RMCP Vol. 12 Núm. 4 (2021): Octubre-Diciembre [versión en español]

Page 1

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 4, pp. 996-1337, OCTUBRE-DICIEMBRE-2021

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 4, pp. 996-1337, OCTUBRE-DICIEMBRE-2021


REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 12 Numero 4, OctubreDiciembre 2021. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 042021-051209561700-203. ISSN: 2428-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en febrero de 2022. Cabras Criollas Cubanas de la Granja 26 de Julio, ubicada en Jiguaní, Granma, Cuba. Fotografía: Manuel Alejandro La O Arias.

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, Dr. Alfonso Juventino Chay Canul, Universidad Autónoma de Tabasco, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Maurcio A. Elzo, Universidad de Florida Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, Universidad Autónoma del Estado de Hidalgo, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México Dr. Jorge Alberto López García, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. José Juan Hernández Ledezma, Consultor privado Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

I


REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

total por publicar es de $ 7,280.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 425.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II


REVISTA MEXICANA DE CIENCIAS PECUARIAS

REV. MEX. CIENC. PECU.

VOL. 12 No. 4

OCTUBRE-DICIEMBRE-2021

CONTENIDO Contents ARTÍCULOS Articles

Pág.

Niveles de consanguinidad y sus efectos sobre la expresión fenotípica en ganado Holstein Inbreeding levels and their effects on phenotypic expression in Holstein cattle Adriana García-Ruiz, Gustavo Javier Martínez-Marín, José Cortes-Hernández, Felipe de Jesús Ruiz-López ……………………………………………………………………………………………………………………..…996 Contribución de los datos genómicos en la definición de la composición racial de bovinos doble propósito Contribution of genomic data in defining the breed composition of dual-purpose cattle Jaime Anibal Rosero Alpala, Wilson David Rangel Garcia, Adonai Rojas Barreto, William Orlando Burgos-Paz………………………………………………………………………………………………………………………1008 Relaciones entre estacionalidad, características corporales y leptina en el inicio de la pubertad en vaquillas Bos taurus taurus y Bos taurus indicus en el trópico mexicano Relationships between seasonality, body characteristics and leptin at the beginning of puberty in Bos taurus taurus and Bos taurus indicus heifers in the Mexican tropics Carlos Hernández-López, René Carlos Calderón-Robles, Alejandro Villa-Godoy, Ángel Ríos-Utrera, Sergio Iván Román-Ponce, Everardo González-Padilla……………………………………………………….…1025

Brachiaria grasses in vitro digestibility with bovine and ovine ruminal liquid as inoculum

Digestibilidad in vitro de gramíneas Brachiaria con líquido ruminal bovino y ovino como inóculo Luis Carlos Vinhas Itavo, Camila Celeste Brandão Ferreira Ítavo, Cacilda Borges do Valle, Alexandre Menezes Dias, Gelson dos Santos Difante, Maria da Graça Morais, Claudia Muniz Soares, Camila da Silva Pereira, Ronaldo Lopes Oliveira ………………………………………………………1045 Grape pomace silage Vitis labrusca L. cv. Isabel) on the intake and digestibility of nutrients, nitrogen balance and ingestive behavior of lambs Ensilado de orujo de uva (Vitis labrusca L. cv. Isabel) en la digestibilidad de nutrientes, balance de nitrógeno y comportamiento ingestivo de corderos Fernando Luiz Massaro Junior, Valter Harry Bumbieris Junior, Ediane Zanin, Elzânia Sales Pereira, Mikael Neumann, Sandra Galbeiro, Odimari Pricila Prado Calixto, Ivone Yurika Mizubuti……….…1061

III


Efectividad del aceite de canola en dietas de cerdos para mejorar el perfil lipídico de la carne Effectiveness of canola oil in pig diets to improve the lipid profile of meat Soni-Guillermo, Eutiquio, José Luis Figueroa-Velasco, María Teresa Sánchez-Torres-Esqueda, José Luis Cordero-Mora, Aleida Selene Hernández-Cázares, José Alfredo Martínez-Aispuro, José M. Fernando Copado-Bueno, María Magdalena Crosby-Galván……………………………………………….….1083 The soil-plant interface in Megathyrsus maximus cv. Mombasa subjected to different doses of nitrogen in rotational grazing La interfaz suelo-planta en Megathyrsus maximus cv. Mombasa sometida a diferentes dosis de nitrógeno en pastoreo rotacional Caryze Cristine Cardoso Sousa, Denise Baptaglin Montagner, Alexandre Romeiro de Araújo, Valéria Pacheco Batista Euclides, Gelson dos Santos Difante, Antonio Leandro Chaves Gurgel, Daniele Lopes de Souza…………………………………………………………………………………………………….1098 Relación entre la resistencia a antibióticos y la producción de biofilm de aislados de Staphylococcus aureus provenientes de mastitis bovina Relationship between antibiotic resistance and biofilm production of Staphylococcus aureus isolates from bovine mastitis Jaquelina Julia Guzmán-Rodríguez, Estefanía Salinas-Pérez, Fabiola León-Galván, José Eleazar Barboza-Corona, Mauricio Valencia-Posadas, Fidel Ávila-Ramos, José Antonio Hernández-Marín, Diana Ramírez-Sáenz, Abner Josué Gutiérrez-Chávez……………………………………………………………1117 Usefulness of Fourier transform infrared (FTIR) spectroscopy to detect Trichinella spiralis (Owen, 1835) muscle larvae in ham and sausages made from the meat of an experimentally infected pig Utilidad de la espectroscopia infrarroja con transformada de Fourier (IRTF) para detectar larvas musculares de Trichinella spiralis (Owen, 1835) en jamón y salchichas hechas de carne de un cerdo infectado experimentalmente Jorge Luis de la Rosa Arana, Jesús Benjamín Ponce Noguez, Tzayhri Gallardo Velázquez, Nydia Edith Reyes Rodríguez, Andrea Paloma Zepeda Velázquez, Ana Berenice López Lugo, Alejandro Pablo Sánchez Paredes, Pablo Martínez Labat, Fabián Ricardo Gómez de Anda………………………1133 Frecuencia de anticuerpos séricos contra los virus de la rinotraqueitis infecciosa bovina y diarrea viral bovina en toros, y su relación con la presencia de los virus en semen Frequency of serum antibodies against infectious bovine rhinotracheitis and bovine viral diarrhea viruses in bulls, and their relationship with the presence of the viruses in semen Jorge Víctor Rosete Fernández, Guadalupe A. Socci Escatell, Abraham Fragoso Islas, Juan Prisciliano Zárate Martínez, Sara Olazarán Jenkins, Lorenzo Granados Zurita, Ángel Ríos Utrera …………………………………………………………………………………………………………………..………………….1151

IV


Variabilidad en el contenido de polifenoles, actividad biológica y antihelmíntica de extractos metanol:agua de las hojas de Gymnopodium floribundum Rolfe Variability in polyphenol content, biological and anthelmintic activity of methanol:water extracts from the leaves of Gymnopodium floribundum Rolfe Guadalupe Isabel Ortíz-Ocampo, Carlos Alfredo Sandoval-Castro, Gabriela Mancilla-Montelongo, Gloria Sarahi Castañeda-Ramírez, José Israel Chan Pérez, Concepción Capetillo Leal, Juan Felipe de Jesús Torres-Acosta………………………………………………………………………………………….…1168 Análisis morfométrico y molecular (ADNmt) de abejas melíferas (Apis mellifera L.) en el estado de Tabasco, México Morphometric and molecular analysis (mtDNA) of honeybees (Apis mellifera L.) in the state of Tabasco, Mexico Juan Florencio Gómez Leyva, Omar Argüello Nájera, Pablo Jorge Vázquez Encino, Luis Ulises Hernández Hernández, Emeterio Payró de la Cruz…………………………………………………………….…1188 Factores epizootiológicos de las estrongilosis gastrointestinales en cabras Criollas Cubanas: bases para un manejo integrado Epizootiological factors of gastrointestinal strongyloses in Cuban Creole goats: bases for integrated management Manuel Alejandro La O-Arias, Francisco Guevara-Hernández, Luis Alfredo Rodríguez- Larramendi, Luis Reyes-Muro, José Nahed-Toral, Hernán Orbelin Mandujano-Camacho, René PintoRuiz…………………………………………………………………………………………………………………………………1208

REVISIONES DE LITERATURA Reviews Linfadenitis caseosa: factores de virulencia, patogénesis y vacunas. Revisión Caseous lymphadenitis: virulence factors, pathogenesis and vaccines. Review Maria Carla Rodríguez Domínguez, Roberto Montes de Oca Jiménez, Jorge Antonio Varela Guerreo……………………………………………………………………………………………………………………………1221 NOTAS DE INVESTIGACIÓN Technical notes Comparación de ecuaciones para ajustar curvas de crecimiento de vacas Holstein, Jersey y Jersey x Holstein en pastoreo Comparison of equations to fit growth curves of Holstein, Jersey and Jersey x Holstein cows in a grazing system Sonia Contreras Piña, José Guadalupe García Muñiz, Rodolfo Ramírez Valverde, Rafael Núñez Domínguez, Citlalli Celeste González Ariceaga…………………………………………………………………..…1250

V


Efecto de la aplicación intrauterina de ozono sobre la migración de neutrófilos y la endometritis subclínica en ganado lechero Effect of intrauterine application of ozone on neutrophil migration and subclinical endometritis in dairy cattle Jessica Bárbara González-Aguado, Elisa Ochoa-Estrada, Héctor Raymundo Vera-Ávila, Ma. de Jesús Chávez-López, Mario Alfredo Espinosa-Martínez, Germinal Jorge Cantó-Alarcón, Claudia Gutiérrez-García, Luis Javier Montiel-Olguín……………………………………………………………..1264 Análisis in silico de la expresión génica en células de granulosa de folículos preovulatorios en dos especies de bovinos In silico analysis of gene expression in granulosa cells of preovulatory follicles in two species of bovines Jesús Alfredo Berdugo-Gutiérrez, Ariel Marcel Tarazona-Morales, José Julián Echeverry-Zuluaga, Albeiro López-Herrera ………………………………………………………………………………………………………1276 Digestibilidad ileal estandarizada de la proteína y aminoácidos de la pasta de ajonjolí en cerdos en crecimiento Standardized ileal digestibility of protein and amino acids of sesame meal in growing pigs Tércia Cesária Reis de Souza, Araceli Aguilera Barreyro, Gerardo Mariscal Landín……………………1292 Prevalencia de diversos serovares de Leptospira interrogans en vacas no vacunadas en los estados de Puebla, Tabasco y Veracruz, México Prevalence of various Leptospira interrogans serovars in unvaccinated cows in the states of Puebla, Tabasco and Veracruz, Mexico Jorge Víctor Rosete Fernández, Ángel Ríos Utrera, Juan P. Zárate Martínez, Guadalupe A. Socci Escatell, Abraham Fragoso Islas, Francisco T. Barradas Piña, Sara Olazarán Jenkins, Lorenzo Granados Zurita………………………………………………………………………………………………………………1305 Detection of porcine reproductive and respiratory syndrome in porcine herds of Baja California, Mexico Detección del virus del síndrome reproductivo y respiratorio en piaras porcinas de Baja California, México Sergio Daniel Gómez-Gómez, Gilberto López-Valencia, José Carlomán Herrera-Ramírez, Enrique Trasviña-Muñoz, Francisco Javier Monge-Navarro, Kattya Moreno-Torres, Issa Carolina GarcíaReynoso, Gerardo Enrique Medina-Basulto, Miguel Arturo Cabanillas-Gámez …………………………1317

Ataxia enzoótica por deficiencia de cobre en ciervo rojo (Cervus elaphus) cautivo en Colima, México Enzootic ataxia due to copper deficiency in captive red deer ( Cervus elaphus) in Colima, Mexico Luis Jorge García-Márquez, Rafael Ramírez-Romero, Julio Martínez-Burnes, Alfonso LópezMayagoitia, Johnatan Alberto Ruíz-Ramírez, Edgar Iván Loman-Zúñiga, Fernando ConstantinoCasas…………………………………………………………………………………………………………………………….1326

VI


Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

6.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes). Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo. El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

4.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

5.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

7.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8.

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

VII


Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

referencias, aunque pueden insertarse en el texto (entre paréntesis).

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés. 12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus. Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

VIII


I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

XI)

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

IX


XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

xg

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50 g

vs

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s)

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

X


Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

4.

5.

6.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts). All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt. Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias”. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

7.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

8.

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

9.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts:

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

b) Technical Notes. They should be brief and be evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which

XI


should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of the research article but without section titles.

names(s), the number of the edition, the country, the printing house and the year. e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to

summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Key rules for references a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one. b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article). c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10. III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

XII


Organization, as author VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

In press VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000. Books and other monographs

Author(s) VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Organization as author XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984. XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996. XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988. XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Conference paper X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003. XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003. XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003. 12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

13. Final version. This is the document in which the authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII


14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m µl µm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v. J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

vs

versus

xg

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIV


https://doi.org/10.22319/rmcp.v12i4.5681 Artículo

Niveles de consanguinidad y sus efectos sobre la expresión fenotípica en ganado Holstein

Adriana García-Ruiz a Gustavo Javier Martínez-Marín a José Cortes-Hernández b Felipe de Jesús Ruiz-López a*

a

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal, Km. 1 carretera Ajuchitlán-Colón, 76280, Ajuchitlán, Querétaro, México. b

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México.

*Autor de correspondencia: ruiz.felipe@inifap.gob.mx

Resumen: El objetivo del presente estudio fue calcular los niveles de consanguinidad en la población Holstein de México y evaluar su efecto sobre la producción de leche, grasa, proteína y puntos finales de conformación. La información de pedigrí constó de 326,238 animales, a los cuales se les calculó la consanguinidad a través del algoritmo recursivo modificado (INBUPGF90). Se obtuvieron tendencias de consanguinidad de animales nacidos de 1990 a 2018 a través de un análisis de regresión, y se evaluó el efecto de la consanguinidad sobre caracteres productivos con un análisis de varianzas, para lo cual se incluyó información fenotípica de 68,779 animales. Se formaron seis grupos de acuerdo al nivel de consanguinidad (1= <1%, 2= ≥1 y <2%, 3= ≥2 y <3%, 4= ≥3 y <4%, 5= ≥4 y <5%, y 6= ≥5%). Los resultados mostraron que, por cada punto porcentual de aumento en la consanguinidad, se disminuye la producción de leche, grasa y proteína en 88, 3.16 y 2.57 kg (P<0.0001). A niveles bajos de consanguinidad (<5%), no se detectó ningún efecto sobre la producción de grasa y proteína. 996


Rev Mex Cienc Pecu 2021;12(4):996-1007

Sin embargo, cuando la consanguinidad aumentó a más de 5%, la pérdida en producción fue de 12 kg de grasa y de 9 kg en proteína. También se observó que los animales con menor promedio de conformación, presentan bajos niveles de consanguinidad (<1%) y los niveles más elevados, no mostraron diferencias significativas entre ellos; lo que ratifica que la conformación funcional es menos sensible a los efectos de la consanguinidad que otras características de interés económico. Se recomienda promover programas de selección basados en contribuciones óptimas para maximizar las ganancias genéticas y controlar los niveles de consanguinidad. Palabras clave: Consanguinidad, Depresión endogámica, Expresión fenotípica.

Recibido: 04/05/2020 Aceptado: 19/04/2021

Introducción La consanguinidad es originada por el cruzamiento de animales emparentados(1) y representa la probabilidad de que en cualquier locus de un individuo se encuentren genes idénticos por descendencia(2). Lo anterior, incide en la modificación de la expresión de los genotipos, fenómeno que se conoce como depresión endogámica. En especies pecuarias, la depresión endogámica incrementa el riesgo de que los individuos padezcan algunas enfermedades genéticas, disminuyan su fertilidad(3) y que se vea afectada su aptitud productiva y de salud(4); además, puede afectar el desempeño de cualquier característica bajo selección(5). Algunas de las explicaciones genéticas sobre las causas de la depresión endogámica, son los efectos de la sobredominancia, la dominancia incompleta, la epistasis y la interacción genotipo por ambiente(1,2). La hipótesis que sustenta los efectos de la sobredominancia, indica que la consanguinidad aumenta la frecuencia de homocigóticos, lo que reduce la frecuencia de heterocigóticos y la expresión de su superioridad. La hipótesis de la dominancia incompleta, plantea que un aumento en la consanguinidad, se refleja en una mayor frecuencia de homocigóticos y con ello se incrementa la presencia de alelos recesivos deletéreos(6), que son eliminados de las poblaciones después de algunas generaciones. Este es el mecanismo que se considera que tiene mayor frecuencia y efecto en las poblaciones(7). La tercera hipótesis, plantea una interacción génica (epistasis), que bajo condiciones de consanguinidad, crea combinaciones desfavorables de genes y como consecuencia se reduce el potencial productivo de los animales(5,7). La interacción genotipo por ambiente, es otro factor que puede explicar la depresión endogámica ya que mientras más heterocigótico sea un individuo, es menos sensible al estrés ambiental en comparación con los individuos

997


Rev Mex Cienc Pecu 2021;12(4):996-1007

homocigóticos. Esta interacción, afecta principalmente a rasgos relacionados con la aptitud física(5). Los mecanismos de acción genética descritos anteriormente, tienen un bajo impacto cuando se miden los efectos en loci individuales, pero en caracteres poligénicos el desempeño del individuo se puede disminuir significativamente(8,9). En bovinos lecheros, la globalización, el avance tecnológico y la innovación de herramientas genéticas han intensificado el proceso de selección, lo que ha ocasionado un incremento en el apareamiento de animales emparentados, ocasionando una disminución en la diversidad del material genético(10) que se encuentra directamente asociada a un incremento en las tasas de consanguinidad y a una disminución del rendimiento animal. En bovinos Holstein, se ha estimado un incremento en el porcentaje de animales consanguíneos a través de los años y aunque las tasas de consanguinidad no han presentado cambios drásticos (aproximadamente 0.11 a 0.21 % por año, que corresponde a un incremento promedio de 0.59 a 0.96 % por generación)(11,12), la disminución del intervalo generacional ha promovido una disminución de la consanguinidad por generación(13), siendo éste mayor en machos que en hembras, por la presión de selección ejercida sobre pocos sementales usados de forma intensiva(14). En el ámbito pecuario, los altos niveles de consanguinidad han causado pérdidas importantes en la producción de leche(15) y sus componentes (grasa y proteína)(16), en la longevidad(15,17), en caracteres de conformación(16) y de fertilidad(18), causando pérdidas económicas significativas para los ganaderos(5,16). El objetivo del presente estudio fue calcular los niveles de consanguinidad en la población Holstein de México, tanto de hembras como de machos, y evaluar su efecto sobre los niveles de producción de leche, grasa, proteína y puntos finales de conformación.

Material y métodos La información de pedigrí usada para estimar los niveles de consanguinidad, constó de 326,238 animales de la raza Holstein registrados en la Asociación Holstein de México. Para estimar el índice de consanguinidad se utilizó un algoritmo recursivo modificado que en el caso de ancestros desconocidos, incorpora como valor de consanguinidad al promedio de los animales nacidos el mismo año, algoritmo implementado en el programa INBUPGF90 desarrollado por Aguilar y Misztal(19); el cual, lleva como principio el método sugerido por Wright (1922), que a través de la siguiente ecuación, considera la probabilidad de que los gametos del padre y de la madre lleven los mismos genes: 𝐹𝑥 = ((1/2)^(𝑛𝑠 + 𝑛𝑑 + 1))(1 + 𝐹𝑎) Donde: 𝐹𝑥=coeficiente de consanguinidad del animal 𝑥, 𝑛𝑠= número de generaciones desde el padre del animal hasta el ancestro común, 𝑛𝑑= número de generaciones desde la madre

998


Rev Mex Cienc Pecu 2021;12(4):996-1007

del animal hasta el antepasado común, 𝐹𝑎= coeficiente de consanguinidad del antepasado común. Posteriormente, se obtuvieron las tendencias de consanguinidad por año de nacimiento (de 1990 a 2018) a través de un análisis de regresión lineal. El análisis incluyó un total de 321,466 registros; del cual, el 91 % fueron hembras. A los animales nacidos en el periodo bajo estudio, se les incluyó información de producción ajustada a 305 días (leche, grasa y proteína) y de calificación de puntos finales de conformación obtenida en la primera ronda. Los animales que no contaron con registros productivos, fueron eliminados del estudio. Finalmente, la base de datos quedó conformada por un total de 68,779 animales. La información productiva y de conformación, fue recolectada por el sistema de control de producción de la Asociación Holstein de México. Con el objeto de evaluar el efecto general de la consanguinidad y el año de nacimiento sobre las características estudiadas (leche, componentes y conformación), se realizaron análisis de regresión lineal. Para determinar a qué nivel de consanguinidad se observan efectos en los caracteres de importancia económica, las hembras se clasificaron en 6 grupos, determinados por el nivel de consanguinidad expresada en porcentaje. El grupo 1 incluyó animales con <1%, el grupo 2 a los que presentaron ≥1 y <2%, el grupo 3 a los que presentaron ≥2 y <3%, el grupo 4 a los que presentaron ≥3 y <4%, el grupo 5 a los que presentaron ≥4 y <5%, y el grupo 6 a los que presentaron un nivel ≥5%. A través de un análisis de varianza, se realizó la comparación de medias de las características productivas y de puntos finales de conformación para cada uno de los grupos formados por el nivel de consanguinidad. Para evaluar las tendencias del efecto de consanguinidad por clase, se realizaron contrastes ortogonales. La comparación de medias y prueba de contrastes se realizó con el procedimiento LSMEANS-GLM y las regresiones a través del procedimiento REG, ambos con el paquete SAS® 9.3(20).

Resultados y discusión El promedio y desviación estándar de la consanguinidad para los animales nacidos de 1990 a 2018 en la población Holstein de México fue de 2.60 ± 2.57, con una tasa de incremento por año de 0.07 (P<0.001), siendo menor para los machos (0.05) que para las hembras (0.07) (Figura 1). La tendencia por sexo difiere de lo observado en la población Holstein norteamericana, dónde la tasa de consanguinidad es menor en hembras que en machos(21), tendencia que puede ser explicada por la mayor presión de selección ejercida sobre estos últimos ejemplares. En la población Holstein de México, la menor tasa de consanguinidad de los machos podría estar explicada por la importación selectiva de los sementales (que resultan ser poco consanguíneos) de diversas poblaciones, especialmente de la norteamericana. La tasa de cambio de consanguinidad presentada en los machos de la población bajo estudio en

999


Rev Mex Cienc Pecu 2021;12(4):996-1007

la década de 1990 al 2000, coincide con las calculadas en poblaciones de Holstein de Francia, Los Países Bajos y Estados Unidos (0.12)(11), y es aproximadamente la mitad de la reportada en ganado Holstein de Canadá (0.26)(22), así como de machos y hembras de Estados Unidos (0.22 y 0.21)(21) para la misma década. Figura 1: Tendencias de consanguinidad por sexo en la población Holstein de México

Para las dos décadas posteriores, la tasa de cambio en la población de estudio fue menor (0.03 del 2000 al 2009 y de 0.06 del 2010 al 2018) (Cuadro 1). La baja tasa de consanguinidad del 2000 al 2009 en hembras (0.03) y el nulo incremento en machos puede ser explicado por la eficiente implementación de programas de selección basados en las contribuciones genéticas óptimas de las futuras generaciones, que consideran los valores genéticos estimados y las relaciones genéticas entre individuos seleccionados(23). Cuadro 1: Tasa de cambio de la consanguinidad por periodo de tiempo de la población Holstein de México, clasificados por sexo Población Holstein de México Hembras Machos Población general

Periodos de año de nacimiento 1990-1999 2000-2009 2010-2018 0.17 0.03 0.05 0.12 0.17

0.00 0.03

0.25 0.06

El uso de los programas de selección basados en contribuciones óptimas en México, ha sido promovido principalmente por las compañías de inseminación artificial, que dan servicio directo a los ganaderos. Las estrategias de cruzamientos empleadas en los programas de

1000


Rev Mex Cienc Pecu 2021;12(4):996-1007

selección basados en contribuciones óptimas y la globalización de las empresas de inseminación artificial, podrían explicar la introducción de material genético proveniente de otros países que no se habían usado en México. De acuerdo a la información de pedigrí, de 1996 al 2000, empezaron a nacer hijas de sementales provenientes de Italia, España, Francia, Bélgica y Australia; suceso al que se le puede atribuir la disminución de la consanguinidad en las siguientes décadas. En el periodo de estudio, se observó el mismo patrón de comportamiento en la población Holstein de Canadá y de Estados Unidos, en las que en los 90s la tasa de consanguinidad aumentó y a principios del 2000 se vio disminuida(21,24). Sin embargo, las tasas de consanguinidad de otras poblaciones fueron superiores en comparación a la población Holstein de México; por ejemplo, la población Holstein canadiense mostró un incremento de 0.08 por año, del 2000 al 2009 y de 0.23 del 2010 al 2016(22,24); mientras que la población Holstein de Estados Unidos mostró incrementos de 0.11 y 0.27 para las mismas décadas(21). En México, como en Estados Unidos y Canadá, se observó el mismo comportamiento, ya que la consanguinidad se incrementó entre dos y tres veces en la década del 2010 (de 0.03 a 0.06, de 0.11 a 0.27 y de 0.08 a 0.23, respectivamente), en comparación con la década anterior, aunque la diferencia entre México y Canadá o Estados Unidos se mantuvo. El incremento de la consanguinidad de los sementales usados en México en la década del 2010 fue muy notable y puede deberse al uso de sementales que fueron seleccionados a través de selección genómica, ya que la introducción de esta herramienta tecnológica ha disminuido la presencia de genes recesivos deletéreos, pero al mismo tiempo, ha afectado la diversidad de haplotipos en el genoma de poblaciones de ganado lechero(25). Este incremento coincide con lo observado en otras poblaciones norteamericanas en los mismos años(21,24). En diversas poblaciones se ha mostrado que la consanguinidad puede causar una disminución en la eficiencia de caracteres de importancia económica(3,26). En la población Holstein de México, se encontró que, por cada punto porcentual de aumento en la consanguinidad, se disminuye la producción de leche, grasa y proteína en 88, 3.16 y 2.57 kg (P<0.0001). En la población Holstein de los Estados Unidos se encontró una menor pérdida para producción de leche (73 kg) que la encontrada en el presente estudio, y menor para grasa (-1.08 kg) y proteína (-0.97 kg)(27). En el análisis del efecto del nivel de consanguinidad a la producción de leche, grasa y proteína, así como puntos finales de conformación (Cuadro 2), los resultados muestran que los animales con mayor nivel de consanguinidad (grupo 6, con nivel de consanguinidad ≥ 5%), son estadísticamente diferentes a los animales que tienen un menor porcentaje, con diferencias entre las clases extremas de -444 kg, -17 kg y -11 kg de leche, grasa y proteína, respectivamente. Estos resultados son coincidentes con los encontrados por Maiwashe et al(28) quienes mencionan que la producción de leche y sus componentes son afectados por el incremento en los coeficientes de consanguinidad, viéndose reflejado en el rendimiento anual promedio de la población. En la población estudiada, se observó que, para producción de leche, existen tres clases estadísticamente diferentes, los que tienen <3% 1001


Rev Mex Cienc Pecu 2021;12(4):996-1007

(grupos 1, 2 y 3), los del 3 a <5% (grupos 4 y 5) y ≥5% (grupo 6), implicando para este último una disminución de 260 kg por lactación respecto al promedio de los grupos 4 y 5. El efecto de la consanguinidad sobre la composición de la leche (grasa y proteína) a niveles bajos (<5%), no tiene un efecto negativo. Sin embargo, cuando la consanguinidad sobrepasa el 5 %, la perdida en producción de grasa es de 11 kg, y de proteína de 10 kg. También es importante mencionar que las tendencias del efecto de la consanguinidad sobre las características productivas no fueron lineales en ninguna de ellas (Cuadro 2), sugiriendo la idea de que existen valores umbrales de la consanguinidad para que ésta se exprese en deterioro del potencial productivo de los animales(3,18). Contrario a lo que se observó en los caracteres productivos, los animales con menores niveles de consanguinidad (<1%) fueron los que presentaron menor promedio en puntos finales de conformación y los niveles más elevados (>1%), no mostraron diferencias significativas entre ellos, lo que sugiere que la conformación funcional es menos sensible al efecto de la consanguinidad. Estudios realizados en ganado Holstein de Irlanda mostraron que la consanguinidad no tiene grandes efectos negativos sobre todos los caracteres de conformación, y aquellos que son afectados, muestran detrimentos a niveles altos (>12.5%)(18). Cuadro 2: Comparación de medias de producción de leche, grasa, proteína (kg) y puntos finales de conformación por nivel de consanguinidad de los animales Grupo

Nivel de consanguinidad

Número de animales

Leche

Grasa Δ¶

Proteína

Δ¶

Δ¶

Puntos finales Δ¶

1 2 3 4 5 6

<1% ≥1 y <2% ≥2 y <3% ≥3 y <4% ≥4 y <5% ≥5%

21,734 11,656 11,184 9,211 6,410 8,604

11,699a 11,754a 11,636a 11,519b 11,511b 11,255c

384a 380a 379a 376a 378a 367b

344a 343a 340a 339a 343a 333b

79.59a 80.33b 80.30b 80.22b 80.38b 80.41b

Las medias con índices desiguales presentan diferencias estadísticas significativas (P<0.001). Tendencias significativas lineales (Δ) y cuadrática (¶), (P≤0.05).

Con los resultados obtenidos en el presente estudio, se mostraron los efectos negativos que puede tener la consanguinidad cuando se encuentra en niveles superiores al 5 % y que la introducción de herramientas de selección genética pueden modificar los niveles de consanguinidad de forma positiva en la expresión de algunas características, como por ejemplo, en las de conformación, en las asociadas a la longevidad y producción de por vida del animal(29), pero al mismo tiempo pueden afectar la expresión de otras(27); por lo que sería importante promover los programas de selección basados en contribuciones óptimas de los animales para maximizar las ganancias genéticas y controlar los niveles de consanguinidad a tasas menores del 1% por generación(30). Es importante mencionar que los efectos de la 1002


Rev Mex Cienc Pecu 2021;12(4):996-1007

consanguinidad no se limitan a características productivas o de conformación, sus efectos sobre caracteres reproductivos también afectan la rentabilidad de las empresas productoras de leche. Smith et al(4) encontraron que un incremento de un punto porcentual de consanguinidad, puede incrementar en 0.55 días más la edad al primer parto, disminuir en 6 días la vida productiva de los animales y en 4.8 días la producción. Mc Parland et al(18) mostraron un efecto negativo de altos niveles de consanguinidad (hasta de 12.5 %) en el rendimiento reproductivo de los animales, observando un incremento del 2 % en la incidencia de distocia, un 1 % más en la incidencia de mortinato, un aumento de 8.8 días en el intervalo de parto y de 2.5 días en la edad al primer parto, una disminución de 1.68 % en la tasa de preñez, cuando las hembras pasan de un nivel de consanguinidad de 6.25 a 12.5%( 3). La estimación de los coeficientes de consanguinidad, es un importante indicador del uso óptimo de los recursos genéticos, ya que evalúa la presencia de loci que pueden afectar el rendimiento productivo de los animales dentro de una población. Su cálculo a partir de la información de pedigrí, ha resultado ser una herramienta a considerar en el proceso de selección y ha permitido evaluar su efecto en la expresión fenotípica en diversas poblaciones. También, el uso de herramientas moleculares puede ayudar de forma significativa a conocer los detalles a nivel molecular que conlleva la consanguinidad(1), a brindar la posibilidad de predecir tempranamente las tasas de mejoramiento genético y así minimizar los efectos asociados con altos niveles de consanguinidad(31). Sin embargo, en los programas de selección genómica, el uso generalizado de sementales ha conducido a una reducción de la diversidad genética dentro de las poblaciones de alto rendimiento productivo(12), por lo que es necesario establecer esquemas de selección de contribución optima basados en valores genómicos que mantengan de bajos a moderados los niveles de consanguinidad especialmente en la selección de reproductores(23, 32),. Estudios recientes sugieren la incorporación de la estimación del coeficiente de consanguinidad en los procedimientos de predicción de valores genéticos; por ejemplo, incluirlo como covariable o considerarlo en la inversa de la matriz de relaciones aditivas en la estimación de valores genéticos de las evaluaciones BLUP, así como en la estimación de confiabilidad de los mismos, ya que, de no ser incluidos, se puede incrementar la varianza del error de predicción o se pueden sobre o sub estimar las confiabilidades (33).

Conclusiones e implicaciones Los resultados obtenidos muestran que los niveles bajos de consanguinidad no afectan la expresión fenotípica de caracteres productivos y que su efecto sobre las características productivas estudiadas no es de forma lineal. Los niveles superiores a 5 % se encuentran asociados a la disminución de características de interés económico como lo son la producción de leche, grasa y proteína. Además, el incremento de la consanguinidad en la población aumentará la probabilidad de que genes letales o enfermedades genéticas asociadas a genes

1003


Rev Mex Cienc Pecu 2021;12(4):996-1007

recesivos se puedan expresar dentro de la población. En contraparte, la manera en que está estructurada la industria del mejoramiento genético ha promovido que sean los animales altos en consanguinidad quienes muestren la conformación más funcional, lo que puede tener repercusiones deseables para los ganaderos. Por lo anterior, se recomienda diseñar programas de mejoramiento genético integral que incluyan tecnología, caracteres reproductivos, de salud y de vida productiva para el control del nivel de consanguinidad de la población y que por consecuencia no se vea comprometida la expresión de caracteres productivos. Agradecimientos y fuente financiadora Proyecto financiado por INIFAP-CENIDFyMA con el nombre “Estudio de la consanguidad y su efecto sobre características productivas y reproductivas en ganado Holstein” con No SIGI: 11513634465. Proyecto financiado parcialmente por Holstein de México A.C. Conflicto de intereses Los autores declaran que no existen conflictos de interés. Literatura citada: 1. Kristensen TN, Pedersen KS, Vermeulen CJ, Loeschcke V. Research on inbreeding in the ‘omic’ era. Trends Ecol Evol 2010;25(1):44-52. 2. Ferenčaković M, Sölkner J, Curik I. Estimating autozygosity from high-throughput information: effects of SNP density and genotyping errors. Genet Sel Evol 2013;45(1):42. 3. González-Recio O, De Maturana EL, Gutiérrez JP. Inbreeding depression on female fertility and calving ease in Spanish dairy cattle. J Dairy Sci 2007;90(12):5744-5752. 4. Smith LA, Cassell BG, Pearson RE. The effects of inbreeding on the lifetime performance of dairy cattle. J Dairy Sci 1998;81(10):2729-2737. 5. Leroy G. Inbreeding depression in livestock species: review and meta‐analysis. Animal Genetics 2014;45(5):618-628. 6. Roff DA. Inbreeding depression: tests of the overdominance and partial dominance hypotheses. Evolution 2002;56(4):768-775. 7. Charlesworth B, Charlesworth D. The genetic basis of inbreeding depression. Genet Res 1999;74(3):329–340.

1004


Rev Mex Cienc Pecu 2021;12(4):996-1007

8. Dekkers JCM, Gibson JP, Bijma P, Van Arendonk JAM. Design and optimisation of animal breeding programmes. Technical notes. Wageningen University, Netherlands; 2000:1-16. 9. Marie J, Charpentier E, Williams C. Inbreeding depression in ring-tailed lemurs (Lemur catta): genetic diversity predicts parasitism, immunocompetence, and survivorship. Conserv Genet Resour 2008;9(6):1605-1615. 10. Lori AS. The effect of inbreeding on lifetime performance of dairy cattle. Master thesis. Blacksburg, Virginia, USA: Faculty of the Virginia Polytechnic Institute and State University; 1997. 11. Danchin-Burge C, Hiemstra SJ, Blackburn H. Ex situ conservation of Holstein-Friesian cattle: comparing the Dutch, French and USA germplasm collections. J Dairy Sci 2011; 94(8):4100-4108. 12. García-Ruiz A, Cole JB, VanRaden PM, Wiggans GR, Ruiz-López FJ, Van Tassell CP. Changes in genetic selection differentials and generation intervals in US Holstein dairy cattle as a result of genomic selection. PNAS 2016;113(28):E3995-E4004. 13.VanRaden PM, Olson KM, Wiggans GR, Cole JB, Tooker ME. Genomic inbreeding and relationships among Holsteins, Jerseys, and Brown Swiss. J Dairy Sci 2011;94(11):5673-5682. 14. Miglior F, Burnside EB, Dekkers JC. Non-additive genetic effects and inbreeding depression for somatic cell counts of Holstein cattle. J Dairy Sci 1995;78(5):1168-1173. 15. Thompson JR, Everett RW, Hammerschmidt NL. Effects of inbreeding on production and survival in Holsteins. J Dairy Sci 2000;83(8):1856-1864. 16. Croquet C, Mayeres P, Gillon A, Vanderick S, Gengler N. Inbreeding depression for global and partial economic indexes, production, type, and functional traits. J Dairy Sci 2006;89(6):2257-2267. 17. Sewalem A, Kistemaker GJ, Miglior F, Van Doormaal BJ. Analysis of inbreeding and its relationship with functional longevity in Canadian dairy cattle. J Dairy Sci 2006; 89(6):2210-2216. 18. Mc Parland S, Kearney JF, Rath M, Berry DP. Inbreeding effects on milk production, calving performance, fertility, and conformation in Irish Holstein-Friesians. J Dairy Sci 2007; 90(9):4411-4419. 19. Aguilar I, Misztal I. Technical Note: Recursive algorithm for inbreeding coefficients assuming nonzero inbreeding of unknown parents. J Dairy Sci 2008;91(4):1669-1672.

1005


Rev Mex Cienc Pecu 2021;12(4):996-1007

20. SAS. SAS/STAT 9.3. User's Guide: Mathematical Programming Examples. Cary NC, USA: SAS Inst. Inc. 2012. 21. CDCB. Council of Dairy Cattle Breeding. Trend in inbreeding coefficients of Cows for Holstein or Red & White. Bowie, MD, USA 2020. https://queries.uscdcb.com/eval/summary/inbrd.cfm. Accessed Apr 6, 2020. 22. Stachowicz K, Sargolzaei M, Miglior F, Schenkel FS. Rates of inbreeding and genetic diversity in Canadian Holstein and Jersey cattle. J Dairy Sci 2011;94(10):5160-5175. 23. Weigel KA. Controlling inbreeding in modern breeding programs. J Dairy Sci 2001;84:E177-E184. 24. CDN. Canadian Dairy Network. Inbreeding Update. Guelph, Ontario, Canadá 2020. https://www.cdn.ca/document.php?id=529. Accessed Apr 8, 2020. 25. Makanjuola BO, Miglior F, Abdalla EA, Maltecca C, Schenkel FS, Baes CF. Effect of genomic selection on rate of inbreeding and coancestry and effective population size of Holstein and Jersey cattle populations. J Dairy Sci 2020;103(6):5183-5199. 26. Biémont C. Inbreeding effects in the epigenetic era. Nature Reviews Genetics 2010;11(3):234-234. 27. Wiggans GR, VanRaden PM, Zuurbier J. Calculation and use of inbreeding coefficients for genetic evaluation of United States dairy cattle. J Dairy Sci 1995;78(7):1584-1590. 28. Maiwashe A, Nephawe K, Theron H. Estimates of genetic parameters and effect of inbreeding on milk yield and composition in South African Jersey cows. S Afr J Anim Sci 2008;38(2):119-125. 29. Vollema AR, Groen AF. Genetic correlations between longevity and conformation traits in an upgrading dairy cattle population. J Dairy Sci 1997;80(11):3006-3014. 30. Granleese T, Clark SA, Swan AA, Van der Werf JH. Increased genetic gains in sheep, beef and dairy breeding programs from using female reproductive technologies combined with optimal contribution selection and genomic breeding values. Genet Sel Evol 2015;47(1):1-13. 31. Howard JT, Pryce JE, Baes C, Maltecca C. Invited review: Inbreeding in the genomics era: Inbreeding, inbreeding depression, and management of genomic variability. J Dairy Sci 2017;100(8):6009-6024. 32. Clark SA, Kinghorn BP, Hickey JM, Van der Werf JH. The effect of genomic information on optimal contribution selection in livestock breeding programs. Genet Sel Evol 2013;45(1):1-8.

1006


Rev Mex Cienc Pecu 2021;12(4):996-1007

33. Aguilar I, Fernandez EN, Blasco A, Ravagnolo O, Legarra A. Effects of ignoring inbreeding in model‐based accuracy for BLUP and SSGBLUP. J Anim Breed Genet 2020;37(4):356-364.

1007


https://doi.org/10.22319/rmcp.v12i4.5690 Artículo

Contribución de los datos genómicos en la definición de la composición racial de bovinos doble propósito

Jaime Anibal Rosero Alpala a* Wilson David Rangel Garcia a Adonai Rojas Barreto a William Orlando Burgos-Paz b

a

Corporación Colombiana de Investigación Agropecuaria-AGROSAVIA, Centro de Investigación La Libertad, km 17 vía Puerto López, Villavicencio, Meta, Colombia. b

Corporación Colombiana de Investigación Agropecuaria - AGROSAVIA, Centro de Investigación Tibaitatá, Mosquera, Cundinamarca, Colombia.

*Autor de correspondencia: jroseroa@agrosavia.co

Resumen: La heterosis animal es clave en la obtención de animales más productivos y mejor adaptados al trópico. Sin embargo, el inadecuado manejo genético conlleva a la obtención de mosaicos de razas que incluye la pérdida del potencial productivo del hato. El objetivo de este estudio fue definir la composición racial de bovinos mestizos doble propósito en el piedemonte Llanero departamento del Meta-Colombia. Un total de 126 individuos mestizos (MEZ) de seis hatos fueron evaluados por una aproximación fenotípica (APF) y una genotípica (ARG). Para ARG se incluyeron las razas control asociadas a Bos taurus taurus y Bos taurus indicus, para ello se genotiparon con un chip de GeneSeek GGP-LD de 26K de SNP y se analizaron mediante análisis de componentes principales (PCA) y asignación probabilística bayesiana de ADMIXTURE. Las agrupaciones raciales generadas por APF variaron respecto de ARG. El análisis molecular detectó siete (k= 7) grupos genéticos en la composición racial de los animales de estudio. Las tres razas con mayor participación en la composición racial de los individuos mestizos fueron: Holstein, Gyr, Brahman con 23.4, 21.4, y 21 % respectivamente, mientras que las restantes Blanco Orejinegro, Pardo Suizo, Normando y Jersey no superaron el 13 %. A diferencia de APF, la aproximación ARG permitió de forma efectiva la identificación de la composición

1008


Rev Mex Cienc Pecu 2021;12(4):1008-1024

racial de bovinos mestizos y suministró información clave en miras de desarrollo de programas de apareamiento que buscan mejorar indicadores productivos, y a su vez propendan por la adaptación de los animales requisito indispensable para los sistemas bovino doble propósito. Palabras clave: Genotipado, Mestizos, Variabilidad, Genética.

Recibido: 13/05/2020 Aceptado: 29/03/2021

Introducción El sistema bovino doble propósito en Colombia representa aproximadamente el 35 % (8.2 millones de cabezas) de la población bovina total(1). Similar a otras regiones de América latina, este sistema se basa en la obtención de animales a partir de cruzamiento de razas con algún grado de ventaja productiva en un entorno particular, y que le confiera mayor productividad(2). Contrario a lo obtenido en condiciones subtropicales, los sistemas de producción bovina en general en regiones tropicales no han alcanzado el éxito esperado(3) y como recurso para mejorar la producción se realiza la selección de razas locales y exóticas de los géneros Bos taurus taurus, Bos taurus indicus y cruzamientos entre éstas(4) para hacer un uso eficiente de la heterosis, paterna o materna según se utilice, e incrementar la eficiencia de los sistemas de producción de carne o leche(5). Sin embargo, no todos los cruzamientos pueden conferir las ventajas esperadas y la incorrecta aplicación de lineamientos zootécnicos puede acelerar la presencia de problemas de adaptación y producción. Es necesario considerar las implicaciones de un hato multirracial, donde su composición racial es parcialmente conocida o desconocida completamente, y donde los efectos genéticos no aditivos delinean la expresión del fenotipo animal(6). Al respecto, la situación en Colombia requiere una atención especial, pues además de una condición tropical predominante, el uso de una amplia gama de razas y cruces, la falta de registros productivos y el uso indiscriminado de reproductores sin conocimiento de la procedencia o el manejo, resultan en una errónea percepción de animales más productivos y mejor adaptados a las condiciones donde se explotan(4,6). En este caso, la disponibilidad de información de la estructura genealógica o co-ancestría entre individuos, permite manejar la diversidad y a tener un control sobre la endogamia(7)

1009


Rev Mex Cienc Pecu 2021;12(4):1008-1024

y el uso de marcadores moleculares, particularmente de SNP (del inglés Single Nucleotide Polymorphism), ha demostrado la efectividad de los análisis genómicos en la determinación de la composición racial en hatos mestizos de carne(8) y leche(9) con deficiente información genealógica. De hecho, la contribución de los análisis moleculares ha permitido identificar si el origen B. taurus taurus o B. taurus indicus de un segmento cromosómico de bovinos puede tener efectos en características de interés productivo(10). Por lo anterior, el objetivo de este estudio fue cuantificar la contribución de la información genómica, en la determinación de la composición racial de bovinos mestizos del sistema doble propósito predominante en el piedemonte Llanero, como herramienta de apoyo en la definición de estrategias de manejo y selección en hatos mestizos de la región.

Material y métodos Localización Este estudio se realizó en animales presentes en seis hatos de tres rutas lecheras en la subregión del piedemonte Llanero del departamento del Meta- Colombia. Esta subregión se caracteriza por presentar temperaturas que oscilan entre 23 y 30 °C, humedad relativa entre 76 y 78 % y alturas a nivel del mar entre 300 y 700 msnm(11). Los hatos mestizos (MEZ) en cada municipio definidos se nombraron por siglas de la siguiente manera: ACA: hato municipio de Acacías, CLN: hato municipio de Castilla La Nueva, CUM: hato municipio de Cumaral, MES: hato municipio de Mesetas, SJA: hato municipio de San Juan de Arama y VLL: hato municipio de Villavicencio.

Valoración fenotípica Inicialmente, en cada hato seleccionado (conformados por un promedio de 70 animales), se consolidó la información productiva mediante una encuesta básica para identificar los criterios productivos y objetivos de uso de las razas presentes. Posteriormente, se llevó a cabo la clasificación racial de un grupo de animales representativos y del cual hacían parte novillas y vacas de hasta tercer parto. Para tal fin, se seleccionaron alrededor de 21 animales por hato, para un total de 126 animales con el ánimo de generar una clasificación por su Aparente predominancia fenotípica –APF(12), donde se tuvo en cuenta la amplia gama de cruzamientos entre razas de origen B. taurus taurus y B. taurus indicus usadas en los hatos del sistema de producción doble propósito. La APF clasifica los animales así: animales con predominio B. taurus taurus (PREDTAU): sin giba, sin papada y sin pliegue

1010


Rev Mex Cienc Pecu 2021;12(4):1008-1024

umbilical, orejas cortas y peludas, pelaje manchado o no, pelaje negro, rojo y marrón, con cuernos o sin ellos. Animales con predominio B. taurus indicus (PREDCEB): con giba, papada y pliegue umbilical muy desarrollado, orejas largas y sin pelos, color sólido, gris, negro, cenizo o rojo. Con predominancia intermedia B. taurus taurus x B. taurus indicus (PREDINTER): con giba, papada y pliegue umbilical, orejas largas y escasos pelos, raramente manchado, casi siempre con cuernos.

Asignación racial genotípica La asignación racial genotípica-ARG, se obtuvo a partir información genotípica de 126 animales (21 por hato), previamente seleccionados (por APF) y muestreados bajo las recomendaciones de un muestreo reducido extremo(13), así garantizar la comparación entre las dos matrices de información (APF y ARG). Para la valoración molecular, en cada animal se colectó una muestra de sangre mediante punción en la vena coccígea y se transportaron al Laboratorio de Genética Molecular del Centro de Investigación Tibaitatá de AGROSAVIA para su posterior genotipificación. La extracción de ADN se realizó mediante el kit comercial UltraClean ® Blood DNA Isolation (MoBio Laboratories Inc.) y el genotipado de polimorfismos de nucleótido simple (SNP) distribuidos en el genoma bovino se realizó con el chip GGP-LD de GeneSeek® de 26K SNPs bajo las recomendaciones de la casa fabricante.

Depuración de bases de datos y análisis estadístico La información derivada de la evaluación fenotípica permitió generar cuadros de frecuencia sobre los componentes raciales observados en los hatos evaluados. Por su parte, la información molecular fue preparada para análisis poblacionales, a fin de identificar los grupos genéticos presentes. Por tanto, inicialmente se excluyeron aquellos marcadores SNP con posición desconocida y los ubicados en cromosomas sexuales. Igualmente se descartaron del análisis SNP que no fueron detectados en más de 5 % de los individuos, aquellos SNP que se desviaron del equilibrio Hardy-Weinberg (P<0.01) y los SNP que presentaron un MAF <0.01. Después de realizar la depuración se emplearon 24,266 SNP de las 126 muestras, con los que se realizaron los análisis genéticos. Con la información molecular se determinó inicialmente la estructura genética de la población MEZ mediante el análisis de componentes principales (PCA), es decir, a partir de los datos genotípicos se evaluó las relaciones genéticas entre individuos y se buscó posibles aglomeraciones respecto a los grupos genéticos establecidos en APF y las razas control usadas en ARG. Para tal fin, se usó el comando PRCOMP de la librería STATS del programa R(14). Para identificar las relaciones genéticas y posibles eventos de introgresión se utilizó la asignación probabilística de individuos a grupos genéticos, para ello, se empleó el algoritmo de máxima verosimilitud, el cual, basado en modelos estima

1011


Rev Mex Cienc Pecu 2021;12(4):1008-1024

la ancestria y calcula la probabilidad de los genotipos observados usando las proporciones de ancestria y las frecuencias alélicas de la población, algoritmo implementado en ADMIXTURE(15). Para la determinación de los k grupos genéticos presentes en la población, se analizaron de k= 2 a k= 10 grupos genéticos, y el valor k más probable se determinó por el valor más bajo de error en la validación cruzada realizada con las opciones por defecto del programa, y las recomendaciones del autor(15). Finalmente, mediante el algoritmo descrito previamente(15), se compararon las frecuencias alélicas de los SNP de la población mestiza de este estudio (MEZ, n= 126), respecto a las razas control, donde se usó un número aproximado de 20, buscando simetría con el número de muestras tomadas por hato (21 muestras). Para ello, se usó una base de datos de SNPs de las siete razas control, facilitadas por Laboratorio de Genética Molecular del Centro de Investigación Tibaitatá de AGROSAVIA y correspondieron a las razas: Brahman (BRA, n= 18), Holstein (HOL, n= 29), Blanco Orejinegro (BON, n= 19), Gyr (GYR, n= 18), Pardo Suizo (PAR, n= 20), Jersey (JER, n= 20) y Normando NOR, n= 20) por considerar su aparente uso en la formación del mestizaje de los bovinos del sistema doble propósito y de este modo establecer los grupos genéticos con mayor precisión.

Resultados Valoración fenotípica A partir de la información suministrada por los productores, se encontró que los grupos raciales predominantes fueron cruces con Gyr (22.4 %), cruces con Cebú (18.36 %), cruces con Holstein (16.32 %), cruces con Pardo Suizo (10.20 %), cruces con Normando (4.76 %) y cruces con Jersey (4.08 %). En la mayoría de los casos, los productores respondieron que la aparente composición racial de sus hatos obedecía a la raza del toro reproductor usado en los últimos años de apareamientos. El restante 23.80 % de los cruces hacen referencia a individuos con posibles grupos raciales criollos y no definidos. Por su parte, en los hatos MEZ con la aproximación APF, el 34 % de los animales fueron catalogados como PREDCEB, 37 % como PREDTAU y el restante 29 % como PREDINTER. A nivel de los hatos, las proporciones de las agrupaciones por fenotipo fueron variables entre sí, aunque una ligera similitud fue observada entre SJA y CUM (Figura 1), que a pesar de estar en regiones distantes muestran composiciones genéticas similares debido a su manejo y orientación productiva.

1012


Rev Mex Cienc Pecu 2021;12(4):1008-1024

Figura 1: Porcentaje de contribución por agrupaciones fenotípicas en los hatos evaluados

PREDCEB= animales con predominio Bos taurus indicus, PREDTAU= animales con predominio Bos taurus taurus, PREDINTER= animales con predominancia intermedia Bos taurus taurus x Bos taurus indicus, ACA= hato municipio de Acacías, CLN= hato municipio de Castilla La Nueva, CUM= hato municipio de Cumaral, MES= hato municipio de Mesetas, SJA= hato municipio de San Juan de Arama y VLL= hato municipio de Villavicencio.

Asignación racial genotípica En primer lugar, con la información genotípica se estableció la relación genética entre las muestras mediante análisis de componentes principales para los tres grupos genéticos PREDTAU, PREDINTER y PREDCEB (Figura 2). El primer componente principal (PC1) explicó el 6.52 % de la varianza total, asociada a la diferenciación de los componentes genéticos Bos taurus taurus y Bos taurus indicus. Las agrupaciones por APF propuestas PREDTAU, PREDCEB y PREDINTER no mostraron la separación genética esperada para la población MEZ, y por el contrario, todos los individuos de los grupos se dispersaron a lo largo del primer componente. Por su parte, el segundo componente principal explicó el 2.9 % de la variación, donde un grupo de individuos valorados por APF como PREDTAU se separó del eje de diferenciación observado en PC1 (Figura 2). En las gráficas de PCA se observó una alta dispersión en los animales con fenotipo Bos taurus taurus y Bos taurus indicus, lo cual puede asociarse a una variabilidad genética de las poblaciones superior a la variación fenotípica. No obstante, la proyección espacial de los animales diferenciados por el PC2 es un indicador de cómo las frecuencias alélicas distinguen animales con predominancia de un fenotipo, lo que hace obligatorio el uso de razas control para su mejor definición.

1013


Rev Mex Cienc Pecu 2021;12(4):1008-1024

Figura 2: Análisis de componentes principales (PCA) entre individuos para bovinos mestizos doble propósito y su aparente predominancia fenotípica (APF)

PREDCEB= animales con predominio Bos taurus indicus, PREDTAU= animales con predominio Bos taurus taurus, PREDINTER= animales con predominancia intermedia Bos taurus taurus x Bos taurus indicus.

Con el fin de establecer posibles razas que conformen el grupo genético el grupo MEZ, se incluyeron siete razas control y se valoró su relación mediante PCA (Figura 3). Figura 3: Análisis de componentes principales (PCA) con la inclusión de grupos raciales testigo en la población de bovinos doble propósito mestizo (MEZ)

BON= Blanco Orejinegro, BRA= Brahman, GYR= Gyr, HOL= Holstein, JER= Jersey, NOR= Normando, PAR= Pardo Suizo.

1014


Rev Mex Cienc Pecu 2021;12(4):1008-1024

El PC1 explicó 13.38 % de la variación total asociada a la diferenciación entre animales del grupo de razas B. taurus indicus (BRA y GYR) ubicados al lado derecho y el grupo de razas B. taurus taurus (HOL, JER, PAR, BON y NOR) ubicado al lado izquierdo (Figura 3). De hecho, la proyección espacial de los individuos mestizos presenta un amplio espectro entre estos dos grupos de razas tal como se observó inicialmente en la APF. El segundo componente principal PC2 explicó el 3.14 % de la variación. Es evidente que el grupo de razas B. taurus taurus presenta mayor variabilidad que el grupo B. taurus indicus, se destaca que la raza JER muestra la mayor separación entre las razas B. taurus taurus y solo un pequeño grupo de animales MEZ se mostrarían en el espectro hacia esta raza (Figura 3). El tercer componente-PC3, el 2,77 % de la variación fue explicada por este componente, las razas HOL y PAR se muestran como los grupos más alejados entre sí y en el espectro abarca a una parte de los animales mestizos de este estudio y a animales de las razas BON y NOR. La segunda aproximación para definir los grupos genéticos existentes empleó la asignación probabilística bayesiana implementada en ADMIXTURE, donde se determinó que el menor error en la validación cruzada correspondía a 7 (k=7) grupos genéticos, tomando este valor como adecuado para explicar la composición genética en la población MEZ de este estudio, asociada a los grupos genéticos BRA, GYR, BON, HOL, PAR, JER y NOR (Figura 4), donde se observa la representación gráfica de los resultados, donde cada individuo está representado por una línea vertical, y los colores representan la fracción de asignación a cada grupo genético. Figura 4: Estructura poblacional de genotipos de la población mestiza doble propósito (MEZ) y razas control

BON= Blanco Orejinegro, BRA= Brahman, GYR= Gyr, HOL= Holstein, JER= Jersey, NOR= Normando, PAR= Pardo Suizo.

Las razas HOL, GYR y BRA presentaron la mayor proporción racial en la población MEZ. El análisis de ADMIXTURE permitió con mayor claridad determinar la composición racial del hato de estudio respecto a los análisis de PCA. Sin embargo, ciertos hatos mostraron de forma excepcional composiciones raciales abundantes para ciertas razas como la BON. 1015


Rev Mex Cienc Pecu 2021;12(4):1008-1024

En el Cuadro 1, se observa la composición racial por hato a partir de la información generada del análisis de ADMIXTURE. Se encontró que la contribución de las razas HOL, GYR y BRA en la composición de MEZ fue 23.47 %, 21.43 % y 21.05 % respectivamente. Otras razas como BON (12.41%) y PAR (10,15 %) contribuyeron en menor medida, y las razas NOR y JER mostraron la menor contribución de todas las razas testigo con 6.51 y 4.96 % respectivamente. Las razas HOL, GYR y BRA fueron predominantes en las observaciones fenotípica y molecular de la población MEZ, pero la estimación de su aporte al acervo genético de la población mestiza mejoró considerablemente cuando se usaron los análisis moleculares. Cuadro 1: Porcentajes de conformación racial de bovinos mestizo doble propósito (MEZ) respecto a razas control Hato* ACA CLN CUM MES SJA VLL Total general

PAR 10.99 9.70 19.12 12.93 7.03 3.04 10.15

GYR 23.41 36.07 15.52 18.14 22.58 14.58 21.43

JER 2.84 4.08 10.04 3.36 5.94 2.87 4.96

BRA 16.65 14.39 18.96 28.92 18.12 25.76 21.05

BON 6.33 3.58 8.54 5.62 6.29 41.07 12.41

HOL

NOR

32.18 28.05 22.38 25.05 28.02 9.41 23.47

7.59 4.13 5.42 5.98 12.01 3.29 6.51

PAR= Pardo Suizo, GYR= Gyr, JER= Jesey; BRA= Brahman, BON= Blanco Orejinegro, HOL= Holstein, NOR= Normando. * Hato: ACA= hato mestizo municipio de Acacías, CLN= hato mestizo municipio de Castilla La Nueva, CUM= hato mestizo municipio de Cumaral, MES= hato mestizo municipio de Mesetas, SJA= hato mestizo municipio de San Juan de Arama, VLL= hato mestizo municipio de Villavicencio.

De igual forma el uso de marcadores moleculares permitió cuantificar la proporción de otras razas cuyo aporte por fenotipo resultan menos predecibles. Por ejemplo, se identificó la alta presencia de la raza criolla colombiana BON en VLL (41.07 %); presencia de la raza PAR en CUM (19.12 %), MES (12.93 %) y ACA (10.99 %), mientras que NOR sobresalió en SJA (12.01%) y JER en CUM (10.04 %) como se observa en el Cuadro 1.

Aparente predominancia fenotípica (APF) vs Asignación racial genotípica (ARG) Cuando los tres grupos genéticos generados por la aparente predominancia fenotípicaAPF (PREDTAU, PREDCEB y PREDINTER) fueron comparados con las composiciones raciales generadas por la asignación racial genotípica-ARG, se encontró que los animales asignados al grupo PREDTAU (37 % de la población de estudio), presentaban una amplia variación de su composición racial obtenida mediante ARG. Los grupos raciales usados como testigos en ARG, en las razas variaron entre un mínimo de 0.1 % hasta un máximo de 80 %, el valor más alto de asignación fue encontrado en la 1016


Rev Mex Cienc Pecu 2021;12(4):1008-1024

raza BON, seguido de PAR y HOL, no obstante, la raza GYR también mostró una considerable proporción (Cuadro 2). Cuadro 2: Asignación racial genotípica (ARG) individual máxima, respecto a los grupos raciales asignados por aparente predominancia fenotípica (%) Grupos APF* PAR

GYR

JER

BRA

BON

HOL

NOR

PREDCEB 35.78 PREDINTER 44.42 PREDTAU 65.16

84.27 60.41 65.40

34.57 15.39 53.46

71.66 58.34 52.73

18.34 88.07 80.01

53.34 56.09 64.86

14.26 34.84 33.49

BON= Blanco Orejinegro, GYR= Gyr, NOR= Normando, BRA= Brahman, JER= Jersey, HOL= Holstein, PAR= Pardo Suizo. * APF= aparente predominancia fenotípica, PREDCEB= con predominio Bos taurus indicus, PREDTAU= con predominio Bos taurus taurus, PREDINTER=con predominancia intermedia Bos taurus taurus x Bos taurus indicus.

Por su parte, animales catalogados en PREDCEB (34 % de la población de estudio), mostraron una variabilidad en la composición racial principalmente para las razas relacionadas al grupo Bos taurus indicus, con valores que iban desde un mínimo de 0.1 % hasta un máximo de 84.2 %, se destacó las máximas asignaciones en la raza GYR y BRA, e incluso se desataca la considerable asignación encontrada para HOL (Cuadro 2). Para animales agrupados en PREDINTER (29 % de la población de estudio), cuya asignación racial predominante presenta mayor dificultad, mostraron una gran variabilidad tanto para las razas Bos taurus indicus como para las razas Bos taurus taurus de acuerdo con ARG. Los valores de asignación racial variaron entre 0.1 y 88 %, para razas BON y HOL y valores relevantes de asignación en las razas GYR y BRA (Cuadro 2). De esta forma, es evidente las discrepancias entre la asignación fenotípica y genotípica de los individuos.

Discusión Valoración fenotípica La información derivada de visitas a predios y entregada por los productores da idea de constantes situaciones ambientales, sanitarias y de coyuntura económica que modelan día a día las ganaderías en Colombia. En MEZ, la abundante proporción encontrada de razas históricamente asociadas con la producción de leche (p. ej. Holstein y Pardo Suizo) y más recientemente la raza Gyr reconocida por su capacidad para producción de leche, rusticidad y fertilidad a lo largo zonas tropicales y subtropicales(16) se asocian directamente a la búsqueda de animales productivos con adaptación al entorno.

1017


Rev Mex Cienc Pecu 2021;12(4):1008-1024

Como se ha establecido, una proporción superior al 50 % de B. taurus taurus especialmente por las razas lecheras Holstein, Pardo Suizo y Jersey está asociado a mayor producción de leche y una menor respuesta reproductiva en ambientes tropicales, mientras que una proporción mayor de B. taurus indicus en especial de las razas Brahman y Gyr están asociadas a un mayor grado de adaptación e índices reproductivos superiores que los B. taurus taurus , sin dejar de lado los factores netamente relacionados al manejo animal(17,18). Bajo esta premisa, los productores han promovido el mestizaje de los animales, pero sin una orientación de manejo del recurso animal, sin criterios técnicos y en ocasiones sin el conocimiento de la pureza racial de los reproductores(19). Resultado de estas prácticas en este estudio se observó que el desconocimiento total del mestizaje puede llegar hasta un 23.8 % de los animales de sus hatos. Por su parte, las agrupaciones generadas por APF mostraron cierta simetría entre los grupos PREDTAU, PREDCEB y PREDINTER, solo una ligera desviación fue observada en PREDTAU (+3 %). Lo anterior deja en evidencia la intención del productor por mantener las proporciones raciales entre los grupos genéticos establecidos por APF, con la intención de explotar mejor el vigor hibrido entre las razas B. taurus taurus y B. taurus indicus más comunes para la producción de leche y a la vez de carne en un sistema tradicional de doble propósito. La aproximación APF, fue un abordaje inicial para la comprensión de los diversos cruces de razas definidas(12), y obedece a protocolos de caracterización racial los cuales aportan información a los análisis genotípicos basados en marcadores moleculares(20). La amplia gama de cruces y la predominancia del fenotipo B. taurus indicus encontrado en MEZ está bien argumentada en la búsqueda constante por complementar los componentes de mayor producción de leche generalmente otorgada por las razas lecheras del género B. taurus taurus, como Holstein, Pardo Suizo entre otras, y aprovechar la adaptación de los animales B. taurus indicus o criollos existentes de los hatos del sistema doble propósito en la Orinoquia(21). El análisis de componentes principales muestra la alta variabilidad genética de la población y que reduce la correspondencia con las agrupaciones APF propuestas. Esto se traduce en un amplio margen de error cuando se diseñe la estrategia de apareamiento donde se requiere información genotípica o genealógica más precisa de los ancestros que conforman cada individuo y por ende en cada hato(22). De igual forma, el análisis de componentes principales con razas testigo mostró el alto grado de mestizaje entre B. taurus taurus y B. taurus indicus. El considerable número de razas testigos usadas en este estudio dan muestra de la compleja relación genética en los hatos doble propósito en la región de estudio y puede ser un indicador de lo que sucede en la gestión genética de los hatos doble propósito en Colombia. Otros estudios presentan esa misma característica, como los reportado para hatos mestizos en África oriental, donde la población estudiada mostro un similar espectro de mestizaje entre Bos taurus taurus y Bos taurus indicus pero sin la presencia de la raza Gyr(23). 1018


Rev Mex Cienc Pecu 2021;12(4):1008-1024

Designación racial genotípica La relativa baja definición de la estructura poblacional obtenida mediante componentes principales para la población MEZ, evidencia de forma clara eventos de mestizaje. Dichos resultados obedecen a un seguimiento genealógico, limitado uso de registros y cruzamientos sin una orientación clara. De hecho, se observa una relación en clina de los individuos en la proyección del PC1 (Figuras 2). Se espera que la frecuencia alélica de los animales MEZ sea intermedia respecto a los animales Bos taurus taurus y Bos taurus indicus(10). Sin embargo, los sistemas productivos tienden a conformar animales cruzados sin control de las proporciones raciales, guiados por la búsqueda de un mayor grado de adaptación a las condiciones ambientales de la región, eficiencia reproductiva y producción de leche(18,19). Cuando se incluyeron grupos genéticos conocidos en los análisis (Figura 3), se logró proyectar la estructura genética de estas poblaciones y permitió establecer la composición de MEZ, siendo evidente la ubicación en los extremos de los grupos genéticos B. taurus taurus, conformada por las razas; HOL, JER, PAR, NOR y BON y el grupo genético B. taurus indicus conformado por las razas GYR, BRA, dado que el sistema de producción está enfocado en buscar biotipos animales mejor catalogados para producción de leche y carne. La amplia variabilidad observada en los análisis componentes principales (PC1; Figura 3), coincide con la distribución observada en estudios con hatos mestizos doble propósito en África(23). La abundante proporción de las razas HOL, GYR y BRA encontradas en la población de estudio mediante los análisis de ADMIXTURE, evidencian el uso de toros reproductores de origen B. taurus taurus con mayor afinidad para producción de leche (Holstein) y de origen B. taurus indicus (Brahman y Gyr) con afinidad para la producción de carne y leche(24). No obstante, existen hatos con casos particulares donde el aporte B. taurus taurus puede provenir de otras razas de origen europeo como Pardo Suizo, Normando, Jersey y de razas criollas como la Blanco orejinegro, incluso, pese a su aparente menor tolerancia al trópico cálido, ciertas razas locales pueden suplir las necesidades de hibridación con razas B. taurus indicus(25). Las proporciones raciales predominantes pueden variar por hato, región o país, dependiendo de la disponibilidad de los reproductores (material seminal y animales en pie), orientación y hato base(8) como lo demuestra estudios en hatos mestizos en África oriental, donde la mayor composición de los hatos estuvo dada por las razas Holstein, Friesian (Tanzania y Etiopia) y Ayrshire (Kenia), mientras que la raza Nelore resultó común para los tres países(23). La diversidad en la gestión de los hatos bovinos doble propósito en Colombia ha sido generalmente asociada a un manejo extensivo, con limitado registro de información productiva de los animales, lo que ha socavado aún más en problemas para establecer biotipos o cruzamientos que brinden mayor heterosis y por ende el mejor desempeño 1019


Rev Mex Cienc Pecu 2021;12(4):1008-1024

productivo(24,26), en este sentido, las aproximaciones genotípicas resultan determinantes para conocer la composición racial y cimentar las bases para la comprensión del desempeño productivo y adaptativo del hato.

Agrupación fenotípica propuesta (AFP) vs Asignación racial genotípica (ARG) La agrupación fenotípica propuesta (AFP) ayudó parcialmente a la designación racial del 71 % de los animales en los grupos PREDTAU y PREDCEB, por ende, podría emplearse como una herramienta de orientación en el manejo de cruzamientos o una estrategia para el mejoramiento genético(27). Sin embargo, el 29 % de animales catalogados como PREDINTER resulta compleja su orientación, requiriendo que los animales presenten un fenotipo B. taurus taurus y B. taurus indicus definido. El rango tan amplio observado en PREDTAU (0.1 a 80 %), PREDCEB (0.1 a 84.2 %) y PREDINTER (0.1 a 88 %) para la asignación racial individual hizo visible como la aproximación por ARG favorece la correcta definición de la composición racial, incluso al detectar una considerable proporción para la raza Gyr (65.4 %) en PREDTAU un grupo donde presume que la proporción de razas B. taurus indicus es mínima o HOL (53.3 %) en PREDCEB donde se espera una mínima porción de razas B. taurus taurus. Por su parte la porción que presenta mayor dificultad como es PREDINTER reveló que ambos grupos genéticos B. taurus taurus (BON y HOL) y B. taurus indicus (GYR y BRA) alcanzaron valores máximos superiores al 50 %. Tal como lo sugieren estudios en animales Brangus y en cruces terminales entre Angus, Charolais y Hereford la aproximación genotípica aportó precisión a la correcta definición de la composición máxima para la raza Angus(22) y los cruces terminales(28). La consideración de una clasificación APF requiere que los animales presenten los rasgos fenotípicos de las razas, o que contemplen una estructura fenotípica con rasgos combinados. Sin embargo, aunque los individuos presenten un fenotipo similar, es posible encontrar diferencias alélicas asociadas a otras características de interés, como rendimiento en canal, producción de leche, calidad de la carne y la leche(29). Una amplia divergencia entre métodos APF y ARG fue observada cuando estas fueron comparadas entre sí, un amplio y variado rango de aporte genético (determinado por ARG) de diversas razas fue encontrado (0.1 % hasta el 88.9 %), lo cual deja al descubierto las erróneas interpretaciones a las que ha estado sumergido el manejo de un hato cuando éste se ciñe a la perspectiva de su apariencia, contrario a lo que ocurre en hibridaciones orientadas por información genealógica, como es el caso de animales para la producción de carne, buscando el equilibrio en las composiciones genéticas y explotar mejor el vigor hibrido(22). Así mismo, se sabe que no todos los cambios fenotípicos pueden ser atribuidos a cambios genéticos. Algunas diferencias en el color del pelo pueden ser atribuido a factores no genéticos como la edad, intensidad de la radiación solar o por la combinación

1020


Rev Mex Cienc Pecu 2021;12(4):1008-1024

de los factores genéticos y no genéticos(28). Esta es la razón por la cual es posible observar diferencias en la correspondencia fenotípica y genotípica, y es aquí donde las evaluaciones genotípicas cobran gran valor por su contribución en la precisión de las determinaciones y una herramienta adicional para la orientación de los esquemas de apareamiento más acordes a la realidad(22,25) y que contribuyan a mejorar los indicadores productivos al recortar tiempo para alcanzar los objetivos del productor, al permitirle a éste de forma temprana identificar y seleccionar animales cuya composición racial diverja de las metas establecidas, en otras palabras, haciendo del sistema productivo más rentable(22). La definición de las razas que más aportan a la composición del mestizaje en cada hato da idea de la orientación que ha recibido, por ende, es el indicativo fiel de los indicadores productivos en un hato cuyo enfoque incluye la producción de leche y carne(23). Previos reportes sugieren que las predicciones genotípicas han permitido corregir eficazmente erróneas asignaciones basadas en información genealógica de bovinos cruzados(9). Por otro lado, la asignación racial genotípica incorpora elementos de la demografía de las poblaciones y permite definir estrategias de manejo y conservación tanto en términos de población(30), como en el manejo de las frecuencias alélicas para genes de interés productivo asociados al crecimiento, calidad de la canal, calidad de la leche, la reproducción y la adaptación al trópico(9,25).

Conclusiones e implicaciones El conocimiento de los productores y la aproximación APF (PREDTAU, PREDCEB y PREDINTER) aportaron a dilucidar parcialmente la composición racial de un hato mestizo de bovinos doble propósito y sobre el manejo genético que un hato lleva en búsqueda de un equilibrio entre los grupos genéticos B. taurus taurus y B. taurus indicus. Sin embargo, se observó un amplio rango de error bajo esta metodología, por lo que una porción del hato podría asignarse de forma errada en un grupo determinado y desencadenar el ya conocido mestizaje sin orientación. La aproximación ARG permitió de forma efectiva identificar 7 grupos genéticos en la conformación de los hatos MEZ, con ello permitió de forma clara robustecer los métodos convencionales basados en apreciaciones fenotípicas como APF para definir la composición racial de bovinos mestizos doble propósito. La ARG tiene la capacidad de garantizar una amplia precisión en las predicciones de composición racial individual y del hato, con lo cual podría aportar de forma segura y rentable al desarrollo de estrategias de apareamientos dirigidos o de cruzamiento que garanticen mejor aprovechamiento del vigor hibrido con un equilibrio entre la producción de leche, carne y contemple su adaptación reconociendo las condiciones tropicales donde se desarrolla este sistema de producción como es el piedemonte del departamento de Meta.

1021


Rev Mex Cienc Pecu 2021;12(4):1008-1024

Agradecimientos y conflicto de intereses Los autores agradecen a la Corporación Colombiana de Investigación AgropecuariaAGROSAVIA adscrita al Ministerio de Agricultura de Desarrollo Rural de ColombiaMADR por la financiación de esta investigación. A los productores de ganado doble propósito que hicieron parte del proyecto y al laboratorio de genética molecular del C.I. Tibaitatá por los análisis genómicos. Este trabajo fue parte del proyecto “Estrategias integrales y participativas de fortalecimiento tecnológico del sistema bovino doble propósito del piedemonte llanero (Fase 1)”. Literatura citada: 1. Federación Colombiana de Ganaderos- FEDEGAN. Cifras de referencia del sector ganadero colombiano.2018. https://www.fedegan.org.co/estadisticas/documentosde-estadistica. 2. Ortega LE, Ward RW, Andrew CO. Technical efficiency of the dual-purpose cattle system in Venezuela. J Agr Appl Economy 2007;39:719-733. 3. Pariacote FA. Perspectivas de mejoramiento genético del bovino criollo. En Duran C, Campos R, editores. Perspectivas de conservación: Mejoramiento y utilización de recursos genéticos criollos y colombianos en los nuevos escenarios del mejoramiento animal. Palmira-Valle del Cauca. UN-Palmira. 2008:17-30. 4. Vergara GOD, Flórez MJM, Hernández PMJ, Yaguna GCJ, Manco JC, Barrios RTE, Rico CJ. Efectos raciales, de heterosis y parámetros genéticos para peso al nacer en una población multirracial de ganado de carne en Colombia. Livest Res Rural Develop 2014;26(58). 5. Echeverry ZJ, Salazar RVE, Múnera D. El cruzamiento como estrategia para mejorar la rentabilidad de hatos lecheros. Revista Lasallista de Investigación. 2006, 3 (juliodiciembre):<http://www.redalyc.org/articulo.oa?id=69530209> ISSN 1794-4449. Consultado 25 Abr, 2019. 6. Elzo MA. Evaluación Multirracial de Bovinos en Colombia: desde la genética a la genómica. Departamento de Ciencias Animales, Universidad de Florida, Gainesville, FL. Estados Unidos. 2011. 7. Frankham R, Ballou JD, Briscoe DA. Introduction to conservation genetics. Cambridge, UK: Cambridge University Press; 2002. 8. Gorbach DM, Makgahlela ML, Reecy JM, Kemp SJ, Baltenweck I, Ouma R, et al. Use of SNP genotyping to determine pedigree and breed composition of dairy cattle in Kenya. J Anim Breed Genet 2010;127:348–351.

1022


Rev Mex Cienc Pecu 2021;12(4):1008-1024

9. Akanno EC, Chen L, Abo-Ismail MK, Crowley JJ, Wang Z, Li C, Basarab J, et al. Genomic prediction of breed composition and heterosis effects in Angus, Charolais and Hereford crosses using 50K genotypes. Can J Anim Sci 2017;97:431–438. 10. Bolormaa S, Hayes BJ, Hawken RJ, Zhang Y, Reverter A, Goddard ME. Detection of chromosome segments of zebu and taurine origin and their effect on beef production and growth. J Anim Sci 2011;89(7):2050-60. 11.Otero AE, Mosquera AL, Silva CG, Guzmán VJC. El Piedemonte. La Orinoquia de Colombia. Bogotá: Banco de Occidente 2014. ISBN 95896774968. 12.Villasmil IW, Aranguren-Méndez JA. Clasificación fenotípica en vacas mestizas. En: González-Stagnaro C, Soto-Belloso E, editores. Manual de Ganadería Doble Propósito. Maracaibo-Venezuela: Ediciones Astro Data, S.A; 2005;8(1):283-290. 13. Li Y, Levran O, Kim J, Zhang T, Chen X, Suo Ch. Extreme sampling design in genetic association mapping of quantitative trait loci using balanced and unbalanced casecontrol samples. Sci Rep 2019;9:15504. https://doi.org/10.1038/s41598-019-51790w. 14. R Core Team R: A language and environment for statistical computing. R Foundation for Statistical Computing 2014: Vienna, Austria. http://www.R-project.org/. 15. Alexander DH, Novembre J, Lange K. Fast model-based estimation of ancestry in unrelated individuals. Genome Res 2009;19(9):1655-1664. 16. Neves HHR, Carvalheiro R, Fries LA, Queiroz SA. Uso combinado de sêmen sexado e acasalamento dirigido sobre uma população de bovinos de corte submetida a seleção: estudo de simulação. Rev Brasileira Zoot 2009;38:2368-2374. 17. Perdomo-Carrillo D, Perea F, Soto-Belloso E, Piña-Monsalve J, Moratinos-López P, Martínez-López M, Perea-Brugal M. Efecto de la raza paterna sobre el desempeño productivo de un rebaño de vacas mestizas doble propósito en Venezuela. Maskana 2017;8:141-143. https://publicaciones.ucuenca.edu.ec/ojs/index.php/maskana/article/view/1509 18. Zambrano R, Santos H, Contreras R, Moreno A, Chirinos Z. Características productivas de un rebaño mestizo bovino doble propósito comercial en Venezuela. Actas Iberoam Conserv Anim 2013;3:15-19. 19. Galeano AP, Manrique C. Estimación de parámetros genéticos para características productivas y reproductivas en los sistemas doble propósito del trópico bajo colombiano. Rev Facultad Med Vet Zoot 2010;57(II):119-131. 20. FAO. Food and Agriculture Organization of the United Nations. Phenotypic characterization of animal genetic resources. FAO Animal Production and Health Guidelines. Rome. 2012.

1023


Rev Mex Cienc Pecu 2021;12(4):1008-1024

21.Salamanca-Carreño A, Vélez TM, Bentez MJ. Efectos no genéticos sobre la reproducción en vacas mestizas con predominio Bos indicus en el municipio de Arauca, Colombia. Rev Invest Vet Perú 2017;28(1):101-109. https://doi.org/10.15381/rivep.v28i1.11749. 22. Wang Y, Wu X-L, Li Z, Bao Z, Tait RG Jr, Bauck S, Rosa GJM. Estimation of genomic breed composition for purebred and crossbred animals using sparsely regularized admixture models. Front Genet 2020;11:576. 23. Strucken EM, Al-Mamun HA, Esquivelzeta-Rabell C, Gondro C, Mwai OA, Gibson JP. Genetic tests for estimating dairy breed proportion and parentage assignment in East African crossbred cattle. Genet Sel Evol 2017;49(1):67. doi.org/10.1186/s12711-017-0342-1. 24. Cortés H, Aguilar C, Vera R. Sistemas bovinos doble propósito en el trópico bajo de Colombia. Modelo de simulación. Arch Zootec 2003;52:25-34. 25. Ahmad SF, Panigrahi M, Chhotaray S, Pal D, Parida S, Bhushan B, Gaur GK, et al. Revelation of genomic breed composition in a crossbred cattle of India with the help of Bovine 50K BeadChip. Genomics. 2020; 112(2):1531-1535. doi: 10.1016/j.ygeno.2019.08.025. Epub 2019 Aug 28. PMID: 31472242. 26. Ramírez-Toro EJ, Ocampo-Gallego RJ, Burgos-Paz WO, Elzo MA, MartínezSarmiento RA, Cerón-Muñoz MF. Estimación poligénica y genómico-poligénica para características de crecimiento en ganado Blanco Orejinegro (BON). Livest Res Rural Develop 2019;31:30. 27. Aranguren-Méndez J, Román R, Villasmil-Ontiveros Y. Evaluación genética de la ganadería mestiza doble propósito en Venezuela. XX Reunión ALPA, XXX Reunión APPA-Cusco-Perú. Arch Latinoam Prod Anim 2007:15(Supl 1):241-250. 28. Akanno EC, Chen L, Abo-Ismail MK, Crowley JJ, Wang Z, et al. Genomic prediction of breed composition and heterosis effects in Angus, Charolais, and Hereford crosses using 50K genotypes, Can J Anim Sci 2017;97(3):431-438. 29. Orgogozo V, Morizot B, Martin A. The differential view of genotype-phenotype relationships. Front Genet 2015;6:179. 30. Gobena M, Elzo MA, Mateescu RG. Population structure and genomic breed composition in an Angus–Brahman crossbred cattle population. Front Genet 2018; 9:90. https://doi.org/10.3389/fgene.2018.00090.

1024


https://doi.org/10.22319/rmcp.v12i4.5796 Artículo

Relaciones entre estacionalidad, características corporales y leptina en el inicio de la pubertad en vaquillas Bos taurus taurus y Bos taurus indicus en el trópico mexicano

Carlos Hernández-López a René Carlos Calderón-Robles b Alejandro Villa-Godoy c Ángel Ríos-Utrera d Sergio Iván Román-Ponce e Everardo González-Padilla c*

a

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal. Querétaro, México. b

INIFAP. Campo Experimental Las Margaritas, Puebla, México.

c

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México. d

INIFAP. Campo Experimental La Posta. Veracruz, México.

e

INIFAP. Campo Experimental La Campana. Chihuahua, México.

* Autor de correspondencia: ever@unam.mx

Resumen: El estudio analizó, en dos años, los efectos de raza [Brahman (BHM; n= 65); Suizo Europeo (SE; n= 56)], suplementación con Zilpaterol® (ZIL; tratadas o testigo), estación de nacimiento (primavera u otoño) y sus interacciones, sobre superficie corporal (SC), edad 1025


Rev Mex Cienc Pecu 2021;12(4):1025-1044

(EPB), peso corporal (PPB), condición corporal (CC), profundidad del músculo largo dorsal (MD), grosor de grasa dorsal (GD) y concentración sérica de leptina (LEP) a la pubertad (PB) de 121 vaquillas. A la PB, las BHM fueron más pesadas y tuvieron más edad que las SE (376.8 ± 7.4 vs 302.0 ± 6.6 kg; 588.1 ± 14.7 vs 445.5 ± 12.5 días). ZIL aumentó EPB, PPB, CC y MD, pero no afectó GD y LEP. Las BHM tuvieron 18 % más SC que las SE. Sin embargo, la diferencia en PPB/SC fue sólo de 6.4 %. Cuando se usó peso metabólico (PM) como proporción de la SC (PM/SC) en lugar de PPB, la diferencia entre BHM y SE desapareció (P>0.05). El GD fue 63.7 % mayor en BHM que en SE. Las nacidas en primavera iniciaron la PB con 24.4 % menos GD que las nacidas en otoño. La mayoría de las vaquillas BHM (73.8 %) inició la PB en los meses en que las horas luz iban en aumento (P<0.05), mientras que en las SE el inicio de la PB estuvo uniformemente distribuido a través del año, independientemente de la duración de las horas luz; este efecto se mostró en los dos años de estudio. Se concluye que el establecimiento de la pubertad es un fenómeno multifactorial; la estacionalidad afecta a BHM y SE de manera diferenciada y, aparentemente, la SC es un factor importante, probablemente asociado con la eficiencia en la utilización de energía. Este trabajo reitera la importancia de la grasa dorsal y documenta, por primera vez PM/SC y su asociación con el establecimiento de la pubertad. Palabras clave: Pubertad, Superficie corporal, Estacionalidad, Ganado tropical, Leptina.

Recibido: 04/09/2020 Aceptado: 03/09/2021

Introducción Entre las determinantes más importantes para el establecimiento de la pubertad en vaquillas para producción de carne se incluyen la edad(1), la talla y el peso corporal(2), con diferencias marcadas entre razas. En condiciones tropicales, actualmente son comunes los sistemas de producción con bovinos Bos taurus taurus, Bos taurus indicus y sus cruzas y del desempeño reproductivo de los hatos de cría depende la producción y productividad global del sistema de producción de carne de res. La etapa prepuberal de las vaquillas es un factor de costo y la edad a primer parto es un indicador importante del desempeño reproductivo del hato. Las vaquillas Cebú (Bos taurus indicus) requieren más edad y peso para alcanzar la pubertad que las Bos taurus taurus(3). Este hecho se ha destacado como un factor limitante para el éxito reproductivo de las razas Bos taurus indicus(4). La edad a la pubertad está estrechamente relacionada con el peso y la composición corporal de los animales(5).

1026


Rev Mex Cienc Pecu 2021;12(4):1025-1044

Existen interacciones complejas entre diferentes hormonas para el establecimiento de la pubertad(6) y se resalta la importancia de la leptina por su asociación con la acumulación de grasa, ya que participa en la regulación del consumo de alimento, y es buen indicador dinámico de la condición corporal y del estado nutricional en rumiantes(7). Se ha reportado que las concentraciones circulantes de leptina aumentan durante el desarrollo puberal en vaquillas(8). La información disponible sugiere que hay un nivel crítico de grasa requerido para el inicio de la actividad reproductiva(9) y que puede haber diferencias en este límite crítico de grasa entre razas(10), lo que implica que deben existir condiciones para regular la acumulación de energía excedente en forma de grasa corporal. A pesar de que se conocen varios factores que afectan el establecimiento de la pubertad en vaquillas, es escasa la literatura sobre las interacciones entre estos y, particularmente, sobre las diferencias entre B. taurus taurus y B. taurus indicus, en especial si consideramos el factor estacionalidad, que se asocia con el ganado Cebú(3,11,12). Con base en lo anterior, el presente estudio tuvo como objetivo determinar la asociación entre algunos señalizadores de la composición corporal, del ambiente interno de los animales y los del medio ambiente externo, con el establecimiento de la pubertad en vaquillas B. taurus taurus y B. taurus indicus, alimentadas en forma individual para tener ganancias de peso similares, nacidas en diferentes estaciones del año, con una composición corporal diferente, inducida durante su crecimiento.

Material y métodos Localización El estudio se realizó en el campo experimental Las Margaritas, dependiente del INIFAP, ubicado en Hueytamalco, Puebla, México, a 19º 51’ 03" LN y 97º 12’ 48" LO, a 500 msnm. El clima es subtropical húmedo semicálido Af(c), con temperatura promedio anual de 20.8 °C, precipitación pluvial media anual de 3,000 mm y humedad relativa de 90 %.

Tratamientos El estudio se repitió durante dos años; en total se utilizaron 121 vaquillas provenientes de dos estaciones de nacimiento: 24 Suizo Europeo (SE) y 33 Brahman (BHM) nacidas en primavera (04 de mayo ± 36 días), y 32 SE y 32 BHM nacidas en otoño (27 de octubre ± 35 días). La mitad de las vaquillas de cada raza y estación-año recibió uno de dos tratamientos: 1) con el β-agonista clorhidrato de Zilpaterol (ZIL, Zilpaterol®); 0.15 mg/kg de los 220 a los 300 kg de peso corporal y 0.25 mg/kg de los 301 kg de peso corporal hasta la primera ovulación, mezclado en el concentrado, y 2) sin β-agonista (testigo). La PB para este estudio se definió como la primera ovulación que precedió al primer ciclo estral con formación de un cuerpo lúteo de duración normal (≥ 12 ≤ 17 días), correspondiente a un ciclo estral regular (21 ± 4 días)(13).

1027


Rev Mex Cienc Pecu 2021;12(4):1025-1044

Manejo general Las vaquillas ingresaron al estudio con alrededor de siete meses de edad. Se alojaron de manera individual en corrales de 4 × 6 m, con piso de cemento, techo de asbesto (4 × 3 m), comedero y bebedero. Para su adaptación al manejo y a la rutina de muestreo, las vaquillas se introdujeron a los corrales aproximadamente 30 días antes del estudio, se sujetaron con jáquima (2 h/día) y se cepillaron manualmente. La alimentación consistió en forraje (Saccharum sinense) fresco, picado, a libertad, y concentrado comercial (18 % de proteína cruda y 70 % de TDN), cuya cantidad se ajustaba luego de cada pesaje de las vaquillas, para obtener ganancias de peso similares entre animales. Por cuestiones prácticas, se decidió nombrar de forma indistinta «vaquillas» a todas las hembras desde el inicio hasta su salida del experimento.

Estimación de parámetros de desarrollo y composición corporal Los animales se pesaron cada 14 días, previo retiro de alimento y agua por 18 h. Cada 21 días se registró la condición corporal (1 a 9; 1= muy delgada, 9= obesa)(14), la cual fue calificada de manera independiente por tres personas, y el promedio de estas calificaciones se usó como variable de respuesta. La superficie corporal se midió cada 48 días, con un contador adaptado a un instrumento de rodillos para medir la superficie del tronco (odómetro); además, se empleó una cinta métrica para determinar la superficie de miembros, cabeza, orejas y cola. Para garantizar la reproducibilidad de las mediciones, el odómetro se validó mediante la medición independiente de 10 animales, por tres personas en tres ocasiones un mismo día. Se obtuvo un coeficiente de correlación intraclase de las medidas individuales y del promedio de 0.96 y 0.98 (P<0.0001), respectivamente, y una fiabilidad de 0.98 en el Alfa de Cronbach(15). El área medida con el odómetro se estableció con la circunferencia de las llantas, la distancia entre las mismas y el número de vueltas. Para calcular la superficie corporal (SC), se utilizó la siguiente fórmula: SC= 2 (a + p + m + o) + r + c, donde: a= área medida con el odómetro, p= área de la pierna, m = área del miembro anterior, o= área de la oreja, r= área de la cola y c= área de la cabeza. Las mediciones generales, hechas con cinta métrica, se ingresaron a una base de datos Excel y se validaron de la misma forma que el odómetro, obteniendo un coeficiente de correlación intraclase de 0.99 para las medidas individuales y el promedio (P<0.0001). Se midió el grosor de la grasa dorsal (GD) y la profundidad del músculo largo dorsal (MD), obteniendo imágenes con un ultrasonido (equipado con un transductor de 3.5 MHz) en el lado izquierdo del dorso, a 12 cm de la línea media, a nivel de la doceava costilla, previa depilación del área y aplicación de gel(16). Las mediciones se hicieron cada 14 días, coincidiendo con los pesajes de los animales a lo largo del estudio. Las mediciones de MD corresponden solo a las vaquillas del segundo año de experimentación.

1028


Rev Mex Cienc Pecu 2021;12(4):1025-1044

Obtención de sangre y medición de hormonas Al iniciar el estudio, para confirmar el estado prepuberal de las vaquillas mediante la progesterona sérica, se colectó una muestra de sangre de cada animal durante cinco días consecutivos, mediante punción de la vena yugular con aguja y tubos al vacío sin anticoagulante. Posteriormente, se colectaron muestras cuatro veces por semana hasta que cada vaquilla alcanzó 230 kg de peso corporal. A partir de ese momento el muestreo fue diario hasta finalizar el estudio, que fue cuando se determinó el inicio de la pubertad (PB), confirmado con la identificación de la primera ovulación mediante ultrasonido. Las muestras se procesaron para obtención de suero, el cual se congeló -20°C hasta determinar por radioinmunoanálisis (RIA) la concentración de progesterona (P4). La concentración de P4 se utilizó como confirmación del estado prepuberal (valores < 1 ng/ml) de las vaquillas. La concentración sérica de leptina (LEP) se evaluó con RIA específico para rumiantes(17). Las concentraciones séricas de leptina se cuantificaron a partir de las muestras tomadas cuatro veces por semana desde el inicio del experimento. Una vez identificado el inicio de la PB, se seleccionaron las últimas 12 muestras previas a la primera ovulación, de las cuales se obtuvo el valor promedio de la concentración sérica de leptina a la pubertad; los datos obtenidos fueron únicamente de las vaquillas del segundo año de experimentación.

Ultrasonografía de estructuras ováricas A partir de que se pudo introducir la mano por el recto de las vaquillas, aproximadamente a los 230 kg y 10 meses de edad, se tomaron imágenes ultrasonográficas de los ovarios para identificar la primera ovulación; inicialmente dos veces por semana y después diariamente. Para ello se utilizó un equipo Sonovet, con transductor rectal de 7.5 MHz y videograbadora. La primera ovulación se consideró el primer día que se detectó tejido lúteo precedido por la desaparición súbita del folículo dominante, lo anterior corroborado con la P4 sérica.

Variables Las variables de respuesta fueron los valores a la PB de: edad (EPB; días), peso corporal (PPB; kg), peso metabólico (PM; peso corporal elevado a la 0.75 potencia; kg), SC (m2), condición corporal (CC; puntos), GD (cm), MD (cm), peso corporal entre superficie corporal (PPB/SC; g/cm2), peso metabólico entre superficie corporal (PM/SC; g/cm2) y concentración sérica de leptina (LEP; ng/ml). Las variables PPB/SC y PM/SC se generaron para saber cuántos gramos de tejido metabólicamente activo hay por cada centímetro cuadrado de piel, que es un órgano que participa en la regulación de la temperatura corporal y puede actuar como un difusor de energía.

1029


Rev Mex Cienc Pecu 2021;12(4):1025-1044

Análisis estadísticos Los datos se analizaron mediante análisis de varianza y correlación de Pearson. El diseño fue un completamente al azar con arreglo factorial 2×2×2. El modelo estadístico preliminar incluyó los efectos principales de raza (RZ), estación de nacimiento (EN) y tratamiento (con o sin β-agonista), las interacciones dobles y triples entre estos efectos, el peso corporal de entrada al experimento como covariable y, como bloque, el grupo de entrada al experimento (animales agrupados según la fecha y año exacta de estudio) anidado en RZ x EN. El modelo estadístico definitivo incluyó los efectos principales y el bloque. Además, para EPB y CC, el modelo incluyó el peso corporal al inicio del experimento; la interacción RZ x EN solo se incluyó en el análisis definitivo de CC. Para analizar LEP, se realizó un análisis de covarianza de las concentraciones séricas de leptina, sobre los días transcurridos desde el inicio del estudio hasta el inicio de la PB, incluyendo los efectos fijos de RZ, EN y tratamiento. Las diferencias entre medias se determinaron con la opción PDIFF, todo esto con el procedimiento GLM de SAS(18). Se realizó una prueba de homogeneidad con una Jicuadrada, para observar el efecto de estacionalidad a la PB de las vaquillas, utilizando las variables categóricas RZ y EN, con respecto a las horas luz (en aumento o disminución) a la PB.

Resultados Correlaciones entre variables Independientemente de la raza de las vaquillas, se encontró correlación alta entre PPB y EPB (r= 0.86; P<0.01), así como entre SC y EPB (r= 0.84; P<0.01). Asimismo, la SC se correlacionó con PPB y PM (r= 0.90; P<0.01). Para LEP y PPB se observó una baja correlación (r= 0.28; P<0.01), así como para LEP y SC (r= 0.37; P<0.01). Se observó una correlación intermedia para las variables PM/SC y GD (r= 0.52; P<0.01). La covariable peso de las vaquillas al inicio del experimento sólo resultó significativa para EPB (P<0.01) y CC (P<0.05). Se encontró efecto de la interacción RZ x EN sobre CC (P<0.05). Además, hubo relación lineal (P<0.01) de LEP con respecto a los días transcurridos hasta la PB, existiendo 35 pg/ml más de LEP por cada día que se aproximó la pubertad.

Efecto de raza sobre las variables relacionadas con la pubertad A la PB, las vaquillas BHM fueron 74.8 kg más pesadas que las SE (P<0.0001), diferencia relacionada con la edad, ya que las BHM requirieron 142.6 d más que las SE para que la PB se presentara (P<0.0001; Cuadro 1). Las vaquillas BHM tuvieron 0.64 m² (18 %) más de SC que las SE (P<0.0001), mientras que la relación PPB/SC fue 6.4 % superior (P<0.001) en las BHM; esta diferencia desapareció cuando la comparación se hizo con base en PM/SC. Las 1030


Rev Mex Cienc Pecu 2021;12(4):1025-1044

vaquillas BHM mostraron 0.4 % más (P<0.05) CC que las SE (7.72 vs 7.69 puntos) a la PB. La diferencia más evidente fue en GD, donde las BHM mostraron 64 % más GD a la PB que las SE (P<0.0001). Coincidiendo con lo anterior, las vaquillas BHM tuvieron 20 % más (P<0.0001) LEP a la PB que las SE. Cuadro 1: Medias de cuadrados mínimos y errores estándar para las variables de respuesta a la pubertad, para los efectos raza y tratamiento

Variable1 PPB, kg PM, kg EPB, días SC, m2 PPB/SC, g/cm2 PM/SC, g/cm2 CC, 1 a 9 MD, cm* GD, cm LEP, ng/ml*

Raza

Tratamiento

Suizo Brahman Europeo 376.77 ± 301.97 ± 7.42a 6.59b 85.34 ± 1.29a 72.32 ± 1.15b 588.13 ± 445.51 ± 14.71a 12.48b 4.22 ± 0.07a 3.58 ± 0.06b 8.99 ± 0.11a 8.45 ± 0.10b

Control 320.47 ± 6.25a 75.57 ± 1.09a 490.29 ± 11.96a 3.79 ± 0.05a 8.48 ± 0.09a

Zilpaterol 358.27 ± 6.42b 82.09 ± 1.12b 543.35 ± 12.42b 4.00 ± 0.06b 8.97 ± 0.10b

Promedio 339.37 ± 6.78 78.83 ± 1.18 516.82 ± 13.08 3.90 ± 0.06 8.72 ± 0.10

2.05 ± 0.02a 7.72 ± 0.06a 5.86 ± 0.10a 2.39 ± 0.07a 3.30 ± 0.10a

2.01 ± 0.02a 7.56 ± 0.05a 4.95 ± 0.09a 1.95 ± 0.06a 2.95 ± 0.09a

2.07 ± 0.02b 7.86 ± 0.05b 5.60 ± 0.09b 1.91 ± 0.06a 3.09 ± 0.09a

2.04 ± 0.02 7.71 ± 0.06 5.28 ± 0.10 1.93 ± 0.06 3.02 ± 0.09

2.03 ± 0.02a 7.69 ± 0.05b 4.69 ± 0.10b 1.46 ± 0.06b 2.75 ± 0.09b

1

PPB= peso corporal; PM= peso metabólico; EPB= edad; SC= superficie corporal; PPB/SC= peso corporal entre superficie corporal; PM/SC= peso metabólico entre superficie corporal; CC= condición corporal; MD= profundidad del músculo largo dorsal; GD= grosor de la grasa dorsal; LEP= concentración sérica de leptina. *Resultados del segundo año. a,b Medias con distinta literal entre columnas de cada efecto fijo en cada una de las variables de respuesta indican diferencia (P<0.05).

Efecto del tratamiento sobre las variables relacionadas con el inicio de la pubertad El tratamiento con ZIL tuvo un efecto significativo (P<0.01) sobre el PPB; los animales que recibieron ZIL requirieron 37.8 kg más de peso corporal para iniciar la PB. En cuanto a EPB, tardaron 53 días más que los no tratados (P<0.05); además, su SC y PPB/SC fueron 7.0 (P<0.001) y 6.0 % mayores (P<0.05), respectivamente. La CC y la MD a la PB de los animales suplementados con ZIL fue 4.0 y 13.1 % mayor (P<0.001) que la de los del grupo control, respectivamente. Por el contrario, no se registró diferencia significativa (P>0.05) entre los dos grupos con respecto a GD y LEP.

1031


Rev Mex Cienc Pecu 2021;12(4):1025-1044

Efecto de la estación de nacimiento sobre las variables relacionadas con el inicio de la pubertad Las vaquillas nacidas en primavera tuvieron 0.42 cm menos GD que las vaquillas nacidas en otoño (P<0.05). Para LEP, a la PB se encontraron 0.46 ng/ml más en las vaquillas nacidas en otoño que en las nacidas en primavera (P<0.001). La SC fue mayor en las nacidas en primavera, en tanto que el PPB/SC y el PM/SC fueron menores (P<0.05) en las vaquillas nacidas en primavera (Cuadro 2). Cuadro 2: Medias de cuadrados mínimos y errores estándar para las variables de respuesta a la pubertad, para el efecto estación de nacimiento Estación de nacimiento Variable Primavera Otoño a PPB, kg 342.49 ± 6.55 336.25 ± 7.44a PM, kg 79.38 ± 1.14a 78.28 ± 1.29a EPB, días 533.19 ± 12.42a 500.46 ± 14.51a SC, m2 4.04 ± 0.06a 3.75 ± 0.06b PPB/SC, g/cm2 8.46 ± 0.10a 8.98 ± 0.11b PM/SC, g/cm2 1.97 ± 0.02a 2.10 ± 0.02b CC, 1 a 9 7.68 ± 0.09a 7.73 ± 0.06a MD, cm* 5.32 ± 0.10a 5.23 ± 0.10a GD, cm 1.72 ± 0.06a 2.14 ± 0.07b LEP, ng/ml* 2.79 ± 0.10a 3.25 ± 0.09b PPB= peso corporal; PM= peso metabólico; EPB= edad; SC= superficie corporal; PPB/SC= peso corporal entre superficie corporal; PM/SC= peso metabólico entre superficie corporal; CC= condición corporal; MD= profundidad del músculo largo dorsal; GD= grosor de la grasa dorsal; LEP= concentración sérica de leptina. *Resultados del segundo año. a,b Medias con distinta literal entre columnas de cada efecto fijo en cada una de las variables de respuesta indican diferencia (P<0.05).

Efecto de la interacción raza x estación de nacimiento sobre la condición corporal Las vaquillas SE nacidas en primavera tuvieron menor CC que las vaquillas SE nacidas en otoño y que las BHM nacidas en primavera (P<0.05), pero fueron similares a las BHM nacidas en otoño (Figura 1).

1032


Rev Mex Cienc Pecu 2021;12(4):1025-1044

Figura 1: Medias de cuadrados mínimos y errores estándar para condición corporal (CC) a la pubertad, por raza y estación de nacimiento

BHM= Brahman, SE= Suizo Europeo. Literales distintas (a,b) entre medias indican diferencia (P<0.05).

Se observó que 48 de las 65 vaquillas BHM iniciaron la PB en los meses en los que las horas luz aumentaban (22 de diciembre al 21 de junio) y las otras 17 vaquillas lo hicieron en los meses en los que las horas luz disminuían (22 de junio al 21 de diciembre) (P<0.05). Por el contrario, las vaquillas SE iniciaron la PB independientemente de la tendencia de cambio del fotoperiodo, ya que 30 de ellas iniciaron la PB cuando las horas luz aumentaban y otras 26 lo hicieron cuando las horas luz disminuían (P>0.05).

Discusión El presente estudio aporta información relevante sobre las relaciones entre señalizadores de la composición corporal, del ambiente interno de los animales y los del medio externo con el establecimiento de la pubertad en vaquillas. Se destaca la relación del establecimiento de la PB con características corporales como la cantidad de grasa y la SC; para esta última, la diferencia mostrada entre razas (17.8 %) se redujo al incorporar en el análisis PPB/SC (6.4 %), pero desapareció al considerarse PM/SC (<1%; P>0.05), lo que sugiere que más que la SC en sí, lo importante es la relación de la masa corporal con la SC, independientemente de la raza, a pesar de las claras y significativas (P<0.05) diferencias a la PB en el resto de las variables estudiadas entre BHM y SE. En buena medida, las diferencias en varias características corporales entre BHM y SE a la PB pudieron estar asociadas al hecho de que la PB en BHM ocurrió con 4.6 meses más de edad, período en que siguieron creciendo y modificando su composición corporal, sin embargo, no existió diferencia en la relación PM/SC a la PB, lo que sugiere que éste es un parámetro importante; si no es detonante, al 1033


Rev Mex Cienc Pecu 2021;12(4):1025-1044

menos indicativo de que hay un balance de energía que permite cubrir la demanda de las funciones vitales, termorregulación, locomoción, crecimiento, y hay un excedente a destinar para procesos reproductivos(19). El tratamiento con zilpaterol a la mitad de los animales para inducir una composición corporal diferente entre estos y los del grupo control, permitió observar que a pesar de las diferencias a la PB en cuanto a las variables peso, edad y características corporales, debidas al tratamiento, GD y LEP no mostraron diferencias entre los grupos ZIL y testigo, lo que destaca la importancia de la composición corporal y, en particular, de la cantidad de grasa corporal para el establecimiento de la PB. Se ha reportado que en el crecimiento y la composición de la canal, existe una gran variación entre B. taurus taurus(20,21) y B. taurus indicus(22). Así mismo, existen diferencias en la distribución de la grasa corporal entre razas; las razas lecheras depositan mayor proporción de su grasa internamente y menor proporción de forma subcutánea que las de carne(23). Estas diferencias, independientemente de los factores ambientales, aparentemente participan en los procesos de maduración para que los individuos sean cronológicamente distintos entre razas(24), con la consecuente variación en la edad al primer parto, que es una variable de importancia económica. La edad estimada a la PB del ganado Cebú en los trópicos y subtrópicos oscila ampliamente entre 16 y 40 meses(25) y, en consecuencia, la edad al primer parto es igualmente muy variable debido al efecto que tienen variables ambientales, destacándose la alimentación de los animales, que en condiciones de pastoreo depende de condicionantes como la precipitación pluvial, la calidad y fertilidad de los suelos y las especies forrajeras en uso, particularmente en condiciones tropicales, de tal forma que el estudio de fenómenos fisiológicos, como el establecimiento de la pubertad y los efectos estacionales en procesos reproductivos, requieren del control de variables como la alimentación, que puede confundir los resultados. Por esa razón, para este trabajo se alimentó individualmente a los animales para que todos tuvieran una ganancia diaria similar. La ganancia diaria de peso promedio general fue de 560 ± 121 g/día. A la PB, las vaquillas BHM fueron más pesadas y tuvieron mayor edad que las SE; de hecho, esos 142 días de diferencia implicaron que BHM tuviera en promedio 74.8 kg más (en congruencia con la ganancia promedio de peso de las vaquillas durante el estudio), sin embargo, por la diferencia en SC no hubo diferencia en PM/SC entre las dos razas. Se observó una correlación de 0.96 (P<0.01) entre PPB y SC. Otros investigadores(26-28) han reportado que becerras B. taurus indicus requieren mayor peso y edad para iniciar la PB que becerras B. taurus taurus. Además, se ha descrito(29) que en vaquillas Nelore una buena alimentación posdestete es un método efectivo para anticipar la PB. Entre las razas B. taurus indicus, la Nelore, que es la que aparentemente tiene menos colgajos y pliegues de piel y, por ende, menor superficie corporal, ha tenido mayor popularidad en Brasil, aparentemente por su mejor desempeño productivo, particularmente, mayor precocidad para iniciar la PB(29) y 1034


Rev Mex Cienc Pecu 2021;12(4):1025-1044

menor edad al primer parto(30,31); sin embargo, no se encontraron estudios que relacionen específicamente dichas características reproductivas con la SC de los animales. La importancia de la relación entre superficie y masa corporal en el costo energético de mantenimiento de los animales ha sido reconocida y considerada desde hace más de un siglo; de hecho, entre los estudios iniciales sobre metabolismo basal, se discutió que la SC era tan importante o más importante que la masa corporal(32). En estudios realizados con roedores, caninos, bovinos y humanos, se observó que la SC es una variable que permite la predicción más precisa de la tasa metabólica(33). Por ello, se consideró como la variable que permitía, con mayor precisión, la comparación entre especies animales de diferentes tamaños en estudios cuantitativos de metabolismo(34), lo que promovió el desarrollo de instrumentos para su medición(35). No se encontraron trabajos específicamente diseñados para asociar la SC de los bovinos con algunas características productivas; en estudios previos(36,37), se midió la SC de vacas lecheras y su relación con el peso corporal, para el uso de una fórmula basada en la “Ley de Kleiber” en estudios de bioenergética. Se ha estimado que a mayor SC aumenta la pérdida de calor corporal por radiación, convección y evaporación(38), condiciones que implican un costo energético. Se ha evaluado que desde el nacimiento a medida que la masa corporal del animal aumenta con el crecimiento, su proporción relativa a la superficie corporal va también aumentando, y la disipación relativa de energía térmica corporal se reduce, permitiendo paulatinamente más energía disponible para los procesos fisiológicos y el almacenamiento de excedentes. Entre esos procesos fisiológicos no fundamentales para sostener la vida del individuo se encuentra la reproducción, que se vuelve factible una vez que la energía disponible en el organismo garantiza los procesos indispensables para la vida y otros prioritarios como la locomoción. Ello requiere un balance entre la energía que se consume y procesa y la que se acumula en tejidos, para después transformarse en trabajo o disiparse al ambiente como energía calórica; en esta última función, la piel y la respiración juegan un papel central en los bovinos(19). En el caso del ganado B. taurus indicus su mayor adaptación a climas cálidos, como los tropicales, se debe a su capacidad superior de regulación de la temperatura corporal durante condiciones de estrés por calor, derivada de una tasa metabólica más baja y mayor capacidad de disipación de calor a través de la piel(39). Conviene recordar que los animales que tienen mayor proporción de genes Cebú muestran menor tamaño de sus órganos torácicos y abdominales, como peso del rumen y longitud de los intestinos, que los animales B. taurus taurus(40,41). Se ha observado que la tasa metabólica basal en B. taurus indicus x B. taurus taurus es menor que en B. taurus taurus. En un estudio, la tasa de calor producido por unidad de superficie corporal de vacas no lactantes y en ayuno fue 57 MCal/m2 para Red Sindhi x Holstein y 100 MCal/m2 para Holstein(42).

1035


Rev Mex Cienc Pecu 2021;12(4):1025-1044

Desde un punto de vista práctico, la mayor superficie de piel en Cebú por un lado le confiere ventajas (disipación de calor y resistencia al estrés térmico), pero aparentemente se asocia con una menor eficiencia en la utilización de la energía del alimento(38), velocidad de crecimiento(39) y acumulación de energía en forma de grasa corporal(43,44), que es un factor importante para la PB, como se reitera en los resultados de este trabajo, donde a pesar del uso de zilpaterol, que promovió un crecimiento más rápido, la pubertad se alcanzó a mayor edad, con mayor peso y musculatura en las vaquillas tratadas, pero con GD similar entre controles y tratados. La suplementación con el β-agonista ZIL hizo que aumentara la EPB, y que las vaquillas control fueran más jóvenes a la PB. La administración de ZIL modifica la repartición de los nutrimentos, por lo que los animales crecen más rápido y ganan más peso, pero esta ganancia es más magra(45,46). Para el inicio de la PB, no solo es importante la ganancia absoluta de peso de las vaquillas, es también importante la composición de la masa corporal(47-49), ya que probablemente cambios sutiles o agudos en el estado metabólico inicien los eventos fisiológicos que conducen a la pubertad(5,50). De ahí que, aunque las tratadas con ZIL llegaron con más peso y EPB, no fueron diferentes a las del grupo testigo en GD, a pesar de que estas últimas eran más livianas y con menor MD, lo que fue uno de los supuestos del estudio sobre el efecto de los β-agonistas en la repartición de los nutrimentos, ocasionando disminución de la lipogénesis y aumento de la acreción muscular, como han observado diversos autores, que han reportado que la suplementación con ZIL aumentó la MD y disminuyó el GD en vacas(51), vaquillas(52) y novillos(53). La información disponible indica que se requiere un mínimo de grasa corporal para detonar procesos reproductivos como la PB en vaquillas(9) y un mínimo de CC(54). En un estudio(55) realizado en vaquillas Nelore, se encontraron altas correlaciones (de 0.82 a 0.93) entre la CC y el GD, y se afirmó que con la CC se puede predecir el GD en ganado B. taurus indicus en las diferentes etapas del ciclo de producción. En un estudio con vacas B. taurus taurus(56), se observó que un incremento de la CC tendía a estar acompañado por un aumento de tamaño de los adipocitos en el tejido adiposo subcutáneo. La información presentada indica que los animales B. taurus indicus necesitan mayor acumulación de grasa que los B. taurus taurus para iniciar la PB, pudiéndose lograr esto mediante dietas con más energía. En el trabajo motivo de esta comunicación, esas relaciones fueron modificadas por el uso del β-agonista ZIL en ambas razas, y las vaquillas tratadas fueron más musculosas y tuvieron mayor CC y más MD a la PB, como era de esperarse(5), pero no hubo diferencia con las del grupo testigo en GD a la PB. Es manifiesto que en BHM, por encima de los señalizadores internos relacionados con el peso y composición corporal, prevaleció un efecto de estacionalidad asociado con los cambios de luz; por ello, se observó efecto de RZ sobre EPB y diferencias entre razas en los

1036


Rev Mex Cienc Pecu 2021;12(4):1025-1044

meses de presentación de la PB. El efecto de estacionalidad se manifestó en que las vaquillas SE iniciaron la PB de manera homogénea a través del año, pero 73.8 % de las vaquillas BHM iniciaron la PB en los meses en que las horas luz iban en aumento y sólo 26.2 % lo hizo cuando las horas luz decrecían (P<0.05). De hecho, el efecto de estacionalidad se manifiesta sobre otras variables, como se muestra en el Cuadro 2, donde se mantuvieron las diferencias en variables que se consideraron como críticas para el inicio de la PB, como es el caso de PM/SC, GD y LEP, en animales nacidos en diferentes estaciones. La observación del efecto de estacionalidad sobre la PB en BHM coincide con lo descrito por otros autores(3), que observaron que vaquillas BHM sólo iniciaron la pubertad en un periodo comprendido de febrero a mayo (días en los que las horas luz van en aumento) a diferencia de vaquillas Suizo Pardo que iniciaron la pubertad a lo largo del año. Dicho efecto lo atribuyeron a la susceptibilidad de las becerras BHM a los efectos ambientales que determinan las estaciones del año (estacionalidad). Estas observaciones coinciden con resultados de otros estudios con hembras Cebú(11,12,57), donde se observó una tendencia estacional en la actividad reproductiva posparto de las vacas, aún en condiciones de alimentación controlada. El fotoperiodo parece influir en el inicio de la pubertad. En un experimento con vaquillas lecheras, la iluminación suplementaria (16 h de luz/día) durante el invierno mejoró las tasas de crecimiento y redujo la edad a la pubertad(58). De igual forma, con vaquillas B. taurus taurus, la iluminación suplementaria (18 h de luz/día) después de las 22 o 24 semanas de edad redujo la edad a la pubertad en las vaquillas nacidas de febrero a julio. Estos efectos del fotoperiodo se acompañaron de cambios en el desarrollo ovárico(59). El mismo autor(60) señala que vaquillas con propensión genética a alcanzar la pubertad a edades tempranas, pueden verse afectadas por la estación de nacimiento de manera diferente a aquellas que alcanzan la pubertad a edades más avanzadas. En comparación con las vaquillas SE, las vaquillas BHM fueron más susceptibles a señales ambientales por el cambio de horas luz, lo cual probablemente desencadenó los procesos neuroendocrinos asociados con el inicio de la PB, situación que debe considerarse en la planificación de los programas de manejo reproductivo de bovinos en hatos con una composición racial diversa. El efecto de la estación de nacimiento influyó en que las vaquillas nacidas en otoño tuvieron mayor GD y niveles más elevados de LEP a la PB que las nacidas en primavera, pero sin haber diferencias (P>0.05) en EPB entre estaciones de nacimiento en las condiciones de este estudio. Se observó interacción de RZ x EN sobre CC a la pubertad, donde las vaquillas SE nacidas en primavera mostraron menor CC que las vaquillas SE nacidas en otoño y que las BHM nacidas en primavera. Con base en promedios generales (no mostrados aquí, pueden consultarse en un estudio previo(61)), aparentemente, las vaquillas de menor EPB (BHM nacidas en primavera y SE nacidas en otoño) llegaron con mayor CC (Figura 1), aunque las diferencias en esta variable fueron mínimas. A este respecto, diversos autores han sugerido

1037


Rev Mex Cienc Pecu 2021;12(4):1025-1044

que hay un fenómeno de compensación de edad con peso para el establecimiento de la PB(49,62,63). Se ha informado que en vacas Bos taurus taurus(56) hay una correlación positiva de la leptina con peso corporal y CC; además, un incremento de la CC tendía a estar acompañado por un aumento de tamaño de los adipocitos en el tejido adiposo subcutáneo. En el presente estudio, la LEP a la PB fue diferente entre razas; las vaquillas BHM mostraron mayor LEP que las SE. Esta diferencia de LEP entre razas puede deberse a que las BHM fueron las que también presentaron mayor edad y cantidad de GD a la PB, ya que los niveles circulantes de leptina están directamente asociados con la adiposidad corporal(64,65). Hasta el momento no hay evidencia de una transición abrupta en las concentraciones plasmáticas prepuberales de leptina a la pubertad o de que las concentraciones circulantes puedan ser un desencadenante crítico para la PB en vaquillas de crecimiento rápido, pero aparentemente se requiere un mínimo de leptina circulante para la PB en vaquillas con tasas de crecimiento normal o restringido(66).

Conclusiones e implicaciones Se concluye que la masa corporal como proporción de la SC parece tener un papel importante en el inicio de la PB de vaquillas y que se requiere un mínimo de masa de tejidos metabólicamente activos por unidad de SC y un mínimo de acumulación de grasa para que se detone el inicio de la PB, independientemente de la raza de que se trate. El establecimiento de la pubertad es un fenómeno complejo, que depende de la interacción entre variables y señalizadores internos de los animales y de otros factores de su entorno, como los cambios de las horas luz, que afectan a las vaquillas Cebú. Las observaciones derivadas de este trabajo permiten especular que la pubertad tardía de las vaquillas BHM puede estar asociada con la mayor SC en comparación con las vaquillas SE y ratifica el efecto de los cambios de horas luz en fenómenos reproductivos en hembras Cebú, aun cuando se elimina el efecto indirecto de estacionalidad a través de la alimentación controlada. Este trabajo documenta por primera ocasión la relación de la masa corporal, como proporción de la superficie corporal, con el establecimiento de la pubertad en bovinos. Conflicto de intereses Los autores declaran que no existe ningún conflicto de intereses en la presentación de este trabajo.

1038


Rev Mex Cienc Pecu 2021;12(4):1025-1044

Literatura citada: 1. Day ML, Nogueira GP. Management of age at puberty in beef heifers to optimize efficiency of beef production. Anim Front 2013;3:6-11. 2. Manthey AK, Anderson JL, Perry GA, Keisler DH. Feeding distillers dried grains in replacement of forage in limit-fed dairy heifer rations: Effects on metabolic profile and onset of puberty. J Dairy Sci 2017;100:1-12. 3. Calderón RRC, Villa-Godoy A, Lagunes LJ. Determinación ultrasonográfica de la primera ovulación: asociación con la primera ovulación de ciclos estrales regulares en vaquillas Cebú y Suizo Pardo mantenidas en el trópico. Téc Pecu Méx 1996;34(2):79-88. 4. Moriel P, Piccolo M, Lancaster PA, Lamb GC, Vendramini J, Arthington JD. Effects of post-weaning plane of nutrition and estrus synchronization on reproductive performance of influenced beef heifers. J Anim Sci 2017;95(4):3523-3531. 5. Hall JB, Staigmiller RB, Bellows RA, Short RE, Moseley WM, Bellows SE. Body composition and metabolic profiles associated with puberty in beef heifers. J Anim Sci 1995;73(11):3409-3420. 6. Gonzalez-Padilla E, Wiltbank JN, Niswender GD. Puberty in beef heifers. I. The interrelationship between pituitary, hypothalamic and ovarian hormones. J Anim Sci 1975;40(6):1091-1104. 7. Foote AP, Tait RG, Keisler DH, Hales KE, Freetly HC. Leptin concentrations in finishing beef steers and heifers and their association with dry matter intake, average daily gain, feed efficiency, and body composition. Domest Anim Endocrinol 2016;55:136-141. 8. Garcia MR, Amstalden M, Williams SW, Stanko RL, Morrison CD, Keisler DH et al. Serum leptin and its adipose gene expression during pubertal development, the estrous cycle, and different seasons in cattle. J Anim Sci 2002;80(8):2158-2167. 9. Pardo AM, Villareal EL, Papaleo MJ, Melucci OG, Santamaría S, Ferrario J et al. Sexual precocity and productivity of beef cattle female under grazing conditions. Anim Prod Sci 2018;59:757-766. 10. Johnston DJ, Barwick SA, Corbet NJ, Fordyce G, Holroyd RG, Williams PJ et al. Genetics of heifer puberty in two tropical beef genotypes in northern Australia and associations with heifer- and steer-production traits. Anim Prod Sci 2009;49:399-412. 11. Lozano DRR, Asprón PMA, González-Padilla E, Vásquez PCG. Estacionalidad reproductiva en vacas Bos indicus en el trópico mexicano. Téc Pecu Méx 1987;2(25):192-205.

1039


Rev Mex Cienc Pecu 2021;12(4):1025-1044

12. Villagómez AME, Castillo RH, Villa-Godoy A, Román PH, Vázquez PC. Influencia estacional sobre el ciclo estral y el estro en hembras cebú mantenidas en clima tropical. Téc Pecu Méx 2000;38(2):89-103. 13. Evans ACO, Adams GP, Rawlings NC. Endocrine and ovarian follicular changes leading up to the first ovulation in prepuberal heifers. J Reprod Fertil 1994;100:187-194. 14. Richards MW, Spitzer JC, Warner MB. Effect of varying levels of postpartum nutrition and body condition at calving on subsequent reproductive performance in beef cattle. J Anim Sci 1986;62:300-306. 15. SPSS Inc. PASW Statistics for Windows, Version 18.0. Chicago: SPSS Inc. 2009. 16. Perkins TL, Green RD, Hamlin KE. Evaluation of ultrasonic estimates of carcass fat thickness and longissimus muscle area in beef cattle. J Anim Sci 1992;70:1002-1010. 17. Delavaud C, Bocquier F, Chilliard Y, Keisler DH, Gertler A, Kann G. Plasma leptin determination in ruminants: Effect of nutritional status and body fatness on plasma leptin concentration assessed by a specific RIA in sheep. J Endocrinol 2000;165:519-526. 18. SAS. Statistical Analysis System Institute Inc, Cary, NC, USA. 2002. 19. Foster DL, Hileman SM. Puberty in sheep. Knobil and Neill´s Physiology of Reproduction. Fourth ed. 2015;1441-1485. 20. Alberti P, Panea B, Sanudo C, Olleta JL, Rpoll G, Ertbjerg P et al. Live weight, body size and carcass characteristics of young bulls of fifteen European breeds. Livest Sci 2008;114:19-30. 21. Clarke AM, Drennan MJ, McGee M, Kenedy DA, Evans RD, Berry DP. Intake, live animal scores/measurements and carcass composition and value of late-maturing beef and dairy breeds. Livest Sci 2009;126:57-68. 22. Thrift FA, Sanders JO, Brown AH, Herring AD, Riley DG, DeRouen SM. Preweaning, postweaning, and carcass trait comparisons for progeny sired by subtropically adapted beef sire breeds at various US locations. The Prof Anim Scientist 2010;26(5):451-473. 23. McGee M, Keane MG, Neilan R, Moloney AP, Caffrey PJ. Production and carcass traits of high dairy genetic merit Holstein, standard dairy genetic merit Friesian and Charolais x Holstein-Friesian male cattle. Irish J Agr Food Res 2005;44:215-231. 24. Black JL. Animal growth and its regulation. J Anim Sci 1988;66:1-22. 25. Nogueira GP. Puberty in South American Bos indicus (Zebu) cattle. Anim Reprod Sci 2004;82-83:361-372.

1040


Rev Mex Cienc Pecu 2021;12(4):1025-1044

26. Reynolds WL, de Rouen TM, High Jr JW. The age and weight at puberty of Angus, Brahman and zebu cross heifers [abstract]. J Anim Sci 1963;22:243. 27. Calderón RRC. Cambios dinámicos de las estructuras ováricas y su relación con la progesterona sérica en becerras peripúberes Bos taurus y Bos indicus, mantenidas en clima tropical [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1994. 28. Pereira GR, Barcellos JOJ, Sessim AG, Tarouco JU, Feijó FD, Neto JB et al. Relationship of post-weaning growth and age at puberty in crossbred beef heifers. Rev Bras Zootec 2017;46(5):413-420. 29. Nepomuceno DD, Pires AV, Ferraz MVC, Biehl MV, Gonçalves JRS, Moreira EM et al. Effect of pre-partum dam supplementation, creep-feeding and post-weaning feedlot on age at puberty in Nellore heifers. Livest Sci 2017;195:58-62. 30. Eler JP, Silva JVA, Ferraz JBS, Dias F, Oliveira NH, Evans JL et al. Genetic evaluation of the probability of pregnancy at 14 months for Nellore heifers. J Anim Sci 2002;80:951-954. 31. Nogueira GP, de Lucia RFS, Pereira FV, Cirilo PD. Precocious fertility in Nelore heifers [abstract]. Biol Reprod 2003;68(Suppl 1):382. 32. Richet C. La Chaleur Animale. Paris, 1889. 33. Kleiber M. Body size and metabolism. Hilgardia 1932;6:315-353. 34. Kleiber M. Body size and metabolic rate. Physiol Rev 1947;4(27): 511-541. 35. Mitchell HH. The effect of the amount of feed consumed by cattle on the utilization of its energy content. J Agric Res 1932;3(45):163-191. 36. Hogan AG, Skouby CI. Determination of the surface area of cattle and swine. J Agric Res 1923;19(25):419-430. 37. Elting ECA. Formula for estimating surface area of dairy cattle. J Agric Res 1926;33(3):269-280. 38. Berman A. Effects of body surface area estimates on predicted energy requirements and heat stress. J Dairy Sci 2003;86(11):3605-3610. 39. Hansen P. Physiological and cellular adaptations of zebu cattle to thermal stress. Anim Reprod Sci 2004;82-83:349-360.

1041


Rev Mex Cienc Pecu 2021;12(4):1025-1044

40. Swett WW, Matthews CA, McDowell RE. 1961. Sindhi-Jersey and Sindhi-Holstein crosses: their external form and internal anatomy compared with those of purebred Jerseys and Holsteins. Tech Bull 1961. USDA 1236. 41. McDowell RE, Wilk JC, Talbott CW. Economic viability of crosses of Bos taurus and Bos indicus for dairying in warm climates. J Dairy Sci 1996;79(7):1292-1303. 42. Johnston JE, Hamblin FB, Schrader GT. Factors concerned in the comparative heat tolerance of Jersey, Holstein, and Red Sindhi-Holstein (F1) cattle. J Anim Sci 1958;17:473-479. 43. Bucholtz DC, Manning J, Herbosa CG, Schillo KK, Foster DL. The energetics of LH secretion: a temporally-focused view of sexual maturation [abstract]. In: Annual Meeting of the Society for Neuroscience, Washington, D.C. 1993;23:349. 44. Frisch RE. Body weight, body fat and ovulation. Trends Endocrinol Metab 1991;2:191– 197. 45. Moloney AP, Beermann DH. Mechanisms by wich β-adrenergic agonists alter growth and body composition in ruminants. In: Enne G, et al, editors Residues of veterinary drugs and mycotoxins in animal products. Pers, Wageningen 1996;124-136. 46. Cônsolo NRB, Rodriguez FD, Goulart RS, Frasseto MO, Ferrari VB, Silva LFP. Zilpaterol hydrochloride improves feed efficiency and changes body composition in nonimplanted Nellore heifers. J Anim Sci 2015;93(10):4948-4955. 47. Maciel MN, Zieba DA, Amstalden M, Keisler DH, Neves J, Williams GL. Recombinant leptin prevents fasting-mediated reductions in pulsatile LH release and stimulates GH secretion in peripubertal heifers [abstract]. Proc Mid West Sect Am Soc Anim Sci 2003;66:263. 48. Arije GF, Wiltbank JN. Age and weight at puberty in Hereford heifers. J Anim Sci 1971;33:401-406. 49. González-Padilla E, Ruíz DR, Wiltbank JN. Inducción y sincronización del estro en vaquillas prepúberes mediante la administración de estrógenos y un progestágeno. Téc Pecu Méx 1975;(1):17-23. 50. Steiner RA, Cameron JL, McNeill TH, Clifton DK, Bremner WJ. Metabolic signals for the onset of puberty. In: Norman RL, editor. Neuroendocrine aspects of reproduction. Academic Press, New York 1983. 51. Lowe BK, Mckeith RO, Segers JR, Safko JA, Froetschel MA, Stewart Jr RL et al. The effects of zilpaterol hydrochloride supplementation on market dairy cow performance, carcass characteristics, and cutability. Prof Anim Scient 2012;28(2):150-157. 1042


Rev Mex Cienc Pecu 2021;12(4):1025-1044

52. Rathmann RJ, Bernhard BC, Swingle RS, Lawrence TE, Nichols WT, Yates DA. Effects of zilpaterol hydrochloride and days on the finishing diet on feedlot performance, carcass characteristics, and tenderness in beef heifers. J Anim Sci 2012;90:3301-3311. 53. Kononoff PJ, Defoor PJ, Engler MJ, Swingle RS, James ST, Deobald HM et al. Impact of a leptin single nucleotide polymorphism and zilpaterol hydrochloride on growth and carcass characteristics in finishing steers. J Anim Sci 2013;91(10):5011-5017. 54. Perry GA. Physiology and endocrinology symposium: harnessing basic knowledge of factors controlling puberty to improve synchronization of estrus and fertility in heifers. J Anim Sci 2012;90(4):1172-1182. 55. Ayres H, Ferreira RM, de Souza Torres-Júnior JR, Demétrio CGB, de Lima CG, Baruselli PS. Validation of body condition score as a predictor of subcutaneous fat in Nelore (Bos indicus) cows. Livest Sci 2009;123(2-3):175-179. 56. Locher L, Häussler S, Laubenthal L, Singh SP, Winkler J, Kinoshita A et al. Effect of increasing body condition on key regulators of fat metabolism in subcutaneous adipose tissue depot and circulation of nonlactating dairy cows. J Dairy Sci 2015;98(2):10571068. 57. Plasse D, Warnick AC, Koger M. Reproductive behavior of Bos indicus females in a subtropical environment. I. Puberty and ovulation frequency in Brahman and Brahman x British heifers. J Anim Sci 1968;27:94-100. 58. Peters RR, Chapin LT, Leining KB, Tucker HA. Supplemental lighting stimulates growth and lactation in cattle. Science 1976;199:911-912. 59. Hansen PJ, Kamwanja LA, Hauser ER. Photoperiod influences age at puberty of heifers. J Anim Sci 1983;57:985-992. 60. Hansen PJ. Seasonal modulation of puberty and the postpartum anestrus in cattle: A review. Livest Prod Sci 1985;12:309-327. 61. Hernández LC. Interacciones entre estacionalidad, características corporales y leptina en el establecimiento de la pubertad en vaquillas Bos taurus taurus y Bos taurus indicus [tesis maestría]. México, CDMX: Universidad Nacional Autónoma de México; 2018. 62. Greer RC, Whitman RW, Staigmiller RB, Anderson DC. Estimating the impact of management decisions on the occurrence of puberty in beef heifers. J Anim Sci 1983;56(1):30-39. 63. Ferreira VCP, Penna VM, Bergmann JAG, Torres RA. Interação genótipo-ambiente em algumas características produtivas de gado de corte no Brasil. Arq Bras Med Vet Zootec 2001;53:385-392. 1043


Rev Mex Cienc Pecu 2021;12(4):1025-1044

64. Ehrhardt R. Development of a specific radioimmunoassay to measure physiological changes of circulating leptin in cattle and sheep. J Endocrinology 2000;166(3):519-528. 65. Geary TW, McFadin EL, MacNeil MD, Grings EE, Short RE, Keisler DH. Leptin as a predictor of carcass composition in beef cattle. J Anim Sci 2003;81(1):1-8. 66. Chelikani PK, Ambrose DJ, Keisler DH, Kennelly JJ. Effects of dietary energy and protein density on plasma concentrations of leptin and metabolic hormones in dairy heifers. J Dairy Sci 2009;92(4):1430-1441.

1044


https://doi.org/10.22319/rmcp.v12i4.5294 Artículo

Digestibilidad in vitro de gramíneas Brachiaria con líquido ruminal bovino y ovino como inóculo

Luis Carlos Vinhas Itavo a* Camila Celeste Brandão Ferreira Ítavo a Cacilda Borges do Valle b Alexandre Menezes Dias a Gelson dos Santos Difante a Maria da Graça Morais a Claudia Muniz Soares a Camila da Silva Pereira a Ronaldo Lopes Oliveira c

a

Federal University of Mato Grosso do Sul, Faculty of Veterinary Medicine and Animal Science. Av. Senador Filinto Muller, 2443. Vila Ipiranga. CEP 79070-900 Campo Grande, MS, Brazil. b

Brazilian Corporation of Agricultural Research - Embrapa Beef Cattle. Campo Grande, MS. 79106-550, Brazil. c

Federal University of Bahia, Faculty of Veterinary Medicine. Salvador, BA 40170110, Brazil.

*Autor de correspondencia: luis.itavo@ufms.br

Resumen: Se planteó la hipótesis de que es posible que el inóculo de diferentes especies de rumiantes con capacidades digestivas diferentes que se alimentan de un determinado forraje puede mostrar diferentes utilizaciones de alimento en comparación con otras especies de 1045


Rev Mex Cienc Pecu 2021;12(4):1045-1060

rumiantes. Se evaluaron cinco gramíneas Brachiaria: B. decumbens cv. Basilisk, B. decumbens acceso D70, B. humidicola cv. Tupi, B. humidicola cv. Común, y B. ruziziensis acceso R124, en dos edades de rebrote (21 y 42 d). Se analizó la producción, el contenido bromatológico, la digestibilidad de materia seca in vitro (DMSiv) y la digestibilidad de la fibra detergente neutro in vitro (DFDNiv) utilizando inóculos bovinos u ovinos. El experimento utilizó un diseño factorial de 5 × 2 × 2 y encontró efectos significativos para la variedad de gramínea y la edad de rebrote. Además, se encontraron interacciones significativas de gramínea × edad en la materia seca, la proteína cruda, la fibra detergente neutro y la fibra detergente ácido de la muestra total y lamina de la hoja. Hubo un efecto significativo de la variedad de gramínea y la edad de la gramínea en la masa del forraje, la relación lámina de la hoja/tallo, lámina de la hoja, tallo, material senescente y crecimiento. En los ensayos de la digestibilidad in vitro, el origen del inóculo mostró un efecto significativo en algunas variedades. Debido a las diferencias en los ensayos in vitro, se recomendó el uso de inóculos específicos de las especies para las evaluaciones de alimentos según el animal al que se destina. Asimismo, B. decumbens cv. Basilisk presentó la mejor digestibilidad in vitro (DMSiv y DFDNiv) en inóculo bovino, mientras que B. humidicola cv. Tupi tuvo mejor digestibilidad in vitro (DMSiv y DFDNiv) en inóculo ovino. Palabras clave: Brachiaria decumbens, Brachiaria humidicola, Brachiaria ruziziensis, Digestibilidad, Inóculo ruminal.

Recibido: 16/03/2019 Aceptado: 22/02/2021

Introducción Las gramíneas Brachiaria son importantes porque permiten la producción de rumiantes en suelos ácidos de baja fertilidad(1). Este género, principalmente de África tropical y subtropical, está compuesto por aproximadamente 100 especies, incluyendo B. decumbens, B. humidicola y B. ruziziensis, que son ampliamente utilizadas como fuentes de forraje en América tropical. La evaluación y posterior recomendación de un forraje específico está determinada por su capacidad para soportar el pastoreo de determinados animales de diferentes especies o categorías y su valor nutricional. Uno de los métodos de los que se puede inferir su valor nutricional es someterlo a pruebas de digestibilidad in vitro. In vitro es una alternativa a las técnicas in vivo e in situ (2), que requiere menos animales, reduce los costos y es un método confiable para evaluar la digestibilidad de los piensos.

1046


Rev Mex Cienc Pecu 2021;12(4):1045-1060

Los componentes nutritivos están estrechamente correlacionados con la digestibilidad de los forrajes(3). A través del análisis bromatológico es posible estimar los componentes nutritivos de los forrajes, así como el contenido celular y los componentes estructurales. Estos componentes incluyen proteína cruda (PC), contenido soluble y fibra detergente neutro (FDN). La técnica de digestibilidad in vitro ha sido ampliamente utilizada en el análisis de diferentes tipos de piensos proporcionados a rumiantes. Sin embargo, puede verse afectado por la fuente del inóculo, así como por la dieta previa del animal donante, el tiempo de ayuno del animal antes del muestreo y, ocasionalmente, por fallas en la ejecución de la técnica(4). Es posible que diferentes especies de rumiantes muestren una digestibilidad diferente, y cuando se alimentan con un determinado forraje pueden mostrar una mejor utilización del alimento que otras especies de rumiantes. Por lo tanto, el objetivo de esta investigación fue evaluar cinco gramíneas Brachiaria de dos edades de rebrote, sometidas a un ensayo de digestibilidad in vitro utilizando dos inóculos diferentes (bovino y ovino).

Material y métodos Consideraciones éticas Este estudio se llevó a cabo en estricta conformidad con las recomendaciones de la Guía del Consejo Nacional para el Control de Experimentación Animal de Brasil. El experimento fue aprobado por el Comité de Ética de Experimentación Animal de la Universidad Federal de Mato Grosso do Sul, Estado de Mato Grosso do Sul, Brasil (Número de protocolo: 367/2011).

Ubicación y campo experimental de los cultivares de Brachiaria spp. Este estudio se llevó a cabo en la Universidad Federal de Mato Grosso do Sul en asociación con el Laboratorio de Biotecnología Aplicada a la Nutrición Animal de la Universidad Católica Dom Bosco y Embrapa Beef Cattle. Las gramíneas Brachiaria se evaluaron en parcelas experimentales en Embrapa Beef Cattle (latitud 20°27'S, longitud 54°37'W y 530 m de altitud, ubicada en Campo Grande, MS, Brasil). El tipo de suelo en el área de estudio fue latosol púrpura distrófico álico. El clima según la clasificación de Köppen & Geiger(5) es tropical lluvioso, subtipo AW, caracterizado por una ocurrencia bien definida de un período seco durante los meses más fríos del año (abril-septiembre) y una estación lluviosa durante los meses de verano (octubre-marzo) con una precipitación media anual de 1,469 mm y una temperatura media anual de 23 °C.

1047


Rev Mex Cienc Pecu 2021;12(4):1045-1060

Los forrajes fueron evaluados durante dos veranos consecutivos (diciembre-febrero), que es la temporada de lluvias en el Cerrado brasileño, debido a la estacionalidad de los forrajes. El área experimental consistió en 20 parcelas (unidades experimentales, cuatro parcelas/cultivar), que midieron 4.0 × 4.0 m (16 m2). Las parcelas se cortaron a 5 cm sobre el suelo con el fin de estandarizarlas para su evaluación.

Determinación de la masa y crecimiento del forraje Después de que se tomaron muestras de los forrajes, cada una se envolvió en una bolsa de plástico y se identificó. En el laboratorio se pesaron y se dividieron en dos partes: una para ser procesada como muestra total y la otra separada en lámina de la hoja, tallo y material muerto(6). La masa del forraje se estimó por el método del cuadro, con la cuantificación del forraje, en una base de materia seca, muestreado dentro del cuadro de 0.5 × 0.5 convertido a tonelada métrica (1,000 kg) por hectárea (t ha–1). La relación lámina de la hoja/tallo se obtuvo dividiendo la masa de las láminas de las hojas entre la masa de los tallos(7). El crecimiento vegetativo del dosel se determinó en seis puntos diferentes en cada unidad experimental, que fueron marcados para su medición de acuerdo con las diferentes edades de crecimiento evaluadas(7).

Composición química del forraje Después del muestreo y la separación en muestra total, lámina de la hoja, tallo y material muerto, los materiales se presecaron a 55°C durante 72 h y se molieron a 1 mm con un molino Wiley (Tecnal, Ciudad de Piracicaba, São Paulo, Brasil) y luego se almacenaron en envases herméticos de plástico (ASS, Ciudad de Ribeirão Preto, São Paulo, Brasil) hasta su análisis. Se determinó el contenido de materia seca (MS) (Método 967.03, AOAC(8)) y el contenido de PC (Método 981.10, AOAC(8)). Para la determinación del contenido de FDN y fibra detergente ácido (FDA) se utilizó la metodología de Van Soest et al(3) con modificaciones propuestas en el manual del dispositivo ANKOM (ANKOM Technology Corporation, Macedon, Nueva York, EE. UU.).

Digestibilidad de materia seca in vitro (DMSiv) y digestibilidad de fibra detergente neutro in vitro (DFDNiv) Las muestras totales (todas las estructuras del dosel) de las diferentes variedades de gramíneas Brachiaria de dos edades de rebrote (21 y 42 días) se sometieron a pruebas in vitro, se incubaron con líquido ruminal bovino u ovino (inóculo). El inóculo bovino se recolectó de tres bovinos cruzados Nellore × Angus y el inóculo ovino de cinco ovejas cruzadas Dorper × Suffolk, ya equipadas con cánula ruminal de silicio y adaptadas a la dieta forrajera.

1048


Rev Mex Cienc Pecu 2021;12(4):1045-1060

La digestibilidad in vitro de los nutrientes se determinó según la metodología de Tilley y Terry(9) adaptada para el sistema ANKOM Daisy (ANKOM Technology Corp., Macedon, NY, EE. UU.) como describe Holden(10). Se colocaron bolsas de tela no tejida que contenían muestras de gramíneas Brachiaria en frascos (con un límite de 30 bolsas por frasco, dos de ellos blancos) que contenían aproximadamente 1.6 L de solución tampón(11). Luego se agregó líquido ruminal bovino u ovino (400 ml) y se purgó el CO2 en los frascos. Los frascos permanecieron incubados con agitación a una temperatura constante de 39 °C durante 48 h, después de eso se agregaron 40 ml de HCl (6 N) y 8 g de pepsina a cada frasco y se dejaron durante otras 24 h. Una vez finalizada la incubación, los frascos se escurrieron y las bolsas se lavaron con agua destilada y se secaron a 105 ºC durante 16 h. Luego se pesaron para determinar la MS posterior a la incubación y se sometieron a análisis de FDN(3) con adaptación del manual del dispositivo ANKOM (ANKOM Technology Corp., Macedon, NY, EE. UU.). Los coeficientes de digestibilidad in vitro (Div) para MS (DMSiv) y FDN (DFDNiv) se obtuvieron a través de la ecuación: Div (g/kg) = [(nutriente incubado, g) – (nutriente residual, g – blanco, g)] / (nutriente incubado, g) × 1,000.

Análisis estadístico Todos los datos se analizaron utilizando el paquete estadístico SAS® (SAS® Inst. Inc., Cary, NC, EE. UU.), y las medias se compararon mediante la prueba de Tukey con un nivel de significancia de P<0.05, y la tendencia se consideró en P<0.10. Para evaluar la composición bromatológica, producción y rebrote de las gramíneas, se utilizó el siguiente modelo estadístico: Yijkl = µ + Ai + Gj + AGk + eijkl Donde: μ es la media general, Ii es el efecto de la i-ésima edad (21, 42), Gj es el efecto de la j-ésima gramínea (1, ..., 5), IGk es el efecto de la interacción de la i-ésima edad con la j-ésima gramínea, eijkl es el error aleatorio. Para comparar los valores de Div de MS y FDN realizados con diferentes inóculos, se utilizó el siguiente modelo estadístico: Yijkl = µ + Ii + Gj + IGk + eijkl

Donde: μ es la media general, Ii es el efecto del i-ésimo inóculo ruminal (1, 2), Gj es el efecto del j-ésimo cultivar (1, ..., 5), 1049


Rev Mex Cienc Pecu 2021;12(4):1045-1060

IGk es el efecto de la interacción del i-ésimo inóculo ruminal con el j-ésimo cultivar, eijkl es el error aleatorio.

Resultados Determinación de la masa y el crecimiento del forraje La masa y los parámetros de crecimiento del forraje se presentan en el Cuadro 1. Hubo un efecto significativo (P<0.05) en la masa del forraje de la variedad y la edad, la relación lámina de la hoja/tallo, lámina de la hoja, tallo, material senescente y crecimiento. Además, hubo una interacción gramínea × edad significativa (P≤0.0001) para todas las variables. La variedad que presentó la mayor masa de forraje a los 21 días fue B. humidicola cv. Común, y a los 42 días fue B. ruziziensis acceso R124 (8.86 y 12.81 g kg–1, respectivamente; P=0.0001). Se observó una menor relación lámina de la hoja/tallo en B. humidicola cv. Común a los 21 y 42 días (0.51 y 0.30, respectivamente; P=0.0001) con similitud entre las otras gramíneas. Sin embargo, la mayor relación lámina de la hoja/tallo a los 21 días se observó en B. humidicola cv. Tupi (relación 1.21; P=0.0001), mientras que U. decumbens acceso D70 presentó la relación más alta a los 42 días de rebrote (1.51; P=0.0001). Para los resultados del tallo, B. humidicola cv. Común tuvo valores significativamente altos a los 21 y 42 días de edad (448.8 y 656.8 g kg–1, respectivamente; P=0.0001). En la producción de material senescente en las variedades estudiadas, la mayor cantidad se observó para B. decumbens acceso D70 con 42 días de rebrote (684.8 g kg–1; P=0.0001), y a los 21 días B. decumbens cv. Basilisk tuvo numéricamente el valor más alto, cercano a B. decumbens acceso D70 (389.0 y 385.7 g kg–1, respectivamente). En contraste, B. humidicola cv. Común y B. humidicola cv. Tupi tuvieron numéricamente el material senescente más bajo a los 21 días (220.2 y 276.3 g kg–1, respectivamente). El parámetro de crecimiento fue significativo (P=0.00001) con el mayor crecimiento mostrado por B. ruziziensis acceso R124 a los 42 días (28.2 cm) y el más bajo por B. humidicola cv. Común a los 21 días (11.6 cm).

Composición química del forraje En relación con la composición química, hubo un efecto significativo (P<0.05) de la variedad de gramínea y la edad de crecimiento en MS, PC, FDN y FDA en todos los tipos de muestra (muestra total, lámina de la hoja y tallo; Cuadro 2). Además, hubo una interacción gramínea × edad significativa (P<0.05) para MS, PC, FDN y FDA en todas las muestras, excepto MS y FDN del material del tallo, que no mostró interacción significativa (P>0.05), sino una tendencia para FDN (P=0.0985).

1050


Rev Mex Cienc Pecu 2021;12(4):1045-1060

Cuadro 1: Masa del forraje, relación lámina de la hoja/tallo (LH:T), tallo,|||||||||| material senescente y crecimiento de diferentes variedades de gramíneas Brachiaria en diferentes edades de corte B. decumbens B. decumbens B. humidicola B. humidicola B. ruziziensis Valor P CV cv. Basilisk acceso D70 cv. Común cv. Tupi acceso R124 (%) 21 d 42 d 21 d 42 d 21 d 42 d 21 d 42 d 21 d 42 d Gramínea Edad G×E -1 Masa, t ha 6.18 4.58 6.13 5.75 8.86 8.21 7.69 5.21 7.31 12.81 36.54 0.0001 0.0001 0.0001 Relación 0.0001 0.81 1.21 1.11 1.51 0.51 0.30 1.21 1.11 0.91 1.01 24.31 0.0001 0.0001 LH:T Lámina de la 0.0001 0.0001 238.1 364.9 319.3 198.4 238.5 131.1 409.7 406.5 306.3 215.0 21.32 0.0001 -1 hoja, g kg Tallo, g kg-1 270.4 294.3 303.3 125.0 448.8 656.8 343.9 325.6 334.4 212.3 29.17 0.0001 0.0001 0.0001 Senescente, g 0.0001 0.0001 389.0 449.8 385.7 684.8 220.2 321.3 254.7 276.3 367.6 581.1 25.58 0.0001 -1 kg Crecimiento, 0.0001 0.0001 20.7 24.2 15.1 17.1 11.6 18.2 12.1 14.1 20.7 28.2 25.90 0.0001 cm CV = Coeficientes de variación (%).

1051


Rev Mex Cienc Pecu 2021;12(4):1045-1060

Cuadro 2: Composición química de muestras de planta total, lámina de la hoja y tallo de diferentes gramíneas Brachiaria en diferentes edades de rebrote (días, d) B. decumbens B. decumbens B. humidicola B. humidicola B. ruziziensis Valor P cv. Basilisk acceso D70 cv. Común cv. Tupi acceso R124 CV (%) P 21 d 42 d 21 d 42 d 21 d 42 d 21 d 42 d 21 d 42 d Gramínea Edad G×E Planta total MST 299.1 MO 941.2 PC 59.8 FDN 676.3 FDA 437.0 Lámina de la hoja MS 378.9 MO 924.5 PC 102.3 FDN 513.0 FDA 305.1 Muestras de tallo MS 353.4 MO 934.1 PC 37.6 FDN 798.2 FDA 463.0

480.6 925.9 47.53 743.8 498.4

324.7 940.4 67.8 702.3 483.8

398.4 922.7 54.9 798.0 541.5

444.3 943.6 49.4 669.3 505.8

564.6 907.2 42.6 772.5 510.8

402.9 939.3 47.2 701.9 497.5

433.2 902.7 31.3 769.4 557.7

398.3 929.9 58.3 572.8 425.5

424.8 922.5 61.9 710.4 542.9

0.19 0.29 9.01 9.20 3.29

0.0001 0.9431 0.0001 0.0001 0.0001

0.0001 0.0347 0.0001 0.0001 0.0001

0.0001 0.8609 0.0001 0.0465 0.0001

416.7 899.5 93.7 608.0 367.6

392.7 926.7 138.9 600.0 288.8

497.3 896.6 104.9 668.4 298.9

422.8 919.0 80.2 580.3 290.8

518.3 883.0 39.6 624.3 303.4

388.8 921.6 62.2 726.9 307.0

460.1 886.4 49.5 810.9 384.7

425.8 945.7 117.3 652.2 357.5

489.0 885.0 144.2 700.7 351.9

0.332 0.26 16.02 3.71 4.95

0.0001 0.8885 0.0001 0.0001 0.0001

0.0001 0.0007 0.0001 0.0001 0.0001

0.0009 0.8312 0.0001 0.0001 0.0001

402.8 924.7 36.9 804.1 457.1

421.0 931.5 55.5 766.9 412.9

464.1 926.2 44.6 788.5 442.7

383.8 948.0 31.3 821.3 445.3

449.1 934.9 48.7 811.9 442.1

336.1 939.0 31.2 822.4 432.1

415.8 932.0 31.7 884.6 476.7

406.2 924.7 50.1 774.4 484.4

463.0 921.4 49.5 821.99 486.1

0.33 0.34 5.08 1.32 2.69

0.0001 0.8324 0.0001 0.0001 0.0001

0.0001 0.4687 0.0214 0.0074 0.0119

0.1240 0.9986 0.0001 0.0985 0.0089

CV= Coeficientes de variación (%).

1052


Rev Mex Cienc Pecu 2021;12(4):1045-1060

Comparando las edades de rebrote de la muestra total, los forrajes a los 21 días de rebrote mostraron valores más bajos de MS, FDN y FDA (P<0.05); sin embargo, presentaron valores de PC más altos. Como se esperaba, la PC de las láminas de las hojas fue mayor que la de las muestras de tallo. La PC de las láminas de las hojas de B. ruziziensis R124 a los 42 días de rebrote mostró la mayor cantidad (144.2 g kg–1; P<0.05) B. humidicola cv. Tupi presentó valores más altos de FDN y FDA para láminas de las hojas a los 42 días de rebrote (769.4 y 557.7 g kg–1, respectivamente; P<0.05). Los valores más altos de FDN del tallo también los presentó B. humidicola cv. Tupi (884.6 g kg–1; P<0.05). También se observaron valores altos de FDA para B. humidicola cv. Tupi y B. decumbens cv. Basilisk (384.7 y 367.6 g kg–1, respectivamente; P<0.05).

Digestibilidad de la materia seca in vitro (DMSiv) y digestibilidad de la fibra detergente neutro in vitro (DFDNiv) No hubo interacción significativa (P>0.05) entre el inóculo y las gramíneas. Se observó que el inóculo ovino vs el inóculo bovino dio como resultado valores más altos de DMSiv para B. decumbens cv. Basilisk a los 21 días (611.2 vs 571.9 g kg–1; P=0.0200), B. humidicola cv. Tupi a los 21 días (631.8 vs 568.4 g kg–1; P=0.0370), y B. ruziziensis acceso R124 a los 21 días (548.8 vs 613.4 g kg–1; P=0.0420; Cuadro 3). Al evaluar únicamente el inóculo bovino, B. humidicola cv. Tupi y B. ruziziensis acceso R124 a los 42 días de rebrote mostraron los valores más bajos de DMSiv (544.3 y 542.0 g kg–1, respectivamente; P=0.0078). Al evaluar sólo el inóculo ovino, B. ruziziensis acceso R124 también presentó la DMSiv más baja (535.0 g kg–1; P=0.0184) a los 42 días.

Cuadro 3: Digestibilidad de materia seca in vitro (DMSiv) de diferentes variedades de gramíneas Brachiaria en diferentes edades de rebrote incubadas con líquido ruminal bovino u ovino (g kg-1) Edad B. decumbens cv. Basilisk B. decumbens acceso D70 B. humidicola cv. Común B. humidicola cv. Tupi B. ruziziensis acceso R124 CV, % Valor-P

21 42 21 42 21 42 21 42 21 42

Inóculo ruminal Bovino Ovino ABb 571.9 611.2 ABa AB 612.9 575.5 ABC AB 583.4 599.2 AB 558.6 BC 550.7 BC B 515.9 574.3 B ABC 593.2 598.8 AB 568.4 ABb 631.8 ABa C 544.3 577.6 ABC ABb 548.8 613.4 ABa C 542.0 535.0 C 2.564 1.972 0.0078 0.0184

CV (%) 0.96 1.48 2.85 2.12 2.86 1.30 2.09 1.81 3.30 0.07

Valor P 0.0200 0.0520 0.1235 0.1354 0.0650 0.1845 0.0370 0.0820 0.0420 0.2002

Los valores medios con diferentes letras mayúsculas en la misma columna o letras minúsculas superíndices difieren (P<0.05) según la prueba de Tukey. CV= Coeficientes de variación.

1053


Rev Mex Cienc Pecu 2021;12(4):1045-1060

En cuanto a la DFDNiv, tal como se presenta en el Cuadro 4, el inóculo ovino dio como resultado valores más altos que el bovino en B. humidicola cv. Común a los 21 días de rebrote (420.3 vs 369.5 g kg–1; P=0.0040), y B. humidicola cv. Tupi a los 42 días (490.8 vs 452.4 g kg–1; P=0.0270). Sin embargo, en B. decumbens cv. Basilisk a los 42 días, se observó lo contrario: el inóculo ovino resultó en valores de DFDNiv más bajos que el bovino (413.9 vs 472.4 g kg–1; P=0.0150).

Cuadro 4: Digestibilidad de fibra detergente neutro in vitro (DFDNiv) de diferentes variedades de gramíneas Brachiaria en diferentes edades de rebrote incubadas con líquido ruminal bovino u ovino (g kg-1) Inóculo ruminal ValorEdad CV(%) Bovino Ovino P A 21 436.8 439.1 9.75 0.3542 B. decumbens cv. Basilisk Aa b 42 472.4 413.9 1.64 0.0150 A 21 482.7 487.7 5.76 0.1423 B. decumbens acceso D70 A 42 445.7 412.5 4.87 0.2540 ABb a 21 369.5 420.3 0.84 0.0040 B. humidicola cv. Común A 42 443.4 458.7 1.30 0.1210 A 21 458.4 510.3 3.62 0.0970 B. humidicola cv. Tupi Ab a 42 452.4 490.8 1.35 0.0270 B 21 212.2 455.7 70.20 0.4080 B. ruziziensis acceso R124 A 42 427.6 424.0 15.53 0.0870 CV, % 25.333 4.622 Valor-P

0.0044

0.1562

Los valores medios con diferentes letras mayúsculas en la misma columna o letras minúsculas superíndices difieren (P<0.05) según la prueba de Tukey. CV= Coeficientes de variación.

No hubo efecto (P>0.05) en DFDNiv del cultivar y edad de rebrote cuando las muestras se incubaron con inóculo ovino; sin embargo, los valores más altos se observaron para B. humidicola cv. Tupi a los 21 y 42 días (510.3 y 490.8 g kg–1, respectivamente). Cuando se utilizó el inóculo bovino sólo la variedad B. ruziziensis acceso R124 a los 21 días presentó valores de DFDNiv por debajo de los demás (P=0.0044). A los 21 días de rebrote las variedades que presentaron los valores más altos (P=0.0044) fueron B. decumbens cv. Basilisk, B. decumbens acceso D70, B. humidicola cv. Común y B. humidicola cv. Tupi, destacando numéricamente B. decumbens acceso D70, con el valor medio más alto. A los 42 días, B. decumbens cv. Basilisk, B. decumbens acceso D70, B. humidicola cv. Común, B. humidicola cv. Tupi y B. ruziziensis acceso R124 tuvieron estadísticamente los valores más altos (P=0.0044), destacando numéricamente B. decumbens cv. Basilisk con la media más alta.

1054


Rev Mex Cienc Pecu 2021;12(4):1045-1060

Discusión El hábito estolonífero de B. humidicola, con nudos fuertes que se ramifican en nuevas plantas, favorece un alto residuo durante el corte estándar de forraje para la evaluación del rebrote(12). El sistema radicular grande da como resultado más reservas de carbohidratos para un rebrote más vigoroso, como se observó en este estudio en el mayor peso de la lámina de la hoja en B. humidicola cv. Tupi y tallos en B. humidicola cv. Común (Cuadro 1). Es posible que un mayor rebrote de hojas se deba a la intensa renovación de nutrientes y a un aumento de PC en hojas jóvenes relacionado con una pared celular más delgada(13) Sin embargo, el alto desarrollo del tallo en las gramíneas tropicales también se debe a otros dos factores principales: la baja frecuencia de defoliación y floración(14). En respuesta a la necesidad de exponer las hojas más jóvenes al dosel superior, donde la luz es más abundante, puede presentarse una competencia por la luz entre los macollos obligándolos a alargar sus tallos(15,16). Las gramíneas B. humidicola presentaron menos material de senescencia (Cuadro 1), favoreciendo la evaluación positiva de las hojas verdes, que son de gran importancia en el valor nutricional de un forraje. Las láminas de las hojas de los cultivares de B. humidicola son morfológicamente más delgadas (0.5–0.8 cm de ancho) que las de B. decumbens (ancho promedio de 1.5 cm) y B. ruziziensis (ancho de 1.0 a 1.5 cm), proporcionando menos sombra (menos de 65 %). Por lo tanto, tienen menor senescencia o muerte de los macollos jóvenes y hojas viejas, como se reportó anteriormente en otros estudios(6,16,17). Las láminas de las hojas en expansión, especialmente las intermedias en el macollo, recorren un camino más alto entre su punto de conexión con la región meristemática y el final de los pseudotallos y, en consecuencia, alcanzan un tamaño completo(6). Comparando las edades de rebrote, las fechas de muestreo no afectaron significativamente el crecimiento vegetativo (Cuadro 1). En cuanto a la producción de forraje, es posible sugerir que B. humidicola cv. Tupi mostró el mejor rendimiento, a pesar de que B. decumbens cv. Basilisk tiene una mayor producción de láminas de hojas, tallo y material senescente, pero menos láminas de hojas y material senescente más alto que los demás (P<0.05), lo que puede interferir con el contenido de nutrientes. Evaluando las composiciones químicas de las gramíneas B. decumbens, este estudio presentó un mayor contenido de PC a los 21 días de rebrote, pero a los 42 días B. ruziziensis tuvo un alto contenido de PC (Cuadro 2). Los hallazgos de un estudio(18) que evaluó B. decumbens cv. Basilisk y B. ruziziensis cv. Kennedy reportaron un mayor contenido de PC, pero esto pudo haberse debido a una altura de corte diferente (10 cm vs 5 cm); cuando se corta más cerca del suelo puede haber más tallo y material senescente en las muestras, – pero también pudo haberse debido a diferencias de fertilidad del suelo y otras condiciones edafoclimáticas donde se cultivaron las plantas–.

1055


Rev Mex Cienc Pecu 2021;12(4):1045-1060

En cuanto a la porción fibrosa del material, debido a que la FDN consiste en celulosa, hemicelulosa, lignina y sílice y la FDA es la fracción compuesta de celulosa, lignina y sílice, incluso un ligero cambio en esos compuestos alterará los valores de FDN y FDA(19). La FDN y la FDA de la muestra total de las variedades de B. decumbens encontradas en este estudio fueron inferiores a los observados en otro estudio(20), el cual citó valores a los 30 días de rebrote de 832.4 g kg-1 FDN y 462.1 g kg-1 FDA. Un estudio con Brachiaria decumbens(13) obtuvo una media de 809.0 g kg-1 de FDN y 475.0 g kg–1 de FDA. Estos resultados están más cerca de los hallazgos en este estudio con las dos variedades de B. decumbens a los 42 días de rebrote (B. decumbens cv. Basilisk 743.8 g kg-1 de FDN y 498.4 g kg-1 de FDA; B. decumbens acceso D70 798.0 g kg-1 de FDN y 541.5 g kg–1 de FDA; Cuadro 2). Las plantas con menos carbohidratos estructurales (residuos FDA) son más eficientes en el ciclo de nutrientes y tienen efectos beneficiosos en los rendimientos de los cultivos(21). Teniendo en cuenta todos los parámetros de composición bromatológica, a los 21 días de rebrote, B. ruziziensis acceso R124 mostró la mejor combinación de parámetros, con menos FDN y FDA (P<0.05) y uno de los valores más altos de contenido de PC. Sin embargo, a los 42 días, la variedad que tuvo la mejor combinación de contenido bromatológico fue B. decumbens cv. Basilisk; incluso con un valor de PC no tan alto, tuvo un menor contenido de FDA y FDN y una menor proporción de FDA dentro de la FDN, lo que interfiere directamente con la digestión de un alimento y, en consecuencia, su valor nutricional. Las técnicas de digestibilidad in vitro que utilizan inóculos ovinos y bovinos tienen ventajas para una evaluación rápida de los piensos, como la uniformidad física y química de los recipientes fermentativos y la conveniencia de mantener menos animales fistulados; aunque no reproducen perfectamente el proceso de digestión como lo hacen los animales vivos. Esto pudo observarse cuando se comparan los resultados de este estudio con otros que analizaron el mismo forraje in situ o in vivo(12,22,23,24). Además, la digestibilidad ruminal ovina presentó porcentajes que fueron de 10 a 15 % superiores a los del líquido ruminal bovino (Cuadro 3). Sin embargo, la capacidad de predicción y la aplicabilidad de las técnicas in vitro pueden depender del grado de similitud entre el proceso digestivo técnico y el de los rumiantes. Los sistemas in vitro utilizan fluido ruminal y una solución estándar para simular el proceso anaeróbico de fermentación ruminal(25), la solución estándar es típicamente una solución tampón que simula la saliva de los rumiantes(11). Todas las gramíneas presentaron valores superiores a los 500 g kg–1 de DMSiv, indicado por los autores(26) como un valor mínimo para calificarlas como forraje de buena calidad nutricional y no comprometer el rendimiento animal, incluso dada la caída esperada de la colonización microbiana de 0.1 a 0.2 % por día con el aumento de la edad fisiológica de la planta(13). Como se esperaba, la media de DFDNiv fue menor que la de DMSiv (Cuadros 3 y 4). Sin embargo, el no encontrar diferencias significativas (P>0.05) entre las edades de rebrote en unas variedades de Brachiaria contradice los resultados de Paciullo et al(27), 1056


Rev Mex Cienc Pecu 2021;12(4):1045-1060

quienes encontraron que con el desarrollo de la planta durante el período de descanso, los metabolitos surgen de la fotosíntesis y se convierten en componentes estructurales. La solubilización de la hemicelulosa puede ocurrir, la expansión de la fibra posiblemente aumenta la disponibilidad de sustratos fermentables, proporcionando así condiciones adecuadas para el crecimiento microbiano y, en consecuencia, la digestibilidad de la FDN. La reducción de los enlaces de hidrógeno intermoleculares y el tipo de enlace éster entre la lignina y la hemicelulosa permite su liberación y exposición al ataque de las bacterias del rumen, además de la posible presencia de un contenido elevado de carbohidratos fácilmente fermentable(19). Finalmente, al analizar los resultados de DMSiv y DFDNiv y considerando los dos inóculos, fue posible observar que, en el inóculo bovino, B. decumbens cv. Basilisk presentó la mejor digestibilidad en ambas edades de rebrote, mientras que en el inóculo ovino B. humidicola cv. Tupi tuvo la mejor digestibilidad, también para ambas edades.

Conclusiones e implicaciones La especie animal de origen para el inóculo tiene un efecto en las pruebas de digestibilidad in vitro. Por lo tanto, es muy recomendable utilizar un inóculo específico para las evaluaciones de gramíneas según la especie objetivo (bovino u ovino). De los resultados obtenidos, B. decumbens cv. Basilisk presentó la mejor digestibilidad in vitro (DMSiv y DFDNiv) en inóculo bovino y también una buena combinación de contenido de nutrientes y aumento de la producción de todos sus componentes de dosel, mientras que B. humidicola cv. Tupi tuvo mejor digestibilidad in vitro (DMSiv y DFDNiv) en inóculo ovino y la mejor producción. Agradecimientos Los autores agradecen a la Universidad Federal de Mato Grosso do Sul; Consejo Nacional de Desarrollo Científico y Tecnológico - CNPq, (proceso 563988/2010-0); Fundación de Apoyo al Desarrollo de la Educación, la Ciencia y la Tecnología del Estado de Mato Grosso do Sul- FUNDECT (proceso 23/200.145/2011), y Coordinación de Perfeccionamiento de Personal de Nivel Superior –CAPES (Clave de Financiamiento 001). También desean agradecer al Centro Brasileño de Investigación Agrícola (Embrapa Beef Cattle) por proporcionar los forrajes. Literatura citada: 1. Fernandes LO, Reis RA, Paes JMV, Teixeira RMA, Queiroz DS, Paschoal JJ. Performance of Gir young bull maintained in" Brachiaria brizantha" pastures submitted to different management. Rev Bras Saúde e Produção Anim 2015;16(1):36–46.

1057


Rev Mex Cienc Pecu 2021;12(4):1045-1060

2. Medeiros FF, Silva AMA, Carneiro H, Araújo DRC, Morais RKO, Moreira MN, et al. Fontes proteicas alternativas oriundas da cadeia produtiva do biodiesel para alimentação de ruminantes. Arq Bras Med Veterinária e Zootec 2015;67(2):519– 526. 3. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):3583–3597. 4. Weiss WP. Estimation of digestibility of forages by laboratory methods. Forage Qual. Eval. Util. John Wiley & Sons, Ltd; 1994:644–681. 5. Köppen W, Geiger R. Handbuch der Klimatologie: Das geographische System der Klimate. Berlin: Borntraeger Science Publishers; 1936 vol. 35. 6. Machado LAZ, Fabrício AC, Assis PGG de, Maraschin GE. Estrutura do dossel em pastagens de capim-marandu submetidas a quatro ofertas de lâminas foliares. Pesqui Agropecuária Bras 2007;42(10):1495–1501. 7. Santos MER, da Fonseca DM, Silva GP, Pimentel RM, de Carvalho VV, da Silva SP. Estrutura do pasto de capim-braquiária com variação de alturas. Rev Bras Zootec 2010;39(10):2125–2131. 8. AOAC (Association of Official Analytical Chemists). Official Methods of Analysis 1990;1(Vol 1):552. 9. Tilley JMA, Terry RA. A two-stage technique for the in vitro digestion of forage crops. Grass Forage Sci 1963;18(2):104–111. 10. Holden LA. Comparison of methods of in vitro dry matter digestibility for ten feeds. J Dairy Sci 1999;82(8):1791–1804. 11. McDougall EI. Studies on ruminant saliva. 1. The composition and output of sheep’s saliva. Biochem J 1948;43(1):99–109. 12. Zorzi K, Detmann E, Queiroz AC de, Paulino MF, Mantovani HC, Bayão GF. In vitro degradation of neutral detergent fiber of high-quality tropical forage according to supplementation with different nitrogenous compounds. Rev Bras Zootec 2009;38(5):964–971. 13. Santos EDG, Paulino MF, Queiroz DS, Valadares Filho S de C, Fonseca DM da, Lana R de P. Avaliação de pastagem diferida de Brachiaria decumbens Stapf: 1. Características químico-bromatológicas da forragem durante a seca. Rev Bras Zootec 2004;33(1):203–213. 14. Barbosa RA, Nascimento Júnior D do, Euclides VPB, Silva SC da, Zimmer AH, Torres Júnior RA de A. Capim-tanzânia submetido a combinações entre intensidade e freqüência de pastejo. Pesqui Agropecuária Bras 2007;42(3):329–340. 1058


Rev Mex Cienc Pecu 2021;12(4):1045-1060

15. Velásquez PAT, Berchielli TT, Reis RA, Rivera AR, Dian PHM, Teixeira IAMDA. Composição química, fracionamento de carboidratos e proteínas e digestibilidade in vitro de forrageiras tropicais em diferentes idades de corte. Rev Bras Zootec 2010;39(6):1206–1213. 16. Santos MER, Fonseca DM da, Euclides VPB, Nascimento Júnior D do, Queiroz AC de, Ribeiro Júnior JI. Características estruturais e índice de tombamento de Brachiaria decumbens cv. Basilisk em pastagens diferidas. Rev Bras Zootec 2009;38(4):626–634. 17. Paciullo DSC, De Carvalho CAB, Aroeira LJM, Morenz MJF, Lopes FCF, Rossiello ROP. Morphophysiology and nutritive value of signalgrass under natural shading and full sunlight. Pesqui Agropecu Bras 2007;42(4):573–579. 18. Moreira EA, Souza SM de, Ferreira AL, Tomich TR, Azevêdo JAG, Souza Sobrinho F de, et al. Nutritional diversity of Brachiaria ruziziensis clones. Ciência Rural 2018;48(2):1–8. 19. Rosa B, Reis RA, De Resende KT, Do Nascimento Kronka S, Jobim CC. Nutritive value of Brachiaria decumbens stapf cv. Basilisk hay submitted to anhydrous ammonia or urea treatment. Rev Bras Zootec 1998;27(4):815–822. 20. Moraes EHBK de, Paulino MF, Zervoudakis JT, Valadares Filho S de C, Moraes KAK de. Avaliação qualitativa da pastagem diferida de Brachiaria decumbens Stapf., sob pastejo, no período da seca, por intermédio de três métodos de amostragem. Rev Bras Zootec 2005;34(1):30–35. 21. Silva AM, Oliveira RL, Ribeiro OL, Bagaldo AR, Bezerra LR, Carvalho ST, et al. Valor nutricional de resíduos da agroindústria para alimentação de ruminantes. Comun Sci 2014;5(4):370–379. 22. Rodrigues ALP, Sampaio IBM, Carneiro JC, Tomich TR, Martins RGR. Degradabilidade in situ da matéria seca de forrageiras tropicais obtidas em diferentes épocas de corte. Arq Bras Med Veterinária e Zootec 2004;56(5):658–664. 23. Costa VAC, Detmann E, Valadares Filho SDC, Paulino MF, Henriques LT, Mantovani HC. Degradação in vitro da fibra em detergente neutro de forragem tropical de baixa qualidade em função de suplementação com proteína e/ou carboidratos. Rev Bras Zootec 2008;37(3):494–503. 24. Mutimura M, Ebong C, Rao IM, Nsahlai IV. Nutritional values of available ruminant feed resources in smallholder dairy farms in Rwanda. Trop Anim Health Prod 2015;47(6):1131–1137. 25. Goering HK, Van Soest PJ. Forage fiber analyses: apparatus, reagents, procedures, and some applications. Agr Res Serv. US Department of Agriculture; 1970.

1059


Rev Mex Cienc Pecu 2021;12(4):1045-1060

26. Euclides VPB, Flores R, Medeiros RN, Oliveira MP de. Diferimento de pastos de braquiária cultivares Basilisk e Marandu, na região do Cerrado. Pesqui Agropecuária Bras 2007;42(2):273–280. 27. Paciullo DSC, Gomide JA, Queiroz DS, Silva EAM da. Chemical composition and in vitro digestibility of leaf blades and stems of forages grasses, according to level of insertion on grass tiller, age and season of growth. Rev Bras Zootec 2001;30(3):964– 74.

1060


https://doi.org/10.22319/rmcp.v12i4.5820 Artículo

Ensilado de orujo de uva (Vitis labrusca L. cv. Isabel) en la digestibilidad de nutrientes, balance de nitrógeno y comportamiento ingestivo de corderos

Fernando Luiz Massaro Junior a Valter Harry Bumbieris Junior a* Ediane Zanin a Elzânia Sales Pereira b Mikael Neumann c Sandra Galbeiro a Odimari Pricila Prado Calixto a Ivone Yurika Mizubuti a

a

State University of Londrina, Department of Animal Science, Londrina, Paraná, Brazil, 86057-970. b

Ceará Federal University, Department of Animal Science, Ceará, Brazil.

c

State University of Central-West of Paraná, Department of Veterinary Medicine, Paraná, Brazil.

* Autor de correspondencia: jrbumbieris@uel.br

Resumen: Este estudio investigó la inclusión del ensilado de orujo de uva (EOU; 0, 10, 20 y 30 %), se evaluó en dietas de corderos, en la ingesta y digestibilidad de nutrientes, balance de nitrógeno y comportamiento ingestivo. Cuatro corderos de la raza Santa Inés con un peso de 21.93 ± 87 kg y aproximadamente siete meses de edad fueron alojados en jaulas metabólicas y distribuidos en un diseño cuadrado latino de 4x4. Los tratamientos consistieron en cuatro dietas con la inclusión de 0, 10, 20 y 30 % de EOU en las dietas. La ingesta de nutrientes se observó con un comportamiento lineal creciente para la ingesta 1061


Rev Mex Cienc Pecu 2021;12(4):1061-1082

de extracto etéreo (EE) (P<0.05) de acuerdo con el aumento de EE en las dietas, causado por el contenido de EE de las semillas en el EOU. Las dietas no difirieron en los coeficientes de digestibilidad de nutrientes y balance de nitrógeno (P>0.05), con una digestibilidad de materia seca (DMS) media de 678.6 ± 0.62 g kg-1 de MS y retención media de N de 239.78 g kg-1 de N ingerido. El comportamiento ingestivo de las dietas solo influyó (P<0.05) en el tiempo que los animales permanecieron inactivos de pie. Este parámetro mostró un comportamiento cuadrático con un punto máximo estimado en 17.73 % de EOU (P=0.041). En conclusión, se puede hacer uso de EOU hasta un nivel de inclusión del 30 % sin afectar negativamente a los parámetros evaluados. Palabras clave: Subproductos de frutas, Comportamiento, Consumo, Digestibilidad, Corderos, Ensilado.

Recibido: 02/10/2020 Aceptado: 29/03/2021

Introducción El uso de alimentos alternativos como los subproductos que ayudan a abastecer la demanda de nutrientes de animales rumiantes en épocas de baja oferta de pasto, principalmente durante los períodos de invierno o sequía, despierta el interés de las diferentes áreas de los investigadores, incluyendo la de los alimentos conservados. El sector primario genera anualmente toneladas de subproductos orgánicos con excelente composición de nutrientes(1) que podrían ser transformados en carne, leche, piel y lana por los rumiantes(2) y, en consecuencia, pueden reducir las amenazas de contaminación ambiental, ya que parte de este subproducto puede almacenarse o desecharse de forma inadecuada en el medio ambiente. Investigaciones recientes han sugerido reemplazar parcialmente los granos de cereales por subproductos agrícolas en la alimentación animal(2,3,4), con el fin de promover una producción más sostenible. Además, el uso de subproductos de diferentes fuentes de materia prima puede contribuir a satisfacer la demanda de los consumidores, con respecto a la sostenibilidad de los sistemas de producción animal y el mantenimiento de la integridad del medio ambiente. El uso de subproductos agrícolas e industriales está presente desde la producción de productos químicos hasta la alimentación animal(1,5). La uva destinada a la industria del vino y los jugos, por ejemplo, genera cantidades de subproductos, como orujo y semillas, que ofrecen riesgos económicos y medioambientales(6). Sin embargo, este subproducto es una fuente alternativa de fibra, tiene bajo costo comercial, composición química de calidad(7) y se ha incorporado tradicionalmente en dietas de ovejas y corderos (8,9,10). Estudios recientes mostraron la viabilidad para el almacenamiento en forma de ensilado, con cantidades satisfactorias de azúcares y fibras residuales, que cumplen con las

1062


Rev Mex Cienc Pecu 2021;12(4):1061-1082

características deseables de los alimentos conservados(11). También es una alternativa para asegurar el ensilado durante todo el año y el destino adecuado de este subproducto. El uso de subproductos igualados puede contribuir en las pequeñas granjas que no tienen áreas de tierra disponibles para cultivos destinados a la producción de ensilado tradicional, como maíz entero y forrajes. El uso de orujo de uva en las dietas para corderos había mostrado resultados considerables en la composición nutricional, el rendimiento, el consumo de nutrientes y la aceptabilidad por parte de los animales(10,12,13). Aunque existen resultados en el rendimiento de los corderos con la inclusión de solo orujo de uva, el suministro de este subproducto en forma de ensilado y las limitaciones de los respectivos niveles de inclusión, relacionados con el contenido de fibra y el extracto etéreo de las semillas, merecen investigarse, ya que existe variedad en los cultivares de uva que pueden ofrecer diferentes efectos cualitativos en los ensilados y el rendimiento de los animales. Con base en esta hipótesis, el trabajo se realizó con el objetivo de evaluar la inclusión de 0, 10, 20, 30 % de ensilado de orujo de uva (Vitis labrusca L. cv. Isabel) en dietas de cordero y sus efectos sobre la ingesta y digestibilidad de nutrientes, balance de nitrógeno y comportamiento ingestivo.

Material y métodos Animales de experimentación, manejo y dietas El estudio se llevó a cabo en el cobertizo de metabolismo ovino de la granja escolar y en el Laboratorio de Nutrición Animal de la Universidad Estatal de Londrina, Paraná, Brasil en el mes de julio de 2012. Todos los procedimientos de este estudio se realizaron de acuerdo con el Comité de Ética de Experimentos con Animales de esta Universidad y se aprobaron bajo el número de identificación (Protocolo nº 78/10). Cuatro corderos de la raza Santa Inés, machos, castrados, con un peso promedio de 21.93 ± 0.87 kg y de aproximadamente siete meses de edad, con fondo recolector de orina, comederos individuales para alimentos y suplementos minerales, así como bebederos. El diseño experimental fue un cuadrado latino de 4x4, con cuatro períodos y cuatro tratamientos. Los animales se sometieron a una adaptación inicial a las dietas de 21 días, seguida de 4 días para la recolección de muestras de heces, orina y del alimento proporcionado y las sobras en cada período, y 1 día para los datos de comportamiento. Los siguientes períodos de recolección fueron precedidos por 10 días de adaptación para dietas posteriores. Los animales fueron pesados al principio y al final de cada período para ajustar la ingesta y cuantificar el consumo voluntario de materia seca. El alimento se administró en dos comidas al día, y a las 0730 h y 1630 h, ajustado diariamente de tal manera que había un 15 % de la materia seca suministrada, con el fin de no restringir el consumo.

1063


Rev Mex Cienc Pecu 2021;12(4):1061-1082

La siembra del sorgo (Sorghum bicolor L., cv. AG 2002) se realizó en la granja escolar de la Universidad Estatal (FAZESC-UEL) ubicada en Londrina, Paraná (23o20'10" latitud sur y 51o09'15" longitud oeste, 610 m de altura). El sorgo utilizado para la producción de ensilado se cultivó bajo un sistema de labranza cero con siembra en octubre de 2011. El corte de la planta entera ocurrió con un 28 % de MS en el mes de mayo de 2012 con el segundo corte de la planta, después de cortar el sorgo se almacenó en un silo búnker compactado con tractor en capas y cubierto con lona de plástico protegida por una capa de suelo de 15 cm. El subproducto del orujo de uva cultivar Isabel (Vitis labrusca L.) recolectado de un lote homogéneo, directamente de la industria de jugo (COROL, Rolândia, Paraná) después de su procesamiento. El subproducto de la uva estaba compuesto en gran parte por semillas (610 g kg-1 de materia seca (MS)), cáscaras y residuos de pulpa (390 g kg-1 de MS). En el momento de la recolección en la industria, el subproducto contenía 11 % de MS y se deshidrató al aire libre, volteándose tres veces al día, hasta alcanzar aproximadamente 30 % de MS. Después de la deshidratación del subproducto, se añadieron 5 g kg-1, como materia fresca (MF), de urea como aditivo químico utilizando un equipo de mezcla manual. La masa ensilada del subproducto (orujo de uva) se almacenó en febrero de 2012 en silos de tipo tambor de plástico con una capacidad de 100 a 200 litros con tapas de sellado. El tiempo de almacenamiento fue de cinco meses en un cobertizo cubierto hasta la fecha de apertura de los silos para el inicio del experimento. Las características químicas del ensilado de orujo de uva están representadas en el Cuadro 1 y en este trabajo sobre la calidad fermentativa del ensilado de orujo de uva cv. Isabel (Vitis labrusca L.)(11). Se utilizaron cuatro dietas isoprotéicas (160.46 ± 0.21 g kg-1 de MS de PC) e isoenergéticas (674.85 ± 5.23 g kg-1 de MS de nutrientes digestibles totales (NDT)), y se incluyó ensilado de orujo de uva (EOU) al 0, 10, 20 y 30 % de la base de MS, manteniéndose la mayor parte de la ración concentrada de 55:45 (Cuadro 1). Inicialmente, se formuló una dieta estándar (tratamiento sin la inclusión de EOU, 0 %) y a partir de esta dieta se hicieron las demás, eliminando 10, 20 y 30 % del ensilado de sorgo e incluyendo 10, 20 y 30 % de EOU. Debido a las diferencias en la composición del ensilado de sorgo y el EOU, se cambiaron los niveles de harina de maíz y soya para obtener una menor variación en los contenidos de proteínas y NDT de las dietas. Por cada inclusión del 10 % de EOU, el contenido de maíz se incrementó en un 1 % y el contenido de harina de soya se redujo en un 1 %.

1064


Rev Mex Cienc Pecu 2021;12(4):1061-1082

Cuadro 1: Niveles de ingredientes y composición química de las dietas e ingredientes (g/kg de MS-1) kg-1

Ingredientes, g Ensilado de sorgo Ensilado de orujo de uva Grano de maíz Harina de soya Total Composición química de las dietas MS MO PC EE FDN FDA NDT Composición química de los ingredientes MS MO PC EE FDN FDA NDT DMSIV

Niveles de EOU (%) 0 10 550.0 495.0 0.0 55.0 240.0 250.0 210.0 200.0 1000.0 1000.0

20 440.0 110.0 260.0 190.0 1000.0

30 385.0 165.0 270.0 180.0 1000.0

537.3 940.9 160.0 21.2 454.4 264.3 662.7

540.3 945.8 160.6 29.0 448.8 274.1 678.9

541.8 948.3 161.0 32.9 446.0 279.0 687.0

ES 278.6 924.0 58.4 16.5 691.4 438.3 533.2 -

EOU 305.9 959.9 139.8 83.4 640.7 533.1 679.3 461.2

Maíz 885.6 984.8 90.1 37.5 163.6 37.0 823.5 -

538.8 943.4 160.3 25.1 451.6 269.2 670.8 Harina de soya 897.9 935.0 505.9 14.8 166.4 68.5 818.2 -

MS (Materia seca), MO (Materia orgánica), PC (Proteína cruda), EE (Extracto etéreo), FDN (Fibra insoluble en detergente neutro), FDA (Fibra insoluble en detergente ácido), NDT (Nutrientes digestibles totales), DMSIV (Digestibilidad de materia seca in vitro), EOU (Ensilado de orujo de uva), ES (Ensilado de sorgo).

Los contenidos de NDT de los ingredientes utilizados en la formulación de las dietas se estimaron de acuerdo con las ecuaciones propuestas por Kearl(14). Para el ensilado de sorgo (ES) y el ensilado de orujo de uva (EOU) se utilizó la ecuación: %NDT= - 21.9391 + (1.0538 x PC) + (0.9738 x ENN) + (3.0016 x EE) + (0.4590 x FC); donde PC= proteína cruda, ENN= extractos no nitrogenados, EE= extracto etéreo. Para la harina de soya: %NDT= 40.3217 + (0.5398 x PC) + (0.4448 x ENN) + (1.4223 x EE) - (0.7007 x FC), donde FC= fibra cruda. Finalmente, para el grano de maíz: %NDT= 40.2625 + (0.1969 x PC) + (0.4028 x ENN) + (1.903 x EE) - (0.1379 x FC).

1065


Rev Mex Cienc Pecu 2021;12(4):1061-1082

Ingesta, digestibilidad de nutrientes y balance de nitrógeno Se pesaron los suministros y las sobras diariamente para ajustar el consumo, al final del período de adaptación, durante cuatro días consecutivos, se recogieron muestras de suministros, se recogieron las sobras directamente del comedero, heces y orina con ayuda de una bolsa y un cubo colector. La ingesta de nutrientes se estimó restando los nutrientes de los nutrientes sobrantes. El porcentaje de digestibilidad aparente se estimó de acuerdo con Coelho y Leão(15), donde: Digestibilidad aparente= ((Nutrientes suministrados (g) Nutrientes en las sobras (g)) / (Nutrientes de las heces (g))) * 100. Para determinar el balance de nitrógeno se recogió la orina y se midió en segundo lugar, Schneider y Flat(16). Las muestras de heces, orina y alimento suministrado y rechazado fueron analizadas para determinar los contenidos de nitrógeno y se calculó la retención de nitrógeno de acuerdo con Decandia et al(17), siendo: N retenido= N ingerido - (N fecal + N urinario); N ingerido= (N suministrado - N sobrante). Las muestras de las dietas, ingredientes, restos de alimento, heces y orina fueron recogidas y analizadas para determinar la materia seca (MS), materia orgánica (MO), proteína cruda (PC), nitrógeno (N), extracto etéreo (EE) de acuerdo con la metodología de la AOAC(18) descrita por Mizubuti et al(19), la fibra insoluble en detergente neutro (FDN), fibra insoluble en detergente ácido (FDA) ensayada con una alfa amilasa estable al calor y corregido por ceniza según la metodología de Van Soest(20), descrita por Detmann et al(21). Los carbohidratos totales (CHOT) y los carbohidratos no fibrosos (CNF) se calcularon de acuerdo con las ecuaciones propuestas(22). Para determinar el porcentaje de semillas, se separaron 500 g del orujo de uva utilizando un tamiz y pinzas, en semillas y porción sin semillas. Posteriormente, las porciones se pre-secaron durante 72 h a 55 ºC en un horno con circulación de aire forzado, se trituraron y analizaron para dterminar el contenido final de MS(18). La digestibilidad in vitro de la MS se estimó utilizando la técnica de digestión en dos etapas según la técnica propuesta por Tilley y Terry(23) y adaptada por Mizubuti et al(19).

Comportamiento ingestivo El comportamiento ingestivo se evaluó durante 24 h consecutivas mediante observaciones directas a intervalos de 5 min realizadas en el quinto día de cada uno de los cuatro períodos de recolección de datos del experimento, totalizando 288 observaciones por período según el método de Martin y Bateson(24). Un total de seis observadores entrenados realizaron observaciones directas en parejas, durante un período de 6 h de observación. Una de las parejas alternó el período de observación al amanecer con descanso durante el día para completar las 24 h de observación. Los observadores se posicionaron estratégicamente cerca de las jaulas para no interferir con el comportamiento de los animales. La iluminación artificial se realizó con lámparas de flujo luminoso de baja incidencia y se fijó a la estructura del cobertizo

1066


Rev Mex Cienc Pecu 2021;12(4):1061-1082

para las observaciones nocturnas. El comportamiento ingestivo se observó después de 7 días de adaptación de los corderos a las jaulas, observadores, iluminación artificial en la noche y ambiente. El tiempo dedicado a alimentarse, rumiar acostado, rumiar de pie, acostarse y permanecer inactivo de pie se observó de acuerdo con la metodología de Johnson y Combs(25). Los parámetros de masticación y rumiación se midieron en términos del número de masticaciones y el tiempo de masticación de cinco bolos ruminales en cada uno de los cuatro períodos evaluados durante las 24 h de observación. Los resultados relativos a la eficiencia de alimentación y de rumiación expresada en g de MS h-1 y g de FDN h-1, respectivamente, se calcularon dividiendo la ingesta de MS y FDN entre el tiempo total dedicado a comer o rumiar en un período de 24 h, y se obtuvieron mediante las ecuaciones(26): EIMS = CMS / CONA, donde EIMS= Eficiencia de la ingesta de materia seca (g/h), CMS= consumo de materia seca (g/d), CONA= Tiempo de consumo de alimento (horas); EIFDN= CFDN/CONA, donde EIFDN= Eficiencia de la ingesta de fibra insoluble en detergente neutro (g/hora), CFDN= Consumo de fibra insoluble en detergente neutro (g/d); ERMS= CMS / (TRP + TRA), donde ERMS= Eficiencia de rumiación de materia seca (g/h), TRP= Tiempo de rumiación de pie (horas/día), TRA= Tiempo de rumiación acostado (h/d); ERFDN = CMS / (TRP + TRA), donde ERFDN= Eficiencia de la rumiación de fibra insoluble en detergente neutro (g/h); TTM= CONA + TRP + TRA, donde TTM= Tiempo total de masticación (min/día).

Análisis estadísticos Los datos fueron sometidos a las pruebas de Shapiro-Wilk y Bartlett, con el fin de verificar los supuestos de la prueba de normalidad para la distribución de los errores y la homogeneidad de la varianza, respectivamente. Una vez que se cumplieron estos supuestos, los datos se sometieron al análisis de la varianza para la digestibilidad de nutrientes y el balance de nitrógeno. El análisis de regresión (α= 0.05) fue aplicable para la ingesta de nutrientes y el comportamiento ingestivo. Se utilizó el paquete estadístico ExpDes del programa estadístico R (Versión 2013) para estudiar los valores medios mediante el análisis de regresión, utilizando la prueba “F” (α= 0.05), siguiendo el modelo: Yijk = µ + 𝑇𝑖 + 𝛼𝑗 + 𝛽𝑘 + 𝑖𝑗𝑘 donde: 𝐘𝐢𝐣𝐤 = es el valor observado en la i-ésima fila y la k-ésima columna para el j-ésimo tratamiento; 𝝁= es la media general; 𝑻𝒊= es el efecto del i-ésimo tratamiento; 𝛼𝑗= es el efecto de la j-ésima fila. 𝜷𝒌= es el efecto de la k-ésima columna;

1067


Rev Mex Cienc Pecu 2021;12(4):1061-1082

𝒊𝒋𝒌= es un componente de error aleatorio, asociado con la i-ésima fila, k-ésima columna y el j-ésimo tratamiento.

Resultados y discusión Con el fin de evaluar la MS y la ingesta de nutrientes de las dietas, se observó que la inclusión del ensilado de orujo de uva influyó (P<0.05) en aumentar linealmente solo el consumo de EE (Cuadro 2). El EE en EOU se debe a la mayor densidad de las semillas (610 g kg-1 de MS) en comparación con la cáscara y la pulpa (390 g kg-1 de MS) que constituyen el orujo de uva(11) y las semillas, a su vez, tienen una alta concentración de aceite(27). Por lo tanto, este comportamiento puede explicarse por la mayor concentración de EE en el EOU y por proporcionar un aumento de la concentración de este nutriente en la dieta, de acuerdo con el aumento de los niveles de inclusión del EOU. El aumento del EE en las dietas y la ingesta se observa a menudo de acuerdo con el aumento del nivel de inclusión de residuos de uva de hasta el 15 %, respectivamente(10,12,13). El nivel máximo de EE de 32.9 g kg-1 de MS ofrecido en la dieta con 30 % de inclusión en este trabajo no supera el límite máximo de 50 g kg-1 de MS propuesto por Palmquist y Mattos(28). La ingesta media de MS (3.80 % de peso vivo) cumplió con los requerimientos de los animales y presentó un valor superior al recomendado por el NRC(29), es del 3.51 % para la categoría animal analizada con 30 kg y ganancia diaria de peso de 300 g/día. La IFDN recomendada por Mertens(30) para animales rumiantes debe mantener una ingesta de FDN en torno al 1.2 % de su peso vivo, en este estudio la IFDN fue de 1.43 %, lo que podría estar relacionado con la cantidad de fracciones fibrosas de las dietas de cada tratamiento.

1068


Rev Mex Cienc Pecu 2021;12(4):1061-1082

Cuadro 2: Ingesta de nutrientes (g kg-1) en dietas para corderos con inclusión de ensilado de orujo de uva (EOU) Ingesta MS MO PC EE FDN CHOT CNF NDT MS MO PC EE FDN CHOT CNF NDT

Niveles de EOU (%) 0 10 -1 gd 1226.3±54.78 1246.4±118.32 1176.9±55.57 1197.5±114.50 220.3±16.13 222.4±34.35 38.6±11.45 41.3±12.88 468.8±28.97 463.5±35.23 918.0±34.93 933.8±87.90 477.9±44.25 470.3±63.03 864.4±69.13 855.6±69.38 -1 g kg de peso vivo 37.80±5.64 37.98±4.09 36.27±5.39 36.48±3.83 6.78±0.93 6.74±0.75 1.18±0.36 1.25±0.33 14.39±2.56 14.19±1.94 28.31±4.34 28.50±3.51 14.59±0.90 14.31±1.88 26.61± 26.07±

Media

20

30

1242.6±83.63 1199.1±84.59 224.9±18.91 50.8±17.21 462.1±51.56 923.5±71.42 461.3±32.72 876.0±76.31

1226.7±121.96 1183.4±114.21 218.1±23.27 52.5±12.53 451.9±62.72 912.9±102.95 460.9±43.95 854.6±70.62

1235.5±10.50 1189.2±55.57 221.4±2.88 Ŷ=38.1+0.513x 461.6±6.13 922.0±8.95 467.6±8.11 862.7±9.93

38.44±7.12 37.08±6.81 6.91±0.90 1.55±0.47 14.39±3.59 28.62±5.88 14.24±2.37 27.09±

37.84±5.51 36.49±5.09 6.68±0.47 1.59±0.21 14.01±2.91 28.22±4.84 14.21±1.96 26.33±

38.02±0.29 36.58±0.35 6.78±0.10 Ŷ=1.16+0.015x 15.25±0.18 28.41±0.18 14.34±0.18 26.53±0.44

1069

R2

0.92

0.9

CV

Valor P

5.12 5.16 6.61 11.22 7.34 4.98 7.08 4.85

0.951 0.942 0.923 0.021 0.937 0.925 0.865 0.876

7.08 7.10 8.07 9.96 9.02 7.13 8.07 6.80

0.985 0.972 0.940 0.013 0.968 0.991 0.962 0.869


Rev Mex Cienc Pecu 2021;12(4):1061-1082

MS MO PC EE FDN CHOT CNF NDT MS MO PC EE FDN CHOT CNF NDT

g kg-1 de peso vivo0.75 90.10±10.78 90.83±8.70 86.46±10.30 87.25±8.18 16.16±1.82 16.13±1.89 2.82±0.83 2.99±0.83 34.28±5.04 33.89±3.86 67.48±8.28 68.13±7.38 34.87±1.44 34.24±4.27 63.46±8.16 62.35±4.89 % de peso vivo 3.78±0.56 3.80±0.41 3.63±0.54 3.65±0.38 0.68±0.09 0.67±0.08 0.12±0.04 0.12±0.03 1.44±0.26 1.42±0.19 2.83±0.43 2.85±0.35 1.46±0.09 1.43±0.19 2.66±0.41 2.61±0.24

91.53±13.77 88.30±13.20 16.48±1.70 2.70±1.14 34.20±7.29 68.12±11.57 33.92±4.54 64.51±10.16

90.18±11.10 86.97±10.19 15.95±0.92 2.80±0.59 33.35±6.13 67.22±9.97 33.87±3.92 62.77±6.29

90.66±0.66 87.25±0.87 16.18±0.22 Ŷ=2.77+0.037x 33.93±0.42 67.74±0.46 34.23±0.46 63.27±0.94

3.84±0.71 3.71±0.68 0.69±0.09 0.15±0.05 1.44±0.36 2.86±0.59 1.42±0.24 2.71±0.51

3.78±0.55 3.65±0.51 0.67±0.05 0.16±0.02 1.40±0.29 2.82±0.48 1.42±1.18 2.63±0.33

3.80±0.03 3.66±0.04 0.68±0.01 Ŷ=0.116+0.002x 1.43±0.02 2.84±0.02 1.43±0.02 2.65±0.04

0.85

0.9

6.50 6.53 7.62 10.16 8.51 6.52 7.7 6.22

0.983 0.972 0.940 0.014 0.965 0.987 0.944 0.872

7.08 7.10 8.07 9.96 9.02 7.13 8.07 6.80

0.985 0.972 0.940 0.013 0.968 0.991 0.962 0.869

MS= (Materia seca), MO (Materia orgánica), PC (Proteína cruda), EE (Extracto etéreo) FDN (Fibra insoluble en detergente neutro), CHOT (Carbohidratos totales), CNF (Carbohidratos no fibrosos), NDT (Nutrientes digestibles totales), CV (Coeficiente de variación), R²= coeficiente de determinación.

1070


Rev Mex Cienc Pecu 2021;12(4):1061-1082

Estos valores de ingesta de nutrientes (Cuadro 2) se corroboran con un estudio(10) que encontró valores para IMS de 1,192, 1,144 y 1,127 g kg-1 para niveles de 0, 10 y 20 %, respectivamente, de inclusión de ensilado de orujo de uva en dietas para corderos, así como otros nutrientes que están en el rango para el intervalo observado por estos autores en el consumo de nutrientes. Algunos autores(12) encontraron IMS de 1,445.8, 1,379 y 1,482.4 g d-1 de corderos alimentados con niveles de 0, 5 y 10 % de orujo de uva de vino. Los corderos alimentados con un 10 % de orujo de uva de vino no tuvieron su IMS y tuvieron una ganancia diaria media mayor que los corderos en la suplementación de 0 y 5 %. A pesar de que el valor de IMS fue más alto que en este estudio, la ingesta de nutrientes no fue influenciada por la inclusión de orujo de uva. No se observaron variaciones (P>0.05) en la digestibilidad aparente de los nutrientes en función del aumento de los contenidos de EOU (Cuadro 3). Factores como la similitud en los contenidos de FDN de las dietas (Cuadro 1), la ausencia de diferencias en el consumo de MS y la asociación entre el ensilado de orujo de uva y otros alimentos, pueden estar asociados con la similitud entre la digestibilidad de los nutrientes en las dietas. Se observó una reducción en la digestibilidad de la MS y los nutrientes en las dietas ovinas(31) al asociar el 50 % de residuos de uva deshidratados con diferentes fuentes de energía, que según los autores, la digestibilidad de las dietas se vio afectada por la baja digestibilidad del residuo de uva deshidratado del 30 % determinado in vitro. También se observó una reducción significativa en la digestibilidad para las dietas de orujo de uva roja(32). Estos autores relacionaron la disminución de la digestibilidad con la presencia de taninos y el alto contenido de lignina en el orujo de uva. Sin embargo, los valores encontrados para la digestibilidad de nutrientes del presente estudio (Cuadro 3) son superiores al estudio de Zalikarenab et al(32). Para DMS, el valor promedio fue de 678.6 ± 0.62 g kg-1 de MS, también se observó como mayor al valor encontrado por otros(33) con DMS de 285 g kg-1 de MS al evaluar la digestibilidad del ensilado de bagazo para rumiantes. Es probable que los valores de digestibilidad de las dietas observados en el presente experimento se deban a la mejor utilización del ensilado de orujo de uva por parte del animal, considerando 461.2 g kg-1 de DMSIV del subproducto utilizado (Cuadro 1). Sin embargo, cabe mencionar que los valores de digestibilidad de los nutrientes encontrados en este trabajo se refieren al orujo de uva Vitis Labrusca L. de la variedad Isabel(11) y debido a que aún no hay estudios con esta variedad en el alimento para corderos, no es posible establecer comparaciones entre los resultados obtenidos. Además, las diferencias en la digestibilidad pueden estar relacionadas con variaciones entre los subproductos utilizados en las dietas, además del tipo de procesamiento y aditivo utilizado para la conservación. Según Rogério et al(34), el procesamiento en las agroindustrias frutícolas resulta en una gran variación en la composición química de los residuos generados, observándose variaciones incluso entre lotes que han sido sometidos al mismo tipo de procesamiento. 1071


Rev Mex Cienc Pecu 2021;12(4):1061-1082

Cuadro 3: Digestibilidad aparente de nutrientes (g kg de MS-1) en dietas que contienen niveles de EOU Variables DMS DMO DPC DEE DFDN DTCHOT DCNF DNDT

Niveles de EOU (%) 0 10 675.5±4.62 671.9±2.08 696.1±4.20 691.0±1.79 696.4±4.67 695.9±4.69 870.7±4.34 861.8±3.69 621.9±5.98 559.6±4.96 658.3±8.76 681.4±1.55 747.3±4.63 800.5±3.54 700.6±2.66 690.3±1.94

20 686.2±1.26 704.5±1.23 701.8±4.08 909.2±2.43 590.0±4.54 693.2±1.64 794.3±2.30 705.8±2.33

30 680.7±3.72 699.4±3.58 684.5±3.03 901.0±3.28 559.0±5.43 690.8±3.82 818.8±3.80 701.1±2.26

Media 678.6±0.62 697.8±0.57 694.7±0.73 885.7±2.30 582.6±2.99 680.9±1.59 790.2±3.04 699.5±0.65

CV (%) 4.25 3.71 4.63 2.46 5.89 6.06 4.03 1.08

Valor P 0.901 0.897 0.890 0.057 0.114 0.116 0.083 0.640

DMS (Digestibilidad de la materia seca), DMO (Digestibilidad de la materia orgánica), DPC (Digestibilidad de la proteína cruda), DEE (Digestibilidad del extracto etéreo), DFDN (Digestibilidad de la fibra insoluble en detergente neutro), DCHOT (Digestibilidad de los carbohidratos totales) DCNF (Digestibilidad de los carbohidratos no fibrosos), DNDT (Digestibilidad de los nutrientes digestibles totales). EOU (Ensilado de orujo de uva), CV (Coeficiente de variación).

1072


Rev Mex Cienc Pecu 2021;12(4):1061-1082

Cuadro 4: Absorción, excreción y nitrógeno en corderos alimentados con dietas con inclusión de ensilado de orujo de uva (EOU) Variable Nitrógeno ingerido g d-1 Nitrógeno fecal g d-1 g kg-1de N ingerido Nitrógeno urinario g d-1 g kg-1de N ingerido Nitrógeno retenido g d-1 g kg-1de N ingerido

Niveles de inclusión de EOU (%) 0 10

20

30

Media

Valor P

CV

35.25±2.58

35.58±5.50

35.98±3.03

34.89±3.72

35.43±0.46

0.922

6.61

10.53±1.74 298.81±46.46

10.86±2.61 304.08±46.86

10.71±1.65 298.15±40.83

10.95±0.93 315.42±30.27

10.76±0.18 304.12±7.99

0.977 0.837

13.72 9.91

18.48±0.78 525.45±26.91

14.82±3.57 417.72±79.18

17.14±4.50 473.27±101.3

14.11±2.18 407.98±74.14

16.14±2.03 456.11±54.4

0.452 0.352

25.07 20.79

6.24±2.40 175.74±58.95

9.90±4.78 278.20±120.2

8.13±2.04 228.58±67.47

9.84±4.10 276.60±89.44

8.53±1.73 239.78±48.5

0.546 0.556

45.87 46.37

CV (Coeficiente de variación), N (Nitrógeno).

1073


Rev Mex Cienc Pecu 2021;12(4):1061-1082

Los parámetros de ingestión, excreción fecal, excreción urinaria y retención de nitrógeno no fueron influenciados (P>0.05) por las dietas (Cuadro 4), y posiblemente que el uso de dietas isoprotéicas y el consumo de proteína cruda no fueran influenciados por las dietas, son las razones de la similitud observada para el balance de nitrógeno entre dietas y niveles similares de PC. El balance positivo de los contenidos de nitrógeno con valores medios de 8.53 g día-1 de nitrógeno retenid0o y 239.78 g kg-1 de nitrógeno ingerido puede indicar que hubo retención de proteínas en el cuerpo del animal, proporcionando condiciones para que no se produjera pérdida de peso y probablemente las necesidades de proteínas se cumplieran con las dietas(35) . Los resultados del presente estudio indicaron que las dietas experimentales tuvieron un suministro balanceado de proteínas y energía, lo que a su vez puede haber mejorado el uso de proteínas dietéticas. Las dietas con residuos de uva deshidratados y diferentes niveles de urea para corderos evaluadas encontraron valores medios de 22.62 g día-1, para la retención de N(36). Según los autores, el valor alto puede explicarse por el hecho de que los animales están creciendo y requieren altas cantidades de proteína para la formación de tejidos. Al sustituir el ensilado de sorgo por coproductos de fruta deshidratados, no se observaron diferencias para el balance de nitrógeno entre las dietas(37). Según estos autores, este hecho indica que los animales retuvieron proteínas de la dieta y se alcanzó el objetivo del estudio, además de que estos productos son una buena alternativa para su uso durante la escasez de alimento y potencialmente reducen los costos de alimentación. A pesar de que los valores observados para N retenido en el presente estudio, 8.53 g d-1, son inferiores a los observados en otros lugares(36) no mostraron daños en el desarrollo de los animales. Sin embargo, los valores son cercanos al N retenido y superiores para el N ingerido, fecal y urinario, a los encontrados por otros(13) cuando incluyeron residuos de uva en dietas con 11 % de PC para alimentar corderos. La retención de N está estrechamente relacionada con el balance y el momento de la degradación entre los carbohidratos y las proteínas dietéticas. De acuerdo con algunos autores(15), las mayores retenciones de nitrógeno son un reflejo del mejor balance entre la energía y proteína característica de cada alimento, lo que permite una mayor eficiencia en la utilización de proteínas. La excreción de N vía heces fue menor que la excreción descrita por Van Soest(38) para rumiantes, del 6 al 8 % de la proteína ingerida, ya que por consumo de PC de 221.4 g día-1 obtenido en esta investigación, y pérdidas de excreción fecal de 13.3 g N día-1. Se puede inferir que la cantidad de tanino presente en el orujo de uva no causó daños a la degradación proteica o que la cantidad máxima de EOU, 16.5 % presente en la dieta con una inclusión del 30 %, no fue suficiente para causar este efecto indeseable. Min et al(39), mencionan que los taninos pueden afectar al proceso de digestión mediante la formación de complejos con enzimas y principalmente con proteínas, lo que provocaría una menor degradación, absorción y, en consecuencia, una mayor excreción de proteínas a través de las heces.

1074


Rev Mex Cienc Pecu 2021;12(4):1061-1082

La presencia de taninos provoca la partición de nitrógeno, provocando que una menor proporción se excrete en la orina, dirigiendo su excreción hacia las heces(40). Este comportamiento no se observó en el presente experimento, la excreción urinaria de N de 16.14 g día-1 fue superior a la excreción fecal de N de 10.76 g día-1. Cuando la tasa de degradación de proteínas excede la de la fermentación de carbohidratos, una gran cantidad de compuestos de nitrógeno se puede eliminar a través de la orina(38).

1075


Rev Mex Cienc Pecu 2021;12(4):1061-1082

Cuadro 5: Comportamiento ingestivo de corderos alimentados con dietas que contienen diferentes niveles de ensilado de orujo de uva (EOU)

CMS, g d-1 CFDN, g d-1 TCON, min d-1 TIP, min d-1 TIA, min d-1 TRP, min d-1 TRA, min d-1 EIMS, g h-1 EIFDN, g h-1 ERMS, g h-1 ERFDN, g h-1 TTM, min d-1

Niveles de EOU (%) 0 10 1226.3±54.78 1246.4±118.32 468.8±28.97 463.5±35.23 237.5±81.45 270.0±83.77 315.0±20.21 342.5±94.65 493.8±119.8 395.0±86.70 30.0±26.46 21.2±15.48 363.8±40.72 411.3±36.83 388.1±102.3 341.9±82.00 181.2±47.78 159.6±38.28 237.0±15.72 202.8±18.16 110.7±7.34 94.7±8.48 631.3±105.0 702.5±65.89

20 1242.6±83.63 462.1±51.56 276.3±79.41 351.3±74.99 437.5±61.98 22.5±23.27 352.5±38.62 337.1±102.1 157.4±47.66 234.9±29.10 109.7±13.59 651.3±64.21

30 1226.7±121.96 452.0±62.72 255.0±33.42 320.0±76.70 468.8±73.30 16.3±8.54 380.0±32.40 346.1±42.92 161.6±20.04 221.6±21.84 103.5±10.35 651.3±40.29

Mean

R2

CV

Valor P

1235.5±10.50 461.60±6.13 259.7±17.27 Ŷ=A 435.3±42.59 22.5±5.68 376.9±25.55 355.29±23.47 164.92±10.96 224.09±15.75 104.61±7.35 659.06±30.45

0.98 -

5.12 11.22 26.23 4.59 15.23 113.5 12.85 20.67 20.67 20.61 20.61 9.57

0.951 0.942 0.854 0.041 0.295 0.894 0.414 0.749 0.751 0.717 0.717 0.481

CDM: Consumo de materia seca; CFDN, Consumo de fibra insoluble en detergente neutro; TCON, Tiempo de consumo; TIP, Tiempo inactivo de pie; TIA, Tiempo inactivo acostado; TRP, Tiempo de rumiación de pie; TRA: Tiempo de rumiación acostado; EIMS, Eficiencia de la ingesta de materia seca; EIFDN, Eficiencia de la ingestión de fibra insoluble en detergente neutro; ERMS, Eficiencia de la rumiación de materia seca; ERFDN, Eficiencia de la rumiación de fibra insoluble en detergente neutro; TTM, Tiempo total de masticación; CV, Coeficiente de variación; A= 313.9+4.64x-0.1147x2.

1076


Rev Mex Cienc Pecu 2021;12(4):1061-1082

No hubo diferencias en la ingesta de MS y FDN (Cuadro 5), lo que puede indicar que la palatabilidad no fue afectada negativamente por la inclusión de EOU de Vitis Labrusca L. cultivar Isabel (P>0.05). Gao et al(13), al evaluar la inclusión de hasta un 15 % de residuos de uva en las dietas de corderos, encontraron que los valores más bajos para la ingesta de MS y la ingesta de FDN se incrementaron con niveles de inclusión más altos. El tiempo dedicado al consumo, la rumia, el tiempo inactivo acostado y la masticación total no fueron influenciados (P>0.05) por la inclusión de EOU (Cuadro 5). La ausencia de efectos de las dietas en estos parámetros puede deberse a la similitud entre los niveles de fibra y concentrados de las dietas, así como los niveles de fibra, consumo y digestibilidad de MS y FDN. Además del contenido de humedad, causado por el uso del ensilado, ha facilitado el consumo de dietas por parte de los animales, facilitando el tiempo dedicado a la alimentación. El tiempo dedicado a la rumiación es proporcional al contenido de pared celular, tamaño de partícula y efectividad de la fibra alimentaria, con una mayor necesidad de procesar la fibra, así como más tiempo para el consumo de alimento(38). También en cuanto a la influencia del contenido de FDN en el comportamiento ingestivo, Cardoso et al(41) evaluaron dietas con diferentes niveles de FDN (25, 31, 37 y 43 %), no observaron cambios en el comportamiento ingestivo e informaron que se observaron variaciones en la ingesta en dietas con contenidos de FDN superiores a los observados en el presente experimento, o cuando hay mayor amplitud entre los contenidos de fibra en las dietas evaluadas. El tiempo dedicado al comportamiento ingestivo de las dietas influyó solo en el tiempo que los animales permanecieron inactivos de pie (Cuadro 5). Este parámetro mostró un comportamiento cuadrático con un punto máximo estimado en 17.73 % de EOU (P= 0.041). Aunque no hubo grandes variaciones en el contenido de FDN y el consumo de FDN no fue influenciado por los niveles de inclusión de ensilado de orujo de uva. Considerando el contenido de fibra como parámetro, se espera que el tiempo de inactividad disminuya a medida que aumente el contenido de FDN en la dieta, es decir, cuanto mayor sea la necesidad de procesar fibra dietética, menor será la permanencia de los animales inactivos(42,43). Como se observó en el presente estudio para el nivel de inclusión de 0 % con el mayor contenido de FDN de 454.4 g kg-1 de MS con el menor tiempo de inactividad de 315 min-1. Esto se debe a las características de la fibra del ensilado de sorgo(44), y en el presente estudio presentó un menor contenido de FDA y un mayor contenido de FDN que el EOU y también en la dieta (Cuadro 1). Al considerar el contenido total de fibra mediante la suma de FDN y FDA (725 g kg-1 de fibra total) para el nivel de inclusión de 30 % de EOU, el valor de 320 min día-1 de tiempo de inactividad puede haber sido influenciado por el contenido total de fibra. Esto se debe a las características de fibra del EOU(11), compuesto por 610 g kg-1 de MS de semillas, 390 g kg-1 de MS de residuos de pulpa y cáscaras. Las semillas representaron la mayor proporción en el ensilado y contribuyeron a aumentar los niveles de FDN y FDA en la 1077


Rev Mex Cienc Pecu 2021;12(4):1061-1082

dieta al nivel del 30 % de inclusión (Cuadro 1), lo que puede haber demandado una mayor necesidad de rumiación y menos tiempo de inactividad entre los niveles de inclusión (Cuadro 5). Para los corderos confinados, la inclusión de EOU puede mantenerlos activos y contribuir a la reducción del estrés y fomentar el comportamiento natural de la rumia. La eficacia de la ingestión y la rumiación de MS y FDN no fueron influenciadas (P>0.05) por los tratamientos con los diferentes niveles de inclusión. Este comportamiento puede justificarse por el consumo de MS y FDN (1,235.5 y 461.6 g d-1) respectivamente, los cuales no mostraron variación significativa (P>0.05) entre tratamientos. Según varios trabajos(45,46), las eficiencias de ingestión y rumiación de MS y FDN están directamente relacionadas con el consumo de MS y FDN, que pueden estar influenciadas por el tamaño de partícula, la calidad y el contenido de la dieta.

Conclusiones e implicaciones El ensilado de orujo de uva se puede utilizar para alimentar corderos, con una inclusión de hasta 30 % en dietas que contienen un 55 % de fibra, sin causar cambios en la ingesta y la digestibilidad de nutrientes, así como en el balance de nitrógeno y el comportamiento ingestivo. El ensilado de orujo de uva tiene características favorables para su uso en dietas para corderos, siendo el ensilado una buena alternativa para su almacenamiento, además de ofrecer el destino correcto para este subproducto. Agradecimientos Agradecemos al programa de posgrado en Ciencia Animal de la Universidad Estatal de Londrina (Londrina, Paraná, Brasil), a la Coordinación de Perfeccionamiento del Personal de Educación Superior (CAPES; Brasilia, DF, Brasil) y el apoyo de la Fundación Araucária (Paraná, Brasil). Conflictos de interés Los autores no tienen conflictos de interés que declarar. Literatura citada: 1. Kodagoda KHGK, Marapana RAUJ. Utilization of fruit processing by-products for industrial applications: A review. Intern J Sci Nutr 2017;2:24-30. 2. Barreto FM, Lima POA, Souza CMSA, et al. Uso de coprodutos de frutas tropicais na alimentação de ovinos no semiárido do Brasil. Arch Zootec 2014;3:17-131. 3. Mazza PHS, Jaeger SMPL, Silva FL, et al. Effect of dehydrated residue from acerola (Malpighia emarginata DC.) fruit pulp in lamb diet on intake, ingestive behavior, digestibility, ruminal parameters and N balance. Livest Sci 2020;103938.

1078


Rev Mex Cienc Pecu 2021;12(4):1061-1082

4. De Evan T, Cabezas A, De La Fuente J, et al. Feeding Agroindustrial byproducts to light lambs: influence on growth performance, diet digestibility, nitrogen balance, ruminal fermentation, and plasma metabolites. Animals 2020;10:4-600. 5. Eleonora N, Dobrei A, Dobrei A, et al. Grape pomace in sheep and dairy cows feeding. J Hort Forest Biotechnol 2014;18:146-150. 6. Zhang N, Hoadley A, Patel J, et al. Sustainable options for the utilization of solid residues from wine production. Waste Manag 2017;60:173–183. 7. Gülcü M, Uslu N, Özcan MM, et al. The investigation of bioactive compounds of wine, grape juice and boiled grape juice wastes. J Food Process Preserv 2019;43:e13850. 8. Baumgärtel T, Kluth H, Epperlein K, et al. A note on digestibility and energy value for sheep of different grape pomace. Small Ruminant Res 2007;67:302–306. 9. Calderón-Cortés JF, González-Vizcarra VM, Pétriz-Celaya Y, et al. Energy value of unfermented dried grape pomace as substitute of alfalfa hay in diets for growing lambs. Austral J Vet Sci 2018;63:59–63. 10. Chikwanha CO, Muchenjeb V, Noltec EJ, et al. Grape pomace (Vitis vinifera L. cv. Pinotage) supplementation in lamb diets: Effects on growth performance, carcass and meat quality. Meat Sci 2019;147:6-12. 11. Massaro Junior FL, Bumbieris Junior VH, Zanin E, et al. Effect of storage time and use of additives on the quality of grape pomace silages. J Food Process Preserv 2020; e14373. 12. Zhao JX, Li Q, Zhang RX, et al. Effect of dietary grape pomace on growth performance, meat quality and antioxidant activity in ram lambs. Anim Feed Sci Technol 2018;236:76–85. 13. Gao X, Tang F, Zhang F, et al. Effects of the supplementation of distillers’ grape residues on ruminal degradability, whole tract digestibility and nitrogen metabolism in sheep. Arch Anim Nutr 2019;1–15. 14. Kearl LC. Nutrient requirements of ruminants in developing countries. Logan: Utah State University/ International Feedstuffs Institute, 1982. 15. Coelho Da Silva JF, Leão MI. Fundamentos de nutrição dos ruminantes. Piracicaba: Livroceres, São Paulo. 1979. 16. Schneider BH, Flat WP. The evaluation of feeds through digestibility experiments. Athens: The University of Georgia Press; 1975. 17. Decandia M, Sitzia M, Cabiddu A, Kababya D, Molle G. The use of polyethylene glycol to reduce the anti-nutritional effects of tannins in goat fed woody species. Small Ruminant Res 2000;38:2157-2164.

1079


Rev Mex Cienc Pecu 2021;12(4):1061-1082

18. AOAC International. Association of Official Analytical Chemists. Official methods of analysis. 15th ed. Arlington, VA: AOAC International; 1990. 19. Mizubuti IY, Pinto AP, Pereira ES, et al. Métodos laboratoriais de avaliação de alimentos para animais. Londrina: EDUEL. 2009. 20. Van Soest PJ. User of detergents in the analyses of fibrous feeds. II. A rapid method for the determination of fibers and lignin. J Assoc Official Agricult Chemists1963; 46:829-835. 21. Detmann E, Souza MA, Valadares Filho SC, et al. Métodos para análise de alimentos: INCT: Ciência Animal. Visconde do Rio Branco: Suprema. 2012. 22. Sniffen CJ, O’connor JD, Van Soest PJ, et al. A net carbohydrate and protein availability. J Anim Sci 1992;70:3562-3577. 23. Tilley JMA, Terry RA. A two-stage technique for the in vitro digestion of forage crops. J British Grass Society 1963;18:104-111. 24. Martin P, Bateson P. Measuring behavior. 2nd ed. Cambridge: Cambridge University Press; 1993. 25. Johnson TR, Combs DK. Effects of prepartum diet, inert rumen bulk, and dietary polyethylene glycol on dry matter intake of lactating dairy cows. J Dairy Sci 1991; 74:933-944. 26. Bürger PJ, Pereira JC, Queiroz AC, et al. Comportamento ingestivo em bezerros holandeses alimentados com dietas contendo diferentes níveis de concentrado. Rev Bras Zootec 2000;29:236- 242. 27. Shinagawa FB, Santana FC, Torres LRO, Mancini-Filho J. Grape seed oil: a potential functional food. Food Sci Technol 2015; 35:399-406. 28. Palmquist DL, Mattos WRS. Metabolismo de lipídeos. In: Berchielli, TT, et al. Nutrição de ruminantes. Jaboticabal: FUNEP, Cap.10, 2006:287-310. 29. NRC. Nutrient requirements of small ruminants: Sheep, goats, cervids, and new world camelids. 1th. Washington, DC: National Academy Pres; 2007. 30. Mertens DR. Predicting intake and digestibility using mathematical models of ruminal function. J Dairy Sci 1987;64:1548-1558. 31. Barroso DD, Araújo GGL, Silva D, Medina FT. Resíduo desidratado de vitivinícolas associado a diferentes fontes energéticas na alimentação de ovinos: consumo e digestibilidade aparente. Ciênc Agrotec 2006;30:67-773. 32. Zalikarenab L, Pirmohammadi R, Teimuriyansari A. Chemical composition and digestibility of dried white and red grape pomace for ruminants. J Anim Vet Adv 2007;9:1107-1111.

1080


Rev Mex Cienc Pecu 2021;12(4):1061-1082

33. Pirmohammadi R, Golgasemgarebagh A, Azari MA. Effects of ensiling and drying of white grape pomace on chemical composition, degradability and digestibility for ruminants. J Anim Vet Adv 2007;6:1079-1082. 34. Rogério MCP, Costa HHA, Ximenes LJF, Neiva JNM. Utilização de subprodutos agroindustriais na alimentação de novilhas leiteiras. In: Produção de bovinos no nordeste do Brasil: desafios e resultados, Fortaleza: Banco do Nordeste do Brasil, Cap. 11,2011:263-297. 35. Vasconcelos AM, Leão MI, Valadares Filho SC, et al. Parâmetros ruminais, balanço de compostos nitrogenados e produção microbiana de vacas leiteiras alimentadas com soja e seus subprodutos. Rev Bras Zootec 2010;39:425-433. 36. Menezes DR, Araújo GGL, Oliveira RL, et al. Balanço de nitrogênio e medida do teor de uréia no soro e na urina como monitores metabólicos de dietas contendo resíduo de uva de vitivinícolas para ovinos. Ver Bras Saúde Prod Anim 2006;4:169– 175. 37. Almeida SCJ, Figueiredo MD, Azevedo KK. Intake, digestibility, microbial protein production, and nitrogen balance of lambs fed with sorghum silage partially replaced with dehydrated fruit by-products. Trop Anim Health Prod 2019;51:619-627. 38. Van Soest PJ. Nutritional ecology of the ruminant. New York: Cornell University Press; 1994. 39. Min BR, Barry TN, Attwood GT, McNabb WC. The effect of condensed tannins on the nutrition and healt of ruminants fed fresh tempeate forages: a review. Anim Feed Sci Tech 2003;106:3-19. 40. Oliveira SG, Berchielli TT. Potencial da utilização de taninos na conservação de forragens e nutrição de ruminantes - revisão. Arch Vet Sci 2007;12:1-9. 41. Cardoso AR, Carvalho S, Galvani DB, Pires BD, Gasperin CC, Garziera B, Garcia RPA. Comportamento ingestivo de cordeiros alimentados com dietas contendo diferentes níveis de fibra em detergente neutro. Ciência Rural 2006;36:604-609. 42. Missio RL, Brandana IL, Alves Filho DC, et al. Comportamento ingestivo de tourinhos terminados em confinamento, alimentados com diferentes níveis de concentrado na dieta. Rev Bras Zootec 2010;39:1571-1578. 43. Hubner CH, Pires CC, Galvani DB. Comportamento ingestivo de ovelhas em lactação alimentadas com dietas contendo diferentes níveis de fibra em detergente neutro. Ciência Rural, 2008;38:1078-1084. 44. Henz EL, Silva LDF, Bumbieris Junior, VH, et al. Evaluation and characterization of triticale silage (x. Triticosecale wittmack) to replace Sorghum bicolor (L.) Moench (S. vulgare Pers.) silage as feed for beef cattle. Sem Ciências Agrar 2020;4:335-344.

1081


Rev Mex Cienc Pecu 2021;12(4):1061-1082

45. Carvalho GGP, Pires AJV, Silva RR, Ribeiro LSO, Chagas DMT. Comportamento ingestivo de ovinos Santa Inês alimentados com dietas contendo farelo de cacau. Rev Bras Zootec 2008;37:660-665. 46. Bastos VPM, Carvalho PGG, Pires AJV, et al. Ingestive behavior and nitrogen balance of confined Santa Ines lambs fed diets containing soybean hulls. Asian-Aust J Anim Sci 2014;27:24-29.

1082


https://doi.org/10.22319/rmcp.v12i4.5594 Artículo

Efectividad del aceite de canola en dietas de cerdos para mejorar el perfil lipídico de la carne

Soni-Guillermo, Eutiquio ad José Luis Figueroa-Velasco a María Teresa Sánchez-Torres-Esqueda a José Luis Cordero-Mora a Aleida Selene Hernández-Cázares b José Alfredo Martínez-Aispuro a José M. Fernando Copado-Bueno c María Magdalena Crosby-Galván a

a

Colegio de Postgraduados. Campus Montecillo. Programa de Ganadería. Km 36.5 Carretera México-Texcoco. 56230, Montecillo, Texcoco, Estado de México. México. b

Colegio de Postgraduados. Campus Córdoba. Congregación Manuel León, Municipio de Amatlán de los Reyes, Veracruz, México. c

Universidad Autónoma Chapingo. Departamento de Zootecnia. Texcoco, Estado de México, México. d

Benemérita Universidad Autónoma de Puebla. Programa Educativo de Ingeniería Agronómica y Zootecnia. Tlatlauquitepec, Puebla, México.

* Autor de correspondencia: jlfigueroa@colpos.mx

Resumen: El objetivo de este estudio fue determinar el nivel máximo de inclusión de aceite de canola (AC) en dietas para cerdos en finalización, para incrementar el contenido de ácido oleico y ácidos grasos

1083


Rev Mex Cienc Pecu 2021;12(4):1083-1097

insaturados y mejorar la relación Ω6: Ω3 en la carne, sin afectar el comportamiento productivo, características de la canal y fisicoquímicas de la carne. Los tratamientos fueron: la sustitución gradual de aceite de soya (6%) por AC en dietas para cerdos en etapa de finalización I y II (0, 2, 4 y 6% de AC). Las unidades experimentales fueron 48 cerdos machos castrados con peso vivo inicial de 50.00 ± 4.5 kg, evaluados durante cuatro semanas en cada etapa. Con los datos obtenidos se realizó un ANDEVA y se detectaron tendencias lineales o cuadráticas (P≤0.10). En finalización I la ganancia de peso disminuyó con la inclusión de 2% de AC, aunque la incorporación de 2 y 4% de AC no tuvo efecto. En finalización II, un nivel entre 2-4% de AC redujo el consumo de alimento y mejoró la conversión alimenticia (P≤0.05). La adición de AC no modificó las características de la canal y no afectó las características fisicoquímicas de la carne (P≥0.10). El AC en la dieta aumentó la concentración de ácidos grasos monoinsaturados (AGMI) y ácido oleico (P≤0.05); redujo el ácido linoleico (P≤0.03), ácidos grasos poliinsaturados (P≤0.07) y la relación Ω6:Ω3 (P≤0.01). En conclusión, la adición de AC (2-6%) en la dieta de cerdos en finalización incrementa gradualmente el contenido de ácido oleico y de AGMI, además, mejora la relación Ω6:Ω3 en la carne de cerdo, sin afectar las variables productivas y la calidad de la carne. Palabras clave: Comportamiento productivo, características de la canal, perfil de ácidos grasos, ácido oleico.

Recibido: 15/01/2020 Aceptado: 06/01/2021

Introducción La cantidad y la calidad de grasa en la dieta afectan la salud humana(1). La baja ingesta de ácidos grasos saturados (AGS)(2), un alto consumo de ácidos grasos monoinsaturados (AGMI) y de ácidos grasos poliinsaturados (AGPI)(3) se relacionan con aspectos benéficos a la salud humana. Así mismo, el consumo de ácidos grasos (AG) Ω3 representa beneficios potenciales en la salud y prevención de ciertas enfermedades(4); sin embargo, los patrones de alimentación humana han conllevado a un menor consumo, ocasionando una inapropiada relación con los AG Ω6(5). Por otra parte, el consumo de ácido oleico ha mostrado efectos positivos en la salud previniendo enfermedades humanas(6,7). Debido a lo anterior, es importante el consumo de alimentos que permitan mejorar el perfil de ácidos grasos dietarios de las personas(8). La cantidad y composición de los ácidos grasos en la dieta del cerdo se refleja y cambia la composición lipídica en la carne(9). En la nutrición porcina, las prácticas de alimentación típicas (cereales-pasta de soya) le dan una alta proporción de AGPI y una alta relación AG Ω6:Ω3 a la

1084


Rev Mex Cienc Pecu 2021;12(4):1083-1097

carne(10-13). Para cambiar el perfil y mejorar las relaciones entre AG es necesario suministrar componentes alimenticios con un perfil graso afín al objetivo que persigamos(14,15). El uso de aceite de canola (AC) en la dieta de cerdos parece ser una buena fuente lipídica de AGMI y AGPI, debido a que está compuesto principalmente por los ácidos grasos oleico (59.8 %), linoleico (20.6 %), linolénico (8.49 %) y una apropiada relación de AG Ω6: Ω3(16). Sin embargo, una mayor proporción de AGM y AGPI podría tener una influencia negativa en las propiedades tecnológicas de la carne de cerdo y su estabilidad oxidativa, así como en las características sensoriales(1). Algunos trabajos(17,18,19) han explorado la posibilidad de utilizar el AC (2-4 %) en la nutrición porcina como fuente de AG insaturados en la carne, sin afectar el comportamiento productivo y las características fisicoquímicas de la carne. En general, se observa que la inclusión de AC en la dieta aumenta el contenido de ácido oleico, linolénico y AGMI, reduce la concentración de ácido linoleico, AGPI, y mejora la relación Ω6:Ω3 en la carne. Teniendo en cuenta que el perfil de los ácidos grasos ingeridos puede alterar el desarrollo del tejido adiposo del cerdo y depositarse directamente en la grasa corporal, el objetivo de este estudio fue determinar el nivel máximo de inclusión de AC en dietas para cerdos en finalización para incrementar el contenido de ácido oleico, ácidos grasos insaturados y mejorar la relación Ω6:Ω3 en la carne, sin afectar el comportamiento productivo, características de la canal y fisicoquímicas de la carne.

Material y métodos El estudio se realizó en la Unidad Porcina de la Granja Experimental del Colegio de Postgraduados, ubicada en Montecillo, Municipio de Texcoco, Estado de México, localizada a 98º 48’ 27” O y a 19º 48’ 23” N y una altitud de 2,241 msnm, con clima templado subhúmedo con lluvias en verano, temperatura media anual de 15.2 °C y precipitación media anual de 644.8 mm(20).

Animales y dietas experimentales Los tratamientos (Tr) consistieron en la sustitución gradual de aceite de soya (6%) por AC en dietas para cerdos en etapa de finalización I (50-75 kg de peso) y finalización II (75-100 kg de peso): 0, 2, 4 y 6% de AC (Cuadro 1). Las unidades experimentales fueron 48 cerdos híbridos (Landrace×Yorkshire×Pietrain) machos castrados (12 animales por tratamiento en ambas etapas), con peso vivo inicial (PVI) promedio de 50.00 ± 4.5 kg evaluados durante cuatro semanas en cada etapa, distribuidos en un diseño completamente al azar. Los cerdos se alojaron en corrales

1085


Rev Mex Cienc Pecu 2021;12(4):1083-1097

individuales equipados con comedero tipo tolva y bebedero de chupón. Las dietas se formularon con el comando Solver(21), de acuerdo a los requerimientos sugeridos por el NRC(22) para las dos etapas (Cuadro 1). Para la dieta de cerdos de 75 a 100 kg se adicionó ractopamina (10 mg kg-1) en todos los tratamientos, por lo cual se consideró la concentración de nutrientes recomendados por el NRC(22) cuando se utiliza dicho aditivo. Cuadro 1: Dietas experimentales para cerdos en finalización

Sorgo Pasta de soya Salvado de trigo Aceite de soya Aceite de canola Carbonato de calcio Ortofosfato Arena Vitaminas y mineralesA, B Lisina Metionina Sal Treonina Triptófano

Finalización I (aceite de canola %) 0 2 4 62.19 62.49 62.80 14.53 14.48 14.44 10.00 10.00 10.00 6.00 4.00 2.00 0.00 2.00 4.00 0.54 0.54 0.54 0.94 0.94 0.93 4.40 4.14 3.88 0.35 0.35 0.35 0.62 0.62 0.62 0.04 0.04 0.04 0.30 0.30 0.30 0.09 0.09 0.09 0.00 0.00 0.00

EM (Mcal/kg) PC Arginina Lisina Metionina+Cistina Treonina Triptófano Valina Calcio total Fósforo total

Aporte nutricional (%) 3.30 3.30 3.30 14.87 14.88 14.89 0.77 0.77 0.77 0.85 0.85 0.85 0.41 0.41 0.41 0.52 0.52 0.52 0.15 0.15 0.15 0.66 0.66 0.66 0.64 0.64 0.64 0.45 0.45 0.45

Ingrediente (%)

A Proporcionó

6 63.10 14.40 10.00 0.00 6.00 0.55 0.93 3.62 0.35 0.62 0.04 0.30 0.09 0.00

Finalización II (aceite de canola %) 0 2 4 66.19 66.52 66.84 10.08 10.01 9.94 10.00 10.00 10.00 6.00 4.00 2.00 0.00 2.00 4.00 1.01 1.01 1.01 0.21 0.21 0.21 4.65 4.39 4.13 0.35 0.35 0.35 0.70 0.70 0.70 0.09 0.09 0.09 0.30 0.30 0.30 0.20 0.20 0.20 0.22 0.22 0.22

6 67.17 9.87 10.00 0.00 6.00 1.01 0.20 3.87 0.35 0.70 0.09 0.30 0.20 0.22

3.30 14.90 0.77 0.85 0.41 0.52 0.15 0.66 0.64 0.45

3.30 13.50 0.64 0.93 0.42 0.57 0.16 0.56 0.64 0.30

3.30 13.50 0.64 0.93 0.42 0.57 0.16 0.56 0.64 0.30

3.30 13.50 0.64 0.93 0.42 0.57 0.16 0.56 0.64 0.30

3.30 13.50 0.64 0.93 0.42 0.57 0.16 0.56 0.64 0.30

por kilo de alimento: vitamina A, 15,000 UI; vitamina D3, 2,500 UI; vitamina E, 37.5 UI; vitamina K, 2.5 mg; tiamina, 2.25 mg; riboflavina, 6.25 mg; niacina, 50 mg; piridoxina, 2.5 mg; cianocobalamina, 0.0375 mg; biotina, 0.13 mg; cloruro de colina, 563 mg; ácido pantoténico, 20 mg; ácido fólico, 1.25 mg. B Aportó por kg de alimento: Fe, 150 mg; Zn, 150 mg; Mn, 150 mg; Cu, 10 mg; Se, 0.15 mg; I, 0.9 mg; Cr, 0.2 mg.

1086


Rev Mex Cienc Pecu 2021;12(4):1083-1097

Variables de respuesta y características de la canal Las variables de respuesta estudiadas en ambas etapas experimentales fueron: comportamiento productivo (consumo de alimento, CAL; ganancia diaria de peso, GDP; conversión alimenticia, CA; ganancia de carne magra, GCM; y peso vivo final, PVF) y características de la canal (grasa dorsal, GD; porcentaje de carne magra, %CM; área del músculo Longissimus dorsi, AML). La GD y AML se midieron utilizando un ultrasonido de tiempo real (SonoVet 600, Medison, Inc., Cypress, California, USA) al inicio y al final de cada etapa. Con estos datos y con el peso vivo inicial y final se calculó la GCM utilizando la ecuación del National Pork Producers Council(23).

Características fisicoquímicas Al final de la segunda etapa experimental se seleccionaron al azar y sacrificaron cinco cerdos por tratamiento (alrededor de 100 kg de peso vivo). El sacrificio se realizó en el rastro de la granja experimental, cumpliendo con la Norma Oficial Mexicana NOM-033-SAG/ZOO-2014(24). Se obtuvo una muestra de carne de pierna (Bíceps femoris) y una muestra de carne de lomo (Longissimus dorsi) de cada animal, y se procedió a medir pH, color, capacidad de retención de agua y textura. Las muestras de carne se mantuvieron en refrigeración a 4 °C. Parte de las muestras se congelaron, hasta la determinación de ácidos grasos. La determinación del color se midió a las 24 h post mortem, utilizando un colorímetro portátil (Hunter Lab, Chroma meter CR-410, Konica Minolta Sensing, Inc. Japan). Se calibró con el color blanco en tres diferentes puntos sobre el área superficial de la pierna y el lomo del cerdo (en una muestra de carne de 15 mm de espesor) para medir las variables luminosidad (L*), rojo (a*) y amarillo (b*)(25). El pH se midió directamente en el músculo de la pierna (Bíceps femoris) y lomo (Longissimus dorsi) a las 24 h post mortem con un potenciómetro portátil de punción (Modelo pH1100, Hanna® México)(26). La capacidad de retención de agua (CRA)(26) se realizó 24 h post mortem: se pesaron 2 g de carne de pierna y lomo finamente picada, se colocaron en un tubo de centrífuga, se homogeneizaron las muestras con 5 ml de una solución 0.6 M de cloruro de sodio y se agitaron en un vortex (1,000 rpm) durante un minuto. Las muestras se dejaron reposar durante 30 min en un refrigerador a 4 °C y posteriormente se centrifugaron durante 15 min a 3500 g (centrifugadora Beckman J-MI). El sobrenadante fue decantado y medido en una probeta. El volumen retenido de agua destilada se reporta como la cantidad de agua retenida en 100 g de carne. Las mediciones se hicieron por triplicado, las medidas promedio fueron calculadas y registradas.

1087


Rev Mex Cienc Pecu 2021;12(4):1083-1097

La determinación de la textura se realizó 24 h post mortem; se tomaron muestras de carne de pierna y lomo, se utilizó un analizador de textura TA-XT2 (Textura Technologies Corp., Scarsdale, NY) con una navaja de Warner-Bratzler. Se cortaron cubos de carne cruda de 1 cm3, se colocaron con las fibras del músculo transversalmente al filo de la navaja, usando el registro de la fuerza máxima para cortar y la fuerza conocida(27). Las mediciones se hicieron por triplicado, las medidas promedio fueron calculadas y registradas.

Perfil de ácidos grasos El perfil de ácidos grasos en carne se determinó con base al método descrito por Folch et al(28). Para la determinación del perfil de ácidos grasos se utilizó el cromatógrafo HP® (Modelo 6890) estándar de ésteres metílicos Supelco 37 (Component FAME Mix Catalogo N0.47885-U), con una columna Supelco (SPTM- 2660 FUSED SILICA Capillary Column, 100 m x 0.25 mm x 0.2 µm film thickness). Como gas portador se utilizó helio a 0.8 ml/min; la inyección de muestras fue de 1 µl en modo Split 1:10 manualmente, con una rampa de temperatura inicial de 140 °C por 1.00 grado min-1, con un incremento a 3 °C min-1 a una temperatura de 210 °C, y un decremento de 0.7 grados min-1 y una temperatura final de 235 °C. El tiempo total para analizar cada muestra fue de 60 min.

Análisis estadístico Para las dos etapas experimentales se utilizó un diseño completamente al azar, con cuatro tratamientos y doce repeticiones en cada uno, considerando cada cerdo como una unidad experimental para evaluar el comportamiento productivo. Para el perfil de ácidos grasos y características fisicoquímicas de la carne, cinco cerdos de cada tratamiento se seleccionaron al azar al final de la segunda fase experimental. Cuando los cerdos fueron sacrificados, se tomó una muestra de pierna y de lomo de cada animal. Las pruebas de Shapiro-Wilk y Levene se usaron para verificar la distribución normal y la homogeneidad de la varianza de las variables. Con los datos obtenidos se realizó un ANDEVA mediante el procedimiento GLM y para detectar tendencias lineales y cuadráticas en respuesta a la inclusión de aceite de canola en la dieta se usaron polinomios ortogonales (P≤0.10)(29). El PVI se utilizó como covariable para CAL, GDP, PVF, CA y GCM (P≤0.10). Mientras que, para la GD, AML y %CM se utilizaron sus respectivas mediciones iniciales como covariable (P≤0.10).

Resultados Los resultados de respuesta productiva y de características de la canal se muestran en el Cuadro 2. En finalización I (50-75 kg PV) la GDP y el PVF mostraron una tendencia cuadrática (P=0.08),

1088


Rev Mex Cienc Pecu 2021;12(4):1083-1097

disminuyendo con la inclusión de 2% de AC en la dieta; la incorporación de 4 y 6% de AC no tuvo efecto negativo. El resto de las variables en la etapa de finalización I no fueron modificadas debido a la sustitución de aceite de soya por aceite de canola (P>0.10). Para finalización II, el CAL se comportó de manera cuadrática (P=0.03) reduciéndose con un nivel entre 2 y 4% de AC sin afectar la GDP y el PVF, lo que conllevó a que se mejorara la CA (P=0.05) con estos mismos niveles de AC. En finalización II la grasa dorsal se redujo linealmente (P=0.01) y el porcentaje de CM aumentó linealmente (P=0.05) en respuesta a la inclusión de AC en la dieta. Para el resto de las variables no hubo efecto (P>0.10) al sustituir aceite de soya por AC en ambas etapas. Cuadro 2: Comportamiento productivo de cerdos en finalización alimentados con cuatro niveles de aceite de canola en la dieta Finalización I

Finalización II

Aceite de canola (%)

Valor P

Aceite de canola (%)

EE

L

C

0

2

4

6

EE

L

C

2.59

0.10

0.77

0.24

3.06

2.82

2.92

3.08

0.09

0.72

0.03

0.69

0.67

0.02

0.53

0.08

0.84

0.84

0.85

0.81

0.03

0.55

0.52

70.95

72.62

72.30

0.58

0.52

0.08

96.20

96.14

96.51

95.32

0.85

0.54

0.52

3.74

3.97

3.71

3.85

0.13

0.87

0.73

3.64

3.39

3.45

3.90

0.18

0.29

0.05

0.27

0.24

0.26

0.26

0.01

0.62

0.29

0.26

0.27

0.29

0.27

0.01

0.44

0.40

10.61

10.39

10.57

10.77

0.48

0.77

0.66

15.34

14.53

13.78

13.31

0.60

0.01

0.75

AML, cm

28.05

27.19

27.88

27.66

0.72

0.88

0.66

32.72

32.71

33.56

33.58

0.94

0.92

0.61

% CM

39.27

39.33

39.21

39.36

0.28

0.90

0.89

37.01

37.21

37.65

37.59

0.24

0.05

0.62

0

2

4

6

CAL, kg d-1

2.66

2.47

2.54

-1

0.71

0.63

73.41

GDP, kg d PVF CA

GCM, kg d GD, mm 2

-1

Valor P

CAL= consumo de alimento, GDP= ganancia diaria de peso, PVF= Peso vivo final, CA= conversión alimenticia, GCM= ganancia de carne magra, GD=grasa dorsal, AML= área de músculo Longissimus, CM= carne magra, EE= error estándar de la media, L= efecto lineal, C= efecto cuadrático.

Los resultados de las características fisicoquímicas de la carne en pierna y lomo se presentan en el Cuadro 3. Para color, CRA y textura no se encontraron diferencias significativas (P>0.10) por efecto de los niveles de AC, a excepción de L* (P=0.03) que se incrementó en la carne de lomo al utilizar 2-4% de AC. En pierna y lomo, el pH tendió a reducirse (P=0.01) conforme se incrementó la concentración de AC en la dieta. Cuadro 3: Características fisicoquímicas de la carne de cerdos en finalización 75-100 kg, alimentados con cuatro niveles de aceite de canola Carne de pierna

Carne de lomo

Aceite de canola (%)

pH L*

Valor P

Aceite de canola (%)

Valor P

0

2

4

6

EE

L

C

0

2

4

6

EE

L

C

6.74

5.43

5.44

5.70

0.10

0.01

0.01

6.64

5.63

5.49

5.69

0.20

0.01

0.01

45.38

46.54

46.20

47.52

1.60

0.41

0.96

55.98

58.84

56.24

54.10

1.71

0.92

0.03

1089


Rev Mex Cienc Pecu 2021;12(4):1083-1097

a* b* CRA, ml/g Textura, g

19.44 4.36 0.89 1225

19.78 4.54 0.99 1318

19.56 4.00 0.86 1294

19.40 4.94 0.87 1443

0.52 0.53 0.13 155

0.89 0.62 0.96 0.38

0.64 0.49 0.84 0.86

17.24 6.04 0.89 1791

16.86 9.38 0.87 1406

17.62 5.80 0.88 1446

16.84 5.22 0.86 1445

0.51 1.21 0.15 222

0.84 0.28 0.95 0.34

0.70 0.12 0.83 0.39

L*= luminosidad; a*= índice rojo; b*= índice amarillo; CRA= capacidad de retención de agua, EE= Error estándar de la media, L= efecto lineal, C= efecto cuadrático.

En el Cuadro 4 se muestran los resultados del perfil lipídico de la carne de pierna y lomo. En ambas muestras el ácido mirístico (P=0.01) y palmítico (P=0.06 y P=0.01 respectivamente) presentaron una tendencia cuadrática, observándose una reducción con 2% de AC. Tanto en pierna como en lomo se incrementó linealmente la concentración de ácido oleico (P=0.01) y el ácido linoleico se redujo (P=0.03 y P=0.01 respectivamente) en respuesta al incremento del AC dietario. El contenido de ácido linolénico en la carne no fue modificado (P>0.10); sin embargo, la relación Ω6: Ω3 se redujo linealmente (P=0.01) en la carne de pierna al sustituir aceite de soya por AC. El total de AGS en pierna y lomo se redujo (P=0.06 y P=0.01 respectivamente) con 2% de AC, aunque los otros niveles de AC no modificaron la concentración de estos ácidos grasos. En pierna y el lomo los AGMI aumentaron linealmente (P≤0.01) y los AGPI se redujeron (P=0.07 y P=0.01 respectivamente) linealmente por efecto de la inclusión de AC en la dieta. Cuadro 4: Perfil de ácidos grasos de carne de cerdo en finalización, alimentados con cinco niveles de aceite de canola Carne de pierna Ácido graso

Carne de lomo

Aceite de canola (%)

Valor P

Aceite de canola (%)

Valor P

0

2

4

6

EE

L

C

0

2

4

6

EE

L

C

Mirístico

1.99

1.28

1.41

1.79

0.19

0.56

0.01

2.04

1.35

1.51

1.93

0.19

0.84

0.01

Palmítico

24.80

22.37

23.25

23.22

0.65

0.18

0.06

26.17

23.17

24.56

24.39

0.54

0.09

0.01

Esteárico

11.94

10.17

11.24

10.79

0.58

0.37

0.27

12.53

10.67

11.83

11.48

0.60

0.43

0.21

∑AGS

38.73

33.82

35.9

35.8

1.14

0.23

0.06

40.74

35.19

37.9

37.8

1.07

0.17

0.01

Palmitoleico

3.07

3.09

2.67

3.17

0.26

0.92

0.34

3.28

3.31

3.49

3.40

0.20

0.55

0.78

Oleico

39.90

42.07

42.86

45.09

1.13

0.01

0.98

40.49

45.06

45.23

46.45

0.86

0.01

0.07

Eicosaenoico

0.53

0.72

0.68

0.74

0.09

0.11

0.44

0.60

0.69

0.63

0.60

0.06

0.82

0.35

∑AGMI

43.5

45.88

46.21

49.0

1.21

0.01

0.86

44.37

49.06

49.35

50.45

0.94

0.01

0.09

Araquidónico

1.08

1.35

1.28

1.03

0.10

0.79

0.12

0.84

0.93

0.76

0.93

0.13

0.86

0.73

Linoleico

14.75

16.36

14.41

11.63

1.07

0.03

0.05

12.26

12.84

10.39

8.94

1.02

0.01

0.31

Linolénico

1.38

1.83

1.59

1.73

0.15

0.22

0.27

1.33

1.42

1.15

1.21

0.15

0.30

0.87

Eicosadienoico

0.55

0.74

0.60

0.55

0.10

0.77

0.20

0.45

0.53

0.43

0.27

0.11

0.21

0.28

∑AGPI

17.76

20.28

17.88

14.94

1.17

0.07

0.04

14.88

15.72

12.73

11.35

1.19

0.01

0.32

Ω6:Ω3

12.04

10.19

10.54

7.64

0.69

0.01

0.48

10.57

10.22

10.65

8.65

1.21

0.29

0.47

AGS=ácidos grasos saturados, AGMI= ácidos grasos monoinsaturados, AGPI= ácidos grasos poliinsaturados, L=efecto lineal, C=efecto cuadrático.

1090


Rev Mex Cienc Pecu 2021;12(4):1083-1097

Discusión El comportamiento cuadrático de la GDP y el PVF no tiene una explicación clara, ya que, las dietas fueron formuladas isoenergéticas e isoproteicas, suponiendo que los valores de energía y nutrientes en general para cada dieta y fuente de aceite(22) fueron apropiados para la etapa productiva, y por lo tanto se esperaría una respuesta similar en las variables productivas. De acuerdo con algunos autores(10,13,30) al evaluar diferentes fuentes de grasa (aceite de soya, palma, oliva y lino) en dietas isocalóricas para cerdos en finalización, no encontraron efecto negativo en el comportamiento productivo y características de la canal. El cambio en el perfil lipídico de la dieta al sustituir 2% de aceite de soya por AC fue marginal considerando que en las dietas donde no se afectó el comportamiento productivo la sustitución fue de 4 y 6%, modificando en mayor grado el perfil de ácidos grasos. Por lo cual se esperaría un cambio en la respuesta productiva (negativo o positivo) al utilizar una mayor cantidad de AC en la dieta. A diferencia de lo obtenido en la presente investigación, estudios en cerdos en etapa de finalización(19,31,32) reportan que la inclusión de AC (4, 3, 2.5 y 3.5 % respectivamente en cada uno de los trabajos) en sustitución de otros aceites de origen vegetal (soya o maíz) o grasa animal, no afectaron los parámetros productivos, siempre y cuando se respetara la concentración de nutrientes en las dietas, haciendo énfasis principalmente en la energía. Más aún, al evaluar niveles de AC de 0, 5 y 10%, existió un efecto lineal a mejorar el consumo de alimento, ganancia de peso y conversión alimenticia en cerdos de crecimiento-finalización, además no hubo efecto en la grasa dorsal y el AML(33). En el presente trabajo se supuso que, al no alterar la concentración general de nutrientes, pero sí la de algunos ácidos grasos, las características fisicoquímicas de la carne podrían tener alteraciones mínimas. Esta suposición fue respaldada por estudios realizados con la adición de 2.5-4% de AC en la dieta de cerdos sobre las características de la carne, en donde se informa que la inclusión de AC no tuvo efecto negativo(18,19,31). De hecho, otros investigadores(16) encontraron que la inclusión de 2% de AC en la dieta de cerdos aumentó el pH, favoreció las características sensoriales y el marmoleo de la carne, en comparación a dietas sin la adición de aceite. Aunque el uso de concentraciones muy elevadas (10%) de AC en la dieta afectó el marmoleado y el color de la carne, además, redujo la firmeza de grasa(33), probablemente porque ese nivel de adición de aceite en la dieta aporta demasiados ácidos grasos monoinsaturados y poliinsaturados, que se depositan en tejido adiposo y muscular, lo que cambia las características de la carne y de la grasa. En la presente investigación, el aumento de AC redujo el pH, tendiendo a alcanzar los valores de pH máximos y mínimos (5.4-5.8)(34). En este intervalo post rigor de la carne indican que no ha iniciado la producción de compuestos de putrefacción, como aminas biogénicas, aldehídos, cetonas

1091


Rev Mex Cienc Pecu 2021;12(4):1083-1097

y ácidos grasos de cadena corta, ya que el pH depende de la relación tiempo: temperatura postmortem, en consecuencia, se generan compuestos químicos que hacen que aumente el pH(34). La textura en pierna y lomo tampoco se afectó por los diferentes tratamientos, debido probablemente a que los ácidos grasos poliinsaturados de cadena larga se incorporaron al tejido graso y no al muscular, ya que la dureza de la carne se debe a las estructuras de las fibras musculares formadas en un alto porcentaje por proteínas, por lo que los ácidos grasos poliinsaturados no afectaron la dureza de la carne al no incorporarse notablemente lípidos a las fibras musculares(35). Respecto a la variable CRA, de igual manera no se afectó en pierna y lomo por los diferentes tratamientos; esto se explica probablemente porque al adicionar ácidos grasos poliinsaturados de cadena larga a dietas para no rumiantes, existe un aumento en la relación de ácidos grasos saturados:insaturados en la grasa del cerdo, ya que entre mayor sea el grado de insaturación, menor es la cantidad de cargas eléctricas que puedan interactuar con el agua(36). La disminución de los ácidos linoleico y AGPI, y el aumento de ácidos oleico y AGMI conforme se incrementó el nivel de AC, coincide con los resultados obtenidos en otros trabajos al adicionar desde 3 hasta 10% de AC(3,19,33). En reportes previos(3,19,31) no encontraron cambios en el contenido del ácido mirístico y AGS al sustituir algún tipo de aceite por AC, contrario a lo encontrado en el presente estudio; sin embargo, sí se observó la reducción del ácido palmítico al adicionar desde 4 hasta 10% de AC(3,33). La suplementación de 3-4% de AC en sustitución por aceite de soya en dietas para cerdos en etapa de finalización aumentó el contenido de ácidos oleico, linolénico y AGMI, redujo la concentración de ácido linoleico, AGPI, total de Ω6 y la relación Ω6: Ω3 en la grasa de la carne(3,19). Al adicionar 5 o 10% de AC en dietas para cerdos en finalización se incrementaron linealmente los ácidos oleico, linoleico, linolénico, AGMI y AGPI, y se redujo el ácido palmítico en la grasa de la carne en comparación con dietas sin aceite(33). El AC (2.5%) en dietas para cerdos en finalización aumenta el contenido de ácido oleico y AGM, reduce la cantidad de ácido linoleico y AGP en la grasa corporal(31), aumenta el contenido de ácido linolénico y se mejora la estabilidad oxidativa en la carne(17,18,31) en comparación con el aceite de maíz. Otra posible opción para tratar de mejorar el perfil lipídico de la carne de cerdo sería utilizar distintos tipos de aceite, ya que en algunas investigaciones(19,37) han encontrado que la combinación de AC (1-1.5%) con aceite de linaza (1.5-2.3%) tiene una respuesta favorable en el perfil de ácidos grasos en la carne, ya que aumentan los ácidos oleico, linolénico y AGMI, disminuyen los ácidos linoleico, AGPI, total de Ω6 y la relación de Ω6: Ω3. Los resultados del presente trabajo muestran que se modifica el perfil de ácidos grasos en la carne de cerdo en función del contenido de AG en la fuente de aceite de la dieta; ya que el AC y el aceite

1092


Rev Mex Cienc Pecu 2021;12(4):1083-1097

de soya poseen perfiles distintos de ácidos grasos(22) con un predominio de ácidos grasos insaturados oleico y linoleico, respectivamente. En cerdos, el perfil de ácidos grasos de la dieta se refleja en la grasa corporal, porque parte de los ácidos grasos ingeridos se deposita directamente en los tejidos(30,38,39). El grado de cambio de los ácidos grasos corporales depende del tiempo y del porcentaje de suplementación de grasas en la dieta(40,41). Los ácidos grasos específicos tienen diferentes tasas o potencial de cambio en la grasa corporal inducida por la suplementación de grasas en la dieta(12,19,38). Además, el suministro de grasas en la dieta reduce la lipogénesis(42,43), por ende, un aumento de la incorporación de ácidos grasos de la dieta en la grasa corporal.

Conclusiones e implicaciones La inclusión de aceite de canola (2-6%) en la dieta de cerdos en etapa de finalización es efectivo para incrementar proporcionalmente el contenido de ácido oleico, mejorar la relación Ω6:Ω3, reducir el contenido de ácidos grasos saturados e incrementar los ácidos grasos monoinsaturados en la carne. Además, el uso de hasta 6% de aceite de canola en la dieta no afecta el comportamiento productivo, características de la canal y estabiliza positivamente el pH de la carne. Agradecimientos y conflicto de interés Agradecimientos al Colegio de Postgraduados por el financiamiento a este trabajo. Los autores declaran no tener conflicto de interés con respecto al presente trabajo. Literatura citada: 1.

Jasinska K, Kurek A. The effect of oil plants supplementation in pig diet on quality and nutritive value of pork meat. Anim Sci Pap Rep 2017;35(2):137-146.

2.

Clarke R, Frost C, Collins R, Appleby P, Peto R. Dietary lipids and blood cholesterol: Quantitative meta–analysis of metabolic ward studies. Br Med J 1997;314(7074):112-117.

3.

Vehovsky K, Stupka R, Zadinova K, Sprysl M, Okrouhla M, Lebedova N, et al. Effect of dietary rapeseed and soybean oil on growth performance, carcass traits, and fatty acid composition of pigs. R Bras Zootec 2019;48:e20180131.

4.

Saini RK, Keum YS. Omega-3 and omega-6 polyunsaturated fatty acids: Dietary sources, metabolism, and significance- A review. Life Sci 2018;203:255-267.

1093


Rev Mex Cienc Pecu 2021;12(4):1083-1097

5.

Simopoulos AP. Evolutionary aspects of diet, the omega-6/omega-3 ratio and genetic variation: nutritional implications for chronic diseases. Biomed Pharmacother 2006;60(9):502-507.

6.

Sales-Campos H, Reis SP, Crema PB, Santana SJ, Ribeiro CC. An overview of the modulatory effects of oleic acid in health and disease. Mini Rev Med Chem 2013;13(2):201-210.

7.

Karacor K, Cam M. Effects of oleic acid. Medical Sci Discovery 2015;2(1):125-132.

8.

Castellanos L, Rodriguez M. El efecto de omega 3 en la salud humana y consideraciones en la ingesta. Rev Chil Nutr 2015;42(1):90-95.

9.

Skiba G, Polawska E, Sobol M, Raj S, Weremko D. Omega-6 and omega-3 fatty acids metabolism pathways in de body of pigs fed diets with different sources of fatty acids. Arch Anim Nutr 2015;69(1):1-16.

10. Teye GA, Sheard PR, Whittington FM, Nute GR, Stewart A, Wood JD. Influence of dietary oils and protein level on pork quality. 1. Effects on muscle fatty acid composition, carcass, meat and eating quality. Meat Sci 2006;73(1):157-165. 11. Apple JK, Maxwell CV, Galloway DL, Hamilton CR, Yancey JWS. Interactive effects of dietary fat source and slaughter weight in growing-finishing swine: II. Fatty acid composition of subcutaneous fat. J Anim Sci 2009;87(4):1423-1440. 12. Apple JK, Maxwell CV, Galloway DL, Hamilton CR, Yancey JWS. Interactive effects of dietary fat source and slaughter weight in growing-finishing swine: III. Carcass and fatty acid compositions. J Anim Sci 2009;87(4):1441-1454. 13. Benz JM, Tokach MD, Dritz SS, Nelssen JL, DeRouchey JM, Sulabo RC, et al. Effects of choice white grease and soybean oil on growth performance, carcass characteristics, and carcass fat quality of growing-finishing pigs. J Anim Sci 2011;89(2):404-413. 14. Dugan ME, Vahmani P, Turner TD, Mapiye C, Juárez M, Prieto N, et al. Pork as a source of omega-3 (n-3) fatty acids. J Clin Med 2015;4(12):1999-2011. 15. Leikus R, Juskiene V, Juska R, Juodka R, Stankeviciene D, Nainiene R, et al. Effect of linseed oil sediment in the diet of pigs on the growth performance and fatty acid profile of meat. R Bras Zootec 2018;47:e20170104. 16. Kolacz R, Korniewicz A, Dobrzański Z, Bykowski P, Kolacz D, Korniewicz D. Effect of dietary fish and rapeseed oils on sensory and physicochemical characteristics of pigs M. Longissimus dorsi and fatty acid composition. J Anim Feed Sci 2004;13(143):143-152.

1094


Rev Mex Cienc Pecu 2021;12(4):1083-1097

17. Corino C, Magni S, Pagliarini E, Rossi R, Pastorelli G, Chiesa LM. Effects of dietary fats on meat quality and sensory characteristics of heavy pig. Meat Sci 2002;60(1):1-8. 18. Pastorelli G, Magni S, Rossi R, Pagliarini E, Baldini P, Dirinck P, et al. Influence of dietary fat, on fatty acid composition and sensory properties of dry-cured Parma ham. Meat Sci 2003;65(1):571-580. 19. Bertol TM, De Campos RML, Ludke JV, Terra NN, De Figueiredo EAP, Coldebella A, et al. Effects of genotype and dietary oil supplementation on performance, carcass traits, pork quality and fatty acid composition of backfat and intramuscular fat. Meat Sci 2013;93(3):507516. 20. García E. Modificaciones al sistema de clasificación de Köppen. 5a ed. México DF: Instituto de Geografía, Universidad Nacional Autónoma de México; 2004. 21. Microsof Excel. Microsoft Corporation. 1985-2001. Redmond WA, USA. 2007. 22. NRC. National Research Council. Nutrient requirements tables and feed ingredient composition. Nutrient requirements of swine. 11th ed. Washington, DC, USA: National Academy Press; 2012. 23. Burson D, Berg E. Procedures for estimating pork carcass composition. Pork quality facts. Des Moines, IA, USA: National Pork Producers Council; 2001. 24. SAGARPA. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Norma Oficial Mexicana NOM-033-SAG/ZOO-2014. Métodos para dar muerte a los animales domésticos y silvestres. México. 2014. En: https://www.dof.gob.mx/nota_detalle.php?codigo=5405210&fecha=26/08/2015 Consultado 26 Nov, 2019. 25. Mancini RA, Hunt M. Current research in meat color. Meat Sci 2005;71(1):100-121. 26. Braña VD, Ramírez RE, Rubio LMS, Sánchez EA, Torrescano UA, Arenas MML, et al. Manual de análisis de calidad en muestras de carne. 1er ed. Querétaro, México. Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal; 2011. 27. Guerrero LI, Ponce AE, Pérez ML. Curso práctico de tecnología de carnes y pescado. México DF: Universidad Metropolitana, Unidad Iztapalapa; 2002. 28. Folch J, Lees M, Sloane SGH. A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem 1957;226:497-509. 29. SAS. SAS/STAT User’s Guide (9.4) Cary NC, USA: SAS Inst. Inc. 2010.

1095


Rev Mex Cienc Pecu 2021;12(4):1083-1097

30. Olivares A, Daza A, Rey AI, Lopez-Bote CJ. Interactions between genotype, dietary fat saturation and vitamin A concentration on intramuscular fat content and fatty acid composition in pigs. Meat Sci 2009;82(1):6-12. 31. Rossi R, Corino C. Influence of long-term nutrition with different dietary fats on fatty acid composition of heavy pigs backfat. Ital J Anim Sci 2002;1(1):7-16. 32. De Sousa RV, Ribeiro O, Zangeronimo MG, De Sousa VC, Da Silva MSF, Pereira LJ. Total cholesterol and its fractions in the blood of finishing pigs fed diets with different levels of canola oil. Acta Sci Vet 2013;41(1):1-6. 33. Myer RO, Lamkey JW, Walker WR, Brendemuhl JH, Coms GE. Performance and carcass characteristics of swine when fed diets containing canola oil and added copper to alter the unsaturated:saturated ratio of pork fat. J Anim Sci 1992;70(5):1417-1423. 34. Guerrero LI. Meat spoilage detection. In Nollet L, Toldrá F editors. Handbook of processed meat and poultry analysis. Boca Raton, Florida USA: CRC Pres; 2009:445-460. 35. Pérez MI, Larrea V, Quiles A, Llunch MA. Microstructure of muscle foods. In: Nollet L, Toldrá F, editors. Handbook of processed meat and poultry analysis. Boca Raton, Florida USA: CRC Pres; 2009:335-352. 36. Lo Fiego DP, Macchioni P, Santero P, Pastorelli G, Corino CC. Effect of dietary conjugated linoleic acid (CLA) supplementation on CLA isomers content and fatty acid composition of dry-cured Parma ham. Meat Sci 2005;70(2):285-291. 37. Lisiak D, Grzeskowiak E, Borzuta K, Raj S, Janiszewski P, Skiba G. Effects of supplementary vegetable and animal fats on the slaughter values of fatteners, meat quality, and fatty acid profile in pigs. Czech J Anim Sci 2013;58(11):497-511. 38. Apple JK, Maxwell CV, Galloway DL, Hutchison S, Hamilton CR. Interactive effects of dietary fat source and slaughter weight in growing-finishing swine: I. Growth performance and Longissimus muscle fatty acid composition. J Anim Sci 2009;87(4): 1407-1422. 39. Juárez M, Dugan MER, Aldai N, Aalhus JL, Patience JF, Zijlstra RT, et al. Feeding coextruded flaxseed to pigs: Effects of duration and feeding level on growth performance and backfat fatty acid composition of grower-finisher pigs. Meat Sci 2010;84(3):578-584. 40. Romans JR, Wulf DM, Johnson RC, Libal GW, Costello WJ. Effects of ground flaxseed in swine diets on pig performance and on physical and sensory characteristics and omega-3 fatty acid content of pork: II. Duration of 15% dietary flaxseed. J Anim Sci 1995;73(7):1987-1999.

1096


Rev Mex Cienc Pecu 2021;12(4):1083-1097

41. Kouba M, Enser M, Whittington FM, Nute GR, Wood JD. Effect of a high-linolenic acid diet on lipogenic enzyme activities, fatty acid composition, and meat quality in the growing pig. J Anim Sci 2003;81(8):1967-1979. 42. Allee GL, Baker DH, Leveille GA. Influence of level of dietary fat on adipose tissue lipogenesis and enzymatic activity in the pig. J Anim Sci 1971;33(6):1248-1254. 43. Smith DR, Knabe DA, Smith SB. Depression of lipogenesis in swine adipose tissue by specific dietary fatty acids. J Anim Sci 1996;74(5):975-983.

1097


https://doi.org/10.22319/rmcp.v12i4.5904 Artículo

La interfaz suelo-planta en Megathyrsus maximus cv. Mombasa sometida a diferentes dosis de nitrógeno en pastoreo rotacional

Caryze Cristine Cardoso Sousa a Denise Baptaglin Montagner b Alexandre Romeiro de Araújo b Valéria Pacheco Batista Euclides b Gelson dos Santos Difante c Antonio Leandro Chaves Gurgel c* Daniele Lopes de Souza d

a

Federal University of Grande Dourados. Dourados Mato Grosso do Sul, Brazil.

b

Embrapa Beef Cattle. Av. Radio Maia, 830. Zona Rural, 79.106-550. Campo Grande, MS, Brazil. c

Federal University of Mato Grosso do Sul. Faculty of Veterinary Medicine and Animal Science. Campo Grande, Mato Grosso do Sul, Brazil. d

Dom Bosco Catholic University. Campo Grande, Mato Grosso do Sul, Brazil.

* Autor de correspondencia: antonioleandro09@gmail.com

Resumen: Este trabajo tuvo como objetivo evaluar los efectos de tres dosis de nitrógeno (N) en las características morfogénicas y estructurales, la masa (MR) y la distribución de las raíces en el perfil del suelo, y la resistencia del suelo a la penetración de las pasturas de guinea Mombasa manejados con pastoreo rotacional. El diseño experimental utilizó bloques al azar con tres dosis de N (100, 200 y 300 kg ha-1) y tres repeticiones. El criterio para interrumpir el rebrote de los pastos fue la altura de 80 a 90 cm del dosel (90-95 % de intercepción de luz por el dosel). Los animales fueron retirados de los potreros cuando el dosel alcanzó el 50 % de la altura prepastoreo. Se evaluó la masa y acumulación del 1098


Rev Mex Cienc Pecu 2021;12(4):1098-1116

forraje, las características morfogénicas y estructurales del dosel, la MR y distribución en el perfil del suelo, y la resistencia del suelo a la penetración. En pastos fertilizados con 200 y 300 kg ha-1 de N, se observó la mayor aparición foliar (0.090 hojas macollo-1 día-1 y 0.081 hojas macollo-1 día-1), tasas de alargamiento (2.82 y 2.61 cm macollo-1 d-1) y mayor acumulación diaria de forraje (113.8 y 106.6 kg ha-1d-1). El uso de 300 kg ha-1 de N promovió una mayor resistencia del suelo a la penetración a 10 cm de profundidad en el pospastoreo (3.3 MPa). No se observó ningún efecto de las dosis de N en la MR (P>0.05). Por lo tanto, el control de la altura antes y después del pastoreo de los animales en los potreros ayudó a mantener la estructura del pasto y evitar el proceso de compactación del suelo. De acuerdo con los resultados, se concluye que 200 y 300 kg ha-1 de fertilización con N es una estrategia para intensificar los pastos. Palabras clave: Altura del dosel, Tasa de aparición foliar, Intercepción de luz, Masa radicular, Resistencia del suelo.

Recibido: 18/12/2020 Aceptado: 29/03/2021

Introducción Los sistemas de pastoreo intensivo utilizan cultivares con alto potencial de producción forrajera y buen valor nutricional que requieren inversión en fertilización de mantenimiento. Panicum maximum (Sin. Megathyrsus maximus) cv. Mombasa es el cultivar más utilizado debido a su alto macollaje y vigor de rebrote después del pastoreo(1,2). Este cultivar también tiene un potencial de producción que puede superar las 27 t ha-1 por año(3,4) y alcanza valores nutricionales compatibles con ganancias individuales superiores a 700 g por animal día-1(5). Debido a su hábito de crecimiento y potencial productivo, este cultivar debe ser manejado utilizando pastoreo intermitente. Además, el período de descanso debe interrumpirse cuando el dosel del forraje intercepta entre el 90 % y el 95 % de la luz incidente(6) y el retiro de los animales debe ocurrir cuando se haya pastoreado el 50 % del forraje(4,7). La fertilización con nitrógeno (N) mejora la producción de un pasto, ya que actúa directamente sobre las características morfogénicas y estructurales de la planta forrajera(8). El N aumenta la aparición y las tasas de alargamiento de las hojas y reduce la vida útil de las hojas, y el filocrono aún estimula el brote de yemas axilares, aumentando la producción de macollos(9,10). En este sentido, el estudio de la morfogénesis en pastos fertilizados permite comprender los mecanismos fisiológicos del crecimiento de las plantas, así como el papel de N como modulador, regulador y potenciador de este proceso.

1099


Rev Mex Cienc Pecu 2021;12(4):1098-1116

Se ha realizado poca investigación sobre los efectos de N en el sistema radicular de los pastos, especialmente en los trópicos. Sin embargo, se ha demostrado que el N influye en el crecimiento de las raíces en períodos de mayor precipitación(11), lo que puede conducir a un incremento lineal de la masa radicular (MR)(12). La fertilización nitrogenada aumenta la capacidad productiva de un pasto con un aumento significativo de la carga animal(13,14), lo que puede comprometer las características físicas del suelo(15). Queda mucho por investigar con respecto a los efectos del pisoteo animal que resulta de la presión del pastoreo sobre los atributos físicos del suelo, incluida la compactación del suelo y la resistencia a la penetración (RP) del suelo, y el desarrollo de las raíces, ya que la longevidad de un pasto se basa en el balance químico, biológico y físico del suelo. Este último factor determina la capacidad de las raíces para desarrollarse y aprovechar los suelos para absorber agua y nutrientes. Para este trabajo se formularon las siguientes preguntas de investigación: ¿Cómo afecta la fertilización con N a las características morfogénicas, estructurales y a la acumulación de forraje? ¿Los pastos que reciben dosis más altas de N estarán más compactados cuando el método de RP los evalúe? ¿El manejo correcto de los pastos (basado en la IL del 95 %) asociado con una intensidad de pastoreo moderada, podría reducir el efecto de compactación en el desarrollo de las raíces? En busca de respuestas, el objetivo fue evaluar los efectos de la fertilización utilizando tres dosis diferentes de N sobre las características morfogénicas y estructurales, MR y distribución en el perfil del suelo, y la resistencia a la penetración del suelo de los pastos de guinea Mombasa manejados con pastoreo rotacional.

Material y métodos Localización del experimento y monitoreo edafoclimático El experimento se realizó en Embrapa Beef Cattle, Campo Grande, MS (20º27’S, 54º37’O y una altitud de 530 m) de noviembre de 2016 a abril de 2017. Según la clasificación de Köppen, esta región tiene un clima de sabana tropical (Aw) con una distribución estacional de las precipitaciones. La estación meteorológica de Embrapa Beef Cattle, ubicada aproximadamente a 4 km del área experimental, registró la precipitación y las temperaturas mínimas, promedio y máximas (Figura 1).

1100


Rev Mex Cienc Pecu 2021;12(4):1098-1116

Figura 1: La precipitación promedio mensual e histórica y las temperaturas mínimas, promedio y máximas durante el período experimental

El suelo del área experimental está clasificado como Latosol Rojo y tiene un contenido arcilloso de alrededor del 30 %(16). Antes de que iniciara el experimento, el suelo se muestreó en las capas de 0-10, 0-20 y 20-40 cm para la evaluación química (Cuadro 1). Con base en los resultados del análisis de suelo y el sistema de producción propuesto, los pastos fueron fertilizados en cobertura con 80 kg ha-1 de P2O5 y 80 kg ha-1 de K2O en noviembre de 2016. Cuadro 1: Características químicas del suelo del área experimental a profundidades de 0–10, 0–20 y 20–40 cm en pastos de guinea Mombasa fertilizados Dosis (N)

100

200

300

Prof (cm)

pH CaCl2

0–10 0–20 20–40 0–10 0–20 20–40 0–10 0–20 20–40

5.53 5.56 5.47 5.50 5.53 5.33 5.27 5.33 5.42

PM g dm-³ 4.34 3.89 1.47 5.89 4.64 1.87 4.06 3.85 1.33

MO g dm-³ 44.03 42.38 28.38 37.92 37.24 25.62 40.08 39.46 32.64

K

Ca

Mg

Ca+Mg

Al

H

Al+H

S

T

-3

cmol dm 0.43 0.32 0.19 0.38 0.35 0.19 0.41 0.26 0.13

4.08 4.18 2.06 3.87 3.83 2.22 3.45 3.48 2.32

V %

1.18 1.15 0.97 1.17 1.18 1.42 1.10 1.08 0.97

5.27 5.33 3.23 5.03 5.02 3.63 4.55 4.57 3.28

0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

3.47 3.49 3.15 3.25 3.10 2.98 4.25 3.93 3.15

3.47 3.49 3.15 3.25 3.10 2.98 4.25 3.93 3.15

5.69 5.66 3.42 5.42 5.37 3.83 4.96 4.83 3.42

9.16 9.15 6.57 8.66 8.46 6.80 9.21 8.76 6.56

62.17 61.88 51.96 62.54 63.39 56.36 53.93 55.22 52.33

N100 = 100 kg ha-1 por año de N; N200 = 200 kg ha-1 por año de N; y N300 = 300 kg ha-1 por año de N.

Diseño y conducción experimental El área experimental de 13.5 ha se dividió en tres bloques de 4.5 ha cada uno; cada bloque se dividió en tres módulos de 1.5 ha y estos en seis potreros de 0.25 ha. El diseño experimental utilizó bloques completamente al azar, con tres tratamientos y tres repeticiones (módulos). Los tratamientos fueron pastos de guinea Mombasa fertilizados con dosis de 100 (N100), 200 (N200) y 300 (N300) kg ha-1 de N.

1101


Rev Mex Cienc Pecu 2021;12(4):1098-1116

La fertilización con N se dividió en dos aplicaciones para el tratamiento N100 y tres aplicaciones para los tratamientos N200 y N300. La primera dosis de N se aplicó en noviembre, junto con P y K (80 kg ha-1 de P2O5 y 80 kg de K2O). La fuente de N utilizada fue urea, aplicada hasta finales de marzo (temporada lluviosa) y solo cuando los animales abandonaron los potreros. El método de pastoreo utilizado fue el de pastoreo rotacional con una carga animal variable (put-and-take). Se adoptaron alturas de dosel de 80 a 90 cm y de 40 a 50 cm como condiciones pre y pospastoreo(6), respectivamente, para todas las dosis de N evaluadas. Cincuenta y cuatro (54) novillos cruzados de la raza Angus x Nellore, con edad y peso inicial de 10 meses y 300 kg se utilizaron para rebajar los pastos, y no se realizaron evaluaciones de rendimiento para este experimento. Los animales recibieron suplementación mineral ad libitum.

Variables estimadas del dosel forrajero La altura del dosel forrajero (cm), antes y después del pastoreo, se determinó utilizando una regla graduada en 40 puntos aleatorios por potrero. La altura de cada punto correspondió a la altura del dosel alrededor de la regla, y el promedio de estos puntos representó la altura promedio del dosel en cada potrero. Para la estimación de la masa del forraje, antes y después del pastoreo, se eligió al azar un potrero de cada módulo, y se cortaron nueve muestras de 1 m2 cerca del nivel del suelo en cada ciclo de pastoreo(4). El mismo potrero fue muestreado durante todo el período experimental. Las muestras se pesaron y se dividieron en dos submuestras: Una se secó a 65 ºC hasta un peso constante para determinar la materia seca total. La otra se subdividió manualmente en hoja (lámina de la hoja), tallo (vaina y tallo) y material muerto, se secó a 55 ºC hasta un peso constante y se pesó. El porcentaje de cada componente se determinó para estimar la relación hoja:tallo. La tasa de acumulación de forraje se calculó utilizando la diferencia entre la masa de forraje en el prepastoreo actual y el pospastoreo anterior, considerando solo la porción verde (hoja y tallo), dividida entre el número de días entre muestras. La acumulación total de forraje durante el período experimental fue la suma de la acumulación de forraje de todos los ciclos de pastoreo. Al comienzo de cada período de descanso del potrero, se marcaron 10 macollos en cada unidad experimental para determinar las características morfogénicas y estructurales. Los macollos se marcaron en dos potreros por módulo, totalizando 18 potreros (seis potreros por cada dosis de N evaluada). La medición de hojas y macollos individuales permitió evaluar los siguientes factores: tasa de aparición foliar (TAF; hojas macollo-1 dia-1), o el número de hojas por macollo dividido entre el número de días en el período de evaluación; filocrono (días), o el inverso de TAF; tasa de alargamiento foliar (TLF; cm macollo-1 d-1), o la suma del alargamiento de la lámina de la hoja dividida entre el número de días en el período de evaluación; tasa de alargamiento del tallo (TAT; cm macollo-1 d-1), o la suma del alargamiento del tallo dividida entre el número de días en el período de 1102


Rev Mex Cienc Pecu 2021;12(4):1098-1116

evaluación; longitud foliar final (LFF; cm macollo-1), o la longitud media completamente expandida de las láminas de las hojas; tasa de senescencia foliar (TSF; cm macollo-1 d-1), o la relación entre la suma de las longitudes senescentes de las láminas de las hojas en el macollo y el número de días en el período de evaluación; número de hojas verdes (NHV), o el número de hojas en expansión y expandidas, sin tener en cuenta las hojas senescentes de cada macollo; vida útil de la hoja (VUH; días), o el período de tiempo desde la aparición de la hoja hasta su muerte, estimado utilizando la ecuación VUH = NHV x Filocrono(17). La densidad de población de macollos (DPM) se estimó contando los macollos en tres áreas de 1 m2 (número de macollos por m2) por unidad experimental. Las ubicaciones de estos puntos se eligieron para representar la condición promedio del pasto en el momento de la evaluación. Estas áreas se mantuvieron fijas y marcadas con una estaca de madera y se cambiaron solo cuando ya no representaban la condición promedio del pasto. El conteo de macollos se realizó durante la condición previa al pastoreo.

Variables estimadas del suelo La MR seca se evaluó recolectando ocho muestras de dos potreros de cada módulo, utilizando una barrena cilíndrica de 4.8 cm de ancho y 10 cm de alto, del 20 al 24 de marzo de 2017. Se recogieron cuatro muestras debajo de las matas y cuatro fuera de las matas. Cada muestra se submuestreó a profundidades de 0–10, 0–20, 20–30 y 30–40 cm. Las muestras de suelo húmedo + raíz se empacaron en bolsas de plástico identificadas. Las muestras de suelo + raíz se lavaron con agua corriente utilizando tamices con cribas de 2 y 1 mm, separando el suelo de la MR. Las raíces se secaron en un horno de 60 a 65 ºC durante 72 h y luego se pesaron para determinar el contenido de materia seca. Para evaluar la humedad del suelo, se recogió una muestra de suelo deformada por módulo experimental(18). Los valores de humedad del suelo se utilizaron para ajustar los cálculos de MR seca (kg ha-1) y la distribución radicular en el perfil del suelo. La resistencia a la penetración (RP) del suelo se estimó utilizando el Falker PenetroLOG - PLG 1020 (medidor electrónico de compactación del suelo) del 15 de marzo al 17 de abril de 2017. Las evaluaciones de RP se realizaron en 10 posiciones en los dos potreros centrales de cada módulo antes y después del pastoreo. Además, el mismo día en que se completaron las evaluaciones de RP, se recolectaron muestras para determinar la humedad del suelo a profundidades de 0–15, 15–30, 30–45 y 45–60 cm para la posterior corrección de los valores de RP(19).

Análisis estadístico El análisis estadístico de los datos de la masa y la tasa de acumulación de forraje se realizó utilizando un modelo matemático que contenía el efecto de bloque aleatorio y los efectos

1103


Rev Mex Cienc Pecu 2021;12(4):1098-1116

fijos de los tratamientos, las estaciones y las interacciones entre ellos. Para todos los análisis, se utilizó el procedimiento mixto disponible en el Instituto SAS (1996). La comparación de medias se realizó mediante la prueba de Tukey, adoptando una probabilidad del 5 %. En el caso de interacciones significativas, la comparación de medias se realizó utilizando la probabilidad de la diferencia y la prueba de Tukey al 5 %. Los componentes principales (CP) evaluaron los datos relativos a las características morfogénicas y estructurales: el conjunto de datos se estandarizó, lo que significa que cada descriptor presentó media cero y variación unitaria. Este análisis permitió reducir el espacio de las variables originales en un conjunto más pequeño, preservando el máximo de la variabilidad original de los datos. Todos los análisis estadísticos se realizaron utilizando el software R versión 3.6.1. Para MR y RP del suelo, se adoptó un diseño de bloques al azar en un arreglo de parcelas divididas. El efecto residual de las dosis de N se asignó a la parcela y las profundidades a la subparcela. Se utilizó el siguiente modelo: Yijk = μ + Di + Bj + αij + Pk + (D*P)ik + βijk Yijk= valor observado en la dosis i, bloque j y profundidad k; μ= efecto medio general; Di= efecto de la dosis i (i = 100, 200 y 300); Bj= efecto del bloque j; αij= efecto del error aleatorio atribuido a la parcela; Pk= efecto de la profundidad k; (D*P)ik = el efecto de la interacción entre dosis y profundidad; y βijk= error aleatorio asignado a la subparcela. Cuando fue significativo según la prueba F, el efecto de las dosis se analizó mediante la prueba de Tukey y el efecto de las profundidades con la prueba de Scott-Knott, ambas con una probabilidad del 5 %.

Resultados Características morfogénicas y estructurales La fertilización con N200 y N300 promovió la TAF y TLF más altas en comparación con la fertilización con N100 (Figura 2). La TSF fue alta en pastos fertilizados con N100, y fue la misma en pastos fertilizados con N200 y N300 (Cuadro 3). Además, los pastos fertilizados con N100 demostraron la TAT más baja, los pastos fertilizados con N300 la TAT más alta y los pastos fertilizados con N200 una TAT intermedia (Figura 2).

1104


Rev Mex Cienc Pecu 2021;12(4):1098-1116

Figura 2: Las características morfogénicas y estructurales del dosel de pasto guinea Mombasa fertilizado con dosis de nitrógeno (N)

Los valores entre paréntesis indican el error estándar de la media. SER= tasa de alargamiento del tallo (TAT); LAR= tasa de aparición foliar (TAF); LER= tasa de alargamiento foliar (TLF); LLS= vida útil de la hoja (VUH); LSR= tasa de senescencia foliar (TSF); FLL= longitud foliar final (LFF); TPD= densidad de población de macollos (DPM); GLN= número de hojas verdes (NHV); LAI= Índice de área foliar (IAF).

Los pastos fertilizados con N100 también tuvieron la DPM más baja, mientras que los pastos fertilizados con N200 y N300 tuvieron la DPM más alta (Figura 2). La LFF no difirió entre las dosis de N. Los pastos que recibieron N100 revelaron el NHV por macollo más bajo, mientras que los pastos que recibieron N300 revelaron el más alto; la dosis de N200 promovió valores intermedios de NHV. La relación hoja:tallo no difirió por las dosis de N evaluadas. Finalmente, el filocrono y la TSF fueron mayores en pastos fertilizados con N100 y menores en pastos fertilizados con N200 o N300 (Cuadro 2). Cuadro 2: Promedios de filocrono y tasa de senescencia foliar (TSF) en los pastos de guinea Mombasa fertilizados con dosis de N Dosis de N (kg ha-1) Variables 100 200 300 Valor-P a b b Filocrono, días 18.6 11.3 12.9 0.0001 -1 -1 a b b TSF, cm macollo día 1.09 0.72 0.73 0.0001 Letras minúsculas distintas en la misma fila difieren según la prueba de Tukey (P>0.05).

El análisis de CP indicó que sólo dos CP explicaron el 99 % de la variación en el conjunto de datos. El primer CP explicó el 84.2 % de la variación total de los datos y aspectos relacionados con la aparición de los tejidos (Figura 3). En este CP, la TAF se asoció positivamente con la LFF, la TLF, el NHV y la TAT y se asoció negativamente con el filocrono, la VUH y la TSF. Además, la TAF, la LFF, la TLF, el NHV y la TAT indicaron

1105


Rev Mex Cienc Pecu 2021;12(4):1098-1116

una alta asociación con las dosis de N200 y N300. En el segundo CP, que explicó el 15.7 % de la variación de los datos, se observó una asociación positiva entre el filocrono, la VUH, el NHV, la LFF y la TAT y una asociación negativa entre estas variables y la TAF y la TLF. En este CP, el filocrono, la VUH, NHV, LFF y la TAT se asociaron con la dosis de N300 y la TAF y la TLF con la dosis de N200. La TSF demostró neutralidad por dosis de N. Figura 3: Biplot del primer componente principal (eje x) y del segundo componente principal (eje y)

FLL= longitud foliar final (LFF); Phil= filocrono; LAR= tasa de aparición foliar (TAF); LER= tasa de alargamiento foliar (TLF); GLN= número de hojas verdes por macollo (NHV); LSR= tasa de senescencia foliar (TSF); LLS= vida útil de la hoja (VUH); SER= tasa de alargamiento del tallo (TAT).

Altura del dosel, masa y tasa de acumulación de forraje Las alturas pre y pospastoreo se aproximaron a los objetivos predeterminados para las tres dosis de N evaluadas. Los promedios de altura fueron de 81.6 (± 1.61) cm en la condición prepastoreo y de 44.7 (± 1.21) cm en la condición pospastoreo (cuando los animales abandonaron los potreros). Los pastos de guinea Mombasa fertilizados con N300 revelaron la tasa diaria de acumulación de forraje más alta (Cuadro 3) y los períodos de pastoreo y descanso más cortos, mientras que los pastos fertilizados con N100 revelaron los períodos de pastoreo y descanso más largos. Los fertilizados con N200 presentaron valores intermedios.

1106


Rev Mex Cienc Pecu 2021;12(4):1098-1116

Cuadro 3: La tasa de acumulación de forraje; alturas pre y pospastoreo; y promedios de los períodos de pastoreo y descanso en pastos de guinea Mombasa fertilizados Dosis de N (kg ha-1) Variables 100 200 300 Valor-P a ab b Período de pastoreo, días 6.5 (0.16) 5.6 (0.16) 5.1 (0.14) 0.0001 a b c Período de descanso, días 30.9 (0.88) 27.5 (0.84) 24.6 (0.82) 0.0001 -1 -1 c b a TAF, kg ha día 86.2 (3.1) 106.6 (3.8) 113.8 (3.5) 0.0001 abc

TAF= Tasa de acumulación de forraje. Letras minúsculas distintas en la misma fila difieren (P<0.05); los valores entre paréntesis son el error estándar de la media.

La masa del forraje (5,670 ± 121 kg ha-1); hoja (67.9 ± 2.1 %), tallo (17.3 ± 1.3 %), y material muerto (14.8 ± 1.1 %); y relación hoja:tallo (3.9 ± 0.6) no difirieron entre las dosis de N en el prepastoreo. Las dosis de N tampoco afectaron a la masa del forraje y a los porcentajes de hoja, tallo y material muerto en el pospastoreo, con valores medios y sus errores estándar de: 3,544 ± 109 kg ha-1, 67.9 ± 2.1 %, 31.1 ± 1.7, 41.5 ± 3.5 %, para masa del forraje, hoja, tallo y material muerto, respectivamente.

Resistencia mecánica a la penetración del suelo y la masa radicular No se produjo interacción entre las dosis de N y las profundidades del suelo (P=0.1397) para la RP mecánica del suelo. Además, las dosis de N no tuvieron efecto en la RP (P=0.4693), con un promedio de 2.2 ± 0.16 MPa. Sin embargo, en el prepastoreo, se produjo un efecto de profundidad del suelo (P=0.0001) en la PR. La RP más alta se observó en la capa de 10 cm (2.77 ± 0.06 MPa), seguida de las capas de 5-20 cm. Se observaron RP más bajas a mayor profundidad del suelo. En el pospastoreo, se produjo una interacción entre las dosis de N y las profundidades del suelo (P= 0.0001) para la RP (Cuadro 4). Hasta 10 cm de profundidad, se observó una mayor RP en pastos fertilizados con N300 en comparación con los fertilizados con N100 y N200. En la capa de 15 cm, la RP no difirió por las dosis de N. Por el contrario, en las capas de 20-35 cm, la RP fue mayor en los pastos fertilizados con N300 y menor en los pastos fertilizados con N200; los fertilizados con N100 no fueron afectados. Después de 40 cm de profundidad, no se observaron diferencias en la RP entre los niveles de N.

1107


Rev Mex Cienc Pecu 2021;12(4):1098-1116

Cuadro 4: Resistencia mecánica a la penetración (MPa) del suelo sometido a diferentes dosis de nitrógeno (N) en pastos de guinea Mombasa durante el pospastoreo Dosis de N (kg ha-1) Profundidad (cm) 100 200 300 bA bA 5 2.5 2.5 3.4aA 10 2.7bA 2.7bA 3.3aA 15 2.2aB 2.2aB 2.7aB 20 2.5abA 2.1bB 2.9aB 25 2.4abB 1.9bC 2.6aB 30 2.2abB 1.7bC 2.4aC 35 2.1abB 1.6bD 2.2aD 40 1.9aC 1.6aD 2.0aD 45 1.8aC 1.5aD 1.8aE 50 1.6aD 1.5aD 1.7aE 55 1.6aD 1.4aD 1.6aE 60 1.5aD 1.4aD 1.5aE ab

Promedios seguidos de letras minúsculas distintas en la misma fila difieren (P<0.05). AB Letras mayúsculas distintas en la misma columna difieren (P<0.05). Error estándar de la media = 0.102.

No se produjo ningún efecto de interacción entre las dosis de N y las profundidades del suelo para las MR (P>0.05). Además, no se observó ningún efecto de la dosis de N para las MR bajo (2.70 ± 0.595 t/ha de MS) o fuera (1.05 ± 0.230 t/ha de MS) de las matas (P>0.05), que difirieron por las capas muestreadas (Figura 4). Las MR más grandes se observaron en la capa de 0-10 cm, seguidas por la capa de 10-20 cm; las capas de 20-30 y 30-40 cm tuvieron las MR más bajas, sin diferencias entre ellas. La suma de todas las capas muestreadas reveló 10.82 t ha-1 de MS de raíz en el espacio debajo y 4.22 t/ha de MS de raíz fuera de las matas. Figura 4: Masa radicular dentro y entre las matas de pasto guinea Mombasa fertilizados con dosis de nitrógeno

ab

Letras diferentes comparan profundidades en la misma posición según la mata.

1108


Rev Mex Cienc Pecu 2021;12(4):1098-1116

Discusión La fertilización nitrogenada influye en las características morfogénicas y estructurales del dosel del pasto guinea Mombasa(9,10,20). De hecho, se han observado diferentes respuestas a las dosis de N utilizadas. Por ejemplo, las dosis altas de N condujeron a aumentos en TAF y TLF(9,10,21). El nitrógeno también estimula un efecto sistemático sobre el crecimiento de las hojas: a medida que aumenta la nutrición N, la TAF también aumenta. Además, el N aumenta la producción celular en las hojas en crecimiento, alterando la división celular y las tasas de expansión(22) y afectando así a la TLF. Por lo tanto, los pastos fertilizados con N100 tuvieron un alargamiento foliar más prolongado debido a su menor suministro de este nutriente. A medida que N se vuelve más disponible para una planta, su TLF aumenta, aumentando su tamaño final de hoja y, en última instancia, disminuyendo su vida útil(23). Los pastos de guinea Mombasa que recibieron dosis más altas de N (200 y 300 kg ha-1) alcanzaron el objetivo prepastoreo de 80-90 cm más rápidamente que aquellos que recibieron una dosis de N más baja (100 kg ha-1) debido a su filocrono más corto, o el tiempo necesario para que aparezcan dos hojas consecutivas. Las dosis de N más altas pueden haber favorecido la recuperación del aparato fotosintético de las hojas de los pastos guinea Mombasa poco después de la defoliación, reduciendo el filocrono y el tiempo que los pastos necesitaban para recuperarse. Las reducciones en la VUH debido a la fertilización con N requirieron ajustar las prácticas de manejo del pastoreo para cosechar el forraje en el momento apropiado, lo que la evolución de la TAF, la TLF y la TSF puede determinar. Los diferentes períodos de pastoreo y descanso de los pastos resultaron de ajustar el manejo del pastoreo para lograr la condición adecuada de uso del forraje. El uso de N en las estrategias de fertilización favorece el crecimiento y la tasa de acumulación de forraje al aumentar las tasas de reacciones enzimáticas y el metabolismo de las plantas forrajeras(23). A medida que aumenta la acumulación de forraje, también aumenta el índice de área foliar, promoviendo el sombreado de hojas y macollos en la base del pasto(24). En su búsqueda de luz, los tallos se alargan, y las hojas más jóvenes y fotosintéticamente eficientes se exponen en la parte superior del dosel(20,25,26). El manejo del pastoreo con control de la condición del pasto permitió la cosecha de forraje cuando el número de tallos no dañó la estructura del dosel, ya que no se produjo ninguna variación entre los porcentajes de hoja y tallo en el prepastoreo, incluso con diferencias en la TAF, la TAT y la LFF (Figura 2) por las dosis de N evaluadas. Dado que las características morfogénicas del dosel influyen en sus características estructurales(27), se observaron los efectos de las diferentes dosis de N en la mayoría de las variables estructurales. La TAF determina directamente la DPM, ya que cada nueva hoja que emerge representa un fitómero, que está formado por la lámina de la hoja, la

1109


Rev Mex Cienc Pecu 2021;12(4):1098-1116

lígula, la vaina, el nudo, el entrenudo, las yemas axilares y las raíces(28). Cada fitómero puede generar un nuevo macollo, cuya aparición está regulada por la cantidad y calidad de la luz que llega a la base del dosel(29). El mayor número de macollos es, por lo tanto, responsable de la mayor producción de forraje, observada en pastos fertilizados con las dosis más altas de N. Por el contrario, el manejo del pastoreo determina la apertura o el cierre del dosel, lo que influye en las tasas de aparición y mortalidad de macollos(25). Mientras que las hojas verdes por macollo es una variable determinada genéticamente, se observaron 0.73 hojas adicionales macollo-1 en pastos fertilizados con N300 y 0.52 hojas macollo-1 en pastos fertilizados con N200 en comparación con los que recibieron N100. Debido al efecto de N sobre la TAF, el NHV también aumentó(30), expresando el máximo potencial genético de la planta. La LFF y la relación hoja:tallo responden a la intensidad de la defoliación y pueden clasificarse como mecanismos morfológicos de escape que las plantas presentan en respuesta a la defoliación(29). En este experimento, se utilizaron las mismas alturas pre y pospastoreo para todas las dosis de N aplicadas, lo que determinó la misma intensidad de pastoreo, representada por el 50 % de utilización de la altura prepastoreo. Esta intensidad de pastoreo se considera moderada(7) y puede haber contribuido a que la longitud de las hojas no difiera según las dosis de N utilizadas. Durante el período vegetativo, la demanda de N tiende a asociarse linealmente con la TLF, de modo que la absorción de N de lujo ocurre solo después de que una hoja se ha expandido completamente y se origina predominantemente a través de la translocación de las hojas inferiores del dosel(31). Las fertilizaciones con 200 y 300 kg ha-1 año-1 de N tuvieron más probabilidades de satisfacer la demanda de nutrientes y promovieron mayores velocidades de aparición y alargamiento de la forma y los órganos de la planta hasta que se alcanzó la frecuencia de pastoreo determinada por la altura. La fertilización con N de gramíneas tropicales aumenta la acumulación de forraje(32,33,34). Por lo tanto, es esencial ajustar la carga animal por cada dosis de N aplicada para permitir que los animales de pastoreo consuman el forraje producido. Además de la carga animal, los períodos de pastoreo y descanso difirieron por las dosis de N, lo que refleja las diferentes tasas de crecimiento del forraje debido a la disponibilidad de N para las plantas. Los pastos que recibieron la dosis más baja de N (100 kg ha-1 año-1) necesitaron 6.3 días más de descanso que aquellos que recibieron la dosis más alta de N (300 kg) y 3.4 más que los que recibieron la dosis intermedia de N (200 kg). Se realizaron ajustes en el manejo del pastoreo para mantener las alturas objetivo pre y pospastoreo, independientemente de la dosis de N aplicada; por lo tanto, la masa del forraje y el porcentaje de los componentes del pasto fueron similares para las tres dosis de N aplicadas. La intensidad del pastoreo se controló satisfactoriamente, manteniendo la condición de dosel. Por el contrario, la diferente acumulación de forraje para las tres dosis 1110


Rev Mex Cienc Pecu 2021;12(4):1098-1116

de N determinó la frecuencia de pastoreo, reflejándose en los períodos de descanso. El control de altura pre y pospastoreo permitió aprovechar el aumento de la acumulación de biomasa que proporciona la fertilización con N. La dosis más alta de N (300 kg ha-1 año-1) produjo la mayor acumulación de forraje, con períodos de pastoreo y descanso más cortos para los pastos. Por lo tanto, una mayor acumulación de forraje demandó una mayor carga animal para que se pudiera alcanzar el objetivo pospastoreo (40-50 cm), lo que se reflejó en el aumento de la presión de pastoreo. Los aumentos de la carga animal y la presión de pastoreo que resultan de la intensificación (fertilización con N) están fuertemente relacionados con la compactación del suelo en pastos(35,36) debido a la presión que ejercen los cascos de los animales. La intensidad de esta presión depende de la masa corporal, el área de las pezuñas y la energía cinética ejercida sobre los suelos(15), aumentando la densidad del suelo debido a las cargas y la presión aplicada. La RP está directamente relacionada con la carga animal(37), que fue un factor determinante en el aumento de la RP en los pastos que recibieron N300 en el período pospastoreo. En particular, en las capas superficiales del suelo (0-10 cm), se concentra la mayoría de las raíces del pasto(38,39). Por lo tanto, una RP superior a 2.5 MPa a estas profundidades puede limitar el desarrollo de las raíces(37,40). Aunque los pastos que recibieron N300 indicaron valores de RP superiores a 2.5 MPa en las capas de 0–10 cm de profundidad en el período pospastoreo, la carga animal que proporcionaron las diferentes fertilizaciones con N no parece haber afectado a la MR. Este hallazgo indica que el método de pastoreo intermitente que utiliza la técnica de putand-take, que implica el uso de un número variable de animales para el ajuste de la carga(41), podría controlar eficientemente la presión de pastoreo, manteniéndola dentro de lo que se considera ideal. Además, los pastos demostraron un excelente vigor de rebrote y una alta acumulación de forraje a pesar de los valores de RP que podrían estar impidiendo el desarrollo de los pastos. La compactación reduce los poros del suelo cuando los poros más grandes se pierden o reducen de tamaño(42); sin embargo, los pastos parecen ajustar el diámetro de sus raíces para llenar espacios porosos en su búsqueda de agua y nutrientes(43). Por lo tanto, el alargamiento de las raíces durante esta búsqueda parece tener una función de desempaque del suelo durante el rebrote de los pastos, lo que justifica la ausencia del efecto de N en la RP del suelo en el período prepastoreo. Si bien algunas investigaciones sugieren que se produce una reducción en la MR de los pastos forrajeros debido al aumento de las dosis de N, incluso en períodos con mayor precipitación(11,44), esta investigación determinó que el criterio de manejo adoptado (alturas de 80–90 cm prepastoreo y 40–50 cm pospastoreo) podría garantizar el rebrote y el mantenimiento de la acumulación de forraje sin comprometer el sistema radicular. De hecho, el índice de área foliar restante (después del pastoreo) tiene una relación importante con la MR, de modo que intensidades de defoliación más severas pueden 1111


Rev Mex Cienc Pecu 2021;12(4):1098-1116

reducir la MR y el crecimiento(12,45). En este experimento, la intensidad de la defoliación se consideró moderada (se eliminó el 50 % de la parte aérea de la planta) y dentro de los límites de resistencia al pastoreo considerados ideales para el uso de la planta(46), lo que significa que el índice de área foliar restante podría garantizar el restablecimiento completo de las partes aéreas y radiculares de la planta.

Conclusiones e implicaciones La fertilización nitrogenada influye en el crecimiento de los pastos de guinea Mombasa, así como en sus características morfogénicas y estructurales. Tales cambios afectan la resistencia a la penetración de las raíces al suelo, lo que puede promover la compactación del suelo si el manejo del pastoreo no se controla estratégicamente. El control de altura pre y pospastoreo es una alternativa de manejo que permite no solo mantener la estructura del dosel, sino también evitar el proceso de compactación, preservando la materia seca de las raíces en el suelo, independientemente del nivel de intensificación. Agradecimientos A la Coordinación de Perfeccionamiento de Personal de Nivel Superior (CAPES, por sus siglas en portugués) por el incentivo financiero – Código de Financiamiento 001. El apoyo de la Universidad Federal de Grande Dourados (UFGD), el Consejo Nacional de Desarrollo Científico y Tecnológico (CNPq) y la Embrapa Gado de Corte. Literatura citada: 1.

Veras ELL, Difante, GS, Gurgel ALC, Costa ABG, Rodrigues JGR, Costa CM, et al. Tillering and structural characteristics of Panicum cultivars in the Brazilian Semiarid Region. Sustainability 2020;12(9):3849.

2.

Montagner DB, Nascimento Júnior D, Vilela HH, Sousa BML, Euclides VPB, Silva SC, et al. Tillering dynamics in pastures of guinea grass subjected to grazing severities under intermittent stocking. R Bras Zootec 2012;41(3):544-549.

3.

Da Silva SC, Bueno AAO, Carnevalli RA, Uebele MC, Bueno FO, Hodgson J, et al. Sward structural characteristics and herbage accumulation of Panicum maximum cv. Mombasa subjected to rotational stocking managements. Sci Agric 2009;66(1):8-19.

4.

Euclides VPB, Carpejani GC, Montagner DB, Nascimento Junior D, Barbosa RA, Difante GS. Maintaining post-grazing sward height of Panicum maximum (cv. Mombasa) at 50 cm led to higher animal performance compared with post-grazing height of 30 cm. Grass Forage Sci 2018;73(1):174-182.

5.

Escarela CM, Pietroski M, Prado RM, Campos CSN, Caione G. Effect of nitrogen fertilization on productivity and quality of Mombasa forage (Megathyrsus maximum cv. Mombasa). Acta Agron 2017;66(1):42-48.

1112


Rev Mex Cienc Pecu 2021;12(4):1098-1116

6.

Alvarenga CAF, Euclides VPB, Montagner DB, Sbrissia AF, Barbosa RA, Araújo AR. Animal performance and sward characteristics of Mombasa guineagrass pastures subjected to two grazing frequencies. Trop Grassl-Forrajes Trop 2020; 8(1):1-10.

7.

Fonseca L, Carvalho PCF, Mezzalira JC, Bremm C, Galli JR, Gregorini P. Effect of sward surface height and level of herbage depletion on bite features of cattle grazing Sorghum bicolor swards. J Anim Sci 2013;91(9):4357-4365.

8.

Cruz P, Boval M. Effect of nitrogen on some morphogenetic traits of temperate and tropical perennial forage grasses. In: Lemaire G, et al, editors. Grassland ecophysiology and grazing ecology. 1rst ed. Wallingford, UK: CABI Publishing; 2000:151-168.

9.

Braz TGS, Fonseca DM, Freitas FP, Martuscello JA, Santos MER, Santos MV. et al. Morphogenesis of Tanzania guinea grass under nitrogen doses and plant densities. R Bras Zootec 2011;40(7):1420-1427.

10. Martuscello JA, Silva LP, Cunha DNFV, Batista ACS, Braz TGS, Ferreira PS. Adubação nitrogenada em capim-massai: Morfogênese e produção. Cienc Anim Bras 2015;16(1):1-13. 11. Giacomini AA, Mattos WT, Mattos HM, Werner JC, Cunha EA, Carvalho DD. Crescimento de raízes dos capins aruana e tanzânia submetidos a duas doses de nitrogênio. R Bras Zootec 2005;34(4):1109-1120. 12 Gomide CAM, Paciullo DSC, Morenz MJF, Costa IA, Lanzoni CL. Productive and morphophysiological responses of Panicum maximum Jacq. cv. BRS Zuri to timing and doses of nitrogen application and defoliation intensity. Grassl Sci 2019; 65(2):93-100. 12. Costa MAT, Tormena CA, Lugão SMB, Fidalski J, Nascimento WG, Medeiros FM. Resistência do solo à penetração e produção de raízes e de forragem em diferentes níveis de intensificação de pastejo. R Bras Ci Solo 2012;36(1):993-1004. 14. Barbosa LF. Acúmulo de forragem e desempenho animal em pastos de capimmombasa sob doses de nitrogênio e pastejo intermitente [tesis maestría]. Brasil, MS: Universidade Federal da Grande Dourados; 2018. 15. Greewood KL, Mckenzie BM. Grazing effects on soil physical properties and the consequences for pastures: a review. Aust J Exp Agric 2001;41(8):1231-1250. 16. EMBRAPA. Empresa Brasileira de Pesquisa Agropecuária. Sistema Brasileiro de Classificação de Solos. 3th ed. Rio de Janeiro, Brasil: Centro Nacional de Pesquisa de solo; 2013.

1113


Rev Mex Cienc Pecu 2021;12(4):1098-1116

17. Lemaire G, Chapman D. Tissue flows in grazed plant communities. In: Hodgson J, Illius AW, editors. The ecology and management of grazing systems. 1rst ed. Wallingford, UK: CABI Publishing; 1996:3-29. 18. EMBRAPA. Empresa Brasileira de Pesquisa Agropecuária. Manual de métodos de análise de solo. 3th ed. Rio de Janeiro, Brasil: Centro Nacional de Pesquisa de solo; 2017. 19. Busscher WJ, Bauer PJ, Campa CR, Sojka RE. Correction of cone index for soil water content differences in a coastal plain soil. Soil Tillage Res 1997;43(3-4):205– 217. 20. Basso KC, Cecato U, Lugão SMB, Gomes JAN, Barbero LM, Mourão GB, et al. Morfogênese e dinâmica do perfilhamento em pastos de Panicum maximum Jacq. cv. IPR-86 Milênio submetido a doses de nitrogênio. Rev Bras Saúde Prod An 2010; 11(4):976-989. 21. Farias LN, Zanine AM, Ferreira DJ, Ribeiro MD, Souza AL, Geron LJV, et al. Effects of nitrogen fertilization and seasons on the morphogenetic and structural characteristics of Piatã (Brachiaria brizantha) grass. Rev Fac Cienc Agrar 2019; 51(2):42-54. 22. Gastal F, Lemaire GN. Uptake and distribution in crops: An agronomical and ecophysiological perspective. J Exp Bot 2002;53(370):789-799. 23. Vitor CMT, Fonseca DM, Cóser AC, Martins CE, Nascimento Júnior D, Ribeiro Júnior JI. Produção de matéria seca e valor nutritivo de pastagem de capim-elefante sob irrigação e adubação nitrogenada. R Bras Zootec 2009;41(3):565-573. 24. Brougham RW. Effect of intensity of defoliation on regrowth of pasture. Aust J Agric Res 1956;7(5):377-387. 25. Difante GDS, Nascimento Júnior D, Silva SC, Euclides VPB, Zanine AM, Adese B. Tillering dynamics of marandu palisadegrass submitted to two cutting heights and three cutting intervals. R Bras Zootec 2008;37(2):189-196. 26. Pereira LET, Paiva AJ. Geremia EV, Silva SC. Components of herbage accumulation in elephant grass cvar Napier subjected to strategies of intermittent stocking management. J Agric Sci 2014;152(6):954-966. 27. Difante GS, Nascimento Júnior D, Silva SC, Euclides VPB, Montagner DB, Silveira MCT, et al. Características morfogênicas e estruturais do capim-marandu submetido a combinações de alturas e intervalos de corte. R Bras Zootec 2011;40(5):955-963. 28. Nelson CJ. Shoot morphological plasticity of grasses: leaf growth vs. tillering. In: Hodgson J, Illius AW, editors. The ecology and management of grazing systems. 1rst ed. Wallingford, UK: CABI Publishing; 1996:101-126.

1114


Rev Mex Cienc Pecu 2021;12(4):1098-1116

29. Gastal F, Lemaire G. Defoliation, shoot plasticity, sward structure and herbage utilization in pasture: review of the underlying ecophysiological processes. Agriculture 2015;5(4):1146-1171. 30. Garcez Neto AF, Nascimento Junior D, Regazzi AJ, Fonseca DM, Mosquim PR, Gobbi KF. Respostas morfogênicas e estruturais de Panicum maximum cv. Mombasa sob diferentes níveis de adubação nitrogenada e alturas de corte. R Bras Zootec 2002; 31(5):1890-1900. 31. Lemaire G, Oosterom EV, Sheehy J, Jeuffroy MH, Massignam A, Rossato L. Is crop N demand more closely related to dry matter accumulation or leaf area expansion during vegetative growth? Field Crops Res 2007;100(1):91-106. 32. Alderman PD, Boote KJ, Sollenberger LE. Regrowth dynamics of “tifton 85” bermudagrass as affected by nitrogen fertilization. Crop Sci 2011;51(4):1716-1726. 33. Fagundes JL, Moreira AL, Freitas AWP, Augusto ZontaI; Henrichs R, Rocha FC, et al. Capacidade de suporte de pastagens de capim-tifton 85 adubado com nitrogênio manejadas em lotação contínua com ovinos. R Bras Zootec 2011;40(12):2651-2657. 34. Carvalho RM, Alves LC, PHM Rodrigues PHM, Souza WD, Ávila AB, Santos MER. Acúmulo de forragem e estrutura do dossel de Capim-Marandu diferido e adubado com nitrogênio. Bol Ind Anim 2017;74(1):1-8. 35. Bertol I, Almeida JA, Almeida EX, Kurtz C. Propriedades físicas do solo relacionadas a diferentes níveis de oferta de forragem de capim-elefante-anão cv. Mott. Pesq Agropec Bras 2000;35(5):1047-1054. 36. Leão TP, Silva AP, Macedo MCM, Imhoff S, Euclides VPB. Least limiting water range: A potential indicator of changes in near-surface soil physical quality after the conversion of Brazilian Savanna into pasture. Soil Tillage Res 2006;88(1–2):279285. 37. Leão TP, Silva AP, Macedo MCM, Imhoff S, Euclides VPB. Least limiting water range in the evaluation of continuous and short-duration grazing systems. R Bras Ci Solo 2004;28(3):415-422. 38. Beloni T, Piotto VC, Mari GC, Pinheiro AA, Tormena CA, Cecato U. Root system and resistance to penetration of Mombaça grass fertilized with nitrogen and irrigated. Semin Cienc Agrar 2016;37(5):3243-3252. 39. Gurgel ALC, Difante GS, Araujo AR, Montagner DB, Euclides VPB, Silva MGP. Carbon and nitrogen stocks and soil quality in an area cultivated with guinea grass under the residual effect of nitrogen doses. Sustainability 2020;12(22):3849. 40. Imhoff S, Silva AP, Tormena CA. Aplicações da curva de resistência no controle da qualidade física de um solo sob pastagem. Pesq Agropec Bras 2000;35(7):14931500. 1115


Rev Mex Cienc Pecu 2021;12(4):1098-1116

41. Allen VG, Batello C, Berretta EJ, Hodgson J, Kothmann M, Li X, et al. An international terminology for grazing lands and grazing animals. Grass Forage Sci 2011;66(1):2–28. 42. Dexter AR. Soil physical quality: Part I. Theory, effects of soil texture, density, and organic matter, and effects on root growth. Geoderma 2004;120(3-4):201–214. 43. Huot C, Zhou Y, Philp JNM, Denton MD. Root depth development in tropical perennial forage grasses is related to root angle, root diameter and leaf area. Plant Soil 2020;456(1-2):145-158. 44. Sarmento P, Rodrigues LRA, Lugão SMB, Cruz MCP, Campos FP, Ferreira ME, et al. Sistema radicular do Panicum maximum Jacq. cv. IPR-86 Milênio adubado com nitrogênio e submetido à lotação rotacionada. R Bras Zootec 2008;37(1):27-34. 45. Guo YJ, Han L, Li GD, Han JG, Wang GL, Li ZY, et al. The effects of defoliation on plant community, root biomass and nutrient allocation and soil chemical properties on semi-arid steppes in northern China. J Arid Environ 2012;(78):128134. 46. Da Silva S, Sbrissia A, Pereira L. Ecophysiology of C4 forage grasses-understanding plant growth for optimizing their use and management. Agriculture 2015;5(3):598625.

1116


https://doi.org/10.22319/rmcp.v12i4.5645 Artículo

Relación entre la resistencia a antibióticos y la producción de biofilm de aislados de Staphylococcus aureus provenientes de mastitis bovina

Jaquelina Julia Guzmán-Rodríguez a,b Estefanía Salinas-Pérez b Fabiola León-Galván a,c José Eleazar Barboza-Corona a,c Mauricio Valencia-Posadas a,b Fidel Ávila-Ramos a,b José Antonio Hernández-Marín a,b Diana Ramírez-Sáenz d Abner Josué Gutiérrez-Chávez a,b*

a

Universidad de Guanajuato. Campus Irapuato-Salamanca. División de Ciencias de la Vida, Programa de Posgrado en Biociencias. Km. 9.0 Carr. Irapuato-Silao, El Copal, Irapuato, 36821, Guanajuato, México. b

Universidad de Guanajuato. Campus Irapuato-Salamanca. División de Ciencias de la Vida, Departamento de Medicina Veterinaria y Zootecnia. c.

Universidad de Guanajuato. Campus Irapuato-Salamanca. División de Ciencias de la Vida, Departamento de Alimentos. México. d

Consultoría en Biotecnología, Bioingeniería y Servicios Asociados, SA de CV. México.

*Autor de correspondencia: ajgutierrez@ugto.mx

Resumen: El objetivo fue analizar la relación entre el perfil de resistencia a antibióticos y la formación de biofilm de aislados de S. aureus provenientes de mastitis bovina. Se analizaron 30 aislados

1117


Rev Mex Cienc Pecu 2021;12(4):1117-1132

de S. aureus procedentes de casos de mastitis subclínica en granjas lecheras en sistemas de producción semi-intensivo y de traspatio ubicadas en los estados de Guanajuato y Michoacán, México. Se realizó un antibiograma por el método de difusión en disco Kirbi Bauer. La formación de biofilm se determinó por el método de tinción con cristal violeta. Para la evaluación de genes de resistencia a antibióticos y de formación de biofilm se obtuvo ADN genómico de una colonia para la identificación de los genes: blaZ, mecA, tetK, tetM, gyrA y gyrB, y icaA e icaD. Los resultados mostraron que el 100 % de los aislados fueron resistentes a penicilina y dicloxacilina, seguidos por cefotaxima (86.6 %), ampicilina y cefalotina (83.3 %) y ceftazidima (80.0 %), mientras que se observó un 36.6 % de resistencia a oxacilina. Se identificó que todos los aislados de S. aureus presentaron la capacidad de formar biofilm con un rango del 20 a 98 %. Se observó además que los aislados con una multirresistencia elevada presentaron una mayor formación de biofilm; estableciéndose una correlación positiva significativa. En conclusión, los aislados de S. aureus provenientes de mastitis bovina presentaron elevados niveles de resistencia a antibióticos; así como una importante capacidad formadora de biofilm, demostrando la existencia de una correlación positiva entre estos dos factores. Palabras clave: Antibióticos, Mastitis, ADN, Biofilm.

Recibido: 20/03/2020 Aceptado: 12/03/2021

Introducción El procesamiento de la leche bovina es un sector de suma importancia en la industria ganadera, en México, se estimó una producción superior a los 12 millones de toneladas en el 2019(1), lo que lo ubica dentro de los primeros diez países productores de leche a nivel mundial(1). Uno de los principales objetivos de una granja lechera debería ser tener una producción eficiente de leche y que ésta sea saludable y libre de contaminantes, por lo que es esencial que la glándula mamaria esté saludable(2). En este sentido, la mastitis es la enfermedad más común y costosa en el ganado bovino lechero, ya que afecta el bienestar de la vaca y causa problemas económicos por pérdidas en producción, disminución de calidad y cantidad de leche, eliminación prematura de la vaca, costo de tratamiento veterinario y el descarte de la leche debido a la contaminación con antibiótico(3,4). Staphylococcus aureus es un patógeno ubicuo que causa una variedad de infecciones en humanos y animales y es uno de los principales agentes causales de la mastitis bovina(5,6). Esta bacteria Grampositiva produce infecciones crónicas, persistentes y recurrentes, ya que es capaz de superar todas las barreras del sistema de defensa del huésped, debido a que posee un amplio espectro de factores de virulencia como la producción de enzimas, antígenos, 1118


Rev Mex Cienc Pecu 2021;12(4):1117-1132

adhesinas y toxinas, entre otros(7). Estos factores de virulencia eventualmente le confieren a la bacteria la multirresistencia a los antibióticos y la formación de biopelículas (“biofilm”)(8). El biofilm es un consorcio de microorganismos que se encuentra embebido dentro de una matriz polimérica, constituida principalmente por exopolisacaridos, proteínas y ácidos nucleicos, que le permite a la bacteria adherirse a una superficie biótica o abiótica(9). La formación de biofilm es una estrategia de vida para la mayoría de las bacterias, ya que ésta les brinda estabilidad, desempeña funciones catalíticas, aumenta las posibilidades de transferencia de material genético y la resistencia a los antibióticos, participa en los procesos de comunicación celular y ofrece protección para sobrevivir a las condiciones adversas y variables del ambiente; lo que contribuye a su colonización exitosa en el hospedador(10). La multirresistencia a antibióticos y la formación de biofilms son características de virulencia que se encuentran relacionadas entre sí de manera importante. En este sentido, se sabe que el biofilm formado por S. aureus aumenta significativamente la resistencia a los antibióticos, al inhibir la penetración del antimicrobiano lo que resulta en una situación cada vez más grave en el combate terapéutico de este microorganismo(11). Actualmente nuestro grupo cuenta con una colección de aislados de S. aureus provenientes de mastitis bovina que fueron colectados en los estados de Guanajuato y Michoacán, México, los cuales han presentado niveles de multirresistencia a antibióticos muy elevados (70 a 100 %)(12), lo que es congruente con la poca eficiencia en las terapias utilizadas en las unidades de producción de la región. Lamentablemente, en México hasta el momento no se ha evaluado la capacidad que tienen dichas bacterias causantes de mastitis bovina, para formar biofilms; y su posible relación con los niveles de resistencia a antibióticos. Con base en lo anterior, el objetivo del presente trabajo fue analizar si existe correlación entre el perfil de resistencia a antibióticos y la formación de biofilm de los aislados de S. aureus provenientes de mastitis bovina.

Material y métodos Asilamiento de S. aureus Se analizaron 30 aislados de S. aureus procedentes de casos de mastitis subclínica de vacas localizadas en granjas lecheras ubicadas en localidades de los estados de Guanajuato y Michoacán, México, las cuales utilizan sistemas de producción semi-intensivo y de traspatio. El muestreo, aislamiento y caracterización de los aislados ya fue reportado por Varela et al en 2018(12).

1119


Rev Mex Cienc Pecu 2021;12(4):1117-1132

Perfil de multirresistencia a antibióticos Se realizó un antibiograma por el método de difusión en disco Kirbi Bauer(13), utilizando sensidiscos de la marca Biorad® con los siguientes antibióticos y concentraciones: penicilina (PE) 6 µg, oxacilina (Oxa) 6 µg, dicloxacilina (DC) 30 µg, pefloxacina (PEF) 5 µg, cefuroxima (CXM) 30 µg, gentamicina (GE) 120 µg, cefotaxima (CTX) 30 µg, sulfametoxazol + trimetoprima (SXT) 1.25 y 23,75 µg, tetraciclina (TE) 30 µg, ampicilina (AM) 10 µg, eritromicina (E) 15 µg, ceftazidima (CAZ) 30 µg y cefalotina (CF) 30 µg. Los resultados se reportan como sensible, intermedio y resistente con base en los parámetros establecidos en Performance Standards for Antimicrobial Susceptibility Testing, 2019(14). Una vez establecido el perfil de resistencia, los 30 aislados se clasificaron como se describe a continuación: Grupo 1: Resistencia alta (resistentes a 11-13 antibióticos), Grupo 2: Resistencia media (9-10 antibióticos), Grupo 3: Resistencia baja (4-8 antibióticos).

Formación de biofilm Para medir la capacidad formadora de biofilm de los aislados de S. aureus, se utilizó el protocolo de tinción con cristal violeta(11), como se describe a continuación: se cultivó el aislado bacteriano en medio LB y se incubó 24 h a 37 ⁰C. Los ensayos se realizaron en placas estériles de 96 pozos y se colocaron ≈ 1 x 106 UFC en un volumen final de 100 µl en cada pozo. Los aislados se incubaron 48 horas a 37°C. Una vez transcurrido el tiempo de incubación, se descartó el sobrenadante, se lavaron los pozos con 100 µl de solución PBS (137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4 y 2 mM KH2PO4) y se secaron los pozos. Posteriormente, a cada pozo se adicionaron 100 µl de solución de cristal violeta (0.5% peso/volumen) y se dejó reposar 15 min. Después se eliminó el colorante y se lavó dos veces con 100 µl de PBS. Después se adicionaron 125 µl de etanol al 95% (volumen/volumen) y se resuspendió vigorosamente para disolver el colorante. Se tomó la lectura de la absorbancia a 495 nm en un analizador de microelisa ELIREAD (Kontrolab®, Guidonia, Italia). Una vez obtenidos los datos, se graficó el porcentaje de formación de biofilm utilizando como 100 % la absorbancia registrada de la cepa certificada de S. aureus (ATCC 27543). Se realizaron tres experimentos independientes con tres repeticiones.

Análisis de los genes de resistencia y formación de biofilm La presencia de genes relacionados con la resistencia a antibióticos y formación de biofilm se realizó a partir del ADN genómico, el cual se obtuvo picando una colonia bacteriana de una placa de cultivo fresco, para posteriormente colocarla en la mezcla de reacción de PCR. Los oligonucleótidos utilizados en este estudio se muestran en el Cuadro 1. La reacción se

1120


Rev Mex Cienc Pecu 2021;12(4):1117-1132

realizó en un volumen final de 20 µl que contenía oligonucleótidos 0.4 µM, desoxinucleótidos trifosfatos 200 µM (Invitrogen, Carlsbad, California, Estados Unidos), cloruro de magnesio 2 mM (Invitrogen, Invitrogen, Carlsbad, California, Estados Unidos) y 1 U de Taq polimerasa (Invitrogen, Invitrogen, Carlsbad, California, Estados Unidos). Las condiciones de amplificación fueron las siguientes: temperatura de desnaturalización inicial a 95 °C durante 10 min, seguida de 30 ciclos de amplificación de desnaturalización durante 10 min a 94 °C, alineamiento durante 1 min a la temperatura específica de los oligonucleótidos (Cuadro 1), polimerización durante 30 seg a 72 °C, y un ciclo de extensión final durante 7 min a 72 °C. Los amplicones (5 µl) se analizaron por electroforesis en un gel de agarosa al 1% (peso/volumen) y se tiñeron con bromuro de etidio. Se consideró positivo para el gen, la presencia de una banda de amplificación correspondiente al tamaño del producto esperado. Cuadro 1: Oligonucleótidos (OLIG) utilizados OLIG blaZ mecA tetK tetM gyrA gyrB icaA icaD nuc

Secuencia 5´-TAAGAGATTTGCCTATGCTT-3´ 5´-TTAAAGTCTTACCGAAAGCAG-3´ 5´-GTAGAAATGACTGAACGTCCGATGA-3´ 5´-CCAATTCCACATTGTTTCGGTCTAA-3´ 5´-GTAGCGACAATAGGTAATAGT-3´ 5´-GTAGTGACAATAAACCTCCTA-3´ 5´-AGTGGAGCGATTACAGAA-3´ 5´-CATATGTCCTGGCGTGTCTA-3´ 5´-AATGAACAAGGTATGACACC-3´ 5´-ACGCGCTTCAGTATAACGC-3´ 5´-CAGCGTTAGATGTAGCAAGC-3´ 5´-CCGATTCCTGTACCAAATGC-3´ 5'-CCTAACTAACGAAAGGTAG-3´ 5'-AAGATATAGCGATAAGTGC-3' 5'-AAACGTAAGAGAGGTGG-3' 5'-GGCAATATGATCAAGATAC-3' 5´-GACTATTATTGGTTGATCCACCTG-3´ 5´-GCCTTGACGAACTAAAGCTTCG-3´

TA (°C)

TPE (pb)

49

377

62

310

49

360

49

158

49

222

49

250

50

1315

50

381

54

218

Referencia Yang et al., 2016(29) Elhassan et al., 2015(27) Yang et al., 2016(29) Yang et al., 2016(29) Hashem et al., 2013(28) Hashem et al., 2013(28) Dhanawade, 2010(49) Dhanawade, 2010(49) Brakstad et al., 2002(50)

TA= temperatura de alineamiento; TPE= tamaño del producto esperado.

Para analizar el fundamento genético de los mecanismos de resistencia bacteriana, se analizó la presencia de los genes blaZ y mecA para los antibióticos betalactámicos(15,16); tetK y , tetM para tetraciclinas(16) y gyrA y gyrB para quinolonas(17).

1121


Rev Mex Cienc Pecu 2021;12(4):1117-1132

Análisis estadístico Se realizaron tres experimentos independientes en los cuales se midió la absorbancia producida por la tinción del biofilm formado. Los experimentos fueron hechos por triplicado. Se obtuvo la diferencia entre la mayor absorbancia, menos la mayor cantidad de biofilm, dicha diferencia definida en este estudio como absorbancia. Los 30 aislados de S. aureus se clasificaron en tres grupos de acuerdo con el nivel de resistencia a antibióticos: alta, media y baja, de 10 aislados en cada uno y posteriormente fueron evaluados de acuerdo con su absorbancia. En los análisis se incluyeron los resultados de los controles positivos para cada nivel de resistencia de cada experimento. Se evaluó la normalidad de la variable dependiente absorbancia, utilizando la prueba de bondad de ajuste de Ji cuadrada resultando normal (P>0.05). Los datos fueron analizados con un análisis de varianza (ANDEVA) con un diseño factorial con arreglo completamente al azar. El modelo utilizado se muestra a continuación: Yijk=µ + EXi + GRj + EXixGRj + eijk, en donde: Yijk= es la k-ésima observación de absorbancia, del i-ésimo experimento y el j-ésimo grado de resistencia, µ= media general como parámetro constante, EXi= i-ésimo experimento, j=1, 2 y 3, GRj= j-ésimo grado de resistencia, i=1, 2 y 3, GRixEXj= interacción entre el i-ésimo grado de resistencia y el j-ésimo experimento, eijk= error experimental. Adicionalmente, se estimó la correlación de rango de Spearman entre grado de resistencia y la absorbancia.

Resultados y discusión Perfil de resistencia a antibióticos de los aislados de S. aureus provenientes de mastitis bovina Los resultados muestran que el 100 % de los aislados son resistentes a la penicilina y dicloxacilina, además el 86.6, 83.3 y 80.0 % muestran resistencia a la ampicilina, cefalotina y ceftazidima, respectivamente; se observó también que un 36.6 % de los aislados son resistencia a la oxacilina. En general, todos los aislados analizados fueron resistentes al menos al 33.3 % de los antibióticos probados (Cuadro 2). 1122


Rev Mex Cienc Pecu 2021;12(4):1117-1132

Cuadro 2: Perfil de resistencia de los aislados de S. aureus Antibiótico

Grupo 1

Aislados

PE

OXA DC PEF CXM GE CTX SXT TE AM E

1 2 3 4 5 6 7 8 9 10

Aislados resistentes, % 100 90

Grupo 2

CAZ CF

100 100 100

70

100 80

90

100 70

90

100

100 20

20

80

50

90

80

90

1 2 3 4 5 6 7 8 9 10

Aislados resistentes, % 100 70

90

20

60

Grupo 3

1 2 3 4 5 6 7 8 9 10 Aislados resistentes, % 100 30 100 30 40 0 80 0 30 60 0 70 60 Total, % 100.0 36.6 100.0 50.0 76.6 70.0 86.6 33.3 56.6 83.3 43.3 80.0 83.3 Código de color: Negro, aislado resistente; gris, aislado con resistencia intermedia; blanco, aislado sensible.

1123


Rev Mex Cienc Pecu 2021;12(4):1117-1132

La resistencia a antibióticos es un fenómeno que sigue en aumento y que afecta de manera importante al sector salud, tanto en la medicina humana como en la medicina veterinaria, ya que dificulta el manejo adecuado de las enfermedades infecciosas. Tal es el caso de la mastitis bovina; S. aureus, como una de las principales bacterias aisladas de mastitis bovina presenta altos índices de resistencia. En los últimos años, a nivel mundial, continúa en aumento la selección de mecanismos de resistencia bacteriana(18). En este sentido, en diversos países donde se analizó el perfil de resistencia de S. aureus proveniente de mastitis bovina, se encontraron porcentajes de resistencia a penicilina cercanos al 100 %(19-23), lo que coincide con los resultados aquí reportados. Con relación a la resistencia presentada a la oxacilina, se encontraron resultados contrastantes, ya que estudios realizados en países como la India y en China se presentaron niveles de resistencia del 48 al 84 %(21,24,); sin embargo, en Alemania, Japón y Colombia los niveles de resistencia a oxacilina son mínimos (2-7 %)(21,23,25), mientras que estos resultados muestran niveles intermedios de resistencia (33.3 %). En México, estudios revelan elevados niveles de resistencia bacteriana a penicilina, amoxicilina y dicloxacilina (100 %)(26,27), lo que es congruente con lo reportado en este trabajo. Asimismo, existe un incremento importante en la resistencia a la cefalotina, por ejemplo, en el 2008 se reportó que el 30 % de las cepas de S. aureus estudiadas presentaban resistencia(27); sin embargo, en este trabajo se encontró resistencia de hasta 83 %. Estas variaciones pueden deberse a la posible variabilidad genética de los aislados, a las diferencias climatológicas, así como discrepancias geográficas entre otros factores(28). Con base en estas diferencias, se resalta la necesidad de realizar trabajos como el que aquí se expone, para definir las características de virulencia de los S. aureus aislados de regiones particulares; para generar la información necesaria que permita la implementación de tratamientos más eficientes para la mastitis bovina subclínica. La presencia del gen blaZ fue observada en el 100 % de los aislados analizados, mientras que sólo el 36.6 % resultó positivo para el gen mecA (Cuadro 3). Estos resultados concuerdan con lo reportado con anterioridad, donde se mostró la presencia de estos genes en la totalidad de los aislados analizados(19,29). La presencia de los genes tetK, tetM, gyrA y gyrB fue expresada de manera descendiente en función de los grupos analizados, lo cual es congruente con el fenotipo encontrado en los antibiogramas. Esta coherencia entre el fenotipo y el genotipo de resistencia bacteriana ya ha sido demostrada con anterioridad(29,30), por lo que la resistencia observada se puede atribuir a la presencia y eventual expresión de los genes analizados(31).

1124


Rev Mex Cienc Pecu 2021;12(4):1117-1132

icaD + + + + + + + + +

Presencia del gen (%) 100

Grupo 1

Cuadro 3: Análisis de genes de resistencia y formación de biofilm Genes de resistencia Biofilm Aislados blaZ mecA tetK tetM gyrA gyrB icaA 1 + + + + + + 2 + + + + + + 3 + + + + + 4 + + + + 5 + + + + + 6 + + + + + 7 + + + + + + 8 + + + + + + 9 + + + + + + 10 + + + + + + 40

70

100

70

90

90

+ + + + +

+ + + + + + + + -

+ + + +

+ + +

+ + + +

+ + + + + + + +

+ + + + + + + +

50

80

40

30

40

80

80

+ + + + + + + + + +

+ -

+ + + + -

+ + + + + -

+ +

+ + + +

+ + + + + + + + +

+ + + + + + + + +

Presencia del gen, %

100

10

40

50

20

40

90

90

Total, %

100.0

46.6

53.3

53.3

50.0

50.0

86.6

86.6

Grupo 2

80

1 2 3 4 5 6 7 8 9 10

+ + + + + + + + + +

Grupo 3

Presencia del gen (%) 100 1 2 3 4 5 6 7 8 9 10

1125


Rev Mex Cienc Pecu 2021;12(4):1117-1132

Formación de biofilm de S. aureus aislado de mastitis bovina El análisis de la formación de biofilm mostró que la totalidad de los aislados presentaron la capacidad de formar biofilm con un rango del 20 a 98 %. Diversos estudios alrededor del mundo reportan que las cepas de S. aureus analizadas presentan la capacidad de formación de biofilm (90 a 99 %)(32,33), lo que coincide con el presente estudio. Debido a que S. aureus presenta altos niveles de resistencia a antibióticos; es necesario analizar los factores y características de virulencia que posee esta bacteria para poder diseñar estrategias de control más eficientes. En este sentido, ya se ha reportado que S. aureus tiene la capacidad de formar biofilm(34), lo cual puede estar relacionado con la baja efectividad que presentan los fármacos utilizados convencionalmente(35). Para establecer la posible relación entre la resistencia y la formación de biofilm en los 30 aislados provenientes de mastitis bovina, se siguió la siguiente estrategia. Primeramente, los resultados de formación de biofilm se analizaron en función del nivel de resistencia de los aislados (Figura 1); para lo cual, estos fueron ordenados en tres grupos como se describe en la sección de materiales y métodos. En el análisis de varianza de este estudio, solo el efecto de grado de resistencia resultó significativo (P<0.01), encontrando que los niveles promedio de absorbancia de los aislados fueron de 1.34 (63.17 %), 0.77 (38.78 %) y 0.66 (26.28 %) para los grupos 1, 2 y 3, respectivamente. En la comparación de medias, los grupos 1-3 fueron diferentes (P<0.05) (Figura 1B). La correlación estimada entre el grado de resistencia y la formación de biofilm fue positiva (0.50) y significativa (P<0.01) (Figura 2); además, estas diferencias fueron analizadas microscópicamente, donde la formación de biofilm en los aislados del grupo 1 se observaron incrementadas de manera importante en comparación con los otros dos grupos (Figura 1A). Debido a que la formación de biofilm por S. aureus induce al desarrollo de infecciones crónicas y recalcitrantes(32), resalta la necesidad de analizar cómo es que esta característica de virulencia se relaciona con otros mecanismos como la resistencia a antibióticos. Con referencia a lo anterior, esta relación ha sido estudiada tanto en bacterias Gramnegativas(36-39) como Grampositivas(40,41,); sin embargo, existen discrepancias al definir si la correlación que se presenta es positiva(42,43,44) o negativa(41). En este estudio, se observó que los aislados con una multirresistencia elevada presentan una mayor formación de biofilm; estableciéndose una correlación positiva, la cual es consistente con la mayoría de los trabajos reportados al respecto(42,43,44). Finalmente, se analizó la presencia de los genes icaA, icaD, los cuales se encuentran directamente relacionados con la formación de biofilm(45). Interesantemente, se encontró que existe una alta frecuencia de ambos genes en los aislados (86.6 %), sin importar el grado de resistencia que presentan (Cuadro 3). Diversos autores coinciden con este resultado, ya que reportan una frecuencia cercana al 100 % de uno o ambos genes en las cepas de S. aureus formadoras de biofilm(46,47,48).

1126


Rev Mex Cienc Pecu 2021;12(4):1117-1132

Figura 1: Formación de biofilm por los aislados de S. aureus. Para medir la formación de biofilm se utilizó el protocolo de tinción con cristal violeta.

A) Imágenes representativas de la tinción del biofilm en los tres grupos (Grupo 1: Resistencia alta, de 11 a 13 antibióticos; Grupo 2: Resistencia media, de 9 a 10 antibióticos y Grupo 3: Resistencia baja de 4-8 antibióticos), visualizadas con microscopia de campo claro. B) El gráfico representa el porcentaje de formación de biofilm de los tres grupos de aislados. Se utilizó la cepa certificada de S. aureus ATCC 27543 como control positivo, cuyo valor de absorbancia se estandarizó como el 100 %. Se presenta el promedio de tres experimentos independientes por triplicado ± su desviación estándar. (*) representa diferencia estadísticamente significativa entre grupos (P≤0.001).

Figura 2: Relación entre el porcentaje de resistencia y formación de biofilm (%) de los aislados de S. aureus

1127


Rev Mex Cienc Pecu 2021;12(4):1117-1132

Conclusiones e implicaciones Los aislados de S. aureus provenientes de mastitis bovina de los estados de Guanajuato y Michoacán, México, presentan elevados niveles de resistencia a antibióticos; así como una importante capacidad formadora de biofilm. Además, en el presente trabajo se demostró la existencia de una relación positiva entre estos dos factores. Estas características de virulencia pueden estar asociadas directamente con el bajo índice de eficacia clínica de los tratamientos utilizados de manera convencional en las granjas lecheras. La variabilidad de los resultados registrados en este estudio y otros reportes en diversas partes del mundo, ponen en evidencia la necesidad de realizar investigaciones sobre las características de virulencia de los microorganismos localizados en una ubicación geográfica específica y con ello establecer estrategias de manejo de la mastitis bovina de una manera integral y eficiente. Agradecimientos La presente investigación fue financiada por la Universidad de Guanajuato a través de la Convocatoria 2018 (DAIP-CIIC-077/2018) y por La Secretaría de Innovación, Ciencia y Educación Superior (MA-CFINN1042). Literatura citada: 1. SIAP. Servicio de Información Agroalimentaria y Pesquera. Boletín de Leche. México. 2018. 2. Smith PB. Medicina interna de grandes animales. Serrales, DC (trad.). 4ta ed. Barcelona, España: Elsevier; 2010. 3. Taponen S, Liski E, Heikkilä AM, Pyörälä S. Factors associated with intramammary infection in dairy cows caused by coagulase-negative Staphylococci, Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, Corynebacterium bovis, or Escherichia coli. J Dairy Sci 2017;100(1):493–503. 4. Martínez-Sigales JM. Patología y clínica bovina recopilación de clases y relatos de la experiencia práctica de un veterinario de campo. Intermedica. Buenos Aires Argentina. 2016. 5. Gomes F, Henriques M. Control of bovine mastitis: Old and recent therapeutic approaches. Curr Microbiol 2016;72:377–382. 6. Monistero V, Graber HU, Pollera C, Cremonesi P, Castiglioni B, Bottini E, CeballosMarquez A. et al. Staphylococcus aureus isolates from bovine mastitis in eight countries: Genotypes, detection of genes encoding different toxins and other virulence genes. Toxins 2018;10:1-22. 1128


Rev Mex Cienc Pecu 2021;12(4):1117-1132

7. Dorneles EMS, Fonseca MDAM, Abreu JAP, Lage AP, Brito MAVP, Pereira CR, Brandão HM, Guimarães AS, Heinemann MB. Genetic diversity and antimicrobial resistance in Staphylococcus aureus and coagulase‐negative Staphylococcus isolates from bovine mastitis in Minas Gerais, Brazil. Microbiologyopen 2019;8:e736. 8. Thiran E, Di Ciccio PA, Graber HU, Zanardi E, Ianieri A, Hummerjohann J. Biofilm formation of Staphylococcus aureus dairy isolates representing different genotypes. J Dairy Sci 2018;101:1000–1012. 9. Raza A, Muhammad G, Sharif S, Atta A. Biofilm producing Staphylococcus aureus and bovine mastitis: A review. Mol Microbiol Res 2013;3(1):1-8. 10. Lister JL, Horswill AR. Staphylococcus aureus biofilms: recent developments in biofilm dispersal. Front Cell Infect Microbiol 2014;4:178:1-9. 11. Chen Y, Liu T, Wang K, Hou Ch, Cai S, Huang Y, Du Z, et al. Baicalein Inhibits Staphylococcus aureus biofilm formation and the quorum sensing system in vitro. Plos ONE 2016;11(4):e0153468. 12. Varela-Ortiz DF, Barboza-Corona JE, González-Marrero J, León-Galván MF, ValenciaPosadas M, Lechuga-Arana AA, Sánchez-Felipe CG. Antibiotic susceptibility of Staphylococcus aureus isolated from subclinical bovine mastitis cases and in vitro efficacy of bacteriophage. Vet Res Commun 2018;42:243–250. 13. Hudzicki J. Kirby-Bauer Disk diffusion susceptibility test protocol. Am Soc Microbiology. 2016. 14. CLSI. Performance standards for antimicrobial susceptibility testing. 20th ed. CLSI supplement M100 Wayne, PA: Clinical and Laboratory Standards Institute; 2019. 15. Yang Y, Jiang X, Chai B, Ma L, Li B, Zhang A, Cole JR, Tiedje JM, Zhang T. ARGsOAP: online analysis pipeline for antibiotic resistance genes detection from metagenomic data using an integrated structured ARG-database. Bioinformatics 2016;32(15):2346-2351. 16. Elhassan MM, Ozbak HA, Hemeg HA, Elmekki MA, Ahmed LM. Absence of the mecA gene in methicillin resistant Staphylococcus aureus isolated from different clinical specimens in Shendi City, Sudan. Bio Med Res Int 2015;ID895860:1-5. 17. Hashem RA, Yassin AS, Zedan HH, Amin MA. Fluoroquinolone resistant mechanisms in methicillin-resistant Staphylococcus aureus clinical isolates in Cairo, Egypt J Infect Dev Ctries 2013;7(11):796-803. 18. Chokshi A, Sifri Z, Cennimo D, Horng H. Global contributors to antibiotic resistance. J Glob Infect Dis 2019;11(1):36–42. 1129


Rev Mex Cienc Pecu 2021;12(4):1117-1132

19. Yang F, Zhang S, Shang X, Li H, Zhang H, Cui D, Wang X, et al. Short communication: Detection and molecular characterization of methicillin-resistant Staphylococcus aureus isolated from subclinical bovine mastitis cases in China. J Dairy Sci 2020;103:840–845. 20. Li T, Lu H, Wang X, Gao Q, Dai Y, Shang J, Li M. Molecular characteristics of Staphylococcus aureus causing bovine mastitis between 2014 and 2015. Front Cell Infect Microbiol 2017;7(127):1-10. 21. Cheng J, Qu W, Barkema HW, Nobrega DB, Gao J, Liu G, De Buck J, et al. Antimicrobial resistance profiles of 5 common bovine mastitis pathogens in large Chinese dairy herds. J Dairy Sci 2019;102:1–11. 22. Kadlec K, Entorf M, Peters T. Occurrence and characteristics of livestock-associated methicillin-resistant Staphylococcus aureus in quarter milk samples from dairy cows in Germany. Front Microbiol 2019;10:1295. 23. Thongratsakul S, Usui M, Higuchi H, Takahashi T, Sato T, Poolkhet Ch, Tamura Y. Prevalence and characterization of Staphylococcus aureus isolated in raw milk from cows in Hokkaido, Japan. Trop Anim Healt Prod 2020;52(4):1631-1637. 24. Mistry H, Sharma P, Mahato S, Saravanan R, Kumar PA, Bhandari V. Prevalence and characterization of oxacillin susceptible mecA-positive clinical isolates of Staphylococcus aureus causing bovine mastitis in India. Plos ONE 2016;11(9):e0162256. 25. Jiménez-Velásquez SC, Torres-Higuera LD, Parra-Arango GL, Rodríguez-Bautista JL, García-Castro FE, Patiño-Burbano RE. Perfil de resistencia antimicrobiana en aislamientos de Staphylococcus spp. obtenidos de leche bovina en Colombia. Rev Argent Microbiol 2020;52(2):121-130. 26. León-Galván MF, Barboza-Corona JE, Lechuga-Arana AA, Valencia-Posadas M, Aguayo DD, Cedillo-Pelaez C, Martínez-Ortega EA, Gutierrez-Chavez AJ. Molecular detection and sensitivity to antibiotics and bacteriocins of pathogens isolated from bovine mastitis in family dairy herds of Central Mexico. Bio Med Res Int 2015;2015:615153 1-9. 27. Ochoa-Zarzosa A, Loeza-Lara PD, Torres-Rodríguez F, Loeza-Ángeles H, MascotChiquito N, Sánchez-Baca S, López-Meza JE. Antimicrobial susceptibility and invasive ability of Staphylococcus aureus isolates from mastitis from dairy backyard systems. Antonie van Leeuwenhoek 2008;94:199–206. 28. Karzis J, Petzer IM, Donkin EF, Naidoo V, Etter EMC. Climatic and regional antibiotic resistance patterns of Staphylococcus aureus in South African dairy herds. Onderstepoort J Vet Res 2019;86(1):e1-e9.

1130


Rev Mex Cienc Pecu 2021;12(4):1117-1132

29. Yang F, Wang Q, Wang XR, Wang L, Li XP, Luo JY, Zhang SD, et al. Genetic characterization of antimicrobial resistance in Staphylococcus aureus isolated from bovine mastitis cases in Northwest China. J Integ Agr 2016;15(12):2842–2847. 30. Artursson K, Söderlund R, Liu L, Monecke S, Schelin J. Genotyping of Staphylococcus aureus in bovine mastitis and correlation to phenotypic characteristics. Vet Microbiol 2016;193:156-61. 31. Foster TJ. Antibiotic resistance in Staphylococcus aureus. Current status and future prospects. FEMS Microbiology Reviews 2017;41:430–449. 32. Avila-Novoa MG, Iñíguez-Moreno M, Solís-Velázquez OA, González-Gómez JP, Guerrero-Medina PJ, Gutiérrez-Lomelí M. Biofilm formation by Staphylococcus aureus isolated from food contact surfaces in the dairy industry of Jalisco, Mexico. Hindawi J Food Qual 2018;ID1746139:1-8. 33. Piechota M, Kot B, Frankowska-Maciejewska A, Gruhewska A, Wofniak-Kosek A. Biofilm formation by methicillin-resistant and methicillin-sensitive Staphylococcus aureus strains from hospitalized patients in Poland. BioMed Res Int 2018; ID4657396:17. 34. Archer NK, Mazaitis MJ, Costerton JW, Leid JG, Powers ME, Shirtliff ME. Staphylococcus aureus biofilms properties, regulation and roles in human disease. Virulence 2011;2(5):445-459. 35. Moormeier DE, Bayles KW. Staphylococcus aureus biofilm: A complex developmental organism. Mol Microbiol 2017;104(3):365–376. 36. Dumaru R, Baral R, Shrestha LB. Study of biofilm formation and antibiotic resistance pattern of gram‑negative Bacilli among the clinical isolates at BPKIHS, Dharan. BMC Res Notes 2019;12(1):38. 37. Qi L, Li H, Zhang Ch, Liang B, Li J, Wang Li, Du X, et al. Relationship between antibiotic resistance, biofilm formation, and biofilm-specific resistance in Acinetobacter baumannii. Front Microbiol 2016;7:483. 38. Bawankar SK. Correlation of antibiotic resistance and biofilm formation amongst uropathogenic E. coli. Indian J Appl Res 2018;8:4. 39. Cepas V, López Y, Muñoz E, Rolo D, Ardanuy C, Martí S, Xercavins M, et al. Relationship between biofilm formation and antimicrobial resistance in Gram-negative bacteria. Microb Drug Resist 2019;25:1.

1131


Rev Mex Cienc Pecu 2021;12(4):1117-1132

40. Vitale M, Galluzzo P, Bu PB, Carlino E, Spezia O, Alduina R. Comparison of antibiotic resistance profile and biofilm production of Staphylococcus aureus isolates derived from human specimens and animal-derived samples. Antibiotics 2019;8:97. 41. Zhang Y, Xu D, Shi L, Cai R, Li Ch, Yan H. Association between agr type, virulence factors, biofilm formation and antibiotic resistance of Staphylococcus aureus isolates from pork production. Front Microbiol 2018;9:1876. 42. Tahmasebi H, Dehbashi S, Jahantigh M, Arabestani MR. Relationship between biofilm gene expression with antimicrobial resistance pattern and clinical specimen type based on sequence types (STs) of methicillin‑resistant S. aureus. Mol Biol Rep 2020;47(2):1309-1320. 43. Lin Q, Sun H, Yao K, Cai J, Ren Y, Chi Y. The prevalence, antibiotic resistance, and biofilm formation of Staphylococcus aureus in bulk Ready-to-eat foods. Biomolecules 2019;9:524. 44. Kwon AS, Park GC, Ryuc SY, Limd DH, Lime DY, Choi CL, Park Y, Lima Y. Higher biofilm formation in multidrug-resistant clinical isolates of Staphylococcus aureus. Int J Antimicrob Agents 2008;32:68–72. 45. O’Gara JP. ica and beyond: biofilm mechanisms and regulation in Staphylococcus epidermidis and Staphylococcus aureus. FEMS Microbiol Lett 2007;270:179–188. 46. Castelani L, Pilon LE, Martins T, Rodrigues-Pozzi C, Rodriguez-Pozzi Arcaro J. Investigation of biofilm production and icaA and icaD genes in Staphylococcus aureus isolated from heifers and cows with mastitis. Anim Sci J 2015;86(3):340-4. 47. Gad GFM, El-Feky MH, El-Rehewy MS, Hassan MA, Abolella H, El-Baky RMA. Detection of icaA, icaD genes and biofilm production by Staphylococcus aureus and Staphylococcus epidermidis isolated from urinary tract catheterized patients. J Infect Dev Ctries 2009;3(5):342-351. 48. Kivanc SA, Arik G, Akova-Budak B, Kivanc M. Biofilm forming capacity and antibiotic susceptibility of Staphylococcus spp. with the icaA/icaD/bap genotype isolated from ocular surface of patients with diabetes. Malawi Med J 2018;30 (4):243-249. 49. Dhanawade NB, Kalorey DR, Srinivasan R, Barbuddhe SB, Kurkure NV. Detection of intercellular adhesion genes and biofilm production in Staphylococcus aureus isolated from bovine subclinical mastitis. Vet Res Commun 2010;34:81–89. 50. Brakstad OG, Aasbakk K, Maeland JA. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol 1992;30:1654–1660.

1132


https://doi.org/10.22319/rmcp.v12i4.5897 Artículo

Utilidad de la espectroscopia infrarroja con transformada de Fourier (IRTF) para detectar larvas musculares de Trichinella spiralis (Owen, 1835) en jamón y salchichas hechas de carne de un cerdo infectado experimentalmente

Jorge Luis de la Rosa Arana a Jesús Benjamín Ponce Noguez b Tzayhri Gallardo Velázquez c Nydia Edith Reyes Rodríguez b Andrea Paloma Zepeda Velázquez b Ana Berenice López Lugo d Alejandro Pablo Sánchez Paredes d Pablo Martínez Labat d Fabián Ricardo Gómez de Anda b*

a

Instituto de Diagnóstico y Referencia Inmunoparasitología. Ciudad de México. b

Epidemiológicos.

Laboratorio

de

Universidad Autónoma del Estado de Hidalgo. Instituto de Ciencias Agropecuarias, Área

Académica de Medicina Veterinaria y Zootecnia. Tulancingo de Bravo, Estado de Hidalgo, México. c

Instituto Politécnico Nacional. Escuela Nacional de Ciencias Bilógicas, Departamento de Biofísica. Ciudad de México. d

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán, laboratorio de Parasitología.

*Autor de correspondencia: fabian_gomez9891@uaeh.edu.mx

1133


Rev Mex Cienc Pecu 2021;12(4):1133-1150

Resumen: El objetivo de este trabajo fue determinar la utilidad de la espectroscopia infrarroja transformada de Fourier (IRTF) para detectar larvas musculares de Trichinella spiralis (Owen, 1835) en jamón y salchichas hechas de carne de un cerdo infectado experimentalmente. Las larvas musculares (LM) se buscaron mediante métodos convencionales (digestión artificial y triquinoscopía teñida con tinción de hemalum de Mayer) y por espectroscopia IRTF. Además, se analizó la capacidad infectiva de las larvas encontradas en los productos porcinos. La carga parasitaria fue de 8.5 ± 3 LM/g en jamón y 4.5 ± 1.4 LM/g en salchicha (P<0.0001). Los espectros de los productos porcinos preparados con la carne de un cerdo no infectado fueron diferentes en el rango de 1,700 a 900 cm -1 con respecto a los espectros de los productos de cerdos infectados. En esta región, el glucógeno es el grupo químico más abundante (1,200 y 900 cm-1). La distancia entre las clases entre los productos no infestados y los infestados fue de 10.2 para el jamón y de 5.52 para las salchichas (tres es el valor mínimo para indicar la separación de clases). La capacidad infectiva de las larvas recuperadas de los productos porcinos disminuyó hasta cinco veces en comparación con la de las larvas obtenidas de ratones infectados experimentalmente. Estos resultados muestran que la espectroscopia IRTF es útil para determinar la presencia de larvas de T. spiralis en los alimentos estudiados aquí. Se necesitan más estudios para determinar la influencia de los sabores de la carne en la detección de Trichinella mediante espectroscopia IRTF. Palabras clave: Trichinella, Inspección de carne, Embutido, Diagnóstico, Espectroscopía infrarroja.

Recibido: 09/12/2020 Aceptado: 30/03/2021

Introducción Trichinella spiralis (Owen, 1835) es un nematodo parásito de distribución mundial que causa la zoonosis transmitida por los alimentos llamada triquinelosis. Dado que varios casos clínicos humanos y brotes están relacionados con el consumo de carne de cerdo o productos de cerdo (embutidos) insuficientemente cocidos que albergan larvas viables(1-5), la Comisión Internacional de Triquinelosis emite continuamente recomendaciones para la inspección y el tratamiento de la carne destinada al consumo humano(6). En los mataderos, la digestión artificial utilizando la proteasa pepsina y ácido clorhídrico es el ensayo estándar para la detección de larvas de Trichinella(7-9). A pesar de que la inspección de cerdos en mataderos públicos es obligatoria, algunos cerdos permanecen sin ningún control sanitario y, después 1134


Rev Mex Cienc Pecu 2021;12(4):1133-1150

del sacrificio, la carne o los productos cárnicos se venden en el país sin inspección sanitaria. Por lo tanto, los fabricantes actúan con cautela para mejorar la estabilidad de la carne de cerdo cruda utilizando técnicas de conservación. Sin embargo, se ha informado que la capacidad reproductiva de las larvas musculares de Trichinella no se ve afectada por el “curado húmedo”, el “adobado” (carne condimentada con chile) o el almacenamiento en frío de carne cruda(10). Los embutidos, además de formar parte de las costumbres culinarias de la sociedad, también son una forma de conservar la carne de cerdo. Hay algunos informes de triquinelosis humana por ingestión de salchichas de cerdo(1,4,11,12) y, adicionalmente, Forbes et al(13) informaron que las larvas de T. nativa (Britov & Boev, 1972) mantuvieron su infectividad en salchichas tradicionales del norte crudas y parcialmente cocidas preparadas con carne de focas infectadas experimentalmente. Dado que los embutidos preparados de carne de cerdo sin control podrían ser un riesgo en la transmisión de Trichinella, es necesario contar con alternativas de diagnóstico que puedan apoyar las técnicas recomendadas para la inspección de la carne para hacer el diagnóstico definitivo del parásito(7). Un método alternativo, utilizado actualmente en el análisis de alimentos, es la espectroscopia infrarroja transformada de Fourier (IRTF) con reflectancia total atenuada (RTA) y modelado independiente suave de analogías de clases (SIMCA). Se ha reportado previamente la utilidad de la espectroscopia IRTF para detectar adulteraciones en los productos de carne de cerdo(14,15). Recientemente, alguien de nuestro grupo desarrolló el modelo para carne de rata con larvas de T. spiralis y fue capaz de detectar tres larvas en 10 g de carne de rata; no se observó interferencia con antígenos de Ascaris suum (Goeze, 1782) o Taenia solium (Linnaeeus, 1758)(16). En un experimento posterior, fue posible identificar larvas musculares de T. spiralis en cerdos infectados con diferentes dosis infectivas, de 812 a 13,000 larvas/cerdo(17). Sin embargo, la identificación de larvas en productos cárnicos derivados de cerdos infectados estaba pendiente. Por lo tanto, este trabajo tuvo como objetivo determinar la utilidad de la espectroscopia infrarroja transformada de Fourier (IRTF) para detectar larvas musculares de Trichinella spiralis en jamón y salchichas hechas de carne de un cerdo infectado experimentalmente.

Material y métodos Parásito El parásito Trichinella spiralis (MSUS/ME/92/CM-92) se mantuvo en ratas Wistar. El parásito se aisló en México de un cerdo infectado naturalmente en 1970 y fue tipificado en 1990(18). Cada rata (250 g de peso corporal y 6 semanas de edad) fue infectada por vía oral con 23 larvas musculares (LM) por gramo de peso corporal (equivalente a 6,000 ± 250 LM por rata). La infección experimental para obtener las larvas fue aprobada por el Comité de

1135


Rev Mex Cienc Pecu 2021;12(4):1133-1150

Ética y Cuidado de los Animales (CIECUA) del Instituto de Ciencias Agropecuarias de la UAEH bajo los lineamientos de la regulación mexicana(19). Las larvas musculares se aislaron por digestión artificial con una solución de pepsina al 0.5 % (Sigma-Aldrich St. Louis, Mo; EE. UU.) en ácido clorhídrico al 0.2 %. Después, las larvas se contaron a un aumento de 100x con microscopía de campo brillante. El número de larvas musculares de T. spiralis presentes en las salchichas también se evaluó mediante digestión artificial.

Infección experimental Dos cerdos macho York Landrace (Sus scrofa domestica Linnaeus, 1758) de 4 semanas de edad y 10 ± 0.2 kg fueron alimentados ad libitum con alimento comercial granulado para la etapa de engorda (Agribrands Purina México, Cuautitlán, Edo. Méx.). Un cerdo estaba infectado con 800 larvas musculares de T. spiralis, equivalente a una infección leve de 0.08 larvas musculares por gramo de peso corporal; el otro cerdo permaneció sin infectar. Los animales se mantuvieron en corrales separados siguiendo las regulaciones mexicanas(19,20). Los animales se sacrificaron utilizando una pistola de perno cautivo penetrante a las 12 semanas después de la infección y se obtuvieron tres muestras de 10 g de cinco regiones anatómicas (costilla, lomo, pierna, masetero y diafragma). Las muestras fueron sometidas a digestión artificial o compresión entre dos portaobjetos y observación a un aumento de 40x (triquinoscopía) para buscar parásitos. La carne de la pierna se utilizó para hacer el jamón, y la carne de lomo, costilla y chamorro se utilizó para hacer la salchicha, a menudo similar a los hotdogs, salchicha frankfurt o salchina viena.

Productos de cerdo El jamón y la salchicha se prepararon sin condimentos en la Facultad de Estudios Superiores Cuautitlán (Universidad Nacional Autónoma de México) de acuerdo con las recetas tradicionales mexicanas y de acuerdo con la regulación mexicana(21). El jamón se preparó a partir de carne de pierna (605 g) sin grasa, tendones ni ligamentos. La carne se colocó en una picadora para reducir el tamaño de las piezas de carne. La salmuera se preparó utilizando fosfato de sodio (9.0 g), sal (13.3 g), azúcar (4.2 g), sal de curado (12.0 g), eritorbato de sodio (1.99 g), glutamato monosódico (0.18 g) y carragenano (4.2 g) disueltos en agua (350 ml). Luego, la carne se colocó en un recipiente y se agregó la salmuera, después el recipiente se cubrió con plástico adhesivo y se puso en condiciones de enfriamiento a 4 °C durante 24 h. Al día siguiente, la carne curada se colocó dentro de una envoltura anudada con hilo desde el extremo, eliminando tanto como fuera posible el aire para acomodar la carne. La preparación se colocó en una máquina de vacío para eliminar cualquier presencia de aire y luego anudar firmemente el extremo libre de la envoltura. El jamón se cocinó completamente sumergido en agua a 80 ± 1 °C durante 50 min y luego se enfrió durante 5 min en agua helada. La salchicha se hizo con la carne de lomo, costilla y chamorro sin tendones ni ligamentos.

1136


Rev Mex Cienc Pecu 2021;12(4):1133-1150

La carne (595 g) se picó dos veces con hielo (110 g), sal (11 g) y sal de curado (1.7 g) para hacer una emulsión. En ese momento, se agregó grasa de cerdo (171.4 g) y hielo (110 g) mientras la picadora estaba trabajando. Posteriormente, el almidón de maíz (92.2 g) se incorporó lentamente para formar una pasta emulsionada. Sin detener la picadora, se añadió eritorbato de sodio (1.3 g), hielo (110 g) y fosfato de sodio (5.2 g). Para preparar la salchicha, se detuvo la operación de la picadora y se colocó la pasta en la parte inferior de la llenadora, que se equipó con una boquilla de 1 cm de diámetro. La boquilla se cubrió con una capa de aceite vegetal para insertar el celofán que se anudó en el extremo opuesto. Finalmente, la envoltura de celofán se llenó cuidadosamente y se dividió cada 10 a 12 cm; cada fracción estaba anudada. La salchicha se sumergió completamente en agua a 72 ± 1 °C durante 20 min y luego se enfrió durante 5 min en agua helada. Las muestras frescas se sometieron a digestión artificial y triquinoscopía para determinar el número de larvas musculares en el jamón y la salchicha.

Detección de larvas en productos porcinos teñidos con hemalum de Mayer Las muestras de 0.1 mm de grosor de jamón y salchicha (n= 20, cada una) se tiñeron con hemalum de Mayer, como se reportó anteriormente(22), pero se hicieron varias modificaciones al método original. Brevemente, las muestras se incubaron en éter durante 1 h a temperatura ambiente, luego se fijaron en formalina al 10 % durante 12 h. Después, se tiñeron con hemalum (Sigma Aldrich, St. Louis, MO, EE. UU.) durante 15 min y posteriormente las muestras se deshidrataron mediante pases consecutivos a través de alcohol al 70, 80, 90, 96 y 100 % durante 15 min cada vez. Se realizó una incubación final de 20 min en salicilato de metilo antes de montar cada laminilla con resina sintética. Las preparaciones se observaron en microscopía de luz a un aumento de 40X, y se contaron las larvas musculares.

Detección de Trichinella spiralis en productos porcinos mediante espectroscopia IRTF Los espectros de jamón y salchicha se obtuvieron como se describió anteriormente(16,17), utilizando un espectrofotómetro IRTF (Spectrum GX, Perkin Elmer Massachusetts, EE. UU.) equipado con un detector de sulfato de triglicina deuterado. La estación de muestreo tiene un accesorio de reflexión total atenuada (RTA) a través del cual la radiación infrarroja pasa a un cristal de seleniuro de zinc. Se colocó una muestra de un gramo (n= 5) de cada jamón y salchicha en la estación de muestreo. Las muestras se presionaron sobre la superficie del portaobjetos para permitir que el rayo infrarrojo pasara a través de ellas y se reflejara hacia el espectrómetro y, se obtuvieron 64 lecturas (escaneos) de cada muestra analizada. Los espectros fueron obtenidos y procesados con el software Spectrum versión 3.01.00 (Perkin

1137


Rev Mex Cienc Pecu 2021;12(4):1133-1150

Elmer, Inc.). Los espectros se escanearon en un rango de número de onda de 4,000-650 cm-1, con un promedio de 64 escaneos a una resolución de 4 cm-1. La región de análisis fue de 1,700 a 900 cm-1.

Desarrollo del modelo SIMCA Con los espectros obtenidos, se elaboró el modelo SIMCA (modelado independiente suave de analogías de clases) para el que se utilizaron 40 espectros de salchichas infectadas y no infectadas con larvas de Trichinella spiralis. A continuación, los espectros se sometieron a un análisis de modelado independiente suave de analogía de clases (SIMCA) para determinar la distancia interclase entre grupos. El valor mínimo de la distancia interclase debe ser mayor que 3 para que las dos poblaciones analizadas se consideren diferentes(16,17).

Capacidad infectiva del parásito Para determinar la capacidad infectiva de las larvas recuperadas mediante digestión artificial del jamón y la salchicha infectados, ratones macho ingenuos CD1 (n= 10 por producto) de 5 semanas de edad y 20 g se infectaron por vía oral con 50 ± 3 LM. Además, cinco ratones de la misma edad, sexo y peso fueron infectados con una dosis igual de LM obtenidas de una rata donante infectada experimentalmente. El día 60 posinfección, los ratones fueron sacrificados por luxación cervical y luego sometidos a digestión artificial para calcular el índice de capacidad reproductiva, es decir, el número de larvas recuperadas de los cadáveres dividido entre el número de larvas utilizadas para infectar a los ratones (10,23). El CIECUA aprobó el protocolo experimental de infección.

Análisis estadístico La carga parasitaria en el cerdo infectado experimentalmente se analizó utilizando la prueba ANOVA bidireccional seguida de la prueba posterior de Bonferroni. La carga parasitaria en los productos de carne de cerdo se analizó mediante la prueba T de Student no emparejada. El índice de capacidad reproductiva de las larvas recuperadas de jamón o salchicha se analizó con la prueba ANOVA unidireccional seguida de la prueba de comparación múltiple de Tukey. El análisis se realizó con el GraphPad Prism versión 6.01 para Windows (GraphPad Prism Software, versión 6.01, La Jolla California EE. UU.).

1138


Rev Mex Cienc Pecu 2021;12(4):1133-1150

Resultados Infección experimental del cerdo La carga parasitaria se determinó en cinco regiones anatómicas (costilla, lomo, pierna, diafragma y masetero; n= 3 muestras de cada región) mediante digestión artificial y triquinoscopía (Figura 1). Se observaron diferencias estadísticas entre las regiones anatómicas (P<0.0001) pero los resultados obtenidos con los dos métodos de detección fueron similares (P=0.4494). Cabe señalar que las regiones anatómicas con alta demanda comercial tienen tres veces menos carga parasitaria que el masetero y cinco veces menos que el diafragma, dos de los sitios preferidos de enquistamiento de T. spiralis en cerdos.

Número de larvas musculares por gramo de tejido (LM/g)

Figura 1: Carga larvaria de Trichinella spiralis en cinco regiones anatómicas de un cerdo infectado experimentalmente

El gráfico muestra el número de larvas musculares por gramo de tejido (LM/g) obtenidas mediante digestión artificial (DA) o por triquinoscopía (T). Se analizó un total de 3 muestras, 10 g cada una, por región anatómica; el gráfico muestra el promedio de 3 muestras y su desviación estándar.

Detección de larvas en jamón y salchichas de cerdo utilizando métodos estándar La detección de las larvas musculares en jamón y salchichas se llevó a cabo mediante digestión artificial y triquinoscopía. Sin embargo, la triquinoscopía estándar no permitió identificar claramente los parásitos debido a la interferencia de la grasa y el almidón contenidos en los productos. Veinte muestras de jamón (Figura 2, paneles “a” y “b”), y 20 muestras de salchicha (Figura 2, paneles “c” y “d”) se tiñeron con hemalum de Meyer para

1139


Rev Mex Cienc Pecu 2021;12(4):1133-1150

mejorar la nitidez de la observación larvaria. Las larvas musculares y la célula nodriza se observaron cómo estructuras púrpuras rodeadas de células no infectadas, que eran de coloración rosa. La carga parasitaria en jamón fue de 8.5 ± 3 LM/g (media ± DE) mientras que, en salchicha, la carga parasitaria fue de 4.5 ± 1.4 LM/g (P<0.0001; Prueba T de Student, dos colas). Figura 2: Micrografías representativas de larvas musculares de Trichinella spiralis

Larvas musculares de Trichinella spiralis teñidas con hemalum de Mayer en jamón (paneles a y b, aumento de 100x) y salchicha caseros (paneles c y d, aumento de 400x y 100x, respectivamente) preparados con carne de un cerdo infectado experimentalmente.

Detección de larvas en jamón y salchichas de cerdo mediante espectroscopia IRTF La Figura 3 muestra los espectros IRTF de jamón (panel a) y salchicha (panel b), obtenidos con 30 muestras de cada producto de cerdo. Se observaron diferencias en el espectro entre productos de cerdo infectados y no infectados en el rango de 1,700 a 900 cm-1. Dado que cada pico en el espectro está relacionado con grupos químicos funcionales, todas las muestras biológicas tienen un espectro de “huellas dactilares” relacionado con su composición 1140


Rev Mex Cienc Pecu 2021;12(4):1133-1150

química. El modelado independiente suave de analogías de clases (SIMCA) mostró una tasa de reconocimiento del 100 % y una tasa de rechazo del 100 %. Los espectros de jamón no infectado o salchicha no infectada se clasificaron como producto normal de carne de cerdo (100 % de reconocimiento), mientras que los espectros de jamón o salchicha infectados se rechazaron (100 %) porque la distancia interclase entre productos de cerdo no infectados e infectados fue de 10.2 para jamón y 5.2 para salchicha (Cuadro 1). Figura 3: Espectros representativos obtenidos por MID-IRTF-RTA para la detección de larvas musculares de Trichinella spiralis en jamón y salchicha caseros de un cerdo infectado experimentalmente

El panel (a) muestra los espectros del jamón infectado y no infectado, mientras que el panel (b) muestra los espectros de la salchicha infectada y no infectada. La absorbancia (A) se presenta como función de la longitud de onda.

1141


Rev Mex Cienc Pecu 2021;12(4):1133-1150

Cuadro 1: Distancia interclase y porcentajes de tasas de reconocimiento y rechazo (modelo SIMCA) entre T. spiralis. Jamón y salchicha de cerdo infectado y no infectado Tasa de Tasa de rechazo Clase DI reconocimiento (%) (%) Jamón infectado 100 (30/30) 100 (30/30) 10.2 Jamón no infectado Salchicha infectada 100 (30/30) 5.52 100 (30/30) Salchicha no infectada La Figura 4 muestra el análisis tridimensional de productos porcinos no infectados e infectados. El panel (a) muestra el jamón, y el panel (b), la salchicha. La imagen tridimensional de los productos no infectados parece superponerse porque comparten en común toda la materia prima para hacer las salchichas, pero también tienen elementos que no se comparten (puntos dentro de la figura), es decir, componentes de la larva de Trichinella. Figura 4: Gráficos tridimensionales de puntuación de análisis de componentes

El análisis de componentes fueron generados por los modelos SIMCA optimizados para los diferentes jamones (panel a) y salchichas (panel b) infectados y no infectados con Trichinella spiralis

1142


Rev Mex Cienc Pecu 2021;12(4):1133-1150

Capacidad reproductiva Solo 2 de cada 10 (20 %) ratones a los que se administró larvas recuperadas de jamón se encontraron infectados, mientras que en el grupo al que se le dio larvas recuperadas de salchichas, 3 de cada 10 (30 %) ratones estaban infectados. La Figura 5 muestra que el índice de capacidad reproductiva (ICR) de las larvas recuperadas de jamón fue 5.5 veces menor que el de las larvas recuperadas de ratas infectadas. El ICR de las larvas recuperadas de salchicha fue 3 veces menor que el de las larvas recuperadas de ratas infectadas.

Índice de capacidad reproductiva

Figura 5: Comparación del índice de capacidad reproductiva de las larvas de Trichinella spiralis de productos de cerdo preparados con carne de un cerdo infectado experimentalmente

Las diferencias entre los grupos se evaluaron con un ANOVA unidireccional a un nivel de significancia de 0.05 seguido de la prueba de Tukey para la comparación entre grupos (P<0.0001).

Discusión Aunque la inspección sanitaria de los cerdos es obligatoria en los mataderos públicos, muchos productos se preparan a partir de cerdos de “traspatio” y luego se comercializan sin inspección sanitaria. La búsqueda de Trichinella en productos de cerdo es complicada porque diversas partes del cerdo se utilizan para hacer embutidos, y se sabe que estos parásitos no se distribuyen homogéneamente en las diferentes regiones anatómicas de su hospedero(2,5); los datos aquí encontrados confirman esta observación. La carne de cerdo es una de las principales fuentes de proteína para la población mexicana; de hecho, es la segunda carne

1143


Rev Mex Cienc Pecu 2021;12(4):1133-1150

más consumida en el país y el ingrediente principal en muchas recetas culinarias. Casualmente, las regiones con mayor demanda económica (pierna, lomo, costilla, chamorro, entre otras) son las que tienen menor carga parasitaria. Sin embargo, no hay ninguna parte anatómica del cerdo que no se explote para el consumo como alimento principal o combinada con otros elementos; las salchichas son un buen ejemplo porque generalmente se preparan con grasa, vísceras o sangre. Dado que existen escasas alternativas para buscar parásitos en los productos de cerdo, aquí examinamos la utilidad de la espectroscopia IRTF para detectar larvas musculares de Trichinella spiralis en jamón y salchichas de un cerdo infectado experimentalmente. Esta técnica ya había sido probada en cerdos infectados experimentalmente con Trichinella(17), y no se observó interferencia con antígenos de Ascaris suum o Taenia solium(16); por lo tanto, el siguiente paso fue identificar la utilidad diagnóstica de la espectroscopia IRTF en productos de carne de cerdo. La espectroscopia infrarroja ya se ha aplicado con éxito para el control de calidad, detección de adulterantes y denominación de origen del vino, abejas melíferas, aceite de oliva, bebidas espirituosas y cerveza, productos lácteos, pescado, carne de res y clembuterol, entre otros(24). Experimentos anteriores han demostrado que la espectroscopia IRTF es capaz de reconocer hasta 3 larvas de Trichinella en 10 g de carne con un límite de confianza del 99 %(16). El análisis de los datos reportados aquí sugiere que las larvas de T. spiralis se identificaron con éxito en productos de cerdo infectados. Los espectros de jamón y salchicha no infectados mostraron las bandas características de ácidos grasos, proteínas y glucógenos ya reportados(25,26), y los espectros de productos de cerdo infectados fueron similares a los descritos anteriormente en carne obtenida de cerdos infectados experimentalmente(17). En esta región, los carbohidratos, principalmente glucógeno, son el grupo químico más abundante (1,200 y 900 cm-1) y, como punto de interés, se sabe que una vez que la Trichinella se establece en el músculo esquelético, la larva transforma la célula muscular en una célula nodriza, y desde esta ubicación, libera continuamente productos excretores y secretores o PES. Estos productos contribuyen a establecer el parasitismo(27) y son importantes en la inducción y modulación de la respuesta inmune del hospedero(28). Los PES contienen muchas proteínas funcionales, que son glicoproteínas, algunas de ellas con N-glicanos multiantenarios cubiertos con un monosacárido llamado tivelosa(29). Los resultados obtenidos en este trabajo muestran que la espectroscopia IRTF podría ser una alternativa adicional a los procedimientos de inspección establecidos para el comercio de carne para consumo humano. Anteriormente, se ha demostrado que el modelo SIMCA (modelado independiente suave de analogías de clases) es capaz de diferenciar entre Trichinella y otros gusanos como Ascaris y Taenia(16). Los tres gusanos se encuentran con frecuencia en los cerdos y son transmisibles a los humanos; sin embargo, solo Trichinella es microscópica (1.2 mm), mientras que las otras se pueden ver a simple vista, el gusano adulto de Ascaris mide más de 15 cm y la larva 1144


Rev Mex Cienc Pecu 2021;12(4):1133-1150

de Taenia mide al menos 0.5 cm. Por lo tanto, es deseable tener un método de diagnóstico alternativo para evitar la transmisión de Trichinella entre cerdos y humanos. También es deseable que estas metodologías puedan ser aplicadas en estudios epidemiológicos para conocer la prevalencia y distribución de Trichinella. Aunque la cantidad de producto a analizar con fines de vigilancia epidemiológica aún no se ha evaluado, aquí obtuvimos resultados con solo 5 g para cada producto de carne de cerdo. Hasta donde se sabe, hay muchos tipos diferentes de condimentos utilizados con frecuencia para preservar y mejorar el sabor de la carne, pero hay escasos datos sobre su espectroscopia. Por lo tanto, se deben realizar más estudios para determinar si algún condimento podría tener un espectro similar al de Trichinella, lo que podría causar el informe de muestras “falsas positivas”. Tal estudio es significativo ya que se ha demostrado previamente que algunos condimentos no influyen en la infectividad de Trichinella(10). En contraste, el análisis de las salchichas mediante triquinoscopía y digestión artificial fue complicado debido a la interferencia con la grasa y el almidón; algunas muestras tuvieron que ser teñidas para mejorar la detección del parásito. Hasta donde se sabe, este es el primer informe en el que la tinción de hemalum de Mayer se utiliza como ayuda en la identificación y diagnóstico de T. spiralis. Se aprovechó el contraste entre los parásitos y el miocito no infectado para contar las larvas musculares. Las propiedades de tinción de las larvas musculares y de la célula nodriza han sido ampliamente descritas a partir de secciones histológicas teñidas con hematoxilina-eosina(30) y músculo comprimido teñido con Giemsa(31). Aunque en este trabajo se tiñeron secciones de jamón y salchicha para demostrar la presencia de larvas musculares, parece que el uso de colorantes podría ser una alternativa para apoyar la búsqueda intencional de la larva en muestras de carne, donde la naturaleza del producto enmascara u oculta la presencia de parásitos. Los resultados evidenciaron que la preparación de jamón y salchicha limita la capacidad infectiva de las larvas de Trichinella. Lo más probable es que casi todas las larvas mueran durante la preparación de productos de cerdo. Kotula et al(32) informaron que las larvas musculares de Trichinella no son infectivas en chuletas de cerdo (2.54 cm de grosor) cocidas a una temperatura interna de 66 a 77 °C en un horno convencional. Esta temperatura interna se alcanzó después de 35 a 43 minutos de cocción. Hoy en día, la Comisión Internacional de Triquinelosis reconoce la cocción como uno de los tres medios aceptables para inactivar Trichinella(33). Aquí, se coció el jamón con agua a 80 ± 1 °C durante 50 min y la salchicha a 72 ± 1 °C durante 20 min. La diferencia en el tiempo de cocción entre el jamón y la salchicha consiste en que la carne de salchicha se pre-cose durante 20 min (entre 60 y 70 °C); así, la carne no pierde consistencia ni plasticidad y la salchicha se puede montar adecuadamente. De acuerdo con recetas culinarias, para preparar el alimento, las salchichas deben tener una cocción final adicional (hervida o frita) durante 10 a 30 min; los resultados muestran que algunas larvas permanecieron vivas. Esto se puede explicar teniendo en cuenta que el calor 1145


Rev Mex Cienc Pecu 2021;12(4):1133-1150

dentro del jamón y la salchicha no se distribuyó de manera consistente o, en el caso de la salchicha, se debe a que el tiempo de cocción fue corto. Los resultados de la capacidad infectiva muestran que el ICR obtenido con las larvas recuperadas del jamón fue inferior al obtenido con las salchichas. Este dato es importante ya que existen varios reportes de triquinelosis humana por ingestión de salchichas de cerdo(1,34-37), convirtiendo a las salchichas de carne sin inspección sanitaria en una fuente probable de transmisión de Trichinella. Esta información también es importante porque, en algunos países, como México, donde la salchicha ocupa el primer lugar en la lista de consumo de embutidos en el país, seguida del jamón, el chorizo y la mortadela. En 2011, el consumo per cápita en México fue de 7.8 kg y en 2017 fue de 8.6 kg(38).

Conclusiones e implicaciones En este estudio, se utilizó con éxito la espectroscopia IRTF para la detección de larvas musculares de Trichinella spiralis en productos de cerdo (jamón y salchichas) y la discriminación de productos no infectados de los infectados con el parásito. La utilidad de esta metodología podría ampliarse para detectar otros agentes etiológicos. La implementación del método para la inspección rutinaria de productos de cerdo reduciría el tiempo de análisis de la muestra (5 min), en comparación con los 10-30 min para la triquinoscopía y 1 a 3.5 h para la digestión artificial. Otras ventajas son la cantidad de muestra necesaria para el análisis, el procesamiento de la muestra sin tratamientos previos, la rápida obtención de resultados. Además, la metodología es un proceso respetuoso con el medio ambiente. Sin embargo, las limitaciones de esta metodología son el costo del equipo y la infraestructura necesaria para su operación. Agradecimientos Agradecemos la destacada asistencia técnica de María-Teresa Corona-Souza y Seidy Zamora-Carrillo. Dr. Guillermo Osorio-Revilla por su apoyo durante la realización de este trabajo. MSc Katia-Marleth Herrera-Aguirre y MSc Juan-Carlos Cruz-Tapia (hablantes nativos de inglés) para la revisión en inglés del manuscrito. Jorge-Luis de-la-Rosa-Arana, Vicente Vega-Sánchez y Tzayhri Gallardo-Velázquez son miembros del Sistema Nacional de Investigadores (CONACYT, México). Conflictos de intereses Ninguno de los autores tiene un conflicto de interés con respecto a esta publicación.

1146


Rev Mex Cienc Pecu 2021;12(4):1133-1150

Literatura citada: 1. Ruetsch C, Delaunay P, Armengaud A, Peloux-Petiot F, Dupouy-Camet J, Vallée I, et al. Inadequate labeling of pork sausages prepared in Corsica causing a trichinellosis outbreak in France. Parasite 2016;23:27. 2.

Ribicich M, Miguez M, Argibay T, Basso N, Franco A. Localization of Trichinella spiralis in muscles of commercial and parasitologic interest in pork. Parasite 2001;8(2 Suppl):S246-S248.

3.

Pozio E, Pence DB, La Rosa G, Casulli A, Henke SE. Trichinella infection in wildlife of the southwestern United States. J Parasitol 2001;87(5):1208-1210.

4.

Ortega-Pierres MG, Arriaga C, Yepez-Mulia L. Epidemiology of trichinellosis in Mexico, Central and South America. Vet Parasitol 2000;93(3-4):201-225.

5.

Kapel CMO, Webster P, Gamble R. Muscle distribution of sylvatic and domestic Trichinella larvae in production animals and wildlife. Vet Parasitol 2005;132(1-2):101105.

6.

Noeckler K, Pozio E, van der Giessen J, Hill DE, Gamble HR. International Commission on Trichinellosis: Recommendations on post-harvest control of Trichinella in food animals. Food Waterborne Parasitol 2019;14:e00041.

7.

Nöckler K, Pozio E, Voigt W, Heidrich J. Detection of Trichinella infection in food animals. Vet Parasitol 2000;93(3-4):335-350.

8.

Konecsni K, Scheller C, Scandett B, Buholzer P, Gajadhar A. Evaluation of the PrioCHECK™ Trichinella AAD Kit for the digestion and recovery of larva in pork, horse meat and wild meat. Vet Parasitol 2017;243:267-271.

9.

Gajadhar AA, Konecsni K, Scandrett B, Buholzer P. Validation of a new commercial serine protease artificial digestion assay for the detection of Trichinella larvae in pork. Food Waterborne Parasitol 2018;10:6-13.

10. Medina-Lerena MS, Ramirez-Álvarez A, Kühne M, Gómez-Priego A, de-la-Rosa JL. Influence of different processing procedures on the reproductive capacity of Trichinella spiralis in pork meat. Trop Anim Health Prod 2009;41(4):437-442. 11. Potter ME, Kruse MB, Matthews MA, Hill RO, Martin RJ. A sausage-associated outbreak of trichinosis in Illinois. Amer J Public Health 1976;66(12):1194-1196. 12. Hill DE, Luchanscky A, Porto-Fett A, Gamble R, Fournet VM, Hawkins-Cooper DS, et al. Curing conditions to inactivate Trichinella spiralis muscle larvae in ready-to-eat pork sausage. Food Waterborne Parasitol 2017;6:1-8.

1147


Rev Mex Cienc Pecu 2021;12(4):1133-1150

13. Forbes LB, Measures L, Gajadhar A, Kapel C. Infectivity of Trichinella nativa in traditional northern (country) foods prepared with meat from experimentally infected seals. J Food Prot 2003;66(10):1857-1863. 14. Rohman A, Sismindari S, Erwanto Y, Che-Man YB. Analysis of pork adulteration in beef meatball using Fourier transform infrared (FTIR) spectroscopy. Meat Sci 2011;88(1):91–95. 15. Sari TNI, Guntarti A. Wild boar fat analysis in beef sausage using Fourier Transform Infrared method (FTIR) combined with chemometric. Indonesian J Med Health 2018;9(1):16-23. 16. Gómez-de-Anda F, Gallardo-Velazquez T, Osorio-Revilla G, Dorantes-Alvarez L, Calderón-Domínguez G, Nogueda-Torres B, et al. Feasibility study for the detection of Trichinella spiralis in a murine model using mid-Fourier transform infrared spectroscopy (MID-FTIR) with attenuated total reflectance (ATR) and soft independent modelling of class analogies (SIMCA). Vet Parasitol 2012;190(3-4):496-503. 17. Gómez-de-Anda F, Dorantes-Álvarez L, Gallardo-Velazquez T, Osorio-Revilla G, Calderón-Domínguez G, Martínez-Labat P, et al. Determination of Trichinella spiralis in pig muscles using mid-Fourier transform infrared spectroscopy (MID-FTIR) with attenuated total reflectance (ATR) and soft independent modeling of class analogy (SIMCA). Meat Sci 2012;91(3):240-246. 18. Martínez-Fernández AR, Arribas B, Bolás F. Freezing resistance of spanish Trichinella isolates (T. spiralis and T. britovi). In: Gamble R, et al editors. Proc Ninth Int Conf Trichinellosis. 1rst ed. Ciudad de México, México: CINVESTAV; 1997:99-105. 19. Norma Oficial Mexicana NOM-062-ZOO-1999, Especificaciones técnicas para la Producción, Cuidado y Uso de los Animales de Laboratorio. 20. Norma Oficial Mexicana NOM-194-SSA1-2004, Productos y servicios. Especificaciones sanitarias en los establecimientos dedicados al sacrificio y faenado de animales para abasto, almacenamiento, transporte y expendio. Especificaciones sanitarias de productos. 21. Norma Oficial Mexicana NOM-213-SSA1-2002, Productos y servicios. Productos cárnicos procesados. Especificaciones sanitarias. Métodos de prueba. 22. Cooper DW. The preparation of serial sections of platyhelminth parasites, with details of the materials and facilities required. Syst Parasitol 1988;12:211-229.

1148


Rev Mex Cienc Pecu 2021;12(4):1133-1150

23. de-la-Rosa JL, Álvarez N., Gómez-Priego A. Study of the reproductive capacity of Trichinella spiralis recovered from experimentally infected mice under-dosed with albendazole or mebendazole. Trop Biomed 2007;24(2):93-97. 24. Meza-Márquez OG, Gallardo-Velázquez T, Dorantes-Álvarez L, Osorio-Revilla G, dela-Rosa-Arana JL. FT-MIR and Raman spectroscopy coupled to multivariate analysis for the detection of clenbuterol in murine model. Analyst 2011;136:3355-3365. 25. Lewis PD, Lewis KE, Ghosal R, Bayliss S, Lloyd AJ, Wills J, et al. Evaluation of FTIR spectroscopy as a diagnostic tool for lung cancer using sputum. BMC Cancer 2010;10:640. 26. Rohman A, Sismindari, Erwanto Y, Che-Man YB. Analysis of pork adulteration in beef meatball using Fourier transform infrared (FTIR) spectroscopy. Meat Sci 2011;88(1):91-95. 27. Nagano I, Wu Z, Takahashi Y. Functional genes and proteins of TrichKinella spp. Parasitol Res 2009;104(2):197-207. 28. Bruschi F, Chiumiento L. Immunomodulation in trichinellosis: does Trichinella really scape the host immune system?. Endocr Metab Immune Disord Drug Targets 2012;12(1):4-15. 29. Morelle W, Haslam SM, Morris HR, Dell A. Characterization of the N-linked glycans of adult Trichinella spiralis. Mol Biochem Parasitol 2000;109(2):171-177. 30. Boonmars T, Wu Z, Nagano I, Takahashi Y. Trichinella pseudospiralis infection is characterized by more continuous and diffuse myopathy than T. spiralis infection. Parasitol Res 2005;97(1):13-20. 31. Ramírez-Melgar C, Gómez-Priego A, de-la-Rosa JL. Application of Giemsa stain for easy detection of Trichinella spiralis muscle larvae. Korean J Parasitol 2007;45(1):6568. 32. Kotula AW, Murrell KD, Acosta-Stein L, Lamb L, Douglass L. Destruction of Trichinella spiralis during cooking. J Food Sci 1983;48(3):765-768. 33. Gamble HR, Bessonov AS, Cuperlovic K, Gajadhar AA, van-Knapen F, Noeckler K., et al. International Commission on Trichinellosis: recommendations on methods for the control of Trichinella in domestic and wild animals intended for human consumption. Vet Parasitol 2000;93(3-4):393-408. 34. Potter ME, Kruse MB, Matthews MA, Hill RO, Martin RJ. A sausage-associated outbreak of trichinosis in Illinois. Am J Public Health 1976;66(12):1194-1196.

1149


Rev Mex Cienc Pecu 2021;12(4):1133-1150

35. Martínez-Marañón R. ¿Está aumentando la triquinosis en México? ¿Podría esto ser una consecuencia inesperada de nuestro "desarrollo"? Salud Publica Mex 1985;27(1):40-51. 36. Zamora-Chávez A, de-la-O-Cavazos ME, Bernal-Redondo RM, Berrones-Espericueta D, Vázquez-Antona C. Triquinosis aguda en niños. Brote epidémico intrafamiliar en la ciudad de México. Bol Med Hosp Infant Mex 1990;47(6):395-400. 37. Krivokapich SJ, Graciana MG, Gonzalez-Prous CL, Degese MF, Arbusti PA, Ayesa GE, et al. Detection of Trichinella britovi in pork sausage suspected to be implicated in a human outbreak in Mendoza, Argentina. Parasitol Int 2019;71:53-55. 38. Saldaña, M. Aumentan mexicanos su consumo de embutidos. EL UNIVERSAL 2018; (16/02/2018).https://www.eluniversal.com.mx/cartera/aumentan-mexicanos-suconsumo-de-embutidos. Consultado 12 Dic, 2020.

1150


https://doi.org/10.22319/rmcp.v12i4.5739 Artículo

Frecuencia de anticuerpos séricos contra los virus de la rinotraqueitis infecciosa bovina y diarrea viral bovina en toros, y su relación con la presencia de los virus en semen

Jorge Víctor Rosete Fernández a Guadalupe A. Socci Escatell b Abraham Fragoso Islas a Juan Prisciliano Zárate Martínez c Sara Olazarán Jenkins a Lorenzo Granados Zurita d Ángel Ríos Utrera c*

a

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), Sitio Experimental Las Margaritas. Kilómetro 9.5 carretera Hueytamalco-Tenampulco, Hueytamalco, Puebla, México. b

INIFAP, CENID Salud Animal e Inocuidad. Ciudad de México, México.

c

INIFAP, Campo Experimental La Posta. Veracruz, México.

d

INIFAP, Campo Experimental Huimanguillo. Tabasco, México.

*Autor de correspondencia: rios.angel@inifap.gob.mx

Resumen: El objetivo fue estimar la frecuencia de anticuerpos séricos contra los virus de

1151


Rev Mex Cienc Pecu 2021;12(4):1151-1167

la rinotraqueitis infecciosa bovina (VRIB) y diarrea viral bovina (VDVB) en toros no vacunados, así como la relación entre la presencia de anticuerpos en suero y la presencia de dichos virus en semen. Los anticuerpos se detectaron mediante ELISA, mientras que la presencia de los virus en semen mediante PCR. Se realizaron análisis de regresión logística con PROC GENMOD de SAS. Los factores fueron: estado, hato anidado en estado, y genotipo del toro (excepto para la presencia de los virus en semen). El grado de asociación entre la presencia de anticuerpos séricos y la presencia de los virus en semen se midió mediante la correlación phi (r). Ninguno de los tres factores fue significativo (P>0.05). Para el VRIB, la frecuencia de anticuerpos séricos por estado varió de 66 a 86 %, mientras que por hato varió de 28 a 90 %. Para el VDVB, la frecuencia de anticuerpos séricos por estado osciló de 58 a 76 %, mientras que por hato osciló de 43 a 86 %. La presencia del VRIB en semen, por estado, varió de 50 a 55 %, mientras que por hato varió de 33 a 80 %. No se encontró asociación (P>0.05) entre la presencia de anticuerpos en suero y la presencia del VRIB (r=0.07) y VDVB en semen (r=0.16). La presencia de anticuerpos séricos sugiere la infección de los toros, pero la presencia de los virus en semen sugiere su transmisión por contacto sexual. Palabras clave: Toros, Rinotraqueitis infecciosa bovina, Diarrea viral bovina, Anticuerpos, Antígenos, Semen, Trópico.

Recibido: 20/07/2020 Aceptado: 30/03/2021

Introducción La diarrea viral bovina (DVB) es una enfermedad aguda y epizoótica(1) debido a que ocasiona un amplio rango de lesiones y manifestaciones clínicas, así como considerables pérdidas en bovinos de carne y leche(2), siendo los trastornos reproductivos los de mayor impacto económico(3). Debido a su patogenia, la DVB se ha considerado la enfermedad viral más complicada en bovinos(4).

1152


Rev Mex Cienc Pecu 2021;12(4):1151-1167

Existen dos biotipos del virus de la DVB (VDVB): el citopático (CP) y el no citopático (NCP), según su comportamiento en cultivos celulares(2,4,5). El biotipo común en la mayoría (95 %) de los aislamientos de campo es el NCP; el biotipo CP se genera por mutaciones o re-arreglos del genoma de la cepa original paterna NCP. Además, debido a sus características genéticasantigénicas se clasifican en dos genotipos, los cuales son el VDVB-1 y el VDVB-2, que son mayormente NCP. Estos biotipos y genotipos son cualidades independientes de los Pestivirus(6). Cada biotipo tiene un papel específico en una variedad de síndromes clínicos, tales como infecciones crónicas, agudas y congénitas. El VDVB-2 se ha asociado con brotes de infecciones agudas severas y el síndrome hemorrágico(7). La principal característica de este virus es su variabilidad genética y antigénica, debido a que los virus RNA se caracterizan por su plasticidad, la cual se debe a la falta de una exonucleasa eficiente para corregir las bases mal incorporadas, ocasionando una sustitución de base de alta frecuencia (un error por cada 10,000 nucleótidos polimerizados). El VDVB usa esta estrategia para sobrevivir, originando cepas mutantes que escapan a la respuesta inmunológica del hospedador. El VDVB infecta principalmente bovinos, especie para la cual representa uno de los patógenos más importantes, pero también se puede encontrar en ovejas, cabras(1), porcinos, alpacas, llamas, camellos, búfalos de agua y rumiantes silvestres(3). Esta peculiaridad se debe tomar en cuenta a la hora de implementar un programa de control, ya que los Pestivirus cruzan la barrera de especie(3). La gran diversidad de estudios disponibles indica que la DVB tiene una distribución mundial(6,8-11), pues el virus es de alta morbilidad y baja mortalidad(12), de tal manera que un animal persistentemente infectado menor de cuatro meses de edad es capaz de infectar al 90 % de sus compañeros de hato en condiciones estabuladas(13). Por su parte, la rinotraqueitis infecciosa bovina (RIB) es una enfermedad distribuida en diversas regiones de México, pues desde 1988 se han encontrado anticuerpos neutralizantes contra el virus de la RIB (VRIB) en bovinos del Estado de México, Puebla y Yucatán, a partir de bovinos con signos respiratorios que hacían sospechar de la presencia del virus(14). En

1153


Rev Mex Cienc Pecu 2021;12(4):1151-1167

Tizimín, Yucatán, se observó una seroprevalencia de 5.33 %(15) y, posteriormente, en otro estudio en bovinos sin antecedentes de vacunación, se encontró una seroprevalencia de 54.4 %(16), lo que demuestra que el VRIB está presente y latente en el trópico, pues su prevalencia ha ido en aumento, debido a que es altamente contagioso. La RIB se manifiesta de diferentes maneras y se transmite por contacto directo con secreciones nasales, oculares y genitales, así como con semen fresco de toros infectados(17). Esta enfermedad se ha investigado poco en toros, principalmente en hatos comerciales del trópico mexicano, pues, aunque se han reportado fallas reproductivas en vacas, no se ha actuado para identificar problemas sanitarios en toros. Por lo tanto, es importante estudiarla, pues en la mayoría de las vacas la enfermedad pasa desapercibida por no causar la muerte, teniendo como principal característica el aborto, afectando los parámetros reproductivos y productivos e incrementando notablemente las pérdidas económicas(18), ya que existe menor producción de becerros para engorda y vaquillas de reemplazo. Algunos estudios han demostrado la presencia del VRIB en semen congelado. En centros de inseminación artificial se han realizado aislamientos de este agente en toros clínicamente sanos(19), pero poco se ha investigado sobre la presencia de este virus en semen de toros que se reproducen por medio de monta natural en hatos comerciales del trópico mexicano. En estudios previos, se reconoce que toros infectados son un factor de riesgo para la transmisión de la RIB, ya que su agente causal se transmite por vía venérea(20), reactivándose la enfermedad en el hato y manteniéndolo infectado, lo cual explica los altos títulos de anticuerpos encontrados en algunas investigaciones en toros destinados para monta natural(21). En hatos donde la reproducción ha sido a través de monta natural, se han encontrado prevalencias de 74.0(22) y 69.5%(23), poniendo de manifiesto la participación del macho en la transmisión de la enfermedad, a pesar de que las pruebas serológicas pudieran ser negativas(21). En un estudio se observó que la fertilidad de toros no se afectó por la RIB(24); por lo tanto, es un factor de riesgo que se debe considerar cuando se adquieren toros para monta sin control sanitario, lo que sin duda contribuye a empeorar la situación de la RIB en los hatos.

1154


Rev Mex Cienc Pecu 2021;12(4):1151-1167

Con base en lo anterior, el objetivo del presente trabajo fue estimar la frecuencia de anticuerpos séricos contra los virus de la DVB y RIB en toros no vacunados, así como la relación entre la presencia de anticuerpos en suero y la presencia de los virus en semen.

Material y métodos El estudio se realizó en 14 hatos comerciales ubicados en el trópico y subtrópico de México en los estados de Puebla, Tabasco y Veracruz. Los hatos se ubican en el área de influencia de los campos experimentales del INIFAP: Las Margaritas, en Puebla, Huimanguillo, en Tabasco, y La Posta, en Veracruz. Los hatos se seleccionaron con base en un muestreo no probabilístico por conveniencia, de acuerdo con el interés de los ganaderos de participar en el presente estudio. Por otro lado, el tamaño de muestra (n= 76) dependió de los toros existentes en cada hato participante. Los toros pertenecían a hatos oficialmente libres de Brucella abortus y Mycobacterium bovis, los cuales se dedicaban a la producción de carne y al doble propósito. El genotipo de los toros se clasificó en cebú (Bos indicus), europeo (Bos taurus) y cruzado (Bos taurus x Bos indicus). Las muestras de sangre se obtuvieron de la vena coccígea y se conservaron entre 4 y 6 °C en una hielera hasta llegar al laboratorio del campo experimental correspondiente, donde se centrifugaron a 4,000 rpm durante 10 min, para obtener 3 ml de suero/toro. Las muestras de suero se conservaron en viales de polietileno a -20 °C hasta el momento de su análisis. El diagnóstico serológico para la detección de anticuerpos contra los virus de la RIB y de la DVB se realizó con los kits CIVTEST BOVIS IBR y CIVTEST BOVIS BVD/BD P80 (Laboratorios Hipra, S.A., México), basados en la prueba de ELISA, cuya sensibilidad y especificidad es 96.3 y 99.5 %, respectivamente. En ambos diagnósticos serológicos, la lectura se realizó a una densidad óptica de 450 nanómetros, en un espectrofotómetro ELx800, marca BioTek (BioTek Instruments, Inc., EUA).

1155


Rev Mex Cienc Pecu 2021;12(4):1151-1167

Las muestras de semen (3 ml/toro) se obtuvieron por medio de electroeyaculación y se contuvieron en tubos de polietileno; posteriormente, se mantuvieron entre 4 y 6 °C en una hielera. Al llegar al laboratorio, las muestras se conservaron en congelación a -20 °C hasta el momento de su análisis. Estas muestras fueron analizadas por PCR para detectar antígenos de los virus mencionados. De cada muestra de semen ya homogenizada, se tomaron 200 µl para la extracción de ácidos nucleicos mediante el paquete comercial High Pure PCR Template Preparation Kit (Laboratorios Roche), bajo el protocolo descrito por el fabricante para muestras de sangre completa, con la modificación de que, en el último paso, los ácidos nucleicos se eluyeron en 50 µl de agua inyectable bidestilada. La amplificación del ADN para la detección del virus de la RIB se realizó con la utilización de un par de iniciadores que amplifican 468 pb del gen de la glicoproteína gI(25). La mezcla de reacción se elaboró en un volumen final de 25 µl con las siguientes concentraciones: 1X de Buffer 10X, 1.5 mM de MgCl2, 0.4 mM de dNTP’s, 20 pmol de cada iniciador, 1.25 U de Taq polimerasa y 1.5 mcg de BSA. El programa de amplificación constó de 1 ciclo a 95 °C durante 1 min; 35 ciclos a 95 °C durante 1 min, 62 °C 1 min y 72 °C 1 min; y un ciclo final a 72 °C durante 7 min. La electroforesis de los productos de amplificación se llevó a cabo en geles de agarosa al 1.5%, teñidos con el reactivo GelRed (Biotium). La visualización de los productos de amplificación se realizó bajo luz UV en un fotodocumentador. Para la detección del virus de la DVB se realizó la síntesis de cDNA y su amplificación en un solo paso. Se utilizaron un par de iniciadores que amplifican un fragmento de 191 pb de la región 5’ UTR del genoma viral(26). La reacción se llevó a cabo en un volumen final de 25 µl bajo las siguientes condiciones: 1X de Buffer 10X, 1.5 mM de MgCl2, 0.4 mM de dNTP’s, 20 pmol de cada iniciador, 1.25 U de Taq polimerasa, 6 U de Transcriptasa reversa y 1.5 mcg de BSA. El programa de amplificación consistió en 1 ciclo a 48 °C durante 30 min, seguido de 1 ciclo a 95 °C durante 10 min; 35 ciclos a 94 °C durante 1 min, 58 °C durante 1 min, 72 °C durante 1 min; y un ciclo de extensión final de 72 °C durante 7 min. La electroforesis y la visualización se realizaron de la misma forma que para el virus de la RIB.

1156


Rev Mex Cienc Pecu 2021;12(4):1151-1167

Las frecuencias de anticuerpos en suero, así como las frecuencias de antígenos en semen, se trataron como características binarias, por lo que se registraron como 1 cuando un toro resultó positivo a la prueba de ELISA o PCR, respectivamente; en caso contrario, como 0. El modelo estadístico (modelo de regresión logística binomial) para analizar las frecuencias de anticuerpos incluyó los factores estado de la República Mexicana, hato anidado en estado y genotipo del toro; para analizar las frecuencias de antígenos en semen, el modelo estadístico solo incluyó estado de la República Mexicana y hato anidado en estado de la República Mexicana. Se realizaron análisis de regresión logística por característica, con el procedimiento GENMOD del paquete SAS, utilizando una función liga logit para la distribución binomial. El criterio de convergencia aplicado en cada análisis estadístico fue 10-8. El grado de asociación entre la presencia de anticuerpos en suero y de antígenos en semen de los virus de la DVB y RIB, como indicador de la eliminación de los virus a través del semen, se determinó con el coeficiente phi, también llamado coeficiente de correlación de Mathews, el cual se calcula para tablas de contingencia 2x2, toros positivos (1) o negativos (0) para la presencia de anticuerpos en suero, y toros positivos (1) o negativos (0) para la presencia de antígenos en semen. Los coeficientes de correlación, así como la significancia estadística para determinar si eran diferentes de cero, se estimaron con el procedimiento CORR del paquete SAS.

Resultados y discusión Ninguno de los tres factores de ajuste afectó (P>0.05) la frecuencia de anticuerpos séricos contra el VDVB. La frecuencia de antígenos en semen del VDVB no fue estimable, ya que una gran proporción de los toros fueron negativos a la prueba de PCR (97.4 %), resultando en la ausencia de variación en algunos de los factores de ajuste incluidos en el modelo estadístico. Las frecuencias de anticuerpos séricos contra el VDVB y sus intervalos de confianza al 95%, por estado y genotipo se presentan en los Cuadros 1 y 2, respectivamente; sin embargo, las frecuencias por hato no se presentan. La frecuencia de anticuerpos séricos contra el VDVB varió de 58 a 76 % por estado, de 43 a 86 % por hato, y de 54 a 79 % por genotipo. No se encontró asociación (P>0.05) entre la presencia de anticuerpos en suero y la presencia 1157


Rev Mex Cienc Pecu 2021;12(4):1151-1167

del VDVB en semen (r= 0.16). Cuadro 1: Frecuencias (± errores estándar) de anticuerpos séricos contra el virus de la diarrea viral bovina e intervalos de confianza al 95%, por estado Estado No. de toros Frecuencia, % Intervalo Puebla 28 58 ± 11 36 - 77 Tabasco 26 59 ± 11 38 - 78 Veracruz 22 76 ± 11 49 - 92 (P>0.05).

Cuadro 2: Frecuencias (± errores estándar) de anticuerpos séricos contra el virus de la diarrea viral bovina e intervalos de confianza al 95%, por genotipo Genotipo No. de toros Frecuencia, % Intervalo Cebú 29 54 ± 13 29 - 77 Cruza 33 60 ± 10 40 - 77 Europeo 14 79 ± 14 43 - 95 (P>0.05).

La frecuencia de anticuerpos séricos contra el VDVB estimada en el presente estudio es relativamente alta y, en consecuencia, de consideración. Por lo tanto, sabiendo de antemano que en los hatos evaluados la reproducción se realizó mediante monta natural, los toros representan un factor de riesgo en la transmisión de la DVB. Por otro lado, aunque la frecuencia de antígenos en semen del VDVB no se pudo estimar mediante un modelo estadístico, ésta se considera baja, ya que una gran proporción de toros resultó negativa a la prueba de PCR (97.4 %), lo que sugiere que no todos los sementales estaban eliminando el virus al momento de tomar la muestra de semen, o bien, existe la posibilidad que solo los toros persistentemente infectados (PI) eliminaron el virus, ya que se ha demostrado que el virus se replica en la próstata y vesículas seminales en toros PI y no se elimina constantemente(27,28,29). En otro estudio en toros de Perú, también se observó una frecuencia de anticuerpos séricos relativamente alta (51.3 %), argumentándose una amplia difusión y actividad viral entre animales y enfatizándose el riesgo de transmisión a través del semen(29), por lo que es importante la vacunación en hembras, para prevenir problemas reproductivos por el riesgo de infección(27).

1158


Rev Mex Cienc Pecu 2021;12(4):1151-1167

La frecuencia de anticuerpos séricos contra el VDVB hallada en este estudio sugiere que los hatos a los que pertenecen los toros están infectados y expuestos permanentemente a la reinfección, y en cuanto a la frecuencia del VDVB en semen, se esperaba que ésta fuera mucho mayor, y que mostrara una alta correlación con la presencia de anticuerpos en suero, pero esto no sucedió debido, probablemente, a que el VDVB no se elimina constantemente a través del semen(29); sin embargo, aún la presencia mínima del VDVB en semen representa un factor de riesgo en el momento de la monta natural, como lo han argumentado otros autores(28,30), y si se trata de semen congelado, éste debe ser inocuo, pues al infectar a las vacas inseminadas causa problemas de fertilidad(31-33), por el riesgo de la eliminación del virus, aunque no permanentemente en el eyaculado de los toros PI(28,29,34). Esto lo demuestra un estudio en toros de dos años de edad, sin antecedentes de DVB e inoculados vía nasal con el VDVB(35), que eliminaron el virus en semen durante un periodo de hasta siete meses, para después desaparecer, lo que puede explicar por qué muy pocos toros eliminaron el virus en semen en el presente estudio, pues no se elimina constantemente(29,34,35). Aun así, la detección del VDVB en suero o semen es importante en sementales para monta natural o congelación de semen, pues al impedir la utilización de animales positivos, se minimiza el riesgo de transmisión a las hembras(28,30). Debido a que la DVB persiste en animales infectados, se facilita su transmisión a animales sanos(3,7,36,37), entonces, la vacunación es la herramienta de control apropiada, pues la eliminación de animales PI es complicada y requiere de mucho tiempo. Por lo tanto, los hatos evaluados en este estudio se deberían vacunar(27) para prevenir problemas reproductivos(29). Para la frecuencia de anticuerpos séricos contra el VRIB, el estado, hato anidado en estado y genotipo del toro tampoco fueron factores de ajuste importantes (P>0.05). En los Cuadros 3 y 4 se muestran las frecuencias de anticuerpos séricos contra el VRIB y sus intervalos de confianza al 95%, por estado y genotipo del toro, respectivamente; sin embargo, las frecuencias por hato no se presentan. La frecuencia de anticuerpos séricos contra este virus varió de 66 a 83 % por estado, de 28 a 90 % por hato, y de 54 a 84 % por genotipo.

1159


Rev Mex Cienc Pecu 2021;12(4):1151-1167

Cuadro 3: Frecuencias (± errores estándar) de anticuerpos séricos contra el virus de la rinotraqueitis infecciosa bovina e intervalos de confianza al 95%, por Estado Estado No. de toros Frecuencia, % Intervalo Puebla 34 83 ± 7 63 - 93 Tabasco 11 66 ± 18 29 - 90 Veracruz 29 70 ± 10 47 - 86 (P>0.05).

Cuadro 4: Frecuencias (± errores estándar) de anticuerpos séricos contra el virus de la rinotraqueitis infecciosa bovina e intervalos de confianza al 95%, por genotipo Genotipo No. de toros Frecuencia, % Intervalo Cebú 33 79 ± 10 52 - 92 Cruza 29 54 ± 13 30 - 76 Europeo 12 84 ± 12 46 - 97 (P>0.05).

La presencia del VRIB en semen tampoco fue afectada por los efectos de estado y hato; la frecuencia correspondiente varió de 50 a 55 % por estado (Cuadro 5) y de 33 a 80 % por hato (estas frecuencias no se presentan). La presencia de anticuerpos en suero y la presencia del VRIB en semen tampoco estuvieron correlacionadas (r=0.07; P>0.05). Cuadro 5: Frecuencias (± errores estándar) para el virus de la rinotraqueitis infecciosa bovina en semen e intervalos de confianza al 95%, por Estado Estado

No. de toros

Frecuencia, %

Intervalo

Puebla

21

54.9 ± 12.5

31 - 77

Tabasco

12

50.0 ± 15.3

23 - 77

Veracruz

23

52.3 ± 10.4

33 - 71

(P>0.05).

Los resultados de este estudio muestran una frecuencia de anticuerpos séricos contra el VRIB relativamente alta. Una frecuencia similar (69.5 %) se encontró en toros cruzados de doble propósito de hatos del municipio de

1160


Rev Mex Cienc Pecu 2021;12(4):1151-1167

Tonalá, Chiapas(23), así como en toros cruzados para producción de carne y doble propósito de hatos de la Sierra Oriente de Puebla (76.0 %)(24) y de toros para producción de carne en Yucatán (54.4 %)(16). Por otro lado, en toros para producción de carne de hatos del Istmo y de la Costa de Oaxaca(38) se observaron frecuencias menores (31.6 y 27.9 %, respectivamente). En estudios realizados en toros colombianos se observaron frecuencias relativamente altas, 85.5 % en Antioquia(20), 67.6 % en Urabá y 75.0 % en el Valle del Cauca(39). En cuanto a la presencia del VRIB en semen, se ha documentado la identificación del virus en toros para monta natural, así como en sementales de centros de inseminación artificial(40), en los que se han podido aislar ambos virus a partir de pajuelas de semen congelado de varias casas comerciales(41), evidenciando que la inseminación artificial también es un factor de riesgo importante en la propagación de la RIB, ya que es un patógeno frecuentemente presente en semen, asociado con baja calidad del mismo. El virus se encuentra más en el plasma seminal que en la fracción celular, de tal manera que su transmisión ha mostrado pérdida de la fertilidad en vacas(31). En este estudio no se encontró asociación entre la relativamente alta frecuencia de anticuerpos y la presencia del VRIB en semen, en los que hubo solo un 53 % de toros eliminadores del virus, en contraste con un estudio previo(40) en el que del total de toros seropositivos a anticuerpos contra el virus, el 100 % lo eliminaron en el semen. Lo anterior se puede deber a factores que inducen la excreción o reactivación del virus, como el estrés calórico, el estrés por manejo, los tratamientos con cortico-esteroides, que causan inmunosupresión, lo que permite que el virus se replique en las células epiteliales y otros tejidos (ocular, por ejemplo), sin que llegue a los órganos reproductores; o bien, que suceda lo contrario, que el sistema inmune esté funcionando perfectamente, evitando la replicación del virus y, por lo tanto, el virus no se encuentra en semen en el momento de la eyaculación(42-44). Sin embargo, la detección de anticuerpos contra el VRIB y de antígenos en semen, juntas o separadas, son efectivas para detectar la enfermedad en los toros(45) y, por ende, en el hato. Finalmente, debido a las altas frecuencias de anticuerpos en suero y del VRIB en semen en este estudio y considerando que la enfermedad también se transmite por contacto sexual, es importante señalar

1161


Rev Mex Cienc Pecu 2021;12(4):1151-1167

que urge una campaña de control para la RIB en México, como se ha hecho en Brasil(46).

Conclusiones e implicaciones No se encontró asociación entre la presencia de anticuerpos en suero y la presencia de los virus en semen; tampoco se encontraron diferencias entre estados en la frecuencia de anticuerpos séricos contra los virus de la RIB y DVB ni en la frecuencia de antígenos en semen del VRIB. Sin embargo, dichas frecuencias fueron de magnitud considerable, por lo que se debería implementar un programa de control mediante la vacunación. Si un toro elimina estos virus a través del semen se puede considerar persistentemente infectado, lo que también debe tomarse en cuenta antes de comprar sementales, los cuales deberían estar libres de DVB y RIB, comprobado con pruebas de laboratorio. Literatura citada: 1. Obando RCA, Rodríguez JM. Diarrea viral bovina. En: González-Stagnaro C, Soto BE editores. Manual de ganadería doble propósito. 1ª ed. Maracaibo, Venezuela: Astro Data, S. A.; 2005:317-322. 2. Rondón I. Diarrea viral bovina: Patogénesis e inmunopatología. Rev MVZ Córdoba 2006;11(1):694-704. 3. Lértora WJ. Diarrea viral bovina: Actualización. Rev Vet FCV UNNE 2003;14(1):1-11. 4. Ramírez RR, Chavarría MB, López MA, Rodríguez TLE, Nevárez GAM. Presencia del virus de la diarrea viral bovina y su asociación con otros cuadros patológicos en ganado en corral de engorda. Vet Méx 2012;43(3):225-234. 5. Vargas DS, Jaime J, Vera JV. Perspectivas para el control del virus de la diarrea viral bovina (BVDV). Rev Colomb Cienc Pecu 2009;22:677-688.

1162


Rev Mex Cienc Pecu 2021;12(4):1151-1167

6. Carter GR, Wise DJ, Flores EF. Flaviviridae. En: Carter GR, Wise DJ, Flores EF eds. Virología veterinaria. International Veterinary Information Service, Ithaca NY. 2005:251-262. 7. OIE. Office International des Epizooties. Diarrea Viral Bovina. Manual de la OIE Sobre Animales Terrestres. 2008:1-15. 8. Bedekovic T, Lemo N, Barbic L, Cvetnic Z, Lojkic I, Benic M, et al. Influence of category, herd size, grazing and management on epidemiology of bovine viral diarrhoea in dairy herds. Acta Vet Brno 2013;82:125-130. 9. Chowdhury MMR, Afrin F, Saha SS, Jhontu S, Asgar MA. Prevalence and haematological parameters for bovine viral diarrhoea (BVD) in South Bengal areas in Bangladesh. The Bangladesh Vet 2015;32(2):48-54. 10. Handel IG, Willoughby K, Land F, Koterwas B, Morgan KL, Tanya VN, et al. Seroepidemiology of bovine viral diarrhoea virus (BVDV) in the Adamawa region of Cameroon and use of the SPOT test to identify herds with PI calves. Plos One 2011;6(7):e21620. 11. Luzzago C, Lauzi S, Ebranati E, Giammarioli M, Moreno A, Cannella V, et al. Extended genetic diversity of bovine viral diarrhea virus and frequency of genotypes and subtypes in cattle in Italy between 1995 and 2013. BioMed Res Int 2014:1-8. 12. Gasque GR. Diarrea Viral Bovina. 1ª Ed. México, D.F.: UNAM; 2008. 13. Houe H. Survivorship of animals persistently infected with bovine viral diarrhoea virus (BVDV). Pre Vet Med 1993;15:275-283. 14. Correa, G. Complejo reproductivo bovino. En: Correa, G. Enfermedades virales de los animales domésticos poligástricos. 5ª ed. Paradigmas. México, D.F. 1988:45-90. 15. Calderón VG, Alvarado IA, Vilchis MC, Aguilar SA, Batalla CD. Detección de seropositividad al virus de rinotraqueitis infecciosa bovina (IBR) en ganado del municipio de Tizimín, Yucatán, México. Téc Pecu Méx 1997;35(3):161-164.

1163


Rev Mex Cienc Pecu 2021;12(4):1151-1167

16. Solis-Calderon JJ, Segura VM, Segura JC, Alvarado IA. Seroprevalence of and risk factors for infection bovine rhinotracheitis in beef cattle herds of Yucatan, Mexico. Prev Vet Med 2003;57(4):199-208. 17. Nuotio L, Neuvonen E, Hyytiäinen M. Epidemiology and eradication of infectious bovine rhinotracheitis/infectious pustular vulvovaginitis (IBR/IPV) virus in Finland. Acta Vet Scand 2007;49(3):1-6. 18. Bracho CA, Jaramillo ACJ, Martínez, MJJ, Montaño HJA, Olguín BA. Comparación de tres pruebas diagnósticas para el aborto por rinotraqueitis infecciosa bovina en hatos lecheros. Vet Méx 2006;37:151163. 19. Martínez CPJ, Riveira SIM. Antecedentes, generalidades y actualización en aspectos de patogénesis, diagnóstico y control de la diarrea viral bovina (DVB) y rinotraqueitis infecciosa bovina [tesis licenciatura]. Bogotá D.C., Colombia: Pontificia Universidad Javeriana; 2008. 20. Ruiz J, Jaime J, Vera VJ. Prevalencia serológica y aislamiento del Herpesvirus Bovino-1 (BHV-1) en hatos ganaderos de Antioquia y del Valle del Cauca. Rev Colomb Cienc Pecu 2010;23:299-307. 21. Schroeder WH. IBR-IPV y Reproducción. En: Schroeder WH editor. Fisiopatología reproductiva de la vaca. 1ª ed. Bogotá, Colombia: Celsus; 1999:825-833. 22. Romero-Salas D. Enfermedades que causan abortos en la ganadería bovina. 1ª ed. Veracruz, Veracruz: Universidad Veracruzana; 2012. 23. De los Santos MC, Orantes MA, Sánchez B, Manzur A, Cruz JL, Ruiz JL, et al. Determinación de anticuerpos de IBR mediante la técnica de ELISA en la zona Paredón- Boca del Cielo, Tonalá, Chiapas. Quehacer Cient Chis 2013;8(1):31-34. 24. Soto JR. Prevalencia de anticuerpos a IBR, BVD, Leptospirosis y Neosporosis y su relación con la fertilidad en sementales bovinos productores de carne del subtrópico húmedo de puebla [tesis licenciatura]. Puebla, México: Benemérita Universidad Autónoma de Puebla; 2014.

1164


Rev Mex Cienc Pecu 2021;12(4):1151-1167

25. Deka D, Ramneek, Maiti NK, Oberoi MS. Detection of bovine herpesvirus-1 infection in breeding bull semen by virus isolation and polymerase chain reaction. Rev Sci Tech Off Int Epiz 2005;24(3):10851094. 26. Sandvik T, Paton DJ, Lowings PJ. Detection and identification of ruminant and porcine pestiviruses by nested amplification of 5’ untranslated cDNA regions. J Virol Methods 1997;64:43-56. 27. González-Altamiranda EA, Kaiser GG, Weber N, Leunda MR, Pecora A, Malacan DA, et al. Clinical and reproductive consequences of using BVDV-contaminated semen in artificial insemination in a beef herd in Argentina. Anim Reprod Sci 2012;133(3-4):146-152. 28. Givens MD, Waldrop JG. Bovine viral diarrhea virus in embryo and semen production systems. Vet Clin Food Anim 2004;20(1):21-38. 29. Cárdenas AC, Rivera GH, Araínga RM, Ramírez VM, De Paz MJ. Prevalencia del virus de la diarrea viral bovina y de animales portadores del virus en bovinos en la provincia de Espinar, Cusco. Rev Inv Vet Perú 2011;22(3):261-267. 30. Mishra N, Kalaiyarasu S, Mallinath KC, Rajukumar K, Khetan RK, Gautam S, et al. Identification of bovine viral diarrhoea virus type 2 in cattle bull semen from southern India and its genetic characterization. Current Sci 2018;114(3):666-670. 31. Dejucq N, Jégou B. Viruses in the mammalian male genital tract and their effect on reproductive system. Microbiol Mol Biol R 2001;65(2):208231. 32. Kirkland PD, McGowan MR, Mackintosh SG, Moyle A. Insemination of cattle with semen from a bull transiently infected with pestivirus. Vet Rec 1997;140:124-127. 33. Meyling A, Jensen AM. Transmission of bovine virus diarrhoea virus (BVDV) by artificial insemination (AI) with semen from a persistentlyinfected bull. Vet Microbiol 1998;17:97-105.

1165


Rev Mex Cienc Pecu 2021;12(4):1151-1167

34. Niskanen R, Alenius S, Belák K, Baule C, Belák S, Voges H, Gustafsson H. Insemination of susceptible heifers with semen from a non-viraemic bull with persistent bovine virus diarrhoea virus infection localized in the testes. Reprod Dom Anim 2002;37:171-175. 35. Givens MD, Heath AM, Carson RL, Brock KV, Edens MSD, Wenzel JGW, et al. Analytical sensitivity of assays used for detection of bovine viral diarrhea virus in semen samples from the Southeastern United States. Vet Microbiol 2003;96(2):145-155. 36. Edmondson MA, Givens MD, Walz PH, Gard JA, Stringfellow DA, Carson RL. Comparison of tests for detection of bovine viral diarrhea virus in diagnostic samples. J Vet Diagn Invest 2007;19:376-381. 37. Grooms DL. Reproductive consequences of infection with bovine viral diarrhea virus. Vet Clin North Am Food Anim Pract 2004;20:5-19. 38. Hernández BEG, Gutiérrez HJL, Herrera LE, Palomares REG, Díaz AE. Frecuencia de diarrea viral bovina, rinotraqueitis infecciosa bovina, leptospirosis y brucelosis, en las 2 regiones ganaderas más importantes de Oaxaca. En: González IDR, Posadas ME editores. XXXIX Congreso Nacional de Buiatría. 2015:87-92. 39. Peña MA, Góngora A, Jiménez C. Infectious agents affecting fertility of bulls, and transmission risk through semen. Retrospective analysis of their sanitary status in Colombia. Rev Colomb Cienc Pecu 2011;24:634646. 40. Oliveira MT, Campos FS, Dias MM, Velho FA, Freneau GE, Brito WMED, et al. Detection of bovine herpesvirus 1 and 5 in semen from Brazilian bulls. Theriogenology 2011;75:1139-1145. 41. Morán PE, Favier PA, Lomónaco M, Catena MC, Chiapparrone ML, Odeón AC, et al. Search for the genome of bovine herpesvirus types 1, 4 and 5 in bovine semen. Open Vet J 2013;3(2):126-130. 42. Gregersen JP, Wagner K. Persistent infection of the genital tract and excretion of the vaccine strain after live virus inmunization with bovine herpesvirus 1 (IBR/IPV virus). Zentralbl Veterinaermed B 1985;32:1-10.

1166


Rev Mex Cienc Pecu 2021;12(4):1151-1167

43. Alonzo P, Puentes R, Benavides U, Esteves PA, Silva AD, Roehe PM, et al. Infección natural de un toro con dos subtipos diferentes de herpesvirus bovino tipo 1. Veterinaria (Montevideo) 2011;48(184):5-10. 44. Duque D, Estévez JNR, Abreu AM, Moncada M, Durango J, Molina D. Aspectos sobre rinotraqueitis infecciosa bovina. J Agric Anim Sci 2014;3(1):58-71. 45. Jain L, Kanani AN, Kumar V, Joshi CG, Purohit JH. Detection of bovine herpesvirus 1 infection in breeding bulls by ELISA and PCR assay. Indian J Vet Res 2009;18(1):1-4. 46. Sá Filho MFL, Vieira LCM, Martins CA, Rodríguez PS. New approaches in superovulation programs and embryo transfer in Brazil. Curso Internacional de Biotecnologías Reproductivas en Ganadería Tropical. 2013:1-9.

1167


https://doi.org/10.22319/rmcp.v12i4.5894 Artículo

Variabilidad en el contenido de polifenoles, actividad biológica y antihelmíntica de extractos metanol:agua de las hojas de Gymnopodium floribundum Rolfe

Guadalupe Isabel Ortíz-Ocampo a Carlos Alfredo Sandoval-Castro a Gabriela Mancilla-Montelongo b Gloria Sarahi Castañeda-Ramírez a José Israel Chan Pérez a Concepción Capetillo Leal a Juan Felipe de Jesús Torres-Acosta a*

a

Universidad Autónoma de Yucatán, Facultad de Medicina Veterinaria y Zootecnia. Km

15.5 Carretera Mérida-Xmatkuil, 97315, Mérida, Yucatán, México. b

CONACYT–Universidad Autónoma de Yucatán, Facultad de Medicina Veterinaria y Zootecnia. Km 15.5 Carretera Mérida-Xmatkuil, 97315, Mérida,Yucatán, México.

*Autor de correspondencia: tacosta@correo.uady.mx

Resumen: Se determinó el efecto del mes de cosecha y edad de las hojas de Gymnopodium floribundum sobre el contenido de compuestos polifenólicos (fenoles totales (FT), taninos totales (TT) y taninos condensados (TC)) de extractos metanol:agua. Además, se determinó la actividad biológica de los polifenoles medida como la capacidad de precipitar proteína (PP), inhibir la eclosión de huevos (EH), y el desenvaine larval (IDL) de Haemonchus contortus. Se cosecharon hojas de G. floribundum en cuatro meses del año: diciembre, marzo, junio y

1168


Rev Mex Cienc Pecu 2021;12(4):1168-1187

septiembre. Se obtuvieron 24 extractos metanol:agua (70:30), 12 producidos de hojas de edad variada (EV) y 12 de hojas de 90 días (E90). Todos los extractos ocasionaron similar PP independientemente de edad y mes de cosecha. La inhibición de la EH solo fue significativa para el extracto EV de diciembre (CE50 = 374.4 μg/ml; P<0.05). Los extractos de hojas E90 mostraron una CE50 > 1500 μg/ml en diciembre, junio y septiembre. Aunque todos los extractos inhibieron el desenvaine larval (IDL), la menor CE50 fue la del extracto de hojas EV de junio (CE50 = 80.4 μg/ml; P<0.05). La incubación de extractos con polivinilpolipirrolidona (PVPP) limitó la IDL (P<0.05), pero los polifenoles solo explicaron parte de esa actividad. En conclusión, el contenido de TC de los extractos de hojas de G. floribundum depende de su edad y mes de cosecha. Los polifenoles mostraron actividad de PP y se asociaron parcialmente con la IDL. Sin embargo, los polifenoles no explican la actividad contra huevos de H. contortus. Palabras clave: Polifenol, Antihelmíntico, Haemonchus contortus, Precipitación de proteína, Extractos, Taninos.

Recibido: 08/12/2020 Aceptado: 10/05/2021

Introducción Los ovinos y caprinos que ramonean en la selva baja caducifolia (SBC) de Yucatán consumen cantidades variables de follaje de una amplia variedad de especies de plantas ricas en taninos(1). Una de las especies más consumidas es el Gymnopodium floribundum que es un árbol de talla baja abundante en la SBC y que ha sido estudiado por su contenido de compuestos secundarios (CS)(2). Entre los CS reportados para G. floribundum se encuentran los compuestos volátiles (E)-ocimeno, 2-etil-1-hexanol y linalool presentes en sus flores(3). Las hojas de esta especie contienen otros CS importantes como los polifenoles, i.e. fenoles totales (FT), taninos totales (TT) y taninos condensados (TC)(1,2). Los polifenoles pudieran estar involucrados en la defensa de las plantas contra infecciones por bacterias y hongos fitopatógenos y también limitan el consumo de las hojas por los herbívoros vertebrados e invertebrados(4,5,6). Esto último pudiera estar relacionado con las propiedades astringentes de los polifenoles. La capacidad de los polifenoles para limitar el consumo de hojas por parte de los herbívoros también ha sido descrita para los pequeños rumiantes pastoreando en algunos ecosistemas, ocasionando baja productividad animal(7). Sin embargo, el efecto de reducir el consumo no se ha encontrado en los pequeños rumiantes ramoneando en la SBC(8). Por el contrario, ovinos y caprinos ramoneando en la SBC buscan consumir el follaje de diferentes especies de plantas con elevado contenido de TC posiblemente como una

1169


Rev Mex Cienc Pecu 2021;12(4):1168-1187

estrategia para bloquear el exceso de nitrógeno en su dieta, favoreciendo un mejor balance de nitrógeno y energía, y reduciendo la necesidad de eliminar nitrógeno en la orina(2). Esto se debe a que los polifenoles tienen la capacidad de precipitar proteínas (PP) en la dieta(9,10). La PP es la propiedad de los polifenoles para formar complejos con proteínas y otras macromoléculas que poseen grupos carbonilo y amino, formando enlaces de hidrógeno con macromoléculas susceptibles de autooxidación para formar enlaces covalentes(5). Se desconoce si la actividad de PP de los polifenoles varía a lo largo del año en las hojas de G. floribundum. Por otro lado, estudios recientes han demostrado que los extractos del follaje de G. floribundum tienen actividad antihelmíntica (AH) in vitro contra huevos y larvas de H. contortus(11,12), y se ha demostrado que los polifenoles están involucrados en dicha actividad(12). La actividad AH in vitro fue confirmada recientemente en estudios in vivo usando follaje de G. floribundum en la dieta de corderos infectados con H. contortus(13). Lo anterior permite considerar a las hojas de G. floribundum como un alimento con potencial nutracéutico que pudiera ser usado en el control de nematodos gastrointestinales (NGI). Sin embargo, se ha reportado variabilidad en el contenido de polifenoles en las hojas de los árboles forrajeros ricos en polifenoles de la SBC como Acacia pennatula, Lysiloma latisiliquum y Psicidia piscipula(14). Así mismo, las hojas de G. floribundum muestran variación en su contenido de polifenoles, siendo mayor en época de lluvias (33.8 %), periodo de rápido crecimiento foliar, y menor en época de secas (9.5 %), cuando los árboles pierden su follaje(2,13). Recientemente, un estudio anual de las hojas de G. floribundum confirmó que la edad de las hojas y el mes de cosecha afectan su composición bromatológica y su contenido de polifenoles(15). Lo anterior sugiere que es indispensable estudiar la variabilidad del contenido de compuestos bioactivos en las plantas para hacer uso racional de estos recursos como nutracéuticos(6,16,17). Hasta el momento no existen estudios que identifiquen la variabilidad en el contenido de polifenoles y su actividad biológica en árboles tropicales. Este estudio determinó el efecto del mes de cosecha y edad de las hojas de G. floribundum sobre el contenido de compuestos polifenólicos de extractos metanol:agua y la actividad biológica de los polifenoles medida como su capacidad de precipitar proteína (PP), inhibir la eclosión de huevos e inhibir el desenvaine larval de H. contortus.

Material y métodos Lugar de colecta de material de Gymnopodium floribundum El estudio se llevó acabo en el periodo comprendido entre el 18 de diciembre de 2017 y el 21 de diciembre de 2018. Se realizó en un área experimental de SBC de 12,000 m2 (50  240

1170


Rev Mex Cienc Pecu 2021;12(4):1168-1187

m) ubicado en la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Autónoma de Yucatán, México (20°51'93.2'' N y 89°37'11'' O, a 10 msnm). El área experimental cuenta con un clima AW0 (cálido subhúmedo con lluvias en verano). El tipo de suelo se clasifica como cambisol y luvisol. La temperatura máxima promedio fue 32 °C y la mínima de 16 ºC con una precipitación pluvial anual que varía de 984.4 mm a 1,092 mm, distribuida de junio a noviembre(18).

Colecta y producción de extractos de hojas de Gymnopodium floribundum El material vegetativo se cosechó trimestralmente a mano en las siguientes fechas: (a) 18 al 21 de diciembre de 2017 y 2018, (b) 18 al 21 de marzo 2018, (c) 18 al 21 de junio 2018, y (d) 18 al 21 de septiembre de 2018. Se conformaron tres muestras compuestas en los diferentes meses de cosecha. Cada muestra se formó con la totalidad de las hojas de cuatro árboles. Las muestras de hojas de edad variada (EV) incluyeron las hojas de ejemplares no defoliados previamente. Las muestras de hojas de 90 días de edad (E90) se obtuvieron de los mismos ejemplares a los 90 días postcosecha. A las hojas frescas de cada muestra se les añadió metanol:agua (70:30 v/v) y se homogenizaron con una licuadora (Oster®, México) durante < 1 min, hasta lograr un tamaño de partícula homogéneo. A la mezcla se le adicionó ácido ascórbico y se dejó macerar por 24 h. Posteriormente, la mezcla se filtró usando gasa y papel filtro de poro grande No. 50 (Tequimec SDRL, México). Para obtener el extracto, el disolvente (metanol) se evaporó a 50 °C empleando presión reducida (rotavapor Ika®, Alemania). La clorofila y los lípidos se removieron de la fracción acuosa utilizando cloruro de metileno (1:1 v/v, 3-7 lavados). Finalmente, el resto de la fracción se liofilizó, se envasó y se mantuvo en refrigeración a 4 °C hasta su uso.

Determinación de polifenoles en los extractos Se cuantificó la cantidad de fenoles totales (FT), taninos totales (TT) y taninos condensados (TC) de cada extracto obtenido de cada edad y mes de cosecha. La técnica de Folin-Ciocalteu se usó para determinar los FT(19). El contenido de TT se determinó mediante la técnica de Folin-Ciocalteu + PVPP(19). El contenido de TC de los extractos se determinó mediante la prueba de vainillina(20).

Producción de huevos y larvas de Haemonchus contortus Los huevos y larvas en fase infectiva (L3) de H. contortus se obtuvieron de animales donadores infectados artificialmente con H. contortus (aislado Paraíso, Yucatán, México). Se colectaron huevos frescos de las heces de cada animal donante. Las heces de los donantes se colectaron directamente del recto de los mismos, usando bolsas de plástico nuevas y las heces se procesaron en las 3 h siguientes a su recolección. Aproximadamente 10 g de heces

1171


Rev Mex Cienc Pecu 2021;12(4):1168-1187

fueron macerados en 100 ml de agua purificada. La suspensión se filtró con una gasa. El material filtrado se centrifugó (168 xg/5 min/21 °C) usando tubos cónicos de 15 ml. El sobrenadante se desechó y el sedimento se mezcló con una solución saturada elaborada con azúcar de caña comercial (densidad relativa 1.28). Una vez mezclado, el sedimento se homogeneizó mediante un vortex. La suspensión se centrifugó (168 xg/5 min/21 °C). La capa superficial de la solución se recuperó con un asa bacteriológica. Los huevos se lavaron tres veces con agua purificada para eliminar el azúcar restante y se volvieron a suspender en tubos de 15 ml que contenían 10 ml de solución salina de fosfatos (PBS 0.01 M: NaCl 0.138 M, KCl 0.0027 M, KH2PO4 0.001M, Na2HPO4 0.0081M; pH 7.4; Sigma® USA). Se determinó la concentración de huevos y la suspensión se diluyó a 150 huevos / ml de PBS para su uso en la prueba de eclosión de huevos (EH)(12). Para la prueba de inhibición del desenvaine larval (IDL) se recuperaron heces de los animales donadores y se enjuagaron en un colador con agua corriente para eliminar la hierba u otros desechos. Las heces se colocaron en placas Petri (15 cm de diámetro), se incubaron por cinco días a 28 °C y se hidrataron a diario manualmente con un rociador de agua. Las larvas L3 se cosecharon usando la técnica de Baermann y se almacenaron a 4 °C hasta su uso. La edad de las larvas empleadas en la IDL fue de entre 2 y 5 semanas(12,21).

Actividad antihelmíntica in vitro contra huevos de Haemonchus contortus Se prepararon soluciones madre (10,000 μg/ml de PBS) para cada extracto probado. Se usó PBS como control negativo. Se prepararon alícuotas de 0.5 ml de las distintas diluciones (3600, 2400, 1200, 600, 300 y 150 μg/ml de PBS) a partir de la solución madre de cada extracto de planta en placas de 24 pozos. Se adicionaron 0.5 ml de la suspensión de huevos (150 huevos / ml) a cada pozo hasta lograr un volumen final de 1 ml. Se utilizaron seis réplicas para cada concentración de extracto. Las placas de pozos múltiples se incubaron a 28 °C (48 h). Al final de dicho proceso, se agregaron dos gotas de Lugol a cada pozo para detener la eclosión, además de teñir los huevos y las larvas(22, 23). Se contaron los huevos no larvados, los huevos larvados y las larvas L1 de cada pozo y se calculó el porcentaje de eclosión con la fórmula: Eclosión huevos%= (100) (larvas L1) / (huevos larvados + huevos + larvas L1) Para determinar el papel de los polifenoles en el efecto AH de los extractos, se utilizó un inhibidor de los taninos, la polivinilpolipirrolidona (PVPP)(11,19). En estos bioensayos se incluyó únicamente la concentración de 3,600 µg de extracto / ml PBS (con y sin PVPP) y sus respectivos controles PBS(24).

1172


Rev Mex Cienc Pecu 2021;12(4):1168-1187

Prueba de inhibición del desenvaine larval (IDL) de Haemonchus contortus Se agregaron 1,000 μl de suspensión de L3 (∼1,000/ml) a cada tubo para obtener las concentraciones finales de extracto (1,200, 600, 400, 200, 100, 30 μg/ml) a partir de las respectivas soluciones madre de G. floribundum. Como control negativo se usó un tubo que contenía 1,000 μl de PBS sin extracto. Las larvas se incubaron durante 3 h (24 °C). Se colocaron alícuotas de cada suspensión de larvas en microviales (200 μl en cada uno.) con cuatro repeticiones para cada concentración y el control PBS. El desenvaine de L3 fue inducido artificialmente con una solución de hipoclorito (2.2 %) e hidróxido de sodio (0.7 %) (Clorox®) diluido a 1/300, 1/343, 1/400 y 1/480. La cinética del desenvaine se estimó contando larvas con vaina y sin vaina con un microscopio (10x), y se registró el desenvaine a los 0, 20, 40 y 60 min(23). Se calculó el porcentaje de desenvaine de larvas L3 para cada punto de medición usando la siguiente fórmula: Desenvaine (%) = (100) (total de L3 sin vaina) / (L3 con vaina + L3 sin vaina) Para determinar el papel de los polifenoles en el efecto AH de los extractos, se utilizó un inhibidor de taninos, el PVPP(12,19). Para cada extracto se incluyó únicamente la dosis de 1200 µg/ml PBS (con y sin PVPP) y sus respectivos controles PBS.

Precipitación de proteína mediante la técnica de difusión radial Se determinó la PP como un indicador de la actividad biológica de los polifenoles. Se realizó mediante el ensayo de difusión radial(25). La técnica identifica la capacidad de los polifenoles para unirse a moléculas de proteína (por ejemplo la hemoglobina bovina) en una placa con agar. Se preparó gel de agarosa al 1% (Baker®, Alemania) en tampón de acetato y hemoglobina bovina (Sigma®, Alemania) (100 mg/L agar). El pH se ajustó a 5.0 con NaOH. Se colocaron 10 ml de agar en placas de Petri de 10 cm de diámetro. En el agar de cada placa de Petri se formaron cinco pozos de 4 mm de diámetro cada uno (uno en el centro y las cuatro restantes en las posiciones de 0, 90, 180 y 270 grados). En estos últimos se adicionaron 15 μl de una solución de cada extracto y se incubaron durante 48 h a 25 ºC. Al término de ese tiempo se midió el halo que se formó alrededor de cada pozo. Este halo es el resultado de la precipitación de la hemoglobina por acción de los polifenoles de cada extracto. La PP se ponderó por la concentración de TT, FT y TC contenida en cada extracto evaluado. Para esto se utilizó la fórmula descrita por Hagerman(25): PP = ((D22-D12) / T); donde: D1: diámetro menor poceta (mm); D2: diámetro mayor (mm); T: Fenoles totales o taninos totales o taninos condensados (mg).

1173


Rev Mex Cienc Pecu 2021;12(4):1168-1187

Procesamiento de datos y análisis estadísticos Se determinó el efecto de la edad de las hojas (EV o E90) y el mes de cosecha, así como su interacción sobre la composición de polifenoles (FT, TT, TC) mediante respectivos modelos lineales generalizados (MLG). Posteriormente la comparación de medias se realizó mediante la prueba de Tukey con α<0.05(26). Para la prueba de la EH, se registró el número de huevos que permanecieron en estado de mórula (MOE), huevos que desarrollaron una larva, pero no eclosionaron (LFE) y número de larvas que emergieron de los huevos como resultado de su exposición a diferentes extractos en la concentración respectiva previamente descrita. Esta información se utilizó para determinar la tasa de eclosión de huevos (%EH) y la inhibición de la eclosión de huevos (%IEH) de la siguiente manera(24,27): %EH =

Número de larvas × 100 número de huevos morulados + huevos con larva + número de larvas %IEH = 100 − %EH

El porcentaje de huevos morulados que no formaron larva (efecto ovicida) se calculó así: %MOE =

Número de huevos morulados × 100 número de huevos morulados + huevos con larva + número de larvas

El porcentaje de huevos con larva que no eclosionó (%LFE) se calculó así: %LFE =

Número de huevos que contienen larvas × 100 número de huevos morulados + huevos con larva + número de larvas

El porcentaje del desenvaine (%D) y el de inhibición del desenvaine (%IDL) se determinaron con las siguientes fórmulas(28): %D =

Larvas L3 con vaina × 100 larvas con vaina + larvas sin vaina %IDL = 100 − %D

La inhibición de la EH y los resultados de IDL obtenidos para los diferentes extractos se analizaron con los respectivos modelos lineares generalizados (MLG) para evaluar las diferencias entre el control PBS y las diferentes concentraciones de extracto analizados. Los datos obtenidos de las incubaciones de PVPP de cada extracto se analizaron usando un diseño completamente al azar (MLG con comparaciones realizadas con el grupo control respectivo para cada extracto)(26).

1174


Rev Mex Cienc Pecu 2021;12(4):1168-1187

La concentración efectiva requerida para inhibir el 50 % de la eclosión de huevos, o el 50 % del desenvaine de las L3 (concentración efectiva 50 %; CE50) se estimó con los datos obtenidos de las pruebas de EH e IDL respectivamente para cada extracto de planta probado usando el software PoloPlus 1.0(29). Se realizó la prueba de Shapiro-Wilk para evaluar la normalidad de los datos de PP, EH e IDL. Se analizó la actividad biológica respectiva (PP, EH e IDL) mediante un MLG y los efectos principales de la edad de las hojas (EV y E90) y el mes de cosecha (cuatro meses de cosecha), así como su interacción. La comparación de medias se realizó mediante la prueba de Tukey con α<0.05. Adicionalmente se realizaron respectivas correlaciones de Pearson para determinar la asociación entre el contenido de polifenoles (FT, TT y CT), y la PP, así como de las CE50 de EH e IDL respectivamente(26).

Resultados En el Cuadro 1 se muestra el contenido de FT, TT y TC, en los extractos de las muestras compuestas de hojas de G. floribundum de diferentes edades. El contenido de FT y TT no fue modificado por el mes de cosecha, la edad o la interacción (P>0.05). Sin embargo, sí se encontraron diferencias significativas en el contenido de TC debidas a la interacción entre la edad de las hojas y el mes de cosecha, como se puede apreciar para los extractos de marzo (secas) y de junio (lluvias) de las hojas EV (P<0.05). Así mismo, en el mes de junio (lluvia) se observó un mayor contenido de TC en las hojas EV que en las hojas E90 (P<0.05). Cuadro 1: Efecto de la edad de las hojas y del mes de cosecha sobre el contenido de polifenoles en los extractos metanol:agua de hojas de Gymnopodium floribundum Fenoles Taninos Taninos Totales (%) totales (%) condensados (%)* Extractos de hojas de edad variable (EV) Diciembre 19.3ª 2.9ª 65.9ab Marzo 20.2ª 4.4ª 48.7b Junio 28.2ª 6.7ª 131.7ª Septiembre 26.1ª 10.4ª 106.9ab Extractos de hojas de edad de 90 días (E90) Diciembre 20.0ª 5.4ª 69.5ab Marzo 20.8ª 9.0ª 65.9ab Junio 24.5ª 6.4ª 49.8b Septiembre 27.6ª 12.9ª 99.2ab Error Estándar 1.83 2.80 13.50 a,b

Diferentes literales en la misma columna indican diferencias a P<0.05. *: Equivalentes a catequina.

1175


Rev Mex Cienc Pecu 2021;12(4):1168-1187

Prueba de eclosión de huevos (EH) El extracto de hojas EV cosechadas en diciembre fue el único que mostró actividad sobre la EH de H. contortus (CE50 = 374.4 μg/ml). En el Cuadro 2 se puede observar que los extractos de hojas E90 de G. floribundum de diciembre, junio y septiembre mostraron una baja actividad sobre la EH (CE50 >1,500 μg/ml), mientras que para el extracto de marzo no fue posible calcular la CE50. Cuadro 2: Efecto de la edad de las hojas y del mes de cosecha sobre la concentración efectiva (CE50) e intervalo de confianza de los extractos metanol: agua de hojas de Gymnopodium floribundum sobre la eclosión de huevos de Haemonchus contortus CE50 IC95% (μg/ml) (μg/ml) Extractos de hojas de edad variable (EV) Diciembre 374.4ª 282.08 - 473.66 Marzo Sin actividad Junio Sin actividad Septiembre Sin actividad Extractos de hojas de 90 días de edad (E90) Diciembre 3088.3b 2262.45 - 4192.55 Marzo Sin actividad b Junio 1907.5 1783.75 - 2029.55 b Septiembre 1575.0 981.26 - 2395.96 a,b

Diferentes literales en la misma columna indican diferencias a P<0.05.

En el Cuadro 3 se aprecia el efecto de bloquear los polifenoles mediante PVPP sobre la proporción de MOE, LFE y L1 de huevos incubados con los diferentes extractos de G. floribundum. Los diferentes extractos mostraron una actividad más orientada a retener a las larvas L1 dentro de los huevos (LFE). Sin embargo, al bloquear a los polifenoles se observó mayor actividad ovicida para los extractos de hojas EV (diciembre y marzo). Los análisis de correlación no mostraron asociación entre el contenido de FT, TT o TC, y la CE50 de inhibición de la eclosión de huevos (P>0.05).

1176


Rev Mex Cienc Pecu 2021;12(4):1168-1187

Cuadro 3: Efecto de la incubación de huevos de Haemonchus contortus en diferentes extractos de Gymnopodium floribundum a la concentración de 3,600 μg/ml, con y sin polivinilpolipirrolidona (PVPP), sobre la proporción (%) de huevos que permanecieron en estado de mórula (MOE), larvas sin eclosionar de sus huevos (LFE) y larvas (L1) Etapa de PBS 3,600 μg/ml 3,600 μg/ml Error vida (%) (%) + PVPP (%) estándar Extracto de hojas de edad variable (EV) Diciembre MOE 5.14a 8.60b 12.97a 4.40 a b c LFE 1.60 66.69 86.33 2.65 a b c L1 93.25 24.71 0.70 2.52 a a Marzo MOE 4.91 7.72ª 13.67 3.56 a b c LFE 0.62 28.60 82.80 0.79 a b c L1 94.46 63.69 3.54 3.97 a a Junio MOE 2.35 4.62ª 29.27 8.13 a b LFE 1.22 22.25ª 33.37 8.41 a b L1 96.42 73.13ª 35.37 8.12 a a Septiembre MOE 7.37 9.86ª 10.16 1.11 a b b LFE 0.14 25.11 26.58 0.94 a b b L1 92.50 65.03 63.27 1.69 Extractos de hojas de 90 días de edad (E90) Marzo MOE 7.37a 9.86b 10.16c 0.77 a b c LFE 0.14 25.11 26.58 0.82 L1 92.50a 65.03b 63.27b 1.37 a b c Junio MOE 0.37 3.48 41.09 0.77 a b c LFE 9.21 25.83 83.55 2.46 a b c L1 90.42 70.69 2.36 3.11 a a Septiembre MOE 11.66 15.91ª 15.28 3.14 a b b LFE 0.14 37.61 34.11 0.90 a b b L1 88.20 46.47 50.61 1.90 a b a Diciembre MOE 10.95 19.52 11.74 2.02 a b b LFE 0.48 33.13 34.85 0.96 a b c L1 88.57 47.35 53.41 2.06 abc

Diferentes letras en la misma fila indican diferencia significativa entre los grupos PBS, extracto y extracto+PVPP (P<0.05).

1177


Rev Mex Cienc Pecu 2021;12(4):1168-1187

Prueba de inhibición del desenvaine larval (IDL) La CE50 obtenida con los diferentes extractos de G. floribundum de hojas EV y E90 con la prueba de IDL, se presenta en el Cuadro 4. Se observó un efecto significativo de la interacción entre edad de hojas y mes de cosecha. En el caso de los extractos de hojas EV, todos los meses de cosecha mostraron diferente actividad, siendo el extracto de junio el más activo y el de marzo el menos activo (P<0.05). Por su parte, los extractos de hojas E90 también fueron diferentes para cada mes (P<0.05), siendo el más activo el de septiembre y el menos activo el de junio. Cuadro 4: Efecto de la edad de las hojas y del mes de cosecha sobre la concentración efectiva (CE50) e intervalo de confianza de los extractos de hojas de Gymnopodium floribundum sobre el desenvaine de L3 de Haemonchus contortus CE50 IC95% (μg/ml) (μg/ml) Extractos de hojas de edad variada (EV) Diciembre 199.9ef 136.67 - 279.12 gh Marzo 283.5 207.27 - 382.01 Junio 80.4ª 55.83 - 104.55 bc Septiembre 146.1 119.93 - 175.37 Extractos de hojas de 90 días de edad (E90) Diciembre 168.3de 134.10 - 205.21 cd Marzo 146.1 119.93 - 175.37 fg Junio 263.6 245.33 - 281.28 ab Septiembre 108.4 81.41 - 139.02 abcdefgh

Diferentes letras en la misma columna indican una diferencia significativa (P<0.05).

En el Cuadro 5 se presenta el efecto de los extractos de hojas de G. floribundum de diferente edad y mes de cosecha sobre los porcentajes de IDL de las L3 de H. contortus, con o sin la adición de PVPP para bloquear a los polifenoles. El uso de PVPP mostró que la inhibición del desenvaine se debe parcialmente a los polifenoles, y hace evidente que otros CS participan en la IDL. Además, los análisis de correlación no mostraron asociación entre los contenidos de FT, TT o TC, y la CE50 de IDL.

1178


Rev Mex Cienc Pecu 2021;12(4):1168-1187

Cuadro 5: Efecto de la incubación de L3 de Haemonchus contortus en diferentes extractos metanol:agua de Gymnopodium floribundum con y sin polivinilpolipirrolidona (PVPP) sobre el porcentaje de inhibición del desenvaine PBS 1,200 μg/ml 1,200 μg/ml + PVPP Error (%) (%) (%) estándar Extractos de hojas de edad variada (EV) Diciembre 0.2ª 100.0b 60.0c 6.75 a b c Marzo 0.0 100.0 65.5 9.94 b a Junio 3.4ª 100.0 45.7 20.80 a b b Septiembre 2.9 100.0 79.3 13.25 Extractos de hojas de 90 días de edad (E90) Diciembre 2.1a 92.0b 36.6a 9.24 a b b Marzo 3.1 100.0 53.5 11.18 a b c Junio 0.3 100.0 76.1 3.34 a b b Septiembre 0.4 100.0 86.7 2.51 abc

Diferentes letras en la misma columna indican una diferencia significativa (P<0.05).

Prueba de difusión radial para medir la precipitación de proteína (PP) La PP obtenida con los extractos de hojas de G. floribundum no mostró diferencias debidas a la edad de las hojas o el mes de cosecha (Cuadro 6). El análisis de correlación demostró que un mayor contenido de FT, TT o TC en los extractos no influyó sobre la PP. Cuadro 6: Efecto de la edad y mes de cosecha de hojas de Gymnopodium floribundum sobre la precipitación de proteína (PP) medida por el método de difusión radial y su relación con el contenido de fenoles totales (FT), taninos totales (TT) y taninos condensados (TC) PP-FT (mm/mg)

PP-TT (mm/mg)

PP-TC (mm/mg)

Extractos de hojas de edad variada (EV) Diciembre 9.29ª 64.65ª 2.75ª Marzo 9.23ª 43.15ª 4.38ª Junio 8.29ª 34.96ª 1.87ª Septiembre 9.37ª 40.69ª 2.29ª Extractos de hojas de 90 días de edad (E90) Diciembre 10.05ª 42.65ª 2.09ª Marzo 11.95ª 40.69ª 3.79ª Junio 7.93ª 38.14ª 4.68ª Septiembre 9.57ª 28.34ª 2.68ª Error estándar 1.03 11.05 0.63 a Valores en columnas con la misma literal no difieren significativamente P>0.1

1179


Rev Mex Cienc Pecu 2021;12(4):1168-1187

Discusión Composición de polifenoles en los extractos de Gymnopodium floribundum Los valores reportados en el presente estudio para FT y TT son semejantes a los reportados previamente para extractos metanol:agua y acetona:agua elaborados con hojas de la misma especie de planta(11,12). Un aspecto interesante del contenido de FT y TT es que se mantuvieron relativamente constantes para los diferentes extractos independientemente de la edad de las hojas o el mes de cosecha. En el caso de los FT, esto pudiera deberse a que la planta necesita una cantidad constante de estos compuestos ya que son intermediarios de diferentes rutas biosintéticas de la planta(30). En el caso de los TT, que son compuestos más complejos, la semejanza en su contenido pudiera deberse a que estos son afectados por variables distintas a las dos evaluadas en el presente estudio. En cuanto al contenido de TC, solo se tiene un estudio previo de un extracto de G. floribundum elaborado con hojas EV obtenido en época de seca(11) y en éste se reportó un valor semejante al de hojas EV de marzo del presente estudio. Sin embargo, el presente estudio mostró que existen diferencias en el contenido de TC debidas a la interacción entre edad de hojas y mes de cosecha. La variación en el contenido de TC de hojas de G. floribundum debidas al mes de cosecha ya habían sido sugeridas previamente(1,13,31). La diferencia en el contenido de TC fue solo evidente entre las hojas EV de marzo (mes de sequía) y junio (mes de lluvias), y de éstas últimas con respecto a las hojas E90 de junio. El mayor contenido de TC en las hojas EV de junio pudiera deberse a que las plantas usan los TC como una herramienta para defenderse de hongos y bacterias que proliferan en lluvias. Por otro lado, las hojas E90 no presentaron un mayor contenido de TC, en comparación con las hojas EV. Esto pudiera deberse a que los árboles de donde se cosecharon las hojas E90 fueron completamente defoliados 90 días antes. Por lo tanto, las hojas E90, que estaban en pleno crecimiento, tal vez no podían invertir más recursos de la planta en producir sustancias de defensa.

Actividad antihelmíntica de extractos metanol:agua Prueba de inhibición de la eclosión de huevos (EH) El extracto de hojas EV de diciembre inhibió significativamente la eclosión de huevos de H. contortus y esa inhibición se logró a una CE50 menor que la reportada previamente para el mismo tipo extracto de hojas EV(11). Por otro lado, tres de los extractos de hojas E90 (junio, septiembre y diciembre) inhibieron la EH, aunque estos extractos tuvieron una CE50 más alta que la reportada para hojas EV de este estudio y el reporte previo(11). Con excepción del extracto de hojas EV de marzo, la nula o baja actividad sobre la EH por parte de los extractos

1180


Rev Mex Cienc Pecu 2021;12(4):1168-1187

metanol:agua de G. floribundum es similar a la reportada para otras plantas ricas en polifenoles y se ha sugerido que esta baja actividad contra huevos se debe a que los CS que se obtienen utilizando metanol o acetona como disolventes orgánicos(11,24,27). El presente estudio confirmó también que la actividad contra huevos de H. contortus en los extractos metanol:agua de G. floribundum se manifiesta como la presencia de larvas atrapadas dentro de los huevos (LFE), tal como había sido reportado(12,24,27). Así mismo, el uso de PVPP confirmó que los polifenoles no explican la actividad de inhibición de la EH, sino que el bloqueo de polifenoles incrementó el efecto de LFE en los meses de diciembre, marzo y junio para los extractos de hojas EV (P<0.05), y en los meses de marzo y junio para los extractos de hojas E90 (P<0.05). Prueba de inhibición del desenvaine larval (IDL) de Haemonchus contortus Todos los extractos de hojas de G. floribundum inhibieron el desenvaine de L3 de H. contortus. Estos resultados coinciden con los estudios previos usando extractos de G. floribundum, ya sea metanol:agua(11) o acetona: agua(12,13). La mejor CE50 se observó para el extracto de hojas EV del mes de junio (P<0.05), que a su vez fue el extracto con la mayor concentración de TC. Esta mayor actividad AH coincide con el momento en que G. floribundum empieza su mayor producción de hojas (época de lluvias)(15). Como se mencionó, en la época de lluvias la planta pudiera usar los TC de sus hojas para defenderse del ataque de insectos, hongos y bacterias(4). El alto contenido de TC en los meses de lluvia pudiera también limitar el ataque de herbívoros vertebrados como es el caso de los rumiantes, ya que estudios recientes demuestran que los pequeños rumiantes consumen menos follaje de G. floribundum en época de lluvias comparado con la época de seca(1,2). Coincidentemente, es en la época de seca que las hojas de G. floribundum contienen menos TC(15). Los extractos de G. floribundum disminuyeron su actividad de IDL cuando los polifenoles fueron bloqueados con el PVPP (P<0.05). Sin embargo, el PVPP solo bloqueó parcialmente la actividad de IDL de los extractos. Esto pudiera deberse a dos fenómenos: (a) no se usó suficiente PVPP para bloquear a todos los polifenoles en la solución, y (b) existen otros CS que son parcialmente responsables de la actividad IDL. Cualquiera de los dos fenómenos pudieran explicar la ausencia de correlación entre la actividad de IDL y los contenidos de FT, TT y TC. Esto sugiere que se deberían explorar dosis crecientes de PVPP cuando se realiza la prueba de IDL, para confirmar que la dosis usada sí bloquea a la mayoría o totalidad de los polifenoles. Por otro lado, sería necesario explorar qué otros CS pudieran ayudar a explicar la actividad de IDL no asociada a los polifenoles. Esto requeriría de un proceso de fraccionamiento biodirigido. Este tipo de proceso ha pemitido identificar la actividad de cromenona(32) y de derivados de ácidos fenólicos (cafeico, cumárico) sobre la inhibición de la eclosión de huevos de NGI de rumiantes(33,34).

1181


Rev Mex Cienc Pecu 2021;12(4):1168-1187

Ensayo de precipitación de proteína Se observó que todos los extractos precipitaron la proteína hemoglobina. Esto corrobora la actividad de PP que se ha reportado para otros árboles forrajeros ricos en polifenoles de Yucatán(14). Sin embargo, estos autores determinaron que el extracto acetona:agua de A. pennatula tuvo fuerte asociación entre FT y la PP. En el caso de G. floribundum no se encontró correlación entre contenido de polifenoles y la PP. Lo anterior pudiera representar una oportunidad para que futuros trabajos de investigación pudieran ayudar a seleccionar individuos que den lugar a variedades de plantas con diferente contenido de polifenoles o con diferente actividad biológica de PP. Es necesario identificar qué factores adicionales influyen sobre la expresión de polifenoles en las hojas o su capacidad de PP. En este estudio se confirmó que los extractos de G. floribundum precipitan proteínas independientemente del mes de cosecha, edad de hojas o su contenido de polifenoles. Por lo tanto, los ovinos y caprinos pudieran aprovechar la actividad biológica (PP) de las hojas de G. floribundum como parte de una estrategia para sobrevivir en un ambiente donde predominan plantas ricas en proteínas (leguminosas). Esto es consistente con la hipótesis de que ovinos y caprinos pudieran consumir el follaje de G. floribundum para bloquear parte de la proteína de la dieta y ayudar a reducir la vía de eliminación de nitrógeno en la orina que es muy costosa para el animal(2,8). Dado que los extractos mostraron una buena PP medida con hemoglobina, se sugiere evaluar esta actividad de PP empleando otras proteínas que pudieran estar más cercanamente relacionadas con la actividad AH contra H. contortus. Por ejemplo, se podrían obtener proteínas directamente de las L3 (con o sin vaina) de H. contortus ya que estas fases de vida estarían en contacto con los polifenoles en el tracto gastrointestinal. Este contacto con los polifenoles se produce desde que entran en la boca del rumiante y se mantienen en contacto a lo largo del esófago, retículo-rumen, omaso y abomaso, hasta que realizan la invasión de la mucosa abomasal para establecerse y pasar a L4. También pudiera evaluarse la PP usando proteína de huevos de H. contortus, ya que estos están en contacto con los polifenoles a lo largo de todo el tránsito desde su salida del útero del gusano hembra, pasando por el abomaso, intestinos delgado y grueso hasta llegar a las heces. Estas evaluaciones pudieran servir como modelo para estudiar la interacción parásito-hospedero-planta.

Conclusiones e implicaciones Existen diferencias en la composición de TC asociadas a la interacción entre la edad de las hojas y el mes de cosecha en los extractos metanol:agua de hojas de G. floribundum. La actividad de inhibición de la eclosión de huevos fue evidente solo en el extracto de hojas EV de diciembre, y tres extractos de hojas E90 presentaron actividad a altas concentraciones. Todos los extractos mostraron actividad de inhibición del desenvaine de larvas L3, siendo el

1182


Rev Mex Cienc Pecu 2021;12(4):1168-1187

extracto de hojas EV de junio el que tuvo mejor actividad. Los polifenoles de los extractos mostraron actividad de PP y se asociaron a la inhibición del desenvaine larval de H. contortus. Sin embargo, no explican la actividad contra huevos de H. contortus. La principal implicación del presente trabajo fue demostrar por primera vez que los FT y TT de extractos de hojas de G. floribundum no son modificados significativamente por la edad de las hojas y mes de cosecha, en tanto que los TC sí varían. Además, se demostró que la actividad biológica de los polifenoles es fuerte para la PP, es parcial para la IDL y es independiente de la EH. Esta información sirve como base para la toma de decisiones con respecto a la aplicación de las hojas de G. floribundum en la nutrición de rumiantes y para la evaluación del potencial nutraceútico contra H. contortus. La variabilidad encontrada también indica que existe potencial para la selección de individuos de esta especie que se orienten hacia un mayor o menor contenido o actividad de TC. Agradecimientos Al CONACYT-México por el financiamiento de este trabajo (Proyecto-CB-2013-01221608). G.I. Ortíz-Ocampo reconoce al Consejo Nacional de Ciencia y Tecnología de México (CONACYT) por la beca otorgada para su estudio de doctorado (referencia 257653). Mancilla-Montelongo agradece el financiamiento del “Programa de Investigadores e Investigadoras por México” CONACYT (Proyecto No. 692). Agradecemos a todo el equipo del Campus su valiosa contribución durante el trabajo de campo: P.G. González-Pech, J. Ventura-Cordero, F.A. Méndez-Ortiz, E. Ramos-Bruno y F. Torres-Salazar. También agradecemos a los tutores: V. Parra-Tabla, J.J. Ortíz-Díaz, L.R. Borges-Argáez. Agradecemos también el apoyo de I.C. Trinidad-Martínez en el laboratorio de Diagnóstico de la FMVZ-UADY. onflicto de intereses Los autores declaramos no tener conflicto de interés con la publicación del presente estudio. Literatura citada: 1. González-Pech PG, Torres-Acosta JFJ, Sandoval-Castro CA, Tun-Garrido J. Feeding behavior of sheep and goats in a deciduous tropical forest during the dry season: the same menu consumed differently. Small Ruminant Res 2015;(133):128-134. 2.

Ventura-Cordero J, González-Pech PG, Torres-Acosta JFJ, Sandoval-Castro CA, TunGarrido J. Sheep and goat browsing a tropical deciduous forest during the rainy season: why does similar plant species consumption result in different nutrient intake? Anim Prod Sci 2019;59(1):66-72.

1183


Rev Mex Cienc Pecu 2021;12(4):1168-1187

3.

Cuevas-Glory L, Sosa-Moguel O, Ortiz-Vázquez E, Sauri-Duch E, Pino A. Volatile constituents of tzizilché flower (Gymnopodium floribundum Rolfe) from Yucatán Peninsula, Mexico. J Esse Oil Res 2012;(24):359-361.

4.

Ek de Val. Herbivoría. En: Ecología y evolución de las interacciones bióticas. En: Ek de val, Boege K, editors. Ecología y evolución de las interacciones bióticas. 1a ed. México, DF: FCE, Fondo de Cultura Económica 2012:43-75.

5.

Graça MAS, Bärlocher F. Radial diffusion assay for tannins. In: Bärlocher F, et al. editors. Methods to study litter decomposition. Germany Springer 2020;163-167.

6.

Zimmer M, Topp W. Species-specific utilization of food sources by sympatric woodlice (Isopoda: Oniscidea). J Anim Ecol 2008;68(6):1071-1082.

7.

Min BR, Barry TN, Atwood GT, McNabb WC. The effect of condensed tannins on the nutrition and health of ruminants fed fresh temperate forages: a review. Anim Feed Sci Tech 2003;106(1-4):3-19.

8.

Torres-Fajardo RA, Navarro-Alberto JA, Ventura-Cordero J, González-Pech PG, Sandoval-Castro CA, Chan-Pérez JI, et al. Intake and selection of goats grazing heterogeneous vegetation: effect of gastrointestinal nematodes and condensed tannins. Rangel Ecol Manag 2019;72(6):946-953.

9.

Bennick A. Interactions of plant polyphenols with salivary proteins. Crit Rev Oral Biol Med 2002;13(2):184-196.

10. Makkar HPS, Francis G, Becker K. Bioactivity of phytochemicals in some lesser-known plants and their effects and potential applications in livestock and aquaculture production systems. Anim 2007;1(9);1371–1391. 11. Castañeda-Ramírez GS, Torres-Acosta JFJ, Sandoval-Castro CA, González-Pech PG, Parra-Tabla VP, Mathieu C. Is there a negative association between the content of condensed tannins, total phenols, and total tannins of tropical plant extracts and in vitro anthelmintic activity against Haemonchus contortus eggs? Parasitol Res 2017;116(12): 3341-3348. 12. Castañeda-Ramírez GS, Rodríguez-Labastida M, Ortíz-Ocampo GI, González-Pech PG, Ventura-Cordero J, Borges-Argáez R, et al. An in vitro approach to evaluate the nutraceutical value of plant foliage against Haemonchus contortus. Parasitol Res 2018;117(12):3979-3991.

1184


Rev Mex Cienc Pecu 2021;12(4):1168-1187

13. Méndez-Ortiz FA, Sandoval-Castro CA, Ventura-Cordero J, Sarmiento-Franco LA, Santos-Ricalde RH, Torres-Acosta JFJ. Gymnopodium floribundum fodder as a model for the in vivo evaluation of nutraceutical value against Haemonchus contortus. Trop Anim Health Prod 2019;51(6):1501-1599. 14. Alonso-Díaz MA, Torres-Acosta JFJ, Sandoval-Castro CA, Capetillo-Leal CM. Polyphenolic compounds of nutraceutical trees and the variability of their biological activity measured by two methods. Trop Subtrop Agroecosyst 2010;12(3):649-656. 15. Ortiz-Ocampo GI, Sandoval-Castro CA, González-Pech PG, Mancilla-Montelongo G, Ventura-Cordero J, Castañeda-Ramírez GS, et al. Month of harvest and age of leaves are key modifiers of the bromatological composition and polyphenol content of Gymnopodium floribundum leaves. Flora [sometido] 2021. 16. Hoste H, Torres-Acosta JFJ, Alonso-Díaz MA, Brunet S, Sandoval-Castro C, Houzangbe-Adote S. Identification and validation of bioactive plants for the control of gastrointestinal nematodes in small ruminants. Trop Biomed 2008;25(1):56-72. 17. Verma N, Shukla S. Impact of various factors responsible for fluctuation in plant secondary metabolites. J Appl Res Med and Arom Plants 2015;2(4):105-113. 18. García E. Modificaciones al Sistema de clasificación climática de Köppen. Quinta ed. Instituto de Geografía, Universidad Nacional Autónoma de México (UNAM). México. 2004:90. 19. Makkar HPS. Quantification of tannins in tree and shrub foliage. A laboratory manual. Food and Agriculture Organization of the United Nations/International Atomic Energy Agency (FAO/IAEA), Vienna, Austria 2003:49-53. 20. Price ML, Van-Scoyoc S, Butler LG. A critical evaluation of the vanillin reaction assay for tannin in sorghum grain. J Agric Food Chem 1978;26(5):1214-1218. 21. Castañeda-Ramírez GS, Matheieu C, Vilarem G, Hoste H, Mendoza-de-Gives P, González-Pech PG, et al. Age of Haemonchus contortus third stage infective larvae is a factor influencing the in vitro assessment of anthelmintic properties of tannin containing plant extracts. Vet Parasitol 2017;243(30):130-134. 22. Von Samson-Himmelstjerna G, Coles GC, Jackson F, Bauer C, Borgsteede F, Cirak VY, et al. Standardization of the egg hatch test for the detection of benzimidazole resistance in parasitic nematodes. Parasitol Res 2009;105(3):825-834.

1185


Rev Mex Cienc Pecu 2021;12(4):1168-1187

23. Jackson F, Hoste H. In vitro methods for the primary screening of plant products for direct activity against ruminant gastrointestinal nematodes. In: Vercoe PE, et al. editors. In vitro screening of plant resources for extra-nutritional attributes in ruminants: Nuclear and related methodologies. UK: Springer; 2010:25-45. 24. Vargas-Magaña JJ, Torres-Acosta JFJ, Aguilar-Caballero AJ, Sandoval-Castro CA, Hoste H, Chan-Pérez JI. Anthelmintic activity of acetone-water extracts against Haemonchus contortus eggs: interactions between tannins and other plant secondary compounds. Vet Parasitol 2014;206(3-4):322-327. 25. Hagerman AE. Radial diffusion method for determination tannin in plant extracts. J Chem Ecol 1987;13(3):437-449. 26. Minitab 16 Statistical software 2013. Computer software Minitab ver.16.2.4. State College, PA: Minitab Inc. (www.minitab.com). Accessed: Nov 3, 2020. 27. Chan-Pérez JI, Torres-Acosta JFJ, Sandoval-Castro AC, Hoste H, Castañeda-Ramírez GS, Vilarem G, et al. In vitro susceptibility of ten Haemonchus contortus isolates from different geographical origins towards acetone:water extracts of two tannin rich plants. Vet Parasitol 2016;(217):53-60. 28. Chan-Pérez JI, Torres-Acosta JFJ, Sandoval-Castro AC, Castañeda-Ramírez GS, Vilarem G, Mathieu C, et al. Susceptibility of ten Haemonchus contortus isolates from different geographical origins towards acetone:water extracts of polyphenol-rich plants. Part 2: Infective L3 larvae. Vet Parasitol 2017;(240):11-16. 29. LeOra Software. Polo Plus. Probit and logit analysis. Berkeley, California, U.S.A., LeOra Software. 2004. 30. Winkel-Shirley B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol 2001;126(2):485-493. 31. Ventura-Cordero J, González-Pech PG, Jaimez-Rodríguez PR, Ortiz-Ocampo GI, Sandoval-Castro CA, Torres-Acosta JFJ. Gastrointestinal nematode infection does not affect selection of tropical foliage by goats in cafeteria trial. Trop Anim Health Prod 2017;49(1):97-104. 32. Von Son-de Fernex E, Alonso-Díaz MÁ, Valles-de la Mora B, Mendoza-de Gives P, González-Cortazar M, Zamilpa A. Anthelmintic effect of 2H-chromen-2-one isolated from Gliricidia sepium against Cooperia punctata. Exp Parasitol 2017;(178):1-6.

1186


Rev Mex Cienc Pecu 2021;12(4):1168-1187

33. Castillo-Mitre GF, Olmedo-Juárez A, Rojo-Rubio R, González-Cortázar M, Mendozade Gives P, Hernández-Beteta EE, et al. Caffeoyl and coumaroyl derivatives from Acacia cochliacantha exhibit ovicidal activity against Haemonchus contortus. J Ethnopharmacol 2017;(204):125-131. 34. Castañeda-Ramírez GS, Torres-Acosta JFJ, Sandoval-Castro CA, Borges-Argáez R, Cáceres-Farfán M, Mancilla-Montelongo G, et al. Bio-guided fractionation to identify Senegalia gaumeri leaf extract compounds with anthelmintic activity against Haemonchus contortus eggs and larvae. Vet Parasitol 2019;(270):13-19.

1187


https://doi.org/10.22319/rmcp.v12i4.5144 Artículo

Análisis morfométrico y molecular (ADNmt) de abejas melíferas (Apis mellifera L.) en el estado de Tabasco, México

Juan Florencio Gómez Leyva a Omar Argüello Nájera b Pablo Jorge Vázquez Encino c Luis Ulises Hernández Hernández d Emeterio Payró de la Cruz c*

a

Tecnológico Nacional de México. Campus Instituto Tecnológico de Tlajomulco Jalisco, Laboratorio de Biología Molecular. Km 10 Carretera a San Miguel Cuyutlán. Tlajomulco de Zúñiga, Jalisco, México. b

El Colegio de la Frontera Sur (ECOSUR-San Cristóbal, Chiapas). San Cristóbal L.C. Chiapas. México. c

Tecnológico Nacional de México. Campus Instituto Tecnológico de la Zona Olmeca. Laboratorio de Biología. Zaragoza s/n. Villa Ocuiltzapotlán, Centro, Tabasco, México. d

Universidad Juárez Autónoma de Tabasco. División Académica de Ciencias Agropecuarias. Tabasco. México.

*Autor de correspondencia: epayro@itzonaolmeca.edu.mx

Resumen: La apicultura en México se sostiene con subespecies de abejas (Apis mellifera L) europeas y africanizadas. Debido a la dificultad en la diferenciación morfológica de las poblaciones Europeas (E) y Africanizadas (A) de A. mellifera, el objetivo de este trabajo fue realizar un análisis comparativo entre la técnica morfométrica FABIS, contra el diagnóstico empleando el polimorfismo en la longitud de los fragmentos de restricción (RFLP) del ADN 1188


Rev Mex Cienc Pecu 2021;12(4):1188-1207

mitocondrial (ADNmt). Se emplearon muestras de abejas procedentes de 135 colonias comerciales (CC), 15 colonias pie de cría (CPC) y 3 colonias silvestres (CS) localizados en diferentes municipios del estado de Tabasco (N=153). Ambos métodos de diagnóstico, identificaron a las CPC como europeas y las CS como africanizadas, pero en las CC el método FABIS no pudo definir 9 colonias, dándolas como sospechosas (S) y otras 50 no coincidieron con el resultado del método molecular, por lo que, en total ambos métodos coincidieron en 94 identificaciones (61.44 %). El agrupamiento bayesiano basado en el análisis de las doce variables morfométricas mostró que las categorías A-CC y E-CC, forman un grupo cercano a la categoría E-CPC; mientras que la categoría A-CS presentó la mayor distancia formando un grupo aislado. Por lo tanto, abejas de CC tienen características morfométricas tendientes a abejas E-CPC. Este trabajo también pretende ser una contribución a la falta de registros sobre la africanización en el estado de Tabasco. Se recomienda emplear el método molecular para discriminar entre abejas E/A, por no estar afectado por los factores ambientales. Palabras clave: Colonias, Africanización, PCR, Morfometría, ADNmt.

Recibido: 12/11/2018 Aceptado: 08/04/2021

Introducción Existen al menos 24 subespecies de Apis mellifera agrupadas en cuatro ramas evolutivas principales: Línea O (Oriente próximo), línea A (Africana), línea M (Mediterráneo occidental) y línea C (Mediterráneo central y sureste de Europa)(1). En 1956, con el objetivo de estudiar la adaptación a los climas tropicales y mejorar la producción de miel, abejas reinas africanas (A. mellifera scutellata) y sus híbridos fueron importadas de Sudáfrica a Brasil(2,3). En 1957 el escape de las abejas en Brasil, dio lugar al cruzamiento masivo con las abejas locales de origen europeo, lo cual generó poblaciones con genotipos híbridos denominadas africanizadas(4). En México la abeja africanizada fue primeramente identificada en septiembre de 1986, cuando un enjambre fue atrapado e identificado cerca de Tapachula, Chiapas, en la zona fronteriza con Guatemala(5,6). Posteriormente se reportó la presencia de abejas africanizadas colectadas en 1987 en los municipios de Tenosique y Centla, Tabasco, así como en los municipios de Coatzacoalcos Veracruz, Palenque Chiapas y Hopelchen Campeche(7). En la península de Yucatán, las abejas silvestres africanizadas (descendientes de A. mellifera scutellata), fueron reportadas en 1987(8). Diversos estudios han demostrado que la abeja Apis mellifera scutellata posee cualidades que merecen destacarse; 1189


Rev Mex Cienc Pecu 2021;12(4):1188-1207

principalmente son productoras de miel en climas templados, toleran ambientes fríos, son prolíficas padeciendo menos enfermedades por parasitosis que otras razas(9). Las abejas africanizadas tienden a recolectar más polen y más propóleos que las abejas europeas (10). Debido a su mayor capacidad de adaptación al medio ambiente tropical, se encuentran ampliamente distribuidas en el continente americano(11). De acuerdo con FAOSTAT(12) hasta 2019, China generó la mayor producción y exportación de miel a nivel mundial, con 120,845 t exportadas, seguido de India (65,351 t exportadas), Argentina (63,522 t), Ucrania (54,834 t), Brasil (30,039 t), Alemania (25,239 t) y México (25,122 t). En México, durante el periodo de enero a noviembre de 2020 las exportaciones de miel alcanzaron las 26,077 t, lo que significó un aumento de la demanda en un 3.66 %, comparado con el año 2019. El 62.86 % de la producción de miel (toneladas) en 2020, se concentró en siete estados, entre los que destacaron Jalisco (6,059), Yucatán (5,529), Chiapas (5,434), Campeche (5,375), Veracruz (4,645), Oaxaca (4,533) y Puebla (2,450). Tabasco sólo reportó una producción de 405 t, ocupando el lugar 25, como productor de miel a nivel nacional, muy inferior a sus estados vecinos(13), a pesar de disponer de recursos botánicos para el desarrollo de la apicultura. Estos datos reflejan la magnitud de la problemática de la apicultura en esta entidad ubicada en el trópico húmedo mexicano. Actualmente la apicultura en México se practica con abejas africanizadas y diversas subespecies de abejas europeas que fueron introducidas a México tales como Apis mellifera mellifera y Apis mellifera ligustica. En el estado de Tabasco, los genotipos de abejas que coexisten, mediante cruzamientos naturales sucesivos, han generado un pool genético de abejas africanizadas del que no se cuenta con suficientes reportes que permitan valorar su dinámica poblacional y sus efectos en la productividad. Una limitante es que son muy difíciles de identificar por sus características morfométricas externas(9), sin embargo existen diversas técnicas moleculares(14,15); las cuales se han utilizado exitosamente en diversos estudios relativos a la estructura, diversidad genética y filogenia, determinación de mitotipos y flujo genético de las poblaciones de abejas(16-22). En el presente estudio se hizo un análisis comparativo entre la técnica morfométrica FABIS (por sus siglas en inglés Fast Africanized Bee Identification System) y el diagnóstico RFLP (por sus siglas en inglés Restriction Fragment Length Polymorphism), empleando el polimorfismo en la longitud de los fragmentos de restricción del ADN mitocondrial (ADNmt) para identificación de abejas africanizadas del estado de Tabasco y su relación con 12 variables morfométricas alares, femorales y abdominales.

1190


Rev Mex Cienc Pecu 2021;12(4):1188-1207

Material y métodos El estado de Tabasco se encuentra ubicado al sureste de la República Mexicana, en la región del trópico húmedo entre los 17º 15ʹ 00ʺ - 18º 39ʹ 07ʺ N y los 90º 50ʹ 23ʺ - 94º 07ʹ 49ʺ O(23).

Material biológico

Se obtuvieron muestras de abejas obreras tomadas al azar de tres colonias por apiario. Se colectaron directamente de la cámara de cría aproximadamente 400 abejas obreras por colonia, las cuales se colocaron en recipientes etiquetados conteniendo etanol al 96 % y conservadas hasta su uso a -20 ºC. El presente estudio comprende el muestreo de 135 colonias de abejas comerciales (CC) de productores cooperantes, 15 colonias pie de cría (CPC) con abejas reinas inseminadas y 3 colonias silvestres (CS). Los análisis morfométricos y los análisis moleculares se realizaron, en las siguientes etapas:

Análisis morfométrico

De cada muestra de las colonias, se tomaron 10 abejas obreras cuyas estructuras fueron disectadas y fijadas en porta objetos para su observación y análisis morfométrico. Las estructuras se digitalizaron con un equipo de microscopía Marca Karl Zeiss con cámara integrada y el software, Axiovision LE 472. Las variables de longitud y ancho se midieron en milímetros (mm): Longitud del ala anterior derecha (V1 LAAD), ancho del ala anterior derecha (V2 AAAD), longitud del ala posterior derecha (V3 LAPD), número de hámulus del ala posterior (V4 NHAP), longitud de la trompa (V5 LTR), longitud de la tibia pata posterior (V6 LTPP), longitud del fémur pata posterior (V7 LFPP), ancho del cuarto tergito (V8 ACT), longitud del cuarto tergito (V9 LCT), longitud de la banda del cuarto tergito (V10 LBCT), ancho del cuarto esternito (V11 ACE), y longitud del cuarto esternito (V12 LCE). Para la identificación de abejas africanizadas se usó el método FABIS (Por sus siglas en inglés Fast Africanized Bee Identification Sistem)(22,24). Para determinar el índice de africanización por subregiones geográficas, también se calcularon las frecuencias de los morfotipos.

1191


Rev Mex Cienc Pecu 2021;12(4):1188-1207

Extracción de ADN

La extracción de ADN se realizó empleando el método descrito por Doyle y Doyle(16) modificado: se depositaron cinco abejas obreras en un mortero, adicionando amortiguador de extracción (Tris-HCl 100 mM, NaCl 1.5 M, EDTA 20 mM pH 8, CTAB 4 %, PVP 40.4 %, ácido ascórbico 0.1 %, -mercaptoetanol 0.3 %) precalentado, recuperando la fase acuosa en tubos cónicos. Se recuperan 500 l de la fase acuosa, se incubaron a 60 °C en baño María durante 1 h y se agitó cada 15 min; se dejó reposar hasta llegar a temperatura ambiente. Se agregaron 500 l de cloroformo: alcohol isoamílico (49:1 v/v). El tubo se agitó hasta mezclar y formar una emulsión. Se centrifugó a 14,000 rpm durante 5 min y la fase acuosa se transfirió a un tubo nuevo con una micropipeta; se agregó un volumen de isopropanol frío y se dejó incubar a -20 °C durante 15 min. Se centrifugó a 5,000 rpm durante 5 min y el sobrenadante fue descartado. La pastilla obtenida se lavó con etanol frío al 70 %, se agitó para lavarla completamente, se centrifugó a 14,000 rpm durante 2 min; retirando el etanol y dejando secar a temperatura ambiente. Finalmente, la pastilla se suspendió en 200 l de agua inyectable y se almacenó a 20 °C. El ADN extraído se observó en un gel de agarosa al 1 % y se cuantificó por absorbancia a 260 nm.

Amplificación por PCR del ADN mitocondrial.

La región de 485 pb del gen citocromo b, fue amplificada usando los oligonucleotidos CytbAF (5' TATGTACTACCATGAGGACAAATATC) y CytbA-R (5' ATTACACCTCCTAATTTATTAGGAAT). Se empleó un equipo termociclador Mca. Genius, modelo Techne, programando las condiciones de corrida: 94 ºC (2 min), seguida por 30 ciclos 94 ºC (1 min), 50 ºC (1 min) y 72 ºC (1 min), después del ciclo final 72 ºC (7 min).

Análisis en la longitud de los fragmentos de restricción (RFLP)

Después de la amplificación de las muestras, 10 µl de los productos de PCR fueron digeridos con 1 U de enzima de restricción Bgl II (Invitrogen), a 37 ºC durante 4 h. La digestión se sometió a electroforesis en un gel de agarosa 2 %, visualizada bajo luz ultravioleta. Los sitios de restricción se midieron como: Mitotipo europeo (E), al visualizar un patrón de dos fragmentos (194 y 291 pb), o mitotipo africanizado (A), al visualizar un fragmento único sin digerir de 485 pb(1,17).

1192


Rev Mex Cienc Pecu 2021;12(4):1188-1207

Cuando fue detectado el mitotipo, se clasificó en cuatro categorías: A-CS (Mitotipo africanizado, colonia silvestre); A-CC (Mitotipo africanizado, colonia comercial); E-CC (Mitotipo europeo, colonia comercial) y E-CPC (Mitotipo europeo, colonia pie de cría). Tomando como fuentes de variación las categorías anteriormente descritas, los datos morfométricos de las abejas se sometieron a análisis de varianza y prueba de medias Bonferroni (P≤0.05; 95 % de confianza) cuando fue requerido. El análisis multivariado se realizó mediante componentes principales, análisis discriminante y de clúster para los atributos de los grupos, y como aporte de cada una de las variables en función de las distancias de enlace, se empleó el software estadístico Statgraphics centurión XVI, Versión 2016 e INFOSTAT.

Resultados Como puede observarse en el Cuadro 1, se encontraron diferencias estadísticas significativas entre las subregiones en 7 de las 12 variables morfométricas estudiadas (V1 LAAD, V3 LAPD, V5 LTR, V8 ACT, V9 LCT, V10 LBCT y V12 LCE). Las abejas de la subregión Chontalpa en promedio mostraron los valores más grandes en la mayoría de las variables, excepto en la V6 LTPP (P=0.9298), ya que el valor más grande se encontró en la subregión Centro (3.02 mm), con una diferencia de 0.01 y 0.03 mm respecto a las otras subregiones. No se encontraron diferencias estadísticamente significativas entre las subregiones respecto a esta variable, así como en la V2 AAAD (P=0.1368), V4 NHAP (P=0.2764), V7 LFPP (P=0.0945) y V11 ACE (0.5569). El análisis de componentes principales mostró que tres componentes tienen un valor propio (Eigenvalue) mayor o igual a 1.0, los cuales en conjunto explican el 60.088 % de la variabilidad de los datos originales. La CP1, tiene una correlación positiva con todas las variables morfométricas estudiadas, mientras que la CP2, tiene una correlación positiva con cinco variables y negativa o nula con el resto. La CP3, tiene una correlación positiva con ocho variables, y negativa o nula con el resto.

1193


Rev Mex Cienc Pecu 2021;12(4):1188-1207

Cuadro 1: Resumen de 12 variables morfométricas medidas en 153 colonias del estado de Tabasco (mm) Subregión Centro

Resumen Media

V1 9.02ab

V2 3.09

V3 6.33ab

V4 20.88

V5 4.98ab

V6 3.02

V7 2.55

V8 2.05ab

V9 8.82c

V10 7.23c

V11 1.60

V12 3.99b

Chontalpa 68

D.E. Mín Máx Media

0.11 8.82 9.25 9.08a

0.06 3.0 3.32 3.09

0.10 6.10 6.56 6.36a

0.870 19.60 23.80 21.23

0.37 4.23 5.57 5.17a

0.07 2.83 3.19 3.01

0.07 2.39 2.67 2.58

0.08 1.84 2.36 2.09a

0.21 8.47 9.23 9.07a

0.30 6.54 8.15 7.49b

0.05 1.50 1.72 1.60

0.14 3.61 4.27 4.10a

24

D.E. Mín Máx Media

0.17 8.64 9.41 8.94b

0.06 2.94 3.2 3.04

0.13 5.99 6.66 6.28b

0.93 18.40 23.50 21.14

0.34 4.24 5.65 5.09a

0.13 2.10 3.22 2.99

0.06 2.48 2.80 2.54

0.05 1.93 2.23 2.04b

0.21 8.63 9.67 8.91bc

0.28 6.83 8.22 7.32bc

0.05 1.48 1.71 1.60

0.12 3.83 4.37 4.03ab

12

D.E. Mín Máx Media

0.13 8.78 9.24 9.02ab

0.05 2.92 3.13 3.11

0.12 6.06 6.59 6.31ab

0.880 19.40 22.80 20.73

0.35 4.15 5.47 4.87ab

0.06 2.87 3.16 3.01

0.05 2.44 2.65 2.57

0.03 1.95 2.09 2.06ab

0.15 8.66 9.24 8.96abc

0.33 6.50 7.92 7.51a

0.05 1.50 1.70 1.58

0.09 3.77 4.15 4.06ab

18

D.E. Mín Máx Media

0.18 8.81 9.49 9.05ab

0.21 2.98 3.76 3.09

0.14 6.14 6.64 6.35ab

0.75 19.70 22.40 21.08

0.48 4.35 5.77 4.73b

0.07 2.89 3.15 3.02

0.05 2.50 2.65 2.56

0.05 1.97 2.15 2.10a

0.22 8.54 9.25 9.07ab

0.24 7.13 7.87 7.43bc

0.05 1.53 1.68 1.59

0.11 3.87 4.26 4.08ab

153

D.E. Mín Máx P

0.12 8.84 9.35 0.0025

0.04 3.00 3.18 0.1368

0.08 6.20 6.55 0.0471

1.11 19.30 23.10 0.2764

0.35 4.10 5.33 0.0001

0.06 2.91 3.12 0.9298

0.05 2.49 2.70 0.0945

0.05 2.01 2.17 0.0001

0.15 8.85 9.40 0.0001

0.27 6.73 7.85 0.0006

0.04 1.52 1.67 0.5569

0.10 3.95 4.25 0.0007

Pantanos

Ríos

Sierra

n 31

Longitud del ala anterior derecha (V1), Ancho del ala anterior derecha (V2), Longitud del ala posterior derecha (V3), Número de hámulus del ala posterior (V4), Longitud de la trompa (V5), Longitud de la tibia pata posterior (V6), Longitud del fémur pata posterior (V7), Ancho del cuarto tergito (V8), Longitud del cuarto tergito (V9), Longitud banda cuarto tergito (V10), Ancho del cuarto esternito (V11), y Longitud del cuarto esternito (V12). P= valores ≤0.05, indican diferencias significativas; D.E= desviación estándar.

1194


Rev Mex Cienc Pecu 2021;12(4):1188-1207

En la gráfica de influencias (Figura 1) se muestran los coeficientes de cada variable de los dos primeros componentes, siendo la longitud del ala anterior derecha (V1 LAAD), longitud del ala posterior derecha (V3 LAPD), longitud del fémur pata posterior (V7 LFPP), ancho del cuarto tergito (V8 ACT), longitud del cuarto tergito (V9 LCT) y longitud del cuarto esternito (V12 LCE) las variables con mayor influencia sobre CP1. Sin embargo, las tres variables discriminantes explican solamente el 60.088 % de la variabilidad de los datos originales, lo cual se considera insuficiente para los fines del presente análisis. Figura 1: Información bidimensional de influencias de las variables morfométricas sobre dos principales componentes

Longitud del ala anterior derecha (V1), Ancho del ala anterior derecha (V2), Longitud del ala posterior derecha (V3), Número de hámulus del ala posterior (V4), Longitud de la trompa (V5), Longitud de la tibia pata posterior (V6), Longitud del fémur pata posterior (V7), Ancho del cuarto tergito (V8), Longitud del cuarto tergito (V9), Longitud banda cuarto tergito (V10), Ancho del cuarto esternito (V11), y Longitud del cuarto esternito (V12).

De acuerdo con el diagnóstico mediante el método FABIS, a nivel estatal (n= 153), se determinaron 67 colonias (43.79 %) con morfotipo africanizado, 77 colonias (50.33 %) con morfotipo europeo y 9 colonias (5.88 %) sospechosas (S), mostrando diferencias significativas (Ji2= 52.86, n= 153, P=0.0001). Las colonias sospechosas fueron localizadas en apiarios de la subregión Centro (n=31) 1 colonia (3.2 %), subregión Chontalpa (n= 68) 6 colonias (8.82 %) y en la subregión Pantanos (n= 24), 2 colonias (8.33 %). De acuerdo con el análisis del ADNmt (Figura 2, Cuadro 2), a nivel estatal (n=153), se determinaron 86 colonias (56.21 %) con mitotipo Africanizado y 67 colonias (43.79 %) con mitotipo Europeo, sin encontrar significancia estadística (Ji2=2.36, n=153, P=0.124). De 1195


Rev Mex Cienc Pecu 2021;12(4):1188-1207

manera específica de las 135 colonias comerciales muestreadas, se detectaron frecuencias relativas de genes del mitotipo E en 52 colonias (38.52 %) y 83 colonias (61.48 %) presentaron mitotipo A encontrando diferencias significativas (Ji2= 7.12, n= 135, P=0.0076). Lo cual demuestra el predominio del mitotipo africanizado sobre el europeo en un orden de 1.59 A/E en las colonias comerciales. Como puede observarse en el Cuadro 2, en promedio, la subregión de los Ríos mostró la frecuencia más baja de mitotipo A (41.67 %), encontrándose mayor grado de africanización en el resto de las subregiones, hasta 75 % en la subregión Pantanos. Figura 2: Amplificación del ADNmt de Apis mellifera digerido con la enzima de restricción Bgl II

Af= Africanizado, mitotipo sin digerir, Eur= Europeo (doble bandeo). M= marcador de talla molecular.

Al realizar el análisis morfométrico de las 12 variables empleando como fuentes de variación las cuatro categorías descritas, se encuentran diferencias estadísticamente significativas en el 67 % de las variables (8 de 12). En el Cuadro 3, puede observarse que existen pequeñas diferencias numéricas, sin embargo, las abejas E-CPC presentan en la mayoría de las variables morfométricas las dimensiones más grandes, excepto en V5 LTR, sin embargo, no existen diferencias significativas.

1196


Rev Mex Cienc Pecu 2021;12(4):1188-1207

Cuadro 2. Número y proporción (%) de colonias clasificadas mediante FABIS y el mitotipo del ADNmt, identificado como africanizado - europeo en las subregiones del estado de Tabasco Subregión FABIS Centro Chontalpa Pantanos Ríos Sierra Total (Morfotipo) Africanizado 15 (48.39) 21 (30.88) 17 (70.83) 8 (66.67) 6 (33.33) 67 (43.79) 15 (48.39) 41 (60.29) 5 (20.83) 4 (33.33) 12 (66.67) 77 (50.33) Europeo 6 (8.82) 2 (8.33) 9 (5.88) Sospechoso 1 (3.23) 2 2 2 2 2 Ji =12.65, n=31, Ji =27.21, n=68, Ji =15.75, n=24, Ji =1.33, n=12, Ji =2.00, n=18, Ji2=52.86, n=153, P=0.0018 P=0.0001 P=0.0004 P=0.2482 P=0.1573 P=0.0001 MITOTIPO (ADNmt) Africanizado 15 (48.39) 36 (52.94) 18 (75.0) 5 (41.67) 12 (66.67) 86 (56.21) 16 (51.61) 32 (47.06) 6 (25.0) 7 (58.33) 6 (33.33) 67 (43.79) Europeo 2 2 2 2 2 Ji =0.03, n=31, Ji =0.24, n=68, Ji =6.00, n=24, Ji =0.33, n=12, Ji =2.00, n=18, Ji2=2.36, n=153, P=0.857 P=0.627 P=0.014 P=0.563 P=0.157 P=0.124 P= valores de ≤0.05, indican diferencias significativas.

1197


Rev Mex Cienc Pecu 2021;12(4):1188-1207

Cuadro 3: Análisis morfométrico entre abejas con mitotipo: A-CC= Africanizado colonia comercial, A-CS= Africanizado colonia silvestre, E-CC= Europeo colonia comercial y E-CPC= Europeo colonia pie de cría (mm) Categorías n Resumen V1 V2 V3 V4 V5 V6 V7 V8 V9 V10 V11 V12

A-CC

83

A-CS

3

E-CC

52

E-CPC

15

153

Media

8.99b

3.07ab

6.31b

21.08

5.03

3.00

2.55ab

2.07b

8.95b

7.36

1.60b

4.05b

D.E. Mínima Máxima Media

0.12 8.71 9.36 8.74c

0.09 2.92 3.76 3.0b

0.10 6.06 6.59 6.07c

0.95 18.4 23.50 20.83

0.38 4.10 5.65 5.12

0.12 2.10 3.19 2.93

0.05 2.44 2.69 2.53b

0.06 1.84 2.36 1.98b

0.19 8.47 9.40 9.01ab

0.28 6.50 7.96 7.23

0.04 1.50 1.69 1.50c

0.11 3.77 4.29 3.91b

D.E. Mínima Máxima Media

0.09 8.64 8.82 9.08ab

0.06 2.94 3.07 3.09a

0.07 5.99 6.13 6.36ab

0.47 20.30 21.20 21.01

0.20 4.90 5.26 5.09

0.03 2.91 2.96 3.02

0.03 2.50 2.56 2.57ab

0.05 1.93 2.03 2.08ab

0.57 8.63 9.67 9.00ab

0.12 7.09 7.32 7.45

0.04 1.48 1.55 1.60b

0.06 3.85 3.97 4.07ab

D.E. Mínima Máxima Media

0.17 8.80 9.49 9.20a

0.06 2.98 3.32 3.12a

0.12 6.10 6.64 6.43a

0.83 19.60 22.80 21.45

0.38 4.38 5.77 4.96

0.09 2.83 3.22 3.04

0.07 2.39 2.80 2.60a

0.06 1.88 2.23 2.12a

0.24 8.54 9.66 9.14a

0.33 6.54 8.22 7.52

0.05 1.50 1.71 1.64a

0.14 3.61 4.37 4.15a

D.E. Mínima Máxima P

0.11 9.06 9.41 0.0001

0.05 3.02 3.19 0.0238

0.11 6.28 6.66 0.0001

1.130 19.90 23.80 0.3993

0.45 4.18 5.58 0.6237

0.05 2.98 3.13 0.2754

0.06 2.50 2.70 0.0222

0.04 2.04 2.19 0.0019

0.17 8.79 9.48 0.0198

0.34 6.73 8.15 0.1201

0.04 1.57 1.72 0.0001

0.08 4.03 4.33 0.0027

Longitud del ala anterior derecha (V1), Ancho del ala anterior derecha (V2), Longitud del ala posterior derecha (V3), Número de hámulus del ala posterior (V4), Longitud de la trompa (V5), Longitud de la tibia pata posterior (V6), Longitud del fémur pata posterior (V7), Ancho del cuarto tergito (V8), Longitud del cuarto tergito (V9), Longitud banda cuarto tergito (V10), Ancho del cuarto esternito (V11), y Longitud del cuarto esternito (V12); D.E.= desviación estándar. P= valores ≤0.05, indican diferencias significativas. ab Literales diferentes en la misma columna indican diferencias significativas.

1198


Rev Mex Cienc Pecu 2021;12(4):1188-1207

El análisis de agrupamiento presentado en la Figura 3, muestra que, en la primera etapa del procedimiento, la categoría A-CC se agrupa con la categoría E-CC (1.63). Seguidamente se forma un segundo grupo con la categoría E-CPC con una distancia de agrupamiento de 3.96, apareciendo la categoría A-CS como el grupo más alejado (5.76). Figura 3: Fenograma obtenido por el método de agrupamiento del vecino más cercano de 12 variables morfométricas, medidas en abejas meliferas (Apis mellifera L.) en el estado de Tabasco

Discusión Al emplear las subregiones como fuentes de variación, las diferencias encontradas en las variables de longitud y ancho de las estructuras, aunque significativas son muy estrechas y no es posible lograr una discriminación clara de las abejas entre las subregiones. En promedio las abejas del estado de Tabasco, miden V1 LAAD (9.022 mm), V2 AAAD (3.13 mm), V3 LAPD (6.326 mm), V4 NHAP (cuentan con 21.012 hámulos), V6 LTPP (3.01 mm), inferiores a las abejas criollas de una población de abejas africanizadas Apis mellifera sp de la región Lambayeque en Perú(25). No obstante, las abejas de Tabasco son más grandes en cuanto a V7 LFPP (2.56 mm). Las correlaciones momento producto de Pearson, entre cada par de variables (n= 153), mostró que la V1 LAAD tiene fuerte correlación positiva y significativa con V2 AAAD (0.5072), 1199


Rev Mex Cienc Pecu 2021;12(4):1188-1207

V3 LAPD (0.8368), V7 LFPP (0.5220), V8 ACT (0.5377), V9 LCT (0.5568) y V12 LCE (0.5502), pero con el resto las correlaciones son débiles. Llama la atención la débil correlación (0.1541) no significativa entre V3 LAPD y V4 NHAP. La V5 LTR, solo tiene correlación débil positiva significativa con V9 LCT (0.1754), su correlación con el resto de las variables es débil y no significativo. La V7 LFPP, mostró correlación significativa con V8 ACT (0.4130), V9 LCT (0.4785), V10 (0.2910), V11 (0.4719) y V12 (0.4550). Con relación al tergito y esternito, las medidas, correlacionan positiva y significativamente entre sí. La V8 ACT, tiene fuerte correlación positiva y significativa con V9 LCT (0.6392), V10 (0.3441), V11 (0.4528) y V12 (0.5667). Se encontraron diferencias significativas tanto entre las subregiones como entre las categorías, en las variables V1 LAAD y V7 LFPP, lo cual tiene especial atención ya que son utilizadas, para la determinación de la africanización mediante el método FABIS(22,23). Así mismo, estas variables en conjunto mostraron correlaciones positivas significativas con 11 de las 12 variables estudiadas. Respecto al número de hámulus, en un análisis comparativo entre abejas africanizadas y europeas, se reportó que entre las abejas obreras africanizadas y europeas, estadísticamente no existen diferencias(26); los resultados de este trabajo también confirman esa condición al no encontrar el número de hámulus como una característica discriminante entre ambas razas. En relación a que el patrón morfométrico de las abejas africanas es más pequeño, y que las europeas son más grandes(3,27,28), bajo las condiciones de este trabajo se encontró que si bien, la características morfométricas son diferentes estadísticamente, la diferencia en promedio es muy estrecha, lo cual concuerda con diversos investigadores que afirman que las abejas africanizadas son muy difíciles de diferenciar morfométricamente, y que en la actualidad se tienen abejas africanizadas con características más europeas o viceversa(29,30). Esta similitud morfométrica podría llevar a conclusiones erróneas al emplear métodos morfométricos para la determinación A-E. Lo anterior fue demostrado en poblaciones de abejas morfométricamente africanizadas(31) y concuerda con los resultados en este studio, al encontrar de manera general entre ambos métodos de diagnóstico (FABIS/ADNmt) 59 (38.56 %) determinaciones no coincidentes. Estos resultados sugieren la posibilidad de encontrar que abejas de mitotipo y sitio de colecta diferente, compartan el mismo grupo morfométrico, por lo que no es posible realizar una clasificación por subregión geográfica de las abejas del estado de Tabasco, lo cual podría explicarse por los usos y costumbres de distribución de abejas reinas entre los productores de diferentes subregiones. El tamaño corporal de las abejas, tiene una fuerte base genética, sin embargo, se ha demostrado que el manejo de las colonias, particularmente el tamaño de la celda influye sobre el tamaño corporal de las abejas(32). Otro estudio que refuerza la idea de que las prácticas apícolas inciden en el tipo genético de las poblaciones de abejas es el reportado en 2007 por 1200


Rev Mex Cienc Pecu 2021;12(4):1188-1207

Antonio(33), quien encontró que el 67.39 % de las colonias de la comarca lagunera, resultaron europeas, lo cual fue atribuido a la intensidad con la que los apicultores han realizado el reemplazo de reinas. Más recientemente otros investigadores(34) mediante FABIS reportaron que 91.49 % de las colonias de abejas de Mexicali y 67.65 % de las colonias de Ensenada tienen morfotipos africanizados, sin embargo, en los colonias silvestres se encontró que 100 % en Mexicali y 50 % en Ensenada tienen morfotipos africanizados, lo cual coincide con lo encontrado en este trabajo, y que podría ser explicado por las diferencias en la tecnificación de los apiarios muestreados. El hecho de que en el territorio tabasqueño las abejas con mitotipo A y E en las colonias comerciales tengan características morfométricas muy similares, podría explicarse a) por la hibridación natural con las colonias silvestres desde el ingreso de la abeja africana; b) por la introducción de abejas reinas comerciales o abejas pie de cría europeas; c) influenciado por las características de los panales. La procedencia del mitotipo E en el estado de Tabasco, es diversa, ya que durante 2003 a 2010, el ISPROTAB (Instituto de Sistemas de Producción del Trópico Húmedo de Tabasco); adquirió de criaderos certificados, abejas inseminadas de diferentes razas europeas, para reproducirlas en sus criaderos de reinas y donar a los productores reinas F1, con la finalidad de fomentar el recambio anual de abejas reinas; sin embargo, posterior a su cancelación, algunos apicultores adquieren por su cuenta, abejas reinas, procedentes de criaderos locales o foráneos los cuales pudieran estar o no, certificados por la SAGARPA (Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación), con el consecuente riesgo sanitario, por lo que aunado a la presencia de colonias silvestres son la principal fuente de genes de mitotipo A, que poseen una gran capacidad para multiplicarse, y eventualmente la fecundación de reinas vírgenes de mitotipo E, con zánganos africanizados, podrían estar resultando en la proliferación de genes africanizados toda vez que se ha reportado que los genes africanos son dominantes(11). Los resultados demuestran que los apiarios se componen de colonias con ambos mitotipos en diferentes proporciones, lo cual confirma la coexistencia de ambos tipos raciales de abejas en algunos apiarios, y coincide con lo informado recientemente en un estudio mediante ADNmt realizado en siete zonas de Buenos Aires, Argentina, para un total de 430 colonias, encontrando que colonias derivadas de abejas africanas coexisten con europeas en dos de las siete zonas, además de que los mitotipos europeos continúan siendo más frecuentes, en comparación a los resultados que ellos obtuvieron en 2005(35). Por otro lado Quezada-Euan(8) mediante análisis de aloenzimas en 25 colonias manejadas reportó el 95 % de haplotipos AHB (Por sus siglas en inglés Africanized Honeybee) en los estados de Chiapas y Tabasco, y 73 % en Yucatán, encontrando los niveles más bajos en los estados de Michoacán y Jalisco (56 y 40 % respectivamente), lo cual es muy cercano a lo que se encontró en este trabajo (56.21 %), y menciona que sus hallazgos, podrían estar relacionados con la intensidad de las 1201


Rev Mex Cienc Pecu 2021;12(4):1188-1207

prácticas de cambio de reinas. Con relación a estos resultados se reportó el 56.21 % de mitotipos africanizados encontrados en colonias comerciales en el estado de Tabasco, lo cual está abajo del rango reportado en un estudio de la africanización mediante ADNmt realizado en cinco poblaciones del estado de Veracruz México y tres poblaciones de referencia, ya que se detectó del 60 al 77 % de mitotipo africanizado en las poblaciones ubicadas entre 72 a 1,300 msnm(20). Las dos técnicas de diagnóstico usadas en este trabajo definen claramente la raza de las muestras de los grupos CPC y CS, en las que ambas técnicas coinciden plenamente en los resultados, lo que no es de extrañar para la técnica de ADNmt, sabiendo de su robustez; pero también dan evidencia de que el análisis morfométrico es capaz de definir la raza de las abejas, cuando éstas poseen medidas claramente diferenciables o extremas; sin embargo, cuando las mediciones están en rangos compartidos entre las razas, el análisis morfométrico pierde precisión y los resultados pueden ser erráticos, así lo demuestran las coincidencias y no coincidencias de ambos métodos diagnósticos. En este sentido es importante mencionar que el análisis de ADNmt manifiesta el origen ancestral de las abejas, por la estabilidad generacional del ADNmt, pero el análisis morfométrico refleja la dificultad de definir racialmente, ya que las poblaciones de abejas se están entrecruzando y poseen características físicas y de comportamiento de ambas razas. En una investigación realizada en Colombia, sin hacer referencia al genotipo de las abejas, se reportó que en las regiones apícolas Tolima y Boyacá, los valores promedio del ala anterior fueron de 8.74 mm a 8.63 mm, lo cual indica uniformidad morfológica africana o muy cercana a las africanas, por el proceso de africanización de las abejas de esas regiones(9) . De igual forma en Colombia, se reportó un patrón de amplificación de sitios Dra I, 16S RFLP, del 87.5 % de colonias africanas (Apis mellifera scutellata) y 12.5 % europeas (cárnica/ligústica), puntualizando que Tolima posee predominantemente genes africanizados(36,37). Respecto a la longitud del ala, se encontró que en las abejas A-CS, A-CC y E-CC, miden en promedio 8.74 mm, 8.99 mm y 9.08 mm respectivamente. Sin embargo, las abejas con mitotipo E-CC de Tabasco tienen una longitud de ala anterior derecha de 9.08 mm ligeramente menor que las del altiplano ≥9.12 mm reportadas(19). La caracterización molecular basada en el ADNmt se ha convertido en una técnica ampliamente utilizada para el estudio de la diferenciación de subespecies o razas de la abeja de la miel Apis mellifera L. por diversos autores(37-40). Esta molécula circular y de herencia materna, permite caracterizar la abeja reina a través de las obreras y así a toda la colonia, pudiendo considerarse un marcador de toda la colonia. Su estudio ha permitido elaborar diferentes hipótesis sobre la evolución de las subespecies de Apis mellifera y definir cinco linajes evolutivos: el linaje A, incluye las subespecies africanas como intermissa y scutellata, 1202


Rev Mex Cienc Pecu 2021;12(4):1188-1207

el linaje M está formado por las subespecies de Europa Occidental, incluyendo mellifera, el linaje C formado por las subespecies de Europa Oriental (ligustica o abeja italiana), el linaje O que abarca a las subespecies de Oriente Próximo y el Y que incluye a la subespecie Apis mellifera yemenitica de Etiopía(15). Cada uno de estos linajes presenta una composición característica en la secuencia de diferentes regiones del ADN mitocondrial, como sucede con la subunidad I del gen de la citocromo oxidasa (COI), para la que el linaje M presenta una diana de la endonucleasa Hinc II que no se encuentra en el linaje A(40).

Conclusiones e implicaciones Los análisis morfométricos solamente fueron discriminantes en los valores extremos, y por lo tanto clasifican como sospechosas de ser africanizadas, con lo que se podría estar reflejando la realidad de la dinámica entrecruzamientos de las poblaciones. La coexistencia de abejas de tipo europeo y africanizado, ha sido afectada por algunas prácticas como el cambio de reinas, que han influido sustancialmente en el tipo de abejas presentes en las colonias. El comportamiento reproductivo de las abejas melíferas contribuye fuertemente en el mantenimiento de los niveles de africanización de las colonias, ya que permite la introgresión de genes silvestres a las poblaciones de abejas manejadas por los apicultores, lo cual se puede apreciar en las colonias de abejas comerciales identificadas en este trabajo como (CC). Estos resultados discriminan clara y significativamente la categoría A-ES de la E-CPC, mostrando los valores morfométricos extremos; sin embargo, las categorías A-CC y E-CC, presentaron marcadas similitudes; este amplio rango morfométrico, sugiere diversidad genética, la cual debe de ser investigada para determinar los linajes a los que pertenecen las abejas en esta región del país. Hasta el momento el mejor método para discriminar genotipos E o A es el método molecular.

Agradecimientos

Al Tecnológico Nacional de México por el financiamiento otorgado al proyecto: Determinación de varroa y detección molecular de Nosema apis y Nosema ceranae, en apiarios comerciales de Apis mellifera, en el estado de Tabasco, México. Clave: 6328.17P.

1203


Rev Mex Cienc Pecu 2021;12(4):1188-1207

Literatura citada: 1. Ruttner F. Biogeography and taxonomy of honey bees. Germany, New York, USA: Springer Verlag: Heiddelberg; 1988. 2. Padilla-Álvarez F, Sereno FTP de S. Estudio de la diversidad morfológica existente en las abejas melíferas (Apis mellífera L.) del sur de Europa y del Continente Sudamericano. Arch Zootec 2005;(54):221-226. 3. Kerr WE. The history of the introduction of Africanized bees in Brazil. S Afr Bee J 1967;(39):3-5. 4. Schneider SS, DeGrandi-Hoffman G, Smith DR. The African honey bee: Factors contributing to a successful invasion. Ann Rev of Entom 2004;(49):351–376. doi:10.1146/annurev.ento.49.061802.123359. 5. Fierro MM, Barraza A, Maki DL, Moffet JO. The effect of the first year of africanization on honey bee populations in Chiapas, Mexico. Proc Third Am Bee Res Conf. Weslaco, Tx. USA. 1987. 6. Moffett JO, Dale LM, Thomas A, Fierro MM. The africanized bee in Chiapas, Mexico. Am Bee J 1987;127(7):517-519. 7. Herrera SA. Monitoreo de abejas africanas. III Seminario Americano de Apicultura. Acapulco, México. 1989;9-11. 8. Quezada-Euan JJG. The present status of african-derived honeybees in tropical México. VI Encontro sobre Abelhas. Riberao Preto Brasil. 2006. 9. Salamanca GG, Vargas EF, Pérez FC. Estudio morfométrico y sistemático del grado de africanización de la abeja. 1999. https://www.apiservices.biz/es/articulos/ordenar-porpopularidad/716-estudio-morfometrico-y-sistematico-del-grado-de-africanizacion. Consultado 8 Mar, 2019. 10. Danka RG, Hellmich RL II, Rinderer TE, Collins AM. Diet-selection ecology of tropically and temperately adapted honey bees. Anim Behav 1987;(35):1858-1863. 11. Guzmán-Novoa E, Correa-Benítez A, Guzmán G, Espinosa LG. History, colonization and impact of the africanized honey bee in Mexico. Vet Méx 2011;42(2):149-178. 12. FAOSTAT. Base de datos del mundo sobre estadísticas alimentarias y agrícolas. Organización de las naciones unidas. http://www.fao.org/faostat/es/#rankings/countries_by_commodity_exports. Consultado 15 Feb, 2021. 1204


Rev Mex Cienc Pecu 2021;12(4):1188-1207

13.

INFOSIAP. Servicio de información y estadística agroalimentaria. http://infosiap.siap.gob.mx/repoAvance_siap_gb/pecAvanceEdo.jsp. Consultado 15 Feb, 2021.

14. Winston ML. Killer bees: The africanized honey bee in the Americas. Cambridge: Harvard University Press; 1992. 15. Franck P, Garnery L, Loiseau A, Oldroyd BP, Hepburn HR, Solignac M. Genetic diversity of the honeybee in Africa: microsatellite and mitochondrial data. Heredity 2001;(86):420-430. 16. Doyle JJ, Doyle JL. Isolation of plant DNA from fresh tissue. Focus 1990;12(1):13-16. 17. Crozier YC, Koulianus S, Crozier RH. An improved test for africanized honey bee mitocondrial DNA. Experientia 1991;(47):968-969. 18. Clarke KE, Oldroyd BP, Javier J, Quezada-Euan G, Rinderer TE. Origin of honeybees (Apis mellifera L) from Yucatan Peninsula inferred from mitocondrial DNA analysis. Mol Ecol 2001;(10):1347-1355. 19. Uribe-Rubio JL, Guzmán-Novoa E, Hunt GJ, Correa-Benítez A, Zozaya JA. Efecto de la africanización sobre la producción de miel, comportamiento defensivo y tamaño de las abejas melíferas (Apis mellifera L.) en el altiplano mexicano. Vet Mex 2003;34(1):4759. 20. Kraus FB, Franck P, Vandame R. Asymmetric introgression of African genes in honeybee populations (Apis mellífera L.) in Central Mexico. Heredity 2007:1-8. 21. de la Rua P, Hernández-García R, Pedersen BV, Galián J, Serrano J. Molecular diversity of honeybee Apis mellifera Iberica L. (Hymenoptera: Apidae) from western Andalusia. Arch Zootec 2004;(53):195-203. 22. Sylvester HA, Rinderer TE. Fast africanized bee identification system (FABIS) manual. Am Bee J 1987;127(7):511-516. 23. INAFED. Instituto Nacional para el Federalismo y el Desarrollo Municipal. Enciclopedia de los municipios y delegaciones de México. 2018. EN: http://www.inafed.gob.mx/work/enciclopedia/emm27tabasco/regionalizacion.html. Consultado 8 May, 2020.

1205


Rev Mex Cienc Pecu 2021;12(4):1188-1207

24. DOF. Diario Oficial de la Federación. Norma oficial mexicana NOM-056-ZOO-1995. Especificaciones técnicas para las pruebas diagnósticas que realicen los laboratorios de pruebas aprobados en materia zoosanitaria. http://www.dof.gob.mx/nota_detalle.php?codigo=4944688&fecha=22/02/1999. Consultado 15 May, 2020. 25.

Vásquez-Arca, OR, Mestanza-Arca BS, Alarcón-Silva RE. Características morfométricas, comportamiento higiénico y agresividad de abejas criollas Apis mellifera sp. Rev Inv Cult 2016;(1). https://www.redalyc.org/jatsRepo/5217/521753139003/html/index.html. Consultado 15 Jul, 2020.

26. del Lama MA, Gruber CV, de Godóy IC. Heterozigosidade e assimetria do número de hámulos em operárias adultas de Apis mellifera (Hymenoptera, Apidae). Rev Bras Entomol 202;46(4):591-595. 27. Guzman-Novoa E, Page RE, Spangler HG, Erickson EH. A comparison of two assays to test the defensive behaviour of honey bee (Apis mellifera L.). J Apic Res 1999;(38):205209. 28. Zhou T, Huang Z, Yao J, Wang G, Huang S. Los efectos que el tamaño de la celda de cría tiene sobre el comportamiento reproductivo de la varroa. China: Apimondia 2010. 29. May-Itzá WJ, Quezada-Euan JJG, Iuit L, Echazarreta CM. Do morphometrics and allozymes reliably distinguis africanized and european Apis mellifera drones in subtropical Mexico?. J Apic Res 2001;40(1):17-23. 30. Pérez-Castro EE, May-Itzá WJ, Quezada-Euan JJG. Thirty years alter: a survey on the distribution and expansion of africanized honey bees (Apis mellifera) in Peru. J Apic Res 2002;41(3-4):69-73. 31. Quezada-Euan JJG, Hinsull SM. Evidence of continued European morphometrics and mtDNA in feral colonies of honey bees (Apis mellifera) from the Yucatan peninsula, Mexico. J Apic Res 1995;34(3):16-166. 32. Masaquiza-Moposita DA, Curbelo RLM, Díaz MB, Arenal CA. Relaciones entre producción melífera, defensividad y diámetro de celdas de cría de Apis mellifera L; en el altiplano ecuatoriano. Rev Prod Anim 2019;31(3). https://revistas.reduc.edu.cu/index.php/rpa/article/view/e2994. Consultado 22 Jun, 2020.

1206


Rev Mex Cienc Pecu 2021;12(4):1188-1207

33. Antonio GMA. Estado actual de la africanización de las abejas melíferas en la Comarca Lagunera [Tesis licenciatura]. Torreón, Coahuila, México: Universidad Autónoma Agraria Antonio Narro Unidad Laguna; 2008. 34. Alaniz-Gutiérrez L, Torres-Salado N, Ail-Catzim CE, Velazco-López JL. Frecuencia de morfotipos africanizados y europeos de Apis mellifera en Ensenada y Mexicali, Baja California. Ecosist Recur Agropec 2016;3(9):421-426. 35. Genchi G, Reynaldi FJ, Bravi CM. An update of Africanization in honey bee (Apis mellifera) populations in Buenos Aires, Argentina. J Apic Res 2018. DOI: 10.1080/00218839.2018.1494887. https://doi.org/10.1080/00218839.2018.1494887. Accessed Jun 15, 2020. 36. Prada QCF, Duran TJ, Salamanca GG, del Lama AM. Population genetics of Apis mellifera L (Hymenoptera: Apidae) from Colombia. J Apic Res 2009;48(1):3-10. 37. Garnery L, Cornuet JM, Solignac M. Evolutionary history of the honeybee Apis mellifera L. inferred from mitochondrial DNA analysis. Mol Ecol 1992;(1):145-154. 38. de la Rua P, Galián J, Serrano J. Variabilidad del ADN mitocondrial en poblaciones de abejas de la miel (Apis mellifera L.) de la región de Murcia. Invest Agr Prod Sanid Anim 1999;14(3):41-49. 39. de la Rua P, Galián J, Serrano J, Moritz RFA. Molecular characterization and population structure of honey bee from the Belaric island (Spain). Apidologie 2001;(32):417-427. 40. Hall HG, Smith DR. Distinguishing african and european honeybee matrilines using amplified mitochondrial DNA. Proc Natl Acad Sci USA. 1991;88(10):4548-52.

1207


https://doi.org/10.22319/rmcp.v12i4.5615 Artículo

Factores epizootiológicos de las estrongilosis gastrointestinales en cabras Criollas Cubanas: bases para un manejo integrado

Manuel Alejandro La O-Arias a Francisco Guevara-Hernández b* Luis Alfredo Rodríguez- Larramendi c Luis Reyes-Muro d José Nahed-Toral e Hernán Orbelin Mandujano-Camacho f René Pinto-Ruiz g

a

Universidad Autónoma de Chiapas. Facultad de Ciencias Agronómicas Campus V. Chiapas. México. b

Universidad Autónoma de Chiapas. Facultad de Ciencias Agronómicas Campus V. Chiapas. México. c

Universidad de Ciencias y Artes de Chiapas (UNICACH). Facultad de Ingeniería. Chiapas. México. d

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), Aguascalientes, México. e

El Colegio de la Frontera Sur (ECOSUR). San Cristóbal de las Casas, Chiapas. México.

f

Universidad Autónoma de Chiapas (UNACH). Facultad de Medicina, Veterinaria y Zootecnia. Chiapas. México. g

Universidad Autónoma de Chiapas (UNACH). Facultad de Ciencias Agronómicas Campus V. Chiapas. México.

*Autor de correspondencia: francisco.guevara@unach.mx 1208


Rev Mex Cienc Pecu 2021;12(4):1208-1220

Resumen: El parasitismo causado por estrongilidos es uno de los principales factores limitantes de la producción de Cabras Criollas en el Este de Cuba. Mediante una investigación descriptiva y exploratoria realizada durante el periodo comprendido entre los años 2013 y 2018, fueron identificados los factores que regulan la dinámica epizootiológica de las estrongilosis gastrointestinales en 18 rebaños. Los factores bajo control fueron: la dinámica de población de larvas por mes, los estados reproductivos y el proceso de crecimiento de las cabras. Se registró la dinámica mensual de larvas infestivas en el pasto. Se aplicaron ANOVAS simples para modelos lineales correspondientes a cada factor y la prueba de Newmankeuls para comparaciones múltiples de media. Se observó que las dinámicas parasitarias de las estrongilosis gastrointestinales, que afectan a las cabras Criollas Cubanas, están relacionadas con procesos fisiológicos y zootécnicos. En estas dinámicas se identificaron dos momentos críticos o picos de infestación: en los animales en crecimiento durante el periodo de destete (2,188 huevos por gramo, HPG) y en las reproductoras en periodos de periparto (972 HPG). La infestación general de los rebaños está condicionada por la combinación de mayor ingestión de larvas infestivas, procesos de estrés alimentario y estados fisiológicos predisponentes, que conducen a picos de infestación estacionales entre los meses de diciembre a febrero superiores a 1,500 HPG. La dinámica de infestación del pasto está relacionada con la estacionalidad lluviosa con picos de infestación entre los meses de julio a septiembre y un máximo promedio de 1,200 larvas por kilo de pasto. Palabras clave: Caprino, Infestación parasitaria, Hospedero, Pasto.

Recibido: 08/02/2020 Aceptado.05/02/2021

Introducción Las cabras Criollas Cubanas son un genotipo diferenciado de sus ancestros ibéricos y africanos(1). Esta diferenciación es el resultado de 500 años de coevolución en el contexto socio ambiental del Este de Cuba, región donde se concentra más del 90 % de la población caprina cubana y donde se registró oficialmente el primer grupo de animales de esta raza(2). Según La O et al(3) estos animales son propios de sistemas de crianza campesinos, fundamentalmente con objetivos de autosubsistencia. Por esta razón, sus criadores destinan muy pocos insumos para esta actividad y esperan tener sus producciones sobre la base de la

1209


Rev Mex Cienc Pecu 2021;12(4):1208-1220

rusticidad del genotipo. Sin embargo, otros investigadores encontraron que estos animales podían portar cargas significativas de estrongilidos gastrointestinales e informaron, incluso, la presencia de dos especies de Haemonchus, contortus y placei, esta última, de alta especificidad para el ganado bovino(4). Varios estudios sobre el efecto de este grupo parasitario han demostrado que pueden afectar más del 25 % del potencial productivo de los animales, sin mostrar señales para los productores(5). De esta forma, se estima que el parasitismo causado por estrongilidos es uno de los principales factores limitantes de la producción de Cabras Criollas en el Este de Cuba. Esta situación genera polémica sobre las estrategias más convenientes para el desarrollo de los sistemas tradicionales de crianza. Los esquemas convencionales de tratamientos antihelmínticos no son compatibles con la racionalidad tradicional de crianza, por esta razón todo apunta a desarrollar estrategias de control integrado más consistentes con la visión del criador campesino. Para generar estrategias de control integrado, es importante identificar las particularidades del proceso parasitario para estas cabras en la región. De esta problemática se genera la pregunta de investigación que dio lugar al presente estudio ¿Cuáles son los factores que definen la dinámica de las estrongilosis gastrointestinales que afectan a las cabras Criollas Cubanas? Entonces, el objetivo fue identificar los factores que regulan la dinámica de las estrongilosis gastrointestinales de las cabras Criollas Cubanas.

Material y métodos Ubicación del estudio y muestra

La investigación se realizó en la subcuenca de los ríos Cautillo-Jiguaní, del Valle del Río Cauto, ubicada en el este de Cuba, Municipio de Jiguaní, provincia de Granma (Figura 1) Los rebaños pertenecían a la comunidad “26 de Julio”, zona donde se registraron por primera vez en Cuba, ejemplares de esta raza como raciales puros.

1210


Rev Mex Cienc Pecu 2021;12(4):1208-1220

Figura 1: Ubicación del área de estudio

Se seleccionaron 18 rebaños en correspondencia con las tipologías de crianza tradicionales para esta raza, identificadas por La O et al(3). En total se investigaron 860 animales, de ellos: 26 sementales, 455 reproductoras y 379 animales en crecimiento. Los animales fueron apreciados por expertos y clasificados como Criollos Cubanos.

Diseño de la investigación

La investigación realizada fue del tipo descriptiva y exploratoria. El objeto de estudio fue el proceso parasitario por medio de dos variables o indicadores: 1) el número de huevos de parásitos por gramo de heces (HPG) y el número de larvas infestivas en el pasto (larvas por kilo de pasto). Estas variables se monitorearon por tres años con frecuencia mensual. En el caso de los hospederos, se tomó una muestra mínima de 10 animales por rebaño pero que en su conjunto representara más del 10 % de los animales existentes por categorías. En total se trabajaron 3,715 muestras de heces fecales. En el caso de los pastos, las muestras se tomaron del área en ocupación y de las áreas con menos de 28 días de descanso. En total se procesaron 1,250 muestras de pastos procedentes de las 18 unidades de crianza. Los factores de influencia epizootiológica controlados fueron: a) mes del año; b) categoría de crianza (sementales, reproductoras y animales en crecimiento hasta el destete (120 días) y después del destete); c) estado fisiológico (animales secos y vacíos, tiempo de gestación y tiempo de lactancia)

1211


Rev Mex Cienc Pecu 2021;12(4):1208-1220

Estudios parasitológicos

Las muestras de heces fecales se tomaron antes de las 0800 h con frecuencia mensual. Para identificar los géneros presentes se realizaron cultivos por siete días protegidos con carbón activado. El conteo de huevos se realizó mediante la técnica de Mac Master(6). En el caso de los pastos la muestra se tomó antes de las 0800 h, mediante un recorrido por las áreas de pastoreo en el cual se recogieron pequeñas porciones de pasto cada 10 pasos. Para el conteo de larvas infestivas por kilo de pasto se utilizó la técnica descrita por Arece y Rodríguez(7).

Análisis estadístico

Se aplicaron ANOVAS simples para modelos lineales correspondientes con cada uno de los factores controlados (periodo de crecimiento, mes, estados reproductivos). Para las comparaciones múltiples de media se aplicó la prueba de Newmankeuls. El software utilizado fue STATISTICA 12.0(8).

Resultados y discusión Los géneros de parásitos diagnosticados en los cultivos de larvas fueron Haemonchus (48 %), Bunostomun (23 %), Trichostrongylus (23 %) y Oesophagostomun (6 %). Esta estructura poblacional concordó con los resultados informados por Rojas et al(4) en esta misma localidad. En realidad, es consistente con un patrón de estructura poblacional característico de las zonas tropicales(9). El predominio del género Haemonchus está dado por las condiciones favorables para desarrollar su fase exógena durante todo el año y porque se trata de un grupo mucho más prolífero que el resto de los géneros identificados(10). Los géneros Haemonchus y Oesophagostomum predominan a temperatura y humedad elevadas, mientras que el género Cooperia lo hace en climas húmedos y tropicales a la inversa de Teladorsagia que incide en climas templados o fríos(11). Para la dinámica de expulsión de huevos durante el ciclo reproductivo (Figura 2), se encontró un incremento durante el periodo de periparto; fenómeno epizootiológico denominado PPR (siglas en inglés) descrito por varios autores(12-13); los que refieren que, durante este periodo, que incluye un mes antes y un mes después del parto, se producen determinados procesos inmunodepresores que propician el desarrollo de larvas que se habían mantenido hipobióticas.

1212


Rev Mex Cienc Pecu 2021;12(4):1208-1220

Figura 2: Dinámica de la expulsión de huevos en cabras durante el ciclo reproductivo

G1 a G5= gestante de 1 a 5 meses; L1 a L4= lactante de 1 a 4 meses; V= vacía; abc P<0.01; CV= 12 %.

Tampoco se descarta la posibilidad de incrementos de la fertilidad de hembras de parásitos con mayores producciones de huevos. En la Figura 3 se observan dos fotos de hembras de Haemonchus spp., en la sección cercana a las aletas vulvares. En estas imágenes, se puede apreciar mayor carga aparente de huevos en la hembra de parásitos, recuperada de una reproductora caprina en periparto. Esta no es una evidencia concluyente, pero induce a la investigación para probar esta hipótesis. Figura 3: Secciones de aletas vulvares de hembras de Haemonchus spp., recuperadas de reproductoras caprinas dentro y fuera del periodo de periparto (Fotos: Manuel A. La O Arias)

1213


Rev Mex Cienc Pecu 2021;12(4):1208-1220

En Cuba, el primer informe de procesos de incremento de la actividad parasitaria en el periodo de periparto fue realizado en la especie ovina(14). En esta investigación, se realiza el primer informe del proceso de periparto en la especie caprina en Cuba. Respecto a la dinámica de la expulsión de huevos durante el periodo de crecimiento (Figura 4), se encontró que la infestación de las crías comienza a manifestarse poco antes de los 60 días y muestra una tendencia a incrementarse hasta alcanzar picos significativos (P<0.001) entre los 90 y 120 días (más de 1,800 huevos por gramo (HPG). Este periodo coincide con la caída del consumo de leche, ya sea por destete o por reducción significativa de la producción de la madre. A partir de ese momento (120 a 135 días) se reduce significativamente la infestación hasta alcanzar los niveles más bajos a los 180 días de edad con picos esporádicos. Figura 4: Dinámica de la expulsión de huevos de parásitos en cabritos criollos en crecimiento

ab P<0.10; CV= 20 %.

El incremento de la infestación en las crías alrededor del destete ha sido reportado por diferentes autores(15-16), los que coinciden en el planteamiento de que las crías tienen un sistema inmunológico inmaduro a lo cual se agrega el estrés del destete. Cuando se reduce o se trunca bruscamente el consumo de leche se incrementa el consumo de pasto, por tanto, se incrementa el consumo de larvas infestivas. En ese periodo, comienzan a activarse los mecanismos de respuesta de inmunidad activa en los animales en crecimiento(17). En cuanto a la reducción del conteo a partir de los 180 días, ocurre el proceso denominado de “auto cura” en ovinos, el cual se verifica alrededor de este mismo periodo (180 días). Este proceso tiene bases inmunológicas y su continuidad estará determinada por factores que alteran el estado de resistencia general del individuo hospedero(18).

1214


Rev Mex Cienc Pecu 2021;12(4):1208-1220

La dinámica mensual de la expulsión de huevos en las heces (HPG) en las reproductoras (Figura 5) mostró que el nivel de infestación presentó una tendencia a incrementarse a partir de octubre. El pico de infestación se presentó en diciembre (1,722 HPG), lo que denota un mayor nivel de infestación durante los meses secos. Figura 5: Dinámica mensual del conteo de huevos de parásitos en las heces fecales en reproductoras caprinas Criollas

* Medias transformadas; ab P<0.01; CV= 15 %.

La dinámica mensual del conteo de huevos en animales en crecimiento (Figura 6), mostró los niveles más altos en diciembre, enero y febrero (P<0.001), que coincide con el periodo seco y con las temperaturas más bajas. En marzo y abril comienza a bajar la infestación, con un nuevo pico más ligero en mayo (inicio del periodo lluvioso). Posteriormente, la infestación desciende hasta alcanzar los niveles más bajos entre julio y octubre. A partir de noviembre (inicio del periodo seco), comienza a incrementarse nuevamente.

1215


Rev Mex Cienc Pecu 2021;12(4):1208-1220

Figura 6: Dinámica mensual del conteo en huevos en cabras Criollas Cubanas en crecimiento

Bedotti et al(11) explicaron que, en el periodo seco, las condiciones son menos propicias para el desarrollo de la fase exógena del ciclo biológico de estos parásitos, debido a la combinación de altas temperaturas y baja humedad, letal para las larvas pre-infestivas. Diversos estudios realizados en condiciones tropicales en especies menores muestran mayores infestaciones durante la lluvia(19). Este comportamiento, en los sistemas tradicionales de crianza de Cabras Criollas, en Cuba, se ve reforzado por la ausencia de prácticas de suplementación alimentaria en el periodo seco. Las cargas de animales en las áreas de pastos se incrementan en función de la disponibilidad de alimentos(1). Entonces, se produce una caída del estado de resistencia de los hospederos por estrés alimentario y las estrongilosis gastrointestinales, comienzan a presentarse con más intensidad. En este caso, los parásitos encuentran hospederos más susceptibles que les brindan mejores condiciones para el desarrollo de la fase endógena de su ciclo biológico. Además del estrés alimentario, el consumo a fondo de los pastos y niveles favorables de humedad, crean condiciones propicias para que el rebaño consuma mayor cantidad de larvas infestivas. La humedad favorece los procesos de desarrollo y migración de larvas parasitarias. La Figura 7 muestra la dinámica mensual de la población de larvas infestivas en el pasto. Los niveles de infestación más altos se presentaron en el periodo de julio a noviembre. Estos periodos de máxima contaminación larvaria coinciden con la época lluviosa, donde las condiciones climáticas favorecen el desarrollo de las larvas.

1216


Rev Mex Cienc Pecu 2021;12(4):1208-1220

Figura 7: Comportamiento de la dinámica mensual de larvas infestivas en el pasto en sistemas de crianza de cabras Criollas Cubanas

Durante la fase exógena, las condiciones de humedad, temperaturas y radiación definen el éxito del desarrollo de las larvas. Por tanto, las variaciones estacionales de estos parámetros ambientales son generalmente un factor determinante en el comportamiento epidemiológico de las estrongilosis gastrointestinales. Según Bedotti et al(11) las altas temperaturas en el período estival causan mortandad de las larvas infectivas, lo que merma la población de nemátodos. Temperaturas elevadas, por encima de 35 a 40 °C se presentan como el segundo factor de importancia con una acción letal sobre los estadios preinfestantes. En el área de estudio, las temperaturas máximas anuales oscilan entre 29 y 33 °C, mientras, las mínimas promedio oscilan entre 17 y 22 °C (20). Este intervalo de temperaturas es óptimo para el desarrollo larval en el pasto durante todo el año. Entonces, la estacionalidad descrita en este estudio está determinada por diversas interacciones entre la estacionalidad de las lluvias y los estados fisiológicos de los hospedadores. En el Valle del Cauto existen dos periodos climáticos bien definidos: 1) el periodo lluvioso, de mayo a octubre y 2) el periodo seco, de noviembre a abril. Ramírez et al(20) describieron las variaciones en la producción de biomasa asociadas a estas épocas lo que explica la dinámica larvaria del pasto. Sin embargo, la dinámica de infestación en el hospedero sigue a la combinación de procesos más complejos. En las reproductoras, se combina el efecto de estrés alimentario, en periodo seco, con el estrés fisiológico del periparto. Esta combinación se refleja en el pico de infestación identificado en el mes de diciembre, donde se concentran los partos(1) y se agudiza el estrés alimentario por la poca producción de biomasa que caracteriza ese mes. En el caso de los animales en crecimiento, también se verifica este pico por estrés alimentario en periodo seco, pero, además, se observa un pico menos marcado en

1217


Rev Mex Cienc Pecu 2021;12(4):1208-1220

el mes de mayo. Este comportamiento en epizootiología del parasitismo gastrointestinal se conoce como “alza de primavera”. El “alza de primavera” ya había sido informada en condiciones de montaña, en el Este de Cuba(21). Aunque es necesario seguir estudiando este aspecto de la dinámica mensual, se puede afirmar que en ambos casos hay tres puntos de coincidencia que ayudan a explicar las causas de este pico. Primero, en este periodo se concentran destetes, lo que significa muchos animales estresados. Segundo, las áreas de pastoreo están altamente contaminadas por la concentración de hembras en periparto que depositan heces con altos valores de HPG. Tercero, el comienzo de las lluvias facilita la dilución de las heces y los procesos migratorios de las larvas infestivas acumuladas en el último mes del periodo seco.

Conclusiones e implicaciones Las dinámicas parasitarias de las estrongilosis gastrointestinales, que afectan a las cabras Criollas Cubanas, están relacionadas con procesos fisiológicos y zootécnicos que definen momentos críticos en los animales en crecimiento durante el periodo de destete (2,188 HPG) y para las reproductoras en periodos de periparto (972 HPG). La infestación general de los rebaños está condicionada por la combinación de mayor ingestión de larvas infestivas, procesos de estrés alimentario y estados fisiológicos predisponentes, que condicionan picos de infestación entre los meses de diciembre a febrero superiores a 1,500 HPG. La dinámica de infestación del pasto está relacionada con la estacionalidad lluviosa con picos de infestación entre los meses de julio a septiembre con un máximo promedio de 1,200 larvas por kilo de pasto.

Conflictos de interés

Los autores declaran no haber recibido fondo alguno para la realización de la presente investigación. Tampoco existe conflicto de interés entre los autores y la revista o alguna otra instancia o institución relacionada con la presente investigación. Este trabajo debido al tipo de investigación realizada, no presenta ninguna implicación ética o bioética.

1218


Rev Mex Cienc Pecu 2021;12(4):1208-1220

Literatura citada: 1. Chacón ME, La O AM, Fonseca FN, Pérez PE, Velázquez RFJ, Cos DY, Fonseca JY, et al. Caracterización genética y conservación de la Cabra Criolla Cubana. En: Biodiversidad caprina iberoamericana. Vargas-Bayona JE. (Comp.). Bogotá: Ed. Universidad Cooperativa de Colombia, 2016:75-86. 2. CENCOP. Centro de Control Pecuario. Registros de razas puras y ferias ganaderas. Ministerio de la Agricultura. Granma. Cuba. 2018. 3. La O AM, Guevara HF, Rodríguez LLA, Pinto RR, Nahed TJ. Ley de CA, Reyes ML. Evolución de los sistemas de crianza de Cabras Criollas Cubanas en el contexto de la conservación del genotipo. Rev Mex Cienc Pecu 2018;9(1):68-85. 4. Rojas N, La O AM, Arece J, Carrión M, Pérez K, San-Martín C, Valerino P, et al. Identificación y caracterización de especies de haemonchus en caprinos del Valle del Cauto en Granma. REDVET. Revista Electrónica de Veterinaria 2012;13(2):1-10. http://www.redalyc.org/articulo.oa?id=63623405003. Consultado: 25 Sep, 2019. 5. Parra RI, Magaña MA, Duarte JH, Téllez G. Caracterización técnica y rentabilidad de granjas ovinas con visión empresarial del departamento del Tolima. Rev Colombiana Cienc Anim 2014;7(1):64-72. 6. Witlock JH. The evaluation of pathological growth and parasitic diseases. Cornell Vet 1955;(45):411–421. 7. Arece J, Rodríguez JG. Dinámica de las larvas infestantes de estrongílidos gastrointestinales en ovinos en pastoreo. Pastos y Forrajes 2010;33(1):1-17. 8. StatSoft, Inc. STATISTICA (Data Analysis Software System), version 12.0., 2017 www.statsoft.com. 9. Figueroa AA, Pineda RSA, Godínez JF, Vargas ÁD, Rodríguez BE. Parásitos gastrointestinales de ganado bovino y caprino en Quechultenango, Guerrero, México. Agroproductividad 2018;11(6):97-104. 10. Rossanigo C, Page W. Evaluación de FAMACHA en el control de nematodos gastrointestinales en cabras de San Luis (Argentina). RIA. Rev Invest Agropec 2017;43(3):239-246. 11. Bedotti DO, Cristel SL, Lux J M, Hurtado AW, Babinec FJ. Presencia y dinámica parasitaria en dos majadas de Cabras Criollas en el oeste de la Provincia de la Pampa, Argentina. Actas Iberoamericanas de Conservación Animal AICA 2018;12:164-170.

1219


Rev Mex Cienc Pecu 2021;12(4):1208-1220

12. da Rosa FR, Leite TE, Mendes ADD. Correlação entre condição corporal e parasitismo de ovelhas no periparto e o desenvolvimento dos cordeiros. Anais do 10 Salão Internacional de Ensino, Pesquisa e Extensão 2018;9(3). https://guri.unipampa.edu.br/uploads/evt/arq_trabalhos/13079/seer_13079.pdf. Consultado: 25 Sep, 2019. 13. Silva JB, Castro GNS, Fonseca AH. Comparação da prevalência de parasitos gastrointestinais em cabras mantidas em manejo orgânico e convencional. Revista de Educação Continuada em Medicina Veterinária e Zootecnia do CRMV-SP 2013;11(1):69-69. 14. Arece J, Rodríguez DJG, López Y. La metodología FAMACHA®: una estrategia para el control de estrongilidos gastrointestinales de ovinos. Estudios preliminares. Rev Salud Anim 2007;29(2):91-94. 15. Suárez VH, Rossanigo CE, Descarga C. Epidemiologia e impacto productivo de nematodos en la Pampa Central de Argentina. Enfermedades parasitarias de importancia clínica y productiva en rumiantes. Fundamentos epidemiológicos para su diagnóstico y control. Eds. Fiel 2013;C:59-88. 16. Arece J. El control integrado del parasitismo gastrointestinal en los rumiantes: la garantía de un rebaño sano. Pastos y Forrajes 2012;23(1): https://payfo.ihatuey.cu/index.php?journal=pasto&page=article&op=view&path%5B %5D=959. Consultado: 25 Sep, 2019. 17. Charlier J, Morgan ER, Rinaldi L, Van Dijk J, Demeler J, Höglund J, Kenyon F. Practices to optimize gastrointestinal nematode control on sheep, goat and cattle farms in Europe using targeted (selective) treatments. Vet Record 2014;175(10):250-255. 18. Suárez VH, Fondraz M, Viñabal AE, Salatin AO. Validación del método FAMACHA© para detectar anemia en caprinos lecheros en los valles templados del Noroeste Argentino. Rev Med Vet 2014;95(2):4-11. 19. de Macedo FD, Lorenço FJ, Santello GA, Martins EN, de Moraes GV, Mexia AA, Mora NHAP. Parasitose gastrointestinal e valor do hematócrito em fêmeas ovinas alimentadas com diferentes níveis de proteína bruta. Rev Ciênc Agroamb 2016;13(2):65-73. 20. Ramírez JL, Herrera RS, Leonard I, Verdecia D, Álvarez Y. Rendimiento de materia seca y calidad nutritiva del pasto Brachiaria brizantha x Brachairia ruziziensis cv. Mulato en el Valle del Cauto, Cuba. Rev Cubana Cienc Agr 2010;44(1):65-72. 21. La O M, Fonseca N, Costa PJ, Carrión M, Vázquez J, Liranza, E, García, A. Infestación por nematodos gastrointestinales en un sistema de explotación caprina silvopastoril en condiciones de montaña. Pastos y Forrajes 2003;26(1):53-59.

1220


https://doi.org/10.22319/rmcp.v12i4.5699 Revisión bibliográfica

Linfadenitis caseosa: factores de virulencia, patogénesis y vacunas. Revisión

Maria Carla Rodríguez Domínguez a Roberto Montes de Oca Jiménez a* Jorge Antonio Varela Guerreo a

a

Universidad Autónoma del Estado de México. Centro de Investigación y Estudios Avanzados en Salud Animal (CIESA). Facultad de Medicina Veterinaria y Zootecnia. km 15.5 Carretera Panamericana Toluca-Atlacomulco, Toluca, Estado de México, México.

* Autor de correspondencia: romojimenez@yahoo.com

Resumen: La linfadenitis caseosa es una enfermedad que afecta la producción ovina y caprina a nivel mundial. El agente etiológico es una bacteria Gram positiva, intracelular facultativa denominada Corynebacterium pseudotuberculosis biovar ovis. La enfermedad puede cursar con un desarrollo cutáneo o visceral, provocando deterioro en la condición física del animal, así como pérdidas en la producción de leche y carne, decomiso de las canales, rechazo de las pieles y como consecuencia, grandes pérdidas económicas. El estudio de los factores de virulencia y los mecanismos de patogénesis han permitido comprender esta enfermedad, así como establecer las moléculas diana para el desarrollo de nuevas vacunas. Existen vacunas comerciales disponibles a nivel mundial; sin embargo, la protección conferida por éstas no ha sido eficaz en el control de la enfermedad. Actualmente el uso de nuevas tecnologías ha permitido la obtención y caracterización de proteínas con potencial inmunogénico para el desarrollado de nuevas vacunas, las cuales podrían ser una alternativa para incrementar la protección. En el presente trabajo se exponen los principales factores de virulencia de Corynebacterium pseudotuberculosis, sus implicaciones en la patogénesis y las tendencias actuales en las formulaciones vacunales.

1221


Rev Mex Cienc Pecu 2021;12(4):1221-1249

Palabras clave: Linfadenitis caseosa, Corynebacterium pseudotuberculosis, Factores de virulencia, Patogénesis, Vacunas.

Recibido: 01/06/2020 Aceptado: 08/01/2021

Introducción La linfadenitis caseosa (LAC) es una de las enfermedades que más afecta las producciones ovinas y caprinas a nivel mundial(1). El agente etiológico de la enfermedad, Corynebacterium pseudotuberculosis biovar ovis, causa una infección crónica que se caracteriza por la formación de abscesos en nódulos linfáticos cutáneos o viscerales. Esta enfermedad provoca el deterioro en las condiciones físicas de los animales, disminución de la producción de lana(2), carne(3) y leche(4), así como desórdenes reproductivos(5). En Australia el análisis de tres granjas de la región Occidental, para un total de 600 animales evaluados, permitió establecer que la infección por C. pseudotuberculosis produjo la disminución en la producción de lana grasa en 3.8-4.8 % y de lana limpia en 4.1-6.6 %. Basados en los datos obtenidos la pérdida anual en la producción de lana estaría alrededor de los $17 millones de dólares australianos (AUD)(2). Las pérdidas en la producción de carne se han estimado entre los $12-13 millones de AUD(6). Otros estudios indican que las pérdidas en general serían de alrededor de $30 a 40 millones de dólares, contemplando el rechazo de carne y canales(7). En Canadá se identificó que entre un 3 a 5 % de la carne y 0.02 a 0.03 % de los animales, son rechazados durante procesos de inspección de las plantas productoras(8). Estos hechos tienen un impacto negativo en las exportaciones, disminuyendo las posibilidades de comercialización(9). Corynebacterium pseudotuberculosis es un microorganismo zoonótico, por lo que también afecta al hombre, siendo más vulnerable el personal que trabaja en la producción de pequeños rumiantes(10). La LAC ha sido reportada en diversos países como China(11), Australia(12), Brasil(13), Canadá(14), Estados Unido(8) y México(15,16). La propagación de la enfermedad pudo ser originada por ovejas enfermas exportadas desde España a Sur América y desde Australia a Norte América y al Medio Oriente(17). La enfermedad es escasamente notificada, según los resultados de una encuesta realizada a 264 veterinarios y 510 agricultores en el Reino Unido. Solo el 18 % de los veterinarios había visto al menos un caso de la enfermedad y el 45 % de los granjeros habían notado la formación de abscesos en sus ovejas. Pocos productores investigan la causa de los abscesos, pero de 32 granjas que fueron estudiadas mediante diagnóstico de laboratorio, 24 fueron confirmadas con la presencia de la enfermedad(18). La frecuencia de presentación de la LAC en cada región o país depende principalmente del tipo 1222


Rev Mex Cienc Pecu 2021;12(4):1221-1249

de explotación, manejo y programas de control. Los rebaños en producciones extensivas, el pastoreo y la actividad de esquila condicionan la aparición de la enfermedad(19). El tratamiento con antibióticos, las intervenciones quirúrgicas y la aplicación de soluciones desinfectantes en los abscesos externos(20,21), no siempre constituyen opciones eficaces. El contenido purulento de los abscesos puede contaminar el suelo, alimento y equipos de manejo(22,23) y aunque C. pseudotuberculosis in vitro exhibe sensibilidad a un amplio rango de antibióticos(24), in vivo el tratamiento es difícil debido a la naturaleza intracelular de la bacteria(25) y al contenido grueso, seco y fibroso del absceso(8,9). La Organización Mundial de Sanidad Animal (OIE), contempla a la LAC dentro de la lista de enfermedades que requieren el desarrollo de vacunas eficaces para reducir el uso indiscriminado de antimicrobianos(26). Existen vacunas comerciales a nivel mundial contra LAC; sin embargo, la protección conferida por éstas no ha sido eficiente en el control de la enfermedad(11). Actualmente, el uso de tecnologías de nueva generación ha permitido el desarrollado de nuevas vacunas experimentales, las cuales podrían ser una alternativa para mejorar la protección. Las nuevas formulaciones buscan incluir moléculas, principales factores de virulencia, que permitan la activación del sistema inmune humoral y celular(27). La presente revisión de la literatura aborda las temáticas referentes a los principales factores de virulencia, su relación en la patogénesis y las estrategias empleadas para el desarrollo de nuevas formulaciones vacunales contra linfadenitis caseosa.

Características generales: Corynebacterium pseudotuberculosis El género Corynebacterium incluye numerosas especies de gran importancia para la industria médica, biotecnológica y veterinaria. La base de datos PATRIC Database, en el 2017 contaba con el reporte de 466 genomas y 83 especies de Corynebacterias(28). Corynebacterium pseudotuberculosis pertenece a la familia Corynebacteriaceae, género Corynebacterium. Presenta una morfología cocobacilar con amplitud de 0.5 a 0.6 μm y 1.0 a 3.0 μm de longitud. Este microorganismo es un patógeno intracelular facultativo, no flagelado, no formador de esporas ni capsula. Tiene la capacidad de crecer en anaerobiosis, degrada la galactosa, maltosa, L-y D-arabinosa y glucosa sin producción de gases. En medio de cultivo caldo simple, el crecimiento es escaso sin turbidez; sin embargo, en caldo de Infusión CerebroCorazón, BHI (por sus siglas en inglés, Brain Heart Infusion) se obtiene un crecimiento abundante con sedimento de color blanco amarillento(1). La pared celular de la bacteria está formada por una capa de peptidoglicano compuesto por ácido meso-diaminopimelico (mesoDAP), arabinosa y galactosa como azucares principales. En las reacciones de la vía de biosíntesis II de peptidoglicano; el ácido meso-DAP es el producto de la reacción catalizada por UDP-N-acetilmuramil-tripéptido sintetasa, enzima que ha sido identificada en cepas de Corynebacterium(29). El peptidoglicano a su vez está unido covalentemente con arabinogalactanos que forman un enrejado, que se encuentra unido a una capa externa de ácidos corynomicólicos (22 a 36 átomos de carbono), que se unen a trehalosa, siendo el

1223


Rev Mex Cienc Pecu 2021;12(4):1221-1249

extremo de la pared más expuestos con el exterior(30). Esta estructura lipídica actúa como una barrera, con permeabilidad selectiva mediada por proteínas integrales de membranas llamadas porinas(31). La exotoxina Fosfolipasa D (PLD) es considerada el principal factor de virulencia y puede ser detectada mediante un ensayo de hemólisis sinérgica frente a Rhodococcus equi o por inhibición de la ß hemolisina del Staphylococcus aureus. Las cepas de C. pseudotuberculosis son clasificadas en biovar equi para los aislamientos que presentan actividad enzimática nitrato reductasa (nitrato-positivo) y biovar ovis para aquellas cepas que no presentan dicha capacidad (nitrato-negativo)(1). El biovar ovis es el agente causal de la enfermedad LAC y ha sido aislado de ovejas(15), cabras(16), antílopes(32), vacas(33), alpacas(34), llamas(35), cabra montés(36) y cerdos(37). El biovar equi provoca la formación de abscesos en tejido muscular del área pectoral de equinos y en menor medida lesiones internas(38), así como también se ha aislado de camellos(39) y búfalos(40). C. pseudotuberculosis provoca infección en humanos, con la existencia de casos reportados principalmente en países dedicados a la ganadería de pequeños rumiantes. Los síntomas clínicos incluyen adenopatías axilares, inguinales o cervicales, fiebre y mialgias, con evolución crónica o subaguda, en algunos casos también puede generar neumonía(10).

Factores de virulencia Los factores de virulencia son las estructuras y moléculas que le confieren la capacidad a la bacteria de ser patógena. La adquisición de genes por transferencia horizontal ha sido trascendental en la evolución de la patogenicidad de las bacterias; ya que las funciones de los genes adquiridos le han permitido adaptarse a las distintas condiciones ambientales, incluyendo la supervivencia en diferentes nichos durante la infección a los hospederos. La mayoría de los genes de virulencia de C. pseudotuberculosis están agrupados en el genoma en regiones denominadas islas de patogenicidad (PAI). En C. pseudotuberculosis 16 PAI se han identificado, denominadas PiCp, donde la presencia de un gen de transposasa en la PiCp1, posiblemente permitió la incorporación de las PAI en el genoma(29,41). Estas regiones contienen varios genes implicados en la adhesión, invasión, colonización, propagación dentro del hospedero, supervivencia en el interior de las células infectadas y la evasión del sistema inmune. Las secuencias de las PiCp tienen un alto nivel de similitud (82–100 %) intra-biovar en las cepas ovis, las cuales presentan de 78 a 91 % de similitud con respecto al biovar equi. Sin embargo, las cepas de biovar equi contienen grandes deleciones y un menor nivel de similitud intra-biovar (77–88 %) y también en comparación con las PiCp de biovar ovis (62-74 %)(41).

1224


Rev Mex Cienc Pecu 2021;12(4):1221-1249

Ácidos corynomicólicos Los ácidos corynomicólicos, se encuentran formando parte de la capa externa de la pared celular de la bacteria, la cual constituye una barrera protectora y permeable. La unión de estos a moléculas de trehalosa, conlleva a la formación de estructuras curvas, que bloquea el acceso de moléculas (antibióticos o lisosimas) hacia el peptidoglicano, confiriendo protección mecánica(30,31). A diferencia de los ácidos grasos lineales de los fosfolípidos, los ácidos corynomicólicos son ácidos grasos hidroxi-𝛽-ramificados, que requieren carboxilación y condensación de dos ácidos grasos para su síntesis. Las enzimas AccD2 y AccD3 son carboxilasas ampliamente conservadas en la familia Corynebacteriaceae, involucradas en la generación de intermediarios para la síntesis de los ácidos corynomicólicos. Otras enzimas que participan en la síntesis son la AccD1 para la elongación de la cadena de ácidos micólicos y la FadD una AMP ligasa(29). La inoculación de ácidos corynomicólicos en ovinos demostró que la haptoglobina (Hp) aumentó tres veces su concentración, así como también dos veces los niveles de amiloide sérico A (SAA), proteínas indicadoras de inflamación e infecciones agudas(42). Estos resultados indican su potencial virulento, ya que por sí solos, son capaces de inducir en el hospedero reacciones de inflamación, que contribuye a la formación de granulomas.

Fosfolipasa D, PLD La exotoxina Fosfolipasa D es considerada el factor de virulencia principal de C. pseudotuberculosis. El gen pld fue identificado y secuenciado en 1990, forma parte de la isla de patogenicidad PiCp1 y codifica para una proteína de 31.4KDa(43). La comparación de la secuencia de la proteína PLD de C. pseudotuberculosis reveló que presenta mayor similitud con Fosfolipasa A2; sin embargo, PLD no pertenece a la familia de las fosfolipasas debido a que carece del motivo HKD conservado en esta familia(43). La PLD es clasificada como una Esfingomielinasa D (SMasaD; EC 3.1.4.41), también conocidas como esfingomielina fosfodieasterasas D o fosfolipasa D (PLD), que cataliza la escisión hidrolítica de la esfingomielina para producir colina y ceramida 1-fosfato o colina y ácido lisofosfatídico (LPA)(44). Los compuestos derivados de la degradación de la esfingomielina causan la agregación plaquetaria, hiper-permeabilidad endotelial y respuestas pro-inflamatorias(45). La acción enzimática de PLD hidroliza la esfingomielina, componente principal de las membranas celulares, lo que conlleva a una alteración de la morfología de la membrana diana. La PLD contribuye a la diseminación y persistencia de la bacteria en el interior de los macrófagos(46). El gen pld presenta una secuencia ampliamente conservada en las cepas de C. pseudotuberculosis, y cuando ésta se encuentra modificada, se dificulta la capacidad de producir la enfermedad(41).

1225


Rev Mex Cienc Pecu 2021;12(4):1221-1249

Endoglicosidasa, CP40 La proteína CP40 es codificada por un gen con un marco abierto de lectura de 1,137 pb, que se encuentra ubicado corriente abajo del gen pld en la PiCp1. Fue descrita como enzima con actividad proteasa serina(47), pero en otro estudio, el análisis de la secuencia permitió su agrupación más cercana junto a endoglicosidasas y más lejos de las secuencias de proteasas de serina(48). En este trabajo se propuso que su actividad enzimática es de endoglicosidasa, mediadora de la hidrólisis de enlaces glicosídicos, proteínas de la familia GH18, similar al dominio EndoE perteneciente a Enterococcus faecalis. Las enzimas GH18 contienen una secuencia consenso conservada motivo (LIVMFY) - (DN) -G- (LIVMF) - (DN) - (LIVMF) - (DN) -X-E, donde el ácido glutámico terminal es esencial para la actividad enzimática. Al alinear el sitio activo GH18 en CP40, quedo establecida su similitud con las enzimas EndoE y EndoS, solo con cambios en uno o dos aminoácidos respectivamente. La función como factor de virulencia se ha asociado a la capacidad demostrada in vitro de degradar la región Fc de los anticuerpos IgG. La endoglicosidasa CP40 no hidroliza los glicanos en la IgG bovina y caprina, mientras que la IgG ovina se hidroliza de manera parcial y la IgG equina por completo. También se realizó el análisis con subclases de IgG humano, presentando actividad en todas y de manera parcial en IgG4. No hubo actividad enzimática detectable en otras glicoproteínas, incluido algunos de los otros isotipos de inmunoglobulina (IgA, IgD y IgE)(48).

Proteínas secretadas PLD y CP40 Según varios informes, las proteínas exportadas o secretadas por las bacterias participan activamente en el proceso de infección(49). Por tal motivo, la expresión y secreción de las proteínas PLD y CP40 han sido sumamente estudiadas. El desarrollo de una infección experimental evidenció mediante inmunoblot que la producción de anticuerpos estuvo dirigida en un 88 % al reconocimiento de proteínas de 30-31Kda (PLD) y en un 75 a 88 % hacia proteínas de 38-41KDa (CP40), rango en el que se encuentran ambas proteínas(50). La cepa 1002 atenuada, tras varios pases en un modelo murino fue capaz de revertir la virulencia. El análisis por espectrometría de masas permitió la identificación de las proteínas PLD y CP40 únicamente, en la cepa 1002 reactivada, lo que indica la participación de estas proteínas en la virulencia(51). Por otra parte, a través de PCR en tiempo real se identificó in vitro e in vivo la expresión de varios genes involucrados en la virulencia entre ellos pld y cp40. Este análisis permitió constatar que en las cepas aisladas de nódulos linfáticos la expresión de estos genes fue superior en comparación con las cepas obtenidas de cultivos in vitro(52)

1226


Rev Mex Cienc Pecu 2021;12(4):1221-1249

Factores de virulencia involucrados en la adquisición de hierro En la PiCp1 se encuentra el operón (fag ABCD)(29), compuesto por cuatro genes fagA, fagB, fagC, fagD que se encuentran ubicados corriente abajo del gen pld. Estos genes codifican respectivamente para una proteína integral de membrana, una enterobactina transportadora de hierro, una proteína de membrana citoplasmática de unión a ATP y una proteína siderófora de unión a hierro. La FagA fue identificada como proteína de asociación a membrana con potencialidades patogénicas, mediante el análisis por espectrometría de masas de las proteínas expresadas en una cepa de C. pseudotuberculosis cultivada con suero animal(53). El cultivo de C. pseudotuberculosis en medios con quelantes de hierro (dipiridilo), provocó la disminución en un orden de logaritmo en el conteo de unidades formadoras de colonias (UFC), en comparación con las bacterias crecidas en medios enriquecidos con hierro. La evaluación de la respuesta transcripcional de C. pseudotuberculosis, con restricción de hierro, permitió identificar la regulación negativa de genes que participan en el metabolismo energético del ciclo de Krebs (sdhC, sdhB, lpd), producción de ATP (atpF, atpH), metabolismo del piruvato (lpd), fosforilación oxidativa (qcrC, qcrA, qcrB, ctaC, ctaF, ctaE, ctaD), procesos del ribosoma, transporte (rplJ, rplL, rplM, rpmA, rpsC, rpsI, rpsL, rpsM) y factores de alargamiento EF-G y EF-Ts asociados a la traducción del RNAm (fusA, tsf). Se identificó el gen análogo a dtxR de C. diphteriae, con un 79 % de similitud en la secuencia, que codifica para una proteína dependiente de unión a hierro, que actúa como factor de regulación de más de 40 genes(54). En PiCp3 y PiCp4 se han estudiado los genes pertenecientes al operón ciuABCDE involucrados en la absorción de hierro, transporte y biosíntesis de sideróforo(29).

Proteína TetA En PiCp2 el gen tetA codifica una proteína transportadora de eflujo de tetraciclina que protege ante la acción de este antibiótico y confiere resistencia a la bacteria. El gen tetA a menudo es transportado por elementos transmisibles como plásmidos, transposones e integrones y ha sido identificado en C. pseudotuberculosis(29).

Factores de virulencia para la infección de macrófagos En la isla de patogenicidad PiCp2 se encuentran los genes potG, sigK y dipZ, que responden a los mecanismos responsables del estilo de vida intramacrofágico de C. pseudotuberculosis. El gen potG codifica para una proteína de membrana de unión a ATP que proporciona energía para absorción de putrescina (poliamina) desde el espacio periplásmico, funciona como sistema transportador de putrescinas(29). Las putrescinas son poliamidas producidas por los macrófagos que inducen la disminución de la producción de especies reactivas del nitrógeno y la síntesis de citocinas pro-inflamatorias. El gen dipZ se ha identificado en el filum

1227


Rev Mex Cienc Pecu 2021;12(4):1221-1249

Actinobacteria, está regulado por sigK(55) y se activa durante la infección de macrófagos por Mycobacterium tuberculosis. En la PiCp4 la presencia del gen que codifica para el factor Sigma, confiere capacidad de proteger ante estrés oxidativo, específicamente ante la acción de los productos intermediarios del nitrógeno, producidos por los macrófagos(56). La cepa FCR41 de C. pseudotuberculosis fue empleada en el estudio de los genes relacionados con la síntesis del pili. La estructura del pili está compuesta por el pili mayor SpaA y SpaD; el pili menor SpaB y SpaE; y el pilli tipo, SpaC, SpaF. Una estructura completa de pili o incluso el pili menor pueden realizar un contacto inicial con receptores de las células hospederas, para facilitar la entrada del microrganismo. En esta cepa se identificó el gen spaC, que codifica para una proteína responsable del anclaje del pili a la pared celular, que puede permitir el contacto inicial con los receptores de la célula, para luego facilitar la invasión intracelular. También presentó el gen namH, que codifica para una neuroaminidasa extracelular, que catalizan la eliminación de los grupos de ácido siálico presentes en una gran variedad de glicoconjugados de la matriz extracelular de la célula del hospedero, lo que favorece la adherencia a las células. En FCR41 se detectó el gen sodC, que codifica para una superóxido dismutasa, enzima anclada a la membrana con dominio extracelular, que elimina los radicales libres del oxígeno productos del estallido respiratorio en los macrófagos(57).

Factores de virulencia de resistencia y adaptación Las proteínas chaperonas (HSP) son altamente conservadas y se expresan ante el estrés térmico, así como la diminución de nutrientes, hipotaxia, ruptura del metabolismo y otros procesos celulares. En C. pseudotuberculosis han sido estudiadas la Hsp10 (groES) y Hsp60 (groEL)(58). En la cepa 1002, se evaluó la resistencia a diversos tipos de estrés abióticos, tales como acidez, altas temperaturas y estrés osmótico, asociado a la presencia de estas proteínas(59). El gen hspR, codifica para el factor de regulación de la expresión (proteína represora) del operón con los genes dnaK, grpE, dnaJ y hspR, que codifican proteínas de choque térmico. En ausencia de estrés, la proteína HspR se une a una secuencia de repetición invertida que reprime a los promotores responsables de controlar la expresión del operón Hsp. En otro estudio la separación de proteínas mediante electroforesis bidimensional, permitió identificar 11 proteínas extracelulares nuevas, 3 con funciones desconocidas y 8 relacionadas con el factor de alargamiento Tu, GroEL (HSP60), enolasa, deshidrogenasa de gliceraldehído-3-fosfato y superóxido dismutasa (SodA), los cuales dependen de un método de secreción no clásico vía SecA. Ambos genes SecA (SecA1 y SecA2), se identificaron en las cepas estudiadas, posiblemente involucrados en el sistema de secreción de C. pseudotuberculosis(60). Aun se continúa con el estudio de los factores de virulencia de C. pseudotuberculosis como moléculas candidatas para el desarrollo de vacunas más potentes y eficaces.

1228


Rev Mex Cienc Pecu 2021;12(4):1221-1249

Patogénesis y mecanismos de evasión del sistema inmune La manifestación cutánea de la LAC se caracteriza por la formación de abscesos en nódulos linfáticos subcutáneos, los cuales son visibles y palpables a través de la piel y su localización depende del punto de entrada del microorganismo. Las lesiones pueden aparecer como abscesos organizados, con inflamación, encapsulación fibrosa, pérdida de pelo sobrepuesto y ruptura eventual, dando como resultado la descarga de contenido purulento. En la forma visceral, los abscesos tienen lugar en los nódulos linfáticos internos, así como en pulmones, hígado y riñones, causando deterioro en la condición orgánica del animal hacia el desarrollo de un curso crónico(61). En las formas atípicas de la enfermedad, las lesiones macroscópicas no se corresponden con nódulos caseosos, describiéndose la toxemia neonatal o icterohemoglobinuria de recién nacidos, artrosinovitis, endometritis, mastitis y orquitis(62). La infección se inicia con el ingreso de la bacteria a través de lesiones en la piel generadas durante el manejo de los ovinos, como cortes de cola, marcaje de orejas, castración, esquila o en algunos casos, lesiones generadas durante la alimentación con forraje espinoso que dañan la mucosa oral. Los baños sanitarios también contribuyen a la infección, favoreciendo la entrada del microorganismo a través de pequeñas heridas de la piel(1). La infección primaria ocurre en el sitio de ingreso de la bacteria, con diseminación hematógena y linfática formando abscesos en los nódulos linfáticos más cercanos al sitio de infección (parotídeos, submandibulares, prefemorales, preescapulares, poplíteos o mamarios). Luego ocurre una infección secundaria con la formación de abscesos en ganglios linfáticos (torácicos, bronquiales y mediastínicos) y diversos órganos(63,64). En ovinos la apariencia morfológica de los nódulos abscedados es la característica de capa de cebolla al presentar una distribución en láminas concéntricas fibrosas separadas por material caseoso. En las cabras los nódulos afectados usualmente forman una pasta purulenta uniforme seca. Esta diferencia podría deberse a la naturaleza de las enzimas fagocíticas, siendo en las cabras de mayor actividad lítica que en las ovejas(8,9). Los mecanismos involucrados en la adherencia y supervivencia intracelular de C. pseudotuberculosis en células no fagocíticas aún siguen siendo objeto de estudio por diversos investigadores. En estudios in vitro C. pseudotuberculosis fue capaz de adherirse e invadir la línea fibroblástica de células embrionarias de riñón ovino FLK-BLV-044, con replicación celular durante 24 h y viabilidad bacteriana de 120 h, con una correlación positiva entre la tasa de adherencia e invasión(65). Estos resultados sugieren que la instauración de la infección, así como la persistencia, pueden estar favorecidas por la infección intracelular en tejido del sitio de entrada del microorganismo y no solo por la infección de células fagocíticas. C. pseudotuberculosis es fagocitada por los macrófagos que son reclutados al sitio de infección, y se ha demostrado que tienen la capacidad de permanecer viables dentro de estos hasta por 72 h, evadiendo los mecanismos de eliminación de patógenos que presentan los

1229


Rev Mex Cienc Pecu 2021;12(4):1221-1249

macrófagos(66). Los macrófagos infectados con C. pseudotuberculosis activan la producción de compuestos intermediarios reactivos del oxígeno (ROI), los cuales provocan daños a nivel de ADN. La unión de las bacterias a los receptores de la membrana del fagosoma del macrófago provoca el denominado estallido respiratorio que favorece la producción de NADH. Antes de que el lisosoma se fusione con el fagosoma, en este último, tiene lugar una reducción de oxígeno molecular (O2) catalizada por la NADPH-oxidasa presente en la membrana del fagosoma. El anión superóxido resultante (O-2) es tóxico para la bacteria, pero a su vez da lugar a otros radicales tóxicos de vida corta, como el peróxido de hidrógeno (H2O2), el radical hidroxilo (OH) y el oxígeno singlete (O12). Cuando el lisosoma se fusiona con el fagosoma, se libera la enzima mieloperoxidasa, que actúa sobre los peróxidos en presencia de haluros (I- y Cl-), para producir compuestos halogenados (hipohaluros) muy tóxicos y de vida larga: ácido hipocloroso (ClOH) e hipoiodoso(66). Sin embargo, C. pseudotuberculosis ha desarrollado mecanismos de resistencia para protegerse ante los radicales libres del O2. Las superóxido dismutasas (SODs) constituyen una familia de tres metaloenzimas (FeSOD, MnSOD y CuZnSOD) con diferente localización intracelular y distribución, que catalizan la conversión de los radicales superóxido en H2O y O2. Se ha comprobado la presencia de Mn/FeSODs en C. pseudotuberculosis y el análisis filogenético permitió establecer las diferencias y similitudes evolutivas de las secuencias de esta enzima en hospederos de la especie ovina, caprina, bovina, equina y el humano, así como con diferentes especies de Corynebacterium. Esto explicaría la capacidad que presenta una misma cepa de C. pseudotuberculosis biovar ovis de permanecer en macrófagos de diferentes tipos de hospederos(67). C. pseudotuberculosis presenta la enzima catalasa(1) que brinda protección ante la acción del H2O2, ya que lo descomponen en H2O y O2. También los productos intermediarios de la enzima durante la reacción de dismutación, pueden unirse a NADPH oxidasa, lo que funciona como regulador de la actividad enzimática y disminuye la formación de otros productos del estrés oxidativo como el radical hidroxilo y el oxígeno singlete (O12). También en los macrófagos actúan como otro mecanismo de eliminación de patógenos los productos reactivos del nitrógeno (RNI). El estudio in vitro de cepas de C. pseudotuberculosis mutantes del factor sigma, fueron más susceptibles a concentraciones de óxido nítrico, por lo que se propone que la presencia de éste, proteja ante este tipo de estrés oxidativo(56). La presencia de ácidos corynomicólicos le otorga a C. pseudotuberculosis protección mecánica y posiblemente bioquímica, permitiéndole resistir la digestión por enzimas hidrolíticas presentes en los lisosomas y la acción de proteínas antimicrobianas(66). La inoculación de extractos de ácidos corynomicólicos, en cabras hembras, causó hemorragia, congestión, degeneración, necrosis, edema e infiltraciones leucocíticas en órganos reproductores y en ganglios linfáticos asociados, así como aumentó la concentración de hormonas estrogénicas(62). También se han asociado con disminución de testosterona y pérdida de calidad del semen, con aumento en producción de citocinas pro-inflamatorias(5). 1230


Rev Mex Cienc Pecu 2021;12(4):1221-1249

La exotoxina PLD cataliza la disociación de la esfingomielina componente importante de las membranas celulares, cuya hidrólisis provoca la lisis celular incrementando la permeabilidad vascular, con la consecuente formación de edemas(1). La PLD actúa directamente sobre las células endoteliales en el entorno del punto de infección y en los macrófagos una vez que ha sido fagocitada la bacteria. La acción de esta toxina facilita la colonización, la diseminación regional y sistémica de la bacteria, con la generación de abscesos en los nódulos linfáticos(66). Las bacterias no controladas por la pared del absceso entran en los capilares y forman colonias que ocluyen a los vasos sanguíneos, generando isquemia que, junto a las toxinas, destruyen las células del tejido sano, aumentando la masa necrótica. Las bacterias viables se diseminan a través de los vasos linfáticos y penetran otros linfonodos y vasos sanguíneos, llegando a diferentes órganos donde se repite la formación de abscesos. Este comportamiento origina las manifestaciones clínicas de la enfermedad de tipo visceral, que afecta nódulos linfáticos internos y órganos especialmente pulmones e hígado(61,64). C. pseudotuberculosis se libera del interior de las células como resultado de un proceso que conlleva a la muerte de los fagocitos. Aunque los mecanismos específicos aún no están claros, se plantea que la muerte celular de los macrófagos no es inducida por la autofagia o la apoptosis. Estudios realizados in vitro mediante la infección de la línea de macrófagos J774 con C. pseudotuberculosis, permitió determinar que los niveles de la proteína I asociada a microtubulos de cadena ligera 3 (mecanismo de autofagia) y la actividad de la caspasa-3 (mecanismo de apoptosis), se mantuvieron estables sin variación en las células infectadas(25). En otros trabajos la necrosis se ha visto favorecida en vez de la apoptosis, en macrófagos infectados con C. pseudotuberculosis, provocando cambios degenerativos como la ruptura de la membrana plasmática, alteraciones en las mitocondrias, cambios en la envoltura nuclear, dilatación de la envoltura del núcleo y de la membrana del retículo endoplásmico rugoso y formación de vesículas en el citoplasma(68,69). Otra característica de la enfermedad es la formación de piogranulomas, como resultado del crecimiento bacteriano incontrolado dentro de los macrófagos, el hospedero intenta restringir y limitar la infección a través de la formación de estas estructuras. Los estudios inmunohistoquímicos sobre la composición celular de las lesiones pulmonares en ovejas infectadas por C. pseudotuberculosis han puesto de manifiesto un predominio de macrófagos grandes en las paredes del absceso y rodeando el parénquima pulmonar, con expresión de moléculas del complejo principal de histocompatibilidad de clase II (MHC). Los linfocitos T fueron prominentes en las lesiones, mientras que los linfocitos B y granulocitos comprendían una porción menor en los infiltrados celulares. Dentro de las lesiones encapsuladas se encontraron linfocitos y células MHC clase II en el centro de la masa necrótica. Rodeando esta región se identificaron células CD5+, así como células CD4+ y CD8+ distribuidas a través del tejido linfático. Generalmente en las lesiones caseosa inmaduras se encuentran linfocitos CD4+ y en las lesiones más desarrolladas la concentración 1231


Rev Mex Cienc Pecu 2021;12(4):1221-1249

de células CD8+ es predominante, lo que se relaciona con el mecanismo del sistema inmune para combatir la diseminación de los macrófagos infectados(70,71). En cabras los cambios histopatológicos observados en el tracto reproductivo y nódulos linfáticos después de la inoculación experimental con C. pseudotuberculosis, revelaron infiltración leucocítica, así como congestión generalizada, degeneración, infiltración de células del estroma y necrosis en los ovarios(71). El estudio de la respuesta del sistema inmune en un modelo experimental permitió establecer que la respuesta humoral comienza entre el día 6 y 11 post infección. A partir del día 5 de la infección se produce la expresión de IFN-γ con valores de 0.5 a 1.0 (DO450), seguido de una segunda producción a partir del día 16 post-infección con máximos de 2.5 a 3.0, valores elevados que se mantienen hasta el día 4256 de la infección, donde empieza a decaer la respuesta. La producción primaria de IFN-γ se ha asociado con la respuesta innata que involucra células NK, mientras que la respuesta secundaria de mayor duración se asocia con la respuesta inmune adquirida con la participación de células T(70). La producción de citoquinas pro-inflamatorias TNF-α e IL6 tienen lugar en el sitio de inoculación, mientras que el IFN-γ se encuentra en los linfonódulos drenados (72).

Vacunas comerciales La mayoría de las vacunas comerciales disponibles para LAC están compuestas por formulaciones polivalentes, presentando una combinación de antígenos de varios agentes patógenos incluyendo exotoxina PLD, considerada el antígeno con mayor capacidad inmunogénica para C. pseudotuberculosis(11,27). Han sido empleadas desde hace varias décadas, sin embargo aún no se encuentran disponibles en todos los países productores de pequeños rumiantes, incluido México. La vacuna Glanvac 3 (Zoetis, London) (73), combina toxinas de CIostridium perfringens Tipo D, Clostridium tetani y C. pseudotuberculosis y evaluada en ovinos del Reino Unido, informó que solo el 20.8 % del total de seis animales vacunados y desafiados con una cepa virulenta, presentaron lesiones de donde se aisló la bacteria. La vacuna Glanvac 6 (Zoetis, West Ryde, Australia), presenta una formulación multicomponente que incluye toxinas de C. pseudotuberculosis, Clostridium perfringens tipo D, Clostridium tetani, Clostridium novy tipo B, Clostridium septicum y Clostridium chauvoei. Esta vacuna reduce las manifestaciones clínicas de la enfermedad y el desarrollo de lesiones pulmonares(8,13). En Australia es administrada tanto a ovejas como cabras, y varios ensayos de campo han mostrado tasas de protección variables, con valores que van desde 25 hasta 90 % del total del rebaño. En 1995 la prevalencia promedio de LAC en ovejas adultas en rebaños vacunados era de 97 % en Nueva Gales del Sur, 91 % en Victoria y el 88 % en Australia Occidental. Para el 2003 la prevalencia promedio estimada de LAC en la población de ovejas adultas había disminuido

1232


Rev Mex Cienc Pecu 2021;12(4):1221-1249

a 29 % en Nueva Gales del Sur, 26 % en Victoria y 20 % en Australia Occidental; y de un 26 % en general a 5.9 % en el 2009. Además, el estudio permitió establecer que solo el 43 % de los productores usaban la vacuna y de estos solo el 12 % seguían de manera adecuada las indicaciones del fabricante(6,12). Sin embargo, estas vacunas de la serie Glanvac no impiden la infección, y presentan reacciones adversas con formación de granulomas cutáneos en el sitio de la inyección, tanto en ovejas como en cabras, con choque anafilácticos en esta última(7,8). En Canadá en 1998 se realizó una evaluación de la eficacia de Glanvac 6 en comparación con la vacuna comercial Case-Bac (Colorado Serum, EUA), y una vacuna experimental compuesta por muramil dipéptido. La vacuna Glanvac 6 y la vacuna experimental presentaron un mayor título de anticuerpos que Case-Bac, durante 6 a 12 meses; sin embargo, Glanvac 6 provocó un elevado número de manifestaciones de alergia en el sitio de inoculación(74). La vacuna Caseous D-T (Colorado Serum, EUA) compuesta por toxinas de Clostridium perfringens tipo D, Clostridium tetani y cultivos totales inactivados de C. pseudotuberculosis en combinación con PLD, se ha empleado en Estados Unidos, demostrando que ayuda a disminuir la presencia de abscesos internos y externos, aunque con efectos secundarios como leve cojera (dolor) en corderos y letargo, en un porcentaje elevado de los animales maduros. Por otra parte, la vacuna Case-Bac (Colorado Serum, EUA), compuesta por toxina PLD, ha sido utilizada fundamentalmente en ovejas. Esta vacuna también ocasiona reacciones adversas en el sitio de inoculación, letargo, rigidez y fiebre, siendo estos síntomas más severos en cabras, incluyendo manifestaciones de edema ventral, ataxia y convulsiones, lo que conlleva a que este profiláctico no esté aprobado para su uso en esta especie. El empleo de esta vacuna en ovejas, redujo la formación de abscesos, donde solo 10 de un total de 18 animales presentaron abscesos externos en comparación con el grupo control donde todos desarrollaron estas lesiones. Por otra parte solo 2 de las 18 ovejas vacunadas tenían abscesos internos, mientras que 9 de cada 10 ovejas de control tenían abscesos internos(8, 9). En España la compañía Zoetis comercializa la vacuna Biodectin™, la cual está compuesta por seis fracciones antigénicas: Clostridium septicum, Clostridium novyi Tipo B, Clostridium tetani, Clostridium perfringens Tipo D, C. pseudotuberculosis y Clostridium chauvoei, hidróxido de aluminio, Tiomersal y Moxidectina (compuesto con actividad antiparasitaria)(75). También existen vacunas comerciales elaboradas a partir de cepas vivas atenuadas, como LinfoVac (Laboratorios Vencofarma do Brasil), desarrollado por la Empresa Baiana de Desarrollo Agrícola (www.ebda.ba.gov.br) en colaboración con el Instituto de Ciencias de la Salud de la Universidad Federal de Bahía, que contiene la cepa viva atenuada 1002 de C. pseudotuberculosis y su uso está autorizado en Brasil. Estudios experimentales en un modelo murino indicó que la protección que confiere esta vacuna es de 80 %(10).

1233


Rev Mex Cienc Pecu 2021;12(4):1221-1249

La protección proporcionada por las vacunas comerciales está asociada a la producción de anticuerpos anti-exotoxina PLD, los cuales protegen contra el daño tisular y la diseminación del microorganismo. Sin embargo, confieren una protección parcial, ya que estas vacunas no favorecen la activación de la respuesta inmune celular, principalmente de tipo T citotóxicas necesaria para eliminar las bacterias intracelulares. Por tal motivo diferentes grupos de investigadores han trabajo en el desarrollo de vacunas experimentales que permitan mejorar la protección.

Vacunas experimentales Vacunas inactivadas y toxoides Las vacunas inactivadas están compuestas por cultivos totales de la bacteria no viables o toxinas inactivadas, ya sea por métodos químicos o físicos. En estas formulaciones el microrganismo se encuentra muerto por lo que no confieren peligro de desarrollo de la enfermedad; sin embargo, la respuesta principalmente es de tipo humoral, menos intensa, requiere de altas concentraciones del microorganismo y de varias dosis. No son sometidas a ningún procedimiento de purificación, por lo que contienen todos los componentes bioquímicos de la bacteria los cuales son más reactógenos y pueden producir efectos adversos. El precipitado proteico de una cepa de C. pseudotuberculosis aislada de alpaca en Perú, se evaluó en un grupo de 20 ratones BALB/c, donde indujo protección ante el desafío con 104 UFC de una cepa virulenta de C. pseudotuberculosis. La vacuna redujo los efectos tóxicos provocados por la bacteria, lo cual se observó con la disminución del número y tamaño de abscesos en los animales del grupo vacunado (40 % afectado) en comparación con los múltiples abscesos de mayor tamaño a nivel subcutáneo y en riñón e hígado, en los animales del grupo control (95 % afectado)(76). Las formulaciones vacunales en base a 250 - 500 mg/ml de pared celular y 133-265 mg/ml de toxina PLD, todas suplementadas con 20 mg/ml de muramil dipéptido como adyuvante, fueron evaluadas en alpacas, sometidas al desafío con 106 UFC de una cepa virulenta de C. pseudotuberculosis. Los animales vacunados con la mayor dosis de PLD no mostraron abscesos a diferencia del grupo vacunado con la menor concentración, donde se observó la formación de abscesos en el sitio de inoculación y en linfonodos renales. Las formulaciones que incluyeron pared celular mostraron un menor grado de protección, con formación de abscesos superficiales e internos. Los resultados sugieren que la concentración de toxina PLD, puede influir en la capacidad protectora, siendo dosis dependiente en la inmunización de alpacas(77). El grado de protección conferido por la vacunación con toxina PLD adsorbida en gel de hidróxido de aluminio (Grupo 1) o su combinación con toxinas de Clostridium perfringens

1234


Rev Mex Cienc Pecu 2021;12(4):1221-1249

D, Clostridium novyi B, Clostridium tetani, Clostridium septicum y Clostridium chauvoei (Grupo 2), así como toxinas de Clostridium spp., PLD y 1.2 mg/ml de selenato de sodio (Grupo 3); fue evaluado en un modelo ovino, desafiado con 1.3 x 108 UFC de una cepa virulenta de C. pseudotuberculosis. El porciento de animales afectados en el grupo 1 fue de 10.5 % (4 de 38 animales mostraron una lesión superficial), para el grupo 2 de 7.9 % (3 de 38 animales mostraron una lesión superficial) y de 8.3 % en el grupo 3 (2 de 24 animales), cada uno con una lesión superficial y a nivel de pulmón, en contraste con los resultados obtenidos en el grupo control de animales no vacunado con afectación del 51.5 % (17/33) con 60 lesiones a nivel de pulmón y 16 en carcasas, con 4.5 lesiones por animal. Los resultados indicaron que no hubo depresión de la potencia protectora como resultado de la combinación de PLD con los antígenos de Clostridium(78). La eficacia de cuatro vacunas no comerciales en base a PLD como antígeno se evaluó en ovinos desafiados con una cepa virulenta. Los niveles de iones superóxido se determinaron como respuesta inmune inespecífica, siendo estos elevados en el grupo vacunado con PLD + bacteria inactivada, seguido del grupo vacunado con Toxoide PLD. La actividad de lisozimas fue superior en el grupo vacunado con PLD + bacteria inactivada, seguido de Toxoide PLD, PLD + vacuna comercial Covexin8 y una vacuna experimental local. El grupo vacunado solo con PLD mostró una marcada respuesta positiva de proliferación de linfocitos en comparación con el resto de los grupos. Los resultados indicaron que la PLD estimuló la respuesta inmune celular específica e inespecífica(79). Cuatro extractos antigénicos diferentes obtenidos de la cepa atenuada T1, fueron evaluados en cabras de raza Canindé, para el estudio de la respuesta inmune humoral y celular. Los animales del grupo 1 (inmunizados con 0.5ml del sobrenadante de cultivo de la cepa T1 en proporción 1:1 con adyuvante incompleto de Freund, AIF) y grupo 3 (inmunizados con 100 mg de concentrado extracelular, 250 mg de oligodesoxinucleótidos CpG y 0.5 ml de adyuvante AIF); mostraron los niveles de anticuerpos e IFN-ɣ más elevados luego de la inmunización, así como post-desafío con 105 UFC de la cepa virulenta VD57, en comparación con los grupos 2 (1 ml de suspensión de 2 x 106 UFC/ml cepa T1), grupo 4 (formulación del grupo 3 sin AIF) y grupo 5 control. Solo el 25 % de los animales del grupo 1, el 33.3 % del grupo 2 y 22.2 % del grupo 3 no desarrollaron lesiones, en el grupo 4 y 5 el 100 % de los animales desarrollo algún tipo de lesión(80). Estos resultados evidencian que la producción de anticuerpos específicos anti-PLD solo disminuye la diseminación de la bacteria y aparición de lesiones en tejidos diferentes al sitio de inoculación, no controlando la infección. Las vacunas de tipo bacterinas o toxoides, contribuyen a disminuir las manifestaciones clínicas de la enfermedad, siendo más eficientes en ovinos que caprinos, aunque en ninguna de las dos especies se logra controlar la infección, quedando un porciento de animales afectados que pueden propagar la enfermedad.

1235


Rev Mex Cienc Pecu 2021;12(4):1221-1249

Vacunas atenuadas Las vacunas atenuadas presentan agentes inmunizantes vivos que pueden replicarse en el organismo sin causar la enfermedad, ya que carecen de determinadas estructuras o moléculas que disminuyen su virulencia. En principio confieren una respuesta inmune muy intensa y de larga duración, ya que dan lugar a una infección similar a la natural, pero constituyen un riesgo, ya que en algunos casos puede revertirse la virulencia. Las primeras vacunas atenuadas experimentales para LAC empleaban una cepa denominada Toxminus, cuyo gen pld se modificó mediante mutación sitio específica. La necropsia de los animales vacunados con 105 a 107 UFC de la cepa atenuada Toxminus, permitió observar que no se formaron abscesos en los animales desafiados con 106 UFC de una cepa virulenta, en comparación con el grupo control donde se desarrollaron abscesos de 2.5 cm en ganglios poplíteo. Sin embargo, la vacuna produjo un absceso indeseable en el sitio de inoculación, el título de anticuerpos en los grupos vacunados con 105 a 107 UFC fue similar, por lo que la respuesta no fue dosis dependiente y la cepa virulenta de desafío indujo una respuesta de anticuerpos superior en las semanas 5 y 9. También hubo una reducción en la capacidad de la cepa Toxminus de permanecer en el hospedero, debido a la ausencia de PLD, antígeno que favorece la persistencia, además de activar de manera elevada la respuesta inmune humoral(81). En otro estudio se transformó la cepa Toxminus con un plásmido que contenía el gen de pld modificado para la obtención de la exotoxina con un cambio de histidina por un triptófano en la posición 20, lo que elimina la actividad enzimática. La inmunización con la cepa Toxminus administrada vía oral, indujo una respuesta humoral predominante de tipo IgG1, mientras que los niveles del isotipo IgG2 fueron superiores en ovejas vacunadas vía subcutánea. Las células Th1 son responsables de la inmunidad celular mediada por células, producen IFN-ɣ, IL-2 y factor de necrosis tumoral beta (TNF-β), citoquinas que activan macrófago y complementan la activación de los linfocitos B para la producción de anticuerpos del isotipo IgG2. Por otra parte, los clones Th2 secretan IL-4 y preferentemente inducen en las células B la producción de IgG1, IgA e IgE. En consecuencia, con los resultados obtenidos, los animales vacunados vía oral no presentaron niveles significativos de protección, debido a que el aumento en IgG1 es indicativo de ausencia de una respuesta Th1, la cual es fundamental para la activación de célula T citotóxicas, esenciales para la eliminación de patógenos intracelulares, como C. pseudotuberculosis. La incidencia y el grado de formación de abscesos fueron muy reducidos (abscesos de 0.2 cm y 1 cm), presentándose solo en dos animales en el sitio de inoculación de la cepa virulenta para el desafío. En el grupo de animales vacunados con la cepa Toxminus no modificada, el 50 % de las ovejas desarrollaron abscesos, así como también el 66 % de animales del grupo control no vacunado. La cepa Toxminus no permitió una expresión elevada de PLD y se encontró evidencia de la excreción de la bacteria viva atenuada a través de las heces(82).

1236


Rev Mex Cienc Pecu 2021;12(4):1221-1249

La cepa CZ171053 mutada en el gen ciuA, mediante el sistema tramposon-TnFuZ, presentó una capacidad reducida para sobrevivir in vitro dentro de los macrófagos de la línea celular J774. La inmunización de ratones BALB/c con esta cepa atenuada, permitió la sobrevivencia del 80 % de los animales desafiados con 106 UFC de la cepa virulenta MIC-6. Estos resultados sugieren que la cepa CZ171053 podría evaluarse como vacuna viva atenuada en los hospederos diana de la enfermedad. El comportamiento de la respuesta inmune humoral y celular se evaluó en ratones BALB/c inoculados con 107 UFC de la cepa atenuada T1. Se observó un aumento en el título de IgG1 e IgG2, no se mostraron lesiones características de la enfermedad y el cultivo de las células del bazo, estimuladas in vitro con antígenos secretados por T1, presentaron una mayor proliferación en comparación con las células estimuladas con antígenos intracelulares(83).

Vacunas de ADN Los avances en las técnicas de biología molecular han permitido el desarrollo de vacunas de nueva generación, dentro de las que se encuentran las vacunas de ADN desnudo. Estas vacunas son solo de ADN (plásmidos con los genes de interés), no cuentan con envolturas o estructuras proteicas, por lo que es muy importante la ruta de administración, la dosis, y la re-inmunización, ya que son factores que influyen en la potencia y el tipo de respuesta inmune. La desventaja de este tipo de vacunas radica en la capacidad de expresar el antígeno de interés, ya que en la mayoría de los casos las partículas presentan una baja adsorción y la cantidad de plásmidos que se introduce en las células es limitada. El diseño de un plásmido portador del gen que codifica para el dominio extracelular de CTLA-4 bovino fusionado al gen pld inactivado (boCTLA-4-HIg-ΔPLD) se evaluó como vacuna de ADN desnudo en ovinos. El CTLA-4 se une con alta afinidad al antígeno de membrana B7 en células presentadoras de antígeno (APC), mejorando la respuesta inmune humoral. Aunque aumentó el título de anticuerpos significativamente, la protección de los ovinos inmunizados fue parcial ante el desafío experimental con una cepa virulenta(84). Diferentes vías de inmunización fueron evaluadas: intramuscular, subcutánea y bombardeo con pistola génica. Los niveles máximos de anticuerpos IgG totales fueron de 12x103 en el grupo vacunado vía intramuscular, mientras que en los grupos con las otras vías de administración se alcanzaron valores de 3-4 x 103. La protección conferida por la vacuna administrada vía intramuscular fue de un 45 % (9 de 20 animales), en comparación con el resto de los grupos (vía subcutánea y pistola génica) que solo protegieron al 10 % de los animales(85). El potencial de una vacuna de ADN formulada en base al plásmido pTARGET transformado con la proteína esterasa cp09720(86), se comparó con una vacuna de subunidades con

1237


Rev Mex Cienc Pecu 2021;12(4):1221-1249

CP09720 recombinante adyuvada con hidróxido de aluminio. Ambas se evaluaron en ratones BALB/c, siendo la vacuna de proteína recombinante la que indujo mayor título de anticuerpos IgG1 e IgG2. Las dos vacunas fueron capaces de aumentar la expresión de IFNγ, aunque la vacuna de subunidades presentó los niveles más altos de ARNm de IFN-γ. Los niveles de protección ante el desafío fueron de 58.3 % en los animales vacunados con la esterasa recombinante, mientras que la vacuna de ADN pTARGET/ proteína esterasa cp09720 solo protegió al 16.6 %.

Vacunas de subunidades proteicas recombinantes Las vacunas de subunidades combinan antígenos como lipopolisacáridos, proteínas recombinantes o péptidos sintéticos. Estas vacunas son muy seguras, pero poco inmunogénicas, por lo que se utilizan sustancias adyuvantes que potencien la respuesta del sistema inmune. La proteína PLD obtenida por vía recombinante ha sido de las más empleadas para el desarrollo de vacunas de subunidades. Un grupo de investigadores del Reino Unido determinó las potencialidades de una vacuna a partir de 50 µg de PLD obtenida por vía recombinante (PLDr) en E. coli y su combinación con 1.25×1010 células/ml de cultivos totales de C. pseudotuberculosis inactivados con formalina. En este trabajo, el grupo control fue vacunado con la vacuna comercial Glanvac 3 (Commonwealth Serum Laboratories (CSL) Ltd., Victoria, Australia). Los niveles más altos de anticuerpos fueron detectados en los grupos inmunizados con la vacuna de PLDr y la vacuna PLDr + células totales inactivadas, en comparación con los grupos controles(73). La proteína PLDr junto a cultivos totales de C. pseudotuberculosis biovar ovis y equi, inactivados con formalina, fueron empleados para la inmunización de ovinos. La detección de los niveles de anticuerpos anti-PLD mediante ELISA permitió detectar que los animales vacunados presentaron un aumento de IgG después de la segunda dosis de refuerzo, pero luego del desafío se produjo una disminución en la DO de 0.65 a 0.55, aunque los niveles se mantuvieron por encima del valor de corte durante 20 semanas. No se observaron lesiones en nódulos linfáticos externos e internos, en comparación con el grupo control no vacunado donde el 80 % de los animales presentaron lesiones y manifestaciones de la enfermedad. Ambas vacunas fueron capaces de proteger a los animales ante el desafío con una cepa virulenta. En este trabajo por primera vez se inmunizan ovejas con una cepa biovar equi en combinación con la PLDr(87). Diferentes proteínas obtenidas por vía recombinante rCP09720 (esterasa), rCP01850 (proteína L14 de unión a la subunidad ARNr 50S) y la PLD (rPLD) también se han evaluado en la inmunización de ratones BALB/c. En este estudio, las tasas de supervivencia después del desafío con una cepa virulenta fueron de 30 % (rPLD), 40% (rPLD + rCP09720) y 50 % (rPLD + rCP01850). La vacuna rPLD + rCP01850 fue capaz de inducir una respuesta inmune

1238


Rev Mex Cienc Pecu 2021;12(4):1221-1249

celular aumentando significativamente los niveles de IFN-γ y TNF-α, mientras que la producción de IL4 e IL12 no fue detectada(88). También se empleó una cepa viva atenuada de Mycobacterium bovis BCG (BacillusCalmette- Guerin) para la expresión de PLD recombinante en el plásmido pUS2000. El sistema no fue eficiente para la expresión elevada de la proteína PLD, pero fue efectivo para la vacunación y protección en un modelo murino. La inmunización de ratones BALB/c con 106 UFC de M. bovis pUS2000/PLD para la expresión de PLD, así como con M. bovis pUS2000/PLD+ 50µg de PLDr purificada y la cepa M. bovis sin modificar, indujo una producción de anticuerpos elevada en comparación con el control negativo (100 µl de Na Cl 0.9%), pero sin diferencias significativas entre los grupos vacunados. Esto se debe a que la cepa M. bovis por si sola es capaz de inducir una respuesta inmune humoral y celular elevada. Sin embargo, ante el desafío con 2 x 104 UFC de la cepa virulenta MIC-6, el grupo vacunado con M. bovis pUS2000/PLD experimentó un aumento significativo en los niveles de IgG en comparación con el resto de los grupos. La respuesta inmune celular se evaluó midiendo los niveles de producción de IFN-γ e IL-10 en los sobrenadantes de cultivo de células de bazo de los animales vacunados, tras ser estimuladas con 8 µg/ml de PLDr. Los niveles de IFN-γ e IL-10 fueron superiores en el cultivo celular del grupo que recibió una reactivación de la vacunación con 50 µg de PLDr. El nivel de protección conferida por estas formulaciones fue del 88 % en los animales vacunados con M bovis pUS2000/PLD+ 50 µg de PLDr, de 77 % para el grupo M. bovis pUS2000/PLD y del 66 % para el grupo M. bovis no modificado. La respuesta inmune protectora generada por esta vacuna de células enteras de M. bovis BCG modificada para expresar PLD, podría originar la activación de varias poblaciones de células T, debido a la variedad de antígenos (lípidos, proteínas y carbohidratos) de la formulación. Luego la re-inmunización con 50 µg de la PLD obtenida vía recombinante estimula el aumento en la proliferación de células T específicas para este antígeno en particular(89). Las vacunas de subunidades también se han desarrollado empleando la proteína CP40 obtenida por vía recombinante. La preparación de las vacunas de PLD a partir de sobrenadantes de cultivo de C. pseudotuberculosis habitualmente contienen otros antígenos, que podrían estar contribuyendo con la respuesta inmune protectora. La proteína CP40 fue identificada en preparaciones de vacunas inactivadas, a través de ensayos de inmunoblot, donde se observó que los sueros de animales vacunados con Glanvac 6 podían reconocer de manera intermitente esta proteína, lo que sugiere que estaba presente en algunos lotes de vacuna(82). En un estudio experimental en ovejas, la inmunización con 100 µg de CP40 recombinante protegió al 82 % de los animales, con una disminución de las lesiones pulmonares en un 98 %. No se encontró relación entre la disminución en el desarrollo de lesiones pulmonares y el titulo de anticuerpos, por lo que se asumió que la respuesta celular, como citotoxicidad celular dependiente de anticuerpos, podría ser responsable de la protección(43).

1239


Rev Mex Cienc Pecu 2021;12(4):1221-1249

Posteriormente se realizó la evaluación comparativa de cuatro formulaciones vacunales, que utilizaron como inmunógenos la proteína CP40 recombinante y la cepa CP09 atenuada mediante mutagénesis inducida. La cepa viva atenuada de C. pseudotuberculosis CP09 no fue capaz de inducir una respuesta inmune humoral en los ratones vacunados, ni desafiados con una cepa virulenta. Los animales vacunados con las formulaciones que incluían CP40r presentaron un aumento significativo en el título de anticuerpos IgG1. Sin embargo, estos grupos luego del desafío experimentaron un aumento significativo en los niveles de IgG2, siendo el máximo alcanzado por los animales inmunizados con CP40r. La formulación a base de CP40r protegió al 90 % de los animales ante el desafío con la cepa virulenta, seguido del grupo vacunado con la cepa atenuada CP09 + CP40r con 70 %, mientras que la vacunación con CP40r seguido de la re-inmunización con CP09 solo protegió al 60 %(90). Otro grupo de investigadores realizó la evaluación en ratones BALB/c de una vacuna de subunidades de CP40r con diferentes adyuvantes, saponina o adyuvante completo de Freud (ACF). Los animales inmunizados con CP40r/saponina mostraron valores elevados en los niveles completos de anticuerpos y de IgG2a, IgG2b e IgG3, con diferencias estadísticas significativas con respecto al grupo control. El grupo vacunado con CP40r/ACF mostró diferencias significativas en los niveles completos de IgG, IgG2a e IgG2b. Ambas formulaciones vacunales protegieron al 100 % de los animales desafiados con 104 UFC de C. pseudotuberculosis cepa virulenta C57, con una tendencia hacia una respuesta de Th1. La reactividad y la producción de isotipos específicos IgG2a, IgG2b e IgG3 se asocian con la acción de las citocinas pro-inflamatorias como IFN-γ y las células T CD8+, que activan las células B modificando la cadena pesada de la inmunoglobulina. El uso de diferentes adyuvantes no influyó en la respuesta de anticuerpos, por lo que se propone el empleo de la saponina en sustitución del adyuvante de Freud que es tóxico en ovejas(91).

Conclusiones La linfadenitis caseosa continúa siendo un reto para los productores ovinos y caprinos a nivel mundial. Las investigaciones más recientes se han enfocado en la identificación de nuevas moléculas implicadas en los mecanismos de patogenicidad y virulencia de C. pseudotuberculosis, para su posterior evaluación como candidatos vacunales. Hasta la fecha se han obtenido resultados alentadores con formulaciones a base de la exotoxina PLD o la endoglicosidasa CP40, obtenidas por vía recombinante. Cabe destacar que la combinación de estas moléculas no se ha evaluado en una misma vacuna, lo cual sería una propuesta que favorecería la activación de la respuesta inmune humoral y celular. Por otra parte, la aplicación del análisis computacional en estudios de vacunología reversa constituye una de las herramientas más empleadas actualmente en la búsqueda de moléculas candidatas vacunales. Sin duda se debe continuar trabajando con el empleo de estas tecnologías que constituyen una alternativa eficiente para la identificación de nuevos factores de virulencia,

1240


Rev Mex Cienc Pecu 2021;12(4):1221-1249

así como la evaluación in silico de moléculas con potencial inmunogénico para el desarrollo de vacunas eficaces. Conflicto de intereses Los autores declaran que no existe conflicto de intereses. Literatura citada: 1.Dorella FA, Pacheco LG, Oliveira SC, Miyoshi A, Azevedo V. Corynebacterium pseudotuberculosis: microbiology, biochemical properties, pathogenesis and molecular studies of virulence. Vet Res 2006;37(2):201–218. 2. Paton MW, Rose IR, Hart RA, Sutherland SS, Mercy AR, Ellis TM, et al. New infection with Corynebacterium pseudotuberculosis reduces wool production. Aust Vet J 1994; 71:47-49. 3. Collett MG, Bath GF, Cameron CM. Corynebacterium pseudotuberculosis infections. In: Coetzer J, Thomson GR, Justin RC, editores. Infectious diseases of livestock with special reference to Southern Africa. Cape Town, South Africa: Oxford University Press; 1994:1387–1395. 4. Schreuder BE, Ter Laak EA, De Gee AL. Corynebacterium pseudotuberculosis in milk of CL affected goats. Vet Rec 1990;127(15):387. 5.Faeza NMN, Jesse FFA, Hambal IU, Odhah MN, Umer M, Wessam MMS, et al. Responses of testosterone hormone concentration, semen quality, and its related pro-inflammatory cytokines in bucks following Corynebacterium pseudotuberculosis and its mycolic acid infection. Trop Anim Health Prod 2019;51(7):1855-1866. 6.Paton MW, Walker SB, Rose IR, Watt GF. Prevalence of Caseous lymphadenitis and usage of Caseous lymphadenitis vaccines in sheep flocks. Aust Vet J 2003;81:91-95. 7.Windsor PA. Control of Caseous Lymphadenitis. Vet Clin Food Anim 2011;27:193–202. 8.Williamson LH. Caseous lymphadenitis in small ruminants. Vet Clin North Am Food Anim Pract 2001;17(2): 359-371. 9.Aleman MR, Spier SJ. Corynebacterium pseudotuberculosis infections. In: Smith PB, editor. Large animal internal medicine, 3rd ed. St. Louis: Mosby Co. 2002:1076–1084. 10.Bastos BL, Dias PRW, Dorella FA, Ribeiro D, Seyffert N. Corynebacterium pseudotuberculosis: Immunological responses in animal models and zoonotic potential. J Clin Cell Immunol 2012;S4 (005):1-15.

1241


Rev Mex Cienc Pecu 2021;12(4):1221-1249

11.Gao H, Ma Y, Shao Q, Hong Q, Zheng G, Li Z. Genome sequence of Corynebacterium pseudotuberculosis strain KM01, isolated from the abscess of a goat in Kunming, China. Genome Announc 2018;6(11):e00013-18. 12.Windsor P. Managing control programs for ovine Caseous lymphadenitis and Paratuberculosis in Australia, and the need for persistent vaccination. Vet Med Auckl 2014;5:11-22. 13.de Farias AEM, Alves JRA, Alves FSF, Pinheiro RR, Faccioli MPY, Lima A MC, et al. Seroepidemiological characterization and risk factors associated with seroconversion to Corynebacterium pseudotuberculosis in goats from Northeastern Brazil. Trop Anim Health Pro 2019;51(4):745-752. 14.Debien E, Hélie P, Buczinski S, Leboeuf A, Bélanger D, Drolet R. Proportional mortality: A study of 152 goats submitted for necropsy from 13 goat herds in Quebec, with a special focus on Caseous lymphadenitis. Can Vet J 2013;54:581-587. 15.Varela GJA, Montes de Oca JR, Acosta JD, Hernández FL, Morales EV, Monroy SGH. First report of isolation and molecular characterization of the pathogenic Corynebacterium pseudotuberculosis from of sheep and goats in Mexico. Microb Pathog 2018;117:304-309. 16. Parise D, Parise M, Viana MVC, Muñoz BAV, Cortés-Pérez YA, Azevedo V et al. First genome sequencing and comparative analyses of Corynebacterium pseudotuberculosis strains from Mexico. Stand in Genomic Sci 2018;13(21). 17. Robins R. Focus on Caseous lymphadenitis. State Vet J 1991;1:7–10. 18. Binns SH, Bailey M, Green LE. Postal survey of ovine Caseous lymphadenitis in the United Kingdom between 1990 and 1999.Vet Record 2002;150(9):263-268. 19. Paton M, Rose I, Hart R, Sutherland S, Mercy A, Ellis T. Post-shearing management affects the seroincidence of Corynebacterium pseudotuberculosis infection in sheep flocks. Prev Vet Med 1996;26(3-4):275-284. 20.Santos LM, Stanisic D, Menezes UJ, Mendonça MA, Barral TD, Seyffert N, et al. Biogenic silver nanoparticles as a post-surgical treatment for Corynebacterium pseudotuberculosis infection in small ruminants. Front Microbiol 2019;10:824. 21.Stanisic D, Fregonesi NL, Barros CHN, Pontes JGM, Fulaz S, Menezes UJ, et al. NMR insights on nano silver post-surgical treatment of superficial Caseous lymphadenitis in small ruminants. RSC Advances 2018;71. 22. Baird G, Synge B, Dercksen D. Survey of Caseous lymphadenitis seroprevalence in British terminal sire sheep breeds. Vet Record 2004;154:505-506. 1242


Rev Mex Cienc Pecu 2021;12(4):1221-1249

23. Pinto AC, de Sa PHCG, Ramos RTJ, Barbosa S, Barbosa, HPM, Ribeiro AC, et al. Differential transcriptional profile of Corynebacterium pseudotuberculosis in response to abiotic stresses. BMC Genomics 2014;15:14. 24.Gallardo A, Toledo RA, González-Pasayo RA, Azevedo V, Robles C, Paolicchi FA, et al. Corynebacterium pseudotuberculosis biovar ovis evaluación de la sensibilidad antibiótica in vitro. Rev Argent Microbiol 2019;51(4):334-338. 25. Stefanska I, Gierynska M, Rzewuska M, Binek M. Survival of Corynebacterium pseudotuberculosis within macrophages and induction of phagocytes death. Polish J Vet Sci 2010;13(1):143-149. 26.OIE, Organización Mundial de Sanidad Animal. Informe del grupo ad hoc de la OIE sobre las enfermedades prioritarias para las cuales las vacunas pueden reducir el uso de agentes antimicrobianos en bovinos, ovejas y cabras. Paris, 2018. http//:www.oie.int › fileadmin › SST › adhocreports › AHG. 27. de Pinho RB, de Oliveira Silva MT, Bezerra FSB. Vaccines for caseous lymphadenitis: up-to-date and forward-looking strategies. Appl Microbiol Biotechnol 2021;105:2287– 2296. 28. Wattam ARJ, Davis J, Assaf R, Brettin T, Bun C, Conrad N, et al. Improvements to PATRIC, the all-bacterial bioinformatics database and analysis resource. Nucleic Acids Res 2017;45:535-542. 29. Ruiz JC, D’Afonseca V, Silva A, Ali A, Pinto AC. Evidence for reductive genome evolution and lateral acquisition of virulence functions in two Corynebacterium pseudotuberculosis strains. PLoS One 2011;6(4):e18551. 30. Burkovski A. The role of corynomycolic acids in Corynebacterium-host interaction. Antonie van Leeuwenhoek 2018;111(5):717-725. 31.Burkovski A. Cell Envelope of Corynebacteria: Structure and Influence on Pathogenicity. ISRN Microbiol 2013;935736:11. 32. Muller B, de Klerk LLM, Henton MM, Lane E, Parsons S, Kotze A, et al. Mixed infections of Corynebacterium pseudotuberculosis and non-tuberculous mycobacteria in South African antelopes presenting with tuberculosis-like lesions. Vet Microbiol 2011;147:340–345. 33. Silva A, Schneider MPC, Cerdeira L, Barbosa MS, Ramos RTJ. Complete genome sequence of Corynebacterium pseudotuberculosis I19, a strain isolated from a cow in Israel with bovine mastitis. J Bacteriol 2011;193:323-324.

1243


Rev Mex Cienc Pecu 2021;12(4):1221-1249

34. Sprake P, Gold JR. Corynebacterium pseudotuberculosis liver abscess in a mature alpaca (Lama pacos). Can Vet J 2012;53:387-390. 35. Lopes T, Silva A, Thiago R, Carneiro A, Dorella FA. Complete genome sequence of Corynebacterium pseudotuberculosis Strain Cp267, isolated from a Llama. J Bacteriol 2012;194:3567-3568. 36. Colom CA, Velarde R, Salinas J, Borge C, Garca BI, Serrano E, et al. Management of a Caseous lymphadenitis outbreak in a new Iberian ibex (Capra pyrenaica) stock reservoir. Acta Vet Scand 2014;56:83. 37.Oliveira M, Barroco C, Mottola C, Santos R, Lemsaddek A, Tavares L, Semedo LT. First report of Corynebacterium pseudotuberculosis from Caseous lymphadenitis lesions in Black Alentejano pig (Sus scrofa domesticus). Vet Res 2014;10:218. 38. Muñoz BAV, Cortés PYA, Arellano RB, Hernández GM, Hernández CR, Díaz AE. Identification of Corynebacterium pseudotuberculosis isolated from muscular abscesses in two horses: first report in Mexico. Equine Vet Educ 2016;29(8):431-435. 39. Borham M, Oreiby A, El GA, Al GM. Caseous Lymphadenitis in Sudanese and Somalian camels imported for meat consumption in Egypt. AJVS 2017;55(2):52-59. 40. Viana MVC, Figueiredo H, Ramos R, Guimares LC, Dorella FA, Azevedo V. Comparative genomic analysis between Corynebacterium pseudotuberculosis strains isolated from buffalo. PLoS ONE 2017;12(4):e0176347. 41. Soares SC, Silva A, Trost E, Blom J, Ramos R, Carneiro A. The pan-genome of the animal pathogen Corynebacterium pseudotuberculosis reveals differences in genome plasticity between the biovar ovis and equi strains. PLoS ONE 2013;8(1):e53818. 42. Odhah MN, Jesse FFA, Lawan A, Idris UH, Marza AD, Mahmood ZK, et al. Responses of haptoglobin and serum amyloid A in goats inoculated intradermally with C. pseudotuberculosis and mycolic acid extract immunogen. Microb Pathog 2018;117:243246. 43. Hodgson ALM, Bird P, Nisbett IT. Cloning, nucleotide sequence, and expression in Escherichia coli of the phospholipase D gene from Corynebacterium pseudotuberculosis. J Bacteriol 1990;172:1256–1261. 44. Kolesnikov YS, Nokhrina KP, Kretynin SV, Volotovski ID, Martinec J, et al. Molecular structure of phospholipase D and regulatory mechanisms of its activity in plant and animal cells. Biochem Biokhimiia 2012;77:1-14.

1244


Rev Mex Cienc Pecu 2021;12(4):1221-1249

45. Dias-Lopes C, Neshich IAP, Neshich G, Ortega JM, Granier C, Chávez-Olortegui C, et al. Identification of new Sphingomyelinases D in pathogenic fungi and other pathogenic organisms. PLoS ONE 2013;8(11):e79240. 46. Baird GJ, Fontaine MC. Corynebacterium pseudotuberculosis and its role in ovine Caseous Lymphadenitis. J Comp Pathol 2007;137(4):179-210. 47. Walker J, Wilson MJ, Brandon MR. Molecular and biochemical characterization of a protective 40-kilodalton antigen from Corynebacterium pseudotuberculosis. Infect Immun 1995;63:206-211. 48. Shadnezhad A, Naegeli A, Collin M. CP40 from Corynebacterium pseudotuberculosis is a endo B-N- acetylglucosaminidase. BMC Microbiol 2016;63(1):206-211. 49. Pacheco LGC, Slade SE, Seyffert N, Santos AR, Castro TLP. A combined approach for comparative exoproteome analysis of Corynebacterium pseudotuberculosis. BMC Microbiol 2011;11:12. 50. Paule BJ, Meyer R, Moura-Costa LF, Bahia RC, Carminati R, Regis LF. Three-phase partitioning as an efficient method for extraction / concentration of immunoreactive excreted-secreted proteins of Corynebacterium pseudotuberculosis. Protein Expr Purif 2004;34:311-316. 51. Silva WM, Dorella FA, Soares SC, Souza GHM, Seyffert N, Azevedo V, et al. A shift in the virulence potential of Corynebacterium pseudotuberculosis biovar ovis after passage in a murine host demonstrated through comparative proteomics. BMC Microbiol 2017;17(1):55. 52. Corrêa JI, Stocker A, Castro ST, Vale V, Brito T, Bastos B, et al. In vivo and in vitro expression of five genes involved in Corynebacterium pseudotuberculosis virulence. AMB Expr 2018;8:89. 53. Ibraim IC, Parise MT, Tadra MZ, de Paula TL, Wattam AR, Azevedo V, et al. Transcriptome profile of Corynebacterium pseudotuberculosis in response to iron limitation. BMC Genomics 2019;20:663. 54. Ibraim IC, Parise MT, Tadra MZ, de Paula TL, Wattam AR, Azevedo V, et al. Transcriptome profile of Corynebacterium pseudotuberculosis in response to iron limitation. BMC Genomics 2019;20:663. 55. Saıd-Salim B, Mostowy S, Kristof AS, Behr MA. Mutations in Mycobacterium tuberculosis RV0444c, the gene encoding anti-sigK, explain high level expression of mpb70 and mpb83 in Mycobacterium bovis. Mol Microbiol 2006;62:1251–1263.

1245


Rev Mex Cienc Pecu 2021;12(4):1221-1249

56. Pacheco LGC, Castro TLP, Carvalho RD, Moraes PM, Dorella FA, Azevedo V, et al. A role for sigma factor σ in Corynebacterium pseudotuberculosis resistance to nitric oxide/peroxid stress. Front Microbiol 2012;3:126. 57. Trost E, Ott L, Schneider J, Schröder J, Jaenicke S, Goesmann A, Husemann P, et al. The complete genome sequence of Corynebacterium pseudotuberculosis FRC41 isolated from a 12-year-old girl with necrotizing lymphadenitis reveals insights into gene regulatory networks contributing to virulence. BMC Genomics 2010;11:728. 58. Costa PM, McCulloch JA, Almeida SS, Dorella FA, Fonseca CT, et al. Molecular characterization of the Corynebacterium pseudotuberculosis hsp60-hsp10 operon, and evaluation of the immune response and protective efficacy induced by hsp60 DNA vaccination in mice. BMC Res Notes 2011;4:243. 59. Pinto GAC, Gomes SP, Queiroz AL, Sousa T, Rodrigues L, Azevedo V, et al. Heat shock stress: Profile of differential expression in Corynebacterium pseudotuberculosis biovar Equi Gene 2018;645:124–130. 60. Silva WM, Seyffert SN, Santos AV, Castro TLP, Pacheco LGC, Azevedo V, et al. Identification of 11 new exoproteins in Corynebacterium pseudotuberculosis by comparative analysis of the exoproteoma. Microb Pathog 2013;1e6:1-6. 61. Al-Gaabary MH, Osman SA, Oreiby AF. Caseous lymphadenitis in sheep and goats: Clinical, epidemiological and preventive studies. Small Ruminant Res 2009;87:116– 121. 62. Jesse FFA, Odhah MN, Abbad Y, Garba B, Mahmood Z, Hambali IU, et al. Responses of female reproductive hormones and histopathology in the reproductive organs and associated lymph nodes of Boer does challenged with Corynebacterium pseudotuberculosis and its immunogenic corynomycolic acid Extract. Microb Pathog 2020;139:103852. 63. Odhah MN, Jesse FFA, Teik CEL, Mahmood Z, Wahid HA, Mohd LMA, et al. Clinicopathological responses and PCR detection of Corynebacterium pseudotuberculosis and its immunogenic mycolic acid extract in the vital organs of goats. Microb Pathog 2019;135:103628. 64.Mahmood ZKH, Jesse FF, Saharee AA, Jasni S, Yusoff R, Wahid H. Clinio-pathological changes in goats challenged with Corynebacterium peudotuberculosis and its exotoxin (PLD). Am J Anim Vet Sci 2015;10 (3):112.132. 65.Valdivia J. Vida intracelular de Corynebacterium pseudotuberculosis [tesis Doctorado]. España, Islas Canarias: Universidad de las Palmas de Gran Canaria. Instituto Universitario de Sanidad animal y Seguridad alimentaria; 2015.

1246


Rev Mex Cienc Pecu 2021;12(4):1221-1249

66. Oliveira A, Oliveira LC, Aburjaile F, Benevides L, Tiwari S, Azevedo V, et al. Insight of Genus Corynebacterium: Ascertaining the role of pathogenic and non-pathogenic species. Front Microbiol 2017;8:1937. 67. Oliveira A, Teixeira P, Barh D, Barh D, Ghosh P, Azevedo V. Key amino acids in understanding evolutionary characterization of Mn/Fe-Superoxide dismutase: A phylogenetic and structural analysis of proteins from Corynebacterium and Hosts. Trends Artif Intell 2017;1(1):1-11. 68. Hard GC. Examination by electron microscopy of interaction between peritoneal phagocytes and Corynebacterium ovis. J Med Microbiol 1972;5:483-491. 69. Tashjian JJ, Campbell SG. Interaction between caprine macrophages and Corynebacterium pseudotuberculosis: an electron microscopy study. Am J Vet Res 1983;44:690-693. 70. Paule BJA, Azevedo V, Regis LF, Carminati R, Bahia R. Experimental Corynebacterium pseudotuberculosis primary infection in goats: kinetics of IgG and interferon-γ production, IgG avidity and antigen recognition by Western blotting. Vet Immunol Immunopathol 2003;96:129-139. 71. Seyffert N, Silva RF, Jardin J, Silva WM, Castro TL, Tartaglia NR, et al. Serological proteome analysis of Corynebacterium pseudotuberculosis isolated from different hosts reveals novel candidates for prophylactics to control Caseous lymphadenitis. Vet Microbiol 2014;174:255-260. 72. Rebouças MF, Portela RW, Lima DD, Loureiro D, Bastos BL. Corynebacterium pseudotuberculosis secreted antigen-induced specific gamma-interferon production by peripheral blood leukocytes: Potential diagnostic marker for Caseous Lymphadenitis in sheep and goats. J Vet Diag Invest 2011;23:213-220. 73. Fontaine MC, Baird G, Connor KM, Rudge K, Sales J, Donachie, W. Vaccination confers significant protection of sheep against infection with a virulent United Kingdom strain of Corynebacterium pseudotuberculosis. Vaccine 2006;24:5986–5996. 74. Stanford K, Brogden KA, McClelland LA, Kozub GC, Audibert F. The incidence of Caseous lymphadenitis in Alberta sheep and assessment of impact by vaccination with commercial and experimental vaccines. Can J Vet Res 1998;62:38-43. 75. Zoetis, 2020. Zoetis Spain, S.L. Avda. de Europa 20B, Parque Empresarial La Moral. https://www.zoetis.es/_locale-assets/spc/biodectin.pdf. Consultado 16 Abr, 2020.

1247


Rev Mex Cienc Pecu 2021;12(4):1221-1249

76. Medrano G, Hung ACh, Alvarado AS, Li EO. Evaluación de una vacuna contra Corynebacterium pseudotuberculosis en ratones albinos. Rev Inv Vet 2003;14(1):6167. 77. Braga WU. Protection in alpacas against Corynebacterium pseudotuberculosis using different bacterial components. Vet Microbiol 2007;119:297–303. 78. Eggleton DG, Doidge CV, Middleton HD, Minty DW. Immunisation against ovine caseous lymphadenitis: efficacy of monocomponent Corynebacterium pseudotuberculosis toxoid vaccine and combined clostridial-corynebacterial vaccines. Aust Vet J 1991;68:320421. 79. Syame SM, Abuelnaga ASM, Ibrahim ES, Hakim AS. Evaluation of specific and nonspecific immune response of four vaccines for caseous lymphadenitis in sheep challenged. Vet World 2018;11(9):1272-1276. 80. Moura-Costa LF, Bahia RC, Carminati R, Vale VL, Paule BJ, et al. Evaluation of the humoral and cellular immune response to different antigens of Corynebacterium pseudotuberculosis in Canindé goats and their potential protection against Caseous lymphadenitis. Vet Immunol Immunopathol 2008;126:131-141. 81. Hodgson ALM, Krywult J, Corner LA, Rothel JS, Radford AJ. Rational attenuation of Corynebacterium pseudotuberculosis: Potential cheesy gland vaccine and live delivery vehicle. Infect Immun 1992;60(7):2900-2905. 82. Hodgson ALM, Tachedjian M, Corner LA, Radford AJ. Protection of sheep against Caseous lymphadenitis by use of a single oral dose of live recombinant Corynebacterium pseudotuberculosis. Infect and Immunol 1994;62(12):5275-5280. 83. Ribeiro D, Rocha FS, Leite KM, Soares SC, Silva A, Portela RW, et al. An ironacquisition-deficient mutant of Corynebacterium pseudotuberculosis efficiently protects mice against challenge. Vet Res 2014;45:28. 84. Chaplin PJ, De Rose R, Boyle JS, McWaters P, Kelly J, Tennent JM, et al. Targeting improves the efficacy of a DNA vaccine against Corynebacterium pseudotuberculosis in sheep. Infect Immun 1999;67:6434–6438. 85. De Rose R, Tennent J, McWaters P, Chaplin PJ, Wood PR, Kimpton W, et al. Efficacy of DNA vaccination by different routes of immunisation in sheep, Vet Immunol Immunopathol 2002;90:55-63.

1248


Rev Mex Cienc Pecu 2021;12(4):1221-1249

86. Brum AA, Silva AFR, Silvestre FB, Collares T, Begnine K, Kommling F, et al. Recombinant esterase from Corynebacterium pseudotuberculosis in DNA and subunit recombinant vaccines partially protects mice against challenge. J Med Microb 2017;66:635-642. 87. Moussa IM, Mohamed SA, Ashgan M, Hessain SA, Kabli E, Hassan AH, et al. Vaccination against Corynebacterium pseudotuberculosis infections controlling Caseous lymphadenitis (CLA) and oedematousskin disease. Saudi J Biol Sci 2016;23:718–723. 88.Silva MTO, Bezerra FSB, de Pinho RB, Begnini KR, Seixas FK, Collares T, et al. Association of Corynebacterium pseudotuberculosis recombinant proteins rCP09720 or rCP01850 with rPLD as immunogens in Caseous lymphadenitis immunoprophylaxis. Vaccine 2018;36(1):74-83. 89. Leal KS, Silva TO, Silva AFR, Brilhante FSB, Begnini K, Seixas F, et al. Recombinant M. bovis BCG expressing the PLD protein promotes survival in mice challenged with a C. pseudotuberculosis virulent strain. Vaccine 2018;36:3578–3583. 90. Silva JW, Droppa-Almeida D, Borsuk S, Azevedo V, Portela RW. Corynebacterium pseudotuberculosis cp09 mutant and cp40 recombinant protein partially protect mice against caseous lymphadenitis. BMC Vet Res 2014;10:965. 91. Droppa-Almeida D, Vivas WL, Silva KK, Rezende AF, Simionatto S. Recombinant CP40 from Corynebacterium pseudotuberculosis confers protection in mice after challenge with a virulent strain. Vaccine 2016;34(8):1091–1096.

1249


https://doi.org/10.22319/rmcp.v12i4.5016 Nota de investigación

Comparación de ecuaciones para ajustar curvas de crecimiento de vacas Holstein, Jersey y Jersey x Holstein en pastoreo

Sonia Contreras Piña a José Guadalupe García Muñiz a* Rodolfo Ramírez Valverde a Rafael Núñez Domínguez a Citlalli Celeste González Ariceaga a

a

Universidad Autónoma Chapingo. Departamento de Zootecnia, Posgrado en Producción Animal, km 38.5 Carretera México-Texcoco, 56230, Chapingo, Estado de México, México.

*Autor de correspondencia: jgarciamppa@hotmail.com

Resumen: El objetivo del estudio fue comparar la bondad de ajuste de cuatro ecuaciones no lineales para describir las curvas de crecimiento de vacas Jersey, Holstein, y Jersey x Holstein en pastoreo. Las ecuaciones de Brody, Gompertz, von Bertalanffy, y Logística se ajustaron a los datos (n= 2,315) de peso y edad de vacas Jersey (n= 54), Holstein (n= 6) y Jersey x Holstein (n= 30). Para cada animal, genotipo y ecuación, se estimaron los parámetros A, b y k que produjeron las curvas de crecimiento de mejor ajuste. En cada una de las cuatro ecuaciones comparadas, el parámetro A corresponde a la asíntota superior de la curva y estima el ‘peso maduro’ del animal, los parámetros b y k representan la constante de integración y la tasa de maduración. Para las curvas de crecimiento de las vacas Jersey y las cruzas de Jersey x Holstein, las ecuaciones de Gompertz y de von Bertalanffy produjeron el mejor ajuste. En contraste, la ecuación Logística tuvo el mejor ajuste para las curvas de crecimiento de Holstein, seguida muy de cerca por las ecuaciones de Gompertz y von Bertalanffy. En las condiciones de manejo y alimentación de los animales en este estudio, las curvas de

1250


Rev Mex Cienc Pecu 2021;12(4):1250-1263

crecimiento de las hembras de los tres genotipos estudiados pueden ajustarse con la ecuación de von Bertalanffy. Palabras clave: Ganado lechero; modelos no lineales; patrón de crecimiento.

Recibido: 15/08/2018 Aceptado: 17/02/2021

Cuando se tiene el peso de un mismo individuo a intervalos regulares de edad, desde el nacimiento hasta la madurez, es posible ajustar una función que describa la curva de peso de acuerdo con la edad. A esta curva que permite condensar la trayectoria de crecimiento de un individuo en unos cuantos parámetros se le denomina curva de crecimiento(1). Existen diversas ecuaciones que se han utilizado para describir el crecimiento de plantas y animales(2), entre ellas la de Brody(3), Gompertz(4), Logística(5) y von Bertalanffy(5), todas casos especiales de la ecuación de Richards(5). Las curvas de crecimiento reflejan las interrelaciones entre el impulso inherente del individuo de crecer y madurar, y el ambiente en el que se expresan estos impulsos(6). Algunas de estas ecuaciones se han utilizado para describir el crecimiento de varias especies de interés zootécnico, como bovinos Pantaneira en Brasil(7), y de hembras Holstein para predecir su crecimiento desde el nacimiento hasta el primer parto(8). Estas ecuaciones también se han utilizado para describir el crecimiento de genotipos ovinos(9,10,11), bovinos productores de leche(12,13), y caballos(14). En sistemas de producción de leche en pastoreo con bajo uso de alimento suplementario y una mezcla de genotipos bovinos que difieren en tamaño maduro, el peso promedio de la vaca determina en gran medida la máxima carga animal que soporta el sistema. Diversos genotipos bovinos pueden presentar diferentes pesos maduros y requerimientos de energía metabolizable para mantenimiento. El ajuste de una curva de crecimiento desde el nacimiento hasta la madurez puede ser útil para calcular los requerimientos de mantenimiento durante la vida del animal. Las curvas de crecimiento de animales individuales pueden estimarse ajustando modelos mixtos no lineales, aun con registros incompletos de la curva de crecimiento de los animales del hato. El objetivo de este estudio fue comparar la bondad de ajuste de cuatro ecuaciones no lineales, para describir las curvas de crecimiento de vacas Jersey, Holstein, y Jersey x Holstein en pastoreo de praderas mixtas de alfalfa-ballico perenne-ovillo-trébol blanco. El estudio se realizó en el Módulo de Producción de Leche Orgánica en Pastoreo de la Granja Experimental de la Universidad Autónoma Chapingo, México. Díaz(15) menciona

1251


Rev Mex Cienc Pecu 2021;12(4):1250-1263

detalladamente el desarrollo del Módulo: brevemente, el módulo se inició con 10 vacas Holstein y 25 vacas Jersey de primer parto en mayo de 2000. Los animales que integran el hato son vacas Jersey de la línea genética de Nueva Zelanda, vacas Holstein de la línea genética de Norteamérica y vacas originadas de la cruza de vacas Holstein con semen Jersey. La alimentación de los animales se basa en el pastoreo de las praderas, heno que de éstas se conserva y ensilado de maíz que se produce en áreas de pradera que se renuevan cada año. Los animales se manejan en pastoreo intensivo rotacional en franjas, de praderas mixtas de alfalfa (Medicago saltiva) variedad Aragonesa, pasto ovillo (Dactylis glomerata) variedad Potomac, pasto ballico perenne (Lolium perenne) variedad Linn y trébol blanco (Trifolium repens) variedad Ladino. Los animales del hato se manejan en tres grupos: lactantes, secas y animales en crecimiento. Dependiendo de las condiciones de crecimiento de la pradera se asignan potreros por grupo o se realiza el pastoreo con el esquema de líderes y seguidores, los líderes son las vacas en producción y los seguidores el grupo de vacas secas y ganado en crecimiento. Con este esquema de pastoreo se provee a los animales de condiciones de producción que garantizan suficiente libertad de movimiento, área para descanso, aire fresco, luz y temperatura adecuada, agua limpia y alimento suficiente para la etapa productiva del animal. Además del forraje de la pradera, a los animales se le proporciona una mezcla mineral a libre acceso. Dicha mezcla fue formulada con base en un diagnóstico del estado mineral de los animales y del forraje de la pradera, con análisis en sangre, forraje, heces, pelo y leche(16). Las vacas paren en la pradera, en el grupo de vacas secas, proporcionándoles asistencia sólo cuando es necesario. La cría permanece con la madre en la pradera durante los primeros dos días de vida consumiendo calostro a libertad. Al tercer día, la madre se integra al grupo de vacas lactantes, la cría se envía a una sala de crianza con ventilación natural y se le asigna una jaula individual con piso elevado. Solo para las hembras, se abre una tarjeta en la cual se registra identificación de la cría, fecha y peso al nacimiento, identificación de la madre y del padre. La identificación de la cría consiste en tatuaje en la oreja derecha y arete en la oreja izquierda, usando un sistema de cuatro dígitos. Durante las dos primeras semanas de vida, las crías reciben cuatro litros de leche entera repartidos en dos tomas. Posteriormente, además de la leche las crías tienen acceso al forraje de la pradera. El destete se realiza a los tres meses de edad(15). Los registros de peso y edad de los animales de los genotipos estudiados se generaron a partir de las fechas de nacimiento, fechas de pesada y registros del peso vivo de animales individuales en diferentes etapas de su vida, desde el nacimiento hasta la madurez. Los animales se pesaron periódicamente en intervalos regulares de aproximadamente 30 d. Se utilizó una báscula digital Tru-Test (Tru-Test, Palmerston North, NZ), Sistema EC 2000 con 1252


Rev Mex Cienc Pecu 2021;12(4):1250-1263

Barras GP 600, con capacidad de 1,500 kg y precisión de 0.5 kg. Los datos de peso vivo utilizados en este estudio se registraron de 2012 a 2016. Los animales incluidos en el estudio se pesaron al nacimiento, al destete y mensualmente. En total se contó con 2,315 registros de peso (kg) y edad (d) generados por 54 vacas Jersey, 6 Holstein, y 30 Jersey x Holstein, con edades que fluctuaron de 1 a 6,597 d. Los modelos de Brody(3), una versión modificada de la función de Gompertz(4), Logístico(5) y de von Bertalanffy(5), se ajustaron a los datos de peso y edad de las vacas. Brody: 𝑌𝑡 = 𝐴(1 − 𝑏𝑒 −𝑘𝑡 ) (𝑏−𝑘𝑡)

Gompertz: 𝑌𝑡 = 𝐴𝑒 −𝑒 Logístico: 𝑌𝑡 = 𝐴(1 + 𝑏𝑒 −𝑘𝑡 )−1 von Bertalanffy: 𝑌𝑡 = 𝐴(1 − 𝑏𝑒 −𝑘𝑡 )3 En todos los casos, Yt es el peso vivo (kg) registrado a la edad t (días); el parámetro A corresponde a la asíntota superior, que estima el peso (kg) maduro del animal; el parámetro b es una constante de integración relacionada con el peso inicial; el parámetro k es la tasa de maduración; y e es la base de los logaritmos naturales(12). Con la información de peso y edad se calcularon los estadísticos descriptivos en diferentes secciones de la curva de crecimiento del hato. Se generaron nueve intervalos de edad: tres que cubrieron el intervalo del nacimiento hasta un año, y seis que cubrieron el intervalo de dos a doce años, con dos años de separación entre ellos. Una partición similar se hizo para describir la curva de crecimiento de ganado Angus de Norteamérica(17). Los estadísticos descriptivos se obtuvieron utilizando el procedimiento MEANS de SAS(18). Para cada genotipo se ajustaron cada una de las ecuaciones evaluadas, mediante el procedimiento NLMIXED de SAS(18). Sólo el parámetro relacionado con el peso maduro (A) se ajustó como efecto aleatorio en la ecuación respectiva; los restantes parámetros de la curva de crecimiento (b y k) se consideraron fijos. Se siguió un procedimiento similar al de otros estudios en los que se ajustaron modelos estocásticos para describir la variación individual en el crecimiento de animales de granja(19,20,21). La inclusión de un término aleatorio (𝑎𝑖 ) asociado con el parámetro A de las ecuaciones de crecimiento comparadas, se hizo como lo describieron Craig y Schinckel(19) cuando ajustaron curvas de crecimiento en cerdos. Así, el modelo estadístico ajustado dentro de genotipo, para cada una de las ecuaciones comparadas en el presente estudio, incluyó un término aleatorio relacionado con el tamaño maduro de la vaca, se expresa de la siguiente manera:

1253


Rev Mex Cienc Pecu 2021;12(4):1250-1263

Brody:

𝑌𝑖,𝑡 = (𝐴 + 𝑎𝑖 )(1 − 𝑏𝑒 −𝑘𝑡 ) + 𝜀𝑖,𝑡

Gompertz: Logístico: von Bertalanffy:

𝑌𝑖,𝑡 = (𝐴 + 𝑎𝑖 )𝑒 −𝑒 + 𝜀𝑖,𝑡 −𝑘𝑡 −1 𝑌𝑖,𝑡 = (𝐴 + 𝑎𝑖 )(1 + 𝑏𝑒 ) + 𝜀𝑖,𝑡 𝑌𝑖,𝑡 = (𝐴 + 𝑎𝑖 )(1 − 𝑏𝑒 −𝑘𝑡 )3 + 𝜀𝑖,𝑡

(𝑏−𝑘𝑡)

donde Yi,t es el peso vivo del animal i registrado en el día t de edad, e es la base de los logaritmos naturales (i.e. 2.718281), A es el peso maduro predicho, ai es el efecto aleatorio del animal i para el parámetro de la curva de crecimiento relacionado con el peso maduro (A) del animal ~𝑁𝑜𝑟𝑚𝑎𝑙(0, 𝜎𝐴2 ), t es la edad del animal en días, b es una constante de integración relacionada con el peso inicial del animal, k es la tasa de maduración y 𝜀 i,t es el residual del modelo ~𝑁𝑜𝑟𝑚𝑎𝑙(0, 𝜎𝜀2 ). El ajuste de estos modelos generó, además de los estimadores de los parámetros de la curva de crecimiento, estimadores de varianza para el parámetro A (𝜎𝐴2 ) y de la varianza residual (σ2𝜀 ). El ajuste del modelo también generó estimadores de -2 log likelihood, el Criterio de Información de Akaike (AIC) y el Criterio de Información Bayesiano (BIC), que se utilizaron como criterios de bondad de ajuste para comparar las cuatro ecuaciones ajustadas. El ajuste de cada uno de los modelos a los tres genotipos estudiados generó los coeficientes de los parámetros A, b y k, para producir las curvas de crecimiento de animales individuales. En el código SAS utilizado, también se incluyó una expresión para generar los coeficientes de la regresión fija para describir la curva de crecimiento promedio de cada genotipo estudiado. Estos coeficientes se utilizaron para producir, en cada ecuación y genotipo, los valores predichos de peso vivo para generar las curvas de animales individuales y las curvas de crecimiento promedio por genotipo de la vaca, utilizando el procedimiento SGPLOT de SAS(18). Los estadísticos descriptivos del peso vivo para distintos intervalos de edad de la curva de crecimiento de los genotipos evaluados se presentan en el Cuadro 1. En general, se observa que el peso se incrementa notablemente en los primeros tres a cuatro años, posteriormente se mantiene relativamente constante. La desviación estándar se incrementa conforme avanza la edad del animal; esto se explica por una mayor variación en el peso adulto en los diferentes genotipos(22).

1254


Rev Mex Cienc Pecu 2021;12(4):1250-1263

Cuadro 1: Estadísticos descriptivos de peso (kg) agrupado por edad de hembras Jersey, Holstein y Jersey x Holstein manejadas en pastoreo Edad (días) 0- 30 30- 120 121- 200 201-365 366-730 731-1460 1461-2190 2191-2920 >2920

Jersey n 10 19 44 92 201 404 213 103 235

Media 26.2 56.1 81.6 128.4 245.9 338.5 358.5 384.4 403.0

DE 6.6 11.9 14.2 29.5 46.3 54.3 51.1 33.4 58.0

Holstein n Media DE ------2 110.5 2.1 5 136.2 24.9 12 276.0 56.6 28 490.5 66.5 43 477.0 42.5 55 512.0 37.0 130 527.2 44.5

Jersey x Holstein n Media 7 26.0 2 69.5 27 104.2 72 151.4 157 255.3 269 365.0 138 441.7 23 480.7 11 464.0

DE 3.4 21.9 34.4 35.1 58.9 60.4 56.3 55.1 28.9

DE = desviación estándar.

Los estimadores de bondad de ajuste del modelo, -2 log likelihood, el Criterio de Información de Akaike (AIC) y el Criterio de Información Bayesiano (BIC), se presentan en el Cuadro 2. De acuerdo con la magnitud de estos estimadores (valores más pequeños indican mejor ajuste), los modelos de von Bertalanffy y de Gompertz fueron los que mejor ajustaron las curvas de crecimiento de hembras del genotipo Jersey. Para las curvas de crecimiento de las cruzas Jersey x Holstein el mejor ajuste se obtuvo con la ecuación de von Bertalanffy, y para Holstein con la Logística, seguida muy de cerca por las ecuaciones de Gompertz y von Bertalanffy. Cuadro 2: Valores de los criterios utilizados para comparar el ajuste de las ecuaciones a los registros de peso y edad de bovinos de tres genotipos Genotipo Jersey (J)

Holstein (H)

JH 1

Modelo Brody von Bertalanffy Gompertz Logístico Brody von Bertalanffy Gompertz Logístico Brody von Bertalanffy Gompertz Logístico

Indicador de bondad de ajuste del modelo1 -2 log likelihood AIC BIC 12963 12973 12983 12892 12902 12912 12891 12901 12911 12920 12930 12940 2945 2955 2954 2915 2925 2924 2909 2919 2918 2895 2905 2904 7143 7153 7260 7111 7121 7128 7122 7132 7139 7151 7161 7168

AIC y BIC son los Criterio de Información de Akaike (AIC) y Bayesiano (BIC) para evaluar la bondad de ajuste del modelo respectivo (valores más bajos indican mejor ajuste del modelo).

1255


Rev Mex Cienc Pecu 2021;12(4):1250-1263

En un estudio de crecimiento de bovinos en Brasil, la ecuación de Brody produjo el mejor ajuste para describir la curva de crecimiento de bovinos Nellore en confinamiento(23). Igualmente, la ecuación de Brody ajustó mejor las curvas de crecimiento de bovinos Tropicarne, lo que implica para este genotipo una tasa de maduración lenta, característica del crecimiento de los bovinos en condiciones de pastoreo en el trópico(24). Brown et al(25) reportaron que la ecuación de Brody fue la que mejor ajustó la curva de crecimiento en varios genotipos bovinos bajo diferentes condiciones de manejo y alimentación. En contraste, otros investigadores(26) indican que las ecuaciones de Gompertz y de von Bertalanffy se ajustaron mejor para describir el crecimiento de novillos Hereford, lo que concuerda con lo encontrado en este estudio para los genotipos Jersey y Jersey x Holstein. Los estimadores de los parámetros A, b y k de los modelos de crecimiento evaluados, así como los estimadores de las varianzas del ‘peso maduro’ y residual se presentan en el Cuadro 3. El parámetro A, que representa el peso maduro, fue diferente en cada genotipo, dependiendo de la ecuación utilizada. La ecuación de Brody ajustó para los tres genotipos el valor más alto del peso maduro, lo que concuerda con lo obtenido en otros estudios(23), en los que también se menciona que esta ecuación sobreestima el peso maduro. Herrera et al(27) indicaron que grupos de animales con mayor valor en A son menos precoces. Para Holstein, las ecuaciones de von Bertalanffy y Logística produjeron prácticamente el mismo valor de A (512 kg). Este valor del peso maduro para las vacas del genotipo Holstein está muy por debajo de los estimadores de 591, 566 y 543 kg obtenidos en Irlanda en condiciones de pastoreo para dos líneas de Holstein-Friesian de Norteamérica-Europa y Holstein-Friesian de Nueva Zelanda, respectivamente(13). La ecuación de Brody produjo el valor más bajo de k. Un valor pequeño de k representa una menor velocidad de crecimiento para llegar al peso asintótico a partir del peso inicial, o tasas de maduración más lentas(7,24,28).

1256


Rev Mex Cienc Pecu 2021;12(4):1250-1263

Cuadro 3: Parámetros de la curva de crecimiento (± error estándar), estimadores de las varianzas residual y del peso maduro después de ajustar las ecuaciones a los registros de peso y edad de bovinos de tres genotipos Parámetro Jersey Holstein Jersey x Holstein _________________________Ecuación de Brody________________________ A 400.0 ± 6.5 513.5 ± 13.6 455.8 ± 9.4 b 1.04 ± 0.01 0.99 ± 0.03 1.02 ± 0.02 -3 -5 -3 k 1.71E ± 5.6E 1.95E ± 0.01 1.65E-3 ± 8.1E-5 1005.0 ± 156.8 800.0 ± 617.0 803.0 ± 121.0 σ𝐴2 2 1075.0 ± 43.7 1875.0 ± 154.2 1497.5 ± 100.0 σ𝑒 _______________________Ecuación de Gompertz________________________ A 383.5 ± 5.6 510.6 ± 15.0 426.6 ± 7.9 b 0.98 ± 0.03 1.30 ± 0.01 0.84 ± 0.04 -3 -5 -3 -4 k 3.19E ± 9.6E 3.86E ± 3.42E 2.97E-3 ± 1.27E-4 918.7 ± 140.2 904.8 ± 2598.0 952.4 ± 143.2 σ𝐴2 2 996.4 ± 39.7 1731.2 ± 148.4 1238.0 ± 68.0 σ𝑒 _________________________Ecuación Logística________________________ A 373.5 ± 5.3 512.3 ± 10.2 413.8 ± 7.5 b 7.31 ± 0.41 13.2 ± 2.86 5.55 ± 0.39 -3 -4 -3 -4 k 4.69E ± 1.39E 5.43E ± 4.02E 4.26E-3 ± 1.83E-4 900.8 ± 134.4 500.6 ± 437.7 958.7 ± 138.7 σ𝐴2 2 1000.4 ± 39.3 1661.5 ± 141.8 1282.7 ± 70.6 σ𝑒 __________________Ecuación de von Bertalanffy________________________ A 388.4 ± 5.9 512.0 ± 10.6 432.3 ± 8.6 b 0.64 ± 0.02 0.92 ± 0.16 0.59 ± 0.02 -3 -5 -3 -4 k 2.70E ± 8.3E 3.45E ± 3.92E 2.57E-3 ± 1.07E-4 1013.7 ± 163.9 512.2 ± 411.7 1153.9 ± 191.7 σ𝐴2 998.1 ± 39.8 1778.0 ± 152.0 1135.3 ± 57.6 σ2𝑒 1

A es el parámetro de la curva de crecimiento que corresponde a la asíntota superior, que estima el peso (kg) maduro del animal; b es una constante de integración; k es la tasa de maduración; (σ𝐴2 ) es la varianza del peso (kg2) maduro del animal estimada por el modelo ajustado; (σ2𝑒 ) es la varianza residual (kg2).

El ajuste de la ecuación de Brody a los datos de peso y edad de los tres genotipos estudiados se muestra en la Figura 1. En el presente trabajo fue reducida la disponibilidad de registros del nacimiento al destete al inicio del proyecto. Para los genotipos Jersey y Jersey x Holstein, la ecuación de Brody, en el caso del presente trabajo, predijo valores negativos para peso al nacimiento, mientras que para Holstein estimó pesos positivos pero bajos. Lo anterior concuerda con lo estimado por Mgbere y Olutogun(29), quienes argumentan que la ecuación de Brody subestima el peso durante los primeros días de vida de ganado N'Dama, pero que ajusta bien a edades mayores que seis meses. Igualmente, Berry et al(13) encontraron que la ecuación de Brody predice pesos negativos a edades tempranas cuando se utiliza para ajustar 1257


Rev Mex Cienc Pecu 2021;12(4):1250-1263

las curvas de crecimiento de vacas Holstein de las líneas genéticas de Norteamérica, Holstein Europea y Holstein-Friesian, manejadas en condiciones de semipastoreo. En Brasil(30) encontraron que las ecuaciones de Brody y Gompertz tuvieron el mejor ajuste de la curva de crecimiento del nacimiento a la edad adulta de vacas Caracu. Lo anterior concuerda con el mejor ajuste de la ecuación de Brody para describir la curva de crecimiento de ganado de carne Lagune en condiciones de pastoreo(31). Figura 1: Diagrama de dispersión para pesos y edades del ajuste de las curvas de crecimiento generadas por la ecuación de Brody para hembras Jersey, Holstein y Jersey x Holstein

El ajuste de la ecuación de Gompertz a los datos de peso y edad de los tres genotipos estudiados se muestra en la Figura 2. En el presente estudio, los pesos al nacimiento para Holstein, predichos con el ajuste de la ecuación de Gompertz, fueron muy cercanos a cero, mientras que para Jersey y Jersey x Holstein se observó un mejor ajuste. Varios investigadores(32) utilizaron esta ecuación para describir el crecimiento de bovinos lecheros, por ser la que mejor ajustó sus datos. Berry et al(13) también encontraron que la ecuación de Gompertz ajustó mejor que la de Brody las curvas de crecimiento de vacas Holstein Americana, Holstein Europea y Holstein-Friesian, manejadas en condiciones de pastoreo.

1258


Rev Mex Cienc Pecu 2021;12(4):1250-1263

Figura 2: Diagrama de dispersión para pesos y edades del ajuste de las curvas de crecimiento generadas por la ecuación de Gompertz para hembras Jersey, Holstein y Jersey x Holstein

El ajuste de la ecuación Logística a los datos de peso y edad de los tres genotipos estudiados se muestra en la Figura 3. En estudios previos que describen la curva de crecimiento de ganado lechero, la ecuación Logística subestimó el peso maduro de los animales(12). En este estudio, la ecuación Logística produjo valores idénticos a la de von Bertalanffy para este parámetro de la curva de crecimiento. Figura 3: Diagrama de dispersión para pesos y edades del ajuste de las curvas de crecimiento generadas por la ecuación Logística para hembras Jersey, Holstein y Jersey x Holstein

1259


Rev Mex Cienc Pecu 2021;12(4):1250-1263

El ajuste de la ecuación de von Bertalanffy a los datos de peso y edad de los tres genotipos estudiados se muestra en la Figura 4. Esta ecuación ajustó los pesos vivos al nacimiento de Holstein con valores negativos y de Jersey y Jersey x Holstein, con pesos cercanos al cero, lo que difiere con lo reportado en otros estudios en los que la ecuación de von Bertalanffy sobreestimó el peso a edades tempranas en ganado N'Dama(29). Investigadores españoles(33) compararon la ecuación de Brody, Richards y von Bertalanffy para describir las curvas de crecimiento de vacas Retinta para carne en condiciones de pastoreo extensivo en España, encontrando que la ecuación de von Bertalanffy tuvo el mejor ajuste para el patrón de crecimiento de este genotipo. En el presente estudio, la ecuación de von Bertalanffy generó el mejor ajuste en las curvas de crecimiento de vacas Jersey y Jersey x Holstein, y para vacas Holstein produjo parámetros idénticos a los de la ecuación Logística, que produjo el mejor ajuste para las curvas de crecimiento de este genotipo. Figura 4: Diagrama de dispersión para pesos y edades del ajuste de las curvas de crecimiento generadas por la ecuación de von Bertalanffy para hembras Jersey, Holstein y Jersey x Holstein

En conclusión, las ecuaciones de Gompertz y de von Bertalanffy describen mejor la curva de crecimiento de vacas Jersey; la de von Bertalanffy la de hembras Jersey x Holstein, y la Logística la de las hembras Holstein, seguida por las de Gompertz y von Bertalanffy. Para las condiciones de manejo y alimentación de los animales en este estudio, y con la finalidad de describir adecuadamente su patrón de crecimiento, las curvas de crecimiento de las hembras de los tres genotipos estudiados pueden ajustarse con la ecuación de von Bertalanffy.

1260


Rev Mex Cienc Pecu 2021;12(4):1250-1263

Agradecimientos Al Consejo Nacional de Ciencia y Tecnología (CONACYT) por el apoyo económico otorgado al primer autor para realizar estudios de Maestría en Ciencias en la Universidad Autónoma Chapingo. Literatura citada: 1.Val JE, Freitas MAR, Oliveira HN, Cardoso VL, Machado PF, Paneto JC. Indicadores de desempenho em rebanho da raça Holandesa: curvas de crescimento e altura, características reprodutivas, produtivas e parâmetros genéticos. Arq Bras Med Vet Zootec 2004;56(1):86-93. 2. Koya PR, Goshu AT. Solutions of rate-state equation describing biological growths. Am J Math and Stat 2004;3(6):305-311. 3. Thornley JHM, France J. Mathematical models in agriculture, 2nd ed. Wallingford: CABI Publishing; 2007. 4. Tjørve KMC, Tjørve E. The use of Gompertz models in growth analyses, and new Gompertz-model approach: an addition to the Unified-Richards family. PLoS One 2017;12(6) e0178691. https://doi.org/10.1371/journal.pone.0178691. 5. Tjørve E, Tjørve KMC. A unified approach to the Richards-model family for use in growth analyses: why we need only two model forms. J Theor Biol 2010;267:417-425. 6. Fitzhugh HA. Analysis of growth curves and strategies for altering their shape. J Anim Sci 1976;42(4):1036-1051. 7. Abreu UG, Cobuci JA, da Silva MVGB, Sereno JRB. Uso de modelos no lineales para el ajuste de la curva de crecimiento de bovinos Pantaneiros. Arch Zootec 2004;53(204):367-370. 8. Noor RR, Saefuddin A, Talib C. Comparison on accuracy of Logistic, Gompertz and von Bertalanffy models in predicting growth of new born calf until first mating of Holstein Friesian heifers. J Ind Trop Anim Agric 2012;37(3):151-160. 9. Gbangboche AB, Glele-Kakai R, Salifou S, Albuquerque LGD, Leroy PL. Comparison of non-linear growth models to describe the growth curve in West African Dwarf sheep. Animal 2008;2(7):1003-1012. 10. Malhado CHM, Carneiro PLS, Affonso PRAM, Souza Jr AAO, Sarmento JLR. Growth curves in Dorper sheep crossed with the local Brazilian breeds, Morada Nova, Rabo Largo, and Santa Inês. Small Ruminant Res 2009;84(1):16-21.

1261


Rev Mex Cienc Pecu 2021;12(4):1250-1263

11. Behzadi MRB, Aslaminejad AA. A comparison of neural network and nonlinear regression predictions of sheep growth. J Anim Vet Adv 2010;9(16):2128-2131. 12. Perotto D, Cue RI, Lee AJ. Comparison of nonlinear functions for describing the growth curve of three genotypes of dairy cattle. Can J Anim Sci 1992;72(4):773-782. 13. Berry DP, Horan B, Dillon P. Comparison of growth curves of three strains of female dairy cattle. Anim Sci 2005;80(2):151-160. 14. McManus CM, Louvandini H, Campos VAL. Nonlinear growth curves for weight and height in four genetic groups of horses. Ciencia Anim Bras 2010;11(1):80-89. 15. Díaz HM. Indicaciones preliminares y el establecimiento de un módulo de producción de leche orgánica [tesis licenciatura]. Chapingo, Estado de México: Universidad Autónoma Chapingo; 2002. 16. Del Razo ROE. Características productivas y nivel de selenio y hormonas tiroideas en vacas lecheras suplementadas con bolos con selenio, bolos con selenio y yodo o bolos con yodo [tesis maestría]. Chapingo, Estado de México: Universidad Autónoma Chapingo; 2002. 17. Qing QBS. Comparison of four growth curve models in Angus cow: An application of Bayesian nonlinear mixed model. Report Presented to the Faculty of the Graduate School of the University of Texas at Austin; 2012. 18. SAS. SAS User’s Guide: Statistics (version 9.3 ed.). Cary NC, USA: SAS Inst. Inc. 2016. 19. Craig BA, Schinckel AP. Nonlinear mixed effects model for swine growth. Prof Anim Scient 2001;17(4):256-260. 20. Schinckel AP, Li N, Preckel PV, Einstein ME, Miller D. Development of a stochastic pig compositional growth model. Prof Anim Scient 2003;19(3):255-260. 21. Strathe AB, Danfaer A, Sorensen H, Kebreab E. A multilevel nonlinear mixed-effects approach to model growth in pigs. J Anim Sci 2010;88(2):638-649. 22. Echeverri ZJ, Salazar RV, Parra SJ. Análisis comparativo de los grupos genéticos Holstein, Jersey y algunos de sus cruces en un hato lechero del Norte de Antioquia en Colombia. Zoot Trop 2011;29(1):49-59. 23. Posada OS, Rosero NR, Rodríguez N, Costa CA. Estimación de parámetros de curvas de crecimiento de ganado Nellore criado en confinamiento. Rev MVZ Córdoba 2011;16(3):2701-2710.

1262


Rev Mex Cienc Pecu 2021;12(4):1250-1263

24. Domínguez-Viveros J, Rodríguez-Almeida FA, Núñez-Domínguez R, Ramírez-Valverde R, Ortega-Gutiérrez A, Ruiz-Flores A. Ajuste de modelos no lineales y estimación de parámetros de crecimiento en bovinos Tropicarne. Agrociencia 2013;47(1):25-34. 25. Brown J, Fizugh H, Cartwright TC. A comparison of nonlinear models for describing weight-age relationships in cattle. J Anim Sci 1976;42(4):810-818. 26. Mazzini AR de A, Muniz JA, Silva FF, de Aquino LH. Curva de crescimento de novilhos Hereford: heterocedasticidade e resíduos autorregressivos. Cienc Rural 2005;35(2):422427. 27. Herrera RAC, Vergara GOD, Cerón MMF, Agudelo-Gómez D, Arboleda ZEM. Curvas de crecimiento en bovinos cruzados utilizando el modelo Brody. Livest Res Rural Dev 2008, http://www.lrrd.org/lrrd20/9/herr20140.htm. Consultado Dic 11, 2017. 28. Oliveira HN, Lôbo RB, Pereira CS. Comparação de modelos não-lineares para descrever o crescimento de fêmeas da raça Guzerá. Pesqui Agropecu Bras 2000;35(9):1843-1851. 29. Mgbere OO, Olutogun O. A Comparison of non-linear models for describing weight-age relationships in N'Dama cattle. J Appl Anim Res 2002;22(2):225-230. 30. Moreira RP, Mercadente MEZ, Pedrosa VB, Cyrillo JNSG, Henrique W. Growth curves of the Caracu breed. Ciências Agrárias 2016;37(4):2749-2758. 31. Gbangboche AB, Alkoiret TI, Toukourou Y, Kagbo A, Mensah GA. Growth curves for different body traits of Lagune Cattle. Res J Anim Sci 2011;5(2):17-24. 32. Vargas-Leitón B, Cuevas-Abrego M. Modelo estocástico para estimación de valores económicos de rasgos productivos y funcionales en bovinos lecheros. Agrociencia 2009;43(8):881-893. 33. López de Torre G, Candotti JJ, Reverter A, Bellido MM, Vasco P, García LJ, Brinks JS. Effects of growth curve parameters on cow efficiency. J Anim Sci 1992;70(9):2668-72.

1263


https://doi.org/10.22319/rmcp.v12i4.5736 Nota de investigación

Efecto de la aplicación intrauterina de ozono sobre la migración de neutrófilos y la endometritis subclínica en ganado lechero

Jessica Bárbara González-Aguado a Elisa Ochoa-Estrada b Héctor Raymundo Vera-Ávila a Ma. de Jesús Chávez-López a,c Mario Alfredo Espinosa-Martínez b Germinal Jorge Cantó-Alarcón a Claudia Gutiérrez-García d Luis Javier Montiel-Olguín a,b,d*

a

Universidad Autónoma de Querétaro. Facultad de Ciencias Naturales, Maestría en Salud y Producción Animal Sustentable. Av. de las Ciencias s/n, 76230, Santiago de Querétaro, Querétaro, México. b

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, CENID Fisiología y Mejoramiento Animal. Querétaro, México. c

Universidad Autónoma de Querétaro. Centro de Extensión e Innovación Regional AC. Querétaro, México. d

Tecnologico de Monterrey, Escuela de Ingeniería y Ciencias. Querétaro, México.

* Autor de correspondencia: montiel.luis@inifap.gob.mx

Resumen: El objetivo fue determinar si una solución salina ozonizada (SSO3) incrementa los neutrófilos polimorfonucleares (NPMN) endometriales (Exp 1) y desafiar el efecto preventivo de SSO3 sobre la endometritis subclínica (ESC) (Exp 2). En el Exp 1 se utilizaron 38 vacas Holstein primíparas. Se incluyeron vacas con (CAM) y sin

1264


Rev Mex Cienc Pecu 2021;12(4):1264-1275

antecedentes de metritis postparto (SAM); posteriormente se repartieron en subgrupos control (CTRL, solución salina) o SSO3 (6.7 ± 0.3 ppm). A los 55 días postparto se aplicó 50 ml de CTRL o SSO3 intrauterinamente y a las 48 h se registró la cantidad de NPMN por citología endometrial. En el Exp 2 se utilizaron 26 vacas Holstein primíparas SAM. Las vacas se repartieron aleatoriamente en CTRL o SSO3. Se administraron dos dosis de 50 ml con intervalo de 7 días (primera aplicación 11.3 ± 0.4 días postparto). Al día 30 postparto se diagnosticó ESC (≥6% NPMN). Las vacas CAM tuvieron mayor número de NPMN endometriales comparado con vacas SAM (13.9 ± 6.2 vs 1.0±0.46, P<0.05). El grupo CAM-CTRL presentó mayor número de NPMN que el SAM-CTRL (17.0 ± 9.6 vs 0.1 ± 0.1, P<0.05) mientras que los grupos CAM-SSO3 y SAM-SSO3 (10.4 ± 8.1 vs 1.8±4.8, P>0.05) y SAM-CTRL y SAM-SSO3 (0.1 ± 0.1 y 1.8 ± 4.8, P>0.05) no fueron diferentes. Se observó una tendencia estadística (P=0.09) de menor porcentaje de ESC en grupo CTRL comparado con SSO3 (15.4 y 46.2 %, respectivamente). En conclusión, la SSO3 por vía transcervical no incrementa el número de NPMN endometriales y el tratamiento preventivo con SSO3 aplicado a vacas SAM no disminuyó la ESC. Los resultados sugieren un posible efecto antiinflamatorio del tratamiento solución salina ionizada. Palabras clave: Ozonoterapia, Puerperio, Holstein.

Recibido: 15/07/2020 Aceptado: 30/03/2021

La endometritis subclínica (ESC) es una enfermedad puerperal con alta prevalencia en los establos lecheros(1,2). Las vacas con ESC se caracterizan por presentar altos conteos de neutrófilos polimorfonucleares (NPMN) en muestras citológicas endometriales. Esta enfermedad repercute negativamente en el desempeño reproductivo porque reduce la tasa de concepción por servicio incrementando los días abiertos(1,2). Además, es una enfermedad difícil de diagnosticar a nivel de campo ya que requiere el uso de instrumental especializado y el uso de un microscopio(3,4). Aunado a esto, se ha reportado que otras enfermedades puerperales, como la retención de membranas placentarias y la metritis, son factores de riesgo para la ESC(5,6). En cuanto a la patogenia, la presencia de bacterias en el útero estimula la liberación de citocinas proinflamatorias en el endometrio que favorecen la migración de NPMN para combatir la infección(7,8). Estudios sugieren que la ESC se desarrolla a consecuencia de una elevada producción de citocinas proinflamatorias durante el control de la infección bacteriana en el útero(1,8). Por lo tanto, una estrategia para reducir la prevalencia de ESC pudiera ser disminuir la carga bacteriana uterina durante el posparto temprano. Con relación a lo anterior, la terapia con ozono ha sido utilizada experimentalmente para tratar afecciones puerperales por sus propiedades bactericidas y moduladoras de la respuesta inmune. Algunos ejemplos de las enfermedades tratadas son urovagina, lesiones 1265


Rev Mex Cienc Pecu 2021;12(4):1264-1275

en canal de parto, mastitis, infecciones uterinas y regeneración del epitelio endometrial (revisado por Đuričić et al(9)). En forma específica, la terapia con ozono en forma de espuma aplicada por vía transcervical ha demostrado ser efectiva para mitigar los efectos negativos de enfermedades puerperales sobre indicadores del desempeño reproductivo(10,11). Por ejemplo, vacas con retención de placenta, metritis o endometritis clínica tratadas con ozono tuvieron tasas de concepción similares a las de vacas sin patologías uterinas(10,11). Estos efectos benéficos han sido atribuidos a las propiedades bactericidas del ozono(9,12). Aunado a esto, aunque los mecanismos de acción bactericida del ozono no están completamente dilucidados(13), reportes sugieren que la muerte de los microorganismos se induce a través de un efecto oxidante directo por los radicales libres de oxígeno liberados con la terapia(14,15). Por otra parte, hay evidencia que sugiere que la terapia con ozono tiene la capacidad para estimular la respuesta inmune(16). Por ejemplo, se ha reportado que el ozono aplicado en ppm en vías respiratorias induce la expresión de factores quimiotácticos (IL8 y MIIP2) en el epitelio incrementando al doble el número de NPMN comparado con el grupo control(17,18). Todo lo anterior permite suponer que, además del efecto bactericida, el tratamiento con ozono pudiera estimular la expresión de factores quimiotácticos en el endometrio incrementando el número de NPMN, sin embargo, este efecto en el útero aún no ha sido demostrado. Por lo tanto, por sus propiedades inmunomoduladoras, el objetivo del presente estudio fue determinar la capacidad de la solución salina ozonizada (SSO3) para incrementar la cantidad de NPMN en el endometrio y, por sus propiedades bactericidas, desafiar el efecto preventivo de esta terapia sobre la prevalencia de ESC en bovinos lecheros. El estudio se llevó a cabo en un establo comercial en el estado de Querétaro (20° 25’ N, clima semi-seco), entre los meses de agosto y octubre del 2019. Las vacas estuvieron alojadas durante todo el estudio en corrales techados y asoleaderos de tierra con acceso libre. Cada corral contó con echaderos individuales y camas con arena silica. La limpieza de los corrales se realizó una vez al día a las 1300 h. Se ofreció una ración totalmente mezclada conteniendo 55 % de forraje (alfalfa, avena y ensilado de maíz) y 45 % de concentrado (maíz molido y rolado, salvado húmedo y soya) en base seca. Las vacas fueron alimentadas una vez al día (0700 h) y con acceso a libertad a los comederos; durante el día, el alimento fue repetidamente barrido hacia el comedero para estimular el consumo. Para producir la solución salina ozonizada, se utilizó un generador de ozono comercial de grado médico (Oxyzonic System Medic, EDE Ozone). Posteriormente, en un frasco lavador de gases se colocaron 150 ml de solución salina (NaCl 0.9%) y durante 60 seg se realizó el pase de 0.5 L/min de oxígeno de grado médico utilizando una piedra difusora de 25 mm de diámetro. La concentración de ozono en el generador se fijó a 70.09 μg/ml. En el laboratorio se determinó la concentración de ozono residual de forma indirecta con el método estándar de titulación por yodometría. Los resultados indicaron una concentración de 6.7 ± 0.3 ppm de ozono en la solución salina con este protocolo.

1266


Rev Mex Cienc Pecu 2021;12(4):1264-1275

Para alcanzar el objetivo del estudio se diseñaron dos experimentos; el Exp 1 para evaluar la capacidad de la SSO3 de incrementar el número de NPMN en el endometrio y el Exp 2 para desafiar la capacidad de esta terapia para prevenir la ESC. En la Figura 1 se muestran los diseños experimentales correspondientes. Figura 1: Diseños experimentales del estudio

SAM= vacas sin antecedentes de metritis clínica; CAM= vacas con antecedentes de metritis clínica; CTRL= tratamiento con solución salina; SSO3= tratamiento con solución salina ozonizada; PG= prostaglandina; ESC= endometritis subclínica.

En el Exp 1, se utilizaron 38 vacas de primera lactación de la raza Holstein, clínicamente sanas al momento de aplicar los tratamientos experimentales (vacas sin signos sistémicos de enfermedad, con útero involucionado a la palpación transrectal y sin la presencia de exudados que indicaran endometritis clínica), con un promedio de 28 L de leche en dos ordeñas (0400 y 1500 h). Durante los primeros siete días postparto se registró la presencia de vacas sin (SAM) o con metritis (CAM) diagnosticadas a partir de las características de las secreciones uterinas (líquido acuoso color café rojizo y con olor fétido(19)), estas últimas recibieron tratamiento con antibióticos locales y sistémicos de amplio espectro (ceftiofur 2 mg•kg-1 sc y dos lavados uterinos con oxitetraciclina/solución salina (50:50) a intervalo de tres días con terapia de soporte). Como parte del manejo reproductivo del establo, a las vacas se les aplicó un programa de pre-sincronización que consistió en dos dosis de prostaglandina (25 mg de dinoprost trometamina) a intervalo de 14 días. Doce días después de la segunda prostaglandina (entre los 50 y 60 días postparto), se tomó una biopsia pre-tratamiento de tejido endometrial mediante la técnica de Cytobrush(3,4). Posteriormente, las vacas en los grupos CAM y SAM fueron subdivididas para recibir por vía transcervical 50 ml de solución salina en el grupo control (CTRL) o solución salina ozonizada en el grupo tratado (SSO3). Cuarenta y ocho horas después de la 1267


Rev Mex Cienc Pecu 2021;12(4):1264-1275

aplicación del tratamiento, se tomaron nuevamente muestras (post-tratamiento) de tejido endometrial con la misma técnica. En ambas muestras (pre y post-tratamiento), se montaron laminillas que se analizaron al microscopio a 400X, se contabilizaron 200 células, y se registró la cantidad de neutrófilos polimorfonucleares. En este experimento era necesario contar con animales sin ESC al momento de los desafíos con solución salina. Los resultados del análisis de las laminillas indicaron que dos vacas presentaron ESC (≥6% NPMN(2)) en la muestra pre-tratamiento las cuales fueron descartadas del estudio para prevenirlo como factor de confusión. Por otra parte, en el Exp 2, se utilizaron 26 vacas de primera lactación de la raza Holstein. Las vacas se repartieron de forma aleatoria en dos grupos; control (solución salina 0.9%; CTRL) y tratamiento (solución salina ozonizada; SSO3). Utilizando pipetas de infusión, se administraron de forma intrauterina, dos dosis de 50 ml (con un intervalo de 7 días) de solución salina o de salina ozonizada. La primera dosis se administró a los 11.3 ± 0.4 días postparto. Las vacas incluidas en el estudio fueron animales clínicamente sanos, sin signos de metritis y sin antecedentes de aplicación de tratamientos para enfermedades puerperales. Al día 30 postparto se realizó el diagnóstico de ESC con la técnica de Cytobrush(3,4). Las vacas, cuyas muestras tuvieron ≥6 % de neutrófilos polimorfonucleares (en un conteo de 200 células) en el análisis citológico, fueron diagnosticadas positivas a ESC(2). Referente al análisis estadístico, todos se llevaron a cabo utilizando SAS versión 9.3 (SAS Institute Inc. Cary, NC, USA). En el Exp 1, el análisis estadístico consistió en un análisis de varianza con un diseño completamente al azar con arreglo factorial (antecedentes de enfermedades (CAM o SAM) x tratamiento con solución salina (CTRL o SSO3)) utilizando el procedimiento GLM. Se llevó a cabo el análisis de residuales con el procedimiento UNIVARIATE para verificar el cumplimiento de los supuestos del modelo. Para cumplir con los supuestos del análisis de varianza, la variable de respuesta (número de NPMN) fue transformada logarítmicamente (logY= log(Y+1)). Para facilitar la interpretación de los resultados, las medias y los errores estándar se muestran sin transformar. La comparación entre medias se llevó a cabo utilizando la opción PDIFF. En el Exp 2, para determinar si existieron diferencias entre el porcentaje de vacas con ESC se utilizó la prueba exacta de Fisher. Para determinar el riesgo que tuvo una vaca para desarrollar ESC se obtuvo la razón de momios a través de un análisis de regresión logística simple con el procedimiento LOGISTIC. Para ambos experimentos, se estableció un valor de P<0.05 como umbral de significancia estadística y un valor de P≤0.1 como indicador de tendencia. Los resultados del Exp 1 indicaron que el efecto principal antecedentes de metritis fue significativo (P=0.002) y la interacción antecedentes de metritis (CAM o SAM) x tratamiento con solución salina (CTRL o SSO3) mostró una tendencia estadística (P=0.08). En relación con el efecto principal antecedentes de metritis, las vacas CAM tuvieron un mayor número de NPMN endometriales que las vacas SAM (13.9 ± 6.2 vs 1.0±0.46, P<0.05). En la Figura 2 se muestran los resultados de la interacción sobre el 1268


Rev Mex Cienc Pecu 2021;12(4):1264-1275

número de NPMN en citologías endometriales por grupo. El grupo CAM-CTRL presentó mayor número de NPMN que el SAM-CTRL (17.0 ± 9.6 vs 0.1 ± 0.1, P<0.05) mientras que los grupos CAM-SSO3 y SAM-SSO3 no fueron diferentes (10.4 ± 8.1 vs 1.8 ± 4.8, P>0.05), aunque CAM-SSO3 si tuvo mayor cantidad de NPMN que SAM-CTRL (10.4 ± 8.1 vs 0.1 ± 0.1, P<0.05). Por su parte SAM-CTRL y SAM-SSO3 no fueron diferentes (P>0.05). La capacidad de la vaca para montar una respuesta inmune posterior al parto es un factor determinante para controlar la proliferación bacteriana que ocurre en el útero durante el puerperio de forma natural(19,20,21). En el presente estudio se repporta evidencia de que las vacas con antecedentes de metritis tuvieron mayores conteos de NPMN endometriales comparadas con el grupo de vacas sin antecedentes de metritis. Este efecto no puede ser atribuido a que el grupo CAM tenía mayores conteos de NPMN, debido a que se utilizaron vacas sin ESC (todas con conteos bajos de NPMN en la biopsia pretratamiento). Por lo tanto, una posible explicación radica en una respuesta inmune endometrial diferenciada a la aplicación de los tratamientos en ambos grupos. Se ha reportado que la solución salina tiene un efecto irritante moderado y su administración en lavados uterinos ha sido propuesto como un tratamiento efectivo contra la ESC(22). Por otra parte, en la literatura se reporta que las vacas con endometritis clínica y subclínica y vacas con antecedentes de distocia (factor de riesgo para ESC), tienen mayores cantidades de interleucinas inflamatorias en el útero(23,24). Además, análisis transcriptómicos revelaron que vacas con antecedentes de endometritis clínica tienen mayores niveles de IL-17A a los 21 días postparto(25), lo cual estimula el reclutamiento de células inflamatorias vía IL-8(26,27). Con base en lo anterior, una posible explicación a nuestros resultados (mayor número de NPMN post-tratamiento en vacas CAM), es que el endometrio pudiera tener una mayor respuesta inflamatoria a los efectos irritantes de la solución salina en las vacas con historial de metritis y endometritis clínica. Figura 2: Conteo de neutrófilos polimorfonucleares en citologías endometriales

NPMN= neutrófilos polimorfonucleares; CTRL= subgrupo control con tratamiento con solución salina; SSO3= subgrupo tratamiento con solución salina ozonizada; SAM= vacas sin antecedentes de metritis clínica; CAM= vacas con antecedentes de metritis clínica. abc Columnas con diferente letra indica diferencias estadísticas (P<0.05).

1269


Rev Mex Cienc Pecu 2021;12(4):1264-1275

Diversos estudios reportan que la aplicación de ozono por vía intrauterina es efectiva en el tratamiento de metritis y retención placentaria, efecto que se ha asociado a su propiedad bactericida(10,11). Además, se ha observado que el ozono estimula la expresión de factores quimiotácticos en el epitelio respiratorio(17,18), por lo tanto, se hipotetizó que el tratamiento con ozono estimularía la migración de una mayor cantidad de NPMN al endometrio en nuestro experimento. Sin embargo, los resultados indicaron que el número de NPMN endometriales en vacas CAM-SSO3 no fue estadísticamente diferente al que presentó el grupo SAM-SSO3, es decir, el tratamiento tendió a disminuir la sobrerespuesta inflamatoria en vacas CAM. Una posible explicación a estos resultados se encuentra en estudios recientes que reportan propiedades antiinflamatorias de la terapia con ozono(16). Se ha reportado que el tratamiento con ozono fue efectivo para disminuir la severidad de la enfermedad inflamatoria pélvica en un modelo de ratas; efecto presuntamente asociado a la disminución en la expresión de los factores inflamatorios IL6 y TNF-α(28). En otro estudio, se reportó que pacientes con osteoartritis que recibieron tratamiento local con ozono tuvieron mayor expresión de IL-10 (factor antiinflamatorio) y menores niveles de TNF-α(29). Con base en esto, es posible que, con el protocolo utilizado, la terapia de ozono haya disminuido la respuesta inflamatoria local en vacas con antecedentes de metritis. Estos resultados sugieren que la terapia con ozono utilizada pudiera tener también un efecto antiinflamatorio en el endometrio. Además, con base en otros estudios(28,29), el mecanismo pudiera ser a través de la modulación a la baja de la expresión de factores inflamatorios en vacas con antecedentes de metritis, hipótesis pendiente de ser desafiada. Por otra parte, los resultados del segundo experimento indicaron que el porcentaje general de vacas con ESC al día 30 fue de 30.7 %. También, se observó una tendencia estadística (P=0.09) para diferencias en el porcentaje de vacas con ESC entre grupos CTRL y SSO3 (15.4 y 46.2 %, respectivamente, Figura 3). Los resultados del análisis de regresión logística indicaron una tendencia estadística (P=0.1); las vacas que recibieron el tratamiento con ozono (SSO3) tuvieron una razón de momios de 4.7 (0.73-30.3, IC 95%) para desarrollar ESC en comparación con las vacas que recibieron únicamente solución salina (CTRL).

1270


Rev Mex Cienc Pecu 2021;12(4):1264-1275

Figura 3: Porcentaje de vacas con endometritis subclínica al día 30 postparto

CTRL= grupo control con tratamiento con solución salina; SSO3= grupo tratamiento con solución salina ozonizada. (P=0.09).

La patogenia de la ESC no ha sido explicada completamente, sin embargo, hay reportes que indican que el origen de la enfermedad es una respuesta inmune exacerbada en respuesta a una alta cantidad de bacterias en el útero(1,8). El razonamiento detrás del segundo experimento fue que se podría disminuir el porcentaje de vacas con ESC aplicando la terapia con ozono durante el puerperio temprano, esto para reducir la carga bacteriana presente en ese momento. Sin embargo, los resultados indicaron que las vacas que recibieron el tratamiento con SSO3 tuvieron mayor prevalencia y mayor riesgo de sufrir ESC a los 30 días postparto. Estos resultados deben tomarse con cautela, ya que a pesar de que el grupo con SSO3 tuvo tres veces más animales con ESC y la razón de momios indicó 370 % mayor probabilidad de desarrollar ESC, la significancia estadística fue a nivel de tendencia. Ahora bien, una posible explicación a estos resultados es que las dos dosis administradas a intervalo de siete días no hayan sido efectivas para reducir la carga bacteriana, pero sí para modular a la baja la respuesta inmune. En la práctica se ha observado que la aplicación de una dosis única de 50 ml de SSO3 (6.7 ± 0.3 ppm) mejora las características de las secreciones uterinas en vacas con metritis 24 h después de la aplicación del tratamiento (resultados no publicados). Sin embargo, las vacas tratadas vuelven a presentar secreciones con características de metritis en días posteriores. Esto permite suponer que el protocolo utilizado en el presente estudio pudo haber sido insuficiente para reducir la carga bacteriana en el útero. Por otra parte, se sabe que la presencia de bacterias en la luz uterina estimula la expresión de factores proinflamatorios que favorecen la migración de NPMN para combatir la infección(8). Además, se ha reportado que un incremento en la cantidad de citocinas proinflamatorias predispone al desarrollo de ESC(1,8). Si el tratamiento con SSO3 fue insuficiente para disminuir la carga bacteriana, pero disminuyó la respuesta inmune local, se pudo haber inducido una infección uterina más grave. Posteriormente, esta infección uterina pudo haber estimulado una respuesta inmune aún más agresiva, predisponiendo así a un mayor riesgo en las vacas para desarrollar ESC, hipótesis pendiente por desafiar. No se omite mencionar que el 1271


Rev Mex Cienc Pecu 2021;12(4):1264-1275

presente es un estudio preliminar y los resultados del tratamiento preventivo son aplicables a vacas con un puerperio sano y sin factores de riesgo para ESC. Además, la tendencia estadística obtenida invita a tomar los resultados con cautela. La modulación de la respuesta inmune se ha propuesto como una estrategia para reducir la prevalencia de la ESC(7). En el primer experimento, los resultados sugieren que pudiera haber una disminución en la respuesta inmune en respuesta al tratamiento con SSO3. En el segundo experimento, los resultados indicaron que las vacas tratadas con SSO3 tienden a tener una mayor predisposición a desarrollar ESC lo cual pudo haber sido posible por un efecto inmunosupresor inducido por la terapia. Sin embargo, una limitante del presente estudio es que en el segundo experimento solo se utilizaron vacas que no estaban cursando cuadros de metritis (factor de riesgo para ESC(5,6)) y la tendencia estadística obtenida. Como se observó en el primer experimento, existe una respuesta diferenciada al tratamiento dependiendo de si los animales cursan con enfermedad uterina infecciosa. Por lo tanto, queda aún pendiente desafiar el efecto preventivo del tratamiento con ozono en vacas con factores de riesgo para ESC. A pesar de esta limitante, los resultados que aquí se presentan son fundacionales para continuar explorando los efectos de la terapia local uterina con ozono, principalmente por el aparente efecto antiinflamatorio de este elemento. En conclusión, con el protocolo utilizado, la SSO3 por vía transcervical no incrementa el número de NPMN en el endometrio posterior a su aplicación. Además, el tratamiento con SSO3 aplicado en vacas sin antecedentes de metritis temprana incrementa el riesgo de desarrollar ESC. Una implicación de este trabajo es que la SSO3 pudiera tener un efecto antiinflamatorio local, lo cual justifica explorar la efectividad del protocolo preventivo en vacas con factores de riesgo para ESC. Agradecimientos Al Fondo para el Fortalecimiento a la Investigación (FOFI; FNV201809) de la UAQ por el financiamiento de este proyecto. El programa académico de González-Aguado fue apoyado por CONACyT bajo la supervisión del último autor (LJMO). Cumplimiento de normas éticas y conflicto de interés El protocolo de este estudio fue aprobado por el Comité de Bioética de la Facultad de Ciencias Naturales de la Universidad Autónoma de Querétaro (84FCN2018). Los autores declaran que no tienen conflictos de interés. Literatura citada: 1. Wagener K, Gabler C, Drillich M. A review of the ongoing discussion about definition, diagnosis and pathomechanism of subclinical endometritis in dairy cows. Theriogenology 2017;94:21-30.

1272


Rev Mex Cienc Pecu 2021;12(4):1264-1275

2. Barajas Merchan JL, Hernández Cerón J, García Alfonso A, Martínez Bárcenas E, Juárez López NO, Bedolla Alva MA, et al. Endometritis subclínica y tasa de gestación en vacas lecheras en México. Rev Mex Cienc Pecu 2018;9(1):135-146. 3. Barlund CS, Carruthers TD, Waldner CL, Palmer CW. A comparison of diagnostic techniques for postpartum endometritis in dairy cattle. Theriogenology 2008;69(6):714-723. 4. Cardoso B, Oliveira ML, Pugliesi G, Batista EDOS, Binelli M. Cytobrush: A tool for sequential evaluation of gene expression in bovine endometrium. Reprod Domest Anim 2017;52(6):1153-1157. 5. Cheong SH, Nydam DV, Galvão KN, Crosier BM, Gilbert RO. Cow-level and herdlevel risk factors for subclinical endometritis in lactating Holstein cows. J Dairy Sci 2011;94(2):762-770. 6. Adnane M, Kaidi R, Hanzen C, England GCW. Risk factors of clinical and subclinical endometritis in cattle: a review. Turk J Vet Anim Sci 2017; 41(1):1-11. 7. Herath S, Lilly ST, Santos NR, Gilbert RO, Goetze L, Bryant CE, et al. Expression of genes associated with immunity in the endometrium of cattle with disparate postpartum uterine disease and fertility. Reprod Biol Endocrin 2009;7(1):55. 8. Fischer C, Drillich M, Odau S, Heuwieser W, Einspanier R, Gabler C. Selected proinflammatory factor transcripts in bovine endometrial epithelial cells are regulated during the oestrous cycle and elevated in case of subclinical or clinical endometritis. Reprod Fertil Dev 2010;22(5):818-829. 9. Đuričić D, Valpotić H, Samardžija M. Prophylaxis and therapeutic potential of ozone in buiatrics: Current knowledge. Anim Reprod Sci 2015;159:1-7. 10. Djuricic D, Vince S, Ablondi M, Dobranic T, Samardzija M. Intrauterine ozone treatment of retained fetal membrane in Simmental cows. Anim Reprod Sci 2012;134(3-4):119-124. 11. Đuričić D, Lipar M, Samardžija M. Ozone treatment of metritis and endometritis in Holstein cows. Vet Arh 2014;84(2):103-110. 12. Megahed A, Aldridge B, Lowe J. The microbial killing capacity of aqueous and gaseous ozone on different surfaces contaminated with dairy cattle manure. Plos One 2018;13(5):e0196555. 13. Zeng J, Lu J. Mechanisms of action involved in ozone-therapy in skin diseases. Int Immunopharmacol 2018;56:235-241. 14. Al‐Saadi H, Potapova I, Rochford ET, Moriarty TF, Messmer P. Ozonated saline shows activity against planktonic and biofilm growing Staphylococcus aureus in vitro: a potential irrigant for infected wounds. Int Wound J 2016;13(5):936-942.

1273


Rev Mex Cienc Pecu 2021;12(4):1264-1275

15. Khatri I, Moger G, Anil Kumar, N. Evaluation of effect of topical ozone therapy on salivary Candidal carriage in oral candidiasis. Indian J Dent Res 2015;26(2):158. 16. Di Mauro R, Cantarella G, Bernardini R, Di Rosa, M, Barbagallo, I, Distefano A, et al. The biochemical and pharmacological properties of ozone: the smell of protection in acute and chronic diseases. Int J Mol Sci 2019;20:634. 17. Driscoll KE, Simpson L, Carter J, Hassenbein D, Leikauf GD. Ozone inhalation stimulates expression of a neutrophil chemotactic protein, macrophage inflammatory protein 2. Toxicol Appl Pharm 1993;119(2):306-309. 18. Chang MMJ, Wu R, Plopper CG, Hyde DM. IL-8 is one of the major chemokines produced by monkey airway epithelium after ozone-induced injury. Am J PhysiolLung C 1998;275(3):L524-L532. 19. Sheldon M, Croning J, Goetze L, Danofrito G, Schubert H. Defining postpartum uterine disease and the mechanisms of infection and immunity in the female reproductive tract in cattle. Biol Reprod 2009;81(6):1025–1032. 20. Santos TM, Bicalho RC. Diversity and succession of bacterial communities in the uterine fluid of postpartum metritic, endometritic and healthy dairy cows. Plos One 2012;7(12):e53048. 21. Dervishi E, Zhang G, Hailemariam D, Goldansaz SA, Deng Q, Dunn SM, et al. Alterations in innate immunity reactants and carbohydrate and lipid metabolism precede occurrence of metritis in transition dairy cows. Res Vet Sci 2016;104:30-39. 22. Dini P, Farhoodi M, Hostens M, Van Eetvelde M, Pascottini OB, Fazeli MH, Opsomer G. Effect of uterine lavage on neutrophil counts in postpartum dairy cows. Anim Reprod Sci 2015;158:25-30. 23. Ill-Hwa K, Hyun-Gu K, Jae-Kwan J, Tai-Young H, Young-Hun J. Inflammatory cytokine concentrations in uterine flush and serum samples from dairy cows with clinical or subclinical endometritis. Theriogenology 2014;82(3):427-432. 24. Healy LL, Cronin JG, Sheldon IM. Endometrial cells sense and react to tissue damage during infection of the bovine endometrium via interleukin 1. Sci Rep 2014;4(1):19. 25. Foley C, Chapwanya A, Callanan JJ, Whiston R, Miranda-CasoLuengo R, Lu J, et al. Integrated analysis of the local and systemic changes preceding the development of post-partum cytological endometritis. 2015 BMC Genomics;16(1):811. 26. Ahn SH, Edwards AK, Singh SS, Young SL, Lessey BA, Tayade C. IL-17A contributes to the pathogenesis of endometriosis by triggering proinflammatory cytokines and angiogenic growth factors. J Immunol 2015;195(6):2591-2600.

1274


Rev Mex Cienc Pecu 2021;12(4):1264-1275

27. Hirata T, Osuga Y, Hamasaki K, Yoshino O, Ito M, Hasegawa A, et al. Interleukin (IL)-17A stimulates IL-8 secretion, cyclooxygensase-2 expression, and cell proliferation of endometriotic stromal cells. Endocrinology 2008;149(3):1260–1267. 28. Wei A, Feng H, Jia XM, Tang H, Liao YY, Li BR. Ozone therapy ameliorates inflammation and endometrial injury in rats with pelvic inflammatory disease. Biomed Pharmacother 2018;107:1418-1425. 29. Asadi S, Farzanegi P, Azarbayjani MA. Effect of exercise, ozone and mesenchymal stem cells therapies on expression of IL-10 and TNF-α in the cartilage tissue of overweight rats with knee osteoarthritis. Soc Determ Health 2018;4(3):162-170.

1275


https://doi.org/10.22319/rmcp.v12i4.5625 Nota de investigación

Análisis in silico de la expresión génica en células de granulosa de folículos preovulatorios en dos especies de bovinos

Jesús Alfredo Berdugo-Gutiérrez a* Ariel Marcel Tarazona-Morales b José Julián Echeverry-Zuluaga a Albeiro López-Herrera a

a

Universidad Nacional de Colombia- Sede Medellín. Facultad de Ciencias Agrarias. Grupo de Investigación BIOGEM. Carrera 65 No 59 a 110. Medellín, Colombia. b

Universidad Nacional de Colombia- Sede Medellín. Facultad de Ciencias Agrarias. Grupo de Investigación BIOGENESIS.

*Autor de correspondencia: jaberdugog@unal.edu.co

Resumen: Los búfalos y vacunos son dos especies de bovinos con gran parecido en su fisiología reproductiva, pero a la vez con gran diferencia en sus parámetros reproductivos. El objetivo del presente trabajo es comparar la expresión génica en células de granulosa de folículos preovulatorios de estas dos especies, basados en información disponible en la literatura, los repositorios de transcriptomas existentes y en el análisis funcional usando Ingenuity Pathway Analysis. Sólo se encontraron dos estudios independientes en los que se comparan búfalos y vacunos en cuanto a la expresión génica en células de la granulosa de folículos preovulatorios. Se analizaron los datos de expresión de forma independiente y combinada. Se encontró que, entre búfalos y vacunos, prácticamente no hay correspondencia entre los procesos evaluados, ni en las vías canónicas, ni en los reguladores corriente arriba, solamente se encuentra alguna correspondencia entre las redes y aspectos fisiológicos de cada proceso. Se concluye que cada especie tiene forma diferente de realizar el mismo proceso y que debe investigarse cada evento de acuerdo con las necesidades de los investigadores. Palabras clave: Bovinos, Granulosa, Transcriptómica, Folículo, In Silico. 1276


Rev Mex Cienc Pecu 2021;12(4):1276-1291

Recibido: 25/02/2020 Aceptado: 22/12/2020 Los búfalos (Bubalus bubalis) y vacunos (Bos taurus) son bovinos, muy emparentados que solo los diferencia su ADN mitocondrial(1). Búfalos y vacunos son poliéstricos estacionales, con dos o tres ondas foliculares por ciclo estral(2); sin embargo en iguales condiciones medioambientales y de manejo su función reproductiva es diferente evidenciado en la tasa de natalidad, expresión de celo y respuesta a las biotecnologías reproductivas. También se ha descrito que el búfalo tiene ovarios de menor tamaño(3), diferente diámetro folicular al momento de la desviación y de la ovulación(4), menor calidad de oocitos y menor tasa de producción de embriones comparados con los vacunos. Li et al(5) encontraron 40 loci (asociados con 28 genes) que pudieron relacionarse con parámetros reproductivos tales como edad al primero, segundo y tercer parto, días abiertos, servicios por concepción e intervalo entre partos(5,6). La formación de un oocito competente depende del desarrollo folicular, en una la formación de un folículo preantral con un oocito capaz de formar el individuo y la segunda es el desarrollo de este folículo hasta la ovulación, asociado a todos los cambios endocrinos que deben suceder en la hembra para lograrlo(7,8). El control de la población folicular depende de la función que ejerce la hormona antimulleriana (AMH), los que van a ovular deben adquirir receptores para la hormona folículo estimulante (FSH), finalmente algún folículo gana receptores para LHr(8), lo que genera un descenso en la velocidad de crecimiento que se mantiene hasta el pico preovulatorio de LH(9,10). Se ha informado que el oocito bufalino es de pobre calidad cuando es evaluado con los parámetros que normalmente se usan para los vacunos, y aunque no se conoce en detalle las razones se ha propuesto como causa: un microambiente folicular adverso, lo que ha motivado a los investigadores a estudiar las proteínas del líquido folicular bufalino(11). Se ha demostrado que la comunicación existente entre las células de granulosa y el oocito juegan un papel fundamental para producir oocitos de buena calidad(12). Hoy en día es factible el análisis en profundidad de los eventos reproductivos en la hembra bovina. Es innegable el avance logrado con los microarreglos y otros sistemas usados en transcriptómica, los datos son depositados en repositorios, que pueden analizarse y permiten al investigador evaluar sus premisas. Sin embargo es una base heterogénea debido a todos los aspectos técnicos y las herramientas computacionales usadas para el análisis de la misma(13). En un estudio reciente, Khan et al(10) generaron una interfase interactiva llamada GranulosaIMAGE, que provee información sobre los perfiles de expresión de los genes y sus isoformas en las células de granulosa de vacunos en diferentes estados de la foliculogénesis (http://emb bioinfo.fsaa.ulaval.ca/granulosaIMAGE/).

1277


Rev Mex Cienc Pecu 2021;12(4):1276-1291

Una herramienta importante es Ingenuity Pathway Analysis (IPA) que es una base datos que se usa para el análisis, integración e interpretación de los datos relacionados con experimentos basados en información obtenida mediante RNAseq, principalmente IPA permite en un solo análisis, identificar las moléculas reguladoras, lo que facilita la explicación de los patrones de expresión, prediciendo las consecuencias del control sugerido sobre la biología celular y sobre la presentación de las enfermedades(14). El programa hace los cálculos basados en algoritmos y datos experimentales(15) finalmente en los cuales los genes expresados diferencialmente en el experimento son asociados con aquellos que se han informado más frecuentemente en una función particular o vía metabólica(16) y sus sistemas de control(17). Los desarrollos en bioinformática permiten el estudio de fenómenos biológicos de una forma compleja: en este caso las diferencias en la expresión génica de folículos de búfalos y de vacunos, de una forma más global, que permiten por los menos considerar todos los posibles genes que se expresan en un momento dado, mostrando los detalles de la expresión génica y de las posibles alternativas que la naturaleza ha generado para la realización de un mismo proceso. El objetivo del presente trabajo es evaluar si existen diferencias en la expresión génica de células de granulosa de folículos preovulatorios búfalos y vacunos tendientes a buscar explicaciones al diferencial de respuesta a las biotecnologías reproductivas observado entre las especies mencionadas. Este trabajo fue realizado en dos fases: la primera, se realizó una búsqueda bibliográfica exhaustiva, en las bases de datos de PUBMED y Google Académico, enfocándola en información correspondiente a los análisis de expresión génica entre búfalos y vacas y cuyos archivos estuvieran depositados en GEO (Gene Expression Omnibus) hasta marzo del 2018, la segunda, se realizó el análisis de los reportes encontrados. El criterio de inclusión fue: experimentos donde hubiera comparación de datos; o si no había comparación, que los datos fueran obtenidos de la misma forma y procesados de forma similar. Se encontraron dos estudios de transcriptomas de folículo preovulatorio(18,19). En el caso de las vacas el RNA fue extraído con RNeasy mini kit (Qiagen) y en el de búfalo con TRIZOL seguido de purificación con RNeasy mini kit, en ambos casos se obtuvo cDNA y fueron hibridizados con un Chip de Affimetrix (Affymetrix Gene - Chip Bovine Genome Arrays), que contenían 24,128 sondas, representando 23,000 transcritos y sus variantes, incluyendo 19,000 clúster unigénicos. Aquellos genes con un cambio en la expresión ≥2 con una tasa falsa de descubrimiento (FDR < 0.05) fueron considerados como expresados diferentemente, posteriormente se realizó una RT-PCR semi cuantitativa para la validación de los resultados con los siguientes genes: receptor de LH (LHR), receptor de la progesterona (PR) y ciclooxigenasa COX-2 en búfalos, y dos genes del citocromo P450 relacionados con la producción de estrógenos, Citocromo 450 CPY19A1, CPY17A1, 18s, para los vacunos.

1278


Rev Mex Cienc Pecu 2021;12(4):1276-1291

Posteriormente, los datos crudos de cada microarreglo se corrigieron mediante la remoción del ruido de fondo (Background) y normalización (loess) utilizando el software FlexArray 1.6.1, y todos los datos fueron exportados a archivos de excell (Microsoft Office) para ser analizados de forma funcional usando Ingenuity® Pathway Analysis (IPA). Se utilizó como genoma de comparación UMD Bos taurus 3.1.1 para ambos casos, dado que el genoma bufalino aún no está totalmente secuenciado. Se obtuvo de una lista de genes diferencialmente expresados de los folículos preovulatorios de cada especie y se cuantificó esta diferencia, se agruparon de acuerdo a su función biológica y a los potenciales reguladores corriente arriba (upstream). La información se procesó individualmente y compararon entre las dos especies. El programa funciona asignándole un valor probabilístico a la asociación entre los genes sobre o sub expresados y las principales funciones biológicas. Para el análisis de los reguladores corriente arriba, IPA® compara los resultados del experimento con su propia base de datos de los efectos conocidos de los genes y moléculas sobre la expresión. De cada regulador se calculan dos valores, un valor de sobreposición (overlap p) y un valor de activación (Z score), que corresponde a un promedio numérico calculado de los efectos conocidos de la molécula o gen (up or down regulation) y sus respectivos blancos. Se considera un valor de Z significante cuando tiene un valor mayor a 2 (Z-score > 2) para activación y (Z-score < 2) para inhibición, los valores intermedios se consideran que no pueden ser atribuibles a la experimentación(14). Se encontraron 21 reportes de expresión génica en células de la granulosa bovinas en los que hubiera al menos una base de datos depositada, y de estos solamente uno tenía información de búfalos. No hubo reportes de comparación de expresión diferencial de genes entre búfalos y vacas. Finalmente los requisitos se cumplieron por dos reportes: “Transcriptome profiling of granulosa cells of bovine ovarian follicles during growth from small to large antral sizes”, número de acceso GSE39589 con cuatro repeticiones(19), y “Buffalo Gene expression profiling of preovulatory follicle in the buffalo cow: effects of increased IGF-I concentration on periovulatory events”, número de acceso GSE11312, con tres repeticiones(18). En los trabajos iniciales se informa que existen en las búfalas 110 genes diferencialmente expresados que pertenecen a 14 vías metabólicas de acuerdo con la base de datos de Ontología Génica (Gene ontology), para las vacas se encontraron 446 genes que pertenecían a 10 vías metabólicas. El análisis de IPA muestra que las más importantes vías metabólicas canónicas asociadas con el patrón de expresión observado en el búfalo fueron: Ubiquitinación de proteínas, disfunción mitocondrial, fosforilación oxidativa y la señalización asociada al receptor de estrógenos y de las sirtuinas, en las vacas las vías canónicas más importantes son la síntesis de triacilglicéridos , traductor de señales y activador de la transcripción 3 (STAT3) , maduración de fagosomas, Proteína Kinasa Janus 2 (JAK 2) en la señalización de hormonas parecidas a las citoquinas y la de la Oncostatina (Cuadro 1). 1279


Rev Mex Cienc Pecu 2021;12(4):1276-1291

Cuadro 1: Principales rutas metabólicas en el folículo de búfalo y vaca Sobreposición Ruta Valor p (%) Moléculas Folículo de búfala Ubiquitinación de proteínas 1.11 E -11 19.70 53/269 Disfunción mitocondrial 2.41 E-11 22.30 42/188 Fosforilación oxidativa 7.80 E-10 25.20 30/119 Señales del receptor de estrógenos 9.46 E -10 23.90 32/134 Señalización de la sirtuina 3.46 E -08 16.00 52/325 Folículo de vaca Biosíntesis de triacilglicerol 1.41 E-03 6.90 4/58 Via STAT3 1.83 E -03 4.80 5/104 Maduración de los fagosomas 1.97 E-03 3.90 6/155 Papel de la señalización de JAK2* 8.80 2.84 E -03 .3/34 Señalización de la oncostatin M 4.53 E-03 7.50 .3/40 * hormona parecida a las citokinas.

El análisis del IPA mostró que estaban activados los genes o moléculas de las siguientes rutas HNF4A, RICTOR, EIF4E,1-2-dithiol-3-thione, STI926 en los búfalos, sin estar ninguno caracterizado en búfalos y para las vacas fueron factor transformante beta 1 (TGFB1), Receptor de estrógenos tipo B2 (ERBB2), dexametasona, beta-estradiol, D-glucosa (Cuadro 2). Cuadro 2: Principales reguladores corriente arriba Valor p Búfalos HNF4A RICTOR EIF4E 1,2-dithiol-3-thione ST1926

2.70 E-27 2.15 E -17 1.38 E -15 4.9 E-15 5.64 E-15 Vacas

TGFB1 ERBB2 Dexamethasona beta-estradiol D-glucosa

7.64 E-09 1.2 E -08 1.3 E E-07 5.21 E-07 2.10 E -06

Las redes funcionales más importantes para los búfalos fueron: 1) transporte molecular, tráfico del RNA y modificaciones postraduccionales, 2) señalización celular, modificaciones postraduccionales, y síntesis proteica, 3) ensamblaje y organización celular, desórdenes del

1280


Rev Mex Cienc Pecu 2021;12(4):1276-1291

desarrollo y hereditarios, 4) modificaciones postranscripcionales del RNA, síntesis proteica y expresión génica, mantenimiento y función celular, modificaciones postraduccionales y doblamiento de proteínas. Para las vacas 1) organización y ensamblaje de la célula, desordenes del desarrollo y enfermedades neurológicas, 2) metabolismo de lípidos, bioquímica de moléculas pequeñas, señalización e interacción intracelular, 3) muerte y supervivencia de las células, interacción entre ellas y cáncer, 4) transporte molecular, señalización celular y metabolismo de vitaminas y minerales (Cuadro 3). Cuadro 3: Redes funcionales más importantes Nombre de las redes y sus funciones Búfalos Transporte molecular, tráfico del RNA y modificaciones postraduccionales Señalización celular, modificaciones postraduccionales, y síntesis proteica Ensamblaje y organización celular, desordenes del Desarrollo y hereditarios Modificaciones postranscripcionales del RNA, síntesis proteica y expresión génica Mantenimiento y función celular, modificaciones postraduccionales y doblamiento de proteínas Vacas Nombre de las redes y sus funciones Organización y ensamblaje de la célula, desordenes del Desarrollo y enfermedades neurológicas Metabolismo de lípidos, bioquímica de moléculas pequeñas, señalización e interacción intracelular Muerte y sobrevida de las células, interacción entre ellas y cáncer Transporte molecular, señalización celular y metabolismo de vitaminas y minerales

Puntaje 153 146 141 139 123 Score 163 79 73 11

En este trabajo se comparó: la expresión génica en folículos preovulatorios entre dos especies muy relacionadas, la forma de hacerlo es un abordaje novedoso para tener más conocimiento. A primera vista no se encuentra una estricta relación entre los conceptos enunciados en la introducción y los resultados del experimento. Este hecho se puede considerar para ser discutido pues antes de hacer el análisis el pensamiento de los investigadores estaba centrado en el conocimiento existente sobre el control endocrino y el desarrollo del folículo en las especies y los resultados muestran una información asociada a aspectos relacionados casi exclusivamente con biología celular y molecular. Es importante resaltar la dificultad para encontrar información comparable, y dado el enfoque biológico del escrito, se decide evitar la discusión técnica sobre la forma de obtención de los datos y su análisis, que es tan frecuente en este tipo de publicaciones. En un trabajo previo del grupo(20), donde se describe lo informado en los dos artículos evaluados en este estudio,

1281


Rev Mex Cienc Pecu 2021;12(4):1276-1291

se muestra que en los folículos preovulatorios de vacas y búfalos solamente hay coincidencia en la expresión de tres genes (20 %): activador tisular del plasminógeno (PLAT), regulador agudo esteroidogénico, (STAR), receptor parecido I al factor II de coagulación (F2RL-1), con diferencias en los niveles de expresión (expresión relativa) 9,7 vs 17,5, 8,74 vs 3,4, and 7,7 vs 5,3 veces para PLAT, STAR y F2RL-1 respectivamente, mostrando las diferencias entre las especies. Adicionalmente no se ha informado que alguno de los genes encontrados tenga que ver directamente sobre la ovulación, el desarrollo folicular o que sean marcadores de los mismos procesos biológicos. PLAT es una serina-proteasa secretada que convierte la proenzima plasminógeno en plasmina, una proteína fibrinolítica. Un aumento de su función causa hiperfibrinólísis que se evidencia por el excesivo sangrado y una disminución de su función causa hipofribrinólisis que se evidencia por trombosis y embolismo se ha informado sobre expresada en células de granulosa de folículos ovulatorios y se ha asociado con la ruptura folicular(21). STAR, tiene un papel importante en la regulación aguda de la síntesis de hormonas esteroidales, permite el rompimiento del colesterol a pregnenolona para facilitar su transporte de la membrana externa a la interna en la mitocondria. En búfalos se ha informado que la expresión esta aumentada (up regulated) en las células de granulosa y pared folicular después del tratamiento de hormona de crecimiento bovina(18), adicionalmente un sinergismo entre el factor de crecimiento insulinoide 1 y las gonadotropinas para aumentar la expresión de STAR(22). F2RL-1, es una proteína que pertenece a la familia de las que están asociadas al receptor tipo I de las proteínas G, tiene además función sobre la respuesta inflamatoria, en la inmunidad innata y adaptativa(23). La señalización a través de este gen (F2RL-1) media la citogénesis in vitro de las células endoteliales y promueve la vasodilatación y permeabilidad microvascular, pasos fundamentales de la angiogénesis. Se ha observado la sobreexpresión del gen F2RL-1 que explican en parte los cambios de crecimiento de los vasos sanguíneos de las células de la teca, y la invasión de las células de granulosa murales después de la ruptura folicular(24). Aunque hay una correspondencia baja entre las dos especies, los genes comunes están asociados a los mecanismos de ovulación, genes asociados con la forma como la célula realiza su función. No se observan genes expresados diferencialmente asociados a los fenómenos que dirigen el proceso como gonadotropinas o esteroides sexuales. En consecuencia, se debe encontrar una forma nueva de ver y analizar los datos obtenidos, ya que lo encontrado es más bien la descripción de cómo se ejecuta un fenómeno que en este caso serían los factores proteolíticos para el rompimiento del folículo, los cambios en la vasculatura para el remodelamiento del órgano y la acumulación de estrógenos para generar el pico de LH. Para algunos autores la ovulación ha sido asociada con inflamación(25), pudiera entonces suponerse que las dos especies hacen lo mismo, con un grupo de moléculas maestras 1282


Rev Mex Cienc Pecu 2021;12(4):1276-1291

generales y otro de efectoras que pueden ser muy específicas y marcar las diferencias observadas. La ubiquitinación de proteínas es la ruta más importante para la degradación de proteínas reguladoras de vida media. Hatzirodos et al(20), encontraron que esta ruta está involucrada en la transición de un folículo pequeño a grande. Otros investigadores, lo encontraron como regulador de los receptores de andrógenos en los humanos(26). Las mitocondrias son los principales consumidores de oxígeno de la célula; se ha informado el efecto que tiene el buen funcionamiento de la vía para la competencia del oocito por su papel en la formación de especies reactivas de oxígeno(27). En mujeres, se ha propuesto la transferencia de mitocondrias como una alternativa para el tratamiento de oocitos provenientes de pacientes con enfermedades que incluyen alteraciones en las mitocondrias(28), también en humanos obesos que la disfunción mitocondrial se asocia con alteraciones en la fertilidad. Se ha informado en búfalos que la suplementación de los medios de maduración para producir embriones in vitro, con cistina con o sin cisteamina incrementa significativamente la proporción de oocitos que presentan fertilización normal, clivaje y producción de blastocistos(29). La fosforilación oxidativa es el proceso mediante el cual la célula produce ATP. Li et al(6) reportaron en los búfalos que la fosforilación oxidativa es importante para las primeras fases del desarrollo folicular. También se ha informado su rol en el proceso ovulatorio dada la naturaleza hipóxica del procesos, se ha mostrado evidencia en la que el folículo necesita producir más moléculas para la respuesta hipóxica en los folículos antrales preovulatorios(5). Las sirtuinas pertenecen a la clase III de enzimas deacetilasas que utilizan el NAD+ como sustrato para realizar su función, se ha reportado que existen 7 en mamíferos con múltiples funciones (SIRT 1-7), tienen función como reguladores de la transcripción en envejecimiento, metabolismo, cáncer, inflamación, reparación del ADN y respuesta celular al stress(30). Se ha reportado que SIRT1, SIRT2 and SIRT3 tienen función protectora para el envejecimiento del oocito después de la ovulación, además SIRT3 tiene un papel en la detección de especies reactivas de oxigeno (ROS) en la foliculogénesis y los procesos de luteinización de las células de granulosa(31). Pacella-Ince, et al, han descrito que niveles bajos de mRNA de la SIRT 5 mitocondrial están asociados con una reducida reserva ovárica y envejecimiento del ovario en humanos(32). Dentro de las vías metabólicas más importantes en vacas se encuentran: Biosíntesis de triacilglicerol. En la literatura está ampliamente documentado el efecto de las gotas lipídicas sobre la calidad y función de los oocitos(33). Hoy en día se consideran como 1283


Rev Mex Cienc Pecu 2021;12(4):1276-1291

un organelo aparte con sus propias enzimas asociadas. En humanos, el perfil lipídico de las células de granulosa se ha asociado con éxito en la gestación, en oocitos de vaca ha sido asociada con calidad, y en humanos con efecto en la maduración(34). La maduración del fagosoma es un proceso en el cual algunas partículas que se internalizan se mueven sobre estructuras acidificadas, que se integran en un mecanismo de apoptosis. Este proceso necesariamente involucra la maduración, que se puede ver por la fusión secuencial de los diferentes estadios de los lisosomas que terminan la formación de un fagolisosoma. Hay muy poca información sobre el papel de esta vía en la formación del folículo o la calidad del oocito; se ha sugerido como una vía alternativa para el control de la muerte del oocito y que puede activarse durante la formación del folículo para los procesos de autofagia. La alteración de algunos genes que codifican proteínas para autofagia causan una gran pérdida de oocitos, sugiriendo un papel de la autofagia en la regulación de su sobrevida(35). Las quinasas Janus, son una familia de 4 tirosina quinasas. Estas juegan un papel importante en el crecimiento celular, supervivencia y diferenciación; se expresan ampliamente en el folículo preovulatorio y se inhibe su expresión por la inyección intrafolicular, también se ha informado que en las células de granulosa, la IL-6 promueve la expresión inducida por FSH de VEGF por la vía JAK/STAT3(36). Las citoquinas son los principales mediadores intercelulares, estos activan en el ovario células inmunes y no inmunes que facilitan la constante reorganización del estroma ovárico a través de vías proteolíticas, facilitando las modificaciones de la membrana basal de las células de granulosa, y la invasión vascular endotelial. Martins, et al., informaron que los receptores para la oncostatina M están regulados en las células de granulosa durante la atresia folicular, ovulación y luteólísis, y que la proteína oncostatina proveniente de otras células regulan la función de genes de viabilidad celular en la granulosa y las células luteales (37). Muchas moléculas involucradas en desarrollo folicular que afectan las señales para la ovulación disparan la expresión de citoquinas como TNFa, interleukina7, and CDKN1A(38). Cuando se hace la comparación de la expresión de los genes entre las dos especies y se analizan las 10 vías canónicas activadas con mayor valor de P, solo se comparten unas pocas con los análisis individuales, para el caso del búfalo 5 de las 10, mientras que para las vacas solo 1 (Cuadro 4).

1284


Rev Mex Cienc Pecu 2021;12(4):1276-1291

Cuadro 4: Comparación de las principales rutas metabólicas en las dos especies Valor p

Rutas metabólicas

Relación Score- z

5.02E+00 Vía de señalización de las sirtuinas Papel de las proteínas CHK. Proteínas en el control del 4.74E+00 ciclo celular

1.63E-01

2.191

2.78E-01

1.897

Fosforilación oxidativa

4.61E+00

2.19E-01

-4.583

Biosíntesis de novo de ribonucleótidos de piridina

4.38E+00

2.89E-01

-1.941

Papel mitótico de las Polo-like quinasas

4.07E+00

2.46E-01

-1.667

Inter conversión de los ribonucleótidos de pirimidina

3.93E+00

2.79E-01

-1.732

Señalización de andrógenos

3.85E+00

1.83E-01

0.378

Degradación de 3-phosphoinositidol

3.76E+00

1.74E-01

-1.569

Regulación de las señales de eIF4 and p70S6K

3.67E+00

1.72E-01

0.632

Biosíntesis de D-mio-inositol (1,4,5,6)-tetrakisfosfato 3.65E+00

1.78E-01

-1.225

De los reguladores corriente arriba, en los búfalos: El factor nuclear del hepatocito 4A (HNF4A), está involucrado en la gluconeogénesis y el metabolismo lipídico. Este factor ha sido reportado por Khan et al(11), como un regulador corriente arriba en células de granulosa de vacas después de ser estimulados con FSH. RIPTOR, es un gen que produce una molécula que, acompaña al blanco de la rapamicina. Se ha informado en células humanas que una quinasa asociada a mTOR es necesaria para que se fosforile la Ser473, inhibiendo la vía metabólica AkT/PKB que está involucrada en apoptosis y maduración de oocito. El factor de inicio de la traducción, EIF4E, produce una proteína que ayuda al inicio de la traducción reclutando ribosomas en el extremo 5'- de la subunidad, limita el inicio de la traducción. Se ha informado que su función se incrementa en la transición de folículo primordial a folículo primario(39), en el oocito para el inicio de la traducción de mRNA asociados a la continuación de la meiosis, y en la inhibición de la función de TORC1 para el consumo de los aminoácidos. IPA también informa sobre el papel de algunas moléculas reguladoras de la función génica, evalúa los genes asociados al control de la función como 1-2-dithiol-3-thiona que tiene efecto sobre enzimas antioxidantes y ST1926 que es una molécula parecida al ácido retinoico con 1285


Rev Mex Cienc Pecu 2021;12(4):1276-1291

efectos sobre el crecimiento y la diferenciación(40). No hay reportes de la acción de estas moléculas sobre la función de las células de granulosa. De los reguladores corriente arriba en vacas: El factor transformante beta-1 pertenece a la superfamilia de las proteínas de los factores transformantes beta, han sido descritos en una gran cantidad de actividades de regulación en el ovario, desarrollo folicular y ovulación, en diferentes especies. Landry, et al informan que tiene un papel en la producción de un oocito competente y en la inducción de atresia en el caso de folículos persistentes(10). ERBB2 codifica una tirosina quinasa, que pertenece a la familia de los receptores epidermales de crecimiento, la amplificación o sobreexpresión de este gen ha sido asociada con tumores de mama y de ovario(30) y el desarrollo folicular(19) , en la regulación de la expresión del gen de supresión tumoral TP53 durante la proliferación de las células de granulosa bajo el estímulo de la FSH y después del pico de LH(41). Estrógenos, Dexametasona y D- Glucosa son moléculas reportadas con efectos sobre el desarrollo folicular de los vacunos(42). La estrona y el estradiol, son hormonas esteroidales sintetizadas en el ovario, críticas para la función reproductiva, la principal enzima de esta ruta es la aromatasa CPY19A1(43). En este punto es fácilmente entendible, que, a pesar de ser bovinos, cada especie tiene su forma diferente de realizar el fenómeno, y ese es uno de los resultados importantes de este trabajo, la evidencia muestra que cada especie desarrolla el folículo de forma o modo diferente. Dado que se observa que cada especie ovula con eventos distintos, no se puede cumplir el objetivo de explicar las diferencias reproductivas en el comportamiento reproductivo entre estas dos especies. La alta correspondencia del resultado obtenido cuando se analizan las redes o funciones biológicas más frecuentes en el evento estudiado entre las dos especies analizadas, se muestra que ambas están teniendo el mismo evento biológico: crecimiento de una estructura dentro del organismo con alta producción metabólica, proliferación celular, producción de señales para todos los eventos que sucederán, cuya consecuencia es la ovulación. La comparación entre redes muestra como hacen lo mismo con un número de moléculas diferente, los búfalos involucran más moléculas que las vacas lo que les pudiera dar una ventaja para la ovulación, al tener más opciones de rutas celulares disponibles. En el análisis comparativo entre especies, los búfalos no comparten solamente la vía del metabolismo de lípidos con las vacas, sugiriendo que deberían existir diferencias a este nivel en el líquido folicular o los oocitos, sin que hasta la fecha haya reportes al respecto en la literatura.

1286


Rev Mex Cienc Pecu 2021;12(4):1276-1291

Solo algunas publicaciones en reproducción, han tratado de hacer comparaciones entre búfalos y vacas con enfoque global del problema, es interesante ver como la evidencia de las diferencias está en aumento. Se puede encontrar con facilidad reportes sobre las diferencias en genes específicos en eventos puntuales como la señalización para el reinicio de la meiosis(44), o el papel de los factores transformantes sobre el desarrollo folicular(45). Para la fisiología de las células de granulosa y su papel en el desarrollo folicular se conoce mucha información en vacas, pero es escasa en búfalos y mucho menos su comparación. Solo se encuentra un artículo en el estudio de la transcriptómica de las células de granulosa bufalinas, utilizando RNA seq y material de planta de faenado, encontrando expresión diferencial en 595 genes, cuando se comparan los estados iniciales con los finales del desarrollo folicular(5). La comparación entre especies es un abordaje novedoso en el área de la biología reproductiva, estudiar el mismo fenómeno en igualdad de condiciones entre búfalos y vacas muestra como cada especie ha desarrollado su propia forma de realizar sus procesos, que la regulación de los mismos tienen vías diferentes entre Bos indicus y Bubalus bubalis, por lo cual los fenómenos deben estudiarse de forma particular para cada especie y que debe evitarse la extrapolación de la información obtenida entre especies y ser base para el análisis de la complejidad de los fenómenos estudiados, con la obligatoriedad de verlos de una manera diferente, no reduccionista.

Agradecimientos

A la Universidad Nacional de Colombia – Sede Medellín y la Asociación Colombiana de Criadores de Búfalos por la financiación de este trabajo. A Minciencias por la financiación del estudiante Doctoral JAB. Literatura citada: 1.

Buntjer JB, Otsen M, Nijman IJ, Kuiper MT, Lenstra JA. Phylogeny of bovine species based on AFLP fingerprinting. Heredity 2002;88(1):46-51.

2.

Berdugo J, Posada I, Angel J. Need of reevaluation of the parameters of semen straws to be used in artificial insemination programs. Ital J Anim Sci 2007;6(suppl 2):619-21.

3.

Drost M. Bubaline versus bovine reproduction. Theriogenology 2007;68(3):447-449.

4.

Santos SS, Ferreira MA, Lima MY, Sampaio RV, Cordeiro MS, Silva TV, et al. Quantification, morphology and ultrastructure of preantral follicles of buffalo (Bubalus bubalis) foetuses. Reprod Dom Anim 2011;46(1):e17-22.

1287


Rev Mex Cienc Pecu 2021;12(4):1276-1291

5.

Gimenes LU, Fantinato Neto P, Arango JS, Ayres H, Baruselli PS. Follicular dynamics of Bos indicus, Bos taurus and Bubalus bubalis heifers treated with norgestomet ear implant associated or not to injectable progesterone. Anim Reprod 2009;6(1):256.

6.

Li J, Liu J, Campanile G, Plastow G, Zhang C, Wang Z, et al. Novel insights into the genetic basis of buffalo reproductive performance. BMC Genom 2018;19(1):1-1.

7.

Blondin P, Vigneault C, Nivet AL, Sirard MA. Improving oocyte quality in cows and heifers-What have we learned so far? Anim Reprod 2018;9(3):281-290.

8.

Baldrighi JM, Sá Filho MF, Batista EOS, Lopes RN, Visintin JA, Baruselli PS, et al. Anti-mullerian hormone concentration and antral ovarian follicle population in Murrah heifers compared to Holstein and Gyr kept under the same management. Reprod Domest Anim 2014;49(6):1015–1020.

9.

Nivet AL, Bunel A, Labrecque R, Belanger J, Vigneault C, Blondin P, et al. FSH withdrawal improves developmental competence of oocytes in the bovine model. Reproduction 2012;143(2):165–171.

10. Carvalho NA, Soares JG, Porto Filho RM, Gimenes LU, Souza DC, Nichi M, et al. Equine chorionic gonadotropin improves the efficacy of a timed artificial insemination protocol in buffalo during the nonbreeding season. Theriogenology 2013;79(3):423428. 11. Khan DR, Landry DA, Fournier É, Vigneault C, Blondin P, Sirard MA. Transcriptome meta-analysis of three follicular compartments and its correlation with ovarian follicle maturity and oocyte developmental competence in cows. Physiol Genom 2016;48(8):633-643. 12. Fu Q, Huang Y, Wang Z, Chen F, Huang D, Lu Y, et al. Proteome profile and quantitative proteomic analysis of buffalo (Bubalus bubalis) follicular fluid during follicle development. Int J Mol Sci 2016;17(5):618. 13. Mondadori RG, Luque MC, Santin TR, Báo SN. Ultrastructural and morphometric characterization of buffalo (Bubalus bubalis) ovarian preantral follicles. Anim Rep Sci 2007;97(3-4):323-333. 14. Robert C. Microarray analysis of gene expression during early development: A cautionary overview. Reproduction 2010;140(6);787–801. 15. Krämer A, Green J, Pollard Jr J, Tugendreich S. Causal analysis approaches in ingenuity pathway analysis. Bioinformatics 2014;30(4):523-530.

1288


Rev Mex Cienc Pecu 2021;12(4):1276-1291

16. Lamb J, Crawford ED, Peck D, Modell JW, Blat IC, Wrobel MJ, et al. The Connectivity Map: using gene-expression signatures to connect small molecules, genes, and disease. Science 2006;313(5795):1929-1935. 17. Abatangelo L, Maglietta R, Distaso A, D'Addabbo A, Creanza TM, Mukherjee S, et al. Comparative study of gene set enrichment methods. BMC Bioinfo 2009;10(1):1-2. 18. Pollard Jr J, Butte AJ, Hoberman S, Joshi M, Levy J, Pappo J. A computational model to define the molecular causes of type 2 diabetes mellitus. Diab Tech Ther 2005;7(2):323-336. 19. Rao JU, Shah KB, Puttaiah J, Rudraiah M. Gene expression profiling of preovulatory follicle in the buffalo cow: effects of increased IGF-I concentration on periovulatory events. PloS One 2011;6(6):e20754. 20. Hatzirodos N, Hummitzsch K, Irving-Rodgers HF, Harland ML, Morris SE, Rodgers RJ. Transcriptome profiling of granulosa cells from bovine ovarian follicles during atresia. BMC Genom 2014;15(1):1-26. 21. Berdugo JA, Echeverri JJ, Tarazona AM, López A. Differences in transcriptomic data from preovulatory follicles of buffalo (Bubalus bubalis) and (Bos indicus) cattle: A meta-analysis No Title. Anim Reprod 2018;15(Suppl 1):1161. 22. Lussier JG, Diouf MN, Lévesque V, Sirois J, Ndiaye K. Gene expression profiling of upregulated mRNAs in granulosa cells of bovine ovulatory follicles following stimulation with hCG. Reprod Biol Endocrinol 2017;15(1):1-6. 23. Natesampillai S, Kerkvliet J, Leung PC, Veldhuis JD. Regulation of Kruppel-like factor 4, 9, and 13 genes and the steroidogenic genes LDLR, StAR, and CYP11A in ovarian granulosa cells. Am J Physiol-End Metab 2008;294(2):E385-91. 24. Castilho AC, Dalanezi FM, Franchi FF, Price CA, Ferreira JC, Trevisol E, et al. Expression of fibroblast growth factor 22 (FGF22) and Its receptor, FGFR1B, during development and regression of bovine corpus luteum. Theriogenology 2019;125:1-5. 25. Harlow CR, Hillier SG. Connective tissue growth factor in the ovarian paracrine system. Mol Cell End 2002;187(1-2):23-27. 26. Ruebel ML, Cotter M, Sims CR, Moutos DM, Badger TM, Cleves MA, et al. Obesity modulates inflammation and lipid metabolism oocyte gene expression: a single-cell transcriptome perspective. J Clin End Metab 2017;102(6):2029-38. 27. Lim JJ, Lima PD, Salehi R, Lee DR, Tsang BK. Regulation of androgen receptor signaling by ubiquitination during folliculogenesis and its possible dysregulation in polycystic ovarian syndrome. Scientific Reports 2017;31;7(1):1-2. 1289


Rev Mex Cienc Pecu 2021;12(4):1276-1291

28. Benkhalifa M, Ferreira YJ, Chahine H, Louanjli N, Miron P, Merviel P, et al. Mitochondria: participation to infertility as source of energy and cause of senescence. Int J Biochem Cell Biol 2014;55:60-64. 29. Cecchino GN, Seli E, Da Motta EL, García-Velasco JA. The role of mitochondrial activity in female fertility and assisted reproductive technologies: overview and current insights. Reprod Biomed Online 2018;36(6):686-697. 30. Gasparrini B, Boccia L, Marchandise J, Di Palo R, George F, Donnay I, et al. Enrichment of in vitro maturation medium for buffalo (Bubalus bubalis) oocytes with thiol compounds: Effects of cystine on glutathione synthesis and embryo development. Theriogenology 2006;65(2):275–287. 31. Li J, Li Z, Liu S, Zia R, Liang A, Yang L. Transcriptome studies of granulosa cells at different stages of ovarian follicular development in buffalo. Anim Reprod Sci 2017;(187):181–192. 32. Sirotkin AV. The role and application of sirtuins and mTOR signaling in the control of ovarian functions. Cells 2016;5(4):42. 33. Fu H, Wada-Hiraike O, Hirano M, Kawamura Y, Sakurabashi A, Shirane A, et al. SIRT3 positively regulates the expression of folliculogenesis-and luteinization-related genes and progesterone secretion by manipulating oxidative stress in human luteinized granulosa cells. Endocrininol 2014;155(8):3079-3087. 34. Pacella-Ince L, Zander-Fox DL, Lane M. Mitochondrial SIRT5 is present in follicular cells and is altered by reduced ovarian reserve and advanced maternal age. Reprod Fert Develop 2014;26(8):1072-1083. 35. Dunning KR, Russell DL, Robker RL. Lipids and oocyte developmental competence: the role of fatty acids and b-oxidation. Reproduction 2014;148(1):R15-27. 36. Fayezi S, Ghaffari-Novin M, Darabi M, Norouzian M, Nouri M, Farzadi L, et al. Primary culture of human cumulus cells requires stearoyl-coenzyme a desaturase 1 activity for steroidogenesis and enhancing oocyte in vitro maturation. Reprod Sci 2018;(6):844-853. 37. Gawriluk TR, Hale AN, Flaws JA, Dillon CP, Green DR, Rucker EB. Autophagy is a cell survival program for female germ cells in the murine ovary. Reproduction 2011;141(6):759. 38. Yang M, Wang L, Wang X, Wang X, Yang Z LJ. IL-6 promotes FSH-induced VEGF expression through JAK/STAT3 signaling pathway in bovine granulosa cells. Cell Physiol Biochem 2017;44(1):293–302.

1290


Rev Mex Cienc Pecu 2021;12(4):1276-1291

39. Martins KR, Haas CS, Ferst, JG, Rovani, MT, Goetten AL, Duggavathi R. et al. Oncostatin M and its receptors mRNA regulation in bovine granulosa and luteal cells. Theriogenology 2019;125;324–330. 40. Stassi AF, Baravalle ME, Belotti EM, Rey F, Gareis NC, Díaz PU, et al. Altered expression of cytokines IL-1α, IL-6, IL-8 and TNF-α in bovine follicular persistence. Theriogenology 2017;97:104-112. 41. Ernst EH, Grøndahl ML, Grund S, Hardy K, Heuck A, Sunde L, Franks S, et al. Dormancy and activation of human oocytes from primordial and primary follicles: molecular clues to oocyte regulation. Hum Reprod 2017;32(8):1684-1700. 42. El Hajj H, Khalil B, Ghandour B, Nasr R, Shahine S, Ghantous A, et al. Preclinical efficacy of the synthetic retinoid ST1926 for treating adult T-cell leukemia/lymphoma. Blood 2014;124(13):2072-2080. 43. Sirotkin AV, Ovcharenko D, Benčo A, Mlynček M. Protein kinases controlling PCNA and p53 expression in human ovarian cells. Funct Integr Genom 2009;(2):185-195. 44. Noma N, Kawashima I, Fan HY, Fujita Y, Kawai T, Tomoda Y, et al. LH-induced neuregulin 1 (NRG1) type III transcripts control granulosa cell differentiation and oocyte maturation. Mol End 2011;25(1):104-116. 45. Baufeld A, Vanselow J. A tissue culture model of estrogen-producing primary bovine granulosa cells. Journal of visualized experiments: JoVE 2018;(139):58208.

1291


https://doi.org/10.22319/rmcp.v12i4.5714 Nota de investigación

Digestibilidad ileal estandarizada de la proteína y aminoácidos de la pasta de ajonjolí en cerdos en crecimiento

Tércia Cesária Reis de Souza a Araceli Aguilera Barreyro a Gerardo Mariscal Landín b*

a

Universidad Autónoma de Querétaro. Facultad de Ciencias Naturales, Querétaro, México.

b

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, CENID-Fisiología, Ajuchitlán 76280, Querétaro, México.

*Autor de correspondencia: mariscal.gerardo@inifap.gob.mx

Resumen: Para determinar la digestibilidad ileal aparente (DIA) y estandarizada (DIE) de los aminoácidos de pasta de ajonjolí (PA), se utilizaron 10 cerdos de 78.6 ± 5.2 kg, alojados en jaulas metabólicas; localizadas en una sala con temperatura controlada (19 a 22 °C). A los cerdos se les implantó una cánula “T” en íleon y se alimentaron dos veces al día, a 2.5 veces su requerimiento de energía digestible de mantenimiento (110 kcal por kg de PV0.75). Se elaboraron dos dietas con 160 g de PC/kg de alimento: una con PA y otra con pasta de soya (PS). Los resultados muestran que la DIA de los siguientes aminoácidos fue superior en la PA que en la PS: arginina (P<0.0001) 7.3 unidades; alanina, ácido glutámico, glicina, metionina y valina fue en promedio 6.8 unidades mayor (P<0.01); cisteína fue mayor en 11.5 unidades (P <0.05). Contrariamente la DIA de prolina (P<0.0001), leucina (P<0.01) y lisina (P<0.05) fueron inferiores en 21.9, 2.8 y 2.5 unidades respectivamente en la PA que en la PS. La DIE de arginina (P<0.0001) fue 6.7 % superior; valina (P<0.001) 10.6 % mayor, alanina, ácido glutámico, glicina y treonina (P<0.01) fue superior en promedio en 6.4 %; y de cisteína, histidina, isoleucina, y tirosina (P<0.05) fue superior en 7.45 % en la PA que en la PS. La DIE de prolina (P<0.01) y leucina (P<0.05) fueron inferiores en 4.7 y 2.1 en la PA

1292


Rev Mex Cienc Pecu 2021;12(4):1292-1304

que en PS. Se concluye que la PA es una buena fuente de aminoácidos digestibles para la alimentación del cerdo. Palabras clave: Pasta de Ajonjolí, Digestibilidad ileal, Aminoácidos, Cerdos.

Recibido: 24/06/2020 Aceptado: 25/11/2020

El alto costo de la pasta de soya, ha propiciado la búsqueda de fuentes alternativas de proteína para ser utilizadas en la alimentación porcina(1). Dentro de estas fuentes alternas, el ajonjolí se caracteriza por su alto contenido de aceite 40 a 50 % y de proteína 27 %(2). Como subproducto de la extracción del aceite de ajonjolí se obtiene la pasta de ajonjolí, la cual se caracteriza por contener entre 45 y 50 % de proteína, de 10 a 12 % de extracto etéreo en la pasta obtenida por presión y entre 1 y 2 % en la obtenida con solventes(3). Esta pasta se caracteriza por ser una buena fuente de aminoácidos principalmente de aminoácidos azufrados, arginina y leucina; sin embargo, es pobre en lisina(3). El uso de una fuente proteica depende de su aporte de aminoácidos, ya que los alimentos se formulan empleando los conceptos de proteína ideal(4) y de digestibilidad ileal estandarizada de los aminoácidos(5), forma en que son expresados los requerimientos nutricionales del cerdo(6,7). El uso de esos conceptos, y la disponibilidad de aminoácidos cristalinos (Lisina-HCL, L-Treonina, LTriptófano y DL-Metionina), han permitido la inclusión de diferentes fuentes proteicas en la alimentación del cerdo, aunque esas fuentes sean deficientes en alguno de esos aminoácidos, como sería el caso de la pasta de ajonjolí con respecto a la lisina. Sin embargo, la información disponible sobre la digestibilidad de la proteína y aminoácidos de la pasta de ajonjolí en cerdos es escasa y contradictoria, ya que se ha reportado una baja digestibilidad de los aminoácidos de ajonjolí en cerdos en crecimiento(8). Por lo que el objetivo de este trabajo fue determinar la digestibilidad ileal en cerdos en crecimiento de los aminoácidos de pasta de ajonjolí obtenida por presión, ya que la información existente ha sido obtenida en pastas extraídas con solventes. El trabajo se realizó en la granja experimental del CENID Fisiología del INIFAP. El protocolo fue revisado y aprobado por el Comité de Bioética de la Facultad de Ciencias Naturales de la Universidad Autónoma de Querétaro. El manejo empleado en los animales respetó los lineamientos de la Norma Oficial Mexicana para la producción, cuidado y uso de los animales de laboratorio(9), así como los de la International Guiding Principles for Biomedical Research Involving Animals(10).

1293


Rev Mex Cienc Pecu 2021;12(4):1292-1304

Se utilizaron 10 cerdos (machos castrados) provenientes de un cruzamiento (Landrace × Large-White), con un peso promedio de 78.6 ± 5.2 kg divididos en dos grupos de 5 cerdos. Los cerdos se alojaron en jaulas metabólicas individuales, provistas de comedero y bebedero; localizadas en un corral con temperatura controlada, la cual fluctuaba entre los 19 y 22 °C. Los cuatro días posteriores a su ingreso a la unidad experimental sirvieron como periodo de adaptación a las jaulas metabólicas; durante los primeros tres días se les ofreció la dieta que consumían previamente; el cuarto día se ayunaron y en el quinto día se les implantó a los cerdos una cánula en “T” a nivel del íleon terminal(11). El periodo postquirúrgico duró 21 días, en el cual los cerdos tuvieron libre acceso al agua y el alimento ofrecido durante ese periodo se incrementó gradualmente hasta alcanzar el consumo previo a la cirugía. Durante el periodo experimental los cerdos se alimentaron dos veces al día a razón de 2.5 veces su requerimiento de energía digestible de mantenimiento, el cual se estimó en 110 kcal por kilo de PV0.75(12). Se comparó la pasta de ajonjolí contra la pasta de soya (Cuadro 1). Con estas materias primas se formularon dos dietas experimentales (Cuadro 2), una dieta con pasta de ajonjolí (PA) y otra con pasta de soya (PS), ambas dietas aportaron 160 g de PC/kg de alimento; el nivel de inclusión de ambas pastas dependió de su contenido de proteína. A ambas dietas, se le agregó sacarosa a razón de 65 g/kg para incrementar su palatibilidad, una fuente de fibra (Arbocel ™) 40 g/kg y aceite de maíz a razón de 30 g/kg. Las vitaminas y minerales se adicionaron para proporcionar o exceder los requerimientos recomendados por el NRC(6), el óxido de cromo se incluyó a razón de 3 g/kg como marcador de digestibilidad.

1294


Rev Mex Cienc Pecu 2021;12(4):1292-1304

Cuadro 1: Composición de las materias primas Pasta de ajonjolí

Pasta de soya

Proteína cruda Extracto etéreo FDN AIT, mg AIT/g1

53.50 11.10 17.50 1.00

50.10 1.30 13.80 6.00

AF, g fitato de sodio/100g2

4.00

2.80

Alanina Arginina Ácido aspártico Ácido glutámico Glicina Histidina Isoleucina Leucina Lisina Metionina + Cisteína Fenilalanina Prolina Serina Treonina Tirosina Valina

1.90 4.90 3.60 7.50 2.10 1.00 1.50 2.80 1.00 2.10 1.80 1.60 1.90 1.50 1.60 1.90

2.00 3.40 5.40 9.30 2.20 1.20 2.20 3.40 2.80 1.40 2.50 3.70 2.30 1.90 1.80 2.30

1

AIT= actividad del inhibidor de tripsina. 2 AF=ácido fítico.

1295


Rev Mex Cienc Pecu 2021;12(4):1292-1304

Cuadro 2: Composición de las dietas experimentales Pasta de ajonjolí

Pasta de soya

Almidón de maíz Pasta de soya Pasta de ajonjolí Azúcar Celulosa1 Aceite de maíz Sal Carbonato de calcio Fosfato dicálcico Premezcla mineral2

53.60

46.37 36.40

30.00 6.50 4.00 3.00 0.40 0.07 1.90 0.07

6.50 4.00 3.00 0.40 1.10 1.70 0.07

Premezcla vitamínica3 Óxido de cromo Análisis químico: Proteína cruda FDN

0.16 0.30

0.16 0.30

16.30 8.80

16.10 11.90

1

Arbocel= concentrado de fibra. Premezcla mineral= aporta las siguientes cantidades por kilo de alimento: Co, 0.60 mg; Cu, 14 mg; Fe, 100 mg; I, 0.80 mg; Mn, 40 mg; Se, 0.25 mg; Zn, 120 mg. 3 Premezcla vitamínica= aporta las siguientes cantidades por kilo de alimento: vitamina A, 4,250 UI/g; vitamina D3, 800 UI/g; vitamina E, 32 UI/g; vitamina K 3 menadiona, 1.5 mg/kg; biotina, 120 mg/kg; cianocobalamina, 16 μg/kg; colina, 250 mg/kg; ácido fólico, 800 mg/kg; niacina, 15 mg/kg; ácido pantoténico 13 mg/kg; piridoxina 2.5 mg/kg; riboflavina 5 mg/kg; tiamina, 1.25 mg/kg. 2

El agua se proporcionó a libertad a través de un bebedero de chupón localizado en una pared de la jaula metabólica. El periodo experimental tuvo una duración de siete días (cinco de adaptación a la dieta y dos para la colecta de la digesta ileal). La digesta ileal se colectó en bolsas de plástico (de 11 cm de largo × 5 cm de ancho), a las bolsas se les agregaban 10 ml de una solución de HCl 0.2 M con el objeto de bloquear toda actividad bacteriana. Las bolsas se fijaron a la cánula con una liga a las 0800 h del día uno y se colectó la digesta ileal de 0800 a 1800 h. Conforme se llenaban las bolsas con la digesta ileal, ésta se transfería a un contenedor para proceder inmediatamente a congelarla a –20 °C hasta su liofilización. Las muestras de digesta del experimento se liofilizaron y posteriormente se molieron a través de una malla de 0.5 mm con un molino de laboratorio (Arthur H. Thomas Co. Philadelphia, PA). Los siguientes análisis se realizaron en las dietas experimentales y en las muestras de digesta ileal: materia seca (MS) y proteína cruda (PC) de acuerdo a los métodos 934.01 y 976.05 del AOAC(13), óxido de cromo según Fenton y Fenton(14). La preparación de las muestras para la determinación de AA se realizó siguiendo el método 994.12 del AOAC(13), 1296


Rev Mex Cienc Pecu 2021;12(4):1292-1304

el cual consiste en hidrolizar las muestras a 110 °C durante 24 h en HCl 6M; en el caso de metionina y cisteína se realizó una oxidación previa con ácido perfórmico. Los análisis de AA se realizaron por medio de cromatografía en fase reversa según el método descrito por Henderson et al(15) en un HPLC de marca Hewlett Packard, modelo 1100. La actividad del inhibidor de tripsina (AIT) de las materias primas y las dietas experimentales se determinó de acuerdo con el método descrito por Kakade et al(16); el ácido fítico se analizó de acuerdo con Vaintraub y Lapteva(17); y la fibra detergente neutra (FDN) se analizó según van Soest et al(18). Los cálculos para estimar la digestibilidad ileal aparente (DIA) de la proteína, aminoácidos y energía de las dietas experimentales, se realizaron empleando la ecuación utilizada por Fan y Sauer(19). DIA = [1 – [(ID × AF)/(AD × IF)]] × 100 Donde DAI es la digestibilidad aparente ileal de un nutrimento en la dieta en porcentaje, ID es la concentración del indicador en la dieta (mg/kg de MS), AF es la concentración del nutrimento en la digesta ileal (mg/kg de MS), AD es la concentración del nutrimento en la dieta (mg/kg de MS), IF es la concentración del indicador en la digesta ileal (mg/kg de MS). Los cálculos para estimar la digestibilidad estandarizada ileal (DIE) de la proteína y aminoácidos se realizaron utilizando la fórmula propuesta por Furuya y Kaji(20). DIE = DIA +[(EndoN/ConsN) × 100] Donde DIE es la digestibilidad ileal estandarizada de un nutrimento en porcentaje. DIA es la digestibilidad ileal aparente de un nutrimento. EndoN es la cantidad endógena excretada del nutrimento en mg/kg de materia seca consumida. ConsN es la cantidad de nutrimento consumido en mg/kg de materia seca consumida. Para los cálculos se utilizó el endógeno reportado por Mariscal-Landín y Reis de Souza(21). Los datos de la DIA y DIE de la proteína y aminoácidos en cerdos en crecimiento se analizaron empleando el procedimiento GLM del paquete estadísticos SAS(22), según un diseño completamente al azar(23). Las medias de tratamientos se compararon empleando el método de Tukey(23). Las diferencias fueron consideradas significativas cuando (P<0.05), y una tendencia fue reconocida cuando (0.05<P<0.10). Los resultados muestran que los cerdos consumieron su ración completa. La pasta de ajonjolí tuvo un 6.8 % más PC; 42.9 % más ácido fítico y 26.8 % más FDN que la pasta de soya. El contenido de extracto etéreo de la pasta de ajonjolí fue 8.5 veces superior (111 vs 13 g/kg) al de la pasta de soya (Cuadro 1). Por el contrario, el contenido del inhibidor de tripsina fue 6 veces superior en la pasta de soya (6 mg/g) que en la pasta de ajonjolí (1 mg/g). En lo que 1297


Rev Mex Cienc Pecu 2021;12(4):1292-1304

respecta al contenido de aminoácidos totales la pasta de ajonjolí tuvo un 50 % más contenido de aminoácidos azufrados (metionina + cisteína) y un 44 % más de arginina que la pasta de soya. Por el contrario, la pasta de soya tuvo un contenido de lisina 280 % superior que la pasta de ajonjolí, al igual que en el caso de la prolina 231 %; así como un 50 % más de ácido aspártico, 46 % más de isoleucina, 38 % más de fenilalanina y 26 % más de treonina. La DIA de la proteína cruda de la pasta de ajonjolí fue mayor (P<0.01) en 5.6 unidades porcentuales que la de pasta de soya (Cuadro 3). La DIA de la arginina fue superior (P<0.0001) en 7.3 unidades porcentuales en la pasta de ajonjolí que en la pasta de soya; las digestibilidades de alanina, ácido glutámico, glicina, metionina y valina fueron en promedio 6.8 unidades porcentuales mayores (P<0.01) en la pasta de ajonjolí que en la pasta de soya. La DIA de cisteína, fue mayor en 11.5 unidades porcentuales (P<0.05) en la pasta de ajonjolí que en pasta de soya. Por el contrario, la DIA de prolina (P<0.0001), así como la de leucina (P<0.01) y de lisina (P<0.05) fueron inferiores en 21.9, 2.8 y 2.5 unidades porcentuales respectivamente en la pasta de ajonjolí que en la pasta de soya (Cuadro 3).

EEM

Proteína cruda

Cuadro 3: Digestibilidad ileal aparente Pasta de Pasta de soya Probabilidad ajonjolí 83.8 a 78.2 b 0.01

Alanina Arginina Ácido aspártico Cisteína Ácido glutámico Glicina Histidina Isoleucina Leucina Lisina Metionina Fenilalanina Prolina Serina Treonina Tirosina Valina

76.1 a 92.9 a 83.6 72.9 a 90.5 a 82.1 a 90.8 a 82.8 84.4 b 91.6 b 83.4 a 82.2 59.6 b 84.1 76.9 76.2 78.5 a

0.8 0.4 0.4 2.3 0.4 0.6 0.7 0.5 0.4 0.4 1.3 0.5 0.5 1 0.4 0.7 0.7

67.8 b 85.6 b 85.3 61.6 b 87.1 b 77.0 b 87.1 b 81.4 87.2 a 94.1a 72.4 b 81.2 81.5 a 83.6 76.0 72.9 72.0 b

0.01 0.0001 NS 0.05 0.01 0.01 0.05 NS 0.01 0.05 0.01 NS 0.0001 NS NS NS 0.01

EEM= Error estándar de la media.

1298

0.8


Rev Mex Cienc Pecu 2021;12(4):1292-1304

La DIE de la proteína de la pasta de ajonjolí fue mayor (P<0.01) en un 6.4 %. La DIE de la arginina (P<0.0001) fue 6.7 % superior; de la valina (P<0.001) 10.6 % mayor, de los aminoácidos alanina, ácido glutámico, glicina y treonina (P<0.01) fue superior en promedio en 6.4 %; y la DIE de cisteína, histidina, isoleucina, y tirosina (P<0.05) fue superior en un 7.45 % en la pasta de ajonjolí que en la pasta de soya. Sin embargo, la DIE de la prolina (P<0.01) y la leucina (P<0.05) fueron inferiores en 4.7 y 2.1 % en la pasta de ajonjolí con respecto a las de la pasta de soya (Cuadro 4).

EEM

Proteína cruda

Cuadro 4: Digestibilidad ileal estandarizada Pasta de Pasta de Probabilidad ajonjolí soya 91.6a 86.1b 0.01

Alanina Arginina Ácido aspártico Cisteína Ácido glutámico Glicina Histidina Isoleucina Leucina Lisina Metionina Fenilalanina Prolina Serina Treonina Tirosina Valina

83.4a 95.8a 88.3 75.9a 94.2a 88.8a 93.8a 90.5a 89.4b 95.5 86.3 86.00 86.3b 94.0 88.2a 81.6a 86.7a

0.8 0.4 0.4 2.3 0.4 0.6 0.7 0.5 0.4 0.4 1.3 0.5 0.5 1 0.4 0.7 0.7

75.2b 89.8b 88.4 65.0b 90.5b 83.5b 90.2b 87.3b 91.3a 96.2 76.2 84.2 90.6a 91.5 84.5b 77.6b 78.4b

0.01 0.0001 NS 0.05 0.01 0.01 0.05 0.05 0.05 NS NS NS 0.01 NS 0.01 0.05 0.001

0.8

EEM= Error estándar de la media.

Según la FAO la producción mundial de ajonjolí en 2018 fue de 6’448,961 ton métricas, ocupando México el quinceavo lugar con una producción de 57,256 t, FAO STAT(24). El ajonjolí se cultiva principalmente como fuente de aceite, ya que contiene en promedio 44 a 58 % de aceite, pero también es rico en proteína 18 a 25 % PC(25). El aceite de ajonjolí se caracteriza por ser muy estable, debido a la presencia de los antioxidantes naturales (sesamolina, sesamina y sesamol)(26). Las proteínas del ajonjolí consisten predominantemente de cuatro fracciones proteicas, las cuales son designadas en función de su peso molecular como 2S, 7S, 11S (bajo, medio y alto peso molecular) y 15-18S (proteínas poliméricas resultantes de una posible agregación de 2S, 7S u 11S)(27). Las proteínas de alto 1299


Rev Mex Cienc Pecu 2021;12(4):1292-1304

peso molecular son las principales en el ajonjolí, y ellas se caracterizan por ser ricas en ácido glutámico y aminoácidos aromáticos, y bajas en lisina; además de tener una baja proporción de la conformación α-hélice y una alta proporción de lámina βeta(27); la proteína del ajonjolí se caracteriza por ser rica en arginina(28). La globulina 11S (insoluble en agua) y la albúmina 2S (soluble), se denominan α-globulina y β-globulina respectivamente; y son las dos principales proteínas de almacenamiento del ajonjolí, constituyendo entre el 80 y el 90 % del total de las proteínas de ajonjolí(29). Se ha reportado que el ácido fítico puede interferir con la digestibilidad de la proteína debido a su capacidad quelante(30). El fitato se forma durante el período de maduración de la planta y su función es ser almacenamiento de P y minerales, jugando un papel importante en el metabolismo de las semillas durante la germinación. Además, el mioinositol (el componente químico de la molécula de fitato) es utilizado para la formación de las paredes celulares (31). El ajonjolí se caracteriza por contener niveles altos de fitato, (14.6 g de fitato-P/kg de semilla, hasta 51.8 g de fitato/kg de pasta)(28). La molécula de fitato contiene doce protones reactivos, seis pueden disociarse a pH ácido, tres a pH neutro y los tres restantes a pH básico, lo que le permite unirse con moléculas cargadas provenientes de la dieta y con secreciones endógenas como las enzimas digestivas y la mucina en todas las condiciones de pH encontrado en el intestino(32). Entre los aminoácidos que son quelados más fácilmente por el fitato están los aminoácidos básicos y ya se mencionó previamente la riqueza en arginina de la proteína del ajonjolí(28,30). Sin embargo, la digestibilidad en pepsina del aislado de proteína de ajonjolí es alta 89.57 %; por lo que se puede asumir que lo que modularía negativamente la digestibilidad de la proteína de ajonjolí es la cantidad de fítato. La DIA de la proteína fue de 83.8 y la DIA promedio de los aminoácidos del ajonjolí fue de 81.7, muy similar a la DIA promedio de los aminoácidos de pasta de soya, la cual fue de 79.6; sin embargo, se observaron diferencias en algunos aminoácidos siendo superiores la DIA de leucina, lisina y prolina en el caso de pasta de soya. En el caso particular de lisina su mayor DIA puede ser debida al mayor contenido de lisina en la pasta de soya: 2.8 veces superior con respecto a la de la pasta de ajonjolí. Similar situación se observa en el caso de arginina (ya que la DIA de arginina en la pasta de ajonjolí fue superior en 7.3 unidades porcentuales), metionina (la DIA en la pasta de ajonjolí fue superior en 11.0 unidades porcentuales) y cisteína (la DIA en la pasta de ajonjolí fue superior en 11.3 unidades porcentuales). En los tres casos el ajonjolí fue más rico: arginina 30.6 %; aminoácidos azufrados 50.0 %. La DIA de la proteína y aminoácidos reportados en el presente trabajo son similares a los reportados previamente(33,34,35). En lo que respecta a la DIE de la proteína y aminoácidos del ajonjolí, esta fue mayor en 5.5 y 3.8 unidades porcentuales respectivamente, manteniéndose la diferencia en la DIE de arginina, la cual fue mayor en 6 unidades porcentuales en ajonjolí que en pasta de soya y en el caso de la DIE de lisina, esta fue similar en el ajonjolí y la pasta de soya; de igual manera 1300


Rev Mex Cienc Pecu 2021;12(4):1292-1304

la DIE de los aminoácidos de ajonjolí reportados en el presente trabajo son similares a los reportados previamente(33,34,35). La diferencia encontrada en la DIE de la proteína y aminoácidos de la pasta de ajonjolí reportada por Son et al(8) pudiera ser debida a la calidad de la pasta de ajonjolí que ellos utilizaron en su estudio, ya que los mismos autores mencionan que la baja digestibilidad pudo ser debido a un diferente proceso de extracción del aceite (sin particularizar en el mismo); y al contenido de FDN, ya que fue mucho más rica en FDN la pasta de ajonjolí utilizada por Son et al(8), la cual contenía 28 % de FDN y la utilizada en este trabajo contenía 10 unidades porcentuales menos de FDN (17.5 %); aunque se sabe que la fibra incrementa las pérdidas endógenas de aminoácidos(36,37), afectando en algunos casos la digestibilidad ileal de los mismos(36). Sin embargo, a pesar de su alto contenido de fitatos, la buena digestibilidad de la proteína y aminoácidos de la pasta de ajonjolí permite utilizarla en la alimentación de cerdos(38) y aves(39) en cualquier etapa productiva, sin menoscabo del aspecto productivo. Los resultados permiten concluir que la pasta de ajonjolí es una fuente alternativa de proteína y aminoácidos digestibles para la alimentación del cerdo, ya que la DIE promedio de sus aminoácidos es de 88.5 %. Además de ser una fuente rica de arginina y aminoácidos azufrados.

Agradecimientos

Este estudio fue financiado parcialmente por la Universidad Autónoma de Querétaro a través del Fondo de Fortalecimiento para la Investigación, y el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Los autores agradecen a Dipasa Internacional de México, S.A. de C.V. por su ayuda en proporcionar la pasta de ajonjolí utilizada en este estudio. Literatura citada: 1.

Woyengo TA, Beltranena E, Zijlstra RT. Nonruminant Nutrition Symposium: Controlling feed cost by including alternative ingredients into pig diets: A review. J Anim Sci 2014;92:1293-1305.

2.

Nzikou JM, Matos L, Bouanga-Kalou G, Ndangui CB, Pambou-Tobi NPG, Kimbonguila A, et al. Chemical composition on the seeds and oil of sesame (Sesamum indicum L.) grown in Congo-Brazzaville. Ad J Food Sci Technol 2009;1:6-11.

3.

Aguilera A, Reis de Souza TC, Mariscal-Landín G, Escobar K, Montaño S, Bernal MG. Standardized ileal digestibility of proteins and amino acids in sesame expeller and soya bean meal in weaning piglets. J Anim Physiol Anim Nutr 2015;99:728-736.

1301


Rev Mex Cienc Pecu 2021;12(4):1292-1304

4.

Wang TC, Fuller MF. The optimum dietary amino acid pattern for growing pigs 1. Experiments by amino acid deletion. Br J Nutr 1989;62:77-89.

5.

Stein HH, Sève B, Fuller MF, Moughan PJ, de Lange CFM. Invited review: Amino acid bioavailability and digestibility in pig feed ingredients: Terminology and application. J Anim Sci 2007;85:172-180.

6.

NRC. Nutrient Requirements of Swine: Eleventh Rev Ed. Washington, DC: The National Academies Press; 2012.

7.

INRA. Tables de composition et de valeur nutritive des matières premières destinées aux animaux d'élevage. Porcs, volailles, bovins, ovins, caprins, lapins, chevaux, poissons. Paris, France: Institut National de la Recherche Agronomique; 2002.

8.

Son AR, Park CS, Park KR, Kim BG. Amino acid digestibility in plant protein sources fed to growing pigs. Asian Australas J Anim Sci 2019;32:1745-1752.

9.

Diario Oficial de la Federación. Especificaciones técnicas para la producción, cuidado y uso de los animales de laboratorio. Norma Oficial Mexicana NOM-062-ZOO-1999. Diario Oficial de la Federación 2001(Miércoles 2 de agosto).

10. CIOMS. International guiding principles for biomedical research involving animals. In: Organization WH editor. International guiding principles for biomedical research involving animals. Council for International Organizations of Medical Sciences ed. Geneva; 1985. 11. Reis de Souza TC, Mar BB, Mariscal LG. Canulación de cerdos posdestete para pruebas de digestibilidad ileal: Desarrollo de una metodología. Téc Pecu Méx 2000;38:143-150. 12. INRA. L'alimentation des animaux monogastriques: porc, lapin, volailles. Paris, France: Institut National de la Recherche Agronomique; 1984. 13. AOAC. Official Methods of Analysis. 17 th. ed. Arlington, VA. USA: Assoc Offic Anal Chem; 2000. 14. Fenton TW, Fenton M. An improved procedure for determination of chromic oxide in feed and feces. Can J Anim Sci 1979;59:631-634. 15. Henderson JH, Ricker RD, Bidlingmeyer BA, Woodward C. Rapid, accurate and reproducible HPLC analysis of amino acids. Amino acid analysis using Zorbax Eclipse AAA columns and the Agilent 1100 HPLC. Agilent technologies 2000(Part No.59801193E):10 pag. Agilent technologies home page at: www.agilent.com/chem/supplies.

1302


Rev Mex Cienc Pecu 2021;12(4):1292-1304

16. Kakade ML, Rackis JJ, McGhee JE, Puski G. Determination of trypsin inhibitor activity of soy products: A collaborative analysis of an improved procedure. Cereal Chem 1974;51:376-382. 17. Vaintraub IA, Lapteva NA. Colorimetric determination of phytate in unpurified extracts of seeds and the products of their processing. Anal Biochem 1988;15:227-230. 18. van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74:3583-3597. 19. Fan MZ, Sauer WC. Determination of apparent ileal amino acid digestibility in barley and canola meal for pigs with the direct, difference, and regression methods. J Anim Sci 1995;73:2364-2374. 20. Furuya S, Kaji Y. Estimation of the true ileal digestibility of amino acids and nitrogen from their apparent values for growing pigs. Anim Feed Sci Technol 1989;26:271-285. 21. Mariscal-Landín G, Reis de Souza TC. Endogenous ileal losses of nitrogen and amino acids in pigs and piglets fed graded levels of casein. Arch Anim Nutr 2006;60:454-466. 22. SAS version 9.2. Statistical Analysis Systems Institute User’s guide. Statistical Analysis Systems Institute User’s guide. 9.2 ed. Cary NC, USA: SAS Institute Inc.; 2008. 23. Steel RGD, Torrie JH. Principles and procedures of statistics. A Biometrical approach. 2nd ed. New York: McGraw-Hill 1980. 24. FAO. “Food Outlook, Bienal Report on Global Food Markets,” Bienal Report on Global Food Markets. Date acces: 14-Sep-2020. http://www.fao.org/3/ca9509en/ca9509en.pdf. 25. Omer HAA, Ahmed SM, Abdel-Magid SS, Bakry A, El-Karamany MF, El-Sabaawy EH. Nutritional impact of partial or complete replacement of soybean meal by sesame (Sesamum indicum) meal in lambs rations. Bull Natl Res Cent 2019;43:98. 26. Dossa K, Diouf D, Wang L, Wei X, Zhang Y, Niang M, et al. The emerging oilseed crop sesamum indicum enters the “Omics” era. Front Plant Sci 2017;8:1154. 27. Prakash V, Rao M. Structural similarities among the high molecular weight protein fractions of oilseeds. J Biosci 1988;13:171-180. 28. Selle P, Cowieson A, Cowieson N, Ravindran V. Protein-phytate interactions in pig and poultry nutrition: a reappraisal. Nutr Res Rev 2012;25:1-17. 29. Orruño E, Morgan MRA. Purification and characterisation of the 7S globulin storage protein from sesame (Sesamum indicum L.). Food Chem 2007;100:926-934.

1303


Rev Mex Cienc Pecu 2021;12(4):1292-1304

30. Selle PH, Ravindran V, Caldwell A, Bryden WL. Phytate and phytase: consequences for protein utilisation. Nutr Res Rev 2000;13:255-278. 31. Humer E, Schwarz C, Schedle K. Phytate in pig and poultry nutrition. J Anim Physiol Anim Nutr 2015;99:605-625. 32. Woyengo TA, Cowieson AJ, Adeola O, Nyachoti CM. Ileal digestibility and endogenous flow of minerals and amino acids: responses to dietary phytic acid in piglets. Br J Nutr 2009;102:428-433. 33. Fasuan TO, Gbadamosi SO, Omobuwajo TO. Characterization of protein isolate from Sesamum indicum seed: In vitro protein digestibility, amino acid profile, and some functional properties. Food Sci Nutr 2018;6:1715-1723. 34. Li D, Qiao SY, Yi GF, Jiang JY, Xu XX, Piao XS, et al. Performance of growingfinishing pigs fed sesame meal supplemented diets formulated using amino acid digestibilities determined by the regression technique. Asian Australas J Anim Sci 2000;13:213-219. 35. Casas GA, Jaworski NW, Htoo JK, Stein HH. Ileal digestibility of amino acids in selected feed ingredients fed to young growing pigs. J Anim Sci 2018;96:2361-2370. 36. Mariscal-Landín G, Reis de Souza TC, Hernández DAA, Escobar GK. Pérdidas endógenas de nitrógeno y aminoácidos en cerdos y su aplicación en la estimación de los coeficientes de digestibilidad ileal de la proteína y aminoácidos de las materias primas. Téc Pecu Méx 2009;47:371-388. 37. Mariscal-Landín G, Reis de Souza TC, Bayardo UA. Neutral detergent fiber increases endogenous ileal losses but has no effect on ileal digestibility of amino acids in growing pigs. Anim Sci J 2017;88:322-330. 38. Reis de Souza TC, Escobar García K, Aguilera AB, Ramirez RE, Mariscal-Landín G. Sesame meal as the first protein source in piglet starter diets and advantages of a phytase: a digestive study. S Afr J Anim Sci 2017;47:606-615. 39. Amin H, Majid M, Maryam H. Effects of microbial fermented sesame meal and enzyme supplementation on the intestinal morphology, microbiota, pH, tibia bone and blood parameters of broiler chicks. Ital J Anim Sci 2020;19:457-467.

1304


https://doi.org/10.22319/rmcp.v12i4.5310 Nota de investigación

Prevalencia de diversos serovares de Leptospira interrogans en vacas no vacunadas en los estados de Puebla, Tabasco y Veracruz, México

Jorge Víctor Rosete Fernández a Ángel Ríos Utrera b* Juan P. Zárate Martínez b Guadalupe A. Socci Escatell c Abraham Fragoso Islas a Francisco T. Barradas Piña b Sara Olazarán Jenkins a Lorenzo Granados Zurita d

a

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Sitio Experimental Las Margaritas. Kilómetro 9.5 carretera Hueytamalco-Tenampulco, Hueytamalco, Puebla, México. b

INIFAP, Campo Experimental La Posta. Veracruz, México.

c

INIFAP, CENID Salud Animal e Inocuidad. Ciudad de México, México.

d

INIFAP, Campo Experimental Huimanguillo. Tabasco, México.

*Autor de correspondencia: rios.angel@inifap.gob.mx

Resumen: El objetivo fue comparar las prevalencias de anticuerpos contra diferentes serovares de Leptospira interrogans entre los estados de Puebla, Tabasco y Veracruz, así como entre algunos de sus municipios, y determinar si el estatus sanitario de las vacas influye en su

1305


Rev Mex Cienc Pecu 2021;12(4):1305-1316

fertilidad. Se tomaron muestras de sangre de 423 vacas (Bos taurus x Bos indicus y Bos indicus) de 24 ranchos de 11 municipios de los estados mencionados. Las prevalencias de los serovares Hardjo e Inifap fueron mayores (P<0.05) en el estado de Veracruz que en el estado de Puebla, pero la prevalencia del serovar Wolffi fue mayor (P<0.05) en el estado de Puebla que en el estado de Veracruz. Las prevalencias de los serovares Hardjo y Palo Alto fueron mayores (P<0.05) en el estado de Tabasco que en el estado de Puebla, pero no hubo diferencias entre estos dos estados en las prevalencias de los serovares Inifap y Wolffi (P>0.05). El número de serovares en el estado de Veracruz fue mayor (P<0.05) que en el estado de Puebla, pero el número de serovares en Tabasco fue intermedio; además, existió una variación importante (P<0.05) entre municipios y entre ranchos en la prevalencia de los diferentes serovares. Globalmente, el serovar con mayor frecuencia fue Inifap, mientras que el serovar con menor frecuencia fue Tarassovi. El estatus zoosanitario de las vacas no influyó la tasa de gestación (P>0.05); sin embargo, se recomienda la vacunación del ganado contra Leptospira interrogans, con el fin de disminuir los riesgos asociados con esta bacteria en bovinos y humanos. Palabras clave: Prevalencia, Leptospira interrogans, Hardjo, Wolffi, Tarassovi, Vacas, Tasa de gestación.

Recibido: 15/04/2019 Aceptado: 30/03/2021

La leptospirosis es una enfermedad infecciosa de origen bacteriano clasificada como una zoonosis distribuida mundialmente, que afecta a numerosas especies de animales domésticos y silvestres(1). Es una enfermedad de gran impacto social y económico en la ganadería, en especial en bovinos, debido a las pérdidas que ocasiona por abortos, mortalidad perinatal, nacimiento de crías débiles, infertilidad y disminución de la producción láctea(2). Existen dos especies: Leptospira interrogans, que es patógena, y Leptospira biflexa, que es saprófita y se localiza en la superficie del suelo y el agua. La Leptospira interrogans es patógena para el hombre y los animales, siendo identificados más de 250 serovares, mientras que la Leptospira biflexa presenta 60 serovares(3). A nivel nacional y mundial, se sabe que la leptospirosis bovina es ocasionada principalmente por el serovar Hardjo, cuyo huésped de mantenimiento es el bovino; sin embargo, en diferentes estudios se ha demostrado que los serovares Hardjo, Wolffi y Tarassovi son los más frecuentes en México(3), aunque se han detectado las leptospiras santarosai y kirschneri con impacto potencial en bovinos(4). El conocimiento de las prevalencias en una localidad, la determinación de sus huéspedes de mantenimiento y el monitoreo de la emergencia de nuevos serovares de Leptospira, son esenciales para comprender la epidemiologia de la leptospirosis en una región y para enfocar las estrategias

1306


Rev Mex Cienc Pecu 2021;12(4):1305-1316

de control(5). Con base en lo anterior, el objetivo fue comparar las prevalencias de anticuerpos contra diferentes serovares de Leptospira interrogans entre los estados de Puebla, Tabasco y Veracruz, así como entre algunos de sus municipios, y determinar si el estatus sanitario de las vacas influye en su fertilidad. El presente estudio se llevó a cabo en 24 ranchos dedicados a la producción bovina. Seis ranchos se encontraban localizados en tres municipios del estado de Tabasco; once se encontraban en cinco municipios del estado de Puebla; y siete estaban ubicados en tres municipios del estado de Veracruz. Once de los ranchos muestreados producían leche y becerros (sistema doble propósito), mientras que trece ranchos solo producían becerros (sistema vaca-cría). Los ranchos se seleccionaron con base en un muestreo no probabilístico por conveniencia, de acuerdo con el interés de los ganaderos de participar en el presente estudio. Por otro lado, el tamaño de muestra dependió del presupuesto del estudio, por lo tanto, no todas las vacas de cada rancho se muestrearon; sin embargo, por lo menos 12 vacas se seleccionaron en cada uno. Dentro de cada rancho, las vacas se seleccionaron mediante selección aleatoria simple. Las hembras utilizadas en el estudio tenían uno o más partos, siendo la mayoría de ellas Bos taurus x Bos indicus, aunque también se utilizaron algunas vacas puras Bos indicus de la raza Brahman (N= 403 y 20, respectivamente). Las hembras no mostraron signos clínicos de ninguna enfermedad en el momento en que se realizaron los muestreos. La presente investigación solo incluyó vacas adultas, ya que no se contó con suficiente recurso económico para muestrear becerros (ambos sexos), toretes y vaquillas. Sin embargo, debido a que las vacas permanecen más tiempo en el hato, tienen mayor probabilidad de infectarse y, en consecuencia, más probabilidad de presentar anticuerpos contra todo tipo de enfermedades. Las vacas no tenían antecedentes de vacunación contra leptospirosis previo a la realización del estudio, por lo que es válido asumir que la presencia de anticuerpos en las hembras se debió únicamente a la exposición natural a la bacteria. Las vacas se evaluaron reproductivamente por medio de ultrasonografía (vía rectal) de útero y ovarios, con el fin de determinar su estatus reproductivo (gestante o no gestante); sin embargo, en los hatos del estado de Tabasco no fue posible determinar dicho estatus. Las muestras de sangre se obtuvieron por punción de la vena coccígea. Para obtener el suero de cada una de las muestras de sangre, éstas se centrifugaron a 3,000 xg durante 10 min. Las muestras de suero se conservaron a -20 °C. El diagnóstico serológico para la detección de anticuerpos contra Leptospira se realizó mediante la técnica de microaglutinación (MAT)(6,7). Para este propósito se incluyeron cinco cepas, tres de referencia internacional (Hardjo, Wolffi y Tarassovi) y dos aislamientos nacionales (Inifap y Palo Alto; serovares Hardjo e Icterohaemorrhagiae, respectivamente) obtenidos en el INIFAP. Esta técnica se realizó en 1307


Rev Mex Cienc Pecu 2021;12(4):1305-1316

microplacas de 96 pozos; se utilizaron 50 µl de cada dilución del suero a partir de 1:50 hasta la última dilución doble en donde se observó 50 % de aglutinación en el campo, en solución amortiguadora de fosfatos (PBS). Como antígeno se adicionaron 50 µl de cada cepa de Leptospira cultivadas en medio EMJH durante 8 días con un título de 2X108/ml. Tras una hora de incubación a temperatura ambiente, las reacciones fueron observadas en un microscopio de campo oscuro. Todos los sueros que mostraron 50 % o más de aglutinación a una dilución de 1:100 o más fueron considerados positivos. Cuando un suero reaccionó a dos o más antígenos, para el análisis de los datos se tomó el título más alto del suero. Se analizaron siete variables de respuesta: prevalencia de anticuerpos contra los serovares Hardjo, Inifap, Palo Alto, Wolffi y Tarassovi; número de serovares por vaca; y tasa de gestación. La positividad de anticuerpos se registró como 1 cuando una vaca tuvo anticuerpos contra un serovar de Leptospira interrogans en particular (Hardjo, Inifap, Palo Alto, Wolffi o Tarassovi), mientras que la negatividad de anticuerpos se registró como 0. Al igual que cada una de las cinco prevalencias de anticuerpos, la tasa de gestación también se registró como una variable binaria. La tasa de gestación se codificó como 1 cuando una vaca resultó gestante al diagnóstico por ultrasonografía rectal; en caso contrario (no gestante), esta variable reproductiva se codificó como 0. El estudio se realizó bajo un diseño completamente al azar. Con el fin de determinar el efecto de los factores estado de la República Mexicana, municipio anidado en estado de la República Mexicana, y rancho anidado en estado de la República Mexicana x municipio sobre las prevalencias de anticuerpos contra los serovares de Leptospira interrogans se utilizó un modelo de regresión logística. Los análisis se realizaron con el procedimiento GENMOD (PROC GENMOD) del programa SAS(8), considerando una distribución binomial y aplicando una función liga logit. El número de serovares por vaca se analizó de una manera muy similar a las prevalencias, con la única diferencia de que se consideró una distribución Poisson, ya que esta variable es de tipo conteo. La tasa de gestación también se analizó mediante regresión logística, con el procedimiento GENMOD de SAS(8), considerando una distribución binomial y aplicando una función liga logit. Para el análisis de esta variable reproductiva, el modelo estadístico incluyó los efectos fijos de estatus sanitario de la vaca, estado de la República Mexicana y municipio anidado en estado de la República Mexicana. El estatus zoosanitario se definió como la presencia/ausencia de anticuerpos contra cualquiera de los cinco serovares de Leptospira interrogans. Cuando una vaca presentó anticuerpos contra al menos uno de los cinco serovares, el estatus sanitario se registró como seropositivo; cuando una vaca no presentó anticuerpos contra ninguno de los serovares de Leptospira interrogans, el estatus zoosanitario se registró como seronegativo. El criterio de convergencia fue 10-8 en los siete análisis estadísticos. La prevalencia del serovar Hardjo en los estados de Tabasco y Veracruz fue mayor (P<0.05) que en el estado de Puebla (64.1 y 71.3 % vs 39.8 %; Figura 1). La prevalencia del serovar 1308


Rev Mex Cienc Pecu 2021;12(4):1305-1316

Inifap fue mayor (P<0.05) en el estado de Veracruz que en los estados de Puebla y Tabasco, con valores de 91.8, 63.8 y 78.8 %, respectivamente. Estos valores son considerablemente mayores que los reportados en la literatura científica para el serovar Hardjo identificado en bovinos de los estados de Campeche(9), Oaxaca(10,11), Yucatán(12-14), Veracruz(15,16), Tamaulipas(17) y Estado de México(18). Figura 1: Prevalencias de serovares de Leptospira interrogans, por estado

La prevalencia del serovar Palo Alto fue mayor (P<0.05) en el estado de Tabasco que en los estados de Puebla y Veracruz (78.3 vs 36.0 y 41.4 %). La prevalencia del serovar Palo Alto para el estado de Veracruz reportada en el presente estudio es dos veces mayor que la encontrada (19.8 %) en un estudio previo realizado en el sur de este mismo estado(16). La prevalencia promedio del serovar Palo Alto (51.9 %) obtenida en el presente estudio es similar a la reportada por Ramos et al(10) para el estado de Oaxaca (57.1 %), pero mucho mayor que las reportadas (8.8, 8.0, 3.1, 1.6, 1.0 y 0.0 %) por otros autores para otros estados de la República Mexicana(13,14,19,20,21). La prevalencia del serovar Wolffi en el estado de Puebla fue mayor (P<0.05) que en el estado de Veracruz (31.3 vs 9.9 %); la prevalencia del serovar Wolffi en el estado de Tabasco (25.0 %) fue similar a las prevalencias encontradas en los estados de Puebla y Veracruz. La prevalencia del serovar Wolffi obtenida en el presente trabajo para el estado de Veracruz es similar a la prevalencia promedio correspondiente (11.0 %) encontrada en un estudio anterior realizado en cuatro municipios del sur de este estado(16). En diversos estudios realizados en otros estados de la República Mexicana (Yucatán, Oaxaca, Estado de México) también se han hallado bajas prevalencias (menores a 10 %) para el serovar Wolffi(11,12,14,18). Por el

1309


Rev Mex Cienc Pecu 2021;12(4):1305-1316

contrario, las prevalencias del serovar Wolffi (77.7 y 66.0 %) reportadas por Córdova et al(9) y Luna et al(19) son, al menos, dos veces más grandes que las prevalencias del serovar Wolffi reportadas en la presente investigación para los estados de Puebla y Tabasco. Las prevalencias del serovar Tarassovi encontradas en los estados de Puebla, Tabasco y Veracruz fueron similares entre sí (P<0.01), con valores de 14.4, 11.0 y 11.2 %, respectivamente. Estas prevalencias son similares a las reportadas previamente para los estados de Veracruz(16) y Tamaulipas(17), pero mucho menores que las reportadas por Cárdenas-Marrufo et al(12), Segura-Correa et al(13) y Luna et al(19), quienes reportaron prevalencias para el serovar Tarassovi con valores de 66.6, 53.6 y 53.3 %, respectivamente. Por el contrario, otros autores han reportado prevalencias para este mismo serovar menores a 8.0 %(9,10,11,18,21). Las prevalencias promedio de los serovares Hardjo, Inifap, Palo Alto, Wolffi y Tarassovi fueron 58.4, 78.1, 51.9, 22.1 y 12.2 %, respectivamente, lo que indica que el serovar Inifap fue el más frecuente, mientras que los serovares Wolffi y Tarassovi fueron los menos frecuentes. Este orden de magnitud de las prevalencias es similar al encontrado en Oaxaca(11) y Campeche(9). Por el contrario, en Tamaulipas, Veracruz y Estado de México se encontró que los serovares Wolffi, Tarassovi y Hardjo tuvieron similares prevalencias(16-18). En el estado de Yucatán se determinó una mayor prevalencia para el serovar Tarassovi (53.6 %) que para los serovares Hardjo (31.6 %) y Wolffi (9.4 %)(12), resultado que también difiere del obtenido en el presente trabajo. El número de serovares de Leptospira interrogans presentes en las vacas del estado de Veracruz fue mayor (P<0.05) que el número de serovares presentes en las vacas del estado de Puebla (2.23 vs 1.68); el número de serovares de Leptospira interrogans presentes en las vacas del estado de Tabasco fue intermedio (2.05). De manera general, se esperaba encontrar una mayor prevalencia de cada uno de los serovares estudiados y un mayor número de serovares por vaca en los estados de Veracruz y Tabasco que en el estado de Puebla, ya que en los estados de Veracruz y Tabasco existe mayor precipitación pluvial y temperatura ambiental que en el estado de Puebla; sin embargo, el serovar Hardjo fue el único serovar que presentó mayor prevalencia en Veracruz y Tabasco en relación con Puebla (Figura 1). En un estudio que comparó la prevalencia de leptospirosis de las distintas regiones ecológicas de México, se encontró que la prevalencia fue mayor en las regiones tropical seca y tropical húmeda que en las regiones árida/semiárida y templada(19); sin embargo, este estudio careció de un análisis estadístico formal. Vinetz(22) informó que la Leptospirosis ocurre con mayor frecuencia en países con clima tropical, donde la precipitación pluvial y la temperatura ambiental son mayores. En el estado de Puebla, los municipios de Ayotoxco, Hueytamalco y San José Acateno presentaron prevalencias del serovar Hardjo mayores (P<0.05) que el municipio de 1310


Rev Mex Cienc Pecu 2021;12(4):1305-1316

Nauzontla. En el estado de Tabasco, las prevalencias del serovar Hardjo de los municipios de Cunduacán, Huimanguillo y Ranchería El Puente fueron similares (P>0.05; Cuadro 1). En el estado de Veracruz, los municipios de Cotaxtla, Medellín y San Rafael presentaron similares prevalencias del serovar Hardjo. Cuadro 1: Medias de cuadrados mínimos y errores estándar para prevalencia (%) y número de serovares de Leptospira interrogans, por municipio Serovar Municipio Hardjo Inifap Palo Wolffi Tarassovi Número Alto Ayotoxco 65.0 ± 90.0 ± 60.0 ± 80.0 ± 8.9a 35.0 ± 3.30 ± ab ab ab a a 10.7 6.7 11.0 10.7 0.41 c Hueytamalco 49.7 ± 68.9 ± 21.4 ± 6.9 ± 4.1 NE 1.36 ± ab b c e 5.0 4.7 4.6 0.12 c Nauzontla 7.7 ± 7.4 15.4 ± 46.2 ± 38.5 ± NE 1.08 ± c b b e 10.0 13.8 13.5 0.29 c San José 67.5 ± 77.9 ± 17.8 ± 20.9 ± 5.0 ± 3.4 1.77 ± ab b c bc d Acateno 7.3 5.9 5.6 5.7 0.18 Xochitlán 28.6 ± 57.1 ± 42.9 ± 28.6 ± NE 1.57 ± bc bc b bc d 17.1 18.7 18.7 17.1 0.47 Cunduacán 41.7 ± 58.3 ± 41.7 ± NE NE 1.42 ± abc b b de 14.2 14.2 14.2 0.34 Huimanguillo 63.8 ± 78.4 ± 86.8 ± 25.0 ± 13.2 ± 2.24 ± ab b a bc abc bcd 6.8 7.6 5.1 10.8 5.5 0.22 bc El Puente 81.8 ± 90.9 ± 90.9 ± NE 9.1 ± 8.7 2.73 ± a ab a a 11.6 8.7 8.7 0.50 Cotaxtla 67.1 ± 89.4 ± 70.1 ± NE 27.7 ± 2.56 ± ab ab a ab ab 9.9 5.5 7.6 11.5 0.26 c bc Medellín 81.7 ± 95.4 ± 40.6 ± 6.5 ± 3.8 9.1 ± 4.4 2.34 ± a a b bc 5.8 3.2 8.0 0.23 c San Rafael 62.6 ± 88.3 ± 18.0 ± 14.8 ± 5.0 ± 3.4 1.86 ± ab ab c bc cd 6.6 4.6 5.3 4.9 0.18 a,b,c,d,e

Medias con diferente literal dentro de columna son diferentes (P<0.05). NE= no estimable.

En el estado de Puebla, los municipios de Ayotoxco, Hueytamalco y San José Acateno presentaron prevalencias del serovar Inifap mayores (P<0.05) que el municipio de Nauzontla. Cunduacán, Huimanguillo y Ranchería El Puente, municipios del estado de Tabasco, tuvieron prevalencias del serovar Inifap similares (P>0.05). Similarmente, los municipios de Cotaxtla, Medellín y San Rafael no presentaron diferencia (P>0.05) en la prevalencia del serovar Inifap (Cuadro 1). 1311


Rev Mex Cienc Pecu 2021;12(4):1305-1316

Los municipios de Ayotoxco, Nauzontla y Xochitlán, del estado de Puebla, presentaron mayores (P<0.05) prevalencias del serovar Palo Alto que los municipios de Hueytamalco y San José Acateno. En Tabasco, las prevalencias del serovar Palo Alto de los municipios de Huimanguillo y Ranchería El Puente fueron mayores (P<0.05) que la del municipio de Cunduacán. En el estado de Veracruz, el municipio de Cotaxtla mostró una mayor (P<0.05) prevalencia del serovar Palo Alto que los municipios de Medellín y San Rafael (Cuadro 1). Se encontró una mayor (P<0.05) prevalencia del serovar Wolffi en el municipio de Ayotoxco que en los demás municipios del estado de Puebla. Las prevalencias del serovar Wolffi encontradas en los tres municipios del estado de Veracruz fueron similares (P>0.05; Cuadro 1). En el estado de Puebla, el municipio de Ayotoxco tuvo una prevalencia del serovar Tarassovi similar (P>0.05) a la del de San José Acateno. Las prevalencias del serovar Tarassovi encontradas en el estado de Tabasco no fueron diferentes entre sí (P>0.05). En el estado de Veracruz, la prevalencia del serovar Tarassovi del municipio de Cotaxtla fue mayor (P<0.05) que la del municipio de San Rafael (Cuadro 1). Al parecer, esta es la primera vez que se reporta la prevalencia de estos cinco serovares para estos once municipios de los estados de Puebla, Tabasco y Veracruz, pues no se encontraron en la literatura publicaciones científicas al respecto. El número de serovares de Leptospira interrogans encontradas en el municipo de Ayotoxco fue mayor (P>0.05) que el número de serovares encontrados en los demás municipios del estado de Puebla. Se encontró un mayor (P<0.05) número de serovares en el municipio de Ranchería El Puente que en los municipios de Cunduacán y Huimanguillo. El número de serovares encontrados en el municipio de Cotaxtla fue mayor (P<0.05) que el número de serovares encontrados en el de San Rafael (Cuadro 1). Las vacas con anticuerpos contra Leptospira interrogans tuvieron una tasa de gestación similar (P>0.05) a las vacas sin anticuerpos (55.5 vs 51.5 %); tampoco existió diferencia (P>0.05) en la tasa de gestación entre estados, ni entre municipios (Cuadro 2). En concordancia con este resultado, se ha reportado que Leptospira interrogans no se encuentra relacionada con la generación de quistes foliculares, los cuales afectan negativamente la fertilidad de las vacas(23).

1312


Rev Mex Cienc Pecu 2021;12(4):1305-1316

Cuadro 2: Tasas de gestación (%) y sus respectivos errores estándar e intervalos de confianza al 95% (IC95%) por estatus zoosanitario de la vaca, estado de la República Mexicana y municipio Efecto/nivel Tasa de gestación IC95% Estatus zoosanitario Seronegativoa 51.5 ± 8.5c 35.2 – 67.4 b c Seropositivo 55.5 ± 3.7 48.1 – 62.6 Estado de la República Mexicana Puebla 51.4 ± 6.4c 38.9 – 63.7 c Veracruz 55.5 ± 5.8 44.0 – 66.5 Municipio Ayotoxco de Guerrero 48.2 ± 11.8c 26.9 – 70.2 c Hueytamalco 51.2 ± 6.0 39.7 – 62.7 c Nauzontla 38.0 ± 13.5 16.7 – 65.3 c San José Acateno 48.8 ± 7.0 35.6 – 62.2 c Xochitlán 69.8 ± 18.0 30.2 – 92.5 c Cotaxtla 49.4 ± 9.0 32.5 – 66.4 c Medellín de Bravo 68.0 ± 8.1 50.6 – 81.6 c San Rafael 48.4 ± 7.3 34.6 – 62.5 a

Seronegativo= ausencia de anticuerpos contra Leptospira interrogans. Seropositivo= presencia de anticuerpos contra Leptospira interrogans. c Las tasas de gestación no son diferentes (P>0.05).

b

En conclusión, las prevalencias de los serovares Hardjo e Inifap fueron mayores en el estado de Veracruz que en el estado de Puebla, pero la prevalencia del serovar Wolffi fue mayor en el estado de Puebla que en el estado de Veracruz. Las prevalencias de los serovares Hardjo y Palo Alto fueron mayores en el estado de Tabasco que en el estado de Puebla, pero no hubo diferencias entre estos dos estados en las prevalencias de los serovares Inifap y Wolffi. El número de serovares de Leptospira interrogans en el estado de Veracruz fue mayor que en el estado de Puebla, pero el número de serovares en el estado de Tabasco fue intermedio; además, entre municipios y entre ranchos existió una variación importante en la prevalencia de los diferentes serovares de Leptospira interrogans. De manera global, el serovar con la mayor frecuencia fue Inifap, mientras que el serovar con la menor frecuencia fue Tarassovi. El estatus sanitario de las vacas no influyó la fertilidad de las mismas; sin embargo, los ganaderos de los municipios evaluados deberían vacunar contra Leptospira interrogans, como medida preventiva para disminuir los riesgos asociados con esta bacteria en bovinos y humanos.

1313


Rev Mex Cienc Pecu 2021;12(4):1305-1316

Literatura citada: 1. Dragui MG, Brihuega B, Benítez D, Sala JM, Biotti GM, Pereyra M, Homse A, Guariniello L. Brote de leptospirosis en terneros en recría en la provincia de Corrientes, Argentina. Rev Arg Microbiol 2011;43:42-44. 2. Arias ChF, Suárez AF, Huanca LW, Rivera GH, Camacho SJ, Huanca MT. Prevalencia de leptospirosis bovina en dos localidades de Puno en época de seca y determinación de factores de riesgo. Rev Inv Vet Perú 2011;22(2):167-170. 3. Méndez C, Benavides L, Esquivel A, Aldama A, Torres J, Gavaldón D, Meléndez P, Moles L. Pesquisa serológica de Leptospira en roedores silvestres, bovinos, equinos y caninos en el noreste de México. Rev Salud Anim 2013;35(1):25-32. 4. Carmona-Gasca CA, León LL, Castillo-Sánchez LO, Ramírez-Ortega JM, Ko A, Luna PC, de la Peña-Moctezuma A. Detección de Leptospira santarosai y L. kirschneri en bovinos: nuevos aislados con potencial impacto en producción bovina y salud pública. Vet Méx 2011;42(4):277-288. 5. Hernández-Rodríguez P, Gómez AP, Villamil LC. Implicaciones de las prácticas agropecuarias urbanas y rurales sobre la transmisión de la leptospirosis. Agrociencia 2017;51:725-741. 6. OIE. Organización Mundial de Sanidad Animal. 2004. Manual de las pruebas de diagnóstico y de las vacunas para los animales terrestres (mamíferos, aves y abejas). http://www.oie.int/doc/ged/D6508.pdf. Consultado 8 abr, 2019. 7.

WHO. World Health Organization. 2019. Zoonoses. Leptospirosis. http://www.who.int/zoonoses/diseases/leptospirosis/en/. Consultado 8 abr, 2019.

8. SAS Institute Inc. SAS/STAT® 9.3 User’s guide. Cary, NC: SAS Institute Inc. 2011. 9. Córdova IA, Cano MS, Moles CLP, Cisneros PMA, Rodríguez AG, Ávila GJ, Pérez GJF. Diagnóstico de leptospirosis en ganado bovino productor de carne. REDVET 2005;6(7):1-5. 10. Ramos GAB, Herrera LE, Gutiérrez HJL, Palomares REG, Díaz AE, Limón GMM, et al. Frecuencia de rinotraqueitis infecciosa bovina (IBR), diarrea viral bovina (DVB), y leptospirosis, en bovinos de doble propósito, en el municipio de San Juan Cotzocón, Oaxaca, México. En: Ricardo GID, et al, editores. Congreso Nacional de Buiatría. Villahermosa, Tabasco, México. 2014:134-139.

1314


Rev Mex Cienc Pecu 2021;12(4):1305-1316

11. Hernández BEG, Gutiérrez HJL, Herrera LE, Palomares REG, Díaz AE. Frecuencia de diarrea viral bovina, rinotraqueitis infecciosa bovina, leptospirosis y brucelosis, en las dos regiones ganaderas más importantes de Oaxaca. En: Ricardo GID, Posadas ME editores. Congreso Nacional de Buiatría. Puebla, Puebla, México. 2015:87-92. 12. Cárdenas-Marrufo MF, Vado-Solís I, Pérez-Osorio CE, Segura-Correa JC. Seropositivity to leptospirosis in domestic reservoirs and detection of Leptospira spp. from water sources, in farms of Yucatan, Mexico. Trop Subtrop Agroecosys 2011;14:185-189. 13. Segura-Correa VM, Solis-Calderón JJ, Segura-Correa JC. Seroprevalence of and risk factors for leptospiral antibodies among cattle in the state of Yucatan, Mexico. Trop Anim Hlth Prod 2003;35:293-299. 14. Vado-Solís I, Cárdenas-Marrufo MF, Jiménez-Delgadillo B, Alzina-López A, LaviadaMolina H, Suarez-Solís V, Zavala-Velázquez JE. Clinical-epidemiological study of Leptospirosis in humans and reservoirs in Yucatán, México. Rev Inst Med Trop Sao Paulo 2002;44(6):335-340. 15. Barajas-Rojas JA, Riemann HP, Franti CE. Application of enzyme-linked immunosorbent assay for epidemiological studies of diseases of livestock in the tropics of Mexico. Rev Sci Tech Off Int Epiz 1993;12(3):717-732. 16. Rodríguez BSA. Serofrecuencia de leptospirosis bovina en cuatro municipios ubicados en el sur del estado de Veracruz [tesis maestría]. Veracruz, Ver.: Universidad Veracruzana; 2010. 17. Cantú CA, Banda RVM. Serofrecuencia de leptospirosis bovina en tres municipios del sur de Tamaulipas. Tec Pecu Mex 1995;33(2):121-124. 18. Leon LL, Garcia RC, Diaz CO, Valdez RB, Carmona GCA, Velazquez BLG. Prevalence of Leptospirosis in dairy cattle from small rural production units in Toluca Valley, State of Mexico. Animal Biodiversity and Emerging Diseases: Ann NY Acad Sci 2008;1149:292-295. 19. Luna AMA, Moles CLP, Gavaldón RD, Nava VC, Salazar GF. Estudio retrospectivo de serofrecuencia de leptospirosis bovina en México considerando las regiones ecológicas. Rev Cubana Med Trop 2005;57(1):28-31. 20. Zavala VJ, Pinzón CJ, Flores CM, Damián CAG. La Leptospirosis en Yucatán. Estudio serológico en humanos y animales. Salud Púb Méx 1984;26:254-59. 21. Moles CLP, Cisneros PMA, Gavaldón RD, Rojas SN, Torres BJI. Estudio serológico de leptospirosis bovina en México. Rev Cubana Med Trop 2002;54(1):24-27.

1315


Rev Mex Cienc Pecu 2021;12(4):1305-1316

22. Vinetz JM. Leptospirosis. Current opinion in infectious diseases. 2001;14(5):527-538. 23. Cedillo SLC, Banda RVM, Morales SE, Villagómez-Amezcua ME. Asociación de quistes foliculares ováricos con la presencia de anticuerpos y agentes causantes de las principales enfermedades infecciosas reproductivas en vacas. Abanico Vet 2012;2(1):11-22.

1316


https://doi.org/10.22319/rmcp.v12i4.5778 Nota de investigación

Detección del virus del síndrome reproductivo y respiratorio en piaras porcinas de Baja California, México

Sergio Daniel Gómez-Gómez a Gilberto López-Valencia a* José Carlomán Herrera-Ramírez a Enrique Trasviña-Muñoz a Francisco Javier Monge-Navarro a Kattya Moreno-Torres a Issa Carolina García-Reynoso a Gerardo Enrique Medina-Basulto a Miguel Arturo Cabanillas-Gámez a

a

Universidad Autónoma de Baja California. Instituto de Investigaciones en Ciencias Veterinarias. Km 3.5, Carretera San Felipe, Fraccionamiento Campestre, 21386, Mexicali, Baja California, México.

*Autor de correspondencia: gilbertolopez@uabc.edu.mx

Resumen: El objetivo de este estudio fue evaluar la presencia del virus del síndrome reproductivo y respiratorio porcino genotipo 2 (VSRRP-2) en Baja California (Baja), así como la estandarización de la técnica qRT-PCR. Se realizó un estudio transversal de 2016 a 2017 en granjas de Baja. Se obtuvieron 97 muestras de sangre de verracos y cerdas clínicamente sanos y no vacunados. Se diseñaron y estandarizaron iniciadores con el fin de realizar pruebas qRTPCR a partir de la capa leucocitaria. Todos los resultados positivos fueron confirmados por

1317


Rev Mex Cienc Pecu 2021;12(4):1317-1325

estudios de secuenciación. Se encontró que el 9.3 % de las muestras fueron positivas. Las muestras positivas provinieron del 66.6 % de las regiones muestreadas. Este estudio demuestra la presencia de VSRRP-2 en Baja, por lo tanto, es necesario realizar estudios epidemiológicos para identificar la magnitud del problema y establecer medidas preventivas y de control. Palabras clave: Detección, México, PCR, SRRP, Porcino.

Recibido: 24/08/2020 Aceptado: 29/12/2020

El síndrome reproductivo y respiratorio porcino (SRRP) es una enfermedad causada por un virus ARN, con dos genotipos conocidos actualmente: 1 (europeo) y 2 (americano)(1). Se transmite fácilmente por saliva, secreciones nasales, orina, semen, leche y calostro(2). Produce fallo reproductivo, lechones nacidos débiles y enfermedades respiratorias(3). La principal vía de introducción del virus SRRP (VSRRP) en países previamente libres es a través de movimientos de cerdos y con la introducción de semen; por lo tanto, deben establecerse protocolos para reducir el riesgo(4). Cuando se introduce por primera vez en un rebaño inmunológicamente ingenuo, el virus se propaga a cerdos de todas las edades en aproximadamente 2 a 3 semanas(2), con tasas de mortalidad de hasta 69 % en cerdos de destete(5). Las pruebas diagnósticas comerciales más comunes son ELISA(6) y en los últimos años, las técnicas moleculares, en particular la reacción en cadena de la polimerasa con transcriptasa inversa en tiempo real (qRT-PCR)(7). En México, el VSRRP se describió por primera vez en 1994 con una prevalencia serológica de 8.1 % en cerdos importados de Estados Unidos y Canadá(8). Desde 2002, se ha reportado la presencia de múltiples variantes del VSRRP genotipo 2 (VSRRP-2) dentro de granjas porcinas en todo Sonora(9-10), estado vecino de Baja California (Baja), y el segundo mayor productor de carne de cerdo en México. Por su parte, en Baja, la mayor producción de carne de cerdo proviene de pequeños productores de traspatio, con instalaciones hechas básicamente de materiales rústicos, con las mismas áreas utilizadas para las diferentes etapas de producción; generalmente alimentados con desechos y otros subproductos de desperdicio de alimentos; por lo general, sin programas de medicina preventiva o asesoramiento veterinario y, en la mayoría de los casos, ni siquiera con prácticas de higiene adecuadas. El objetivo principal de este estudio fue evaluar la presencia del virus del síndrome reproductivo y respiratorio porcino genotipo 2 en las regiones productoras de carne de cerdo

1318


Rev Mex Cienc Pecu 2021;12(4):1317-1325

más representativas de Baja California, México, además de la estandarización de la prueba qRT-PCR para esta enfermedad. El estudio fue aprobado por el Comité Institucional de Ética Animal, que está representado por el Grupo Académico de Salud Animal y el Grupo Académico de Diagnóstico de Enfermedades Infecciosas, ambos son parte del Instituto de Investigaciones en Ciencias Veterinarias. Los propietarios de los cerdos utilizados en esta investigación fueron informados sobre el estudio y dieron su consentimiento. Se realizó un estudio transversal en 26 granjas dentro de seis regiones de Baja: Ensenada, Mexicali, Tecate y Tijuana, así como en los valles de Mexicali y San Quintín. Las granjas fueron seleccionadas de una base de datos de la Asociación de Criadores de Cerdos de Baja California e invitadas a participar de acuerdo con su proximidad y el tamaño del rebaño. Solo se visitó a aquellos que estaban interesados. La estimación del tamaño de la muestra se realizó para la detección de una enfermedad(11), considerando una población estatal porcina de 10,315(12), una sensibilidad diagnóstica del 99.5 %, una prevalencia esperada del 4 % y un nivel de confianza del 95 %. (1 − (1−∝)1/𝐹 ) (𝑁 − 1/2(𝑆𝑒𝐸 − 1)) 𝑛≅ 𝑆𝑒 Donde, n= tamaño de la muestra; N= tamaño de la población; E= número de enfermos; α= nivel de confianza; Se= sensibilidad de la prueba. En consecuencia, se necesitó un tamaño de muestra de al menos 74; sin embargo, se pudo recolectar un total de 97 muestras de sangre de la vena yugular de verracos y cerdas aparentemente sanos que no participaron en la vacunación contra el VSRRP. Se utilizaron tubos estériles Vacutainer® con anticoagulante EDTA (BD, Franklin Lakes, NJ, EE.UU.). Las muestras fueron transportadas al Laboratorio de Biología Molecular del Instituto de Investigaciones en Ciencias Veterinarias, después se separaron 200-300 μl de la capa leucocitaria en tubos estériles para la extracción de ARN. La extracción de ARN se realizó utilizando el Kit de tejido graso y fibroso de ARN total AurumTM (Bio-Rad, Hercules, CA, EE.UU.) de acuerdo con las instrucciones del fabricante. El ARN se reconstituyó a un volumen final de 30 μL de elución preparada. El ARN se almacenó a -70 °C hasta que se realizó la prueba qRT-PCR. Los iniciadores RT-PCR fueron diseñados para amplificar un fragmento con una longitud de 87 pb del gen de la nucleocápside contenido dentro del marco de lectura abierto 7 (ORF7) de VSRRP-2 (GenBank AF494042.1), ya que esta es la proteína viral más conservada en células de cerdo infectadas por VSRRP(13). Los iniciadores fueron diseñados utilizando Primer3Plus versión 2.4, GenneRunner versión 6.1 y OligoCalc versión 3.2, generando los iniciadores PRRS-USA-F 5’-CGATCCAGACTGCCTTTAAC-3’ y PRRS-USA-R 3’CACTGTGGAGTTTAGTTTGC-5’. 1319


Rev Mex Cienc Pecu 2021;12(4):1317-1325

Las condiciones de qRT-PCR se optimizaron probando los iniciadores por triplicado a 200, 400 y 800 nM con 1, 2 y 3 μl de ARN molde en un volumen total de 10 μL utilizando una mezcla maestra con colorante EvaGreen® (Biotium, Hayward, CA, EE.UU.). La mejor eficiencia se logró mediante el uso de los iniciadores a 800 nM en 2 μl de ARN molde y se probó a través de diluciones de diez veces para generar un análisis de curva de fusión (Figura 1) y compararlo con electroforesis en gel de agarosa. Una vez obtenida la mejor concentración, se probaron, por triplicado, 40 muestras de control positivo y 40 muestras negativas para lograr una confianza de especificidad del 95 %(14). La sensibilidad se determinó a través de diluciones de diez veces mediante la generación de una curva estándar de 97.6 % de eficiencia, R2 de 0.996 y pendiente de 3.25 (Figura 2). Figura 1: Picos de amplificación de diferentes diluciones de control positivo en la temperatura de fusión previamente establecida (77.4-78.0 ºC)

Figura 2: Curva estándar de los iniciadores diseñados

1320


Rev Mex Cienc Pecu 2021;12(4):1317-1325

Se extrajo ARN del control positivo de la vacuna Ingelvac PRRS® MLV (Boheringer Ingelheim). Se utilizaron tres controles negativos diferentes: mezcla maestra sin ARN molde, agua de grado molecular y aire. Todas las muestras se analizaron por duplicado. Las reacciones de qRT-PCR se ejecutaron en un termociclador de tiempo real CFX96 (Bio-Rad, Hercules, CA, EE.UU.). Las reacciones de prueba consistieron en 1 μl de ARN, 400 nM de cada iniciador y mezcla maestra de iScript One Step RT-PCR con colorante EvaGreen y agua de grado molecular en un volumen total de reacción de 10 μl. Las condiciones del termociclador se calcularon utilizando el software CFX96, lo que resultó en un paso inicial de transcripción inversa a 50 °C durante 10 min, desnaturalización a 95 °C durante 3 min, 40 ciclos de desnaturalización a 95 °C durante 10 seg, alineamiento a 53.7 °C durante 25 seg y extensión a 72 °C durante 20 seg. Se realizó un análisis de la curva de fusión después de cada ejecución para confirmar la temperatura de fusión (Tm) del fragmento amplificado, calculada entre 77.4 y 78.0 °C. Las muestras positivas fueron confirmadas por secuenciación en un laboratorio externo y estas secuencias, verificadas mediante la herramienta BLAST (Figura 3). Figura 3: Secuencia de muestras positivas y verificadas mediante la herramienta BLAST

Panel A: Resultados de secuenciación de una de las muestras positivas, resaltando una secuencia de 26 nucleótidos. Panel B: Captura de pantalla de la base de datos BLAST, que muestra los 26 nucleótidos del panel A, resaltados y que coinciden con una cepa del virus del síndrome reproductivo y respiratorio porcino tipo 2 en el gen de la proteína nucleocápside. La base de datos arroja 100 resultados (no mostrados), todos ellos cepas de VSRRP-2.

Se encontraron 9.3 % (9/97) de muestras positivas a VSRRP-2, presentes en el 66 % (4/6) de las regiones donde se realizó el estudio. La frecuencia de casos positivos fue de 33 % (2/6)

1321


Rev Mex Cienc Pecu 2021;12(4):1317-1325

en Tijuana, 16.6 % (3/18) en el Valle de San Quintín, 11.1 % (3/27) en Mexicali y 3.7 % (1/27) en Ensenada (Figura 4). En Tecate (0/13) y Valle de Mexicali (0/6) no hubo muestras positivas. No se encontraron ni se informaron signos de SRRP en ninguna granja. Figura 4: Distribución geográfica del VSRRP en Baja California y la frecuencia en cada región analizada

El objetivo principal de este estudio fue evaluar la presencia del virus del síndrome reproductivo y respiratorio porcino tipo 2 en las regiones productoras de carne de cerdo más representativas de Baja California, por lo tanto, considerando el diseño epidemiológico del estudio, se puede afirmar que VSRRP-2 está presente en Baja, con una prevalencia de al menos 4 %. Este estudio representa el primer informe del VSRRP-2 en Baja(15), a pesar del reporte previo de su presencia en la zona noroeste del país(16) que incluye, además del estado de Baja, el estado de Sonora y otros cuatro estados. Es importante destacar la cercanía geográfica con Sonora así como las características de su industria porcina, ya que Sonora introduce carne de cerdo así como cerdos vivos y semen a Baja(17), por lo que existe la posibilidad de contagio de SRRP considerando que la vacunación contra VSRRP nunca se ha implementado en Baja, ya que se supone que está libre de la enfermedad y además, la mayor proporción de pequeños productores de traspatio, que no suelen utilizar medidas primarias de medicina preventiva. En este estudio también se diseñaron iniciadores capaces de detectar VSRRP-2 en la región ORF7, y estos resultados fueron confirmados por secuenciación, demostrando la efectividad de la prueba y la presencia de VSRRP-2 en Baja, independientemente de la falta de signos clínicos(18). Esto podría deberse a la presencia de cepas de VSRRP de baja virulencia dentro

1322


Rev Mex Cienc Pecu 2021;12(4):1317-1325

del territorio mexicano(19); o a una baja concentración viral dentro de las muestras(20) dada la amplificación de las curvas positivas después del ciclo 30. Este estudio demuestra la amplia presencia de VSRRP-2 en Baja, incluso en ausencia de signos clínicos que indiquen la presencia de la enfermedad; por lo tanto, es necesario realizar estudios epidemiológicos prospectivos con el objetivo de determinar la prevalencia y los posibles factores de riesgo asociados con el fin de identificar la magnitud del problema, así como establecer medidas preventivas y de control. Agradecimientos Este estudio permitió al primer autor obtener el título de Doctor en Ciencias Agropecuarias (Universidad Autónoma de Baja California). Los autores también agradecen al MVZ José Soto, Dra. Laura Kinejara, MC Arsenio Guzmán, MC Kelvin Espinoza y MC Ricardo Martínez. Declaración de conflicto de intereses Los autores no tienen ninguna relación financiera o personal con personas u organizaciones que puedan influir o sesgar el contenido del artículo de manera inapropiada. Literatura citada: 1.

Nan Y, Wu C, Gu G, Sun W, Zhang YJ, Zhou EM. Improved vaccine against PRRSV: Current progress and future perspective. Front Microbiol 2017;8:1635.

2.

Pileri E, Mateu E. Review on the transmission porcine reproductive and respiratory syndrome virus between pigs and farms and impact on vaccination. Vet Res 2016;47:108.

3.

Wang X, Marthaler D, Rovira A, Rossow S, Murtaugh MP. Emergence of a virulent porcine reproductive and respiratory syndrome virus in vaccinated herds in the United States. Virus Res 2015;210:34-41.

4.

Organization of Animal Health. PRRS: the disease, its diagnosis, prevention and control. Paris: Office of International Epizootica, 2008:1-7.

5.

Young B, Dewey C, Poljak Z, Rosendal T, Carman S. Clinical signs and their association with herd demographics and porcine reproductive and respiratory syndrome (PRRS) control strategies in PRRS PCR-positive swine herds in Ontario. Can J Vet Res 2010;74(3):170-177.

1323


Rev Mex Cienc Pecu 2021;12(4):1317-1325

6.

Henao-Diaz A, Giménez-Lirola L, Magtoto R, Ji J, Zimmerman J. Evaluation of three commercial porcine reproductive and respiratory syndrome virus (PRRSV) oral fluid antibody ELISAs using samples of known status. Res Vet Sci 2019;125:113-118.

7.

Yang Q, Xi J, Chen X, Hu S, Chen N, Qiao S, et al. The development of a sensitive droplet digital PCR for quantitative detection of porcine reproductive and respiratory syndrome virus. Int J Biol Macromol 2017;104(A):1223-1228.

8.

Milián SF, Cantó AGJ, Weimersheimer RJ, Coba AMA, Anaya EAM, Correa GP. Estudio seroepidemiológico para determinar la presencia de anticuerpos contra el virus del síndrome disgenésico del cerdo en México. Tec Pecu Mex 1994;32(3):139-144.

9.

Batista L, Pijoan C, Lwamba H, Johnson CR, Murtaugh MP. Genetic diversity and possible avenues of dissemination of porcine reproductive and respiratory syndrome virus in two geographic regions of Mexico. J Swine Health Prod 2004;12:170-175.

10. Burgara-Estrella A, Reséndiz-Sandoval M, Cortey M, Mateu E, Hernández J. Temporal evolution and potential recombination events in PRRSV strains of Sonora Mexico. Vet Microbiol 2014;174(3-4):540-546. 11. Cannon, RM. Sense and sensitivity-designing surveys based on an imperfect test. Prev Vet Med 2001;49(3-4):141-63. 12. State Information Office for Sustainable Rural Development. Livestock statistical notebook, 2011-2015. Baja California, México: Ministry of Agricultural Development, 2016:19. 13. King SJ, Ooi PT, Phang LY, Nazariah Z, Allaudin B, Loh WH, et al. Phylogenetic characterization of genes encoding for viral envelope glycoprotein (ORF5) and nucleocapsid protein (ORF7) of porcine reproductive & respiratory syndrome virus found in Malaysia in 2013 and 2014. BMC Vet Res 2016;13(1):3. 14. Broeders S, Huber I, Grohmann L, Berben G, Taverniers I, Mazzara M, et al. Guidelines for validation of qualitative real-time PCR methods. Trends in Food Science & Technology 2014;37(2):115-126. 15. National Secretary of Health Quality and Food Safety. Bulletin of the Secretary of Epidemiological Surveillance Inform, 2017. https://www.gob.mx/senasica/documentos/boletin-sive-informa-2017. Accessed Oct 10, 20018.

1324


Rev Mex Cienc Pecu 2021;12(4):1317-1325

16. Martínez-Bautista NR, Sciutto-Conde E, Cervantes-Torres J, Segura-Velázquez R, Mercado-García MC, Ramírez-Mendoza H, et al. Phylogenetic analysis of ORF5 and ORF7 of porcine reproductive and respiratory syndrome (PRRS) virus and the frequency of wild-type PRRS virus in Mexico. Transbound Emerg Dis 2018;65(4):993-1008. 17. Extension and Territorial Innovation Group. Innovation program pig chain of GEIT livestock, Mexicali, in the State of Baja California. Baja California, Mexico: Rural Extension and Innovation Center. 2015:10. 18. Zimmerman JJ, Benfield A, Dee SA, Murtaugh MP, Stadejek T, Stevenson GW, et al. Porcine reproductive and respiratory syndrome virus (Porcine Arterivirus). In: Zimmerman JJ, et al, editors. Diseases of swine. 10th ed. Ames, Iowa: Wiley-Blackwell, 2012:461-486. 19. Weimersheimer R, Canto AJEE, Anaya EGJ, Coba AMA, Millán SF, Correa GP. Frecuencia de anticuerpos contra el virus del síndrome disgenésico y respiratorio en cerdos sacrificados en rastros de México. Tec Pecu Mex 1997;35:139-144. 20. Walker NJ. A technique whose time has come. Science 2002;296:557-559.

1325


https://doi.org/10.22319/rmcp.v12i4.5750 Nota de investigación

Ataxia enzoótica por deficiencia de cobre en ciervo rojo (Cervus elaphus) cautivo en Colima, México

Luis Jorge García-Márquez a Rafael Ramírez-Romero b Julio Martínez-Burnes c Alfonso López-Mayagoitia d Johnatan Alberto Ruíz-Ramírez a * Edgar Iván Loman-Zúñiga e Fernando Constantino-Casas f

a

Universidad de Colima. Facultad de Medicina Veterinaria y Zootecnia, Av. Universidad #333 Col. de las Víboras 28040, Colima, México. b

Universidad Autónoma de Nuevo León. Facultad de Medicina Veterinaria y Zootecnia. Nuevo León, México. c

Universidad Autónoma de Tamaulipas. Facultad de Medicina Veterinaria y Zootecnia. Tamaulipas, México. d

University of Prince Edward Island. Atlantic Veterinary College. Charlottetown, Canadá.

e

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México. f

University of Cambridge. Department of Veterinary Medicine. Cambridge, Reino Unido

*Autor de correspondencia: jruiz7@ucol.mx

1326


Rev Mex Cienc Pecu 2021;12(4):1326-1337

Resumen: El objetivo del trabajo fue describir un caso de ataxia enzoótica en un Cervus elaphus (ciervo rojo) cautivo asociado a deficiencia de cobre, en el estado de Colima, México. En julio y octubre del 2018 dos hembras de ciervo rojo de 3 y 7 años manifestaron incoordinación con debilidad de los miembros posteriores y se estableció un diagnóstico anatomopatológico de ataxia progresiva. En septiembre del 2019 una hembra de 13 años manifestó signos nerviosos similares a los casos del 2018, por lo que se tomó una muestra de sangre para la medición sérica de cobre. Al animal se le aplicó eutanasia para su examen post mortem y se recolectaron muestras de tejido para histología, también se tomaron muestras de hígado, riñón, forraje y suelo para la medición de cobre y molibdeno. Las principales lesiones se encontraron microscópicamente en medula espinal, que mostró leucomalacia, desmielinización, cuerpos esferoides y cromatolisis neuronal. La concentración de cobre fue 2.7 en hígado, 4.67 en riñón y 0.08 en suero (mg/kg MS o ppm). La relación Cu:Mo para el suelo 1 fue Cu 8.48; Mo 3.00; Cu:Mo 2.83:1, suelo 2: Cu 9.10; Mo 3.00; Cu:Mo 3.03:1. Forraje 1: Cu 6.59; Mo 7.35; Cu:Mo 0.90:1; forraje 2: Cu 2.77; Mo 6.12 ± 0.61; Cu:Mo 0.45:1. Los signos clínicos, lesiones microscópicas y los niveles bajos de Cu en suero, hígado y forrajes son consistentes con ataxia enzoótica por deficiencia primaria de cobre. Hasta donde se conoce, este es el primer informe de ataxia enzoótica en un ciervo rojo cautivo en México. Palabras clave: Cervus elaphus, Colima, Cobre, Ataxia enzoótica, Ciervo rojo.

Recibido: 31/07/2020 Aceptado: 17/12/2020

El ciervo rojo (Cervus elaphus) es propenso a padecer enfermedades metabólicas cuando es criado en cautiverio. La deficiencia de cobre (Cu) en esta especie ha sido asociada a osteocondrosis, ataxia enzoótica y pobre crecimiento en ciervos jóvenes(1-4). Estos síndromes han sido reconocidos en ciervos de granjas, pero no en poblaciones silvestres. La ataxia enzoótica es una enfermedad metabólica de los cérvidos que causa parálisis lenta y progresiva afectando principalmente los miembros posteriores. Los signos clínicos son el resultado de una leucomielomalacia, o sea, necrosis de la substancia blanca de la médula espinal. Microscópicamente se caracteriza por una desmielinización de los axones de la médula espinal asociada a una deficiencia de cobre(5,6,7). Además, puede haber cambios degenerativos en neuronas del cerebro o cerebelo, las cuales también exhiben lisis o rexis nuclear y solo en algunos casos se produce necrosis cerebrocortical con edema cerebral agudo(5,7). La morbilidad de esta enfermedad es baja, menor al 1 %, aunque en algunos casos puede llegar a ser hasta del 13 %(8,9,10). La ataxia enzoótica en cérvidos ha sido descrita en Europa y 1327


Rev Mex Cienc Pecu 2021;12(4):1326-1337

Nueva Zelanda, donde es considerado un problema de salud generalizado en las granjas de ciervo rojo(2,11,12). En América se ha reportado en ciervo rojo de Argentina(5). En México existen 54 Unidades de Manejo, para la conservación de vida silvestre (UMAS) de Cervus elaphus y son de tipo extensivo, distribuidos en 16 estados de la República Mexicana, y Colima cuenta con una de ellas(13). En México no se ha tenido ningún informe de ataxia enzoótica en las UMAS de ciervos rojo cautivos, por eso es importante describir por primera vez la presencia de este tipo de enfermedad. El objetivo de este trabajo fue describir los aspectos clínicos y patológicos de la ataxia enzoótica en un ciervo rojo (Cervus elaphus) cautivo y su relación con la deficiencia de cobre, en el estado de Colima, México. La UMA “Rancho el Peregrino” (SEMARNAT-UMA-IN0013-COL/2003) está formado por 21 ciervos rojos (Cervus elaphus) (4 machos, 9 hembras y 8 crías), con edades de entre 1 mes a 15 años. Se encuentra ubicada a los 19° 15´ N y 103° 43´ O y a 490 msnm en el municipio de Colima, México(14). El propósito es la cría en cautiverio del C. elaphus en un sistema extensivo para la producción de carne y cornamenta dura. Se tienen destinadas 11 ha divididas en seis potreros, con pasto Cynodon nlemfuensis, árboles de Pithecellobium dulce y Acacia farneciana; además se suplementan durante todo el año con 300 g animal/día de maíz molido, soya, salvado de trigo, pasta de coco y harina de alfalfa adicionado con sales minerales (cada 100 g contiene: fosforo, calcio, hierro, magnesio, cobre, zinc, manganeso, cobalto, yodo, selenio y vitamina A). Para el manejo reproductivo, las montas se llevan a cabo de octubre a diciembre y los partos ocurren en junio y julio; como medicina preventiva, lo ciervos se desparasitan y se vacunan contra clostridiasis. Cada 21 días se asperjan con garrapaticida durante la primavera y otoño. Durante el 2018 se presentaron dos hembras de ciervo rojo de 3 y 7 años de edad (pesos promedios de 60 y 80 kg respectivamente) con historia clínica de incoordinación, debilidad de los miembros pélvicos, caídas frecuentes y locomoción alterada de 3 a 18 meses de evolución; también hubo pérdida de peso progresiva y finalmente postración. El primero de estos casos sucedió en julio y el segundo en octubre del mismo año. En ambos animales solo se realizó la necropsia y estudio histopatológico cuyo diagnóstico final fue leucoencefalomalacia bilateral severa, sugerente de ataxia progresiva por deficiencia de cobre. En septiembre del 2019 otra de las hembras de la UMA manifestó signos clínicos similares a los casos observados en el 2018. Esta hembra tenía 13 años de edad y un peso promedio 95 Kg. En el examen clínico se observaron algunas laceraciones en la piel en distintas regiones del cuerpo, originadas por la postración. Se llevó a cabo un examen neurológico a distancia, donde se observó ataxia propioceptiva ligera y lentamente progresiva. Estos signos eran más evidentes cuando el animal caminaba en círculos, o al jalar la cola hacia uno de los lados. También mostró debilidad de los miembros posteriores, alteración de la ambulación (incoordinación bamboleante y miembros pélvicos entrecruzados (paso de tijera), dismetría por hipermetría, movimientos de circunducción (animal está dando 1328


Rev Mex Cienc Pecu 2021;12(4):1326-1337

vueltas), pérdida de la propiocepción consciente, cuello rígido y dificultad para pararse. De igual manera mostraba dificultad para levantar los tarsos, los cuales arrastraba durante la marcha; además presentaba pérdida de peso, opistótonos, extensión tónica de miembros, paraparesia, exacerbación, postración y depresión. Considerando que la historia y signos clínicos fueron similares a los casos del 2018, se tomó una muestra sanguínea para obtener suero y realizar la medición sérica de cobre. Debido a la severidad de los signos clínicos se realizó la eutanasia mediante una sobredosis intravenosa de barbitúrico (5 ml/1.0 kg de peso corporal) (Pisabental® pentobarbital sódico 6.3%, Pisa, SAGARPA, Q-7833-215, Guadalajara, Jalisco, México). El cadáver se remitió a la sala de necropsia del laboratorio de Patología de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad de Colima, para realizar el estudio post mortem. Durante la necropsia no se observaron lesiones macroscópicas evidentes, por lo que se obtuvo la médula espinal completa, y de acuerdo con la localización anatómica se dividió en las siguientes secciones: cervical craneal, cervical caudal, torácica craneal, torácica caudal, lumbar craneal, lumbar caudal, sacra craneal, sacra caudal y coccígea; así mismo se tomaron muestras de los nervios ciáticos y encéfalo. Las muestras recolectadas se fijaron en formalina al 10% (pH 7.2), se procesaron con la técnica histológica de rutina, se incluyeron en parafina y se cortaron a 6 µm de grosor para teñirlas con hematoxilina y eosina (HE). También se utilizó la tinción de Luxol Fast Blue para evaluar la mielina de la médula espinal(15). Por otra parte, se tomaron muestras de hígado, riñón, forraje y suelo de dos potreros donde pastoreaban los ciervos, para determinar los niveles de cobre y molibdeno utilizando la técnica de espectrometría de absorción atómica(16,17). Los cambios macroscópicos más relevantes a la necropsia fueron: pobre condición corporal (escala 2/5), pelo hirsuto, zonas alopécicas, laceraciones cutáneas y hematomas subcutáneos; ocasionados por la postración. El hígado mostró de manera multifocal áreas discretas de fibrosis capsular. Los demás órganos no presentaron cambios macroscópicos evidentes (Figura 1). En el estudio histológico, las lesiones más relevantes se encontraron en la médula espinal, principalmente en los funículos ventrales y laterales, con menos evidencia en los funículos dorsales; estas lesiones eran bilaterales y simétricas. En la sustancia blanca se observaron extensas áreas de desmielinización, caracterizadas por la distensión notable de las vainas de mielina, las cuales en el interior mostraban escasos fragmentos hipereosinofílicos de axones y algunas células Gitter (cámaras de digestión); algunos axones se encontraban tumefactos e hipereosinofílicos (cuerpos esferoides). Mediante la tinción de Luxol Fast Blue en cada una de las secciones de la médula espinal, se evidenció la pérdida de mielina (desmielinización) en los funículos laterales y ventrales, principalmente en las zonas adyacentes a la fisura ventral medial. Las zonas afectadas se caracterizaban por la pérdida de la afinidad tintorial. En los nervios eferentes de la porción lumbar se apreciaban focos de mineralización distrófica, así como escasos cuerpos esferoides. Algunas neuronas, principalmente de las astas ventrales de la substancia gris se encontraban tumefactas, con 1329


Rev Mex Cienc Pecu 2021;12(4):1326-1337

pérdida de la sustancia de Nissl o con los gránulos marginados a la periferia (cromatolisis central). Figura 1: Muestras de tejido nervioso de ciervo rojo (C. elaphus) para evaluación histopatológica

A. Encéfalo, B. Cerebelo, C. Médula espinal, D. Nervios ciáticos, E. Cervical craneal, F. Cervical caudal, G. Torácica craneal, H. Torácica caudal, I. Lumbar, J. Sacra.

Adicionalmente, por cada sección evaluada había escaso número de neuronas carentes de núcleo y su citoplasma contenía moderada cantidad de gránulos cafés ocres compatibles con lipofucsina (Figura 2). No se observó reacción inflamatoria en ninguno de los cortes de médula espinal. Histológicamente, no se observaron lesiones en encéfalo, nervio ciático, bazo, rumen, retículo, omaso, abomaso, riñones, pulmones, tráquea, glándula tiroides, páncreas y vejiga. A nivel hepático se corroboró microscópicamente la fibrosis leve localizada a nivel capsular y que se consideró sin relevancia diagnóstica. En el Cuadro 1, se muestran los valores de cobre en tejidos y suero sanguíneo, mientras que en el Cuadro 2, se muestran los valores de los microminerales de Cu, Mo y la relación Cu:Mo en el forraje y suelos. 1330


Rev Mex Cienc Pecu 2021;12(4):1326-1337

Figura 2: Corte transversal de la porción cervical de la médula espinal, teñido con H-E

A. Los funículos ventrales y laterales se observan con áreas extensas simétricas bilaterales de desmielinización (flechas). B. Corte transversal de la porción cervical de la médula espinal teñido con Luxol fast blue, se hacen evidentes las áreas de desmielinización con la pérdida de la afinidad tintorial (flechas). C. Porción cervical craneal de la médula espinal, las vainas de mielina están dilatadas y en su interior se aprecian fragmentos de axones y la desmielinización (flechas). D. Cámaras de digestión, en su interior hay una célula Gitter (flecha) y restos de un axón. E. Cuerpos esferoides (flecha). F. Zonas de mineralización en los nervios eferentes de la asta dorsal de la porción dorsal de la médula espinal. G. Cromatolisis central en una neurona y pérdida de núcleos (flecha). H. Pigmento café ocre granular en un soma neuronal compatible con lipofucsina.

Cuadro 1: Valores de cobre (mg/kg MS o ppm) en tejidos y suero sanguíneo de ciervo rojo (Cervus elaphus) en cautiverio Muestra

Cu

Cu, Referencia

Suero

0.08

0.5-1.5

Hígado

2.70

6.4-29

Riñón

4.67

3.3-7.2

Valores de referencia tomados de: (7,12,18).

1331


Rev Mex Cienc Pecu 2021;12(4):1326-1337

Cuadro 2: Valores de cobre, molibdeno y la relación Cu:Mo (mg/kg MS o ppm) en suelo y forraje de dos praderas de la UMA El Peregrino Cu (ppm) Referencia Mo Referencia Cu:Mo Referencia Muestra Cu (ppm) Mo Cu:Mo 5.1-10 1-5 Suelo 1 8.48±0.45 3.00±0.30 2.83:1 2:1 (Ẋ= 7.5) (Ẋ= 3.0) 5.1-10 1-5 Suelo 2 9.10±0.48 3.00±0.30 3.03:1 2:1 (Ẋ= 7.5) (Ẋ= 3.0) 8-11 0.07-5.0 Forraje 1 6.59±0.35 7.35±0.74 0.90:1 2:1 (Ẋ= 9.5) (Ẋ= 2.5) 8-11 0.07-5.0 Forraje 2 2.77±0.15 6.12±0.61 0.45:1 2:1 (Ẋ= 9.5) (Ẋ= 2.5) Referencias: (19,20,21).

La ataxia enzoótica es una enfermedad neurodegenerativa ocasionada por la deficiencia de cobre ya sea primaria o secundaria. La deficiencia primaria o absoluta ocurre cuando los forrajes o suelo son pobres en este elemento, y por lo tanto hay una ingesta insuficiente, mientras tanto la secundaria o condicionada, es provocada por una reducción en su absorción a nivel intestino, generando bajas disponibilidades para los tejidos(6,7,12). Esta enfermedad afecta principalmente ovinos, aunque también ha sido descrita en caprinos, lechones y ciervo rojo(5). Su diagnóstico se lleva a cabo a través de signos clínicos, lesiones microscópicas en el sistema nervioso central y la determinación de niveles de cobre en el hígado(12). En algunos informes se refiere que la morbilidad de ataxia enzoótica en ciervo rojo y en híbridos Wapiti rojos es alrededor del 1 %, aunque puede llegar hasta el 13 %(5,10); sin embargo, dichas proporciones podrían variar dependiendo de la región geográfica, además, el suministro adecuado con suplementos de Cu a los animales puede prevenir eficazmente la enfermedad, mientras que el tratamiento de los animales afectados produce cierta remisión de los signos sin eliminar la enfermedad, por lo que la ataxia generalmente progresa hasta la muerte de los animales(7,8). En la UMA "El Peregrino" la morbilidad fue del 9.8 % y 0.1 % de mortalidad, manteniéndose dentro del rango establecido según la literatura(8,9,10). Las causas más comunes de morbilidad y mortalidad en ciervo rojo cautivo en la UMA "El Peregrino" han sido: 33.4 % babesiosis transmitida por la garrapata del género Rhipicephalus, 17.7 % poliartritis secundaria a una onfaloflebitis, 13.7 % bronconeumonía supurativa, 9.8 % ataxia enzoótica, 7.8 % fracturas por traumatismo, 3.9 % diarrea y timpanismo, 2.0 % de endoparásitos Fasciola hepatica y Oesophagostomum spp(22). La signología clínica de ataxia enzoótica en ciervos, se presentó con incoordinación y debilitamiento de los miembros pélvicos, la cual fue progresiva y finalmente culminó con la postración del animal. Estos signos concuerdan perfectamente con los observados por otros autores(10,11,12). Las lesiones en la médula espinal en la ataxia enzoótica son puramente microscópicas, y esto explica por qué no se observaron lesiones a la necropsia. La 1332


Rev Mex Cienc Pecu 2021;12(4):1326-1337

distribución de la leucomielomalacia, afectando principalmente los funículos laterales y ventrales adyacente a la fisura ventral media fueron también consistentes con otros reportes en la literatura(5,7,12). Microscópicamente los hallazgos observados fueron bilaterales y simétricos en la substancia blanca de la médula espinal con degeneración walleriana, desmielinización, escasos cuerpos esferoides, así como células Gitter; en las neuronas, de las astas ventrales suele observarse cromatolisis central y necrosis neuronal(23,24,25). La patogenia de esta enfermedad no se encuentra del todo esclarecida, sin embargo, se sabe que los bajos niveles de cobre en el organismo interfieren con el adecuado funcionamiento de diversas enzimas, entre ellas el superóxido dismutasa, ceruloplasmina y la citocromooxidasa, lo que ocasiona la supresión de la respiración mitocondrial y por ende la disminución en la producción de fosfolípidos y la mielina(26,27). A esto se suma la acción de radicales libres ocasionando una axonopatía desmielinizante. En otras palabras, las lesiones son típicas de una enfermedad neurodegenerativa en ciervos(5,26,27). Los valores de cobre en suero sanguíneo e hígado, se encontraron por debajo de los valores considerados como límites normales (para suero sanguíneo de 0.5 a 1.5 mg/kg y de 50 ppm en materia seca para hígado). Sin embargo, se han descrito casos de ataxia enzoótica, donde se manifiesta por debajo de 25 ppm e inferiores a 15 ppm(28,29,30). En el presente estudio se encontraron muy por debajo de estos límites, a pesar de que el organismo es muy eficiente en mantener los niveles de cobre en sangre entre los valores óptimos, estas características también han sido observadas y registradas por otros autores(28,29,31,32). El hígado tiene la capacidad de ocasionar la redistribución del Cu y posteriormente favorecer su acumulación en riñón para después ser excretados en la orina(26), esto genera que los niveles dentro del tejido renal, como en este caso (4.67 mg/kg), no se vean afectados y sean encontrados dentro del rango establecido (3.3 a 7.2 mg/kg). El análisis de cobre y molibdeno realizados en los pastos y en el suelo, así como su relación Cu:Mo sugiere una baja de cobre en el pasto, lo cual se correlaciona con los niveles bajos de cobre encontrados en hígado y suero sanguíneo de los ciervos, siendo esto indicativo de una deficiencia primaria. Sin embargo, se debe considerar que la enfermedad se presenta durante todo el año, pero puede ser estacional, debido a la variación de los requerimientos nutricionales de los animales durante el año y las diferencias en la composición mineral del suelo y pastos, según la estación del año; disminuyendo en invierno-primavera e incrementándose en el verano-otoño como lo mencionan otros autores(19,20,21). En ciervos de granja, las concentraciones de Cu en el hígado <4 μg/kg y las concentraciones séricas <0.3 μg/ml indican deficiencia de este elemento. Se considera como deficiencia de Cu en forrajes <10 ppm y <3 ppm de molibdeno, perdiéndose la relación de Cu:Mo de 2:1(6), como en el presente estudio 0.90:1 y 0.45:1. Esto sugiere que el molibdeno no interfirió en el metabolismo del Cu en estos ciervos. Se consideran que para el hígado, concentraciones de Cu >6.35 mg/kg se consideran adecuados y <3.81 mg/kg de tejido representa el rango de deficiente. Para las concentraciones séricas de Cu, los rangos de <0.32 mg/L son de 1333


Rev Mex Cienc Pecu 2021;12(4):1326-1337

deficiencia y > 0.51 son adecuados(2). En deficiencias severas de cobre se han reportado problemas óseos y articulares, como osteocondrosis y fracturas espontáneas (1,7,28), sin embargo, esto no fue evidente en los ciervos de la UMA de Colima. Los hallazgos clínicos, de necropsia e histopatología junto con el análisis de Cu y Molibdeno fueron utilizados para hacer el diagnóstico final de leucomielomalacia bilateral o ataxia enzoótica por deficiencia de cobre. Esta enfermedad nutricional de la UMA en Colima fue clasificada como una deficiencia de cobre primaria o absoluta, debido a los bajos niveles de Cu en el forraje, mismos que fueron insuficientes para cubrir los requerimientos nutricionales de los animales, reflejando niveles bajos de Cu en hígado, suero y favoreciendo al desarrollo de lesiones degenerativas progresivas en el sistema nervioso central. Aunque los niveles de Cu no fueron analizados en los casos presentados en el 2018, la signología y lesiones anatomopatológicas fueron sugerentes de ataxia enzoótica; sin embargo, es importante que ante la manifestación de signos neurológicos en ciervos estabulados se considere a esta enfermedad como diagnóstico diferencial, y que de manera adicional al estudio clínicopatológico, se lleve a cabo la medición de Cu y Mo (suero, hígado, forraje y suelo) para realizar un diagnóstico definitivo y poder establecer medidas de prevención. Con base en la búsqueda bibliográfica, se considera que este es el primer informe de ataxia enzoótica en un ciervo rojo cautivo en México. Agradecimientos Este Proyecto fue financiado por la Red Académica de Enfermedades en la Vida Silvestre y su impacto como reservorio (PROMEP-CA-SEP). Se agradece a Alfredo Díaz por el procesamiento histológico de las muestras en el Departamento de Aves de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Nacional Autónoma de México. Literatura citada: 1. Wilson PR, Grace ND. A review of tissue reference valves used to assess the trace element status of farmed red deer (Cervus elaphus). NZ Vet J 2001;49(4):126-132. 2. Grace ND, Wilson PR. Trace element metabolism dietary requirements, diagnosis and prevention of deficiencies in deer. NZ Vet J 2002;50(6):252-259. 3. Grace ND, Wilson PR, Quinn AK. The effect of copper-amended fertilizer and copper oxide wire particles on the copper status of farmed red deer (Cervus elaphus) end their progeny. NZ Vet J 2005;53(1):31-38. 4. Grace ND, Wilson PR, Quinn AK. Impact of molybdenum on the copper status of red deer (Cervus elaphus). N Z Vet J 2005;53(2):137-141.

1334


Rev Mex Cienc Pecu 2021;12(4):1326-1337

5. Soler JP, Cseh SB. Ataxia enzoótica en ciervo rojo (Cervus elaphus) en Argentina. Arch Med Vet 2007;39(1):73-76. 6. Handeland K, Bernhoft A, Aartun MS. Copper deficiency and effects of copper supplementation in a herd of red deer (Cervus elaphus). Acta Vet Scand 2008;50:1-8. 7. Maryam R, Ghulam M. Copper deficiency in ruminants in Pakistan. Matrix Sci Med (MSM) 2018; 2(1):18-21. 8. Booth DH, Wilson PR, Alexander AM. The effect of oral copper wire on liver copper in farmed red deer. NZ Vet J 1989;37:98-101. 9. Jones DG. Trace element deficiencies. In: Alexander TL, Buxton D, editor. Management and diseases of deer. 2. Midlothian, Scotland: Macdonald Lindsay Pindar; 1994;182– 191. 10. Thompson KG, Audigé L, Arthur DG, Julian AF, Orr MB, McSporran KD, Wilson PR. Osteochondrosis associated with copper deficiency in young farmed red deer and wapitired deer hybrids. NZ Vet J New 1994;42:137-143. 11. Audigé L, Wilson PR, Morris RS, Davidson GW. Osteochondrosis skeletal abnormalities and enzootic ataxia associated with copper deficiency in a farmed red deer (Cervus elaphus). NZ Vet J 1995;43:70-76. 12. Vengust G, Svara T, Gombac M, Zele D. Enzootic ataxia associated with copper deficiency in a farmed red deer: a case report. Vet Med-Czech 2015;60(9):522–526. 13. Álvarez RJ, Medellín RA. Cervus elaphus Linnaeus, (1758). Vertebrados superiores exóticos en México: diversidad, distribución y efectos potenciales. Instituto de Ecología, Universidad Nacional Autónoma de México. Bases de datos SNIB-CONABIO. Proyecto U020. México, D.F. 2005. 14.

INEGI. Instituto Nacional de Estadística, Geografía e Informática. Marco Geoestadístico: aspectos geográficos de Colima; 2019.

15. Prophet EB, Mills B, Arrington JB, Sobin LH. Métodos histotecnológicos. Instituto de Patología de las Fuerzas Armadas de los Estados Unidos de América (AFIP) Registro de Patología de los Estados Unidos de América (ARP) Washington, D.C. 1995;280. 16. Perkin Elmer. Analytical methods for atomic absortion spectrophotometry. Connecticut, USA: Ed Perkin Elmer Corporation; 1982.

1335


Rev Mex Cienc Pecu 2021;12(4):1326-1337

17. NOM. Norma Oficial Mexicana NOM-010-ZOO-1994. Determinación de cobre, plomo y cadmio en hígado, músculo y riñón de bovinos, equinos, porcinos, ovinos y aves, por espectrometría de absorción atómica. SAGARPA. SENASICA. Diario Oficial Mexicano, 9 de enero 1995;16-25. 18. Falandysz J, Szymczyk KK, Brzostowski A, Zalewski K, Zasadowski A. Concentrations of heavy metals in the tissues of red deer (Cervus elaphus) from the region of Warmia and Mazury, Poland. Food Addit Contam 2005;22:141-149. 19. Cabrera TE, Sosa REE, Castellanos RAF, Gutiérrez BAO, Ramírez SJH. Comparación de la concentración mineral en forrajes y suelos de zonas ganaderas del estado de Quintana Roo, México. Vet Mex 2009;40:167-17. 20. De La Vega VJA. Perfil mineral en un hato de vacas en ordeña, en los períodos de seca y lluvias: relación con variables hemáticas [Tesis licenciatura]. Facultad de Medicina Veterinaria y Zootecnia. Universidad Veracruzana, México. 2009. 21. NCR. National Research Council. Nutrient Requirements of Small Ruminants: Sheep, Goats, Cervids, and New World Camelids. Washington, DC, USA: The National Academies Press; 2007. https://doi.org/10.17226/11654. 22. Anzar DA. Estudio retrospectivo de causas de mortalidad del ciervo rojo (Cervus elaphus) cautivo en el rancho "El Peregrino" del Estado de Colima, México [Tesis licenciatura]. Facultad de Medicina Veterinaria y Zootecnia de la Universidad de Colima; 2011. 23. Hartman HA, Evenson MA. Deficiency of cooper can cause neuronal degeneration. Med Hypotheses 1992;38:75-78. 24. Yoshikawa HH, Seo T, Oyamada T, Ogasawara T, Oyamada T, Yoshikawa X, Wei S, Wang A, Li Y. Histopathology of enzootic ataxia in Sika deer (Cervus nippon temminck). J Vet Med Sci 1996;58(9):849-854. 25. Geisel O, Betzl E, Dahme E, Schmahl W, Hermanns W. Enzootic spinal ataxia in fallow and wild red deer in Upper Bavaria. Tierarztl Prax Ausg G Grosstiere Nutztiere. 1997;25(6):598-604. 26. Quiroz G, Bouda J. Fisiopatología de las deficiencias de cobre en rumiantes y su diagnóstico. Vet Mex 2001;32(4):289-296. 27. Cantile C, Youssef S. Nervous system. Vol 1. Maxie, M. Grant. Jubb, Kennedy, and Palmers. Pathology of domestic animals. Elsevier; 2016. 28. Mackintosh GG. Deer health and diseases. Acta Vet Hung 1998;46:381-394.

1336


Rev Mex Cienc Pecu 2021;12(4):1326-1337

29. Wilson PR. Bodyweight and serum copper concentrations of farmed red deer stags following oral copper oxide wire administration. NZ Vet J 1989;37:94-97. 30. Padilla S, Bouda J, Quiroz RG, Dávalos JL, Sánchez A. Biochemical and haematological vales in venous blood of captive red deer (Cervus elaphus) at high altitude. Acta Vet Brno 2000;69:327-331. 31. Ellison RS. Major trace elements limiting livestock performance in New Zealand. NZ Vet J 2002;50(3):35-40. 32. Vikoren T, Bernhof A, Waaler T, Handeland K. Liver concentrations of copper, cobalt and selenium in wild Norwegican red deer (Cervus elaphus). J Wildl Dis 2005; 41(3):569-579.

1337


Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 4, pp. 996-1337, OCTUBRE-DICIEMBRE-2021

ISSN: 2448-6698

Pags. Niveles de consanguinidad y sus efectos sobre la expresión fenotípica en ganado Holstein

Inbreeding levels and their effects on phenotypic expression in Holstein cattle Adriana García-Ruiz, Gustavo Javier Mar�nez-Marín, José Cortes-Hernández, Felipe de JesúsRuiz-López ………………….…………………………………………………………………………………………………………………….....…...996

Contribución de los datos genómicos en la definición de la composición racial de bovinos doble propósito

Contribution of genomic data in defining the breed composition of dual-purpose cattle Jaime Anibal Rosero Alpala, Wilson David Rangel Garcia, Adonai Rojas Barreto, William OrlandoBurgos-Paz……………………………………………………………………………………………………………...…...……………….........1008

Relaciones entre estacionalidad, características corporales y leptina en el inicio de la pubertad en vaquillas Bos taurus taurus y Bos taurus indicus en el trópico mexicano

Relationships between seasonality, body characteristics and leptin at the beginning of puberty in Bos taurus taurus and Bos taurus indicus heifers in the Mexican tropics Carlos Hernández-López, René Carlos Calderón-Robles, Alejandro Villa-Godoy, Ángel Ríos-Utrera, Sergio Iván Román-Ponce, Everardo González-Padilla………………………….....……..……..….....……..…………….1025

Brachiaria grasses in vitro digestibility with bovine and ovine ruminal liquid as inoculum

Digestibilidad in vitro de gramíneas Brachiaria con líquido ruminal bovino y ovino como inóculo Luis Carlos Vinhas Itavo, Camila Celeste Brandão Ferreira Ítavo, Cacilda Borges do Valle, Alexandre Menezes Dias, Gelson dos Santos Difante, Maria da Graça Morais, Claudia MunizSoares, Camila da Silva Pereira, Ronaldo Lopes Oliveira..........……..…….……………….….....…...……….....…….....…….....…….....…..…….......………1045

Grape pomace silage Vitis labrusca L. cv. Isabel) on the intake and digestibility of

Ensilado de orujo de uva (Vitis labrusca L. cv. Isabel) en la digestibilidad de nutrientes, balancede nitrógeno y comportamiento ingestivo de corderos Fernando Luiz Massaro Junior, Valter Harry Bumbieris Junior, Ediane Zanin, Elzânia Sales Pereira, Mikael Neumann, Sandra Galbeiro, Odimari Pricila Prado Calixto, Ivone Yurika Mizubu�……….…......…………..…………..…………………………………………………………………………………………………………………………..…..1061

Efectividad del aceite de canola en dietas de cerdos para mejorar el perfil lipídico de la carne

Effectiveness of canola oil in pig diets to improve the lipid profile of meat Soni-Guillermo, Eu�quio, José Luis Figueroa-Velasco, María Teresa Sánchez-Torres-Esqueda, José Luis Cordero-Mora, Aleida Selene Hernández-Cázares, José Alfredo Mar�nez-Aispuro, José M. Fernando Copado-Bueno, María Magdalena Crosby-Galván…………………………….…………………...………..1083

The soil-plant interface in Megathyrsus maximus cv. Mombasa subjected to differentdoses of nitrogen in rotational grazing

La interfaz suelo-planta en Megathyrsus maximus cv. Mombasa sometida a diferentes dosis denitrógeno en pastoreo rotacional Caryze Cris�ne Cardoso Sousa, Denise Baptaglin Montagner, Alexandre Romeiro de Araújo, Valéria Pacheco Ba�sta Euclides, Gelson dos Santos Difante, Antonio Leandro Chaves Gurgel, Daniele Lopes de Souza……………………………………………………………………………………………..……………...……….......1098

Relación entre la resistencia a antibióticos y la producción de biofilm de aislados de Staphylococcus aureus provenientes de mastitis bovina

Relationship between antibiotic resistance and biofilm production of Staphylococcus aureus isolates from bovine mastitis Jaquelina Julia Guzmán-Rodríguez, Estefanía Salinas-Pérez, Fabiola León-Galván, José Eleazar Barboza-Corona, Mauricio Valencia-Posadas, Fidel Ávila-Ramos, José Antonio Hernández-Marín, Diana Ramírez-Sáenz, Abner Josué Gu�érrez-Chávez………………………………......………………………………..…..1117

Usefulness of Fourier transform infrared (FTIR) spectroscopy to detect Trichinella spiralis (Owen, 1835) muscle larvae in ham and sausages made from the meat of an experimentally infected pig

Utilidad de la espectroscopia infrarroja con transformada de Fourier (IRTF) para detectar larvas musculares de Trichinella spiralis (Owen, 1835) en jamón y salchichas hechas de carne de un cerdo infectado experimentalmente Jorge Luis de la Rosa Arana, Jesús Benjamín Ponce Noguez, Tzayhri Gallardo Velázquez, Nydia Edith Reyes Rodríguez, Andrea Paloma Zepeda Velázquez, Ana Berenice López Lugo, Alejandro Pablo Sánchez Paredes, Pablo Mar�nez Labat, Fabián Ricardo Gómez de Anda………………………………………………………………..…….....…….....…….....…….....….………………….1133

Frecuencia de anticuerpos séricos contra los virus de la rinotraqueitis infecciosa bovina y diarrea viral bovina en toros, y su relación con la presencia de los virus en semen

Frequency of serum antibodies against infectious bovine rhinotracheitis and bovine viral diarrhea viruses in bulls, and their relationship with the presence of the viruses in semen Jorge Víctor Rosete Fernández, Guadalupe A. Socci Escatell, Abraham Fragoso Islas, JuanPrisciliano Zárate Mar�nez, Sara Olazarán Jenkins, Lorenzo Granados Zurita, Ángel Ríos Utrera……………….…......1151

Variabilidad en el contenido de polifenoles, actividad biológica y antihelmíntica de extractos metanol: agua de las hojas de Gymnopodium floribundum Rolfe

Variability in polyphenol content, biological and anthelmintic activity of methanol: water extracts from the leaves of Gymnopodium floribundum Rolfe Guadalupe Isabel Or�z-Ocampo, Carlos Alfredo Sandoval-Castro, Gabriela Mancilla-Montelongo, Gloria Sarahi Castañeda-Ramírez, José Israel Chan Pérez, Concepción Cape�llo Leal, Juan Felipe de Jesús Torres-Acosta……………………………………………...………………………………...……….....…….....…….....……...1168

Análisis morfométrico y molecular (ADNmt) de abejas melíferas (Apis mellifera L.) en el estado de Tabasco, México

Morphometric and molecular analysis (mtDNA) of honeybees (Apis mellifera L.) in the state of Tabasco, Mexico Juan Florencio Gómez Leyva, Omar Argüello Nájera, Pablo Jorge Vázquez Encino, Luis Ulises Hernández Hernández, Emeterio Payró de la Cruz…………………………….…………..…………..…………..…………..…..…1188

Factores epizootiológicos de las estrongilosis gastrointestinales en cabras Criollas Cubanas: bases para un manejo integrado

Epizootiological factors of gastrointestinal strongyloses in Cuban Creole goats: bases for integrated management Manuel Alejandro La O-Arias, Francisco Guevara-Hernández, Luis Alfredo Rodríguez- Larramendi, Luis Reyes-Muro, José Nahed-Toral, Hernán Orbelin Mandujano-Camacho, René Pinto-Ruiz…………………………………………………………………………….....…….....…….....……....…………………………………………………………………………………………………………....1208

REVISIONES DE LITERATURA Linfadenitis caseosa: factores de virulencia, patogénesis y vacunas. Revisión

Caseous lymphadenitis: virulence factors, pathogenesis and vaccines. Review Alejandra Barragán Sierra, Leonel Avendaño-Reyes, Juan A. Hernández Rivera, Ricardo Vicente-Pérez, Abelardo Correa-Calderón, Miguel Mellado, Cesar A. Meza-Herrera, Ulises Macías-Cruz ……....……1221

NOTAS DE INVESTIGACIÓN Comparación de ecuaciones para ajustar curvas de crecimiento de vacas Holstein, Jersey y Jersey x Holstein en pastoreo en un ambiente urbano en el noroeste de la Ciudad de México

Comparison of equations to fit growth curves of Holstein, Jersey and Jersey x Holstein cows in a grazing system Sonia Contreras Piña, José Guadalupe García Muñiz, Rodolfo Ramírez Valverde, Rafael Núñez Domínguez, Citlalli Celeste GonzálezAriceaga………………………………………………….....…….....…….....…….....……..1250

Efecto de la aplicación intrauterina de ozono sobre la migración de neutrófilos y la endometritis subclínica en ganado lechero

Effect of intrauterine application of ozone on neutrophil migration and subclinical endometritis in dairy cattle Jessica Bárbara González-Aguado, Elisa Ochoa-Estrada, Héctor Raymundo Vera-Ávila, Ma. de Jesús Chávez-López, Mario Alfredo Espinosa-Mar�nez, Germinal Jorge Cantó-Alarcón, Claudia Gu�érrez-García, Luis Javier Mon�el-Olguín…………………………………………………………………….…………………………..….……………….…..1264

Análisis in silico de la expresión génica en células de granulosa de folículos preovulatorios en dos especies de bovinos

In silico analysis of gene expression in granulosa cells of preovulatory follicles in two species of bovines Jesús Alfredo Berdugo-Gu�érrez, Ariel Marcel Tarazona-Morales, José Julián Echeverry-Zuluaga, Albeiro López-Herrera…....……………………………………………………………………………………………….………………….1276

Digestibilidad ileal estandarizada de la proteína y aminoácidos de la pasta de ajonjolí en cerdos en crecimiento

Standardized ileal digestibility of protein and amino acids of sesame meal in growing pigs Tércia Cesária Reis de Souza, Araceli Aguilera Barreyro, Gerardo Mariscal Landín………………… ………..…………...………..………………………………………………………………………………………………………………………......…..1292

Prevalencia de diversos serovares de Leptospira interrogans en vacas no vacunadas en los estados de Puebla, Tabasco y Veracruz, México

Prevalence of various Leptospira interrogans serovars in unvaccinated cows in the states of Puebla, Tabasco and Veracruz, Mexico Jorge Víctor Rosete Fernández, Ángel Ríos Utrera, Juan P. Zárate Mar�nez, Guadalupe A. Socci Escatell, Abraham Fragoso Islas, Francisco T. Barradas Piña, Sara Olazarán Jenkins, Lorenzo Granados Zurita……………………………………………………………………………………………………………….…………..…………..……………………………………………........1305

Detection of porcine reproductive and respiratory syndrome in porcine herds of BajaCalifornia, Mexico

Detección del virus del síndrome reproductivo y respiratorio en piaras porcinas de Baja California, México Sergio Daniel Gómez-Gómez, Gilberto López-Valencia, José Carlomán Herrera-Ramírez, Enrique Trasviña-Muñoz, Francisco Javier Monge-Navarro, Ka�ya Moreno-Torres, Issa Carolina García- Reynoso, Gerardo Enrique Medina-Basulto, Miguel Arturo Cabanillas-Gámez…………………………………………………………………………………..…………...………..…………..1317

Ataxia enzoótica por deficiencia de cobre en ciervo rojo (Cervus elaphus) cautivo en Colima, México

Enzootic ataxia due to copper deficiency in captive red deer (Cervus elaphus) in Colima, Mexico Jorge Víctor Rosete Fernández, Ángel Ríos Utrera, Juan P. Zárate Mar�nez, Guadalupe A. Socci Luis Jorge García-Márquez, Rafael Ramírez-Romero, Julio Mar�nez-Burnes, Alfonso López-Mayagoi�a, Johnatan Alberto Ruíz-Ramírez, Edgar Iván Loman-Zúñiga, Fernando Constan�no-Casas…………………………………………………..………………………………………………….................………..1326

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 4, pp. 996-1337, OCTUBRE-DICIEMBRE-2021

CONTENIDO CONTENTS

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 4, pp. 996-1337, OCTUBRE-DICIEMBRE-2021