Page 1

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm 2, pp. 318-664, ABRIL-JUNIO-2021

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 2, pp. 318-664, ABRIL-JUNIO-2021


REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 12 Número 2, Abril Junio 2021. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 04-2021-051209561700-203. ISSN: 2428-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en junio de 2021. Queso criollo en hoja de luna, elaborado para venta en el mercado municipal de Molango, Hidalgo. Fotografía: Griselda Monroy Neria

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, Dr. Alfonso Juventino Chay Canul, Universidad Autónoma de Tabasco, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Maurcio A. Elzo, Universidad de Florida Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, Universidad Autónoma del Estado de Hidalgo, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. José Juan Hernández Ledezma, Consultor privado Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

I


REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

total por publicar es de $ 7,280.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 425.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II


In memoriam El

Dr. Pino fue fundador y director del Centro

Nacional de Investigaciones Pecuarias (CNIP) de México, como parte de los trabajos de la Oficina de Estudios Especiales de la Fundación Rockefeller y la Secretaría de Agricultura y Ganadería. El Dr. Pino desempeñó

un

papel

fundamental

para

la

organización de la investigación pecuaria en el país, con

el

establecimiento

de

programas

de

otorgamiento de becas para realizar estudios de John Anthony Pino (26 de enero de 1926 – 5 de abril de 2021)

posgrado

en

el

extranjero

para

jóvenes

investigadores (antes de la existencia de CONACYT), desarrolló de una red de campos experimentales en

el país y modernos laboratorios especializados. Su labor incluyó el desarrollo de investigación en diversas áreas del diagnóstico y prevención de enfermedades de los animales y en especialidades zootécnicas para la intensificación racional de los sistemas de producción animal Un hecho que amerita una especial mención es la visión que tuvo sobre la importancia de documentar los trabajos de investigación que se realizaban; para lo cual, fundó en 1963 la revista periódica, con arbitraje por pares, que denominada Técnica Pecuaria en México, la cual lleva más de medio siglo de publicarse de manera ininterrumpida hasta la fecha, ahora con el nombre de Revista Mexicana de Ciencias Pecuarias, que es la revista científica más antigua del sector y una de las revistas científicas más longevas del sector agropecuario, y de muchos otros campos de especialidad en el país. El Dr. Pino fue uno de ocho hijos de una pareja de inmigrantes a los Estados Unidos y el único de ellos que realizó estudios universitarios: obtuvo la licenciatura en agricultura y posterior a la II Guerra Mundial, donde participó como capitán de infantería, obtuvo el doctorado en zoología en la Universidad de Rutgers en 1951, institución donde prestó sus servicios como académico hasta 1955, cuando fue contratado por la Fundación Rockefeller, institución donde desempeñó una brillante carrera, incluida su labor en México, que le mereció el cargo de Director de Ciencias Agropecuarias en 1970.

III


En su larga y brillante trayectoria el Dr. Pino cumplió diversas tareas, destacándose algunas de ellas las siguentes: Inter-American Development Bank: 1983-1986, Agricultural Division. National Academy of Sciences: 1986-1990. Winrock International: 1990-1995; Trinational Animal Health Research Project:1995-1996. National Academy of Sciences, Committee on Animal Health, 1968-1972, and 1974-1977; Agricultural Board, 1971-1973. Board on Agriculture and Renewable Resources, 1973-1977 and vice chair, 1983-1989; National Research Council, Board on Agriculture 1985-1990. Board of Trustees, International Foundation for Science, 1987-1991. Board of Directors, GRCS-Diversity Magazine, 1992-1996. Independent Consultant, 1990-2000, work related to agricultural research organizations, the conservation and utilization of genetic resources, rural development and ecosystems. United States Presidential Agricultural Task Force to Peru, 1982. USAID Project Design Team, Indian National Bureau for Plant Genetic Resources; Review of Foundation for Agricultural Development, Dominican Republic. Appropriate Technology Institute, Development of Rural Microenterprises Providing Services to Agricultural Production in the Puebla Region of Mexico. Member of American Association for the Advancement of Science. Co-editor, volume on Immunity to Blood Parasites of Animals and Man, Plenum Press, 1977. Autor y co-autor de numerosos artículos y conferencias. El destacado fundador de nuestra revista formó una bella familia con su esposa Edith Norman Pino (difunta), con quien procreó cuatro hijos: Susanne Eugenia (difunta), John (difunto), Eugene David y Thomas Michael y tienen ocho nietos y doce bisnietos. Que descanse en paz el Dr. John Anthony Pino, que dejó una profunda huella en el desarrollo científico agropecuario de nuestro país, y ganó el reconocimiento como un extraordinario ser humano entre quienes tuvieron la suerte de conocerlo y trabajar con él.

IV


REVISTA MEXICANA DE CIENCIAS PECUARIAS

REV. MEX. CIENC. PECU.

VOL. 12 No. 2

ABRIL-JUNIO-2021

CONTENIDO CONTENTS

ARTÍCULOS Articles

Pág. Efecto de la pasteurización en la concentración de diclorodifeniltricloroetano (DDT) y hexaclorociclohexano (HCH) en leche de bovino Effect of pasteurization on the concentration of dichlorodiphenyltrichloroethane (DDT) and hexachlorocyclohexane (HCH) in bovine milk Violeta Trinidad Pardío Sedas, Karla María López Hernández, Argel Flores Primo, Roxana Uscanga Sero………………………………………………………………………………………………………………………………….318 Physicochemical composition, yield and sensory acceptance of Coalho cheese obtained from Zebu’s cow milk Composición fisicoquímica, rendimiento y aceptación sensorial del queso fresco Coalho obtenido a partir de leche de vaca cebú Ingrid Laíse Silvestre de Oliveira, Adriano Henrique do Nascimento Rangel, Rodrigo Coutinho Madruga, Dorgival Morais de Lima Júnior, Rhaabe Dayane da Silva Gomes, Danielle Cavalcanti Sales, Juliana Paula Felipe de Oliveira, Joadilza da Silva Bezerra …………………………………………….337 Traditional ranchero Jarocho cheese: a multidisciplinary study from a typicity approach El queso tradicional ranchero Jarocho: un estudio multidisciplinario aplicando un enfoque de la tipicidad José Manuel Juárez-Barrientos, Pablo Díaz-Rivera, Emmanuel de Jesús Ramírez-Rivera, Jesús Rodríguez-Miranda, Cecilia Eugenia Martínez-Sánchez, Roselis Carmona-García, Erasmo HermanLara……………………………………………………………………………………………………………………………….…353 Efecto de alimentación húmeda de cerdos en finalización sobre el comportamiento productivo, composición de la canal y calidad de la carne Effect of wet feeding of finishing pigs on production performance, carcass composition and meat quality Néstor Arce Vázquez, Hugo Bernal Barragán, Nydia Corina Vásquez Aguilar, Estela Garza Brenner, Fernando Sánchez Dávila, Adriana Morales Trejo, Miguel Cervantes Ramírez……………………………370

V


Sperm subpopulations and quality in fractions obtained after single layer centrifugation in fresh normospermic ram samples Subpoblaciones espermáticas y calidad en fracciones obtenidas tras la centrifugación de una sola capa en muestras frescas de carnero normospérmico Carlos Carmelo Pérez-Marín, Ander Arando, Francisco Maroto-Molina, Alberto Marín, Juan Vicente Delgado………………………………………………………………………………………………………………………….…386 Cowpea [Vigna unguiculata (L.) Walp] herbage yield and nutritional quality in cowpeasorghum mixed strip intercropping systems Rendimiento de la planta de frijol caupí [Vigna unguiculata (L.) Walp] y calidad nutricional en los sistemas de cultivo intercalado de frijol caupí y sorgo Muhammad Aamir Iqbal, Asif Iqbal, Zahoor Ahmad, Ali Raza, Junaid Rahim, Muhammad Imran, Umer Ayyaz Aslam Sheikh, Qaiser Maqsood, Walid Soufan, Nesma M.A. Sahloul, Sobhy Sorour, Ayman El Sabagh……………………………………………………………………………………………………………….402 Prevalencia del virus de la leucosis bovina en búfalos de agua en la región centro occidental de Colombia Prevalence of bovine leukosis virus in water buffaloes in West-central Colombia Juan Carlos Rincón Flórez, Edgar Antonio Peláez Peláez, Nathaly Trejos Marín, Juan Carlos Echeverry López, Juan Carlos González Corrales……………………………………………………………………419 Efecto del modelo y material de construcción de la caja y recubrimiento de los panales de cría en la termorregulación y desarrollo de colonias de Scaptotrigona mexicana Effect of model and construction material of the brood box and brood comb coating on the thermoregulation and development of Scaptotrigona mexicana colonies Juan Antonio Pérez-Sato, Hugo Rodolfo Salazar-Vargas, Juan Valente Hidalgo-Contreras, Natalia Real-Luna, Héctor Debernardi-De La Vequia, Roberto De La Rosa-Santamaría………………………….437 Análisis de la rentabilidad apícola por estratos en Aguascalientes, México Analysis of beekeeping profitability by strata in Aguascalientes, Mexico José Inés Zavala Beltrán, Marco Andrés López Santiago, Ramón Valdivia Alcalá, Blanca Margarita Montiel Batalla…………………………………………………………………………………………………………………...453 Tipología y caracterización de cunicultores en los Estados del centro de México Type and characterization of rabbit farmers in Mexico's central states Alejandra Vélez Izquierdo, José Antonio Espinosa García, Francisco Aguilar Romero…………………469 Intracellular survival of Mycobacterium bovis strains with high and low frequency in cattle populations in a bovine macrophage model Supervivencia intracelular de cepas de Mycobacterium bovis de alta y baja frecuencia probado en un modelo de macrófagos bovinos Alejandro Nava-Vargas, Feliciano Milián-Suazo, Germinal Jorge Cantó-Alarcón, José A. GutiérrezPabello………………………………………………………………………………………………………………………………487

VI


Genealogía y trayectoria artesanal del queso criollo en hoja de luna de Hidalgo, México Genealogy and artisanal trajectory of the criollo cheese in cocoyam leaf of Hidalgo, Mexico Fernando Cervantes Escoto, María Isabel Palacios Rangel, Griselda Monroy Neria, Alfredo Cesín Vargas, Abraham Villegas de Gante………………………………………………………………………………………503 REVISIONES DE LITERATURA Reviews

Índices de eficiencia alimenticia en ovinos de pelo: calidad de la carne y genes asociados. Revisión Feed efficiency indexes in hair sheep: meat quality and associated genes. Review Carlos Arce-Recinos, Alfonso Juventino Chay-Canul, Baldomero Alarcón-Zúñiga, Jesús Alberto Ramos-Juárez, Luis Manuel Vargas-Villamil, Emilio Manuel Aranda-Ibáñez, Nathaly del Carmen Sánchez-Villegas, Ricardo Lopes Dias da Costa………………………………………………………………………523 Bioelectrical impedance analysis (BIA) in animal production. Review Análisis de impedancia bioeléctrica (AIB) en la producción animal. Revisión Larissa Luísa Schumacher, Julio Viégas, Gilmar dos Santos Cardoso, Anderson Bertoluzzi Moro, Tiago João Tonin, Stela Naetzold Pereira, Leonardo Tombesi da Rocha, Ana Luiza Van Caeneghen, Janaína Vargas Teixeira………………………………………………………………………………………………………553 NOTAS DE INVESTIGACIÓN Technical notes

Chemical and biological additives in high moisture triticale silages: Nutritional value and ingestive behavior in sheep Ensilajes de triticale de alta humedad con aditivos químicos y biológicos: valores nutrimentales y comportamiento de ingesta en ovinos Valter H. Bumbieris-Junior, Egon H. Horst, Murilo D. Paranzini, Odimári P. P. Calixto, Edson L. A. Ribeiro, Leandro D. F. Silva, Ivone Y. Mizubuti, Clóves C. Jobim, Mikael Neumann……………………573 Suplementación de ácidos grasos poliinsaturados en el empadre de ovejas nulíparas Katahdin: eficiencia reproductiva y crecimiento pre-destete de las crías Polyunsaturated fatty acid supplementation during breeding in nulliparous Katahdin ewes: reproductive efficiency and pre-weaning growth in lambs Ricardo Vicente-Pérez, Ulises Macías-Cruz, Leonel Avendaño-Reyes, Enrique O. García-Flores, Ricardo Martínez-Martínez, Oziel D. Montañez-Valdez, José A. Reyes-Gutiérrez, Alfonso J. ChayCanul, María M. Crosby-Galván………………………………………………………………………………………….…586 Presencia de aflatoxina B1 en alimentos para cabras en unidades de producción de leche caprina del altiplano mexicano Presence of aflatoxin B1 in goat feed in goat milk production units of the Mexican Highlands José Jesús Pérez González, Salvador Vega y León, Rey Gutiérrez Tolentino, Beatriz Sofia Schettino Bermúdez, Fátima Itzel Martínez Solis, Arturo Camilo Escobar Medina…………………………………..…598

VII


Predicción de la calidad fermentativa de ensilados de girasol mediante espectroscopía de reflectancia en el infrarrojo cercano (NIRS) sobre muestras secas Prediction of the fermentative quality of sunflower silage by near-infrared reflectance spectroscopy (NIRS) on oven-dried samples Sonia Pereira-Crespo, Aurora Sainz-Ramírez, Dalia Andrea Plata-Reyes, Aida Gómez-Miranda, Felipe González-Alcántara, Adrián Botana, Laura González, Marcos Veiga, Cesar Resch, Roberto Lorenzana, Fernando Próspero-Bernal, Carlos Manuel Arriaga-Jordán, Gonzalo Flores-Calvete…..609 Corbicular pollen spectrum (Apis mellifera) of samples from Huejotitan, Jalisco, Mexico Espectro de polen corbicular de Apis mellifera en muestras de Huejotitán, Jalisco, México Roberto Quintero Domínguez, Lino de la Cruz Larios, Diego Raymundo González Eguiarte, José Arturo Solís Magallanes, José Francisco Santana Michel, José Luis Reyes Carrillo .……………….……621 Eficacia del timol en el control del hongo Nosema ceranae infectando abejas africanizadas Efficacy of thymol in the control of the fungus Nosema ceranae infecting Africanized bees Azucena Vargas-Valero, Roberto C. Barrientos-Medina, Luis A. Medina Medina…………………………633 Caracterización de la curva de lactancia y calidad de la leche en ovejas Santa Cruz ( Ovis

aries)

Characterization of the lactation curve and milk quality in Santa Cruz sheep ( Ovis aries) Ingrid Merchant, Agustín Orihuela, Reyes Vázquez, Virginio Aguirre……………………………………..…644 Optimización de un protocolo de extracción de ADN a partir de sangre bovina hemolizada y coagulada para la detección molecular de Anaplasma spp. Optimization of a DNA extraction protocol for hemolyzed and coagulated bovine blood for use in molecular detection of Anaplasma spp. Tomás Humberto Landázuri Rafael, Andrés Carrazco, Renato León, Lenin Vinueza, Verónica Barragán ………………………………………………………………………………………………………………………..…653

VIII


Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

6.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes). Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo. El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

4.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

5.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

7.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8.

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

IX


Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

referencias, aunque pueden insertarse en el texto (entre paréntesis).

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés.

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus.

12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

X


I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

XI)

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI


XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

xg

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50 g

vs

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s)

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

XII


https://doi.org/10.22319/rmcp.v12i2.5483 Artículo

Efecto de la pasteurización en la concentración de diclorodifeniltricloroetano (DDT) y hexaclorociclohexano (HCH) en leche de bovino

Violeta Trinidad Pardío Sedas a Karla María López Hernández a* Argel Flores Primo a Roxana Uscanga Serrano a

a Universidad Veracruzana.

Facultad de Medicina Veterinaria y Zootecnia, Av. Miguel Ángel de Quevedo s/n, Col. Unidad Veracruzana, 91710. Veracruz, Veracruz, México.

*Autor de correspondencia: klopez@uv.mx

Resumen: El diclorodifeniltricloroetano (DDT) y hexaclorociclohexano (HCH) son disruptores endocrinos cuya presencia en la leche representa un riesgo para la salud. Existe evidencia de que la pasteurización disminuye o incrementa la concentración de plaguicidas organoclorados en productos lácteos. La presente investigación evaluó el efecto de la pasteurización a 63 °C 30 min-1 y 73 °C 15 seg-1 en las concentraciones de DDT, HCH y sus metabolitos en leche bovina, para estimar la exposición dietaria por consumo humano de leche pasteurizada. Se realizó un diseño experimental completamente al azar con dos tratamientos en 100 muestras de leche recolectadas en Soledad de Doblado y Jamapa, Veracruz, México. Los plaguicidas se cuantificaron por cromatografiá de gases con detector de microcaptura de electrones. Los datos se analizaron mediante análisis de varianza unifactorial (P<0.05) y las medias se compararon con Tukey (P<0.05). La exposición dietaria a plaguicidas se evaluó por la ingesta diaria estimada (IDE) y dosis diaria promedio (DDP) en tres grupos de población. La pasteurización a 73 ºC disminuyó 30.94, 44.51, 3.18, 81.23 y 42.82 % las concentraciones de p,p'-DDE, p,p'-DDD, o,p'-DDT, p,p'-DDT y DDT 318


Rev Mex Cienc Pecu 2021;12(2):318-336

total, respectivamente, así como las concentraciones de β-HCH, γ-HCH y HCH total (85.68, 18.88 y 99.31 %, respectivamente). La IDE para niños, adultos y ancianos de DDT total fue menor por consumo de leche pasteurizada a 73 ºC y de γ-HCH a 63 ºC. La DDP de DDT total disminuyó con la pasteurización a 73 °C. La exposición dietaria de DDT y HCH fue mayor en niños. Palabras clave: DDT, HCH, Leche, Pasteurización, Exposición dietaria, Niños.

Recibido: 22/08/2019 Aceptado: 02/07/2020

Introducción Los plaguicidas organoclorados (POC), como diclorodifeniltricloroetano (DDT) y hexaclorociclohexano (HCH), se usaron abundantemente en todo el mundo a partir de 1949, principalmente en programas de agricultura y salud pública para la prevención de plagas, malezas y otros patógenos en países tropicales(1). En México, el DDT fue el insecticida utilizado para el control de la malaria; en Veracruz se aplicó rutinariamente hasta el 2003 en regiones endémicas y el γ-HCH (lindano) se utilizó para el control de plagas veterinarias(2), ya que este isómero es considerado el elemento activo del HCH técnico con propiedades insecticidas específicas(3,4). En mayo de 2004 quedó restringido el uso de estos plaguicidas después de entrar en vigor el Convenio de Estocolmo. Este tratado internacional tuvo el objeto de proteger la salud humana y el ambiente de sustancias químicas tóxicas, persistentes y bioacumulables(5). Sin embargo, en México y otros países el lindano se usa como conservador de semillas, como ectoparasiticida en ganadería y en lociones o jabones para tratamiento de sarnas y piojos en humanos(6). Los POC son compuestos que, por su presión de vapor y coeficiente de partición, son persistentes y móviles en el medio ambiente(7) y por su naturaleza lipófila se bioacumulan y biomagnifican a través de la cadena alimentaria(8,9). El DDT y HCH son considerados compuestos cancerígenos y disruptores endocrinos(4,10) y sus residuos han sido reportados en animales y humanos(11). La vida media de los POC puede oscilar entre algunos meses y varios años hasta décadas. Se ha estimado que la degradación del DDT en el suelo varía de 4 a 30 años(12). La exposición de los animales al DDT y HCH puede aumentar a partir del tratamiento directo con plaguicidas, la inhalación de aire o la ingestión de forrajes y piensos contaminados(2). En los organismos bovinos después de la reabsorción, los POC ingresan al hígado y se metabolizan lentamente antes de que se liberen en el sistema circulatorio y finalmente se depositan en la grasa o se eliminan a través de la leche, pasando al ternero o al consumidor humano(9,13). Diversos estudios han demostrado la presencia de DDT y HCH en leche, carne y tejidos de bovino(9,14,15). Más aún, la leche bovina se ha utilizado como un indicador de la

319


Rev Mex Cienc Pecu 2021;12(2):318-336

persistencia de estos plaguicidas debido a la alimentación animal, inhalación del aire y el uso intensivo en programas para el control de ectoparásitos en el ganado. En este contexto, se han realizado monitoreos de los niveles de POC en estos alimentos para estimar la exposición de la población y los posibles riesgos para la salud(16,17). La producción nacional de leche bovina en 2018 fue de 11 mil 923 millones de litros, de los cuales el estado de Veracruz aportó el 6.0 % de la producción. México ocupó el octavo lugar en producción lechera a nivel mundial, destacando que la Unión Europea, considerada como entidad geopolítica conformada por 28 países, ocupó el primer lugar de producción de leche(18,19). En México el consumo per cápita de leche durante 2018 fue de 339 ml/persona/día(18). En base a su composición, la leche es un alimento completo y equilibrado que proporciona un elevado contenido de nutrientes en relación con su contenido calórico, por lo que su consumo debe considerarse necesario desde la infancia a la tercera edad(20). Debido a la importancia que tiene este producto como alimento, se han desarrollado varias investigaciones con el propósito de reducir el contenido de los POC en la leche. Abd-Rabo et al(21) reportaron que la pasteurización de leche de búfala a 73 °C ocasionó una disminución del 23.07 % de la concentración inicial de p,p’-DDE y un 32.85 % de p,p’-DDT, pero un incremento del 30 % en la concentración de p,p’-DDD. Deiana y Fatichenti(22) reportaron un incremento del 6.5 % en la concentración de DDT y HCH en leche de bovino pasteurizada a 73 °C. Sin embargo, Abou-Arab(23) observó la disminución de -HCH (72.90 y 65.00 %) en leche de bovino pasterizada a 63 y 72 ºC. No obstante, son pocas las investigaciones que evalúan el riesgo a la salud asociado al consumo de leche bronca y pasteurizada comercializada contaminada con estos plaguicidas(24,25). Abou-Arab et al(26) encontraron que la ingesta diaria estimada (IDE) de HCH en leche bronca, pasteurizada y ultrapasteurizada fue 0.28, 0.11 y 0.03 µg kg-1 pc día1 , respectivamente; a su vez, el metabolito del DDT con mayor IDE fue o,p'-DDE (0.48 µg kg-1 pc día-1) por consumo de leche bronca y o,p'-DDD (0.60 µg kg-1 pc día-1) por consumo de leche pasterizada. Amir et al(17) evaluaron la presencia de POC en diferentes alimentos, pero las IDEs más altas correspondieron a la leche bronca con 0.011, 0.074 y 0.103 µg kg-1 pc día-1 para -HCH, HCH total y DDT total, respectivamente. Miclean et al(27) reportaron IDE de HCH total para mujeres, hombres y niños de 0.002, 0.002 y 0.012 µg kg-1 pc día-1, respectivamente, y de DDT total 0.001, 0.002 y 0.008 µg kg-1 pc día-1, respectivamente. En base a lo anterior, el objetivo de esta investigación fue determinar el efecto de la pasteurización a 63 °C 30 min-1 (lenta de baja temperatura) y 73 °C 15 seg-1 (rápida de alta temperatura) en los niveles de concentración de DDT, HCH y sus metabolitos (p,p'-DDE, p,p'-DDD, o,p'-DDT, p,p'-DDT, -HCH, HCH, -HCH y -HCH) en leche bovina procedente de la zona agraria central del Estado de Veracruz, México y estimar la exposición

320


Rev Mex Cienc Pecu 2021;12(2):318-336

dietaria de grupos de población de niños, adultos y ancianos a estos plaguicidas contenidos en leche bronca y pasteurizada a estas dos temperaturas, mediante la IDE y la DDP.

Material y métodos Se seleccionaron 10 animales clínicamente sanos de más de dos años, con más de un parto que estuvieron en ordeña en dos unidades de producción (UP) ubicadas en el municipio de Soledad de Doblado (19º03’ N, 96º24’ O) y Jamapa (19º01’ N, 96º13’ O), Veracruz, México. Los municipios se caracterizan por tener clima cálido subhúmedo con lluvia en verano, el rango anual de precipitación es de 900 a 1,100 mm y 1,100 a 1,300, respectivamente, el rango anual de temperatura es de 24 a 26 ºC(28,29). El estudio se realizó con la aprobación del Comité de Bioética y Bienestar Animal de la Facultad de Medicina Veterinaria y Zootecnia. Se recolectaron mensualmente durante un ciclo anual (2017-2018) un total de 100 muestras de leche bovina (de 500 ml cada una) de la primera ordeña de los mismos animales seleccionados y se transportaron al Laboratorio de Toxicología de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Veracruzana de acuerdo con la NOM-243-SSA12010(30). En cada muestreo se realizó un pool de las muestras recolectadas procedentes de ambas UP del cual la mitad de las muestras se asignaron aleatoriamente a la pasteurización lenta y el resto a la pasteurización rápida. De tal forma que, de las 100 muestras, 25 muestras se pasteurizaron a 63 °C 30 min-1 y otras 25 muestras sin pasteurizar correspondieron al testigo de 63 ºC. Así mismo, 25 muestras se pasteurizaron a 73 °C 15 seg-1 y otras 25 muestras sin pasteurizar correspondieron al testigo de 73 ºC. De esta forma, se simuló la mezcla de la leche bronca de diferente procedencia en los centros de acopio y que es vendida a la industria láctea en la zona.

Pasteurización de la leche El proceso de pasteurización se realizó en el Laboratorio de Toxicología en base a la norma NOM-243-SSA1-2010(30). Brevemente: 500 ml de leche bronca se calentaron para la pasteurización lenta a 63 °C durante 30 min y 500 ml para la pasteurización rápida a 73 °C durante 15 seg; al término de cada pasteurización, las muestras se enfriaron rápidamente a 4 °C y, una vez alcanzada esta temperatura, inmediatamente se centrifugaron a 3,500 rpm para separar la grasa, la cual se almacenó en viales color ámbar etiquetados y se almacenaron a -20 °C hasta el momento de su análisis.

Determinaciones analíticas La determinación del contenido etéreo de la leche se realizó por el método de Gerber(31) y la determinación de los niveles de concentración de DDT, HCH y sus metabolitos en la grasa de la leche se realizó de acuerdo con la metodología modificada de Murphy(32). Todos los 321


Rev Mex Cienc Pecu 2021;12(2):318-336

productos químicos empleados en los análisis fueron grado analítico de marca Merck (Darmstadt, Alemania), J.T. Baker y Sigma-Aldrich Company (St. Louis, MO, EE. UU.). Cada muestra se analizó por triplicado y los resultados se expresaron como µg kg-1 base lipídica. Los residuos químicos de los análisis almacenados en galones ámbar fueron recolectados por la compañía EcoEntorno S.A. de C.V. contratada por la Universidad Veracruzana para la colecta de residuos peligrosos.

Análisis cromatográfico La concentración de DDT, HCH y sus metabolitos se cuantificaron en un cromatógrafo de gases Agilent-Hewlett-Packard 6890 Plus con automuestreador 7683 y con un detector de microcaptura de electrones con fuente Ni-63. Las condiciones de operación fueron las siguientes: inyector en modo splitless, flujo de purga de 60 ml min-1, tiempo de purga 0.80 min y temperatura de 250 ºC, columna HP-608 de 30 m de largo x 530 μm de diámetro y 0.5 μm de grosor de película, con flujo constante de nitrógeno ultrapuro de 2 ml min-1. Se programó el horno con la siguiente rampa de temperatura: temperatura inicial de 80 ºC a 180 ºC a 30 ºC min-1, y de 280 ºC a 10 ºC min-1 sostenida 2.7 min. El tiempo de corrida fue 19.03 min, la temperatura del detector de 320 ºC con flujo constante de nitrógeno de 30 ml min-1 y el volumen de inyección 1 μl.

Linearidad, límites de detección y cuantificación La linearidad del detector se determinó mediante análisis de regresión linear efectuado por el software ChemStation a partir de cinco puntos en las curvas de calibración para cada plaguicida. La calibración se realizó previamente al análisis de las muestras utilizando los estándares de los POC adquiridos en ChemService (Chem Service, Inc., West Chester, PA, USA) y Supelco (Supelco Park, Bellefonte, PA, USA). El análisis cualitativo y cuantitativo se efectuó mediante la comparación de los tiempos de retención y el área del pico de la muestra, respectivamente, con los estándares de referencia de la calibración. El límite de detección (LOD) y de cuantificación (LOQ) se calculó para cada plaguicida de acuerdo a Su(33). Para validar dicho método se usaron muestras de leche fortificadas con una recuperación de 91 a 99 %. El LOD para DDT y HCH varió de 0.0004-0.00036 y 0.000020.00031µg kg-1, respectivamente y el LOQ varió de 0.001 µg kg-1 base lipídica.

Valoración de la exposición dietaria a los plaguicidas La exposición dietaria a DDT, HCH y sus metabolitos se evaluó mediante la ingesta diaria estimada (IDE) y la dosis diaria promedio (DDP) de acuerdo a Pandit y Sahu(34). El riesgo se estimó en tres grupos de población, niños, adultos y ancianos. La IDE se reportó en µg de plaguicida kg-1 pc (peso corporal) día-1 y se calculó con la siguiente fórmula: 𝐼𝐷𝐸 = 𝐶𝑎 × 322


Rev Mex Cienc Pecu 2021;12(2):318-336

𝐹 × 𝐼; donde Ca: nivel medio de residuos de plaguicidas organoclorados en muestras de leche (µg kg-1 base lipídica), F: contenido de grasa en muestras de leche (%), I: ingesta de leche en mililitros por kilos de peso corporal por día (mlkg-1 pc día-1). La ingesta diaria de leche (339 ml por persona día-1) utilizada para calcular las IDE fue considerada en base al consumo per cápita de leche en México durante 2018, y los pesos promedio por persona fueron: 25 kg en niños(35), 70 kg en adultos(36) y 51 kg en ancianos(37). La dosis diaria promedio (DDP) es la tasa de dosis promedio en un periodo específico de exposición expresada en unidades de masa-tiempo (µg kg-1 día-1) calculada con la siguiente fórmula: 𝐷𝐷𝑃 = 𝐶𝑚 × 𝐹 × 𝐼; donde Cm: concentración máxima de plaguicidas organoclorados en muestras de leche (µg kg-1), F: contenido de grasa en muestras de leche (%), I: ingesta de leche (ml kg-1 pc día-1). Para la DDP de plaguicidas se consideró la siguiente ingesta diaria de leche (ml) y pesos recomendados (kg) en tres grupos principales de población: niños (480 ml/25 kg)(35), adultos (240 ml/70 kg)(38) y ancianos (310 ml/51 kg)(37).

Análisis estadístico Se empleó un diseño experimental completamente al azar, siendo la fuente de variación el método de pasteurización lenta y rápida de la leche para evaluar su efecto en los niveles de concentración de DDT, HCH y sus metabolitos (p,p'-DDE, p,p'-DDD, o,p'-DDT, p,p'-DDT, -HCH, β-HCH, -HCH y -HCH) en la leche. El modelo estadístico del diseño experimental fue el siguiente: Yij = µ + τi + ɛij En donde: Yij es la variable de respuesta (concentración de los POCs) de la ij-ésima unidad experimental (cada muestra de leche) (i y j denotan el nivel del factor y la replicación en el nivel del factor, respectivamente); µ es el efecto de la media general; τi es el efecto del i-ésimo tratamiento (pasteurización lenta y rápida); ɛij es el efecto del error experimental asociado a la i-ésima unidad experimental. Con las concentraciones obtenidas se realizó un ANDEVA de una vía (P<0.05) para evaluar el efecto de la pasteurización a 63 y 73 °C en los niveles medios de concentración de DDT, HCH y sus metabolitos en la leche de bovino bronca. Las diferencias significativas entre las medias se determinaron por prueba de Tukey (P<0.05) mediante el programa estadístico Minitab v.17.0.

323


Rev Mex Cienc Pecu 2021;12(2):318-336

Resultados y discusión Niveles de concentración de DDT y HCH en leche bronca De acuerdo a los resultados (Cuadro 1), las concentraciones de p,p'-DDE, p,p'-DDD, o,p'DDT y DDT total (15.736 ± 8.133, 9.849 ± 5.271, 15.237 ± 9.006 y 26.480 ± 13.880 µg kg-1 base lipídica, respectivamente) de la leche bronca utilizada como control de la pasteurización a 63 ºC fueron más altas (P<0.05) con respecto a la leche control pasteurizada a 73 ºC (3.829 ± 2.172, 4.904 ± 3.493, 3.734 ± 1.526 y 8.920 ± 7.340 µg kg-1 base lipídica, respectivamente). Sin embargo, las concentraciones de DDT total en las leches testigo no rebasaron el Límite Máximo de Residuos (LMR) de 50 μg kg-1 (base lipídica) establecido por la Food and Agricultural Organization/World Health Organization(39). Cuadro 1: Media y desviación estándar de DDT, HCH y sus metabolitos (µg kg-1 base lipídica) en leche bronca control y pasteurizada Tratamiento de 63 ºC 30 min-1 Tratamiento de 73 ºC 15 seg-1 Leche Leche Leche Leche control pasteurizada control pasteurizada (n=25) (n=25) (n=25) (n=25) ax b ay p,p'-DDE 15.736 ± 8.133 10.673 ± 5.682 3.829 ± 2.172 2.644 ± 2.023a ax a ay p,p'-DDD 9.849 ± 5.271 8.334 ± 4.771 4.904 ± 3.493 2.721 ± 1.333a o,p'-DDT 15.237 ± 9.006ax 7.559 ± 4.015b 3.734 ± 1.526ay 3.615 ± 1.831a a a p,p'-DDT 13.441 ± 7.905ax 13.484 ± 6.673 11.351 ± 6.485ax 2.130 ± 1.566 DDT total α-HCH β-HCH γ-HCH δ-HCH HCH total

26.480 ± 13.880ax 0.270 ± 0.154ax 0.401 ± 0.276ax 0.511 ± 0.338ax 0.424 ± 0.229ax 0.552 ± 0.368ax

20.170 ± 16.05a

8.920 ± 7.340ay

5.100 ± 3.210a

0.355 ± 0.137b 0.919 ± 0.062b 0.702 ± 0.236a 1.504 ± 2.379a 1.067 ± 1.076a

0.310 ± 0.111ax 1.438 ± 0.376ay 1.187 ± 0.204ay 0.523 ± 0.346ax 1.241 ± 0.830ax

0.543 ± 0.151b 0.206 ± 0.113b 0.963 ± 0.122a 1.504 ± 2.379a 0.684 ± 0.452a

DDT total= p,p'-DDE + p,p'-DDD + o,p'-DDT + p,p'-DDT; □HCH total= α-HCH + β-HCH + γ-HCH + δHCH. a,b Valores con literales distintas son diferentes significativamente (P<0.05) entre columnas del mismo tratamiento. x,y Valores con literales distintas son diferentes significativamente (P<0.05) entre controles de ambos tratamientos.

Como se aprecia en el Cuadro 2, estas concentraciones detectadas en la leche bronca fueron menores a las registradas en leche bronca de bovino en el estudio anterior realizado por Pardío et al(40) en el estado de Veracruz. Comparando nuestros datos con las concentraciones

324


Rev Mex Cienc Pecu 2021;12(2):318-336

de los metabolitos del DDT detectados en leche bronca de Brasil(24), Colombia(14) y Rumania(27), se observa que los niveles detectados en las leches control de 63 ºC y 73 ºC en el presente estudio fueron hasta 26 y 11 veces más altos, respectivamente. Sin embargo, en Egipto la concentración de p,p'-DDT en leche bronca fue dos veces mayor que la encontrada en los testigos en esta investigación. Con respecto a las concentraciones de β-HCH y γ-HCH (1.438 ± 0.376 y 1.187 ± 0.204 µg kg-1 base lipídica, respectivamente) de la leche control de 73 ºC fueron (P<0.05) más altas con respecto a las concentraciones del control de 63 ºC (0.401 ± 0.276 y 0.511 ± 0.338 µg kg-1 base lipídica, respectivamente). No obstante que el HCH total de la leche control de 73 ºC fue 2.24 veces mayor que el de 63 °C, no fue significativamente (P>0.05). La variación de las concentraciones de los POC entre los controles pudo haberse debido a que sus niveles en la leche de cada UP pudieron haber variado indistintamente a lo largo del ciclo anual. Esta variación podría atribuirse a la combinación de las prácticas de manejo zootécnico en las unidades de producción y a las dietas formuladas con ingredientes contaminados, el efecto de la cinética debido a las propiedades fisicoquímicas de cada isómero, las actividades metabólicas relacionadas con la movilización lipídica, y posiblemente la falta de homogeneidad en la concentración de los metabolitos debido a la remobilización de los lípidos y contaminantes durante la síntesis de la leche, así como a la carga de aplicación del plaguicida ya que éste puede ser depositado o absorbido desde la atmosfera hacia la superficie del pasto, siendo afectado por la temperatura, la lluvia, el viento y el clima(2). Los metabolitos α-HCH, β-HCH, γ-HCH y HCH total presentes en los controles de 63 ºC y 73 ºC no rebasaron los LMR de 50, 20, 10 y 100 µg kg-1 (base lipídica), respectivamente, establecidos por la FAO/WHO(39). Como se aprecia en el Cuadro 2, las concentraciones de los metabolitos α-HCH, β-HCH y γ-HCH evaluados en el presente estudio fueron menores a las reportadas por Pardío et al(40) en Veracruz, México; los niveles de γ-HCH reportados en leche de Tlalixcoyan, Ver., fueron 250.3 veces mayor a lo reportado en la leche control de 63 ºC (0.511 ± 0.338 µg kg-1 base lipídica) y 107.76 veces mayor a la leche control de 73 ºC (1.187 ± 0.204 µg kg-1 base lipídica). La concentración de γ-HCH en Egipto fue 62.5 veces mayor a la reportada en la leche bronca a 63 ºC y 26.9 veces mayor en la leche control de 73 ºC. Sin embargo, la concentración de α-HCH registrada en la leche de Colombia fue similar a la observada en la leche control a 73 ºC (0.310 ± 0.111 µg kg-1 base lipídica).

325


Rev Mex Cienc Pecu 2021;12(2):318-336

Cuadro 2: Residuos de plaguicidas organoclorados (µg kg-1 base lipídica) en leche bronca reportados en otros estudios p,p'- p,p'- p,p'- o,p'- αβγReferencia Localidad/País

DDE

DDD DDT

DDT

HCH

HCH

HCH

HCH Medellín, 39.000 ND 89.000 26.000 13.000 23.000 49.000 NA Pardío et Veracruz/México al(40) Paso San Juan, 18.000 ND 49.000 ND 13.000 17.000 22.000 NA Pardío et Veracruz/México al(40) Tlalixcoyan, 24.000 ND 36.000 ND 31.00 69.000 128.000 NA Pardío et Veracruz/México al(40) Rio Grande do 0.011 0.000 ND 0.000 0.002 ND 0.006 ND Heck et (24) Sul/Brasil al Cairo/Egipto 12.000 6.000 24.000 3.000 NA NA 32.000 NA Abou-Arab et al(26) Sabanas, ND ND 0.034 ND 0.469 ND ND ND Díaz et Córdoba/Colombia al(14) Rumania 0.011 0.000 0.000 0.000 0.001 0.010 0.002 0.001 Miclean et al(27) NA= no analizado; ND= no detectado.

Cabe destacar que los plaguicidas organoclorados y sus residuos son de naturaleza altamente lipofílica y persistente, por lo que se concentran fácilmente en la grasa de la leche(26). Esto implica que, aunque los POC se prohibieron para el uso agrícola a principios de la década de 1970 en la mayoría de los países, sus residuos aún persisten. Debido a su persistencia, las concentraciones detectadas de DDT, HCH y sus metabolitos en la leche bronca del presente estudio son debidas probablemente a las cargas aplicadas de DDT durante su uso legal anterior, mismo que ha provocado la contaminación de las áreas de pastoreo de bovinos en el estado de Veracruz. Así mismo, el γ-HCH continúa siendo utilizado para el control de ectoparásitos en el ganado(2). De hecho, estos plaguicidas se siguen aplicando en varias partes del mundo debido a sus efectos potentes y de amplio espectro contra organismos nocivos(41).

Efecto de la pasteurización en los niveles de concentración de DDT y HCH Como se aprecia en los Cuadros 1 y 3, después de la pasteurización a 63 ºC, los niveles de concentración de los metabolitos p,p’-DDE y o,p’-DDT (10.673 ± 5.682 y 7.559 ± 4.015 µg kg-1 base lipídica, respectivamente) disminuyeron (P<0.05) con respecto a los niveles de la leche control (bronca) un 32.17 y 50.39 %, respectivamente, y sólo el p,p’DDT incrementó (P>0.05) 0.31 % su concentración con respecto al control; por lo que la concentración del DDT total (20.170 ± 16.050 µg kg-1 base lipídica) disminuyó (P>0.05) 29.83 % con respecto a la del control (26.480 ± 13.880 µg kg-1 base lipídica). Sin embargo, los niveles de α-HCH

326


Rev Mex Cienc Pecu 2021;12(2):318-336

y β-HCH (0.355 ± 0.137 y 0.919 ± 0.062 µg kg-1 base lipídica, respectivamente) se incrementaron (P<0.05) 31.48 y 129.11 %, respectivamente, pero el incremento de los niveles de γ-HCH, δ-HCH y HCH total no fue significativo (P>0.05). Los isómeros α-HCH y γ-HCH se pueden isomerizar a β-HCH. La estabilidad del β-HCH, su tendencia a acumularse en los tejidos humano y animal con el tiempo, su rápida bio-concentración en el hombre (525 veces) y su eliminación más lenta, representa un riesgo respecto a su toxicidad crónica. Este metabolito es el más tóxico seguido por el α-, γ-HCH y δ-HCH debido a su mayor vida media biológica en el cuerpo de 7-8 años (ATSDR)(42). Cuadro 3: Variación (%) de la concentración de DDT, HCH y sus metabolitos debido al efecto de pasteurización de la leche de ganado bovino en diversos estudios Tipo de PLAG muestra/Procedencia Leche de búfalo/Egipto

Leche bovina/Italia

Leche bovina/Egipto

Pasteurización 63 ºC 30 Pasteurización 73 °C 15 min-1 seg-1 Referencia Disminución Incremento Disminución Incremento

p,p'DDE p,p'DDD p,p'DDT DDT total○ HCH total□

NA

NA

23.07

---

NA

NA

---

30

NA

NA

32.85

---

NA

NA

---

6.5

NA

NA

---

6.5

γ-HCH

72.90

---

65.00

---

Abd-Rabo et al(21)

Deiana y Fatichenti(22)

Abou-Arab (23)

Leche bovina/México

p,p'32.17 --30.94 --Presente DDE estudio p,p'15.38 --44.51 --DDD o,p'50.39 --3.18 --DDT p,p'--0.31 81.23 --DDT DDT 29.83 42.82 --total○ α-HCH --31.48 --75.16 β-HCH --129.11 85.68 --γ-HCH --37.37 18.88 --δ-HCH --257.24 --187.57 HCH --93.29 99.31 --total□ PLAG= plaguicida; NA= no analizado; ○DDT total= p,p'-DDE + p,p'-DDD + o,p'-DDT + p,p'-DDT; □HCH total= α-HCH + β-HCH + γ-HCH + δ-HCH.

327


Rev Mex Cienc Pecu 2021;12(2):318-336

La pasteurización a 73 ºC disminuyó (P<0.05) los niveles de concentración de DDT y sus metabolitos en la leche con respecto a la leche testigo, disminuyendo desde 3.18 % (o,p’DDT) hasta un 81.23 % (p,p’-DDT). Se observó un incremento significativo (P<0.05) en los niveles de α-HCH y d-HCH (0.543 ± 0.151 y 1.504 ± 2.379 µg kg-1 base lipídica, respectivamente) en 75.16 y 185.57 %, respectivamente, y una disminución significativa (P<0.05) para β-HCH (0.206 ± 0.113 µg kg-1 base lipídica) en 85.68 %. La disminución observada en las concentraciones de p,p'-DDE, p,p'-DDD, o,p'-DDT y DDT total en la leche pasteurizada a 63 °C en comparación con la concentración del control, excepto el p,p'-DDT pudiera atribuirse a la isomerización del p,p'-DDE y del p,p'-DDD a p,p'-DDT por el calentamiento. Sin embargo, las concentraciones de HCH y todos sus metabolitos se incrementaron con la pasteurización a 63 °C y los metabolitos α-HCH y -HCH por la pasteurización a 73 °C. Los plaguicidas organoclorados pueden ser degradados por fotólisis, hidrólisis, oxidación y reducción, temperatura y pH. La retención de los plaguicidas dependerá de las propiedades físico-químicas de la molécula del plaguicida así como del alimento(43). No obstante, la concentración del DDT total de la leche control y pasteurizada a 63 y 73 °C no rebasó el LMR de 50 µg kg-1 (base lipídica) establecido por la FAO/WHO(39). Así mismo, los metabolitos α-HCH, β-HCH, γ-HCH y HCH total presentes en las leches pasteurizadas a 63 ºC y 73 ºC no rebasaron los LMR de 50, 20, 10 y 100 µg kg-1 (base lipídica), respectivamente, establecidos por la FAO/WHO(39). Sin embargo, el metabolito δHCH cuyos niveles se incrementaron en ambas pasteurizaciones está estructuralmente relacionado a los HCH cancerígenos (ATSDR)(42). Los resultados de la pasteurización a 63 y 73 °C difieren con los de Abou-Arab(23) quien reportó una disminución de 72.9 y 65.0 %, respectivamente, en la concentración de γ-HCH en leche de bovino, mientras que en nuestro estudio este metabolito incrementó 37.37 % con la pasteurización a 63 °C pero disminuyó 18.88 % con la pasteurización a 73 °C. Abd-Rabo et al(21) en Egipto reportó que los metabolitos p,p'-DDE y p,p'-DDT disminuyeron en la leche pasteurizada a 73 °C. En el presente estudio se observó un disminución similar en el p,p'DDE pero un incremento en el p,p'-DDT. La disminución observada en el p,p’-DDD (44.51 %) en este estudio contrasta con el incremento reportado por este autor (30 %). Deiana y Fatichenti(22) en Italia reportaron que las concentraciones del DDT y HCH totales incrementaron el 6.50 % en leche bovina pasteurizada a 73 °C, mientras que en el presente estudio disminuyeron 42.82 y 99.31 %, respectivamente. Estos resultados indican que la pasteurización a 73 °C 15 seg-1 disminuye la concentración de la mayoría de los POC analizados. Es importante señalar que la leche está considerada como un producto de primera necesidad en la alimentación humana. Los beneficios de la leche bovina no se limitan a su valor nutricional, constituyen un factor de prevención de patologías como la enfermedad cardiovascular, algunos tipos de cáncer, la hipertensión arterial y ósea o dental (20). De ahí la importancia de la disminución de la concentración de estos contaminantes en la leche por la pasteurización, ya que su presencia representa un riesgo a la salud pública.

328


Rev Mex Cienc Pecu 2021;12(2):318-336

Estimación de la exposición dietaria de DDT y HCH a través del consumo humano de leche de bovino

Ingesta diaria estimada (IDE) para DDT y HCH

Con la finalidad de proteger la salud pública se han establecido ingestas límites de POC en leche y otros alimentos que no deben superarse. La ingesta diaria aceptable (IDA) para la DDT total es de 20 µg kg-1 pc día-1 recomendado por la FAO/WHO(39) y 0.5 µg kg-1 pc día-1 recomendado por la EPA(44), para γ-HCH (lindano) es de 8 µg kg-1 pc día-1(39). Por lo tanto, la IDE se calculó para el DDT total y el metabolito γ-HCH a partir de la concentración detectada en las leches estudiadas para tres grupos de población: niños, adultos y ancianos. En el Cuadro 4 se observa que en el grupo de los niños la mayor IDE se calculó en la leche control de 63 °C, que no rebasó los valores aceptables recomendados por la FAO/WHO (20 µg kg-1 pc día-1), pero fue 28.06 veces más alta que los niveles recomendados por la EPA (0.5 µg kg-1 pc día-1). En el grupo de los adultos la mayor concentración también ocurrió en la leche control de 63 °C, sin rebasar los valores recomendados por la FAO/WHO; sin embargo, rebasó 10 veces los valores aceptables de la EPA. La IDE del grupo de ancianos fue mayor para la leche control de 63 °C, rebasando 13.74 veces los valores aceptables por la EPA. Abou-Arab et al(26) estimaron IDE de DDT total de 0.394 y 0.113 µg kg-1 pc día-1 para adultos y de 0.475 y 0.135 µg kg-1 pc día-1 para niños, así mismo las IDEs de γ-HCH fueron 0.280 y 0.113 µg kg-1 pc día-1 para adultos y 0.336 y 0.135 µg kg-1 pc día-1 para niños por el consumo de leche bronca y pasteurizada (63 °C), respectivamente, procedente de mercados locales en el Cairo, Egipto. De acuerdo con esto, las IDE del presente estudio fueron menores a las estimadas en adultos y niños que consumen leche bronca y pasteurizada en Egipto, debido a que las concentraciones de DDT y HCH en esa zona fueron más altas que las reportadas en la presente investigación.

329


Rev Mex Cienc Pecu 2021;12(2):318-336

Cuadro 4: Ingesta diaria estimada (IDE) (µg kg-1 pc día-1) de DDT total y γ-HCH para niños, adultos y ancianos estimada en el consumo de leche bronca (control) y pasteurizada Tratamiento 63 ºC 30 min-1 Grupo de población Leche control DDT total Niños 14.03 Adultos 5.00 Ancianos 6.87

Tratamiento 73 ºC 15 sec-1

Leche pasteurizada

Leche control

10.68 3.81 5.23

4.72 1.62 2.31

IDA (µg kg-1 pc Leche pasteurizada día) 20(39) y 0.05(44) 2.70 0.96 1.32

γ-HCH Niños

0.27

0.37

0.62

0.50

Adultos

0.04

0.06

7.81

0.09

Ancianos

0.08

0.11

0.19

0.16

8(39)

IDA= ingesta diaria aceptable; FAO/WHO, 1997(39); EPA(44). DDT total= p,p'-DDE + p,p'-DDD + o,p'-DDT + p,p'-DDT.

La IDE más alta γ-HCH en los tres grupos de población se presentó en la leche control de 73 °C. Sin embargo, ninguna de las IDEs rebasó el valor aceptable recomendado por la FAO/WHO (8 µg kg-1 pc por día). Pardío et al(40) reportaron que las IDE para infantes y adultos por el consumo de leche cruda de Tlalixcoyan, Veracruz, México, contaminada con -HCH fue de 0.666 y 0.021 µg kg-1 pc día-1, respectivamente. Sin embargo, las IDE para infantes y adultos por el consumo de leche cruda contaminada con DDT total fueron más altas para la leche procedente de Medellín, Veracruz, México con valores de 0.530 y 0.017 µg kg-1 pc día-1, respectivamente. En un estudio reciente, Miclean et al(27) reportó IDEs de HCH total en leche bronca para mujeres, hombres y niños de 0.002, 0.002 y 0.012 µg kg-1 pc día-1, respectivamente; para DDT total fueron 0.001, 0.002 y 0.008 µg kg-1 pc día-1 para mujeres, hombres y niños, respectivamente, menores a las estimadas para el DDT total en niños en el presente estudio por el consumo de leche pasteurizada a 63 y 73 °C y bronca (controles respectivos). Al comparar los resultados de Pardío et al(40) con los del presente estudio, se observa que la exposición a -HCH y a DDT total a través del consumo de leche bronca ha aumentado en la zona. Lo anterior indica un incremento de la contaminación en el tiempo debido al uso continuo del -HCH en la ganadería en la región y a las altas cargas de DDT rociadas en el pasado que resultaron en pastizales contaminados cercanos a las zonas urbanas y suburbanas, donde el DDT era rociado para el control del paludismo(2). Sin embargo, el 30 a 37 % de la leche fluida sin pasteurizar de la producción nacional se destina a la producción de quesos artesanales(45), mientras que, de la producción en el estado de Veracruz, el 50 % de la leche fluida no pasteurizada en acopios se venden a queserías locales para la producción de quesos y otros productos lácteos artesanales que se comercializan en

330


Rev Mex Cienc Pecu 2021;12(2):318-336

las principales zonas urbanas de la entidad(46). Como consecuencia, los consumidores de la leche producida en esta zona agraria de Veracruz están expuestos a niveles dietarios de POs superiores a los niveles de exposición en países desarrollados, en donde el uso de estos plaguicidas fue prohibido desde hace muchos años(40). Este riesgo podría reducir si la leche fuera pasteurizada a 73 °C 15 seg-1 para disminuir la concentración de la mayoría de los POC analizados. Como se aprecia en el cuadro 3, de acuerdo con la literatura consultada, son muy escasos los estudios realizados en pasteurización lenta y rápida y la estimación de la ingesta dietaria respectiva. La vigilancia de los niveles de estos POC en la leche y en otros alimentos resulta indispensable para observar que no se sobrepasen los LMR y las IDA recomendadas por la FAO/WHO. Dosis diaria promedio (DDP) estimada para DDT La DDP es una predicción de la ingesta diaria de residuos de un plaguicida basada en la estimación de las concentraciones de residuos en los alimentos y en los datos disponibles sobre el consumo de los alimentos en relación con una población determinada(47). Para el DDT total, la Organización de las Naciones Unidas para la Agricultura y la Alimentación (FAO) y la Organización Mundial de la Salud (OMS) han establecido la DDP, de 48 µg kg-1 día-1(45). En el caso de HCH no hay una DDP establecida. Las DDP más altas estimadas en niños, adultos y ancianos fueron de 142.01, 71.00 y 91.72 µg kg-1 día-1, respectivamente, debido a la ingesta de leche control (bronca) de 63 ºC, sobrepasando el límite recomendado por la FAO/WHO (48 µg kg-1 día-1) por 2.9 veces el grupo de los niños, 1.4 veces los adultos y 1.9 veces los ancianos. Después de pasteurizar esta leche a 63 ºC, las DDP calculadas en los tres grupos de población (114.06, 57.03 y 73.66 µg kg-1 día-1 en niños, adultos y ancianos, respectivamente) también rebasaron el límite recomendado. Cabe destacar que la DDP estimada por consumo de leche control de 73 ºC en niños fue de 59.48 µg kg-1 día-1, mayor al límite recomendado por la FAO/WHO (48 µg); sin embargo, una vez pasteurizada la leche el valor de DDP resultó 6.15 veces menor (9.67 µg) en comparación a la leche testigo. Las DDP calculadas para los adultos y ancianos en la leche control (29.74 y 38.41 µg kg-1 día-1, respectivamente) y pasteurizada a 73 ºC (18.08 y 23.35 µg, respectivamente) permanecieron por debajo del límite recomendado por la FAO/WHO y fueron menores a las estimadas por el consumo de leche bronca utilizada como control a 63 ºC. Estos resultados contrastan con los reportados por Pardío et al(40) quienes estimaron menores dosis diarias para infantes y adultos (4.068 y 2.339 µg kg-1 día-1, respectivamente) que consumían leche bronca de Medellín, Veracruz, México. Se debe destacar que existen determinados grupos de población más vulnerables a los efectos de estos plaguicidas, como son la población infantil, primordialmente aquéllos que poseen algún grado de desnutrición y la población femenina en edad fértil, particularmente en estado de gestación, ya que existe evidencia de su actividad de disrupción hormonal y lipídica(48). Los efectos de la exposición

331


Rev Mex Cienc Pecu 2021;12(2):318-336

a POC a la salud humana a través de los alimentos es un problema que merece más atención. Los resultados obtenidos indican su presencia en la leche bronca y pasteurizada y un incremento en las DDP, por lo que resulta indispensable la revisión de los LMR y la búsqueda de métodos alternativos de control de plagas para mejorar la inocuidad alimentaria y proteger la salud pública.

Conclusiones e implicaciones El proceso de pasteurización a 73 ºC de leche disminuye las concentraciónes de DDT y sus metabolitos, así como la mayoría de las concentraciones de los metabolitos de HCH. Por lo tanto, el proceso térmico bajo estas condiciones representa una alternativa favorable para la dismunución de la exposición dietaria a estos plaguicidas por consumo humano de leche pasteurizada a 73 ºC. Agradecimientos Se agradece al proyecto “Formación y Fortalecimiento de Cuerpos Académicos e Integración de Redes” clave 103.5/03/477 UVER-F-11 fondos PRODEP por el financiamiento de este estudio. Literatura citada: 1. Negi RK, Rani S. Contamination profile of DDT and HCH in packaged milk samples collected from Haridwar, India. Int J Pure App Biosci 2015;3:121-127. 2. Pardío V, Martínez D, Flores A, Romero D, Suárez V, López K, et al. Human health risk of dietary intake of organochlorine pesticide residues in bovine meat and tissues from Veracruz, México. Food Chem 2012;135:1873-1893. 3. Avalos GM, Ramiŕ ez GJ. La situación del lindano en México. Gaceta Ecol 2003;69:93100. http://www.redalyc.org/pdf/539/53906907.pdf. Consultado 29 Abr, 2019. 4. Vijgen J, Abhilash PC, Fan LY, Lal R, Forter M, Torres J, et al. Hexachlorocyclohexane (HCH) as new Stockholm Convention POPs a global perspective on the management of Lindane and its waste isomers. Environ Sci Pollut Res 2011;18:152-162. 5. Mendoza CA, Ize LIAR. Las sustancias químicas en México. Perspectivas para un manejo adecuado. Rev Int Contam Ambie 2017;33:719-745. 6. Ocampo-Camberos L, Rosiles-Martínez R, Tapia-Pérez G, Sumano-López H. Cinética de eliminación de Lindano en grasa de leche de vacas tratadas con tres dosis de Lindano. Agrociencia 2010;44:461-469.

332


Rev Mex Cienc Pecu 2021;12(2):318-336

7. Kalantzi OI, Alcock RE, Johnston PA, Santillo D, Stringer RL, Thomas GO, et al. The global distribution of PCBs and organochlorine pesticides in butter. Environ Sci Technol 2001;35:1013-1018. 8. Vieira DRE, Torres JPM, Malm O. DDT environmental persistence from its use in a vector control program: a case study. Environ Res Section A 2001;86:174-182. 9. Nag SK, Raikwar MK. Organochlorine pesticide residues in bovine milk. Bull Environ Contam Toxicol 2008;80:5-9. 10. Tsakiris IN, Goumenou M, Tzatzarakis MN, Alegakis AK, Tsitsimpikou C, Ozcagli E, et al. Risk assessment for children exposed to DDT residues in various milk types from the Greek market. Food Chem Toxicol 2015;75:156-165. 11. Yentür G, Kalay A, Öktem AB. A survey on organochlorine pesticide residues in butter and cracked wheat available in Turkish markets. Nahrung 2001;45:40-42. 12. Yadav ICh, Devi NL, Syed JH, Cheng Z, Li J, Zhang G, et al. Current status of persistent organic pesticides residues in air, water, and soil, and their possible effect on neighboring countries: A comprehensive review of India. Sci Total Environ 2015;511:123-137. 13. Jandacek RJ, Tso P. Factors affecting the storage and excretion of toxic lipophilic xenobiotics. Lipids 2001;36:1289-1305. 14. Diá z-Pongutá B, Lans-Ceballos E, Barrera-Violeth JL. Organochlorine insecticide residues present in raw milk sold in the Department Córdoba, Colombia. Acta Agron 2012;61(1):10-15. 15. Kuba J, Tomza-Marciniak A, Pilarczyk B, Tarasewicz N, Pilarczyk, Ligocki M. Comparison of DDT and its metabolites concentrations in cow milk from agricultural and industrial areas. J Environ Sci Health B 2015;50:1-7. 16. Battu RS, Balwinder S, Kang BK, Joia BS. Risk assessment through dietary intake of total diet contaminated with pesticide residues in Punjab, India, 1999-2002. Ecotoxicol Environ Saf 2005;62:132-139. 17. Aamir M, Khan S, Li G. Dietary exposure to HCH and DDT congeners and their associated cancer risk based on Pakistani food consumption. Environ Sci Pollut Res 2018;25(9):8465-8474. 18. SAGARPA/SIAP. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación/Servicio de Información Agroalimentaria y Pesquera. Panorama de la leche en México. México. 2018.

333


Rev Mex Cienc Pecu 2021;12(2):318-336

19. USDA/WASDE. United States Department of Agriculture/World Agricultural Supply and Demand Estimates. Dairy: world market and trade. United States. 2018. 20. Fernández FE, Martínez HJA, Martínez SV, Moreno VJM, Collado YLR, Hernández CM, et al. Documento de Consenso: importancia nutricional y metabólica de la leche. Nutr Hosp 2015;31:92-101. 21. Abd-Rabo FH, Abou DAE, Ahmed NS, Hassan FAM. Heat treatments change amounts of pesticide residues in buffaloe’s milk. Egypt J Dairy Sci 1989;17:349-357. 22. Deiana P, Fatichenti F. Pesticide residues in milk processing. Ital J Food Sci 1992;4:229245. 23. Abou-Arab AAK. Effects of processing and storage of dairy products on lindane residues and metabolites. Food Chem 1999;64:467-473. 24. Heck MC, Sifuentes dos Santos J, Bogusz Junior S, Costabeber I, Emanuelli T. Estimation of children exposure to organochlorine compounds through milk in Rio Grande do Sul, Brazil. Food Chem 2007;102:288-294. 25. Castilla-Pinedo Y, Alvis-Estrada L, Alvis-Guzmán N. Exposición a organoclorados por ingesta de leche pasteurizada comercializada en Cartagena, Colombia. Rev Salud Pública 2010;12:14-26. 26. Abou-Arab AAK, Abou DMA, Enb A. Chemical composition, metals content and pesticide residues in raw, pasteurized and UHT milk and their dietary intake. J Egypt Soc Toxicol 2008;39:111-121. 27. Miclean M, Cadar O, Levei EA, Todea DA. Human health risk assessment of organochlorine compounds associated with raw milk consumption in a Romanian industrial area. Ital J Food Sci 2018;30:116-127. 28. INEGI. Instituto Nacional de Estadística, Geografía e Informática. (2009). Prontuario de información geográfica municipal de los Estados Unidos Mexicanos. Jamapa, Veracruz de Ignacio de la Llave. http://www3.inegi.org.mx/contenidos/app/mexicocifras/datos_geograficos/30/30090.p df. Consultado: 13 May, 2018. 29. INEGI. Instituto Nacional de Estadística, Geografía e Informática. (2009). Prontuario de información geográfica municipal de los Estados Unidos Mexicanos. Soledad de Doblado, Veracruz de Ignacio de la Llave. http://www3.inegi.org.mx/contenidos/app/mexicocifras/datos_geograficos/30/30148.p df. Consultado: 13 May, 2018.

334


Rev Mex Cienc Pecu 2021;12(2):318-336

30. Norma Oficial Mexicana NOM-243-SSA1-2010. Productos y servicios. Leche, fórmula láctea, producto lácteo combinado y derivados lácteos. Disposiciones y especificaciones sanitarias. Métodos de prueba. Secretaría de Salud. México, DF. 2010. 31. Alais C. Ciencias de la leche: principio de técnica lechera. 12a ed. México: CECSA; 1998. 32. Murphy PG. Sulfuric acid cleanup of animal tissues for analysis of acid-stable chlorinated hydrocarbon residues. J AOAC 1972;55:1360-1362. 33. Su GCC. A comparison of statistical and empirical detection limits. J AOAC International 1998;81:105-110. 34. Pandit GG, Sahu SK. Assessment of risk to public health posed by persistent organochlorine pesticide residues in milk and milk products in Mumbai, India. J Environ Monit 2002;4:182-185. 35. Cervera P, Clapes J, Rigolfas R. Alimentación y dietoterapia. 3ª ed. Madrid: McGrawHill Interamericana; 1999. 36. INEGI. Instituto Nacional de Estadística, Geografía e Informática. Consumo per cápita de alimentos en México. Mexico. 2002. 37. Thoulon-Page Ch. Cuaderno de dietética: Alimentación de las personas sanas. 2a ed. Barcelona: Masson; 1995. 38. Ziegler EE, Filer LJ. Conocimientos actuales sobre nutrición. Publicación Científica No. 565. 7a ed. Whasington, DC, EUA: Organización Panamericana de la Salud - Instituto Internacional de Ciencias de la Vida; 1997. 39. FAO/WHO. Food and Agriculture Organization and World Health Organization. Guidelines for Predicting Dietary Intake of Pesticide Residues (revised). Global Environment Monitoring System – Food Contamination Monitoring and Assessment Programme (GEMS/Food) in collaboration with the Codex Committee on Pesticide Residues WHO/FSF/FOS/97.7. Switzerland: World Health Organization. 1997. 40. Pardío VT, Waliszewski KN, Landín LA, Bautista RG. Organochlorine pesticide residues in cow’s milk from a tropical region of Mexico. Food Addit Contam 2003;20:259-269. 41. Gutiérrez R, Ruíz JL, Ortiz R, Vega S, Schettino B, Yamazaki A, et al. Organochlorine pesticide residues in bovine milk from organic farms in Chiapas, Mexico. Bull Environ Contam Toxicol 2012;89:882-887. 42. ATSDR. Agency for Toxic Substances and Disease Registry. Toxicological profiles of toxic substances. US Department of Health and Human Services, Public Health Service, Atlanta, GA. 2005. http:/www.atsdr.cdc.gov. Accessed: May 13, 2018. 335


Rev Mex Cienc Pecu 2021;12(2):318-336

43. Bajwa U, Singh K. Effect of handling and processing on pesticide residues in food- a review. J Food Sci Technol 2014;51:201-220. 44. EPA. Environmental Protection Agency. Guidelines for carcinogenic risk assessment. Federal Register 51:33992-34003. 1986. 45. Arriaga C, Heredia D, Martínez C, Rayas A. Importancia de los sistemas de producción de leche a pequeña escala en México: ICAR-UAM. México. 2012. 46. Martiń ez CCJ, Cotera RJ, Zavaleta JA. Características de la producción y comercialización de leche bovina en sistemas de doble propósito en Dobladero Veracruz. Rev Mex Agroneg 2012;16:816-824. 47. FAO/WHO. Food and Agriculture Organization and World Health Organization. Orientaciones para el estudio de las ingestas alimentarias de contaminantes químicos. Ginebra: Organización Mundial de la Salud 1987;87:19-23. 48. Mnif W, Hadj AI, Bouaziz A, Bartegi A, Thomas O, Roig B. Effect of endocrine disruptor pesticides: A review. Int J Environ Res Public Health 2001;8:2265-2303.

336


https://doi.org/10.22319/rmcp.v12i2.5600 Artículo

Composición fisicoquímica, rendimiento y aceptación sensorial del queso fresco Coalho obtenido a partir de leche de vaca cebú

Ingrid Laíse Silvestre de Oliveira a Adriano Henrique do Nascimento Rangel a Rodrigo Coutinho Madruga b Dorgival Morais de Lima Júnior c Rhaabe Dayane da Silva Gomes a Danielle Cavalcanti Sales a Juliana Paula Felipe de Oliveira d Joadilza da Silva Bezerra e

a

Universidade Federal do Rio Grande do Norte (UFRN), Unidade Acadêmica Especializada em Ciências Agrárias, Macaíba, Brazil. b

Associação Brasileira dos Criadores de Zebu (ABCZ), Brazil.

c

Universidade Federal Rural do Semi-Árido (UFERSA), Departamento de Ciencias Animais. Massoró, Brazil. d

Universidade Federel Rural de Pernambuco, Departamento de Zootecnia. Recife, Brazil.

e

Universidade Federal Rural de Pernambuco (UFRPE), Departmento de Morfologia e Fisiologia Animal, Recife/PE, Brazil.

*Autor de correspondencia: jupaula.oliv@yahoo.com.br

337


Rev Mex Cienc Pecu 2021;12(2):337-352

Resumen: Los objetivos fueron evaluar el efecto de la raza sobre el polimorfismo genético de la kappa-caseína, la composición fisicoquímica de la leche y del queso Coalho, y el rendimiento del queso, así como evaluar el efecto de diferentes periodos de almacenamiento sobre la aceptación sensorial del queso Coalho obtenido a partir de leche de vacas Guzerat, Gyr y Sindi. Se seleccionaron veinte (20) vacas de razas cebú y se obtuvieron sus valores de frecuencia del polimorfismo genético de la kappa-caseína. La leche se sometió a un análisis de grasa, proteína, lactosa, sólidos no grasos y sólidos totales, conductividad eléctrica y cuenta de células somáticas. Los quesos se sometieron a análisis de grasa, proteína, sólidos totales, pH, humedad y rendimiento (g ST/L). Se evaluaron los atributos apariencia, aroma, textura y sabor en los días 1, 25 y 46 de almacenamiento. La frecuencia total fue de 0.70 para el genotipo AA y 0.30 para el genotipo AB. No hubo diferencias significativas en la composición de la leche entre las razas estudiadas. Sin embargo, hubo diferencias en la composición fisicoquímica (exceptuando la proteína) y el rendimiento de los quesos; pero todas las razas mostraron un rendimiento real similar. El periodo de almacenamiento tuvo efectos observables sobre los atributos sensoriales de los quesos en las diferentes razas, con la excepción de su apariencia. La leche de las razas Guzerat, Gyr y Sindi constituye una excelente materia prima para la producción de cuajada y garantiza una aceptación sensorial satisfactoria del producto a los días 1, 25 y 46 de almacenamiento. Palabras clave: Bos taurus indicus, Raza, Consumidor, Producto lácteo, Almacenamiento.

Recibido: 21/01/2020 Aceptado: 24/09/2020

Introducción El ganado cebú (Bos taurus indicus) se importó de la India a Brasil en el siglo XIX. Representa más del 80 % del hato nacional(1) debido a su adaptabilidad y rendimiento en condiciones de clima tropical y tiene una importante participación en el éxito de la ganadería en el país. Las vacas cebú constituyen el grueso del hato lechero brasileño, incluidos sus cruces con razas especializadas (Bos taurus taurus) en la producción de leche, especialmente la raza holandesa(2). Brasil es el mayor inversor en la mejora genética del ganado cebú en el mundo(3), con proyectos estratégicos de mejora genética de animales cebúes con aptitud

338


Rev Mex Cienc Pecu 2021;12(2):337-352

lechera, principalmente Gyr y Guzerat. Los datos actuales de las existencias de estas acciones muestran que las medias de producción a 305 d de las razas Gyr, Guzerat y Sindi son de 11.25 kg(4), 7.46 kg(5) y 5.59 kg(6), respectivamente. Las características de producción y calidad de la leche están directamente influidas por los factores ambientales, la nutrición, la genética y la propia fisiología del animal(7). La raza es un factor genético con un efecto relevante en el rendimiento productivo de los animales lecheros. La fisiología de una vaca especializada en la producción de leche le permite producir un gran volumen, pero con baja concentración de sólidos, a diferencia de una vaca cebú pura con aptitud lechera. Esto ocurre porque el nivel de producción de la vaca está relacionado negativamente con los porcentajes de grasa, proteína y sólidos totales de la leche(8,9). Las proteínas de la leche pueden clasificarse en caseínas y proteínas del suero. Las caseínas constituyen aproximadamente el 80 % de las proteínas de la leche y se subdividen en 4 fracciones: α1, α2, β y K. En la especie bovina, los marcadores genéticos se utilizan para seleccionar animales mediante la determinación de pares de genes (A y B), presentes en las caseínas de la leche, como la kappa-caseína. En términos generales, el alelo A tiene un efecto significativo en la producción de leche, y el alelo B, en la concentración de proteína y grasa, lo que da como resultado un mejor rendimiento de los productos lácteos(10). Se han encontrado varios polimorfismos para esta proteína, que es la responsable de estabilizar la leche contra los tratamientos térmicos y la formación de coágulos(11). La posibilidad de utilizar la leche para obtener productos lácteos es una importante oportunidad para añadir valor a la leche bronca, diversificar la cartera de productos e impulsar la competitividad y rentabilidad del sector. El queso Coalho es un derivado lácteo tradicional de la cultura de la región nordeste de Brasil. Es un queso obtenido por un proceso de fermentación y coagulación de leche bronca o pasteurizada. Ya se pueden encontrar en el mercado quesos curados de razas cebúes, lo que demuestra el potencial lechero de estas razas para la producción de queso. Sin embargo, hay pocos estudios sobre el queso obtenido a partir de leche de cebú. La evaluación sensorial es el método más común para analizar la calidad de los alimentos(12). Los atributos sensoriales de los productos pueden medirse mediante pruebas específicas, identificando la importancia de cada uno de ellos para su aceptación por parte de los consumidores(13). Por lo tanto, los objetivos fueron evaluar el efecto de la raza sobre el polimorfismo genético de la kappa-caseína, la composición físico-química de la leche y del queso Coalho, y sobre el rendimiento del queso; y evaluar el efecto de diferentes períodos de almacenamiento sobre la aceptación sensorial del queso Coalho obtenido a partir de leche de vacas Guzerat, Gyr y Sindi. 339


Rev Mex Cienc Pecu 2021;12(2):337-352

Material y métodos Determinación del polimorfismo genético de la kappa-caseína Los pasos entre la extracción del ADN y la electroforesis capilar se desarrollaron en el Centro de Genotipado del Laboratorio de Genética Animal (Belo Horizonte, Minas Gerais, Brasil), utilizando protocolos desarrollados internamente. El ADN genómico se extrajo del bulbo capilar de cada animal, produciendo un total de 22 muestras. Para la lisis celular se utilizaron soluciones tampón que contenían un detergente y los reactivos tris-hidroximetil aminometano (Tris), cloruro de sodio (NaCl) y ácido etilendiaminotetraacético (EDTA). Tras la extracción del ADN, las muestras se sometieron a la técnica de reacción en cadena de la polimerasa (PCR) de las regiones STR, utilizando un termociclador Veriti™ (Applied Biosystems, Forster City, CA, EEUUA). Los microtubos con los reactivos necesarios para la reacción enzimática se colocaron en el termociclador: Fragmentos de ADN extraídos del bulbo capilar, agua libre de ADN, desoxirribonucleótidos trifosfatos (dNTPs), cebadores oligonucleótidos, enzima ADN polimerasa, magnesio y solución tampón. Los cebadores utilizados en la reacción fueron fabricados por Life Technologies. Los fragmentos de ADN amplificados se sometieron a electroforesis capilar en un sistema automatizado de fluorescencia inducida por láser (Secuenciador ABI 3500xL) para verificar la calidad y la concentración de ADN en cada muestra. La lectura de las bandas se realizó con el programa GeneMapper®. La migración de los fragmentos se indujo mediante electroforesis capilar, y luego éstos se detectaron mediante un rayo láser y se alinearon por tamaños. En la misma corrida se aplicaron estándares de peso molecular y muestras conocidas AA, AB y BB. Por último, se obtuvieron las frecuencias genotípicas y alélicas de las tres razas evaluadas tras identificar los polimorfismos genéticos del gen de la kappa-caseína mediante la técnica de PCR.

Recolección de materias primas La leche bronca para producir el queso Coalho se obtuvo de las hembras de las razas Guzerat (n= 3), Gyr (n= 7) y Sindi (n= 10). El procedimiento de recolección para el análisis de la composición fisicoquímica de la leche se realizó manualmente, utilizando un

340


Rev Mex Cienc Pecu 2021;12(2):337-352

cucharón de acero inoxidable debidamente higienizado tras la homogeneización de la leche. Las muestras se almacenaron en frascos de plástico con un volumen de 40 ml, identificadas individualmente, y mantenidas en un contenedor térmico con hielo para conservar la temperatura entre 4 y 7 °C hasta el procedimiento de análisis en el laboratorio de calidad de la leche de la Universidad Federal de Rio Grande do Norte. También se recogieron 15 L de leche de cada raza para la producción de quesos Coalho, los cuales se conservaron en recipientes isotérmicos y se enviaron a la Unidad de Procesamiento Lechero (UPL) de la UFRN.

Producción del queso Coalho Para la producción de queso a partir de las tres razas se siguió el mismo proceso tecnológico de fabricación que se llevó a cabo en la UPL de la UFRN. Las muestras de leche de las tres razas para la producción de los quesos se sometieron por separado a la pasteurización LTLT (a baja temperatura, por tiempo prolongado 65 °C/30 min). Tras el tratamiento térmico, se enfriaron a 35 °C para la adición de cuajo (renina). Tras la homogeneización de los ingredientes (leche y cuajo), la masa se dejó reposar durante 40 minutos hasta alcanzar el punto de cuajado, antes de cortar. A continuación, se calentó la cuajada, agitándola manualmente, hasta alcanzar los 45 °C. A continuación, se extrajo parcialmente el suero para salar la cuajada. Los procedimientos de pre-prensado y conformación se realizaron en el molde en el cual se prensó posteriormente la cuajada y se la volteó. El proceso de producción del queso se muestra en la Figura 1 y concluye con el envasado de queso al vacío y su almacenamiento a 4 °C en una cámara de refrigeración. La materia prima, los ingredientes y los envases utilizados para la producción de queso se manipularon de acuerdo con las buenas prácticas de fabricación de productos lácteos.

Análisis fisicoquímico de la leche En la leche de las tres razas se analizaron los porcentajes de grasa, proteína, lactosa, sólidos no grasos (SNGL) y sólidos totales (ST) por el método de absorción de infrarrojos en el equipo DairySpec FT® (Bentley Instruments Inc., Chaska MN, EEUUA). La conductividad eléctrica de la leche se midió con un conductivímetro digital Quimis® - ISO 9001 (SP, BR). La cuenta de células somáticas (CCS) se estimó utilizando el kit Somaticell® (Madasa, São Paulo, Brasil), siguiendo las recomendaciones del fabricante. El valor de la CCS varió de 69,000 células/mL a 1'970,000 células/mL.

341


Rev Mex Cienc Pecu 2021;12(2):337-352

Figura 1: Diagrama de flujo de la producción del queso Coalho

Análisis fisicoquímico del queso Tras la elaboración de los quesos, se extrajeron 10 gramos de cada muestra, mismos que fueron triturados en una batidora Philipis Walita® (R12134) para reducir las partículas, que luego se sometieron a análisis fisicoquímicos de proteínas, grasas, sólidos totales, cenizas y pH. El porcentaje de proteínas se determinó según el procedimiento de Cecchi(14). El contenido de grasa se determinó extrayendo el disolvente de éter de petróleo a 90 °C durante 1 h con un extractor Ankom® XT15 (NY, EEUUA), siguiendo las instrucciones del equipo. El cálculo del porcentaje de sólidos totales de las muestras se realizó mediante el método de secado en estufa a 105 °C durante 6 h, y el de las cenizas, por combustión de la materia orgánica en horno de mufla a 600 °C durante 4 h(15). El pH de los quesos se determinó utilizando un medidor de pH Lucadema® 210 (SP, BR) previamente calibrado, con tres lecturas por muestra. Todos los análisis fisicoquímicos de los quesos se realizaron a los 46 días de maduración.

342


Rev Mex Cienc Pecu 2021;12(2):337-352

Cálculo del rendimiento del queso Coalho El rendimiento de los quesos se expresó en gramos de sólidos totales de queso por litro de leche (g ST/L) y se calculó mediante la fórmula(16):

en la que, Y= rendimiento; W= kilos de quesos obtenidos; TS= porcentaje de sólidos totales de los quesos; V= volumen de leche utilizado.

Análisis sensorial La prueba de aceptación sensorial de las muestras de queso Coalho se llevó a cabo en la Unidad de Ciencias Agrícolas - Escuela Agrícola de Jundiaí (EAJ), en el campus de la Universidad Federal de Rio Grande do Norte (UFRN), con 60 participantes de ambos sexos (de entre 18 y 60 años), quienes juzgaron los atributos de apariencia, aroma, textura y sabor de los quesos Coalho a los días 1, 25 y 46 de vida útil. La selección de los evaluadores se realizó sobre la base del consentimiento voluntario y la ausencia de reacciones alérgicas a la leche y los productos lácteos. La evaluación sensorial de las muestras de queso de Coalho se realizó mediante una escala hedónica de 9 puntos, anclada en los extremos 1 (no me gustó en absoluto) y 9 (me gustó mucho)(17). Las pruebas fueron realizadas individualmente por los participantes en un entorno con humedad y temperatura controladas (sala climatizada con aire acondicionado) en el que se utilizó luz blanca, con lo cual se garantizaron las condiciones ambientales idóneas para realizar el análisis sensorial. Antes de iniciar las evaluaciones los participantes fueron instruidos en todos los procedimientos para la realización de las pruebas. Se les ofreció una pequeña porción de una galleta baja en sal y una ración de agua simple sin gas a temperatura ambiente para ser consumida entre las diferentes muestras a fin de limpiar el paladar y eliminar cualquier sabor residual. Las muestras de queso Coalho (25 g) destinadas a las pruebas se conservaron en cajas isotérmicas con hielo hasta que se sirvieron a los catadores en vasos de plástico desechables blancos de 50 ml. Las muestras se codificaron con números compuestos por tres dígitos aleatorios utilizando una tabla de números aleatorios.

343


Rev Mex Cienc Pecu 2021;12(2):337-352

Análisis de datos El análisis de los datos se realizó mediante estadísticas descriptivas por media y desviación estándar. Se realizó un análisis de varianza (ANDEVA) de los datos para evaluar el efecto de la raza sobre las características físico-químicas de la leche y los quesos, así como sobre el rendimiento del queso. Cada evaluador asignó su preferencia para las evaluaciones de aceptación sensorial de los quesos mediante pruebas de aceptabilidad, y los resultados se determinaron con base en el promedio final de los puntajes dados por los jueces a los diferentes atributos evaluados en el análisis sensorial, y se sometieron a un análisis de varianza (ANDEVA). Se utilizó la prueba de Tukey al 5% de significancia para comparar las medias de todos los análisis mediante el software SAS (versión 9.0).

Resultados y discusión Polimorfismo genético de la kappa-caseína Los valores de frecuencia del polimorfismo genético de la kappa-caseína en las razas Guzerat, Gyr y Sindi se muestran en el Cuadro 1. Hubo una frecuencia total de 0.70 (n= 14) para el genotipo AA, 0.30 (n= 6) para el genotipo AB y 0 para el genotipo BB. En este estudio no se encontraron genotipos BB homocigotos. Estos resultados concuerdan con los reportados en otros estudios, en los que se mostró una mayor frecuencia de los genotipos AA y AB, y ninguna observación del homocigoto BB en las razas lecheras(18,19). Cuadro 1: Distribución de la frecuencia de polimorfismo del gen de la kappa-caseína para las razas analizadas Polimorfismo de la kappa-caseína Alelos Raza AA AB BB A B Guzerat 0.66 0.33 0.83 0.17 Gyr 1 0 1 0 Sindi 0.50 0.50 0.75 0.25 Total 0.70 0.30 0.85 0.15 La mayor frecuencia del alelo A en los rebaños de cebú brasileños puede deberse al origen de los animales y a la selección de la producción de carne al principio de su explotación (20), ya que en los animales cebúes indios es más frecuente el alelo B que en el promedio de los animales brasileños. Otro factor es el número de animales seleccionados a nivel de rebaño efectivo. Es posible que para el alelo A se elijan animales homocigotos o se utilicen los heterocigotos en menor proporción.

344


Rev Mex Cienc Pecu 2021;12(2):337-352

La frecuencia de polimorfismo del gen de la kappa-caseína para el alelo B de las tres razas se aproxima a la reportada por otros(21). Los autores analizaron el polimorfismo genético de la kappa-caseína en animales cebúes brasileños y encontraron una frecuencia del 30 %, 110 % y 18 % del alelo B en Sindi (n= 55), Gyr (n= 150) y Guzerat (n= 69), respectivamente. La selección de animales AB o BB en el genotipo de la kappa-caseína es importante para la producción de derivados lácteos, ya que el alelo B se correlaciona con los parámetros de composición química de la leche, principalmente la grasa y la proteína, y favorece el aumento del rendimiento y la calidad del queso(10). El rendimiento quesero de las vacas con genotipo BB es mayor en comparación con la leche de las vacas AA, y la variante B es determinante en el proceso de eficiencia en el tiempo de coagulación de la leche. El par genético BB para la kappa-caseína se correlaciona con unas características de procesado superiores, ya que las vacas con genotipo BB para la kappa-caseína obtienen un tiempo de coagulación más corto para los quesos, una formación de cuajada de mayor densidad debido al menor tamaño de las micelas, así como un mayor rendimiento del queso en relación con la leche de las vacas con genotipo AA para la kappa-caseína(22,23). Por lo tanto, esta variante puede utilizarse como criterio de selección en los programas de cría en las explotaciones con fines queseros. El alelo B también tiene una influencia positiva en el contenido de proteína y grasa de la leche(24,25); sin embargo, al igual que en el presente trabajo, algunos investigadores(26,27) no encontraron ningún efecto en el porcentaje de proteína producido en animales con genotipos diferentes. Confirmando los estudios mencionados, la raza Sindi obtuvo la mayor frecuencia del alelo B (25 %) en comparación con las demás razas. Este resultado puede haber implicado el mayor porcentaje de grasa y sólidos totales y rendimiento en el queso obtenido de la leche de la raza Sindi.

Evaluación fisicoquímica de la leche de vaca cebú El Cuadro 2 muestra las medias y la desviación estándar de la composición fisicoquímica de la leche de las tres razas. No hubo diferencias significativas (P>0.05) en la composición de la leche entre las razas estudiadas. Los resultados similares entre las razas pueden atribuirse a que las condiciones de manejo empleadas son las mismas y el potencial genético para la composición de la leche es similar.

345


Rev Mex Cienc Pecu 2021;12(2):337-352

Cuadro 2: Composición fisicoquímica de la leche de las razas cebúes Guzerat, Gyr y Sindi Raza Ítem Valor de P Guzerat Gyr Sindi Grasa, % 5.14 + 1.08 4.81 + 0.67 5.35 + 1.06 0.14 Proteína, % 3.12 + 0.48 3.13 + 0.34 3.16 + 0.37 0.24 Lactosa, % 4.66 + 0.71 4.68 + 0.51 4.72 + 0.56 0.21 SNGL, % 8.51 + 1.29 8.52 + 0.92 8.60 + 1.02 0.12 ST, % 14.16 + 1.8 13.98 + 1.41 14.65 + 1.79 0.18 3 CCS, 10 /ml 333.33 + 348.53 243.10 + 248.77 256.87 + 444.65 0.62 CE, mS/cm 3.94 + 0.33 4.07 + 0.35 3.81 + 0.32 0.34 SNGL= sólidos no grasos de la leche; ST= sólidos totales; CCS= cuenta de células somáticas; CE= conductividad eléctrica.

Dado que no hay diferencias entre las razas, especialmente en los porcentajes de grasa y proteína, existe un potencial similar de las tres razas para producir estos componentes. La concentración total de sólidos en la leche destaca como base principal para el pago por la calidad en la mayoría de los países con un alto índice de desarrollo y en algunos lugares de Brasil. Al estudiar la conductividad eléctrica (CEL) y la cuenta de células somáticas (CCS) de la leche de vaca cebú, Moura et al(28) estimaron valores más altos que los reportados en el presente estudio, el cual encontró 1'629,000 células/ml para la raza Gyr y 1'356,000 células/ml para la raza Guzerat; no obstante, los resultados encontrados para la CEL son cercanos con resultados de 3.88 y 3.59 mS/cm para las razas Gyr y Guzerat, respectivamente.

Evaluación fisicoquímica de los quesos lácteos de vaca cebú El Cuadro 3 muestra los valores medios de la composición fisicoquímica del queso Coalho de las razas cebúes Guzerat, Gyr y Sindi. Los resultados demuestran que el contenido de proteínas fue similar para los quesos evaluados (P>0.05). Los quesos de la raza Sindi presentaron mayores porcentajes de grasa y sólidos totales, así como un valor de pH más alto en comparación con los obtenidos de la leche de las otras razas. Por otra parte, el queso de Guzerat obtuvo una menor concentración de grasa y una mayor concentración de cenizas, mientras que la raza Gyr tuvo un valor de pH más bajo. El porcentaje de grasa expresado en relación con los sólidos totales evita los errores de medición en el rendimiento que se producen debido a la pérdida de humedad. Descritos en base seca, los valores de grasa de los quesos corresponden respectivamente a: 48.12 %, 53.79 % y 54.83 % para las razas Guzerat, Gyr y Sindi. Así, los resultados encontrados están dentro de los establecidos por la legislación para el queso de Coalho(29), que define como valores estándar entre el 346


Rev Mex Cienc Pecu 2021;12(2):337-352

35 % y el 60 % de grasa en los sólidos totales. El reglamento establece además que el queso Coalho puede definirse como semigraso (25.0 a 44.9 %), graso (45.0 a 59.9 %) o extra graso (mínimo de 60.0 %) en relación con el contenido de grasa, por lo que los quesos de este estudio se clasifican como quesos grasos. Cuadro 3: Composición fisicoquímica y rendimiento del queso Coalho de las razas cebúes Guzerat, Gyr y Sindi (Media + DE) Raza Ítem Valor de P Guzerat Gyr Sindi Grasa, % 24.26 + 0.51c 27.77 + 0.73b 32.23 + 1.26a <0.05 Proteína, % 18.77 + 0.83 17.93 + 1.39 17.91 + 0.55 0.15 b b a Sólidos totales, % 50.41 + 1.06 51.62 + 0.07 58.78 + 1.13 <0.05 a b b Cenizas, % 3.30 + 0.01 2.58 + 0.24 2.49 + 0.30 <0.05 b c a pH 6.92 + 0.02 6.28 + 0.05 7.16 + 0.14 <0.05 c b a Rendimiento, g ST/L 82.25 83.33 93.68 <0.05 abc

g ST/L: gramos de sólidos totales por litro. Las medias con letras diferentes en la misma línea representan diferencias (P<0.05).

La raza Sindi presentó un mayor porcentaje de sólidos totales (ST) en el queso, lo que confiere un mayor potencial de rendimiento (g de ST/L) en la producción del derivado. Todavía no existe una normativa que estandarice los parámetros fisicoquímicos de la proteína y la ceniza, ya que el proceso de producción de la mayoría de los quesos de Coalho sigue siendo artesanal. Los valores de pH oscilaron entre 6.28 y 7.16. Estos resultados fueron superiores a los encontrados por Araújo y Nassu(30) en la evaluación del pH del queso Coalho industrializado y artesanal, los cuales variaron de 5.10 a 5.80. El queso Sindi tuvo el pH más alto (7.16). La raza Sindi obtuvo un rendimiento superior (P<0.05) de queso Coalho (g ST/L) debido a la mayor concentración de sólidos totales presentes en la leche. Sin embargo, en el análisis del rendimiento real (l/kg), todas las razas obtuvieron valores similares, con la utilización de 6.13 (Guzerat), 6.05 (Gyr) y 6.27 (Sindi) litros de leche para producir 1 kg de queso, lo cual confirma el potencial de todas las razas para la producción de queso.

347


Rev Mex Cienc Pecu 2021;12(2):337-352

Evaluación sensorial del queso Coalho de leche de vaca cebú Los resultados obtenidos del análisis sensorial del queso Coalho elaborado con leche de las tres razas de cebú en diferentes periodos de almacenamiento se muestran en el Cuadro 4. Las puntuaciones sensoriales variaron de 6.32 (gustó ligeramente) a 7.98 (gustó moderadamente). Los quesos Coalho de diferentes razas presentaron un aspecto similar a lo largo de todo el periodo de almacenamiento (P>0.05). Cuadro 4: Puntuaciones sensoriales obtenidas en la prueba de aceptación del queso Coalho de leche de cebú en diferentes periodos de almacenamiento (Medias + DE) Parámetros sensoriales Raza Día Aspecto Aroma Textura Sabor c abc 7.18+1.50 1 6.58+1.53 7.56+0.98 7.70+1.27a 25 7.31+1.48 Guzerat 6.81+1.60bc 7.55+1.18abc 6.51+1.47bc 46 7.38+1.13 7.37+1.10abc 7.71+0.99ab 6.83+1.46bc 1 7.64+1.15 6.84+1.48bc 7.85+1.02a 7.98+1.03a 25 7.59+1.2 Gyr 7.67+1.01a 7.16+1.53abc 6.44+1.49c 46 7.63+0.98 7.58+0.99a 7.05+1.32bc 6.57+1.44bc 1 7.60+1.26 6.72+1.56c 7.46+1.19abc 7.28+1.47a 25 7.36+1.28 Sindi 6.91+1.51abc 6.96+1.33c 6.32+1.41c 46 7.52+1.15 7.19+1.47abc 6.91+1.37c 6.60+1.63bc 0.12 <0.05 <0.05 <0.05 Valor de P abc

Las medias en la misma columna con letras diferentes son significativamente diferentes (P<0.05).

Al primer día de almacenamiento, se observó que los quesos obtenidos a partir de la leche de las diferentes razas estudiadas eran similares en aspecto, aroma y sabor (P>0.05), mientras que sólo la textura del queso Coalho de Guzerat (7.71) difería (P<0.05) de la del queso de Sindi (6.91) a los 46 d de almacenamiento, alcanzando una mayor puntuación. El aroma de los quesos en el primer día de almacenamiento obtuvo puntuaciones sensoriales más bajas (ligeramente apreciadas), posiblemente debido al efecto de la proteólisis coagulante, que puede afectar a la disponibilidad de aminoácidos para la degradación enzimática(31). Durante la maduración del queso se generan diferentes compuestos aromáticos a lo largo del periodo de almacenamiento debido a varias reacciones bioquímicas(32,33). Los quesos elaborados con leche de vaca de las razas Guzerat y Sindi alcanzaron una aceptación sensorial similar (P>0.05) para el atributo textura durante todo el periodo de evaluación, mientras que el queso elaborado con leche de vacas Gyr mostró una menor 348


Rev Mex Cienc Pecu 2021;12(2):337-352

aceptación (7.05) a los 46 días de almacenamiento (P<0.05) que al primer día (7.85). Según Ordoñez(34), la proteólisis provoca cambios en la textura y consistencia de los quesos, que pierden progresivamente su estructura proteica con el paso del tiempo, lo que les confiere mayor suavidad. Otro aspecto a tener en cuenta es que el queso Coalho se caracteriza por la consistencia firme y "gomosa" producida por la agregación de las moléculas de grasa en las micelas de caseína, las cuales forman una especie de esponja, por lo que los quesos Coalho con mayor contenido en grasa, como el queso de Sindi, pueden ser más blandos y menos consistentes, y por lo mismo su aceptación sensorial con estas características es menor. Para el atributo del sabor, los quesos obtuvieron mejores (P<0.05) puntuaciones sensoriales (moderadamente agradables) al primer día de vida útil. Esto se debe a que la composición química del queso (grasa, proteína y lactosa) influye en el sabor del producto, especialmente cuando hay maduración. Este comportamiento se produce en función de las lipasas que actúan sobre los lípidos, las cuales forman ácidos grasos libres de cadena media y corta, ésteres, cetonas y aldehídos, interfiriendo en las características sensoriales del queso(35). El mercado de consumo es cada vez más exigente a fin de lograr una mayor competitividad y aceptación por parte de los consumidores, por lo que el sector lácteo ha buscado una mayor variedad, así como una mejor calidad y productividad. Los productos que alcanzan una larga vida útil sin afectar a sus propiedades sanitarias, fisicoquímicas y sensoriales son alternativas para impulsar el comercio mayorista y de exportación.

Conclusiones e implicaciones La leche de las razas Guzert, Gyr y Sindi presenta características fisicoquímicas favorables para la producción de queso Coalho, con rendimientos superiores al 40 %, por lo que constituye una excelente materia prima para la producción de derivados. Además, los quesos presentaron una aceptación sensorial satisfactoria durante los periodos de almacenamiento estudiados. Agradecimientos Los autores desean agradecer a la Asociación Brasileña de Criadores de Cebú - Oficina Técnica Regional y al Núcleo Noreste de Criadores de Sindi, Natal-RN, Brasil. Agradecemos a la fundación CAPES su apoyo financiero.

349


Rev Mex Cienc Pecu 2021;12(2):337-352

Literatura citada: 1. ABCZ. Associação Brasileira de Criadores de Zebu. Pecuária Brasileira. Produção a Pasto 2012-2018. 2012. 2. Lima JAM, Coelho SG, Ruas JRM, Lana AMQ, Saturnino HM, Reis RB. Efeito do aumento da frequência de ordenhas no início da lactação sobre produção, composição do leite e características reprodutivas de vacas mestiças Holandês-Zebu. Arq Bras Med Vet Zootec 2011;63(5):1160-1166. 3. Neiva R. Genômica promove seleção mais veloz. In: XXI Ciência para a vida Embrapa: geração de valor genômico. (15nd ed.). Brasília, DF: Embrapa; 2017. 4. Panetto JCC, Silva MVGB, Verneque RS, Machado MA, Fernandes AR, Martins MF, et al. Programa Nacional de Melhoramento do Gyr Leiteiro – Sumário Brasileiro de Touros – Resultado do Teste de Progênie. Juiz de Fora, MG: Embrapa; 2018. 5. Bruneli FAT, Peixoto MGCD, Santana-Junior ML, Pereira RJ, Arbex WA, Penna VM, et al. Programa Nacional de Melhoramento do Guzerá para leite: resultados do teste de progênie, do programa de melhoramento genético de zebuínos da ABCZ e do núcleo MOET. Juiz de Fora, MG: Embrapa; 2019. 6. Ventura HTV, Costa EV, Pereira MA, Silva FF, Josahkian LA, Silva EJS, et al. Sumário de Touros da Avaliação Genética Nacional das Raças Zebuínas Leiteiras: Gyr e Sindi. Uberaba, MG: ABCZ; 2018. 7. Dufour S, Fréchette A, Barkema HW, Mussell A, Scholl DT. Effect of udder health management practices on herd somatic cell count. J Dairy Sci 2011;94(2):563-579. 8. Campos PPL, Rangel AHN, Borba LHF, Urbano SA, Novaes LP, Galvão-Júnior JG, et al. Quality indicators of tank milk in different production systems of tropical regions. Semina Ciênc Agrar 2016;37(4):2807-2818. 9. Simioni JF, Duarte CR, Baretta M, Stefani LM, Lopes LS, Tizziani T. Qualidade do leite proveniente de propriedades com diferentes níveis de especialização. Semina Ciênc Agrar 2013;34(4):1901-1912. 10. Trakovická A, Moravčíková N, Navrátilová A. Kappa-casein gene polymorphism (CSN3) and its effect on milk production traits. Acta Fytotech Zootech 2012;15(3):6164. 11. Glantz M, Lindmark MH, Stålhammar H, Paulsson M. Effect of polymorphisms in the leptin, leptin receptor, and acyl-coenzyme A: diacylglycerol acyltransferase 1

350


Rev Mex Cienc Pecu 2021;12(2):337-352

(DGAT1) genes and genetic polymorphism of milk proteins on cheese characteristics. J Dairy Sci 2011;94(7):3295-3304. 12. Jo Y, Benoist DM, Ameerally A, Drake MA. Sensory and chemical properties of Gouda cheese. J Dairy Sci 2018;101(3):1967-1989. 13. Lawless HT, Heymann H. Sensory evaluation of food: principles and practices. 2nd ed. Springer; 2010. 14. Cecchi HM. Fundamentos teóricos e práticos em análise de alimentos. Campinas, SP: Editora Unicamp; 1999. 15. IAL. Instituto Adolfo Lutz. Métodos físico-químicos para análise de alimentos. São Paulo: Instituto Adolfo Lutz; 2008. 16. Saboya LV, Oliveira AJ, Furtado MM, Spadoti LM. Efeitos físico-químicos da adição de leite reconstituído na fabricação de queijo minas frescal. Ciênc Tecnol Alim 1998;18(4):368-378. 17. Dutcosky SD. Análise sensorial de alimentos. 4nd ed. Curitiba, PR: Champagnat; 2013. 18. Deb R, Singh U, Kumar S, Singh R, Sengar G, Sharma A. Genetic polymorphism and association of kappa-casein gene with milk production traits amon Frieswal (HF × Sahiwal) cross breed of Indian origin Iranian. J Vet Res 2016;4(15):406-408. 19. Veronezi ABS, Guaberto LM, Araujo DS, Martins TR. Genotipagem do gene kappa caseína e sua influência na porcentagem de caseína e produção de queijo frescal. Colloq Vitae 2017;9(1):45-51. 20. Del-Lama SN, Zago MA. Identification of the kappa-casein and beta-lactoglobulin genotypes in brazilian Bos indicus and Bubalus bubalis populations. Braz J Genet 1996;19(1):73–77. 21. Azevedo ALS, Nascimento CS, Steinberg RS, Carvalho MRS, Peixoto MGCD, Teodoro RL, et al. Genetic polymorphism of the kappa-casein gene in Brazilian cattle. Genet Molec Res 2008;7(3):623-630. 22. Sulimova GE, Ahani-Azari M., Rostamzadeh J, Mohammad-Abadi MR, Lazebny OE. K–casein gene (CSN3) allelic polymorphism in Russian cattle breeds and its information value as a genetic marker. Russian J Genet 2007;43(1):73-79. 23. Van-Eenennaam A, Medrano JF. Milk protein polymorphisms in California dairy cattle. J Dairy Sci 1991;74(5):1730-1742.

351


Rev Mex Cienc Pecu 2021;12(2):337-352

24. Heck JML, Schennink A, Van-Valenberg HJ, Bovenhuis H, Visker MH, Van-Arendonk JA, et al. Effects of milk protein variants on the protein composition of bovine milk. J Dairy Sci 2009;92(3):1192-1202. 25. Kučerová J, Matějíček A, Jandurová OM, Sørensen P, Němcová E, Štípková M, et al. Milk protein genes CSN1S1, CSN2, CSN3, LGB and their relation to genetic values of milk production parameters in Czech Fleckvieh. Czech J Ani Sci 2006;51(6):241-247. 26. Robitaille G, Britten M, Petitclerc D. Effect of a differential allelic expression of kappacasein gene on ethanol stability of bovine milk. J Dairy Res 2001;68(1):145-149. 27. Botaro BGL, Cortinhas YVR, Silva CS, Renno LFP, Palma F, Santos MV. Effect of the kappa-casein gene polymorphism, breed and seasonality on physicochemical characteristics, composition and stability of bovine milk. R Bras Zootec 2009;38(12):2447-2454. 28. Moura EO, Rangel AHN, Borba LHF, Galvão-Júnior JGB, Lima GF, Lima-Júnior DM, et al. Electrical conductivity and somatic cell count in zebu cow’s milk. Semina Ciênc Agrar 2017;38(5):3231-3240. 29. Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Regulamento técnico de identidade e qualidade de queijo de Coalho. Anexo II. Instrução Normativa Nº 30, de 26 de Junho de 2001. Brasília, DF: Diário Oficial da União de 16/07/01. 30. Araújo RS, Nassu RT. Caracterização físico-química de queijo de manteiga, queijo de Coalho e manteiga da terra, produzidos no estado do Rio Grande do Norte e do Ceará. R Hig Alim 2002;16(97):70-75. 31. Hailu Y, Hansen EB, Seifu E, Eshetu M, Petersen MA, Lametsch R, et al. Rheological and sensory properties and aroma compounds formed during ripening of soft brined cheese made from camel milk. Intern Dairy J 2018;81(1):122-130. 32. Mcsweeney PLH, Sousa MJ. Biochemical pathways for the production of flavour compounds in cheeses during ripening: A review. Le Lait 2000;80(3):293-324. 33. Urbach G. The flavour of milk and dairy products. II. Cheese: Contribution of volatile compounds. Int J Dairy Techn 1997;50(3):79-89. 34. Ordóñez JA. Tecnologia de Alimentos – Alimentos de origem animal I. São Paulo, Brazil: Artmed; 2005. 35. Alewijn M, Sliwinski EL, Wouters JTM. Production of fat-derived (flavour) compounds during the ripening of Gouda cheese. J Dairy Internat 2005;15(6-9):733740 352


https://doi.org/10.22319/rmcp.v12i2.5230 Artículo

El queso tradicional ranchero Jarocho: un estudio multidisciplinario aplicando un enfoque de la tipicidad

José Manuel Juárez-Barrientos a Pablo Díaz-Rivera b Emmanuel de Jesús Ramírez-Rivera c Jesús Rodríguez-Miranda d Cecilia Eugenia Martínez-Sánchez d Roselis Carmona-García d Erasmo Herman-Lara d*

a

Universidad del Papaloapan Campus Loma Bonita/DES Ciencias Agropecuarias, Av. Ferrocarril S/N, Cd. Universitaria, C.P. 68400 Loma Bonita, Oaxaca, México.

b

Colegio de Postgraduados. Campus Veracruz. México.

c

Tecnológico Nacional de México/Instituto Tecnológico Superior de Zongolica. México.

d

Tecnológico Nacional de México/Instituto Tecnológico de Tuxtepec. Depto. de Ingeniería Química y Bioquímica. Av. Dr. Víctor Bravo Ahuja No. 561. Col. Predio el Paraíso. 68350 Tuxtepec, Oaxaca, México.

* Autor de correspondencia: erasmo_hl@hotmail.com

Resumen: Lograr una protección legal-comercial de un tipo de queso requiere de una caracterización completa de éste. Empleando un enfoque de tipicidad, se llevó a cabo una evaluación del queso ranchero Jarocho del estado de Veracruz, México. Se colectaron datos sobre el sistema local de producción de leche, características fisicoquímicas y microbiológicas de la leche, del proceso de elaboración, así como características fisicoquímicas, microbiológicas y sensoriales del

353


Rev Mex Cienc Pecu 2021;12(2):353-369

queso. La mayoría de las lecherías que se encuestaron las ha operado una sola familia por tres generaciones. Hubo variabilidad en la composición química y microbiológica en los valores de color y textura, así como en la caracterización sensorial de los quesos entre productores. Esta variabilidad se relacionó con el tiempo de prensado, el número de vueltas dado el queso durante el prensado, y de las cantidades de sal y grasa vegetal agregadas. Los quesos de menor tiempo de prensado tuvieron un mayor contenido de humedad y menores contenidos de proteínas y grasas. Los recuentos bacterianos tanto en leche como en quesos, estuvieron vinculados con el uso de pruebas de calidad, implementación de cursos de capacitación, el material de los envases y superficies en las lecherías. Los valores de dureza de los quesos se incrementaron en respuesta a niveles más altos de sal y grasa vegetal añadida. El ángulo de tono (h°) de los quesos indicó una tonalidad cercana al amarillo (90°). La presencia de diferencias en los valores de cromaticidad (C*) se puede deber al uso de grasa vegetal. Los quesos con mayor contenido de humedad eran más brillantes (L*) y tenían menos saturación de color. La evaluación sensorial mostró que la tipicidad de este tipo de queso radica en las percepciones de los atributos de salado, aroma a leche, aroma a suero y olor a ordeño. La asignación de una protección legalcomercial para el queso ranchero Jarocho sería factible si se mejoran las medidas de saneamiento durante la recolección de la leche, se implementan buenas prácticas de elaboración de quesos en las lecherías y se evita adicionar la grasa vegetal al producto. Palabras clave: Leche cruda, Queso tradicional, Tipicidad, Sistemas lecheros.

Recibido: 26/01/2019 Aceptado: 05/08/2020

Introducción Los alimentos tradicionales expresan la identidad de una sociedad y son un símbolo de su patrimonio. La transmisión del conocimiento sobre los alimentos tradicionales ocurre entre las generaciones, normalmente de las personas mayores a los jóvenes(1). La tipicidad es un enfoque que permite el análisis de los alimentos tradicionales vinculados a un territorio específico. Este puede resultar de una trayectoria social de técnicas de fabricación, durante la cual se desarrolla un conocimiento colectivo a partir de la interacción entre los factores físico-biológicos y el ser humano. El presente estudio parte de la premisa de que se puede establecer la tipicidad de un tipo de queso cuando se integra la información sobre el sistema de producción de la leche, las características de la leche, los parámetros de procesamiento, y las características fisicoquímicas, microbiológicas y sensoriales del producto(2). La información que se incorpora para identificar una tipicidad se obtiene mayormente de estudios multidisciplinarios en los cuales las disciplinas no necesariamente interactúan, aunque sí tienen un objetivo común y por lo tanto sus resultados coinciden(3). Esta incorporación de datos es vital, ya que una caracterización incompleta puede impedir la obtención de algún tipo de derecho de propiedad intelectual(4). Para lograr esto es

354


Rev Mex Cienc Pecu 2021;12(2):353-369

necesario asegurar la existencia de una conexión entre los atributos extrínsecos de una región de origen (referido en la literatura como terroir, o terruño en español) y los atributos intrínsecos de un producto(5). En México, existen varios quesos tradicionales vinculados a una región específica(6). Sin embargo, la información disponible sobre ellos es limitada en relación con su calidad química y microbiológica, así como en el proceso de producción(7). También, hace falta información sobre los sistemas de producción y las características sensoriales. Bajo la normativa mexicana vigente los quesos mexicanos tradicionales enfrentan un serio reto porque las normas requieren el uso de la leche estandarizada y pasteurizada para que se pueda clasificar un queso como tal. Además, permiten la adición de leche en polvo y otros ingredientes lácteos y no lácteos, generando una proliferación de quesos de imitación(8). Otro impedimento a que los quesos tradicionales logren una protección comercial es la falta de experiencia de los productores en el marco legal. Sin embargo, no es inalcanzable tal protección, como se demuestra el caso del queso Cotija. Este es un queso con un fuerte vínculo con el territorio y la sociedad que lo produce, y se ha establecido su tipicidad por medio de diversos estudios que definen sus aspectos fisicoquímicos, microbiológicos y sensoriales. El queso Cotija es un queso pionero en el reconocimiento y la protección de los productos alimenticios tradicionales mexicanos ya que, a pesar de no haber obtenido la denominación de origen, se le ha otorgado la marca colectiva. Esto a su vez se ha traducido en un crecimiento en el mercado para el queso Cotija y delinea el camino a seguir para otros quesos mexicanos(9). El queso Jarocho es un queso tradicional tipo ranchero que se elabora con leche cruda de vaca. Es típico de las zonas ganaderas del estado de Veracruz, México. Su producción representa la principal fuente de ingresos de varias familias en la región. El objetivo del presente estudio fue aplicar el enfoque de la tipicidad al queso ranchero Jarocho usando un acercamiento interdisciplinario para generar los datos que eventualmente permitirán la protección de la marca. Se evaluaron el sistema local de producción de la leche, las características fisicoquímicas y microbiológicas de la leche, el proceso de elaboración del queso, y sus características fisicoquímicas, microbiológicas y sensoriales.

Material y métodos Área de estudio y caracterización del sistema de producción El estudio se llevó a cabo en el Distrito de Desarrollo Rural 008 en el Estado de Veracruz, México (18º11’ a 18º45’ N; 95º09’ a 96º37’ O). El distrito abarca siete municipios (Tierra Blanca, Tres Valles, Cosamaloapan, Ixmatlahuacan, Acula, Chacaltianguis and Tlacotalpan) las cuales producen el 90.5 % de la leche de vaca del distrito(10). Los datos sobre los sistemas de producción de la leche (sistema de ganado, alimentación y suplementación) se recolectaron por medio de un cuestionario semiestructurado. El tamaño de la muestra necesario se calculó

355


Rev Mex Cienc Pecu 2021;12(2):353-369

usando datos oficiales sobre el número de unidades de producción (UP) como un marco de muestreo (N= 5,924 σ²= 8.0). El cálculo se hizo con la fórmula que se presenta a continuación, considerando un nivel de confianza de 95% (Z = 1.96) y un error máximo permisible (B) de 0.5: 𝑁𝜎 2 (𝑁 − 1)𝐵 2 𝑛= + 𝜎2 𝑍2

El tamaño de muestra resultante fue n= 120 UP, sin embargo, se recolectaron datos de un total de 124 UP.

Caracterización del proceso de fabricación del queso y muestreo De cada uno de los siete municipios del distrito, se seleccionó a una lechería con base en la cantidad de leche procesada por día (un mínimo de 500 L). Se aplicó el cuestionario semiestructurado a los productores considerando una serie de variables (Cuadro 1). En cada una de las siete lecherías se tomaron cinco muestras de leche y cinco muestras de queso cada semana (35 muestras de leche y 35 muestras de queso por semana). Este proceso se llevó a cabo durante un periodo de cinco semanas, resultando en un total de 175 muestras de leche y 175 muestras de queso. Antes de comenzar el procesamiento del queso, en cada lechería se tomaron muestras de leche (500 ml) del tanque de almacenamiento utilizando botellas de vidrio de borosilicato estériles. Al final del proceso de producción, se tomaron muestras de queso (500 g) en bolsas estériles con un cierre hermético. Todas las muestras se tomaron por triplicado y se guardaron a 4 ± 1 °C durante su transporte al laboratorio y hasta su análisis.

Análisis químico y microbiológico de la leche y el queso Se evaluó el contenido de grasa, proteína y lactosa en la leche con un equipo ultrasónico Lactoscan S (Milkotronic Ltd., Nova Zagora, Bulgaria). También se midió el contenido de grasa, humedad y proteína de las muestras de queso(11). Para el análisis microbiológico, se diluyeron 10 ml de muestra de leche o 10 g de muestra de queso en 90 ml de peptona estéril y se homogeneizaron durante un minuto a 265 rpm en un homogeneizador Stomacher™ modelo 400 (Seward Limited, Reino Unido). Usando diluciones de 10-1, 10-2 y 10-3, se hizo el recuento bacteriano total (RBT) y el recuento total de coliformes (RTC) en la leche. También se hicieron los análisis de RBT y RTC en las muestras de queso, y además, se realizaron pruebas para determinar la presencia de hongos(11). Para cumplir con el supuesto de normalidad, los valores expresados como unidades formadoras de colonias (UFC) se sometieron a una transformación logarítmica y se expresaron como Log10 UFC para realizar el análisis estadístico.

356


Rev Mex Cienc Pecu 2021;12(2):353-369

Textura y color del queso

Se tomaron muestras cilíndricas del queso (2.5 cm diámetro y 3.0 cm altura) para las pruebas de la dureza y la adhesividad. Se utilizó un texturómetro TA-XT (Stable Micro Systems, Surrey, Reino Unido) con un disco acrílico de 35 mm de diámetro (A/BE35) y una tasa de compresión de 5 mm/seg. Se utilizó un colorímetro UltraScan™ Vis (HunterLab, Hunter Associates Laboratory Inc., Virginia, EE. UU.) para medir tres parámetros de color: L* (luminosidad), a* (coordenadas rojo/verde; +a indica rojo y -a indica verde) y b* (coordenadas amarillo/azul; +b indica amarillo y -b indica azul). Se calcularon la cromaticidad o saturación (C*) y el ángulo de tono (hº). Todos los análisis se llevaron a cabo por triplicado para cada muestra y usando tres puntos diferentes sobre la superficie del queso.

Análisis sensorial del queso

El análisis sensorial se llevó a cabo por un panel de ocho jueces capacitados. Se evaluaron un total de 14 aspectos: brillo (BR), poroso a la vista (PV), presencia de suero (PS), dureza al tacto (DT), cremosidad al tacto (CT), olor a leche (OL), olor a suero (OS), olor a ordeño (OO), Salado (SA), dureza en la boca (DB), aroma a plástico (AP), aroma a leche (AL), regusto a suero (RS) y regusto a leche (RL). Se utilizó una escala no estructurada de cero (baja intensidad) a nueve (alta intensidad). El atributo "Típico" (TI) se evaluó utilizando una escala no estructurada (las anclas derecha e izquierda eran "buen ejemplo" y "mal ejemplo" de un queso típico)(12). Se realizaron ocho sesiones de cata con una replicación para generar el perfil sensorial por QDA™. Solo se utilizaron muestras con recuentos bacterianos dentro de la norma oficial mexicana.

Análisis estadístico

Los datos experimentales se analizaron mediante un análisis de varianza (ANOVA) y se utilizó una prueba de diferencia mínima significativa con un nivel de confianza del 95%. Se identificó la correlación entre algunas variables y el efecto del proceso de fabricación sobre las características del queso. Estos análisis se llevaron a cabo con el software de SAS versión 9.3(13). Los datos instrumentales, sensoriales y del proceso de fabricación se integraron por medio de un análisis factorial múltiple (MFA) y el coeficiente de correlación vectorial Rv. Estos análisis se llevaron a cabo con el software de XLSTAT versión 1.0(14). Los cálculos de las estabilidades del mapa sensorial, las elipses de confianza (95%) y la prueba T2 de Hotelling se hicieron utilizando SensoMineR con el lenguaje R versión 2.15.3 (R Development Core Team).

357


Rev Mex Cienc Pecu 2021;12(2):353-369

Resultados y discusión Caracterización del sistema de producción de leche Todos los sistemas de producción muestreados eran de doble propósito. La mayoría (85 %) usaron animales Swiss x Cebú, porque tienen niveles adecuados de producción de leche y son resistentes a las condiciones tropicales(15). La alimentación de los rebaños consistía en Cynodon nlemfuensis (Vanderyst) (23.4 %), Brachiaria humidícola (Rendle) (18.2 %), Digitaria eriantha (Stent) (17.3 %) y mezclas indefinidas (41.1 %). En el 20 % de los casos los productores proveyeron suplementos de concentrados proteicos durante la temporada de sequía con el propósito, según algunos de ellos, de mantener los niveles de producción y evitar el incremento de los costos de producción. Los hatos lecheros muestreados tenían un promedio de 63 vacas, las cuales ordeñaron una vez al día de manera manual en la mayoría (98.4 %) de los casos. La producción promedio de leche fue de 4.4 L·vaca-1, y en el 32 % de los casos no se vendía la leche porque se destinó a la producción de queso.

Caracterización del sistema de producción de queso Entre los productores de queso ranchero Jarocho encuestados en el área de estudio, un poco más de la mitad (57.2 %) son empresas familiares que tienen una trayectoria que abarca tres generaciones. El proceso de producción comienza con (a) la coagulación de la leche cruda (3234 °C/2-3 h) con un cuajo comercial (Cuamex, Industrias México). Luego, (b) se corta la cuajada y (c) se deja que escurra el suero por decantación. Se agrega sal (d) a la vez que desmenuza la cuajada de manera manual para reducir su tamaño. Finalmente, (e) se prensa la cuajada en moldes de plástico (Cuadro 1). La leche utilizada para fabricar este tipo de queso no está estandarizada ni homogeneizada, y no se utiliza cloruro de calcio ni cultivo iniciador. Algunas (28 %) de las lecherías agregaron grasa vegetal a la leche para aumentar el rendimiento(16), lo cual se considera una adulteración(17). La técnica de prensado fue similar a la reportada en la obtención del queso Caciocavallo(18) y el queso fresco de Croacia(19). Una característica de fabricación distintiva registrada durante la producción es la rotación del queso durante el prensado, con el objetivo de que la humedad se distribuya de manera homogénea.

358


Rev Mex Cienc Pecu 2021;12(2):353-369

Cuadro 1: Descripción de las variables en el proceso de fabricación del queso ranchero Jarocho Variable

Niveles

Lecherías fabricantes (%)

Pruebas de calidad a la leche

Si No 5 6 7 2.0 3.0 3.5 4.0 4.5 0 2 3 Si No 10 11-15 16 Plástico Acero inoxidable

28 72 57 28 15 14 29 14 29 14 72 14 14 28 72 57 28 15 28 72

1 3

42 58

Cantidad de sal agregada (%)

Tiempo de prensado (horas)

Número de rotaciones durante el prensado Grasa vegetal agregada Rendimiento de queso (%) Material de los contenedores utilizados Antigüedad de la lechería en la producción de queso (Generaciones)

Composición química y análisis microbiológico de la leche De las muestras de leche colectada en los siete municipios, las leches de Acula y Cosamaloapan contenían menos grasa, posiblemente debido a que el forraje ofrecido a las vacas durante la época de lluvias contenía más humedad y menos fibra. Las leches que se colectaron en Chacaltianguis e Ixmatlahuacan presentaron valores fisiológicamente improbables, lo cual es debido a la adición de grasa vegetal. El contenido de proteína fue bajo de manera general, posiblemente debido al alto rendimiento del tipo racial Bos taurus(20). El contenido de lactosa fue menor que lo reportado en sistemas de doble propósito(15). La composición de la leche se caracterizó por un bajo contenido de sólidos, lo cual está relacionado con variables genéticas, tecnológicas, ambientales y del hato lechero(21).

359


Rev Mex Cienc Pecu 2021;12(2):353-369

Los niveles de RBT registrados en las leches indicaron una higiene inadecuada en el manejo del ordeño y post ordeño(22), ya que fueron superiores a 100,000 UFC ml-1(23) (Cuadro 2). Solo las leches de Tierra Blanca y Cosamaloapan tuvieron niveles de RTC menor que 750 UFC y desde luego cumplieron la normativa vigente(23). Los conteos mayores a este umbral están relacionados con fallas en la remoción de agua residual o leche de los depósitos o contenedores utilizados durante el procesamiento(22). Cuadro 2: Composición química y análisis microbiológico de la leche colectada en los municipios muestreados (Media±EE) Grasa

Proteína

Lactosa

RTB

RTC

Municipio (g L-1) Ixmatlahuacan * Chacaltianguis * Tierra Blanca Tres Valles Tlacotalpan Cosamaloapan Acula EEM *

84.50 ± 0.30e 73.35 ± 0.10d 35.00 ± 0.10c 34.20 ± 0.30c 32.20 ± 0.40b 31.75 ± 0.20b 24.75 ± 0.50a 4.877

(log10 UFC mL-1)

32.0 ± 0.80c 27.1 ± 0.38a 26.2 ± 0.04a 29.8 ± 0.32b 31.6 ± 1.80c 26.9 ± 0.87a 30.4 ± 1.40b 2.408

43.3 ± 1.20b 44.3 ± 2.57b 38.6 ± 0.54a 42.6 ± 0.49b 39.1 ± 0.05a 38.2 ± 1.20a 43.2 ± 0.10b 0.578

5.72 ± 0.11e 5.54 ± 0.01b 5.34 ± 0.01a 5.61 ± 0.00d 5.74 ± 0.01f 5.57 ± 0.01c 5.76 ± 0.00g 0.032

4.35 ± 0.00c 4.20 ± 0.02b ND 4.10 ± 0.01a 4.12 ± 0.01b ND 4.35 ± 0.00c 0.427

-1

Leches con grasa vegetal agregada. ND= no detectado (<1 log10 UFC ml ). RTB= recuento total bacteriano; RTC= recuento total de coliformes. EEM= error estándar de la media. abcde Letras superíndices diferentes en la misma columna indican diferencias (P<0.05).

Composición química y análisis microbiológico del queso Basado en su contenido de humedad el queso ranchero Jarocho se clasifica como un queso fresco y blando(24)(Cuadro 3). El contenido de proteína de los quesos fue menor al reportado en el queso Mihalic(25). La heterogeneidad observada en la composición química de las muestras de queso de los diferentes fabricantes está relacionada con variaciones en el proceso de elaboración. Por ejemplo, los quesos fabricados con un menor tiempo de prensado tuvieron un mayor contenido de humedad, y menos contenido de proteína y grasa (Figura 1a). Este es un efecto de la concentración de sólidos en respuesta a la eliminación de la humedad(26).

360


Rev Mex Cienc Pecu 2021;12(2):353-369

Los valores de RTB, RTC y hongos fueron superiores a los reportados para el queso Dil elaborado con leche pasteurizada(27), pero similares a los reportados para el queso crema tropical, probablemente por el uso de leche cruda(28). Hubo una correlación entre los recuentos microbianos de la leche y los recuentos microbianos de los quesos (RTB: R= 0.64, P˂0.05; RTC: R= 0.98, P˂0.001). Los quesos tuvieron valores de RTB y RTC más altos que los de la leche debido a la retención física de microorganismos en la cuajada y al crecimiento microbiano durante la coagulación y la remoción del suero(29). Algunas de las variables del proceso de fabricación afectaron los recuentos microbianos del queso (Figuras 1b, 1c y 1d). Las lecherías en donde se realizaron pruebas de calidad y utilizaron recipientes de acero inoxidable tuvieron los valores más bajos de RTB, RTC y hongos. Esto ocurrió porque los recipientes y las superficies de acero inoxidable son más fáciles de mantener en condiciones sanitarias que los de otros materiales(27). También los conteos de RTB, RTC y hongos fueron los más bajos en las lecherías donde se llevaron a cabo cursos de capacitación. Los altos recuentos microbianos observados en los quesos podrían estar relacionados con el uso de leche no pasteurizada. Aunque la pasteurización de la leche utilizada en la producción de un queso puede reducir el recuento microbiano en el producto final(30), también puede eliminar las bacterias responsables de los sabores típicos(29) y las características sensoriales específicas del queso(31). Cuadro 3: Composición química y análisis microbiológico del queso ranchero Jarocho fabricado en lecherías en los diferentes municipios (media±EE) Humedad

Grasa

Proteína

RTB

Hongos

RTC

Municipio (g kg-1) Acula Chacaltianguis Ixmatlahuacan Tres Valles Cosamaloapan Tlacotalpan Tierra Blanca EEM

(log10 UFC g-1)

510.01 ± 0.25a 540.52 ± 0.31b 540.75 ± 0.15b 560.24 ± 0.01c 590.36 ± 0.22d

170.6 ± 0.50d 150.5 ± 0.54b 180.5 ± 0.54e 160.7 ± 0.43c 130.3 ± 0.41a

250.10 ± 1.06e 230.11 ± 1.58d 200.43 ± 0.40c 190.35 ± 0.37bc 180.23 ± 0.27ab

5.97 ± 0.00c 5.61 ± 0.01ab 6.15 ± 0.11d 5.68 ± 0.00b 5.66 ± 0.01ab

3.91 ± 0.01c 3.39 ± 0.01a 3.64 ± 0.36b 3.20 ± 0.00a

4.94 ± 0.00d 4.26 ± 0.03c 4.95 ± 0.00d 4.16 ± 0.01a

ND

ND

600.54 ± 0.01e

160.1 ± 0.41bc

180.16 ± 0.19ab

5.78 ± 0.01b

3.20 ± 0.03a

4.15 ± 0.01b

620.2 ± 0.26f 8.099

160.0 ± 0.0bc 3.272

170.1 ± 0.27a 6.087

5.5 ± 0.02a 0.044

ND

ND

0.355

0.459

RTB= recuento total bacteriano; RTC= recuento total de coliformes; ND= no detectado (<1 log10 UFC ml-1). EEM = error estándar de la media. abcdef Letras superíndices diferentes en la misma columna indican diferencias significantes (P<0.05).

361


Rev Mex Cienc Pecu 2021;12(2):353-369

Figura 1: Efecto (a) del tiempo de prensado sobre el contenido de humedad, grasa y proteína del queso, y la respuesta del recuento total bacteriana (RTB), recuento total de coliformes (RTC) y recuento de hongos en el queso a (b) la aplicación de pruebas de calidad a la leche, (c) el material de los contendedores de fabricación, y (d) la capacitación de los productores

Textura y color de los quesos El análisis de textura mostró que los valores de la dureza y la adhesividad del queso ranchero Jarocho fueron menores que los de quesos frescos con aceite de canola agregado(32) (Cuadro 4). Los parámetros del tiempo de prensado, el número de rotaciones, la adición de grasa vegetal y el porcentaje de sal afectaron la dureza del queso (Figura 2). Un tiempo de prensado más largo permitió que se expulsara más agua del queso, lo que aumentó las concentraciones de grasas y proteínas, y desde luego la dureza(33). El número de rotaciones durante el prensado también afectó la eliminación de agua; cuanto mayor eran las rotaciones más humedad retenía el queso y menor era su dureza. Los quesos fabricados con grasa vegetal agregada tuvieron la mayor dureza (P˂0.05) entre los quesos evaluados. Esto es un resultado del mayor diámetro de los glóbulos de grasa vegetal, lo cual permite su interacción con más proteína por unidad de área y provee una mayor resistencia a la deformación de la matriz proteica(16,32). Los quesos con un mayor porcentaje de sal agregada tenían valores de dureza más altos, probablemente debido a una disminución en el grado de proteólisis(34). Los valores de L* del queso ranchero Jarocho indica que tenía un alto brillo (Cuadro 4), lo cual coincide con los valores reportados para el queso fresco de Minas Gerais en Brasil (26). Los ángulos de tono del queso indican que tenía una tonalidad cercana al amarillo (90°) con diferencias en la saturación (C*). El color amarillento de los quesos es característico de los quesos elaborados con leche de vaca porque las vacas pueden transferir carotenoides de su dieta 362


Rev Mex Cienc Pecu 2021;12(2):353-369

a su leche(25). Los valores de humedad en los quesos evaluados se correlacionaron con los valores de L* (R= 0.38, P˂0.001) y C* (R= -0.43, P˂0.001). Los quesos con mayor humedad fueron más brillantes y tuvieron una menor saturación de color debido a que su mayor contenido de agua aumentaba su capacidad de reflejar o transmitir luz(26). Las diferencias observadas en la saturación de color entre los quesos pueden estar relacionadas con el uso de grasa vegetal en algunos, como se ha reportado anteriormente(16). Cuadro 4: Los parámetros de la textura y el color del queso ranchero Jarocho fabricado por lecherías en diferentes municipios (Media±EE) Dureza

Adhesividad

L*

C*

91.5 ± 5.46ab 92.5 ± 0.70b 92.1 ± 0.64ab 91.9 ± 0.73ab 91.0 ± 0.42ab 90.5 ± 0.67a 90.7 ± 0.79ab 0.423

14.7 ± 1.10bc 12.0 ± 2.91a 14.2 ± 0.62ab 13.0 ± 0.66ab 16.4 ± 1.04c 16.1 ± 0.89c 15.6 ± 0.53c 0.418

89.4 ± 0.29a 87.2 ± 3.05a 88.3 ± 0.70a 89.3 ± 0.40a 89.4 ± 0.47a 89.0 ± 0.37a 89.3 ± 0.38a 0.281

Municipio (N) Tierra Blanca Tlacotalpan Tres Valles Cosamaloapan Acula Chacaltianguis Ixmatlahuacan EEM

0.72 ± 0.10a 1.72 ± 0.17b 1.81 ± 0.61b 1.85 ± 0.41b 2.18 ±0.64bc 2.56 ± 0.59c 3.18 ± 0.60c 0.182

-0.26 ± 0.27a -0.11 ± 0.11a -0.18 ± 0.14a -0.03 ± 0.04a -0.08 ± 0.10a -0.16 ± 0.18a -0.14 ± 0.10a 0.031

L*= Luminosidad; C*= Cromaticidad o saturación; h°= Ángulo del tono. EEM = Error estándar del medio. abc Letras superíndices diferentes en la misma columna indican diferencias (P<0.05)..

Figura 2: Efecto del a) tiempo de prensado, b) la rotación, c) la grasa vegetal agregada y c) el porcentaje de sal agregado sobre la dureza en el queso ranchero Jarocho

363


Rev Mex Cienc Pecu 2021;12(2):353-369

Análisis sensorial La agregación de las características sensoriales en tres grupos, en la gráfica de elipses de confianza, mostraron que el panel de jueces fue capaz de discriminar entre las muestras de queso evaluadas, lo cual es comprobado en la prueba T2 de Hotelling (0.205, 0.39 y 0.14) (Figura 3a). El perfil sensorial reveló que los quesos de Tierra Blanca se caracterizaron por tener una mayor intensidad en los atributos de BR, CT, AL y RL, mientras los de Acula e Ixmatlahuacan tenían intensidades menores de BR, AL y SA. Los quesos de Tlacotalpan, Cosamaloapan, Chacaltianguis y Tres Valles mostraron una mayor intensidad en los atributos de RS, AL, OO y OS (Figura 3b). En el análisis de componentes principales, los primeros dos componentes explicaron el 70 % de la inercia total de los datos (Figuras 3c y 3d). Los quesos de Tres Valles, Tlacotalpan y Cosamaloapan se agruparon según el porcentaje de sal agregada y se consideraron los más típicos, con mayores intensidades de RL, SA, OS, OO y AL (Figura 3c). Este resultado coincide con la diferenciación entre los quesos Mihalic basados en los atributos de SA y OS(25), lo cual es de esperar, ya que el contenido de sal afecta la intensidad del aroma de los quesos(35). Los atributos BR y CT se asociaron con un mayor contenido de humedad y mayor L*, mientras los de DT y DB se asociaron con un mayor contenido de proteína, sólidos totales más altos y una mayor dureza. Los datos sensoriales y fisicoquímicos están cerca del punto medio entre todos los quesos, lo cual se confirmó con el coeficiente Rv (RvSE-FQ= 0.74) (Figura 3d). Los resultados del estudio sugieren que el queso ranchero Jarocho tiene un alto potencial para obtener la protección comercial. Sin embargo, lograr tal protección requiere enfrentar tres retos principales. El primero es la alta variabilidad en la calidad de la leche utilizada para fabricar el queso. Esto es una consecuencia de la variabilidad entre los sistemas de doble propósito en el área de estudio y resulta en una alta heterogeneidad en la calidad de los quesos. Por lo tanto, a nivel del sistema de producción es necesario capacitar a los productores para que mantengan la calidad de leche lo más estable y homogénea posible. El segundo es la adición de grasa vegetal a la cuajada como una estrategia para aumentar el rendimiento del queso. Esta práctica descarta por completo la posibilidad de que el queso ranchero Jarocho logre la protección comercial y desde luego es urgente convencer a los productores que eviten caer en ello. Tercero, y quizás el más preocupante, es el uso de leche no pasteurizada en la elaboración de los quesos. Esto viola la normativa vigente y representa un alto riesgo de contaminación con bacterias patógenas como Salmonella, E. coli, Listeria, y Campylobacter, entre otras, que causan enfermedades en los seres humanos. De primera vista la solución a este problema parece simple: usar leche pasteurizada. Sin embargo, los atributos sensoriales de los quesos están estrechamente ligados a algunos microorganismos específicos y la pasteurización elimina tanto las bacterias patógenas como las que están relacionadas con el desarrollo de aromas y sabores. Una manera de resolver este problema es correlacionar bacterias específicas en la leche con el desarrollo de los atributos sensoriales que hacen que el queso ranchero Jarocho sea percibido como “típico”. Al aislar esta microbiota se podría luego agregarla a la leche después del proceso de pasteurización. Una vez desarrollada la tecnología necesaria se puede transferirla a los productores.

364


Rev Mex Cienc Pecu 2021;12(2):353-369

Figura 3: (a) Las elipses de confianza de los quesos, (b) el perfil sensorial de los quesos, (c) la correlación de los atributos sensoriales-fisicoquímicos, y (d) las representaciones totales y parciales de los quesos en el MFA (línea continua: datos sensoriales; línea intermitente: datos fisicoquímicos)

Conclusiones e implicaciones El queso ranchero Jarocho se elabora con leche cruda de sistemas locales de doble propósito. El proceso de elaboración refleja un conocimiento empírico tradicional y está asociado con las prácticas culturales que han mantenido estos recursos biológicos durante varias generaciones. El análisis de integración multivariante mostró que los quesos con mayor intensidad en los atributos sensoriales como aroma a suero, aroma a ordeño, y aroma a leche, intensificado por un mayor porcentaje de sal, fueron percibidos como los más típicos del tipo ranchero Jarocho. La posibilidad de lograr una protección comercial para el queso ranchero Jarocho se ve comprometida por el uso de leche cruda y la falta de prácticas consistentes de higiene durante su elaboración. La heterogeneidad en la composición del queso ranchero Jarocho, relacionado con las diferencias en el proceso de producción entre diferentes lecherías (por ejemplo, la adición de grasa vegetal) también podría dificultar la protección de este tipo de queso. Sin embargo, el abordaje multidisciplinario aplicado en este estudio resaltó el potencial de este tipo 365


Rev Mex Cienc Pecu 2021;12(2):353-369

de queso para obtener su tipicidad y por ende una protección legal-comercial del queso ranchero Jarocho. Se requiere de la aplicación de medidas de saneamiento durante la recolección de la leche, buenas prácticas en la elaboración del queso y evitar la adición de grasa vegetal. Literatura citada: 1. Sharif MS, Zahari M, Nor N, Muhammad R. The importance of knowledge transmission and its relation towards the Malay traditional food practice continuity. Procedia Soc Behav Sci 2016;222:567–577. 2. Scintu M, Piredda G. Typicity and biodiversity of goat and sheep milks products. Small Ruminant Res 2007;68:221–231. 3. Figueroa-Romero R, Ranchero-Ventura P. Reflexiones teórico-metodológicas en la construcción del conocimiento en multidisciplina (interdisciplina). Estado de Derecho y Democracia. En: IV Encuentro Latinoamericano de Metodología de las Ciencias Sociales. La investigación social ante desafíos transnacionales: procesos globales, problemáticas emergentes y perspectivas de integración regional. Universidad Nacional de La Plata. Facultad de Humanidades y Ciencias de la Educación. Centro Interdisciplinario de Metodología de las Ciencias Sociales. 2014. 4. Silva P, Freitas J, Silva C, Perestrelo R, Nunes F, Câmara JS. Establishment of authenticity and typicality of sugarcane honey based on volatile profile and multivariate analysis. Food Control 2017;73:1176–1188. 5. Lenglet F. Influence of terroir products meaning on consumer’s expectations and likings. Food Quality Preference 2014;32:264-270. 6. Torres-Llanez MJ, Vallejo-Cordoba B, Díaz-Cinco ME, Mazorra-Manzano M, GonzálezCórdova AF. Characterization of the natural microflora of artisanal Mexican Fresco cheese. Food Control 2006;17:683–690. 7. Cuevas-González P, Heredia-Castro P, Méndez-Romero J, Hernández-Mendoza A, ReyesDíaz R, Vallejo-Cordoba B, et al. Artisanal Sonoran cheese (Cocido cheese): an exploration of its production process, chemical composition and microbiological quality. J Sci Food Agric 2017;97(13):4459-4466. 8. Villegas-Gante A, de la Huerta-Benítez R. Naturaleza, evolución, contrastes e implicaciones de las imitaciones de quesos mexicanos genuinos. Estudios sociales. Hermosillo, Son. 2015;23(45):213-236. 9. Pomeon T, Barragán-López E, Boucher F, Cervantes-Escoto F. ¿Denominación de origen o denominación genérica?: el caso del queso Cotija. IICA-Mexique. 2009. 10. INEGI. Instituto Nacional de Estadística y Geografía. Cría y explotación de animales en Veracruz de Ignacio de la Llave. Censo Agropecuario. 2013.

366


Rev Mex Cienc Pecu 2021;12(2):353-369

11. AOAC. Official Methods of Analysis. 18th Ed. Washington, DC, USA: Association of Official Analytical Chemists. 2005. 12. Ballester J, Patris B, Symoneaux R, Valentin D. Conceptual vs. perceptual wine spaces: Does expertise matter. Food Qual Prefer 2008;19:267–276. 13. SAS. User's Guide: Statistics (version 9.3). Cary NC, USA. SAS Inst. Inc. 2011. 14. XLSTAT. Statistics and Multivariate Analysis (version 1.0). New York NY, USA: Addinsoft; 2009. 15. Briñez W, Valbuena E, Castro G, Tovar A, Ruiz, RJ. Algunos parámetros de composición y calidad en leche cruda de vacas doble propósito en el municipio Machiques de Perijá Estado Zulia, Venezuela. Revista FCV-LUZ 2008;18:607–617. 16. Cunha CR, Dias I, Viotto H. Microstructure, texture, colour and sensory evaluation of a spreadable processed cheese analogue made with vegetable fat. Food Res Int 2010; 43:723–729. 17. Herman-Lara E, Tejeda-Paz M, Martínez-Sánchez C, Rodríguez-Miranda J, RamírezRivera E, Hernández-Santos B, et al. Differential scanning calorimetry coupled with chemometric tools for determining adulteration with vegetable fat in fresh cheeses. LWT Food Sci Technol 2017;85:269–274. 18. Di Grigoli A, Francesca N, Gaglio R, Guarrasi V, Moschetti M, Scatassa M, et al. The influence of the wooden equipment employed for cheese manufacture on the characteristics of a traditional stretched cheese during ripening. Food Microbiol 2015;46:81–91. 19. Golić N, Čadež N, Terzić-Vidojević A, Šuranská H, Beganović J, Lozo J, et al. Evaluation of lactic acid bacteria and yeast diversity in traditional white pickled and fresh soft cheeses from the mountain regions of Serbia and lowland regions of Croatia. Int J Food Microbiol 2013;166(2):294–300. 20. De Marchi M, Bittante G, Dal Z, Dalvit C, Cassandro M. Effect of Holstein Friesian and Brown Swiss breeds on quality of milk and cheese. J Dairy Sci 2008;91:4092–4102. 21. Juárez-Barrientos J, Díaz-Rivera P, Rodríguez-Miranda J, Martínez-Sánchez C, HernándezSantos B, Ramírez-Rivera E, et al. Caracterización de la leche y clasificación de calidad mediante análisis Cluster en sistemas de doble propósito. Rev Mex Cienc Pecu 2016;7(4):525–537. 22. Pantoja J, Reinemann J, Ruegg L. Associations among milk quality indicators in raw bulk milk. J Dairy Sci 2009;92:4978–4987.

367


Rev Mex Cienc Pecu 2021;12(2):353-369

23. Murphy S, Boor K. Trouble-shooting sources and causes of high bacteria counts in raw milk. Dairy Food Environ Sanit 2000;20(8):606–611. 24. Ramírez-López C, Vélez-Ruiz JF. Quesos frescos: propiedades, métodos de determinación y factores que afectan su calidad. Temas Selectos de Ingeniería de Alimentos 2012;6:131– 148. 25. Aday S, Karagul YY. Physicochemical and sensory properties of Mihalic cheese. Int J Food Prop 2014;17:2207–2227. 26. Magenis R, Prudêncio S, Fritzen F, Stephan P, do Egito A, Daguer H. Rheological, physicochemical and authenticity assessment of Minas Frescal cheese. Food Control 2014;45:22–28. 27. Irkin R. Determination of microbial contamination sources for use in quality management of cheese industry: “Dil” cheese as an example. J Verbrauch Lebensm 2010;5:91–96. 28. Romero-Castillo P, Leyva R, Cruz J, Santos M. Evaluación de la calidad sanitaria de quesos crema tropical mexicanos de la región de Tonalá, Chiapas. Rev Mex Ing Quím 2009;8:111–119. 29. Torres-Llanez MJ, Vallejo-Cordoba B, Díaz-Cinco ME, Mazorra-Manzano MA, GonzalezCordova AF. Characterization of the natural microflora of artisanal Mexican fresco cheese. Food Control 2006;17(9):683-690. 30. USDA. Unıted State Department of Agriculture Milk for Manufacturing Purposes and its Production and Processing, Recommended Requirements. Dairy Programs. USA. 2011. 31. Aldrete-Tapia A, Escobar-Ramírez MC, Tamplin ML, Hernández-Iturriaga M. HighThroughput sequencing of microbial communities in Poro Cheese, an artisanal Mexican cheese. Food Microbiol 2014;44:136–141. 32. Lobato-Calleros C, Reyes-Hernández J, Beristain C, Hornelas-Uribe Y, Sánchez-García J, Vernon-Carter E. Microstructure and texture of white fresh cheese made with canola oil and whey protein concentrate in partial or total replacement of milk fat. Food Res Int 2007;40:529–537. 33. Hussein G, Shalaby S. Microstructure and textural properties of Kareish cheese manufactured by various ways. Ann Agric Sci 2014;59:25–31. 34. Guo L, Hekken L, Tomasula M, Shieh J, Tunick H. Effect of salt on the chemical, functional, and rheological properties of Queso Fresco during storage. Int Dairy J 2011;21:352–357.

368


Rev Mex Cienc Pecu 2021;12(2):353-369

35. Boisard L, Andriot I, Martin C, Septier C, Boissard V, Salles C, et al. The salt and lipid composition of model cheeses modifies in-mouth flavour release and perception related to the free sodium ion content. Food Chem 2014;145:437–444.

369


Solo para uso interno

https://doi.org/10.22319/rmcp.v12i2.5582 Artículo

Efecto de alimentación húmeda de cerdos en finalización sobre el comportamiento productivo, composición de la canal y calidad de la carne

Néstor Arce Vázquez a Hugo Bernal Barragán a* Nydia Corina Vásquez Aguilar a Estela Garza Brenner a Fernando Sánchez Dávila a Adriana Morales Trejo b Miguel Cervantes Ramírez b

a

Universidad Autónoma de Nuevo León. Facultad de Agronomía. Campus de Ciencias Agropecuarias UANL. Calle Francisco Villa S/N. Fracc. Ex-Hacienda “El Canadá”. 66054 Gral. Escobedo, N.L., México. b

Universidad Autónoma de Baja California. Instituto de Ciencia Agrícolas. Mexicali. Baja California. México.

*Autor de correspondencia: hugo.bernalbr@uanl.edu.mx

Resumen: El objetivo del estudio fue evaluar el efecto de la alimentación húmeda de cerdos en finalización (alimento:agua, 1:1) de una dieta basada en sorgo y harina de soya (15.0% PC, 3,200 kcal EM/kg MS), sobre el comportamiento productivo, composición de la canal y calidad de la carne. Dieciséis cerdos cruzados (York-Landrace x Duroc) de 68.4±2.4 kg de peso fueron alojados individualmente, y asignados a dos tratamientos (n=8 repeticiones por tratamiento): AS, alimentación seca; AH, alimentación húmeda. Alimento fue ofrecido 370


Rev Mex Cienc Pecu 2021;12(2):370-385

diariamente en dos porciones iguales (0800 y 1500 h) durante cinco semanas. Semanalmente se registraron el peso vivo (PV) y el consumo de alimento individuales, para calcular ganancia diaria de peso (GDP) y eficiencia alimenticia (EA). Se midió la composición de la canal; la calidad de la carne fue medida en muestras de Longissimus dorsi. Cerdos AH tuvieron mayor (P<0.05) PV final (108.4 vs 101.9 kg) y GDP (1.043 vs 0.990 kg/día) que los cerdos AS. Cerdos AS tuvieron menor consumo (semana 5) y EA (semana 3) que los cerdos AH (Interacción Tratamiento x Semana, P<0.05). Cerdos AH tuvieron pesos mayores de pierna, canal caliente y fría (P<0.05). Lomo, costillas, paleta, contenido de proteína, capacidad de retención de agua y pH de la carne fueron similares (P>0.05) entre tratamientos. Valores de dureza, adhesividad, masticabilidad y resistencia fueron menores (P<0.05) en carne de cerdos AH. En conclusión, los cerdos que recibieron alimento húmedo tuvieron mejor comportamiento productivo, composición de la canal y características de la carne que cerdos que recibieron alimento seco. Palabras clave: Alimentación húmeda, Alimentación seca, Cerdos en finalización, Medición de canal.

Recibido: 19/12/2019 Aceptado: 02/11/2020

Introducción El correcto manejo de la alimentación es importante para mejorar el bienestar animal, la eficiencia de crecimiento y los datos productivos de cerdos. Una posibilidad de mejorar los sistemas de alimentación para cerdos, consiste en mezclar alimento seco con agua, (proporciones entre 1: 1.0 y 1.5)(1). Alimentación húmeda ha demostrado reducir el estrés en la transición de dieta líquida a sólida de lechones destetados(1,2,3) y esto puede tener efectos beneficiosos tales como la reducción del uso de antibióticos en los sistemas de producción actuales(4,5). Además, la alimentación húmeda, mejora el consumo de agua y alimento(3,6), y el suministro de nutrientes en cerdos crecimiento-finalización(7), comparada con la alimentación seca, pudiendo esto favorecer el comportamiento productivo(4) sin afectar el contenido de grasa y calidad de la canal en cerdos(1,5). Características sensoriales, como la terneza, color y marmoleo, son importantes para determinar la calidad y la aprobación por el consumidor de la carne de res(8), pollo(9), conejo(10) y cerdos(11,12). Estas mejoras pueden ser mayores en regiones donde la temperatura ambiente rebasa la zona termoneutral (confort) de los cerdos. Sin embargo, la información

371


Rev Mex Cienc Pecu 2021;12(2):370-385

sobre el efecto de la alimentación húmeda es escasa para los sistemas de producción intensiva de carne de cerdo en zonas cálidas como el norte de México. Por lo tanto, el objetivo del presente estudio fue determinar el efecto de la alimentación húmeda a base de sorgo y pasta soya, sobre la tasa y eficiencia de crecimiento, comportamiento productivo, composición de la canal y calidad de la carne de los cerdos en finalización. La hipótesis del presente estudio fue que el consumo y utilización del alimento de los cerdos en estas condiciones climáticas podría mejorarse con la alimentación húmeda.

Material y métodos Los cerdos utilizados, en la presente investigación, fueron atendidos de acuerdo con las pautas establecidas en la Norma Oficial Mexicana para el Cuidado de Animales(13). El estudio se realizó en la Estación Experimental Porcina de la Unidad Académica Marín de la Facultad de Agronomía de la Universidad Autónoma de Nuevo León, ubicada en Marín, N.L., México. Se utilizaron 16 cerdos (8 hembras y 8 machos castrados; unidades experimentales) de la cruza terminal York-Landrace x Duroc con peso vivo inicial de 68.4 ± 2.4 kg. Los animales se alojaron individualmente en corrales con piso de concreto (1.4 m2), equipado con bebedero de acero inoxidable y comedero de plástico. Los cerdos se asignaron aleatoriamente por sexo, a cada uno de los dos tratamientos: AH, alimentación húmeda en una proporción de 1: 1 (dieta: agua); AS, alimento seco. La dieta ofrecida a los cerdos se elaboró con base en de grano de sorgo molido, harina de soya y premezcla de vitaminas y minerales, formulada con 3200 kcal EM/kg y 15% de proteína cruda, para cubrir o exceder los requerimientos nutricionales de cerdos en el rango de peso de 50 a 120 kg, NRC(7).

Procedimiento experimental

Durante el período experimental, la temperatura ambiente mínima y máxima se registró diariamente a nivel del corral, utilizando un termómetro digital (STEREN®, modelo TER100, China). El periodo de adaptación a los corrales y la alimentación fue de una semana, seguida de cinco semanas de prueba. El peso vivo de los cerdos se registró semanalmente para calcular la ganancia de peso diario promedio (GDP). La alimentación ofrecida y rechazada se registró diariamente para calcular semanalmente el consumo diario de alimento (CDA), y la relación ganancia/consumo (eficiencia alimenticia = EA). Al final del experimento, se sacrificaron todos los cerdos en un rastro TIF (Tipo Inspección Federal). Se registró el peso de canal caliente (CC) y canal fría (CF; 24 h post-sacrificio, 2 °C). Se midió la longitud de la canal registrando la distancia (cm) entre la 6ª vértebra

372


Rev Mex Cienc Pecu 2021;12(2):370-385

cervical y el hueso de la cadera(11); se registraron los pesos de los cortes primarios de la canal: pierna, paleta, lomo y costillas de acuerdo a la Norma Mexicana de Productos Pecuarios(14).

Análisis de laboratorio de la carne

Después de 24 h post mortem, el pH, color y la capacidad de retención de agua (CRA, %) del músculo Longissimus dorsi (LD) se determinaron por cuadruplicado para cada muestra(11). En el presente estudio, el pH del músculo se determinó introduciendo directamente el electrodo de un potenciómetro de punción (Orion 3 star Thermo Fisher Scientific, USA). Para evaluar la calidad de la carne, una muestra de músculo LD fue tomada de entre la 10a y 12a costilla, y fue conservada a -20 °C hasta su análisis. El color se analizó con un colorímetro (Minolta Chroma Meter 2002, Konica Minolta Holdings, Inc., Tokyo, Japón) y los valores se expresaron con base al Sistema CIE (L*, a* y b*). La CRA se determinó por el método de compresión anteriormente descrito(15). La fuerza de corte (FC) se midió en cuatro rectángulos (4x2x2 cm) de cada muestra de LD, en cortes realizados en paralelo a la dirección de las fibras musculares, utilizando un texturómetro (TA.XT2i Stable Micro Systems Serrey, England) equipado con una navaja Warner-Bratzler. Las condiciones de corte fueron velocidad de 2 mms-1 en la prueba previa, 2 mms-1 en la prueba, 10 mms-1 en la prueba posterior, y a una distancia de 30 mm(16). El análisis de perfil de textura (APT) de las muestras de LD fue realizado con un texturómetro (TA.XT2i Stable Micro Systems Serrey, England), utilizando cuatro cubos estandarizados de 2 cm por cada muestra, los cuales se obtuvieron perpendiculares a la dirección de las fibras musculares. Se usó un pistón cilíndrico para comprimir la muestra al 60 % de la altura original, durante dos ciclos de compresión, con un intervalo de tiempo de 5 seg entre ellos. Las curvas de deformación fuerza-tiempo se obtuvieron a partir de las condiciones establecidas de velocidad, previa a la prueba 1.0 mms-1, en la prueba 5.0 mms-1 y posterior a la prueba de 5.0 mms-1. La dureza (g), adhesividad (g/seg), elasticidad (mm), cohesividad, gomosidad (g), masticabilidad (g mm) y la resistencia se obtuvieron de acuerdo a reportes anteriores(17,18). Todas las muestras de carne se analizaron para determinar el contenido de proteína por el método 990.03 de la AOAC(19).

373


Rev Mex Cienc Pecu 2021;12(2):370-385

Análisis económico

El ingreso del crecimiento animal se calculó considerando un precio del cerdo vivo de $ 32.00 MN/kg, multiplicado por el respectivo aumento de peso de cada animal. El costo de la alimentación se calculó considerando el precio del alimento para ambos tratamientos ($ 5.90 MN/kg), multiplicado por el consumo respectivo de cada animal. Estas dos variables se usaron para calcular la diferencia del ingreso para el crecimiento, menos el costo de alimentación. Los precios del cerdo vivo y el costo de la alimentación se obtuvieron con los precios base de agosto-septiembre de 2018 publicados por la Confederación de Porcicultores de México(20), y el Sistema Nacional de Información e Integración de Mercados de México(21).

Análisis estadístico

Los datos se analizaron bajo un diseño de bloques completos al azar, utilizando el paquete estadístico SPSS versión 22 (Versión 2013. IBM SPSS Statistics para Windows, Versión 22.0, Armonk, NY: IBM Corp.). Los datos se presentan como medias y las diferencias significativas (P<0.05) se determinaron mediante la prueba de Tukey.

Resultados La temperatura ambiente durante el experimento fluctuó desde una mínima de 9.1 °C a una máxima de 35.3 °C, con promedio de 27.3 °C durante el estudio. En el Cuadro 1 se muestran los resultados de comportamiento productivo después de cinco semanas experimentales. El peso vivo de los cerdos con alimentación húmeda fue mayor (P<0.01) al final de las semanas 4 y 5, y de todo el estudio, con respecto a cerdos que recibieron alimento seco. Las diferencias en peso vivo entre tratamientos se fueron acentuando sobre las semanas experimentales (P<0.01). Aunque la GDP no fue estadísticamente diferente en cada una de las semanas, sí lo fue en forma global en los cerdos con el alimento húmedo (P<0.01; Figura 1). El CDA fue menor en la semana 1 y mayor en la semana 5 cuando se ofreció húmedo (P<0.01), pero no fue diferente a lo largo de todo el estudio (P>0.10). La variable EA (P<0.05) fue mejor con el alimento húmedo en las semanas 1 y 3 (Figura 2), y en todo el estudio.

374


Rev Mex Cienc Pecu 2021;12(2):370-385

Cuadro 1: Efecto de ofrecer alimentación húmeda (AH) o alimentación seca (AS) sobre peso vivo, CDA, GDP y EA de cerdos en finalización (68 a 108 kg), por cada semana experimental Semana 1 2 3 4 5 EEM Peso vivo (PV, kg) AH 74.8 83.3 91.6 98.4a 108.4a 0.73 AS 74.2 81.6 88.5 92.6b 101.9b 0.75 Consumo diario de alimento promedio (CDA, kg/d) AH 2.56b 3.14 3.34 3.36 3.35a 0.064 AS 3.01a 2.959 3.28 3.04 2.84b 0.066 Ganancia diaria de peso promedio (GDP, kg/d) AH 0.902 1.22 1.18 0.982 1.43 0.038 AS 0.755 1.20 0.991 0.786 1.27 0.039 Eficiencia alimenticia (EA, kg) AH 0.353a 0.386 0.351a 0.294 0.426 0.010 AS 0.250b 0.410 0.298b 0.253 0.448 0.010 a,b

P Trat

Semana Interacción

0.001

<0.001

0.322

0.180

0.010

0.023

0.010

<0.001

0.861

0.032

<0.001

0.023

EEM= error estándar de la media. Medias con letras diferentes dentro de la misma columna para cada variable son diferentes (P<0.05).

Figura 1: Consumo diario de alimento (Media ± EEM) de los cerdos en fase final (68 a 108 kg) alimentados con alimentación húmeda (AH) o alimentación seca (AS)

a,b

Diferencia significativa (P<0.05) entre grupos.

375


Rev Mex Cienc Pecu 2021;12(2):370-385

Figura 2: Eficiencia alimenticia (Media ± EEM) medidas semanalmente de los cerdos en la fase final (68 a 108 kg), alimentados con alimentación húmeda (AH) o alimentación seca (AS)

a,b

Diferencia significativa (P<0.05) entre grupos.

Peso de los componentes de la canal

Los cerdos con alimentación húmeda tuvieron mayor peso de canal caliente (P=0.019) y fría (P=0.021) que los cerdos que recibieron alimentación seca (Cuadro 2). La longitud de la canal no fue diferente (P>0.05) para los dos tratamientos. El peso promedio de la pierna y de la piel con grasa fue mayor (P=0.04) en los cerdos con alimentación húmeda, que en los cerdos de alimentación seca. Los pesos del lomo, costilla, paletas y patas no fueron diferentes entre los cerdos alimentados con una dieta húmeda o seca (P>0.05).

376


Rev Mex Cienc Pecu 2021;12(2):370-385

Cuadro 2: Características de la canal y peso de los principales componentes de la canal de cerdos sacrificados a 108 kg de peso vivo, con alimentación húmeda (AH) o alimentación seca (AS) Concepto

Tratamiento AS

AH

Medidas de la canal Peso canal caliente, kg Peso canal fría, kg Longitud de la canal, cm Peso promedio de las piezas, media canal, kg Pierna Lomo Costilla Paleta Piel + grasa Patas

EEM

P

90.80 89.13 81.56

84.80 83.39 80.94

1.599 1.564 0.985

0.019 0.021 0.661

10.33 9.33 5.66 4.45 11.63 0.739

9.78 9.34 5.03 4.25 9.65 0.694

0.172 0.212 0.254 0.109 0.468 0.019

0.040 0.967 0.097 0.214 0.009 0.120

EEM= error estándar de la media.

Características fisicoquímicas y de textura de la carne Las características fisicoquímicas y de textura de la carne se presentan en el Cuadro 3. No se observaron diferencias en el contenido de proteína y carbono, pH y capacidad de retención de agua en la carne (P>0.05) entre los tratamientos. La dureza, gomosidad, masticabilidad y resistencia de la carne fue mayor (P<0.05) en los cerdos con alimentación seca que en los de alimentación húmeda. Las características de fuerza de corte, adhesividad, elasticidad y cohesividad no fueron diferentes (P>0.05) entre los tratamientos. Cuadro 3: Valores de las características fisicoquímicas y textura de la carne de los cerdos sacrificados a 108 kg de PV, con alimentación húmeda (AH) y alimentación seca (AS) Características Fisicoquímicas Proteína, % MS Carbono, % MS pH CRA, % Textura Fuerza de corte, N Dureza, N

Tratamiento AH AS

EEM

P

25.70 16.39 5.50 64.31

25.31 16.07 5.48 62.98

0.300 0.235 0.018 0.864

0.372 0.353 0.506 0.284

41.22 35.37

37.46 57.32

2.384 7.071

0.270 0.032

377


Rev Mex Cienc Pecu 2021;12(2):370-385

Adhesividad, g/seg Elasticidad, mm Cohesividad Gomosidad, g Masticabilidad, gmm Resistencia

-25.11 0.435 0.446 15.86 6.30 0.237

-22.66 0.457 0.453 27.16 11.65 0.283

1.400 0.015 0.010 3.470 1.367 0.013

0.216 0.324 0.584 0.025 0.007 0.015

EEM= error estándar de la media; CRA= capacidad de retención de agua.

Tendencia al color de la carne Los valores de luminosidad (L*), tendencia al rojo (a*) y amarillo (b*), saturación (C) y ángulo Hue (H) de la carne no fueron diferentes (P>0.05) entre los dos tratamientos (Cuadro 4). Cuadro 4: Color de la carne medidas en músculo Longissimus dorsi de los cerdos sacrificados a 108 kg de peso vivo, con alimentación húmeda (AH) o alimentación seca (AS) Caracteristica *

L a* b* C H

Tratamiento AH 53.62 17.03 9.16 19.37 28.29

AS 54.04 17.3 9.32 19.75 28.35

EEM 0.879 0.221 0.255 0.194 0.790

P 0.734 0.392 0.656 0.175 0.954

EEM= error estándar de la media; L* luminosidad; a*= tendencia al rojo; b*= tendencia al amarillo; C= saturación; H= ángulo Hue

Análisis económico El costo de alimentación (Cuadro 5) fue similar (P=0.180) para cerdos alimentados con AH que con AS (promedio = $ 127.61 MN/animal durante la fase experimental). Sin embargo, debido a una mayor tasa de crecimiento, el ingreso económico fue 13 % mayor (P=0.01) para los cerdos que recibieron alimentación húmeda que para los cerdos alimentados con alimentación seca. La diferencia del ingreso debido al crecimiento de los cerdos menos el costo de alimentación, fue 27.3 % mayor (P=0.008) para los cerdos que recibieron la alimentación húmeda, comparado con la de los cerdos que recibieron alimento seco.

378


Rev Mex Cienc Pecu 2021;12(2):370-385

Cuadro 5: Análisis de costo y utilidad económica de los cerdos en la fase final (68 a 108 kg) alimentado con la dieta húmeda (AH) o alimentación seca (AS) Tratamiento AH Ingresos por el crecimiento de los cerdos 256.00 Costo de alimentación 130.12 Diferencia de ingresos menos costo de 125.88 alimentación Variable económica ($ MN)

AS 226.53 124.96 101.56

EEM

P

12.145 0.010 3.802 0.180 9.923 0.008

Discusión El presente experimento se llevó a cabo bajo condiciones climáticas representativas de muchos lugares tropicales secos, siendo este, uno de los primeros estudios realizados en la región noreste de México. Durante el experimento, los cerdos se alojaron en una nave con paredes laterales abiertas, de modo que los animales se encontraban en condiciones naturales de temperatura ambiente, que varió de 10 a 35.3 °C. Estas condiciones ambientales, extremadamente variables, pudieron haber afectado la ingesta de alimento y la eficiencia alimenticia de los cerdos. Se obtuvo una interacción significativa entre semana experimental x tratamiento para CDA y EA, de una forma similar a lo reportado previamente(22,23). Se ha reportado que la exposición a temperatura ambiente de 33 °C reduce en 20 a 30 % el consumo voluntario de alimento de los cerdos(22). En el presente estudio, el CDA durante la semana 1 fue 12 % menor, pero en la semana 5 fue 18 % mayor en los cerdos que recibieron alimentación húmeda. Aunque el consumo de alimento global no fue diferente, la tendencia a incrementar a medida que avanzó el experimento hasta llegar a ser significativamente mayor en la semana 5 indica que el humedecimiento del alimento podría ayudar a recuperar el consumo voluntario de alimento de animales bajo condiciones climáticas de estrés por calor. La alimentación húmeda incrementó también en 14 % la ganancia de peso y en 8 % la eficiencia alimenticia. La mayor GDP de cerdos AH, como el observado en el presente experimento, concuerda con los resultados reportados en cerdos de finalización(24) y cerdos en crecimiento-finalización alimentados con dieta húmeda durante 90 días(25). En conjunto, estos resultados indican que la alimentación húmeda de cerdos expuestos a condiciones de temperatura ambiente elevada podría mejorar no solamente el consumo de alimento sino también la eficiencia en la utilización del alimento. Yang et al(6) reportaron una menor GDP y EA en cerdos en crecimiento-finalización alimentados con una dieta líquida con subproductos de la industria del etanol, en comparación con los cerdos alimentados con una dieta húmeda a base de maíz y harina soya. Esto sugiere que, además del tipo de alimentación (húmeda o seca), los ingredientes utilizados también son importantes en la eficiencia productiva. Posiblemente, la alimentación húmeda ofrecida a los cerdos a altas temperaturas

379


Rev Mex Cienc Pecu 2021;12(2):370-385

ambientales, les permitió tener un mejor equilibrio de la temperatura corporal, lo que resultó en un aumento de peso y una mayor eficiencia alimenticia. Los pesos de CC y CF mayores en los cerdos con AH registrados en el presente estudio, concuerdan con otros resultados previamente publicados(24), en los que se reportó un mayor peso de la canal caliente, y rendimiento, aunque similar profundidad de grasa dorsal en cerdos alimentados con dieta húmeda, indicando esto la posibilidad de tener una influencia positiva de la alimentación húmeda en las características de la canal. Se tienen reportes de similitud en grasa dorsal en cerdos con alimentación húmeda o seca(25). Sin embargo, en pollos de engorda alimentados con una dieta húmeda tenían un mayor contenido de grasa abdominal(26). Cuando el comedero está equipado con un suministro de agua integrado, los cerdos tienden a consumir más alimento(24). El mayor consumo de alimento en cerdos que recibieron AH, reportado en la semana 5 del presente trabajo, podría reflejarse en un mayor contenido de grasa dorsal. En el presente estudio, la pierna fue más pesada en los cerdos que recibieron alimentación húmeda, que en los de alimentación seca. Esto concuerda con reportes previos(27) en los que mayores pesos de pierna han sido registrados en cerdos con mayores tasas de crecimiento. El término calidad de la carne describe la suma de diferentes propiedades(28) como, pH, color, terneza, CRA y la composición química(29), que revisten especial importancia en la evaluación sensorial(30). En este estudio, se observaron diferencias a favor de los cerdos alimentados con una dieta húmeda en cuanto a las características de calidad y textura de la carne, tales como resistencia al corte, gomosidad, y masticabilidad(31). La CRA y el color son atributos importantes que determinan el atractivo visual y la terneza de la carne(32,33). Los valores observados en este experimento, fueron similares entre tratamientos, y concuerdan con los reportados previamente(34,35) en cerdos de finalización. En el presente trabajo, la carne de cerdos que recibieron alimento húmedo tuvo valores de dureza menores a la de cerdos que recibieron alimento seco, lo cual es indicativo de mayor terneza(36), que es una de las características más importantes de la calidad de la carne(32,37). Los otros resultados del análisis del perfil de textura, tales como adhesividad y la cohesividad, que también se utilizan regularmente para determinar los atributos sensoriales(38) no fueron diferentes entre los tratamientos en el presente trabajo. El color es un rasgo importante de la calidad de la carne de cerdo, que puede verse afectado por diferentes factores, como la estrategia de alimentación(31) y la raza de cerdos(11,12). En el presente estudio, no se encontraron diferencias entre tratamientos en las variables cromáticas L*, a*, b*, C y H, que determinan el color. Comparado con resultados de investigaciones previas(34), los valores de luminosidad (L*) en el presente trabajo para la carne de cerdos alimentados con AH y AS (53.6 y 54.0, respectivamente; Cuadro 4) fueron indicativos de 380


Rev Mex Cienc Pecu 2021;12(2):370-385

carne “normal”(39). Valores de L* de 58 son indicativos de carne PSE (pálido, suave, exudativo), mientras que valores inferiores a 52 indican la condición de ASD (oscuro, firme, seco)(39,40,41). El análisis económico realizado en este estudio ha sido utilizado anteriormente(42), ya que permite combinar en un solo valor (diferencia del ingreso económico menos el costo del alimento) el efecto que el tipo de alimentación evaluada tiene sobre diversas características, tales como el consumo de alimento, el aumento diario de peso y la eficiencia alimenticia. En el presente estudio, la diferencia del ingreso económico por crecimiento del cerdo, menos el costo por alimento durante cinco semanas, fue 27.3 % superior para los cerdos que recibieron alimentación húmeda. El mayor porcentaje de este beneficio económico se originó en la mayor tasa de crecimiento registrada en los cerdos que recibieron alimentación húmeda. Por el contrario, no hubo diferencias en el costo de la alimentación, respecto a la forma en que se ofrecía alimento (seco o húmedo) a los cerdos. En un estudio publicado por Myers et al(43), cerdos de entre 80 y 110 kg de peso alimentados utilizando un comedero que humedece el alimento tuvieron mejores datos de crecimiento que en el caso de cerdos que recibieron alimento seco. Considerando el aumento de peso y el consumo de alimento de esos cerdos(43), al recibir alimento húmedo o seco, así como los precios del alimento y la carne de cerdo del presente experimento, el beneficio económico obtenido por Myers et al(43) en sus cerdos, habría sido un 9.1 % mejor en los que obtuvieron alimentación húmeda, que para los de alimentación seca, cifra inferior al beneficio económico registrado en el presente estudio. En resumen, con base en los resultados de este experimento, se concluye que la alimentación de cerdos en finalización con una dieta húmeda mejora las variables productivas (ganancia diaria de peso, consumo de alimento, eficiencia alimenticia), el beneficio económico, la composición de la canal y la calidad de la carne. Agradecimientos Los autores agradecen el soporte financiero provisto por la Convocatoria de Estancias Posdoctorales Nacionales 2018(1) del Consejo Nacional de Ciencia y Tecnología (CONACYT, México). También se agradece a la Facultad de Agronomía de la UANL por las facilidades otorgadas para la realización de la presente investigación. Conflicto de interés Los autores declaran no tener conflictos de interés.

381


Rev Mex Cienc Pecu 2021;12(2):370-385

Literatura citada: 1. Chae BJ. Impacts of wet feeding of diets on growth and carcass traits in pigs. J Appl Anim Res 2000;17(1):81-96. 2. Yang JS, Lee JH, Ko TG, Kim TB, Chae BJ, Kim YY, Han InK. Effects of wet feeding of processed diets of performance, morphological change in the small intestine and nutrient digestibility in weaned pigs. Asian-Aust J Anim Sci 2001;14(9):1308-1315. 3. Moon JS, Kwon IK, Chae BJ. Effects of wet feeding of diets with or without food waste on growth performance and carcass characteristics in finishing pigs. Asian-Aust J Anim Sci 2004;17(4):504-510. 4. Brooks PH, Beal JD, Niven S. Liquid feeding of pigs: potential for reducing environmental impact and for improving productivity and food safety. Recent Adv Anim Nut Aust 2001;13:49-63. 5. Zoric M, Johansson SE, Wallgren P. Behaviour of fattening pigs fed with liquid feed and dry feed. Porcine Health Managem 2015;1:14. 6. Yang X, Nath C, Doering A, Goih J, Baidoo SK. Effects of liquid feeding of corn condensed distiller’s solubles and whole stillage on growth performance, carcass characteristics, and sensory traits of pigs. J Anim Sci Biotechnol 2017;8:9. 7. NRC. National Research Council. Nutrient requirements of swine. 12th ed. Washington, DC. USA: National Academy Press; 2012. 8. Guzek D, Głąska D, Pogorzelski G, Kozań K, Pietras J, Konarska M, et al. Variation of meat quality parameters due to conformation and fat class in Limousin bulls slaughtered at 25 to 27 months of age. Asian-Aust J Anim Sci 2013;26(5):716. 9. Mir NA, Rafiq A, Kumar F, Singh V, Shukla V. Determinants of broiler chicken meat quality and factors affecting them: a review. J Food Sci Technol 2017;54(10):29973009. 10. Dalle ZA. Perception of rabbit meat quality and major factors influencing the rabbit carcass and meat quality. Livest Prod Sci 2002;75(1):11-32. 11. Choi JS, Lee HJ, Jin SK, Choi YI, Lee JJ. Comparison of carcass characteristics and meat quality between Duroc and crossbred pigs. Korean J Food Sci An 2014;34(2):238-244. 12. Chen G, Shui S, Cai Y, Na L, Su Y. Production performance, slaughtering and meat quality of different breed pigs. J Bioproces Biotech 2017;7:304.

382


Rev Mex Cienc Pecu 2021;12(2):370-385

13. Norma Oficial Mexicana. Especificaciones técnicas para la producción, cuidado y uso de los animales de laboratorio. Ochoa MLI ed. Diario Oficial de la Federación, México (AS), México. NOM-062-ZOO-1999-2001. 14. Norma Mexicana de Productos Pecuarios. Productos pecuarios-Carne de porcino en canal-Calidad de la carne-Clasificación. Ochoa MLI ed. Diario Oficial de la Federación, México (AS), México. NMX-FF-081-2003. 15. Tsai TC, Ockerman HW. Water binding measurement of meat. J Food Sci 1981;46(3):697-701. 16. Intarapichet KO, Maikhunthod B, Thungmanee N. Physicochemical characteristics of pork fed palm oil and conjugated linoleic acid supplements. Meat Sci 2008;80:788-794. 17. Bourne MC, Kenny JF, Barnard J. Computer‐assisted readout of data from texture profile analysis curves. J Texture Stud 1978;9(4):481-494. 18. Alonso V, del Mar Campo M, Provincial L, Roncalés P, Beltrán JA. Effect of protein level in commercial diets on pork meat quality. Meat Sci 2010;85(1):7-14. 19. AOAC. Official Methods of Analysis. 16th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 2005. 20. Confederación de Porcicultores de México. https://www.porcimex.org/supremo.htm. Consultado 15 Ene, 2019. 21. Sistema Nacional de Información e Integración de Mercados de México http://www.economia-niim.gob.mx/nuevo/Home.aspx?opcion=Consultas/MercadosNa cionales/PreciosDeMercado/Agricolas/ConsultaGranos.aspx?SubOpcion=6|0 Consultado 15 Ene, 2019. 22. Morales A, Grageola F, García H, Arce N, Araiza B, Yáñez J, Cervantes M. Performance, serum amino acid concentrations and expression of selected genes in pair-fed growing pigs exposed to high ambient temperatures. J Anim Physiol Anim Nutr 2014;98(5):928935. 23. Cervantes M, Antoine D, Valle JA, Vásquez N, Camacho RL, Bernal H, Morales A. Effect of feed intake level on the body temperature of pigs exposed to heat stress conditions. J Thermal Biol 2018;76:1-7. 24. Bergstrom JR, Nelssen JL, Edwards LN, Tokach MD, Dritz SS, Goodband RD, DeRouchey JM. Effects of feeder design and changing source of water to a location separate from the wet-dry feeder at 4 or 8 weeks before harvest on growth, feeding behavior, and carcass characteristics of finishing pigs. J Anim Sci 2012;90(12):45674575. 383


Rev Mex Cienc Pecu 2021;12(2):370-385

25. Chae BJ, Han InK, Kim JH, Yang CJ, Ohh SJ, Rhee YC, Chung YK. Effects of feeding processing and feeding methods on growth and carcass traits for growing-finishing pigs. Asian-Aust J Anim Sci 1997;10(2):164-169. 26. Akinola OS, Onakomaiya AO, Agunbiade JA, Oso AO. Growth performance, apparent nutrient digestibility, intestinal morphology and carcass traits of broiler chickens fed dry, wet and fermented-wet feed. Livest Sci 2015;177:103-109. 27. Lanferdini E, Andretta I, Fonseca LS, Morerira RHR, Cantarelli VS, Ferreira RA, Saraiva A, Abreu MLT. Piglet birth weight, subsequent performance, carcass traits and pork quality: A meta-analitycal study. Livest Sci 2018;214:175-179. 28. Maltin C, Balcerzak D, Tilley R, Delday M. Determinants of meat quality: tenderness. Proc Nut Soc 2003;62:337-347. 29. Kim TW, Kim CW, Yang MR, No GR, Kim SW, Kim II-S. Pork quality traits according to postmortem pH and temperature in Berkshire. Korean J Food Sci An 2016;36(1):2936. 30. Hoffman, K. 1994. What is quality? Definition, measurement and evaluation of meat quality. Meat Focus Internat 1994;3(2):73-82. 31. Rosenvold K, Andersen HJ. Factors of significance for pork quality-a review. Meat Sci 2003;64:219-237. 32. Hughes JM, Oisek SK, Purslow PP, Warner RD. A structural approach to understanding the interactions between colour, water-holding capacity and tenderness. Meat Sci 2014;98:520-532. 33. Starky CP, Gessink GH, Oddy VH, Hopkins DL. Explaining the variation in lamb longissimus shear force across and within ageing periods using protein degradation, sarcomere length and collagen characteristics. Meat Sci 2015;105:332-37. 34. Nguyen DH, Park JW, Kim IH. Effect of crumbled diet on growth performance, market day age and meat quality of growing-finishing pigs. J Appl Anim Res 2017;45(1):396399. 35. Sasaky K, Motoyama M, Narita T, Chikuni K. Effects of cooking end-point temperature and muscle part on sensory “hardness” and “chewiness” assessed scales presented in ISO11036:1994. Asian-Aust J Anim Sci 2013;26(10):1490-1495. 36. Válvoká V, Saláková A, Butchtová H, Tremlová B. Chemical, instrumental and sensory characteristics of cooked pork ham. Meat Sci 2007;77:608-615.

384


Rev Mex Cienc Pecu 2021;12(2):370-385

37. Sørheim O, Idland J, Halvorsen EC, Frøystein T, Lea P, Hildrum KI. Influence of beef carcass stretching and chilling rate on tenderness of m. longissimus dorsi. Meat Sci 2001;57(1):79-85. 38. Nishinary K, Kohyama K, Kumgai H, Funami T, Bourne MC. Parameters of texture profile analysis. Food Sci Technol Res 2013;19(3):519-521. 39. Adzitey F, Nurl H. Pale soft exudative (PSE) and dark firm dry (ASD) meats: causes and measures to reduce these incidences - a mini review. Int Food Res J 2011;18:11-20. 40. Kusêc G, Kralik G, Petričević A, Gutzmirtl H, Grgurić D. Meat quality indicators and their correlation in two crosses of pigs. Agric Conspectus Scient 2003;68(2): 115-119. 41. Van Laack RLJM. Determinants of ultimate pH and quality of pork-NPB#99-129. https://www.pork.org/wp-content/uploads/2007/08/99-129-VANLAACK-U-ofTN.pdf. Accesed Feb 15, 2019. 42. Guarneros-Altamirano R, Gutiérrez-Ornelas E, Bernal-Barragán H, Ávalos-Ramírez R, Castillo-Gallegos E, Olivares-Sáenz E. Acondicionamiento de becerros previos a la recría bajo pastoreo en trópico seco: Efectos sobre el peso corporal y la condición sanitaria. Rev Mex Cienc Pecu 2017;8(4):341-351. 43. Myers AJ, Goodband RD, Tokach MD, Dritz SS, DeRouchey JM, Nelssen JL. The effects of diet form and feeder design on the growth performance of finishing pigs. J Anim Sci 2013;91:3420-3428.

385


https://doi.org/10.22319/rmcp.v12i2.5683 Artículo

Las subpoblaciones de espermatozoides y su calidad en fracciones producidas por la centrifugación de una sola capa en muestras frescas y normospérmicas de esperma de cordero

Carlos Carmelo Pérez-Marín a Ander Arando b* Francisco Maroto-Molina c Alberto Marín a Juan Vicente Delgado b

a

Universidad de Córdoba. Department of Animal Medicine and Surgery, Campus de Rabanales, Ctra. Madrid-Cadiz km 396, Cordoba, 14014, Spain. b

Universidad de Córdoba. Department of Genetics, Cordoba, Spain.

c

Universidad de Córdoba, Department of Animal Production. Cordoba, Spain.

*Autor de correspondencia: anderarando@hotmail.com

Resumen: La técnica de centrifugación de una sola capa (SLC) ha sido desarrollada para seleccionar la mejor población de espermatozoides en un eyaculado con la finalidad de aumentar las tasas de fertilización mediante la inseminación artificial o fertilización in vitro. Se procesaron muestras normospérmicos de semen de carnero que contenían 800 y 3000 × 106 espermatozoides/ml (C800 y C3000, respectivamente) utilizando SLC. Se separaron tres fracciones de espermatozoides en cada muestra y se analizó el rendimiento, la calidad y las subpoblaciones de espermatozoides en cada una. En las muestras de C800, la tasa de recuperación de espermatozoides no varió entre las fracciones. Sin embargo, en las C3000, la fracción superior (F1) contenía más espermatozoides que la fracción inferior (F3). La F1 en las C3000 tenía un porcentaje mayor de espermatozoides (53.2 %) que, en las C800, mientras que en la F2 de las C3000 el porcentaje de espermatozoides recuperados fue menor (25.2 %) que en la F2 de las C800 (45.4 %). Aplicando los parámetros de motilidad de los espermatozoides se identificaron tres subpoblaciones de 386


Rev Mex Cienc Pecu 2021;12(2):386-401

espermatozoides: SP1, de baja velocidad y sin movimiento progresivo (19.1 %); SP2, rápidos y progresivos (43.7 %); y SP3, rápidos, pero con movimiento no lineal (37.2 %). Si bien SLC se ha utilizado para la separación de espermatozoides en muestras de semen subóptimas y/o de baja concentración de espermatozoides, los resultados indican que SLC no es eficiente en la separación de diferentes poblaciones de espermatozoides en muestras normospérmicas de semen de carnero con altas concentraciones de espermatozoides. Palabras clave: Centrifugación de una sola capa, Eyaculados, Ovinos, Espermatozoides.

Recibido:08/05/2020 Aceptado:26/08/2020

Introducción La motilidad es una característica importante relacionada con el avance de los espermatozoides a lo largo del tracto reproductivo femenino(1) y a su penetración en los ovocitos. La evaluación de la motilidad es esencial en la evaluación de la calidad del semen y la potencial fertilidad masculina(2). Se sabe que los eyaculados de los mamíferos están constituidos por un conjunto de células heterogéneas, más varias subpoblaciones de espermatozoides. Con el fin de seleccionar los mejores espermatozoides se han desarrollado muchos procedimientos para reducir la cantidad de residuos, células no espermatozoides y bacterias en las muestras de semen, así como para eliminar el plasma seminal y así evitar el proceso de la capacitación temprana(3). Este procesamiento del eyaculado pueda mejorar los resultados de la inseminación artificial (IA) y es fundamental en la implementación de otros procedimientos biotecnológicos, como la producción in vitro y la inyección intracitoplasmática de espermatozoides (intracytoplasmatic sperm injection – ICSI)(4). En numerosas especies, Percoll, el cual consiste en partículas de sílice recubiertas de polivinilpirrolidona, fue uno de los coloides más utilizados en la separación de los espermatozoides(5-7). Sin embargo, su uso se ha reducido en respuesta a la detección de endotoxinas que ejercen un efecto negativo sobre los espermatozoides. Para superar las deficiencias del Percoll se han diseñado nuevos medios. Los coloides de sílice recubiertos de silano son actualmente las soluciones más utilizadas, ya que se ha demostrado que son más estables y estandarizadas(8). Estos coloides se emplean en una variedad de procedimientos, como la centrifugación de doble capa (double-layer centrifugation - DLC) o en una simplificación de esta técnica llamada centrifugación de una sola capa (single-layer centrifugation - SLC)(9). El volumen de una muestra de semen y su concentración de espermatozoides puede afectar la eficacia de estos procedimientos(10). En este contexto, DLC se considera poco práctica como medio para procesar eyaculados completos destinados a la IA(9). Está indicado para los eyaculados oligospérmicos, pero no para las muestras normospérmicas completas. Una técnica más fácil es SLC, lo cual requiere menos tiempo y se ha utilizado

387


Rev Mex Cienc Pecu 2021;12(2):386-401

ampliamente en equinos(11). Hay pocos informes sobre su uso en otras especies. Los estudios llevados a cabo en toros han mostrado que los espermatozoides seleccionados por SLC exhiben un aumento en la integridad de la cromatina del esperma(12) y un alto potencial de membrana mitocondrial, aunque aumenta la producción de superóxido(13). Sin embargo, esta técnica solo mejora la motilidad de los espermatozoides cuando se procesan muestras de semen de baja calidad(14). Una comparación entre las fracciones obtenidas por la centrifugación coloidal del semen humano muestra que los espermatozoides aislados en el sedimento inferior mostraban una menor fragmentación del ADN espermático, aunque su longevidad era menor que la del semen puro(15). Estos hallazgos sugieren que se debe de llevar a cabo un análisis más profundo a las fracciones de espermatozoides obtenidas mediante diferentes procedimientos de enriquecimiento o separación de espermatozoides con el fin de determinar su eficiencia en términos de la viabilidad, la concentración y otros variables. Los eyaculados que contienen una alta concentración de espermatozoides (por ejemplo, los de los rumiantes) dificulta el uso de las técnicas de centrifugación en capas para procesar eyaculados enteros(10). Muy pocos estudios han evaluado el efecto de la separación coloidal en el eyaculado fresco, entero y normospérmico de carnero. En este trabajo se utilizaron muestras de semen de carnero que contenían diferentes concentraciones de espermatozoides. El objetivo fue cuantificar la tasa de recuperación de espermatozoides y su calidad, así como la distribución de las diferentes subpoblaciones de espermatozoides móviles en cada fracción del semen después de la separación por SLC.

Material y métodos Animales y colecta de semen Para este estudio se utilizaron cuatro carneros maduros de la raza Merino de entre 3 y 5 años de edad. Los animales se alojaron en corrales individuales ubicados en la Diputación de Córdoba (España). Se alimentaron con un concentrado comercial (0.5 kg/día), heno de alfalfa, agua y minerales. Se tomaron muestras de semen una vez a la semana durante la temporada de no reproducción (marzo-junio) mediante una vagina artificial con una oveja como celadora. Los eyaculados se mantuvieron a 37 ºC y se cuantificaron la motilidad de la masa (utilizando una escala de 1 a 5; aumento de 40×; Olympus, Tokio, Japón), la concentración de espermatozoides (Accurread, Tecnologías IMV, Francia) y el volumen del eyaculado. Se utilizaron los eyaculados con una motilidad de masa ≥4, una concentración ≥3000 × 106 espermatozoides/ml y una motilidad individual ≥70 %. Todos los experimentos se autorizaron por el Comité de Bioética de la Universidad de Córdoba (n. 2018PI / 29) y se llevaron a cabo de acuerdo con el Reglamento Español de Protección Animal (RD 53/2013), tal y como establece el Reglamento UE 2010/63.

388


Rev Mex Cienc Pecu 2021;12(2):386-401

Diseño experimental Después de su evaluación, los eyaculados de los cuatro carneros se diluyeron (1:2) con el diluyente TCFEY: Tris (33.19 g/L), fructosa (9.55 g/L), 10% de yema de huevo clarificada, ácido cítrico (17.29 g/L), penicilina G (4 g/L) y estreptomicina (3 g/L). Se combinaron en agua bidestilada, se tomaron dos alícuotas de semen y se colocaron en tubos cónicos para centrifugación (300 xg durante 20 min) (Figura 1). Después de eliminar el sobrenadante, se añadió TCFEY hasta alcanzar una concentración final de 800 x 106 espermatozoides/ml (C800) y 3000 x 106 espermatozoides/ml (C3000). La calidad de los espermatozoides se evaluó en cada concentración. Figura 1: Diseño experimental para la evaluación de la calidad de los espermatozoides y las subpoblaciones en las diferentes fracciones producidos por SLC de muestras con concentraciones de 800 y 3000 × 106 esp/ml (C800 and C3000).

Se preparó SLC a base de sílice recubierta de silano (BoviPure y BoviDilute, Nidacon, Suecia), de acuerdo con las instrucciones del fabricante. Aunque estas soluciones se desarrollaron para el esperma de toro, se pueden usar también para los pequeños rumiantes. En resumen, se colocó una capa de 1.5 ml de BoviPure al 80% (v/v) en un tubo cónico de 15 ml. En la parte superior se colocó una capa de una muestra de semen de C800 o C3000 y se centrifugó a 300 xg por 20 min. Se descartó el plasma seminal (aprox. 1.5 ml) y se aislaron tres fracciones distintas por muestra: la superior (F1), la media (F2) y la inferior (F3). Cada fracción tenía un volumen de aproximadamente 0.5 ml. Se extrajeron utilizando pipetas Pasteur en movimientos circulares. En cada fracción de cada muestra se cuantificó la tasa de recuperación de espermatozoides (TRE), su calidad (la motilidad, concentración, viabilidad, morfología y funcionalidad de la

389


Rev Mex Cienc Pecu 2021;12(2):386-401

membrana del esperma) y las subpoblaciones de ellos. Se replicó el experimento seis veces utilizando un total de 24 eyaculados.

Tasa de recuperación de los espermatozoides Se diluyeron las muestras a 1:200 y se evaluó su concentración por medio de una camera de conteo Thoma. Se calculó la TRE por cada fracción usando la fórmula: TRE =

conc. post centrifugación × vol. post centrifugación

× 100

conc. pre-centrifugación × vol. pre-centrifugación

Evaluación de la motilidad de los espermatozoides Para evaluar la motilidad de los espermatozoides se diluyeron las muestras con TCFEY hasta alcanzar una concentración final de 25 x 106 espermatozoides/ml. Se mantuvieron las muestras a una temperatura de 37 ºC durante 10 min y posteriormente se colocó una gota (5 µl) de cada muestra en un portaobjetos cubierto con cubreobjetos de 22 × 22 mm. Se tomaron imágenes a una velocidad de 25 fotogramas por segundo de manera aleatoria de cuatro campos, o hasta alcanzar imágenes de un mínimo de 500 espermatozoides. Se consideró un área de la cabeza de los espermatozoides de entre 10 y 70 µm2. Los espermatozoides con una velocidad promedia de trayectoria (VAP) >10 µm/seg se clasificaron como móviles, y los que se desviaron <80 % de una línea recta se clasificaron como móviles de manera linear. En cada muestra de esperma analizada se midieron diez parámetros: motilidad total (TM, %); motilidad progresiva (PM, %), velocidad curvilínea (VCL, µm/seg); velocidad en línea recta (VSL, µm/seg); velocidad de la trayectoria promedia (VAP, µm/seg); rectitud (STR, %); linealidad (LIN, %); oscilación lateral de la cabeza del espermatozoide (WOB,%); amplitud del desplazamiento lateral de la cabeza (ALH; µm); y frecuencia de latido/cruzamiento (BCF; Hz). Se utilizó el software ISAS v.1.2 (Proiser, Valencia, España) para la evaluación de la motilidad de los espermatozoides.

Evaluación de la funcionalidad de la membrana de los espermatozoides Se utilizó la prueba de hinchazón hipoosmótica (HOST)(16) para medir el estado funcional de la membrana de los espermatozoides. Se diluyeron 10 µl de cada fracción de semen en 100 µl de solución de citrato de sodio hipoosmótico (1.351 g de fructosa, 0.735 g de citrato de sodio y 100 ml de agua bidestilada; 100 mOsmol/kg), y se entibió la solución a la temperatura ambiente durante 30 min. Después de la incubación, las muestras se fijaron en glutaraldehído al 2% y se observaron con microscopía de contraste de fase (aumento 400x). La membrana de los espermatozoides se consideró intacta y funcional cuando la cola de los espermatozoides exhibía enrollamiento. Se analizaron un total de 200 espermatozoides y los resultados se expresaron como un porcentaje de la endosmosis positiva. 390


Rev Mex Cienc Pecu 2021;12(2):386-401

Evaluación de la morfología de los espermatozoides Se usó la tinción de hemacolor (Merck, Darmstadt, Alemania) para identificar las diferentes anormalidades morfológicas del esperma(17). Se colocaron 10 µl de semen sobre un portaobjetos y se tiñó siguiendo las indicaciones del fabricante. Se cuantificó el porcentaje de las anormalidades basado en el conteo de aproximadamente 200 células espermatozoides (aumento de 1000x) (Olympus, Tokio, Japón).

Evaluación de la viabilidad de los espermatozoides La viabilidad de los espermatozoides se evaluó mediante tinción con eosina-nigrosina(18). En resumen, se disolvieron 0.67 g de Eosin Y (Panreac, Barcelona, España) y 0.9 g de cloruro de sodio (Panreac, Barcelona, España) en agua bidestilada (100 ml) bajo un calentamiento suave, y luego se agregaron 10 g de nigrosina (Panreac, Barcelona, España). Se mezcló una gota de 10 µl de muestra de semen con una gota de 10 µl del colorante sobre un portaobjetos de vidrio y se realizó el frotis. Para la evaluación, se analizaron 200 espermatozoides (aumento de 1000x) (Olympus, Tokio, Japón). Los espermatozoides se clasificaron como vivos (es decir, con la membrana intacta) cuando las células no estaban teñidas, o muertas (es decir, con la membrana alterada) cuando se tiñeron de rosa con eosina. Los resultados se expresaron como porcentaje de espermatozoides vivos.

Análisis estadístico Los datos se muestran en forma de la media ± DE. Se probó la normalidad de los datos mediante la prueba de Shapiro-Wilks, y cuando los datos no eran normales se transformaron. A las variables expresadas como porcentajes (LIN, STR y WOB) se transformaron en arcoseno, mientras que los que están expresados como valores absolutos (VCL, VSL, VAP, ALH y BCF) se transformaron por medio de un logaritmo. Para identificar la TRE y la calidad de los espermatozoides, se aplicó un ANOVA de una vía para comparar los parámetros de los espermatozoides en las diferentes fracciones producidas por SLC, en las dos concentraciones (C800 y C3000), con los valores de esperma fresco. Se utilizó la prueba post hoc de Bonferroni cuando se detectaron diferencias significativas entre las fracciones (P≤0.05). Con el fin de identificar las subpoblaciones de espermatozoides específicas en función a los parámetros cinemáticos, se evaluó un total de 20,485 observaciones de semen fresco y procesado por medio de procedimientos de agregación. Para comenzar, se realizó un análisis de componentes principales (PC) de los datos para reducir las ocho variables estudiadas (VCL, VSL, VAP, LIN, STR, WOB, ALH y BCF) al menor número de las combinaciones lineales de las variables iniciales (llamados PC) que guardarían la mayor cantidad de la información contenida en las variables originales. Es de esperar que algunos pocos de las PC explican una alta proporción de la varianza total. Se utilizó el

391


Rev Mex Cienc Pecu 2021;12(2):386-401

método de rotación varimax y se seleccionó el número de las PC aplicando el criterio de Kaiser para identificar aquellos con un valor propio superior a 1. Se utilizó un procedimiento de agregación de dos pasos para analizar los índices derivados de los espermatozoides producidos por los PC. Se identificaron las diferentes subpoblaciones y se detectaron valores atípicos. Se analizó el tipo de subpoblación de espermatozoides en cada muestra de semen y se utilizó la prueba de Ji-cuadrada para comparar las frecuencias relativas de subpoblaciones dentro de cada muestra (o fracción) de semen. Los análisis estadísticos se hicieron con el paquete SPSS 17.0 (SPSS, Chicago, IL, EE. UU.).

Resultados Tasa de recuperación por SLC El porcentaje de recuperación de espermatozoides por SLC en la fracción que, en teoría, contendría los mejores espermatozoides (F3) no difirió (P>0.05) entre las concentraciones de C800 (36.1%) y C3000 (27.5%) (Figura 2). En la F1, el porcentaje de recuperación fue mayor en las muestras C3000 que en las C800; lo contrario ocurrió en la F2. En las muestras de C800, no hubo diferencias entre las tres fracciones, mientras en las de C3000 el porcentaje de recuperación en la F1 fue mayor que en la F3. Figura 2: Tasa de recuperación de espermatozoides (%) en las tres fracciones producidas por SLC en muestras de semen con concentraciones de 800 y 3000 × 106 esp/ml; (C800 and C3000)

* Diferencias (P≤0.05) entre las dos concentraciones dentro de la misma fracción. A, B Diferencias (P≤0.05) entre las fracciones dentro de la misma concentración.

392


Rev Mex Cienc Pecu 2021;12(2):386-401

Evaluación de los espermatozoides

Los valores de motilidad que corresponden a los espermatozoides aislados en las diferentes fracciones no difirieron entre las fracciones ni entre las concentraciones (C800 a nd C3000) (Cuadro 1). Cuadro 1: Valores promedios ( DE) de la motilidad y de parámetros cinemáticos para las fracciones SLC de espermatozoides en muestras de dos concentraciones Parámetros Fracción

C800 FRESCO

TM (%)

PM (%)

SLC 89.0 ± 2.0 88.4 ± 6.8 89.5 ± 2.5

F1 F2 F3 Completo F1 F2 F3 Completo

50.3 ± 7.0 41.7 ± 9.6 37.0 ± 18.4 48.8  12.2

VSL (µm/s)

VAP (µm/s)

LIN (%)

117.9  11.1

120 ± 9.7 129.9 ± 12.9 124.2  4.7

72.2 ± 13.9 66.5 ± 12.4 69.1 ± 12.3

69.7 ± 7.1 81.8 ± 11.8 71.7 ± 14.6 58.2  18.1

59.9  18.6

F1 F2 F3

F1 F2 F3

119 ± 5.3

133 ± 18.6

F1 F2 F3

Completo

48.2 ± 4.8 56.2 ± 12.2 48.4 ± 20.2

121.4 ± 17.6 127.3 ± 12.8

F3

Completo

SLC 86.0 ± 3.5 86.5 ± 4.0 88.5 ± 6.1

50.2  9.0

F2

Completo

FRESCO

89.8  3.06

87.9  3.7

F1 VCL (µm/s)

C3000

94.9 ± 16.5 94.2 ± 15.4 96.5 ± 14.5 80.23  18.0

91.5 ± 7.4 100.2 ± 6.9 95.1 ± 12.0 77.9  17.5

59.4 ± 6.3 52.2 ± 9.0 52.9 ± 11.2

393

58.4 ± 3.5 68.4 ± 12.3 56.7 ± 14.9


Rev Mex Cienc Pecu 2021;12(2):386-401

Completo STR (%)

WOB (%)

ALH (µm)

BCF (Hz)

F1 F2 F3 Completo F1 F2 F3

72.8  6.3

Completo

66.7  9.4

F1 F2 F3 Completo F1 F2 F3 Completo

46.6  12.9

50.0  10.2 76.1 ± 5.5 70.5 ± 5.7 71.4 ± 6.9

76.1 ± 2.1 81.3 ± 8.7 74.7 ± 7.8 73.7  5.8

77.9 ± 4.6 73.7 ± 8.3 73.5 ± 10.6

76.8 ± 3.4 83.8 ± 7.8 74.6 ± 13.3 62.5  12.3

3.4 ± 0.4 3.8 ± 0.4 3.9 ± 0.9 3.78  0.3

3.5 ± 0.4 3.1 ± 0.5 3.9 ± 1.2 4.3  0.4

8.9 ± 3.2 8.9 ± 2.7 10.1 ± 4.0 11.9  0.9

10.3 ± 0.3 10.0 ± 0.8 10.9 ± 2.0 12.9  1.6

C800= muestra de 800 × 106 esp/ml; C3000= muestra de 3000 × 106 esp/ml; SLC= centrifugación de una sola capa; F1= fracción superior; F2= fracción media; F3= fracción inferior; TM= motilidad total; PM= motilidad progresiva; VCL= velocidad curvilínea; VSL= velocidad en línea recta; VAP= velocidad de la trayectoria promedio; STR= rectitud; LI=: linealidad; WOB= oscilación lateral de la cabeza del esperma; ALH= amplitud del desplazamiento de la cabeza; BCF= frecuencia latido/cruzamiento.

Los resultados de la viabilidad, la morfología y la funcionalidad de la membrana de los espermatozoides mostraron que la F3 tuvo los valores más altos (Cuadro 2), aunque no fueron diferentes (P>0.05) de los valores de las otras fracciones ni entre las dos concentraciones.

394


Rev Mex Cienc Pecu 2021;12(2):386-401

Cuadro 2: Los valores promedios ( DE) de la viabilidad, la morfología y la funcionalidad de la membrana de los espermatozoides en las diferentes fracciones SLC en muestras con dos concentraciones Parámetros

Fracción

C800 FRESCO SLC F1 81.2 ± F2 92.0 17.1± F3 95.4 8.6 ± Completo 89.0  8.9 5.4

Viabilidad (%)

F1 F2 F3 Completo 87.6  5.1

Morfología (%)

Funcionalidad membrana (%)

de

la

F1 F2 F3 Completo 65.4  1.7

61.0 ± 80.7 25.9± 85.3 15.5± 6.6

C3000 FRESCO SLC 91.3 ± 93.5 10.2± 94.8 8.2 ± 89.5 5.7 14.6 83.5 ± 90.3 7.1 ± 93.5 5.9 ± 5.1 90.1  3.3

64.5 ± 65.5 15.8± 68.3 9.9 ± 9.8

75.3 ± 78.7 7.9 ± 80.7 2.7 ± 3.8

80.6  4.5

C800= muestra de 800 × 106 esp/ml; C3000= muestra de 3000 × 106 esp/ml; SLC= centrifugación de una sola capa; F1= fracción superior; F2= fracción media; F3= fracción inferior.

Las subpoblaciones de los espermatozoides Entre los 20,485 espermatozoides individuales motiles evaluados en este estudio, se identificaron tres subpoblaciones (Cuadro 3). Cuadro 3: Los valores promedios ( DE) de los parámetros cinemáticos y de velocidad usados en la caracterización de las tres subpoblaciones de espermatozoides identificadas en las muestras frescas de semen ovino. VCL VSL VAP LIN STR WOB ALH BCF (µm/s) (µm/s) (µm/s) (%) (%) (%) (µm) (Hz) 65.5  18.5  38.9  31  52  60  2.9  5.5  SP1 3,906 19.1 41.4 13.4 27.4 2 2 1 1.7 2.5 106.9 121  93.1  77  87  88  3.1  9.4  SP2 8,950 43.7  34.4 36.2 31.7 1 1 8 1.2 2.8 154.4 61.4  96.7  40  65  63  5.4  12.9 SP3 7,629 37.2  35.2 26.7 26.9 2 2 1 1.4  3.1 122.8 67.1  90.1  55  72  73  3.9  10  Total 20,485 100  48.6 38.7 39.6 2 2 2 1.8 3.9 VCL= velocidad curvilínea; VSL= velocidad de línea recta; VAP= velocidad de la trayectoria promedio; STR= rectitud; LIN= linealidad; WOB= oscilación lateral de la cabeza del esperma; ALH= amplitud del desplazamiento de la cabeza; BCF= frecuencia latido/cruzamiento. Subpop.

N

%

395


Rev Mex Cienc Pecu 2021;12(2):386-401

En el análisis de PC se identificaron tres componentes que explicaron un 76.70 % de la varianza total (Cuadro 4). Los parámetros de VCL, VSL y VAP se asociaron con el PC1, los de STR y LIN con el PC2 y el WOB con el PC3. Cuadro 4: El análisis de los componentes principales (PC) con ocho parámetros del esperma, utilizando la rotación varimax Valor propio Porcentaje Porcentaje cumulativo VCL VSL VAP ALH BCF LIN STR WOB

PC1

PC2

PC3

2.55 31.91 31.91 0.96 0.70 0.92 0.46 0.23 0.11 0.06 0.17

2.27 28.35 60.26 0.01 0.64 0.16 -0.18 0.13 0.82 0.98 0.39

1.31 16.44 76.70 - 0.06 0.24 0.29 - 0.28 - 0.02 0.53 0.15 0.89

Pesos ≥0.70 están en negritas.

Los espermatozoides incluidos en la subpoblación 1 (SP1) mostraron una velocidad más baja (basada en VCL, VSL y VAP) que los de las otras fracciones y ninguna motilidad progresiva (valores bajos de LIN, STR, WOB, ALH y BCF); un total del 19.1 % de los espermatozoides pertenecían a la SP1. Los que estaban en la SP2 mostraron una velocidad alta (VCL, VSL, VAP y ALH), una progresividad alta (altos valores de LIN, STR y WOB) y buenos valores para el ALH y BCF. Se podría definir esta subpoblación como constituida por espermatozoides rápidos y progresivos; el 43.7 % de los espermatozoides pertenecían a la SP2. Los que estaban en la SP3 mostraron valores altos de VCL, ALH y BCF, pero bajos valores de LIN y STR. Estos espermatozoides se podrían definir como rápidos y no lineales, y representaron el 37.2 % del total. En las muestras de C800, la SP3 fue más alto (P≤0.05) en las F2 y F3 que, en la F1, mientras que las SP1 y SP2 fueron más altos (P≤0.05) en la F1 que en las demás fracciones (Figura 3). El patrón era diferente en las muestras de C3000. La SP2 (rápido y progresiva) fue más alta (P≤0.05) en la F1 que en las F3 (fracción selectiva) y F2. La alta concentración causó que la mayoría de los espermatozoides en la F3 (la que, en teoría, contiene los mejores espermas) provenían de la SP3 (rápido y no progresivo).

396


Rev Mex Cienc Pecu 2021;12(2):386-401

Figura 3: Distribución relativa de las frecuencias de las subpoblaciones de los espermatozoides en las fracciones de semen producidos por SLC en las muestras con concentraciones espermáticas de 800 y 3000 × 106 /ml (C800 and C3000)

ab

Distintas letras entre las fracciones de la misma concentración indican diferencia (P≤0.05).

Discusión El presente estudio evaluó la capacidad de separación de espermatozoides y las características de las fracciones de semen aisladas después de SLC en muestras normospérmicas de carnero. Con el propósito de confirmar si este procedimiento de separación de espermatozoides podría ser eficaz con eyaculados frescos de carnero, se prepararon las muestras con un volumen de alrededor de 1.5 ml y concentraciones de 800 o 3000 × 106 espermatozoides/ml. Más aún, el enfoque en ocho parámetros cinemáticos permitió la identificación de tres subpoblaciones de espermatozoides diferentes en los eyaculados frescos enteros y en las fracciones separadas por SLC. Se sabe que la centrifugación del semen puede afectar la motilidad y la integridad de la membrana en los espermatozoides de pequeños rumiantes(19,20). Sin embargo, el uso de la centrifugación combinada con coloides es una opción prometedora para la selección de los mejores espermatozoides con el propósito de mejorar los resultados de la IA. Con base en los parámetros aplicados en el presente estudio (motilidad, viabilidad, morfología y funcionalidad de la membrana), los resultados sugieren que SLC no produce una separación adecuada de los espermatozoides en el semen normospérmico de carnero. Esto concuerda con un estudio reciente llevado a cabo en ciervo rojo(21), en el cual se demuestra que el tipo de coloide utilizado afecta la eficiencia de la técnica SLC, y que DLC ofrece una mejor capacidad de separación si las muestras de semen son de baja calidad(22).

397


Rev Mex Cienc Pecu 2021;12(2):386-401

De las tres fracciones de espermatozoides aislados por SLC se esperaba encontrar los de mejor calidad en la F3. Sin embargo, los espermatozoides de esta fracción no lograron una mayor motilidad (total y progresiva) que los de las F2 y F1. Los resultados confirmaron que las anomalías morfológicas se reducen mientras los espermatozoides cruzan las capas coloides, pero las diferencias no fueron significativas. Estos resultados están de acuerdo con reportes sobre rumiantes silvestres(23) y llamas(24), en donde no se encontraron diferencias morfológicas entre los espermatozoides frescos y los separados en muestras de semen de buena calidad. En otro estudio de esperma de toro, los procedimientos coloidales aumentaron el número de espermatozoides con una morfología normal en muestras de semen de mala calidad(25). Sin embargo, cuando se utilizó SLC con muestras normospérmicas no se produjo una ventaja en términos de la separación de espermatozoides con una morfología normal. Los valores de la funcionalidad de la membrana de los espermatozoides no variaron después de la aplicación de SLC, no importa la concentración de los espermatozoides (C800 o C3000). Aparentemente, la aplicación de SLC no excluyó de manera eficaz a los espermatozoides con una funcionalidad de membrana, una morfología y/o una viabilidad de bajo nivel. Esto concuerda con los resultados de la separación del semen de equinos por medio de SLC usando Androcoll(26). Otros estudios sobre el semen normospérmico de toro no hallaron un efecto de SLC en comparación con muestras no tratadas(25). Según el conocimiento de los autores, este es el primer estudio en analizar las subpoblaciones de espermatozoides de carnero en diferentes fracciones de semen producidas por la SLC. Se confirmó que los eyaculados de carnero contienen subpoblaciones de espermatozoides heterogéneas. Estos determinan la fertilidad, ya que el éxito reproductivo post inseminación ocurre mediante la selección natural de los espermatozoides(27). Se puede mejorar la fertilidad que ofrece un eyaculado por medio de procedimientos como la selección de espermatozoides con la centrifugación usando los coloides. Con base en investigaciones previas(28,29), y después de la evaluación de parámetros cinemáticos individuales en muestras de espermatozoides de carnero en el presente estudio, se pudieron identificar tres subpoblaciones distintas con características diferenciales. Como es de esperar en los eyaculados normospérmicos, la subpoblación que mostraba espermatozoides con motilidad baja y no progresiva (SP1) representaba la proporción más chica en la muestra de semen (19.1 %). Por el contrario, la SP2 (clasificado como rápida y progresiva) representaba el 43.7 %, la subpoblación más grande. Finalmente, la SP3 (rápidos, no lineares) tenía altos valores de VLC y ALH, bajo valores de LIN y STR, y representaba un 37.2 % de los espermatozoides, lo cual está de acuerdo con estudios previos(28,29). El procesamiento del esperma de carnero por SLC y el aislamiento de sus diferentes fracciones no es eficaz en la separación de la subpoblación con la mejor motilidad, no importa la concentración de los espermatozoides (C800 o C3000). Por ejemplo, la SP2 no fue la subpoblación más abundante en la F3, como se esperaba. De hecho, muchos de los espermatozoides en la SP2 (considerada como la mejor subpoblación) fueron 398


Rev Mex Cienc Pecu 2021;12(2):386-401

retenidos en la segunda interfaz. Una posible explicación para este resultado es que el alto número de espermatozoides incluidos en la muestra podría haber impedido que otros espermatozoides óptimos logren nadar hasta el fondo de los tubos(30). En estudios anteriores(31), se recomienda utilizar SLC para el procesamiento de grandes volúmenes de semen, lo cual sugiere que la alta concentración de espermatozoides (3000 x 106 esp/ml) impidió el funcionamiento adecuado de esta técnica. Los resultados presentes concuerdan con estudios anteriores(23), ya que muestran que las técnicas de selección de semen no mejoran la calidad de los espermatozoides en muestras de semen no estresadas.

Conclusiones e implicaciones La centrifugación coloidal no es un método eficaz en la selección de espermatozoides en muestras que contienen una alta concentración de espermatozoides de buena calidad (es decir, normospérmicas). En futuros estudios sería informativo aplicar la misma técnica con muestras de semen de baja calidad para cuantificar la eficiencia de la separación de semen de carnero por centrifugación coloidal. Además, será importante determinar la capacidad de congelación de las fracciones de espermatozoides separadas por centrifugación coloidal. Literatura citada: 1. Palacín I, Vicente-Fiel S, Santolaria P, Yániz JL. Standardization of CASA sperm motility assessment in the ram. Small Ruminant Res 2013;(1-3):128-135. 2.

Martínez-Pastor F, Garcia-Macias V, Álvarez M, Herráez P, Anel L, de Paz P. Sperm Subpopulations in Iberian red deer epididymal sperm and their changes through the cryopreservation process. Biol Reprod 2005;(2):316-327.

3.

Aalberts M, Sostaric E, Wubbolts R, Wauben MW, Nolte-'t Hoen EN. Spermatozoa recruit prostasomes in response to capacitation induction. Biochim Biophys Acta 2013;(11):2326-2335.

4.

Ou Z, Yanf L, Chen Z, Deng Y, Wang H, Sun L. Comparison of the outcomes of different human spermatozoa selection methods in assisted reproduction. Biomed Res 2018;(12):2615-2619.

5.

Kaneko S, Oshio S, Kobanawa K, Kobayashi T, Mohri H, Iizuka R. Purification of human sperm by a discontinuous Percoll density gradient with an innercolumn. Biol Reprod 1986;(4):1059-1063.

6.

Valcárcel A, de las Heras MA, Moses DF, Pérez LJ, Baldassarre H. Comparison between Sephadex G-10 and Percoll for preparation of normospermic, asthenospermic and frozen/thawed ram semen. Anim Reprod Sci 1996;(3-4):215224.

399


Rev Mex Cienc Pecu 2021;12(2):386-401

7.

Matás C, Vieira L, García-Vázquez FA, Avilés-López K, López-Úbeda R, Carvajal JA et al. Effects of centrifugation through three different discontinuous Percoll gradients on boar sperm function. Anim Reprod Sci 2011;(1-2):62-72.

8.

Morrell JM, Johannisson A, Dalin AM, Rodriguez-Martinez H. Morphology and chromatin integrity of stallion spermatozoa prepared by density gradient and single layer centrifugation through silica colloids. Reprod Domest Anim 2009;(3):512-517.

9.

Morrell JM, Rodriguez H. Colloid centrifugation of semen: Applications in assisted reproduction. Am J Analyt Chem 2016;(7):597-610.

10. Edmond AJ, Brinsko SP, Love CC, Blanchard TL, Teague SR, Varner DD. Effect of centrifugal fractionation protocols on quality and recovery rate of equine sperm. Theriogenology 2012;(5):959-966. 11. Morrell JM. Biomimetics in Action: Practical applications of single layer centrifugation for equine breeding. J Vet Sci Technol 2011;(2):107. 12. Goodla L, Morrell JM, Yusnizar Y, Stalhammar H, Johannosson A. Quality of bull spermatozoa after preparation by single-layer centrifugation. J Dairy Sci 2014;(4):19. 13. Nongbua T, Johannisson A, Edman A, Morrell JM. Effects of single layer centrifugation (SLC) on bull spermatozoa prior to freezing on post-thaw semen characteristics. Reprod Domest Anim 2017;(4):596-602. 14. Yulnawati Y, Abraham MC, Laskowski D, Johannisson A, Morrell JM. Changes in bull sperm kinematics after single layer centrifugation. Reprod Domest Anim 2014; (6):954-956. 15. Gosalvez J, Johnston S, Lopez-Fernandez C, Gosalbez A, Arroyo F. Sperm fractions obtained following density gradient centrifugation in human ejaculates show differences in sperm DNA longevity. Asian Pacific J Reprod 2014;(3):116-120. 16. Jeyendran RS, Van der Ven HH, Perez-Pelaez M, Crabo BG, Zaneveld LJD. Development of an assay to assess the functional integrity of the human sperm membrane and its relationship to other semen characteristics. J Reprod Fertil 1984; (1):219-228. 17. World Health Organization. WHO laboratory manual for the examination and processing of human semen. 5th ed. Cambridge University Press; 2010. 18. Björndahl L, Soderlund I, Kvist U. Evaluation of the one-step eosin-nigrosin staining technique for human sperm vitality assessment. Hum Reprod 2003;(4):813-816. 19. Ritar AJ. Control of ovulation, storage of semen and artificial insemination of fibreproducing goats in Australia: a review. Aust J Exp Agric 1993;(6):807-820.

400


Rev Mex Cienc Pecu 2021;12(2):386-401

20. Gil J, Söderquist L, Rodríguez-Martínez H. Influence of centrifugation and different extenders on post-thaw sperm quality of ram semen. Theriogenology 2000;(1):93108. 21. García-Álvarez O, Soler AJ, Maulen Z, Maroto-Morales A, Iniesta-Cuerda M, Martín-Maestro A et al. Selection of red deer spermatozoa with different cryoresistance using density gradients. Reprod Domest Anim 2016;(6):895-900. 22. Maxwell WMC, Parrilla I, Caballero I, Garcia E, Roca J, Martínez EA et al. Retained functional integrity of bull spermatozoa after double freezing and thawing using PureSperm® density gradient centrifugation. Reprod Domest Anim 2007;(5):489494. 23. Santiago-Moreno J, Esteso MC, Castaño C, Toledano-Díaz A, Rodríguez E, LópezSebastián A. Sperm selection by Capripure® density-gradient centrifugation versus the dextran swim-up procedure in wild mountain ruminants. Anim Reprod Sci 2014;(3-4):178-186. 24. Santa Cruz R, Giuliano SM, Gambarotta MC, Morrell JM, Abraham MC, Miragaya MH et al. Comparison of differents methods of sperm selection of llama raw semen. Anim Reprod Sci 2016;(173):8-12. 25. Gloria A, Carluccio A, Wegher L, Robbe D, Befacchia G, Contri A. Single and double layer centrifugation improve the quality of cryopreserved bovine sperm from poor quality ejaculates. J Anim Sci Biotechnol 2016;(7):1-9. 26. Gamboa S, Quaresma A, Castro F, Bravo P, Rebordão MR, Oom MM et al. In vivo fertilizing ability of stallion spermatozoa processed by single layer centrifugation with Androcoll-E™. Saudi J Biol Sci 2017;(7):1489-1496. 27. Holt WV, Van Look KJW. Concepts in sperm heterogeneity, sperm selection and sperm competition as biological foundations for laboratory tests of semen quality. Reproduction 2004;(5):527-535. 28. Santolaria P, Vicente-Fiel S, Palacín I, Fantova E, Blasco ME, Silvestre MA et al. Predictive capacity of sperm quality parameters and sperm subpopulations on field fertility after artificial insemination in sheep. Anim Reprod Sci 2015;(163):82-88. 29. Yániz JL, Palacín I, Vicente-Fiel S, Sánchez-Nadal JA, Santolaria P. Sperm population structure in high and low field fertility rams. Anim Reprod Sci 2015;(156):128-134. 30. Bergstein TG, Bicudo LC, Rodello L, Weiss RR, Bicudo SD. Kinematic and spermatic recovery after selection by centrifugation in colloid solutions of ovine cryopreserved semen. Arq Bras Med Vet Zootec 2016;(6):1539-1547. 31. Morrell JM,Van Wienen M, Wallgren M. Single layer centrifugation can be scaledup further to process up to 150 ml semen. ISRN Vet Sci 2012;1-6. 401


https://doi.org/10.22319/rmcp.v12i2.4918 Artículo

Rendimiento de la planta de frijol caupí [Vigna unguiculata (L.) Walp] y calidad nutricional en los sistemas de cultivo intercalado de frijol caupí y sorgo

Muhammad Aamir Iqbal a Asif Iqbal b Zahoor Ahmad c Ali Raza d Junaid Rahim e Muhammad Imran e Umer Ayyaz Aslam Sheikh e Qaiser Maqsood f Walid Soufan g Nesma M.A. Sahloul h Sobhy Sorour h Ayman El Sabagh h

a

University of Poonch Rawalakot (AJK). Faculty of Agriculture, Department of Agronomy, Pakistan. b

University of Agriculture Faisalabad, Department of Agronomy, Pakistan.

c

University of Central Punjab, Bahawalpur Campus, Department of Botany, Pakistan.

d

Fujian Agriculture and Forestry University, Fujian Provincial Key Laboratory of Crop Molecular and Cell Biology, China. e

University of Poonch Rawalakot (AJK). Faculty of Agriculture, Department of Entomology, Pakistan. f

Government College University Faisalabad, Layyah University, Department of Botany, Pakistan. 402


Rev Mex Cienc Pecu 2021;12(2):402-418 g

King Saud University. Plant Production Department, Saudi Arabia.

h

Kafrelsheikh University. Faculty of Agriculture, Department of Agronomy, Egypt.

*Autor de correspondencia: muhammadaamir@upr.edu.pk

Resumen: En los sistemas tradicionales de cultivo intercalado de frijol caupí y sorgo en franjas y filas, el rendimiento de forraje del frijol caupí se reduce significativamente debido a la intensa competencia y al dominio del sorgo en la adquisición de recursos para el cultivo. Este estudio de campo evaluó novedosos sistemas de cultivo intercalado en franjas mixtas de frijol caupí forrajero y sorgo con diferente número de filas de cultivo en diferentes disposiciones espaciales. El frijol caupí se intercaló con el sorgo en franjas de 8, 12 y 16 filas con un espaciamiento de 30, 45 y 60 cm entre las filas. En cada franja se mantuvo igual número de filas de frijol caupí y sorgo. Para la ejecución de los ensayos de campo durante las temporadas de verano de 2013 y 2014 se utilizó un diseño factorial en bloques completos aleatorizados con tres repeticiones. Las franjas con 12 filas y un espaciamiento de 60 cm entre las filas afectaron positivamente a todas las variables agronómicas del frijol caupí que condujeron al máximo rendimiento forrajero (22.2 y 23.7 t/ha en 2013 y 2014, respectivamente) y de biomasa de materia seca (6.63 y 6.94 t/ha en 2013 y 2014, respectivamente). En cambio, las franjas de 8 filas con un espaciamiento de 30 cm superaron a otros sistemas de cultivo intercalado al obtener el rendimiento máximo de hierba y de biomasa de materia seca del sorgo. El sistema de cultivo intercalado compuesto por franjas de 12 filas con un espaciamiento de 60 cm entre las filas siguió siendo superior, al registrar el contenido máximo de proteína bruta, grasas y cenizas junto con el mínimo contenido de fibra de frijol caupí. Además, este sistema de cultivo intercalado bajo el resto de las disposiciones espaciales también permaneció incomparable, mientras que las franjas de 16 filas bajo todas las geometrías de siembra permanecieron inferiores a otros sistemas de cultivo intercalado. Por lo tanto, el cultivo intercalado de frijol caupí con sorgo en franjas de 12 filas con un espaciado de 60 cm ofrece una solución biológicamente viable para mejorar la biomasa y la calidad del forraje del caupí en cultivo intercalado con sorgo. Palabras clave: Nutrición animal, Esquemas de plantación, Cultivos intercalados en filas.

Recibido: 30/05/2018 Aceptado: 31/08/2020

403


Rev Mex Cienc Pecu 2021;12(2):402-418

Introducción La seguridad alimentaria de una población en rápido crecimiento exige un aumento proporcional de la producción de leche y carne en todo el mundo(1,2). Bajo un clima cambiante, la producción de forrajes con una calidad nutricional aceptable ocupa un lugar central para obtener una producción de leche de forma sostenible(3). Aunque muchos cereales, incluido el sorgo, proporcionan un enorme tonelaje de biomasa, no son capaces de proporcionar una nutrición equilibrada a los animales lecheros(4,5,6). En consecuencia, hay que suministrar suplementos proteicos caros, lo que hace que se reduzcan los beneficios económicos. Además, la población de rumiantes está aumentando en todo el mundo, por lo que es necesario producir durante todo el año grandes cantidades de forraje nutritivo y más barato(7,8). Así, el cultivo intercalado de cereales con leguminosas podría conducir a lograr el doble propósito de obtener mayores cantidades de forraje con una mejor calidad nutricional. Los cultivos intercalados en filas, mixtos y en franjas de cereales con leguminosas se practican desde hace mucho tiempo(9,10). El cultivo intercalado de leguminosas forrajeras con cereales diversificó los recursos de la explotación, preservó y restauró la fertilidad del suelo y mejoró la eficiencia de los recursos edáficos y ambientales(11,12). Sin embargo, hay que considerar seriamente la elección de los cultivos intercalados de leguminosas con respecto a su compatibilidad en la utilización de los recursos en las dimensiones espacial y temporal. Entre los cultivos intercalados de leguminosas, el frijol caupí [Vigna unguiculata (L.) Walp] podría ser una buena opción por tener potencial para producir una cantidad considerablemente mayor de forraje nutritivo en cultivos intercalados con sorgo(13,14,15). Además, el frijol caupí tiene potencial para tolerar la sombra y soportar una sequía moderada, así como para fijar el nitrógeno atmosférico, lo que favorece su utilización como cultivo intercalado con los cereales(16,17). Sin embargo, el cultivo intercalado de frijol caupí sufrió pérdidas en el rendimiento forrajero y en la calidad nutricional debido al dominio de los cereales en la adquisición de recursos de cultivo(18,19). De este modo, el tipo de cultivo intercalado resulta fundamental para lograr la ventaja agregada del cultivo intercalado de frijol caupí con cereales forrajeros(20). Por lo tanto, en los sistemas de cultivo intercalado de sorgo y frijol caupí, el verdadero reto consiste en evitar la drástica reducción del rendimiento y la calidad del caupí forrajero. Varios estudios han informado de resultados contrastados sobre la eficacia del sistema de cultivo intercalado en franjas en el que se mantienen franjas separadas de los cultivos que lo integran(8,21,22). Sin embargo, existen pocas investigaciones de campo sobre el sistema de cultivo intercalado en franjas mixtas que implique filas de cultivos componentes en una misma franja. Además, la disposición espacial de los cultivos componentes también determinó la complementariedad y la competencia en los sistemas de cultivo intercalado de cereales y leguminosas(2,14). Sin embargo, hay que optimizar la disposición espacial con respecto al tipo de cultivo intercalado, especialmente para potenciar la productividad de las legumbres. 404


Rev Mex Cienc Pecu 2021;12(2):402-418

Por lo tanto, se planteó la hipótesis de que la optimización de los sistemas de cultivo intercalado en franjas y las disposiciones espaciales podrían conducir a un mejor rendimiento y valor nutricional del forraje de caupí. El presente estudio tuvo como objetivo principal investigar la influencia de los cultivos intercalados en franjas mixtas (franjas con filas de caupí y sorgo en la misma franja) y las geometrías de plantación en el rendimiento de forraje del frijol caupí sembrado con sorgo forrajero. Además, otro objetivo fue probar los rasgos agro-cualitativos del caupí forrajero debidos a la influencia de los distintos sistemas de cultivo intercalado en franjas, así como de la disposición espacial.

Material y métodos Descripción del sitio experimental Para evaluar el impacto de los cultivos intercalados en franjas mixtas y las geometrías de siembra en la productividad de los cultivos intercalados de caupí, se realizó un experimento de campo durante los meses de verano de 2013 y 2014 en el área de investigación de la Universidad de Agricultura de Faisalabad (30.35-41.47° N y 72.0873.40° E) situada a una altura de 184 m(14). El clima de la zona experimental es semiárido según Köppen, mientras que el suelo del sitio experimental se cataloga como yermosoles háplicos según el sistema de clasificación de suelos de la FAO. Los datos meteorológicos de las temporadas de cultivo del frijol caupí se obtuvieron del centro meteorológico situado más cerca (aproximadamente 1 km) de los campos de investigación (Cuadro 1).

Cuadro 1: Datos meteorológicos de las temporadas de cultivo del frijol caupí en 2013 y 2014 junto con los valores medios de 10 años (M10A)

2013

2014

M10A 2013

2014

Humedad relativa (%) M10A 2013 2014 M10A

Junio

40.3

41.5

40.1

44

40

40

60

64

59

Julio

39.5

38.6

41.0

106

102

101

65

72

62

Agosto

35.0

37.8

34.7

77

68

72

58

69

65

Media/Total 38.2

39.3

38.6

227

210

213

61.0

68.3

65.3

Mes

Temperatura (°C)

Precipitación (mm)

405


Rev Mex Cienc Pecu 2021;12(2):402-418

Tratamientos experimentales y diseño El frijol caupí y el sorgo se sembraron utilizando diferentes sistemas de cultivo intercalado en franjas y en tres disposiciones espaciales, como sigue: T1A1= franjas de 8 filas (caupí-sorgo en filas de 4 x 4 en las mismas franjas) con una separación de 30 cm entre las filas, T1A2= franjas de 8 filas (caupí-sorgo en filas de 4 x 4 en la misma franja) con una separación de 45 cm entre las filas, T1A3= franjas de 8 filas (caupí-sorgo en filas de 4 x 4 en la misma franja) con una separación de 60 cm entre las filas, T2A1= franjas de 12 filas (caupí-sorgo en filas de 6 x 6 en la misma franja) con una separación de 30 cm entre las filas, T2A2= franjas de 12 filas (caupí-sorgo en filas de 6 x 6 en la misma franja) con una separación de 45 cm entre las filas, T2A3= franjas de 12 filas (caupí-sorgo en filas de 6 x 6 en la misma tira) con una separación de 60 cm entre las filas, T3A1= franjas de 16 filas (caupí-sorgo en filas de 8 x 8 en la misma franja) con una separación de 30 cm entre las filas, T3A2= franjas de 16 filas (caupí-sorgo en filas de 8 x 8 en la misma franja) con una separación de 45 cm entre las filas, T3A3= Franjas de 16 filas (caupí-sorgo en filas de 8 x 8 en la misma franja) con una separación de 60 cm entre las filas. De este modo, se probaron un total de 9 combinaciones de tratamiento en disposición factorial de diseño de bloques completos aleatorios (DCA) con tres repeticiones. La distancia franja × franja para todos los sistemas de cultivo intercalado se mantuvo en 70 cm. Las filas de caupí eran adyacentes a las filas de sorgo en las franjas siguientes. No se tuvo en cuenta la distancia entre plantas. En total, hubo 27 parcelas experimentales que se mantuvieron en forma homogénea para probar los tratamientos propuestos.

Plan de procedimiento agronómico Para formular el plan de gestión de la fertilidad del suelo, se realizaron análisis físicoquímicos previos a la siembra a partir de muestras de suelo recogidas a 15 y 30 cm de profundidad (Cuadro 2). La preparación del lecho de siembra se inició con un riego de 12 cm previo a la siembra y la tierra se aró con tractor en tres ocasiones y se planchó después de cada una. Se intercaló frijol caupí (cv. P-51840 a kg/ha) y sorgo (cv. Hegari a 80 kg/ha) en filas separadas por una distancia de 30 cm, utilizando un taladro manual. La dosis recomendada de nitrógeno (50 kg/ha) (urea) se aplicó en dos partes (una en el momento de la siembra, y la otra, con el primer riego 12 días después de la siembra) mientras que el fósforo total (superfosfato simple) (40 kg/ha) se aplicó como dosis basal. Se aplicaron tres riegos de inundación, 12, 33 y 50 días después de la siembra. La escarda manual se realizó tres veces (12, 22 y 32 días después de la siembra) para mantener a raya la infestación de malas hierbas. Los cultivos intermedios de frijol caupí se cosecharon con una hoz manual en plena floración.

406


Rev Mex Cienc Pecu 2021;12(2):402-418

Cuadro 2: Análisis físico-químico previo a la siembra del suelo experimental en 2013 y 2014 Características del suelo Análisis mecánico: Arena, % Limo,% Arcilla, % Clase de textura Análisis químico: pH CE, dS/m Materia orgánica, % Nitrógeno disponible, ppm Fósforo disponible, ppm Potasio disponible, ppm

2013

2014

57.0 17.5 25.5 Franco arcilloso arenoso

54.5 19.3 26.2 Franco arcilloso arenoso

7.9 1.68 0.75 6.1 0.96 117

7.6 1.64 0.78 6.4 0.91 112

Registro de datos Todos los atributos agronómicos del frijol caupí se registraron en el momento de la cosecha siguiendo los métodos prescritos. Se cosecharon diez plantas de las filas centrales de cada réplica y luego se calculó su promedio. La altura de la planta se registró con la ayuda de una cinta métrica de sastre desde la base de la planta hasta la punta de la hoja más alta. La circunferencia del tallo se midió utilizando un calibre de vernier. Se utilizó una balanza eléctrica para precisar el peso fresco por planta, mientras que una balanza de resorte se utilizó para registrar el rendimiento de forraje verde por parcela, que luego se convirtió a toneladas por hectárea. Los atributos agro-cualitativos del caupí forrajero se determinaron utilizando las metodologías indicadas en el Cuadro 3.

Cuadro 3: Procedimiento adoptado para medir los rasgos agrocualitativos del caupí según lo sugerido por la AOAC (2003) Atributos de calidad

Metodología

Proteína bruta

Método Macro-KJeldahl y, posteriormente, multiplicar el porcentaje de nitrógeno por una constante de 6.25

Fibra bruta

Método de digestión de H2SO4 y NaOH

Grasa extraíble con éter

Método de extracción Soxhlet

Total de cenizas

Cenizas calentadas a 600 °C en horno de mufla

407


Rev Mex Cienc Pecu 2021;12(2):402-418

Análisis estadístico Los análisis estadísticos de los datos registrados se realizaron mediante el empleo del análisis de la varianza (ANOVA) utilizando el programa estadístico “Statistix 8.1”. Las medias se agruparon para realizar contrastes ortogonales sobre la base de lo siguiente: (a) sistema de intercultivo vs. año, (b) disposición espacial vs. año, (c) sistema de intercultivo vs. disposición espacial y (d) sistema de intercultivo vs. disposición espacial vs. año a un nivel de probabilidad del 5%. Los datos también se sometieron a un análisis de correlación para determinar la relación (lineal o inversa) entre los atributos de rendimiento y el rendimiento forrajero del caupí.

Resultados y discusión Altura de la planta y diámetro del tallo Las variables agronómicas del caupí forrajero mejoraron significativamente en 2014, probablemente debido a las mayores precipitaciones y a las temperaturas moderadas en comparación con 2013. El efecto interactivo de los sistemas de cultivo intercalado en franjas y las disposiciones espaciales fue significativo para la altura de la planta de caupí (189** y 203** en 2013 y 2014, respectivamente) y la circunferencia del tallo (88* y 98** en 2013 y 2014, respectivamente) (Cuadro 4). Las plantas de caupí más altas (110.3 ± 0.57 y 117.9 ± 0,83 cm en 2013 y 2014, respectivamente) con mayor circunferencia del tallo (2.87 ± 0.67 y 2.94 ± 0.69 cm en 2013 y 2014, respectivamente) se registraron en el caupí sembrado en franjas de 12 filas espaciadas a 60 cm (T2A3), mientras que las franjas de 16 filas espaciadas a 45 cm (T3A2) dieron como resultado la menor altura de planta (78. 0 ± 0.38 y 83.1 ± 0.82 cm en 2013 y 2014, respectivamente), así como la menor circunferencia del tallo (2.32 ± 0.81 y 2.53 ± 0.41 cm en 2013 y 2014, respectivamente) (Cuadro 5). El análisis de correlación reveló que había una correlación lineal entre la altura de la planta y la circunferencia del tallo del caupí, como se muestra en la Figura 1. Estos resultados coinciden totalmente con los de otro estudio(23) en el que la altura de la planta de leguminosas y el diámetro del tallo se vieron influidos por las geometrías de siembra de los sistemas de cultivo intercalado de cereales y leguminosas. El cultivo simultáneo de los componentes de los sistemas de cultivo intercalado en filas y mixto intensificó la competencia entre especies por los recursos aplicados a la explotación, lo que provocó una reducción de la altura de las plantas y del perímetro del tallo de las leguminosas en comparación con sus monocultivos. Pero cuando el frijol caupí se sembró en franjas de 12 filas (caupí-sorgo en filas de 6 x 6), puede haber disminuido el dominio del sorgo en la adquisición de recursos para el crecimiento. La variación de la longitud de las raíces del caupí y del sorgo podría atribuirse a la reducción de la competencia por los recursos para el crecimiento, que se vio reforzada por un mayor espaciamiento de las franjas(24).

408


Rev Mex Cienc Pecu 2021;12(2):402-418

Número de hojas y relación hoja/tallo Los sistemas de cultivo intercalado y las disposiciones espaciales tuvieron un efecto interactivo significativo sobre el número de hojas (93* y 112* en 2013 y 2014, respectivamente) y sobre la relación hoja/tallo (83* y 96* en 2013 y 2014, respectivamente) (Cuadro 4). El cultivo intercalado de sorgo y frijol caupí en franjas de 12 filas espaciadas a 60 cm (T2A3) dio lugar a un mayor número de hojas por planta (29.1 ± 0.57 y 29.9 ± 0.31 en 2013 y 2014, respectivamente) y a una mayor relación hoja/tallo (0.59 ± 0.19 y 0.69 ± 0.21 en 2013 y 2014, respectivamente) (Cuadro 5). Estos resultados corroboran los hallazgos de otros estudios(2,3,25), en los que se concluyó que las filas de leguminosas estrechamente espaciadas registraron el menor número de hojas y la menor relación hoja/tallo a pesar de que se exploraron diversos horizontes del suelo para la absorción de humedad y nutrientes por parte del sorgo y las leguminosas; aun así, la competencia intraespecífica fue lo suficientemente severa como para reducir drásticamente el crecimiento de los cultivos intercalados de leguminosas. Además, el efecto de sombreado producido por el sorgo también resultó ser un factor importante en la reducción de la fotosíntesis de las plantas de leguminosas, particularmente en las filas adyacentes al sorgo, lo que conduce a que haya un menor número de hojas por planta.

Peso fresco y seco de las plantas, rendimiento de forraje verde y biomasa de materia seca El sistema de cultivo intercalado y las disposiciones espaciales también tuvieron un efecto interactivo significativo en el peso fresco (274** y 297** en 2013 y 2014, respectivamente), el peso seco (187** y 257** en 2013 y 2014, respectivamente) y el rendimiento de forraje verde (266** y 287** en 2013 y 2014, respectivamente), así como en el rendimiento de materia seca (134** y 120** en 2013 y 2014, respectivamente). El mayor peso fresco (188.6 ± 0.67 y 190.5 ± 0.61 g en 2013 y 2014, respectivamente) y el mayor peso seco (59.1 ± 0.67 y 66.3 ± 1.19 g en 2013 y 2014, respectivamente) por planta (Cuadro 5) se obtuvieron con el cultivo en franjas de 12 filas espaciadas a 60 cm (T2A3). El análisis de correlación mostró una relación lineal para los pesos fresco y seco por planta con los rendimientos de forraje verde y de materia seca (Figura 1). El mismo sistema de cultivo intercalado (T2A3) fue fundamental para obtener el máximo rendimiento de forraje verde (22.2 ± 0.28 y 23.7 ± 0.34 t/ha en 2013 y 2014, respectivamente) y de biomasa de materia seca (6.63 ± 0.26 y 6.94 ± 0.19 t/ha en 2013 y 2014, respectivamente) de caupí forrajero (Cuadro 6), cuando se utilizó seguido de la siembra en franjas de 12 filas con una separación de 45 cm (T2A1). En cambio, el cultivo en franjas de 8 filas de sorgo y frijol con una separación de 30 cm entre las filas (T2A1) siguió siendo superior en lo que respecta a la biomasa de forraje verde y al rendimiento de materia seca de sorgo. Le siguió el mismo sistema de cultivo intercalado con una separación de 45 cm entre las filas, mientras que el sistema de cultivo intercalado de sorgo y frijol compuesto por franjas de 16 filas con una separación de 60 cm entre las filas (T3A3) permaneció inferior al resto de los sistemas 409


Rev Mex Cienc Pecu 2021;12(2):402-418

de cultivo intercalado y a las disposiciones espaciales (Cuadro 6). El sistema de cultivo intercalado T2A3 dio lugar a atributos agronómicos superiores, como la altura de la planta, la circunferencia del tallo y el peso fresco y seco por planta, por lo que mejoró la biomasa de forraje verde y el rendimiento de materia seca. Esto coincide con los hallazgos de otros autores(22,26), quienes dedujeron que la productividad del caupí en sistemas de cultivo intercalado de espaciado estrecho (30 y 45 cm) seguía siendo inferior a la del caupí en solitario a pesar de desarrollar una buena nodulación y una fijación biológica del nitrógeno (FBN) plenamente funcional. Otros investigadores también han comunicado resultados similares(10,27), según los cuales el caupí siguió teniendo una menor captación de nutrientes y humedad que los cereales. Además, los cultivos intercalados de leguminosas sufrieron pérdidas de productividad debido a su dependencia de la solución de suelos para la captación de nitrógeno antes del inicio de la BNF después de 27-35 d de la siembra. Asimismo, en los sistemas de cultivo intercalado en franjas, las filas de frijol caupí adyacentes al sorgo se enfrentaron a una menor competencia por los recursos de crecimiento al explotar diversos horizontes del suelo, pero tuvieron que enfrentarse al efecto de sombreado producido por las plantas de sorgo más altas. Del mismo modo, las filas interiores de caupí se enfrentaron a un menor efecto de sombreado, pero la competencia por los recursos de crecimiento se intensificó debido a que tenían la misma longitud de raíz, lo que condujo a un menor rendimiento de hierba(28).

Contenido de proteína bruta y fibra bruta Todos los rasgos de calidad se vieron influidos significativamente por los sistemas de cultivo intercalado y las disposiciones espaciales, incluyendo la proteína bruta (120** y 135** en 2013 y 2014, respectivamente), la fibra bruta (142* y 169** en 2013 y 2014, respectivamente), la grasa extraíble por éter (200** y 225* en 2013 y 2014, respectivamente) y la ceniza total (101* y 109* en 2013 y 2014, respectivamente) (Cuadro 4). El contenido de proteínas ocupa una posición vital en la determinación de la calidad nutricional del forraje, mientras que los agrónomos y los nutricionistas de animales recomiendan forrajes ricos en proteínas para aumentar el rendimiento de los animales lecheros. El cultivo intercalado de frijol caupí y sorgo en franjas de 12 filas espaciadas a 60 cm (T2A3) mejoró efectivamente la proteína bruta (19.9 ± 0.21 y 19.6 ± 0.37 en 2013 y 2014, respectivamente) del forraje de caupí con el menor contenido de fibra bruta (26.1 ± 0.51 y 26.0 ± 0.90 en 2013 and 2014, respectivamente) (Cuadro 6). Le siguieron las franjas de 12 filas con una separación de 45 cm (T2A1), mientras que las franjas de 16 filas tuvieron un rendimiento inferior en todas las disposiciones espaciales. Las investigaciones anteriores(1,14) coinciden con estos resultados, puesto que informaron que se podía lograr una mejora sustancial de la proteína bruta de los forrajes mixtos mediante el cultivo intercalado de frijol caupí con forrajes de cereales con una disposición espacial optimizada. Se sugirió que el tipo de cultivo intercalado podría influir en el nitrógeno fijado por el caupí; esto se podría atribuir a la mejora del 410


Rev Mex Cienc Pecu 2021;12(2):402-418

contenido de proteína bruta y a la reducción de la fibra, ya que existía una correlación lineal entre el nitrógeno absorbido y el contenido de proteína. Los tipos de cultivo intercalado y las geometrías de siembra utilizados en nuestra investigación también han mejorado la eficacia de los nutrientes aplicados, lo que ha influido significativamente en el contenido de proteína y fibra bruta de los forrajes(14,29).

Contenido de grasa extraíble con éter y contenido total de cenizas Las grasas son un atributo de calidad esencial de los forrajes, ya que producen mayores cantidades de energía durante el metabolismo que las proteínas. Del mismo modo, los componentes minerales de los forrajes necesarios para realizar diversos procesos metabólicos se miden como cenizas. El sistema de cultivo intercalado (T2A3) dio como resultado el máximo contenido de grasa (1.91 ± 0.17 y 1.95 ± 0.29 % en 2013 y 2014, respectivamente) y de cenizas totales (11.78 ± 0.16 y 11.7 ± 0.21 % en 2013 y 2014, respectivamente) (Cuadro 6). Las franjas de 16 filas registraron los contenidos mínimos de grasa y cenizas independientemente de la disposición espacial. Las franjas con 8 filas en todas las geometrías de siembra se comportaron mejor en términos de calidad del forraje que las franjas de 16 filas, pero quedaron por debajo del caupí sembrado con sorgo forrajero en franjas de 12 filas. Estos resultados también coinciden con un estudio realizado anteriormente(30), que reveló que se podía obtener un rendimiento de hierba considerablemente mayor con atributos de calidad mejorados optimizando el tipo de cultivo intercalado y la disposición espacial de los cultivos componentes.

Conclusiones e implicaciones Este estudio informa sobre nuevos sistemas de cultivo intercalado en franjas mixtas para controlar la drástica reducción del rendimiento forrajero del caupí en el cultivo intercalado con el sorgo forrajero. En cuanto al rendimiento de forraje verde y a los rasgos agrocualitativos del caupí, se pudo deducir que las franjas de 12 filas (frijol caupí-sorgo en filas de 6x6) (T1A2) resultaron inigualables, sobre todo cuando la distancia entre las filas se mantuvo en 60 cm. Además, se observó un mejor crecimiento del frijol caupí en las filas adyacentes a las de sorgo en las franjas posteriores, en comparación con las filas de caupí adyacentes a las de sorgo en la misma franja. Las franjas de 16 filas, independientemente de la geometría de siembra, no pudieron estar a la altura de las demás franjas, probablemente debido a la mayor competencia intraespecífica por los recursos de crecimiento. Sin embargo, en virtud de estos resultados alentadores se requieren más investigaciones de campo sobre el cultivo mixto en franjas de cereales forrajeros y leguminosas para aumentar el rendimiento de las leguminosas en diversas condiciones agroclimáticas y agroecológicas.

411


Rev Mex Cienc Pecu 2021;12(2):402-418

Agradecimientos

Se agradece el apoyo a la investigación bajo el número de Proyecto de Apoyo a investigadores RSP/2021/390, de la Universidad King Saud, Riad, Arabia Saudita. Además, también se agradece el apoyo de la Comisión de Educación Superior de Pakistán en el marco de la beca indígena (2AV1-215). Literatura citada: 1.

Addo QA, Darkwa A, Ocloo GK. Growth analysis of component crops in a maizesoybean intercropping system as affected by time of planting and spatial arrangement. ARPN J Agric Biol Sci 2011;(6):34-44.

2.

Iqbal MA, Brandon JB, Asif I, Rana NA, Zubair A, Haroon ZK, Bilal A. Agrobotanical response of forage sorghum-soybean intercropping systems under atypical spatio-temporal pattern. Pak J Bot 2017;(49):987-994.

3.

Iqbal MA, Iqbal A, Akbar N, Khan HZ, Abbas RN. A study on feed stuffs role in enhancing the productivity of milch animals in Pakistan- Existing scenario and future prospect. Global Vet 2015;(14):23-33.

4.

Iqbal MA, Iqbal A, Ali K, Khan RD, Ahmad B, Raza A, Nabeel F. Integration of forage sorghum and by-products of sugarcane and sugar beet industries for ruminant nutrition: A Review. Global Vet 2015a;(14):752-760.

5.

Motha NK, De R. Intercropping maize and soybean. J Agric Sci 2009;(95):117122.

6.

Omari RE, Nhiri M. Adaptive response to salt stress in sorghum (Sorghum bicolor). Am-Eur J Agric Environ Sci 2015;(15):1351-1360.

7.

Iqbal MA. Agronomic management strategies elevate forage sorghum yield: A Review. J Adv Bot Zoo 2015;(3):1-6.

8.

Rudra SG, Shruti S, Jha SK, Rajeev K. Physico-chemical and functional properties of cowpea protein isolateas affected by the dehydration technique. Leg Res 2016;(39):370-378.

9.

Mucheru MM, Pypers P, Mugendi D, Kungu J, Mugwe J, Merckx R, Vanlauwe B. A staggered maize-legume intercrop arrangement robustly increases crop yields and economic returns in the highlands of Central Kenya. Field Crops Res 2010;(115):132-139.

10. Crusciol CAC, Mateus GP, Nascente AS, Martins PO, Borghi E, Pariz CM. An innovative crop-forage intercrop system: early cycle soybean cultivars and palisade grass. Agron J 2012;(104):1085-1095.

412


Rev Mex Cienc Pecu 2021;12(2):402-418

11. Sanchez DGR, Silva JET, Gil AP, Corona JSS, Wong JAC, Mascorro AG. Forage yield and quality of intercropped corn and soybean in narrow strips. Span J Agric Res 2010;(8):713-721. 12. Tracy BF, Zhang Y. Soil compaction, corn yield response, and soil nutrient pool dynamics within an integrated crop-livestock system in Illinois. Crop Sci 2008;(48):1211-1218. 13. Iqbal MA, Iqbal A, Ali K, Khan RD, Ahmad B, Raza A, Nabeel F. Integration of forage sorghum and by-products of sugarcane and sugar beet industries for ruminant nutrition: A Review. Global Vet 2015;(14):752-760. 14. Iqbal MA, Iqbal A, Ayub M, Akhtar J. Comparative study on temporal and spatial complementarity and profitability of forage sorghum-soybean intercropping systems. Cust Agroneg 2016;(12):2-18. 15. Singh V, Singh P. Effect of intercropping of guara and cowpea with forage sorghum on yield and nutrient uptake during summer season. Haryana J Agron 2004;(20):97-98. 16. Yadav NS, Solanki. Effect of intercropping of forage legumes with pearl millet and sorghum in arid region. For Res 2002;28:77-79. 17. Oseni TO, Aliyu IG. Effect of row arrangements on sorghum-cowpea intercrops in the semi-arid savannah of Nigeria. Int J Agric Biol 2010;(12):137-140. 18. Singh A, Singh YV, Asheesh S, Amit V, Mithilesh KS, Surendra S. Genetic analysis of quantitative traits in cowpea [Vigna unguiculata (L.) walp.] using six parameters genetic model. Leg Res 2016;(39):502-509. 19. Keating BA, Carberry PS. Resource capture and use in intercropping: solar radiation. Field Crops Res 1993;(34):273-301. 20. Surve VH, Patil PR, Arvadia MK. Performance of fodder sorghum (Sorghum bicolor L.); maize (Zea mays L.) and cowpea (Vigna unguiculata (L.) Walp.) under sole and intercropping systems. Madras Agric J 2011;(98):372-374. 21. Ahmad AH, Ahmad R, Mahmood N. Production potential and quality of mixed sorghum forage under different intercropping systems and planting patterns. Pak J Agric Sci 2007;(44):87-93. 22. Langat MC, Okiror MA, Ouma JP, Gesimba RM. The effect of intercropping groundnut (Arachis hypogea L.) with sorghum (Sorghum bicolor L.) on yield and cash income. Agric Trop Subtrop 2006;(39):88-96. 23. Zhang FS, Li L. Using competitive and facilitative interactions in intercropping systems enhances crop productivity and nutrient-use efficiency. Plant Soil 2003;(248):305-312. 413


Rev Mex Cienc Pecu 2021;12(2):402-418

24. Dapaah HK, Asafu-Agyei JN, Ennin SA, Yamoah C. Yield stability of cassava; maize; soya bean and cowpea intercrops. J Agric Sci 2003;(140):73-82. 25. Ibrahim M, Ayub M, Tanveer A, Yaseen M. Forage quality of maize and legumes as monocultures and mixtures at different seed ratios. J Anim Plant Sci 2012;(22):987-992. 26. Akhtar MF, Ahmad AUH, Zamir MSI, Khalid F, Mohsin AU, Afzal M. Agroqualitative studies on forage sorghum (Sorghum bicolor L.) sown alone and in mixture with forage legumes. Pak J Sci 2013;(65):179-185. 27. Patel JR, Rajagopal S. Production potential of forage maize (Zea mays) with legumes under intercropping system. Indian J Agron 2001;(46):211-215. 28. Sharma NK, Misra OR, Khushwaha SS, Pachilanya NK. Response of sorghum based intercropping system to chemical fertilizers; FYM and crop residues. Res Crops 2000;(1):289-291. 29. Iqbal MA, Siddiqui MH, Sher A, Zahoor A, Qaiser M, Rana DK. Forage productivity of cowpea [Vigna unguiculata (L.) Walp] cultivars improve by optimization of spatial arrangements. Rev Mex Cienc Pecu 2018;(9):203-219. 30. Hakan G, Avcioglu R, Soya H, Kir B. Intercropping of corn with cowpea and bean: Biomass yield and silage quality. Afr J Biotechnol 2008;(22):4100-4104

414


Rev Mex Cienc Pecu 2021;12(2):402-418

Cuadro 4: Análisis de varianza (ANOVA) de todas las variables experimentales estudiadas del frijol caupí sembrado junto con sorgo en distintas disposiciones espaciales en 2013 y 2014 Rendimiento del Altura de las Circunferencia Hojas por Relación hojaPeso fresco Peso seco por forraje verde de plantas (cm) del tallo (cm) planta tallo por planta (g) planta (g) OdV caupí (t/ha) 2013

2014

2013

2014

2013

2014

2013

2014

2013

2014

2013

2014

2013

2014

T

213**

288**

73*

85*

109*

100*

74*

89*

287**

234**

166**

183**

244**

280**

DE

134**

111**

66*

71*

81*

123*

33*

57*

132**

141**

211**

137**

112*

89*

T×DE 189**

203**

88*

98**

93*

112*

83*

96*

274**

297**

187**

257**

266**

287**

RFV de Sorgo (t/ha)

2013

2014

2013

2014

2013

2014

2013

2014

2013

2014

2013

2014

2013

2014

T

123**

116**

97

110**

88*

104**

91**

109**

237**

250**

233**

240*

134*

103*

DE

91*

75*

132

103*

145*

74*

51*

74*

88*

122**

75*

111*

90*

87*

120**

114

139*

137*

92*

120*** 135**

142*

169**

200**

225*

101*

109*

OdV

T×DE 134** T×A=NS

DE×A=NS

RMS de Sorgo (t/ha)

Proteína bruta (%)

Fibra bruta (%)

Grasa extraíble con éter (%)

RMS de frijol caupí (t/ha)

Contenido total de cenizas (%)

T×DE×A=NS

OdV= origen de la varianza; T= Tipo de cultivo intercalado en franjas, DE= Disposición del espacio, A=Año. *(P<0.05) ** (P<0.01).

415


Rev Mex Cienc Pecu 2021;12(2):402-418

Cuadro 5: Altura de la planta (AP), circunferencia del tallo (CT), número de hojas (NH), relación hoja/tallo (RHT), peso fresco (PF) y peso seco (PS) por planta de caupí sembrado con sorgo en diferentes tiempos de siembra y disposiciones espaciales 2013

2014

SCI

T1A1

AP (cm)

CT (cm)

NH

RHT

PF (g)

PS (g)

AP (cm)

CT (cm)

NH

RHT

PF (g)

PS (g)

94.5±0.27c

2.60±1.16d

22.7±0.55c

0.50±0.18b

172.5±0.83c

50.8±0.21c

96.2±0.67d

2.63±0.33

24.3±0.27d

0.52±1.19c

173.0±0.65d

52.6±0.66d

d

c

d

d

21.2±0.67d

0.44±0.27d

170.1±0.67d

48.4±0.37d

90.7±0.64cd

T1A2

2.64±0.51c

e

2.67±0.57

23.0±0.53d

0.50±0.35c

d

e

d

2.71±1.17

26.5±0.49c

0.55±0.82b

c

d

c

108.4±0.19

2.87±0.94

29.0±0.72b

b

b

101.6±0.43

2.73±0.35

27.3±0.60c

c

c

117.9±0.83

2.94±0.69

a

a

89.9±0.67ef

2.58±0.52

94.7±0.51de

d

94.3±0.37c

T1A3

102.7±0.29

T2A1

2.68±0.94c 2.74±0.56b

b

T2A2

T2A3

24.0±0.34c 28.9±0.67a

0.52±0.30b 0.53±0.28b

b

100.0±0.33

2.70±0.42b

b

c

110.3±0.57

2.87±0.67a

26.6±0.90b 29.1±0.57a

174.5±0.31c 185.1±0.44a

52.3±0.25c 58.5±0.50a

b

0.52±0.64b 0.59±0.19a

181.5±0.58b 188.6±0.67a

55.9±0.41b 59.1±0.67a

a

83.5±0.41d

T3A1

2.35±0.31e

21.5±0.87d

f

78.0±0.38e

T3A2

2.32±0.81f

0.45±0.22c

169.9±0.29d

d

18.8±0.66e

0.41±0.37e

44.9±0.59e

97.2±0.28d

f

164.2±0.21e

e

173.9±0.25d

50.8±1.15e

177.0±0.37c

54.1±0.96d

0.57±0.93b

186.2±0.24b

61.4±0.67b

0.55±0.24b

184.6±0.51b

58.3±0.29c

c

29.9±0.31a

0.69±0.21a

190.5±0.61a

66.3±1.19a

22.5±0.29e

0.48±0.17d

171.2±0.20d

46.0±0.88f

e

g

g

41.7±0.32f

83.1±0.82f

2.53±0.41

21.9±0.40f

0.45±0.29e

165.3±0.19f

43.8±0.60g

24.4±0.69d

0.51±0.33c

170.9±1.11e

48.7±0.37f

4.01

3.87

h

91.1±0.24cd

T3A3

2.39±0.92e

21.4±0.37d

0.48±0.40c

166.0±0.34d

46.2±0.19e

92.4±0.97e

e

LSD0.0

3.80

0.06

2.93

0.04

4.23

2.60±0.60 g

3.89

5.29

0.15

d

0.47

0.03

5

Los datos presentados aquí son la media de 3 réplicas. SCI= Sistema de cultivo intercalado, T1= franjas de 8 filas (caupí+sorgo en filas de 4 x 4), T2= franjas de 12 filas (caupí+sorgo en filas de 6 x 6), T3= Franjas de 16 filas (caupí+sorgo en filas de 8 x 8). A1= franjas espaciadas a 30 cm, A2= franjas espaciadas a 45 cm, A3= franjas espaciadas a 60 cm. abcdef Los valores seguidos de letras diferentes dentro de una misma columna difieren (P<0.05); ± representa el aumento o disminución de la desviación estándar.

416


Rev Mex Cienc Pecu 2021;12(2):402-418

Figura 1: Análisis de correlación de los atributos de rendimiento con el rendimiento de forraje verde y el rendimiento de materia seca del frijol caupí (análisis combinado de los datos agrupados de 2013 y 2014)

417


Rev Mex Cienc Pecu 2021;12(2):402-418

Cuadro 6: Forraje verde (RVF), materia seca (RMS), proteína bruta (PB), fibra bruta (FC), grasa extraíble por éter (GEE) y contenido total de cenizas (CTC) del caupí sembrado junto con sorgo en diferentes épocas de siembra y disposiciones espaciales en 2013 y 2014 2013

2014

SCI

T1A1

RFV (t/ha) 18.4±0.18d

RMS (t/ha) 5.36±0.18e

PB (%) 18.8±0.41b

FB (%) 26.2±0.72e

c

T1A2

17.7±0.53e

5.29±0.37e

18.6±0.22c

f

T1A3

T2A1

19.9±0.91c 21.0±1.23b

5.52±0.25d 5.93±0.53b

26.9±0.15c

GEE (%) 1.79±0.24c

CTC (%) 11.00±0.15

d

d

1.76±0.17d

11.07±0.37

d

19.0±0.34b 19.6±0.55a

26.6±0.37d 26.1±0.51e

20.4±0.44b

5.78±0.47c

19.0±0.67b

1.81±0.18c 1.86±0.29b

26.7±0.18d

22.2±0.28a

6.63±0.26a

19.9±0.21a

25.9±0.91f

17.8±0.37e

5.26±0.38e

18.2±0.79d

27.6±0.27b

f

T3A2

16.1±0.41f

5.16±0.82f

18.1±0.62d

27.9±0.67a

PB (%) 18.9±0.33

d

c

5.51±0.34

18.8±0.92

d

c

20.7±0.67c

5.72±0.84

19.3±0.53

c

d

c

b

11.29±0.28

22.2±1.09b

6.09±0.50

19.4±0.20

b

b

5.91±0.77

19.3±.37b

1.84±0.33b

11.08±0.34

c

d

1.91±0.17a

11.78±0.16

21.0±0.77c 23.7±0.34a

LSD0.0

17.2±0.30ef

1.38

5.18±0.21f

0.19

18.6±0.63c

0.40

27.1±0.41c

0.33

GEE (%) 1.82±0.18c

CTC (%) 11.33±0.11c

26.6±0.62c

1.79±0.11c

11.07±0.24e

d

25.4±0.37e

1.73±0.23d

10.93±0.28

e

e

1.70±0.29e

10.55±0.27

18.5±0.59d 16.7±0.44f

1.84±0.23c

11.39±0.15b c

26.0±0.90d

1.90±0.15b

11.45±0.37b

26.7±1.17c

1.87±0.26b

11.23±0.38d

c

6.94±0.19

19.6±0.37

a

a

5.29±0.61

18.5±0.40

e

d

5.10±0.94f

18.0±1.11

f

T3A3

FB (%) 26.0±0.98d

b

a

T3A1

RMS (t/ha) 5.59±0.16

11.13±0.17

b

c

T2A3

17.9±0.28e

d

b

T2A2

RFV (t/ha) 18.8±0.58d

21.5±0.32f

1.95±0.29a

11.78±0.21a

27.3±0.67b

1.75±0.20d

11.05±0.16e

27.8±0.85a

1.71±0.10e

10.58±0.44f 11.46±0.27b

e

1.74±0.37d

11.07±0.18

e

d

0.05

0.13

17.8±0.69e

1.08

5.48±0.26

18.9±0.91

27.1±0.71b

1.79±0.17c

d

c

c

d

0.21

0.20

0.36

0.04

0.10

5

Los datos presentados aquí son la media de 3 réplicas. SCI= Sistema de cultivo intercalado: T1= franjas de 8 filas (frijol caupí+sorgo en filas de 4x4), T2= franjas de 12 filas (frijol caupí+sorgo en filas de 6x6), T3= franjas de 16 filas (frijol caupí+sorgo en filas de 8x8). A1= franjas espaciadas a 30 cm, A2= franjas espaciadas a 45 cm, A3=franjas espaciadas a 60 cm. abcd Los valores seguidos de letras diferentes dentro de una misma columna difieren (P<0.05); ± representa el aumento o disminución de la desviación estándar.

418


https://doi.org/10.22319/rmcp.v12i2.5459 Artículo

Prevalencia del virus de la leucosis bovina en búfalos de agua en la región centro occidental de Colombia

Juan Carlos Rincón Flórez a,b* Edgar Antonio Peláez Peláez a Nathaly Trejos Marín a Juan Carlos Echeverry López a Juan Carlos González Corrales a

a

Universidad Tecnológica de Pereira. Grupo de Investigación Biomolecular y Pecuaria (BIOPEC), Carrera 27 N 10-02, 660003, Pereira, Colombia. b

Universidad Nacional de Colombia sede Palmira. Carrera 32 N 12 - 00, 763352. Palmira, Colombia.

*Autor de correspondencia: jcrincon@unal.edu.co

Resumen: La leucosis viral bovina (LVB) es una enfermedad de alta morbilidad y baja mortalidad. Existen reportes de la infección natural en algunas especies de bóvidos; sin embargo, en búfalos es poco estudiado. En Colombia la producción de búfalos crece rápidamente y hasta el momento no hay reportes de la enfermedad. El objetivo de este trabajo fue caracterizar la producción bufalina en el eje cafetero y determinar la prevalencia de LVB por PCR en búfalos y la presencia en humanos, bovinos y ovejas en cercanías. Se tomaron muestras de sangre de 140 búfalos, 10 de leche de búfala y 58 muestras de bovinos, 35 de ovejas y 9 de humanos en contacto con los búfalos. Se realizaron análisis hematológicos. Posteriormente, extracción de ADN para evaluación por PCR. Se recolectó información productiva y los resultados fueron procesados y analizados mediante el software R. La mayoría de animales fueron hembras de la raza mediterránea, con peso al nacimiento de 33.39 kg, peso al destete 202.93 kg, intervalo entre partos 491.77 días, tiempo al pico 67.26 días y 381.59 L de leche (ajustada a 305 días a dos tetas). Se encontró una prevalencia de 33.6 % en búfalos y 3.4 % en bovinos; ninguna muestra de leche, oveja o humano resultó positiva. No se encontraron 419


Rev Mex Cienc Pecu 2021;12(2):419-436

factores de riesgo asociados a la infección, ni una alteración significativa del cuadro hemático, ni de los factores productivos. Estos resultados se constituyen en el primer reporte molecular del VLB en América y una de las primeras en el mundo. Palabras clave: BLV, Deltaretrovirus, Leucemia bovina, Linfosarcoma, PCR.

Recibido: 25/07/2019 Aceptado: 14/05/2020

Introducción La leucosis viral bovina (LVB) es una enfermedad neoplásica de origen viral, maligna, sistémica, de alta morbilidad y baja mortalidad, con una acumulación característica de linfocitos neoplásicos en varios órganos, lo que lleva a inmunosupresión y predisposición a patologías secundarias, convirtiéndolo en un animal generador de pérdidas económicas, no sólo por el aumento de enfermedades, sino por el efecto negativo que se ha evidenciado en la producción de leche. La leucosis es causada por un virus de la familia retroviridae tipo “C” ARN, subfamilia Orthoretrovirinae, del género Deltaretrovirus, que causa linfomas, linfosarcomas y leucemia. El virus puede ser trasmitido de forma horizontal o vertical, es decir, entre bovinos o de madre a feto(1-3). Existen reportes de leucosis en varias especies, sin embargo de forma natural solamente se ha reportado en bovinos, búfalos y capibaras(4), aunque el caso de los búfalos, es poco estudiado(5). Las ovejas se han encontrado muy susceptibles a la inoculación, mostrando tumores rápidamente; otras especies de caprinos, ciervos, conejos, gatos, monos, cerdos y chimpancés han mostrado anticuerpos persistentes después de una inoculación experimental(4), lo que parece sugerir que el virus puede pasar la barrera de especie, aunque aún falta más investigación al respecto, sobre todo si se tiene en cuenta que un estudio ha mostrado relación entre la presencia del virus y el cáncer de mama en humanos(6). Los búfalos de agua han sido considerados como una especie resistente a diferentes enfermedades entre ellas las garrapatas, hemoparásitos y algunos nematodos(7). Sin embargo, unos pocos reportes sugieren que el virus de la leucosis bovina infecta naturalmente a los búfalos. En la literatura se encuentran reportes de la infección experimental(1), pero muy pocos reportes de infección natural y aunque algunos estudios presentan prevalencias, estas son cercanas a cero y realizadas con pruebas que podrían permitir ese porcentaje de falsos positivos(1). En Pakistán y Camboya hay reportes de prevalencia de leucosis en búfalos del 0 % evaluados por Western blotting. Otros estudios, han sugerido lo mismo, en los análisis serológicos(1,8,9). Incluso, recientemente en el sudeste de Brasil un estudio mostró 0 % de

420


Rev Mex Cienc Pecu 2021;12(2):419-436

prevalencia mediante inmunodifusión en agar (AGID), PCR y ELISA (ELISA-gp51), lo que refuerza la idea de una posible ausencia de infección natural en los búfalos de agua. En ese mismo estudio, usando un kit de ELISA comercial (ELISA-BLV) en las mismas muestras, el 24.4 % de los animales fueron seropositivos, lo cual muestra los problemas diagnósticos asociados a esta prueba de ELISA que presenta una tasa alta de falsos positivos(1,5), a raíz de estos estudios se ha planteado la PCR como una prueba de referencia, a pesar de que AGID es considera la prueba Gold Estándar(5). En un estudio realizado en Filipinas, se encontró una prevalencia del 27 % por PCR, pero con valores del 0 % en un grupo de origen desconocido(7). Esto abre nuevamente la incógnita sobre la infección natural de los búfalos, sobre todo en el caso de los animales de producción, porque aunque en el mundo existen múltiples reportes de caso de linfosarcoma en búfalos(10,11), muchos de estos casos han sido reportados como negativos al virus de la leucosis bovina(5,11), lo que plantea más interrogantes sobre esta enfermedad en los búfalos. Por lo anterior, es necesario aclarar adecuadamente si existe infección natural en los búfalos, en especial si está presente en América, específicamente en Colombia donde no existen reportes de la enfermedad en búfalos(12). Se estima que en el continente americano existen 3’800,000 búfalos; los países americanos con mayor población bufalina son Brasil con 3’500,000 cabezas, Venezuela con 350,000 y Colombia con 308,580(13-15). En Colombia es una de las poblaciones de ganado que más ha crecido en los últimos años, debido a la capacidad de los búfalos a adaptarse y mantener su rendimiento en condiciones difíciles en las que los bovinos no podrían(14,15). Por este motivo esta actividad económica es cada vez más importante y el estudio sobre las enfermedades que puede padecer constituye un factor importante para la producción, por lo que el objetivo de este trabajo fue caracterizar la producción bufalina en el eje cafetero, determinar la prevalencia del virus de la leucosis bovina por medio de PCR en los búfalos y la presencia del virus en humanos, bovinos y ovejas en contacto o cercanía con los búfalos.

Material y métodos Tamaño de muestra De acuerdo con el censo pecuario nacional 2017 del ICA, en el eje cafetero hay 34 predios con aproximadamente 3,105 animales(15); con esta información se estimó el tamaño de muestra en 94 animales, teniendo en cuenta una heterogeneidad del 50 %, un margen de error del 10 % y un nivel de confianza del 95 %. Sin embargo, fue posible realizar la evaluación en mayor número de animales, por lo que se obtuvieron 140 muestras de sangre de Búfalos de diferentes razas incluyendo la Murrah, Mediterráneo y Bufalypso, estando la mayoría de los animales en etapa productiva; los búfalos fueron muestreados en ocho hatos del eje

421


Rev Mex Cienc Pecu 2021;12(2):419-436

cafetero durante los años 2016-2017. También se tomaron muestras de 58 bovinos, 35 ovejas africanas y 9 humanos que estaban en el mismo sistema de producción o muy cerca. En el caso de los humanos fueron personas involucradas con el manejo de los animales. Estas especies fueron tenidas en cuenta porque se han reportado como susceptibles a la infección natural por el VLB(4-6).

Toma de información En los hatos muestreados se tomó información productiva y de factores de riesgo que podrían estar asociados a la presencia de leucosis. Sin embargo, sólo se contó con información productiva de tres hatos porque los demás no llevaban registros o había muy pocos. La información productiva recolectada incluyó peso al nacimiento, peso al destete, ganancia de peso al destete, intervalo entre partos, producción de leche a dos tetas ajustada a 305 días (considerando que dos tetas se dejan para el becerro), producción al pico y días al pico; mientras que los factores de riesgo considerados fueron la raza, el hato y el grupo etario dividido como búfalas en edad productiva (de 3 años o mayores) y no productiva (menores de 3 años)(16). Las fincas en donde se tomaron las muestras de los búfalos estaban ubicadas en la región centro-occidental conocida como región cafetera, integrada principalmente por el departamento de Caldas, Quindío y Risaralda. Las producciones se encontraron en altura promedio entre 917 msnm y 1,575 msnm y una temperatura promedio entre los 18 y 30 °C. El municipio con más animales muestreados fue Marsella con 44, seguido por Chinchiná y Calarcá con 32 cada uno, Pueblo Rico 29, Cerritos 18, Pereira 8 y Cartago 4. Para 47 muestras no se determinó su procedencia exacta porque fueron muestreados en una central de sacrificio. Se incluyó el municipio de Cartago que se sitúa en el norte del departamento del Valle pero es considerado parte de la región cafetera.

Toma de muestras y análisis hematológico El proyecto fue avalado por el comité de bioética de la Universidad Tecnológica de Pereira en el acta 17 de 2015 (código CBE-SYR-172015). Las muestras de sangre se tomaron con tubos BD vacutainer con EDTA como anticoagulante y agujas número 18, previa desinfección del área con alcohol antiséptico. Los búfalos y ovejas se muestrearon de la vena yugular, los bovinos de la vena coccígea. En el caso de los humanos las muestras se tomaron por un bacteriólogo tras firmar el consentimiento informado. Adicional a las muestras de sangre, se adquirieron 10 muestras de leche de búfalas de venta comercial. Las muestras de leche y sangre se transportaron en neveras portátiles aproximadamente a 4 °C hasta el laboratorio múltiple de Ciencias Animales de la Universidad Tecnológica de Pereira, en donde se realizó el análisis hematológico mediante un analizador automatizado URIT 2900Vet plus (URIT®, Guilin, China) en la opción para búfalos y se tomaron las variables: 422


Rev Mex Cienc Pecu 2021;12(2):419-436

conteo de glóbulos blancos (En inglés WBC), rojos (RBC), hemoglobina (HGB), hematocrito (HCT) y plaquetas (PLT). Con la cantidad de sangre restante se procedió a la extracción de ADN.

Extracción de ADN de sangre y leche Para la extracción del ADN de sangre se usó el kit illustra blood genomicPrep Mini Spin Kit de GE® (GE Healthcare Bio-Sciences, Pittsburgh, PA, USA) siguiendo las recomendaciones del fabricante. Una vez obtenidas las muestras se evaluó su pureza mediante análisis de relación de absorbancia a dos longitudes de onda (260/280 nm) usando para esto el Nanodrop 2000c. (Thermo scientific®, Wilmington, USA). Sólo se tuvieron en cuenta las muestras de ADN con relación de absorbancia de 1.8 a 2 y que presentaban una concentración mayor de 10 ng/ml. Las muestras se almacenaron en tubos Eppendorf a -20 °C hasta el momento de los análisis por PCR. Para la extracción del ADN de las células somáticas de leche se usó el método por Salting out modificado, teniendo en cuenta dos enfoques diferentes, considerando la cantidad de grasa presente en la leche de búfalas. En el primer protocolo, se tomaron muestras de 14 ml de leche cruda en tubos Falcon; se dejaron reposar en el refrigerador a 4 ºC por 1 h y se centrifugaron a 3,500 rpm durante 8 min; luego se rompió y retiró la capa grasa utilizando una pipeta Pasteur y se descartó el sobrenadante sin perturbar el botón de células. Posteriormente se adicionaron 5 ml de solución salina agitando fuerte hasta lograr disolver el botón de células. Se centrifugó nuevamente (de 2 a 3 veces más hasta observar el sobrenadante incoloro) a 3,500 rpm durante 8 min y se descartó el sobrenadante sin perturbar el botón. Después, se adicionaron 5 ml de solución de lisis (10 mM Tris HCl pH 8.2, 400 mM de NaCl, 2 mM de Na2EDTA), 26.5 µl de la enzima proteinasa K (2 mg/ml) y 300 µl de solución SDS y se resuspendió mediante vortex suave durante 1 min; después se llevó a incubar al baño maría a 55 ºC durante 6 h, luego se refrigeraron a 4 ºC por 5 min, se dejó enfriar para luego adicionar 1,5 ml de solución salina saturada (6 M); posterior a esto se usó un vórtex para mezclar y se centrifugó por 10 min a 3,500 rpm; el sobrenadante se llevó a un tubo de 15 ml para agregar etanol al 100% a -20 °C hasta llegar a 14 ml, luego de lo cual el tubo se agitó suavemente por inversión para observar la madeja de ADN. La muestra fue lavada con 1 ml de etanol al 70% y luego se llevó centrifugación a 4,000 rpm; el sobrenadante fue descartado y se invirtió el tubo dejando secar el contenido. Finalmente, el botón fue resuspendido en 300 µl de buffer TE 1X pH 8.0 (Tris HCl 1 M y EDTA 0.5 M), para posteriormente ser almacenado a 4 °C hasta el momento del análisis. El protocolo 2 fue igual al protocolo 1, sólo que en este caso no se rompió la capa de nata, ni se adicionó la solución salina, solo se procedió a pasar directamente de la centrifugación de la leche cruda a la adición del buffer de lisis. Para los dos protocolos se realizó la cuantificación de ADN mediante un nanodrop 2000c (Thermo scientific®, Wilmington, USA) usando 2µl de la muestra resultante de cada protocolo de extracción. Se tuvo en cuenta también las relaciones 423


Rev Mex Cienc Pecu 2021;12(2):419-436

260/280 y 260/230 como indicadores de pureza del ADN. Los datos se almacenaron para su posterior análisis estadístico.

Evaluación por PCR Se evaluó una región altamente conservada del gen env proviral usando la técnica PCRanidada. Se utilizaron muestras de ADN de bovinos positivos y negativos a leucosis, las cuales fueron aportadas por el grupo de Biodiversidad y genética molecular (BIOGEM) de la Universidad Nacional de Colombia, sede Medellín. Los controles suministrados fueron obtenidos de animales que habían sido previamente confirmados por PCR y ELISA directa para el gen env del provirus. La primera PCR se hizo en un volumen final de 25 µl que contenía aproximadamente 150 ng de ADN, con una concentración final de 0.4 µM de cada oligonucleótido BLV forward (5′-ATGCCCAAAGAACGACGG-3′) y BLV reverse (5′CGACGGGACTAGGTCTGACCC-3′) 200 µM de cada dNTP, 2.5µl de tampón Top Taq PCR 10X que contiene 15mM de MgCl2 y 1U de Top Taq DNA polimerasa (Qiagen®, Germantown, Alemania). En la segunda reacción de PCR se utilizaron 5µl del producto de PCR de la primera amplificación como ADN molde, con las mismas condiciones que la anterior, pero con los oligonucleótidos Env5032 forward (5′TCTGTGCCAAGTCTCCCAGATA-3′) y Env5608 Reverse (5′AACAACAACCTCTGGGAAGGGT-3′). Los iniciadores habían sido reportados previamente(17), pero la estandarización se llevó a cabo en un termociclador Labnet TC9610 MultiGene OptiMax Thermal Cycler (Labnet®, Northlake, IL, USA). El perfil de la PCR incluyó una etapa de desnaturalización inicial a 95 °C por 5 min, seguido por 25 ciclos de 95 °C por 30 seg, 60 °C por 30 seg y 72 °C por 1 min, para terminar con una extensión final a 72 °C por 8 min. Para la segunda PCR se tuvo una etapa de desnaturalización a 95 °C por 5 min, seguido por 35 ciclos de 95 °C por 30 seg, 60 °C por 30 seg y 72 °C por 45 seg, para finalizar con una extensión a 72 °C por 10 min(18). Los productos de la segunda PCR se observaron por medio electroforesis en gel de agarosa al 2.5% (Amresco, Cochran Road, OH). Se sirvieron 5 μl del producto de PCR mezclados en 2 μl de tinción EZ vision (AMRESCO, Sidney, Aus). En cada línea de corrido se usaron 2 μl de marcador de peso molecular de 100 pb (low range Fermentas, Glen Burnie, MD), junto con dos 2 μl de EZ-vision. Los geles fueron documentados mediante un fotodocumentador ENDUROTM GDS (Labnet, NJ, USA) para tener evidencia fotográfica. Una banda de 598 bp indicó la presencia del provirus en un individuo. En todos los casos en la PCR se usó un testigo negativo y uno positivo de bovino, también se usaron testigos positivos y negativos de búfalos hallados en este trabajo.

424


Rev Mex Cienc Pecu 2021;12(2):419-436

Análisis estadísticos A partir de la información recolectada en los hatos se realizó estadística descriptiva para resumir la producción y los factores de riesgo en los hatos muestreados. También se realizó un análisis descriptivo de los datos hematológicos, de cuantificación de ADN y de su pureza para las muestras de leche y se realizó una comparación de los protocolos con la prueba tstudent para la concentración de ADN, la relación 260/280 y 260/230 de las muestras de leche. Finalmente, se estimaron las prevalencias con su respectivo intervalo de confianza del 95% para cada una de las especies muestreadas. Utilizando la información recolectada para los búfalos se desarrolló un modelo lineal generalizado (GLM) para evaluar el efecto de la infección sobre las características productivas y las variables hematológicas glóbulos blancos, glóbulos rojos, hemoglobina, hematocrito y plaquetas. Posteriormente, se realizó un modelo de regresión logística para determinar si algún factor de riesgo era estadísticamente significativo para la presencia del virus en los individuos.

Resultados Descripción de los hatos y características productivas En este estudio, la mayoría de los búfalos muestreados fueron provenientes del departamento de Risaralda (46 %), Quindío (17 %), Caldas (15 %) y otros (22 %). La mayoría de los búfalos fueron de la raza Mediterráneo (29 %), seguido de Murrah (19 %), Bufalypso (13 %) y cruces indeterminados (39 %). De acuerdo al grupo etario tomando en cuenta animales jóvenes en edad no productiva (menores de tres años) y animales adultos en edad productiva (mayores de tres años), se muestrearon 21.6 % de animales jóvenes y 78.4 % de adultos. En cuanto a los parámetros productivos, se encontró en promedio un peso al nacimiento de 33.39 kg, peso al destete de 202.93 kg, ganancia de peso al destete de 136.27 kg, intervalo entre partos de 491.77 días, leche ajustada a 305 días de 381.59 L, días al pico de 67.29 días (Cuadro 1). Cuadro 1: Caracterización productiva de los búfalos de agua de la región centro occidental de Colombia Característica

Media

Error estándar

Desviación estándar

Peso al nacimiento, kg Peso al destete, kg Ganancia al destete, kg Intervalo entre partos Leche 305 días Días al pico Producción al pico

33.89 202.93 136.27 491.77 381.59 76.26 2.15

0.17 2.22 3.75 5.20 28.79 6.30 0.12

4.31 53.43 96.33 63.87 345.49 62.38 3.07

425


Rev Mex Cienc Pecu 2021;12(2):419-436

Descripción hematológica Respecto a la evaluación hematológica de las muestras, se encontró que los glóbulos blancos (WBC x 103 µl) fueron más altas en los animales positivos, pero no difirieron estadísticamente de los no infectados; en cuanto a los glóbulos rojos (RBC x 103 µl), estos fueron mayores de forma significativa en los positivos, mientras que la hemoglobina (HGB%) y el hematocrito (HCT%) fueron similares en positivos y negativos. Las plaquetas (PLT x 103 µl) fueron más bajas en las muestras positivas, pero no de forma significativa (Cuadro 2). Cuadro 2: Descripción de las variables hematológicas en búfalos de agua positivos y negativos a leucosis enzootica bovina Característica Estadístico Total Negativos (n=93) Positivos (n=47) 3 WBCx10 µl Media±EE 32.94±1.85 30.12±3.16 33.45±2.80 Desviación estándar 39.84 20.72 13.14 Min 126 78 9 Max 125 77 55 3 RBCx10 µl* Media±EE 46.93±3.11 66.67±6.06 85.64±4.13 Desviación estándar 26.84 39.75 19.37 Min 80 125 45 Max 79 124 117 HGB% Media±EE 27.74±1.59 20.09±2.47 21.82±3.96 Desviación estándar 22.26 16.2 18.56 Min 68 66 68 Max 67 65 65 HCT% Media±EE 43.94±2.32 46.07±4.39 46.77±3.57 Desviación estándar 32.71 28.81 16.76 Min 97 87 17 Max 96 86 74 3 PLTx10 µl Media±EE 38.78±2.47 45.91±4.89 46.32±6.33 Desviación estándar 32.3 32.09 29.69 Min 99 98 5 Max 98 97 98 WBC= glóbulos blancos; RBC= glóbulos rojos; HGB= hemoglobina; HTC= hematocrito; PLT= plaquetas. *Diferencia estadísticamente significativa (P<0.05) entre positivos y negativos.

426


Rev Mex Cienc Pecu 2021;12(2):419-436

Extracción de ADN Fue posible establecer un método para extracción de ADN a partir de leche de búfala, con el cual se logró obtener cantidades promedio por encima de 50 ng/µl, que es lo recomendado. Teniendo en cuenta que las muestras de búfalo tienen alta concentración de grasa, se planteó un método con la extracción de ésta. Sin embargo, el protocolo 2 sin eliminación de la grasa fue el que presentó mejores resultados, con una concentración promedio de 165.7 ng/µl frente a 20.5 ng/µl del protocolo 1 (P<0.05). La relación 260/280 del protocolo fue 1.74. Para la extracción de ADN de sangre mediante kit, se obtuvieron concentraciones mayores a 10 ng/ml con una relación 260/280 de 1.8 a 2.

Detección de ADN del VLB Fue posible la detección exitosa del ADN del VLB mediante la prueba de PCR para leucosis (Figura 1), y de las 140 muestras de búfalo analizadas, se encontró una positividad del 33.6 %. En cuanto a las 58 muestras de bovinos, se encontró una positividad del 3.4 %. Ninguna de las muestras de leche de búfala arrojó resultados positivos (Cuadro 3); tampoco las muestras de ovinos, ni de humanos en contacto con los búfalos fueron positivas, en todos los casos las pruebas fueron validadas con los respectivos controles positivos y negativos mencionados previamente. Figura 1: Electroforesis en gel de agarosa para un fragmento del gen Env del provirus de leucosis enzootica bovina en muestras de sangre completa de búfalos

Línea 1= testigo negativo, línea 2= testigo positivo, línea 3= una muestra positiva, líneas 4-6 muestras negativas.

427


Rev Mex Cienc Pecu 2021;12(2):419-436

Cuadro 3: Positividad a leucosis en búfalos y otros animales de producción de la región centro occidental de Colombia No. Total/ Intervalo de confianza Especie Prevalencia (%) Positivos 95% Bufalinos - Sangre 140/47 33.6 26 - 42.1 Bufalinos - Leche 12/0 0.0 0.0 - 60.4 Bovinos 58/2 3.4 0.5 - 12.9 Humanos 9/0 0.0 0.0 - 37.1 Ovinos 35/0 0.0 0.0 - 12.3

Factores de riesgo Se evaluaron los efectos de factores como municipio, hato, edad y raza sobre la presencia del virus por medio de una regresión logística, pero no se encontró un efecto significativo en ninguno de los casos (P>0.05), por lo que no hay evidencia para suponer que estos son factores de riesgo para la infección con leucosis en búfalos. Finalmente, no se encontraron relaciones de la positividad con la producción de leche, ni los demás parámetros productivos. Aunque es importante aclarar que la información no se logró recolectar de forma homogénea y completa, ya que en las unidades de producción de leche de búfalas no se contaba con suficientes registros.

Discusión Dadas las características de los búfalos de agua para adaptarse a diferentes climas incluyendo las condiciones tropicales, el clima entre los 18 y 30 °C en donde se encontraban los animales de estudio en la región centro occidental, es propicio para la producción lechera, carne o doble propósito(19). En este estudio la raza Mediterráneo fue la más frecuente, similar a Argentina(20) y Brasil, aunque la raza lechera más difundida es la Murrah(21,22) y en Costa Rica la Bufalypso(23). Respecto al sexo, se encontró un mayor número de hembras dado el enfoque lechero de la raza predominante, lo cual concuerda con un estudio previo realizado en la región cafetera de Colombia(24) y en Venezuela(25). Respecto al peso al nacimiento, éste fue similar a lo encontrado en otras regiones de Colombia con pesos entre 35 a 40 kg y 30 a 37 kg(12,26). El peso al destete de 202.93 kg, también fue similar al peso encontrado en Costa Rica de 160 a 220 kg(23) y dentro del rango reportado en Colombia (204.17 -356.45 kg) en hembras Murrah. En cuanto al intervalo entre partos de 491.77 días, fue superior al encontrado en Córdoba (Colombia), el cual fue de 414 días(27). La lactancia a los 305 días de 381.59 L a dos tetas, fue inferior a lo reportado en la misma zona, que fue de 1098 L, pero en los cuatro cuartos(24). Es importante resaltar que en la zona es una práctica habitual ordeñar dos tetas y dejar las otras dos para el becerro, por lo 428


Rev Mex Cienc Pecu 2021;12(2):419-436

que las producciones suelen ser menores a las reportadas en otros trabajos. De forma similar fue lo encontrado en la producción al pico fue 2.15 L, valor menor al reportado para la zona de 5.0 L, pero de los cuatro cuartos. Es importante resaltar que la mayoría de los datos productivos de este trabajo fueron obtenidos de un solo hato. Con respecto a la extracción de ADN de leche de búfala, se encontró que en el protocolo 2 sin extraer la capa de grasa fue el mejor método, ya que permitió obtener concentraciones de ADN mayores con un promedio de 165.78 ng/µl con una relación 260/280 de 1.74 que la permite clasificar como ADN de pureza aceptable; adicionalmente fue encontrada una relación 260/230 de 0.41 lo que hace pensar que con este método quedan algunas contaminaciones con fenoles. Los anteriores resultados coinciden con lo encontrado en un estudio que utilizó seis métodos de extracción en leche de ovejas(28), los cuales incluyeron diferentes kits de extracción, fenol-cloroformo y lisis con hidroclorato de guanidina; la relación 260/280 estuvo entre 1.55 a 1.80 y 260/230 entre 1.43 a 1.80 teniendo la mayor contaminación con la solución de lisis. La cantidad obtenida de ADN está dentro del rango obtenido de leche de cabras por el método de “salting out” que fue de 2.12 ng/µl a 610.12 ng/µl, aunque en ese estudio la grasa inicial luego de centrifugar fue descartada(28). Finalmente, las muestras fueron tomadas y analizadas por PCR para evaluar posible presencia de BLV; al realizar el análisis de estas 12 muestras de leche, se encontró que ninguna fue positiva para el BLV obteniendo entonces una positividad del 0 %, con la respectiva validación del testigo positivo y negativo mencionado previamente, lo cual es importante si se tiene en cuenta que algunos autores sugieren una relación con el cáncer de mama en humanos(6). El diagnóstico de la leucosis antes del uso de pruebas serológicas y moleculares se basaba en los hallazgos hematológicos, los cuales se respaldaban en la presencia de linfocitosis persistente en la fase preclínica y en la fase leucótica o tumoral, hasta un 30 % de los animales positivos(29). En este trabajo, aunque sin diferencia estadísticamente significativa, se encontró un aumento de los glóbulos blancos en los animales positivos comparado con los negativos, pero sin discriminar las líneas celulares, por lo cual no se pueden evidenciar alteraciones específicas en los linfocitos. Similar resultado fue encontrado en Brasil en vacas Holstein en donde la línea blanca fue de 10.3 x 103 µl en negativas y de 27.96 en positivas(30). Respecto a la hemoglobina, ésta ha sido reportada como baja en animales positivos, sin embargo, en el presente trabajo no hubo diferencias en este aspecto entre animales positivos y negativos, pero si la hubo respecto a glóbulos rojos, los cuales fueron significativamente más altos en positivos, posiblemente por problemas de desregulación en la diferenciación y maduración de las células sanguíneas tras la infección con el virus. Con respecto a los bovinos muestreados en este trabajo no se encontraron diferencias estadísticamente significativas en ninguno de los parámetros hematológicos evaluados, aunque hay que resaltar que el número de animales era pequeño para tener suficiente potencia estadística.

429


Rev Mex Cienc Pecu 2021;12(2):419-436

Aunque se considera al búfalo como una de las especies susceptibles a la infección por el virus de la leucosis bovina, existen pocas evidencias concretas de esto, ya que pocos reportes comprueban la presencia de forma natural, y los que lo hacen han utilizado para el diagnóstico pruebas como la ELISA, AGID y Western blot, los cuales detectan anticuerpos, mas no el ADN proviral, y presentan un porcentaje importante de falsos positivos según algunos reportes de literatura(1,5), que ante las bajas prevalencias podrían en duda la verdadera presencia. Por otra parte, se ha considerado susceptible al búfalo por algunos estudios en el que se inocula al animal con el virus para hacer seguimiento de su infección y desarrollo fisiopatológico. Algunos reportes de linfosarcoma bovino en búfalos han tratado de asociar la presencia de este tipo de lesión con la presencia del virus de la leucosis bovina. Incluso en un caso reportado describen los hallazgos clínicos, hematológicos y celulares atribuyéndole a éste como etiología el VLB, pero sin confirmación con técnicas de laboratorio(10). Otro caso en Brasil de linfosarcoma fue reportado en una hembra bufalina a la cual se le realizó prueba de PCR anidada y dió resultado negativo(11). En 2016 se realizó un estudio en búfalos del Amazonas y el sudeste de Brasil, se buscó la presencia del virus por medio de inmunodifusión en agar (AGID), ELISA y PCR. En este estudio se encontró un 24.6 % de animales positivos por ELISA, pero ninguno positivo por AGID que es la prueba considerada como la Gold estándar; tampoco se obtuvieron resultados positivos por medio de PCR, por lo que se concluyó que no había presencia del virus en los animales evaluados; sin embargo, en el año 2000 se encontró en la misma región amazónica la presencia de anticuerpos al VLB en búfalos. Las pruebas que se realizaron fueron AGID y dos tipos de ELISA para detección de antígeno gp51 e inmunoglobulina G. La conclusión de ese estudio fue la presencia natural del virus en búfalos(31) con 87, 81 y 69 muestras de suero positivas por cada prueba, respectivamente. Todo lo anterior hace pensar en los resultados de pruebas no específicas y deja en evidencia los pocos hallazgos la infección natural. Uno de los pocos casos reportados por PCR es en Filipinas, donde se encontró una positividad de 27.6 % para VLB, lo que se convierte en el único reporte confirmatorio del virus en búfalos encontrado en la literatura por este método(7). Al igual que en el estudio de Filipinas, en este trabajo se demostró por medio de PCR, la presencia de forma natural del VLB en búfalos de agua en la región del Eje Cafetero de Colombia, siendo este el primer reporte en América por medio de esta técnica y también uno de los primeros a nivel mundial. En el estudio Filipino, se identificó el virus en un total de 272 muestras de la raza Murrah (70 positivos), Carabao Filipino (5 positivos) y raza no determinada (0 positivos). En el presente trabajo, no hubo diferencias significativas entre razas.

430


Rev Mex Cienc Pecu 2021;12(2):419-436

En bovinos se encontró una positividad de 3.4 %, inferior a las encontradas en la literatura y aún inferior a la encontrada en búfalos en este estudio que fue de 33.6 %. El análisis de las muestras bovinas también fue realizado por medio de PCR anidada, lo cual puede explicar la diferencia con estudios en Montería con prevalencias de 24 % y Mesa de Los Santos en Colombia con 73 % y en varias regiones de Chile con un 34.7 % en donde el diagnóstico se llevó a cabo por medio de ELISA, con los posibles falsos positivos discutidos anteriormente(32–34). A pesar de los resultados encontrados, no se puede descartar la transmisión del virus de VLB entre especies, aunque se tiene que confirmar si los virus que producen la enfermedad en las especies susceptibles, son iguales genéticamente. Se puede pensar que los factores de riesgo asociados a la presencia de la enfermedad son similares en bovinos y búfalos. Estos factores son la reutilización de agujas en tareas como la vacunación, reutilización de mangas de palpación en chequeos reproductivos, descornado con sierra y falta de control de moscas. En el presente trabajo, no se tuvo acceso a esos datos por lo que otros factores como el hato, la edad de los búfalos y su raza fueron tenidos en cuenta. Ninguno de ellos presentó correlación con la presencia del VLB. En Montería (Colombia) se han encontrado asociaciones positivas en bovinos respecto a la presencia del VLB y la edad, la raza y el tipo de producción, siendo más alto en hembras, ganadería doble propósito y en cruces de cebuinos y Europeos(32). Por otro parte, tras la identificación de la presencia del virus en el humano y su posible asociación con el cáncer mamario, se ha sugerido que la vía de contagio es el consumo de leche cruda y carne de bovinos infectados. En este estudio se analizaron por medio de PCR 12 muestras de leche de búfala adquiridas en el comercio local, de la cuales ninguna fue positiva a la presencia del virus. Algunos estudios en Colombia y Argentina(35,36), han demostrado la presencia del virus de la leucosis en leche fresca bovina con 49 y 59 % de positividad respectivamente; sin embargo no existe reporte de hallazgos similares en búfalos. En cuanto a los resultados de la positividad en la especie ovina, las ovejas han sido consideradas como una de las especies susceptibles a la infección por VLB. Aunque pocos reportes existen al respecto, en Brasil se obtuvo una seropositividad del 0.077 % (2 de 2592). Los animales positivos fueron una hembra de raza Santa Inés y otra hembra de raza desconocida(37). En otro caso, ante la aparición de una oveja con linfoma, se realizó prueba con AGID dando resultado negativo(38). En otro estudio realizado en Irán en 2015, se evaluaron mediante PCR anidada 95 ovejas con un 7.04 % positivas. En este estudio se analizaron muestras de 35 ovejas africanas (Camuro) mediante PCR anidada y ninguna resultó positiva. En este estudio también se tomaron nueve muestras de sangre en personal que se encuentra o ha estado en contacto con bovinos y búfalos durante su ejercicio profesional. Ninguna de las muestras fue positiva. Aunque como se mencionó, al parecer el contagio al humano se 431


Rev Mex Cienc Pecu 2021;12(2):419-436

realiza por medio de alimentos contaminados, no se puede descartar que al igual que en los bovinos, el virus se trasmita por punción con agujas o de alguna otra forma tal como sucede en el caso de otro retrovirus, el del VIH. En el 2003, Buehring y colaboradores detectaron la presencia de anticuerpos al VLB por inmunoblot en humanos obteniendo 39 % positivos de 257 voluntarios. Cabe aclarar que los voluntarios no eran trabajadores del sector agropecuario(39).

Conclusiones e implicaciones Se encontró la presencia del VLB en 33.6 % de los búfalos de la región centro occidental de Colombia, valor mucho mayor que el encontrado en bovinos de la misma zona muestreada (3.4 %); no se encontró presencia del provirus en muestras de leche comerciales de búfala, ni alteraciones hematológicas o productivas en los animales positivos. Dado que éste se constituye en el primer reporte en Colombia de la presencia del VLB en búfalos, no se han establecidos programas de control del mismo para esta especie. Al encontrar casos positivos, los programas podrían ser similares a los utilizados en bovinos, y que están enfocados a la identificación de animales positivos, uso de aguja por animal, cambio de mangas de palpación, desinfección de la tatuadora y descorne químico. Estos sistemas han evitado el sacrificio selectivo de animales positivos(40), además el control de la enfermedad disminuye las pérdidas económicas por baja en la producción y atención veterinaria y es fundamental en una posible futura exportación de carme o productos lácteos de búfalo. Agradecimientos Agradecimientos a la Vicerrectoría de Investigaciones, Innovación y Extensión por el apoyo económico y logístico para la realización de este trabajo. Los autores declaran que no existe ningún tipo de conflicto de interés. Literatura citada: 1. Feliziani F, Martucciello A, Iscaro C, Vecchio D, Petrini S, Grassi C, et al. Bovine leukemia virus: Experimental infection in buffaloes and evaluation of diagnostic test reliability. Res Vet Sci 2017;(114):450–454. 2. Ooshiro M, Konnai S, Katagiri Y, Afuso M, Arakaki N, Tsuha O, et al. Short communication: Horizontal transmission of bovine leukemia virus from lymphocytotic cattle, and beneficial effects of insect vector control. Vet Rec 2013;(173):527. 3. Bartlett PC, Norby B, Byrem TM, Parmelee A, Ledergerber JT, Erskine RJ. Bovine leukemia virus and cow longevity in Michigan dairy herds. J Dairy Sci 2013;96(3):1591–7. https://linkinghub.elsevier.com/retrieve/pii/S0022030213000428. 432


Rev Mex Cienc Pecu 2021;12(2):419-436

4. Organización Mundial de Sanidad Animal. Leucosis bovina enzoótica. En: Manual de las pruebas de diagnóstico y de las vacunas para los animales terrestres. 8th ed. Paris, Francia: OIE; 2018:1–12. 5. De Oliveira CHS, Resende CF, Oliveira CMC, Barbosa JD, Fonseca AA, Leite RC, et al. Absence of Bovine leukemia virus (BLV) infection in buffaloes from Amazon and southeast region in Brazil. Prev Vet Med 2016;129:9–12. http://dx.doi.org/10.1016/j.prevetmed.2016.05.002. 6. Buehring GC, Shen HM, Schwartz DA, Lawson JS. Bovine leukemia virus linked to breast cancer in Australian women and identified before breast cancer development. PLoS One 2017;12(6):e0179367. 7. Mingala CN, Konnai S, Cruz LC, Onuma M, Ohashi K. Comparative moleculoimmunological analysis of swamp- and riverine-type water buffaloes responses. Cytokine 2009;46(2):273–282. 8. Meas S, Seto J, Sugimoto C, Bakhsh M, Riaz M, Sato T, et al. Infection of bovine immunodeficiency virus and bovine leukemia virus in water buffalo and cattle populations in Pakistan. J Vet Med Sci 2000;62(3):329–31. http://www.ncbi.nlm.nih.gov/pubmed/10770609. 9. De Souza Rajão D, Bastianetto E, Pereira dos Reis JK. Estudo da infecção pelo vírus da leucose bovina em bubalinos (Bubalus bubalis) no estado de Minas Gerais. Rev Bras Med Vet 2010;32(1):42–45. 10. Chand N, Deshmukh S, Banga HS, Dua K. Bovine lymphosarcoma in a buffalo (Bubalus bubalis). Vet Pract 2012;13(1):114. 11. De R, Barbosa G, Luiz W, Pereira A, Pituco EM, Nogueira AHDC. Linfossarcoma em uma búfala - Relato de caso. Ver Bras Med Vet 2016;38(1):19–24. 12. Cervantes E, Espitia A, Prieto E. Viabilidad de los sistemas bufalinos en Colombia. Rev Colomb Cienc Anim 2018;2(1):215. 13. Pérez A. El búfalo, una opción de la ganadería. Redvet 2007;8(8):1-23. 14. Ruiz J. Producción bufalina en Colombia: del trópico para el mundo. CES Med Vet Zootec 2016;11(2):1. 15. ICA. Instituto Colombiano Agropecuario. Censo Pecuario Nacional - 2017. 16. De Olivera L, Tonhati H, Cardoso VL, El Faro L, Sesana RC, Aspilicueta RR. Genetic parameters for milk yield, age at first calving and interval between first and second calving in milk Murrah buffaloes. Ital J Anim Sci 2007;6(2):397-400.

433


Rev Mex Cienc Pecu 2021;12(2):419-436

17. Polat M, Takeshima S, Hosomichi K, Kim J, Miyasaka T, Yamada K, et al. A new genotype of bovine leukemia virus in South America identified by NGS‑based whole genome sequencing and molecular evolutionary genetic analysis. Retrovirology 2016;13(4):1-23. 18. Peláez EA, Trejos N. Estandarización de una prueba por PCR para el virus de la Leucosis enzoótica Bovina en Búfalos de agua del eje cafetero colombiano [tesis pregrado]. Pereira, Colombia: Universidad Tecnológica de Pereira; 2017. 19. Valdés AM. Antecedentes y perspectivas de la actividad bufalina en el trópico. TM 2011;24(5):121. https://revistas.tec.ac.cr/index.php/tec_marcha/article/view/170. 20. Crudeli GA, Patiño EM, Maldonado VP, Konrad JL. Pasado, presente y futuro del búfalo en Argentina. Rev Vet 2014;25(2):140–145. 21. Mendes MCH, Mendes MAC, Ramos AA, Carneiro SPL, De Souza JC, Pala A. Genetic parameters for milk yield, lactation length and calving intervals of Murrah buffaloes from Brazil. R Bras Zootec 2013;42(8):565–569. 22. Rosa BRT, Ferreira MMG, Avante ML, Filho DZ, Martins IS. Introdução de búfalos no brasil e sua aptidão leiteira. Rev Cient Eletrônica Med Vet 2007;(8):1–6. http://faef.revista.inf.br/imagens_arquivos/arquivos_destaque/vDXNCfZHc6Lxtn8_20 13-5-21-17-2-38.pdf. 23. Rosales R. Situación del búfalo de agua en Costa Rica. TM 2011;24(5):19–24. https://revistas.tec.ac.cr/index.php/tec_marcha/article/view/162. 24. Henao SS, López JC. Caracterización productiva y su relación con el color del pelaje en búfalos de agua de diferentes hatos lecheros del Eje cafetero [tesis pregrado]. Pereira, Risaralda: Universidad Tecnológica de Pereira; 2017. 25. Menéndez-Buxadera A, Verde O. Componentes de (Co)varianza de la producción de leche de un rebaño bufalino venezolano estimados con modelos de lactancia completa o del día de control. Zootec Trop 2014;32(1):63–75. 26. Dumar JK, Romero JD, Velásquez JC. Evaluación de parámetros productivos y reproductivos en la bufalera El Marañón en la Dorada en el departamento de Caldas [tesis de pregrado]. Bogotá, Colombia: Universidad de la Salle; 2014. 27. Bedoya C, Mira T, Guarín J, Berdugo J. Reproductive parameters of water buffalo (Bubalus bubalis) in the south of Cordoba, north coast of Colombia. Proc VI World Buffalo Congres. Maracaibo. 2001:271–275.

434


Rev Mex Cienc Pecu 2021;12(2):419-436

28. D’Angelo F, Santillo A, Sevi A, Albenzio M. Technical note: A simple salting-out method for DNA extraction from milk somatic cells: investigation into the goat CSN1S1 gene. J Dairy Sci 2007;90(7):3550–3552. 29. Romero H, Miranda A, Gauna C, Trincheri M, Minatel L, Giménez H. Caso reportado de síndrome vestibular o parálisis facial en la provincia de La Pampa, Argentina. Vet Arg 2014;31(318):1-12. 30. Rezende ST, Godoi BH, Batista C, Souza F, Azedo M, Blagitz M, et al. Correlação entre a atipia linfocitária e o perfil imunológico de vacas leiteiras infectadas pelo vírus da leucemia bovina. Semin Cienc Agrar 2013;34(1):293-300. 31. Molnár E, Molnár L, Guedes VT, de Lima ES. Naturally occurring bovine leukosis virus in water buffalo (Bubalus bubalis) in Brazil. Vet Rec 2000;146(24):705–706. 32. Betancur C, Rodas G J. Seroprevalencia del virus de la leucosis viral bovina en animales con trastornos reproductivos de Montería. Rev MVZ Córdoba. 2018;13(1):1197-1294. 33. Carrero J, Martínez F, Tarazona A, Cepeda B. Prevalencia de seropositividad a leucosis bovina mediante la técnica diagnóstica de Elisa indirecta en hatos lecheros situados en Mesa de los Santos, Santander. Spei Domus 2009;5(11):6–11. https://revistas.ucc.edu.co/index.php/sp/article/view/590/558. 34. Grau M, Monti G. Prevalencia serológica predial e intrapredial para el virus de la leucosis bovina (VLB) en lecherías de las regiones de Los Ríos y de Los Lagos de Chile. Arch Med Vet 2010;42:87–91. 35. Jaworski JP, Porta NG, Gutierrez G, Politzki RP, Álvarez I, Galarza R, et al. Short communication: Relationship between the level of bovine leukemia virus antibody and provirus in blood and milk of cows from a naturally infected herd. J Dairy Sci 2016;99(7):5629–5634. 36. Olaya GNN, Corredor FAP, Guzmán GTC, Ríos HKS, Salas CSP, Patarroyo MA, et al. Bovine leukaemia virus DNA in fresh milk and raw beef for human consumption. Epidemiol Infect 2017;145(15):3125–3130. 37. Del Fava C, Basílio MDLF, Donato TM de, Ribeiro CP, Okuda LH, Stefano E, et al. Ocorrência de ovinos (Ovis aries) soropositivos ao vírus da Leucemia Bovina no Brasil. Braz J Vet Res Anim Sci 2010;47(6):483-487. 38. Nekoei S, Hafshejani TT, Doosti A, Khamesipour F. Molecular detection of Bovine leukemia virus in peripheral blood of Iranian cattle, camel and sheep. Pol J Vet Sci 2015;18(4):703–707.

435


Rev Mex Cienc Pecu 2021;12(2):419-436

39. Buehring GC, Philpott SM, Choi KY. Humans have antibodies reactive with bovine leukemia virus. AIDS Res Hum Retroviruses 2003;19(12):1105–1113. 40. Bartlett PC, Sordillo LM, Byrem TM, Norby B, Grooms DL, Swenson CL, et al. Options for the control of bovine leukemia virus in dairy cattle. J Am Vet Med Assoc 2014;244(8):914–922.

436


https://doi.org/10.22319/rmcp.v12i2.6050 Artículo

Efecto del modelo y material de construcción de la caja y recubrimiento de los panales de cría en la termorregulación y desarrollo de colonias de Scaptotrigona mexicana

Juan Antonio Pérez-Sato a Hugo Rodolfo Salazar-Vargas a Juan Valente Hidalgo-Contreras a* Natalia Real-Luna a Héctor Debernardi-De La Vequia a Roberto De La Rosa-Santamaría a

a

Colegio de Postgraduados, Campus Córdoba, Km. 348 Carretera Federal CórdobaVeracruz, Congregación Manuel León, 94946, Amatlán de los Reyes, Veracruz, México.

*Autor de correspondencia: e-mail: jvhidalgo@colpos.mx

Resumen: La división artificial de colonias de abejas S. mexicana es una actividad en la meliponicultura, en donde se reporta la mayor pérdida de colonias. Entre las diversas causas de dicha mortalidad destaca la dificultad de la nueva colonia por mantener la termorregulación de su nido, ya que tradicionalmente se utilizan vasijas de barro en cuyo caso es más difícil mantener una temperatura estable. El objetivo de este estudio fue analizar las interacciones entre modelo de caja, su material de construcción y el recubrimiento de los panales de cría; en la temperatura interna del nido y el desarrollo de colonias obtenidas por división artificial. Se cuantificó el desarrollo de éstas mediante su ganancia de peso final e inicial, y el número de celdas construidas, actividad de la colonia y capacidad del diseño en mantener la temperatura interna del nido. Los resultados muestran que los mejores rangos de temperatura interna se lograron en nidos transferidos a cajas racionales modelo Portugal-Araujo (P<0.05) y Ailton-

437


Rev Mex Cienc Pecu 2021;12(2):437-452

Fontana (P<0.05) cuyos diseños originales fueron modificados al incluir láminas de poliestireno expandible. Además, la temperatura y desarrollo de la colonia se vio favorecida cuando los panales recién transferidos fueron recubiertos con un molde elaborado de cera de abeja Apis mellifera L. La interacción positiva entre estos factores permitió proporcionar un rango de temperatura óptimo (27.9 a 31.0 °C) para el desarrollo de las colonias, las cuales obtuvieron ganancia de peso entre 0.149 a 0.289 kg y del número de celdas construidas entre 3,511 a 4,956 celdas de cría. Palabras clave: Termorregulación, Cavidad, Abeja sin aguijón, División artificial, Material aislante, Sustituto de involucro.

Recibido: 10/09/2018 Aceptado: 17/02/2020

Introducción La división artificial de colonias es un método utilizado en la meliponicultura y consiste en que a partir de una colonia madre de abejas(1) se obtienen varias colonias hijas a través de los años(2). Posterior a la división la sobrevivencia de la colonia hija llega a ser critica si no se le brindan las condiciones adecuadas(3,4) debido a que las partes del nido son destruidas(5) y la cría de las nuevas colonias queda expuesta a las fluctuaciones de temperatura externa y se estabiliza hasta que las estructuras del nido son nuevamente reconstruidas(6-9). La temperatura óptima del nido oscila entre 31 y 35 °C(10,11); para conseguirla las obreras cubren el área de cría con pequeñas láminas de cerumen conocido como involucro(12,13) seguido del área de almacenamiento, además las abejas revisten las paredes periféricas con batumen (mezcla de cerumen producido por la abeja y resina de los árboles). Una inadecuada termorregulación del nido puede tener consecuencias graves para la colonia(14), desde un lento crecimiento hasta su muerte(15,16,17). Bajo condiciones de una mala termorregulación del nido, las abejas invierten la mayor parte de sus energías en construir las estructuras de aislamiento, y un menor esfuerzo en recolectar néctar y polen que son esenciales para el desarrollo y sobrevivencia de la colonia(12,18). Otro factor clave que contribuye en la termorregulación del nido es el tipo de cavidades donde se alojan los nidos de S. mexicana(12); las que comúnmente se utilizan de forma tradicional son cavidades naturales como troncos y vasijas de barro. Los troncos poseen paredes gruesas (>10 cm) que les permiten conservar adecuadamente la temperatura interna del nido(19). Sin embargo, en las cajas racionales existe una mayor fluctuación en la temperatura interna del

438


Rev Mex Cienc Pecu 2021;12(2):437-452

nido debido a que éstas tienen un mayor volumen, altura y menor grosor de las paredes que las cavidades naturales(20). Debido a la importancia que la termorregulación tiene en el desarrollo de una colonia, es necesario construir cajas racionales que favorezcan el mantenimiento de rangos óptimos de temperatura para el desarrollo de la cría(21). Las cavidades comúnmente usadas para la crianza de S. mexicana son a base cajas de madera y vasijas de barro(17,22). Sin embargo, estos materiales no poseen las mejores propiedades térmicas aislantes que ayuden al nido a mantener su temperatura óptima, especialmente en colonias de tamaño pequeño. En la actualidad se han diseñado modelos de cajas racionales de madera, que facilitan el manejo de la colonia y brindan una mejor termorregulación al nido(6,23,24). El modelo más utilizado para la especie S. mexicana es el Portugal-Araujo(23), mientras que el AiltonFontana es utilizado para Tetragonisca angustula y Nannotrigona testaceicornis(24). Este último modelo de caja puede ser modificado para ser usado exitosamente para alojar S. mexicana. Ambos modelos pueden ser ampliamente mejorados para brindar una mayor termorregulación al nido de las abejas sin aguijón, si se incluye en su diseño y construcción un material aislante como el poliuretano(6) o poliestireno expandible. Durante la división artificial de las colonias de abeja sin aguijón, las estructuras del nido esenciales para brindar una termorregulación adecuada al mismo son destruidas durante esta actividad. Esto deja en un estado de vulnerabilidad a las nuevas colonias hijas a los cambios bruscos de temperaturas del ambiente. Una propuesta de contrarrestar esta situación sería diseñar y construir cajas racionales con materiales con propiedades térmicas aislantes y recubrir el área de cría con algún material que cumpla con las funciones del involucro. El objetivo de esta investigación fue analizar en colonias pequeñas obtenidas por división artificial, el efecto que se tiene en la temperatura interna del nido y desarrollo de la colonia de S. mexicana; el recubrir sus panales de cría con un material que sustituye al involucro y alojarlos en modelos de cajas racionales construidas con material convencional y materiales con propiedades térmicas aislantes.

Material y métodos El estudio se llevó a cabo en el Meliponario ubicado en el área de Permacultura del Colegio de Postgraduados, Campus Córdoba, Amatlán de los Reyes, Veracruz, México, entre los paralelos 18° 46’ y 18° 58’ N; los meridianos 96° 49’ y 96° 58’ O; altitud de 600 msnm. El clima corresponde a cálido húmedo (88 %) y semicálido húmedo (12 %) con abundantes lluvias en verano, con un rango de temperatura entre 20 a 24 °C y precipitación de 1,900 a 2,600 mm(25). El periodo de estudio fue de junio a agosto de 2016, una vez que se contó con el material experimental, con la construcción del área experimental y buscando evitar el

439


Rev Mex Cienc Pecu 2021;12(2):437-452

período de lluvias, que para el caso de Amatlán de los Reyes es de junio a septiembre; sin embargo, se consideró realizar el experimento en los días donde se presentó un período de días secos y bajo un pabellón para evitar la invasión de la mosquita Pseudohyphocera spp. Otro aspecto por considerar para el período de estudio fue la disponibilidad de alimento para llevar a cabo la división, por lo cual se tiene que realizar cuando se encuentra la época de floración, lo cual al encontrarse en el área de Permacultura las abejas disponen de flora que le proporcionó alimento (néctar y polen) en los meses en los que se realizó la división(3). En este experimento se utilizaron 36 colonias hijas de S. mexicana obtenidas de la siguiente manera: con base en 107 colonias de dos meliponarios del Colegio de Postgraduados, se establecieron 36 colonias madres con un peso promedio de 5 kg por colonia (rango=4.52 a 5.86 kg). Estas inicialmente estaban alojadas en vasijas de barro, con la finalidad de facilitar su manejo, sólo los panales de cría e involucro con un peso promedio de 265 g (rango=118 a 384 g) se transfirieron al modelo de caja racional Ailton-Fontana construida de maderapoliestireno. Las colonias recién transferidas se alimentaron con miel de Apis mellifera por 19 días, hasta que las colonias lograron su organización. Después de 84 días, se procedió a la división artificial(26) de las colonias madres para obtener 36 colonias hijas, dando el mismo manejo post transferencia y todas presentaron una reina fecundada hasta los 35 días posterior a la división. Antes de colocar los panales en la caja, estos fueron pesados en una báscula digital (OHAUS®), y se registró el peso inicial de panales en cada colonia hija al momento de la división artificial. Este se mantuvo dentro del rango de 0.077 a 0.335 kg(27). Las nuevas colonias estuvieron compuestas por panales de cría joven y de capullo, abejas obreras y reina fecundada. El diseño del experimento se realizó bajo un diseño en bloques completos al azar (DBCA) con un arreglo factorial completo en los tratamientos (Cuadro 1) y el peso inicial de la colonia como covariable. El arreglo factorial consistió de tres factores (2x2x3), donde el primer factor fue el modelo: modelo Ailton-Fontana (MAF) y modelo Portugal-Araujo (MPA); el segundo factor fue el material utilizado en la construcción de las cavidades racionales: cajas construidas de madera (CCM) y cajas construidas de madera en su exterior, en su parte media contienen una capa de poliestireno expandido y en su parte interna otra capa de madera unidas entre sí formando un emparedado (CCM+PE); y el tercer factor fue el tipo de material utilizado para recubrir los panales de cría recién transferidos a las cajas con tres niveles: panales de cría transferidos sin recubrimiento (PCTSR) (testigo), panales de cría transferidos recubiertos con cera de Apis mellifera (PCTRCAM) y panales de cría transferidos recubiertos con poliestireno expandible (PCTRPE). La cera de abeja utilizada fue de Apis mellifera L.

440


Rev Mex Cienc Pecu 2021;12(2):437-452

Cuadro 1: Arreglo factorial de los tratamientos Modelo de caja MAF MAF MAF MAF MAF MAF MPA MPA MPA MPA MPA MPA

Material de la caja CCM CCM CCM CCM+PE CCM+PE CCM+PE CCM CCM CCM CCM+PE CCM+PE CCM+PE

Material de panales PCTSR PCTRCAM PCTRPE PCTSR PCTRCAM PCTRPE PCTSR PCTRCAM PCTRPE PCTSR PCTRCAM PCTRPE

Arreglo factorial de los tratamientos MAF-CCM-PCTSR MAF-CCM- PCTRCAM MAF-CCM-PCTRPE MAF- CCM+PE- PCTSR MAF- CCM+PE- PCTRCAM MAF-CCM+PE- PCTRPE MPA-CCM-PCTSR MPA-CCM- PCTRCAM MPA-CCM-PCTRPE MPA-CCM+PE- PCTSR MPA-CCM+PE- PCTRCAM MPA-CCM+PE- PCTRPE

Clave T1* T2 T3 T4 T5 T6 T7* T8 T9 T10 T11 T12

MAF= modelo Ailton-Fontana, MPA= modelo Portugal-Araujo, CCM=caja construida de madera, CCM+PE= + poliestireno expandible, PCTSR= panales de cría transferidos sin recubrir, PCTRCAM= panales de cría transferidos recubiertos con cera de Apis mellifera, PCTRPE= panales de cría transferidos recubiertos con poliestireno expandible. *Tratamientos testigo: T1 para el Modelo Ailton-Fontana (MAF) y T7 para el Modelo Portugal-Araujo (MPA).

Debido a que el peso inicial de las colonias fue muy variable para todas las colonias divididas, se introdujo como covariable al modelo estadístico el peso inicial de las colonias. El modelo estadístico del experimento fue un modelo de efectos mixtos con análisis de covarianza representado de la siguiente manera: 𝐲𝐢𝐣𝐤𝐥 μ + bloquel + αi + βj + γk + (αβ)ij + (αγ)ik + (βγ)jk + (αβγ)ijk + δ(xijkl − x̅… ) + eijkl con i = 1,2; j = 1,2; k = 1,2,3 y l = 1,2,3 Donde: 𝐲𝐢𝐣𝐤𝐥 es la variable respuesta del i-ésimo efecto del modelo de caja con el j-ésimo tipo de material de construcción y el k-ésimo tipo de recubrimiento del panal de cría en el l-ésimo bloque; μ es la media global; bloquel es el efecto aleatorio del l-ésimo bloque con media 0 y varianza σ2bloque ; 𝛂𝐢 es el efecto fijo del i-ésimo del modelo de caja; 𝛃𝐣 es el efecto fijo del material de construcción de la caja; 𝛄𝐤 es el efecto fijo del k-ésimo tipo de recubrimiento del panal de cría; (𝛂𝛃)𝐢𝐣 , (𝛂𝛄)𝐢𝐤 , (𝛃𝛄)𝐣𝐤, y (𝛂𝛃𝛄)𝐢𝐣𝐤 son las interacciones de los efectos fijos;

441


Rev Mex Cienc Pecu 2021;12(2):437-452

𝛅(𝐱 𝐢𝐣𝐤𝐥 − 𝐱̅ … ) es la covariable cuyo coeficiente de regresión lineal es δ respecto al peso inicial xijkl ; 𝐞𝐢𝐣𝐤𝐥 es el error experimental aleatorio el cual se asume independiente e idénticamente distribuido normal con media cero y varianza σ2 . El análisis de comparación múltiple de las medias se realizó bajo el procedimiento GLIMMIX del paquete estadístico SAS versión 9.4. Las comparaciones de las medías fue a través de la prueba LSD de Fisher. Las variables respuesta (temperatura) analizadas bajo este diseño se clasificaron de la siguiente manera: temperatura ambiente de día (TAD), temperatura ambiente de noche (TAN) temperatura ambiente promedio (TAP), temperatura interna del nido de día (TIND), temperatura interna del nido de noche (TINN) y temperatura interna promedio (TIP). Respecto al tamaño de la colonia, las mediciones que se realizaron fueron las siguientes: peso inicial de la colonia (PIC), peso final de la colonia (PFC), ganancia de peso de la colonia (GPC), numero de celdas de cría construidas (NCCC), numero de potes totales construidos (NPTC). Finalmente, para observar las relaciones entre las variables respuesta, se realizó un análisis de correlación de Pearson. Para este estudio se construyeron 18 cajas del MAF con volumen de 5.3 L y 18 cajas MPA con volumen de 4.2 L. En el MAF nueve de dichas cajas fueron construidas completamente de madera (espesor 2.54 cm) y nueve de madera (espesor de 2.54 cm) y poliestireno expandible. Para el modelo MPA se construyeron bajo las mismas condiciones descritas para MAF. Por otra parte, los panales de cría transferidos a las 36 cajas construidas con las características mencionadas fueron recubiertos con los siguientes tipos de materiales: con un molde de cera de Apis mellifera (PCTRCAM) (Figura 1) de 12 cm de diámetro por 6 cm de alto y un espesor de 0.2 mm con 4 orificios de ventilación con diámetro de 1 cm en cada uno de los bordes y con una molde de poliestireno expandible (PCTRPE) (Figura 2) que tuvo características similares a PCTRCAM y también se incluyeron nidos sin este tratamiento como testigo. Figura 1: Elaboración del recubrimiento para Panales de Cría Transferidos Recubiertos con Cera de Apis mellifera (PCTRCAM)

A) Trazo de medidas en lámina de cera estampada de abeja europea Apis mellifera L. B) Corte de láminas. C) Ajuste de medidas (6 x 30 cm). D) Elaboración de orificios de ventilación con sacabocados con diámetro de 1 cm. E) Lámina terminada con orificios de ventilación. F) Elaboración de cilindro para colocar dentro la cría recién transferida. Fuente: Elaboración propia. Foto: H.R. Salazar-Vargas. 442


Rev Mex Cienc Pecu 2021;12(2):437-452

Figura 2: Elaboración del recubrimiento para los panales de cría transferidos utilizando un recipiente de poliestireno expandible

A) Vista del fondo del recipiente de poliestireno expandible B) Trazo de medidas en el recipiente. C) Corte con una tijera de la parte inferior del recipiente. D) La parte inferior del recipiente es eliminado. E) Elaboración de orificios de ventilación con sacabocados con diámetro de 1 cm. F) Recubrimiento terminado con orificios de ventilación. G) Panales de cría transferidos recubiertos con poliestireno expandible (PCTRPE). Fuente: Elaboración propia. Foto: H.R. Salazar-Vargas.

En el Cuadro 1 se muestran los 12 tratamientos (tres repeticiones cada uno) que resultaron de las combinaciones de tres factores (modelo de caja, material de construcción de las cajas, materiales que recubren el nido) y sus respectivos niveles. Para facilitar la identificación de la combinación se asignó una clave a cada combinación. Durante 41 días previo al inicio del experimento se hicieron revisiones periódicas donde todas las colonias fueron alimentadas con miel, y polen y se tomaron las medidas de control: limpieza de caja y uso de trampas internas con uso de atrayente (ácido acético al 5%), en colonias que resultaron positivas a mosca vinagrera (Pseudohypocera spp.). Cuando las colonias presentaron un comportamiento similar, se colocaron en el Meliponario del Área de Permacultura del Campus Córdoba-CP. Estas fueron distribuidas aleatoriamente en tres bloques de 12 colonias con cada una de las combinaciones, el primer bloque se colocó a 2 m de distancia del piso, el segundo a 1.5 m y el tercero a 1 m de distancia. Las entradas de los nidos se orientaron hacia el norte. Para evaluar la interacción del modelo de caja, material de construcción de la caja y material que recubre el nido en la temperatura interna, sobre el último disco de cría de cada colonia se colocó un sensor de termómetro digital (VA-DT-1H Avaly®). Durante 12 semanas en intervalos de cada 4 h, se registró la temperatura interna del nido y la del ambiente. Durante el día se colectaron datos de temperatura a las 0900 h, 1300 h y 1700 h; mientras que durante la noche los horarios fueron 2100 h, 0100 h y 0500 h. Para obtener el incremento de peso de la colonia hija se cuantificó su peso inicial y peso final. Para esto se utilizó una báscula portátil (EQB-100 Torrey®), además se calculó el número de celdas de cría; esto se realizó de forma indirecta, a través de medir la altura y el diámetro del nido, relacionando el cálculo del número de celdas por centímetro cuadrado mediante un conteo previo para realizar esta estimación, y se contabilizó la cantidad de potes totales visualmente(5).

443


Rev Mex Cienc Pecu 2021;12(2):437-452

Resultados Durante el periodo de estudio, el promedio de la temperatura ambiente de día fue de 27. 3 °C (rango= 26.7 a 28.4 °C) y la temperatura ambiente de noche de 21.2 °C (rango= 20.8 a 22.4 °C). La interacción entre modelo de caja, material de construcción de la caja y material que recubre el nido para la temperatura interna del nido de día (TIND) muestra diferencia significativa (P<0.05), no así para la temperatura interna del nido en la noche (TINN) (P>0.05). Para la TIND entre tratamientos se observa que la media ajustada más alta corresponde a T11 con una media ajustada de 31.5 °C (Cuadro 2) y la más baja corresponde para T4. Los tratamientos con la media ajustada más alta para la variable TINN fueron T1, T5 y T11 y la más baja fue T4. Entre el tratamiento control T1 y T5 no se observan diferencias significativas (P>0.05). Sin embargo, entre el tratamiento T7 y T11 hubo diferencias significativas (P<0.05).

Cuadro 2: Medias ajustadas (±SD) del nido de S. mexicana de las variables TIND, TINN y TIP

Tratamiento T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 abcd

Temperatura interna del nido (°C) De día (TIND) De noche (TINN) 29.598 ± 0.715 abc 27.896 ± 1.012 a 29.391 ± 0.726 abc 27.058 ± 1.03 ab 28.361 ± 0.714 c 25.386 ± 1.011 ab 25.929 ± 1.024 d 23.395 ± 1.504 b 30.132 ± 0.69 abc 27.973 ± 0.972 a 29.497 ± 0.697 abc 27.178 ± 0.984 ab 28.736 ± 0.69 bc 25.323 ± 0.971 ab 29.771 ± 0.741 abc 26.484 ± 1.054 ab 28.811 ± 0.73 bc 24.895 ± 1.037 ab 30.292 ± 0.698 ab 27.198 ± 0.985 ab 31.358 ± 0.761 a 28.137 ± 1.088 a 30.148 ± 0.772 abc 26.741 ± 1.106 ab

Promedio (TIP) 28.745 ± 0.837 ab 28.222 ± 0.851 ab 26.872 ± 0.836 bc 24.655 ± 1.223 c 29.052 ± 0.807 ab 28.339 ± 0.815 ab 27.029 ± 0.806 bc 28.13 ± 0.87 ab 26.855 ± 0.856 bc 28.746 ± 0.816 ab 29.75 ± 0.896 a 28.448 ± 0.91ab

Letras diferentes indican diferencia significativa entre tratamientos (P˂0.05).

La gráfica de la TIP media ajustada de los tratamientos, durante un periodo de 24 h (Figura 3) muestra oscilaciones similares entre tratamientos. Las oscilaciones para medias más altas corresponden a T11 y T5 y las mínimas para T4.

444


Rev Mex Cienc Pecu 2021;12(2):437-452

Figura 3: Temperatura media ajustada (±SD) de nidos de S. mexicana

T1(MAF-CCM-PCTSR), T2(MAF-CCM- PCTRCAM), T3(MAF-CCM-PCTRPE), T4(MAF- CCM+PEPCTSR), T5(MAF- CCM+PE- PCTRCAM), T6(MAF-CCM+PE- PCTRPE), T7(MPA-CCM-PCTSR), T8(MPA-CCM- PCTRCAM), T9(MPA-CCM-PCTRPE), T10(MPA-CCM+PE- PCTSR), T11(MPACCM+PE- PCTRCAM) y T12 (MPA-CCM+PE- PCTRPE), durante 24 h.

Los resultados de las medias ajustadas para el peso final de la colonia (PFC), ganancia de peso de la colonia (GPC) se muestran en el Cuadro 3. Así como el número de celdas de cría construidas (NCCC) y número de potes totales construidos (NPTC). Se observaron diferencias significativas para las variables analizadas: PFC (P=0.0224), GPC (P=0.0224), NCCC (P=0.0036), no así para NPTC (P=0.1509). Cuadro 3: Medias ajustadas (±DE) del PIC, PFC y GPC del nido de S. mexicana después de 12 semanas del experimento Tratamientos T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 abc

Peso de la colonia (kg) Peso inicial Peso final (PIC) (PFC) 0.2021± 0.0293 0.308 ± 0.0515 abc 0.2112 ± 0.0293 0.294 ± 0.0524 abc 0.2015 ± 0.0293 0.368 ± 0.0514 ab 0.3352 ± 0.0293 0.17 ± 0.0768 c 0.1653 ± 0.0293 0.308 ± 0.0495 abc 0.1344 ± 0.0293 0.307 ± 0.05 abc 0.1594 ± 0.0293 0.188 ± 0.0494 c 0.0953 ± 0.0293 0.233 ± 0.0537 bc 0.1026 ± 0.0293 0.195 ± 0.0528 c 0.1333 ± 0.0293 0.254 ± 0.0501 bc 0.083 ± 0.0293 0.448 ± 0.0554 a 0.077 ± 0.0293 0.258 ± 0.0563 bc

Ganancia de peso (GPC) 0.1499 ± 0.0515 abc 0.1358 ± 0.0524 abc 0.2099 ± 0.0514 ab 0.0113 ± 0.0768 c 0.1491 ± 0.0495 abc 0.1481 ± 0.05 abc 0.0295 ± 0.0494 c 0.0748 ± 0.0537 bc 0.0369 ± 0.0528 c 0.0953 ± 0.0501 bc 0.2893 ± 0.0554 a 0.0991 ± 0.0563 bc

Letras diferentes indican diferencia significativa entre tratamientos (P˂0.05).

445


Rev Mex Cienc Pecu 2021;12(2):437-452

Las comparaciones entre los tratamientos revelaron que para las variables PFC y GPC, T3 (MAF-CCM-PCTRPE) y T11 fueron los más altos (Cuadro 3) y los más bajos T4. Con respecto a las variables NCCC los valores más altos corresponden a T5 y T11 y para NPTC los valores más altos les corresponden a los tratamientos T4, T5 y T11 (Cuadro 4). Existe una correlación significativa entre la TIP y el NCCC (P˂0.0001), entre el PIC y NPTC (P˂ 0.0001), y entre el PFC con NCCC (P˂0.0001) y NPTC (P˂0.0001). El T3 y T11 tuvieron un PFC y GPC mayor en comparación con los otros tratamientos (Figura 3). Cuadro 4: Medias ajustadas (±SD) del NCCC y NPTC de S. mexicana después de 12 semanas del experimento Numero de celdas de cría Numero de potes totales Tratamientos construidas (NCCC) construidos (NPTC) T1 2372.1 ± 819.66 bc 32.801 ± 8.6603 abc T2 3029.8 ± 829.78 abc 26.189 ± 8.7897 bc T3 2158.8 ± 819.01 bcd 18.558 ± 8.6521 c T4 -496.44 ± 1110.6 d 36.3 ± 12.286 abc T5 3511.5 ± 797.54 ab 43.688 ± 8.3764 ab T6 1950.6 ± 803.82 bcd 31.724 ± 8.4572 abc T7 1293.7 ± 796.98 cd 21.184 ± 8.3692 c T8 2189.1 ± 843.39 bcd 31.932 ± 8.9632 abc T9 1245.2 ± 833.41 cd 25.555 ± 8.8359 bc T10 2739.2 ± 804.48 bc 30.551 ± 8.4657 bc T11 4956.8 ± 862.5 a 52.006 ± 9.2057 a T12 1784.7 ± 872.76 bcd 32.846 ± 9.3355 abc abcd

Letras diferentes indican diferencia significativa entre tratamientos (P˂0.05).

Discusión En este estudio los mejores tratamientos que proporcionan una temperatura interna promedio del nido (TIP), TIND y TINN adecuada para el desarrollo de la cría de S. mexicana fueron los tratamientos: T5 (MAF- CCM+PE- PCTRCAM) y T11 (MPA-CCM+PE- PCTRCAM). Esto se explica en parte por las interacciones positivas que resultan de combinar material con propiedades térmicas aislantes (poliestireno expandible) en la construcción de cajas racionales(28), y el recubrir los panales de cría recién transferidos con un material que imita la función que tiene el involucro, como es el caso de la cera de abeja Apis mellifera L. Las interacciones de estas combinaciones impactaron positivamente en la temperatura interna del nido; lo que a su vez influyó en el desarrollo de la colonia mejorando los siguientes aspectos: NCCC, NPTC, PFC y GPC. Como el caso de Melipona subnitida(29) a la cual se le proporcionaron la mayor cantidad de condiciones favorables como temperatura alta y alimento, lo que propició el incremento de celdas de cría. También se ha observado que para

446


Rev Mex Cienc Pecu 2021;12(2):437-452

el caso de Nannotrigona testaceicornis, alojadas en cajas con temperatura artificial durante un periodo invernal, ésta logra mantener la producción de cría y reducir las actividades de termorregulación realizadas por las abejas durante el día o la noche(30). Comparando los resultados obtenidos en las temperaturas del nido (TIND, TINN, TIP) en los tratamientos T5 (29.052 ± 0.807) y T11 (29.75 ± 0.896). Se observa que, aunque no hubo diferencias significativas (P>0.05) entre estos dos tratamientos, en T11 se obtuvieron los mejores resultados con relación a la temperatura interna del nido y desarrollo de la colonia expresado en un mayor número de celdas de cría (4,956 ± 862) y potes de almacenamiento (52 ± 9). Estos resultados confirman que la termorregulación interna del nido es importante en los insectos sociales, ya que de ella depende el desarrollo y la supervivencia de la colonia(8,9). El rango de temperatura logrado (28.13 a 31.35 °C) en este tratamiento se atribuyó a que la caja racional MPA fue diseñada desde un inicio para S. mexicana y posee el volumen adecuado (4.3 L) para la especie. La interacción entre el volumen interno del MPA, el material con propiedades térmicas aislantes y la protección de la cría utilizando un molde de cera de Apis mellifera L. hacen de este tratamiento, uno de los mejores para la crianza de S. mexicana. El rango de temperatura que permite un buen desarrollo de la cría en las abejas nativas es de 31 a 32.3 °C(11), la temperatura óptima es de 35 °C(10). El resultado de temperatura del nido obtenido en este tratamiento se encuentra dentro del rango que ha sido calculado como adecuado para el desarrollo esta especie. El incluir un material con propiedades aislantes (poliestireno expandible) en los modelos de cajas racionales (MAF, MPA) y el recubrir los panales de cría transferidos es vital para proporcionar un rango de temperatura adecuado para el desarrollo de la colonia de tamaño pequeño obtenidas por división artificial. La interacción de estos dos factores juega un papel importante en la termorregulación del nido. Esto se verifica claramente en los resultados obtenidos en los tratamientos T7 (27.029 ± 0.806 °C) y T11 (29.75 ± 0.896 °C); en donde el modelo de caja racional MPA fue el mismo para ambos tratamientos. La diferencia radica en que en T7 la caja racional no incluye material con propiedades aislante en su diseño; ni tampoco se recubre la cría con ningún tipo de material. Estas diferencias en los tratamientos originaron diferencias significativas en la temperatura interna del nido (P<0.05). Otras especies de abejas sin aguijón responde de manera similar como es el caso de Melipona colimana que conserva una temperatura homogénea independiente de la temperatura ambiente, sí las condiciones de la cavidad son favorables(31). En el caso de la caja racional MAF, la cual fue diseñada para las especies T. angustula y N. testaceicornis(24), fue modificada en sus dimensiones para adaptarla al comportamiento de S. mexicana. Su volumen final debido a las modificaciones fue de 5.3 L, ligeramente mayor al MPA. Debido a su volumen mayor, los resultados mostraron que el MAF modificado funciona adecuadamente para alojar S. mexicana, pero se requiere que la cría transferida sea recubierta con un molde de cera de abeja de A. mellifera L. La caja racional MAF modificada 447


Rev Mex Cienc Pecu 2021;12(2):437-452

y completamente de madera también proporcionó una temperatura adecuada al nido cuando los panales de cría fueron recubiertos con cera de abeja. El tratamiento en donde se registró la TIP del nido más baja fue en el tratamiento T4 (MAFCCM+PE- PCTSR). La TINN fue de 23.395 ± 1.504 y tuvo un efecto negativo en el NCCC (-496.44 ± 1110.6). Un rango de temperatura interna inadecuado provoca que las abejas inviertan la mayor parte de sus energías en construir estructuras de aislamiento, y un menor tiempo en recolectar néctar y polen que son esenciales para el desarrollo y sobrevivencia de la colonia(11,32). En el caso de Scaptotrigona depilis, temperaturas entre 26 a 34 °C, no afectan la sobrevivencia de las crías; sin embargo, temperaturas por debajo de 22 °C o superiores a 38 °C causan la mortalidad de la cría, por lo que es muy probable la perdida de las colonias de tamaño pequeño bajo estas condiciones(14). Es importante señalar que el Modelo Ailton-Fontana (MAF) fue diseñado para T. angustula y N. testaceicornis (especies de tamaño pequeño) y aunque en este estudio el modelo fue modificado, adicionando a su diseño original láminas de poliestireno expandible. Sin embargo, esta acción no fue suficiente para proporcionar una temperatura óptima para el desarrollo de colonias de tamaño pequeño de S. mexicana obtenidas por división artificial. Debido al tamaño mayor de volumen (5.3 L) que tiene el MAF, para el caso de S. mexicana se requiere que los panales de cría sean recubiertos con cera de abeja para obtener mejores resultados; tal como se observó en el tratamiento T5 (MAF- CCM+PE- PCTRCAM) en donde se logró una de las mejores TIP del nido. Las colonias alojadas en el MAF modificado con láminas de poliestireno expandible y sin recubrimientos en los panales, tuvieron los valores más bajos en las siguientes variables: peso final de la cría, ganancia de peso de la cría y número de celdas construidas. Lo anterior se atribuye a la relación que estas variables tienen con la termorregulación del nido. Respecto a la variable cantidad de potes totales, esta fue similar al resto de los tratamientos, esto se explica a que durante el periodo de estudio (primavera-verano), el aprovisionamiento de alimento no se ve afectado debido a que el flujo de néctar es abundante y es favorecido por la temperatura ambiente de día. En otros estudios con Trigona carbonaria se observaron que, para estas colonias, las bajas temperaturas en el nido tuvieron una buena ganancia de peso; debido a la construcción excesiva de involucro o batumen, sin embargo, hubo poco desarrollo de su cría(33). Los resultados mostraron que la caja racional MAF construida exclusivamente de madera de 3.74 cm (2.54 cm + 1.2 cm) proporciona rangos adecuados de temperatura (27.896 a 29.598 °C) para la cría alojada en su interior. En el caso de M. colimana, el control interno de la temperatura es mejor con un mayor espesor de las paredes en la cavidad (22). La combinación de uso del MAF y el recubrimiento de los panales con el molde de cera de Apis mellifera L. mejoran aún más el rango de temperatura interna del nido. 448


Rev Mex Cienc Pecu 2021;12(2):437-452

Las combinaciones de los tratamientos T3, T6, T9 y T12, no se recomiendan debido a que el recubrimiento en los panales de cría con moldes de poliestireno expandible es rechazado por las abejas, dado que al final del período de estudio se observaron mordeduras en este material, en respuesta a que la abeja intentaba manipular para llevar a cabo la termorregulación pasiva del nido.

Conclusiones e implicaciones La caja modelo Portugal Araujo (MPA) modificada proporciona un rango de temperaturas adecuadas (25.323-28.736°C) para el desarrollo de colonias de tamaño pequeño de S. mexicana obtenidas por división artificial. Sin embargo, el desarrollo de la colonia y el rango de temperatura mejora ligeramente si los panales de cría son recubiertos con cera de abeja Apis mellifera L. La caja MPA modificada construida con paredes de madera y láminas de poliestireno expandible proporcionaron un mejor rango de temperatura (27.198-30.292°C). La caja modelo Ailton-Fontana (MAF) aunque no fue diseñada para la crianza de S. mexicana; mostró que el modelo modificado proporciona rangos adecuados de temperatura (27.896-29.598 °C) para el desarrollo de esta especie. Dicho rango de temperatura mejoró cuando la caja MAF se modificó adicionando a su diseño láminas de poliestireno expandible y recubriendo los panales de cría con cera de abeja europea (T5). No se recomienda utilizar la caja racional MAF-modificada con poliestireno expandible, sin colocar el recubrimiento de cera de abeja Apis mellifera L. a los panales de cría recién transferidos; debido a que su volumen dificulta que las abejas mantengan un rango de temperatura adecuada para su desarrollo. Literatura citada: 1.

Cortopassi-Laurino M, Imperatriz-Fonseca VL, Roubik DW, Dollin A, Heard T, Aguilar I, Nogueira-Neto P. Global meliponiculture: challenges and opportunities. Apidologie 2006;37(2): 275–292.

2.

Jaffé R, Pope N, Carvalho AT, Maia UM, Blochtein B, Carvalho CAL, ImperatrizFonseca VL. Bees for development: Brazilian survey reveals how to optimize stingless beekeeping. PLoS ONE 2015;10(3).

3.

Halcroft MT, Spooner-Hart R, Haigh AM, Heard TA, Dollin A. The Australian stingless bee industry: a follow-up survey, one decade on. J Apic Res 2013;52(2):1–7.

4.

Villanueva-Gutiérrez R, Roubik DW, Colli-Ucán W, Güemez-Ricalde FJ, Buchmann SL. A critical view of colony losses in managed Mayan honey-making bees (Apidae: Meliponini) in the heart of Zona Maya. J Kan Ent Soc 2013;86(4):352–362.

449


Rev Mex Cienc Pecu 2021;12(2):437-452

5.

Lóriga-Peña W, Álvarez-López D, Fonte-Carballo L, Demedio-Lorenzo J. Población inmadura y reservas de alimentos en colonias naturales de Melipona beecheii Bennett (Apidae: Meliponini) como factores básicos para su salud. Rev Sal Anim 2015;37(1):47–51.

6.

Pisté-Mukul MJ. Caracterización y termorregulación del nido de la abeja sin aguijón Scaptotrigona mexicana alojado en cavidades artificiales [tesis maestría]. Campeche, México: Colegio de Postgraduados; 2011.

7.

Quezada-Euán JJ. Biología y uso de las abejas sin aguijón de la península de Yucatán, México (Hymenoptera: Meliponini). Edi Univ Aut Yuc 2005;(16).

8.

Engels W, Rosenkranz P, Engels E. Thermoregulation in the nest of the Neotropical Stingless bee Scaptotrigona postiça and a hypothesis on the evolution of temperature homeostasis in highly Eusocial bees. Stud Neo F Env 1995;30(4):193–205.

9.

Moritz RFA, Southwick EE. Bees as superorganisms - An evolutionary reality. Heidelberg, Germany: Springer; 1992.

10. Márquez-Luna JM. Meliponicultura en México. Dugesiana 1994;1(1):3–12. 11. Roubik DW, Peralta JA. Thermodynamics in nests of two melipona species in Brasil. A Amaz 1983;13(2):453–466. 12. Jones JC, Oldroyd BP. Nest thermoregulation in social insects. Adv Ins Phys 2006;33:153–191. 13. Roubik DW. Stingless bee nesting biology. Apidologie 2006;37(2):124–143. 14. Vollet-Neto A, Menezes C, Imperatriz-Fonseca VL. Behavioural and developmental responses of a stingless bee (Scaptotrigona depilis) to nest overheating. Apidologie 2015;46(4):455–464. 15. Quijano E, González-Acereto J, Quezada-Euán JG. Desarrollo de divisiones de colonias de Melipona beecheii (Hymenoptera, Meliponini) a partir de tres tamaños de población. Bioagrociencias 2008;1(1):4–11. 16. Quezada-Euán JJ. Biología y uso de las abejas sin aguijón de la península de Yucatán, México (Hymenoptera: Meliponini). Edi Univ Aut Yuc 2005;(16). 17. Quezada-Euán JJ, May-Itzá W, González-Acereto JA. Meliponiculture in Mexico: problems and perspective for development. Bee World 2001;82(4):160–167. 18. Biesmeijer JC, Slaa EJ. Information flow and organization of stingless bee foraging. Apidologie 2004;35(2):143–157.

450


Rev Mex Cienc Pecu 2021;12(2):437-452

19. Macias-Macias JO, Quezada-Euan J, Tapia-González JM, Conteras-Escareño F. Nesting sites, nest density and spatial distribution of Melipona colimana Ayala (Hymenoptera: Apidae: Meliponini) in two highland zones of western, Mexico. Sociobiology 2014;61(4): 423-427. 20. Moo-Valle H, Quezada-Euán JJ, Navarro J, Rodríguez-Carvajal LA. Patterns of intranidal temperature fluctuation for Melipona beecheii colonies in natural nesting cavities. J Apic Res 2000;39(2):3–7. 21. Macías-Macías JO, Quezada-Euán JJ, González JM. Effect of lodging type on the internal temperature and humidity of colonies of Melipona colimana (Hymenoptera: Meliponini) from a Mexican temperate zone. J Apic Res 2011;50(3):235–241. 22. Ayala R. Revisión de las abejas sin Aguijón de México (Hymenoptera: Apidae: Meliponini). Fol Ento Mex 1999;106. 23. Guzmán-Díaz M, Balboa C, Vandame R, Albores ML, González-Acereto J. Manejo de las abejas nativas sin aguijón en México. Primer ed: El Colegio de la Frontera Sur; 2011. 24. Barbieri C. Caracterização da meliponicultura e do perfil do meliponicultor no estado de São Paulo: ameaças e estratégias de conservação de abelhas sem ferrão. [tesis maestría]. São Paulo, Brasil: Universidad de São Paulo; 2018. 25. INEGI. Prontuario de información geográfica municipal de los Estados Unidos Mexicanos, Amatlán de los Reyes, Veracruz de Ignacio de la Llave. México; 2009. 26. Kwapong P, Aidoo K, Combey R, Karikari A. Stingless bees, importance, management and utilization. A training manual for stingless beekeeping. First Ed. Accra North, Ghana, Africa: Unimax Macmillan LTD; 2010. 27. Arzaluz A, Obregón F, Jones R. Optimum brood size for artificial propagation of the stingless bee, Scaptoptrigona mexicana. J Apic Res 2002;41(1–2):62–63. 28. Horvath JS. Expanded Polystyrene (EPS) geofoam: An introduction to material behavior. Geo Geomembranes 1994;13(4):263–280. 29. Maia-Silva C, Hrncir M, da Silva CI, Imperatriz-Fonseca VL. Survival strategies of stingless bees (Melipona subnitida) in an unpredictable environment, the Brazilian tropical dry forest. Apidologie 2015;46(5):631–643. 30. Vollet-Neto A, Menezes C, Imperatriz-Fonseca VL. Brood production increases when artificial heating is provided to colonies of stingless bees. J Apic Res 2011;50(3):242– 247.

451


Rev Mex Cienc Pecu 2021;12(2):437-452

31. Macías-Macías JO, Quezada-Euán JJ, Contreras-Escareño F, Tapia-González JM, MooValle H, Ayala, R. Comparative temperature tolerance in stingless bee species from tropical highlands and lowlands of Mexico and implications for their conservation (Hymenoptera: Apidae: Meliponini). Apidologie 2011;42(6):679–689. 32. Marshall AG. Ecology and natural history of tropical bees. J Trop Eco 1989;9(2):248– 248. 33. Norgate M, Boyd-Gerny S, Simonov V, Rosa MG, Heard TA, Dyer AG. Ambient temperature influences Australian native stingless bee (Trigona carbonaria) preference for warm nectar. PLOS ONE 2010;5(8).

452


https://doi.org/10.22319/rmcp.v12i2.5652 Artículo

Análisis de la rentabilidad apícola por estratos en Aguascalientes, México

José Inés Zavala Beltrán a Marco Andrés López Santiago b* Ramón Valdivia Alcalá a Blanca Margarita Montiel Batalla a

a

Universidad Autónoma Chapingo (UACh). División de Ciencias EconómicoAdministrativas, Carretera México-Texcoco Km 38.5, Texcoco, Estado de México. b

UACh. Unidad Regional Universitaria de Zonas Áridas, Durango, México.

*

Autor de correspondencia: marcoandres@chapingo.uruza.edu.mx

Resumen: La presente investigación se enfocó en analizar la estructura de costos y la rentabilidad en el proceso de producción de la apicultura. A través de técnicas de muestreo, se seleccionaron aleatoriamente 56 apicultores de un padrón de 230, mismos que se agruparon en tres estratos: productores de 20 a 50 colmenas (pequeños), 51 a 200 colmenas (medianos) y más de 200 colmenas (grandes). Se encontró que el costo económico de producción total se compone principalmente por el costo variable, con una participación promedio relativa de 55.4 % en los tres estratos. El gasto en alimentación es el concepto primordial, considerando que, para sostener la colmena, el 90.0 % de los apicultores alimentan con azúcar o fructosa cuando no hay floración. El costo fijo representa el 14.0 % respecto al total, la mayor erogación fue en el rubro de la depreciación en maquinaria y material de campo. Los costos de oportunidad representan el 30.6 % en promedio para los tres estratos. El rendimiento promedio por colmena fue de 25.4 kg/año. En conclusión, considerando el análisis económico, para el estrato I la actividad no es viable, ya que no considera el valor de todos los recursos en el proceso productivo (costos de oportunidad), así mismo en este estrato el ingreso principal proviene de otras actividades. En términos financieros, la actividad es viable en los tres

453


Rev Mex Cienc Pecu 2021;12(2):453-468

estratos, lo que indica que se tiene la capacidad de cubrir costos fijos y costos variables. Al incluir los costos de oportunidad, los costos fijos y variables disminuyen. Palabras clave: Abejas, Productividad, Competitividad.

Recibido: 26/03/2020 Aceptado: 11/09/2020

Introducción En México, la apicultura tiene una gran importancia socioeconómica y ecológica, es considerada como una de las principales actividades pecuarias generadora de divisas(1). Generalmente, esta actividad se asocia únicamente con la producción de miel, polen, jalea real y propóleo; sin embargo, las abejas también son fundamentales para el equilibrio del medio ambiente debido a su colaboración en la polinización. Se estima que, dentro del 90 % de la polinización que ocurre en plantas con flor en todo el mundo, un 67 % es llevado a cabo por insectos, constituyéndose como el grupo de polinizadores más importante, tanto para especies de plantas silvestres como cultivadas(2). De acuerdo con las cifras del sector ganadero, México se ubica entre el quinto y sexto lugar mundial como productor de miel, produjo 62,320 t en 2018(3). El incremento en el valor de las exportaciones para el 2018 con respecto al año anterior fue de 15 %(3) y, en términos de volumen, 60 % superior con relación a las registradas en 2017(1). El estado de Aguascalientes está ubicado en la región del altiplano mexicano. En esta región, debido al clima semiárido, florecen una gran cantidad de arbustos como el mezquite (Prosopis laevigata), y en época de lluvias, se presenta la floración de aceitilla (Bidens spp). En el 2018, Aguascalientes contaba con un inventario de 15,312 colmenas(4). Con base en el Sistema Producto Apícola de Aguascalientes (2018)(5), 230 apicultores dependen de la producción apícola con únicamente dos floraciones al año; aceitilla en noviembre y mezquite en abril. En la zona de estudio, en primavera se cosecha más del 60 % de la miel, proveniente del mezquite (Prosopis laevigata) como fuente de néctar silvestre. Contrario a la región estudiada, en el sureste mexicano la gran diversidad de flores impide analizar su influencia sobre la producción de miel, bajo las condiciones agroclimáticas correspondientes(6). Aguascalientes presenta una ventaja competitiva en la miel por ser de tipo monoflora, significa que posee características relativamente homogéneas(6), lo que se evidencia en la diferencia del precio respecto al promedio nacional(7).

454


Rev Mex Cienc Pecu 2021;12(2):453-468

Sin embargo, aunque se cuenta con una ventaja competitiva, existen factores que han ocasionado que un gran número de apicultores abandonen la actividad o bajen sus niveles de producción. Un primer factor adverso lo constituye la baja precipitación, lo que repercute en una baja actividad de pecoreo y la escasez de alimento(8). Aunado a lo anterior, se presentan bajos precios al productor en el mercado de la miel (existe varianza amplia entre el precio al productor y el consumidor final), una deficiente capacitación técnica de producción, así como un alto costo de los insumos utilizados(9). Otros productos importantes que produce la apicultura de esta zona son el propóleo, jalea real, polen, cera, material biológico, abeja reina y material genético(10). En este panorama, la competitividad de todo sistema o proceso de producción en el mercado interno, se determina por su nivel de rentabilidad. La rentabilidad se estima descontando al valor de la venta de cierta cantidad de producto, los costos en los que se incurrió para obtenerlo(9). En este sentido, es necesario realizar un análisis del costo-beneficio y calcular los precios de equilibrio en la región para los diferentes tipos de apicultores. Por ende, el objetivo del presente trabajo fue estimar la estructura de costos, así como un análisis de flujo desembolsado, financiero y económico(11) de la producción apícola en el estado de Aguascalientes, para determinar el nivel de utilidades unitarias o rentabilidad del sistema. La hipótesis fue que el costo del equipo, herramientas e insumos utilizados en el proceso de producción tienen una relación inversa con la rentabilidad que obtiene el apicultor en esta región.

Material y métodos Ubicación del área El estado de Aguascalientes se ubica en las coordenadas: al norte 22°27'35", al sur 21°37'20" de latitud norte, al este 101°50'07", al oeste 102°52'27" de longitud oeste y colinda al norte, noreste y oeste con Zacatecas y al sureste y sur con Jalisco. Representa el 0.3 % de la superficie del país(12).

Muestreo La muestra se calculó a partir de la población de apicultores que están adheridos al Sistema Producto Apícola del estado de Aguascalientes. Con datos del 2018, el padrón estuvo conformado por 230 apicultores(5). Se levantó información de campo a través de cuestionarios; estos fueron aplicados directamente a los productores de la zona de estudio.

455


Rev Mex Cienc Pecu 2021;12(2):453-468

Los datos presentados provienen de los 11 municipios del estado de Aguascalientes. Se utilizó el criterio de estratificación aportada por Vélez(13) y Fachini(14), donde se clasificó en tres categorías por el número de colmenas: Pequeños (10 a 50), Mediano (51 a 200) y Grande (más de 200). Se empleó la técnica de muestreo estratificado aleatorio. La variable que fue asociada al procedimiento de muestreo para la estimación de la varianza fue el número de colmenas por apicultor y el límite de error fue de 5%. El tamaño de la muestra final se estimó con base en la siguiente fórmula: 𝑁 ∗ 𝑍𝛼2 ∗ 𝑝 ∗ 𝑞 𝒏= 2 𝑑 (𝑁 − 1) + 𝑍𝛼2 ∗ 𝑝 ∗ 𝑞 Donde: n= tamaño final de muestra; Z=1.96 (nivel de confianza); p= proporción esperada (0.05); q= 1-p; N= total de productores (230); d= precisión (0.05). La muestra se conformó por 56 apicultores incluidos en Sistema Producto Apícola estatal. Al primer estrato le correspondió el 11 % (7) de la muestra final, al segundo estrato 40 % (22) y al tercero 49 % (27). La información se procesó mediante una hoja de cálculo de Excel.

Contenido de la encuesta Las preguntas que incluyó el cuestionario se dividieron en los siguientes aspectos: Manejo técnico: 1) nivel de conocimiento de los apicultores sobre las actividades productivas; 2) nivel de conocimiento técnico; 3) control del porcentaje de africanización en la zona; 4) genotipo; 5) frecuencia del cambio de la abeja reina; 6) frecuencia del cambio de colmenas; 7) alimentación de los apiarios; 8) control de enfermedades y plagas; 9) tiempo invertido en la apicultura. Costos: 1) costos de alimentación, 2) plagas y enfermedades, 3) cambio de reina, 4) mano de obra, 5) traslado y 6) otros costos. Producción: 1) número de productores; 2) número de colmenas; 3) producción total; 4) ubicación de las colmenas. Ingresos: 1) precio de la miel y subproductos; 2) producción; 3) venta.

Método Para la descripción y análisis de los aspectos de carácter social relacionados con la producción apícola, se consideraron las siguientes variables: la importancia del factor genético, el manejo técnico y el medio ambiente, la organización para la producción y asistencia técnica. Los elementos considerados para el procesamiento análisis de los coeficientes técnicos fueron: mano de obra, número de apiarios, número de colmenas, implementos alimenticios, control de enfermedades, numero de cosechas, entre otros. Se

456


Rev Mex Cienc Pecu 2021;12(2):453-468

calcularon los costos de la mano de obra y los insumos considerando las siguientes variables: el número de jornales utilizados para las diferentes actividades, los gastos efectuados para comprar azúcar, vitaminas, control de varroa, entre otros. La metodología de análisis de costos fue la utilizada por Sagarnaga et al(11), donde retoma la metodología empleada por el Departamento de Agricultura de los Estados Unidos (USDA), cuya base teórica y metodológica se ajusta a los estándares recomendados por el Grupo de Trabajo sobre Costos y Retornos de la Asociación Americana de Economía Agrícola (AAEA por sus siglas en ingles). Dentro de este contexto, el USDA clasifica los costos en dos tipos: de operación (operating costs) y generales (allocated overhead). La Universidad Estatal de Washington, retoma la clasificación de los costos en fijos y variables y los desagrega en forma de costos económicos, financieros y desembolsados. En los costos financieros se incluyen únicamente los costos fijos y variables; en los costos desembolsados se consideran, además de los costos fijos y variables, el efectivo requerido para pagar el abono a capital de los créditos de largo plazo y para cubrir el gasto familiar del productor. Los costos económicos incluyen los costos financieros y el costo de oportunidad de los factores de la producción(11). Se calcularon los costos de oportunidad: tierra, mano de obra, capital y gestión empresarial. Se utilizó el valor de todos los recursos en el proceso productivo, independientemente si representaban gastos desembolsados o no. Una vez cuantificados los costos de producción se procedió a determinar el precio objetivo para cada uno de los estratos, donde se identificó el precio mínimo para asegurar el cumplimiento de ganancias(15).

Resultados Inversiones en colmenas y equipo Las unidades productivas que conforman la apicultura en México están integradas por las clásicas colmenas estándares. En Aguascalientes, el apicultor conforma la colmena con su soporte (mayormente de ladrillo), piso, cámara de cría tipo langstroth y techo, con 2 alzas. La inversión por cada estrato de productores se muestra en el Cuadro 1. Respecto a la inversión de material en campo, su valor total aumenta conforme el productor aumenta de colmenas; esto debido a que necesita mayor capacidad de instalación (porta-núcleos, cámaras de cría y alzas, principalmente). El segundo y tercer estrato aumenta considerablemente en el rubro de equipo de trabajo, derivado de una mayor capacidad; algunos de los componentes necesarios son el extractor, tanque de sedimentación y banco desoperculador. Para el primer

457


Rev Mex Cienc Pecu 2021;12(2):453-468

estrato, el 80 % de los productores no cuentan con la tecnología necesaria; por lo que optan por rentar estos servicios principalmente en la cosecha. Cuadro 1: Inversión realizada por apicultor ($) Estratos de productores por número de colmenas 1-50 51-200 más de 200 Equipo de trabajo 15,805.6 150,000.0 165,050.0 Material en campo 25,900.0 140,535.0 400,800.0 Total de inversión 41,705.6 290,535.0 565,850.0 Coeficiente de variación (%) 38.9 14.9 19.46 Fuente: Elaboración propia con datos de la encuesta a apicultores, 2018.

La diferencia entre los estratos fue la inversión del equipo de campo, bodega y la calidad de dicho equipo; es decir, un extractor para 80 bastidores tiene un valor casi cinco veces mayor que el de 32 bastidores, o 10 veces más que el de lámina galvanizada. Los altos costos ocasionan que el apicultor del estrato I recurra a la renta del equipo (bodega) para la cosecha.

Estructura de costos A partir de la información recabada de las encuestas, se estimaron los costos de producción, económico, financiero y desembolsado por estrato, de acuerdo al número de colmenas. La estructura porcentual de los costos totales está compuesta en mayor medida por los costos variables. Considerando los costos de oportunidad, el costo variable para el estrato I se compone del 51.9 % (Cuadro 2), para el segundo estrato 54.1% (Cuadro 3) y el tercer estrato 60.2 % (Cuadro 4). Cuadro 2: Estructura de costos de producción ($) del estrato I (1-50 colmenas) Concepto de costos Económico Financiero Desembolsado Costos variables Alimento Medicamentos Mantenimiento Compra de reinas Combustible Total costos variables Costos fijos Renta de terrenos Mano de obra indirecta Mano de obra familiar

12,801.78 182.14 1,000.00 3,295.25 6,988.89 24,268.07

12,801.78 182.14 1,000.00 3,295.25 6,988.89 24,268.07

12,801.78 182.14 1,000.00 3,295.25 6,988.89 24,268.07

-

-

-

458


Rev Mex Cienc Pecu 2021;12(2):453-468

Depreciación de equipos Depreciación de materia de campo Otros costos fijos Total de costos fijos Costos de oportunidad Costo de oportunidad de la tierra (renta) Capital de trabajo Mano de obra del productor/familiar Gestión empresarial Total de costos de oportunidad Costos totales

2,000.00 3,000.00 1,445.00 6,445.00

2,000.00 3,000.00 1,445.00 6,445.00

1,445.00 1,445.00

1,500.00

-

-

4,170.56 5,600.00 4,800.00 16,070.56 46,783.63

30,713.07

25,713.07

Cuadro 3: Estructura de costos de producción ($) del estrato II (51-200 colmenas) Concepto de costos Económico Financiero Desembolsado Costos variables Alimento 40,319.07 40,319.07 40,319.07 Medicamentos 1,008.00 1,008.00 1,008.00 Mantenimiento 1,500.00 1,500.00 1,500.00 Compra de reinas 14,182.08 14,182.08 14,182.08 Combustible 13,640.00 13,640.00 13,640.00 Mano de obra 4,008.18 4,008.18 4,008.18 Total de costos variables 74,657.33 74,657.33 74,657.33 Costos fijos Renta de terrenos 3,000.00 3,000.00 3,000.00 Mano de obra indirecta Mano de obra familiar Depreciación de equipos 7,260.00 7,260.00 Depreciación de materia de campo 4,840.00 4,840.00 Otros costos fijos 2,080.00 2,080.00 2,080.00 Total de costos fijos 17,180.00 17,180.00 5,080.00 Costos de oportunidad Costo de oportunidad de la tierra (renta) 1,500.00 Capital de trabajo 29,053.50 Mano de obra del productor/familiar 8,400.00 Gestión empresarial 7,200.00 Total de costos de oportunidad 46,153.50 Costos totales 137,990.83 91,837.33 79,737.33 Fuente: Elaboración propia con datos de la encuesta a apicultores, 2018.

459


Rev Mex Cienc Pecu 2021;12(2):453-468

Respecto al costo fijo, se encontró que la participación es de 13.8 %, 12.5 % y 15.8 % respectivamente. Siguiendo con los costos fijos, se observó que para el segundo y tercer estrato presenta una relación directa. Esto es, al tener más colmenas, el apicultor opta por adquirir tecnología de mayor capacidad. Por otro lado, se tiene la necesidad de aumentar el número de apiarios, lo que conlleva un mayor costo por renta de los terrenos. Cuadro 4: Estructura de costos de producción ($) del estrato III (más de 200 colmenas) Concepto de costos Económico Financiero Desembolsado Costos variables Alimento 115,475.36 115,475.36 115,475.36 Medicamentos 3,000.00 3,000.00 3,000.00 Mantenimiento 3,600.00 3,600.00 3,600.00 Compra de reinas 38,124.45 38,124.45 38,124.45 Combustible 23,335.00 23,335.00 23,335.00 Mano de obra 9,963.03 9,963.03 9,963.03 Total de costos variables 193,497.84 193,497.84 193,497.84 Costos fijos Renta de terrenos 6,000.00 6,000.00 6,000.00 Mano de obra indirecta 9,963.03 9,963.03 9,963.03 Mano de obra familiar Depreciación de equipos 19,380.00 19,380.00 Depreciación de materia de campo 12,920.00 12,920.00 Otros costos fijos 2,625.00 2,625.00 2,625.00 Total de costos fijos 50,888.03 50,888.03 18,588.03 Costos de oportunidad Costo de oportunidad de la tierra (renta) 3,000.00 Capital de trabajo 51,717.50 Mano de obra del productor/familiar 10,200.00 Gestión empresarial 12,000.00 Total de costos de oportunidad 76,917.50 Costos totales 321,303.37 244,385.87 212,085.87 Fuente: Elaboración propia con datos de la encuesta a apicultores, 2018.

Dentro de los costos variables, el rubro con mayor participación es la alimentación, en el estado de Aguascalientes los apicultores alimentan con azúcar y fructosa. La alimentación es proporcionada cuando no hay floración y es importante para la supervivencia de la abeja; en este sentido, este costo variable tiene un crecimiento progresivo a medida que el productor aumenta el número de colmenas. El segundo rubro con mayor participación es el costo de transporte, el cual básicamente se refiere al gasto en combustible que se utiliza para la realización del manejo técnico en cada apiario. El tercer rubro corresponde a la mano de obra 460


Rev Mex Cienc Pecu 2021;12(2):453-468

para la realización de las actividades apícolas; en temporada de cosecha (marzo-abril) se requiere el mayor número de jornales. En cuanto a los costos fijos, se integran en mayor proporción por el valor de la depreciación de infraestructura en campo, seguido por la depreciación de los equipos de trabajo y protección. En el caso de la depreciación de los equipos de trabajo (extractor, banco desoperculador, tambo de acero inoxidable, etc.), tienen una relación inversa con el número de colmenas. Los costos de oportunidad representan el 34.3 % para el estrato I, 33.4 % para el II y 24.0 % para el estrato III; siendo el costo de capital de trabajo el de mayor aportación. Para el cálculo de costos de oportunidad de la mano de obra del productor, los jornales fueron cotizados en $200 como referencia del precio de un jornal en la región. Los encuestados del primer estrato consideran que para la actividad de sus colmenas requieren 28 jornales al año, el segundo estrato considera que se usan 42 jornales y el tercer estrato 51 jornales. Los apicultores de la región consideran que la tierra tiene un costo de oportunidad de $1,500, en el entendido de que, si estas no son usadas, se pueden rentar a otros apicultores al costo mencionado. Para valorar la gestión empresarial, los productores del estrato I consideraron que trabajan una hora a la semana para administrar los apiarios, el estrato II 3 horas y el estrato III trabaja 5 horas a la semana para la planeación de sus actividades. El estimado del costo financiero por kilogramo de miel producido, es de $45.92, $31.54 y $25.49 respectivamente para cada estrato.

Ingresos y rentabilidad Cuando el apicultor depende mayormente de la actividad apícola, tiene más colmenas; por el contrario, cuando el apicultor posee menos colmenas, tiende a optar por dedicarse a otras actividades que le generen ingreso. Para estimar los ingresos, para el estrato I se consideró un rendimiento promedio de 19.6 kilogramos por colmena a un precio de $ 65, al estrato II le correspondieron 26.4 kilogramos por colmena a un precio de $50.9 y para el estrato III se consideraron 30.2 kilogramos por colmena a un precio de $ 50.45 de acuerdo con los datos de las encuestas.

461


Rev Mex Cienc Pecu 2021;12(2):453-468

Cuadro 5: Porcentaje de aportación al ingreso total Estratos por número de colmenas Concepto 20 a 50 51 a 199 200 o más Aportación económica de la apicultura 9.6 32.5 62.8 miel 97.2 87.0 88.0 cera 1.0 1.6 3.9 polen 0.0 0.0 0.3 núcleos 0.0 3.7 2.4 otros 1.8 7.7 5.5 Total 100.0 100.0 100.0 Fuente: Elaboración propia con datos de la encuesta a apicultores, 2018.

A medida que el apicultor adquiere más colmenas, los ingresos generados en la actividad apícola incrementan su participación en el ingreso total (Cuadro 5). En este sentido, se pudo notar que la miel es el producto principal que se comercializa. En términos financieros es viable en los tres estratos; es decir, se tiene la capacidad de cubrir los costos fijos y variables (Cuadro 6). Por otro lado, en términos económicos, en el estrato I se puede observar que la actividad no es viable, lo que indica que los factores de producción no son remunerados adecuadamente. En el estrato dos y tres, en términos económicos, es viable la actividad ya que remunera costos fijos, costos variables, la mano de obra del productor, el costo de la inversión y la gestión empresarial, así como la depreciación. Cuadro 6: Costos, ingresos y rentabilidad ($)

Estrato I

Estrato II

Estrato III

Costos totales Ingresos totales Utilidad neta Coeficiente de rentabilidad, % Costos totales Ingresos totales Utilidad neta Coeficiente de rentabilidad, % Costos totales Ingresos totales Utilidad neta Coeficiente de rentabilidad, %

Económico Financiero Desembolsado 46,783.63 30,713.07 25,713.07 44,096.67 44,096.67 44,096.67 2,686.96 13,383.60 18,383.60 -5.7 43.6 71.5 137,990.83 91,837.33 79,737.33 148,275.20 148,275.20 148,275.20 10,284.37 56,437.87 68,537.87 7.5 61.5 86.0 321,303.37 244,385.87 212,085.87 483,711.50 483,711.50 483,711.50 162,408.13 239,325.63 271,625.63 50.5 97.9 128.1

Fuente: Elaboración propia con datos de la encuesta a apicultores, 2018.

462


Rev Mex Cienc Pecu 2021;12(2):453-468

Los precios de la miel se diferencian por el tipo de néctar que existe en la región. En este caso, la mayor producción es proveniente de la flor de mezquite(16), que está entre las mejores cotizadas a nivel internacional(17). Se identificó una relación inversa entre el volumen de producción y el precio respectivo, esto debido a que el productor del estrato I vende su producto al mercado local, mientras que los estratos II y III venden al mayoreo a un precio inferior en el mercado nacional e internacional (Cuadro 7). A pesar de que el pequeño apicultor alcanza un precio más alto, obtiene menor rentabilidad debido a factores como son los canales de comercialización, manejo técnico, economía de escala, valor agregado y limitados apoyos gubernamentales.

Estrato I Estrato II Estrato III

Cuadro 7: Mercados de la miel de abeja (%) Local Nacional Internacional 92.78 7.22 0.00 34.50 23.00 43.50 24.38 27.50 47.12 Fuente: Elaboración propia con datos de la encuesta a apicultores, 2018

Precio de equilibrio El punto de equilibrio indica la magnitud de la producción y el precio al que se requiere vender o producir para evitar una perdida (Cuadro 8).

Estrato I Estrato II Estrato III

Cuadro 8: Precios de equilibrio por estrato ($) Económico Financiero Desembolsado 69.95 45.92 38.45 47.39 31.54 27.38 33.51 25.49 22.12 Fuente: Elaboración propia con datos de la encuesta a apicultores, 2018.

En el estrato I, el precio de $69.95, es el necesario para cubrir el costo de todos los recursos, incluyendo la mano de obra familiar de la unidad de producción, gestión empresarial y costos de capital neto invertido. Los precios por arriba de $69.95 generan un retorno al riesgo asumido por el productor; por debajo de esta cantidad implican retorno a la mano de obra del productor, gestión empresarial y retorno al capital neto invertido, menor al que se podría generar en el mejor uso alternativo de los recursos. Siguiendo con el mismo estrato, el precio de equilibrio de $45.92, es el precio necesario para cubrir los costos financieros de acuerdo con los sistemas contables, implica cero retribuciones a la mano de obra del productor. Los precios por debajo del precio de equilibrio implican una disminución de las ganancias retenidas. Un precio de $38.45 cubre los gastos en efectivo del 463


Rev Mex Cienc Pecu 2021;12(2):453-468

proceso productivo. Para el estrato II y III, los precios de equilibrio económico, financiero y desembolsado son más bajos respecto al primer estrato.

Discusión Con base en la información recabada de la zona de estudio, se constata que la necesidad de adquirir los equipos de trabajo (aumento de capacidad del extractor, banco desoperculador, mini-spinner, recuperador de cera, tanque de sedimentación) y el material de campo (alzas, cámaras de cría, porta núcleos, etc.) se incrementa a medida que el apicultor adquiere más colmenas. Así los apicultores del estrato II y III que operan con más de 51 colmenas tienen una producción mayor a una tonelada y media, lo que conlleva a optar por aumentar la capacidad de instalación de maquinaria (acero inoxidable) favoreciendo la inocuidad de los productos. Lo encontrado, concuerda con estudios(18) donde mencionan que el porcentaje de implementos aumenta de forma directa con el número de colmenas. Asimismo, en otra investigación similar, se afirma que el inventario o posesión de equipos complementarios, como extractor, banco desoperculador, embudo, cuchillos, entre otros, presentan un aumento progresivo con el tamaño del apiario(19). Del mismo modo, otros autores(20) llegan a la conclusión que a mayor número de colmenas mayor es su inversión. A medida que los apicultores aumentan sus colmenas, la inversión en material de campo va superando a la inversión en maquinaria. Esto concuerda con lo reportado para el estado de Morelos, México(13), donde se menciona que para el caso de la actividad apícola, las inversiones en maquinaria y equipo son mínimas, por ello las colmenas representan la mayor inversión en términos absolutos. De acuerdo con los resultados de la región de estudio, en el primer estrato, la inversión por colmena fue de $933.33 (coeficiente de variación del 20 %), $819.98 (coeficiente de variación=23.7 %) para el segundo y $768.51 (coeficiente de variación 32 %) para el tercer estrato, con un promedio de $830.60; lo cual es menor a lo que se reportó en las comunidades mayas del litoral centro de Yucatán, donde el promedio general de inversión por colmena fue de 1,201.3 pesos(19). En lo que se refiere a la estructura de los costos, en general para México(9) se estima que los costos de producción de la actividad apícola están compuestos mayormente por el costo variable, con una participación relativa de 67.1 %, mientras que los costos fijos representan una proporción del 32.9 % respecto al costo total. Por otro lado, respecto al costo total, en Yucatán se reportó una contribución del 77.9 % para el costo variable y 22.1 % para el costo fijo(19). Con respecto al desglose de los costos financieros mencionados previamente, el promedio estimado a nivel nacional y estatal fue menor a lo estimado en Aguascalientes. De

464


Rev Mex Cienc Pecu 2021;12(2):453-468

esta manera, en la zona de estudio, para el estrato I el costo variable financiero contribuyó con el 79.0 % respecto al total, para el estrato II fue 81.3 % y para el estrato III le correspondió el 79.2 %. Para el caso específico de los costos variables, el azúcar representó el 53.0 % de los costos variables totales para el primer estrato, 54.4 % para el segundo estrato y 60.0% para el tercer estrato, con un promedio total de 55.8 %. Dichos porcentajes estimados presentan una diferencia significativa comparado con los resultados de otras investigaciones(19) que reportan 38.7 % en promedio. Una probable causa de esta diferencia porcentual, puede ser debido a que los intervalos entre una floración y otra son mas largos en la zona estudiada (dada la condición climática); por lo que el costo de alimentación se incrementa. Por otro lado, para el estado de Nayarit hallaron, a través de un modelo para la generación de costos en empresas apícolas, que los productores con menores colmenas (estrato I) tienen una mayor erogación en el transporte, para el segundo (estrato II) el mayor gasto lo constituye el material de producción y para el tercer estrato es la mano de obra(21). Respecto al caso particular de los costos fijos, la depreciación (depreciación en infraestructura, equipos de protección y equipo) representó el 63.0 % respecto al total de costos fijos. Lo anterior, fue más bajo a lo referido por otros autores(19) donde representó 88.4 % en promedio. Cuando se hace el análisis agregando los costos de oportunidad (análisis económico), existe una disminución en los rubros de costo fijo y costo variable. Cuando la actividad apícola es la principal actividad económica, se manifiesta con la posesión de un tamaño mayor de apiarios, en contraste cuando se tienen pocas colmenas, los apicultores diversifican las actividades económicas(20). Es por ello, que en los estratos II y III del presente trabajo fue mayor el número de productores que depende primordialmente de la apicultura. También se encontró que se tiene una escasa diversificación en la producción de la colmena, el 90.7 % produce sólo miel, siendo ésta su mayor fuente de ingreso. Esto coincide a lo observado en Argentina, que registraron un 82 % en promedio(21), mientras que en algunas regiones de México señalan que es el 99.5 %(19). Los precios de equilibro a nivel financiero estimados (para el primer estrato de $45.92 por kilogramo de miel, $31.54 por kilogramo de miel para el segundo y $ 25.46 para el último) fueron similares a los reportados para algunas regiones de México(22). En Nayarit se encontró que el punto de equilibrio para el apicultor que tiene 100 colmenas es de $14,865.00 por ingresos, $73,715.00 para el que tiene 450 colmenas y $52,642.00 para el apicultor con 600 colmenas(23).

465


Rev Mex Cienc Pecu 2021;12(2):453-468

Conclusiones e implicaciones Se observó que la rentabilidad económica para los pequeños productores es negativa, mientras que para el segundo y tercer estrato son positivos. La rentabilidad positiva de los medianos y grandes productores puede deberse a la escala de producción, ya que disminuyen los costos de los insumos al tener volúmenes de compra altos y precio de venta asegurados. De esta manera, con base en los resultados expuestos, se puede deducir que, en el estado de Aguascalientes, el estrato II y III practican la apicultura a mediana y alta escala; mientras que el estrato I, es una apicultura de baja escala, caracterizado por un manejo tradicional, donde no contemplan los costos administrativos. Para la consolidación de los pequeños productores, se requiere la inversión de capital y tecnología para la formación de la pequeña empresa, con el objetivo de generar mayor producción y poder negociar en el mercado. De acuerdo con los datos analizados, se puede concluir que en la entidad existe un potencial de diversificación de los subproductos de gran demanda en el mercado como la jalea real, propóleo, polen, cera, núcleos de abejas y reinas. Literatura citada: 1. SIAVI. Sistema de Información Comercial Vía Internet. http://www.economiasnci.gob.mx/. Consultado Sep 12, 2019. 2. García GM, Ríos OLA, Álvarez-Castillo J. La polinización en los sistemas de producción agrícola: Revisión sistemática de la literatura. Idesia, 2016;34(3):53–68. 3. SIAP. Sistema de Información Agropecuaria y Pesquera. Produccion Pecuaria. Resumen nacional. https://www.gob.mx/siap/acciones-y-programas/produccion-pecuaria. Consultado 20 Oct, 2019. 4. SIACON-NG. Sistema de Información Agroalimentaria de Consulta. Consultado 20 Oct, 2019. 5. Rodriguez S. Gana miel de aguascalientes primer certificado TIF. NW aguascalientes. (12 de febrero de 2018). Recuperado de https://newsweekespanol.com/2018/02/gana-mielde-aguascalientes-primer-certificado-tif/ 6. Medina CSE, Álvarez JM, Portillo VM, Terrazas GGH. Influencia de los factores ambientales y de manejo en la segunda temporada de producción de miel de abeja en Aguascalientes, México. Rev Esp Estud Agrosoc Pesq 2014;(238):65–80.

466


Rev Mex Cienc Pecu 2021;12(2):453-468

7. Martínez BHA, Hernández AEG. Análisis de brechas tecnológicas e identificación de oportunidades de vinculación con organizaciones y empresas del sector apícola en Aguascalientes.. 1ra ed. (versión electrónica). Aguascalientes, México. Universidad Autónoma de Aguascalientes; 2017. 8. Castellanos PBP, Gallardo LF, Sol SA, Landeros SC, Diaz PG, Sierra FP, Santibañez JL. Impacto potencial del cambio climático en la apicultura. Rev Iberoam Bioecon Cambio Clim 2016;2(1):1-19. 9. Magaña MA, Leyva CE. Costos y rentabilidad del proceso de producción apícola en México. Contad Adm 2011;(235):99–119. 10. Franco VH, Siqueiros ME, Hernández EG. Flora apícola del estado de aguascalientes. 1ra ed. México. Universidad Autónoma de Aguascalientes; 2012. 11. Sagarnaga VLM, Salas GJM, Aguilar AJ. Ingresos y costos de produccion. Unidades representativas de produccion. Trópico humedo y mesa central. Centro de Investigaciones Economicas, Sociales y Tecnologicas de la Agroindustria y la Agricultura mundial (CIESTAAM) 2014;1 (1): 19-47. 12. Instituto Nacional de Estadística y Geografía (México). Anuario estadístico y geográfico de Aguascalientes: INEGI; 2017. 13. Vélez IA, Espinosa GJA, Amaro GR, Arechavaleta VME. Tipología y caracterización de apicultores del Estado de Morelos, México. Rev Mex Cienc Pecu 2016;7(4):507–524. 14. Fachini C, Firetti R, Cardoso-Oliveira E, Assiz-Caravalo A. Perfil da apicultura em Capão Bonito, Estado de São Paulo: aplicação da análise multivariada. Rev Econom Agríc 2010;57(1):51-63. 15. Baca UG. Evaluación de proyectos. 7a ed. México. McGraw-Hill/Interamericana Editores, SA de CV; 2013. 16. Medina CSE, Tirado GDN, Portillo VM, López SMA, Franco OVH. Environmental implications for the production of honey from mesquite (Prosopis laevigata) in semiarid ecosystems. J Apic Res 2018;57(4):507–515. 17. Soto MLE, Elizarra BR, Soto MI. Situación apícola en México y perspectiva de la producción de miel en el Estado de Veracruz. Rev Estrateg Desarro Empresarial 2017;3(7):40–64. 18. Contreras-Uc LC, Magaña MA, Sanginés JR. Características técnicas y socioeconómicas de la apicultura en comunidades mayas del Litoral Centro de Yucatán. Acta Univ 2018;28(1):44–86.

467


Rev Mex Cienc Pecu 2021;12(2):453-468

19. Contreras- Uc LC, Magaña MA. Costos y rentabilidad de la apicultura a pequeña escala en comunidades mayas del Litoral Centro de Yucatán, México. Invest cien 2017;25(71):52-58. 20. Contreras EF, Perez AB, Echazarreta CM, Cavazos AJ, Macias JO, Tapia GJM. Características y situación actual de la apicultura en las regiones Sur y Sureste de Jalisco, Mexico. Rev Mex Cienc Pecu 2013;4(3):387–398. 21. Ulmer J, Travadelo M, Caporgno J, Castignani H. Caracterización de los modelos de producción apícola representativos de la zona central de la provincia de Santa Fé. Cienc Agron 2011;(XVIII):043–049. 22. Dolores MG, Santiago MDJ, Arana CJJ, Utrera QF. Estudio del impacto de la actividad apícola en el Istmo de Tehuantepec, Oaxaca, México. Agric Soc Desarro 2017;14(2):187-203. 23. Ulloa CRR, Anzalo VJE, Martínez VM, Martínez GS, Lenin OJL. Generacion de un modelo para la determinación de costos de empresas productoras de miel en el estado de Nayarit. Rev Mex Agroneg 2014;35(2014):1072–1081.

468


https://doi.org/10.22319/rmcp.v12i2.5811 Artículo

Tipología y caracterización de cunicultores en los Estados del centro de México

Alejandra Vélez Izquierdo a José Antonio Espinosa García a* Francisco Aguilar Romero b

a

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias (INIFAP). Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal. Km 1 Carretera a Colón, Ajuchitlán, 76280.Colón, Querétaro, México. b

INIFAP. Centro Nacional de Investigación Disciplinaria en Salud Animal. Palo Alto, Ciudad de México, México.

*Autor de correspondencia: espinosa.jose@inifap.gob.mx

Resumen: El objetivo fue identificar y caracterizar el tipo de productores de conejos en los estados del centro de México con base a factores sociales, productivos, tecnológicos, económicos y de eficiencia, con el fin de generar información para el diseño de recomendaciones de apoyo a la cunicultura. Se diseñó y aplicó un cuestionario a una muestra de 155 unidades de producción de conejos (UPC) de donde se obtuvo información socioeconómica, productiva, económica, uso de infraestructura y de componentes tecnológicos, de la cual se definieron 14 variables originales, con las que se obtuvo la estratificación de los cunicultores aplicando métodos multivariados. Para la caracterización y comparación de los grupos resultantes se realizó un análisis de varianza bajo un modelo completamente aleatorio para las variables continuas y una prueba de homogeneidad para las variables categóricas. Se detectaron cuatro factores que explican el 67.5 % de la variación total y que por las cargas factoriales de las variables analizadas se llamaron: 1) capacidad productiva de la UPC, 2) capacidad técnica de la UPC, 3) capacidades del cunicultor y 4) eficiencia técnica de la UPC. Se identificaron

469


Rev Mex Cienc Pecu 2021;12(2):469-486

tres tipos de productores; pequeño cunicultor familiar (37 %), mediano cunicultor familiar (50 %) y cunicultor empresarial (13 %). La tipología obtenida puede ser útil para contribuir al diseño de políticas públicas diferenciadas de apoyo a la cunicultura, que incidan en una mayor eficiencia y productividad de unidades de producción de conejos en los estados del centro del país. Palabras clave: Cunicultura, Estratificación, Tecnología pecuaria, Eficiencia técnica.

Recibido: 21/09/2020 Aceptado:03/12/2020

Introducción La producción pecuaria conlleva la crianza de animales para luego ser consumidos o comercializados, como es el caso de la cunicultura, que a través de la cría de conejos (Oryctolagus cunículus) se aprovecha la carne(1), que además posee características nutritivas con potencial para una sociedad que demanda carnes menos grasosas y más proteicas, dado que la carne de conejo es magra, con más proporción de proteínas que otras carnes(2).. Es por ello que en México el gobierno federal y las instituciones académicas han fomentado la cunicultura, creando centros de fomento, distribuyendo paquetes de conejo y promoviendo el consumo de carne(3), lo anterior ha propiciado que la cunicultura se desarrolle en la mayoría de los estados el país, siendo los estados más importantes el de México, Michoacán, Ciudad de México, Puebla e Hidalgo(4). A pesar de ello el conejo es una especie que se explota de forma marginal(5). En México existían en el año 2000, 1’300,000 conejos y una producción de 4,160 t de carne y para el 2018 el inventario de conejos llegó a 1’407,000 y una producción de 4,483 t(6), con una tasa media de crecimiento anual (TMCA) de 0.004 % para el periodo de 2000 al 2018. México ocupa el 13º y 19º lugar mundial en existencia de conejo y producción de conejo respectivamente(6). En cuanto al consumo per cápita de carne de conejo en México, se ha estimado en 100 g(4), mientras que países como Portugal, Francia, España e Italia consumen 2 o más kilogramos por persona. La producción de conejo en México, ofrece ventajas que pueden ser aprovechadas en algunas regiones para afrontar problemas de alimentación que afectan a sectores de la población con escasos recursos económicos(5). No obstante, lo expresado previamente y dado que la cunicultura es una actividad ganadera, su crecimiento depende de las condiciones agroecológicas y de factores sociales, económicos y tecnológicos de los productores, así como de las particularidades de sus sistemas de producción, por lo que es necesario estudiar estos aspectos para entender cómo es que influyen en los procesos

470


Rev Mex Cienc Pecu 2021;12(2):469-486

productivos y, a la vez, generar información que apoye la toma de decisiones que contribuyan al desarrollo de esta actividad. Existe una amplia gama de métodos y técnicas para caracterizar y clasificar los sistemas de producción agrícolas y pecuarios, entre los que sobresalen los multivariados, tales como el análisis de componentes principales, el análisis factorial(7) y el análisis de conglomerados(8), sin embargo, existen pocos estudios sobre la actividad cunícula en México. En un trabajo realizado con cunicultores del estado de Tlaxcala, los autores reportaron el predominio de un sistema extensivo, combinado con características de otros como el semiintensivo y empresarial, y exponen algunas alternativas para mejorar la comercialización de la carne de conejo(9). Se reporta otro estudio de campo, donde se entrevista a consumidores para identificar las preferencias por atributos relacionados con la calidad de carne de conejo; los autores reportan que los atributos más preferidos fueron lo orgánico, la inocuidad, la frescura, y el precio de la carne(10). También se reportan estudios que presentan parámetros productivos de experimentos donde utilizan diferentes dietas proporcionadas a conejos en una granja del estado de Hidalgo(11), y resultados económicos igualmente al utilizar diferentes dietas en una granja del estado de Yucatán(12). En México no se han realizado estudios donde se apliquen métodos multivariados para estudiar la cunicultura, como los realizados para analizar la estructura de los sistemas de producción y tipificar las unidades de producción ovinas de la región templada de los estados de Puebla y Tlaxcala(13); o el realizado para caracterizar sistemas productivos de ganado bovino en la región indígena XIV Tulijá-Tseltal-Chol, Chiapas(14); o para caracterizar los tipos de productores apícolas que existen en el estado de Morelos(15). Por ello, el objetivo de este estudio fue identificar y caracterizar el tipo de productores de conejos en los estados del centro de México con base a factores sociales, productivos, tecnológicos, económicos y de eficiencia, con el fin de generar información para el diseño de recomendaciones de apoyo a la cunicultura.

Material y métodos Área de estudio y fuente de información El estudio se llevó a cabo en nueve estados de México: Ciudad de México, Guanajuato, Hidalgo, Jalisco, Estado de México, Morelos, Puebla, Querétaro y Tlaxcala, que son las entidades de la región centro de México con mayor número de vientres de conejos (3), en los cuales predominan el clima templado y alturas al nivel del mar de más de 1,000 m. Para obtener la información, se diseñó una encuesta que se aplicó a una muestra significativa de cunicultores, integrada por los siguientes apartados: i) datos socioeconómicos del cunicultor y de su unidad de producción de conejos (UPC), integrado por 10 variables que se presentan

471


Rev Mex Cienc Pecu 2021;12(2):469-486

en el Cuadro 1; ii) datos técnicos-productivos de la UPC, integrado por 12 variables que se presentan en el Cuadro 1; iii) instalaciones, equipo, variables de manejo y componentes tecnológicos, integrado por 24 variables que se presentan en el Cuadro 2. El marco muestral fue el Padrón de productores del PROGAN de la SAGARPA (actualmente SADER) del año 2015(16), el tamaño de la muestra se determinó mediante diseño de Muestreo de Proporciones de Varianza Máxima(17): n=

N p(1 - q) æ b ( N - 1)çç è Z1-a

2

ö ÷÷ + p(1 - q) ø

Donde n es el tamaño de muestra; N es la población; Z es el nivel de confianza;  es el nivel Dónde: de precisión; p es la probabilidad que la muestra sea representativa y; q es la probabilidad n = de T amaño de la muestr a de que la muestra no sea representativa, con un nivel de confianza de 90% (Z2= 1.65), un N = T amaño de la población objetivo nivel de precisión de 14%. El tamaño de muestra n estimado fue 155 encuestas, que b = Pr ecisión en por centaje del 10% representan el 15 % de la población. Para la distribución de la muestra, se consideró el Z1-a =V confiabilidad número de unidades de producción en alor cada de estado, el número al de 95% granjas y el total de conejos promedio reportados en el padrón de beneficiarios del PROGRAN en el año 2015, que se presentan en el Cuadro 3. Cuadro 1: Variables socioeconómicas y técnico productivas de los cunicultores de los estados del centro de México Socioeconómicas

Técnico-productivas

Género: masculino y femenino Experiencia (años de ser cunicultor) Edad (años) Escolaridad (años cursados) Número de dependientes económicos Tenencia de la tierra: pequeña propiedad, ejido, comunal. Otras actividades económicas: ninguna, asalariado fijo, eventual, comercio, agropecuaria, independiente. Número de empleos (jornales) Mano de obra familiar (porcentaje)

Número de vientres Número de sementales Número de crías Número de conejos en engorda Número de gazapos por vientre por año Número de gazapos destetados por año Edad al destete (días) Número de conejos muertos por año Número de conejos desechados Número de conejos vendidos por año Superficie destinada a los Conejos (m2) Superficie destinada a la matanza (m2)

Aportación de la cunicultura al ingreso*

* < 50%, > 50% < 100% y única fuente de ingresos.

472


Rev Mex Cienc Pecu 2021;12(2):469-486

Cuadro 2: Variables de instalaciones, equipo, manejo y tecnológicas de los cunicultores en los estados del centro de México Área Variables 1) Cuenta con tapete sanitario: sí=1, no=0; 2) Cuenta con bodega: Instalaciones y sí=1, no=0; 3) Cuenta con bomba de agua: sí=1, no=0; 4) Cuenta equipo con báscula: sí=1, no=0; 5) Cuenta con vehículo: sí=1, no=0 y 6) Cuenta con refrigerador: sí=1, no=0. 1) Usa registros técnicos: sí=1, no=0; 2) Usa registros económicos: sí=1, no=0; 3) Usa lotificación de conejos: 0 no lotifica, 1 por edad Manejo de la granja y sexo, 2 por edad, sexo y etapa productiva; 4) Realiza desecho de vientres improductivas: sí=1, no=0; 5) Realiza manejo de excretas: sí=1, no=0 y 6) Procesa carne: sí=1, no=0. 1) Usa razas puras de conejos: sí=1, no=0; 2) Usa sementales de registro: sí=1, no=0; 3) Realiza evaluación de sementales: sí=1, Reproducción y no=0; 4) Realiza selección de hembras: sí=1, no=0; 4) Realiza Genética selección de sementales: sí=1, no=0; 5) Método reproductivo: 1 Monta libre, 2 Monta controlada y 6) Realiza diagnóstico de gestación: sí=1, no=0. 1) Usa alimento comercial: sí=1, no=0; 2) Prepara alimento en la Alimentación unidad de producción: sí=1, no=0. 1) Realiza desparasitación interna: sí=1, no=0; 2) Realiza Sanidad desparasitación externa: sí=1, no=0. Asesoría técnica 1) Cuenta con asistencia técnica: sí=1, no=0. Uso de instalaciones, equipo y 1) La suma de los datos positivos de las variables de instalaciones, componentes equipo y componentes tecnológicos, con un valor máximo de 26. tecnológicos

473


Rev Mex Cienc Pecu 2021;12(2):469-486

Cuadro 3: Número de unidades de producción, estructura del conejal, superficie promedio y encuestas aplicadas a cunicultores del centro de México CM GTO HGO JAL MEX MOR PUE QRO TLX Granjas 31 11 700 25 180 12 53 21 19 Vientres 30 257 212 59 45 44 66 24 67 Crías 76 13 77 69 80 85 124 34 87 Engorda 72 13 62 69 58 95 67 58 164 Reemplazo 10 1 16 7 7 4 9 5 7 Sementales 5 96 17 8 7 4 6 3 9 Total 192 380 384 212 196 334 272 233 123 2 Superficie, m 0.03 4.27 0.66 2.4 9.54 0.42 6.79 2.58 4.57 Encuestas 20 11 32 18 25 9 20 12 8 Fuente: Elaboración Propia con datos de Beneficiarios del PROGAN 2015 (16). CM= Ciudad de México; GTO= Guanajuato; HGO= Hidalgo; JAL= Jalisco; MEX= Estado de México; MOR= Morelos; PUE= Puebla; QRO= Querétaro; TLX= Tlaxcala.

Análisis de la información

Se realizó un análisis exploratorio con las estadísticas básicas y correlación de las 46 variables consideradas para el estudio. Para estratificar a los cunicultores se realizó un análisis multivariado utilizando un análisis factorial por componentes principales y conglomerados jerárquicos. Para realizar el primer análisis se seleccionaron las 20 variables cuantitativas con correlación significativa (P<0.05); además de aplicar los criterios de calidad, disponibilidad y relevancia, propuestos en otros estudios(18,19). Los componentes principales con valores propios mayores que 1 se rotaron por el método Varimax, para reducir el número de variables, mediante la construcción de factores que expliquen la mayor varianza en el análisis global(18,20). El análisis de conglomerados jerárquico, se utilizó para identificar el número de grupos de cunicultores de forma gráfica, basado en el algoritmo de Ward(21,22) y la distancia euclidiana al cuadrado(21,23) para identificar el punto de corte en el dendograma (Figura 1). Las variables utilizadas fueron los factores obtenidos en el análisis factorial por componentes principales y se estandarizaron con la media y desviación estándar. Los análisis estadísticos se realizaron con el programa estadístico JMP® 9.0 (SAS Institute). Para la caracterización y comparación de los grupos de cunicultores resultantes se calcularon las medias y desviaciones estándar para las variables cuantitativas y se realizó un análisis de varianza bajo un modelo completamente aleatorio para detectar diferencias entre grupos, mientras que para las variables cualitativas se calcularon las frecuencias, y se realizó una prueba de homogeneidad con objeto de identificar diferencias entre los grupos de cunicultores(19). 474


Rev Mex Cienc Pecu 2021;12(2):469-486

Resultados Tipología de cunicultores de los estados del centro de México Con base a la matriz de correlaciones de las 46 variables mencionadas en los Cuadros 1 y 2, se seleccionaron las 20 variables cuantitativas que tuvieron las correlaciones más altas y con ellas se llevó a cabo el análisis multivariado. A partir del análisis factorial se extrajeron cuatro factores, que presentaron valores propios mayores a 1, explican el 67.5 % de la variación total de las variables originales. La carga factorial que cada variable tiene en el factor extraído con valores superiores al 0.50, permitieron identificar las variables asociadas a dicho factor, y con ello asignarle una interpretación empírica y darle un nombre físico. El Factor 1 tiene una correlación elevada con las variables: número de vientres, conejos vendidos, sementales, gazapos destetados, animales muertos y superficie destinada para su producción (Cuadro 4), por ello se le llamó capacidad productiva de la unidad de producción de conejos; es importante señalar que esta nueva variable explica el 29.3 % de la varianza de las 14 variables, por lo tanto el Factor 1 es el que más influye en el análisis y como consecuencia el que mejor explica las diferencias entre los distintos grupos de cunicultores y su escala de producción. El Factor 2 presenta una alta correlación con el uso de instalaciones, de equipo y de innovaciones tecnológicas, así como del personal de labora en la granja y la superficie destinada a la matanza de conejos (Cuadro 4), por lo tanto, se le llamó capacidad técnica de unidad de producción de conejos y este factor explica el 14.7 % de la varianza. El Factor 3 presenta una alta correlación con las características sociales del cunicultor, como edad, escolaridad y años de experiencia en la producción de conejos, lo que permite definir la habilidad para producir de la unidad de producción, por lo tanto, se le nombro capacidades del cunicultor; este factor explica el 11.6 % de varianza. Finalmente, el Factor 4 presenta una alta correlación con el número de gazapos producidos por vientre por año, que valora la productividad de la granja, por ello se le llamó eficiencia técnica de la unidad de producción de conejos y explica el 10.6 % de la variación.

475


Rev Mex Cienc Pecu 2021;12(2):469-486

Cuadro 4: Cargas factoriales de las variables que componen los factores definidos para los cunicultores de los estados del Centro de México Variable Número de vientres Número de conejos vendidos/año Número de sementales Número de gazapos destetados/año Número de animales muertos/año Superficie destinada a los conejos Uso de instalaciones, equipo y componentes tecnológicos Total de personal que labora en la UP Escolaridad Superficie destinada a la matanza Edad del cunicultor Años de experiencia en la cunicultura Número de gazapos por vientre/año Porcentaje mano de obra familiar Varianza explicada (%)

Factor 1 0.916667 0.83149 0.816544 0.799396 0.71444 0.642098

Factor 2 0.206498 0.228365 0.167483 0.258606 -0.046216 0.181289

Factor 3 0.035692 -0.041729 0.075937 -0.062843 0.105208 -0.008589

Factor 4 -0.032912 0.462372 -0.145468 0.462191 0.287652 -0.087412

0.343973 -0.159698 0.171105 0.23495 0.023885 0.141377 0.089981 -0.298046 29.3

0.682402 0.670922 0.44837 0.513992 -0.074193 0.256117 0.098896 0.60223 14.7

-0.013021 0.062029 0.605979 -0.125401 0.831125 0.69565 -0.05581 -0.176492 12.9

-0.048417 0.219434 -0.072184 0.119383 -0.084211 -0.003725 0.927394 0.040382 10.6

Los valores en negritas son las cargas factoriales de las variables que integran cada factor.

La información de los factores mencionados previamente se integró al análisis de conglomerados para identificar los grupos de cunicultores mediante el análisis jerárquico. Se identificaron tres tipos de cunicultores de forma gráfica (Figura 1). El número de cunicultores que integran cada grupo son G1=57 (37 %), G2=78 (50 %) y G3=20 (13 %). Figura 1: Dendograma de cunicultores de los estados del centro de México

Para asignarle un nombre a cada grupo se tomó como referencia el tamaño del inventario de la unidad de producción, el porcentaje de mano de obra familiar utilizado en la granja y el uso de instalaciones, equipo y componentes tecnológicos (Cuadro 5). El grupo 1 lo integran productores con un promedio de 24 vientres, el 91.5 % del personal que trabaja son 476


Rev Mex Cienc Pecu 2021;12(2):469-486

familiares, usan el 60 % de las 24 variables referidas a instalaciones, equipo y componentes tecnológicos, por ello, este grupo está compuesto por pequeños cunicultores familiares (G1) con nivel tecnológico medio, el grupo 2 lo integran productores que cuentan en promedio con 52 vientres, el 87 % es mano de obra familiar y usan el 67 % de instalaciones, equipo y componentes tecnológicos, por ello lo conforman medianos cunicultores familiares (G2) y el grupo 3 lo integran productores con 55 vientres, contratan el 40 % del personal que trabaja en la granja y usan el 88 % de las instalaciones, equipo y componentes tecnológicos (de los 22 presentados en el Cuadro 2) por ello son cunicultores empresariales (G3). Cuadro 5: Media  error estándar de las variables utilizadas para la caracterización de los cunicultores de los estados del centro de México Pequeño Mediano Cunicultor cunicultor cunicultor Factores Variables empresarial familiar familiar (G3) (G1) (G2) Número de vientres 24.0±4.1b 51.5±3.5a 54.9±28.9a Número de conejos 664.7±145c 1541.7±124b 2949.2±245a vendidos/año Número de sementales 1. Capacidad productiva

Número gazapos destetados/año Número de animales muertos Superficie destinada a los conejos Uso de instalaciones, equipo y componentes tecnológicos Total de personal que 2. Capacidad labora técnica Superficie destinada a la matanza Porcentaje mano de obra familiar Escolaridad 3.Capacidades del Edad cunicultor Años de ser cunicultor Número de gazapos por 4. Eficiencia técnica vientre/año ab

2.7±0.5b

6.1±0.4a

6.1±0.9a

571.3±132c 1,353.1±113b 2,596.8±223a 93.4±23.8b 188.5±20.3a

252.4±40.1a

55.3±11.8b 124.3±10.1a

108.4±19.9ab

13.1±0.6b

14.8±0.5b

19.4±0.9a

1.5±0.1b

1.28±0.1b

3.3±0.2a

1.1±1.1b

4.09±1.0ab

8.8±1.9a

91.5±4.1a

86.5±3.6a

62.1±7.0b

9.1±3.7b 54.3±9.5a 9.3±0.8a

13.4±0.4a 39.3 ±11.3c 6.2±0.7b

13.9±0.8a 46.5 ±13.5b 12.0±1.5a

29.5±1.7b

30.36±1.4b

52.0±2.8a

Literales distintas indican diferencias en base a un ANOVA y la prueba de Tuckey (P0.05).

477


Rev Mex Cienc Pecu 2021;12(2):469-486

Caracterización por tipo de cunicultor Una vez definidos los tipos de cunicultores, se procedió a caracterizarlos con base a los factores definidos previamente, para identificar las particularidades de cada tipo de unidad de producción cunícula, como se ha realizado en otros sistemas de producción(15,18,19). De las seis variables que integran el Factor 1 Capacidad productiva de la UP de conejos, en dos de ellas se presentan diferencias estadísticas (P<0.01) entre los tres tipos de productores, y en las cuatro variables restantes, al menos uno de los grupos es diferente de los otros dos (P<0.05) (Cuadro 5). Al analizar las variables de inventario de vientres y sementales, así como la superficie destinada a la producción de conejos, se observa que los productores del grupo G1 presentan los promedios más bajos; estos datos guardan una relación directa con la escala productiva de la unidad de producción de conejos, situación que se refleja en el promedio de conejos destetados y vendidos. Se encontraron diferencias entre los tres grupos para número de gazapos destetados por año (F=31.7; gl=2, 152; P<0.01), el valor promedio del grupo G3 fue significativamente superior al valor de G2 (P<0.05), con una diferencia de 1,243 gazapos y el valor de este grupo, igual significativamente superior al promedio del G1 (P<0.05), con un valor superior de 782 conejos (Cuadro 5). Se encontraron diferencias entre grupos para el número de animales muertos (F=7.5; gl=2, 152; P<0.01), el valor promedio de los grupos G2 y G3 fue significativamente superior al del grupo G1 (P<0.05). Mismo comportamiento para la variable superficie destinada a los conejos, con diferencias entre grupos (F=10.8; gl=2, 152; P<0.01), la cantidad de metros cuadrados que tienen los cunicultores de los grupos G2 y G3 fue significativamente superior a la superficie que tienen los del grupo G1 (P<0.05). Se encontraron diferencias significativas entre grupos para número de vientres (F=15.1; gl=2, 152; P<0.01), el valor promedio de los grupos G2 y G3 fue significativamente superior al del grupo G1 (P<0.05) (Cuadro 5), el promedio de vientres que tiene los cunicultores de los grupos G2 y G3 es el doble de los del grupo G1. Se encontraron diferencias significativas entre los tres grupos para el número de conejos vendidos por año (F=30.8; gl=2, 152; P<0.01), el valor promedio del grupo G3 fue significativamente superior al valor de G2 (P<0.05), con una diferencia de 1,308 conejos y el valor de este grupo, igual significativamente superior al promedio del G1 (P<0.05), con un valor superior a 877 conejos (Cuadro 5). Para la variable de número de sementales, también se encontraron diferencias significativas entre grupos (F=13.1; gl=2, 152; P<0.01), con un comportamiento similar al de vientres, donde el valor promedio de los grupos G2 y G3 fue significativamente superior al del grupo G1 (P<0.05) (Cuadro 5). Para el Factor 2 Capacidad técnica de la unidad de producción de conejos, se encontraron diferencias entre grupos de productores en el uso de instalaciones, equipo y tecnología

478


Rev Mex Cienc Pecu 2021;12(2):469-486

(F=16.5; gl=2, 152; P<0.01), el valor promedio del grupo G3 fue significativamente superior al de los grupos G1 y G2 (P<0.05) y no se encontraron diferencias entre estos dos grupos (P<0.05) (Cuadro 5). Al analizar las instalaciones y el equipo que integran esta variable, se encontró que dos de los seis conceptos analizados no se comportan de forma homogénea entre los grupos, respecto a contar con tapete sanitario lo tiene el 70 % de los productores del grupo G3, de los cunicultores de grupo G2 el 31 % los usa y los del grupo G1 apenas el 17.5 % (Xi2=19.1; n=155; P<0.01); igualmente pasa con los que tienen bodega para almacenar sus insumos, el 60 % de los cunicultores del Grupo G3 cuentan con esta instalación, en cambio los del G1 y G2 menos del 26 % la tienen (Xi2=14.5; n=155; P<0.01) (Figura 2). Figura 2: Uso de instalaciones, equipo y componentes tecnológicos por cunicultores de los estados del Centro de México

* Indica diferencia estadística Prob > Ji cuadrada 0.05. ** Indica diferencia estadística Prob > Ji cuadrada 0.01.

Al analizar los componentes tecnológicos que usan los cunicultores que integran la variable, se encontró que 8 de los 18 actividades analizados no se comportan de forma homogénea entre los grupos, estos componentes fueron: registros económicos con un porcentaje de 65, 42 y 26 % para el G3·, G2 y G1 respectivamente (Xi2=9.9; n=155; P<0.01); lotificación de los conejos, con un porcentaje de 95, 74 y 65 % para el G3, G2 y G1 respectivamente (Xi2=21.4; n=155; P<0.01); uso de razas puras, con un porcentaje de 85, 68 y 56 % para el G3, G2 y G1 respectivamente (Xi2=5.8; n=155; P<0.05); uso de sementales de registro, con 479


Rev Mex Cienc Pecu 2021;12(2):469-486

un porcentaje de 40, 26 y 9 % para el G3, G2 y G1 respectivamente (Xi2=10.4; n=155; P<0.01); evaluación de sementales, con un porcentaje de 45, 36 y 14 % para el G3, G2 y G1 respectivamente (Xi2=10.5; n=155; P<0.01); realizar desparasitación interna, con un porcentaje de 70, 54 y 39 % para el G3, G2 y G1 respectivamente (Xi2=7.3; n=155; P<0.02); realizar desparasitación externa, con un porcentaje de 90, 64 y 53 % para el G3, G2 y G1 respectivamente (Xi2=8.9; n=155; P<0.01); finalmente los productores que reciben asesoría técnica son el 60, el 38 y el 26 % de los G3, G2 y G1 respectivamente (Xi2=7.4; n=155; P<0.02) (Figura 2). También se encontraron diferencias entre grupos de productores en la variable total de personal que labora en la granja (F=43; gl=2, 152; P<0.01), el valor promedio del grupo G3 fue significativamente superior al de los grupos G1 y G2 (P<0.05) y no se encontraron diferencias entre estos dos grupos (P<0.05) (Cuadro 5). Respecto a la variable superficie destinada a la matanza se encontró diferencias entre los tres grupos (F=6.2; gl=2, 152; P<0.01), siendo significativamente mayor la superficie de los productores del G3 respecto al G2 (P<0.05) y superior la superficie de este grupo respecto al G1 (P<0.05). En cuanto al porcentaje de mano de obra familiar utilizada en la granja, se encontró diferencia (F=6.6; gl=2, 152; P<0.01), el valor promedio del grupo G3 fue significativamente menor al de los grupos G1 y G2 (P<0.05) y no se encontraron diferencias entre estos dos grupos (P<0.05) (Cuadro 5). En el caso del Factor 3 Capacidades del cunicultor se encontraron diferencias entre grupos de productores para las variables que componen el factor: respecto a la escolaridad del cunicultor se encontró diferencia (F=25.5; gl=2, 152; P<0.01), el valor promedio del grupo G1 fue significativamente menor al de los grupos G2 y G3 (P<0.05) y no se encontraron diferencias entre estos dos grupos (P>0.05) (Cuadro 5). En cuanto a la edad del cunicultor se encontró diferencia (F=30.7; gl=2, 152; P<0.01), siendo la edad de los productores del grupo G1 significativamente mayor al de los del grupo G3 (P<0.05) y estos a su vez son mayores a los del G2 (P<0.05) (Cuadro 5), escolaridad y años de ser cunicultor. Respecto a los años de ser cunicultor, se encontró diferencia (F=7.7; gl=2, 152; P<0.01), el valor promedio del grupo G2 fue significativamente menor al de los grupos G1 y G3 (P<0.05) y no se encontraron diferencias entre estos dos grupos. El Factor 4 Eficiencia técnica de la unidad de producción de conejos, solo la integra una variable, producción de gazapos por vientre por año, se encontraron diferencias entre grupos (F=26.3; gl=2, 152; P>0.01), el valor promedio del grupo G3 fue significativamente mayor al de G1 y G2 (P<0.05) y no se encontraron diferencias entre estos dos grupos.

480


Rev Mex Cienc Pecu 2021;12(2):469-486

Discusión Los cuatro factores que se obtuvieron a partir del análisis factorial y que fueron identificados como 1) Capacidad productiva de la unidad de producción de conejos, 2) Capacidad técnica de la unidad de producción de conejos, 3) Capacidades del cunicultor y 4) Eficiencia técnica de la unidad de producción de conejos explican el 67.5 % de la variación existente entre las unidades de producción incluidas en el estudio. Este valor es considerado como aceptable tomando en cuenta que para el caso de las ciencias sociales es posible considerar soluciones que representen un 60 % de la varianza total(24) y similar al reportado en Argentina, de 68 % al tipificar productores agropecuarios(25), por lo que los resultados presentados se pueden considerar confiables para la inferencia. La clasificación de los productores en tres categorías: pequeños cunicultores familiares, medianos cunicultores familiares y cunicultores empresariales, con base a la participación de la familia en las actividades de la granja y su tamaño, es pertinente con base en la clasificación que se hace, al considerar dos formas de organización social de la producción, agricultura campesina y agricultura empresarial, que asocia entre otras características el origen de la fuerza de trabajo familiar y asalariada para las dos formas respectivamente(26), clasificación apropiada para actividades agropecuarias emergentes como es el caso de la cunicultura en México. Sin embargo, esta clasificación difiere de la reportada para cunicultores del estado de Tlaxcala, que menciona que existen tres sistemas de producción; traspatio o extensivo, semiintensivo e intensivo o empresarial, donde predomina un sistema de producción extensivo de conejos(9), donde no es considerada la mano de obra familiar como factor de clasificación. Al analizar las características de las variables que integran el Factor 1 Capacidad productiva de la unidad de producción de conejos, tres de las variables están relacionadas con el tamaño de la unidad de producción y las otras tres restantes con la producción misma de conejos, si bien estas variables no han sido estudiadas previamente para analizar la producción de conejos, hay estudios que mencionan que la capacidad productiva de una unidad de producción pecuaria está determinada principalmente por el tamaño de la unidad de producción, traducido en inventarios(27), como maquinaria, equipo, construcciones y vientres. En el caso particular de la actividad cunícula este inventario lo constituye principalmente los vientres y sementales, por lo tanto, la cantidad de carne de conejo producida depende del número de vientres con que cuenten los cunicultores, como se reporta en otras especies pecuarias, que mencionan que el tamaño de la unidad de producción es un factor que impacta en la producción como el realizado con productores de bovinos de doble propósito en el trópico de México(27), o el realizado en apicultura en Suiza(28), en donde el tamaño de la unidad de producción medido en número de colonias fue el factor que más afecta la producción de miel.

481


Rev Mex Cienc Pecu 2021;12(2):469-486

Otro factor que afecta la producción de una actividad económica son las actividades y componentes tecnológicos que se incorporen a la unidad de producción(29), para el caso de la cunicultura estas innovaciones pueden ser en instalaciones, equipo o componentes tecnológicos, siendo estos últimos los que han sido evaluados por sus efectos en la producción de conejos. Se ha estudiado la lotificación de los conejos, conformando camadas de hasta 8 gazapos agrupándolos por edad, logrando con ello reducir la mortalidad(30), estos resultados han sido reconocidos por los cunicultores de los estados del Centro de México, como se puede observar en el porcentaje de uso de lotificación en los tres grupo de productores (Figura 2), igualmente hay coincidencia en el uso de registros técnicos que para los productores del estado Tlaxcala fue de 74 %(9), y con los cunicultores del centro de México la mayoría los realiza. De las practicas tecnológicas que más se han evaluado en la producción de conejos son las que tienen que ver con las áreas de nutrición y reproducción; se ha estudiado el uso de alimento comercial solo y con dietas que se agregan al forraje local en la engorda de conejos, no se ha encontrando diferencia significativa en los parámetros productivos(11,31), por ello igualmente en este estudio la mayoría de los productores usan alimento comercial en sus dietas, situación que también se reporta para los productores de conejos del estado de Tlaxcala, que indica que la base de la alimentación de los conejos es el alimento comercial(9). Los productores del grupo G3, usan razas puras, aunque hay un margen tecnológico porque aún no usan sementales de registro ni evaluación de sementales, principalmente los cunicultores del grupo G1, situación que coincide con las practicas reportadas para los cunicultores del estado de Tlaxcala donde sólo el 9.5 % hace selección de vientres(9). No se ubicaron estudios que cuantifiquen la presencia de enfermedades y plagas en las granjas de conejos, solo reportan presencia de virus(10), aunque sí se menciona que los problemas más frecuentes son neumonías, sarna y enteritis, y por ello es que se aplican medidas preventivas, realizando la desparasitación externa el 76.2 % de los productores de Tlaxcala(9), dato que coincide con lo reportado por los cunicultores del centro de México, principalmente los del grupo G3, muestra que es una práctica que tienen incorporada a su proceso productivo. El cunicultor y su familia son el capital humano de la unidad de producción de conejos, y es considerado como un factor propiciador de desarrollo y crecimiento económico. Los promedios para las variables que conforman el Factor 3 Capacidades del cunicultor fueron diferentes para los tres grupos. El promedio de edad que presentaron los cunicultores de los tres grupos corresponde a la etapa adulta, la que además de estar influyendo en el uso y la adopción de innovaciones, también es un factor importante a considerar en la gestión administrativa y técnica de la unidad de producción(15). El nivel de escolaridad de los cunicultores de los grupos G2 y G3 es de educación media superior (13 años) y el nivel de los cunicultores del G1 es de educación de secundaria (9 años), resultados que coinciden con 482


Rev Mex Cienc Pecu 2021;12(2):469-486

lo reportado en otros estudios(15), pero difiere de la situación nacional que indica que el 78.5 % de la población rural no ha realizado estudios, tiene primaria incompleta o solo concluyó la primaria(32), situación que favorece el desarrollo de actividades orientadas a fortalecer el desarrollo de capacidades en los tres grupos de cunicultores. La experiencia en la actividad representada por los años como cunicultor, fue mayor en el grupo G3 con 12 años en promedio, seguida por el grupo G1 con 9 años y por los cunicultores del G2 con 6 años en promedio, llama la atención que los productores del grupo G2 son los más jóvenes, con menos años de ser cunicultores y más años de estudio cursados, lo cual muestra que la cunicultura es vista como una actividad con potencial(3,4), si bien no se ubicaron estudios que muestren la importancia de las variables sociales como la edad, la escolaridad o la experiencia en el uso de innovaciones y en la productividad de la cunicultura, hay que considerar que diversos autores reportan(8,15,18) la importancia que tienen estas variables, como elementos que favorecen o impiden el uso de innovaciones. Las variables relacionadas con el Factor 4 Eficiencia técnica de la unidad de producción de conejos, muestra el resultado tanto de la capacidad productiva como de la capacidad técnica, los resultados reportados en este estudio para los productores de los grupos G1 y G2 están por debajo de los promedios reportados para los sistemas de producción de conejos de zonas templadas(33), que indican como mínimo 36 gazapos por vientre por año, es por ello que la cunicultura analizada representa una oportunidad de mejora si se incorporan más componentes tecnológicos, como el diagnóstico de gestación, el uso de sementales de registro, evaluación de sementales, lotificación e implementación de registros económicos.

Conclusiones e implicaciones Se identificaron tres tipos de cunicultores en los estados del centro de México: pequeños cunicultores familiares (37 %), medianos cunicultores familiares (50 %) y cunicultores empresariales (13 %), siendo los factores relevantes para su estratificación y caracterización: la capacidad productiva, la capacidad técnica y la eficiencia técnica de la unidad de producción; así como la capacidad del cunicultor. Los pequeños cunicultores familiares se diferencian de los otros dos grupos por contar con menor capacidad productiva, dado que el número de vientres es en promedio la mitad de lo que poseen los otros grupos; sin embargo, su capacidad y eficiencia técnica, es similar a los medianos cunicultores familiares, siendo la de ambos menor a la de los cunicultores empresariales. Igualmente, predomina el porcentaje de mano de obra familiar empleada en la unidad de producción en los dos primeros grupos. Los resultados obtenidos permitirán proponer recomendaciones orientadas a fomentar la mejora de la capacidad productiva y el desarrollo de capacidades de los pequeños cunicultores familiares del Centro de México.

483


Rev Mex Cienc Pecu 2021;12(2):469-486

Literatura citada: 1. Arrechedora I. Actividades pecuarias: Producción y actividades en México. https://www.lifeder.com/actividades-pecuarias/. Consultado 14 Sep, 2020. 2. Savino L. La carne de conejo, una buena opción para adquirir hábitos alimenticios saludables. Suena a Campo. Disponible: http://suenaacampo.com/2019/10/05/. Consultado 14 Sep, 2020. 3. SAGARPA-SENASICA. Manual de buenas prácticas de producción de carne de conejo. 1ª ed. Ciudad de México. 2015. 4. Comité Sistema Producto Cunícula. Plan rector sistema producto cunícola del Distrito Federal, actualizado a 2012. Ciudad de México. 5. Jaramillo VJL, Vargas LS, Guerrero RJ de D. Preferencias de consumidores y disponibilidad a pagar por atributos de calidad en carne de conejo orgánico. Rev Mex Cienc Pecu 2015;6(1):221-232. 6. FAOSTAT. Ganadería. Organización de las Naciones Unidas para la Alimentación y la Agricultura. Disponible: http://www.fao.org/faostat/es/#data/QC. Consultado 10 Sep, 2020. 7. Duvernoy I. Use of a land cover model to identify farm types in the Misiones agrarian frontier (Argentina). Agric Syst 2000;64(3):137-149. 8. Köbrich C, Rehman T, Khan M. Typification of farming systems for constructing representative farm models: two illustrations of the application of multivariate analyses in Chile and Pakistan. Agric Syst 2003;(76):141-157. 9. Olivares PR, Gómez CMA, Schwentesius RR, Carrera ChB. Alternativas a la producción y mercadeo para la carne de conejo en Tlaxcala, México. Región y Sociedad 2009;21(46):191-207. 10. Reynoso UE, Bautista GLG, Martínez CJS, Romero NC, García RVG, Aguado AGL, et al. Análisis de la presencia de Rotavirus en conejos del Estado de México. Rev Mex Cienc Pecu 2019;10(2):511-521. 11. Pérez MK, García VS, Soto SS, Zepeda BA, Ayala MM. Parámetros productivos de conejos alimentados con diferentes partes de la planta Tithonia tubaeformis. Abanico Veterinario 2018;8(2):108-114. 12. Peniche RJA, Rejón ÁMJ, Valencia HER, Pech MVC. Análisis de rentabilidad de dos alternativas de alimentación no convencionales en la producción de conejos en el municipio de Tixpehual, Yucatán, México. Rev Mex Agroneg 2010;XIV(27):411-418.

484


Rev Mex Cienc Pecu 2021;12(2):469-486

13. Vázquez MI, Jaramillo VJ, Bustamante GA, Vargas LS, Calderón SF, Torres HG, Pittroff, W. Estructura y tipología de las unidades de producción ovinas en el centro de México. ASyD 2018;(15):85-97. 14. Velázquez AJA, Raúl Perezgrovas GR. Caracterización de sistemas productivos de ganado bovino en la región indígena XIV Tulijá-Tseltal-Chol, Chiapas, México. Agrociencia 2017;(51):285-297. 15. Vélez IA, Espinosa GJA, Amaro GR, Arechavaleta VME. Tipología y caracterización de apicultores del estado de Morelos, México. Rev Mex Cienc Pecu 2016;7(4):507-524. 16.

SAGARPA. PROGRAN Productivo de SAGARPA, https://datos.gob.mx/busca/dataset/. Consultado 14 Mar, 2016.

datos

2015.

17. Infante GS, Zarate de LGP. Métodos estadísticos: un enfoque interdisciplinario. Colegio de Postgraduados. Mundi-Prensa España. 1990. 18. Fachini C, Firetti R, Cardoso DeOE, Assiz DeCA. Perfil da apicultura em Capão Bonito, estado de São Paulo: aplicação da análise multivariada. Rev Econom Agr 2010;57(1):49-60. 19. Gelasakis AI, Valergakis GE, Arsenos G, Banos G. Description and typology of intensive Chios dairy sheep farms in Greece. J Dairy Sci 2012;95(6):3070-3079. 20. Castaldo A, Acero R, Perea J, Martos J, Valerio D, Pami J, et al. Tipología de los sistemas de producción de engorde bovino en la Pampa Argentina. Arch Zootec 2006;55(210):183-193. 21. García CH, Calle LM. Consideraciones metodológicas para la tipificación de sistemas de producción bovina a partir de fuentes secundarias. Rev Corpoica 2013;2(2):6-15. 22. Hair JF. Multivariate data analysis. 7th ed. Upper Saddle River, NJ, USA: Pearson Prentice Hall; 2009. 23. Cuevas RV, Loaiza MA, Espinosa GJA, Vélez IA, Montoya FMD. Tipología de las explotaciones ganaderas de bovinos doble propósito en Sinaloa, México. Rev Mex Cienc Pecu 2016;7(1):69-83. 24. Valerio D, García A, Acero R, Castaldo A, Perea J, Martos J. Metodología para la caracterización y tipificación de sistemas ganaderos. Documentos de Trabajo Producción Animal y Gestión. Córdoba (España): Universidad de Córdoba. http://www.uco.es/zootecnia-ygestion/img/pictorex/14_19_10_sistemas2.pdf , Consultado 20 Ago, 2020.

485


Rev Mex Cienc Pecu 2021;12(2):469-486

25. Coronel DeRM, Ortuño PS. Tipificación de los sistemas productivos agropecuarios en el área de riego de Santiago del Estero, Argentina. Problemas del desarrollo. Rev Latinoam Econom 2005;36(140):63-88. 26. Schejtman A. Economía campesina: lógica interna, articulación y persistencia. Rev de la Cepal 1980;11(8):121-141. 27. Rangel RJ, Espinosa GJA, de Pablos C, Rivas J, Perea J, Angón E, García MA. Is the increase of scale in the tropics a pathway to smallholders? Dimension and ecological zone effect on the mixed crop-livestock farms. Spanish J Agr Res 2017;15(2):1-22. 28. Masuko MB. Socioeconomic analysis of beekeeping in Swaziland: A case study of the Manzini Region, Swaziland. J Develop Agr Econom 2013;5(6):236-241. 29. Kalenatic D, González L, López CA, Arias LH. El sistema de gestión tecnológica como parte del sistema logístico en la era del conocimiento. Cuadernos de administración 2009;22(39):257-286. 30. González RP, Negretti P, Finzi A. Adopción de gazapos a diferentes tamaños de camada en un sistema alternativo de producción de conejos. Agrociencia 2010;44(3):275-282. 31. Bonilla VCE, Delgado ALA, Mora LRE, Herrera AAM. Efecto de niveles crecientes de follaje de Arachis pintoi en dietas para conejos sobre el desempeño zootécnico en fase de crecimiento-engorde. Rev Científica FCV-LUZ 2016; XXVI(1):41-48. 32. FAO-SAGARPA. Diagnóstico del sector rural y pesquero de México 2012. Disponible: https://www.agricultura.gob.mx/sites/default/files/sagarpa/document/2019/01/28/1608/ 01022019-1-diagnostico-del-sector-rural-y-pesquero.pdf. Consultado 27 Nov, 2020. 33. Cruz BLE, Ramírez VS, Vázquez GM del C, Zapata CCC. Reproducción de conejos bajo condiciones tropicales, efectos negativos y posibles soluciones. Ciencia UAT 2018; 13(1):135-145.

486


https://doi.org/10.22319/rmcp.v12i2.5542 Artículo

Supervivencia intracelular de cepas de Mycobacterium bovis de alta y baja frecuencia probado en un modelo de macrófagos bovinos

Alejandro Nava-Vargas a Feliciano Milián-Suazo b Germinal Jorge Cantó-Alarcón b José A. Gutiérrez-Pabello c*

a

Universidad Autónoma de Querétaro. Facultad de Ciencias Naturales, Doctorado en Ciencias Biológicas, Querétaro, México.

b

Universidad Autónoma de Querétaro. Facultad de Ciencias Naturales, Querétaro, México.

c

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Ciudad Universitaria, Av. Universidad #3000, Colonia, C.U., Coyoacán, 04510, Ciudad de México, México.

* Autor de correspondencia: jagp@unam.mx

Resumen: Causada por Mycobacterium bovis, la tuberculosis bovina es una enfermedad que afecta al ganado y a otras especies, incluidos los humanos. M. bovis reside principalmente en macrófagos, por lo que la supervivencia de los bacilos dentro de los macrófagos está relacionada con la virulencia. El aislamiento y la identificación de cepas son importantes para el control de las enfermedades causadas por M. bovis. Se sabe poco sobre la virulencia de las cepas de M. bovis circulantes en las poblaciones de ganado. En este estudio se comparó la supervivencia intracelular de cepas de M. bovis de genotipos que se encuentran en altas y bajas frecuencias en los bovinos en México. Se identificaron cuatro genotipos de alta frecuencia y cuatro de baja frecuencia a las cuales se sometieron a ensayos de supervivencia intracelular en macrófagos bovinos. La proporción de

487


Rev Mex Cienc Pecu 2021;12(2):487-502

fagocitosis fue de aproximadamente 63% para todas las cepas. No hubo diferencias entre los grupos de alta y baja frecuencia en cuanto al promedio de las unidades formadoras de colonias (UFC) en fagocitosis y supervivencia. Sin embargo, el promedio de UFC de fagocitosis sí difirió de UFC de supervivencia en ambos grupos. El crecimiento intracelular fue diferente entre las cepas de baja y alta frecuencia, pero también entre las cepas de baja frecuencia. El promedio de crecimiento intracelular no fue diferente entre las cepas de alta y baja frecuencia. Estos resultados sugieren que la supervivencia intracelular y la virulencia de las cepas de M. bovis evaluadas no están relacionadas con la frecuencia de los genotipos en una población bovina. Palabras clave: Mycobacterium bovis, Tuberculosis bovina, Macrófagos.

Recibido: 19/10/2019 Aceptado: 11/08/2020

Introducción La tuberculosis bovina (TBb) es una enfermedad bacteriana crónica causada por Mycobacterium bovis, bacteria obligada patógena intracelular y de crecimiento lento, que se caracteriza por producir granulomas en diferentes órganos, especialmente en los pulmones y los ganglios linfáticos de diferentes especies animales y de los humanos(1-4). En el ganado bovino, la formación de granulomas (es decir, tubérculos) puede ocurrir en cualquier tejido corporal, aunque las lesiones son más frecuentes en los ganglios linfáticos [retrofaríngea medial (29.4 %), mediastínica (28.2 %), traqueobronquial (18.0 %), mesentérica (2.9 %), parótida (2.4 %) y caudal cervical (2.4 %)], y menos frecuentes en los pulmones (8.0 %)(5-9). La enfermedad provoca una reducción de alrededor del 10 al 20 % en la producción de leche y carne, lo cual limita la venta de los animales infectados y sus productos. Por lo tanto, el control de la tuberculosis bovina es una prioridad de la industria ganadera nacional para asegurar el potencial productivo del ganado y permitir la exportación de sus derivados(10,11). Como en muchos países del mundo, México tiene un programa nacional de control y erradicación de la tuberculosis bovina. En bovinos de carne este programa ha reducido la prevalencia a <0.5 % en el 85 % del territorio nacional; sin embargo, en las áreas de ganado lechero el programa no ha logrado un control adecuado y la prevalencia es alta (~16 %)(12,13). El papel de la variabilidad genética bacteriana en el resultado de la infección con M. bovis sigue siendo incierto. Hasta principios de la década de 1990, cuando se introdujeron las huellas de ADN, se creía que el complejo M. tuberculosis era un grupo de bacterias 488


Rev Mex Cienc Pecu 2021;12(2):487-502

altamente conservadas genéticamente, con diferencias fenotípicas limitadas que influían en la patogénesis. Sin embargo, los datos epidemiológicos sugieren que las diferencias en la transmisibilidad y la virulencia entre cepas están relacionadas con sus genotipos(14-18). Mycobacterium bovis es un patógeno intracelular que reside principalmente en los macrófagos. Por lo tanto, se pueden utilizar modelos de macrófagos in vitro para determinar la supervivencia intracelular, que a su vez se asocia con la virulencia de las cepas de M. bovis. Por ejemplo, en un estudio se encontró que las cepas virulentas sobreviven más que las cepas avirulentas en macrófagos bovinos(19). El modelo in vitro también ha sido validado para la evaluación de la patogenicidad o virulencia de micobacterias con genes inactivados o para la identificación de genes asociados con la virulencia(20). Algunos bovinos manifiestan una resistencia natural a la TBb. El criterio aplicado para clasificar un animal como resistente se basa en la capacidad de sus macrófagos para permitir el crecimiento de la cepa avirulenta de M. bovis BCG (Bacilo Calmette-Guérin) in vitro; cuando este crecimiento es superior al 65 % se considera el animal susceptible y cuando es inferior al 65 % se considera resistente(21). En el mismo estudio se demostró que, en comparación con animales susceptibles, los macrófagos de animales resistentes controlaron mejor el crecimiento intracelular de los patógenos B. abortus y Salmonella dublin. Los macrófagos de animales resistentes y susceptibles difieren en su capacidad de control la multiplicación intracelular de M. bovis(19). Por lo tanto, el uso de la evaluación in vitro de la supervivencia intracelular bacteriana en macrófagos de un donante resistente pueda proveer información sobre la virulencia bacteriana. La genotipificación de M. bovis para el análisis filogenético se ha realizado mediante diferentes métodos: polimorfismos de longitud de fragmentos de restricción (RFLP); amplificación aleatoria de ADN polimórfico - reacción en cadena de la polimerasa (RAPD-PCR); espoligotipado; y unidades repetitivas micobacterianas intercaladas número variable de repeticiones en tándem (MIRU-VNTR). Entre estos métodos se ha identificado gran diversidad de cepas, con genotipos de baja y alta frecuencia(22-24). El método aleatorio de RAPD-PCR proporciona resultados comparables a los del RFLP, pero evita el uso de materiales radiactivos peligrosos, es menos costoso y más fácil y rápido de realizar. Por ejemplo, mientras que RFLP puede requerir semanas para obtener resultados, RAPD-PCR se puede completar en <5 a 8 h. En comparación con PCR dirigida, RAPD-PCR no requiere el conocimiento de la secuencia constante para desarrollar cebadores. Los oligómeros monocatenarios de 10 nucleótidos de secuencia arbitraria se utilizan individualmente para realizar PCR(25). Con el advenimiento de la epidemiología molecular se han desarrollado métodos más rápidos y confiables para el diagnóstico de TBb. Estos brindan información sobre la estructura genética que permita establecer las relaciones entre cepas. El método más popular para el genotipado de M. bovis es el espoligotipado y ha resultado útil en un gran número de estudios con una amplia gama de objetivos y especies animales. En comparación con otros métodos, el 489


Rev Mex Cienc Pecu 2021;12(2):487-502

espoligotipado es fácil de realizar, requiere cantidades muy pequeñas de ADN, es robusto y altamente reproducible, y puede realizarse con muestras clínicas. Más aún, el espoligotipado es muy útil en cepas de M. bovis con algunas copias del elemento de inserción IS6110, como es el caso en cepas de ganado(22). El MIRU-VNTR es una herramienta molecular basada en la amplificación por PCR de 41 loci diferentes de la secuencia de ADN de Mycobacterium que funcionan como marcadores moleculares. Este herramienta permita dar seguimiento rápido, objetivo y de alta resolución en brotes o emergencias epidemiológicas(23). En un estudio previo realizado por nuestro grupo sobre la genotipificación de cepas de M. bovis de ganado de diferentes regiones de México se identificó la presencia de genotipos (espoligotipo y MIRU-VNTR) de alta y baja frecuencia(22,23,26). Estos hallazgos llevaron a plantear las siguientes preguntas: ¿Son las cepas de baja frecuencia menos virulentas que las de alta frecuencia? Y si es así, ¿es esta la razón de la baja frecuencia de algunos espoligotipos en la población? El objetivo de este estudio fue comparar la supervivencia intracelular de cepas de M. bovis que tienen genotipos de alta o baja frecuencia en bovinos mexicanos usando un modelo de macrófagos procedente de ganado con una resistencia natural a esta bacteria.

Material y métodos Este proyecto se aprobó por el Comité de Bioética del Departamento de Ciencias Naturales de la Universidad Autónoma de Querétaro con el número de registro 47FCN2016.

Caracterización molecular de cepas Se utilizaron cepas de M. bovis, previamente caracterizadas genéticamente por espoligotipado y MIRU-VNTR(19,22). Para los propósitos de este estudio, se seleccionaron cuatro cepas con un genotipo de alta frecuencia y cuatro con un genotipo de baja frecuencia de un conjunto de cepas obtenidas de bovinos en diferentes regiones de México (Cuadro 1). Primero se seleccionaron los espoligotipos de alta frecuencia y posteriormente se identificaron sus tipos de MIRU-VNTR más frecuentes.

490


Rev Mex Cienc Pecu 2021;12(2):487-502

Cuadro 1: Frecuencia de espoligotipo y VNTR-tipo de las cepas de M. bovis utilizadas Código SB SB0673 SB0971 SB0669 SB0140 SB1495 SB1118 SB0290 SB0131

VNTR 023404625334 433363325242 002060703320 242352524244 403403625133 452300824234 403363525142 252252323224

en el estudio Estado de origen ID Coahuila 777 Aguascalientes 833 Estado de México 351 Hidalgo 559 Coahuila 776 Estado de México 694 Querétaro 301 Hidalgo 906

Frecuencia 155 70 124 71 1 1 1 1

Alta frecuencia

Baja frecuencia

Preparación del inóculo Las cepas experimentales de M. bovis se replicaron en medio Middlebrook 7H9 (BBL™, Middlebrook 7H9 Broth Base, Becton; Dickinson Mycrobiology Systems, Cockeysville, MD, EE. UU.) con enriquecimiento OADC y 0.5 g/L de Tween 80 (Sigma Chemical Co., St. Louis, MO, EE. UU.). Se incubaron las cepas a 37 °C bajo agitación constante durante 12 días. Para el análisis, las bacterias se conservaron en alícuotas de 1 ml en medio RPMI (Medio RPMI 1640, Invitrogen™ Co., Grand Island, NY, EE. UU.), suplementado con 0.1 mM de aminoácidos esenciales, 1 mM de piruvato de sodio, 2 mM de L-glutamina, 20 mM de bicarbonato de sodio NaHCO3 (cRPMI), y 15% de suero bovino fetal (Gibco™ Invitrogen Co., Grand Island, NY, EE. UU.) a -70 °C. Para cada inóculo bacteriano, se cuantificaron las unidades formadoras de colonias (UFC) mediante diluciones decuples en serie sembradas en placas de agar Middlebrook 7H10 (Bacto® Mycobacteria 7H11 Agar, Difco Laboratories, Detroit MI, EE.UU.) con enriquecimiento OADC (BBL™ Middlebrook OADC Enrichment, Becton, Dickinson and Company, Sparks, MD, EE.UU.).

Macrófagos derivados de monocitos bovinos (MDMB) Con jeringas conteniendo solución ácido-citrato-dextrosa (ACD), se extrajo sangre venosa periférica de la vena yugular de un bovino sano previamente identificado como resistente(27). Los macrófagos se obtuvieron a partir de células mononucleares de sangre periférica (CMSP). Las CMSP se aislaron mediante centrifugación en gradiente en una suspensión Histopaque -1077 (Sigma-Aldrich, San Luis, MO, EE. UU.). Los sedimentos celulares se lavaron y suspendieron en CRPMI. Las células se cultivaron en placas de ultrabaja adherencia (Corning® Costar®, EE. UU.) a 37 °C con 5% de CO2. Después de 2

491


Rev Mex Cienc Pecu 2021;12(2):487-502

h, se eliminaron las células no adherentes y los monocitos adherentes se cultivaron en CRPMI más 12% de suero autólogo durante 12 días para permitir su diferenciación en macrófagos(28,29).

Ensayo microbicida Los ensayos bactericidas se realizaron según un protocolo establecido(21), con algunas modificaciones. Estos ensayos han sido útiles para la clasificación de fenotipos de ganado susceptible o resistente utilizando la cepa avirulenta M. bovis BCG y un punto de corte de 65 % de la replicación bacteriana. Se infectaron monocapas de macrófagos en cultivo celular en placas Terasaki con M. bovis con una multiplicidad de infección (MOI) de 10:1. Posteriormente, se centrifugó a 200 xg durante 10 min y se incubó a 37 °C con CO2 al 5% durante 4 h en atmósfera humidificada para permitir la fagocitosis. A continuación, las células se lavaron cinco veces con CRPMI reciente, más un 12% de suero autólogo para eliminar las bacterias extracelulares, y se incubaron de nuevo a 37 ºC. Se consideró este momento del cultivo como tiempo 0 h. Las células se lisaron para su análisis a 0 y 24 h (tiempo 1) después de la infección. La fagocitosis bacteriana se calculó midiendo las diluciones en serie de bacterias intracelulares vivas liberadas de los macrófagos después del tratamiento con Tween 20 al 0.5%. El crecimiento bacteriano se calculó como la relación entre el número total de bacterias intracelulares al final y el número total de bacterias al comienzo del ensayo, expresado como una proporción. Los resultados son el promedio de tres experimentos independientes, cada uno con tres repeticiones internas. Los análisis estadísticos se realizaron con la prueba no paramétrica de Friedman y la prueba de comparaciones múltiples de Dunn con un nivel de significancia de 10 %, y la prueba t de Student para comparar los UFC con un nivel de significancia 5 %.

Resultados La proporción de fagocitosis fue de alrededor del 63 % para todas las cepas, lo que indica que los macrófagos fagocitaron un número similar de bacterias en cada cepa. Se contaron las unidades formadoras de colonias (UFC) en los ensayos bactericidas que mostraron permisividad de los macrófagos para la replicación de cepas de campo con genotipos de baja frecuencia y mayor UFC/ml en el tiempo de supervivencia (tiempo 1). En la cepa BCG durante el tiempo 1, la cantidad de UFC disminuyó en comparación con el tiempo de fagocitosis (tiempo 0). El mismo escenario se observó con la cepa de genotipo de alta frecuencia en que la cantidad de UFC/ml fue mayor, mientras que en BCG, la cantidad de UFC/ml disminuyó (Figura 1).

492


Rev Mex Cienc Pecu 2021;12(2):487-502

Figura 1: Unidades formadoras de colonias (UFC) de cepas de M. bovis con genotipos de alta (+) y baja (-) frecuencia, cuantificadas a las 0 (T0) y 24 (T1) horas después de la infección de macrófagos de bovinos con un fenotipo resistente

Se realizó una comparación del promedio de UFC por grupo utilizando la prueba t de Student. No se encontraron diferencias (P>0.05) entre los grupos de alta y baja frecuencia ni en fagocitosis (T0) y ni en supervivencia (T1) (Figura 2). Dentro de cada grupo se realizó un análisis estadístico utilizando la prueba t de Student pareada para comparar el promedio de UFC entre la fagocitosis y la supervivencia, en lo cual sí hubo diferencias (P<0.05) (Figura 3). Figura 2: Comparación de los promedios de UFC de cepas de alta y baja frecuencia en el tiempo 0 y en el tiempo 1

493


Rev Mex Cienc Pecu 2021;12(2):487-502

Figura 3: Comparación de los promedios de UFC en el tiempo 0 y el tiempo 1 en cepas de alta y baja frecuencia

El análisis estadístico se realizó utilizando la prueba t de Student para datos apareados. Los asteriscos indican diferencia (P<0.05) entre los tiempos.

En el ensayo de crecimiento intracelular en cepas del genotipo de baja frecuencia, la cepa 906 fue la que presentó la mayor supervivencia (214 %), mientras que la cepa 776 tuvo la más bajo (153 %). El crecimiento intracelular en la cepa 694 fue de (205 %) y el crecimiento en la 301 fue de (172 %) (Figura 4). En los grupos de alta frecuencia, la cepa 777 tuvo el mayor crecimiento (208 %), mientras que el menor correspondió a la 833 (169 %). El crecimiento en la 351 fue de 207 % y el crecimiento de la 559 fue de (187 %). La cepa control (BCG) mostró un crecimiento del 57 %, lo cual valida el ensayo porque confirma la resistencia del fenotipo bovino resistente. Figura 4: Crecimiento intracelular de cepas de M. bovis de baja y alta frecuencia y M. bovis avirulento (BCG) en macrófagos de bovinos con fenotipo resistente

Los asteriscos indican diferencia (P<0.1) según una prueba no paramétrica de comparaciones múltiples de Dunn

494


Rev Mex Cienc Pecu 2021;12(2):487-502

En las comparaciones del crecimiento intracelular entre cepas individuales se observó una diferencia (P<0.01) entre la cepa de baja frecuencia 776 y la cepa de alta frecuencia 351. La cepa 776 (SB1495) se colectó de un bovino del estado de Coahuila, mientras que la cepa 351 (SB0669) correspondió a un bovino del Estado de México. Hubo diferencias (P<0.01) entre las cepas de baja frecuencia 776 (SB1495) y 694 (SB1118), y entre la cepa de BCG atenuada y las cepas de campo analizadas (P<0.01) (Figura 4). No hubo diferencia (P>0.05) en la comparación de los promedios de incremento intracelular entre las cepas de alta frecuencia y las de baja frecuencia (Figura 5). Figura 5: Comparación de los promedios de crecimiento intracelular de cepas de alta y baja frecuencia. Análisis estadístico mediante la prueba no paramétrica de Wilcoxon.

Discusión Se ha demostrado que el genotipo de las micobacterias es uno de los factores que contribuyen a la gravedad de la enfermedad y que puede desempeñar un papel en la aparición

de

farmacorresistencia,

susceptibilidad,

respuesta

del

huésped

y

transmisibilidad. Sin embargo, se desconocen los factores genéticos que determinan la asociación de diferentes linajes micobacterianos con diferentes niveles de gravedad de la enfermedad(30,31). La alta frecuencia de ciertos genotipos de cepas puede ser indicativo del movimiento de ganado infectado en ausencia de adecuadas medidas de control sanitario. Por otro lado, la baja frecuencia de algunos genotipos puede deberse a la falta de representatividad en el muestreo; es decir, el número de aislamientos analizados es

495


Rev Mex Cienc Pecu 2021;12(2):487-502

más bien una consecuencia de su disponibilidad debido a una baja prevalencia en la región. Este sugiere que la escasa o nula presencia de ciertos genotipos en algunas regiones sea más una consecuencia de la pequeña cantidad de aislamientos aportados y no de una ausencia real(22). En los resultados del presente estudio, la proporción de fagocitosis no fue diferente entre las cepas evaluadas; sin embargo, sí se encontraron diferencias estadísticas entre las cepas de campo y la cepa BCG atenuada de M. bovis. La BCG mostró menor supervivencia (65 %) que las de campo, lo cual confirma que los macrófagos usados en los ensayos provenían de un bovino con fenotipo resistente y que las cepas de campo eran más virulentas que la BCG. Estos resultados coindicen con estudios anteriores(21). Los resultados de un estudio sobre el Brucella abortus sugirieron que las diferencias en la adhesión bacteriana a células entre el ganado resistente y el susceptible podría estar relacionada con los componentes de la pared celular en este bacteria, lo cual tiene mecanismos distintos a M. bovis para evadir la respuesta inmune y la eliminación por macrófagos(28). En otro estudio(19), se realizaron ensayos bactericidas utilizando una cepa de campo y encontraron resultados similares a los del presente estudio en cuanto a la diferencia de supervivencia con respecto a la cepa BCG atenuada, con un crecimiento del 165 % en macrófagos de bovinos resistentes. Los macrófagos que se obtuvieron de bovinos con genotipo resistente produjeron una mayor cantidad de óxido nítrico (NO) en comparación con los macrófagos de bovinos susceptibles. En bovinos, el NO juega un papel importante en la eliminación de patógenos intracelulares por macrófagos(27,29). El M. bovis virulento tiene varias formas de evadir los mecanismos bactericidas del sistema inmunológico innato. Uno de los mecanismos más conocidos e importantes es el “estallido respiratorio” para la eliminación de bacterias fagocitadas, aunque M. bovis tiene la capacidad de evadirlo(32). Además, M. bovis puede evade la eliminación al interrumpir la maduración de los fagosomas, impidiendo su fusión con los lisosomas, y también parece inhibir la presentación de antígenos al reducir la expresión de moléculas MHC II(33,34). En los resultados del presente estudio se encontraron diferencias estadísticas entre tres de las ocho cepas de campo, entre los grupos de frecuencias altas y bajas, y dentro del mismo grupo de frecuencia baja. Esto sugiere que las cepas evaluadas difieran en cuanto a sus virulencias, y que la frecuencia del genotipo en el ganado no está relacionada con la virulencia de la cepa, cuando se evalúa con la metodología aplicado en este estudio. Una limitación en el presente estudio fue que el número de cepas evaluadas no alcanzó la

496


Rev Mex Cienc Pecu 2021;12(2):487-502

representatividad. En un estudio previo se intentó asociar los espoligotipos con la virulencia en bovinos por medio de relacionar el espoligotipo con el número de lesiones y el grado de lesión en la canal(30). Los resultados mostraron que los espoligotipos SB0273 y SB0520 tenían alta virulencia y baja frecuencia. Otro intento a relacionar la virulencia con diferentes genotipos usó un modelo de tuberculosis pulmonar progresiva en ratones, y encontró que los genotipos de animales salvajes eran más virulentos que los aislados de humanos o ganado(36); sin embargo, se propone que el M. bovis es muy virulento en el modelo de ratón(35,36). En los rebaños de Irlanda del Norte, se han identificado diferencias en el genotipo de patógenos por el tamaño del brote y la proporción de casos con lesiones visibles en la canal. Estos resultados sugieren que los genotipos de M. bovis, aunque están estrechamente relacionados, pueden variar en términos de transmisibilidad. Los genotipos demuestran diferencias en el grado en causan lesiones visibles, en sus patrones de respuesta inmune y en sus niveles de virulencia. Sin embargo, los factores genéticos que determinan la asociación de diferentes genotipos de micobacterias con diferentes grados de gravedad de la enfermedad siguen siendo en gran parte desconocidos. En M. tuberculosis se ha encontrado que entre sus seis genotipos principales existe una variación en inmunogenicidad, virulencia y patología, y que hay evidencia de una coevolución huésped-patógeno en las regiones donde se establecen estos genotipos(37). La gran diversidad genética de las cepas del complejo M. tuberculosis (CMTB) sustenta un importante escenario natural, donde estas cepas (particularmente M. bovis) se han diversificado. Este es un interesante contexto epidemiológico y evolutivo en el que pueden surgir nuevos genotipos que luego se diversifican para adaptarse mejor al huésped bajo una variedad de factores ambientales y antropogénicos(38). En los países de alta incidencia, la aparición de una cepa exitosa en cuanto a su epidemiología se ha atribuido a la virulencia debido a las características codificadas en el genoma bacteriano; sin embargo, estas características están relacionadas con genes distintos del genotipado(39). Esto se debe a que estos métodos de genotipificación cubren solo una pequeña parte de los aproximadamente 4,000 genes contenidos en los 4.4 Mb del genoma micobacteriano y no están directamente relacionados con la virulencia(40).

497


Rev Mex Cienc Pecu 2021;12(2):487-502

Conclusiones e implicaciones Los resultados de este estudio contribuyen a la comprensión de la interacción huéspedpatógeno. Las bacterias intracelulares intentan sobrevivir al ambiente hostil presentado por la respuesta inmune donde uno de los efectores principales es el macrófago. Estos resultados ayudan a validar el ensayo microbicida como una herramienta para evaluar, en cierta medida, la virulencia de patógenos bacterianos de vida intracelular, además de sugerir que los genotipos de las bacterias no están directamente relacionados con la virulencia. Agradecimientos La investigación de lo cual forma parte este artículo fue financiada por el Programa de Apoyos a Proyectos de Investigación e Innovación Tecnológica (PAPIIT-UNAM) (Proyecto AG-200918). Conflictos de interés Los autores declaran que no tienen conflicto de interés. Literatura citada: 1. Pollock JM, Neill SD. Mycobacterium bovis infection and tuberculosis in cattle. Vet J Lond Engl 2002;163(2):115–127. 2. Gibson AL, Hewinson G, Goodchild T, Watt B, Story A, Inwald J, et al. Molecular epidemiology of disease due to Mycobacterium bovis in humans in the United Kingdom. J Clin Microbiol 2004;42(1):431–434. 3. Lari N, Rindi L, Bonanni D, Tortoli E, Garzelli C. Molecular analysis of clinical isolates of Mycobacterium bovis recovered from humans in Italy. J Clin Microbiol 2006;44(11):4218–4221. 4. Romero B, Aranaz A, de Juan L, Alvarez J, Bezos J, Mateos A, et al. Molecular epidemiology of multidrug-resistant Mycobacterium bovis isolates with the same spoligotyping profile as isolates from animals. J Clin Microbiol 2006;44(9):3405– 3408. 5. Palmer MV, Waters WR, Thacker TC. Lesion development and immunohistochemical changes in granulomas from cattle experimentally infected with Mycobacterium bovis. Vet Pathol 2007;44(6):863–874.

498


Rev Mex Cienc Pecu 2021;12(2):487-502

6. García-Jiménez WL, Salguero FJ, Fernández-Llario P, Martínez R, Risco D, Gough J, et al. Immunopathology of granulomas produced by Mycobacterium bovis in naturally infected wild boar. Vet Immunol Immunopathol 2013;156(1–2):54–63. 7. Corner L, Melville L, McCubbin K, Small KJ, McCormick BS, Wood PR, et al. Efficiency of inspection procedures for the detection of tuberculous lesions in cattle. Aust Vet J 1990;67(11):389–392. 8. Domingo M, Vidal E, Marco A. Pathology of bovine tuberculosis. Res Vet Sci 2014;97 Suppl:S20-29. 9. Carrisoza-Urbina J, Morales-Salinas E, Bedolla-Alva MA, Hernández-Pando R, Gutiérrez-Pabello JA. Atypical granuloma formation in Mycobacterium bovisinfected calves. PloS One 2019;14(7):e0218547. 10. Bennett RM, Cooke RJ. Costs to farmers of a tuberculosis breakdown. Vet Rec 2006;158:429–432. 11. Boland F, Kelly GE, Good M, More SJ. Bovine tuberculosis and milk production in infected dairy herds in Ireland Prev Vet Med 2010;93(2–3):153–161. 12. Milián-Suazo F. Tuberculosis bovina en México: las bases. Primera ed. Ajuchitlan, Qro.: INIFAP. 2013. 13. González-Ruiz S, Sosa-Gallegos SL, Rodríguez-Hernández E, Flores-Villalva S, Román-Ponce SI, Bárcenas-Reyes I, et al. Genetic diversity of Mycobacterium bovis in Jalisco, Mexico: Tracing back sources of infection. J Vet Med Anim Health 2018;10(5):114–122. 14. Valway SE, Sanchez MP, Shinnick TF, Orme I, Agerton T, Hoy D, et al. An outbreak involving extensive transmission of a virulent strain of Mycobacterium tuberculosis. N Engl J Med 1998;338(10):633–639. 15. Caminero JA, Pena MJ, Campos-Herrero MI, Rodríguez JC, García I, Cabrera P, et al. Epidemiological evidence of the spread of a Mycobacterium tuberculosis strain of the Beijing genotype on Gran Canaria Island. Am J Respir Crit Care Med 2001;164(7):1165–1170. 16. López B, Aguilar D, Orozco H, Burger M, Espitia C, Ritacco V, et al. A marked difference in pathogenesis and immune response induced by different Mycobacterium tuberculosis genotypes. Clin Exp Immunol 2003;133(1):30–37. 17. Milián-Suazo F, Garcia-Casanova L, Robbe-Austerman S, Canto-Alarcón GJ, Bárcenas-Reyes I, Stuber T, et al. Molecular relationship between strains of M. bovis from Mexico and those from countries with free trade of cattle with Mexico. PloS One 2016;11(5):e0155207.

499


Rev Mex Cienc Pecu 2021;12(2):487-502

18. Zumárraga MJ, Arriaga C, Barandiaran S, Cobos-Marín L, de Waard J, EstradaGarcia I, et al. Understanding the relationship between Mycobacterium bovis spoligotypes from cattle in Latin American countries. Res Vet Sci 2013;94(1):9–21. 19. Gutiérrez-Pabello JA, Adams LG. Sobrevivencia de Mycobacterium bovis en macrófagos de bovinos naturalmente resistentes y susceptibles a patógenos intracelulares. Vet México 2003;34(3):277–281. 20. Forrellad MA, Klepp LI, Gioffré A, Sabio y García J, Morbidoni HR, de la Paz Santangelo M, et al. Virulence factors of the Mycobacterium tuberculosis complex. Virulence 2013;4(1):3–66. 21. Qureshi T, Templeton JW, Adams LG. Intracellular survival of Brucella abortus, Mycobacterium bovis BCG, Salmonella dublin, and Salmonella typhimurium in macrophages from cattle genetically resistant to Brucella abortus. Vet Immunol Immunopathol 1996;50(1–2):55–65. 22. Milián Suazo F, García Casanova L, Romero Torres C, Cantó Alarcón GJ, Gutiérrez RJA, et al. Diversidad genética y distribución regional de cepas de Mycobacterium bovis del ganado en México. Rev Mex Cienc Pecu 2012;3(4):459–471. 23. Nava Vargas A, Milián Suazo F, Cantó Alarcón GJ, Rubio Venegas Y, Guerrero Solorio R, Rodríguez Hernández E, etal. Genetic diversity based on MIRU-VNTR profile of isolates of Mycobacterium bovis from Mexican cattle. Prev Vet Med 2016;131:75–78. 24. Perea Razo CA, Rodríguez Hernández E, Ponce SIR, Milián Suazo F, RobbeAusterman S, Stuber T, et al. Molecular epidemiology of cattle tuberculosis in Mexico through whole-genome sequencing and spoligotyping. PLoS ONE 2018;13(8). 25. Milián-Suazo F, Salman MD, Black WC, Triantis JM, Ramírez CP, Payeur JB, et al. Molecular epidemiologic analysis of Mycobacterium bovis isolates from Mexico. Am J Vet Res 2000;61(1):90–95. 26. Gutiérrez Reyes JA, García Casanova L, Romero Torres C, Sosa Gallegos SL, Cantó Alarcón GJ, Mercado Pezzat M, etal. Population structure of Mycobacterium bovis isolates from cattle in Mexico. Prev Vet Med 2012;106(1):1–8. 27. Esquivel-Solís H, Vallecillo AJ, Benítez-Guzmán A, Adams LG, López-Vidal Y, Gutiérrez-Pabello JA. Nitric oxide not apoptosis mediates differential killing of Mycobacterium bovis in bovine macrophages. PloS One 2013;8(5):e63464. 28. Campbell GA, Adams LG. The long-term culture of bovine monocyte-derived macrophages and their use in the study of intracellular proliferation of Brucella abortus. Vet Immunol Immunopathol 1992;34(3–4):291–305.

500


Rev Mex Cienc Pecu 2021;12(2):487-502

29. Castillo-Velázquez U, Aranday-Cortés E, Gutiérrez-Pabello JA. Alternative activation modifies macrophage resistance to Mycobacterium bovis. Vet Microbiol 2011;151(1–2):51–59. 30. Garbaccio S, Macias A, Shimizu E, Paolicchi F, Pezzone N, Magnano G, et al. Association between spoligotype-VNTR types and virulence of Mycobacterium bovis in cattle. Virulence 2014;5(2):297–302. 31. Coker OO, Chaiprasert A, Ngamphiw C, Tongsima S, Regmi SM, Clark TG, et al. Genetic signatures of Mycobacterium tuberculosis Nonthaburi genotype revealed by whole genome analysis of isolates from tuberculous meningitis patients in Thailand. Peer J 2016;4:e1905. 32. Davis AS, Vergne I, Master SS, Kyei GB, Chua J, Deretic V. Mechanism of inducible nitric oxide synthase exclusion from mycobacterial phagosomes. PLoS Pathog 2007;3(12):e186. 33. Chávez-Galán L, Ángel M del CAD, Ovalle IS, Lascurain R. Principales mecanismos de evasión de la respuesta inmune por Mycobacterium tuberculosis. Gac Médica México. 2009;145(4):323–330. 34. Gupta A, Kaul A, Tsolaki AG, Kishore U, Bhakta S. Mycobacterium tuberculosis: immune evasion, latency and reactivation. Immunobiology 2012;217(3):363–74. 35. Medina E, Ryan L, LaCourse R, North RJ. Superior virulence of Mycobacterium bovis over Mycobacterium tuberculosis (Mtb) for Mtb-resistant and Mtb-susceptible mice is manifest as an ability to cause extrapulmonary disease. Tuberc Edinb Scotl 2006;86(1):20–27. 36. Aguilar LD, Zumárraga MJ, Jiménez OR, Gioffré AK, Bernardelli A, Orozco EH, et al. Mycobacterium bovis with different genotypes and from different hosts induce dissimilar immunopathological lesions in a mouse model of tuberculosis. Clin Exp Immunol 2009;157(1):139–147. 37. Wright DM, Allen AR, Mallon TR, McDowell SWJ, Bishop SC, Glass EJ, et al. Fieldisolated genotypes of Mycobacterium bovis vary in virulence and influence case pathology but do not affect outbreak size. PloS One 2013;8(9):e74503. 38. de la Fuente J, Díez-Delgado I, Contreras M, Vicente J, Cabezas-Cruz A, Tobes R, et al. Comparative genomics of field isolates of Mycobacterium bovis and M. caprae provides evidence for possible correlates with bacterial viability and virulence. PLoS Negl Trop Dis 2015;9(11):e0004232. 39. Lee RS, Radomski N, Proulx JF, Levade I, Shapiro BJ, McIntosh F, et al. Population genomics of Mycobacterium tuberculosis in the Inuit. Proc Natl Acad Sci USA. 2015;112(44):13609–13614.

501


Rev Mex Cienc Pecu 2021;12(2):487-502

40. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, et al. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 1998;393(6685):537–544.

502


https://doi.org/10.22319/rmcp.v12i2.5509 Artículo

Genealogía y trayectoria artesanal del queso criollo en hoja de luna de Hidalgo, México

Fernando Cervantes Escoto a* María Isabel Palacios Rangel a Griselda Monroy Neria a Alfredo Cesín Vargas b Abraham Villegas de Gante a

a

Universidad Autónoma Chapingo. Centro de Investigaciones Económicas Sociales y Tecnológicas de la Agroindustria y Agricultura Mundial, Chapingo, Estado de México. México. b

Universidad Nacional Autónoma de México. México.

*Autor de correspondencia: tartalian04@gmail.com

Resumen: El objetivo fue aportar información cualitativa sobre el queso criollo en hoja de luna, para contribuir a difundir su presencia y posibilitar su valorización y permanencia como acervo gastronómico local. En metodología, se aplicó una encuesta estructurada a 18 productores de queso, lo cual cubrió el universo total de personas dedicadas a esta actividad. También se realizaron entrevistas focalizadas de tipo semiestructurado con personajes clave, como las personas más antiguas que todavia lo elaboran, y los comercializadores. Además, se utilizaron las herramientas metodológicas de historia oral, método genealógico y trayectoria tecnológica. Se encontró que tiene un alto grado de artesanalidad, la técnica del saber-hacer asociado para su elaboración es la misma que utilizaban los ancestros de los productores, con mínimas modificaciones en su proceso. Se concluye, que se puede contribuir a su difusión y valorización como acervo gastronómico local, mencionando al consumidor, que

503


Rev Mex Cienc Pecu 2021;12(2):503-522

este queso a pesar del tiempo ha conservado un carácter altamente artesanal; y que las peculiaridades que ha adquirido del entorno físico y cultural, se expresan en un sabor característico, mayor contenido graso, diferente coloración y consistencia; y que todo ello, junto con su envasado en la hoja de luna; le confiere características organolépticas diferentes a los quesos comerciales, y contribuye a generar un queso típico, con atributos valorados en la región en que se produce. Palabras clave: Queso criollo, Historia oral, Método genealógico, Trayectoria tecnológica, Artesanalidad, Tipicidad.

Recibido: 11/09/2019 Aceptado: 03/06/2020

Introducción Los alimentos son un componente importante en la identidad de la sociedad, en un mundo sometido a rápidos y profundos cambios, en el cual resulta importante destacar su papel, ya que ellos constituyen una referencia identitaria esencial(1), donde las especialidades culinarias se han convertido en vínculo de acercamiento cultural, en la medida en que se han configurado como elementos que hablan de la vida de pueblos y territorios. La gastronomía puede convertirse entonces, en un elemento de sostenibilidad que mejore el buen vivir de la población que los produce, consume y comercializa(2). En ese sentido, lo que la gente come, y como lo hace, puede convertirse en un elemento dinamizador de su cultura, que posibilita establecer pautas espacio-temporales y de forma, que a la larga se transforman no solo en hábitos alimenticios sino también en cultura tecnológica alimentaria(3). La sociedad enfrenta un escenario complejo, por la enorme riqueza simbólica y material implicada en la diversidad alimentaria y gastronomía local de los pueblos, aspecto que requiere ser visibilizado, debido a que no solo representa un acervo invaluable, sino que también forma parte de la memoria colectiva de la sociedad en su conjunto(4). El proceso de transformación industrial de los alimentos, genera un cambio en los patrones de consumo, ya que sustituye los alimentos cotidianos, por el empleo indistinto de ingredientes altamente procesados. Este también es el caso de los quesos, cuya presencia a lo largo de la historia, muestra la capacidad que tenían los lugareños para elaborar un producto gastronómico con características, al mismo tiempo, propias y distintivas con

504


Rev Mex Cienc Pecu 2021;12(2):503-522

respecto a los de otras regiones, pero que al insertarse en el dominio de la producción masiva tienden a perder sus vínculos territoriales, mismos que les generaban atributos especiales desde una visión social(5,6). En ese sentido, la producción masiva de quesos de imitación (aquellos elaborados con sucedáneos de leche) distorsiona la visión que los pueblos habían conservado de sus atributos de genuinidad y autenticidad comunitaria, al afectar su condición culinaria. Es decir, al poner a su alcance nuevos tipos de queso, cuyos componentes intrínsecos guardan escasa identidad con los procedimientos, utensilios e ingredientes originarios que les dieron su sentido comunitario, se abre la puerta para que se pierda, así como el conocimiento tácito (territorial, cultural y funcional) que llevaba implícita su elaboración(7,8). Es decir, en este proceso, algunos quesos han ido perdiendo paulatinamente, parte de su saber-hacer, lo que representa en los hechos, la desaparición de una cultura tecnológica recreada a lo largo de siglos, lo que no es poca cosa; dado que el desarrollo local rural suele tener como base de sustento una actividad productiva de referencia, el concepto de producto agroalimentario local(9), definido como aquel que emerge del acervo de saberes y recursos que constituyen un sistema agroalimentario localizado (SIAL)(10), se vuelve muy importante para esta investigación(9). Así, la industrialización masiva y la elaboración creciente de productos sustitutos de los alimentos originarios, se ha convertido en factor determinante para la generación de un consumidor que desconoce, en su gran mayoría, las propiedades nutricionales y organolépticas contenidas por ejemplo, en los quesos genuinos, lo que se traduce, en los hechos, en una apreciación insuficiente del valor contenido en ellos, lo que afecta su presencia en mercados de alto consumo, convirtiéndolos en productos confinados, casi siempre, a espacios locales muy específicos(8,11). En México, existen cerca de 40 variedades identificadas como quesos artesanales genuinos, que enfrentan una gradual desaparición(12), este es el caso del queso criollo en hoja de luna, un producto poco conocido que se elabora en la sierra alta del estado de Hidalgo. Es un queso fresco de consistencia blanda, se vende directamente al consumidor y solo se produce en esa región, donde las características del territorio, el tipo de ganado y el saber-hacer transgeneracional le otorgan particularidades que lo hacen único. Por tal motivo, es objetivo de este artículo es aportar información cualitativa sobre este queso, para contribuir a difundir su presencia y posibilitar su valorización y permanencia como acervo gastronómico local.

505


Rev Mex Cienc Pecu 2021;12(2):503-522

Material y métodos Estrategias de recolección de datos y herramientas de análisis La investigación de campo se desarrolló durante el verano de 2018. Se aplicó una encuesta estructurada a 18 productores de queso, lo cual cubrió el universo total de personas dedicadas a esta actividad, que se ubican en la Sierra Alta del estado de Hidalgo, México, en los municipios de Molango de Escamilla y Lolotla (Figura 1). En el cuestionario, se incluyeron items que tenían como propósito identificar los elementos externos básicos, que determinan la preservación o no, de este queso en la región. Se utilizaron variables como: i) género, ii) edad, iii) escolaridad de quienes lo producen, iv) escala, v) uso de ciertas tecnologías, vi) existencia de otras actividades asociadas (producción de leche, comercialización, gestión de apoyos). De lo anterior se pudo identificar que género, escala de producción y uso de cierta tecnología eran las tres variables principales para entender el sistema quesero. Figura 1: Municipios en los que se produce el queso criollo en hoja de luna

También se realizaron entrevistas focalizadas de tipo semiestructurado con personajes clave, como las personas más antiguas que todavia lo elaboran, y los comercializadores. Cabe señalar que se eligió este tipo de técnica cualitativa, porque resultó ser adecuada, dado el interés particular en profundizar sobre determinados aspectos(13). Para el caso concreto, las preguntas tenian que ver con aspectos tales como: i) origen de la producción del queso en la región, ii) existencia de lazos de filiación o no entre quienes han preservado su hechura; iii) canales o medios mediante los cuales se transfirió y preservó el saber-hacer; iv) elementos tecnológicos del saber-hacer (saberes, tradiciones, equipo, instrumentos e 506


Rev Mex Cienc Pecu 2021;12(2):503-522

insumos) preservados o desaparecidos a través del tiempo; v) dinámica y vínculos entre los elementos que integran el sistema; vi) niveles de estabilidad o inestabilidad entre los distintos elementos básicos para la producción del queso. Para el caso, se consideró como un factor de estabilidad o inestabilidad, la presencia o no, de cambios tecnológicos en el tiempo, aspecto que se contempló como que le confiere valor agregado al producto. Para seleccionar a las personas a quienes se les aplicaría la encuesta y se les haría la entrevista, se utilizó el método muestral no probabilístico, conocido como “Bola de nieve discriminatorio exponencial”(14), que consiste en ir preguntando a residentes del lugar, quienes son los individuos o grupos con un conocimiento especial del fenómeno a investigar; a medida que se avanza se recoge un conjunto de recursos ricos en información(15). Al final se logró un censo de todos los que se dedican a la actividad, 18 queseros. Como parte de las herramientas metodológicas se empleó la historia oral, la cual ofrece una alternativa dinámica y sencilla para identificar el valor simbólico que tienen algunos productos agroalimentarios para los habitantes de las comunidades, y determinar si son considerados un legado de los antepasados(16). En este caso, se utilizó para identificar el origen del queso criollo en hoja de luna, a través de la memoria y el relato de los productores (la hoja de luna pertenece al género Xanthosoma; se le conoce comúnmente también como mafafa, otoe, malanga, cocoñame). También se utilizó el método genealógico, para indagar sobre el saber-hacer quesero, el cual permitió visualizar la transferencia del conocimiento del queso a través de las generaciones de las familias productoras. Esta información se sistematizó y representó gráficamente en genealogías(17). Por lo general, este método se emplea en investigaciones de corte antropológico, ya que posibilita entender toda una gama de aspectos (sistemas de parentesco, leyes y normas de la filiación y herencia, migración, magia, religión, usos y costumbres), todos vinculados con el comportamiento social y cultural, individual o grupal, en ciertos entornos societarios. De igual manera, se utiliza para reconstruir las relaciones de parentesco establecidas al interior de un grupo, así como la historia comunitaria y familiar en la cual se inscribe. También se emplea cuando se requiere hacer un análisis más detallado de los sistemas de producción. Es de particular utilidad cuando se quiere estudiar el desarrollo de la quesería artesanal, como este caso(16). Otra herramienta metodológica que se utilizó fue el enfoque de la trayectoria tecnológica, con el cual se buscó identificar los cambios tecnológicos que se han incorporado a las unidades de producción a través del tiempo, para verificar el grado de persistencia de la “tradición tecnológica” en la elaboración de los productos agroalimentarios, mediante la evaluación de los efectos que han tenido en la preservación o pérdida de la genuinidad (18). Se verificaron los cambios en las etapas del proceso, uso de insumos y equipo para la 507


Rev Mex Cienc Pecu 2021;12(2):503-522

producción del queso criollo. Para identificar la trayectoria tecnológica del queso, se consideraron las variables volumen de leche procesado, uso de instrumentos y equipos para la elaboración, empleo de insumos relacionados con la producción (leche fluida y/o en polvo, cuajo animal y/o sintético, cloruro de calcio) y realización de pruebas de calidad. En el Cuadro 1 se relacionan todas las variables y herramientas utilizadas. Cuadro 1: Variables y herramientas utilizadas Herramienta

Variable Datos generales Género Edad Escolaridad Familiares dedicados a la actividad Historia oral Antigüedad del queso Primera persona que lo produjo Contexto del evento Cómo se difundió el saber-hacer Genealogía Familiar más antiguo dedicado a la actividad Conocidos dedicados a la actividad (no familiar) De quién aprendió A quién le enseñó Años dedicados a la actividad Trayectoria tecnológica Uso de cierta tecnología Volumen de leche procesada Maquinaria, equipo, instrumentos para el proceso de elaboración Uso de insumos Pruebas de calidad Escala de producción Cambios en el proceso de elaboración Comercialización Quién lo vende A quién se le vende Empaque Lugar de venta Distancia del punto de venta

Encuesta, entrevista focal Encuesta, entrevista focal Encuesta, entrevisa focal Entrevista focal Entrevista focal Entrevista focal Entrevista focal Entrevista focal Entrevista focal Entrevista focal Entrevista focal Entrevista focal Encuesta, entrevista focal Encuesta Encuesta Encuesta Encuesta Encuesta Encuesta Encuesta, entrevista focal Encuesta, entrevista focal Encuesta Encuesta Encuesta

508


Rev Mex Cienc Pecu 2021;12(2):503-522

Resultados y discusión Origen del queso criollo en hoja de luna La elaboración de este queso inició en varias comunidades de los municipios de Molango y Lolotla hace aproximadamente un siglo. La interpretación etimológica de la palabra Molango es "Lugar de Mole", denominación, de raíz náhuatl, que le dieron los aztecas al conquistar la región. Lolotla, también palabra náhuatl, significa "piedra rodeada de hilo", expresión que hace referencia a la topografía del lugar, constituida por lomeríos donde se asientan la mayoría de las viviendas. De acuerdo con los resultados obtenidos mediante la historia oral, el queso criollo en hoja de luna se empezó a elaborar alrededor de 1916 por la familia Melo Quijano. En su narración de hechos, uno de sus descendientes, el Sr. Ángelo Crescenciano Melo Castillo, rememora que sus abuelos eran dueños de una amplia extensión de terreno, y poseían alrededor de 130 cabezas de ganado bovino, el cual, como ahora, era criado en el monte (elevación natural de terreno cubierta de vegetación). Para la ordeña los peones se trasladaban caminando hasta el monte, cargando sobre la cabeza un chapal, olla de barro con capacidad de hasta 20 L, que servía para almacenar la leche durante su traslado; para evitar lastimarse con el peso, lo cargaban en la cabeza con el apoyo de un trapo que se entretejía. Una vez realizada la colecta de leche, la llevaban hasta la cocina de doña Rafaela Pedraza Bautista, esposa de Delfino Melo Quijano, propietario de la finca. Después de que se consumía, o vendía, el líquido fresco, con los excedentes se elaboraba el queso criollo. Una vez en la cocina, la leche se vaciaba en otro chapal de barro, colocando una manta para colarla, para evitar la proliferación de agentes extraños, que pudieran descomponerla o trasmitirle sabores desagradables al queso. Si la leche aún se encontraba caliente le adicionaban cuajo natural, pero si no, se calentaba en el fogón hasta que alcanzara una temperatura aproximada de 37 a 38 °C, se agregaba el cuajo y se dejaba reposar. Una vez formada la cuajada, ésta se cortaba con un chamolito, palo en forma de cruz, para después, con las manos, irla separando poco a poco dentro del mismo chapal, hasta formar una bola que se extraía y colocaba sobre una manta, y así hasta terminar. Una vez separado el suero de la cuajada se molía en el metate agregando poco a poco sal. Después, se formaban las piezas en moldes de madera, donde se escurrian colocados sobre una tabla inclinada, posteriormente se envolvía cada pieza en la “hoja de luna” (planta que abunda en la región), contribuyendo a su conservación y a la preservación de sus cualidades organolépticas.

509


Rev Mex Cienc Pecu 2021;12(2):503-522

Características del sistema quesero local La comercialización del queso Se hacía de forma directa con el consumidor y se realizaba en algunas poblaciones vecinas como Zacualtipán, Tamazunchale, San Felipe, Huitepec, e Ixtlahuaco. Era tan demandado que, según los informantes, tardaban más en llegar al sitio que en venderse; además del queso, ofrecían leche y requesón. Se ha documentado que algunos productos, como el queso, se venden mejor si tienen el reconocimiento del consumidor(19); además, la confianza en la calidad del alimento se establece, entre otros parámetros, por las relaciones personales entre el productor-comercializador y el consumidor y las recomendaciones de boca en boca, buenas o malas, contribuyen a la construcción del prestigio del quesero artesanal, para el caso que nos ocupa. En ese sentido, en los mercados locales es importante para el comerciante la fidelidad de los consumidores, la cual se construye con constancia, cuidando todo aquello que constituye una relación armónica y por periodos prolongados, pero se puede perder rápidamente. En ese nivel, es importante que los dos sujetos que intervienen en la transacción consideren que salen beneficiados de ella. Como sucedía en todo el país en esa época, para el transporte de los productos se utilizaban animales de carga, ya sea caballos, burros o mulas. El traslado del queso y del requesón se hacía en “chiquigüites”, vocablo de origen náhuatl, con el que se nombra a canastos de mimbre, de diversos tamaños, hechos de varas raspadas, para el caso de la leche, usaban chapales. No todo el queso producido se enviaba al mercado, una parte importante se comercializaba en la casa. De manera similar, en el caso del queso serrano de Campos da Cima do Serra (Brasil), a mediados del siglo XVIII, las caravanas de mulas transportaban el queso desde la localidad en que se elaboraba hasta el vecino estado de Santa Catarina, donde se comercializaba y difundía el gusto por el producto(20). Similar a esta la forma de comercialización, era la del queso Cotija, que era transportado por arrieros, como producto y tambien como alimento, desde el occidente mexicano hasta el sureste del país, incluso se menciona que llegaba a algunas partes de Centroamérica, teniendo como consecuencia que actualmente se elabore un queso tipo Cotija en el estado de Chiapas, resultado de la transmisión del saber hacer y la migración de productores derivada de esos intercambios iniciales. En el caso del queso en hoja de luna, la forma de pago era diversa, en algunos casos se hacía mediante transacción monetaria, en otros, por trueque, o, incluso, a cambio de algún trabajo realizado por al adquiriente. Debido a que se producía en el ámbito doméstico y de forma artesanal, la cantidad de pedidos era pequeña, como máximo 20 piezas, lo cual hace 510


Rev Mex Cienc Pecu 2021;12(2):503-522

referencia no solo a su pequeña escala de producción, sino también a que había personas que compraban todo lo producido, haciendo hincapié en la calidad del producto. Esto es similar en algunas localidades cercanas al mediterráneo italiano, en donde una cantidad importante de quesos artesanales poseían un sabor único y peculiar, siendo la mayoría elaborados como quesos de granja, producidos a partir de leche cruda(21). En el mismo sentido, algunos autores mencionan que esto se debe, especialmente, a que cuando las características únicas de un producto, como el queso, satisfacen al cliente, la demanda tiende a guardar fidelidad al producto, al mismo tiempo que crece(22). La necesidad de valorizar el queso en hoja de luna En el momento de la investigación, la venta de leche cruda en la región era mínima, los queseros señalaron que aproximadamente en 1996 se introdujo en los comercios locales el lacticinio en envase de cartón, lo cual disminuyó hasta su desaparición la demanda de leche cruda. Desde entonces, el total de la leche producida, en esas comunidades, se procesa para transformarla en queso, el cual sigue teniendo buena fama y aceptación en la zona. Lo anterior, se sostiene, como es el caso del queso en hoja de luna, en que los quesos artesanales poseen una fuerte raíz comunitaria y local, debido a que su elaboración se basa, desde sus orígenes, en la utilización de recursos naturales y sociales autóctonos, facilitando su integración en la cultura gastronómica local. Cuando la problemática de los quesos artesanales trasciende lo local, por los diferentes fenómenos que se han presentado en el medio rural, tales como pérdida de población, por migración, y por la misma razón, el riesgo de que desaparezca el conocimiento tradicional vinculado con el saber hacer, el aumento de los indices de pobreza, etc.; se vuelve necesario valorizarlos, porque con ello se contribuye al desarrollo de las comunidades y de los queseros, y se asegura su permanencia en la actividad, ya que un alimento tradicional es un producto consumido frecuentemente o asociado a celebraciones o épocas del año específicas, temporada de lluvias por ejemplo, normalmente es transmitido de generación en generación, elaborado con esmero de una forma concreta (saber-hacer), según la herencia gastronómica, con poco o ningún procesado/manufacturado, diferenciado y conocido por sus propiedades sensoriales y asociado con una localidad, región o país determinado, por lo tanto merece ser preservado o rescatado, según sea su situación(23). Finalmente, un aspecto por demás importante en la valorización territorial de los quesos artesanales es la implementación de protocolos, en las queserías, para asegurar la calidad sanitaria del producto, asimismo, otro tipo de atributos como los organolépticos, son los que le proprcionan fortalezas a este tipo de alimentos. Por otro lado, se debe garantizar un adecuado manejo y conservación de los recursos naturales locales, así como, incentivar la participación de los productores para lograr los objetivos señalados(11). Un ejemplo de esto se relaciona con la elaboración del queso Cotija en México, cuyos productores formularon 511


Rev Mex Cienc Pecu 2021;12(2):503-522

el proyecto “Potencialización del patrimonio cultural de la sierra de Jalmich”, lo que permitió involucrar a todos los actores y hacer coincidir la mejora de su calidad alimenticia y artesanal con el rescate de éste como patrimonio colectivo (económico, social y cultural)(24). Otro caso lo constituyó el queso bola de Ocosingo, Chiapas, México, donde los productores lograron la consecución temporal de una marca colectiva (MC), que le dio durante un periodo considerable de tiempo, reconocimiento externo a la cultura quesera local(25). En estos dos casos, cuando los productores consideraron que no tenían la misma problemática o afloraron los desacuerdos, los procesos de valorización fracasaron, ya sea disolviéndose la organización o siendo apropiada por unos cuantos actores, excluyendo a los demás miembros originales. Sin embargo, revalorizar la cultura quesera local requiere desarrollar diversas acciones, la mayoría de ellas colectivas, que muchas veces los productores no logran consolidar, como son organizarse para lograr el bien colectivo, y de esta forma mejorar aspectos tales como, la calidad sanitaria del queso y su proceso productivo, su control de calidad, la certificación del producto, además del desarrollo de mejores opciones de mercado. Hay que considerar que una indicación geográfica (IG), o cualquier otro sello de anclaje territorial, no tienen valor por sí mismo, sino se sustentan en la acción colectiva, de los productores y demás actores cercanos, que influyen en la elaboración de los quesos tradicionales, genuinos y de identidad social(25). Cabe señalar que los consumidores no siempre valoran factores de tipo intangible (reconocimiento, cultura) que incidan sobre su consumo. Por tanto, es un aspecto importante que debe rescatarse de los quesos artesanales, su riqueza cultural a fin de generar una mayor valoración por parte del consumidor(26). La revalorización de productos locales se ha constituido como una estrategia que se encuentra íntimamente relacionada con lo que muchos autores denominan desarrollo local, presentando una concepción del desarrollo como algo generado a partir de las capacidades y recursos locales(10).

La transmisión del saber-hacer del queso criollo en hoja de luna a través de generaciones A partir de diversos relatos de los descendientes del Sr. Delfino Melo Quijano, se generó la pauta que permitió ubicar el origen del queso en hoja de luna, así como la forma en que el saber-hacer se fue transmitiendo de una generación a otra. Así se logró interconectar la transferencia de conocimiento con la elaboración del producto. La narración oral refiere: “al contar Don Delfino y su esposa Rafaela Pedraza con una gran cantidad de ganado, decidieron producir queso con el remanente que les quedaba después de la venta de leche bronca”. De esta forma “mientras Delfino y algunos empleados se encargaban del cuidado de las vacas y la ordeña, Rafaela elaboraba el queso en casa, apoyada por algunas vecinas,

512


Rev Mex Cienc Pecu 2021;12(2):503-522

ya que como es tradición, a la par de sus actividades domésticas y la atención que prestaba a sus cinco hijos: Gonzalo, Casimiro, Pablo, Baldomero y Sofía, sus preocupaciones también se orientaban a obtener un poco más de recursos pecuniarios”. Un hecho innegable es que “la producción de queso con el tiempo no solo integró a las mujeres de la familia, sino de igual modo a los hombres”. El saber-hacer fue trasmitido a todos. Sin embargo, solo algunos de los hijos continuaron con la actividad. Andrea Castillo esposa de Casimiro Melo Pedraza, aprendió de su suegra la técnica quesera. Ella se convirtió, con el paso del tiempo, en una colaboradora importante en la hechura del queso. Del matrimonio Melo Castillo nacieron seis hijos, dos hombres y cuatro mujeres, cuyos nombres fueron Ángelo Crescenciano, Crisanto, Justina, Teresa, Prisca y Honorina, de todos fue Ángelo Crecenciano en compañía de su esposa, Angelina Díaz Hernández, el que rescató el saber-hacer quesero, conocimiento que heredaron a su vez sus dos hijas, Griselda y Susana, las que también aprendieron el proceso de elaboración desde que eran pequeñas. Por su parte, Honorina, hija menor de Casimiro Melo Pedraza y Andrea Castillo, contrajo matrimonio con Rodolfo García Díaz, pequeño ganadero local, el que no sólo sigue aportado el insumo lácteo, base para la producción del queso, sino que también ha estimulado que ella siga elaborándolo en la actualidad. Este saber lo ha transmitido a sus hijos, Alejandro y María Concepción, quienes, aunque pequeños todavía, han aprendido la técnica, y seguramente serán ellos los que con el tiempo continúen con la tradición quesera familiar. Cabe destacar que, en esta región la mayoría de los queseros actuales, siguen preservando la forma tradicional en que la familia originaria elaboraba este tipo de queso. Tal es el caso de Paula y Graciela Hernández, Cipriana López, Irma Reyes, Cecilia Apolonio, Marina Bustos, Alicia e Hilaria Montiel y la familia Campoy, quienes en su testimonio mencionan que sus padres o abuelos, trabajaron muy cercanamente en la producción con Rafaela Pedraza. De esta forma se puede decir que el conocimiento y técnica de elaboración del queso criollo en hoja de luna, ha rebasado el círculo familiar que le dio origen, y se han transformado en un valor comunitario. En la Figura 2, se describe la simbología utilizada en el mapa genealógico que integra, a los actores que han intervenido, a partir de la familia Melo Pedraza, en la preservación del conocimiento y técnica para la elaboración del queso criollo en hoja de luna en esta región, y la Figura 3 muestra la genealogía seguida para la difusión del conocimiento en la elaboración del queso criollo, por aquellas personas que lo aprendieron directamente de esa familia.

513


Rev Mex Cienc Pecu 2021;12(2):503-522

Figura 2: Simbología utilizada en el mapa genealógico

Hombre Mujer Persona que recupera la tradición quesera

Persona que posee el conocimiento quesero Vínculo matrimonial Productores actuales de queso criollo Nivel del actor dentro del mapa genealógico

Figura 3: Genealogía de la difusión del conocimiento de la elaboración del queso criollo

Existen otras vertientes mediante las cuales se desarrolló la transmisión del saber-hacer quesero, pero que no se relacionan de forma directa con la familia Melo Quijano, lo cual puede interpretarse como que la cultura, en la producción de este acervo culinario, tiene orígenes internos muy precisos, pero también ramificaciones externas, que se relacionan con el desarrollo de la producción del mismo, como parte de un sistema geográfico más 514


Rev Mex Cienc Pecu 2021;12(2):503-522

amplio(27,28). Este es el caso de la Sra. María del Carmen Bustos, quien acumula más de 40 años de experiencia en la actividad, misma que le fue enseñada por su mamá, Lucía Pelcastre, quien a su vez la aprendió de su abuela, Rufina Apolonio, desarrollando juntas la actividad hasta el fallecimiento de la última. Un caso similar es el de la Sra. María Abraham Ávalos, la que se dedica a elaborar este queso desde hace 37 años, conocimiento que adquirió de su suegra, Teresa Mendoza. De igual forma, Raúl Valentín, quien desde hace desde cinco años produce el queso, técnica que le enseñó su abuela Agustina Serna. También, el testimonio de Abundia Juárez, quien adquirió el saber de su madre; ambas lo elaboran desde hace treinta años. En la Figura 4, se representa el mapa genealógico de estos queseros. Figura 4: Genealogía de las familias donde no se logró establecer la transferencia de conocimiento de la producción de queso criollo

Como se observa, desde los testimonios aportados, la participación de las mujeres en la transmisión del saber-hacer para la elaboración de este producto ha sido predominante. Sin embargo, la permanencia de la práctica quesera en esta región es un factor que, aunque marca de manera clara la presencia femenina en su fabricación, al mismo tiempo, forma parte de una estrategia de reproducción familiar, ya que en su manufactura se involucra a todo el núcleo. De esta forma hay una división de las actividades, el padre se encarga de la producción de leche y del mantenimiento de las vacas; la mujer elabora, difunde el saberhacer y vende el queso; los hijos e hijas colaboran en su producción y distribución; es decir, el queso criollo en hoja de luna no solo tiene un sabor territorial, sino también forma parte de una cultura familiar que trasciende el ámbito doméstico, y se convierte en un factor geográfico de identificación comunitaria. Así, el hecho de que la producción de queso complemente los ingresos familiares, al integrar las actividades de la madre con la quesería, y que todo esto cuente con el apoyo activo de los integrantes de la familia, son factores que han ayudado al sostenimiento de su producción. Investigaciones previas apuntan a que la estructura doméstica que está detrás de la producción de queso en pequeñas unidades familiares es resultado de adecuaciones a 515


Rev Mex Cienc Pecu 2021;12(2):503-522

la división familiar del trabajo, misma que se modifica a medida que la mujer tiene una participación económica más amplia en la captación del ingreso, lo que, también, repercute en un incremento sustancial de su producción(29). El este caso, la quesería es un ejemplo paradigmático del proceso de transición de una sociedad rural tradicional a la nueva ruralidad(30), adaptación a nuevos escenarios que no es uniforme y que, para las regiones o actividades menos favorecidas representa un verdadero reto, con más limitantes que recursos para superarlo. Del mismo modo, el estudio previo de un caso de producción de queso artesanal en Hezergovina, concluyó que la mujer desempeña un papel muy importante en la valorización de los productos típicos, lo cual garantiza no sólo su reconocimiento, protección y bienestar económico, sino también genera un modelo más integrado en el desarrollo de la región de origen, que muestra evidentes ventajas de mejora y beneficios tangibles (crecimiento del empleo, mayores ingresos, etc.)(31). En otras regiones de México, la producción familiar de leche y la tradición en la fabricación de quesos, ha sustentado el desarrollo local de un territorio delimitado. En estos ámbitos, la articulación del sistema familiar de leche se convierte en un recurso productivo específico, vinculado a la fabricación doméstica, local y regional de quesos, donde el saber-hacer se transforma en una ventana de oportunidades, con fama y reputación regionales(32). Esta articulación es importante, porque da viabilidad a hogares en el medio rural, integrando a los diferentes miembros de la familia a la actividad quesera, algunos de tiempo parcial y permitiendo la pluriactividad que puede ser fundamental para su funcionamiento. Particularmente, la conservación del carácter artesanal de un producto es un proceso de producción y características que se definen en función de los saberes locales, e incluso de las prácticas culinarias heredadas por cada familia, este, representa una ventaja a lo largo de la cadena hasta el consumo final(33). Las relaciones de confianza se establecen entre el productor (o comercializador) y el consumidor, pueden ser perdurables por mucho tiempo, los productos son valorados, recomendados y promocionados de boca en boca, por sus compradores, enalteciendo sus cualidades. En el caso particular del Queso Crema de Chiapas (QCCh) las características de producción artesanal son aquéllas que el sujeto valora y van de acuerdo al origen, la forma de producirse, los enseres de elaboración, el ganado que se utiliza (de doble propósito), su alimentación, el saber‑hacer del queso (transmitido por generaciones), etc. y que al final contribuyen a impartir las características únicas al queso como son la genuinidad y tipicidad. Los queseros valoran el proceso ya que les permite reproducir su saber‑hacer, transmitido en la historia; también les posibilita formar parte de un grupo o gremio, donde el conocimiento se comparte y mejora(34). En ese sentido, el saber-hacer de los productos artesanales está asociado a conocimientos empíricos que se difunden a manera de procesos de educación no formal, escasamente valorados por las instituciones públicas. Esta situación se asocia con la elaboración de 516


Rev Mex Cienc Pecu 2021;12(2):503-522

productos de calidad ligada al origen, donde las condiciones climáticas naturales les confieren características distintivas que permiten a los consumidores su reconocimiento y valorización(10). De esta manera, el potencial creciente de este tipo de productos genuinos se vincula de forma estrecha con aspectos tales como, la diversidad geográfica y cultural, y posibilita la creación de una gran variedad de alimentos y formas de preparación en la gastronomía local y regional(35).

Trayectoria tecnológica en el proceso de elaboración del queso criollo en hoja de luna Al estudiar los productos típicos en Italia, como estrategia para fortalecer el turismo gastronómico, se considera que el grado de artesanalidad en la elaboración de un producto local está directamente vinculado con la relación entre territorio y producciones originales, y ésta contribuye a elevar la calidad del producto, por el cuidado que le ponen los productores en la selección de los ingredientes(36). Lo anterior, también posibilita que el producto genuino conserve su pertenecía cultural, lo cual establece un vínculo fuerte entre el producto genuino y el desarrollo de una conciencia comunitaria valorativa. El queso criollo en hoja de luna surgió, al igual que otros, como una estrategia para aprovechar los excedentes estacionales de leche. La manera de elaborarse en la actualidad sigue siendo muy similar a la original, sólo se han incorporado algunos cambios leves en el proceso (Cuadro 2). La mayor parte de los quesos mexicanos genuinos se comenzaron a elaborar en los ranchos como un medio para aprovechar y conservar los excedentes de leche en el periodo de lluvias.

Cuadro 2: Trayectoria tecnológica del sistema productivo de queso criollo en hoja de luna Año

Tecnología de elaboración

1916

Fecha que se estableció como la del origen de este queso.

1917

En este año se terminó de concluir la designación del procedimiento para la elaboración de este queso, mismo que incluyó los siguientes aspectos: 

Para la elaboración se utilizaba leche fluida de vaca

la leche se cuajaba en los chápales de barro, los cuales tenían una capacidad de 20 litros; para tal procedimiento se utilizaba el chamolito, 517

Imagen


Rev Mex Cienc Pecu 2021;12(2):503-522

Año

Tecnología de elaboración instrumento de palo semejante a una cuchara. 

La temperatura se determinaba con base en la observación y el tacto.

El procedimiento de molido de la cuajada se realizaba en metate, en esta etapa de elaboración se le agregaba sal gruesa.

El procedimiento de escurrido consistía en colocar el queso molido en una hoja de luna y ahí se dejaba el tiempo necesario para que adquiriese consistencia y sabor.

Una vez logrado lo anterior se terminaba de envolver el queso en la hoja de luna, lo cual permitía su posterior traslado y venta.

El procedimiento de elaboración del queso no incluía el uso de canastos de hoja de palma, ni de recipientes metálicos

1994

Se empieza a introducir en la elaboración del queso el garrafón de plástico y las cubetas de aluminio, utensilios que sustituyeron el uso del chápal.

1997

Se empieza a utilizar lienzos de tela o talegos para facilitar el escurrido del suero.

1998

Se sustituyó el uso del chamolito por la cuchara de aluminio, aunque en la actualidad todavía algunos queseros lo siguen utilizando (Por ejemplo, Angelina Díaz e Hilaria Apolonio).

1999

Se introdujo el uso de moldes de madera y PVC.

2012

Se sustituyó la utilización de cuajo natural por el comercial

518

Imagen


Rev Mex Cienc Pecu 2021;12(2):503-522

Año

Tecnología de elaboración

Imagen

(solo dos productores). 2013

El quesero Raúl Valentín sustituyó la hoja de luna por bolsas de plástico, situación que no prosperó entre los otros productores.

2017

Del procedimiento tradicional en la elaboración de este queso continua vigente, el empleo de leche fluida de vaca, la forma de cuajado, salado y molido. Así como el envasado del producto final en la hoja de luna. La pasteurización de la leche no ha sido un método adoptado por los queseros, dado que este procedimiento adiciona costos al producto, además de modificar la consistencia y sabor del queso.

Conclusiones e implicaciones El anclaje territorial (entendido como el vínculo que tienen los productos alimentarios, con el lugar donde se producen) resulta fundamental para entender y sostener un sistema artesanal como el que aquí se presenta, ya que esa conexión se transforma con el tiempo en una tradición culinaria, de la cual los pueblos se sienten altamente orgullos. La importancia del queso criollo en hoja de luna consiste en que es, precisamente, un alimento con historia, resultado de un saber-hacer propio, que ha sido transmitido por generaciones a través de familiares y conocidos. Una forma en que se podría contribuir a su difusión y valorización como acervo gastronómico local, sería mencionando al consumidor que este queso, a pesar del tiempo, ha conservado un carácter altamente artesanal, y que las peculiaridades que ha adquirido del entorno físico y cultural, se expresan en un sabor característico, mayor contenido graso, diferente coloración y consistencia; además, de su envasado en la hoja de luna; todo ello le confiere características organolépticas diferentes a los llamados quesos comerciales. Literatura citada: 1.

Muchnik J. Identidad territorial y calidad de los alimentos: procesos de calificación y competencias de los consumidores. Agroalimentaria 2006;(22):89–98.

2.

Martín GMB, López AXA. Productos agroalimentarios de calidad y turismo en España: Estrategias para el desarrollo local. Geographicalia 2005;(47):87–110.

519


Rev Mex Cienc Pecu 2021;12(2):503-522

3.

Nunes DC. Somos lo que comemos Identidad cultural, hábitos alimenticios y turismo. Estud y Perspect en Tur 2007;16(2):234–242.

4.

Unigarro SC. Patrimonio cultural alimentario. Primera ed. Ecuador: Auxiliadora Balladares UM, editor; 2010.

5.

Leyva TDA, Pérez VA. Pérdida de las raíces culinarias por la transformación en la cultura alimentaria. Rev Mex Cienc Agríc 2015;6(4):867–881.

6.

Fournier T. Are traditional foods and eating patterns really good for health? In: Sébastia B, editor. Comer comida tradicional Política, identidad y prácticas. 1rst ed. Francia: Routledge; 2016:180–200.

7.

Bachmann HP. Cheese analogues: a review. Int Dairy J 2001;11(2001):505–515.

8.

Cesín VA, Aliphat FM, Ramírez VB, Herrera HJG, Martínez CD. Ganadería lechera familiar y producción de queso. Estudio en tres comunidades del municipio de Tetlatlahuca en el estado de Tlaxcala, México. Téc Pecu Méx 2007;45(1):61–76.

9.

Otero J. Valorización de productos agroalimentarios locales para el desarrollo rural: reflexiones sobre dos experiencias argentinas. Rev Agroaliment 2015;21(41):71–80.

10. Velarde I. Methodological Proposal for the activation of localized agroalimentary systems in Argentina. International Conference of Territorial Intelligence. Salermo, Italy. 2009:1–26. 11. Cervantes EF, Villegas GA, Cesín VA, Espinoza OA. Los quesos mexicanos genuinos. Patrimonio cultural que debe rescatarse. 2nd ed. Guadalajara: Colegio de Posgraduados, Universidad Autónoma Chapingo, Instituto Interamericano de Cooperación para la Agricultura, Grupo Mundi-Prensa; 2013. 12. Villegas GA, Cervantes EF. La genuinidad y tipicidad en la revalorización de los quesos artesanales mexicanos. Estud Soc 2011;19(38):147–164. 13. Merton RK, Fiske M, Kendall PL. Propósitos y criterios de la entrevista focalizada. Empiria Rev Metodol Ciencias Soc 2002;(1):215–227. 14. Goodman LA. Snowball Sampling. Ann Math Stat 1961;32(1):148–170. 15. Ulin RP, Robinson TE, Tolley EE. Investigacón aplicada en salud pública: Métododos cualitativos. Washington: OMS/OPAS; 2006. 16. Hinojosa LR. La historia oral y sus aportaciones a la investigación educativa. Investig Educ la rediech 2012;3(5):57–65.

520


Rev Mex Cienc Pecu 2021;12(2):503-522

17. Héritier F. La encuesta genealógica y el proceso de datos. In: Cresswell R, Godelier M, editors. Útiles de encuesta y análisis antropológicos. 1rst ed. Madrid, España: Fundamentos; 1981:239–284. 18. Pacheco PA. Sociología de la ciencia y semiótica. El esquema actancial en la teoría del actor-red y el programa constructivista. Redes 2013;19(36):79–103. 19. Palau H, Mesa MA, Vilella F, Contreras D. Diagnosis of hand-made cheese sector in Uruguay. VI International PENSA Conference. Brasil; 2007. 20. Krone E, Thomé CF, Menasche R. Del lomo de las mulas a la clandestinidad: Dilemas entre las exigencias legales y el sistema tradicional de producción del queso serrano de los campos de Cima da Serra (Brasil). International EAAE-SYAL Seminar-Spatial Dynamic in Agri-food Systems. Brasil; 2010. 21. Romano P, Ricciardi A, Salzano G, Suzzi G. Yeasts from Water Buffalo Mozzarella, a traditional cheese of the Mediterranean area. Int J Food Microbiol 2001;69(1–2):45– 51. 22. Thomé CF, Menasche R. Tradition and diversity jeopardised by food safety regulations? The Serrano Cheese case, Campos de Cima da Serra region, Brazil. Food Policy. 2014;45:116–124. 23. Villegas A, Santos A, Cervantes F. Los quesos mexicanos tradicionales. México: Universidad Autónoma Chapingo-CIESTAAM; 2016. 24. Pomeón T. El queso Cotija, México. Un producto con marca colectiva queso “Cotija Región de origen”, en proceso de adquisición de una Denominación de Origen. México: FAO-IICA; 2007. 25. Poméon T. De la retórica a la práctica del patrimonio: procesos de calificación de los quesos tradicionales mexicanos [tesis doctorado]. Texcoco, México; Universidad Autónoma Chapingo; 2011. 26. Espejel GA, Rodríguez PDM, Barrera RAI, Ramírez GAG. Factores estratégicos de la innovación y mercado en queserías artesanales de México. Rev Venez Gerenc 2018;23(82):424–441. 27. Enríquez-Sánchez J, Muñoz-Rodríguez M, Altamirano-Cárdenas JR, Villegas-De Gante A. Activation process analysis of the localized agri-food system using social networks. Agric Econ 2017;63(3):121–135. 28. Guzmán M. La valorización de los alimentos en Europa y en América Latina. In: Aspects juridiques de la valorisation des denrées alimentaires Colloque Lascaux. San José, Costa Rica; 2012:1–15. 521


Rev Mex Cienc Pecu 2021;12(2):503-522

29. Grass RJF, Sánchez GJ, Altamirano CJR. Análisis de redes en la producción de tres quesos mexicanos genuinos. Estud Sociales 2015;23(45):185–212. 30. Aguilar CE, Amaya CS, López MI. Alimentos con calidad. Nuevas estrategias rurales para nuevos consumidores. Arx d’Etnografia Catalunya 2016;(16):137-152. 31. Samardzic S, El Bilali H, Bajramovic S, Kanlic V, Ostojic A, Berjan S, et al. Cheese in a suck: exploring history, production area and production process of a typical herzegovinian product. Int J Environ Rural Dev 2014;5(2):74–79. 32. Castañeda MT, Boucher F, Sánchez VE, Espinoza OA. La concentración de agroindustrias rurales de producción de quesos en el noroeste del Estado de México: un estudio de caracterización. Estud Soc 2009;17(34):73–109. 33. Andablo RAC, Hernández MMC, Catalán DCG. Gobernanza e integración de familias rurales a cadenas pecuarias: el caso del ejido Cobachi, Sonora. Econ Teoría y Práctica. 2015;(42):105–135. 34. Lozano MO, Villegas GA. Valorización simbólica del Queso Crema de Chiapas, un queso mexicano tradicional con calidad de origen. PASOS Rev Tur y Patrim Cult 2016;14(2):459–473. 35. Goméz MMB, Armesto LXA. Productos agroalimentarios de calidad y turismo en España: Estrategias para el desarrollo local. Geographicalia 2005;(47):87–110. 36. Olivieri FM, Giraldi A. Food and wine tourism: an analysis of Italian typical products. Alma Tour 2015;(11):11–35.

522


https://doi.org/10.22319/rmcp.v12i2.5642 Revisión bibliográfica

Índices de eficiencia alimenticia en ovinos de pelo: calidad de la carne y genes asociados. Revisión

Carlos Arce-Recinos a Alfonso Juventino Chay-Canul b* Baldomero Alarcón-Zúñiga c Jesús Alberto Ramos-Juárez a Luis Manuel Vargas-Villamil a Emilio Manuel Aranda-Ibáñez a Nathaly del Carmen Sánchez-Villegas a Ricardo Lopes Dias da Costa d

a

Colegio de Postgraduados. Campus Tabasco. Periférico Carlos A. Molina, Km 3.5. Carretera Cárdenas-Huimanguillo. 86500 H. Cárdenas, Tabasco, México. b

Universidad Juárez Autónoma de Tabasco. División Académica de Ciencias Agropecuarias, Tabasco, México. c

Universidad Autónoma Chapingo. Departamento de Zootecnia, Estado de México, México.

d

Instituto de Zootecnia. São Paulo, Brasil.

*Autor de correspondencia: alfonso.chay@ujat.mx; alfonsochay2@gmail.com

Resumen: Los ovinos de pelo desempeñan un papel importante en la producción de carne en zonas tropicales, donde los estudios de eficiencia alimenticia han sido poco evaluados. El consumo de alimento representa más del 70 % de los costos; por lo tanto, la selección de animales con

523


Rev Mex Cienc Pecu 2021;12(2):523-552

alta eficiencia alimenticia puede mejorar la rentabilidad del sistema de producción. Se han desarrollado herramientas que permiten seleccionar individuos con mayor eficiencia alimenticia sin comprometer la calidad del producto. Por lo que esta revisión tiene la finalidad de identificar estas herramientas genético-moleculares y estadísticas, como son, el consumo de alimento residual (CAR) y ganancia e ingesta residual (GIR). En la literatura consultada, se reportan diferencias en el consumo de materia seca (CMS) en un rango del 9 al 30 % entre animales eficientes e ineficientes, manteniendo una ganancia diaria de peso (GDP) similar empleando el índice CAR. Por otro lado, utilizando el índice GIR los CMS son similares, aunque la GDP en animales eficientes es mayor hasta en 50 g día-1, reduciendo la conversión alimenticia en un kilo. Esta diferencia se asume a un conjunto de genes asociados a la eficiencia alimenticia (Adra2a, Gfra1, Gh, Glis1, Il1rapl1, Lep, Lepr, Mc4r, Oxsm, Pde8b, Rarb, Ryr2, Sox5 y Sox6, Trdn), que pudieran ser utilizados para la selección de ovinos de razas de pelo con alta eficiencia alimenticia, teniendo en cuenta los genes relacionados con la calidad de carne (Capns1, Cast, Dgat1, Fabp4, Igf-i, Lep, Mstn y Scd). Palabras clave: Eficiencia alimenticia, Calidad de carne, Genes, Ovinos de pelo.

Recibido: 16/03/2020 Aceptado: 11/09/2020

Introducción La población mundial de ovejas en 2017 fue de 1,202 millones de cabezas, cerca del 74 % de la población se encuentra distribuida en los continentes Asiático y Africano (42.25 y 31.70 %, respectivamente), y el 26 % restante se ubica en los demás continentes, siendo el continente Americano el que menor población presenta, con 6.76 %; aunque el peso medio en canal reportado en el continente Americano es mayor, únicamente superado por el continente de Oceanía, presentando pesos en canal de 18.6 y 21.6 kg, respectivamente(1). En México, la producción ovina es una de las actividades pecuarias con mayor presencia en su distribución territorial; las cifras preliminares del 2018 indican que la población ovina alcanzó un total de 8’683,835 cabezas(2), las cuales representan cerca del 11 % de la población del continente Americano, distribuidos en alrededor de 53,000 unidades de producción. Aproximadamente el 53 % se ubica en el centro del país, 24 % en el sur-sureste y 23 % en el norte(3), siendo la raza Pelibuey una de las razas más numerosas, ya que es utilizada como pie de cría por su habilidad materna, alta prolificidad, rusticidad, resistencia a parásitos y su gran adaptación a las diversas condiciones climáticas presentes en el país, para la producción cárnica(4).

524


Rev Mex Cienc Pecu 2021;12(2):523-552

Por otro lado, el consumo de alimento es uno de los factores más importantes en los sistemas intensivos de producción de carne ovina, representando más del 70 % de los costos totales de producción(5). Por ello, la selección de animales eficientes en la utilización del alimento, que presenten una menor ingesta de alimento, manteniendo su rendimiento o incrementando la producción con una ingesta similar, podría incrementar la rentabilidad de las unidades de producción(6). Esto es importante, debido a que la reducción de los costos de alimentación contribuiría a mantener los precios rentables dentro de un mercado de insumos agrícolas fluctuantes y la competitividad en el mercado global. Tradicionalmente en la industria ganadera de producción de carne, se ha empleado la conversión alimenticia (CA) como medida de eficiencia alimenticia(7). Sin embargo, esta medida es cuestionable, debido a que, el consumo de materia seca (CMS) guarda una alta correlación con el tamaño corporal y el nivel de producción(8), tendiendo a seleccionar animales que presentan una ganancia diaria de peso (GDP) alta, sin embargo, también se seleccionan animales con un alto CMS, incrementando los costos de producción(7). Otro enfoque de eficiencia alimenticia ha sido propuesta por otros autores, definiéndola como la capacidad del animal para alcanzar un determinado peso con un menor CMS(9). En los rumiantes la eficiencia es baja comparada con otras especies, no obstante, tienen la capacidad de transformar recursos no comestibles para el ser humano (forrajes y nitrógeno no proteico) en alimentos de alta calidad (proteína animal)(7). En consecuencia, se han buscado diversas herramientas que ayuden a explicar, predecir y seleccionar a los individuos con mayor eficiencia en la utilización del alimento y de la energía consumida. Entre estas, el consumo de alimento residual (CAR) o “Residual Feed Intake” (RFI, por sus siglas en inglés), es una de las más empleadas(9,10). El CAR, está definido como la diferencia entre el consumo de alimento real y el consumo de alimento esperado para un peso y nivel productivo determinado durante un periodo específico(8,11). Su objetivo es identificar a los animales más eficientes en la utilización del alimento y con esto lograr una mejora genética del hato ganadero, además, de reducir los costos de la producción de cada kilo de peso vivo incrementado(8). Además del CAR, Koch et al(9) propusieron el índice Ganancia residual (GR) o “Residual Gain”, el cual permite estimar la ganancia esperada para un nivel productivo, con el objetivo de identificar a los animales con las mayores tasas de ganancia de peso. Recientemente, ha sido propuesto un nuevo indicador de eficiencia alimenticia denominado Ganancia e Ingesta Residual (GIR) o “Residual Intake and Gain” (RIG, por sus siglas en inglés). Este indicador de eficiencia alimenticia conserva la característica de selección de CAR y GR, que son independientes del peso corporal. El GIR permite seleccionar animales que presentan mayores GDP y menor CMS, debido a que el RIG se correlaciona negativamente con el CMS y positivamente con la GDP(12). 525


Rev Mex Cienc Pecu 2021;12(2):523-552

El interés de la industria cárnica no solo es en la eficiencia del uso del alimento, sino también en la calidad del producto destinado al mercado. La calidad de la carne se compone de varios rasgos, incluidos los atributos fisicoquímicos (terneza, color, contenido de grasa intramuscular y la capacidad de retención de agua) y los factores que afectan la palatabilidad (sabor, jugosidad y olor), así como las características de inocuidad(13), los cuales influyen en la toma de decisión del cliente al elegir un tipo de corte, así como también para la industria en el procesamiento de la carne(14). En este sentido, se han realizado diversos estudios que emplearon la herramienta CAR para determinar el efecto de la eficiencia alimenticia sobre la calidad de la carne, reportando que la selección de bovinos Angus eficientes (bajo CAR) no afecta negativamente la calidad de carne producida(15,16). Sin embargo, existe controversia en los resultados en estudios recientes en bovinos Nelore, ya que se han reportado que la eficiencia no afecta la calidad de la carne y la actividad del sistema Calpaina(17,18), mientras que otros estudios indican lo contrario. En consecuencia, los animales con bajo CAR tienden a presentar mayor dureza de su carne(19), y se ha indicado que esta característica indeseable está regulada por el recambio proteico y la expresión génica de ciertas enzimas (principalmente por el sistema de las Calpaínas) encargadas de la proteólisis post-morten del músculo(20). Así mismo, se ha documentado que la degradación de la proteína está relacionada con la energía requerida para el mantenimiento (REMm) y una alta tasa de degradación proteica está asociada con un REMm mayor(21). En este sentido, se ha reportado que los animales más eficientes tienen un menor requerimiento de energía metabolizable para el mantenimiento(17,21). Por lo tanto, los animales más eficientes presentan una baja tasa de degradación proteica(22), lo que se relaciona con una mayor fuerza de corte a diferentes tiempos de maduración (0 d= 4.50 vs 4.00, 7 d= 4.22 vs 3.61, 21 d= 3.27 vs 2.69 kg/cm2), bajo índice de fragmentación miofibrilar (37.0 vs 42 %) y alto contenido de colágeno soluble (17.7 vs 14.9 %) en ganado Nelore con bajo CAR, presentando carne de menor calidad(19). Por otro lado, con el desarrollo de la genética molecular, secuenciación y técnicas moleculares de amplificación de regiones genómicas selectivas, se han aumentado las posibilidades de detectar genes que tienen un efecto notable en los rasgos de interés (ej. eficiencia alimenticia y calidad de carne), detectando secuencias genómicas vinculados a estos genes y la posibilidad de establecer programas de selección con marcadores moleculares(23). Un marcador genético es una secuencia de ADN específica con una ubicación conocida en un cromosoma que tiene una función específica o está asociada al nivel de expresión fenotípica de un carácter(24). Su uso ayuda a abordar los problemas asociados con la selección tradicional, seleccionando individuos genéticamente superiores(25). Además, se pueden predecir los valores de mejora para los individuos seleccionados al momento del nacimiento con una precisión mayor que el índice de pedigrí clásico, reduciendo el intervalo generacional(23). Por lo tanto, el objetivo de este trabajo fue realizar una revisión sobre índices 526


Rev Mex Cienc Pecu 2021;12(2):523-552

de eficiencia alimenticia y su relación con la calidad de carne y genes asociados a estos rasgos en ovinos de pelo.

Índices de eficiencia alimenticia Los indicadores CAR y GR, fueron propuestos por Koch et al(9), al observar que el mantenimiento de peso vivo y la ganancia diaria de peso, son afectados por la alimentación. Propusieron que el consumo de alimento puede ajustarse al peso corporal y a la ganancia de peso, dividiendo el consumo de alimento en dos componentes: 1) el consumo de alimento esperado para un rendimiento o nivel de producción dado, y 2) una porción residual. La porción residual del consumo de alimento podría usarse para identificar animales que se desvían hacia abajo de su nivel esperado de consumo de alimento (CAR negativo), permitiendo realizar una comparación entre los animales que difieren en el nivel de producción durante el periodo de medición. El CAR se ha utilizado como criterio de selección en programas de mejora genética en ganado de carne, ya que se ha observado que vaquillas que son seleccionadas por un CAR bajo, al llegar a la madurez son más eficientes en el uso de los alimentos que aquellos con un CAR alto(26) y su progenie tiende a comportarse en forma mas más eficiente(27). La heredabilidad estimada de esta característica es moderada (0.27-0.58) e independiente del crecimiento y del nivel productivo(9,28,29,30), sin tener un efecto negativo en otras características económicamente importantes como la calidad de carne producida(15). Así mismo, el CAR reduce el impacto medioambiental de la ganadería, ya que individuos con bajo CAR tienden a producir menor cantidad de metano (CH4) por unidad de materia seca consumida, debido al menor CMS y mejor eficiencia en el uso de la energía(31,32,33). Es por ello que el CAR representa una de las estrategias de mitigación en las emisiones de dióxido de carbono (CO2) y CH4 de la actividad ganadera al ambiente. Entre las principales ventajas obtenidas usando el CAR como criterio de selección, está la mejora en la eficiencia de la alimentación(8,34), incremento en la productividad en el sector cría, y en consecuencia reducción de la superficie utilizada por unidad animal(35). El nuevo índice GIR, además de tener como ventaja la mejora en la eficiencia en la alimentación, permite identificar animales con mayores tasas de crecimiento y una menor proporción de grasa, sin afectar la calidad de la carne y canal; reduciendo los tiempos de confinamiento y sacrificio de los animales, con pesos comerciales a edades tempranas(36). Los estudios que involucran los índices CAR y GIR, han sido realizados principalmente en especies bovinas, porcinas y aves. En el caso de ovinos se han realizado en razas de clima

527


Rev Mex Cienc Pecu 2021;12(2):523-552

templado; aunque, se han reportado cuatro estudios que involucran cruzas de ovinos de pelo de la raza brasileña, destacando la raza Santa Inés y Pantaneira(5,36,37,38), y un estudio en la raza Dorper(39) (Cuadros 1 y 2). En México se comienza a implementar esta herramienta por lo que el número de estudios es reducido, y en ovinos solo se tiene el trabajo realizado con la raza Rambouillet(40), por lo que se desconoce el comportamiento en los ovinos de pelo (Cuadro 1).

Estimación de los indicadores CAR y GIR El CAR, permite determinar el CMS esperado, y es estimado a través de una ecuación de regresión lineal múltiple en función del peso medio metabólico (PMM) y la GDP. El modelo utilizado por Koch et al(9), se muestra a continuación: Yi = β0 + β1 GDPi + β2 PMMi + εi Donde: 𝐘𝐢 = Ingesta de materia seca del i-ésimo animal. 𝛃𝟎 = Intercepto de la regresión. 𝛃𝟏 𝐆𝐃𝐏𝐢 = coeficiente de regresión parcial de la ingesta de materia seca en la i-ésima ganancia diaria de peso del animal. 𝛃𝟐 𝐏𝐌𝐌𝐢 = coeficiente de regresión parcial de ingesta de materia seca del i-ésimo peso medio metabólico del animal. 𝛆𝐢 = error residual en la ingesta de materia seca del i-ésimo animal. Por otro lado, GR nos ayuda a estimar la GDP esperada, mediante regresión lineal múltiple en función del de CMS y PMM. Donde:

𝑌𝑖 = 𝛽0 + 𝛽1൫𝐶𝑀𝑆𝑖 ൯ + 𝛽2൫𝑃𝑀𝑀𝑖 ൯ + Ԑ𝑖 .

Yi= Ganancia de peso del i-ésimo animal. 𝛃𝟎 = Intercepto de la regresión. 𝛃𝟏 𝐂𝐌𝐒𝐢 = coeficiente de regresión parcial de la ganancia diaria de peso del i-ésimo consumo de materia seca del animal. 𝛃𝟐 𝐏𝐌𝐌𝐢 = coeficiente de regresión parcial de la ganancia diaria de peso del i-ésimo peso medio metabólico del animal. 𝛆𝐢 = error residual en la ganancia diaria de peso del i-ésimo animal. Para el cálculo de GIR, se utiliza los dos modelos antes descritos, empleando la siguiente fórmula: 𝐺𝐼𝑅(𝐶𝐴𝑅 ∗ −1) + 𝐺𝑅. El índice requiere una previa estandarización (Media = 0 y Desviación estándar = 1) del CAR y GR.

528


Rev Mex Cienc Pecu 2021;12(2):523-552

Después de determinar el CAR, los animales son clasificados en grupos de CAR alto (>0.5 DE por encima de la media, mayor consumo de alimento de lo esperado para el mantenimiento y producción, por lo tanto, menor eficiencia), CAR medio (±0.5 DE de la media) y CAR bajo (<0.5 DE por debajo de la media, menor consumo de alimento de lo esperado, por lo tanto, mayor eficiencia)(41). El mismo procedimiento de categorización se utiliza para determinar los grupos GIR, sin embargo, un alto GIR nos indica mayor eficiencia y un bajo GIR menor eficiencia.

Factores fisiológicos que intervienen Los mecanismos fisiológicos que están relacionados con una mayor eficiencia en el uso del alimento son numerosos e interrelacionados, sin embargo, no están completamente dilucidados. Richardson y Herd(42), proporcionaron una síntesis de los resultados de una serie de experimentos en bovinos de la raza Angus seleccionados de forma divergente para CAR, y estimaron la proporción de la variación en CAR que explican los siguientes procesos: el recambio proteico, metabolismo y estrés tisular (37 %), digestibilidad (10 %), incremento de calor y fermentación (9 %), actividad física (9 %), composición corporal (5 %) y patrones de alimentación (2 %). Los mecanismos responsables de más de un cuarto de la variación en CAR todavía no se conocen. Posteriormente, estos procesos fisiológicos del animal que se asocian a la variación en la eficiencia en la utilización del alimento se han agrupado en cinco categorías 1) la capacidad de ingesta de alimento, 2) la digestión del alimento, 3) el metabolismo (anabolismo y catabolismo), 4) producción de calor relacionado con la digestión de la dieta y la actividad física, y 5) la termorregulación(30). Conocer los procesos biológicos implicados y el grado en que estos contribuyen en la eficiencia alimenticia de los ovinos de pelo, es de vital importancia, ya que en estas razas es escaza la información. Por lo que es necesario, emprender estudios que ayuden a dilucidar como estos mecanismos favorecen este comportamiento. De esta manera, se podrá seleccionar individuos más eficientes y de mayor productividad.

Consumo de alimento y comportamiento productivo El consumo voluntario de alimento del ganado está regulado por una interacción compleja entre mecanismos de control neuroendocrino y las propiedades fisicoquímicas del alimento, y varía acorde al estado fisiológico del animal(43). Por otra parte, existe una relación entre la ingesta del alimento y la energía que se gasta para digerirse, y a medida que mayor sea la ingesta, mayor será el gasto energético; esto se debe a un aumento en el tamaño de los órganos digestivos y a la energía gastada dentro de los tejidos de dichos órganos(30), a este gasto

529


Rev Mex Cienc Pecu 2021;12(2):523-552

energético se le conoce como incremento de calor en la fermentación y en rumiantes es aproximadamente el 9 % de la ingesta de la energía metabolizable(44). La mayoría de los estudios (Cuadro 1) indican que los ovinos con CAR bajo tienen la misma GDP que animales con CAR alto(5,6,38-40,45-55), debido a que los animales con bajo CAR tienen una mejor eficiencia en el uso de la energía(33). Sin embargo, Rocha et al(37) reportaron diferencias significativas en la GDP, haciendo más notoria la eficiencia en la utilización de la energía; en todos los estudios el CMS fue menor en los animales más eficientes, observándose una diferencia que varía en un rango de 9 a 30 % comparado con los menos eficientes. De este modo, es de esperar que los animales más eficientes presenten una mejor CA (Cuadro 1). Empleando el índice GIR en los estudios realizados en ovinos(5,36,38), se observa que los ovinos clasificados con un alto GIR presentan un menor CMS, mayor GDP, menor CA y mayor eficiencia alimenticia (EA) (Cuadro 2). Aunque la diferencia en el CMS no es tan amplia como en la observada con el CAR, en la GDP se observa una diferencia de hasta 50 g día-1. Por otro lado, la diferencia en la CA es de más de un kilo, por lo que la EA es mayor en los animales con GIR alto. Desde el punto de vista productivo, un menor consumo de alimento y mayores ganancias de peso representan una importante reducción en los costos de operación, aumento de la rentabilidad de las unidades de producción y uso eficiente de la energía suministrada, considerando que la alimentación representa el mayor costo de producción en los sistemas de producción animal.

Producción de metano El ecosistema microbiano del rumen es extremadamente diverso, habitado por filotipos de los dominios Eucariota, Arqueas y Bacterias interactuando entre ellos, el alimento y el hospedero, con densidades de 1010 bacterias mL-1, 106 protozoos mL-1, y 103 hongos ml-1 de fluido ruminal(56). La diversidad y la concentración de organismos que habitan en el rumen están influenciados por diversos factores, tales como: la dieta, la raza, la edad y la salud del huésped, el ambiente y la ubicación geográfica(57). Sin embargo, la dieta es considerada como la principal determinante de diversidad de microorganismos ruminales y del parámetro de fermentación en bovinos y ovinos(58). En este sentido, los animales alimentados con forraje tienen un ecosistema microbiano más diverso y es más frecuente encontrar grupos metanogénicos, en comparación con aquellos con dieta alta en concentrados(59). Lo que implica una mayor utilización del H2 libre (producido por una fermentación más acética) para la reducción del CO2 en CH4(60).

530


Rev Mex Cienc Pecu 2021;12(2):523-552

Los resultados reportados por Henderson et al(61), indican que independientemente del tipo de dieta y ubicación geográfica, hay un microbioma central en el rumen compuesto por siete grupos que conforman el 67.1 % de las secuencias bacterianas presentes en las muestras globales analizadas. Este grupo central está constituido por los géneros Prevotella, Butyrivibrio, Ruminicoccus, Lachnospiraceae, Ruminococcaceae, Bacteroidales y Clostridiales. Sin embargo, algunos géneros se encuentran en mayor abundancia relativa con un tipo de dieta, citando entre ellos a Bacteroidales, Clostridiales, Fibrobacter, y Ruminococcaceae que son más abundantes en animales alimentados con forrajes, mientras que Prevotella y Succinivibrionaceae en dietas que contienen concentrados. Por otro lado, en el mismo estudio, reportaron que la población de arqueas está constituido principalmente por los miembros de Methanobrevibacter gottschalkii y Methanobrevibacter ruminantium, representando el 74 % de todas las arqueas dentro del rumen. Otras especies encontradas fueron Methanosphaera sp. y dos grupos pertenecientes a Methanomassiliicoccaceae, estas cinco especies constituyeron el 89 % del total de las arqueas; siendo estas Methanobacterias unas de las principales especies que utilizan los H2 libres para reducir el C02 a CH4(62), por lo que están asociados a dietas fibrosas, donde la fermentación es más acética y la liberación de H2 es mayor. Estudios recientes indican que existe una relación entre la eficiencia alimenticia y la producción de metano, CH4(31,62,63). Se ha reportado que las comunidades metanogénicas en animales con alto CAR son más diversas comparadas con los animales eficientes, presentando una alta prevalencia de Methanosphaera stadtmaniae y Methanobrevibacter sp. En este sentido, los animales con CAR alto tienen mayores emisiones de dióxido de carbono (CO2) y CH4, esto es debido al mayor consumo de compuestos fibrosos, los cuales aumentan la producción de CH4 ruminal. En animales con CAR bajo, se ha observado que tienden a modificar los consorcios bacterianos, por lo cual utilizan los compuestos fibrosos de la ración con más eficiencia, reduciendo con esto la tasa de pasaje y aumentando la digestibilidad, fermentando completamente las raciones a nivel ruminal(62). En ovinos, se han reportado diferencia significativa en emisiones de CH4 en hembras utilizando modelos estadísticos de predicción, siendo menores en aquellas con CAR bajo y CAR medio comparadas contra CAR alto (0.025a. 0.028a y 0.032b CH4 kg-1 día-1, respectivamente). Sin embargo, no encontraron diferencias estadísticas en machos para emisiones de CH4, debido a una pobre diferencia observada en el CMS entre animales eficientes e ineficientes(40). Así mismo, una mayor eficiencia podría estar relacionada con la presencia de bacterias que modifican el patrón de fermentación hacia una fermentación más propiónica, lo cual favorece la ganancia de peso(33). El propionato es considerado el principal sustrato contribuyente al proceso de gluconeogénesis y formación de glucosa, la cual es requerida como fuente de energía en la síntesis de proteína(43). En este sentido, se ha reportado una mayor concentración 531


Rev Mex Cienc Pecu 2021;12(2):523-552

de propionato en ovinos altamente eficientes (CAR bajo) alimentados con concentrados, comparado con los menos eficientes (41.2 vs 30.2 % Molar)(6). Por lo tanto, la selección de animales a través de los índices de eficiencia alimenticia, también podría contribuir con la reducción de la emisión de gases de efecto invernadero (GEI) producidas por la ganadería ovina.

Genes candidatos asociados a eficiencia alimenticia Diversos estudios han reportado una gran cantidad de polimorfismos de un solo nucleótido (SNP por sus siglas en inglés, “Single Nucleotide Polymorphism”) asociados con la eficiencia alimenticia en bovinos(64-67), aunque son pocos los trabajos en ovinos. Conocer o determinar los genes que están asociados u implicados en los procesos biológicos relacionados con características productivas deseables (eficiencia alimenticia y calidad de carne) de los animales domésticos(20,55,68-86), ayuda a entender la relación entre estos parámetros y poder utilizar estos genes como marcadores moleculares para la selección de animales con que pueden trasmitir características deseadas a su progenie (Cuadro 3). Cockrum et al(87) identificaron marcadores mediante el análisis de asociación del genoma completo (GWAS) que alcanzaron un umbral nominal P <3.02-4 en genes ovinos asociados a CAR, siendo los genes de la Familia Dedos de Zinc 1 (Glis1), Factor de transcripción SRY caja -5 y -6 (Sox5, Sox6) y la Proteína Accesoria 1 del Receptor de Interleucina (Il1rapl1) los genes candidatos. Otro gen asociado a este índice es el Receptor de Leptina (Lepr). También se ha reportado la asociación de un SNP en el exón 2 de Lepr en ovejas en etapa de lactación (P<0.05), siendo el genotipo homocigoto CC con mayor CAR (2.579a) comparado con los genotipos TC (1.218b) y TT (1.005b)(88). Estudios recientes han reportado la asociación de la GDP con SNP de genes que pueden ser considerados en la selección de animales con mejor desempeño productivo. Por ejemplo, se han identificado tres genes relacionados con la GDP en ovinos, ubicado en el cromosoma 8 el gen Triadina (Trdn) y en el cromosoma 26 los genes 3-Oxoacil-ACP Sintasa (Oxsm) y el Receptor de Ácido Retinoico Beta (Rarb)(89). Así mismo, se ha relacionado el gen Leptina (Lep) con GDP, con diferencias significativas (P<0.05) en la GDP (destete-seis meses) en los genotipos heterocigoto BC, AB y AC que en los homocigotos AA y CC (116, 103, 99, 94 y 94 g día-1, respectivamente)(90). En genotipos de la hormona del crecimiento (Gh) en la raza Salsk, se encontraron diferencias significativas (P<0.001), siendo el genotipo AB superior al AA (128.64 vs 81.51 g día-1)(91). También, se ha asociado al gen Receptor de Melanocortina4 (Mc4r) con la GDP, un SNP localizando en la región no traducida 3´ del gen (NM_001126370.2) provoca una variación de nucleótido en la posición 1016 G>A, observándose que el genotipo heterocigoto GA fue superior al homocigoto GG a los 120 días (210.23 vs 192.01 g/día) y 180 días (166.35 vs 155.66 g/día) de engorda; así mismo se detectó

532


Rev Mex Cienc Pecu 2021;12(2):523-552

el SNP 292 G>A con una variación en el aminoácido 98 Gly>Arg, el cual tuvo efecto sobre el área del músculo Longisimus dorsi(92). Se ha reportado la asociación de la conversión alimenticia (CA) con algunos genes. En el exón 3 del gen Lep en ovejas lactantes, se encontraron diferencias significativas (P<0.001) en los genotipos de un SNP con variación en aminoácidos (c.314 G>A, Arg>Gln); el genotipo GG presentó menor CA (2.019 kg) comparada con el genotipo AG (3.886 kg) en la producción de leche(88). Así mismo, se encontró un efecto positivo de dos mutaciones sinónimas g.1429 C>A y g.1117 A>C en los genes Adrenoreceptor alfa 2A (Adra2a) y Receptor de Rianodina 2 (Ryr2) con este indicador de eficiencia, en Adra2a se identificaron tres genotipos CC, CA y AA, donde el homocigoto CC presentó menor CA (4.67b, 5.18a y 5.14a kg, respectivamente). Por su parte en Ryr2, fueron identificados genotipos similares, aunque el homocigoto presentó menor CA pero estadísticamente fue similar al genotipo CC (5.14b, 5.08b y 5.46a kg, respectivamente)(55). Recientemente, se reportó la asociación de los genes de la Familia GDNF Receptor Alfa 1 (Gfra1) y gen Fosfodiesterasa (Pde8b) con la EA en ovinos Santa Inés(93). Los genes implicados en la eficiencia alimenticia pueden ser de gran ayuda para identificar mediante técnicas moleculares a los individuos superiores. Estas técnicas, han sido pobremente empleadas en los ovinos de pelo, por lo que su uso permitirá identificar y seleccionar a muy temprana edad aquellos individuos con mayor eficiencia alimenticia, reduciendo el intervalo generacional.

Calidad de carne y genes candidatos asociados Los resultados en estudios realizados en ovinos(5,37,39,46-49,51), sugieren que las características de la canal (área del longissimus, espesor de la grasa subcutánea y profundidad del músculo longissimus), no se ven afectados negativamente al seleccionar por el índice CAR, mientras que, en el rendimiento de la canal existen tendencias a haber una diferencia significativa (P<0.1) entre animales eficientes e ineficientes(37,54). Por otro lado, se han reportado la asociación de genes con los parámetros físico-químicos que determinan la calidad de la carne, tales como el pH, terneza, capacidad de retención de agua, y color. pH En los pequeños rumiantes un pH normal para la carne debe estar en un rango de 5.5 a 5.8(94), y está relacionado con las características deseables en la calidad de la carne, como el color, fuerza de corte y capacidad de retención de agua(95). Algunos estudios han demostrado la relación que existe entre el pH y el polimorfismo de algunos genes. Se ha informado la asociación del gen Lep (intrón 2, g.103 A>G) en la raza Suffolk, identificando los genotipos

533


Rev Mex Cienc Pecu 2021;12(2):523-552

AA y AG, siendo el genotipo homocigoto que presentó menor pH 5.53 vs 5.70 para el heterocigoto (P<0.05)(96). Por otro lado, se identificaron genotipos del gen de la Proteína de Unión a Ácidos Grasos (Fabp4) en ovejas chinas con efecto sobre el pH (P<0.1). El genotipo heterocigoto AG presentó menor pH (6.3), mientras que AA y GG presentaron un valor de 6.5(97), aunque el pH final fue superior al reportado como deseable en la literatura(94). Terneza A medida que comienza el proceso de rigor mortis, los sarcómeros se acortan y se produce una contracción transversal de la miofibrilla, dando como resultado un aumento de la resistencia al corte. La reducción en el espacio entre miofilamentos dentro de la miofibrilla aumenta la densidad de las proteínas en un área definida, y es probable que esta reducción de espacio, disminuya la acción enzimática de las proteasas encargadas de la degradación de proteínas miofibrilares, afectando la terneza de la carne(98). Conjuntamente, con el descenso de la temperatura y el pH en la canal, y el aumento del calcio citoplasmático, se favorece la activación de las enzimas proteolíticas como las caspasas y las calpaínas(95), lo cual beneficia la terneza de la carne. Se ha reportado que la actividad de las calpaínas es responsable hasta en un 90% del ablandamiento proteolítico de la carne(99). Otros sistemas proteolíticos presentes en el músculo como las proteasas lisosómicas y el complejo de proteasoma multicatalítico están involucrados en la proteólisis del citoesqueleto y ablandamiento de la carne, aunque en menor proporción(100). En ovinos se ha reportado la relación de algunos genes con la fuerza de corte, destacando el gen Calpastatina (Cast) como el principal gen relacionado con la textura. Se han reportado diferencias significativas entre los genotipos del gen Cast (B, C, D, I) en razas Iranies(101), donde el genotipo I requirió una fuerza al corte de 8.39 kg y el genotipo C una fuerza de 12.69 kg, siendo más deseable ovinos del genotipo I para este parámetro. Además, se reportó una variación en el nucleótido 197A>T en el exón 6 del gen Cast, provocando un cambio en el aminoácido 66 Glutamina (Gln)>Leucina (Leu), donde el genotipo heterocigoto AT presentó menor fuerza al corte que el homocigoto AA (6.68 vs 8.71 kg). Para este mismo gen, se encontró la presencia de dos genotipos en la raza Awassi, con diferencias significativas (P<0.05) en la fuerza utilizada, presentando el genotipo MN mayor fuerza que el genotipo MM (4.36 y 3.98 kg, respectivamente)(102). En razas chinas, se ha reportado la asociación de genotipos del gen Diacilglicerol O-Aciltransferasa 1 (Dgat1) y la terneza, en el genotipo TT se necesitó menor fuerza que TC y CC (2.30, 2.69 y 2.73 kg) (103). También en razas chinas, se reportó el efecto de genotipos en el gen Fabp4 con la terneza, el genotipo AA presento mayor terneza que los genotipos AG y GG (2.24, 2.78 y 2.88 kg, respectivamente, P<0.05)(97). Otro gen asociado a este parámetro es el gen Lep; citando el polimorfismo en este gen (intrón 2, g.103 A>G) en la raza Suffolk, siendo el genotipo homocigoto AA quien presentó menor fuerza al corte que el genotipo AG (3.6 y 4.7 kg, respectivamente)(96). 534


Rev Mex Cienc Pecu 2021;12(2):523-552

Capacidad de retención de agua (CRA) La CRA es definida como la habilidad de la carne para retener toda o parte de su propia agua(104), y está estrechamente relacionada con pH y el punto isoeléctrico de las proteínas musculares (pH 5.1-5, carga neta 0), por lo que, si se alcanza este punto, la CRA se reduce al mínimo(98). Este parámetro, es evaluado a través de las pruebas de pérdida por goteo y pérdida por cocción. La primera hace referencia al agua que se pierde derivada de la fuerza de gravedad(105), es decir el agua extracelular. La segunda, es la cantidad de agua que la carne pierde durante la cocción(104). El gen Cast está relacionado con la pérdida por cocción, reportándose diferencias (P<0.05) entre los genotipos MM y MN en ovinos Awassi, donde el genotipo homocigoto (MM) presentó el mayor porcentaje de pérdida de agua (48.45 y 45.69 %, respectivamente)(102). Por otro lado, se han reportado genes asociados al parámetro pérdida por goteo y se identificaron tres genotipos en el gen Dgat1, el genotipo TT presentó menor pérdida de agua, mientras que en TC y CC las pérdidas fueron similares (67.1, 92.6 y 92.4 g kg-1)(103). Así mismo, se ha reportado que el gen Fabp4 está asociado al parámetro, donde reportan la identificación de los genotipos AA, AG y GG; el genotipo AA presentó un menor porcentaje de pérdida (8.86, 9.48 y 9.39 %, respectivamente), aunque estadísticamente no hubo diferencias significativas (P<0.1)(97). Así mismo, polimorfismos en el gen Calpaína Subunidad 1 (Capns1) han sido asociados a CRA, identificando cinco genotipos con diferencia en el porcentaje de pérdida de humedad (P<0.01); el genotipo B1B1 presentó 4.11 % mientras que los genotipos A1A1, A1B1, A1C1 y B1C1 estuvieron en un rango de 2.23 a 3.30 %(14). Además, dos genotipos en el gen de la Insulina como Factor de Crecimiento 1 (Igf-1) con efectos significativos sobre la pérdida por goteo han sido reportados, el genotipo homocigoto AA registró un 2.47 % de pérdida, mientras que el heterocigoto AB un 3.33 %(106). También el polimorfismo en el gen de la Miostatina (Mstn) ha sido asociado a este parámetro, se reportó la identificación de dos genotipos, obteniendo diferencias significativas (P<0.05) en el porcentaje de pérdida de agua, siendo el genotipo AA que registró un 2.5 % mientras que AE un 3.5 %(107). Color El color de la carne es en gran medida el principal factor atractivo para el cliente, ya que perciben en este parámetro una señal de frescura y calidad, por lo que un color rojo en una carne ovina es preferible. El color de la carne cambia a medida que los pigmentos de mioglobina en la superficie de la carne entran en contacto con el oxígeno, y van de deoxymioglobina (púrpura), oxymioglobina (rojo), hasta metamioglobina (marrón)(108). Los valores de CIE-L* (negro-blanco), a*(rojo-verde) y b*(azul-amarillo) han sido utilizados para cuantificar el color de la carne, siendo utilizada una relación de reflectancia de la luz en las longitudes de onda de 630 nm y 580 nm para detectar cambios químicos en la carne debido a la oxigenación u oxidación de la mioglobina(109). 535


Rev Mex Cienc Pecu 2021;12(2):523-552

Al respecto, se ha reportado diferencias significativas (P<0.05) entre los genotipos del gen Capns1 y las coordenadas de reflectancia L*, observando dos genotipos homocigotos A1A1 y B1B1 y tres heterocigotos A1B1, A1C1 y B1C1 en ovinos de la raza Merino, donde el genotipo B1B1 y A1C1 presentaron la menor y mayor unidades de luminosidad (38.05 y 41.13, respectivamente)(14). Al igual que las calpaínas, el antagonista de esta enzima Cast es asociada al color, se han encontrado diferencias (P<0.05) para L* entre los genotipos MM y MN en ovinos Awassi, el genotipo homocigoto presentó mayor luminosidad (37.60 y 32.47, respectivamente)(102). Para el gen Estearoil-CoA Desaturasa (Scd) en ovinos Iraníes, fueron identificados dos genotipos A y B, los cuales presentaron diferencias significativas para L* y a*, el genotipo B presentó mayor luminosidad L* (40.96 y 43.16, respectivamente), mientras que A presentó un mayor valor al color rojo a* (16.0 y 15.08, respectivamente)(110). En los ovinos de pelo, no existen investigaciones donde se evalúen los genes relacionados con características de la canal y la calidad de carne de importancia económica. Por lo que, evaluar genes relacionados a estos rasgos mediante técnicas moleculares, es de gran importancia para acelerar el mejoramiento genético de las razas de pelo.

Conclusiones El CAR y GIR son índices que permiten identificar y seleccionar individuos eficientes en el uso del alimento y, en ovinos no se ha encontrado un efecto negativo sobre las características de la canal. Esta característica deseable (eficiencia) es de moderada heredabilidad, y está asociada a múltiples genes que pueden ser utilizados como marcadores moleculares para el mejoramiento genético. Por lo que, realizar trabajos de investigación que incluyan estos índices y el uso de técnicas moleculares en la selección y mejoramiento genético de ovinos de pelo, podría permitir predecir el comportamiento animal. Además, existen genes relacionados a rasgos de la canal y calidad de carne de importancia económica, que pueden ser incluidos en los programas de mejoramiento genético de estas razas. Con ello se podrá impulsar un mayor desarrollo de la ovinocultura, debido a que, individuos más eficientes tienen una menor ingesta sin afectar la tasa de crecimiento (CAR) o mayor ganancia de peso con ingestas similares de alimento (GIR), reduciendo los costos de producción e incrementando la rentabilidad de las unidades de producción. Además de producir alimentos de calidad que exige el mercado global y, contribuyendo en la reducción la huella ecológica de la ganadería.

536


Rev Mex Cienc Pecu 2021;12(2):523-552

Literatura citada: 1. FAO. Faostat database. 2020. http://www.fao.org/faostat/en/#home, Consultado: 20 Ene, 2020. 2. SIAP. Ovino Población Ganadera 2009-2018. https://www.gob.mx/cms/uploads/attachment/file/516348/Inventario_2018_Ovino.pdf, Consultado: 15 Ene, 2020. 3. PROGAN. Programa Nacional Ganadero. SAGARPA. 2010. http://www.sagarpa.gob.mx/ganaderia/Programas/Paginas/PROGRAM.aspx 4. Chay-Canul AJ, Magaña-Monforte JG, Chizzotti ML, Piñeiro-Vázquez AT, Canul-Solís JR, Ayala-Burgos AJ, et al. Energy requirements of hair sheep in the tropical regions of Latin America. Review. Rev Mex Cien Pecu 2016;7(1):105-125. 5. Lima NLL, Ribeiro CRF, De Sá HCM, Júnior IL, Cavalcanti LFL, Santana RAV, et al. Economic analysis, performance, and feed efficiency in feedlot lambs. Rev Bras Zoot 2017;46(10):821-829. 6. Ellison MJ, Conant GC, Lamberson WR, Cockrum RR, Austin KJ, Rule DC, et al. Diet and feed efficiency status affect rumen microbial profiles of sheep. Small Ruminant Res 2017;(156):12-19. 7. Cantalapiedra-Hijar, G, Abo-Ismail M, Carstens, GE, Guan LL, Hegarty R, Kenny DA, et al. Review: Biological determinants of between-animal variation in feed efficiency of growing beef cattle. Animal 2018;12(S2):s321-s335. 8. Arthur JPF, Herd RM. Residual feed intake in beef cattle. Rev Bras Zootecn 2008;37(Suppl):269-279. 9. Koch RM, Swiger LA, Chambers D, Gregory KE. Efficiency of feed use in beef cattle. J Anim Sci 1963;(22):486-494. 10. Bezerra L, Sarmento J, Neto S, Paula N, Oliveira R, Rêgo W. Residual feed intake: a nutritional tool for genetic improvement. Trop Anim Health Prod 2013;(45):1649-1661. 11. Fitzsimons C, Kenny DA, McGee M. Visceral organ weights, digestion and carcass characteristics of beef bulls differing in residual feed intake offered a high concentrate diet. Animal 2014;(8):949-959. 12. Berry DP, Crowley JJ. Residual intake and gain: A new measure of efficiency in growing cattle. J Anim Sci 2012;(90):109-115. 13. Becker T. Consumer perception of fresh meat quality: a framework for analysis. Brit Food J 2000;(102):158-176.

537


Rev Mex Cienc Pecu 2021;12(2):523-552

14. Grochowska E, Borys B, Grzeskowiak E, Mroczkowski S. Effect of the calpain small subunit 1 gene (CAPNS1) polymorphism on meat quality traits in sheep. Small Ruminant Res 2017;(150):15-21. 15. Baker SD, Szasz JI, Klein TA, Kuber PS, Hunt CW, Glaze JBJr, et al. Residual feed intake of purebred Angus steers: Effects on meat quality and palatability. J Anim Sci 2006;(84):938-945. 16. Perkins SD, Key CN, Garrett CF, Foradori CD, Bratcher CL, Kriese-Anderson LA, Brandebourg TD. Residual feed intake studies in Angus-sired cattle reveal a potential role for hypothalamic gene expression in regulating feed efficiency. J Anim Sci 2014;92(2):549-560. 17. Gomes RC, Sainz RD, Silva SL, César MC, Bonin MN, Leme PR. Feedlot performance, feed efficiency reranking, carcass traits, body composition, energy requirements, meat quality and calpain system activity in Nellore steers with low and high residual feed intake. Livest Sci 2012;(150):265-273. 18. Fidelis HA, Bonilha SFM, Tedeschi LO, Branco RH, Cyrillo JNSG, Mercadante MEZ. Residual feed intake, carcass traits and meat quality in Nellore cattle. Meat Sci 2017;(128):34-39. 19. Zorzi K, Bonilha SFM, Queiroz AC, Branco RH, Sobrinho TL, Duarte MS. Meat quality of young Nellore bulls with low and high residual feed intake. Meat Sci 2013;(93):593599. 20. Koohmaraie M, Kent MP, Shackelford SD, Veiseth E, Wheeler TL. Meat tenderness and muscle growth: is there any relationship?. Meat Sci 2002;62(3):345-352. 21. Castro-Bulle FCP, Paulino PV, Sanches AC, Sainz RD. Growth, carcass quality, and protein and energy metabolism in beef cattle with different growth potentials and residual feed intakes. J Anim Sci 2007;85(4):928-936. 22. McDonagh M, Herd R, Richardson E, Oddy V, Archer J, Arthur P. Meat quality and the calpain system of feedlot steers following a single generation of divergent selection for residual feed intake. Aust J Exp Agric 2001;(41):1013-1021. 23. Blasco A, Toro MA. A short critical history of the application of genomics to animal breeding. Livest Sci 2014;(166):4-9. 24. Benavides FJ, Guénet JL. Mouse genomics. In: Hedrich HJ editor. The laboratory mouse. 2nd ed. London: Elservier; 2012:57-90.

538


Rev Mex Cienc Pecu 2021;12(2):523-552

25. Singh U, Deb R, Rahman AR, Alex R, Kumar S, Chakraborty S, et al. Molecular markers and their applications in cattle genetic research: A review. Biomark Genom Med 2014;(6):49-58. 26. Archer JA, Reverter A, Herd RM, Johnston DJ, Arthur PF. Genetic variation in feed intake and efficiency of mature beef cows and relationships with post-weaning measurements. In: 7th World Congress Genetics Applied to Livestock Production. Montpellier, France. 2002:221-225. 27. Basarab JA, McCartney D, Okine EK, Baron VS. Relationships between progeny residual feed intake and dam productivity traits. Can J Anim Sci 2007;(87):489-502. 28. Crews JrDH, Shannon NH, Genswein BMA, Crews RE, Johnson CM, Kendrick BA. Genetic parameters for net feed efficiency of beef cattle measured during postweaning growing versus finishing periods. Proc West Sect Am Soc Anim Sci 2003;(54):125-128. 29. Steyn Y, Van Marle-Koster E, Theron HE. Residual feed intake as selection tool in South African Bonsmara cattle. Livest Sci 2014;(164):35-38. 30. Herd RM, Arthur PF. Physiological basis for residual feed intake. J Anim Sci 2009;87(E. Suppl):E64-E71. 31. Nkrumah JD, Okine EK, Mathison GW, Schmid K, Li C, Basarab JA, et al. Relationships of feedlot feed efficiency, performance and feeding behavior with metabolic rate, methane production, and energy partitioning in beef cattle. J Anim Sci 2006;(84):145– 153. 32. Hegarty RS, Goopy JP, Herd RM, McCorkell B. Cattle selected for lower residual feed intake have reduced daily methane production. J Anim Sci 2007;(85):1479-1486. 33. Fitzsimons C, Kenny DA, Deighton M, Fahey AG, McGee M. Methane emissions and rumen fermentation variables of beef heifers differing in phenotypic residual feed intake. J Anim Sci 2013;(91):5789-5800. 34. Basarab JA, Price MA, Aalhus JL, Okine EK, Snelling WM, Lyle KL. Residual feed intake and body composition in young growing cattle. Can J Anim Sci 2003;(83):189204. 35. Lanna DP, Almeida R. Residual feed intake, um novo critério para seleção?. In: V Simpósio da Sociedade Brasileira de Melhoramento Animal. 2004:1-12. Disponible en: http://www.sbmaonline.org.br/anais/v/palestras/palest04.pdf>. Accessed: Dec 10, 2019.

539


Rev Mex Cienc Pecu 2021;12(2):523-552

36. Carneiro MMY, Morais MdaG, Souza ARDL, Fernandes HJ, Feijó GLD, Bonin MdeN, et al. Residual intake and gain for the evaluation of performance, non-carcass components, and carcass characteristics of confined crossbred Texel lambs. Rev Bras Zoot 2019;(48):e2018206. 37. Rocha RFAT, Souza ARDL, Morais MDaG, Carneiro MMY, Fernandes HJ, Feijó GLD, et al. Performance, carcass traits, and non-carcass components of feedlot finished lambs from different residual feed intake classes. Semin-Cienc Agrar 2018;39(6):2645-2658. 38. Lima-Montelli NLL, De Almeida AK, Ribeiro CRF, Grobe MD, Abrantes MAF, Lemos GS, et al. Performance, feeding behavior and digestibility of nutrients in lambs with divergent efficiency traits. Small Ruminant Res 2019;(180):50-56. 39. Paula EFE, Monteiro ALG, Prado OR, Cosmo TR, Junior NST, Kulik CH, et al. Medidas de desempenho e eficiência, características da carcaca mensuradas por ultrssonografia e o consumo alimentar residual de ovinos. Rev Acad Ciênc Agrár Ambient 2012;10(2):129-135. 40. Muro-Reyes A, Gutierrez-Banuelos H, Diaz-Garcia LH, Gutierres-Pina FJ, EscarenoSanchez LM, et al. Potential environmental benefits of residual feed intake as strategy to mitigate methane emissions in sheep. J Anim Vet Adv 2011;10(12):1551-1556. 41. Bonilha MSF, Branco HR, Mercadante ZME, Cyrillo GJNS, Monteiro MF, Ribeiro EG. Digestion and metabolism of low and high residual feed intake Nellore bulls. Trop Anim Health Prod 2017;(49):529-535. 42. Richardson EC, Herd RM. Biological basis for variation in residual feed intake in beef cattle. 2. Synthesis of results following divergent selection. Aust J Exp Agric 2004;(44):431-440. 43. Allen MS. Review: Control of feed intake by hepatic oxidation in ruminant animals: integration of homeostasis and homeorhesis. Animal 2020;14(S1):s55-s64. 44. Standing Committee on Agriculture. Feeding standards for Australian livestock. Ruminants. East Melbourne, Australia. CSIRO Publications. 2000. 45. Redden RR, Surber LMM, Roeder BL, Nichols BM, Paterson JA, Kott RW. Residual feed efficiency established in a post-weaning growth test may not result in more efficient ewes on the range. Small Ruminant Res 2011;96(2-3):155-159. 46. Rajai-Sharifabadi H, Zamiri MJ, Rowghani E, Bottje WG. Relationship between the activity of mitochondrial respiratory chain complexes and feed efficiency in fat-tailed Ghezel lambs. J Anim Sci 2012;(90):1807-1815.

540


Rev Mex Cienc Pecu 2021;12(2):523-552

47. Paula EFE, Monteiro ALG, Souza DF, Prado OR, Nomura TM, Stivari TSS, et al. The residual feed intake and its relationship with performance and efficiency measures and in vivo carcass characteristics of lambs. Arq Bras Med Vet Zoot 2013;65(2):566-572. 48. Redden RR, Surber LMM, Grove AV, Kott RW. Growth efficiency of ewe lambs classified into residual feed intake groups and pen fed a restricted amount of feed. Small Ruminant Res 2013;(114):214-219. 49. Redden RR, Surber LMM, Grove AV, Kott RW. Effects of residual feed intake classification and method of alfalfa processing on ewe intake and growth. J Anim Sci 2014;92(2):830-835. 50. Meyer AM, Vraspir RA, Ellison MJ, Cammack KM. The relationship of residual feed intake and visceral organ size in growing lambs fed a concentrate-or forage-based diet. Livest Sci 2015;(176):85-90. 51. Rajai-Sharifabadi H, Naserian AA, Valizadeh R, Nassiry MR, Bottje WG, Redden RR. Growth performance, feed digestibility, body composition, and feeding behavior of high– and low–residual feed intake fat-tailed lambs under moderate feed restriction. J Anim Sci 2016;(94):3382-3388. 52. Liang YS, Li GZ, Li XY, Lü JY, Li FD, Tang DF, et al. Growth performance, rumen fermentation, bacteria composition, and gene expressions involved in intracellular pH regulation of rumen epithelium in finishing Hu lambs differing in residual feed intake phenotype1. J Anim Sci 2017;(95):1727-1738. 53. Zamiri MJ, Mehrabi R, Kavoosi GR, Rajaei-Sharifabadi H. Relationships between the activity of respiratory-chain complexes in pre-(biopsy) or post-slaughter muscle samples and feed efficiency in random-bred Ghezel lambs. Anim Prod Sci 2017;(57):1674-1681. 54. Zhang X, Wang W, Mo F, La Y, Li C, Li F. Association of residual feed intake with growth and slaughtering performance, blood metabolism, and body composition in growing lambs. Sci Rep 2017;(7):12681. 55. Zhang D, Zhang X, Li F, Li C, La Y, Mo F, et al. Transcriptome analysis identifies candidate genes and pathways associated with feed efficiency in Hu Sheep. Front Genet 2019;(10):1183. 56. Singh B, Mal G, Gautam SK, Mukesh M. Gut/rumen microbiome – A livestock and industrial perspective. In: Advances in animal biotechnology. Cham, Switzerland: Springer International Publishing; 2019:17-30.

541


Rev Mex Cienc Pecu 2021;12(2):523-552

57. King EE, Smith RP, St-Pierre B, Wright ADG. Differences in the Rumen Methanogen Populations of Lactating Jersey and Holstein Dairy Cows under the Same Diet Regimen. Appl Environ Microbiol 2011;(76):5682-5687. 58. Carberry CA, Kenny DA, Han S, McCabe MS, Waters SM. Effect of phenotypic residual feed intake and dietary forage content on the rumen microbial community of beef cattle. Appl Environ Microbiol 2012;78(14):4949-4958. 59. Ellison MJ, Conant GC, Cockrum RR, Austin KJ, Truong H, Becchi M, et al. Diet alters both the structure and taxonomy of the ovine gut microbial ecosystem. DNA Res 2014;21(2):115-125. 60. Hristov AN, Oh J, Lee C, Meinen R, Montes F, Ott T, et al. Mitigación de las emisiones de gases de efecto invernadero en la producción ganadera – Una revisión de las opciones técnicas para la reducción de las emisiones de gases diferentes al CO2. En: Gerber PJ, et al editores. Producción y Sanidad Animal FAO, Documento No. 177. FAO, Roma, Italia. 2013:13-17. 61. Henderson G, Cox F, Ganesh S, Jonker A, Young W, Global Rumen Census Collaborators, et al. Rumen microbial community composition varies with diet and host, but a core microbiome is found across a wide geographical range. Sci Rep 2015;(5):14567. 62. Zhou M, Hernández-Sanabria E, Guan LL. Assessment of the microbial ecology of ruminal methanogens in cattle with different feed efficiencies. Appl Environ Microbiol 2009;(75):6524-6533. 63. Paganoni B, Rose G, Macleay C, Jones C, Brown DJ, Kearney G, et al. More feed efficient sheep produce less methane and carbon dioxide when eating high-quality pellets. J Anim Sci 2017;(95):3839–3850. 64. Seabury CM, Oldeschulte DL, Saatchi M, Beever JE, Decker JE, Halley YA, et al. Genome-wide association study for feed efficiency and growth traits in U.S. beef cattle. BMC Genomics 2017;(18):386. 65. Abo-Ismail MK, Lansink N, Akanno E, Karisa BK, Crowley JJ, Moore SS, et al. Development and validation of a small SNP panel for feed efficiency in beef cattle. J Anim Sci 2018;(96):375–397. 66. Higgins MG, Fitzsimons C, McClure MC, McKenna C, Conroy S, Kenny DA, et al. GWAS and eQTL analysis identifies a SNP associated with both residual feed intake and GFRA2 expression in beef cattle. Sci Rep 2018;(8):14301.

542


Rev Mex Cienc Pecu 2021;12(2):523-552

67. Duarte DAS, Newbold CJ, Detmann E, Silva FF, Freitas PHF, Veroneze R, et al. Genome-wide association studies pathway-based meta-analysis for residual feed intake in beef cattle. Anim Genet 2019;(50):150-153. 68. Maekawa M, Yamaguchi K, Nakamura T, Shibukawa R, Kodanaka I, Ichisaka T, et al. Direct reprogramming of somatic cells is promoted by maternal transcription factor GLIS1. Nature 2011;(474):225–229. 69. Han Y, Lefebvre V. L-Sox5 and Sox6 drive expression of the aggrecan gene in cartilage by securing binding of Sox9 to a far-upstream enhancer. Mol Cell Biol 2008;(28):4999– 5013. 70. Montani C, Gritti L, Beretta S, Verpelli C, Sala C. The synaptic and neuronal functions of the x-linked intellectual disability protein interleukin-1 receptor accessory protein like 1 (IL1RAPL1). Dev Neurobiol 2019;79(1):85-95. 71. Ladyman SR, Grattan DR. Review JAK-STAT and feeding. JAK-STAT 2013;(2):e23675. 72. Roux-Buisson N, Cacheux M, Fourest-Lieuvin A, Fauconnier J, Brocard J, Denjoy I, et al. Absence of triadin, a protein of the calcium release complex, is responsible for cardiac arrhythmia with sudden death in human. Hum Mol Genet 2012;21(12):27592767. 73. Gao T, Qian S, Shen S, Zhang X, Liu J, Jia W, et al. Reduction of mitochondrial 3oxoacyl-ACP synthase (OXSM) by hyperglycemia is associated with deficiency of αlipoic acid synthetic pathway in kidney of diabetic mice. Biochem Bioph Res Co 2019;512(1):106-111. 74. Mark M, Ghyselinck NB, Chambon P. Function of retinoid nuclear receptors: lessons from genetic and pharmacological dissections of the retinoic acid signaling pathway during mouse embryogenesis. Annu Rev Pharmacol Toxycol 2006;46:451-480. 75. Houseknecht KL, Portocarrero CP. Leptin and its receptors: regulators of whole-body energy homeostasis. Domest Anim Endocrinol 1998;15(6):457-75. 76. Akers RM. Major advances associated with hormone and growth factor regulation of mammary growth and lactation in dairy cows. J Dairy Sci 2006;89(4):1222-1234. 77. Cone RD. Anatomy and regulation of the central melanocortin system. Nat Neurosci 2005;(8):571-578. 78. Lima JJ, Feng H, Duckworth L, Sylvester JE, Kissoon N, Garg H. Association analyses of adrenergic receptor polymorphisms with obesity and metabolic alterations. Metabolism 2007;(56):757-765. 543


Rev Mex Cienc Pecu 2021;12(2):523-552

79. Hayashi M, Matsushima K, Ohashi H, Tsunoda H, Murase S, Kawarada Y, Tanaka T. Molecular cloning and characterization of human PDE8B, a novel thyroid-specific isozyme of 3′,5′-cyclic nucleotide phosphodiesterase. Biochem Bioph Res Co 1998;250:751–756. 80. Kopp P. Thyroid hormone synthesis. In: Braverman LE, Utiger RD, editors. The thyroid. A fundamental and clinical text. New York: Lippincott; 2005:52–76. 81. Paratcha G, Ledda F, Baars L, Coulpier M, Besset V, Anders J, et al. Released GFRalpha1 potentiates downstream signaling, neuronal survival, and differentiation via a novel mechanism of recruitment of c-ret to lipid rafts. Neuron 2001;(29):171-184. 82. Yan W, Zhou H, Hu J, Luo Y, Hickford JGH. Variation in the FABP4 gene affects carcass and growth traits in sheep. Meat Sci 2018;(145):334-339. 83. Yen CL, Stone SJ, Koliwad S, Harris C, Farese RV Jr. DGAT enzymes and triacylglycerol biosynthesis. J Lipid Res 2008;49(11):2283-2301. 84. Rechler MM, Nissley SP. Insulin-Like Growth Factors. In: Sporn MB, Roberts AB editors. Peptide growth factors and their receptors I. Springer, New York, NY: Springer Study Edition; 1991:263-267. 85. Tellam RL, Cockett NE, Vuocolo T, Bidwell CA. Genes contributing to genetic variation of muscling in sheep. Front Genet 2012;(3):164. 86. Sampath H, Ntambi JM. Stearoyl-coenzyme A desaturase 1, sterol regulatory element binding protein-1c and peroxisome proliferator-activated receptor-α: independent and interactive roles in the regulation of lipid metabolism. Curr Opin Clin Nutr 2006;9(2):84-88. 87. Cockrum RR, Pickering NK, Anderson RM, Hyndman DL, Bixley MJ, Dodds KG, et al. Identification of single nucleotide polymorphisms associated with feed efficiency in rams. Proc West Sect Am Soc Anim Sci 2012;(63):79-83. 88. Jonas E, Martin GB, Celi P, Li L, Soattin M, Thomson PC, et al. Association of polymorphisms in leptin and leptin receptor genes with circulating leptin concentrations, production and efficiency traits in sheep. Small Ruminant Res 2016;(136):78-86. 89. Zhang L, Liu J, Zhao F, Ren H, Xu L, Lu J, et al. Genome-wide association studies for growth and meat production traits in sheep. Plos One 2013;8(6):e66569. 90. Hajihosseinlo A, Hashemi A, Sadeghi S. Association between polymorphism in exon 3 of leptin gene and growth traits in the Makooei sheep of Iran. Livest Res Rural Dev 2012;24(166). http://www.lrrd.org/lrrd24/9/haji24166.htm. Accessed Nov 22, 2019.

544


Rev Mex Cienc Pecu 2021;12(2):523-552

91. Gorlov IF, Kolosov YA, Shirikova NV, Getmantseva LV, Slozhenjina MI, Mosolova NI, et al. Association of the growth hormone gene polymorphism with growth traits in Salsk sheep breed. Small Ruminant Res 2017;(150):11-14. 92. Zou B, Liu G, Peng Y, Qian H, Liu J, Jiang X, Mara A. Melanocortin-4 receptor (MC4R) polymorphisms are associated with growth and meat quality traits in sheep. Mol Biol Rep 2014;(41):6967-6974. 93. Alvarenga AB, Rovadoscki GA, Petrini J, dos Santos ACP, Coutinho LL, Mourão GB, et al. Novelty SNPs for feed efficiency in Santa Inês breed sheep. In: Proc Int Meeting Adv Anim Sci. Campinas: GALOÁ. 2018. https://proceedings.science/imas/papers/novelty-snps-for-feed-efficiency-in-santa-inesbreed-sheep?lang=en. Accessed Nov 21, 2019. 94. De Almeida RFC, Françozo MC, Ludovico A. Fatty acid profile and lambs’ meat quality fed with different levels of crude glycerin replacing corn. Semin-Cienc Agrar 2017;38(4):2051–2064. 95. Corazzin M, Del Bianco S, Bovolenta S, Piasentier E. Carcass characteristics and meat quality of sheep and goat. In: Lorenzo JM, et al editors. More than beef, pork and chicken-The production, processing, and quality traits of other sources of meat for human diet. Cham, Switzerland: Springer International Publishing; 2019:119-165. 96. Boucher D, Palin MF, Castonguay F, Gariépy C, Pothier F. Detection of polymorphisms in the ovine leptin (LEP) gene: Association of a single nucleotide polymorphism with muscle growth and meat quality traits. Can J Anim Sci 2006;86(1):31-35. 97. Xu QL, Tang GW, Zhang QL, Huang YK, Liu YX, Quan K, et al. The FABP4 gene polymorphism is associated with meat tenderness in three Chinese native sheep breeds. Czech J Anim Sci 2011;(56):1-6. 98. Warner R. Meat: Conversion of Muscle into Meat. In: Caballero B, et al editors. The Encyclopedia of Food and Health. Oxford: Academic Press; 2016:677-684. 99. Gheisari HR, Shekarforoush SS, Aminlari M. Comparative studies on calpain activity of different muscles of cattle, camel, sheep and goat. Iran J Vet Res 2007;8(3):225–230. 100. Koohmaraie M, Geesink GH. Contribution of postmortem muscle biochemistry to the delivery of consistent meat quality with particular focus on the calpain system. Meat Sci 2006;74(1):34–43.

545


Rev Mex Cienc Pecu 2021;12(2):523-552

101. Aali M, Moradi-Shahrbabak H, Moradi-Shahrbabak M, Sadeghi M, Yousefi AR. Association of the calpastatin genotypes, haplotypes, and SNPs with meat quality and fatty acid composition in two Iranian fat- and thin-tailed sheep breeds. Small Ruminant Res 2017;(149):40-51. 102. Jawasreh KI, Jadallah R, Al-Amareen AH, Abdullah AY, Al-Qaisi A, Alrawashdeh IM, et al. Association between MspI calpastatin gene polymorphisms, growth performance, and meat characteristics of Awassi sheep. Indian J Anim Sci 2017;87(5):635-639. 103. Xu QL, Chen YL, Ma RX, Xue P. Polymorphism of DGAT1 associated with intramuscular fat-mediated tenderness in sheep. J Sci Food Agric 2009;(89):232–237. 104. Honikel KO. Water-holding capacity of Meat. In: Pas MFW, et al editors. Muscle development of livestock animals- physiology, genetics, and meat quality. UK: CABI Publishing; 2004:389-399. 105. Fisher K. Drip loss in pork: influencing factors and relation to further meat quality traits. J Anim Breed Genet 2007;124(1):12-18. 106. Grochowska E, Borys B, Janiszewski P, Knapik J, Mroczkowski S. Effect of the IGF-I gene polymorphism on growth, body size, carcass and meat quality traits in Coloured Polish Merino sheep. Arch Anim Breed 2017;(60):161-173. 107. Grochowska E, Borys B, Lisiak D, Mroczkowski S. Genotypic and allelic effects of the myostatin gene (MSTN) on carcass, meat quality, and biometric traits in Colored Polish Merino sheep. Meat Sci 2019;(151):4-17. 108. Calnan HB, Jacob RH, Pethick DW, Gardner GE. Factors affecting the colour of lamb meat from the longissimus muscle during display: The influence of muscle weight and muscle oxidative capacity. Meat Sci 2011;96(2B):1049-1057. 109. Hunt MC, Acton JC, Benedict RC, Calkins CR, Cornforth DP, Jeremiah LE, et al. Guidelines for meat color evaluation. Kansas State University, Manhattan, KS: American Meat Science Association; 1991:1-17. 110. Aali M, Moradi-Shahrbabak H, Moradi-Shahrbabak M, Sadeghi M, Kohram H. Polymorphism in the SCD gene is associated with meat quality and fatty acid composition in Iranian fat and thin tailed sheep breeds. Livest Sci 2016;(188):81-90

546


Rev Mex Cienc Pecu 2021;12(2):523-552

Razas ½D½SI RHS ¾T¼P ½D½SI Dorper Rambouillet Targhee Ghezel Ile de France Targhee Targhee RHS Kurdi Hu Ghezel Hu Hu

Cuadro 1: Parámetros productivos en ovinos clasificados por consumo de alimento residual (CAR) Consumo de alimento residual Bajo Medio Alto Bajo Medio Alto Bajo Medio Alto DCMS Ganancia diaria de peso Consumo de materia seca Conversión alimenticia % b a b a 0.280 0.270 1.24 1.41 4.43 5.15 12.06 0.260 0.240 2.23b 3.22a 30.74 a b ab b b b a b b 0.321 0.277 0.306 1.34 1.35 1.52 4.18 4.90 5.00 11.84 ** ** ** 0.284 0.301 0.286 1.25 1.37 1.44 13.19 b a b a 0.266 0.253 2.63 3.00 5.94 6.91 12.33 c b a 0.180 0.170 0.180 1.39 1.48 1.67 16.77 b b a b a a 0.350 0.330 0.360 1.92 2.02 2.32 6.58 7.71 7.83 17.24 b a b a 0.210 0.200 1.01 1.12 4.95 5.53 9.82 b a 0.329 0.335 1.42 1.63 4.35 4.93 12.88 b b a 0.297 0.302 0.286 2.15 2.31 2.52 14.68 b a 0.294 0.293 2.21 2.43 9.05 b a 2.10 2.89 27.34 b a 0.260 0.260 1.82 2.11 13.74 b a 0.280 0.250 1.50 1.72 12.80 b a 0.280 0.290 1.52 1.72 5.47 5.93 11.63 c b a c b a 0.250 0.260 0.260 1.09 1.25 1.33 4.51 4.84 5.39 18.04 b a b a 0.260 0.270 1.05 1.48 3.92 5.62 29.05

Autor 5 6 37 38 39 40 45 46 47 48 49 50 51 52 53 54 55

DCMS= Diferencia en el consumo de materia seca (%), ½D½SI= ½Dorper ½Santa Inés, RHS= Rambouillet, Hampshire y Suffolk, ¾T¼P= ¾Texel ¼Pantaneira, **, abc= Diferencias significativas.

547


Rev Mex Cienc Pecu 2021;12(2):523-552

Raza ½D½SI ¾T¼P ½D½SI

Cuadro 2: Parámetros productivos en ovinos clasificados por ganancia e ingesta residual (GIR) Ganancia e ingesta residual Bajo Medio Alto Bajo Medio Alto Bajo Medio Alto Bajo Medio Alto Consumo de materia seca Ganancia diaria de peso Conversión alimenticia Eficiencia alimenticia a b b a 1.39 1.31 0.26 0.30 5.32a 4.28b 0.19b 0.23a 1.28 1.27 1.22 0.26b 0.29a 0.31a 4.99a 4.28b 3.91c 0.20c 0.24b 0.26a 1.41 1.37 1.31 0.26** 0.29** 0.30** 5.36* 4.61* 4.27* 0.18* 0.21* 0.23*

½D½SI= ½Dorper ½Santa Inés, ¾T¼P= ¾Texel ¼Pantaneira, *= Datos calculados, **, abc= Diferencias significativas.

548

Autor 5 36 38


Rev Mex Cienc Pecu 2021;12(2):523-552

Cuadro 3: Genes asociados a eficiencia alimenticia y calidad de carne en ovinos Símbolo

Glis1

Gen

Glis Familia Dedos de Zinc 1

Crom

1

Sox5 y Sox6

Factor de transcripción SRY caja -5 y -6

15

Il1rapl1

Proteína Accesoria 1 del Receptor de Interleucina 1

X

Lepr

Receptor de Leptina

1

Proceso biológico Promueve significativamente la reprogramación de fibroblastos en humanos y de ratón, en células madre pluripotentes inducidas durante el desarrollo embrionario. Teniendo una expresión enriquecida en el óvulo fertilizado, expresión moderada en los ovocitos de metafase II y expresión débil en embriones de dos células. Además, está asociado en la regulación de genes (incluido el factor de transcripción Foxa2, múltiples genes de la familia Wnt y Esrrb) implicados en la transición mesenquimal-epitelial, un proceso crítico en la reprogramación de las células somáticas. Su expresión está relacionada con un proceso eficiente de la condrogénesis (desarrollo del cartílago), aunque se requiere del gen Sox9 para activar y mantener genes específicos de condrocitos. Los genes Sox5 y Sox6 aumentan notablemente la actividad transcripcional de Sox9, asegurando su unión al ADN. Relacionado con la discapacidad intelectual y trastornos del espectro autista promovido por la ausencia de la proteína de Il1rapl1. Las mutaciones en Il1rapl1 causan la ausencia de la proteína o la producción de una proteína disfuncional en humanos. Produce una proteína del mismo nombre, que al unirse con la Leptina desencadenan una serie de señales químicas (vía de señalización JAK/STAT) causando la activación del receptor y la transfosforilación de las moléculas JAK asociadas al receptor. Una de las funciones en las que participa esta vía es la homeostasis energética.

549

Parám

Autor

CAR

68-70, 87

CAR

71, 88


Rev Mex Cienc Pecu 2021;12(2):523-552

Trdn

Triadina

8

Oxsm

3-Oxoacil-ACP Sintasa Mitocondrial

26

Rarb

Receptor de ácido Retinoico Beta

26

Lep

Leptina

Gh

Hormona del Crecimiento

11

Mc4r

Receptor de Melanocortina 4

23

4

Contribuye a la regulación de la liberación de Ca2+ a través de los canales de liberación de calcio del retículo sarcoplásmico Ryr2 y Casq2, un paso clave para desencadenar la contracción del músculo GDP esquelético y cardíaco; la ausencia de triadinina es responsable de la arritmia cardiaca con muerte súbita en humanos. Enzima relacionada con la vía sintética de ácido α-lipoico, su actividad es necesaria para el alargamiento de las cadenas de ácidos GDP grasos en la producción de ácido α-lipoico. La deficiencia del ácido α-lipoico representa un factor de riesgo en la patogenia diabética. En general, los receptores de ácido retinoico son esenciales para la señalización de ácido retinoico durante el desarrollo embrionario y la organogénesis. La ausencia de dos isotipos de Rara, Rarb, Rarg GDP en ratones muestra algunos aspectos de los síndromes de la deficiencia de vitamina A en etapas fetal y posnatal, así como algunas malformaciones congénitas. Hormona sintetizada por el tejido adipocito que, desempeña un GDP papel importante en la regulación del apetito y el metabolismo de la CA energía. Además, se ha relacionado con la deposición de grasa en pH mamíferos. Terneza Activación de procesos anabólicos, regulando el aumento en el tamaño corporal y el crecimiento esquelético, controla y coordina el GDP flujo de los procesos metabólicos como la movilización de grasas de depósito, catabolismo de ácidos grasos y glucosa en tejidos. Receptor que se expresa predomiantemente en el núcleo hipotalámico regulador del apetito, su importancia radica en la GDP regulación de la ingesta de alimentos y la homeostasis energética.

550

72-74, 89

75, 90 75, 88 75, 96

76, 91

77, 92


Rev Mex Cienc Pecu 2021;12(2):523-552

Adra2a

Adrenoreceptor Alfa 2A

22

Ryr2

Receptor de Rianodina 2

25

Pde8b

Fosfodiesterasa 8B

7

Gfra1

Familia GDNF Receptor Alfa 1

22

Fabp4

Proteína de Unión a Ácidos Grasos, Adipocito

9

Capns1

Calpaina Subunidad pequeña 1

14

Cast

Calpastatina

5

Regulador de las catecolaminas, asociado con el metabolismo energético. Además, participa en la vía de la adrenalina y puede CA regular el metabolismo energético a través de la secreción de adrenalina, lo que afecta la CA. Principal canal de liberación de Ca2+ del retículo sarcoplasmatico en los miocitos ventriculares, relacionada con enfermedades cardiacas. Además, participa en la vía de la adrenalina y puede regular el CA metabolismo energético a través de la secreción de adrenalina, lo que afecta la CA. Codifica una fosfodiesterasa específica de adenosín monofosfato cíclico, como moduladores genéticos de los niveles de la hormona estimulante de la tiroides. La tiroides sintetiza tiroxina que se une a EA los receptores para controlar vías procesos biológicos, entre ellas la expresión génica, el crecimiento, el desarrollo y el metabolismo. Efecto sobre el receptor de tirosina quinasa, el cual regula la proliferación celular, factores de crecimiento, desarrollo y EA diferenciación neuronal. Conocidas como chaperonas lipídicas intracelulares, tienen la pH función de unir y transportar ácidos grasos de cadena larga en Terneza mamíferos, además de estar asociado con el crecimiento, la CRA deposición de grasa y los rasgos de la canal en el ganado. Principalmente asociado con la degradación de las proteínas CRA miofibrilares post-morten y la generación de aminoácidos libres, Color ocasionando ablandamiento de la carne. Enzima que inhibe la acción de las calpainas, está relacionada con Terneza la regulación de la degradación proteica muscular. La inhibición de la degradación proteica muscular por el sistema calpastatina, CRA

551

51, 55, 72, 78

79-81, 93

82, 97

20, 14 20, 101,102 20, 102


Rev Mex Cienc Pecu 2021;12(2):523-552

Dgat1

Diacilglicerol OAciltransferasa 1

9

Igf-1

Insulina como Factor de Crecimiento 1

3

Mstn

Miostatina

2

Scd

Estearoil-CoA Desaturasa

22

incrementa la eficiencia productiva, pero induce un impacto en la Color terneza o suavidad de la carne producida. Enzima moduladora de la síntesis de triglicéridos y regulación del Terneza flujo de triglicéridos en el cuerpo, así mismo, tiene implicaciones directas en el metabolismo de la glucosa y la enfermedad de la CRA obesidad, resistencia a la insulina y la esteatosis hepática. Involucrado en el control del crecimiento esquelético y la CRA diferenciación celular mediante la activación del ciclo celular. La miostatina es un potente regulador negativo de la masa muscular en mamíferos, siendo las mutaciones naturales en Mstn las que inactivan la proteína codificada o suprimen su cantidad provocando un aumento de la musculatura. Los músculos esqueléticos afectados CRA por estas mutaciones generalmente aumentan el número de miofibrillas (hiperplasia) y, en menor medida, el área transversal de las miofibras (hipertrofia), teniendo un mayor impacto en los individuos homocigotos en comparación con los heterocigotos. Regulador de la síntesis y oxidación lipídica. Color

83, 103

84, 106

85, 107

86, 110

Crom= Cromosoma, Parám= Parámetro, CAR= consumo de alimento residual, GDP= ganancia diaria de peso, CA= conversión alimenticia, EA= eficiencia alimenticia, CRA= capacidad de retención de agua.

552


https://doi.org/10.22319/rmcp.v12i2.5821 Revisión bibliográfica

Análisis de impedancia bioeléctrica (AIB) en la producción animal. Revisión

Larissa Luísa Schumacher a* Julio Viégas a Gilmar dos Santos Cardoso a Anderson Bertoluzzi Moro a Tiago João Tonin a Stela Naetzold Pereira a Leonardo Tombesi da Rocha a Ana Luiza Van Caeneghen a Janaína Vargas Teixeira a

a

Federal University of Santa Maria. Department of Animal Science. Santa Maria, Brazil.

*Autor de correspondencia: larissaluisaschumacher@gmail.com

Resumen: El análisis de impedancia bioeléctrica (AIB) es un método basado en los diferentes niveles de oposición al flujo de una corriente iónica a través de los diversos tejidos corporales. Los resultados se expresan mediante medidas primarias de resistencia (Rs) y reactancia (Xs). A partir de estas medidas, se aplican ecuaciones para determinar el ángulo de fase (AF) y la impedancia (Z). El análisis de bioimpedancia ha sido indicado como un método fiable y preciso para determinar la composición corporal y el estado nutricional en los seres humanos. El AIB se ha adaptado recientemente para ser aplicado en la producción animal. Por lo tanto, el objetivo de esta revisión es proporcionar un análisis sobre el uso potencial de la impedancia bioeléctrica en la producción zootécnica. A través del AIB se pueden establecer correlaciones entre las medidas bioeléctricas y la composición de los tejidos de los cadáveres de los cerdos, los bovinos, los ovinos, los bufalinos y los peces.

553


Rev Mex Cienc Pecu 2021;12(2):553-572

En este sentido, entre el número creciente de demandas destaca la de contar con métodos más precisos y rentables para evaluar la composición corporal en el sector zootécnico, entre los que el análisis de la impedancia bioeléctrica demostró ser una tecnología prometedora y mínimamente invasiva para reemplazar los métodos tradicionales. Palabras clave: Composición corporal, Impedancia, Tecnología, Producción zootécnica.

Recibido:02/10/2020 Aceptado:10/03/2021

Introducción La búsqueda de la excelencia en la calidad dentro de la cadena zootécnica en Brasil y en el mundo ha sido constante. Para mantener el statu quo, debe hacerse hincapié en el uso de tecnologías que garanticen la bioseguridad de los alimentos en la producción animal adaptable a las exigencias de los consumidores. En la literatura existen diferentes métodos para evaluar la calidad y composición de los más diversos productos cárnicos y lácteos. Sin embargo, muchos de estos métodos, como la disección de los cadáveres y la composición física y química, requieren una mano de obra especializada y cualificada, un equipamiento de última generación y unos fondos económicos considerables. Por lo tanto, la investigación y la exploración de tecnologías y metodologías son fundamentales para ayudar a evaluar eficazmente la calidad de los productos zootécnicos. Ante ello, el análisis de impedancia bioeléctrica (AIB) se caracteriza por ser una tecnología de medición rápida, mínimamente invasiva, relativamente rentable y menos subjetiva. El AIB muestra un gran potencial para predecir la composición química de los tejidos de las canales de animales de granja(1) así como para evaluar la calidad de la leche bronca de vaca(2). El análisis AIB se basa en el principio de que los tejidos del cuerpo tienen diferentes impedancias, es decir, una oposición al flujo de una corriente iónica. Dicha impedancia está determinada por las medidas primarias de resistencia (Rs) y reactancia capacitiva (Xc). El flujo de la corriente eléctrica se opone al vector Rs, cuando pasa por entornos intra y extracelulares(3). Del mismo modo, Xc también muestra la oposición al flujo de corriente causado por la capacitancia producida por las membranas celulares(4). Por ello, la búsqueda de métodos alternativos se hace necesaria para determinar y mantener la calidad de los productos zootécnicos si se tiene en cuenta la coyuntura actual.

554


Rev Mex Cienc Pecu 2021;12(2):553-572

En este sentido, esta revisión del artículo pretende relacionar y desvelar el principio del AIB y su uso en la producción animal.

Bioimpedancia eléctrica Los tejidos corporales tienen diferentes niveles de conductividad y oposición al flujo de una corriente iónica debida a su composición químico-física(4). Con base en este principio, el análisis de la bioimpedancia eléctrica se realiza como método de evaluación de la composición corporal, del estado nutricional, de la cantidad total de agua corporal y de las propiedades fisiológicas, y como indicador de varias situaciones clínicas y patológicas, como el pronóstico del cáncer, la desnutrición y la insuficiencia cardíaca(5). Este método es relativamente rentable, mínimamente invasivo y de fácil manejo y aplicación. También ofrece una medición rápida, ya que tarda aproximadamente 5 seg en obtener los datos(6). Además, a diferencia de los métodos tradicionales, el AIB no requiere el sacrificio de los animales para evaluar la composición de los tejidos y el nivel energético, a menos que se realice una disección cuando corresponda(7). Los principios del AIB se han aplicado y adaptado a la producción animal para determinar la composición de los tejidos de los cerdos(8), los bovinos(9), los ovinos(10,11) y los bufalinos(12), así como para evaluar la composición de la leche cruda de vaca(2). Para realizar el AIB, es necesario pasar una corriente iónica a lo largo del cuerpo del animal. La corriente suele ser alterna de baja amplitud (500 a 800 μA) y alta frecuencia, las cuales no pueden ser sentidas por el cuerpo. Normalmente se necesitan cuatro electrodos (un sistema tetrapolar) para aplicar la corriente: un par de electrodos produce la excitación de la corriente mientras que el otro par mide la diferencia de potencial alcanzada(13). En los sistemas biológicos, humanos o animales, el desplazamiento de la corriente se produce a través de los iones disueltos en los fluidos corporales, especialmente los iones de sodio y potasio. La literatura muestra que cuando se aplica la corriente al bioimpedómetro, los diferentes tejidos animales presentan diferente oposición al flujo de la corriente iónica, lo que se denomina impedancia (Z). El valor de la impedancia depende de la frecuencia(4) y es la composición resultante de dos vectores denominados resistencia (Rs) y reactancia (Xc). Cuando la corriente se aplica, se dispersa a través de los iones de los fluidos corporales y es inversamente proporcional a su motilidad y directamente proporcional al área que atraviesa. A partir de los valores primarios de Rs y Xc obtenidos por el bioimpedómetro, se utiliza el modelo matemático propuesto por Lukaski et al(14), que depende de la longitud del conductor, de la frecuencia utilizada y del área de la sección transversal, es decir, del volumen del cuerpo: Z = (Rs² + Xc²)0.5.

555


Rev Mex Cienc Pecu 2021;12(2):553-572

La magnitud de la impedancia se calcula mediante la raíz cuadrada de la suma de los cuadrados de la resistencia y la reactancia combinadas al circuito(14); todas las medidas se expresan en ohmios (Ω). La resistencia se produce por la oposición a la corriente eléctrica cuando fluye a través de los medios intra y extracelulares(3). Lo contrario puede obtenerse mediante la conductancia (C). Según Eickemberg et al(4), la conductancia está en relación inversa con la resistencia (C=1/Rs), es decir, cuanto mayor sea la cantidad de líquido, más débil será la oposición del flujo de corriente. Por lo tanto, la resistencia muestra un comportamiento opuesto a la cantidad de agua en el cuerpo y al nivel de hidratación en estos ambientes. Los fluidos intracelulares están compuestos por el núcleo y el citoplasma, formados en su mayoría por sales, proteínas y agua, los cuales se consideran buenos conductores eléctricos. Asimismo, los materiales conductores, como los iones K y PO-4(15), también forman los fluidos extracelulares. Lo mismo ocurre con los tejidos magros formados por músculos y vísceras, que son buenos conductores de la corriente iónica debido a su gran cantidad de agua y electrolitos. Los tejidos adiposo y óseo, en cambio, conducen la corriente iónica con menor intensidad, que los músculos y las vísceras, pues son muy resistentes(16). Si los tejidos fueran homogéneos, la oposición sería sólo resistiva. Sin embargo, los tejidos son heterogéneos y muestran otro tipo de oposición, la reactancia, que se origina en aquellos tejidos que tienen composición y características de condensadores eléctricos (condensadores) en su estructura producida por las membranas celulares. La capacitancia celular es conocida como una propiedad de almacenamiento de energía (para concentrar electrones) en las interfaces de los tejidos y las membranas celulares durante un corto período, teniendo la característica de retrasar la corriente eléctrica(17). Las membranas citoplasmáticas constan de dos capas de material proteico con propiedades hidrofílicas, que resultan ser buenas conductoras de la electricidad, y una capa aislante de lípidos (la capa dieléctrica). Esas membranas actúan como si fueran un condensador (Xc)(4). Esta evaluación es un indicador de la cantidad de masa magra del cuerpo, que puede relacionarse con la estructura y la función de las membranas celulares, ya que cada componente del tejido responde de manera diferente al flujo de una corriente alterna aplicada(18,19). El método AIB considera que un conductor cilíndrico singular con longitud y área transversal homogéneas representa el cuerpo del animal. Sin embargo, tal afirmación es objetable toda vez que la composición y las áreas transversales de la sección se consideran heterogéneas(20). Por lo tanto, es necesario relacionar el AIB con métodos probados en la literatura para determinar las composiciones químicas y físicas, de modo que sea posible validar el 556


Rev Mex Cienc Pecu 2021;12(2):553-572

método y sus respectivas ecuaciones de predicción, identificar y reducir los errores y hacer que la tecnología sea más fiable y precisa(21). Dado que el análisis AIB también puede proporcionar información sobre la composición corporal, deben tenerse en cuenta factores como la temperatura del cuerpo y del entorno, y la longitud del segmento corporal. Según Hartmann et al(22), la temperatura y la longitud afectan significativamente a las mediciones de resistencia y reactancia, lo que se explica por el aumento de temperatura que potencia la vibración de los átomos. Teniendo en cuenta la naturaleza de los fluidos biológicos, la temperatura presenta un coeficiente negativo para la resistencia, es decir, cuando la temperatura disminuye la resistencia aumenta. En consecuencia, la conductancia disminuye proporcionalmente(6). Otras variables también pueden interferir en la concentración sérica de electrolitos, los puntos de colocación de los electrodos, los tipos de electrodos utilizados, la formación de los usuarios en la aplicación del bioimpedómetro, el uso de materiales no conductores, la calibración del dispositivo, así como la raza, la edad y el peso(3,10). En este sentido, los valores de impedancia están asociados a la cantidad total de agua y a la composición de los tejidos corporales de los animales(6). Además, la impedancia también puede utilizarse como método indirecto para evaluar la calidad bacteriológica de la leche bronca.

Ángulo de fase Cuando se aplica una corriente eléctrica a los tejidos biológicos, se forma un desvío en cuanto la corriente atraviesa las membranas celulares. Una parte de las membranas tiene la capacidad de almacenar energía, lo que significa que debería haber un retraso observable en el flujo de la corriente eléctrica debido a la capacitancia, con lo cual se produce una disminución de la tensión de la corriente(23). Esta característica origina un cambio de fase al no existir sincronía en el condensador entre las variaciones de corriente y tensión, lo cual genera una transformación geométrica del ángulo de la capacitancia que se denomina ángulo de fase (AF)(4). Según Cintra et al(3), el ángulo de fase determinado mediante el AIB es un método para medir la relación existente entre la resistencia y la reactancia en circuitos en serie o en paralelo. Eickemberg et al(4) explicó que puede haber una variación de 0º a 90º, en la que el 0º implica un circuito resistivo sin ninguna membrana celular ni degradación, y el 90º corresponde a un circuito capacitivo en el que todas las membranas celulares tienen líquido extracelular. El AF depende de la capacitancia y se asocia negativamente a la resistencia(24). Se relaciona con la calidad, el tamaño y la integridad celular, ya que su variación indica alteraciones en la composición corporal, en el funcionamiento de la membrana o en las condiciones de salud humana(4).

557


Rev Mex Cienc Pecu 2021;12(2):553-572

Por tanto, el AF puede cuantificarse geométricamente mediante la fórmula AF = (Xc/R), calculada por la relación entre el arco tangente de Xc y Rs, cuyo resultado se expresa en radianes, multiplicándose por (180°/π ≅ 57,296) para convertir en grados(25). La ecuación, según Baumgartner et al(24), es la siguiente: AF = [tan-1(Xc/R) x 180°/π]. Eickemberg et al(4) establecen como valor de normalidad para los individuos sanos una variación entre 4 y 15 grados. Según Selberg y Selberg(26), cuando los valores del AF son mayores, los valores de reactancia muestran la misma tendencia. Estos, a su vez, se relacionan con las buenas condiciones de salud y las membranas celulares intactas. Por el contrario, cuando los índices de AF son bajos, existe una relación con la reactancia, que los asocia a la muerte celular, a la reducción de la permeabilidad selectiva de la membrana celular e incluso a la existencia o empeoramiento de alguna enfermedad(27). Cuando se realizó la evaluación en peces, Cox y Heintz(28) observaron que el ángulo superior a 15º indicaba que los animales estaban en buenas condiciones de salud, mientras que el ángulo inferior a 15º indicaba que las condiciones de salud estaban comprometidas. En este contexto, la AF ha sido ampliamente utilizada como indicador del estado nutricional en seres humanos y en canales de animales, al igual que de la evaluación de la calidad y de la adulteración de la leche cruda de vaca(1,2,9).

El AIB para la evaluación de la composición corporal y las canales de los animales de granja La evaluación de la composición corporal se utiliza con frecuencia para mejorar la gestión y el control zootécnico en el sector de los animales de granja, lo que permite al técnico responsable y al criador seleccionar los animales con mayor rendimiento, adaptándolos al mercado de consumo(16). Los métodos más comúnmente utilizados para predecir la composición y la canal de los animales vivos o sacrificados suelen ser largos, caros e invasivos(10). Por ello, la investigación de nuevas metodologías y tecnologías precisas es fundamental para cumplir con dicha estimación. En este sentido, el AIB es un método mínimamente invasivo y relativamente barato que se ha utilizado en el sector zootécnico para estimar la composición corporal de los animales de granja. En los seres humanos, según Eickemberg et al(4) El AIB se utiliza para evaluar el índice de masa corporal (IMC), ya que toma en cuenta la asociación entre el peso y la altura al cuadrado del paciente (IMC = peso/altura²). Basándose en los principios de la ley de Ohm, algunos investigadores(29) relacionaron el área de la sección transversal con el volumen del cuerpo, describiendo que el volumen de una masa conductora puede ser el cociente entre la altura al cuadrado y la resistencia (V = altura² / Rs). Con el objetivo de reproducir en los animales las ecuaciones de volumen utilizadas en humanos, sustituyeron la altura por la longitud de la canal(30). Berg and Marchello(31) sustituyeron la altura por la longitud del conductor, representada por la distancia entre los 558


Rev Mex Cienc Pecu 2021;12(2):553-572

electrodos que detectan la corriente. En otros trabajos(9) asociaron las composiciones corporales de los animales y las densidades resistiva (DRs) y reactiva (DXc) y describieron la relación entre el peso, el volumen resistivo y el capacitivo, expresado en Kg²/cm² ohmios. Al evaluar el uso potencial del AIB para determinar la composición de la parte blanda de las canales de corderos calientes y frías, se comprobó que las mediciones de AIB obtenidas en canales fríos anticipan sus componentes con mayor precisión que las obtenidas en canales calientes(32). Este hecho se explica por la disminución de la conductancia en respuesta a la pérdida de fluidos durante el enfriamiento, y los cambios en la distribución de los electrolitos entre los entornos intracelular y extracelular en los tejidos. Se pueden utilizar agujas de acupuntura o hipodérmicas como electrodos para realizar las mediciones. Se deben introducir en el animal a una profundidad de penetración constante, permitiendo la transmisión sin interrupción de la señal a través de los tejidos(11). Además, hay que tener especial cuidado cuando los animales se colocan sobre superficies no conductoras. Para poder establecer la relación entre las variables del AIB y la composición corporal de los animales, se deben determinar en el laboratorio los niveles de humedad, proteína, materia mineral y lípidos, entre otros. La posición de los electrodos con la que supuestamente se debían obtener las medidas primarias del AIB realizado en la espalda de los animales mostró resultados más precisos que las lecturas ventrales debido a los tejidos diferenciados que muestra cada compartimento(21). No se encuentran cambios significativos en las variables de AIB ni en las membranas o compartimentos extracelulares justo después del sacrificio, considerando que la temperatura muestra poca variación. Sin embargo, cuando la canal comienza a enfriarse, se producen cambios bioquímicos en las membranas celulares debido al efecto de rigor mortis, ya que la canal pierde sus gradientes iónicos con el aumento de la temperatura y el tiempo de maduración(33). Según se ha mencionado(33), este proceso es consistente con los mecanismos enzimáticos, ya que las capas de fosfolípidos de las membranas sufren oxidación y dan a la membrana un aspecto poroso. Este mecanismo descrito por Damez et al(34) provoca un aumento de la permeabilidad, facilitando el flujo y la mezcla de los fluidos intra y extracelulares. Se ha informado(35) que los valores de Rs y Xc en canales frías de cerdos eran aproximadamente de 6 a 11 veces superiores a los de los cerdos vivos y observaron que la Rs disminuía proporcionalmente a la temperatura. Altmann et al(10) obtuvieron una correlación muy débil entre la reactancia y la composición de la canal, lo que también se puede encontrar en los estudios sobre los corderos(31). Otros autores(8) hallaron una correlación positiva entre la resistencia, el peso 559


Rev Mex Cienc Pecu 2021;12(2):553-572

vivo y la cantidad de grasa en los cerdos. En consecuencia, se produjo un aumento de la resistencia debido a la disminución de la cantidad total de agua en el cuerpo, lo que dio como resultado un aumento de peso y grasa en los cerdos. Gibbs et al(36) encontraron que el estrés produce cambios en la masa libre de grasa y en el tejido blando libre de grasa cuando utilizaron el AIB para determinar las alteraciones corporales en corderos recién nacidos expuestos al estrés térmico intrauterino. Asimismo, se observó que el AIB mostró potencial para estimar el marmoleo en bovinos en Japón(37). Berg y Marchello(31) utilizaron las siguientes variables en sus modelos: peso de las canales frías y calientes, longitud de la canal y temperatura asociada a Rs y Xc. Algunos investigadores(9) informaron que obtuvieron una relación débil entre la mayoría de los componentes de las canales. Moro et al(1) añadieron el ángulo de fase, el volumen bioeléctrico, la densidad resistiva y reactiva a sus ecuaciones para asociarlas con los componentes de la canal, ya que la densidad resistiva puede relacionarse con estos componentes y la densidad reactiva podría indicar una asociación con la concentración de masa magra. Además, al utilizar el análisis AIB como técnica de predicción de la canal y la musculatura de las cabras ligeras, se observó(38) que la Rs era la única variable independiente que determinaba la grasa subcutánea con prescripción. Sin embargo, al incluir en el modelo la longitud de la canal combinada con la Rs, obtuvieron un nivel de determinación aún mayor, de 0.943 (P<0.01). La inserción en la ecuación del peso de la canal fría combinada con la Rs reportó una precisión de 0.998 para predecir la cantidad de músculo. En un trabajo reciente(39), los autores mostraron el potencial que tienen los parámetros evaluados por AIB para medir las características de la carne: la combinación de Rs y Xc para predecir la grasa intramuscular demostró un ajuste del 79.3 %, mientras que para las características físico-químicas los mejores ajustes fueron en la longitud del sarcómero, con un 64.4 %, y en la fuerza de cizallamiento, con un 60.5 %. La precisión de los modelos de predicción mejoró con la inclusión de información adicional. El Cuadro 1 muestra algunos modelos junto con sus respectivas variables, que se ajustan mejor para aumentar la capacidad de determinar las ecuaciones.

560


Rev Mex Cienc Pecu 2021;12(2):553-572

Cuadro 1: Ecuaciones de predicción a partir de evaluaciones in vivo, de la bioimpedancia, en canales de bovino, bufalino, cordero y cerdo Autores

Variable dependiente

Bovino Velazco et al., 1999 Bufalino

Masa libre de Y= 0.130 PC – 0.039 L + 0.0002 L2 – 0.007 Z – 0.98 grasa 9.320 Vol2 + 9.507 Vol3 + 35.555 IMC – 34.249

Sarubbi et al., 2008

Masa libre de Y= 28.10 + 0.972PV + 12.21 grasa

Ecuaciones

0.94

Ovino in vivo Masa libre de grasa Berg y Marchelho, Sin grasa 1994 Tejido adiposo Proteína (kg) Grasa (kg) Moro et al., 2019 Masa magra (kg) Masa libre de grasa (kg) Avril et al., 2013 Masa grasa (kg) Canales de Cordero

Y= 0.555 PV – 0.247 Rs + 0.390 Xc + 16.260

0.77

Y= 0.555 PV – 0.247 Rs + 0.390 Xc + 16.260

0.78

Y = - 0.70 + 0.05DRs + 0.03V + 0.07AF Y = - 2.11 + 0.10DRs + 0.04V

0.91 0.87

Y = - 1.90 + 0.11V + 0.18DRs + 0.31AF

0.89

Y= 18.8+0.023 PV−10.5 L²/R

0.85

Y=1.43+0.001 PV−0.81 C

0.65

Y= 0.439 PCC + 0.167 L – 0.134 Rs + 0.191 Xc – Masa libre de 0.258 T + 19.914 grasa Y= 0.583 PCF + 0.150 L – 0.027 Rs + 0.013 Xc – 0.287 T + 1.836 Berg y Marchelho, 1994 Y= 0.433 PCC + 0.124 L – 0.114 Rs + 0.175 Xc – Sin grasa 0.211 T + 17.811 Tejido Y= 0.555 PCF + 0.096 L – 0.022 Rs + 0.008 Xc – adiposo 0.278 T + 3.868 Cerdo Masa libre de Y= 0.486 PV – 0.881 Rs + 0.480 L + 0.880 Xc + grasa 7.950 Swantek et al., 1992 Masa libre de y= 0.267 PCF – 0.158 Rs + 0.519 L + 0.103 Xc + grasa (fría) 20.04

0.77 0.77 0.79 0.77

0.81 0.83

Variables independientes: IMC= PC 2/L2; IMC= índice de masa corporal; PC= peso corporal; C= conductancia; PCF= peso de la canal en frío; PCC= peso de la canal en caliente; L= longitud; PV= peso vivo; AF= ángulo de fase; Rs= resistencia; DRs= densidad resistiva; T= temperatura; V= volumen bioeléctrico; Vol2= L2/ (Rs 2 + Xc 2).5; Vol3= volumen geométrico; Xc= reactancia; Z= impedancia.

561


Rev Mex Cienc Pecu 2021;12(2):553-572

Es posible evaluar el AIB en toda la extensión de las canales. Sin embargo, algunas restricciones presentes durante la medición de la bioimpedancia hicieron surgir la necesidad de evaluar el análisis del AIB por segmentos, es decir, por pequeñas secciones en las canales. Sin embargo, se reportó recientemente(32) que el análisis de la bioimpedancia resultó ser una tecnología más prometedora que los métodos tradicionales para proporcionar información precisa y satisfacer las demandas del mercado de consumo, ya que proporciona una forma fácil y rápida de determinar la composición de grasa, proteína y agua en los cortes comerciales.

Evaluación mediante el AIB en peces La bioimpedancia eléctrica puede ser una herramienta útil no sólo para los estudios científicos sobre los peces sino también para la industria piscícola, ya que permite evaluar rápidamente la composición corporal de una gran cantidad de peces vivos(40). Además, su uso podría reducir entre 20 y 41 veces el costo total de los procedimientos de evaluación en comparación con los métodos tradicionales de análisis químico. Dado que esta tecnología no es letal, permite monitorear los cambios en la composición corporal de los peces a medida que crecen y hacen cambios en la dieta acordes a la evaluación, mediante un AIB, de las respuestas a las interacciones biológicas(41). Otro hallazgo importante(42) es que el AIB puede ser útil para analizar las variaciones bióticas y abióticas que pueden afectar a los componentes del cuerpo de los animales, que no pueden ser sacrificados, ya que son especies en peligro de extinción. Algunos autores(43) afirman que la geometría corporal de los peces favorece el uso de la impedancia como estimación de la composición corporal, ya que ella basta una sola medida para representar de manera precisa todo el cuerpo (R²= 0.96). El objetivo es utilizar los análisis AIB para determinar la composición corporal de los peces. Zaniboni-Filho et al.(44) trataron a los peces con una dieta compuesta por diferentes índices lipídicos (8.90 vs 18.68 %) para producir individuos con distintas composiciones corporales. Los resultados mostraron correlaciones más fuertes para los análisis dorsales de humedad y resistencia en serie (0.87); proteína y resistencia en serie (0.87); ceniza y reactancia en paralelo (0.82). Se observaron correlaciones débiles entre los datos del AIB por lectura ventral y los contenidos lipídicos (0.44). Estos autores destacaron que el AIB demostró ser un método adecuado para determinar la composición corporal de los peces de acuerdo con los autores mencionados anteriormente. Arantes(7) probó el uso de la técnica de bioimpedancia en el pez boga (Leporinus obtusidens) y se encontró un alto nivel del coeficiente de determinación obtenido en la región lateral. Los coeficientes fueron respectivamente de 0.92, 0.85 y 0.87 entre el método AIB y los parámetros de composición corporal obtenidos por el método químico, 562


Rev Mex Cienc Pecu 2021;12(2):553-572

tales como la humedad, las proteínas y el extracto etéreo. Según estos resultados, el AIB demostró ser válido para estimar la composición corporal y calificar los niveles de energía del pez boga. La eficacia del AIB para evaluar la composición de los peces es beneficiosa para la gestión de la pesca y las investigaciones ecológicas. Permite evaluar el flujo energético entre y dentro de las poblaciones, además de valorar las respuestas sobre los cambios ambientales. Si bien los métodos tradicionales de medición son muy precisos, consumen mucho tiempo, son caros y son letales. Por otro lado, el método AIB constituye una técnica rápida y no letal que explica el 80 % de la variabilidad en el porcentaje de lípidos de los peces, demostrando una alta precisión en la estimación y seguimiento de las condiciones corporales de los peces que viven en los ríos del territorio interior de Alaska(45). Además, la técnica puede ser beneficiosa para determinar los cambios bioenergéticos relacionados con las variaciones del entorno. Fitzhugh et al(46) utilizaron el AIB para establecer una relación con la energía disponible para la reproducción de los peces marinos. Los autores observaron que el ángulo de fase se mantenía por debajo de los 15º después de la temporada alta de desove. Otros autores(40) informaron que el AIB mostró potencial para medir el estado reproductivo, la madurez y el desarrollo gonadal, ya que en estas condiciones los peces presentan alteraciones en su porcentaje de grasa corporal. Según algunos autores(28), los ángulos de fase superiores a 15º indicaban que los peces estaban sanos, mientras que los valores inferiores a 15º mostraban peces con una salud comprometida debido a cambios en el ambiente acuícola. A diferencia de los modelos utilizados para otros animales, el ángulo de fase mostró una alta productividad entre los peces. También se encuentran cambios en el ángulo de fase cuando los peces se enfrentan a un largo período de ayuno. El ayuno obliga al organismo a utilizar los nutrientes almacenados para satisfacer sus necesidades energéticas(47). La utilización de los nutrientes almacenados provoca cambios en los fluidos intra y extracelulares, pérdida de proteínas corporales, deshidratación celular progresiva y disminución de los ángulos de fase. Además, Zavadlav et al(48) sugirieron estimar la duración del almacenamiento y las propiedades sensoriales de las muestras de calamar con mediciones de AF, dado que mostraron una estrecha correlación. Por otra parte, se observaron(49) correlaciones débiles y no significativas entre AF, Rs y Xc y los componentes de la composición corporal, y, según se reportó, el motivo de esta débil correlación es que la metodología del AIB no fue capaz de detectar alteraciones en la composición corporal de los peces. Este hecho corrobora los resultados obtenidos por otros autores(50), según los cuales las medidas morfológicas estimadas por AIB en los 563


Rev Mex Cienc Pecu 2021;12(2):553-572

peces que se enfrentan a la amenaza de extinción al habitar en regiones desiertas fueron redundantes y se requiere de precaución en la evaluación de campo, ya que presenta una gran sensibilidad. Según Cox et al(21), el pescado puede mantenerse en hielo hasta 9 h después de sacrificado sin que se alteren los valores de Rs o Xc. Los retrasos en la congelación afectan primero a la Xc, y luego a la Rs y al AF. Este orden se debe a que la Xc representa la integridad de la membrana celular, que después de 12 h comienza a hincharse ante el rigor mortis. Así, la membrana celular se rompe liberando líquido intracelular en espacios extracelulares. Para satisfacer la demanda del mercado de consumo, se ha comprobado que es posible definir la calidad, la frescura y el reblandecimiento muscular de la trucha arco iris por medio de la impedancia y durante su almacenamiento en hielo(51). Los mismos autores describieron que el procedimiento permitió detectar el índice de rigor mortis a través de la impedancia, condición en la que se evidenció una fuerte correlación negativa entre el rigor mortis y el potasio (K) (r = -0.938, P<0,01) y se encontró una fuerte correlación positiva con r= 0.981 (P<0,01) respecto a la dureza. Yuan et al(52), describen algunas similitudes que demuestran que el análisis de bioimpedancia arrojó una buena correlación con el valor de K tras 24 h de almacenamiento en hielo, lo que sugiere que el AIB refleja eficazmente el cambio en los compuestos bioquímicos relacionados con la frescura de la carne de pescado. Para reducir los errores durante la investigación, se recomienda que la muestra mínima sea de 60 peces y que haya una capa de grasa mínima del 29 % entre los peces a fin de obtener correlaciones ≥ 0.80. Por lo tanto, los resultados podrían mostrar una mayor fiabilidad para estimar la composición corporal de los peces(40). Sin embargo, la evaluación de las fuentes potenciales de errores y variaciones durante las mediciones de BIA es un paso importante en el desarrollo del protocolo para garantizar la aplicación de los datos obtenidos por este método. Champion et al(42) evaluaron algunos desafíos que presenta la técnica, la cual para que sea eficaz, los autores sugieren algunos criterios a seguir: la ubicación anatómica de la inserción del electrodo; el tamaño de los peces y la variación entre especies; la temperatura del entorno/del cuerpo; el tiempo transcurrido entre la captura y la muerte de los peces; la degradación del tejido biológico post-mortem; la normalización del método de captura para reducir el estrés fisiológico. Según se ha comentado(21), el cambio de los electrodos de la parte dorsal a la ventral de un pez modifica no sólo las distancias entre los electrodos, sino también los tipos de tejidos que se examinan. Se han identificado mejores correlaciones entre el AIB y los componentes del tejido cuando los electrodos se colocaron a lo largo de la línea dorsal(53).

564


Rev Mex Cienc Pecu 2021;12(2):553-572

El hecho de que los peces tengan escamas grandes y gruesas podría dificultar el contacto entre la piel y el electrodo, por lo que habría que extraer algunas escamas. En resumen, el uso del AIB en peces ha mostrado resultados prometedores para estimar la composición corporal. Sin embargo, se necesitan más estudios para desarrollar protocolos y ecuaciones de predicción para mejorar la precisión y la aplicabilidad de esta técnica hasta un nivel que permita su uso en el campo y en la industria.

Evaluación de la leche bovina mediante el AIB La mayoría de los análisis actuales para verificar la calidad, la composición o incluso la adulteración de la leche se valen de métodos analíticos y se llevan a cabo en laboratorios certificados. Sin embargo, en el entorno de un laboratorio es difícil realizar pruebas y ofrecer predicciones en tiempo real a los técnicos. Por lo tanto, es importante desarrollar nuevas metodologías para controlar la composición y la calidad de la leche a fin de cumplir con las expectativas del mercado de consumo. Es útil y prometedor utilizar las propiedades eléctricas de la leche. Felice et al(54) sugirieron un método de cuantificación de bacterias en la leche bronca de vaca basado en la variación de la capacitancia eléctrica. Mabrook et al(55) observaron que la conductancia eléctrica disminuye a medida que aumenta el porcentaje de grasa en la leche. Se reportó(56) que al aumentar la temperatura de la leche, la movilidad y el número de iones en la solución también aumentaron, provocando una disminución de Z. Esto valida los hallazgos de otros autores(2), que reportaron resultados similares. La grasa de la leche puede considerarse un obstáculo para el flujo de la corriente eléctrica, ya que está formada por grandes glóbulos cubiertos por una membrana fina y no conductora. La leche con un alto porcentaje de grasa mostró una alta resistencia y, en consecuencia, una baja conductividad(57). También es necesario señalar la fuerte correlación entre la conductividad (C) y el recuento de células somáticas (RCS) de la leche. El aumento del C en la leche es directamente proporcional al aumento de la inflamación de la ubre y del RCS. Esta inflamación provoca una alteración de la permeabilidad de los tejidos, lo que se traduce en un aumento del flujo de iones Na+ y Cl- de la sangre al interior del lumen alveolar de la glándula mamaria(58). Se observaron fuertes correlaciones entre las variables Rs, Xs, C, Z y AF y los componentes sólidos-no grasos totales en la leche bronca de vaca, las cuales coinciden también con el coeficiente de determinación de las ecuaciones de predicción(2). En el mismo estudio, cuando la temperatura de la leche estaba a 5 ºC, la media de Z era de 147 ohmios y 1.21 % de grasa. Veiga et al(59) encontraron diferentes valores medios de Z en la leche entera (219.56 ohmios), semidesnatada (203.57 ohmios) y desnatada (170.08 ohmios) cuando analizaron la bioimpedancia eléctrica de la grasa de la leche de vaca. Otros autores(60) informaron de valores medios de 89 ohmios para Z. 565


Rev Mex Cienc Pecu 2021;12(2):553-572

Se desarrolló un sensor de espectroscopía de impedancia para detectar la adulteración de la leche basado en las medidas de AF(61). En este estudio, el AF disminuyó cuando se añadió agua del grifo. Cuando los valores de pH cambiaron a una solución básica, el AF y la conductividad también disminuyeron. Cuando se añadió urea y suero de leche, el AF y la conductividad mostraron un aumento. Esto se debe a que las variables tienen la misma naturaleza. En otras palabras, la naturaleza del cambio en el AF es la misma de la conductividad. Durante et al(56) observaron que la adulteración de la composición de la leche bronca de vaca y de la leche UHT (de ultra alta temperatura) difería principalmente en la variable resistencia. La leche bronca mostró poca variación frente a la adulteración por peróxido de hidrógeno. Sin embargo, la adulteración estaba presente en las muestras de leche UHT. Este hecho estaba posiblemente relacionado con el índice de grasa y la falta de homogeneidad de la leche bronca. En las muestras de hidróxido de sodio se percibió una tendencia a disminuir la resistencia debido a una mayor presencia de iones de sodio, lo que demuestra que el sistema de espectroscopía arrojó resultados consistentes en cuanto a la adulteración de la leche de vaca. Las metodologías para identificar la composición, la adulteración y la conductividad de la leche(56) utilizando la espectroscopía de impedancia(62) y los conductivímetros son diferentes del AIB. Es importante destacar que la técnica de espectroscopía de impedancia puede proporcionar datos sobre la estructura y la composición de las propiedades de la leche mediante diferentes frecuencias eléctricas. El AIB, por su parte, utiliza una corriente alterna de baja amplitud (500 a 800 μA) y alta frecuencia (50 kH). A la hora de analizar la bioimpedancia de la leche de vaca deben tenerse en cuenta aspectos como la raza, la fase de la lactancia, la genética y la nutrición, las frecuencias de ordeño, la edad del animal, así como los receptores y los tipos de electrodos. En este sentido, el uso de la espectroscopía o simplemente de la bioimpedancia de una única frecuencia son técnicas prometedoras, que podrían proporcionar resultados rápidos y rentables sobre la composición, la calidad y la posible adulteración de la leche de vaca.

Conclusiones El creciente aumento de las exigencias del mercado de consumo en materia de seguridad alimentaria, bienestar y composición de los productos de origen animal pone de manifiesto la necesidad de investigar métodos precisos y rentables que aseguren la calidad. El análisis de bioimpedancia, por lo tanto, demostró ser una tecnología prometedora, rápida, relativamente barata y mínimamente invasiva para caracterizar y predecir la composición corporal de los animales domésticos y la calidad de la leche bovina bronca, mostrando una gran capacidad para sustituir los métodos tradicionales. Sin embargo, para ampliar el uso del AIB, es importante destacar la necesidad de

566


Rev Mex Cienc Pecu 2021;12(2):553-572

controlar, en la medida de lo posible, las posibles fuentes de errores y variaciones, independientemente de la especie utilizada para definir los protocolos y estandarizar el análisis. Además, es necesario seguir investigando para evaluar la interacción del AIB con la variación de los entornos más diversos y el estado nutricional. Para que la información y los modelos sean más precisos, se recomienda asociar los datos del AIB con los métodos de modelización y los paquetes estadísticos. Es de esperar que, en un futuro próximo, el AIB pueda utilizarse tanto en el campo como en las plantas industriales. Agradecimientos A la Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) por la beca concedida a la primera autora. Declaración de conflicto de interés Los autores declaran no tener ningún conflicto de interés con el trabajo presentado en este artículo de revisión. Literatura citada: 1. Moro AB, Pires CC, Silva LP, Dias AMO, Simões RR, Pilecco VM, et al. Prediction of lamb body composition using in vivo bioimpedance analysis. Meat Sci 2019; (50):1-6. 2. Schumacher LL, Viégas J, Naetzold S, Tonin TJ, Rocha L, Cauduro L, et al. Use of electrical bioimpedance analysis to evaluate the quality of bovine raw milk. S Afr J Anim Sci 2019;(49):728-734. 3. Cintra TCF, Canola JC, Borges NC, Carciofi AC, Vasconcelos RS, Zanatta R. Influência de diferentes tipos de eletrodos sobre os valores da bioimpedância corporal e na estimativa de massa magra (MM) em gatos adultos. Ci Anim Bras 2010;(11):149-155. 4. Eickemberg M, Oliveira CC, Roriz AKC, Sampaio LR. Bioimpedância elétrica e sua aplicação em avaliação nutricional. Ver Nutr 2011;(24):883-893. 5. Bera TK. Bioelectrical impedance methods for noninvasive health monitoring: A review. J Med Eng 2014;1-28. 6. Berg EP, Neary MN, Forrest JC, Thomas DL, Kauffman RG. Assessment of lamb carcass composition from live animal measurement of bioelectrical impedance or ultrasonic tissue depths. J Anim Sci 1996;(74):2672-2678. 7. Arantes TB. Bioimpedância como ferramenta de análise da composição corporal de Piava, Leporinus obsutidens. [Dissertação de Mestrado]. Brasil, DF: Universidade Federal de Santa Catarina; 2014. 567


Rev Mex Cienc Pecu 2021;12(2):553-572

8. Daza A, Mateos A, Ovejero I, Bote CJC. Prediction of body composition of Iberian pigs by means bioelectrical impedance. Meat Sci 2006;(72):43-46. 9. Zollinger BL, Farrow RL, Lawrence TE, Latman, NS. Prediction of beef carcass salable yield and trimmable fat using bioelectrical impedance analysis. Meat Sci 2010; (84):449-454. 10. Altmann M, Pliquett V, Suess R, Borell E. Prediction of lamb carcass composition by impedance spectroscopy. J Anim Sci 2004;(82):816-825. 11. Moro AB, Pires CC, Silva LP, Menegon AM, Venturini RS, Martins AA. Prediction of physical characteristics of the lamb carcass using in vivo bioimpedance analysis. Animal 2019;(13):1744-1749. 12. Sarubbi F, Báculo R, Balsarano B. Bioelectrical impedance analysis for the prediction of fat-free mass in buffalo calf. Animal 2008;(2):1340–1345. 13. Grimnes S, Martinsen O. Bioimpedance and bioelectricity basics. 2nd ed. Oxford, UK: Elsevier-Academic Press; 2008. 14. Lukaski HC, Johnson PE, Bolonchuk PE, Lykken G. Assessment of fat-free mass using bioelectrical impedance measurements of the human body. Am J Clin Nutr 1985;(41):810–817. 15. Khalil SF, Mohktar MS, Ibrahim F. The theory and fundamentals of bioimpedance analysis in clinical status monitoring and diagnosis of diseases. Sensors 2014;(4):10895-10928. 16. Avril DH, Lallo C, Mlambo V, Bourne G. The application of bioelectrical impedance analysis in live tropical hair sheep as a predictor of body composition upon slaughter. Trop Anim Health Prod 2013;(45):1803-1808. 17. Kyle UG, Bosaeus I, Lorenzo AD, Deurenberg P, Elia M, Gómez JM. Bioelectrical impedance analysis part I: review of principles and methods. Clin Nutr 2004;(23):1226–1243. 18. Bera KT. Bioelectrical impedance and the frequency dependent current conduction through biological tissues: A short review. IOP Conf. Ser.: Mater Sci Eng 2018; (331). 19. Kumar G, Kasiviswanathan U, Mukherjee S, Mahto SK, Sharma N, Patnaik R. Changes in electrolyte concentrations alter the impedance during ischemiareperfusion injury in rat brain. Physiol Meas 2019;(10):1-22. 20. Guedes DP. Clinical procedures used for analysis of the body composition. Rev Bras Cineantropometria & Desempenho Hum 2013;(15):1-17.

568


Rev Mex Cienc Pecu 2021;12(2):553-572

21. Cox MK, Heintz R, Hartman K. Measurements of resistance and reactance in fish with the use of bioelectrical impedance analysis: sources of error. Fish Bull 2011;(109):34-47. 22. Hartman KJ, Phelan BA, Rosendale JE. Temperature effects on bioelectrical impedance analysis (BIA) used to estimate dry weight as a condition Proxy in Coastal Bluefish. Mar Coast Fish 2011;(3):307-316. 23. Barbosa-Silva MCG, Barros AJD, Wang J, Heymsfiel SB, Pierson RN. Bioelectrical impedance analysis: population reference values for phase angle by age and sex. Am J Clin Nutr 2005;(82):49-52. 24. Baumgartner RN, Chumlea WC, Roche AF. Bioelectric impedance phase angle and body composition. Am J Clin Nutr 1998;(48):16-23. 25. Lukaski HC. Evolution of bioimpedance: a circuitous journey from estimation of physiological function to assessment of body composition and a return to clinical research. Eur J Clin Nutr 2013;(67):2–9. 26. Selberg O, Selberg D. Norms and correlates of bioimpedance phase angle in healthy human subjects, hospitalized patients, and patients with liver cirrhosis. Eur J Appl Physiol 2002;(86):509-516. 27. Britto EP, Mesquita ET. Bioimpedância elétrica aplicada à insuficiência cardíaca. Rev SOCERJ 2008; (21):178-183. 28. Cox MK, Heintz R. Electrical phase angle as a new method to measure fish condition. Fish Bull 2009;(107):477–487. 29. Lukaski HC. Methods for the assessment of human body composition: traditional and new. Am J Clin Nutr 1987;(46):537-556. 30. Jenkins TG, Leymaster TGKA, Turlington LM. Estimation of fat-free soft tissue in lamb carcasses by use of carcass and resistive impedance measurements. J Anim Sci 1988;(66):2174−2179. 31. Berg EP, Marchello MJ. Bioelectrical impedance analysis for the prediction of fatfree mass in lambs and lamb carcasses. J Anim Sci 1994;(72):322-329. 32. Moro AB, Galvani DG, Montanholi YR, Bertemes-Filho P, Venturini RS, Martins AA, da Silva LP, Pires CC. Assessing the composition of the soft tissue in lamb carcasses with bioimpedance and accessory measures. Meat Sci 2020;(169):1-20. 33. Bertotti FS. Sistema de biotelemetria passiva e técnica de medição para aquisição da impedância elétrica de tecido animal post mortem. [Tese Doutorado]. Brasil, DF: Universidade Tecnológica Federal do Paraná;2010.

569


Rev Mex Cienc Pecu 2021;12(2):553-572

34. Damez JL, Clerjon S, Said A, Lepetit J. Dielectric behavior of beef meat in the 11500 kHz range: Simulation with Fricke/Cole-Cole model. Meat Sci 2007;(77):512– 519. 35. Swantek PM, Crenshaw JD, Marchello MJ, Lukaski HC. Bioelectrical impedance: a nondestructive method to determine fat-free mass of live market swine and pork carcasses. J Anim Sci 1992;(70):169-177. 36. Gibbs LR, Cadaret CN, Swanson RM, Beede KA, Posont RJ, Schmidt BT. Body composition estimated by bioelectrical impedance analyses is diminished by prenatal stress in neonatal lambs and by heat stress in feedlot wethers. Transl Anim Sci 2019;(3):1691–1695. 37. Fukuda O, Hashimoto D, Ahmed I. Bioelectrical impedance analysis for estimating marbling score of live beef cattle in Japan. IEEE IEEM 2016;(10):1508-1512. 38. Silva ER, Afonso J, Monteiro JA, Morais R, Cabo RA, Batista AC, Guedes CM, Teixeira A. Application of bioelectrical impedance analysis in prediction of light kid carcass and muscle chemical composition. Animal (2017);1-7. 39. Afonso J, Guedes C, Santo V, Morais R, Silva J, Teixeira A, Silva S. Utilization of bioelectrical impedance to predict intramuscular fat and physicochemical traits of the beef Longissimus thoracis et Lumborum Muscle. Foods 2020;(9):1-11. 40. Hartmann KJ, Margraf FJ, Hafs AW, Cox MK. Bioelectrical impedance analysis: A new tool for assessing fish condition. Fisheries 2015;(40):590-600. 41. Wuenschel MJ, McElroy WD, Oliveira K, Richard S. McBride RS. Measuring fish condition: an evaluation of new and old metrics for three species with 2 contrasting life histories. Can J Fish Aquat Sci 2018:1-64. 42. Champion C, Hobdayb AJ, Pecla GT, Traceya SR. Maximising the utility of bioelectrical impedance analysis for measuring fish condition requires identifying and controlling for sources of error. Fish Res 2020;(229):1-10. 43. Cox MK, Hartman KJ. Non-lethal estimation of proximate composition in fish. Can J Fish Aquat Sci 2005;(62):269–275. 44. Zaniboni-Filho E, Hermes-Silva S, Weingartnerb M, Jimeneza JE, Borbab MR, Fracalossi DM. Bioimpedance as a tool for evaluating the body composition of suruvi (Steindachneridion scriptum). Braz J Biol 2015;(75):239-244. 45. Falke JA, Bailey LT, Fraley KM, Lunde MJ, Gryska AD. Energetic status and bioelectrical impedance modeling of Arctic grayling Thymallus arcticus in interior Alaska rivers. Environ Biol Fish 2019;(102):1337–1349.

570


Rev Mex Cienc Pecu 2021;12(2):553-572

46. Fitzhugh GR, Wuenschel MJ, Mcbrid RS. Evaluation of bioelectrical impedance analysis (BIA) to measure condition and energy allocated to reproduction in marine fishes. J Phy Conf Ser 2010;(224):1-4. 47. Moyle PB, Cech JJ. Fishes an introduction to ichthyology. 5nd ed. NJ, USA: Prentice Hall, Upper Saddle River; 2004. 48. Zavadlav S, Lackovi´c I, Kovacevic DB, Greiner R, Putnik P, Filipec SV. Utilizing impedance for quality assessment of European squid (Loligo vulgaris) during chilled storage. Foods 2019;(624):1-12. 49. Garner SB, Boswel KM, Van Der Ham JL, Cowan JH. Use of bioelectric impedance analysis to assess total body condition and predict energy density in juvenile Atlantic croaker. Trans Am Fish Soc 2012;(141):1117-1125. 50. Dibble KL, Yard MD, Ward DL, Yackulic CB. Does bioelectrical impedance analysis accurately estimate the physiological condition of threatened and endangered desert fish species? Trans Am Fish Soc 2017;(146):888-902. 51. Fan X, Lin X, Wu C, Zhang N, Cheng Q, Qi H, Konno K, Dong X. Estimating freshness of ice storage rainbow trout using bioelectrical impedance analysis. Food Sci Nutr 2020;(9):154–163. 52. Yuan P, Miyazaki R, Liang J, Hirasaka K, Tachibana K, Taniyama S. A convenient and nondestructive method using bio-impedance analysis to determine fish freshness during ice storage. Fish Sci 2018;(84):1099–1108. 53. Hafs AW, Hartman KJ. Influence of electrode type and location upon bioelectrical impedance analysis measurements of brook trout. Trans Am Fish Soc 2011;(140):1290-1297. 54. Felice CJ, Madrid RE, Oliveira JM, Rotger VI, Valentinuzzi ME. Impedance microbiology: quantification of bacterial content in milk by means of capacitance growth curves. J Microbiol Methods 1999;(35):37–42. 55. Mabrook MF, Petty MC. Effect of composition on the electrical conductance of milk. J Food Eng 2003;(60):321-325. 56. Durante E, Becari W, Lima FAS, Peres HEM. Electrical impedance sensor for realtime detection of bovine milk adulteration. IEEE Sens J 2016;(16):861-865. 57. Mucchetti G, Gatti M, Neviani E. Electrical conductivity changes in milk caused by acidification: determining factors. J Dairy Sci 1994;(77):940-944. 58. Tozzetti DS, Bataier MBN, Alemida LR. Prevenção, controle e tratamento das mastites bovinas: revisão de literatura. Rev Cient Eletrônica de Med Vet 2008;(6):17.

571


Rev Mex Cienc Pecu 2021;12(2):553-572

59. Veiga EA, Bertemes-Filho P. Bioelectrical impedance analysis of bovine milk fat. J Phys Conf Ser 2012;(407):1-5. 60. Bertemes-Filho P, Valicheski R, Pereira RM, Paterno AS. Bioelectrical impedance analysis for bovine milk: preliminary results. J Phys Conf Ser 2010;(224):012133. 61. Das S, Sivaramakrishna M, Biswas K, Goswami B. Performance study of a ‘constant phase angle based’ impedance sensor to detect milk adulteration. Sensor Actuat APhys 2011;(167):273–278. 62. Santos LF, Coelho KS, Cunha AF, Nunes MF, Falcão JPM. Influência de parâmetros físico químicos do leite na detecção de mastite subclínica bovina por condutividade elétrica. Rev Cient Univiçosa 2015;(7):1-6.

572


https://doi.org/10.22319/rmcp.v12i2.5623 Nota de investigación

Ensilajes de triticale de alta humedad con aditivos químicos y biológicos: valores nutrimentales y comportamiento de ingesta en ovinos

Valter H. Bumbieris-Junior a Egon H. Horst a* Murilo D. Paranzini a Odimári P. P. Calixto a Edson L. A. Ribeiro a Leandro D. F. Silva a Ivone Y. Mizubuti a Clóves C. Jobim b Mikael Neumann c

State University of Londrina, Center of Animal Science – Rod. Celso Garcia Cid, PR445, 86057-970, Londrina, Paraná, Brazil. a

b

State University of Maringá, Center of Animal Science, Maringá, Paraná, Brazil.

c

Midwestern Parana State University, Departament of Veterinary, Guarapuava, Parná, Brazil.

*

Autor de correspondencia: egonhh@yahoo.com.br

Resumen: El ensilaje de triticale de grano con alto contenido de humedad es una excelente opción para las dietas de rumiantes. Sin embargo, falta información sobre el control de pérdidas durante el proceso de fermentación. Se hizo una evaluación sobre los efectos de los aditivos químicos y biológicos a ensilajes de triticale de alta humedad en la composición química-bromatológica, la estabilidad aeróbica, la digestibilidad in vivo y el

573


Rev Mex Cienc Pecu 2021;12(2):573-585

comportamiento de ingesta en ovinos. Se evaluaron cuatro tratamientos: ensilaje de triticale sin aditivo (control); ensilaje con un inoculante enzimático-bacteriano; ensilaje con 0.5% de urea en materia natural; y ensilaje con benzoato de sodio al 1.5% en materia natural. El comportamiento de ingesta se evaluó con cuatro ovejas macho en jaulas metabólicas. La adición de urea como aditivo proporcionó un aumento en el contenido de la proteína cruda (189.7 g kg MS-1) y el nitrógeno amoniacal (106.2 g kg MS-1), pero no afectó la digestibilidad (699.6 g kg MS-1 en tratamiento con urea, promedio = 687.5 g kg MS-1) ni el comportamiento de ingesta. El consumo de fibra aumentó con la adición del aditivo enzimático-bacteriano (431.87 vs 388.06 g d-1 fibra detergente neutra en el control). Todos los aditivos ayudaron a preservar el contenido de proteína cruda después de la apertura del silo, pero ninguno interfirió en el tiempo de estabilidad aeróbica del ensilado. Palabras clave: Benzoato de sodio, Calidad nutrimental, Estabilidad aeróbica, Inoculante enzimático-bacteriano, Urea.

Recibido: 20/02/20 Aceptado:04/08/2020

El ensilaje de triticale de alta humedad es un potencial recurso alimenticio de sustitución o suplementación en las dietas de rumiantes. Comparado con el maíz (Zea mays), su almidón tiene una mayor solubilidad(1) y niveles más altos de lisina(2). Sin embargo, la alta concentración epífita de levadura presente en el grano de triticale(3) favorece la pérdida de nutrientes y la disminución de la estabilidad aeróbica del ensilaje una vez abierto el silo. Se ha probado el uso de aditivos químicos, como el benzoato de sodio y la urea, para el control de estos microorganismos, ya que deterioran el grano, y el consiguiente mantenimiento de la calidad del alimento. El benzoato de sodio se ha probado para controlar la calidad de ensilajes, pero solo se ha aplicado en dosis bajas. Esto se debe a la posibilidad de la esterilización del alimento y los posibles efectos negativos sobre el proceso de fermentación(4); sin embargo, hay reportes que contradicen estas afirmaciones(5). En un estudio, la adición de urea al ensilaje de maíz de alta humedad redujo las pérdidas de materia seca y aumentó la estabilidad aeróbica(6). Otro acercamiento a la mitigación de las pérdidas y el mejoramiento de la estabilidad aeróbica de los ensilajes es el uso de inoculantes bacterianos, con o sin enzimas(7,8), aunque todavía no se ha llegado a un acuerdo general sobre su uso(4). Hasta la fecha, existe poca información sobre los ensilajes de triticale de alta humedad y las posibles estrategias para su preservación. El objetivo de este estudio fue evaluar los efectos de diferentes aditivos químicos, y uno biológico de enzimas fibrolíticas, sobre la composición químico-bromatológica y la estabilidad aeróbica de los ensilajes de triticale 574


Rev Mex Cienc Pecu 2021;12(2):573-585

de alta humedad. En adición, se determinó la digestibilidad de nutrientes y comportamiento de alimentación en un modelo de ovinos. La cosecha de granos de triticale (X. Triticosecale Wittmack cv. IPR 111) para la producción del ensilaje se hizo cuando los granos alcanzaron un contenido de humedad aproximado de 30 %. Poco después de la cosecha se trituraron los granos en tamices de 8 mm. Con los granos triturados se prepararon cuatro tipos de ensilaje: triticale de alta humedad sin aditivo, es decir, un control (ETC); triticale de alta humedad con inoculante enzimático-bacteriano (ETEB); triticale de alta humedad con 0.5% de urea en materia natural (ETU); y ensilaje de triticale de alta humedad con 1.5% de benzoato de sodio en materia natural (ETBS). El inoculante enzimático-bacteriano utilizado fue Silotrato®, compuesto por 4 % de complejos de base enzimática sobre celulasa y siete cepas de bacteria (concentración= 109 UFC g-1): Lactobacillus curvatus, L. acidophilus, L. plantarum, L. buchneri, Pediococcus acidilactici, Enterococcus faecium, y L. lactis. Para su aplicación se diluyó el inoculante en agua sin cloro a una concentración de 4.3 g L-1, según las recomendaciones del fabricante. Se agregaron el inoculante, la urea y el benzoato de sodio por separado al triticale triturado y cada mezcla se homogenizó manualmente. Para compensar el efecto de la adición de agua en el ensilaje agregado con el inoculante enzimático-bacteriano, se adicionó el mismo volumen de agua a los demás ensilajes. Para los análisis de la composición química-bromatológica y de la estabilidad aeróbica, se ensilaron los cuatro tipos de ensilaje en silos experimentales. Estos eran cubetas de polietileno con una capacidad de 4.5 L. Se rellenaron un total de 24 cubetas con los ensilajes, con seis cubetas asignadas a cada tipo de ensilaje. La densidad media de compactación fue de 1.067 kg de MV m-3. Los silos se almacenaron durante once meses hasta su apertura. Para la evaluación químico-bromatológica de los ensilajes se utilizó un diseño completamente al azar con cuatro repeticiones. Se evaluaron ocho variables: capacidad tampón (CT); nitrógeno amoniacal (N-NH3); pH; materia orgánica (MO) y materia seca (MS); proteína cruda (PC); extracto etéreo (EE); fibra detergente neutra (FDN); y fibra detergente ácida (FDA). La cuantificación del N-NH3 y la CT se realizó mediante la técnica descrita por Playne y McDonald(9). Los valores de pH se midieron según Cherney y Cherney(10). Los contenidos de MS, MO y EE se cuantificaron según la AOAC(11). Las fibras (FDN y FDA) se midieron con la metodología de Van Soest(12). La estabilidad aeróbica se evaluó a los 340 días después del sellado del silo. Se colocaron muestras de 1.0 kg de cada réplica en recipientes de polipropileno recubiertos con una bolsa de plástico y se acondicionaron en un ambiente a una temperatura no controlada. Durante siete días, las temperaturas de los ensilajes se midieron dos veces al día, a las 09:00 h y a las 15:00 h, con un termómetro insertado a una profundidad de 10 cm en el centro de la masa. La pérdida de estabilidad aeróbica se definió como el tiempo necesario para que la temperatura del ensilaje se eleve 2 °C respecto a la temperatura ambiente (13). 575


Rev Mex Cienc Pecu 2021;12(2):573-585

Para la medición de las variables de pH, MS y PC, cada día se tomaron muestras de otro conjunto de recipientes para cada réplica. El diseño fue completamente al azar con tres repeticiones y usando un esquema de parcelas subdivididas, en el cual los factores atribuidos a las parcelas fueron los ensilajes y el factor atribuido a la sub-parcela fue el tiempo de exposición al aire. Se prepararon los ensilajes utilizados para alimentar a los ovinos siguiendo el mismo procedimiento de fabricación descritos anteriormente. Una vez preparados, se almacenaron en dieciséis silos de hormigón con una capacidad de 250 L cada uno. Se utilizó el método de recolección fecal total en la evaluación del comportamiento de la ingesta y la digestibilidad aparente de los nutrientes. Para llevar a cabo este método se usaron cuatro machos castrados (peso promedio = 25 kg) alojados en jaulas metabólicas apropiadas y equipadas con bebedero y comederos individuales y mezcladores de minerales. Todos los procedimientos cumplieron con los principios éticos de la experimentación animal, y fueron aprobados por el Comité de Ética en Experimentación Animal de la Universidad Estatal de Londrina (No. 26014.2012.79). Las evaluaciones con los ovinos se realizaron aplicando un diseño de cuadrado latino 4x4; es decir, con cuatro tratamientos y cuatro períodos. Cada período de recolección duró 5 días y la precedió 10 días de adaptación. En las dietas se mantuvo una relación de 50:50 fibra:concentrado. Se formularon únicamente con los ingredientes descritos en el Cuadro 1, y siguiendo los requisitos de la NRC(14) para la categoría de ovino destetado con una ganancia de peso promedio diaria de 300 g. Para completar el volumen se utilizó heno de pasto de estrella (Cynodon dactylon (L.) pers) picado y suministrado como pienso mixto. Cuadro 1: Composición química-bromatológica de pasto de estrella y dietas con ensilaje de triticale de alta humedad con los aditivos evaluados y mezclado con C. dactylon a una proporción de 50:50 (g kg MS-1) Dieta Heno ETC ETEB ETU ETBS MS, g kg MH-1 780.3 793.9 787.8 789.3 823.2 PC 158.5 154.8 177.1 154.2 129.7 EE 19.1 20.3 19.3 18.5 11.7 FDN 433.5 441.8 436.1 441.1 677.1 FDA 228.8 233.8 231.1 230.9 337.7 MM 49.5 49.9 49.2 51.7 83.8 MO 950.6 950.1 950.9 948.4 ETC= testigo; ETEB= inoculante enzimático-bacteriano; ETU= urea; ETBS= benzoato de sodio; MS= materia seca; PC= proteína cruda; EE= extracto etéreo; FDN= fibra detergente neutral; FDA= fibra detergente acida; MM= materia mineral; MO= materia orgánica.

Se alimentaron a los animales dos veces al día a las 08:00 y 17:00 h. Tuvieron acceso libre a agua y sal mineral. Al inicio de cada período se pesaron a los animales. Se calculó el tamaño metabólico con el peso promedio.

576


Rev Mex Cienc Pecu 2021;12(2):573-585

Dos veces al día se recolectaron las heces de cada animal. Se guardaron las heces en bolsas de recolección, y se pesaron. Una submuestra del 20 % del total de cada colección se almacenó en un congelador a -20 °C. Lo mismo se hizo con las submuestras de alimentos suministrados y sobras. Para los análisis de laboratorio, las submuestras se combinaron para formar muestras compuestas por animal, tratamiento y período. Los coeficientes de digestibilidad de las diferentes dietas se obtuvieron mediante el sistema de ecuaciones citado por Silva y Leão(15). Los análisis químicos y bromatológicos de los ensilajes, la dieta total, las sobras y las heces produjeron datos sobre la materia seca, la materia orgánica, la proteína cruda, el extracto etéreo, y las fibras detergente neutro y ácido. En el último día de cada período se observaron a los animales por 24 h para documentar el comportamiento de ingesta(16). La duración de cada observación se llevó a cabo por un tiempo de cinco minutos(17). Se documentaron ocho comportamientos: ingesta de sólidos (IS); ingesta de agua (IA); ingesta de sales minerales (ISM); rumia de pie (RP); rumia de reposo (RR); ocio de pie (OP); ocio de reposo (OR); y comportamiento atípico (CA). También se documentaron tres elementos de la rumia: el número de masticaciones (MAST); el número de masticaciones por segundo (MAST/S); y la duración del ciclo ruminal (DUR). Se compararon a los datos de la composición química y bromatológica de los ensilajes y las raciones experimentales, además del rendimiento animal y el comportamiento de ingesta mediante una prueba de Tukey con un nivel de significancia del 5%. Se llevó a cabo mediante el procedimiento GLM en el programa de SAS (2001). Los resultados de la estabilidad aeróbica fueron sometidos a un análisis de regresión por medio del programa R (2013). La adición de urea provocó un aumento (P<0.05) en el contenido de nitrógeno amoniacal (N-NH3) del ensilaje (Cuadro 2). Este se debe a la solubilización de la urea en presencia de ureasa, una enzima que cataliza la hidrólisis de la urea a dióxido de carbono y amoníaco. Tal aumento causó una mayor CT de la masa ensilada (364.2 meq de NaOH 100 g de MS-1), aunque este no difirió (P>0.05) del ensilaje control (323.3 meq de NaOH 100 g de MS-1). El contenido de PC también fue mayor (P<0.05) en el ensilado de urea agregada (189.7 g kg MS-1) ya que la urea es una fuente de nitrógeno no proteico. La adición del inoculante enzimático-bacteriano al ensilaje no alteró la composición químico-bromatológica en comparación con el control (Cuadro 2). Este coincide con otro estudio en que la adición de inoculantes con bacterias homo y heterofermentativas no parece haber influido en la estabilidad aeróbica del ensilaje (4).

577


Rev Mex Cienc Pecu 2021;12(2):573-585

Cuadro 2: Composición química y bromatológica, pH y capacidad de tampón de los ensilajes de triticale alta en humedad con diferentes aditivos Ensilajes ETC ETEB ETU ETSB Prom. CV P MS, g kg MF-1 PC, g kg MS-1 EE, g kg MS-1 FDN, g kg MS-1 FDA, g kg MS-1 MM, g kg MS-1 MO, g kg MS-1 pH N-NH3, % N total CT, meq NaOH 100g DM-1

686.9 172.6b 16.0 109.3 39.1 19.6b 980.4a 4.50c

714.1 165.2b 18.5 126.0 49.0 20.5ab 979.5ab 4.35c

702.0 189.7a 16.4 114.5 43.6 19.0b 981.0a 4.84b

704.9 164.0b 14.9 124.5 43.3 24.0a 976.0b 5.67a

701.9 172.9 16.5 118.6 43.7 20.8 919.2 4.84

2.93 3.21 13.72 10.70 15.85 8.20 0.17 1.30

0.2208 <0.0001 0.2286 0.3081 0.4390 0.0092 0.0092 <0.0001

58.7b

46.4b

106.2a

42.1b

63.4

17.07

<0.0001

323.3ab

294.1b

364.2a

216.7c

299.6

6.25

<0.0001

ETC= control; ETEB= inoculante enzimático-bacteriano; ETU= urea; ETBS= benzoato de sodio; MS= Materia seca; PC= Proteína cruda; EE= extracto etéreo; FDN= Fibra detergente neutral; FDA= Fibra detergente acida; MM= Materia mineral; MO= Materia orgánica; N-NH3: Nitrógeno amoniacal; CT=Capacidad tampón. ab Diferentes letras superíndices en la misma fila indican diferencias (P<0.05).

El pH del ETU (4.84) estaba más alto que el del control (4.50), pero menor que el encontrado en el ETBS (5.67). La razón por la cual el ETBS tuvo un valor alto de pH y una baja CT, sería por el pKa del ácido láctico. Cuando los valores de pH son superiores a pKa, la eficiencia del ácido en la solución se reduce porque la forma ácida disminuye y predomina sobre la forma ionizada(4). Los valores promedios de pH evidenciaron un aumento constante debido al consumo de ácidos orgánicos; sin embargo, no hubo diferencias entre los tratamientos (Figura 1). Figura 1: Valor medio del pH durante la prueba de la estabilidad aeróbica

578


Rev Mex Cienc Pecu 2021;12(2):573-585

En una evaluación de ensilajes de alta humedad de diferentes granos de invierno se encontró un mayor contenido de ácido acético y propiónico en el triticale de alta humedad(18). En adición, hay un predominio de bacterias heterofermentativas en la comunidad epífita de triticale, lo que podría explicar la estabilidad aeróbica prolongada de ensilajes hecho con ello(3,19). En comparación con la temperatura ambiente, ninguno de los tratamientos mostró un aumento de temperatura superior a 2 °C durante todo el período de exposición aeróbica (Cuadro 3). Este hecho es un buen indicador del control del deterioro(13). Todos los ensilajes alcanzaron su temperatura máxima al séptimo día del periodo, lo que es un resultado de la prioridad del desarrollo microbiológico. Se observó que la oscilación en la temperatura en los ensilajes siguió el comportamiento de la temperatura ambiente, contrarrestando un posible aumento gradual que fue independiente del ambiente externo. Cuadro 3: Temperatura del ambiente y rangos de temperaturas (°C) durante la exposición aeróbica en ensilajes de triticale de alta humedad con diferentes aditivos Días de exposición aeróbica Ensilaje 1 2 3 4 5 6 7 ETC 28.83 28.35 29.02 29.13 27.45 28.83 30.28 ETEB 28.92 27.92 28.45 28.57 26.93 28.30 29.73 ETU 28.92 28.17 28.72 28.93 27.27 28.30 30.02 ETSB 28.58 27.97 28.57 28.70 27.08 28.23 30.03 Temp. Ambiente 27.10 28.10 28.15 27.30 27.20 30.25 29.80 ETC= testigo; ETEB= inoculante enzimático-bacteriano; ETU= urea; ETSB= benzoato de sodio.

La alta densidad de compactación alcanzada en los silos podría haber sido un factor determinante en el aparente buen control del deterioro. La compactación favorece que la población de levaduras se reduzca durante la fase de anaerobiosis dentro del silo, proporcionando un alimento más estable ante la exposición al oxígeno(20). Los resultados del comportamiento de los contenidos de la MS y la PC durante los días de exposición aeróbica muestran una interacción entre los ensilajes y los días de exposición (Figura 2). El ensilaje de control (a) tuvo un comportamiento cuadrático, mientras que el ETEB tuvo uno lineal (b) y los ETU (c) and ETBS (d) mostraron uno cúbico.

579


Rev Mex Cienc Pecu 2021;12(2):573-585

Figura 2: Contenidos de la materia seca (línea punteada) y la proteína cruda (línea solida) durante la exposición aeróbica de ensilajes de triticale de alta humedad con diferentes aditivos

ETC= control (a); ETEB= inoculante enzimático-bacteriano (b); ETU= urea (c); ETBS= benzoato de sodio (d).

Tanto el ETC (a) como el ETBS (d) mostraron una caída abrupta en el contenido de MS a partir del cuarto día de exposición aeróbica, mientras que el ETEB (b) tuvo una disminución lineal (R2= 0.8421). La disminución en el contenido de materia seca en los ensilajes con aditivos bacterianos es común y sugiere que ocurre una pérdida de materia. Estas pérdidas se deben a la reducción en la concentración de acetato(21), un potente antifúngico, y al aumento de la concentración de lactato, un sustrato de crecimiento para las levaduras. De hecho, por cada molécula de ácido acético formada se produce una molécula equivalente de dióxido de carbono, lo cual aumenta la pérdida de materia seca(22). La rápida disminución inicial en el contenido de MS en el ETU (c) puede deberse a la evaporación del amoníaco (Cuadro 2); en este tratamiento, hubo formación de grandes cantidades de amoníaco durante el proceso de fermentación. El aumento en el contenido de materia seca observado durante los primeros días en el ETBS (d) indica una pérdida de humedad por causa del ambiente. Este tipo de aditivo se caracteriza por

580


Rev Mex Cienc Pecu 2021;12(2):573-585

dificultar el desarrollo de las levaduras, lo cual retrasa la aparición del deterioro de la materia(5). Un comportamiento similar esta reportado en un ensilaje de caña de azúcar adicionado con benzoato de sodio(23). Los contenidos de PC se incrementaron de forma lineal en todos los ensilajes con agregados. Esta tendencia es un reflejo de la dilución, donde se observa principalmente el consumo de carbohidratos, y un aumento consecuente en las concentraciones de otros constituyentes en la materia seca. En cambio, el ETC tuvo un comportamiento opuesto observando que el contenido de PC disminuyó durante el tiempo de exposición aeróbica. Este sugiere que hubo degradación por mohos, que actúan a valores de pH más altos y consumen componentes más complejos(24). Hay una amplia variedad de estudios sobre las pérdidas de materia seca en los ensilajes después de la apertura del silo(7). Sin embargo, no hay muchos datos sobre el comportamiento de componentes específicos. Se necesitan más investigaciones sobre el tema para llegar a conclusiones más precisas. En cuanto a las variables de la ingesta de nutrientes, solo las de la FDN y la FDA mostraron diferencias entre los tratamientos; en ambos casos las más altas se registraron en el tratamiento del ETEB (Cuadro 4). Aunque es posible que este resultado no está relacionado con el tratamiento, también es posible que las bacterias presentes en el inoculante alteraron el ambiente ruminal, desde luego permitiendo un mayor consumo. Una mejoría en la ingesta de fibra en respuesta al uso de un inoculante enzimáticobacteriano no es un resultado consistente en la literatura. En una revisión, se concluyeron que las discrepancias entre los resultados de diferentes estudios pueden estar relacionadas, entre otros factores, con variaciones entre los inoculantes utilizados y entre las dietas(7). Por ejemplo, en un estudio sobre el efecto de la adición de un inoculante con celulasa a un alimento de sorgo se esperaba que se aprovechara mejor la fibra, pero no se observó tal respuesta ya que este grano tiene de por si un bajo contenido de fibra(25). Cuadro 4: Ingesta de nutrientes (g día-1) en dietas con ensilajes de triticale de alta humedad con diferentes aditivos Dietas Promedio CV (%) P ETC ETEB ETU ETBS IMS 975.78 1056.15 954.12 957.75 985.95 7.33 0.2569 IPC 156.51 164.47 163.66 147.41 158.01 7.73 0.2688 IEE 19.49 22.23 19.73 18.36 19.95 14.95 0.3876 b a b b IFND 388.06 431.87 383.64 381.76 396.33 5.33 0.0435 ab a b b IFDA 211.46 232.54 208.28 203.55 213.95 4.42 0.0197 IMO 927.66 1003.84 908.26 908.97 937.18 7.36 0.2599 ETC= control; ETEB= inoculante enzimático-bacteriano; ETU= urea; ETBS= benzoato de sodio; IMS= ingesta de materia seca; IPC= ingesta de proteína cruda; IEE= ingesta de extracto etéreo; IFDN= ingesta de fibra detergente neutra; IFDA= ingesta de fibra detergente acida; IMO= ingesta materia orgánica. ab Distintas letras superíndices en la misma línea indican diferencias (P<0.05).

581


Rev Mex Cienc Pecu 2021;12(2):573-585

En general, la digestibilidad de los nutrientes y de la materia seca de los ensilajes se vio afectada (P>0.05) por la adición de aditivos (Cuadro 5). Todas las dietas mostraron una digestibilidad de MS compatible con el ensilaje de maíz y sorgo de alta humedad, que son los alimentos de referencia para esta variable(26,27). Sin embargo, tanto los valores de digestibilidad de la MO (891 g kg MS-1) como de la PC fueron inferiores a los descritos para el triticale de alta humedad (907 g kg MS-1)(18). Cuadro 5: Digestibilidad aparente de los nutrientes en dietas de ensilajes de triticale de alta humedad con diferentes aditivos (g kg MS-1) Dietas ETC ETEB ETU ETBS Promedio CV P DMS 679.6 687.4 699.6 683.4 687.5 2.01 0.2898 DPC 707.5 715.2 703.6 689.7 711.5 2.67 0.0823 DEE 770.9 782.5 768.6 769.0 772.7 3.97 0.9035 DFDN 548.3 568.4 549.3 551.9 554.5 6.78 0.8583 DFDA 578.4 597.5 607.4 602.2 596.4 7.32 0.8012 DMO 706.8 710.4 721.0 710.6 712.2 1.95 0.5515 ETC= control; ETEB= inoculante enzimático-bacteriano; ETU= urea; ETBS= benzoato de sodio; DMS= digestibilidad de materia seca; DPC= digestibilidad de proteína cruda; DEE= digestibilidad extracto etéreo; DFDN= digestibilidad fibra detergente neutra; DFDA= digestibilidad fibra detergente acida; DMO= digestibilidad materia orgánica.

El comportamiento de la ingesta del animal es un parámetro eficaz en la evaluación de cualquier alimento(27). Muchas veces los beneficios químicos o fermentativos adquiridos de un alimento no se reflejan al momento de la alimentación. En el presente estudio ninguna de las variables relacionadas con el comportamiento de la ingesta de las ovejas difirió entre los tratamientos. En el tratamiento de ETBS, se esperaba un mayor tiempo de ingesta de agua ya que el mismo aditivo contiene sodio, pero no se observó tal comportamiento. Cabe señalar que en el presente estudio el consumo de agua no se midió. La falta de diferencias que se observó en los resultados es de notar porque la composición de una dieta puede afectar el comportamiento de la ingesta. Por ejemplo, se reporta que en ovejas el comportamiento de la ingesta se puede afectar por el contenido de proteína de una dieta, sin embargo, cuando la fuente de proteína fue urea no hubo diferencia con la dieta control(28), tal y como se observó en el presente estudio. Además, la acción fibrolítica de algunas enzimas presentes en determinados aditivos conduce a una reducción del contenido de fibra del ensilaje, lo que puede incrementar la ingesta de pienso(27). Sin embargo, el contenido de fibra en el tratamiento ETEB no se vio afectado (Cuadro 1) y, desde luego, el comportamiento de la ingesta no difirió del control.

582


Rev Mex Cienc Pecu 2021;12(2):573-585

Cuadro 6: Comportamiento de la ingesta en ovejas alimentadas con una dieta de ensilajes de triticale de alta humedad con diferentes aditivos Dietas ETC ETEB ETU ETBS Promedio P MAST 78.73 84.69 79.35 79.71 80.62 0.3716 -1 DUR, seg ciclo 56.29 59.94 57.52 57.06 57.70 0.4289 -1 MAST S 1.40 1.41 1.38 1.40 1.40 0.6047 -1 IA, min día 2.19 4.06 2.19 3.75 3.05 0.7490 -1 IS, min día 57.50 55.00 53.75 52.50 54.69 0.8895 -1 ISM, min día 5.31 3.75 3.13 6.65 4.71 0.1597 -1 RP, min día 7.81 6.25 6.88 5.31 6.56 0.7381 -1 RR, min día 141.56 148.75 147.50 132.50 142.58 0.4305 -1 OP, min día 43.75 42.19 40.94 45.93 43.20 0.8783 -1 OR, min día 99.69 97.81 102.81 109.00 102.34 0.6623 -1 CA, min día 2.19 2.19 2.81 4.36 2.89 0.5053 ETC= control; ETEB= inoculante enzimático-bacteriano; ETU= urea; ETBS= benzoato de sodio; MAST= Número de masticaciones; DUR= Duración del ciclo de rumiación; MAST S -1= Número de masticaciones por segundo; IA= ingesta de agua; IS= ingesta de solidos; ISM= ingesta de sales minerales; R= rumia de pie; RR= rumia de reposo; OP= ocio de pie; OR= ocio en reposo; CA: comportamiento atípico.

En el presente estudio la adición de los aditivos al triticale de alta humedad no derivó en efectos notables sobre la composición químico-bromatológica, la estabilidad aeróbica, la digestibilidad de nutrientes ni el comportamiento de ingesta en ovinos. Cabe señalar que la adición de urea al triticale de alta humedad sí incrementó el contenido de proteína cruda del ensilaje. Literatura citada: 1.

Moeinoddini HR, Alikhani M, Ahmadi F, Ghorbani GR. Rezamand P. Partial replacement of triticale for corn grain in starter diet and its effects on performance, structural growth and blood metabolites of Holstein calves. Animal 2017;11:61-67.

2.

Zhu F. Triticale: Nutritional composition and food uses. Food Chem 2018;241:468– 479.

3.

Ni K, Wang Y, Cai Y, Pang H. Natural lactic acid bacteria population and silage fermentation of whole-crop wheat. Asian-Australas J Anim Sci 2015;28:1123-1132.

4.

Bernardes TF, Reis RA, Siqueira GR, Amaral RC, Pires AJP. Estabilidade aeróbia da ração total e de silagens de capim-marandu tratadas com aditivos químicos e bacterianos. Rev Bras Zootec 2007;36:754-762.

5.

Knicky M, Spörndly R. The ensiling capability of a mixture of sodium benzoate, potassium sorbate, and sodium nitrite. J Dairy Sci 2011;94:824-831.

583


Rev Mex Cienc Pecu 2021;12(2):573-585

6.

Jobim CC, Lombardi L, Macedo FAFD, Branco AF. Silagens de grãos de milho puro e com adição de grãos de soja, de girassol ou uréia. Pesqu Agropecu Bras 2008;43:649-656.

7.

Oliveira MR, Jobim CC, Neumann M, Bueno AVI, Leão GFM, Daniel JLD. Effects of inoculation with homolactic bacteria on the conservation of wheat silage stored in bunker-silos. Ital J Anim Sci 2018;17:81-86.

8.

Jondreville C, Genthon C, Bouguennec A, Carre B, Nys Y. Characterization of European varieties of triticale with special emphasis on the ability of plant phytase to improve phytate phosphorus availability to chickens. Br Poult Sci 2007;48:678689.

9.

Playne MJ, McDonald P. The buffering constituents of herbage and silage. J Sci Food Agric 1996;17:262-268.

10. Cherney JH, Cherney DJR. Assessing silage quality. In: Buxtou DR, Muck RE, Harisson JH. Silage science and technology. Madison. 2003;141-198. 11. Official Methods of Analysis. Official methods of analysis. 15th ed. Gaithersburg (MD): AOAC International. Official Methods 934. 01, 942.05. 1990. 12. Van Soest PJ. Nutritional ecology of the ruminant. 2. ed. Ithaca: Cornell University Press; 1994. 13. Taylor CC, Kung Junior L. The effect Lactobacillus buchneri 40788 on the fermentation and aerobic stability of high moisture corn in laboratory silos. J Dairy Sci 2002;85:1526-1532. 14. NRC. Nutrient requirements of sheep 6th ed. National Academy of SciencesNational Research Council, Washington, DC, 1985. 15. Silva CJF, Leão MI. Fundamentos de Nutrição de Ruminantes. Piracicaba: Ed. Livroceres; 1979. 16. Johnson TR, Combs DK. Effects of prepartum diet, inert rumen bulk, and dietary polythylene glicol on dry matter intake of lactating dairy cows. J Dairy Sci 1991;74:933-944. 17. Carvalho GGP, Pires AJV, Silva RR, Carvalho BMA, Silva HGO, Carvalho, LM. Aspectos metodológicos do comportamento ingestivo de ovinos alimentados com capim-elefante amonizado e subprodutos agroindustriais. Rev Bras Zootec 2007;36:1105-1112. 18. Pieper R, Hackl W, Korn U, Zeyner A, Souffrant B, Pieper B. Effects of ensiling triticale, barley and wheat grains at different moisture content and addition of Lactobacillus plantarum (DSMZ 8866 and 8862) on fermentation characteristics and nutrient digestibility in pigs. Anim Feed Sci Technol 2011;164:96-105.

584


Rev Mex Cienc Pecu 2021;12(2):573-585

19. Leão GFM, Jobim CC, Neumann M, Horst EH, Santos SKD, Venancio BJ, et al. Nutritional composition and aerobic stability of winter cereal silage at different storage times. Acta Sci Anim Sci 2017;39:131-136. 20. Tabacco E, Piano S, Revello-Chion A, Borreani G. Effect of Lactobacillus buchneri LN4637 and Lactobacillus buchneri LN40177 on the aerobic stability, fermentation products, and microbial populations of corn silage under farm conditions. J Dairy Sci 2011;90:928-936. 21. Silva VP, Pereira OG, Leandro E, Silva T, Ribeiro K, Mantovani H, et al. Effects of lactic acid bacteria with bacteriocinogenic potential on the fermentation profile and chemical composition of alfalfa silage in tropical conditions. J Dairy Sci 2016;99:1895–1902. 22. Wilkinson JM, Davies DR. The aerobic stability of silage: key findings and recent developments. Grass Forage Sci 2012;68:1-19. 23. Pedroso ADF, Nussio LG, Loures DRS, Paziani SDF, Ribeiro JL, Mari LJ, et al. Fermentation, losses, and aerobic stability of sugarcane silages treated with chemical or bacterial additives. Sci Agric 2008;65:589-594. 24. Nout MR. Rich nutrition from the poorest–Cereal fermentations in Africa and Asia. Food Microbiol 2009;26:685-692. 25. McCuistion K, Foste JL, Schuster G, Wester D, Lopez Z, Umphres AM et al. Forage mass, nutritive value, and in situ degradation of sorghum silage treated with fibrolytic enzymes. Crop Forage Turfgrass Manag 2017;3:182-194. 26. Costa FMJ, Júnior GD, Zacaroni OF, Santos JF, Pereira RAN, Pereira MN. Silagem de grãos úmidos de milho de textura dura ou macia em dietas com polpa cítrica para vacas em lactação. Arq Bras Med Vet Zoot 2014;66:203-210. 27. Ribeiro ELA, Mizubuti IY, Silva LDF, Paiva FHP, Sousa CL, Castro, FAB. Desempenho, comportamento ingestivo e características de carcaça de cordeiros confinados submetidos a diferentes frequências de alimentação. Rev Bras Zootec 2011;40:892-898. 28. Kozloski GV, Cadorin Júnior RL, Harter CJ, Oliveira L, Alves TP, Mesquita FR et al. Effect of suplemental nitrogen source and feeding frequency on nutrient supply to lambs fed a kikuyu grass (Pennisetum clandestinum) hay-based diet. Small Ruminant Res 2009;81:112-118.

585


https://doi.org/10.22319/rmcp.v12i2.5540 Nota de investigación

Suplementación de ácidos grasos poliinsaturados en el empadre de ovejas nulíparas Katahdin: eficiencia reproductiva y crecimiento pre-destete de las crías

Ricardo Vicente-Pérez a Ulises Macías-Cruz b* Leonel Avendaño-Reyes b Enrique O. García-Flores a Ricardo Martínez-Martínez a Oziel D. Montañez-Valdez c José A. Reyes-Gutiérrez c Alfonso J. Chay-Canul d María M. Crosby-Galván e

a

Universidad de Guadalajara. Departamento de Producción Agrícola-CUCSUR, Av. Independencia Nacional 151, C.P. 48900, Autlán, Jalisco, México. b

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas, Baja California, México. c

Universidad de Guadalajara. Departamento de Ciencias de la Naturaleza-CUSUR, Jalisco, México. d

Universidad Juárez Autónoma de Tabasco. División Académica de Ciencias Agropecuarias, Villahermosa, Tabasco, México. e

Colegio de Posgraduados. Campus Montecillo, Programa de Ganadería. Estado de México, México.

*Autor de correspondencia: ulisesmacias1988@hotmail.com

586


Rev Mex Cienc Pecu 2021;12(2):586-597

Resumen: Un total de 46 ovejas nulíparas Katahdin se asignaron bajo un diseño de bloques completamente al azar a dos tratamientos dietarios (n= 23) alrededor del empadre para evaluar el efecto de adicionar ácidos grasos poliinsaturados (AGP) sobre el comportamiento reproductivo y el crecimiento pre-destete de las crías. Los tratamientos consistieron en dos concentrados isoenergéticos e isoproteícos formulados sin (testigo) y con AGP omega 6, los cuales se ofrecieron durante 42 d (7 d antes y 35 d de exposición al semental). La adición dietaria de AGP disminuyó (P<0.05) el intervalo a estro, sin afectar (P>0.05) las demás variables reproductivas. En crías, el peso al nacimiento no varió (P>0.05) con la adición de AGP; sin embargo, la inclusión dietaria de AGP aumentó (P<0.05) la tasa de crecimiento pre-destete y el peso al destete en corderos, pero no en corderas. La inclusión de AGP en la dieta también mejoró (P<0.05) el crecimiento pre-destete en crías de parto gemelar pero no en crías de parto simple. En conclusión, la inclusión de AGP omega 6 en la dieta de ovejas nulíparas Katahdin durante el empadre, redujo el tiempo de aparición del estro sin afectar otras variables reproductivas; asimismo, mejoró el crecimiento pre-destete de sus crías machos y aquellas nacidas en parto gemelar. Palabras clave: Ovinos de pelo, Ácido linoleico, Efecto flushing, Fertilidad, Crecimiento post-parto.

Recibido: 09/10/2019 Aceptado: 16/07/2020 Las ovejas jóvenes presentan menor eficiencia reproductiva que las ovejas adultas debido a su mayor incidencia de estros silenciosos, cortos y poco intensos(1). Adicionalmente, las crías nacidas de ovejas jóvenes tienden a presentar bajo peso al nacimiento y un crecimiento predestete lento(2). Los ácidos grasos poliinsaturados (AGP) omega 6 (n-6) son esenciales para los rumiantes y favorecen los procesos reproductivos de foliculogénesis, ovulación y actividad estral por estimular la síntesis de estradiol 17β a nivel ovárico, así como las prostaglandinas F2α (PGF2α) en el endometrio(3,4). Adicionalmente, los AGP pueden regular procesos epigenéticos y modificar la programación fetal durante la gestación temprana, provocando efectos de largo plazo sobre las crías en su vida post-natal(5). En este sentido, la formulación de la dieta de empadre con AGP n-6 podría ser una estrategia nutricional para mejorar la eficiencia reproductiva y el crecimiento de las crías en ovejas nulíparas. En ovejas multíparas Pelibuey, la suplementación dietaria de aceite de maíz (rico en AGP n6) mejoró el desarrollo folicular(6), el número de cuerpos lúteos, la calidad de los ovocitos(6) y el desarrollo embrionario(7). Esto se atribuyó a un aumento en las concentraciones séricas de colesterol, insulina, estradiol 17β y progesterona(8). Aunque, los efectos de incluir AGP n587


Rev Mex Cienc Pecu 2021;12(2):586-597

6 en la dieta de ovejas en empadre sobre sus variables reproductivas siguen siendo poco consistentes a través de los estudios(9,10). Adicionalmente, en ovejas multíparas de lana, la suplementación de AGP n-6 alrededor de la concepción resultó efectiva para reducir la mortalidad pre-destete e incrementar la capacidad de termorregulación post-natal en las crías(11). Cabe mencionar que estos efectos benéficos de los AGP n-6 no se han demostrado en ovejas primíparas de pelo. Por lo tanto, el objetivo del presente estudio fue evaluar el efecto de incluir AGP n-6 en la dieta de empadre sobre la eficiencia reproductiva de ovejas nulíparas Katahdin durante la época reproductiva natural, así como en el crecimiento predestete de sus crías. El presente estudio se realizó durante la época reproductiva (octubre-noviembre) en el rancho “El Tilzapote”, ubicado en la localidad de Ayutita del municipio Autlán de Navarro, Jalisco, México (1948 LN, 10424 LO y 1,013 msnm). Se utilizaron 46 ovejas nulíparas puras Katahdin, las cuales tenían 9 meses de edad, 43.9 ± 2.5 kg de peso vivo (PV) y 3.1 ± 0.6 unidades de condición corporal (CC) en una escala de 1 a 5(12). Los criterios para seleccionar las ovejas fueron CC entre 2.5 y 3.5 unidades, y presencia de signos de estro un mes previo al inicio del estudio para garantizar ciclicidad ovárica. Las ovejas se asignaron bajo un diseño de bloques completamente al azar (DBCA; factor de bloque= PV) a uno de dos tratamientos dietarios (n= 23). Los tratamientos consistieron en alimentar a las ovejas con ensilado de maíz sin elote a libre acceso y 400 g/día/oveja de un concentrado formulado sin (grupo testigo) o con una fuente rica en AGP n-6 (grupo AGP; Cuadro 1). Cuadro 1: Composición química de los concentrados y del ensilado que se ofrecieron a las ovejas en el empadre Componentes químicos Proteína cruda, % Cenizas, % Fibra cruda, % FDA, % FDN, % TND, % ED, Mcal/kg de MS EM, Mcal/kg de MS

Concentrados Testigo AGP 38.4 39.0 6.0 5.0 10.2 10.1 16.4 15.5 53.0 43.5 84.0 85.0 3.7 3.7 3.0 3.1

Ensilado 7.2 25.7 11.6 23.9 59.1 47.4 2.1 1.7

Ácidos grasos, % C14:0 C16:0 C16:1 n-7 C18:0 C18:1 n-9 C18:2 n-6 C20:0 C18:3 n-6 C20:1 n-9 C18:3 n-3 C22:0 Poliinsaturados Monoinsaturados Saturados

Concentrados Testigo AGP 0.5 0.1 20.4 12.1 0.4 0.2 3.3 3.6 39.5 24.4 28.0 50.3 0.4 0.3 0.3 0.2 0.4 0.1 2.8 2.4 0.1 0.2 31.4 53.2 40.3 24.7 24.3 16.0

FDA= fibra detergente ácida, FDN= fibra detergente neutra, TND= total de nutrientes digestibles, ED= energía digestible, EM= energía metabolizable.

588


Rev Mex Cienc Pecu 2021;12(2):586-597

Los concentrados fueron isoenergéticos e isoproteicos, pero el concentrado del grupo AGP se formuló con 3 % de aceite vegetal comercial rico en n-6. Para evitar afectaciones en el consumo del concentrado por la consistencia que podría darle el aceite, el concentrado del grupo testigo se formuló usando 3 % de aceite de freiduría, el cual es rico en ácidos grasos oxidados. Las ovejas se alimentaron con las dietas de tratamiento durante 42 días, 7 días antes del empadre y durante los 35 días de empadre. Los concentrados se ofrecieron diariamente en una sola exhibición por las mañanas (0700 h), antes de servir el ensilado. Después del periodo de empadre, las ovejas se alimentaron únicamente con ensilado de maíz hasta cuatro semanas antes del parto. En este último periodo de gestación y durante la lactancia, la alimentación de las ovejas se complementó con 500 g/día/oveja de un concentrado (energía metabolizable [EM] = 3.0 Mcal/kg de materia seca [MS] y proteína cruda [PC] = 380 g/kg de MS), que se formuló con 50 % de pasta de soya, 23 % de canola molida, 19 % de maíz molido, 4 % de minerales, 1 % de urea y 3 % de aceite. Por su parte, las crías tuvieron acceso libre a un alimento iniciador (“creep-feeding”) a partir de la segunda semana post-parto hasta el destete (día 90 post-parto), el cual contenía 210 g de PC/kg de MS y 3.5 Mcal de EM/kg de MS. El alimento iniciador se formuló con 30 % de pasta de soya, 63 % de maíz, 2 % de gluten, 2 % de aceite, 2 % de minerales y 1 % de sustituto de leche. Durante el experimento, las ovejas se mantuvieron en corrales separados por tratamiento. El espacio en comedero fue suficiente para garantizar que todas consumieran concentrado y ensilado simultáneamente, sin problemas de competencia. Se colectaron muestras de alimento (ensilado y concentrados) una vez por semana, las cuales fueron usadas para determinar análisis bromatológico (MS, PC, cenizas y fibra cruda)(13) y fracciones de fibra detergente neutro y ácida(14). Mismo procedimiento se realizó para las muestras de ensilado. Los contenidos de TND(15), energía digestible y EM(16) fueron calculados con fórmulas. Adicionalmente, el perfil de ácidos grasos se determinó en los concentrados usando un cromatógrafo de gases (HP 6890, USA), el cual estaba equipado con inyector automático (HP 7683, USA), charola con automuestreador y columna capilar de 100 m x 0.25 mm x 0.2 m (película) a 29 psi (Supelco SP 2560, USA). Evaluación de estado corporal: El PV y la CC de las ovejas se registró al día 7 antes del empadre, al final del empadre y al parto. Se calculó la ganancia de peso total (GPT) y la ganancia diaria de peso (GDP) de las ovejas durante el periodo que se ofrecieron los tratamientos (42 días). Evaluación del comportamiento reproductivo: Las ovejas no recibieron ningún tratamiento hormonal antes o durante el empadre por lo que la evaluación de la actividad estral fue acorde al desarrollo de su ciclo estral natural. La actividad estral de las ovejas se registró diariamente (0800 y 1800 h) durante los 35 días del periodo de empadre (del 8 de octubre al 11 de 589


Rev Mex Cienc Pecu 2021;12(2):586-597

noviembre) con ayuda de tres sementales de raza Dorper que tenían fertilidad probada. Los sementales se introdujeron individualmente en los corrales, pero se rotaron entre los tratamientos. Se consideró que una oveja estaba en estro cuando se mostraba receptiva al macho, aceptando la monta natural sin ningún reflejo de movimiento. La fecha y hora de la detección del estro se registró para cada oveja, e igualmente estas hembras en estro se marcaron con un crayón en el dorso y permanecieron en el mismo corral. El número de montas por oveja no se controló, pero se consideró una relación de 15 hembras por macho para asegurar el apareamiento(17). Un mes después de finalizado el periodo de empadre, se realizó el diagnóstico de gestación abdominalmente con ayuda de un equipo de ultrasonido portátil (Modelo DP-10 Vet, Mindray, Shenzhen, China) provisto de un transductor microconvexo. Las ovejas diagnosticadas no gestantes fueron retiradas del corral. Al parto, las ovejas permanecieron en el mismo corral, y solo se registraba fecha de parto y tipo de parto (simple o gemelar). La información colectada se utilizó para calcular las variables reproductivas. El porcentaje de ovejas en estro se obtuvo expresando el número de ovejas que presentaron estro como un porcentaje del total de ovejas tratadas, y el intervalo a estro contando el número de días transcurridos entre el primer día del empadre y el día que presentó la oveja estro. La tasa de gestación fue el porcentaje de ovejas diagnosticadas gestantes a partir de las ovejas montadas, mientras que la tasa de parición fue el porcentaje de ovejas paridas a partir de las ovejas diagnosticadas gestantes. La fertilidad fue el porcentaje de ovejas paridas a partir del total de ovejas tratadas, y la fecundidad fue el porcentaje de corderos nacidos por oveja montada. La prolificidad se calculó como el número de corderos nacidos por oveja parida. Finalmente, se calculó el porcentaje de ovejas con parto simple o doble a partir del total de ovejas paridas. Evaluación del crecimiento pre-destete: Todas las crías se identificaron al nacimiento con aretes, y se registró su sexo y peso al nacimiento. Al destete (90 d post-parto), los corderos se pesaron nuevamente para calcular la GPT y la GDP. Análisis estadístico: Todos los datos se analizaron utilizando el paquete estadístico SAS(18). Las variables de estado corporal, intervalo a estro y prolificidad se sometieron a un análisis de varianza bajo un DBCA. Las variables expresadas en porcentaje se analizaron con una prueba de Ji-cuadrada. El peso al nacimiento y las variables de crecimiento pre-destete de los corderos también se sometieron a un análisis de varianza, pero en un arreglo factorial 23 bajo un diseño completamente al azar, donde el modelo consideró los efectos fijos de tratamiento dietario (testigo y AGP), sexo (hembra y macho), tipo de parto (simples y gemelar) y todas las posibles interacciones. En el caso de variables de crecimiento pre-destete se adicionó al modelo el peso al nacimiento como covariable. Las comparaciones de medias se analizaron con una prueba de Tukey a una = 0.05. La interacción tratamiento x sexo x tipo de parto no fue significativa (P>0.05) por lo cual no se incluyó en los resultados.

590


Rev Mex Cienc Pecu 2021;12(2):586-597

La inclusión dietaria de AGP no afectó (P≥0.31) las variables de estado corporal de las ovejas (PV, CC, GPT y GDP) en ninguno de los tiempos de medición (Cuadro 2). Adicionalmente, la alimentación de las ovejas con AGP redujo (P=0.05) en siete días el intervalo a estro, pero no afectó (P≥0.28) las demás variables reproductivas (Cuadro 3). Los resultados de distribución de estros (Figura 1) mostraron que la mayoría (P<0.05) de las ovejas tratadas con AGP presentaron estro en la primera semana de empadre (17.4 vs 47.8 %), mientras que las ovejas testigo presentaron estro mayormente (P<0.05) en la segunda semana (43.5 vs 17.4 %). La presencia de estro fue baja para ambos tratamientos en las siguientes tres semanas (3, 4 y 5), aunque las ovejas testigo presentaron mayor (P<0.05) porcentaje de estro que las ovejas alimentadas con AGP en la cuarta semana. Cuadro 2: Peso vivo, ganancia de peso y condición corporal de ovejas nulíparas Katahdin alimentadas durante el empadre con un concentrado formulado con (AGP) o sin (testigo) ácidos grasos poliinsaturados n-6 Variables Peso vivo, kg Inicial (7 días pre-empadre) Fin de empadre Parto Ganancia de peso total, kg Ganancia diaria de peso, g/día Condición corporal Inicial (7 días pre-empadre) Fin de empadre Parto

Tratamientos Testigo AGP

EE

Valor de P

44.0 49.5 49.5 5.6 132

43.8 48.6 48.7 4.8 114

0.1 0.6 3.7 0.6 14

0.42 0.31 0.84 0.37 0.37

3.1 3.5 3.3

3.2 3.6 3.2

0.1 0.1 0.2

0.52 0.42 0.50

EE= error estándar.

Cuadro 3: Comportamiento reproductivo de ovejas nulíparas Katahdin alimentadas durante el empadre con un concentrado formulado con (AGP) o sin (testigo) ácidos grasos poliinsaturados n-6 Variables Ovejas, n Ovejas en estro, % Intervalo a estro, días Tasa de gestación, % Tasa de parición, % Fertilidad, % Fecundidad, % Partos simples, % Partos dobles, % Prolificidad, n

Tratamiento Testigo 23 23/23 (100.0) 17.0 ± 2.3 18/23 (78.3) 16/18 (88.9) 16/23 (69.6) 24/23 (104.3) 8/16 (50.0) 8/16 (50.0) 1.5 ± 0.1 591

AGP 23 22/23 (95.6) 10.3 ± 2.3 17/22 (77.3) 16/17 (94.1) 16/23 (69.6) 21/23 (91.3) 11/16 (68.7) 5/16 (31.2) 1.3 ± 0.1

Valor de P 0.31 0.05 0.66 0.57 1.00 0.35 0.28 0.28 0.67


Rev Mex Cienc Pecu 2021;12(2):586-597

Figura 1: Distribución de estros por semana (a) y acumulación de estros semanal (b) durante el periodo de empadre en ovejas Katahdin alimentadas con un concentrado formulado con (AGP) y sin (testigo) ácidos grasos poliinsaturados n-6

a,b

Letras diferentes dentro de una misma semana indican diferencias entre tratamientos a P<0.05.

Los resultados de crecimiento pre-destete se muestran en el Cuadro 4. La interacción tratamiento x sexo no afectó (P>0.11) el peso al nacimiento, pero sí (P<0.05) la GDP, GPT y peso al destete. El tratamiento de AGP incrementó (P<0.05) la GPT, GDP y peso al destete en corderos, pero no en corderas. Por su parte, la interacción tratamiento x tipo de parto afectó (P<0.05) el peso al nacimiento y todas las variables del crecimiento pre-destete. Las crías de

592


Rev Mex Cienc Pecu 2021;12(2):586-597

parto simple tuvieron mayor (P<0.05) peso al nacimiento que las crías de parto gemelar en ambos tratamientos dietarios. No obstante, los AGP incrementaron (P<0.05) la GDP, GPT y peso al destete en crías de parto gemelar, pero no (P>0.05) en crías de parto simple. Finalmente, la interacción tipo de parto x sexo afectó (P<0.05) el peso al nacimiento, pero no la GPT, GDP y peso al destete. El peso al nacimiento fue mayor (P<0.05) en crías de parto simple que en crías de parto gemelar en ambos sexos. Cuadro 4: Crecimiento pre-destete de crías de ovejas Katahdin alimentadas durante el empadre con un concentrado formulado con (AGP) o sin (testigo) ácidos grasos poliinsaturados n-6 Factores de estudio Variables de crecimiento n Factor A Factor B PVN (kg) PVD (kg) GPT (kg) GDP (g/día) Interacción tratamiento dietario x sexo Hembra 14 3.8 ± 0.2ª 28.0 ± 1.2ª 24.2 ± 1.2a 269 ± 14ª Testigo a Macho 10 3.9 ± 0.3ª 28.2 ± 1.7ª 24.5 ± 1.7 276 ± 19ª a Hembra 15 3.9 ± 0.2ª 28.5 ± 1.2ª 24.7 ± 1.2 278 ± 13ª AGP b b Macho 6 3.7 ± 0.3ª 34.3 ± 2.9 30.5 ± 2.9 341 ± 33b Interacción tratamiento dietario x tipo de parto Simple 8 4.5 ± 0.3ª 29.6 ± 2.0ab 25.9 ± 2.0ab 306 ± 20ª Testigo b Doble 16 3.2 ± 0.2 26.6 ± 1.4ª 22.8 ± 1.4ª 239 ± 12b Simple 11 4.1 ± 0.2ª 31.6 ± 2.4b 27.9 ± 2.4b 324 ± 25ª AGP b b b Doble 10 3.5 ± 0.2 31.1 ± 2.3 27.4 ± 2.3 295 ± 26ª Interacción tipo de parto x sexo Hembra 14 4.5 ± 0.2ª 29.8 ± 1.5ª 25.2 ± 1.5ª 281 ± 13ª Simple Macho 5 4.2 ± 0.3ª 32.0 ± 2.7ª 27.9 ± 2.7ª 310 ± 29ª Hembra 15 3.2 ± 0.2b 27.7 ± 1.5ª 24.5 ± 1.5ª 272 ± 16ª Doble b Macho 11 3.4 ± 0.2 28.8 ± 2.3ª 25.4 ± 2.3ª 282 ± 25ª n= número de corderos; PVN= peso vivo al nacimiento; PVD= peso vivo al destete; GPT= ganancia de peso total; GDP= ganancia diaria de peso. ab Letras diferentes en columnas, dentro de cada interacción doble, indican diferencias (P<0.05).

El estado corporal de las ovejas Katahdin no se modificó por adicionar AGP n-6 en la dieta de empadre, lo cual se esperaba considerando que los concentrados fueron isoenergéticos e isoproteicos, y el nivel de inclusión de aceite en las dietas fue relativamente bajo (3 %). Las dietas en ovinos no deben formularse con más del 6 % de cualquier aceite vegetal, ya que en exceso pueden reducir la actividad microbiana ruminal y, en consecuencia, también el consumo de alimento y estado corporal del animal(3). Los resultados de PV y CC coinciden con lo publicado(10).

593


Rev Mex Cienc Pecu 2021;12(2):586-597

Por otra parte, la inclusión de AGP n-6 en la dieta de empadre acortó en siete días el tiempo de aparición del estro natural en las ovejas Katahdin. Este hallazgo puede ser explicado por dos posibles mecanismos, dependiendo de la etapa del ciclo estral en que se encontraban las ovejas al momento de iniciar su alimentación con la dieta rica en AGP: 1) los AGP causaron una lisis temprana del cuerpo lúteo por estimular la síntesis de PGF2α al ser precursores del ácido araquidónico(4), y 2) los AGP aumentaron el crecimiento y la capacidad esteroidogénica de los folículos pre-ovulatorios(8). En congruencia con estos resultados, las ovejas Merino también presentaron menor tiempo al estro cuando se alimentaron con semillas de oleaginosas ricas en AGP n-6 durante el periodo de empadre(19). El uso de AGP n-6 en el periodo de empadre resultó en una estrategia nutricional que ayudó parcialmente a sincronizar naturalmente la actividad estral en las ovejas. Alrededor del 50 % de las ovejas alimentadas con AGP presentaron estro y recibieron monta natural dentro de la primera semana post-inicio del periodo de empadre. Este hallazgo tiene gran relevancia práctica, ya que podría reducir los tiempos de producción asociados con actividades como empadres, partos, cuidados pre-destete de las crías y manejo general del rebaño. Si bien, el tiempo al estro se redujo por incluir AGP n-6 en la dieta de empadre, el comportamiento reproductivo de las ovejas Katahdin no cambió por la implementación de esta estrategia nutricional. Este hallazgo es contrario a lo esperado. Estudios previos en ovejas Pelibuey indican que la suplementación de AGP n-6 durante el empadre favorece el desarrollo folicular(6) y embrionario(7), así como la tasa ovulatoria(7) y la funcionalidad del cuerpo lúteo(8). Por consiguiente, en este estudio se esperaba mayor tasa de preñez, fertilidad, prolificidad y presencia de partos múltiples en las ovejas nulíparas Katahdin. Contrario a los presentes resultados, las ovejas multíparas Afshari mejoraron su fertilidad, tasa de parición y porcentaje de partos gemelares por recibir AGP n-6 a partir de aceite de girasol protegido con sal de calcio(9,20). En un estudio(17) donde usaron ovejas de los genotipos Pelibuey, Blackbelly y Pelibuey x Blackbelly, se reportó que la suplementación de aceite de soya como fuente de AGP n-6 ayudó a incrementar la prolificidad pero no la tasa de concepción y fertilidad. Posiblemente, los AGP no mejoraron el comportamiento reproductivo de las ovejas Katahdín porque el tiempo de alimentación con AGP antes del periodo del empadre fue corto (7 días); se requiere ofrecer el concentrado al menos 20 días antes de exponer a las ovejas al macho, y continuar durante el periodo de empadre(9,17,20). Otra posible causa es una baja biodisponibilidad de los AGP en la circulación después de su consumo, considerando que solo el 15 % de ellos llegan intactos al intestino para su absorción, y el resto, es saturado durante la biohidrogenación ruminal(3). Al respecto, Asgari Safdar et al(20) encontraron mayor crecimiento folicular, concentración sérica de hormonas esteroidales, fertilidad, prolificidad y tasa de parición cuando las ovejas consumieron aceite de girasol protegido en sal de calcio comparado a cuando dicho aceite no estaba protegido. 594


Rev Mex Cienc Pecu 2021;12(2):586-597

Por otra parte, el efecto de alimentar ovejas con AGP en el empadre sobre el peso al nacimiento de las crías es contradictorio en la literatura; mientras que algunos estudios no reportan efectos(19), otros indican una mejora en el peso al nacimiento(9,20). En este estudio, la alimentación de las ovejas en el empadre y el sexo de las crías no afectaron el peso al nacimiento, pero el tipo de parto mostró ser un factor importante para definir la variación de dicha variable. Las crías de cualquier sexo u origen de madre fueron más pesadas cuando nacieron en parto simple que en parto gemelar. En la literatura se señala consistentemente esta diferencia de peso al nacimiento debido al tipo de parto(21). Las crías de ovejas alimentadas con AGP en el empadre mostraron un mejor crecimiento predestete, particularmente, las crías que nacieron macho o en parto gemelar. Actualmente, se conoce que la programación fetal se inicia después de la concepción, y varía entre individuos de acuerdo al sexo y tipo de parto(2). Mientras que los fetos machos se programan para tener un mejor desarrollo muscular postnatal que las hembras(22), los fetos de gestación múltiple a diferencia de los fetos de gestación simple se programan para presentar de manera natural restricción intrauterina en su crecimiento fetal pudiendo afectar negativamente su desarrollo postnatal(23). Por lo tanto, los hallazgos encontrados sugieren que, en ovejas Katahdin, los AGP n-6 en el empadre ejercen efectos benéficos de largo plazo sobre el crecimiento predestete de los corderos a través de modificar su programación fetal en la etapa temprana de la gestación. Adicionalmente, esta estrategia nutricional parece revertir parcialmente la programación fetal natural del crecimiento que presentan los fetos de preñez gemelar; este hecho explica el mejorado crecimiento pre-destete que tuvieron los corderos de origen gemelar nacidos a partir de ovejas alimentadas con AGP. Los AGP se asocian a la programación fetal del metabolismo lipídico y muscular, así como a la conducta y vigor de los neonatos(5). Cabe mencionar que esto se requiere comprobar en estudios futuros donde la programación fetal sea evaluada. La alimentación con AGP n-6 en el empadre redujo el tiempo de aparición del estro, pero no mejoró el comportamiento reproductivo general en ovejas nulíparas Katahdin durante la época reproductiva natural. Adicionalmente, esta estrategia nutricional tuvo efectos benéficos de largo plazo sobre el crecimiento pre-destete de los corderos y las crías nacidas en parto gemelar. Agradecimientos Se agradece al M.V.Z. Ramón Andrade Mancilla por facilitar su rancho “El Tilzapote”, y por todo el apoyo técnico que brindo durante la realización del experimento.

595


Rev Mex Cienc Pecu 2021;12(2):586-597

Literatura citada: 1. Corner RA, Mulvaney FJ, Morris ST, West DM, Morel PCH, Kenyon PR. A comparison of the reproductive performance of ewe lambs and mature ewes. Small Ruminant Res 2013;114:126-133. 2. Kenyon PR, Blair HT. Foetal programming in sheep – Effects on production. Small Ruminant Res 2014;118:16-30. 3. Hess BW, Moss GE, Rule DC. A decade of developments in the area of fat supplementation research with beef and sheep. J Anim Sci 2008;86(14 Suppl):E188204. 4. Whates DC, Abayasekara DRE, Aitken RJ. Polyunsaturated fatty acids in males and female reproduction. Biol Reprod 2007;77:190-201. 5. Kabaran S, Besler HT. Do fatty acids affect fetal programing? J Health Popul Nutr 2015;33(14):1-9. 6. Meza-Villalvazo V, Magaña H, Sandoval C, Morales M, Chay A, Trejo A. Efecto de los ácidos grasos poliinsaturados sobre población folicular y calidad ovocitaria en ovejas Pelibuey. Universidad y Ciencia 2013;29:255-261. 7. Herrera-Camacho J, Aké-López JR, Ku-Vera JC, Williams GL, Quintal-Franco JA. Respuesta ovulatoria, estado de desarrollo y calidad de embriones de ovejas Pelibuey superovuladas suplementadas con ácidos grasos poliinsaturados. Téc Pecu Méx 2008;46:107-117. 8. Meza-Villalvazo VM, Magaña-Sevilla H, Rojas-Marquez CA, Sandoval-Castro C, TrejoCordova A. El aceite de maíz incrementa los niveles séricos de progesterona y estradiol en ovejas de pelo. Ecosist Recur Agropec 2018;5:583-589. 9. Daghigh Kia H, Asgari Safdar AH. Effects of calcium salts of fatty acids (CSFA) with different profiles (w-3 and w-6) during the flushing period on reproductive performance on Afshari ewes. Small Ruminant Res 2015;126:1-8. 10. Mirzaei-Alamouti H, Mohammadi Z, Shahir MH, Vazirigohar M, Mansouryar M. Effects of short-term feeding of different sources of fatty acids in pre-mating diets on reproductive performance and blood metabolites of fat-tailed Iranian Afshari ewes. Theriogenology 2018;113:85-91. 11. Clayton EH, Wilkins JF, Friend MA. Intergenerational effects of omega-6 fatty acids. 2. Preliminary evidences for the influences of diet fed to dam at conception on sex ratio of lambs born to their daugthers. Anim Reprod Sci 2017;57:51-59.

596


Rev Mex Cienc Pecu 2021;12(2):586-597

12. Russel AJF, Doney JM, Gunn RJ. Subjective assessment of body fat in live sheep. J Agr Sci 1969;72(3):451-454. 13. AOAC, 2003. Official methods of analysis. 17th Edition current through 2nd Revition.ED. Association of Official Analytical Chemists, Washington DC, USA. 14. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):223-232. 15. Alves AR, Beelen PMG, de Medeiros AN, Neto SG, Beelen RN. Consumo e digestibilidad do feno de sabia por caprinos e ovinos suplementados com polietilenoglicol. Rev Caatinga 2011;24:152-157. 16. NRC. Nutrient requirements of sheep. National Academy Press, Washington, DC. 1985. 17. Cansino-Arroyo G, Herrera-Camacho, Aké-López. Tasas de concepción, fertilidad y prolificidad en ovejas de pelo alimentadas con dietas enriquecidas con ácidos grasos poliinsaturados. Universidad y Ciencia 2009;25:181-185. 18. SAS Institute, SAS/STAT. User´s guide statistical released 9.1. 2nd Ed. SAS Intitute, Inc. Cary, NC, USA; 2004. 19. Clayton EH, Friend MA, Wilkins JF. Increasing the proportion of female lambs by feeding Merino ewes a diet high in omega-6 fatty acids around mating. Anim Prod Sci 2016;56(7):1174-1184. 20. Asgari Safdar AH, Sadeghi AA, Chamani M. Effects of different fat sources (saturated and unsaturated) on reproductive performance and biological indices of ewes during flushing period. Trop Anim Health Prod 2017;49:1447-1453. 21. Macías-Cruz U, Álvarez-Valenzuela FD, Olguín-Arredondo HA, Molina-Ramírez L, Avendaño-Reyes L. Ovejas Pelibuey sincronizadas con progestágenos y apareadas con machos de raza Dorper y Katahdin bajo condiciones estabuladas: producción de la oveja y crecimiento de los corderos durante el período pre-destete. Arch Med Vet 2012;44:2937. 22. Sinclair KD, Allegrucci C, Singh R, Gardner DS, Sebastian S, Bispham J, et al. DNA methylation, insulin resistance, and blood pressure in offspring determined by maternal periconceptional B vitamin and methionine status. Proc Natl Acad Sci U S A 2007;104:19351-19356. 23. Van der Linden DS, Sciascia Q, Sales F, McCoard SA. Placental nutrient transport is affected by pregnancy rank in sheep. J Anim Sci 2013;91:644-653.

597


https://doi.org/10.22319/rmcp.v12i2.4856 Nota de investigación

Presencia de aflatoxina B1 en alimentos para cabras en unidades de producción de leche caprina del altiplano mexicano

José Jesús Pérez González a Salvador Vega y León a Rey Gutiérrez Tolentino a* Beatriz Sofia Schettino Bermúdez a Fátima Itzel Martínez Solis a Arturo Camilo Escobar Medina ab

a

Universidad Autónoma Metropolitana. Departamento de Producción Agrícola y Animal. Calzada del Hueso 1100, Col. Villa Quietud, Delegación Coyoacán, 04960, Ciudad de México, México. b

Centro Nacional de Sanidad Agropecuaria (CENSA). San José de las Lajas, Mayabeque, Cuba.

*Autor de correspondencia: reygut@correo.xoc.uam.mx

Resumen: La presencia de aflatoxinas en el ensilaje y en granos que se destinan para la alimentación de los rumiantes en lactación representa un problema para la salud animal y la inocuidad de la leche. El objetivo del presente trabajo fue determinar el contenido de aflatoxina B1 en alimentos consumidos por cabras procedentes de cuatro unidades de producción de leche caprina del altiplano mexicano (APM). Un total de 47 muestras de concentrados y 29 muestras de ensilados procedentes de cuatro unidades de producción de leche caprina del Altiplano Mexicano (APM). Se analizaron 47 muestras de concentrados y 29 muestras de ensilados por Cromatografía de Líquidos de Alta Resolución (HPLC), empleando una columna de fase reversa y detección por fluorescencia previa derivatización de las aflatoxinas. Los resultados mostraron que el 38.29 % y 31.02 % de las muestras de concentrados y ensilados respectivamente presentaron niveles de AFB1 superiores al límite máximo permisible establecido por la 598


Rev Mex Cienc Pecu 2021;12(2):598-608

Unión Europea (UE) (0.05 µg/kg); mientras el 29.78 % y 10.34 % para concentrados y ensilados respectivamente presentaron valores superiores a los 20 µg/kg propuesto por la norma oficial mexicana. Los resultados obtenidos corroboran la problemática actual de la presencia de aflatoxinas en la alimentación de las cabras lactantes, al poder metabolizarse esta toxina en aflatoxina M1 y afectar la inocuidad de la leche y derivados de encontrarse la misma. Palabras clave: Aflatoxina B1, Concentrado, Ensilado, HPLC, Cabras lactando.

Recibido: 13/04/2018 Aceptado: 08/01/2020

Hoy en día, la seguridad de la calidad e inocuidad alimentaria constituye un factor relevante para muchos países(1). La salud y productividad de un animal, junto con la calidad e inocuidad de su leche producida, dependen de la calidad y el manejo del alimento que consumen. Ningún alimento destinado a la nutrición de los animales productores de leche debe presentar algún riesgo de contaminación física, química o microbiológica. Tanto el alimento comercial, como el producido en la granja, deben considerarse como potencial de riesgo para la salud, por lo que antes de proporcionarlo al ganado productor de leche como las cabras, debe ser examinado cuidadosamente para cerciorarse de que no exista presencia de contaminantes (tierra, cuerpos extraños, alambre, hongos, entre otros)(2). La contaminación de alimentos por hongos es un fenómeno muy frecuente, debido a que sus esporas se encuentran ampliamente distribuidas en el ambiente (aire, agua, suelo); de tal modo que la producción agrícola (granos y semillas principalmente) se ve afectada en más de un 25 % con la presencia de algún tipo de micotoxinas(3). Los hongos son capaces de desarrollarse en cualquier punto de la cadena alimentaria, en condiciones (pH, humedad relativa, humedad del grano, viabilidad, tiempo de almacenamiento y la presencia de microflora) que favorezcan su desarrollo(4), cabe hacer mención que algunas especies de hongos son capaces de colonizar y producir aflatoxinas en diferentes medios como alimentos para humanos y animales. Las aflatoxinas son sustancias tóxicas producidas en el metabolismo secundario de los hongos Aspergillus flavus, Aspergillus parasiticus y Penicillium puberulum(5). Se han identificado 18 tipos de aflatoxinas, de las cuales seis tienen significación como contaminantes de los alimentos: B1, B2, G1, G2, M1 y M2; de ellas la AFB1 es la más carcinogénica y tóxica(4). Las aflatoxinas, al encontrarse en forrajes, ensilados y concentrados, estos al ser consumidos por los animales pueden estar presentes en su forma original o metabolizados en sus tejidos. Entre sus metabolitos aparece la aflatoxina M1 (AFM1) que es excretada en la leche(6,7).

599


Rev Mex Cienc Pecu 2021;12(2):598-608

Los primeros estudios sobre la determinación de AFM1 en México, fueron realizados en el estado de Sonora por Esqueda et al(8) en muestras de leche de vaca ultrapasteurizada y comercializada en dicho estado, y por otra parte tampoco se ha informado sobre la presencia de AFB1 en alimentos para cabras lecheras en hatos mexicanos. Algunos de los países en los que se han hecho investigaciones sobre alimentos, leche y derivados lácteos de cabra son: Egipto(9,10), Cuba(11), Portugal(12), España(13), Italia(14-17), Brasil(18), Turquía(19,20) Kenia(21,22), Sudáfrica(23). En la mayoría de las investigaciones se determinó la transferencia de AFB1 de los alimentos a AFM1 en la leche y queso. También evaluaron el contenido de AFM1 en leche y quesos, encontrando hasta un 69 % de muestras positivas con niveles superiores al límite máximo permisible establecido por la Unión Europea (UE) de 0.05 µg/kg para el caso de la leche y hasta un 19 % de muestras positivas con niveles superiores al límite máximo permisible establecido por la UE para el caso de los quesos. En México se desconoce el estado actual de la presencia de AFB1 en alimento para cabras y la aplicación permanente de métodos y técnicas para valorar esa micotoxina considerada como patógena. El objetivo de este trabajo fue determinar el contenido de AFB1 en alimento para cabras procedentes de cuatro unidades de producción de leche caprina del Altiplano mexicano (APM). La metodología se desarrolló de la siguiente forma: se obtuvieron un total de 47 muestras de concentrados (compuestos principalmente por maíz, sorgo y soya) y 29 muestras de ensilados de maíz procedentes de cuatro unidades de producción de leche caprina (Unidad 1, Unidad 2, Unidad 3 y Unidad 4) del APM. Las muestras se tomaron simultáneamente cada mes durante el periodo comprendido de junio del 2008 a agosto del 2009, de acuerdo con la metodología propuesta por la Norma NOM-188-SSA12002(24). La cantidad mínima para cada una de las muestras fue de un kilogramo, tomándose de distintos puntos del lote. Las muestras se transportaron al laboratorio en recipientes limpios, etiquetados, y protegidos contra la contaminación y deterioro del transporte. Las muestras se analizaron para determinar su contenido de AFB1 por HPLC con detector de fluorescencia de acuerdo con lo establecido en los métodos 968.22 (extracción y columna cromatográfica), 971.22 (preparación de soluciones y determinación de concentración de aflatoxinas) y 990.33 (derivatización) de la AOAC(25) e ISO 14718 (método de cromatografía líquida de alta resolución)(26). Para el procesado de las muestras, se molieron 500 g de muestra en un molino y se pasó por un tamiz con una abertura de 1 mm. Posteriormente, se dividió la muestra por el procedimiento de cuarteo, tomando la muestra en forma diagonal, se mezcló y se almacenó en una bolsa de nylon o frasco bien cerrado. Para la extracción, se pesaron 50 g de muestra previamente molida y tamizada con exactitud de 0.1 g y se colocó en un matraz Erlenmeyer con tapa y se le adicionaron 25 g de Celite 545, 25 ml de agua y 250 ml de cloroformo. Se aseguró el tapón y se agitó mecánicamente durante 30 min. Posteriormente, se decantó la solución pasándola por un papel filtro estriado. Se colectaron los primeros 50 ml del filtrado y se almacenaron en un frasco de color ámbar a 4 ºC hasta su análisis.

600


Rev Mex Cienc Pecu 2021;12(2):598-608

Para la purificación, se rellenó el fondo de una columna cromatográfica con lana de vidrio, se adicionaron 5 g de sulfato de sodio anhidro (J.T. Baker) y una cantidad suficiente de cloroformo hasta la mitad de la columna. Seguidamente se adicionaron 10 g de sílica gel (J.T. Baker) disuelta en cloroformo deslizándola sobre las paredes de la columna. Se lavaron las paredes de la columna con 20 ml de cloroformo dejando drenar, cuando quedaron entre 5 a 7 cm de cloroformo por encima de la sílica, se adicionaron 15 g de sulfato de sodio anhidro dejando entre 1 a 2 cm de cloroformo por encima del tope del sulfato, se drenó el cloroformo hasta el tope del sulfato, se adicionó la muestra y se drenó hasta que llegó al tope de la columna. Se lavó la misma con 150 ml de hexano y 150 ml de éter dietílico, ambos lavados se descartaron y se eluyeron las aflatoxinas con 150 ml de una mezcla de cloroformo: metanol (97:3 v/v). El eluato cloroformo:metanol se rotoevaporó a casi sequedad bajo presión reducida a una temperatura de 30 ºC. El residuo obtenido se transfirió a un vial recuperándolo con 500 a 1000 μl de cloroformo y se evaporó a sequedad bajo nitrógeno. Al residuo seco se le adicionaron 200 μl de hexano y se agitó con el vortex (ZX4 Advanced IR Vortex Mixer- VELP Scientifica) por 1 min. Posteriormente, se agregaron 50 μl de ácido trifluoroacético, se tapó y se mezcló con el vortex por 1 min y se colocó en baño María a 40 ºC por 30 min. Una vez transcurrido este lapso se evaporó bajo nitrógeno. El residuo se resuspendió en 500 μl de la fase móvil (200 ml de metanol, 200 ml de acetonitrilo y 600 ml de agua; filtrada y desgasificada) antes de someterlo a la cromatografía. Para derivatizar el estándar se tomaron 50 μl de la concentración conocida del estándar, se llevó a sequedad bajo nitrógeno y se procedió de la misma forma anteriormente descrita. Se empleó un cromatógrafo de líquidos de alta resolución Merck-Hitachi con detector de fluorescencia LaCrhom-7480 (longitud de excitación y emisión de 350 nm y 450 nm respectivamente) y una columna de fase reversa C18 Lichrocart 100 (5µm 250 x 0.4 cm). El flujo fue de 1 ml/min. Primero se aplicó fase móvil seguida del estándar para comprobar los tiempos de retención. Posteriormente, se aplicaron 50 μl del eluato de las muestras. Los cromatogramas se registraron usando una interfase Perkin Elmer NCI 900 y procesados con el software TOTALCHROM versión 6.2. La validación del método se realizó bajo las directrices del Centro Nacional de Metrología(27). A partir de la solución de trabajo se preparó una curva patrón con concentraciones conocidas de 0.1, 0.25, 0.5 y 1 µg/ml; con el fin de establecer la linealidad, límite de detección, límite de cuantificación y exactitud del método. Los resultados fueron los siguientes, en la Figura 1 se presenta el perfil cromatográfico de la AFB1 cuando el estándar es derivatizado con ácido trifluoroacético. El tiempo de retención fue de 5.21 ± 0.10 min. La curva de calibración (y=312869.71x+218056.30) mostró una linealidad significativa (P<0.05) en un intervalo de 0.10-1 µg/ml con un coeficiente de regresión de 0.99. Los límites de detección y cuantificación fueron 0.241 y 0.43 µg/kg respectivamente. El recobrado fue de 87 %. Los resultados obtenidos fueron satisfactorios según los criterios propuestos en la Guía de Laboratorio para la Validación de Métodos(27) y muestran que el método fue eficiente para evaluar la 601


Rev Mex Cienc Pecu 2021;12(2):598-608

presencia de AFB1 en los niveles que exige la UE(28) y la NOM-188-SSA1-2002(24) para 5 y 20 µg/kg respectivamente. Figura 1: Perfil cromatográfico del estándar de AFB1 (2.19 µg/ml) derivatizado

En el cromatograma 1 es del blanco de reactivo donde la señal (A) corresponde precisamente al pico del solvente.

En el Cuadro 1 se presenta un resumen del número de muestras de concentrados y ensilados en diferentes intervalos de contenidos de AFB1, donde se observa que el 38.29 y 31.0 % de las muestras presentaron niveles de AFB1 superiores al límite máximo permisible establecido por la UE (5 µg/kg) para los concentrados y ensilaje respectivamente(28), por otra parte el 29.78 y 10.3 % de las muestras de concentrado y ensilaje respectivamente, sobrepasan el valor establecido en la norma mexicana (NOM188-SSA1-2002)(24). Cuadro 1: Ocurrencia de aflatoxina B1 en muestras de concentrados y ensilados en cuatro unidades productoras de leche de cabra Distribución de frecuencia (%) Matriz

Concentrado Ensilado

Muestras analizadas, No. Muestras positivas que rebasan el LMR establecido por la UE, % Muestras positivas que rebasan el LMR establecido por la NOM, % nd-5 µg/kg 5-20 µg/kg >20 µg/kg

Total

47 38.3

29 31

76 69.3

29.8

10.3

41.1

29 (61.7%) 4 (8.5%) 14 (29.7%)

20 (68.9%) 6 (20.6%) 3 (10.3%)

49 (64.4%) 10 (13.1%) 17 (22.3%)

LMR= límite máximo permitido; UE= Unión Europea; NOM= Norma Oficial Mexicana.

602


Rev Mex Cienc Pecu 2021;12(2):598-608

En la Figura 2 se muestran los intervalos de concentraciones de aflatoxina B1 por unidades para las muestras de concentrados y ensilados, donde el intervalo de concentración osciló entre 0.46-974 µg/kg y 0.44-123.98 µg/kg respectivamente. La unidad 1 para concentrado presentó los mayores valores de aflatoxinas con una mediana de 125 µg/kg, mientras en ensilado la unidad 2 presentó una mediana de 8 µg/kg. El 22.3 % de todas las muestras (concentrados y ensilados) presentaron valores por encima de 20 µg/kg, alcanzando niveles hasta 50 veces por encima del valor permisible, aspecto de gran preocupación por el riesgo que puede presentar en la inocuidad de los productos lácteos(29). Figura 2: Concentraciones de AFB1 en concentrados (A) y ensilados (B) procedentes de cuatro unidades de producción de leche de cabra en el altiplano mexicano

En la gráfica B, en la Unidad 1 no se proporciona el valor de aflatoxina porque no se oferta este producto.

La presencia de aflatoxinas en maíz en concentraciones altas en orden de miles de µg/kg han sido informada por diversos autores en la región de África(30), donde existe un predominio de un clima subtropical y tropical caracterizado por alta temperatura y humedad, que unido a malas prácticas agrícolas y de producción favorece el crecimiento de estas toxinas(31). Informes en otras regiones como Asia y América Latina(32), también reportan altos valores de aflatoxinas en alimentos, lo que corrobora la problemática global de esta toxina y ha sido alertado por la Organización de las Naciones Unidas para la Alimentación (FAO) en diferentes escenarios, donde se prevé que el riesgo de contaminación por aflatoxinas aumentará en el maíz por el efecto del cambio climático(33). Otro factor que condiciona el nivel y la síntesis de aflatoxinas es el sustrato. De esta manera, alimentos con elevadas concentraciones de hidratos de carbono favorecen la producción de toxinas(29). Los hidratos de carbono constituyen la parte más importante de los cereales como el maíz, avena, sorgo y soya, utilizados para la elaboración de los concentrados que se proporcionan como alimento a las cabras, por lo cual, son más susceptibles a la contaminación fúngica y la consiguiente síntesis de aflatoxinas. La presencia de aflatoxina B1 en ensilados también se ha reportado cuando se presenta un 603


Rev Mex Cienc Pecu 2021;12(2):598-608

deterioro aeróbico durante su proceso, lo que favorece el crecimiento de microorganismos patógenos y la producción de endotoxinas y micotoxinas(34,35). Un estudio realizado en Brasil mostró valores de aflatoxina B1 en ensilaje de maíz en un rango 0 -100 µg/g en muestra pre y post fermentada(36), superior a lo encontrado a este estudio. Otros estudios también reflejan altos conteos de hongos, lo que podría afectar la palatabilidad de los alimentos y reducir la absorción de nutrientes de los animales(37); sin embargo, la mayor preocupación está cuando se consumen estos alimentos por animales en lactación y la presencia de productos metabólicos en los productos lácteos, que eventualmente afectarán la salud humana, principalmente la de los bebés. La presencia de aflatoxina M1 en leche es debido a la transformación metabólica de la aflatoxina B1, donde una tasa de contaminación de 13.4 % en los materiales de alimentación, se estiman niveles de AFM1 entre 0.22 a 3.47 %(38). Un estudio realizado en 17 granjas caprinas del noreste de Italia, mostraron una correlación positiva (0.6) entre la presencia de aflatoxina B1 en el concentrado y la aflatoxina M1 en leche, donde concentraciones de 5 µg/kg de aflatoxina B1 en el alimento presentaron una tasa de conversión de aflatoxina M1 del 0.5 % (25 ng/kg de leche)(39). Estos resultados alertan a los organismos reguladores en predecir la presencia de aflatoxina M1 en la leche en estas unidades, si se considera que la mediana de concentración de AFB1 en concentrado y ensilado fue mayor de 20 µg/kg en este estudio y considerando una tasa de conversión del 0.5 % se puede encontrar más de 100 ng de aflatoxina por kilo, estando por encima de LMP por la FDA. Por otra parte, se alerta la necesidad de tener un mayor control de los alimentos que se emplean en las granjas pecuarias que permita minimizar el impacto de la micotoxinas en la industria láctea y en la salud pública. Aspecto que ha sido corroborado en varios estudios cuando existe una mejora continua de las técnicas de alimentación en las granjas lecheras(40). Existió una alta incidencia y concentración de AFB1 en las cuatro unidades de producción de leche caprina del APM, encontrándose por arriba de los límites máximos permisibles establecidos. Por lo tanto, es necesario seguir con las investigaciones y desarrollar un programa de detección permanente en dichas unidades para evitar lotes de alimentos contaminados con AFB1, ya que se debe tener presente que para la industria láctea la ausencia de AFB1 es muy importante, debido a que cuando un animal ingiere un alimento contaminado con AFB1, entre el 1 y 3 % de ésta es metabolizada hacia la leche y derivados lácteos en forma de AFM1, lo que afecta la calidad e inocuidad de la leche y derivados lácteos. Se reporta por vez primera la presencia de aflatoxina B1 en ensilado en México, aspecto que se debe seguir profundizando para conocer la presencia de otras micotoxinas que también repercuten en la salud pública como son ocratoxina zearalenona y fumonisinas, que han sido reportadas en países del trópico como Brasil. Por otra parte, debido al incremento de la producción de leche de cabra en México en la última década y la poca información en este tema, se debe potencializar los estudios longitudinales con la

604


Rev Mex Cienc Pecu 2021;12(2):598-608

intención de entender la presencia de AFB1 y AFM1 en la producción caprina, sumando además otras zonas con gran potencial de producción de leche de cabra. Literatura citada: 1. FAO. Food and Agriculture Organization of the United Nations. Sistemas Nacionales de Inocuidad de Alimentos en las Américas y el Caribe: Análisis de la situación actual http://fao.org/docrep/fao/010/j6410s.pdf 20/05/08. Consultado 30 Ago, 2017. 2. Trujillo J. Lineamientos para el reconocimiento de las buenas prácticas en producción de leche caprina. (2002). Fuente: http://64.233.187.104/search?q=cache:ILqy5ULsQi8J:www.senasica.sagarpa.gob. mx/web/propuestas_web/221204/inocuidad_agroalimentaria/Lineamientos. Consultado 30 Ago, 2017. 3. Escobar A, Vega S, Gutiérrez R, Coronado M, Díaz G. Aflatoxina M1 en leche y derivados lácteos. Actualidad y Perspectivas en América Latina. Carnilac Ind 2005;20:21-27. 4. Vega S, León J. Residuos tóxicos en alimentos. Conceptos y métodos. 1.a ed. CDMX, México: UAM-X. 1998. 5. Bolet M, Socarrás M. Micotoxinas y cáncer. Rev Cubana Invest Bioméd 2005;24:5459. 6. Gimeno A, Martinez M. Residuos de Aflatoxina M1 y otras micotoxinas en leche y derivados, control y recomendaciones http://www.engormix.com 20/05/08. 2001. Consultado 14 Jul, 2017. 7. Noa M, Pérez N, Gutiérrez R, Escobar A. Los residuos químicos en la leche: importancia y problemática actual en México y en el mundo. 1.a ed. México, DF, UAM-X; 2001:192. 8. Esqueda M, Higuera I, Nieblas J. Aflatoxina M1 en leche comercializada en Hermosillo, Sonora, México. Rev Mex Mic 1995;11:179-183. 9. Helferich W. Aflatoxin in food producing animals: metabolism and transmission. Dissertation Abstr Internat 1984;44:3583-3605. 10. Mashaly R, El-Deeb S, El-Nouty F, Hassan G, Salem M. Effect of feeding aflatoxins to Egyptian Baladi goats on milk yield, composition and physical properties. Egypt J Dairy Sci 1984;12:135-144. 11. Acosta A, Escobar A, Margolles E, Mella C. Dinámica de excreción de aflatoxina M1 en leche de cabras. Rev Salud Anim 1989;11:208-211.

605


Rev Mex Cienc Pecu 2021;12(2):598-608

12. Bento H, Fernandes A, Barbosa M. Detection of aflatoxin M1 in goat milk [abstract]. XXIII International Dairy Congress. Montreal. Quebec. 1990:26. 13. Barrios M, Gualda M, Cabanas J, Medina LM, Jordano R. Occurrence of aflatoxin M1 in cheeses from the south of Spain. J Food Protect 1996;59:898-900. 14. Finoli C, Vecchio A. Aflatoxin M1 in goat dairy products. Mic Aliment Nut 1997;15:47-52. 15. Minervini F, Visconti A, Bottalico A, Montagna M. On the occurrence of aflatoxin M1 in cheeses in some southern Italian areas. Ind Aliment-Italy 2001;40:513-516. 16. Battacone G, Nudda A, Palomba M, Pulina G. Carry over of aflatoxin from feed to ovine milk and curd. Scienza e Tecnica Lattiero-Casearia 2002;53:283-293. 17. Virdis S, Corgiolu G, Scarano C, Pilo A, De Santis E. Occurrence of aflatoxin M1 in tank bulk goat milk and ripened goat cheese. Food Control 2008;19:44-49. 18. Oliveira C, Ferraz J. Occurrence of aflatoxin M1 in pasteurised, UHT milk and milk powder from goat origin. Food Control 2007;18:375-378. 19. Bingol N, Tanritanir P, Dede S, Ceylan E. Influence of aflatoxin present in forages and concentrated feedingstuffs on milk and some serum biochemical parameters in goats. B Vet I Pulawy 2007;51:65-69. 20. Ozdemir M. Determination of aflatoxin M1 levels in goat milk consumed in Kills province. Ankara Univ. Vet. Fak. 2007;54:99-103. 21. Anyango G, Mutua F, Kagera I, Andang`O P, Grace D, Lindahl J. A survey of aflatoxin M1 contamination in raw milk produced in urban and peri-urban areas of Kisumu County, Kenya. Infect Ecol Epidemiol 2018;8:1-10. 22. Kilonzo R, Imungi J, Muiru W, Lamuka P, Kamau Njage P. Household dietary exposure to aflatoxins from maize and maize products in Kenya. Food Addit Contam 2014;31:2055-2062. 23. Bingol N, Tanritanir P, Dede S, Ceylan E. Influence of aflatoxin present in forages and concentrated feedingstuffs on milk and some serum biochemical parameters in goats. B Vet I Pulawy 2007;51:65-69. 24. NOM-188-SSA1-2002. Norma Oficial Mexicana. Productos y Servicios. Control de aflatoxinas en cereales para consumo humano y animal. Especificaciones sanitarias. Secretaría de Salud. Diario Oficial de la Federación. 14 de junio de 2000. 25. AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1995.

606


Rev Mex Cienc Pecu 2021;12(2):598-608

26. ISO. International Organization for Standardization. Animal feeding stuffsdetermination of aflatoxin B1 content of mixed feeding stuffs-method using highperformance liquid chromatography. ISO. 14718:1998. 27. CENAM. CNM-MRD-PT-030. Métodos analíticos adecuados a su propósito. Guía de Laboratorio para la Validación de Métodos y Temas Relacionados. Centro Nacional de Metrología. Publicación Técnica. Los Cués, Querétaro., México. 2005. 28. UE. Commission Directive 2003/100/EC. Amending Annex I to Directive 2002/32/EC of the European Parliament and of the Council on undesirable substances in animal feed. European Union. Official Journal of the European Union. Brussels. 2003. 29. Moss M. Risk assessment for aflatoxins in foodstuffs. Int Biodeter Biodegr 2002;50:137-142. 30. Misihairabgwi JM, Ezekiel CN, Sulyok M, Shephard GS, Krska R. Mycotoxin contamination of foods in Southern Africa: A 10-year review (2007–2016). Critical Rev Food Sci Nutr 2017;1-16. 31. Matumba L, Van Poucke C, Njumbe Ediage E, De Saeger, S. Keeping mycotoxins away from the food: Does the existence of regulations have any impact in Africa. Crit Rev Food Sci Nutr 2014;57(8):1584-1592. 32. Bhat R, Rai V, Karim A. Mycotoxins in food and feed: present status and future concerns. Compr Rev Food Sci Food Saf 2009;9:57-81. 33. EFSA. Modelización, predicción y cartografía de la aparición de aflatoxinas en los cereales en la UE debido al cambio climático. Informe científico presentado por la Autoridad Europea de Seguridad Alimentaria. 2012. Fuente: https://efsa.onlinelibrary.wiley.com/doi/epdf/10.2903/sp.efsa.2012.EN-223. Consultado 20 ago, 2017. 34. Pahlow G, Muck R, Driehuis F, Oude Elferink S, Spoelstra S. Microbiology of ensiling. Silage science and technology (Agronomy Series No. 42). Buxton DR, et al editors. Am Soc Agron. Madison, WI. 2003. 35. Ferrero FS, Prencipe D, Spadaro ML, Gullino L, Cavallarin S, Piano E, Tabacco BG. Increase in aflatoxins due to Aspergillus section Flavi multiplication during the aerobic deterioration of corn silage treated with different bacteria inocula. J Dairy Sci 2019;102(2):1176-1193. 36. Keller M, Pereyra M, Keller K, Alonso V, Oliveira A, Almeida T, et al. Fungal and mycotoxins contamination in corn silage: Monitoring risk before and after fermentation. J Stored Prod Res 2013;52:42–47.

607


Rev Mex Cienc Pecu 2021;12(2):598-608

37. Alonso A, Pereyra C, Keller L, Dalcero A, Rosa C, Chiacchiera S. Cavaglier L. Fungi and mycotoxins in silage: an overview. J Appl Microbiol 2013;115(3):637643. 38. Dimitrieska-Stojković, E, Stojanovska-Dimzoska, B, Ilievska, G, Uzunov, R, Stojković G, Hajrulai-Musliu Z, et al. Assessment of aflatoxin contamination in raw milk and feed in Macedonia during 2013. Food Control 2016;59:201-206. 39. Sacca E, Boscolo D, Vallati A, Ventura W, Bigarand F, Piasentiera E. Aflatoxin ocurrence in milk and supplied concentrates of goat farms of north-eastern Italy. J Sci Food Agric 2009;89(3):487-493. 40. Cammilleri G, Graci S, Collura R, Buscemi MD, Vella A, Macaluso A, et al. Aflatoxin M1 in cow, sheep, and donkey milk produced in Sicily, Southern Italy. Mycotoxin Res 2019;35(1):47-53.

608


https://doi.org/10.22319/rmcp.v12i2.5466 Nota de investigación

Predicción de la calidad fermentativa de ensilados de girasol mediante espectroscopía de reflectancia en el infrarrojo cercano (NIRS) sobre muestras secas

Sonia Pereira-Crespo a Aurora Sainz-Ramírez b Dalia Andrea Plata-Reyes b Aida Gómez-Miranda b Felipe González-Alcántara b Adrián Botana a Laura González a Marcos Veiga a Cesar Resch a Roberto Lorenzana c Fernando Próspero-Bernal a* Carlos Manuel Arriaga-Jordán b Gonzalo Flores-Calvete a

a

Centro de Investigacións Agrarias de Mabegondo de la Axencia Galega da Calidade Alimentaria de la Consellería do Medio Rural. Xunta de Galicia, Mabegondo, Abegondo, A Coruña, Galicia, España. b

Universidad Autónoma del Estado de México, Instituto de Ciencias Agropecuarias y Rurales. Toluca, Estado de México, México.

c

Laboratorio Interprofesional Galego de Análise do Leite, Mabegondo, Abegondo, A Coruña, Galicia, España. 609


Rev Mex Cienc Pecu 2021;12(2):609-620 *

Autor de correspondencia: fer_104_7@hotmail.com

Resumen: El objetivo del presente trabajo fue evaluar la capacidad de predicción de las ecuaciones de calibración desarrolladas mediante NIRS (espectroscopía de reflectancia en el infrarrojo cercano) sobre muestras secas y molidas, para estimar la calidad fermentativa de ensilados de girasol. Un total de 52 muestras de ensilados procedentes de diferentes ensayos de silos de laboratorio realizados en el CIAM (Centro de Investigacións Agrarias de Mabegondo), cuyo espectro NIRS se registró sobre muestras secas en estufa y molidas. Las muestras en estado fresco fueron analizadas por métodos de referencia. Se determinó el pH, ácido láctico, ácido acético, etanol, nitrógeno amoniacal y nitrógeno soluble. Las calibraciones NIRS fueron desarrolladas utilizando regresión por mínimos cuadrados parciales modificada, realizando la regresión entre los datos espectrales y los de referencia. La capacidad predictiva de las ecuaciones obtenidas osciló entre excelente y buena, mostrando coeficientes de determinación de validación cruzada (r2vc) iguales o superiores a 0.88. Los valores del índice RPD para todos los parámetros estudiados fueron iguales o superiores a 3.0, por lo tanto, las ecuaciones de calibración obtenidas sobre muestras secas y molidas pueden utilizarse satisfactoriamente para predecir la calidad fermentativa de ensilados de girasol en análisis de rutina. Palabras clave: Forrajes, Parámetros de fermentación, Espectroscopía de reflectancia.

Recibido: 23/08/2019 Aceptado:18/04/2020

La evaluación nutritiva de los forrajes es relevante debido a la elevada variabilidad de su valor nutritivo y a la alta contribución al total de la materia seca de las raciones de ganado, en comparación con el concentrado. El valor nutricional del ensilado está condicionado fundamentalmente, además de por las características intrínsecas del forraje en el momento del corte, por la calidad de fermentación desarrollada durante el almacenamiento en el silo(1), siendo sumamente variable dependiendo de la ensilabilidad del forraje y del tratamiento postcosecha(2), y afectando particularmente al valor nitrogenado y la ingestión voluntaria del ensilado(3). Por tanto, para un uso eficiente de los ensilados es necesario caracterizar previamente su calidad fermentativa, para lo cual es fundamental disponer de métodos rápidos, precisos y fiables. Los análisis instrumentales para determinar los parámetros de calidad fermentativa de un ensilado son complejos, costosos y requieren un gran consumo de tiempo. 610


Rev Mex Cienc Pecu 2021;12(2):609-620

La tecnología NIRS (Espectroscopía de reflectancia en el infrarrojo cercano) está ampliamente reconocida como una técnica analítica rápida, barata y de gran precisión en la caracterización de la calidad de conservación de los ensilados, como alternativa al análisis por vía húmeda(4), y además, se trata de una tecnología medioambientalmente limpia que no emplea reactivos ni genera residuo alguno. El análisis NIRS de los ensilados en modo intacto, en fresco, implica gran dificultad, debido a que se trata de un material con elevada heterogeneidad(5). Por otro lado, la presencia de agua en la muestra intacta interfiere en el espectro NIRS, dado que ésta absorbe parte de la radiación infrarroja, generando dos bandas de absorción muy significativas en el espectro. No obstante, hay que señalar que el análisis NIRS de muestras secas presenta desventajas respecto al análisis con muestras frescas, debido a que los constituyentes volátiles del ensilado, como los ácidos de fermentación, alcoholes y amonio, son liberados y perdidos durante el proceso de secado de la muestra. En un estudio se determinó por métodos de referencia una serie de muestras antes y después del proceso de secado, y se comparó la predicción de las ecuaciones NIRS desarrolladas sobre muestras secas con las realizadas con material húmedo, como resultado se observó que la predicción del pH, láctico y nitrógeno amoniacal fue más robusta sobre material seco mientras que la calidad de la predicción para el acético fue mejor cuando la medida NIRS se realizaba sobre la muestra húmeda (6). Esto se atribuye a que la calidad de predicción obtenida para los diferentes parámetros por los dos métodos no tiene relación con las pérdidas durante el secado de las muestras, toda vez que la reducción de la concentración de ácido láctico, ácido acético, etanol y nitrógeno amoniacal en la materia seca durante el secado fue del 3.5 %; 57 %, 53 % y 100 % para ensilados de hierba y del 3.5 %; 83 %, 16 % y 100 % para ensilados de maíz, respectivamente, en clara correspondencia con su volatilidad(6). Por otra parte, en otro trabajo evaluaron el efecto de la preparación de la muestra de ensilados de maíz (estado fresco vs seca y molida) sobre la estimación de parámetros fermentativos mediante NIRS, y los resultados indican que las muestras en estado fresco proporcionan una capacidad predictiva ligeramente superior para ácido acético (r2vc = 0.85 vs 0.82) y ácido láctico (r2cv = 0.78 vs 0.73) e inferior para pH (r2vc = 0.54 vs 0.63)(7). Un estudio realizado en el Centro de Investigacións Agrarias de Mabegondo (CIAM) en Galicia, indica la conveniencia de utilizar las muestras secas y molidas en vez de intactas, al obtener modelos de predicción de la composición química y calidad fermentativa de ensilados de hierba con mayor precisión(8). En otro trabajo realizado recientemente en el CIAM se evaluó la predicción de parámetros fermentativos de ensilados de hierba mediante calibraciones NIRS, desarrolladas sobre material seco y molido, los resultados obtenidos fueron satisfactorios con coeficientes de determinación iguales o superiores a 0.80(9). El conocimiento de la calidad fermentativa de nuevos tipos de forrajes de manera rápida y precisa requiere avanzar en el desarrollo de nuevas calibraciones NIRS, en ese sentido, el objetivo del presente trabajo fue evaluar la capacidad predictiva de las ecuaciones de calibración NIRS en muestras secas y molidas para estimar parámetros de calidad fermentativa de ensilados de girasol.

611


Rev Mex Cienc Pecu 2021;12(2):609-620

El trabajo se realizó con un total de 52 muestras de ensilados de girasol provenientes de diferentes ensayos de silos de laboratorio realizados en el CIAM durante los años 2016 y 2017. La colección de muestras abarca una elevada variabilidad en cuanto al estado de madurez, incluye muestras de girasol cosechadas en diferentes estados fenológicos, según la escala de Schneiter y Miller, desde el estado R4 (1 semana antes de la floración) hasta el estado R7 (5 semanas tras el inicio de la floración)(10). El forraje con el que se elaboraron los silos de laboratorio procede del cultivo de dos híbridos comerciales: una variedad forrajera (Rumbosol 91) y una variedad de aceite (ES Shakira), realizado en las fincas experimentales del CIAM situadas en dos localidades de Galicia (España), en Mabegondo (zona costera atlántica noroccidental de Galicia, a 100 msnm) y en Pobra de Brollón (zona interior de Galicia, a 400 msnm). Además, en los ensayos realizados se incluyeron ensilados sin aditivo y con diferentes aditivos: ácido fórmico y dos inoculantes comerciales (uno de ellos a base de bacterias lácticas homofermentativas y otro a base de bacterias lácticas homo y heterofermentativas). Los silos de laboratorio se abrieron a los 60 días tras su realización. Las muestras de ensilados, tras homogeneizarlas manualmente, se dividieron en dos alícuotas, una de las cuales se secó en estufa a 80 ºC durante 16 h (11) y la otra se congeló a -18 ºC, envasada herméticamente al vacío en envases de plástico, hasta la realización de su análisis fermentativo por métodos de referencia. La información espectral de las muestras secas y molidas a 1 mm, se obtuvo en un espectrofotómetro monocromador Foss NIRSystem 6500 (Foss NIRSystem, Silver Spring, Washington, USA), situado en una sala con temperatura controlada (24 ± 1 °C) y provisto de módulo de giro que realiza medidas de reflectancia (R) en la región espectral comprendida entre 400 y 2,500 nm, a intervalos de 2 nm. Los datos de absorbancia son expresados como Log (1/R, R= Reflectancia). La recogida de espectros y el análisis quimiométrico de los datos se llevó a cabo mediante el programa Win ISI II v.1.5 (Infrasoft International, Port Matilda, PA, USA)(12). Mediante el algoritmo CENTER(13), se realizó un Análisis de Componentes Principales (ACP), seguido del cálculo de distancias entre espectros en un espacio n-dimensional a través de la distancia de Mahalanobis, el cual permitió estudiar la estructura y variabilidad espectral de la población y detectar muestras anómalas (13). La distancia Global de Mahalanobis (GH) está definida como la distancia entre una muestra y el centro de la población en el espacio definido por el ACP (Figura 1), considerando como muestras atípicas aquellas con valores GH>3 (anómala espectral) (13).

612


Rev Mex Cienc Pecu 2021;12(2):609-620

Figura 1: Representación tridimensional de los espectros del colectivo de muestras según la distancia Global de Mahalanobis

Se aplicó a los datos espectrales el pretratamiento SNV-Detrend(14) para corregir el fenómeno de radiación dispersa y se evaluaron los ocho tratamientos matemáticos siguientes: 1,5,5,1; 1,6,4,1; 1,10,5,1; 1,10,10,1; 2,5,5,1; 2,6,4,1; 2,10,5,1; 2,10,10,1, donde el primer dígito expresa el orden de la derivada (1= primera derivada, 2= segunda derivada), el segundo dígito indica el tamaño del segmento sobre el cual se realiza la derivación (intervalo expresado en nanómetros), el tercer y cuarto dígito indican el tamaño de los intervalos, expresados en nanómetros, empleados para el cálculo de suavización de la señal(15). El desarrollo de las ecuaciones de calibración se realizó mediante regresión por mínimos cuadrados parciales modificada (MPLS)(16) entre los datos espectrales y los de referencia, incluyendo cuatro grupos de validación cruzada para prevenir el sobreajuste, que fueron secuencialmente utilizados para efectuar la validación de las ecuaciones generadas. El análisis fermentativo de las muestras intactas de ensilados se realizó mediante métodos de referencia, por duplicado(17). Sobre un extracto de 50 g de muestra fresca de ensilado, macerada a temperatura ambiente durante 2 h en 150 ml de agua destilada, se determinó el pH, el nitrógeno amoniacal (N-NH3) con un electrodo selectivo (Orion) y el nitrógeno soluble (N-sol) mediante digestión macro Kjeldahl. Los ácidos de fermentación (láctico, acético y propiónico) y el etanol se determinaron por cromatografía de gases (Agilent Technologies, USA) con una columna capilar de elevada polaridad BR-SwaxAcids (30 m x 0.53 mm x 1

613


Rev Mex Cienc Pecu 2021;12(2):609-620

µm; Bruker, USA). Los parámetros de N-NH3 y N-sol se refirieron al nitrógeno total y los ácidos de fermentación y el etanol a materia seca. Los estadísticos utilizados para seleccionar las mejores ecuaciones de calibración fueron los errores estándar de calibración (EEC) y de validación cruzada (EEVC) y los coeficientes de determinación (r2c y r2vc) obtenidos en el proceso de calibración y validación cruzada, respectivamente(18). Además, se utilizaron otros estadísticos de gran utilidad para evaluar la capacidad predictiva de las ecuaciones de calibración obtenidas, como el índice RER o relación entre el rango de los datos de referencia y el EEVC y el índice RPD o relación entre la desviación estándar de los datos de referencia y el EEVC (19). Las características descriptivas (rango, media y la desviación estándar) de los parámetros fermentativos del colectivo de calibración se muestran en el Cuadro 1, observándose un amplio rango y una elevada desviación estándar, para cada uno de los componentes analizados por métodos de referencia. Esta elevada variabilidad confirma que dicho colectivo está constituido por ensilados muy diversos, factor clave para la obtención de ecuaciones de calibración robustas(20). El valor medio (y rango de variación) del contenido en materia seca de la población de ensilados que conformaron el set de calibración fue de 16.0 % (11.3 a 21.9 %). Cuadro 1: Rango, media y desviación estándar de los parámetros de calidad fermentativa del grupo de calibración (n=52) de ensilados de girasol Parámetro

Rango

Media

DE

pH

3.55

4.29

3.91

0.21

Láctico, %MS

0.00

15.74

7.99

5.51

Acético, %MS

0.52

4.04

2.39

1.10

Etanol, %MS

0.90

12.50

3.78

3.43

N-NH3, %NT

2.21

10.37

6.09

2.59

N soluble, %NT

26.96

52.95

41.41

7.68

MS= materia seca; N-NH3= nitrógeno amoniacal; NT= nitrógeno total; DE= desviación estándar.

En el Cuadro 2 se muestran los estadísticos de las ecuaciones de calibración obtenidas para la predicción de los parámetros de calidad fermentativa. Los coeficientes de determinación en el proceso de validación cruzada (r2vc) ofrecen información sobre la calidad de la calibración, del cual se han definido tres niveles de precisión de los modelos de predicción, donde valores de r2cv superiores a 0.90 indican una capacidad de predicción excelente, valores

614


Rev Mex Cienc Pecu 2021;12(2):609-620

de r2cv entre 0.89 y 0.70 indican que la calibración es considerada de buena capacidad de predicción cuantitativa, y calibraciones con valores de r2cv entre 0.69 y 0.50 permiten sólo una adecuada discriminación entre valores altos, medios y bajos(21). Por tanto, los valores de r2vc para los parámetros de pH (r2vc=0.98), N-NH3 (r2vc=0.96), acético (r2vc=0.94), láctico (r2vc=0.90) y etanol (r2vc=0.90) indican una capacidad de predicción excelente, y el contenido en N soluble (r2vc=0.88) presenta una capacidad de precisión buena(21). La exactitud de la predicción puede juzgarse en función de los valores de los índices RER y RPD(19), dado que valores de RPD mayores de 3 y de RER mayores de 10 son tomados como indicadores de la utilidad de las predicciones(19). La elevada desviación estándar y el amplio rango de variación del colectivo de calibración explican los adecuados valores del RPD (3.0 – 6.5) y RER (9.0 – 22.8) obtenidos. Cuadro 2: Estadísticos de la ecuación de calibración desarrollada para la predicción de los parámetros de calidad fermentativa de ensilados de girasol Parámetro

TM

EEC

r2c

EEVC

r2vc

RER

RPD

pH

(1,5,5,1)

0.02

0.99

0.03

0.98

22.8

6.5

Láctico, %MS

(2,10,10,1)

1.63

0.91

1.75

0.90

9.0

3.2

Acético, %MS

(2,10,5,1)

0.17

0.97

0.25

0.94

13.9

4.3

Etanol , %MS

(2,6,4,1)

0.97

0.92

1.07

0.90

10.9

3.2

N-NH3, %NT

(2,10,10,1)

0.44

0.97

0.54

0.96

15.1

4.8

N soluble, %NT

(2,10,10,1)

2.18

0.92

2.58

0.88

10.1

3.0

MS= materia seca; TM= tratamiento matemático; N-NH3= nitrógeno amoniacal; NT= nitrógeno total; EEC= error estándar de calibración; EEVC= error estándar de validación cruzada; r2c y r2vc: coeficiente de determinación en calibración y validación cruzada; RER= Rango/EEVC; RPD= desviación estándar/EEVC.

Las ecuaciones de predicción para pH, ácido acético, etanol, N-NH3 y N-sol presentan valores de RPD>3 y RER >10, cumpliendo con los valores recomendados en la bibliografía(19). Así, el valor de pH sería el estimado con mayor exactitud (RER=22.8; RDP=6.5) seguido por los valores de ácido acético (RER=19.5; RDP=4.3), N-NH3 (RER=19.5; RDP=4.3), etanol (RER=10.9; RDP=3.2) y N-sol (RER=10.1; RDP=3.0). En el caso de la ecuación de predicción del ácido láctico el valor del índice RER (9.0) no alcanzó el valor recomendado, si bien el valor de RPD (3.2) supera el valor mínimo recomendado en la bibliografía(19). Por lo tanto, los valores de los estadísticos RER y RPD confirman la elevada exactitud y precisión de las ecuaciones obtenidas, asegurando la validez de estas desde el punto de vista de su aplicación en análisis cuantitativo(19).

615


Rev Mex Cienc Pecu 2021;12(2):609-620

La información existente en la bibliografía acerca de la aplicabilidad de la técnica NIRS para la predicción del pH de ensilados de girasol forrajero es escasa(22). Un trabajo realizado con un colectivo similar al de este trabajo, una colección de 50 muestras secas y molidas de ensilados experimentales de girasol, cuyo resultado mostró una menor capacidad predictiva para la estimación del pH que en el presente trabajo, con valores inferiores de r2vc (0.86), RER (5.9), RPD (2.5) y mayor de EEVC (0.44)(22). En otros trabajos, sobre muestras en estado fresco, han obtenido una menor capacidad predictiva para el valor de pH que en este trabajo, con valores de r2vc de 0.85, 0.72 y 0.78 en ensilados de hierba(4), ensilados de cebada(23) y ensilados de raigrás(24), respectivamente. Respecto al contenido en ácido láctico, ácido acético y etanol, sobre muestras frescas de ensilado de hierba, han indicado una precisión menor a la observada en este estudio, con valores de r2vc y RPD de 0.83 y 2.5, 0.73 y 2.0 y 0.77 y 2.8, respectivamente(25). Se ha reportado en ensilado de hierba, sobre muestras frescas, valores de r2vc y RPD para N-sol de 0.89 y 3.3, y de 0.92 y 4.0 para N-NH3(25), valores similares a los obtenidos en este estudio. Una vez elaborado los modelos de predicción se debe evaluar el ajuste de los datos al mismo, para lo cual se utiliza la representación gráfica de los valores predichos mediante NIRS versus los valores de referencia. En la Figura 2 se muestra dicha representación gráfica para los parámetros de calidad fermentativa estudiados. Los resultados obtenidos mostraron una alta correlación entre los valores predichos mediante NIRS y los valores de referencia, para todos los parámetros estudiados, con valores del coeficiente de determinación (R2) de la regresión superiores a 0.90 y los valores de la pendiente de la regresión oscilaron entre 0.98 y 1.01, confirmando la elevada precisión de las ecuaciones desarrolladas, con valores próximos a 1 en ambos casos(26).

616


Rev Mex Cienc Pecu 2021;12(2):609-620

Figura 2: Valores de referencia versus predichos por NIRS para todos los parámetros fermentativos

Los valores de referencia de los parámetros estudiados están distribuidos en todos los intervalos de concentración y en un rango muy amplio de variación. En el caso de la concentración de ácido láctico, los valores analíticos de referencia presentan un rango muy amplio de variación, pero no están distribuidos en todos los intervalos de concentración (Figura 2), situándose la mayoría de las muestras en el intervalo comprendido entre 6 y 15.7 % MS, y sólo un reducido número de muestras se sitúan entre valores de 0 y 2 % MS.

617


Rev Mex Cienc Pecu 2021;12(2):609-620

Estos bajos contenidos en ácido láctico están en relación con la aplicación de ácido fórmico a los ensilados(27). Este trabajo debe considerarse de carácter preliminar al tener una cantidad limitada de muestras, siendo deseable incrementar la base de datos en futuros estudios(18). Es recomendable la incorporación de nuevas muestras representativas, con valores que se distribuyan en los sectores menos representados, principalmente para el contenido de ácido láctico, el aumento del número de muestras del colectivo de calibración reforzará e incrementará la robustez de los modelos desarrollados(18). Se concluye que la tecnología NIRS, aplicada a muestras secas y molidas, es una herramienta útil y apropiada para la predicción de los parámetros de la calidad fermentativa de ensilados de girasol, siendo por tanto una alternativa para la determinación de estos parámetros con respecto a los métodos analíticos convencionales. Agradecimientos y conflictos de interés Trabajo financiado por los proyectos ATT 2016/106, ATT 2017/180 y 2017/182 de la Consejería del Medio Rural de la Xunta de Galicia. Se agradece al Consejo Nacional de Ciencia y Tecnología de México por otorgar becas Mixtas a Sainz-Ramírez, Plata-Reyes, Gómez-Miranda y González-Alcántara y de estancia posdoctoral a Prospero-Bernal. Los autores señalan la ausencia de conflictos de interés. Literatura citada: 1. Demarquilly C. Composition chimique, caractéristiques fermentaires, digestibilité et quantité ingérée des ensilages de fourrages: modifications par rapport au forage vert initial. Annales de Zootechnie 1973;(22):1-35. 2. McDonald P. Silage fermentation. In : Forage Conservation in the 80´s. E.G.F. Occasional Sympossium nº 11. British Grassland Society. Brighton, Reino Unido. C. Thomas 1979:6775. 3. Woolford MK. The silage fermentation. Nueva York, EEUU. Marcel Dekker, Inc. 1984:350. 4. Park RS, Agnew RE, Gordon FJ, Barnes RJ. The development and transfer of undried grass silage calibrations between near infrared reflectance spectroscopy instruments. Anim Feed Sci Technol 1999;(78):325-340. 5. Givens DI, De Boever JL, Deaville ER. The principles, practices and some future applications of near infrared spectroscopy for predicting the nutritive value of foods for animals and humans. Nutr Res Rev 1997;(10):83-114. 618


Rev Mex Cienc Pecu 2021;12(2):609-620

6. Sorensen LK. Prediction of fermentation parameters in grass and corn silage by near infrared spectroscopy. J Dairy Sci 2004;(87):3826-3835. 7. Park R, Agnew E, Porter M. Recent developments in methods to characterize the chemical and biological parameters of grass silage. In Park R, Stronge M. editors. Silage production and utilization. Proc XIV Int Silage Conf, a satellite workshop of the XX Int Grassland Cong. Belfast, Northern Ireland: Wageningen Academic Publishers; 2005:109-119. 8. Castro P. Use of near infrared reflectance spectroscopy (NIRS) for forage analysis. Lowland and grasslands of Europe: Utilization and development. Corporate Document Repository. FAO- Food And Agriculture Organization Of The United Nations, Rome, Italy. 2002. http://www.fao.org/DOCREP/006/AD236E/ad236e14.htm. Accessed July 1, 2019. 9. Pereira-Crespo S, Fernández-Lorenzo B, Resch C, Valladares-Alonso J, González L, Dagnac T, et al. Predicción de la calidad fermentativa de ensilados de hierba mediante NIRS sobre muestras secas y molidas. Pastos y Forrajes en el siglo XXI. Palma de Mallorca, España, Sociedad Española para el Estudio de los Pastos. 2015:161-167. 10. Schneiter AA, Miller JF. Description of sunflower growth stages. Crop Sci 1981;(21):901-903. 11. Castro P. Efecto de tres temperaturas de secado sobre la composición química de forrajes y heces. En: Consejería de Agricultura, Ganadería y Desarrollo Rural Ed. Actas de XXXVI Reunión Científica de la SEEP. La Rioja, España: Sociedad Española para el Estudio de los Pastos. 1996:365-368. 12. WIN ISI 1.5. ISI WINDOWS. Near-Infrared Software, The Complete Software Solution for Routine Analysis, Robust Calibration and Networking, Port Matilda, PA, USA. ISI (Infrasoft International), LLC, 2000. 13. Shenk JS, Westerhaus MO. Population definition, sample selection, and calibration procedures for near infrared reflectance spectroscopy. Crop Sci 1991;(31):469-474. 14. Barnes RJ, Dhanoa MS, Lister SJ. Standard normal variate transformation and Detrending of near infrared diffuse reflectance spectra. Appl Spectroscopy 1989;(43):772-777. 15. Shenk J, Westerhaus M. Routine operation, calibration, development and network system management manual. Silver Spring, MD, USA NIRS Systems Inc, 1995. 16. Martens H, Naes T. Multivariate calibration by data compression. In: Williams P, Norris K. editors. Near-infrared technology in the agricultural and food industries. St. Paul, Minnesota, USA. American Association of Cereal Chemists. 1987:57-88. 17. Stern M, Endres M. Laboratory manual: Research techniques in ruminant nutrition. Department of Animal Science. Minnesota, USA. University of Minnesota. 1991. 619


Rev Mex Cienc Pecu 2021;12(2):609-620

18. Shenk JS, Westerhaus MO. Analysis of agriculture and food products by Near Infrared Reflectance Spectroscopy. USA: Monograph, NIR Systems Inc. MD, USA. Silver Spring, 1995. 19. Williams PC, Sobering DC. How do we do it: a brief summary of the methods we use in developing near infrared calibrations. In: Davies AMC, Williams P. editors. Near Infrared Spectroscopy: The future waves. Chichester, England, United Kingdom: NIR Publications; 1996:185-188. 20. Shenk JS, Westerhaus MO. Population structuring of near infrared spectra and modified partial least squares regression. Crop Sci 1991;(31):1548-1555. 21. Shenk JS, Westerhaus MO, Calibration the ISI way. In: Davies AMC, Williams P. editors. Near Infrared Spectroscopy: The future waves. Chichester, England, United Kingdom, NIR Publications; 1996:198-202. 22. Fassio A, Gimenez A, Fernandez , Vaz Martins D, Cozzolino D. Prediction of chemical composition in sunflower whole plant and silage (Helianthus annus L.) by Near Infrared Reflectance Spectroscopy. J Near Infrared Spec 2007;15(3):201-207. 23. Park H, Hoon Lee S, Cheol Lim Y, Seo S, Choi K, Hea Kim J, et al. Prediction of the chemical composition of fresh whole crop barley silages by Near Infrared Spectroscopy. J Kor Grassl Forage Sci 2013;33(3):171-176. 24. Park H, Hoon Lee S, Choi K, Cheol Lim Y, Hea Kim J, Won Lee K, et al. Prediction of the chemical composition and fermentation parameters of winter rye silages by Near Infrared Spectroscopy. J Kor Grassl Forage Sci 2014;34(3):209-213. 25. Park RS, Agnew RE, Gordon FJ, Steen RWJ. The use of near infrared reflectance spectroscopy (NIRS) on undried samples of grass silage to predict chemical composition and digestibility parameters. Anim Feed Sci Technol 1998;72(1):155-167. 26. Shenk JS, Westerhaus MO, Abrams SM 1989. Protocols for NIRS calibration: monitoring analysis results and recalibration. In Near Infared Reflectance Spectroscopy (NIRS): Analysis of forage quality. Marten GC, Shenk J, Barton FE editors. USDA. ARS. Agriculture Handbook Nº 643, Washington, USA. 1989:104-110. 27. Sainz-Ramírez A, Botana A, Pereira-Crespo S, González-González L, Veiga M, Resch C, et al. Efecto de la fecha de corte y del uso de aditivos en la composición química y calidad fermentativa de ensilado de girasol. Rev Mex Cienc Pecu 2020;11(3):620-637.

620


https://doi.org/10.22319/rmcp.v12i2.4398 Nota de investigación

Espectro de polen corbicular de Apis mellifera en muestras de Huejotitán, Jalisco, México

Roberto Quintero Domínguez a Lino de la Cruz Larios a Diego Raymundo González Eguiarte a José Arturo Solís Magallanes b José Francisco Santana Michel c† José Luis Reyes Carrillo d*

a

Universidad de Guadalajara. Centro Universitario de Ciencias Biológicas y Agropecuarias, Departamento de Producción Agrícola, Camino Ramón Padilla Sánchez 2100 Nextipac, 45200 Zapopan, Jalisco, México. b

Universidad de Guadalajara. Centro Universitario de la Costa Sur, Departamento de Ecología y Recursos Naturales, Autlán, Jalisco, México. c

Universidad de Guadalajara. Centro Universitario de la Costa Sur, Departamento de Ecología y Recursos Naturales, Laboratorio de Botánica, Autlán, Jalisco, México. d

Universidad Autónoma Agraria Antonio Narro. Unidad Laguna, Departamento de Biología, Torreón, Coahuila, México.

*Autor de correspondencia: jlreyes54@gmail.com

Resumen: Las abejas melíferas (Apis mellifera L.) dependen completamente de los recursos que las rodean. Estos afectan su supervivencia, producción de miel y la calidad de ésta. Muy poca información está disponible sobre los recursos que utilizan las abejas melíferas en México.

621


Rev Mex Cienc Pecu 2021;12(2):621-632

Se hizo un estudio para identificar los recursos florales utilizados por las abejas melíferas por medio de un análisis del polen corbicular colectado de un colmenar en la población de Huejotitan, municipio de Jocotepec, estado de Jalisco, México. Se utilizaron trampas de polen tipo Ontario modificadas para colectar muestras de polen de manera mensual de tres colmenas a través de un periodo de cuatro meses (agosto – noviembre, 2012). Se etiquetaron y congelaron las muestras para luego procesarlas mediante la técnica de acetólisis para eliminar la exina. Se prepararon portaobjetos permanentes de glicerina para conservar y analizar las muestras. La identificación, el recuento de los granos de polen, así como la medición de cada grano se realizaron por medio de un microscopio vertical equipado con un micrómetro ocular de 100X y utilizando aceite de inmersión. Se hizo una colección de referencia como medio auxiliar de identificación y como referencia estacional de las especies florecientes en el área del colmenar muestreado. Una vez al mes se recolectaron, se marcaron, y se prensaron flores de todas las plantas en flor, y se llevaron al herbario para su identificación. El polen fue extraído de estas flores, procesado e identificado. En las muestras de polen corbicular se identificaron 23 tipos de plantas pertenecientes a 17 familias de plantas. Trece de ellas se identificaron a nivel de especie, cinco a nivel de género y cinco más a nivel familia. Myrtaceae fue la familia representada con mayor frecuencia en las muestras, seguida por Asteraceae, Fabaceae y Lamiaceae. Palabras clave: Comportamiento, Pecoreo, Apipalinología, Apibotánica.

Recibido: 08/03/2018 Aceptado: 25/05/2020 A pesar de su papel como polinizadores clave entre los insectos(1), los fundamentos biológicos para la selección de fuentes de polen por las abejas melíferas (Apis mellifera) en México aún se desconocen en su mayoría. Los estudios botánicos de interés apícola no son particularmente abundantes si se considera que México es un país grande y mega diverso, clasificado en los primeros lugares en producción y exportación apícola en el mundo(2). Dado que las abejas melíferas dependen por completo de la vegetación para su supervivencia es fundamental comprender sus preferencias alimenticias, así como los detalles sobre la disponibilidad de polen durante todo el año. El polen contiene la proteína nutritiva(3) necesaria para la supervivencia y el desarrollo adecuado de las crías y las obreras jóvenes. El polen también contiene lípidos, vitaminas y minerales(4) como componentes secundarios. La disponibilidad de los recursos florales, la distancia a la fuente, el valor nutricional(5), las necesidades de la colmena, es decir, el ciclo de vida y fisiología de las obreras, reinas y zánganos y las condiciones climáticas(6), influyen en los patrones y las proporciones de

622


Rev Mex Cienc Pecu 2021;12(2):621-632

recolección del polen. Esto es de particular interés para apicultores e investigadores pues el comportamiento de recolección de las abejas no parece tener patrones fijos. Cada temporada, las abejas recolectan polen en función a diferentes variables, e incluso de una manera arbitraria que parece no corresponder con el valor nutrimental de los recursos ni con su cercanía o disponibilidad(7). Esta clase de información es fundamental para evaluar el potencial de un área determinada para la producción de polen, y para orientar los esfuerzos relacionados con la conservación de la biodiversidad(8), particularmente en lugares donde las poblaciones de abejas están disminuyendo. El análisis del polen recolectado proporciona información sobre su origen botánico y sobre las especies de plantas preferidas por las abejas que lo recolectaron. Así mismo ayuda a comprender su comportamiento de búsqueda de alimento. El objetivo de este estudio fue identificar los tipos de polen recolectados por las abejas A. mellifera durante la temporada de producción de miel. Teniendo esto en cuenta se diseñó un proyecto de muestreo para recolectar y analizar el polen corbicular para caracterizar el espectro del polen utilizado por A. mellifera en el área de estudio. Los granos de polen se identificaron principalmente mediante una colección especial de referencia de polen de plantas en flor en la localidad durante el periodo de estudio. Las identificaciones estuvieron a cargo de un equipo de especialistas del Herbario del Instituto de Botánica de la Universidad de Guadalajara, Centro de Ciencias Biológicas y Agropecuarias (CUCBA). El estudio se llevó a cabo en un apiario en la población de Huejotitán, en el municipio de Jocotepec, estado de Jalisco, México (20°21’13.45” N; 103°29’6.97” O), un área con un sector apícola de importancia. La vegetación alrededor del colmenar está dominada por cultivos de temporada, pastos y vegetación secundaria intercalados con bosque tropical caducifolio con una elevación de 1,597 msnm. El apiario en estudio contenía un total de 23 colmenas de las cuales se escogieron tres basados en su buena salud. Usando trampas de polen de tipo Ontario modificadas(9), se colectaron muestras de polen una vez al mes durante cuatro meses consecutivos (agosto a noviembre 2012). Este período corresponde a la época de precosecha y cosecha de miel en el área de estudio. Las trampas se instalaron y se mantuvieron en su lugar durante 24 a 48 horas y luego se retiraron. Una vez que se colectaron los gránulos corbiculares de las trampas, se limpiaron de impurezas y se colocaron en recipientes de plástico con etiquetas. Luego se congelaron hasta su procesamiento y análisis. Se colectó un total de doce muestras de polen, es decir, una por cada una de las tres colmenas en cada uno de los cuatro meses. En el laboratorio, se tomaron 1.5 g de polen de cada una de las tres muestras correspondientes a un mes y se combinaron para formar una sola muestra 623


Rev Mex Cienc Pecu 2021;12(2):621-632

correspondiente a las tres colmenas en su conjunto en un mes. Antes de su procesamiento, se trituraron cuidadosamente las muestras de cada mes en un mortero. Para eliminar su contenido de exina se procesaron las muestras mediante la técnica de acetólisis. Se conservaron las muestras incorporándolas en portaobjetos permanentes con gelatina de glicerina. La observación de los granos se hizo por medio de un microscopio vertical Olympus BH-2® equipado con un micrómetro ocular 100X para medir el grano de polen de cada especie, utilizando aceite de inmersión. El volumen de los granos de polen individuales se calculó con la fórmula: V = 4 / 3πa2b donde “V” es el volumen, “a” es el eje mayor del grano de polen y “b” el eje menor(10). La identificación de los granos de polen se realizó con base en una comparación del tamaño y forma con la colección de referencia de polen del Instituto de Geología de la Universidad Nacional Autónoma de México. Para obtener los porcentajes relativos de cada especie o género y familia de planta, se contaron todos los granos de polen en cada portaobjetos. Como un apoyo en la identificación de los granos de polen, se preparó una colección auxiliar de referencia utilizando granos de polen coleccionados de plantas en la etapa de floración durante cada mes del periodo de estudio. Las plantas estaban ubicadas en el entorno del colmenar muestreado. Las colectas de polen se hicieron una vez al mes en cada uno de los cuatro meses del periodo de estudio. Se colectaron las muestras de polen a lo largo de un circuito de entre 3 y 5 km en los alrededores del colmenar. A todas las plantas en flor el día de la colecta se extrajeron las anteras de las flores de un ejemplar. Se procesaron las anteras por acetólisis de acuerdo con la técnica mencionada(11). Las plantas muestreadas se identificaron por especialistas en botánica de la Universidad de Guadalajara, y se sometieron los ejemplares del bono al Herbario del Instituto Botánico del Centro Universitario de Ciencias Biológicas y Agropecuarias (CUCBA) de la misma universidad. También se tomó información de la literatura sobre la flora visitada por A. mellifera(11-15). Se utilizaron los datos de las colectas y de la literatura para identificar si las plantas eran fuente de néctar y/o polen, y su condición migratoria (nativa, exótica). De las muestras de polen se identificaron 23 diferentes tipos pertenecientes a 17 familias de plantas (Cuadro 1). De estos, 13 se identificaron a nivel de especie, cinco a nivel de género y cinco solo a nivel de familia. En el mes de agosto no hubo un tipo de polen predominante, pero sí hubo tres tipos secundarios (Aster sp., Eucalyptus citriodora y Ricinus communis), uno menor pero importante (Cyperaceae) y trazas de otros tipos. Todos estos cuatro tipos representaron porcentajes superiores a diez y desde luego fueron recursos importantes para A. mellifera. En el mes de septiembre, E. citriodora fue el tipo de polen predominante, seguido por los secundarios Poaceae y Psidium guajava y trazas de otros tipos. Los tres representaron porcentajes superiores a diez y desde luego fueron recursos importantes. Ningún tipo polen fue dominante en el mes de octubre, pero hubo tres tipos secundarios (E. citriodora, Hyptis albida y L. leucocephala), todos con porcentajes superiores a diez y desde 624


Rev Mex Cienc Pecu 2021;12(2):621-632

luego significantes; además se detectaron trazas de otros tipos. Eucalyptus citriodora dominó la muestra de polen de noviembre, seguido por dos tipos secundarios (Asteraceae y Pseudosmodingium sp.), y trazas de otros. Los tres representaron porcentajes superiores a diez y fueron significativos. Globalmente, E. citriodora fue significativa en cada uno de los cuatro meses, Asteraceae y L. leucocephala se encontraron en tres meses, y R. communis, Sicyos angulatus, Citrus sp., Pseudosmodingium sp. y Poaceae aparecieron cada una en dos meses. Cuadro 1: Taxones identificados en granos de polen, expresados como porcentaje del total, de muestras de polen corbicular de Apis mellifera coleccionadas en Huejotitán, Jalisco, México, de agosto a noviembre de 2012 Taxones Acacia farnesiana Aster sp. Asteraceae Betula sp. Citrus sp. Cyperaceae Dodonaea viscosa Eucalyptus citriodora Fabaceae Fragaria vesca Fraxinus uhdei Heliocarpus terebinthinaceus Hyptis albida Leucaena leucocephala Poaceae Pseudosmodingium sp. Psidium guajava Psittacanthus calyculatus Ricinus communis Rubus idaeus Salix sp. Sapindaceae Sicyos angulatus Otros

Ago Sep Oct Nov (%) (%) (%) (%)

Familia Fabaceae Asteraceae Asteraceae Betulaceae Rutaceae Cyperaceae Sapindaceae Myrtaceae Fabaceae Rosaceae Oleaceae

Condición migratoria

2.4

Nativa 34.1 Desconocida 5.3 5.8 14.5 Desconocida 5.5 Desconocida 1.7 1.4 Exótica 14.0 Desconocida 1.0 1.2 Nativa 20.5 47.2 34.6 65.6 Exótica 2.1 Desconocida 4.5 Exótica 3.0 Nativa

Malvaceae Lamiaceae Fabaceae Poaceae Anacardiaceae Myrtaceae Loranthaceae Euphorbiaceae Rosaceae Salicaceae Sapindaceae Cucurbitaceae

2.1 18.2 2.9 16.1 2.0 17.5 1.0 8.2 11.9 17.0 2.1 17.1 1.9 1.6 3.9

1.7

625

5.8 1.6

1.3 1.7

Nativa Nativa Nativa Desconocida Desconocida Nativa Nativa Exótica Exótica Nativa Desconocida Nativa Desconocida


Rev Mex Cienc Pecu 2021;12(2):621-632

Aunque las familias representadas en las muestras cambiaron cada mes, sus presencias a través del periodo experimental y sus representaciones proporcionales tuvieron consistencias generales (Cuadro 2). Cuadro 2: Familias de plantas identificadas, y sus porcentajes del total de la muestra, en polen corbicular de Apis mellifera coleccionado en Huejotitán, Jalisco, México, de agosto a noviembre de 2012 Agosto 2012 Septiembre 2012 Octubre 2012 Noviembre 2012 Asteraceae Myrtaceae Euphorbiaceae Cyperaceae Rosaceae Salicaceae Fabaceae Loranthaceae Rutaceae

34.1 20.5 17.2 14.0 4.5 3.9 2.1 2.1 1.6

Myrtaceae Poaceae Betulaceae Asteraceae Fabaceae Euphorbiaceae Sapindaceae Otros

64.2 17.5 5.5 5.3 2.9 1.9 1.0 1.7

Total

100

Total

100

Myrtaceae Fabaceae Lamiaceae Anacardiaceae Asteraceae Cucurbitaceae Malvaceae Rosaceae Rutaceae Sapindaceae Poaceae Otras Total

34.6 18.5 18.2 8.2 5.8 5.8 2.1 1.6 1.4 1.2 1.0 1.6 100

Myrtaceae Asteraceae Anacardiaceae Oleaceae Fabaceae Cucurbitaceae Otros

65.6 14.5 11.9 3.0 2.0 1.3 1.7

Total

100

La familia mejor representada en las cuatro muestras fue Asteraceae seguido por Myrtaceae en tres muestras, Anacardiaceae, Fabaceae y Rosaceae en dos muestras, y Betulaceae, Cucurbitaceae, Cyperaceae, Euphorbiaceae, Lamiaceae y Oleaceae en 1 muestra. La colecta de polen de plantas en floración durante el periodo experimental para generar una colección de referencia resultó en la identificación de 78 especies de plantas, pertenecientes a 71 géneros y 30 familias (Cuadro 3). Las cinco familias mejor representadas fueron Asteraceae (33.33 %), Fabaceae (8.97 %), Solanaceae (6.41 %), Lamiaceae (5.12 %) y Verbenaceae (3.84 %). Estas cinco familias representan el 29.41 % del total de las familias y el 57.67 % del total de las especies identificadas en la colección. De estas especies, 17 son productoras de néctar, siete son productoras de polen, 17 son productoras de néctar y polen, y se desconoce la importancia de los restantes 37 para las abejas melíferas La mitad (50 %) de las especies fueron herbáceas, el 30.77 % fueron arbustos y el 19.23 % fueron árboles. La mayor parte (88.46 %) fueron especies nativas y las restantes (11.54 %) fueron exóticas. Se documentaron visitas florales por abejas melíferas en 26 de especies.

626


Rev Mex Cienc Pecu 2021;12(2):621-632

Cuadro 3: Las especies de plantas muestreadas para la colección de referencia Condición Especies Familias Fuente1 Forma migratoria Acacia farnesiana Fabaceae N-P Arbusto Nativa Adenophyllum cancellatum Asteraceae x Hierba Nativa Argemone mexicana Papaveraceae P Hierba Nativa Asclepias glaucescens Apocynaceae N Arbusto Nativa Bidens odorata Asteraceae N-P Hierba Nativa Bidens pilosa Asteraceae N-P Hierba Nativa Bocconia arborea Papaveraceae x Árbol Nativa Brassica rapa Brassicaceae N Hierba Exótica Buddleja sessiliflora Scrophulariaceae N-P Arbusto Nativa Casimiroa edulis Rutaceae N Árbol Nativa Castilleja tenuiflora Orobanchaceae x Hierba Nativa Chromolaena collina Asteraceae x Arbusto Nativa Cissus verticillata Vitaceae N Hierba Nativa Clematis rhodocarpa Ranunculaceae x Hierba Nativa Conyza canadensis Asteraceae x Hierba Nativa Cucurbita foetidissima Cucurbitaceae P Hierba Nativa Dicliptera peduncularis Acanthaceae x Hierba Nativa Diphysa puberulenta Fabaceae N-P Arbusto Nativa Dyssodia tagetiflora Asteraceae x Hierba Nativa Ehretia latifolia Boraginaceae x Árbol Nativa Erythrina coralloides Fabaceae x Árbol Nativa Eucalyptus citriodora Myrtaceae N-P Árbol Exótica Eupatorium odoratum Asteraceae N-P Hierba Nativa Flaveria trinervia Asteraceae x Hierba Nativa Fleischmannia sonorae Asteraceae x Hierba Nativa Fraxinusuhdei Oleaceae N-P Árbol Nativa Gronovia scandens Loasaceae x Hierba Nativa Guazuma ulmifolia Malvaceae N-P Árbol Nativa Heimia salicifolia Lythraceae x Arbusto Nativa Helianthus annuus L. Asteraceae N-P Hierba Nativa Hyptis albida Lamiaceae N Arbusto Nativa Ipomoea hederifolia Convolvulaceae x Hierba Nativa Ipomoea murucoides Convolvulaceae N Árbol Nativa Ipomoea purpurea Convolvulaceae x Hierba Nativa Iresine diffusa Amarantaceae x Hierba Nativa Jacaranda mimosifolia Bignoniaceae P Árbol Exótica Lantana camara Verbenaceae P Arbusto Nativa

627


Rev Mex Cienc Pecu 2021;12(2):621-632

Leonotis nepetifolia Licopersicum esculentum var. cerasiforme Lippia umbellata Mandevilla foliosa Melampodium perfoliatum Melia azedarach Mimosa galeottii Montanoa karwinskii Nicotiana glauca Olivaea tricuspis Parthenium hysterophorus Perityle microglossa Phytolacca icosandra Pistacia mexicana Pithecellobium dulce Prosopis laevigata Pseudognaphalium chartaceum Psidium guajava Psilactis asteroides Psittacanthus calyculatus Ricinus communis Salvia misella Salvia tiliifolia Schinus molle Senecio salignus Senna occidentalis Serjania racemosa Solanum ferrugineum Solanum grayi Solanum grayi var. grandiflorum Tagetes erecta Thunbergia alata Tithonia tubiformis Tournefortia mutabilis Trixis hyposericea Verbena bipinnatifida Verbesina barrancae Verbesina crocata Vernonanthura cordata

Lamiaceae Solanaceae Verbenaceae Apocynaceae Asteraceae Meliaceae Fabaceae Asteraceae Solanaceae Asteraceae Asteraceae Asteraceae Phytolaccaceae Anacardiaceae Fabaceae Fabaceae Asteraceae Myrtaceae Asteraceae Loranthaceae Euphorbiaceae Lamiaceae Lamiaceae Anacardiaceae Asteraceae Fabaceae Sapindaceae Solanaceae Solanaceae Solanaceae Asteraceae Acanthaceae Asteraceae Boraginaceae Asteraceae Verbenaceae Asteraceae Asteraceae Asteraceae

628

N-P

Arbusto

Exótica

N

Hierba

Nativa

N x x N-P N N-P x x P x N x N-P N-P x N x N N x x N-P P x N-P x x x N x N x x x x x N

Arbusto Arbusto Hierba Árbol Arbusto Arbusto Arbusto Hierba Hierba Hierba Hierba Árbol Árbol Árbol Hierba Árbol Hierba Hierba Arbusto Hierba Hierba Árbol Arbusto Hierba Hierba Arbusto Hierba Hierba Hierba Hierba Hierba Arbusto Arbusto Hierba Arbusto Arbusto Arbusto

Nativa Nativa Nativa Exótica Nativa Nativa Exótica Nativa Nativa Nativa Nativa Nativa Nativa Nativa Nativa Nativa Nativa Nativa Exótica Nativa Nativa Exótica Nativa Nativa Nativa Nativa Nativa Nativa Nativa Exótica Nativa Nativa Nativa Nativa Nativa Nativa Nativa


Rev Mex Cienc Pecu 2021;12(2):621-632

Vernonia bealliae Viguiera quinqueradiata

Asteraceae Asteraceae 1

P N

Arbusto Arbusto

Nativa Nativa

P= polen, N= néctar, x= no documentado.

Los meses con más especies en floración fueron septiembre y noviembre con16 especies cada uno, seguido por octubre con 13 y agosto con 12. Las abejas representan los principales polinizadores entre los insectos observados durante el muestreo. En las áreas bajo cultivo intensivo de monocultivos, las abejas melíferas se están convirtiendo en los únicos polinizadores ya que los insectos nativos silvestres están desapareciendo de manera gradual. Una de las razones por esta dominancia es que A. mellifera pertenece a uno de los pocos géneros de abejas conocidos por tener hábitos polilécticos(16). Además, se promueve su presencia entre cultivos ya que producen aumentos de rendimiento de hasta un 96%(17). De las familias de planta utilizadas por las abejas melíferas, los resultados indican que la Myrtaceae tuvo el segundo porcentaje más alto en agosto y, con mucho, el primero en septiembre, octubre y noviembre. En la muestra esta familia estuvo representada de manera prominente por E. citriodora, una especie exótica. Evolucionada originalmente en la región Austro-Malaya(18), se ha introducido a muchos países por su valor como fuente de madera, leña, y fibra de madera y como una ornamental(19). La fenología floral de Eucalyptus suele ser sincrónica entre diferentes individuos dentro de una arboleda, pero muestra una gran variación en su tiempo de floración e incluso puede tener períodos de floración intermitentes durante la mayor parte del año(20). Está documentado que Apis mellifera es uno de los visitantes más frecuentes de sus flores(21). En el mes de agosto, la familia Asteraceae fue más visitada que la Myrtaceae. Esta familia de plantas es la más abundante en México(22-25), y representa aproximadamente el 10% de todas las plantas conocidas en el mundo(26). Su centro de diversificación está en México, donde es el grupo de plantas más grande y representativo; abarca del 7 al 32 % de la flora del país y el 12.5 % de la de Jalisco(27). En septiembre, la segunda familia más abundante en las muestras de polen fue Poaceae, pero no se podía identificar ni especies ni géneros dentro de ella. Esta también es una familia extensa, con más de 500 especies en todo el mundo e incluye, tanto los cereales utilizados en la alimentación humana, como los pastos usados en la alimentación del ganado(26). En octubre, hubo dos familias que fueron las segundas más importantes para las abejas, con porcentajes iguales de polen: Fabaceae (representada por L. leucocephala y A. farnesiana, y Lamiaceae, por H. albida. Aunque los porcentajes en este estudio se refieren al número de granos de polen documentados y no a su volumen, los tamaños siguen siendo relevantes ya que las proporciones cambian cuando se analizan en términos de una variable diferente. Por ejemplo, los granos de polen de E. citriodora son pequeños, 25 µm en promedio, tienen la forma de un prisma triangular aplanado y su volumen promedia aproximadamente 3,125 µm3. Por el contrario, los granos de polen de A. farnesiana tienen un tamaño promedio de 60 µm, una forma elipsoide y un volumen de 629


Rev Mex Cienc Pecu 2021;12(2):621-632

aproximadamente 78,539.8 µm3. En términos del número de granos, E. citriodora representó el 34 % de la muestra mientras A. farnesiana (Fabaceae) el 2.4%. Sin embargo, si se comparan en términos de sus volúmenes totales, las proporciones cambian radicalmente: 106,250 µm3 para E. citriodora y 196,349.5 µm3 para A. farnesiana, es decir, casi el doble del volumen de E. citriodora. En noviembre, Asteraceae fue la segunda familia más importante; independientemente de su frecuencia, el polen de algunas especies estuvo presente en al menos dos de las muestras de carga de polen. Este indica su presencia durante más de un mes, lo cual significa que son recursos alimenticios a largo plazo durante el año. Tal es el caso de E. citriodora (presente en cuatro muestras), y Asteraceae y L. leucocephala (en tres muestras). De los 23 tipos de polen encontrados en las muestras, siete han sido reportados como fuentes de polen para las abejas melíferas en otros estados de México: A. farnesiana, Fraxinus uhdei, Heliocarpus terebinthinaceus, L. leucocephala, P. guajava, R. communis y S. angulatus(11-15, 27, 28). Del número total de especies de plantas en flor que se observaron en la zona durante todo el año, solo el 34.21% son utilizadas por las abejas(22-26,29,30). Esto podría explicarse por la selectividad de las abejas melíferas en función a la abundancia relativa y la calidad del néctar y del polen, y la distancia a los recursos florales. Agradecimientos El presente estudio forma parte de un proyecto financiado por el CONACyT, la Universidad de Guadalajara y la Universidad Autónoma Agraria Antonio Narro, Unidad Laguna. Agradecemos a Rafael Ordaz-Briseño por su asesoramiento experto en asuntos de la apicultura y a Arturo Castro-Castro por su supervisión durante la preparación e identificación de los ejemplares de las plantas. Una mención especial a nuestro amigo, colega investigador y coautor José Francisco Santana Michel quien falleció antes de la publicación de este trabajo. Literatura citada: 1.

Potts SG, Biesmeijer JC, Kremen C, Neumann P, Schweiger O, Kunin WE. Global pollinator declines: trends, impacts and drivers. Trends Ecol Evol 2010;25:(6)345-353.

2.

FAOSTAT-FAO Agriculture Organization of the United Nations. Retrieved from http://faostat3.fao.org/faostat-gateway/go/to/download/Q/QC/S. Accessed May 25,2017.

3.

Kostić AŽ, Barać MB, Stanojević SP, Milojković-Opsenica DM, Tešić ŽL, Šikoparija B,et al. Physicochemical composition and techno-functional properties of bee pollen collected in Serbia. LWT-Food Sci Technol 2015;62(1):301-309.

630


Rev Mex Cienc Pecu 2021;12(2):621-632

4.

Roulston TH, Cane JH. Pollen nutritional content and digestibility for animals. Pollen and pollination. Pl Syst Evol 2000;222:187-209.

5.

Höcherl N, Siede R, Illies I, Gätschenberger H, Tautz J. Evaluation of the nutritive value of maize for honey bees. J Insect Physiol 2012;58(2):278-285.

6.

Levin MD, Haydak MH. Seasonal variation in weight and ovarian development in the worker honeybee. J Econ Entomol 1951;44(1):54-57.

7.

Wells H, Wells PH. Honey bee foraging ecology: optimal diet, minimal uncertainty or individual constancy?. J Anim Ecol 1983;52(3):829-836.

8.

Dötterl S, Vereecken NJ. The chemical ecology and evolution of bee-flower interactions: a review and perspectives. Can J Zool 2010;88(7):668-697.

9.

Waller GD. Modification of the OAC pollen trap. Am Bee J 1980;(120):119-121.

10. Kearns CA, Inouye DW. Techniques for pollination biologists. Niwot, Colorado, USA: University Press of Colorado; 1993. 11. SAGADER. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Flora nectarífera y polinífera del estado de Michoacán, México. 1999. 12. Franco OVH, Siqueiros DME, Hernández AEG. Flora apícola del estado de Aguascalientes. Universidad Autónoma de Aguascalientes, México. 2012. 13. SAGARPA. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Flora nectarífera y polinífera en el estado de Tamaulipas, México. 2003. 14. SAGADER. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Flora nectarífera y polinífera en el estado de Chiapas, México. 2000. 15. Souza-Novelo N, Barrera-Vásquez A, Suárez-Molina VM. Plantas melíferas y poliníferas que viven en Yucatán. Fondo Editorial de Yucatán. 2001. 16. Cortopassi LM, Ramalho M. Pollen harvest by Africanized Apis mellifera and Trigona spinipes in São Paulo botanical and ecological views. Apidologie 1988;19(1):1-24. 17. Klein AM, Vaissière BE, Cane JH, Steffan-Dewenter I, Cunningham SA, Kremen C, Tscharntke T. Importance of pollinators in changing landscapes for world crops. Proc R Soc Lond [Biol] 2007;274(1608):303-313. 18. Hanks LM, Paine TD, Millar JG, Hom JL. Variation among Eucalyptus species in resistance to eucalyptus longhorned borer in Southern California. Entomol Exp Appl 1995;74(2):185-194.

631


Rev Mex Cienc Pecu 2021;12(2):621-632

19. Zacharin RF. Emigrant eucalypts: gum trees as exotics. Victoria, Australia: Melbourne University Press; 1978. 20. Griffin A. Floral phenology of a stand of mountain ash (Eucalyptus regnans F. Muell.) in Gippsland, Victoria. Aust J Bot 1980;28(4):393-404. 21. Horskins K, Turner V. Resource use and foraging patterns of honeybees, Apis mellifera, and native insects on flowers of Eucalyptus costata. Austral Ecol 1999;24(3):221-227. 22. Castellanos PBP, Ramírez AE, Zaldivar CJM, Análisis del contenido polínico de mieles producidas por Apis mellifera L. (Hymenoptera: Apidae) en el estado de Tabasco, México. Acta Zool Mex 2012;28(1):13-36. 23. Piedras GB, Quiroz GDL. Estudio melisopalinológico de dos mieles de la porción sur del Valle de México. Polibotánica 2007;23:57-75. 24. Ramírez AE, Navarro CLA, Díaz CE. Botanical characterisation of Mexican honeys from a subtropical region (Oaxaca) based on pollen analysis. Grana 2011;50(1):40-54. 25. Ramírez AE, Martínez BA, Ramírez MN, Martínez HE. Análisis palinológico de mieles y cargas de polen de Apis mellifera (Apidae) de la región Centro y Norte del estado de Guerrero, México. Bot Sci 2016;94(1):141-156. 26. Ordetx GS, Zozaya RJA, Franco MW. Estudio de la flora apícola nacional. Universidad de Chapingo, México, DF 1972. 27. Villaseñor JL, Ibarra G, Ocaña D. Strategies for the conservation of Asteraceae in Mexico. Conserv Biol 1998;12(5):1066-1075. 29. Acosta CS, Quiroz GDL, Arreguín SML, Fernández NR. Análisis polínico de tres muestras de miel de Zacatecas, México. Polibotánica 2011;(32):179-191. 30. Louveaux J. Étude expérimentale de la récolte du pollen. In: Chauvin R, editor. Traité de biologie de l'abeille, Masson et Cie, Paris, France 1968;(3):174-203.

632


https://doi.org/10.22319/rmcp.v12i2.5480 Nota de investigación

Eficacia del timol en el control del hongo Nosema ceranae infectando abejas africanizadas

Azucena Vargas-Valero a Roberto C. Barrientos-Medina b Luis A. Medina Medina c*

a

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Centro de Investigación Regional del Sureste, Campo Experimental Edzná, Campeche, México. b

Universidad Autónoma de Yucatán. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Ecología, Yucatán, México. c

Universidad Autónoma de Yucatán. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Apicultura, Yucatán, México.

* Autor de correspondencia: mmedina@correo.uady.mx

Resumen: Nosema ceranae, es un parásito obligatorio del intestino medio de las abejas melíferas que causa destrucción de las células epiteliales afectando la digestión y asimilación del alimento, impactando negativamente el desarrollo y sobrevivencia de las colonias de abejas. Con la finalidad de reducir los efectos negativos, se evaluó la eficacia del timol en el control de esta parasitosis. El estudio se realizó en dos apiarios experimentales con un total de 56 colonias de abejas distribuidas en tres grupos experimentales: G1) 18 colonias que recibieron tratamiento con fumagilina como producto de referencia (25.2 mg de fumagilina/semana); G2) 19 colonias que recibieron tratamiento con timol como producto alternativo (66 mg de cristales/semana) y G3) 19 colonias que no recibieron ningún tratamiento (grupo testigo). Los tratamientos con la fumagilina y timol se aplicaron a través del jarabe de azúcar una vez por semana durante cuatro semanas consecutivas. Los niveles de infección de N. ceranae se estimaron en el macerado del abdomen de 60 abejas adultas colectadas de cada colonia 633


Rev Mex Cienc Pecu 2021;12(2):633-643

experimental. Los resultados al final de los tratamientos indican que las colonias que recibieron fumagilina (G1) disminuyeron sus niveles de infección de 123,529 a 1,805 esporas por abeja; para G2 (timol), la reducción fue de 133,438 a 28,099 esporas por abeja, y para las colonias del grupo testigo (G3) fue de 119,306 a 36,447 esporas por abeja. Los tres grupos experimentales presentaron diferencias estadísticas significativas en los niveles de infección de N. ceranae al final de los tratamientos. La fumagilina presentó una mayor eficacia (95.2 %) en comparación con el timol la, cual fue baja (31.1 % de eficacia) indicando que se requieren estudios adicionales para determinar la concentración más efectiva a nivel de colonia bajo condiciones tropicales de Yucatán, a fin de que este aceite esencial de origen vegetal sea incorporado como producto alternativo para el control de esta parasitosis. Palabras clave: Nosema ceranae, Nosemosis, Fumagilina, Timol, Eficacia, Apis mellifera.

Recibido: 20/08/2019 Aceptado: 02/09/2020

La nosemosis, es una parasitosis que afecta el tracto digestivo de las abejas Apis mellifera y es causado por dos especies de hongos de la familia Nosematidae: Nosema apis, especie originalmente asociada a esta infección en las abejas melíferas y Nosema ceranae, especie originalmente asociada a la abeja asiática Apis cerana y diagnosticada por primera vez infectando a las abejas A. mellifera en el centro y norte de España en 2006(1) donde se había registrado durante el invierno una reducción en la producción de miel y una alta mortalidad de colonias de abejas(2,3). Ambas especies de microsporidios (N. apis y N. ceranae) se reproducen rápidamente dentro de las células epiteliales del intestino medio (ventrículo) de las abejas adultas (reina, obreras y zánganos) ocasionando la destrucción de las células epiteliales encargadas de la digestión y asimilación del alimento(3) lo que ocasiona un estrés nutricional en las abejas infectadas(4). Otros daños observados a nivel individual demuestran una reducción en el periodo de vida(3,5,6) y un efecto negativo en la orientación y habilidades como forrajeadoras en las obreras infectadas(7,8). A nivel de colonia, los daños causados por la nosemosis pueden ser graves cuando la prevalencia y niveles de infección son altos, ocasionando una reducción en las áreas de cría y en la población de abejas adultas y en consecuencia una reducción en la producción de miel de las colonias(9,10) hasta llegar al colapso y pérdida de las mismas(11,12).

634


Rev Mex Cienc Pecu 2021;12(2):633-643

A partir de 2006 cuando se diagnosticó la infección en las abejas A. mellifera, la especie N. ceranae se ha convertido en uno de los patógenos más ampliamente distribuidos a nivel mundial(13,14), y ha estado asociada a una alta mortalidad de colonias de abejas en Europa(11), Norteamérica(15) y Sudamérica(16) presentando una mayor virulencia en comparación con la infección causada por N. apis(5,17,18). En Yucatán, los apicultores no han reportado la pérdida masiva o alta mortalidad de colonias de abejas debido a la infección por N. apis o N. ceranae. Sin embargo, a partir de 2008(19) se ha reportado una elevada prevalencia de la nosemosis (74 a 100 %) en colonias provenientes de apiarios comerciales en comparación con lo reportado en años anteriores (7.2 %)(20), y esta alta prevalencia se ha atribuido a la presencia de la especie N. ceranae, infectando a las abejas africanizadas en Yucatán(21). Recientemente, se confirmó que la infección causada por N. ceranae afecta negativamente el inicio y duración de forrajeo en abejas de origen africanizado, así como la longevidad de las obreras bajo las condiciones tropicales de Yucatán(22). Para el control de la nosemosis, el único medicamento considerado eficaz contra este microsporidio ha sido la fumagilina (sal de diciclohexilamonio), un antibiótico obtenido del hongo Aspergillus fumigatus y que históricamente se ha utilizado para controlar esta parasitosis causada por N. apis en abejas melíferas desde que fue evaluado a principios de la década de los 50(23). El mecanismo de acción de la fumagilina, es la inhibición de la replicación del ADN del microsporidio suprimiendo su reproducción, lo que resulta en una disminución del número de esporas en el ventrículo de las abejas(24,25). A diferencia de los Estados Unidos de América donde las infecciones causadas por N. apis o N. ceranae pueden ser controladas con la aplicación de fumagilina, en diversos países de Europa(26) así como en México, este antibiótico no está autorizado para el control de la nosemosis debido a la toxicidad que puede representar para los humanos, por lo que cualquier residuo que quede en la miel de las colonias que se encuentren bajo tratamiento, representa un riesgo directo para el consumidor(27). Debido a estos inconvenientes, algunos productos alternativos han sido propuestos para el control de esta parasitosis, incluyendo diferentes aceites esenciales de origen vegetal como el timol obtenido del tomillo (Thymus vulgaris), el aceite esencial de vetiver (Chrysopogon zizanioides) así como el resveratrol, que es un polifenol natural presente en numerosas plantas y frutos como la uva. Estos aceites esenciales han presentado resultados favorables en el control de la nosemosis, principalmente el timol(28,29). Se ha demostrado que colonias con nosemosis que fueron tratadas con timol aplicado a través de un jarabe de azúcar en una concentración de 0.44 mM, presentaron una reducción en el número de esporas por abeja y registraron un incremento en las áreas de cría, población de abejas adultas y producción de

635


Rev Mex Cienc Pecu 2021;12(2):633-643

miel posterior a la aplicación de este producto en comparación con las colonias de abejas que no recibieron ningún tipo de tratamiento(28). Adicionalmente, se considera que por su naturaleza, los productos alternativos a base de aceites esenciales no representan toxicidad para las abejas, presentan un menor riesgo de dejar residuos en la miel(30) y son de menor costo para el apicultor. Debido a la necesidad de contar con productos alternativos, el objetivo del presente trabajo fue comparar la eficacia del timol en el control de la nosemosis causada por la especie N. ceranae infectando abejas africanizadas (A. mellifera) bajo condiciones tropicales de Yucatán. El experimento se realizó en dos apiarios pertenecientes a la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Autónoma de Yucatán (UADY) ubicados en la localidad de Xmatkuil (20º 51' 51'' N, 89º 36' 45'' O y 20º 51' 55'' N, 89º 36' 46'' O), a 15.5 km de la ciudad de Mérida, Yucatán. Esta región presenta un clima cálido sub-húmedo con lluvias en verano (Awo), con una precipitación pluvial promedio anual de 985 mm, temperatura promedio anual de 26.8 ºC y humedad relativa promedio anual de 78 %(31). Las colonias de abejas en ambos apiarios eran colonias dobles (cámara de cría y un alza) alojadas en colmenas tipo Langstroth, que contaban con reinas africanizadas fecundadas naturalmente, con una población de abejas adultas que cubrían entre 7 a 9 panales de la cámara de cría y con 6 a 8 panales conteniendo cría en diferentes etapas (huevos, larvas y pupas), además de contar con panales con miel y polen. Las colonias fueron distribuidas de manera similar entre los grupos experimentales y todas se encontraban infectadas con la especie N. ceranae, la cual fue identificada a través de la técnica de PCR punto final(32) en muestras de abejas forrajeadoras colectadas en la entrada de cada colonia experimental. Antes de iniciar las evaluaciones, se realizó un diagnóstico preliminar en ambos apiarios para determinar el nivel de infección de N. ceranae (número de esporas/abeja) en todas las colonias de abejas, con la finalidad de que los tres grupos experimentales presenten un nivel de infección similar al inicio del experimento. Para determinar el nivel de infección, se colectaron muestras de abejas adultas (~100 a 150 obreras) de la entrada de cada colonia experimental. Sesenta abejas de cada muestra fueron analizadas para determinar la presencia de esporas de N. ceranae y se cuantificó la severidad de la infección (número de esporas/abeja) a través del conteo de esporas presentes en el tracto digestivo de las obreras, la cual consiste en retirar el abdomen de las 60 abejas adultas y colocarlas en un mortero añadiendo 60 ml de agua destilada(9,33). Los abdómenes fueron macerados hasta obtener una mezcla homogénea y la suspensión se filtró a través de una gasa para eliminar impurezas. Una gota de la solución fue colocada en ambos retículos de una cámara de Neubauer donde

636


Rev Mex Cienc Pecu 2021;12(2):633-643

se observó a 400 aumentos y se registró el número de esporas del macerado, determinando el nivel de infección (número de esporas) promedio por abeja. La evaluación de la eficacia de la fumagilina (Fumagilin-B®) y los cristales de timol (SigmaAldrich; ≥99.5 % de pureza) en el control de N. ceranae se realizó durante un período de cuatro semanas y las colonias de abejas de ambos apiarios se dividieron en tres grupos experimentales, los cuales fueron: Grupo 1 (G1): con 18 colonias de abejas que recibieron tratamiento con fumagilina como producto de referencia (Fumagilin-B®), aplicando 1.2 g del producto comercial (25.2 mg de fumagilina base) por colonia/semana en un litro de jarabe de azúcar (2:1, azúcar: agua); Grupo 2 (G2): con 19 colonias que recibieron tratamiento con timol como producto alternativo, aplicando 66 mg de cristales de timol (99.5 % de pureza) por colonia/semana en un litro de jarabe de azúcar (2:1, azúcar: agua), y el Grupo 3 (G3): con 19 colonias de abejas a las cuales se les suministró únicamente un litro de jarabe de azúcar (2:1, azúcar: agua) por colonia/semana, sin ningún tipo de tratamiento, conformando el grupo testigo. Los tratamientos se aplicaron una vez por semana durante cuatro semanas consecutivas. Al final de cada semana de aplicación, abejas adultas se colectaron de la entrada de cada colonia con la finalidad de determinar el nivel de infección para cada grupo experimental, de acuerdo con la metodología descrita con anterioridad. Los datos originales (número de esporas por abeja) fueron divididos entre mil, para facilitar su manejo estadístico, y se utilizó la transformación Box-Cox(34) para normalizar la distribución de la variable de interés. Finalmente, se empleó un análisis de varianza de medidas repetidas para comparar los promedios por tratamiento (grupos experimentales), semana y la interacción de ambos factores (tratamiento x semana). El nivel de significancia empleado fue del 5% y los cálculos se realizaron con el programa PAST versión 3.20(35). Antes de iniciar la aplicación de los tratamientos, se observó que los niveles de infección de N. ceranae en los tres grupos experimentales, no presentaron diferencias estadísticas significativas de acuerdo con la prueba de Kruskal-Wallis (H= 0.5587, P=0.7563), indicando una distribución similar de los niveles de infección de las colonias para los tres grupos experimentales (Cuadro 1).

637


Rev Mex Cienc Pecu 2021;12(2):633-643

Cuadro 1: Número de esporas por abeja (𝑋 ± EE) registrado en los tres grupos experimentales después de la aplicación de cada tratamiento para el control de Nosema ceranae Fumagilina

Timol

Testigo

H

Día 0

123,529±41,220 a

133,438±59,291 a

119,306±53,100 a

0.5587

Día 7 (1ra aplicación) Día 14 (2da aplicación) Día 21 (3ra aplicación) Día 28 (4ta aplicación)

104,688±42,293 a

67,812±14,426 a

80,394±22,381 a

1.8960

57,666±14,827 a

84,500±23,054 a

96,666±25,476 a

2.1100

30,468±11,190 a

27,058±9,779 a

42,631±9,055 a

4.9040

1,805±527 a

28,099±17,574 b

36,447±17,554 c

24.0900

Eficacia final, %

95.2

31.1

-

Se incluye el valor del estadístico de prueba (H) para cada semana de aplicación. abc

𝑋 ± EE= Promedio ± error estándar. Literales diferentes entre columnas indican diferencias significativas (P<0.05).

De acuerdo con los resultados obtenidos, se observó que las colonias que recibieron tratamiento con la fumagilina (Fumagilin-B®), presentaron una disminución de los niveles de infección (𝑋±E.E.) de 123,529 ± 41,200 a 1,805 ± 527 esporas por abeja al final de las cuatro semanas de tratamiento, lo que representa una eficacia del 95.2 % de este antibiótico en el control de N. ceranae (Cuadro 1). Para las colonias del grupo que recibieron el jarabe con los cristales de timol (G2), el número de esporas se redujo de 133,438 ± 59,291 a 28,099 ± 17,574 esporas por abeja, representando una eficacia del 31.1 %. La disminución natural de los niveles de infección de la nosemosis observada en el grupo testigo, puede ser resultado de las fluctuaciones estacionales que se observan durante los diferentes meses del año, las cuales como se ha reportado en otros trabajos(36), pueden variar drásticamente entre las diferentes temporadas del ciclo apícola. Durante las tres primeras semanas de aplicación de los tratamientos, el número de esporas por abeja registrado en los tres grupos experimentales no presentaron diferencias estadísticas significativas, las cuales fueron significativas hasta al final de las cuatro semanas de tratamiento (Cuadro 1) donde el grupo que recibió la fumagilina, presentó una mayor eficacia seguido por el grupo que recibió el timol. La diferencia en la reducción de la infección registrada hasta el final de la cuarta semana del grupo que recibió la fumagilina (G1), indica que este antibiótico alcanza su mayor eficacia cuando las colonias de abejas recibieron los 100.8 mg de fumagilina base (4.8 g de Fumagilin-B® en total) de acuerdo con las indicaciones del laboratorio fabricante.

638


Rev Mex Cienc Pecu 2021;12(2):633-643

Los resultados obtenidos en este trabajo indican que la aplicación de la fumagilina disminuyó significativamente los niveles de infección de N. ceranae hasta la cuarta semana de aplicación y fue diferente a los niveles de infección registrados en las colonias que recibieron timol (G2) o solo recibieron el jarabe de azúcar sin tratamiento (G3), lo cual coincide con lo reportado por diversos autores en diferentes países(37- 40), donde señalan que este antibiótico continúa siendo apropiado para controlar la infección causada por la especie N. ceranae. Sin embargo, aun cuando este antibiótico es eficiente en reducir temporalmente los niveles de infección de N. ceranae, no evita las reinfecciones en las colonias después de seis meses de aplicados los tratamientos(38). La eficacia del timol registrada en este trabajo (31.1 %), fue inferior a lo observado bajo condiciones de laboratorio en abejas infectadas por N. ceranae que fueron alimentadas con jarabe de azúcar conteniendo timol, donde se observó una reducción del 40 % del nivel de infección en comparación al grupo testigo que no recibió ningún tratamiento para el control de esta parasitosis(41). Se reporta que el timol presenta una mayor eficacia en el control de la nosemosis a partir del tercer año de la aplicación del producto(28) a diferencia del presente trabajo donde este aceite esencial de origen vegetal fue aplicado en una sola temporada, por lo que sería recomendable seguir aplicando el producto durante dos años adicionales para verificar la eficacia de la dosis suministrada. De acuerdo con los resultados obtenidos en este trabajo, se puede concluir que la fumagilina demuestra eficacia en reducir los niveles de infección de la nosemosis causada por la especie N. ceranae infectando abejas africanizadas bajo condiciones de clima tropical. Sin embargo, la aplicación de este antibiótico no está autorizado en México para uso en abejas y se recomienda su aplicación cuando los niveles de infección sean superiores a los dos millones de esporas/abeja y se respeten las dosis suministradas(28). En este sentido y considerando que los niveles de infección de N. ceranae en este trabajo fueron inferiores a este valor (dos millones de esporas/abeja) antes de iniciar los tratamientos, es posible que la aplicación del timol reduzca los niveles de infección de N. ceranae en abejas africanizadas establecidas bajo condiciones tropicales de Yucatán. Sin embargo, para que el timol sea considerado en el control alternativo de este hongo, se requiere realizar otras evaluaciones para tener resultados favorables en su eficacia, ya sea incrementando la dosis aplicada en cada tratamiento, el número de aplicaciones y el período o época de aplicación, para que pueda ser utilizado como una alternativa de control, ya que por su origen presenta un menor riesgo de dejar residuos en la miel.

639


Rev Mex Cienc Pecu 2021;12(2):633-643

Literatura citada: 1. Higes M, Martin R, Meana A. Nosema ceranae, a new microsporidian parasite in honeybees in Europe. J Inv Pathol 2006;(92):81-83. 2. Higes M, Martín R, Sanz A, Álvarez N, Sanz A, García MP, Meana A. El síndrome de despoblamiento de las colmenas en España. Consideraciones sobre su origen. Vida Apícola 2005;(133):15-21. 3. Higes M, Garcia‐Palencia P, Martin‐Hernandez R, Meana A. Experimental infection of Apis mellifera honeybees with Nosema ceranae (Microsporidia). J Invertebr Pathol 2007;(94):211–217. 4. Mayack C, Naug D. Energetic stress in the honeybee Apis mellifera from Nosema ceranae infection. J Inv Pathol 2009;(100):185–188. 5. Paxton RJ, Klee J, Korpela S, Fries I. Nosema ceranae has infected Apis mellifera in Europe since at least 1998 and may be more virulent than Nosema apis. Apidologie 2007;(38):558–565. 6. Goblirsch M, Huang ZY, Spivak M. Physiological and behavioral changes in honey bees (Apis mellifera) induced by Nosema ceranae infection. PLos One 2013;8(3):e58165. 7. Kralj J, Fuchs S. Nosema sp. influences flight behavior of infected honey bee (Apis mellifera) foragers. Apidologie 2010;(41):21–28. 8. Wolf S, McMahon DP, Lim KS, Pull CD, Clark SJ, Paxton RJ, Osborne JL. So near and yet so far: harmonic radar reveals reduced homing ability of Nosema infected honeybees. PLoS One 2014;9(8):e103989. 9. Fries I, Ekbohm G, Villumstad E. Nosema apis, sampling techniques and honey yield. J Apic Res 1984;(23):102–105. 10. Botías C, Martin-Hernandez R, Barrios L, Meana A, Higes M. Nosema spp. infection and its negative effects on honey bees (Apis mellifera iberiensis) at the colony level. Vet Res 2013;(44):25. 11. Higes M, Martín-Hernandez R, Botias C, Bailon EG, Gonzales-Porto A, Barrios L, del Nozal MJ, Palencia PG, Meana A. How natural infection by Nosema ceranae causes honeybee colony collapse. Environ Microbiol 2008;10(10):2659-2669. 12. Higes M, Martin-Hernandez R, Garrido-Bailon E, Gonzalez-Porto AV, Garcia-Palencia P, Meana A, et al. Honeybee colony collapse due to Nosema ceranae in professional apiaries. Environ Microbiol Rep 2009;1(2):110–113.

640


Rev Mex Cienc Pecu 2021;12(2):633-643

13. Klee J, Besana AM, Genersch E, Gisder S, Nanetti A, Tam DO, et al. Widespread dispersal of the microsporidian Nosema ceranae, an emergent pathogen of the western honeybee, Apis mellifera. J Invertebr Pathol 2007;96(1):1-10. 14. Goulson D, Nicholls E, Botías C, Rotheray EL. Bee declines driven by combined stress from parasites, pesticides, and lack of flowers. Science 2015;347(6229):1255957. 15. vanEngelsdorp D, Evans JD, Saegerman C, Mullin C, Haubruge E, Nguyen BK, et al. Colony collapse disorder: A descriptive study. PLoS One 2009;4(8):e6481. 16. Martínez J, Leal G, Conget P. Nosema ceranae an emergent pathogen of Apis mellifera in Chile. Parasitol Res 2012;(111):601–607. 17. Fries I. Nosema apis – a parasite in the honey bee colony. Bee World 1993;(74): 5-19. 18. Webster TC, Pomper KW, Hunt G, Thacker EM. Nosema apis infection in worker and queen Apis mellifera. Apidologie 2004;(35):49-54. 19. Martinez-Puc JFM, Medina, LAM, Catzin-Ventura GA. Frecuencia de Varroa destructor, Nosema apis y Acarapis woodi en colonias manejadas y enjambres silvestres de abejas (Apis mellifera) en Mérida, Yucatán, México. Rev Mex Cienc Pecu 2011;2(1):25-38. 20. García-Millán M, Quezada-Euan JJG. Distribución de Nosemiasis en apiarios comerciales del estado de Yucatán. Apicultura Moderna 1993;(5): 22-24. 21. Briceño-Uc AR. Estudio retrospectivo de microsporidos (Nosema apis y Nosema ceranae) en colmenas de Apis mellifera de Yucatán, México. [tesis maestría]. Mérida, Yucatán. Universidad Autónoma de Yucatán. 2013. 22. Fleites-Ayil FA, Quezada-Euan JJG, Medina ML. Onset of foraging and lifespan of Africanized honey bees (Apis mellifera) infected with different levels of Nosema ceranae spores in Neotropical Mexico. Apidologie 2018;(49):781–788. 23. Katznelson H, Jamieson CA. Control of Nosema disease of honey bees with fumagillin. Science 1952;(115):70-71. 24. Hartwig A, Przelecka A. Nucleic acids in the intestine of Apis mellifera infected with Nosema apis and treated with Fumagillin DCH: cytochemical and autoradiographic studies. J Invertebr Pathol 1971;18(3):331–336. 25. Liu TP. Ultrastructural changes in the secretion granules of the hypopharyngeal glands of the honeybee infected by Nosema apis and after treatment with fumagillin. Tissue Cell 1990;22(4):523-531.

641


Rev Mex Cienc Pecu 2021;12(2):633-643

26. Fries I. Nosema ceranae in European honey bees (Apis mellifera). J Invertebr Pathol 2010;(103):S73-S79. 27. van den Heever JP, Thompson TS, Curtis JM, Ibrahim A, Pernal SF. Fumagillin: an overview of recent scientific advances and their significance for apiculture. J Agric Food Chem 2014;(62):2728–2737. 28. Yücel B, Doğaroğlu M. The impact of Nosema apis Z. infestation of honey bee (Apis mellifera L.) colonies after using different treatment methods and their effects on the population levels of workers and honey production on consecutive years. Pakistan J Biol Sci 2005;8(8):1142-1145. 29. Maistrello L, Lodesani M, Costa C, Leonardi F, Marani G, Caldon M, Mutinelli F, Granato A. Screening of natural compounds for the control of nosema disease in honeybees (Apis mellifera). Apidologie 2008;(39):436-445. 30. Bogdanov S, Imdorf A, Kilchenmann V. Thymol residues in wax and honey after Apilife VAR Treatment. Swiss Bee Research Centre 1998;(133):1-9. 31. Orellana LR, Espadas MC, Nava MF. Climas. In: Durán R, Méndez M. editores. Biodiversidad y desarrollo humano en Yucatán. Yucatán, México: CONABIOSEDUMA; 2010:10-11. 32. Chen Y, Evans J, Smith B, Pettis J. Nosema ceranae is a long-present and wide-spread microsporidian infection of the European honey bee (Apis mellifera) in the United States. J Invertebr Pathol 2007;(97):186-188. 33. Cantwell GE. Standard methods for counting Nosema spores. Am Bee J 1970;110(6):222223. 34. Krebs CJ. Ecological Methodology. 2nd ed. Menlo Park, California, USA: AddisonWelsey Educational Publishers; 1999. 35. Hammer Ø, Harper DAT, Ryan PD. PAST: Paleontological statistics software package for education and data analysis. Palaeontologia Electronica 2001;4(1):9pp. http://palaeo-electronica.org/2001_1/past/issue1_01.htm. Consultado 12 May, 2018. 36. Traver BE, Williams MR, Fell RD. Comparison of within hive sampling and seasonal activity of Nosema ceranae in honey bee colonies. J Invertebr Pathol. 2012;(109):187193.

642


Rev Mex Cienc Pecu 2021;12(2):633-643

37. Higes M, Nozal MJ, Álvaro A, Barrios L, Meana A, Martín-Hernández R, Bernal JL, Bernal J. The stability and effectiveness of fumagillin in controlling Nosema ceranae (Microsporidia) infection in honey bees (Apis mellifera) under laboratory and field conditions. Apidologie 2011;(42):364-377. 38. Williams GR, Sampson MA, Shutler D, Rogers REL. Does fumagillin control the recently detected invasive parasite Nosema ceranae in western honey bees (Apis mellifera)? J Invertebr Pathol 2008;(99):342–344. 39. Holt HL, Grozinger CM. Approaches and challenges to managing Nosema (Microspora: Nosematidae) parasites in honey bee (Hymenoptera: Apidae) colonies. J Econ Entomol 2016;(109):1487–1503. 40. Burnham AJ. Scientific advances in controlling Nosema ceranae (Microsporidia) infections in honey bees (Apis mellifera). Front Vet Sci 2019;(6):79. 41. van den Heever JP, Thompson TS, Otto SJG, Curtis, JM, Ibrahim A, Pernal SF. Evaluation of Fumagilin-B® and other potential alternative chemotherapies against Nosema ceranae-infected honeybees (Apis mellifera) in cage trial assays. Apidologie 2016;(47):617–630.

643


https://doi.org/10.22319/rmcp.v12i2.5519 Nota de investigación

Caracterización de la curva de lactancia y calidad de la leche en ovejas Santa Cruz (Ovis aries)

Ingrid Merchant a Agustín Orihuela a* Reyes Vázquez a Virginio Aguirre a

a

Universidad Autónoma del Estado de Morelos. Facultad de Ciencias Agropecuarias. Avenida Universidad 1001 Colonia Chamilpa, Cuernavaca Morelos 62210, México.

* Autor de correspondencia: aorihuela@uaem.mx

Resumen: En las ovejas de pelo existe muy poca información respecto a las características de la producción y calidad de la leche a lo largo de la lactancia, pese a sus implicaciones tanto en la sobrevivencia y mantenimiento de los corderos, como en la alimentación humana. Con el propósito de caracterizar la curva de lactancia y la calidad de la leche en ovejas Santa Cruz, se utilizaron 18 ovejas multíparas que parieron en un lapso de cuatro días. La producción láctea se registró cada 72 h en el periodo comprendido de 6 a 60 días postparto (dpp), mientras que la calidad de la leche se determinó una vez por semana de una muestra de la producción total del día. La producción de leche 6 dpp fue de 1.95 L, alcanzando un máximo de 2.31 L, 12 dpp y disminuyendo hasta 1.01, a los 57 dpp. El porcentaje de sólidos totales fue 18 %, incrementando hasta 20.5 % en la octava semana. El porcentaje de grasa durante la segunda semana fue 8 % incrementándose hasta 9.8 % al final del periodo evaluado, mientras que los porcentajes de proteína y lactosa se mantuvieron relativamente uniformes durante todo el periodo experimental en niveles entre 4.86 y 5.18 % para proteína, y 4.68 a 4.74 % para lactosa. Se concluye que la producción de leche en ovejas Santa Cruz, alcanza su máximo alrededor de la segunda semana de lactancia, disminuyendo a partir de ese momento de

644


Rev Mex Cienc Pecu 2021;12(2):644-652

manera constante y paulatina, incrementando los porcentajes de sólidos totales y grasa a través del tiempo, mientras que los de proteína y lactosa se mantienen constantes. Palabras clave: Proteína, Lactosa, Grasa, Sólidos totales, Producción de leche, Ovinos.

Recibido: 26/09/2019 Aceptado: 23/07/2020

En las zonas tropicales, la ovinocultura está enfocada principalmente hacia la producción de carne, sobresaliendo las razas de pelo debido a su capacidad de adaptación a temperaturas elevadas, resistencia a parásitos y prolificidad alta(1). En este tipo climas, el sistema productivo más común es el extensivo, donde el número de corderos criados tiene el mayor valor para la producción, representando la principal fuente de ingresos para el productor(2). La producción de leche en estas razas, tiene un valor fundamental para la supervivencia, crecimiento y peso al destete de los corderos(3,4), y en ocasiones llega a ser una fuente alternativa de proteína para el consumo humano. Pese a lo anterior, la información respecto a la producción de leche en ovinos de pelo se limita a pocos estudios en razas como la Santa Cruz, Blackbelly, Katahdin(5-7) y algunas otras ovejas del oeste de África(8), mientras que la composición nutritiva de la leche, sólo se ha caracterizado en Blackbelly X Katahdin(9,10), lo que refleja la poca información respecto a la producción y calidad de la leche durante la lactancia en ovinos de pelo, pese a su popularidad en la región tropical de Norte y Centro América(11,12). El consumo diario de leche es el factor más importante en la tasa de crecimiento de los corderos; por lo que la supervivencia, potencial de crecimiento y peso al destete de las crías, dependerá de la producción de leche a través de la lactancia de la madre(3,4). Sin embargo, existe una gran variación en los genotipos de las razas tropicales, por lo que la estimación de la producción láctea a lo largo de la lactancia, así como la variación en su composición es información indispensable para establecer estrategias de manejo para ovejas y corderos. Por lo anterior, el objetivo del presente estudio fue caracterizar la producción y calidad de la leche en ovejas Santa Cruz, desde el parto hasta el destete. El estudio se realizó en el campo experimental de la Facultad de Ciencias Agropecuarias de la Universidad Autónoma del Estado de Morelos, ubicado a 18° 56´ N y 99°13’ O, a una altitud de 2,160 msnm. La temperatura anual promedio es de 20 °C, con una precipitación media anual de 1,243 mm.

645


Rev Mex Cienc Pecu 2021;12(2):644-652

Se utilizaron 18 ovejas multíparas Santa Cruz con edad y peso promedio de 2.0 años y 51.22 ± 2.36 kg, respectivamente, que parieron dentro de un rango de cuatro días. De las ovejas consideradas, 12 parieron mellizos, 2 tuvieron partos triples y 4 partos sencillos. Durante la gestación, las ovejas se mantuvieron en un solo grupo, pastoreando de 0800 a 1400 h en una pradera establecida con pasto estrella africana (Cynodon nlemfluensis). El resto del día permanecían estabuladas recibiendo una suplementación de 300 g de concentrado comercial. Este concentrado aportó 16 % de PC y 2.79 Mcal/kg de EM, mientras que el forraje (alfalfa + sorgo) proporcionaron 7.6 % de PC y 1.78 Mcal/kg de EM. Considerando que la dieta incluyó 50 % de concentrado y 50 % de forraje, ésta cubría los requerimientos nutricionales de una oveja de 60 kg, con dos crías, produciendo entre 0.79 y 1.48 kg de leche por día(13). Durante la lactancia, las ovejas se alimentaron con 1 kg del mismo alimento concentrado comercial, agua y una mezcla de forraje (30 % alfalfa y 70 % paja de sorgo) a libre acceso. Los primeros 5 días posparto (dpp) cada oveja con sus crías, se alojó en corrales individuales de 2 x 2 m, techados, con piso de cemento, comedero y bebedero individual. A partir del sexto dpp hasta el momento del destete (60 dpp) todas las hembras con sus crías se mantuvieron en un solo grupo dentro de un corral (4 m2/oveja), techado, piso de cemento, comedero y bebedero compartido. El corral contaba con un área de suplementación para las crías (creep feeding) donde se les ofreció alimento concentrado comercial al 18 % de PC a partir de los 14 dpp, a libre acceso. La producción láctea de las ovejas se midió a partir del 6to dpp, cada tres días, mediante el “método de la oxitocina”, el cual consiste en separar a los corderos de las hembras y aplicar 5 UI de oxitocina sintética por vía intravenosa (Oxitopisa; Pisa; Hidalgo, México) y ordeñar la ubre por completo de forma manual. Transcurridas 4 h de la aplicación de la hormona, se aplicó una segunda dosis y se ordeñó nuevamente, registrando el volumen de leche obtenida. Este valor se multiplicó por 6, para estimar la producción diaria(14). La calidad de la leche se determinó una vez por semana a partir de una muestra de 50 ml de leche recolectada del total de la ordeña diaria. El análisis de laboratorio (Alimenlab; Jalisco, México) determinó la concentración de proteína, grasa, lactosa y sólidos totales en la leche mediante el método de espectrofotometría infrarroja(15). Para el análisis estadístico de la producción y calidad de leche se realizó una regresión polinómica para obtener la ecuación, el valor de R2 y su probabilidad mediante el procedimiento PROC REG(16). La producción de leche al día 6 postparto fue de 1.95 L, incrementándose hasta alcanzar un máximo alrededor de 12 dpp con 2.31 L, disminuyendo posteriormente hasta 1.01 L a los 57 dpp.

646


Rev Mex Cienc Pecu 2021;12(2):644-652

Al dividir la curva de lactancia en cinco períodos de 9 días, se observó que en los dos primeros periodos (equivalentes a 18 dpp) no existe diferencia entre ellos (P>0.05). Sin embargo, en los siguientes periodos se observa una disminución (P<0.05) gradual; 15 % en el 3er periodo, 26 % en el 4to periodo y del 39 % en el 5to periodo con respecto a los 2 primeros. El peso promedio de las ovejas fue similar a lo largo de la lactancia (P>0.05), registrando 52.24 ± 1.19 y 52.00 ±1 .63 kg al parto y destete, respectivamente. En el análisis de regresión correspondiente (Figura 1), se observa una relación inversamente proporcional en el tiempo, ajustada a una línea de tendencia polinómica con r2=0.88; y=0.0003x2-0.0513x+2.1079 (P=0.0001). Figura 1: Curva de lactancia de ovejas Santa Cruz durante los primeros 60 Días post parto (media ± EE) (P≤0.001). Regresión polinómica

Durante la segunda semana de lactancia (Figura 2), el porcentaje de sólidos totales en la leche fue de 18 %, incrementando hasta el 20.5 % en la octava semana. En el análisis de regresión correspondiente se observa una relación proporcional en el tiempo, con r2=0.92; y=0.0993x2+1.1487x+17.276 (P=0.01).

647


Rev Mex Cienc Pecu 2021;12(2):644-652

Figura 2: Composición de la leche de ovejas de pelo de la raza Santa Cruz durante los primeros 60 días post parto (media ± EE) (P≤0.001)

El porcentaje de grasa en la leche durante la segunda semana fue de 8 % incrementándose hasta 9.8 % al final de la lactancia. El análisis de regresión confirma esta tendencia con una r2 = 0.61; y=-0.3929x2+2.8471x+5.32 (P=0.23). Los porcentajes de proteína y lactosa durante la segunda semana fueron de 4.86 y 4.68 % para proteína y lactosa, respectivamente. Al final de la lactancia los valores correspondientes fueron de: 5.18 % y 4.75 %. El análisis de regresión muestra muy poca fluctuación a lo largo de la lactancia para ambas variables. En el caso de proteína, se obtuvo una r2= 0.84; y=0.0029x2+0.0029x+4.672 (P=0.90), mientras que para lactosa la r2= 0.60; y= 0.1779x2– 1.0201x+5.83 (P=0.05). La producción láctea en ovejas Santa Cruz muestra un máximo a los 12 dpp, sin apreciarse un claro pico de lactancia para posteriormente disminuir paulatina y constante. En general, la máxima secreción de leche en las diferentes razas ovinas se produce entre la segunda y cuarta semanas de lactancia(17). En el caso de la Santa Cruz, este periodo de máxima producción coincide con hallazgos previos en ovejas Katahdin(7), así como los de ovejas Ile de France(18) y otras razas(19). Sin embargo, la cantidad de leche producida durante este mismo periodo en estas razas cárnicas fue mayor en Santa Cruz (2.33 L/día) en comparación con las razas antes mencionadas (1.38, 0.50 y 0.43, respectivamente), resaltando la alta producción de leche en las razas de pelo(20) en comparación con la información de razas cárnicas de origen europeo. En el único estudio encontrado por los autores que caracteriza la producción de leche a lo largo de la lactancia en ovejas Santa Cruz(7), tampoco les fue posible identificar un pico máximo de producción láctea. Situación que podría deberse al alto contenido

648


Rev Mex Cienc Pecu 2021;12(2):644-652

energético que se proporcionó en la dieta de estos trabajos(21-23), considerando que se ofreció el mismo alimento concentrado, variando únicamente el forraje (alfalfa+paja de sorgo vs ensilado de maíz), ofrecido en ambos casos a libre demanda. En la composición química de la leche de las ovejas Santa Cruz, los porcentajes de sólidos totales y grasa incrementaron al final de la lactancia. Lo anterior resulta lógico debido a que en general, al disminuir la producción láctea, se concentran los sólidos totales y la grasa, situación observada en otras razas(24), incluyendo las especializadas en la producción de leche(25-26), lo que a su vez, se asocia con leches de menor calidad(27). Por otra parte, llama la atención que, en el presente experimento, los porcentajes de proteína y lactosa se mantuvieron constantes a través del tiempo, lo que, dada la disminución total de leche conforme avanza la lactación, significarían un incremento de estas sustancias conforme avanza el tiempo. Esto podría ser una ventaja importante en las características nutricionales de la leche de esta raza. Sin embargo, se recomienda realizar mayor investigación con el fin de confirmar este hallazgo. La mayor concentración de proteína y lactosa en la leche podría deberse a que las ovejas tropicales viven en condiciones húmedas, lo que reduce los requerimientos de agua de las crías a través de la leche. Una situación inversa se ha encontrado en otras especies que habitan climas desérticos, donde la cantidad de agua en la leche se incrementa(27). Por otra parte, las razas tropicales son más ligeras que las europeas, por lo que menores requerimientos de mantenimiento, podrían permitir destinar mayor cantidad de nutrientes para una mejor calidad de leche(19). Se concluye que la producción de leche en ovejas Santa Cruz, alcanza su máximo alrededor de la segunda semana de lactancia, disminuyendo a partir de ese momento, de manera constante y paulatina, incrementando los porcentajes de sólidos totales y grasa a través del tiempo, mientras que los de proteína y lactosa se mantienen constantes. Conflicto de intereses Los autores declaran no tener conflicto de intereses en relación con el presente trabajo. Agradecimientos Se agradece al CONACyT por la beca otorgada para la realización de los estudios de doctorado en Ciencias Agropecuarias y Desarrollo Rural a la MC Ingrid Merchant Fuentes con número de becario: 410994.

649


Rev Mex Cienc Pecu 2021;12(2):644-652

Literatura citada: 1. Quintanilla-Medina JJ, González-Reyna A, Hernández-Meléndez J, Limas-Martínez AG, Carreón-Pérez A, Martínez-González JC. Producción de ovinos de pelo bajo condiciones de pastoreo en el noreste de México. Rev Invest Vet Peru 2018;(29):544– 551. 2. FAOSTAT. Estadísticas | FAO | Organización de las Naciones Unidas para la Alimentación y la Agricultura. División de las Estadísticas de la Organización de las Naciones Unidas para la Alimentación (FAO). 2013. 3. Banchero GE, Quintans G, Milton JT, Lindsay DR. Alimentación estratégica para mejorar la lactogénesis de la oveja al parto. Seminario de actualización técnica: Reproducción Ovina. INIA 2005;(33 Tacuarembó):127–136. 4. Millanao I, Herdener N, Parada D, Sepúlveda N. Producción de leche , curvas de lactancia y crecimiento de sus corderos, en dos razas de ovejas en la región de la Araucanía Chile. Sitio Argentino Prod Anim 2007;(APPA-ALPA):1–4. 5. Godfrey RW, Gray ML, Collins JR. Lamb growth and milk production of hair and wool sheep in a semi-arid tropical environment. Small Ruminant Res 1997;(24):77–83. 6. Peniche-Gonzalez I, Sarmiento-Franco L, Santos-Ricalde R. Estimation of milk production in hair ewes by two methods of measurement. Rev MVZ Córdoba 2015;(20):4629–4635. 7. Burgos-González C, Huerta-Aparicio M, Aguirre V, Vazquez R, Orihuela A, Pedernera M. Short communication : Milk production and lamb development in Saint Croix and Katahdin hair sheep breeds (Ovis aries). Trop Anim Health Prod 2017;(3):683-687. 8. Ünal N, Akçapinar H, Atasoy F, Yakan A, Uǧurlu M. Milk yield and milking traits measured with different methods in Bafra sheep. Rev Med Vet (Toulouse). 2008;(159):494–501. 9. Araujo RC, Pires AV., Susin I, Mendes CQ, Rodrigues GH, Packer IU, et al. Milk yield, milk composition, eating behavior, and lamb performance of ewes fed diets containing soybean hulls replacing coastcross (Cynodon species). J Anim Sci 2008;(86):3511– 3521. 10. Peniche-Gonzalez I, Sarmiento-Franco LA, Santos-Ricalde RH. Utilization of Mucuna pruriens whole pods to feed lactating hair ewes. Trop Anim Health Prod 2018;(7):14551461. 11. Notter DR. Effects of ewe age and season of lambing on prolificacy in US Targhee, Suffolk, and Polypay sheep. Small Ruminant Res 2000;(38):1–7.

650


Rev Mex Cienc Pecu 2021;12(2):644-652

12. Sánchez-Dávila F, Bernal H, Colín J, Olivares E, del Bosque AS, Ledezma R, et al. Environmental factors and interval from the introduction of rams to estrus in postpartum Saint Croix sheep. Trop Anim Health Prod 2011;(43):887–891. 13. Nutrient requirements of small ruminants; Sheep, goats, cervids, and new world camelids. Animal Nutrition Series, National Research Council of the National Academies. 2007. 14. Velasco S, Cañeque V, Díaz MT, Pérez C, Lauzurica S, Huidobro F. Producción lechera y composición lipídica de la leche de ovejas Talaveranas durante el período de lactancia. Investig Agrar Prod y Sanid Anim 2001;(16):182–192. 15. ISO. Determination of milkfat, protein and lactose content. 1999. 16. SAS. Proceedings of the Twenty Eighth Annual SAS Users Group International Conference. SAS Instit. Cary, NC; 2003. 17. Church D. Alimentos y alimentación del ganado. 2da ed. Montevideo, Uruguay; 1989. 18. Lopes-Zeola BNM, da Silva-Sobrinho GA, Hatsumura CT, Borghi TH, Viegas CR, Barbosa JC. Production, composition and processing of milk from ewes fed soybean seeds. Rev Bras Zootec 2015;(44):146–154. 19. De Souza-Emediato RM, Ramos-De Siqueira E, De Melo-Stradiotto M, Maestá SA, Gonçalves HC. Desempenho de ovelhas da raça Bergamácia alimentadas com dieta contendo gordura protegida. Rev Bras Zootec 2009;(38):1812–1818. 20. Forcada F, Thos J, Lopez M, Sierra I. Producción de leche de la raza Rasa Aragonesa en la fase de amamantamiento del cordero. Actas IX Jornadas SEOC 1984:161–164. 21. Resksupaphon J. Nutritional effects on mammary development and milk production: effects of prepartum protein supplements [Master thesis]. Universiy of New England; 1996. 22. Ripoll-Bosch R, Álvarez-Rodríguez J, Blasco I, Picazo R, Joy M. Producción de leche y crecimiento de corderos en la raza Ojinegra de Teruel. Inf Téc Económ Agrar 2012;(108):298–311. 23. Manterola H, Cerda D, Mira J, Pavlic A. Producción y composición de la leche en ovejas Merino precoz, Suffolk y Suffolk x Merino. Adv Prod Anim 2007;(32):59–70. 24. Pulina G, Nudda A. La produzione del latte. In: Pulina G, editor. L’alimentazione degli ovini da latte. Avenue Media, Bologna, Italy; 2001:9-31. 25. Bencini R, Pulina G. The quality of sheep milk: a review. Aust J Exp Agric 1997;(37):485–504.

651


Rev Mex Cienc Pecu 2021;12(2):644-652

26. Pulina G, Macciotta N, Nudda A. Milk composition and feeding in the Italian dairy sheep. Ital J Anim Sci 2005;(4 Suppl. 1):5–14. 27. Hinde K, Milligan LA. Primate milk: Proximate mechanisms and ultimate perspectives. Evol Anthropol 2011;(20):9–23.

652


https://doi.org/10.22319/rmcp.v12i2.5635 Nota de investigación

Optimización de un protocolo de extracción de ADN a partir de sangre bovina hemolizada y coagulada para la detección molecular de Anaplasma spp.

Tomás Humberto Landázuri Rafael a,b Andrés Carrazco a Renato León a Lenin Vinueza c Verónica Barragán a*

a

Universidad San Francisco de Quito. Colegio de Ciencias Biológicas y Ambientales, Campus Cumbayá, Diego de Robles s/n, 170901. Quito, Ecuador. b

Pontificia Universidad Católica del Ecuador. Facultad de Ciencias Exactas y Naturales. Quito, Ecuador. c

Universidad San Francisco de Quito. Colegio de Ciencias de la Salud, Escuela de Medicina Veterinaria. Quito, Ecuador.

*Autor de correspondencia: vbarragan@usfq.edu.ec

Resumen: La anaplasmosis es una enfermedad que puede afectar de manera significativa a la producción en el sector pecuario. Para la detección molecular por PCR de Anaplasma spp., se requiere de una extracción eficiente de ADN a partir de sangre completa, lo que a su vez depende de la calidad de la muestra de sangre. Fallas en los procedimientos de muestreo o conservación de las muestras pueden ocasionar hemolisis y coagulación de la sangre, lo que a su vez puede obstaculizar el diagnóstico. El objetivo de esta investigación fue optimizar un protocolo casero de bajo costo que utiliza resina de Chelex® 100 y permite detectar de manera eficiente a Anaplasma spp. en 30 muestras de sangre bovina hemolizada y coagulada. La eficiencia del protocolo optimizado se comparó con dos kits comerciales de extracción de ADN mostrando una alta concordancia (Kappa de Cohen = 0.72) en la detección molecular de Anaplasma spp. por PCR. Se recomienda esta 653


Rev Mex Cienc Pecu 2021;12(2):653-664

metodología para superar las limitaciones de investigación que pueden surgir al extraer ADN a partir de muestras de sangre complejas. Palabras clave: Anaplasma, Anaplasmosis, Detección molecular, Extracción de ADN, Chelex® 100, Sangre.

Recibido: 09/03/2020 Aceptado: 10/08/2020

La anaplasmosis es una enfermedad reconocida por su impacto mundial en el área de la salud y el sector pecuario(1,2). La enfermedad es causada por bacterias del género Anaplasma, que en ganado bovino se presenta como una enfermedad debilitante que en ciertos casos puede llegar a ser mortal. La presencia de anaplasmosis puede producir pérdidas económicas en el sector ganadero por disminución de la producción lechera, retraso en el crecimiento y baja en la ganancia de peso de los animales(3,4). Es importante recalcar que el verdadero impacto económico de la anaplasmosis bovina no es posible de determinar debido a la falta de datos epidemiológicos en países latinoamericanos(5). El manejo de la enfermedad se vuelve complejo por la existencia de portadores asintomáticos del patógeno, los cuales actúan como reservorios, contribuyen a la propagación e incrementan el riesgo de contagio para las poblaciones ganaderas susceptibles a la enfermedad(5). Para la detección de Anaplasma spp., la reacción en cadena de la polimerasa (PCR) muestra mayor especificidad y sensibilidad en comparación con métodos convencionales como el cultivo, la serología y microscopía óptica(6,7). Además, la probabilidad de que ocurra detección cruzada de otros hemoparásitos al utilizar PCR es mínima(6). Un paso previo e importante para realizar la detección de un patógeno por PCR es la extracción del ADN a partir de muestras clínicas, es por esto que la eficiencia de la extracción de ADN es primordial para obtener resultados confiables y repetibles. Idealmente, para detectar Anaplasma spp. por PCR, se utiliza una muestra de sangre completa, esto es debido a la capacidad que tiene este género para parasitar diferentes células sanguíneas(7). Sin embargo, diversos elementos de la sangre o fallas en el muestreo, transporte o conservación de las muestras pueden dar lugar a cambios que dificulten la extracción del material genético o inhiban la reacción de PCR(8,9). Es así que en muchas ocasiones se puede observar alteraciones en la homogeneidad de las muestras, así como también la aparición de hemólisis y de coágulos, lo que dificulta la lisis celular y liberación del material genético durante su extracción. Así mismo, la sangre hemolizada contiene una mayor concentración de hemoglobina y sus derivados, lo que puede comprometer la eficacia diagnóstica de la PCR. Por esta razón, la sangre hemolizada y coagulada es generalmente descartada para las pruebas de detección molecular.

654


Rev Mex Cienc Pecu 2021;12(2):653-664

Actualmente, existen diversos kits de extracción de ADN de diferentes casas comerciales que han sido diseñados para obtener ADN de alta calidad, pero de baja concentración(10), a partir de muestras complejas o de mala calidad como la sangre coagulada y hemolizada(11). Sin embargo, su elevado costo limita su uso en investigaciones de bajo presupuesto, situación muy frecuente en países en vías de desarrollo. El método de extracción de ADN con resina de Chelex® 100 es sencillo y barato de ejecutar, por lo tanto, es utilizado en una gran variedad de tejidos(12,13). Este método empieza con un tratamiento térmico o si es necesario la maceración del tejido, con el objetivo de lisar las células y liberar el ADN. Luego, la resina de Chelex® 100 actúa como quelante al capturar los iones de magnesio y como consecuencia evita la degradación del ADN debido a la acción de las nucleasas(12). El protocolo con resina de Chelex® 100 presentado por Singh et al(14) se destaca por obtener eficientemente ADN de alta cantidad y pureza. Este protocolo está diseñado para sangre seca en papel filtro, su uso no ha sido descrito para otro tipo de muestras. Es así como el presente estudio busca optimizar dicho protocolo de extracción de ADN a partir de muestras de sangre bovina hemolizada y coagulada, con el fin de que sea utilizado para la detección molecular de patógenos en animales, específicamente de Anaplasma spp. en bovinos. Se utilizaron 40 muestras de sangre que fueron colectadas en septiembre de 2018 dentro de un proyecto más amplio denominado “Planes de Finca”(15) que es impulsado por el Gobierno Autónomo Descentralizado de la Provincia de Esmeraldas (GADPE) y el Instituto Interamericano de Cooperación para la Agricultura (IICA), con la participación de la Universidad San Francisco de Quito. Las muestras provienen de bovinos mestizos Bos taurus, con al menos 50 garrapatas en su cuerpo, a los que se les extrajo 5 ml de sangre de vena coccígea o yugular en tubos con anticoagulante. Las muestras se mantuvieron en refrigeración a 4-5 °C hasta llegar al laboratorio del Hospital Veterinario Docente de la Universidad San Francisco de Quito, en donde se congelaron hasta su procesamiento. Al descongelar las muestras, se confirmó que éstas estaban hemolizadas y con coágulos de pequeño o mediano tamaño. Se realizó la extracción de ADN en un subgrupo de 10 muestras con estas características y a las que previamente se les había confirmado positividad para Anaplasma sp. Para el análisis se utilizó el protocolo diseñado por Singh(14). Debido a que este protocolo de extracción de ADN fue diseñado para muestras de sangre seca en papel filtro, se realizó un ensayo con diferentes volúmenes de sangre (5 µl, 50 µl y 100 µl). Un resumen del protocolo de Singh et al(14) se puede encontrar en el Cuadro 1. Adicionalmente, para mejorar la pureza del ADN obtenido con el volumen de muestra definido en el procedimiento anterior, se adicionaron pasos al protocolo, específicamente a la fase de precipitación de proteínas. Dichos pasos se detallan a continuación: a) añadir alcohol al 75 % en proporción 1:1 con el volumen de sobrenadante recuperado en el paso 10; b) dejar reposar durante una noche a -20 oC por aproximadamente 16 h; c) centrifugar la mezcla a 13,000 rpm por 1.5 min; d) recuperar el sobrenadante; e) realizar el paso 11 según el Cuadro 1

655


Rev Mex Cienc Pecu 2021;12(2):653-664

Cuadro 1: Protocolo de extracción de ADN según Singh et al(14) Extracción de ADN 1. Calentar a 100 oC, 300 µl de solución stock de resina de Chelex® 100 al 7% por 10 min. 2. Añadir 5 μl de sangre y calentar la mezcla por 8 min a 100 oC. 3. Mezclar con la ayuda de un vórtex por 15 s y recalentar por 7 min a 100 oC. 4. Centrifugar por 1.5 min a 12,000 rpm. 5. Recuperar el sobrenadante y descartar el pellet. Precipitación de Proteínas 6. Añadir solución stock de acetato de amonio (7.5 M) al sobrenadante recuperado previamente de forma que la solución final tenga una concentración de 2.5 M 7. Reposar la mezcla por 5 min en hielo. 8. Mezclar con la ayuda de un vórtex por 10 seg. 9. Centrifugar por 13,000 rpm por 10 min a - 4 oC. 10. Recuperar el sobrenadante en un tubo nuevo. Precipitación de ADN 11. Añadir solución stock de acetato de sodio (3 M) al sobrenadante recuperado de forma que la solución final tenga una concentración de 0.3 M. 12. Añadir 200 µl de alcohol absoluto. 13. Mezclar con la ayuda de un vórtex por 5 seg. 14. Reposar la mezcla por 4 h a -20 oC. 15. Centrifugar a 13,000 rpm por 10 min a -4 oC. Descartar sobrenadante. 16. Lavar el pellet dos veces: la primera vez con 200 µl alcohol 75 % helado y la segunda vez con 200 µl alcohol 100 % helado. Cada lavado fue seguido por una centrifugación a 13,000 rpm por 10 min a -4 oC y el descarte del sobrenadante. 17. Dejar secar el pellet al aire por 10 min. 18. Resuspender en 100 µl de 1X AE 19. Incubar por 10 min a 55 oC.

656


Rev Mex Cienc Pecu 2021;12(2):653-664

Se comparó la cantidad y pureza del ADN entre el protocolo original y el que contenía modificaciones en la fase de precipitación de proteínas. La concentración y calidad del ADN de las muestras se midieron por espectrofotometría en un NanoVue Plus Spectrophotometer (GE Healthcare, USA). El análisis molecular de este estudio fue realizado bajo el Contrato Marco de Acceso a los Recursos Genéticos Nro. MAE-DNBCM-2018-0106. Para demostrar la eficiencia de las modificaciones realizadas al protocolo de Singh(14), se extrajo ADN de 30 muestras de sangre hemolizada y coagulada de las que se desconocía su positividad para Anaplasma spp. La extracción de ADN fue realizada utilizando el protocolo de Singh modificado en las secciones anteriores y al que en adelante se le llamará Protocolo de Chelex Modificado (PCM). El ADN de las mismas muestras fue extraído con los kits comerciales DNeasy Blood & Tissue Kits Print Qiagen® y AccuPrep® Genomic DNA Extraction Kit Bioneer®, siguiendo las recomendaciones del fabricante para extracción de ADN a partir de sangre completa. Para confirmar la utilidad del PCM en la detección molecular de Anaplasma spp. se realizó una reacción de PCR específica para este género bacteriano detallado por Zobba et al(16). Los amplicones obtenidos a partir de 13 muestras positivas (n= 40) fueron secuenciados en Functional Biosciences, Inc. (Wisconsin-USA) para confirmar la presencia de ADN de Anaplasma sp. También, se utilizó el gen constitutivo que codifica para la proteína β-Actina, siempre presente en las muestras de sangre bovina(17) para descartar la posibilidad de obtener falsos negativos debido a la inhibición de la reacción de PCR. El detalle de los cebadores y el tamaño del producto de ambas reacciones de PCR están detallados en el Cuadro 2. Cuadro 2: Secuencias de cebadores utilizados en este estudio Gen 16S rDNA

Cebador

AnaplsppF AnaplR3 XAHR 17 β-actina XAHR 20

Secuencia: 5’ – 3’ AGAAGAAGTCCCGGCAAACT GAGACGACTTTTACGGATTAGCTC CGGAACCGCTCATTGCC ACCCACACTGTGCCCATCTA

Tamaño Ref. 800 bp

(18)

289 bp

(19)

Todas las pruebas estadísticas se realizaron con un nivel de significancia del 95 % con el software R v.3.3.0(18). Se realizó la prueba de normalidad de Shapiro-Wilks y pruebas no paramétricas para el análisis de los datos del estudio. Para determinar las diferencias en la cantidad de ADN obtenida entre los volúmenes de sangre (5 µl, 50 µl y 100 µl), se utilizó la prueba de Friedman y análisis post-hoc de Wilcoxon; los valores de P fueron ajustados con la corrección de Bonferroni(19). La pureza de ADN, de los ensayos de precipitación de proteínas, se comparó con la prueba no paramétrica Wilcoxon. La concordancia de los resultados de PCR entre los tres métodos de extracción fue determinada con la prueba Kappa de Cohen y la prueba McNemar(20,21).

657


Rev Mex Cienc Pecu 2021;12(2):653-664

El protocolo de Singh(14), se utilizó en 10 muestras de sangre hemolizada y coagulada. Para definir el volumen de muestra se probaron 5 µl, 50 µl y 100 µl de sangre líquida de cada muestra. Los resultados mostraron que la concentración de ADN difiere entre los volúmenes de sangre utilizados (Test de Friedman: χ2(2) = 16.800, P=0.017) (Figura 1), excepto entre 50 µl y 100 µl de muestra (Wilcoxon: Z= -2,293, P= 0.063). Por lo que, para los siguientes pasos, se utilizó 50 µl de muestra, con la intención de utilizar el volumen más bajo. Figura 1: Concentración de ADN (ng/µl) obtenida a partir de diferentes volúmenes de sangre (n=10)

Se utilizó el método de extracción de ADN publicado por Singh et al(14) (χ2(2) = 16,800; P=0.017*).

La pureza del ADN extraído con el protocolo publicado por Singh et al(14), a partir de las muestras de sangre coagulada y hemolizada, arrojó un radio mediano entre A260/280 de 0,820 (n=10). Al modificar la fase de precipitación de proteínas en el protocolo PCM se logró incrementar el radio mediano entre A260/280 a 1,970 (n=10). En comparación al protocolo original, el PCM permite obtener un incremento significativo en los rangos 260/280 (Wilcoxon: Z= -2,803, P=0.005) y 260/230 (Wilcoxon: Z= -2,666, P=0.002) respectivamente (Figura 2). Es importante mencionar que la concentración de ADN en estas muestras disminuyó significativamente (Wilcoxon: Z= -2,803, P=0.005) en relación a la obtenida con el protocolo original. Sin embargo, esto no interfirió en la detección molecular de Anaplasma spp. en ninguna de las muestras. Adicionalmente, se observó que las bandas inespecíficas, observadas al amplificar las muestras extraídas con el protocolo original, desaparecían al utilizar el PCM.

658


Rev Mex Cienc Pecu 2021;12(2):653-664

Figura 2: Comparación de A. pureza y B. cantidad de ADN obtenida con el protocolo de extracción de ADN de Singh et al(14) con el PCM (n=10).

El ADN de 30 muestras de sangre coagulada y hemolizada fue extraído con dos kits comerciales y con PCM. No se observó inhibición de la reacción de PCR en las muestras de ADN obtenidas con los tres métodos de extracción. Además, se obtuvieron resultados equivalentes para la presencia de Anaplasma spp. (Cuadro 3) con índices de concordancia Kappa de Cohen de 0.72 entre el protocolo PCM y los dos kits comerciales. La prueba exacta de McNemar determinó que no existe diferencia significativa en la proporción de muestras positivas por PCR entre los kits y el protocolo PCM (McNemar's Ji-cuadrada 0.500; P=0.5)

659


Rev Mex Cienc Pecu 2021;12(2):653-664

Cuadro 3: Resultados de positividad de Anaplasma spp. en muestras de sangre extraída con diferentes métodos (n=30) Kit Qiagen Kit Bioneer Positivos Negativos Positivos Negativos PCM Positivos 25 0 25 0 Negativos 2 3 2 3 PMC= Protocolo de Chelex modificado.

La anaplasmosis bovina es una enfermedad que tiene impacto negativo sobre el sector pecuario(1,2). Esta enfermedad es causada por especies del género Anaplasma y produce anemia, debilidad, reducción en el crecimiento y en la producción lechera, abortos e incluso puede producir la muerte en ganado bovino infectado(22). Desafortunadamente, en países de América Latina y el Caribe se desconoce la verdadera prevalencia de anaplasmosis en ganado bovino. Esta situación se agrava debido a que el 80 % de los productores ganaderos de estos países son pequeños agricultores familiares que viven en zonas rurales y marginales(23). En estas zonas, la vacunación y control de las enfermedades infecciosas se encuentran limitados a la disponibilidad de recursos económicos, que en la mayoría de casos son escasos(24). Esto es relevante en países en vías de desarrollo, en el que los insumos de laboratorio pueden costar de 2 a 10 veces más que en países desarrollados(25). Como consecuencia, es importante contar con técnicas que permitan detectar con precisión la presencia de Anaplasma spp. y que al mismo tiempo sean asequibles, tanto para las entidades de control como para los pequeños y grandes ganaderos. La detección molecular de patógenos por PCR a partir de muestras clínicas se ha convertido en una metodología muy utilizada para el diagnóstico y monitoreo de enfermedades infecciosas(26). Esta técnica también permite la posterior caracterización del patógeno mediante la secuenciación de su material genético, información que puede ser de gran utilidad para entender la epidemiología de una enfermedad. Un paso muy importante, previo a la detección molecular, es la extracción del material genético a partir de las muestras. Este procedimiento está estrechamente relacionado a la colección, transporte y almacenamiento de las muestras. Todos estos pasos deben asegurar que el material genético del patógeno permanezca intacto hasta que se lleve a cabo el procedimiento de extracción. Desafortunadamente, las condiciones no siempre son idóneas, por ejemplo, cuando se necesita obtener muestras de animales que viven en áreas rurales de difícil acceso, es complicado asegurar una óptima toma y conservación de la muestra. En dichas condiciones es muy frecuente que las muestras muestren hemolisis y coágulos, lo que dificulta su posterior análisis al inhibir la reacción de detección molecular del patógeno. Los resultados demuestran que las modificaciones adicionadas al protocolo de extracción de ADN(14) permiten obtener ADN, a partir de sangre hemolizada y coagulada, que puede ser utilizado para la detección molecular de Anaplasma spp. Al extraer ADN a partir de

660


Rev Mex Cienc Pecu 2021;12(2):653-664

50 µl de muestra con el PCM, se observó que los valores de pureza, en los radios 260/280 y 260/230, eran superiores en comparación a los resultados obtenidos con el protocolo publicado por Singh(14). Una limitación del protocolo modificado es la baja cantidad de ADN que se obtiene en relación con los kits comerciales, sin embargo, no se encontraron diferencias significativas entre la positividad de Anaplasma spp. obtenida a partir del ADN extraído con PCM y los kits comerciales utilizados. Así mismo, el índice de concordancia Kappa de 0.72 indica que existe una alta concordancia más allá del azar entre los resultados obtenidos con los métodos de extracción(20). Es así que la estandarización del volumen de sangre y la modificación al protocolo de referencia(14), permitieron tener resultados equivalentes entre la extracción del material genético con PMC y los kits comerciales. En el futuro, sería interesante probar este método de extracción para la detección de otros patógenos que pueden encontrarse en la sangre de bovinos y de otros animales. Adicionalmente, el protocolo modificado permite obtener ADN de Anaplasma spp. a partir de muestras de sangre bovina a un costo considerablemente menor al de los kits comerciales. Para ilustrar esto, se consideraron los valores de los reactivos a proveedores autorizados en el Ecuador. Es así que, para extraer ADN a partir de 250 muestras, tomando en cuenta todos los reactivos utilizados para el PCM, se requiere alrededor de 60 dólares americanos. En contraste con el costo de los kits comerciales utilizados en esta investigación, que llega a ser hasta 10 veces mayor: Bionner® y Qiagen® para 250 reacciones el costo es aproximadamente $600 y $2,000 respectivamente, sin contar con el precio del equipo automatizado necesario para utilizar el kit de Bionner®. La mayoría de reactivos que se utilizan para realizar investigación en países como Ecuador, Colombia, México, entre otros, no son fabricados en Latinoamérica. Debido a esto, los valores de importación y de comisiones de los proveedores locales incrementan enormemente el costo de análisis de muestras. Lamentablemente, la falta de dinero es la mayor limitante para realizar estudios de investigación en nuestros países. Por lo tanto, es importante ser creativos y buscar métodos confiables que abaraten los costos de investigación y el monitoreo de enfermedades infecciosas. Solo así se podrá entender la epidemiología de estas enfermedades, y como consecuencia aplicar planes control/monitoreo efectivos, que beneficien a la producción animal y a las comunidades humanas expuestas. Esta investigación adapta un protocolo de bajo costo que utiliza resina de Chelex® 100 para la extracción de ADN a partir de sangre hemolizada y coagulada. Este protocolo permite obtener ADN a partir del cual se puede realizar la detección molecular de Anaplasma spp. por PCR con resultados equivalentes a los obtenidos con kits comerciales. El protocolo propuesto es ideal para realizar monitoreo de Anaplasma spp. en bovinos con un presupuesto limitado. Es importante generar protocolos alternativos de bajo costo para la detección y análisis molecular de patógenos, que permitirán realizar investigación con menores recursos, principalmente en países en vías de desarrollo. De esta manera se podrán generar resultados actualizados para que las autoridades del sector 661


Rev Mex Cienc Pecu 2021;12(2):653-664

ganadero y de salud pública actúen de manera eficaz e informada. Tomando en cuenta las ventajas económicas que presenta el Protocolo de Chelex Modificado (PCM), sugerimos comprobar su utilidad para la detección de otros patógenos y su eficiencia de extracción en otros tipos de muestra. Agradecimientos Esta investigación fue posible gracias al apoyo del Gobierno Autónomo Descentralizado de la Provincia de Esmeraldas (GADPE) e Instituto Interamericano de Cooperación para la Agricultura (IICA). El financiamiento se realizó con fondos de Investigación del Colegio de Ciencias Biológicas-USFQ (2019-2020) otorgados a Verónica Barragán y con fondos de Investigación de la Escuela de Medicina Veterinaria-USFQ (2017-2018) otorgados a Lenin Vinueza. La publicación de este artículo fue financiada por el Fondo para Publicación de Artículos Académicos de la Universidad San Francisco de Quito USFQ. Agradecemos a Fernanda Loaiza por sus sugerencias técnicas al inicio de esta investigación. Conflictos de interés Los autores declaran no tener ningún conflicto de interés. Literatura citada: 1.

Reyna-bello A. Anaplasma marginale: Logros y retos. En: González C, Madrid N, Soto E, editores. Logros y desafíos de la ganadería doble propósito. Maracaibo, Venezuela: Ediciones Astro Data SA; 2014:388-395.

2.

OIE. Organización mundial de sanidad animal. Terrestrial manual-Bovine Anaplasmosis: 2018. https://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/3.04.01_BOVINE _ANAPLASMOSIS.pdf.

3.

Goodger WJ, Carpenter T, Riemann H. Estimation of economic loss associated with anaplasmosis in California beef cattle. J Am Vet Med Assoc 1979;174(12):1333– 1336.

4.

Jonsson NN, Bock RE, Jorgensen WK. Productivity and health effects of anaplasmosis and babesiosis on Bos indicus cattle and their crosses, and the effects of differing intensity of tick control in Australia. Vet Parasitol 2008;155(2):1–9.

5.

Rodríguez RI, Grisi L, Pérez de León A, Silva H, Torres JF, Fragoso H, et al. Potential economic impact assessment for cattle parasites in Mexico. Review. Rev Mex Cienc Pecu 2017;8(1):61-74.

6.

Aubry P, Geale DW. A review of bovine anaplasmosis. Transbound Emerg Dis 2011;58(1):1–30.

662


Rev Mex Cienc Pecu 2021;12(2):653-664

7.

Silaghi C, Santos AS, Gomes J, Christova I, Matei IA, Walder G, et al. Guidelines for the direct detection of Anaplasma spp. in diagnosis and epidemiological studies. Vector-Borne Zoonotic Dis 2017;17(1):12–22.

8.

Al-Soud WA, Rådström P. Purification and characterization of PCR-inhibitory components in blood cells. J Clin Microbiol 2001;39(2):485–493.

9.

Sidstedt M, Hedman J, Romsos EL, Waitara L, Wadsö L, Steffen CR, et al. Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and realtime PCR. Anal Bioanal Chem 2018;410(10):2569–2583.

10. Ghaheri M, Kahkrizi D, Yari K, Babaie A, Suthar RS, Kazemi E. A comparative evaluation of four DNA extraction protocols from whole blood sample. Cell Mol Biol 2016;62(3):119-123. 11. Smith K, Diggle MA, Clarke SC. Comparison of commercial DNA extraction kits for extraction of bacterial genomic DNA from whole-blood samples. J Clin Microbiol 2003;41(6):2440–2443. 12. Polski JM, Kimzey S, Percival RW, Grosso LE. Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100. J Clin Pathol Mol Pathol 1998;51(4):215–217. 13. Walsh PS, Metzger DA, Higushi R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques 2013;54:134– 139. 14. Singh UA, Kumari M, Iyengar S. Method for improving the quality of genomic DNA obtained from minute quantities of tissue and blood samples using Chelex 100 resin. Biol Proced Online 2018;20:12. 15. IICA. Instituto Interamericano de Cooperación para la Agricultura. Planes de Fincas Ganaderas en Esmeralda, Ecuador: 2017: https://repositorio.iica.int/handle/11324/8410. 16. Zobba R, Anfossi AG, Parpaglia MLP, Dore GM, Chessa B, Spezzigu A, et al. Molecular investigation and phylogeny of Anaplasma spp. in mediterranean ruminants reveal the presence of neutrophil-tropic strains closely related to A. platys. Appl Environ Microbiol 2014;80(1):271–280. 17. Du Breuil RM, Patel JM, Mendelow BV. Quantitation of β-actin-specific mRNA transcripts using xeno-competitive PCR. Genome Res 1993;3(1):57–59. 18. R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. 2020. URL http://www.Rproject.org/.

663


Rev Mex Cienc Pecu 2021;12(2):653-664

19. McLaughlin MJ, Sainani KL. Bonferroni, holm, and hochberg corrections: Fun names, serious changes to P values. PM R 2014;6(6):544–546. 20. McHugh ML. Interrater reliability: The kappa statistic. Biochem Medica 2012;22(3):276–282. 21. Sánchez-Otero J. Introducción a la estadística no paramétrica y al análisis multivariado. Quito, Ecuador: Giro Creativo; 2016:12-13. 22. Suarez CE, Noh S. Emerging perspectives in the research of bovine babesiosis and anaplasmosis. Vet Parasitol 2011;180(2):109–125. 23. FAO. Ganadería de América Latina y el Caribe puede jugar rol clave en el logro de los Objetivos de Desarrollo Sostenible. 2016. http://www.fao.org/americas/noticias/ver/es/c/421098/. 24. Donadeu M, Nwankpa N, Abela-Ridder B, Dungu B. Strategies to increase adoption of animal vaccines by smallholder farmers with focus on neglected diseases and marginalized populations. PLoS Negl Trop Dis 2019;13(2). 25. Rodríguez V. La investigación científica en Ecuador es cinco veces más cara por costos de reactivos y equipos. 2019. https://www.primicias.ec/noticias/tecnologia/investigacion-cientifica-ecuadorcuesta-cinco-veces-mas/. 26. Dong J, Ismail N, Walker DH. Molecular testing in emerging infectious diseases. En: Coleman W, Tsongalis G, editores. Diagnostic molecular pathology. Londres, Reino Unido: Elsevier Academic Press; 2016:179–200.

664


Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 12 Núm 2, pp. 318-664, ABRIL-JUNIO-2021

ISSN: 2448-6698

CONTENIDO CONTENTS Pags. Efecto de la pasteurización en la concentración de diclorodifeniltricloroetano (DDT) y hexaclorociclohexano (HCH) en leche de bovino

Effect of pasteurization on the concentration of dichlorodiphenyltrichloroethane (DDT) and hexachlorocyclohexane (HCH) in bovine milk Violeta Trinidad Pardío Sedas, Karla María López Hernández, Argel Flores Primo, Roxana Uscanga Serrano…........….....….………..…………..…………..…………..…………..…………..……………………………………...…………...318

Traditional ranchero Jarocho cheese: a multidisciplinary study from a typicity approach

El queso tradicional ranchero Jarocho: un estudio multidisciplinario aplicando un enfoque de la tipicidad José Manuel Juárez-Barrientos, Pablo Díaz-Rivera, Emmanuel de Jesús Ramírez-Rivera, Jesús Rodríguez-Miranda, Cecilia Eugenia Mar nez-Sánchez, Roselis Carmona-García, Erasmo Herman-Lara…………………….……………….…………….……………..….……………………………..…………..…………..…………..…………..………..……..…………….353

Efecto de alimentación húmeda de cerdos en finalización sobre el comportamiento productivo, composición de la canal y calidad de la carne

Effect of wet feeding of finishing pigs on production performance, carcass composition and meat quality Néstor Arce Vázquez, Hugo Bernal Barragán, Nydia Corina Vásquez Aguilar, Estela Garza Brenner, Fernando Sánchez Dávila, Adriana Morales Trejo, Miguel Cervantes Ramírez..........……..…….....……………….370

Sperm subpopulations and quality in fractions obtained after single layer centrifugation in fresh normospermic ram samples

Subpoblaciones espermáticas y calidad en fracciones obtenidas tras la centrifugación de una sola capa en muestras frescas de carnero normospérmico Carlos Carmelo Pérez-Marín, Ander Arando, Francisco Maroto-Molina, Alberto Marín, Juan Vicente Delgado……………………………..............….…..………………………………………...………..…………..……………………….…386

Cowpea [Vigna unguiculata (L.) Walp] herbage yield and nutritional quality in cowpea-sorghum mixed strip intercropping systems

Rendimiento de la planta de frijol caupí [Vigna unguiculata (L.) Walp] y calidad nutricional en los sistemas de cultivo intercalado de frijol caupí y sorgo Muhammad Aamir Iqbal, Asif Iqbal, Zahoor Ahmad, Ali Raza, Junaid Rahim, Muhammad Imran, Umer Ayyaz Aslam Sheikh, Qaiser Maqsood, Walid Soufan, Nesma M.A. Sahloul, Sobhy Sorour, Ayman El Sabagh…..……………………………………………...……………………...……………………...……………………...……………………...……………………...……………………...…………………...……….402

Prevalencia del virus de la leucosis bovina en búfalos de agua en la región centro occidental de Colombia

Prevalence of bovine leukosis virus in water buffaloes in West-central Colombia Juan Carlos Rincón Flórez, Edgar Antonio Peláez Peláez, Nathaly Trejos Marín, Juan Carlos Echeverry López, Juan Carlos González Corrales……………………………………………………....………………………….…….….....419

Efecto del modelo y material de construcción de la caja y recubrimiento de los panales de cría en la termorregulación y desarrollo de colonias de Scaptotrigona mexicana

Effect of model and construction material of the brood box and brood comb coating on the thermoregulation and development of Scaptotrigona mexicana colonies Juan Antonio Pérez-Sato, Hugo Rodolfo Salazar-Vargas, Juan Valente Hidalgo-Contreras, Natalia Real-Luna, Héctor Debernardi-De La Vequia, Roberto De La Rosa-Santamaría …………………..……...………….....437

Análisis de la rentabilidad apícola por estratos en Aguascalientes, México

Analysis of beekeeping profitability by strata in Aguascalientes, Mexico José Inés Zavala Beltrán, Marco Andrés López San ago, Ramón Valdivia Alcalá, Blanca Margarita Mon el Batalla……………………………………….…………………………………………………………………..…………..………….....453

Tipología y caracterización de cunicultores en los Estados del centro de México

Type and characterization of rabbit farmers in Mexico's central states Alejandra Vélez Izquierdo, José Antonio Espinosa García, Francisco Aguilar Romero………………………..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..………………………..…………..… 469

Intracellular survival of Mycobacterium bovis strains with high and low frequency in cattle populations in a bovine macrophage model

Supervivencia intracelular de cepas de Mycobacterium bovis de alta y baja frecuencia probado en un modelo de macrófagos bovinos and Ovis canadensis (Artiodactyla: Bovidae) in three northern Mexican states Alejandro Nava-Vargas, Feliciano Milián-Suazo, Germinal Jorge Cantó-Alarcón, José A. Gu érrez-Pabello……………………………………..………………....…………………..…………..…………..…………..…………..…………....…....487

Genealogía y trayectoria artesanal del queso criollo en hoja de luna de Hidalgo, México

Genealogy and artisanal trajectory of the criollo cheese in cocoyam leaf of Hidalgo, Mexico Fernando Cervantes Escoto, María Isabel Palacios Rangel, Griselda Monroy Neria, Alfredo Cesín Vargas, Abraham Villegas de Gante……………………………………..……………………..…………………..……..…….........…..503

Revisiones de Literatura Índices de eficiencia alimenticia en ovinos de pelo: calidad de la carne y genes asociados. Revisión

Feed efficiency indexes in hair sheep: meat quality and associated genes. Review Carlos Arce-Recinos, Alfonso Juven no Chay-Canul, Baldomero Alarcón-Zúñiga, Jesús Alberto Ramos-Juárez, Luis Manuel Vargas-Villamil, Emilio Manuel Aranda-Ibáñez, Nathaly del Carmen Sánchez-Villegas, Ricardo Lopes Dias da Costa …………………………..……..……..……..……..……..……...……………………….........……..…523

Bioelectrical impedance analysis (BIA) in animal production. Review

Análisis de impedancia bioeléctrica (AIB) en la producción animal. Revisión Larissa Luísa Schumacher, Julio Viégas, Gilmar dos Santos Cardoso, Anderson Bertoluzzi Moro, Tiago João Tonin, Stela Naetzold Pereira, Leonardo Tombesi da Rocha, Ana Luiza Van Caeneghen, Janaína Vargas Teixeira………………..………………..……..……..……..……..……..……..……..……..……..……......……..……553

Notas de Investigación Chemical and biological additives in high moisture triticale silages: Nutritional value and ingestive behavior in sheep

Ensilajes de triticale de alta humedad con aditivos químicos y biológicos: valores nutrimentales y comportamiento de ingesta en ovinos Valter H. Bumbieris-Junior, Egon H. Horst, Murilo D. Paranzini, Odimári P. P. Calixto, Edson L. A. Ribeiro, Leandro D. F. Silva, Ivone Y. Mizubu , Clóves C. Jobim, Mikael Neumann……….……..…………..…………..573

Suplementación de ácidos grasos poliinsaturados en el empadre de ovejas nulíparas Katahdin: eficiencia reproductiva y crecimiento pre-destete de las crías

Polyunsaturated fatty acid supplementation during breeding in nulliparous Katahdin ewes: reproductive efficiency and pre-weaning growth in lambs Ricardo Vicente-Pérez, Ulises Macías-Cruz, Leonel Avendaño-Reyes, Enrique O. García-Flores, Ricardo Mar nez-Mar nez, Oziel D. Montañez-Valdez, José A. Reyes-Gu érrez, Alfonso J. Chay-Canul, María M. Crosby-Galván…………………..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..…….....………………………..…………..…586

Presencia de aflatoxina B1 en alimentos para cabras en unidades de producción de leche caprina del altiplano mexicano

Presence of aflatoxin B1 in goat feed in goat milk production units of the Mexican Highlands José Jesús Pérez González, Salvador Vega y León, Rey Gu érrez Tolen no, Beatriz Sofia Sche no Bermúdez, Fá ma Itzel Mar nez Solis, Arturo Camilo Escobar Medina………. …..…………..…………..…………....598

Predicción de la calidad fermentativa de ensilados de girasol mediante espectroscopía de reflectancia en el infrarrojo cercano (NIRS) sobre muestras secas

Prediction of the fermentative quality of sunflower silage by near-infrared reflectance spectroscopy (NIRS) on oven-dried samples Sonia Pereira-Crespo, Aurora Sainz-Ramírez, Dalia Andrea Plata-Reyes, Aida Gómez-Miranda, Felipe González-Alcántara, Adrián Botana, Laura González, Marcos Veiga, Cesar Resch, Roberto Lorenzana, Fernando Próspero-Bernal, Carlos Manuel Arriaga-Jordán, Gonzalo Flores-Calvete……………………………………..……………………..…………….....…..609

Corbicular pollen spectrum (Apis mellifera) of samples from Huejotitan, Jalisco, Mexico

Espectro de polen corbicular de Apis mellifera en muestras de Huejotitán, Jalisco, México Roberto Quintero Domínguez, Lino de la Cruz Larios, Diego Raymundo González Eguiarte, José Arturo Solís Magallanes, José Francisco Santana Michel, José Luis Reyes Carrillo………..…….....………..…………..621

Eficacia del timol en el control del hongo Nosema ceranae infectando abejas africanizadas

Efficacy of thymol in the control of the fungus Nosema ceranae infecting Africanized bees Azucena Vargas-Valero, Roberto C. Barrientos-Medina, Luis A. Medina Medina………………………………………..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..……..………..…………..…633

Caracterización de la curva de lactancia y calidad de la leche en ovejas Santa Cruz (Ovis aries)

Characterization of the lactation curve and milk quality in Santa Cruz sheep (Ovis aries) Ingrid Merchant, Agus n Orihuela, Reyes Vázquez, Virginio Aguirre……………....…………………..…………..…………..…………..…………..…………..…………..……..……..……..……..……..……..……..……..……..……..……..…………....644

Optimización de un protocolo de extracción de ADN a partir de sangre bovina hemolizada y coagulada para la detección molecular de Anaplasma spp.

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm 2, pp. 318-664, ABRIL-JUNIO-2021

Physicochemical composition, yield and sensory acceptance of Coalho cheese obtained from Zebu’s cow milk

Composición fisicoquímica, rendimiento y aceptación sensorial del queso fresco Coalho obtenido a partir de leche de vaca cebú Ingrid Laíse Silvestre de Oliveira, Adriano Henrique do Nascimento Rangel, Rodrigo Cou nho Madruga, Dorgival Morais de Lima Júnior, Rhaabe Dayane da Silva Gomes, Danielle Cavalcan Sales, Juliana Paula Felipe de Oliveira, Joadilza da Silva Bezerra………………………………………….……….………………………………….………..….......…...………………..…337

Optimization of a DNA extraction protocol for hemolyzed and coagulated bovine blood for use in molecular detection of Anaplasma spp Tomás Humberto Landázuri Rafael, Andrés Carrazco, Renato León, Lenin Vinueza, Verónica Barragán……………………………………..……………………..……………..……..……..……..……..……..……..……..……....…….........…..653

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 2, pp. 318-664, ABRIL-JUNIO-2021

Profile for Revista Mexicana de Ciencias Pecuarias

RMCP Vol. 12 Núm. 2 (2021): Abril-Junio [versión en español]  

RMCP Vol. 12 Núm. 2 (2021): Abril-Junio [versión en español]  

Advertisement

Recommendations could not be loaded

Recommendations could not be loaded

Recommendations could not be loaded

Recommendations could not be loaded