolate, Yucatán, Mexico). Fresh eggs were

1171

Rev Mex Cienc Pecu 2021;12(4):1168-1187

collected from the feces of each donor animal. The donors’ feces were collected directly from their rectum, using new plastic bags and the feces were processed within 3 hours after collection. Approximately 10 g of feces were macerated in 100 ml of purified water. The suspension was filtered with gauze. The filtered material was centrifuged (168 xg/5 min/21 °C) using 15 ml conical tubes. The supernatant was discarded, and the sediment was mixed with a saturated solution made from commercial cane sugar (relative density 1.28). Once mixed, the sediment was homogenized by a vortex. The suspension was centrifuged (168 xg/5min/21 °C). The surface layer of the solution was recovered with an inoculation loop. The eggs were washed three times with purified water to remove the remaining sugar and were resuspended in 15 ml tubes containing 10 ml of phosphate saline solution (PBS 0.01 M: NaCl 0.138 M, KCl 0.0027 M, KH2PO4 0.001M, Na2HPO4 0.0081M; pH 7.4; Sigma® USA). Egg concentration was determined and the suspension was diluted to 150 eggs/ml of PBS for use in the egg hatch (EH) test(12). For the larval exsheathment inhibition (LEI) assay, feces were collected from the donor animals and rinsed in a strainer with running water to remove grass or other debris. The feces were placed in Petri dishes (15 cm in diameter), incubated for 5 d at 28 °C and hydrated daily manually with a water spray. L3 larvae were harvested using Baermann’s technique and stored at 4 °C until use. The age of the larvae used in LEI was between 2 and 5 wk(12,21).

In vitro anthelmintic activity against Haemonchus contortus eggs Stock solutions (10,000 μg/ml of PBS) were prepared for each extract tested. PBS was used as a negative control. Respective 0.5 ml aliquots of the different dilutions (3,600, 2,400, 1,200, 600, 300 and 150 μg/mL of PBS) were prepared from the stock solution of each plant extract in 24-wells plates. Point five milliliters of the egg suspension (150 eggs/mL) were added to each well until a final volume of 1 mL was achieved. Six replicates were used for each extract concentration. The multi-well plates were incubated at 28 °C (48 h). At the end of this process, two drops of Lugol were added to each well to stop hatching, in addition to staining the eggs and larvae(22,23). The non-larvated eggs, larvated eggs and L1 larvae of each well were counted, and the percentage of hatching was calculated with the formula: Egg hatch %= (100) (L1 larvae) / (larvated eggs + eggs + L1 larvae) To determine the role of polyphenols in the AH effect of extracts, a tannin inhibitor, polyvinylpolypyrrolidone (PVPP), was used(11,19). These bioassays included only the

1172

Rev Mex Cienc Pecu 2021;12(4):1168-1187

concentration of 3,600 μg of extract / ml of PBS (with and without PVPP) and their respective PBS controls(24).

Haemonchus contortus larval exsheathment inhibition (LEI) test

One thousand microliters of L3 suspension (∼1,000 /ml) were added to each tube to obtain the final extract concentrations (1,200, 600, 400, 200, 100, 30 μg/ml) from the respective stock solutions of G. floribundum. A tube containing 1,000 μl of PBS without extract was used as a negative control. The larvae were incubated for 3 h (24 °C). Aliquots of each larval suspension were placed in microvials (200 μl in each.) with four repetitions for each concentration and PBS control. The exsheathment of L3 was artificially induced with a solution of hypochlorite (2.2 %) and sodium hydroxide (0.7 %) (Clorox®) diluted to 1/300, 1/343, 1/400 and 1/480. The kinetics of the exsheathment was estimated by counting sheathed and unsheathed larvae with a microscope (10x), and the exsheathment was recorded at 0, 20, 40 and 60 min(23). The percentage of L3 larval exsheathment for each measurement point was calculated using the following formula: Exsheathment (%) = (100) (total L3 without sheath) / (L3 with sheath + L3 without sheath) To determine the role of polyphenols in the AH effect of extracts, a tannin inhibitor, PVPP(12,19), was used. For each extract, only the dose of 1200 μg/ml of PBS (with and without PVPP) and their respective PBS controls were included.

Protein precipitation using the radial diffusion technique

The PP was determined as an indicator of the biological activity of polyphenols. It was performed with the radial diffusion assay(25). The technique identifies the ability of polyphenols to bind to protein molecules (e.g., bovine hemoglobin) on a plate with agar. One percent agarose gel (Baker®, Germany) was prepared in acetate and bovine hemoglobin buffer (Sigma®, Germany) (100 mg/L agar). The pH was adjusted to 5.0 with NaOH. Ten milliliters of agar were placed in Petri dishes 10 cm in diameter. Five wells of 4 mm in diameter each were formed in the agar of each Petri dish (one in the center and the remaining four in the positions of 0, 90, 180 and 270 degrees). In the latter, 15 μl of a solution of each extract were added and incubated for 48 h at 25 ºC. At the end of that time, the halo that was formed around each well was measured. This halo is the result of the precipitation of hemoglobin by the action of the polyphenols of each extract. PP was weighted by the

1173

Rev Mex Cienc Pecu 2021;12(4):1168-1187

concentration of TT, TP and CT contained in each extract evaluated. For this, the formula described by Hagerman(25) was used: PP= ((D22-D12) /T); where: D1: smaller diameter of the well (mm); D2: larger diameter (mm); T: Total phenols or total tannins or condensed tannins (mg).

Data processing and statistical analyses

The effect of leaf age (VA or A90) and harvest month, as well as their interaction on polyphenol composition (TP, TT, CT) were determined using respective generalized linear models (GLM). Subsequently, the comparison of means was performed using Tukey’s test with α<0.05(26). For the EH test, the number of eggs that remained in the morula stage (MOE), eggs that developed a larva but did not hatch (LNH), and the number of larvae that emerged from the eggs as a result of their exposure to different extracts at the respective concentration previously described were recorded. This information was used to determine egg hatching rate (%EH) and egg hatching inhibition (%EHI) as follows (24,27): %EH =

Number of larvae × 100 number of morulated eggs + eggs with larva + number of larvae %EHI = 100 − %EH

The percentage of morulated eggs that did not form larvae (ovicidal effect) was calculated as follows: %MOE =

Number of morulated eggs × 100 number of morulated eggs + eggs with larva + number of larvae

The percentage of eggs with larva that did not hatch (%LNH) was calculated as follows: %LNH =

Number of eggs that contain larvae number of morulated eggs + eggs with larva + number of larvae

× 100

The percentage of exsheathment (%E) and that of exsheathment inhibition (%LEI) were determined with the following formulae(28): %E =

L3 Larvae with sheath × 100 larvae with sheath + larvae without sheath %LEI = 100 − %E

1174

Rev Mex Cienc Pecu 2021;12(4):1168-1187

EH inhibition and LEI results obtained for the different extracts were analyzed with the respective generalized linear models (GLM) to evaluate the differences between the PBS control and the different extract concentrations analyzed. Data obtained from PVPP incubations of each extract were analyzed using a completely randomized design (GLM with comparisons made with the respective control group for each extract)(26). The effective concentration required to inhibit 50 % of egg hatching, or 50 % of L3 exsheathment (effective concentration 50 %; EC50) was estimated with data obtained from EH and LEI tests, respectively, for each plant extract tested using PoloPlus 1.0 software(29). The Shapiro-Wilk test was performed to assess the normality of the PP, EH and LEI data. The respective biological activity (PP, EH and LEI) was analyzed by means of a GLM and the main effects of leaf age (VA and A90) and harvest month (four harvest months), as well as their interaction. The comparison of means was performed using Tukey’s test with α<0.05. Additionally, respective Pearson correlations were performed to determine the association between the content of polyphenols (TP, TT and CT) and PP, as well as the EC50 of EH and LEI, respectively(26).

Results Table 1 shows the content of TP, TT and CT, in the extracts of the composite samples of G. floribundum leaves of different ages. The content of TP and TT was not modified by the harvest month, age or interaction (P>0.05). However, significant differences in the CT content due to the interaction between leaf age and harvest month were found, as can be seen for the March (dry) and June (rainfall) extracts of VA leaves (P<0.05). Likewise, in June (rainfall), a higher CT content was observed in the VA leaves than in the A90 leaves (P<0.05).

1175

Rev Mex Cienc Pecu 2021;12(4):1168-1187

Table 1: Effect of leaf age and harvest month on the polyphenol content in methanol:water extracts from Gymnopodium floribundum leaves Total phenols Total tannins Condensed tannins (%) (%) (%)* Varied age (VA) leaf extracts December 19.3ª 2.9ª 65.9ab March 20.2ª 4.4ª 48.7b June 28.2ª 6.7ª 131.7ª September 26.1ª 10.4ª 106.9ab 90-d-old (A90) leaf extracts December 20.0ª 5.4ª 69.5ab March 20.8ª 9.0ª 65.9ab June 24.5ª 6.4ª 49.8b September 27.6ª 12.9ª 99.2ab Standard error 1.83 2.80 13.50 a,b

Different literals in the same column indicate differences at P<0.05. *: Equivalent to catechin.

Egg hatching (EH) test The extract from VA leaves harvested in December was the only one that showed activity on the EH of H. contortus (EC50 = 374.4 μg/ml). In Table 2, it can be seen that A90 leaf extracts of G. floribundum of December, June and September showed low activity on EH (EC50 > 1,500 μg/ml), while for the extract of March, it was not possible to calculate the EC50. Table 2: Effect of leaf age and harvest month on effective concentration (EC50) and confidence interval of methanol:water extracts from Gymnopodium floribundum leaves on the hatching of Haemonchus contortus eggs EC50 95%CI (μg/ml) (μg/ml) Varied age (VA) leaf extracts December 374.4ª 282.08 - 473.66 March No activity June No activity September No activity 90-day-old (A90) leaf extracts December 3088.3b 2262.45 - 4192.55 March No activity b June 1907.5 1783.75 - 2029.55 b September 1575.0 981.26 - 2395.96 a,b

Different literals in the same column indicate differences at P<0.05.

1176

Rev Mex Cienc Pecu 2021;12(4):1168-1187

Table 3 shows the effect of blocking polyphenols with PVPP on the proportion of MOE, LNH and L1 of eggs incubated with the different G. floribundum extracts. The different extracts showed an activity more oriented to retain the L1 larvae inside the eggs (LNH). However, by blocking polyphenols, increased ovicidal activity was observed for VA leaf extracts (December and March). Correlation analyses showed no association between the content of TP, TT or CT, and the EC50 of egg hatching inhibition (P>0.05). Table 3: Effect of incubation of Haemonchus contorrtus eggs in different extracts of Gymnopodium floribundum at the concentration of 3,600 μg/ml, with and without polyvinylpolypyrrolidone (PVPP), on the proportion (%) of eggs that remained in the morula stage (MOE), larvae that did not hatch from their eggs (LNH) and larvae (L1) Life PBS 3,600 μg/ml 3,600 μg/ml Standard stage (%) (%) + PVPP (%) error Varied age (VA) leaf extracts December MOE 5.14a 8.60b 12.97a 4.40 a b c LNH 1.60 66.69 86.33 2.65 a b c L1 93.25 24.71 0.70 2.52 a a March MOE 4.91 7.72ª 13.67 3.56 a b c LNH 0.62 28.60 82.80 0.79 a b c L1 94.46 63.69 3.54 3.97 a a June MOE 2.35 4.62ª 29.27 8.13 a b LNH 1.22 22.25ª 33.37 8.41 L1 96.42a 73.13ª 35.37b 8.12 a a September MOE 7.37 9.86ª 10.16 1.11 a b b LNH 0.14 25.11 26.58 0.94 a b b L1 92.50 65.03 63.27 1.69 90-day-old (A90) leaf extracts March MOE 7.37a 9.86b 10.16c 0.77 a b c LNH 0.14 25.11 26.58 0.82 a b b L1 92.50 65.03 63.27 1.37 a b c June MOE 0.37 3.48 41.09 0.77 a b c LNH 9.21 25.83 83.55 2.46 a b c L1 90.42 70.69 2.36 3.11 a a September MOE 11.66 15.91ª 15.28 3.14 a b b LNH 0.14 37.61 34.11 0.90 a b b L1 88.20 46.47 50.61 1.90 a b a December MOE 10.95 19.52 11.74 2.02 a b b LNH 0.48 33.13 34.85 0.96 a b c L1 88.57 47.35 53.41 2.06 abc

Different letters in the same row indicate significant differences between groups PBS, extract and extract+PVPP (P<0.05).

1177

Rev Mex Cienc Pecu 2021;12(4):1168-1187

Larval exsheathment inhibition (LEI) test

The EC50 obtained for the different extracts of G. floribundum from VA and A90 leaves with the LEI test is presented in Table 4. A significant effect of the interaction between leaf age and harvest month was observed. In the case of VA leaf extracts, all harvest months showed different activity, with the extract of June being the most active and that of March being the least active (P<0.05). On the other hand, the extracts from A90 leaves were also different for each month (P<0.05), with that of September being the most active and that of June being the least active. Table 4: Effect of leaf age and harvest month on effective concentration (EC50) and confidence interval of Gymnopodium floribundum leaf extracts on the exsheathment of Haemonchus contortus L3 EC50 95%CI (μg/ml) (μg/ml) Varied age (VA) leaf extracts December 199.9ef 136.67 - 279.12 gh March 283.5 207.27 - 382.01 June 80.4ª 55.83 - 104.55 bc September 146.1 119.93 - 175.37 90-day-old (A90) leaf extracts December 168.3de 134.10 - 205.21 cd March 146.1 119.93 - 175.37 fg June 263.6 245.33 - 281.28 ab September 108.4 81.41 - 139.02 abcdefgh

Different letters in the same column indicate a significant difference (P<0.05).

Table 5 presents the effect of extracts of G. floribundum from leaves of different age and harvest month on the LEI percentages of H. contortus L3, with or without the addition of PVPP to block polyphenols. The use of PVPP showed that inhibition of exsheathment is partially due to polyphenols and makes it evident that other SCs participate in LEI. In addition, correlation analyses showed no association between TP, TT or CT contents, and the EC50 of LEI.

1178

Rev Mex Cienc Pecu 2021;12(4):1168-1187

Table 5: Effect of incubation of Haemonchus contortus L3 in different methanol:water extracts of Gymnopodium floribundum with and without polyvinylpolypyrrolidone (PVPP) on the percentage of exsheathment inhibition PBS 1,200 μg/ml 1,200 μg/ml+ PVPP Standard (%) (%) (%) error Varied age (VA) leaf extracts December 0.2ª 100.0b 60.0c 6.75 a b c March 0.0 100.0 65.5 9.94 b a June 3.4ª 100.0 45.7 20.80 a b b September 2.9 100.0 79.3 13.25 90-day-old (A90) leaf extracts December 2.1a 92.0b 36.6a 9.24 a b b March 3.1 100.0 53.5 11.18 a b c June 0.3 100.0 76.1 3.34 a b b September 0.4 100.0 86.7 2.51 abc

Different letters in the same column indicate a significant difference (P<0.05).

Radial diffusion test to measure protein precipitation (PP) The PP obtained with G. floribundum leaf extracts showed no difference due to leaf age or harvest month (Table 6). Correlation analysis showed that a higher content of TP, TT or CT in the extracts did not influence PP. Table 6: Effect of the age and harvest month of Gymnopodium floribundum leaves on protein precipitation (PP) measured by the radial diffusion method and its relationship with the content of total phenols (TP), total tannins (TT) and condensed tannins (CT) PP-TP PP-TT PP-CT (mm/mg) (mm/mg) (mm/mg) Varied age (VA) leaf extracts December 9.29ª 64.65ª 2.75ª March 9.23ª 43.15ª 4.38ª June 8.29ª 34.96ª 1.87ª September 9.37ª 40.69ª 2.29ª 90-day-old (A90) leaf extracts December 10.05ª 42.65ª 2.09ª March 11.95ª 40.69ª 3.79ª June 7.93ª 38.14ª 4.68ª September 9.57ª 28.34ª 2.68ª Standard error 1.03 11.05 0.63 a

Values in columns with the same literal do not differ significantly P>0.1

1179

Rev Mex Cienc Pecu 2021;12(4):1168-1187

Discussion Composition of polyphenols in the Gymnopodium floribundum extracts The values reported in the present study for TP and TT are similar to those previously reported for methanol:water and acetone:water extracts made with leaves of the same plant species(11,12). An interesting aspect of the TP and TT content is that they remained relatively constant for the different extracts regardless of the leaf age or harvest month. In the case of TPs, this could be because the plant needs a constant amount of these compounds since they are intermediaries of different biosynthetic pathways of the plant(30). In the case of TTs, which are more complex compounds, the similarity in their content could be due to the fact that they are affected by variables other than the two evaluated in the present study. As for the CT content, there is only one previous study of an extract of G. floribundum made with VA leaves obtained in the dry season(11) and in this, a value similar to that of VA leaves of March of the present study was reported. However, this study showed that there are differences in CT content due to the interaction between leaf age and harvest month. The variation in the CT content of G. floribundum leaves due to the harvest month had already been previously suggested(1,13,31). The difference in CT content was only evident between the VA leaves of March (drought month) and June (rainy month), and of the latter with respect to the A90 leaves of June. The higher CT content in the VA leaves of June could be due the fact that plants use CTs as a tool to defend themselves against fungi and bacteria that proliferate in the rain. On the other hand, A90 leaves did not have a higher CT content, compared to VA leaves. This could be because the trees from which the A90 leaves were harvested were completely defoliated 90 days earlier. Therefore, the A90 leaves, which were growing, perhaps, could not invest more plant resources in producing defense substances.

Anthelmintic activity of methanol:water extracts

Egg hatching (EH) inhibition test

Extract from VA leaves of December significantly inhibited the hatching of H. contortus eggs and that inhibition was achieved at an EC50 lower than that previously reported for the same type of VA leaf extract(11). On the other hand, three of the A90 leaf extracts (June, September, and December) inhibited EH, although these extracts had an EC50 higher than 1180

Rev Mex Cienc Pecu 2021;12(4):1168-1187

that reported for VA leaves in this study and the previous report(11). With the exception of the VA leaf extract of March, the zero or low activity on EH of methanol:water extracts of G. floribundum is similar to that reported for other polyphenol-rich plants and it has been suggested that this low activity against eggs is due to the SCs obtained using methanol or acetone as organic solvents(11,24,27). The present study also confirmed that the activity against H. contortus egss in methanol:water extracts of G. floribundum manifests itself as the presence of larvae trapped inside the eggs (LNH), as had been reported(12,24,27). Likewise, the use of PVPP confirmed that polyphenols do not explain the EH inhibition activity, but that the blocking of polyphenols increased the effect of LNH in the months of December, March and June for VA leaf extracts (P<0.05), and in the months of March and June for A90 leaf extracts (P<0.05).

Haemonchus contortus larval exsheathment inhibition (LEI) test

All G. floribundum leaf extracts inhibited the exsheathment of H. contortus L3. These results coincide with previous studies that used extracts of G. floribundum, either methanol:water(11) or acetone:water(12,13). The best EC50 was observed for the VA leaf extract of June (P<0.05), which in turn was the extract with the highest concentration of CT. This increased AH activity coincides with the time when G. floribundum begins its highest leaf production (rainy season)(15). As mentioned, in the rainy season, the plant could use the CTs of its leaves to defend itself against the attack of insects, fungi and bacteria(4). The high CT content in the rainy months could also limit the attack of vertebrate herbivores such as ruminants, since recent studies show that small ruminants consume less G. floribundum foliage in the rainy season compared to the dry season(1,2). Coincidentally, it is in the dry season when G. floribundum leaves contain less CT(15). G. floribundum extracts decreased their LEI activity when polyphenols were blocked with PVPP (P<0.05). However, PVPP only partially blocked the LEI activity of the extracts. This could be due to two phenomena: (a) not enough PVPP was used to block all polyphenols in the solution, and (b) there are other SCs that are partially responsible for LEI activity. Either of the two phenomena could explain the absence of correlation between LEI activity and TP, TT and CT contents. This suggests that increasing doses of PVPP should be explored when performing the LEI test to confirm that the dose used does block most or all polyphenols. On the other hand, it would be necessary to explore what other SCs could help explain the activity of LEI not associated with polyphenols. This would require a bio-guided fractionation process. This type of process has made it possible to identify the activity of chromenone(32) and phenolic acid derivatives (caffeic, coumaric) on the inhibition of the hatching of GIN eggs of ruminants(33,34).

1181

Rev Mex Cienc Pecu 2021;12(4):1168-1187

Protein precipitation assay

It was observed that all extracts precipitated the hemoglobin protein. This corroborates the PP activity that has been reported for other polyphenol-rich forage trees in Yucatan(14). However, these authors determined that the acetone:water extract of A. pennatula had a strong association between TP and PP. In the case of G. floribundum, no correlation between polyphenol content and PP was found. This could represent an opportunity for future studies to help select individuals that give rise to plant varieties with different polyphenol content or with different biological activity of PP. It is necessary to identify which additional factors influence the expression of polyphenols in the leaves or their capacity for PP. In this study, it was confirmed that G. floribundum extracts precipitate proteins regardless of the harvest month, age of leaves or their polyphenol content. Therefore, sheep and goats could take advantage of the biological activity (PP) of G. floribundum leaves as part of a strategy to survive in an environment where protein-rich plants (legumes) predominate. This is consistent with the hypothesis that sheep and goats could consume the foliage of G. floribundum to block some of the protein in the diet and help reduce the pathway of elimination of nitrogen in the urine, which is very costly for the animal(2,8). Since the extracts showed good PP measured with hemoglobin, it is suggested to evaluate this PP activity using other proteins that may have closer relationship with the AH activity against H. contortus. For example, proteins could be obtained directly from H. contortus L3 (with or without sheath) since these stages of life would be in contact with polyphenols in the gastrointestinal tract. This contact with polyphenols occurs from the moment they enter the ruminant’s mouth and remains in contact along the esophagus, reticulum-rumen, omasum and abomasum, until they invade the abomasal mucosa to settle and pass to L4. The PP could also be evaluated using protein of H. contortus eggs, as these are in contact with polyphenols throughout the entire transit from their exit from the uterus of the female worm, through the abomasum, small and large intestines until reaching the feces. These assessments could serve as a model for studying the parasite-host-plant interaction.

Conclusions and implications There are differences in CT composition associated with the interaction between leaf age and harvest month in methanol:water extracts from G. floribundum leaves. Egg hatching inhibition activity was evident only in the VA leaf extract of December, and three A90 leaf extracts exhibited activity at high concentrations. All extracts showed L3 larval exsheathment inhibition activity, with the VA leaf extract of June having the best activity. The polyphenols

1182

Rev Mex Cienc Pecu 2021;12(4):1168-1187

of the extracts showed PP activity and were associated with the inhibition of the larval exsheathment of H. contortus. However, they do not explain the activity against H. contortus eggs. The main implication of the present work was to demonstrate for the first time that the TP and TT of G. floribundum leaf extracts are not significantly modified by the age of the leaves and harvest month, while CTs do vary. In addition, the biological activity of polyphenols was shown to be strong for PP, partial for LEI, and independent of EH. This information serves as a basis for decision-making regarding the application of G. floribundum leaves in ruminant nutrition and for the evaluation of nutraceutical potential against H. contortus. The variability found also indicates that there is potential for the selection of individuals of this species that are oriented towards a greater or lesser content or activity of CT.

Acknowledgements

To CONACYT-Mexico for the financing of this work (Proyecto-CB-2013-01-221608). G.I. Ortíz-Ocampo recognizes the National Council for Science and Technology of Mexico (CONACYT) for the scholarship granted for her doctoral studies (reference 257653). Mancilla-Montelongo thanks for the financial support of the “Programa de Investigadores e Investigadoras por México” CONACYT (Project No. 692). We thank the entire Campus team for their valuable contribution during the fieldwork: P.G. González-Pech, J. VenturaCordero, F.A. Méndez-Ortiz, E. Ramos-Bruno and F. Torres-Salazar. We also thank the tutors: V. Parra-Tabla, J.J. Ortíz-Díaz, L.R. Borges-Argáez. We also appreciate the support of I.C. Trinidad-Martínez in the Diagnostic laboratory of the FMVZ-UADY.

Conflict of interest

The authors declare that they have no conflict of interest with the publication of this study. Literature cited: 1. González-Pech PG, Torres-Acosta JFJ, Sandoval-Castro CA, Tun-Garrido J. Feeding behavior of sheep and goats in a deciduous tropical forest during the dry season: the same menu consumed differently. Small Ruminant Res 2015;(133):128-134. 2.

Ventura-Cordero J, González-Pech PG, Torres-Acosta JFJ, Sandoval-Castro CA, TunGarrido J. Sheep and goat browsing a tropical deciduous forest during the rainy season: why does similar plant species consumption result in different nutrient intake? Anim Prod Sci 2019;59(1):66-72.

1183

Rev Mex Cienc Pecu 2021;12(4):1168-1187

Cuevas-Glory L, Sosa-Moguel O, Ortiz-Vázquez E, Sauri-Duch E, Pino A. Volatile constituents of tzizilché flower (Gymnopodium floribundum Rolfe) from Yucatán Peninsula, Mexico. J Esse Oil Res 2012;(24):359-361.

Ek de Val. Herbivoría. En: Ecología y evolución de las interacciones bióticas. En: Ek de val, Boege K, editors. Ecología y evolución de las interacciones bióticas. 1a ed. México, DF: FCE, Fondo de Cultura Económica 2012:43-75.

Graça MAS, Bärlocher F. Radial diffusion assay for tannins. In: Bärlocher F, et al. editors. Methods to study litter decomposition. Germany Springer 2020;163-167.

Zimmer M, Topp W. Species-specific utilization of food sources by sympatric woodlice (Isopoda: Oniscidea). J Anim Ecol 2008;68(6):1071-1082.

Min BR, Barry TN, Atwood GT, McNabb WC. The effect of condensed tannins on the nutrition and health of ruminants fed fresh temperate forages: a review. Anim Feed Sci Tech 2003;106(1-4):3-19.

Torres-Fajardo RA, Navarro-Alberto JA, Ventura-Cordero J, González-Pech PG, Sandoval-Castro CA, Chan-Pérez JI, et al. Intake and selection of goats grazing heterogeneous vegetation: effect of gastrointestinal nematodes and condensed tannins. Rangel Ecol Manag 2019;72(6):946-953.

Bennick A. Interactions of plant polyphenols with salivary proteins. Crit Rev Oral Biol Med 2002;13(2):184-196.

10. Makkar HPS, Francis G, Becker K. Bioactivity of phytochemicals in some lesser-known plants and their effects and potential applications in livestock and aquaculture production systems. Anim 2007;1(9);1371–1391. 11. Castañeda-Ramírez GS, Torres-Acosta JFJ, Sandoval-Castro CA, González-Pech PG, Parra-Tabla VP, Mathieu C. Is there a negative association between the content of condensed tannins, total phenols, and total tannins of tropical plant extracts and in vitro anthelmintic activity against Haemonchus contortus eggs? Parasitol Res 2017;116(12): 3341-3348. 12. Castañeda-Ramírez GS, Rodríguez-Labastida M, Ortíz-Ocampo GI, González-Pech PG, Ventura-Cordero J, Borges-Argáez R, et al. An in vitro approach to evaluate the nutraceutical value of plant foliage against Haemonchus contortus. Parasitol Res 2018;117(12):3979-3991.

1184

Rev Mex Cienc Pecu 2021;12(4):1168-1187

13. Méndez-Ortiz FA, Sandoval-Castro CA, Ventura-Cordero J, Sarmiento-Franco LA, Santos-Ricalde RH, Torres-Acosta JFJ. Gymnopodium floribundum fodder as a model for the in vivo evaluation of nutraceutical value against Haemonchus contortus. Trop Anim Health Prod 2019;51(6):1501-1599. 14. Alonso-Díaz MA, Torres-Acosta JFJ, Sandoval-Castro CA, Capetillo-Leal CM. Polyphenolic compounds of nutraceutical trees and the variability of their biological activity measured by two methods. Trop Subtrop Agroecosyst 2010;12(3):649-656. 15. Ortiz-Ocampo GI, Sandoval-Castro CA, González-Pech PG, Mancilla-Montelongo G, Ventura-Cordero J, Castañeda-Ramírez GS, et al. Month of harvest and age of leaves are key modifiers of the bromatological composition and polyphenol content of Gymnopodium floribundum leaves. Flora [sometido] 2021. 16. Hoste H, Torres-Acosta JFJ, Alonso-Díaz MA, Brunet S, Sandoval-Castro C, Houzangbe-Adote S. Identification and validation of bioactive plants for the control of gastrointestinal nematodes in small ruminants. Trop Biomed 2008;25(1):56-72. 17. Verma N, Shukla S. Impact of various factors responsible for fluctuation in plant secondary metabolites. J Appl Res Med and Arom Plants 2015;2(4):105-113. 18. García E. Modificaciones al Sistema de clasificación climática de Köppen. Quinta ed. Instituto de Geografía, Universidad Nacional Autónoma de México (UNAM). México. 2004:90. 19. Makkar HPS. Quantification of tannins in tree and shrub foliage. A laboratory manual. Food and Agriculture Organization of the United Nations/International Atomic Energy Agency (FAO/IAEA), Vienna, Austria 2003:49-53. 20. Price ML, Van-Scoyoc S, Butler LG. A critical evaluation of the vanillin reaction assay for tannin in sorghum grain. J Agric Food Chem 1978;26(5):1214-1218. 21. Castañeda-Ramírez GS, Matheieu C, Vilarem G, Hoste H, Mendoza-de-Gives P, González-Pech PG, et al. Age of Haemonchus contortus third stage infective larvae is a factor influencing the in vitro assessment of anthelmintic properties of tannin containing plant extracts. Vet Parasitol 2017;243(30):130-134. 22. Von Samson-Himmelstjerna G, Coles GC, Jackson F, Bauer C, Borgsteede F, Cirak VY, et al. Standardization of the egg hatch test for the detection of benzimidazole resistance in parasitic nematodes. Parasitol Res 2009;105(3):825-834.

1185

Rev Mex Cienc Pecu 2021;12(4):1168-1187

23. Jackson F, Hoste H. In vitro methods for the primary screening of plant products for direct activity against ruminant gastrointestinal nematodes. In: Vercoe PE, et al. editors. In vitro screening of plant resources for extra-nutritional attributes in ruminants: Nuclear and related methodologies. UK: Springer; 2010:25-45. 24. Vargas-Magaña JJ, Torres-Acosta JFJ, Aguilar-Caballero AJ, Sandoval-Castro CA, Hoste H, Chan-Pérez JI. Anthelmintic activity of acetone-water extracts against Haemonchus contortus eggs: interactions between tannins and other plant secondary compounds. Vet Parasitol 2014;206(3-4):322-327. 25. Hagerman AE. Radial diffusion method for determination tannin in plant extracts. J Chem Ecol 1987;13(3):437-449. 26. Minitab 16 Statistical software 2013. Computer software Minitab ver.16.2.4. State College, PA: Minitab Inc. (www.minitab.com). Accessed: Nov 3, 2020. 27. Chan-Pérez JI, Torres-Acosta JFJ, Sandoval-Castro AC, Hoste H, Castañeda-Ramírez GS, Vilarem G, et al. In vitro susceptibility of ten Haemonchus contortus isolates from different geographical origins towards acetone:water extracts of two tannin rich plants. Vet Parasitol 2016;(217):53-60. 28. Chan-Pérez JI, Torres-Acosta JFJ, Sandoval-Castro AC, Castañeda-Ramírez GS, Vilarem G, Mathieu C, et al. Susceptibility of ten Haemonchus contortus isolates from different geographical origins towards acetone:water extracts of polyphenol-rich plants. Part 2: Infective L3 larvae. Vet Parasitol 2017;(240):11-16. 29. LeOra Software. Polo Plus. Probit and logit analysis. Berkeley, California, U.S.A., LeOra Software. 2004. 30. Winkel-Shirley B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol 2001;126(2):485-493. 31. Ventura-Cordero J, González-Pech PG, Jaimez-Rodríguez PR, Ortiz-Ocampo GI, Sandoval-Castro CA, Torres-Acosta JFJ. Gastrointestinal nematode infection does not affect selection of tropical foliage by goats in cafeteria trial. Trop Anim Health Prod 2017;49(1):97-104. 32. Von Son-de Fernex E, Alonso-Díaz MÁ, Valles-de la Mora B, Mendoza-de Gives P, González-Cortazar M, Zamilpa A. Anthelmintic effect of 2H-chromen-2-one isolated from Gliricidia sepium against Cooperia punctata. Exp Parasitol 2017;(178):1-6.

1186

Rev Mex Cienc Pecu 2021;12(4):1168-1187

33. Castillo-Mitre GF, Olmedo-Juárez A, Rojo-Rubio R, González-Cortázar M, Mendozade Gives P, Hernández-Beteta EE, et al. Caffeoyl and coumaroyl derivatives from Acacia cochliacantha exhibit ovicidal activity against Haemonchus contortus. J Ethnopharmacol 2017;(204):125-131. 34. Castañeda-Ramírez GS, Torres-Acosta JFJ, Sandoval-Castro CA, Borges-Argáez R, Cáceres-Farfán M, Mancilla-Montelongo G, et al. Bio-guided fractionation to identify Senegalia gaumeri leaf extract compounds with anthelmintic activity against Haemonchus contortus eggs and larvae. Vet Parasitol 2019;(270):13-19.

1187

https://doi.org/10.22319/rmcp.v12i4.5144 Article

Morphometric and molecular analysis (mtDNA) of honeybees (Apis mellifera L.) in the state of Tabasco, Mexico

Juan Florencio Gómez Leyva a Omar Argüello Nájera b Pablo Jorge Vázquez Encino c Luis Ulises Hernández Hernández d Emeterio Payró de la Cruz c*

Tecnológico Nacional de México. Campus Instituto Tecnológico de Tlajomulco Jalisco, Laboratorio de Biología Molecular. Km 10 Carretera a San Miguel Cuyutlán. Tlajomulco de Zúñiga, Jalisco, México. b

El Colegio de la Frontera Sur (ECOSUR-San Cristóbal, Chiapas). San Cristóbal L.C. Chiapas. México. c

Tecnológico Nacional de México. Campus Instituto Tecnológico de la Zona Olmeca. Laboratorio de Biología. Zaragoza s/n. Villa Ocuiltzapotlán, Centro, Tabasco, México. d

Universidad Juárez Autónoma de Tabasco. División Académica de Ciencias Agropecuarias. Tabasco. México.

*Corresponding author: epayro@itzonaolmeca.edu.mx

Abstract: Beekeeping in Mexico is based on subspecies of European (Apis mellifera L) and Africanized bees. Due to the difficulty in the morphological differentiation of the European (E) and Africanized (A) populations of A. mellifera, the objective of this work was to perform a comparative analysis between the FABIS morphometric technique, against the diagnosis using the restriction fragment length polymorphism (RFLP) of mitochondrial DNA 1188

Rev Mex Cienc Pecu 2021;12(4):1188-1207

(mtDNA). Samples of bees from 135 commercial colonies (CC), 15 breeding colonies (BRC) and 3 wild colonies (WC), located in different municipalities of the state of Tabasco (N= 153), were used. Both diagnostic methods identified BRCs as European and WCs as Africanized, but in CCs, the FABIS method could not define 9 colonies, considering them as suspicious (S) and another 50 did not coincide with the result of the molecular method, so, in total, both methods coincided in 94 identifications (61.44 %). The Bayesian grouping based on the analysis of the twelve morphometric variables showed that the categories A-CC and E-CC form a group close to the category E-BRC; while the category A-WC presented the greatest distance, forming an isolated group. Therefore, CC bees have morphometric characteristics tending to E-BRC bees. This work is also intended to be a contribution to the lack of records on Africanization in the state of Tabasco. It is recommended to use the molecular method to discriminate between E/A bees, as it is not affected by environmental factors. Key words: Colonies, Africanization, PCR, Morphometry, mtDNA.

Received: 12/11/2018 Accepted: 08/04/2021

Introduction There are at least 24 subspecies of Apis mellifera grouped into four main evolutionary branches: Line O (Near East), line A (African), line M (Western Mediterranean) and line C (Central Mediterranean and Southeastern Europe)(1). In 1956, with the aim of studying adaptation to tropical climates and improving the production of honey, African queen bees (A. mellifera scutellata) and their hybrids were imported from South Africa to Brazil(2,3). In 1957, the escape of bees in Brazil led to massive crossing with local bees of European origin, which generated populations with hybrid genotypes called Africanized(4). In Mexico, the Africanized bee was first identified in September 1986, when a swarm was caught and identified near Tapachula, Chiapas, in the border area with Guatemala(5,6). Subsequently, the presence of Africanized bees collected in 1987 in the municipalities of Tenosique and Centla, Tabasco, as well as in the municipalities of Coatzacoalcos Veracruz, Palenque Chiapas and Hopelchen Campeche, was reported(7). In the Yucatan Peninsula, Africanized wild bees (descendants of A. mellifera scutellata) were reported in 1987(8). Several studies have shown that the bee Apis mellifera scutellata has qualities that deserve to be highlighted; they are mainly honey producers in temperate climates, tolerate cold environments, are prolific 1189

Rev Mex Cienc Pecu 2021;12(4):1188-1207

suffering from fewer diseases due to parasitosis than other breeds(9). Africanized bees tend to collect more pollen and more propolis than European bees(10). Due to their greater ability to adapt to the tropical environment, they are widely distributed in the Americas(11). According to FAOSTAT(12), until 2019, China generated the highest production and export of honey globally, with 120,845 t exported, followed by India (65,351 t exported), Argentina (63,522 t), Ukraine (54,834 t), Brazil (30,039 t), Germany (25,239 t) and Mexico (25,122 t). In Mexico, during the period from January to November 2020, honey exports reached 26,077 t, which meant an increase in demand by 3.66 %, compared to 2019. Sixty-two point eightysix percent of honey production (tonnes) in 2020 was concentrated in seven states, among which Jalisco (6,059), Yucatán (5,529), Chiapas (5,434), Campeche (5,375), Veracruz (4,645), Oaxaca (4,533) and Puebla (2,450) stood out. Tabasco only reported a production of 405 t, ranking 25th as a producer of honey nationwide, much lower than its neighboring states(13), despite having botanical resources for the development of beekeeping. These data reflect the magnitude of the problem of beekeeping in this entity, located in the humid Mexican tropics. Currently, beekeeping in Mexico is practiced with Africanized bees and various subspecies of European bees that were introduced to Mexico, such as Apis mellifera mellifera and Apis mellifera ligustica. In the state of Tabasco, the genotypes of bees that coexist, through successive natural crosses, have generated a genetic pool of Africanized bees of which there are not enough reports that allow assessing their population dynamics and their effects on productivity. A limitation is that they are very difficult to identify due to their external morphometric characteristics(9), however, there are several molecular techniques(14, 15); which have been successfully used in various studies related to the structure, genetic diversity and phylogeny, determination of mitotypes and gene flow of bee populations(16-22). In the present study, a comparative analysis between the FABIS (Fast Africanized Bee Identification System) morphometric technique and the RFLP (Restriction Fragment Length Polymorphism) diagnosis was made, using the restriction fragment length polymorphism of mitochondrial DNA (mtDNA) for the identification of Africanized bees from the state of Tabasco and their relationship with 12 wing, femoral and abdominal morphometric variables.

1190

Rev Mex Cienc Pecu 2021;12(4):1188-1207

Material and methods The state of Tabasco is located in the southeast of the Mexican Republic, in the humid tropics region between 17º 15ʹ 00ʺ - 18º 39ʹ 07ʺ N and 90º 50ʹ 23ʺ - 94º 07ʹ 49ʺ W(23).

Biological material

Samples of worker bees taken at random from three colonies per apiary were obtained. Approximately 400 worker bees per colony were collected directly from the brood chamber, which were placed in labeled containers containing 96 % ethanol and preserved at -20 °C until use. The present study includes the sampling of 135 commercial bee colonies (CC) of cooperating producers, 15 breeding colonies (BRC) with inseminated queen bees and 3 wild colonies (WC). Morphometric analyses and molecular analyses were performed in the following stages:

Morphometric analysis

From each sample of the colonies, 10 worker bees were taken, whose structures were dissected and fixed in slides for observation and morphometric analysis. The structures were digitalized with a Karl Zeiss microscopy equipment with integrated camera and the Axiovision LE 472 software. Length and width variables were measured in millimeters (mm): Right forewing length (V1 RFWL), right forewing width (V2 RFWW), right hindwing length (V3 RHWL), number of hamuli of the hindwing (V4 NHHW), proboscis length (V5 PRL), tibia length of the hindleg (V6 TLHL), femur length of the hindleg (V7 FLHL), fourth tergite width (V8 FTW), fourth tergite length (V9 FTL), fourth tergite band length (V10 FTBL), fourth sternite width (V11 FSW), and fourth sternite length (V12 FSL). For the identification of Africanized bees, the FABIS (Fast Africanized Bee Identification System) method was used(22,24). To determine the Africanization index by geographical subregion, the frequencies of morphotypes were also calculated.

1191

Rev Mex Cienc Pecu 2021;12(4):1188-1207

DNA extraction

DNA extraction was performed using the modified method described by Doyle and Doyle(16): five worker bees were placed in a mortar, adding preheated extraction buffer (Tris-HCl 100 mM, NaCl 1.5 M, EDTA 20 mM pH 8, CTAB 4 %, PVP 40.4 %, ascorbic acid 0.1 %, mercaptoethanol 0.3 %), recovering the aqueous phase in conical tubes. Five hundred microliters of the aqueous phase were recovered, incubated at 60 °C in a water bath for 1 h and stirred every 15 min; it was left to stand until it reached ambient temperature. Five hundred microliters of chloroform were added: isoamyl alcohol (49:1 v/v). The tube was stirred until mixed, and an emulsion formed. It was centrifuged at 14,000 rpm for 5 min and the aqueous phase was transferred to a new tube with a micropipette; a volume of cold isopropanol was added, and it was left to incubate at -20 °C for 15 min. It was centrifuged at 5,000 rpm for 5 min and the supernatant was discarded. The obtained pellet was washed with cold 70 % ethanol, stirred to wash it completely, centrifuged at 14,000 rpm for 2 min; removing the ethanol and letting it dry at ambient temperature. Finally, the pellet was suspended in 200 µl of injectable water and stored at 20 °C. The extracted DNA was observed in a 1 % agarose gel and quantified by absorbance at 260 nm.

PCR amplification of mitochondrial DNA

The 485 bp region of the cytochrome b gene was amplified using the oligonucleotides CytbAF (5' TATGTACTACCATGAGGACAAATATC) and CytbA-R (5' ATTACACCTCCTAATTTATTAGGAAT). A Genius thermocycler, Techne model, was used, programming the running conditions: 94 ºC (2 min), followed by 30 cycles 94 ºC (1 min), 50 ºC (1 min) and 72 ºC (1 min), after the final cycle 72 ºC (7 min).

Restriction fragment length (RFLP) Analysis

After amplification of the samples, 10 µl of the PCR products were digested with 1 U of Bgl II restriction enzyme (Invitrogen), at 37 ºC for 4 h. Digestion was subjected to electrophoresis in a 2 % agarose gel, visualized under ultraviolet light. Restriction sites were measured as: European (E) mitotype, when visualizing a pattern of two fragments (194 and 291 bp), or Africanized (A) mitotype, when visualizing a single undigested fragment of 485 bp(1,17).

1192

Rev Mex Cienc Pecu 2021;12(4):1188-1207

When the mitotype was detected, it was classified into four categories: A-WC (Africanized mitotype, wild colony); A-CC (Africanized mitotype, commercial colony); E-CC (European mitotype, commercial colony) and E-BRC (European mitotype, breeding colony). Taking the categories described above as sources of variation, the morphometric data of the bees were subjected to analysis of variance and Bonferroni mean test (P≤0.05; 95 % confidence) when required. The multivariate analysis was performed using principal components, discriminant and cluster analysis for the attributes of the groups, and as a contribution of each of the variables depending on the link distances, the statistical software Statgraphics centurion XVI, Version 2016 and INFOSTAT were used.

Results As can be seen in Table 1, significant statistical differences between the subregions in 7 of the 12 morphometric variables studied (V1 RFWL, V3 RHWL, V5 PRL, V8 FTW, V9 FTL, V10 FTBL and V12 FSL) were found. The bees of the Chontalpa subregion showed on average the largest values in most of the variables, except in V6 TLHL (P= 0.9298), since the largest value was found in the Central subregion (3.02 mm), with a difference of 0.01 and 0.03 mm with respect to the other subregions. No statistically significant differences between the subregions with respect to this variable were found, neither in V2 RFWW (P=0.1368), V4 NHHW (P=0.2764), V7 FLHL (P=0.0945) and V11 FSW (0.5569). The principal component analysis showed that three components have an eigenvalue greater than or equal to 1.0, which together account for 60.088 % of the variability of the original data. CP1 has a positive correlation with all the morphometric variables studied, while CP2 has a positive correlation with five variables and negative or no correlation with the rest. CP3 has a positive correlation with eight variables, and negative or no correlation with the rest.

1193

Rev Mex Cienc Pecu 2021;12(4):1188-1207

Table 1: Summary of 12 morphometric variables measured in 153 colonies from the state of Tabasco (mm) Subregion Center

Summary V1 Mean 9.02ab

V2 3.09

V3 6.33ab

V4 20.88

V5 4.98ab

V6 3.02

V7 2.55

V8 2.05ab

V9 8.82c

V10 7.23c

V11 1.60

V12 3.99b

Chontalpa 68

S.D. Min Max Mean

0.11 8.82 9.25 9.08a

0.06 3.0 3.32 3.09

0.10 6.10 6.56 6.36a

0.870 19.60 23.80 21.23

0.37 4.23 5.57 5.17a

0.07 2.83 3.19 3.01

0.07 2.39 2.67 2.58

0.08 1.84 2.36 2.09a

0.21 8.47 9.23 9.07a

0.30 6.54 8.15 7.49b

0.05 1.50 1.72 1.60

0.14 3.61 4.27 4.10a

S.D. Min Max Mean

0.17 8.64 9.41 8.94b

0.06 2.94 3.2 3.04

0.13 5.99 6.66 6.28b

0.93 18.40 23.50 21.14

0.34 4.24 5.65 5.09a

0.13 2.10 3.22 2.99

0.06 2.48 2.80 2.54

0.05 1.93 2.23 2.04b

0.21 8.63 9.67 8.91bc

0.28 6.83 8.22 7.32bc

0.05 1.48 1.71 1.60

0.12 3.83 4.37 4.03ab

S.D. Min Max Mean

0.13 8.78 9.24 9.02ab

0.05 2.92 3.13 3.11

0.12 6.06 6.59 6.31ab

0.880 19.40 22.80 20.73

0.35 4.15 5.47 4.87ab

0.06 2.87 3.16 3.01

0.05 2.44 2.65 2.57

0.03 1.95 2.09 2.06ab

0.15 8.66 9.24 8.96abc

0.33 6.50 7.92 7.51a

0.05 1.50 1.70 1.58

0.09 3.77 4.15 4.06ab

S.D. Min Max Mean

0.18 8.81 9.49 9.05ab

0.21 2.98 3.76 3.09

0.14 6.14 6.64 6.35ab

0.75 19.70 22.40 21.08

0.48 4.35 5.77 4.73b

0.07 2.89 3.15 3.02

0.05 2.50 2.65 2.56

0.05 1.97 2.15 2.10a

0.22 8.54 9.25 9.07ab

0.24 7.13 7.87 7.43bc

0.05 1.53 1.68 1.59

0.11 3.87 4.26 4.08ab

153

S.D. Min Max P

0.12 8.84 9.35 0.0025

0.04 3.00 3.18 0.1368

0.08 6.20 6.55 0.0471

1.11 19.30 23.10 0.2764

0.35 4.10 5.33 0.0001

0.06 2.91 3.12 0.9298

0.05 2.49 2.70 0.0945

0.05 2.01 2.17 0.0001

0.15 8.85 9.40 0.0001

0.27 6.73 7.85 0.0006

0.04 1.52 1.67 0.5569

0.10 3.95 4.25 0.0007

Pantanos

Ríos

Sierra

n 31

Right forewing length (V1), Right forewing width (V2), Right hindwing length (V3), Number of hamuli of the hindwing (V4), Proboscis length (V5), Tibia length of the hindleg (V6), Femur length of the hindleg (V7), Fourth tergite width (V8), Fourth tergite length (V9), Fourth tergite band length (V10), Fourth sternite width (V11), and Fourth sternite length (V12). P= values ≤0.05 indicate significant differences; S.D.= standard deviation.

1194

Rev Mex Cienc Pecu 2021;12(4):1188-1207

The graph of influences (Figure 1) shows the coefficients of each variable of the first two components, with right forewing length (V1 RFWL), right hindwing length (V3 RHWL), femur length of the hindleg (V7 FLHL), fourth tergite width (V8 FTW), fourth tergite length (V9 FTL) and fourth sternite length (V12 FSL) being the variables with the greatest influence on CP1. However, the three discriminant variables explain only 60.088 % of the variability of the original data, which is considered insufficient for the purposes of this analysis.

Second component

Figure 1: Two-dimensional information of the influences of morphometric variables on two principal components

First component Right forewing length (V1), Right forewing width (V2), Right hindwing length (V3), Number of hamuli of the hindwing (V4), Proboscis length (V5), Tibia length of the hindleg (V6), Femur length of the hindleg (V7), Fourth tergite width (V8), Fourth tergite length (V9), Fourth tergite band length (V10), Fourth sternite width (V11), and Fourth sternite length (V12).

According to the diagnosis by the FABIS method, at the state level (n= 153), 67 colonies (43.79 %) were determined with Africanized morphotype, 77 colonies (50.33 %) with European morphotype and 9 colonies (5.88 %) suspicious (S), showing significant differences (Chi2= 52.86, n= 153, P=0.0001). The suspicious colonies were found in apiaries of the Central subregion (n= 31) 1 colony (3.2 %), Chontalpa subregion (n= 68) 6 colonies (8.82 %) and in the Pantanos subregion (n= 24), 2 colonies (8.33 %). According to the mtDNA analysis (Figure 2, Table 2), at the state level (n= 153), 86 colonies (56.21 %) were determined with Africanized mitotype and 67 colonies (43.79 %) with European mitotype, without finding statistical significance (Chi2= 2.36, n= 153, P=0.124). 1195

Rev Mex Cienc Pecu 2021;12(4):1188-1207

Specifically, of the 135 commercial colonies sampled, relative frequencies of mitotype E genes were detected in 52 colonies (38.52 %) and 83 colonies (61.48 %) presented mitotype A, finding significant differences (Chi2= 7.12, n= 135, P=0.0076). This demonstrates the predominance of the Africanized mitotype over the European one in an order of 1.59 A/E in the commercial colonies. As can be seen in Table 2, on average, the Ríos subregion showed the lowest frequency of mitotype A (41.67 %), with a higher degree of Africanization found in the rest of the subregions, up to 75 % in the Pantanos subregion. Figure 2: Amplification of the mtDNA of Apis mellifera digested with the Bgl II restriction enzyme

Af= Africanized, undigested mitotype, Eur= European (double banding). M= molecular size marker.

When performing the morphometric analysis of the 12 variables using the four categories described as sources of variation, statistically significant differences are found in 67 % of the variables (8 of 12). In Table 3, it can be seen that there are small numerical differences, however, E-BRC bees present in most of the morphometric variables the largest dimensions, except in V5 PRL, however, there are no significant differences.

1196

Rev Mex Cienc Pecu 2021;12(4):1188-1207

Table 2. Number and proportion (%) of colonies classified by FABIS and the mtDNA mitotype, identified as Africanized - European in the subregions of the state of Tabasco Subregion FABIS Center Chontalpa Pantanos Ríos Sierra Total (Morphotype) Africanized 15 (48.39) 21 (30.88) 17 (70.83) 8 (66.67) 6 (33.33) 67 (43.79) 15 (48.39) 41 (60.29) 5 (20.83) 4 (33.33) 12 (66.67) 77 (50.33) European 1 (3.23) 6 (8.82) 2 (8.33) 9 (5.88) Suspicious 2 Chi =2.00, 2 2 2 2 Chi =12.65, Chi =27.21, Chi =15.75, Chi =1.33, n=18, Chi2=52.86, n=153, n=31, P=0.0018 n=68, P=0.0001 n=24, P=0.0004 n=12, P=0.2482 P=0.1573 P=0.0001 MITOTYPE (mtDNA) Africanized 15 (48.39) 36 (52.94) 18 (75.0) 5 (41.67) 12 (66.67) 86 (56.21) 16 (51.61) 32 (47.06) 6 (25.0) 7 (58.33) 6 (33.33) 67 (43.79) European 2 2 2 2 2 Chi =0.03, n=31, Chi =0.24, n=68, Chi =6.00, n=24, Chi =0.33, Chi =2.00, Chi2=2.36, n=153, P=0.857 P=0.627 P=0.014 n=12, P=0.563 n=18, P=0.157 P=0.124 P= values ≤0.05 indicate significant differences.

1197

Rev Mex Cienc Pecu 2021;12(4):1188-1207

Table 3: Morphometric analysis between bees with mitotype: A-CC= Africanized commercial colony, A-WC= Africanized wild colony, E-CC= European commercial colony and E-BRC= European breeding colony (mm) Categories n Summary V1 V2 V3 V4 V5 V6 V7 V8 V9 V10 V11

A-CC

A-WC

E-CC

E-BRC

153

V12

Mean

8.99b

3.07ab

6.31b

21.08

5.03

3.00

2.55ab

2.07b

8.95b

7.36

1.60b

4.05b

S.D. Minimum Maximum Mean

0.12 8.71 9.36 8.74c

0.09 2.92 3.76 3.0b

0.10 6.06 6.59 6.07c

0.95 18.4 23.50 20.83

0.38 4.10 5.65 5.12

0.12 2.10 3.19 2.93

0.05 2.44 2.69 2.53b

0.06 1.84 2.36 1.98b

0.19 8.47 9.40 9.01ab

0.28 6.50 7.96 7.23

0.04 1.50 1.69 1.50c

0.11 3.77 4.29 3.91b

S.D. Minimum Maximum Mean

0.09 8.64 8.82 9.08ab

0.06 2.94 3.07 3.09a

0.07 5.99 6.13 6.36ab

0.47 20.30 21.20 21.01

0.20 4.90 5.26 5.09

0.03 2.91 2.96 3.02

0.03 2.50 2.56 2.57ab

0.05 1.93 2.03 2.08ab

0.57 8.63 9.67 9.00ab

0.12 7.09 7.32 7.45

0.04 1.48 1.55 1.60b

0.06 3.85 3.97 4.07ab

S.D. Minimum Maximum Mean

0.17 8.80 9.49 9.20a

0.06 2.98 3.32 3.12a

0.12 6.10 6.64 6.43a

0.83 19.60 22.80 21.45

0.38 4.38 5.77 4.96

0.09 2.83 3.22 3.04

0.07 2.39 2.80 2.60a

0.06 1.88 2.23 2.12a

0.24 8.54 9.66 9.14a

0.33 6.54 8.22 7.52

0.05 1.50 1.71 1.64a

0.14 3.61 4.37 4.15a

S.D. Minimum Maximum P

0.11 9.06 9.41 0.0001

0.05 3.02 3.19 0.0238

0.11 6.28 6.66 0.0001

1.130 19.90 23.80 0.3993

0.45 4.18 5.58 0.6237

0.05 2.98 3.13 0.2754

0.06 2.50 2.70 0.0222

0.04 2.04 2.19 0.0019

0.17 8.79 9.48 0.0198

0.34 6.73 8.15 0.1201

0.04 1.57 1.72 0.0001

0.08 4.03 4.33 0.0027

Right forewing length (V1), Right forewing width (V2), Right hindwing length (V3), Number of hamuli of the hindwing (V4), Proboscis length (V5), Tibia length of the hindleg (V6), Femur length of the hindleg (V7), Fourth tergite width (V8), Fourth tergite length (V9), Fourth tergite band length (V10), Fourth sternite width (V11), and Fourth sternite length (V12); S.D.= standard deviation. P= values ≤0.05 indicate significant differences. ab Different literals in the same column indicate significant differences.

1198

Rev Mex Cienc Pecu 2021;12(4):1188-1207

The clustering analysis presented in Figure 3 shows that, in the first stage of the procedure, category A-CC is grouped with category E-CC (1.63). Next, a second group forms with category E-BRC (it appears as E-CPC in Figure 3) with a grouping distance of 3.96, with category A-WC (it appears as A-CS in Figure 3) appearing as the furthest group (5.76). Figure 3: Phenogram obtained by the nearest neighbor grouping method of 12 morphometric variables, measured in honeybees (Apis mellifera L.) in the state of Tabasco

Euclidean distance

Discussion By using subregions as sources of variation, the differences found in the variables of length and width of structures, although significant, are very narrow and it is not possible to achieve clear discrimination of bees between subregions. On average, the bees from the state of Tabasco measure V1 RFWL (9.022 mm), V2 RFWW (3.13 mm), V3 RHWL (6.326 mm), V4 NHHW (they have 21.012 hamuli), V6 TLHL (3.01 mm), lower than Creole bees from a population of Africanized bees Apis mellifera sp. from the Lambayeque region in Peru(25). However, Tabasco bees are larger in terms of V7 FLHL (2.56 mm).

Pearson’s moment-product correlations between each pair of variables (n= 153) showed that V1 RFWL has a strong positive and significant correlation with V2 RFWW (0.5072), V3 1199

Rev Mex Cienc Pecu 2021;12(4):1188-1207

RHWL (0.8368), V7 FLHL (0.5220), V8 FTW (0.5377), V9 FTL (0.5568) and V12 FSL (0.5502), but with the rest the correlations are weak. The non-significant weak correlation (0.1541) between V3 RHWL and V4 NHHW is striking. V5 PRL only has significant positive weak correlation with V9 FTL (0.1754), its correlation with the rest of the variables is weak and not significant. V7 FLHL showed significant correlation with V8 FTW (0.4130), V9 FTL (0.4785), V10 (0.2910), V11 (0.4719) and V12 (0.4550). In relation to the tergite and sternite, the measures correlate positively and significantly with each other. V8 FTW has strong positive and significant correlation with V9 FTL (0.6392), V10 (0.3441), V11 (0.4528) and V12 (0.5667). Significant differences were found both between the subregions and between the categories, in the variables V1 RFWL and V7 FLHL, which has special attention since they are used for the determination of Africanization by the FABIS method(22,23). Likewise, these variables together showed significant positive correlations with 11 of the 12 variables studied. Regarding the number of hamuli, in a comparative analysis between Africanized and European bees, it was reported that, statistically, there are no differences between Africanized and European worker bees (26); the results of this work also confirm this condition, as the number of hamuli was not found as a discriminating characteristic between both breeds. In relation to the fact that the morphometric pattern of African bees are smaller, and that European bees are larger(3,27,28), under the conditions of this work, it was found that although the morphometric characteristics are different statistically, the difference on average is very narrow, which agrees with several researchers who affirm that Africanized bees are very difficult to differentiate morphometrically, and that currently there are Africanized bees with more European characteristics or vice versa(29,30). This morphometric similarity could lead to erroneous conclusions when using morphometric methods for A-E determination. This was demonstrated in populations of morphometrically Africanized bees(31) and agrees with these results by finding, in a general way, 59 (38.56 %) non-coincident determinations between both diagnostic methods (FABIS/mtDNA). These results suggest the possibility of finding that bees of different mitotype and collection site share the same morphometric group, so it is not possible to classify the bees from the state of Tabasco by geographical subregion, which could be explained by the uses and customs of distribution of queen bees among producers from different subregions. The body size of bees has a strong genetic basis, however, it has been shown that the management of colonies, particularly cell size, influences the body size of bees(32). Another study that reinforces the idea that beekeeping practices affect the genetic type of bee populations is the one reported in 2007 by Antonio(33), who found that 67.39 % of the colonies in the Comarca Lagunera region were European, which was attributed to the intensity with which beekeepers have carried out the replacement of queens. More recently, other researchers(34), through FABIS, reported that 91.49 % of the bee colonies in Mexicali and 1200

Rev Mex Cienc Pecu 2021;12(4):1188-1207

67.65 % of the colonies in Ensenada have Africanized morphotypes, however, in the wild colonies, it was found that 100 % in Mexicali and 50 % in Ensenada have Africanized morphotypes, which coincides with what was found in this work, and that could be explained by the differences in the technification of the sampled apiaries. The fact that, in the Tabasco territory, the bees with mitotype A and E in the commercial colonies have very similar morphometric characteristics could be explained a) by the natural hybridization with the wild colonies since the entry of the African bee; b) by the introduction of commercial queen bees or European breeding bees; c) influenced by the characteristics of the honeycombs. The origin of mitotype E in the state of Tabasco is diverse, since from 2003 to 2010, the ISPROTAB (Institute of Production Systems of the Humid Tropics of Tabasco) acquired inseminated bees of different European breeds from certified farms, to reproduce them in their queen farms and donate F1 queens to producers, in order to promote the annual replacement of queen bees; however, after its cancellation, some beekeepers acquire on their own queen bees from local or foreign farms, which may or may not be certified by SAGARPA (Secretariat of Agriculture, Livestock, Rural Development, Fisheries and Food), with the consequent health risk. So, together with the presence of wild colonies, they are the main source of mitotype A genes, which have a great capacity to multiply, and eventually the fertilization of virgin queens of mitotype E with Africanized drones could be resulting in the proliferation of Africanized genes, since it has been reported that African genes are dominant(11). The results show that apiaries are composed of colonies with both mitotypes in different proportions, which confirms the coexistence of both breed types of bees in some apiaries, and coincides with what was recently reported in a study using mtDNA conducted in seven areas of Buenos Aires, Argentina, for a total of 430 colonies, finding that colonies derived from African bees coexist with European ones in two of the seven areas, in addition to the fact that European mitotypes continue to be more frequent, compared to the results they obtained in 2005(35). On the other hand, Quezada-Euan(8), through analysis of alloenzymes in 25 managed colonies, reported 95 % of AHB (Africanized Honeybee) haplotypes in the states of Chiapas and Tabasco, and 73 % in Yucatan, finding the lowest levels in the states of Michoacán and Jalisco (56 and 40 % respectively), which is very close to what it was found in this work (56.21 %), and they mention that their findings could be related to the intensity of queen replacement practices. In relation to results in this research, was reported 56.21 % of Africanized mitotypes found in commercial colonies in the state of Tabasco, which is below the range reported in a study of Africanization using mtDNA conducted in five populations from the state of Veracruz Mexico and three reference populations, since 60 to 77 % of Africanized mitotype was detected in populations located between 72 and 1,300 masl(20).

1201

Rev Mex Cienc Pecu 2021;12(4):1188-1207

The two diagnostic techniques used in this work clearly define the breed of the samples of the BRC and WC groups, in which both techniques fully coincide in the results, which is not surprising for the mtDNA technique, knowing its robustness; but they also give evidence that morphometric analysis is capable of defining the breed of bees when these have clearly differentiable or extreme measures; however, when measurements are in ranges shared between breeds, morphometric analysis loses accuracy and results can be erratic, as evidenced by the coincidences and non-coincidences of both diagnostic methods. In this sense, it is important to mention that the mtDNA analysis manifests the ancestral origin of bees due to the generational stability of mtDNA, but the morphometric analysis reflects the difficulty of defining by breed, since bee populations are interbreeding and have physical and behavioral characteristics of both breeds. In a research carried out in Colombia, without referring to the genotype of bees, it was reported that, in the beekeeping regions of Tolima and Boyacá, the average values of the forewing were from 8.74 mm to 8.63 mm, which indicates African morphological uniformity or very close to the African ones, due to the process of Africanization of the bees from those regions(9). Similarly, in Colombia, a pattern of amplification of Dra I sites, 16S RFLP, of 87.5 % of African (Apis mellifera scutellata) and 12.5 % European (carnica/ligustica) colonies, was reported, pointing out that Tolima has predominantly Africanized genes(36,37). Regarding the wing length, it was found that in A-WC, A-CC and E-CC bees, they measure on average 8.74 mm, 8.99 mm and 9.08 mm respectively. However, bees with E-CC mitotype from Tabasco have a right forewing length of 9.08 mm, slightly less than those reported in the highlands ≥9.12 mm(19). Molecular characterization based on mtDNA has become a widely used technique for the study of the differentiation of subspecies or breeds of honeybee Apis mellifera L. by various authors(37-40). This circular and maternally inherited molecule allows characterizing the queen bee through the workers and thus the entire colony and can be considered a marker of the entire colony. Its study has allowed formulating different hypotheses about the evolution of the subspecies of Apis mellifera and defining five evolutionary lineages: lineage A includes the African subspecies such as intermissa and scutellata, lineage M is formed by the subspecies of Western Europe, including mellifera, lineage C formed by the subspecies of Eastern Europe (ligustica or Italian bee), lineage O that includes the subspecies of Near Eastern and the Y that includes the subspecies Apis mellifera yemenitica from Ethiopia(15). Each of these lineages presents a characteristic composition in the sequence of different regions of mitochondrial DNA, as is the case with the subunit I of the cytochrome oxidase (COI) gene, for which lineage M presents a target of the Hinc II endonuclease that is not in lineage A(40).

1202

Rev Mex Cienc Pecu 2021;12(4):1188-1207

Conclusions and implications Morphometric analyses were only discriminant in the extreme values, and therefore they classify as suspicious of being Africanized, which could be reflecting the reality of the dynamics of intercrossing of populations. The coexistence of bees of European and Africanized type has been affected by some practices such as the replacement of queens, which have substantially influenced the type of bees present in the colonies. The reproductive behavior of honeybees contributes strongly to the maintenance of the levels of Africanization of the colonies, since it allows the introgression of wild genes to the bee populations managed by beekeepers, which can be seen in the commercial bee colonies identified in this work as (CC). Our results clearly and significantly discriminate the category A-ES from the E-BRC, showing the extreme morphometric values; however, the categories A-CC and E-CC showed marked similarities; this wide morphometric range suggests genetic diversity, which must be studied to determine the lineages to which bees belong in this region of the country. So far, the best method to discriminate genotypes E or A is the molecular method.

Acknowledgements

To the National Technological Institute of Mexico for the financing granted to the project: Determination of varroa and molecular detection of Nosema apis and Nosema ceranae, in commercial apiaries of Apis mellifera,in the state of Tabasco, Mexico. Code: 6328.17P. Literature cited: 1. Ruttner F. Biogeography and taxonomy of honey bees. Germany, New York, USA: Springer Verlag: Heiddelberg; 1988. 2. Padilla-Álvarez F, Sereno FTP de S. Estudio de la diversidad morfológica existente en las abejas melíferas (Apis mellífera L.) del sur de Europa y del Continente Sudamericano. Arch Zootec 2005;(54):221-226. 3. Kerr WE. The history of the introduction of Africanized bees in Brazil. S Afr Bee J 1967;(39):3-5. 4. Schneider SS, DeGrandi-Hoffman G, Smith DR. The African honey bee: Factors contributing to a successful invasion. Ann Rev of Entom 2004;(49):351–376. doi:10.1146/annurev.ento.49.061802.123359.

1203

Rev Mex Cienc Pecu 2021;12(4):1188-1207

5. Fierro MM, Barraza A, Maki DL, Moffet JO. The effect of the first year of africanization on honey bee populations in Chiapas, Mexico. Proc Third Am Bee Res Conf. Weslaco, Tx. USA. 1987. 6. Moffett JO, Dale LM, Thomas A, Fierro MM. The africanized bee in Chiapas, Mexico. Am Bee J 1987;127(7):517-519. 7. Herrera SA. Monitoreo de abejas africanas. III Seminario Americano de Apicultura. Acapulco, México. 1989;9-11. 8. Quezada-Euan JJG. The present status of african-derived honeybees in tropical México. VI Encontro sobre Abelhas. Riberao Preto Brasil. 2006. 9. Salamanca GG, Vargas EF, Pérez FC. Estudio morfométrico y sistemático del grado de africanización de la abeja. 1999. https://www.apiservices.biz/es/articulos/ordenar-porpopularidad/716-estudio-morfometrico-y-sistematico-del-grado-de-africanizacion. Consultado 8 Mar, 2019. 10. Danka RG, Hellmich RL II, Rinderer TE, Collins AM. Diet-selection ecology of tropically and temperately adapted honey bees. Anim Behav 1987;(35):1858-1863. 11. Guzmán-Novoa E, Correa-Benítez A, Guzmán G, Espinosa LG. History, colonization and impact of the africanized honey bee in Mexico. Vet Méx 2011;42(2):149-178. 12. FAOSTAT. Base de datos del mundo sobre estadísticas alimentarias y agrícolas. Organización de las naciones unidas. http://www.fao.org/faostat/es/#rankings/countries_by_commodity_exports. Consultado 15 Feb, 2021. 13.

INFOSIAP. Servicio de información y estadística agroalimentaria. http://infosiap.siap.gob.mx/repoAvance_siap_gb/pecAvanceEdo.jsp. Consultado 15 Feb, 2021.

14. Winston ML. Killer bees: The africanized honey bee in the Americas. Cambridge: Harvard University Press; 1992. 15. Franck P, Garnery L, Loiseau A, Oldroyd BP, Hepburn HR, Solignac M. Genetic diversity of the honeybee in Africa: microsatellite and mitochondrial data. Heredity 2001;(86):420-430. 16. Doyle JJ, Doyle JL. Isolation of plant DNA from fresh tissue. Focus 1990;12(1):13-16. 17. Crozier YC, Koulianus S, Crozier RH. An improved test for africanized honey bee mitocondrial DNA. Experientia 1991;(47):968-969. 1204

Rev Mex Cienc Pecu 2021;12(4):1188-1207

18. Clarke KE, Oldroyd BP, Javier J, Quezada-Euan G, Rinderer TE. Origin of honeybees (Apis mellifera L) from Yucatan Peninsula inferred from mitocondrial DNA analysis. Mol Ecol 2001;(10):1347-1355. 19. Uribe-Rubio JL, Guzmán-Novoa E, Hunt GJ, Correa-Benítez A, Zozaya JA. Efecto de la africanización sobre la producción de miel, comportamiento defensivo y tamaño de las abejas melíferas (Apis mellifera L.) en el altiplano mexicano. Vet Mex 2003;34(1):4759. 20. Kraus FB, Franck P, Vandame R. Asymmetric introgression of African genes in honeybee populations (Apis mellífera L.) in Central Mexico. Heredity 2007:1-8. 21. de la Rua P, Hernández-García R, Pedersen BV, Galián J, Serrano J. Molecular diversity of honeybee Apis mellifera Iberica L. (Hymenoptera: Apidae) from western Andalusia. Arch Zootec 2004;(53):195-203. 22. Sylvester HA, Rinderer TE. Fast africanized bee identification system (FABIS) manual. Am Bee J 1987;127(7):511-516. 23. INAFED. Instituto Nacional para el Federalismo y el Desarrollo Municipal. Enciclopedia de los municipios y delegaciones de México. 2018. EN: http://www.inafed.gob.mx/work/enciclopedia/emm27tabasco/regionalizacion.html. Consultado 8 May, 2020. 24. DOF. Diario Oficial de la Federación. Norma oficial mexicana NOM-056-ZOO-1995. Especificaciones técnicas para las pruebas diagnósticas que realicen los laboratorios de pruebas aprobados en materia zoosanitaria. http://www.dof.gob.mx/nota_detalle.php?codigo=4944688&fecha=22/02/1999. Consultado 15 May, 2020. 25.

Vásquez-Arca, OR, Mestanza-Arca BS, Alarcón-Silva RE. Características morfométricas, comportamiento higiénico y agresividad de abejas criollas Apis mellifera sp. Rev Inv Cult 2016;(1). https://www.redalyc.org/jatsRepo/5217/521753139003/html/index.html. Consultado 15 Jul, 2020.

26. del Lama MA, Gruber CV, de Godóy IC. Heterozigosidade e assimetria do número de hámulos em operárias adultas de Apis mellifera (Hymenoptera, Apidae). Rev Bras Entomol 202;46(4):591-595. 27. Guzman-Novoa E, Page RE, Spangler HG, Erickson EH. A comparison of two assays to test the defensive behaviour of honey bee (Apis mellifera L.). J Apic Res 1999;(38):205209. 1205

Rev Mex Cienc Pecu 2021;12(4):1188-1207

28. Zhou T, Huang Z, Yao J, Wang G, Huang S. Los efectos que el tamaño de la celda de cría tiene sobre el comportamiento reproductivo de la varroa. China: Apimondia 2010. 29. May-Itzá WJ, Quezada-Euan JJG, Iuit L, Echazarreta CM. Do morphometrics and allozymes reliably distinguis africanized and european Apis mellifera drones in subtropical Mexico?. J Apic Res 2001;40(1):17-23. 30. Pérez-Castro EE, May-Itzá WJ, Quezada-Euan JJG. Thirty years alter: a survey on the distribution and expansion of africanized honey bees (Apis mellifera) in Peru. J Apic Res 2002;41(3-4):69-73. 31. Quezada-Euan JJG, Hinsull SM. Evidence of continued European morphometrics and mtDNA in feral colonies of honey bees (Apis mellifera) from the Yucatan peninsula, Mexico. J Apic Res 1995;34(3):16-166. 32. Masaquiza-Moposita DA, Curbelo RLM, Díaz MB, Arenal CA. Relaciones entre producción melífera, defensividad y diámetro de celdas de cría de Apis mellifera L; en el altiplano ecuatoriano. Rev Prod Anim 2019;31(3). https://revistas.reduc.edu.cu/index.php/rpa/article/view/e2994. Consultado 22 Jun, 2020. 33. Antonio GMA. Estado actual de la africanización de las abejas melíferas en la Comarca Lagunera [Tesis licenciatura]. Torreón, Coahuila, México: Universidad Autónoma Agraria Antonio Narro Unidad Laguna; 2008. 34. Alaniz-Gutiérrez L, Torres-Salado N, Ail-Catzim CE, Velazco-López JL. Frecuencia de morfotipos africanizados y europeos de Apis mellifera en Ensenada y Mexicali, Baja California. Ecosist Recur Agropec 2016;3(9):421-426. 35. Genchi G, Reynaldi FJ, Bravi CM. An update of Africanization in honey bee (Apis mellifera) populations in Buenos Aires, Argentina. J Apic Res 2018. DOI: 10.1080/00218839.2018.1494887. https://doi.org/10.1080/00218839.2018.1494887. Accessed Jun 15, 2020. 36. Prada QCF, Duran TJ, Salamanca GG, del Lama AM. Population genetics of Apis mellifera L (Hymenoptera: Apidae) from Colombia. J Apic Res 2009;48(1):3-10. 37. Garnery L, Cornuet JM, Solignac M. Evolutionary history of the honeybee Apis mellifera L. inferred from mitochondrial DNA analysis. Mol Ecol 1992;(1):145-154. 38. de la Rua P, Galián J, Serrano J. Variabilidad del ADN mitocondrial en poblaciones de abejas de la miel (Apis mellifera L.) de la región de Murcia. Invest Agr Prod Sanid Anim 1999;14(3):41-49. 1206

Rev Mex Cienc Pecu 2021;12(4):1188-1207

39. de la Rua P, Galián J, Serrano J, Moritz RFA. Molecular characterization and population structure of honey bee from the Belaric island (Spain). Apidologie 2001;(32):417-427. 40. Hall HG, Smith DR. Distinguishing african and european honeybee matrilines using amplified mitochondrial DNA. Proc Natl Acad Sci USA. 1991;88(10):4548-52.

1207

https://doi.org/10.22319/rmcp.v12i4.5615 Article

Epizootiological factors of gastrointestinal strongyloses in Cuban Creole goats: bases for integrated management Manuel Alejandro La O-Arias a Francisco Guevara-Hernández b* Luis Alfredo Rodríguez- Larramendi c Luis Reyes-Muro d José Nahed-Toral e Hernán Orbelin Mandujano-Camacho f René Pinto-Ruiz g

Universidad Autónoma de Chiapas. Facultad de Ciencias Agronómicas Campus V. Chiapas. México. b

Universidad Autónoma de Chiapas. Facultad de Ciencias Agronómicas Campus V. Chiapas. México. c

Universidad de Ciencias y Artes de Chiapas (UNICACH). Facultad de Ingeniería. Chiapas. México. d

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), Aguascalientes, México. e

El Colegio de la Frontera Sur (ECOSUR). San Cristóbal de las Casas, Chiapas. México.

Universidad Autónoma de Chiapas (UNACH). Facultad de Medicina, Veterinaria y Zootecnia. Chiapas. México. g

Universidad Autónoma de Chiapas (UNACH). Facultad de Ciencias Agronómicas Campus V. Chiapas. México.

*Corresponding author: francisco.guevara@unach.mx

1208

Rev Mex Cienc Pecu 2021;12(4):1208-1220

Abstract: Parasitism caused by strongyles is one of the main limiting factors of the production of Creole goats in eastern Cuba. Through a descriptive and exploratory research carried out during the period between 2013 and 2018, the factors that regulate the epizootiological dynamics of gastrointestinal strongyloses were identified in 18 herds. The factors under control were: the population dynamics of larvae per month, the reproductive states and the growth process of the goats. The monthly dynamics of infective larvae in the pasture were recorded. Simple ANOVAS for linear models corresponding to each factor and the Newmankeuls test for multiple comparisons of means were applied. It was observed that the parasitic dynamics of gastrointestinal strongyloses, which affect Cuban Creole goats, are related to physiological and zootechnical processes. In these dynamics, two critical moments or peaks of infestation were identified: in growing animals during the weaning period (2,188 eggs per gram, EPG) and in breeding females in peripartum periods (972 EPG). The general infestation of the herds is conditioned by the combination of greater ingestion of infective larvae, processes of food stress and predisposing physiological states, which lead to seasonal infestation peaks between the months from December to February greater than 1,500 EPG. The dynamics of pasture infestation are related to rainy seasonality with infestation peaks between the months from July to September and an average maximum of 1,200 larvae per kilo of grass. Key words: Goats, Parasitic infestation, Host, Pasture.

Received: 08/02/2020 Accepted.05/02/2021

Introduction

Cuban Creole goats are a genotype differentiated from their Iberian and African ancestors(1). This differentiation is the result of 500 yr of coevolution in the socio-environmental context of eastern Cuba, a region where more than 90 % of the Cuban goat population is concentrated and where the first group of animals of this breed was officially registered(2).According to La O et al(3), these animals are typical of peasant breeding systems, mainly with self-subsistence objectives. For this reason, their breeders allocate very few inputs for this activity, and expect to have their productions based on the rusticity of the genotype. However, other researchers found that these animals could carry significant loads of gastrointestinal strongyles and even reported the presence of two species of Haemonchus, contortus and placei, the latter, of high specificity for cattle(4).

1209

Rev Mex Cienc Pecu 2021;12(4):1208-1220

Several studies on the effect of this parasitic group have shown that they can affect more than 25 % of the productive potential of animals, without showing signals to producers(5). In this way, it is estimated that parasitism caused by strongyles is one of the main limiting factors of the production of Creole goats in eastern Cuba. This situation generates controversy about the most convenient strategies for the development of traditional breeding systems. Conventional schemes of anthelmintic treatments are not compatible with the traditional rationality of breeding, for this reason everything points to develop integrated control strategies more consistent with the vision of the peasant breeder. To generate integrated control strategies, it is important to identify the particularities of the parasitic process for these goats in the region. From this problem, the research question that gave rise to the present study is generated, what are the factors that define the dynamics of gastrointestinal strongyloses that affect Cuban Creole goats? Then, the objective was to identify the factors that regulate the dynamics of gastrointestinal strongyloses of Cuban Creole goats.

Material and methods Study location and sample

The research was carried out in the sub-basin of the Cautillo-Jiguaní rivers, of the Cauto River Valley, located in eastern Cuba, Municipality of Jiguaní, province of Granma (Figure 1) The herds belonged to the community “26 de Julio”, an area where specimens of this breed were registered for the first time in Cuba as pure racial.

1210

Rev Mex Cienc Pecu 2021;12(4):1208-1220

Figure 1: Location of the study area

Eighteen (18) herds were selected in correspondence with the traditional breeding typologies for this breed, identified by La O et al(3). In total, 860 animals were studied, of them: 26 bucks, 455 breeding females and 379 growing animals. The animals were evaluated by experts and classified as Cuban Creoles.

Research design

The research carried out was descriptive and exploratory. The object of study was the parasitic process by means of two variables or indicators: 1) the number of parasite eggs per gram of feces (EPG) and the number of infective larvae in the grass (larvae per kilo of grass). These variables were monitored for three years, with a monthly frequency. In the case of hosts, a minimum sample of 10 animals per herd was taken, but which as a whole represented more than 10 % of the existing animals by category. A total of 3,715 samples of feces were worked on. In the case of pastures, samples were taken from the area under occupation and from areas with less than 28 d of rest. In total, 1,250 samples of pastures from the 18 breeding units were worked on. The epizootiological influence factors contolled were: a) month of the year; b) breeding category (bucks, breeding females and growing animals until weaning (120 d) and after weaning); c) physiological state (dry and empty animals, gestation time and lactation time).

1211

Rev Mex Cienc Pecu 2021;12(4):1208-1220

Parasitological studies

Samples of feces were taken before 0800 h, with a monthly frequency. To identify the genera present, cultures were carried out for 7 d protected with activated carbon. Egg counting was performed using the Mac Master technique(6). In the case of pastures, the sample was taken before 0800 h, through a tour of the grazing areas in which small portions of grass were collected every 10 steps. For the counting of infective larvae per kilo of grass, the technique described by Arece and Rodríguez(7) was used.

Statistical analysis

Simple ANOVAS were applied for linear models corresponding to each of the controlled factors (growth period, month, reproductive states). For multiple comparisons of means, the Newmankeuls test was applied. The software used was STATISTICA 12.0(8).

Results and discussion The genera of parasites diagnosed in cultures of larvae were Haemonchus (48 %), Bunostomun (23 %), Trichostrongylus (23 %) and Oesofagostomun (6 %). This population structure was consistent with the results reported by Rojas et al(4) in this same locality. In fact, it is consistent with a population structure pattern characteristic of tropical areas(9). The predominance of the genus Haemonchus is given by the favorable conditions to develop its exogenous phase throughout the year and because it is a much more prolific group than the rest of the identified genera(10). The genera Haemonchus and Oesophagostomum predominate at high temperature and humidity, while the genus Cooperia does so in humid and tropical climates in reverse of Teladorsagia that occurs in temperate or cold climates(11). For the dynamics of egg expulsion during the reproductive cycle (Figure 2), an increase was found during the peripartum period; epizootiological phenomenon called PPR, described by several authors(12-13); those who report that, during this period, which includes one month before and one month after calving, certain immunosuppressive processes occur that promote the development of larvae that had remained hypobiotic.

1212

Rev Mex Cienc Pecu 2021;12(4):1208-1220

Figure 2: Dynamics of egg expulsion in goats during the reproductive cycle

G1 to G5= pregnant form 1 to 5 mo; L1 to L4=lactationg from 1 to 4 mo; ab P<0.01; CV= 12 %.

V= open.

The possibility of increases in the fertility of female parasites with higher egg productions is not ruled out either. Figure 3 shows two photos of females of Haemonchus spp., in the section near the vulvar flap. In these images, a greater apparent load of eggs in the female of parasites, recovered from a breeding female in peripartum, can be observed. This is not conclusive evidence, but it induces research to test this hypothesis. Figure 3: Sections of vulvar flaps of females of Haemonchus spp., recovered from breeding female goats within and outside of the peripartum period (Photos: Manuel A. La O Arias).

1213

Rev Mex Cienc Pecu 2021;12(4):1208-1220

In Cuba, the first report of processes of increased parasitic activity in the peripartum period was carried out in the sheep species(14). In this research, the first report of the peripartum process in the goat species in Cuba is made. Regarding the dynamics of egg expulsion during the growth period (Figure 4), it was found that the infestation of the kids begins to manifest itself shortly before 60 d and shows a trend to increase until reaching significant peaks (P<0.001) between 90 and 120 d (more than 1,800 eggs per gram (EPG). This period coincides with the fall in milk consumption, either due to weaning or a significant reduction in the mother’s production. From that moment (120 to 135 d), the infestation reduces significantly until reaching the lowest levels at 180 d of age with sporadic peaks. Figure 4: Dynamics of parasite egg expulsion in growing Creole kids

ab P<0.10; CV= 20 %.

The increase in infestation in the kids around weaning has been reported by different authors(15-16), who agree that the kids have an immature immune system to which weaning stress is added. When milk consumption reduces or is truncated abruptly, the consumption of grass increases, therefore, the consumption of infective larvae increases. In this period, the active immunity response mechanisms in growing animals begin to be activated(17). As for the reduction of the count from 180 d, the process called “self-cure” occurs in sheep, which is verified around this same period (180 d). This process has immunological bases, and its continuity will be determined by factors that alter the state of general resistance of the host individual(18).

1214

Rev Mex Cienc Pecu 2021;12(4):1208-1220

The monthly dynamics of the expulsion of eggs in the feces (EPG) in the breeding females (Figure 5) showed that the level of infestation tended to increase from October. The peak of infestation occurred in December (1,722 EPG), which denotes a higher level of infestation during the dry months. Figure 5: Monthly dynamics of the count of parasite eggs in feces in Creole breeding female goats

*Transformed means; ab P<0.01; CV= 15 %.

The monthly dynamics of the count of eggs in growing animals (Figure 6) showed the highest levels in December, January and February (P<0.001), which coincides with the dry period and the lowest temperatures. In March and April, the infestation begins to decrease, with a new milder peak in May (beginning of the rainy period). Subsequently, the infestation descends until reaching the lowest levels between July and October. From November (beginning of the dry period), it begins to increase again. Figure 6: Monthly dynamics of egg count in growing Cuban Creole goats

1215

Rev Mex Cienc Pecu 2021;12(4):1208-1220

Bedotti et al(11) explained that, in the dry period, the conditions are less conducive to the development of the exogenous phase of the biological cycle of these parasites, due to the combination of high temperatures and low humidity, lethal for pre-infective larvae. Several studies conducted in tropical conditions on minor species show higher infestations during rain(19). This behavior, in the traditional breeding systems of Creole goats, in Cuba, is reinforced by the absence of food supplementation practices in the dry period. Stocking rates in pasture areas increase depending on food availability(1). Then, there is a drop in the state of resistance of the hosts due to food stress and gastrointestinal strongyloses begin to appear with more intensity. In this case, the parasites find more susceptible hosts that provide them with better conditions for the development of the endogenous phase of their biological cycle. In addition to food stress, the thorough consumption of pastures and favorable levels of humidity create favorable conditions for the herd to consume more infective larvae. Humidity favors the processes of development and migration of parasitic larvae. Figure 7 shows the monthly dynamics of the population of infective larvae in the pasture. The highest infestation levels occurred in the period from July to November. These periods of maximum larval contamination coincide with the rainy season, where climatic conditions favor the development of larvae. Figure 7: Behavior of the monthly dynamics of infective larvae in the pasture in breeding systems of Cuban Creole goats

During the exogenous phase, the conditions of humidity, temperatures and radiation define the success of the development of the larvae. Therefore, seasonal variations in these environmental parameters are generally a determining factor in the epidemiological behavior of gastrointestinal strongyloses. According to Bedotti et al(11), high temperatures in the

1216

Rev Mex Cienc Pecu 2021;12(4):1208-1220

summer period cause mortality of infective larvae, which reduces the population of nematodes. High temperatures, above 35 to 40 °C occur as the second factor of importance with a lethal action on the pre-infesting instars. In the study area, annual maximum temperatures range between 29 and 33 °C, while average minimums range between 17 and 22 °C(20). This temperature range is optimal for larval development in pasture throughout the year. So, the seasonality described in this study is determined by various interactions between the seasonality of rainfall and the physiological states of the hosts. In the Cauto Valley, there are two well-defined climatic periods: 1) the rainy period, from May to October and 2) the dry period, from November to April. Ramírez et al(20) described the variations in biomass production associated with these periods, which explains the larval dynamics of the pasture. However, the dynamics of infestation in the host follow the combination of more complex processes. In breeding females, the effect of food stress, in dry period, is combined with the physiological stress of peripartum. This combination is reflected in the peak of infestation identified in December, where births are concentrated(1) and food stress is exacerbated by the low biomass production that characterizes that month. In the case of growing animals, this peak due to food stress in the dry period is also verified, but, in addition, a less marked peak is observed in May. This behavior in epizootiology of gastrointestinal parasitism is known as “spring rise”. The “spring rise” had already been reported in mountain conditions in eastern Cuba(21). Although it is necessary to continue studying this aspect of the monthly dynamics, it can be said that, in both cases, there are three points of coincidence that help explain the causes of this peak. First, in this period weaning is concentrated, which means many stressed animals. Second, grazing areas are highly contaminated by the concentration of females in the peripartum period that deposit feces with high EPG values. Third, the beginning of the rains facilitates the dilution of the feces and the migratory processes of the infective larvae accumulated in the last month of the dry period.

Conclusions and implications The parasitic dynamics of gastrointestinal strongyloses, which affect Cuban Creole goats, are related to physiological and zootechnical processes that define critical moments in growing animals during the weaning period (2,188 EPG) and for breeding females in peripartum periods (972 EPG). The general infestation of the herds is conditioned by the combination of greater ingestion of infective larvae, food stress processes and predisposing physiological

1217

Rev Mex Cienc Pecu 2021;12(4):1208-1220

states, which condition infestation peaks greater than 1,500 EPG between the months from December to February. The dynamics of pasture infestation are related to rainy seasonality with infestation peaks between the months from July to September with an average maximum of 1,200 larvae per kilo of grass.

Conflicts of interest

The authors declare that they have not received any funds for the conduct of this research. There is also no conflict of interest between the authors and the journal, or any other instance or institution related to this research. This work, due to the type of research carried out, does not have any ethical or bioethical implications. Literature cited: 1. Chacón ME, La O AM, Fonseca FN, Pérez PE, Velázquez RFJ, Cos DY, Fonseca JY, et al. Caracterización genética y conservación de la Cabra Criolla Cubana. En: Biodiversidad caprina iberoamericana. Vargas-Bayona JE. (Comp.). Bogotá: Ed. Universidad Cooperativa de Colombia, 2016:75-86. 2. CENCOP. Centro de Control Pecuario. Registros de razas puras y ferias ganaderas. Ministerio de la Agricultura. Granma. Cuba. 2018. 3. La O AM, Guevara HF, Rodríguez LLA, Pinto RR, Nahed TJ. Ley de CA, Reyes ML. Evolución de los sistemas de crianza de Cabras Criollas Cubanas en el contexto de la conservación del genotipo. Rev Mex Cienc Pecu 2018;9(1):68-85. 4. Rojas N, La O AM, Arece J, Carrión M, Pérez K, San-Martín C, Valerino P, et al. Identificación y caracterización de especies de haemonchus en caprinos del Valle del Cauto en Granma. REDVET. Revista Electrónica de Veterinaria 2012;13(2):1-10. http://www.redalyc.org/articulo.oa?id=63623405003. Consultado: 25 Sep, 2019. 5. Parra RI, Magaña MA, Duarte JH, Téllez G. Caracterización técnica y rentabilidad de granjas ovinas con visión empresarial del departamento del Tolima. Rev Colombiana Cienc Anim 2014;7(1):64-72. 6. Witlock JH. The evaluation of pathological growth and parasitic diseases. Cornell Vet 1955;(45):411–421. 7. Arece J, Rodríguez JG. Dinámica de las larvas infestantes de estrongílidos gastrointestinales en ovinos en pastoreo. Pastos y Forrajes 2010;33(1):1-17.

1218

Rev Mex Cienc Pecu 2021;12(4):1208-1220

8. StatSoft, Inc. STATISTICA (Data Analysis Software System), version 12.0., 2017 www.statsoft.com. 9. Figueroa AA, Pineda RSA, Godínez JF, Vargas ÁD, Rodríguez BE. Parásitos gastrointestinales de ganado bovino y caprino en Quechultenango, Guerrero, México. Agroproductividad 2018;11(6):97-104. 10. Rossanigo C, Page W. Evaluación de FAMACHA en el control de nematodos gastrointestinales en cabras de San Luis (Argentina). RIA. Rev Invest Agropec 2017;43(3):239-246. 11. Bedotti DO, Cristel SL, Lux J M, Hurtado AW, Babinec FJ. Presencia y dinámica parasitaria en dos majadas de Cabras Criollas en el oeste de la Provincia de la Pampa, Argentina. Actas Iberoamericanas de Conservación Animal AICA 2018;12:164-170. 12. da Rosa FR, Leite TE, Mendes ADD. Correlação entre condição corporal e parasitismo de ovelhas no periparto e o desenvolvimento dos cordeiros. Anais do 10 Salão Internacional de Ensino, Pesquisa e Extensão 2018;9(3). https://guri.unipampa.edu.br/uploads/evt/arq_trabalhos/13079/seer_13079.pdf. Consultado: 25 Sep, 2019. 13. Silva JB, Castro GNS, Fonseca AH. Comparação da prevalência de parasitos gastrointestinais em cabras mantidas em manejo orgânico e convencional. Revista de Educação Continuada em Medicina Veterinária e Zootecnia do CRMV-SP 2013;11(1):69-69. 14. Arece J, Rodríguez DJG, López Y. La metodología FAMACHA®: una estrategia para el control de estrongilidos gastrointestinales de ovinos. Estudios preliminares. Rev Salud Anim 2007;29(2):91-94. 15. Suárez VH, Rossanigo CE, Descarga C. Epidemiologia e impacto productivo de nematodos en la Pampa Central de Argentina. Enfermedades parasitarias de importancia clínica y productiva en rumiantes. Fundamentos epidemiológicos para su diagnóstico y control. Eds. Fiel 2013;C:59-88. 16. Arece J. El control integrado del parasitismo gastrointestinal en los rumiantes: la garantía de un rebaño sano. Pastos y Forrajes 2012;23(1): https://payfo.ihatuey.cu/index.php?journal=pasto&page=article&op=view&path%5B %5D=959. Consultado: 25 Sep, 2019. 17. Charlier J, Morgan ER, Rinaldi L, Van Dijk J, Demeler J, Höglund J, Kenyon F. Practices to optimize gastrointestinal nematode control on sheep, goat and cattle farms in Europe using targeted (selective) treatments. Vet Record 2014;175(10):250-255.

1219

Rev Mex Cienc Pecu 2021;12(4):1208-1220

18. Suárez VH, Fondraz M, Viñabal AE, Salatin AO. Validación del método FAMACHA© para detectar anemia en caprinos lecheros en los valles templados del Noroeste Argentino. Rev Med Vet 2014;95(2):4-11. 19. de Macedo FD, Lorenço FJ, Santello GA, Martins EN, de Moraes GV, Mexia AA, Mora NHAP. Parasitose gastrointestinal e valor do hematócrito em fêmeas ovinas alimentadas com diferentes níveis de proteína bruta. Rev Ciênc Agroamb 2016;13(2):65-73. 20. Ramírez JL, Herrera RS, Leonard I, Verdecia D, Álvarez Y. Rendimiento de materia seca y calidad nutritiva del pasto Brachiaria brizantha x Brachairia ruziziensis cv. Mulato en el Valle del Cauto, Cuba. Rev Cubana Cienc Agr 2010;44(1):65-72. 21. La O M, Fonseca N, Costa PJ, Carrión M, Vázquez J, Liranza, E, García, A. Infestación por nematodos gastrointestinales en un sistema de explotación caprina silvopastoril en condiciones de montaña. Pastos y Forrajes 2003;26(1):53-59.

1220

https://doi.org/10.22319/rmcp.v12i4.5699 Review

Caseous lymphadenitis: virulence factors, pathogenesis and vaccines. Review

Maria Carla Rodríguez Domínguez a Roberto Montes de Oca Jiménez a* Jorge Antonio Varela Guerreo a

Universidad Autónoma del Estado de México. Centro de Investigación y Estudios Avanzados en Salud Animal (CIESA). Facultad de Medicina Veterinaria y Zootecnia. km 15.5 Carretera Panamericana Toluca-Atlacomulco, Toluca, Estado de México, México.

* Corresponding author: romojimenez@yahoo.com

Abstract: Caseous lymphadenitis is a disease that affects sheep and goat production worldwide. The etiological agent is a Gram-positive, facultative intracellular bacterium called Corynebacterium pseudotuberculosis biovar ovis. The disease can occur with a cutaneous or visceral development, causing deterioration in the physical condition of the animal, as well as losses in the production of milk and meat, carcass confiscation, skin rejection and consequently, great economic losses. The study of virulence factors and pathogenesis mechanisms have made it possible to understand this disease, as well as to establish the target molecules for the development of new vaccines. There are commercial vaccines available globally; however, the protection conferred by them has not been effective in controlling the disease. Currently, the use of new technologies has allowed the obtaining and characterization of proteins with immunogenic potential for the development of new vaccines, which could be an alternative to increase protection. In the present work, the main factors of virulence of Corynebacterium pseudotuberculosis, their implications in the pathogenesis and the current trends in the vaccine formulations are presented.

1221

Rev Mex Cienc Pecu 2021;12(4):1221-1249

Key words: Caseous lymphadenitis, Corynebacterium pseudotuberculosis, Virulence factors, Pathogenesis, Vaccines.

Received: 01/06/2020 Accepted: 08/01/2021

Introduction Caseous lymphadenitis (CLA) is one of the diseases that most affects sheep and goat production worldwide(1). The etiological agent of the disease, Corynebacterium pseudotuberculosis biovar ovis, causes a chronic infection that is characterized by the formation of abscesses in cutaneous or visceral lymph nodes. This disease causes deterioration in the physical conditions of animals, decreased production of wool(2), meat(3) and milk(4), as well as reproductive disorders(5). In Australia, the analysis of three farms in the Western region, for a total of 600 animals evaluated, allowed establishing that infection by C. pseudotuberculosis caused a decrease in the production of greasy wool by 3.8-4.8 % and clean wool by 4.1-6.6 %. Based on the data obtained, the annual loss in wool production would be around $17 million Australian dollars (AUD)(2). Losses in meat production have been estimated around $12-13 million AUD(6). Other studies indicate that overall losses would be around $30 to 40 million dollars, considering the rejection of meat and carcasses(7). In Canada, it was identified that between 3 and 5 % of meat and 0.02 to 0.03 % of animals are rejected during inspection processes of producing plants(8). These facts have a negative impact on exports, decreasing the possibilities of trading(9). Corynebacterium pseudotuberculosis is a zoonotic microorganism, so it also affects man, with the personnel who work in the production of small ruminants being more vulnerable(10). CLA has been reported in several countries such as China(11), Australia(12), Brazil(13), Canada(14), the United States(8) and Mexico(15,16). The spread of the disease could have been caused by sick sheep exported from Spain to South America and from Australia to North America and the Middle East(17).The disease is poorly reported, according to the results of a survey of 264 veterinarians and 510 farmers in the UK. Only 18 % of veterinarians had seen at least one case of the disease and 45 % of farmers had noticed abscess formation in their sheep. Few producers investigate the cause of abscesses, but of 32 farms that were studied by laboratory diagnosis, 24 were confirmed with the presence of the disease(18).The frequency of the appearance of CLA in each region or country depends mainly on the type of farm, management and control programs. Herds in extensive production, grazing and shearing 1222

Rev Mex Cienc Pecu 2021;12(4):1221-1249

condition the appearance of the disease(19). Antibiotic treatment, surgical interventions and the application of disinfectant solutions to external abscesses(20,21) are not always effective options. The purulent content of abscesses can contaminate soil, food and handling equipment(22,23) and although, in vitro, C. pseudotuberculosis exhibits sensitivity to a wide range of antibiotics(24), in vivo, treatment is difficult due to the intracellular nature of the bacterium(25) and the thick, dry and fibrous content of the abscess(8,9). The World Organisation for Animal Health (OIE) considers CLA within the list of diseases that require the development of effective vaccines to reduce the indiscriminate use of antimicrobials(26). There are commercial vaccines against CLA worldwide; however, the protection conferred by these has not been efficient in controlling the disease(11).Currently, the use of new generation technologies has allowed the development of new experimental vaccines, which could be an alternative to improve protection. The new formulations seek to include molecules, the main virulence factors, that allow the activation of the humoral and cellular immune system(27). This literature review addresses the issues related to the main virulence factors, their relationship in pathogenesis and the strategies used for the development of new vaccine formulations against caseous lymphadenitis.

General characteristics: Corynebacterium pseudotuberculosis The genus Corynebacterium includes numerous species of great importance for the medical, biotechnology and veterinary industries. The PATRIC Database had, in 2017, the report of 466 genomes and 83 species of Corynebacteria(28). Corynebacterium pseudotuberculosis belongs to the family Corynebacteriaceae, genus Corynebacterium. It has a coccobacillary morphology with an amplitude from 0.5 to 0.6 μm and 1.0 to 3.0 μm in length. This microorganism is a non-spore- or capsule-forming, non-flagellated, facultative intracellular pathogen. It has the ability to grow anaerobically, degrades galactose, maltose, L- and Darabinose and glucose without gas production. In simple broth culture medium, growth is scarce without turbidity; however, in Brain-Heart Infusion (BHI) broth, abundant growth with yellowish-white sediment is obtained(1).The cell wall of the bacterium is formed by a layer of peptidoglycan composed of meso-diaminopimelic (meso-DAP) acid, arabinose and galactose as main sugars. In the reactions of the peptidoglycan II biosynthesis pathway; meso-DAP acid is the product of the reaction catalyzed by UDP-N-acetylmuramyl-tripeptide synthetase, an enzyme that has been identified in strains of Corynebacterium(29). Peptidoglycan in turn is covalently bound with arabinogalactans that form a lattice, which is bound to an outer layer of corynomicolic acids (22 to 36 carbon atoms), which bind to trehalose, with the end of the wall most exposed to the outside(30).This lipid structure acts as a barrier, with selective permeability mediated by integral membrane proteins called porins(31). The Phospholipase D (PLD) exotoxin is considered the main virulence factor and

1223

Rev Mex Cienc Pecu 2021;12(4):1221-1249

can be detected by a synergistic hemolysis assay against Rhodococcus equi or by inhibition of the ß-hemolysin of Staphylococcus aureus. Strains of C. pseudotuberculosis are classified into biovar equi for isolates that have nitrate reductase (nitrate-positive) enzymatic activity, and biovar ovis for those strains that do not have such capacity (nitrate-negative)(1). Biovar ovis is the causative agent of CLA disease and has been isolated from sheep(15), goats(16), antelopes(32), cows(33), alpacas(34), llamas(35), ibex(36) and pigs(37). Biovar equi causes the formation of abscesses in muscle tissue of the pectoral area of horses and to a lesser extent internal injuries(38), it has also been isolated from camels(39) and buffaloes(40). C. pseudotuberculosis causes infection in humans, with the existence of cases reported mainly in countries engaged in the farming of small ruminants. Clinical symptoms include axillary, inguinal or cervical adenopathies, fever and myalgia, with chronic or subacute evolution, in some cases it can also generate pneumonia(10).

Virulence factors

Virulence factors are the structures and molecules that give the bacterium the ability to be pathogenic. The acquisition of genes by horizontal transfer has been transcendental in the evolution of the pathogenicity of bacteria; since the functions of the acquired genes have allowed it to adapt to different environmental conditions, including survival in different niches during infection to the hosts. Most of the virulence genes of C. pseudotuberculosis are clustered in the genome in regions called pathogenicity islands (PAIs). In C. pseudotuberculosis, 16 PAIs have been identified, called PiCp, where the presence of a transposase gene in PiCp1 possibly allowed the incorporation of PAIs into the genome(29,41). These regions contain several genes involved in adhesion, invasion, colonization, spread within the host, survival inside infected cells and evasion of the immune system. PiCp sequences have a high level of intra-biovar similarity (82–100 %) in ovis strains, which exhibit from 78 to 91 % similarity with respect to biovar equi. However, biovar equi strains contain large deletions and a lower level of intra-biovar similarity (77–88 %) and also compared to PiCp of biovar ovis (62–74 %)(41).

Corynomicolic acids

Corynomicolic acids are part of the outer layer of the cell wall of the bacterium, which constitutes a protective and permeable barrier. The binding of these to trehalose molecules leads to the formation of curved structures, which blocks the access of molecules (antibiotics 1224

Rev Mex Cienc Pecu 2021;12(4):1221-1249

or lysozymes) to the peptidoglycan, conferring mechanical protection(30,31). Unlike the linear fatty acids of phospholipids, corynomicolic acids are 𝛽-hydroxy-branched fatty acids, which require carboxylation and condensation of two fatty acids for synthesis. The AccD2 and AccD3 enzymes are carboxylases widely conserved in the family Corynebacteriaceae, involved in the generation of intermediates for the synthesis of corynomicolic acids. Other enzymes involved in synthesis are AccD1, for the elongation of the mycolic acid chain, and FadD, an AMP ligase(29). Inoculation of corynomycolic acids in sheep showed that haptoglobin (Hp) increased its concentration three times, as well as twice the levels of serum amyloid A (SAA), proteins that indicate inflammation and acute infections(42). These results indicate their virulent potential, since on their own, they are able to induce reactions of inflammation in the host, which contributes to the formation of granulomas.

Phospholipase D, PLD

The Phospholipase D exotoxin is considered the main virulence factor of C. pseudotuberculosis. The pld gene was identified and sequenced in 1990, is part of the pathogenicity island PiCp1 and encodes a 31.4KDa protein(43). Comparison of the sequence of the PLD protein of C. pseudotuberculosis revealed that it has greater similarity with Phospholipase A2; however, PLD does not belong to the family of phospholipases because it lacks the HKD motif conserved in this family(43). PLD is classified as a Sphingomyelinase D (SMasaD; EC 3.1.4.41), also known as sphingomyelin phosphodiesterases D or phospholipase D (PLD), which catalyzes the hydrolytic cleavage of sphingomyelin to produce choline and ceramide 1-phosphate or choline and lysophosphatidic acid (LPA)(44). Compounds derived from sphingomyelin degradation cause platelet aggregation, endothelial hyperpermeability, and pro-inflammatory responses(45). The enzymatic action of PLD hydrolyzes sphingomyelin, the main component of cell membranes, which leads to an alteration of the morphology of the target membrane. PLD contributes to the spread and persistence of the bacterium inside macrophages(46). The pld gene presents a widely conserved sequence in the strains of C. pseudotuberculosis, and when this is modified, the ability to produce the disease is hindered(41).

Endoglycosidase, CP40

The CP40 protein is encoded by a gene with an open reading frame of 1,137 bp, which is located downstream of the pld gene in PiCp1. It was described as an enzyme with serine protease activity(47), but in another study, the analysis of the sequence allowed its grouping 1225

Rev Mex Cienc Pecu 2021;12(4):1221-1249

closer next to endoglycosidases and further away from serine protease sequences(48). In this work, it was proposed that its enzymatic activity is endoglycosidase, mediator of the hydrolysis of glycosidic bonds, proteins of the GH18 family, similar to the EndoE domain belonging to Enterococcus faecalis. GH18 enzymes contain a conserved consensus sequence motif (LIVMFY) - (DN) -G- (LIVMF) - (DN) - (LIVMF) - (DN) -X-E, where terminal glutamic acid is essential for enzymatic activity. By aligning the GH18 active site in CP40, its similarity to the EndoE and EndoS enzymes was established, only with changes in one or two amino acids respectively. The function as a virulence factor has been associated with the demonstrated ability in vitro to degrade the Fc region of IgG antibodies. CP40 endoglycosidase does not hydrolyze glycans in bovine and caprine IgG, while sheep IgG is partially hydrolyzed and equine IgG completely. The analysis was also performed with subclasses of human IgG, presenting activity in all and partially in IgG4. There was no detectable enzymatic activity in other glycoproteins, including some of the other immunoglobulin isotypes (IgA, IgD, and IgE)(48).

Secreted proteins PLD and CP40

According to various reports, proteins exported or secreted by bacteria are actively involved in the infection process(49). For this reason, the expression and secretion of the PLD and CP40 proteins have been highly studied. The development of an experimental infection showed by immunoblot that the production of antibodies was directed 88 % to the recognition of proteins of 30-31Kda (PLD) and in 75 to 88 % towards proteins of 38-41KDa (CP40), range in which are both proteins(50). The attenuated strain 1002, after several passes in a mouse model, was able to reverse the virulence. The analysis by mass spectrometry allowed the identification of the PLD and CP40 proteins only in the reactivated strain 1002, which indicates the participation of these proteins in the virulence(51). On the other hand, through real-time PCR, the expression of several genes involved in virulence was identified in vitro and in vivo, including pld and cp40. This analysis made it possible to verify that, in the strains isolated from lymph nodes, the expression of these genes was higher compared to the strains obtained from in vitro cultures(52).

Virulence factors involved in iron acquisition

In PiCp1 is the operon (fag ABCD)(29), composed of four genes, fagA, fagB, fagC, fagD, that are located downstream of the pld gene. These genes respectively encode an integral membrane protein, an iron-transporting enterobactin, an ATP-binding cytoplasmic 1226

Rev Mex Cienc Pecu 2021;12(4):1221-1249

membrane protein, and an iron-binding siderophore protein. FagA was identified as a membrane-associated protein with pathogenic potentialities, by mass spectrometry analysis of proteins expressed in a strain of C. pseudotuberculosis grown with animal serum(53). The culture of C. pseudotuberculosis in media with iron chelators (dipyridyl) caused the decrease in a logarithm order in the count of colony-forming units (CFUs), compared to bacteria grown in iron-enriched media. The evaluation of the transcriptional response of C. pseudotuberculosis, with iron restriction, allowed identifying the negative regulation of genes involved in the energy metabolism of the Krebs cycle (sdhC, sdhB, lpd), ATP production (atpF, atpH), pyruvate metabolism (lpd), oxidative phosphorylation (qcrC, qcrA, qcrB, ctaC, ctaF, ctaE, ctaD), ribosome processes, transport (rplJ, rplL, rplM, rpmA, rpsC, rpsI, rpsL, rpsM) and EF-G and EF-Ts elongation factors associated with the translation of mRNA (fusA, tsf). The gene analogous to dtxR of C. diphteriae was identified, with 79 % similarity in sequence, which encodes an iron-binding dependent protein, which acts as a regulatory factor for more than 40 genes(54). In PiCp3 and PiCp4, the genes belonging to the operon ciuABCDE involved in iron absorption, transport and biosynthesis of siderophores have been studied(29).

TetA Protein

In PiCp2, the tetA gene encodes a tetracycline efflux transporter protein that protects against the action of this antibiotic and confers resistance to the bacterium. The tetA gene is often carried by transmissible elements such as plasmids, transposons and integrons and has been identified in C. pseudotuberculosis(29).

Virulence factors for macrophage infection

On the pathogenicity island PiCp2 are the potG, sigK and dipZ genes, which respond to the mechanisms responsible for the intramacrophagic lifestyle of C. pseudotuberculosis. The potG gene encodes an ATP-binding membrane protein that provides energy for absorption of putrescine (polyamine) from the periplasmic space, it functions as a putrescine transporter system(29). Putrescines are polyamides produced by macrophages that induce decreased production of reactive nitrogen species and synthesis of pro-inflammatory cytokines. The dipZ gene has been identified in the phylum Actinobacteria, is regulated by sigK(55) and is activated during macrophage infection by Mycobacterium tuberculosis. In PiCp4, the presence of the gene that encodes the Sigma factor confers the ability to protect against oxidative stress, specifically against the action of nitrogen intermediate products, produced 1227

Rev Mex Cienc Pecu 2021;12(4):1221-1249

by macrophages(56). The FCR41 strain of C. pseudotuberculosis was used in the study of genes related to pili synthesis. The structure of the pili is composed of the major pili SpaA and SpaD; the minor pili SpaB and SpaE; and the pili type, SpaC, SpaF. A complete pili structure or even the minor pili can make initial contact with host cell receptors to facilitate the entry of microorganisms. In this strain, the spaC gene was identified, which encodes a protein responsible for anchoring the pili to the cell wall, which can allow initial contact with the cell receptors, to then facilitate intracellular invasion. It also presented the namH gene, which encodes an extracellular neuraminidase, which catalyzes the elimination of sialic acid groups present in a wide variety of glycoconjugates of the extracellular matrix of the host cell, which favors adherence to cells. In FCR41, the sodC gene was detected, which encodes a superoxide dismutase, an enzyme anchored to the membrane with extracellular domain, which eliminates oxygen free radicals, products of respiratory burst in macrophages(57).

Resistance and adaptation virulence factors

Chaperone proteins (HSPs) are highly conserved and are expressed under heat stress, as well as nutrient reduction, hypotaxia, breakdown of metabolism and other cellular processes. In C. pseudotuberculosis, Hsp10 (groES) and Hsp60 (groEL)(58) have been studied. In strain 1002, resistance to various types of abiotic stress, such as acidity, high temperatures and osmotic stress, associated with the presence of these proteins, was evaluated(59). The hspR gene encodes the regulatory factor of the expression (repressor protein) of the operon with the genes dnaK, grpE, dnaJ and hspR, which encode heat shock proteins. In the absence of stress, the HspR protein attaches to an inverted repeat sequence that represses the promoters responsible for controlling the expression of the Hsp operon. In another study, the separation of proteins by two-dimensional electrophoresis allowed the identification of 11 new extracellular proteins, 3 with unknown functions and 8 related to the elongation factor Tu, GroEL (HSP60), enolase, glyceraldehyde-3-phosphate dehydrogenase and superoxide dismutase (SodA), which depend on a non-classical secretion method via SecA. Both SecA genes (SecA1 and SecA2) were identified in the strains studied, possibly involved in the secretion system of C. pseudotuberculosis(60). The study of the virulence factors of C. pseudotuberculosis as candidate molecules for the development of more powerful and effective vaccines is still being continued.

1228

Rev Mex Cienc Pecu 2021;12(4):1221-1249

Pathogenesis and immune system evasion mechanisms

The cutaneous manifestation of CLA is characterized by the formation of abscesses in subcutaneous lymph nodes, which are visible and palpable through the skin and their location depends on the point of entry of the microorganism. Lesions can appear as organized abscesses, with inflammation, fibrous encapsulation, overlapping hair loss and eventual rupture, resulting in the discharge of purulent content. In the visceral form, abscesses occur in the internal lymph nodes, as well as in the lungs, liver and kidneys, causing deterioration in the organic condition of the animal towards the development of a chronic course(61). In atypical forms of the disease, macroscopic lesions do not correspond to caseous nodes, with neonatal toxemia or icterohemoglobinuria of newborns, arthrosynovitis, endometritis, mastitis and orchitis being described(62). The infection begins with the entry of the bacterium through skin lesions generated during the handling of sheep, such as tail cuttings, ear marking, castration, shearing or in some cases, lesions generated during feeding with spiny fodder that damage the oral mucosa. Sanitary baths also contribute to infection, favoring the entry of the microorganism through small wounds of the skin(1). Primary infection occurs at the site of entry of the bacterium, with hematogenous and lymphatic spread forming abscesses in the lymph nodes closest to the site of infection (parotid, submandibular, prefemoral, prescapular, popliteal or mammary). Then a secondary infection occurs with the formation of abscesses in lymph nodes (thoracic, bronchial and mediastinal) and various organs(63,64). In sheep, the morphological appearance of the abscessed nodes is the characteristic of an onion layer as they present a distribution in fibrous concentric layers separated by caseous material. In goats, the affected nodes usually form a dry uniform purulent paste. This difference could be due to the nature of phagocytic enzymes, being of greater lytic activity in goats than in sheep(8,9). The mechanisms involved in the adherence and intracellular survival of C. pseudotuberculosis in non-phagocytic cells are still being studied by various researchers. In in vitro studies, C. pseudotuberculosis was able to adhere to and invade the FLK-BLV-044 fibroblast line of sheep kidney embryonic cells, with cell replication for 24 h and bacterial viability of 120 h, with a positive correlation between the rate of adhesion and invasion(65). These results suggest that the establishment of infection, as well as persistence, may be favored by intracellular infection in tissue of the site of entry of the microorganism and not only by infection of phagocytic cells. C. pseudotuberculosis is phagocytosed by macrophages that are recruited to the site of infection, and it has been shown that they have the ability to remain viable within these for up to 72 h, evading the mechanisms of elimination of pathogens presented by macrophages(66). Macrophages infected with C. pseudotuberculosis activate the production of reactive oxygen intermediate (ROI) compounds, which cause 1229

Rev Mex Cienc Pecu 2021;12(4):1221-1249

damage at the DNA level. The binding of bacteria to the receptors of the macrophage phagosome membrane causes the so-called respiratory burst that favors the production of NADH. Before the lysosome fuses with the phagosome, in the latter, a reduction of molecular oxygen (O2) catalyzed by NADPH-oxidase present in the phagosome membrane occurs. The resulting superoxide anion (O-2) is toxic to the bacterium, but in turn gives rise to other shortlived toxic radicals, such as hydrogen peroxide (H2O2), hydroxyl radical (OH), and singlet oxygen (O12). When the lysosome fuses with the phagosome, the myeloperoxidase enzyme is released, which acts on peroxides in the presence of halides (I- and Cl-), to produce highly toxic and long-lived halogenated compounds (hypohalides): hypochlorous acid (ClOH) and hypoiodous acid (66). However, C. pseudotuberculosis has developed resistance mechanisms to protect against O2-free radicals. Superoxide dismutases (SODs) constitute a family of three metalloenzymes (FeSOD, MnSOD and CuZnSOD) with different intracellular localization and distribution, which catalyze the conversion of superoxide radicals into H2O and O2. The presence of Mn/FeSODs in C. pseudotuberculosis has been verified and the phylogenetic analysis allowed establishing the evolutionary differences and similarities of the sequences of this enzyme in hosts of the sheep, goat, bovine, equine and human species, as well as with different species of Corynebacterium. This would explain the ability of the same strain of C. pseudotuberculosis biovar ovis to remain in macrophages of different types of hosts(67). C. pseudotuberculosis presents the catalase enzyme(1) that provides protection against the action of H2O2, since they decompose it into H2O and O2. Also, the intermediate products of the enzyme during the dismutation reaction can bind to NADPH oxidase, which functions as a regulator of enzymatic activity and decreases the formation of other oxidative stress products such as hydroxyl radical and singlet oxygen (O12). Also, in macrophages, reactive nitrogen products (RNI) act as another mechanism of elimination of pathogens. The in vitro study of sigma factor mutant strains of C. pseudotuberculosis, they were more susceptible to concentrations of nitric oxide, so it is proposed that its presence protects against this type of oxidative stress(56). The presence of corynomicolic acids gives C. pseudotuberculosis mechanical and possibly biochemical protection, allowing it to resist digestion by hydrolytic enzymes present in lysosomes and the action of antimicrobial proteins(66). Inoculation of corynomycolic acid extracts, in female goats, caused hemorrhage, congestion, degeneration, necrosis, edema and leukocytic infiltrations in reproductive organs and associated lymph nodes, as well as increased the concentration of estrogenic hormones(62). They have also been associated with decreased testosterone and loss of semen quality, with increased production of pro-inflammatory cytokines(5). PLD exotoxin catalyzes the dissociation of sphingomyelin, an important component of cell membranes, whose hydrolysis causes cell lysis, increasing vascular permeability, with the consequent formation of edema(1). PLD acts directly on endothelial

1230

Rev Mex Cienc Pecu 2021;12(4):1221-1249

cells around the point of infection and on macrophages once the bacterium has been phagocytosed. The action of this toxin facilitates colonization, regional and systemic spread of the bacterium, with the generation of abscesses in the lymph nodes(66). Bacteria not controlled by the abscess wall enter the capillaries and form colonies that occlude the blood vessels, generating ischemia that, together with toxins, destroy the cells of healthy tissue, increasing the necrotic mass. Viable bacteria spread through the lymphatic vessels and penetrate other lymph nodes and blood vessels, reaching different organs where abscess formation is repeated. This behavior originates the clinical manifestations of the visceral type of the disease, which affects internal lymph nodes and organs, especially lungs and liver (61,64). C. pseudotuberculosis is released from inside the cells as a result of a process that leads to the death of phagocytes. Although the specific mechanisms are not yet clear, it is proposed that cell death of macrophages is not induced by autophagy or apoptosis. Studies carried out in vitro by infection of the macrophage line J774 with C. pseudotuberculosis, allowed determining that the levels of protein I associated with light chain 3 microtubules (autophagy mechanism) and the activity of caspase-3 (apoptosis mechanism) remained stable without variation in infected cells(25). In other studies, necrosis has been favored instead of apoptosis, in macrophages infected with C. pseudotuberculosis, causing degenerative changes such as the rupture of the plasma membrane, alterations in the mitochondria, changes in the nuclear envelope, dilation of the nuclear envelope and membrane of the rough endoplasmic reticulum and formation of vesicles in the cytoplasm(68,69). Another characteristic of the disease is the formation of pyogranulomas, as a result of uncontrolled bacterial growth within macrophages, the host tries to restrict and limit infection through the formation of these structures. Immunohistochemical studies on the cellular composition of lung lesions in sheep infected with C. pseudotuberculosis have revealed a predominance of large macrophages in the walls of the abscess and surrounding the pulmonary parenchyma, with expression of molecules of the major histocompatibility complex (MHC) class II. T lymphocytes were prominent in the lesions, while B lymphocytes and granulocytes comprised a smaller portion in the cell infiltrates. Within the encapsulated lesions, lymphocytes and MHC class II cells were found in the center of the necrotic mass. Surrounding this region, CD5+ cells, as well as CD4+ and CD8+ cells distributed through the lymphatic tissue, were identified. Generally, in immature caseous lesions, CD4+ lymphocytes are found and in more developed lesions, the concentration of CD8+ cells is predominant, which is related to the mechanism of the immune system to combat the spread of infected macrophages(70,71).

1231

Rev Mex Cienc Pecu 2021;12(4):1221-1249

In goats, the histopathological changes observed in the reproductive tract and lymph nodes after experimental inoculation with C. pseudotuberculosis revealed leukocytic infiltration, as well as generalized congestion, degeneration, infiltration of stromal cells and necrosis in the ovaries(71). The study of the response of the immune system in an experimental model allowed establishing that the humoral response begins between day 6 and 11 post-infection. From day 5 of infection, the expression of IFN-γ with values from 0.5 to 1.0 (DO450) occurs, followed by a second production from day 16 post-infection with maximums from 2.5 to 3.0, high values that keep until day 42-56 of the infection, where the response begins to decline. Primary production of IFN-γ has been associated with the innate response that involves NK cells, while the secondary response of longest duration is associated with the acquired immune response with the involvement of T cells(70). The production of pro-inflammatory cytokines TNF-α and IL6 occurs at the inoculation site, while IFN-γ is found in drained lymph nodes(72).

Commercial vaccines

Most commercial vaccines available for CLA are composed of polyvalent formulations, presenting a combination of antigens of several pathogenic agent including the PLD exotoxin, considered the antigen with the highest immunogenic capacity for C. pseudotuberculosis(11,27). They have been employed for several decades, however, they are not yet available in all small ruminant producing countries, including Mexico. The Glanvac 3 vaccine (Zoetis, London)(73) combines toxins of Clostridium perfringens Type D, Clostridium tetani and C. pseudotuberculosis and evaluated in sheep from the United Kingdom, it reported that only 20.8 % of the total of six animals vaccinated and challenged with a virulent strain presented lesions from which the bacterium was isolated. The Glanvac 6 vaccine (Zoetis, West Ryde, Australia) has a multicomponent formulation that includes toxins of C. pseudotuberculosis, Clostridium perfringens type D, Clostridium tetani, Clostridium novy type B, Clostridium septicum and Clostridium chauvoei. This vaccine reduces the clinical manifestations of the disease and the development of lung lesions(8,13). In Australia, it is administered to both sheep and goats, and several field assays have shown variable protection rates, with values ranging from 25 to 90 % of the total herd. In 1995, the average prevalence of CLA in adult sheep in vaccinated herds was 97 % in New South Wales, 91 % in Victoria and 88 % in Western Australia. By 2003, the estimated average prevalence of CLA in the adult sheep population had declined to 29 % in New South Wales, 26 % in Victoria and 20 % in Western Australia; and from 26 % overall to 5.9 % in 2009. In addition, the study allowed establishing that only 43 % of producers used the vaccine and of these, only 12 % adequately followed the manufacturer’s instructions(6,12). However, these vaccines 1232

Rev Mex Cienc Pecu 2021;12(4):1221-1249

of the Glanvac series do not prevent infection and present adverse reactions with the formation of cutaneous granulomas at the injection site, both in sheep and goats, with anaphylactic shock in the latter(7,8). In Canada in 1998, an evaluation of the efficacy of Glanvac 6 was carried out compared to the commercial Case-Bac vaccine (Colorado Serum, USA), and an experimental vaccine composed of muramyl dipeptide. The Glanvac 6 vaccine and the experimental vaccine had a higher antibody titer than Case-Bac for 6 to 12 months; however, Glanvac 6 caused a high number of allergy manifestations at the inoculation site(74). The Caseous D-T vaccine (Colorado Serum, USA) composed of toxins of Clostridium perfringens type D, Clostridium tetani and inactivated whole cultures of C. pseudotuberculosis in combination with PLD has been used in the United States, demonstrating that it helps to decrease the presence of internal and external abscesses, although with side effects such as mild lameness (pain) in lambs and lethargy in a high percentage of mature animals. On the other hand, the Case-Bac vaccine (Colorado Serum, USA), composed of PLD toxin, has been used mainly in sheep. This vaccine also causes adverse reactions at the inoculation site, lethargy, stiffness and fever, these symptoms being more severe in goats, including manifestations of ventral edema, ataxia and seizures, which leads to this prophylactic not being approved for use in this species. The use of this vaccine in sheep reduced the formation of abscesses, where only 10 of a total of 18 animals presented external abscesses compared to the control group where all developed these lesions. Moreover, only 2 of the 18 vaccinated sheep had internal abscesses, while 9 out of 10 control sheep had internal abscesses(8,9). In Spain, the company Zoetis sells the Biodectin™ vaccine, which is composed of six antigenic fractions: Clostridium septicum, Clostridium novyi Type B, Clostridium tetani, Clostridium perfringens Type D, C. pseudotuberculosis and Clostridium chauvoei, aluminum hydroxide, Thiomersal and Moxidectin (compound with antiparasitic activity)(75). There are also commercial vaccines made from live attenuated strains, such as LinfoVac (Laboratorios Vencofarma do Brasil), developed by the Company Baiana de Desarrollo Agrícola (www.ebda.ba.gov.br) in collaboration with the Institute of Health Sciences of the Federal University of Bahia, which contains the live attenuated strain 1002 of C. pseudotuberculosis and its use is authorized in Brazil. Experimental studies in a mouse model indicated that the protection conferred by this vaccine is 80 %(10). The protection provided by commercial vaccines is associated with the production of antiexotoxin PLD antibodies, which protect against tissue damage and the spread of the microorganism. However, they confer partial protection, since these vaccines do not favor the activation of the cellular immune response, mainly cytotoxic T-type necessary to eliminate intracellular bacteria. For this reason, different groups of researchers have worked on the development of experimental vaccines to improve protection.

1233

Rev Mex Cienc Pecu 2021;12(4):1221-1249

Experimental vaccines Inactivated vaccines and toxoids

Inactivated vaccines are composed of non-viable whole cultures of the bacterium or inactivated toxins, either by chemical or physical methods. In these formulations, the microorganism is dead, so they do not confer danger of development of the disease; however, the response is mainly humoral, less intense, requires high concentrations of the microorganism and several doses. They are not subjected to any purification procedure, so they contain all the biochemical components of the bacterium, which are more reactogenous and can produce adverse effects. The protein precipitate of a strain of C. pseudotuberculosis isolated from alpaca in Peru was evaluated in a group of 20 BALB/c mice, where it induced protection from challenge with 104 CFUs of a virulent strain of C. pseudotuberculosis. The vaccine reduced the toxic effects caused by the bacterium, which was observed with the decrease in the number and size of abscesses in the animals of the vaccinated group (40 % affected) compared to the multiple abscesses of greater size at the subcutaneous level and in kidney and liver in the animals of the control group (95 % affected)(76). Vaccine formulations based on 250 - 500 mg/ml of cell wall and 133-265 mg/ml of PLD toxin, all supplemented with 20 mg/ml of muramyl dipeptide as an adjuvant, were evaluated in alpacas, subjected to the challenge with 106 CFUs of a virulent strain of C. pseudotuberculosis. The animals vaccinated with the highest dose of PLD did not show abscesses, unlike the vaccinated group with the lowest concentration, where the formation of abscesses at the inoculation site and in renal lymph nodes was observed. Formulations that included cell wall showed a lower degree of protection, with the formation of superficial and internal abscesses. The results suggest that the concentration of PLD toxin may influence the protective capacity, being dose dependent on the immunization of alpacas(77). The degree of protection conferred by vaccination with PLD toxin adsorbed in aluminum hydroxide gel (Group 1) or its combination with toxins of Clostridium perfringens D, Clostridium novyi B, Clostridium tetani, Clostridium septicum and Clostridium chauvoei (Group 2), as well as toxins of Clostridium spp., PLD and 1.2 mg/ml of sodium selenate (Group 3); it was evaluated in an ovine model, challenged with 1.3 x 108 CFU of a virulent strain of C. pseudotuberculosis. The percentage of affected animals in group 1 was 10.5 % (4 of 38 animals showed a superficial lesion), for group 2 7.9 % (3 of 38 animals showed a superficial lesion) and 8.3 % in group 3 (2 of 24 animals, each with a superficial lesion and at the lung level), in contrast to the results obtained in the control group of unvaccinated animals with an impact of 51.5 % (17/33), with 60 lesions at the lung level and 16 in

1234

Rev Mex Cienc Pecu 2021;12(4):1221-1249

carcasses, with 4.5 lesions per animal. The results indicated that there was no reduction of protective potency as a result of the combination of PLD with Clostridium antigens(78). The efficacy of four non-commercial vaccines based on PLD as an antigen was evaluated in sheep challenged with a virulent strain. The levels of superoxide ions were determined as a non-specific immune response, these being elevated in the group vaccinated with PLD + inactivated bacterium, followed by the group vaccinated with PLD Toxoid. Lysozyme activity was higher in the group vaccinated with PLD + inactivated bacterium, followed by PLD Toxoid, PLD + commercial Covexin8 vaccine and a local experimental vaccine. The group vaccinated only with PLD showed a marked positive response of lymphocyte proliferation compared to the rest of the groups. The results indicated that PLD stimulated the specific and non-specific cellular immune response(79). Four different antigenic extracts obtained from the attenuated strain T1 were evaluated in goats of Canindé breed, for the study of the humoral and cellular immune response. Animals in group 1 (immunized with 0.5ml of the culture supernatant of the T1 strain in 1:1 ratio with Freund’s incomplete adjuvant, FIA) and group 3 (immunized with 100 mg of extracellular concentrate, 250 mg of CpG oligodeoxynucleotides and 0.5 ml of adjuvant FIA) showed the highest levels of antibodies and IFN-ɣ after immunization, as well as post-challenge with 105 CFUs of the virulent strain VD57, compared to groups 2 (1ml of suspension of 2 x 106 CFU/ml strain T1), group 4 (formulation of group 3 without FIA) and control group. Only 25 % of the animals in group 1, 33.3 % in group 2 and 22.2 % in group 3 did not develop lesions, in group 4 and 5, 100 % of the animals developed some type of lesion(80). These results show that the production of specific anti-PLD antibodies only decreases the spread of the bacterium and the appearance of lesions in tissues other than the inoculation site, not controlling the infection. Bacterin or toxoid vaccines contribute to reducing the clinical manifestations of the disease, being more efficient in sheep than goats, although in neither species is it possible to control the infection, leaving a percentage of affected animals that can spread the disease.

Attenuated vaccines

Attenuated vaccines have live immunizing agents that can replicate in the body without causing disease, since they lack certain structures or molecules that decrease their virulence. In principle, they confer a very intense and long-lasting immune response, since they give rise to an infection similar to the natural one, but they constitute a risk, since in some cases the virulence can be reversed. The first experimental attenuated vaccines for CLA used a strain called Toxminus, whose pld gene was modified by site-specific mutation. The

1235

Rev Mex Cienc Pecu 2021;12(4):1221-1249

necropsy of the animals vaccinated with 105 to 107 CFUs of the attenuated strain Toxminus allowed observing that no abscesses formed in the animals challenged with 106 CFUs of a virulent strain, compared to the control group where abscesses of 2.5 cm developed in popliteal ganglia. However, the vaccine produced an undesirable abscess at the inoculation site, the antibody titer in the groups vaccinated with 105 to 107 CFUs was similar, so the response was non-dose dependent and the virulent challenge strain induced a superior antibody response at weeks 5 and 9. There was also a reduction in the ability of the Toxminus strain to remain in the host, due to the absence of PLD, an antigen that favors persistence, in addition to highly activating the humoral immune response(81). In another study, the Toxminus strain was transformed with a plasmid containing the pld gene modified to obtain the exotoxin with a change of histidine for a tryptophan at position 20, which eliminates enzymatic activity. Immunization with the orally administered Toxminus strain induced a predominant humoral response of IgG1 type, while IgG2 isotype levels were higher in subcutaneously vaccinated sheep. Th1 cells are responsible for cellmediated cellular immunity, they produce IFN-ɣ, IL-2, and tumor necrosis factor beta (TNFβ), cytokines that activate macrophages and complement the activation of B lymphocytes to produce antibodies of the IgG2 isotype. On the other hand, Th2 clones secrete IL-4 and preferably induce the production of IgG1, IgA and IgE in B cells. Consequently, with the results obtained, the orally vaccinated animals did not present significant levels of protection, because the increase in IgG1 is indicative of the absence of a Th1 response, which is essential for the activation of cytotoxic T cells, essential for the elimination of intracellular pathogens, such as C. pseudotuberculosis. The incidence and degree of abscess formation were very low (abscesses of 0.2 cm and 1 cm), occurring only in two animals at the site of inoculation of the virulent strain for the challenge. In the group of animals vaccinated with the non-modified Toxminus strain, 50 % of the sheep developed abscesses, as well as 66 % of animals in the unvaccinated control group. The Toxminus strain did not allow for elevated PLD expression and evidence of the excretion of the live attenuated bacterium through feces was found(82). The CZ171053 strain mutated in the ciuA gene, by means of the transposon-TnFuZ system, presented a reduced ability to survive in vitro within the macrophages of the J774 cell line. The immunization of BALB/c mice with this attenuated strain allowed the survival of 80 % of the animals challenged with 106 CFUs of the virulent strain MIC-6. These results suggest that the CZ171053 strain could be evaluated as a live attenuated vaccine in the target hosts of the disease. The behavior of the humoral and cellular immune response was evaluated in BALB/c mice inoculated with 107 CFUs of the attenuated strain T1. An increase in the titer of of IgG1 and IgG2 was observed, no lesions characteristic of the disease were shown and the culture of spleen cells, stimulated in vitro with antigens secreted by T1, presented a greater proliferation compared to cells stimulated with intracellular antigens(83). 1236

Rev Mex Cienc Pecu 2021;12(4):1221-1249

DNA vaccines

Advances in molecular biology techniques have allowed the development of new generation vaccines, among which are naked DNA vaccines. These vaccines are only DNA (plasmids with the genes of interest), they do not have envelopes or protein structures, so the route of administration, the dose, and re-immunization are very important, since they are factors that influence the potency and type of immune response. The disadvantage of this type of vaccine lies in the ability to express the antigen of interest, since in most cases, the particles have a low adsorption and the quantity of plasmids that are introduced into the cells is limited. The design of a plasmid carrying the gene encoding the extracellular domain of bovine CTLA-4 fused to the inactivated pld gene (boCTLA-4-HIg-ΔPLD) was evaluated as a naked DNA vaccine in sheep. CTLA-4 binds with high affinity to B7 membrane antigen in antigenpresenting cells (APCs), improving the humoral immune response. Although the antibody titer increased significantly, the protection of immunized sheep was partial against the experimental challenge with a virulent strain(84). Different immunization routes were evaluated: intramuscular, subcutaneous and gene gun bombardment. The maximum levels of total IgG antibodies were 12x103 in the group vaccinated intramuscularly, while in the groups with the other routes of administration, values of 3-4 x 103 were reached. The protection conferred by the intramuscular vaccine was 45 % (9 of 20 animals), compared to the rest of the groups (subcutaneously and with gene gun) that only protected 10 % of the animals(85). The potential of a DNA vaccine formulated based on the pTARGET plasmid transformed with the protein esterase cp09720(86) was compared with a subunit vaccine with recombinant CP09720 adjuvated with aluminum hydroxide. Both were evaluated in BALB/c mice, with the recombinant protein vaccine being the one that induced the highest titer of IgG1 and IgG2 antibodies. The two vaccines were able to increase IFN-γ expression, although the subunit vaccine presented the highest levels of IFN-γ mRNA. Protection levels against the challenge were 58.3 % in animals vaccinated with recombinant esterase, while the pTARGET DNA/protein esterase cp09720 vaccine only protected 16.6 %.

Recombinant protein subunit vaccines

Subunit vaccines combine antigens such as lipopolysaccharides, recombinant proteins, or synthetic peptides. These vaccines are very safe, but not very immunogenic, so adjuvant substances that enhance the response of the immune system are used. The PLD protein obtained by recombinant route has been one of the most used for the development of subunit 1237

Rev Mex Cienc Pecu 2021;12(4):1221-1249

vaccines. A group of researchers from the United Kingdom determined the potentialities of a vaccine from 50 μg of PLD obtained recombinantly (PLDr) in E. coli and its combination with 1.25×1010 cells/ml of whole cultures of C. pseudotuberculosis inactivated with formalin. In this work, the control group was vaccinated with the commercial Glanvac 3 vaccine (Commonwealth Serum Laboratories (CSL) Ltd., Victoria, Australia). The highest levels of antibodies were detected in the groups immunized with the PLDr vaccine and the vaccine of PLDr + inactivated whole cells, compared to the control groups(73). The PLDr protein together with whole cultures of C. pseudotuberculosis biovar ovis and equi, inactivated with formalin were used for the immunization of sheep. The detection of antiPLD antibody levels by ELISA allowed detecting that the vaccinated animals presented an increase in IgG after the second booster dose, but after the challenge, there was a decrease in the OD from 0.65 to 0.55, although the levels remained above the cut-off value for 20 weeks. No lesions were observed in external and internal lymph nodes, compared to the unvaccinated control group where 80 % of the animals presented lesions and manifestations of the disease. Both vaccines were able to protect the animals from the challenge with a virulent strain. In this work for the first time, sheep are immunized with a biovar equi strain in combination with PLDr(87). Different recombinant proteins rCP09720 (esterase), rCP01850 (L14 protein binding to the 50S rRNA subunit) and PLD (rPLD) have also been evaluated in the immunization of BALB/c mice. In this study, survival rates after challenge with a virulent strain were 30 % (rPLD), 40 % (rPLD + rCP09720) and 50 % (rPLD + rCP01850). The vaccine rPLD + rCP01850 was able to induce a cellular immune response, significantly increasing levels of IFN-γ and TNF-α, while IL4 and IL12 production was not detected(88). A live attenuated strain of Mycobacterium bovis BCG (Bacillus-Calmette-Guerin) was also used for the expression of recombinant PLD in the pUS2000 plasmid. The system was not efficient for elevated expression of the PLD protein but was effective for vaccination and protection in a mouse model. Immunization of BALB/c mice with 106 CFUs of M. bovis pUS2000/PLD for PLD expression, as well as with M. bovis pUS2000/PLD + 50μg of purified PLDr and the unmodified M. bovis strain, induced elevated antibody production compared to the negative control (100 μl of NaCl 0.9 %), but without significant differences between the vaccinated groups. This is because the M. bovis strain alone is able to induce an elevated humoral and cellular immune response. However, faced with the challenge with 2 x 104 CFUs of the virulent strain MIC-6, the group vaccinated with M. bovis pUS2000/PLD experienced a significant increase in IgG levels compared to the rest of the groups. The cellular immune response was evaluated by measuring the production levels of IFN-γ and IL-10 in the spleen cell culture supernatants of the vaccinated animals, after being stimulated with 8 μg/ml of PLDr. The levels of IFN-γ and IL-10 were higher in the cell culture of the group that received a reactivation of the vaccination with 50 μg of PLDr. The level of 1238

Rev Mex Cienc Pecu 2021;12(4):1221-1249

protection conferred by these formulations was 88 % in animals vaccinated with M bovis pUS2000/PLD+ 50 μg of PLDr, 77 % for group M. bovis pUS2000/PLD and 66 % for the non-modified M. bovis group. The protective immune response generated by this whole cell vaccine of M. bovis BCG modified to express PLD could cause the activation of several populations of T cells due to the variety of antigens (lipids, proteins and carbohydrates) of the formulation. Then re-immunization with 50 μg of PLD obtained recombinantly stimulates increased proliferation of T cells specific to this particular antigen(89). Subunit vaccines have also been developed using the recombinant CP40 protein. The preparation of PLD vaccines from C. pseudotuberculosis culture supernatants usually contain other antigens which could be contributing to the protective immune response. The CP40 protein was identified in inactivated vaccine preparations through immunoblot assays, where it was observed that sera from animals vaccinated with Glanvac 6 could intermittently recognize this protein, suggesting that it was present in some vaccine batches(82). In an experimental study in sheep, immunization with 100 μg of recombinant CP40 protected 82 % of the animals, with a decrease in lung lesions by 98 %. No relationship was found between decreased development of lung lesions and antibody titer, so it was assumed that cellular response, as antibody-dependent cellular cytotoxicity, could be responsible for protection(43). Subsequently, the comparative evaluation of four vaccine formulations was carried out, which used as immunogens the recombinant CP40 protein and the CP09 strain attenuated by induced mutagenesis. The live attenuated strain CP09 of C. pseudotuberculosis was not able to induce a humoral immune response in the vaccinated mice, nor challenged with a virulent strain. Animals vaccinated with formulations that included CP40r had a significant increase in the titer of IgG1 antibodies. However, these groups, after the challenge, experienced a significant increase in IgG2 levels, the maximum being reached by animals immunized with CP40r. The formulation based on CP40r protected 90 % of the animals from the challenge with the virulent strain, followed by the vaccinated group with the attenuated strain CP09 + CP40r with 70 %, while vaccination with CP40r followed by re-immunization with CP09 only protected 60 %(90). Another group of researchers performed the evaluation in BALB/c mice of a CP40r subunit vaccine with different adjuvants, saponin or Freud’s complete adjuvant (FCA). Animals immunized with CP40r/saponin showed elevated values in complete levels of antibodies and IgG2a, IgG2b and IgG3, with statistically significant differences with respect to the control group. The group vaccinated with CP40r/ACF showed significant differences in complete levels of IgG, IgG2a and IgG2b. Both vaccine formulations protected 100 % of the animals challenged with 104 CFUs of the virulent strain C57 of C. pseudotuberculosis, with a tendency towards a Th1 response. Reactivity and production of specific isotypes IgG2a, IgG2b and IgG3 are associated with the action of pro-inflammatory cytokines such as IFN-γ 1239

Rev Mex Cienc Pecu 2021;12(4):1221-1249

and CD8+ T cells, which activate B cells by modifying the immunoglobulin heavy chain. The use of different adjuvants did not influence the antibody response, so the use of saponin is proposed to replace Freud’s adjuvant, which is toxic in sheep(91).

Conclusions

Caseous lymphadenitis continues to be a challenge for sheep and goat producers worldwide. The most recent studies have focused on the identification of new molecules involved in the mechanisms of pathogenicity and virulence of C. pseudotuberculosis, for subsequent evaluation as vaccine candidates. To date, encouraging results have been obtained with formulations based on PLD exotoxin or CP40 endoglycosidase, obtained recombinantly. It should be noted that the combination of these molecules has not been evaluated in the same vaccine, which would be a proposal that would favor the activation of the humoral and cellular immune response. On the other hand, the application of computational analysis in reverse vaccinology studies is currently one of the most used tools in the search for vaccine candidate molecules. Undoubtedly, work with the use of these technologies that constitute an efficient alternative for the identification of new virulence factors should continue, as well as the in-silico evaluation of molecules with immunogenic potential for the development of effective vaccines.

Conflict of interests

The authors declare that there is no conflict of interests. Literature cited: 1.Dorella FA, Pacheco LG, Oliveira SC, Miyoshi A, Azevedo V. Corynebacterium pseudotuberculosis: microbiology, biochemical properties, pathogenesis and molecular studies of virulence. Vet Res 2006;37(2):201–218. 2. Paton MW, Rose IR, Hart RA, Sutherland SS, Mercy AR, Ellis TM, et al. New infection with Corynebacterium pseudotuberculosis reduces wool production. Aust Vet J 1994; 71:47-49.

1240

Rev Mex Cienc Pecu 2021;12(4):1221-1249

3. Collett MG, Bath GF, Cameron CM. Corynebacterium pseudotuberculosis infections. In: Coetzer J, Thomson GR, Justin RC, editores. Infectious diseases of livestock with special reference to Southern Africa. Cape Town, South Africa: Oxford University Press; 1994:1387–1395. 4. Schreuder BE, Ter Laak EA, De Gee AL. Corynebacterium pseudotuberculosis in milk of CL affected goats. Vet Rec 1990;127(15):387. 5.Faeza NMN, Jesse FFA, Hambal IU, Odhah MN, Umer M, Wessam MMS, et al. Responses of testosterone hormone concentration, semen quality, and its related pro-inflammatory cytokines in bucks following Corynebacterium pseudotuberculosis and its mycolic acid infection. Trop Anim Health Prod 2019;51(7):1855-1866. 6.Paton MW, Walker SB, Rose IR, Watt GF. Prevalence of Caseous lymphadenitis and usage of Caseous lymphadenitis vaccines in sheep flocks. Aust Vet J 2003;81:91-95. 7.Windsor PA. Control of Caseous Lymphadenitis. Vet Clin Food Anim 2011;27:193–202. 8.Williamson LH. Caseous lymphadenitis in small ruminants. Vet Clin North Am Food Anim Pract 2001;17(2): 359-371. 9.Aleman MR, Spier SJ. Corynebacterium pseudotuberculosis infections. In: Smith PB, editor. Large animal internal medicine, 3rd ed. St. Louis: Mosby Co. 2002:1076–1084. 10.Bastos BL, Dias PRW, Dorella FA, Ribeiro D, Seyffert N. Corynebacterium pseudotuberculosis: Immunological responses in animal models and zoonotic potential. J Clin Cell Immunol 2012;S4 (005):1-15. 11.Gao H, Ma Y, Shao Q, Hong Q, Zheng G, Li Z. Genome sequence of Corynebacterium pseudotuberculosis strain KM01, isolated from the abscess of a goat in Kunming, China. Genome Announc 2018;6(11):e00013-18. 12.Windsor P. Managing control programs for ovine Caseous lymphadenitis and Paratuberculosis in Australia, and the need for persistent vaccination. Vet Med Auckl 2014;5:11-22. 13.de Farias AEM, Alves JRA, Alves FSF, Pinheiro RR, Faccioli MPY, Lima A MC, et al. Seroepidemiological characterization and risk factors associated with seroconversion to Corynebacterium pseudotuberculosis in goats from Northeastern Brazil. Trop Anim Health Pro 2019;51(4):745-752. 14.Debien E, Hélie P, Buczinski S, Leboeuf A, Bélanger D, Drolet R. Proportional mortality: A study of 152 goats submitted for necropsy from 13 goat herds in Quebec, with a special focus on Caseous lymphadenitis. Can Vet J 2013;54:581-587.

1241

Rev Mex Cienc Pecu 2021;12(4):1221-1249

15.Varela GJA, Montes de Oca JR, Acosta JD, Hernández FL, Morales EV, Monroy SGH. First report of isolation and molecular characterization of the pathogenic Corynebacterium pseudotuberculosis from of sheep and goats in Mexico. Microb Pathog 2018;117:304-309. 16. Parise D, Parise M, Viana MVC, Muñoz BAV, Cortés-Pérez YA, Azevedo V et al. First genome sequencing and comparative analyses of Corynebacterium pseudotuberculosis strains from Mexico. Stand in Genomic Sci 2018;13(21). 17. Robins R. Focus on Caseous lymphadenitis. State Vet J 1991;1:7–10. 18. Binns SH, Bailey M, Green LE. Postal survey of ovine Caseous lymphadenitis in the United Kingdom between 1990 and 1999.Vet Record 2002;150(9):263-268. 19. Paton M, Rose I, Hart R, Sutherland S, Mercy A, Ellis T. Post-shearing management affects the seroincidence of Corynebacterium pseudotuberculosis infection in sheep flocks. Prev Vet Med 1996;26(3-4):275-284. 20.Santos LM, Stanisic D, Menezes UJ, Mendonça MA, Barral TD, Seyffert N, et al. Biogenic silver nanoparticles as a post-surgical treatment for Corynebacterium pseudotuberculosis infection in small ruminants. Front Microbiol 2019;10:824. 21.Stanisic D, Fregonesi NL, Barros CHN, Pontes JGM, Fulaz S, Menezes UJ, et al. NMR insights on nano silver post-surgical treatment of superficial Caseous lymphadenitis in small ruminants. RSC Advances 2018;71. 22. Baird G, Synge B, Dercksen D. Survey of Caseous lymphadenitis seroprevalence in British terminal sire sheep breeds. Vet Record 2004;154:505-506. 23. Pinto AC, de Sa PHCG, Ramos RTJ, Barbosa S, Barbosa, HPM, Ribeiro AC, et al. Differential transcriptional profile of Corynebacterium pseudotuberculosis in response to abiotic stresses. BMC Genomics 2014;15:14. 24.Gallardo A, Toledo RA, González-Pasayo RA, Azevedo V, Robles C, Paolicchi FA, et al. Corynebacterium pseudotuberculosis biovar ovis evaluación de la sensibilidad antibiótica in vitro. Rev Argent Microbiol 2019;51(4):334-338. 25. Stefanska I, Gierynska M, Rzewuska M, Binek M. Survival of Corynebacterium pseudotuberculosis within macrophages and induction of phagocytes death. Polish J Vet Sci 2010;13(1):143-149. 26.OIE, Organización Mundial de Sanidad Animal. Informe del grupo ad hoc de la OIE sobre las enfermedades prioritarias para las cuales las vacunas pueden reducir el uso de agentes antimicrobianos en bovinos, ovejas y cabras. Paris, 2018. http//:www.oie.int › fileadmin › SST › adhocreports › AHG. 1242

Rev Mex Cienc Pecu 2021;12(4):1221-1249

27. de Pinho RB, de Oliveira Silva MT, Bezerra FSB. Vaccines for caseous lymphadenitis: up-to-date and forward-looking strategies. Appl Microbiol Biotechnol 2021;105:2287– 2296. 28. Wattam ARJ, Davis J, Assaf R, Brettin T, Bun C, Conrad N, et al. Improvements to PATRIC, the all-bacterial bioinformatics database and analysis resource. Nucleic Acids Res 2017;45:535-542. 29. Ruiz JC, D’Afonseca V, Silva A, Ali A, Pinto AC. Evidence for reductive genome evolution and lateral acquisition of virulence functions in two Corynebacterium pseudotuberculosis strains. PLoS One 2011;6(4):e18551. 30. Burkovski A. The role of corynomycolic acids in Corynebacterium-host interaction. Antonie van Leeuwenhoek 2018;111(5):717-725. 31.Burkovski A. Cell Envelope of Corynebacteria: Structure and Influence on Pathogenicity. ISRN Microbiol 2013;935736:11. 32. Muller B, de Klerk LLM, Henton MM, Lane E, Parsons S, Kotze A, et al. Mixed infections of Corynebacterium pseudotuberculosis and non-tuberculous mycobacteria in South African antelopes presenting with tuberculosis-like lesions. Vet Microbiol 2011;147:340–345. 33. Silva A, Schneider MPC, Cerdeira L, Barbosa MS, Ramos RTJ. Complete genome sequence of Corynebacterium pseudotuberculosis I19, a strain isolated from a cow in Israel with bovine mastitis. J Bacteriol 2011;193:323-324. 34. Sprake P, Gold JR. Corynebacterium pseudotuberculosis liver abscess in a mature alpaca (Lama pacos). Can Vet J 2012;53:387-390. 35. Lopes T, Silva A, Thiago R, Carneiro A, Dorella FA. Complete genome sequence of Corynebacterium pseudotuberculosis Strain Cp267, isolated from a Llama. J Bacteriol 2012;194:3567-3568. 36. Colom CA, Velarde R, Salinas J, Borge C, Garca BI, Serrano E, et al. Management of a Caseous lymphadenitis outbreak in a new Iberian ibex (Capra pyrenaica) stock reservoir. Acta Vet Scand 2014;56:83. 37.Oliveira M, Barroco C, Mottola C, Santos R, Lemsaddek A, Tavares L, Semedo LT. First report of Corynebacterium pseudotuberculosis from Caseous lymphadenitis lesions in Black Alentejano pig (Sus scrofa domesticus). Vet Res 2014;10:218. 38. Muñoz BAV, Cortés PYA, Arellano RB, Hernández GM, Hernández CR, Díaz AE. Identification of Corynebacterium pseudotuberculosis isolated from muscular abscesses in two horses: first report in Mexico. Equine Vet Educ 2016;29(8):431-435. 1243

Rev Mex Cienc Pecu 2021;12(4):1221-1249

39. Borham M, Oreiby A, El GA, Al GM. Caseous Lymphadenitis in Sudanese and Somalian camels imported for meat consumption in Egypt. AJVS 2017;55(2):52-59. 40. Viana MVC, Figueiredo H, Ramos R, Guimares LC, Dorella FA, Azevedo V. Comparative genomic analysis between Corynebacterium pseudotuberculosis strains isolated from buffalo. PLoS ONE 2017;12(4):e0176347. 41. Soares SC, Silva A, Trost E, Blom J, Ramos R, Carneiro A. The pan-genome of the animal pathogen Corynebacterium pseudotuberculosis reveals differences in genome plasticity between the biovar ovis and equi strains. PLoS ONE 2013;8(1):e53818. 42. Odhah MN, Jesse FFA, Lawan A, Idris UH, Marza AD, Mahmood ZK, et al. Responses of haptoglobin and serum amyloid A in goats inoculated intradermally with C. pseudotuberculosis and mycolic acid extract immunogen. Microb Pathog 2018;117:243246. 43. Hodgson ALM, Bird P, Nisbett IT. Cloning, nucleotide sequence, and expression in Escherichia coli of the phospholipase D gene from Corynebacterium pseudotuberculosis. J Bacteriol 1990;172:1256–1261. 44. Kolesnikov YS, Nokhrina KP, Kretynin SV, Volotovski ID, Martinec J, et al. Molecular structure of phospholipase D and regulatory mechanisms of its activity in plant and animal cells. Biochem Biokhimiia 2012;77:1-14. 45. Dias-Lopes C, Neshich IAP, Neshich G, Ortega JM, Granier C, Chávez-Olortegui C, et al. Identification of new Sphingomyelinases D in pathogenic fungi and other pathogenic organisms. PLoS ONE 2013;8(11):e79240. 46. Baird GJ, Fontaine MC. Corynebacterium pseudotuberculosis and its role in ovine Caseous Lymphadenitis. J Comp Pathol 2007;137(4):179-210. 47. Walker J, Wilson MJ, Brandon MR. Molecular and biochemical characterization of a protective 40-kilodalton antigen from Corynebacterium pseudotuberculosis. Infect Immun 1995;63:206-211. 48. Shadnezhad A, Naegeli A, Collin M. CP40 from Corynebacterium pseudotuberculosis is a endo B-N- acetylglucosaminidase. BMC Microbiol 2016;63(1):206-211. 49. Pacheco LGC, Slade SE, Seyffert N, Santos AR, Castro TLP. A combined approach for comparative exoproteome analysis of Corynebacterium pseudotuberculosis. BMC Microbiol 2011;11:12.

1244

Rev Mex Cienc Pecu 2021;12(4):1221-1249

50. Paule BJ, Meyer R, Moura-Costa LF, Bahia RC, Carminati R, Regis LF. Three-phase partitioning as an efficient method for extraction / concentration of immunoreactive excreted-secreted proteins of Corynebacterium pseudotuberculosis. Protein Expr Purif 2004;34:311-316. 51. Silva WM, Dorella FA, Soares SC, Souza GHM, Seyffert N, Azevedo V, et al. A shift in the virulence potential of Corynebacterium pseudotuberculosis biovar ovis after passage in a murine host demonstrated through comparative proteomics. BMC Microbiol 2017;17(1):55. 52. Corrêa JI, Stocker A, Castro ST, Vale V, Brito T, Bastos B, et al. In vivo and in vitro expression of five genes involved in Corynebacterium pseudotuberculosis virulence. AMB Expr 2018;8:89. 53. Ibraim IC, Parise MT, Tadra MZ, de Paula TL, Wattam AR, Azevedo V, et al. Transcriptome profile of Corynebacterium pseudotuberculosis in response to iron limitation. BMC Genomics 2019;20:663. 54. Ibraim IC, Parise MT, Tadra MZ, de Paula TL, Wattam AR, Azevedo V, et al. Transcriptome profile of Corynebacterium pseudotuberculosis in response to iron limitation. BMC Genomics 2019;20:663. 55. Saıd-Salim B, Mostowy S, Kristof AS, Behr MA. Mutations in Mycobacterium tuberculosis RV0444c, the gene encoding anti-sigK, explain high level expression of mpb70 and mpb83 in Mycobacterium bovis. Mol Microbiol 2006;62:1251–1263. 56. Pacheco LGC, Castro TLP, Carvalho RD, Moraes PM, Dorella FA, Azevedo V, et al. A role for sigma factor σ in Corynebacterium pseudotuberculosis resistance to nitric oxide/peroxid stress. Front Microbiol 2012;3:126. 57. Trost E, Ott L, Schneider J, Schröder J, Jaenicke S, Goesmann A, Husemann P, et al. The complete genome sequence of Corynebacterium pseudotuberculosis FRC41 isolated from a 12-year-old girl with necrotizing lymphadenitis reveals insights into gene regulatory networks contributing to virulence. BMC Genomics 2010;11:728. 58. Costa PM, McCulloch JA, Almeida SS, Dorella FA, Fonseca CT, et al. Molecular characterization of the Corynebacterium pseudotuberculosis hsp60-hsp10 operon, and evaluation of the immune response and protective efficacy induced by hsp60 DNA vaccination in mice. BMC Res Notes 2011;4:243. 59. Pinto GAC, Gomes SP, Queiroz AL, Sousa T, Rodrigues L, Azevedo V, et al. Heat shock stress: Profile of differential expression in Corynebacterium pseudotuberculosis biovar Equi Gene 2018;645:124–130.

1245

Rev Mex Cienc Pecu 2021;12(4):1221-1249

60. Silva WM, Seyffert SN, Santos AV, Castro TLP, Pacheco LGC, Azevedo V, et al. Identification of 11 new exoproteins in Corynebacterium pseudotuberculosis by comparative analysis of the exoproteoma. Microb Pathog 2013;1e6:1-6. 61. Al-Gaabary MH, Osman SA, Oreiby AF. Caseous lymphadenitis in sheep and goats: Clinical, epidemiological and preventive studies. Small Ruminant Res 2009;87:116– 121. 62. Jesse FFA, Odhah MN, Abbad Y, Garba B, Mahmood Z, Hambali IU, et al. Responses of female reproductive hormones and histopathology in the reproductive organs and associated lymph nodes of Boer does challenged with Corynebacterium pseudotuberculosis and its immunogenic corynomycolic acid Extract. Microb Pathog 2020;139:103852. 63. Odhah MN, Jesse FFA, Teik CEL, Mahmood Z, Wahid HA, Mohd LMA, et al. Clinicopathological responses and PCR detection of Corynebacterium pseudotuberculosis and its immunogenic mycolic acid extract in the vital organs of goats. Microb Pathog 2019;135:103628. 64.Mahmood ZKH, Jesse FF, Saharee AA, Jasni S, Yusoff R, Wahid H. Clinio-pathological changes in goats challenged with Corynebacterium peudotuberculosis and its exotoxin (PLD). Am J Anim Vet Sci 2015;10 (3):112.132. 65.Valdivia J. Vida intracelular de Corynebacterium pseudotuberculosis [tesis Doctorado]. España, Islas Canarias: Universidad de las Palmas de Gran Canaria. Instituto Universitario de Sanidad animal y Seguridad alimentaria; 2015. 66. Oliveira A, Oliveira LC, Aburjaile F, Benevides L, Tiwari S, Azevedo V, et al. Insight of Genus Corynebacterium: Ascertaining the role of pathogenic and non-pathogenic species. Front Microbiol 2017;8:1937. 67. Oliveira A, Teixeira P, Barh D, Barh D, Ghosh P, Azevedo V. Key amino acids in understanding evolutionary characterization of Mn/Fe-Superoxide dismutase: A phylogenetic and structural analysis of proteins from Corynebacterium and Hosts. Trends Artif Intell 2017;1(1):1-11. 68. Hard GC. Examination by electron microscopy of interaction between peritoneal phagocytes and Corynebacterium ovis. J Med Microbiol 1972;5:483-491. 69. Tashjian JJ, Campbell SG. Interaction between caprine macrophages and Corynebacterium pseudotuberculosis: an electron microscopy study. Am J Vet Res 1983;44:690-693.

1246

Rev Mex Cienc Pecu 2021;12(4):1221-1249

70. Paule BJA, Azevedo V, Regis LF, Carminati R, Bahia R. Experimental Corynebacterium pseudotuberculosis primary infection in goats: kinetics of IgG and interferon-γ production, IgG avidity and antigen recognition by Western blotting. Vet Immunol Immunopathol 2003;96:129-139. 71. Seyffert N, Silva RF, Jardin J, Silva WM, Castro TL, Tartaglia NR, et al. Serological proteome analysis of Corynebacterium pseudotuberculosis isolated from different hosts reveals novel candidates for prophylactics to control Caseous lymphadenitis. Vet Microbiol 2014;174:255-260. 72. Rebouças MF, Portela RW, Lima DD, Loureiro D, Bastos BL. Corynebacterium pseudotuberculosis secreted antigen-induced specific gamma-interferon production by peripheral blood leukocytes: Potential diagnostic marker for Caseous Lymphadenitis in sheep and goats. J Vet Diag Invest 2011;23:213-220. 73. Fontaine MC, Baird G, Connor KM, Rudge K, Sales J, Donachie, W. Vaccination confers significant protection of sheep against infection with a virulent United Kingdom strain of Corynebacterium pseudotuberculosis. Vaccine 2006;24:5986–5996. 74. Stanford K, Brogden KA, McClelland LA, Kozub GC, Audibert F. The incidence of Caseous lymphadenitis in Alberta sheep and assessment of impact by vaccination with commercial and experimental vaccines. Can J Vet Res 1998;62:38-43. 75. Zoetis, 2020. Zoetis Spain, S.L. Avda. de Europa 20B, Parque Empresarial La Moral. https://www.zoetis.es/_locale-assets/spc/biodectin.pdf. Consultado 16 Abr, 2020. 76. Medrano G, Hung ACh, Alvarado AS, Li EO. Evaluación de una vacuna contra Corynebacterium pseudotuberculosis en ratones albinos. Rev Inv Vet 2003;14(1):6167. 77. Braga WU. Protection in alpacas against Corynebacterium pseudotuberculosis using different bacterial components. Vet Microbiol 2007;119:297–303. 78. Eggleton DG, Doidge CV, Middleton HD, Minty DW. Immunisation against ovine caseous lymphadenitis: efficacy of monocomponent Corynebacterium pseudotuberculosis toxoid vaccine and combined clostridial-corynebacterial vaccines. Aust Vet J 1991;68:320421. 79. Syame SM, Abuelnaga ASM, Ibrahim ES, Hakim AS. Evaluation of specific and nonspecific immune response of four vaccines for caseous lymphadenitis in sheep challenged. Vet World 2018;11(9):1272-1276.

1247

Rev Mex Cienc Pecu 2021;12(4):1221-1249

80. Moura-Costa LF, Bahia RC, Carminati R, Vale VL, Paule BJ, et al. Evaluation of the humoral and cellular immune response to different antigens of Corynebacterium pseudotuberculosis in Canindé goats and their potential protection against Caseous lymphadenitis. Vet Immunol Immunopathol 2008;126:131-141. 81. Hodgson ALM, Krywult J, Corner LA, Rothel JS, Radford AJ. Rational attenuation of Corynebacterium pseudotuberculosis: Potential cheesy gland vaccine and live delivery vehicle. Infect Immun 1992;60(7):2900-2905. 82. Hodgson ALM, Tachedjian M, Corner LA, Radford AJ. Protection of sheep against Caseous lymphadenitis by use of a single oral dose of live recombinant Corynebacterium pseudotuberculosis. Infect and Immunol 1994;62(12):5275-5280. 83. Ribeiro D, Rocha FS, Leite KM, Soares SC, Silva A, Portela RW, et al. An ironacquisition-deficient mutant of Corynebacterium pseudotuberculosis efficiently protects mice against challenge. Vet Res 2014;45:28. 84. Chaplin PJ, De Rose R, Boyle JS, McWaters P, Kelly J, Tennent JM, et al. Targeting improves the efficacy of a DNA vaccine against Corynebacterium pseudotuberculosis in sheep. Infect Immun 1999;67:6434–6438. 85. De Rose R, Tennent J, McWaters P, Chaplin PJ, Wood PR, Kimpton W, et al. Efficacy of DNA vaccination by different routes of immunisation in sheep, Vet Immunol Immunopathol 2002;90:55-63. 86. Brum AA, Silva AFR, Silvestre FB, Collares T, Begnine K, Kommling F, et al. Recombinant esterase from Corynebacterium pseudotuberculosis in DNA and subunit recombinant vaccines partially protects mice against challenge. J Med Microb 2017;66:635-642. 87. Moussa IM, Mohamed SA, Ashgan M, Hessain SA, Kabli E, Hassan AH, et al. Vaccination against Corynebacterium pseudotuberculosis infections controlling Caseous lymphadenitis (CLA) and oedematousskin disease. Saudi J Biol Sci 2016;23:718–723. 88.Silva MTO, Bezerra FSB, de Pinho RB, Begnini KR, Seixas FK, Collares T, et al. Association of Corynebacterium pseudotuberculosis recombinant proteins rCP09720 or rCP01850 with rPLD as immunogens in Caseous lymphadenitis immunoprophylaxis. Vaccine 2018;36(1):74-83. 89. Leal KS, Silva TO, Silva AFR, Brilhante FSB, Begnini K, Seixas F, et al. Recombinant M. bovis BCG expressing the PLD protein promotes survival in mice challenged with a C. pseudotuberculosis virulent strain. Vaccine 2018;36:3578–3583.

1248

Rev Mex Cienc Pecu 2021;12(4):1221-1249

90. Silva JW, Droppa-Almeida D, Borsuk S, Azevedo V, Portela RW. Corynebacterium pseudotuberculosis cp09 mutant and cp40 recombinant protein partially protect mice against caseous lymphadenitis. BMC Vet Res 2014;10:965. 91. Droppa-Almeida D, Vivas WL, Silva KK, Rezende AF, Simionatto S. Recombinant CP40 from Corynebacterium pseudotuberculosis confers protection in mice after challenge with a virulent strain. Vaccine 2016;34(8):1091–1096.

1249

https://doi.org/10.22319/rmcp.v12i4.5016 Technical note

Comparison of equations to fit growth curves of Holstein, Jersey and Jersey x Holstein cows in a grazing system

Sonia Contreras Piña a José Guadalupe García Muñiz a* Rodolfo Ramírez Valverde a Rafael Núñez Domínguez a Citlalli Celeste González Ariceaga a

Universidad Autónoma Chapingo. Departamento de Zootecnia, Posgrado en Producción Animal, km 38.5 Carretera México-Texcoco, 56230, Chapingo, Estado de México, México.

*Corresponding author: jgarciamppa@hotmail.com

Abstract: The objective of the study was to compare the goodness of fit of four nonlinear equations to describe the growth curves of Jersey, Holstein, and Jersey x Holstein cows in grazing. The Brody, Gompertz, von Bertalanffy, and Logistic equations were fitted to the data (n= 2,315) on weight and age of Jersey (n= 54), Holstein (n= 6) and Jersey x Holstein (n= 30) cows. For each animal, genotype and equation, the parameters A, b and k that generated the best-fit growth curves were estimated. In each of the four equations compared, parameter A corresponds to the upper asymptote of the curve and estimates the ‘mature weight’ of the animal, parameters b and k represent the integration constant and the maturation rate. For the growth curves of Jersey cows and Jersey x Holstein crosses, the Gompertz and von Bertalanffy equations produced the best fit. In contrast, the Logistic equation had the best fit for the growth curves of Holstein, followed closely by the Gompertz and von Bertalanffy equations. Under the management and feeding conditions of the animals in this study, the growth curves of the females of the three genotypes studied can be fitted with the von Bertalanffy equation. 1250

Rev Mex Cienc Pecu 2021;12(4):1250-1263

Key words: Dairy cattle, Nonlinear models, Growth pattern.

Received: 15/08/2018 Accepted: 17/02/2021

When the weight of the same individual at regular age intervals, from birth to maturity, is available, it is possible to fit a function that describes the weight curve according to age. This curve that allows condensing the growth path of an individual into a few parameters is called the growth curve(1). There are several equations that have been used to describe the growth of plants and animals(2), including Brody’s(3), Gompertz’s(4), Logistic(5) and von Bertalanffy’s(5), all special cases of Richards’ equation(5). Growth curves reflect the interrelationships between the individual’s inherent impulse to grow and mature, and the environment in which these impulses are expressed(6). Some of these equations have been used to describe the growth of several species of zootechnical interest, such as Pantaneira bovines in Brazil(7), and Holstein females to predict their growth from birth to first calving(8). These equations have also been used to describe the growth of sheep genotypes(9,10,11), dairy cattle(12,13), and horses(14). Under grazing milk production systems with low use of supplemental feed and a mixture of bovine genotypes that differ in mature size, the average weight of the cow largely determines the maximum stocking rate supported by the system. Different bovine genotypes may have different mature weights and metabolizable energy requirements for maintenance. Fitting a growth curve from birth to maturity can be useful for calculating maintenance requirements over the life of the animal. The individual growth curves of animals can be estimated by fitting mixed nonlinear models, even with incomplete records of the growth curve of the animals of the herd. The objective of this study was to compare the goodness of fit of four nonlinear equations to describe the growth curves of Jersey, Holstein, and Jersey x Holstein cows grazing on mixed meadows of alfalfa-perennial ryegrass-orchard grass-white clover. The study was conducted in the Module of Organic Milk Production in Grazing of the Experimental Farm of the Chapingo Autonomous University, Mexico. Díaz(15) details the development of the Module. Briefly, the module started with 10 Holstein cows and 25 Jersey cows of first calving in May 2000. The animals that make up the herd are Jersey cows from the New Zealand genetic line, Holstein cows from the North American genetic line and cows originating from the cross of Holstein cows with Jersey semen.

1251

Rev Mex Cienc Pecu 2021;12(4):1250-1263

The feeding of the animals is based on the grazing on meadows, hay that is preserved from these and corn silage that is produced in meadow areas that are renewed every year. The animals are managed in intensive rotational grazing in strips on mixed meadows of alfalfa (Medicago saltiva) variety Aragonese, orchard grass (Dactylis glomerata) variety Potomac, perennial ryegrass (Lolium perennial) variety Linn and white clover (Trifolium repens) variety Ladino. The animals of the herd are managed in three groups: lactating, dry and growing animals. Depending on the growing conditions of the meadow, paddocks are assigned by group or grazing is carried out with the scheme of leaders and followers, the leaders are the cows in production and the followers the group of dry cows and growing cattle. With this grazing scheme, the animals are provided with production conditions that guarantee sufficient freedom of movement, area for rest, fresh air, adequate light and temperature, clean water and sufficient food for the productive stage of the animal. In addition to the meadow forage, animals are provided with a freely accessible mineral mixture. This mixture was formulated based on a diagnosis of the mineral status of animals and meadow forage, with tests on blood, forage, feces, hair and milk(16). Cows give birth on the meadow, in the group of dry cows, providing them with assistance only when necessary. The calf remains with the mother in the meadow for the first two days of life consuming colostrum freely. On the third day, the mother joins the group of lactating cows, the calf is sent to a rearing room with natural ventilation, and it is assigned an individual cage with a raised floor. Only for females, a card is opened on which identification of the calf, date and weight at birth, identification of the mother and father are recorded. The identification of the calf consists of a tattoo on the right ear and earring on the left ear, using a four-digit system. During the first two weeks of life, the calves receive four liters of whole milk divided into two doses. Subsequently, in addition to milk, the calves have access to the meadow forage. Weaning is done at three months of age(15). The weight and age records of the animals of the genotypes studied were generated from the dates of birth, weighing dates and individual records of the live weight of animals at different stages of their life, from birth to maturity. The animals were periodically weighed at regular intervals of about 30 d. A Tru-Test digital scale (Tru-Test, Palmerston North, NZ), EC 2000 System with GP 600 Bars, with a capacity of 1,500 kg and an accuracy of 0.5 kg, was used. The live weight data used in this study were recorded from 2012 to 2016. The animals included in the study were weighed at birth, weaning, and monthly. In total, there were 2,315 records of weight (kg) and age (d) generated by 54 Jersey, 6 Holstein, and 30 Jersey x Holstein cows, with ages ranging from 1 to 6,597 d.

1252

Rev Mex Cienc Pecu 2021;12(4):1250-1263

The Brody(3) model, a modified version of the Gompertz(4) function, the Logistic(5) and von Bertalanffy(5) models were fitted to the weight and age data of the cows. Brody: 𝑌𝑡 = 𝐴(1 − 𝑏𝑒 −𝑘𝑡 ) (𝑏−𝑘𝑡)

Gompertz: 𝑌𝑡 = 𝐴𝑒 −𝑒 Logistic: 𝑌𝑡 = 𝐴(1 + 𝑏𝑒 −𝑘𝑡 )−1 von Bertalanffy: 𝑌𝑡 = 𝐴(1 − 𝑏𝑒 −𝑘𝑡 )3 In all cases, Yt is the live weight (kg) recorded at age t (days); parameter A corresponds to the upper asymptote, which estimates the mature weight (kg) of the animal; parameter b is an integration constant related to the initial weight; parameter k is the maturation rate; and e is the base of natural logarithms(12). With the information of weight and age, descriptive statistics were calculated in different sections of the herd growth curve. Nine age intervals were generated: three that covered the interval from birth to one year, and six that covered the interval from two to twelve years, with two years apart. A similar partition was made to describe the growth curve of North American Angus cattle(17). Descriptive statistics were obtained using the MEANS procedure of SAS(18). For each genotype, each of the equations evaluated was fitted by the NLMIXED procedure of SAS(18). Only the parameter related to mature weight (A) was fitted as a random effect in the respective equation; the remaining parameters of the growth curve (b and k) were considered fixed. A procedure similar to that of other studies, in which stochastic models were fitted to describe individual variation in farm animal growth, was followed(19,20,21). The inclusion of a random term (𝑎𝑖 ) associated with parameter A of the growth equations compared was done as described by Craig and Schinckel(19) when fitting growth curves in pigs. Thus, the statistical model fitted within genotype, for each of the equations compared in the present study, included a random term related to the mature size of the cow, it is expressed as follows: Brody:

𝑌𝑖,𝑡 = (𝐴 + 𝑎𝑖 )(1 − 𝑏𝑒 −𝑘𝑡 ) + 𝜀𝑖,𝑡

Gompertz: Logistic: von Bertalanffy:

𝑌𝑖,𝑡 = (𝐴 + 𝑎𝑖 )𝑒 −𝑒 + 𝜀𝑖,𝑡 −𝑘𝑡 −1 𝑌𝑖,𝑡 = (𝐴 + 𝑎𝑖 )(1 + 𝑏𝑒 ) + 𝜀𝑖,𝑡 𝑌𝑖,𝑡 = (𝐴 + 𝑎𝑖 )(1 − 𝑏𝑒 −𝑘𝑡 )3 + 𝜀𝑖,𝑡

(𝑏−𝑘𝑡)

where Yi,t is the live weight of the animal i recorded on day t of age, e is the base of the natural logarithms (i.e. 2.718281), A is the predicted mature weight, ai is the random effect of the animal i for the parameter of the growth curve related to the mature weight (A) of the animal ~𝑁𝑜𝑟𝑚𝑎𝑙(0, 𝜎𝐴2 ), t is the age of the animal in days, b is an integration constant related 1253

Rev Mex Cienc Pecu 2021;12(4):1250-1263

to the initial weight of the animal, k is the maturation rate and 𝜀 i,t, is the residual of the model~𝑁𝑜𝑟𝑚𝑎𝑙(0, 𝜎𝜀2 ). The fitting of these models generated, in addition to the estimators of the parameters of the growth curve, estimators of variance for parameter A (𝜎𝐴2 ) and residual variance (σ2𝜀 ). The fitting of the model also generated estimators of -2 log likelihood, the Akaike Information Criterion (AIC) and the Bayesian Information Criterion (BIC), which were used as goodnessof-fit criteria to compare the four fitted equations. The fitting of each of the models to the three genotypes studied generated the coefficients of parameters A, b and k, to generate the individual growth curves of animals. In the SAS code used, an expression was also included to generate the coefficients of the fixed regression to describe the average growth curve of each genotype studied. These coefficients were used to generate, in each equation and genotype, the predicted values of live weight to generate the individual curves of the animals and the average growth curves per cow genotype, using the SGPLOT procedure of SAS(18). The descriptive statistics of the live weight for different age intervals of the growth curve of the genotypes evaluated are shown in Table 1. In general, it is observed that the weight increases markedly in the first three to four years, subsequently, it remains relatively constant. The standard deviation increases as the age of the animal advances; this is explained by a greater variation in adult weight in the different genotypes(22). Table 1: Descriptive statistics of weight (kg) grouped by age of Jersey, Holstein and Jersey x Holstein females managed in grazing Jersey Holstein Jersey x Holstein Age (days) n Mean SD n Mean SD n Mean SD 0- 30 10 26.2 6.6 ---7 26.0 3.4 30- 120 19 56.1 11.9 ---2 69.5 21.9 121- 200 44 81.6 14.2 2 110.5 2.1 27 104.2 34.4 201-365 92 128.4 29.5 5 136.2 24.9 72 151.4 35.1 366-730 201 245.9 46.3 12 276.0 56.6 157 255.3 58.9 731-1460 404 338.5 54.3 28 490.5 66.5 269 365.0 60.4 1461-2190 213 358.5 51.1 43 477.0 42.5 138 441.7 56.3 2191-2920 103 384.4 33.4 55 512.0 37.0 23 480.7 55.1 >2920 235 403.0 58.0 130 527.2 44.5 11 464.0 28.9 SD = standard deviation.

The estimators of the goodness of fit of the model, -2 log likelihood, the Akaike Information Criterion (AIC) and the Bayesian Information Criterion (BIC) are shown in Table 2. According to the magnitude of these estimators (smaller values indicate better fit), the von 1254

Rev Mex Cienc Pecu 2021;12(4):1250-1263

Bertalanffy and Gompertz models were the ones that best fitted the growth curves of females of the Jersey genotype. For the growth curves of the Jersey x Holstein crosses, the best fit was obtained with the von Bertalanffy equation, and for Holstein with the Logistic, followed very closely by the Gompertz and von Bertalanffy equations. Table 2: Values of the criteria used to compare the fit of the equations to the weight and age records of bovines of three genotypes Indicator of the goodness of fit of the model1 Genotype Model -2 log likelihood AIC BIC Brody 12963 12973 12983 von Bertalanffy 12892 12902 12912 Jersey (J) Gompertz 12891 12901 12911 Logistic 12920 12930 12940 Brody 2945 2955 2954 von Bertalanffy 2915 2925 2924 Holstein (H) Gompertz 2909 2919 2918 Logistic 2895 2905 2904 Brody 7143 7153 7260 von Bertalanffy 7111 7121 7128 JH Gompertz 7122 7132 7139 Logisticl 7151 7161 7168 1

AIC and BIC are the Akaike (AIC) and Bayesian (BIC) Information Criteria for assessing the goodness of fit of the respective model (lower values indicate better model fit).

In a study of bovine growth in Brazil, the Brody equation generated the best fit to describe the growth curve of Nellore bovines in confinement(23). Likewise, the Brody equation best fitted the growth curves of Tropicarne bovines, which implies for this genotype a slow maturation rate, characteristic of the growth of bovines under grazing conditions in the tropics(24). Brown et al(25) reported that the Brody equation best fitted the growth curve in several bovine genotypes under different management and feeding conditions. In contrast, other researchers(26) indicate that the Gompertz and von Bertalanffy equations best fitted to describe the growth of Hereford steers, which is consistent with what was found in this study for the Jersey and Jersey x Holstein genotypes. The estimators of parameters A, b and k of the growth models evaluated, as well as the estimators of the variances of ‘mature weight’ and residual are presented in Table 3. Parameter A, which represents mature weight, was different in each genotype, depending on the equation used. The Brody equation fitted for the three genotypes the highest value of mature weight, which is consistent with what was obtained in other studies(23), in which it is also mentioned that this equation overestimates mature weight. Herrera et al(27) indicated that groups of animals with higher A value are less precocious. For Holstein, the von Bertalanffy

1255

Rev Mex Cienc Pecu 2021;12(4):1250-1263

and Logistic equations produced practically the same A value (512 kg). This value of mature weight for cows of the Holstein genotype is well below the estimators of 591, 566 and 543 kg obtained in Ireland under grazing conditions for two lines from Holstein-Friesian from North America-Europe and Holstein-Friesian from New Zealand, respectively(13). The Brody equation yielded the lowest value of k. A small value of k represents a slower growth rate to reach asymptotic weight from initial weight, or slower maturation rates(7,24,28). Table 3: Parameters of the growth curve (± standard error), estimators of residual and mature weight variances after fitting the equations to the weight and age records of three bovine genotypes Parameter Jersey Holstein Jersey x Holstein _________________________Brody equation________________________ A 400.0 ± 6.5 513.5 ± 13.6 455.8 ± 9.4 b 1.04 ± 0.01 0.99 ± 0.03 1.02 ± 0.02 -3 -5 -3 k 1.71E ± 5.6E 1.95E ± 0.01 1.65E-3 ± 8.1E-5 1005.0 ± 156.8 800.0 ± 617.0 803.0 ± 121.0 σ𝐴2 2 1075.0 ± 43.7 1875.0 ± 154.2 1497.5 ± 100.0 σ𝑒 _______________________Gompertz equation________________________ A 383.5 ± 5.6 510.6 ± 15.0 426.6 ± 7.9 b 0.98 ± 0.03 1.30 ± 0.01 0.84 ± 0.04 -3 -5 -3 -4 k 3.19E ± 9.6E 3.86E ± 3.42E 2.97E-3 ± 1.27E-4 918.7 ± 140.2 904.8 ± 2598.0 952.4 ± 143.2 σ𝐴2 2 996.4 ± 39.7 1731.2 ± 148.4 1238.0 ± 68.0 σ𝑒 _________________________Logistic equation________________________ A 373.5 ± 5.3 512.3 ± 10.2 413.8 ± 7.5 b 7.31 ± 0.41 13.2 ± 2.86 5.55 ± 0.39 -3 -4 -3 -4 k 4.69E ± 1.39E 5.43E ± 4.02E 4.26E-3 ± 1.83E-4 900.8 ± 134.4 500.6 ± 437.7 958.7 ± 138.7 σ𝐴2 2 1000.4 ± 39.3 1661.5 ± 141.8 1282.7 ± 70.6 σ𝑒 __________________von Bertalanffy equation________________________ A 388.4 ± 5.9 512.0 ± 10.6 432.3 ± 8.6 b 0.64 ± 0.02 0.92 ± 0.16 0.59 ± 0.02 -3 -5 -3 -4 k 2.70E ± 8.3E 3.45E ± 3.92E 2.57E-3 ± 1.07E-4 1013.7 ± 163.9 512.2 ± 411.7 1153.9 ± 191.7 σ𝐴2 2 998.1 ± 39.8 1778.0 ± 152.0 1135.3 ± 57.6 σ𝑒 1

A is the parameter of the growth curve that corresponds to the upper asymptote, which estimates the mature weight (kg) of the animal; b is an integration constant; k is the maturation rate; (σ𝐴2 ) is the variance of the mature weight (kg2) of the animal estimated by the fitted model; (σ2𝑒 ) is the residual variance (kg2).

The fit of the Brody equation to the weight and age data of the three genotypes studied is shown in Figure 1. In the present work, the availability records from birth to weaning at the 1256

Rev Mex Cienc Pecu 2021;12(4):1250-1263

beginning of the project was low. For the Jersey and Jersey x Holstein genotypes, the Brody equation, in the case of the present work, predicted negative values for birth weight, while for Holstein, it estimated positive but low weights. This is consistent with what was estimated by Mgbere and Olutogun(29), who argue that the Brody equation underestimates weight during the first days of life of N’Dama cattle, but that it fits well at ages greater than six months. Similarly, Berry et al(13) found that the Brody equation predicts negative weights at early ages when used to fit the growth curves of Holstein cows from the North American, European Holstein and Holstein-Friesian genetic lines, managed under semi-grazing conditions. In Brazil(30), they found that the Brody and Gompertz equations had the best fit of the growth curve from birth to adulthood of Caracu cows. This is consistent with the best fit of the Brody equation to describe the growth curve of Lagune beef cattle under grazing conditions(31). Figure 1: Scatter plot for weights and ages of the fit of the growth curves generated by the Brody equation for Jersey, Holstein and Jersey x Holstein females

The fit of the Gompertz equation to the weight and age data of the three genotypes studied is shown in Figure 2. In the present study, birth weights for Holstein, predicted with the fit of the Gompertz equation, were very close to zero, while for Jersey and Jersey x Holstein, a better fit was observed. Several researchers(32) used this equation to describe the growth of dairy cattle, as it was the one that best fitted their data. Berry et al(13) also found that the

1257

Rev Mex Cienc Pecu 2021;12(4):1250-1263

Gompertz equation better fitted the growth curves of American Holstein, European Holstein and Holstein-Friesian cows, managed under grazing conditions, better than Brody’s. Figure 2: Scatter plot for weights and ages of the fit of growth curves generated by the Gompertz equation for Jersey, Holstein and Jersey x Holstein females

The fit of the Logistic equation to the weight and age data of the three genotypes studied is shown in Figure 3. In previous studies describing the growth curve of dairy cattle, the Logistic equation underestimated the mature weight of the animals(12). In this study, the Logistic equation yielded values identical to those of von Bertalanffy for this growth curve parameter.

1258

Rev Mex Cienc Pecu 2021;12(4):1250-1263

Figure 3: Scatter plot for weights and ages of the fit of growth curves generated by the Logistic equation for Jersey, Holstein and Jersey x Holstein females

The fit of the von Bertalanffy equation to the weight and age data of the three genotypes studied is shown in Figure 4. This equation fitted the live birth weights of Holstein with negative values and of Jersey and Jersey x Holstein, with weights close to zero, which differs from what was reported in other studies in which the von Bertalanffy equation overestimated the weight at early ages in N’Dama cattle(29). Spanish researchers(33) compared the Brody, Richards and von Bertalanffy equations to describe the growth curves of Retinta beef cows under extensive grazing conditions in Spain, finding that the von Bertalanffy equation had the best fit for the growth pattern of this genotype. In the present study, the von Bertalanffy equation generated the best fit in the growth curves of Jersey and Jersey x Holstein cows, and for Holstein cows, it produced parameters identical to those of the Logistic equation, which produced the best fit for the growth curves of this genotype.

1259

Rev Mex Cienc Pecu 2021;12(4):1250-1263

Figure 4: Scatter plot for weights and ages of the fit of growth curves generated by the von Bertalanffy equation for Jersey, Holstein and Jersey x Holstein females

In conclusion, the Gompertz and von Bertalanffy equations best describe the growth curve of Jersey cows; that of von Bertalanffy, that of Jersey x Holstein females; and the Logistics, that of Holstein females, followed by those of Gompertz and von Bertalanffy. For the management and feeding conditions of the animals in this study, and in order to adequately describe their growth pattern, the growth curves of the females of the three genotypes studied can be fitted with the von Bertalanffy equation.

Acknowledgements To the National Council for Science and Technology (CONACYT) for the financial support granted to the first author to carry out Master of Science studies at Universidad Autónoma Chapingo.

1260

Rev Mex Cienc Pecu 2021;12(4):1250-1263

Literature cited: 1.Val JE, Freitas MAR, Oliveira HN, Cardoso VL, Machado PF, Paneto JC. Indicadores de desempenho em rebanho da raça Holandesa: curvas de crescimento e altura, características reprodutivas, produtivas e parâmetros genéticos. Arq Bras Med Vet Zootec 2004;56(1):86-93. 2. Koya PR, Goshu AT. Solutions of rate-state equation describing biological growths. Am J Math and Stat 2004;3(6):305-311. 3. Thornley JHM, France J. Mathematical models in agriculture, 2nd ed. Wallingford: CABI Publishing; 2007. 4. Tjørve KMC, Tjørve E. The use of Gompertz models in growth analyses, and new Gompertz-model approach: an addition to the Unified-Richards family. PLoS One 2017;12(6) e0178691. https://doi.org/10.1371/journal.pone.0178691. 5. Tjørve E, Tjørve KMC. A unified approach to the Richards-model family for use in growth analyses: why we need only two model forms. J Theor Biol 2010;267:417-425. 6. Fitzhugh HA. Analysis of growth curves and strategies for altering their shape. J Anim Sci 1976;42(4):1036-1051. 7. Abreu UG, Cobuci JA, da Silva MVGB, Sereno JRB. Uso de modelos no lineales para el ajuste de la curva de crecimiento de bovinos Pantaneiros. Arch Zootec 2004;53(204):367-370. 8. Noor RR, Saefuddin A, Talib C. Comparison on accuracy of Logistic, Gompertz and von Bertalanffy models in predicting growth of new born calf until first mating of Holstein Friesian heifers. J Ind Trop Anim Agric 2012;37(3):151-160. 9. Gbangboche AB, Glele-Kakai R, Salifou S, Albuquerque LGD, Leroy PL. Comparison of non-linear growth models to describe the growth curve in West African Dwarf sheep. Animal 2008;2(7):1003-1012. 10. Malhado CHM, Carneiro PLS, Affonso PRAM, Souza Jr AAO, Sarmento JLR. Growth curves in Dorper sheep crossed with the local Brazilian breeds, Morada Nova, Rabo Largo, and Santa Inês. Small Ruminant Res 2009;84(1):16-21. 11. Behzadi MRB, Aslaminejad AA. A comparison of neural network and nonlinear regression predictions of sheep growth. J Anim Vet Adv 2010;9(16):2128-2131. 12. Perotto D, Cue RI, Lee AJ. Comparison of nonlinear functions for describing the growth curve of three genotypes of dairy cattle. Can J Anim Sci 1992;72(4):773-782.

1261

Rev Mex Cienc Pecu 2021;12(4):1250-1263

13. Berry DP, Horan B, Dillon P. Comparison of growth curves of three strains of female dairy cattle. Anim Sci 2005;80(2):151-160. 14. McManus CM, Louvandini H, Campos VAL. Nonlinear growth curves for weight and height in four genetic groups of horses. Ciencia Anim Bras 2010;11(1):80-89. 15. Díaz HM. Indicaciones preliminares y el establecimiento de un módulo de producción de leche orgánica [tesis licenciatura]. Chapingo, Estado de México: Universidad Autónoma Chapingo; 2002. 16. Del Razo ROE. Características productivas y nivel de selenio y hormonas tiroideas en vacas lecheras suplementadas con bolos con selenio, bolos con selenio y yodo o bolos con yodo [tesis maestría]. Chapingo, Estado de México: Universidad Autónoma Chapingo; 2002. 17. Qing QBS. Comparison of four growth curve models in Angus cow: An application of Bayesian nonlinear mixed model. Report Presented to the Faculty of the Graduate School of the University of Texas at Austin; 2012. 18. SAS. SAS User’s Guide: Statistics (version 9.3 ed.). Cary NC, USA: SAS Inst. Inc. 2016. 19. Craig BA, Schinckel AP. Nonlinear mixed effects model for swine growth. Prof Anim Scient 2001;17(4):256-260. 20. Schinckel AP, Li N, Preckel PV, Einstein ME, Miller D. Development of a stochastic pig compositional growth model. Prof Anim Scient 2003;19(3):255-260. 21. Strathe AB, Danfaer A, Sorensen H, Kebreab E. A multilevel nonlinear mixed-effects approach to model growth in pigs. J Anim Sci 2010;88(2):638-649. 22. Echeverri ZJ, Salazar RV, Parra SJ. Análisis comparativo de los grupos genéticos Holstein, Jersey y algunos de sus cruces en un hato lechero del Norte de Antioquia en Colombia. Zoot Trop 2011;29(1):49-59. 23. Posada OS, Rosero NR, Rodríguez N, Costa CA. Estimación de parámetros de curvas de crecimiento de ganado Nellore criado en confinamiento. Rev MVZ Córdoba 2011;16(3):2701-2710. 24. Domínguez-Viveros J, Rodríguez-Almeida FA, Núñez-Domínguez R, Ramírez-Valverde R, Ortega-Gutiérrez A, Ruiz-Flores A. Ajuste de modelos no lineales y estimación de parámetros de crecimiento en bovinos Tropicarne. Agrociencia 2013;47(1):25-34. 25. Brown J, Fizugh H, Cartwright TC. A comparison of nonlinear models for describing weight-age relationships in cattle. J Anim Sci 1976;42(4):810-818.

1262

Rev Mex Cienc Pecu 2021;12(4):1250-1263

26. Mazzini AR de A, Muniz JA, Silva FF, de Aquino LH. Curva de crescimento de novilhos Hereford: heterocedasticidade e resíduos autorregressivos. Cienc Rural 2005;35(2):422427. 27. Herrera RAC, Vergara GOD, Cerón MMF, Agudelo-Gómez D, Arboleda ZEM. Curvas de crecimiento en bovinos cruzados utilizando el modelo Brody. Livest Res Rural Dev 2008, http://www.lrrd.org/lrrd20/9/herr20140.htm. Consultado Dic 11, 2017. 28. Oliveira HN, Lôbo RB, Pereira CS. Comparação de modelos não-lineares para descrever o crescimento de fêmeas da raça Guzerá. Pesqui Agropecu Bras 2000;35(9):1843-1851. 29. Mgbere OO, Olutogun O. A Comparison of non-linear models for describing weight-age relationships in N'Dama cattle. J Appl Anim Res 2002;22(2):225-230. 30. Moreira RP, Mercadente MEZ, Pedrosa VB, Cyrillo JNSG, Henrique W. Growth curves of the Caracu breed. Ciências Agrárias 2016;37(4):2749-2758. 31. Gbangboche AB, Alkoiret TI, Toukourou Y, Kagbo A, Mensah GA. Growth curves for different body traits of Lagune Cattle. Res J Anim Sci 2011;5(2):17-24. 32. Vargas-Leitón B, Cuevas-Abrego M. Modelo estocástico para estimación de valores económicos de rasgos productivos y funcionales en bovinos lecheros. Agrociencia 2009;43(8):881-893. 33. López de Torre G, Candotti JJ, Reverter A, Bellido MM, Vasco P, García LJ, Brinks JS. Effects of growth curve parameters on cow efficiency. J Anim Sci 1992;70(9):2668-72.

1263

https://doi.org/10.22319/rmcp.v12i4.5736 Technical note

Effect of intrauterine application of ozone on neutrophil migration and subclinical endometritis in dairy cattle

Jessica Bárbara González-Aguado a Elisa Ochoa-Estrada b Héctor Raymundo Vera-Ávila a Ma. de Jesús Chávez-López a,c Mario Alfredo Espinosa-Martínez b Germinal Jorge Cantó-Alarcón a Claudia Gutiérrez-García d Luis Javier Montiel-Olguín a,b,d*

Universidad Autónoma de Querétaro. Facultad de Ciencias Naturales, Maestría en Salud y Producción Animal Sustentable. Av. de las Ciencias s/n, 76230, Santiago de Querétaro, Querétaro, México. b

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, CENID Fisiología y Mejoramiento Animal. Querétaro, México. c

Universidad Autónoma de Querétaro. Centro de Extensión e Innovación Regional AC. Querétaro, México. d

Tecnologico de Monterrey, Escuela de Ingeniería y Ciencias. Querétaro, México.

* Corresponding author: montiel.luis@inifap.gob.mx

Abstract: The objective was to determine whether an ozonized saline solution (O3SS) increases endometrial polymorphonuclear neutrophils (PMNN) (Exp 1) and to challenge the preventive effect of O3SS on subclinical endometritis (SCE) (Exp 2). In Exp 1, 38 primiparous Holstein cows were used. Cows with (WHM) and no history of postpartum

1264

Rev Mex Cienc Pecu 2021;12(4):1264-1275

metritis (NHM) were included; they were then divided into control (CTRL, saline solution) or O3SS (6.7 ± 0.3 ppm) subgroups. At 55 d postpartum, 50 ml of CTRL or O3SS was applied intrauterinely and at 48 h, the quantity of PMNN was recorded by endometrial cytology. In Exp 2, 26 primiparous NHM Holstein cows were used. The cows were randomly distributed in CTRL or O3SS. Two doses of 50 ml were administered with an interval of 7 d (first application 11.3 ± 0.4 d postpartum). At d 30 postpartum, SCE (≥6 % PMNN) was diagnosed. WHM cows had higher numbers of endometrial PMNN compared to NHM cows (13.9 ± 6.2 vs 1.0 ± 0.46, P<0.05). The WHM-CTRL group had a higher number of PMNN than NHM-CTRL (17.0 ± 9.6 vs 0.1 ± 0.1, P<0.05), while the WHM-O3SS and NHM-O3SS groups (10.4 ± 8.1 vs 1.8 ± 4.8, P>0.05) and the NHMCTRL and NHM-O3SS groups (0.1 ± 0.1 and 1.8 ± 4.8, P>0.05) were not different. A statistical trend (P=0.09) of lower percentage of SCE was observed in the CTRL group compared to O3SS (15.4 and 46.2 %, respectively). In conclusion, transcervical O3SS does not increase the number of endometrial PMNN and preventive treatment with O3SS applied to NHM cows did not decrease SCE. The results suggest a possible antiinflammatory effect of the ionized saline solution treatment. Key words: Ozone therapy, Puerperium, Holstein.

Received: 15/07/2020 Accepted: 30/03/2021

Subclinical endometritis (SCE) is a puerperal disease with high prevalence in dairy farms(1,2). Cows with SCE are characterized by high polymorphonuclear neutrophil (PMNN) counts in endometrial cytological samples. This disease has a negative impact on reproductive performance because it reduces the conception rate per service by increasing the open days(1,2). In addition, it is a difficult disease to diagnose at the field level since it requires the use of specialized instruments and the use of a microscope(3,4). In addition to this, other puerperal diseases, such as placental membrane retention and metritis, have been reported to be risk factors for SCE(5,6). As for the pathogenesis, the presence of bacteria in the uterus stimulates the release of pro-inflammatory cytokines in the endometrium that favor the migration of PMNN to fight the infection(7,8). Studies suggest that SCE develops as a result of high production of pro-inflammatory cytokines during the control of the bacterial infection in the uterus(1,8). Therefore, a strategy to reduce the prevalence of SCE may be to decrease uterine bacterial load during the early postpartum period. In relation to the above, ozone therapy has been used experimentally to treat puerperal conditions due to its bactericidal and immune response modulating properties. Some examples of the diseases treated are urovagina, birth canal lesions, mastitis, uterine infections and regeneration of the endometrial epithelium (reviewed by Đuričić et al(9)). Specifically, ozone therapy in the form of foam applied transcervically has been shown 1265

Rev Mex Cienc Pecu 2021;12(4):1264-1275

to be effective in mitigating the negative effects of puerperal diseases on indicators of reproductive performance(10,11). For example, cows with placental retention, clinical metritis or endometritis treated with ozone had conception rates similar to those of cows without uterine pathologies(10,11). These beneficial effects have been attributed to the bactericidal properties of ozone(9,12). In addition to this, although the mechanisms of bactericidal action of ozone are not fully elucidated(13), reports suggest that the death of microorganisms is induced through a direct oxidative effect by oxygen free radicals released with the therapy(14,15). On the other hand, there is evidence to suggest that ozone therapy has the ability to stimulate the immune response(16). For example, it has been reported that ozone applied in ppm in the respiratory tract induces the expression of chemotactic factors (IL8 and MIIP2) in the epithelium, doubling the number of PMNN compared to the control group(17,18). All of the above allows supposing that, in addition to the bactericidal effect, ozone treatment could stimulate the expression of chemotactic factors in the endometrium, increasing the number of PMNN, however, this effect in the uterus has not yet been demonstrated. Therefore, due to its immunomodulatory properties, the objective of the present study was to determine the ability of ozonized saline solution(O3SS) to increase the quantity of PMNN in the endometrium and, due to its bactericidal properties, to challenge the preventive effect of this therapy on the prevalence of SCE in dairy cattle. The study was carried out in a commercial farm in the state of Querétaro (20° 25’ N, semi-dry climate), between the months of August and October 2019. The cows were housed throughout the study in roofed pens and earthen areas to sunbathe with free access. Each pen had individual stalls and beds with silica sand. The cleaning of the pens was carried out once a day at 1300 h. A fully mixed ration containing 55 % fodder (alfalfa, oats and corn silage) and 45 % concentrate (ground and rolled corn, wet bran and soybean) on a dry basis was offered. The cows were fed once a day (0700 h) and with free access to the feeders; during the day, the food was repeatedly swept into the feeder to stimulate consumption. To produce the ozonized saline solution, a commercial medical grade ozone generator (Oxyzonic System Medic, EDE Ozone) was used. Subsequently, 150 ml of saline solution (NaCl 0.9 %) was placed in a gas washing bottle and 0.5 L/min of medical-grade oxygen was passed for 60 sec using a diffuser stone of 25 mm in diameter. The ozone concentration in the generator was set at 70.09 μg/ml. In the laboratory, the residual ozone concentration was determined indirectly with the standard iodometric titration method. The results indicated a concentration of 6.7 ± 0.3 ppm of ozone in the saline solution with this protocol. To achieve the objective of the study, two experiments were designed; Exp 1 to evaluate the ability of O3SS to increase the number of PMNN in the endometrium and Exp 2 to challenge the ability of this therapy to prevent SCE. Figure 1 shows the corresponding experimental designs.

1266

Rev Mex Cienc Pecu 2021;12(4):1264-1275

Figure 1: Experimental study designs

SAM= cows with no history of clinical metritis (NHM); CAM= cows with a history of clinical metritis (WHM); CTRL= saline solution treatment; SSO3= treatment with ozonized saline solution (O3SS); PG= prostaglandin; ESC= subclinical endometritis (SCE).

In Exp 1, 38 first-lactation Holstein cows were used, clinically healthy at the time of applying the experimental treatments (cows without systemic signs of disease, with uterus involuted to transrectal palpation and without the presence of exudates indicating clinical endometritis), with an average of 28 L of milk in two milkings (0400 and 1500 h). During the first 7 d postpartum, the presence of cows without (NHM) or with metritis (WHM), diagnosed from the characteristics of uterine secretions (reddish-brown aqueous liquid with a fetid odor(19)), was recorded, the latter received treatment with local and systemic broad-spectrum antibiotics (ceftiofur 2 mg•kg-1 sc and two uterine washes with oxytetracycline/saline solution (50:50) at three-day intervals with supportive therapy). As part of the reproductive management of the farm, the cows were applied a presynchronization program consisting of two doses of prostaglandin (25 mg of dinoprost tromethamine) at an interval of 14 d. Twelve days after the second prostaglandin (between 50 and 60 d postpartum), a pre-treatment biopsy of endometrial tissue was taken using the Cytobrush technique(3,4). Subsequently, cows in the WHM and NHM groups were subdivided to receive transcervically 50 ml of saline solution in the control group (CTRL) or ozonized saline solution in the treated group (O3SS). Forty-eight hours after the application of the treatment, samples (post-treatment) of endometrial tissue were taken again with the same technique. In both samples (pre- and post-treatment), slides were mounted and analyzed under a microscope at 400X, 200 cells were counted, and the number of polymorphonuclear neutrophils was recorded. In this experiment, it was necessary to have animals without SCE at the time of the challenges with saline solution. The results of the analysis of the slides indicated that two cows presented SCE (≥6 % 1267

Rev Mex Cienc Pecu 2021;12(4):1264-1275

PMNN(2)) in the pre-treatment sample, which were discarded from the study to prevent it as a confounding factor. On the other hand, in Exp 2, 26 first-lactation Holstein cows were used. The cows were randomly divided into two groups; control (0.9 % saline solution; CTRL) and treatment (ozonized saline solution; O3SS). Using infusion pipettes, two doses of 50 ml (with an interval of 7 d) of saline solution or ozonized saline solution were administered intrauterinely. The first dose was administered at 11.3 ± 0.4 d postpartum. The cows included in the study were clinically healthy animals, with no signs of metritis and no history of treatment for puerperal diseases. At d 30 postpartum, the diagnosis of SCE was made with the Cytobrush technique(3,4). The cows whose samples had ≥6 % polymorphonuclear neutrophils (in a count of 200 cells) in the cytological analysis were diagnosed positive for SCE(2). Regarding the statistical analysis, all were carried out using SAS version 9.3 (SAS Institute Inc. Cary, NC, USA). In Exp 1, the statistical analysis consisted of an analysis of variance with a completely randomized design with factorial arrangement (history of diseases (WHM or NHM) x saline solution treatment (CTRL or O3SS)) using the GLM procedure. Residual analysis was carried out with the UNIVARIATE procedure to verify the compliance with the assumptions of the model. To meet the assumptions of the analysis of variance, the response variable (number of PMNN) was logarithmically transformed (logY= log(Y+1)). To facilitate the interpretation of the results, means and standard errors are shown untransformed. The comparison between means was carried out using the PDIFF option. In Exp 2, Fisher’s exact test was used to determine if there were differences between the percentage of cows with SCE. To determine the risk that a cow had to develop SCE, the odds ratio was obtained through a simple logistic regression analysis with the LOGISTIC procedure. For both experiments, a value of P<0.05 was established as a threshold of statistical significance and a value of P≤0.1 as a trend indicator. The results of Exp 1 indicated that the main effect history of metritis was significant (P=0.002), and the interaction history of metritis (WHM or NHM) x saline solution treatment (CTRL or O3SS) showed a statistical trend (P=0.08). In relation to the main effect history of metritis, WHM cows had a higher number of endometrial PMNN than NHM cows (13.9 ± 6.2 vs 1.0 ± 0.46, P<0.05). Figure 2 shows the results of the interaction on the number of PMNN in endometrial cytologies by group. The WHM-CTRL group had a higher number of PMNN than NHMCTRL (17.0 ± 9.6 vs 0.1 ± 0.1, P<0.05) while the WHM-O3SS and NHM-O3SS groups were not different (10.4 ± 8.1 vs 1.8 ± 4.8, P>0.05), although WHM-O3SS did have more PMNN than NHM-CTRL (10.4 ± 8.1 vs 0.1 ± 0.1, P<0.05). For their part, NHM-CTRL and NHM-O3SS were no different (P>0.05). The cow’s ability to generate a postpartum immune response is a determining factor in controlling the bacterial proliferation that occurs naturally in the uterus during the puerperium(19,20,21). In the present study, it was 1268

Rev Mex Cienc Pecu 2021;12(4):1264-1275

reported evidence that cows with a history of metritis had higher endometrial PMNN counts compared to the group of cows with no history of metritis. This effect cannot be attributed to the fact that the WHM group had higher PMNN counts because cows without SCE (all with low PMNN counts in the pre-treatment biopsy) were used. Therefore, a possible explanation lies in a differentiated endometrial immune response to the application of treatments in both groups. Saline solution has been reported to have a moderate irritant effect and its administration in uterine washes has been proposed as an effective treatment against SCE(22). On the other hand, in the literature, it is reported that cows with clinical and subclinical endometritis and cows with a history of dystocia (risk factor for SCE) have higher quantities of inflammatory interleukins in the uterus(23,24). In addition, transcriptomic analyses revealed that cows with a history of clinical endometritis have higher levels of IL-17A at 21 d postpartum(25), which stimulates the recruitment of inflammatory cells via IL-8(26,27). Based on the above, a possible explanation for these results (higher number of post-treatment PMNN in WHM cows) is that the endometrium could have a greater inflammatory response to the irritating effects of saline solution in cows with a history of clinical metritis and endometritis. Figure 2: Polymorphonuclear neutrophil count in endometrial cytologies

NPMN= polymorphonuclear neutrophils (PMNN); CTRL= control subgroup with saline soultion treatment; SSO3= treatment subgroup with ozonized saline solution (O3SS); SAM= cows with no history of clinical metritis (NHM); CAM= cows with a history of clinical metritis (WHM). abc Columns with different letter indicate statistical differences (P<0.05).

Several studies report that intrauterine ozone application is effective in the treatment of metritis and placental retention, an effect that has been associated with its bactericidal property(10,11). In addition, it has been observed that ozone stimulates the expression of chemotactic factors in the respiratory epithelium(17,18), therefore, it was hypothesized that ozone treatment would stimulate the migration of a greater quantity of PMNN to the endometrium in our experiment. However, the results indicated that the number of

1269

Rev Mex Cienc Pecu 2021;12(4):1264-1275

endometrial PMNN in WHM-O3SS cows was not statistically different from that presented by the NHM-O3SS group, that is, the treatment tended to decrease the inflammatory over-response in WHM cows. A possible explanation for these results is in recent studies reporting anti-inflammatory properties of ozone therapy(16). Ozone treatment has been reported to be effective in reducing the severity of pelvic inflammatory disease in a rat model; an effect presumably associated with decreased expression of inflammatory factors IL-6 and TNF-α(28). In another study, patients with osteoarthritis who received local ozone treatment were reported to have higher IL-10 expression (antiinflammatory factor) and lower levels of TNF-α(29). Based on this, it is possible that, with the protocol used, ozone therapy has decreased the local inflammatory response in cows with a history of metritis. These results suggest that the ozone therapy used may also have an anti-inflammatory effect on the endometrium. In addition, based on other studies(28,29), the mechanism could be through the downward modulation of the expression of inflammatory factors in cows with a history of metritis, a hypothesis pending to be challenged. On the other hand, the results of the second experiment indicated that the overall percentage of cows with SCE at d 30 was 30.7 %. A statistical trend (P=0.09) was also observed for differences in the percentage of cows with SCE between CTRL and O3SS groups (15.4 and 46.2 %, respectively, Figure 3). The results of the logistic regression analysis indicated a statistical trend (P=0.1); cows that received ozone treatment (O3SS) had an odds ratio of 4.7 (0.73-30.3, 95 % CI) to develop SCE compared to cows that received only saline solution (CTRL). Figure 3: Percentage of cows with subclinical endometritis at day 30 postpartum

CTRL= control group with saline solution treatment; SSO3= treatment group with ozonized saline solution (O3SS). (P=0.09).

1270

Rev Mex Cienc Pecu 2021;12(4):1264-1275

The pathogenesis of SCE has not been fully explained, however, there are reports indicating that the origin of the disease is an exacerbated immune response in response to a high number of bacteria in the uterus(1,8). The reasoning behind the second experiment was that the percentage of cows with SCE could be decreased by applying ozone therapy during the early puerperium, this to reduce the bacterial load present at that time. However, the results indicated that cows that received O3SS treatment had a higher prevalence and higher risk of suffering SCE at 30 d postpartum. These results should be taken with caution, since, although the group with O3SS had 3 times more animals with SCE and the odds ratio indicated 370 % higher probability of developing SCE, the statistical significance was at the trend level. Now, a possible explanation for these results is that the two doses administered at a 7-d interval have not been effective in reducing the bacterial load, but in modulating the immune response downwards. In the laboratory of this research, it was observed that the application of a single dose of 50 ml of O3SS (6.7 ± 0.3 ppm) improves the characteristics of uterine secretions in cows with metritis 24 h after the application of treatment (unpublished results). However, the treated cows again present secretions with characteristics of metritis in later days. This allows supposing that the protocol used in the present study may have been insufficient to reduce the bacterial load in the uterus. On the other hand, it is known that the presence of bacteria in the uterine lumen stimulates the expression of pro-inflammatory factors that favor the migration of PMNN to fight the infection(8). In addition, it has been reported that an increase in the number of pro-inflammatory cytokines predisposes to the development of SCE(1,8). If treatment with O3SS was insufficient to decrease the bacterial load, but decreased the local immune response, a more severe uterine infection may have been induced. Subsequently, this uterine infection may have stimulated an even more aggressive immune response, thus predisposing cows to an increased risk to develop SCE, a hypothesis pending to be challenged. It is not omitted to mention that the present is a preliminary study, and the results of preventive treatment are applicable to cows with a healthy puerperium and without risk factors for SCE. In addition, the statistical trend obtained invites one to take the results with caution. Modulation of the immune response has been proposed as a strategy to reduce the prevalence of SCE(7). In the first experiment, the results suggest that there may be a decrease in immune response in response to O3SS treatment. In the second experiment, the results indicated that cows treated with O3SS tend to have a greater predisposition to develop SCE, which may have been made possible by an immunosuppressive effect induced by the therapy. However, a limitation of the present study is that in the second experiment only cows that were not suffering from metritis (risk factor for SCE(5,6)) were used and the statistical trend obtained. As observed in the first experiment, there is a differentiated response to treatment depending on whether the animals have infectious uterine disease. Therefore, it is still pending to challenge the preventive effect of ozone treatment in cows with risk factors for SCE. Despite this limitation, the results presented here are foundational to continue exploring the effects of local uterine therapy with ozone, mainly due to the apparent anti-inflammatory effect of this element.

1271

Rev Mex Cienc Pecu 2021;12(4):1264-1275

In conclusion, with the protocol used, transcervical O3SS does not increase the number of PMNN in the endometrium after its application. In addition, treatment with O3SS applied in cows with no history of early metritis increases the risk of developing SCE. One implication of this work is that O3SS may have a local anti-inflammatory effect, which justifies exploring the effectiveness of the preventive protocol in cows with risk factors for SCE.

Acknowledgements

To the Fund for the Strengthening of Research (FOFI; FNV201809) of the UAQ for the financing of this project. González-Aguado’s academic program was supported by CONACyT under the supervision of the last author (LJMO).

Compliance with ethical standards and conflict of interest

The protocol of this study was approved by the Bioethics Committee of the Faculty of Natural Sciences of the Autonomous University of Querétaro (84FCN2018). The authors declare that they have no conflicts of interest. Literature cited: 1. Wagener K, Gabler C, Drillich M. A review of the ongoing discussion about definition, diagnosis and pathomechanism of subclinical endometritis in dairy cows. Theriogenology 2017;94:21-30. 2. Barajas Merchan JL, Hernández Cerón J, García Alfonso A, Martínez Bárcenas E, Juárez López NO, Bedolla Alva MA, et al. Endometritis subclínica y tasa de gestación en vacas lecheras en México. Rev Mex Cienc Pecu 2018;9(1):135-146. 3. Barlund CS, Carruthers TD, Waldner CL, Palmer CW. A comparison of diagnostic techniques for postpartum endometritis in dairy cattle. Theriogenology 2008;69(6):714-723. 4. Cardoso B, Oliveira ML, Pugliesi G, Batista EDOS, Binelli M. Cytobrush: A tool for sequential evaluation of gene expression in bovine endometrium. Reprod Domest Anim 2017;52(6):1153-1157.

1272

Rev Mex Cienc Pecu 2021;12(4):1264-1275

5. Cheong SH, Nydam DV, Galvão KN, Crosier BM, Gilbert RO. Cow-level and herdlevel risk factors for subclinical endometritis in lactating Holstein cows. J Dairy Sci 2011;94(2):762-770. 6. Adnane M, Kaidi R, Hanzen C, England GCW. Risk factors of clinical and subclinical endometritis in cattle: a review. Turk J Vet Anim Sci 2017; 41(1):1-11. 7. Herath S, Lilly ST, Santos NR, Gilbert RO, Goetze L, Bryant CE, et al. Expression of genes associated with immunity in the endometrium of cattle with disparate postpartum uterine disease and fertility. Reprod Biol Endocrin 2009;7(1):55. 8. Fischer C, Drillich M, Odau S, Heuwieser W, Einspanier R, Gabler C. Selected proinflammatory factor transcripts in bovine endometrial epithelial cells are regulated during the oestrous cycle and elevated in case of subclinical or clinical endometritis. Reprod Fertil Dev 2010;22(5):818-829. 9. Đuričić D, Valpotić H, Samardžija M. Prophylaxis and therapeutic potential of ozone in buiatrics: Current knowledge. Anim Reprod Sci 2015;159:1-7. 10. Djuricic D, Vince S, Ablondi M, Dobranic T, Samardzija M. Intrauterine ozone treatment of retained fetal membrane in Simmental cows. Anim Reprod Sci 2012;134(3-4):119-124. 11. Đuričić D, Lipar M, Samardžija M. Ozone treatment of metritis and endometritis in Holstein cows. Vet Arh 2014;84(2):103-110. 12. Megahed A, Aldridge B, Lowe J. The microbial killing capacity of aqueous and gaseous ozone on different surfaces contaminated with dairy cattle manure. Plos One 2018;13(5):e0196555. 13. Zeng J, Lu J. Mechanisms of action involved in ozone-therapy in skin diseases. Int Immunopharmacol 2018;56:235-241. 14. Al‐Saadi H, Potapova I, Rochford ET, Moriarty TF, Messmer P. Ozonated saline shows activity against planktonic and biofilm growing Staphylococcus aureus in vitro: a potential irrigant for infected wounds. Int Wound J 2016;13(5):936-942. 15. Khatri I, Moger G, Anil Kumar, N. Evaluation of effect of topical ozone therapy on salivary Candidal carriage in oral candidiasis. Indian J Dent Res 2015;26(2):158. 16. Di Mauro R, Cantarella G, Bernardini R, Di Rosa, M, Barbagallo, I, Distefano A, et al. The biochemical and pharmacological properties of ozone: the smell of protection in acute and chronic diseases. Int J Mol Sci 2019;20:634.

1273

Rev Mex Cienc Pecu 2021;12(4):1264-1275

17. Driscoll KE, Simpson L, Carter J, Hassenbein D, Leikauf GD. Ozone inhalation stimulates expression of a neutrophil chemotactic protein, macrophage inflammatory protein 2. Toxicol Appl Pharm 1993;119(2):306-309. 18. Chang MMJ, Wu R, Plopper CG, Hyde DM. IL-8 is one of the major chemokines produced by monkey airway epithelium after ozone-induced injury. Am J PhysiolLung C 1998;275(3):L524-L532. 19. Sheldon M, Croning J, Goetze L, Danofrito G, Schubert H. Defining postpartum uterine disease and the mechanisms of infection and immunity in the female reproductive tract in cattle. Biol Reprod 2009;81(6):1025–1032. 20. Santos TM, Bicalho RC. Diversity and succession of bacterial communities in the uterine fluid of postpartum metritic, endometritic and healthy dairy cows. Plos One 2012;7(12):e53048. 21. Dervishi E, Zhang G, Hailemariam D, Goldansaz SA, Deng Q, Dunn SM, et al. Alterations in innate immunity reactants and carbohydrate and lipid metabolism precede occurrence of metritis in transition dairy cows. Res Vet Sci 2016;104:30-39. 22. Dini P, Farhoodi M, Hostens M, Van Eetvelde M, Pascottini OB, Fazeli MH, Opsomer G. Effect of uterine lavage on neutrophil counts in postpartum dairy cows. Anim Reprod Sci 2015;158:25-30. 23. Ill-Hwa K, Hyun-Gu K, Jae-Kwan J, Tai-Young H, Young-Hun J. Inflammatory cytokine concentrations in uterine flush and serum samples from dairy cows with clinical or subclinical endometritis. Theriogenology 2014;82(3):427-432. 24. Healy LL, Cronin JG, Sheldon IM. Endometrial cells sense and react to tissue damage during infection of the bovine endometrium via interleukin 1. Sci Rep 2014;4(1):19. 25. Foley C, Chapwanya A, Callanan JJ, Whiston R, Miranda-CasoLuengo R, Lu J, et al. Integrated analysis of the local and systemic changes preceding the development of post-partum cytological endometritis. 2015 BMC Genomics;16(1):811. 26. Ahn SH, Edwards AK, Singh SS, Young SL, Lessey BA, Tayade C. IL-17A contributes to the pathogenesis of endometriosis by triggering proinflammatory cytokines and angiogenic growth factors. J Immunol 2015;195(6):2591-2600. 27. Hirata T, Osuga Y, Hamasaki K, Yoshino O, Ito M, Hasegawa A, et al. Interleukin (IL)-17A stimulates IL-8 secretion, cyclooxygensase-2 expression, and cell proliferation of endometriotic stromal cells. Endocrinology 2008;149(3):1260–1267.

1274

Rev Mex Cienc Pecu 2021;12(4):1264-1275

28. Wei A, Feng H, Jia XM, Tang H, Liao YY, Li BR. Ozone therapy ameliorates inflammation and endometrial injury in rats with pelvic inflammatory disease. Biomed Pharmacother 2018;107:1418-1425. 29. Asadi S, Farzanegi P, Azarbayjani MA. Effect of exercise, ozone and mesenchymal stem cells therapies on expression of IL-10 and TNF-α in the cartilage tissue of overweight rats with knee osteoarthritis. Soc Determ Health 2018;4(3):162-170.

1275

https://doi.org/10.22319/rmcp.v12i4.5625 Technical note

In silico analysis of gene expression in granulosa cells of preovulatory follicles in two species of bovines

Jesús Alfredo Berdugo-Gutiérrez a* Ariel Marcel Tarazona-Morales b José Julián Echeverry-Zuluaga a Albeiro López-Herrera a

Universidad Nacional de Colombia- Sede Medellín. Facultad de Ciencias Agrarias. Grupo de Investigación BIOGEM. Carrera 65 No 59 a 110. Medellín, Colombia. b

Universidad Nacional de Colombia- Sede Medellín. Facultad de Ciencias Agrarias. Grupo de Investigación BIOGENESIS.

*Corresponding author: jaberdugog@unal.edu.co

Abstract: Buffaloes and cattle are two species of bovines with great similarity in their reproductive physiology, but at the same time with great difference in their reproductive parameters. The objective of this work is to compare gene expression in granulosa cells of preovulatory follicles of these two species, based on information available in the literature, existing transcriptome repositories and functional analysis using Ingenuity Pathway Analysis. Only two independent studies comparing buffalo and cattle in terms of gene expression in granulosa cells of preovulatory follicles were found. Expression data were analyzed independently and in combination. It was found that, between buffaloes and cattle, there is practically no correspondence between the processes evaluated, neither in the canonical pathways, nor in the upstream regulators, only some correspondence is found between the networks and physiological aspects of each process. It is concluded that each species has a different way of carrying out the same process and that each event should be studied according to the needs of the researchers. 1276

Rev Mex Cienc Pecu 2021;12(4):1276-1291

Key words: Bovines, Granulosa, Transcriptomics, Follicle, In Silico.

Received: 25/02/2020 Accepted: 22/12/2020

Buffaloes (Bubalus bubalis) and cattle (Bos taurus) are bovines closely related that are only differentiated by their mitochondrial DNA(1). Buffaloes and cattle are seasonal polyestrous, with two or three follicular waves per estrous cycle(2); however, under the same environmental and management conditions, their reproductive function is different, evidenced by the birth rate, expression of heat and response to reproductive biotechnologies. It has also been described that the buffalo has smaller ovaries(3), different follicular diameter at the time of deviation and ovulation(4), lower quality of oocytes and lower rate of embryo production compared to cattle. Li et al(5) found 40 loci (associated with 28 genes) that could be related to reproductive parameters such as age at first, second and third calving, days open, services per conception and calving interval(5,6). The formation of a competent oocyte depends on follicular development, in one the formation of a preantral follicle with an oocyte capable of forming the individual and the second is the development of this follicle until ovulation, associated with all the endocrine changes that must happen in the female to achieve it(7,8). The control of the follicular population depends on the function performed by the antiMüllerian hormone (AMH), those who are going to ovulate must acquire receptors for follicle-stimulating hormone (FSH), finally some follicle gains receptors for LHr(8),which generates a decrease in the speed of growth that is maintained until the preovulatory peak of LH(9,10). It has been reported that the buffalo oocyte is of poor quality when evaluated with the parameters normally used for cattle, and although the reasons are not known in detail, it has been proposed as a cause: an adverse follicular microenvironment, which has motivated researchers to study the proteins of the buffalo follicular fluid(11). The existing communication between granulosa cells and the oocyte has been shown to play a critical role in producing good quality oocytes(12). Nowadays, it is feasible the in-depth analysis of reproductive events in the female bovine. It is undeniable the progress achieved with microarrays and other systems used in transcriptomics, the data are deposited in repositories, which can be analyzed and allow the researcher to evaluate their premises. However, it is a heterogeneous base due to all the technical aspects and computational tools used for its analysis(13). In a recent study, Khan et al(10) generated an interactive interface called GranulosaIMAGE, which provides information on gene expression profiles and their

1277

Rev Mex Cienc Pecu 2021;12(4):1276-1291

isoforms in granulosa cells of cattle in different states of folliculogenesis (http://emb bioinfo.fsaa.ulaval.ca/granulosaIMAGE/). An important tool is Ingenuity Pathway Analysis (IPA), which is a database used for the analysis, integration and interpretation of data related to experiments based on information obtained by RNA-seq, principally, IPA allows, in a single analysis, identifying regulatory molecules, which facilitates the explanation of expression patterns, predicting the consequences of suggested control on cell biology and on the appearance of diseases(14). The program makes the calculations based on algorithms and experimental data(15), in which the genes differentially expressed in the experiment are associated with those that have been most frequently reported on a particular function or metabolic pathway(16) and its control systems(17). Developments in bioinformatics allow the study of biological phenomena in a complex way: in this case, the differences in the gene expression of buffalo and cattle follicles, in a more global way, which allow at least to consider all the possible genes that are expressed at a given time, showing the details of gene expression and the possible alternatives that nature has generated to carry out the same process. The objective of this work is to evaluate whether there are differences in the gene expression of granulosa cells of buffalo and cattle preovulatory follicles tending to seek explanations of the differential of the response to reproductive biotechnologies observed between the aforementioned species. This work was carried out in two phases: the first, an exhaustive bibliographic search was carried out in the databases of PUBMED and Google Scholar, focusing on information corresponding to the analysis of gene expression between buffaloes and cows and whose files were deposited in GEO (Gene Expression Omnibus) until March 2018, the second, the analysis of the reports found was carried out. The inclusion criterion was: experiments where there was comparison of data; or if there was no comparison, that the data were obtained in the same way and processed in a similar way. Two studies of transcriptomes of preovulatory follicle were found(18,19). In the case of cows, RNA was extracted with RNeasy mini kit (Qiagen) and in buffalo with TRIZOL followed by purification with RNeasy mini kit, cDNA was obtained in both cases, and they were hybridized with an Affimetrix Chip (Affymetrix Gene - Chip Bovine Genome Arrays), which contained 24,128 probes, representing 23,000 transcripts and their variants, including 19,000 unigene clusters. Those genes with a change in expression ≥2 with a false discovery rate (FDR < 0.05) were considered as expressed differently, subsequently, a semi-quantitative RT-PCR was performed for the validation of the results with the following genes: LH receptor (LHR), progesterone receptor (PR) and cyclooxygenase COX-2 in buffaloes, and two cytochrome P450 genes related to estrogen production, Cytochrome P450 CPY19A1, CPY17A1, 18s, for cattle. 1278

Rev Mex Cienc Pecu 2021;12(4):1276-1291

Subsequently, the raw data from each microarray were corrected by background noise removal and normalization (loess) using the FlexArray 1.6.1 software, and all data were exported to excel (Microsoft Office) files to be functionally analyzed using Ingenuity® Pathway Analysis (IPA). UMD Bos taurus 3.1.1 was used as the comparison genome for both cases since the buffalo genome is not yet fully sequenced. It was obtained from a list of differentially expressed genes of the preovulatory follicles of each species and this difference was quantified, they were grouped according to their biological function and potential upstream regulators. The information was processed individually and compared between the two species. The program works by assigning a probabilistic value to the association between over- or under-expressed genes and major biological functions. For the analysis of upstream regulators, IPA® compares the results of the experiment with its own database of the known effects of genes and molecules on expression. Two values are calculated from each regulator, an overlap value (overlap p) and an activation value (Z score), which corresponds to a calculated numerical average of the known effects of the molecule or gene (up or down regulation) and their respective targets. A Z value is considered significant when it has a value greater than 2 (Z-score > 2) for activation and (Z-score < 2) for inhibition, intermediate values are considered not to be attributable to the experimentation(14). Twenty-one reports on gene expression in bovine granulosa cells in which there was at least one database deposited were found, and of these, only one had information on buffaloes. There were no reports on the comparison of differential gene expression between buffaloes and cows. Finally, the requirements were met by two reports: “Transcriptome profiling of granulosa cells of bovine ovarian follicles during growth from small to large antral sizes”, access number GSE39589 with four repetitions(19), and “Buffalo Gene expression profiling of preovulatory follicle in the buffalo cow: effects of increased IGF-I concentration on periovulatory events”, access number GSE11312, with three repetitions(18). In the initial works, it is reported that, in buffaloes, there are 110 differentially expressed genes that belong to 14 metabolic pathways according to the Gene Ontology database, for cows, 446 genes belonging to 10 metabolic pathways were found. The IPA analysis shows that the most important canonical metabolic pathways associated with the expression pattern observed in the buffalo were: Protein ubiquitination, mitochondrial dysfunction, oxidative phosphorylation and signaling associated with the estrogen receptor and sirtuins, in cows, the most important canonical pathways are the synthesis of triacylglycerides, signal translator and activator of transcription 3 (STAT3), phagosome maturation, Janus Kinase 2 (JAK 2) Protein in the signaling of cytokine-like hormones and that of oncostatin (Table 1).

1279

Rev Mex Cienc Pecu 2021;12(4):1276-1291

Table 1: Main metabolic pathways in the buffalo and cow follicle Pathway p-value Overlap (%) Molecules Buffalo follicle Protein ubiquitination 1.11 E -11 19.70 53/269 Mitochondrial dysfunction 2.41 E-11 22.30 42/188 Oxidative phosphorylation 7.80 E-10 25.20 30/119 Signals of the estrogen receptor 9.46 E -10 23.90 32/134 Sirtuin signaling 3.46 E -08 16.00 52/325 Cow follicle Triacylglycerol biosynthesis 1.41 E-03 6.90 4/58 STAT3 pathway 1.83 E -03 4.80 5/104 Phagosome maturation 1.97 E-03 3.90 6/155 Role of JAK2 signaling* 8.80 2.84 E -03 .3/34 Oncostatin M signaling 4.53 E-03 7.50 .3/40 *cytokine-like hormone.

The IPA analysis showed that the genes or molecules of the following pathways: HNF4A, RICTOR, EIF4E, 1-2-dithiole-3-thione, STI926 were activated in buffaloes, without being any characterized in buffaloes, and for cows, they were: transforming factor beta 1 (TGFB1), Estrogen receptor type B2 (ERBB2), dexamethasone, beta-estradiol, D-glucose (Table 2). Table 2: Main upstream regulators p-value Buffaloes HNF4A RICTOR EIF4E 1,2-dithiole-3-thione ST1926

2.70 E-27 2.15 E -17 1.38 E -15 4.9 E-15 5.64 E-15 Cows

TGFB1 ERBB2 Dexamethasone beta-estradiol D-glucose

7.64 E-09 1.2 E -08 1.3 E E-07 5.21 E-07 2.10 E -06

The most important functional networks for buffaloes were: 1) molecular transport, RNA trafficking and post-translational modifications, 2) cell signaling, post-translational modifications and protein synthesis, 3) cell assembly and organization, developmental and hereditary disorders, 4) post-transcriptional RNA modifications, protein synthesis and gene

1280

Rev Mex Cienc Pecu 2021;12(4):1276-1291

expression, cell maintenance and function, post-translational modifications, and protein folding. For cows 1) cell organization and assembly, developmental disorders and neurological diseases, 2) lipid metabolism, small molecule biochemistry, intracellular signaling and interaction, 3) cell death and survival, interaction between them and cancer, 4) molecular transport, cell signaling and vitamin and mineral metabolism (Table 3).

Table 3: Most important functional networks Name of networks and their functions

Score

Buffaloes Molecular transport, RNA trafficking and post-translational modifications Cell signaling, post-translational modifications and protein synthesis Cell assembly and organization, developmental and hereditary disorders Post-transcriptional RNA modifications, protein synthesis and gene expression Cell maintenance and function, post-translational modifications and protein folding Cows Name of networks and their functions Cell organization and assembly, developmental disorders and neurological diseases Lipid metabolism, small molecule biochemistry, intracellular signaling and interaction Cell death and survival, interaction between them and cancer Molecular transport, cell signaling and vitamin and mineral metabolism

153 146 141 139 123 Score 163 79 73 11

In this work, gene expression in preovulatory follicles between two closely related species was compared, the way to do it is a novel approach to have more knowledge. At first glance, there is no strict relationship between the concepts enunciated in the introduction and the results of the experiment. This fact can be considered to be discussed because before doing the analysis, the thought of the researchers was focused on the existing knowledge about endocrine control and follicle development in the species and the results show information associated with aspects related almost exclusively to cell and molecular biology. It is important to highlight the difficulty in finding comparable information, and given the biological approach of the writing, it is decided to avoid the technical discussion on the way of obtaining the data and its analysis, which is so frequent in this type of publications. In a previous work of the group(20), where the information reported in the two articles evaluated in this study is described, it is shown that in the preovulatory follicles of cows and buffaloes, there is only coincidence in the expression of three genes (20 %): tissue plasminogen activator (PLAT), steroidogenic acute regulator, (STAR), coagulation factor II receptor-like I (F2RL-1), with differences in expression levels (relative expression) 9.7 vs 17.5, 8.74 vs

1281

Rev Mex Cienc Pecu 2021;12(4):1276-1291

3.4, and 7.7 vs 5.3 times for PLAT, STAR and F2RL-1 respectively, showing the differences between species. Additionally, it has not been reported that any of the genes found have to do directly with ovulation, follicular development or that they are markers of the same biological processes. PLAT is a secreted serine protease that converts the proenzyme plasminogen into plasmin, a fibrinolytic protein. An increase in its function causes hyperfibrinolysis, which is evidenced by excessive bleeding, and a decrease in its function causes hypofibrinolysis, which is evidenced by thrombosis and embolism, it has been reported overexpressed in granulosa cells of ovulatory follicles and it has been associated with follicular rupture(21). STAR has an important role in the acute regulation of steroid hormone synthesis, allows the breakdown of cholesterol to pregnenolone to facilitate its transport from the outer membrane to the inner one in the mitochondria. In buffaloes, it has been reported that the expression is increased (up regulated) in granulosa cells and follicular wall after the bovine growth hormone treatment(18), additionally, a synergism between insulin-like growth factor 1 and gonadotropins to increase the STAR expression(22). F2RL-1 is a protein that belongs to the family of those that are associated with the type I receptor of G proteins, also has a function on the inflammatory response, in innate and adaptive immunity(23). Signaling through this gene (F2RL-1) mediates the in vitro cytogenesis of endothelial cells and promotes vasodilation and microvascular permeability, fundamental steps of angiogenesis. Overexpression of the F2RL-1 gene has been observed, partly explaining the growth changes of the blood vessels of the theca cells, and the invasion of the mural granulosa cells after follicular rupture(24). Although there is a low correspondence between the two species, common genes are associated with ovulation mechanisms, genes associated with the way the cell performs its function. No differentially expressed genes are observed associated with the phenomena that direct the process, such as gonadotropins or sex steroids. Consequently, a new way of viewing and analyzing the data obtained must be found since what was found is rather the description of how a phenomenon is executed, which, in this case, would be the proteolytic factors for the rupture of the follicle, the changes in the vasculature for the remodeling of the organ and the accumulation of estrogens to generate the LH peak. For some authors, ovulation has been associated with inflammation(25), it could then be assumed that the two species do the same, with a group of general master molecules and another of effectors that can be very specific and mark the differences observed. Protein ubiquitination is the most important pathway for the degradation of half-life regulatory proteins. Hatzirodos et al(20) found that this pathway is involved in the transition

1282

Rev Mex Cienc Pecu 2021;12(4):1276-1291

from a small to large follicle. Other researchers found it as a regulator of androgen receptors in humans(26). Mitochondria are the main oxygen consumers of the cell; the effect of the proper functioning of the pathway on oocyte competition for its role in the formation of reactive oxygen species has been reported(27). In women, mitochondrial transfer has been proposed as an alternative for the treatment of oocytes from patients with diseases that include alterations in the mitochondria(28), also in obese humans, that mitochondrial dysfunction is associated with alterations in fertility. In buffaloes, it has been reported that supplementation of maturation media to produce embryos in vitro, with cystine with or without cysteamine significantly increases the proportion of oocytes exhibiting normal fertilization, cleavage and blastocyst production(29). Oxidative phosphorylation is the process by which the cell produces ATP. Li et al(6) reported, in buffaloes, that oxidative phosphorylation is important for the early stages of follicular development. Its role in the ovulatory process given the hypoxic nature of the process has also been reported. Evidence that the follicle needs to produce more molecules for the hypoxic response in the preovulatory antral follicles has been shown (5). Sirtuins belong to class III of deacetylase enzymes that use NAD+ as a substrate to perform their function, it has been reported that there are 7 in mammals with multiple functions (SIRT 1-7), they have function as regulators of transcription in aging, metabolism, cancer, inflammation, DNA repair and cellular response to stress(30). SIRT1, SIRT2 and SIRT3 have been reported to have protective function for oocyte aging after ovulation, in addition, SIRT3 has a role in the detection of reactive oxygen species (ROS) in folliculogenesis and luteinization processes of granulosa cells(31). Pacella-Ince et al have described that low mRNA levels of mitochondrial SIRT 5 are associated with reduced ovarian reserve and ovarian aging in humans(32). Most important metabolic pathways in cows: Triacylglycerol biosynthesis. The effect of lipid droplets on oocyte quality and function is widely documented in the literature(33). Today, they are considered as a separate organelle with their own associated enzymes. In humans, the lipid profile of granulosa cells has been successfully associated in gestation, in cow oocytes, it has been associated with quality, and in humans with effect on maturation(34). Phagosome maturation is a process in which some particles that are internalized move on acidified structures, which are integrated into a mechanism of apoptosis. This process necessarily involves maturation, which can be seen by the sequential fusion of the different 1283

Rev Mex Cienc Pecu 2021;12(4):1276-1291

stages of lysosomes that end the formation of a phagolysosome. There is very little information about the role of this pathway in follicle formation or oocyte quality; it has been suggested as an alternative pathway for the control of oocyte death and that it can be activated during follicle formation for autophagy processes. Alteration of some genes encoding proteins for autophagy cause a large loss of oocytes, suggesting a role of autophagy in regulating their survival(35). Janus kinases are a family of 4 tyrosine kinases. These play an important role in cell growth, survival and differentiation; they are widely expressed in the preovulatory follicle and their expression is inhibited by intrafollicular injection, it has also been reported that in granulosa cells, IL-6 promotes FSH-induced VEGF expression by the JAK/STAT3 pathway(36). Cytokines are the main intercellular mediators, these activate in the ovary immune and nonimmune cells that facilitate the constant reorganization of the ovarian stroma through proteolytic pathways, facilitating modifications of the basement membrane of granulosa cells, and endothelial vascular invasion. Martins et al reported that receptors for oncostatin M are regulated in granulosa cells during follicular atresia, ovulation, and luteolysis, and that oncostatin protein from other cells regulate the function of cell viability genes in granulosa and luteal cells(37). Many molecules involved in the follicular development that affect signals for ovulation trigger the expression of cytokines such as TNFa, interleukin 7, and CDKN1A(38). When the comparison of gene expression between the two species is made and the 10 activated canonical pathways with the highest P value are analyzed, only a few are shared with the individual analyses, in the case of buffalo, 5 of the 10, while for cows only 1 (Table 4).

1284

Rev Mex Cienc Pecu 2021;12(4):1276-1291

Table 4: Comparison of the main metabolic pathways in the two species p-value

Relationship

Score- z

Sirtuins signaling pathway 5.02E+00 Role of CHK proteins. Proteins in cell cycle control 4.74E+00

1.63E-01

2.191

2.78E-01

1.897

Oxidative phosphorylation

4.61E+00

2.19E-01

-4.583

De novo biosynthesis of pyridine ribonucleotides 4.38E+00

2.89E-01

-1.941

Mitotic role of the Polo-like kinases

4.07E+00

2.46E-01

-1.667

Interconversion of pyrimidine ribonucleotides

3.93E+00

2.79E-01

-1.732

Androgen signaling

3.85E+00

1.83E-01

0.378

3-phosphoinositide degradation

3.76E+00

1.74E-01

-1.569

Regulation of eIF4 and p70S6K signals Biosynthesis of D-myo-inositol (1,4,5,6)tetrakisphosphate

3.67E+00

1.72E-01

0.632

3.65E+00

1.78E-01

-1.225

Metabolic pathways

Upstream regulators in buffaloes: Hepatocyte nuclear factor 4A (HNF4A) is involved in gluconeogenesis and lipid metabolism. This factor has been reported by Khan et al(11) as an upstream regulator in cow granulosa cells after being stimulated with FSH. RIPTOR is a gene that produces a molecule that accompanies the target of rapamycin. In human cells, it has been reported that an mTORassociated kinase is necessary for Ser473 to be phosphorylated, inhibiting the AkT/PKB metabolic pathway that is involved in apoptosis and oocyte maturation. The translation initiation factor, EIF4E, produces a protein that helps the start of translation by recruiting ribosomes at the 5’-end of the subunit, limiting the start of translation. Its function is reported to be increased in the transition from primordial follicle to primary follicle(39), in the oocyte for the initiation of mRNA translation associated with the continuation of meiosis, and in the inhibition of the TORC1 function for the consumption of amino acids. IPA also reports on the role of some regulatory molecules of gene function, evaluates genes associated with function control such as 1-2-dithiole-3-thione, which has effect on antioxidant enzymes, and ST1926, which is a retinoic acid-like molecule with effects on

1285

Rev Mex Cienc Pecu 2021;12(4):1276-1291

growth and differentiation(40). There are no reports of the action of these molecules on the function of granulosa cells. Upstream regulators in cows: The transforming factor beta-1 belongs to the superfamily of proteins of the transforming factors beta, they have been described in many regulatory activities in the ovary, follicular development and ovulation in different species. Landry et al report that it has a role in the production of a competent oocyte and in the induction of atresia in the case of persistent follicles(10). ERBB2 encodes a tyrosine kinase that belongs to the family of epidermal growth receptors, amplification or overexpression of this gene has been associated with breast and ovarian tumors(30) and follicular development(19), in the regulation of the expression of the TP53 tumor suppression gene during the proliferation of granulosa cells under the stimulation of FSH and after the LH peak(41). Estrogens, Dexamethasone and D-Glucose are molecules reported with effects on follicular development in cattle(42). Estrone and estradiol are steroid hormones synthesized in the ovary, critical for reproductive function, the main enzyme of this pathway is the aromatase CPY19A1(43). At this point, it is easily understandable that, despite being bovines, each species has its different way of performing the phenomenon, and that is one of the important results of this work, the evidence shows that each species develops the follicle in a different way. Since it is observed that each species ovulates with different events, the objective of explaining the reproductive differences in reproductive behavior between these two species cannot be met. The high correspondence of the result obtained when analyzing the most frequent biological networks or functions in the studied event between the two species analyzed, it is shown that both are having the same biological event: growth of a structure within the organism with high metabolic production, cell proliferation, production of signals for all the events that will happen, whose consequence is ovulation. The comparison between networks shows how they do the same with a different number of molecules, buffaloes involve more molecules than cows, which could give them an advantage for ovulation, having more options of cellular pathways available. In the comparative analysis between species, buffaloes do not only share the pathway of lipid metabolism with cows, suggesting that there should be differences at this level in follicular fluid or oocytes, with no reports to date in the literature. Only a few publications in reproduction have tried to make comparisons between buffaloes and cows with a global approach to the problem, it is interesting to see how the evidence of 1286

Rev Mex Cienc Pecu 2021;12(4):1276-1291

the differences is increasing. Reports on differences in specific genes in specific events, such as signaling for meiosis restart(44), or the role of transforming factors on follicular development(45), can easily be found. Much information is known about the physiology of granulosa cells and their role in follicular development in cows, but it is scarce in buffaloes and much less its comparison. There is only one article in the study of the transcriptomics of buffalo granulosa cells, using RNA-seq and slaughter plant material, finding differential expression in 595 genes when comparing the initial states with the end states of follicular development(5). The comparison between species is a novel approach in the area of reproductive biology, studying the same phenomenon on equal conditions between buffaloes and cows shows how each species has developed its own way of carrying out its processes, that the regulation of the same have different pathways between Bos indicus and Bubalus bubalis, so the phenomena must be studied in a particular way for each species and that the extrapolation of the information obtained between species should be avoided and be the basis for the analysis of the complexity of the phenomena studied, with the obligation to see them in a different, non-reductionist way.

Acknowledgements

The authors would like to express their gratitude to the National University of ColombiaMedellín campus and the Colombian Association of Buffalo Breeders for the financing of this work. Literature cited: 1.

Buntjer JB, Otsen M, Nijman IJ, Kuiper MT, Lenstra JA. Phylogeny of bovine species based on AFLP fingerprinting. Heredity 2002;88(1):46-51.

Berdugo J, Posada I, Angel J. Need of reevaluation of the parameters of semen straws to be used in artificial insemination programs. Ital J Anim Sci 2007;6(suppl 2):619-21.

Drost M. Bubaline versus bovine reproduction. Theriogenology 2007;68(3):447-449.

Santos SS, Ferreira MA, Lima MY, Sampaio RV, Cordeiro MS, Silva TV, et al. Quantification, morphology and ultrastructure of preantral follicles of buffalo (Bubalus bubalis) foetuses. Reprod Dom Anim 2011;46(1):e17-22.

1287

Rev Mex Cienc Pecu 2021;12(4):1276-1291

Gimenes LU, Fantinato Neto P, Arango JS, Ayres H, Baruselli PS. Follicular dynamics of Bos indicus, Bos taurus and Bubalus bubalis heifers treated with norgestomet ear implant associated or not to injectable progesterone. Anim Reprod 2009;6(1):256.

Li J, Liu J, Campanile G, Plastow G, Zhang C, Wang Z, et al. Novel insights into the genetic basis of buffalo reproductive performance. BMC Genom 2018;19(1):1-1.

Blondin P, Vigneault C, Nivet AL, Sirard MA. Improving oocyte quality in cows and heifers-What have we learned so far? Anim Reprod 2018;9(3):281-290.

Baldrighi JM, Sá Filho MF, Batista EOS, Lopes RN, Visintin JA, Baruselli PS, et al. Anti-mullerian hormone concentration and antral ovarian follicle population in Murrah heifers compared to Holstein and Gyr kept under the same management. Reprod Domest Anim 2014;49(6):1015–1020.

Nivet AL, Bunel A, Labrecque R, Belanger J, Vigneault C, Blondin P, et al. FSH withdrawal improves developmental competence of oocytes in the bovine model. Reproduction 2012;143(2):165–171.

10. Carvalho NA, Soares JG, Porto Filho RM, Gimenes LU, Souza DC, Nichi M, et al. Equine chorionic gonadotropin improves the efficacy of a timed artificial insemination protocol in buffalo during the nonbreeding season. Theriogenology 2013;79(3):423428. 11. Khan DR, Landry DA, Fournier É, Vigneault C, Blondin P, Sirard MA. Transcriptome meta-analysis of three follicular compartments and its correlation with ovarian follicle maturity and oocyte developmental competence in cows. Physiol Genom 2016;48(8):633-643. 12. Fu Q, Huang Y, Wang Z, Chen F, Huang D, Lu Y, et al. Proteome profile and quantitative proteomic analysis of buffalo (Bubalus bubalis) follicular fluid during follicle development. Int J Mol Sci 2016;17(5):618. 13. Mondadori RG, Luque MC, Santin TR, Báo SN. Ultrastructural and morphometric characterization of buffalo (Bubalus bubalis) ovarian preantral follicles. Anim Rep Sci 2007;97(3-4):323-333. 14. Robert C. Microarray analysis of gene expression during early development: A cautionary overview. Reproduction 2010;140(6);787–801. 15. Krämer A, Green J, Pollard Jr J, Tugendreich S. Causal analysis approaches in ingenuity pathway analysis. Bioinformatics 2014;30(4):523-530.

1288

Rev Mex Cienc Pecu 2021;12(4):1276-1291

16. Lamb J, Crawford ED, Peck D, Modell JW, Blat IC, Wrobel MJ, et al. The Connectivity Map: using gene-expression signatures to connect small molecules, genes, and disease. Science 2006;313(5795):1929-1935. 17. Abatangelo L, Maglietta R, Distaso A, D'Addabbo A, Creanza TM, Mukherjee S, et al. Comparative study of gene set enrichment methods. BMC Bioinfo 2009;10(1):1-2. 18. Pollard Jr J, Butte AJ, Hoberman S, Joshi M, Levy J, Pappo J. A computational model to define the molecular causes of type 2 diabetes mellitus. Diab Tech Ther 2005;7(2):323-336. 19. Rao JU, Shah KB, Puttaiah J, Rudraiah M. Gene expression profiling of preovulatory follicle in the buffalo cow: effects of increased IGF-I concentration on periovulatory events. PloS One 2011;6(6):e20754. 20. Hatzirodos N, Hummitzsch K, Irving-Rodgers HF, Harland ML, Morris SE, Rodgers RJ. Transcriptome profiling of granulosa cells from bovine ovarian follicles during atresia. BMC Genom 2014;15(1):1-26. 21. Berdugo JA, Echeverri JJ, Tarazona AM, López A. Differences in transcriptomic data from preovulatory follicles of buffalo (Bubalus bubalis) and (Bos indicus) cattle: A meta-analysis No Title. Anim Reprod 2018;15(Suppl 1):1161. 22. Lussier JG, Diouf MN, Lévesque V, Sirois J, Ndiaye K. Gene expression profiling of upregulated mRNAs in granulosa cells of bovine ovulatory follicles following stimulation with hCG. Reprod Biol Endocrinol 2017;15(1):1-6. 23. Natesampillai S, Kerkvliet J, Leung PC, Veldhuis JD. Regulation of Kruppel-like factor 4, 9, and 13 genes and the steroidogenic genes LDLR, StAR, and CYP11A in ovarian granulosa cells. Am J Physiol-End Metab 2008;294(2):E385-91. 24. Castilho AC, Dalanezi FM, Franchi FF, Price CA, Ferreira JC, Trevisol E, et al. Expression of fibroblast growth factor 22 (FGF22) and Its receptor, FGFR1B, during development and regression of bovine corpus luteum. Theriogenology 2019;125:1-5. 25. Harlow CR, Hillier SG. Connective tissue growth factor in the ovarian paracrine system. Mol Cell End 2002;187(1-2):23-27. 26. Ruebel ML, Cotter M, Sims CR, Moutos DM, Badger TM, Cleves MA, et al. Obesity modulates inflammation and lipid metabolism oocyte gene expression: a single-cell transcriptome perspective. J Clin End Metab 2017;102(6):2029-38. 27. Lim JJ, Lima PD, Salehi R, Lee DR, Tsang BK. Regulation of androgen receptor signaling by ubiquitination during folliculogenesis and its possible dysregulation in polycystic ovarian syndrome. Scientific Reports 2017;31;7(1):1-2. 1289

Rev Mex Cienc Pecu 2021;12(4):1276-1291

28. Benkhalifa M, Ferreira YJ, Chahine H, Louanjli N, Miron P, Merviel P, et al. Mitochondria: participation to infertility as source of energy and cause of senescence. Int J Biochem Cell Biol 2014;55:60-64. 29. Cecchino GN, Seli E, Da Motta EL, García-Velasco JA. The role of mitochondrial activity in female fertility and assisted reproductive technologies: overview and current insights. Reprod Biomed Online 2018;36(6):686-697. 30. Gasparrini B, Boccia L, Marchandise J, Di Palo R, George F, Donnay I, et al. Enrichment of in vitro maturation medium for buffalo (Bubalus bubalis) oocytes with thiol compounds: Effects of cystine on glutathione synthesis and embryo development. Theriogenology 2006;65(2):275–287. 31. Li J, Li Z, Liu S, Zia R, Liang A, Yang L. Transcriptome studies of granulosa cells at different stages of ovarian follicular development in buffalo. Anim Reprod Sci 2017;(187):181–192. 32. Sirotkin AV. The role and application of sirtuins and mTOR signaling in the control of ovarian functions. Cells 2016;5(4):42. 33. Fu H, Wada-Hiraike O, Hirano M, Kawamura Y, Sakurabashi A, Shirane A, et al. SIRT3 positively regulates the expression of folliculogenesis-and luteinization-related genes and progesterone secretion by manipulating oxidative stress in human luteinized granulosa cells. Endocrininol 2014;155(8):3079-3087. 34. Pacella-Ince L, Zander-Fox DL, Lane M. Mitochondrial SIRT5 is present in follicular cells and is altered by reduced ovarian reserve and advanced maternal age. Reprod Fert Develop 2014;26(8):1072-1083. 35. Dunning KR, Russell DL, Robker RL. Lipids and oocyte developmental competence: the role of fatty acids and b-oxidation. Reproduction 2014;148(1):R15-27. 36. Fayezi S, Ghaffari-Novin M, Darabi M, Norouzian M, Nouri M, Farzadi L, et al. Primary culture of human cumulus cells requires stearoyl-coenzyme a desaturase 1 activity for steroidogenesis and enhancing oocyte in vitro maturation. Reprod Sci 2018;(6):844-853. 37. Gawriluk TR, Hale AN, Flaws JA, Dillon CP, Green DR, Rucker EB. Autophagy is a cell survival program for female germ cells in the murine ovary. Reproduction 2011;141(6):759. 38. Yang M, Wang L, Wang X, Wang X, Yang Z LJ. IL-6 promotes FSH-induced VEGF expression through JAK/STAT3 signaling pathway in bovine granulosa cells. Cell Physiol Biochem 2017;44(1):293–302.

1290

Rev Mex Cienc Pecu 2021;12(4):1276-1291

39. Martins KR, Haas CS, Ferst, JG, Rovani, MT, Goetten AL, Duggavathi R. et al. Oncostatin M and its receptors mRNA regulation in bovine granulosa and luteal cells. Theriogenology 2019;125;324–330. 40. Stassi AF, Baravalle ME, Belotti EM, Rey F, Gareis NC, Díaz PU, et al. Altered expression of cytokines IL-1α, IL-6, IL-8 and TNF-α in bovine follicular persistence. Theriogenology 2017;97:104-112. 41. Ernst EH, Grøndahl ML, Grund S, Hardy K, Heuck A, Sunde L, Franks S, et al. Dormancy and activation of human oocytes from primordial and primary follicles: molecular clues to oocyte regulation. Hum Reprod 2017;32(8):1684-1700. 42. El Hajj H, Khalil B, Ghandour B, Nasr R, Shahine S, Ghantous A, et al. Preclinical efficacy of the synthetic retinoid ST1926 for treating adult T-cell leukemia/lymphoma. Blood 2014;124(13):2072-2080. 43. Sirotkin AV, Ovcharenko D, Benčo A, Mlynček M. Protein kinases controlling PCNA and p53 expression in human ovarian cells. Funct Integr Genom 2009;(2):185-195. 44. Noma N, Kawashima I, Fan HY, Fujita Y, Kawai T, Tomoda Y, et al. LH-induced neuregulin 1 (NRG1) type III transcripts control granulosa cell differentiation and oocyte maturation. Mol End 2011;25(1):104-116. 45. Baufeld A, Vanselow J. A tissue culture model of estrogen-producing primary bovine granulosa cells. Journal of visualized experiments: JoVE 2018;(139):58208.

1291

https://doi.org/10.22319/rmcp.v12i4.5714 Technical note

Standardized ileal digestibility of protein and amino acids of sesame meal in growing pigs

Tércia Cesária Reis de Souza a Araceli Aguilera Barreyro a Gerardo Mariscal Landín b*

Universidad Autónoma de Querétaro. Facultad de Ciencias Naturales, Querétaro, México.

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, CENID-Fisiología, Ajuchitlán 76280, Querétaro, México.

*Corresponding author: mariscal.gerardo@inifap.gob.mx

Abstract: To determine the apparent (AID) and standardized ileal digestibility (SID) of the amino acids of sesame meal (SM), 10 pigs of 78.6 ± 5.2 kg, housed in metabolic cages, were used; located in a room with controlled temperature (19 to 22 °C). The pigs were implanted with a “T” cannula in the ileum and fed twice a day, at 2.5 times their digestible energy requirement for maintenance (110 kcal per kg of LW0.75). Two diets were prepared with 160 g of CP/kg of feed: one with SM and one with soybean meal (SBM). The results show that the AID of the following amino acids was higher in SM than in SBM: arginine (P<0.0001) 7.3 units; alanine, glutamic acid, glycine, methionine and valine, it was on average 6.8 units higher (P<0.01); cysteine, it was higher by 11.5 units (P<0.05). On the contrary, the AID of proline (P<0.0001), leucine (P<0.01) and lysine (P<0.05) was lower by 21.9, 2.8 and 2.5 units, respectively, in SM than in SBM. The SID of arginine (P<0.0001) was 6.7 % higher; valine (P<0.001) 10.6 % higher, alanine, glutamic acid, glycine and threonine (P<0.01), it was higher on average by 6.4 %; and cysteine, histidine, isoleucine, and tyrosine (P<0.05), it was 7.45 % higher in SM than in SBM. The SID of proline (P<0.01) and leucine (P<0.05) was lower by 4.7 and 2.1 SM than in SBM. It is concluded that SM is a good source of digestible amino acids for pig feeding. Key words: Sesame meal, Ileal digestibility, Amino acids, Pigs. 1292

Rev Mex Cienc Pecu 2021;12(4):1292-1304

Received: 24/06/2020 Accepted: 25/11/2020 The high cost of soybean meal has led to the search for alternative sources of protein to be used in pig feeding(1). Within these alternative sources, sesame is characterized by its high content of oil, 40 to 50 %, and 27 % protein(2). As a by-product of the extraction of sesame oil, sesame meal is obtained, which is characterized by containing between 45 and 50 % protein, 10 to 12 % ether extract in the meal obtained by pressure and between 1 and 2 % in that obtained with solvents(3). This meal is characterized by being a good source of amino acids, mainly sulfur amino acids, arginine and leucine; however, it is poor in lysine (3). The use of a protein source depends on its contribution of amino acids, since feeds are formulated using the concepts of ideal protein(4) and standardized ileal digestibility of amino acids(5), the way in which the nutritional requirements of the pig are expressed(6,7). The use of these concepts and the availability of crystalline amino acids (Lysine-HCL, L-Threonine, LTryptophan and DL-Methionine) have allowed the inclusion of different protein sources in the pig’s diet, although these sources are deficient in some of those amino acids, as would be the case of sesame meal with respect to lysine. However, the available information on the digestibility of protein and amino acids of sesame meal in pigs is scarce and contradictory, as low digestibility of sesame amino acids has been reported in growing pigs(8). Therefore, the objective of this work was to determine the ileal digestibility in growing pigs of the amino acids of sesame meal obtained by pressure, since the existing information has been obtained in meals extracted with solvents. The work was carried out in the experimental farm of CENID Physiology of INIFAP. The protocol was reviewed and approved by the Bioethics Committee of the Faculty of Natural Sciences of the Autonomous University of Querétaro. The handling used in the animals respected the guidelines of the Official Mexican Standard for the production, care and use of laboratory animals(9), as well as those of the International Guiding Principles for Biomedical Research Involving Animals(10). Ten pigs (castrated males) from a cross (Landrace × Large-White) were used, with an average weight of 78.6 ± 5.2 kg, divided into two groups of 5 pigs. The pigs were housed in individual metabolic cages, provided with a feeder and drinker; located in a temperature controlled room, which fluctuated between 19 and 22 °C. The four days after their entry to the experimental unit served as a period of adaptation to the metabolic cages; for the first three days, they were offered the diet they previously consumed; on the fourth day, they fasted and on the fifth day, the pigs were implanted with a “T” cannula at the level of the terminal ileum(11). The post-surgical period lasted 21 days, in which the pigs had free access to water and the feed offered during that period was gradually increased until reaching pre-surgery consumption. During the experimental period, the pigs were fed twice a day at the rate of 2.5 1293

Rev Mex Cienc Pecu 2021;12(4):1292-1304

times their digestible energy requirement for maintenance, which was estimated at 110 kcal per kilo of LW0.75(12). Sesame meal was compared with soybean meal (Table 1). Two experimental diets were formulated with these raw materials (Table 2), a diet with sesame meal (SM) and another with soybean meal (SBM), both diets provided 160 g of CP/ kg of feed; the level of inclusion of both meals depended on their protein content. To both diets, sucrose was added at the rate of 65 g/kg to increase their palatability, a source of fiber (Arbocel™) 40 g/kg and corn oil at a rate of 30 g/kg. Vitamins and minerals were added to provide or exceed the requirements recommended by the NRC(6), chromium oxide was included at the rate of 3 g/kg as a digestibility marker. Table 1: Composition of the raw materials Sesame meal

Soybean meal

Crude protein Ether extract NDF TIA, mg TIA/g1

53.50 11.10 17.50 1.00

50.10 1.30 13.80 6.00

PA, g sodium phytate/100 g2

4.00

2.80

Alanine Arginine Aspartic acid Glutamic acid Glycine Histidine Isoleucine Leucine Lysine Methionine + Cysteine Phenylalanine Proline Serine Threonine Tyrosine Valine

1.90 4.90 3.60 7.50 2.10 1.00 1.50 2.80 1.00 2.10 1.80 1.60 1.90 1.50 1.60 1.90

2.00 3.40 5.40 9.30 2.20 1.20 2.20 3.40 2.80 1.40 2.50 3.70 2.30 1.90 1.80 2.30

TIA= trypsin inhibitor activity. 2 PA= phytic acid.

1294

Rev Mex Cienc Pecu 2021;12(4):1292-1304

Table 2: Composition of experimental diets Sesame meal

Soybean meal

Corn starch Soybean meal Sesame meal Sugar Cellulose1 Corn oil Salt Calcium carbonate Dicalcium phosphate Mineral premix2

53.60

46.37 36.40

30.00 6.50 4.00 3.00 0.40 0.07 1.90 0.07

6.50 4.00 3.00 0.40 1.10 1.70 0.07

Vitamin premix3 Chromium oxide Chemical analysis: Crude protein NDF

0.16 0.30

16.30 8.80

16.10 11.90

Arbocel= fiber concentrate. Mineral premix= it provides the following amounts per kilo of feed: Co, 0.60 mg; Cu, 14 mg; Fe, 100 mg; I, 0.80 mg; Mn, 40 mg; Se, 0.25 mg; Zn, 120 mg. 3 Vitamin premix= it provides the following amounts per kilo of feed: vitamin A, 4,250 IU/g; vitamin D3, 800 IU/g; vitamin E, 32 IU/g; vitamin K3 menadione, 1.5 mg/kg; biotin, 120 mg/kg; cyanocobalamin, 16 μg/kg; choline, 250 mg/kg; folic acid, 800 mg/kg; niacin, 15 mg/kg; pantothenic acid 13 mg/kg; pyridoxine 2.5 mg/kg; riboflavin 5 mg/kg; thiamine, 1.25 mg/kg. 2

Water was provided freely through a nipple drinker located on a wall of the metabolic cage. The experimental period lasted 7 d (five days of adaptation to the diet and two for the collection of the ileal digesta). The ileal digesta was collected in plastic bags (11 cm long × 5 cm wide), 10 ml of a solution of HCl 0.2 M was added to the bags in order to block all bacterial activity. The bags were fixed to the cannula with a band at 0800 h on day one and the ileal digesta was collected from 0800 to 1800 h. As the bags were filled with the ileal digesta, this was transferred to a container to proceed immediately to freeze it at -20 °C until lyophilization. Digesta samples from the experiment were lyophilized and subsequently ground through a 0.5 mm mesh with a laboratory mill (Arthur H. Thomas Co. Philadelphia, PA). The following analyses were performed on the experimental diets and ileal digesta samples: dry matter (DM) and crude protein (CP) according to methods 934.01 and 976.05 of the AOAC (13), chromium oxide according to Fenton and Fenton(14). The preparation of the samples for the determination of AA was carried out following method 994.12 of the AOAC(13), which 1295

Rev Mex Cienc Pecu 2021;12(4):1292-1304

consists of hydrolyzing the samples at 110 °C for 24 h in HCl 6M; in the case of methionine and cysteine, a previous oxidation with performic acid was carried out. AA analyses were performed by reversed-phase chromatography according to the method described by Henderson et al(15) on a Hewlett Packard HPLC, model 1100. The trypsin inhibitor activity (TIA) of the raw materials and experimental diets was determined according to the method described by Kakade et al(16); phytic acid was analyzed according to Vaintraub and Lapteva(17); and neutral detergent fiber (NDF) was analyzed according to van Soest et al(18). Calculations to estimate the apparent ileal digestibility (AID) of protein, amino acids, and energy of the experimental diets were performed using the equation used by Fan and Sauer(19). AID = [1 – [(ID × AF)/(AD × IF)]] × 100 Where AID is the apparent ileal digestibility of a nutrient in the diet in percentage, ID is the concentration of the indicator in the diet (mg/kg of DM), AF is the concentration of the nutrient in the ileal digesta (mg/kg of DM), AD is the concentration of the nutrient in the diet (mg/kg of DM), IF is the concentration of the indicator in the ileal digesta (mg/kg of DM). Calculations to estimate the standardized ileal digestibility (SID) of protein and amino acids were performed using the formula proposed by Furuya and Kaji(20). SID = AID +[(EndoN/ConsN) × 100] Where SID is the standardized ileal digestibility of a nutrient in percentage. AID is the apparent ileal digestibility of a nutrient. EndoN is the endogenous amount excreted of the nutrient in mg/kg of dry matter consumed. ConsN is the amount of nutrient consumed in mg/kg of dry matter consumed. For the calculations, the endogenous reported by Mariscal-Landín and Reis de Souza(21) was used. Data on the AID and SID of protein and amino acids in growing pigs were analyzed using the GLM procedure of the SAS statistical package(22), according to a completely randomized design(23). Treatment means were compared using Tukey’s method(23). The differences were considered significant when (P<0.05), and a trend was recognized when (0.05<P<0.10). The results show that the pigs consumed completely their ration. Sesame meal had 6.8 % more CP; 42.9 % more phytic acid and 26.8 % more NDF than soybean meal. The ether extract content of sesame meal was 8.5 times higher (111 vs 13 g/kg) than that of soybean meal (Table 1). On the contrary, the trypsin inhibitor content was 6 times higher in soybean meal (6 mg/g) than in sesame meal (1 mg/g). Regarding the total amino acid content, sesame 1296

Rev Mex Cienc Pecu 2021;12(4):1292-1304

meal had 50 % more sulfur amino acid content (methionine + cysteine) and 44 % more arginine than soybean meal. In contrast, soybean meal had a lysine content 280 % higher than sesame meal, as in the case of proline 231 %; as well as 50 % more aspartic acid, 46 % more isoleucine, 38 % more phenylalanine and 26 % more threonine. The AID of the crude protein of sesame meal was higher (P<0.01) by 5.6 percentage units than that of soybean meal (Table 3). The AID of arginine was higher (P<0.0001) by 7.3 percentage units in sesame meal than in soybean meal; the digestibilities of alanine, glutamic acid, glycine, methionine and valine were on average 6.8 percentage units higher (P<0.01) in sesame meal than in soybean meal. The AID of cysteine was higher by 11.5 percentage units (P<0.05) in sesame meal than in soybean meal. On the contrary, the AID of proline (P<0.0001), as well as that of leucine (P<0.01) and lysine (P<0.05) was lower by 21.9, 2.8 and 2.5 percentage units, respectively, in sesame meal than in soybean meal (Table 3).

Table 3: Apparent ileal digestibility Sesame meal

Soybean meal Probability

SEM

Crude protein

83.8 a

78.2 b

0.01

0.8

Alanine Arginine Aspartic acid Cysteine Glutamic acid Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tyrosine Valine

76.1 a 92.9 a 83.6 72.9 a 90.5 a 82.1 a 90.8 a 82.8 84.4 b 91.6 b 83.4 a 82.2 59.6 b 84.1 76.9 76.2 78.5 a

67.8 b 85.6 b 85.3 61.6 b 87.1 b 77.0 b 87.1 b 81.4 87.2 a 94.1a 72.4 b 81.2 81.5 a 83.6 76.0 72.9 72.0 b

0.01 0.0001 NS 0.05 0.01 0.01 0.05 NS 0.01 0.05 0.01 NS 0.0001 NS NS NS 0.01

0.8 0.4 0.4 2.3 0.4 0.6 0.7 0.5 0.4 0.4 1.3 0.5 0.5 1 0.4 0.7 0.7

SEM= Standard error of the mean.

1297

Rev Mex Cienc Pecu 2021;12(4):1292-1304

The SID of the protein of sesame meal was higher (P<0.01) by 6.4 %. The SID of arginine (P<0.0001) was 6.7 % higher; of valine (P<0.001) 10.6 % higher, of the amino acids alanine, glutamic acid, glycine and threonine (P<0.01), it was higher on average by 6.4 %; and the SID of cysteine, histidine, isoleucine and tyrosine (P<0.05) was 7.45 % higher in sesame meal than in soybean meal. However, the SID of proline (P<0.01) and leucine (P<0.05) was 4.7 % and 2.1 % lower in sesame meal compared to those in soybean meal (Table 4).

SEM

Crude protein

Table 4: Standardized ileal digestibility Soybean Sesame meal Probability meal 91.6a 86.1b 0.01

Alanine Arginine Aspartic acid Cysteine Glutamic acid Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tyrosine Valine

83.4a 95.8a 88.3 75.9a 94.2a 88.8a 93.8a 90.5a 89.4b 95.5 86.3 86.00 86.3b 94.0 88.2a 81.6a 86.7a

0.8 0.4 0.4 2.3 0.4 0.6 0.7 0.5 0.4 0.4 1.3 0.5 0.5 1 0.4 0.7 0.7

75.2b 89.8b 88.4 65.0b 90.5b 83.5b 90.2b 87.3b 91.3a 96.2 76.2 84.2 90.6a 91.5 84.5b 77.6b 78.4b

0.01 0.0001 NS 0.05 0.01 0.01 0.05 0.05 0.05 NS NS NS 0.01 NS 0.01 0.05 0.001

0.8

SEM= Standard error of the mean.

According to the FAO, the world production of sesame was 6’448,961 metric tons in 2018, with Mexico ranking 15th with a production of 57,256 t, FAO STAT(24). Sesame is mainly grown as an oil source, as it contains on average 44 to 58 % oil, but it is also rich in protein 18 to 25 % CP(25). Sesame oil is characterized by being very stable, due to the presence of natural antioxidants (sesamolina, sesamin and sesamol)(26). Sesame proteins consist predominantly of four protein fractions, which are designated according to their molecular weight as 2S, 7S, 11S (low, medium and high molecular weight) and 15-18S (polymeric proteins resulting from a possible aggregation of 2S, 7S or 11S)(27). High-molecular-weight 1298

Rev Mex Cienc Pecu 2021;12(4):1292-1304

proteins are the main ones in sesame, and they are characterized by being rich in glutamic acid and aromatic amino acids, and low in lysine; in addition to having a low proportion of the α-helix conformation and a high proportion of βeta sheet(27); the sesame protein is characterized by being rich in arginine(28). Globulin 11S (insoluble in water) and albumin 2S (soluble) are called α-globulin and β-globulin respectively; and they are the two main storage proteins of sesame, constituting between 80 and 90 % of the total sesame proteins(29).

It has been reported that phytic acid can interfere with protein digestibility due to its chelating ability(30). Phytate is formed during the maturation period of the plant and its function is to be storage of P and minerals, playing an important role in the metabolism of seeds during germination. In addition, myo-inositol (the chemical component of the phytate molecule) is used for the formation of cell walls(31). Sesame is characterized by containing high levels of phytate, (14.6 g of phytate-P/kg of seed, up to 51.8 g of phytate/kg of meal)(28). The phytate molecule contains twelve reactive protons, six can dissociate at acidic pH, three at neutral pH and the remaining three at basic pH, allowing it to bind with charged molecules from the diet and with endogenous secretions such as digestive enzymes and mucin in all pH conditions found in the intestine(32). Among the amino acids that are most easily chelated by phytate are the basic amino acids and richness in arginine of the sesame protein was already previously mentioned(28,30). However, the pepsin digestibility of sesame protein isolate is high 89.57 %; so, it can be assumed that what would negatively modulate the digestibility of sesame protein is the amount of phytate.

The AID of protein was 83.8 and the average AID of sesame amino acids was 81.7, very similar to the average AID of soybean meal amino acids, which was 79.6; however, differences were observed in some amino acids, with the AID of leucine, lysine and proline being higher in the case of soybean meal. In the case of lysine, its higher AID may be due to the higher lysine content in soybean meal: 2.8 times higher than that of sesame meal. A similar situation is observed in the case of arginine (since the AID of arginine in the sesame meal was higher by 7.3 percentage units), methionine (the AID in the sesame meal was higher by 11.0 percentage units) and cysteine (the AID in the sesame meal was higher by 11.3 percentage units). In the three cases, the sesame was richer: arginine 30.6 %; sulfur amino acids 50.0 %. The AID of the protein and amino acids reported in the present work are similar to those previously reported(33,34,35).

Regarding the SID of the protein and amino acids of sesame, this was higher by 5.5 and 3.8 percentage units respectively, maintaining the difference in the SID of arginine, which was higher by 6 percentage units in sesame than in soybean meal and in the case of the SID of lysine, this was similar in sesame and soybean meal; similarly, the SID of the sesame amino 1299

Rev Mex Cienc Pecu 2021;12(4):1292-1304

acids reported in the present work are similar to those previously reported(33,34,35). The difference found in the SID of the protein and amino acids of the sesame meal reported by Son et al(8) could be due to the quality of the sesame meal that they used in their study, since the same authors mention that the low digestibility could be due to a different process of extraction of the oil (without particularizing in it); and to the content of NDF, since the sesame meal used by Son et al(8) was much richer in NDF, which contained 28 % NDF and the one used in this work contained 10 percentage units less NDF (17.5 %); although it is known that fiber increases endogenous amino acid losses(36,37), affecting, in some cases, their ileal digestibility(36). However, despite its high content of phytates, the good digestibility of the protein and amino acids of sesame meal allows it to be used in the feeding of pigs(38) and poultry(39) at any productive stage, without impairing the productive aspect.

The results allow concluding that sesame meal is an alternative source of protein and digestible amino acids for pig feeding, since the average SID of its amino acids is 88.5 %. In addition to being a rich source of arginine and sulfur amino acids.

Acknowledgements

This study was partially funded by the Autonomous University of Querétaro through the Strengthening Fund for Research, and the National Institute of Forestry, Agricultural and Livestock Research. The authors thank Dipasa Internacional de México, S.A. de C.V. for its help in providing the sesame meal used in this study.

Literature cited: 1.

Woyengo TA, Beltranena E, Zijlstra RT. Nonruminant Nutrition Symposium: Controlling feed cost by including alternative ingredients into pig diets: A review. J Anim Sci 2014;92:1293-1305.

Nzikou JM, Matos L, Bouanga-Kalou G, Ndangui CB, Pambou-Tobi NPG, Kimbonguila A, et al. Chemical composition on the seeds and oil of sesame (Sesamum indicum L.) grown in Congo-Brazzaville. Ad J Food Sci Technol 2009;1:6-11.

1300

Rev Mex Cienc Pecu 2021;12(4):1292-1304

Aguilera A, Reis de Souza TC, Mariscal-Landín G, Escobar K, Montaño S, Bernal MG. Standardized ileal digestibility of proteins and amino acids in sesame expeller and soya bean meal in weaning piglets. J Anim Physiol Anim Nutr 2015;99:728-736.

Wang TC, Fuller MF. The optimum dietary amino acid pattern for growing pigs 1. Experiments by amino acid deletion. Br J Nutr 1989;62:77-89.

Stein HH, Sève B, Fuller MF, Moughan PJ, de Lange CFM. Invited review: Amino acid bioavailability and digestibility in pig feed ingredients: Terminology and application. J Anim Sci 2007;85:172-180.

NRC. Nutrient Requirements of Swine: Eleventh Rev Ed. Washington, DC: The National Academies Press; 2012.

INRA. Tables de composition et de valeur nutritive des matières premières destinées aux animaux d'élevage. Porcs, volailles, bovins, ovins, caprins, lapins, chevaux, poissons. Paris, France: Institut National de la Recherche Agronomique; 2002.

Son AR, Park CS, Park KR, Kim BG. Amino acid digestibility in plant protein sources fed to growing pigs. Asian Australas J Anim Sci 2019;32:1745-1752.

Diario Oficial de la Federación. Especificaciones técnicas para la producción, cuidado y uso de los animales de laboratorio. Norma Oficial Mexicana NOM-062-ZOO-1999. Diario Oficial de la Federación 2001(Miércoles 2 de agosto).

10. CIOMS. International guiding principles for biomedical research involving animals. In: Organization WH editor. International guiding principles for biomedical research involving animals. Council for International Organizations of Medical Sciences ed. Geneva; 1985. 11. Reis de Souza TC, Mar BB, Mariscal LG. Canulación de cerdos posdestete para pruebas de digestibilidad ileal: Desarrollo de una metodología. Téc Pecu Méx 2000;38:143-150. 12. INRA. L'alimentation des animaux monogastriques: porc, lapin, volailles. Paris, France: Institut National de la Recherche Agronomique; 1984. 13. AOAC. Official Methods of Analysis. 17 th. ed. Arlington, VA. USA: Assoc Offic Anal Chem; 2000. 14. Fenton TW, Fenton M. An improved procedure for determination of chromic oxide in feed and feces. Can J Anim Sci 1979;59:631-634.

1301

Rev Mex Cienc Pecu 2021;12(4):1292-1304

15. Henderson JH, Ricker RD, Bidlingmeyer BA, Woodward C. Rapid, accurate and reproducible HPLC analysis of amino acids. Amino acid analysis using Zorbax Eclipse AAA columns and the Agilent 1100 HPLC. Agilent technologies 2000(Part No.59801193E):10 pag. Agilent technologies home page at: www.agilent.com/chem/supplies. 16. Kakade ML, Rackis JJ, McGhee JE, Puski G. Determination of trypsin inhibitor activity of soy products: A collaborative analysis of an improved procedure. Cereal Chem 1974;51:376-382. 17. Vaintraub IA, Lapteva NA. Colorimetric determination of phytate in unpurified extracts of seeds and the products of their processing. Anal Biochem 1988;15:227-230. 18. van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74:3583-3597. 19. Fan MZ, Sauer WC. Determination of apparent ileal amino acid digestibility in barley and canola meal for pigs with the direct, difference, and regression methods. J Anim Sci 1995;73:2364-2374. 20. Furuya S, Kaji Y. Estimation of the true ileal digestibility of amino acids and nitrogen from their apparent values for growing pigs. Anim Feed Sci Technol 1989;26:271-285. 21. Mariscal-Landín G, Reis de Souza TC. Endogenous ileal losses of nitrogen and amino acids in pigs and piglets fed graded levels of casein. Arch Anim Nutr 2006;60:454-466. 22. SAS version 9.2. Statistical Analysis Systems Institute User’s guide. Statistical Analysis Systems Institute User’s guide. 9.2 ed. Cary NC, USA: SAS Institute Inc.; 2008. 23. Steel RGD, Torrie JH. Principles and procedures of statistics. A Biometrical approach. 2nd ed. New York: McGraw-Hill 1980. 24. FAO. “Food Outlook, Bienal Report on Global Food Markets,” Bienal Report on Global Food Markets. Date acces: 14-Sep-2020. http://www.fao.org/3/ca9509en/ca9509en.pdf. 25. Omer HAA, Ahmed SM, Abdel-Magid SS, Bakry A, El-Karamany MF, El-Sabaawy EH. Nutritional impact of partial or complete replacement of soybean meal by sesame (Sesamum indicum) meal in lambs rations. Bull Natl Res Cent 2019;43:98. 26. Dossa K, Diouf D, Wang L, Wei X, Zhang Y, Niang M, et al. The emerging oilseed crop sesamum indicum enters the “Omics” era. Front Plant Sci 2017;8:1154.

1302

Rev Mex Cienc Pecu 2021;12(4):1292-1304

27. Prakash V, Rao M. Structural similarities among the high molecular weight protein fractions of oilseeds. J Biosci 1988;13:171-180. 28. Selle P, Cowieson A, Cowieson N, Ravindran V. Protein-phytate interactions in pig and poultry nutrition: a reappraisal. Nutr Res Rev 2012;25:1-17. 29. Orruño E, Morgan MRA. Purification and characterisation of the 7S globulin storage protein from sesame (Sesamum indicum L.). Food Chem 2007;100:926-934. 30. Selle PH, Ravindran V, Caldwell A, Bryden WL. Phytate and phytase: consequences for protein utilisation. Nutr Res Rev 2000;13:255-278. 31. Humer E, Schwarz C, Schedle K. Phytate in pig and poultry nutrition. J Anim Physiol Anim Nutr 2015;99:605-625. 32. Woyengo TA, Cowieson AJ, Adeola O, Nyachoti CM. Ileal digestibility and endogenous flow of minerals and amino acids: responses to dietary phytic acid in piglets. Br J Nutr 2009;102:428-433. 33. Fasuan TO, Gbadamosi SO, Omobuwajo TO. Characterization of protein isolate from Sesamum indicum seed: In vitro protein digestibility, amino acid profile, and some functional properties. Food Sci Nutr 2018;6:1715-1723. 34. Li D, Qiao SY, Yi GF, Jiang JY, Xu XX, Piao XS, et al. Performance of growingfinishing pigs fed sesame meal supplemented diets formulated using amino acid digestibilities determined by the regression technique. Asian Australas J Anim Sci 2000;13:213-219. 35. Casas GA, Jaworski NW, Htoo JK, Stein HH. Ileal digestibility of amino acids in selected feed ingredients fed to young growing pigs. J Anim Sci 2018;96:2361-2370. 36. Mariscal-Landín G, Reis de Souza TC, Hernández DAA, Escobar GK. Pérdidas endógenas de nitrógeno y aminoácidos en cerdos y su aplicación en la estimación de los coeficientes de digestibilidad ileal de la proteína y aminoácidos de las materias primas. Téc Pecu Méx 2009;47:371-388. 37. Mariscal-Landín G, Reis de Souza TC, Bayardo UA. Neutral detergent fiber increases endogenous ileal losses but has no effect on ileal digestibility of amino acids in growing pigs. Anim Sci J 2017;88:322-330.

1303

Rev Mex Cienc Pecu 2021;12(4):1292-1304

38. Reis de Souza TC, Escobar García K, Aguilera AB, Ramirez RE, Mariscal-Landín G. Sesame meal as the first protein source in piglet starter diets and advantages of a phytase: a digestive study. S Afr J Anim Sci 2017;47:606-615. 39. Amin H, Majid M, Maryam H. Effects of microbial fermented sesame meal and enzyme supplementation on the intestinal morphology, microbiota, pH, tibia bone and blood parameters of broiler chicks. Ital J Anim Sci 2020;19:457-467.

1304

https://doi.org/10.22319/rmcp.v12i4.5310 Technical note

Prevalence of various Leptospira interrogans serovars in unvaccinated cows in the states of Puebla, Tabasco and Veracruz, Mexico

Jorge Víctor Rosete Fernández a Ángel Ríos Utrera b* Juan P. Zárate Martínez b Guadalupe A. Socci Escatell c Abraham Fragoso Islas a Francisco T. Barradas Piña b Sara Olazarán Jenkins a Lorenzo Granados Zurita d

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Sitio Experimental Las Margaritas. Kilómetro 9.5 carretera Hueytamalco-Tenampulco, Hueytamalco, Puebla, México. b

INIFAP, Campo Experimental La Posta. Veracruz, México.

INIFAP, CENID Salud Animal e Inocuidad. Ciudad de México, México.

INIFAP, Campo Experimental Huimanguillo. Tabasco, México.

*Corresponding author: rios.angel@inifap.gob.mx

Abstract: The objective was to compare the prevalences of antibodies against different serovars of Leptospira interrogans among the states of Puebla, Tabasco and Veracruz, as well as among some of their municipalities, and to determine if the health status of the cows influences their

1305

Rev Mex Cienc Pecu 2021;12(4):1305-1316

fertility. Blood samples were taken from 423 cows (Bos taurus x Bos indicus and Bos indicus) from 24 ranches in 11 municipalities in the aforementioned states. The prevalences of the Hardjo and Inifap serovars were higher (P<0.05) in the state of Veracruz than in the state of Puebla, but the prevalence of the Wolffi serovar was higher (P<0.05) in the state of Puebla than in the state of Veracruz. The prevalences of the Hardjo and Palo Alto serovars were higher (P<0.05) in the state of Tabasco than in the state of Puebla, but there were no differences between these two states in the prevalences of the Inifap and Wolffi serovars (P>0.05). The number of serovars in the state of Veracruz was higher (P<0.05) than in the state of Puebla, but the number of serovars in Tabasco was intermediate; in addition, there was an important variation (P<0.05) between municipalities and between ranches in the prevalence of the different serovars. Overall, the serovar with the highest frequency was Inifap, while the serovar with the lowest frequency was Tarassovi. The health status of the cows did not influence the pregnancy rate (P>0.05); however, vaccination of cattle against Leptospira interrogans is recommended in order to decrease the risks associated with this bacterium in cattle and humans. Key words: Prevalence, Leptospira interrogans, Hardjo, Wolffi, Tarassovi, Cows, Pregnancy rate.

Received: 15/04/2019 Accepted: 30/03/2021

Leptospirosis is an infectious disease of bacterial origin classified as a globally distributed zoonosis, affecting numerous species of domestic and wild animals(1). It is a disease of great social and economic impact on livestock, especially in cattle, due to the losses caused by abortions, perinatal mortality, birth of weak calves, infertility and decreased milk production(2). There are two species: Leptospira interrogans, which is pathogenic, and Leptospira biflexa, which is saprophytic and is found on the surface of soil and water. Leptospira interrogans is pathogenic for humans and animals, with more than 250 serovars identified, while Leptospira biflexa has 60 serovars(3). Nationally and globally, it is known that bovine leptospirosis is mainly caused by the Hardjo serovar, whose maintenance host is the bovine; however, in different studies it has been shown that the Hardjo, Wolffi and Tarassovi serovars are the most frequent in Mexico(3), although Leptospiras santarosai and kirschneri have been detected with potential impact on cattle(4). Knowledge of the prevalences in a locality, the determination of its maintenance hosts and the monitoring of the emergence of new Leptospira serovars are essential to understand the epidemiology of leptospirosis in a region and to focus control strategies(5). Based on the above, the objective was to compare the prevalences of antibodies against different serovars of Leptospira

1306

Rev Mex Cienc Pecu 2021;12(4):1305-1316

interrogans among the states of Puebla, Tabasco and Veracruz, as well as among some of their municipalities, and to determine if the health status of cows influences their fertility. The present study was carried out in 24 ranches dedicated to bovine production. Six ranches were located in three municipalities in the state of Tabasco; eleven were located in five municipalities in the state of Puebla; and seven were located in three municipalities in the state of Veracruz. Eleven of the sampled ranches produced milk and calves (dual-purpose system), while thirteen ranches only produced calves (cow-calf system). The ranches were selected based on a non-probabilistic convenience sampling, according to the interest of the ranchers to participate in the present study. On the other hand, the sample size depended on the budget of the study, therefore, not all the cows from each ranch were sampled; however, at least 12 cows were selected in each. Within each ranch, cows were selected by simple random selection. The females used in this study had one or more calvings, most of them being Bos taurus x Bos indicus, although some pure Bos indicus cows of the Brahman breed were also used (N= 403 and 20, respectively). The females showed no clinical signs of any disease at the time the samplings were performed. The present research only included adult cows, since there was not enough economic resource to sample calves (both sexes), steers and heifers. However, because cows stay longer in the herd, they are more likely to become infected and, consequently, more likely to have antibodies against all kinds of diseases. The cows had no history of leptospirosis vaccination prior to the study, so it is valid to assume that the presence of antibodies in the females was due solely to natural exposure to the bacterium. The cows were evaluated reproductively by means of ultrasonography (rectal route) of the uterus and ovaries, in order to determine their reproductive status (pregnant or non-pregnant); however, in the herds from the state of Tabasco, it was not possible to determine such status. Blood samples were obtained by puncture of the coccygeal vein. To obtain the serum from each of the blood samples, these were centrifuged at 3,000 xg for 10 min. Serum samples were stored at -20 °C. The serological diagnosis for the detection of antibodies against Leptospira was made using the microagglutination (MAT) technique(6,7). For this purpose, five strains were included, three of international reference (Hardjo, Wolffi and Tarassovi) and two national isolates (Inifap and Palo Alto; Hardjo and Icterohaemorrhagiae serovars, respectively) obtained at INIFAP. This technique was performed in 96-well microplates; 50 μl of each dilution of the serum were used, from 1:50 to the last double dilution where 50 % agglutination was observed in the field, in phosphate buffer solution (PBS). As antigen, 50 μl of each strain of Leptospira cultured in EMJH medium for 8 days with a titer of 2X108/ ml were added. After 1 h of incubation at ambient temperature, the reactions were observed 1307

Rev Mex Cienc Pecu 2021;12(4):1305-1316

under a dark-field microscope. All sera that showed 50 % or more agglutination at a dilution of 1:100 or more were considered positive. When a serum reacted to two or more antigens, the highest serum titer was taken for the analysis of the data. Seven response variables were analyzed: prevalence of antibodies against the serovars Hardjo, Inifap, Palo Alto, Wolffi and Tarassovi; number of serovars per cow; and pregnancy rate. Antibody positivity was recorded as 1 when a cow had antibodies against a particular Leptospira interrogans serovar (Hardjo, Inifap, Palo Alto, Wolffi or Tarassovi), while antibody negativity was recorded as 0. Like each of the five antibody prevalences, the pregnancy rate was also recorded as a binary variable. The pregnancy rate was coded as 1 when a cow was pregnant at the diagnosis by rectal ultrasonography; otherwise (not pregnant), this reproductive variable was coded as 0. The study was conducted under a completely randomized design. In order to determine the effect of the factors state of the Mexican Republic, municipality nested within state of the Mexican Republic, and ranch nested within state of the Mexican Republic x municipality on the prevalences of antibodies against the serovars of Leptospira interrogans, a logistic regression model was used. The analyses were performed with the GENMOD procedure (PROC GENMOD) of the SAS program(8), considering a binomial distribution and applying a logit link function. The number of serovars per cow was analyzed in a very similar way to the prevalences, with the only difference that a Poisson distribution was considered, since this variable is of the counting type. The pregnancy rate was also analyzed by logistic regression, with the GENMOD procedure of SAS(8), considering a binomial distribution and applying a logit link function. For the analysis of this reproductive variable, the statistical model included health status of the cow, state of the Mexican Republic, and municipality nested within state of the Mexican Republic as fixed effects. Cow’s health status was defined as the presence/absence of antibodies against any of the five serovars of Leptospira interrogans. When a cow presented antibodies against at least one of the five serovars, the health status was recorded as seropositive; when a cow did not present antibodies against any of the serovars of Leptospira interrogans, the animal health status was recorded as seronegative. The convergence criterion was 10-8 in the seven statistical analyses. The prevalence of the Hardjo serovar in the states of Tabasco and Veracruz was higher (P<0.05) than in the state of Puebla (64.1 and 71.3 % vs 39.8 %; Figure 1). The prevalence of the Inifap serovar was higher (P<0.05) in the state of Veracruz than in the states of Puebla and Tabasco, with values of 91.8, 63.8 and 78.8 %, respectively. These values are considerably higher than those reported in the scientific literature for the Hardjo serovar identified in cattle from the states of Campeche(9), Oaxaca(10,11), Yucatán(12-14), Veracruz(15,16), Tamaulipas(17) and the State of México(18).

1308

Rev Mex Cienc Pecu 2021;12(4):1305-1316

Figure 1: Prevalences of Leptospira interrogans serovars, by state 100

91.8

90 80

78.3 71.3 78.8

Percentage

70 60

64.1

63.8 41.4

40 30

31.3 39.8

36.0

25.0

14.4 11.0

10 9.9

0 Hardjo

Inifap

Puebla

Palo Alto Serovar Tabasco

Wolffi

11.2

Tarassovi

Veracruz

The prevalence of the Palo Alto serovar was higher (P<0.05) in the state of Tabasco than in the states of Puebla and Veracruz (78.3 vs 36.0 and 41.4 %). The prevalence of the Palo Alto serovar for the state of Veracruz reported in the present study is two times higher than that found (19.8 %) in a previous study conducted in the south of this same state(16). The average prevalence of the Palo Alto serovar (51.9 %) obtained in the present study is similar to that reported by Ramos et al(10) for the state of Oaxaca (57.1 %), but much higher than those reported (8.8, 8.0, 3.1, 1.6, 1.0 and 0.0 %) by other authors for other states of the Mexican Republic(13,14,19,20,21). The prevalence of the Wolffi serovar in the state of Puebla was higher (P<0.05) than in the state of Veracruz (31.3 vs 9.9 %); the prevalence of the Wolffi serovar in the state of Tabasco (25.0 %) was similar to the prevalences found in the states of Puebla and Veracruz. The prevalence of the Wolffi serovar obtained in the present study for the state of Veracruz is similar to the corresponding average prevalence (11.0 %) found in a previous study conducted in four municipalities in the south of this state(16). In several studies carried out in other states of the Mexican Republic (Yucatán, Oaxaca, Estado de México), low prevalences (less than 10 %) for the Wolffi serovar have also been found(11,12,14,18). On the contrary, the prevalences of the Wolffi serovar (77.7 and 66.0 %) reported by Córdova et al(9) and Luna et al(19) are at least two times higher than the Wolffi serovar prevalences reported in the present study for the states of Puebla and Tabasco.

1309

Rev Mex Cienc Pecu 2021;12(4):1305-1316

The prevalences of the Tarassovi serovar found in the states of Puebla, Tabasco and Veracruz were similar to each other (P<0.01), with values of 14.4, 11.0 and 11.2 %, respectively. These prevalences are similar to those previously reported for the states of Veracruz(16) and Tamaulipas(17), but much lower than those reported by Cárdenas-Marrufo et al(12), SeguraCorrea et al(13) and Luna et al(19), who reported prevalences for the Tarassovi serovar with values of 66.6, 53.6 and 53.3 %, respectively. On the contrary, other authors have reported prevalences for this same serovar less than 8.0 %(9,10,11,18,21). The average prevalences of the Hardjo, Inifap, Palo Alto, Wolffi and Tarassovi serovars were 58.4, 78.1, 51.9, 22.1 and 12.2 %, respectively, indicating that the Inifap serovar was the most frequent, while the Wolffi and Tarassovi serovars were the least frequent. This order of magnitude of the prevalences is similar to that found in Oaxaca(11) and Campeche(9). On the contrary, in Tamaulipas, Veracruz and Estado de México, Wolffi, Tarassovi and Hardjo serovars were found to have similar prevalences(16-18). In the state of Yucatán, a higher prevalence was determined for the Tarassovi serovar (53.6 %) than for the Hardjo (31.6 %) and Wolffi (9.4 %) serovars(12), a result that also differs from that obtained in the present study. The number of Leptospira interrogans serovars present in the cows from the state of Veracruz was greater (P<0.05) than the number of serovars present in the cows from the state of Puebla (2.23 vs 1.68); the number of serovars of Leptospira interrogans present in the cows from the state of Tabasco was intermediate (2.05). In general, it was expected to find a higher prevalence of each of the serovars studied and a higher number of serovars per cow in the states of Veracruz and Tabasco than in the state of Puebla, since there is greater rainfall and environmental temperature in the states of Veracruz and Tabasco than in the state of Puebla; however, the Hardjo serovar was the only serovar with higher prevalence in Veracruz and Tabasco in relation to Puebla (Figure 1). In a study comparing the prevalence of leptospirosis from the different ecological regions of Mexico, it was found that the prevalence was higher in the dry tropical and humid tropical regions than in the arid/semi-arid and temperate regions(19); however, this study lacked a formal statistical analysis. Vinetz (22) reported that Leptospirosis occurs most often in countries with tropical climate, where rainfall and environmental temperature are higher. In the state of Puebla, the municipalities of Ayotoxco, Hueytamalco and San José Acateno had higher prevalences of the Hardjo serovar (P<0.05) than the municipality of Nauzontla. In the state of Tabasco, the prevalences of the Hardjo serovar in the municipalities of Cunduacán, Huimanguillo and Ranchería El Puente were similar (P>0.05; Table 1). In the state of Veracruz, the municipalities of Cotaxtla, Medellín and San Rafael had similar prevalences of the Hardjo serovar.

1310

Rev Mex Cienc Pecu 2021;12(4):1305-1316

Table 1: Least squares means and standard errors for prevalence (%) and number of Leptospira interrogans serovars, by municipality Serovar Municipality Hardjo Inifap Palo Wolffi Tarassovi Number Alto Ayotoxco 65.0 ± 90.0 ± 60.0 ± 80.0 ± 8.9a 35.0 ± 3.30 ab ab ab a 10.7 6.7 11.0 10.7 0.41a Hueytamalco 49.7 ± 68.9 ± 21.4 ± 6.9 ± 4.1c NE 1.36 ab b c 5.0 4.7 4.6 0.12e Nauzontla 7.7 ± 7.4c 15.4 ± 46.2 ± 38.5 ± NE 1.08 c b b 10.0 13.8 13.5 0.29e San José 67.5 ± 77.9 ± 17.8 ± 20.9 ± 5.0 ± 3.4c 1.77 Acateno 7.3ab 5.9b 5.6c 5.7bc 0.18d Xochitlán 28.6 ± 57.1 ± 42.9 ± 28.6 ± NE 1.57 bc bc b bc 17.1 18.7 18.7 17.1 0.47d Cunduacán 41.7 ± 58.3 ± 41.7 ± NE NE 1.42 abc b b 14.2 14.2 14.2 0.34de Huimanguillo 63.8 ± 78.4 ± 86.8 ± 25.0 ± 13.2 ± 2.24 ab b a bc abc 6.8 7.6 5.1 10.8 5.5 0.22bcd El Puente 81.8 ± 90.9 ± 90.9 ± NE 9.1 ± 8.7bc 2.73 11.6a 8.7ab 8.7a 0.50a Cotaxtla 67.1 ± 89.4 ± 70.1 ± NE 27.7 ± 2.56 ab ab a ab 9.9 5.5 7.6 11.5 0.26ab Medellín 81.7 ± 95.4 ± 40.6 ± 6.5 ± 3.8c 9.1 ± 4.4bc 2.34 5.8a 3.2a 8.0b 0.23bc San Rafael 62.6 ± 88.3 ± 18.0 ± 14.8 ± 5.0 ± 3.4c 1.86 6.6ab 4.6ab 5.3c 4.9bc 0.18cd a,b,c,d,e

± ± ± ± ± ± ± ± ± ± ±

Means with different literal within columns are different (P<0.05). NE= not estimable.

In the state of Puebla, the municipalities of Ayotoxco, Hueytamalco and San José Acateno had higher (P<0.05) prevalences of the Inifap serovar than the municipality of Nauzontla. Cunduacán, Huimanguillo and Ranchería El Puente, municipalities in the state of Tabasco, had similar (P>0.05) prevalences of the Inifap serovar. Similarly, the municipalities of Cotaxtla, Medellín and San Rafael showed no difference (P>0.05) in the prevalence of the Inifap serovar (Table 1). The municipalities of Ayotoxco, Nauzontla and Xochitlán, in the state of Puebla, had higher (P<0.05) prevalences of the Palo Alto serovar than the municipalities of Hueytamalco and San José Acateno. In Tabasco, the prevalences of the Palo Alto serovar in the municipalities of Huimanguillo and Ranchería El Puente were higher (P<0.05) than in the municipality of 1311

Rev Mex Cienc Pecu 2021;12(4):1305-1316

Cunduacán. In the state of Veracruz, the municipality of Cotaxtla showed a higher (P<0.05) prevalence of the Palo Alto serovar than the municipalities of Medellín and San Rafael (Table 1). A higher (P<0.05) prevalence of the Wolffi serovar was found in the municipality of Ayotoxco than in the other municipalities of the state of Puebla. The prevalences of the Wolffi serovar found in the three municipalities of the state of Veracruz were similar (P>0.05; Table 1). In the state of Puebla, the municipality of Ayotoxco had a prevalence of the Tarassovi serovar similar (P>0.05) to that of San José Acateno. The prevalences of the Tarassovi serovar found in the state of Tabasco were not different from each other (P>0.05). In the state of Veracruz, the prevalence of the Tarassovi serovar in the municipality of Cotaxtla was higher (P<0.05) than in the municipality of San Rafael (Table 1). Apparently, this is the first time that the prevalence of these five serovars has been reported for these eleven municipalities in the states of Puebla, Tabasco and Veracruz, since no scientific publications on the subject were found in the literature. The number of Leptospira interrogans serovars found in the municipality of Ayotoxco was greater (P>0.05) than the number of serovars found in the other municipalities of the state of Puebla. A higher (P<0.05) number of serovars was found in the municipality of Ranchería El Puente than in the municipalities of Cunduacán and Huimanguillo. The number of serovars found in the municipality of Cotaxtla was greater (P<0.05) than the number of serovars found in the municipality of San Rafael (Table 1). Cows with antibodies against Leptospira interrogans had similar (P>0.05) pregnancy rate to cows without antibodies (55.5 vs 51.5 %); there was also no difference (P>0.05) in the pregnancy rate between states, or between municipalities (Table 2). In accordance with this result, it has been reported that Leptospira interrogans is not related to the generation of follicular cysts, which negatively affect the fertility of cows(23).

1312

Rev Mex Cienc Pecu 2021;12(4):1305-1316

Table 2: Pregnancy rates (%) and their respective standard errors and 95 % confidence intervals (95 % CI) by animal health status of the cow, state of the Mexican Republic and municipality Effect/level Pregnancy rate 95 % CI Animal health status Seronegativea 51.5 ± 8.5c 35.2 – 67.4 b c Seropositive 55.5 ± 3.7 48.1 – 62.6 State of the Mexican Republic Puebla 51.4 ± 6.4c 38.9 – 63.7 c Veracruz 55.5 ± 5.8 44.0 – 66.5 Municipality Ayotoxco de Guerrero 48.2 ± 11.8c 26.9 – 70.2 c Hueytamalco 51.2 ± 6.0 39.7 – 62.7 c Nauzontla 38.0 ± 13.5 16.7 – 65.3 c San José Acateno 48.8 ± 7.0 35.6 – 62.2 c Xochitlán 69.8 ± 18.0 30.2 – 92.5 c Cotaxtla 49.4 ± 9.0 32.5 – 66.4 c Medellín de Bravo 68.0 ± 8.1 50.6 – 81.6 c San Rafael 48.4 ± 7.3 34.6 – 62.5 a

Seronegative= absence of antibodies against Leptospira interrogans. Seropositive= presence of antibodies against Leptospira interrogans. c Pregnancy rates are not different (P>0.05).

In conclusion, the prevalences of the Hardjo and Inifap serovars were higher in the state of Veracruz than in the state of Puebla, but the prevalence of the Wolffi serovar was higher in the state of Puebla than in the state of Veracruz. The prevalences of the Hardjo and Palo Alto serovars were higher in the state of Tabasco than in the state of Puebla, but there were no differences between these two states in the prevalences of the Inifap and Wolffi serovars. The number of serovars of Leptospira interrogans in the state of Veracruz was greater than in the state of Puebla, but the number of serovars in the state of Tabasco was intermediate; in addition, there was important variation in the prevalence of the different serovars of Leptospira interrogans between municipalities and between ranches. Overall, the serovar with the highest frequency was Inifap, while the serovar with the lowest frequency was Tarassovi. The health status of the cows did not influence their fertility; however, farmers in the municipalities evaluated should vaccinate against Leptospira interrogans, as a preventive measure to reduce the risks associated with this bacterium in cattle and humans.

1313

Rev Mex Cienc Pecu 2021;12(4):1305-1316

Literature cited: 1. Dragui MG, Brihuega B, Benítez D, Sala JM, Biotti GM, Pereyra M, Homse A, Guariniello L. Brote de leptospirosis en terneros en recría en la provincia de Corrientes, Argentina. Rev Arg Microbiol 2011;43:42-44. 2. Arias ChF, Suárez AF, Huanca LW, Rivera GH, Camacho SJ, Huanca MT. Prevalencia de leptospirosis bovina en dos localidades de Puno en época de seca y determinación de factores de riesgo. Rev Inv Vet Perú 2011;22(2):167-170. 3. Méndez C, Benavides L, Esquivel A, Aldama A, Torres J, Gavaldón D, Meléndez P, Moles L. Pesquisa serológica de Leptospira en roedores silvestres, bovinos, equinos y caninos en el noreste de México. Rev Salud Anim 2013;35(1):25-32. 4. Carmona-Gasca CA, León LL, Castillo-Sánchez LO, Ramírez-Ortega JM, Ko A, Luna PC, de la Peña-Moctezuma A. Detección de Leptospira santarosai y L. kirschneri en bovinos: nuevos aislados con potencial impacto en producción bovina y salud pública. Vet Méx 2011;42(4):277-288. 5. Hernández-Rodríguez P, Gómez AP, Villamil LC. Implicaciones de las prácticas agropecuarias urbanas y rurales sobre la transmisión de la leptospirosis. Agrociencia 2017;51:725-741. 6. OIE. Organización Mundial de Sanidad Animal. 2004. Manual de las pruebas de diagnóstico y de las vacunas para los animales terrestres (mamíferos, aves y abejas). http://www.oie.int/doc/ged/D6508.pdf. Consultado 8 abr, 2019. 7.

WHO. World Health Organization. 2019. Zoonoses. Leptospirosis. http://www.who.int/zoonoses/diseases/leptospirosis/en/. Consultado 8 abr, 2019.

8. SAS Institute Inc. SAS/STAT® 9.3 User’s guide. Cary, NC: SAS Institute Inc. 2011. 9. Córdova IA, Cano MS, Moles CLP, Cisneros PMA, Rodríguez AG, Ávila GJ, Pérez GJF. Diagnóstico de leptospirosis en ganado bovino productor de carne. REDVET 2005;6(7):1-5. 10. Ramos GAB, Herrera LE, Gutiérrez HJL, Palomares REG, Díaz AE, Limón GMM, et al. Frecuencia de rinotraqueitis infecciosa bovina (IBR), diarrea viral bovina (DVB), y leptospirosis, en bovinos de doble propósito, en el municipio de San Juan Cotzocón, Oaxaca, México. En: Ricardo GID, et al, editores. Congreso Nacional de Buiatría. Villahermosa, Tabasco, México. 2014:134-139.

1314

Rev Mex Cienc Pecu 2021;12(4):1305-1316

11. Hernández BEG, Gutiérrez HJL, Herrera LE, Palomares REG, Díaz AE. Frecuencia de diarrea viral bovina, rinotraqueitis infecciosa bovina, leptospirosis y brucelosis, en las dos regiones ganaderas más importantes de Oaxaca. En: Ricardo GID, Posadas ME editores. Congreso Nacional de Buiatría. Puebla, Puebla, México. 2015:87-92. 12. Cárdenas-Marrufo MF, Vado-Solís I, Pérez-Osorio CE, Segura-Correa JC. Seropositivity to leptospirosis in domestic reservoirs and detection of Leptospira spp. from water sources, in farms of Yucatan, Mexico. Trop Subtrop Agroecosys 2011;14:185-189. 13. Segura-Correa VM, Solis-Calderón JJ, Segura-Correa JC. Seroprevalence of and risk factors for leptospiral antibodies among cattle in the state of Yucatan, Mexico. Trop Anim Hlth Prod 2003;35:293-299. 14. Vado-Solís I, Cárdenas-Marrufo MF, Jiménez-Delgadillo B, Alzina-López A, LaviadaMolina H, Suarez-Solís V, Zavala-Velázquez JE. Clinical-epidemiological study of Leptospirosis in humans and reservoirs in Yucatán, México. Rev Inst Med Trop Sao Paulo 2002;44(6):335-340. 15. Barajas-Rojas JA, Riemann HP, Franti CE. Application of enzyme-linked immunosorbent assay for epidemiological studies of diseases of livestock in the tropics of Mexico. Rev Sci Tech Off Int Epiz 1993;12(3):717-732. 16. Rodríguez BSA. Serofrecuencia de leptospirosis bovina en cuatro municipios ubicados en el sur del estado de Veracruz [tesis maestría]. Veracruz, Ver.: Universidad Veracruzana; 2010. 17. Cantú CA, Banda RVM. Serofrecuencia de leptospirosis bovina en tres municipios del sur de Tamaulipas. Tec Pecu Mex 1995;33(2):121-124. 18. Leon LL, Garcia RC, Diaz CO, Valdez RB, Carmona GCA, Velazquez BLG. Prevalence of Leptospirosis in dairy cattle from small rural production units in Toluca Valley, State of Mexico. Animal Biodiversity and Emerging Diseases: Ann NY Acad Sci 2008;1149:292-295. 19. Luna AMA, Moles CLP, Gavaldón RD, Nava VC, Salazar GF. Estudio retrospectivo de serofrecuencia de leptospirosis bovina en México considerando las regiones ecológicas. Rev Cubana Med Trop 2005;57(1):28-31. 20. Zavala VJ, Pinzón CJ, Flores CM, Damián CAG. La Leptospirosis en Yucatán. Estudio serológico en humanos y animales. Salud Púb Méx 1984;26:254-59. 21. Moles CLP, Cisneros PMA, Gavaldón RD, Rojas SN, Torres BJI. Estudio serológico de leptospirosis bovina en México. Rev Cubana Med Trop 2002;54(1):24-27.

1315

Rev Mex Cienc Pecu 2021;12(4):1305-1316

22. Vinetz JM. Leptospirosis. Current opinion in infectious diseases. 2001;14(5):527-538. 23. Cedillo SLC, Banda RVM, Morales SE, Villagómez-Amezcua ME. Asociación de quistes foliculares ováricos con la presencia de anticuerpos y agentes causantes de las principales enfermedades infecciosas reproductivas en vacas. Abanico Vet 2012;2(1):11-22.

1316

https://doi.org/10.22319/rmcp.v12i4.5778 Technical note

Detection of porcine reproductive and respiratory syndrome in porcine herds of Baja California, Mexico

Sergio Daniel Gómez-Gómez a Gilberto López-Valencia a* José Carlomán Herrera-Ramírez a Enrique Trasviña-Muñoz a Francisco Javier Monge-Navarro a Kattya Moreno-Torres a Issa Carolina García-Reynoso a Gerardo Enrique Medina-Basulto a Miguel Arturo Cabanillas-Gámez a

Universidad Autónoma de Baja California. Instituto de Investigaciones en Ciencias Veterinarias. Km 3.5, Carretera San Felipe, Fraccionamiento Campestre, 21386, Mexicali, Baja California, México.

*Corresponding author: gilbertolopez@uabc.edu.mx

Abstract: The objective of this study was to assess the presence of genotype 2 porcine reproductive and respiratory syndrome virus (PRRSV-2) in Baja California (Baja), as well as the standardization of the qRT-PCR technique. A cross-sectional study was conducted from 2016 to 2017 in farms from Baja. It was obtained 97 blood samples from clinically healthy, notvaccinated boars and sows. Primers were designed and standardize, in order to perform qRTPCR tests from the buffy coat. Every positive results were confirmed by sequence studies. It

1317

Rev Mex Cienc Pecu 2021;12(4):1317-1325

was found that 9.3 % of the samples were positive. The positive samples came from 66.6 % of the sampled regions. This study demonstrates the presence of PRRSV-2 in Baja, therefore, it is necessary to conduct epidemiological studies in order to identify the magnitude of the problem and to establish preventive and control measures. Key words: Detection, Mexico, PCR, PRRS, Swine.

Received: 24/08/2020 Accepted: 29/12/2020

Porcine reproductive and respiratory syndrome (PRRS) is a disease caused by an RNA virus, with two currently known genotypes: 1 (European) and 2 (American)(1). It is easily transmitted by saliva, nasal secretions, urine, semen, milk and colostrum(2). It produces reproductive failure, weak-born piglets and respiratory diseases(3). The main route of introduction of PRRS virus (PRRSV) into previously free countries is via pig movements and with introduction of semen; therefore, protocols must be in place to reduce the risk(4). When first introduced into an immunologically naive herd, the virus spreads to pigs of all ages in about 2 to 3 wk(2), with mortality rates in nursery pigs up to 69 %(5). Most common diagnosis tests are commercial ELISA(6) and in recent years, molecular techniques, particularly real time reverse transcriptase polymerase chain reaction (qRT-PCR)(7). In Mexico, PRRSV was first described in 1994 with an 8.1 % serological prevalence in imported pigs from USA and Canada(8). Since 2002, it has been reported the presence of multiple variants of genotype 2 PRRSV (PRRSV-2) within pig farms throughout Sonora(9-10), neighbor state of Baja California (Baja), and the second biggest pork producer in Mexico. Meanwhile, in Baja, the main pork production comes from small backyard producers, with installations made basically from rustic materials, with the same areas used for the different production stages; generally fed with swill and other food waste subproducts; usually with none preventive medicine programs or veterinary’s advice and in most cases not even adequate hygiene practices. The main objective of this study was to assess the presence of genotype 2 porcine reproductive and respiratory syndrome virus in the most representative pork production regions in Baja California, Mexico, besides the standardization of the qRT-PCR test for this disease.

1318

Rev Mex Cienc Pecu 2021;12(4):1317-1325

The study was approved by the Institutional Committee for Animal Ethics, which is represented by the Academic Group of Animal Health and the Academic Group for Diagnosis of Infectious Diseases, both of which are part of the Institute of Research in Veterinary Sciences. The owners of pigs used in this research were informed about the study and they gave their consent. A cross-sectional study was conducted in 26 farms within six regions of Baja: Ensenada, Mexicali, Tecate and Tijuana, as well as the Mexicali and San Quintin valleys. The farms were selected from a Baja California Pig Farmers Association Database and invited to participate according to their proximity and herd size. Only those who were interested were visited. Estimation of sample size was done for one disease detection(11), considering a state swine population of 10,315(12), a 99.5% diagnostic sensitivity, 4% expected prevalence and 95% confidence level. (1 − (1−∝)1/𝐷 ) (𝑁 − 1/2(𝑆𝑒𝐷 − 1)) 𝑛≅ 𝑆𝑒 where, n= sample size; N= population size; D= number of diseased; α= confidence level; Se= test sensitivity. Accordingly, it was needed a sample size of at least 74; however, it was possible to collect a total of 97 blood samples from the jugular vein of apparently healthy boars and sows not involved in vaccination against PRRSV. It was used sterile Vacutainer® tubes with EDTA anticoagulant (BD, Franklin Lakes, NJ, USA). Samples were transported to the Molecular Biology Laboratory of the Institute of Research in Veterinary Sciences, then there were separated 200-300 µL of the buffy coat into sterile tubes for RNA extraction. RNA extraction was made using AurumTM Total RNA Fatty and Fibrous Tissue Kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. The RNA was reconstituted to a final volume of 30 µL of prepared elution. RNA was stored at -70 °C until the qRT-PCR test were performed. The RT-PCR primers were designed to amplify a fragment with a length of 87 bp of the nucleocapsid gene contained within the open reading frame 7 (ORF7) of PRRSV-2 (GenBank AF494042.1), since this is the most conserved viral protein in PRRSV-infected pig cells(13). The primers were designed using Primer3Plus version 2.4, GenneRunner version 6.1 and OligoCalc version 3.2, generating the primers PRRS-USA-F 5’CGATCCAGACTGCCTTTAAC-3’ and PRRS-USA-R 3’CACTGTGGAGTTTAGTTTGC-5’. The qRT-PCR conditions were optimized by testing primers in triplicate at 200, 400 and 800 nM with 1, 2 and 3 µL of RNA template in a total volume of 10 µL using a master mix with EvaGreen® dye (Biotium, Hayward, CA, USA). The best efficiency was achieved by using the primers at 800 nM in 2 µL of RNA template and was proved it through ten-fold dilutions to generate a melt curve analysis (Figure 1) and comparing it with agarose gel 1319

Rev Mex Cienc Pecu 2021;12(4):1317-1325

electrophoresis. Once obtained the best concentration, it was tested by triplicate 40 control positive samples and 40 negative samples so to achieve a 95% confidence of specificity(14). The sensitivity was determined through ten-fold dilutions by generating a standard curve of 97.6 % efficiency, R2 of 0.996 and 3.25 slope (Figure 2). Figure 1: Amplification peaks of different positive control dilutions in the melting temperature previously stablished (77.4-78.0 ºC)

Figure 2: Standard curve of the designed primers

1320

Rev Mex Cienc Pecu 2021;12(4):1317-1325

Positive control RNA was extracted from Ingelvac PRRS® MLV (Boheringer Ingelheim) vaccine. Three different negative controls were used: master mix without RNA template, molecular grade water and air. All samples were tested in duplicate. The qRT-PCR reactions were executed in a CFX96 real-time thermocycler (Bio-Rad, Hercules, CA, USA). Test reactions consisted of 1 µl of RNA, 400 nM of each primer and master mix of iScript One Step RT-PCR with EvaGreen dye and molecular grade water in a total reaction volume of 10 μL. Thermocycler conditions were calculated using CFX96 software, resulting in an initial step of reverse transcription at 50 °C for 10 min, denaturation at 95 °C for 3 min, 40 cycles of denaturation at 95 °C for 10 sec, annealing at 53.7 °C for 25 sec and extension at 72 °C for 20 sec. A melt curve analysis was performed after each run in order to confirm the melt temperature (Tm) of the amplified fragment, calculated between 77.4 and 78.0 °C. The positive samples were confirmed by sequencing at an external laboratory and these sequences, verified using BLAST tool (Figure 3). Figure 3: Sequence of positive samples and verified using BLAST tool

Panel A: Sequencing results of one of the positive samples, highlighting a sequence of 26 nucleotides. Panel B: BLAST database screenshot, showing the 26 nucleotides of the panel A, highlighted and matching a type 2 porcine reproductive and respiratory syndrome virus strain in the nucleocapsid protein gene. The database casts 100 results (not shown), all of them PRRSV-2 strains.

1321

Rev Mex Cienc Pecu 2021;12(4):1317-1325

It was found 9.3 % (9/97) positive samples to PRRSV-2, present in 66 % (4/6) of the regions where the study was carried out. The frequency of positive cases was 33 % (2/6) in Tijuana, 16.6 % (3/18) in San Quintin Valley, 11.1 % (3/27) in Mexicali and 3.7 % (1/27) in Ensenada (Figure 4). In Tecate (0/13) and Mexicali Valley (0/6) there was no positive samples. Signs of PRRS were not found or reported on any farm. Figure 4: Geographical distribution of PRRSV in Baja California and the frequency in each tested area

The main objective of this study was to assess the presence of type 2 porcine reproductive and respiratory syndrome virus in the most representative pork production regions in Baja California, therefore, considering the epidemiological design of the study can state that PRRSV-2 is present in Baja, with a prevalence of at least 4 %. This study represents the first report of PRRSV-2 in Baja(15), despite the previous report of its presence in the northwest area of the country(16) which includes, besides the state of Baja, the state of Sonora and four other states. It is important to highlight the geographical proximity with Sonora as well as the characteristics of their pork industry, since Sonora introduces pork meat as well as live pigs and semen into Baja(17), thus the possibility of PRRS contagion is present considering that vaccination against PRRSV has never been implemented in Baja since it is supposed to be free of the disease and furthermore, the biggest proportion of small backyard producers, who do not usually use primary preventive medicine measures.

1322

Rev Mex Cienc Pecu 2021;12(4):1317-1325

In this study were also designed primers capable of detecting PRRSV-2 in the ORF7 region, and these results were confirmed by sequencing, proving the effectiveness of the test and the presence of PRRSV-2 in Baja, regardless of the lack of clinical signs(18). This might be owed to the presence of low-virulence strains of PRRSV within Mexican territory(19); or a low viral concentration within the samples(20) given the amplification of the positive curves was observed after cycle 30. This study demonstrates the broad presence of PRRSV-2 in Baja, even in absence of clinical signs that indicate the presence of the disease; therefore, it is necessary to make prospective epidemiological studies aiming at determining the prevalence and the possible associated risk factors in order to identify the magnitude of the problem as well as to establish preventive and control measures.

Acknowledgments

This study permitted to the first author to obtain the Doctor’s degree in Agricultural Sciences (Autonomous University of Baja California). The authors are also grateful to MVZ José Soto, Dra. Laura Kinejara, MC Arsenio Guzmán, MC Kelvin Espinoza and MC Ricardo Martínez.

Conflict of interest statement

The authors have no financial or personal relationship with people or organizations that could inappropriately influence or bias the content of the paper. Literature cited: 1.

Nan Y, Wu C, Gu G, Sun W, Zhang YJ, Zhou EM. Improved vaccine against PRRSV: Current progress and future perspective. Front Microbiol 2017;8:1635.

Pileri E, Mateu E. Review on the transmission porcine reproductive and respiratory syndrome virus between pigs and farms and impact on vaccination. Vet Res 2016;47:108.

Wang X, Marthaler D, Rovira A, Rossow S, Murtaugh MP. Emergence of a virulent porcine reproductive and respiratory syndrome virus in vaccinated herds in the United States. Virus Res 2015;210:34-41.

1323

Rev Mex Cienc Pecu 2021;12(4):1317-1325

Organization of Animal Health. PRRS: the disease, its diagnosis, prevention and control. Paris: Office of International Epizootica, 2008:1-7.

Young B, Dewey C, Poljak Z, Rosendal T, Carman S. Clinical signs and their association with herd demographics and porcine reproductive and respiratory syndrome (PRRS) control strategies in PRRS PCR-positive swine herds in Ontario. Can J Vet Res 2010;74(3):170-177.

Henao-Diaz A, Giménez-Lirola L, Magtoto R, Ji J, Zimmerman J. Evaluation of three commercial porcine reproductive and respiratory syndrome virus (PRRSV) oral fluid antibody ELISAs using samples of known status. Res Vet Sci 2019;125:113-118.

Yang Q, Xi J, Chen X, Hu S, Chen N, Qiao S, et al. The development of a sensitive droplet digital PCR for quantitative detection of porcine reproductive and respiratory syndrome virus. Int J Biol Macromol 2017;104(A):1223-1228.

Milián SF, Cantó AGJ, Weimersheimer RJ, Coba AMA, Anaya EAM, Correa GP. Estudio seroepidemiológico para determinar la presencia de anticuerpos contra el virus del síndrome disgenésico del cerdo en México. Tec Pecu Mex 1994;32(3):139-144.

Batista L, Pijoan C, Lwamba H, Johnson CR, Murtaugh MP. Genetic diversity and possible avenues of dissemination of porcine reproductive and respiratory syndrome virus in two geographic regions of Mexico. J Swine Health Prod 2004;12:170-175.

10. Burgara-Estrella A, Reséndiz-Sandoval M, Cortey M, Mateu E, Hernández J. Temporal evolution and potential recombination events in PRRSV strains of Sonora Mexico. Vet Microbiol 2014;174(3-4):540-546. 11. Cannon, RM. Sense and sensitivity-designing surveys based on an imperfect test. Prev Vet Med 2001;49(3-4):141-63. 12. State Information Office for Sustainable Rural Development. Livestock statistical notebook, 2011-2015. Baja California, México: Ministry of Agricultural Development, 2016:19. 13. King SJ, Ooi PT, Phang LY, Nazariah Z, Allaudin B, Loh WH, et al. Phylogenetic characterization of genes encoding for viral envelope glycoprotein (ORF5) and nucleocapsid protein (ORF7) of porcine reproductive & respiratory syndrome virus found in Malaysia in 2013 and 2014. BMC Vet Res 2016;13(1):3. 14. Broeders S, Huber I, Grohmann L, Berben G, Taverniers I, Mazzara M, et al. Guidelines for validation of qualitative real-time PCR methods. Trends in Food Science & Technology 2014;37(2):115-126.

1324

Rev Mex Cienc Pecu 2021;12(4):1317-1325

15. National Secretary of Health Quality and Food Safety. Bulletin of the Secretary of Epidemiological Surveillance Inform, 2017. https://www.gob.mx/senasica/documentos/boletin-sive-informa-2017. Accessed Oct 10, 20018. 16. Martínez-Bautista NR, Sciutto-Conde E, Cervantes-Torres J, Segura-Velázquez R, Mercado-García MC, Ramírez-Mendoza H, et al. Phylogenetic analysis of ORF5 and ORF7 of porcine reproductive and respiratory syndrome (PRRS) virus and the frequency of wild-type PRRS virus in Mexico. Transbound Emerg Dis 2018;65(4):993-1008. 17. Extension and Territorial Innovation Group. Innovation program pig chain of GEIT livestock, Mexicali, in the State of Baja California. Baja California, Mexico: Rural Extension and Innovation Center. 2015:10. 18. Zimmerman JJ, Benfield A, Dee SA, Murtaugh MP, Stadejek T, Stevenson GW, et al. Porcine reproductive and respiratory syndrome virus (Porcine Arterivirus). In: Zimmerman JJ, et al, editors. Diseases of swine. 10th ed. Ames, Iowa: Wiley-Blackwell, 2012:461-486. 19. Weimersheimer R, Canto AJEE, Anaya EGJ, Coba AMA, Millán SF, Correa GP. Frecuencia de anticuerpos contra el virus del síndrome disgenésico y respiratorio en cerdos sacrificados en rastros de México. Tec Pecu Mex 1997;35:139-144. 20. Walker NJ. A technique whose time has come. Science 2002;296:557-559.

1325

https://doi.org/10.22319/rmcp.v12i4.5750 Technical note

Enzootic ataxia due to copper deficiency in captive red deer (Cervus elaphus) in Colima, Mexico

Luis Jorge García-Márquez a Rafael Ramírez-Romero b Julio Martínez-Burnes c Alfonso López-Mayagoitia d Johnatan Alberto Ruíz-Ramírez a * Edgar Iván Loman-Zúñiga e Fernando Constantino-Casas f

Universidad de Colima. Facultad de Medicina Veterinaria y Zootecnia, Av. Universidad #333 Col. de las Víboras 28040, Colima, México. b

Universidad Autónoma de Nuevo León. Facultad de Medicina Veterinaria y Zootecnia. Nuevo León, México. c

Universidad Autónoma de Tamaulipas. Facultad de Medicina Veterinaria y Zootecnia. Tamaulipas, México. d

University of Prince Edward Island. Atlantic Veterinary College. Charlottetown, Canadá.

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México. f

University of Cambridge. Department of Veterinary Medicine. Cambridge, Reino Unido

*Corresponding author: jruiz7@ucol.mx

1326

Rev Mex Cienc Pecu 2021;12(4):1326-1337

Abstract: The objective of the study was to describe a case of enzootic ataxia in a captive Cervus elaphus (red deer) associated with copper deficiency, in the state of Colima, Mexico. In July and October 2018, two female red deer aged 3 and 7 yr manifested incoordination with weakness of the hind limbs and an anatomopathological diagnosis of progressive ataxia was established. In September 2019, a 13-yr-old female showed nervous signs similar to the 2018 cases, so a blood sample was taken for serum copper measurement. The animal was euthanized for post-mortem examination and tissue samples were collected for histology, liver, kidney, forage and soil samples were also taken for copper and molybdenum measurement. The main lesions were found microscopically in spinal cord, which showed leukomalacia, demyelination, spheroid bodies and neuronal chromatolysis. The copper concentration was 2.7 in liver, 4.67 in kidney and 0.08 in serum (mg/kg DM or ppm). The Cu:Mo ratio for soil 1 was Cu 8.48; Mo 3.00; Cu:Mo 2.83:1, soil 2: Cu 9.10; Mo 3.00; Cu:Mo 3.03:1. Forage 1: Cu 6.59; Mo 7.35; Cu:Mo 0.90:1; forage 2: Cu 2.77; Mo 6.12 ± 0.61; Cu:Mo 0.45:1. Clinical signs, microscopic lesions, and low levels of Cu in serum, liver, and forage are consistent with enzootic ataxia due to primary copper deficiency. As far as known, this is the first report of enzootic ataxia in a captive red deer in Mexico. Key words: Cervus elaphus, Colima, Copper, Enzootic ataxia, Red deer.

Received: 31/07/2020 Accepted: 17/12/2020

Red deer (Cervus elaphus) is prone to metabolic diseases when bred in captivity. Copper (Cu) deficiency in this species has been associated with osteochondrosis, enzootic ataxia and poor growth in young deer(1-4). These syndromes have been recognized in farmed deer, but not in wild populations. Enzootic ataxia is a metabolic disease of the deer that causes slow and progressive paralysis mainly affecting the hind limbs. Clinical signs are the result of leukomyelomalacia, that is, necrosis of the white matter of the spinal cord. Microscopically, it is characterized by a demyelination of the spinal cord axons associated with a copper deficiency(5,6,7). In addition, there may be degenerative changes in neurons of the brain or cerebellum, which also exhibit lysis or nuclear rexis and only in some cases cerebrocortical necrosis occurs with acute cerebral edema(5,7). The morbidity of this disease is low, less than 1 %, although in some cases it can be up to 13 %(8,9,10). Enzootic ataxia in deer has been described in Europe and New Zealand, where it is considered a widespread health problem in red deer farms(2,11,12). In America, it has been reported in red deer from Argentina(5).

1327

Rev Mex Cienc Pecu 2021;12(4):1326-1337

In Mexico, there are 54 Management Units for wildlife conservation (UMAs, for its acronym in Spanish) of Cervus elaphus and they are of extensive type, distributed in 16 states of the Mexican Republic, and Colima has one of them(13). In Mexico, there have been no reports of enzootic ataxia in the UMAs of captive red deer, so it is important to describe for the first time the presence of this type of disease. The objective of this work was to describe the clinical and pathological aspects of enzootic ataxia in a captive red deer (Cervus elaphus) and its relationship with copper deficiency, in the state of Colima, Mexico. The “Rancho el Peregrino” UMA (SEMARNAT-UMA-IN0013-COL/2003) consists of 21 red deer (Cervus elaphus) (4 males, 9 females and 8 offspring), aged between 1 month and 15 years. It is located at 19° 15 ́ N and 103° 43 ́ W and at 490 m asl in the municipality of Colima, Mexico(14). The purpose is the captive breeding of C. elaphus in an extensive system to produce meat and hard antlers. Eleven hectares are destined, divided into six paddocks, with Cynodon nlemfuensis grass, Pithecellobium dulce trees and Acacia farneciana; in addition, they are supplemented throughout the year with 300 g animal/d of ground corn, soybeans, wheat bran, coconut paste and alfalfa meal added with mineral salts (each 100 g contains: phosphorus, calcium, iron, magnesium, copper, zinc, manganese, cobalt, iodine, selenium and vitamin A). For reproductive management, mounts are carried out from October to December and calving occurs in June and July; as a preventive medicine, deer are dewormed and vaccinated against clostridiosis. Every 21 d, they are sprayed with tick during the spring and autumn. During 2018, there were two female red deer aged 3 and 7 yr (average weights of 60 and 80 kg respectively) with a clinical history of incoordination, weakness of the pelvic limbs, frequent falls and altered locomotion from 3 to 18 mo of evolution; there was also progressive weight loss and finally prostration. The first of these cases occurred in July and the second in October of the same year. In both animals, only the necropsy and histopathological study were performed, whose final diagnosis was severe bilateral leukoencephalomalacia, suggestive of progressive ataxia due to copper deficiency. In September 2019, another of the females of the UMA showed clinical signs similar to the cases observed in 2018. This female was 13 yr old and had an average weight of 95 kg. In the clinical examination, some lacerations in the skin were observed in different regions of the body, caused by prostration. A remote neurological examination was carried out, where mild and slowly progressive proprioceptive ataxia was observed. These signs were more evident when the animal walked in circles, or when pulling its tail to one side. It also showed weakness of the hind limbs, impaired ambulation (wobbly incoordination and crisscrossed pelvic limbs (scissor step), dysmetria due to hypermetria, circumduction movements (animal is circling), loss of conscious proprioception, stiff neck and difficulty standing. In the same way, it showed difficulty to lift the tarsi, which it dragged during the march; it also had weight loss, opisthotonos, tonic extension of limbs, paraparesis, exacerbation, prostration and depression. Considering that the clinical history and signs were similar to the cases of 2018, a blood 1328

Rev Mex Cienc Pecu 2021;12(4):1326-1337

sample was taken to obtain serum and perform the serum copper measurement. Due to the severity of the clinical signs, euthanasia was performed by intravenous overdose of barbiturate (5 ml/1.0 kg body weight) (Pisabental® pentobarbital sodium 6.3 %, Pisa, SAGARPA, Q-7833-215, Guadalajara, Jalisco, Mexico). The corpse was referred to the necropsy room of the Pathology laboratory of the Faculty of Veterinary Medicine and Zootechnics of the University of Colima, to carry out the postmortem study. During the necropsy, no obvious macroscopic lesions were observed, so the complete spinal cord was obtained, and according to the anatomical location, it was divided into the following sections: cranial cervical, caudal cervical, cranial thoracic, caudal thoracic, cranial lumbar, caudal lumbar, cranial sacral, caudal sacral and coccygeal; likewise, samples were taken from the brain and sciatic nerves. The collected samples were fixed in 10 % formalin (pH 7.2), processed with the routine histological technique, included in paraffin and cut to 6 μm thick to be stained with hematoxylin and eosin (HE). Luxol Fast Blue staining was also used to evaluate spinal cord myelin(15). On the other hand, liver, kidney, forage and soil samples were taken from two paddocks where the deer grazed, to determine the levels of copper and molybdenum using the atomic absorption spectrometry technique(16,17). The most relevant macroscopic changes at the necropsy were: poor body condition (scale 2/5), hirsute hair, alopecic areas, skin lacerations and subcutaneous hematomas; caused by prostration. The liver showed multifocal discrete areas of capsular fibrosis. The other organs showed no obvious macroscopic changes (Figure 1). In the histological study, the most relevant lesions were found in the spinal cord, mainly in the ventral and lateral funiculi, with less evidence in the dorsal funiculi; these lesions were bilateral and symmetrical. In the white matter, extensive areas of demyelination were observed, characterized by the remarkable distension of the myelin sheaths, which inside showed few hypereosinophilic fragments of axons and some Gitter cells (digestion chambers); some axons were swollen and hypereosinophilic (spheroid bodies). By staining Luxol Fast Blue in each of the sections of the spinal cord, the loss of myelin (demyelination) in the lateral and ventral funiculi was evidenced, mainly in the areas adjacent to the ventral median fissure. The affected areas were characterized by the loss of tinctorial affinity. In the efferent nerves of the lumbar portion, foci of dystrophic mineralization were appreciated, as well as few spheroid bodies. Some neurons, mainly from the ventral horn of the gray matter were swollen, with loss of the Nissl substance or with the granules marginalized to the periphery (central chromatolysis).

1329

Rev Mex Cienc Pecu 2021;12(4):1326-1337

Figure 1: Nerve tissue samples from red deer (C. elaphus) for histopathological evaluation

A. Brain, B. Cerebellum, C. Spinal cord, D. Sciatic nerves, E. Cranial cervical, F. Caudal cervical, G. Cranial thoracic, H. Caudal thoracic, I. Lumbar, J. Sacral.

Additionally, for each section evaluated, there were a small number of neurons lacking a nucleus and their cytoplasm contained a moderate amount of ochre brown granules compatible with lipofuscin (Figure 2). No inflammatory reaction was observed in any of the spinal cord cuts. Histologically, no lesions were observed in the brain, sciatic nerve, spleen, rumen, reticulum, omasum, abomasum, kidneys, lungs, trachea, thyroid gland, pancreas and bladder. At the hepatic level, mild fibrosis located at the capsular level was microscopically corroborated and considered to be of no diagnostic relevance. In Table 1, the values of copper in tissues and blood serum are shown, while in Table 2, the values of the microminerals of Cu, Mo and the Cu:Mo ratio in forage and soils are shown.

1330

Rev Mex Cienc Pecu 2021;12(4):1326-1337

Figure 2: Cross-section of the cervical portion of the spinal cord, stained with H-E

A. The ventral and lateral funiculi are observed with extensive bilateral symmetrical areas of demyelination (arrows). B. Cross-section of the cervical portion of the spinal cord stained with Luxol fast blue, areas of demyelination with loss of tinctorial affinity (arrows) become evident. C. Cranial cervical portion of the spinal cord, the myelin sheaths are dilated and inside there are fragments of axons and demyelination (arrows). D. Digestion chambers, inside there is a Gitter cell (arrow) and remains of an axon. E. Spheroid bodies (arrow). F. Mineralization areas in the efferent nerves of the dorsal horn of the dorsal portion of the spinal cord. G. Central chromatolysis in a neuron and loss of nuclei (arrow). H. Granular ochre brown pigment in a neuronal soma compatible with lipofuscin.

Table 1: Copper values (mg/kg DM or ppm) in tissues and blood serum of red deer (Cervus-elaphus) in captivity Sample

Cu, Reference

Serum

0.08

0.5-1.5

Liver

2.70

6.4-29

Kidney

4.67

3.3-7.2

Reference values taken from:(7,12,18).

1331

Rev Mex Cienc Pecu 2021;12(4):1326-1337

Table 2: Values of copper, molybdenum and the Cu:Mo ratio (mg/kg DM or ppm) in soil and forage of two meadows of the El Peregrino UMA Cu (ppm) Reference Mo Reference Cu:Mo Reference Sample Cu (ppm) Mo Cu:Mo 5.1-10 1-5 Soil 1 8.48±0.45 3.00±0.30 2.83:1 2:1 (Ẋ= 7.5) (Ẋ= 3.0) 5.1-10 1-5 Soil 2 9.10±0.48 3.00±0.30 3.03:1 2:1 (Ẋ= 7.5) (Ẋ= 3.0) 8-11 0.07-5.0 Forage 1 6.59±0.35 7.35±0.74 0.90:1 2:1 (Ẋ= 9.5) (Ẋ= 2.5) 8-11 0.07-5.0 Forage 2 2.77±0.15 6.12±0.61 0.45:1 2:1 (Ẋ= 9.5) (Ẋ= 2.5) References: (19,20,21).

Enzootic ataxia is a neurodegenerative disease caused by copper deficiency, whether primary or secondary. Primary or absolute deficiency occurs when forages or soil are poor in this element, and therefore there is insufficient intake, meanwhile the secondary or conditioned is caused by a reduction in its absorption at the intestinal level, generating low availability for tissues(6,7,12). This disease mainly affects sheep, although it has also been described in goats, piglets and red deer(5). Its diagnosis is carried out through clinical signs, microscopic lesions in the central nervous system and the determination of copper levels in the liver(12). In some reports, it is reported that the morbidity of enzootic ataxia in red deer and red wapiti hybrids is around 1 %, although it can reach up to 13 %(5,10); however, these proportions could vary depending on the geographical region, in addition, the adequate supply with Cu supplements to animals can effectively prevent the disease, while treatment of affected animals produces some remission of signs without eliminating the disease, so ataxia usually progresses to the death of animals(7,8). In the “El Peregrino” UMA, morbidity was 9.8 % and mortality 0.1 %, remaining within the range established according to the literature(8,9,10). The most common causes of morbidity and mortality in captive red deer in the “El Peregrino” UMA have been: 33.4 % babesiosis transmitted by the tick of the genus Rhipicephalus, 17.7 % secondary polyarthritis to an omphalophlebitis, 13.7 % suppurative bronchopneumonia, 9.8 % enzootic ataxia, 7.8 % fractures due to trauma, 3.9 % diarrhea and tympanites, 2.0 % of endoparasites Fasciola hepatica and Oesophagostomum spp(22). The clinical signology of enzootic ataxia in deer presented with incoordination and weakening of the pelvic limbs, which was progressive and finally culminated in the prostration of the animal. These signs are perfectly consistent with those observed by other authors(10,11,12). Spinal cord injuries in enzootic ataxia are purely microscopic, and this explains why no lesions were observed at necropsy. The distribution of leukomyelomalacia, mainly affecting the lateral and ventral funiculi adjacent to the ventral median fissure, was also consistent with other reports in the literature(5,7,12). Microscopically, the observed 1332

Rev Mex Cienc Pecu 2021;12(4):1326-1337

findings were bilateral and symmetrical in the white matter of the spinal cord with Wallerian degeneration, demyelination, scarce spheroid bodies, as well as Gitter cells; in neurons, central chromatolysis and neuronal necrosis are usually observed from the ventral horns(23,24,25). The pathogenesis of this disease is not fully clarified, however, it is known that low levels of copper in the body interfere with the proper functioning of various enzymes, including superoxide dismutase, ceruloplasmin and cytochrome oxidase, which causes the suppression of mitochondrial respiration and therefore the decrease in the production of phospholipids and myelin(26,27). To this is added the action of free radicals causing a demyelinating axonopathy. In other words, the lesions are typical of a neurodegenerative disease in deer(5,26,27). The values of copper in blood serum and liver were below the values considered as normal limits (for blood serum of 0.5 to 1.5 mg/kg and 50 ppm in dry matter for liver). However, cases of enzootic ataxia have been described, where it manifests below 25 ppm and below 15 ppm(28,29,30). In the present study, they were found well below these limits, although the body is very efficient in maintaining blood copper levels among optimal values, these characteristics have also been observed and recorded by other authors(28,29,31,32). The liver has the ability to cause the redistribution of Cu and subsequently favor its accumulation in the kidney to then be excreted in the urine(26), this generates that the levels within the renal tissue, as in this case (4.67 mg/kg), are not affected and are found within the established range (3.3 to 7.2 mg/kg). The analysis of copper and molybdenum performed on pastures and in the soil, as well as their Cu:Mo ratio suggests a low copper in the grass, which correlates with the low levels of copper found in liver and blood serum of deer, this being indicative of a primary deficiency. However, it should be considered that the disease occurs throughout the year, but can be seasonal due to the variation of the nutritional requirements of animals during the year and differences in the mineral composition of soil and pastures, depending on the season of the year; decreasing in winter-spring and increasing in summer-autumn as mentioned by other authors(19,20,21). In farmed deer, Cu concentrations in the liver <4 μg/kg and serum concentrations <0.3 μg/ml indicate a deficiency in this element. It is considered as Cu deficiency in forages <10 ppm and <3 ppm molybdenum, losing the Cu:Mo ratio of 2:1(6), as in the present study 0.90:1 and 0.45:1. This suggests that molybdenum did not interfere with Cu metabolism in these deer. It is considered that for the liver, Cu concentrations >6.35 mg/kg are considered adequate and <3.81 mg/kg of tissue represents the range of deficient. For serum Cu concentrations, the ranges of <0.32 mg/L are deficient and >0.51 are adequate(2). In severe copper deficiencies, bone and joint problems have been reported, such as osteochondrosis and spontaneous fractures(1,7,28), however, this was not evident in the deer of the UMA of Colima.

1333

Rev Mex Cienc Pecu 2021;12(4):1326-1337

Clinical, necropsy and histopathology findings along with the analysis of Cu and molybdenum were used to make the final diagnosis of bilateral leukomyelomalacia or enzootic ataxia due to copper deficiency. This nutritional disease of the UMA in Colima was classified as a primary or absolute copper deficiency due to the low levels of Cu in the forage, which were insufficient to meet the nutritional requirements of the animals, reflecting low levels of Cu in liver, serum and favoring the development of progressive degenerative lesions in the central nervous system. Although Cu levels were not analyzed in the cases occurred in 2018, the signology and anatomopathological lesions were suggestive of enzootic ataxia; however, it is important that in the face of the manifestation of neurological signs in stabled deer, this disease is considered as a differential diagnosis, and that in addition to the clinicalpathological study, the measurement of Cu and Mo (serum, liver, forage and soil) is carried out to make a definitive diagnosis and to be able to establish prevention measures. Based on the literature search, this is the first report of enzootic ataxia in a captive red deer in Mexico.

Acknowledgments

This project was funded by the Academic Network of Diseases in Wildlife and its impact as a reservoir (PROMEP-CA-SEP). Alfredo Díaz is thanked for the histological processing of the samples in the Department of Birds of the Faculty of Veterinary Medicine and Zootechnics of the National Autonomous University of Mexico. Literature cited: 1. Wilson PR, Grace ND. A review of tissue reference valves used to assess the trace element status of farmed red deer (Cervus elaphus). NZ Vet J 2001;49(4):126-132. 2. Grace ND, Wilson PR. Trace element metabolism dietary requirements, diagnosis and prevention of deficiencies in deer. NZ Vet J 2002;50(6):252-259. 3. Grace ND, Wilson PR, Quinn AK. The effect of copper-amended fertilizer and copper oxide wire particles on the copper status of farmed red deer (Cervus elaphus) end their progeny. NZ Vet J 2005;53(1):31-38. 4. Grace ND, Wilson PR, Quinn AK. Impact of molybdenum on the copper status of red deer (Cervus elaphus). N Z Vet J 2005;53(2):137-141. 5. Soler JP, Cseh SB. Ataxia enzoótica en ciervo rojo (Cervus elaphus) en Argentina. Arch Med Vet 2007;39(1):73-76.

1334

Rev Mex Cienc Pecu 2021;12(4):1326-1337

6. Handeland K, Bernhoft A, Aartun MS. Copper deficiency and effects of copper supplementation in a herd of red deer (Cervus elaphus). Acta Vet Scand 2008;50:1-8. 7. Maryam R, Ghulam M. Copper deficiency in ruminants in Pakistan. Matrix Sci Med (MSM) 2018; 2(1):18-21. 8. Booth DH, Wilson PR, Alexander AM. The effect of oral copper wire on liver copper in farmed red deer. NZ Vet J 1989;37:98-101. 9. Jones DG. Trace element deficiencies. In: Alexander TL, Buxton D, editor. Management and diseases of deer. 2. Midlothian, Scotland: Macdonald Lindsay Pindar; 1994;182– 191. 10. Thompson KG, Audigé L, Arthur DG, Julian AF, Orr MB, McSporran KD, Wilson PR. Osteochondrosis associated with copper deficiency in young farmed red deer and wapitired deer hybrids. NZ Vet J New 1994;42:137-143. 11. Audigé L, Wilson PR, Morris RS, Davidson GW. Osteochondrosis skeletal abnormalities and enzootic ataxia associated with copper deficiency in a farmed red deer (Cervus elaphus). NZ Vet J 1995;43:70-76. 12. Vengust G, Svara T, Gombac M, Zele D. Enzootic ataxia associated with copper deficiency in a farmed red deer: a case report. Vet Med-Czech 2015;60(9):522–526. 13. Álvarez RJ, Medellín RA. Cervus elaphus Linnaeus, (1758). Vertebrados superiores exóticos en México: diversidad, distribución y efectos potenciales. Instituto de Ecología, Universidad Nacional Autónoma de México. Bases de datos SNIB-CONABIO. Proyecto U020. México, D.F. 2005. 14.

INEGI. Instituto Nacional de Estadística, Geografía e Informática. Marco Geoestadístico: aspectos geográficos de Colima; 2019.

15. Prophet EB, Mills B, Arrington JB, Sobin LH. Métodos histotecnológicos. Instituto de Patología de las Fuerzas Armadas de los Estados Unidos de América (AFIP) Registro de Patología de los Estados Unidos de América (ARP) Washington, D.C. 1995;280. 16. Perkin Elmer. Analytical methods for atomic absortion spectrophotometry. Connecticut, USA: Ed Perkin Elmer Corporation; 1982. 17. NOM. Norma Oficial Mexicana NOM-010-ZOO-1994. Determinación de cobre, plomo y cadmio en hígado, músculo y riñón de bovinos, equinos, porcinos, ovinos y aves, por espectrometría de absorción atómica. SAGARPA. SENASICA. Diario Oficial Mexicano, 9 de enero 1995;16-25.

1335

Rev Mex Cienc Pecu 2021;12(4):1326-1337

18. Falandysz J, Szymczyk KK, Brzostowski A, Zalewski K, Zasadowski A. Concentrations of heavy metals in the tissues of red deer (Cervus elaphus) from the region of Warmia and Mazury, Poland. Food Addit Contam 2005;22:141-149. 19. Cabrera TE, Sosa REE, Castellanos RAF, Gutiérrez BAO, Ramírez SJH. Comparación de la concentración mineral en forrajes y suelos de zonas ganaderas del estado de Quintana Roo, México. Vet Mex 2009;40:167-17. 20. De La Vega VJA. Perfil mineral en un hato de vacas en ordeña, en los períodos de seca y lluvias: relación con variables hemáticas [Tesis licenciatura]. Facultad de Medicina Veterinaria y Zootecnia. Universidad Veracruzana, México. 2009. 21. NCR. National Research Council. Nutrient Requirements of Small Ruminants: Sheep, Goats, Cervids, and New World Camelids. Washington, DC, USA: The National Academies Press; 2007. https://doi.org/10.17226/11654. 22. Anzar DA. Estudio retrospectivo de causas de mortalidad del ciervo rojo (Cervus elaphus) cautivo en el rancho "El Peregrino" del Estado de Colima, México [Tesis licenciatura]. Facultad de Medicina Veterinaria y Zootecnia de la Universidad de Colima; 2011. 23. Hartman HA, Evenson MA. Deficiency of cooper can cause neuronal degeneration. Med Hypotheses 1992;38:75-78. 24. Yoshikawa HH, Seo T, Oyamada T, Ogasawara T, Oyamada T, Yoshikawa X, Wei S, Wang A, Li Y. Histopathology of enzootic ataxia in Sika deer (Cervus nippon temminck). J Vet Med Sci 1996;58(9):849-854. 25. Geisel O, Betzl E, Dahme E, Schmahl W, Hermanns W. Enzootic spinal ataxia in fallow and wild red deer in Upper Bavaria. Tierarztl Prax Ausg G Grosstiere Nutztiere. 1997;25(6):598-604. 26. Quiroz G, Bouda J. Fisiopatología de las deficiencias de cobre en rumiantes y su diagnóstico. Vet Mex 2001;32(4):289-296. 27. Cantile C, Youssef S. Nervous system. Vol 1. Maxie, M. Grant. Jubb, Kennedy, and Palmers. Pathology of domestic animals. Elsevier; 2016. 28. Mackintosh GG. Deer health and diseases. Acta Vet Hung 1998;46:381-394. 29. Wilson PR. Bodyweight and serum copper concentrations of farmed red deer stags following oral copper oxide wire administration. NZ Vet J 1989;37:94-97.

1336

Rev Mex Cienc Pecu 2021;12(4):1326-1337

30. Padilla S, Bouda J, Quiroz RG, Dávalos JL, Sánchez A. Biochemical and haematological vales in venous blood of captive red deer (Cervus elaphus) at high altitude. Acta Vet Brno 2000;69:327-331. 31. Ellison RS. Major trace elements limiting livestock performance in New Zealand. NZ Vet J 2002;50(3):35-40. 32. Vikoren T, Bernhof A, Waaler T, Handeland K. Liver concentrations of copper, cobalt and selenium in wild Norwegican red deer (Cervus elaphus). J Wildl Dis 2005; 41(3):569-579.

1337

Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 4, pp. 996-1337, OCTUBRE-DICIEMBRE-2021

ISSN: 2448-6698

Pags. Niveles de consanguinidad y sus efectos sobre la expresión fenotípica en ganado Holstein

Inbreeding levels and their effects on phenotypic expression in Holstein cattle Adriana García-Ruiz, Gustavo Javier Mar�nez-Marín, José Cortes-Hernández, Felipe de JesúsRuiz-López ………………….…………………………………………………………………………………………………………………….....…...996

Contribución de los datos genómicos en la definición de la composición racial de bovinos doble propósito

Contribution of genomic data in defining the breed composition of dual-purpose cattle Jaime Anibal Rosero Alpala, Wilson David Rangel Garcia, Adonai Rojas Barreto, William OrlandoBurgos-Paz……………………………………………………………………………………………………………...…...……………….........1008

Relaciones entre estacionalidad, características corporales y leptina en el inicio de la pubertad en vaquillas Bos taurus taurus y Bos taurus indicus en el trópico mexicano

Relationships between seasonality, body characteristics and leptin at the beginning of puberty in Bos taurus taurus and Bos taurus indicus heifers in the Mexican tropics Carlos Hernández-López, René Carlos Calderón-Robles, Alejandro Villa-Godoy, Ángel Ríos-Utrera, Sergio Iván Román-Ponce, Everardo González-Padilla………………………….....……..……..….....……..…………….1025

Brachiaria grasses in vitro digestibility with bovine and ovine ruminal liquid as inoculum

Grape pomace silage Vitis labrusca L. cv. Isabel) on the intake and digestibility of

Ensilado de orujo de uva (Vitis labrusca L. cv. Isabel) en la digestibilidad de nutrientes, balancede nitrógeno y comportamiento ingestivo de corderos Fernando Luiz Massaro Junior, Valter Harry Bumbieris Junior, Ediane Zanin, Elzânia Sales Pereira, Mikael Neumann, Sandra Galbeiro, Odimari Pricila Prado Calixto, Ivone Yurika Mizubu�……….…......…………..…………..…………………………………………………………………………………………………………………………..…..1061

Efectividad del aceite de canola en dietas de cerdos para mejorar el perfil lipídico de la carne

Effectiveness of canola oil in pig diets to improve the lipid profile of meat Soni-Guillermo, Eu�quio, José Luis Figueroa-Velasco, María Teresa Sánchez-Torres-Esqueda, José Luis Cordero-Mora, Aleida Selene Hernández-Cázares, José Alfredo Mar�nez-Aispuro, José M. Fernando Copado-Bueno, María Magdalena Crosby-Galván…………………………….…………………...………..1083

The soil-plant interface in Megathyrsus maximus cv. Mombasa subjected to differentdoses of nitrogen in rotational grazing

La interfaz suelo-planta en Megathyrsus maximus cv. Mombasa sometida a diferentes dosis denitrógeno en pastoreo rotacional Caryze Cris�ne Cardoso Sousa, Denise Baptaglin Montagner, Alexandre Romeiro de Araújo, Valéria Pacheco Ba�sta Euclides, Gelson dos Santos Difante, Antonio Leandro Chaves Gurgel, Daniele Lopes de Souza……………………………………………………………………………………………..……………...……….......1098

Relación entre la resistencia a antibióticos y la producción de biofilm de aislados de Staphylococcus aureus provenientes de mastitis bovina

Relationship between antibiotic resistance and biofilm production of Staphylococcus aureus isolates from bovine mastitis Jaquelina Julia Guzmán-Rodríguez, Estefanía Salinas-Pérez, Fabiola León-Galván, José Eleazar Barboza-Corona, Mauricio Valencia-Posadas, Fidel Ávila-Ramos, José Antonio Hernández-Marín, Diana Ramírez-Sáenz, Abner Josué Gu�érrez-Chávez………………………………......………………………………..…..1117

Usefulness of Fourier transform infrared (FTIR) spectroscopy to detect Trichinella spiralis (Owen, 1835) muscle larvae in ham and sausages made from the meat of an experimentally infected pig

Utilidad de la espectroscopia infrarroja con transformada de Fourier (IRTF) para detectar larvas musculares de Trichinella spiralis (Owen, 1835) en jamón y salchichas hechas de carne de un cerdo infectado experimentalmente Jorge Luis de la Rosa Arana, Jesús Benjamín Ponce Noguez, Tzayhri Gallardo Velázquez, Nydia Edith Reyes Rodríguez, Andrea Paloma Zepeda Velázquez, Ana Berenice López Lugo, Alejandro Pablo Sánchez Paredes, Pablo Mar�nez Labat, Fabián Ricardo Gómez de Anda………………………………………………………………..…….....…….....…….....…….....….………………….1133

Frecuencia de anticuerpos séricos contra los virus de la rinotraqueitis infecciosa bovina y diarrea viral bovina en toros, y su relación con la presencia de los virus en semen

Frequency of serum antibodies against infectious bovine rhinotracheitis and bovine viral diarrhea viruses in bulls, and their relationship with the presence of the viruses in semen Jorge Víctor Rosete Fernández, Guadalupe A. Socci Escatell, Abraham Fragoso Islas, JuanPrisciliano Zárate Mar�nez, Sara Olazarán Jenkins, Lorenzo Granados Zurita, Ángel Ríos Utrera……………….…......1151

Variabilidad en el contenido de polifenoles, actividad biológica y antihelmíntica de extractos metanol: agua de las hojas de Gymnopodium floribundum Rolfe

Variability in polyphenol content, biological and anthelmintic activity of methanol: water extracts from the leaves of Gymnopodium floribundum Rolfe Guadalupe Isabel Or�z-Ocampo, Carlos Alfredo Sandoval-Castro, Gabriela Mancilla-Montelongo, Gloria Sarahi Castañeda-Ramírez, José Israel Chan Pérez, Concepción Cape�llo Leal, Juan Felipe de Jesús Torres-Acosta……………………………………………...………………………………...……….....…….....…….....……...1168

Análisis morfométrico y molecular (ADNmt) de abejas melíferas (Apis mellifera L.) en el estado de Tabasco, México

Morphometric and molecular analysis (mtDNA) of honeybees (Apis mellifera L.) in the state of Tabasco, Mexico Juan Florencio Gómez Leyva, Omar Argüello Nájera, Pablo Jorge Vázquez Encino, Luis Ulises Hernández Hernández, Emeterio Payró de la Cruz…………………………….…………..…………..…………..…………..…..…1188

Factores epizootiológicos de las estrongilosis gastrointestinales en cabras Criollas Cubanas: bases para un manejo integrado

Epizootiological factors of gastrointestinal strongyloses in Cuban Creole goats: bases for integrated management Manuel Alejandro La O-Arias, Francisco Guevara-Hernández, Luis Alfredo Rodríguez- Larramendi, Luis Reyes-Muro, José Nahed-Toral, Hernán Orbelin Mandujano-Camacho, René Pinto-Ruiz…………………………………………………………………………….....…….....…….....……....…………………………………………………………………………………………………………....1208

REVISIONES DE LITERATURA Linfadenitis caseosa: factores de virulencia, patogénesis y vacunas. Revisión

Caseous lymphadenitis: virulence factors, pathogenesis and vaccines. Review Alejandra Barragán Sierra, Leonel Avendaño-Reyes, Juan A. Hernández Rivera, Ricardo Vicente-Pérez, Abelardo Correa-Calderón, Miguel Mellado, Cesar A. Meza-Herrera, Ulises Macías-Cruz ……....……1221

NOTAS DE INVESTIGACIÓN Comparación de ecuaciones para ajustar curvas de crecimiento de vacas Holstein, Jersey y Jersey x Holstein en pastoreo en un ambiente urbano en el noroeste de la Ciudad de México

Comparison of equations to fit growth curves of Holstein, Jersey and Jersey x Holstein cows in a grazing system Sonia Contreras Piña, José Guadalupe García Muñiz, Rodolfo Ramírez Valverde, Rafael Núñez Domínguez, Citlalli Celeste GonzálezAriceaga………………………………………………….....…….....…….....…….....……..1250

Efecto de la aplicación intrauterina de ozono sobre la migración de neutrófilos y la endometritis subclínica en ganado lechero

Effect of intrauterine application of ozone on neutrophil migration and subclinical endometritis in dairy cattle Jessica Bárbara González-Aguado, Elisa Ochoa-Estrada, Héctor Raymundo Vera-Ávila, Ma. de Jesús Chávez-López, Mario Alfredo Espinosa-Mar�nez, Germinal Jorge Cantó-Alarcón, Claudia Gu�érrez-García, Luis Javier Mon�el-Olguín…………………………………………………………………….…………………………..….……………….…..1264

Análisis in silico de la expresión génica en células de granulosa de folículos preovulatorios en dos especies de bovinos

In silico analysis of gene expression in granulosa cells of preovulatory follicles in two species of bovines Jesús Alfredo Berdugo-Gu�érrez, Ariel Marcel Tarazona-Morales, José Julián Echeverry-Zuluaga, Albeiro López-Herrera…....……………………………………………………………………………………………….………………….1276

Digestibilidad ileal estandarizada de la proteína y aminoácidos de la pasta de ajonjolí en cerdos en crecimiento

Standardized ileal digestibility of protein and amino acids of sesame meal in growing pigs Tércia Cesária Reis de Souza, Araceli Aguilera Barreyro, Gerardo Mariscal Landín………………… ………..…………...………..………………………………………………………………………………………………………………………......…..1292

Prevalencia de diversos serovares de Leptospira interrogans en vacas no vacunadas en los estados de Puebla, Tabasco y Veracruz, México

Prevalence of various Leptospira interrogans serovars in unvaccinated cows in the states of Puebla, Tabasco and Veracruz, Mexico Jorge Víctor Rosete Fernández, Ángel Ríos Utrera, Juan P. Zárate Mar�nez, Guadalupe A. Socci Escatell, Abraham Fragoso Islas, Francisco T. Barradas Piña, Sara Olazarán Jenkins, Lorenzo Granados Zurita……………………………………………………………………………………………………………….…………..…………..……………………………………………........1305

Detection of porcine reproductive and respiratory syndrome in porcine herds of BajaCalifornia, Mexico

Detección del virus del síndrome reproductivo y respiratorio en piaras porcinas de Baja California, México Sergio Daniel Gómez-Gómez, Gilberto López-Valencia, José Carlomán Herrera-Ramírez, Enrique Trasviña-Muñoz, Francisco Javier Monge-Navarro, Ka�ya Moreno-Torres, Issa Carolina García- Reynoso, Gerardo Enrique Medina-Basulto, Miguel Arturo Cabanillas-Gámez…………………………………………………………………………………..…………...………..…………..1317

Ataxia enzoótica por deficiencia de cobre en ciervo rojo (Cervus elaphus) cautivo en Colima, México

Enzootic ataxia due to copper deficiency in captive red deer (Cervus elaphus) in Colima, Mexico Jorge Víctor Rosete Fernández, Ángel Ríos Utrera, Juan P. Zárate Mar�nez, Guadalupe A. Socci Luis Jorge García-Márquez, Rafael Ramírez-Romero, Julio Mar�nez-Burnes, Alfonso López-Mayagoi�a, Johnatan Alberto Ruíz-Ramírez, Edgar Iván Loman-Zúñiga, Fernando Constan�no-Casas…………………………………………………..………………………………………………….................………..1326

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 4, pp. 996-1337, OCTUBRE-DICIEMBRE-2021

CONTENIDO CONTENTS

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 4, pp. 996-1337, OCTUBRE-DICIEMBRE-2021