RMCP Vol. 12 Núm. 3 (2021): Julio-Septiembre [versión en español]

Page 1

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 3, pp. 665-995, JULIO-SEPTIEMBRE-2021

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 3, pp. 665-995, JULIO-SEPTIEMBRE-2021


REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 12 Numero 3, JulioSeptiembre 2021. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 042021-051209561700-203. ISSN: 2428-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en julio de 2021. 1er Concurso de Dibujo Infantil INIFAP 2021 “Futuros Investigadores” 3er Lugar, Categoría A (5 años o menos) Autor: Derek Sánchez Serra Título: Ayudemos a la naturaleza

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, Dr. Alfonso Juventino Chay Canul, Universidad Autónoma de Tabasco, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Maurcio A. Elzo, Universidad de Florida Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, Universidad Autónoma del Estado de Hidalgo, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. José Juan Hernández Ledezma, Consultor privado Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

I


REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

total por publicar es de $ 7,280.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 425.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II


REVISTA MEXICANA DE CIENCIAS PECUARIAS

REV. MEX. CIENC. PECU.

VOL. 12 No. 3

JULIO-SEPTIEMBRE-2021

CONTENIDO Contents ARTÍCULOS Articles

Pág.

Diversidad genética y factores de virulencia de cepas de Staphylococcus aureus aisladas de la piel de ubre bovina Genetic diversity and virulence factors of Staphylococcus aureus strains isolated from bovine udder skin Roberto Adame-Gómez, Jeiry Toribio-Jimenez, Natividad Castro-Alarcón, Karina Talavera-Alarcón, Jacqueline Flores-Gavilan, Sandra-Alheli Pineda-Rodríguez, Arturo Ramírez-Peralta ……………….…665 Molecular prediction of serotypes of Streptococcus suis isolated from pig’s farms in Mexico Predicción molecular de serotipos de Streptococcus suis aislados de granjas porcinas en México Arianna Romero Flores, Marcelo Gottschalk, Gabriela Bárcenas Morales, Víctor Quintero Ramírez, Rosario Esperanza Galván Pérez, Rosalba Carreón Nápoles, Ricardo Ramírez R., José Iván Sánchez Betancourt, Abel Ciprián Carrasco, Susana Mendoza Elvira……………………………………………………..681 La coexistencia de Desmodus rotundus con la población humana en San Luis Potosí, México The coexistence of Desmodus rotundus with the human population in San Luis Potosí, Mexico Ximena Torres-Mejía, Juan José Pérez-Rivero, Luis Alberto Olvera-Vargas, Evaristo Álvaro BarragánHernández, José Juan Martínez-Maya, Álvaro Aguilar-Setién……………………………………………..……694 Detection of Pasteurella multocida, Mannhemia haemolytica, Histophilus somni and Mycoplasma bovis in cattle lung Detección de Pasteurella multocida, Mannhemia haemolytica, Histophilus somni y Mycoplasma bovis en pulmón de bovinos Seyda Cengiz, M. Cemal Adıgüzel, Gökçen Dinç………………………………………………………………….…710 Treating horse chronic laminitis with allogeneic bone marrow mesenchymal stem cells Tratamiento de la laminitis crónica en equinos utilizando células troncales mesenquimales alogénicas de la médula ósea Alma A García-Lascuráin, Gabriela Aranda-Contreras, Margarita Gómez-Chavarín, Ricardo Gómez, Adriana Méndez-Bernal, Gabriel Gutiérrez-Ospina, María Masri…………………………………………….…721

III


Composición nutricional de la carne equina y grado de sustitución de la carne bovina por equina en expendios de la Ciudad de México Nutritional composition of equine meat and degree of substitution of bovine for equine meat in stores in Mexico City Guillermo Reséndiz González, Baldomero Alarcón Zúñiga, Itzel Villegas Velázquez, Samuel Albores Moreno, Gilberto Aranda Osorio ……………………………………………………………………………………….…742 Supplementation with Agave fourcroydes powder on growth performance, carcass traits, organ weights, gut morphometry, and blood biochemistry in broiler rabbits Suplementación con polvo de Agave fourcroydes en el crecimiento, características de la canal, peso de los órganos, morfometría intestinal y bioquímica sanguínea en conejos de engorda Yordan Martínez, Maidelys Iser, Manuel Valdivié, Jorge Galindo, David Sánchez…………………….…756 Evaluación de los componentes del manejo antes, durante y después de la matanza y su asociación con la presencia de carne DFD en bovinos del noreste de México Evaluation of the components of management before, during and after slaughter and their association with the presence of DFD beef in cattle from northeastern Mexico Jorge Loredo Osti, Eduardo Sánchez López, Alberto Barreras Serrano, Fernando Figueroa Saavedra, Cristina Pérez Linares, Miguel Ruiz Albarrán …………………………………………………………………………773

In vitro methane production and fermentative parameters of wild sunflower and

elephant grass silage mixtures, either inoculated or not with epiphytic lactic acid bacteria strains Producción de metano in vitro y parámetros fermentativos de mezclas de ensilado de girasol silvestre y pasto elefante, inoculadas o no con cepas de bacterias ácido-lácticas epífitas Vilma Amparo-Holguín, Mario Cuchillo-Hilario, Johanna Mazabel, Steven Quintero, Siriwan Martens, Jairo Mora-Delgado ……………………………………………………………………………………………………………789 Fases de desarrollo y propagación de ecotipos destacados de Tithonia diversifolia (Hemsl.) A. Gray Phases of development and propagation of outstanding ecotypes of Tithonia diversifolia (Hemsl.) A. Gray Julián Esteban Rivera-Herrera, Tomás Ruíz-Vásquez, Julián Chará-Orozco, Juan Florencio GómezLeyva, Rolando Barahona-Rosales …………………………………………………………………………………….…811 Structure of forage sward with Urochloa brizantha cultivars under shading Estructura del pasto forrajero con cultivares de Urochloa brizantha bajo sombra Estella Rosseto Janusckiewicz, Luísa Melville Paiva, Henrique Jorge Fernandes, Alex Coene Fleitas, Patricia dos Santos Gomes ………………………………………………………………………………………………….828 Características de la producción de leche en La Frailesca, Chiapas, México Characteristics of milk production in La Frailesca, Chiapas, Mexico Joaquín Huitzilihuitl Camacho-Vera, Juan Manuel Vargas-Canales, Leticia Quintero-Salazar, Gregorio Wenceslao Apan-Salcedo ……………………………………………………………………………………………………845

IV


Análisis de la demanda de bovinos carne en pie en los centros de sacrificio de México, 2000-2018 Analysis of the demand for live beef cattle in slaughter centers in Mexico, 2000-2018 Nicolás Callejas Juárez, Samuel Rebollar Rebollar……………………………………………………………….…861

Effect of two phantom parent grouping strategies on the genetic evaluation of growth traits in Mexican Braunvieh cattle Efecto de dos estrategias de agrupación de padres fantasmas en la evaluación genética de rasgos de crecimiento en el ganado Braunvieh mexicano Luis Antonio Saavedra-Jiménez, Rodolfo Ramírez-Valverde, Rafael Núñez-Domínguez, Agustín RuízFlores, José Guadalupe García-Muñiz, Mohammad Ali Nilforooshan ………………………………………..878 Evaluación mineral de los componentes del sistema silvopastoril intensivo con Leucaena leucocephala en tres épocas del año Mineral evaluation of the components of the intensive silvopastoral system with Leucaena leucocephala in three seasons of the year Andrés Camilo Rodríguez-Serrano, Alejandro Lara-Bueno, José Guadalupe García-Muñiz, Maximino Huerta-Bravo, Citlalli Celeste González-Aricega ………………………………………………………………….…893 REVISIONES DE LITERATURA Reviews Termorregulación y respuestas reproductivas de carneros bajo estrés por calor. Revisión Thermoregulation and reproductive responses of rams under heat stress. Review Alejandra Barragán Sierra, Leonel Avendaño-Reyes, Juan A. Hernández Rivera, Ricardo VicentePérez, Abelardo Correa-Calderón, Miguel Mellado, Cesar A. Meza-Herrera, Ulises Macías-Cruz ….910 NOTAS DE INVESTIGACIÓN Technocal notes Evaluación de las condiciones predisponentes a enfermedades en granjas porcinas a pequeña escala en un ambiente urbano en el noroeste de la Ciudad de México Evaluation of disease-predisposing conditions in small-scale swine farms in an urban environment in northwestern Mexico City Roberto Martínez Gamba, Gerardo Ramírez Hernández …………………………………………………………932 Determinación de aflatoxinas en especias, ingredientes y mezclas de especias usados en la formulación de productos cárnicos comercializados en la Ciudad de México Determination of aflatoxins in spices, ingredients and spice mixtures used in the formulation of meat products marketed in Mexico City Montserrat Lizeth Ríos Barragán, José Fernando González Sánchez, Rey Gutiérrez Tolentino, Arturo Camilo Escobar Medina, José Jesús Pérez González, Salvador Vega y León………………………………944

V


Efecto de la altura de corte de sorgo a la cosecha sobre el rendimiento de forraje y el valor nutritivo del ensilaje Effect of the cutting height of sorghum at harvest on forage yield and nutritional value of silage Jorge A. Granados-Niño, David G. Reta-Sánchez, Omar I. Santana, Arturo Reyes-González, Esmeralda Ochoa-Martinez, Fernando Díaz, Juan I. Sánchez-Duarte……………………………………..…958 The effects of Pyrantel-Oxantel on the Dipylidium caninum tapeworm: An in vitro study Efecto del Pyrantel-Oxantel en la tenia Dipylidium caninum: estudio in vitro Jair Millán-Orozco, Jersson Millán-Orozco, Miguel Ángel Betancourt-Alonso, América Ivette BarreraMolina, María Soledad Valledor, Virginia Méndez, Alejandra Larrea, Martín Sebastián Lima, Javier Morán-Martínez, Nadia Denys Betancourt-Martínez, Liliana Aguilar-Marcelino .………………………...969 Definición y análisis del panel de polimorfismos de nucleótido simple a utilizar en pruebas de paternidad para tres razas de bovinos Definition and analysis of the panel of SNPs to be used in paternity tests for three breeds of cattle Joel Domínguez-Viveros, Adán Medellín-Cazares, Nelson Aguilar-Palma, Francisco Joel JahueyMartínez, Felipe Alonso Rodríguez-Almeida …………………………………………………………………………987

VI


Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

6.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes). Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo. El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

4.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

5.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

7.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8.

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

VII


Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

referencias, aunque pueden insertarse en el texto (entre paréntesis).

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés. 12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus. Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

VIII


I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

XI)

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

IX


XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

xg

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50 g

vs

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s)

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

X


Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

4.

5.

6.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts). All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt. Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias”. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

7.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

8.

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

9.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts:

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

b) Technical Notes. They should be brief and be evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which

XI


should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of the research article but without section titles.

names(s), the number of the edition, the country, the printing house and the year. e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to

summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Key rules for references a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one. b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article). c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10. III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

XII


Organization, as author VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

In press VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000. Books and other monographs

Author(s) VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Organization as author XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984. XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996. XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988. XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Conference paper X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003. XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003. XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003. 12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

13. Final version. This is the document in which the authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII


14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m µl µm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v. J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

vs

versus

xg

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIV


https://doi.org/10.22319/rmcp.v12i3.5646 Artículo

Diversidad genética y factores de virulencia de cepas de Staphylococcus aureus aisladas de la piel de ubre bovina

Roberto Adame-Gómez a Jeiry Toribio-Jimenez b Natividad Castro-Alarcón c Karina Talavera-Alarcón a Jacqueline Flores-Gavilan a Sandra-Alheli Pineda-Rodríguez d Arturo Ramírez-Peralta a*

a

Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación en Patometabolismo Microbiano. Chilpancingo, Guerrero, México. b

Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Microbiología Molecular y Biotecnología Ambiental. Chilpancingo, Guerrero, México. c

Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación en Microbiología. Chilpancingo, Guerrero, México. d

Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación en Parasitología. Chilpancingo, Guerrero, México.

*Autor de correspondencia: ramirezperaltauagro@gmail.com

Resumen: Staphylococcus aureus es un patógeno reconocido como causa de mastitis en bovinos a nivel mundial, por lo cual el objetivo de este trabajo fue determinar la presencia de Staphylococcus aureus en la piel de pezón de la ubre bovina y relacionarlo a la presencia de mastitis, así 665


Rev Mex Cienc Pecu 2021;12(3):665-680

como determinar los factores de virulencia y la diversidad genética de las cepas. En tres establos se tomaron muestras de 250 vacas de ordeña en dos temporadas del año, estiaje y lluvias. Además, se realizó la prueba de California. Staphylococcus aureus fue aislado en agar sal y manitol e identificado bioquímicamente y confirmado con la amplificación del gen femA. Para la identificación de los factores de virulencia se usaron los genes hlB, mec, saK, pvL, tsst-1, seA, seB, seC, seD y seE por PCR en punto final. Para la tipificación de S. aureus, se realizó la amplificación y restricción del gen coag. La frecuencia de S. aureus fue 13.4 %. No se encontró una relación estadística entre la presencia de S. aureus en la piel de la ubre bovina y el desarrollo de mastitis subclínica. El gen de la enterotoxina más frecuente en las cepas fue el de la enterotoxina A. Aunque el porcentaje de tipificación es bajo, se lograron identificar dos restrictotipos que agrupan cepas aisladas de diferentes vacas, lo cual evidencia la capacidad infectocontagiosa del microorganismo. Palabras clave: Ubre bovina, Staphylococcus aureus, Diversidad genética, Mastitis.

Recibido: 20/03/2020 Aceptado: 08/01/2021

Introducción La mastitis bovina (MB) es la inflamación de la glándula mamaria causada en la mayoría de los casos por un microorganismo, el cual invade la ubre a través del canal del pezón(1,2). Esta enfermedad es clasificada de acuerdo a las manifestaciones clínicas que presentan, en mastitis clínica (MC) y mastitis bovina subclínica (MSC), siendo esta última, la entidad clínica más común(3). Aún cuando son numerosos los géneros bacterianos que causan mastitis, solamente una cantidad reducida de especies son prevalentes y constituyen un problema real de salud pública(2). Staphylococcus aureus es reconocido como un patógeno a nivel mundial por causar mastitis(4), siendo responsable aproximadamente de un tercio de los casos de mastitis clínica y subclínica en bovinos(5,6), considerándose un problema en la industria pecuaria debido a su patogenicidad, persistencia en el ambiente, facilidad de contagio entre vaca y vaca durante el proceso de ordeño(2,7), debido a las bajas tasas de resolución de la enfermedad con los tratamientos actuales(8), conllevando infecciones crónicas, que persisten entre periodos de lactación, con intermitentes episodios clínicos que ocurren desde la elevación de la temperatura, grados de anorexia, la aparición de coágulos en la leche(1), lo cual incrementa los riesgos de sacrificio del animal, el trabajo, el tratamiento y los costos de reemplazo, visitas de veterinarios, incorporación de protocolos para evitar riesgo con inversión en

666


Rev Mex Cienc Pecu 2021;12(3):665-680

infraestructura así como la implementación de métodos de diagnóstico con mayor frecuencia(9). Sin embargo, la mastitis no solo tiene un impacto en la economía del productor, sino también se convierte en un problema de salud pública al ser una fuente potencial de transmisión zoonótica, debido a que se ha descrito que S. aureus es capaz de causar enfermedad en humanos(10,11). La mastitis bovina tiene relevancia en el contexto de las intoxicaciones alimentarias en humanos. La ingestión de productos contaminados con enterotoxinas estafilococcicas produce una intoxicación caracterizada por vómito violento y diarrea(12). Dentro de los factores relacionados a una infección por S. aureus en la glándula mamaria se encuentra la higiene tanto en el ordeño como en la ubre del animal(13,14). En años recientes, se ha planteado que la colonización de la piel de la ubre podría ser un factor predominante al desarrollo de mastitis por arrastre del microorganismo durante el ordeño hacia el pezón del animal; sin embargo, diversos estudios difieren en relación a esta aseveración. Se ha descrito que los casos de mastitis por S. aureus son causados por cepas altamente adaptadas a la glándula mamaria y que son diferentes de los aislados de piel (2,15). Mientras otros estudios sugieren que la mayoría de S. aureus aislados de la piel y del canal del pezón así como de los sitios extra mamarios como vagina, narinas y piel de las fauces son genéticamente iguales a las encontradas en glándulas mamarias o leche(16-18). Por lo anterior, el objetivo de este estudio fue determinar la frecuencia de S. aureus en la piel de los pezones de ubres de vacas de tres establos lecheros ubicados el sur del estado de Guerrero, México, la diversidad genética y de factores de virulencia de las cepas de S. aureus, así como la posible relación con mastitis bovina.

Material y métodos Establos y muestreo Tres establos fueron incluidos en el estudio. Basados en el permiso de los propietarios y el tamaño de la granja. Se tomó una muestra de la piel del pezón de los cuatro cuartos de las 250 vacas de ordeña, en dos temporadas del año distintas: lluvias y estiaje, teniendo un total de 500 muestras. Las muestras se tomaron con un hisopo de algodón, el cual se deslizó en cada borde del pezón y alrededor del mismo cubriendo un área de 2 cm. Después, se realizó la prueba de California, considerando la interpretación de la prueba anteriormente descrita. Todos los establos venden la leche cruda directamente a los consumidores y una de ellas es caracterizada por ser un sitio de producción de quesos elaborados con leche cruda. En esta granja, la leche cruda es colectada durante la mañana y directamente procesada en una pequeña planta artesanal de producción de quesos.

667


Rev Mex Cienc Pecu 2021;12(3):665-680

Aislados Las muestras tomadas con hiposos de la piel del pezón se cultivaron en agar sal y manitol. Los aislados fueron presuntivamente identificados como S. aureus de acuerdo al siguiente esquema: manitol positivo, catalasa positivo, coco Gram positivos y coagulasa positivo en 6 h. Los aislamientos se conservaron a -20 °C en caldo BHI (por sus siglas en inglés “Brain Heart Infusion”) con 15% (V/V) de glicerol.

Identificación molecular de S. aureus Las cepas fueron cultivadas en caldo infusión cerebro corazón e incubadas a 37 °C. Las cepas testigo usadas en este estudio fueron S. aureus ATCC29231 (sea), S. aureus ATCC14458 (seb), S. aureus ATCC19095 (sec), S. aureus ATCC13563 (sed), S. aureus ATCC27664 (see) y S. aureus ATCC25923 (femA, coag, hlb, sak). El ADN total se obtuvo de 1 ml de un cultivo de 18 h de todas las cepas bacterianas incluidas las cepas ATCC. Las células se sedimentaron a partir de la centrifugación de los cultivos a 10,000 rpm por 10 min y suspendidas en 300 μl de buffer de lisis (10 mM Tris HCl, 1 mM EDTA, pH 8,0, lisozima 1 mg/ml) e incubadas a 37 °C por media hora o hasta la observación de viscosidad. El ADN de todas las preparaciones fue subsecuentemente extraído con fenol cloroformo y precipitado con etanol. Las muestras de ADN se diluyeron en buffer TE (10 mM Tris HCl, 1 mM EDTA, pH 8.0)(19). Una PCR en punto final del gen femA fue realizada a las cepas para la confirmación molecular de S. aureus con los oligonucleótidos descritos en el Cuadro 1. La mezcla final de reacción de PCR contenía 0.2 mM de cada dNTP, 3 mM de MgCl2, 0.2 mM de los oligonucleótidos, 1 U taq ADN polimerasa (Amplicon, Denmark) 5 μl de buffer 10X y 100 ng de ADN como molde. Cuadro 1: Oligonucleótidos usados para la identificación molecular, detección de genes de enterotoxinas y tipificación molecular Gene (factor de Secuencia (5’- 3’) TPA Ref. virulencia) femA coa (coagulasa) seA (enterotoxina A)

femaF- AAAAAAGCACATAACAAGCG femaR- GATAAAGAAGAAAACCAGCAG coaF- CGAGACCAAGATTCAACAAG coaR- AAAGAAAACCACTCACATCA seaF- TGCAGGGAACAGCTTTAGGC seaR- GTGTACCACCCGCACATTGA

668

130

(20)

600900

(22)

250

(20)


Rev Mex Cienc Pecu 2021;12(3):665-680

seB (enterotoxina B)

seC (enterotoxina C)

seD (enterotoxina D)

seE (enterotoxina E) hlB (hemolisina β)

sebFATTCTATTAAGGACACTAAGTTAGGG sebR- ATCCCGTTTCATAAGGCGAGT secF- GTAAAGTTACAGGTGGCAAAACTTG secRCATATCATACCAAAAAGTATTGCCGT sedFGAATTAAGTAGTACCGCGCTAAATAATA TG sedR- GCTGTATTTTTCCTCCGAGAGT seeFCAAAGAAATGCTTTAAGCAATCTTAGGC seeR- CACCTTACCGCCCAAAGCTG hlbF- GTGCACTTACTGACAATAGTGC hlbR- GTTGATGAGTAGCTACCTTCAGT

400

297

492

480

300

saK (estafiloquinasa)

sakF- ATCCCGTTTCATAAGGCGAGT sakR- CACCTTACCGCCCAAAGCTG

260

En este estudio

mecA (Resistencia a meticilina)

mecaF- TCCAGATTACAACTTCACCAGG mecaR- CCACTTCATATCTTGTAACG

180

(21)

476

En este estudio

tsst-1 (toxina del syndrome del shock tóxico)

tsstF- CATCTACAAACGATAATATAAAGG tsstRCATTGTTATTTTCCAATAACCACCCG

TPA= tamaño del producto amplificado (pb); Ref.= referencia.

Identificación de genes codificantes para factores de virulencia La detección de los genes hlB, mec, saK, pvL, tsst-1, seA, seB, seC, seD y seE codificantes para la β-hemolisina, región de resistencia a meticilina, estafiloquinasa, la toxina Panton Valentine, la toxina del síndrome del choque tóxico y enterotoxinas respectivamente, fue a partir de PCR en punto final con los oligonucleótidos descritos en el Cuadro 1. La mezcla final de reacción de PCR contenía: 0.2 mM de cada dNTP, 3 mM MgCl2, 0.2 µM de los oligonucleótidos, 1 U de Taq ADN polimerasa (Ampliqon ®, DEN), 1X Buffer y 100 ng de DNA como templado. Las mezclas de reacción se sometieron bajo las siguientes condiciones de amplificación: desnaturalización inicial por 5 min, a 94 °C; 30 ciclos de 30 seg a 94 °C, 30 seg a 52 °C, 30 seg a 72 °C; y una extensión final por 5 min a 72 °C para mec, hlB, pvL, tsst-1, seA y seE. Desnaturalización inicial por 5 min a 94 °C; 30 ciclos de 30 seg a 94 °C, 45 seg a 52 °C, 45 seg a 72 °C; y una extensión final por 5 min a 72 °C para saK, seB, seC y seD(20,21).

669


Rev Mex Cienc Pecu 2021;12(3):665-680

La electroforesis de los de los productos de PCR se realizó en geles de agarosa al 2% a 80 V durante 60 min. Los geles fueron teñidos con Midori green (Nippon Genetics®, GER) y visualizados con luz LED (Nippon Genetics®, GER) a 470 nm.

Prueba fenotípica para evidenciar la expresión del gen hlB Para demostrar la expresión de la β hemolisina, las cepas se cultivaron por estría cruzada en agar gelosa sangre de carnero al 5%, incubándose a 37 °C en tensión de CO2 por 24 h. Las cepas que presentaron un halo de transparencia en el perímetro de las colonias se consideraron β-hemolíticas (hlB+). Las cepas que presentaron α y γ-hemolisis se consideraron hlB-.

Tipificación molecular de S. aureus A las cepas confirmadas molecularmente como S. aureus, se les realizó la amplificación del gen coag mediante PCR en punto final con los oligonucleótidos descritos en el Cuadro 1 y con la siguiente mezcla final para cada reacción de PCR: 0.2 mM de cada dNTP, 3 mM MgCl2, 0.2 µM de oligonucleótidos, 1 U de Taq DNA polimerasa (Ampliqon®, DEN), 1X Buffer y 100 ng de DNA como molde. El protocolo de PCR inicia con desnaturalización inicial de 5 min, a 94 °C; 30 ciclos de 30 seg a 94 °C, 30 seg a 52 °C, 60 seg a 72 °C; y una extensión final por 5 min a 72 °C(22). Los productos de PCR fueron digeridos por 2 h a 37 °C con 10 U de la enzima de restricción AluI (Thermo Scientific®, EE.UU.) de acuerdo al protocolo recomendado por el fabricante. Los fragmentos de restricción se detectaron por electroforesis en geles de agarosa al 2% a 70 V por 60 min. Los geles se tiñeron con de Midori green (Nippon Genetics®, GER) y visualizados con luz LED (Nippon Genetics®, GER).

Análisis estadístico Se utilizó el paquete estadístico STATA V. 12 (STATA®, EE. UU.) para calcular frecuencias simples y se utilizó la prueba estadística Ji cuadrada para posibles relaciones entre la presencia de S. aureus en la piel de ubre bovina y el desarrollo de mastitis subclínica, se consideran valores de P= <0.05 como estadísticamente significativos.

Resultados y discusión En este estudio, del total de vacas analizadas en los dos periodos, se determinó una frecuencia de mastitis subclínica del 6.6 % (33/500) y de mastitis clínica del 0.8 % (4/500). La frecuencia de mastitis subclínica por establo lechero fue mayor en el establo A (12 %) en relación al B (4 %) y el C (1 %) (P=0.001) (Cuadro 2). Estas diferencias en cuanto a frecuencias pueden 670


Rev Mex Cienc Pecu 2021;12(3):665-680

estar relacionadas a la implementación o cumplimiento de estrategias bien caracterizadas para el control de infecciones intramamarias o conocido como el plan de los 5 puntos; en el cual se incluye la secuencia de ordeño, uso de guantes, cambio de toalla de papel o tela entre los cuartos de la ubre, pre sello y post sello del pezón(23). Además, de otros factores como la presencia de infección y el tiempo de evolución de éstas(24), la naturaleza del agente infeccioso, la paridad y el estado de lactación del animal, así como la nutrición y el ambiente en donde este se encuentre(25). En este último punto, se conoce que la temporada de lluvias (verano) es un factor de riesgo ambiental para el desarrollo de mastitis, siendo más frecuente la aparición de casos durante esta temporada en relación a otras como el invierno(26), mismo que fue observado en nuestro estudio, en el cual, durante el periodo de lluvias la frecuencia de mastitis subclínica fue mayor (10.8 %) con relación a la temporada de seca (2.4 %) (P= 0.001). Diversos autores coinciden en esta afirmación, considerando que la humedad podría tener un papel importante; sin embargo, también concluyen que este periodo podría coincidir con el inicio de la lactación o el término de la gestación, que por lo general debe considerarse para las vacas de primera paridad durante la temporada con el clima más deseable, en este caso el verano, durante el cual la disposición de pasto y por ende de alimento es mayor(27,28). Cuadro 2: Frecuencia de mastitis subclínica y clínica en relación a establos lecheros, temporal y presencia de S. aureus en el pezón de ubres de vacas Prueba de california Característica Total p Mastitis Mastitis Negativo Trazas subclínica clínica Establo lechero A 200 8 (4) 164 (82) 24 (12) 4 (2) B 200 4 (2) 188 (94) 8 (4) 0 0.001 C 100 0 99 (99) 1 (1) 0 Temporal Lluvias 250 11 (4.4) 208 (83.2) 27 (10.8) 4 (1.6) Secas 250 1 (0.4) 242 (97.8) 6 (2.4) 0 0.001 S. aureus en ubre Positivo 67 0 66 (98.5) 1 (1.5) 0 0.106 Negativo 433 12 (2.7) 385 (88.9) 32 (7.5) 4 (0.9) Los casos de mastitis clínica solo se presentaron en el establo lechero A (2 %) y en temporada de lluvias (1.6 %) (P= 0.001). En el caso del aislamiento del microorganismo de interés en la piel del pezón de la ubre de las vacas analizadas, la frecuencia de S. aureus a partir de la identificación del gen femA fue del 13.4 % (67/500) (Figura 1, Cuadro 2). Otros marcadores son utilizados para determinar la especie de S. aureus como el gen de la termonucleasa (nuc)(29) y la región del gen del 16 rRNA(30); sin embargo, el gen nuc puede ser encontrado en otras especies de Staphylococcus coagulasa positivos (S. hyicus, S. delphini, S.

671


Rev Mex Cienc Pecu 2021;12(3):665-680

intermedius, S. pseudointermedius, S. schleiferi) y negativos (S. capitis, S. caprae, S. epidermidis, S. warneri, S. simulans, S. carnosus, S. kloosii, S. saprophyticus)(31), por lo cual se decidió trabajar con dicho gen, el cual está relacionado en la síntesis del peptidoglucano y tiene un alto poder de identificación para S. aureus resistentes a meticilina(32). Figura 1: Electroforesis de la amplificación del gen femA de cepas de S. aureus de la piel de la ubre bovina

A) 1, S522 (AL); 2, S528 (AL), 3; S519 (AL) 4, S529 (AL); 5, S521 (BL); 6, MPM; 7, control negativo; 8, control positivo (S. aureus ATCC25923); 9, S517 (AL); 10, S643 (BS). B) 1, control negativo; 2, S522 (AL); 3, S528 (AL); 4, S529 (AL); 5, S521 (BL); 6, MPM (100 PB); 7, S517 (AL); 8, S643 (BS); 9, S650 (BS); a= establo A; b= establo B; L= lluvias; S= secas. MPM= Marcador de peso molecular de 100 pb. En B, las cepas débilmente positivas y positivas se volvieron a repetir y se modificaron las condiciones de electroforesis.

S. aureus fue aislado en la mayoría de cuartos lecheros que solo presentaron trazas o baja cantidad de células somáticas, y aislándose solamente en una vaca con mastitis subclínica. Determinando que no existe una relación entre los aislados de S. aureus de la piel del pezón de la ubre de las vacas con el desarrollo de cuadros de mastitis (P= 0.106). Diversos factores podrían explicar la ausencia de esta relación, desde el estado inmunitario del animal, el inóculo del microorganismo y las características genéticas de la cepa. Incluso en años recientes, se ha descrito el papel de la microbiota de la ubre de la vaca como un factor importante en el desarrollo de la mastitis, con la presencia de otros microorganismos que podrían actuar como antagonistas de patógenos restringiendo su multiplicación o establecimiento de la infección; por ejemplo, se ha descrito que S. chromogenes produce

672


Rev Mex Cienc Pecu 2021;12(3):665-680

bacteriocinas capaces de inhibir el crecimiento de la mayoría de patógenos intramamarios(33,34). Considerando que factores como la paridad y el estado de inmunosupresión generado durante la gestación, la lactancia, el perfil metabólico y la carga genética del animal podrían impactar positiva o negativamente en la composición de la microbiota de la ubre y por ende en la susceptibilidad de la mastitis(35). Aun cuando no se encontró una relación con los casos de mastitis subclínica en el estudio, se buscaron otras relaciones como la distribución de S. aureus en los tres establos lecheros (A, B y C), la cual fue del 14, 11.5 y 16 % respectivamente, no observándose diferencias estadísticamente significativas (P= 0.531) (Cuadro 3). Estos resultados podrían explicarse por la ubicuidad del microorganismo, la capacidad infectocontagiosa, así como de persistencia del mismo en el ambiente lechero(2). Las diferencias observadas en la estacionalidad en este estudio con mayor frecuencia para S. aureus fue en temporada de seca (23.6 %, 29/250) en relación a lluvias (3.2 %, 8/250), podrían ser explicadas por el crecimiento acelerado de microorganismos asociados a la temperatura y la humedad de la estación(36), así como un estado metabólico alterado, incluido algún tipo de inmunocompromiso debido a la restricción de alimento(35), lo cual favorezca la colonización del microrganismo. Cuadro 3: Presencia de S. aureus en el pezón de ubres de vacas en relación a establos lecheros y temporal S. aureus Características Total P Positivos Negativos Establo lechero A 200 28 (14.0) 172 (86.0) B 200 23 (11.5) 177 (88.5) 0.531 C 100 16 (16.0) 84 (84.0) Temporal Lluvias 250 8 (3.20) 242 (96.8) 0.001 Secas 250 59 (23.6) 191 (76.4) De igual modo no se encontró una relación estadística entre la presencia de S. aureus en la piel de la ubre bovina y el desarrollo de mastitis subclínica; sin embargo, se determinaron factores de virulencia que son claves tanto en el desarrollo de infecciones como de intoxicaciones alimentarias(37,38). El gen de la enterotoxina más frecuente en las cepas de S. aureus fue el de la enterotoxina A (10.44 %), destacando que no se encontraron cepas con los genes para las enterotoxinas B y C. En cuanto a toxinas, se encontraron 23 cepas con el gen de la hemolisina β (34.32 %); es importante mencionar que este dato, está ajustado con la prueba fenotípica de hemolisis en sangre de carnero, lo cual se consideró debido a que los oligonucleótidos diseñados para este gen, no lo amplifican por completo y este gen es

673


Rev Mex Cienc Pecu 2021;12(3):665-680

susceptible para la inserción de fagos y la inclusión de genes como el de la enterotoxina A y la estafiloquinasa (saK) (39,40). En este estudio, no se encontraron cepas con uno de los genes asociados a la toxina Panton Valentine. Finalmente, solo se encontraron dos cepas con el gen saK (2.98 %) y tres cepas se definieron como SARM a partir de la amplificación del gen mecA (4.47 %) (Cuadro 4). En este sentido, diversos estudios han buscado establecer un perfil de virulencia característico de las cepas de S. aureus capaces de causar mastitis subclínica, en el supuesto, de que el microorganismo se debe adaptar a un determinado entorno al invadir la ubre bovina, los resultados han sido diversos, sin embargo, como puntos en común, convergen en que la hemolisina b y la toxina Panton Valentine, son factores de virulencia que podrían participar en el desarrollo de la mastitis subclínica, al tener como función principal, la formación de poros o lisis de leucocitos(2,41,42). Lo que podría confirmarse con los resultados en este estudio, las cepas al tener en baja frecuencia o nula, los genes de estas toxinas (tanto el de la hemolisina como la toxina Panton Valentine) no se asociaron a casos de mastitis subclínica. No se estableció una relación de estas cepas con cuadros clínicos particulares en la ubre bovina; sin embargo, las cepas tienen importancia epidemiológica por la presencia de genes de enterotoxinas, éstas podrían contaminar por arrastre durante la ordeña de leche y en última instancia encontrarse en el producto lácteo final y ocasionar un problema de intoxicación alimentaria(43). Cuadro 4: Factores de virulencia de cepas de S. aureus aisladas de ubres de vaca Factor de virulencia

n(%), N= 67

Enterotoxinas seA seB seC seD seE tsst-1 Toxinas hlB pvL Enzimas saK mecA

7 (10.44) 2 (2.98) 1 (1.49) 4 (5.97) 23 (34.32) 2 (2.98) 3 (4.47)

En cuanto a la tipificación molecular de las cepas de S. aureus, el porcentaje de tipificación ha presentado variaciones importantes en relación al tiempo; en los años cercanos al inicio del uso de la técnica de PCR- RFLP`s del gen coag, se logró la tipificación del 100 % de las cepas(44-48); no obstante, en los últimos años este porcentaje disminuye hasta 40 %(29,30,49), lo

674


Rev Mex Cienc Pecu 2021;12(3):665-680

cual aún es más alto del porcentaje determinado en este estudio (19.47 %) (Figura 1a). En este sentido, se deben de considerar dos eventos, en primera instancia se ha propuesto que la disminución en el porcentaje de tipificación podría estar relacionado a mutaciones en el gen de la coagulasa, que impacten en la especificidad de los oligonucleótidos planteados, pero que no afectan la actividad de la enzima, remarcando que los oligonucleótidos son los mismos que los usados en la técnica original y fueron establecidos desde 1992(22); por otro lado, es importante comparar los resultados en relación al tipo de hospedero del cual se aisló S. aureus, debido a que el cambio de hospedero podría involucrar cambios importantes en la cepa incluida la variabilidad del gen coag; sin embargo, si se compara el porcentaje de tipificación en estudios de S. aureus en vacas, los resultados varían considerablemente entre porcentajes de tipificación(29,30,44,49). Aunque el porcentaje de tipificación es bajo, se logró identificar un restrictotipo (400 pb, 350 pb) que agrupa cepas aisladas de diferentes vacas tanto del establo B (Figura 2c, carril 4) como el establo A (Figura 2b, carril 2,3 y 4; Figura 2c, carril 1,2 y 3), así como de temporada de lluvias (Figura 2b, carril 2; Figura 2c, carril 1,2 y 3) y de estiaje (Figura 2b, carril 3 y 4), lo cual evidencia la capacidad infectocontagiosa de S. aureus, y esto reafirma el papel de este microorganismo en casos de mastitis de tipo infeccioso, lo cual también remarca la importancia de adoptar medidas que eviten la transmisión del microorganismo en el ambiente lechero, al poder infectar al ganado bovino, alterar la calidad de la leche y el ganado debe ser considerado como una fuente de contaminación importante en la producción de derivados lácteos. Figura 2: Electroforesis de la restricción del gen coag de cepas aisladas de la piel de la ubre bovina

A) 1, S528; 2, testigo positivo (S. aureus ATCC25923); 3, testigo negativo; 4, MPM; 5, S519 (PL); 6, S520 (PL); 7, S530 (PL); 8, S618; 9, S673 (PS). B) 1, S673 (PS); 2, S665 (PL); 3, 668 (PS); 4, 669 (PS); 671 (PS); 6, MPM c) 1, S522 (PL); 2, S528 (PL); 3, S529 (PL); 4, S521 (CL); 5, MPM (100 PB); 6, S517 (PL); 7, S643 (CS); 8, S650 (CS); 9, S618 (BL). a= establo A; b= establo B, L= lluvias; S= secas.

675


Rev Mex Cienc Pecu 2021;12(3):665-680

Conclusiones e implicaciones En este estudio, no se encontró una relación entre la presencia de S. aureus en la piel del pezón de la ubre de ganado bovino con el desarrollo de mastitis; sin embargo, se determinaron cepas con genes para enterotoxinas, las cuales son un problema de salud pública. Además, se evidenció la transmisión de cepas en los establos lecheros, lo que remarca la importancia de las buenas prácticas de ordeño. Agradecimientos y conflictos de intereses Se les extiende un agradecimiento a todos los propietarios del ganado bovino incluido en este estudio, quienes accedieron a participar y colaboraron en el manejo del ganado durante la toma de muestra, y que además siempre externaron su preocupación por la salud de su ganado. Un agradecimiento especial a la Dra. Elvia Rodríguez Bataz, por los comentarios finales de la revisión del manuscrito. Literatura citada: 1. Pumipuntu N, Tunyong W, Chantratita N, Diraphat P, Pumirat P, Sookrung N, et al. Staphylococcus spp. associated with subclinical bovine mastitis in central and northeast provinces of Thailand. Peer J 2019;7:e6587. doi:10.7717/peerj.6587. 2. Rainard P, Foucras G, Fitzgerald JR, Watts JL, Koop G, Middleton JR. Knowledge gaps and research priorities in Staphylococcus aureus mastitis control. Transbound Emerg Dis 2018;65:149–165. 3. Islam MA, Islam MZ, Islam M, Rahman M, Islam MT. Prevalence of subclinical mastitis in dairy cows in selected areas of Bangladesh. Trop Anim Health Prod 2012;9(1):73– 78. 4. Zecconi AA, Calvinho LFL, Fox K. Staphylococcus aureus intramammary infections. International Dairy Federation; 2006. Report No 408. 5. Botrel MA, Haenni M, Morignat E, Sulpice P, Madec JY, Calavas D. Distribution and antimicrobial resistance of clinical and subclinical mastitis pathogens in dairy cows in Rhône-Alpes, France. Foodborne Pathog Dis 2010;7(5):479–487. 6. Bradley AJ, Leach KA, Breen JE, Green LE, Green MJ. Survey of the incidence and aetiology of mastitis on dairy farms in England and Wales. Vet Rec 2007;160(8):253– 258.

676


Rev Mex Cienc Pecu 2021;12(3):665-680

7. da Costa LB, Rajala-Schultz PJ, Hoet A, Seo KS, Fogt K, Moon BS. Genetic relatedness and virulence factors of bovine Staphylococcus aureus isolated from teat skin and milk. J Dairy Sci 2014;97(11):6907–6916. 8. Peton V, Le Loir Y. Staphylococcus aureus in veterinary medicine. Infect Genet Evol 2014;21:602–615. 9. Halasa T, Huijps K, Østerås O, Hogeveen H. Economic effects of bovine mastitis and mastitis management: A review. Vet Q 2007;29(1):18–31. 10. Balaban N, Rasooly A. Staphylococcal enterotoxins. Int J Food Microbiol 2000;61(1):1– 10. 11. Honeyman AL, editor. Staphylococcus aureus infection and disease. New York, NY: Kluwer Acad./Plenum Publ; 2001. 12. Fetsch A, Johler S. Staphylococcus aureus as a foodborne pathogen. Curr Clin Microbiol Rep 2018;5(2):88–96. 13. Neave FK, Dodd FH, Kingwill RG, Westgarth DR. Control of mastitis in the dairy herd by hygiene and management. J Dairy Sci 1969;52(5):696–707. 14. Schreiner DA, Ruegg PL. Relationship between udder and leg hygiene scores and subclinical mastitis. J Dairy Sci 2003;86(11):3460–3475. 15. Zadoks RN, van Leeuwen WB, Kreft D, Fox LK, Barkema HW, Schukken YH, et al. Comparison of Staphylococcus aureus isolates from bovine and human skin, milking equipment, and bovine milk by phage typing, pulsed-field gel electrophoresis, and binary typing. J Clin Microbiol 2002;40(11):3894–33902. 16. Capurro A, Aspán A, Ericsson UH, Persson WK, Artursson K. Identification of potential sources of Staphylococcus aureus in herds with mastitis problems. J Dairy Sci 2010;93(1):180–191. 17. Haveri M, Hovinen M, Roslof A, Pyorala S. Molecular types and genetic profiles of Staphylococcus aureus strains isolated from bovine intramammary infections and extramammary sites. J Clin Microbiol 2008;46(11):3728–3735. 18. Mørk T, Kvitle B, Jørgensen HJ. Reservoirs of Staphylococcus aureus in meat sheep and dairy cattle. Vet Microbiol 2012;155(1):81–87. 19. Asadollahi P, Delpisheh A, Hossein MM, Azizi JF, Alikhani MY, Asadollahi K, et al. Enterotoxin and exfoliative toxin genes among methicillin-resistant Staphylococcus aureus isolates recovered from Ilam, Iran. Avicenna J Clin Microb Infec 2014;1(2):20208. doi:10.17795/ajcmi-20208.

677


Rev Mex Cienc Pecu 2021;12(3):665-680

20. Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun 2002;70(2):631–341. 21. Milheiriço C, Oliveira DC, de Lencastre H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother 2007;51(9):3374–3377. 22. Goh SH, Byrne SK, Zhang JL, Chow AW. Molecular typing of Staphylococcus aureus on the basis of coagulase gene polymorphisms. J Clin Microbiol 1992;30(7):1642–1645. 23. Keane OM. Symposium review: Intramammary infections—major pathogens and strainassociated complexity. J Dairy Sci 2019;102(5):4713–4726. 24. Bradley AJ. Bovine Mastitis: An evolving disease. Vet J 2002;164(2):116–128. 25. Moyes KM. Triennial lactation symposium: Nutrient partitioning during intramammary inflammation: A key to severity of mastitis and risk of subsequent diseases? J Anim Sci 2015;93(12):5586–5593. 26. Joshi S, Gokhale S. Status of mastitis as an emerging disease in improved and periurban dairy farms in India. Ann N Y Acad Sci 2006;1081(1):74–83. 27. Morse D, DeLorenzo MA, Wilcox CJ, Collier RJ, Natzke RP, Bray DR. Climatic effects on occurrence of clinical mastitis. J Dairy Sci 1988;71(3):848–853. 28. Smith KL, Todhunter DA, Schoenberger PS. Environmental mastitis: cause, prevalence, prevention. J Dairy Sci 1985;68(6):1531–1553. 29. Javid F, Taku A, Bhat MA, Badroo GA, Mudasir M, Sofi TA. Molecular typing of Staphylococcus aureus based on coagulase gene. Vet World 2018;11(4):423–430. 30. Sharma V, Sharma S, Dahiya DK, Khan A, Mathur M, Sharma A. Coagulase gene polymorphism, enterotoxigenecity, biofilm production, and antibiotic resistance in Staphylococcus aureus isolated from bovine raw milk in North West India. Ann Clin Microbiol Antimicrob 2017;16(1):65. doi:10.1186/s12941-017-0242-9. 31. Hirotaki S, Sasaki T, Kuwahara-Arai K, Hiramatsu K. Rapid and accurate identification of human-associated Staphylococci by use of multiplex PCR. J Clin Microbiol 2011;49(10):3627–3631. 32. Vannuffel P, Heusterspreute M, Bouyer M, Vandercam B, Philippe M, Gala JL. Molecular characterization of from and-based discrimination of staphylococcal species. Res Microbiol 1999;150(2):129–141.

678


Rev Mex Cienc Pecu 2021;12(3):665-680

33. Braem G, Stijlemans B, Van Haken W, De Vliegher S, De Vuyst L, Leroy F. Antibacterial activities of coagulase-negative Staphylococci from bovine teat apex skin and their inhibitory effect on mastitis-related pathogens. J Appl Microbiol 2014;116(5):1084– 1093. 34. Carson DA, Barkema HW, Naushad S, De Buck J. Bacteriocins of Non-aureus Staphylococci isolated from bovine milk. Appl Environ Microbiol 2017;83(17) doi:10.1128/AEM.01015-17. 35. Derakhshani H, Fehr KB, Sepehri S, Francoz D, De Buck J, Barkema HW, et al. Invited review: Microbiota of the bovine udder: Contributing factors and potential implications for udder health and mastitis susceptibility. J Dairy Sci 2018;101(12):10605–10625. 36. Hogan J, Smith KL. Managing environmental mastitis. Vet Clin North Am Food Anim Pract 2012;28(2):217–224. 37. Kadariya J, Smith TC, Thapaliya D. Staphylococcus aureus and Staphylococcal Foodborne disease: An ongoing challenge in public health. BioMed Res Int 2014;2014:1–9. 38. Tong SYC, Davis JS, Eichenberger E, Holland TL, Fowler VG. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev 2015;28(3):603–661. 39. van Wamel WJB, Rooijakkers SHM, Ruyken M, van Kessel KPM, van Strijp JAG. The innate immune modulators Staphylococcal complement inhibitor and chemotaxis inhibitory protein of Staphylococcus aureus are located on hemolysin-converting bacteriophages. J Bacteriol 2006;188(4):1310–1315. 40. Argudín MÁ, Mendoza MC, Rodicio MR. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2010;2(7):1751–1773. 41. Foster TJ. Immune evasion by staphylococci. Nat Rev Microbiol 2005;3(12):948–958. 42. van Kessel KPM, Bestebroer J, van Strijp JAG. Neutrophil-mediated phagocytosis of Staphylococcus aureus. Front immunol 2014;26(5):467. doi: 10.3389/fimmu.2014.00467. 43. Piccinini R, Cesaris L, Daprà V, Borromeo V, Picozzi C, Secchi C, et al. The role of teat skin contamination in the epidemiology of Staphylococcus aureus intramammary infections. J Dairy Res 2009;76(1):36–41. 44. Aarestrup FM, Dangler CA, Sordillo LM. Prevalence of coagulase gene polymorphism in Staphylococcus aureus isolates causing bovine mastitis. Can J Vet Res 1995;59(2):124–128.

679


Rev Mex Cienc Pecu 2021;12(3):665-680

45. Hookey JV, Richardson JF, Cookson BD. Molecular typing of Staphylococcus aureus based on PCR restriction fragment length polymorphism and DNA sequence analysis of the coagulase gene. J Clin Microbiol 1998;36(4):1083–1099. 46. Schlegelová J, Dendis M, Benedík J, Babák V, Rysánek D. Staphylococcus aureus isolates from dairy cows and humans on a farm differ in coagulase genotype. Vet Microbiol 2003;92(4):327–334. 47. Schwarzkopf A, Karch H. Genetic variation in Staphylococcus aureus coagulase genes: potential and limits for use as epidemiological marker. J Clin Microbiol 1994;32(10):2407–2412. 48. Su C, Herbelin C, Frieze N, Skardova O, Sordillo LM. Coagulase gene polymorphism of Staphylococcus aureus isolates from dairy cattle in different geographical areas. Epidemiol Infect 1999;122(2):329–336. 49. Momtaz H, Tajbakhsh E, Rahimi E, Momeni M. Coagulase gene polymorphism of Staphylococcus aureus isolated from clinical and sub-clinical bovine mastitis in Isfahan and Chaharmahal va Bakhtiari provinces of Iran. Comp Clin Path 2011;20(5):519–522.

680


https://doi.org/10.22319/rmcp.v12i3.5668 Artículo

Predicción molecular de serotipos de Streptococcus suis aislados de granjas porcinas en México

Arianna Romero Flores a Marcelo Gottschalk b Gabriela Bárcenas Morales a Víctor Quintero Ramírez a Rosario Esperanza Galván Pérez c Rosalba Carreón Nápoles c Ricardo Ramírez R. d José Iván Sánchez Betancourt c Abel Ciprián Carrasco a Susana Mendoza Elvira a *

a

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán. Cuautitlán Izcalli Estado de México, México. b

University of Montreal. College of Veterinary Medicine. Canada. 3200 Sicotte, SaintHyacinthe, Québec, Canada. c

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México. d

John Innes Centre, UK. Norwich Research Park Norwich, NR4 7UH, UK.

* Autor de correspondencia: seme_6@yahoo.com.mx

681


Rev Mex Cienc Pecu 2021;12(3):681-693

Resumen: Las infecciones causadas por Streptococcus suis (S. suis) representan un problema para la industria porcina en todo el mundo. Los cerdos a menudo portan múltiples serotipos de S. suis en el tracto respiratorio superior, de donde S. suis se aísla con frecuencia. El diagnóstico clínico de la infección es presuntivo y generalmente se basa en signos clínicos, la edad del animal y lesiones macroscópicas. En el laboratorio, la identificación de S. suis se realiza bioquímicamente, y luego, se realiza la serotipificación con antisueros para determinar el serotipo, pero estas pruebas pueden no ser concluyentes. A la fecha, existen pocos estudios que han documentado la presencia y diversidad de serotipos de S. suis en México. En el presente estudio, se caracterizaron cepas de S. suis de granjas porcinas mexicanas utilizando enfoques moleculares; las muestras se procesaron primero mediante PCR del gen gdh para detectar S. suis. Después, las muestras positivas se sometieron a una PCR múltiple de dos pasos (PCR cps) para detectar y caracterizar cada cepa; el primer paso consistió en una PCR de agrupación y el segundo paso consistió en una PCR de tipificación. Los serotipos detectados en las áreas de cría de cerdos de México incluyeron 1/2, 2, 3, 5, 7, 8, 9, 17 y 23. Estos hallazgos son importantes para la caracterización de los serotipos presentes en México y para la prevención de brotes. Palabras clave: PCR gdh, Granjas porcinas, Serotipos, Streptococcus suis.

Recibido: 21/04/2020 Aceptado: 04/12/2020

Introducción Streptococcus suis (S. suis) es un patógeno importante en varios países de Europa, Asia y América. Esta especie bacteriana causa septicemia, meningitis, endocarditis, encefalitis y bronconeumonía en cerdos y es un agente zoonótico(1). La mayoría de los cerdos portan cepas de múltiples serotipos en sus tractos respiratorios superiores(2,3). Los síntomas de la infección a menudo se encuentran en lechones a partir de las dos semanas de edad, pero son más comunes en cerdos recién destetados(4). S. suis crece en placas de agar sangre (PAS) y aparece como pequeñas colonias α-hemolíticas con un diámetro de 0.5 a 1 mm. Las colonias son grisáceas o transparentes y son ligeramente mucoides. Cuando se utiliza la tinción de Gram, los cocos aparecen aislados, en pares y en cadenas cortas. S. suis es una bacteria facultativamente anaeróbica, inmóvil y catalasa y oxidasa negativa, que exhibe metabolismo fermentativo y produce ácido a partir de azúcares, incluido el manitol. S. suis también es amilasa positiva, Voges-Proskauer negativa, NaCl positiva, y resistente a la optoquina; esta bacteria tiene una cápsula con epítopos que permiten la identificación de 35 serotipos.

682


Rev Mex Cienc Pecu 2021;12(3):681-693

La identificación de S. suis se realiza a través de métodos bacteriológicos, y se recomienda que las pruebas bioquímicas se complementen con serotipificación confirmatoria. La serotipificación es una parte importante del diagnóstico rutinario y se basa en antígenos polisacáridos capsulares que se encuentran en la superficie de las cepas de S. suis, aunque algunas cepas de casos clínicos se han considerado no tipificables(3). En los últimos 12 años, más de 4,500 cepas han sido serotipadas de cerdos enfermos en todo el mundo; los serotipos que se aislaron con mayor frecuencia fueron, en orden decreciente, 2 (28 %), 9 (19.4 %) y 3 (15.9 %), seguidos de los serotipos 1/2 y 7(5). La distribución de los serotipos aislados de cerdos infectados varía según la ubicación geográfica(6), pero el serotipo 2 se aísla con mayor frecuencia en casos de meningitis tanto de cerdos como de humanos(7). El diagnóstico presuntivo de la infección por S. suis en lechones a menudo se basa en signos clínicos y lesiones macroscópicas; la confirmación se logra aislando el agente infeccioso y observando lesiones microscópicas en los tejidos afectados(3). Para los casos clínicos en cerdos, el aislamiento y la identificación de cepas son relativamente fáciles; la identificación exitosa se puede lograr utilizando un mínimo de pruebas bioquímicas, y la confirmación se puede lograr mediante la serotipificación basada en antígenos polisacáridos capsulares. Sin embargo, el uso de kits bioquímicos rápidos y multiprueba puede ser engañoso, ya que algunas cepas de S. suis pueden identificarse erróneamente como Streptococcus pneumoniae, S. bovis y estreptococos del grupo viridans (por ejemplo, S. anginosus y S. vestibularis). Del mismo modo, aunque la serotipificación debe ser parte de la identificación rutinaria de cepas de S. suis recuperadas de cerdos y humanos enfermos para confirmar aún más la identidad del patógeno, puede haber reacciones cruzadas entre los serotipos. Las técnicas de serotipificación son relativamente simples; sin embargo, la producción de antisueros es laboriosa, requiere mucho tiempo y es costosa. Además, hay cepas que no pueden ser serotipadas utilizando antisueros(1). Una desventaja de la serotipificación con antisueros es que las cepas no encapsuladas no pueden ser caracterizadas y se denominan no tipificables. Estas cepas se identifican utilizando técnicas moleculares como la PCR siempre y cuando no se hayan modificado los genes del grupo de genes de la cápsula (cps)(8). Clonado el gen que codifica la glutamato deshidrogenasa (gdh) de S. suis tipo 2, observaron que, al igual que los genes que codifican otros GDH, el gen de S. suis estaba altamente conservado y tenía una tasa de mutación muy baja en relación con la de otros genes. Con la ayuda de PCR gdh, se pueden identificar aislados de S. suis. La PCR gdh se ha utilizado como una técnica de diagnóstico rápida y fiable para muestras de animales sanos y enfermos, y también es valiosa en casos humanos(7). En el presente estudio, la caracterización de cepas de S. suis aisladas de animales enfermos, incluida la determinación del serotipo, se realizó mediante técnicas moleculares, PCR del gen gdh y PCR múltiple (8,9). El objetivo de este estudio fue determinar los serotipos de S. suis presentes en granjas porcinas ubicadas en diferentes zonas de la República Mexicana. 683


Rev Mex Cienc Pecu 2021;12(3):681-693

Material y métodos Recolección e identificación de muestras microbiológicas Se obtuvieron sesenta y tres (63) muestras de órganos de cerdos con signos clínicos característicos de infección por S. suis de diferentes granjas de la República Mexicana. Las muestras se maceraron en solución salina estéril tamponada con fosfato, se rayaron sobre PAS al 5 % y luego se incubaron a 37 °C durante 24 h. Se seleccionaron colonias que estaban formadas por cocos α-hemolíticos, Gram positivos, agrupados en cadenas, catalasa y oxidasa negativos.

PCR del gen gdh La extracción de ADN se realizó utilizando el sistema de purificación de ADN Wizard Plus SV minipreps (Promega, Madison, WI, EE. UU.), seguido de PCR gdh para identificar cepas de S. suis utilizando un kit Invitrogen (Thermo Fisher Scientific, Carlsbad, CA, EE. UU.). Las reacciones se ejecutaron en un termociclador Techne Progene bajo las siguientes condiciones: 2 min a 40 °C, 5 min a 94 °C, 35 ciclos (1 min a 94 °C, 1 min a 55 °C y 1 min a 72 °C), y 7 min a 72 °C. El número de acceso de GenBank de la secuencia utilizada para diseñar los cebadores fue AF229683.1. La secuencia de los cebadores es JP4 (5´ GCAGCGTATTCTGTCAAACG 3´) y JP5 (5´CCATGGACAGATAAAGATGG 3´). Los productos de reacción se visualizaron en un gel de agarosa al 2 %, teñido con GelRed, utilizando un sistema de bioimagen Gene Genius (Artisan Technology Group, Champaign, IL, EE. UU.)(9). Cuadro 1. Secuencias de los cebadores (5’ a 3’) utilizadas en este estudio y los tamaños predichos de los productos de PCR [Okura, et al 2014](8) Grupo o tipo de cps Tamaño (pb) de los Hacia adelante Reverso de destino productos TGGTTCAAATATCA ATTGGTTGTGAGT I 933 ATGCTC GCATTG TCAAAATACGCAC CACTCACCTGCCC II 823 CTAAGGC CAAGAC TGATTTGGGTGAG CTCATGCTGGATA III 583 ACCATG ACACGT ACAGTCGGTCAAG TCAGCTTGGGTAA IV 455 ATAATCG TATCTGG GGAAAGATGGAGG CCAACCAGACTCA V 265 ACCAGC TATCCCC GATGCCCCAAGCG GGACCAACAATGG III y VI 146 ATATGCC CCATCTC GACGCACCAAGTG GGTCCGACAATAGCCATTTC ATATGCC

684


Rev Mex Cienc Pecu 2021;12(3):681-693

Para la tipificación de PCR GRUPO I

Hacia adelante

Reverso

GGTTTTGATTGGTC TAGTTG TATGGTTAAAGGT 13 GGAACTG TAATGGGATAGTT 18 GCGTTAC

CTCTAAAGCTCGA TATCTAC CCTTGTATATATTC CCTCCA ATACATAAAGTTG TCCTGCG

TTAGCAACGTTGCC AATAAG GCTCACTATTTTTA 6 CATTACAC TTAGACAGACACC TTATAGG AAGGTTATCCACG 16 AAAGATG AGACACTGCTTGC 27 ATTATTG

AATCCTCCATTAA AACCCTG TATTACTCCGCCA AATACAG CTAGCTTCGTTAC TTGATTC TCCGGCAATATTC TTTCAAG TCAGAATTACTTC CTGTTGC

TATCATATTGAGAA TCTTCCC ATTATGTTGGTTGC 28 AGAAGG TTCTGGGATTTTAG 29 GAATGC TATTGCACTAGCTT 30 CAGAAC

TTGCGTAGCATAC AAAGTTC CGACTCAATTGTT GTAGTAG CATGAAATACGCA CTTGTAC TGCATCCATAGTT GTATTCG

GACTATCTGTATAC CCAAAC ATCTTAGGAATGAT TCGGAC AACTACCTACCTG AACTTTG TAGCATCAGTTTAT ACGAGG GTGTCGCAAATCA AGTATTG TAATGTATGCTCTG TCACTG

TCCTTCCAAGTAT TCTCTAG ACCAGATATCTGA GCAAATG AGTCTAAAAGTGA TCGAGTC TAGTTTATCTGTG ACACACC AAGCTAGTACAAC AAGCATG AACGAAACGGAAT AGTTTGC

AAATAAGGTAGGA GCTACTC

ATCCAACCTTAGC TTTCTGT

3

Tamaño (pb) de los productos 214 408 617

GRUPO II 2 y 1/2

1 y 14

173 278 386 494 655

GRUPO III 21

160 272 415 568

GRUPO IV 4 5 7 17 19 23

903 720 566 455 348 221

GRUPO V 8

685

446


Rev Mex Cienc Pecu 2021;12(3):681-693

ATCGTTTTGAGATT GAGTGG TGTGGATTTCTGGG 20 ATAATC GCATTATCAGGATT 22 CTTTCC GTTTGCTCCGATCA 25 TAATAG

TAAACGGATTCGG TTACTCA TGTGGACGAATTA CTACTTG CCAATTGGGTGTT CAAAAAG CCAGTAAAAGGAC TCAATAC

GAAAGTAGGTATA TCTCAGC TTTCCCATTTGCTT ATGGAC ATGCGATTGCAAC AATTGAC AACAGGTATTTCA GGATTGC TACTGAGATTTATT GGGACG TTATACCGAAATTT TGTTGCC GATGTTTTCAACAG GTGTAC

GGGCTATTAAAAC TCCTATC GGAATAAAAACG ATTGGGAG AGGCATGAGTAAT ACATAGG CTCGGATAAAGAT AATCAGC AAGCGATTGGATT ACATTGC CGTCAATCATATA AAGTGGG CAAAGTACCTATT TTCAGCG

ACAATCGTTTCTGC AATACG AACCGCTGTTGAAT 32 TAAGAG AAGTTTCATTCGAG 34 GACTTC

GATGAAAACATCG TTGGTAG TTCGTTAGTTGAA CTGTTCC GTATATAACACCG CAAGAAG

15

542 698 296 174

GRUPO VI 9 10 11 12 24 26 33

368 633 833 131 224 472 710

GRUPO VII 31

842 570 246

Control interno ARNr 16S

GAGTTTGATCCTGG AGAAAGGAGGTG CTCAG ATCCAGCC

1542-1553

PCR múltiple de dos pasos Para determinar los serotipos, se utilizó una PCR múltiple de dos pasos. En primer lugar, se realizó una PCR de agrupación bajo las siguientes condiciones de termociclador: 15 min a 95 °C, 30 ciclos (30 s a 94 °C, 90 s a 90 °C y 60 s a 72 °C), y 10 min a 72 °C. En segundo lugar, se realizó una PCR tipificación bajo las siguientes condiciones de termociclador: 15 min a 95 °C, 30 ciclos (30 s a 94 °C, 90 s a 53 °C y 90 s a 72 °C), y 10 min a 72 °C, utilizando un termociclador Biometra (Biometra, Göttingen, Alemania). Se utilizó la mezcla maestra de PCR multiplex Qiagen, y los productos de PCR se visualizaron por electroforesis en un gel de agarosa al 2 % (100 V, 40 min)

686


Rev Mex Cienc Pecu 2021;12(3):681-693

teñido con GelRed(8). Las secuencias de los cebadores y los tamaños de producto predichos para cada tipo de PCR(10) se muestran en el Cuadro 1.

Resultados Recolección e identificación de muestras microbiológicas De las 63 muestras (pulmón, corazón y cerebro) recolectadas de animales, 23 fueron positivas para S. suis por PCR, con un producto de 688 pb de longitud amplificado mediante PCR gdh (Figura 1). Figura 1: Geles de agarosa (2 %) que muestran resultados de la PCR gdh

Carril 1, marcador de 100–1,000 pb; carril 2, control negativo, C(−); carril 3, control positivo, C(+) = S. suis serotipo 2; carriles 4 a 8, muestras de animales enfermos.

PCR del gen gdh

Los resultados de la PCR de agrupación se muestran en la Figura 2; las muestras se asignaron a los siguientes grupos en función de los tamaños de los productos de PCR: I, II, IV, V y VI, correspondientes a los tamaños de productos de PCR de 933, 823, 455, 265 y 146 pb, respectivamente. La Figura 3 muestra los resultados de la PCR de tipificación, en la que se determinó el serotipo de cada muestra. Los serotipos 1/2 y 2 se caracterizaron por el mismo tamaño de sus productos de PCR (173 pb); los serotipos 3, 5, 7, 8, 9, 17 y 23 produjeron fragmentos de PCR de 214, 720, 566, 446, 368, 445 y 221 pb, respectivamente. Para diferenciar los serotipos 1/2 y 2, se utilizó la coaglutinación con antisueros específicos.

687


Rev Mex Cienc Pecu 2021;12(3):681-693

Figura 2: Geles de agarosa (2 %) que muestran los resultados de la PCR de agrupación

Gel A: carril Mbp, marcador de 100-1,000 pb; carril C(−), testigo negativo; carril C(+), serotipo 2 de S. suis; carriles 1 a 5, muestras de S. suis. Gel B: carril Mbp, marcador de 100-1,000 pb; carril C(−), testigo negativo; carril C(+), serotipo 2 de S. suis; carriles 1 a 8, muestras.

Figura 3: Gel de agarosa (2 %) que muestra los resultados de la PCR de tipificación

Carril pb, marcador de 100–1,000 pb; carril 1, serotipo 3 de S. suis; carriles 2 a 5, muestras positivas para los serotipos 2 y 1/2; carril 6, serotipo 5 de S. suis; carriles 7 y 8, serotipo 7 de S. suis.

PCR múltiple de dos pasos

Los resultados de multiplexar la PCR se muestran en el Cuadro 2, el cual resume la información de las zonas geográficas donde se recolectaron las muestras, los órganos procesados y los serotipos identificados.

688


Rev Mex Cienc Pecu 2021;12(3):681-693

Cuadro 2: Resultados con la zona geográfica donde se recolectaron las muestras, los órganos procesados y los serotipos Zona geográfica Perote-Veracruz Perote-Veracruz Perote-Veracruz Perote-Veracruz Perote-Veracruz Perote-Veracruz Perote, Veracruz Jalisco Jalisco Jalisco Jalisco Jalisco Jalisco Jalisco Jalisco Jalisco Jalisco Puebla Puebla Puebla Puebla Puebla La Piedad Michoacán

Órgano

Serotipo

Cerebro Cerebro Cerebro Cerebro Pulmón Cerebro Cerebro Pulmón Corazón Pulmón Corazón Corazón Corazón Pulmón Pulmón Corazón Corazón Corazón Corazón Corazón Corazón Corazón Corazón

7 7 2 2 1/2 3 9 9 7 9 17 9 9 3 7 23 5 8 8 8 8 9 9

Discusión La PCR del gen gdh es una técnica atractiva para su uso tanto en laboratorios clínicos como en estudios epidemiológicos(9). No obstante, debido a la complejidad de la serotipificación de las cepas de S. suis (8), se ha desarrollado una PCR múltiple de dos pasos. Se secuenciaron y analizaron un grupo de genes de cepas pertenecientes a los 35 serotipos y reportaron que 31 de los serotipos (3 a 13 y 15 a 34) tenían genes específicos, mientras que los serotipos 1 y 14, así como los 2 y 1/2 eran casi idénticos. En el primer paso de la PCR múltiple, las cepas se clasifican en siete grupos de genes cps, llamados grupos de homología (GH). Estos genes cps se agrupan dentro del mismo locus en el cromosoma. A cada GH se le asigna un número (I-VII) e incluye serotipos específicos de S. suis. La PCR de tipificación detecta genes cps específicos para cada grupo e identifica el serotipo. La serotipificación molecular utilizando PCR múltiple es atractiva porque ya no se 689


Rev Mex Cienc Pecu 2021;12(3):681-693

requieren animales para la producción de los 35 antisueros, ya que los antisueros solo son necesarios para identificar los serotipos 1, 1/2, 2 y 14(11). Anteriormente, S. suis se había clasificado en 35 serotipos (1/2 y 1-34), y luego, el número de serotipos se redujo a 33 porque las cepas de los serotipos 32 y 34 se reclasificaron como Streptococcus orisratti. Más recientemente, se ha propuesto eliminar las cepas de los serotipos 20, 22, 26 y 33 del taxón S. suis (12); sin embargo, en el presente estudio, ninguna de las cepas mexicanas aisladas perteneció a estos serotipos. En este estudio, se determinaron serotipos de cepas de S. suis aisladas de animales enfermos de granjas porcinas mexicanas, y el tiempo de diagnóstico se redujo, lo que fue una ventaja sobre los métodos de diagnóstico rutinarios. Se encontró que el serotipo 9 fue predominante en siete muestras, aisladas ya sea de Jalisco (cuatro muestras), Veracruz, Michoacán o Puebla (una muestra cada uno), seguido del serotipo 7, con cuatro muestras de Jalisco y Veracruz (dos muestras cada uno), y el serotipo 8, con cuatro muestras de Puebla. Dos muestras de Veracruz fueron positivas para el serotipo 2, y dos muestras de Jalisco y Veracruz fueron positivas para el serotipo 3. Una muestra cada uno fue positiva para los serotipos 1/2, 5, 17 y 23. Jalisco fue el estado que presentó la mayor variación en los serotipos, con seis aislamientos diferentes de pulmón y corazón pertenecientes a los serotipos 3, 5, 7, 9, 17 y 23. En Veracruz se detectaron cinco serotipos en las muestras de pulmón y cerebro. Puebla estuvo representada por dos serotipos de muestras de corazón. Sólo se detectó un serotipo en una muestra de corazón de Michoacán. La evaluación del serotipo es una herramienta valiosa para comprender la epidemiología de un brote en particular, y la serotipificación también aumenta el éxito de los programas de vacunación dentro de las granjas. Hasta donde se sabe, este es el primer reporte sobre la distribución de serotipos de S. suis en áreas dedicadas a la cría de cerdos en México. Se encontró que los serotipos predominantes de S. suis fueron comparables a los reportados por Gottschalk et al(10) entre 2008 y 2011, quienes confirmaron una prevalencia relativamente baja del serotipo 2 en América del Norte en comparación con la de los países europeos y asiáticos. Entre otros serotipos, los serotipos 1/2, 5, 9 y 14 también se han asociado con brotes en cerdos en América del Norte y Europa(10). Aunque no se evaluó la prevalencia, el serotipo 9 fue el más frecuente, seguido de los serotipos 7 y 8. Estos resultados apoyan una hipótesis previa que sugiere que una menor prevalencia del serotipo 2 de S. suis es común en los países de América del Norte(3). Dado que las cepas del serotipo 2 de América del Norte y de Europa son genotípica y fenotípicamente diferentes (con diferente potencial de virulencia)(13), sería interesante estudiar más a fondo las cepas de México para determinar a qué grupo de cepas pertenecen. Del mismo modo, se ha reportado que las cepas del serotipo 9 de Europa son más homogéneas y probablemente más virulentas que las cepas norteamericanas(14). También se necesita una mayor evaluación de las cepas mexicanas para predecir el nivel de patogenicidad de dichas cepas. Además, se necesitan más estudios, con un mayor número de aislamientos de México, para confirmar esta hipótesis. Aunque no existe una asociación clara entre los serotipos y una condición patológica determinada, se ha reportado que, en los países asiáticos, las cepas aisladas de cerdos enfermos pertenecían principalmente al serotipo 2, seguido de los 690


Rev Mex Cienc Pecu 2021;12(3):681-693

serotipos 3, 4, 5, 7, 8 y 1/2(15). En algunos países europeos, el serotipo 9 se recupera con mayor frecuencia de animales enfermos, seguido de los serotipos 1 y 14. Sin embargo, en Canadá, los serotipos 1/2, 2 y 3 son los tres serotipos más prevalentes, seguidos de los serotipos 4, 7 y 8(16). En humanos, el serotipo 2 es el serotipo aislado más prevalente, pero también se han reportado los serotipos 1, 4, 5, 14, 16 y 24(5). En América del Sur, sólo se han publicado dos estudios, ambos de Brasil, que reportaron el serotipo 2 como el más prevalente, con una media del 57.6 % de todos los casos, seguido, en orden decreciente de prevalencia, por los serotipos 1/2, 14, 7 y 9. Importantes países europeos productores de cerdos, como Dinamarca, Bélgica, Francia, Alemania, Italia y el Reino Unido, no han informado recientemente de la distribución de serotipos recuperados de casos clínicos en cerdos. Los últimos informes de estos países publicaron datos sobre cepas aisladas entre 1990 y 2000, y su falta de información es importante. Los únicos dos países con datos más recientes son España y los Países Bajos. De hecho, en España, el serotipo 2 ya no es el serotipo más prevalente; ahora es el segundo detrás del serotipo 9, seguido de los serotipos 7, 8 y 3. En los Países Bajos, el serotipo 9 fue el más prevalente entre 2002 y 2007, seguido de los serotipos 2, 7, 1 y 4. En estudios realizados antes de 2002, el serotipo 1 parecía ser prevalente en países como Bélgica y el Reino Unido(1).

Conclusiones e implicaciones Los serotipos detectados en las zonas de cría de cerdos de México incluyeron 1/2, 2, 3, 5, 7, 8, 9, 17 y 23. Jalisco fue el estado que presentó la mayor variación en los serotipos, con seis serotipos diferentes. En Veracruz se detectaron cinco serotipos en las muestras. Puebla estuvo representada por dos serotipos de las muestras. Sólo se detectó un serotipo en una muestra de Michoacán. La evaluación del serotipo es una herramienta valiosa para comprender la epidemiología de un brote en particular, y la serotipificación también aumenta el éxito de los programas de vacunación dentro de las granjas. Estos hallazgos son importantes para la caracterización de los serotipos presentes en México y para la prevención de brotes. Hasta donde se sabe, éste es el primer informe sobre la distribución de serotipos de S. suis en áreas dedicadas a la cría de cerdos en México. La investigación debe continuar para lograr una mejor comprensión de este microorganismo y tener datos más completos. El MALDI TOF MS es un método alternativo para identificar S. suis y la prueba gdh se consideró específica para S. suis. La PCR recN es la prueba reconocida como específica para S. suis y así continuar con las investigaciones. Agradecimientos Subsidios: DGAPA PAPIIT IN228516 y PIAPI2032; Beca: CONACYT-492133, Doctorado (Posgrado de Producción y Salud Animal).

691


Rev Mex Cienc Pecu 2021;12(3):681-693

Literatura citada: 1. Goyette-Desjardins G, Auger JP, Xu J, Segura M, Gottschalk M. Streptococcus suis, an important pig pathogen and emerging zoonotic agent-an update on the worldwide distribution based on serotyping and sequence typing. EMI 2014;3:45. doi:10.1038/emi.2014.45. 2. Flores JL, Higgins R, D'Allaire S, Charette R, Boudreau M, Gottschalk M. Distribution of the different capsular types of Streptococcus suis in nineteen swine nurseries. Can Vet J 1993;34(3):170–171. 3. Zimmerman JJ, Karriker LA, Ramirez A, Schwartz KJ, Gregory WS, Zhang J. Diseases of swine. 11th ed. Streptococcosis. John Wiley & Sons, Inc; 2019. 4. Wisselink HJ, Smith HE, Stockhofe-Zurwieden N, Peperkamp K, Vecht U. Distribution of capsular types and production of muramidase-released protein (MRP) and extracellular factor (EF) of Streptococcus suis strains isolated from diseased pigs in seven European countries. Vet Microbiol 2000;74:237–248. doi:10.1016/s0378-1135(00)00188-7. 5. Liu Z, Zheng H, Gottschalk M, Bai X, Lan R, Ji S, Xu J. Development of multiplex PCR assays for the identification of the 33 serotypes of Streptococcus suis. PLoS One 2013;8(8):e72070. doi:10.1371/journal.pone.0072070. 6. Haas B, Grenier D. Understanding the virulence of Streptococcus suis: A veterinary, medical, and economic challenge. Méd Mal Infect 2018;48(3):159–166. doi:10.1016/j.medmal.2017.10.001. 7. Gottschalk M. Porcine Streptococcus suis strains as potential sources of infections in humans: An underdiagnosed problem in North America? JSAP 2004;12(4):197–199. 8. Okura M, Lachance C, Osaki M, Sekizaki T, Maruyama F, Nozawa T, Takamatsu D. Development of a two-step multiplex PCR assay for typing of capsular polysaccharide synthesis gene clusters of Streptococcus suis. J Clin Microbiol 2014;52:1714–1719. doi:10.1128/jcm.03411-13. 9. Okwumabua O, O'Connor M, Shull E. A polymerase chain reaction (PCR) assay specific for Streptococcus suis based on the gene encoding the glutamate dehydrogenase. FEMS Microbiology Letters 2003;218(1):79–84. doi:10.1111/j.1574-6968.2003.tb11501. 10. Gottschalk M, Lacouture S, Bonifait L, Roy D, Fittipaldi N, Grenier D. Characterization of Streptococcus suis isolates recovered between 2008 and 2011 from diseased pigs in Quebec, Canada. Vet Microbiol 2013;162:819–825. doi:10.1016/j.vetmic.2012.10.028. 11. Kerdsin A, Akeda Y, Hatrongjit R, Detchawna U, Sekizaki T, Hamada S, Oishi K. Streptococcus suis serotyping by a new multiplex PCR. J Med Microbiol 2014;63:824–830. doi:10.1099/jmm.0.069757-0. 692


Rev Mex Cienc Pecu 2021;12(3):681-693

12. Okura M, Osaki M, Nomoto R, Arai S, Osawa R, Sekizaki T, Takamatsu D. Current Taxonomical situation of Streptococcus suis. Pathogens 2016;5(3):45. 13. Straw BE, Zimmerman, JJ, D´Allaire S, Taylor DJ. Diseases of swine. 9th ed. Streptococcosis. Blackwell Publishing. 2006. 14. Zheng H, Du P, Qiu X, Kerdsin A, Roy D, Bai X, Xu J, Vela AI, Gottschalk M. Genomic comparisons of Streptococcus suis serotype 9 strains recovered from diseased pigs in Spain and Canada. Vet Res 2019;49(1):1. doi: 10.1186/s13567-017-0498-2. Erratum in: Vet Res. 2019;16;50(1):62. PMID: 29316972; PMCID: PMC5759227. 15. Wei Z, Li R, Zhang A, He H, Hua Y, Xia J, Jin M. Characterization of Streptococcus suis isolates from the diseased pigs in China between 2003 and 2007. Vet Microbiol 2009;137(12):196–201. doi:10.1016/j.vetmic.2008.12.015. 16. Gottschalk M, Lacouture S. Canada: Distribution of Streptococcus suis (from 2012 to 2014) and Actinobacillus pleuropneumoniae (from 2011 to 2014) serotypes isolated from diseased pigs. Can Vet J 2015;56(10):1093-1094.

693


https://doi.org/10.22319/rmcp.v12i3.5670 Artículo

La coexistencia de Desmodus rotundus con la población humana en San Luis Potosí, México

Ximena Torres-Mejía a Juan José Pérez-Rivero b* Luis Alberto Olvera-Vargas c Evaristo Álvaro Barragán-Hernández d José Juan Martínez-Maya d Álvaro Aguilar-Setién e

a

Universidad Nacional Autónoma de México. Programa de Doctorado en Ciencias de la Producción y de la Salud Animal, Ciudad de México. México. b

Universidad Autónoma Metropolitana. Unidad Xochimilco. Departamento de Producción Agrícola y Animal. Calzada del Hueso 1100, Col. Villa Quietud, Alcaldía Coyoacán, 04960, Ciudad de México. México. c

Centro de Investigación y Asistencia en Tecnología y Diseño del Estado de Jalisco, A.C.

d

Universidad Nacional Autónoma de México. Departamento de Medicina Preventiva y Salud Pública, Facultad de Medicina Veterinaria y Zootecnia, Ciudad de México. México. e

Instituto Mexicano del Seguro Social. Unidad de Investigación Médica, Ciudad de México. México.

*Autor de correspondencia: jperezr@correo.xoc.uam.mx

Resumen: Desmodus rotundus es transmisor de enfermedades zoonóticas y emergentes a los humanos y al ganado, como el caso de la rabia. La mayoría de las enfermedades infecciosas están limitadas espacialmente por la presencia del transmisor, cuya abundancia y supervivencia 694


Rev Mex Cienc Pecu 2021;12(3):694-709

son influenciadas por las condiciones ambientales y la presencia de fuentes de alimentación. Una herramienta que facilita su estudio es el uso de los Sistemas de Información Geográfica. El objetivo de este estudio fue analizar la interacción de las poblaciones de murciélagos hematófagos y humanos, a través de la elaboración de un modelo probable de dispersión del D. rotundus basado en refugios conocidos y diferentes variables medioambientales, además de analizar la relación entre refugios identificados durante tres años y su cercanía con asentamientos humanos, como un proceso de coexistencia. El estudio se llevó a cabo en el estado de San Luis Potosí del año 2014 al 2016. Se identificaron un total de 180 refugios de D. rotundus distribuidos hacia la zona de la Huasteca, el 80 % de éstos fueron construidos por el hombre y el 57 % se encontraron habitados. Se calculó un buffer de 5 km a la redonda a partir de la ubicación de cada refugio, encontrando en su interior un total de 976 comunidades rurales y 15 ciudades, con 337,836 habitantes. La distancia media de los refugios hasta el primer asentamiento humano fue de 518.65 ± 11.33 m. Es necesario continuar estudiando la asociación entre la urbanización y el surgimiento de zoonosis, a través del entendimiento de las interacciones entre animales silvestres-ganadería - humanos. Palabras clave: Murciélago vampiro, Zoonosis, Población humana, Coexistencia, SIG.

Recibido: 20/04/2020 Aceptado: 28/10/2020

Introducción Los murciélagos son los mamíferos a los que se les reconoce como reservorios de virus potencialmente zoonóticos. Han sido asociados a diferentes agentes infecciosos como los de la familia Filoviridae (Ebolavirus, Marburgrvirus), los coronavirus (incluyendo el coronavirus del síndrome respiratorio agudo severo o SARS)(1,2) la rabia y otros Lyssavirus, un linaje de Influenza A y a varios de la familia Paramyxoviridae (Hendra (VHe) y de Nipah (VNi))(3). Estas enfermedades emergentes tienen potencial para causar epidemias, originadas por las interacciones entre murciélagos infectados, el agente infeccioso y el hospedador(2). En ocasiones existe un hospedador intermedio como lo son animales de compañía, silvestres o ganado, estos entran en contacto e infectan a los humanos incluso amplificando el virus(2,3). Es evidente que las interacciones que ocurren entre la vida silvestre, ganado y humanos no son aún bien comprendidas, es probable que ocurran en diferentes escalas de tiempo, espacio y en cierta organización ecológica, donde los vectores cambian su distribución principalmente por el cambio de uso suelo (agricultura, urbanización, recreación) o cambios climáticos(1,4). Los cambios en el ambiente, principalmente los ocasionados por la temperatura, precipitación pluvial y humedad, así como la altura sobre el nivel del mar y los

695


Rev Mex Cienc Pecu 2021;12(3):694-709

dados por las interacciones influencian la frecuencia y duración del contacto entre humanos y murciélagos, lo que puede favorecer la transmisión de patógenos a los primeros, la cual incluso parece ir en aumento(3,5,6). Virus como los de hepatitis C, parainfluenza, distemper canino, entre otros, que son comunes en animales y humanos tuvieron su origen en murciélagos(7). La rabia es la enfermedad viral proveniente de los murciélagos que más se ha estudiado (3). Existen tres especies de murciélagos hematófagos en América Latina, Diaemus youngi, Diphylla ecaudata y Desmodus rotundus (D. rotundus)(8). D. rotundus pertenece a la familia Phyllostomatidae, el cual se caracteriza por alimentarse de manera exclusiva de sangre de mamíferos incluso de humanos, se le ha considerado el principal transmisor de rabia en humanos y de rabia paralitica bovina (RPB) en el ganado, desde México hasta Sudamérica(9,10,11). El impacto económico a causa de los murciélagos vampiros es difícil de cuantificar, debido a que debilitan al ganado por a la pérdida de sangre, conducen a infecciones secundarias, reducen la producción de leche y carne además de conducir a la muerte si el ganado desarrolla RPB(12). En México, esta enfermedad se presenta de forma endémica en 25 estados desde el Pacifico por el sur de Sonora hasta Chiapas y del Golfo de México al sur de Tamaulipas hasta la Península de Yucatán(13,14). De los 255 casos de RPB reportados durante 2019, treinta (11.76 %) fueron notificados en San Luis Potosí(14), donde a pesar de las medidas de prevención y control establecidas (tratamiento con vampiricida y vacunación), se continúan presentando, inclusive ampliando su cobertura geográfica. Hasta el 2017 el estado de Nuevo León se consideró libre de RPB, sin embargo, en 2018 se notificaron tres casos, lo que demuestra un incremento en la dispersión del vector(14,15). Debido a que la transmisión de rabia y otras enfermedades infecciosas, puede tener efectos devastadores en la salud pública e incluso en la conservación de especies silvestres, es claro que el entendimiento ha sido limitado y se vuelve necesario tener distintos enfoques de las interacciones murciélago hematófago-patógeno-humanos. El conocimiento de la ecología del hospedero es esencial para la relación con la población humana en la transmisión de enfermedades y su dinámica. Es importante que las predicciones sean confiables para mejorar el conocimiento de los elementos que empujan la dinámica de la infección espacio temporal, para lograr prevenir enfermedades como la rabia en humanos, así como también en el ganado, se requiere el entendimiento de la dispersión de estos vectores, ya que son reconocidos como los principales transmisores de este virus a estas especies(3,5,16). Se considera que la mayoría de las enfermedades infecciosas están limitadas espacialmente por la presencia del transmisor, cuya abundancia y supervivencia son influenciadas por las condiciones ambientales y la presencia de fuentes de alimentación(17). Una herramienta que facilita el estudio de la distribución de vectores y estas variables es mediante el uso de los Sistemas de Información Geográfica (SIG)(18,19,20). 696


Rev Mex Cienc Pecu 2021;12(3):694-709

A través de modelos espaciales, como los de "Nicho Ecológico", se pueden predecir las áreas de mayor riesgo de transmisión de enfermedades infecciosas, lo que permite establecer prioridades para su atención mediante programas como MaxEnt® o DivaGis®(19,21,22). El modelo de máxima entropía (MaxEnt) es uno de los métodos más usados para estudiar la distribución de diferentes especies, prediciendo la idoneidad relativa del hábitat con funciones derivadas a partir de variables ambientales, evitando que el modelo sobreajuste los datos(22,23). Al igual que MaxEnt, DivaGis respalda el análisis de bases de datos de exploración o de ocurrencia para identificar patrones ecológicos y geográficos en la distribución de especies silvestres(24). De este modo, se ha permitido incluso la predicción de la influencia del cambio climático en la distribución de las especies y enfermedades, la mayoría de los modelos correlacionan la ocurrencia actual de la especie o enfermedad con las variables climáticas o a través del conocimiento de la historia natural de la enfermedad y la estimación de la respuesta fisiológica de la especie al cambio climático estimando su posible redistribución para futuros escenarios climáticos(19). Debido al cambio climático y los patrones de urbanización y que el D. rotundus es una especie con potencial para transmitir enfermedades como la rabia al humano y al ganado, las actividades de vigilancia epidemiológica y el control de este transmisor cobran relevancia, el objetivo de este estudio fue analizar la cercana relación entre D. rotundus y los humanos, a través de la elaboración de un modelo probable de dispersión MaxEnt del D. rotundus basado en los refugios conocidos y diferentes variables medioambientales, y analizar la relación entre los refugios encontrados y su cercanía con asentamientos humanos, como un proceso de coexistencia con el uso de Diva Gis.

Material y métodos El estudio se llevó a cabo en el estado de San Luis Potosí, el cual se encuentra localizado entre los 98°19'33.6 LO, 102°17'45.6 LO y los 21°9'36.72" LN a 24°29'29.4 LN. El clima que predomina es el seco y semiseco presente en el 71 % del estado, la temperatura media anual de 21 °C, siendo la temperatura mínima promedio de 8.4 °C en el mes de enero y la máxima promedio es alrededor de 32 °C en el mes de mayo. Las lluvias se presentan durante el verano en los meses de junio a septiembre, la precipitación media del estado es alrededor de 950 mm anuales(25).

Modelo de dispersión de Desmodus rotundus mediante MaxEnt Se realizó mediante los registros de ubicación de refugios notificados y visitados durante los años 2014-2016, obtenidos por el Comité Estatal para la Promoción y Protección de la

697


Rev Mex Cienc Pecu 2021;12(3):694-709

Ganadería de San Luis Potosí (CEFPPSLP). Obteniendo su longitud, latitud y altitud, además del municipio, el motivo de la acción, el número de vampiros capturados y tratados. Con los registros de ubicación de esos refugios, para el modelo de dispersión se utilizaron 24 variables ambientales (VA), 19 de ellas se descargaron de la base de datos Worldclim en resolución espacial de 1 km2(26,27). Además de otras cinco variables de clima(28) obtenidas del Instituto Nacional de Estadística Geografía e Informática (INEGI) uso de suelo(29), suelos(30), geología(31) y altitud(32) (Cuadro 1). Todas fueron convertidas a formato raster con una resolución espacial igual de las capas climáticas. Con un total de 181 datos ordenados en una base y exportada a un archivo delimitado por comas (CSV), para su posterior incorporación al software MaxEnt. Cuadro 1: Variables Ambientales consideradas para el modelo de dispersión en el estado de San Luis Potosí Código Variable ambiental VA1 VA2 VA3 VA4 VA5 VA6 VA7 VA8 VA9 VA10 VA11 VA12 VA13 VA14 VA15 VA16 VA17 VA18 VA19 VA20 VA21 VA22 VA23 VA24

Temperatura promedio anual (°C) Oscilación diurna de la temperatura (°C) Isotermalidad (cociente entre parámetros VA2 y VA7) Estacionalidad de la temperatura (coeficiente de variación, %) Temperatura máxima promedio del periodo más cálido (°C) Temperatura mínima promedio del periodo más frío (°C) Oscilación anual de la temperatura (diferencia entre parámetros VA5 y VA6) Temperatura promedio del cuatrimestre más lluvioso (°C) Temperatura promedio del cuatrimestre más seco (°C), Temperatura promedio del cuatrimestre más cálido (°C) Temperatura promedio del cuatrimestre más frío (°C) Precipitación anual (mm) Precipitación del periodo más lluvioso (mm) Precipitación del periodo más seco (mm) Estacionalidad de la precipitación (coeficiente de variación, %) Precipitación del cuatrimestre más lluvioso (mm) Precipitación del cuatrimestre más seco (mm) Precipitación del cuatrimestre más cálido (mm) Precipitación del cuatrimestre más frío (mm) Carta climática (tipos de clima) Uso de suelo (tipos) Suelos (tipo de edafología) Geología (tipo de rocas) Altitud (m.s.n.m)

698


Rev Mex Cienc Pecu 2021;12(3):694-709

Al tener solo datos de presencia, MaxEnt creó puntos de pseudoausencia y dividió la base en dos grupos de forma aleatoria: datos para entrenamiento, que es el modelo espacial y donde se consideró el 80 % de los registros de ubicación de los refugios, y datos de validación (test) del modelo, que considera el 20 % restante y mide la capacidad predictiva. El modelo de salida fue de tipo logístico con probabilidades de presencia previstas entre el rango binario(33). El resultado del modelo expresa entonces, el valor de la idoneidad del hábitat para la presencia de D. rotundus como una función de las variables ambientales, a través de una prueba estadística de validación denominado área bajo la curva (AUC por sus siglas en inglés) que indicó la sensibilidad, entendida como la probabilidad de obtener un resultado de presencia cuando la especie está presente, y mientras más cercano esté al valor a 1 más confiable es el resultado. Adicionalmente, el software calculó a partir de iteraciones el porcentaje de contribución al modelo de cada una de las variables ambientales usadas para la creación del modelo. Este análisis marca la similitud climática que hay entre los sitios donde están los refugios y donde posiblemente habite la especie.

Análisis del contacto potencial o coexistencia entre Desmodus rotundus y asentamientos o localidades humanas Con las coordenadas de los refugios habitados por D. rotundus, la base de datos fue exportada a un archivo de tipo shape (.shp), donde se generó una capa buffer con un radio de 5 km(34), a través del programa Qgis. Adicionalmente, se agregó otra capa shp con la información de la localización de comunidades rurales, de ellas solo se seleccionaron las que estuvieron dentro del buffer creado y otra con áreas urbanas, seleccionando aquellas que tocaran ese mismo buffer. Se contabilizó el número de asentamientos humanos (localidades rurales y áreas urbanas), así como su población, que potencialmente están dentro del buffer y por lo tanto mantienen interacciones con colonias de D. rotundus, además se calculó la distancia media del refugio a la vivienda más cercana.

Resultados Información de refugios Del año 2014 al 2016 se identificó un total de 180 refugios, de los cuales 67 fueron identificados durante 2014, 46 en 2015 y 67 en 2016. El 80 % de los refugios eran artificiales, de estos resaltan 3 casas abandonadas, 1 escuela, 1 bodega, una estación de autobús y un puente. El 20 % restante son refugios naturales como cuevas. La distribución de refugios tanto naturales como artificiales es mayor hacia la zona de la Huasteca en el suroriente del estado en diversos municipios. Con relación a la ocupación que guardaban los refugios según 699


Rev Mex Cienc Pecu 2021;12(3):694-709

la presencia de D. rotundus del total identificado, en 102 refugios (56.7 %) se lograron capturar entre 6 a 18 individuos; el resto se encontraron vacíos a pesar de que fueron visitados en promedio dos veces en ese año (Figura 1). Figura 1: Localización geográfica de los refugios vacíos y ocupados por Desmodus rotundus de 2014 a 2016 por el Comité Estatal para la Promoción y Protección de la Ganadería de San Luis Potosí (CEFPPSLP)

Análisis del contacto potencial o coexistencia entre Desmodus rotundus y asentamientos o localidades humanas Se consideró un radio de vuelo promedio del D. rotundus de 5 km a partir de la ubicación de cada refugio(34,35,36), y se realizaron buffers encontrando dentro de estos un total de 976 comunidades rurales, las cuales se encontraban habitadas desde 1 o hasta 3,124 habitantes, haciendo un total de 124,884 habitantes. De ellas, en 375 (38.4 %) tenían 10 o menos habitantes. Así como 15 ciudades con una población estimada en 212,952, lo que representa un total de 337,836 habitantes (Figura 2). Dado que los refugios de D. rotundus muestran conexión entre ellos, estos pueden ocupar un área de 3 a 6 km en promedio, dándoles la oportunidad de vuelos cortos para localizar presas(37), sin embargo, la distancia mínima que se ha encontrado sobre los movimientos en murciélagos vampiro en Argentina fue de 1.5 km(38). En cuanto a la distancia media de los refugios hasta el primer asentamiento con población humana fue de 518.65 ± 11.33 m, esta distancia puede ser fácilmente recorrida para la búsqueda de alimento, lo que implica que hay una directa o indirectamente una interacción a distintos niveles y frecuencia de contacto con humanos, que potencialmente

700


Rev Mex Cienc Pecu 2021;12(3):694-709

podrían tener exposición al virus de la rabia. La coexistencia entre población humana y colonias D. rotundus está ocurriendo dado por su dispersión, concentración de refugios, y la distancia entre refugios a las comunidades humanas. Figura 2: Localidades rurales y urbanas dentro de un radio de 5 km a partir de los refugios habitados en San Luis Potosí durante 2014-2016

Modelo de predicción de dispersión de Desmodus rotundus en el estado El modelo de predicción obtenido con MaxEnt muestra que las condiciones medio ambientales se han modificado de manera moderada desde 2014 hasta 2016, generando más sitios de idoneidad ambiental hacia la región norte del estado para la localización de D. rotundus, pero es en la región sudoccidental donde existe una mayor probabilidad de desarrollo de colonias de D. rotundus, como se muestra en la Figura 3. Consistentemente, las variables climáticas con mayor efecto en el modelo fueron la oscilación anual de la temperatura, estacionalidad de la temperatura, precipitación del trimestre seco, estacionalidad de la precipitación y para el 2016 la oscilación diurna de la temperatura, como se puede ver en el Cuadro 2. El AUC general para el modelo fue de 0.992 en todo el periodo bajo estudio, específicamente para el 2014 (AUC 0.992), 2015 (AUC 0.993), y 2016 (AUC 0.992). Estos resultados permiten hacer un modelo robusto de predicción en cuanto a la dispersión del D. rotundus.

701


Rev Mex Cienc Pecu 2021;12(3):694-709

Figura 3: El modelo de predicción con MaxEnt para la presencia de Desmodus rotundus, para 2014 (A), 2015 (B), 2016 (C)

Nótese el incremento de la distribución potencial hacia la región norte (circulo punteado).

Año 2014

2015

2016

Cuadro 2: Porcentaje de contribución de las variables del modelo de MaxEnt Variable Contribución (%) Estacionalidad de la temperatura 30.0 Precipitación del trimestre más seco 16.1 Oscilación anual de la temperatura 14.9 Estacionalidad de la precipitación 14.3 Oscilación anual de la temperatura 26.8 Precipitación del trimestre más seco 16.7 Estacionalidad de la precipitación 11.8 Estacionalidad de la temperatura 11.5 Oscilación anual de la temperatura 22.8 Estacionalidad de la temperatura 20.0 Precipitación del trimestre más seco 14.9 Oscilación diurna de la temperatura 12.5

Discusión La importancia del murciélago D. rotundus radica no sólo en su capacidad de transmitir enfermedades debido a sus hábitos de alimentación y sociales, como la rabia al ganado bovino y ocasionalmente a los humanos, sino también porque ha logrado tener una adaptación a nuevos ambientes, y a los cambios generados en el uso de suelo, lo que posiblemente favorece su amplia distribución geográfica en diferentes regiones de América Latina y México(5,36). Este estudio confirma que el murciélago hematófago D. rotundus se distribuye en amplias zonas de San Luis Potosí, pero además, que ha ido buscando nuevos nichos al observarse casos de RPB hacia el norte del estado, donde las condiciones climáticas aparentemente no eran propias para la presencia de dichos murciélagos. La presencia de nuevos asentamientos humanos, sobre todo rurales, favorece la creación de refugios artificiales, donde pueden migrar nuevas colonias de estos quirópteros; además, los nuevos

702


Rev Mex Cienc Pecu 2021;12(3):694-709

asentamientos por lo regular desarrollan actividades ganaderas que a su vez facilitan la fuente de alimentación de estos vectores(34). Un estudio en México encontró que sin importar las características ambientales la distribución de murciélagos vampiro fue en aumento(39). Al respecto, otro estudio realizado en México usando MaxEnt determinó a través de condiciones bioclimáticas para el periodo de 2050-2070, que el 30 % del paisaje mexicano proporcionará un hábitat idóneo para el D. rotundus debido a los cambios en los regímenes climáticos. Esta expansión ocurrirá en el norte y centro de México, donde se encuentra San Luis Potosí(13). Concordando con lo anterior otro estudio utilizando el modelo de distribución de múltiples especies (SDM), estimó la distribución potencial de los murciélagos vampiros en América del Norte bajo escenarios climáticos actuales y futuros, encontrando que estos se pueden distribuir en diversos hábitats a lo largo de gran parte del sur, centro y norte de México, inclusive hasta la región sur de Estados Unidos, siendo la única limitación para alcanzar esta latitud su mala capacidad para termo-regular cuando se exponen a temperaturas inferiores de 10 ºC(12). Considerando estudios realizados en México, D. rotundus puede estar en lugares con temperaturas entre 21 y 25 ºC, altitud por debajo de 2,300 msnm y humedad relativa de 45 %(13). La idoneidad ambiental ha ido cambiando en los diferentes años de estudio, incrementando el área de dispersión hacia el norte del estado, en la región árida, sin embargo las variables relacionadas con la temperatura: oscilación anual, estacionalidad y oscilación diurna (>11.5 %), junto con la variables de precipitación: del trimestre más seco y estacionalidad de la precipitación (>14.3 %) se mantuvieron como los factores que contribuyen mayormente para detectar áreas de dispersión potencial del D. rotundus durante el periodo de estudio. En un estudio realizado con métodos geoestadísticos multivariados donde se evaluó la distribución espacial de los casos de RPB a partir de variables climáticas y frecuencia de enfermedad, ahí se encontró que el mayor riesgo para la presencia de casos de RPB se encuentra en la región de la Huasteca del estado de San Luis Potosí, lo que concuerda con el presente trabajo(39). Durante los tres años estudiados se encontraron refugios de D. rotundus en sitios abandonados, en donde a pesar de que fueron visitados en más de una ocasión, no se capturó ningún espécimen, el porcentaje de abandono del 58 % (34 refugios) en el 2014, fue mayor al encontrado al este de Sao Paulo, Brasil, donde se identificaron 260 refugios, de los cuales sólo 29 (11.2 %) estaban vacíos(36). El abandono de los refugios puede deberse a factores como la disponibilidad de alimento, la deforestación, pero sobre todo, a ejecución de actividades de control letal del vampiro(16,36,40). Por lo general, después de algún tiempo, los refugios abandonados pueden ser recolonizados, trayendo consigo nuevos brotes de rabia o de otras enfermedades emergentes(10,16,41).

703


Rev Mex Cienc Pecu 2021;12(3):694-709

El cambio de uso de suelo de rural a urbanizado, favorece que los refugios de los D. rotundus sean de tipo artificial(5). En este trabajo algunos murciélagos vampiros fueron capturados en sitios urbanizados, como paradas de autobús, escuelas, casas deshabitadas, lo que concuerda con lo encontrado en San Paulo, donde el 67 % de los refugios que usan los murciélagos son artificiales(42). Esta situación favorece la interacción entre humanos, animales de compañía y murciélagos vampiro, lo que incrementa el riesgo de propagación y persistencia de enfermedades infecciosas(5,43). Las 337,836 personas que viven dentro del radio de 5 km de vuelo de los murciélagos encontrados en los refugios, haría pensar en un riesgo considerable; sin embargo, son pocos los eventos de agresiones a humanos reportadas por las autoridades de salud, lo anterior hace pensar en una posible convivencia estable entre estas especies. No hay estudios que hagan evidente el grado de interacción, por lo cual se considera necesario establecer con mayor precisión las implicaciones de la relación entre estas dos especies. Ya que resultados de un trabajo realizado en el este de Sao Paulo en Brasil, muestra la presencia de un refugio de D. rotundus por cada seis granjas, lo cual relaciona la información con el tamaño del rebaño, pero no de la población humana. Es importante continuar con estudios como el de Rocha et al(34), que permitan establecer valores sobre el número potencial de murciélagos vampiros por refugio, la frecuencia de mordidas al ganado en una región y los casos de rabia. Con datos como los anteriores, los investigadores pudieron construir un modelo para facilitar la ubicación de los refugios y con eso poder identificar otras granjas vulnerables, donde se debe reforzar la vigilancia de los ataques de murciélagos vampiros y otras medidas de control(36). Considerando que la presencia de ganado es uno de los principales factores de la presencia y cercanía de D. rotundus a comunidades humanas, al mismo tiempo podría ser una protección a los humanos, ya que los vampiros tienen alimento de más fácil acceso con los animales domésticos(8,44).

Conclusiones e implicaciones Es común la identificación de refugios en sitios cercanos a poblaciones humanas de San Luis Potosí, lo que pone de manifiesto una relación en el ecosistema entre personas y D. rotundus, en la cual, podría esperarse una mayor frecuencia de agresiones por parte de los quirópteros; sin embargo, eso no sucede, lo que indica una adaptación de coexistencia entre ambas especies, sobre todo en el suroriente de la entidad. El hecho de que el 80 % de los refugios hayan sido artificiales, hace necesario estudiar el papel que desempeña la urbanización en la distribución de D. rotundus, así como la presencia de animales silvestres y domésticas como un amortiguador de ataques a seres humanos. A la fecha no hay suficiente información sobre la distribución de este quiróptero y su organización espacial y considerando las proyecciones sobre el cambio climático en los próximos años es importante poder predecir los sitios de

704


Rev Mex Cienc Pecu 2021;12(3):694-709

idoneidad ambiental para la localización de posibles refugios asociándolos a los asentamientos humanos. Lo anterior permitirá mejorar las actividades de vigilancia epidemiológica de la rabia y otras enfermedades zoonóticas en la población animal y la humana, dado el potencial de estas especies para transmitir enfermedades infecciosas, lo cual puede permitir atender a localidades más vulnerables dada la interacción tan cercana con la especie. Agradecimientos Ximena Torres Mejía recibió beca para estudios de doctorado por parte del Consejo Nacional de Ciencia y Tecnología (CONACYT), en el Programa de Maestría y Doctorado en Ciencias de la Producción y de la Salud Animal de la Universidad Nacional Autónoma de México (UNAM). Biólogo Ignacio Amezcua, del Comité Estatal para la Promoción y Protección de la Ganadería de San Luis Potosí (CEFPPSLP) por su apoyo en la recolección de datos y el trabajo de campo. Conflicto de interés Los autores declaran no tener conflicto de interés. Literatura citada: 1.- Plowright RK, Eby P, Hudson PJ, Smith I, Westcott D, Bryden WL, et al. Ecological dynamics of emerging bat virus spillover. Proc Biol Sci 2015;282(1798):20142124. 2.- Calisher CH, Childs JE, Field HE, Holmes KV, Schountz T. Bats: important reservoir hosts of emerging viruses. Clin Microbiol Rev 2006;19:531–545. 3.- Hayman DT, Bowen RA, Cryan P M, McCracken GF, O'Shea TJ, Peel AJ, et al. Ecology of zoonotic infectious diseases in bats: current knowledge and future directions. Zoonoses Public Health 2013;60(1):2-21. 4.-Becker DJ, Czirják GÁ, Volokhov DV, Bentz AB, Carrera JE, Camus MS, et al. Livestock abundance predicts vampire bat demography, immune profiles and bacterial infection risk. Phil Trans R Soc B 2018;373:e1745. 5.- Joffrin L, Dietrich M, Mavingui P, Lebarbenchon C. Bat pathogens hit the road: But which one?. PLoS Pathog 2018;14(8):e1007134. 6.- Barcenas-Reyes I, Loza-Rubio E, Zendejas- Martinez H, Luna-Soria H, Canton-Alarcon G, Milian-Suazo F. Comportamiento epidemiológico de la rabia paralitica bovina en la región central de México, 2001-2013. Rev Panam Salud Publica 2015;38(5):396–402.

705


Rev Mex Cienc Pecu 2021;12(3):694-709

7.- Quan P, Firth C, Conte JM, Williams SH, Zambrana-Torrelio CM, Simon J. et al. Bats are a major natural reservoir for hepaciviruses and pegiviruses. Proc Natl Acad Sci USA 2013;110:8194–8199. 8.- Johnson N, Aréchiga-Ceballos N, Aguilar-Setien A. Vampire bat rabies: Ecology, epidemiology and control. Viruses 2014;6:1911-1928. 9.- Velasco-Villa A, Mauldin MR, Shi M, Escobar LE, Gallardo-Romero NF, Damon I, Olson VA, Streicker DG, Emerson G. The history of rabies in the western hemisphere. Antiviral Res 2017;146:221-232. 10.- Blackwood JC, Streicker DG, Altizer S, Rohani P. Resolving the roles of immunity, pathogenesis, and immigration for rabies persistence in vampire bats. Proc Natl Acad Sci USA 2013;110(51):20837-20842. 11.- Condori-Condori RE, Streicker DG, Cabezas-Sanches C, Velasco-Villa A. Enzootic and epizootic rabies associated with vampire bats, Peru. Emerg Infect Dis 2013;19(9)1463– 1469. 12.- Hayes MA, Piaggio AJ. Assessing the potential impacts of a changing climate on the distribution of a rabies virus vector. PLoS ONE 2018;13(2):e0192887. 13.- Zarza H, Martínez-Meyer E, Suzán G, Ceballos G. Geographic distribution of Desmodus rotundus in Mexico under current and future climate change scenarios: implications for bovine paralyticc rabies infection. Vet Mex OA 2017;4(3). 14.- SENASICA.2019. Informe Semanal sobre Enfermedades y Plagas de Reporte Obligatorio Inmediato. Semana 51. https://www.gob.mx/cms/uploads/attachment/file/524294/SEM_51_2019_WEB.PDF. Consultado 22 Feb, 2020. 15.-Moran D, Juliao P, Alvárez D, Lindblade KA, Ellison JA, Gilbert AT, et al. Knowledge, attitudes and practices regarding rabies and exposure to bats in two rural communities in Guatemala. BMC Res Notes 2015;8:955. 16.- Streicker DG, Allgeier JE. Foragingn choices of vampire bats in diverse landscapes: potential implications for land-use change and disease transmission. J App Ecol 2016;53:1280-1288. 17.- Zaidi F, Fatima SH, Jan T, Fatima M, Ali A, Khisroon M. Environmental risk modeling and potential sand fly vectors of cutaneous leishmaniasis in Chitral district: a leishmanial focal point of mount Tirich Mir, Pakistan. Trop Med Int Health 2017;22(9):1130–1140.

706


Rev Mex Cienc Pecu 2021;12(3):694-709

18.- Escobar LE, Peterson AT, Papeş M, Favi M, Yung V, Restif O, Huijie-Qiao H, MedinaVogel G. Ecological approaches in veterinary epidemiology: mapping the risk of batborne rabies using vegetation indices and night-time satellite imagery. Vet Res 2015;46(1):92. 19.- Portilla-Cabrera CV, Selvaraj JJ. Geographic shifts in the bioclimatic suitability for Aedes aegypti under climate change scenarios in Colombia. Heliyon 2020;24: 6(1):e03203. 20.- Tran A, Ippoliti C, Balenghien T, Conte A, Gely M, Calistri P, Goffredo M, Baldet T, Chevalier V. A geographical information system-based multicriteria evaluation to map areas at risk for rift valley fever vector-borne transmission in Italy. Transbound Emerg Dis 2013;60:14–23. 21.- Rousseau R, McGrath G, McMahon BJ, Vanwambeke SO. Multi-criteria decision analysis to model Ixodes ricinus habitat suitability. EcoHealth 2017;14(3):591–602. 22.- West AM, Kumar S, Brown CS, Stohlgren TJ, Brombergc J. Field validation of an invasive species Maxent model. Ecol Inform 2016;36:126-134. 23.- Lee DN, Papeş M, Van den Bussche RA. Present and potential future distribution of common vampire bats in the Americas and the associated risk to cattle. PloS one 2012;7(8):e42466. 24.- Sunil N, Sivaraj N, Anitha K, Abraham B, Kumar V, Sudhir E, Vanaja M, Varaprasad KS. Analysis of diversity and distribution of Jatropha curcas L. germplasm using Geographic Information System (DIVA-GIS). Genet Resour Crop Evol 2008;56(1): 115–119. 25.- INEGI. Cuéntame, información por entidad. San Luis Potosí. Disponible en el URL http://cuentame.inegi.org.mx/monografias/informacion/slp/territorio/clima.aspx?tema= me&e=24. Consultado 8 Feb,2020. 26.- Hesami N, Reza Abai M, Vatandoost H, Alizadeh M, Fatemi M, Ramazanpour J, HanafiBojd AA. Using ecological niche modeling to predict the spatial distribution of Anopheles maculipennis s.l. and Culex theileri (Diptera: Culicidae) in Central Iran. J Arthropod-Borne Dis 2019;13(2):165–176. 27.- Hijmans RJ, Cameron SE, Parra JL, Jones PG, Jarvis A. Very high resolution interpolated climate surfaces for global land areas. Int J Climatol 2005;25:1965–1978. 28.-García E. Modificaciones al sistema de clasificación climática de Köppen. Serie Libros núm. 6. México: Instituto de Geografía, UNAM;2004.

707


Rev Mex Cienc Pecu 2021;12(3):694-709

29.- INEGI, 2007. Carta edafológica. Escala 1:250,000. Instituto Nacional de Estadística y Geografía. México. URL: https://www.inegi.org.mx/app/biblioteca/ficha.html?upc=702825235673.Consultado 22 Feb, 2020. 30.- INEGI, 2008. Unidades climáticas. Escala 1:1,000,000. Instituto Nacional de Estadística y Geografía. México. URL: https://www.inegi.org.mx/app/biblioteca/ficha.html?upc=702825267568. Consultado 22 Feb, 2020. 31.- INEGI, 2015. Carta de uso de suelo y vegetación. Escala 1:250,000. Serie V. Instituto Nacional de Estadística y Geografía. México. URL: https://www.inegi.org.mx/app/biblioteca/ficha.html?upc=702825570385. Consultado 22 Feb, 2020. 32.- INEGI, 2017. Topográfica. Escala 1:50,000. Instituto Nacional de Estadística y Geografía. México. URL: https://www.inegi.org.mx/app/biblioteca/ficha.html?upc=889463532200. Consultado 22 Feb, 2020. 33.- Phillips SJ, Robert P. Anderson RP, Schapire RE. Maximum entropy modeling of species geographic distributions. Ecol Modell 2006;190:231–259. 34.- Rocha F, Ulloa-Stanojlovic FM, Rabaquim VCV, Fadil P, Pompei JC, Brandão PE, Dias RA. Relations between topography, feeding sites, and foraging behavior of the vampire bat, Desmodus rotundus. J Mammal 2019;101(1):164-171. 35.- Delpietro HA, Russo RG,Carter GG, Lord RD, Delpietro GL. Reproductive seasonality, sex ratio and philopatry in Argentina’s common vampire bats. R Soc Open Sci 2017;4:160959. 36.- Rocha F, Dias RA. The common vampire bat Desmodus rotundus (Chiroptera: Phyllostomidae) and the transmission of the rabies virus to livestock: A contact network approach and recommendations for surveillance and control. Prev Vet Med 2020;174:104809. 37.- Romero ML, Aguilar SA, Sanchez, HC. Murciélagos benéficos y vampiros, características, importancia, rabia y conservación. Mexico: AGT Editor SA; 2006. 38.- Delpietro HA, Russo RG, Carter GG, Lord RD, Delpietro GL. Reproductive seasonality, sex ratio and philopatry in Argentina’s common vampire bats. R Soc Open Sci 2017;4:160959. http://dx.doi.org/10.1098/rsos.160959.

708


Rev Mex Cienc Pecu 2021;12(3):694-709

39.- Bárcenas-Reyes I, Nieves-Martínez DP, Cuador-Gil JQ, Loza-Rubio E, González-Ruíz S, Cantó-Alarcón GJ, Milian-Suazo F. Spatiotemporal analysis of rabies in cattle in central Mexico. Geospat Health 2019;14(2). 40.- Olival KJ. To cull, or Not to Cull, Bat is the Question. EcoHealth 2016;13:6-8. 41.- Woodroffe R, Donnelly CA, Jenkins HE, Johnston WT, Cox DR, Bourne FJ, et al. Culling and cattle controls influence tuberculosis risk for badgers. Proc Natl Acad Sci USA 2006;103:14713–14717. 42.- Mialhe P. Characterization of Desmodus rotundus (E. Geoffroy, 1810) (Chiroptera, Phyllostomidae) shelters in the Municipality of São Pedro - SP. Braz J Biol 2013;73(3):521–526. 43.- Hassell JM, Begon M, Ward MJ, Fèvre EM. Urbanization and disease emergence: Dynamics at the wildlife–livestock–human interface. Trends Ecol Evol 2016;32(1):5567. 44.- Bobrowiec PED, Lemes MR, Gribel R. Prey preference of the common vampire bat (Desmodus rotundus, Chiroptera) using molecular analysis. J Mammal 2015;96(1):5463.

709


https://doi.org/10.22319/rmcp.v12i3.5469 Artículo

Detección de Pasteurella multocida, Mannhemia haemolytica, Histophilus somni y Mycoplasma bovis en pulmón de bovinos

Seyda Cengiz a* M. Cemal Adıgüzel a Gökçen Dinç b

a

Atatürk University Faculty of Veterinary Medicine Department of Microbiology 25240 Erzurum. Turkey. b

Erciyes University Faculty of Medicine Department of Microbiology Kayseri. Turkey.

*

Autor de correspondencia: seydacengiz@atauni.edu.tr

Resumen: En este estudio se tuvo como objetivo determinar P. multocida, M. haemolytica, H. somni y M. bovis en pulmones de bovinos macroscópicamente sanos mediante PCR. El estudio se llevó a cabo en 82 pulmones de bovinos macroscópicamente sanos. Se realizó la extracción de ADN de las muestras pulmonares. Después, se realizó la PCR utilizando todos los cebadores específicos. Mediante evaluación molecular, se lograron resultados positivos para P. multocida, M. haemolytica, H. somni y M. bovis en 4 (4.8 %), 4 (4.8 %), 6 (7.3 %) y 3 (3.6 %) de las muestras, respectivamente. Se detectaron infecciones mixtas en cinco muestras. De las muestras, dos fueron positivas tanto para P. multocida como para M. haemolytica, dos fueron positivas tanto para M. haemolytica como para H. somni y una fue positiva tanto para P. multocida como para H. somni. Sin embargo, no se detectó una muestra positiva que transportara todos los patógenos. En conclusión, P. multocida, M. haemolytica, H. somni y M. bovis son los patógenos oportunistas importantes del tracto respiratorio en bovinos y estos patógenos tienen un papel importante durante las infecciones. Pero la naturaleza multifactorial de la enfermedad respiratoria bovina y el sistema inmunológico

710


Rev Mex Cienc Pecu 2021;12(3):710-720

afectaron la formación de la enfermedad. Por lo tanto, en primer lugar, se debe fortalecer la inmunidad de los bovinos y se deben mantener bajo control otras condiciones. Palabras clave: Bovinos, Análisis molecular, Pulmón, Enfermedades respiratorias.

Recibido: 07/08/2019 Aceptado: 07/12/2020

Introducción La enfermedad respiratoria bovina (ERB) es uno de los principales problemas de salud en becerros y bovinos adultos, y tiene un gran impacto económico en la industria ganadera(1-3). La ERB en los hatos causa pérdidas económicas debido al aumento de los costos de tratamiento, la disminución de la producción y el sacrificio(4). La ERB tiene una etiología compleja, que involucra agentes bacterianos y virales. Además, algunos factores predisponentes, como las fallas de manejo, los problemas ambientales y de defensa del hospedero influyen en la ocurrencia de infecciones(5). Los agentes bacterianos más frecuentemente aislados de la enfermedad respiratoria son Pasteurella multocida (P. multocida), Mannheimia haemolytica (M. haemolytica), Histophilus somni (H. somni) y Mycoplasma bovis (M. bovis)(6-7). Pasteurella multocida es uno de los principales patógenos bacterianos y conduce a síntomas clínicos durante la ERB en becerros neonatales y bovinos. La bacteria, que se detecta no solo en bovinos infectados sino también en los sanos, se aísla de hisopos pulmonares, nasofaríngeos y nasales y de los lavados transtraqueales. Por lo tanto, el diagnóstico de P. multocida se convierte en un problema si se detectan síntomas clínicos asociados con neumonía en bovinos(8). Del mismo modo, M. haemolytica se presenta normalmente en la mucosa nasal faríngea en bovinos sanos. Sin embargo, la bacteria se convierte en un patógeno en condiciones inadecuadas, como deficiencia nutricional y estabulación sobrepoblada e infecciones virales. Tras la rápida proliferación de M. haemolytica dentro del pulmón infectado, se presenta bronconeumonía fibrinopurulenta grave. Además, produce una potente leucotoxina que destruye los macrófagos y los neutrófilos(9,10). Debido a estas propiedades, esta bacteria se acepta como el patógeno más dañino para el pulmón. H. somni es una bacteria que normalmente se presenta no solo en el tracto respiratorio sino también en el tracto reproductivo. Al igual que con los patógenos mencionados anteriormente, H. somni también está causando infecciones como meningoencefalitis

711


Rev Mex Cienc Pecu 2021;12(3):710-720

trombótica (MET), neumonía, septicemia, mastitis, artritis, miocarditis e infecciones reproductivas bajo condiciones inapropiadas con síntomas clínicos(5,11-13). M. bovis no es sólo enfermedad respiratoria sino también produce artritis, mastitis, infecciones genitales y abortos(3). Infecciones moderadas en bovinos que tienen el potencial de causar una infección con manifestaciones clínicas graves de bacterias, así como dificultad de diagnóstico, resistencia a penicilina y sus derivados; también existe un problema importante en las explotaciones de cría de ganado con el mecanismo de resistencia de los antibióticos(14). Al mismo tiempo, la rápida propagación de bacterias en el hato bovino fue un resultado de M. bovis que lo hace importante(15). La ERB se conoce como infección polimicrobiana en hatos bovinos y se registra principalmente en vacas más jóvenes(13). Por lo tanto, el diagnóstico de la ERB requiere el uso de diferentes métodos (convencionales y moleculares) para determinar las bacterias que son efectivas en la etiología. En particular, el uso de diferentes medios, las condiciones de incubación (temperatura y relación O2) y las diferencias entre los métodos de diagnóstico convencionales requieren el uso de métodos más rápidos. El diagnóstico molecular de los patógenos basado en técnicas de Reacción en Cadena de la Polimerasa (PCR, por sus siglas en inglés) se puede utilizar para la identificación y evaluaciones detalladas. Las técnicas moleculares, que son más sensibles que los métodos bacteriológicos, son preferidas, especialmente para la identificación directa de patógenos a partir de muestras de tejido(8,9,15,16). El objetivo de este estudio fue determinar P. multocida, M. haemolytica, H. somni y M. bovis de pulmones de bovinos macroscópicamente sanos mediante PCR.

Material y métodos Procedimiento de muestreo Se recogieron un total de 83 muestras de pulmón de diferentes mataderos. Se tomó una pieza de muestra de pulmón de los pulmones sin lesiones y se colocó en tubos estériles transportados al laboratorio con cadena de frío.

Cultivo y extracción de ADN Se tomó una pieza de muestra y se colocó en el tubo Eppendorf. Brevemente, cada muestra se colocó en placas de Petri estériles y luego las muestras se dividieron en partes utilizando bisturís y bolígrafos estériles. El cultivo en caldo solo se usó para M. bovis. Una pieza de muestra de pulmón para el aislamiento de M. bovis inoculada en un medio de caldo PPLO e

712


Rev Mex Cienc Pecu 2021;12(3):710-720

incubada a 37 oC en %5 de CO2 durante 5 días. Se utilizaron cultivos en caldo PPLO para la extracción de ADN de M. bovis, se utilizaron muestras de pulmón lisadas para la extracción de ADN de otras bacterias. El ADN se extrajo de las muestras de pulmón mediante el uso de un kit para purificación de ADN genómico (Qiagen-DNeasy Blood and Tissue Kit-EE. UU.). Se siguieron las instrucciones del fabricante.

Reacción en cadena de la polimerasa

Los procedimientos de PCR, que involucraron condiciones de ciclo y mezcla de reacción, se realizaron de acuerdo con informes anteriores(17,18,19) (Cuadro 1). La mezcla de reacción se preparó con un volumen total de 50 μl que contenía 3 mM de MgCl2, 200 μl de dNTP, 0.5 μM de cada cebador y 1.25 unidades de ADN polimerasa Taq (Vivantis, MY) con revisiones menores para patógenos. Se utilizó ADN extraído (1 μL) como molde. La amplificación se llevó a cabo mediante un termociclador (The SuperCycler Trinity, Kyratech, AU). Todas las muestras de los productos de la amplificación por PCR (10 μL) fueron sometidas a electroforesis. El ADN se visualizó mediante fluorescencia UV después de la tinción con bromuro de etidio.

Cuadro 1: Condiciones de PCR y secuencias de oligonucleótidos Par Condición de Patógeno del ciclo Oligonucleótidos Referencia bases (°C/min) (bp) P. 94/1 F:GGCTGGGAAGCCAAATCAAAG 1432 Miflin y multocida 69/1 30 cic Blackall, 72/1 R:CGAGGGACTACAATTACTGTAA 2001 M. 94/1 F:TGTGGATGCGTTTGAAGAAGG 1145 Akan et haemolytica 55/1 30 cic al., 2006 72/1 R:ACTTGCTTTGAGGTGATCCG H. somni 94/1 F:GAAGGCGATTAGTTTAAGAG 400 Angen et 55/1 35 cic al., 1998 72/1 R:TTCGGGCACCAAGTRTTCA M. bovis 94/1 F: TATTGGATCAACTGCTGGAT 447 Foddai et 54/1 30 cic al., 2005 72/1 R: AGATGCTCCACTTATCTTAG

713


Rev Mex Cienc Pecu 2021;12(3):710-720

Resultados En la evaluación molecular, se obtuvieron resultados positivos para P. multocida, M. haemolytica, H. somni y M. bovis en 4 (4.8 %), 4 (4.8 %), 6 (7.3 %) y 3 (3.6 %) de las muestras, respectivamente (Figura 1-3). Se detectaron infecciones mixtas en cinco muestras. De las muestras, dos fueron positivas tanto para P. multocida como para M. haemolytica, dos fueron positivas tanto para M. haemolytica como para H. somni y una fue positiva tanto para P. multocida como para H. somni. No obstante, no se detectó una muestra positiva que transportara todos los patógenos. Figura 1: Evaluación molecular de P.multocida

M= Marcador (100 pb ADN Ladder Plus), 1-3= P. multocida

Figura 2: Evaluación molecular de M. haemolytica

M= Marcador (100 pb ADN Ladder Plus), 1-2= M. haemolytica

714


Rev Mex Cienc Pecu 2021;12(3):710-720

Figura 3: Evaluación molecular de H. somni y M.bovis

M= Marcador (100 pb ADN Ladder Plus), 1-2= H. somni, 3= M. bovis

Discusión Las enfermedades respiratorias bovinas, que causan pérdidas económicas debido a la disminución de la producción y el sacrificio, tienen una gran importancia en los hatos bovinos. Aunque, bovinos de todas las edades y sexos es susceptible a la enfermedad, es más perjudicial para los becerros(6,20,21). Las bacterias que causan infecciones respiratorias pueden transmitirse de animales curados o inmunológicamente fuertes (sin signos clínicos) a animales sensibles(2,22). Además de los patógenos, algunos factores predisponentes como los establos sobrepoblados y mal ventilados, la alimentación inadecuada y otras enfermedades infecciosas aumentaron el riesgo de infección. En estos hatos, la transmisión suele producirse de forma horizontal(7,9,23). Los estudios previos generalmente se centraron en la detección de P. multocida, M. haemolytica, H. somni y M. bovis en las amígdalas, nasofaringe y el tracto respiratoria superior en animales portadores(2,24,25). En los reportes se obtuvieron varios resultados sobre la presencia de patógenos en las vacas. La positividad de P. multocida, M. haemolytica, H. somni y M. bovis en bovinos varió entre 0.4-57.4 %, 1.6-35 %, 2-45 % y 1459 % en reportes anteriores (Figura 4)(9,19,26,27,28,29,30). En el presente estudio, se encontró que el número de animales positivos identificados para P. multocida fue menor que el descrito por Onat et al(28), pero fue más alto que en otros(24,27). Se encontró que la positividad de M. haemolytica fue más baja que otros trabajos(2,27,29), pero fue más alta que lo encontrado por Hajikolaei et al(20). En cuanto a la positividad, se encontró que H. somni y M. bovis fueron diferentes de otros estudios. En los estudios, en ambas bacterias, se evaluaron diferentes métodos de diagnóstico en vacas neumónicas(15,30,31).

715


Rev Mex Cienc Pecu 2021;12(3):710-720

Además, la variación entre los resultados puede estar asociada con la diferencia en los métodos de diagnóstico, la vacunación y las propiedades bacterianas(2,23,29). Por ejemplo, los métodos de cultivo convencionales pueden ser inadecuados en la detección de patógenos en vacas sanas debido a un menor recuento bacteriano en las muestras. Asimismo, la vacunación puede reducir el transporte de bacterias y lesiones(16,32,33). Además, la detección de algunos patógenos del sistema respiratorio como H. somni y M. bovis en medios de cultivo es difícil aunque las muestras se recojan de vacas infectadas(9,19). Así, se sugieren pruebas de PCR, que implican cebadores específicos para el ARNr 16S, para la identificación de esta bacteria durante las infecciones respiratorias mixtas(5,13). Por lo tanto, las técnicas moleculares basadas en material genético, que permiten la detección de los patógenos a pesar de un recuento bacteriano menor, serían preferibles en lugar de los métodos de cultivo en la determinación de las vacas portadoras(16,34). Figura 4: Cambio proporcional de patógenos según estudios(9,20,24,27,29,30,31)

La presencia de estas bacterias en ausencia de síntomas clínicos en animales o lesiones macroscópicas en la necropsia respalda el carácter oportunista de estas bacterias. Sin embargo, en estos casos, se deben realizar exámenes histopatológicos y se debe cuestionar el estado de salud del animal. Además, debido a que la aparición de la enfermedad tiene asociación con el transporte(22,24,27,35), la detección de animales reservorios es importante para la reducción del riesgo en los hatos. De modo que, la detección de vacas portadoras, que tienen riesgo potencial de contaminación, es un enfoque para el control(22).

Conclusiones e implicaciones En conclusión, P. multocida, M. haemolytica, H. somni y M. bovis, que causan pérdidas económicas y muerte en animales, también son patógenos oportunistas importantes. Por lo tanto, el sistema inmunológico debe desarrollarse mediante la vacunación en animales.

716


Rev Mex Cienc Pecu 2021;12(3):710-720

Además, se deben mejorar las condiciones de estabulación y el manejo, la conciencia del personal (propietario) para establecer un programa de control efectivo y sostenible de las enfermedades del sistema respiratorio. Literatura citada: 1.

Headley SA, Alfieri AF, Oliveira VHS, Beuttemmüller EA, Alfieri AA. Histophilus somni is a potential threat to beef cattle feedlots in Brazil. Vet Rec 2014;175:249-250.

2.

Jaramillo-Arango CJ, Hernandez-Castro R, Suarez-Guemes F, Martinez-Maya JJ, Aguilar-Romero F, Jaramillo-Meza L, Trigo FJ. Characterisation of Mannheimia spp. strains isolated from bovine nasal exudate and factors associated to isolates, in dairy farms in the Central Valley of Mexico. Res Vet Sci 2008;84:7-13.

3.

Margineda GA, Zielinski GO, Jurado S, Alejandra F, Mozgovoj M, Alcaraz AC, López A. Mycoplasma bovis pneumonia in feedlot cattle and dairy calves in Argentina. Braz J Vet Pathol 2017;10(2):79 – 86.

4.

Angen Ø, Thomsen J, Larsen LE, Larsen J, Kokotovic B, Heegaard PMH, Enemark JMD. Respiratory disease in calves: Microbiological investigations on trans-tracheally aspirated bronchoalveolar fluid and acute phase protein respons. Vet Microbiol 2009;137:165-171.

5.

Tegtmeier C, Angen SNG, Riber U, Friis NF. Aerosol challenge of calves with Haemophilus somnus and Mycoplasma dispar. Vet Microbiol 2000;72:229-239.

6.

Klima CL. Characterization of the genetic diversity and antimicrobial resistance in Mannheimia haemolytica from feedlot cattle [Thesis]. Alberta, Canada: University of Lethbridge; 2009.

7.

Kurćubić VS, Đoković RD, Ilić ZŽ, Stojković JS, Petrović MP, Petrović VC. Modern approach to the enigma of bovine respiratory disease complex: A review. Pak Vet J 2014; 34:11-17.

8.

Dabo SM, Taylor JD, Confer AW. Pasteurella multocida and bovine respiratory disease. Anim Health Res Rev 2008;8:129-150.

9.

Tegtmeier C, Angen Ø, Ahrens P. Comparison of bacterial cultivation, PCR, in situ hybridisation and immunohistochemistry as tools for diagnosis of Haemophilus somnus pneumonia in cattle. Vet Microbiol 2000;76:385-394.

10. Bielsa JM. New solution for the control of the bovine respiratory complex. Congress of the Mediterranean Federation for Health and Production of Ruminants (FeMeSPrum) Zadar, Croatia, 2008;35-42.

717


Rev Mex Cienc Pecu 2021;12(3):710-720

11. Humphrey JD, Stephens LR. Haemophilus somnus: a review. Vet Bull 1983;53:9871004. 12. Corbeil LB, Widders PR, Gogolewski RP, Arthur JE, Inzana TJ, Ward ASC. Haemophilus somnus: bovine reproductive and respiratory disease. Can Vet J 1986;27: 90-93. 13. Angen Q, Ahrens P, Tegtmeier C. Development of a PCR test for identification of Haemophilus somnus in pure and mixed cultures. Vet Microbiol 1998;63:39-48. 14. Nicholas RAJ. Recent developments in the diagnosis and control of mycoplasma infections in cattle. 23rd. World Buiatric Congress, Canada. 2004. 15. Petersen MB. Mycoplasma bovis in dairy cattle. [PhD Thesis] Denmark, Department of Veterinary and Animal Sciences Faculty of Health and Medical Sciences. University of Copenhagen; 2018. 16. Casademunt S. The role of Histophilus somni in bovine respiratory disease: An update. 2011. www.hipra.com. Accesed 30 May, 2018. 17. Miflin JK, Blackall P. Development of a 23S rRNA-based PCR assay for the identification of Pasteurella multocida. Lett App Microbiol 2001;33:216-221. 18. Akan M, Oncel T, Sareyyupoglu B, Hazıroglu R, Tel OY, Cantekin Z. Vaccination studies of lambs against experimental Mannheimia (Pasteurella) haemolytica infection. Small Ruminant Res 2006;65:44–50. 19. Foddai A, Idini G, Fusco M, Rosa N, Fe A, Zinellu S, Corona L, Tola S. Rapid differential diagnosis of Mycoplasma agalactiae and Mycoplasma bovis based on a multiplex-PCR and a PCR-RFLP. Mol Cell Prob 2005;19:207-212. 20. Hajikolaei HMR, Ghorbanpour M, Sayfi-Abadshapouri MR, Rasooli A, Ebrahimkhani D, Jabbari AR. Bacteriological and serological studies on Mannheimia haemolytica infection in cattle slaughtered at Ahvaz (southwestern Iran) abattoir. Iranian J Vet Res 2010;11:84-87. 21. Headley SA, Oliveira VH, Figueira GF, Bronkhorst DE, Alfieri AF, Okano W, Alfieri AA. Histophilus somni-induced infections in cattle from southern Brazil. Trop Anim Health Prod 2013;45:1579–1588. 22. Dziva F, Muhairwa A, Bisgaard M, Christensen H. Diagnostic and typing options for investigating diseases associated with Pasteurella multocida. Vet Microbiol 2007;128:1-22.

718


Rev Mex Cienc Pecu 2021;12(3):710-720

23. Taylor JD, Fulton RW, Mady DS, Lehenbauer TW, Confer AW. Comparison of genotypic and phenotypic characterization methods for Pasteurella multocida isolates from fatal cases of bovine respiratory disease. J Vet Diagn Invest 2010;22:366-375. 24. Hajikolaei HMR, Ghorbanpour M, Seyfi-Abadshapouri MR, Rasooli A, Moazeni Jula GR, Ebrahimkhani D. Study on the Prevalence of Pasteurella multocida carriers in slaughtered cattle and relationship with their immunity status at Ahvaz Abattoir. J Vet Res 2008;63:31-35. 25. Aebi M, Borne BHP, Raemy A, Steiner A, Pilo P, Bodmer M. Mycoplasma bovis infections in Swiss dairy cattle: a clinical investigation. Acta Vet Scan 2015;57:1-11. 26. Hajikolaei HMR, Ghorbanpour M, Sayfi-Abadshapouri MR, Rasooli A, Jahferian H. Occurrence of Pasteurella multocida in the nasopharynx of healthy buffaloes and their immunity status. Bull Vet Inst Pulawy 2006;50:435-438. 27. Barbour EK, Nabbut NH, Hamadeh SK, Al-Nakhli HM. Bacterial identity and characteristics in healthy and unhealthy respiratory tracts of sheep and calves. Vet Res Commun 1997;21:421- 430. 28. Onat K, Kahyaoğlu S, Çarlı KT. Frequency and antibiotic susceptibility of Pasteurella multocida and Mannheimia haemolytica isolates from nasal cavities of cattle. Turk J Vet Anim Sci 2010;34:91-94. 29. Alexander TW, Cook S, Klima CL, Topp E, McAllister TA. Susceptibility to tulathromycin in Mannheimia haemolytica isolated from feedlot cattle over a 3-year period. Front Microbio 2013;4:1-8. 30. Tenk M. Examination of Mycoplasma bovis infection in cattle [PhD Thesis]. Budapest: Szent Istvan University; 2005. 31. D’Amours GH, Ward TI, Mulvey MR, Read RR, Morck DW. Genetic diversity and tetracycline resistance genes of Histophilus somni. Vet Microbiol 2011;150:362–372. 32. Pérez DS, Pérez FA, Bretschneider G. Histophilus Somni: Pathogenicity in cattle. An update. An Vet (Murcia) 2010;26:5-21. 33. Lipsitch M. Vaccination against colonizing bacteria with multiple serotypes. Proc Natl Acad Sci 1997;94:6571–6576. 34. Deressa A, Asfaw Y, Lubke B, Kyule MW, Tefera G, Zessin KH. Molecular Detection of Pasteurella multocida and Mannheimia haemolytica in sheep respiratory infections in Ethiopia. Intern J Appl Res Vet Med 2010;8:101-108.

719


Rev Mex Cienc Pecu 2021;12(3):710-720

35. Derosa DC, Mechor GD, Staats JJ, Chengappa MM, Shryock TR. Comparison of Pasteurella spp. simultaneously isolated from nasal and transtracheal swabs from cattle with clinical signs of bovine respiratory disease. J Clin Microbiol 2000;38:327–332.

720


https://doi.org/10.22319/rmcp.v12i3.5765 Artículo

Tratamiento de la laminitis crónica en equinos utilizando células troncales mesenquimales alogénicas de la médula ósea.

Alma A García-Lascuráin a,b Gabriela Aranda-Contreras c Margarita Gómez-Chavarín d Ricardo Gómez e Adriana Méndez-Bernal f Gabriel Gutiérrez-Ospina g María Masri a*

a

Universidad Nacional Autónoma de México (UNAM). Facultad de Medicina Veterinaria y Zootecnia. Departamento de Medicina, Cirugía y Zootecnia para Équidos. 04510 Ciudad de México, México. b

UNAM. Facultad de Medicina Veterinaria y Zootecnia, Programa de Doctorado en Ciencias de la Producción y de la Salud Animal, Ciudad de México, México. c

UNAM. Facultad de Estudios Superiores Cuautitlán. Hospital para Equinos, Cuautitlán Izcalli, Estado de México, México. d

UNAM. Facultad de Medicina, Departamento de Fisiología. México.

Instituto Nacional de Rehabilitación “Luis Guillermo Ibarra Ibarra”. Unidad de Ingeniería de Tejidos, Terapia Celular y Medicina Regenerativa. Ciudad de México, México. e

f

UNAM. Facultad de Medicina Veterinaria y Zootecnia. Departamento de Patología. Ciudad de México, México. g

UNAM. Instituto de Investigaciones Biomédicas, Departamento de Biología Celular y Fisiología, Ciudad de México, México.

* Autor de correspondencia: masri@unam.mx

721


Rev Mex Cienc Pecu 2021;12(3):721-741

Resumen: La laminitis crónica es una condición incapacitante que afecta el corion laminar de los cascos del caballo. Por lo general, se desarrolla como una lesión colateral de numerosas enfermedades sistémicas primarias. Se cree que el evento fisiopatológico crítico que hace que un casco sea vuelva laminítico es la pérdida de células madre mesenquimales. Esta pérdida perjudica en gran medida la capacidad del corion laminar para regenerarse. Aunque el trabajo previo proporciona credibilidad a esta noción, quedan cuestiones sin resolver que deben abordarse antes de aceptarla como un hecho bien fundado. Aquí, se reexaminó el principio central del modelo fisiopatológico de la laminitis mediante la infusión de células madre mesenquimales alogénicas derivadas de la médula ósea (CMMAMO), a través de la vena palmar digital, en los cascos de los caballos afectados por laminitis crónica. Los caballos fueron monitoreados clínicamente durante 6 meses, evaluándolos mensualmente utilizando la escala de Obel-Glasgow de cojera modificada y la termografía de cascos. Se tomaron venogramas y biopsias laminares al principio y al final del período de estudio para reunir evidencia sobre la remodelación vascular y la regeneración del corion laminar. Los resultados mostraron que la infusión de CMM-AMO promueve la remodelación vascular y la regeneración del corion laminar, lo que respalda aún más que la pérdida de células madre es el evento crítico que conduce a la laminitis crónica. Este trabajo también demostró que la infusión de CMM-AMO es segura ya que los caballos tratados no desarrollaron manifestaciones clínicas negativas locales o sistémicas en sintonía con reacciones de rechazo, al menos durante el período de 6 meses en que se les dio seguimiento y bajo el esquema terapéutico propuesto. Palabras clave: Caballos, Laminitis, CMM-AMO, CMMa, MPP, CMM, PRP, Plasma rico en plaquetas.

Recibido: 13/08/2020 Aceptado: 30/11/2020

Introducción La laminitis crónica es una condición podal incapacitante en los caballos. Su prevalencia oscila entre el 7 y el 14 % en todo el mundo(1). La laminitis es el resultado colateral negativo de numerosas enfermedades primarias digestivas, respiratorias, urinarias, metabólicas, ortopédicas y reproductivas(2-4). Faleiros et al(5) y Leise et al(6) han elaborado un modelo trifásico para comprender la progresión de la laminitis: la fase de desarrollo, la fase aguda y la fase crónica. Se ha propuesto que el corion laminar en los cascos de los caballos afectados por laminitis crónica pierde sus capacidades para mantener procesos regenerativos(3). Dado que las células madre mesenquimales son las encargadas de llevar a cabo esta tarea, una pieza 722


Rev Mex Cienc Pecu 2021;12(3):721-741

central del rompecabezas para entender la fisiopatología de la laminitis crónica es, por tanto, la pérdida de células madre mesenquimales durante el proceso inflamatorio(3). Esta noción no es incongruente ya que las células madre mesenquimales mantienen bajo control estricto la homeostasis, la remodelación y reparación del corion laminar(7-8), promueven la regeneración tisular mediante la secreción de factores de crecimiento(9-12); y citoquinas antiinflamatorias(11,13,14). También protegen contra el daño oxidativo y contra la lesión por hipoxia / reperfusión al preservar la integridad endotelial y promover la angiogénesis(3). En 2017, Angelone et al(3) fueron pioneros en un trabajo experimental dirigido a evaluar si la pérdida de células madre mesenquimales era realmente una pieza fundamental del mecanismo fisiopatológico que conduce a la laminitis crónica. Sus resultados respondieron positivamente a su pregunta, solo hasta cierto punto. Desafortunadamente, no pudieron atribuir de manera irrefutable la mejoría clínica y la evidencia venográfica de la angiogénesis observada en los caballos tratados únicamente por las células madre mesenquimales derivadas del tejido adiposo infundidas porque las células fueron coinfundidas con plasma rico en plaquetas. Además, a pesar de que la evidencia previa ha revelado que las células madre alogénicas no tienen efectos nocivos en la salud de los caballos, incluso si pueden desencadenar respuestas inmunes en el caballo tratado contra antígenos extraños(15-21), ellos optaron por infundir primero células madre mesenquimales autólogas derivadas del tejido adiposo y luego alogénicas, confundiendo así la interpretación de sus resultados. Por último, a pesar de que los caballos tratados mejoraron significativamente cuando se evaluaron clínicamente y a pesar de la evidencia presentada que apoya la angiogénesis en curso en los cascos laminíticos infundidos, la regeneración citológica dentro del casco solo se puede inferir. El presente trabajo fue diseñado para superar algunos de los escollos técnicos de la evaluación experimental pionera conducida por Angelone, al tiempo que se evaluó el papel de las células madre mesenquimales en el proceso fisiopatológico que subyace a la laminitis. Para hacer esto con éxito, se infundieron células mesenquimales alogénicas derivadas de la médula ósea (CMM-AMO), suspendidas en medios de cultivo, en ambos cascos frontales de caballos crónicamente afectados por laminitis, se monitoreó el progreso clínico de los caballos infundidos a través de evaluaciones clínicas y venográficas. Además, el estudio incluyó biopsias de los cascos para evaluar directamente la regeneración del corion laminar y la termografía de cascos para realizar un seguimiento de la temperatura de los cascos. En general, los resultados mostraron que las infusiones de CMM-AMO: 1) restauran en gran medida la citoarquitectura del corion laminar, 2) regeneran segmentos del lecho vascular y 3) mejoran notoriamente la postura clínica de los caballos tratados, sin tener efectos nocivos locales ni sistémicos en la salud de los caballos al menos hasta el momento en que los caballos fueron monitoreados y bajo el protocolo de tratamiento ideado en esta investigación. Por lo tanto, estas observaciones respaldan que la pérdida de células madre mesenquimales juega un papel fundamental en la patogénesis de la laminitis crónica; su restitución bien puede revertir la condición. Como corolarios secundarios, los clínicos deben investigar medidas dirigidas a prevenir la pérdida de células madre mesenquimales mediante la inducción de la tolerancia inmunológica protectora de los cascos o mediante 723


Rev Mex Cienc Pecu 2021;12(3):721-741

el fomento de la autoinmunidad beneficiosa de los cascos en caballos que cursan con enfermedades primarias prolaminitis. Por último, vale la pena enfatizar la necesidad de investigar la posibilidad de usar células madre mesenquimales para controlar el dolor en los caballos.

Material y métodos Animales Para realizar este estudio se utilizaron caballos hembras (n= 5) y machos (n= 5) de diferentes razas, edades y diferentes actividades afectados por laminitis crónica (Cuadro 1), ninguno de los caballos estaba bajo ningún tratamiento actual. Todos los animales mostraban rotación de la falange distal, pero no eran hundimientos. El recuento de células sanguíneas (RCS) se extrajo de la vena yugular y se utilizó para evaluar el estado inflamatorio inicial. Todos los caballos se mantuvieron y trataron en sus correspondientes establos habituales. Los animales tuvieron libre acceso al agua y se alimentaron con heno de avena dos veces al día. Los formularios de consentimiento informado fueron firmados por los propietarios. Los protocolos de manejo y procedimiento clínico y experimental de los caballos fueron aprobados por el Comité Institucional de Cuidado y Uso de Animales de la Facultad de Veterinaria (FMVZ-UNAM) (No. MC-2016/2-5; Evaluación terapéutica del uso de células troncales mesenquimales alogénicas, en el control del dolor, inflamación y estructura laminar en caballos con lamintis crónica”).

724


Rev Mex Cienc Pecu 2021;12(3):721-741

Cuadro 1: Caballos de diferentes razas, edades y de diferentes actividades afectados por laminitis crónica No.

1 2

Raza

Sexo

Cuarto Milla Appendix

de Yegua Yegua

Edad (años)

7 12

3 4

Pura Sangre Macho Cuarto de Capón Milla

8 3

5

Cuarto de Macho Milla Cuarto de Yegua Milla Pura Sangre Yegua

14

Cuarto de Capón Milla Santa Yegua Gertrudis Pura Sangre Macho

16

6 7 8 9 10

19 5

8 3

Actividad

Causa de la laminitis

Duración de la laminitis

Pronóstico inicial

Peso inicial

Peso final

ObelGlasgow inicial

ObelGlasgow final

Herraje

Deporte mexicano Servicio de policía Saltador Animal de compañía Deporte mexicano Servicio de policía Carrera

Cólico

13 meses

Pobre

480

408

4

1

Ortopédico

Aborto

Malo

430

450

13

4

Ninguno

Dieta Recorte

+24 meses 1 mes 12 meses

Pobre Pobre

450 320

465 360

2 7

1 2

Ortopédico Ninguno

Cólico

24 meses

Malo

360

370

13

2

Ortopédico

Retención placentaria Desconocida

+24 meses 12 meses

Malo

460

470

12

4

Ninguno

Malo

496

490

11

4

Ortopédico

Deporte mexicano Servicio militar Carrera

Cambio de dieta +24 meses Desplazamiento 2 meses del colon Correr 4 meses

Malo

365

330

13

8

Estándar

Pobre

455

460

2

0

Ninguno

Pobre

400

470

4

0

Ortopédico

725


Rev Mex Cienc Pecu 2021;12(3):721-741

Evaluación de la cojera Se realizó una evaluación ortopédica mediante la observación de las posturas estáticas y dinámicas de cada caballo. Se utilizó la puntuación de dolor de evaluación multifactorial modificada adaptada para caballos laminíticos que califica los signos de dolor y comportamiento alterado combinando, respectivamente, los criterios de Obel y Glasgow(4). Cuanto más alta sea la puntuación (máximo 14), mayor será el dolor.

Evaluación de la temperatura de los cascos La inflamación laminar conduce a incrementos en la temperatura de los cascos(20). La termografía infrarroja puede utilizarse para estimar el cambio de temperatura a través de la obtención de imágenes de los cascos. Se utilizó la cámara infrarroja FLIR XX5 (FlirTM, EE. UU.) para obtener imágenes en tiempo real de los cascos de la extremidad frontal de los caballos una vez al mes durante seis meses. La temperatura de la banda coronaria se registró in situ y se graficó individualmente. Se decidió utilizar la banda coronaria como referencia anatómica para medir la temperatura porque carece de la pared del casco. Esta característica hace que esta región sea adecuada para obtener lecturas de temperatura confiables; la anatomía de la pared del casco en caballos con laminitis crónica puede deformarse mucho. Las sesiones de obtención de imágenes se realizaron a la misma hora (8 AM), mientras se mantenían a los caballos parados en sus establos y antes de ser paseados a mano. Los cascos siempre se limpiaban antes de la toma de imágenes. Las vistas laterales y dorsales se tomaron a una distancia de 30 centímetros del casco. Las imágenes codificadas por colores se obtuvieron con base a una escala lineal calibrada construida en el programa de adquisición de la cámara.

Venografía Los caballos se sedaron con clorhidrato de xilacina al 10 % inyectado a través de la vena yugular. El nervio digital palmar lateral y medial se bloqueó utilizando lidocaína al 2 % a nivel de los sesamoideos proximales; el área fue previamente afeitada y limpiada con una solución que contenía gluconato de clorhexidina al 20 %. Se colocó un torniquete con un vendaje Esmarch en el menudillo. Luego se perforó la vena digital lateral utilizando un catéter mariposa 23G y el medio de contraste Iopamidol (Scanlux, San Chemia, México) se inyectó a través de ella lentamente. Para asegurar una distribución adecuada del Iopamidol en todo el lecho vascular del dedo del caballo, el aspecto dorsal de la rodilla se flexionó dorsalmente y los talones se levantaron del suelo. Al final de la administración, los talones soportaron peso, se retiró la jeringa y el catéter se sujetó con unas pinzas Halsted. Se tomaron vistas latero-medial y dorso-palmar a 60 seg del medio de contraste (21).

726


Rev Mex Cienc Pecu 2021;12(3):721-741

Biopsia laminar El menudillo y la cuartilla se lavaron y secaron. Los caballos se sedaron y los nervios abaxiales laterales y mediales se bloquearon siguiendo las pautas proporcionadas anteriormente. Se colocó un torniquete en el menudillo usando un vendaje Esmarch para reducir el sangrado. La pared dorsal del casco se perforó con una piedra de pulir de 4.8 mm de diámetro (Dremel, Bosch, EE. UU.), a 2 cm de la banda coronaria. La cavidad realizada (9 mm de diámetro) atravesó los estratos externos y medios de la pared del casco hasta llegar a la línea blanca, un punto de referencia anatómico que indica proximidad al corion laminar. La solución salina se regó constantemente para evitar el sobrecalentamiento durante la perforación. Una vez en la línea blanca, se incidió el corion laminar con un bisturí armado con una cuchilla del No. 11, orientada perpendicularmente hacia la pared del casco. El bisturí se movió en el sentido de las manecillas del reloj siguiendo el perímetro de la cavidad hasta llegar a la tercera falange. Luego, con un tallador Frahm del No. 4, el tejido laminar se extrajo de la tercera falange(22). Se obtuvo una muestra laminar de forma cilíndrica, que medía aproximadamente 7 mm en la base y 7 mm de altura. La biopsia se fijó en paraformaldehído tamponado (4 %) durante 24 h, luego se sumergió en una solución tamponada de sacarosa (15 %) durante 24 h, y finalmente se transfirió a una solución tamponada de sacarosa al 30 % a 4 °C hasta su evaluación. El área quirúrgica se secó con gasas y se selló con metacrilato de metilo. El torniquete se retiró después de que el metacrilato de metilo se secó.

Histología Las biopsias se incrustaron en Tissue-Tek (Neg-50, Richard-Allan Scientific, EE. UU.), se congelaron en hielo seco y se cortaron longitudinalmente (30 μm de grosor) en un criostato (SLEE), a -25 °C. Las secciones en serie se montaron en portaobjetos con base de gelatina y se almacenaron a -4 °C hasta su uso. Se obtuvo un total de 15 portaobjetos por muestra. Se tomó un portaobjetos cada tres para teñirlo con violeta de cresilo, base de ácido peryódico de Schiff y tinción tricrómica de Masson. Los portaobjetos se cubrieron con con Cytoseal 60 (Richard-Allan Scientific) y se observaron a través de un microscopio Olympus BX51-WI. La integridad citológica del tejido y el grado de infiltración inflamatoria se estimaron cualitativamente, y los campos representativos de este material se fotomicrografiaron digitalmente, bajo microscopía de campo brillante, utilizando el software Stereo Investigator (10X).

Microscopía electrónica de transmisión Las muestras del corion laminar obtenidas de un caballo sano y uno laminítico se fijaron en una solución tampón que contenía 4 % de paraformaldehído / 2.5 % de glutaraldehído (Electron Microscopy Sciences) durante 72 h. Después de tres lavados suaves con tampón fosfato salino (0.1M; pH 7.2), las muestras se fijaron posteriormente con tetróxido de osmio (1 %) durante 1 h, luego se deshidrataron e incrustaron en Epon 812. Se

727


Rev Mex Cienc Pecu 2021;12(3):721-741

polimerizaron a 60 °C durante 24 h. Las secciones semidelgadas (150 nm) se montaron en portaobjetos y se tiñeron con azul de toluidina, se eligió el área de interés y se montaron secciones ultradelgadas (70 nm) en rejillas de cobre, se contrastaron con acetato de uranilo (2 %) y citrato de plomo (50 %) (Electron Microscopy Sciences) y se observaron a través de un microscopio electrónico de transmisión Jeol 1010 (60kV). La integridad ultraestructural del tejido y el grado de infiltración inflamatoria se estimaron cualitativamente, y los campos representativos de este material se fotomicrografiaron digitalmente.

Muestreo de medula ósea y recolección, aislamiento y expansión de células madre mesenquimales Se recolectaron muestras (15 ml) de médula ósea (MO) (utilizando jeringas de 20 ml que contenían 1,000 UI de heparina/ml de MO) mediante punción esternal de caballos sanos machos y hembras (3-8 años) de diferentes razas. Las muestras se almacenaron a 4 – 8 °C y se transfirieron en condiciones asépticas a la instalación de cultivo celular dentro de una hora desde de la recolección. La médula ósea se transfirió a tubos estériles llenos de Ficoll Hypaque en una proporción de 1:2. Las muestras se centrifugaron a 400 xg durante 30 min y la fracción mononuclear se aisló en un tubo estéril a 4 °C. La fracción se centrifugó a 300 xg durante 10 min a 4 °C. El sobrenadante se desechó y las células se resuspendieron y sembraron, a una densidad de 5x104 células/cm2, en matraces de 25 cm3 que contenían DMEM:F12 (1:1) suplementados con suero fetal bovino al 20 %, 500 U/ml de penicilina, 50 g/ml de estreptomicina y 2.5 g/ml de amphotericina B. Las células se incubaron a 37 °C y 5 % de CO2 y los medios de cultivo se cambiaron cada tres días hasta alcanzar una confluencia del 80 %(23).

Subcultivo y escalamiento de células madre mesenquimales Una vez alcanzada la confluencia del 80 %, las células se subcultivaron semanalmente de la siguiente manera: la monocapa se lavó con DPBS y las células se separaron mediante HBSS con 7.5 mg de tripsina porcina y 0.6 mg de EDTA. Las células se sembraron a una densidad de 5x104 células/cm2 en matraces de 75 cm3 (primer subcultivo) y luego en 175 cm3 (subcultivos posteriores) con DMEM F12 (1:1) suplementados con suero fetal bovino al 20 %.

Citometría de flujo Las células madre mesenquimales alogénicas de la médula ósea se caracterizaron mediante citometría de flujo. Se utilizaron tres conjuntos de anticuerpos para inmunofenotiparlos. Las CMM-AMO utilizadas para la infusión fueron positivas para los marcadores de superficie CD73, CD90, CD105, CD28 y CD44 (CD28/CD44 específicos para MSC equino), negativas para CD45, CD34, CD14 y CD79. La citometría de flujo se realizó con base en protocolos previamente reportados(24-28).

728


Rev Mex Cienc Pecu 2021;12(3):721-741

Administración de CMM-AMO Los caballos se sedaron y prepararon para la administración de CMM-AMO como se describió anteriormente (ver sección venografía). Las CMM-AMO se diluyeron en solución salina fisiológica y se administraron (10-30x 106) en la vena digital palmar lateral (o medial) en condiciones estériles a través de un catéter mariposa de calibre 21, conectado a una jeringa de 20 ml, en el caballo de pie. El torniquete se retiró 20 min después de la administración de las células. El dedo se mantuvo vendado durante un día. Las CMM-AMO se inyectaron tres veces en intervalos de un mes.

Resultados Condición clínica de los caballos tratados con CMM-AMO

Los caballos con laminitis crónica tuvieron puntuaciones de Obel-Glasgow que oscilan entre 2 y 14 antes del inicio del tratamiento con CMM-AMO (Figura 1A). En contraste, el caballo sano no mostró cojera o dolor, ni incrementos de temperatura de los cascos en ningún momento durante el período evaluado. A medida que avanzaba el estudio, todos los caballos tratados con CMM-AMO mejoraron su condición clínica después del segundo o tercer mes de haber recibido infusiones venosas de CMM-AMO. Al final del período de seis meses, todos los caballos tratados con CMM-AMO disminuyeron sus puntuaciones de Obel-Glasgow y mejoraron significativamente su movilidad y condición clínica. En general, los caballos con la peor condición inicial fueron los que más mejoraron (Figura 1A). Todos los caballos tuvieron una mejora en la movilidad, calidad y forma del casco, también mejoraron su comportamiento y las facciones de sus caras (escala Grimace), teniendo una buena calidad de vida. Esta mejoría fue atribuible a la infusión de CMM-AMO, ya que el caballo de simulación tratado solo con el vehículo no mejoró durante el transcurso del tiempo experimental (Figura 1A). En contraste, la temperatura de los cascos en caballos laminíticos osciló entre 27 °C y 35.5 °C (promedio de 33.26 °C + 2.58) antes de que comenzara el tratamiento con CMMAMO. Como referencia, la temperatura en los cascos del caballo sano osciló entre 27 °C y 30 °C (promedio 28.56 °C + 0.79). El tratamiento con CMM-AMO no tuvo un impacto importante en la temperatura de los cascos (Figura 1B). En unos caballos tratados, la temperatura del casco tendió a disminuir ligeramente (1 a 3 °C) después de las infusiones de CMM-AMO (promedio de 32.27 °C + 1.78). En otros, los cambios de temperatura fueron muy variables durante el transcurso del experimento. Sin embargo, en todos los casos, los caballos tratados con CMM-AMO y el caballo de simulación (promedio de 33.01 °C + 1.29) nunca alcanzaron valores saludables estables de temperatura de los cascos.

729


Rev Mex Cienc Pecu 2021;12(3):721-741

Figura 1: Evolución clínica de los caballos después de haber sido tratados con células madre mesenquimales alogénicas de la médula ósea (CMM-AMO)

Evolución clínica (A) y la temperatura de los cascos (B) de los caballos tratados con CMM-AMO, el caballo sano y el caballo de simulación, según lo monitoreado por la escala de Obel-Glasgow y la termografía infrarroja.

Patrón vascular del lecho venoso posterior al tratamiento con CMMAMO Los cascos del caballo están irrigados por un lecho vascular altamente anastomosado formado por el plexo coronario y las papilas, el plexo venoso sublaminar, las papilas terminales, los vasos circunflejos y los plexos venosos de la planta y el talón (Figura 2A). En caballos laminíticos, los rodales de dislocación crónica de la falange distal interrumpieron significativamente este patrón vascular ordenado. Como se ve en la Figura 2B, los cascos prácticamente se vuelven avasculares; todo el lecho vascular mostró defectos graves de llenado de medios de contraste, excepto los vasos madre en el plexo coronario y del talón, donde los vasos se veían irregulares y algo congestionados. En general, la gravedad del daño vascular se correlacionó con la gravedad de los síntomas (no se muestra). En contraste con los hallazgos venográficos descritos para el paisaje vascular en cascos laminíticos, las imágenes de los cascos obtenidas al final del sexto mes de haber comenzado el tratamiento con CMM-AMO revelaron, en todos los caballos, independientemente de la condición clínica inicial y el grado de daño vascular, indicios de recuperación vascular. Comúnmente, los vasos madre del plexo coronario y del talón se ensancharon y se observaron con frecuencia imágenes de brotes vasculares, al igual que vasos que atravesaban trayectorias algo "aberrantes" (Figura 2C). En otras palabras, un proceso de angiogénesis está claramente en camino. Sin embargo, ninguno de los caballos tratados mostró una recuperación completa del patrón vascular, a pesar de que su mejoría clínica era evidente. Por último, el caballo de simulación no mostró mejoría clínica, ni patrones venográficos de recuperación vascular (no mostrados).

730


Rev Mex Cienc Pecu 2021;12(3):721-741

Patrones vascular del casco e histológico del corion laminar de los caballos tratados con CMM-AMO Los caballos infundidos con CMM-AMO, pero no el de simulación, mejoraron su condición clínica y los patrones vasculares de sus cascos al final del sexto mes de tratamiento. Para evaluar si esta recuperación podría estar asociada a la restauración del tejido de los cascos, se realizó una biopsia y se evaluó histológicamente el corion laminar de un caballo sano, simulado/laminítico y laminítico; el segundo y el tercer grupo fueron muestreados antes y al final del tratamiento, seis meses después de la primera biopsia tomada. Los resultados representativos se muestran en la Figura 2. En el casco del caballo sano (Figura 2D), se observaron laminillas epidérmicas y dérmicas primarias interdigitando regularmente. Las laminillas epidérmicas y dérmicas secundarias, por otro lado, corrían en direcciones opuestas, pero paralelas una al lado de la otra. Las laminillas secundarias mostraban extremos redondeados gracias a la cubierta de la célula basal que avanzaba continuamente hasta la punta. Los núcleos de las células basales epidérmicas se yuxtapusieron opuestamente a la membrana basal (no se muestra). Finalmente, la membrana basal formó una capa delgada y continua debajo del revestimiento de los epitelios (Figura 2G) y el colágeno se organizó regularmente en haces paralelos a través de la dermis (Figura 2J). En marcado contraste, la histología de los cascos en caballos con laminitis crónica mostró una pérdida virtual de la arquitectura laminar (Figura 2E), hiperplasia de células basales con numerosos perfiles celulares picnóticos, (Figura 2H), tejido conectivo abundante, así como infiltración perivascular de células mononucleares (no mostrada). No se observó membrana basal (Figura 2H) ni colágeno (Figura 2K). Finalmente, los cascos de los caballos infundidos con CMM-AMO, pero no el de simulación, recuperaron la disposición laminar, la integridad de la monocapa epitelial sobre una membrana basal regular y continua y la organización y presencia de colágeno (Figura 2F, I y L). No se detectó evidencia de infiltración perivascular mononuclear significativa. Por último, se realizaron observaciones microscópicas electrónicas para evaluar más a fondo la integridad epitelial en los cascos de los caballos infundidos con CMM-AMO. En el caballo sano (Figura 2M), las células basales se unen entre sí por numerosos desmosomas. Sus núcleos eucromáticos mostraron formas irregulares caracterizadas por hendiduras. También presentaron una disposición citoplasmática conspicua de tonofilamentos. La lámina basal densa en electrones a la que estaban unidos era delgada, regular y continua. Los cascos laminíticos (Figura 2N), por su parte, mostraron escasos desmosomas, espacios intercelulares electrolúcidos abundantes. Las células basales tendieron a mostrar núcleos con grupos de cromatina. Los agregados de tonofilamento citoplasmáticos también fueron frecuentes, y no se observó evidencia de membrana basal. Los cascos en caballos infundidos con CMM-AMO (Figura 2O) mostraron una marcada reducción de los espacios intercelulares electrolúcidos. Los desmosomas se convierten en un hallazgo regular y los núcleos celulares vuelven a su forma regular y disposición de cromatina.

731


Rev Mex Cienc Pecu 2021;12(3):721-741

Figura 2: Patrones vascular del casco e histológico del corion laminar después de aplicado el tratamiento con CMM-AMO

A-C. Venografías representativas de cascos de caballos sanos (A), laminíticos (B) e infundidos con CMM-AMO (C). Observe la respuesta vascular en los cascos de los caballos infundidos con CMM-AMO. CP, Plexo Coronario; SP: Plexo Sublaminar; DPA: Ápice de la Falange Distal; TP: Plexo terminal; CV: Vasos circunflejos; A: Arco Terminal de los vasos digitales palmares; B: Plexo del talón; SVP: Plexo venoso plantar. D-L. Fotomicrografías representativas de secciones sagitales del corion laminar de un caballo sano (D, G, J), laminítico (E, H, K) e infundido con CMM-AMO (F, I, L) teñidos con violeta de cresilo (núcleos celulares; D-F), PAS (Membrana basal; G-I) o técnicas histoquimicas de Masson

732


Rev Mex Cienc Pecu 2021;12(3):721-741

(Colágeno; J-L). Observe la restauración del corion laminar en caballos infundidos con CMM-AMO. PEL: Laminillas Epidérmicas Primarias; PDL: Laminillas dérmicas Primarias; SEL: Laminillas Epidérmicas Secundarias; SDL: Laminillas dérmicas Secundarias; BM: Membrana basal. M-O. Micrografías electrónicas representativas que muestran características ultraestructurales de células basales en caballos sanos (M), laminíticos (N) e infundidos con CMM-AMO (O). Observe la recuperación de la disposición de cromatina y tonofilamentos, así como la de desmosomas en caballos infundidos con CMM-AMO. Nu: Núcleo; Tf: Tonofilamentos; Ds y puntas de flecha: Desmosomas; : edema; Las flechas en los recuadros señalan la membrana basal. Consulte el texto para obtener una descripción detallada de la Figura 2.

Discusión La laminitis crónica es una enfermedad inflamatoria que afecta los cascos del caballo. Angelone et al(3) propusieron que la pérdida de células madre mesenquimales es el evento fundamental que subyace a la fisiopatología de la laminitis crónica. Aunque sus resultados respaldan su afirmación, no pudieron atribuir de forma irrefutable sus hallazgos clínicos y venográficos a las células madre mesenquimales derivadas del tejido adiposo infundidas porque las células fueron coinfundidas con plasma rico en plaquetas. Además, confundieron la interpretación de sus resultados porque infundieron primero células madre mesenquimales derivadas del tejido adiposo alogénicas y luego autólogas en los caballos laminíticos. Por último, no proporcionaron pruebas directas de la regeneración del corion laminar en los caballos recuperados. El presente trabajo supera todos estos problemas técnicos al infundir solo CMM-AMO, suspendidas en medios de cultivo, en ambos cascos frontales de caballos afectados crónicamente por laminitis. De acuerdo con la predicción de Angelone, la infusión de CMM-AMO en la vena digital lateral de los cascos laminíticos mejoró significativamente las condiciones clínicas de todos los caballos tratados, al tiempo que restauró considerablemente las características citoarquitecturales del corion laminar de los cascos. Esto estuvo acompañado de una reducción de la infiltración inflamatoria perivascular de las células mononucleares, como también lo predijeron Angelone et al(3) con base en sus resultados biológicos moleculares; ellos encontraron una mayor expresión de ARNm de citoquinas antiinflamatorias y proteínas antioxidantes. La especificidad de estos hallazgos está respaldada por el hecho de que el caballo de simulación, infundido solo con medios de cultivo, permaneció sintomático y sus cascos mostraron el deterioro histológico característico del corion laminar al final del tiempo experimental. A pesar de que los presentes resultados apoyan circunstancialmente que las CMM-AMO promueven la regeneración del tejido de los cascos al reducir, en parte, la inflamación local, en este caso, esta noción aún espera confirmación directa mediante la estimación de citoquinas proinflamatorias en el corion laminar de los caballos laminíticos tratados y no tratados con CMM-AMO. Hasta donde se sabe, hasta la fecha, no existe una forma confiable de realizar tales estimaciones(29,30). En cualquier caso, como ya se ha comentado, estos resultados respaldan los reportados por Angelone et al(3), quienes sugirieron que las células madre mesenquimales promoverían la regeneración del corion laminar al ejercer no solo acciones antiinflamatorias, sino también inhibiendo la degradación de la matriz extracelular mediada por MMP, amortiguando el daño de ROS y reclutando células endoteliales y 733


Rev Mex Cienc Pecu 2021;12(3):721-741

madre locales y circulantes. Ciertamente, la evidencia venográfica obtenida por esta investigación de caballos tratados también apoya el llamado de Angelone. Un hallazgo clínicamente relevante fue que, a pesar de que los caballos infundidos con CMM-AMO mejoraron su condición clínica y restauraron en gran medida la citoarquitectura de los cascos, la temperatura de los cascos se mantuvo elevada en los caballos tratados. A primera vista, se podría pensar que estos hallazgos descartan el monitoreo de la temperatura como un procedimiento sensible para seguir el progreso del tratamiento. Sin embargo, el hecho de que la restauración vascular sea parcial en todos los caballos tratados al final del periodo experimental sugiere lo contrario. Por un lado, este hallazgo podría indicar que sigue habiendo algún grado de inflamación que promueve que la temperatura se mantenga alta a través del tejido relativamente avascular en los cascos aún en regeneración. Sin embargo, es probable que la temperatura de los cascos más alta de lo normal no esté relacionada con una inflamación duradera, ya que se encontró que la cojera y el dolor se redujeron significativamente en los caballos infundidos con CMM-AMO. Alternativamente, la falta de recuperación completa del lecho vascular puede poner en peligro la disipación de calor de los cascos. Aunque, hasta donde se sabe, tal función no se ha atribuido a la red vascular de los cascos del caballo, es bien sabido que los lechos vasculares pueden funcionar como dispositivos de enfriamiento en otras partes del cuerpo del mamífero [para la Teoría del Radiador ver Falk, 1990(31)]. En cualquier caso, el monitoreo a largo plazo del lecho vascular y temperatura de los cascos en los caballos tratados podría ayudar a evaluar esta posibilidad. La angiogénesis es un proceso por el cual los vasos sanguíneos se forman nuevamente brotando de los vasos precursores existentes(32-34). De acuerdo con los resultados de Angelone, se obtuvo evidencia venográfica de angiogénesis en curso de los plexos coronarios y del talón de caballos laminíticos tratados con CMM-AMO. Estos datos pueden interpretarse de tres maneras no excluyentes mutuamente. Primero, pueden mostrar que los vasos sanguíneos de los cascos dañados conservan su capacidad de producir células endoteliales, capaces de recrear vasos funcionales; por lo tanto, la infusión de CMM-AMO puede liberar células madre vasculares locales. En segundo lugar, las CMM-AMO infundidas se comprometen con el linaje de células endoteliales, impulsando así la angiogénesis en los cascos de los caballos tratados una vez sembradas. En tercer lugar, las CMM-AMO infundidas pueden favorecer el reclutamiento de células madre autólogas circulantes que se comprometen con el linaje endotelial. Aunque la evidencia actual apoya que las CMM promueven la angiogénesis(34), las otras alternativas siguen abiertas a la investigación. Por lo tanto, los futuros estudios de etiquetado de linaje celular seguramente ayudarían a desenredar este enigma. En cualquier caso, lo que parece estar claro es que, bajo las condiciones experimentales utilizadas, los plexos coronarios y del talón contienen nichos que facilitan el desarrollo de la angiogénesis dadas las condiciones adecuadas. Este proceso parece recapitular la secuencia embrionaria ya que la vasculogénesis en el casco embrionario procede siguiendo un gradiente proximal a distal (35).

734


Rev Mex Cienc Pecu 2021;12(3):721-741

Otro hallazgo interesante en este trabajo es que la restauración de tejidos, hasta el punto en que se tomó la última biopsia de caballos infundidos con CMM-AMO, fue notable, sin evidencia de curación viciosa, ni cicatrices de ningún tipo, al menos en el sitio muestreado de todos los caballos evaluados. Tal observación sugiere que los cascos de los caballos pueden mantener un ambiente bioquímico similar al observado en las etapas ontogenéticas. Esta posibilidad gana apoyo a partir de la observación en el cerebro, donde el hipotálamo adulto exhibe un tremendo potencial de plasticidad debido a la presencia de moléculas de glicano polisialiladas que facilitan la remodelación del tejido(36,37). Los estudios dirigidos a comparar la composición molecular del tejido conectivo de los cascos a diferentes edades pueden proporcionar evidencia para evaluar el mérito de este supuesto. En un estudio previo(3) se encontró que una mezcla de CMMa combinada con PRP mejora la condición clínica de los caballos afectados por laminitis crónica. Como reconocieron, no pudieron determinar si la mejoría clínica observada en los caballos tratados se debió a CMMa o PRP o respondió a un efecto sinérgico de ambos, ya que no probaron la administración de ninguno de los dos por separado. En el presente trabajo, aunque las células madre no son de la misma clase, claramente la mejora clínica y la restauración tisular pueden atribuirse mejor a las CMM-AMO infundidas, ya que la infusión del vehículo (es decir, los medios de cultivo) no tuvo un efecto notable en ninguno de los parámetros evaluados en el caballo de simulación (los estudios futuros deben aumentar el número de caballos de simulación para fortalecer estas observaciones). Sin embargo, lo que nuestro estudio no reveló, es cómo las CMM-AMO promueven la regeneración tisular ya que la reconstitución vascular fue solo parcial [ver Angelone(3), King(32), Gu(38), para consideraciones teóricas]. En este sentido, las CMM-AMO podrían haber migrado del lecho vascular reconstituyente y colonizar territorios relativamente avasculares. Además, las CMM-AMO pueden producir y liberar factores solubles o exosomas(33,39-41), que podrían vigorizar las células madre locales para proliferar, diferenciar y restituir el tejido dañado. Por último, las CMM-AMO pueden promover el reclutamiento de células madre circulantes autólogas y su invasión de las regiones avasculares de los cascos. Los estudios de linaje combinados con biopsias adicionales tomadas en lugares de los cascos distantes al sitio de administración ayudarían a evaluar estas posibilidades. También podrían ayudar a descartar un posible sesgo durante la biopsia tomada, ya que las biopsias podrían haberse obtenido inadvertidamente de lugares donde el frente de la vasculogénesis estaba activamente en curso. Se debe hacer una consideración final con respecto al uso de células madre alogénicas. Se podría pensar que la posibilidad de inducir reacciones inmunológicas aumentaría mediante el uso de células alogénicas(42). Los resultados en el presente estudio y los publicados por otros(3,43,44), apoyan que la infusión de células madre alogénicas es lo suficientemente segura ya que los caballos tratados no presentaron evidencia de rechazo hasta el momento en que fueron evaluados. En contraste, aunque muchos consideran que el uso de células madre autólogas es más seguro, estudios recientes muestran que pueden desarrollar mutaciones de novo en el ADN mitocondrial que produce neoepítopos 735


Rev Mex Cienc Pecu 2021;12(3):721-741

inmunogénicos(45), aumentando así la posibilidad de rechazo inmunológico(46-49). Además, se ha demostrado que las células madre/estromales derivadas del tejido adiposo que recapitulan la expresión de biomarcadores de envejecimiento muestran una plasticidad reducida de las células madre(50), lo que impide su uso potencial como fuente autóloga de células terapéuticas; este también podría ser el caso de las células alogénicas.

Conclusiones e implicaciones En conclusión, las infusiones de CMM-AMO mejoraron las condiciones clínicas y promueven la restauración histológica de los cascos en caballos laminíticos. El procedimiento fue inocuo, independiente del sexo y efectivo al menos hasta por un período de 6 meses. Los estudios futuros deben aumentar el tamaño de la muestra y el tiempo de seguimiento para apreciar realmente los beneficios a largo plazo del tratamiento y si se necesitan infusiones adicionales de CMM-AMO. También se debe evaluar un método de administración menos invasivo, aunque estudios previos demostraron que la administración a través de esta vía no afecta a la eficiencia y eficacia terapéutica de las células madre si la dosis se calcula correctamente. También se deben evaluar los efectos del herrado y el recorte del casco. Finalmente, el uso de CMM-AMO para el manejo del dolor es otro tema que merece investigación con base en los resultados actuales. En cualquier caso, los datos aquí obtenidos respaldan que la pérdida de células madre mesenquimales es de hecho el evento crítico que conduce a la laminitis crónica. Por lo tanto, las medidas dirigidas a inducir tolerancia inmunológica contra el tejido mesenquimal de los cascos pueden ayudar a prevenir dicha pérdida. En este sentido, la infusión de antígenos mesenquimales obtenidos de los cascos laminíticos en la cámara anterior del ojo puede ser un camino para investigar en los próximos años(51). Financiación Alma Angélica García Lascuráin fue estudiante de doctorado del Programa de Doctorado en Ciencias de la Producción y de la Salud Animal, Facultad de Medicina Veterinaria y Zootecnia UNAM y recibió la beca No. 133213 del Consejo Nacional de Ciencia y Tecnología (CONACyT), México. Los autores agradecen a la Universidad Nacional Autónoma de México (UNAM), proyecto PAPIIT IN225316 y a la Dirección General de Asuntos del Personal Académico (DGAPA), por el apoyo financiero de esta investigación. Agradecimientos Los autores agradecen al MVZ Roberto Oropeza, MVZ, MSc Abraham Pineda Aranda, MVZ Roberto Juárez Cervantes y MVZ Jennifer A. Michel Mancilla por su apoyo médico y zootécnico. También estamos en deuda con el MVZ Jorge Rodríguez Lezama por su apoyo técnico en la realización de los estudios venográficos. El cultivo de células madre y la citometría de flujo fueron instrumentados por la IBT Antonia Lizbeth Mireles Ruiz

736


Rev Mex Cienc Pecu 2021;12(3):721-741

y el MC Moisés López Dávila a quienes agradecemos. Por último, también agradecemos al MVZ MSc José Ramírez Lezama, Biol. Maribel Nieto Miranda y MVZ MC Araceli Lima Melo por el aporte conceptual y técnico brindado para obtener y analizar las muestras histológicas. Laura Padierna Mota, Karyna Pérez Saldaña, Jaime Rodríguez Manuel de UNe Aplicaciones Biológicas, Laboratorios de Especialidades Inmunológicas. Conflictos de intereses Los autores reconocen que no existen intereses financieros en competencia o intereses de ninguna otra fuente, para divulgar. Literatura citada: 1.

Lecchi C, Dalla CE, Lebelt D, Ferrante V, Canali E, Ceciliani F, et al. Circulating miR-23b-3p, miR-145-5p and miR-200b-3p are potential biomarkers to monitor acute pain associated with laminitis in horses. Animal 2018;12(2):366-375.

2.

Pollit CC. Lamellar function at the cellular level. In: Belknap JK, Geor R, editors. Equine laminitis. Willey, Blackwell, Iowa, USA; 2017:22-38.

3.

Angelone M, Conti V, Biacca C, Battaglia B, Pecorari L, Piana F, et al. The contribution of adipose tissue-derived mesenchymal stem cells and platelet-rich plasma to the treatment of chronic equine laminitis: A proof of concept. Int J Molecular Sci 2017;18(2122).

4.

Driessen B, Bauquier SH, Zarucco L. Neuropathic pain management in chronic laminitis. Vet Clin North Am Equine Pract 2010;(26):315-337.

5.

Faleiros RR, Belknap JK. Leukocytes and inflammatory signaling in laminitis: Leukocytes. In: Belknap JK, Geor R, editors. Equine laminitis. Iowa, USA: Willey, Blackwell; 2017:91-101.

6.

Carter R, Engiles J, Megee S, Senoo M, Galantino-Homer H. Decreased expression of p63, a regulator of epidermal stem cells, in the chronic laminitic equine hoof. Equine Vet J 2011;43(5):543-551.

7.

Salem H, Thiemermann C. Mesenchymal stromal cells: Current understanding and clinical status. Stem Cells 2010;28(3):585-596.

8.

Keating A. Mesenchymal stromal cells: New directions. Stem Cell. Elsevier Inc. 2012;10(6):709-716.

9.

Ma S, Xie N, Li W, Yuan B, Shi Y, Wang Y. Immunobiology of mesenchymal stem cells. Cell Death Differentiation 2014;21(2):216-225.

10. Yu H, Fischer G, Ebert AD, Wu H, Bai X, Hogan QH. Analgesia for neuropathic pain by dorsal root ganglion transplantation of genetically engineered mesenchymal stem cell: initial results. Molecular Pain 2015;11(5). 737


Rev Mex Cienc Pecu 2021;12(3):721-741

11. Ghannam S, Bouffi C, Djouad F, Jorgensen C, Noel D. Immunosuppression by mesenchymal stem cells: mechanisms and clinical applications. Stem Cell Res Ther 2010;1(1):2. 12. Cassano J, Schnabel L, Betancourt A, Antczak D, Fortier L. Mesenchymal stem Cell therapy: Clinical progress and opportunities for advancement. Current Pathol Reports 2015;3(1):1-7. 13. Renzi S, Ricco S, Dotti S, Sesso L, Grolli S, Cornali M, et al. Autologous bone marrow mesenchymal stromal cells for regeneration of injured equine ligaments and tendons: A clinical report. Res Vet Sci 2013;(95):272-277. 14. Carrade DD, Borjesson DL. Immunomodulation by mesenchymal stem cells in veterinary species. Comp Med 2013;(63):207-217. 15. Kol A, Wood JA, Carrade HDD, Gillette JA, Bohannon-Worsley LK, Puchalski SM, et al. Multiple intravenous injections of allogeneic equine mesenchymal stem cells do not induce a systemic inflammatory response but do alter lymphocyte subsets in healthy horses. Stem Cells Res Ther 2015;6:73. 16. Pezzanite LM, Fortier LA, Antczak DF, Cassano JM, Bronahan MM, Miller D, et al. Equine allogeneic bone marrow-derived mesenchymal stromal cells elicit antibody responses in vivo. Stem Cell Res Ther 2015;6(54). 17. Ardanaz N, Vázquez FJ, Romero A, Remacha AR, Barrachina L, Sanz A, et al. Inflammatory response to the administration of mesenchymal stem cells in an equine experimental model: Effect of autologous, and single and repeat doses of pooled allogeneic cells in healthy joints. BMC Vet Res 2016;12(65). 18. Owens SD, Kol A, Walker NJ, Borjesson DL. Allogeneic mesenchymal stem cells treatment induces specific alloantibodies in horses. Stem Cells Internat 2016; doi: 10.1155/2016/5830103. 19. Brandao JS, Alvarenga ML, Pfeifer JPH, dos Santos VH, Fonseca-Alves CE, Rodrigues M, et al. Allogeneic mesenchymal stem cells transplantation in healthy equine superficial digital flexor tendon: A study of the local inflammatory response. Res Vet Sci 2018;118:423-430. 20. Douthit TL, Bormann JM, Bello NM. Assessing the association between hoof thermography and hoof Doppler ultrasonography for the diagnosis of lameness in horses. J Equine Vet Sci 2014;34(2):275-280. 21. Rucker A, Redden RF, Arthur EG, Reed SK, Hill BW, Dziuban EM, et al. How to perform the digital Venogram. In: AAEP Proc (USA). 2006;52:526-530. 22. Gravena K, Sampaio R, Dias D, Canola P, Peiró J, de Lacerda-Neto J. Evaluation of the integrity of horse hoof dermal and epidermal tissues collected by dorsal transmural access. J Equine Vet Sci 2012;32(12):858-862. 738


Rev Mex Cienc Pecu 2021;12(3):721-741

23. Barberini DJ, Paiva-Freitas NP, Sartori-Magnoni M, Maia L, Listoni AJ, Heckler MC, et al. Equine mesenchymal stem cells from bone marrow, adipose tissue and umbilical cord: immunophenotypic characterization and differentiation potential. Stem Cell Res Ther 2014;5(25). 24. De Schauwer C, Meyer E, Van de Walle GR, Van Soom A. Markers of stemness in equine mesenchymal stem cells: A plea for uniformity. Theriogenology 2011;75:1431-1443. 25. De Schauwer C, Piepers S, Van de Walle GR, Demeyere K, Hoogewijs MK, Govaere JL, et al. In search for cross-reactivity to immunophenotype equine mesenchymal stromal cells by multicolor flow cytometry. Cytometry Part A, 2012;81(4):312-323. 26. Carvalho AM, Yamada ALM, Golim MA, Álvarez LEC, Jorge LL, Conceiçao ML, et al. Characterization of mesenchymal stem cells derived from equine adipose tissue. Arq Bras Med Vet Zootec 2013;65(4):939-945. 27. Carvalho AM, Yamada ALM, Martins JRB, Maia L, Gloim MA, Deffune E, et al. Isolation and characterization of equine peripheral blood-derived multipotent mesenchymal stromal cells. Pesq Vet Bras 2013;33(9):1151-1154. 28. Michler JK, Hillmann A, Saykovic V, Mulling CKW. Horse hair follicles: A novel dermal stem cell source for equine regenerative medicine. Cytometry Part A, 2018;93(1):104-114. 29. Steelman SM, Chowdhary BP. Plasma proteomics shows an elevation of the antiinflammatory protein APOA-IV in chronic equine laminitis. Vet Res 2012;8(179). 30. Steelman SM, Johnson D, Wagner B, Stokes AM, Chowdhary BP. Cellular and humoral immunity in chronic equine laminitis. Vet Immunol Immunopathol 2013;153:217-226. 31. Falk D. Brain evolution in Homo: The “radiator” theory. Behavioral Brain Sci 1990;13:333-381. 32. King A, Balaji S, Keswani SP, Crombleholme TM. The role of stem cells in wound angiogenesis. Adv Wound Care 2014;10:614-625. 33. Schabbir A, Cox A, Rodríguez-Menocal L, Salgado M, Van Badiavas E. Mesenchymal stem cell exosomes induce proliferation and migration of normal and chronic wound fibroblasts, and enhance angiogenesis in vitro. Stem Cells Develop 2015;24(14):1635-1647. 34. Cortez-Toledo E, Rose M, Agu E, Dahlenburg H, Yao W, Nolta JA, et al. Enhancing retention of mesenchymal stem cells with prosurvival factors promotes angiogenesis in a mouse model of limb ischemia. Stem Cells Develop 2018;28:114-119. 2019 Jan 15;28(2):114-119. doi: 10.1089/scd.2018.0090. 739


Rev Mex Cienc Pecu 2021;12(3):721-741

35. Parks AH. Anatomy and function of the equine digit. In: Belknap JK, Geor R editors. Equine laminitis. USA: Willey, Blackwell, Iowa; 2017:22-38. 36. Theodosis DT, Poulain DA, Oliet SH. Activity-dependent structural and functional plasticity of astrocyte-neuron interactions. Physiology Rev 2008;88:983-1008. 37. Bonfanti L, Theodosis DT. Polysialic acid and activity-dependent synapse remodeling. Cell Adhesion Migration 2009;3(1):43-50. 38. Gu W, Hong X, Potter C, Qu A, Xu Q. Mesenchymal stem cells and vascular regeneration. Microcirculation 2017;24:e12324. 39. Ching RC, Wiberg M, Kingham PJ. Schwann cell-like differentiated adipose stem cells promote neurite outgrowth via secreted exosomes and RNA transfer. Stem Cell Res Ther 2018;9:266. 40. Zhang JC, Zceng GF, Wu L, Ou-Yang LY, Li WX. Bone marrow mesenchymal stem cells overexpressing human basic fibroblast growth factor increase vasculogenesis in ischemic rats. Brazilian J Medical Biol Res 2014;47(10):886-894. 41. Bier A, Berenstein P, Kronfeld N, Morgoulis D, Ziv-Av A, Goldstein H, et al. Placenta-derived mesenchymal stromal cells and their exosomes exert therapeutic effects in Duchenne muscular dystrophy. Biomaterials 2018;174:67-78. 42. Kim SC, Adams AB. Pluripotent stem cells that evade the immune radar. Nature Biotechnol 2017;35(8):722-723. 43. Augello A, Tasso R, Negrini SM, Cancedda R, Pennesi G. Cell therapy using allogeneic bone marrow mesenchymal stem cells prevents tissue damage in collageninduced arthritis. Arthritis Rheumatism 2007;56(4):1175-1186. 44. Kol A, Wood J, Carrade HD, Gillette J, Bohannon-Worsley L, Puchalski S, et al. Multiple intravenous injections of allogeneic equine mesenchymal stem cells do not induce a systemic inflammatory response but do alter lymphocyte subsets in healthy horses. Stem Cell Res Ther 2015;6(73). 45. Deuse T, Hu X, Agbor-Enoh S, Koch M, Spitzer MH, Gravina A, et al. De novo mutations in mitochondrial DNA of iPSCs produce immunogenic neoepitopes in mice and humans. Nature Biotechnology. Letters. 2019. 46. Nishikawa S, Goldstein RA, Nierras C. The promise of human induced pluripotent stem cells for research and therapy. Nature Review Molecular Cell Biol 2008;9:725729. 47. Bix M, Liao NS, Zijlstra M, Loring J, Jaenisch R, Raulet D. Rejection of class I MHC-deficient haemopoietic cells by irradiated MHC-matched mice. Nature 1991;349:329-331.

740


Rev Mex Cienc Pecu 2021;12(3):721-741

48. De Almeida PE, Ransohoff JD, Nahid A, Wu JC. Immunogenicity of pluripotent stem cells and their derivatives. Circ Res 2013;112:549-561. 49. Barrachina L, Remacha AR, Romero A, Vázquez FJ, Albareda J, Prades M, et al. Priming equine bone marrow-derived mesenchymal stem cells with proinflammatory cytokines: Implications in immunomodulation-immunogenicity balance, cell viability and differentiation potential. Stem Cells Dev 2017;26(1). 50. Jung JS, Volk C, Marga C, Navarrete Santos A, Jung M, Rujescu D, et al. Adiposederived stem/stromal cells recapitulate aging markers and show reduced stem cell plasticity affecting their adipogenic differentiation capacity. Cellular Reprograming 2019;21(4):187-199. 51. Martínez-Alcantar L, Talavera-Carrillo DK, Pineda-Salazar JU, Ávalos-Viveros M, Gutiérrez-Ospina G, Philips-Farfán BV, et al. Anterior chamber associated immune deviation to cytosolic neural antigens avoids self-reactivity after optic nerve injury and polarizes the retinal environment to an anti-inflammatory profile. J Neuroimmunology 2019;333(476964).

741


https://doi.org/10.22319/rmcp.v12i3.5462 Artículo

Composición nutricional de la carne equina y grado de sustitución de la carne bovina por equina en expendios de la Ciudad de México

Guillermo Reséndiz González a Baldomero Alarcón Zúñiga a Itzel Villegas Velázquez b Samuel Albores Moreno c Gilberto Aranda Osorio a*

a

Universidad Autónoma Chapingo. Posgrado en Producción Animal, Km. 38.5 Carretera México-Texcoco, 56230, Chapingo, México. b

Colegio de Posgraduados. Campus Montecillo. Montecillo, México.

c

Universidad de Ciencias y Artes de Chiapas. Facultad de Ingeniería, Villa Corzo, Chiapas, México.

* Autor de correspondencia: garanda@correo.chapingo.mx, gilberto.aranda@gmail.com

Resumen: Se evaluó el grado de sustitución de carne bovina por carne equina en distintos puntos de venta de las diferentes Alcaldías de la Ciudad de México, y se identificó las bondades o similitudes con la carne bovina como una fuerte alternativa de nutrientes. Se colectaron 161 muestras de carne de bovino que fueron sometidas a espectroscopia de reflectancia en el infrarrojo cercano (NIR´s – Food Scan) para determinar composición nutricional (contenido de humedad, proteína, grasa y colágeno), color de la carne (Hunter Lab L*, a* y b*) y polimorfismo de secuencias repetidas para caracterizar el origen bovino o equino por reacción en cadena de la polimerasa en geles de agarosa (PCR). Las variables de composición nutricional y color de la carne se analizaron en un diseño completamente al azar. Se encontró que nueve de las muestras dieron positivas para carne de equino y 152 muestras fueron 742


Rev Mex Cienc Pecu 2021;12(3):742-755

positivas para carne de bovino; resultando que la carne de bovino fue sustituida el 5.59 % por carne equina en los centros de comercialización en la Ciudad de México. Asimismo, el contenido de humedad, proteína, grasa y colágeno fluctuó entre las muestras de 73.1 a 75.1 %, de 22.0 a 23.5 %, de 2.0 a 2.3 %, y de 1.3 a 1.4 mg g-1, respectivamente; observando un ligero incremento (P<0.05) en la concentración de humedad y proteína en la carne de bovino respecto a la carne equina. La L* (luminosidad) de la carne entre las especies animal fue diferente (P<0.05); mientras que en los indicadores del color de la carne a* (de rojo a verde) y b* (de amarillo a azul) fluctuó de 29.80 a 37.50 y 15.00 a 16.20 (P>0.05). Se concluye que el porcentaje de sustitución de la carne de bovino por carne equina (5.59 %) se considera bajo y constituye un fraude al consumidor. Sin embargo, la carne equina tiene un potencial de ser una alternativa viable para el consumo humano, ya que la composición nutricional fue similar a la carne de bovino. Palabras clave: Carne, Bovino, Equino, PCR, Sustitución.

Recibido: 25/07/2019 Aceptado: 23/09/2020

Introducción En los últimos años se han desarrollado técnicas moleculares para la identificación de la especie origen de la carne y sus subproductos(1,2). Especialmente, el empleo de técnicas de polimorfismo de secuencias repetidas y la reacción en cadena de la polimerasa (PCR) que han sido efectivas para diferenciar entre carne de asno asiático salvaje (Equus hemionus) y el caballo doméstico (Equus domesticus) provenientes de mercados en la ciudad de Ulaanbatar, Mongolia(3). También, la técnica de PCR se ha utilizado para determinar el origen de diferentes especies animales en concentrados, harinas o subproductos cárnicos destinados a la alimentación animal o humana(4,5,6). Por lo anterior, es importante señalar que la carne es considerada una de las principales fuentes de nutrientes para satisfacer los requerimientos nutricionales en la alimentación humana; debido a su alto contenido de proteína de elevado valor biológico, su aporte de minerales, vitaminas(7), ácidos grasos esenciales y vitaminas liposolubles(8). En este sentido, la carne para consumo humano proviene mayormente de las especies bovina, porcina y aviar, y en una menor cantidad la carne de ovinos, caprinos, piscícola y algunas especies silvestres(9). Pero, las tendencias socioeconómicas, ambientales y nutricionales, han generado en la última década un creciente interés en alternativas para sustitución de carne de bovino(10).

743


Rev Mex Cienc Pecu 2021;12(3):742-755

Respecto a lo anterior, una alternativa que se ha utilizado para sustituir la carne de bovino, es la carne equina, la cual abastece el 0.25 % de la producción mundial de carne(11). México es uno de los principales países productores de carne equina y durante el 2013 aportó 11.2 % (83,500 t) de la producción mundial (745,966 t), exportando el 17.3 % de la producción nacional(12). Mientras que el 82.7 % de la producción de carne equina se queda en el país y se utiliza principalmente para abastecer la industria de alimentos para mascotas y para animales de zoológicos. No obstante, el nivel de aceptación y consumo de carne equina para los seres humanos no es favorable, debido a que su comercialización no es del conocimiento del consumidor(13). Esto permite una vía de comercialización fraudulenta que podría promover la sustitución de carne bovina por equina y un sobre precio, ya que el costo económico de venta de la carne equina está muy por debajo de la carne bovina en las carnicerías, y expendios de este rubro en las grandes ciudades del país(14). Por otra parte, la carne equina cuenta con valores nutricionales equivalentes a otras carnes convencionales(15). Sin embargo, puede presentar riesgos claros a la salud humana, ya que no son criados para la producción de alimento, son tratados o inyectados con varias sustancias químicas, peligrosas para los humanos, muchas de las cuales se encuentran prohibidas para su uso en animales de crianza(16). Por ello, es importante que el consumidor esté informado sobre la procedencia de la carne, calidad nutrimental y el precio en el mercado. Por lo tanto, es importante evaluar el grado de sustitución de carne bovina por carne equina en distintos puntos de venta de las diferentes delegaciones de la Ciudad de México e identificar las bondades o similitudes con la carne bovina como una fuerte alternativa de nutrientes.

Material y métodos Sitios de muestreo Las muestras de carne se colectaron en 69 centros de comercialización incluidos los principales centros de distribución como son la Merced, Calle 7, Rastro Viejo, Central de Abastos y Ferrería, ubicados en las diferentes delegaciones de la Ciudad de México.

Diseño de Muestreo Se colectaron 161 muestras de carne de bovino; 23 muestras fueron de carnicerías de grandes centros de distribución y 138 de mercados delegacionales, muestreando un total de 69 carnicerías que corresponde al 22.5 % del total de carnicerías de la Ciudad de México (307). Los puntos de comercialización de carne bovina muestreados fueron identificados en el portal del Instituto de Acceso a la Información Pública y Protección de Datos Personales (IPPDP) de la Ciudad de México. Considerando los siguientes supuestos: (a) el nivel

744


Rev Mex Cienc Pecu 2021;12(3):742-755

económico (alto, medio y bajo) de la región y (b) que el muestreo se realizará de forma al azar distribuidas de manera homogénea en todas las regiones de las Alcadías (Norte, Sur, Este y Oeste). La cantidad de muestras se determinaron con el teorema de límite central (TLC) con una desviación estándar de 8.9 % de acuerdo a las pruebas preliminares (17), siendo aleatoria la selección del mercado. Asimismo, el de los establecimientos, se seleccionaron dos mercados por cada delegación (Cuadro 1), siendo representativos del número total de puntos de venta bajo el TLC a una desviación estándar de 7.3 % en las variables de muestreo. Cuadro 1: Número de mercados, mercados muestreados y número de muestras por Alcaldía de la ciudad de México Carnicería Muestras Alcaldía colectadas Total Muestreadas Álvaro Obregón 15 3 6 Azcapotzalco 20 5 10 Benito Juárez 16 4 8 Coyoacán 17 4 8 Cuajimalpa 5 1 2 Cuauhtémoc 34 8 16 Gustavo A. Madero 49 11 22 Iztacalco 17 4 8 Iztapalapa 20 5 10 La Magdalena 5 1 2 Miguel Hidalgo 19 4 8 Milpa Alta 9 1 2 Tláhuac 19 4 8 Tlalpan 18 4 8 Venustiano Carranza 33 8 16 Xochimilco 11 2 4 Centros de comercialización 23

Tamaño de muestras La muestra de carne cruda fue de 250 g obtenida del corte llamado bistec de aguayón (Biceps femoris) y simulando las condiciones habituales de los consumidores. Para disminuir el riesgo de contaminación durante el período de obtención de muestras, éstas se conservaron en bolsas de plástico identificadas y selladas, las cuales se mantuvieron dentro de un envase isotérmico a una temperatura de 4 ºC. Una vez colectadas las muestras de un día de muestreo se llevaron al Laboratorio del Posgrado en Producción Animal para su separación en

745


Rev Mex Cienc Pecu 2021;12(3):742-755

submuestras para los diferentes análisis y almacenaje en congelación a -20 oC hasta su análisis.

Composición nutrimental de la carne Los contenidos de humedad, proteína, grasa, y colágeno de la carne se determinaron por espectroscopia de reflectancia en el infrarrojo cercano (NIR´s) en el Foodscan Meat Analyzer (FOSS®, Dinamarca). Se pesaron 180 g de muestra y se realizó una molienda con un procesador de alimentos Picalica (Moulinex®, Francia) durante 30 seg (dos series de 15 seg) de acuerdo a la metodología propuesta por la AOAC(18).

Determinación del color de la carne El color de la muestra de carne se determinó en el Miniscan (Hunterlab®, USA), realizando cinco lecturas por muestra en un cuadrante superior, inferior, derecho, izquierdo y centro de acuerdo a la metodología propuesta por la Comisión Internacional de L´Eclairage (1976)(19).

Extracción de ADN de tejido cárnico Para la identificación de especie de la carne bovino o equino se realizó la extracción del ácido desoxirribonucleico (ADN) de la muestra inicial de 250 g, se tomaron 500 mg de carne que se colocaron en microtubos y se congelaron a -80 °C por 48 h en ultracongelación (ThermoSientific®, modelo 2186). Posteriormente, las muestras se liofilizaron (Labconco®, modelo Freezone 4.5) durante cinco días y se molió el tejido seco con la ayuda del disruptor celular TissueLyser II® (Qiagen, Alemania). Una vez molida la muestra, se realizó procedimiento de extracción de ADN, colocando en cada microtubo 1 ml de solución lisis [Tris base (C4H11NO3) 50mM pH8, EDTA (C10H16N2O8) 0.1M, SDS (NaC12H25SO4) 0.5%, 7 µl de proteinasa K] y s e incubaron a 50 °C por 2 h continuas. Después, se agregaron 500 µl de Fenol:Cloroformo:Isoamílico (C6H5OH: CHCl3: C5H12O) (12:24:1) y se centrifugó a 10,000 rpm durante 10 min (Centrifugue eppendorf 5810 R). El sobrenadante se transfirió a otro microtubo, adicionando 1 ml de etanol (C2H5OH) al 70% a una temperatura de -20 °C, mezclándose por inversión hasta que el ADN precipitó. Por último, se centrifugó a 10,000 rpm durante 10 min, se formó un pellet y se secó en una centrífuga de vacío (Vacufuge plus). Para re-suspender el pellet de ADN se utilizaron 50 μl de H2O grado molecular.

746


Rev Mex Cienc Pecu 2021;12(3):742-755

Prueba de PCR para determinación de especie de la carne Previo a la amplificación del ADN por PCR, se comprobó que el ADN extraído fuera lo suficientemente puro y libre de contaminaciones de proteínas. Para medir la concentración del ADN se utilizó un espectrofotómetro Nanodroop® (Thermo Scientific, modelo ND-100) bajo los siguientes indicadores: el ADN presenta un máximo de absorbancia a 260 nm (50 μg/ml tienen una OD a 260=1), mientras que las proteínas lo tienen a 280 nm. La pureza del ADN se calculó, tomando en cuenta la absorción entre A260/A280 (1.9 y 1.7). En el Cuadro 2 se muestran las secuencias seleccionadas a partir de la literatura de los oligonucleótidos utilizados para la amplificación de fragmentos de ADN específicos por especie animal(14); estos consistieron en un primer forward universal y los oligonucleótidos reverse específicos de especie equina y bovina. La amplificación de los fragmentos específicos se realizó por PCR convencional. La amplificación del ADN por PCR, se llevó a cabo considerando un volumen final de 50 µl [5µl de10x PCR buffer, 1µl de 20µM de dNTPs, 2 µl de oligonucleótido universal [10 pmol/µl], 2 µl de oligonucleótido equino [10 pmol/µl], 2 µl de oligonucleótido bovino [10 pmol/µl], 0.25 µl de Taq polimerasa (Roche®), 250 ng de ADN y 32.75 µl de agua grado PCR libre de nucleasas]. Para la amplificación de las secuencias seleccionadas se utilizó un programa de termociclado Maxygen (Axygene®) el cual consistió en: una etapa de desnaturalización inicial, en la que se mantuvo la mezcla de reacción a 94 °C durante 30 seg para que las dos cadenas de ADN molde se separaran. Posteriormente se sometieron las mezclas de reacción a 35 ciclos de tres etapas cada uno [alineamiento (60 °C durante 30 seg), extensión (72 °C durante 30 seg) y refrigeración (4 °C)]. Cuadro 2: Secuencia de los pares de oligonucleótidos para la determinación cortes de carne fresca para bovino y equino de diferentes mercados delegacionales de la ciudad de México Especie Primer Secuencia Tamaño Universal Forward GAC CTC CCA GCT CCA TCA AAC ATC TCA TCT TGA AA Bovino Reverse TGA CTA GAA AAG TGT AAG ACC CGT AAT ATA AG

274bp

Equino

439bp

Reverse CTC AGA TTC ACT CGA CGA GGG TAG TA NA=No reportado

747

NA


Rev Mex Cienc Pecu 2021;12(3):742-755

Gel de electroforesis Finalizado las reacciones, se procedió a tomar 5 µl fragmentos amplificados (amplicones) de los productos PCR de las muestras para ser analizados por electroforesis convencional. Se mezclaron 5 µl del amplicon con 3 µl de buffer de carga 5x, colocando 8 µl en cada pozo del gel de agarosa [ Seakem (Lonza®) al 3% (P/V) en 1,500 ml TAE 1x, con 25 µl de Bromuro de Etidio (Invitrogen®)]. Se corrió a 100 Volts durante 45 min para posteriormente realizar la lectura de amplicones en un fotodocumentador de luz UV. La similitud de las secuencias seleccionadas se analizó aplicando el programa informático BLAST® (http://www.ncbi.nlm.nih.gov/BLAST).

Análisis estadístico Las variables de calidad nutritiva de la carne de bovino y equino (humedad, proteína, grasa, colágeno y color) se analizaron mediante un diseño completamente al azar(20), los tratamientos fueron el factor tipo de carne, la carne equina tuvo 9 repeticiones y la carne de bovino 152 repeticiones. Se utilizó un modelo lineal general con el paquete estadístico SAS(21). Las medias de los tratamientos se analizaron mediante la prueba de comparaciones múltiples de Tukey, y los resultados se consideraron significativos cuando P<0.05(20). Se utilizó el siguiente modelo matemático: Yij= μ + Ti + Eij Donde: Yij fueron las características nutritivas; μ corresponde al valor de la media de las respectivas variables; Tj representa el efecto de la especie; Eij representa el error experimental. También, se realizó una prueba de Ji-cuadrada (X2) con la finalidad de comparar los resultados de los amplicones de ADN de carne respecto a los esperados, por lo que la hipótesis que t odas las muestras de carne adquiridas de carnicerías serán de la especie bovina.

Resultados Identificación de especie Los amplicones, producto de las pruebas de PCR convencional tuvieron fragmentos de 439 y 274 pares de bases (pb) que corresponden al peso molecular del ADN de la carne de bovino y equino, respectivamente (Figura 1). Resultando, un total de 152 muestras positivas para carne de bovino y 9 de las muestras fueron positivas para carne de equino (Figura 2).

748


Rev Mex Cienc Pecu 2021;12(3):742-755

Figura 1: Gel de electroforesis de la prueba de PCR de muestras de carne de bovino y equino de expendios de la Ciudad de México

M50pb = Estandar de 50pb; +B1-3 Control positivo de bovino (274pb); +E1-3 Control positivo de equino (439pb).

Figura 2: Gel de electroforesis de la prueba de PCR de muestras de carne bovina y equina de expendios de la Ciudad de México

- Control negativo, +B Control positivo de Bovino, +E Control positivo de equino, y número de muestra.

Composición nutrimental

Se observó un ligero incremento (P<0.05) en la concentración de humedad y proteína en la carne de bovino respecto a la carne de equino (Cuadro 3). Mientras que el contenido de grasa y colágeno no mostró diferencias (P>0.05) entres las especies y fluctuaron de 22.0 a 23.5 %, de 2.0 a 2.3 %, de 73.1 a 75.1 % y de 1.3 a 1.4 mg g-1. Por otra parte, el color de la carne de bovino fue mayor (P<0.05) respecto a la carne equina en cuanto a la luminosidad (L) (Cuadro 4); mientras que no se observó diferencias (P>0.05) en los colores de la carne de a* (rojo a verde) y b* (amarillo a azul) y fluctuaron de 29.80 a 37.50 y 15.00 a 16.20, respectivamente.

749


Rev Mex Cienc Pecu 2021;12(3):742-755

Cuadro 3: Composición química nutricional de las muestras de carne de equino y bovinos de expendios de la ciudad de México Especie

Proteína a

Grasa a

Humedad a

Colágeno b

Bovino

23.51 ± 0.11

2.3 ± 0.05

75.13 ± 0.19

1.46 ± 0.02

Equino

22.00 ± 0.50

2.0 ± 0.44

73.16 ± 0.69

1.38 ± 0.09

0.001

0.25

0.01

0.32

Pr>F a

Valores expresados en porcentaje; b valores expresados en mg g-1.

Cuadro 4: Indicadores de color (L, a y b) de las muestras de carne de equino y bovinos de expendios de la ciudad de México Especie L a b Bovino 37.50 ± 0.22 16.20 ± 0.01 14.90 ± 0.01 Equino 29.80 ± 0.88 15.00 ± 0.11 13.40 ± 0.11 Pr>F 0.0001 0.27 0.26 L=luminosidad; A= color rojo/ verde; B=color amarillo/azul.

Discusión Identificación de carne equina en diferentes puntos de venta de la Ciudad de México La técnica de PCR y la secuencia de los pares de oligonucleótidos reportados por Matsunaga(4) fueron útiles para la identificación en cortes de carne fresca para bovino y equino en el presente estudio(22), y detectar que el 5.59 % de la carne muestreada en expendios de la Ciudad de México perteneció a la especie equina. La sustitución de la carne bovina por carne equina representa un fraude para el consumidor, ya que el precio de una carne y otra a nivel nacional difiere en casi un 100 %, lo cual no es aceptable desde el punto de vista ético, ni comercial(23). Aunque, la carne equina resulta una alternativa viable para el consumo humano, similar a otros tipos de carne obtenidas de especies tradicionales como la bovina, porcina y aviar(10), su aceptación en México es limitada debido a razones de índole cultural(9), ya que en otros países como Italia, Bélgica, Rusia y Alemania es perfectamente aceptada. Por otro lado, la venta de carne equina en el mercado nacional representa un riesgo potencial a la salud, ya que esta actividad no está regulada por las instancias gubernamentales, y puede haber presencia de fármacos utilizados en producción que pueden dejar residuos peligrosos en carne, como lo demuestra el estudio de Rubio(23) en donde encontraron que un 9.93 % de muestras de carne analizadas en diferentes estados de México dieron positivas para carne de caballo y el 93.10 % de las muestras seleccionadas excedieron los límites máximos de residuos (LMR) para el clembuterol –establecido por la FAO(24)– y 100% -según el límite de

750


Rev Mex Cienc Pecu 2021;12(3):742-755

tolerancia cero de las leyes mexicanas, lo que confirma que si hay un riesgo latente en salud para los consumidores nacionales.

Composición nutrimental de la carne de bovino y equino La composición nutricional de la carne equina es similar a la carne bovina(25,26). La humedad constituye cerca del 70 %, la proteína 22 %, la grasa intramuscular oscila entre 0.5 y 6 %, y los minerales representan cerca del 1.5 %(27). En este sentido, los hallazgos sobre el contenido de humedad fueron mayores (P<0.05) para la carne de bovino comparados a la carne de equina, y podría estar relacionado al tipo de musculo, la edad al sacrificio y el sexo de los animales(9). El tipo de músculo influye significativamente en el contenido de humedad de la carne bovina y equina, siendo mayor en el músculo semimembranoso(27). Estos resultados fueron similares a los reportados por Lorenzo y Pateiro(28) quienes, al evaluar la influencia del tipo de músculos sobre el valor nutricional de la carne de ternero, observaron valores de contenido de humedad de 53 a 77 %, respectivamente. Mientas que Tateo et al(29) presentaron muestras de carne de machos y hembras de raza “Heavy Draft Italian” con valores de humedad similares a los reportados en el presente estudio (70 y 73 %, respectivamente). Por otra parte, la concentración de proteína en la carne de bovino y equino se encuentran en los valores reportados como ideales (15 a 23 %) para el consumo humano(11,29). La carne de bovino mostró un incremento en la concentración de proteína que podría relacionarse principalmente a los factores como el sexo, edad, tipo de músculo y sistema de producción(8,9). Mientras que la concentración de proteína de la carne de equino fue similar a los reportados por otros autores(9,27,29), que observaron niveles que varían entre 20 y 22 % y que concluyen que los factores que influyen en la concentración de proteína son similares a los que afectan el ganado bovino. Es importante señalar que la relación grasa / proteína es una característica clave de las cualidades saludables de la carne para consumo humano(30). El bajo contenido de grasa intramuscular de la carne equina, es debido a que presentan tendencia a almacenar tejido adiposo de forma subcutánea(31). Por ello, algunos autores la denominan “carne saludable”(32). Esta característica es incluida en las estrategias de comercialización. Principalmente para las personas que intentan mantener su peso bajo control(33); ya que la Organización Mundial de la Salud(34), recomienda que sólo el 30 % de la ingesta diaria de energía del ser humano proveniente de la dieta debe de ser originada por la concentración de grasa, por lo que la carne de equino parece ser una buena fuente de proteínas con bajo contenido de grasa(10). La importancia del color como una característica de valoración física y de calidad de la carne, permite mostrar las variaciones del estado químico (grado de oxidación) del pigmento de un determinado momento de la carne y el estado físico de la carne, la estructura de las fibras

751


Rev Mex Cienc Pecu 2021;12(3):742-755

musculares y la cantidad de luz reflejada (L*a*b)(19). En este sentido, la menor luminosidad (L) de la carne equina puede ser debido a la cantidad de oxigenación de la mioglobina que está relacionada con el valor de a*(35). En este sentido, la carne de equino tiene mayor concentración de mioglobina en su vida adulta(36). Además, aumenta el valor de a* y se reduce el valor de L*, y tiende a un color más oscuro(37), lo que explica los valores de similitud del color de la carne para las especies en el presente estudio.

Conclusiones e implicaciones El grado de sustitución de la carne bovina por la carne equina (5.59 %) en los centros de comercialización en la Ciudad de México es bajo. Sin embargo, si la carne equina es producida y se maneja de acuerdo a la normatividad aplicada para la carne bovina, tiene un gran potencial como carne alternativa para el consumidor nacional, ya que la composición nutricional fue similar a la carne bovina. Agradecimientos Al Consejo Nacional de Ciencia y Tecnología (CONACyT) por la beca otorgada al primer autor y al proyecto financiado por la Dirección General de Investigación y Posgrado de la Universidad Autónoma Chapingo (Folio 135502006). Declaración de conflicto de interés Los autores declaran que no tienen ningún conflicto de interés por la publicación del presente artículo científico. Literatura citada: 1. Moreno RMA. Contribución al estudio de la frecuencia de cecina elaborada con carne de equino que se expide en el Distrito Federal [tesis profesional]. México, DF: Universidad Nacional Autónoma de México; 1972. 2. García MJG, Erosa VE, Prieto C, Núñez GYF. Identificación del origen de especie animal en carne fresca utilizando inmunodifusión doble. Téc Pecu Méx 2000;38(3):231-237. 3. Kuehn R, Kaczensky P, Lkhagvasuren V, Pietsch S, Walzer C. Differentiation of meat samples from domestic horses (Equus caballus) and asiatic wild asses (Equus hemionus) using a species-specific restriction site in the mitochondrial cytochrome b region. Mong J Biol Sci 2006;4(2):57-62.

752


Rev Mex Cienc Pecu 2021;12(3):742-755

4. Matsunaga T, Chikuni K, Tanabe R, Muroya S, Shibata K, Yamada J, Shinmura Y. A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Sci 1999;51(2):143-148. 5. Corona B, Lleonard R, Carpio Y, Uffo O, Martínez S. Short communication. PCR detection of DNA of bovine, ovine-caprine and porcine origin in feed as part of a bovine spongiform encephalopathy control program. Span J Agric Res 2007;5(3):312-317. 6. Kesmen Z, Yetim H, Şahin F. Identification of different meat species used in sucuk production by PCR assay. GIDA: J Food 2010;35(2):81-87. 7. Pereira PMDCC, Vicente AFDRB. Meat nutritional composition and nutritive role in the human diet. Meat Sci 2013;93(3):586-592. 8. Cabrera MC, Saadoun A. An overview of the nutritional value of beef and lamb meat from South America. Meat Sci 2014;98(3):435-44. 9. Vanegas AAM, Gutiérrez LF. Horse meat: production, consumption and nutritional value. CES Medicina Veterinaria y Zootecnia 2016;11(3):86-103. 10. Poławska E, Cooper RG, Jóźwik A, Pomianowski J. Meat from alternative species– nutritive and dietetic value, and its benefit for human health–a review. CyTA Food 2013;11(1):37-42. 11. FAO. Food and Agriculture Organization of the United Nations. Food and Agriculture data. http://faostat3.fao.org/browse/Q/QL/S 2015. Accessed Jun 27, 2015. 12.

FAO. FAOSTAT Producción http://www.fao.org/faostat/es/#data/QL.

Agrícola.

2017

disponible

en:

13. Kane DE, Hellberg RS. Identification of species in ground meat products sold on the U.S. commercial market using DNA-based methods. Food Cont 2016;(59):58-163. 14. Premanandh J. Horse meat scandal – A wake-up call for regulatory authorities. Food Cont 2013;(34):568-569. 15. Seong PN, Park KM, Kang GH, Cho SH, Park BY, Chae HS, Ba HV. The differences in chemical composition, physical quality traits and nutritional values of horse meat as affected by vario retail cut types. Asian-Australas J Anim Sci 2016;29(1):89-99. 16. González HG, Mota RD, Becerril HM, Casas GC, Zermeño M, Ramírez-NR, et al. Horse meat for human consumption in México: Slaughter performance and carcass morphometry. J Food Technol;2006:106-110.

753


Rev Mex Cienc Pecu 2021;12(3):742-755

17. Miller I, Miller M, John E. Freunds mathematical statistics. 6th ed. London UKA: Prentince Hall Int; 1999. 18. AOAC. Official methods of analysis. 18th ed. Washington. USA: Association of Official Analytical Chemists. 2007. 19. Sañudo AC, Gonzales C. Aspectos estratégicos para obtener carne ovina de calidad en el cono sur americano. Buenos Aires ed: Buenos Aires, Argentina; 2008. 20. Montgomery DC. Design and analysis of experiments. Eighth ed, New Jersey, USA: Wiley & Sons; 2013. 21. SAS. Institute Inc., SAS/STAT. Software, Ver. 9.00. SAS, Cary, NC, USA. 2006. 22. Iwobi A, Sebah D, Spielmann G, Maggipinto M, Schrempp M, Kraemer I, et al. A multiplex real-time PCR method for the quantitative determination of equine (horse) fractions in meat products. Food Cont 2017;(74):89-97. 23. Rubio LMS, Ruíz LAF, Medina MR, Espinosa P. Estudio del mercado de carne de caballo en México y pruebas de ADN. Reporte convenio HSI-UNAM DGEL/3817/15. Laboratorio de Ciencia de la Carne. Facultad de Medicina Veterinaria y Zootecnia. Universidad Nacional Autónoma de México 2017;1-39. 24. Food and Agriculture Organization of the United Nations, Codex Alimentarius Commision. Maximum residue limits for veterinary drugs in foods (Updated as at the 35th Session of the Codex Alimentarius Commision), Roma, Julio de 2012. ftp://ftp.fao.org/codex/weblinks/MRL2_e_2012.pdf. 25. Lanza M, Landi C, Scerra M, Galofaro V, Pennisi P. Meat quality and intramuscular fatty acid composition of Sanfratellano and Haflinger foals. Meat Sci 2009;81(1):142149. 26. Franco D, Rodríguez E, Purriños L, Crecente S, Bermúdez R, Lorenzo JM. Meat quality of “Galician Mountain” foals breed. Effect of sex, slaughter age and livestock production system. Meat Sci 2011;88(2):292-298. 27. Lorenzo JM, Sarriés MV, Tateo A, Polidori P, Franco D, Lanza M. Carcass characteristics, meat quality and nutritional value of horsemeat: A review. Meat Sci 2014;96(4):1478-1488. 28. Lorenzo JM, Pateiro M. Influence of type of muscles on nutritional value of foal meat. Meat Sci 2013;93(3):630-638.

754


Rev Mex Cienc Pecu 2021;12(3):742-755

29. Tateo A, De Palo P, Ceci E, Centoducati P. Physicochemical properties of meat of Italian Heavy Draft horses slaughtered at the age of eleven months. J Anim Sci 2008;86(5):1205-1214. 30. Paleari MA, Soncini G, Beretta G, Rossi MT. Microbiological and chemical aspects of corned, cooked and vacuum-packed horsemeat. Ital J Food Sci 1992;(4):205-212. 31. De Palo P, Maggiolino A, Centoducati P, Tateo A. Colour changes in meat of foals as affected by slaughtering age and post-thawing time. Asian Australas J Anim Sci 2012;25(12):1775-1779. 32. Badiani A, Nanni N, Gatta PP, Tolomelli B, Manfredini M. Nutrient profile of horsemeat. J Food Composition Analysis 1997;10(3):254-269. 33. Cooper RG. Ostrich meat, an important product of the ostrich industry: A southern African perspective. World’s Poultry Sci J 1999;(55):389–402. 34. Organización Mundial de la Salud (OMS), Organización de las Naciones Unidas para la Agricultura y la Alimentación (FAO). Dieta, nutrición y prevención de enfermedades crónicas. En: Informe de una Consulta Mixta de Expertos. Serie de Informes Técnicos, 916. Ginebra 2003; https://www.who.int/mediacentre/news/releases/2003/pr20/es/. 35. Segato S, Cozzi G, Andrighetto I. Effect of animal morphotype, sex and age on quality of horsemeat imported from Poland. Proceedings of the A.S.P.A. XIII Congress, Piacenza 1999:21–24. 36. Badiani A, Manfredini M. The production of horsemeat. Italian J Anim Sci 1994;(20): 35–43. 36. Rossier E, Berger C. La viande de cheval: des qualités indiscutables et pourtant méconnues. Cahiers de Nutrition et de Diétologie 1988;(23):35–40.

755


https://doi.org/10.22319/rmcp.v12i3.5892 Artículo

Suplementación con harina de Agave fourcroydes en el crecimiento, características de la canal, peso de los órganos, morfometría intestinal y bioquímica sanguínea en conejos de engorda

Yordan Martínez a* Maidelys Iser b Manuel Valdivié c Jorge Galindo d David Sánchez d

a

Universidad de Zamorano. Departamento de Ciencia y Producción Agropecuaria, Valle de Yeguare, San Antonio de Oriente 96, Honduras. b

Universidad de Granma. Facultad de Ciencias Agropecuarias. Granma, Cuba.

c

Centro Nacional para la Producción de Animales de Laboratorio. La Habana, Cuba.

d

Universidad de Guadalajara, Centro Universitario de Ciencias Biológicas y Agropecuarias (CUCBA). Departamento de Producción Animal. Jalisco, México.

*Autor de correspondencia: ymartinez@zamorano.edu

Resumen: El objetivo de este estudio fue evaluar el efecto de la suplementación dietética con polvo de Agave fourcroydes en el desempeño del crecimiento, las características de la canal, el peso de los órganos, la morfometría intestinal y la bioquímica sanguínea en conejos de engorda. Un total de 40 conejos machos (Nueza Zelanda × californianos) destetados a los 35 días fueron seleccionados aleatoriamente para una dieta de control (DC) y DC + 1.5 % de polvo de A. fourcroydes, con 10 réplicas y dos conejos por réplica. Después de 60 días, el polvo de A. fourcroydes aumentó el peso corporal, la ingesta de alimento y la ganancia de peso (P<0.05), sin afectar la relación de conversión alimenticia y la viabilidad 756


Rev Mex Cienc Pecu 2021;12(3):756-772

(P>0.05). Además, este producto natural no afectó las porciones comestibles y los indicadores determinados en el Longissimus dorsi, ni los pesos relativos de los órganos y la morfometría intestinal (P>0.05); sin embargo, se observó una disminución del pH cecal y, en consecuencia, se encontró un aumento de las bacterias beneficiosas cecales (P <0.05). Asimismo, el polvo de A. fourcroydes redujo (P<0.05) la concentración sérica de glucosa, lípidos dañinos, LAD e índice aterogénico, aunque sin cambios para el nitrógeno ureico, creatinina y LMBD (P>0.05). El polvo de Agave fourcroydes como aditivo zootécnico promovió un mejor crecimiento, además, mostró efectos hipolipemiantes e hipoglucémicos, sin modificar las porciones comestibles y los órganos digestivos. Palabras clave: Agave fourcroydes, Aditivo zootécnico, Conejo; Promotor natural de crecimiento, Efecto hipoglucémico, Efecto hipolipemiante.

Recibido: 08/12/2020 Aceptado: 08/02/2021

Introducción La producción moderna de conejos se caracteriza por una alta intensidad productiva, en la que los animales están sujetos a diferentes situaciones de estrés. Estos, a su vez, causan en algunos casos desequilibrios en la microbiota intestinal, con el desarrollo de microorganismos patógenos, inmunosupresión, conversión alimenticia ineficiente, alta mortalidad y disminución de la respuesta zootécnica(1). Por las razones anteriores, a lo largo de las décadas, los antibióticos se han utilizado como aditivos que promueven el crecimiento animal. Sin embargo, como consecuencia de problemas de seguridad alimentaria, especialmente debido al uso indiscriminado de antibióticos preventivos, se han identificado alternativas dietéticas efectivas, con resultados aceptables en el desempeño del crecimiento y porciones comestibles de animales no rumiantes(2). La comunidad científica y la industria del sector ganadero estudian e introducen nuevos aditivos seguros e inocuos para mejorar los indicadores sanitarios y productivos de los animales, como los ácidos orgánicos, prebióticos, probióticos, fitobióticos, enzimas, o su combinación(3,4). Actualmente, estos productos naturales tienen diversas características benéficas como hipocolesterolémico, hipoglucémico, antiinflamatorio, antioxidantes, moduladores de inmunidad, morfología, pH y microbiología intestinal(4), por lo que su 757


Rev Mex Cienc Pecu 2021;12(3):756-772

uso constante en pequeñas concentraciones en las dietas podría contribuir a maximizar la expresión genética de los animales, y a su vez, el desempeño del crecimiento de los animales de granja(5). El género Agave, parte de la familia Agavaceae, es nativo de México. Se sabe que el tallo de Agave fourcroydes es alto en oligosacáridos (fructanos) y metabolitos secundarios antiinflamatorios y bactericidas benéficos como saponinas, flavonoides, antocianinas, cumarinas, azúcares reductores y taninos(6). En este sentido, Iser et al(7) informaron que el uso de polvo de Agave fourcroydes, como suplemento dietético en conejos, promovió la ganancia de peso corporal debido a una mayor ingesta de alimento y una mejor salud intestinal, lo que aumentó la altura de las vellosidades en el intestino delgado y la concentración de IgG, con una disminución en la profundidad de las criptas y sin cambios en los parámetros hematológicos. A pesar de los beneficios prebióticos de Agave spp., según lo conocido al momento, no se encontraron estudios que demostraran su efecto sobre las porciones comestibles, la composición química del músculo Longissimus dorsi, el perfil metabólico sérico, las bacterias ácido-lácticas cecales y el peso relativo de los órganos inmunes y viscerales en conejos. Para este estudio, se planteó la hipótesis de que la suplementación dietética con Agave fourcroydes rico en fructanos podría promover el crecimiento de bacterias ácidolácticas cecales y, por lo tanto, modificar las porciones comestibles y disminuir los lípidos dañinos de los conejos en crecimiento. Por lo tanto, el objetivo de este experimento fue evaluar el efecto de la suplementación dietética con polvo de A. fourcroydes en el desempeño del crecimiento, las características de la canal, el peso de los órganos, la morfometría intestinal y la bioquímica sanguínea en conejos de engorda.

Material y métodos Animales, tratamiento y alojamiento Este estudio se realizó de acuerdo con los lineamientos mexicanos para el bienestar animal y el protocolo experimental, el cual es aprobado por el Comité de Cuidado Animal (Documento CINV.106/12). El experimento se llevó a cabo en el área experimental “Cofradía” del Centro Universitario de Ciencias Biológicas y Agropecuarias, Universidad de Guadalajara, México. La temperatura se mantuvo en 21 °C (±2), y la humedad relativa se mantuvo entre el 63 % (±2).

758


Rev Mex Cienc Pecu 2021;12(3):756-772

Un total de 40 conejos machos (Nueva Zelanda ×californianos) destetados a los 35 d con un PC inicial de 768 ± 2 g fueron seleccionados al azar para dos tratamientos dietéticos, con 10 réplicas y dos conejos por réplica. Para el tamaño de la muestra experimental, se consideraron las recomendaciones de García et al(8). Los tratamientos dietéticos consistieron en una dieta testigo (DT) y DT+1.5 % de polvo de tallo seco de A. fourcroydes. Para el nivel de suplementación de Agave fourcroydes de la dieta, se consideraron las recomendaciones de Iser et al(7). La dieta de testigo se preparó de acuerdo con los requisitos nutricionales de los conejos de engorda(9). Se utilizó la misma dieta de un trabajo anterior(7), que cumplía con los requerimientos nutricionales de los conejos de 35 a 95 días. La harina de tallo seco de Agave tequilana fue proporcionada por el Centro Universitario de Ciencias Biológicas y Agropecuarias. Los conejos se colocaron en jaulas metálicas de 76 x 76 x 45 cm de largo, ancho y alto, respectivamente. El alimento y el agua en comederos tubulares y bebederos de boquilla automáticos, respectivamente, estuvieron disponibles libremente durante todo el período experimental.

Desempeño del crecimiento Durante la fase experimental, el peso corporal inicial y final (35 y 95 días de edad) de los conejos se midió individualmente, siempre al mismo tiempo y antes de alimentarlos. Para ello, se utilizó una báscula digital de la marca OSBORNE® (Kansas, EE. UU.), modelo 37473®, con una precisión de ± 0.1 g. La viabilidad se calculó mediante el número de conejos durante la etapa experimental entre los alojados al comienzo del experimento. La ingesta media de alimento (IA) se determinó diariamente por el método de ofrecimiento y rechazo. La ganancia diaria promedio (GDP) se determinó considerando el peso corporal final e inicial y el número de días experimentales. La relación de conversión alimenticia (RCA) se calculó como la cantidad de alimento consumido, para una ganancia de 1 kg de peso corporal.

Características de la canal Se sacrificaron diez (10) conejos por tratamiento a los 95 días de edad, por el método de sangrado de la vena yugular, en el matadero experimental de la Universidad de Guadalajara, Jalisco, México. Antes del sacrificio, los animales se mantuvieron en ayunas durante 12 h, solo con agua ad libitum(10). Para la caracterización de la canal y la evaluación de sus propiedades, se procedió a la disección de las canales en las patas 759


Rev Mex Cienc Pecu 2021;12(3):756-772

delanteras, patas traseras, lomo y pared abdominal y costillas(11). Las porciones comestibles se pesaron en una báscula digital OSBORNE® (Kansas, EE. UU.), modelo 37473®, con una precisión de ± 0.1 g y el peso relativo se calculó de acuerdo con el peso de la canal. Además, el músculo Longissimus dorsi (LD, a nivel de la quinta vértebra lumbar) se tomó de cada animal sacrificado y se mantuvo a -20 °C para análisis futuros.

Ph, tonos de color, composición química y calidad sensorial del músculo Longissimus dorsi Después de 24 h de sacrificio, las muestras enfriadas (10 conejos por tratamiento) alcanzaron la temperatura ambiente (23 °C) y el pH se determinó mediante un potenciómetro digital Bantex modelo 300 A calibrado con soluciones tampón de pH 7 y 10. Además, los tonos de color del músculo Longisimus dorsi, como los valores de L* (luminosidad), a* (enrojecimiento) y b* (amarillez), se midieron utilizando un cromómetro Minolta CR-400/410 (Konica Minolta Sensing Inc., Osaka Japón). Además, en las muestras se determinó la materia seca (MS), grasa cruda (GC), cenizas y proteína cruda (PCr), de acuerdo con la metodología descrita por la AOAC(12). La calidad sensorial fue evaluada por un panel de 16 catadores entrenados que consumen carne de conejo diariamente, en excelente salud y entre las edades de 20 y 55 años. Los catadores fueron seleccionados del Centro Universitario de Ciencias Biológicas y Agropecuarias de la Universidad de Guadalajara, Jalisco, México. Las muestras (50 g) se cocinaron sin sal ni especias a una temperatura de 70 °C durante 1 h(13). Los criterios para la evaluación fueron: aroma (normal y anormal), jugosidad (normal y anormal), terneza (normal, dura, muy dura y muy suave) y color (normal, pálido e intenso).

Peso relativo de los órganos, morfometría y pH intestinal Durante el sacrificio de los conejos (a los 95 días de edad), se extrajeron y pesaron las vísceras (hígado y corazón), el bazo como órgano inmune y el estómago. Además, se pesó y se midió el intestino delgado, el intestino grueso y el ciego utilizando una báscula digital OSBORNE® (Kansas, EE. UU.), modelo 37473®, con una precisión de ± 0.1 g y una cinta métrica, respectivamente. El peso relativo de los órganos se calculó de acuerdo con el peso corporal al sacrificio. En el momento del sacrificio, varias porciones de estómago, intestino delgado, colon y ciego se cortaron y homogeneizaron en forma de pasta en un mortero de porcelana. Se pesaron 2 g de muestra en un vidrio de reloj; se añadieron 10 ml de agua destilada y se homogeneizaron en un vórtice durante 2 min. El pH fue 760


Rev Mex Cienc Pecu 2021;12(3):756-772

determinado por un potenciómetro digital Bantex modelo 300 A (EE. UU.) calibrado con soluciones tampón de pH 7 y 10.

Recuento total de bacterias mesófilas viables y ácido cecal-ácido láctico El saco de ciego de cada animal se tomó por tratamiento (10 animales por tratamiento). Luego, cada muestra (1 g) se colocó en un tubo que contenía 9 ml de agua peptonada estéril (Cultimed Parnreac-Química-SAU), se homogeneizó en agua destilada en una proporción de 1/10 (p/v) y se realizaron diluciones en serie (1/10) hasta la dilución 10 12. De cada dilución, se tomó 1 ml y se sembró profundamente en placas con agar MRS (Difco Laboratories, Detroit, Michigan) y pH de 6.2 a 37 °C durante 48 h en anaerobiosis (Gas Pak system, BBL, Cockeysville, EE. UU.). Posteriormente, para determinar las bacterias ácido-lácticas, se realizó un conteo visual con un contador de colonias (XK97A, China).

Bioquímica sanguínea De los conejos sacrificados para cada tratamiento (10 conejos por tratamiento), se tomaron 10 ml de sangre. Para obtener el suero sanguíneo, las muestras se dejaron reposar durante una hora en viales de 20 ml, luego se centrifugaron (centrifugadora Eppendorf) a 10,000 rpm y 20 °C durante 25 min. En el suero sanguíneo, la glucosa, la creatinina, el nitrógeno ureico, los lípidos totales, los triglicéridos, el colesterol total, el LAD, el LBD y el LMBD se determinaron por métodos colorimétricos, utilizando un espectrofotómetro ultravioleta de la marca Humalyzer y kits enzimáticos. El índice aterogénico se determinó según la fórmula de Dobiášová et al(14).

Análisis estadístico Los resultados se expresan como media ± EEM. El análisis estadístico se realizó mediante prueba t no apareada de acuerdo con un diseño completamente al azar, utilizando SPSS 20.0 (SPSS Inc., Chicago, IL, EE. UU.). Se tomaron valores de P<0.05 para indicar la significancia.

761


Rev Mex Cienc Pecu 2021;12(3):756-772

Resultados El Cuadro 1 muestra el efecto de la suplementación dietética con harina de A. fourcroydes en el desempeño del crecimiento de los conejos de engorda. La viabilidad fue excelente para ambos tratamientos (100 %), además, el tratamiento experimental aumentó el PC final, GDP y IDPA cuando se comparó con la dieta testigo, aunque la RCA no se vio afectada por el efecto de los tratamientos (P>0.05). Cuadro 1: Efectos de la suplementación con harina de tallo seco de A. fourcroydes en el desempeño del crecimiento de conejos de engorda a los 95 días de edad Tratamientos Ítems (n=40 Testigo Harina de A. EEM ± Valor P conejos) fourcroydes PC final, g 2,395.69 2,468.13 13.025 <0.001 IDPA, g/d 121.42 123.40 0.425 0.031 GDP, g/d 27.12 28.33 0.229 0.022 RCA 4.48 4.36 0.031 0.323 Viabilidad, % 100 100 EEM= error estándar de la media; PC= peso corporal, IDPA= ingesta diaria promedio de alimento, GDP= ganancia diaria promedio, RCA= relación de conversión alimenticia.

El Cuadro 2 muestra que la suplementación dietética con polvo de Agave fourcroydes no tuvo un efecto significativo (P˃0.05) en los rendimientos de las porciones comestibles y la composición química, la colorimetría, el pH y la calidad sensorial del músculo Longissimus dorsi en conejos de engorda.

762


Rev Mex Cienc Pecu 2021;12(3):756-772

Cuadro 2: Efecto de la suplementación con harina de tallo seco de Agave fourcroydes en las características de la canal de conejos de engorda a los 95 días de edad Tratamientos Ítems (n=20 conejos) Testigo Harina de A. EEM ± Valor P fourcroydes Partes comestibles (%) Canal 57.08 56.55 1.073 0.734 Patas delanteras 16.44 15.54 0.753 0.420 Patas traseras 34.13 32.86 1.291 0.505 Costillas 23.11 24.72 1.688 0.519 Composición química (%) Materia seca 32.87 33.57 0.492 0.541 Grasa cruda 3.53 3.06 0.283 0.089 Cenizas 0.92 1.33 0.170 0.148 Proteína cruda 23.44 23.22 0.481 0.447 Colorimetría L* 52.05 51.18 1.173 0.614 a* 5.61 6.03 0.327 0.517 b* 1.78 1.36 0.189 0.772 pH, 24 h post mortem 5.41 5.38 0.042 0.665 Calidad sensorial Aroma Normal Normal Jugosidad Normal Normal Terneza Normal Normal Color Normal Normal EEM= error estándar de la media; L*: luminosidad; a*: enrojecimiento; b*: amarillez.

Del mismo modo, la suplementación dietética con A. fourcroydes no indicó diferencias notables (P>0.05) (Cuadro 3) para el peso relativo de los órganos, morfometría intestinal y pH del aparato digestivo, a excepción del pH del ciego, que disminuyó debido al uso de A. fourcroydes (P<0.05). Además, este producto natural (A. fourcroydes) aumentó el recuento de bacterias mesófilas viables y bacterias ácido-lácticas cecales (P<0.05).

763


Rev Mex Cienc Pecu 2021;12(3):756-772

Cuadro 3: Efecto de la suplementación con harina de tallo seco de Agave fourcroydes en el peso de los órganos, la morfometría y el pH intestinal de conejos de engorda a los

Ítems (n=20 conejos) Peso relativo (%) Hígado Corazón Bazo Estómago Intestino delgado Intestino grueso Ciego Morfometría intestinal (cm) Intestino delgado Intestino grueso Ciego pH Estómago Intestino delgado Ciego Colon Ciego (UFC/ml) Bacterias mesófilas viables Bacterias ácido-lácticas

95 días de edad Tratamientos Testigo Harina de A. EEM± fourcroydes

Valor P

2.38 0.30 0.06 4.27 2.15 9.30 7.48

2.36 0.29 0.05 3.97 2.41 8.66 7.03

0.137 0.019 0.011 0.404 0.189 0.803 0.785

0.941 0.529 0.826 0.432 0.350 0.200 0.240

272.83 113.00 47.50

268.66 110.16 47.83

5.625 4.225 1.267

0.681 0.646 0.856

5.94 6.93 6.77 6.90

5.54 6.90 6.44 6.80

0.249 0.006 0.018 0.113

0.285 0.798 0.046 0.544

10.42 6.36

11.6 8.05

0.309 0.520

0.021 0.044

EEM= error estándar de la media.

La suplementación dietética con 1.5 % de A. fourcroydes redujo (P<0.05) la concentración sérica de glucosa, lípidos totales, colesterol total, triacilglicéridos, LAD y LBD, mientras que la concentración de nitrógeno ureico, creatinina y LMBD no mostró diferencias (P>0.05) entre los tratamientos (Cuadro 4).

764


Rev Mex Cienc Pecu 2021;12(3):756-772

Cuadro 4: Efecto de la suplementación con harina de tallo seco de Agave fourcroydes en la bioquímica sanguínea y el índice aterogénico de conejos de engorda a los 95 días

Ítems (n=20 conejos) Nitrógeno ureico Glucosa Creatinina Lípidos totales Colesterol total Triacilglicéridos LAD LBD LMBD Índice aterogénico

de edad (mg/dl) Tratamientos Testigo Harina de A. fourcroydes 39.20 37.00 129.80 104.20 0.98 0.92 512.00 494.80 213.60 192.80 180.20 163.80 65.44 53.60 184.60 102.82 36.40 35.20 2.82 1.93

EEM±

Valor P

0.906 1.338 0.150 3.077 2.302 2.447 1.392 2.056 0.739 0.048

0.124 <0.001 0.091 0.004 <0.001 <0.001 <0.001 <0.001 0.284 <0.001

EEM= error estándar de la media; LAD= lipoproteínas de alta densidad, LBD= lipoproteínas de baja densidad, LMBD= lipoproteínas de muy baja densidad.

Discusión El uso de nuevos alimentos y aditivos en las dietas de los animales de experimentación provoca cambios en la morfofisiología, la respuesta inmune y la microbiología. Siendo más acentuado en conejos, con característica de un herbívoro no rumiante(9); es por ello que la viabilidad puede mostrar en primera instancia la efectividad biológica de estos productos. En este sentido, Agave fourcroydes como aditivo nutracéutico no causó morbilidad y mortalidad en conejos; resultados similares se encontraron en un experimento previo(7). Por lo tanto, Ayala et al(3) y Abd El‐Hack et al(5) indicaron que los productos naturales no tienen efectos residuales en los productos animales. Además, parece que las características organolépticas de la harina de A. fourcoydes contribuyeron a un aumento en la ingesta de alimento de 1.98 g/d/conejo en relación con el control. Según Iser et al(6), la harina de A. fourcroydes tiene un sabor moderadamente dulce debido a la presencia de fructanos y fructosa, esto podría estimular la ingesta de alimento, sin afectar la relación de conversión alimenticia. Asimismo, Bovera et al(15) reportaron una mayor ingesta de alimento en conejos debido al efecto de MOS (mananooligosacáridos) en comparación con el grupo control.

765


Rev Mex Cienc Pecu 2021;12(3):756-772

Además, una mayor ingesta de alimento con un 1.5 % de A. fourcroydes podría aumentar el peso corporal en este tratamiento, debido a la presencia de metabolitos secundarios beneficiosos y fructanos en la dieta, lo que modificó la respuesta animal como se observa en el Cuadro 1. Los fructanos que se encuentran en este producto natural (A. fourcoydes) aumentan la población de bacterias ácido-lácticas, lo que provoca una exclusión competitiva, con influencias favorables en el peso corporal(1). Por otro lado, la posible acción de los metabolitos secundarios en la microbiota intestinal benéfica de los conejos podría mejorar la absorción de nutrientes, la ganancia de peso y por tanto el peso corporal final(5) . Algunos estudios(16,17) encontraron una relación positiva entre la incorporación de pequeñas concentraciones de metabolitos secundarios benéficos en las dietas y el peso corporal final. Actualmente, se toma como referencia el músculo Longissimus dorsi (LD) para evaluar la composición y la calidad de la carne(11). El Agave fourcroydes como aditivo nutracéutico no afectó el contenido de proteínas, grasas y cenizas de la carne de conejo. Dalle-Zotte et al(18) indicaron valores de proteína (23 a 23.1 %) similares a los de esta investigación. Los valores de grasa en el músculo LD (3.53 a 3.06 %) están dentro del rango permisible para esta especie, similar al publicado por Carrilho et al(19), quienes reportaron niveles de 3.7 a 4.3 %. El valor de pH está directamente relacionado con la maduración y el color de las carnes(3). Según Składanowska‐Baryza et al(20), la evolución del pH post mortem en la carne afecta a la luminosidad y la terneza. En conejos, los rangos de pH oscilan entre 5.3 y 6.4(21), similares a este estudio. Asimismo, Vázquez et al(22) consideraron las coordenadas cromáticas más importantes en carne: L* (luminosidad), a* (tonos rojos) y b* (tonos amarillos). Hay muchos factores que influyen en el valor de estos indicadores, como el tipo de músculo, el pH, la edad, la raza, el contenido de mioglobina, el método de sacrificio y la alimentación(13). En este sentido, se reportaron valores similares de a*(5.53), aunque valores bajos de b* (0.85) que los mostrados en el Cuadro 2(23). Por otro lado, la harina de Agave fourcryde como aditivo nutracéutico en dietas no alteró (P˃0.05) la calidad sensorial del músculo LD de conejos de engorda (Cuadro 2), resultado que se considera positivo, ya que una alteración en estos parámetros disminuye la elección de este producto por parte del consumidor y afecta con pérdidas económicas significativas. Aparentemente, la presencia de fructanos benéficos y metabolitos secundarios en las dietas(6) debido a la suplementación con A. fourcroydes no causó anomalías en la carne de conejo.

766


Rev Mex Cienc Pecu 2021;12(3):756-772

Los resultados en el peso relativo del hígado, corazón y bazo de los conejos (Cuadro 3), mostraron que la harina de Agave fourcroydes no afectó las funciones orgánicas de los conejos, verificadas por el desempeño del crecimiento de los conejos en este grupo. Se reportaron resultados similares para el peso relativo de las vísceras, cuando se utiliza un extracto seco de A. fourcroydes en animales de laboratorio(24). Sin embargo, en varios trabajos(25,26) cuando se utilizaron alimentos nutracéuticos, se reportaron pesos variables en las vísceras. Otro dato interesante es que el peso relativo del bazo no aumentó (P>0.05) cuando se suplementó A. fourcroydes en dietas de conejo. El aumento del peso de los órganos inmunes no siempre se asocia con un aumento de la actividad inmunológica y una respuesta productiva(22), como se observa en este estudio, que la T1 mejoró el desempeño, sin influencia en el peso relativo de este órgano inmune. En conejos, los estudios han demostrado que las características físico-químicas del alimento (principalmente altas concentraciones de FDN) modifican el peso y la morfometría intestinal debido a la mayor permanencia del quimo alimentario en estas porciones(9). En este sentido, el A. fourcoydes como aditivo nutracéutico tiene un bajo contenido de FDN, FDA y LDA(6) y su suplementación dietética no causó cambios significativos en TGI (Cuadro 3). Asimismo, Mourão et al(27) no encontraron variaciones en el peso relativo de los órganos digestivos en conejos cuando utilizaron fructooligosacáridos como suplemento prebiótico. Cabe señalar que el TGI de los conejos es un sistema de órganos, que reacciona de manera muy sensible debido a sus especialidades anatómicas contra alteraciones fuertes(28). Además, los fructanos estimulan la proliferación de microorganismos benéficos, principalmente bacterias ácido-lácticas (BAL)(29). Un aumento de BAL puede influir en una exclusión competitiva favorable a nivel de TGI en los conejos bajo estudio, lo que podría aumentar la inhibición de la proliferación de microorganismos patógenos(30). Asimismo, los metabolitos secundarios, como taninos, cumarinas, carbohidratos reductores y flavonoides identificados en el A. fourcroydes al tener un efecto antimicrobiano comprobado(6), lo que podría reducir las bacterias patógenas intestinales, como E. coli, Clostridium spp. y Salmonella spp. y provocar una exclusión competitiva favorable, debido a la mayor proliferación de BAL. La suplementación dietética con 1.5 % de A. fourcroydes causó una disminución (P<0.05) del pH cecal, tal vez debido al hecho de que las bacterias ácido-lácticas cecales en conejos degradan totalmente los fructanos(24). Autores como Pinheiro et al(31), que utilizaron dietas ricas en fructanos encontraron respuestas similares en el pH cecal de los conejos.

767


Rev Mex Cienc Pecu 2021;12(3):756-772

Aparentemente, la suplementación dietética de A. fourcroydes no disminuyó la eficiencia proteica de la dieta debido a los valores de nitrógeno ureico en sangre(32). Muchos informes indican que los alimentos ricos en fructanos, como A. fourcoydes, reducen la glucosa sérica al aumentar la secreción del péptido similar al glucagón 1 (PSG 1) en las células L endocrinas en el intestino, los autores han encontrado resultados similares al usar extractos de Agave fourcroydes en las dietas de ratones de laboratorio(24). Se demostró que este producto natural tiene un efecto hipoglucémico significativo, ya que disminuyó la glucosa sérica en 25 mg/dl en comparación con el control. Asimismo, quizás, la presencia de metabolitos secundarios (especialmente polifenoles) en A. fourcroydes podría influir en la concentración sérica de glucosa debido al efecto astringente de estos metabolitos (principales polifenoles)(6), que provocan una liberación intestinal lenta y mantenimiento de la glucosa en la dieta. Un hecho relevante en este estudio es que la adición de A. fourcroydes tiene un importante efecto hipolipemiante. La alta concentración de fructanos y la presencia de metabolitos secundarios benéficos en A. fourcroydes, así como una mayor población de BAL y una mejor salud intestinal(7), podrían haber influido en la disminución del colesterol sérico en 21 mg/dl con respecto al control. Tal vez esto causó una disminución de LBD en 82 mg/dl, en comparación con el control. Además, los triacilglicéridos disminuyeron debido al efecto de A. fourcroydes en 17 mg/dl en comparación con el testigo. Los resultados mostraron que la suplementación dietética con A. fourcroydes disminuyó ambas lipoproteínas (LBD y LAD) (Cuadro 4). Sin embargo, la harina de A. fourcroydes redujo el índice aterogénico en 0.89 en comparación con la dieta base. Actualmente, no hay patrones definidos de índices aterogénicos para conejos. Sin embargo, una disminución en este índice debería favorecer la salud de estos animales en crecimiento(33).

Conclusiones e implicaciones La suplementación dietética con harina de Agave fourcroydes promovió un mejor crecimiento, con una disminución del pH cecal y un aumento en el recuento de bacterias ácido-lácticas cecales, además de reducir los lípidos dañinos (colesterol, triacilglicéridos y LBD), el índice aterogénico y la glucosa sérica, sin cambios significativos en el peso relativo de las porciones comestibles, los órganos digestivos y la composición química y la calidad sensorial del músculo Longissimus dorsi.

768


Rev Mex Cienc Pecu 2021;12(3):756-772

Literatura citada: 1. Falçao-e-Cunha L, Castro L, Maertens L, Marounex M, Pinheiro V, Freire J, Mourão J. Alternatives to antibiotic growth promoters in rabbit feeding: a review. World Rabbit Sci 2007;15(3):127-140. 2. Dalle-Zotte A, Celia C, Szendrő, Z. Herbs and spices inclusion as feedstuff or additive in growing rabbit diets and as additive in rabbit meat: A review. Livest Sci 2016;189(7):82-90. 3. Ayala L, Silvana N, Zocarrato I, Gómez S. Use of vulgar oregano (Origanum vulgare) as phytobiotic in fatting rabbits. Cuban J Agr Sci 2011;45(2):159-161. 4. Abd-El-Aziz AH, El-Kasrawy NI, Abd-El-Hack ME, Kamel SZ, Mahrous UE, ElDeeb EM, et al. Growth, immunity, relative gene expression, carcass traits and economic efficiency of two rabbit breeds fed prebiotic supplemented diets. Anim Biotechnol 2020;1-12. 5. Abd-El‐Hack ME, Alagawany M, Abdelnour S. Responses of growing rabbits to supplementing diet with a mixture of black and red pepper oils as a natural growth promoter. J Anim Physiol Anim Nutr 2019;103(2):509-517. 6. Iser M, Valdivié M, Figueredo L, Nuñez E, Más D, Martínez Y. Secondary metabolites, quality indicators and organoleptic characteristics of stems meal from Agave fourcroydes (Henequen). Cuban J Agr Sci 2020;54(1):1-10. 7. Iser M, Martínez Y, Ni H, Jiang H, Valdivié M, Wu X, et al. Effects of Agave fourcroydes powder as a dietary supplement on growth performance, gut morphology, concentration of IgG and hematology parameters of broiler rabbits. Biomed Res Int 2016;2016. 8. García J, Nicodemus N, Carabaño R, Villamide M, de Blas C. Determination of the number of replicates required to detect a significant difference between two means in rabbit’s traits. World Rabbit Sci 2001;9(1):27-32. 9. de Blas J, Mateos G. Feed formulation. In: de Blas C, Wiseman J, editor. The nutrition of the rabbit. 2nd ed. Wallingford, Oxon, UK: CABI Publishing; 2010:223-232. 10. NORMA Oficial Mexicana NOM-033-SAG/ZOO. Métodos para dar muerte a los animales domésticos y silvestres. México. 2014. 11. Blasco A, Ouhayoun J, Masoero G. Harmonization of criteria and terminology in rabbit meat research. World Rabbit Sci 1993;4(2):93-99. 769


Rev Mex Cienc Pecu 2021;12(3):756-772

12. AOAC: Official Methods of Analysis. 18th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 2006. 13. Capra G, Martínez R, Fradiletti F, Cozzano S, Repiso L, Márquez R, Ibáñez F. Meat quality of rabbits reared with two different feeding strategies: with or without fresh alfalfa ad libitum. World Rabbit Sci 2013;21(1):23-32. 14. Dobiášová M. Atherogenic index of plasma theoretical and practical implications. Clin Chem 2004;50(7):1113-1115. 15. Bovera F, Nizza S, Marono S, Mallardo K, Piccolo G, Tudisco R, de Martino L, Nizza A. Effect of mannan oligosaccharides on rabbit performance, digestibility and rectal Bacterial anaerobic populations during an episode of epizootic rabbit enteropathy. World Rabbit Sci 2010;18(1):9-16. 16. Fathi M, Abdelsalam M, Al-Homidan I, Ebeid T, Shehab-El-Deen M, Abd-El-Razik M, Abou-Emera O, et al. Supplemental effects of eucalyptus (Eucalyptus camaldulensis) leaves on growth performance, carcass characteristics, blood biochemistry and immune response of growing rabbits. Ann Anim Sci 2019;19(3):779-791. 17. Wang J, Lin L, Li B, Zhang F, Liu N. Dietary Artemisia vulgaris meal improved growth performance, gut microbes, and immunity of growing Rex rabbits. Czech J Anim Sci 2019;64(4):174-179. 18. Dalle-Zotte A, Cullere M, Tasoniero G, Gerencsér Z, Szendrő Z, Novelli E, Matics Z. Supplementing growing rabbit diets with chestnut hydrolyzable tannins: Effect on meat quality and oxidative status, nutrient digestibilities, and content of tannin metabolites. Meat Sci 2018;146(8):101-108. 19. Carrilho M, Campo M, Olleta J, Beltrán J, López M. Effect of diet, slaughter weight and sex on instrumental and sensory meat characteristics in rabbits. Meat Sci 2009;82(1):37-43. 20. Składanowska‐Baryza J, Ludwiczak A, Pruszyńska‐Oszmałek E, Kołodziejski P, Bykowska M, Stanisz M. The effect of transport on the quality of rabbit meat. Anim Sci J 2018;89(4):713-721. 21. Hulot F, Ouhayoun J. Muscular pH and related traits in rabbits: a review. World Rabbit Sci 2010;7(1):15-36.

770


Rev Mex Cienc Pecu 2021;12(3):756-772

22. Vázquez Y, Bernal H, Valdivié M, Gutiérrez E, Mora LM, Sánchez E, et al. Efecto de la inclusión de granos secos de destilería con solubles (DDGS) en la calidad de la canal y de la carne de conejos en crecimiento. Rev Mex Cienc Pecu 2019;10(3):522535. 23. Castellini C, dal Bosco A, Bernardini M, Cyril HW. Effect of dietary vitamin E on the oxidative stability of raw and cooked rabbit meat. Meat Sci 1998;50(2):153-161. 24. García Y, Bocourt R, Savón LL, García-Vieyra MI, López MG. Prebiotic effect of agave Fourcroydes fructans: an animal model. Food Funct 2015;6(9):3177-3182. 25. Tarek A, Zabut BM, Al-Krenawie A I. Effect of kefir intake on growth performance and some biochemical profiles among domestic rabbits. World J Pharm Pharm Sci 2017;6(3):223-240. 26. de Blas J, Chamorro S, García J, García P, García A, Gómez M, Menoyo D, Nicodemus N, Romero C, Carabaño R. Nutritional digestive disturbances in weaner rabbits. Anim Feed Sci Tech 2012;173(4):102-110. 27. Mourão J, Pinheiro V, Alves A, Guedes C, Pinto L, Saavedra M, Spring P, Kocher A. Effect of mannan oligosaccharides on the performance, intestinal morphology and cecal fermentation in rabbits. Anim Feed Sci Tech 2006;126(2):107-120. 28. Dihigo L, Savón L, Sierra F. Morphometric studies of the gastrointestinal tract and internal organs of rabbits fed with feed containing sugar canmeal. Cuban J Agr Sci 2001;35(4):337-341. 29. Depeint F, Tzortzis G, Vulevic J, I’anson K, Gibson G. Prebiotic evaluation of a novel galactooligosaccharide

mixture

produced

by

the

enzymatic

activity

of

Bifidobacterium bifidum NCIMB 41171: in healthy humans: a randomized, doubleblind, crossover, placebo-controlled intervention study. Am J Clin Nutr 2008;87(3):785-791. 30. Sharma KG, Vidyarthi VK, Zuyie R. Probiotics supplementation and performance of broiler rabbits. Indian J Anim Sci 2016;33(3):331–335. 31. Pinheiro V, Guedes C, Outor D, Mourao J. Effects of fibre level and dietary mannanoligosacharides on digestibility, caecal volatile fatty acids and performances of growing rabbits. Anim Feed Sci Technol 2009;148(2-4):288–300.

771


Rev Mex Cienc Pecu 2021;12(3):756-772

32. Farías-Kovac C, Nicodemus N, Delgado R, Ocasio-Vega C, Noboa T, Abdelrasoul RA, et al. Effect of dietary insoluble and soluble fibre on growth performance, digestibility, and nitrogen, energy, and mineral retention efficiency in growing rabbits. Animals 2020;10(8):1-19. 33. Oršolić N, Landeka Jurčević I, Đikić D, Rogić D, Odeh D, Balta V, Perak E J, Terzi S, Jutrić D. Effect of propolis on diet-induced hyperlipidemia and atherogenic indices in mice. Antioxidants 2019;8(6):1–22.

772


https://doi.org/10.22319/rmcp.v12i3.4866 Artículo

Evaluación de los componentes del manejo antes, durante y después de la matanza y su asociación con la presencia de carne DFD en bovinos del noreste de México

Jorge Loredo Osti a,b Eduardo Sánchez López a* Alberto Barreras Serrano a Fernando Figueroa Saavedra a Cristina Pérez Linares a Miguel Ruiz Albarrán b

a

Universidad Autónoma de Baja California. Instituto de Investigaciones en Ciencias Veterinarias. Laguna Campestre, Mexicali. BC. México. Universidad Autónoma de Tamaulipas. Facultad de Medicina Veterinaria y Zootecnia “Dr. Norberto Treviño Zapata”. Tamaulipas, México. b

* Autor de correspondencia: edsanmxl@hotmail.com

Resumen: Un total de 27 variables de manejo (antes, durante y después del sacrificio) en 394 bovinos fueron analizadas y utilizadas para determinar su asociación y valor explicativo con la presencia de carne DFD (Dark, Firm, Dry, por sus siglas en inglés), mediante las razones de probabilidad en un modelo de regresión logística múltiple. El estudio se realizó de noviembre de 2016 a agosto de 2017 en un rastro Tipo Inspección Federal localizado en el noreste de México. La presencia de carne DFD fue del 13.45 %. Se realizó un contraste entre clases para los factores evaluados mediante t Student y Ji cuadrada en función de la naturaleza de la variable como criterio de inclusión en la modelación logística. Diez de las variables

773


Rev Mex Cienc Pecu 2021;12(3):773-788

mostraron significación estadística (P<0.05) en estas pruebas, pero solo cuatro de ellas presentaron valor explicativo en el modelo logístico múltiple final (P<0.01), las cuales fueron: el tiempo de espera previo a la muerte, un mal insensibilizado, el espesor de la grasa subcutánea y diferencial de pH de la canal establecido con 24 h de diferencia. Las dos primeras aumentaron la posibilidad en la presencia de carne DFD, por el contrario, el espesor de grasa y el diferencial de pH fueron inversamente proporcionales. Las cuatro variables incluidas en el modelo final estuvieron presentes en diferentes etapas y son de naturaleza distinta. Por esta razón, para prevenir de manera efectiva este problema se necesita una evaluación multicausal en todo el proceso de matanza. Palabras clave: Carne, Corte oscuro, DFD, Bovino.

Recibido: 26/04/2018 Aceptado: 29/11/2019

Introducción La carne DFD (Dark, Firm, Dry, por sus siglas en inglés) es un problema que afecta la calidad sanitaria, fisicoquímica y sensorial del producto(1,2), debido a un pH final alto (>5.8) que favorece el crecimiento de flora bacteriana y disminuye la vida de anaquel(3,4). Además, la carne DFD presenta un color rojo oscuro y textura pegajosa, que da la apariencia de ser carne de animales viejos o que ha sido almacenada durante mucho tiempo(5,6). Esto propicia una baja aceptación por el consumidor y origina pérdidas económicas a los productores(7,8). En México, se calcula que la pérdida por cada canal con características DFD es de 88.58 dólares estadounidenses(9), superior a los 5.43 dólares de pérdida por canal encontrada en EE.UU(10). La carne DFD presenta las siguientes características: incremento en la capacidad de retención de agua, palatabilidad pobre, menor terneza y mayor absorción de luz, lo cual afecta su aptitud tecnológica para la elaboración de varios productos cárnicos(11,12,13). La velocidad en la disminución del pH post mortem, está directamente relacionada con el nivel de estrés que sufre el animal antes de la matanza(14,15). El estrés crónico y la exposición de largos plazos de estrés agudo, justo antes de ser sacrificado, hacen que las reservas de glucógeno muscular se consuman rápidamente(2), reduciendo la cantidad de ácido láctico que se forma por la glucólisis anaerobia en el músculo luego de la muerte del animal, lo cual provoca la presencia de carne DFD, también llamada Corte Oscuro(16,17). Existen diferentes factores intrínsecos que aumentan el riesgo de una mayor presencia de carne DFD tales como:

774


Rev Mex Cienc Pecu 2021;12(3):773-788

el origen racial (más frecuente en Bos indicus)(18,19), el sexo (mayor en machos enteros)(7,20), el peso (menos común en ganado de mayor peso vivo)(21,22), la cantidad de grasa (se presenta más frecuentemente con valores bajos en el espesor de la grasa subcutánea)(4,23) y la edad (es más frecuente en animales viejos)(24,25). Las condiciones ambientales también influyen en la presencia de carne DFD, las temperaturas extremas provocan estrés por calor o por frío(26,27). El manejo inadecuado en el procesamiento ante mortem es uno de los principales factores desencadenantes del corte oscuro, las distancias largas en el transporte y la elevada densidad animal en espacios reducidos influyen en su presencia, así como los tiempos prolongados en los corrales de espera, en las mangas y en el cajón de sacrificio(15,20), el uso de instrumentos estresantes (arreadores eléctricos, reatas, palos, etc.) en el arreo hacia el cajón de insensibilizado y una mala efectividad de este último también se han reportado como factores de riesgo(28,29). El proceso post sacrificio también repercute en la presencia de carne DFD, la tasa de disminución del pH y la temperatura del músculo interactúan continuamente durante el rigor mortis, y son probablemente dos de los factores post mortem más importantes que afectan las propiedades de la carne, tales como: color, pH final, capacidad de retención de agua y terneza(30,31,32), algunas características de la canal como su peso y el espesor de grasa subcutánea influyen en esta interacción(33,34). Estudios como los anteriores se han realizado para establecer la asociación entre la presencia de carne DFD y los factores evaluados; sin embargo, la mayoría de ellos han establecido esta asociación analizando dichos factores de manera individual y aislada, lo cual no permite analizar el efecto de las variables de manera conjunta ni sus interacciones. Por lo anterior, el objetivo de este trabajo fue evaluar la asociación de factores con valor explicativo, así como sus interacciones, relacionados con el manejo antes, durante y después del sacrificio, sobre la presencia de carne DFD.

Material y métodos Se evaluaron 27 variables intrínsecas y extrínsecas antes, durante y después del sacrificio, en las cuatro estaciones del año. El trabajo se efectuó entre noviembre de 2016 y agosto de 2017 en una planta de sacrificio Tipo Inspección Federal (TIF) localizada en Cd. Victoria, Tamaulipas. Los registros de las variables se tomaron en 16 períodos de 3 días cada uno: a la llegada, durante el sacrifico y el procesamiento de la canal. El genotipo de los animales correspondió, principalmente, a cruces comerciales de Bos taurus x Bos indicus. Los bovinos arribaron desde distintos puntos de la región y en diferente tipo de vehículo.

775


Rev Mex Cienc Pecu 2021;12(3):773-788

Tamaño de muestra

El número de animales se determinó para un muestreo simple aleatorio por atributos, considerando una población finita(35). Los componentes de la fórmula fueron un valor de confianza del 95% (Z = 1.96), precisión del 5%, un estimador de varianza igual a 0.25 [ σ2 = π(1-π)] y un valor de N generado del centro de sacrificio de los últimos tres años (n= 38,950 animal/año). El tamaño de muestra obtenido (n= 394) fue distribuido proporcionalmente por el número de sacrificio en las estaciones del año: primavera= 95, verano= 110, otoño= 78 e invierno= 110. La toma de datos se realizó en los meses de noviembre de 2016, febrero, mayo y agosto de 2017.

Recopilación de información

Variables ante mortem

Al arribo al matadero se registraron las variables intrínsecas y las extrínsecas tales como prácticas de transporte, forma de adquisición del animal, estación del año, temperatura y humedad relativa (termohigrómetro con una sonda, Hanna instruments, modelo HI9565). En los corrales de descanso se registró la presencia de lesiones visibles y variables concernientes al espacio y tiempo de permanencia. También se registró la separación de algún animal en corrales individuales por motivos de comportamiento o salud (arisco, montas o lesiones). Antes de la matanza se registró el día de la semana y los datos individuales referentes al tiempo de permanencia en la manga que conduce a los animales al cajón de insensibilización y a las condiciones del arreo del ganado. Se midió la temperatura y la humedad relativa antes de entrar en el cajón de sacrificio. Se obtuvo el índice de temperatura-humedad relativa (ITHR) mediante la fórmula siguiente: ITH = [0.81*T] + HR/100*(T–14.4) + 46.4, donde T= Temperatura ambiente (°C) y HR = Humedad relativa (%)(36).

Variables durante la matanza

El aturdimiento se realizó mediante una pistola de perno cautivo. Durante el colgado del cuerpo del animal se valoró la eficacia de la insensibilización mediante el registro de los indicadores de comportamiento siguientes: parpadeo espontáneo, rotación total de globo ocular, respiración rítmica, intento de levantarse, enderezamiento y vocalizaciones. Se

776


Rev Mex Cienc Pecu 2021;12(3):773-788

consideró una incorrecta insensibilización del animal cuando éste presentaba cualquiera de los signos anteriores. También se determinó el intervalo aturdimiento-desangrado desde que el animal colapsó hasta el degüello(37,38).

Variables en la canal caliente

Se registró el peso de la canal caliente; además, 45 min después del sacrificio se registró (por triplicado) el valor del pH (pH45min) con el fin de establecer un diferencial (ΔpH) entre el pH45min y el pH último (pHu) valorado 24 h después, el pH fue medido con un potenciómetro que contaba con un dispositivo de punción para carne (Hanna instruments, modelo HI99163). También se registró la temperatura (por triplicado) de la canal a los 45 min, en el músculo Longissimus dorsi a 5 cm de penetración (termómetro con sonda de penetración, Hanna instruments, modelo HI935007N).

Variables en la canal fría

En el cuarto frío (2 °C) 24 h después de la matanza se registraron los valores del pH final, el espesor de la grasa subcutánea y los parámetros colorimétricos: L* = Luminosidad (0 a 100), a* = índice de rojo (-60 a 60) y b* = índice de amarillo (-60 a 60). Todos estos registros se realizaron por triplicado en el área del músculo Longissimus dorsi entre la 10.ª y 12.ª costilla de la media canal izquierda, 30 min después de haber realizado el corte. El espesor de la grasa subcutánea se determinó con un calibrador Vernier de acero inoxidable y los valores de color con un espectrofotómetro Minolta con 5 cm de apertura, iluminante C y observador de 2° (Modelo CR-410, Minolta Co., Ltd., Osaka, Japón,). El Chroma (0 a 200) se calculó utilizando la siguiente ecuación: C* =(a*2 + b*2)1/2 (39). Por último, se registró la densidad en la cámara fría (número de canales/m2).

Variables de clasificación

Según los criterios establecidos, la canal se clasificó en oscura, firme y no exudativa (DFD) con base en lo siguiente: pHu ≥ 5.8, L* < 40 y C* < 30(40). Las canales que presentaron criterios diferentes se clasificaron como normales.

777


Rev Mex Cienc Pecu 2021;12(3):773-788

Análisis de las variables

El contraste entre las clases DFD y normal para las variables estudiadas se realizó en función de la naturaleza de la variable: Se utilizó t de Student para las variables cuantitativas continuas, mientras Ji-cuadrada y exacta de Fisher (para frecuencia <5 en una casilla) se utilizaron para las variables categóricas. La significancia fue establecida cuando P<0.05.

Estudio de asociación

La asociación de los factores de estudio con la clasificación de la carne (variable dependiente) de naturaleza binomial (1= DFD, 0= normal), se realizó aplicando un modelo logístico con múltiples variables independientes, así como sus interacciones. Como primer paso en la utilización del modelo logístico, se incluyeron las variables con significancia estadística (P<0.05) en la comparación entre clases DFD y normal. Del modelo completo se excluyeron los factores que resultaron no significativos (P≥0.05) según la prueba de Wald. Esto permitió obtener el modelo final con sus razones de probabilidad (OR, por sus siglas en inglés), errores estándar (EE) e intervalos de confianza (IC 95%). Al modelo final se le realizó la prueba de bondad de ajuste de Hosmer-Lemeshow(41,42). Los contrastes entre clases DFD y normal para las variables estudiadas, así como el análisis del modelo logístico con múltiples variables independientes se realizaron al aplicar los procedimientos TTEST, FREQ y LOGISTIC del paquete estadístico SAS 9.4(43).

Resultados y discusión El porcentaje de carne DFD encontrada en este estudio fue de 13.45 %, inferior al 38.99 % observado en el último estudio realizado en otra región de México(41). Las diferencias regionales entre la presencia de carne DFD sugieren que los factores que influyen en esta condición son múltiples y variados(44). Además, se ha observado un aumento de la frecuencia de este problema en otros países de Norteamérica: En EE.UU. pasó de 1.9 % en 2005(45) a 3.2 % en 2012(46) y en Canadá de 1.0 % a 1.3 % en un lapso de poco más de una década(47,48). De las variables incluidas en este estudio, solo 10 mostraron significancia en el contraste DFD vs normal (Cuadros 1 y 2). Sin embargo, al realizar el análisis del modelo de regresión logística múltiple, únicamente cuatro de ellas mostraron valor explicativo (P<0.05), las cuales fueron: tiempo en corral de espera, eficacia del aturdimiento, espesor de grasa

778


Rev Mex Cienc Pecu 2021;12(3):773-788

subcutánea (EGS) y el diferencial de pH (ΔpH) (Cuadro 3). Ninguna de las interacciones entre estas variables o con las otras restantes mostraron valor significativo dentro del modelo (P>0.05). En la prueba de bondad de ajuste de Hosmer-Lemeshow, no se rechazó la hipótesis nula (P=0.963). En el Cuadro 4 se presentan los valores de OR, junto con su intervalo de confianza al 95%. Cuadro 1: Efecto de variables cuantitativas, intrínsecas y extrínsecas, sobre el tipo de carne de bovino Variable DFD Normal Media EE Media EE Valor P Desembarque Temperatura, °C 30.4 1.00 32.5 0.28 0.010 Índice HR– T 77.1 10.5 79.7 0.28 0.934 Transporte Densidad animal, m2/cabeza 3.1 0.29 2.6 0.09 0.061 Corral de descanso Densidad animal, m2/cabeza 9.6 1.17 11.5 0.55 0.214 Tiempo, h 15.4 0.23 14.8 0.10 0.021 Manga de conducción al cajón de matanza N° de personas en arreo 1.5 0.13 1.7 0.07 0.449 Temperatura, °C 23.6 0.80 25.4 0.24 0.009 Índice HR– T 71.2 1.12 74.1 0.33 0.002 Tiempo, min 68.2 6.47 54.4 2.18 0.023 Matanza Intervalo aturdimiento–desangrado, seg 179.8 10.04 147.7 4.49 0.008 Canal caliente Peso, kg 284.7 10.32 295.8 3.78 0.289 pH45min 7.0 0.03 6.9 0.02 0.131 Temperatura, °C 45min 33.2 0.31 33.5 0.11 0.351 Canal fría ΔpH 0.95 0.04 1.45 0.02 < 0.001 Espesor de grasa, cm 0.40 0.04 0.55 0.02 0.007 2 Densidad en el cuarto frío, m /canal 2.3 0.06 2.2 0.03 0.667 Valor P de la prueba t student.

779


Rev Mex Cienc Pecu 2021;12(3):773-788

Cuadro 2: Efecto de variables categóricas, intrínsecas y extrínsecas, sobre el tipo de carne de bovino Variable DFD Normal Frecuencia Porcentaje Frecuencia Porcentaje Valor P Animal Sexo 0.186(1) Macho 11 20.00 44 80.00 Hembra 42 12.39 297 87.61 Origen Forma de adquisición 0.895(1) Subasta 18 14.17 109 88.89 Granja 35 13.11 232 86.49 Desembarque Época 0.097(1) Primavera 6 6.32 89 93.68 Verano 15 13.51 96 86.49 Otoño 14 17.95 64 82.05 Invierno 18 16.36 92 83.64 Transporte Distancia 0.048(1) >60 min 9 25.71 26 74.29 30-60 min 6 8.45 65 91.55 <30 min 38 13.19 250 86.81 Tipo de transporte 0.191(1) <2m largo 24 13.87 149 86.13 2-4 m largo 6 25.00 18 75.00 >4m largo 23 11.68 174 88.32 Corrales de descanso Separación 0.741(2) Si 3 15.00 17 85.00 No 50 13.37 324 86.63 Lesiones visibles 0.293(2) Si 2 25.00 6 75.00 No 51 13.21 335 86.79 Manga de conducción al cajón de matanza Instrumento de arreo 0.070(1) Picana 25 15.92 132 84.08 Otro 6 6.38 88 93.62 Ninguno 22 15.38 121 84.62 Caídas 0.089(2)

780


Rev Mex Cienc Pecu 2021;12(3):773-788

Si 2 No 51 Matanza Día de la semana Lunes 30 Jueves 23 Eficacia en aturdimiento Correcto 25 Incorrecto 28

50.00 13.08

2 339

50.00 86.92 0.771(1)

14.15 12.64

182 159

85.85 87.36 < 0.001(1)

9.29 22.40

244 97

90.71 77.60

Valor P de la prueba χ2 (1) y exacta de Fisher (2).

Cuadro 3: Coeficiente, error estándar y valor de p de las variables incluidas en el modelo logístico múltiple Variable Coeficiente Error estándar Valor de P Tiempo en corral, h 0.522 0.126 <0.0001 Eficacia de aturdimiento 1.251 0.375 0.0009 Espesor de grasa subcutánea, cm -1.883 0.636 0.0031 Diferencial de pH [ΔpH] -4.554 0.695 <0.0001 Constante -5.308 Cuadro 4: Razón de probabilidad (OR) e intervalo de confianza (IC) de las variables incluidas en el modelo logístico Variable OR IC 95% Tiempo en corral, h 1.686 1.317 a 2.159 Aturdimiento incorrecto 3.492 1.674 a 7.287 Espesor de grasa subcutánea,cm 0.152 0.044 a 0.529 Diferencial de pH [ΔpH] 0.011 0.003 a 0.041 El tiempo previo al sacrificio que el ganado pasa en los corrales de espera está asociado con la presencia de carne DFD, el valor de OR indica que la posibilidad de que se presente este defecto en las canales es 1.69 veces más grande por cada hora que transcurra. Algunos autores recomiendan un tiempo de reposo de 3 h como suficiente para que el animal se recupere de los efectos negativos derivados del transporte(15,49), sin embargo, la normatividad de México y de otros países indica que el tiempo de descanso de los animales en el matadero debe ser de 12 a 24 h(50,51), considerando el valor de OR obtenido en este estudio, la aplicación del tiempo máximo de estas normas implica un incremento importante en el riesgo de presencia de carne DFD. Tiempos de espera mayores de 15.8 h y de 12.0 h en corrales de retención, evaluados en dos estudios diferentes, han resultado en valores de OR de 2.20 y 2.03 respectivamente, estimados al aplicar modelos de regresión logística para canales con pH

781


Rev Mex Cienc Pecu 2021;12(3):773-788

final ≥5.8(7,52). Los resultados de este trabajo, así como los referidos anteriormente demuestran que a mayor tiempo que el animal pasa en el corral de descanso, más elementos estresantes pueden presentarse, aumentando la posibilidad de mayor frecuencia de carne DFD. Una mala insensibilización del animal en este rastro mostró una posibilidad de 3.49 veces mayor de resultar en carne de tipo corte oscuro; por esto, en la matanza del ganado es importante determinar si el animal está insensible luego del disparo, ya que el desangrado y el procesamiento de la canal no pueden comenzar sin haberse realizado de manera correcta esta etapa(16,53). Para que la eficacia de la insensibilización en el izado sea reconocida como “aceptable”, debe presentarse un porcentaje no mayor al 0.2 % de animales con signos de sensibilidad(29). En este estudio, el porcentaje de animales con signos de sensibilidad en el izado fue de 31.7 %, lo cual indica que, además de afectar negativamente la calidad de la carne, existe un problema serio de bienestar animal; esta problemática no es exclusiva del rastro evaluado, ya que el porcentaje encontrado fue menor al 49.0 % reportado en otro rastro TIF del noroeste de México(54) y al 66.9 % de otro centro de matanza en Chile(15). En relación al número de disparos se observaron los siguientes porcentajes: 1 (88.1 %), 2 (9.6 %) y 3 o más (2.3 %). Se considera como “aceptable” cuando el porcentaje de animales aturdidos instantáneamente con un solo disparo es del 95 % o más, y como “problema grave” cuando no alcanza el 90 %(29); en este centro de matanza no se llegó a esta última cifra, evidenciando la problemática de bienestar animal en esta etapa. Las causas más frecuentes de la baja eficacia en la insensibilización mediante el disparo con perno retráctil, son el mantenimiento inadecuado de la pistola o la fatiga que el operario experimenta debido a una alta velocidad del flujo de animales en el cajón de aturdimiento(55). Aunque existen estudios que han examinado el impacto de un mal insensibilizado sobre la presencia de carne DFD(28), la mayoría de las investigaciones sobre el insensibilizado en bovinos han puesto mayor atención en las reacciones conductuales y fisiológicas relativas al bienestar animal(29,56). Sin embargo, debe evaluarse de manera más exhaustiva la eficiencia del aturdimiento sobre la calidad de la canal(57), ya que el insensibilizado es parte muy importante del proceso de matanza y, por lo tanto, puede afectar la calidad del producto final(58). El EGS presentó una relación inversamente proporcional sobre la presencia de carne DFD. El valor de OR de 0.15 indica que es un factor protector. Su inverso indica que por cada cm de aumento en EGS, existe una posibilidad de 6.67 veces mayor de resultar carne normal. Este resultado fue similar al obtenido en otra investigación que aplicó el sistema de clasificación de grado de engrasamiento de canal SEUROP, donde se observó un OR de 0.18 para canales con buen grado de engrasamiento(7). Se estima que canales con un EGS menor a 0.76 cm tienen una mayor probabilidad de presentar carne DFD(4). Canales con mayor engrasamiento mantienen una temperatura similar al animal vivo por más tiempo cuando son introducidas al cuarto frio(23), acelerando el metabolismo muscular y presentando una mayor caída de pH en el proceso de instauración del rigor mortis(30). 782


Rev Mex Cienc Pecu 2021;12(3):773-788

La velocidad de disminución del pH en el músculo post-rigor tiene influencia directa sobre el pHu y el color de las canales. La relación observada entre el ΔpH y la presencia de carne DFD resultó inversamente proporcional, con un valor de 0.011 para el OR. Su inverso indica que, por cada incremento en una unidad, la posibilidad de que se presente carne normal será 90.9 veces más grande. Existe una relación directa entre la velocidad de descenso del pH y la temperatura de la canal(32,59). Canales con temperaturas más altas en el período pre-rigor generan valores de ΔpH más altos, por lo tanto, con menor posibilidad de resultar en corte oscuro(30).

Conclusiones e implicaciones El porcentaje en la presencia de carne DFD obtenido en este estudio fue de 13.45 %. De las 27 variables evaluadas, 10 de ellas, intrínsecas y extrínsecas, revelaron asociación estadística con la presencia de carne DFD, sin embargo, solo cuatro de estas diez mostraron valor explicativo para cuantificar el riesgo a corte oscuro dentro del modelo matemático utilizado; estas fueron: tiempo en corral de espera, eficacia del insensibilizado (donde se observaron problemas de bienestar animal), ΔpH y EGS. Las tres primeras están presentes en todo el proceso de matanza; desde el manejo que se da a los animales antes y durante la muerte, así como en el metabolismo post mortem, la última es propia del animal. Por lo anterior, es necesaria una evaluación multicausal en todo el proceso de matanza para prevenir de manera adecuada este problema. En general, este estudio presenta datos concretos sobre qué factores realmente favorecen la presencia de carne DFD, con un interés directo para la planta de sacrificio en sí y para aquellas que trabajan en condiciones similares (TIF), pero también para fines científicos. Literatura citada: 1.

Alende M, Volpi-Lagreca G, Pordomingo AJ, Pighín D, Grigioni G, Carduza F, et al. Efectos del tiempo de transporte, espera pre-faena y maduración en novillos sobre indicadores de estrés, calidad instrumental y sensorial de la carne. Arch Med Vet 2014;(46):217-227.

2.

Adzitey F, Nurul H. Pale soft exudative (PSE) and dark firm dry (DFD) meats: causes and measures to reduce these incidences - a mini review. Int Food Res J 2011;(18):1120.

3.

Lawrie RA, Ledward DA. Lawrie’s meat science. 7th ed. Abington Hall, England. Published by Woodhead Publishing Limited; 2006.

783


Rev Mex Cienc Pecu 2021;12(3):773-788

4.

Page JK, Wulf DM, Schwotzer TR. A survey of beef muscle color and pH. J Anim Sci 2001;79(3):678-687.

5.

Hughes J, Clarke F, Purslow P, Warnerd R. High pH in beef Longissimus thoracis reduces muscle fibre transverse shrinkage and light scattering which contributes to the dark colour. Food Res Int 2017;(101):228-238.

6.

Sawyer J, Apple J, Johnson Z, Baublits R, Yancey J. Fresh and cooked color of dark cutting beef can be altered by post-rigor enhancement with lactic acid. Meat Sci 2009;83(2):263-270.

7.

Mach N, Bach A, Velarde A, Devant M. Association between animal, transportation, slaughterhouse practices, and meat pH in beef. Meat Sci 2008;(78):232–238.

8.

Viljoen HF, de Kock HL, Webb EC. Consumer acceptability of dark, firm and dry (DFD) and normal pH beef steaks. Meat Sci 2001;(61):181–185.

9.

Leyva-García IA, Figueroa-Saavedra F, Sánchez-López E, Pérez-Linares C, BarrerasSerrano A. Economic impact of DFD beef in a Federal Inspection Type (TIF) slaughterhouse. Arch Med Vet 2012;(44):39-42.

10. Miller M. Dark firm and dry beef. Beef facts product enhancement. Texas Tech University. 2007 https://fyi.extension.wisc.edu/wbic/files/2011/04/Dark-Firm-andDry-Beef.pdf. Accessed Aug 20, 2019. 11. Apple JK, Kegley EB, Galloway DL, Wistuba TJ, Rakes LK. Duration of restraint and isolation stress as a model to study the dark-cutting condition in cattle. J Anim Sci 2005;(83):1202-1214. 12. Zhang SX, Farouk MM, Young OA, Wieliezko KJ, Podmore C. Functional stability of frozen normal and high pH beef. Meat Sci 2005;(69):765–772. 13. Huff-Lonergan E, Lonergan SM. Mechanisms of water-holding capacity of meat: The role of postmortem biochemical and structural changes. Meat Sci 2005;(71):194–204, 14. Ferguson DM, Warner RD. Have we underestimated the impact of pre-slaughter stress on meat quality in ruminants? Meat Sci 2008;(80):12–19. 15. Gallo C, Teuber M, Cartes M, Uribe H, Grandin T. Improvements in stunning of cattle with a pneumatic stunner after changes in equipment and employee training. Arch Med Vet 2003;(35):159-170. 16. Chambers PG, Grandin T. Guidelines for humane handling, transport and slaughter of livestock. FAO-HIS. 2001.

784


Rev Mex Cienc Pecu 2021;12(3):773-788

17. Mota D, Huertas SM, Alarcón AD, Pérez C, Guerrero I, Carrasco A, et al. Músculo oscuro, firme y seco: mecanismos involucrados. En: Mota D, et al, editores. Bienestar animal. Una visión global en Iberoamérica. 3a ed. Barcelona, España: Elsevier; 2016: 447-493. 18. Curley KO, Paschal JC, Welsh TH, Randel RD. Technical note: Exit velocity as a measure of cattle temperament is repeatable and associated with serum concentration of cortisol in Brahman bulls. J Anim Sci 2006;(84):3100-3103. 19. King DA, Schuehle CE, Randel RD, Welsh TH, Oliphint RA, Baird BE, et al. Influence of animal temperament and stress responsiveness on the carcass quality and beef tenderness of feedlot cattle. Meat Sci 2006;74(3):546-556. 20. Panea B, Ripoll G, Olleta JL, Sañudo C. Efecto del sexo y del cruzamiento sobre la calidad instrumental y sensorial y sobre la aceptación de la carne de añojos de la raza Avileña-negra ibérica. ITEA. 2011:107(3):239-250 21. Mahmood S, Basarab JA, Dixon WT, Bruce HL. Can potential for dark cutting be predicted by phenotype? Relationship between sex, carcass characteristics and the incidence of dark cutting beef. Can J Anim Sci 2016;(96):19-31. 22. McGilchrist P, Alston CL, Gardner GE, Thomson KL, Pethick DW. Beef carcasses with larger eye muscle areas, lower ossification scores and improved nutrition have a lower incidence of dark cutting. Meat Sci 2012;(92):474–480. 23. Sañudo C, Monsón F, Campo MM, Beltrán JA, Bello JM. Variación del pH en canales comerciales de cordero. En: Casasús-Pueyo I editor. XXXVII Jornadas de estudio y XI Jornadas sobre producción animal. Zaragoza, España 2005:703-705. 24. Hopkins DL, Stanley DF, Martin LC, Toohey ES, Gilmour AR. Genotype and age effects on sheep meat production. 3. Meat quality. Aus J Exp Agric 2007;47(10):11551164. 25. Vestergaard M, Oksbjerg N, Henckel P. Influence of feeding intensity, grazing and finishing feeding on muscle fibre characteristics and meat colour of semitendinosus, Longissimus dorsi and supraspinatus muscles of young bulls. Meat Sci 2000;54(2):177185. 26. Kadim IT, Mahgoub O, Al-Ajmi DS, Al-Maqbaly, RS, Al-Mugheiry SM, Bartolome DY. The influence of season on quality characteristics of hot-boned beef Longissimus thoracis. Meat Sci 2004;66(4):831-836. 27. Gregory NG. How climatic changes could affect meat quality. Food Research Int 2010;43(7):1866-1873.

785


Rev Mex Cienc Pecu 2021;12(3):773-788

28. Chulayo AY, Bradley G, Muchenje V. Effects of transport distance, lairage time and stunning efficiency on cortisol, glucose, HSPA1A and how they relate with meat quality in cattle. Meat Sci 2016;(117):89-96. 29. Grandin T. Return sensibility problems after penetrating captive bolt stunning of cattle in commercial beef slaughter plants. J Am Vet Med Assoc 2002;(221):1258-1261. 30. Cadavez VAP, Xavier C, Gonzales-Barrona U. Classification of beef carcasses from Portugal using animal characteristics and pH/temperature decline descriptors. Meat Sci 2019;(153):94-102. 31. Jacob RH, Surridge VSM, Beatty DT, Gardner GE, Warner RD. Grain feeding increases core body temperature of beef cattle. Animal Prod Sci 2014;(54):444–449. 32. Warner RD, Thompson JM, Polkinghorne R, Gutzke D, Kearney GA. A consumer sensory study of the influence of rigor temperature on eating quality and ageing potential of beef striploin and rump. Animal Prod Sci 2014;(54):396–406. 33. Hargreaves A, Barrales L, Peña I, Larraín R, Zamorano L. Factores que influyen en el pH último e incidencia de corte oscuro en canales de bovinos. Cien Inv Agr 2004;31(3):155-166. 34. Lonergan HE, Zhang W, Lonergan SM. Biochemistry of postmortem muscle - lessons on mechanisms of meat tenderization. Meat Sci 2010;86(1):184-195. 35. Daniel WW, Cross CL. Biostatistics: A foundation for analysis in the health sciences. Tenth edition. New York, NY, USA; 2013. 36. Hahn GL. Dynamic responses of cattle to thermal heat loads. J Anim Sci 1999;77(2):10–20. 37. FAO. Manual de buenas prácticas para la industria de la carne. Organización de las Naciones Unidas para la Agricultura y la Alimentación. Roma, Italia; 2007. 38. HSA. Aturdimiento de animales por perno cautivo. Humane Slaughter Association. Wheat hampstead, Herts. AL4 8AN, UK; 2016. 39. Konica-Minolta. Precise color communication. Konica Minolta Sensing Inc. Japan. 2007.https://www.konicaminolta.com/instruments/knowledge/color/pdf/color_comm unication.pdf. Accessed 21 Aug, 2019. 40. Pérez-Linares C, Barreras A, Sánchez E, Herrera B, Figueroa-Saavedra F. The effect of changing the pre-slaughter handling on bovine cattle DFD meat. Rev MVZ Córdoba. 2015;20(3):4688-4697.

786


Rev Mex Cienc Pecu 2021;12(3):773-788

41. Lattin J, Green PE, Carroll D. Analyzing multivariate data. Pacific Grove, CA, USA. Brooks/Cole Editor; 2003. 42. Hosmer DW, Lemeshow S. Applied logistic regression. 2nd ed. New York, NY, USA. Wiley-Interscience publication; 2000. 43. SAS Inc. Base SAS® 9.4 Procedures Guide: Statistical procedures. 2nd ed. SAS Institute Inc. Cary, NC, USA: 2013. 44. Sánchez E, Navarro C, Sayas ME, Sendra E, Fernández J, Pérez JA. Análisis de diferentes factores que afectan la calidad de la carne: factores intrínsecos y ante mortem. En: Mota D, et al, editores. Bienestar animal. Una visión global en Iberoamérica. 3a ed. Barcelona, España: Elsevier; 2016: 495-510. 45. Garcia LG, Nicholson KL, Hoffman TW, Lawrence TE, Hale DS, Griffin DB, et al. National Beef Quality Audit-2005: Survey of targeted cattle and carcass characteristics related to quality, quantity, and value of fed steers and heifers. J Anim Sci 2008;(86):3533- 3543. 46. Moore MC, Gray GD, Hale DS, Kerth CR, Griffin DB, Savell JW, et al. National beef quality audit–2011: In-plant survey of targeted carcass characteristics related to quality, quantity, value, and marketing of fed steers and heifers. J Anim Sci 2012;90(13):51435151. 47. Donkersgoed JV, Jewison G, Bygrove S, Gillis K, Malchow D, McLeod G. Canadian beef quality audit 1998-99. Can Vet J 2001;(42):121-126. 48. Beef Cattle Research Council. National beef quality audit 2010/11 plant carcass audit. Canadian Cattlemen’s Association; 2013. 49. Tadich N, Gallo C. Echeverría R, Van Schaik G. Efecto del ayuno durante dos tiempos de confinamiento y de transporte terrestre sobre algunas variables sanguíneas indicadoras de estrés en novillos. Arch Med Vet 2003;35(2):171-185. 50. NOM-033-SAG/ZOO-2014. Norma Oficial Mexicana NOM-033-SAG/ZOO-2014, Métodos para dar muerte a los animales domésticos y silvestres. Diario Oficial de la Federación; 2015. 51. MINAGRI, Reglamento sobre estructura y funcionamiento de mataderos, establecimientos frigoríficos, cámaras frigoríficas y plantas de desposte y fija equipamiento mínimo para tales establecimientos. Diario Oficial. Ministerio de Agricultura de Chile; 2009.

787


Rev Mex Cienc Pecu 2021;12(3):773-788

52. Amtmann VA, Gallo C, Van-Schaik G, Tadich N. Relaciones entre el manejo antemortem, variables sanguíneas indicadoras de estrés y pH de la canal en novillos. Arch Med Vet 2006;38(3):259-264. 53. Grandin T. Recommended animal handling guidelines & audit guide: a systematic approach to animal welfare. American Meat Institute Foundation; 2013. 54. Miranda-de-la-Lama GC, Leyva-García IG, Barreras-Serrano A, Pérez-Linares C, Sánchez-López E, Figueroa-Saavedra F, et al. Assessment of cattle welfare at a commercial slaughter plant in the northwest of Mexico. Trop Anim Health Prod 2012;(44):497–504. 55. Méndez-Medina RD, de Aluja AS, Rubio-Lozano MS, Braña-Varela D. Bienestar animal para operarios en rastros de bovinos. 1ª ed. DF, México. SAGARPACONACYT-COFUPRO; 2013. 56. Muñoz D, Strappini A, Gallo C. Animal welfare indicators to detect problems in the cattle stunning box. Arch Med Vet 2012;(44):297-302. 57. Velarde A, Gispert M, Diestre A, Manteca X. Effect of electrical stunning on meat and carcass quality in lambs. Meat Sci 2003;63(1):35-38. 58. Ríos-Rincón FG, Acosta-Sánchez DC. Sacrificio humanitario de ganado bovino e inocuidad de la carne. Nacameh 2008;2(2):106-123. 59. Warris PD. Ciencia de la carne. 1a ed. Zaragoza, España: Editorial Acribia; 2003.

788


https://doi.org/10.22319/rmcp.v12i3.5577 Artículo

Producción de metano in vitro y parámetros fermentativos de mezclas de ensilado de girasol silvestre y pasto elefante, inoculadas o no con cepas de bacterias ácido-lácticas epífitas

Vilma Amparo-Holguín a,b Mario Cuchillo-Hilario c,d* Johanna Mazabel e Steven Quintero e Siriwan Martens e Jairo Mora-Delgado b

a

National University of Colombia (UNAL). Palmira, Colombia.

b

University of Tolima. Livestock Agroforestry System Research Group. Ibagué, Colombia.

c

Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán. INCMNSZ. Departamento de Nutrición Animal Fernando Pérez-Gil Romo. Ciudad de México, México. d

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores de Cuautitlán. Estado de México, México. e

The Alliance of Bioversity International and CIAT. Cali, Colombia.

*Autor de correspondencia: mario.cuchilloh@incmnsz.mx

Resumen: La presente investigación se llevó a cabo para determinar el grado de incorporación de Tithonia diversifolia (TD) y la posibilidad de mezclarla con Pennisetum purpureum (PP) para obtener el máximo beneficio para la ensilabilidad y para la nutrición animal. Las mezclas de ensilado de girasol silvestre (TD) y pasto elefante (PP) se evaluaron en función de la 789


Rev Mex Cienc Pecu 2021;12(3):789-810

composición química, la cuantificación de la producción de gas, la liberación de metano y los parámetros de fermentación. Las mezclas de ensilado se organizaron en cuatro proporciones de T. diversifolia / P. purpureum, a saber: 100/0; 67/33; 33/67; y 0/100 (peso fresco). Los ensilados con mayores proporciones de T. diversifolia aumentaron el contenido de proteína cruda, la digestibilidad in vitro al tiempo que disminuyeron las fracciones de FDN y FDA (P<0.05). Las altas cantidades de T. diversifolia mostraron los valores de producción de gas más bajos (160.2 ml), mientras que los tratamientos con mayor incorporación de pasto produjeron una mayor cantidad de gas, hasta 194.5 ml. La producción de metano fue mayor al aumentar la proporción de P. purpureum en las mezclas de ensilado. El inóculo del ensilado no tuvo ningún impacto en la producción de gas in vitro (P<0.05). Además, las proporciones más altas de T. diversifolia redujeron el proceso de acidificación, mientras que la inclusión de P. purpureum facilitó valores de pH más bajos. El inóculo de bacterias ácido-lácticas tendió a disminuir el pH de los ensilados, pero no se observaron efectos claros sobre la temperatura del ensilado. Los ensilados con proporciones altas de T. diversifolia (67 % de incorporación) serían más apetecibles para los animales y también podrían traducirse en un mayor rendimiento animal debido a un mayor suministro de proteínas y una mejor digestibilidad que los ensilados con mayor proporción de P. purpureum (67 y 100 % de incorporación). Palabras clave: Producción de gas, Inóculo, Fermentación Ruminal, Girasol mexicano, Forraje tropical.

Recibido: 11/12/2019 Aceptado: 02/11/2020

Introducción La creciente competencia actual entre la producción de alimentos humanos y los recursos de alimentos para animales exige nuevas alternativas de alimentos para animales que no comprometan el suministro de alimentos para humanos. Existe un interés especial en la investigación sobre especies forrajeras no convencionales que se pueden ofrecer como heno o ensilado durante todo el año, particularmente en momentos de escasez de alimento como en caso de sequía o inundaciones(1,2,3). Tithonia diversifolia (TD) es una especie no leguminosa que se distribuye ampliamente en zonas húmedas y subhúmedas de América, África, Asia y en regiones cercanas a los cinturones tropicales y subtropicales(4,5). Se ha descrito como un arbusto polivalente con un considerable potencial para la producción animal debido a su valiosa fuente de proteínas y alta palatabilidad(6,7). Asimismo, los forrajes tropicales de baja calidad constituyen algunos de los principales factores que limitan el

790


Rev Mex Cienc Pecu 2021;12(3):789-810

desarrollo de los sistemas de producción ganadera debido al bajo rendimiento animal. Esta es la razón por la cual el forraje excesivo de alta calidad producido durante la temporada de lluvias debe conservarse como ensilado(2,8). Teniendo en cuenta que la TD muestra una alta distribución natural en países tropicales, esta planta subutilizada puede contribuir a la producción ganadera si su follaje se conserva como ensilado(5,9,10). Entre los forrajes tropicales, algunas legumbres y herbáceas no leguminosas como la TD muestran mejores valores nutricionales que las gramíneas, por lo que incluir TD en las dietas animales favorece el contenido de proteína cruda, reduce los valores de fibra y mejora la digestibilidad de los alimentos(7). A pesar de que el alto contenido de proteínas de TD oscila entre el 10.3 y el 25.6 %(4,5), solo se han realizado unos pocos estudios de producción de ensilado para investigar el potencial de ensilabilidad de TD. Por lo tanto, es necesario determinar el grado de incorporación de TD y la posibilidad de mezclarlo con pasto para obtener el máximo beneficio para la nutrición animal y para los hogares de los agricultores. El procedimiento apropiado de ensilado significa que la fermentación del ácido láctico se produce en ausencia de oxígeno. Una acidificación rápida normalmente ocurre cuando una cantidad suficiente de ácido láctico es producida por bacterias ácido-lácticas (BAL) presentes en las superficies de la planta(9,11). En este sentido, es importante mejorar la acidificación láctica para lograr un proceso de fermentación exitoso. Este efecto puede facilitarse inoculando BAL(12,13). Las bacterias ácido-lácticas homofermentativas seleccionadas se han desarrollado tradicionalmente en países templados para favorecer la acidificación láctica y disminuir el pH de los ensilados(8,9,11). Sin embargo, la mayoría de las cepas disponibles comercialmente a la fecha tienen un rendimiento deficiente cuando se inoculan en ensilados tropicales(12). Por lo tanto, las bacterias epífitas seleccionadas parecen ser una buena alternativa para mejorar los parámetros fermentativos de los forrajes tropicales durante el proceso de ensilado. Los trabajos de investigación han estudiado cepas BAL epífitas aisladas de especies de forraje tropical como candidatas prometedoras que podrían usarse como aditivos de ensilado para superar las limitaciones de los inoculantes comerciales y minimizar las pérdidas de valor nutricional del ensilado(11,12,14). Sin embargo, los estudios de emisiones de metano que tratan de los ensilados y aditivos de BAL también son escasos(15). Por otro lado, uno de los métodos comúnmente aceptados para determinar la calidad de la alimentación animal es la técnica de producción de gas. La metodología de producción de gas in vitro determina el grado y la cinética de la degradación del alimento en función del volumen de gas liberado, tanto directamente como producto de fermentación, como indirectamente de la neutralización del fluido ruminal(16,17,18). En este sentido, se ha establecido que la producción entérica acumulada de CH4 en rumiantes aumenta con el tiempo de fermentación, pero también disminuye la eficiencia de utilización de la energía y contribuye al efecto global de los gases de efecto invernadero(19,20). El metano es producido en condiciones anaeróbicas por microorganismos ruminales llamados arqueas 791


Rev Mex Cienc Pecu 2021;12(3):789-810

metanogénicas, que ganan energía al reducir el CO2 con H2 para formar CH4(19,21). La producción de metano depende principalmente de la cantidad y calidad de los forrajes consumidos por los animales(22,23,24). Así, la mitigación de la producción de metano de los rumiantes podría lograrse modificando su dieta(21,25). Estudios previos han sugerido que el aumento de la calidad del forraje disminuye la proporción de CH4 en el gas emitido, lo que significa una reducción de las emisiones por unidad de aumento de peso o por unidad de producto animal producido como leche o carne debido a la mejora de la productividad animal(22,26,27). Por lo tanto, el objetivo de este estudio fue evaluar el efecto de cuatro niveles diferentes de incorporación de T. diversifolia (100, 67, 33 y cero %) en mezcla con P. purpureum, así como el enriquecimiento o no con una cepa de BAL epífita o comercial. Se evaluó la calidad nutricional (MS, PC, FDN, FDA, DMSIV y cenizas), la liberación de metano y la ensilabilidad de los parámetros de los ensilados.

Material y métodos Material vegetal Se cosecharon muestras de forraje TD (biomasa de 40 cm sobre el suelo, incluidas hojas y tallos) en la etapa de prefloración en febrero de 2014 y a los 60 d de edad. La materia seca de TD en la cosecha fue del 17.6 %. Los cultivares se ubicaron en la finca experimental de la Universidad Nacional de Colombia en Palmira, a 1,000 msnm, 24 °C, precipitación anual de 1,020 mm, y humedad relativa de 72 %. Complementariamente, P. purpureum (PP) se cosechó en etapa vegetativa, 10 cm sobre el nivel del suelo y 75 d de edad, al mismo tiempo y lugar. La materia seca de PP a esa edad promedió 18.7 %. La biomasa vegetal de TD y PP se recolectó a mano y se trasladó al laboratorio para elaborar cuarenta y ocho mezclas de microsilos de un kilogramo cada una. Después de eso, las muestras de vegetación se cortaron mecánicamente en secciones de un tamaño de partícula que oscilaba entre dos y tres cm utilizando un picador de hierba eléctrico (7.5 hp, 1400 rpm; Gaitan).

Preparación del ensilado El material forrajero de TD y PP se marchitó al 30 % y al 35 % de materia seca antes del ensilado. Las diferentes mezclas de ensilado se hicieron de la siguiente manera: TD y PP se organizaron en cuatro proporciones diferentes. Proporción 1: 100/0; Proporción 2: 67/33; Proporción 3: 33/67; y Proporción 4: 0/100, base MF. Posteriormente, cada proporción fue inoculada o no: 1) muestra de testigo (sin inóculo); 2) cepa T735 de bacterias acido-lácticas (BAL) epífitas; y 3) SIL-ALL®4x4, resultando en 12 tratamientos en total. La T-735 es una cepa de BAL epífita (Lactobacilus paracasei) aislada de la superficie del tejido de TD y ha sido probada en estudios previos como inoculante de ensilado(9,10). SIL-ALL®4x4 es una mezcla comercial de inóculo de Streptococcus faecium; L. plantarum; Pediococcus

792


Rev Mex Cienc Pecu 2021;12(3):789-810

acidilactici y L. salivarius. El inóculo bacteriano se diluyó para aplicar 1 ml por kg de forraje fresco. Cada inoculante se cultivó previamente de la siguiente manera: 0.1 ml de un inóculo 4x109 UFC ml-1 cultivado en caldo MRS de 10 ml a 37 °C durante 24 h. Las mezclas de forraje de 1,000 g cada una se envasaron en bolsas de plástico envasadas al vacío (18.5 cm × 29 cm; bolsas selladoras al vacío de microcanales Quart, modelo No. 30-0101-W, 0.9 L, China), según las pautas de Rostock Model Silages(28,29), las mezclas de forraje TD y PP se comprimieron a mano. Más tarde, se evacuó el aire de los microsilos y fueron termosellados para asegurar la hermeticidad. Se utilizó un sellador al vacío (acero inoxidable Westonbrand PRO 2300, Vista, CA, EE. UU.) para proporcionar las condiciones anaeróbicas para facilitar la fermentación láctica y la acidificación del ensilado. Los microsilos se envolvieron con cinta adhesiva para evitar deformaciones de los microsilos debido a la hinchazón. Posteriormente, se perforaron las bolsas de polietileno con aguja de inyección desinfectada. Cada bolsa envuelta se colocó inmediatamente en una segunda bolsa (26 cm × 39 cm; bolsas selladoras al vacío de microcanal, modelo No. 30-0102-W, China) a la que se le evacuó el aire en las mismas condiciones. Dos réplicas adicionales de las muestras (~ 250 g) se llenaron en bolsas más pequeñas para abrirlas después de tres días de ensilado a una temperatura de almacenamiento de 25 ° C para la determinación de MS. Más tarde, los microsilos se almacenaron en la oscuridad durante 90 días a temperatura ambiente de aproximadamente 25 °C. A los 90 días se abrieron las bolsas y se midió el pH y la temperatura. El pH se midió utilizando un medidor de pH (Mettler Toledo, o SevenGo, con electrodo de pH InLab@ 41356/2mat), desinfectando el electrodo con etanol al 70 % antes de cada registro. La temperatura se midió utilizando un termómetro digital de mínimo y máximo para interior y exterior. Se introdujo un sensor en el material del ensilado, mientras que un segundo se utilizó para registrar la temperatura ambiente simultáneamente. Además, las muestras se liofilizaron y se molieron en un rotor de molino de laboratorio Thomas Wiley modelo 4 provisto de una malla de 1.0 mm para realizar el gas de prueba. Así, se analizaron 12 tratamientos en total, con cuatro réplicas, resultando en 48 microsilos como un agujero.

Valor nutricional Se analizó un conjunto de muestras de ensilado en el Laboratorio de Calidad de Forrajes del CIAT. El contenido de materia seca (MS) se determinó utilizando un horno de aire forzado a 65 °C hasta un peso constante durante 72 h. También se realizaron las siguientes determinaciones: i) proteína cruda (PC) por el método Micro-Kjeldahl; ii) fibra insoluble en detergente neutro y ácido (FDN y FDA) siguiendo la secuencia descrita por Van Soest et al(30); iii) y extracto etéreo (EE) por extracción soxhlet descrita por Palmquist y Jenkins (31). La metodología de Tilley y Terry(18) modificada por Moore(32) se utilizó para determinar la digestibilidad. El contenido de cenizas se determinó mediante incineración directa del material seco en un horno de mufla a 500 °C según el método oficial de la AOAC (33). El

793


Rev Mex Cienc Pecu 2021;12(3):789-810

análisis se realizó en los 12 tratamientos (con las cuatro repeticiones correspondientes) por triplicado.

Producción de gas in vitro El forraje fresco se sometió a un proceso de secado en un horno convencional a una temperatura de 65 °C durante 72 h. Luego se procesó en un molino de laboratorio Thomas Wiley modelo 4 con un tamiz de malla de 1.0 mm. El fluido ruminal se obtuvo de dos toros Brahman jóvenes canulados pastando Cynodon plestotachyus (pasto estrella) y sal mineralizada suplementada ad libitum. Los toros canulados no tuvieron acceso a alimentos durante una hora antes de comenzar la recolección de líquido ruminal. La recolección de muestras ruminales se realizó a mano. Luego, se exprimió a través de un trozo de gasa para extraer los contenidos sólidos del rumen, se almacenó en termo de 2.0 L, y se conservó en agua caliente a 39 °C durante aproximadamente 10 min, para ser enviado al laboratorio. Luego, el líquido ruminal se licuó durante 20 seg y se volvió a filtrar antes de ser transferido a los matraces de Erlenmeyer. El licor ruminal se saturó entonces con CO2. Siguiendo a Theodorou et al(17), se preparó un medio de digestión con algunas modificaciones. La incubación se realizó en matraces con una capacidad de 160 ml cada uno. Para ello, se pesó un gramo de muestra seca y molida, y se añadieron 85 ml del medio de digestión gaseado con CO2. Posteriormente, se añadieron cuatro ml de agente reductor (preparado en el momento de su uso, mezclando cisteína-HCl (625 mg), 1M NaOH (4 ml) y Na2S • 9H2O (625 mg) en 100 ml de agua destilada); las tapas de goma se colocaron y se aseguraron con sellos metálicos. Por último, las botellas se enfriaron en el refrigerador a 4 °C durante 24 h. Una vez transcurrido este período, las botellas se retiraron del refrigerador y se colocaron en un baño de agua a 39 °C. Cuando el sistema de incubación estaba en equilibrio de temperatura, la inoculación en cada botella se realizó utilizando 10 ml de licor ruminal. Junto con las muestras, se inocularon seis botellas que contenían solo el “medio de digestión”. Estos se consideraron “blancos”, los cuales fueron utilizados para corregir la producción de gas causada por la fermentación del inóculo y el medio. Para ello, se utilizó un transductor de presión (Sper Scientific®, EE. UU.) conectado a un lector digital y una válvula de tres vías. La primera vía se conectó a una aguja 22G (25 mm x 0.7 mm); la segunda al transductor y la tercera a una jeringa de 60 ml. Esto último hizo posible medir el volumen. Antes de comenzar el proceso de incubación y fermentación, todas las botellas se restablecieron a cero psi, eliminando cualquier volumen producido en la sección superior de cada botella. Las mediciones de volumen y presión se realizaron a las 3, 6, 9, 12, 24, 33, 48, 60, 72, 96, 120 y 144 h. Después de cada lectura, las botellas se agitaron e incubaron de nuevo en un baño de agua a 39 °C. Al finalizar el periodo de incubación, el contenido de cada matraz se filtró (papel de filtro; tamaño de poro de 5 μm) utilizando una bomba de vacío

794


Rev Mex Cienc Pecu 2021;12(3):789-810

y se secó en un horno a 104 °C durante la noche. La materia seca degradada se calculó como la diferencia entre el peso de la muestra al comienzo de la incubación y el peso del residuo en el crisol al final de la incubación. Las muestras se realizaron en cuadruplicado.

Liberación de metano La concentración de CH4 en el gas producido se determinó en el Laboratorio de Gases de Efecto Invernadero del Centro Internacional de Agricultura Tropical (CIAT) utilizando un cromatógrafo de gases Shimadzu GC-2014 (Shimadzu®, Japón) con un detector de ionización de llama (DIL) a una temperatura de 250 °C y un detector de captura de electrones a 325 °C bajo las siguientes condiciones: horno a 80 °C y columnas Shimadzu 4mH-D 80/100.07m SQ y 1.5 P-N. El inyector directo funcionaba a temperatura ambiente. El gas portador fue nitrógeno y la tasa de flujo de la columna fue de 30.83 ml/min. El volumen de inyección fue manejado por un bucle con una capacidad de 2 ml. Las muestras se realizaron en cuadruplicado.

Modelo de regresión Se probaron diferentes modelos no lineales y el modelo de Gomperztz fue el que presentó la mejor bondad de ajuste determinada por las estadísticas del criterio de información bayesiana (BIC) y el criterio de información de Akaike (AIC). Así, se utilizó una ecuación de Gompertz(34,35,36) para modelar la acumulación de gas de las diferentes mezclas utilizadas en los ensilados, donde los parámetros α, β y γ se estimaron mediante análisis de regresión no lineal utilizando el software Infostat. Se empleó la siguiente ecuación (Eq. 1): Y = α*exp(β*exp(-β*γ)); Donde: Y es igual a la producción acumulada de gas en el momento x, α> 0 es la producción máxima de gas; el parámetro β> 0 es la diferencia entre el gas inicial y el gas en el momento x, y el parámetro γ> 0 describe la tasa especifica de acumulación de gas. La aplicación práctica de este modelo requiere traducir los parámetros α, β, γ a su relevancia biológica. Para los fines de este estudio, los parámetros son: tiempo hasta el punto de inflexión (HPI, horas), punto de inflexión del gas (PIG ml), tasa máxima de producción de gas (TMPG, ml/h) y fase de latencia (FL o acomodación microbiana h). Para estimar los parámetros biológicos, se utilizaron las siguientes fórmulas, Eq. 2: HPI = α/γ; Eq. 3: PIG = α/e; Eq. 4: TMPG = (α*γ)/e; y Eq. 5: FL = ((β/γ) - (1/γ)); donde e es el número de Euler, que es aproximadamente 2.718281828459.

Análisis estadístico Los valores de producción de gas fueron analizados con el programa InfoStat, utilizando la subrutina “Estimación de Modelos Lineales Generales y Mixtos”, asumiendo varianzas heterogéneas(37). Para el modelo general aplicado a los factores estudiados, la proporción de

795


Rev Mex Cienc Pecu 2021;12(3):789-810

T. diversifolia / P. purpureum - (TD/PP) en la dieta y el inóculo fueron las variables predictoras (factores). Se utilizó un diseño experimental de dos factores, donde el primer factor fue el nivel de incorporación de TD en los ensilados, y el segundo el tipo de inoculante utilizado: Yij = μ + PTDi + Ij + PTDij x I + ε ; donde Y= es la variable objetivo; μ es la media general; PTD= proporción de TD en el ensilado (100, 67, 33 y cero %); I= inoculante (control; T735; SIL-ALL®4x4) y ε= el error experimental aleatorio. En el presente experimento, se evaluaron doce tratamientos en total. Para realizar el análisis estadístico, el valor n empleado fue de 156, mientras que se utilizaron doce iteraciones. A su vez, se realizaron diferentes análisis de la varianza correspondiente a cada hora de muestreo para mostrar las diferencias estadísticas entre tratamientos, y se detectaron diferencias estadísticas mediante comparaciones de medias de Duncan (α<0.05).

Resultados Los resultados mostraron que a medida que aumentaba el nivel de inclusión de PP en las mezclas de ensilado, se obtenían niveles más bajos de proteína (P<0.05) (Cuadro 1). Este efecto fue opuesto para TD; es decir, una mayor inclusión de TD produjo mayores contenidos de PC en las mezclas de ensilado. En el 100 y 67 % de inclusión de T. diversifolia, la PC fue superior en los ensilados sin inóculo (18.1 y 15.1 %) que en ambos ensilados inoculados. Sin embargo, no se observaron efectos del inóculo sobre los ensilados con mayor inclusión de PP. Los valores de PC en promedio para 100, 67, 33 y cero % de inclusión de TD fueron 16.9, 13.4, 8.7 y 5.2 %, respectivamente. Mostrando una tendencia negativa a medida que la inclusión de TD disminuía. En contraste, las fibras (FDN y FDA) tienen una respuesta opuesta. Cuando TD se ensiló solo; los valores fueron más bajos: 36.1 y 25.2 % para FDN y FDA, respectivamente. Sin embargo, cuando la TD se ensiló en 67 % (41.9 y 29.0), en 33 % (44.7 y 33.9) y en cero % (58.0 y 38.5) de inclusión, los valores tanto de FDN como de FDA aumentaron. Además, los datos muestran que la inclusión de TD mejora significativamente el DMSIV en comparación con el ensilado con PP al 100 %; por ejemplo, la TD ensilada sola (67.2 %) fue más digerible que la PP ensilada sola (63.6 %). Las tasas más altas de gas fraccionado (ml/h) de las mezclas ensiladas ocurrieron entre 9 h y 12 h. La mayor parte del gas fue producido por la mezcla ensilada 67:33 TD/PP a las 12 h (Figura 1A). Aunque no hubo diferencias significativas con respecto a los ensilados preparados exclusivamente de TD (100:00 TD/PP) y de los ensilados preparados con alta proporción de pasto (33:67 TD/PP), sí hubo diferencias (P<0.05) con respecto a los ensilados preparados exclusivamente de PP (00:100 TD/PP). La producción de gas después de 12 h disminuyó significativamente del pico anterior con una producción de gas entre 3.2 ml/h y 3.9 ml/h, lo que significa una caída del 50 %. El mayor efecto de la interacción entre tratamientos e inóculos sobre la producción de gas (ml) por hora se observó durante las

796


Rev Mex Cienc Pecu 2021;12(3):789-810

primeras horas de fermentación (Figura 1B). No se observaron grandes diferencias después de 32 h de observación para la producción de gas fraccionado. Figura 1: Tasa fraccional de gas de mezclas de ensilado de Tithonia diversifolia / Pennisetum purpureum, enriquecida o no enriquecida con cepas de bacterias ácido-lácticas

A= efecto del tratamiento. B= efecto del inóculo. TD/PP= proporciones de Tithonia diversifolia/Pennisetum purpureum [Base de materia fresca (MF)]. NI= sin inóculo; SA= Sil-all es una mezcla comercial de inóculos de bacterias ácido-lácticas. T-735= es una cepa de bacterias ácido-lácticas epífitas.

Los resultados mostraron una menor producción acumulada de gas a las 144 h en ensilados preparados exclusivamente de TD (160 ml) en comparación con los otros tratamientos (Figura 2A). Se encontró un aumento en la producción de gas en los ensilados preparados exclusivamente de pasto (194 ml). Los resultados de la interacción entre la mezcla (TD/PP) y el inóculo indican que, independientemente de la inoculación de BAL, los ensilados preparados con una mayor inclusión de TD produjeron una menor cantidad de gas, lo que significa que una mayor tasa de inclusión de PP en el proceso de ensilado aumenta la producción de gas. Los resultados de la ecuación de Gompertz indican que las tasas de producción de gas más altas fueron las siguientes: ensilados preparados exclusivamente de pasto+Silall; los ensilados preparados exclusivamente de pasto+T735; y los ensilados 797


Rev Mex Cienc Pecu 2021;12(3):789-810

preparados exclusivamente de pasto sin inóculo, respectivamente (Cuadro 2). Por el contrario, se reportaron valores más bajos para los tratamientos con mayores proporciones de TD [TD/PP: 100/0 y 67/33 % de inclusión, respectivamente]. Un análisis del gas acumulativo reveló que el parámetro α, que representa la tasa máxima de producción de gas, fue mayor en los ensilados preparados con alta proporción de pasto y los ensilados preparados exclusivamente de pasto (194.5 y 189.7 ml) donde la proporción de pasto fue la más alta. Las mezclas ensiladas mostraron aumentos en la producción acumulada de gas por gramo de materia seca a lo largo del tiempo. Lo mismo ocurrió con el parámetro PIG, donde los ensilados preparados con alta proporción de pasto y los ensilados preparados exclusivamente de pasto (67 y 100 de inclusión de PP) mostraron valores más altos que los ensilados preparados exclusivamente de TD (TD/PP: 100/0) y bajas proporciones de pasto (TD/PP: 67/33) (P<0.05). Los ensilados preparados exclusivamente de pasto tuvieron el mayor tiempo hasta el punto de inflexión (HPI) cercano a las 64 h y la misma tendencia para el tiempo de colonización microbiana (FL; 44.8) con un retraso estadísticamente significativo frente al resto de los tratamientos. Figura 2: Producción acumulativa de gas de mezclas de ensilado de Tithonia diversifolia/Pennisetum purpureum, enriquecido o no enriquecido con cepas de bacterias ácido-lácticas

A= efecto del tratamiento. B= efecto del inóculo. MSD: Materia seca degradada. TD/PP= proporciones de Tithonia diversifolia/Pennisetum purpureum [Base de materia fresca (MF)]. NI= sin inóculo; SA= Sil-all es una mezcla comercial de inóculos de bacterias ácido-lácticas. T-735= es una cepa de bacterias ácido-lácticas epífitas.

798


Rev Mex Cienc Pecu 2021;12(3):789-810

Cuadro 2: Parámetros del modelo de Gompertz para la producción de gas observados en mezclas de ensilados con diferentes niveles de inclusión de Tithonia diversifolia (TD) y Pennisetum purpureum (PP), enriquecidas o no enriquecidas con cepas de bacterias ácidolácticas Inclusión TD/PP: 100/0 TD/PP: 67/33 TD/PP: 33/67 TD/PP: 0/100

HPI (h)

γ

PIG (mL)

TMPG (mL/h)

FL (h)

α

β

160.2±1.62c

3.09±0.17c 0.08±0.0a 39.08c 58.93c

4.67a

26.43c

170.11±1.75b 3.03±0.15c 0.07±0.0b 42.35c 62.58b

4.48a

28.36c

189.65±1.19a 3.20±0.09b 0.06±0.0c 51.36b 69.77a

4.36a

35.29b

194.45±1.33a 3.34±0.10a 0.05±0.0d 63.96a 71.53a

3.76b

44.79a

TD/PP = proporciones de Tithonia diversifolia/Pennisetum purpureum [Base de materia fresca (MF)]. α= es el volumen máximo de producción de gas; β= es la diferencia entre el gas inicial y el gas en el momento x; γ= describe la tasa de acumulación de gas específica. HPI= tiempo hasta el punto de inflexión; PIG= punto de inflexión del gas; TMPG= tasa máxima de producción de gas. FL= fase de latencia (FL o acomodación microbiana).

Se realizaron análisis de la producción neta de CH4 a partir del gas generado a las 72 h de incubación de 1 g de ensilado (Figura 3). La degradación de la MS osciló entre el 63.7 % y el 64.4 %. Cabe señalar que a las 60 h después del inicio de la incubación y cerca del punto de inflexión (HPI), se obtuvo aproximadamente del 80 al 88 % del gas total producido durante el experimento. Se produjo una menor cantidad de metano en los ensilados preparados exclusivamente de TD (TD/PP: 100/0) en relación con los ensilados preparados con alta proporción de pasto y los ensilados preparados exclusivamente de pasto (67 y 100 de inclusión de PP), pero no fue significativamente diferente de los ensilados preparados con bajas proporciones de pasto (TD/PP: 67/33). Se observó una mayor liberación de metano a medida que aumentaba la proporción de PP en la mezcla, mientras que la producción de metano más baja se encontró en los ensilados que contenían la mayor proporción de TD (100/0 de TD/PP).

799


Rev Mex Cienc Pecu 2021;12(3):789-810

Figura 3: Producción de metano por gramo de ensilado de materia seca (a 70 h) incubado a diferentes niveles de inclusión de Tithonia diversifolia/Pennisetum purpureum

TD/PP= proporciones de Tithonia diversifolia/Pennisetum purpureum. [Base de materia fresca (MF)]. MSD: Materia seca degradada. Diferentes letras en la misma columna representan diferencias significativas entre los tratamientos (P<0.05).

Además, los hallazgos del experimento indican que el pH tendió a disminuir a medida que aumentaba la proporción de PP en las mezclas, pero no se observaron diferencias estadísticas (Figura 4). De alguna manera, la adición de BAL disminuyó la acidificación de los ensilados. Aunque el grado de acidificación fue máximo con la adición de la cepa T735 seguida de Silall y el tratamiento de control, no se obtuvieron diferencias estadísticas. Se observó una tendencia opuesta en el parámetro de temperatura, que aumentó a medida que se incrementaba la proporción de PP en las mezclas, a excepción de los ensilados preparados exclusivamente de TD (TD/PP: 100/0). Además, no se observó un efecto claro del inóculo sobre la temperatura del ensilado, sin embargo, T735 y Silall fueron más efectivos a medida que la proporción de PP aumentaba en las mezclas de ensilado (Figura 5; P<0.05). Figura 4: pH en la apertura de los ensilados de Tithonia diversifolia/Pennisetum purpureum enriquecidos o no enriquecidos con cepas de bacterias ácido-lácticas

TD/PP= proporciones de Tithonia diversifolia/Pennisetum purpureum [Base de materia fresca (MF)]. NI= sin inóculo; SA= Sil-all es una mezcla comercial de inóculos de bacterias ácido-lácticas. T-735= es una cepa de bacterias ácido-lácticas epífitas.

800


Rev Mex Cienc Pecu 2021;12(3):789-810

Figura 5: Temperatura en la apertura de los ensilados de Tithonia diversifolia/Pennisetum purpureum enriquecidos o no enriquecidos con cepas de bacterias ácido-lácticas

NI= sin inóculo; SA= Sil-all es una mezcla comercial de inóculos de bacterias ácido-lácticas. T-735= es una cepa de bacterias ácido-lácticas epífitas.

Discusión Se probaron distintas proporciones de Tithonia diversifolia (TD) y Pennisetum purpureum (PP) para obtener el máximo beneficio para la elaboración de ensilados y para la nutrición animal. Además, como las diferentes proporciones de forrajes en las mezclas de ensilado determinan el contenido de fibra detergente neutra (FDN) y proteína cruda (PC), lo que cambia aún más los parámetros de liberación de metano. En el presente estudio, el aumento de la proporción de PP en las mezclas de ensilado disminuyó la PC y el DMSIV, al tiempo que aumentó los valores de FDN y FDA. Estos resultados están en línea con otros estudios donde los forrajes gramíneos son una fuente de energía fácilmente disponible como carbohidratos fermentativos pero con menores contenidos de proteína que van de 5 a 11 g/100 g(9,38). Como las características de FDN y FDA están estrechamente relacionados con la ingesta de forraje y la digestibilidad del forraje, estos hallazgos podrían tener implicaciones adicionales en el rendimiento del animal; es decir, los ensilados con altas proporciones de TD serían más apetecibles para los animales y también podrían traducirse en un mayor rendimiento animal debido a un mayor suministro de proteínas y una mejor digestibilidad que los ensilados con una mayor proporción de PP. Por lo tanto, debería ser prudente corroborar estos hallazgos en modelos in vivo. Además, durante el proceso de fermentación ruminal, el material vegetal es colonizado por microorganismos ruminales causando diferentes tasas de degradación dependiendo de la

801


Rev Mex Cienc Pecu 2021;12(3):789-810

concentración de carbohidratos estructurales. Se recomienda que, al inicio del proceso de ensilado, no debe haber una limitación de carbohidratos para iniciar el proceso de fermentación; como en el caso de los ensilados con alta proporción de PP. Cuando se produce la acidificación, se produce un agotamiento de los sustratos para el metabolismo de BAL y se inicia la fase de estabilización del ensilado(8). A pesar de ello, una rápida acidificación de los ensilados es altamente deseable y se promueve mediante el uso de altas proporciones de gramíneas en las mezclas de ensilado. El contenido de proteína es otro parámetro que merece especial atención porque la mayoría de los materiales conservados para la alimentación animal muestran valores bajos de este componente(6). Aquí, este problema se supera claramente con el uso de TD en las mezclas. Los efectos más significativos se observaron cuando se incluyó TD en proporciones mayores (TD/PP: 100/0 y 67/33), ya que este forraje es una fuente de proteína cruda en los ensilados evaluados. Sin embargo, este efecto es insignificante en tratamientos con mayor proporción de pasto en las mezclas de ensilado (TD/PP: 33/67 y 0/100). Este hallazgo podría ser útil para discriminar el uso de BAL para la acidificación del ensilado. La alta proporción de PP en las mezclas de ensilado podría no requerir la adición de BAL para crear condiciones favorables para facilitar la fermentación del ácido láctico y preservar un contenido moderado de proteína cruda. Por el contrario, para las mezclas de forraje, que necesitan preservar un contenido considerable de proteína cruda, debe ser muy deseable utilizar BAL para prevenir la proteólisis. Durante la fermentación, los microorganismos ruminales y sus enzimas atacan primero a los carbohidratos fácilmente fermentables. Por lo tanto, la producción de gas después de las primeras 12 h se redujo significativamente en relación con las primeras horas después del ensilado. Es evidente que en las primeras horas de la fermentación una porción del sustrato que contiene azúcares solubles se fermenta inmediatamente; sin embargo, los azúcares solubles generalmente representan sólo una pequeña porción de materiales potencialmente digeribles(2). Después de eso, con la colonización de la fibra por bacterias celulolíticas y su degradación, se logra un aumento en la producción de gas. En la derivación de las ecuaciones de Gompertz del presente trabajo, se observó un aumento en la producción de gas a lo largo del tiempo. El comportamiento de la producción acumulada de gas se caracterizó por un aumento en el tiempo de exposición del material vegetal desde los ensilados hasta el ataque de microorganismos. Bezabih et al(23) sugieren que este aumento puede interpretarse como un aumento en la actividad microbiana por unidad de alimento, pero no implica ninguna suposición sobre la constancia del rendimiento del crecimiento microbiano. La reducción de la tasa de degradación del sustrato posiblemente está relacionada con la mayor cantidad de pared celular en el ensilado después del punto de inflexión (HPI), disminuyendo aún más la tasa de crecimiento fraccional y, en consecuencia, reduciendo el rendimiento microbiano. En el parámetro de la tasa máxima de producción de gas no se observaron diferencias significativas entre los ensilados preparados exclusivamente de TD (TD/PP: 100/0), los ensilados preparados con bajas proporciones de pasto (TD/PP: 67/33) y los ensilados preparados con alta proporción de pasto (TD/PP: 0/100). Sin embargo, las diferencias fueron 802


Rev Mex Cienc Pecu 2021;12(3):789-810

significativas en comparación con los ensilados preparados exclusivamente de pasto, lo que presumiblemente está relacionado con la mayor digestibilidad del material proteínico(24) representado en TD. Además, la menor producción de gas está relacionada con la fermentación propiónica como en el caso del ensilado preparado exclusivamente de TD. Para construir una molécula de ácido propiónico es necesario H2. En comparación con el ácido propiónico, la producción de acetato y ácido butírico libera H2(16). Por lo tanto, una mayor proporción de PP en las mezclas de ensilado conduciría a la fermentación butírica y acética que se asocia a una mayor producción de CO2 y metano. Esto tendría una implicación directa en el rendimiento animal, ya que la fermentación propiónica promovería un mejor rendimiento animal debido a una mejor eficiencia en la utilización de la energía de los alimentos. Es muy recomendable vincular los hallazgos in vitro de las emisiones de metano de este estudio para apuntar a una alta productividad animal al tiempo que se mitiga la producción de metano. En contraste con la proporción de TD y PP en las mezclas que modificaron los indicadores de liberación y fermentación de metano, los aditivos de BAL no modificaron estos parámetros. Una razón para esta observación es que BAL tiene el mayor impacto al comienzo del proceso de fermentación con un impacto importante en los carbohidratos fácilmente digeribles para facilitar la acidificación del ensilado, pero este efecto se detuvo durante la fase de estabilización del ensilado sin más efectos sobre otros componentes químicos como FDN o FDA; por lo tanto, se observó un impacto nulo en la liberación de metano(8). Este hallazgo está en línea con los resultados de Bureenok et al(11), quienes informaron que no hubo reducción del contenido de FDN en los ensilados de PP tratados con aditivos de BAL con respecto a los ensilados no tratados. Además, dichos autores indicaron que la adición de una fuente rica en carbohidratos fácilmente fermentables modificó el contenido de FDN por un efecto de dilución y por la mejora de la fermentación láctica(11). Es importante tener en cuenta que el rendimiento del crecimiento microbiano varía con factores como la población microbiana, el pH y la disponibilidad de sustratos de N(13). Está claro que estos factores pueden cambiar durante el período de incubación. Los hallazgos de la presente investigación indican que en el ensilado solo de pasto, la producción de metano es alta, pero puede disminuir a medida que aumenta la inclusión de TD. Esto es consistente con los datos reportados por La O et al(38), quienes, en mezclas de forraje fresco TD/PP, encontraron una disminución de la producción de metano (166.5, 150.3 y 84.2 ml/g) al agregar TD en las mezclas (15, 30 y 100 %, respectivamente). Claramente, los valores obtenidos en este estudio fueron superiores (hasta 204 ml/g) que los obtenidos por los autores anteriores. Los forrajes con un alto contenido de pared celular representan alimentos de baja calidad, por lo que, dependiendo de la calidad y la composición de la dieta, aproximadamente del 2 al 12 % de la energía bruta (EB) del alimento podría emitirse en forma de CH4(16,21). El uso de forrajes gramíneos como PP parece aumentar la liberación de metano. Por lo tanto, los beneficios para la producción animal de TD parecen ser el contenido de nitrógeno y un 803


Rev Mex Cienc Pecu 2021;12(3):789-810

mayor grado de digestibilidad. Sin embargo, esto debe equilibrarse debido a la capacidad buffer, ya que la acidificación es menor en los ensilados con mayor proporción de gramíneas que comprometerían la ensilabilidad de los forrajes(10,12). Por lo tanto, el uso de altas proporciones de TD en las mezclas de ensilado aumentaría la capacidad buffer(12). Este efecto se maximizaría si se observa un alto contenido de proteínas y se activa la capacidad buffer de los grupos amino. Un factor asociado que se debe tener en cuenta es que la capacidad buffer se mejora con altas cantidades de amoníaco (NH3) debido a la desaminación de la proteína. Además, el alto contenido de fibra de los forrajes también se ha relacionado con una alta capacidad buffer, ya que la capacidad de los componentes de fibra para intercambiar cationes durante el proceso de ensilado puede afectar la capacidad buffer del forraje. Además, la alta temperatura de los ensilados en la apertura está relacionada con la actividad microbiana. Este efecto fue más evidente en los ensilados con proporciones superiores de PP en las mezclas de ensilado. El aumento de la temperatura podría afectar aún más la estabilidad aeróbica de los ensilados después de la exposición del material conservado al oxígeno durante la apertura del silo(1,8).

Conclusiones e implicaciones Los ensilados con mayores proporciones de Tithonia diversifolia aumentaron el contenido de proteína cruda, la digestibilidad in vitro al tiempo que disminuyeron las fracciones de FDN y FDA. Las bajas cantidades de TD mostraron los valores de producción de gas más bajos, mientras que los tratamientos con mayor inclusión de pasto produjeron una mayor cantidad de gas. La producción de metano fue mayor al aumentar la proporción de Pennisetum purpureum en las mezclas de ensilado. El inóculo del ensilado no tuvo ningún impacto en la producción de gas in vitro. Las proporciones más altas de TD disminuyeron el proceso de acidificación, mientras que la inclusión de PP facilitó valores de pH más bajos. El inóculo de las bacterias ácido-lácticas tendió a disminuir el pH de los ensilados, pero no se observaron efectos claros sobre la temperatura. Los ensilados con proporciones altas de T. diversifolia (67 % de inclusión) serían más apetecibles para los animales y también podrían traducirse en un mayor rendimiento animal debido a un mayor suministro de proteínas y una mejor digestibilidad que los ensilados con mayor proporción de P. purpureum (67 y 100 % de inclusión). Por lo tanto, debería ser prudente corroborar estos hallazgos en modelos in vivo.

804


Rev Mex Cienc Pecu 2021;12(3):789-810

Conflicto de intereses Los autores declaran que no tienen intereses contrapuestos.

Agradecimientos

Al Centro Internacional de Agricultura Tropical (CIAT) y a la Universidad del Tolima por el apoyo financiero. El apoyo técnico de Patricia Ávila y Orlando Trujillo del Laboratorio de Calidad de Forrajes del CIAT es muy reconocido.

Literatura citada: 1. Muck RE, Nadeau EMG, McAllister TA, Contreras-Govea FE, Santos MC, Kung L. Silage review: Recent advances and future uses of silage additives. J Dairy Sci 2018;101(5):3980-4000. 2. Martens SD, Korn U, Roscher S, Pieper B, Schafft H, Steinhöfel O. Effect of tannin extracts on protein degradation during ensiling of ryegrass or lucerne. Grass Forage Sci 2019;74(2):284-296. 3. Rao I, Peters M, Castro A, Schultze-Kraft R, White D, Fisher M, et al. LivestockPlus: sustainable intensification of tropical forage-based systems for improving livelihood and environmental benefits. Trop Grassl - Forr Trop 2015;3(2):59-82. 4. Holguín VA, Ortiz Grisalez S, Velasco Navia A, Mora-Delgado J. Multi-criteria evaluation of 44 introductions of Tithonia diversifolia (Hemsl.) A. Gray in Candelaria, Valle del Cauca. Rev Med Vet Zoot 2015;6257-72. 5. Mauricio RM, Ribeiro RS, Silveira SR, Silva PL, Calsavara L, Pereira LG, et al. Tithonia diversifolia for ruminant nutrition. Trop Grassl-Forr Trop 2014;2(1):82-84. 6. Vega GE, Sanginés GL, Gómez GA, Hernández BA, Solano L, Escalera VF, et al. Reemplazo de alfalfa con Tithonia diversifolia en corderos alimentados con ensilado de caña de azúcar y pulidura de arroz. Rev Mex Cienc Pecu 2019;10(2):267-282. 7. Ribeiro RS, Terry SA, Sacramento JP, Silveira SRE, Bento CBP, da Silva EF, et al. Tithonia diversifolia as a supplementary feed for dairy cows. PLoS One 2016;11(12):e0165751.

805


Rev Mex Cienc Pecu 2021;12(3):789-810

8. Wilkinson JM, Muck RE. Ensiling in 2050: Some challenges and opportunities. Grass Forage Sci 2019;74(2):178-187. 9. Holguín VA, Cuchillo HM, Mazabel J, Martens SD. In-vitro assessment for ensilabillity of Tithonia diversifolia alone or with Pennisetum purpureum using epiphytic lactic acid bacteria strains as inocula. Acta Sci Anim Sci 2018;40. e37940 1-7. 10. Holguín VA, Cuchillo HM, Mazabel J, Quintero S, Mora DJ. Effect of a Pennisetum purpureum and Tithonia diversifolia silage mixture on in vitro ruminal fermentation and methane emission in a RUSITEC system. Rev Mex Cienc Pecu 2020;11(1):19-37. 11. Bureenok S, Yuangklang C, Vasupen K, Schonewille JT, Kawamoto Y. The effects of additives in napier grass silages on chemical composition, feed intake, nutrient digestibility and rumen fermentation. Asian-Australas J Anim Sci 2012;25(9):12481254. 12. Heinritz SN, Martens SD, Avila P, Hoedtke S. The effect of inoculant and sucrose addition on the silage quality of tropical forage legumes with varying ensilability. Anim. Feed Sci Technol 2012;174(3-4):201-210. 13. Martens SD, Hoedtke S, Avila P, Heinritz SN, Zeyner A. Effect of ensiling treatment on secondary compounds and amino acid profile of tropical forage legumes, and implications for their pig feeding potential. J Sci Food Agr 2014;94(6):1107-1115. 14. Rabelo CHS, Basso FC, Lara EC, Jorge LGO, Härter CJ, Mari LJ, et al. Effects of Lactobacillus buchneri as a silage inoculant or probiotic on in vitro organic matter digestibility, gas production and volatile fatty acids of low dry-matter whole-crop maize silage. Grass Forage Sci 2017;72(3):534-544. 15. Macome FM, Pellikaan WF, Schonewille JT, Bannink A, van Laar H, Hendriks WH, et al. In vitro rumen gas and methane production of grass silages differing in plant maturity and nitrogen fertilisation, compared to in vivo enteric methane production. Anim Feed Sci Technol 2017;23096-102. 16. Posada SL, Noguera RR. Técnica in vitro de producción de gases: Una herramienta para la evaluación de alimentos para rumiantes (In vitro technique of gas production: A tool for feed assesment for ruminants). Livest Res Rural Dev 2005;17Art. #36.

806


Rev Mex Cienc Pecu 2021;12(3):789-810

17. Theodorou MK, Williams BA, Dhanoa MS, McAllan AB, France J. A simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. Anim Feed Sci Technol 1994;48(3):185-197. 18. Tilley JMA, Terry RA. A two stage technique for in vitro digestion of forage crops. Grass Forage Sci 1963;18104-111. 19. Albores-Moreno S, Alayón-Gamboa JA, Miranda-Romero LA, Alarcón-Zúñiga B, Jiménez-Ferrer G, Ku-Vera JC, et al. Effect of tree foliage supplementation of tropical grass diet on in vitro digestibility and fermentation, microbial biomass synthesis and enteric methane production in ruminants. Trop Anim Health Prod 2019;51(4):893-904. 20. Ku-Vera JC, Valencia-Salazar SS, Piñeiro-Vázquez AT, Molina-Botero IC, ArroyaveJaramillo J, Montoya-Flores MD, et al. Determination of methane yield in cattle fed tropical grasses as measured in open-circuit respiration chambers. Agric Forest Meteorol 2018;258:3-7. 21. Haque MN. Dietary manipulation: a sustainable way to mitigate methane emissions from ruminants. J Anim Sci Technol 2018;60(1):15. 22. Vélez OM, Gaona RC, Guerrero HS. Propiedades antimetanogénicas in vitro de algunas plantas adaptadas a las condiciones de sabana inundable del Departamento de Arauca, Colombia. (In vitro antimethanogenic properties of some plants adapted to the floodable savanna conditions of Arauca Department, Colombia). Trop Subtrop Agroecosyst 2015;18(3):335-345. 23. Bezabih M, Pellikaan WF, Tolera A, Khan NA, Hendriks WH. Chemical composition and in vitro total gas and methane production of forage species from the Mid Rift Valley grasslands of Ethiopia. Grass Forage Sci 2014;69(4):635-643. 24. Navarro-Villa A, O'Brien M, López S, Boland TM, O'Kiely P. In vitro rumen methane output of grasses and grass silages differing in fermentation characteristics using the gas-production technique (GPT). Grass Forage Sci 2013;68(2):228-244. 25. Patra AK. Recent advances in measurement and dietary mitigation of enteric methane emissions in ruminants. Front Vet Sci 2016;3(39). 26. Gemeda BS, Hassen A. In vitro fermentation, digestibility and methane production of tropical perennial grass species. Crop Pasture Sci 2014;65(5):479-488.

807


Rev Mex Cienc Pecu 2021;12(3):789-810

27. Patra A, Park T, Kim M, Yu Z. Rumen methanogens and mitigation of methane emission by anti-methanogenic compounds and substances. J Anim Sci Biotecnol 2017;8(1):13. 28. Hoedtke S, Zeyner A. Comparative evaluation of laboratory-scale silages using standard glass jar silages or vacuum-packed model silages. J Sci Food Agric 2011;91(5):841-849. 29. Pieper B, Hoedtke S, Wensch-Dorendorf M, Korn U, Wolf P, Zeyner A. Validation of the Rostock fermentation test as an in vitro method to estimate ensilability of forages using glass jar model silages as a basis for comparison. Grass Forage Sci 2016;72(3):568-580. 30. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):3583-3597. 31. Palmquist DL, Jenkins TC. Challenges with fats and fatty acid methods. J Anim Sci 2003;81(12):3250-3254. 32. Moore JE. Procedures for the two-stage in vitro digestion of for ages. In: Nutrition research techniques for domestic and wild animals, Harris LE, editor. Vol. 1. Utah State Univ., Logan. 1970. 33. AOAC, Determination of ash in animal feed. Official method 942.05. 18th edition (Chapter 4) ed.; Association of Official Analytical Chemists: Gaithersburg, DC. USA. 2005. 34. France J, Dijkstra J, Dhanoa MS, Lopez S, Bannink A. Estimating the extent of degradation of ruminant feeds from a description of their gas production profiles observed in vitro:derivation of models and other mathematical considerations. Br J Nutr 2000;83(2):143-150. 35. Schofield P, Pitt RE, Pell AN. Kinetics of fiber digestion from in vitro gas production. J Anim Sci 1994;72(11):2980-2991. 36. García II, Mora-Delgado J, Estrada J, Piñeros R. Kinetics of gas production of fodder of Moringa oleifera Lam grown in tropical dry forest areas from Colombia. Agrofor Syst 10.1007/s10457-019-00409-0 2019. 37. InfoStat. InfoStat, versión 2008, Grupo InfoStat, FCA, Universidad Nacional de Córdoba, Argentina. 2008.

808


Rev Mex Cienc Pecu 2021;12(3):789-810

38. La OO, Valenciaga D, González H, Orozco A, Castillo Y, Ruíz O, et al. Effect of the combination of Tithonia diversifolia and PP vc. Cuba CT-115 in the kinetics and gas production in vitro. (In spanish) Efecto de la combinación de Tithonia diversifolia y PP vc. Cuba CT-115 en la cinética y producción de gas in vitro. Rev Cubana Cienc Agrí 2009;43149-152.

809


Rev Mex Cienc Pecu 2021;12(3):789-810

Cuadro 1: Valor nutritivo de las mezclas de ensilado de Tithonia diversifolia (TD) y Pennisetum purpureum (PP) enriquecidas o no enriquecidas con cepas de bacterias ácido-lácticas MSA PC FDN FDA DMSIV CENIZA Tratamientos Inóculo (%±EE) (%±EE) (%±EE) (%±EE) (%±EE) (%±EE) d b e a TD/PP: 100/0 T-735 88.0±0.3 16.8±0.4 34.9±0.7f 23.1±0.7 68.9±0.6 13.2±0.2de Silall 88.3±0.3cd 15.9±0.4bc 34.7±0.7f 24.4±0.7e 68.8±0.6 a 13.3±0.2bcde Control 88.9±0.3c 18.1±0.4a 38.6±0.7e 28.1±0.7d 63.9±0.6 d 14.1±0.2a Promedio 88.4±0.2b 16.9±0.3d 36.1±0.4a 25.24±0.7a 67.2±0.3b 13.5±0.1ab TD/PP: 67/33 T-735 87.9±0.3de 12.7±0.4d 40.8±0.7d 28.3±0.7cd 68.3±0.6ab 13.2±0.2cde Silall 87.2±0.3e 12.3±0.4d 41.7±0.7cd 28.7±0.7cd 66.6±0.6 c 12.9±0.2e Control 87.8±0.3de 15.1±0.4c 43.3±0.7c 30.0±0.7c 66.7±0.6 c 13.6±0.2abcd Promedio 87.6±0.2 a 13.4±0.3c 41.9±0.4b 29.0±0.4b 67.2±0.3b 13.2±1.2a TD/PP: 33/67 T-735 88.5±0.3cd 8.6±0.4e 49.1±0.7b 33.4±0.7b 65.8±0.6c 13.9±0.2a Silall 89.1±0.3bc 9.0±0.4e 41.7±0.7cd 34.0±0.7b 67.1±0.6bc 12.9±0.2e Control 88.4±0.3cd 8.4±0.4e 43.3±0.7c 34.4±0.7b 67.4±0.6abc 13.6±0.2 abcd Promedio 88.7±0.2b 8.7±0.3b 44.7±0.4c 33.9±0.4c 66.8±0.3b 13.5±0.1ab TD/PP: 0/100 T-735 89.9±0.3ab 5.3±0.4f 57.3±0.7a 38.1±0.7a 64.0±0.6d 13.7±0.2ab Silall 89.8±0.3ab 5.1±0.4f 57.9±0.7a 38.3±0.7a 63.0±0.6d 14.0±0.2a a a a d Control 90.6±0.3 5.1±0.4f 58.9±0.7 39.1±0.7 63.8±0.6 13.7±0.2abc Promedio 90.1±0.2c 5.2±0.3a 58.0±0.4d 38.5±0.4d 63.6±0.3a 13.8±0.1b TD/PP= proporciones de Tithonia diversifolia/Pennisetum purpureum [Base de materia fresca (MF)]. MSA= materia seca analítica; PC= proteína cruda; FDN= fibra detergente neutra; FDA= fibra detergente ácida; DMSIV; Digestibilidad de la materia seca in vitro. T-735= es una cepa de bacterias ácido-lácticas epífitas. Silall es una mezcla comercial de inóculo de bacterias ácido-lácticas.

810


https://doi.org/10.22319/rmcp.v12i3.5720 Artículo

Fases de desarrollo y propagación de ecotipos destacados de Tithonia diversifolia (Hemsl.) A. Gray

Julián Esteban Rivera-Herrera a* Tomás Ruíz-Vásquez b Julián Chará-Orozco a Juan Florencio Gómez-Leyva c Rolando Barahona-Rosales d

Centro para la Investigación en Sistemas Sostenibles de Producción Agropecuaria – CIPAV. Carrera 25 # 6 – 62 Cali, Colombia. a

b

Instituto de Ciencia Animal, San José de las Lajas. La Habana, Cuba.

c

Instituto Tecnológico de Tlajomulco, TecNM. Laboratorio de Biología Molecular. Jalisco, México. d

Universidad Nacional de Colombia, Sede Medellín, Colombia.

*Autor de correspondencia: jerivera@fun.cipav.org.co

Resumen: La propagación eficiente de especies vegetales con alto potencial alimenticio juega un papel fundamental en su adopción y utilización por parte de los productores. Es importante, por tanto, desarrollar métodos económicos y rápidos para el establecimiento exitoso de sistemas más productivos. Con el objetivo de conocer algunos aspectos reproductivos de diferentes genotipos destacados de T. diversifolia y así favorecer su propagación y mejorar su uso en la alimentación animal, se evaluó su potencial de germinación, producción de semilla y duración del ciclo reproductivo. Se usaron 42 parcelas en un diseño de bloques completos al azar con siete genotipos de T. diversifolia y dos niveles (sin y con fertilización). Los genotipos tuvieron diferencias en todas las variables agronómicas y de producción de semilla a excepción del tiempo de secado de aquenios y en el porcentaje de semillas rudimentarias (P<0.01). Con relación a la

811


Rev Mex Cienc Pecu 2021;12(3):811-827

producción de semilla sexual, la fertilización tuvo efecto significativo (P<0.05) y en general incrementó el tiempo de las fases evaluadas. La mayor producción de semilla se dio en los genotipos 7 y 5 y el porcentaje de germinación tuvo diferencias significativas entre genotipos y entre los tratamientos pre-germinativos (P=0.0001) con mayores porcentajes en los genotipos 3 y 6. Se concluye que a pesar de la baja viabilidad de la semilla sexual de T. diversifolia, existen genotipos con un mayor potencial de producción de semilla y porcentaje de germinación, parámetros que pueden ser mejorados por medio de tratamientos pre-germinativos y el uso de fertilizantes. Palabras clave: Fase reproductiva, Germinación, Propagación vegetal, Semilla sexual, Viabilidad de la semilla.

Recibido: 26/06/2020 Aceptado:28/10/2020

Introducción La inclusión de plantas forrajeras altamente proteicas y con bajo contenido de fibra en la dieta de bovinos, resulta en un incremento de la calidad de la biomasa forrajera, que, a su vez, se traduce en un aumento de la producción de leche y carne(1,2). Por esta razón, una adecuada y eficiente propagación debe ser un objetivo de estudio para mejorar su utilización. Tithonia diversifolia (Hemsl.) A. Gray es una arbustiva de la familia Asteraceae que, por su facultad de adaptación a múltiples condiciones ambientales, edáficas y de manejo, capacidad de rebrote y rápido crecimiento, y alto valor y aporte nutricional, ha demostrado su potencial para la alimentación animal(3,4,5). T. diversifolia puede reproducirse tanto por semilla gámica como por semilla asexual, confiriéndole gran capacidad de reproducción y colonización de nuevos hábitats(6,7). Esta especie florece y produce semillas durante todo el año especialmente en los meses de octubre y noviembre, aunque por condiciones ambientales puede ser de floración anual(8,9). Sin embargo, algunas investigaciones han reportado porcentajes de germinación menores del 30 % en condiciones naturales(7,10). Aunque observaciones de campo indican que T. diversifolia tiene una gran capacidad para crecer clonalmente(6), en la actualidad se sabe que material proveniente de semilla sexual puede favorecer el desarrollo de sistemas radiculares más extensos, plantas más vigorosas, mayor persistencia de los cultivos y recuperación más rápida después del corte o pastoreo(11). Sin embargo, aún es difícil alcanzar material seminal de buena calidad, y adicionalmente, dentro de esta especie existen genotipos con diferentes capacidades de germinación(11,12). Al estudiar el desarrollo de la microsporogénesis, se reconocen

812


Rev Mex Cienc Pecu 2021;12(3):811-827

anormalidades cromosómicas en 32 % de células en metafase I y anafase I, identificando cromosomas rezagados. Por otro lado, las razones de la esterilidad del polen en Tithonia podrían converger en las irregularidades observadas en su división meiótica(13). Con el objetivo de conocer algunos aspectos reproductivos de genotipos destacados de T. diversifolia en Colombia y así favorecer su propagación y mejor uso hacia la alimentación animal, se evaluó el potencial de germinación, producción de semillas viables y duración de las fases de crecimiento.

Material y métodos Genotipos evaluados Se evaluaron siete genotipos destacados para la alimentación animal de T. diversifolia identificados previamente en un análisis de diversidad genética(14) y colectados en diferentes sitios de Colombia.

Localización Las mediciones se desarrollaron en parcelas experimentales localizadas en municipio de San Luis de Cubarral (Meta, Colombia), a 3°47'21.43"N, 73°49'15.93"O y a una altura sobre el nivel del mar de 530 m. El sitio cuenta con una precipitación media anual de 4,100 mm, una temperatura promedio de 24.8 ºC y se ubica en la zona de vida de bosque húmedo tropical (bh-T)(15).

Medición de condiciones ambientales Durante todo el periodo de muestreo las variables ambientales de precipitación (mm), temperatura (ºC), humedad relativa (%), radiación solar (W/m2), punto de rocío (ºC), velocidad del viento (m/s) e índice THSW (sensación térmica a causa del viento, la humedad relativa), la irradiancia (radiación solar instantánea) y la temperatura (ºC) fueron monitoreadas por medio de una estación meteorológica Vantage Pro 2TM (Davis ®).

Análisis de suelos Las variables químicas y físicas de pH, C.E (dS/m), capacidad de campo (%), punto de marchitez permanente (%), densidad aparente (g/cc), carbono orgánico (%), materia orgánica (%), textura, potasio intercambiable (mg/kg), calcio intercambiable (mg/kg), magnesio intercambiable (mg/kg), sodio intercambiable (mg/kg), acidez intercambiable (mg/kg), hierro (mg/kg), manganeso (mg/kg), cobre (mg/kg), zinc (mg/kg), boro (mg/kg), fósforo (mg/kg), azufre (mg/kg) y la C.I.C.E. (meq/100 g), fueron determinadas en el suelo donde se encontraron las parcelas experimentales.

813


Rev Mex Cienc Pecu 2021;12(3):811-827

Variables de crecimiento y reproducción Las variables de duración de la fase vegetativa (días), duración de la fase reproductiva (días), duración del secado de aquenios (días), fase de floración (días), cabezuelas por plantas (#), semillas por cabezuela (#), semillas por planta (#), semillas llenas (%), semillas vacías (%) y semillas rudimentarias (%), fueron medidas en los siete genotipos evaluados. Las duración de la fase vegetativa se determinó desde el momento del corte de uniformización en el que las plantas se podaron a 15 cm de altura hasta el inicio de la floración de más del 50 % de los individuos que conformaban las parcelas experimentales; la duración de la fase reproductiva fue desde el momento de la aparición de botones florales hasta la caída de pétalos en el 50 % de las plantas; la duración de secado de aquenios fue desde la caída de pétalos en las plantas hasta lograr un color marrón oscuro de las cabezuelas, y la fase de floración fue la sumatoria de las fases vegetativa, reproductiva y secado de aquenios. Las variables de cabezuelas por plantas (#), semillas por cabezuela (#), semillas por planta (#), semillas llenas (%), semillas vacías (%) y semillas rudimentarias (%), se midieron de forma manual y en cinco plantas elegidas al azar de cada una de las parcelas experimentales a partir del cálculo de tamaño de la muestra, asumiendo un error máximo de estimación aceptado y nivel de confianza del 10 %. El cultivo evaluado tenía una edad de 13 meses y las mediciones se realizaron en la época de lluvias durante el segundo periodo del año 2019.

Germinación de la semilla sexual Se evaluaron dos tratamientos pre-germinativos y un tratamiento sin proceso previo (Trat 1). Los tratamientos pre-germinativos fueron: agua a 80 ºC durante 10 min (Trat 2)(16,17,18), y ácido sulfúrico al 50 % (H2SO4) durante 5 min (Trat 3)(19). La semilla estuvo almacenada durante cuatro meses después de ser colectada con el objetivo de disminuir la latencia fisiológica de la semilla(17,20), y la germinación se evaluó en macetas durante 25 días usando 50 semillas por sitio.

Diseño experimental y análisis de la información Los siete genotipos de T. diversifolia se establecieron en parcelas experimentales en un diseño de bloques completos al azar con dos factores (el genotipo y el nivel de fertilización). Cada material contó con tres repeticiones las cuales estuvieron conformadas por 36 plantas cada una (0.8 m x 0.8 m) y dos niveles de fertilización (cero fertilización y fertilización de acuerdo con la extracción de nutrientes a los 40 días de crecimiento). Según evaluaciones, plantas de T. diversifolia de 40 días extraen 8.26 g de nitrógeno, 4.3 g de potasio y 1.07 g de fósforo(21). Esta cantidad de nutrientes fue aplicada fertilizando con urea (46 % de N), fosfato biamónico (DAP) ((NH4)2HPO4) (46 % de P2O5, 18% de N) y cloruro de potasio (KCl, K2O del 60 al 63 % y Cl del 45 al 47 %) a razón de16.22, 2.15 y 4.89 g/planta de urea, DAP y KCl, respectivamente. Las

814


Rev Mex Cienc Pecu 2021;12(3):811-827

evaluaciones de germinación igualmente se analizaron bajo el mismo diseño experimental, asignando macetas de acuerdo con las parcelas dispuestas en campo. El modelo matemático del diseño experimental fue: yklj =μ+αk+γl +ξkl+ξkl+βj+ǫklj Donde: yklj = Observación en la unidad experimental de la variable a evaluar; μ = es la media del efecto general; αk = efecto del factor k (materiales colectados 1, 2, 3…7); γl = efecto del factor l (nivel de fertilización 1, 2…); βj = efecto del bloque j; ξkl = interacción de los dos factores; ǫklj = valor aleatorio, error experimental de la unidad experimental lkj. Todos los análisis se realizaron en la herramienta RStudio usando la librería “agricolae”(22). Para los análisis se evaluó la normalidad, homogeneidad de la varianza y la aditividad, además, cuando fue identificada diferencia entre las medias se utilizó la prueba de contraste de Tukey, con un nivel de significancia de 0.05. Finalmente, en las variables de fase reproductiva y semillas llenas, cuando los grupos de datos no cumplieron con las condiciones para un análisis paramétrico, se usó la prueba de Kruskal-Wallis y Mann-Whitney para las comparaciones.

Resultados Condiciones ambientales La Figura 1 muestra las condiciones ambientales observadas durante el periodo de evaluación. Según los registros obtenidos en el sitio de experimentación, la temperatura promedio fue de 23.9 ± 1.2 ºC, la humedad relativa fue de 83.4 ± 5 %, el punto de rocío promedio fue 20.8 ± 0.6 ºC, la velocidad del viento fue de 0.7 ± 0.2 m/seg, el índice THSW promedio fue 26.7 ± 2.1 ºC, la radiación solar 147 ± 53.3 W/m2 y la precipitación acumulada fue de 556.2 mm.

815


Rev Mex Cienc Pecu 2021;12(3):811-827

Figura 1: Condiciones ambientales observadas durante el periodo de experimentación

Las principales características químicas y físicas de los suelos donde se encontraron las parcelas experimentales se muestran en el Cuadro 1. Los suelos fueron ácidos y presentaron baja fertilidad por limitado aporte de nutrientes, características habitualmente encontradas bajo condiciones tropicales.

816


Rev Mex Cienc Pecu 2021;12(3):811-827

Cuadro 1: Características químicas y físicas del suelo Item pH CE, dS/m Capacidad de campo, % Punto de marchitez permanente, % Densidad aparente, g/cc Carbono orgánico, % Materia orgánica, % Arena, % Limo, % Arcilla, % Textura Potasio intercambiable, (mg/kg) Calcio intercambiable, mg/kg Magnesio intercambiable, mg/kg Sodio intercambiable, mg/kg Acidez intercambiable, mg/kg Hierro, mg/kg Manganeso, mg/kg Cobre, mg/kg Zinc, mg/kg Boro, mg/kg Fósforo, mg/kg Azufre, mg/kg CICE, meq/100g

Bloque 1 4.71 0.07 18.5

Bloque 2 4.73 0.06 15.8

Bloque 3 4.67 0.06 13.8

9.25

7.90

6.91

1.51 1.02 1.76 68 12 20 Franco - arcillo arenoso

1.46 0.88 1.52 60 16 24 Franco - arcillo arenoso

1.44 0.62 1.07 50 18 32 Franco - arcillo arenoso

23.4

23.4

15.6

274

130

132

24.0

16.8

18.1

23.2

18.4

16.1

218

219

172

305 9.6 1.1 0.7 0.11 7.6 7.8 3.64

358 6.0 0.75 0.4 0.17 3.7 9.6 3.35

459 3.3 0.53 0.4 0.13 5.5 3.6 2.82

pH= potencial de hidrogeniones; CE= conductividad eléctrica; mg= miligramos; kg= kilogramos; CICE= capacidad de intercambio catiónico.

Fases de desarrollo Los genotipos evaluados tuvieron diferencias significativas en todas las variables de desarrollo (P<0.05), a excepción del tiempo de secado de aquenios y del porcentaje de semillas rudimentarias (P>0.05) (Cuadro 2). El genotipo 1 fue el material que tomó mayor tiempo (140.1 días) en la sumatoria de las etapas de crecimiento y desarrollo (fase de floración) y el genotipo 4 fue el que presentó menores tiempos (127.2 días) con 817


Rev Mex Cienc Pecu 2021;12(3):811-827

diferencias significativas (P<0.001). Con relación a la producción de semilla sexual, la fertilización tuvo efecto (P<0.001) al generar 2.14 veces más semillas, y en general incrementó el tiempo de las fases evaluadas en aproximadamente 5 días. Los genotipos 5 y 7 fueron los materiales con mayor producción de cabezuelas por plantas, mayor porcentaje de semillas llenas y presentaron el número más alto de semillas por planta, esto asociado probablemente a su mayor número de ramas. De igual forma se destaca el alto porcentaje de semillas vacías en todos los genotipos, así como de semillas rudimentarias, que determinan que más del 30 % de las semillas no tienen viabilidad física.

Germinación En el Cuadro 3 se presenta el porcentaje de germinación de la semilla sexual de los genotipos evaluados con los tres tratamientos pre-germinativos usados. De acuerdo con los resultados obtenidos hubo diferencias significativas entre genotipos y tratamientos (P=0.0001). En promedio los porcentajes de germinación fueron 46.87, 53.53 y 25.97 para el tratamiento testigo, uso de agua a 80 ºC y ácido sulfúrico al 50 %, respectivamente, y este proceso inició a los tres días después de la siembra. La germinación de las semillas sin tratamiento fue significativamente menor en el genotipo 1 frente a los otros 6 genotipos (P<0.0001). Además, este mismo material tuvo los valores más bajos cuando se usó el tratamiento con agua y de ácido sulfúrico, aunque no tuvo diferencias significativas con los genotipos 2 y 7. La fertilización incrementó en promedio 9.2 % la germinación de los diferentes genotipos y el tratamiento que logró mayor germinación fue el uso de agua a 80 ºC y el tratamiento con menor germinación fue el que utilizó ácido sulfúrico. En general los genotipos 3 y 6 fueron los que presentaron mayor porcentaje de germinación, pero solo tuvieron diferencias significativas frente al genotipo 1.

Discusión Conocer la fenología de las especies arbustivas y su potencial de propagación permiten no solo lograr un mayor aprovechamiento, sino también un uso más eficiente y económico. Los resultados de los tiempos de cada una de las fases evaluadas coinciden con lo reportado por Saavedra(23). En general los tiempos de crecimiento y desarrollo fueron modificados por la fertilización, debido probablemente a la disminución de algunos factores de estrés. Un uso adecuado de fertilización favorece la producción de semilla y genera un mejor desarrollo(24). Saavedra(23) al evaluar tres orígenes de T. diversifolia, encontró una duración del proceso de desarrollo muy similar entre los materiales, con una duración del desarrollo vegetativo entre 88 y 137 días, el proceso de floración entre 18 y 22 días, y una formación de frutos entre 13 y 18 días. En cuanto a las semillas llenas, vacías y rudimentarias, esta misma autora encontró valores entre 65 y 75 %; 15.75 a 26 % y 9.31 a 12 %, respectivamente, similares a las del presente estudio.

818


Rev Mex Cienc Pecu 2021;12(3):811-827

La producción de semilla para T. diversifolia también ha sido determinada por diferentes autores. En un estudio en África se encontró que esta especie puede producir entre 35 y 212 capítulos por planta, entre 32 y 62 semillas por capítulo, entre 1,120 a 13,144 semillas por planta y que 1,000 semillas pesan entre 6.42 y 7.5 g. Estos resultados evidencian gran variabilidad en esta especie, y los resultados concuerdan con los hallados en esta evaluación a excepción del número de semillas por capítulo, ya que en este estudio se identificó un mayor número(7). La producción de semilla estuvo relacionada con el número de ramas que favorece una mayor producción de botones florales. El manejo al momento del corte, como por ejemplo la altura de la poda, favorece mayor número de ramas y producción de biomasa(25,26). T. diversifolia se puede reproducir tanto por semilla gámica como por semilla asexual, lo que le confiere gran capacidad de reproducción y colonización de nuevos hábitats(7,27). Esta especie florece y produce semillas durante todo el año, especialmente en los meses de octubre y noviembre, aunque por condiciones ambientales puede ser anual(8,9). Las plantas maduras producen de 80,000 a 160,000 semillas por metro cuadrado anualmente, de las cuales se desarrollan completamente el 70 %, pero se han reportado porcentajes de germinación por debajo del 30 % en condiciones naturales(7,10) como ocurrió en los genotipos 1 y 5 del presente estudio. Los resultados encontrados en este estudio indican que la germinación de T. diversifolia durante los primeros meses de pos-cosecha es aceptable, aunque variable entre genotipos. Algunos autores destacan que esta variabilidad puede deberse a una latencia fisiológica(20) y a irregularidades observadas en su división meiótica(10,13,28). Existen diferencias entre ecotipos en su capacidad de germinación. Los resultados encontrados coinciden con un estudio de 29 materiales colectados en Cuba donde se hallaron diferencias significativas en los porcentajes de germinación los cuales oscilaron entre el 5 y el 67 %(29,30). Pero los resultados se encuentran por debajo de lo reportado en otros estudios donde se alcanzaron porcentajes mayores al 70 % en algunos materiales(17,20). También, estudios realizados en China demuestran la variabilidad de la reproducción gámica de esta especie en cinco regiones de la provincia de Yunnan(30). En aquel estudio se determinaron los mayores rangos de germinación (29.5 a 55.5 %) con temperaturas entre los 20 y 30 ºC. Los resultados obtenidos coinciden con los del presente estudio respecto a que, la mayor germinación ocurre entre los primeros cinco a diez días para ambas condiciones estudiadas(30). Se ha identificado que aproximadamente el 65 % de los granos de polen carecen de núcleos espermáticos, indicando una fertilidad cercana al 30 %(10). De igual manera al estudiar el desarrollo de la microsporogénesis, se reconocieron anormalidades cromosómicas en 32 % de células en metafase I y anafase I, identificando cromosomas rezagados, y en la metafase II, 47 % de las células presentaron asincronía de un juego de cromosomas y cromosomas rezagados. Se ha observado que en algunas especies de dicotiledóneas los dos núcleos resultantes de la primera división meiótica entran asincrónicamente en la segunda(31), lo cual podría resultar en esterilidad masculina, 819


Rev Mex Cienc Pecu 2021;12(3):811-827

anomalía que también la han relacionado con la orientación del huso, cromosomas rezagados y puentes anafásicos que afectan la conformación de las tétradas(32). La presencia de cromosomas rezagados en la anafase I puede deberse a la falta de tensión que las enzimas sensitivas del cinetocoro ejercen sobre las fuerzas del huso, evitando así el arrastre de los cromosomas hacia los polos, o a que al menos uno de los cromosomas esté desalineado, generando señales negativas que la célula identifica(13). También es importante mencionar que existen criterios divergentes sobre la viabilidad y latencia de la semilla de T. diversifolia. Se ha informado que el almacenamiento de la semilla y el momento de colección tienen un importante papel en la viabilidad de la semilla sexual de esta especie. Diversos autores reportaron que un almacenamiento por encima de los cuatro meses y una recolección de semilla cuando los aquenios se encuentren de color marrón puede incrementar el porcentaje de germinación hasta un 90 %(25,33). Otros autores de igual forma reportan que procesos pre-germinativos como el ácido sulfúrico y el agua a altas temperaturas por algunos minutos (80 a 100 ºC) pueden incrementar la germinación(16,19) como los utilizados en este trabajo. Mejorar la reproducción de esta especie vía semilla sexual incrementaría su potencial como arbustiva forrajera en los sistemas de producción pecuaria. Observaciones de campo indican que T. diversifolia tiene una gran capacidad para crecer clonalmente(6), pero en la actualidad se sabe que material proveniente de semilla sexual puede favorecer el desarrollo de sistemas radiculares más extensos, plantas más vigorosas, mayor persistencia en el tiempo de los cultivos y recuperación más rápida después del corte o pastoreo, aunque aún es difícil alcanzar material seminal de buena calidad(11). T. diversifolia en diferentes estudios ha sido considerada como una arbustiva forrajera de alta calidad nutricional debido principalmente a sus altos contenidos de minerales (Ca y P), PC (>20 %), carbohidratos no estructurales y porcentaje de degradación (>70 %), y a sus bajos contenidos de FDN (<45 %) y FDA (<40 %)(3,4). Los valores de PC encontrados en esta especie, son tan altos o inclusive superiores a los observados en algunas leguminosas tropicales como Stylosanthes guianensis (20 %)(34), Arachis pintoi (19.7 %)(35) y Gliricidia sepium (18.23 %)(36), y son muy superiores a los observados en la mayoría de las gramíneas tropicales, como Urochloa brizantha (9.3 %)(3) y Cynodon plectostachyus (9.23 %)(37). Además, la FDN y la FDA son menores que los valores comunes observados para forrajes tropicales(38), aspecto que probablemente no limita el consumo voluntario, la degradabilidad de los nutrientes y su potencial aprovechamiento por parte de los animales(1,3,4). Por otro lado, el consumo de T. diversifolia se ha visto asociado a incrementos de la productividad animal y de la capacidad de carga en los sistemas. En Colombia se evaluó el efecto de esta arbustiva bajo condiciones de pastoreo en la producción y calidad de la leche bovina y se halló que su consumo tuvo efectos significativos en la producción de leche observándose 9.70 y 15.4 kg leche/ha/día, respectivamente. Además, la producción de proteína, grasa y solidos totales también fue mayor cuando los animales consumieron 820


Rev Mex Cienc Pecu 2021;12(3):811-827

T. diversifolia (P<0.05)(39). Finalmente, el incremento productivo que se ha obtenido en sistemas con T. diversifolia favorece menores intensidades de emisión al disminuir las emisiones de CH4 por fermentación entérica. Los resultados no encontraron diferencias en las emisiones diarias entre dietas convencionales y dietas con 25 % de inclusión de T. diversifolia (P=0.351); sin embargo, identificaron diferencias en las emisiones por kg de peso ganado en animales en ceba (P=0.002) al pasar de 22.3 kg de CO2-eq/kg de peso ganado en la dieta con brachiarias a 14.9 kg de CO2-eq/kg de peso cuando los animales tuvieron acceso a T. diversifolia(40).

Conclusiones e implicaciones T. diversifolia tiene genotipos con fases de crecimiento y desarrollo significativamente diferentes entre ellos, modificando su momento reproductivo y de producción de semilla sexual. Según los resultados encontrados, existen genotipos con una mayor producción de semilla sexual viable por planta como los genotipos 5 y 7 evaluados en este estudio, los cuales se pueden perfilar como aquellos más adecuados para mejorar la propagación de esta especie. Si bien esta especie tiene una germinación baja (<50 %), existen procesos pre-germinativos con la capacidad de incrementar el porcentaje de germinación como el uso de agua a 80 ºC en un 15 %. También el uso de fertilizante aumenta no solo la producción de semilla viable sino también su germinación, razón por la cual puede ser una alternativa viable para tratar plantas productoras de semilla (20 % más de germinación). Finalmente, este estudio confirma que la especie T. diversifolia, posee un alto porcentaje de semillas no viables, aspecto que invita a desarrollar trabajos orientados a entender los factores responsables de este fenómeno con el fin de mejorar y facilitar su utilización, especialmente la de los genotipos destacados identificados en este trabajo, ya que esta especie ofrece un alto potencial en la alimentación animal producto de su amplia adaptación a diferentes condiciones edafoclimáticas, oferta de altos valores de PC (>20 %), bajo contenido de FDA y FDN (<20 y 40 %, respetivamente), presencia de diferentes compuestos secundarios que modifican la eficiencia fermentativa a nivel del rumen, y una alta degradación que puede estar por encima del 70 %. Agradecimientos Al proyecto Ganadería Colombiana Sostenible, financiado por Gobierno del Reino Unido y el Fondo Mundial para el Medio Ambiente, por aportar recursos necesarios para las evaluaciones y recolección de materiales. También, al predio El Porvenir por permitir llevar a cabo las evaluaciones en sus instalaciones, así como a Miniciencias en su convocatoria de Doctorados Nacionales 727 de 2015.

821


Rev Mex Cienc Pecu 2021;12(3):811-827

Literatura citada: 1. Barahona R, Sánchez S. Limitaciones físicas y químicas de la digestibilidad de pastos tropicales y estrategias para aumentarla. Cienc Tecnol Agropec 2005;6(1):69-82. https://dialnet.unirioja.es/servlet/articulo?codigo=5624715. 2. Schultze-Kraft R, Rao IM, Peters M, Clements RJ, Bai C, Liu G. Tropical forage legumes for environmental benefits: An overview. Trop Grassl 2018;6(1):1–14. http://www.tropicalgrasslands.info/index.php/tgft/article/view/394/241. 3. Ribeiro RS, Terry SA, Sacramento JP, Silveira S, Bento CB, Silva EF, et al. Tithonia diversifolia as a supplementary feed for dairy cows. PloS One 11 2016;e0165751. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5132235/ 4. Mauricio RM, Calsavara LHF, Ribeiro RS, Pereira LGR, Freitas DS, Paciullo DS, et al. Feeding ruminants using Tithonia diversifolia as forage. JDVAR 2017;5(4):00146. http://medcraveonline.com/JDVAR/JDVAR-05-00146.php. 5. Rivera JE, Chará J, Gómez-Leyva JF, Ruíz TE, Barahona R. Variabilidad fenotípica y composición fitoquímica de Tithonia diversifolia A. Gray para la producción animal sostenible. Livest Res Rural Dev 2018;30, Article #200. http://www.lrrd.org/lrrd30/12/rive30200.html . 6. Ruiz TE, Febles G, Díaz H, Achang G. Efecto de la sección y el método de plantación del tallo en el establecimiento de Tithonia diversifolia. Rev Cubana Cienc Agr 2009;43(1):91-96. https://www.redalyc.org/pdf/1930/193015398016.pdf . 7. Obukohwo E, Umar B. Seed production, germination, emergence and growth of Tithonia diversifolia (HEMSL) A. Gray as influenced by different sowing depths and soil types. Am Eurasian J Agric Environ Sci 2014;14(5):440-444. https://www.idosi.org/aejaes/jaes14(5)14/9.pdf . 8. Pérez A, Montejo I, Iglesias J, López O, Martín GJ, García DE, Milián I, Hernández A. Tithonia diversifolia (Hemsl.) A. Gray. Pastos y Forrajes 2009;32(1):1–15. http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S0864-03942009000100001. 9. Chagas-Paula DA, Oliveira RB, Rocha BA, Da Costa FB. Ethnobotany, chemistry, and biological activities of the genus Tithonia (Asteraceae). Chem Biodivers 2012;9(2):210235. 10. Alcorcés N, Lárez A, Mayz J. Adiciones al conocimiento citogenético de Tithonia diversifolia (Hemsl.) A Gray (Asteraceae). Acta Bot Venez 2007;30(2):267–275. http://ve.scielo.org/scielo.php?script=sci_arttext&pid=S0084-59062007000200001.

822


Rev Mex Cienc Pecu 2021;12(3):811-827

11. Romero O, Galindo A, Murgueitio E, Calle Z. Primeras experiencias en la propagación de botón de oro (Tithonia diversifolia, Hemsl. Gray) a partir de semillas para la siembra de sistemas silvopastoriles intensivos en Colombia. Subtrop Agroecosystems 2014;17,524–528. https://pdfs.semanticscholar.org/3dff/1f62f0898f9df00e320078b4b8ba80864462.pdf. 12. Ruiz TE, Febles GJ, Alonso J, Crespo G, Valenciaga N. Agronomy of Tithonia diversifolia in Latin America and the Caribbean región. In: Savon LL, Gutierrez O, Febles F, editors. Mulberry, moringa and tithonia in animal feed, and other uses. Results in Latin America and the Caribbean. ICA / EDICA. La Habana, Cuba; 2017:171-20. 13. Taylor S, Scott M, Holland A. The spindle checkpoint: a quality control mechanism which ensures accurate chromosome segregation. Chromosome Res 2004;12:599-616. https://link.springer.com/article/10.1023/B:CHRO.0000036610.78380.51. 14. Rivera JE, Gómez-Leyva JF, Castaño K, Morales JG, Chará J, Barahona R. Diversidad molecular, química y morfológica en materiales de Tithonia diversifolia (hemsl.) Gray para la alimentación animal en Colombia y México. En: Chará J, et al editores. Congreso Internacional Sobre Sistemas Silvopastoriles. Manizales, Colombia. 2017:249–255. 15. Holdridge LR. Ecología basada en zonas de vida. Leslie Holdridge. IICA. San José, Costa Rica. 1986. 16. Akinola JO, Larbi A, Farinu GO, Odunsi AA. Seed treatment methods and duration effects on germination of wild sunflower. Exp Agric 2000;36:63–69. 17. Agboola DA, Idowu WF, Kadiri M. Seed germination and seedling growth of the Mexican sunflower Tithonia diversifolia (Compositae) in Nigeria, Africa. Rev Bio Trop 2005;54(2):395-402. https://www.scielo.sa.cr/scielo.php?script=sci_arttext&pid=S003477442006000200017 18. Nasreen S, Khan MA, Uddin S. Response of sunflower to various pre-germination techniques for breaking seed dormancy. Pak J Bot 2015;47(2):413-416. 19. Muoghalu JI, Chuba DK. Seed germination and reproductive strategies of Tithonia diversifolia (Hemsl.) A. Gray and Tithonia rotundifolia (P.M.) Blake. Appl Ecol Environ Res 2005;3(1):39-46. http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.541.352&rep=rep1&type=pd f 20. Santos-Gally R, Muñoz M, Franco G. Efecto de la latencia sobre la germinación de Tithonia diversifolia (Asteraceae). En: Rivera J, et al, editores. Congreso internacional sobre sistemas silvopastoriles: por una producción sostenible. Libro de Actas. Editorial CIPAV, Cali. 2019:417–425. 823


Rev Mex Cienc Pecu 2021;12(3):811-827

21. Botero J. Potencial de extracción y utilización de nutrientes de Tithonia diversifolia y su relación con el rendimiento y calidad nutricional. [tesis doctorado]. Palmira, Colombia. Universidad Nacional de Colombia; 2017. http://bdigital.unal.edu.co/56938/2/2021-Julian_Mauricio_Botero.pdf. 22. RStudio Team. RStudio Version 1.1.447: Integrated Development for R. RStudio, Inc., Boston, MA. 2019. https://rstudio.com/. 23. Saavedra S. Fenología y fisiología de semillas de botón de oro Tithonia diversifolia (Hemsl.) Gray. [Tesis maestría]. Medellín, Colombia. Universidad Nacional de Colombia 2016 http://www.bdigital.unal.edu.co/55663/1/1128408177.2016.pdf 24. Márquez F, Sánchez J, Urbano D, Dávila C. Evaluación de la frecuencia de corte y tipos de fertilización sobre tres genotipos de pasto elefante (Pennisetum purpureum). Zootec Trop 2007;25(4):253-259. http://ve.scielo.org/scielo.php?script=sci_arttext&pid=S0798-72692007000400003. 25. Partey SY. Effect of pruning frequency and pruning heighton the biomass production of Tithonia diversifolia (Hemsl)A. Gray. Agrofor Syst 2011;83:181–187. 26. Rodríguez I, Padilla C, Ojeda M. Características de la germinación de la semilla gámica de Tithonia diversifolia (Hemsl.) Gray y su comportamiento en condiciones de vivero. Livest Res Rural Dev 2019;31, Article #69. http://www.lrrd.org/lrrd31/5/idalma31069.html. 27. Ruíz TE, Febles G, Torres V, González J, Achan G, Sarduy L, Díaz H. Evaluación de materiales recolectados de Tithonia diversifolia (Hemsl.) Gray en la zona centrooccidental de Cuba. Rev Cubana Cienc Agríc 2010;44:291–296. https://biblat.unam.mx/hevila/Revistacubanadecienciaagricola/2010/vol44/no3/13.pdf 28. Rodríguez I, Padilla C, Torres V. Evaluación de tres métodos de poda de Tithonia diversifolia (Hemsl.) Gray bajo condiciones de pastoreo. Livest Res Rural Dev 2020; 32, Article #73. from http://www.lrrd.org/lrrd32/5/idal32073.html. 29. Ruiz TE, Febles G, Achan G, Díaz H, González J. Capacidad germinativa de semilla gámica de materiales colectados de Tithonia diversifolia (Hemsl.) Gray en la zona centrooccidental de Cuba. Livest Res Rural Dev 2018;30, Article #81. http://www.lrrd.org/lrrd30/5/ruiz30081.html. 30. Wang SH, Sun WB, Cheng X, Yang YM. Reproductive characteristics of Tithonia diversifolia and its geographical spread in Yunnan Province of South-West China. Acta Entomol Sin 2008;28(3). https://www.researchgate.net/publication/288293086.

824


Rev Mex Cienc Pecu 2021;12(3):811-827

31. González F, Rudall P, Furness C. Microsporogenesis and systematics of Aristolochiaceae. Bot J Linn Soc 2001;137:221-242. https://academic.oup.com/botlinnean/article/137/3/221/2557156 . 32. Mendes-Bonato AB, Junqueira R, Pagliarini MS, Valle CB Oliveira MI. Unusual cytological patterns of microsporogenesis in Brachiaria decumbens abnormalities in spindle and defective cytokinesis causing precocious cellularization. Cell Biol Int 2002; 26 (7):641-646. https://www.sciencedirect.com/science/article/abs/pii/S1065699502909297 33. Padilla C, Rodríguez I, Ruiz TE, Herrera M. Determinación del mejor momento de cosecha de semilla gámica, Tithonia diversifolia (Hemsl.) Gray. Livest Res Rural Dev 2018;30, Article #71. http://www.lrrd.org/lrrd30/4/idal30071.html. 34. La OO, González H, Vásquez M C, Estrada A. Composición química, digestibilidad ruminal in situ y fraccionamiento proteico de Stylosanthes guianensis. Ciencia en la frontera: revista de ciencia y tecnología de la UACJ 2018;15(2):29–35. http://erevistas.uacj.mx/ojs/index.php/cienciafrontera/article/view/2890. 35. Khan MT, Khan NA, Bezabih M, Qureshi M S, Rahman, A. The nutritional value of peanut hay (Arachis hypogaea L.) as an alternate forage source for sheep. Trop Anim Health Prod 2013;45:849–853. 36. Silva SF, Carneiro MS, Edvan RL, Pereira ES, Neto L, Pinto AP Camilo D. Agronomic characteristics and chemical composition of Gliricidia sepium grown under different residual heights in different seasons. Cienc Investing Agrar 2017;44(1):35-42. 37. Montoya E, Barahona R, Chará J. The nutritional balance of early lactation dairy cows grazing in intensive silvopastoral systems. Ciênc Anim Bras 2017;18:1-12. https://www.scielo.br/scielo.php?script=sci_arttext&pid=S1809-68912017000100218. 38. Souza LF, Mauricio RM, Gonçalves L C, Saliba EOS, Moreira GR. Produtividade e valor nutritivo da Brachiaria brizantha cv. Marandu em um sistema silvipastoril. Arq Bras Med Vet Zootec 2007;59(4):1029-1037. https://www.scielo.br/scielo.php?script=sci_arttext&pid=S0102-09352007000400032. 39. Rivera JE, Cuartas CA, Naranjo JF, Tafur O, Hurtado EA, Arenas FA, Chará J, Murgueitio E. Efecto de la oferta y el consumo de Tithonia diversifolia en un sistema silvopastoril intensivo (SSPi), en la calidad y productividad de leche bovina en el piedemonte Amazónico colombiano. Livest Res Rural Dev 2015;27, article #189. http://www.lrrd.org/lrrd27/10/rive27189.html.

825


Rev Mex Cienc Pecu 2021;12(3):811-827

40. Molina IC, Donneys G, Montoya S, Villegas G, Rivera JE, Chará J, Barahona R. Emisiones in vivo de metano en sistemas de producción con y sin inclusión de Tithonia diversifolia. Congreso Nacional de Sistemas Silvopastoriles y Congreso Internacional de Sistemas Agroforestales. Puerto Iguazú, Misiones, Argentina, 2015:678-682.

826


Cuadro 2: Fases de desarrollo agronómico y producción de semilla sexual de diferentes genotipos de Tithonia diversifolia Tratamientos-Genotipos Fert Ge Fert EEM Parámetro 1 2 3 4 5 6 7 No Si P-value a a ab c bc ab bc Fase vegetativa, días 86.8 84.2 80.6 74.3 76.2 80.7 76.3 77.1 82.4 <0.001 <0.001 0.92 a ab ab ab ab b ab Fase reproductiva, días 31.8 29.2 28.8 31.5 29.3 27.5 31.3 29.9 30 0.022 0.845 0.4 Secado de aquenios, días 21.8 21.7 22.7 21.5 23.3 23.3 21.7 22.7 21.7 0.67 0.134 0.36 a ab bc c bc bc bc Fase de floración, días 140 135 132 127 129 131 129 130 134 <0.001 0.001 0.91 b a ab ab a ab a Cabezuelas por planta, # 32.1 62.9 46.1 53.6 70.1 45.1 71.9 36.3 72.7 0.002 <0.001 4.14 c ab bc ab ab ab c Semillas por cabezuela, # 142 155 149 152 153 156 164 147 159 <0.001 <0.001 1.59 c ab bc abc ab bc a Semillas por planta, # 4,668 10,112 6,958 8,238 10,908 7,217 11,946 5,460 11,697 <0.001 <0.001 713 b a b a a ab Semillas llenas, % 63.5 69.5 62.3 71.3 69.3 67.0 62.7b 65.5 67.5 0.025 0.244 0.91 ab ab a b b ab a Semillas vacías, % 23.1 22.8 25.0 20.0 20.8 22.8 25.7 21.5 24.3 0.041 0.006 0.56 Semillas rudimentarias, % 13.5 7.67 12.7 8.83 9.83 10.2 11.7 11.1 10.2 0.059 0.418 0.56 Fert= fertilización; Ge= genotipos, EEM= error estándar de la media. abc Letras diferentes en una misma fila denotan diferencia (P<0.05).

Tr 1 2 3

Cuadro 3: Porcentaje de germinación de la semilla sexual de diferentes genotipos de Tithonia diversifolia Genotipos (Ge) Fert Ge Fert 1 2 3 4 5 6 7 No Si p- value b a a a a a a 32.6 45.4 54.1 45.8 47.7 53.9 48.6 42.6 51.1 0.001 0.002 b a a a a a a 39.5 51.6 58.2 54.1 52.9 62.2 56.9 46.9 59.7 0.001 0.001 c abc a ab c a abc 17.5 22.3 31.9 30.3 19.7 31.8 26.9 23.7 30.2 0.001 0.025

EEM 1.52 1.89 1.31

Tr=Tratamiento; EEM= error estándar de la media; Fert= fertilización; Tr 1= sin tratamiento previo; Tr 2= agua a 80 ºC por 10 min; Tr 3= inmersión en ácido sulfúrico al 50%. abc Letras diferentes en una misma fila denotan diferencia (P<0.05).

811 827


https://doi.org/10.22319/rmcp.v12i3.5742 Artículo

Estructura del pasto forrajero con cultivares de Urochloa brizantha bajo sombra

Estella Rosseto Janusckiewicz a* Luísa Melville Paiva a Henrique Jorge Fernandes a Alex Coene Fleitas b Patricia dos Santos Gomes a

a

State University of Mato Grosso do Sul. University Unit of Aquidauana, Rodovia Graziela Maciel Barroso, Km 12 Zona Rural, 79200000, Aquidauana, MS, Brazil. b

Federal University of Mato Grosso do Sul. Faculty of Veterinary Medicine and Animal Science, Campo Grande, MS, Brazil.

* Autor de correspondencia: estella_rosseto_janusckiewicz@yahoo.com.br

Resumen: Este estudio evaluó la estructura de pastos sembrados con Urochloa brizantha cv. BRS Paiaguas y BRS Piata bajo el sistema de sombra de eucalipto, fertilizados vía foliar al inicio de las temporadas seca y lluviosa. El experimento siguió un diseño de bloques al azar con un arreglo factorial de 4×2×2 (4 niveles de fertilizantes foliares × 2 sistemas × 2 temporadas). Los resultados se analizaron utilizando el GLIMMIX PROC de la Universidad SAS, mientras que las medias se compararon mediante la prueba de t al 5 %. El fertilizante foliar tuvo un efecto significativo (P≤0.05) en la producción de brotes del cv. BRS Paiaguas bajo sombra, mientras que los niveles de 3 y 6 L/ha produjeron las menores masas (P≤0.05). Las masas del forraje y raíz fueron afectadas significativamente (P≥0.05) por los sistemas y las temporadas, mientras que la masa de la materia muerta no fue influenciada por las temporadas. El sistema de sombra resultó en una masa de la materia muerta significativamente menor (P≤0.05) para ambos cultivares y masas de hojas y tallos mayores (P≤0.05) para el cv. BRS Piata. En la temporada de lluvias, las masas de hojas y tallos fueron mayores (P≤0.05). La fertilización foliar con hasta 6 L/ha

828


Rev Mex Cienc Pecu 2021;12(3):828-844

favoreció el control del tallo en el cv. BRS Paiaguas bajo sombra. Las masas resultantes de forraje, materia muerta y raíz permiten concluir que los cultivares se adaptaron bien a la sombra y a la temporada seca. Palabras clave: Brachiaria brizantha, Fertilizante foliar, Pleno sol, Temporadas, Sistema silvopastoril.

Recibido: 23/07/2020 Aceptado: 04/02/2021

Introducción Desde el punto de vista de la sostenibilidad, los sistemas silvopastoriles son importantes por ser una herramienta valiosa para ayudar a la recuperación de pastizales degradados. El proceso de degradación de los pastizales está relacionado con el deterioro físico y químico del suelo que puede reducirse o evitarse cuando se introducen árboles para reducir el impacto de la lluvia en el suelo y la velocidad del viento en la zona, además de ayudar a mantener y mejorar las propiedades físicas del suelo(1). Además, el gobierno brasileño se ha comprometido a reducir las emisiones de gases de efecto invernadero previstas para 2020 entre el 36.1 % y el 38.9 %, y a aumentar el uso de tecnologías para la recuperación de pastizales degradados y la integración de la agricultura, la ganadería y la silvicultura, entre otros compromisos(2). La presencia de árboles altera el microclima, reduciendo la radiación solar y la temperatura y aumentando la humedad del aire y el suelo(1). Así, según los autores, las condiciones ambientales del suelo y su interfaz con la hojarasca mejoran la actividad microbiológica y la tasa de mineralización de los nutrientes. Los pastizales bien establecidos y manejados pueden contribuir a aumentar la tasa de secuestro de C del suelo(3). En los pastizales, la sombra proporcionada por los árboles proporciona un ambiente animal, disminuyendo el estrés térmico y mejorando el rendimiento animal(4). En cuanto al pasto, el sombreado en torno al 35 % aumenta el contenido de proteína cruda, reduce el contenido de fibra detergente neutro y aumenta la digestibilidad de la pasto que crece bajo el dosel de los árboles(5). Además, se producen cambios en la cantidad de clorofila. Oliveira et al(6) observaron un aumento en los niveles de clorofila a en plantas de sombra de Panicum maximum cv. Tanzania y Andropogon gayanus cv. Planaltina, en relación con el pleno sol. Sin embargo, las ventajas de los árboles en la producción de pasto dependen del grado de sombreado, que varía mucho dependiendo de la edad, el espaciamiento y el arreglo del componente árbol(7).

829


Rev Mex Cienc Pecu 2021;12(3):828-844

Aunque no se seleccionan para este propósito, los principales forrajes cultivados en Brasil pueden ser utilizados en sistemas silvopastoriles(8). La respuesta del forraje a la sombra depende de la tolerancia de la planta, la arquitectura de la copa de los árboles y la fertilidad del suelo, mientras que el efecto positivo se asocia con una mayor disponibilidad de N en el suelo(1). Desde el punto de vista de la productividad, así como de la sostenibilidad ambiental y económica, la ganadería exitosa en pastizales requiere una gran atención de la fertilidad del suelo. En la literatura diversos estudios consideran la influencia de la fertilización del suelo en los parámetros morfológicos y/o productivos de los cultivares de Urochloa brizantha: nitrógeno y/o fósforo(9-14), y nitrógeno y potasio(15). Sin embargo, hay pocos estudios específicos sobre la fertilización foliar en forrajes. El manejo del forraje requiere un monitoreo cuidadoso de los parámetros estructurales importantes del pasto, como la altura del pasto, la masa del forraje, la densidad de las hojas y la cantidad, ya que afectan más a la producción de forraje y a los animales(16). La masa del tallo también es de gran importancia porque afecta el consumo animal al tiempo que disminuye el valor nutritivo del forraje disponible. Además del brote aéreo, el sistema radicular es responsable de absorber los nutrientes del suelo y de acumular las reservas orgánicas de las plantas, que son fundamentales para la recuperación de las plantas después de la defoliación. Para ello, queda clara la importancia de los sistemas silvopastoriles, así como conocer el comportamiento del forraje bajo sombra, y utilizar la fertilización foliar como técnica complementaria a la fertilización convencional. Por lo tanto, este trabajo evalúa la estructura de un pasto forrajero sembrado con Urochloa brizantha cv. BRS Paiaguas y BRS Piata fertilizados vía foliar en tres niveles diferentes y un control, bajo sombra de eucalipto y pleno sol y durante las temporadas lluviosa y seca. Los resultados deben aportar nueva información sobre el uso y manejo de los forrajes estudiados en sistemas silvopastoriles.

Material y métodos El estudio se realizó en Aquidauana, MS (20°27'S y 55°40'W, 170 m de altitud media). El clima regional es Aw (sabana tropical), según Köppen(17), y el suelo es un Ultisol de textura franco arenosa(18). Se realizaron dos experimentos simultáneos en dos zonas cada uno, el primero bajo un sistema de sombra de eucalipto y otro a pleno sol (control). Los forrajes evaluados fueron Urochloa brizantha (Hochst. ex A. Rich.) R.D. Webster [sin. Brachiaria brizantha (Hochst. ex A. Rich.) Stapf.] cv. BRS Paiaguas y cv. BRS Piata. Cada cultivar fue utilizado en un experimento. En 2015, se recolectaron muestras de suelo y se enviaron para su análisis químico. El suelo se preparó mediante la aplicación de 3 L/ha de glifosato, seguido de rastreo para controlar la matocompetencia en la zona. El análisis químico del suelo indicó los siguientes resultados: pH en agua 5.32; 15.85 g/dm3 de materia orgánica; 3.96 mg/dm3 de P; 0.15 cmol/dm³ de K; 1.9 cmol/dm³ de Ca; 1.0 cmol/dm³ de Mg; 0.10 cmol/dm³ de Al; 2.68 cmol/dm³ de H + Al; 3.05 cmol/dm³ suma

830


Rev Mex Cienc Pecu 2021;12(3):828-844

de bases, y 53.23 % saturación de bases. Con base en estos resultados, se aplicó piedra caliza seguida de rastreo para incorporar la cal en el suelo. En las áreas designadas para el sistema de sombra, el subsoleo se realizó en las filas de plantación de árboles de entre 30 y 40 cm de profundidad. Antes de la plantación a finales de 2015, las plántulas de eucalipto fueron tratadas con fosfato monoamónico (1.5 %) e insecticida a base de imidacloprid (0.5 %). Las plántulas de los árboles se plantaron en filas individuales de Este-Oeste, con espacio de 14 m entre filas y 3 m entre árboles. Se plantaron los clones I-144 y 1277 de híbridos Eucalyptus grandis x Eucalyptus urophylla, se fertilizaron con 80 g NPK/planta1 (06-30-06) y se regaron con aproximadamente 4 L de agua por planta. Después de 60 días, la matocompetencia se controló mediante deshierbe manual entre árboles y el cepillado mecánico entre filas. Posteriormente, los eucaliptos fueron fertilizados tres veces más con 80 g NPK/planta, a los 90 y 180 días (20-00-20), y a los 12 meses (00-00-60). Al final del período experimental, los eucaliptos tenían una altura promedio de 11.98 m (que oscilaba entre 7.92 y 14.97 m) y aproximadamente 2 años. Los pastos de los cv. BRS Paiaguas y cv. BRS Piata se sembraron en ambas áreas, en noviembre de 2016. Las áreas se dividieron en tres bloques, con cuatro unidades experimentales por bloque, dando un total de 12 unidades experimentales (10 x 9 m cada una) para cada sistema (sombra y pleno sol). Se sembraron 20 filas de forraje por unidad experimental, utilizando la cantidad en gramos recomendada. Las unidades experimentales se regaron hasta que las plantas pudieron desarrollarse sin riego y, a partir de entonces, las unidades experimentales se sometieron a cortes de uniformidad a 15 cm de altura al comienzo de cada temporada. Además, se aplicó el herbicida 2.4 D para controlar las malezas en las filas entre las unidades experimentales. El período de evaluación de agosto de 2017 a marzo de 2018 se dividió en temporadas seca (82 días de agosto a noviembre de 2017) y lluviosa (88 días de diciembre de 2017 a marzo de 2018). Las temperaturas promedio y precipitaciones acumuladas fueron de 27.2 ºC y 183.6 mm y 26.6 ºC y 673.0 mm en las temporadas seca y lluviosa, respectivamente. Además de evaluar los sistemas de sombra y pleno sol, se evaluaron tres niveles de fertilización foliar, Quimiorgen Pasto® (3, 6 y 9 L/ha) con 2 L/ha Niphokam®, y el testigo (sin fertilización foliar). El porcentaje y concentración de nutrientes de Quimiorgen pasto® fueron 20 % y 270.0 g/L de fósforo (P2O5); 0.5 % y 6.75 g/L de boro (B); 3 % y 40.5 g/L de manganeso (Mn) y zinc (Zn). Mientras que la composición de Niphokam® fue de 10 % y 135.0 g/L de nitrógeno; 8 % y 108.0 g/L de fósforo (P2O5) y potasio (K2O); 1 % y 13.5 g/L de calcio (Ca) y zinc (Zn); 0.5 % y 6.75 g/L de magnesio (Mg), boro (B) y manganeso (Mn); y 0.2 % y 2.70 g/L de cobre (Cu). El fertilizante foliar se aplicó utilizando un aspersor de mochila presurizado de CO2. La cantidad total aplicada a cada unidad experimental se calculó de acuerdo con la 831


Rev Mex Cienc Pecu 2021;12(3):828-844

calibración del equipo, considerando la recomendación 200 L/ha de jarabe (los dos fertilizantes foliares más agua) y los niveles recomendados en los tratamientos. La fertilización se realizó por la tarde para evitar las horas más calurosas del día mientras se buscaba maximizar la humedad para que el fertilizante fuera mejor absorbido por las hojas. En todas las áreas experimentales, se aplicó fertilizante al comienzo de cada temporada, una semana después del corte de uniformidad, para garantizar suficiente área de absorción de la hoja. Los parámetros estructurales evaluados fueron la altura media del forraje y la masa total del forraje, así como la masa de las hojas, el tallo, la materia muerta y la raíz. A excepción de la masa de la raíz, las evaluaciones se realizaron en intervalos de 28 días, a los 28, 56 y 84 días después de la fertilización foliar, dando un total de tres evaluaciones en cada temporada (seca y lluviosa). En la temporada seca, la fertilización foliar fue a principios de agosto y las tres evaluaciones fueron a principios de septiembre, octubre y noviembre de 2017, respectivamente. En la temporada de lluvias, la fertilización foliar fue a principios de diciembre de 2017 y las evaluaciones a principios de enero, febrero y marzo de 2018. Las muestras de raíz se recolectaron a fines de octubre de 2017 y febrero de 2018, para las temporadas seca y lluviosa, respectivamente. La altura media del pasto se midió en 20 puntos al azar que representaban la altura media de cada parcela experimental, utilizando una regla graduada en cm. Dos muestras de forraje dentro de un área de 0.0625 m² definida por un marco de metal fueron cortadas cerca del suelo. Cada muestra se dividió en dos submuestras. Se pesó una submuestra, se secó en un horno de circulación forzada a 65 ºC durante 72 h, y se volvió a pesar para obtener la materia seca total. La otra submuestra se separó en fracciones morfológicas de hoja, tallo y materia muerta, que se pesaron, se secaron en horno a 65 °C durante 72 h y se pesaron nuevamente. La masa total de forraje y las masas de los diferentes componentes morfológicos se obtuvieron a partir de los pesos frescos y secos. En cada área experimental, se recolectaron muestras de raíces en lugares que representaban la altura promedio del pasto, que se determinó el día anterior al muestreo, midiendo la altura en 20 puntos aleatorios utilizando una regla graduada en cm. Un cilindro de acero de 15 cm de altura y 15 cm de diámetro se introdujo completamente en el suelo para muestrear las raíces y las partes del brote. La primera parte de cada muestreo consistió en cortar el brote aéreo de la muestra a 5 cm del suelo, seguido de la introducción completa del cilindro en el suelo para la remoción de raíces y suelo. Estas muestras se tomaron siempre entre las 6 y las 10 h de la mañana para evitar las variaciones de los contenidos de hidratos de carbono de reserva(19) y compuestos nitrogenados(20) que se producen a lo largo del día en los órganos de acumulación vegetal. Después de la remoción, las muestras de raíz (más la base del tallo) se empacaron en bolsas de plástico y se colocaron en una caja de poliestireno con hielo para evitar pérdidas de compuestos solubles y, en consecuencia, masa, y se llevaron inmediatamente al laboratorio. Para eliminar el suelo de las raíces, cada muestra se lavó en agua corriente 832


Rev Mex Cienc Pecu 2021;12(3):828-844

sobre un tamiz de malla de 3 mm y se congeló inmediatamente(21) para su posterior secado. Después de la descongelación, las muestras se lavaron nuevamente para eliminar el suelo restante, se pesaron, se secaron a 65 °C durante 72 h y se volvieron a pesar. La masa de la raíz se determinó utilizando los pesos frescos y secos. El diseño experimental consistió en un bloque al azar con 3 bloques y 4 parcelas por bloque, para cada sistema de sombra, dando un total de 12 unidades experimentales por sistema en cada temporada. Los datos se analizaron como un arreglo factorial de 4x2x2 (cuatro niveles de fertilizante fosfatado x dos sistemas de sombra x dos temporadas anuales (lluviosa y seca)), considerando los datos recolectados en cada parcela en cada temporada, como medidas repetidas en el tiempo en la misma unidad experimental. Todas las interacciones fueron evaluadas y eliminadas del modelo cuando no fueron significativas, o se desdoblaron adecuadamente. Los datos fueron analizados utilizando el PROC GLIMMIX de la Universidad SAS (SAS Institute Inc, Cary, CA, EE. UU.) y, en su caso, se compararon las medias de mínimos cuadrados de los sistemas de sombra o las temporadas mediante el pdiff del comando LSmeans. Cuando se identificó el efecto de los niveles de fertilización, los niveles promedio de fertilización se compararon con el testigo (sin fertilización) utilizando un ajuste para la prueba de Dunnett en la opción pdiff. En este caso, los efectos lineales a cuadráticos de los niveles de fertilizantes utilizados también se evaluaron utilizando contrastes ortogonales. Se adoptó un nivel de significancia del 5 % para todos los análisis estadísticos.

Resultados La altura y masa del pasto, las masas de las hojas y de las raíces de los dos cultivares de Urochloa brizantha no fueron afectadas significativamente (P≥0.05) por los niveles de fertilizante foliar estudiados (Cuadro 1). Del mismo modo, la masa de la materia muerta del cv. BRS Paiaguas no fue modificada significativamente (P≥0.05) por los niveles de fertilizante foliar. Sin embargo, la masa de la materia muerta del cv. BRS Piata fue significativamente (P≤0.05) alterada por la interacción nivel de fertilizante foliar × días de crecimiento, que después del desdoblamiento, indicó que la masa de la materia muerta promedio fue similar (P≥0.05) entre los tratamientos en cada período: 3,937.14 kg MS/ha para el tratamiento sin fertilización y 3,738.75; 3,993.97 y 3,984.56 kg MS/ha para los 3, 6 y 9 L/ha de fertilizante foliar, respectivamente.

833


Rev Mex Cienc Pecu 2021;12(3):828-844

Cuadro 1: Altura (cm), masa del forraje (kg MS/ha), masa de las hojas (kg MS/ha), masa de la materia muerta (kg MS/ha) y masa de la raíz (kg MS/ha) de los dos cultivares, para los diferentes niveles de fertilización foliar (Media±EE) Niveles de fertilización foliar (L Quimiorgen/ha) 0 3 6 9 cv. BRS Paiaguas Altura

51.81 ± 1.74

54.62 ± 1.74

54.64 ± 1.74

52.63 ± 1.74

Masa del forraje

14,585.0 ± 758.95 4,893.58 ± 315.25 4,314.33 ± 331.99 22,335 ± 3077.19

12,838.0 ± 758.95

13,278.0 ± 758.95

16,392 ± 3077.19

13,547.0 ± 758.95 4,921.72 ± 315.25 3,812.67 ± 331.99 17,881 ± 3077.19

Masa de las hojas Masa de la materia muerta Masa de la raíz

4,728.92 ± 315.25 3,787.58 ± 331.99

4,779.61 ± 315.25 3,857.00 ± 331.99 19,955 ± 3077.19

cv. BRS Piata Altura

58.32 ± 1.60

58.13 ± 1.60

55.63 ± 1.60

55.99 ± 1.60

Masa del forraje

17,662.0 ± 931.13 6,746.17 ± 348.36 6,978.31 ± 409.71 21,813 ± 3473.95

16,012.0 ± 931.13

17,625.0 ± 931.13 6,995.42 ± 348.36 6,635.61 ± 409.71 23,146 ± 3473.95

17,496.0 ± 931.13

Masa de las hojas Masa del tallo Masa de la raiz

6,220.08 ± 348.36 6,053.64 ± 409.71 31,738 ± 3473.95

6,732.44 ± 348.36 6,778.75 ± 409.71 27,481 ± 3473.95

La masa del tallo del cv. BRS Paiaguas fue afectada significativamente (P≤0.05) por la interacción nivel de fertilizante foliar × sistema (Cuadro 2). En el sistema de sombra, la masa del tallo fue menor (P≤0.05) para 3 y 6 L/ha en comparación con 9 L/ha y el control. En el sistema de pleno sol, la masa del tallo fue similar (P≥0.05) para los niveles de fertilizante foliar y el control. Por otro lado, la masa del brote del cv. BRS Piata no cambió significativamente (P≥0.05) para los niveles de fertilizante foliar estudiados (Cuadro 1). Cuadro 2: Masa del tallo (kg MS/ha) del cv. BRS Paiaguas en relación con la interacción nivel de fertilizante foliar × sistema (Media±EE) Niveles de fertilización foliar (L Quimiorgen/ha) 0 3 6 9 Sistema de sombra 6,818.67 ± 4,307.72 ± 4,975.33 ± 5,138.11 515.85 a 515.85 b 515.85 b 515.85 b Sistema de pleno sol 3,935.28 ± 4,334.67 ± 4,649.00 ± 4,144.44 448.77 a 448.77 a 448.77 a 448.77 a

± ±

ab

Medias en la misma fila, seguidas por letras distintas, difieren (P<0.05).

Los sistemas y temporadas tuvieron un efecto significativo (P≤0.05) en la altura del pasto del cv. BRS Paiaguas, que fue significativamente mayor en sombra en comparación con el sistema de pleno sol y en la temporada de lluvias en comparación con la temporada seca (Cuadro 3). Para el cv. BRS Piata, la altura del pasto fue afectada significativamente 834


Rev Mex Cienc Pecu 2021;12(3):828-844

(P≤0.05) por la interacción sistema × temporada. Tanto en la temporada seca como en la lluviosa, la altura del pasto fue mayor (P≤0.05) en el sistema de sombra. Cuadro 3: Altura (cm) para el cv. BRS Paiaguas en relación con los sistemas y temporadas y el cv. BRS Piata en relación con la interacción sistema × temporada (Media±EE) Sistema de sombra Sistema de pleno sol a cv. BRS Paiaguas 59.13 ± 1.23 47.72 ± 1.23 b Temporada seca Tiempo de lluvia b cv. BRS Paiaguas 34.25 ± 1.23 72.60 ± 1.23 a cv. BRS Piata Sistema de sombra Sistema de pleno sol a Temporada seca 37.87 ± 0.97 33.64 ± 0.97 b Temporada de lluvias 86.27 ± 1.43 a 70.28 ± 1.43 b ab

Medias en la misma fila, seguidas de letras diferentes, difieren según la prueba de t al 5 %.

Las masas del forraje y la raíz de los cultivares Urochloa no fueron afectadas significativamente (P≥0.05) por los sistemas de sombra y de pleno sol (Cuadro 4). Este efecto tampoco se observó (P≥0.05) en la masa de las hojas del cv. BRS Paiaguas. Los componentes morfológicos del cv. BRS Piata fueron afectados (P≤0.05) por los diferentes sistemas, resultando en masas de hojas y tallos mayores (P≤0.05) y menor masa de materia muerta (P≤0.05) en el sistema de sombra. Cuadro 4: Medias y error estándar de la media de la masa del forraje, masa de las hojas, masa de la materia muerta y masa de la raíz del cv. BRS Paiaguas y del cv. BRS Piata y masa del tallo del cv. BRS Piata, para los sistemas (kg MS/ha) Sistema de sombra Sistema de pleno sol cv. BRS Paiaguas Masa del forraje 13,900.00 ± 536.66 13,223.00 ± 536.66 Masa de las hojas 5,068.64 ± 222.91 4,593.28 ± 222.91 b Masa de la materia muerta 3,521.47 ± 234.75 4,364.32 ± 234.75 a Masa de la raíz 21,174 ± 2,175.90 17,108 ± 2,175.90 cv. BRS Piata Masa del forraje 17,787.00 ± 658.41 16,611.00 ± 658.41 a Masa de las hojas 7,034.43 ± 246.33 6,312.63 ± 246.33 b Masa del tallo 7,429.56 ± 289.71 a 5,793.60 ± 289.71 b Masa de la materia muerta 3,322.76 ± 287.71 b 4,504.44 ± 287.71 a Masa de la raíz 30,690 ± 2,456.45 21,399 ± 2,456.45 ab

Medias en la misma fila, seguidas de letras diferentes, difieren (P<0.05).

835


Rev Mex Cienc Pecu 2021;12(3):828-844

Las temporadas no tuvieron un efecto significativo (P≥0.05) en las masas del forraje, materia muerta y raíces de ambos cultivares, (Cuadro 5). Sin embargo, las masas de las hojas y tallos fueron significativamente (P≤0.05) mayores. Cuadro 5: Media y error estándar de la media de la masa del forraje, masa de las hojas, masa del tallo, masa de la materia muerta y masa de la raíz para los cultivares BRS Paiaguas y BRS Piata en las temporadas (kg MS/ha) Temporada seca Tiempo de lluvias Masa del forraje Masa de las hojas Masa del tallo Masa de la materia muerta Masa de la raíz Masa del forraje Masa de las hojas Masa del tallo Masa de la materia muerta Masa de la raíz

cv. BRS Paiaguas 11,249.00 ± 536.7 4,018.50 ± 222.91 b 3,173.93 ± 243.18 b 4,056.82 ± 234.75 16,032 ± 2,175.90 cv. BRS Piata 15,330.00 ± 658.41 6,327.14 ± 246.33 b 4,818.93 ± 289.71 b 4,184.24 ± 287.71 24,933 ± 2,456.45

15,874.00 ± 536.7 5,643.42 ± 222.91 a 6,401.87 ± 243.18 a 3,828.97 ± 234.75 22,250 ± 2,175.90 19,067.00 ± 658.41 7,019.92 ± 246.33 a 8,404.22 ± 289.71 a 3,642.97 ± 287.71 27,156 ± 2,456.45

ab

Medias en la misma fila, seguidas de letras diferentes, difieren (P<0.05).

Los días de crecimiento afectaron (P≤0.05) significativamente la altura y masa de las hojas y brotes del pasto de ambos cultivares de Urochloa, pero no (P≥0.05) la masa del forraje (Cuadro 6). A medida que avanzaba el período experimental, la altura del pasto aumentaba para ambos forrajes estudiados, de modo que las mayores masas de hojas y tallos se midieron (P≤0.05) en la última evaluación a los 83 días de crecimiento. La masa de la materia muerta del cv. BRS Paiaguas fue afectada (P≤0.05) por los días de crecimiento, siendo mayor (P≤0.05) a los 29 días y permaneciendo sin cambios a los 83 d. Sin embargo, para el cv. BRS Piata, como se mencionó anteriormente, después de desdoblar la interacción nivel de fertilizante foliar × días de crecimiento, no se observó ninguna diferencia significativa (P≥0.05) a lo largo de las evaluaciones.

836


Rev Mex Cienc Pecu 2021;12(3):828-844

Cuadro 6: Altura (cm), masa del forraje (kg MS/ha), masa de las hojas (kg MS/ha), y masa del tallo (kg MS/ha) y masa de la materia muerta (kg MS/ha) de los dos cultivares, en relación con los días de crecimiento (Media± EE) Días de crecimiento 29 55 83 cv. BRS Paiaguas Altura 37.97 ± 1.51 c 48.40 ± 1.51 b 73.90 ± 1.51 a Masa del forraje 10,524.00 ± 657.27 10,680.00 ± 657.27 19,481.00 ± 657.27 Masa de hojas 3,281.58 ± 273.01 b 3,538.67 ± 273.01 b 7,672.63 ± 273.01 a Masa del tallo 2,791.77 ± 297.84 b 3,515.81 ± 297.84 b 8,056.12 ± 297.84 a Masa de la materia muerta 4,450.48 ± 287.51 a 3,625.79 ± 287.51 b 3,752.42 ± 287.51 ab cv. BRS Piata Altura 42.45 ± 1.39 c 51.53 ± 1.39 b 77.07 ± 1.39 a Masa del forraje 13,977.00 ± 806.38 12,459.00 ± 806.38 25,160.00 ± 806.38 Masa de hojas 5,388.54 ± 301.69 b 4,628.52 ± 301.69 b 10,004.00 ± 301.69 a Masa del tallo 4,454.31 ± 354.82 b 4,876.69 ± 354.82 b 10,504.00 ± 354.82 a abc

Medias en la misma fila, seguidas de letras diferentes, difieren según la prueba de t al 5 %.

Discusión La mayoría de las características estructurales evaluadas de los cultivares BRS Paiaguas y BRS Piata no fueron afectadas significativamente (P≥0.05) por los tratamientos, lo que indica que los niveles de fertilizante foliar utilizados no fueron suficientes para interferir en el desarrollo del pasto. Este resultado también puede atribuirse probablemente al hecho de que la fertilización se realizó solo una vez al comienzo de cada temporada, lo que permite inferir que una mayor frecuencia de fertilización foliar puede modificar este panorama. Por otro lado, específicamente la masa del tallo del cv. BRS Paiaguas fue afectada (P≤0.05) por la interacción tratamiento × sistema, difiriendo solo en los pastos bajo sombra. La masa del tallo fue significativamente (P≤0.05) menor para los niveles de fertilización de 3 y 6 L/ha en comparación con el control, lo que permite concluir que la fertilización foliar con hasta 6 L/ha aplicada al comienzo de las temporadas puede ayudar a controlar la producción de brotes en el pasto del cv. BRS Paiaguas bajo sombra. La masa del forraje, hojas y raíces del cultivar BRS Paiaguas no fue afectada significativamente (P≥0.05) por los sistemas estudiados. Un resultado similar se observó para la masa del forraje y raíces del cultivar BRS Piata. Además, la masa de la materia muerta fue menor (P≤0.05) para los dos cultivares en el sistema de sombra. Por lo tanto, se puede inferir que los forrajes evaluados se adaptan al sombreado impuesto por el diseño silvícola (eucalipto plantado en hileras individuales de Este-Oeste, con espaciado de 14

837


Rev Mex Cienc Pecu 2021;12(3):828-844

m entre filas y 3 m entre árboles) ya que se mantuvo la productividad, con menor senescencia y muerte de diferentes partes de la planta. Asimismo, Soares et al(22) trabajaron con Pinus taeda en un arreglo similar, 15 m de espacio entre filas y 3 m entre árboles, y reportaron un contenido similar de materia seca para Urochloa brizantha cv. Marandu cultivado a pleno sol. Estos autores encontraron que la producción disminuyó con la disminución de la intensidad de la luz, especialmente para el espaciamiento de 9 m entre filas y 3 m entre árboles, correlacionando esta baja producción con menos espacio entre árboles, y la calidad y cantidad de radiación que llega al pasto. La radiación fotosintética fue tres y seis veces menor en el espaciamiento de 15 y 9 m entre filas, respectivamente, bajo la proyección de la copa que a pleno sol. Urochloa decumbens y Urochloa ruziziensis evaluadas a pleno sol y bajo 36 y 54 % de sombra mantuvieron la producción de forraje, pero redujeron el número de macollos y la masa de la raíz, con un aumento de la sombra(23). Estos autores concluyeron que ambos forrajes eran tolerantes a la sombra, pero que se debe evitar el sombreado severo porque reduce el macollaje y la masa de la raíz, lo que a la larga puede comprometer la persistencia de los pastos. Este efecto adverso del aumento de la sombra en el crecimiento de los forrajes tropicales también ha sido confirmado por otros autores. En pastos de Urochloa brizantha cv. Marandu con sombra del 50 % y 70 %, las tasas de acumulación de MS disminuyeron en un 13 % y un 60 %, respectivamente, en comparación con pleno sol(24). En pastos de Urochloa decumbens, la masa del forraje, la densidad del macollaje y el índice de área foliar disminuyeron para un 65 % de sombra, pero se mantuvieron sin cambios para un 35 % de sombra en comparación con pleno sol(5). En los pastos de BRS Piata, los sistemas tuvieron un efecto significativo (P≤0.05) en las masas de las hojas y tallos, que fueron mayores (P≤0.05) en el sistema de sombra que a pleno sol. Las plantas posiblemente alargaron sus hojas para aumentar el área de la hoja y capturar más luz, lo que contribuye al aumento de la masa de las hojas. Además, cuando entra menos luz en el pasto, las plantas alargan sus tallos para posicionar las hojas en los estratos más altos para facilitar la captura de luz incidente. La elongación del tallo contribuyó al aumento de la altura del pasto. El sombreado cambió morfológicamente el pasto de Urochloa decumbens ya que la hoja y el tallo, así como las láminas de las hojas, se alargaron(25) para aumentar la intercepción de la radiación fotosintética activa(5). Estos autores trabajaron en un consorcio de pasturas de bosque de Eucalyptus grandis y leguminosas arbóreas y reportaron mayores tasas de elongación de las hojas que a pleno sol, lo que indica alteraciones en el patrón de asignación de fotoasimilados con la consiguiente mayor área foliar para captar la luz. Las masas del forraje, materia muerta y raíces de los forrajes de BRS Paiaguas y Piata no fueron afectadas significativamente (P≥0.05) por las temporadas. Los resultados indican 838


Rev Mex Cienc Pecu 2021;12(3):828-844

que los cultivares Urochloa podrían ser utilizados durante la temporada seca, cuando el agua escasea ya que se mantuvo la producción de forraje, sin pérdidas por senescencia y muerte de tejido. La mortalidad del macollo y la reducción del área foliar debido a la senescencia acelerada de las hojas más viejas y el mayor crecimiento del sistema radicular son algunas estrategias de la planta utilizadas para limitar la superficie de transpiración y agravar la deficiencia de agua(26). La falta de resultados significativos en la masa de la raíz está probablemente relacionada con el crecimiento libre (sin corte ni pastoreo) de los pastos durante el período experimental. En ausencia de defoliación, los forrajes no necesitaron reubicar los compuestos de reserva para promover un nuevo crecimiento de la parte aérea, sin alterar, por lo tanto, el sistema radicular. La eliminación de la parte aérea estresa a las plantas en un grado directamente correlacionado con la intensidad de la defoliación(27). A medida que se utiliza la parte aérea, la fotosíntesis y la absorción de nutrientes por las raíces disminuyen para recuperar el área foliar restante, dañando el desarrollo de nuevos macollos y, en consecuencia, de las raíces(28). La velocidad de recuperación del brote aéreo y el crecimiento de la raíz dependen de mecanismos fisiológicos como el uso de reservas orgánicas(29). En ambos forrajes, las temporadas afectaron significativamente (P≤0.05) las masas de los componentes morfológicos. Las masas de hojas y tallos fueron mayores (P≤0.05) en la temporada de lluvias debido a las mejores condiciones de crecimiento proporcionadas a las plantas, especialmente las precipitaciones. El mayor desarrollo de la planta culminó en una mayor altura (P≤0.05) del pasto forrajero en esta temporada. Se espera una mayor elongación de hojas y tallos y, en consecuencia, mayores masas en condiciones climáticas que mantengan la humedad del suelo, favoreciendo el desarrollo de las plantas. En el sistema silvopastoril, Urochloa decumbens mostró tasas más bajas de elongación de hojas y tallos en invierno en comparación con otras temporadas, debido principalmente al déficit de agua y la baja temperatura(25). En Urochloa brizantha cv. Marandu, la elongación, aparición y longitud final de las hojas disminuyeron con la reducción del riego(30). Durante el estudio, la precipitación acumulada fue de 183.3 mm en la temporada seca en comparación con los 673.0 mm en la temporada de lluvias, lo que indica que la cantidad de agua afectó más la variación de las características estructurales de los pastos para los dos cultivares de Urochloa brizantha evaluados. El déficit hídrico durante la temporada seca en la mayor parte de Brasil es responsable de la estacionalidad de la producción de forraje(26). El autor señaló que la deficiencia de agua cambia la anatomía, la fisiología y la bioquímica de la planta, afecta el crecimiento de la planta en una medida que depende del grado y la duración del déficit de agua, así como de la especie de la planta. Los pastos más altos generalmente se observan bajo condiciones favorables para el crecimiento de las plantas forrajeras. En pastos de Urochloa brizantha cv. Marandu, 839


Rev Mex Cienc Pecu 2021;12(3):828-844

Setaria sphacelata cv. Kazungula y Panicum maximum cv. Tanzania que fueron cortados a los 35 días de crecimiento, se observaron mayores alturas en primavera y verano, entre diciembre y febrero(31). Los autores también observaron que la variación en las alturas de los pastos siguió el mismo comportamiento observado para la producción de materia seca en las diferentes temporadas del año. Los días de crecimiento afectaron significativamente (P≤0.05) la altura y masa de las hojas y tallos de ambos cultivares, pero no (P≥0.05) la masa del forraje. Las masas de hojas y tallos fueron más altas (P≤0.05) a los 83 días de crecimiento. Estos resultados se esperaban porque los pastos no sufrieron defoliación, causando acumulación de hojas y tallos no pastoreados. La falta de defoliación puede disminuir la capacidad fotosintética del pasto y la captura de luz. Poco después de la defoliación, la fotosíntesis disminuye, debido especialmente a la eliminación de las hojas más jóvenes de los estratos superiores, de modo que el proceso se vuelve más dependiente de hojas menos fotosintéticamente activas(29). Además, el tamaño y la actividad del aparato fotosintético están directamente relacionados con la cantidad de luz asimilada, que pasa a estar disponible para el proceso de acumulación de materia seca de los pastos. Otro punto a considerar al permitir el crecimiento libre de los pastos es el sombreado mutuo entre las plantas. En esta situación, la luz interceptada por el dosel disminuye haciendo que las plantas alarguen sus tallos hasta que las hojas se coloquen más arriba en los estratos del pasto, para aumentar la captación de luz. En consecuencia, la altura del pasto aumenta. Casagrande et al(32) observaron elongación del tallo en Urochloa brizantha cv. Marandu, a medida que aumentaba la oferta de forraje, es decir, con la reducción de la intensidad de la defoliación. Estos autores explicaron que la mayor altura del pasto en las mayores ofertas de forraje resultó en el sombreado mutuo de los macollos y competencia intensa por luz en los pastos, concluyendo que los pastos que se manejan con ofertas de forraje cercanas al 4 % PV/día tienen una menor elongación del tallo y tienden a reducir las pérdidas por senescencia.

Conclusiones e implicaciones La fertilización foliar con hasta 6 L/ha favorece el control de la producción de brotes del cv. BRS Paiaguas bajo sombra. Se sugieren estudios adicionales que utilicen una frecuencia mayor de aplicación de fertilizantes para obtener resultados concluyentes sobre el impacto de los niveles de fertilizantes foliares en otras variables estructurales de Urochloa brizantha de los cultivares BRS Paiaguas y BRS Piata. Teniendo en cuenta las masas de forraje, hojas, materia muerta y raíces, se puede afirmar que los dos cultivares están adaptados a la sombra de híbridos Eucalyptus grandis x Eucalyptus urophylla, plantados en hileras individuales de Este-Oeste, con espacio de 14 m entre filas y 3 m entre árboles, con una altura media de 11.98 m y de aproximadamente dos años de edad.

840


Rev Mex Cienc Pecu 2021;12(3):828-844

Se indica un estudio a largo plazo ya que la altura de los árboles y, en consecuencia, el nivel de sombra, cambian con el tiempo y podrían mostrar diferencias más significativas en los resultados obtenidos entre plantas con sombra y a pleno sol. Además, las masas de forraje, materia muerta, tallos y raíces indican que los forrajes estudiados toleran bien las condiciones de temporada seca, especialmente, la baja precipitación. Agradecimientos Al Consejo Nacional de Desarrollo Científico y Tecnológico (CNPq, expediente nº 454622/2014-7) y a la Fundación de Apoyo al Desarrollo de la Educación, la Ciencia y la Tecnología del Estado de Mato Grosso do Sul (FUNDECT, expediente nº 23/200.256/2014) por el apoyo financiero para el proyecto. A la Coordinación de Perfeccionamiento de Personal de Nivel Superior/Programa Nacional de Postdoctorado (CAPES/PNPD) por la beca otorgada (expediente nº 88882.317872/2013-01). A la Universidade Estadual de Mato Grosso do Sul, en Aquidauana, por ofrecer las condiciones necesarias y la oportunidad de hacer el trabajo. A Quimifol por proporcionar el fertilizante foliar. Este estudio fue financiado en parte por la Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) - Código financiero 001. Conflicto de intereses Los autores declaran que no tienen conflicto de intereses. Literatura citada: 1. Bernardino FS, Garcia R. Sistemas silvipastoris. Pesq Flor Bras 2009;(60):77-87. 2. Balbino LC, Cordeiro LAM, Martínez GB. Contribuições dos sistemas de integração lavoura-pecuária-floresta (iLPF) para uma agricultura de baixa emissão de carbono. Rev Bras Geogr Fís 2011;(6):1163-1175. 3. Rosendo JS, Rosa R. Comparação do estoque de c estimado em pastagens e vegetação nativa de Cerrado. Soc Nat 2012;(2):359-376. 4. Castro AC, Lorenço Junior JB, Santos NFA, Monteiro EMM, Aviz AB, Garcia AR. Sistema silvipastoril na Amazônia: ferramenta para elevar o desempenho produtivo de búfalos. Cienc Rural 2008;38(8):2395-2402. 5. Paciullo DSC, de Carvalho CAB, Aroeira LJM, Morenz MJF, Lopes FCF, Rossiello ROP. Morfofisiologia e valor nutritivo do capim-braquiária sob sombreamento natural e a sol pleno. Pesq Agropec Bras 2007;42(4):573-579. 6. Oliveira FLRD, Mota VA, Ramos MS, Santos LDT, Oliveira NJFD, Geraseev LC. Comportamento de Andropogon gayanus cv.‘planaltina’ e Panicum maximum cv.‘tanzânia’sob sombreamento. Cienc Rural 2013;43(2):348-354.

841


Rev Mex Cienc Pecu 2021;12(3):828-844

7. Paciullo DSC, Gomide CDM, Muller M, Pires MDFÁ, Castro CRT. Potencial de produção e utilização de forragem em sistemas silvipastoris. In: Embrapa Gado de Leite-Artigo em anais de congresso (ALICE). In: Simpósio de pecuária integrada, 1., 2014, Sinop, MT. Intensificação da produção animal em pastagens: anais. Brasília, DF: Embrapa, 2014:51-82. 8. Almeida RG, Barbosa RA, Zimmer AH, Kichel AN. Forrageiras em sistemas de produção de bovinos em integração. In: Bungenstab DJ editor. Sistemas de integração lavoura-pecuária-floresta: a produção sustentável. 2nd ed. Brasília, Distrito Federal, Brasil: EMBRAPA; 2012:88-94. 9. Martuscello JA, Faria DJG, Cunha DDNFVD, Fonseca DMD. Adubação nitrogenada e partição de massa em plantas de Brachiaria brizantha cv. Xaraés e Panicum maximum x Panicum infestum cv. Massai. Cienc Agrotec 2009;33(3):663-667. 10. Ramos SJ, Faquin V, Rodrigues CR, Silva CA, Boldrin PF. Biomass production and phosphorus use of forage grasses fertilized with two phosphorus sources. Rev Bras Cienc Solo 2009;33(2):335-343. 11. Silva CD, Bonomo P, Pires AJV, Maranhão CDA, Patês NDS, Santos LC. Características morfogênicas e estruturais de duas espécies de braquiária adubadas com diferentes doses de nitrogênio. R Bras Zootec 2009;38(4):657-661. 12. Paciullo DSC, Fernandes PB, Gomide CADM, Castro CRTD, Sobrinho FDS, Carvalho CABD. The growth dynamics in Brachiaria species according to nitrogen dose and shade. R Bras Zootec 2011;40(2):270-276. 13. Lucena Costa N, Townsend CR, Santos Fogaça FH, Magalhães JA, Bendahan AB, Seixas Santos FJ. Produtividade de forragem e morfogênese de Brachiaria brizantha cv. Marandu sob níveis de nitrogênio. Pubvet 2016;10(10):731-735. 14. Sá Medica JA, Reis NS, Santos MER. Caracterização morfológica em pastos de capim-marandu submetidos a frequências de desfolhação e níveis de adubação. Ciênc Anim Bras 2017;18:01-13. 15. Rodrigues RC, Mourão GB, Brennecke K, Luz PDC, Herling VR. Produção de massa seca, relação folha/colmo e alguns índices de crescimento do Brachiaria brizantha cv. Xaraés cultivado com a combinação de doses de nitrogênio e potássio. R Bras Zootec 2008;37(3):394-400. 16. Hodgson J. Grazing management: science into practice. Longman handbooks in agriculture. New York, USA: Longman Scientific and Technical and John Wiley; 1990. 17. Peel MC, Finlayson BL, Mcmahon TA. Updated world map of the Köppen-Geiger climate classification. Hydrol Earth Syst Sci 2007;11:1633-1644.

842


Rev Mex Cienc Pecu 2021;12(3):828-844

18. EMBRAPA. Empresa Brasileira de Pesquisa Agropecuária. Sistema Brasileiro de Classificação de Solos. Rio de Janeiro, Brasil: Embrapa/CNPS; 2013. 19. White LM. Carbohydrate reserves of grasses: a review. J Range Management 1973;26:13-18. 20. Schjoerring JK, Husted S, Mäck G, Mattsson M. The regulation of ammonium translocation in plants. J Exp Bot 2002;53(370):883-890. 21. Cecato U, Cano CCP, Bortolo M, Herling VR, Canto MWD, Castro CRDC. Teores de carboidratos não-estruturais, nitrogênio total e peso de raízes em Coastcross-1 (Cynodon dactylon (L.) Pers) pastejado por ovinos. R Bras Zootec 2001;30(3):644650. 22. Soares AB, Sartor LR, Adami PF, Varella AC, Fonseca L, Mezzalira JC. Influência da luminosidade no comportamento de onze espécies forrageiras perenes de verão. R Bras Zootec 2009;38(3):443-451. 23. Faria BM, Morenz MJF, Paciullo DSC, Lopes FCF, Gomide CAM. Growth and bromatological characteristics of Brachiaria decumbens and Brachiaria ruziziensis under shading and nitrogen. Rev Ciênc Agron 2018;49(3):529-536. 24. Andrade CMS, Valentim JF, da Costa Carneiro J, Vaz FA. Crescimento de gramíneas e leguminosas forrageiras tropicais sob sombreamento. Pesq Agropec Bras 2004;39(3):263-270. 25. Paciullo DSC, Campos NR, Gomide CAM, de Castro CRT, Tavela RC, Rossiello ROP. Crescimento de capim-braquiária influenciado pelo grau de sombreamento e pela estação do ano. Pesq Agropec Bras 2008;43(7):917-923. 26. Duarte ALM. Efeito da água sobre o crescimento e o valor nutritivo das plantas forrageiras. Revis Pesq Tecn 2012;9(2):1-6. 27. Gomide CAM, Gomide JA, Huaman CAM, Paciullo DSC. Fotossíntese, reservas orgânicas e rebrota do capim-Mombaça (Panicum maximum Jacq.) sob diferentes intensidades de desfolha do perfilho principal. R Bras Zootec 2002;31(6):2165-2175. 28. Donaghy DJ, Fulkerson WJ. Priority for allocation of water-soluble carbohydrate reserves during regrowth of Lollim perene. Grass Forage Sci 1998;53(3):211-218. 29. Corsi M, Martha Júnior GB, Pagotto DS. Sistema radicular: dinâmica e resposta a regimes de desfolha. In: Da Silva SC, Pedreira CGS editors. A produção animal na visão dos brasileiros. Piracicaba, São Paulo, Brasil: FEALQ; 2001:838-852. 30. Magalhães JA, Carneiro MDS, Andrade AC, Rodrigues BHN, Costa NDL, Santos FDS, Edvan RL. Características morfogênicas e estruturais do capim-Marandu sob irrigação e adubação. Holos 2016;8:113-124.

843


Rev Mex Cienc Pecu 2021;12(3):828-844

31. Gerdes L, Werner JC, Colozza MT, Carvalho DD, Schammass EA. Avaliação de características agronômicas e morfológicas das gramíneas forrageiras Marandu, Setária e Tanzânia aos 35 dias de crescimento nas estações do ano. R Bras Zootec 2000;29(4):947-954. 32. Casagrande DR, Ruggieri AC, Janusckiewicz ER, Gomide JA, Reis RA, Valente ALDS. Características morfogênicas e estruturais do capim-Marandu manejado sob pastejo intermitente com diferentes ofertas de forragem. R Bras Zootec 2010;39(10):2108-2115.

844


https://doi.org/10.22319/rmcp.v12i3.5375 Artículo

Características de la producción de leche en La Frailesca, Chiapas, México Joaquín Huitzilihuitl Camacho-Vera a Juan Manuel Vargas-Canales b* Leticia Quintero-Salazar c Gregorio Wenceslao Apan-Salcedo d

a

Universidad de la Sierra Sur. División de Estudios de Posgrado, Guillermo Rojas Mijangos s/n, Col. Ciudad Universitaria, 70800 Miahuatlán de Porfirio Díaz, Oaxaca, México. b

Universidad de Guanajuato. División de Ciencias Sociales y Administrativas. Departamento de Estudios Sociales. Campus Celaya-Salvatierra. Guanajuato, México. c

Coinnova Consultores S. C. Guadalajara, México.

d

El Colegio de la Frontera Sur. Departamento de Agricultura, Sociedad y Ambiente. Chiapas, México.

* Autor de correspondencia: jm.vargas@ugto.mx

Resumen: Históricamente, la región Frailesca ha sido una de las principales zonas ganaderas del estado de Chiapas, por lo que se puede intuir que la estructura actual de su sistema lechero es una buena aproximación de la del estado. Este trabajo tuvo como objetivo la caracterización y análisis de las unidades de producción que forman parte del sistema lechero de la región Frailesca con la intención de describir su estructura en cuanto a tamaño y tipo de unidades de producción. Para tal fin se utilizaron parámetros de producción, de costos de producción e indicadores de rentabilidad. Se determinaron las características principales de las unidades de producción en cuanto a su tamaño y condiciones de operación por localidad de per-

845


Rev Mex Cienc Pecu 2021;12(3):845-860

tenencia, a fin de construir una tipología de productores y de realizar un contraste por localidad. Se encontró que la estructura productiva de la región tiene como base unidades de pequeña escala que constituyen alrededor del 76.7 % del total de las unidades de la muestra, mientras que los medianos productores representan un 14.6 % del total y los grandes únicamente el 8.7 %. Entre estos tipos de productores existe una diferencia significativa en cuanto al tamaño del hato productivo, rendimiento, costos y rentabilidad. En síntesis, la estructura del sistema productivo de la región Frailesca, como otros sistemas de lechería tropical en el país, está constituida por unidades de producción de baja escala con características de unidades familiares con uso intensivo de mano de obra, bajo nivel tecnológico y altos costos de suplementación. Palabras clave: Sistema productivo lechero, Rentabilidad, Estacionalidad.

Recibido: 11/05/2019 Aceptado: 30/10/2020

Introducción El estado de Chiapas, junto con otros estados del sureste, forma parte de las entidades en donde las unidades económicas de ganadería bovina asumen un patrón de producción extensivo, de pastoreo y doble propósito(1,2,3). A lo largo de su historia como estado productor lechero, la entidad ha tenido avances dentro de las diez primeras posiciones en cuanto a su volumen de producción, aunque con incrementos menos significativos que los ocurridos en regiones con ganadería familiar (Jalisco) o intensiva (Coahuila)(4). En Chiapas, la ganadería bovina es una actividad relevante para la economía del estado y tiene una enorme importancia relativa en el sector primario. Desde el 2005, la producción de leche mantiene una ligera tendencia al alza, que ha colocado al estado como el noveno productor, aun por arriba de estados con mayores niveles de tecnificación como Hidalgo(4); no obstante que había sido una de las entidades en dónde se han reportado los menores precios pagados al productor hasta 2010. Sin embargo, a partir de ese mismo año se dio una inflexión en el comportamiento de esta variable, que marcó una modificación hacia una tendencia creciente en cuanto al ingreso real pagado al productor(4). La región Frailesca ha sido, históricamente, una de las principales zonas ganaderas chiapanecas. Para 2018, Villaflores, La Concordia y Villa Corzo, tres municipios de La Frailesca, se ubicaron dentro de los principales municipios productores de leche del estado, junto con Ocozocuatla, Tecpatan y Tapachula(4). La región concentra 10 % de las unidades

846


Rev Mex Cienc Pecu 2021;12(3):845-860

ganaderas del estado y es en la producción de leche donde tiene mayor relevancia, dado que el 20 % de las unidades con actividad lechera se ubican dentro de sus límites(5). En La Frailesca, de acuerdo con los últimos censos ganaderos, el 85 % del hato lechero se conduce bajo algún tipo de sistema de pastoreo y la restante proporción bajo estabulación(5). En la configuración actual de la cadena de valor se pueden distinguir cinco eslabones principales: proveeduría, producción, acopio, transformación y comercialización(6). El eslabón primario tiene encadenamientos comerciales hacía atrás con abastecedores locales y regionales de insumos. De estos, destacan por su importancia los relacionados con el abasto de complementos para la alimentación del ganado, en especial los productores y comercializadores de pollinaza, granos y forraje(6). Los vínculos que los productores tienen hacia “adelante” en la cadena son diversos y dependen, entre otras cosas, del tipo de unidades de producción y su situación espacial y tecnológica. El principal encadenamiento de los productores hacia adelante se lleva a cabo con un eslabón clave en la transformación: la producción de quesos. Buena parte de la producción de leche se convierte en materia prima para la industria quesera local y regional, tanto para la artesanal como para aquella con procesos industriales(6). Para profundizar en los análisis del comportamiento de los sistemas de producción de leche es necesario identificar las características de las unidades de producción lechera (UPL), lo que se hace en este trabajo mediante un análisis de conglomerados como una vía para lograr mejores explicaciones sobre la actividad económica y como un recurso para el diseño de mejores estrategias de manejo(7). El potencial de producción de las UPL en el país podría incrementarse si se generaran políticas y estrategias de intervención tecnológica diferenciadas(8). Para tal fin, una caracterización eficaz es necesaria. Si bien se han utilizado distintas variables para la tipificación de unidades de producción, las que mejores resultados aportan para el análisis de los sistemas de producción de leche son el tamaño de la unidad de producción y el nivel de producción(9). Este método de análisis, en la actualidad, es uno de los más empleados, como queda evidenciado en recientes estudios de caso de Brasil, Colombia y México(10-13), debido a que permite encontrar más relaciones entre las variables estudiadas. Lo anterior tiene especial relevancia debido a que la producción de lácteos se lleva a cabo en todas las regiones agroecológicas del país y se tienen desde las altamente tecnificadas hasta las de subsistencia(12). En ese sentido, este trabajo tuvo como objetivo realizar una caracterización de los sistemas de producción de leche en las principales localidades productoras de la región Frailesca, a través de un análisis de los principales parámetros productivos de las UPL y un análisis de los costos de producción y la relación beneficio/costo (rentabilidad) con fines comparativos.

847


Rev Mex Cienc Pecu 2021;12(3):845-860

Material y métodos Se llevó a cabo un muestreo por conveniencia en las principales localidades con producción de leche dentro de los municipios que conforman la región Frailesca. Se consideraron tres de los municipios con mayor actividad lechera: La Concordia, Villaflores y Villa Corzo. De estos municipios se seleccionaron ocho localidades de tal manera que se tuviera una adecuada representación de los sistemas productivos vinculados con la quesería artesanal y, por otra parte, aquellos más vinculados con la transformación de mayor tamaño (industrial). Las localidades seleccionadas fueron Benito Juárez, La Concordia (cabecera municipal) y Las Toronjas en el municipio de La Concordia; San Pedro Buena Vista, Revolución Mexicana y Ricardo Flores Magón para el municipio de Villa Corzo; Calzada Larga y Los Ángeles del municipio de Villaflores. En total se obtuvo información de 104 UPL (46 unidades de La Concordia, 22 de Villa Corzo y 36 de Villaflores). En cada localidad se detectaron productores reconocibles y, posteriormente, a través de la técnica de bola de nieve se dio con otros productores por referencia de los anteriores. A través de un cuestionario estructurado se obtuvo información sobre variables técnicoproductivas y económicas con respecto a las características de la producción, y la comercialización de la leche producida en las distintas localidades de la región. Las variables económicas se obtuvieron a precios del ciclo inmediato anterior, de acuerdo con la información del productor. La mayor parte de los costos variables pudieron relacionarse con el manejo mensual del hato, sin embargo, todos fueron anualizados a fin de relacionarlos con la producción y estimar los costos por vaca y por litro. El cálculo de costos incorporó la suma de la mano de obra directa; costos de alimentación, suplementación y medicamentos, costos por compra de alimentos para el hato (maíz, forraje, ensilado, concentrado y pollinaza) y otros costos directos relacionados con el manejo del hato (transportes y fletes, mantenimiento de praderas, pago de energía eléctrica, producción de forraje, renta de potreros y pago de servicios profesionales). No se tomó en cuenta la mano de obra no remunerada porque se consideró que su inclusión subestima la rentabilidad de UPL familiares. Por lo general se asume que la mano de obra no remunerada debe evaluarse en función de su costo de oportunidad en un mercado hipotético. Sin embargo, la mano de obra de mujeres, niños o adultos mayores difícilmente tiene un mercado de referencia, en ese sentido, incluir su costo como un costo de oportunidad artificial implica incorporar un sesgo negativo en el cálculo de rentabilidad. Para calcular el beneficio de las unidades de producción por la venta de leche se tomaron en cuenta los cambios estacionales en la producción y las variaciones de precios a lo largo del año, es decir, el ingreso anual se obtuvo como la suma del valor mensual de la producción.

848


Rev Mex Cienc Pecu 2021;12(3):845-860

En dicha contabilidad se consideró la estacionalidad de producción y precios enfrentados por cada unidad de producción. Se determinaron las características principales de las unidades de producción en cuanto a su tamaño y condiciones de operación a fin de construir una tipología de productores y de realizar un contraste de acuerdo con esta caracterización y a su ubicación por localidad. La información obtenida y los análisis construidos se cruzaron con información recabada a través de entrevistas focalizadas(14) con actores clave del sistema lechero de la región y del estado, a fin de contar con elementos para discutirlos e interpretarlos. Con la información recabada se realizó un análisis estadístico con el software de IBM SPSS®. Para contrastar las características de los distintos tipos de productores se realizó un análisis de conglomerados, a fin de construir una tipología basada en el tamaño de la unidad de producción. Sólo se consideró la variable tamaño, como factor de conglomeración, con el fin de tener una mejor definición de las categorías pequeño, mediano y grande que son utilizadas por las dependencias oficiales relacionadas con el sector y en la mayoría de investigaciones que buscan realizar caracterizaciones. Para este objetivo se utilizó la técnica de agrupación por vecinos más lejanos, dado que este método permite evitar inconsistencias e indefiniciones en la formación de grupos(15). El análisis de conglomerados es una técnica usada para resolver la pertenencia a grupos y ha sido usada ampliamente en la caracterización y clasificación de sistemas de producción agrícola y pecuaria(16,17). Se realizó un análisis de varianza para delimitar la existencia de diferencias por cuestión de tamaño y localidad de ubicación. Para definir los contrastes entre los grupos se utilizó una prueba de Scheffé dadas las características de disparidad en el tamaño de los grupos y la robustez de este método(18,19,20). Tanto el diseño de la investigación como el análisis de los resultados y la interpretación de la información se realizó bajo la perspectiva de un estudio de casó único con múltiples unidades de análisis(18), entendiendo que era la situación del sistema de producción de leche en La Frailesca, el objeto principal del trabajo y, por lo tanto, el caso de estudio de interés.

Resultados y discusión De acuerdo con los datos obtenidos, alrededor del 65 % de los productores de la muestra no sobrepasan tamaños de hato mayores de 15 cabezas de ganado en ordeña y un 89 % no alcanzan los 30 vientres en ordeña. El hato promedio es de 32.6 vientres productivos, dato en el que se considera también a las vacas secas no gestantes, mientras que el promedio de vacas en ordeña es de 16.37. Lo anterior puede entenderse como la expresión de una ganadería de baja escala en donde predomina la mano de obra familiar(13,21) y bajos niveles

849


Rev Mex Cienc Pecu 2021;12(3):845-860

tecnológicos. Este tipo de estructura productiva es típica de la ganadería tropical de doble propósito en el sur, sureste mexicano y Latinoamérica(11,22,23). Como resultado del proceso de conglomeración, realizado en función del número de cabezas productivas existentes en cada explotación, se definieron tres conglomerados. El primer grupo está integrado por las unidades de producción de mayor tamaño que tienen hatos en un rango entre 75 a 90 vacas productivas. Es importante mencionar que este grupo de productores obtienen los rendimientos de leche más altos de la región, significativamente mayores a la media de los rendimientos de los otros dos grupos, lo que sugiere que tienen un mejor dominio del proceso de producción o mejores condiciones para llevarlo a cabo. El segundo grupo de unidades de producción, considerado de tamaño medio, va de las 44 a 66 vacas productivas y obtienen rendimientos de leche medios. Y finalmente, el tercer grupo de unidades de producción de tamaño pequeño (el más numeroso), que oscilan entre 6 y 42 vientres productivos y obtienen los rendimientos de leche más bajos (Cuadro 1), sin embargo, estadísticamente no hay diferencia entre estos dos últimos grupos. Cuadro 1: Características del hato por tipo de unidad de producción (UPL) Carga No. de Número Vacas en Superficie Tipo UPL REND animal UPL de vacas ordeña (ha) (vacas/ha) Pequeña 80 23.3±9.1a 11.9±5.7a 6.8±3.6a 24.6±19.0a 1.52 ±1.47a Mediana 15 52.3±7.8b 25.2±11.5b 8.0±4.7a 51.4±43.7b 1.50 ±0.83a Grande

9 abc

81.7±5.3c

41.1±12.5c

9.8±6.0b

76.4±53.2c

1.79 ±1.45a

REND= rendimiento (L/vaca/día). Superíndice compartido implica que no hay diferencia significativa (P<0.05).

Esta clasificación da una mejor idea de la estructura productiva de la región y corrobora que se tiene como base a unidades de pequeña escala que constituyen alrededor del 76.7 % del total de las unidades de la muestra. Para la muestra obtenida, los medianos productores representan un 14.6 % del total y los grandes únicamente el 8.7 %. Entre estos tipos de productores existe una diferencia significativa (P<0.05) en cuanto al tamaño del hato productivo y otros parámetros como el rendimiento (no significativo entre pequeños y medianos, pero estadísticamente diferente a las unidades de producción mayores) y superficie medida en hectáreas (Cuadro 1). En cuanto a la superficie de las unidades de producción pecuaria el tamaño es muy variable, por lo que se pueden encontrar explotaciones que van desde las 2 hasta 180 ha de potreros. Sin embargo, la carga animal es similar entre pequeñas, medianas y grandes unidades de producción. Son las pequeñas las que presentan los máximos valores de carga, situación

850


Rev Mex Cienc Pecu 2021;12(3):845-860

que puede explicarse por la menor disponibilidad de tierras y la pulverización de la superficie agrícola en la región. Estas unidades de producción por lo general presentan una alta dependencia entre la disponibilidad de pastos y el nivel de producción de leche, además de una mayor incidencia de enfermedades parasitarias y menor acceso al mercado(24). Las UPL muestran una clara correlación negativa entre la superficie de potrero disponible y la carga animal a la que la someten. Es decir, cuanto menor es la superficie de potrero de la que dispone el productor mayor es la carga animal a la que somete a esa superficie. Este hecho se corrobora cuando se analiza la superficie de la que disponen los ranchos de acuerdo con la localidad en la que se asientan. Como se muestra en el Cuadro 2, tres de las localidades que cuentan con menor superficie para potrero son también las que tienen el mayor número de unidades animales por hectárea. Cuadro 2: Carga animal de las unidades de producción (UPL) según localidad Superficie promeCarga animal Rendimiento Localidad dio de UPL (ha) (UA/Ha) (L/vaca/día) a a Calzada Larga 19.68±13.65 2.3±1.5 12.22±5.4d Las Toronjas 30.80±26.33a 2.0±2.4a 7.52±6.0c Revolución Mexicana 18.50±13.24a 1.8±0.7a 7.42±1.4c Benito Juárez 36.54±45.8a 1.6±1.6a 4.96±2.4a La Concordia 32.11±26.22a 1.4±0.7a 7.21±2.9bc Sn. Pedro Buenavista 42.27±41.53a 1.3±1.0a 6.79±1.0ab Los Ángeles 53.22±30.31a 0.8±0.4a 5.51±2.1ab Ricardo Flores Magón 38.60±26.95a 0.7±0.5a 5.32±1.5ab abcd

Superíndice compartido implica que no hay diferencia significativa (P<0.05).

En el caso de la localidad Calzada Larga, las unidades podrían clasificarse como más intensivas y especializadas, de ahí que sea natural su menor superficie de potrero y sus mayores rendimientos por ordeña, rasgo que ya ha sido descrito para productores lecheros del centro de Chiapas(25) y en Colombia donde obtienen una mayor producción por animal y rendimiento por hectárea(11). En estos sistemas por lo general cuentan con tecnología más avanzada, mejoramiento genético y un suministro equilibrado de alimentos(24). Por las características extensivas del sistema lechero de La Frailesca se esperaría un bajo costo de producción en el eslabón primario, en comparación con los costos de los sistemas productivos especializados y familiares del centro y norte del país(26). No obstante, se pueden encontrar costos proporcionalmente más elevados relacionados con la alimentación del hato, debido a la orientación de los últimos años hacia la suplementación durante la ordeña.

851


Rev Mex Cienc Pecu 2021;12(3):845-860

De acuerdo con los datos obtenidos del trabajo de campo, los costos de la alimentación representan más del 60 % de los costos totales, proporción superior al 50 % reportado para los sistemas de traspatio familiares del centro y sur del país(27,28) pero por debajo del 70 % de las unidades de producción de los sistemas especializados. Esta proporción, está por arriba de los costos reportados para otros sistemas de doble propósito como el del Estado de Jalisco que se encuentra en 38.9 %(29) y a los del Estado de Veracruz de 46 %(21). De la estructura general de costos de operación de las unidades de producción pecuaria, cuatro conceptos destacan por su elevada proporción con respecto al total: los de producción de maíz, la compra de maíz molido, el pago de mano de obra y la adquisición de pollinaza, siendo este último el tercero en relevancia. Este valor refleja la importancia estructural del insumo y su enorme impacto sobre la rentabilidad de la producción lechera por la marcada estacionalidad de los precios ante la demanda de alimento durante la época de secas (Figura 1). El peso específico de la pollinaza en la alimentación del hato puede explicar en buena parte los hallazgos recientes de aflatoxinas, tanto en leche fluida como en derivados de la cadena productiva lechera chiapaneca(30,31,32), dado que este insumo está frecuentemente contaminado con dichas micotoxinas. Las excretas de aves son un insumo de introducción relativamente reciente dado que a mediados de los noventa no era parte habitual de los procesos de ganadería(33) a pesar de que ya había una avicultura desarrollada en la región(6). Figura 1: Estructura de costos de acuerdo con el tipo de unidad de producción Grande

Mediano

Pequeño

1.8 1.6

1.4 1.2 1.0 0.8 0.6 0.4 0.2

852

Serv. Vet.

Energ. Eléc.

Garrapaticidas

Insem. Artif.

Renta potreros

Otros insum.

Forraje

Prod. forraje

Concentr.

Maíz ensilado

Antib.

S. minerales

Manten. praderas

Prod. maíz

Trans. y fletes

Maíz molido

Pollinaza

0.0 Mano de obra

Miles $/vaca.año

2.0


Rev Mex Cienc Pecu 2021;12(3):845-860

Como se observa en la Figura 1, la mano de obra permanente representa el componente de mayor proporción de la estructura de costos, lo que se corresponde con las características de unidades de producción con un bajo componente tecnológico e intensiva en el uso de mano de obra. Este concepto hace referencia a los jornales pagados al responsable de la ordeña y del manejo del hato, quien frecuentemente, forma parte de la estructura familiar de la unidad de producción. Por lo anterior, es importante tomar en cuenta que este egreso generalmente es un ingreso dentro de la unidad familiar ampliada y se convierte en una estrategia de los hogares para valorizar la fuerza de trabajo de los miembros jóvenes y generar una opción laboral. Estos valores coinciden con lo encontrado por otros estudios económicos de producción de leche en el trópico mexicano con respecto a que alimentación y mano de obra son los dos componentes principales de los costos(34). En promedio, el costo de producción por litro de leche es de $4.22, lo que implica que los meses que los productores vendan su producción por debajo de este valor están incurriendo en pérdidas, situación que sucede, por lo menos, tres meses al año durante el periodo de lluvias. No obstante, el incremento de precios durante el estiaje permite que la mayoría de las unidades operen con una rentabilidad positiva y una relación beneficio costo promedio cercano a 3.1. Este índice muestra que por cada peso invertido en la explotación se obtiene ese peso más $2.1 adicional, es decir, que se cubren los costos de operación de la unidad lechera y se obtiene un excedente. Diferenciando los costos de acuerdo con el tipo de unidad de producción se perciben algunos contrastes importantes. En la Figura 1 se aprecia que los productores de menor tamaño son los que hacen un uso más intensivo de la pollinaza dentro de la alimentación de sus hatos, así como de maíz molido. Lo anterior concuerda con otros estudios para la región en donde se reconoce que la relación del consumo de maíz por parte de las UPL está en relación con la cantidad de hectáreas de pastoreo disponible, de ahí que los productores de mayor tamaño en cuanto al número de cabezas, sean también los de menor consumo de pollinaza y maíz, alimentos relacionados con sistemas más intensivos(23). Los grandes y medianos productores por su parte, también hacen uso de este recurso, sin embargo, no en la misma proporción. En cuanto a la mano de obra, los productores de mayor tamaño hacen un uso más intensivo de este recurso, lo que se refleja de manera clara en su estructura de costos. Esta fuerza de trabajo es predominantemente externa (75 %), a diferencia de las unidades productivas pequeñas y medianas en las que la mano de obra no familiar se encuentra entre el 50 % y el 25 %, respectivamente. Con los datos anteriores se puede inferir que las UPL de menor tamaño se aproximan más al comportamiento de unidades de producción de tipo familiar, mientras que las de mayor tamaño tienen más características especializadas y empresariales como lo mencionan otros autores(12,24).

853


Rev Mex Cienc Pecu 2021;12(3):845-860

La Figura 1 muestra que la pequeña producción es más frágil ante la carencia de recursos para el sustento de los hatos. Se entiende que, dada la insuficiencia de recursos por la baja superficie y calidad de pastos, tienen que recurrir a un gasto mayor para la renta de potreros y la adquisición de forraje que los realizados por productores de mayor tamaño. Por ejemplo, el costo por renta de potreros adicionales que erogan los pequeños productores es de hasta $257 por cada cabeza de ganado, monto que representa 3.7 veces más que lo gastado por los grandes productores y 6.4 veces más que los medianos. Estas condiciones son las que permiten explicar los mayores costos relativos por cabeza de ganado productiva. Mientras que unidades de producción medianas y grandes enfrentan costos de $4,371 y $4,967 anuales por vaca respectivamente, a las pequeñas les cuesta $5,815 cada vaca productiva. Como en otros sistemas productivos, el productor de escala más reducida es el que enfrenta los mayores costos de producción, tanto en términos absolutos como relativos. Esta condición se refleja tanto en el costo total anual por vaca como en el costo por litro de leche producido. A pesar de que en términos absolutos el rendimiento lechero por vaca productiva es muy similar en los tres estratos, el de menor tamaño es el que produce con costos más altos y, por lo tanto, el que recibe los menores beneficios por la venta de su producto. Los mayores costos unitarios por litro de leche implican también un mayor riesgo e incertidumbre durante la época de estiaje. El umbral de los costos encontrados se acerca a lo reportado en otros estudios para el municipio de Villa Flores y la capital del estado(35). Mientras las unidades medianas y grandes pueden soportar disminuciones de precio por debajo del rango de los $3.50 sin tener pérdidas, las pequeñas comienzan a enfrentarlas en el umbral $4.50, lo que supone que asumen este déficit por lo menos durante cinco meses al año (Cuadro 3). Aún con estas vicisitudes, la pequeña producción presenta una relación beneficio costo favorable de 1.7, que implica una ganancia de setenta centavos por cada peso invertido en la operación de la unidad. Por su parte, las explotaciones grandes y medianas tienen mejores rendimientos, destacando estas últimas con una relación beneficio costo de 2.6. Cuadro 3: Indicadores de competitividad por tipo de unidad de producción (UPL) UPL grande UPL mediana UPL pequeña a b Litros-vaca/día 9.8±6.0 8.0±4.7 6.8±3.6c Costo total, MN$ 405.60±116.9a 224.28±155.9b 126.49±112.7c Costo/vaca, MN$ 4.97±1.4a 4.37±3.2a 5.81±6.4a Costo/litro, MN$ 3.68±2.4a 3.39±1.9a 4.44±2.8a Ingreso total, MN$ 834.30±488.2a 591.23±497.6b 211.12±117.6c Relación B/C 2.1 2.6 1.7 abc

Superíndice compartido implica que no hay diferencia significativa (P<0.05).

854


Rev Mex Cienc Pecu 2021;12(3):845-860

La actual estructura de la cadena de valor de leche de bovino en La Frailesca tiene un claro predominio del eslabón de la transformación sobre el eslabón de la producción, situación normal para la constitución de la estructura de los sistemas lácteos del país(36). Esta influencia se refleja de manera muy importante en el nivel de precios pagados al productor y en la estacionalidad de estos. En cada localidad y en general en toda la región se ha constituido un oligopsonio de pocos compradores demandantes, cuyo volumen de procesamiento (y por lo tanto de compra), les da la posibilidad de influir de manera significativa en el precio de la leche en cada localidad, debido a que la industria lechera se enfoca a comprar a los productores más especializados(11), posiblemente porque producen más leche y de mayor calidad e higiene(24). Es evidente que en el sistema se refleja la histórica integración vertical de los sistemas lecheros en México, tanto de los intensivos y familiares como de sistemas lecheros tropicales(36). En cuanto a las discrepancias entre localidades los datos arrojaron diferencias significativas en los rendimientos obtenidos por las explotaciones ganaderas en función de su ubicación geográfica. De manera general, la localidad de Calzada Larga destacó por tener los mayores rendimientos lecheros de toda la muestra de la región Frailesca (Cuadro 2), lo que coincide con una diferencia significativa en cuanto a la suplementación con maíz molido y pollinaza, así como con la peculiaridad de que es la única localidad en la que se encuentra generalizada la práctica de la doble ordeña diaria. En refuerzo de la idea de una relación entre suplementación y rendimiento, las localidades con menor producción de leche por cabeza fueron, también, aquellas que presentaron un menor uso de pollinaza. De manera clara, el mayor nivel de suplementación está relacionado con mayores rendimientos y, por ende, con mayores costos. Al igual que en los rendimientos, la localidad de Calzada Larga tiene los mayores costos anuales por cabeza, resaltando la característica intensiva de su producción, pero también su mayor dependencia del uso de suplementos y su vulnerabilidad por la variación de los precios de los insumos. Por su parte, en el otro extremo, se encuentra la localidad de Los Ángeles, del municipio de Villaflores, con los costos más bajos por unidad animal y con rendimientos también bajos, aunque estadísticamente similares a la mayor parte de las localidades, pero por debajo de Calzada Larga. Sin duda, la gestión del nivel de intensidad es un factor crítico que afecta la productividad general(37); sin embargo, el productor decide qué nivel de intensidad adoptar, buscando aumentar sus ganancias y dentro de las limitaciones de los recursos disponibles en la unidad de producción(24). En cuanto a la eficiencia de las unidades de producción se puede apreciar su relación con su sistema de bajo costo. Como se observa en el Cuadro 4, las localidades con los costos más bajos son también las de mayor rentabilidad relativa medida por su relación beneficio-costo (B/C). De los contrastes B/C resalta que, las explotaciones con mayores costos de 855


Rev Mex Cienc Pecu 2021;12(3):845-860

suplementación son las que muestran menor eficiencia en el uso de los recursos, sin embargo, sus altos rendimientos, redundan en mayores ingresos generándoles los mayores beneficios absolutos. En otras palabras, son menos eficientes (dado que tienen las menores relaciones B/C) pero, gracias a sus altos volúmenes de producción, generan los mayores ingresos a las unidades familiares. Cuadro 4: Indicadores económicos de las unidades de producción (UPL) por localidad Ingreso promedio Costo promedio por Localidad Relación B/C por UPL (MN$) UPL (MN$) Ricardo Flores Magón 138.49±57.4a 50.64±61.7a 5.72±5.1a Los Ángeles 248.77±99.9ab 93.90±57.5a 4.03±3.8 ab Benito Juárez 247.98±398.5ab 104.91±108.3a 2.94±2.2 ab Las Toronjas 201.23±160.2a 87.26±81.6a 3.07±2.0ab Sn. Pedro Buenavista 403.34±249.8ab 198.56±160.4ab 5.20±6.4ab La Concordia 357.74±223.3ab 194.59±99.5ab 1.97±0.9 ab Calzada Larga 587.78±485b 325.77±178.14b 1.73±0.7b Revolución Mexicana 251.69±130.3ab 199.80±87.9ab 1.32±0.6b abcd

Superíndice compartido implica que no hay diferencia significativa (P<0.05).

Conclusiones e implicaciones La estructura del sistema productivo de la región Frailesca está constituida por unidades de producción de baja escala con características de unidades familiares, con uso intensivo de mano de obra y bajo nivel tecnológico. En la región se ha constituido un oligopsonio de pocos compradores, lo que les da la posibilidad de influir de manera significativa en el precio de la leche. La producción de leche se puede calificar como rentable en general, tanto para las unidades de menor tamaño como para las más grandes. La diferencia entre las UPL es muy marcada en función de la localidad. Aquellas con sistemas de producción más intensivos están más ligadas a industrias transformadoras de mayor tamaño. En contraparte, las de menores dimensiones están más vinculadas con sistemas de transformación de naturaleza artesanal. Agradecimientos A las instituciones de educación e investigación, a las organizaciones la sociedad civil, a las instituciones de gobierno, al sector privado y sobre todo a los productores de la cadena de valor de leche de la región La Frailesca, Chiapas, por su total disponibilidad para brindar la información para el desarrollo de la presente investigación. Parte de este estudio ha sido posible gracias al apoyo de los Estados Unidos a través de la Agencia de los Estados Unidos para el Desarrollo Internacional (USAID) bajo los términos de su Acuerdo de

856


Rev Mex Cienc Pecu 2021;12(3):845-860

Cooperación No. AID-523-A-11-00001 (Proyecto de Reducción de Emisiones por la Deforestación y la Degradación de Bosques de México) implementado por el adjudicatario principal The Nature Conservancy y sus socios (Rainforest Alliance, Woods Hole Research Center y Espacios Naturales y Desarrollo Sustentable). Literatura citada: 1. Vera R, García O, Botero R, Ullrich C. Producción de leche y reproducción en sistemas doble propósito: Algunas implicancias para el enfoque experimental. Past Trop 1994;18(3):25-32. 2. Cortés H, Aguilar C, Vera R. Sistemas bovinos doble propósito en el trópico bajo de Colombia, modelo de simulación. Arch Zootec 2003;52(197):25-34. 3. Orantes MÁ, Platas D, Córdova V, De los Santos MC, Córdova A. Caracterización de la ganadería de doble propósito en una región de Chiapas, México. Ecosist Recur Agropecu 2014;1(1):49-58. 4. SIAP. 2018. Servicio de Información Agroalimentaria y Pesquera. Datos abiertos. Estadísticas de producción pecuaria 2018. 5. INEGI. 2007. Instituto Nacional de Estadística y Geografía. Censo Agropecuario 2007, VIII Censo Agrícola, Ganadero y Forestal. 6. Camacho VJH, Vargas CJM, Quintero SL, Apan SGW. Evolución del sistema productivo de leche de bovino en La Frailesca, Chis. Rev Geograf Agríc 2018;(61):67-84. 7. Bonora F, Benni S, Barbaresi A, Tassinari P, Torreggiani D. A cluster-graph model for herd characterization in dairy farms equipped with an automatic milking system. Biosyst Eng 2018;167:1-7. 8. Cuevas-Reyes V, Rosales-Nieto C. Characterization of the dual-purpose bovine system in northwest Mexico: producers, resources and problematic. Rev. MVZ Córdoba 2018;23(1):6448-6460. 9. Bedoya ODM, Cassoli LD, Ángel MO, Muñoz MFC. Caracterización de sistemas de producción lechera de Antioquia con sistemas de ordeño mecánico. Livest Res Rural Dev 2018;30:1-10. 10. Kuwahara KC, Damasceno JC, Bánkuti FI, Prizon RC, Rossoni DF, Eckstein II. Sustainability and typology of dairy production systems. Semina: Ciênc Agrár 2018;39(5):2081-2092.

857


Rev Mex Cienc Pecu 2021;12(3):845-860

11. Nivia A, Beltrán E, Marentes D, Pineda A. Caracterización técnico-administrativa de los sistemas de producción bovino de leche de pequeña escala en una región central de Colombia. Idesia 2018;36(2):259-268. 12. Koerich G, Damasceno JC, Bánkuti FI, Parré JL, Santos GTD. Influence of forage production area, concentrate supply, and workforce on productive results in milk production systems. R Bras Zootec 2019;48:e20170177. 13. Albarrán-Portillo B, García-Martínez A, Ortiz-Rodea A, Rojo-Rubio R, VázquezArmijo JF, Arriaga-Jordán CM. Socioeconomic and productive characteristics of dual purpose farms based on agrosilvopastoral systems in subtropical highlands of central Mexico. Agroforest Syst 2019;93(5):1939-1947. 14. Merton R, Marjorie F, Kendall P. Propósitos y criterios de la entrevista focalizada. EMPIRIA 1998;(1):215-227. 15. Hair JF, Anderson RE, Tatham RL, Black WC. Análisis multivariante, 5a ed. Prentice Hall, Iberia, Madrid, España, 1999. 16. Viera GG, Viera RG, Olivera RMP, Morales A. Clasificación dinámica de los sistemas de producción lechera de la cuenca Camagüey-Jimaguayú, Cuba. Rev Prod Anim 2004;16(1):17-26. 17. Forclaz MA, Mazza SM, Giménez LI. Clasificación de los sistemas de producción algodonera en la provincia del Chaco, mediante el uso de análisis de conglomerados. RIA. Rev Investig Agropecu 2004;33(3):15-25. 18. Yin R. Case study research: Design and methods. USA: Sage Publications; 1994. 19. Stake R. Investigación con estudio de casos. España, Ediciones Morata, 1998. 20. Gundermann H. El método de los estudios de caso. Tarrés ML (coord.). Observar, escuchar y comprender sobre la tradición cualitativa en la investigación social, México: Facultad Latinoamericana de Ciencias Sociales; 2004. 21. Cervantes EF, Santoyo CH, Álvarez MA. Lechería familiar, factores de éxito para el negocio. UACh/CIESTAAM-PIAI, México, Plaza y Valdés, 2001. 22. Vilaboa J, Díaz P, Ruiz O, Platas DE, González S, Juárez F. Caracterización socioeconómica y tecnológica de los agroecosistemas con bovinos de doble propósito de la región del Papaloapan, Veracruz, México. Trop Subtrop Agroecosystems 2009;10(1):5362.

858


Rev Mex Cienc Pecu 2021;12(3):845-860

23. Cuevas V, Loaiza A, Espinosa JA, Vélez A, Montoya MD. Tipología de las explotaciones ganaderas de bovinos doble propósito en Sinaloa, México. Rev Mex Cienc Pecu 2016;7(1):69-83. 24. Ramírez-Rivera EJ, Rodríguez-Miranda J, Huerta-Mora IR, Cárdenas-Cágal A, JuárezBarrientos JM. Tropical milk production systems and milk quality: a review. Trop Anim Health Prod 2019;51(6):1295-1305. 25. Castro HG, Tewolde AM, Toral JN. Análisis de los sistemas ganaderos de doble propósito en el centro de Chiapas, México. Arch Latinoam Prod Anim 2002;10(17):5-183. 26. Carranza RG, Macedo R, Cámara J, Sosa J, Meraz AJ, Valdivia AG. Competitividad en la cadena productiva de leche del estado de Aguascalientes, México. Agrociencia 2007;41(6):701-709. 27. García LA. Estrategias de las agroindustrias lecheras latinoamericanas: Estudio comparativo ante el proceso de globalización económica. Rev Mex Agronegocios 2001;5(9):263-273. 28. Vázquez E, Aguilar U, Villagómez JA. Comparación de la eficiencia productiva y económica de grupos ganaderos organizados de doble propósito y de lechería familiar/semiespecializada. Ciencia Administrativa 2016;1:226-237. 29. Lara D, Mora JS, Martínez MA, García G, Omaña JM, Gallegos J. Competitividad y ventajas comparativas de los sistemas producción de leche en el estado de Jalisco, México. Agrociencia 2003;37(1):85-94. 30. Vázquez JA, Herrera JG, Ruíz B, Ortega ME, Barreras A, Rojas RI. Niveles de aflatoxinas en alimento y leche cruda en ranchos de la región centro de Chiapas. Ciencia e Innovación 2018;1(1):155-164. 31. Ruíz JL, Gutiérrez R, Orantes MA, Manzur A. Contaminación por micotoxinas de la leche y derivados lácteos. Quehacer Científico en Chiapas 2017;12(1):90-102. 32. Gutiérrez R, Vega S, Pérez JJ, Ruiz JL, Yamazaki A, Rivera JG, Urbán G, Escobar A. Evaluación de aflatoxina M1 en leche orgánica producida en Tecpatán, Chiapas, México. Rev Salud Anim 2013;35(1):33-37 33. Álvarez A, Barajas V, Montaño E. La reorganización del sistema lechero inducida por la Nestlé en La Frailesca, Chiapas. Comer Exter 1997;47(12):947-954. 34. Zárate JP, Esqueda VA, Vinay JC, Jácome SM. Evaluación económico-productiva de un sistema de producción de leche en el trópico. Agron Mesoam 2010;21(2):255-265.

859


Rev Mex Cienc Pecu 2021;12(3):845-860

35. Lau A, Barrientos JM, Torres JM, Torres SI, Manzur A, Orea RI, Metodología de costos unitarios en microempresas de bovinos de doble propósito del estado de Chiapas, México. Quehacer Científico en Chiapas 2017;12(1):64-68. 36. Del Valle C, Hernández A, Aguilar C. La integración vertical en los sistemas lecheros de la frailesca, Chiapas y los Altos de Jalisco en el contexto de la globalización. Martínez E, et al (Coord.). Dinámica de sistema lechero en el marco regional y global. México: Plaza y Valdés; 1999:203-220. 37. Mezgebe G, Gizaw S, Urge M. Growth, reproductive, and productive performance of Begait cattle under different herd management systems in northern Ethiopia. Trop Anim Health Prod 2018;50(6):1313-1318.

860


https://doi.org/10.22319/rmcp.v12i3.5569 Artículo

Análisis de la demanda de bovinos carne en pie en los centros de sacrificio de México, 2000-2018

Nicolás Callejas Juárez a* Samuel Rebollar Rebollar b

a

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología. Periférico Francisco R. Almada Km 1, Chihuahua, Chihuahua, México. b

Universidad Autónoma del Estado de México. Centro Universitario UAEM Temascaltepec, Estado de México, México.

* Autor de correspondencia: ncallejas@uach.mx

Resumen: El análisis de la cadena de valor en bovinos carne de México se ha centrado en la producción y consumidor final, principalmente; sin embargo, los centros de sacrificio representan el eslabón principal entre productores y consumidores. El objetivo fue analizar de la demanda de bovinos carne en pie en los centros de sacrificio de México, 2000-2018. La muestra consideró 50 casas de matanza, en 26 de 32 entidades federativas y los modelos de demanda fueron estimados mediante el método de mínimos cuadrados ordinarios. Fue posible estimar los cuatro mejores modelos de demanda por producto; el precio explicó 43.4 % de la variabilidad en la cantidad de carne de bovino en los centros de sacrificio; 60.4 % para vacas de desecho, 37.7 % novillos, 33.5 % toros de desecho y 28.8 % novillas. Todos los productos se comportaron inelásticos al precio (-0.17), pero la demanda de novillos tuvo la menor elasticidad (-0.06). El mercado de la carne de bovino presentó una baja densidad media de las conexiones entre productores y centros de sacrificio analizados (25.2 ± 43.4 %), que indica una ineficiencia del mismo. El estado de Jalisco representó el principal centro de sacrificio en novillos y vacas de desecho, mientras que Aguascalientes en novillas y toros de desecho.

861


Rev Mex Cienc Pecu 2021;12(3):861-877

Palabras clave: Carne de novillo, Carne de novilla, Carne de vaca, Carne de toro, Elasticidad de la demanda, Densidad de mercado.

Recibido: 05/12/2018 Aceptado:18/03/2021

Introducción ¿Es el precio la variable, más importante, que determina la cantidad demandada de bovinos en los centros de sacrificio en México? La información de mercado en los sistemas de producción de carne de bovino constituye un bien público, que permite una asignación de recursos basada en la máxima productividad. En México, la disponibilidad de datos de mercados carece de información suficiente y pertinente (análisis de datos), en tiempo y forma, para la toma de decisiones. El Sistema Nacional de Información e Integración de Mercados (SNIIM) es una de las instituciones oficiales que proporciona datos relacionados con el precio, cantidad ofertada y demandada de bovinos en centros de sacrificio en México. Sin embargo, solamente proporciona una muestra, aleatoria, de los centros de sacrificio (privados, TIF y municipales), precio y peso vivo que permite estimar las funciones de demanda. Investigaciones de mercado de carne de bovino en México se han realizado para consumo de carne en pie y canal, no así para centros de sacrificio, ninguno sobre la eficiencia de los centros de sacrificio y todos hacen referencia a estudios de caso o locales(1,2,3). En adición, un estudio sobre las principales carnes consumidas en México confirmó un efecto sustitutivo entre la carne de res y la pollo(4); por su parte, en otros trabajos sobre la demanda regional de carne bovina mexicana, se encontró una relación inversa e inelástica entre la cantidad y precio de la carne de bovino en canal(5), asociadas a un efecto inelástico del precio al productor y elástico al consumidor(6). Por su parte, un estudio adicional examinó el efecto de las importaciones de carne de cerdo en el consumo nacional de carne de res y se concluyó que las importaciones de carne de cerdo tienen un efecto negativo en el mercado sustituto de la carne de res en México(7); confirmándose que a nivel mundial el 70 % de la producción se concentra en India, Brasil, Australia, Estados Unidos (EEUU) y Nueva Zelanda y la demanda en EEUU, Canadá, UE (Unión Europea) y Rusia(8). En otro estudio similar, se encontró que la demanda de productos pecuarios fue una función del ingreso y que, de acuerdo con la tendencia el volumen producido y la demanda de carne de pollo quedará satisfecha, pero no la de res. Por ello, la necesidad de hacer investigación a nivel de centro de abasto (productores) y centro de sacrificio (consumidores) en México(9).

862


Rev Mex Cienc Pecu 2021;12(3):861-877

El mercado de la carne de bovino en pie en México se caracteriza por cuatro productos: novillo, novilla, toro de desecho y vaca de desecho(10); las carnes de novillo y novilla son objetivos del sistema de producción y los otros dos subproductos son del proceso productivo. La oferta de los cuatro tipos de carne está en función de la composición del hato; es decir, de la proporción de vacas, toros, novillas, novillos y terneras(11). El inventario de bovinos carne en México fue de 31.9 millones de cabezas de ganado; en engorda 33.4 %, becerros 25.1 %, de desecho 11.6 %, en desarrollo 10.3 %, vaquillas para reemplazo 7.2 %, vacas solo para la cría de becerros 5.5 %, vacas solo para la producción de leche 4.4 % y otros 2.5 %. Como resultado, a través de intermediarios se comercializó 41.8 %, en rastro TIF 11.4 %, exportación 5.4 %, rastro municipal 2.8 %, rastro privado 1.9 % y otros 36.7 %(12). En el año 2000 se ofertaron en México poco más de 4.2 millones de toneladas (t) de carne en pie; 43 de cada 100 t correspondieron a pollo, 33 a bovino y 24 a cerdo; para 2018, fueron poco más de 6.8 millones de t; 49 de cada 100 t correspondieron a pollo, 39 a bovino y 22 a cerdo. Esto significó un incremento de 6 % en la oferta de carne de pollo y una disminución de 4 y 2 % en carne de bovino y cerdo(13). A su vez, en el 2018, la capacidad nacional instalada mensual para el sacrificio de ganado bovino fue 1’108,043 cabezas; 49.14 % en rastros TIF, 43.36 % en rastros municipales y 7.5 % en rastros privados(14). Sin embargo, solamente se utiliza 54 % de la capacidad nacional mensual instalada; 63 % de rastros TIF, 47 % rastros municipales y 43 % rastros privados. Ninguno de los rastros TIF y privados se encuentra al 100 % de su capacidad instalada; y de los privados, solamente Chiapas reportó 100 % de su capacidad utilizada(15). Entonces, existe un área de oportunidad en la investigación de analizar y proponer estrategias para mejorar la productividad de los centros de sacrificio de bovinos carne en México. La productividad de un sistema de producción se mide por cuatro elementos: eficiencia, eficacia, calidad y economía(16). La eficiencia de la producción pecuaria en México, medida en los centros de sacrificio de carne en pie a carne en canal, mostró que en el año 2019 la producción de carne de cerdo tuvo la mayor eficiencia, entre las carnes con 79.0 %, ave 78.1 %, guajolote 74.4 %, bovino 54.8 %, ovino 51.6 % y caprino 51.4 %. En el caso de bovinos carne, la eficiencia disminuyó 21.8 %, lo que implicaría una mayor cantidad de animales sacrificados para abastecer el consumo nacional(13). Por lo que, la investigación tuvo como objetivo analizar de la demanda de bovinos carne en pie en los centros de sacrificio de México, 2000-2018. La hipótesis central es que la baja capacidad utilizada de los centros de sacrificio se debe a la localización de los centros de abasto y centros de sacrificio, una capacidad instalada mayor a la requerida, y que el precio pagado al productor o centro de abasto determinan la cantidad de novillos, vacas, toros y novillas demandados en los centros de sacrificio de México.

863


Rev Mex Cienc Pecu 2021;12(3):861-877

Material y métodos Fueron analizados cuatro productos de bovino carne en pie: novillo (NO), novilla (NA), toro de desecho (TO) y vaca de desecho (VA) demandados en los centros de sacrificio de México. Como demanda se consideró el número de cabezas de ganado bovino sacrificadas en los centros de sacrificio (rastros privados, rastros TIF y rastros municipales) reportados por el Sistema Nacional de Información e Integración de Mercados (SNIIM) en el periodo 20002018. De 90 centros de sacrificio que reportaron actividades en el periodo de análisis, sin embargo, la muestra (n= 54) consideró aquellos que reportaron actividades durante todo el periodo de análisis: 19 municipales, 10 TIF y 4 privados. Estos se encuentran ubicados en 26 de las 32 entidades federativas. Los centros de sacrificio que reportaron actividades, también se especializan por tipo de producto en: novillo 27 rastros, novilla 11, toro de desecho 17 y vaca de desecho 23. Dado que los datos reportados por el SNIIM, carecen del peso vivo de animales sacrificados, se consideró como cantidad demandada las cabezas de ganado que permitió ser acorde con la capacidad instalada de sacrificio, en lugar de volumen en kilogramos (kg). El precio de mercado de los productos se deflactó con el índice nacional de precios al consumidor (INPC 2018=100)(15). Los modelos teóricos consideran que la cantidad demandada (𝐷𝑗 , j= 1, 2, 3, 4) de novillo en pie (DNO), novilla (DNA), toro (DTO) y vaca (DVA) tienen una relación lineal con el precio (𝑃𝑗 , 𝑗 = 1, 2, 3, 4) de los novillos en pie (PNO), novilla (PNO), toro (PTO) y vaca (PVA), respectivamente. En su forma estadística, Dj se escribió como: Dj = f(Pj ) + e Los modelos utilizándose estimaron a través del método de Mínimos Cuadrados Ordinarios (MCO) propuesto por Gauss y Legendre en 1808, que minimizan la suma de cuadrados de los errores. La validación económica de los modelos se realizó al considerar la teoría económica que indica una relación inversa entre la cantidad demandada de cabezas de ganado y el precio en centros de sacrificio. Si bien, la pendiente de la función de demanda permite medir la cuantía y sentido de la cantidad demandada ante cambios en el precio; existe la elasticidad precio de la demanda (𝐸𝑃𝐷 ), que mide el cambio o sensibilidad de la cantidad demandada (∆𝑄) ante cambios en el precio (∆𝑃𝑗 ). Las 𝐸𝑃𝐷 se obtuvieron mediante un modelo de regresión log-log, para cada producto cárnico analizado. 864


Rev Mex Cienc Pecu 2021;12(3):861-877

Ln(Dj ) = ln(β0 ) + β1 ln(Pj ) + ui De esta manera, 𝛽1 representa la elasticidad precio de la demanda para cada uno de los productos analizados y, mide el cambio porcentual en la cantidad demandada de cabezas de ganado ante un cambio porcentual de su precio. El análisis de la demanda de carne de res en los centros de sacrificio se realizó mediante el análisis de redes sociales, que permite identificar actores (centros de sacrificio y centros de abasto) más importantes y sus relaciones comerciales(17). Finalmente, para validar los resultados y hacer inferencia sobre la demanda de bovinos en pie, la significancia estadística de los modelos se realizó al considerar el p-valor y t-Student para el coeficiente de regresión del precio(18).

Resultados En promedio durante el periodo de análisis, 2000-2018, fueron sacrificadas 2.7 millones de cabezas de ganado bovino, distribuidas de la siguiente manera: 40.9% novillo, 34.7 % vaca, 13.8 % toro y 10.6 % novilla. El peso promedio al sacrificio para novillo fue 465.6 ± 124.4 kilogramos de peso vivo (kgPV), novilla 472.5 ± 43.3 kgPV, vaca 471.5 ± 117.4 kgPV y toro 466.7 ± 53.7 kgPV. Los precios reales de la carne en pie fueron mayores para novillo 32.8 ± 9.0 $/kg, novilla 27.73 ± 8.4 $/kg, vaca 23.3 ± 7.6 $/kg y toro 30.0 ± 9.1 $/kg. En general, el precio de los cuatro productos fue homogéneo (CV= 24 %), el precio de la vaca presentó la mayor variabilidad (CV= 32.7 %) y el de novillo la menor variabilidad (CV= 27.5 %). La especialización de los centros de abasto para el sacrificio de bovinos mostró que 23 de ellos se especializan en carne de novillo, cinco en novilla, 17 en vaca y 11 en toro; los demás centros de sacrificio están en función de la estacionalidad de la producción de carne.

Carne de novillo De acuerdo con la muestra, de los 37 centros de sacrificio de novillo que reportaron operaciones en el año 2000, para 2018 solamente 27 lo hicieron; mientras que el número de novillos sacrificados disminuyó 10.6 %. En 2010, los cuatro principales centros de sacrificio sacrificaron 41.0 % de los novillos en México (rastro Municipal Guadalajara 21.3 %, Naucalpan 7.3 %, La Paz 6.4 % y TIF 78 Frigorífico del Sureste 5.9 %; mientras que, para 2018, cuatro centros de sacrificio demandaron 55.8 % (rastro TIF 111 22.2 %, Rastro Municipal de Guadalajara 16.6 %, rastro Sukarne 10.5 % y rastro Procarne 6.5 %). La oferta 865


Rev Mex Cienc Pecu 2021;12(3):861-877

de novillos se dio en 27 de las 32 entidades federativas. Así mismo, en el periodo de análisis, los tres principales oferentes de novillo cambiaron su posición e importancia; mientras que en el año 2000 fueron Jalisco (29.3 %), Nuevo León (11.5 %) y Chiapas (11.2 %); para 2018 fueron Sinaloa (22.2 %), Nuevo León (18.6 %) y Jalisco (18.2 %).

Carne de novilla En el año 2000 se contaba con 11 centros especializados en el sacrificio de novilla, para 2018 se contabilizó el mismo número, pero no los mismos centros; algunos dejaron de aportar información y otros desaparecieron. En el 2000 un solo centro sacrifico 74.0 % de novilla (TIF 111 Vizur Sin) y las entidades con los centros de sacrificio más importantes se localizaron en Guanajuato 23.6 %, Chiapas 22.3% y San Luis Potosí 12.0 %; para 2018 Sinaloa 74.1 %, Guanajuato 10.24 % y Michoacán 8.2 %. La oferta de novilla la realizaron 19 entidades federativas en 2000, las más importantes fueron Chiapas 21.9 %, Guanajuato 14.1 % y Jalisco 11.8 %; mientras que para 2018 fueron 14 entidades, Sinaloa 74.1 %, Michoacán 8.2 % y Jalisco 8.0 %.

Carne de vaca Las vacas son principalmente un producto de desecho en México, en todos los sistemas de producción. Algunas entidades se caracterizan por un mayor sacrificio por contar con cuencas lecheras, tal es el caso de Coahuila, Durango, Jalisco, Aguascalientes, Querétaro, Chihuahua e Hidalgo. En el año 2000 se contaba con 34 centros de abasto especializados en el sacrificio de vaca y para 2018 se redujo 32.3 %, el más importante fue R.M. Guadalajara que sacrificó 27.6 % de vaca. En el año 2000, las entidades federativas más importantes en el sacrificio de vaca fueron Jalisco 34.8 %, Guanajuato 7.88 % y Chiapas 7.5 %. Para 2018, fueron Jalisco 30.9 %, Sinaloa 28.2 % y Aguascalientes 12.2 %. La oferta de vaca en 2000 se cubrió con producción de 25 entidades federativas, las más importantes fueron Jalisco 36.9 %, Chiapas 7.4 % y Zacatecas 6.6 %; mientras que, en 2018, la oferta correspondió a 21 entidades y los principales oferentes fueron Sinaloa con 28.2 %, Jalisco 27.4 % y Aguascalientes 11.3 %.

Carne de toro Al igual que la carne de vaca, la carne de toro proviene de animales de desecho. En el 2000 se contaba con 14 centros de abasto especializados en el sacrificio de toro, los más importantes fueron RP León Servicios Integrales en Guanajuato (20.7 % de toros sacrificados), TIF 78 Frigorífico del Sureste en Chiapas (19.9 %), y R. M. de San Luis Potosí (10.5 %). Para 2018, se tuvo el mismo número de centros de sacrificio, pero algunos fueron nuevos; ahora los principales centros de sacrificio fueron TIF 111 Visur en Sinaloa con 46.5 % de toro sacrificados, Rastro TIF en Sonora 11.7 % y Frigorífico y Empacadora de 866


Rev Mex Cienc Pecu 2021;12(3):861-877

Aguascalientes 11.6 %. En el año 2000, la oferta de toro se concentró en 19 entidades federativas; las más importantes fueron Chiapas 19.5 %, Sonora 12.47 % y Guanajuato 12.3 %. Para 2018, solo 14 ofertaron toro, las más importantes Sinaloa 46.5 %, Aguascalientes 16.1 % y Sonora 12.2 % de toro ofertados.

Funciones de demanda Todos los modelos para la demanda de carne de res, por producto, coincidieron con la teoría económica, excepto para toro, y fueron estadísticamente significativos en el coeficiente de precio (P<0.05). Para los cuatro tipos de carne el precio explicó 46.4 % del número de cabezas de ganado sacrificadas en los centros de sacrificio, mientras que, para los tres productos, poco más del 28 % (Cuadro 1). Por lo tanto, los modelos estimados se consideran buenos (se cumple la ley de la demanda, el precio explica la variabilidad de la cantidad demandada, el valor de P es <0.05, el coeficiente de variación es bajo y el error estándar de estimación representó menos del 21.2 % del promedio de cabezas de ganado demandadas en los centros de sacrificio). Cuadro 1: Modelos de demanda DNO DNA DTO Intercepto* 1.5 0.5 0.2 Precio -9,736.9 -5,686.5 4,354.6 Coeficiente de determinación 0.4 0.3 0.3 F-calculada 16.5 15.3 0.2 Probabilidad (F-calculada) 0.0 0.0 0.7 Error estándar 3,012.6 1,474.6 13,676.1 T-calculada -3.2 -3.9 0.3 Probabilidad (T-calculada) 0.0046 0.0012 0.7538

DVA 1.4 -19,599.0 0.6 25.9 0.0 3,852.0 -5.1 0.0001

Todos 3.7 -29,737.1 0.5 14.7 0.0 7,756.3 -3.8 0.00012

DNO=cantidad de novillos en pie; DNA= cantidad de novillas en pie; DTO= cantidad de toros en pie; DVA= cantidad de vacas en pie; *Millones de cabezas.

Elasticidad precio de la demanda La elasticidad precio de la demanda para carne de bovino en pie en los centros de sacrificio fue 0.36 %; es decir, inelástica e indica que por cada 1% que cambie el precio real de la carne en México, la cantidad demandada de bovinos en los centros de sacrificio cambiará 0.36 %. La elasticidad precio de la demanda, por producto, también fue inelástica; así se tuvo que la elasticidad precio de la demanda para el novillo se ubicó en 0.33 % (0.33) por 1% de cambio real en su precio, para la novillona 0.65, toro 0.39 y vaca 0.60 % (Cuadro 2).

867


Rev Mex Cienc Pecu 2021;12(3):861-877

Cuadro 2: Demandas estimadas por producto y centro de sacrificio Demanda Intercepto Pendiente R2 Prob(T) Novillos R.M. Aguascalientes R.M. La Paz B.C.S. R. M. Campeche TIF 78 Frigorífico del Sureste R.P. Perecederos y Derivados Procesadora municipal de carne de Colima R.M. Cerro Gordo R.M. Naucalpan R.M. Nezahualcóyotl R.M. Tlalnepantla R.M. Guadalajara R.M. Tlaquepaque R.M. Tonalá R M. Morelia Bodega de Productos Internacional Chamar Alimentos TIF 356 Procesadora Selecta, S.A. de C.V. TIF 15 Emp. Treviño Procesadora de carnes "La Alianza" R.M. de San Luis Potosí TIF Bovinos Cd. Obregón Aric Planta TIF 170 R.M. Zacatecas Novillas R.M. Aguascalientes R.M. Campeche R.P. León, Serv. Integral R.M. Morelia Procesadora de carnes "La Alianza" R.M. de San Luis Potosí TIF Bovinos Cd. Obregón R. M. de Xalapa Aric Planta TIF 170 R.M. Zacatecas Toros R.M. La Paz B.C.S. R.M. Campeche

36103.90 7574.20 12530.50 35372.60 84715.20 20119.00 29763.10 165418.30 159118.40 26727.50 252444.00 24994.70 21284.60 46452.30 158031.90 100326.20 90551.00 58460.80 6694.80 35077.90 12133.30 14011.30 5823.20

-1207.70 -150.50 -172.70 -570.50 -4019.90 -410.50 -475.30 -5588.00 -6746.60 -321.00 -2608.80 -352.80 -308.70 -594.30 -6484.60 -1186.60 -1627.70 -1007.80 -108.70 -496.40 -203.40 -325.90 -106.60

0.70 0.70 0.30 0.40 0.80 0.90 0.60 0.50 0.80 0.60 0.50 0.60 0.60 0.50 0.80 0.30 0.30 0.30 0.80 0.40 0.30 0.40 0.40

0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

12204.00 21591.90 95873.10 34700.10 6393.50 31448.00 12831.10 12555.40 15498.10 4025.80

-391.90 -865.60 -2067.80 -326.50 -110.20 -442.40 -225.30 -360.40 -449.10 -66.80

0.40 0.50 0.60 0.20 0.80 0.30 0.40 0.60 0.50 0.40

0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

9013.50 14448.40

-233.70 -322.40

0.70 0.00 0.40 0.00

868


Rev Mex Cienc Pecu 2021;12(3):861-877

TIF 78 Frigorífico del Sureste R.P. León, Serv. Integral R.M. Querétaro R.M. de San Luis Potosí Rastro TIF Bovinos Cd. Obregón R.M. Zacatecas Vacas R.M. La Paz B.C.S. R.M. Campeche TIF 78 Frigorífico del Sureste R.P. La Torrena PM de carne de Colima R.M. Tlalnepantla R.P. León, Serv. Integral R.M. Guadalajara R.M. Tlaquepaque R.M. Tonalá R.M. Morelia R.M. Tepic R.M. de San Luis Potosí

35465.70 90598.60 65717.70 32320.80 14144.40 4375.10

-650.70 -1530.50 -1069.50 -246.30 -366.00 -69.90

0.40 0.50 0.20 0.20 0.50 0.40

0.00 0.00 0.10 0.00 0.00 0.00

9516.30 13642.80 34722.70 61715.70 17857.40 21154.20 91272.80 242265.20 23580.10 19068.80 46044.10 24111.70 30994.00

-340.60 -327.70 -646.30 -3717.70 -825.90 -347.40 -2275.10 -3116.50 -422.80 -310.20 -813.50 -517.80 -248.10

0.80 0.30 0.40 0.80 0.60 0.20 0.70 0.40 0.50 0.50 0.40 0.60 0.20

0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.10

RM= rastro municipal, RP= rastro privado; TIF= tipo inspección federal.

En adición, el Cuadro 2 presenta las funciones de demanda estimadas tanto por centro de sacrificio como por cada uno de los productos en las que se verifica que se cumple la teoría las funciones estimadas fueron estadísticamente significativas (P>0.05) al nivel de confianza predeterminado.

Redes En la Figura 1 se puede apreciar que en los centros de abasto (n= 33) y de sacrificio (n= 25) más importantes de México la concentración de carne en pie en cuatro centros de sacrificio, cercanos a los cuatros centros de consumo de carne (Ciudad de México, Jalisco, Estado de México y Nuevo León); además que Aguascalientes se ha convertido en un centro de acopio para los centros de abasto del norte del país. En conjunto, el mercado tiene una eficiencia de 25.2 %, que significa el conjunto de relaciones posibles entre centros de producción y centros de sacrificio. La varianza (43.4 %) indica que los centros de abasto y centros de sacrificio reciben las cabezas de ganado de diferente origen o que ambos buscan el mejor precio. El principal centro de sacrificio fue Jalisco con 82.9 ± 38.6 % de las relaciones de mercado posibles, otros importantes fueron Estado de México 77.8 ± 42.9 %, Aguascalientes 63.7 ± 48.1 %, Guanajuato 51.5 ± 50. 0% y Nuevo León 45.6 ± 49.8 % de las relaciones posibles. 869


Rev Mex Cienc Pecu 2021;12(3):861-877

Así mismo, el centro de abasto más importante fue Aguascalientes que se relacionó con 84.0 ± 36.7 % de los centros de sacrificio, Jalisco 44.0 ± 49.7 % y Zacatecas 40.0 ± 49.1 % de los centros de sacrificio. Figura 1: México, red de centros de abasto y sacrificio de bovinos

Color azul = centros de sacrificio y Color rojo = centros de abasto.

Los centros de sacrificio más importantes en el sacrificio de novillo se ubican en el Estado de México, Jalisco y Aguascalientes; reciben novillo de la mayor proporción de entidades federativas. Las entidades más alejadas del país satisfacen su demanda de novillo con producción local (Baja California Sur y Yucatán). La baja relación (25.2 %) de los centros de abasto tienen relación con todos los centros de sacrificio, puede ser explicado por la distancia entre centros de abasto y centros de sacrificio, además de la especialización en el tipo de animales sacrificados. En el caso de Jalisco, que se relacionó con más del 80 % de los centros de abasto o entidades federativas, puede estar explicada por la localización geográfica, la capacidad instalada y la especialización en novillo y vaca (Figura 2).

870


Rev Mex Cienc Pecu 2021;12(3):861-877

Figura 2: Centros de sacrificio y abasto para carne de novillo

En el caso del producto novilla, la relación del mercado de sacrificio y abasto se reduce. El mercado de Baja California Sur se aísla del mercado nacional. El promedio de todas las relaciones posibles fue 19.4 ± 39.5 %, que significa una baja densidad y variabilidad de la red. Los centros de sacrificio con mayor grado nodal o grado de influencia fueron Aguascalientes y Guanajuato con 54.9 ± 50.1 %. Así mismo, los centros de abasto con mayor influencia fueron Aguascalientes 66.7 ± 47.1 % de los centros de abasto, Zacatecas 38.9 ± 48.8 %, Jalisco y Yucatán 33.3 ± 47.1 % respectivamente (Figura 3). Figura 3: Centros de sacrificio y abasto para carne de novilla

871


Rev Mex Cienc Pecu 2021;12(3):861-877

La densidad del mercado para carne de vaca fue 22.9 ± 42.0 %, significa que aproximadamente 23 % de los intercambios que se pudieron dar entre oferentes y los centros de sacrifico se logró. Los centros de sacrificio de Jalisco tienen relaciones de mercado con 84.4 ± 36.3 % de los centros de abasto. Aguascalientes y Guanajuato son los otros centros que tienen relación comercial con 53.1 ± 49.9 % de los centros de abasto. Para los centros de abasto, los estados de Aguascalientes, Jalisco y Zacatecas tuvieron 80.0 ± 40.0, 44.0 ± 49.0 y 40.0 ± 49.1 % de sus relaciones comerciales (Figura 4). Figura 4: Centros de sacrificio y abasto para vaca de desecho

Para el mercado de la carne de toro se encontró una densidad de 19.7 ± 39.8 %, el más bajo de los cuatro productos analizados. Los centros de sacrificio de Aguascalientes y Guanajuato tuvieron intercambio de carne de toro con el 58.6 ± 49.3 % de los centros de abasto, otros como San Luis Potosí 31.0 ± 46.26 %, Durango y Nayarit 31.0 ± 46.3 %. Los centros de abasto de Aguascalientes realizaron intercambio con 72.2 ± 44.8 % de los centros de sacrificio, Jalisco y Zacatecas 38.9 ± 48.8 %, además de Guanajuato, Querétaro y Sonora con 27.8 ± 44.8 % de sus relaciones con los centros de abasto (Figura 5).

872


Rev Mex Cienc Pecu 2021;12(3):861-877

Figura 5: Centros de sacrificio y abasto para carne de toro

Discusión Elasticidad precio de la demanda Los centros de sacrificio con elasticidad precio de la demanda elástica fueron Guanajuato, Nuevo León, San Luis Potosí, Jalisco, Durango, Coahuila y Sinaloa; mientras que el resto se comportó de forma inelástica. Una de las hipótesis de este comportamiento es la especialización que tienen en los productos cárnicos de los animales sacrificados (novillo 74.1 %, novilla 90.0 %, vaca 82.3 % y toro 60.2 %). La segunda, es que, al tener una capacidad utilizada tan baja, los obliga a responder de forma elástica a cambios de precio para mantenerse en el mercado; en este caso, los centros de sacrificio con precio elástico tuvieron una capacidad utilizada de 63.2 %, contra 40.1 % de los inelásticos. Investigaciones que discuten estos resultados fueron casi nulos; sin embargo, se encontraron elasticidades precio de la demanda elásticas para la carne de bovino en México(19). No obstante, ese resultado dista mucho de un estudio donde se confirmó una elasticidad precio de la demanda de carne bovina en México como inelástica (-0.07) para el periodo 19902012(20) y cercano al del país de Chile enfocado a demanda de bovinos carne a nivel nacional para un periodo distinto(21). Por su parte, en una investigación adicional, se halló una respuesta inversa del precio de la carne bovina sobre la cantidad demandada, al confirmar un efecto inelástico(22); mientras que en otros trabajos relacionados se confirmó una respuesta elástica (-1.41) del precio de la carne de bovino sobre la cantidad demandada, para el caso de Colombia(23), mientras que para México, de forma regional, se confirmaron respuestas 873


Rev Mex Cienc Pecu 2021;12(3):861-877

inelásticas del precio (entre -0.15 y -0.53) a la cantidad demandada de carne bovina en canal durante el periodo 1996-2017(5).

Capacidad de los centros de sacrificio La cantidad de centros de sacrificio de bovinos están distribuidos en todo México, lo que es acorde con la dispersión de los centros de abasto o unidades de producción, así como de la población ganadera, están presentes en 30 de 32 entidades federativas. Sin embargo, los centros de sacrificio TIF existen en 20 entidades, los privados en 13 y los municipales en todas las entidades. Actualmente, los centros de sacrificio de bovinos tienen una ineficiencia de 46 %, lo que significa que podrían sacrificar 509,700 cabezas más. Entonces, surge la interrogante ¿Cómo hacer más eficiente los centros de sacrificio? A este respecto, se ha verificado que el ganadero destina bovinos al abasto por tres canales de comercialización: introductor (34.8 %), tablajero (58.8 %) o por cuenta propia (6.4 %)(24); mientras que otros estudios concluyeron que encontraron que 73.0 % de los bovinos se venden directamente a rastros y 26.0 % a intermediarios; lo que podría explicar el por qué los productores prefieren sacrificar sus bovinos en centros de abasto alejados del centro más cercano(25,26).

Los precios en Centros de sacrificio El precio promedio nacional en los centros de sacrificio más alto se pagó en San Luis Potosí (64.08 $/kg) a bovinos provenientes de Michoacán; el más bajo (15.66 $/kg) fue en Nuevo León a bovinos provenientes de San Luís Potosí. Los centros de sacrificio de Jalisco (principal centro nacional) pagaron un promedio de 29.56 ± 2.90 $/kg, Estado de México 34.27 ± 4.48 $/kg y Aguascalientes 23.93 ± 3.52 $/kg; sin embargo, la diferencia no es significativa (P>0.05). El precio promedio para la carne de novillo fue 32.03 ± 5.59 $/kg, el máximo 58.22 $/kg en Sonora para bovinos provenientes de Sinaloa y el más bajo 22.20 en Baja California Sur para bovinos provenientes de Baja California Norte. Los centros de abasto más importantes, por su relación con los centros de abasto, (San Luis Potosí) pagaron un promedio de 36.89 ± 7.33 $/kg, que no es estadísticamente diferente del precio promedio nacional (P>0.05), ni del segundo más importante Centro de estatal de sacrificio (Estado de México). El monitoreo del mercado de la carne de bovino en centros de sacrificio es realizado por el SNIIM. Lo que se puede observar es que los centros de sacrificio municipales mantuvieron una tendencia decreciente en su monitoreo a partir de 2002 en 1.37 centros por año; en el año 2000 del total de centros monitoreados, los centros TIF mantuvieron una tendencia creciente 874


Rev Mex Cienc Pecu 2021;12(3):861-877

hasta 2005, constante hasta 2010, pero decreciente hasta la fecha. Los centros privados, a partir de 2005, han tenido un monitoreo creciente; en 2005, de los centros de sacrificio monitoreados, 17.58 % fueron privados y en 2018 representaron 52.47 %.

Conclusiones e implicaciones La teoría económica y estadística para los modelos lineales de la demanda de carne de novillo, novilla y vaca se cumplió, no así para la carne de toro; lo que permitió hacer inferencia sobre la situación de la demanda de carne de bovino en pie en los principales centros de sacrificio de México. La elasticidad precio de la demanda de carne de bovino en sus cuatro productos los clasifica como inelásticos; pero muestra una mayor sensibilidad en la demanda de novilla y menor en novillo. Los centros de sacrificio más importantes en novillo fueron Jalisco, Estado de México y Aguascalientes; en novilla Aguascalientes, Guanajuato y San Luis Potosí; en vaca Jalisco, Guanajuato, Estado de México y Aguascalientes; y en toro Aguascalientes, San Luis Potosí y Guanajuato. Finalmente, aun y cuando se cuenta con información secundaría, resulta insuficiente, y el tiempo para generar información para el mercado se convierte en una debilidad para el primer eslabón de la cadena de valor de bovinos carne en México. Literatura citada: 1. Vilaboa AJ, Díaz RP, Ruiz RO, Platas RD, González MS, Juárez LF. Patrones de consumo de carne bovina en la región del Papaloapan, Veracruz, México. Agricultura, Sociedad y Desarrollo 2009;6(2):145-159. 2. Taddei C, Preciado M, Robles J, Garza C. Patrones de consumo de carne en el noroeste de México. Estudios Sociales. Rev Aliment Contempor Desarrollo Regional 2012;(2):7796. 3. Bravo FJP, Mata RG, Delgado GG, López EL. Márgenes de comercialización de la carne de res proveniente de la Cuenca del Papaloapan, en el mercado de la ciudad de México. Agrociencia 2002;36(2):255-266. 4. Pérez VFC, Martínez DMA, García MR, Espinosa TMA. El efecto simultaneo entre los precios al consumidor de las principales carnes consumidas en México. Rev Mex Cienc Agríc 2015;6(2):239-251. 5. Rebollar RS, Hernández MJ, Rebollar RE. Determinantes de la demanda de carne bovina en México, 1996-2017: un análisis por regiones. Debate Económico 2020;9(1):65-84. 6. Jiménez JC, Sánchez RCG. El mercado de la carne de bovino en México, 1970-2011. Estudios Sociales 2014;22(43):87-110.

875


Rev Mex Cienc Pecu 2021;12(3):861-877

7. San Juan-Mejía ZM, Martínez DMA, García MR. Efecto de las importaciones de carne de cerdo sobre el mercado de carne de res en México. Agrociencia 2007;41(8):929-938. 8. Errecart V, Lucero M, Sosa MA. Análisis del mercado mundial de carnes. Facultad de Economía y Negocios, Universidad Nacional de San Martín: Tarapoto, Perú; 2015. 9. Salazar JAA, Escoto FC, Cruz MAG, Mohanty S, Málaga J. La demanda de productos pecuarios en México por deciles de ingreso: Proyección al año 2025. Téc Pecu Méx 2006;44(1):41-52. 10. SNIIM. Anuario estadístico de ganado en pie. 2018. Disponible en http://www.economiasniim.gob.mx/nuevo/Home.aspx?opcion=/SNIIM-PecuariosNacionales/e_MenPec.asp?var=Bov 11. Callejas NJ, Gutiérrez J AO, Viveros JD, Rebollar SR. La producción de becerros en Chihuahua: un análisis económico marginal. Avances en Investigación Agropecuaria 2015;19(2):51-66. 12.

INEGI. Encuesta nacional agropecuaria. 2017. Disponible https://www.inegi.org.mx/programas/ena/2017/default.html#Tabulados

en

13. SIAP. Resumen nacional de la producción agropecuaria. 2018. Disponible en http://infosiap.siap.gob.mx/repoAvance_siap_gb/pecResumen.jsp 14. SADER. Capacidad instalada para sacrificio de especies pecuarias. 2019. Disponible en https://www.gob.mx/cms/uploads/attachment/file/466106/Capacidad_instalada_para_s acrificio_de_especies_pecuarias_mayo_2019.pdf 15.

INEGI. Índice nacional de precios al https://www.inegi.org.mx/temas/inpc/default.html#Tabulados

consumidor.

2019.

16. Callejas JN, Rebollar RS, Ortega GJA, Domínguez VJ. Parámetros bio-económicos de la producción intensiva de la carne de bovino en México. Rev Mex Cien Pecu 2017;8(2):129-138. 17. Borgatti SP, Everett MG, Freeman LC. Ucinet for Windows: Software for Social Network Analysis. Harvard, MA: Analytic Technologies. 2002. 18. Karl P, David H. On theories of association. Biometrika 1913;9(1/2):159-315. doi:10.2307/2331805. 19. Márquez SI, Mata RG, Delgado GG, Flores JSM, López EL. El efecto de las importaciones de carne bovina en el mercado interno mexicano, 1991-2001. Agrociencia 2004;38(1):121-130.

876


Rev Mex Cienc Pecu 2021;12(3):861-877

20. Olivares JR. Factores determinantes de la carne de res en México [Tesis Licenciatura] Universidad Autónoma del Estado de México-Centro Universitario UAEM Temascaltepec; 2014. 21. ODEPA. Caracterización de la demanda de carne bovina y evaluación de bienes sustitutos. Gobierno de Chile. https://www.odepa.gob.cl/odepaweb/publicaciones/Estudio_Demanda_Carne_Bovina. pdf. Consultado 14 ene 2019. 22. López GMDR, Ramírez VG, Ramírez VB, Terrazas GGH. Estimadores encogidos en modelos de ecuaciones simultáneas para el análisis del mercado de carne de bovino en México. EconoQuantum 2019;16(1):103-123. 23. Galvis ALA. La demanda de carnes en Colombia. Un análisis econométrico. Centro de Estudios Económicos-Regionales. Banco de la República, Cartagena de Indias. Colombia. 2000; http://www.banrep.gov.co/docum/Lectura_finanzas/pdf/DTSER13Carnes.pdf. Consultado 19 Feb, 2019. 24. Vilaboa AJ, Díaz RP, Platas RDE, Ruiz RO, González MSS, Juárez LF. Fallas de mercado y márgenes de comercialización en bovinos destinados al abasto de carne en la región del Papaloapan, Veracruz. Economía, Sociedad y Territorio, 2010;10(34):813833. 25. Martínez JH, Rebollar SR, Razo FDJG, Soria EG, Portillo BA, Martínez AG. La cadena productiva de ganado bovino en el sur del Estado de México. Rev Mex Agronegocios 2011;29:672-680. 26. Romero RM, Fuenmayor JV. Proceso de comercialización de productos derivados de la ganadería bovina doble propósito. Negotium 2017;13(37):47-61.

877


https://doi.org/10.22319/rmcp.v12i3.5562 Artículo

Efecto de dos estrategias de agrupación de padres fantasmas en la evaluación genética de rasgos de crecimiento en el ganado Braunvieh mexicano

Luis Antonio Saavedra-Jiménez a Rodolfo Ramírez-Valverde a Rafael Núñez-Domínguez a* Agustín Ruíz-Flores a José Guadalupe García-Muñiz a Mohammad Ali Nilforooshan b

a

Universidad Autónoma Chapingo. Departamento de Zootecnia, Posgrado en Producción Animal. Km. 38.5 Carretera México-Texcoco. 56230, Chapingo, Estado de México. México. b

University of Otago, Department of Mathematics and Statistics, Dunedin, New Zealand.

*Autor de correspondencia: rafael.nunez@correo.chapingo.mx

Resumen: El estudio tuvo como objetivo comparar dos estrategias de agrupación de conjuntos de padres desconocidos o padres fantasmas (GPF) en la evaluación genética de rasgos de crecimiento para el ganado Braunvieh mexicano. Los datos fenotípicos incluyeron los pesos al nacimiento (PN), destete (PD) y al año (PA). El pedigrí incluyó 57,341 animales. La primera estrategia involucró 12 GPF (G12) según el año de nacimiento de la progenie del padre desconocido y el sexo del padre desconocido, mientras que la segunda involucró 24 GPF (G24) según el año de nacimiento de la progenie del padre desconocido y las cuatro vías de selección. Los modelos animales incluyeron efectos fijos y el efecto genético aditivo directo aleatorio; el PD también incluyó efectos aleatorios genéticos maternos y ambientales permanentes maternos. Las correlaciones producto-momento entre el VGE de G0 (sin GPF) y G12 fueron 0.96, 0.77 y 0.69 para PN, PD y PA, respectivamente, y entre el VGE de G0 y G24 fueron 0.91, 0.54 y 0.53, respectivamente. 878


Rev Mex Cienc Pecu 2021;12(3):878-892

Las correlaciones de rango correspondientes entre G0 y G12 fueron 0.94, 0.77 y 0.72, y entre G0 y G24 fueron 0.89, 0.61 y 0.60. Las tendencias genéticas mostraron una desviación base de la tendencia genética de G0, a excepción para PN de G12. Los resultados no respaldan el uso de las dos estrategias de agrupación en la población y los rasgos estudiados, y se requiere investigación adicional. Es importante introducir GPF en el modelo, una contribución suficiente del fenotipo de los descendientes a los GPF y evitar la colinealidad entre GPF y los efectos fijos. Los grupos genéticos deben reflejar los cambios en la estructura genética de la población para los padres desconocidos, incluidas las diferentes fuentes de materiales genéticos, y los cambios realizados por selección a lo largo del tiempo. Palabras clave: Bovinos Braunvieh, VGE, Grupos genéticos, Correlación de rango, Padres desconocidos.

Recibido: 27/11/2019 Aceptado: 23/11/2020

Introducción El Braunvieh mexicano es una raza de ganado de doble propósito. Desde junio de 2003, se han realizado evaluaciones genéticas nacionales para los rasgos de crecimiento de esta raza en México(1). Como en cualquier población ganadera, hay padres desconocidos en el pedigrí. Se asume que los padres desconocidos no están relacionados, no son endogámicos y tienen un solo descendiente. Los padres desconocidos pueden corresponder a animales base en la primera generación o extenderse a lo largo de generaciones. Ellos afectan el progreso genético de varias formas: (i) reduciendo la intensidad de la selección para animales con padres desconocidos, (ii) la incertidumbre de linaje disminuye la precisión de las evaluaciones genéticas, (iii) la identificación incorrecta de los padres produce sesgos en estimaciones de valores genéticos (VGE) y de heredabilidad (2). La mejor predicción lineal insesgada (MPLI) regresa las predicciones de mérito genético de los animales para padres desconocidos de media cero. Dependiendo de los antecedentes genéticos y la generación a la que pertenecen los padres desconocidos, su mérito genético esperado podría ser diferente de cero. Quass(3) estableció una metodología para considerar grupos de padres fantasmas (GPF) o grupos genéticos en MPLI. Aunque los GPF no son de interés per se, se consideran para facilitar el modelado y el cómputo(4). Además, junto con la corrección estadística de la información de pedigrí faltante no aleatoria, los GPF permiten la estimación directa de parámetros genéticos cuantitativos(5).

879


Rev Mex Cienc Pecu 2021;12(3):878-892

Debido a que no existen reglas específicas para determinar los GPF, su definición se basa principalmente en los criterios del investigador, pero generalmente incluye un componente de tiempo(6). Otros factores comúnmente considerados en las estrategias de agrupación son el sexo del progenitor o la intensidad de selección(4,7,8). Todos los descendientes de un individuo con GPF contribuyen a la estimación del efecto GPF(5), por lo que es poco probable que tener GPF con un número igual de individuos afecte la capacidad del modelo animal para estimar el efecto GPF con una precisión aceptable. Sin embargo, cualquier estrategia para asignar padres desconocidos a GPF debe reflejar el nivel genético promedio de los padres desconocidos(9). Debido a la inclusión de GPF en el modelo, Theron et al(7) observaron un cambio significativo y una reducción del sesgo en la tendencia genética de la producción de leche para las Holstein sudafricanas. Del mismo modo, se detectó una reducción en el sesgo de VGE al incluir GPF en los análisis genéticos para los pesos al destete, posdestete y al año, la circunferencia escrotal y la puntuación de musculatura en ganado Nelore(10). El objetivo de este estudio fue comparar dos estrategias de agrupación de padres desconocidos a GPF en la evaluación genética de rasgos de crecimiento en el ganado Braunvieh mexicano.

Material y métodos Datos

Los registros de pedigrí y fenotípicos del ganado Braunvieh mexicano se obtuvieron de la Asociación Mexicana de Criadores de Ganado Suizo de Registro (Ciudad de México). Los registros fenotípicos fueron pesos al nacimiento (PN), destete (PD) y al año (PA) de animales nacidos entre 1985 y 2017, en 229 ranchos en todo México. Los pesos de destete y al año se ajustaron a 240 d y 365 d de edad, respectivamente, de acuerdo con el procedimiento propuesto por la Federación para el Mejoramiento Genético de Bovinos de Carne(11). Los registros fuera del rango de la media ± 3 DE para el rasgo de interés no se incluyeron en los análisis. Los registros de PD y PA fuera de 240 ± 45 d y 365 ± 45 d de edad, respectivamente, también fueron excluidos de los análisis. El pedigrí se obtuvo (padres), comenzando de animales con un fenotipo disponible (para cualquiera de los tres rasgos), y limitado a animales nacidos desde 1970. El pedigrí final incluyó 57,341 individuos, 18,689 machos, 38,652 hembras, 2,746 padres y 27,015 madres. Los grupos contemporáneos se formaron teniendo en cuenta el hato, el año y la estación de nacimiento (lluviosa o seca). Los registros de grupos contemporáneos con menos de cuatro animales se excluyeron de los análisis. El Cuadro 1 muestra el número final de registros y la estadística descriptiva para cada rasgo.

880


Rev Mex Cienc Pecu 2021;12(3):878-892

Cuadro 1: 1Estadística descriptiva para los rasgos de crecimiento en la población Braunvieh mexicana Rasgo N Mínimo Media ± DE Máximo Peso al nacimiento 31,654 23.00 38.11 ± 4.84 53.00 Peso al destete 21,333 100.59 235.07 ± 42.85 372.62 Peso al año 14,439 146.66 324.07 ± 56.07 504.84

Análisis genéticos

Los análisis genéticos comprendieron la estimación de parámetros genéticos y la MPLI(12) para la población Braunvieh mexicana, utilizando los siguientes modelos de un solo rasgo: y = Xb + Z1u + e, para PN y PA, y

(1)

y = Xb + Z1u + Z2m + Z3mpe + e, (2) para PD, donde y, b, u, m, mpe y e son vectores de registros fenotípicos, efectos fijos, efectos genéticos aditivos directos, genéticos aditivos maternos, ambientales permanentes maternos y residuales, respectivamente. X, Z1, Z2y Z3 son matrices de incidencia que relacionan los registros con b, u, m y mpe, respectivamente. Los efectos fijos fueron: bPN = [sexo, pureza Braunvieh, edad de la madre, (edad de la madre)2, grupo contemporáneo de nacimiento] bPD = [sexo, pureza Braunvieh, edad de la madre, (edad de la madre)2, grupo contemporáneo de predestete, condición de alimentación con leche] bPA = [sexo, pureza Braunvieh, grupo contemporáneo de posdestete, alimentación posdestete] Hubo 1,778, 1,450 y 1,038 grupos contemporáneos de nacimiento, grupos contemporáneos de predestete y grupos contemporáneos de posdestete, respectivamente. Las condiciones de alimentación con leche eran amamantamiento sin ordeña, amamantamiento con ordeña adicional y alimentación con sustituto de la leche. Los regímenes alimentarios posdestete fueron pastoreo, semiestabulación y estabulación total. Las proporciones sexuales fueron cercanas a 1. La edad de la madre en el parto tuvo un mínimo, media, DE y máximo de 1.70, 6.64, 3.04 y 17.00 años, respectivamente. La pureza de Braunvieh tuvo un mínimo, media, DE y máximo de 0.88, 0.99, 0.01 y 1.00, respectivamente. Se utilizaron los modelos oficiales para la evaluación de los rasgos estudiados en ganado Braunvieh mexicano. Las estructuras de (co)varianza fueron:

881


Rev Mex Cienc Pecu 2021;12(3):878-892

𝐀𝜎 2 0 𝐮 𝑉𝑎𝑟 ( ) = ( 𝑢 ), 𝐞 0 𝐈𝑁 𝜎𝑒2 para PN y PA, y 0 0 𝐀𝜎𝑢2 0 𝐮 2 0 0 𝐀𝜎 𝐦) = ( 0 𝑚 𝑉𝑎𝑟 (𝐩𝐞 ), 2 0 0 𝐈𝑁𝑑 𝜎𝑚𝑝𝑒 0 2 𝐞 0 0 0 𝐈𝑁 𝜎𝑒 para PD, donde A es la matriz de relación genética aditiva basada en pedigrí, INd e IN son 2 2 matrices de identidad de orden igual al número de madres y observaciones. 𝜎𝑢2 , 𝜎𝑚 , 𝜎𝑚𝑝𝑒 y 𝜎𝑒2 son las varianzas genéticas aditivas directas, genéticas aditivas maternas, ambientales permanentes maternas y residuales, respectivamente. Aplicando GPF, el término Z1Qg se agrega al modelo (Ec. [1] y Ec. [2]), donde g es el vector de los efectos de GPF, y Q es la matriz que relaciona a los animales con los GPF. Los componentes de la varianza se obtuvieron sin GPF, con base en REML libre de derivadas, utilizando el software MTDFREML(13).

Grupos genéticos

La evaluación de las estrategias de agrupación genética se realizó mediante la comparación de VGE a partir de la MPLI con y sin GPF. Los criterios utilizados para formar los grupos de padres desconocidos fueron: 1) Año de nacimiento: El año de nacimiento del padre desconocido fue cinco años antes del año de nacimiento de su progenie. Los años de nacimiento de los padres desconocidos se agruparon en seis clases: 1965-69, 1970-74, 1975-79, 1980-84, 1985-89 y 1990-96. 2) Sexo del padre desconocido. 3) Vía de selección (padre de padre, padre de madre, madre de padre, madre de madre). Las dos estrategias de agrupación genética fueron: G12: Clase del año de nacimiento (6 niveles) × sexo del padre desconocido (2 niveles). G24: Clase del año de nacimiento (6 niveles) × vía de selección (4 niveles). Los grupos genéticos basados en criterios como el sexo del ancestro faltante o las vías de selección permiten la evaluación de diferentes diferenciales de selección genética(4). Asimismo, la inclusión de la categoría año de nacimiento permite modelar el mejoramiento genético a lo largo del tiempo(3,7). El Cuadro 2 muestra el número de padres desconocidos en cada GPF para cada estrategia.

882


Rev Mex Cienc Pecu 2021;12(3):878-892

Cuadro 22: Criterios y frecuencia de padres desconocidos en los grupos de padres fantasmas Grupo de años2 Padre Estrategia1 1965- 1970- 1975- 1980- 1985- 1990desconocido 1969 1974 1979 1984 1989 1996 Padre 540 513 820 941 678 433 G12 Madre 647 457 664 891 564 35 Padre de padre 119 58 72 90 87 143 Padre de madre 421 455 748 851 591 290 G24 Madre de padre 145 57 51 84 73 9 Madre de madre 502 400 613 807 491 26 1

Grupo de padres fantasmas con niveles 12 (G12) y 24 (G24). 2 Año de nacimiento de la progenie – 5.

Las ecuaciones del modelo mixto (para PN y PA), sin incluir GPF en el modelo, fueron: ̂ 𝐗′𝐲 𝐗′𝐙 𝐛 [𝐗′𝐗 (3) ′ −1 ] [ ] = [𝐙′𝐲], 𝐙′𝐗 𝐙 𝐙 + 𝐀 𝜆 𝐮 ̂ Donde 𝜆 = 𝜎𝑒2 /𝜎𝑢2 . Añadiendo el efecto de GPF al modelo, las ecuaciones del modelo mixto se convierten en (3): ̂ 𝐗′𝐲 𝐗′𝐗 𝐗′𝐙 𝐗′𝐙𝐐 𝐛 −1 [ 𝐙′𝐗 𝐙′𝐙 + 𝐀 𝜆 𝐙′𝐙𝐐 ] [𝐮 (4) ̂ ] = [ 𝐙′𝐲 ]. ̂ 𝐠 𝐐′𝐙′𝐲 𝐐′𝐙′𝐗 𝐐′𝐙′𝐙 𝐐′𝐙′𝐙𝐐 La incorporación de los efectos de GPF en el mérito genético de los animales (es decir, VGE = û + Qĝ) se puede hacer directamente en las ecuaciones del modelo mixto, utilizando la transformación de Quaas y Pollak(14) que implica la absorción de las ecuaciones de GPF, lo que da(3): ̂ 𝐗′𝐗 𝐗′𝐙 𝟎 𝐛 𝐗′𝐲 −1 −1 [𝐙′𝐗 𝐙′𝐙 + 𝐀 𝜆 −𝐀 𝐐𝜆 ] [𝐮 (5) ̂ + 𝐐𝐠̂] = [𝐙′𝐲]. −1 −1 𝟎 −𝐐′𝐀 𝜆 𝐐′𝐀 𝐐𝜆 𝐠̂ 𝟎 Este procedimiento evita el paso adicional de calcular û + Qĝ después de la Ec. [4] y la necesidad de recrear la matriz Q, que es computacionalmente costosa. La transformación de Quaas y Pollak(14) no está implementada en el software MTDFREML. Por lo tanto, las Ec. [3, 4] se aplicaron para la MPLI con y sin GPF, respectivamente (términos adicionales de los efectos genéticos maternos y de los ambientales permanentes maternos se involucraron para PD). Los valores genéticos estimados que representan GPF (û + Qĝ) se obtuvieron utilizando las funciones "qmat" y "Qgpu" del paquete "ggroups" de R (15), donde se calculó la matriz de contribuciones de GPF a los individuos en un pedigrí (Q), y se agregaron contribuciones de GPF (Qĝ) al mérito genético de los animales (û), con ĝ y û obtenidos de MTDFREML(13).

883


Rev Mex Cienc Pecu 2021;12(3):878-892

Comparaciones de estrategias de agrupación Las comparaciones entre las estrategias de agrupamiento se realizaron mediante: Las correlaciones producto-momento de Pearson y rango de Spearman entre los VGE obtenidos con y sin PPG. Las tendencias genéticas obtenidas para cada análisis, promediando los VGE por año de nacimiento.

Resultados y discusión Hubo 3,925 animales con padre desconocido, 3,258 animales con madre desconocida y 2,430 animales con padre y madre desconocidos. Los padres desconocidos fueron asignados a 12 o 24 GPF (G12 y G24; Cuadro 2). Los componentes de varianza obtenidos con y sin GPF se muestran en el Cuadro 3. Las estimaciones de los parámetros para los rasgos estudiados bajo diferentes escenarios fueron muy similares. Por lo tanto, la elección del modelo no debe interferir con la estimación de los parámetros genéticos. Cuadro 3: 3Componentes de varianza para el peso al nacimiento (PN), peso al destete (PD) y peso al año (PA) para la población Braunvieh mexicana estimados con 12 (G12), 24 (G24) y sin (G0) grupos de padres fantasmas 𝝈𝟐𝒎𝒑𝒆 Estrategia Rasgo 𝝈𝟐𝒖 𝝈𝟐𝒎 𝝈𝟐𝒆 PN 2.69 8.54 G0 PD 87.76 8.80 23.12 435.85 PA 86.27 692.96 PN 2.69 8.53 G12 PD 83.14 8.43 23.06 436.58 PA 81.30 695.01 PN 2.71 8.52 G24 PD 90.27 10.09 21.37 435.37 PA 85.72 692.52 2 2 𝜎𝑢2 = varianza genética aditiva, 𝜎𝑚 = varianza genética materna, 𝜎𝑚𝑝𝑒 = varianza ambiental permanente materna, 𝜎𝑒2 = varianza residual.

Theron et al(7) reportaron que la inclusión de GPF tiene una influencia menor en la estimación de los componentes de co(varianza), asimismo, Shiotsuki et al(16) mostraron que el uso de una matriz de relaciones que incluye grupos genéticos no genera diferencias en las estimaciones de la varianza contrastadas con el uso de una matriz sin grupos genéticos. En algunos estudios(7,8,10) se obtuvieron componentes de varianza considerando un modelo "control", el cual no incluía grupos genéticos, y esos componentes de varianza se utilizaron para predecir valores genéticos en un modelo que incluía GPF, similar al procedimiento aplicado en esta investigación. Las estadísticas descriptivas para VGE obtenidas con modelos que incluyen o excluyen GPF se muestran en el Cuadro 4. En un modelo animal básico, se asume la existencia de

884


Rev Mex Cienc Pecu 2021;12(3):878-892

un solo grupo genético(17). Dado que los valores genéticos son desviaciones de la media del grupo genético, todos los valores en la población base tienen una esperanza de cero(5,17). La metodología de grupos genéticos permite asignar efectos genéticos a múltiples grupos dentro de la población base, que podrían tener una media diferente(5). El VGE que incluye grupos genéticos considera que cada individuo hereda la media de los efectos en el grupo genético de sus padres más la media del valor genético de sus padres; por lo tanto, la esperanza del VGE para la población no es cero(5,17) porque no se cumple con el supuesto de distribución de los valores genéticos. Asignar padres desconocidos a GPF con un promedio posiblemente distinto de cero de mérito genético cambiaría el VGE de sus descendientes. En consecuencia, la media esperada del VGE obtenido tras considerar los grupos genéticos cambia para el producto Qg(3). Cuadro 44: Estadísticas descriptivas de los valores genéticos estimados para los rasgos de crecimiento obtenidos con 12 (G12), 24 (G24) y sin (G0) grupos de padres fantasmas para el ganado Braunvieh mexicano Estrategia Rasgo Mínimo Media ± DE Máximo PN -5.36 0.03 ± 0.79 5.13 G0 PD -26.67 -0.17 ± 3.87 25.32 PA -24.06 0.32 ± 3.39 24.34 PN -5.24 0.31 ± 0.83 5.37 G12 PD -18.73 14.19 ± 5.20 39.77 PA -50.60 -7.77 ± 4.81 18.08 PN -3.67 2.06 ± 0.88 7.57 G24 PD -53.15 -10.75 ± 8.17 32.23 PA -49.13 31.10 ± 7.27 82.12 PN= Peso al nacimiento, PD= Peso al destete, PA= Peso al año.

Las correlaciones producto-momento de Pearson y de rango de Spearman entre el VGE con y sin GPF se muestran en el Cuadro 5. Los coeficientes de correlación entre el VGE sin GPF (G0) y G12 fueron superiores a los de G0 y G24, para todos los rasgos y grupos de animales (es decir, machos y hembras, con y sin fenotipo). Las correlaciones fueron menores para los animales sin fenotipo que con fenotipo, y más bajas para las hembras que para los machos. En general, las correlaciones fueron más altas para PN que para PD, y más altas para PD que para PA (Cuadro 5). Se ha propuesto que los coeficientes de correlación entre el VGE inferiores a 0.90 podrían cambiar la jerarquización de los animales para la evaluación genética(18). Las estimaciones de los coeficientes de correlación obtenidos aquí sugieren posibles cambios en la jerarquización principalmente para PD y PA. Petrini et al(8) también señalaron cambios en el orden para PD debido a la inclusión de GPF (las estimaciones de correlación de Pearson y Spearman variaron de 0.50 a 0.70). Por otro lado, la inclusión de GPF resultó en pequeños cambios en la jerarquización de PN en este estudio. Los resultados para PN concuerdan con lo observado para la producción de leche(7), PA y la ganancia de peso posdestete(16), la circunferencia escrotal o la puntuación de 885


Rev Mex Cienc Pecu 2021;12(3):878-892

musculatura(8). Los cambios de orden se deben a los cambios que los grupos genéticos hacen en el VGE de sus descendientes. La Figura 1 ilustra el efecto de GPF en las tendencias genéticas. Las tendencias fueron relativamente similares para machos y hembras. Para PN, G12 aumentó la pendiente de la tendencia genética, en comparación con G0; G24 también aumentó la pendiente de la tendencia genética, pero mostró una desviación base de G0. Para PD, tanto G12 como G24 mostraron grandes fluctuaciones en los primeros años. Las tendencias genéticas de G12 y G24 mostraron diferencias base positivas y negativas con G0, respectivamente (Figura 1). Para PA, la tendencia genética de G24 mostró una gran desviación base de las tendencias genéticas de G0 y G12 (Figura 1). Generalmente, si una tendencia genética no pasa de cero, indica un problema base para los VGE. Por lo tanto, G24 está descartado para PN y PA, y G12 está descartado para PD, ya que G24 no cruza cero para PN y PA, y G12 no cruza cero para PD (Figura 1). Por otro lado, se espera que una estrategia de agrupación robusta funcione bien para diferentes rasgos(16), ya que una estrategia de agrupación de rasgos específica sería una complejidad adicional para las evaluaciones genéticas de rutina. Cuadro 55: Coeficientes de correlación de Pearson (y Spearman) entre los valores genéticos estimados sin grupos de padres fantasmas (VGE_G0), con 12 grupos de padres fantasmas (VGE_G12) y 24 grupos padres fantasmas (VGE_G24), en la población Braunvieh mexicana

Total de animales r(VGE_G0, VGE_G12) r(VGE_G0, VGE_G24)

Rasgo Peso al nacimiento n =57,341 0.959 (0.942) 0.912 (0.891)

Machos con fenotipo r(VGE_G0, VGE_G12) r(VGE_G0, VGE_G24)

n = 15,810 0.988 (0.982) 0.975 (0.964)

n = 10,748 0.914 (0.886) 0.786 (0.763)

n = 7,384 0.853 (0.846) 0.743 (0.737)

Machos sin fenotipo r(VGE_G0, VGE_G12) r(VGE_G0, VGE_G24)

n = 2,879 0.941 (0.923) 0.861 (0.830)

n = 7,941 0.796 (0.797) 0.606 (0.627)

n = 11,305 0.719 (0.760) 0.587 (0.636)

Hembras con fenotipo r(VGE_G0, VGE_G12) r(VGE_G0, VGE_G24)

n = 15,844 0.986 (0.979) 0.972 (0.960)

n = 10,585 0.901 (0.879) 0.752 (0.749)

n = 7,055 0.844 (0.840) 0.710 (0.743)

Hembras sin fenotipo r(VGE_G0, VGE_G12) r(VGE_G0, VGE_G24)

n = 22,808 0.895 (0.877) 0.799 (0.781)

n = 28,067 0.635 (0.659) 0.407 (0.491)

n = 31,597 0.596 (0.634) 0.445 (0.515)

Tipo de correlación

886

Peso al destete

Peso al año

n = 57,341 0.766 (0.766) 0.538 (0.610)

n = 57,341 0.692 (0.717) 0.535 (0.605)


Rev Mex Cienc Pecu 2021;12(3):878-892

Figura 11: Tendencias genéticas de los rasgos de crecimiento por MPLI (VGE (línea sólida)), MPLI con 12 grupos de padres fantasmas (VGE_G12 (línea discontinua)) y MPLI con 24 grupos de padres fantasmas (VGE_G24 (línea punteada)), con seis clases de años de nacimiento consideradas en los grupos de padres fantasmas

Sin embargo, en la práctica, una estrategia de agrupación puede funcionar bien para un rasgo, pero no para otro rasgo, especialmente si los efectos fijos son diferentes para los dos rasgos(8). Es probable que los posibles problemas con la implementación de GPF se deban a la colinealidad o confusión entre GPF y efectos fijos(3,5). Una solución a este problema es considerar a los GPF como efectos aleatorios. El efecto de la inclusión de GPF en la tendencia genética ha sido variable. Theron et al(7) mostraron que la inclusión de GPF en la evaluación genética tuvo un efecto drástico en la tendencia genética de los rasgos de producción de leche, teniendo una respuesta más

887


Rev Mex Cienc Pecu 2021;12(3):878-892

alta (casi el doble) cuando se incluyó GPF. Además, Shiotsuki et al(16) observaron tendencias genéticas más altas para el peso posdestete y PA cuando el modelo incluyó GPF. En contraste, la inclusión de GPF en los análisis genéticos para PD, circunferencia escrotal y puntuación de musculación mostró una tendencia genética más baja que cuando no se incluyeron GPF(8). Se podría inferir que la efectividad de los GPF en las evaluaciones genéticas depende de la estructura de la población, los rasgos estudiados y los criterios adoptados para definir los GPF. Se ha propuesto que la definición de los GPF debe equilibrar la complejidad de los grupos genéticos y la representación de las diferencias genéticas(8). Además, los grupos genéticos deben considerar los criterios de selección adoptados por los criadores. Se consideran dos posibles razones de los problemas observados con las tendencias genéticas: la escasez de fenotipos de la progenie que apoyan la inferencia de algunos GPF, y la posible confusión o colinealidad entre GPF y los efectos fijos en el modelo, especialmente los grupos contemporáneos. La Figura 2 muestra la frecuencia de animales, padres y madres faltantes a lo largo de los años de nacimiento, y la Figura 3 muestra la frecuencia de fenotipos por año de nacimiento. Se puede interpretar que no hubo suficientes fenotipos que respaldaran la predicción de soluciones de GPF en los primeros años (padres desconocidos nacidos antes de 1990, es decir, su progenie nacida antes de 1995). La contribución de los fenotipos disminuye a medida que aumenta el número de generaciones entre el GPF y el descendiente fenotipado, y disminuye con una menor heredabilidad. Figura 2: 2Número de animales (línea sólida), padres desconocidos (línea discontinua) y madres desconocidas (línea punteada) por año de nacimiento

888


Rev Mex Cienc Pecu 2021;12(3):878-892

Figura 3: Número de fenotipos de peso de nacimiento (línea sólida), peso al destete (línea discontinua) y peso al año (línea punteada) por año de nacimiento

La Figura 2 muestra que la población estudiada no tenía una necesidad real de GPF en el modelo animal, o que los GPF podrían limitarse a solo unos pocos grupos, de modo que los fenotipos de generaciones distantes de descendientes podrían respaldar la estimación de esos pocos GPF. Los modelos animales con GPF son más benéficos para las poblaciones con una prevalencia más alta y amplia de información de pedigrí faltante, especialmente si diferentes antecedentes genéticos (por ejemplo, materiales genéticos importados) o diferentes estrategias/presión de selección están involucrados en diferentes grupos de animales (por ejemplo, machos vs. hembras o diferentes vías de selección). Las tendencias genéticas (Figura 1) muestran que la población no ha estado bajo una selección eficiente, y existe una oportunidad excelente para el mejoramiento genético hacia la producción sostenible en los sistemas y ambientes de producción mexicanos. Las Figuras 2 y 3 también muestran problemas de recopilación de datos entre los años 2003 y 2014, y entre 2014 y 2017. La integridad y exactitud de los datos son esenciales para evaluaciones genéticas precisas y confiables. Como se mencionó en la subsección Datos, se obtuvo el pedigrí (parentesco) a partir de animales fenotipados. El número de animales y padres faltantes (Figura 2) fue mayor sin esta restricción. Sin embargo, en ese caso, hubo padres faltantes adicionales sin contribución del comportamiento de la progenie; por lo tanto, no hay información para hacer inferencias sobre ellos. Se recomienda extraer el pedigrí de animales fenotipados, decidir sobre la formación de grupos genéticos, luego agregar animales que no habían sido extraídos y asignar a sus padres desconocidos a los GPF existentes. Idealmente, debería haber una conectividad de grupo fija entre diferentes GPF (es decir, como el concepto de conectividad genética entre grupos fijos (niveles de un efecto fijo)). En otras palabras, los fenotipos de diferentes grupos de efectos fijos deben aportar

889


Rev Mex Cienc Pecu 2021;12(3):878-892

información a diferentes GPF. Incluso se ha recomendado formar (algunos) GPF compuestos tanto de padres y madres(8). El paquete "ggroups" de R(15) permite formar GPF de ambos sexos. Definiciones similares de GPF y algunos efectos fijos pueden causar colinealidad. En esa situación, el número de grupos de efectos fijos que aportan información a cada GPF disminuye. Una forma de comprobar la colinealidad dentro y entre los efectos fijos y GPF es comprobar el eigenvalor mínimo de [X Qp]ʹ[X Qp], donde Qp es Q con filas limitadas a animales fenotipados. Los problemas de estimación de GPF en el modelo no se limitan a este estudio. Estos problemas se observan a menudo debido a efectos de confusión (colinealidad) entre GPF(19). Incluso, al reducir tal confusión cambiando la composición de GPF, podría haber confusión entre GPF y otros efectos fijos. Esos problemas de estimabilidad se eliminaron y la estimación de valores genéticos parecen normales al considerar GPF como efectos aleatorios mediante la adición de 𝜎𝑒2 /𝜎𝑢2 a las diagonales de las ecuaciones de GPF en el modelo animal(19).

Conclusiones e implicaciones

Se probaron dos estrategias para agrupar a padres desconocidos en GPF (G12 y G24) en PN, PD y PA en ganado Braunvieh mexicano. Las dos estrategias utilizaron los criterios más comunes para definir los GPF (año de nacimiento de la progenie, sexo del padre desconocido para G12 y vía de selección para G24). Las tendencias genéticas tuvieron una desviación compensada de la tendencia genética de la MPLI sin GPF, a excepción de PN del G12. Además, la inclusión de GPF en el modelo puede haber causado colinealidad entre GPF y algunos efectos fijos. La escasez de fenotipos que respaldan las soluciones para algunos efectos de GPF fue otra razón para la falta de beneficio de las dos estrategias de agrupación en la población y los rasgos estudiados. Se recomienda definir los GPF con base en un subconjunto de pedigrí, en el que los padres están conectados a descendientes fenotipados, luego agregar el resto de animales y asignar a sus padres desconocidos a los GPF existentes, para evitar un número excesivo e innecesario de grupos genéticos. Más importante que el número de progenie por GPF o intervalos de años iguales que definen los GPF, es la cantidad de contribuciones fenotípicas para predecir los efectos de los GPF. Se recomienda tener menos traslape entre las definiciones de los GPF y los efectos fijos para reducir la colinealidad entre ellos.

Agradecimientos

Los autores agradecen al Consejo Nacional de Ciencia y Tecnología (CONACyT, México) por el apoyo financiero al primer autor durante sus estudios de doctorado. Los autores también agradecen a la Asociación Mexicana de Criadores de Ganado Suizo de

890


Rev Mex Cienc Pecu 2021;12(3):878-892

Registro por permitir el uso de sus datos, y al Dr. Dale Van Vleck por brindar su ayuda y apoyo con el software MTDFREML. Literatura citada: 1. AMCGSR. Asociación Mexicana de Criadores de Ganado Suizo de Registro. Resumen de evaluaciones genéticas para ganado Suizo Americano 2017. Techn Bull. Mexico. 2018. 2. Van Vleck LD. 1970. Miss-identification in estimating the paternal sib correlation. J Dairy Sci 1970;53:1469-1474. 3. Quaas RL. Additive genetic model with groups and relationships. J Dairy Sci 1988;71:1338-1345. 4. Westell RA, Quass RL, Van Vleck LD. Genetic groups in an Animal Model. J Dairy Sci 1988;71:1310-1318. 5. Wolak ME, Reid JM. Accounting for genetic differences among unknown parents in microevolutionary studies: How to include genetic groups in quantitative genetics animal models. J Anim Ecol 2017;86:7-20. 6. Fikse F. Fuzzy classification of phantom parent group in an animal model. Genet Sel Evol 2009;41:1-8. 7. Theron HE, Kanfer FHJ, Rautenbach L. The effect of phantom parent groups on genetic trend estimation. South African J Anim Sci 2002;32:130-135. 8. Petrini J, Pertile SF, Eler JP, Ferraz JB, Mattos EC, Figuereido LG, et al. Genetic grouping strategies in selection efficiency of composite beef cattle (Bos taurus x Bos indicus). J Anim Sci 2015;93:541-552. 9. Pollak EJ, Quass RL. Definition of group effect in sire evaluation models. J Dairy Sci 1983;66:1503-1509. 10. Oliveira Junior GA, Eler JP, Ferraz JBS, Petrini J, Mattos EC, Mourão GB. Definição de grupos genéticos aditivos visando melhor predição de valores genéticos em bovinos de corte. Rev Bras Saúde Prod Anim 2013;14:277-286. 11. BIF. Beef Improvement Federation. Guidelines for Uniform Beef Improvement Programs. 9th ed. North Carolina State University, Raleigh, NC, USA. 2018. 12. Henderson CR. Best linear unbiased and prediction under a selection model. Biometrics 1975;31:423-447. 13. Boldman KG, Kriese LA, Van Vleck LD, Van Tassell CP, Kachman SD. A manual for use of MTDFREML, a set of programs to obtain estimates of variances and (co)variances. Washington, DC: USDA, ARS. 1995.

891


Rev Mex Cienc Pecu 2021;12(3):878-892

14. Quass RL, Pollack EJ. Modified equations for sire models with groups. J Dairy Sci 1981;64:1868-1872. 15. Nilforooshan MA, Saavedra-Jiménez LA. ggroups: a R package for pedigree and genetic groups data. Hereditas 2020;157:17. 16. Shiotsuki L, Cardoso FF, Silva JAIIV, Albuquerque LG. Comparison of a genetic group and unknown paternity models for growth traits in Nellore cattle. J Anim Sci 2013;91:5135-5143. 17. Van Vleck LD. Breeding value prediction with maternal genetic groups. J Anim Sci 1990;68:3998-4013. 18. Crews DH, Franke DE. Heterogeneity of variances for carcass traits by percentage Brahman inheritance. J Anim Sci 1998;73:1803-1908. 19. Schaeffer LR. Necessary changes to improve animal models. J Anim Breed Genet 2018;135:124-131.

892


https://doi.org/10.22319/rmcp.v12i3.5431 Artículo

Evaluación mineral de los componentes del sistema silvopastoril intensivo con Leucaena leucocephala en tres épocas del año

Andrés Camilo Rodríguez-Serrano a Alejandro Lara-Bueno a* José Guadalupe García-Muñiz a Maximino Huerta-Bravo a Citlalli Celeste González-Aricega a

a

Universidad Autónoma Chapingo. Departamento de Zootecnia, Posgrado en Producción Animal, Km 38.5 carretera México -Texcoco, Chapingo, Estado de México, México.

*Autor para correspondencia: alarab_11@hotmail.com

Resumen: Se realizó evaluación mineral de los componentes del sistema silvopastoril intensivo, suelo, agua de bebida, forraje (Leucaena leucocephala, Megathyrsus máximus) y suero sanguíneo de becerros y vacas lecheras. Se realizaron tres muestreos, en las épocas de frío, secas y lluvias. Se determinaron y analizaron Cu, Fe, Zn, Ca, Mg, K, Na y P. Se encontraron niveles elevados de Fe, Ca, K y Mg en suelo, mientras que los minerales del agua de bebida permanecieron dentro de los rangos adecuados, con excepción del Fe (0.61 y 0.57 mg kg-1) en los ranchos El Vivero y Los Huarinches, respectivamente. La concentración de Ca, Mg, K y Na fue mayor en Leucaena leucocephala que en Megathyrsus máximus, mientras que el contenido de Cu (6.16 y 5.66 mg kg-1), Zn (17.9 y 24.4) y P (2,584.5 y 2,682.8 mg kg-1) en ambos ranchos no satisfacen los requerimientos de las vacas, lo que pudo generar niveles bajos de estos elementos en suero sanguíneo, tanto en las vacas como en las crías: Cu (0.64 y 0.54 mg kg-1), Zn (0.74 y 0.60 mg kg-1) y P (49.24 y 39.43 mg kg-1), respectivamente.

893


Rev Mex Cienc Pecu 2021;12(3):893-909

Palabras clave: Minerales, Nutrición animal, Megathyrsus maximus, Agroforestería, Silvopastoreo.

Recibido: 25/06/2019 Aceptado: 18/11/2020

Introducción Los componentes básicos de un sistema silvopastoril, pasturas, arbóreas, animales y suelo, interactúan entre sí bajo un flujo constante de elementos(1) de forma tal que los niveles de producción y el estado nutricional de los animales, dependen del grado en que se cubren requisitos nutrimentales. Esto está directamente relacionado con la concentración de nutrientes presentes, tanto en las pasturas como en el follaje de árboles forrajeros, y estos a su vez están influenciados por la fertilidad del suelo y la cantidad de minerales que las plantas forrajeras puedan absorber(2). Normalmente, las gramíneas forrajeras no proveen suficientes macronutrientes (N, Ca, Mg, K y P), micronutrientes (Cu, Zn, Fe) y otros elementos(3,4) requeridos por los animales para lograr determinados parámetros productivos, por tal motivo, se ha promovido el establecimiento de sistemas silvopastoriles intensivos (más de 7,000 árboles ha-1) con leguminosas como la Leucaena leucocephala (LL)(5). El cultivo de LL asociada con gramíneas forrajeras es una estrategia que, además de incrementar la oferta de alimento para rumiantes en pastoreo, contribuye a mejorar la calidad del mismo, y a corregir posibles desbalances nutricionales de solo pasturas. Sin embargo, y a pesar de que las leguminosas, normalmente, son más ricas en macro y microelementos que las gramíneas forrajeras(6) diversos factores afectan el contenido de cada elemento en las plantas de LL. Entre esos factores se encuentran la especie, genotipo, partes de la planta, estado de crecimiento y fertilidad del suelo(7). Del mismo modo, las concentraciones séricas de minerales en los animales son afectadas por las interacciones entre la cantidad de cada elemento que ingiere el animal en el alimento y el agua de bebida. Algunos minerales pueden interactuar en formas que pueden desencadenar la correcta absorción de otros minerales en el tracto digestivo y cumplir en conjunto con varias funciones metabólicas(8), o pueden inhibir la absorción de uno o más elementos y producir efectos antagónicos mediante la formación de complejos no absorbibles, a través de competencia entre cationes y aniones(6), lo que puede generar una disminución en los parámetros productivos esperados. Dado lo anterior, el estado mineral de un sistema silvopastoril intensivo, está determinado por el aporte de elementos minerales de cada factor que compone al sistema, a través del 894


Rev Mex Cienc Pecu 2021;12(3):893-909

tiempo. Por tal motivo, el objetivo de la presente investigación fue evaluar el contenido mineral de los componentes de sistemas silvopastoriles intensivos (animal, pastura, follaje de la arbórea, suelo y agua) en tres épocas del año, en dos ranchos ganaderos ubicados en Apatzingán y Tepalcatepec, Michoacán, México, para determinar el aporte de minerales y nutrientes y proponer alternativas para corregir posibles desbalances nutrimentales.

Material y métodos La investigación se realizó en dos ranchos ganaderos (El Vivero y Los Huarinches) ubicados, respectivamente, en los municipios de Apatzingán y Tepalcatepec, en la región de Tierra Caliente, en el Estado de Michoacán, México. Ambos ranchos son pioneros en la implementación de sistemas silvopastoriles intensivos (SSPi) con Leucaena leucocephala y pasto Tanzania con experiencia de más de 10 años de establecido el sistema de pastoreo y en la producción de leche para la elaboración de queso cotija (rancho Huarinches) y más recientemente en el mantenimiento y desarrollo de bovinos de la raza criollo lechero tropical y Romosinuano (rancho El Vivero). La zona de estudio está ubicada a 350-370 msnm, cuenta con un clima cálido subhúmedo con lluvias en verano, con temperatura media anual de 28.5 °C y precipitación promedio anual de 822 mm, el pH del suelo (7.34) es entre neutro a alcalino(9,10).

Sistema silvopastoril intensivo En los dos ranchos ganaderos el SSPi consta de arbustos de Leucaena leucocephala en hileras cada 1.60 m, con densidades de 34,500 pantas ha-1, en asociación con pasto Tanzania (Megathyrsus maximus), que componen la oferta de alimento de 60 % gramínea y 40 % leguminosa. El pastoreo se realiza siguiendo un esquema rotativo de 4 días x 40 de descanso, con riego en épocas secas.

Muestreos Se realizaron tres muestreos correspondientes a las épocas agroecológicas más determinantes para la producción agropecuaria en la zona(10,11,12). Lluvias (agosto), Frío (enero) y Seca (mayo) para un total de tres colectas.

Gramíneas y arbóreas Se realizaron muestreos en cada rancho ganadero en las épocas establecidas, adaptando la metodología utilizada por Bacab-Pérez et al(13), se implementaron cuadrantes de 1.60 x 1.60 m que se ubicaron sobre el surco de LL, el cual se consideró como la línea media de cada cuadro; se distribuyeron aleatoriamente ocho cuadrantes sobre los potreros que al día 895


Rev Mex Cienc Pecu 2021;12(3):893-909

siguiente serían aprovechados por los animales, y que a su vez cumplían 40 días de rebrote. El pasto Tanzania se cosechó a 30 cm del suelo y LL se defolió de forma manual tomando hojas y tallos tiernos, simulando el pastoreo y ramoneo realizado por los animales; el material vegetal fue homogeneizado y se seleccionó una submuestra de 1 kg de cada especie vegetal. Las muestras se secaron en estufa de aire forzado a 60 °C hasta temperatura constante y se llevaron a laboratorio para el posterior análisis.

Suero sanguíneo Se recolectaron muestras de sangre de 8 vacas y 8 crías por cada raza presente en los ranchos (Criollo Lechero Tropical, Suizo Americano y cruza comercial). En animales adultos, la muestra de sangre se extrajo de la vena coccígea y en los animales jóvenes de la vena yugular. La sangre se centrifugó a 3,000 rpm durante 15 min para la separación del suero sanguíneo y su conservación a -20 ºC.

Suelo y agua Se recolectaron 8 muestras de suelo con el fin de abarcar la mayor variedad de niveles de oferta de forraje presentes en cada potrero, a profundidades de 0 a 15 y 15 a 30 cm, en cada rancho ganadero y en cada época del año, las cuales se secaron y tamizaron con malla de 0.2 mm. Se tomaron tres muestras de agua directamente de los bebederos de cada potrero por cada rancho ganadero y cada época del año.

Análisis de minerales Las concentraciones de Cu, Fe, Zn, Ca, Mg, K y Na, en forraje, suero sanguíneo, suelo y agua, se determinaron mediante los procedimientos descritos por Fick et al(14), utilizando un espectrofotómetro de absorción atómica modelo AAnalyst 700 de PerkinElmer. La concentración de P se determinó mediante colorimetría(14).

Análisis estadístico Para los datos del contenido mineral de las muestras de suelo se utilizó el siguiente modelo estadístico: 𝑌𝑖𝑗𝑘 = 𝜇 + 𝑃𝑖 + 𝑆𝑗 + 𝑅𝑘 + (𝑆𝑅)𝑗𝑘 + 𝜀𝑖𝑗𝑘𝑙 Donde Yijk= concentración del mineral; Pi= efecto de la i-ésima profundidad (0-15, 15-30 cm); Sj= efecto de la j-ésima época del año (lluvias, frío, seca); Rk= efecto del k-ésimo rancho (Los Huarinches, El Vivero); 896


Rev Mex Cienc Pecu 2021;12(3):893-909

SRjk= efecto de la interacción entre la época del año y el rancho ganadero. Para el análisis de los datos de la composición mineral del agua se utilizó el siguiente modelo estadístico: 𝑌𝑖𝑗𝑘 = 𝜇 + 𝑆𝑗 + 𝑅𝑘 + (𝑆𝑅)𝑗𝑘 + 𝜀𝑖𝑗𝑘𝑙 Donde Yijk= concentración del mineral en agua; Sj= efecto de la j-ésima época del año (lluvias, frío, seca); Rk= efecto del k-ésimo del rancho ganadero (Los Huarinches, El Vivero); SRjk= efecto de la interacción entre la época del año y el rancho ganadero. Para el análisis de los datos del contenido nutrimental del follaje de LL y pasto Tanzania se utilizó el siguiente modelo estadístico: 𝑌𝑖𝑗𝑘 = 𝜇 + 𝐸𝑖 + 𝑆𝑗 + 𝑅𝑘 + (𝑆𝑅)𝑗𝑘 + 𝜀𝑖𝑗𝑘𝑙 Donde Yijk= concentración del nutriente; Si= efecto de la i-ésima época (lluvias, frío, seca); Ej= efecto de la j-ésima especie forrajera (pasto Tanzania, leucaena); Rk= efecto del k-ésimo del rancho ganadero (Los Huarinches, El Vivero). Para el análisis de la concentración mineral de las muestras de suero sanguíneo se utilizó el siguiente modelo estadístico: 𝑌𝑖𝑗𝑘𝑙 = 𝜇 + 𝐸𝑖 + 𝑆𝑗 + 𝑅𝑘 + (𝑆𝑅)𝑗𝑘 + (𝐸𝑅)𝑖𝑘 + (𝐸𝑆)𝑖𝑗 + (𝐸𝑆𝑅)𝑖𝑗𝑘 + 𝜀𝑖𝑗𝑘𝑙 Donde Yijkl= concentración del mineral en el suero sanguíneo; Ei= efecto de la i-ésima etapa fisiológica del animal (vaca, cría); Sj= efecto de la j-ésima época el año (lluvias, frío, seca); Rk= efecto del k-ésimo rancho (Los Huarinches, El Vivero); ERik=efecto de la interacción entre etapa fisiológica del animal y el rancho ganadero; ESij= efecto de la interacción entre la etapa fisiológica del animal y la época del año; ESRijk= efecto de la interacción entre la etapa fisiológica del animal, época del año y rancho ganadero. Los datos se analizaron mediante el procedimiento GLM del software estadístico SAS(15) y la comparación de medias entre los tratamientos se hizo mediante la prueba de Tukey con un nivel de significancia de 0.05.

897


Rev Mex Cienc Pecu 2021;12(3):893-909

Resultados y discusión Suelo y agua La concentración de Cu (14.73 vs 14.04 mg kg-1), Zn (49.07 vs 47.37 mg kg-1), Fe (1661 vs 1672 mg kg-1), Ca (9412 vs 9679 mg kg-1), K (1963 vs 1870 mg kg-1) y Mg, (5275 vs 5328 mg kg-1) fue similar (P>0.05) en las dos profundidades del suelo (0 a 15 y 15 a 30 cm), respectivamente. Esto probablemente debido a que en ambos ranchos ganaderos el suelo es profundo, lo que facilita el transporte de agua y nutrientes hacia las raíces profundas(16), además, los sistemas silvopastoriles pueden mantener y mejorar la porosidad, infiltración y aireación del suelo(17,18). Sin embargo, la concentración mineral del suelo mostró diferencias entre los ranchos ganaderos estudiados, evidenciando diferentes condiciones edáficas en los sitios de evaluación (Cuadro 1). En los suelos de ambos ranchos se tienen niveles adecuados de Cu y Zn para el desarrollo de las plantas; mientras que, los niveles de Fe son elevados, ya que en suelos con pH neutro o alcalino se favorece la fijación de estos minerales(19); mientras que los niveles de Ca, K y Mg, a pesar de ser elevados, en especial en el rancho El Vivero, concuerdan con la disponibilidad generada por el pH del suelo. El alto contenido de minerales en el suelo de ambos ranchos puede estar influenciado por la cercanía de la zona de estudio con otros predios agrícolas dedicados a la producción de limón, el cual es demandante de fertilización constante con macro y microelementos como N, P, K Ca, Mg, S, Mn, Fe, Zn, Cu y B(20). Sin embargo, en suelos con alto contenido de materia orgánica, nitrógeno y fósforo, como es el caso de los suelos con manejo silvopastoril, se puede obstaculizar la disponibilidad del Cu, lo cual puede crear deficiencia inducida de ese elemento en los pastos y en el animal que consume esos pastos, y esas carencias de Cu pueden acentuarse por exceso de zinc o manganeso(21). Cabe señalar que varios elementos minerales, entre ellos el zinc, incrementan la biodisponibilidad en el suelo en un rango de entre 5 a 77, pero fuera de este rango cambian su estado iónico y precipitan como hidróxido, carbonato o sulfuro, por lo que la solubilidad, movilidad de estos compuestos disminuyen conforme aumenta el pH o disminuye del suelo(22).

898


Rev Mex Cienc Pecu 2021;12(3):893-909

Cuadro 1: Efectos de rancho ganadero y época del año en la concentración mineral (mg kg-1) del suelo en el sistema silvopastoril intensivo Efecto Rancho

Cu

Zn

Fe

16.2 a 64.5 a 1,858 a 12.5 b 31.8 b 1,478 b 0.34 1.36 75.59 Efecto de época × rancho El Vivero: Frío 12.85 a 31.43 a 1,711 a Lluvias 11.76 b 32.55 a 1,606 a Secas 13.04 a 31.65 a 1,115 b EEM 0.31 1 97.25 Efecto de época × rancho Los Huarinches: Frío 16.06 a 57.5 b 1,928 b Lluvias 17.9 a 78.74 a 2,245 a Secas 14.84 b 57.45 b 1,400 b EEM 0.65 2.03 1,52.3 Los Huarinches El Vivero EEMy

Nivel adecuado ab

5-30x

20-150x 50-500x

Ca

Mg

5,042 b 14,049 a 541.8

4,637 b 5,965 a 111.8

2,460 a 1,373 b 319.8

1,2875 b 1,2368 b 1,6903 a 875.2

6,970 a 5,378 a 5,547 a 616

1,926 a 1,712 a 482.6 b 136.28

4,540 a 4,976 a 5,585 a 4,241 a 5,001 a 4,693 a 997.7 482.2 1000 – 80-200v 2000w

K

2,219 b 3,231 a 1,930 b 482.2 60-180 v

EEM= error estándar de la media; x(25) v(26) w(27). Medias en la misma columna con distinta literal muestran diferencias (P<0.05).

La interacción entre rancho ganadero y época del año en la concentración de Cu, Zn, Ca y K en el suelo fue importante (P<0.05, Cuadro 1). La mayor concentración de Cu total en suelo en el rancho El Vivero fue mayor en la época seca, mientras que en Los Huarinches fue en la época lluviosa; en el caso del Zn, la concentración en suelo fue superior en el rancho Los Huarinches, donde se presentó mayor nivel del elemento durante las lluvias, mientras que en el rancho El Vivero, no se presentaron diferencias significativas entre las épocas del año (P>0.05); lo contrario ocurrió en el rancho El Vivero para el contenido de Ca en el suelo, ya que durante la época seca el nivel del este elemento fue mayor, mientras que en Los Huarinches no hubo diferencias significativas en la concentración de Ca en el suelo entre las diferentes épocas del año (P>0.05). Estos resultados evidencian que ante condiciones ambientales similares (temperatura y precipitación), particularidades específicas de cada rancho pueden modificar el grado de influencia sobre la concentración mineral en el suelo; por ejemplo, la disponibilidad de Cu puede afectarse por la humedad y textura del suelo, competencia con elementos como Fe y Zn y elevados niveles de materia orgánica (MO), por el contrario el Zn además de competir con Cu, puede disminuir su disponibilidad debido a bajos niveles de MO(23). Roberts(24) encontró diferentes modificaciones en la concentración de minerales en dos regiones de Nueva Zelanda, en las mismas épocas de muestreo, atribuidas entre otras cosas a la capacidad del sistema silvopastoril de reincorporar nutrientes al suelo, mediante aportes de biomasa o excreciones de los animales. Cabe anotar que los 899


Rev Mex Cienc Pecu 2021;12(3):893-909

ranchos analizados trabajan con diferentes cargas animal y presentan objetivos de producción diferentes, por lo que las diferencias en el manejo de los animales (acordes con cada objetivo de producción) podrían incidir en los cambios en la concentración de minerales en el suelo. Las variaciones en la concentración mineral en el suelo de los ranchos evaluados, en relación con la época del año, puede ser originada por aspectos inherentes al manejo de cada sistema de producción y a condiciones ambientales de cada lugar, aunque las similitudes presentes en temperatura y precipitación no son suficientes para explicar el comportamiento de la concentración mineral en el suelo. Los minerales en el suelo tienen interacciones complejas con el pH, que controlan la movilidad y el intercambio de iones, su precipitación y disolución, las reacciones de óxido- reducción, la actividad microbiana y la disponibilidad de nutrientes(28). Hay también fuertes interacciones con la materia orgánica (MO) del suelo; un exceso de materia orgánica en el suelo disminuye la absorción de varios minerales por las plantas(29). Por esta razón, es importante señalar que el manejo de las formas de producción serán determinantes para la acumulación de los elementos minerales, más que aspectos de condición ambiental, como puede suceder en los sistemas silvopastoriles intensivos moduladores del contenido de materia orgánica, pH y aportadores de N al suelo. Las concentraciones de minerales, excepto Fe, en el agua de bebida en ambos ranchos ganaderos y en las diferentes épocas evaluadas, estuvieron por debajo de los niveles adecuados sugeridos(30): Cu (<1 mg L-1), Zn (<8 mg L-1), Fe (<0.4 mg L-1), Ca (<1,000 mg L-1), Mg (<1,000 mg L-1) y K (<20 mg L-1). No obstante, los niveles de Ca y Mg registrados en el agua de bebida fueron mayores a los requeridos (P<0.05) en el rancho El Vivero (30.55 y 46.15 mg L-1, para cada elemento, respectivamente) comparado con el estatus de esos elementos en el rancho Los Huarinches (10.35 y 9.01 mg L-1 para cada elemento, respectivamente). Del mismo modo, el nivel de Fe en el agua de bebida para el ganado en los ranchos El Vivero y Los Huarinches fue de 0.61 y 0.57 mg L-1, respectivamente, concentraciones superiores al nivel máximo tolerable sugerido por Puls(30) (<0.4 mg L-1), a partir del cual pueden aparecer síntomas de intoxicación por Fe en los animales. Estos datos son congruentes con la elevada concentración de Fe presente en los suelos de ambos ranchos ganaderos.

Forraje Las concentraciones de Ca, Mg, K y Na fueron más altas en el follaje de LL que el pasto Tanzania (Cuadro 2); sin embargo, la concentración de Zn fue mayor en la gramínea que en la leguminosa. Ambas especies forrajeras tuvieron concentraciones de Cu, Zn y P por debajo de los requeridos para bovinos. Estos resultados concuerdan con los ya reportados(31), donde se menciona que la deficiencia de P es una condición predominante en sistemas de pastoreo en el trópico. Adicionalmente(32) se reportan valores promedio de Zn y Cu, inferiores al

900


Rev Mex Cienc Pecu 2021;12(3):893-909

requerimiento de bovinos para diferentes especies de gramíneas y leguminosas, evidenciando que los sistemas de producción en pastoreo, incluyendo los SSP, pueden ser limitados para cubrir los requerimientos mínimos de estos elementos. Los contenidos de Ca, Mg, K y Na de la leucaena fueron superiores a los requeridos para vacas lecheras, lo cual es congruente con la elevada concentración de Ca, Mg y K en los suelos de ambos ranchos ganaderos, evidenciando también la habilidad de la leguminosa sobre la gramínea para absorber del suelo mayor cantidad de estos elementos, ya que la especie se desarrolla mejor en suelos con mayor contenido de Ca intercambiable(33). De este modo, se han reportado niveles de Ca, Mg y K en leucaena de hasta 30,000, 23,000 y 11,000 mg kg-1, respetivamente(34,35,36). Cuadro 2: Efectos de la especie forrajera en la concentración mineral de leucaena y pasto Tanzania en el sistema silvopstoril intensivo (mg kg-1) Nutriente Leucaena Tanzania EEM Requerimientou Cobre 6.1 a 5.6 a 0.35 10 – 11 a a Fierro 94.1 83.9 4.85 12 – 18 b a Zinc 17.9 24.4 0.89 43 – 55 a b Calcio 11,569 3,320 426.7 5,700 – 6,700 a b Magnesio 2,532 1,858 136.5 1,800 – 2,100 a b Potasio 16,411 9,981 1,203 11,000 – 11,900 a b Sodio 4,595 2,409 337.8 2,000 – 2,200 Fósforo 2,585 a 2,683 a 132 3,200 – 3,700 a b Ca:P 4.5 1.2 0.20 1.5 – 2t EEM = error estándar de la media; u(37) t(38). ab Medias en la misma fila con distinta literal muestran diferencias (P<0.05).

Los contenidos de Ca, Na y P, así como la relación Ca:P en el pasto Tanzania fueron diferentes entre ambos ranchos ganaderos (Cuadro 3); estos, con excepción de Na, están por abajo del requerimiento para vacas lecheras en pastoreo, evidenciando que, independientemente de las condiciones específicas de cada región, la gramínea por sí sola no aporta esos minerales para el mantenimiento y producción de los animales, en especial Ca. Esto puede darse porque las gramíneas de climas cálidos, suelen tener menores contenidos de minerales que las gramíneas de clima templado(32), y por las condiciones ambientales de cada región, lo cual se observa también en los resultados del trabajo realizado por Morales et al(39), quienes registraron concentraciones máximas de Ca y P en Lolium perenne, en el Valle Central de México, de hasta 5,830 mg kg-1 y 4,400 mg kg-1 y mínimas de 2,540 mg kg-1 y 2,400 mg kg-1, respectivamente, evidenciando la influencia del ambiente sobre la concentración de estos elementos en las gramíneas.

901


Rev Mex Cienc Pecu 2021;12(3):893-909

Por el contrario, los contenidos de Cu, Mg, K y Na de LL mostraron diferencias (P>0.05) entre los ranchos estudiados (Cuadro 3), posiblemente, por la capacidad de las arbóreas de almacenar mayor cantidad de minerales y de extraerlos de horizontes más profundos del suelo(40,41). Cuadro 3: Efectos de rancho ganadero en la concentración mineral de leucaena y pasto Tanzania en el sistema silvopastoril intensivo (mg kg-1) Leucaena Mineral El Vivero Los Huarinches EEM Requerimientox Cobre 6.8 b 5.39 a 0.38 10 – 11 a a Fierro 96.3 91.2 5.7 12 – 18 a a Zinc 17.1 18.3 0.49 43 – 55 a a Calcio 12,257 10,908 830 5,700 – 6,700 a b Magnesio 2,943 2,075 122.5 1,800 – 2,100 a b Potasio 18,560 13,984 1,490 11,000 – 11,900 b a Sodio 3,452 5,604 421.9 2,000 – 2,200 a a Fósforo 2,542 2,630 85.6 3,200 – 3,700 a a Ca:P 4.46 4.41 0.044 1.5 – 2w Tanzania -1 a Cu, mg kg 5.8 5.5 a 0.22 10 – 11 -1 a a Fe, mg kg 82.7 86.7 3.62 12 – 18 -1 a a Zn, mg kg 25.4 23.4 1.29 43 – 55 -1 b a Ca, mg kg 2,784 3,894 135.4 5,700 – 6,700 -1 a a Mg, mg kg 1,925 1,839 92.7 1,800 – 2,100 -1 a a K, mg kg 9,340 10,386 964 11,000 – 11,900 -1 a b Na, mg kg 2,806 2,095 155.8 2,000 – 2,200 -1 a b P, mg kg 2,540 2,822 70.6 3,200 – 3,700 b a Ca:P 1.14 1.37 0.06 1.5 – 2w EEM = Error estándar de la media; x(36), w(37). ab Medias en la misma fila con distinta literal muestran diferencias (P<0.05).

Las concentraciones de Ca para LL son superiores a las obtenidas en otro trabajo(42) en la Huasteca Potosina de México, donde se registraron niveles de Ca de 2,300 mg kg-1, y una relación Ca:P de 0.81; la concentración superior de Ca en LL obtenida en el presente estudio condujo al incremento en la relación Ca:P (4.5), la cual es superior a la recomendada. La época del año influyó en el contenido mineral de leucaena y pasto Tanzania, de manera tal que los niveles de Cu durante el periodo seco fueron menores que en la estación de lluviosa, esto fue contrario a lo reportado por otros investigadores(43) quienes encontraron mayor concentración de Cu en la época seca (9.4 mg kg-1) en comparación con la época de lluvias (8.94 mg kg-1) en la región cálido húmeda de Pangasinan, Filipinas; no obstante, para 902


Rev Mex Cienc Pecu 2021;12(3):893-909

el pasto Tanzania hubo menor contenido de Cu en la época fría. Potasio registró mayor concentración en leucaena, durante la estación fría, mientras que la gramínea mostró concentraciones máximas de K de 14,823 mg kg-1 durante la época de lluvias, en concordancia con las fluctuaciones del ese elemento en el suelo. Las concentraciones de Mg y P en LL fueron similares (P>0.05) entre las tres estaciones del año, contrario a lo observado en el pasto Tanzania, en la que estos elementos registraron mayor concentración en la época de frío, mientras que los niveles de Fe, K y Ca, en LL fueron mayores que en pasto estrella durante la estación fría, probablemente, por la reducción de la tasa de crecimiento de la leguminosa en la estación fresca del año (Cuadro 4). Cuadro 4: Efecto de la época del año en la concentración mineral (mg kg-1) de leucaena y pasto Tanzania en el sistema silvopastoril intensivo Época Cu Zn Fe Ca Mg K Na P Ca:P Leucaena Frío Lluvias Secas EEM

6.8 a 7.4 a 4b 0.47

21.1 a 16.3 b 16.4 b 0.60

114.4 a 86.2 b 80.4 b 7.04

24.3 a 22.2 a 26.6 a 1.6 43 - 55

100.9 a 67.2 b 86.1 a 4.4 12 – 18

13,094 a 9,673 a 11,979 a 1,025

2,758 a 2,295 a 2,476 a 151.2

20,927 a 15,782 b 12,106 b 1,839

3,196 b 3,000 b 7,521 a 520.7

2,759 a 2,411 a 2,588 a 105.6

4.8 a 3.88 a 4.9 a 0.54

Tanzania Frío Lluvias Secas EEM Req.

4,245 a 2,799 a 5,590 b 3,501 a 2,891 a 2,363 c 1,091 c 14,823 a 1,769 b 2,584 b b b b 3,409 1,755 9,176 2,081 b 2,570 b 164.8 112.8 1,173 189.7 86 5,700 – 1,800 – 11,000 – 2,000 – 3,200 – 6,700 2,100 11,900 2,200 3,700 EEM = Error estándar de la media; Req= requerimiento (36) w(37). abc Medias en la misma columna con distinta literal muestran diferencias (P<0.05).

4.2c 6.9 a 5.9 b 0.27 10 – 11

1.47 a 0.95 b 1.34 a 0.07 1.5 – 2w

Suero sanguíneo No hubo efecto de la interacción entre ranchos ganaderos y etapa fisiológica del animal (P>0.05) en la concentración de los minerales analizados. Sin embargo, la interacción entre la época del año y la etapa fisiológica fue importante (P<0.05) en el contenido de Zn, Ca, y Na, ya que la concentración de Zn en el suero sanguíneo de las vacas fue menor a la de las crías, y menor en la época lluviosa y seca que en la época fría; del mismo modo, los niveles de Ca fueron inferiores en la época seca, aunque las concentraciones séricas de Ca se mantuvieron dentro de los rangos adecuados. La triple interacción (rancho ganadero, época del año y etapa fisiológica del animal) fue importante (P<0.05) para las concentraciones séricas de Cu y Mg. Asimismo, los efectos individuales de rancho ganadero, etapa fisiológica del animal y época del año, influyeron en las concentraciones de la mayoría de los minerales en el suero sanguíneo (Cuadro 5).

903


Rev Mex Cienc Pecu 2021;12(3):893-909

Cuadro 5: Concentración mineral (mg kg-1) en suero sanguíneo de vacas y crías pastando en el sistema silvopastoril intensivo en dos ranchos, en tres épocas del año Cu Huarinches 0.6 a El Vivero 0.5 b EEM 0.01 Época Frío 0.6 a Lluvias 0.5 a Secas 0.5 b EEM 0.02 Etapa fisiológica Cría 0.6 a Vaca 0.5 b EEM 0.017 Rango 0.8 adecuado 1.5 Efectos e interacciones Rancho ** Época * Etapa *** R*S NS R*E NS S*E NS R*S*E **

Zn

Fe

Ca

Mg

K

0.7 a 0.6 b 0.018

2.7 a 1.7 b 0.15

Rancho 110.1 a 19.7 a 109.0 a 19.6 a 2.42 0.50

238.3 a 196.7 b 6.88

0.7 a 0.6 a 0.6 a 0.21

2.2 a 2.4 a 2.1 a 0.20

130.1 a 100.7 b 97.8 b 3.07

19.7 a 20.9 a 18.5 b 0.6

0.7 a 0.6 b 0.019 0.81.4

2.5 a 2.0 b 0.16 1.32.5

108.7 a 110.4 a 2.50 80-110

.** NS *** ** NS ** NS

*** NS * *** NS NS NS

NS *** NS *** NS ** NS

Na

P

Ca:P

2791 a 2371 b 62.24

45.4 a 43.2 a 1.01

2.6 a 2.5 a 0.06

231.4 a 192.4 b 228.6 a 8.5

2575 a 2741 a 2427 b 77.6

39.2 b 48.8 a 44.8 a 1.23

3.4 a 2.1 b 2.2 b 0.08

17.4 b 21.9 a 0.51 18-35

219.1 a 215.8 a 7.03 159198

2634 a 2528 a 63.50 30153450

49.2 a 39.4 b 1.03 45-60

2.2 b 2.9 a 0.06 1.32.7

NS * *** NS NS NS *

** .** NS *** NS NS NS

*** *** NS ** NS * NS

NS *** *** NS NS NS NS

NS *** *** ** NS NS NS

EEM = Error estándar de la media; Rango adecuado(26); R=rancho, S=época, E=etapa fisiológica. ab Medias en la misma columna con distinta literal muestran diferencias (P<0.05). NS= No significativo; *= (P<0.05); **= (P<0.01); *= (P<0.001).

En ninguno de los ranchos evaluados, el nivel de Cu y Zn es suficiente para cubrir lo recomendado(27), lo cual es congruente con los bajos niveles de estos elementos minerales en el forraje, tanto en leucaena como en pasto Tanzania. Asimismo, la concentración sérica de P en los animales del rancho El Vivero está por abajo del nivel recomendado(27), tanto para bovinos adultos como para los jóvenes (45-60 y 60- 90 mg kg-1, respectivamente); mientras que en el rancho Los Huarinches, el contenido sérico de P apenas cubre el mínimo recomendado para bovinos adultos, lo cual es consistente con el bajo contenido de P en las dos especies forrajeras del sistema silvopastoril intensivo. Los niveles séricos de Na son también deficientes en los animales de ambos ranchos, a pesar de que, tanto en leucaena como en Tanzania, este elemento se encuentra en un rango aceptable para cubrir el requerimiento de vacas en producción(27).

904


Rev Mex Cienc Pecu 2021;12(3):893-909

A pesar de que la época del año influyó en la concentración sérica de casi todos los minerales las concentraciones de Zn, Cu y Na, no alcanzaron el mínimo adecuado, contrario a lo que ocurrió con el P durante la época de lluvias, alcanzando apenas el nivel mínimo requerido. Las concentraciones de Ca y Mg en las tres épocas del año están dentro de los rangos adecuados, a pesar de que estos minerales en leucaena estuvieron por encima del requerimiento para vacas lecheras, aunque pudieron ser compensados por el forraje de pasto Tanzania. Esto evidencia que tanto la gramínea como la leguminosa contribuyen a corregir desbalances minerales generados por sus propiedades bioquímicas. Contrario a lo anterior, los niveles de K en suero sanguíneo fueron superiores al rango adecuado, tanto en las épocas de frío como de lluvias, lo cual es consistente con los aportes de K en leucaena y pasto Tanzania en ambos ranchos. Según algunos reportes(26), excesos de K en el suelo conducen a incrementar el contenido de este elemento en las pasturas, lo que posteriormente puede tener efectos negativos en la salud del animal cuando se sobrepasa el máximo tolerable. Tanto las crías como las vacas adultas presentaron niveles séricos de Cu, Zn y Na por debajo de los niveles adecuados, mientras que los animales adultos evidenciaron deficiencias de P y, a pesar de que el nivel de este elemento en las crías fue superior al de las vacas, la deficiencia fue persistente, ya que el rango adecuado de P para bovinos jóvenes es de 60 – 90 mg kg-1(24). Del mismo modo, las crías presentaron ligera deficiencia de Mg, probablemente debido a que la leche tiene un contenido bajo de este elemento (0.1 a 0.2 g L-1(6)); mientras que, para ambos tipos de animal, la concentración de K en suero sanguíneo fue superior a los rangos adecuados.

Conclusiones e implicaciones Las variaciones en la concentración mineral en el suelo de los ranchos evaluados, en relación con la época del año, puede originarse por el manejo de cada sistema de producción y por las condiciones ambientales, por lo que la similitud de la temperatura y precipitación no es suficiente para explicar las diferencias de concentraciones de los minerales evaluados, por lo que, se recomienda realizar estudios adicionales. Con excepción de Fe, las concentraciones de los minerales disueltos en el agua de bebida no satisfacen los requerimientos de los animales. La asociación de Leucaena leucocephala y Megathyrsus maximus var. Tanzania se complementan y contribuyen a mejorar el balance mineral de la dieta de las vacas lecheras, no obstante, diferencias edáficas de cada rancho ganadero, la especie forrajera y época del año son los factores responsables de las deficiencias de Cu, Zn y P de los animales. Los niveles séricos de Ca, Mg y relación Ca:P fueron adecuados, mientras que los niveles de Cu, Zn, Na y P, son menores a las concentraciones normales. No obstante, la concentración sérica de K está por encima del rango normal. Debido a que las concentraciones Cu, Zn, Na y P en el forraje y en el suero sanguíneo son bajas, es conveniente implementar estrategias de suplementación mineral al ganado que permitan incrementar la disponibilidad de estos

905


Rev Mex Cienc Pecu 2021;12(3):893-909

minerales en la dieta, para cubrir los requerimientos para mantenimiento y producción de las vacas lecheras y sus crías. Literatura citada: 1.

Krishnamurthy L, Ávila M. Agroforesteria básica. México D.F. México: Programa de las naciones unidas para el medio ambiente. Serie de textos básicos No. 3;1999.

2.

McDowell LR. Feeding minerals to cattle on pasture. Anim Feed Sci Technol 1996;60(3–4):247–271.

3.

Mayland HF, Hankins JL. Mineral imbalances and animal health: A management puzzle. Wild Range Exp Stn. 2001;73:441–446.

4.

McDowell LR. Minerals in animal and human nutrition. 2nd ed. Amsterdam: Elsevier.; 2003.

5.

Gaviria X, Sossa C, Montoya C, Chará J, Lopera J, Cordoba C, et al. Producción de carne bovina en sistemas silvopastoriles intensivos en el trópico bajo colombiano. VII Congreso Latinoamericano de Sistemas Agroforestales Para la Producción Animal Sostenible. Belém do Pará, Brasil. 2012:661-665.

6.

Suttle N. Mineral nutrition of livestock. 4th ed. Wallingford: CABI Publishing; 2010.

7.

Givens D, Owen E, Axford RF, Omed HM. Forage evaluation in ruminant nutrition. Wallingford: CABI Publishing; 2000.

8.

Prasad CS, Arora S, Prasad T, Chabra A, Ibrahim MNM. Mineral requirements and straw feeding systems. In: Handbook for straw feeding systems, principles and applications with emphasis on Indian livestock production. New Delhi: ICAR.: 1995;225–238.

9.

Huerta OF, Maldonado TR, Álvarez-Sánchez E. Evaluación nutrimental del suelo y limón mexicano con manejo convencional y silvopastoril, Apatzingán, Michoacán. En: Álvarez-Sánchez E, Vásquez-Alarcón A. editores. Agroforestería para la conservación de los recursos naturales y productividad. Chapingo: Universidad Autónoma Chapingo, Chapingo. 2018.

10. INEGI. Anuario estadístico y geográfico de Michoacán de Ocampo. 2017. 11. INEGI. Prontuario de información geográfica municipal de los Estados Unidos Mexicanos Apatzingán, Michoacán de Ocampo 9. 2009. 12. INEGI. Prontuario de información geográfica municipal de los Estados Unidos Mexicanos Tepalcatepec, Michoacán de Ocampo 9. 2009.

906


Rev Mex Cienc Pecu 2021;12(3):893-909

13. Bacab-Pérez HM, Solorio-Sánchez FJ. Oferta y consumo de forraje y producción de leche en ganado doble propósito manejado en sistemas silvopastoriles en Tepalcatepec, Michoacán. Trop Subtrop Agroec 2011;13:271-278. 14. Fick K, McDowell R, Miles LR, Wilkinson PH, Funk NS, Conrad JD, Valdivia R. Methods of mineral analysis for plant and animal tissues. 2nd ed. Gainesville: University of Florida; 1979. 15. SAS (Statistical Analysis System). SAS/STAT User’s Guide (Release 6.4). SAS Inst. 2017. Cary, NC, USA. 16. Jackson RS. Site selection and climate. En: Wine Science. USA: Academic Press; 2014: 307-346. 17. Altieri MA. The ecological role of biodiversity in agroecosystems. Agric Ecosyst Environ 1999;74:19–31. 18. Dollinger J, Jose S. Agroforestry for soil health. Agrofor Systems 2018;92(2):213–219. 19. Kabata-Pendias A, Pendias H. Trace elements in soils and plants. 3rd ed. CRC press; 2001. 20. Maldonado TR, Etchevers JD, Alcántar GG, Rodríguez AJ, Colinas LMT. Estado nutrimental del limón mexicano en suelos calcimorficos. Terra 2001;19(2):163–174. 21. Roca N, Pazos MS, Bech J. Disponibilidad de cobre, hierro, manganeso y zinc en suelos del NO Argentino. Ciencia del suelo. 2007;25(1):31-42. 22. McCauley A, Jones C, Jacobsen J. Soil pH and organic matter. Nutrient management module. 2009;8(2):1-12. 23. Havlin JL. Fertility. In: Encyclopedia of soils in the environment. USA: Academic Press; 2013:10 -19. 24. Roberts AHC. Seasonal variation in soil tests and nutrient of pasture at two sites in Taranaki, N Z J Exp Agr 1987;(3):283-294. 25. Hooda PS. Trace elements in soils. USA: Wiley; 2010. 26. Rayment G. Total potassium to exchangeable potassium ratios as a guide to sustainable soil Potassium supply. Commun Soil Sci Plant Anal 2013;44:113–119. 27. Marx ES, JH, Stevens RG. Soil test interpretation guide. Oregon State Univ Ext Serv. 1999;(3):1–8.

907


Rev Mex Cienc Pecu 2021;12(3):893-909

28. Crespo G, Rodríguez I, Lok S. Contribution to the study of soil fertility and its relation to pastures and forages production. Cuban J Agric Sci 2015;49(2):2011-2019. 29. Rodríguez I, Crespo G, Torres V, Calero B, Morales A, Otero L, Hernández L, Fraga S, Santillán B. Integral evaluation and soil/plant compound in a dairy unit with silvopastoral system in Havana province, Cuba. Cuban J Agric Sci 2008;42(4):403-410. 30. Puls R. Mineral levels in animal health, diagnosis data. Clearbook: Sherpa international; 1988. 31. Mcdowell LR. Nutrition of grazing ruminants in warm climates. Orlando, Florida: Academic press, Inc; 1985. 32. Minson DJ. Forage in ruminant nutrition. USA: Academic press, Inc; 1990. 33. Blair GJ, Lithgow KB, Orchard PW. The effects of pH and calcium on the growth of Leucaena leucocephala in an oxisol and ultisol soil. Plant Soil 1988;214:209–214. 34. Aye PA, Adegun MK. Chemical composition and some functional properties of Moringa, Leucaena and Gliricidia leaf meals. Agric Biol J North Am 2013;4(1):71–77. 35. García M, Wencomo G, Gonzáles C, Medina R, Cova O. Caracterización de diez cultivares forrjeros de Leucaea leucocephala basada en la composición química y la degradabilidad. Rev MVZ Córdoba 2008;13(2):1294–303. 36. Kambashi B, Picron P, Boudry C, Théwis A, Kiatoko H, Bindelle J. Nutritive value of tropical forage plants fed to pigs in the Western provinces of the Democratic Republic of the Congo. Anim Feed Sci Technol 2014;191:47–56. 37. NRC. Nutrient Requirements of Dairy Cattle. 7th ed. Washington, DC: National Academic Press; 2001. 38. Fisher LJ, Waldern DE. Minerals and vitamins for dairy cows. Otawa: Agriculture Canada Publication; 1988. 39. Morales AE, Domínguez VI, González-Ronquillo M, Jaramillo EG, Castelán OO, Pescador SN, Huerta BM. Diagnóstico mineral en forraje y suero sanguíneo de bovinos lecheros en dos épocas en el Valle Central de México. Tec Pecu Méx 2007;45(3),329344. 40. Aguirre-Medina JF, Gálvez-López AL, Ibarra-Puón JC. Crecimiento de Leucaena leucocephala (Lam.) de Wit biofertilizada con hongos micorrízicos arbusculares en vivero. Rev Chapingo Ser Cienc For Amb 2018;24(1):49–58.

908


Rev Mex Cienc Pecu 2021;12(3):893-909

41. Domínguez MT, Marañon T, Murillo JM, Schulin R, Robinson BH. Trace element accumulation in woody plants of the Guadiamar Valley, SW Spain: A large-scale phytomanagement case study. Environ Pollut 2008;152:50–59. 42. Santiago FI, Lara BA, Miranda RL, Huerta BM, Krishnamurthy L, Muñoz-González JC. Composición química y mineral de leucaena asociada con pasto estrella durante la estación de lluvias. Rev Mex Cienc Agr. Pub Esp 2016;(16):3173–83. 43. Uemura E, Hayashuda M, Orden EA, Fujihara T. Tree legume supplementation improves mineral status of grazing does and growth performance of their kids. Livestock Res Rural Develop 2014;26(3).

909


https://doi.org/10.22319/rmcp.v12i3.5624 Revisión bibliográfica

Termorregulación y respuestas reproductivas de carneros bajo estrés por calor. Revisión

Alejandra Barragán Sierra a Leonel Avendaño-Reyes a Juan A. Hernández Rivera b Ricardo Vicente-Pérez c Abelardo Correa-Calderón a Miguel Mellado d Cesar A. Meza-Herrera e Ulises Macías-Cruz a,*

a

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas, Valle de Mexicali, Baja California, México. b

Universidad de Colima. Facultad de Medicina Veterinaria y Zootecnia, Tecomán, Colima, México. c

Universidad de Guadalajara. Departamento de Producción Agrícola, CUCSUR, Autlán de Navarro, Jalisco, México. d

Universidad Autónoma Agraria Antonio Narro. Departamento de Nutrición, Saltillo, Coahuila, México. e

Universidad Autónoma Chapingo. Unidad Regional Universitaria de Zonas Áridas, Bermejillo, Durango, México.

*Autor de correspondencia: umacias@uabc.edu.mx, ulisesmacias1988@hotmail.com

910


Rev Mex Cienc Pecu 2021;12(3):910-931

Resumen: Las temperaturas elevadas registradas durante la época de verano en las regiones cálidas comprometen la capacidad reproductiva de los animales domésticos. En carneros, el estrés por calor (EC) causa en el organismo una serie de ajustes fisiológicos, metabólicos, endocrinos y moleculares con el objeto de mantener normotermia y sobrevivir; sin embargo, varios de estos cambios se asocian negativamente con su fertilidad, principalmente los endocrinos. El EC en carneros provoca una disminución en las concentraciones sanguíneas de testosterona a través de diferentes mecanismos, y esto se refleja negativamente en el proceso de espermatogénesis y en la conducta sexual. En consecuencia, los carneros estresados por calor presentan baja calidad seminal y apetito sexual; a nivel de espermatozoides se ha observado daño estructural y en el ADN. Dada esta situación, se recomienda el uso de estrategias de mitigación del EC durante el verano en las explotaciones ovinas de regiones cálidas, tales como el uso de sombras en corrales, la administración de antioxidantes o modificaciones en la alimentación. Por lo tanto, el objetivo de este documento es revisar el conocimiento actual en relación al efecto del EC sobre la capacidad de termorregulación y reproductiva de los carneros, así como la aplicación de estrategias para su mitigación. Palabras clave: Semental, Macho ovino, Apetito sexual, Calidad seminal, Daño espermático.

Recibido: 18/02/2020 Aceptado: 28/09/2020

Introducción Las regiones con climas calientes se caracterizan por presentar temperaturas ambientales (Ta) y humedades relativas (HR) elevadas en verano, que generalmente sobrepasan el límite superior de la zona termoneutral de los animales de producción (≤ 30 oC), ocasionándoles la presencia de condiciones ambientales de estrés por calor (EC)(1,2). El impacto productivo y reproductivo que genera el EC en los animales varía entre especies, siendo los pequeños rumiantes quienes mejor adaptación muestran a estas condiciones ambientales(3). Algunas revisiones han descrito los mecanismos de termorregulación empleados por los ovinos para evitar hipertermia bajo EC(1,2,4,5), pero poca atención se pone respecto al efecto que tiene en la reproducción del carnero. En climas cálidos, el éxito reproductivo del rebaño depende en gran medida de la adaptación y el correcto funcionamiento reproductivo de los sementales.

911


Rev Mex Cienc Pecu 2021;12(3):910-931

El organismo de los carneros estresados por calor presenta una serie de cambios para evitar hipertermia(1,6-8). Así, la capacidad reproductiva de los carneros disminuye mientras hacen esfuerzos fisiológicos, metabólicos y endocrinológicos para mantenerse en (3,7,9-11) normotermia . El EC puede afectar negativamente la reproducción del carnero por diferentes mecanismos, siendo los principales: 1) disminución en las concentraciones de testosterona, y 2) daño directo en la morfometría y contenido de material genético del espermatozoide(12,13). Esto se refleja en fallas en el proceso de espermatogénesis, así como en baja calidad seminal, conducta reproductiva y fertilidad(7,14-16). No obstante, la aplicación de estrategias de mitigación del EC mejora la capacidad reproductiva del carnero en estas condiciones climáticas(1,8,17). Cabe mencionar que los resultados de los efectos de EC en la reproducción del carnero no son consistentes a través de los estudios. Diferencias entre razas a nivel de adaptación a EC explican en gran medida estas discrepancias(3). Por lo tanto, la presente revisión tiene como objetivo describir el conocimiento actual en relación al efecto del EC en la capacidad de termorregulación y reproductiva de los carneros, así como la aplicación de estrategias para su mitigación.

Ovinos en climas cálidos En las últimas décadas, la acumulación excesiva de gases de efecto invernadero (GEI) en la atmósfera esta provocado un aumento en la Ta de la superficie terrestre(1), por lo cual el cambio climático a nivel mundial es eminente, principalmente con tendencias a promover una mayor presencia de climas cálidos y, consecuentemente, la desertificación de más regiones del globo terrestre(11). Las condiciones ambientales donde predominan Ta elevadas causan que los ovinos, así como cualquier otro animal de producción, experimenten EC(2), lo que representa para el organismo un desafío fisiológico-metabólico para mantenerse en condiciones de homeotermia(6). En la búsqueda de estrategias que ayuden a mantener la producción de alimentos de origen animal bajo este escenario climático adverso, algunos autores proponen la producción de ovinos como una alternativa(1,10,18), principalmente debido a que son capaces de mantener su desempeño productivo bajo condiciones de EC(3). Entre las características de adaptabilidad que poseen los ovinos se incluyen resistencia a parásitos, enfermedades y escasez de agua para consumo(15,19); también capacidad para aprovechar forrajes y esquilmos agrícolas de mala calidad, y el mantenimiento de la capacidad reproductiva del rebaño y el crecimiento de los corderos bajo escenarios de EC(1,3,5). Cabe mencionar que el nivel de adaptación de los ovinos varía ampliamente entre razas, ya que existe una gran diversidad de ellas que fueron desarrolladas desde condiciones climáticas de frío hasta cálidas.

912


Rev Mex Cienc Pecu 2021;12(3):910-931

Estrés por calor y la producción ovina El estrés se genera por la presencia de un evento externo que causa alteraciones en un sistema biológico(20). En animales de producción se considera que hay estrés cuando algún factor externo altera su salud, metabolismo basal y capacidad productiva(3). En este sentido, los ovinos pueden desarrollar signos de estrés por enfrentarse a cambios drásticos en las condiciones climáticas, y de hecho, desarrollan EC cuando las combinación de factores ambientales provocan un incremento en la Ta por arriba del límite superior de su zona termoneutral(1). Las variables climáticas que pueden promover el ambiente de EC son Ta, HR, radiación solar, velocidad del viento y precipitación; no obstante, la Ta y la HR son los principales factores asociados con la presencia de EC(5), y en consecuencia, ambos son usados para construir el índice de temperatura-humedad (ITH= Ta – [(0.31 – 0.31*HR)(Ta – 14.4])(4). Cabe aclarar que este índice no se desarrolló para ovinos, sin embargo, en la actualidad es ampliamente usado para definir el grado de EC en esta especie, ya que a la fecha no existe uno específico para ellos. Basado en ese ITH, se considera que los ovinos comienzan a experimentar EC a las 22.2 unidades, siendo de tipo moderado entre 22.2 y <23.3 unidades, severo entre 23.3 y <25.6 unidades, y severo extremo a ≥25.6 unidades(4). La zona termoneutral para la mayoría de las razas ovinas se encuentra entre los 5 y 25 °C(1), sin embargo, hay razas adaptadas que comienzan a experimentar EC por encima de los 30 °C(5,15). Esto sugiere que, a pesar de ser homeotermos, la tolerancia de los ovinos al EC varía ampliamente entre razas, y estudios específicos para cada raza deben realizarse para evaluar su tolerancia a Ta altas. En el mundo, existen más de 1,000 razas de ovinos, la cuales varían en su capacidad de termorregulación en ambientes de hipertermia, y esto obedece a su origen climático(3). En México, se cuenta tanto con razas de lana y de pelo, pero estas últimas son más tolerantes al EC, dado que se originaron en climas cálidos, mientras que las de lana se originaron en climas fríos o templados(5). Esto no significa que no haya razas de lana tolerantes al EC en otros países; en Australia, la raza Merino muestra gran capacidad de adaptación a regiones cálidas(1). La respuesta termorregulatoria de los ovinos al EC también varía con el sexo, y dentro del sexo con la edad, estado fisiológico y actividad reproductiva(5,21). Mientras que los efectos negativos de EC son más notorios en crías y ovejas gestantes y lactando(21,22), en carneros parecen ser menos perceptibles ya que su producción de calor metabólico es bajo comparado con las ovejas, y más cuando se encuentran en descanso reproductivo(1). Esto último podría ser la causa de que la mayoría de estudios se desarrollen en ovejas, y consideren poco relevante el tema para investigar en carneros. No obstante, los procesos reproductivos testiculares son muy sensibles a cambios en la Ta, lo cual se asocia con baja fertilidad en los

913


Rev Mex Cienc Pecu 2021;12(3):910-931

carneros en épocas cálidas. En este sentido, el resto de la revisión de literatura se centrará en analizar los efectos del EC en la reproducción del carnero.

Estrés por calor y termorregulación del carnero La termorregulación de los carneros bajo condiciones termoneutrales se da esencialmente por la activación de mecanismos no evaporativos, sin que esto implique alteraciones metabólicas, endocrinas o en el requerimiento extra de energía de mantenimiento(1,3). Sin embargo, en condiciones de EC, los carneros activan una serie de mecanismos de termorregulación que favorecen la homeotermia frente al desafío térmico. El EC en regiones cálidas aumenta los valores promedio de las variables fisiológicas, tales como temperatura rectal (TR), frecuencia respiratoria (FR), frecuencia cardiaca y tasa de sudoración (Cuadro 1)(10,18,23). Así, los carneros mantienen su normotermia, aunque resulta importante señalar que el aumento en el número de respiraciones es el principal mecanismo usado por los carneros para perder la carga de calor corporal(21). De hecho, los ovinos bajo EC pueden eliminar entre 60 y 90 % de la carga térmica a través del aparato respiratorio (4). Otro mecanismo fisiológico activado, el cual es más evidente en carneros de raza de pelo sujetos a EC, es la redistribución del flujo sanguíneo hacia tejidos periféricos para disipar el calor corporal por radiación a través de la piel(5,15). Conforme el gradiente de temperaturas entre la piel y el ambiente disminuye, la FR incrementa hasta convertirse en la principal vía de disipación de calor corporal(24). Cuadro 1: Cambios en las variables fisiológicas de carneros estresados por calor Hallazgos durante la Tratamiento Temperatura Fuente Raza época/tratamiento con / época del aire (°C) mayor temperatura Invierno 14.5 (52) Suffolk ↑ TR, TE Verano 28.2 Invierno 19.8 ± 0.4 (45) Najdi ↑ TR, FR y FC Verano 38.4 ± 0.3 Invierno 7.0 - 25.5 (72) Malpura ↑ FR y FC Verano 23.0 - 40.0 Invierno ~ 12.5 - 28.0 (15) Santa Inés ↑ TR, FC y TS Verano ~ 18.0 - 32.0 Invierno ~ 12.5 - 28.0 Morada Nova ↑ TR, FC y TS Verano ~ 18.0 - 32.0 Invierno ~ 12.5 - 27.0 (73) Santa Inés Sin cambios Verano ~ 19.0 - 31.0 Morada Nova Invierno ~ 12.5 - 27.0 ↓ FR y ↑ TMT

914


Rev Mex Cienc Pecu 2021;12(3):910-931

(18)

(74)

(10)

(24)

Verano Invierno Texel Verano Invierno Dorper Verano Termoneutral Han de cola Estrés por pequeña calor Termoneutral Merino Estrés por polaco calor Termoneutral Merino Estrés por calor Malpura х Termoneutral Malpura x Estrés por Garole calor

~ 19.0 - 31.0 ~ 12.5 - 27.0 ~ 19.0 - 31.0 ~ 12.5 - 27.0 ~ 19.0 - 31.0 ~ 22.0 - 23.0 ~ 30.0 - 35.0

Sin cambios ↓ FR y ↑ TMT ↑ FR

16.5 ± 1.0 50.0 ± 1.0 20.1 - 20.9

↑ TR y FR ↑ FR y FC

28.6 - 30.6 33.6 ± 0.7 44.2 ± 0.2

↑ TR y FR

TR= temperatura rectal, FR= frecuencia respiratoria, FC= frecuencia cardíaca, TE= temperatura escrotal, TMT= temperatura media testicular; TS= tasa de sudoración.

En carneros, el escroto funciona como un órgano de termorregulación tanto en condiciones termoneutrales como de EC(1). En condiciones ambientales cálidas de verano, el escroto es una de las regiones corporales que más disipa carga de calor debido a la gran vascularización (plexo pampiniforme) que hay en la superficie testicular, y a la gran cantidad de glándulas sudoríparas(15,16). Existe una alta correlación entre la temperatura interna corporal y la temperatura escrotal, por lo que conocer la variabilidad de la temperatura escrotal permite evaluar la eficiencia de termorregulación del carnero(15). La activación de los mecanismos evaporativos demanda una gran cantidad de agua corporal, por lo que el consumo de agua puede aumentar entre 19 y 25 % en los carneros durante el verano(25). Esto trae como consecuencia que el consumo de alimento se reduzca por un efecto sustitutivo(26). Sin embargo, en ovinos de pelo se demostró que el consumo de alimento se mantuvo similar en verano y primavera, independientemente del aumento en el consumo de agua registrado durante verano(5). Esto sugiere que el efecto sustitutivo del consumo de agua por consumo de alimento se presenta principalmente en carneros con menos tolerancia al EC. Así, la reducción en el consumo de alimento es el resultado del esfuerzo del carnero para reducir la producción de calor endógeno, al suprimir parcialmente la actividad metabólica y ruminal(1,4,27). Todos los ajustes fisiológicos que presentan los carneros producto del EC causan un aumento en los requerimientos de energía de mantenimiento, mientras que la reducción en el consumo 915


Rev Mex Cienc Pecu 2021;12(3):910-931

de alimento altera la disponibilidad de la misma(5). En consecuencia, las Ta altas de verano alteran el metabolismo de los carneros, en primera instancia para distribuir energía a los procesos de termorregulación, y en segunda para reducir la producción de calor endógeno, al mismo tiempo que hacen más eficiente el uso de los sustratos energéticos(28,29). No obstante, los resultados del efecto del EC en las concentraciones séricas de metabolitos y hormonas metabólicas no son consistentes entre los estudios (Cuadro 2). Cuadro 2: Cambios en los metabolitos sanguíneos de carneros estresados por calor Hallazgos durante Tratamiento / Temperatura la época/tratamiento Fuente Raza época del aire (°C) con mayor temperatura (44)

(45)

(24)

(10)

(25)

(74)

(18)

Invierno

24.1

Verano

33.7

Invierno

19.8 ± 0.4

Verano

38.3 ± 0.3

Ossimi

Najdi Malpura Malpura Garole Merino

Iraní fat-tailed

Merino polaco

Han de cola pequeña

x Termoneutral 33.6 ± 0.7 x Estrés por 44.2 ± 0.2 calor Termoneutral

20.1 - 20.9

Estrés calor

28.6 - 30.6

por

21.0

Estrés calor

40.0

Termoneutral

16.5 ± 1.0

Estrés calor

50.0 ± 1.0

por

Termoneutral

~ 22.0 - 23.0

Estrés calor

~ 30.0 - 35.0

por

↑ GLU y PROT ↓ PROT y T3 ↑ COR

↑ COR

Termoneutral por

↑ GLU ↓COL y LIPT

↓ GLU, TRIG, T3 y T4 ↑ PROT y COR ↓ GLU ↑ COR

↓ TRIG, PROT

GLU= glucosa, COL= colesterol, TRIG= triglicéridos, PROT= proteína total, LIPT= lípidos totales, COR= cortisol, T3= triyodotironina, T4= tiroxina.

La elevada FR observada en carneros estresados por calor, demanda una excesiva cantidad de glucosa como fuente de energía para el funcionamiento de los músculos del aparato respiratorio(3). Por consiguiente, los carneros en verano incrementan las concentraciones

916


Rev Mex Cienc Pecu 2021;12(3):910-931

sanguíneas de glucosa comparado con épocas termoneutrales, lo cual se debe a que las concentraciones de cortisol también aumentan en respuesta al EC(1,3). El cortisol promueve la gluconeogénesis y glucólisis hepática(28). De acuerdo con esto, carneros de raza Ossimi(30) y Najdi(31) registraron mayores concentraciones sanguíneas de cortisol y glucosa en verano que en invierno. Sin embargo, hay estudios donde las concentraciones séricas de glucosa disminuyeron(18,32) o no cambiaron(10,23) por efecto del EC en carneros. Esto podría estar asociado con un aumento en las concentraciones de insulina plasmática(28). En los ovinos expuestos a condiciones de EC crónico, principalmente los de razas adaptadas a climas cálidos, aumentan las concentraciones sanguíneas de insulina como un mecanismo adaptativo para mantener un correcto funcionamiento metabólico, mejorar la eficiencia en el uso de energía y reducir el catabolismo de tejido graso(28,29). Particularmente, los niveles altos de insulina permiten a los carneros estresados por calor: 1) evitar la apoptosis de las células β pancreáticas por un aumento en la producción de ácidos grasos no esterificados; 2) promover el consumo celular de glucosa circulante para su metabolismo; y 3) mantener anabolismo y evitar catabolismo, principalmente de tejido graso(3,28). Este último punto ha sido asociado con la disminución en las concentraciones séricas de triglicéridos, colesterol y lípidos totales en carneros sometidos a EC crónico(18,30). Adicionalmente, una reducción en las concentraciones sanguíneas de dichos metabolitos lipídicos, está asociada parcialmente con la movilización de ácidos grasos para cubrir los requerimientos de energía cuando el sistema ahorrador de glucosa se activa(1,28). Macías-Cruz et al(33) mencionan que, en ovinos, las concentraciones séricas de glucosa, colesterol, triglicéridos, proteína total y urea varían de acuerdo al tipo de EC. Un EC crónico reduce las concentraciones séricas de los metabolitos asociados al metabolismo energético (glucosa, colesterol y triglicérido), pero aumenta las concentraciones de los metabolitos asociados con el metabolismo de proteína (proteína total y urea). En el caso de EC agudo, las variaciones en las concentraciones sanguíneas de esos metabolitos muestran un efecto contrario al observado en EC crónico, lo cual obedece a que el metabolismo de energía cambia para garantizar una mayor disponibilidad de sustratos energéticos al momento de hacer los ajustes fisiológicos(3). Finalmente, la glándula tiroidea también juega un rol importante en la termorregulación de todas las especies, incluyendo los carneros(13). El EC causa una reducción en la liberación de hormonas tiroides, lo cual favorece una menor producción de calor metabólico y carga de calor corporal(23,32). Notoriamente, la triyodotironina tiene una vida media más corta y es más termo-sensible que la tiroxina, tal como se demostró en un estudio de carneros de raza Malpura(23).

917


Rev Mex Cienc Pecu 2021;12(3):910-931

Estrés por calor y endocrinología reproductiva del carnero Los factores ambientales juegan un rol importante en el control de la capacidad reproductiva de los carneros. Un ambiente inadecuado puede causar un estrés al carnero y esto desencadenar alteraciones en la función neuroendocrina del eje reproductivo(34). En regiones cálidas, las Ta altas de verano generan un ambiente de EC para los carneros, conduciéndolos a que prioricen las actividades asociadas a los procesos de termorregulación en lugar de las funciones reproductivas(13). De hecho, su capacidad reproductiva podría ser inhibida totalmente en razas susceptibles al EC, mientras que dicha inhibición podría ser parcial o inexistente en razas adaptadas(1,15,23). Los carneros, en repuesta a las condiciones de EC, activan el sistema simpático adrenomedular (SAM) y el eje hipotálamo-hipófisis-adrenal (HHA)(12). El SAM estimula la liberación de catecolaminas (adrenalina y noradrenalina) en la médula de las glándulas adrenales(9), las cuales inducen una vasodilatación periférica e incrementan la disponibilidad de energía por medio de la gluconeogénesis y lipólisis(1,13). Por su parte, el eje HHA comienza su activación con la secreción hipotalámica de las hormonas liberadoras de corticotropinas (CRH), quienes a su vez estimulan la secreción de la hormona adrenocorticotrópica (ACTH) en la adenohipófisis(12,13,17). Adicionalmente, las catecolaminas junto con las CRH provocan la liberación hipotalámica de la β-endorfina, cuyo precursor es el polipéptido proopiomelanocortina, el cual también es precursor de la ACTH(17,34). La ACTH vía endocrina estimula la síntesis de glucocorticoides (cortisol y corticosterona) y mineralocorticoide (aldosterona) en la corteza adrenal a partir del colesterol(13,17,32). La liberación de cortisol es el principal mecanismo a través del cual el eje HHA inhibe el funcionamiento del eje hipotálamo-hipófisis-gonadal (HHG)(9,11), y consecuentemente, el grado de actividad reproductiva en los carneros expuestos a EC(34). Los niveles de actividad de los ejes HHA y HHG se relacionan negativamente, de tal manera que comúnmente se observa una disminución en las concentraciones de testosterona y, en consecuencia, en la actividad reproductiva de los carneros en ambientes cálidos(1). El aumento de cortisol en sangre causa que los niveles de testosterona disponible en los túbulos seminíferos disminuyan, lo cual a su vez reduce la producción y calidad de espermatozoides por una baja actividad en el proceso de espermatogénesis(35,36). Asimismo, las bajas concentraciones de testosterona causan que los carneros presenten libido y capacidad de monta reducida(37-39). La testosterona es sintetizada y liberada por las células testiculares de Leydig, las cuales responden al estímulo de la hormona luteinizante (LH) para dicha acción(9,40). Por su parte, las células de Sertoli, en respuesta a los estímulos de la hormona folículo estimulante (FSH), sintetizan y liberan la proteína ligadora de andrógenos, quien es responsable de unirse con la

918


Rev Mex Cienc Pecu 2021;12(3):910-931

testosterona circulante para introducirla a los túbulos seminíferos(40). Una vez adentro de los túbulos seminíferos, la testosterona se encarga de sincronizar todo el proceso de espermatogénesis(12). Sin embargo, la activación del eje HHA en respuesta al EC puede comprometer negativamente el funcionamiento correcto de este mecanismo en diferentes puntos. Se ha documentado ampliamente que el cortisol genera una retroalimentación negativa sobre GnRH a nivel hipotálamo(1,34), situación que a su vez evita que la adenohipófisis sintetice y libere las hormonas gonadotropinas (FSH y LH)(12,13); ambas esenciales para garantizar la presencia de concentraciones suficientes de testosterona dentro de los túbulos seminíferos, para llevar acabo la espermatogénesis. Algunos estudios también señalan que las concentraciones de testosterona pueden disminuir por otros mecanismos que no necesariamente están asociados con el funcionamiento del hipotálamo y la hipófisis en carneros sujetos a EC(9,12,41). Las concentraciones de testosterona pueden disminuir debido a que los glucocorticoides reducen la expresión de receptores para LH en las células de Leydig(41-43). También se ha reportado que las células de Leydig requieren de ciertas citoquininas como las IL-1 y IL-6 para la liberación de testosterona, sin embargo, un aumento en la síntesis de glucocorticoides mostró disminuir la respuesta inmune y, por ende, la producción de dichas citoquinas(12,44). Otras evidencias señalan que la producción de la proteína ligadora de andrógenos en las células de Sertoli puede disminuir por una baja producción de hormonas tiroideas(22,45). En forma similar, por efecto directo de una hipertermia testicular, las células germinales pueden dañarse, así como afectarse negativamente la expresión de la proteína Conexina-43, encargada de la unión entre las células de Sertoli(46). Estas alteraciones a nivel de células de Sertoli podrían conducir a una baja disponibilidad de testosterona dentro de los túbulos seminíferos(12). Cabe mencionar que algunos de esos estudios no fueron hechos en carneros, por lo que pueden ser motivo de futuras líneas de investigación.

Estrés por calor y capacidad reproductiva del carnero Efectos en la calidad seminal La calidad seminal en los carneros disminuye bajo condiciones de EC debido a la activación de los mecanismos neuroendocrinos, fisiológicos y metabólicos, así como al aumento en el gasto energético de mantenimiento para conservar condiciones de normotermia(1). Generalmente, los daños ocasionados en los espermatozoides por EC se vuelven visibles entre los 14 y 21 días posteriores al inicio de la exposición de los carneros a Ta altas(47), por consiguiente, se detecta hasta entonces una disminución en la calidad seminal. Las características seminales principalmente afectadas son motilidad progresiva, anormalidades espermáticas, integridad de la membrana plasmática, concentración

919


Rev Mex Cienc Pecu 2021;12(3):910-931

espermática y volumen del eyaculado (Cuadro 3)(1,48). La motilidad progresiva y masal disminuyen entre un 5 y 25 %(49,50), lo cual se asocia con un aumento en el porcentaje de espermatozoides anormales(16). Las anormalidades espermáticas que predominan debido al EC son los defectos en cabeza y acrosomales(51). Cabe mencionar que dichas anormalidades son menos frecuentes en los sementales de razas autóctonas de regiones cálidas, de tal manera que estas razas adaptadas a EC presentan entre 1 y 5 % de espermatozoides anormales(49,52). Cuadro 3: Cambios en las características seminales de carneros estresados por calor Hallazgos durante la Tratamiento / Temperatura Fuente Raza época/tratamiento con época del aire (°C) mayor temperatura (49) Chios Otoño 9.7 - 18.3 ↓ MOT y CON ↑ SA Verano 19.1 - 30.6 Friesian

Otoño Verano Invierno Verano Invierno Verano

(54)

Persian Karakul

(52)

Suffolk

(55)

Hamari (no Invierno esquilados) Verano Hamari Invierno (esquilados) Verano Dorper Invierno Verano Zulu Invierno Verano Morada Nova Invierno Verano Santa Inés Invierno Verano Pelibuey Invierno Otoño Ouled Djellal Primavera Verano Malpura Termoneutral Estrés por calor Termoneutral

(50) (27) (15)

(14) (56) (53) (24)

9.7 - 18.3 19.1 - 30.6 5.8 ± 3.8 26.0 ± 4.8 14.5 28.2 14.1 - 32.4 22.9 - 43.3 14.1 - 32.4 22.9 - 43.3 18.0 - 26.0 26.0 - 32.0 23.3 28.3 ~ 12.5 - 28.0 ~ 18.0 - 32.0 ~ 12.5 - 28.0 ~ 18.0 - 32.0 -26.0 - 27.8 -33.0 - 40.0 -42.0 33.6 ± 0.7 920

↓ MOT y CON ↑ MP y SA ↓ VOL ↑ VIT y TES ↓ CE, MM, VIT y CON ↑ pH seminal, SA y daño acrosomal ↓ VOL, VIT, MM y PM ↑ SA ↓ VOL, MM y VIT ↑ SA ↓ CE, CON, MM y PM ↑ SA ↓ VOL, CON e PMI ↑ CE ↑ CON y SAS ↓ PMI ↑ CON ↓ CE y CON ↑ SA ↓ CE, VIT y TES ↓ CE, VOL, MM, CON y TES ↓ MOT


Rev Mex Cienc Pecu 2021;12(3):910-931

Malpura Malpura Garole

x Estrés por calor x

44.2 ± 0.2

CE= circunferencia escrotal, MOT= motilidad espermática, MM= motilidad masal, MP= motilidad progresiva, CON= concentración espermática, VOL= volumen de eyaculado, VIT= vitalidad espermática, PMI= integridad de membrana plasmática, AE= anormalidades espermáticas, AES= anormalidades espermáticas secundarias, TES= testosterona sérica.

El perímetro escrotal y la concentración espermática también han mostrado disminuir por efecto del EC(16), lo cual posiblemente esté relacionado con una menor proliferación de células espermáticas y una mayor apoptosis de células del parénquima testicular(47). Algunos estudios señalan una disminución de 2 a 7 cm en el perímetro escrotal y de 3,000 millones de espermatozoides por mililitro de eyaculado, tras someter a los carneros a condiciones de EC(52,53). Por otra parte, la actividad secretora de las glándulas accesorias disminuye en carneros sujetos a EC, lo cual directamente se refleja en menor volumen de eyaculado(36,53-55). La menor secreción de plasma seminal en las glándulas accesorias se debe a una disminución en las concentraciones séricas de testosterona en carneros expuestos a EC(12,56). Adicionalmente, la composición del plasma seminal se modifica, principalmente a nivel de las concentraciones de electrolitos y proteínas, compuestos que mantienen el pH seminal entre neutro y ligeramente alcalino (7.0 a 7.3)(11). En general, el EC incrementa el pH seminal de los carneros(52,57), lo cual reduce el número de espermatozoides por eyaculado y aumenta el porcentaje de anormalidades(36). En resumen, las Ta ambientales elevadas afectan negativamente la fertilidad del carnero, esencialmente por disminuir la producción de espermatozoides, así como la cantidad y calidad del plasma seminal. Esto termina teniendo un impacto negativo en las características microscópicas del semen. Cabe mencionar que los carneros estresado por calor no recuperan inmediatamente su fertilidad óptima al cambiarlos a un ambiente termoneutral; de hecho, requieren permanecer entre 9 y 11 semanas en este ambiente para eyacular un semen de calidad normal(47).

Efectos en la conducta sexual La conducta sexual de los carneros se ha evaluado poco bajo condiciones de EC, y los resultados hasta ahora son contradictorios. Considerando que el servicio de las hembras se da mayormente por monta natural en los diferentes sistemas de producción, resulta imperante elucidar en investigaciones futuras el impacto del EC en la capacidad de monta de los carneros.

921


Rev Mex Cienc Pecu 2021;12(3):910-931

En carneros de raza Malpura (adaptada a climas cálidos), el EC inducido en cámara termoambiental (42 ºC) redujo el apetito sexual y la capacidad de monta, lo cual se dedujo porque los carneros estresados por calor presentaron mayor tiempo para hacer una monta con eyaculación, así como mayor número de intentos de monta tanto para el primer y segundo eyaculado(53). Igualmente, los carneros de raza Rembi presentaron menor libido durante la época de verano en una región árida(38). La reducción en la conducta sexual mostrada por los carneros expuestos a EC se asoció con una menor capacidad para secretar testosterona. Sin embargo, hay otros estudios realizados en carneros puros(23) o cruzados(7) del genotipo Malpura, donde los efectos del EC en la conducta sexual fueron mínimos sin ninguna diferencia en las concentraciones séricas de testosterona. En carneros de raza de pelo usados en México, un estudio reportó solamente un aumento en el tiempo de reacción de monta por el efecto de la época seca y caliente comparado con la época fresca-húmeda de un clima tropical(39). Las discrepancias entre resultados podrían deberse a que en esos estudios donde no hubo efectos(7,23), las diferencias en Ta no eran tan marcadas. Otros factores importantes a considerar son la condición corporal (CC) y la estacionalidad reproductiva. Los carneros con CC óptima (3.0 en escala de 1 a 5 puntos) presentan mejor conducta sexual que los carnero con baja (≤ 2 puntos) o alta (≥ 4 puntos) CC bajo condiciones de EC(37). Por su parte, la época de verano representa un periodo de transición entre el final del periodo de anestro e inicio del periodo natural reproductivo(58). Por lo tanto, los carneros de las razas con mayor sensibilidad a la estacionalidad reproductiva podrían presentar una reducción en la conducta sexual durante el verano en regiones cálidas, no solo por las temperaturas altas, sino también por su ritmo circanual reproductivo natural. En el caso de las razas ovinas de pelo mexicanas, las cuales se caracterizan por presentar baja estacionalidad reproductiva pero alta adaptación a climas cálidos(5), los efectos negativos esperados del EC en su conducta sexual podrían ser mínimos, tal como se demostró en condiciones tropicales(39). No obstante, poco se ha investigado este tema en carneros de razas de pelo y los estudios existentes aún son superficiales. Las razas de pelo en México tienen gran relevancia para la producción en carne en climas cálidos, por lo que resulta necesario investigar a profundidad el impacto que tiene el EC en la conducta de estos carneros.

Efectos en el daño espermático El daño espermático por EC se comienza a generar desde las células espermáticas que están en diferenciación dentro de los túbulos seminíferos hasta los espermatozoides que están en tránsito en el epidídimo. Los espermatozoides en los carneros duran en maduración dentro del epidídimo entre 13 y 15 días, por lo cual son los primeros en evidenciar daños por hipertermia(59). Estudios previos reportan que la exposición de carneros a Ta mayores a 35 ºC puede causar 17.5 % de cabezas piriformes(60), 18.5 % de anormalidades en acrosoma(61)

922


Rev Mex Cienc Pecu 2021;12(3):910-931

y alrededor de 30 % de espermatozoides sin cola(35). En general, se estima que el EC crónico (> 60 días) causa en los espermatozoides un 43.4 % de anormalidades menores (por ejemplo: presencia de gota citoplasmática distal, cola enrollada de la punta o completamente enrollada y cabezas normales libres) y 3.6 % de anormalidades mayores (p.e. gota citoplasmática proximal y espermatozoides microcefálicos)(57). Otro estudio indicó que la elipticidad de la cabeza aparece en los eyaculados de los sementales ovinos a partir del día 42 posterior a la hipertermia testicular, lo cual se asocia a un daño directo del EC al espermatozoide en la fase de espermiogénesis, aunque no es claro el mecanismo que lleva a esta malformación de la cabeza(62). Cabe mencionar que el daño espermático generado por EC se vuelve constante mientras dichas condiciones ambientales permanecen, y generalmente se proyecta por varias semanas más después de que el desafío térmico termina(1,50). Los testículos deben permanecer entre 2 y 8 °C por debajo de la temperatura corporal para su correcto funcionamiento, de lo contrario, la hipertermia testicular provoca daños en las células somáticas y germinales del testículo(63). Los espermatocitos y espermátidas se consideran más susceptibles a sufrir apoptosis por efecto del EC debido a su alta tasa meiótica(1,47), aunque también puede ocurrir degeneración en espermatogonias, y células de Leydig y Sertoli(23,64). Al parecer el EC crónico, pero no el agudo, afecta a los espermatozoides que ya han concluido su formación y se encuentran en el epidídimo(63,64). Los espermatozoides localizados en el epidídimo aumentan su nivel de estrés oxidativo y disminuyen su capacidad antioxidante en respuesta a la exposición continua y prolongada al EC(63). Esto último se ha demostrado ampliamente en ratones, por lo que se requiere investigar al respecto en carneros. Por otra parte, el flujo sanguíneo en los testículos de los carneros expuestos a EC es insuficiente, lo que causa hipoxia testicular y, junto con la hipertermia directa, promueve condiciones de estrés oxidativo por un aumento en las especies reactivas de oxígeno (ERO)(63). La excesiva producción testicular de ERO conduce a la peroxidación de los fosfolípidos de la membrana espermática, desencadenando un daño directo a nivel de integridad de membrana (20 % de degradación) y del ADN(23). Estos daños pueden disminuir la expresión de la proteína PH-20 en la membrana, la cual se encuentra asociada a la actividad de la unión del espermatozoide con la zona pelúcida(65). Además, hacen más susceptibles a los espermatozoides de los carneros a daños en la conformación de la cromatina(11), y a la presencia de fragmentación del ADN(47,65). Este daño en el ADN espermático puede causar subfertilidad o infertilidad del carnero(11), así como una disminución en la resistencia de los espermatozoides cuando se utilizan en programas de inseminación artificial y fertilización in vitro(51).

923


Rev Mex Cienc Pecu 2021;12(3):910-931

Mitigación del estrés por calor en carneros El uso de estrategias de mitigación del EC es una necesidad para mejorar la capacidad reproductiva de los carneros en climas cálidos. Existe gran variedad de estrategias que pueden implementarse; sin embargo, no todas son igual de eficientes en todos los climas y sistemas de producción. Por ejemplo, en razas de lana, la esquila en los meses de verano es una estrategia ampliamente usada para mejorar la capacidad de termorregulación en carneros, sin embargo, en Argentina reportaron que la incidencia de cabezas espermáticas elípticas aumentó (76 %) en carneros Merino Australiano por esquilarlos completamente en un ambiente de EC(62). Similarmente, la esquila en carneros de raza de pelo Desert Hamari resultó efectiva para mejorar la termorregulación, pero contraproducente para la calidad seminal durante la época de verano(60). Por su parte, Rathore(61) encontró 16 % menos cantidad de anormalidades espermáticas por esquilar los testículos en carneros. Estos hallazgos sugieren la necesidad de realizar más estudios para determinar la efectividad de esta estrategia de mitigación del EC para mejorar la fertilidad del carnero. En sementales Morada Nova y Santa Inés, la capacidad de termorregulación y la circunferencia escrotal y firmeza testicular mejoraron, además, las anormalidades espermáticas disminuyeron por debajo del 4 % debido a la instalación de sombras(66). De forma similar, la implementación de sombras de asbesto mejoró el mantenimiento de normotermia en carneros de raza Barki(67). Por otro lado, un aumento en el flujo de aire en presencia de Ta altas aportó ventajas en las variables fisiológicas de los carneros(10). Además, el uso de camas de paja en los corrales de alojamiento de los carneros mejoró la pérdida de calor corporal por conducción(1); sin embargo, no se tiene conocimiento del efecto de sistemas de enfriamiento o el uso de distintos materiales para cama sobre la actividad reproductiva del carnero. Se ha observado en ovejas y corderos de engorda que la suplementación alimenticia con proteínas, lípidos, antioxidantes y minerales, mejora la manera en que enfrentan el EC(1,68,69). Sin embargo, en carneros solamente hay información del uso de antioxidantes como estrategia de mitigación de los efectos del EC. La suplementación dietaria del antioxidante -oryzanol en carneros disminuyó en 26 % la producción de ERO e incrementó el porcentaje de espermatozoides con membrana intacta tras la hipertermia testicular; sin embargo, también hubo una aumento en las anormalidades espermáticas(59). La administración parenteral de vitamina E o vitamina E más selenio, mejoró la calidad seminal y el apetito sexual de sementales Awassi sometidos a Ta de 43 a 54 °C(70). Cabe mencionar que se necesita desarrollar investigación sobre algunas estrategias nutricionales que puedan ayudar a minimizar los efectos negativos del EC en la reproducción de los carneros.

924


Rev Mex Cienc Pecu 2021;12(3):910-931

Por otra parte, con la intención de mejorar la capacidad de termorregulación en la descendencia, se ha optado por la selección de progenitores de razas autóctonas, que muestren capacidad de termorresistencia y adaptación al ambiente en que se han desarrollado(27). De éste modo, crece el interés por la identificación de marcadores genéticos como el gen de fecundidad Booroola (FecB), el cual aparte de incrementar la prolificidad de las ovejas, también influye positivamente en mejorar la capacidad de producir semen de calidad deseable bajo condiciones de clima cálido semi-árido en carneros de raza pura Garole o cruza con Malpura(23,71).

Conclusiones A pesar de las características de resistencia y rusticidad natural que poseen los ovinos, el EC provoca en el carnero una serie de cambios fisiológicos y metabólicos que modifican el balance energético y hormonal reproductivo, lo que finalmente repercute en forma negativa en las concentraciones sanguíneas de testosterona y, por ende, en la calidad seminal y conducta sexual. Aunado a esto, la hipertermia ocasiona daños directos a nivel de membrana y ADN del espermatozoide, disminuyendo su capacidad fecundante. Por lo tanto, el uso de estrategias de mitigación del EC en carneros es una necesidad para mantener la fertilidad en el rebaño, particularmente en la época caliente del año de climas cálidos. La estrategia de mitigación de EC a usar dependerá del tipo (agudo o crónico) e intensidad del EC (moderado o severo) al que se exponga el carnero, así como a su grado de adaptación al clima, por lo cual podría usarse desde una simple área sombreada con o sin ventiladores, hasta la suplementación de aditivos como antioxidantes. Literatura citada: 1. Sejian V, Bhatta R, Gaughan J, Malik PK, Naqvi S, Lal R. Sheep production adapting to climate change. Singapore: Springer Nature Singapore Pte Ltd; 2017. 2. Bernabucci U, Lacetera N, Baumgard LH, Rhoads RP, Ronchi B, Nardone A. Metabolic and hormonal acclimation to heat stress in domesticated ruminants. Animal 2010;4(7):1167-1183. 3. Al-Dawood A. Towards heat stress management in small ruminants–a review. Ann Anim Sci 2017;17(1):59-88. 4. Marai IFM, El-Darawany AA, Fadiel A, Abdel-Hafez MAM. Physiological traits as affected by heat stress in sheep — A review. Small Ruminant Res 2007;71(1):1-12. 5. Vicente-Pérez R, Macías-Cruz U, Avendaño-Reyes L, Correa-Calderón A, López-Baca MA, Lara-Rivera AL. Impacto del estrés por calor en la producción de ovinos de pelo. Rev Mex Cienc Pecu 2020;11(1):205-222.

925


Rev Mex Cienc Pecu 2021;12(3):910-931

6. Bett B, Kiunga P, Gachohi J, Sindato C, Mbotha D, Robinson T, et al. Effects of climate change on the occurrence and distribution of livestock diseases. Prev Vet Med 2017;137:119-129. 7. Kumar D, Sejian V, Gaughan JB, Naqvi SMK. Biological functions as affected by summer season-related multiple environmental stressors (heat, nutritional and walking stress) in Malpura rams under semi-arid tropical environment. Biol Rhythm Res 2017;48(4):593606. 8. Belhadj SI, Mohamed C, Najar T, Ghram A. Meta-analysis of some physiologic, metabolic and oxidative responses of sheep exposed to environmental heat stress. Livest Sci 2019;229:179–187. 9. Tort L, Teles M. The endocrine response to stress-a comparative view. In: Akin F editor. Basic and clinical endocrinology up-to-date. InTech; 2011:263-286. 10. Wojtas K, Cwynar P, Kołacz R. Effect of thermal stress on physiological and blood parameters in merino sheep. Bull Vet Inst Pulawy 2014;58(2):283-288. 11. Rahman MB, Schellander K, Luceno NL, Van Soom A. Heat stress responses in spermatozoa: Mechanisms and consequences for cattle fertility. Theriogenology 2018;113:102-112. 12. Damián JP, Bausero M, Bielli A. Acute stress, hypothalamic-hypophyseal-gonadal axis and testicular function–A review. Ann Anim Sci 2015;15(1):31-50. 13. Binsiya T, Sejian V, Bagath M, Krishnan G, Hyder I, Manimaran A, et al. Significance of hypothalamic-pituitary-adrenal axis to adapt to climate change in livestock. Int Res J Agri Food Sci 2017;2(1):1-20. 14. Aké-López J, Aké-Villanueva N, Segura-Correa J, Aké-Villanueva J, Montes-Pérez R. Effect of age and season on semen traits and serving capacity of Pelibuey rams under tropical conditions. Livest Res Rural Dev 2016;28(9):166. http://www.lrrd.org/lrrd28/9/akel28166.htm. Accessed Nov 25, 2019. 15. Kahwage PR, Esteves SN, Jacinto MAC, Junior WB, Machado R, Romanello N, et al. Assessment of body and scrotal thermoregulation and semen quality of hair sheep rams throughout the year in a tropical environment. Small Ruminant Res 2018;160:72-80. 16. Moura ABB, Brandao FZ, Esteves SN, de Souza GN, da Fonseca JF, Pantoja MHA, et al. Differences in the thermal sensitivity and seminal quality of distinct ovine genotypes raised in tropical conditions. Theriogenology 2019;123:123-131. 17. Inbaraj S, Sejian V, Bagath M, Bhatta R. Impact of heat stress on immune responses of livestock: a review. Pertanika J Trop Agric Sci 2016;39(4):459-482. 926


Rev Mex Cienc Pecu 2021;12(3):910-931

18. Li FK, Yang Y, Jenna K, Xia CH, Lv SJ, Wei WH. Effect of heat stress on the behavioral and physiological patterns of Small-tail Han sheep housed indoors. Trop Anim Health Prod 2018;50(8):1893-1901. 19. Leite PG, Marques JI, Furtado DA, Lopes Neto JP, de Souza BB, do Nascimento JWB. Ethology, physiological, and ingestive responses of sheep subjected to different temperatures and salinity levels of water. Int J Biometeorol 2019;63(8):1091-1098. 20. Collier RJ, Baumgard LH, Zimbelman RB, Xiao Y. Heat-stress: physiology of acclimation and adaptation. Anim Frontier 2019;9(1):12-19. 21. Macías-Cruz U, Correa-Calderón A, Mellado M, Meza-Herrera CA, Aréchiga CF, Avendaño-Reyes L. Thermoregulatory response to outdoor heat stress of hair sheep females at different physiological state. Int J Biometeorol 2018;62(12):2151-2160. 22. Macías-Cruz U, Álvarez-Valenzuela FD, Correa-Calderón A, Díaz-Molina R, Mellado M, Meza-Herrera CA, et al. Thermoregulation of nutrient-restricted hair ewes subjected to heat stress during late pregnancy. J Therm Biol 2013;38(1):1-9. 23. De K, Kumar D, Balaganur K, Kumar Saxena V, Thirumurugan P, Khursheed Naqvi SM. Effect of thermal exposure on physiological adaptability and seminal attributes of rams under semi-arid environment. J Therm Biol 2017;65:113-118. 24. Fonsêca VFC, Maia ASC, Saraiva EP, de Melo Costa CC, da Silva RG, Abdoun KA, et al. Bio-thermal responses and heat balance of a hair coat sheep breed raised under an equatorial semi-arid environment. J Therm Biol 2019;84:83-91. 25. Cain IJW, Krausman PR, Rosenstock S, Turner JC. Mechanisms of thermoregulation and water balance in desert ungulates. Wildl Soc Bull 2006;34(3):570-581. 26. NRC. National Research Council. Nutrient requirements of sheep. 6th ed. Washington, DC, USA: National Academy Press; 1985. 27. Berihulay H, Abied A, He X, Jiang L, Ma Y. Adaptation mechanisms of small ruminants to environmental heat stress. Animals 2019;9(3):75. 28. Baumgard LH, Rhoads RP, Jr. Effects of heat stress on postabsorptive metabolism and energetics. Annu Rev Anim Biosci 2013;1:311-337. 29. Mahjoubi E, Yazdi MH, Aghaziarati N, Noori GR, Afsarian O, Baumgard LH. The effect of cyclical and severe heat stress on growth performance and metabolism in Afshari lambs. J Anim Sci 2015;93(4):1632-1640. 30. Khalek TMMA. Thermoregulatory responses of sheep to starvation and heat stress conditions. Egyptian J Anim Prod 2007;44(2):137-150.

927


Rev Mex Cienc Pecu 2021;12(3):910-931

31. Al-Haidary A, Aljumaah R, Alshaikh M, Abdoun K, Samara E, Okab A, et al. Thermoregulatory and physiological responses of Najdi sheep exposed to environmental heat load prevailing in Saudi Arabia. Pak Vet J 2012;32(4):515-519. 32. Nazifi S, Saeb M, Rowghani E, Kaveh K. The influences of thermal stress on serum biochemical parameters of Iranian fat-tailed sheep and their correlation with triiodothyronine (T 3), thyroxine (T 4) and cortisol concentrations. Comp Clin Path 2003;12(3):135-139. 33. Macías-Cruz U, López-Baca MA, Vicente R, Mejía A, Álvarez FD, Correa-Calderón A, et al. Effects of seasonal ambient heat stress (spring vs. summer) on physiological and metabolic variables in hair sheep located in an arid region. Int J Biometeorol 2016;60(8):1279-1286. 34. Charmandari E, Tsigos C, Chrousos G. Endocrinology of the stress response. Annu Rev Physiol 2005;67:259-284. 35. Braden A, Mattner P. The effects of scrotal heating in the ram on semen characteristics, fecundity, and embryonic mortality. Aust J Agric Res 1970;21(3):509-518. 36. Chella L, Kunene N, Lehloenya K. A comparative study on the quality of semen from Zulu rams at various ages and during different seasons in KwaZulu-Natal, South Africa. Small Ruminant Res 2017;151:104-109. 37. Maurya VP, Sejian V, Kumar D, Naqvi SM. Effect of induced body condition score differences on sexual behavior, scrotal measurements, semen attributes and endocrine responses in Malpura rams under hot semi-arid environment. J Anim Physiol Anim Nutr (Berl) 2010;94(6):e308-e317. 38. Benia A, Taibi K, Ait-Amrane A, Belhamiti T, Hammoudi S, Kaidi R. Study of seasonal sexual activity variations in Algerian rams: Sexual behaviour, testosterone concentration control and environmental factors. Afr J Biotechnol 2013;12(41):6042-6048. 39. Cárdenas-Gallegos M, Aké-López J, Magaña-Monforte J, Centurión-Castro F. Libido and serving capacity of mature hair rams under tropical environmental conditions. Arch Med Vet 2015;47(1):39-44. 40. Senger PL. Pathways to pregnancy and parturition. 3rd ed. Pullman, Washington: Current conceptions, Inc; 2012. 41. Byers SW, Glover TD. Effect of scrotal insulation on the pituitary-testicular axis of the ram. J Reprod Fertil 1984;71(1):23-31.

928


Rev Mex Cienc Pecu 2021;12(3):910-931

42. Huanca W, Coronado L, Galloway DB. Efecto de la manipulación de la temperatura escrotal sobre las características clínicas, seminales y endocrinas en carneros. Rev Inv Vet Perú 2015;26(4):604-613. 43. Narayan E, Parisella S. Influences of the stress endocrine system on the reproductive endocrine axis in sheep (Ovis aries). Ital J Anim Sci 2017;16(4):640-651. 44. Tsigos C, Papanicolaou DA, Kyrou I, Raptis SA, Chrousos GP. Dose-dependent effects of recombinant human interleukin-6 on the pituitary-testicular axis. J Interferon Cytokine Res 1999;19(11):1271-1276. 45. Patel N, Kashanian JA. Thyroid dysfunction and male reproductive physiology. Semin Reprod Med 2016;34(6):356-360. 46. Hassanpour H, Kadivar A, Mirshokraei P, Nazari H, Afzali A, Badisanaye M. Connexin43: A possible mediator of heat stress effects on ram Sertoli cells. Vet Res Forum 2015;6(2):125-130. 47. Alves MB, Andrade AF, Arruda RP, Batissaco L, Florez-Rodriguez SA, Oliveira BM, et al. Recovery of normal testicular temperature after scrotal heat stress in rams assessed by infrared thermography and its effects on seminal characteristics and testosterone blood serum concentration. Theriogenology 2016;86(3):795-805.e2. 48. Saab SA, Sleiman FT, Kallassy N, Darweesh WY, Aad PY. Effect of adaptation and heat stress on reproductive performances of fat-tail Awassi rams in eastern mediterranean. Leban Sci J 2011;12(1):31-44. 49. Karagiannidis A, Varsakeli S, Alexopoulos C, Amarantidis II. Seasonal variation in semen characteristics of Chios and Friesian rams in Greece. Small Ruminant Res 2000;37(1):125-130. 50. Panyaboriban S, Suwimonteerabutr J, Swangchan-Uthai T, Tharasanit T, Phutikanit N, Techakumphu M. Effect of heat stress on reproductive performance of an imported dorper ram: a case study in Thailand. Thai J Vet Med 2016;46(4):671-677. 51. Francis JR, Javvaji PK, Dhali A, Kolte AP, Roy SC, Giridhar K, et al. Seasonal variations in quality, preservability and fertilizing ability of ovine spermatozoa. Biol Rhythm Res 2019:1-12. 52. Marai IFM, El-Darawany AHA, Ismail ESAF, Abdel-Hafez MAM. Tunica dartos index as a parameter for measurement of adaptability of rams to subtropical conditions of Egypt. Anim Sci J 2006;77(5):487-494.

929


Rev Mex Cienc Pecu 2021;12(3):910-931

53. Maurya VP, Sejian V, Kumar D, Naqvi SMK. Impact of heat stress, nutritional restriction and combined stresses (heat and nutritional) on growth and reproductive performance of Malpura rams under semi-arid tropical environment. J Anim Physiol Anim Nutr (Berl) 2016;100(5):938-946. 54. Kafi M, Safdarian M, Hashemi M. Seasonal variation in semen characteristics, scrotal circumference and libido of Persian Karakul rams. Small Ruminant Res 2004;53(1):133139. 55. Suhair SM, Abdalla MA. Effects of seasonal changes and shearing on thermoregulation, blood constituents and semen characteristics of desert rams (Ovis aries). Pak J Biol Sci 2013;16(24):1884-1893. 56. Belkadi S, Safsaf B, Heleili N, Tlidjane M, Belkacem L, Oucheriah Y. Seasonal influence on sperm parameters, scrotal measurements, and serum testosterone in Ouled Djellal breed rams in Algeria. Vet World 2017;10(12):1486-1492. 57. Moreira EP, Moura AdAA, Araújo AAd. Efeitos da insulação escrotal sobre a biometria testicular e parâmetros seminais em carneiros da raça Santa Inês criados no estado do Ceará. R Bras Zootec 2001;30(6):1704-1711. 58. Gastelum-Delgado MA, Avendaño-Reyes L, Álvarez-Valenzuela FD, Correa-Calderón A, Meza-Herrera CA, Mellado M, et al. Conducta estral circanual en ovejas Pelibuey bajo condiciones áridas del noroeste de México. Rev Mex Cienc Pecu 2015;6(1):109118. 59. Escobar E, Lopes S, Malavolta C, Ramalho JB, Missio D, Pinto HF, et al. Effect of gamma-oryzanol on testicular degeneration induced by scrotal insulation in rams. Theriogenology 2019;128:167-175. 60. Rathore AK. A note on the effect of scrotal wool cover on morphological changes in ram spermatozoa due to heat stress. Anim Prod 1969;11(4):561-563. 61. Rathore AK. Acrosomal abnormality in ram spermatozoa due to heat stress. Br Vet J 1970;126(8):440-443. 62. Armengol MF, Sabino GA, Forquera JC, de la Casa A, Aisen EG. Sperm head ellipticity as a heat stress indicator in Australian Merino rams (Ovis aries) in Northern Patagonia, Argentina. Theriogenology 2015;83(4):553-559.e2. 63. Hamilton TR, Mendes CM, de Castro LS, de Assis PM, Siqueira AF, Delgado JdC, et al. Evaluation of lasting effects of heat stress on sperm profile and oxidative status of ram semen and epididymal sperm. Oxid Med Cell Longev 2016:12.

930


Rev Mex Cienc Pecu 2021;12(3):910-931

64. Silva LKX, Sousa JS, Silva AOA, Lourenco Junior JB, Faturi C, Martorano LG, et al. Testicular thermoregulation, scrotal surface temperature patterns and semen quality of water buffalo bulls reared in a tropical climate. Andrologia 2018;50(2):e12836. 65. Fleming JS, Yu F, McDonald RM, Meyers SA, Montgomery GW, Smith JF, et al. Effects of scrotal heating on sperm surface protein PH-20 expression in sheep. Mol Reprod Dev 2004;68(1):103-114. 66. Kahwage PR, Esteves SN, Jacinto MAC, Junior WB, Pezzopane JRM, de AndradePantoja MH, et al. High systemic and testicular thermolytic efficiency during heat tolerance test reflects better semen quality in rams of tropical breeds. Int J Biometeorol 2017;61(10):1819-1829. 67. Hassanin S, Abdalla E, Kotby E, Abd-Elaziz A, El-Fouly M. Efficiency of asbestos shading for growth of Barki rams during hot summer. Small Ruminant Res 1996;20(3):199-203. 68. Can A, Denek N, Yazgan K. Effect of replacing urea with fish meal in finishing diet on performance of Awassi lamb under heat stress. Small Ruminant Res 2005;59(1):1-5. 69. Sejian V, Singh AK, Sahoo A, Naqvi SM. Effect of mineral mixture and antioxidant supplementation on growth, reproductive performance and adaptive capability of Malpura ewes subjected to heat stress. J Anim Physiol Anim Nutr (Berl) 2014;98(1):7283. 70. Talib AAB, Bomboi G, Floris B. Does vitamin E or vitamin E plus selenium improve reproductive performance of rams during hot weather? Ital J Anim Sci 2009;8(4):743754. 71.Kumar D, Naqvi SMK, Kumar S. Sperm motion characteristics of FecBBB and FecBB+ Garole x Malpura rams during the non-breeding season under hot semi-arid environment. Livest Sci 2012;150(1):337-341. 72. De K, Kumar D, Saxena VK, Naqvi SM. Study of circadian rhythmicity of physiological response and skin temperature of sheep during summer and winter in semi-arid tropical environment. Physiol Behav 2017;169:16-21. 73. Pantoja MHA, Esteves SN, Jacinto MAC, Pezzopane JRM, Paz CCP, Silva J, et al. Thermoregulation of male sheep of indigenous or exotic breeds in a tropical environment. J Therm Biol 2017;69:302-310. 74. Cwynar P, Kolacz R, Czerski A. Effect of heat stress on physiological parameters and blood composition in Polish Merino rams. Berl Munch Tierarztl Wochenschr 2014;127(5/6):177-182.

931


https://doi.org/10.22319/rmcp.v12i3.5178 Nota de investigación

Evaluación de las condiciones predisponentes a enfermedades en granjas porcinas a pequeña escala en un ambiente urbano en el noroeste de la Ciudad de México

Roberto Martínez Gamba a* Gerardo Ramírez Hernández a

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Medicina y Zootecnia de Cerdos, Ciudad de México, México.

*

Autor de correspondencia: rmgamba@yahoo.com.mx

Resumen: El objetivo del trabajo fue desarrollar y aplicar un instrumento para identificar las condiciones predisponentes a la presentación de enfermedades en 12 granjas porcinas a pequeña escala en un ambiente urbano. Se analizó el porcentaje de puntos negativos obtenidos de manera general y por tipo de granja en función a su producción, engorda (T1) o ciclo completo (T2), donde el mayor porcentaje fue para T1 (50 %) y para T2 (66.0 %). Del mismo modo se analizaron los datos para comparar a las granjas T1 y las T2 en relación con los porcentajes de cada sección que integra la encuesta, donde solo se encontró diferencia en la sección “estado de salud” (P<0.0001). La relación entre la densidad de población por m2 con respecto al porcentaje máximo de puntos alcanzados por granjas, no mostró diferencia (R2, 0.03; P=0.854). No se encontró correlación entre el porcentaje de puntos obtenidos con el número de animales (R2, 0.13; P=0.722). En relación al porcentaje promedio por sección por tamaño de la población, solo se detectó diferencia en la sección “alimentación” (P<0.0006), indicando que las granjas con 10 a 40 cerdos obtuvieron menos puntos en esta sección. Se concluye que la metodología para la evaluación de las condiciones predisponentes a enfermedades en este tipo de granjas resultó ser aplicable. Se determinó que el tamaño de las granjas y la densidad de población, no son un factor predisponente en estas granjas, pero las condiciones predisponentes a la presentación de enfermedades difieren entre granjas de ciclo completo y engorda.

932


Rev Mex Cienc Pecu 2021;12(3):932-943

Palabras clave: Cerdos, Enfermedades, Porcicultura urbana.

Recibido: 04/12/2018 Aceptado: 22/10/2020

A manera de introducción se puede mencionar que la producción animal urbana y periurbana existe en diferentes países del mundo(1,2) es una fuente de ocupación en la cual se establecen interrelaciones entre factores sociales, culturales, económicos, religiosos y sanitarios(3), dentro de ella la porcicultura es una estrategia para mitigar la pobreza(4), ya que el cerdo es un animal idóneo para los ambientes urbanos con requerimientos mínimos de espacio, versatilidad en el consumo de alimentos y fácil comercialización. Muchos de los productores porcícolas ubicados en ambientes urbanos se consideran porcicultores a pequeña escala, o sea aquellos que poseen hasta 575 animales o hasta 50 reproductoras(4). A estas granjas a pequeña escala (GPE) en condiciones urbanas se les asocia con la transmisión de enfermedades, la contaminación ambiental, la falta de bienestar animal y por ocasionar efectos negativos sobre la salud pública(5). Si bien existen diversos factores que pueden predisponer a este tipo de granjas a la presentación de enfermedades(6), poco se conoce con respecto a los factores de bioseguridad para evitar la presencia de enfermedades a ellas(7). Lo anterior determina la importancia de tener un diagnóstico correcto de la situación en dichas granjas, especialmente en aspectos sanitarios y de impacto ambiental, ya que, para avalar la producción de estas granjas, es necesario conocer el impacto potencial sobre la salud animal. En la zona noroeste de la ciudad de México, hay GPE que se han visto inmersas en la urbanización, un ejemplo específico son 14 productores porcinos localizados en la delegación de Azcapotzalco, quienes hace años iniciaron la crianza de sus animales en un ambiente rural, pero actualmente están en una situación crítica respecto al impacto de su actividad sobre los vecinos y las autoridades quienes asumen aspectos negativos en la salud, bienestar animal e impacto ambiental. Como objetivo de este trabajo se considera básico establecer una guía para realizar el proceso de calificación cuantitativa de las prácticas zootécnicas, de bioseguridad y medicina preventiva que puedan ser un riesgo de salud para este tipo de granjas, con el fin de posteriormente establecer las medidas paliativas o bien la toma de decisiones administrativas(2). El instrumento se ha modificado para aplicarse en granjas de tipo urbano a pequeña escala y es el primer ejercicio de este tipo. El trabajo se realizó en 12 granjas porcinas a pequeña escala (GPE) localizadas en la delegación Azcapotzalco de la Ciudad de México, mismas que representan el 85 % del total de granjas registradas en la asociación local de porcicultores. Se eligieron granjas donde los productores asumieron la condición de cooperantes, previa solicitud y

933


Rev Mex Cienc Pecu 2021;12(3):932-943

entrevista, y que se encuentran registrados en el Sistema Nacional de Identificación Individual de Ganado (SINIIGA). Las unidades evaluadas tuvieron un mínimo de 10 animales y un máximo de 299 y representan un porcentaje de la población porcina concordante con lo señalado por otros autores(1,8). Inicialmente se obtuvo información relativa al tiempo de operación de la granja, el espacio de la misma, si colinda con casas habitación, quién atiende la granja y si tiene asistencia veterinaria. Posteriormente, se realizó una o más visitas a cada granja acompañadas por la aplicación de un instrumento de evaluación in situ, realizado por un solo evaluador según la metodología usada en estudios semejantes(9,10). Las granjas se clasificaron en engordadoras (T1) o de ciclo completo (Tipo 2). Además se clasificaron con base en la cantidad de animales en tres grupos: A las que tenían de 1 a 40 animales, B de 41 a 100 y C de 101 a 300 animales(10). El instrumento fue aplicado en una granja como ensayo para determinar su operatividad, pero no fue validado previamente. Este se diseñó con siete secciones con un total de 55 preguntas; cada inciso fue confirmado por el evaluador en la inspección física que hizo en la granja; cada inciso tuvo un valor de 0 cuando la respuesta indicó un riesgo de salud alto, 1 cuando fue intermedio y 2 bajo; algunos incisos por sus características solo tuvieron las opciones de 0 y 2. El valor máximo de puntos obtenidos por cada sección fue: bioseguridad (B) 12 puntos, medicina preventiva (MP) 20, instalaciones (I) 12, alimentación (A) 14, manejo (M) 12, estado de salud de los cerdos (S) 16 y ambiente (Am) 14 puntos, dando un total de 100 puntos para T1 y 92 para T2. En la visita se comprobó el inventario de animales y se calculó la densidad de población en cada granja. Debido a que las granjas podían obtener una cantidad diferente de puntos dependiendo de su tipo (T1 o T2), se calculó el porcentaje de puntos obtenidos en forma general y por sección, para cada granja. Para establecer la diferencia entre el porcentaje de puntos de T1 y T2 en forma general y por cada sección se hizo la transformación de los porcentajes obteniendo la raíz cuadrada del arco seno; los datos así obtenidos se analizaron por medio de una prueba de Wilcoxon. De igual manera se analizaron las diferencias en porcentaje de puntos por los tres niveles poblacionales (A, B, C) usando la prueba de KruskallWallis, y en caso de encontrar diferencias estadísticas se realizó una prueba de diferencia de medias empleando la prueba honesta de Tukey(11). Se realizaron correlaciones entre el porcentaje y el total de puntos obtenidos con el número por cada granja, así como entre la densidad de población con el porcentaje de puntos y el total de puntos obtenidos por medio del coeficiente de correlación Spearman(10). Los datos se analizaron por medio del paquete estadístico JMP.8(12). Como resultados, inicialmente se presentan las condiciones generales de las granjas, mismas que se detallan en el Cuadro 1, donde se resume que las granjas tienen un mínimo de 18 años operando, con un espacio variable por debajo de los 600m2, solo una tiene trabajadores contratados, el 90 % están rodeadas de casas habitación y el 40 % de ellas no reciben ningún tipo de asesoría técnica. 934


Rev Mex Cienc Pecu 2021;12(3):932-943

Cuadro 1: Condiciones generales de las granjas Granja Años* Espacio/ Casas Tipo Atiende 2 granja m 1 50 49.2 Si T1 Dueño 2 70 200 Si T2 Familia 3 40 315 Si T2 Familia 4 30 63 Si T2 Familia 5 18 100 Si T2 Familia 6 20 11.25 No T1 Familia 7 44 600 Si T1 Familia 8 42 400 Si T1 Empleados 9 38 80 Si T1 Familia 10 40 300 Si T2 Familia 11 70 150 Si T2 Familia 12 20 200 No T2 Familia

Asesoría veterinaria No No Si Si No Si Si Si No Si No Si

*Antiguedad de la granja.

Se obtuvieron los datos de cinco granjas T1 y siete T2. En el Cuadro 2 se presenta el total de puntos y el porcentaje de puntos obtenidos de manera general en cada granja, así como el tipo de granja en función a su producción, donde se observa que el menor porcentaje de puntos obtenido se presentó en la granja 6 con 31.52 y el mayor en la granja 12 con 66.00. Por tipo de granja el mayor porcentaje de puntos para T1 fue de 50 % y para T2 66.0 %. El porcentaje de puntos obtenido por cada granja se presenta en el Cuadro 3. Cuadro 2: Número de animales, puntos obtenidos y porcentaje de puntos generales por granja Granja

Tipo

Animales

Puntos

% Puntos

1 2 3 4 5 6 7 8 9 10 11 12

1 2 2 2 2 1 1 1 1 2 2 2

19 50 45 53 33 10 299 188 28 113 86 73

37 61 48 56 45 29 46 39 46 58 44 66

37.00 66.00 48.00 56.00 45.00 31.52 50.00 42.39 50.00 58.00 44.00 66.00

935


Rev Mex Cienc Pecu 2021;12(3):932-943

Cuadro 3: Porcentaje de puntos obtenidos por granja y sección del instrumento Granja

Tipo

B

MP

I

A

M

S

Am

1 2 3 4 5 6 7 8 9 10 11 12

1 2 2 2 2 1 1 1 1 2 2 2

15.34 41.67 58.33 41.67 66.67 23.01 30.67 7.67 38.34 33.33 41.67 41.67

57.50 80.00 60.00 40.00 65.00 28.75 57.50 51.75 40.25 80.00 30.00 90.00

46.01 66.67 41.67 66.67 25.00 15.34 53.68 53.68 61.35 66.67 25.00 66.67

18.40 57.14 42.86 71.43 21.43 9.20 46.00 46.00 27.60 57.14 50.00 50.00

46.01 50.00 33.33 41.67 16.67 46.01 61.35 38.34 38.34 16.67 41.67 50.00

51.72 87.50 75.00 87.50 87.50 57.47 57.47 45.98 68.97 87.50 87.50 87.50

13.14 28.57 14.29 42.86 14.29 13.14 13.14 26.28 39.42 42.86 28.57 57.14

B= bioseguridad; MP= medicina preventiva; I= instalaciones; A= alimentación; M= manejo; S= salud; Am= ambiente.

No se encontraron diferencias entre las granjas T1 de las T2 en cuanto a B, MP, I, A, M y Am; sin embargo, se encontró diferencia (P=0.002) entre las granjas T1 y T2 en la sección enfocada al estado de estado de salud (S) (Cuadro 4). Cuadro 4: Promedio y desviación estándar de los porcentajes de cada sección del instrumento por tipo de granja Sección

Tipo 1 (5 granjas)

Tipo 2 (7 granjas)

P

B MP I A M S Am

23.01 ± 12.12 47.15 ± 12.47 46.01 ± 17.9 29.44 ± 16.46 46.01 ± 7.39 56.32 ± 8.53 21.03 ± 11.75

46.43 ± 11.65 63.57 ± 22.12 51.19 ± 20.0 50.00 ± 14.46 35.71 ± 19.68 85.71 ± 17.18 32.65 ± 28.11

0.116 0.121 0.361 0.369 0.367 0.002 0.058

B= bioseguridad; MP= medicina preventiva; I= instalaciones; A= alimentación; M= manejo; S= salud; Am= ambiente.

Se analizó la relación entre la densidad de población por m2 con respecto a los puntos máximos totales alcanzados por las 12 granjas, sin encontrar efecto (R2, 0.03; P=0.854). En la correlación entre el porcentaje de puntos obtenidos con el número de animales existentes en la granja, no se encontró efecto tanto de manera general como por secciones (R2, 0.13; P=0.722). En relación al porcentaje promedio por sección para cada clasificación de tamaño de la población, solo se detectó diferencia en la sección A (Cuadro 5).

936


Rev Mex Cienc Pecu 2021;12(3):932-943

Cuadro 5: Promedio y desviación estándar del porcentaje de puntos de cada sección del instrumento en relación al número de animales por tamaño de granja A (n= 5)

B (n= 4)

C (n= 3)

P

B

35.84 ± 3.03

45.00 ± 0.78

23.89 ± 11.8

0.228

MP

47.88 ± 22.06

60.00 ± 25.5

63.09 ± 13.06

0.584

I

36.92 ± 15.23

53.33 ± 18.0

58.01 ± 7.9

0.286

A

19.16a ± 18.06

54.29b ±8.75

49.71b ± 7.33

0.0006

M

36.76 ± 12.51

43.33 ±4.17

38.79 ± 18.7

0.777

S

66.42 ± 12.3

85.00 ± 0.13

63.65 ± 15.2

0.106

Am

20.00 ± 14.2

34.29 ±11.8

27.43 ± 13.46

0.399

B= bioseguridad; MP= medicina preventiva; I= instalaciones; A= alimentación; M= manejo; S= salud; Am= ambiente.

Los incisos que obtuvieron un puntaje de 0 y 1 se consideraron como deficiencias en el proceso de producción de la granja, pueden indicar un riesgo para la presentación de enfermedades y son áreas de oportunidad para el trabajo en la granja. En el Cuadro 6 se presenta el número de productores que tienen debilidades en función de cada una de las preguntas del instrumento.

Cuadro 6: Incisos del instrumento por sección y número de granjas que presentaron deficiencias (1 o cero puntos) en cada pregunta del instrumento Sección Pregunta B

MP

I

2 puntos

Ubicación con respecto a otras granjas Procedencia de los animales Área de cuarentena Visitas en la granja Uso de ropa de trabajo Existe un baño/vestidor Lavado y desinfección Vacuna al pie de cría Vacuna destetes Vacuna engorda Desparasitación pie de cría Desparasitación en destetes Desparasitación engorda Medicaciones preventivas Control de plagas Presencia de otros animales en la granja Adecuado diseño de la granja Espacio por animal Comederos adecuados

937

2 8 0 5 2 6 5 4 6 6 6 2 7 8 11 1

1 punto

0 puntos

3 2

7 2 12 4 4 6 1 2 5 8

3 6 6 5 3 4 1 6 4 10 1 10 4 1 5

2 4 2

6


Rev Mex Cienc Pecu 2021;12(3):932-943

A

M

S

Am

Bebederos adecuados Control de ventilación Características del piso Tipo de alimento (balanceado, alternativo) Condiciones de almacenamiento Usa tratamiento para alimentación alternativa Adecuado suministro de alimento para lechones Suministro de alimento en maternidad/ hembras Suministro de alimento en destete Suministro de alimento en engorda Sistema de manejo en general Se reagrupa a los cerdos Agrupamiento por tamaño/peso Existe un área de enfermería Se da tratamiento a los enfermos Se usan registros Morbilidad general en la granja el último mes Mortalidad general en la granja el último mes Presencia de diarrea Presencia de signos respiratorios Presencia de signos sistémicos Presencia de signos nerviosos Presencia de trastornos locomotores o de piel Presencia de problemas reproductivos Se tratan las excretas líquidas Se tratan las excretas sólidas Presencia de olores Nivel de ruido en la granja Como es el desecho de desperdicios biológicos Como es el desecho de desperdicios inorgánicos Como es el desecho de desperdicios químicos

5 3 1 3

7 7

5 1 8 9 6 1

5 11

2

2

2

5

1 2 1

4 3 11 2 2 11 11 9 2 1 6 10 1

10 10 1 1 9 11 6 2 11 12 10 11 4 6 10 3

3 1

7 6 4

2 1 12 8 6 2 12 9 12

B= bioseguridad; MP= medicina preventiva; I= instalaciones; A= alimentación; M= manejo; S= salud; Am= ambiente.

Al analizar los incisos que obtuvieron 0 o 1 de calificación en B ninguna granja tiene cuarentena y la mitad de los productores no tienen un baño ni vestidor. En MP destaca que en todas las granjas existe la presencia de otras especies domésticas. En A el diseño, la instalación, la calidad de los comederos y bebederos se consideró como una deficiencia de planeación, ya que un solo productor tiene comederos adecuados, y ninguna de las granjas tuvo bebederos apropiados. En ninguna granja se encontraron los pisos secos y de acabado adecuado para el confort de los animales. En A solo dos granjas emplean una combinación de alimento alternativo y balanceado para las reproductoras, mientras que el resto solo suministra alimento alternativo y ningún 938


Rev Mex Cienc Pecu 2021;12(3):932-943

productor realiza un tratamiento de este tipo de alimento. En M solo en una granja existe “sistema todo dentro todo fuera” y un área de enfermería. En S es un factor de riesgo que 83 % de las granjas presentaron signos respiratorios en varias áreas de la producción y en un 50 % se observó diarreas. Por último, en Am se observó como principal deficiencia que ninguno de los productores trata las excretas y no tienen un desecho adecuado de desperdicios biológicos y químicos. En cuanto al desperdicio inorgánico solo una cuarta parte da tratamiento, el resto lo desecha como basura urbana. A manera de discusión y a raíz de los resultados presentados se plantea que la información obtenida a partir de la aplicación del instrumento de evaluación puede presentar sesgos como sucede con este tipo de trabajos y lo reportan otros autores(1,6,10). De igual manera la falta de validación del instrumento en granjas de tipo urbano y a pequeña escala establece limitaciones en la interpretación de los resultados. La mayor parte de estas granjas se dedican al ciclo completo, contrariamente a lo esperado, ya que se señala que la crianza de cerdos de engorda requiere un mínimo de instalaciones y el costo de alojamiento para el ciclo completo es la parte más cara del sistema, ya que se necesitan construcciones específicas para todas las etapas biológicas del cerdo(13). Por otra parte, estos resultados corresponden a lo presentado por autores que reportaron que las granjas de ciclo completo presentan mejores rendimientos económicos que las productoras de lechones y engordadoras(14). Las labores de las granjas evaluadas concuerdan con otros autores que señalan que el trabajo se realiza por integrantes de la familia y en la mayoría de los casos la crianza de animales no constituye la única actividad económica(14,15), pero se encontró que eran personas de edad avanzada, lo que contrasta a lo mencionado por los mismos autores en otras granjas no urbanas del centro de México, cuyos propietarios están en edad económica activa y tienen mayor escolaridad(14). Las deficiencias en bioseguridad, instalaciones, vacunación y el transporte, entre otros, hace que aumente el riesgo de introducción de agentes patógenos en la granja(10), por lo que es necesario detectar puntos críticos en cada granja para aumentar la bioseguridad y reducir la transmisión de enfermedades(16). El que ninguna granja tenga cuarentena incrementa el riesgo a la transmisión de enfermedades a la población y representa una falla fundamental en la bioseguridad(17) y es el mayor riesgo para la introducción de patógenos a la granja. De igual modo la ausencia de vestidores representa una ruptura en los protocolos de bioseguridad(18). Si bien se entiende que los ingresos de este tipo de granja limitan la inversión en medidas de bioseguridad, es importante que cada una de ellas establezca prácticas que mitiguen el riesgo de transmisión de enfermedades; tal vez lo más importante pase por la concientización de los productores en comprar animales del mismo origen e impedir la entrada y salida de personas a la granja sin las medidas higiénicas básicas.

939


Rev Mex Cienc Pecu 2021;12(3):932-943

Las deficiencias en la cantidad y diseño de bebederos y comederos afectan el consumo de agua y la obtención de nutrientes lo que pueden afectar la salud de los animales(19). Las condiciones de humedad alta y temperatura baja encontradas en el 50 % de las granjas predisponen a neumonías, enfermedades en la piel, presencia de parásitos, consumo de alimento y lesiones en las pezuñas(20). Otra condición que predispone a la existencia de enfermedades es el estado del piso, que puede ser un factor en la presentación de enfermedades debido a que un suelo con grietas dificulta el lavado y la desinfección del mismo(21). Otro aspecto que se puede asociar a la existencia y transmisión de enfermedades es el uso casi generalizado de desperdicios de cocina en la alimentación de cerdos; este tipo de prácticas aumenta la aparición de enfermedades zoonóticas, riesgo que se corre cuando los animales son criados cerca de las viviendas, especialmente cuando se utilizan sin tratamiento(22). El bajo puntaje en aspectos de manejo indica que en las GPE en los cuidados para los cerdos no se emplean prácticas modernas basadas en la fisiología de los animales, lo que concuerda con diversos autores(6,23); en este estudio esta idea se refuerza ya que la mayoría de los productores no tiene enfermería y los cerdos enfermos están distribuidos entre la población. Un punto a favor de las granjas evaluadas es que al no reagrupar se reduce el estrés que esto representa y por ende el estado inmune de los cerdos podría ser mejor, lo que reduce la posibilidad de que se enfermen y puedan transmitir patógenos a otras poblaciones(24,25). El espacio requerido por animal en las granjas evaluadas fue correcto y no representa una situación que predisponga a la presentación de enfermedades(26). La diferencia en el porcentaje de puntos obtenidos entre las granjas de engorda y las de ciclo completo en la sección “Estado de salud”, indica que la finalidad de la granja influye en la presentación de enfermedades, la principal desventaja del sistema de engorda radica en tener animales de diferente edad y origen(24), ya que sabido de los riesgos al comprar a varios proveedores de lechones(17). En función de los resultados del estudio se puede pensar que las GPE son un riesgo para la transmisión de enfermedades, ya que la ausencia de protocolos para desechos biológicos, inorgánicos y químicos y la falta de tratamiento a las excretas sólidas o líquidas representa un riesgo para la salud pública y de otras poblaciones porcinas(27,28). Además el manejo de residuos en un espacio reducido y cercano a casas habitación impacta el ambiente al dispersarse o verterse sin control(22). Si bien el tamaño de las granjas no influyó en la calificación obtenida en A, se encontró una diferencia negativa en las granjas con menos de 40 animales; esto se explica porque los productores con pocos animales emplean alimentación alternativa sin tratamiento, no

940


Rev Mex Cienc Pecu 2021;12(3):932-943

invierten en comederos y alimentan en forma racionada, lo que disminuye el estado de salud(29). Se concluye que la metodología para la evaluación de las condiciones predisponentes a enfermedades en GPE en un ambiente urbano por medio de una calificación numérica resultó ser aplicable a las granjas. Como ventajas de la aplicación del instrumento pueden citarse: establecer una estructura ordenada para realizar la inspección de la granja y contar con una información básica para la detección de áreas de oportunidad para paliar dichos riesgos e implementar métodos de diagnóstico más precisos. Como desventajas del instrumento están que puede ofrecer resultados variantes de una granja a otra y que la calificación de las granjas tendría que realizarse en un mayor número de granjas y validar la información del instrumento. Preliminarmente se observó que el tipo de producción, el tamaño de las granjas y la densidad de población, no son un factor en cuanto a la calificación numérica que se obtuvo, pero el estado de salud difiere si la granja es de ciclo completo y engorda; se identificó que en las granjas con menor población los aspectos de alimentación son un factor de riesgo para la presentación de enfermedades. Los autores declaran no tener conflicto de interés. Literatura citada: 1. Wabacha JK, Maribei JM, Mulei CM, Kyule MN, Zessin KH, Oluoch-Kosura W. Characterisation of smallholder pig production in Kikuyu Division, central Kenya. Prev Vet Med 2004;63:183-195. 2. Costard S, Porphyre V, Messad S, Rakotondrahanta S, Vidon H, Roger F, Pfeiffer DU. Multivariate analysis of management and biosecurity practices in smallholder pig farms in Madagascar. Prev Vet Med 2009;92:199-209. 3. Riethmuller P. The social impact of livestock: A developing country perspective. Animal Sci J 2003;74:245-253. 4. Rivera J, Hermenegildo L, Cortés J, Vieyera J, Castillo A, González O. Cerdos de traspatio como estrategia para aliviar pobreza en dos municipios conurbados al oriente de la Ciudad de México. Livest Res Rural Dev 2007;19:7. http://www.lrrd.org/lrrd19/7/rive19096.htm. 5. Correia GC, Henry MK, Auty H, Gunn GJ. Exploring the role of small-scale livestock keepers for national biosecurity-The pig case. Prev Vet Med 2017;145:7-15. 6. Riedel S, Schiborra A, Hülsebusch C, Schlecht E. The productivity of traditional smallholder pig production and possible improvement strategies in Xishuangbanna, South Western China. Livest Sci 2014;160:151-162. 7. Schembri N, Hernandez-Jover M, Toribio AMLN, Holyoake PK. On-farm characteristics and biosecurity protocols for small-scale swine producers in Eastern Australia. Prev Vet Med 2015;118:104-116. 941


Rev Mex Cienc Pecu 2021;12(3):932-943

8. Hayes L, Woodgate R, Rast L, Toribio ALML, Hernandez-Jover M. Understanding animal health communication networks among smallholders livestock producers in Australia using stakeholder analysis. Prev Vet Med 2017;144:189-101. 9. Simon-Grifé M, Martin-Valls GE, Vilar MJ, García-Bocanegra I, Martín M, Mateu E, Casal J. Biosecurity practices in Spanish pig herds: Perceptions of farmers and veterinarians of the most important biosecurity measures. Prev Vet Med 2013;110: 223-231. 10. Alawneh J, Barnes T, Parke C, Lapuz E, David E, Basinang V, Baluyut A, Villar E, Lopez E, Blackall P. Description of the pig production systems, biosecurity practices and herd health providers in two provinces with high swine density in the Philippines. Prev Vet Med 2014;114:73-87. 11. Marques MJ. Probabilidad y estadística para ciencias Químico-Biológicas. México: Editorial McGraw-Hill; 1996. 12. SPSS Inc. Released 2009. PASW Statistics for windows, version 18.0. Chicago: SPSS Inc. 2009. 13. Padilla M. Manual de porcicultura. Ministerio de Agricultura y Ganadería. Programa Nacional de Cerdos. Fundación para el fomento y promoción de la investigación y transferencia de tecnología agropecuaria en Costa Rica. San José, Costa Rica; 2007. 14. Losada EN, Mercadillo SA, Martínez-Gamba RG. Costos de producción y evaluación

del impacto de diversos insumos sobre la rentabilidad de unidades productoras de cerdos de traspatio en la zona metropolitana de la Ciudad de México. Livest Res Rural Dev 2014;26, Article 205. http://www.lrrd.org/lrrd26/11/losa26205. Consultado Nov 12, 2017. 15. Enríquez-Lorenzo C, Martínez-Castañeda FE. Producción porcina en pequeña escala y su aportación a la economía familiar. Ganadería y seguridad alimentaria en tiempo de crisis. UACH-CP; 2009. 16. Ouma E, Dione M, Lule P, Roesel K, Pezo D. Characterization of smallholder pig production systems in Uganda: constraints and opportunities for engaging with market systems. Livest Res Rural Dev 2014;26, Article 3. http://www.lrrd.org/lrrd26/3/ouma26056.htm. Accessed Feb 15, 2018. 17. Morilla A. Manual de bioseguridad para empresas porcinas. Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad Universitaria. México; 2009. 18. Pitkin A, Otake S, Dee S. A one-night downtime period prevents the spread of porcine reproductive and respiratory syndrome virus and Mycoplasma hyopneumoniae by personnel and fomites (boots and coveralls). J Swine Health Prod 2011;19(6):345348.

942


Rev Mex Cienc Pecu 2021;12(3):932-943

19. Huerta R, Gasa J. Manual de buenas prácticas de producción porcina. Lineamientos generales para el pequeño y mediano productor de cerdos. Red Porcina Iberoamericana 2012;10:1-13. 20. INTA. Manejo sanitario eficiente de los cerdos. Programa Especial Para la Seguridad Alimentaria (PESA). Instituto Nicaragüense de Tecnología Agropecuaria, Managua, Nicaragua. 2010. 21. Guatirojo Y. Manual de bioseguridad en granjas porcícolas [tesis de grado]. Jalapa, Veracruz, México. Universidad Veracruzana. Facultad de Medicina Veterinaria y Zootecnia; 2012. 22. Seija C. Revisión de experiencias urbanas y periurbanas de cría animal como alternativa de seguridad alimentaria. Revista de Investigación Agraria y Animal 2011;2:51-63. 23. Alarcón G, Camacho J, Gallegos J. Manual del participante: Producción de Cerdos. Institución de enseñanza e investigación en ciencias agrícolas México-Puebla-San Luis Potosí-Tabasco-Veracruz. Secretaria de la Reforma Agraria. Fondo de tierras e instalación del joven emprendedor rural; 2005. 24. Laws J, Amusquivar E, Laws A, Herrera E, Lean I, Dodds P, Clarke L. Supplementation of sow diets with oil during gestation: Sow body condition, milk yield and milk composition. Livest Sci 2008;123:88-96. 25. Pérez PE, Roldan SP, Trujillo OM, Martínez RR, Orozco GH, Becerril HM, Mota RD. Factores estresantes en lechones. Jornada de Estrés Animal. Centro de Enseñanza Investigación y Extensión en Producción Porcina-Jilotepec. FMVZ UNAM. 2012:15-21. 26. Mota D, Roldán P, Pérez E, Martínez R, Hernández E, Trujillo M. Factores estresantes en lechones destetados comercialmente. Rev Vet Méx 2014;4:37-51. 27. Arce B, Valencia C, Warnaars M, Prain G, Valle R. The farmer field school (FFS) method in an urban setting: A case study in Lima, Peru. En: van Veenhuizen R. editor. Cities farming for the future, urban agriculture for green and productive cities. Leusden (Netherlands). ETC - Urban Agriculture. 2006:299-303. 28. Martinez R, Pradal P, Castrejon F, Herradora M, Galvan E, Mercado C. Persistence of Escherichia coli, Salmonella choleraesusis, Aujeszky´s disease virus and blue eye disease virus in ensilage base on the solid fraction of pig feaces. J Applied Microbiol 2001;91:750-758. 29. Campabadal C. Guía técnica para la alimentación de cerdos. Nutrición Animal. Asociación Americana de la Soya-IM. Ministerio de Agricultura y Ganadería. 2009;(1):1-16.

943


https://doi.org/10.22319/rmcp.v12i3.5530 Nota de investigación

Determinación de aflatoxinas en especias, ingredientes y mezclas de especias usados en la formulación de productos cárnicos comercializados en la Ciudad de México

Montserrat Lizeth Ríos Barragán a José Fernando González Sánchez a Rey Gutiérrez Tolentino a Arturo Camilo Escobar Medina ab José Jesús Pérez González a Salvador Vega y León a*

a

Universidad Autónoma Metropolitana. Unidad Xochimilco. Departamento de Producción Agrícola y Animal. Calzada del Hueso No. 1100, Colonia Villa Quietud, Alcaldía Coyoacán, 04960, Ciudad de México, México. b

Centro Nacional de Sanidad Agropecuaria (CENSA). La Habana, Cuba.

*Autor de correspondencia: svega@correo.xoc.uam.mx

Resumen: Las aflatoxinas son sustancias tóxicas producidas por algunas especies de hongos que suponen un grave peligro para la salud humana, en especial la aflatoxina B1 que es uno de los principales analitos encontrados en alimentos y está catalogado como cancerígeno. El objetivo de este estudio fue proporcionar información sobre la presencia de aflatoxinas totales en especias, ingredientes y mezclas de especias usados para la formulación de productos cárnicos y productos cárnicos comercializados en la Ciudad de México, empleando un método de ensayo por inmunoabsorción ligado a enzimas (ELISA). Se analizaron 50 muestras contra aflatoxinas totales. El 61 % de especias e ingredientes fueron positivas a

944


Rev Mex Cienc Pecu 2021;12(3):944-957

aflatoxinas totales en concentraciones de 0.07 a 4.24 µg/kg; las mezclas de especias fueron positivas el 75 %, en cantidades de 0.6 a 1.9 µg/kg y los productos cárnicos sólo el 3.5 % fueron positivos a aflatoxinas totales. Las muestras con mayor prevalencia de aflatoxinas totales fueron chile y pimentón. Todos los resultados presentaron concentraciones inferiores al límite máximo establecido por la Unión Europea de 10 a 20 µg/kg para aflatoxinas totales; lo que no constituye un problema de salud pública actual en las condiciones analizadas. Se recomienda el uso del sistema ELISA como método de pesquisaje y posterior confirmación por cromatografía liquida con detección fluorescente, así como contar con un programa de monitoreo para evaluar la presencia de aflatoxinas y otras micotoxinas; además existe la necesidad de una regulación oficial mexicana para micotoxinas en especias considerando el alto consumo de chile en la población mexicana. Palabras clave: Aflatoxinas, Especias, Productos cárnicos, ELISA.

Recibido: 05/10/2019 Aceptado:06/01/2021

De acuerdo con la Organización de las Naciones Unidas para la Alimentación y la Agricultura (FAO), la carne es un producto de origen animal que aporta nutrientes de gran valor a la dieta, entre los que se encuentran proteínas, aminoácidos indispensables, grasas, vitaminas y minerales(1). Con la elaboración de productos cárnicos se aprovecha al máximo la carne y los subproductos de la matanza debido a que los recortes de carne, con una calidad inferior, mezclados con ingredientes no cárnicos generan una fuente importante de proteínas de origen animal para la dieta humana. En la formulación de productos cárnicos se utiliza una gran variedad de productos no cárnicos como las especias, que son derivados vegetales (semillas secas, frutas, raíces, cortezas de árbol) usadas para la preparación de alimentos debido a sus propiedades gastronómicas como sabor, color o aroma e incluso por sus propiedades medicinales y algunas con propiedades antimicrobianas(2,3,4). La FAO documentó que el 25 % de las cosechas están contaminadas al menos con alguna micotoxina(5). Las especias no están exentas de esta problemática, pudiendo contaminarse dentro de la cadena productiva (precosecha, cosecha, procesamiento, almacenamiento, secado o transporte) debido a malas prácticas de manejo(6,7,8) y cuando las condiciones ambientales como temperatura y humedad son favorables para el crecimiento fúngico(6,9). Las micotoxinas son metabolitos secundarios tóxicos de ciertos géneros de hongos, como Aspergillus, Fusarium y Penicillium y se conocen más de 400 micotoxinas. Las aflatoxinas son las más comúnmente encontradas en alimentos, en concentraciones que sobrepasan los niveles máximos (NM) para el consumo humano y animal, además, la aflatoxina B1 es

945


Rev Mex Cienc Pecu 2021;12(3):944-957

carcinogénica, teratogénica, inmunosupresora, hepatotóxica y mutagénica(3,6,8,10,11), por lo que el Centro Internacional de Investigaciones sobre el Cáncer (IARC por sus siglas en inglés) la clasifica en el grupo 1 de carcinógeno humano(2). La Comisión del Codex Alimentarius, organismo que regula la inocuidad de los alimentos, ha informado que algunos países miembros de ésta han establecido NM para micotoxinas en especias entre 5 y 30 µg/kg. México no ha fijado el NM para aflatoxinas totales (AFT) en especias, aunque sí para cereales. Entre las técnicas de laboratorio empleadas para el análisis de aflatoxinas están: los inmunoensayos(6,8,12), cromatografía líquida de alta resolución (HPLC, por sus siglas en inglés) con detectores ultravioleta y de fluorescencia(9-14) y cromatografía de capa fina (TLC, por sus siglas en inglés)(4,15), siendo los inmunoensayos de los métodos más utilizados y reportados en la literatura científica. El uso de mezclas de especias y otros condimentos en derivados cárnicos ha ido en aumento y corren el riesgo de estar contaminados, lo que representa un riesgo potencial a la salud pública(10). Las personas necesitan alimentos inocuos y de buena calidad. El objetivo de este estudio fue proporcionar información sobre la presencia de AFT en especias, ingredientes y mezclas de especias usados para la formulación de productos cárnicos y productos cárnicos comercializados en la Ciudad de México. Un total de 50 muestras se colectaron aleatoriamente(2,12,14) en la Ciudad de México, entre diciembre de 2015 a enero de 2017, de las siguientes matrices: Especias e ingredientes comúnmente utilizados para la formulación de productos cárnicos (n= 18): cebolla en polvo, ajo en polvo, pimentón en polvo, chile guajillo en polvo, fécula de papa, fécula de maíz, soya texturizada y cacahuate. Mezclas de especias para la formulación de productos cárnicos (n= 4): salami, peperoni, chorizo argentino, chistorra ahumada. Productos cárnicos (n= 28): jamón de cerdo, jamón de pavo, salchicha de pavo, carne para hamburguesa, arrachera, alitas de pollo, nuggets de pollo y carne enchilada. Las muestras de especias y de soya texturizada provinieron de dos empresas especializadas con mayor volumen de venta en la Ciudad de México, expendidas en empaques sellados y almacenadas en refrigeración a 4 °C, protegidas de la luz hasta su análisis. La muestra de cacahuates se tomó de un lugar de venta a granel, y los productos cárnicos de marca empacados y con información en el etiquetado, se obtuvieron en supermercados, como 946


Rev Mex Cienc Pecu 2021;12(3):944-957

jamones (cerdo y pavo), salchichas y la carne para hamburguesa, arrachera, alitas y nuggets de pollo, además carne enchilada a granel sin marca. Las muestras se secaron en estufa (Felisa) a 50 °C durante 72 h, posteriormente se molieron y pasaron por un tamiz de 0.1 mm. Todas las muestras se colocaron en bolsas selladas en refrigeración a 4 °C, protegidas de la luz hasta su análisis. Las muestras se analizaron con pruebas cuantitativas basadas en un ensayo de inmunoabsorción ligado a enzimas (ELISA), utilizando el juego de reactivo Veratox® de Neogen® (No 8031). Para lo cual se pesaron 5 g de cada muestra; la extracción de las aflatoxinas se realizó con metanol al 70%. Se agitó la mezcla de muestra con metanol vigorosamente durante 3 min en un vórtex (Velp Scientifica) y se filtraron 5 ml del extracto en papel filtro No. 4 (Whatman). En pocillos de mezcla, se adicionaron 100 μl del conjugado, utilizado para competir con las aflatoxinas o los controles para los sitios de unión de anticuerpos; posteriormente se colocaron 100 μl de los controles (0, 1, 2, 4 y 8 μl) y muestras, se mezcló el contenido succionándolo y liberándolo tres veces. Se transfirieron 100 μl a los pocillos cubiertos con anticuerpos específicos para aflatoxinas, se mezcló durante 20 seg y se incubaron a temperatura ambiente en los pocillos durante 10 min. Pasado ese lapso, se vertió la solución Stop, 100 μl en cada pocillo y la absorbancia se midió a 450 nm en un lector de ELISA (Biorad). Los resultados se analizaron mediante Neogen® Veratox® Software V3.6. El juego de reactivo Veratox® Neogen® (No 8031) presentó reactividad para AFT (B1, B2, G1, G2) y un rango de trabajo entre 1 a 8 µg/kg. La especificidad del ensayo se evaluó a través del estudio con diferentes matrices (pimentón, ajo, fécula de maíz, mezcla de especias para la formulación de salami y salchicha de pavo) correspondientes a los grupos de muestras (especias e ingredientes comúnmente utilizados para la formulación de productos cárnicos, mezclas de especias para la formulación de productos cárnicos y productos cárnicos). Los extractos obtenidos de cada matriz fueron contaminados con los puntos de la curva de calibración anteriormente mencionados. Las curvas de las diferentes matrices presentaron una correlación por encima de 0.98 y el error en cada punto de la curva, considerando las matrices estudiadas, osciló entre 7 y 11 %. El recobrado en las matrices estudiadas osciló entre 72 y 94 %. El límite de detección y el límite de cuantificación son 0.5 µg/kg y 1 µg/kg respectivamente, informado por el fabricante al emplearse la misma curva y no existir diferencias entre la curva de matrices (P=0.909). El total de muestras positivas fue del 40 %. El mayor porcentaje de AFT se encontró en especias e ingredientes comúnmente utilizados para la formulación de productos cárnicos y en mezclas de especias para la formulación de productos cárnicos con el 61 y el 75 % respectivamente, mientras que los productos cárnicos sólo tuvieron un 3.5 % de muestras positivas a AFT. 947


Rev Mex Cienc Pecu 2021;12(3):944-957

En la Figura 1 se muestra la concentración media de AFT para los tres grupos analizados, el valor medio no sobrepasa el valor de 2 μg/kg, inferior al nivel máximo establecido por otros países con normas nacionales para especias y sus mezclas, que oscilan entre 5 y 30 μg/kg(16). México no ha establecido una norma específica para la presencia de aflatoxinas en especias, por lo que en este trabajo para la comparación de resultados se empleó la norma europea, que es la más exigente y plantea límites máximos para la suma de aflatoxinas en especias de 10 µg/kg(17). Figura 1: Concentración media de aflatoxinas totales (µg/kg) en los grupos de muestras analizadas

En cuanto a las especias e ingredientes comúnmente utilizados en la formulación de productos cárnicos, el chile guajillo fue el de mayor contenido de aflatoxinas totales, 4.24 µg/kg (Cuadro 1). Resultados similares se informaron en un estudio realizado en el mercado de Doha, en Qatar, donde analizaron 14 muestras de especias, se detectó la presencia de aflatoxinas en cinco especias y sus mezclas (pimienta negra, chile, tandoori, masala, cúrcuma y garam masala), encontrando el mayor valor de aflatoxina B1 en chile, con una concentración de 69.28 ± 1.08 µg/kg(9). En otro estudio realizado en Pakistán, se analizaron 170 muestras de chile en diferentes presentaciones (salsa de chile, chile triturado y polvo de chile), se detectó la presencia de aflatoxinas en un intervalo de 39 al 59 % de las muestras analizadas, con un valor máximo de 27.5 y 21.1 µg/kg, en muestras procedentes del mercado y de restaurantes respectivamente(18). Los resultados mencionados corroboran que el chile seco es una especia susceptible al desarrollo fúngico y formación de aflatoxinas si las condiciones de humedad y temperatura son propicias durante su producción y almacenamiento.

948


Rev Mex Cienc Pecu 2021;12(3):944-957

Cuadro 1: Concentración de aflatoxinas totales (AFT) en especias e ingredientes comúnmente utilizados en la formulación de productos cárnicos No. de muestras Intervalo de Especias e ingredientes analizadas contaminación (µg/kg) Cebolla 3 Nd – 1.61 Pimentón 2 2 – 3.05 Ajo 3 1 – 2.05 Chile guajillo 1 4.24 Soya texturizada 2 Nd - 0.07 Cacahuate 1 1.57 Fécula de maíz 2 Nd Fécula de papa 4 Nd – 2.75 Nd= No detectado.

Las muestras de pimentón son las segundas con mayor concentración de AFT, de 2.0 a 3.05 µg/kg en el 100 % de las muestras analizadas. En un estudio realizado en setenta muestras de pimentón colectadas en la ciudad de São Paulo, Brasil, de enero a abril de 2006, se detectaron aflatoxinas en el 82.9 % de las muestras y aflatoxina B1 en el 61.4 %, en un intervalo de concentración de 0.5 a 7.3 μg/kg, con una concentración media de 3.4 μg/kg(19). Otro estudio en 130 preparaciones de especias que fueron obtenidos en diversos puntos de venta en Irlanda, (incluidos supermercados, tiendas y puestos de mercado) encontraron que el 20 % de las muestras estaban contaminadas con aflatoxina B1, en un intervalo de 0.40 a 6.40 μg/kg(10). Por otro lado, en un estudio donde evaluaron la presencia de aflatoxinas y ocratoxina A en pimentón rojo para la venta al por menor en España, encontraron que la muestras que presentaban aflatoxinas estaban muy por debajo de los dos límites legales, de 5 μg/kg para aflatoxina B1 y 10 μg/kg para aflatoxinas totales, establecido por la Unión Europea(17); no así la ocratoxina A, que se encontró con mayor frecuencia, con una media de 11.8 μg/kg y en un intervalo más variado (SD 18.9 μ/kg)(20). En cuanto a la cebolla, en ésta se encontró presencia de AFT de 1.61 µg/kg, menor a lo obtenido en un estudio realizado en productos agrícolas en Nigeria, donde la presencia de AFT en cebolla fue de 3.14 µg/kg(21). En otro estudio se encontraron hongos productores de aflatoxina en ajo en polvo proveniente de China, cebolla en polvo y granulada provenientes de Francia(22). Con relación a las muestras de ajo, se detectaron valores máximos de 2.05 µg/kg, concentración muy inferior a lo informado en un estudio realizado en Egipto, donde se determinaron valores de 224.4 µg/kg en ajo entero, mientras que en ajo pelado no se detectaron aflatoxinas(23). Por otro lado, Sahar et al(15) analizaron tres muestras de ajo en donde no detectaron la presencia de aflatoxinas. Los altos niveles encontrados en ajo entero por Refai et al(23) pueden ser discutibles, se ha demostrado el efecto antifúngico del ajo en 949


Rev Mex Cienc Pecu 2021;12(3):944-957

estudios in vitro, donde disminuye la producción de aflatoxinas desde 5.94 hasta 0.15 µg/kg(24). Mientras otro estudio muestra que existe una inhibición del crecimiento micelial en un medio líquido SMKY y en granos de maíz inoculado con Aspegrillus flavus del 61.94 %(25), en otro estudio in vitro empleando medio YES inoculado con Aspergillus flavus, evaluaron el crecimiento micelial, esporulación y producción de aflatoxinas con diferentes concentraciones de ajo y cebolla y demostraron un efecto moderado de inhibición y producción de aflatoxinas(26). Los estudios antes mencionados podrían explicar los bajos valores encontrados de aflatoxinas en ajo y cebolla en este trabajo. El contenido de aflatoxinas en cacahuate fue similar a lo reportado en otros estudios en México donde los valores de AFT oscilan entre 0.11 y 79.69 µg/kg(27). En este trabajo no se detectó la presencia de aflatoxina en la fécula de maíz, lo que puede deberse en primer lugar al proceso de obtención de ésta, donde se separa la cascarilla del resto del grano. En un estudio donde se evaluó la calidad del almidón durante el proceso de fermentación espontánea (21 días), no se encontraron aflatoxinas por encima de 5 µg/kg(28) y en otro estudio donde se analizó el destino de las aflatoxinas durante el proceso de molienda húmeda y su distribución en productos y subproductos, sólo el 8.7 % del total de aflatoxinas en el maíz inicial se encontró en la fracción de almidón, que representa el 61 % del maíz molido, y concluye entonces, que las aflatoxinas fueron destruidas durante la conversión a almidón(29). Un segundo aspecto puede ser que la fécula de maíz analizada no presente aflatoxinas o las presente en cantidades por debajo del límite máximo permisible para su consumo, debido a que existieron buenas prácticas de producción(30). El 50 % de las muestras de fécula de papa, registró resultados positivos a AFT con concentraciones de 0.92 a 2.75 µg/kg, este resultado es discutible ya que no se ha informado la presencia de aflatoxinas en papa cosechada; sin embargo, los cultivos de raíces son susceptibles al crecimiento de Aspergillus y, por lo tanto, a la posible contaminación con aflatoxinas(31). Se ha informado la presencia de aflatoxinas en papa inoculada con un promedio de 8 μg/kg de aflatoxinas totales (principalmente B1 y G1) a 27 °C y 95 a 97 % de humedad relativa en 20 días(32). En camote, se han reportado concentraciones de aflatoxinas en el orden de 0.01-0.18 μg/kg(33). En alimentos con almidón, crudos y cocidos, después del almacenamiento se encontraron niveles de aflatoxinas en el orden de 3-25 µg/kg en Ipomoea batatas(31). A pesar de no haber estudios en papas cosechadas, los estudios en camote y en su almidón, corroboran de alguna manera los resultados de este estudio, y que condiciones no adecuadas durante su almacenamiento también pueden contribuir a la presencia de aflatoxinas, considerando que el almidón de papa se emplea en diferentes medios de cultivo para la producción de aflatoxinas. En la muestra de soya texturizada analizada se encontraron AFT con un valor de 0.07 µg/kg, la cantidad de AFT resulta mínima, esto es debido a que se ha informado por diversos autores 950


Rev Mex Cienc Pecu 2021;12(3):944-957

que la soya contiene sustancias inhibidoras del crecimiento fúngico y la síntesis de aflatoxinas(34,35). En un estudio realizado en Serbia, se analizaron 63 muestras de soya y no se encontró presencia de aflatoxinas(36), lo que corrobora que la soya es menos susceptible a la infección por hongos y formación de micotoxinas que granos más grandes como el maíz. En todos los casos tampoco se rebasó el valor de 10 µg/kg establecido por la Unión Europea(17). En los productos cárnicos, de las 28 muestras analizadas, sólo una muestra de carne enchilada fue positiva, lo que representa el 3.5 % (Cuadro 2). La presencia de aflatoxinas en productos cárnicos ha sido informada por diversos autores, por ejemplo Markov et al(37) realizaron un estudio en noventa productos cárnicos (salchichas, productos secos) evaluando tres micotoxinas (aflatoxinas, ocratoxina y citrinina), las dos primeras por ELISA y la última por HPLC, los resultados arrojaron presencia de aflatoxinas en el 10 % de las muestras analizadas, con una media de concentración de 3.0 μg/kg, sin embargo, la mayor incidencia en las muestras fue de ocratoxina con 64.44 %. Resultados similares en relación a la abundancia de ocratoxina y aflatoxinas fueron informadas en un estudio realizado en Croacia, donde se analizaron 410 muestras: jamones (n= 105), salchichas fermentadas secas (n= 208), tocino (n= 62) y salchichas cocidas (n=35)(38). Cuadro 2: Concentración de aflatoxinas totales (AFT) en productos cárnicos No. de muestras Intervalo de Producto cárnico analizadas contaminación (µg/kg) Carne enchilada 2 Nd- 0.4 Jamón de cerdo 6 Nd Jamón de pavo 6 Nd Salchicha de pavo 3 Nd Nuggets de pollo 4 Nd Chorizo 4 Nd Alitas de pollo 1 Nd Arrachera 1 Nd Carne para hamburguesa 1 Nd Nd= no detectado.

La presencia de micotoxinas en los productos cárnicos puede ocurrir en diferentes puntos de la cadena productiva, en el campo, donde el animal está expuesto a alimentos contaminados(39), en el proceso de elaboración del producto, empleando especias o mezclas de especias contaminadas o durante el almacenamiento final(40). En un estudio realizado en España durante la maduración de los jamones curados, se evaluó el efecto de la temperatura y la actividad del agua en el crecimiento fúngico y producción de aflatoxinas, donde una actividad de agua mayor de 0.9 y una temperatura mayor a 15 °C producen aflatoxinas(41).

951


Rev Mex Cienc Pecu 2021;12(3):944-957

A diferencia de las especias, para las que existen límites máximos permisibles para aflatoxinas, en productos cárnicos no existen regulaciones al respecto, sólo en Italia, el Ministerio de Salud ha recomendado, desde 1999, el valor máximo de 1 μg/kg de ocratoxina A en carne o productos cárnicos(42), considerando que ésta aparece con mayor frecuencia y en concentraciones de 1 a 10 μg/kg, mientras las aflatoxinas aparecen por debajo de 1 μg/kg(38). Respecto a las mezclas de especias usadas para la formulación de productos cárnicos, el 75 % de las muestras resultaron positivas (Cuadro 3). Algunos estudios realizados en Qatar y Turquía, en mezclas de especias procedentes de mercados, reportan AFT en un intervalo de 0.16 a 5.12 µg/kg y 0.1-0.9 µg/kg respectivamente(43,44). Estos resultados son similares a lo encontrado en este trabajo. Los resultados son los esperados si se considera que, en la composición de las mezclas, se presentan especias como el pimentón que es unas de las especias más susceptibles a la contaminación(19). Cuadro 3: Concentración de aflatoxinas totales (AFT) en mezclas de especias para la formulación de productos cárnicos Mezcla de especias para la formulación de: Concentración de AFT (µ𝐠/𝐤𝐠) Peperoni Chorizo argentino Chistorra ahumada Salami

1.9 0.6 Nd 1.77 Nd= no detectado.

En el caso de la mezcla de especias para chistorra, dio resultado negativo a la presencia de aflatoxinas y en la mezcla está presente el pimentón, pudiendo ser contradictorio el resultado, sin embargo, dentro de dicha mezcla también está presente el ajo, que se ha demostrado que es un inhibidor de la contaminación fúngica y de la síntesis de aflatoxinas(24), por lo que puede inferirse que no existió un crecimiento fúngico ni producción de toxinas. Al igual que en las especias e ingredientes comúnmente utilizados para la formulación de productos cárnicos, los valores encontrados no sobrepasan el límite permisible de la UE por lo que su empleo en la formulación de productos cárnicos puede inferir que no constituye un riesgo para la salud pública(17). Los sistemas inmunoenzimáticos en la determinación de micotoxinas en diferentes matrices han sido ampliamente utilizados como una herramienta de pesquisaje para posterior confirmación por técnicas cromatográficas(38). Los resultados obtenidos en este estudio en diferentes matrices (especias, ingredientes y mezclas de especias usadas para la formulación de productos cárnicos y productos cárnicos), aplicando las bondades del ELISA para la

952


Rev Mex Cienc Pecu 2021;12(3):944-957

determinación de AFT, constituyen el primer reporte en México y orienta a estudios posteriores en aquellas especias, ingredientes o mezclas de especies que presentaron mayor prevalencia de AFT, de tal forma que se realice una validación completa de la técnica en la matriz a estudiar. Por otra parte, aquellas muestras que sobrepasen el NM de AFT en especias deben ser confirmadas por técnicas cromatográficas. En conclusión, se informa por primera vez en México la presencia de aflatoxinas totales en especias, ingredientes y mezclas de especias usadas para la formulación de productos cárnicos y productos cárnicos, encontrándose en concentraciones que oscilan entre 0.4 y 4.24 µg/kg. Las especias de mayor prevalencia a las AFT son chile y pimentón de alto consumo en la población mexicana. La metodología empleada de ELISA para detectar AFT en especias, ingredientes, mezclas de especias usadas para la formulación de productos cárnicos y productos cárnicos posibilita su empleo como prueba de pesquisaje; aquellas que presenten concentraciones por encima del nivel máximo deben ser confirmadas por técnicas cromatográficas. Los resultados obtenidos en esta investigación alertan a los organismos reguladores nacionales de la necesidad de implementar una norma para la presencia de aflatoxinas en especias considerando el alto consumo nacional de muchas de las especias estudiadas.

Agradecimientos

Al Consejo Nacional de Ciencia y Tecnología (CONACyT) por la beca otorgada durante los estudios de posgrado en la Maestría en Ciencias Agropecuarias de la Universidad Autónoma Metropolitana, Unidad Xochimilco, perteneciente al Programa Nacional de Posgrados de Calidad. Literatura citada: 1. FAO. Food and Agriculture Organization. Carne y productos cárnicos. 2014. Disponible en: http://www.fao.org/ag/againfo/themes/es/meat/home.html Consultado 25 Ago, 2017. 2. Ozbey F, Kabak B. Natural co-ocurrence of aflatoxins and ochratoxin A in spices. Food Control 2012;28(1):354-361. 3. Asghar MA, Zahir E, Rantilal S, Ahmed A, Iqbal J. Aflatoxins in composite spices collected from local markets of Karachi, Pakistan. Food Addit Contam: Part A 2016;9(2):113–119.

953


Rev Mex Cienc Pecu 2021;12(3):944-957

4. Zahra N, Khan M, Mehmood Z, Saeed MK, Kalim I, Ahmad I, et al. Determination of aflatoxins in spices and dried fruits. J Sci Res 2018;10(3):315-321. 5. OMS. Organización Mundial de la Salud. Resumen sobre inocuidad de los alimentos. Aflatoxinas. 2018: https://www.who.int/foodsafety/FSDigest_Aflatoxins_SP.pdf Consultado: 5 jul, 2019. 6. Ardic M, Karakaya Y, Atasever M, Durmaz H. Determination of aflatoxin B1 levels in deep-red ground pepper (isot) using immunoaffinity column combined with ELISA. Food Chem Toxicol 2008;46(1):1596–1599. 7. Khayoon WS, Saad B, Lee TP, Salleh B. High performance liquid chromatographic determination of aflatoxins in chili, peanut and rice using silica based monolithic column. Food Chem 2012;133(1):489-496. 8. Tosun H, Arslan R. Determination of aflatoxin B1 levels in organic spices and herbs. Sci World J 2013;(4):874093. 9. Hammami W, Fiori S, Thani RA, Kali N A, Balmas V, Migheli Q, et al. Fungal and aflatoxin contamination of marketed spices. Food Control 2014;37(1):177–181. 10. O’ Riordan MJ, Wilkinson MG. A survey of the incidence and level of aflatoxin contamination in a range of imported spice preparations on the Irish retail market. Food Chem 2008;107(1):1429–1435. 11. Akpo-Djènontin DOO, Gbaguidi F, Soumanou MM, Anihouvi VB. Mold infestation and aflatoxins production in traditionally processed spices and aromatic herbs powder mostly used in West Africa. Food Sci Nutr 2018;6(1):541–548. 12. Gojković VS, Grujić RD, Ivanović MM, Marjanović-Balaban ZR, Vujadinović DP, Vukić MS. The frequency of presence of aflatoxin B1 in foodstuffs of vegetable origin. Matica Srpska J Nat Sci 2017;133(1):29–36. 13. Cho SH, Lee CH, Jang MR, Son YW, Lee SM, Choi IS, et al. Aflatoxins contamination in spices and processed spice products commercialized in Korea. Food Chem 2008;107(1):1283-1288. 14. Ali N, Hashim NH, Shuib NS. Natural occurrence of aflatoxins and ochratoxin A in processed spices marketed in Malaysia. Food Addit Contam: Part A 2015;32(4):518– 532. 15. Sahar N, Ahmed M, Parveen Z, Ilyas A, Bhutto A. Screening of mycotoxins in wheat, fruits and vegetables grown in Sindh, Pakistan. Pakistan J Bot 2009;41(1):337–341.

954


Rev Mex Cienc Pecu 2021;12(3):944-957

16. Comité del Codex sobre contaminantes de los alimentos. Documento de debate sobre los niveles máximos para las micotoxinas en las especias. Comisión del Codex Alimentarius 2017. http://www.fao.org/fao-who-codexalimentarius/shproxy/en/?lnk=1&url=https%253A%252F%252Fworkspace.fao.org%252Fsites%252F codex%252FMeetings%252FCX-735-11%252FWD%252Fcf11_11s.pdf Consultado: 13 jun, 2019. 17. UE. Unión Europea (2010) Reglamento No. 165/2010 de la comisión de 26 de febrero de 2010 que modifica, en lo que respecta a las aflatoxinas, el Reglamento (CE) No. 1881/2006 por el que se fija el contenido máximo de determinados contaminantes en los productos alimenticios. https://eur-lex.europa.eu/legalcontent/ES/TXT/PDF/?uri=CELEX:32010R0165&qid=1567559548605&from=EN Consultado: 6 Sept, 2017. 18. Iqbal SZ, Asi MR, Zuber M, Akhtar J, Jawwad MS. Natural occurrence of aflatoxins and ochratoxin A in comercial chilli and chilli sauce samples. Food Control 2013;30(2):621– 625. 19. Shundo L, De-Almeida AP, Alaburda J, Lamardo LC, Navas SA, Ruvieri V et al. Aflatoxins and ochratoxin A in Brazilian paprika. Food Control 2009;20(12):1099-1102 20. Hernández-Hierro J, Garcia-Villanova R, Rodríguez-Torrero P, Toruño-Fonseca IM. Aflatoxins and ochratoxin A in red paprika for retail sale in Spain: occurrence and evaluation of a simultaneous analytical method. J Agri Food Chem 2008;56(3):751-756. 21. Arowora KA, Abiodun AA, Adetunji CO, Sanu FT, Afolayan SS, Ogundele BA. Levels of aflatoxins in some agricultural commodities sold at Baboko Market in Ilorin, Nigeria. Global J Sci Front Res 2012;12(10): 31-33. 22. Tančinová D, Mokrý M, Barboráková Z, Mašková Z. Mycobiota of spices and aromatic herbs. Potravinarstvo Scie J Food Ind 2014;8(1):172-177. 23. Refai MK, Niazi ZM, Aziz NH, Khafaga NEM. Incidence of aflatoxin B1 in the Egyptain cured meat basterma and control by γ irradiation. Food/Nahrung 2003;47(6):377-382. 24. Thanaboripat D, Nontabenjawan K, Leesin K, Teerapiannont D, Sukcharoen O, Ruangrattanamatee R. Inhibitory effect of garlic, clove and carrot on growth of Aspergillus flavus and aflatoxin production. J Forestry Res 1997;8(1):39-42. 25. Bilgrami KS, Sinha KK, Sinha AK. Inhibition of aflatoxin production & growth of Aspergillus flavus by eugenol & onion & garlic extracts. Indian J Med Res 1992;96(1):171-175.

955


Rev Mex Cienc Pecu 2021;12(3):944-957

26. Chalfoun SM, Pereira MC, Resende MLV, Angélico CL, Silva RA. Effect of powdered spice treatments on mycelial growth, sporulation and production of aflatoxins by toxigenic fungi. Ciênc Agrotec 2004;28(4):856-862. 27. Alvarado-Hernández JR, Carvajal-Moreno M, Rojo-Callejas F, Ruiz-Velasco S. Aflatoxins in natural peanuts (Arachis hypogaea L.) of Mexico: Validation of the biochemical methods for extraction and quantification. J Plant Biochem Physiol 2016;4(1):1000168. 28. Yuan ML, Lu ZH, Cheng YQ, Li LT. Effect of spontaneous fermentation on the physical properties of corn starch and rheological characteristics of corn starch noodle. J Food Engin 2008;85(1):12-17. 29. Aly SE. Distribution of aflatoxins in product and by products during glucose production from contaminated corn. Food/Nahrung 2002;46(5):341-344. 30. Sekiyama BL, Ribeiro AB, Machinski PA, Machinski JM. Aflatoxins, ochratoxin A and zearalenone in maize-based food products. Braz J Microbiol 2005;36(3):289-294. 31. Lovelace CE, Aalbersberg WG. Aflatoxin levels in foodstuffs in Fiji and Tonga islands. Plant Foods Hum Nutr 1989;39(4):393-399. 32. Swamlnathan B, Koehler PE. Isolation of an inhibitor of Aspergillus parasiticus from white potatoes (Solanum tuberosum). J Food Sci 1976;41(2):313-319. 33. Tung TC, Ling KH. Study on aflatoxin of foodstuffs in Taiwan. J Vitam 1968;14(1):4852. 34. Strange RN. Natural occurrence of mycotoxins in groundnuts, cottonseed, soya, and cassava. Mycotoxins Anim Foods 1991;341-362. 35. Winter G, Pereg L. A review on the relation between soil and mycotoxins: Effect of aflatoxin on field, food and finance. Eur J Soil Sci 2019;70(4):882-897 36. Jakić-Dimić D, Nešić K, Petrović M. Contamination of cereals with aflatoxins, metabolites of fungi Aspergillus flavus. Biotech Anim Husbandry 2009;25(5-6):12031208. 37. Markov K, Pleadin J, Bevardi M, Vahčić N, Sokolić-Mihalak D, Frece J. Natural occurrence of aflatoxin B1, ochratoxin A and citrinin in Croatian fermented meat products. Food Control 2013;34(1):312-317. 38. Pleadin J, Satver MM, Vahčić N, Kovačević D, Milone S, Saftić L, et al. Survey of aflatoxin B1 and ochratoxin A ocurrence in traditional meat products coming from Croatian households and markets. Food Control 2013;52(1):71-77.

956


Rev Mex Cienc Pecu 2021;12(3):944-957

39. Bailly J, Guerre P. Mycotoxins in meat and processed meat products. In: Safety of meat and processed meat. Toldrá F. editor. New York, USA: Springer Science & Business Media; 2009;83-124. 40. Abd-Elghany SM, Sallam KI. Rapid determination of total aflatoxins and ochratoxins A in meat products by inmuno-affinity fluorimetry. Food Chem 2015;179(1):253-256. 41. Peromingo B, Rodríguez A, Bernáldez V, Delgado J, Rodríguez M. Effect of temperature and water activity on growth and aflatoxin production by Aspergillus flavus and Aspergillus parasiticus on cured meat model systems. Meat Sci 2016;122(1):76-83. 42. Montanha FP, Anater A, Burchard JF, Luciano FB, Meca G, Manyes L, et al. Mycotoxins in dry-cured meats: A review. Food Chem Toxicol 2018;111(1):494-502. 43. Abdulkadar A, Al-Ali A, Al-Kildi A, Al-Jedah J. Mycotoxins in food products available in Qatar. Food Control 2004;15(7):543-548. 44. Cavus S, Tornuk F, Sarioglu K, Yetim H. Determination of mold contamination and aflatoxin levels of the meat products/ingredients collected from Turkey market. J Food Safety 2018;38(5):e12494.

957


https://doi.org/10.22319/rmcp.v12i3.5724 Nota de investigación

Efecto de la altura de corte de sorgo a la cosecha sobre el rendimiento de forraje y el valor nutritivo del ensilaje

Jorge A. Granados-Niño a David G. Reta-Sánchez b Omar I. Santana b Arturo Reyes-González b Esmeralda Ochoa-Martinez b Fernando Díaz c Juan I. Sánchez-Duarte b*

a

Universidad Juárez del Estado de Durango. Facultad de Agricultura y Zootecnia. Carretera Gómez Palacio - Tlahualilo Km. 32. Ej. Venecia, Gómez Palacio, Dgo. México. b

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. México.

c

Dairy Research Center, LLC, Brookings, SD. USA.

*Autor de correspondencia: sanchez.juan@inifap.com.mx

Resumen: El objetivo fue identificar una altura de corte óptima a la cosecha del forraje de sorgo (Sorghum bicolor L.) para mejorar la calidad nutritiva del ensilaje, sin reducir el rendimiento de materia seca (MS) del forraje. Se evaluó el efecto de la altura de corte a 10, 20, 30, 40, 50 y 60 cm, sobre el rendimiento de MS y el valor nutritivo del ensilaje. El forraje se cosechó cuando el grano alcanzó un estado lechoso-masoso. Las plantas se trituraron a un tamaño de partícula de 2 cm y el forraje se compactó a 261 kg de MS/m3 en mini-silos. El rendimiento de MS se redujo a partir de cosechar a 40 cm sobre el suelo. La fibra detergente neutro (FDN)

958


Rev Mex Cienc Pecu 2021;12(3):958-968

y lignina del ensilaje fueron superiores cuando se cosechó a 10 cm, pero la lignina se redujo 1.4 % cuando el corte fue mayor a 20 cm. La digestibilidad de la FDN y la concentración de nutrientes digestibles totales (NDT) aumentaron cuando se cosechó a 40 cm. El mayor contenido de carbohidratos no fibrosos (CNF) se obtuvo cuando se cosechó a 40 y 50 cm. La energía neta de lactancia (ENL) del ensilaje aumentó a partir de cosechar a 20 cm. El pH óptimo del ensilaje se obtuvo cuando se cosechó a 30 cm. En conclusión, cosechar el forraje de sorgo entre 20 y 40 cm permite obtener un ensilaje con menor contenido de lignina y, por consiguiente, mayor digestibilidad y concentración energética sin afectar negativamente el rendimiento de MS del forraje. Palabras clave: Sorghum bicolor (L.), Materia seca, Ensilaje, Altura de corte, Valor nutricional.

Recibido: 02/07/2020 Aceptado: 19/10/2020

El sorgo forrajero es una alternativa viable para producir ensilaje en granjas lecheras que se encuentran en regiones con ambientes áridos y semiáridos. Este cultivo ha demostrado crecer bien bajo condiciones limitadas de agua(1) y altas temperaturas(2); además de que presenta moderada tolerancia a la salinidad del suelo(3). Bajo estas condiciones, el sorgo tiene la ventaja de poder producir cantidades mayores de materia seca (MS) en comparación al maíz forrajero(4,5). Sin embargo, el contenido de lignina en el forraje de variedades de sorgos convencionales (hasta 9.1 % de la MS), se asocia con ensilajes que tienen baja digestibilidad de la FDN (DFDN); por lo cual al ser utilizado en las dietas de las vacas lecheras limita el consumo de MS y la producción de leche(6,7). Una opción práctica para reducir la concentración de lignina y mejorar la digestibilidad de la fibra del ensilaje de diferentes forrajes es incrementar la altura de corte. Al respecto, se ha reportado que el aumento de la altura de corte de 15 a 45 cm en sorgo negro (Sorghum almum), reduce los contenidos de lignina de 7.7 a 6.4 %(8). En maíz forrajero, se encontró que la lignina se redujo de 3.0 a 2.6 % mientras que la DFDN aumentó 2.3 % cuando se incrementó la altura de corte a la cosecha de 12 a 45 cm(9). De igual manera, el incremento de altura de corte en maíz forrajero de 15 a 45 cm aumentó en 5.0 % la DFDN, lo cual se atribuyó a disminuir la proporción de tallos basales que contienen la parte más lignificada de la planta(10). Cuando se aumenta la altura de corte del forraje, la composición nutritiva del ensilaje mejora; sin embargo, las pérdidas de rendimiento de MS pueden llegar a ser muy significativas si se

959


Rev Mex Cienc Pecu 2021;12(3):958-968

utilizan alturas de corte muy elevadas. Lo anterior hace que dicha estrategia de cosecha no sea aceptada por los productores. Las pérdidas de rendimiento en MS del forraje de sorgo pueden ser entre 10 y 20 % al aumentar la altura de corte por encima de los 20 cm(11,12) y de 3 a 16 % al aumentar la altura de corte a más de 40 cm en maíz forrajero(10,13). Por lo tanto, es necesario identificar la mejor altura de corte en sorgo forrajero, que permita tener un balance óptimo entre la composición nutritiva del ensilaje y el rendimiento de MS por hectárea a la cosecha. El objetivo del presente trabajo fue identificar la altura de corte óptima en sorgo forrajero, para mejorar la calidad nutritiva del ensilaje sin afectar el rendimiento de MS. El experimento se estableció durante el ciclo de producción de primavera del 2018 en el Ejido Venecia, ubicado en el Municipio de Gómez Palacio, Durango. El sitio experimental se ubica en 25º46'56" N y 103º21'02" O a una altitud de 1,100 m sobre el nivel del mar. El suelo tiene una textura arcillosa, con una densidad aparente de 1.07 g cm-3, un contenido de materia orgánica de 1.5 % y pH de 8.3. La precipitación y las temperaturas del aire durante el desarrollo del cultivo se muestran en la Figura 1. La precipitación acumulada durante el ciclo fue de 22.4 mm. Las temperaturas máximas variaron de 28.7 a 43.1 °C y las mínimas de 13.1 a 27 °C. Las temperaturas más elevadas que sobrepasaron el rango óptimo de crecimiento en sorgo (6-37.7°C)(3) se presentaron entre los 41 y 52 días después de la siembra (DDS). Figura 1: Temperatura máxima, mínima y media y precipitación registrada durante el periodo experimental (18 de abril al 10 de agosto del 2018)

960


Rev Mex Cienc Pecu 2021;12(3):958-968

Se evaluó el efecto de seis alturas de corte (10, 20, 30, 40, 50 y 60 cm desde la superficie del suelo) sobre el rendimiento de forraje, la composición nutritiva y el rendimiento de nutrientes del ensilaje de sorgo forrajero. La preparación del terreno consistió en un barbecho, rastreo doble y nivelación con escrepa. La siembra se realizó en suelo húmedo el 18 de abril del 2018 con una sembradora de precisión Gaspardo (modelo SPLC-4F) utilizando una densidad de siembra de 12 kg ha-1 de semilla de la variedad Silo Miel (Agricenter Zevilla, Torreón, Coahuila). Se sembraron 4 surcos por tratamiento de 0.8 m de longitud a una distancia de 0.75 m utilizando un diseño de bloques completamente al azar con cuatro repeticiones. Se tuvo una densidad promedio de 195,000 plantas ha-1. Se fertilizó con 134 kg ha-1 de N y 43 kg ha-1 de P2O5. El total del fósforo se aplicó en la siembra, mientras que el N se fraccionó, aplicando el 40 % de la dosis total en la siembra y el 60 % antes del primer riego de auxilio; 48 DDS. A la siembra también se aplicaron 8 kg ha-1 de K y 10 kg ha-1 de S y, antes del primer riego de auxilio, se aplicaron 18 kg ha-1 de Ca y 12 kg ha-1 de Mg. Se utilizaron Yara Mila Star® y Yara Bela Nitromag® como fuentes de fertilizante (Yara, Guadalajara, Jalisco). Se aplicaron cuatro riegos incluyendo un riego de pre-siembra y tres riegos de auxilio a los 48, 65 y 85 DDS. Se utilizó un sistema de riego superficial con agua rodada. A los 25 y 46 DDS se realizaron aplicaciones de etil clorpirifos (Lorsban 480 EM®, BASF Inc., Alemania) a razón de 0.75 L ha-1 para el control de gusano cogollero (Spodoptera frugiperda). Posteriormente, a los 50 y 83 DDS se realizaron aplicaciones para el control de pulgón amarillo (Melanaphis sacchari) utilizando Imidacloprid + Betacyfluthrin (Muralla Max®, Bayer, México) y de Sulfoxaflor (Toretto Isoclast® Active, Corteva Agrosciences, Guadalajara) a razón de 0.25 ml ha-1 y 100 ml ha-1, respectivamente. El control de maleza se realizó de manera manual. La cosecha del cultivo se realizó el 10 de agosto del 2018 a los 105 DDS cuando el grano alcanzó la etapa de lechoso-masoso, acumulando 2,118 horas-calor. Se utilizaron los dos surcos centrales como parcela útil, eliminando 1 m de cada extremo para excluir el efecto de orilla. En total se cosecharon seis metros de longitud para cada uno de los tratamientos (9.12 m2). Cada parcela útil, se cosechó considerando las diferentes alturas de corte de cada tratamiento (10, 20, 30, 40, 50 y 60 cm) tomando como base la superficie del suelo. El forraje fresco, de cada parcela útil, se pesó para estimar el rendimiento de forraje verde. Del total de plantas cortadas por parcela, se seleccionaron 15 plantas al azar y se molieron a un tamaño de partícula teórica de 2 cm utilizando un molino Modelo JF5. Del forraje fresco molido de cada parcela se tomaron tres muestras al azar de 500 g cada una y se secaron a 60 °C hasta peso constante en una estufa de aire forzado para determinar el contenido de MS. El rendimiento de MS se determinó multiplicando el rendimiento de forraje en base verde por hectárea por el contenido de MS del forraje antes de ensilar. Para elaborar los mini-silos, se utilizaron las primeras tres repeticiones del forraje fresco picado de cada tratamiento. Se usaron jarras de vidrio con tapa hermética de 1 L de capacidad en donde el forraje fresco picado se compactó a una densidad de 261 kg de MS m-3(14) en 961


Rev Mex Cienc Pecu 2021;12(3):958-968

cada mini-silo considerando el contenido de MS a la cosecha de cada tratamiento. La estimación del contenido de MS para determinar la densidad en los mini-silos se realizó con el horno de microondas y se estimó un porcentaje de MS promedio de 29.67 ± 0.42 %. La compactación del forraje en cada mini-silo se realizó manualmente con un ablandador de carne macho (Metaltex 779-012). Todos los mini-silos se almacenaron en el laboratorio a temperatura ambiente durante 90 días. Al abrir los mini-silos se desecharon los primeros 5 cm. Posteriormente, en cada mini-silo se tomó una muestra de 20 g de ensilaje fresco a los que se le añadió 200 ml de agua destiladadesionizada y se mezcló por 30 seg en una licuadora de alta velocidad. La muestra diluida se filtró a través de tres capas de gasa de quesería y el pH se midió en el líquido con un potenciómetro portátil (OHAUS Modelo ST2100, Parsippany, NJ, USA)(15). Del remanente del ensilaje fresco se tomaron 400 g y se enviaron a un laboratorio privado comercial (GAQSA, Querétaro, México) para ser analizadas utilizando espectroscopia de infrarrojo cercano (NIR; Mod. 951, Foss Electric, Hillerod, Dinamarca). Cada muestra de ensilaje fresco fue homogenizada y secada en un horno de flujo de aire a 66.7 °C hasta peso constante. Posteriormente, las muestras se trituraron en una licuadora, y consecutivamente, en un molino utilizando una malla de 1 mm. En estas muestras se analizaron los contenidos de proteína cruda (PC), fibra detergente neutra (FDN), fibra detergente acida (FDA), lignina, digestibilidad in vitro de la FDN a las 30 h (DFDN-30h), NDT, CNF, ENL y cenizas. La determinación de los valores nutricionales se basó en las ecuaciones de predicción y bases de datos generadas por la “Cumberland Valley Analytical Services (CVAS)”. La calibración del equipo considero el siguiente procedimiento: selección de la muestra al azar, toma de los espectros de la muestra, selección de los espectros que representan las muestra, análisis de laboratorio de la muestra seleccionada usando la metodología de referencia, confrontación de los resultados de la metodología de referencia con sus respectivos espectros, validación interna con las muestras y realización del análisis por la metodología de referencia y validación de la ecuación de calibración con los resultados de referencia de las muestras de validación interna. Una vez que la ecuación de calibración con los resultados de referencia de la validación interna fue satisfactoria, esta fue utilizada para el análisis de todas las muestras. Los rendimientos de FDN, DFDN-30h, NDT y ENL fueron estimados considerando el contenido de estos nutrientes en el ensilaje y el rendimiento de forraje seco por hectárea de cada tratamiento. El análisis de la información se efectuó con el programa estadístico SAS versión 9.3 (SAS Institute Inc., Cary, NC. USA). Los resultados se analizaron por ANOVA utilizando un diseño de bloques al azar, con seis tratamientos, de cuatro y tres repeticiones para las variables de rendimiento de forraje y calidad del ensilaje, respectivamente. Cuando se encontraron diferencias significativas (P˂0.05), se aplicó la prueba de la diferencia mínima 962


Rev Mex Cienc Pecu 2021;12(3):958-968

significativa protegida de Fisher para comparar las medias entre tratamientos al mismo nivel de significancia. La altura de planta después de aplicar los tratamientos y los rendimientos de forraje se muestran en el Cuadro 1. Como se esperaba, la altura de planta a la cosecha fue superior cuando se utilizó una altura de corte de 10 cm e inferior cuando el forraje se cosechó a 60 cm. Los resultados de rendimiento indicaron que las producciones de forraje fresco y MS pueden reducirse a partir de una altura de corte de 40 y 50 cm, respectivamente, desde la superficie del suelo. Estas reducciones pueden llegar a ser considerables hasta un 12 % cuando la altura de corte alcanza los 60 cm respecto a alturas de corte entre 10 y 40 cm. Al respecto, otros trabajos han reportado que el rendimiento de MS se reduce a medida que aumenta la altura de corte, y que las pérdidas en rendimiento pueden oscilar entre un 10 a 20 % cuando la altura de corte es mayor a 20 cm en sorgo forrajero(11,12). Cuadro 1: Altura de planta y rendimientos de forraje fresco y MS de sorgo forrajero, en respuesta a la altura de cosecha Altura de corte (cm) Concepto

10

20

30

3.4a

3.3ab

Rendimiento de forraje 63.6a fresco, t ha-1

62.8a

Rendimiento de MS, t ha-1 18.7a

18.5a

Altura de planta, m

ab

3.3ab

40

50

60

DMS

3.3ab

3.3ab

3.2b

0.2

61.9a

60.2ab

58.2ab

54.5b

5.8

18.1a

17.8a

17.3ab

16.1b

1.6

Medias con diferente superíndice entre hileras son significativamente diferentes (P˂0.05).

El valor nutritivo del ensilaje de sorgo se alteró conforme la altura de corte se incrementó (Cuadro 2). El contenido de FDN se redujo de 74.1 a 66.9 % al aumentar la altura de corte de 10 a 20 cm, respectivamente, pero no se observó reducción significativa a partir de los 20 cm y hasta la altura de corte de 60 cm. El contenido de lignina se redujo de 8.1 a 6.4 % cuando la altura de corte se elevó de 10 a 30 cm, pero no hubo cambios significativos a partir de los 30 cm y hasta la altura de corte de 60 cm.

963


Rev Mex Cienc Pecu 2021;12(3):958-968

Cuadro 2: Contenido y rendimiento de nutrientes del ensilaje de sorgo a diferentes alturas de cosecha Altura de corte (cm) Variable

10

20

30

40

50

60

DMS

29.4

29.5

29.3

29.5

29.7

29.6

0.6

6.4

6.5

6.1

7.2

6.3

6.4

1.4

FDN

74.1a

66.9b

66.2b

64.0b

63.0b

62.9b

5.6

FDA

52.1a

49.3ab

47.8ab

44.8b

43.6b

43.3b

6.0

8.1a

7.7a

6.4b

6.9b

6.4b

6.5b

0.8

27.4d

29.3cd

Nutrientes (% de la MS) MS (% del ensilaje) PC

Lignina DFDN-30 h (% FDN) CNF

4.5c

30.2c

34.2b

35.6b

38.6a

2.1

9.1bc

11.9abc

15.9ab

18.4a

18.2a

8.0

53.3a

52.7a

5.1

1.2a

1.2a

0.1

10.9b

1.8

NDT

45.9b

49.4ab

49.8ab

52.5a

ENL (Mcal kg-1 MS)

1.0b

1.1ab

1.1ab

1.2a

Cenizas

13.7a

12.5ab

12.4ab

11.5b

11.1b

Rendimiento de nutrientes (t ha-1) 13.9a

12.4ab

11.9b

11.4bc

10.9bc

10.2c

1.5

DFDN-30 h

3.8

3.6

3.6

3.9

3.9

3.9

0.7

NDT

8.6

9.1

9.1

9.3

9.1

8.5

1.1

18,659

20,094

19,808

20,548

20,371

FDN

ENL (Mcal ha-1)

18,684

2,448

MS= materia seca, PC= proteína cruda, FDN= fibra detergente neutro, FDA= fibra detergente acido, DFDN30h= digestibilidad in vitro de la FDN a las 30 horas, CNF= carbohidratos no fibrosos, NDT= nutrientes digestibles totales, ENL= energía neta de lactancia. abcd Medias con diferente superíndice entre hileras son significativamente diferentes (P˂0.05).

Como resultado de los cambios observados en los contenidos de FDN y lignina, la DFDN y la concentración de NDT del ensilaje, pueden aumentar a partir de que el forraje se cosechó a alturas de corte de 40 y 20 cm, respectivamente. De igual manera, el contenido de CNF del ensilaje de sorgo aumentó a medida que la altura de corte se incrementó, en donde los tratamientos de altura de corte de 50 y 60 cm fueron los que presentaron la mayor concentración de carbohidratos. Lo anterior, probablemente asociado a la menor lignificación de la fibra y su mayor digestibilidad, lo que a su vez influenció el incremento en la concentración de ENL del ensilaje a partir de la altura de corte de 40 cm(6,7). 964


Rev Mex Cienc Pecu 2021;12(3):958-968

La reducción del contenido de lignina que se observó en el presente estudio, impactó positivamente al mejorar la digestibilidad de la fibra y la disponibilidad de energía en el ensilaje, lo cual ha sido una estrategia para mejorar la digestibilidad de forrajes fibrosos(16). En un estudio donde aumentaron la altura de corte de 15 a 45 cm en el forraje de maíz criollo, sorgo negro y pasto King grass no se modificaron las concentraciones de lignina y FDN en el maíz y en el pasto; sin embargo, la mayor altura de corte redujo la concentración de FDN en 4.2 % y lignina en 1.3 % en el forraje de sorgo(8). En otro estudio similar, el aumento de la altura de corte de 12 a 45 cm en maíz forrajero a la cosecha redujo el contenido de lignina en 0.5 %, lo que contribuyó al aumento de la digestibilidad de la fibra en 2.4 % en el ensilaje de maíz(9). Se ha reportado que por cada unidad porcentual que se incrementa la DFDN en el forraje, aumenta el consumo de MS y producción de leche en las vacas en 0.17 y 0.25 kg d-1, respectivamente(17). Respecto a la producción de nutrientes, se encontró que el rendimiento de FDN, disminuyó a medida que se incrementó la altura de corte del forraje a la cosecha (Cuadro 2). Lo anterior debido a la disminución en la concentración de la FDN del ensilaje y el aumento de rendimiento de MS del forraje a medida que se eleva la altura de corte del forraje. Sin embargo, la altura de corte no afectó los rendimientos de DFDN, NDT y ENL. El pH del ensilaje de sorgo, en respuesta a la altura de corte del forraje a la cosecha se presenta en la Figura 2. Cortar el forraje de sorgo a una altura de 30 cm de la base del suelo podría favorecer una mejor fermentación del ensilaje, ya que se observó un pH más bajo (3.9). En contraste, el ensilaje de forraje de sorgo cortado a una altura de 20 cm registra el valor más alto (4.8). En relación a las demás alturas de corte; 10, 40, 50 y 60 cm no fueron estadísticamente diferentes, y cortar a 10 cm podría propiciar un pH en el ensilaje similar que cosechar el forraje a 30 cm. El pH final del ensilaje puede ser afectado por muchos factores, pero está mayormente relacionado a la concentración de carbohidratos en el forraje(13). En el presente estudio, la concentración de CNF en el ensilaje comienza a aumentar a partir de que el forraje se cortó a 30 cm (Cuadro 2), lo cual coincide con el pH reducido del ensilaje en este tratamiento. Sin embargo, es importante analizar otros compuestos orgánicos y productos finales de la fermentación que ayuden a confirmar este efecto en investigaciones futuras. En maíz forrajero, el aumento de la altura de corte del forraje de 12 a 45 cm no modificó el pH del ensilaje, pero aumentó la concentración de CNF como el almidón(9).

965


Rev Mex Cienc Pecu 2021;12(3):958-968

Figura 2: pH del ensilaje de sorgo en respuesta a la altura de corte en el forraje de sorgo a la cosecha

Medias con diferente letra son significativamente diferentes (P˂0.05).

En conclusión, al cortar el forraje de sorgo entre 20 y 40 cm de la superficie del suelo se obtuvo un ensilaje con menor contenido de lignina, mayor digestibilidad de la fibra y buen contenido de energía, sin comprometer el rendimiento de MS por hectárea. Además, cosechar el forraje a 30 cm de la base del suelo propicia una buena fermentación del ensilaje. Por lo tanto, incrementar la altura de corte del forraje de sorgo hasta 40 cm sobre la base del suelo mejora la calidad nutritiva del ensilaje sin reducir significativamente el rendimiento de MS. Literatura citada: 1.

Jahanzad E, Jorat M, Moghadam H, Sadeghpour A, Chaichi MR, Dashtaki M. Response of a new and a commonly grown forage sorghum cultivar to limited irrigation and planting density. Agric Water Managen 2013;117:62-69. https://doi.org/10.1016/j.agwat.2012.11.001.

2.

Peacock JM. Response and tolerance of sorghum to temperature stress. Sorghum in the Eighties. Proc Int Symp Sorghum, Patancheru, India 1982;1981:143-159.

3.

Saberi AR, Siti AH, Halim RA, Zharah AR. Morphological responses of forage sorghums to salinity and irrigation frequency. African J Biotechnol 2011;10:9647-9656. DOI: 10.5897/AJB11.778.

4.

Singh BR, Singh DP. Agronomic and physiological responses of sorghum, maize and pearl millet to irrigation. Field Crop Res 1995;42:57-67. https://doi.org/10.1016/03784290(95)00025-L.

966


Rev Mex Cienc Pecu 2021;12(3):958-968

5.

Pedersen JF. Annual forages: New approaches for C-4 forages. In: Janick J. editor. Progress in new crops. ASHS Press, Alexandria, VA 1996;246-251.

6.

Grant RJ, Haddad SG, Moore KJ, Pedersen JF. Brown midrib sorghum silage for midlactation dairy cows. J Dairy Sci 1995;78:1970-1980. https://doi.org/10.3168/jds.S0022-0302(95)76823-0.

7.

Miron J, Zuckerman E, Adin G, Solomon R, Shoshani E, Nikbachat M, et al. Comparison of two forage sorghum varieties with corn and the effect of feeding their silages on eating behavior and lactation performance of dairy cows. Anim Feed Sci Technol 2007;139:23-39. https://doi.org/10.1016/j.anifeedsci.2007.01.011.

8.

Elizondo-Salazar JA. Producción de biomasa y calidad nutricional de tres forrajes cosechados a dos alturas. Agron Mesoam 2017;28(2):329-340. doi 10.15517/ma.v28i2.23418.

9.

Neylon JM, Kung Jr L. Effect of cutting height and maturity on the nutritive value of corn silage for lactating dairy cows. J Dairy Sci 2003;86:2163-2169. https://doi.org/10.3168/jds.S0022-0302(03)73806-5.

10. Gonzalez FC, Peña RA, Núñez HG, Jiménez GCA. Efecto de la densidad y altura de corte en el rendimiento y calidad del forraje de maíz. Rev Fitotec Mex 2005;28(4):393397. 11. Creel RJ, Fribourg HA. Interaction between forage sorghum cultivars and defoliation managements. Agronomy J 1981;73(3):463-469. https://doi.org/10.2134/agronj1981.00021962007300030018x 12. Iptas S, Brohi AR. Effect of nitrogen rate and stubble height on dry matter yield, crude protein content and crude protein yield of a sorghum-sudangrass hybrid [Sorghum bicolor (L) Moench × Sorghum sudanse (Piper) Stapf.] in the three cutting systems. J Agron & Crop Sci 2003;189:227-232. https://doi.org/10.1046/j.1439037X.2003.00001.x. 13. Kung Jr L, Moulder BM, Mulroney CM, Teller RS, Schmidt RJ. The effect of silage cutting height on the nutritive value of a normal corn silage hybrid compared with brown midrib corn silage fed to lactating cow. J Dairy Sci 2008;91:1451-1457. https://doi.org/10.3168/jds.2007-0236. 14. Sucu E, Kalkan H, Canbolat O, Filya I. Effects of ensiling density on nutritive value of maiz and sorghum silage. Rev Bras Zoo 2016;45(10):596-603. https://doi.org/10.1590/S1806-92902016001000003.

967


Rev Mex Cienc Pecu 2021;12(3):958-968

15. Contreras-Govea FE, Albrecht KA, Muck RE. Spring yield and silage characteristics of kura clover, winter wheat, and mixtures. Agron J 2006;98:781-787. https://doi.org/10.2134/agronj2005.0248. 16. Adesogan AT, Arriola KG, Jiang Y, Oyebade A, Paula EM, Pech-Cervantes AA, et al. Symposium review: Technologies for improving fiber utilization. J Dairy Sci 2019;102:5726-15334. https://doi.org/10.3168/jds.2018-15334. 17. Oba M, Allen MS. Evaluation of the importance of the digestibility of neutral detergent fiber from forage: effects on dry matter intake and milk yield of dairy cows. J Dairy Sci 1999;82:589-596. https://doi.org/10.3168/jds.S0022-0302(99)75271-9.

968


https://doi.org/10.22319/rmcp.v12i3.5014 Nota de investigación

Efecto del Pyrantel-Oxantel en la tenia Dipylidium caninum: estudio in vitro

Jair Millán-Orozco a¥*, Jersson Millán-Orozco a‡, Miguel Ángel Betancourt-Alonso b, América Ivette Barrera-Molina c, María Soledad Valledor d, Virginia Méndez d, Alejandra Larrea d, Martín Sebastián Lima d, Javier Morán-Martínez e, Nadia Denys Betancourt-Martínez e, Liliana Aguilar-Marcelino f,

a

Universidad Autónoma del Estado de Morelos, Facultad de Ciencias Agropecuarias. Av. Universidad No. 1001, Col. Chamilpa . 62209, Cuernavaca, Morelos, México. b

Escuela de Medicina Veterinaria y Zootecnia en Pequeñas Especies, Federación Canófila Mexicana A.C. Ciudad de México, México. c

Universidad Autónoma del Estado de Morelos, Facultad de Nutrición. Cuernavaca, Morelos, México. d

Universidad de la República. Facultad de Veterinaria. Montevideo, Uruguay.

e

Universidad Autónoma de Coahuila. Facultad de Medicina. Torreón, Coahuila, México.

969


Rev Mex Cienc Pecu 2021;12(3):969-986 f

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias. Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Jiutepec, Morelos, México. ¥

Universidad Autónoma Agraria Antonio Narro. Departamento de Ciencias Médico Veterinarias. Torreón, Coahuila, México. ‡

Asociación de Médicos Veterinarios Zootecnistas Especialistas en Bovinos de la Comarca Lagunera, A.C. Gómez Palacio, Durango, México.

*Autor de correspondencia: jmillan.orozco@uaaan.edu.mx

Resumen: El presente estudio tuvo como objetivo evaluar, in vitro, el efecto cestocida de PirantelOxantel en la tenia Dipylidium caninum. Cada muestra de intestino se obtuvo mediante una incisión transversal de la zona abdominal de cada sujeto canino sacrificado, se diseccionó individualmente a través de una incisión longitudinal y se examinó para detectar la presencia de D. caninum. Se utilizó un microscopio óptico para identificar y verificar la morfología y viabilidad de la proglótide en función de su aspecto macroscópico. Los efectos cestocidas de Pirantel-Oxantel (75 mg de pamoato de pirantel; 75 mg de pamoato de oxantel) se evaluaron en tenias adultas (grupo tratado, n= 21; grupo testigo, n= 21) colocadas en placas de Petri e incubadas a 37 °C. Una hora postincubación, los cestodos D. caninum tratados con PirantelOxantel presentaron una disminución del 28 % (P= 0.001) en la motilidad, la cual aumentó a una disminución del 52 % (P=0.0001) al final de la segunda hora. El grupo testigo (P= 0.0001) presentó un 55.7 % de motilidad durante al menos las primeras 6 h de incubación y 4.2 % (P= 0.001) de motilidad al final del estudio, mientras que en el grupo tratado se observó un 0 % de motilidad al final del estudio. El Pirantel-Oxantel tuvo un efecto letal (P= 0.0001) en el adulto de D. caninum, con una mortalidad del 100 % observada 6 h después de la postincubación in vitro, mientras que el grupo de control presentó un 55.7 % de viabilidad después del mismo periodo. Además, el Pirantel-Oxantel redujo (P= 0.001) el grosor del tegumento en 42.5 % (10.24 ± 0.21 μm), mientras que éste fue de 17.81 ± 0.33 μm para el grupo testigo. Los resultados de este estudio indican que el Pirantel-Oxantel tiene un efecto terapéutico en la presencia de D. caninum, induciendo tanto una disminución del grosor del tegumento como un aumento de la mortalidad. Palabras clave: Dipylidium caninum, Helmintos, Zoonosis, Motilidad, Morfología, Efecto cestocida.

970


Rev Mex Cienc Pecu 2021;12(3):969-986

Recibido: 11/08/2018 Aceptado: 09/11/2020

Dipylidium caninum (D. caninum) es el agente causal de la dipilidiasis, una enfermedad parasitaria causada por el cestodo adulto en perros, gatos, zorros, coyotes y otros carnívoros silvestres(1-7) y muy conocida como una enfermedad zoonótica que afecta a los humanos(8,9). El control de los cestodos con potencial riesgo zoonótico para los animales de compañía es de gran importancia para la salud pública a nivel mundial(2,10,11) dado el estrecho contacto que tanto perros como gatos tienen con los humanos(12), con un riesgo de infección aún mayor en niños(8,9). El cestodo adulto D. caninum crece hasta una longitud de 50 cm, mientras que su estructura macroscópica tiene la apariencia de cuentas de rosario o una agrupación de semillas de pepino(13). A diferencia de los nematodos, los parásitos cestodos no tienen un sistema digestivo y crecen a partir de células proliferantes en el cuello, produciendo varios cientos de segmentos conocidos como proglótides y obteniendo alimentos a través del tegumento o pared corporal(13). Situado en el intestino delgado del hospedero, D. caninum absorbe el material digerido y obtiene los nutrientes necesarios para su supervivencia, reproduciéndose sin la dificultad que han sufrido otros parásitos, ya que, como parásito hermafrodita, forma proglótides grávidas llenas de huevos infecciosos por medio de la diferenciación continua(9,14,15). El pirantel (E-1,4,5,6-tetrahidro-1-metil-2-pirimidina) es un imidazotiazol antihelmíntico derivado de las tetrahidropirimidinas y utilizado ampliamente por veterinarios en especies pequeñas (perros y gatos), dado su amplio espectro de acción contra parásitos gastrointestinales maduros e inmaduros que infectan a animales domésticos(16). El oxantel (1 metil-2-(3-hidroxifenil-etenil) 1,4,5,6-tetrahidropirimidina) es un derivado m-oxifenol del pirantel(17) que activa el subtipo N, un subtipo sensible a la nicotina y la metiridina. El pirantel activa el subtipo L, un subtipo sensible al levamisol y al pirantel, lo que explica por qué se han reportado diferencias en sus nematodos objetivo(16). Las tetrahidropirimidinas comprenden una amplia variedad de sales de pirantel, morantel y oxantel, todas ellas tienen efectos agonistas nicotínicos que alteran el sistema neuromuscular del parásito, afectando la contracción muscular y causando parálisis tónica. Los receptores nicotínicos de acetilcolina (nAchR) son esenciales para la función nerviosa del parásito, presentando una distribución y fisiología diferente a la encontrada en los mamíferos(9). Los antihelmínticos agonistas nicotínicos actúan en la acetilcolina nicotínica en la unión neuromuscular del parásito, causando despolarización neuromuscular y parálisis espástica(18,19). Los nAchR del parásito tienen cinco subunidades de glicoproteínas ubicadas alrededor de un canal iónico central(20), que comprende un canal iónico pentamérico operado por ligando, que es una estructura con efectos farmacológicos significativos(16). Además, los

971


Rev Mex Cienc Pecu 2021;12(3):969-986

nAchRs son funcionalmente diversos debido a sus extensas familias de genes que codifican subunidades y tres subpoblaciones farmacológicas de receptores(16). La activación del receptor de acetilcolina en nematodos se ha dividido en tres subtipos farmacológicos según el grado de afinidad nicotínica(21,22), caracterizado y definido de la siguiente manera: el subtipo N, con sensibilidad significativa a la nicotina, metiridina y oxantel; el subtipo L, con afinidad al levamisol y pirantel; y, el subtipo B, con una mayor sensibilidad al befenio. El mecanismo de acción del pirantel funciona bloqueando la excitación muscular mediante la activación de un agonista del nAchR(18,19), alterando el sistema neuromuscular y, por lo tanto, provocando contracción muscular y parálisis, lo que resulta en la muerte del parásito(9). El oxantel (m-oxifenol) ha demostrado ser eficaz contra nematodos gastrointestinales de gran impacto tanto en la salud animal como en la salud pública(23,24). Si bien el efecto de piranteloxantel (P-O), como tratamiento combinado, en los parásitos nematodos se ha reportado previamente(25), no hay informes científicos sobre los efectos de una combinación de P-O, ya sea in vivo o in vitro, en la motilidad, el grosor del tegumento u otras estructuras anatómicas en tenias. Por lo tanto, el presente estudio tuvo como objetivo evaluar el efecto cestocida in vitro de P-O en la motilidad y el grosor del tegumento de cestodos adultos Dipylidium caninum y describir los cambios histológicos en las proglótides grávidas de los organismos. Todos los procedimientos de eutanasia aplicados en el presente estudio se realizaron siguiendo las pautas recomendadas y aprobadas por el Comité de Ética para la Experimentación Animal de la Facultad de Ciencias Agropecuarias de la Universidad Autónoma del Estado de Morelos y el Código de Ética de la Asociación Médica Mundial (Declaración de Helsinki). Doscientos sesenta y seis (266) perros callejeros infectados naturalmente fueron muestreados en el Centro de Control Canino y Felino en el municipio de Tláhuac, Ciudad de México, después de ser capturados por la brigada municipal de control de animales. Los animales se sacrificaron por personal autorizado a través de una sobredosis anestésica, obteniéndose después el intestino delgado de cada sujeto mediante una incisión transversal en su abdomen. Los intestinos delgados obtenidos, aún conectados a través de las válvulas gastroduodenal e ileocecal, se almacenaron en bolsas de plástico, etiquetadas con números progresivos y transportadas al Laboratorio de Producción Animal de la Facultad de Ciencias Agropecuarias de la Universidad Autónoma del Estado de Morelos, ubicada en la ciudad de Cuernavaca(26). Cada muestra de intestino se diseccionó individualmente mediante una incisión longitudinal y se examinó la presencia de cestodos D. caninum, que se identificaron a través de la apariencia macroscópica de las proglótides y se distribuyeron utilizando un microscopio óptico para verificar su morfología(27). La observación directa se llevó a cabo bajo un microscopio para determinar la viabilidad de los parásitos en el objetivo de 40X, con cestodos

972


Rev Mex Cienc Pecu 2021;12(3):969-986

que presentaron motilidad completa durante un periodo de un minuto considerado viable para la posterior experimentación(28-30). Se evaluó el efecto cestocida de P-O en parásitos adultos (grupo tratado (P-O), n= 21; grupo testigo (GT), n= 21), con los individuos colocados en placas de Petri de 90x60 mm que contenían 10 ml de RPMI (Roswell Park Memorial Institute) 1640 e incubados a 37 °C durante 10 h. Se utilizó agua destilada y el PMSF (fluoruro de fenilmetanosulfonilo) como vehículo inhibidor de la proteasa para el grupo de control, con el fin de mantener la anatomía estructural y la fisiología de los cestodos. Para el grupo tratado, se utilizó un medicamento desparasitante comercial (75 mg de Pamoato de Pirantel y 75 mg de Pamoato de Oxantel (Vermiplex), Laboratorios Holland Animal Health, Jiutepec, Morelos, México), en el que se agregaron tabletas maceradas al agua destilada en las placas de Petri. Después de la incubación, se realizó una observación directa en un microscopio estereoscópico cada hora para determinar los efectos cestocidas. La prueba de motilidad se realizó por triplicado(26), en la que la motilidad del cestodo se evaluó en una escala de 0 a 5, de la siguiente manera: 0 indicó tenias completamente inmóviles que no respondieron a la estimulación manual; 1 indicó movimiento solo cuando se pincharon; 2 indicó actividad espontánea, pero únicamente en cada extremo del organismo, a saber, el escólex y el extremo del estróbilo; 3 indicó actividad lenta y espontánea durante toda la evaluación; 4 indicó que el sujeto estaba más activo; y, 5 indicó que el sujeto estaba altamente activo(28-30). Se obtuvieron segmentos de parásitos adultos (proglótides grávidas) y se fijaron en paraformaldehído al 10 % y se mantuvieron bajo refrigeración a 4 °C hasta que se realizó el procedimiento histológico. Con el fin de observar la estructura histológica y cuantificar la altura del epitelio secretor y el grosor de la lámina propia, se obtuvieron secciones de tejido y se colocaron sobre portaobjetos de vidrio previamente tratados con poli-l-lisina. La parafina se eliminó de las secciones con xilol, se hidrató con alcoholes de diferentes concentraciones y se hizo permeable con tritón X-100 al 0.1 % en citrato de sodio durante 20 min, mientras que la actividad de la peroxidasa endógena se inhibió incubando el tejido durante 25 min en una solución de H2O2 al 0.3 % a temperatura ambiente. Las preparaciones se lavaron con una solución tampón de fosfato (PBS1X) y se marcaron con un lápiz hidrofóbico alrededor del tejido(31-33). Se procesaron segmentos de cestodo D. caninum, obteniendo secciones semiseriales de 5 μm. Se utilizó tinción de hematoxilina y eosina para evaluar la estructura histológica y el grosor del tegumento(27). Para cada sección histológica, se observaron seis campos de microscopio utilizando un objetivo de 40X, mientras que se realizaron seis mediciones de grosor del tegumento utilizando el analizador de imágenes Motic 2.0 y luego se fotografiaron(26,27). Los datos experimentales correspondientes a las observaciones de motilidad in vitro se analizaron mediante una prueba Z, mientras que las mediciones del grosor del tegumento se 973


Rev Mex Cienc Pecu 2021;12(3):969-986

compararon mediante una prueba t de Student(34). Las diferencias se consideraron estadísticamente significativas cuando P<0.05, los resultados de motilidad in vitro se expresan como porcentaje y los resultados histológicos se expresan como media y error estándar. Los resultados de la eficacia de P-O en términos de la motilidad de los parásitos D. caninum están disponibles en el Cuadro 1. Al inicio del experimento (hora 0) del experimento, ambos grupos presentaron movimiento total (P=0.07). El P-O mostró una reducción progresiva de la motilidad (del 72.0 al 4.8 %) desde la primera hasta la quinta hora después de la incubación, logrando así una reducción media por hora del 19 %, mientras que, de las horas seis a diez, se observó un 0 % de motilidad. En el grupo de control (GT), se observó un 100 % de motilidad durante las primeras 2 h postincubación, mientras que la motilidad se redujo del 96.2 al 4.2 % desde la tercera hora hasta el final del experimento, dando una reducción media del 10 % por hora. Cuadro 1: Motilidad in vitro (%) de los cestodos adultos Dipylidium caninum tratados con Pirantel-Oxantel Grupos

Incubación (h) 0

1

2

3

4

Pirantel-Oxantel 100a 72.0a 48.0a 25.0a 15.8a Testigo 100a 100b 100b 96.2b 85.3b

5

6

7

8

9

10

4.8a

0.0a

0.0a

0.0a

0.0a

0.0a

20.0b

4.2b

72.7b 55.7b 41.5b 31.5b Se realizaron tres réplicas para cada grupo, utilizando 126 tenias. ab Letras diferentes muestran diferencias significativas (P=0.0001).

Se observó una diferencia (P=0.0001) entre el grupo tratado y el GT entre la primera hora y el final del experimento. En la primera hora postincubación, la motilidad del grupo tratado fue del 72.0 %, mientras que esta fue del 100 % para el GT (P=0.0001). Se observó motilidad de 55.7, 41.5, 31.5, 20.0 y 4.2 % en las horas 6, 7, 8, 9 y 10 postincubación, mientras que se observó un 0.0 % de motilidad en el grupo tratado a partir de la sexta hora en adelante postincubación (P=0.0001). Los efectos de P-O en el grosor del tegumento (P=0.001) de los cestodos adultos D. caninum se muestran en las Figuras 1 y 2, en el que el P-O disminuyó el grosor del tegumento en un 42.5 % (10.24 ± 0.21 μm) (Figura 2b; punta de flecha gris), mientras que éste fue de 17.81 ± 0.33 μm para el GT (Figura 2a; punta de flecha gris).

974


Rev Mex Cienc Pecu 2021;12(3):969-986

Figura 1: Efecto de Pirantel-Oxantel en el grosor del tegumento (media ± ESM) en cestodos adultos Dipylidium caninum

**Diferencias significativas entre grupos (P=0.001).

Los efectos de P-O en la estructura general de D. caninum, en comparación con la estructura presentada por el GT, se muestran en las Figuras 2a y b. Un hallazgo significativo con respecto a la histología de las proglótides grávidas observadas fue la concentración de corpúsculos calcáreos (CC) inmaduros (puntas de flecha negras) a lo largo de la superficie y cerca del tegumento (Figura 2a, b). En el GT, la concentración de CC inmadura fue mayor que la observada en las proglótides tratadas con P-O (Figura 2a; punta de flecha negra), mientras que los CC maduros solo se observaron en el grupo P-O (Figura 2b; punta de flecha azul), en el que también se observó una alteración de los huevos de D. caninum. En el grupo tratado con P-O, se encontró que la morfología y distribución de los sacos de los huevos había sido alterada, mientras que, en el GT, los sacos de los huevos presentaron una morfología y distribución normal (Figura 2b; punta de flecha morada). Finalmente, el embrióforo, la capa vitelina y el embrión permanecieron casi completamente intactos en el GT, mientras que, en el grupo P-O, tales estructuras se distendieron (Figura 2a; punta de flecha roja).

975


Rev Mex Cienc Pecu 2021;12(3):969-986

Figura 2: Secciones histológicas de tenias Dipylidium caninum. Espesor del tegumento obtenido en cestodos no tratados (A) y tratados con Pirantel-Oxantel (B)

A) Grosor del tegumento intacto (punta de flecha gris), corpúsculos calcáreos inmaduros a lo largo de la superficie y cerca del tegumento (puntas de flecha negras), embrióforo y capa vitelina intactos (punta de flecha púrpura) y el embrión (puntas de flecha rojas). B) Reducción del grosor del tegumento (punta de flecha gris), reducción del número de corpúsculos calcáreos inmaduros (punta de flecha negra), apariencia de corpúsculos calcáreos maduros (punta de flecha azul), morfología y distribución de sacos de huevos (punta de flecha morada), embrióforo, capa vitelina, embrión y estructuras distendidas (puntas de flecha moradas y rojas).

El presente estudio muestra los efectos de P-O en la motilidad y el grosor del tegumento de los cestodos adultos D. caninum, así como otras estructuras histológicas como corpúsculos calcáreos, sacos de huevos, embrióforo, la capa vitelina y el embrión. Los resultados de motilidad obtenidos en el presente estudio muestran que el P-O tiene un efecto directo en la motilidad, causando 100 % de inhibición de la motilidad 6 h postincubación. Algunos fármacos tienen un efecto rápido en la transmisión neuromuscular de algunos parásitos, con, por ejemplo, pirantel y oxantel que actúan como agonistas en los nAchRs sinápticos y extrasinápticos en las células musculares del nematodo, produciendo contracción y parálisis espástica(35). Estudios anteriores evaluaron los efectos del pamoato de pirantel contra Caenorhabditis elegans(36), mientras que el pamoato pirantel y el pamoato oxantel, utilizados en combinación, han demostrado ser eficaces contra Trichuris muris(37) Ascaris lumbricoides(38), aunque se ha encontrado que este tratamiento es ineficaz contra Ancylostoma ceylanicum y Necator americanus(37). Los efectos del pamoato de pirantel y el pamoato de oxantel, 24 h después de la exposición, incluyen contracción muscular, inhibición de la motilidad y una reducción en el tamaño del parásito(36,37), tanto en larvas infecciosas como en organismos adultos. Mientras los efectos encontrados en estos estudios concuerdan 976


Rev Mex Cienc Pecu 2021;12(3):969-986

con los hallazgos del presente estudio, el tratamiento P-O aplicado causó una mortalidad del 100 % en tenias D. caninum a partir de la sexta hora en adelante postexposición. Los efectos del pamoato de pirantel (en forma de pasta) se evaluaron en la tenia común del caballo A. perfoliata(39-41), con una reducción del 92 a 98 % en la motilidad obtenida en tenias adultas después de 7 a 16 días de tratamiento en caballos infectados naturalmente examinados en la necropsia(40). Dichos resultados concuerdan con el 100 % de mortalidad observada in vitro en el presente estudio 6 h después de la incubación. Como la sal de pamoato de pirantel es prácticamente insoluble en agua, se absorbe a un ritmo reducido en el tracto gastrointestinal, lo que le permite llegar a los sitios microambientales en los parásitos objetivo más fácilmente que otras sales de pirantel como el tartrato, que es más soluble en agua y se absorbe más rápidamente a través del tracto gastrointesinal, para luego ser metabolizada y excretada tanto en la orina como, en pequeñas cantidades, en heces(40). Por lo tanto, el presente estudio muestra, in vivo, la ventaja del tratamiento P-O aplicado en el presente estudio en perros infectados naturalmente con tenias D. caninum, ya que, al menos, se observó un efecto letal in vitro. Se ha encontrado que la combinación de pirantel con otros fármacos tiene un potencial antihelmíntico limitado, como se observó en A. ceylanicum y N. americanus(37) in vitro, los cuales presentaron efectos antagónicos y no letales. Sin embargo, el presente estudio encontró un efecto sinérgico y un aumento de la potencia a través de la combinación de pamoato pirantel y pamoato oxantel, obteniendo una mortalidad del 100 % en el cestodo adulto D. caninum. Un efecto similar se observó en un estudio anterior que utilizó una combinación de pirantel embonato, oxantel embonato y praziquantel, obteniendo una mortalidad in vitro del 100 % ocho horas postincubación(33). Si bien los resultados anteriores concuerdan con los obtenidos por el presente estudio, muestran una mortalidad in vitro del 100 % 6 h postincubación. El efecto de P-O observado en el presente estudio se debe a la capacidad del fármaco para permanecer en micrositios en los parásitos, aumentando así su absorción por el cestodo a lo largo de la longitud del tegumento, y acortando el tiempo en el que surte efecto, aumentando así la mortalidad. El tegumento es una de las principales estructuras de un cestodo, el cual requiere esta característica anatómica tanto para absorber material semidigerido del intestino delgado del hospedero, como para mejorar la función fisiológica y la reproducción del cestodo, dado que, a diferencia de los nematodos, los cestodos no tienen tracto digestivo. Por lo tanto, la capacidad de absorción del tegumento en cestodos es mayor que la encontrada en nematodos. En relación con lo anterior, durante su establecimiento, los parásitos helmintos producen mayores niveles de citoquinas proinflamatorias en el hospedero(42), produciendo, en consecuencia, caquexia.

977


Rev Mex Cienc Pecu 2021;12(3):969-986

El P-O redujo sustancialmente el grosor del tegumento en la tenia D. caninum. Existen informes en la literatura de que este tratamiento afecta al tegumento en diferentes grados, causando cambios y daños morfológicos irreversibles en el tegumento y parénquima, alteraciones en la organización muscular, ausencia de microvellosidades tegumentarias, pérdida de células de la membrana en el tejido subtegumental, el desarrollo de un tegumento granular denso, y grandes vacuolas que generan un aspecto irregular y poroso, en los siguientes organismos: las tenias de roedores Hymenolepis nana(43,44), Hymenolepis microstoma(44), Taenia taeniformis(44,45), Echinococcus multilocularis(44,45) e Hymenolepis diminuta(29,44,45); Taenia solium en hámsteres infectados experimentalmente(46); Taenia crassiceps(47-49); Mesocestoides corti(50); Raillietina echinobothrida(51-54) en aves domésticas; Anoplocephala perfoliata(30) en caballos; D. caninum(33) en perros, gatos y humanos; el trematodo Fasciola hepatica en ratas(55); Artyfechinostomum sufrartyfex(56) en humanos; Fasciolopsis buski(53,56); el nematodo gastrointestinal porcino Ascaris suum(53); el nematodo anquilostoma gastrointestinal canino Ancylostoma ceylanicum(57); los nematodos gastrointestinales de roedores Rodentolepis microstoma(57), Trichuris muris(58) y Heligmosomoides polygyrus(59); y los nematodos parásitos de plantas de los géneros Meloidogyne y Globodera(60). Los resultados del presente estudio concuerdan con los resultados mencionados, como la reducción (adelgazamiento) del tegumento en 42.5 % en los parásitos de D. caninum tratados con P-O después de 6 h de incubación in vitro. El efecto de este tratamiento en el grosor del tegumento puede ser más pronunciado en parásitos incubados durante más de 6 h, como lo demuestran nuestros resultados histológicos; sin embargo, no se obtuvieron resultados histológicos de los sujetos tratados más de 6 h postincubación. El presente estudio mostró la presencia de CC en segmentos grávidos tanto en el GT como en el grupo P-O; sin embargo, en el grupo P-O, el número de CC fue menor. La biomineralización es un fenómeno generalizado en los invertebrados, con el carbonato de calcio, uno de los biominerales más abundantes implicados en dicho proceso(61). En los cestodos, los minerales producen CC, función que ha sido objeto de especulación científica, con algunas hipótesis propuestas, una de las cuales postula que los CC representan aproximadamente el 10 % del peso corporal de los parásitos y que se encuentran comúnmente en el parénquima de muchos metacestodos y cestodos adultos(61,62). Otra hipótesis es que los CC juegan un papel importante en la desintoxicación(63), ya que, debido a que se producen principalmente en ausencia de oxígeno, se cree que amortiguan anaeróbicamente los ácidos y sirven como reservorio para iones inorgánicos(64). Cabe señalar que los CC son, en parte, un producto excretor que sirve para eliminar los desechos metabólicos del cuerpo al pasar a través del tegumento(62). Los corpúsculos calcáreos están compuestos por una base orgánica acoplada a sustancias inorgánicas, como potasio, sodio, magnesio, silicato, calcio, fosfato(61) y sulfato en diferentes larvas de cisticercos y cestodos adultos(64). Su base orgánica incluye ADN, ARN(65), proteínas(66,67) y glucógeno(46,68). Por lo tanto, en el presente estudio, la disminución del número de CC inmaduros distribuidos cerca del tegumento en el grupo P-O 978


Rev Mex Cienc Pecu 2021;12(3):969-986

se debió tanto a un alto nivel de absorción a través del tegumento de los cestodos D. caninum como a la duración de la incubación in vitro. Además, el 100 % de mortalidad obtenido por el presente estudio también se debe tanto a una pérdida de la proteína y el glucógeno requeridos por el proceso metabólico en las células, como a una probable desintegración del ADN del organismo. Como se han realizado pocos estudios sobre la densidad y ubicación de los CC en diferentes partes del estróbilo de cestodos D. caninum, Khalifa et al(27) realizaron un estudio histoquímico y ultraestructural comparativo para determinar las diferencias en la ubicación, distribución, composición y funciones de los CC de D. caninum y T. taeniaeformis. Los resultados del presente estudio en relación con los CC concuerdan con los obtenidos por Khalifa et al(27), ya que la distribución de los CC se concentró en los lados laterales de los segmentos grávidos del cestodo D. caninum y se vieron afectados por el tratamiento P-O. La tinción de hematoxilina y eosina de los segmentos grávidos mostró que, en el GT, los huevos de D. caninum se agruparon en sacos como en lo observado por Khalifa et al(27), mientras que el grupo P-O presentó signos de alteraciones morfológicas, como distensión de los huevos, embrióforo, embrión y capa vitelina. Si bien pocos estudios han observado la estructura de los segmentos grávidos de D. caninum, Peña et al(33) observaron los efectos de la toxina B. thuringiensis en D. caninum, resultados que concuerdan con los del presente estudio al mostrar efectos en la motilidad, el grosor del tegumento y los huevos; efectos que reducen el porcentaje de motilidad, adelgazan el tegumento y dañan los huevos del organismo. Sin embargo, Peña et al(33) utilizaron un fármaco comercial que contenía embonato de pirantel, embonato de oxantel y praziquantel como control positivo. Se han utilizado otras estrategias para disminuir la infectividad de los huevos de D. caninum, con un estudio realizado en Brasil por Araujo et al(69) que evalúa el efecto de los hongos nematófagos Poconia chlamydospora, Duddingtonia flagrans y Monacrosporium thaumasium en las cápsulas de los huevos. Sus resultados mostraron que los aislados de Poconia chlamydospora (tipos 2 y 3) tuvieron una actividad ovicida entre 5 y 15 d después de la incubación in vitro. Sin embargo, hasta la fecha, se ha encontrado que la actividad de un fármaco sintetizado tiene efectos más rápidos y pronunciados, como se observa con el tratamiento P-O utilizado en el presente estudio. Con base en los resultados del presente estudio, el P-O tiene efectos cestocidas in vitro contra la tenia D. caninum, mostrando un efecto letal y disminuyendo la motilidad en un 100 % dentro de las primeras 6 h después de la incubación in vitro. Además, el P-O tiene un efecto directo en el grosor del tegumento, reduciéndolo en un 42 %. El presente estudio es el primero realizado sobre los efectos in vitro de P-O en la mortalidad, la reducción del grosor del tegumento y las alteraciones en las estructuras histológicas, como los huevos, el embrióforo, el embrión y la capa vitelina de la tenia D. caninum. El uso de una combinación de P-O es 979


Rev Mex Cienc Pecu 2021;12(3):969-986

un tratamiento farmacológico opcional para el control de D. caninum en perros y gatos infectados naturalmente.

Agradecimientos

Al Centro de control canino y felino, Tláhuac, Ciudad de México, por su ayuda en la recolección de muestras de intestino delgado de perros infectados naturalmente; a Maribel Nieto Miranda de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Nacional Autónoma de México (FMVZ-UNAM), por su gran ayuda con los procedimientos histológicos; a la SEP-PROMEP por el apoyo financiero brindado a Jair Millán-Orozco (Cuota escolar: 422006-0708) para la realización de su Maestría en Ciencias en la Facultad de Ciencias Agropecuarias de la Universidad Autónoma del Estado de Morelos (FCAUAEM); y, finalmente, a Adriana Silva de Oliveira por su asistencia técnica.

Conflictos de intereses

Los autores declaran no tener conflicto de intereses. Literatura citada: 1.

Dalimi A, Sattari A, Motamedi GH. A study on intestinal helminthes of dogs, foxes and jackals in the western part of Iran. Vet Parasitol 2006;142(1-2):129-133.

2.

Hernández MR, Núñez FA, Pelayo DL. Potencial zoonótico de las infecciones por helmintos intestinales en perros callejeros de Ciudad de La Habana. Rev Cub Med Trop 2007;59(3):234-240.

3.

Ziadinov I, Deplazes P, Mathis A, Mutunova B, Abdykerimov K, Nurgaziev R, Torgerson PR. Frequency distribution of Echinococcus multilocularis and other helminths of foxes in Kyrgyzstan. Vet Parasitol 2010;171(3-4):286-292.

4.

Xhaxhiu D, Kusi I, Rapti D, Kondi E, Postoli R, Rinaldi L, et al. Principal intestinal parasites of dogs in Tirana, Albania. Parasitol Res 2011;108(2):341-353.

5.

Cantó GJ, Guerrero RI, Olvera-Ramírez AM, Milián F, Mosqueda J, Aguilar-Tipacamú G. Prevalence of fleas and gastrointestinal parasites in free-roaming cats in Central Mexico. Plos One 2013;8(4):1-6.

980


Rev Mex Cienc Pecu 2021;12(3):969-986

6.

Adolph C, Barnett S, Beall M, Drake J, Elsemore D, Thomas J, Little S. Diagnostic strategies to reveal covert infections with intestinal helminths in dogs. Vet Parasitol 2017;247:108-112. dx.doi.org/10.1016/j.vetpar.2017.10.002.

7.

Figueiredo PP, da Silva BA, Pereira de Moura AP, Leitão VM, Antunes UCA, Pereira BOM, Reis AMR. Gastrointestinal parasites in stray and shelter cats in the municipality of Rio de Janeiro, Brazil. Braz J Vet Parasitol 2017;26(3):383-388.

8.

Molina CP, Ogburn J, Adegboyega P. Infection by Dipylidium caninum in an infant. Arch Pathol Lab Med 2003;127(3):157-159.

9.

Bowman DD. Georgis’ Parasitología para Veterinarios. 8ª ed. Madrid, España: Elsevier; 2004.

10. Charles SD, Altreuther G, Reinemeyer CR, Buch J, Settje T, Cruthers L, et al. Evaluation of the efficacy of emodepside+prazicuantel topical solution against cestode (Dipylidium caninum, Taenia taeniaeformis, and Echinococcus multilocularis) infection in cats. Parasitol Res 2005;97(1):33-40. 11. Rodríguez-Vivas RI, Gutiérrez-Ruiz E, Bolio-González ME, Ruiz-Piña H, OrtegaPacheco A, Reyes-Novelo E, et al. An Epidemiological study of intestinal parasites of dogs from Yucatan, Mexico, and their risk to public health. Vector-Borne Zoon Dis 2011;11(8):1141-1144. 12. Eguía-Aguilar P, Cruz-Reyes A, Martínez-Maya JJ. Ecological analysis and description of the intestinal helminths present in dogs in Mexico City. Vet Parasitol 2005;127(2):139-146. 13. Hendrix CM. Diagnostic veterinary parasitology. 2nd ed. St. Louis, MO, USA: Mosby; 1998. 14. Merchant MT, Aguilar L, Avila G, Robert L, Flisser A, Willms K. Taenia solium: description of the intestinal implantation sites in experimental hamster infections. J Parasitol 1998;84(4):681-685. 15. Domínguez MF, Koziol U, Porro V, Costábile A, Estrade S, Tort J, Bollati-Fologin F, Castillo E. A new approach for the characterization of proliferative cells in cestodes. Exp Parasitol 2014;138:25-29. dx.doi.org/10.1016/j.exppara.2014.01.005. 16. Martin RJ, Clark CL, Trailovic SM, Robertson AP. Oxantel is an N-type (methyridine and nicotine) agonist not an L-type (levamisole and pyrantel) agonist: classification of cholinergic anthelmintics in Ascaris. Int J Parasitol 2004;34(9):1083-1090. 17. McFarland JW, Howes HL. Novel anthelmintic agents. 6. Pyrantel analogues with activity against whipworm. J Med Chem 1972;15(4):365-368. 981


Rev Mex Cienc Pecu 2021;12(3):969-986

18. Robertson SJ, Pennington AJ, Evans AM, Martin RJ. The action of pyrantel as an agonist and an open channel blocker at acetylcholine receptors in isolated Ascaris suum muscle vesicles. Eur J Pharmacol 1994;271(2-3):273-282. 19. Kopp SR, Kotze AC, McCarthy JS, Traub RJ, Coleman GT. Pyrantel in small animal medicine: 30 years on. Vet J 2008;178(2):177-184. 20. Conti-Tronconi BM, McLane KE, Raftery MA, Grando SA, Protti MA. The nicotinic acetylcholine receptor: Structure and autoimmune pathology. Crit Rev Biochem Mol Biol 1994;29(2):69-123. 21. Robertson AP, Clark CL, Burns TA, Thompson DP, Geary TG, Trailovic SM, Martin RJ. Paraherquamide and 2-deoxyparaherquamide distinguish cholinergic receptor subtypes in Ascaris muscle. J Pharmacol Exp Ther 2002;302(3):853-860. 22. Martin RJ, Bai G, Clark CL, Robertson AP. Methyridine (2- [2-methoxyethyl]-pyridine) and levamisole activate different Ach receptor subtypes in nematode parasites: a new lead for levamisole resistance. Brit J Pharm 2003;140(6):1068-1076. 23. Howes Jr HL. Trans-1,4,5,6-tetrahydro-2-(3-hydroxystyryl)-1-methyl pyrimidine (CP14,445), a new antiwhipworm agent. Proc Soc Exp Biol Med 1972;139:394-398. 24. Robinson M, Hooke F, Iverson KE. Efficacy of oxantel pamoate and pyrantel pamoate in combination against Trichuris vulpis, Ancylostoma caninum and Toxocara canis in dogs. Aust Vet Pract 1976;6:173-176. 25. Albonico M, Bickle Q, Haji HJ, Ramsan M, Khatib KJ, Montresor A, Savioli L, Taylor M. Evaluation of the efficacy of pyrantel-oxantel for the treatment of soil-transmitted nematode infections. Trans R Soc Trop Med Hyg 2002;96(6):685-690. 26. Millán OJ. Evaluación in vitro de cepas nativas de Bacillus thuringiensis contra el cestodo adulto de perros Dipylidium caninum [tesis maestría] Cuernavaca, Morelos, México: Facultad de Ciencias Agropecuarias, Universidad Autónoma del Estado de Morelos; 2009. 27. Khalifa RMA, Mazen NAM, Marawan AMA, Thabit HTM. Histochemical and ultrastructural studies on the calcareous corpuscles and eggs of Taenia teaniformis and Dipylidium caninum. J Egypt Soc Parasitol 2011;41(2):513-528. 28. Stepek G, Buttle DJ, Duce IR, Lowe A, Behnke JM. Assessment of the anthelmintic effect of natural plant cysteine proteinases against the gastrointestinal nematode, Heligmosomoides polygyrus, in vitro. Parasitology 2005;130(2):203-211.

982


Rev Mex Cienc Pecu 2021;12(3):969-986

29. Mansur F, Luoga W, Buttle DJ, Duce IR, Lowe A, Behnke JM. The anthelmintic efficacy of natural plant cysteine proteinases against two rodent cestodes Hymenolepis diminuta and Hymenolepis microstoma in vitro. Vet Parasitol 2014;201(1-2):48-58. 30. Mansur F, Luoga W, Buttle DJ, Duce IR, Lowe AE, Behnke JM. The anthelmintic efficacy of natural plant cysteine proteinases against the equine tapeworm, Anoplocephala perfoliata in vitro. J Helminthol 2016;90(5):561-568. 31. Flores-Pérez FI, de Aluja AS, Martínez-Maya JJ. Efectos en el desarrollo del metacestodo de Taenia solium inducidos por dosis bajas de radiación gamma. Vet Méx 2006;37(3):303-311. 32. Rosas-Velasco C, Pérez-Martínez M, Castillo-Juárez H, Flores-Pérez FI. Cambios histológicos inducidos por el acetato de medroxiprogesterona en el útero de conejas ovariectomizadas. Vet Méx 2007;38(2):207-214. 33. Peña G, Aguilar Jiménez FA, Hallal-Calleros C, Morales-Montor J, HernándezVelázquez VM, Flores-Pérez FI. In vitro ovicidal and cestocidal effects of toxins from Bacillus thuringiensis on the canine and human parasite Dipylidium caninum. BioMed Res Int 2013. dx.doi.org/10.1155/2013/174619. 34. Wayne WD. Bioestadística. Base para el análisis de las ciencias de la salud. 4ª ed. México, D.F: Limusa; 2006. 35. Martin RJ. Modes of action of anthelmintic drugs. Vet J 1997;154(1):11-34. 36. Hu Y, Xiao SH, Aroian RV. The new anthelmintic tribendimidine is an L-type (levamisole and pyrantel) nicotinic acetylcholine receptor agonist. Plos Neglected Trop Dis 2009;3(8):1-9. 37. Keiser J, Tritten L, Silbereisen A, Speich B, Adelfio R, Vargas M. Activity of oxantel pamoate monotherapy and combination chemotherapy against Trichuris muris and hookworms: Revival of an old drug. Plos Neglected Trop Dis 2013;7(3):1-8. 38. Choi WY, Lee OR, Lee WK, Kim WK, Chung CS, Ough BO. A clinical trial of Oxantel and Pyrantel against intestinal nematodes infections. Korean J Parasitol 1979;17(1):6066. 39. Slocombe JOD. A modified critical test for the efficacy of pyrantel pamoate for Anoplocephala perfoliata in equids. Can J Vet Res 2004;68(2):112-117. 40. Marchiondo AA, White GW, Smith LL, Creinemeyer CR, Dascanio JJ, Johnson EG, Shugart JI. Clinical field efficacy and safety of pyrantel pamoate paste (19.13% w/w pyrantel base) against Anoplocephala perfoliata in naturally infected horses. Vet Parasitol 2006;137(1-2):94-102. 983


Rev Mex Cienc Pecu 2021;12(3):969-986

41. Reinemeyer CR, Hutchens DE, Eckblad WP, Marchiondo AA, Shugart JI. Doseconfirmation studies of the cestocidal activity of pyrantel pamoate paste in horses. Vet Parasitol 2006;138(3-4):234-239. 42. Reyes JL, González MI, Ledesma-Soto Y, Satoskar AR, Terrazas LI. TLR2 mediates immunity to experimental cysticercosis. Int J Biol Sci 2011;7(9):1323-1333. 43. Becker B, Mehlhorn H, Andrews P, Thomas H. Scanning and transmission electron microscope studies on the efficacy of praziquantel on Hymenolepis nana (Cestoda) in vitro. Z, Parasitenkd 1980;61(2):121-133. 44. Mehlhorn H, Becker B, Andrews P, Thomas H. On the nature of the proglottids of cestodes: A light and electron microscopic study on Taenia, Hymenolepis, and Echinococcus. Z Parasitenkd 1981;65(3):243-259. 45. Becker B, Mehlhorn H, Andrews P, Thomas H. Ultrastructural investigations on the effect of praziquantel on the tegument of five species of Cestodes. Z Parasitenkd 1981;64(3):257-269. 46. Willms K, Robert L, Caro JA. Ultrastructure of smooth muscle, gap junctions and glycogen distribution in Taenia solium tapeworms from experimentally infected hamsters. Parasitol Res 2003;89(4):308-316. 47. Willms K, Robert L, Jiménez JA, Everhart M, Kuhn RE. Ultrastructure of spermiogenesis and the spermatozoon in Taenia crassiceps strobilae WFU strain (Cestoda, Cyclophyllidea, Taeniidae) from golden hamsters. Parasitol Res 2004;93:262267. dx.doi.org/10.1007/s00436-004-1125-5. 48. Willms K, Robert L. Ultrastructure of a spermatid transport system in the mature proglottids of experimental Taenia crassiceps (WFU strain). Parasitol Res 2007;101:967-973. dx.doi.org/10.1007/s00436-007-0570-3. 49. Willms K, Zurabian R. Taenia crassiceps: in vivo and in vitro models. Parasitology 2010;137(3):335-346. 50. Maggiore M, Elissondo MC. In vitro cestocidal activity of thymol on Mesocestoides corti Tetrathyridia and adult worms. Interdisciplinary Perspectives on Infect Dis 2014. dx.doi.org/10.1155/2014/268135. 51. Tandon V, Pal P, Roy B, Rao HSP, Reddy KS. In vitro anthelmintic activity of roottuber extract of Flemingia vestita, an indigenous plant in Shillong, India. Parasitol Res 1997;83(5):492-498.

984


Rev Mex Cienc Pecu 2021;12(3):969-986

52. Roy B, Dasgupta S, Tandon V. Ultrastructural observations on tegumental surface of Raillietina echinobothrida and its alterations caused by root-peel extract of Millettia pachycarpa. Microscopy Res Tech 2008;71(1):810-815. 53. Challam M, Roy B, Tandon V. Effect of Lysimachia ramosa (Primulaceae) on helmint parasites: Motility, mortality and scanning electron microscopic observations on surface topography. Vet Parasitol 2010;169(1-2):214-218. 54. Dasgupta S, Roy B, Tandon V. Ultrastructural alterations of the tegument of Raillietina echinobothrida with the stem bark of Acacia oxyphylla (Leguminosae). J Ethnopharmacol 2010;127(2):568-571. 55. Meaney M, Fairweather I, Brennan GP, Forbes AB. Transmission electron microscope study of the ultrastructural changes induced in the tegument and gut of Fasciola hepatica following in vivo drug treatment with clorsulon. Parasitol Res 2004;92:232-241. dx.oi.org/10.1007/s00436-003-1036-x. 56. Roy B, Tandon V. Effect of root-tuber extract of Flemingia vestita, a leguminous plant, on Artyfechinostomum sufrartyfex and Fasciolopsis buski: A scanning electron microscopy study. Parasitol Res 1996;82:248-252. dx.doi.org/10.1007/s004360050104. 57. Stepek G, Lowe AE, Buttle DJ, Duce IR, Behnke JM. In vitro anthelmintic effects of cysteine proteinases from plants against intestinal helminths of rodents. J Helminthol 2007;81(4):353-360. 58. Stepek G, Lowe AE, Buttle DJ, Duce IR, Behnke JM. In vitro and in vivo anthelmintic efficacy of plant cysteine proteinases against the rodent gastrointestinal nematode, Trichuris muris. Parasitology 2006;132(5):681-689. 59. Stepek G, Lowe AE, Buttle DJ, Duce IR, Behnke JM. The anthelmintic efficacy of plantderived cysteine proteinases against the rodent gastrointestinal nematode, Heligmosomoides polygyrus, in vivo. Parasitology 2007;134(10):1409-1419. 60. Stepek G, Curtis RHC, Kerry BR, Shewry PR, Clark SJ, Lowe AE, Duce IR, Buttel DJ, Behnke JM. Nematicidal effects of cysteine proteinases against sedentary plant parasitic nematodes. Parasitology 2007;134(12):1831-1838. 61. Chalar C, Salomé M, Señolare-Pose M, Marín M, Williams CT, Dauphin Y. A high resolution analysis of the structure and chemical composition of the calcareous corpuscles from Mesocestoides corti. Micron 2013;44:185-192. dx.doi.org/10.1016/j.micron.2012.06.008. 62. Etges FJ, Marinakis V. Formation and excretion of calcareous bodies by the metacestode (Tetrathyridium) of Mesocestoides vogae. J Parasitol 1991;77(4):595-602.

985


Rev Mex Cienc Pecu 2021;12(3):969-986

63. Vargas-Parada L, Laclette JP. Role of calcareous corpuscles in cestode physiology: A review. Rev Latinoam Microbiol 1999;41(4):303-307. 64. Khin SS, Kitazawa R, Htet K, Htike HM, Yee TT, Aung M, Haraguchi R, Kitazawa S. Intestinal inflammatory pseudotumor caused by taeniasis: Calcareous corpuscles as a diagnostic clue. Pathol Int 2013;63(3):193-194. 65. Loos JA, Caparros PA, Nicolao MC, Denegri GM, Cumino AC. Identification and pharmacological induction of autophagy in the larval stages of Echinococcus granulosus: an active catabolic process in calcareous corpuscles. Int J Parasitol 2014;44(4):415-427. 66. Yang HJ. Immunoblot findings of calcareous corpuscles binding proteins in cyst fluid of Taenia solium metacestode. Korean J Parasitol 2004;42(3):141-143. 67. Park YK, Park JH, Guk SM, Shin EH, Chai JY. A new method for concentration of proteins in the calcareous corpuscles separated from the spargana of Spirometra erinacei. Korean J Parasitol 2005;43(3):119-122. 68. Willms K, Fernández PAM, Jiménez JA, Landa A, Zurabián R, Juárez UME, Robert L. Taeniid tapeworm responses to in vitro glucose. Parasitol Res 2005;96: 296-301. dx.doi.org/10.1007/s00436-005-1348-0. 69. Araujo JM, de Araújo JV, Braga FR, Carvalho RO, Ferreira SR. Activity of the nematophagous fungi Poconia chlamydospora, Duddingtonia flagrans and Monacrosporium thaumasium on egg capsules of Dipylidium caninum. Vet Parasitol 2009;166(1-2):86-89.

986


https://doi.org/10.22319/rmcp.v12i3.5771 Nota de investigación

Definición y análisis del panel de polimorfismos de nucleótido simple a utilizar en pruebas de paternidad para tres razas de bovinos

Joel Domínguez-Viveros a* Adán Medellín-Cazares a Nelson Aguilar-Palma a Francisco Joel Jahuey-Martínez a Felipe Alonso Rodríguez-Almeida a

a

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología. Periférico Francisco R. Almada km 1. 31453, Chihuahua, Chih. México.

*Autor de correspondencia: joeldguezviveros@yahoo.com.mx; jodominguez@uach.mx

Resumen: Con el objetivo de definir el panel de polimorfismos de nucleótido simple (SNP) para pruebas de paternidad en bovinos, se analizaron los genotipos en tres razas (número de SNP evaluados e individuos muestreados): Hereford (HER; 202; 1317), Brangus (BRA; 217; 3431) y Limousin (LIM; 151; 8205). Dentro de raza, se descartó los SNP con porcentaje de individuos genotipados (PIG) menor a 90 %, con desequilibrio Hardy Weinberg (HW; P<0.05), con frecuencia de alelo menor de 0.10 o menos y con desequilibrio de ligamiento, donde la correlación entre frecuencias genotípicas fue superior a 0.25. Se estimó los niveles de heterocigosis esperada (He) y observada (Ho), contenido de información polimórfica (CIP); así como, el índice de Shannon, el índice de fijación y tamaño efectivo de población (Ne). Se calculó la probabilidad de exclusión (PEC) y de identidad combinada (PIC). El panel final fue de 121, 188 y 113 SNP en HER, BRA y LIM, respectivamente; la principal fuente de descarte fue HW seguido de PIG. Los niveles de Ho y He fueron superior a 0.40; el PIC fue mayor a 0.32 y Ne presentó estimaciones por arriba de 181.3. Los resultados para la PEC fueron superiores a 0.999999; para la PIC, estuvieron por debajo de 1 x 10-20. 987


Rev Mex Cienc Pecu 2021;12(3):987-995

Palabras clave: Heterocigosis, Probabilidad de exclusión, Probabilidad de identidad, Polimorfismo, Índice Shannon.

Recibido: 17/08/2020 Aceptado: 03/12/2020

En México, las evaluaciones genéticas (EVGE) en bovinos para carne se realizan a partir de 2001; en torno a 25 razas, dispuestas en asociaciones nacionales de criadores de ganado registro, las EVGE conjugan la información genealógica y productiva contenida en los libros de registro(1). La información genealógica, que conforma el registro genealógico de pureza de raza o grados de pureza, define las relaciones de parentesco de toda la población a través del pedigrí de cada individuo. Errores en la veracidad e integridad del pedigrí tiene efectos en la certeza de la pureza racial; en la definición de ancestros fundadores y asignación de individuos a generaciones, así como en los cálculos de los niveles de consanguinidad y parentesco(2,3,4). En las EVGE, errores en la información genealógica tiene consecuencias en la estimación de componentes de varianza y parámetros genéticos, así como en la predicción de valores genéticos y jerarquización de sementales; por consecuencia, también afecta la respuesta a la selección y progreso genético(5,6,7,8). Los marcadores genéticos (MAGE) expresan el polimorfismo del ADN, su evolución y uso han fortalecido los programas de mejoramiento genético animal(9,10,11). En bovinos, las pruebas de paternidad han evolucionado con el desarrollo de los MAGE(12); la Sociedad Internacional de Genética Animal (SIGA) inicialmente propuso un panel de 121 SNP (Polimorfismo de Nucleótido Simple) desarrollado en razas Bos taurus, posteriormente se agregaron 100 SNP derivados de razas Bos indicus(13,14). En México, las pruebas de paternidad se han implementado en las razas Brangus, Limousin y Hereford con base en el panel de SNP propuesto por la SIGA; no obstante, se requiere validar el panel de SNP a través de poblaciones, dado que la funcionalidad y veracidad de un MAGE en pruebas genéticas depende del equilibrio Hardy-Weinberg, el posible desequilibrio de ligamiento, el contenido de información polimórfica, entre otros componentes; además, en un conjunto de MAGE el poder de prueba es validado por la probabilidad de exclusión(14,15). Al respecto, se han realizado estudios validando el panel de SNP desarrollado por la SIGA a utilizar en pruebas de paternidad de bovinos en Brasil(16), Argentina(17), China(18,19), Estados Unidos(20,21), Japón(22,23) y Europa(24,25,26). Con base en lo anterior, los objetivos del presente estudio fueron validar el panel de SNP definido por la Sociedad Internacional de Genética Animal para pruebas genéticas en poblaciones de bovinos mexicanas.

988


Rev Mex Cienc Pecu 2021;12(3):987-995

Se analizaron los genotipos de SNP para bovinos: Brangus (BRA), Hereford (HER) y Limousin (LIM); en el Cuadro 1 se describe la base de datos analizada. En una primera edición se realizó un control de calidad de la base de datos; se verificó la información del individuo y de la muestra, así como conflicto mendeliano, genotipos duplicados e idénticos por estado. El panel evaluado en cada raza es un subconjunto del panel general propuesto por la SIGA; para LIM, el procesamiento de las muestras lo realizó el laboratorio Labogena con base en los SNP utilizados en Francia; para las otras razas, el proceso lo realizó el laboratorio Neogen GeneSeek con el conjunto de SNP utilizados en EU. Los análisis se desarrollaron dentro de raza en cuatro etapas. 1. Valoración del porcentaje de individuos (call rate) con genotipo identificado (PIG); estimación de las frecuencias alélicas y genotípicas, así como el análisis de equilibrio Hardy Weinberg (HW). 2. Descartando los SNP con desequilibrio HW (P< 0.05) y PIG menor a 90 %, se analizó el posible desequilibrio de ligamiento (DL) con base en la correlación (r2) entre frecuencias genotípicas a través de SNP, se estimó la heterocigosis esperada (He) y observada (Ho), el contenido de información polimórfica (CIP), el índice de Shannon (IS) y el índice de fijación (FIS). Con la r2 promedio y ajustada por el tamaño de muestra se estimó el tamaño efectivo de la población (Ne), con base en el planteamiento de Waples(27). 3. Se integró un panel de SNP por raza descartando los SNP con desequilibrio HW (p < 0.05), con frecuencia de alelo menor (FAM) igual o menor a 0.10, con DL(26) donde la r2 fue superior a 0.25 y PIG menor a 0.90 %. 4. Con el subconjunto de SNP para cada raza, se ordenaron de forma descendente por CIP y se calculó la probabilidad de exclusión (PE) en tres modalidades(28,29,30): a) con un progenitor candidato y otro conocido, para excluir al progenitor candidato [PE1 = 1 – 2*∑𝑛𝑖=1 𝑝𝑖 2 + ∑𝑛𝑖=1 𝑝𝑖 3 + 2*∑𝑛𝑖=1 𝑝𝑖 4 – 3*∑𝑛𝑖=1 𝑝𝑖 5 – 2*(∑𝑛𝑖=1 𝑝𝑖 2 )2 + 3*∑𝑛𝑖=1 𝑝𝑖 2 *∑𝑛𝑖=1 𝑝𝑖 3 ]; b) dado un progenitor candidato y la progenie, poder excluir la relación entre ellos [PE2 = 1 – 4*∑𝑛𝑖=1 𝑝𝑖 2 + 2*(∑𝑛𝑖=1 𝑝𝑖 2 )2 + 4*∑𝑛𝑖=1 𝑝𝑖 3 – 3*∑𝑛𝑖=1 𝑝𝑖 4 ]; y, c) con dos progenitores candidatos, exclusión de uno o ambos [PE3 = 1 + 4*∑𝑛𝑖=1 𝑝𝑖 4 - 4∑𝑛𝑖=1 𝑝𝑖 5 – 3*∑𝑛𝑖=1 𝑝𝑖 6 – 8*(∑𝑛𝑖=1 𝑝𝑖 2)2 + 8*(∑𝑛𝑖=1 𝑝𝑖 2 )*( ∑𝑛𝑖=1 𝑝𝑖 3) + 2*(∑𝑛𝑖=1 𝑝𝑖 3)2. La probabilidad de exclusión combinada para cada situación fue (PEC = 1 - (1 – PEi). Además, se estimaron dos probabilidades de identidad (PI)(31): la probabilidad de identidad de dos individuos tomados al azar, presenten genotipos idénticos [PI1 = ∑𝑛𝑖=1 𝑝𝑖 4 + ∑𝑛𝑖=1 ∑𝑛𝑖=1(2𝑝𝑖𝑝𝑗)2 ]; y, la probabilidad de identidad para dos hermanos completos, tomados al azar, presenten genotipos idénticos [PI2 = 0.25 + (0.5*∑𝑛𝑖=1 𝑝𝑖 2) + (0.5*(∑𝑛𝑖=1 𝑝𝑖 2 )2) – (0.25*∑𝑛𝑖=1 𝑝𝑖 4 )]. La probabilidad de identidad combinada (PIC) para cada situación, se calculó con el producto de las probabilidades de identidad de cada marcador. Los análisis se realizaron con los programas FSTAT(32), LDNE(33) y GenAlex(34).

989


Rev Mex Cienc Pecu 2021;12(3):987-995

En el Cuadro 1 se resume el proceso de selección y descarte de SNP a través de raza, así como la estructura del panel final. El total de SNP retirados por raza, como porcentaje del total evaluados, fluctuó de 13.4 % (BRA) a 40.0 % (HER), donde la principal causa de descarte fue el desequilibrio HW (P<0.05). En el proceso de descarte de SNP no se observó una tendencia o asociación entre marcadores, el conjunto de SNP separado a través de razas fue diferente. El número final de SNP por raza fluctuó de 113 (LIM) a 188 (BRA), los cuales están dentro de los lineamientos de la SIGA(13), la cual estipula que el panel por raza debe estar conformado por al menos 100 SNP. Cuadro 1: Definición del panel de SNP por raza con base en los criterios de descarte Raza Herford Brangus Limousin

N

SNPn

PIG

HW

FAM

DL

SNPf

1,317 3,431 8,205

202 217 151

41 2 9

30 19 28

8 2 1

2 6 0

121 188 113

N= número de individuos muestreados. SNPn= número de SNP evaluados. PIG= número de SNP retirados por porcentaje de individuos con genotipos identificados menor a 90%. HW= número de SNP descartados por presentar desequilibrio Hardy Weinberg (P<0.05). FAM= número de SNP separados por frecuencia de alelo menor, menor a 0.10. DL= número de SNP descartados por desequilibrio de ligamiento, dado que la correlación entre frecuencias fue superior a 0.25. SNPf= total de SNP que conforman el panel por raza.

En el Cuadro 2, se presentan los resultados para Ho, He, CIP, FIS y Ne. No se observan diferencias entre Ho y He, lo cual refleja que el conjunto de SNP seleccionado está en equilibrio HW. Para el IS, los resultados en las tres poblaciones fueron por debajo de la unidad, lo cual se puede asociar con homogeneidad en las poblaciones y se reduce la incertidumbre para predecir la probabilidad de asignación de un individuo a la población que pertenecerá. Para el FIS, todos los resultados tienden a cero, señalando una estabilidad en la relación de homocigotos y heterocigotos. Con las estimaciones del Ne, en el marco del equilibrio HW los incrementos esperados de consanguinidad (ΔF = 1 / 2Ne) por generación van del 0.08 al 0.27 %. Los niveles de He, Ho y CIP determinan si un marcador genético es o no informativo y su potencial de uso en estudios de variabilidad genética; no obstante, la jerarquización u ordenamiento de los SNP por la capacidad de uso puede ser diferente a través de poblaciones. Cuadro 2: Indicadores de variabilidad genética (valores promedio) con base en el panel de SNP seleccionado para cada raza Raza

Ho

He

CIP

IS

FIS

Ne

Herford Brangus Limousin

0.416 0.433 0.451

0.419 0.434 0.452

0.328 0.337 0.348

0.607 0.623 0.643

0.008 0.002 0.004

181.3 246.9 629.8

Heterocigosis observada (Ho) y esperada (He). CIP= contenido de información polimórfica. IS= Índice Shannon. FIS= índice de fijación. Ne= tamaño efectivo.

990


Rev Mex Cienc Pecu 2021;12(3):987-995

Con el total de SNP seleccionado en cada raza, los resultados para la PEC en las tres modalidades fueron superiores a 0.999999; para la PIC, estuvieron por debajo de 1 x 10-39 y 1 x 10-20 en PI1 y PI2, respectivamente. En el Cuadro 3 se describen los resultados para las formas alternas de PEC y PIC, parcialmente alcanzados con 50 SNP. Dado la estructura genética de las poblaciones y las fuerzas que inciden sobre la genética de poblaciones, la conformación y arreglo de un panel de SNP para verificar paternidad en bovinos puede tener diversas dimensiones y valores de probabilidad: Heaton et al(20) con un panel de 32 SNP a través de 17 razas, publicaron PEC superior a 0.994 y PIC de 1.9 x 10-13; Van Eenennaam et al(21) con 28 SNP, FAM superior a 0.40 en hatos comerciales, obtuvieron PEC de 0.956; Hara et al(29) con 29 SNP para una raza nativa de Japón reportaron PIC de 2.73 x 10-12 y PEC de 0.96929 a 0.99693. En otros estudios afines, Werner et al(24) publicaron PEC superior a 0.9999 y PIC de 1 x 10-13 con 37 SNP. Fernández et al(17) en Angus con un arreglo de 116 SNP, reportaron probabilidades de no exclusión combinada (PNEC = 1 – PEC) en el intervalo de 2.1 x 10-4 a 1.4 x 10-9, así como PIC de 4.1 x 10-15. Panetto et al(16) para la raza Sindhi de Brasil, con 71 SNP donde la FAM fue superior a 0.35, publicaron PNEC de 1 x 10-8. Zhang et al(18) en ganado Simmental con 50 SNP y FAM superior a 0.40, reportaron PEC superior a 0.9989; Hu et al(19) en bovinos cruzados de China, con 50 SNP donde el valor promedio de la FAM fue de 0.43, obtuvieron PEC de 0.99797 a 0.999999. Cuadro 3: Valores de probabilidad de exclusión y de identidad, obtenidos con 50 SNP dentro del panel total seleccionado por raza Raza

PEC1

PEC2

PEC3

SNPi

PIC1

PIC2

Hereford Brangus Limousin

0.99996 0.99996 0.99996

0.99831 0.99861 0.99849

0.99999 0.99999 0.99999

113 91 97

1.0E-21 6.2E-22 7.7E-22

8.2E-12 5.7E-12 6.6E-12

PEC1= probabilidad de exclusión combinada, con un progenitor candidato y otro conocido. PEC2= probabilidad de exclusión combinada, dado un progenitor candidato y la progenie. PEC3= probabilidad de exclusión combinada con dos progenitores candidatos. PIC1= probabilidad de identidad combinada para dos individuos tomados al azar. PIC2= probabilidad de identidad combinada, para dos hermanos completos tomados al azar. SNPi= número de SNP requeridos para obtener un valor superior a 0.999999 en las probabilidades de exclusión.

Para bovinos Brangus, Hereford y Limousin el número de SNP que conforma el panel para pruebas de paternidad fue superior a 100; seleccionados con base en los criterios asociados a variabilidad genética y estructura de la población, con valores de probabilidad de exclusión superior a 0.999999 y probabilidad de identidad por debajo a 6.6 x 10-12.

991


Rev Mex Cienc Pecu 2021;12(3):987-995

Agradecimientos

Se agradece a la asociación Nacional de Criadores de Bovinos Brangus y Limousin; así como a la Hereford Mexicana, por proporcionar la base de datos del presente estudio. Se agradece al Consejo Nacional de Ciencia y Tecnología por la beca para estudios de posgrado proporcionada. Todos los autores declaran que no existe conflicto de interés alguno. Literatura citada: 1.

CONARGEN. Guía técnica de programas de control de producción y mejoramiento genético en bovinos. Consejo Nacional de los Recursos Genéticos Pecuarios. México. 2010.

2.

Banos G, Wiggans GR, Powell RL. Impact of paternity errors in cow’s identification on genetic evaluations and international comparisons. J Dairy Sci 2001;84:2523-2529.

3.

Atkin FC, Dieters MJ, Stringer JK. Impact of depth of pedigree and inclusion of historical data on the estimation of additive variance and breeding values in a sugarcane breeding program. Theo Appl Gen 2009;119:555-565.

4.

Ramírez-Valverde R, Delgadillo-Zapata AR, Domínguez-Viveros J, Hidalgo-Moreno JA, Núñez-Domínguez R, Rodríguez-Almeida FA, et al. Análisis del pedigrí en la determinación de la diversidad genética de poblaciones bovinas para carne mexicana. Rev Mex Cienc Pecu 2018;9:614-635.

5.

Visscher PM, Woolliams JA, Smith D, Williams JL. Estimation of pedigree errors in the UK dairy population using microsatellite markers and the impact on selection. J Dairy Sci 2002;85:2368-2375.

6.

Sanders K, Bennewitz J, Kalm E. Wrong and missing sire information affects genetic gain in the Angeln dairy cattle population. J Dairy Sci 2006;89:315-321.

7.

Parlato E, Van Vleck LD. Effect of parentage misidentification on estimates of genetic parameters for milk yield in the Mediterranean Italian buffalo population. J Dairy Sci 2012;95:4059-4064.

8.

Raoul J, Palhiere I, Astruc JM, Elsen JM. Genetic and economic effects of the increase in female paternal filiations by parentage assignment in sheep and goat breeding programs. J Anim Sci 2016;94:3663–3683.

992


Rev Mex Cienc Pecu 2021;12(3):987-995

9.

Vignal A, Milan D, SanCristobal M, Eggen A. A review on SNP and other types of molecular markers and their use in animal genetics. Genet Sel Evol 2002;34:275-305.

10. Cañón J. Using molecular information in animal improvement programs. Rev Corpoica 2006;7:5-15. 11. Dekkers, JCM. Application of genomics tools to animal breeding. Current Genomics 2012;13:207-212. 12. Flanagan SP, Jones AG. The future of parentage analysis: from microsatellites to SNPs and beyond. Mol Ecol 2019;28:544-567. 13. Morrin R, Boscher M. Cattle molecular markers and parentage testing workshop. ISAG Conference 2012;1-7. 14. Strucken EM, Lee SH, Lee HK, Song KD, Gibson JP, Gondro C. How many markers are enough? Factors influencing parentage testing in different livestock populations. J Anim Breed Genet 2016;133:13-23. 15. Baruch E, Weller J. Estimation of the number of SNP genetic markers required for parentage verification. Anim Genet 2008;39:474-479. 16. Panetto JCD, Machado MA, da Silva MVG, Barbosa RS, dos Santos GG, Leite RMHR, Peixoto MGC. Parentage assignment using SNP markers, inbreeding and population size for the Brazilian Red Sindhi cattle. Livest Sci 2017;204:33-38. 17. Fernández ME, Goszczynski DE, Liron JP, Villegas-Castagnasso EE, Cariño MH, Ripoli MV, et al. Comparison of the effectiveness of microsatellites and SNP panels for genetic identification, traceability, and assessment parentage in an inbred Angus herd. Genet Mol Biol 2013;36:185-191. 18. Zhang T, Guo L, Shi M, Xu L, Chen Y, Zhang L, Gao H, Li J, Gao X. Selection and effectiveness of informative SNPs for paternity in Chinese Simmental cattle based on a high-density SNP array. Gene 2018;673:211-216. 19. Hu L, Li D, Chu Q, Wang Y, Zhou L, Yu Y, Zhang Y, et al. Selection and implementation of SNP markers for parentage analysis in a Chinese crossbred cattle population. Res Square 2020;e30446/v1. 20. Heaton MP, Harhay GP, Bennett GL, Stone RT, Grosse WM, Casas E, et al. Selection and use of SNP markers for animal identification and paternity analysis in U.S. beef cattle. Mamm Gen 2002;13:272-281.

993


Rev Mex Cienc Pecu 2021;12(3):987-995

21. Van Eenennaam AL, Weaber RL, Draker DJ, Penedo MCT, Quaas RL, Garrick DJ, Pollak EJ. DNA-based paternity analysis and genetic evaluation in a large commercial cattle ranch setting. J Anim Sci 2007;85:3159-3169. 22. Honda T, Katsuta T, Mukai F. Simulation study on parentage analysis with SNPs in the Japanese cattle population. Asian-Aust J Anim Sci 2009;10:1351-1358. 23. Strucken EM, Gudex B, Ferdosi MH, Lee HK, Song KD, Gibson JP, et al. Performance of different SNP panels for parentage testing in two East Asian cattle breeds. Anim Genet 2014;45:572-575. 24. Werner FAO, Durstewitz G, Habemann FA, Thaller G, Kramer W, Kollers S, et al. Detection, and characterization of SNP useful for identity control and parentage testing in major European dairy breeds. Anim Genet 2004;35:44-49. 25. Negrini R, Nicoloso L, Crepaldi P, Milanesi E, Colli L, Chegdani F, et al. Assessing SNP markers for assigning individuals to cattle populations. Anim Genet 2009;40:1826. 26. Allen AR, Taylor M, McKeown B, Curry AI, Lavery JF, Mitchell A, et al. Compilation of a panel of informative single nucleotide polymorphisms for bovine identification in the Northern Iris cattle population. BMC Genet 2010;11:Art 5. 27. Waples RS. A bias correction for estimate of effective population size base on linkage disequilibrium at unlinked loci. Conserv Genet 2006;7:167-184. 28. Jamieson A, Taylor SC. Comparisons of three probability formulae for parentage exclusion. Anim Genet 1997;28:397-400. 29. Hara K, Watabe H, Sasazaki S, Mukai F, Mannen H. Development of SNP markers for individual identification and parentage test in Japanese black cattle population. Anim Sci J 2010;81:152-157. 30. Olenski K, Kaminski S, Tokarska M, Hering DM. Subset of SNPs for parental identification in European bison Lowland-Bialowieza line (Bison bonasus bonasus). Conserv Genet Res 2018;10:73-78. 31. Waits L, Luikart G, Taberlet P. Estimating the probability of identity among genotypes in natural populations cautions and guidelines. Mol Ecol 2001;10:249-256. 32. Goudet J. FSTAT: A computer program to calculate F-Statistics. J Heredity 1995;86:485-486.

994


Rev Mex Cienc Pecu 2021;12(3):987-995

33. Waples RS, Do Chi. LDNE: a program for estimating effective population size from data on linkage disequilibrium. Mol Ecol 2008;8:753-756. 34. Peakall R, Smouse PE. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research – an update. Bioinformatics 2012;28:2537-2539.

995


Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 3, pp. 665-995, JULIO-SEPTIEMBRE-2021

ISSN: 2448-6698

Pags. Diversidad genética y factores de virulencia de cepas de Staphylococcus aureus aisladas de la piel de ubre bovina

Genetic diversity and virulence factors of Staphylococcus aureus strains isolated from bovine udder skin Roberto Adame-Gómez, Jeiry Toribio-Jimenez, Na vidad Castro-Alarcón, Karina Talavera-Alarcón, Jacqueline Flores-Gavilan, Sandra-Alheli Pineda-Rodríguez, Arturo Ramírez-Peralta ………………….….…665

Molecular prediction of serotypes of Streptococcus suis isolated from pig’s farms in Mexico

Predicción molecular de serotipos de Streptococcus suis aislados de granjas porcinas en México Arianna Romero Flores, Marcelo Go schalk, Gabriela Bárcenas Morales, Víctor Quintero Ramírez, Rosario Esperanza Galván Pérez, Rosalba Carreón Nápoles, Ricardo Ramírez R., José Iván Sánchez Betancourt, Abel Ciprián Carrasco, Susana Mendoza Elvira ….…………………........………...…...………………..681

La coexistencia de Desmodus rotundus con la población humana en San Luis Potosí, México

The coexistence of Desmodus rotundus with the human population in San Luis Potosí, Mexico Ximena Torres-Mejía, Juan José Pérez-Rivero, Luis Alberto Olvera-Vargas, Evaristo Álvaro Barragán-Hernández, José Juan Mar nez-Maya, Álvaro Aguilar-Se én…………….....……..……..….....……..…………….694

Detection of Pasteurella multocida, Mannhemia haemolytica, Histophilus somni and Mycoplasma bovis in cattle lung

Detección de Pasteurella multocida, Mannhemia haemolytica, Histophilus somni y Mycoplasma bovis en pulmón de bovinos Seyda Cengiz, M. Cemal Adıgüzel, Gökçen Dinç..........……..…….....……...……..…….....…...……..…….....…...……..…….....…...……..…….....…...……..…………………….....…...……….....…….....…….....…….....…..…….......………710

Treating horse chronic laminitis with allogeneic bone marrow mesenchymal stem cells

Tratamiento de la laminitis crónica en equinos utilizando células troncales mesenquimales alogénicas de la médula ósea Alma A García-Lascuráin, Gabriela Aranda-Contreras, Margarita Gómez-Chavarín, Ricardo Gómez, Adriana Méndez-Bernal, Gabriel Gu érrez-Ospina, María Masri ......…………..…………..………………….…..721

Composición nutricional de la carne equina y grado de sustitución de la carne bovina por equina en expendios de la Ciudad de México

Nutritional composition of equine meat and degree of substitution of bovine for equine meat in stores in Mexico City Guillermo Reséndiz González, Baldomero Alarcón Zúñiga, Itzel Villegas Velázquez, Samuel Albores Moreno, Gilberto Aranda Osorio ……..………………………………………………………........…………………...………..742

Supplementation with Agave fourcroydes powder on growth performance, carcass traits, organ weights, gut morphometry, and blood biochemistry in broiler rabbits

Suplementación con polvo de Agave fourcroydes en el crecimiento, características de la canal, peso de los órganos, morfometría intestinal y bioquímica sanguínea en conejos de engorda Yordan Mar nez, Maidelys Iser, Manuel Valdivié, Jorge Galindo, David Sánchez……………………………………………………....……………………………………………………………………………………………………...…….…….….......756

Evaluación de los componentes del manejo antes, durante y después de la matanza y su asociación con la presencia de carne DFD en bovinos del noreste de México

Evaluation of the components of management before, during and after slaughter and their association with the presence of DFD beef in cattle from northeastern Mexico Gabriela Palomares Resendiz, Francisco Aguilar Romero, Carlos Flores Pérez, Luis Gómez Núñez, Jorge Loredo Os , Eduardo Sánchez López, Alberto Barreras Serrano, Fernando Figueroa Saavedra, Cris na Pérez Linares, Miguel Ruiz Albarrán …………………..……..………………………………………......………..773

In vitro methane production and fermentative parameters of wild sunflower and elephant grass silage mixtures, either inoculated or not with epiphytic lactic acid bacteria strains

Producción de metano in vitro y parámetros fermentativos de mezclas de ensilado de girasol silvestre y pasto elefante, inoculadas o no con cepas de bacterias ácido-lácticas epífitas Vilma Amparo-Holguín, Mario Cuchillo-Hilario, Johanna Mazabel, Steven Quintero, Siriwan Martens, Jairo Mora-Delgado ……………………………………………..…….....…….....…….....…….....….…………..…………..789

Fases de desarrollo y propagación de ecotipos destacados de Tithonia diversifolia (Hemsl.) A. Gray

Phases of development and propagation of outstanding ecotypes of Tithonia diversifolia (Hemsl.) A. Gray Phases of development and propaga on of outstanding ecotypes of Tithonia diversifolia (Hemsl.) A. Gray……..……..……..……..……..……..……..……..……………………………..……………………………………….…………...811

Structure of forage sward with Urochloa brizantha cultivars under shading

Estructura del pasto forrajero con cultivares de Urochloa brizantha bajo sombra Estella Rosseto Janusckiewicz, Luísa Melville Paiva, Henrique Jorge Fernandes, Alex Coene Fleitas, Patricia dos Santos Gomes …………………………………………………………………....……….....…….....…….....……...828

Características de la producción de leche en La Frailesca, Chiapas, México

Characteristics of milk production in La Frailesca, Chiapas, Mexico Joaquín Huitzilihuitl Camacho-Vera, Juan Manuel Vargas-Canales, Le cia Quintero-Salazar, Gregorio Wenceslao Apan-Salcedo …………..………………....…………………..…………..…………..…………..…………..…..…845

Análisis de la demanda de bovinos carne en pie en los centros de sacrificio de México, 2000-2018

Analysis of the demand for live beef cattle in slaughter centers in Mexico, 2000-2018 Nicolás Callejas Juárez, Samuel Rebollar Rebollar ……………………………………..………………....…………………..…………..…………..…………..……………….....…….....…….....…….....…….....…….....…….....…….....……....…………..861

Effect of two phantom parent grouping strategies on the genetic evaluation of growth traits in Mexican Braunvieh cattle

Efecto de dos estrategias de agrupación de padres fantasmas en la evaluación genética de rasgos de crecimiento en el ganado Braunvieh mexicano Luis Antonio Saavedra-Jiménez, Rodolfo Ramírez-Valverde, Rafael Núñez-Domínguez, Agus n Ruíz-Flores, José Guadalupe García-Muñiz, Mohammad Ali Nilforooshan …..…………..…………..…………..…..878

Evaluación mineral de los componentes del sistema silvopastoril intensivo con Leucaena leucocephala en tres épocas del año

Mineral evaluation of the components of the intensive silvopastoral system with Leucaena leucocephala in three seasons of the year Andrés Camilo Rodríguez-Serrano, Alejandro Lara-Bueno, José Guadalupe García-Muñiz, Maximino Huerta-Bravo, Citlalli Celeste González-Aricega …..…………..…………..………….…….....……..........…………..893

Termorregulación y respuestas reproductivas de carneros bajo estrés por calor. Revisión

Thermoregulation and reproductive responses of rams under heat stress. Review Alejandra Barragán Sierra, Leonel Avendaño-Reyes, Juan A. Hernández Rivera, Ricardo Vicente-Pérez, Abelardo Correa-Calderón, Miguel Mellado, Cesar A. Meza-Herrera, Ulises Macías-Cruz ……..……910

Evaluación de las condiciones predisponentes a enfermedades en granjas porcinas a pequeña escala en un ambiente urbano en el noroeste de la Ciudad de México

Evaluation of disease-predisposing conditions in small-scale swine farms in an urban environment in northwestern Mexico City Roberto Mar nez Gamba, Gerardo Ramírez Hernández ……………………………………..………………....…………………..…………..…………..…………..…………..……………….....…….....…….....…….....…….....…….....…….....……..932

Determinación de aflatoxinas en especias, ingredientes y mezclas de especias usados en la formulación de productos cárnicos comercializados en la Ciudad de México

Determination of aflatoxins in spices, ingredients and spice mixtures used in the formulation of meat products marketed in Mexico City Montserrat Lizeth Ríos Barragán, José Fernando González Sánchez, Rey Gu érrez Tolen no, Arturo Camilo Escobar Medina, José Jesús Pérez González, Salvador Vega y León………………..……………….…..944

Efecto de la altura de corte de sorgo a la cosecha sobre el rendimiento de forraje y el valor nutritivo del ensilaje

Effect of the cutting height of sorghum at harvest on forage yield and nutritional value of silage Jorge A. Granados-Niño, David G. Reta-Sánchez, Omar I. Santana, Arturo Reyes-González, Esmeralda Ochoa-Mar nez, Fernando Díaz, Juan I. Sánchez-Duarte……....…………………………………………………….958

The effects of Pyrantel-Oxantel on the Dipylidium caninum tapeworm: An in vitro study

Efecto del Pyrantel-Oxantel en la tenia Dipylidium caninum: estudio in vitro Jair Millán-Orozco, Jersson Millán-Orozco, Miguel Ángel Betancourt-Alonso, América Ive e Barrera-Molina, María Soledad Valledor, Virginia Méndez, Alejandra Larrea, Mar n Sebas án Lima, Javier Morán-Mar nez, Nadia Denys Betancourt-Mar nez, Liliana Aguilar-Marcelino …… …..…………...………..…………..969

Definición y análisis del panel de polimorfismos de nucleótido simple a utilizar en pruebas de paternidad para tres razas de bovinos

Definition and analysis of the panel of SNPs to be used in paternity tests for three breeds of cattle Joel Domínguez-Viveros, Adán Medellín-Cazares, Nelson Aguilar-Palma, Francisco Joel Jahuey-Mar nez, Felipe Alonso Rodríguez-Almeida ..…………..…………..…………………………………………………..…………..987

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 3, pp. 665-995, JULIO-SEPTIEMBRE-2021

CONTENIDO CONTENTS

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 3, pp. 665-995, JULIO-SEPTIEMBRE-2021


Millions discover their favorite reads on issuu every month.

Give your content the digital home it deserves. Get it to any device in seconds.