RMCP Vol. 12 Num. 1 (2021): January-March [english version]

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm 1, pp. 1-317, ENERO-MARZO-2021

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 1, pp. 1-317, ENERO-MARZO-2021

Aves criollas de la comunidad de Nopala de Villagrán, Hidalgo, México en producción a pequeña escala.

Fotografía: M.C. Ana Rosa Romero López

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 12 Número 1, EneroMarzo 2021. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 04-2016-060913393200-203. ISSN: 2428-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR).

Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en marzo de 2021.

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dr. Martin Talavera Rojas, Universidad Autónoma del Estado de México, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México

Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia.

Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, UAEH, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

I

REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria.

Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados.

Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

total por publicar es de $ 5,600.00 más IVA por manuscrito ya editado.

Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente.

El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México.

Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx.

La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx.

Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research.

The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products.

All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 325.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged.

Manuscripts should be submitted directly in the official web site.

Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx.

For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx.

Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II

REVISTA MEXICANA DE CIENCIAS PECUARIAS

REV. MEX. CIENC. PECU.

VOL. 12 No. 1

ENERO-MARZO-2021

CONTENIDO

ARTÍCULOS Pág.

Efecto de la selección genética en contra de las emisiones de metano sobre los componentes de la leche Genetic selection aimed to reduce methane emissions and its effect on milk components René Calderón-Chagoya, Juan Heberth Hernández-Medrano, Felipe de Jesús Ruiz-López, Adriana García-Ruiz, Vicente Eliezer Vega-Murillo, Enoc Israel Mejía-Melchor, Phil Garnsworthy, Sergio Iván Román-Ponce ………………………………………………………………………………………………………1 Relationships among ß-hydroxybutyrate, calcium and non-esterified fatty acids in blood with milk yield losses at early lactation Relaciones entre el ß-hidroxibutirato, el calcio y los ácidos grasos no esterificados en la sangre con pérdidas de producción de leche en la lactancia temprana Rufino López-Ordaz, Gabriela Pérez-Hernández, Hugo Alonso Ramírez-Ramírez, Reyes López-Ordaz, Germán David Mendoza-Martínez, Agustín Ruíz-Flores ………………………………………18 Caracterización genética de la oveja Pelibuey de México usando marcadores microsatélites Genetic characterization of Mexican Pelibuey sheep using microsatellite markers Cecilio Ubaldo Aguilar Martínez, Bertha Espinoza Gutiérrez, José Candelario Segura Correa, José Manuel Berruecos Villalobos, Javier Valencia Méndez, Antonio Roldán Roldán ……………………36 Diversidad genética de gallinas criollas en valles centrales de Oaxaca usando marcadores microsatélites Genetic diversity of creole chickens in Valles Centrales, Oaxaca, using microsatellite markers Héctor Luis-Chincoya, José Guadalupe Herrera-Haro, Amalio Santacruz-Varela, Martha Patricia Jerez-Salas, Alfonso Hernández-Garay ………………………………………………………………………….……….58 Milk fatty acid profile of crossbred Holstein x Zebu cows fed on cake licuri Perfil de ácidos grasos de la leche de vacas Holstein x Cebú alimentadas con pasta de licuri Antonio Ferraz Porto Junior, Fabiano Ferreira da Silva, Robério Rodrigues Silva, Dicastro Dias de Souza, Edvaldo Nascimento Costa, Evely Giovanna Leite Costa, Bismarck Moreira Santiago, Geónes da Silva Gonçalves …………………………………………………………………………………………………..72

III

Milk yield derived from the energy and protein of grazing cows receiving supplements under an agrosilvopastoral system Rendimiento de leche derivado de energía y proteína de vacas en pastoreo recibiendo suplementos en un sistema agrosilvopastoril Sherezada Esparza-Jiménez, Benito Albarrán-Portillo, Manuel González-Ronquillo, Anastacio GarcíaMartínez, José Fernando Vázquez-Armijo, Carlos Manuel Arriaga-Jordán …………………………………..87 Nutritional management of steers raised in graze and in feedlot: intake, digestibility, performance and economic viability Manejo nutricional de novillos criados en pastoreo y en corral: efectos en el consumo, digestibilidad, rendimiento y viabilidad económica Sinvaldo Oliveira de Souza, Robério Rodrigues Silva, Fabiano Ferreira da Silva, Ana Paula Gomes da Silva, Marceliana da Conceição Santos, Rodrigo Paiva Barbosa, Raul Lima Xavier, Tarcísio Ribeiro Paixão, Gabriel Dallapicola da Costa, Adriane Batista Peruna, Mariana Santos Souza, Laize Vieira Santos……………………………………………………………………………………………………………………………….105 Producción y evaluación de inóculos lácteos probióticos obtenidos del tracto digestivo de lechón (Sus scrofa domesticus) propuestos para alimentación porcina Production and evaluation of probiotic milk inocula obtained from the digestive tract of piglets ( Sus scrofa domesticus) proposed for pig feed Carmen Rojas Mogollón, Gloria Ochoa Mogollón, Rubén Alfaro Aguilera, Javier Querevalú Ortiz, Héctor Sánchez Suárez ………………………………………………………………………………………………………120 Actividad antihelmíntica in vivo de hojas de Acacia cochliacantha sobre Haemonchus contortus en cabritos Boer

In vivo anthelmintic activity of Acacia cochliacantha leaves against Haemonchus contortus in Boer goat kids

Gastón Federico Castillo-Mitre, Rolando Rojo-Rubio, Agustín Olmedo-Juárez, Pedro Mendoza de Gives, José Fernando Vázquez-Armijo, Alejandro Zamilpa, Héctor Aarón Lee-Rangel, Leonel Avendaño-Reyes, Ulises Macias-Cruz …………………………………………………………………………………..138 The effect of silkworm pupae and mealworm larvae meals as dietary protein components on performance indicators in rabbits Efecto de la harina de pupas y larvas de gusano de seda como componentes proteicos de la dieta sobre indicadores de rendimiento en conejos Dorota Kowalska, Janusz Strychalski, Andrzej Gugołek ………………………………………………………….151 Evaluación de indicadores productivos en rebaños caprinos vacunados con cepas RB51– SOD, RB51 (Brucella abortus) y Rev-1 (Brucella melitensis) Evaluation of productive indicators in goat herds vaccinated with RB51–SOD, RB51 (Brucella abortus) and Rev-1 (Brucella melitensis) strains Baldomero Molina-Sánchez, David Izcoatl Martínez-Herrera, Violeta Trinidad Pardío-Sedas, Ricardo Flores-Castro, José A. Villagómez-Cortés, José F. Morales-Álvarez ……………………………………….…163

IV

Distribución corporal de garrapatas (Acari: Ixodidae y Argasidae) asociadas a Odocoielus virginianus (Artiodactyla: Cervidae) y Ovis canadensis (Artiodactyla: Bovidae) en tres estados del norte de México Body distribution of ticks (Acari: Ixodidae and Argasidae) associated with Odocoileus virginianus (Artiodactyla: Cervidae) and Ovis canadensis (Artiodactyla: Bovidae) in three northern Mexican states Mariana Cuesy León, Zinnia Judith Molina Garza, Roberto Mercado Hernández, Lucio Galaviz Silva …………………………………………………………………………………………………………..…173 Detección de anticuerpos de Neospora spp. en caballos, asociados a diferentes factores de riesgo en México Detection of anti-Neospora spp. antibodies associated with different risk factors in horses from Mexico Kenia Jasher Padilla-Díaz, Leticia Medina-Esparza, Carlos Cruz- Vázquez, Irene Vitela-Mendoza, Juan F. Gómez-Leyva, Teódulo Quezada-Tristán………………………………………………………………..….194 Desempeño productivo y costos de granjas porcinas con diferentes protocolos de vacunación al virus del PRRS Productive performance and costs of swine farms with different PRRS virus vaccination protocols Elizabeth Araceli Quezada-Fraide, Claudia Giovanna Peñuelas-Rivas, Frida Saraí Moysén-Albarrán, María Elena Trujillo-Ortega, Francisco Ernesto Martínez-Castañeda ……………………………………..…205 Las funciones de las aves en la producción avícola de pequeña escala: el caso de una comunidad rural en Hidalgo, México Bird roles in small-scale poultry production: the case of a rural community in Hidalgo, Mexico Ana Rosa Romero-López ………………………………………………………………………………………………….…217 Disonancia cognitiva ante el cambio climático en apicultores: un caso de estudio en México Cognitive dissonance in the face of climate change in beekeepers: A case study in Mexico Felipe Gallardo-López, Blanca Patricia Castellanos-Potenciano, Gabriel Díaz-Padilla, Arturo PérezVásquez, Cesáreo Landeros- Sánchez, Ángel Sol-Sánchez …………………………………………………..…238 Evaluation of two supplemental zilpaterol hydrochloride sources on meat quality and carcass traits of crossbred Bos indicus bulls in the tropics Evaluación de dos fuentes suplementarias de clorhidrato de zilpaterol sobre la calidad de la carne y los rasgos de la canal de toros Bos indicus cruzados en los trópicos Pedro Antonio Alvarado García, Maria Salud Rubio Lozano, Héctor Salvador Sumano López, Luis Ocampo Camberos, Graciela Guadalupe Tapia Pérez, Enrique Jesús Delgado Suárez, Jeny Aguilar Acevedo…………………………………………………………………………………………………………………………….256

V

NOTAS DE INVESTIGACIÓN

Nivel de infestación de Rhipicephalus microplus y su asociación con factores climatológicos y la ganancia de peso en bovinos Bos taurus x Bos indicus

Rhipicephalus microplus infestation level and its association with climatological factors and weight gain in Bos taurus x Bos indicus cattle Roberto Omar Castañeda Arriola, Jesús Antonio Álvarez Martínez, Carmen Rojas Martínez, José Juan Lira Amaya, Ángel Ríos Utrera, Francisco Martínez Ibáñez ……………………………….…….273 Características histopatológicas y detección de Papilomavirus en la fibropapilomatosis bovina en el estado de San Luis Potosí, México Histopathology and PCR detection of bovine fibropapillomatosis in cattle in San Luis Potosí, Mexico Isaura Méndez Rodríguez, Fernando Alberto Muñoz Tenería, Milagros González Hernández, Alan Ytzeen Martínez Castellanos, Luisa Eugenia del Socorro Hernández Arteaga.……………………. 286 Prevalencia de genes qnrB, qnrA y blaTEM en bacteriófagos atemperados de Escherichia coli aislados en agua residual y alcantarillas de rastros del Estado de México Prevalence of the qnrB, qnrA and blaTEM genes in temperate bacteriophages of Escherichia coli isolated from wastewater and sewer water from slaughterhouses in the State of Mexico Juan Martín Talavera-González, Jorge Acosta-Dibarrat, Nydia Edith Reyes-Rodríguez, Celene Salgado-Miranda, Martín Talavera-Rojas ………………………………………………………………………………298 Calidad sensorial de la carne de cabritos lechales criados en sistemas de producción basados en pastoreo Sensory quality of meat from suckling kids of two indigenous Spanish goat breeds raised in grazing production systems Francisco De-la-Vega Galán, José Luis Guzmán Guerrero, Manuel Delgado Pertíñez, Luis Ángel Zarazaga Garcés, Pilar Ruiz Pérez-Cacho, Hortensia Galán-Soldevilla ………………………………………306

VI

Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

6.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437.

1.

2.

3.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes).

Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo.

El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

4.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

5.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

7.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8.

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales.

A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

VII

Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

referencias, aunque pueden insertarse en el texto (entre paréntesis).

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación.

Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista).

Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año.

Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés.

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año.

Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus.

12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias.

Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

VIII

I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

XI)

Sólo número sin indicar volumen.

II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries.

World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor.

XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor.

VI) The Cardiac Society of Australia and New Zealand.

Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación.

VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed.

Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total.

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.).

Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo.

IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf.

Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor.

Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones.

X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores.

Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz.

Veracruz. 1990:51-56.

IX

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto.

Para las notas al pie se deberán utilizar los símbolos convencionales.

14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución.

Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto.

Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro.

15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas.

16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista.

17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

xg

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50 g

vs

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s)

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

X

Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437.

1.

2.

3.

4.

5.

6.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted.

Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts).

All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt.

Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias”. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

7.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

8.

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology.

The more significant results and their statistical value and the main conclusions should be elaborated briefly.

At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

9.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts:

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text).

Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

b) Technical Notes. They should be brief and be

evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which

XI

should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of t he research article but without section titles.

names(s), the number of the edition, the country, the printing house and the year. e.

When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to

summarize, analyze and discuss an outstanding topic.

The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f.

In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements.

Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc.

11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Journals

Standard journal article (List the first six authors followed by et al.)

I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume

Key rules for references

II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

a.

The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s).

In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one.

III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries.

World Anim Rev 1993;(74-75):26-35.

No author given

b.

The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article).

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

c.

Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets). d.

In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

XII

Organization, as author

Organization as author XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

VI) The Cardiac Society of Australia and New Zealand.

Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

In press VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Official methods of analysis. 15th ed.

Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Books and other monographs

Author(s)

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.).

Cary NC, USA: SAS Inst. Inc. 1985.

Chapter in a book IX)

Electronic publications

Roberts SJ. Equine abortion. In: Faulkner LLC editor.

Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf.

Accesed Jul 30, 2003.

Conference paper X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores.

Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz.

Veracruz. 1990:51-56.

XI)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003.

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

13. Final version. This is the document in which the authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word.

Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution.

Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII

14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m µl µm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines.

16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v.

J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

vs

versus

xg

gravidity

The full term for which an abbreviation stands should precede its first use in the text.

18. Scientific names and other Latin terms should be written in italics.

XIV

https://doi.org/10.22319/rmcp.v12i1.5347 Article

Genetic selection aimed to reduce methane emissions and its effect on milk components

Rene Calderón-Chagoya a,c,f Juan Heberth Hernández-Medrano a,b,f Felipe de Jesús Ruiz-López c,f Adriana García-Ruiz c,f Vicente Eliezer Vega-Murillo d,f Enoc Israel Mejía-Melchor a,f Phil Garnsworthy b Sergio Iván Román-Ponce e,f*

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia.

Av. Universidad 300, 04510, Ciudad de México. México. b

The University of Nottingham. School of Biosciences, Sutton Bonington Campus.

Loughborough LE 12 5RD, UK. c

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal. Querétaro, México. d

INIFAP. Centro de Investigación Regional Golfo-Centro. Campo Experimental La Posta.

Veracruz, México. e

INIFAP. Centro de Investigación Regional Norte-Centro. CE La Campana. Chihuahua, México. f

Red de Investigación e Innovación Tecnológica para la Ganadería Bovina Tropical (REDGATRO).

1

Rev Mex Cienc Pecu 2021;12(1):1-17 *

Corresponding author: roman.sergio@inifap.gob.mx

Abstract: This study aimed to estimate the response to selection through different selection indices between methane production and milk production and its components in specialized tropical, dual-purpose, and family dairy systems. Methane emissions were sampled during milking using the Guardian-NG gas monitor; milk samples were collected individually during methane sampling. DNA was extracted from the hair follicles of all the animals included in this study. The variance and covariance components were estimated using the mixed model methodology. Due to the incomplete genealogical information, molecular markers were used to build the genomic relationship matrix (Matrix G). The estimated heritability for methane emissions during milking was 0.18 and 0.32 for the univariate and bivariate analysis, respectively. The genetic correlation between the milk fat and protein percentages and methane emissions during milking was negative, -0.09 and -0.18, respectively. The response to selection, estimated through selection indices, demonstrated that it is feasible to reduce methane emissions up to 0.021 mg/L during milking in five generations without detriment to milk components.

Key words: Methane, Milk, Heritability, Genetic correlation.

Received: 21/04/2019 Accepted: 26/08/2020

Introduction In recent years, the Intergovernmental Panel on Climate Change (IPCC)(1) and the Food and Agriculture Organization of the United Nations (FAO)(2) declared that the agricultural sector is the principal source of short-lived greenhouse gases (GHG), such as methane (CH4) and nitrous oxide (N2O).

Some strategies to mitigate methane emissions from dairy cattle include reducing the herd, changing bovine diet, using supplements, immunization against methanogenic archaea, and selecting animals with lower CH4 production(3).

The selection of low methane-producing animals requires knowledge about the genetic correlations between methane production and other characteristics of productive and economic importance(4).

2

Rev Mex Cienc Pecu 2021;12(1):1-17

A selection index is a methodology that maximizes breeding for a specific trait (5). Selection indices have been widely used to estimate the reproduction value of dairy cattle for individual and combined characteristics for selection purposes(6).

In cattle and sheep, the variation of CH4 emission has been demonstrated between individuals fed the same diet(7). De Haas et al(8) mentioned the possibility of selecting cows with low CH4 emissions since genetic variation suggests that the reductions would be 11-26 % in 10 yr and could be even higher in a genomic selection program. However, the available information about the opportunities to mitigate enteric CH4 through genetic improvement is scarce. Still, the genetic selection of animals with low methane emissions could affect economically important production traits.

This study aimed to estimate the response to selection through different selection indices between methane production and milk production and components in three dairy production systems in Mexico.

Material and methods This study was carried out in three dual-purpose (DP) production units (PUs), two specialized tropical dairy (STD) PUs, and four family dairy (FD) systems (Table 1). Milk components and methane emissions were measured in 274 cows (98, 74, and 102 in the DP, STD, and FD systems, respectively).

Table 1: Production systems sampled Farm

System

n

Localization

Breeds

La Posta El Zapato La Doña Santa Elena Aguacatal Farm 5 Farm 6 Farm 7 Farm 8

DP DP DP STD STD FD FD FD FD

33 16 49 37 37 16 32 24 30

Veracruz Veracruz Puebla Puebla Puebla Jalisco Jalisco Jalisco Jalisco

HOZ and BSZ HOZ HOZ, BSZ, and SMZ HO, BS, and HOBS HO, BS, and HOBS HO HO HO HO

DP= dual-purpose; STD= specialized tropical dairy; FD= family dairy.

HOZ= Holstein x Zebu, BSZ= Brown Swiss x Zebu, SMZ= Simmental x Zebu, HO= Holstein, BS= Brown Swiss, HOBS= Holstein x Brown Swiss.

Two of the three DP PUs are located in the Medellín de Bravo municipality, Veracruz, and have a tropical savanna climate, Aw(o), and an altitude of 12 m asl(9). The annual mean

3

Rev Mex Cienc Pecu 2021;12(1):1-17

temperature and precipitation are 25 °C and 1,460 mm(9). The third DP PU and the STD PUs are located in the Hueytamalco municipality, Puebla, at an altitude of 240 m, with a tropical wet climate (Af(c)), mean annual temperature of 23 ºC, and mean annual precipitation ranging from 2,200 to 2,500 mm(9).

The four FD PUs are located in the Tepatitlán municipality, Jalisco, at an altitude of 1,927 m. This location has a humid subtropical climate ((A)C(w1) (e)g) with an annual mean temperature and precipitation of 18 ºC and 715 mm(9).

The DP systems mainly use cross-bred Bos taurus taurus and Bos taurus indicus. The most common Bos taurus indicus breeds are Brahman, Gyr, and Sardo Negro; as for Bos taurus taurus, the most common breeds are Holstein, Brown Swiss, and Simmental(10).

One of the variants of tropical dairy systems is the STD. This system is characterized by using pure breeds, such as Holstein and Brown Swiss. Overall, STD management is similar to DP systems except for calf rearing, which is artificial, and milking, which is carried out without calf support(10).

FDs are characterized by small production units that fluctuate from 3 to 30 cows. The production units are conditioned to small areas and adjacent to the housing units, called “backyard.” FDs can be intensive or semi-intensive according to the conditions of the cultivation field. Holstein is the most common breed. The technological level is considered scarce because producers do not carry out adequate feeding, reproductive, preventive, or breeding practices. This system lacks production records and has rudimentary facilities; manual milking is often performed. Feeding is based on grazing or the supply of forages and wastes from the producer's crops(11).

Methane sampling

Methane was sampled using the methodology developed by Garnsworthy et al(12) and the Guardian-NG gas monitor (Edinburgh Instruments, Scotland, United Kingdom); this methodology measures environmental gas concentrations every second using a nondispersed dual-wavelength system.

The devices were installed in the feeding troughs where cows were offered feed during milking. Adaptations were made for the different types of feeding troughs to create a closed atmosphere to prevent drafts from skewing CH4 concentrations. These adaptations aimed to

4

Rev Mex Cienc Pecu 2021;12(1):1-17

generate the least disturbance during routine milking and allow the atmospheric sampling of the trough while the animal was feeding.

An adaptation period of one week was carried out to the presence of the new troughs. CH 4 was measured for two weeks during milking; the aim was to have a minimum of 10 effective days of measurement in each PU.

Milk sampling

Milk samples were obtained from each animal during milking. Samples were at least 50 mL and were directly obtained from the weighers at the start of the measurements. After collection, samples were preserved with bronopol and identified with the PU’s number and the animal’s identification number.

Milk samples were analyzed in the milk quality control laboratory of the Asociación Holstein de México A.C. using the mid-infrared technique to measure protein and fat percentages.

DNA sampling and extraction

Hair follicles were collected from the hairs obtained from the tail of all the animals included in this study. Hair samples were labeled and sent to the GENESEEK laboratory (Lincoln, Nebraska). In this laboratory, DNA was extracted, and genotypes were obtained through high-density microarrays. The GGP BOVINE LD V4 array was used for the animals from FDs; with this array, it is possible to get 30,125 SNPs. As for the animals from the STD and DP systems, the GGDP BOVINE 150K array was used to identify 138,962 SNPs per animal; this is because crossed animals require a greater number of markers for the information to be valid. In this study, only the SNPs located in the 29 autosomal chromosomes were included.

The quality control of the genotypes was carried out using the PLINK 1.7 (13) software and consisted of 1) removing the individuals with less than 90 % of the genotypic information, 2) removing the animals with a minor allele frequency of less than 5%, and 3) removing the animals with less than 90 % of the useful markers. At the end of the quality control analysis and keeping the markers shared in both platforms, the number of available markers was 20,776 SNPs for each animal.

5

Rev Mex Cienc Pecu 2021;12(1):1-17

Statistical analysis

Estimation of the genomic relationships

Variance components were estimated using the mixed model methodology. Due to the lack of complete genealogical information needed to build the additive relationship matrix (A Matrix), molecular markers were used to construct the genomic relationship matrix between all animals (G). The G matrix was built based on the method proposed by VanRaden(14). This method creates the M matrix using the dimensions: number of individuals (n) x number of markers (m). The matrix elements were coded as -1 (homozygous for one allele), 0 (heterozygous), and 1 (homozygous for the other allele). The P(nxm) matrix is subtracted from the M matrix; this subtraction results in the Z matrix (Z = M – P). The P(nxm) matrix contains columns with all the 2(pi-0.5) elements, where pi is the frequency of the second allele in the locus i. Finally, the G matrix was calculated as: 𝑍𝑍´ 𝐺= 2∑𝑝𝑖 (1 − 𝑝𝑖 )

Estimation of the variance components

The variance components for CH4 emissions and the milk components (fat and protein percentages) were implemented with the ASReml-R program(15).

The model was selected based on the effects of daily milk production during measurements, lactation days, lactation period, lactation number, production system, herd number, and breed on the response variables: methane production during milking, fat percentage, protein percentage. All the logical combinations within the fixed and random effects that converged with the response variables were tested. The resulting univariate model is represented as follows: 𝑦 = 𝜇 + 𝑋𝑏 + 𝑍1 𝑎 + 𝑊1 𝑛 + 𝑒 Where, 𝒚 is the vector of the response variables (CH4 production during milking, fat and protein percentage); 𝝁 is the overall mean of the response variables; 𝑿 is the incidence matrix for the fixed effects of daily milk production during measurements and lactation number;

6

Rev Mex Cienc Pecu 2021;12(1):1-17

𝒃 is the solution vector for the fixed effects of daily milk production during measurements and lactation number; 𝑍 is the incidence matrix of the random effects of the animal; 𝒂 is the solution vector of the random effects of the animal ~ 𝑁 (0, 𝐺𝜎 2 𝑎 ); 𝑾 is the incidence matrix for the random effect of the production system; 𝒏 is the solution vector for the random effect of the production system; 𝒆 is the vector of the random effects of the residuals ~ 𝑁 (0, 𝐼𝜎 2 𝑒 ).

Estimation of the covariance components

The covariance components between CH4 emissions during milking and milk components were calculated with the ASReml-R program(15). The variances estimated with the univariate models were used as initial values to estimate covariances.

The bivariate model is represented in matrix terms as follows: 𝑦1 𝑒1 𝑋 0 𝑏 𝑍 0 𝑎1 𝑊 0 𝑛1 |𝑦 | = | 1 | | 1 | + | 1 | |𝑎 | + | 1 | |𝑛 | + |𝑒 | 2 0 𝑋2 𝑏2 0 𝑍2 2 0 𝑊2 2 2 Where, 𝑦1 and 𝑦2 are the vectors of the response variable (CH4 production during milking, fat and protein percentage); 𝑋1 and 𝑋2 are incidence matrices for the fixed effects of daily milk production during measurements and lactation number; 𝑏1 and 𝑏2 are the solution vectors for the fixed effects of daily milk production during measurements and lactation number; 𝑍1 and 𝑍2 are the incidence matrices of the random effects of the animal; 𝑎 and 𝑎2 are the solution vectors of the random effects of the animal ~ 𝑁 (0, 𝐺𝜎 2 𝑎 ); 𝑊1 and 𝑊2 are the incidence matrices for the random effect of the production system; 𝑛1 and 𝑛2 are the solution vector for the random effect of the production system; 𝑒1 and 𝑒2 are the random effect vectors of the residuals ~ 𝑁 (0, 𝐼𝜎 2 𝑒 ).

Estimation of the genetic parameters

The h2 were obtained from the variance components estimated with the univariate models.

The genetic correlations (𝑟𝑥𝑦 ) were estimated from the bivariate models. The h2 was calculated by dividing the additive variance (𝜎 2 𝑎 ) by the phenotypic variance (𝜎 2𝑓 )(16): 𝜎2𝑎 ℎ2 = 2 𝜎 𝑓 The 𝑟𝑥𝑦 were estimated by dividing the genetic covariance (𝜎𝑥𝑦 ) of variables x and y between the square root of the product of the genetic variance of the variable x and y(16): 7

Rev Mex Cienc Pecu 2021;12(1):1-17

𝑟𝑥𝑦 =

𝜎𝑥𝑦 √𝜎 2 𝑥 𝜎 2 𝑦

Selection index

The response to selection was estimated by different selection indices between methane production and milk production and components. A sensitivity analysis identified different scenarios in which methane emissions, fat percentage, and protein percentage could be selected. Thus, it was possible to observe the dynamics between the accuracy of the indices and their genetic gain (Table 2). The selection indices were carried out for five generations.

The traits included in the indices were assigned a value based on selection importance and intensity; the sum of the values in absolute quantities must be equal to 100. CH4 emissions were assigned values ranging from 0 to -100; fat and protein percentages were assigned values ranging from 0 to 100.

Index INDEX1 INDEX2 INDEX3 INDEX4 INDEX5 INDEX6 INDEX7 INDEX8 INDEX9 INDEX10 INDEX11 INDEX12 INDEX13 INDEX14 INDEX15 INDEX16 INDEX17 INDEX18 INDEX19

Table 2: Selection indices and selection intensity of each model trait CH4 Fat Protein Index CH4 Fat Protein -100 -90 -90 -80 -80 -80 -70 -70 -60 -70 -70 -60 -50 -60 -50 -40 -60 -60 -50

0 0 10 0 10 20 0 10 0 20 30 10 0 20 10 0 30 40 20

0 10 0 20 10 0 30 20 40 10 0 30 50 20 40 60 10 0 30

INDEX34 INDEX35 INDEX36 INDEX37 INDEX38 INDEX39 INDEX40 INDEX41 INDEX42 INDEX43 INDEX44 INDEX45 INDEX46 INDEX47 INDEX48 INDEX49 INDEX50 INDEX51 INDEX52

8

0 -40 -20 -30 -40 -10 0 -40 -30 -20 -10 -30 -20 0 -30 -10 -30 -20 -20

10 40 20 30 50 20 20 60 40 30 30 50 40 30 60 40 70 50 60

90 20 60 40 10 70 80 0 30 50 60 20 40 70 10 50 0 30 20

Rev Mex Cienc Pecu 2021;12(1):1-17

INDEX20 INDEX21 INDEX22 INDEX23 INDEX24 INDEX25 INDEX26 INDEX27 INDEX28 INDEX29 INDEX30 INDEX31 INDEX32 INDEX33

-30 -40 -50 -20 -40 -10 -30 -50 0 -50 -20 -40 -30 -10

0 10 30 0 20 0 10 40 0 50 10 30 20 10

70 50 20 80 40 90 60 10 100 0 70 30 50 80

INDEX53 INDEX54 INDEX55 INDEX56 INDEX57 INDEX58 INDEX59 INDEX60 INDEX61 INDEX62 INDEX63 INDEX64 INDEX65 INDEX66

-10 -20 0 0 -20 -10 0 -10 -10 0 -10 0 0 0

50 70 50 40 80 60 60 70 80 70 90 80 90 100

40 10 50 60 0 30 40 20 10 30 0 20 10 0

The variance and covariance components used were those obtained with the previously described models for milk components (fat and protein percentages) and CH4 production during milking.

The original specification of the selection index foresees the use of a correlated variable (I) based on the phenotypic performance of each animal for several traits(5). Therefore, it is defined as: I=bp Where p is a vector of phenotypic values for the selection criteria and b corresponds to the weighting factors used in selection decision making. To maximize the correlation of I with the contribution of any candidate for the selection as a possible parent, the information is combined as: Ga = Pb Where G is a nxm matrix of genetic variances and covariances between all the m traits, a is a mx1 vector of values relative to the selection intensity for all traits. P is a nxn matrix of phenotypic variances and covariances between the n traits measured and available as selection criteria and b is a nx1 vector of weighting factors applied to the traits used in selection decision making. Thus, the previous equation is solved as: P-1 Ga = b To obtain the weighting factors contained in b, the selection candidates are classified based on the index (I).

9

Rev Mex Cienc Pecu 2021;12(1):1-17

The index precision (𝑟𝐻𝐼 ) can be described as the correlation between the index on which the selection is based and the genetic value; it is calculated as follows: 𝑏 𝑃𝑏

𝑟𝐻𝐼 = 𝑎 𝑄𝑎 Where, b is a vector of weighting factors to be applied to the traits used to decide the selection; P is a matrix of phenotypic variances and covariances between the measured traits used as selection criteria; a is a vector of relative values for all traits; Q is a matrix of the genetic variances and covariances between all the traits considered as part of the system.

The genetic gain (∆𝑔) for each trait was estimated; it indicates the increase in performance achieved through breeding programs: 𝐸 (∆𝑔) =

𝑖G´b 𝜎𝐼

Where: i= selection intensity; G= matrix of the genetic variance-covariance of the traits; b= is a vector of weighting factors to be applied to traits used in selection decision making; 𝜎𝐼 = is the standard deviation of the index.

The standard deviation of the index was calculated as follows: 𝜎𝐼 = √b′Pb Where: b= vector of the weighting factors applied to the traits used in selection decision making; P= matrix of the phenotypic variances and covariances between the measured traits used as selection criteria.

Results The CH4 emissions in the STD system were 0.08 mg of CH4/ L; FD and DP systems produced 0.06 mg of CH4/ L (Table 3). The average of the three systems was 0.065 mg of CH4/ L. As for milk components, the average fat percentage in the three systems was 4.82 %; the values per system were 3.69 % in STD, 3.72% in FD, and 6.84 % in DP. The protein percentage in the STD, FD, and DP systems was 3.20, 3.29, and 3.21 %, respectively. When combining the three systems, the average protein percentage was 3.23 %.

10

Rev Mex Cienc Pecu 2021;12(1):1-17

Table 3: Descriptive statistics of methane production and milk components in three production systems in Mexico Methane (mg/L) Fat % Protein % System Mean SD Mean SD Mean SD DP (n=98) 0.06 0.039 6.84 4.938 3.21 0.405 FD (n=102) 0.06 0.014 3.72 0.632 3.29 0.315 STD (n=74) 0.08 0.016 3.69 0.492 3.20 0.417 Average 0.065 0.028 4.828 3.344 3.234 0.380 DP= dual-purpose system, FD= family dairy, STD= specialized tropical dairy, N= number of observations, SD= standard deviation.

The h2 estimated for CH4 emissions during milking using the univariate model was 0.19.

Similarly, the h2 for fat percentage was 0.39 and 0.18 for protein percentage.

However, the h2 estimated using bivariate models was 0.32±0.245 for CH4 emissions during milking and 0.46±0.278 for fat percentage. The h2 for protein percentage was similar to the one estimated with the univariate model. However, the h2 of CH4 is similar to the one found in the bivariate analysis with fat percentage (0.35). The genetic correlations between milk fat and protein percentage and CH4 emissions during milking were -0.090 ± 0.080 and -0.18 ± 0.575, respectively.

Table 4 and Figure 1 show the accuracy of the selection indices (𝑟𝐻𝐼 ) and the genetic gain (∆𝑔). In all the selection indices, the decrease of CH4 emissions during milking does not negatively affect milk components. Moreover, the 𝑟𝐻𝐼 of the most accurate indices are those where CH4 emissions during milking are selected.

Index INDEX1 INDEX2 INDEX3 INDEX4 INDEX5 INDEX6 INDEX7 INDEX8 INDEX9 INDEX10 INDEX11

Table 4: Selection indices and genetic gain for CH4 and milk components CH4 Fat Protein CH4 Fat rHI Index rHI (mg/L) (%) (%) (mg/L) (%) 19.58 -0.021 0.030 0.073 INDEX34 10.72 -0.013 0.015 18.38 -0.021 0.029 0.078 INDEX35 10.63 -0.021 0.030 17.92 -0.021 0.030 0.073 INDEX36 10.41 -0.018 0.023 17.23 -0.021 0.029 0.082 INDEX37 10.32 -0.020 0.027 16.72 -0.021 0.030 0.078 INDEX38 10.12 -0.021 0.031 16.26 -0.021 0.030 0.072 INDEX39 9.95 -0.016 0.020 16.14 -0.021 0.028 0.088 INDEX40 9.70 -0.014 0.016 15.57 -0.021 0.029 0.083 INDEX41 9.70 -0.021 0.032 15.13 -0.020 0.027 0.093 INDEX42 9.62 -0.020 0.029 15.06 -0.021 0.030 0.078 INDEX43 9.56 -0.018 0.025 14.61 -0.021 0.031 0.072 INDEX44 9.01 -0.017 0.022

11

Protein (%) 0.117 0.086 0.110 0.100 0.078 0.115 0.117 0.069 0.094 0.107 0.113

Rev Mex Cienc Pecu 2021;12(1):1-17

INDEX12 INDEX13 INDEX14 INDEX15 INDEX16 INDEX17 INDEX18 INDEX19 INDEX20 INDEX21 INDEX22 INDEX23 INDEX24 INDEX25 INDEX26 INDEX27 INDEX28 INDEX29 INDEX30 INDEX31 INDEX32 INDEX33

14.49 14.21 13.92 13.50 13.41 13.40 12.96 12.86 12.74 12.63 12.27 12.23 11.90 11.89 11.89 11.76 11.75 11.32 11.30 11.23 11.08 10.91

-0.020 -0.020 -0.021 -0.020 -0.019 -0.021 -0.021 -0.020 -0.018 -0.019 -0.021 -0.017 -0.020 -0.015 -0.018 -0.021 -0.013 -0.021 -0.017 -0.020 -0.019 -0.015

0.028 0.026 0.029 0.027 0.025 0.030 0.031 0.028 0.023 0.026 0.030 0.020 0.027 0.017 0.024 0.031 0.014 0.032 0.021 0.029 0.025 0.018

0.089 0.099 0.084 0.095 0.104 0.078 0.071 0.090 0.110 0.101 0.085 0.114 0.097 0.117 0.107 0.078 0.118 0.070 0.112 0.092 0.104 0.116

INDEX45 INDEX46 INDEX47 INDEX48 INDEX49 INDEX50 INDEX51 INDEX52 INDEX53 INDEX54 INDEX55 INDEX56 INDEX57 INDEX58 INDEX59 INDEX60 INDEX61 INDEX62 INDEX63 INDEX64 INDEX65 INDEX66

12

9.01 8.77 8.70 8.49 8.12 8.09 8.05 7.41 7.28 6.90 6.78 6.78 6.52 6.52 5.89 5.86 5.35 5.08 5.02 4.40 3.90 3.67

-0.020 -0.019 -0.014 -0.021 -0.017 -0.020 -0.020 -0.020 -0.018 -0.020 -0.016 -0.015 -0.020 -0.019 -0.017 -0.020 -0.020 -0.017 -0.019 -0.018 -0.018 -0.017

0.030 0.027 0.018 0.032 0.024 0.033 0.029 0.031 0.026 0.033 0.022 0.020 0.034 0.029 0.025 0.032 0.034 0.028 0.036 0.032 0.035 0.037

0.087 0.103 0.117 0.078 0.111 0.067 0.097 0.089 0.107 0.078 0.114 0.116 0.064 0.100 0.110 0.091 0.077 0.104 0.057 0.092 0.073 0.044

Rev Mex Cienc Pecu 2021;12(1):1-17

Figure 1: Precision of the selection indices and genetic gain for CH4 and milk components

In the indices with greater 𝑟𝐻𝐼 , indices from 1 to 10, this variates from 15.06 to 19.58 in five generations; this would result in CH4 reductions ranging from 0.021 to 0.020 mg/L, fat percentage increases ranging from 0.027 to 0.030 and from 0.072 to 0.093 for protein percentage. These results indicate that milk production decreases when CH4 emissions decrease. For the remaining indices, the changes in CH4 emissions during milking, fat percentage, and protein percentage were not significant; however, the 𝑟𝐻𝐼 is lower.

Discussion The CH4 emissions during milking estimated in this study are lower than those reported by Bell et al(17).; this is possibly due to diet heterogeneity. In the farms analyzed in this study, animals are fed by grazing; in the specialized systems, animals are fed a concentrate-based diet. The h2 of CH4 production during milking estimated in this study are similar to those reported by other authors with metabolic chambers(18,19) or even with prediction equations(8).

These results coincide with those reported by other authors using similar CH4 measuring methodologies(20); this suggests that CH4 during milking is a trait that could be potentially

13

Rev Mex Cienc Pecu 2021;12(1):1-17

used in breeding programs because it can be easily incorporated into production control programs and requires unsophisticated equipment compared to respiratory chambers; additionally, this equipment can be mobilized to places of difficult access. The fat percentage h2 estimated in this study is higher than those observed in other studies(21-22). The protein percentage h2 is lower than the 0.23 reported by Othmane et al(23); this may be due to the inherent heterogeneity in dairy production units depending on the herd's diet and race.

The genetic correlations between CH4 emissions and milk components suggest genetic antagonism. However, the estimates in this study were not different from zero. The CH4 and grams of milk fat correlation observed by Pszczola et al(4) is higher (0.21) than that reported in this study; the correlation between CH4 and grams of milk protein in this study was similar to the one reported by Lassen et al(24) (0.39). In both cases, the opposite sign. It is important to mention that this difference is due to the units of measurement since milk production and the percentages of milk components have a negative correlation. In contrast, milk production and the content of its components have a positive correlation(25). Currently, the reduction of CH4 emissions through genetic selection has been proposed; this could reduce dairy cattle CH4 emissions in 10 yr between 11 and 26 %(8); 5 % in beef cattle(26).

The selection indices performed by Kandel et al(27) include fat and protein production, which were positively correlated with CH4 production. Considering the units of measurement, their result is similar to the one reported in this study since the correlation between milk production and the percentage of milk components is negative. In contrast, the correlation between milk production and the content of milk components is positive(27).

Conclusions and implications The genetic correlations between CH4 emissions and milk components (fat and protein percentage) suggest that a breeding program aimed to simultaneously decrease CH4 emissions and increase the percentages of milk components is feasible. In other words, these results show that it is possible to genetically select animals to reduce CH4 emissions without negatively affecting milk composition; this is confirmed by the genetic gains per generation predicted by the selection indices. The above, with CH4 reductions during milking in five generations ranging from 0.013 to 0.021 mg/L, without decreasing fat and protein percentages.

14

Rev Mex Cienc Pecu 2021;12(1):1-17

Acknowledgments

The authors would like to thank the Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias and the Consejo Nacional de Ciencia y Tecnología.

Conflicts of interest

The authors declare no conflicts of interest.

Literature cited: 1.

IPCC. Climate Change 2007: Impacts, adaptation and vulnerability. 1a ed. Cambridge University Press, 2007. doi:10.2134/jeq2008.0015br.

2.

FAO. Greenhouse gas Emissions from the Dairy Sector. Roma, Italy, 2010. doi:10.1016/S0301-4215(01)00105-7.

3.

Wall E, Simm G, Moran D. Developing breeding schemes to assist mitigation of greenhouse gas emissions.

Animal 2010;4(03):366– 376.doi:10.1017/S175173110999070X.

4.

Pszczola M, Calus MPL, Strabel T. Short communication: Genetic correlations between methane and milk production, conformation, and functional traits. J Dairy Sci 2019;102:1–5. doi:10.3168/jds.2018-16066.

5.

MacNeil MD, Nugent RA, Snelling WM. Breeding for profit: an introduction to selection index concepts. Range Beef Cow Symposium. 1997.

6.

Philipson J, Banos G, Arnason T. Present and future uses of selection index methodology in dairy cattle. J Dairy Sci 1994;77:3252–3261. doi:10.3168/jds.s00220302(94)77266-0.

7.

Grainger C, Clarke T, McGinn SM, Auldist MJ, Beauchemin KA, Hannah MC, et al Methane emissions from dairy cows measured using the sulfur hexafluoride (SF6) tracer and chamber techniques. J Dairy Sci 2007;90:2755–2766. doi:10.3168/jds.2006-697.

8.

De Haas Y, Windig JJ, Calus MPL, Dijkstra J, Haan M De, Bannink A, Veerkamp RF. Genetic parameters for predicted methane production and potential for reducing enteric emissions through genomic selection.

J Dairy Sci 2011;94:6122– 6134.doi:10.3168/jds.2011-4439.

15

Rev Mex Cienc Pecu 2021;12(1):1-17

9.

García E. Modificaciones al sistema de clasificación Köppen. Quinta ed. México; Instituto de Geografía-UNAM; 2014.

10. Román PH, Ortega RL, Ruiz LFJ, Medina CM, Vera AHR, Núñez HG, et al. Producción de leche de bovino en el sistema de doble propósito. Libro técnico. INIFAP-CIRGOC. Veracruz, Ver. 2009.

11. Vera A, Hernández A, Espinoza G, Díaz A, Román P, Núñez H, Al E. Producción de leche de bovino en el sistema familiar. Libro técnico. INIFAP-CIRGOC. Veracruz, Ver. 2009.

12. Garnsworthy PC, Craigon J, Hernandez-Medrano JH, Saunders N. Variation among individual dairy cows in methane measurements made on farm during milking. J Dairy Sci 2012;95:3181–3189.doi:10.3168/jds.2011-4606.

13. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira M, Bender D, et al. PLINK (1.07). PLINK: a toolset for whole-genome association and population-based linkage analysis.

Am J Human Genet 2007;81:1– 293.doi:http://pngu.mgh.harvard.edu/purcell/plink/.

14. VanRaden PM. Efficient methods to compute genomic predictions. J Dairy Sci 2008;91:4414–23. doi:10.3168/jds.2007-0980.

15. Butler DG, Cullis BR, Gilmour AR, Gogel BJ. Analysis of mixed models for S language environments: ASReml-R reference manual. 2009:145. doi:citeulike-articleid:10128936.

16. Cameron N. Selection indices and prediction of genetic merit in animal breeding. CAB international, 1997.

17. Bell M, Saunders N, Wilcox R, Homer E, Goodman J, Craigon J, Garnsworthy P. Methane emissions among individual dairy cows during milking quantified by eructation peaks or ratio with carbon dioxide. J Dairy Sci 2014;97:6536–6546. doi:10.3168/jds.2013-7889.

18. Pinares-Patiño CS, Hickey SM, Young EA, Dodds KG, MacLean S, Molano G, et al.

Heritability estimates of methane emissions from sheep. Animal 2013;7(2):316– 321.doi:10.1017/S1751731113000864.

19. Pickering NK, Chagunda MGG, Banos G, Mrode R, Mcewan JC, Wall E. Genetic parameters for predicted methane production and laser methane detector measurements.

Am Soc Anim Sci 2015;92(1):11–20.DOI:10.2527/jas2014-8302.

16

Rev Mex Cienc Pecu 2021;12(1):1-17

20. Lassen J, Lovendahl P, Madsen J. Accuracy of noninvasive breath methane measurements using Fourier transform infrared methods on individual cows. J Dairy Sci 2012;95:890–898.doi:10.3168/jds.2011-4544.

21. Miglior F, Sewalem A, Jamrozik J, Bohmanova J, Lefebvre DM, Moore RK. Genetic analysis of milk urea nitrogen and lactose and their relationships with other production traits in Canadian Holstein Cattle. J Dairy Sci 2007;90(5):2468–2479. doi:10.3168/jds.2006-487.

22. González-Peña D, Guerra D, Evora JC, Portales A, Ortiz J, González S, Ramírez R. Heredabilidad y tendencia genética de la producción de leche y grasa en vacas Siboney de Cuba. Ciencia y Tecnología Ganadera 2009;3(1):27–32.

23. Othmane MH, De La Fuente LF, Carriedo JA, San Primitivo F. Heritability and genetic correlations of test day milk yield and composition, individual laboratory cheese yield, and somatic cell count for dairy ewes. J Dairy Sci 2002;85(10):2692–2698. doi:10.3168/jds.S0022-0302(02)74355-5.

24. Lassen J, Poulsen NA, Larsen MK, Buitenhuis AJ. Genetic and genomic relationship between methane production measured in breath and fatty acid content in milk samples from Danish Holsteins. Anim Prod Sci 2016;56(3):298–303. doi:10.1071/AN15489.

25. Schutz MM, Hansen LB, Steuernagel GR, Reneau JK, Kuck AL. Genetic parameters for somatic cells, protein, and fat in milk of Holsteins. J Dairy Sci 1990;73:494–502. doi:10.3168/jds.S0022-0302(90)78697-3 26. Hayes BJ, Donoghue KA, Reich CM, Mason BA, Bird-Gardiner T, Herd RM, Arthur PF. Genomic heritabilities and genomic estimated breeding values for methane traits in Angus cattle. J Anim Sci 2016;94:902–908. doi:10.2527/jas.2015-0078.

27. Kandel P, Vanderick S, Vanrobays ML, Soyeurt H, Gengler N. Consequences of genetic selection for environmental impact traits on economically important traits in dairy cows.

Anim Prod Sci 2018;58(1966):1779–1787. doi:10.1071/AN1659.2

17

https://doi.org/10.22319/rmcp.v12i1.5105 Article

Relationships among ß-hydroxybutyrate, calcium and non-esterified fatty acids in blood with milk yield losses at early lactation

Rufino López-Ordaz a* Gabriela Pérez-Hernández a Hugo Alonso Ramírez-Ramírez b Reyes López-Ordaz c Germán David Mendoza-Martínez c Agustín Ruíz-Flores a

a

Universidad Autónoma Chapingo. Posgrado en Producción Animal. Carr. MéxicoTexcoco. 56230. Chapingo, Estado de México. México. b

Iowa State University. Animal Science Department. Ames, IA.USA.

c

Universidad Autónoma Metropolitana. Departamento de Producción Agrícola. Ciudad de México, México.

*Corresponding author: rlopezor@yahoo.com

Abstract: The objectives were to study the associations of concentrations of β-hydroxybutyrate acid (BHBA), calcium (Ca2+), and non-esterified fatty acids (NEFA) in blood serum 7 d prepartum with losses in milk yield (MY) and metabolic dysfunctions at seven and 14 d of lactation. Three hundred and thirty-six (336) Holstein-Friesian (780 ± 36 kg BW; which had lactated more than twice) were sampled by coccygeal venipuncture, 7 d before, and 7 and 14 d after parturition. For each sample and metabolite serum concentrations were stratified in thresholds and related to MY. When BHBA levels were high 7 d before parturition and were related to MY at d-7 postpartum, it was observed that 11.00 % of the 18

Rev Mex Cienc Pecu 2021;12(1):18-35

cows lost 0.370 kg d-1 of milk. In contrast, no relationship was observed between BHBA prepartum and MY on d-14 of lactation. It was not observed any association between high NEFA and low Ca2+ levels prepartum and MY. NEFA concentrations ≥ 0.5 mmol L-1 on d-7 before calving were 7.6 more susceptible for lameness incidence (P≤ 0.01), and when BHBA ≥ 0.8 mmol L-1 cows were 2.4 times more likely to develop ketosis (P≤0.05) in the first 60 d in milk. In brief, data indicate that a high proportion of cows are above the thresholds of β-hydroxybutyrate and non-esterified fatty acids, and are also deficient in calcium, when determined one week before parturition. The risk thresholds for each metabolite were not associated with the amount of milk lost at d-14 after calving.

Key words: Negative energy balance, Biomarkers, Metabolites, Milk yield, Metabolic dysfunctions.

Received: 08/10/2018 Accepted: 22/11/2019

Introduction Animal health and herd productivity are the most difficult challenges that dairy producers confronting on a regular basis. The period around calving is critical due to the reduction in dry matter intake (DMI), increases in the demand of nutrients, energy and calcium (Ca2+) for the maintenance and synthesis of milk. Due to the reduction in DMI, the requirements of the animals cannot be met, and the deficit allows the animal to fall into negative energy balance (NEB).

At early lactation, the concentration of glucose in blood serum is low, with a parallel increase in the concentration of non-esterified fatty acids (NEFA), and ketone bodies(1).

The most prominent circulating ketone body in ruminants is β-hydroxybutyrate (BHBA), which is used as an energy source in body tissues such as brain, heart(2), kidney and skeletal muscle(3). However, the increase of BHBA above 1.2 mmol L-1 is an indicator of subclinical ketosis in dairy cows(4). The increase in plasma BHBA reduces circulating glucose in blood(5) and increases the risk of ketosis, hypocalcemia, abomasal displacement and metritis with the consequent reduction in MY(6).

Measurements of BHBA, Ca2+, and NEFA concentrations around calving may be potential indicators of the cow's ability to overcome metabolic challenges in the transition period, 19

Rev Mex Cienc Pecu 2021;12(1):18-35

and possibly allow predicting some disease risks and possible MY losses at the start of lactation. Calcium concentrations demonstrate the ability of the cow to replace extracellular Ca2+ loss as a result of the milk production process, and the balance between bone, and the efficiency of absorption of insulin and Ca2+(7). Non-esterified fatty acids serve as an indicator of mobilization of body fat and reflect the particularity of the cow to adapt to the NEB. At the level of cow, reductions in serum Ca2+ concentrations, increases in NEFA and BHBA have been associated with an increased risk to contracting diseases(8) and milk loss(9). The cow-level thresholds of these metabolites have been used to identify individuals at risk of damaging their health and productivity. However, individual interventions to minimize the undesirable effects of NEB on hypocalcemia, ketosis or other metabolic disorders around calving are difficult to achieve. Based on this premise, the objective of this study was to determine the serum concentrations of βhydroxybutyrate, Ca2+, and, non-esterified fatty acids, seven days before parturition, and the relationships between them and milk losses at seven and 14 d of lactation in HolsteinFriesian cows in confinement.

Material and methods Study area

The study was carried out in a commercial dairy farm located in the Comarca Lagunera Region, Northern, Mexico. The dairy farm was selected based on the accessibility of the manager to participate in the study; the farm met the criteria of having approximately 2,000 milking cows and managing with two milking per day and complete sorghumsoybean diets. The dairy farm is located in San Pedro, Coahuila, at 1,100 m (25° 44' 36" N and 103° 10' 22" W). Temperatures at animal pens were from 4 to 20 °C during the study period. The climate of the region is desert. The precipitation is approximately 300 mm per year distributed mainly from July to September(10).

Animal feeding and management

Animals used in the study were 336 Holstein-Friesian pregnant cows, approximately 30 d before the probable date of calving. The body weight (BW) was approximately 780 ± 36 20

Rev Mex Cienc Pecu 2021;12(1):18-35

kg, with a body condition score (BCS) of 3.5 (scale 1, thin to 5, fat) and with more than two lactations. The possible dates of calving were obtained from the lists generated by the AfiFarm’ (Ltd., Kibbutz Afikim, Israel) software. The cows were selected taking into account the milk production records of the previous lactation. The selection criterion was the average production indicated in kilograms of milk for 305 d of a previous year.

The number of cows considered in the study was obtained according to the criteria of Fox et al(11) for sample size, considering the total population of milking cows minus 16.0 % of cows in the dry period and 12.0 % of those with only one lactation. Those reported with mastitis, metabolic disorders or respiratory problems were also discarded. Finally, 336 cows were used in the sampling. Selected animals were sampled at 7 d before, and at 7 and 14 d after calving (-7d, +7d, and +14d).

Each dairy cow group (pre and post-partum) was fed with the respective diet. In each diet was used the same ingredients. Cows were provided ad libitum access to fresh water and were fed a total mixed ration (TMR) daily that was designed to meet NRC recommendations(12) for close-up and fresh cows. The close-up diet (prepartum) was based on oats hay, soybean meal, and cracked corn, and the diet for fresh cows (postpartum) was based on alfalfa and soybean meal (Table 1).

Table 1: Ingredients and chemical composition of the total mixed ration fed pre (closeup period), and post-partum (fresh period) to Holstein-Friesian cows in confinement conditions Ingredients

Close-up diet, %1

Fresh diet, %2

7.75 13.78

20.41 25.36 6.82 1.47 4.75 3.43 12.76 1.51 3.40

Alfalfa hay Soybean Cotton seed Destillery grain Sorghum grain steam-flake Corn steam-flake Citrus pulp Soy hulls Corn silage Oat hay Cracked corn Minerals Molasses Calcium soaps of fatty acids Sodium bicarbonate Dicalcium phosphate Vitamin premix 1

4.68

10.62 44.18 7.15 0.81 9.24 0.05 1.38 0.36 21

0.45 12.76 5.08 0.05 1.45 0.30

Rev Mex Cienc Pecu 2021;12(1):18-35

Chemical composition3 Metabolizable energy, Mcal kg 1.68 -1 Net energy of lactation, Mcal kg 1.06 Crude protein, % 12.60 Acid detergent fiber, % 21.70 Neutral detergent fiber, % 25.60 -1

3.08 2.04 22.00 18.00 18.70

1

Close-up period was from wk 3 to 0 before calving. 2Fresh diet period was from calving to d- 60 in milk.

Chemical compositions were determined in lab following the procedures of AOAC (31); whereas NDF and ADF were analyzed according the methods of Goering and Van Soest (32).

3

Serum analysis

In each sampling day, approximately 10.0 mL of blood from the coccygeal vein/artery was collected in vacutainer tubes without anticoagulant (Beckton-Dickinson, Franklin Lakes, NJ) immediately following morning milking and before feeding. The samples were kept under refrigeration and their coagulation was allowed. The blood was centrifuged at 1,500 rpm for 25 min; serum was separated and stored at -20 °C within a period no longer than 6 h of collection.

The samples were analyzed for BHBA and NEFA in the Universidad Autónoma Nacional de México at the laboratories. NEFA concentrations in blood serum were determined with an enzymatic colorimetric assay Half-micro test number 11 383 175 001 distributed by Sigma Aldrich laboratories (Roche, Diagnostics, Mannheim, Germany); whereas the BHBA was analyzed with an enzymatic colorimetric kit via plate reader. This kit is distributed by Stanbio Laboratories (EKF Diagnostics-Stanbio, Boerne, TX, USA). An atomic absorption spectrophotometer (Analyst 700, Perkin Elmer) was used to analyze Ca2+ concentrations in blood serum. Calcium concentrations were determined following procedures of the manufacturer(13).

Recording diseases

The dairy herd was visited daily. Herd veterinarians recorded disease events nearly after morning milking with a standard sheet, which was handled in the systems area dairy farm by the AfiFarm software (Ltd., Kibbutz Afikim, Israel). Metabolic dysfunctions such as acidosis, hypocalcemia, ketosis, and lameness were classified as clinical events. The veterinarians followed the protocols established by the dairy for the detection of diseases and disorders to standardize the information collected. The definitions of the diseases have already been described previously by LeBlanc et al(14).

22

Rev Mex Cienc Pecu 2021;12(1):18-35

Statistical analysis

Statistical analyses were performed using SAS software(15) with cow as the experimental unit. Descriptive statistics were obtained with the UNIVARIATE procedure; they are shown in Table 2.

Table 2: Threshold, and descriptive statistics of samples from experiment used to evaluate the relation between blood serum metabolites concentrations and milk yield of Holstein-Friesian cows in confinement Threshold Item

Low

Body condition score,  2.25 (cows numbers) (116)

Mean

Standard deviation

 3.50 (130)

3.55

0.18

Medium

High

2.25-3.50 (95)

Lactation, (cows numbers)

 3.00 (104)

3.0-4.00 (108)

 4.00 (124)

2.69

0.83

Milk yield, kg cow-1 d-1, (cows numbers)

18.20 (122)

18.2036.32 (123)

 36.33 (91)

38.44

10.33

Differences among BHBA, Ca2+ and NEFA concentrations were analyzed using PROC MIXED in a completely randomized design for repeated measures. The final model is as indicated, after removing the covariables and the double or triple interactions that were not significant (P≥0.05).

Yijk =  + COWi + DAY OF SAMPLINGj + COW X DAY OF SAMPLINGij + Eijk Were: Yijk is an observation of the response variables;  is the general mean; COWi is the random effect of the i-th cow (i= 1, 2,…336); DAY OF SAMPLING is the effect of the j-th day of sampling (j= -7, 7, and 14); COW x DAY OF SAMPLINGij is the interaction Cow x Day of sampling; Eijk is the random error.

23

Rev Mex Cienc Pecu 2021;12(1):18-35

The covariance structure for BHBA, and NEFA concentrations was compound symmetry, whereas the more appropriate for Ca2+ was autoregressive of order one. Both of them were based on the lowest Akaike’s information criterion.

BHBA, Ca2+, and NEFA levels in blood serum were dichotomized and evaluated individually against MY on d 7 and 14 after calving. Dummy variables of MY and BCS were defined following procedures published by López-Ordaz et al(16). For BCS, the cows were classified as moderate (2.25 to 3.25), and fat (≥ 3.5). Cows with BCS > 3.5, were categorized with number one, and were considered as risk factor. These values were performed using Proc Freq of SAS. For each metabolite and date of sampling, at least three types of thresholds were made (low, medium and high). The thresholds were formed following the methodology proposed by Chapinal et al(9). To predict the volume of milk lost or not harvested, the categorization of the cows was used in groups of low, medium and high risk. To study the difference between thresholds were created hierarchical Dummy variables, categorical values were 1.0 and 0.0, for cows considered in high and low risk, respectively, based on the serum concentrations of each metabolite in each sampling day thresholds used. In most of the thresholds the average level worked as a reference point.

With the high-risk thresholds defined for BHBA, Ca2+ and NEFA, the proportion of cows that were above and below the same thresholds for each metabolite and for each sampling date was determined with Chi-squared test (Table 3); whereas, blood concentrations of BHBA, Ca2+ and NEFA for animals that were above or below the high-risk thresholds were analyzed with Proc mixed from SAS. When the differences were significant between cows, the orthogonal contrasts test was used to establish the magnitude of the differences.

Table 3: Descriptive statistics of samples from experiment used to evaluate the relation between blood serum metabolites concentrations and milk yield of Holstein-Friesian cows in confinement Mean (n=336)

Standard Deviation

BHBA, mmol L-1

0.73

0.45

0.20

3.84

Ca2+, mmol L-1

2.46

0.57

1.24

4.98

NEFA, mmol L-1

0.59

0.46

0.12

2.95

Item

Minimum

Maximum

To predict MY lost or not harvested, and the possible relationship between metabolites and metabolic disorders, the categorization of low, medium and high was used; whereas 24

Rev Mex Cienc Pecu 2021;12(1):18-35

MY was classified as low (≤ 18.20), medium (18.21 to 36.33), and high (≥ 36.33 kg d-1) and where referred to as 0, -1 and 1, respectively, based on the discrete variables reported

by López-Ordaz et al(16).

For each concentration threshold and day of sampling, multivariate conditional logistic regression models (Proc Glimmix) were developed, using a binary distribution and logit link function. The variables of interest were BHBA, Ca2+ and NEFA concentrations (the dichotomized proportions of animals in the low, moderate or high-risk group), date of interest sampling and the previous date (when -7 was the date of interest, 7 postpartum days was included in the model). It was also included CC, PL and date of births and the results are presented as odd ratio and the confidence intervals (CI = 95%) between animals above and below the reference threshold. The odd ratio expresses the advantage or probability of experiencing an event (for example lost or unharvest milk) for a high-risk group (above the threshold) when compared with a low risk group (below the threshold).

Results Table 2 shows the thresholds and the number of the cows for BCS, lactation and MY of animals used in the study; whereas, Table 3 shows the number of repetitions, the mean and the standard deviations values of the blood serum metabolites concentrations of the animals considered in the study.

Table 4 shows the sampling dates, and the proportion of cows that were above and below the thresholds. The proportion of cows above the thresholds for BHBA at d-7 was less (P≤0.05) than those observed at d 7 and 14. In contrast, it was not observed differences between d 7 and 14.The proportion of cows above the thresholds for Ca2+ was greater (P≤0.001) for -7 and 7 d in comparison with 14 d. However, for NEFA, the proportion was greater (P≤0.001) in d 14 than the other days (224 vs 108 and 30, for 7 and – 7, respectively).

25

Rev Mex Cienc Pecu 2021;12(1):18-35

Table 4: Cows above or below the thresholds, and descriptive statistics of samples from experiment used to evaluate the relation between blood serum metabolites concentrations

Item

Cows above the thresholds

n

-7 BHBA ≤ 0.8 mmol L-1 Calcium ≤ 2.3 mmol L-1 NEFA ≥ 0.5 mmol L-1

a

7 b

SEM

P

14 b

336

9

24

27

2.12

0.05

336

108b

108b

84a

11.34

0.001

336

30a

108b

224c

28.55

0.001

Cows below the thresholds BHBA ≤ 0.8 mmol L-1 Calcium ≤ 2.3 mmol L-1 NEFA ≥ 0.5 mmol L-1 ab

336

327

312

309

3.00

0.05

336

228a

228a

252b

9.87

0.04

336

306c

228b

122a

17.99

0.001

Different literals in row mean statistical difference (P<0.05) between treatments.

The proportion of cows below the thresholds for BHBA at d 7 and 14 was less (P≤ 0.05) than those observed at d-7. In contrast, it was not observed differences between d 7 and 14 (Table 4). The proportion of cows below the thresholds for Ca2+ was greater (P≤ 0.04) than - 7 and 7 d in comparison with 14 d. However, for NEFA, the proportion was greater (P≤0.001) in d-7 than the other days (306 vs 228 and 122, for 7 and 14, respectively).

Table 5 shows the metabolite concentrations observed in cows that were above and below the thresholds obtained for BHBA, Ca2+ and NEFA, on d -7, 7 and 14. In cows above the thresholds, the concentrations of BHBA at d 7 and 14 were greater (P≤0.02) than those observed at d-7. On the contrary, the concentrations of Ca2+ and NEFA at d - 7, 7, and 14 prepartum were not different (P≥0.05).

26

Rev Mex Cienc Pecu 2021;12(1):18-35

Table 5: Metabolites concentrations, cows above and below the thresholds, and descriptive statistics of samples from experiment used to evaluate the relation between blood serum metabolites concentrations Item

n

Cows above the thresholds -7

BHBA ≤ 0.8 mmol L-1 Calcium ≤ 2.3 mmol L-1 NEFA ≥ 0.5 mmol L-1

a

7

SEM

P

14 b

336

1.04

1.65

1.68b

0.12

0.05

336

2.82

2.78

2.87

0.03

0.12

336

1.08

1.14

1.16

0.04

0.23

Cows below the thresholds BHBA ≤ 0.8 mmol L-1 Calcium ≤ 2.3 mmol L-1 NEFA ≥ 0.5 mmol L-1 ab

336

0.49a

0.71b

0.66b

0.06

0.02

336

1.93

1.85

1.88

0.05

0.02

336

0.20a

0.42b

0.41b

0.05

0.01

Different literals in row mean statistical difference (P<0.05) between treatments.

With respect to the cows below the thresholds, the concentrations of BHBA at d 7 and 14 were different (P≤0.02) compared with -7 d; on the contrary, no difference (P≥0.02) were observed between d 7 and 14. While for the same date, the Ca2+ concentrations were not different (P≥0.12) compared to the other two dates. The NEFA concentrations of d-7 were different (P≤0.01) to the concentration on d 7 and 14 postpartum. On the contrary, no difference was observed between d 7 and 14.

Cows on day seven after parturition showed high-risk with blood concentrations of NEFA. The relationship of blood concentrations determined on d-7 before calving and metabolic dysfunctions incidence in the first 7 d of lactation had a significant effect for the incidence of lameness (P≤0.01), with an OR estimate of 7.6 [1.50 – 38.74; CI = 95%; P=0.01] times more likely to present this clinical disorder when NEFA ≥0.5 mmol L-1. It was also observed that 11 % of the cows with high concentrations of BHBH were lost approximately 0.37 kg cow-1 d-1 of milk [Odd ratio = 0.37; (0.14 to 1.01; CI = 95%; P=0.05)].

27

Rev Mex Cienc Pecu 2021;12(1):18-35

Discussion The ketone bodies, with the BHBA as the main one, are known to be involved in the expression of ketosis, as depressants of feed intake and that affect negatively the fertility of dairy cows(17). It was determined the serum concentrations of BHBA, Ca2+, and NEFA 7 d before parturition, and 7 and 14 after parturition, in order to establish the relationships between those concentrations and milk losses in Holstein-Friesian cows in confinement.

In the current study, the low proportion of cows above the BHBA thresholds on d - 7 in comparison with d 7 and14 of lactation was explained by the metabolic and endocrine adaptations of the cow during the dry period in the absence of the requirement of nutrients for MY; while in lactation; the metabolism of nutrients is related to negative energy balance (NEB) caused by MY and inadequate feed intake.

The necessary adaptation is reflected by changes in several blood parameters. As noted in other studies, the concentration of glucose decreases, whereas the concentrations of BHBA and NEFA increase, concomitantly with related changes in the endocrine system mainly insulin and glucagon(18).

The difference in BHBA concentrations before and after parturition was also observed in other studies. Chapinal et al(9) in a large multiregional study conducted in 55 stables, to validate the relationships between concentrations of BHBA with diseases at the beginning of lactation, observed that cows sampled -7 d were four times below the risk threshold for BHBA compared to those sampled seven days after parturition. The difference was explained by the metabolism of energy in different physiological states.

In the Chapinal et al(9) study BHBA concentrations was similar to those observed here. In the present study, the serum concentrations of BHBA found were on average 0.73 with a variation of 0.20 to 3.84 mmol L-1. The highest concentrations were obtained on d 7 and 14 of lactation in comparison with those obtained on d -7. The cow-level threshold of <0.8 mmol L-1 used in the present study is similar to those suggested by Chapinal et al(9) and Ospina et al(19). Conceivably, subclinical ketosis may start at levels of BHBA greater than 1.0 mmol L-1; however, the decision to set an appropriate subclinical threshold using serum or plasma BHBA appears to be somewhat arbitrary.

Kelly(20) suggested that 1.0 mmol L-1 be used to separate cows with low and high BHBA concentrations; whereas, Suthar et al(21) selected a subclinical ketosis threshold of 1.2 mmol L-1 of BHBA. Because increased ketone bodies post calving is considered to be part of a normal metabolic response to increased energy demand, it seems that a cut point to 28

Rev Mex Cienc Pecu 2021;12(1):18-35

define high ketone body concentrations should be based on both production and health impairment.

Other factors such as age of the cow are also part of the explanation of the high levels of BHBA in early lactation. In the current study, cows with three or more (2.5 vs 3.6 ± 1.5) lactations were more productive than young cows as a consequence a greater proportion were above the risk threshold (approximately 19 %). Older cows (> 4 lactations) consume more feed than younger cows, mobilize more glucose and respond with greater increases in BHBA due to the needs of lactation(13).

According to these criteria, in the present study approximately 3, 7 and 8 % cows would be considered with subclinical ketosis; because their BHBA concentrations were higher than 1.0 mmol L-1 for d -7, 7 and 14, respectively. It can be a call for attention to health and the possible requests for milk in the herd under study. Particularly, the herd in study has the most productive and reproductive records of the area, which means that other herds with lower parameters could present subclinical ketosis in greater proportions in the study area. Calcium plays a fundamental role in MY, because it is involved in the transmission of nerve impulses, contraction of muscles, blood coagulation, secretory activity of cells, cell differentiation, immune response, and enzymatic activation(22).

In the current study, the proportion of cows above the Ca2+ thresholds were lower for d 14 compared to 7 and -7; this may be due to the mobility of Ca2+ during the end of gestation only has very slight fluctuations because the changes in the requirements for the mineral are not very variable. On the contrary, in the days after parturition, the needs for the metabolite increase dramatically as the synthesis of the milk produced increases.

According to the NRC(11) at the start of lactation, approximately all cows are on a negative Ca2+ balance, so as lactation progresses and MY increases in volume, as a consequence the need for mineral increases.

Van't Klooster(23) indicated that the absorption of Ca2+ increased 22 % towards the end of pregnancy to 36 % by d 8 of lactation in cows that consumed total mixed ration (TMR).

What represented approximately 1.6 times increase in Ca2+ absorption. After that period, the changes were small and in response to increases in MY. Chapinal et al(9) indicated that Ca2+ effectively tends to increase in order to cover the demand of the mineral for milk synthesis. This study included 48 herds, of which 33 % were above the risk threshold when Ca2+ was determined on d -7, compared to 40 % of them that were above the same threshold when determined Ca2+ on d 7 postpartum.

In the present study, serum Ca2+ concentrations were approximately 2.46 mmol L-1, with a wide range of variation from 1.24 to 4.98 mmol L-1. As indicated, previously, the Ca2+ 29

Rev Mex Cienc Pecu 2021;12(1):18-35

threshold was <2.3 mmol L-1, suggesting that a high proportion of cows were at risk of presenting subclinical hypocalcemia (serum Ca2+ concentration <1.8 mmol L-1(24); although the signs of milk fever were imperceptible.

As indicated above, the herd under study has the highest productive indicators of the dairy basin, and still presented a high number of cows prone to subclinical hypocalcemia. The inference could be true for herds with similar management conditions, where, possibly that condition can be a problem that limits MY. Another part of the explanation is also related to the age of the cow. Adult cows with more than four lactations (approximately 19 %) were more prone to hypocalcemia and were above the proposed threshold for Ca2+.

In support of the above, Venjakob et al(25) observed that primiparous cows with serum concentrations of Ca2+ < 2.0 mmol L-1 had no effect on MY, while adult cows not only showed hypocalcemia, but also produced less milk (- 2.19 kg animal-1 d-1) than cows free of the disease.

Neves et al(26) observed that prepartum cows with concentrations of Ca2+ ≤ 2.4 mmol L-1, had higher risks of being classified as subclinical hypocalcemia one week before parturition. The authors indicated that the Ca2+ threshold (≤ 2.4 mmol L-1) is required for the identification of animals in prepartum with a higher probability of presenting subclinical hypocalcemia. Herd-level studies using this cut-off point could establish objectives to measure the success of preventive strategies.

Additional studies are needed to determine the sampling times of blood around parturition, and to evaluate the relationship between fatty acids and Ca2+ in the prepartum. In modern dairy farms, the periparturient period (approximately 3 wk before and after parturition) presents the highest risks for developing diseases and mortality in cows. Ferguson (27) suggested that approximately one of two cows suffer adverse effects on their health, with approximately 75 % of the diseases occurring during the peripartal period(13). The most common metabolic diseases, such as hypocalcemia and hyperketonemia, have been shown to alter the cow's immune system, increase risks for other diseases, and reduce productive behavior(17).

In the current study, approximately 30 cows were above that threshold for NEFA on d -7, while for days 7 and 14 of lactation, number of cows increased from 108 to 224, respectively. The postpartum increase in NEFA levels could be explained by the increase in nutritional requirements due to the particular needs of lactation. This effect is related to the fact that most cows are in NEB, and they need to mobilize their body reserves of lipids in order to cover their energy needs(11,28).

Chapinal et al(9) from a larger study in cows and locations than the present study, but based on same BHBA, Ca2+, and NEFA thresholds concluded that approximately 11 % of 30

Rev Mex Cienc Pecu 2021;12(1):18-35

the herds studied were above the risk threshold on d -7 compared with 23 % of herds on day seven of lactation. The authors concluded that 5 to 50 % of the animals sampled with NEFA levels above the thresholds both a week before and after were associated with risks of abomasal displacement, milk loss and pregnancy reduction at the first insemination.

In the present study, NEFA levels averaged 0.59 mmol L-1 with a range between 0.12 and 2.95 mmol L-1. This suggests that the cows in the study would be at risk of losing milk at the beginning of lactation, mainly due to some association with hypocalcemia and hyperketonemia due to the circulating levels of NEFA. The results obtained in the current study do agree with those from other studies. Ospina et al(19) found that NEFA concentrations > 0.3 mEq L-1 from d 14 to 2 prepartum, and NEFA > 0.6, and BHBA > 10 mg dL-1 from 3 to 14 d postpartum, both prepartum and postpartum values above these thresholds were associated with increases in ketosis, metritis, abomasal displacement, and placental retention.

In the current study, it was search through conditional logistic regression to relate the concentrations of metabolites with metabolic dysfunctions around parturition. However, the associations obtained were not significantly important and due to this they were not reported. One significant unique observation was as the blood NEFA increased (≥ 0.5 mmol L-1) there was an increase of up to 7.6 [Odd ratio = 7.61; (1.50 to 38.74; CI = 95%; P=0.01)] times the chances of laminitis occurrence; this may be due to the fact that lameness produces fever and pain in the hooves, which alter resting and feeding behavior of the animals(29,30).

Fever reduces the cow's appetite and pain in the hooves impair the ability to walk and look for feed. The deficiency of food increases the possibility of the removal of body reserves, increasing the free fatty acids.

Results from the current study were observed by others. Collard et al(29) indicated that plasma samples with NEFA concentrations of 0.6 to 0.8 mmol L-1 were associated with lameness presence around parturition in Holstein-Friesian dairy cows fed TMR. The results obtained in the present study in relation with the levels of NEFA and laminitis are contradictory with other reports in literature. Calderon and Cook(30) reported no relationship between lameness and NEFA in Holstein-Friesian cows around parturition in a mattress-bedded commercial free stall facility. They also observed that lame cows had longer lying times throughout the transition period and notably for 3 d before and after parturition. Lameness was also associated with a greater risk for ketosis in the study farm, as evidenced by the elevated BHBA concentration found in cows.

31

Rev Mex Cienc Pecu 2021;12(1):18-35

The results obtained in the present study offer the opportunity to examine the effects of pre and postpartum concentrations of NEFA and BHBA on MY at the cow level. The identification of these prepartum levels will allow the dairy producers to improve their strategies of nutritional management, in order to avoid losses in MY or to avoid the presence of metabolic disorders such as laminitis. The results obtained also show how the metabolism state influence health cow during the transition period suggesting that nutritional management has to be carefully reviewed due to its impact on subsequent lactation.

Conclusions and implications High proportion of cows are above the thresholds of β-hydroxybutyrate and nonesterified fatty acids, and most of them were also deficient in calcium, when determined one week before parturition. High β-hydroxybutyrate concentrations could promote losses in MY up to 0.37 kg cow-1d-1 seven days after calving in Holstein-Friesian cows.

High non-esterified fatty levels were associated with 7.6 times more risk of laminitis. The risk thresholds for each metabolite were not associated with the amount of milk lost at d 14 after calving in Holstein-Friesian cows.

Acknowledgments

The authors are grateful to Biotecap, especially Ing. Juan de Dios, and Dr. Adelfo Vite for providing the facilities to carry out the field phase of this study. The thanks are extended to Dr. Agustin Garza for facilitating the animals used in the experiment. Thanks, are also given to CONACYT for providing the funds for the Master of Science studies of the second author.

Literature cited: 1. Gross J, van Dorland HA, Bruckmaier RM, Schwarz FJ. Performance a metabolic profile energy balance with subsequent re-alimentation. J Dairy Sci 2011;94:1820– 1830, doi: 10.3168/jds.2010-3707.

2. Veech RL, Chance B, Kashiwaya Y, Lardy HA, Cahill GF. Ketone bodies, potential therapeutic uses. Inter Union Biochem Mol Biol 2001;51:241-247, doi:10.1080/152165401753311780.

32

Rev Mex Cienc Pecu 2021;12(1):18-35

3. Ruderman NB, Goodman MN. Regulation of ketone body metabolism in skeletal muscle.

Amer J Phys 1973;224:1391-1397. doi: 10.1152/ajplegacy.1973.224.6.1391.4.

4. Ospina PA, Nydam DV, Stokol T, Overton, TR. Associations of elevated non-esterified fatty acids and β-hydroxybutyrate concentrations with early lactation reproductive performance and milk production in transition dairy cattle in the northeastern of Unites States. J Dairy Sci 2010;93:1596–1603. doi:10.3168/jds.2009-2852.

5. Schlumbohm C, Harmeyer J. Hyperketonemia impairs glucose metabolism in pregnant and nonpregnant ewes. J Dairy Sci 2004;87:350-358. doi:10.3168/jds.S00220302(04)73174-4.

6. Duffield T, Lissemore K, McBride M, Leslie K. Impact of hyperketonemia in early lactation dairy cows on health and production. J Dairy Sci 2009;92:571-580. doi: 10.3168/jds.2008-1507.

7. Horst RL, Goff JP, Reinhardt TA. Calcium and vitamin D metabolism in the dairy cow.

J Dairy Sci 1994;77:1936–1951. doi: 10.3168/jds.S0022-0302(94)77140X. 8. Seifi HA, LeBlanc SJ, Leslie KE, Duffield TF. Metabolic predictors of postpartum disease and culling risk in dairy cattle. Vet J 2011; 188:216220. doi: 10.1016/j.tvjl.2010.04.007.

9. Chapinal N, LeBlanc S, Carson M, Leslie K, Godden S, Capel M, Duffield T. Herdlevel association of serum metabolites in the transition period with disease, milk production, and early-lactation reproductive performance. J Dairy Sci 2012;95:13011309. doi:10.3168/jds.2011-4724.

10. García E. Modificaciones al sistema de clasificación climática de Köppen. Instituto de Geografía. 5ta. ed. México: UNAM; 2005.

11. Fox N, Hunn A, Mathers N. Sampling and sample size calculation. The National Institute for Health Research. USA: NHR RDs eM/YH; 2009.

12. NRC. Nutrient Requirements of Dairy Cattle. 7th revised ed. National Academy of Sciences, Washington, DC USA: National Academy Press; 2001.

13. Perkin Elmer. Perkin Elmer Corporation. Analytical methods for atomic absorption.

Associations of Official Analytical chemists. 2000. Norwalk, Connecticut; 1996.

14. LeBlanc SJ, Duffield TF, Leslie KE, Bateman KG, Ten-Hag J, Walton JS, Johnson WH. The effect of prepartum injection of vitamin E on health in transition dairy cows.

J Dairy Sci 2002;85:1416–1426. doi: 10.3168/jds.S0022-0302(02)74209-4.

33

Rev Mex Cienc Pecu 2021;12(1):18-35

15. SAS. SAS User’s Guide: Statistics (Version 9.1.3). SAS Inst. Inc. Cary, NC, USA; 2012.

16. López-Ordaz R, Tinajero, PT, López OR, Mendoza G, Roldan MJ, Vite A, Ruiz FA. Relaciones entre calcio, ácidos grasos no esterificados, e insulina sanguínea en preparto y leche bovina perdida en el inicio de la lactancia. Nova Scientia 2017;9(19):306-328. doi:10.21640/ns.v9i19.1053.

17. Raboisson D, Mounie M, Maigne M. Disease, reproductive performance, and changes in milk production associated with subclinical ketosis in dairy cows: A meta-analysis and review. J Dairy Sci 2015;97:7457–7563. doi: 10.3168/jds.2014-8237.

18. Bruckmaier RM, Gross JJ. Lactational changes in transition dairy cows. Anim Prod Sci 2017; 57:1471-1483. doi.org/10.1071/ANI1657.

19. Ospina PA, Nydam DV, Stokol T, Overton TR. Association between the proportions of sampled transition cows with increased nonesterified fatty acids and betahydroxybutyrate and disease incidence, pregnancy rate, and milk production at the herd level. J Dairy Sci 2010;93:3595–3601. doi: 10.3168/jds.2010-3074.

20. Kelly JM. Changes in serum B hydroxybutyrate concentrations in dairy cows kept under commercial farm conditions. Vet Rec 1977;101:499–502.

21. Suthar VS, Canelas-Raposo J, Deniz A, Heuwieser W. Prevalence of subclinical ketosis and relationships with postpartum diseases in European dairy cows. J Dairy Sci 2013;96:2925–2938. doi: 10.3168/jds.2012-6035.

22. Mori M, Rossi S, Bonferoni MC, Ferrari F, Giuseppina S, Riva F, Del Fant C, Perotti C, Caramella C. Calcium alginate particles for the combined delivery of platelet lysate and vancomycin hydrochloride in chronic skin ulcers. Int J Pharmac 2014;461:505-513. doi.org/10.1016/j.ijpharm.2013.12.020.

23. van´t Klooster AT. Adaptation of calcium absorption from the small intestine of dairy cows’ changes in the dietary calcium intake and at the onset of lactation. Zeitschrift fuer Thierphysiology 1976;37:169-182.

24. Duffield TF, Lissemore KD, McBride BW, Leslie KE. Impact of hyperketonemia in early lactation dairy cow on health and production. J Dairy Sci 2005;92:571–580. doi:10.3168/jds.2008-1507.

25. Venjakob PL, Paiper L, Heuwieser W, Borchardt S. Association of postpartum hypocalcemia with early-lactation milk yield, reproductive performance, and culling in dairy cows. J Dairy Sci 2018;101:1-10. doi:10.3168/jds.2016-11714.

34

Rev Mex Cienc Pecu 2021;12(1):18-35

26. Neves RC, Leno BM, Curler MD, Thomas MJ, Overton TR, McArt JAA. Association diseases, culling, reproduction, and milk production in Holstein cows. J Dairy Sci 2017;100:547-5. doi:10.3168/jds.2017-13313.

27. Ferguson JD. Nutrition and reproduction in dairy herds. Vet Clin N Am Food Anim Pract 2005;21:325-333.

28. Bernabucci UL, Basiricó P, Morera D, Dipasquale A, Vitali F, Piccioli C, Calamari L. Effect of summer season on milk protein fractions in Holstein cow. J Dairy Sci 2015;98:1815-1827. doi: 10.3168/jds.2014-8788.

29. Collard BL, Boettcher PJ, Dekkers JCM, Petitclerc D, Schaeffer LR. Relationships between energy balance and health traits of dairy cattle in early lactation. J Dairy Sci 2000;83:2683–2690. doi: 10.3168/jds.S0022-0302(00)75162-9.

30. Calderon DF, Cook NB. The effect of lameness on the resting behavior and metabolic status of dairy cattle during the transition period in a free stall-housed dairy herd. J Dairy Sci 2011;94:2883-2894. doi:10.3168/jds.2010-3855.

31. AOAC. Association of Official Analytical Chemists. Official methods of analysis. 18th. ed. Association of Official Analytical Chemists Press.

Gaithersburg, MD. AOAC International. 2006.

32. Goering HK, Van Soest PJ. Forage fiber analyses (apparatus, reagents, procedures, and some applications) Agricultural handbook no. 379. ARSUSDA, Washington, DC, USA. ARS-USDA Press Inc. 1970.

35

https://doi.org/10.22319/rmcp.v12i1.5106 Article

Genetic characterization of Mexican Pelibuey sheep using microsatellite markers

Cecilio Ubaldo Aguilar Martínez a Bertha Espinoza Gutiérrez b José Candelario Segura Correa c José Manuel Berruecos Villalobos d Javier Valencia Méndez a Antonio Roldán Roldán e*

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Reproducción. Avenida Universidad 3000, Ciudad Universitaria, Ciudad de México, México. b

Universidad Nacional Autónoma de México. Instituto de Investigaciones Biomédicas, Departamento de Inmunología. Ciudad de México, México. c

Universidad Autónoma de Yucatán. Campus de Ciencias Biológicas y Agropecuarias.

Yucatán, México d

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Genética y Bioestadística. Ciudad de México, México. e

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Fisiología y Farmacología. Ciudad de México, México.

*Corresponding author: arre@comunidad.unam.mx

Abstract: This study aimed to genetically characterize 23 subpopulations of the Mexican Pelibuey sheep and a Cuban flock using nine microsatellite markers. A total of 99 alleles and a polymorphic information content (PIC) of 0.84 were observed. The observed FIS, FST, and FIT were 0.007, 0.151, and 0.158, respectively. Three primers (OarFCB304, 36

Rev Mex Cienc Pecu 2021;12(1):36-57

OarJMP29, and ILSTS5) showed deviations in the Hardy-Weinberg equilibrium (HWE; P<0.05). In a subpopulation analysis, the number of alleles per subpopulation ranged from 28 to 49, the mean number of alleles (MNA) was 4.08, and the effective number of alleles (NE) was 3.25. The observed and expected heterozygosity values were 0.726 and 0.731, respectively. Six of the 24 evaluated subpopulations showed deviations of the HWE (P<0.05). The FIS values by subpopulation varied between -0.71 and 0.138. Nine private alleles were detected, and no shared alleles were observed. Using a principal component analysis (PCA), subpopulations were grouped into two clusters. Mantel's test determined that the genetic distance (measured by Nei's unbiased minimum distances) was not related to the geographic distance (r= -0.062; P>0.05). The population structure analysis determined two founder populations (K), similar to the PCA. This study concludes that the Pelibuey sheep in Mexico have high genetic diversity and that its subpopulations are grouped into two clusters, one of which shows the most preserved genetic material.

Key words: Pelibuey, Genetic characterization, Microsatellites, Hair sheep.

Received: 10/10/2018 Accepted: 01/07/2020

Introduction

Pelibuey is the most important hair sheep breed in Mexico. It entered the country between 1930 and 1940 from Cuba(1,2,3), and since then, no new genetic material has entered the country. Initially, Pelibuey sheep were distributed in tropical regions. Nowadays, it is spread throughout the country(4). Pelibuey sheep are not highly productive; their biological importance lies in their ability to adapt to different environments and climates(5) and reproduce throughout the year(6).

The wide range of environments in which Pelibuey sheep have been bred has led to adaptive responses, which are part of their gene pool. However, in recent years, this breed has been subjected to indiscriminate crosses with breeds specialized in meat production to increase its productivity(3,7); this has put at risk the original genetic diversity of the breed. Additionally, artificial insemination and the intense flow of genetic material between flocks have exacerbated the problem(8).

An initial step for the conservation of animal genetic resources is breed characterization.

The Food and Agriculture Organization of the United Nations (FAO) has proposed that 37

Rev Mex Cienc Pecu 2021;12(1):36-57

the initial characterization should include a phenotypic description of the breed and its subsequent genetic characterization using molecular markers(9). Molecular markers, such as microsatellites, have been used in population genetics to characterize several breeds(9).

More profound knowledge about the genetic diversity and variability and the population structure of different flocks in Mexico will allow us to determine the degree of risk of the Pelibuey sheep and, consequently, suggest viable strategies for its conservation.

Therefore, this study aimed to characterize different Pelibuey subpopulations in Mexico using microsatellite markers.

Material and methods Sampling

Blood samples were collected from 119 Pelibuey sheep from 23 domestic flocks and one Cuban flock. Domestic flocks were sampled in the agroecological zones that correspond to the tropical wet, tropical dry, and central mountainous regions. The geographical location of the domestic flocks is shown in Figure 1. Of the 24 flocks, 11 belong to universities or research institutes; the remaining 13 belong to private producers. All the flocks in this study were handled according to the Institutional Animal Care and Use Committee (SICUAE, as per its acronym in Spanish) of the School of Veterinary Medicine and Zootechnics of the UNAM. The flocks that belong to the Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP) in Yucatan (INIFAP Mocochá=IN-MOC) and Puebla (INIFAP Las Margaritas= IN-MAR) were considered as the domestic reference subpopulations because they were the first to settle in Mexico and their breeding practices have targeted the conservation of their breed. Furthermore, both have served as the basis for the formation of other domestic flocks. The inclusion criteria were the following: an external appearance characteristic of the Pelibuey sheep, female specimens, clinically healthy, and not related to each other.

38

Rev Mex Cienc Pecu 2021;12(1):36-57

Figure 1: Geographical location of the domestic Pelibuey sheep flocks included in this study

The order of the subpopulations can be found in Table 2. 1. INIFAP Mocochá (IN-MOC), 2. INIFAP Las Margaritas (IN-MAR), 3. Centro de Enseñanza, Investigación y Extensión en Ganadería Tropical (CEIEGT)-UNAM, 4. Centro de Enseñanza, Investigación y Extensión en Producción y Salud Animal (CEPIPSA)-UNAM, 5. Instituto Tecnológico de Conkal (ITC), 6. Universidad del Papaloapan (UNPA), 7. Colegio de Postgraduados Campus Córdoba (COLPOS-COR), 8. Universidad Veracruzana (UV), 9.

Benemérita Universidad Autónoma de Puebla (BUAP), 10. Colegio de Postgraduados Campus Texcoco (COLPOS-TEX), 11. Universidad de Colima (UCOL), 12. Rancho San Alberto, 13. Rancho Garrido, 14.

Rancho Belbesah, 15. Rancho Libertad, 16. Rancho Jalapa, 17. Rancho El Porvenir, 18. Rancho El Paraíso, 19. Rancho Santa Anita, 20. Posta El Cuatro, 21. Finca El Cielo, 22. Rancho La Fama, and 23.

Rancho El Carrizal.

Following FAO recommendations, the analysis included five individuals from each flock(10). We only included four samples of the Rancho Jalapa and Rancho El Carrizal flocks because of the DNA degradation of some samples.

Blood samples (6 ml) were obtained by jugular venipuncture and collected in Vacutainer® tubes with EDTA as an anticoagulant; samples were labeled at the time of sampling. Samples were stored at -80 °C until further processing and analysis.

DNA extraction and polymerase chain reaction (PCR)

DNA isolation was carried out based on a simple and inexpensive protocol for extracting DNA from poultry blood samples(11). This protocol was subsequently adapted for sheep blood(12).

39

Rev Mex Cienc Pecu 2021;12(1):36-57

The yield and purity of the extracted DNA were determined by spectrophotometry (NanoDrop Thermo Scientific, Wilmington, DE). These results were corroborated by a 0.8% agarose gel electrophoresis using 10 µL of the extracted DNA. The extracted DNA was stored at -80 °C until further used.

Nine microsatellite markers were amplified through PCR following the International Society for Animal Genetics (ISAG) and the FAO(10,13) recommendations. The PCR reactions were carried out in a final volume of 25 µL and consisted of 100 ng of genomic DNA (2 µL), 0.2 µM of each primer (Forward and Reverse; 0.5 µL), 200 µM of each dNTP (2.5 µL), 2.5 mM of MgCl2+ (0.5 µL), 1.25 U of DNA Taq polymerase (0.25 µL), 10 X PCR buffer (2.5 µL), and 16.25 µL of sterile water.

PCR reactions were carried out in a thermocycler (Axygen Scientific Inc.). The PCR protocol was the following: an initial denaturation step at 95 °C for 5 min; followed by 35 cycles of denaturation at 94 °C for 45 s, annealing for 1 min at variable temperature, and extension at 72 °C for 1 min; with a final extension at 72 °C for 10 min.

Amplifications were stored at 4 °C until further analysis.

Electrophoresis

Amplifications were subjected to a non-denaturing polyacrylamide (12 %) gel electrophoresis. Electrophoresis was carried out with 0.5% TBE as a running buffer. The size of the DNA fragments was determined using a 25 bp molecular weight ladder (Invitrogen Life Technologies, Carlsbad, USA). Gels were stained with 0.5 µg/ml of ethidium bromide and visualized under ultraviolet light (Kodak Gel Logic 2200 Imaging System). The gel images were processed using the MyImageAnalysisSystem TM (Fisher) software.

Statistical analysis

The number of alleles (NA), effective number of alleles (NE), mean number of alleles (MNA), Shannon index (I), observed heterozygosity (HO), and expected heterozygosity (HE) for each marker were estimated using the POPGENE v.1.31(14) and FSTAT(15) software. The polymorphic information content (PIC) was calculated with the CERVUS v 3.0.7(16) software. For each marker, exact tests were carried out to determine deviations from Hardy-Weinberg equilibrium (HWE) through the Markov chain Monte Carlo simulation method using the GENEPOP v 4.7.0(17,18) software.

40

Rev Mex Cienc Pecu 2021;12(1):36-57

F statistics measured genetic structure. The inbreeding index within a population (FIS), fixation index of the total population (FIT), and the genetic differentiation index between populations (FST) were calculated with the GENEPOP v 4.7.0 software, carrying out 1,000 permutations(17,18). Private alleles were analyzed using the GENALEX v 6.5 software(19,20). Shared alleles between subpopulations were analyzed by creating a binary matrix that recorded the presence (1) or absence (0) of each of the alleles in the subpopulations. Subsequently, the proportions of the subpopulations with the most and least common shared alleles were calculated.

The genetic flow between the subpopulations was measured through the number of migrants per generation (Nm) and calculated from the FST between pairs of subpopulations using the GENETIX v. 4.05 software(21).

Isolation by distance between subpopulations was analyzed using a Mantel test(22), which consisted of correlating the genetic distances (measured through Nei's unbiased minimum distances(23)) and the geographic distances between the subpopulation pairs using the XLSTAT software. This test used a significance of 0.05 and 10,000 permutations.

The spatial relationships between the subpopulations were analyzed using a principal component analysis (PCA) implemented in the PCAGEN software(24). The population structure and degree of mixture were estimated using a Bayesian clustering model implemented in the STRUCTURE v 2.3(25) software. This analysis involved a mixture model with correlated allele frequencies. To choose the correct number of inferred clusters (K) needed to model the data, 2-24 clusters were inferred with 20 independent runs in each cluster. All runs used 100,000 interactions (burn-in), followed by 1,000,000 interactions (MCMC). The most probable number of K was calculated with the ΔK algorithm using the online software STRUCTURE HARVESTER(26). Finally, results were processed using the online software CLUMPAK(27) to interpret the obtained inferences.

Results Genetic diversity of the entire population

Table 1 shows the global statistics obtained with the nine microsatellites. For the entire Pelibuey population, 99 alleles were detected in 119 animals genotyped with nine microsatellite primers. All loci were polymorphic in the analyzed subpopulations. The number of alleles per locus fluctuated from 9 (OarCP34, OarFCB304, and ILSTS5) to 14 (OarJMP58). The observed average number of alleles per locus was 11. The NE ranged from 5.31 (OarCP34) to 8.68 (OarJMP58).

41

Rev Mex Cienc Pecu 2021;12(1):36-57

Table 1: Global statistics obtained with the nine microsatellites Marker

TA (°C)

SR (bp)

NA

NE

HO

HE

PIC

I

HWE

FIT

FST

OarCP34

58

96134

9

5.31

0.731

0.740

0.79

1.90

NS

0.111*

0.099*

OarFCB304

58

140210

11

7.34

0.812

0.741

0.85

2.11

0.0285*

0.075*

0.154

OarJMP29

56

110180

12

6.67

0.694

0.807

0.83

2.11

0.0002*

0.185

0.056*

OarJMP58

58

130185

14

8.68

0.737

0.761

0.87

2.35

NS

0.173

0.148

DYMS1

58

155225

11

8.53

0.697

0.778

0.87

2.26

NS

0.217*

0.130

ILSTS5

58

180235

9

6.65

0.781

0.664

0.84

2.00

0.0180*

0.092*

0.228*

SRCRSP5

58

146200

12

6.24

0.699

0.667

0.82

2.06

NS

0.180

0.215*

SRCRSP9

58

95135

10

7.65

0.657

0.723

0.86

2.14

NS

0.255*

0.180

MAF33

60

115170

11

5.73

0.730

0.707

0.80

1.97

NS

0.123

0.150

11

6.97

0.726

0.732

0.84

2.1

0.158

0.151

Average

Annealing temperature (TA), allele size range (SR), number of alleles (NA), effective number of alleles (NE), observed heterozygosity (HO), expected heterozygosity (HE), polymorphic information content (PIC), Shannon index (I), deviation from the Hardy-Weinberg equilibrium (HWE), fixation index of the entire population (FIT), and differentiation index between populations (FST) of the nine microsatellite markers used in the genetic characterization of Pelibuey sheep.

NS = non-significant; *P<0.05.

The HO values ranged from 0.657 (SRCRSP9) to 0.812 (OarFCB304). The average HO for the entire population was 0.726. Moreover, HE fluctuated from 0.664 (ILSTS5) to 0.807 (OarJMP29), with an average of 0.732. The PIC for each marker ranged from 0.79 (OarCP34) to 0.87 (OarJMP58 and DYMS1), with a global average of 0.84. The I value was between 1.90 (OarCP34) and 2.35 (OarJMP58), with a global average of 2.1.

The microsatellite markers were tested for deviation from the HWE. Most loci were under HWE. However, OarFCB304, OarJMP29, and ILSTS5 showed a significant deviation from the HWE (P<0.05). The global values of FIS, FIT, and FST were 0.007, 0.158, and 0.151, respectively, with no significant differences (P>0.05). The highest FIS value (0.136) was observed in the OarJMP29 marker; the lowest value (-0.176) was observed in the ILSTS5 marker. The highest FIT value (0.255) was observed in the SRCRSP9 locus, the lowest (0.075) in the OarFCB304 locus. Furthermore, the highest FST value (0.228) was observed in the ILSTS5 locus, the lowest (0.056) in the OarJMP29 locus.

The differences between subpopulations, evaluated by the multilocus values of FST, revealed that, for the most part, genetic variation corresponds to differences between

42

Rev Mex Cienc Pecu 2021;12(1):36-57

individuals within the subpopulations (84.9 %); 15.1 % results from differences between subpopulations.

Genetic diversity between subpopulations

Table 2 shows the genetic diversity measures for each subpopulation. The subpopulation with the higher genetic diversity was UNPA (49 alleles); the subpopulation with the lowest genetic diversity was IN-MOC (28 alleles), with a global average of 36.6 alleles per subpopulation. The average MNA and NE were 4.08 and 3.25, respectively. The highest values were observed in the UNPA subpopulation (5.44 and 4.20, respectively); the IN-MOC subpopulation had the lowest values (3.11 and 2.46, respectively).

Table 2: Number of animals (n), total number of alleles (TNA), mean number of alleles (MNA), effective number of alleles (NE), observed heterozygosity (HO), expected heterozygosity (HE), and inbreeding coefficient within the population (FIS) in 24 Pelibuey sheep subpopulations, based on the analysis with nine microsatellite markers Population

State

n

IN-MOC IN-MAR CEIEGT CEPIPSA ITC UNPA COL-CORD UV BUAP COL-TEX

Yucatan Puebla Veracruz Mexico City Yucatan Oaxaca Veracruz Veracruz Puebla Mexico State Colima Yucatan Yucatan Yucatan Yucatan Tabasco Tabasco Puebla SLP Jalisco Sinaloa Sinaloa BCS La Habana

5 5 5 5 5 5 5 5 5 5

28 30 30 30 36 49 37 37 37 43

5 5 5 5 5 4 5 5 5 6 5 5 4 5 119

36 38 38 39 43 32 37 34 31 44 38 39 36 37 36.6

UCOL Rancho San Alberto Rancho Garrido Rancho Belbesah Rancho Libertad Rancho Jalapa Rancho El Porvenir Rancho El Paraíso Rancho Santa Anita Posta El Cuatro Finca El Cielo Rancho La Fama Rancho El Carrizal Cuba Total/Average

TNA MNA

NE

HO

HE

FIS

3.11 3.33 3.33 3.33 4.11 5.44 4.11 4.11 4.11 4.78

2.46 2.73 2.62 2.73 3.0 4.20 3.72 3.28 3.32 4.10

0.666 0.733 0.689 0.779 0.778 0.778 0.756 0.711 0.711 0.800

0.627 0.664 0.651 0.677 0.721 0.840 0.782 0.674 0.738 0.803

-0.071 -0.118* -0.064 -0.171* -0.089* 0.081 0.038 -0.062 0.041 0.003

4.0 4.22 4.22 4.33 4.89 3.56 4.11 3.78 3.44 4.89 4.22 4.33 4.0 4.11 4.08

3.10 3.47 3.20 3.58 3.89 2.92 3.32 2.77 2.82 3.45 3.40 3.60 3.26 3.27 3.25

0.733 0.711 0.689 0.733 0.711 0.694 0.733 0.733 0.689 0.685 0.711 0.733 0.694 0.779 0.726

0.709 0.733 0.751 0.758 0.812 0.706 0.733 0.686 0.699 0.735 0.746 0.787 0.778 0.738 0.731

-0.039 0.033 0.091* 0.036 0.138* 0.019 0.000 -0.077 0.015 0.075 0.051 0.076 0.122* -0.060 0.0072

INIFAP: Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias; CEIEGT: Centro de Enseñanza, Investigación y Extensión en Ganadería Tropical; CEPIPSA: Centro de Enseñanza, Investigación y Extensión en Producción y Salud Animal; COLPOS: Colegio de Postgraduados; BUAP: Benemérita Universidad Autónoma de Puebla. *Indicates FIS different from zero (P˂0.05).

43

Rev Mex Cienc Pecu 2021;12(1):36-57

The average HO was 0.726. The lowest value was observed in the IN-MOC subpopulation (0.666), the highest in COL-TEX (0.800). The average HE was 0.731. The lowest value was observed in the IN-MOC subpopulation (0.627), the highest in UNPA (0.840).

The average FIS for each subpopulation, considering all loci, fluctuated from -0.171 (CEPIPSA) to 0.138 (Rancho Libertad). Nine of the 24 analyzed subpopulations (INMOC, ITC, UV, CEIEGT, IN-MAR, Rancho El Paraíso, CEPIPSA, UCOL, and Cuba) showed negative FIS values; the remaining 15 had positive values. Six subpopulations showed (Table 2) FIS values different from zero (P<0.05), with positive (Rancho Garrido, Rancho Libertad, and Rancho El Carrizal) and negative values (ITC, IN-MAR, and CEPIPSA).

The allele analysis (Table 3; end of manuscript) demonstrated the presence of nine private alleles (9.09% of the 99 alleles) distributed in seven subpopulations (29.1% of the 24 flocks). The Posta El Cuatro subpopulation had three private alleles; CEIEGT, COLPOSCORD, Rancho San Alberto, Rancho Belbesah, Rancho Libertad, and Rancho Jalapa had one private allele. The loci that contributed to private alleles were OarFCB304 (2), OarJMP29 (2), SRCRSP5 (2), MAF33 (2), and SRCRSP9 (1). The frequencies of private alleles ranged from 0.083 in Posta El Cuatro (markers OarFCB304 and OarJMP29) to 0.400 in CEIEGT (marker SRCRSP9). The Cuban Pelibuey flock had no private alleles.

Although not all subpopulations shared alleles, it was identified two alleles ("110" and "150" of the OarCP34 and OarJMP29 loci, respectively) that were shared by 23 subpopulations (95.83 %). Table 4 (end of the manuscript) shows the analysis of the genetic flow (measured by Nm). The highest value of Nm was observed between the CEIEGT and CEPIPSA subpopulations. Of the 276 possible subpopulation comparisons, 222 (80.43 %) had a Nm higher than 1; 14 (5.07 %) had a Nm higher than 4.

The isolation by distance in the subpopulations was corroborated using Mantel's test (Figure 2). This analysis showed that the genetic differentiation between the Pelibuey sheep subpopulations (measured through Nei's unbiased minimum distances) is not related to their geographic distances (r= -0.062; P>0.05).

44

Rev Mex Cienc Pecu 2021;12(1):36-57

Figure 2: Relationship between the pairs of Nei's unbiased minimum genetic distances and the geographic distances (r=-0.062; P>0.05)

Genetic relationships between subpopulations and population structure analysis

A PCA was carried out using the frequencies of the 99 alleles observed in the population.

Figure 3 shows the global PCA. The first two principal components explained 30.21 % of the total variation. The first axis contributed 17.04 % of the variance and separated the flocks into two clusters. Subpopulations IN-MOC, IN-MAR, CEIEGT, CEPIPSA, and ITC comprise the first cluster. The second axis contributed 13.17% of the variance and separated the UCOL, COLPOS-CORD, Rancho el Paraíso, Universidad Veracruzana, ITC, and IN-MAR subpopulations.

Figure 3: Principal component analysis between Pelibuey sheep subpopulations in Mexico. The first two components were included

45

Rev Mex Cienc Pecu 2021;12(1):36-57

The analysis with the STRUCTURE software demonstrated the presence of two ancestral populations (K), similar to the PCA. The first group included the IN-MOC, IN-MAR, CEIEGT, CEPIPSA, and ITC subpopulations (Figure 4). Hypothetically, if K=3 or K=4, it would be possible to observe the formation of new clusters; however, the subpopulations of the first group remain constant.

Figure 4: Clustering of the different Pelibuey sheep subpopulations in Mexico using the STRUCTURE software

Each individual is represented by a vertical bar, which is typically segmented into various colors. The colors represent the proportions of the ancestral populations (K=2, K=3, K=4) that make up the individual genome. Black lines separate subpopulations.

Discussion Genetic diversity of the entire population

This study is the first genetic characterization of Pelibuey sheep using microsatellites.

The average NA was 11, which is lower than the 14.27 value reported in a previous study carried out in 13 Colombian sheep breeds using 11 microsatellite markers(28); however, it is very similar to the 10.96 value reported in nine Spanish, Cuban, Mexican, and African 46

Rev Mex Cienc Pecu 2021;12(1):36-57

breeds using 26 microsatellite markers(29). The average NE was 3.25, which is lower than the 3.73 observed in five Chinese sheep breeds(30) and the 4.68 value reported in Colombian sheep breeds(28). When contemplating all loci, the NA was higher than the NE, which indicates that alleles are irregularly distributed in each of the loci; this could be because of the geographic isolation or the selection or flow of genetic material between subpopulations(31).

Heterozygosity is a parameter that reflects the genetic diversity in the population. The average values of HO and HE (0.726 and 0.732, respectively) were very similar in all loci. Values are similar to those observed in several Spanish, Cuban, Mexican, and African sheep breeds, in which an average HE value of 0.731 was reported(29). A different study reported HO and HE values of 0.744 and 0.755, respectively, in several Hungarian sheep breeds(32). In four of the nine analyzed markers (OarFCB304, ILSTS5, SRCRSP5, and MAF33), the HO was higher than the HE, suggesting an excess of heterozygotes in the analyzed subpopulations.

The PIC values in this study were greater than 0.7; this indicates that the markers used in this study correctly measure genetic diversity. The average value of the Shannon Index (2.1) was similar to the 2.2 value obtained in 14 types of Iranian sheep (33) and the 2.38 value reported in four Nigerian sheep breeds(34). This result reflects the high genetic variability of the analyzed subpopulations.

Three of the nine markers showed a deviation from the HWE due to either high (OarFCB304 and ILSTS5) or low heterozygosity (OarJMP29). Although the deviation from the HWE can have biological implications, such as intensive selection, inbreeding, migration, mutation, or an insufficient number of samples(35), it is also possible that this deviation results from errors during genotyping(36). In this study, it was only observed deviation from the HWE in 20 of the 216 Fisher's exact tests; therefore, it was decided to keep all markers in subsequent analyses.

The observed FIT value (0.158) indicates a global deficiency of 15.8 % of heterozygotes in the population. Furthermore, the FST value (0.151) indicates that 15.1 % of the genetic variation corresponds to differences between subpopulations. Similar values in both indexes were found in several sheep breeds, where FIT and FST values of 14.2 and 13.4 %, respectively, were observed(29). Thus, both values indicate that there is moderate genetic differentiation between the studied flocks.

Genetic diversity between subpopulations

The highest NA, MNA, and NE values corresponded to the UNPA, COL-TEX, Rancho Libertad, and Posta El Cuatro subpopulations. The genetic diversity in these subpopulations can be attributed to the introduction of new individuals, which was 47

Rev Mex Cienc Pecu 2021;12(1):36-57

corroborated with the flocks' record books. Furthermore, Posta El Cuatro corresponds to a unit intended for the production of record Pelibuey specimens. In recent years, pure Pelibuey breeders have substantially improved the productive yield of this breed by resorting to the crosses between different Pelibuey lines. In Rancho Libertad, the high values of FIS (0.138) do not support the latter. However, this result could be attributed to the reduced sample size of the subpopulation. The lowest NA, MNA, and NE were observed in the IN-MOC, IN-MAR, CEIEGT, and CEPIPSA subpopulations; this is probably because these subpopulations belong to universities and research institutes, which have remained as closed centers and have not allowed the introduction of new animals. Thus, the breed's original genetic material is expected to be more conserved in these subpopulations. The negative FIS values confirm that these flocks follow a minimum inbreeding policy.

The HO (0.726) and HE (0.731) values obtained in this study were higher than those observed in a Pelibuey flock in Queretaro, Mexico (HO= 0.652 and HE= 0.659)(29).

Furthermore, an HO of 0.72 and an HE of 0.71 was observed in a Colombian Pelibuey flock(28). The high global values of HO and HE could be attributed to the analysis of several subpopulations since the other studies only evaluated one flock.

The total value of FIS was 0.0072. However, in nine subpopulations (IN-MOC, UV, Rancho El Paraíso, IN-MAR, ITC, UCOL, CEIEGT, CEPIPSA, and Cuba), FIS was negative, suggesting an excess of heterozygotes. In the remaining subpopulations, FIS was positive, indicating a deficiency of heterozygotes; this coincides with the heterozygosity values since, in the same subpopulations, the HO was higher than the HE. Previous studies in Pelibuey sheep have reported FIS values of 0.023(29) and 0.02(28), indicating a slight deficiency of heterozygotes. The negative FIS values could be explained by the absence of inbreeding, high heterozygosity values, and low selection pressure, similar to what has been observed in other studies(33). High FIS values (Rancho Garrido, Rancho Libertad, and Rancho El Carrizal) indicate a deficiency of heterozygotes commonly associated with selection and inbreeding(37). In farm animal populations, inbreeding is a common finding due to flaws in reproductive programs and the fact that they are relatively small populations. Furthermore, the small number of sampled individuals per subpopulation could also contribute to the estimations obtained in these subpopulations.

Private alleles are defined as those that occur in a single population or subpopulation.

Nine private alleles were detected in six of the evaluated subpopulations. The subpopulation with the highest number of private alleles (3) was Posta El Cuatro. The CEIEGT, COLPOS-CORD, Rancho San Alberto, Rancho Belbesah, Rancho Libertad, and Rancho Jalapa had one private allele. Except for allele "95" (CEIEGT subpopulation, locus SRCRSP9), which had a 0.400 frequency, private alleles showed relatively low frequencies (0.083-0.125). Thus, these private alleles are more at risk of disappearing if not considered in breeding programs. Private alleles with higher frequencies indicate that a population is unique and has a certain degree of isolation(38), which is compatible with 48

Rev Mex Cienc Pecu 2021;12(1):36-57

the recent history of the CEIEGT flock; this flock has behaved as a closed core, avoiding the introduction of new genetic material. Additionally, the negative FIS (-0.064) rules out the possibility that the high frequency of the allele mentioned above is due to an inbreeding process.

The private alleles observed with low frequencies in the analyzed subpopulations could be due to relatively recent mutation events(39). Microsatellites have high mutation rates that range from 10-6 to 1x10-2(40); this allows the appearance of a mutation in 1/1,000,0001/100 individuals per generation. Additionally, private alleles could also be due to the high gene flow between subpopulations(41); this is corroborated by the global FST (0.151) observed in this study, which indicates a moderate gene flow between subpopulations.

The private allele analysis could not differentiate the Cuban subpopulation from the Mexican flocks. It is important to consider the founder effect that resulted from the introduction of the Pelibuey breed into Mexico, in which only a few specimens of the total Cuban population were selected. The genetic drift of the Pelibuey specimens introduced into Mexico played an important role in the extinction or fixation of available alleles. Furthermore, mutations could significantly contribute to the emergence of new alleles within the newly formed flock. Therefore, a substantial difference between the genetic diversity of the Mexican and Cuban flocks would be expected. However, in this study, it was observed that the Cuban flock shares alleles with the Mexican flock; this could be because the Cuban subpopulation consisted of only five individuals, representing a minimum sample of the actual genetic diversity. Therefore, it is impossible to carry out an objective comparison of both subpopulations; results should only be considered indicative.

The analysis of shared alleles did not identify alleles shared between all subpopulations.

However, alleles "110" and "150", corresponding to the OarCP34 and OarJMP29 loci, were found in 23 of the 24 analyzed subpopulations; only UV and Rancho Belbesah were missing these alleles. Future research should determine if these alleles could be used as markers of the Pelibuey breed.

The gene flow analysis, measured by the Nm, showed that CEIEGT and CEPIPSA (Nm= 16.39) had the highest gene flow, which corresponds with their record books. These flocks belong to the Universidad Nacional Autónoma de México (UNAM), where rams from CEIEGT have been regularly introduced to CEPIPSA for some years. Furthermore, the Nm analysis confirmed that the value was greater than one in 80.43 % of the subpopulation pairs. Meanwhile, 5.07 % of the subpopulation pairs reached values higher than four. Nm values lower than one indicate that the gene flow is not enough to counteract the differentiation caused by the genetic drift between subpopulations; therefore, subpopulations tend to differentiate. Values greater than one prevent differentiation. Moreover, if the Nm is higher than four, subpopulations behave as a panmictic population(42); this is corroborated by the global FST (0.151), which indicates a moderate gene flow between subpopulations.

49

Rev Mex Cienc Pecu 2021;12(1):36-57

The correlation between the genetic and geographic distances was nonsignificant; this means that the genetic structure of the Pelibuey flocks does not correspond to isolation by distance model between subpopulations. This could be attributed to the flow of Pelibuey specimens across the country.

Genetic relationships between subpopulations and population structure analysis

The PCA showed that the first component separated the IN-MOC, IN-MAR, CEIEGT, CEPIPSA, and ITC subpopulations from the rest. This result was expected since these populations belong to research institutes and universities, where the main focus is research and breed conservation. The latter was previously corroborated by the negative FIS values that indicate high heterozygosity. The second group was conformed of flocks from other universities and research institutes (BUAP, COL-TEX, COL-COR, UCOL, and UNPA), all the private producers, and the Cuban flock. The divergence of the second group is probably due to the current flow of specimens between Pelibuey subpopulations in Mexico; this is supported by the moderate FST value of 0.151 and the significant proportion of subpopulation pairs with an Nm greater than one. Recently, reproductive technologies, such as embryo transfer and artificial insemination, have enabled faster genetic improvement(8). Such technologies and the specimen flow (especially rams) between production units have substantially modified the original Pelibuey sheep genetic diversity. Additionally, the crossings with other breeds have significantly increased, resulting in greater divergence. Exhaustive studies should verify the breed's genetic erosion.

The second component of the PCA separated the UCOL, COLPOS-CORD, Rancho el Paraíso, Universidad Veracruzana, ITC, and IN-MAR subpopulations. These subpopulations belong to research institutes, universities, and private producers.

Although it is difficult to explain, this clustering could be due to the practices to which the flocks have been subjected in recent years. For example, the UCOL and IN-MAR populations have drastically decreased; furthermore, Rancho El Paraíso has started introducing new genetic material.

The analysis with the STRUCTURE software suggests that all the Pelibuey subpopulations in Mexico originated from two ancestral populations that have diverged after several years of adaptation to different environments and practices. Furthermore, each of the subpopulations has a mixture of both clusters to a greater or lesser degree.

The IN-MOC, IN-MAR, CEIEGT, CEPIPSA, and ITC subpopulations were grouped into one cluster, as observed in the PCA (first component). The relationship between the Mexican reference subpopulations and the other flocks was confirmed with the shared

50

Rev Mex Cienc Pecu 2021;12(1):36-57

allele analysis previously mentioned. Furthermore, the analysis with STRUCTURE shows low mixture levels between the subpopulations in this cluster and the second one.

Additionally, it has been confirmed that the main objective of those populations is research and breed conservation. If hypothetically is considered a K= 3 or K= 4, it would be possible to observe that the IN-MOC, IN-MAR, CEIEGT, CEPIPSA, and ITC subpopulations continue clustering together; this allows to conclude that these subpopulations have the most preserved genetic material.

Conclusions and implications The Pelibuey sheep subpopulations in this study showed high genetic diversity and were genetically different from each other. The principal component analysis and the population structure study conclude that the IN-MOC, IN-MAR, CEIEGT, CEPIPSA, and ITC subpopulations have the most preserved genetic material. These results suggest that animals from these subpopulations could be used to implement national conservation programs for the Pelibuey breed. During this study, was observed that despite the significant importance of the Pelibuey breed in sheep farming and research, there are flocks, such as IN-MAR and UCOL, in which the number of individuals has decreased and could potentially disappear. Currently, there are research groups and organizations in Mexico, such as the Unidad Nacional de Ovinocultores [National Unit of Sheep Farmers], that have recognized the importance of the Pelibuey breed in Mexican sheep farming.

Through individual efforts, they have tried to contribute to its conservation. A comprehensive plan is required for the conservation of this breed and the preservation of their genetic material. Further studies are essential to determine if there is genetic erosion of the Pelibuey sheep in Mexico.

Acknowledgments

The PAPIIT project 28RN-219115 financed this research. The authors thank all the owners and people in charge of the flocks included in this study, especially the M.S. Octavio Rojas from INIFAP Mocochá.

Literature cited: 1. Berruecos VJM, Valencia ZM, Castillo RH. Genética del borrego Tabasco o Peligüey.

Téc Pecu 1975;29:59-65.

2. Montalvo MP, Romualdo MJG, Sierra VA, Ortiz OJ, Hernández ZJ, Medrano HA. El ovino Pelibuey en el trópico mexicano. En: Delgado BJV, Nogales BS editores.

51

Rev Mex Cienc Pecu 2021;12(1):36-57

Biodiversidad ovina iberoamericana. Caracterización y uso sustentable. España, Universidad de Córdoba. Servicio de Publicaciones 2009:363-375.

3. Aguilar-Martínez CU, Berruecos-Villalobos JM, Espinoza-Gutiérrez B, Segura-Correa JC, Valencia-Méndez J, Roldán-Roldán A. Origen, historia y situación actual de la oveja Pelibuey en México. Trop Subtrop Agroecosys 2017;20(3):429-439.

4. Arteaga CJD. Diagnóstico actual de los ovinos en México. En: Memorias del 8 Congreso Mundial de la Lana y el Cordero. Asociación Mexicana de Criadores de Ovinos. Querétaro, Qro.2007:9-12.

5. Magaña-Monforte JG, Huchin-Cab M, Ake-López RJ, Segura-Correa JC. A field study of reproductive performance and productivity of Pelibuey ewes in southeaster Mexico. Trop Anim Health Prod 2013;45(8):1771-1776.

6. Valencia J, Porras A, Mejía O, Berruecos JM, Trujillo J, Zarco L. Actividad reproductiva de la oveja Pelibuey durante la época de anestro: influencia de la presencia del macho. Rev Científica FCV-LUZ 2006;16(2):136-141.

7. Arredondo-Ruiz V, Macedo-Barragán R, Molina-Cárdenas J, Magaña-Álvarez AJ, Prado-Rebolledo O, García-Márquez LJ, Herrera-Corredor A, Lee-Rangel H. Morphological characterization of Pelibuey sheep in Colima, México. Trop Anim Health Prod 2013;45(4):895-900.

8. Taberlet P, Valentini A, Rezaei HR, Naderi S, Pompanon F, Negrini R, AjmoneMarsan P. Are cattle, sheep and goats endangered species? Mol Ecol 2008;17(1):275-284.

9. Organización de las Naciones Unidas para la Alimentación y la Agricultura (FAO).

The second Report on the State of the World’s Animal Genetic Resources for Food and Agriculture. Scherf BD, Pilling D (eds). FAO Commission on Genetic Resources for Food and Agriculture Assessments. Rome 2015.

10. Organización de las Naciones Unidas para la Alimentación y la Agricultura (FAO).

Molecular genetic characterization of animal genetic resources. FAO Animal Production and Health Guidelines. No. 9. Roma 2011.

11. Bailes SM, Devers JJ, Kirby JD, Rhoads DD. An inexpensive, simple protocol for DNA isolation from blood for high-throughput genotyping by polymerase chain reaction or restriction endonuclease digestion. Poult Sci 2007;86(1):102-106.

12. Roldán RA. Identificación de ovejas Pelibuey con actividad reproductiva continua mediante polimorfismos de ADN [tesis maestría]. México, D. F.: Universidad Nacional Autónoma de México; 2015.

13. International Society for Animal Genetics (ISAG). Panel of markers for parentage verification tested 2001/02 ISAG comparison test. 2002.

52

Rev Mex Cienc Pecu 2021;12(1):36-57

14. Yeh FC, Yang RC, Boyle T. POPGENE version 1.31. Microsoft Windows based freeware for population genetic analysis, University of Alberta and the Centre for International Forestry Research, Edmonton, 1999.

15. Goudet J. FSTAT, a program to estimate and test gene diversities and fixation indices F-statistics.

Version 2.9.3.

2001.

Disponible en: http://wwww.unil.ch/izea/softwares/fstat.html.

16. Kalinowsky ST, Taper ML, Marshall TC. Revising how the computer program CERVUS accommodates error increases success in paternity assignment. Mol Ecol 2007;16(5):1099-1106.

17. Raymond M, Rousset F. GENEPOP (version 1.2) population genetics software for exact test and ecumenicism. J Hered 1995;86(3):248-249.

18. Rousset F. Genepop’007: a complete reimplementation of the GENEPOP software for Windows and Linux. Mol Ecol Resour 2008;8(1):103-106.

19. Peakall R, Smouse PE. GENALEX 6: a genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 2006;6:288-295.

20. Peakall R, Smouse PE. GenAlEx 6.5: genetics analysis in Excel. Population software for teaching and research-an update. Bioinformatics 2012;28(19):2537-2539.

21. Belkhir K, Borsa P, Chikhi L, Raufaste N, Bonhomme F. GENETIX 4.05, logiciel sous WindowsTM pour la génetique des populations. Laboratoire Génome.

Populations, Interactions, CNRS UMR 5000, Université de Montpellier II, Montpellier (France) 1996-2004.

22. Mantel N. The detection of disease clustering and a generalized regression approach.

Cancer Res 1967;27(2):209-220.

23. Nei M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 1978;89(3):583-590.

24. Goudet J. PCAGEN. Principal component analysis of gene frequency data (version 1.2). Lausanne, Switzerland: Population Genetics Laboratory, University of Lausanne. 1999.

25. Pritchard JK, Stephens M, Donnelly P. Inference of populations structure using multilocus genotype data. Genetics 2000;155(2):945-959.

26. Earl DA, VonHoldt BM. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Resour 2012;4(2):359-361.

27. Kopelman NM, Mayzel J, Jakobsson M, Rosenberg NA, Mayrose I. CLUMPAK: a program for identifying clustering modes and packaging populations structure inferences across K. Mol Ecol Resour 2015;15(5):1179-1191.

53

Rev Mex Cienc Pecu 2021;12(1):36-57

28. Ocampo R, Cardona H, Martínez R. Genetic diversity of Colombian sheep by microsatellite markers. Chil J Agric Res 2016;76(1):40-47.

29. Álvarez I, Capote J, Traouré A, Fonseca N, Pérez K, Cuervo M, Fernández I, Goyache F. Genetic relationships of the Cuban hair sheep inferred from microsatellite polymorphism. Small Ruminant Res 2012;104(1-3):89-93.

30. Sun W, Chang, H, Tsunoda K, Musa H, Ma Y, Guan W. Analysis of geographic and pairwise genetic distances among sheep populations. Biochem Genet 2010;48(56):376-384.

31. Qu D, Yang Z, Guo X, Mao Y, Sun W, Gen R et al. Study of polymorphisms of microsatellite DNA of six Chinese indigenous sheep and goat breeds. Front Agr China 2007;1(4):472-477.

32. Neubauer V, Volg C, Seregi J, Sáfar L, Brem G. Genetic diversity and population structure of Zackel sheep and other Hungarian sheep breeds. Arch Anim Breed 2015;58:343-350.

33. Taghi VEM, Mhammadabadi M, Esmailizadeth A. Using microsatellite markers to analyze genetic diversity in 14 sheep types in Iran. Arch Anim Breed 2017;60:183189.

34. Agaviezor BO, Peters SO, Adefenwa MA, Yakubu A, Adebambo OA, Ozoje MO et al. Morphological and microsatellite DNA diversity of Nigerian indigenous sheep. J Anim Sci Biotechnol 2012;3(1):38.

35. Usha AP, Simpson SP, Williams JL. Probability of random sire exclusion using microsatellite markers for parentage verification. Anim Genetic 1995(26):155-161.

36. Morin PA, Leduc RG, Archer FI, Martien KK, Huebinger R, Bickham JW, Taylor BL. Significant deviations from Hardy-Weimberg equilibrium caused by low levels of microsatellite genotyping errors. Mol Ecol Res 2009;9(2):498-504.

37. Bhatia S, Arora R. Genetic diversity in Kheri-A pastarolist developed Indian sheep using microsatellite markers. Indian J Biotechnol 2008;7(1):108-112.

38. Dalvit C, De Marchi M, Zanetti E, Cassandro M. Genetic variation and population structure of Italian native sheep breeds undergoing in situ conservation. J Anim Sci 2009;87(12):3837-3844.

39. Konzen ER, Martins MP. Contrasting levels of genetic diversity among populations of the endangered tropical palm Euterpe edulis. CERNE 2017;23(1):31-42.

40. Schlötterer C. Evolutionary dinamics of microsatellite DNA. Chromosoma 2000;109(6):365-371.

41. Slatkin M. Gene flow in natural populations. Annu Rev Ecol Syst 1985;16(1):393430.

54

Rev Mex Cienc Pecu 2021;12(1):36-57

42. Piñero D, Barahona A, Eguiarte L, Rocha OA, Salas LR. La variabilidad genética de las especies: aspectos conceptuales y sus aplicaciones y perspectivas en México. In: Sarukhán KJ et al. (editores). Capital natural de México, vol. I: Conocimiento actual de la biodiversidad. CONABIO, México, D. F. CONABIO 2009:603-649.

55

Rev Mex Cienc Pecu 2021;12(1):36-57

Table 3: Private and shared alleles in 24 Pelibuey sheep subpopulations genetically characterized with nine microsatellite markers

Private alleles Number of PA (SP %)

SP with PA Alleles (frequency)

Shared alleles Most shared allele Number of SP (%) Least shared allele Number of SP (%) SP mean with SA (%)

OarCP34

OarFCB304

OarJMP29

OarJMP58

DYMS1

ILSTS5

SRCRSP5

SRCRSP9

MAF33

0 (0)

2 (4.33)

2 (8.33)

0 (0)

0 (0)

0 (0)

2 (8.33)

1 (4.17)

2 (8.33)

―

Posta El Cuatro 140 (0.083) 210 (0.083)

Rancho Libertad 170 (0.100) Posta El Cuatro 180 (0.083)

―

―

―

COLPOSCORD 172 (0.100) Rancho Jalapa 200 (0.125)

CEIEGT 95 (0.400)

San Alberto 170 (0.100) Rancho Belbesah 160 (0.100)

110 23 (95.83)

164 15 (62.5)

150 23 (95.83)

135 16 (67.5)

175/200 16/16 (66.7/66.7)

225 19 (79.17)

152 17 (70.83)

125 14 (58.3)

120 18 (75)

100 2 (8.33)

150 7 (29.17)

110/140 3/3 (12.5/12.5)

177/185 2/2 (8.33/8.33)

225 (4) 16.67

180 3 (12.5)

154 2 (8.33)

135 5 (20.8)

155 5 (20.83)

11 (45.8)

10.3 (42.8)

9 (37.5)

7.36 (30.7)

10.91 (45.45)

9.89 (44.79)

7.42 (33.3)

9.2 (38.3)

8.18 (34.1)

PA= private alleles; SP= subpopulation; SA= shared alleles.

56

Rev Mex Cienc Pecu 2021;12(1):36-57

Table 4: Gene flow measured through the number of migrants (Nm) between pairs of Pelibuey sheep subpopulations in Mexico. * The numbering of the subpopulations follows the same order as Table 2.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

1 ― 3.13 2.56 2.62 1.66 2.15 0.94 0.81 0.79 1.12 0.65 1.17 1.06 1.16 1.18 1.04 0.82 0.59 0.90 0.91 1.54 1.13 0.80 1.33

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

― 1.73 1.83 2.34 1.42 1.05 0.77 0.80 1.07 0.93 1.09 0.92 1.13 1.36 1.09 0.73 0.98 0.91 0.95 1.19 1.06 0.87 1.12

― 16.39 1.29 1.48 0.87 0.82 0.96 1.18 0.71 1.29 1.04 1.32 1.56 1.98 0.93 0.73 1.16 1.18 1.43 1.28 0.86 1.06

― 2.25 1.62 0.92 1.21 1.13 1.22 0.78 2.13 1.19 1.36 1.93 1.79 1.05 0.80 1.29 1.14 1.99 1.66 0.87 1.29

― 2.10 1.74 1.49 1.04 1.21 1.39 1.11 1.05 1.26 1.40 1.07 0.94 1.37 0.85 1.18 1.55 1.53 0.97 1.17

― 5.40 1.40 2.23 4.17 2.56 2.39 2.19 3.05 2.40 1.73 8.18 1.25 1.54 1.78 7.73 2.59 2.81 2.35

― 1.41 1.90 2.08 2.41 1.16 1.36 1.68 2.24 1.17 1.87 1.53 0.93 1.31 1.77 1.48 2.01 1.14

― 1.35 1.07 0.80 0.81 0.90 1.04 1.31 0.82 0.84 0.73 0.70 1.07 1.08 1.87 0.99 0.89

― 2.20 1.26 1.17 1.37 1.31 2.20 1.08 1.99 0.98 1.31 2.38 1.28 1.77 2.68 1.25

― 1.55 1.91 2.64 2.14 6.43 1.49 2.41 1.30 1.53 1.49 1.73 3.37 3.79 2.55

― 1.00 1.45 1.45 1.37 0.84 3.81 1.28 0.93 1.07 0.97 1.34 1.32 0.90

― 1.92 1.91 4.34 1.87 1.52 0.86 2.53 1.47 2.25 1.53 1.62 1.56

― 3.40 3.91 1.90 5.12 1.29 2.08 2.25 1.69 7.85 4.54 2.51

― 5.53 1.92 3.14 1.16 1.80 1.81 3.15 3.07 2.36 1.86

― 5.41 1.81 1.34 2.50 2.21 2.89 9.46 5.72 2.75

― 1.18 0.81 2.38 1.78 2.47 2.05 1.93 1.62

― 1.12 1.13 1.71 1.41 2.14 1.93 1.26

― 0.75 0.86 0.96 1.05 0.99 0.96

― 2.12 1.78 1.42 2.30 1.75

― 1.65 2.73 1.77 1.37

― 2.52 1.44 2.18

― 2.41 1.94

― 1.55

57

https://doi.org/10.22319/rmcp.v12i1.5109 Article

Genetic diversity of creole chickens in Valles Centrales, Oaxaca, using microsatellite markers

Héctor Luis-Chincoya a José Guadalupe Herrera-Haro a Amalio Santacruz-Varela b* Martha Patricia Jerez-Salas c Alfonso Hernández-Garay a

a

Colegio de Postgraduados., Campus Montecillos. Recursos Genéticos y ProductividadGanadería. Texcoco, México. b

Colegio de Postgraduados. Campus Montecillos. Recursos Genéticos y ProductividadGenética. Texcoco, México. c

Instituto Tecnológico del Valle de Oaxaca. Xoxocotlán, Oaxaca, México.

*

Corresponding author: asvarela@colpos.mx

Abstract: The population of creole chickens in small-scale farms is remarkably diverse and part of the poultry genetic reservoir in Mexico. Furthermore, this population represents a vital protein source for rural families. The genetic variability of creole chicken populations in the central region of Oaxaca was determined in blood samples collected from 109 creole chickens belonging to 17 populations and 30 Plymouth Rock chickens (control group). Ten microsatellite markers were used to detect a total of 109 alleles, with an average of 10.9 ± 3.1 alleles per locus. The observed heterozygosity (Ho) ranged from 0.575 (San Lucas) to 0.750 (San Antonio 2); the expected heterozygosity ranged from 0.625 (Control) to 0.733 (Huixtepec 2). Overall, it was observed an increase in the number of heterozygotes, evidenced by a global-level inbreeding (FIT) of 0.042; the FST population differentiation index 58

Rev Mex Cienc Pecu 2021;12(1):58-71

was moderate (0.059), and the inbreeding of individuals within populations (FIS) was negative (-0.017), which indicates an excess of heterozygotes at that level. Cluster analysis grouped the Nazareno, ITVO, San Lucas, and San Antonio populations, indicating that these creole chicken populations are isolated and genetically differentiated in some characteristics.

This information is important to design future conservation, selection, and multiplication programs for this species at the backyard level in the central region of Oaxaca, Mexico.

Key words: Local poultry, SSR, Genetic diversity, Zoogenetic resources.

Received: 16/10/2018 Accepted: 03/02/2020

Introduction

The development of highly efficient and profitable intensive poultry production systems, in addition to the market demand for good quality and uniform meat and egg products, favors the incorporation of specialized breeds; this results in the decrease and genetic erosion of local genotypes, known as "creoles," due to the decline of their effective population size(1).

These creole genotypes are subjected to rustic practices in small-scale production units, adapted to the climate and low-input production systems, under favorable conditions, and are tolerant to diseases(2). Furthermore, these genotypes are part of the cultural patrimony of rural communities. For this reason, the FAO(3) has highlighted the importance of the identification and conservation of local chickens, paying particular attention to their breeding(4). Due to their biological diversity, these chickens undergo continuous change as a result of natural selection and migration processes.

Microsatellites are molecular markers of genetic variability at the DNA level; they consist of tandem repeats of one to six base pairs. These markers are widely used because their random distribution in the genome, high polymorphism, and codominant inheritance(5,6). This technique results in descriptive genetic statistics, such as heterozygosity, genetic distance, effective number of alleles, and polymorphic information content of the markers between closely related populations.

In Mexico, few studies have evaluated the genetic diversity of creole chickens in small-scale poultry systems using molecular markers. Therefore, it is essential to identify the existent populations of creole chickens and develop breeding and conservation programs that benefit 59

Rev Mex Cienc Pecu 2021;12(1):58-71

the producers in rural areas(7). This research aimed to determine the genetic diversity of populations of creole chickens in Valles Centrales, Oaxaca.

Material and methods Sampling

Samples were collected from January to December 2015 using a two-stage cluster sampling(8). The seven districts comprised the primary units, and the production units (PU) within the districts were considered secondary units. A sample of three primary units (n) was selected; 17 secondary units were randomly selected within these primary units. From each secondary unit (PU), six chickens were selected, resulting in a total sample size of 109 adult chickens: 93 adult creole hens, in the early laying stage and weighing 2.0 kg on average, and 16 adult roosters. The estimated inventory of adult chickens was 2,004 animals in the Valles Centrales region; thus, 6 % of the population was sampled. The sample size was obtained with a precision of 10 % and reliability of 90 %. Sampling was distributed in six geographic cores (ITVO: Nazareno and ITVO; Cuilápam: San Antonio, San Lucas, and Cuilápam; Etla: San Juan and Suchilquitongo; Huixtepec: Huixtepec 1, 2, 3, and 4; Ocotlán: Chichicapam, San Antonino 1 and 2; and Tlacolula: Teotitlán, Totolapam 1 and 2, plus a Plymouth Rock chicken control. Blood samples (2 mL) were drawn from the cubital vein of the wing of each animal and collected into Vacutainer tubes with EDTA. Samples were stored at -20 °C until further processing.

DNA extraction, microsatellite markers, and PCR procedure

DNA was extracted using the ChargeSwitch® gDNA Plant Kit (Invitrogen), following the protocol provided by the manufacturer. The DNA was then quantified using an ultra-low volume spectrophotometer (NanoDrop 2000, Thermo Scientific, Wilmington, DE, USA); DNA concentrations were adjusted to 10 ng μl-1. To evaluate genetic diversity, it was used ten pairs of previously reported(9-11) microsatellite primers (Table 1). Primers were fluorescently labeled (6-FAM, HEX, or ROX) at their 5' end for PCR multiplex.

60

Rev Mex Cienc Pecu 2021;12(1):58-71

Table 1: Description of the primers of the microsatellite loci used; annealing temperature (Tm) and expected fragment size.

Primer

5’ - 3’ sequence

MCW32-F MCW32-R MCW68-F MCW68-R MCW94-F MCW94-R MCW95-F MCW95-R MCW114-F MCW114R MCW131-F MCW131R MCW134-F MCW134R MCW135-F MCW135R MCW145-F MCW145R MCW158-F MCW158R

AGTTCCTTGTACAATTGTTA TCATTACTAGTACAATCAAGATGG CCTCACTGTGTAGTGTGGTAGTCA GAGAAGCTTGAACCTACCAGTCTT GGAGCTGGTATTTGTCCTAAG GCACAGCCTTTTGACATGTAC GATCAAAACATGAGAGACGAAG TTCATAGCTTGAATTGCATAGC AGCAAACTGCTCAGTGCTGTG

Tm Size (bp) (°C) 53.6 273 to 314 62

171 to 193

53.6 77 to 95 62

72 to 91

62

261 to 293

Reference b c a a c

GCGTTGAAAGTAGTGCTTCCG GTTGCTGATTCTAAGGCAGGC

53.6 195 to 217 c

TTGCAGTTGTAAAGGTGTAGC GGAGACTTCATTGTGTAGCAC

62

260 to 284 b

ACCAAAAGACTGGAGGTCAAC ATATGCTGCAGAGGGCAGTAG

62

124 to 150 a

CATGTTCTGCATTATTGCTCC ACTTTATTCTCCAAATTTGGCT

62

164 to 212 b

AAACACAATGGCAACGGAAAC GATCCATTTATAAAGACCCCAC

53.6 164 to 224 a

TTCAATACTCCTTTGTAAAGCA a: Crooijmans et al. (1996); b: Yu et al. (2006); c: Horbańczuk et al. (2007).

The PCR reaction final volume was 25 µL, this included: 5 µL of 5X Buffer (Promega), 2 µL of 25 mM MgCl2 (Promega), 0.5 µL of 2 mM dNTPs mix (Promega), 1 µL of each primer (5 pmol), 1 UI of Taq polymerase (Promega), and 1 µL of template DNA (10 ng µl-1). The amplification was carried out in a thermocycler (Bio-Rad C1000TM) with the following conditions: initial denaturation at 94 °C for 5 min, followed by 35 denaturation cycles at 94 °C for 45 s, annealing for primer groups at 53.6 °C, 56.6 °C, and 62 °C for 1 min, extension at 72 °C for 1 min, and final extension at 72 °C for 10 min. PCR products were separated by capillary electrophoresis in an automated DNA sequencer (Genetic Analyzer ABI-3130 61

Rev Mex Cienc Pecu 2021;12(1):58-71

Applied Biosystems, Foster City, CA, USA) and analyzed with the GeneMapper® software of Applied Biosystems.

Statistical analysis

Based on the allelic profile determined in each individual for each locus, it was calculated the allelic frequencies, observed heterozygosity (Ho), expected heterozygosity (He), and Hardy-Weinberg equilibrium. Wright's F-statistics (FIS, FIT, and FST) were estimated based on the population's degree of genetic differentiation, considering the geographic cores as a clustering criterion. The POPGENE software (Version 1.3.2) was used to define the genetic diversity parameters. Furthermore, using the allelic frequencies of each locus, a principal component analysis was carried out with SAS V. 9.4(12), as well as a clustering analysis using the UPGMA method, which is based on the Euclidean distances between the creole chicken and reference populations, to determine their pattern of genetic similarity.

Results and discussion Genetic diversity

A total of 109 alleles were identified in the 18 chicken populations. Considering the ten evaluated loci, the number of alleles ranged from six for MCW145 to 16 for MCW158, with an average of 10.9 alleles per locus. All loci were polymorphic (Table 2), coinciding with some of the primers with a chicken mapping(9). MCW145 was the exception because it showed a lower value compared to previous reports(9,10).

62

Rev Mex Cienc Pecu 2021;12(1):58-71

Table 2: Genetic diversity parameters detected with the 10 microsatellite loci evaluated in 109 creole chickens distributed in 17 populations Loci MCW131 MCW158 MCW32 MCW94 MCW114 MCW134 MCW135 MCW145 MCW68 MCW95 Mean Standard deviation

Ra

Na

Ne

Ho

He

7 8 6 7 7 9 7 8 7 7

8 16 13 10 11 12 15 6 9 9 10.9 3.142

2.493 8.682 5.175 5.170 3.748 5.065 10.982 2.210 4.035 2.176 4.974 2.866

0.596 0.525 0.877 0.912 0.590 0.927 0.845 0.080 0.749 0.476 0.658 0.133

0.601 0.888 0.809 0.809 0.736 0.805 0.912 0.549 0.755 0.542 0.738 0.133

Ra= previously reported alleles, Na= number of alleles, Ne= effective number of alleles, Ho= observed heterozygosity, He= expected heterozygosity, for each locus of the populations.

Previous studies of different local creole chicken breeds reported a lower total number of alleles per locus using different microsatellite loci in the same species. In Sweden, Germany, and Poland, studies reported 113, 217, and 62 alleles with 24, 29, and 10 loci, respectively(1,13,14). Studies in China, Thailand, and India reported similar values; 276, 227, and 170 alleles with 29, 20, and 17 loci(6,15,16). Similarly, researchers in Israel and Iran(17,18) observed 211 and 310 alleles in local populations using 22 and 31 microsatellite loci, respectively, akin to what was observed in this study. The average number of reported alleles in the evaluated populations indicates a wide diversity of genes, similar to that in other countries with well-defined local chicken breeds.

The effective number of alleles per locus ranged from 2.1 (MCW95) to 10.9 (MCW135), with an average of 4.9. The observed heterozygosity (Ho) value ranged from 0.08 (MCW145 locus) to 0.92 (MCW134) (Table 2). Meanwhile, the expected heterozygosity (He) ranged from 0.54 (MCW95 and MCW145) to 0.91 (MCW135). Although these results suggest that the analyzed populations present a wide genetic diversity, they also indicate discrepancies between both types of heterozygosity, which indicates deviations from the Hardy-Weinberg equilibrium. These deviations result from migration or genetic drift processes, possibly attributed to the low number of individuals that generally make up each population. Other studies(10,19) have reported He values of 0.69 and 0.75, respectively, for the MCW145 locus.

These results were higher than what was observed in this study (0.54) because this locus is associated with a lower number of alleles, significantly influencing the He since each allele 63

Rev Mex Cienc Pecu 2021;12(1):58-71

represents an additional term to the summation for He calculation. Previous studies(10,20) for the MCW134 locus reported He values of 0.68 and 0.64 in China, respectively. These values are lower than the value obtained in this study (0.805).

The number of alleles found in populations per loci was in descending order: Plymouth Rock reference genotype, with 70 alleles, followed by Cuilápam with 65 alleles, contrasting with the Teotitlán population with 41 alleles, this being the lowest value (Table 3). However, the San Antonio 1 population had the higher effective number of alleles (43.8), followed by ITVO with 37.8 alleles; the Suchilquitongo population registered 29 effective alleles. These values imply the potential transmission of a high number of alleles to the following generation of creole chickens.

Table 3: Total number of alleles (TNa), total number of effective alleles (TNe), observed heterozygosity (Ho), and expected heterozygosity (He) in the studied populations Population

Ni*

Nazareno 7 ITVO 7 San Antonio 7 San Lucas 7 Cuilápam 7 Plymouth 30 Rock† Chichicapam 6 Teotitlán 6 San Juan 7 Suchilquitongo 7 San Antonino 1 7 San Antonino 2 6 Huixtepec 1 7 Huixtepec 2 7 Huixtepec 3 7 Huixtepec 4 6 Totolapam 1 7 Totolapam 2 8

TNa

TNe

Ho ± SD

He ± SD

49 60 48 48 65

35.288 37.805 31.166 32.506 39.618

0.577 ± 0.296 0.674 ± 0.248 0.630 ± 0.284 0.575 ± 0.205 0.615 ± 0.311

0.684 ± 0.258 0.692 ± 0.229 0.643 ± 0.234 0.732 ± 0.098 0.691 ± 0.236

70

37.639

0.631 ± 0.297

0.625 ± 0.253

53 41 53 53 63 45 58 53 52 46 42 57

34.564 30.550 32.539 29.88 43.851 35.533 34.179 36.984 34.482 36.009 32.729 36.746

0.633 ± 0.227 0.65 ± 0.298 0.587 ± 0.304 0.676 ± 0.361 0.690 ± 0.332 0.75 ± 0.316 0.67 ± 0.316 0.711 ± 0.262 0.70 ± 0.247 0.716 ± 0.324 0.673 ± 0.337 0.703 ± 0.325

0.656 ± 0.238 0.654 ± 0.252 0.643 ± 0.265 0.661 ± 0.112 0.716 ± 0.230 0.695 ± 0.266 0.71 ± 0.124 0.733 ± 0.121 0.718 ± 0.144 0.710 ± 0.204 0.673 ± 0.264 0.681 ± 0.222

†

Reference population Ni* = Number of individuals per population.

The observed heterozygosity (Ho) ranged from 0.575 in the San Lucas population to 0.75 in the San Antonino population, with an average of 0.741. Meanwhile, the expected heterozygosity (He) was lower in the reference group (0.625), suggesting that the kinship level between progenitors is lower. Furthermore, Huixtepec 2, San Lucas, and San Antonio 64

Rev Mex Cienc Pecu 2021;12(1):58-71

1 (0.733, 0.732, and 0.716, respectively) were the most genetically diverse populations, indicating greater potential in breeding programs. Previous studies in local chickens(2,21-23), carried out in Sweden, Korea, China, and India, reported lower Ho and He values. Moreover, in local Tibetan and Chinese chicken populations, previous studies have reported He values of 0.798 and 0.76(10,24), higher than those observed in this study, probably because of the use of different microsatellite loci.

Genetic differentiation of chicken populations

The Ocotlán and Tlacolula clusters had the lowest FIS values (-0.072 and -0.079), indicating a higher number of heterozygous individuals within each population. Overall, the less than zero values, close to the Hardy-Weinberg equilibrium, of these clusters indicate that the creole chickens are non-inbred populations. Studies have emphasized the adaptation of local chickens to the different geographical conditions in each country; therefore, the HardyWeinberg equilibrium remains constant across generations(2,21).

As for the FIT, the lowest values were observed at the production unit level in the Ocotlán and control clusters (-0.003 and -0.037). In the Ocotlán cluster, the constant change of male breeders through direct purchase in regional markets results in an important local poultry genetic material flow at a regional level. While in the control group, due to its origin and established reproduction scheme, the production of heterozygous individuals is maximized.

The Cuilápam cluster had the highest FIS (0.106) and FIT (0.177) values compared to the other clusters. However, statistically, by establishing confidence intervals, its heterozygous individuals are in equilibrium (Table 4); this is explained by the lack of a male substitution process in the production units, increasing the kinship relationship and the proportion of homozygous loci.

65

Rev Mex Cienc Pecu 2021;12(1):58-71

Table 4: Wright's F-statistics of ten microsatellite loci and confidence limits for seven chicken clusters in Valles Centrales, Oaxaca Populations ITVO Cuilápam Control Etla Huixtepec Ocotlán Tlacolula Global

FIS

UL and LL

FIT

0.015 0.106 -0.037 -0.014 -0.040 -0.072 -0.079 -0.017

0.1424 to -0.111 0.253 to -0.040 0.090 to -0.165 0.248 to -0.277 0.170 to -0.250 0.076 to -0.220 0.172 to -0.330

0.091 0.177 -0.037 0.032 0.038 -0.003 -0.001 0.042

SL and IF 0.209 to -0.027 0.337 to 0.017 0.090 to -0.165 0.288 to -0.223 0.234 to -0.156 0.138 to -0.145 0.227 to -0.229

FST 0.077 0.079 0.000 0.046 0.076 0.063 0.072 0.059

FIS, inbreeding indicator of an individual within a subpopulation; F IT, inbreeding indicator relative to the total population; FST, genetic differentiation index; UL, upper limit; LL, lower limit.

The Cuilápam, ITVO, and Huixtepec clusters had a moderate genetic differentiation (FST)(25) (0.079, 0.077, and 0.076, respectively). These results indicate that these populations are different due to geographic isolation or handling practices, and, therefore, the genetic flow between the individuals from the different poultry regions is reduced. The global FST value of 0.059 indicates that 94.1% of the total variation is within the populations, only 5.9% between populations(25) (Table 4). This value confirms a moderate genetic diversity within the populations, which is associated with the selection strategies of breeding males and replacement females carried out by the producers and demonstrates the potential for intrapopulation genetic breeding through recurrent selection schemes, taking advantage of the selection and recombination effects in a continuous process. Similar results have been reported(26-28) in local chicken populations in Egypt, Bhutan, Asia, and China. Meanwhile, another study evaluating eight Korean domestic chicken breeds(29) reported a differentiation coefficient of 0.180.

Relationships between the populations The principal component analysis (PC) explained 32.2 % of the total variation with the three first components integrated by the most important alleles of the ten microsatellite loci (Table 5). The three-dimensional plane of the populations (Figure 1), based on the first three principal components, identifies the most distant populations: Nazareno= A, ITVO= B, Suchiquitongo= J, and Huixtepec=N, characterized for not allowing commercial poultry genetic material, suggesting a significant genetic flow within the same populations. Other studies have reported clear differentiation in local chicken populations of Kenya (30) and India(31), using PC and considering the two first components, with genetic variation values of 46.25 % and 23.37 %.

66

Rev Mex Cienc Pecu 2021;12(1):58-71

Figure 1: Three-dimensional plane of chicken populations with the principal components PC1 vs. PC2 vs. PC3, generated with the allelic frequencies of ten microsatellite loci

Table 5: Eigenvalues and proportion of the explained variance of the seven principal components with the frequency matrix of 109 alleles from chicken populations PC Eigenvalue Proportion

Accumulated

1

14.6493163 0.1344

0.1344

2

10.7115308 0.0983

0.2327

3

9.7335336

0.322

0.0893

Alleles MCW32-A, MCW32-E, MCW94-B, MCW94-D, MCW94-F, MCW134-A, MCW135-C, MCW135-E, MCW135G, MCW135-I, MCW135-O, MCW145-A, MCW95-A, MCW95-B MCW158-B, MCW32-C, MCW32-D, MCW32-G, MCW32-H, MCW94-B, MCW114-K, MCW134-K, MCW135B, MCW135-J, MCW68-A MCW131-C, MCW131-H, MCW158K, MCW94-A, MCW114-E, MCW134-G, MCW134-J, MCW135D, MCW95-D, MCW95-H

The groups obtained through the cluster analysis (Figure 2) were similar to those observed in the three-dimensional plane of the principal component analysis; three main groups are distinguished (genetic distance of 0.90). The first (Nazareno, ITVO, San Lucas, and San 67

Rev Mex Cienc Pecu 2021;12(1):58-71

Antonio) includes isolated and genetically different populations that resulted from the reduced genetic flow between these creole populations and poultry populations with a degree of recombination with known breeds, such as Plymouth Rock. Subgroup 2 includes populations with a higher degree of genetic kinship, evidenced by the proportion of alleles with the reference group (Plymouth Rock) as a result of the introduction of this commercial breed as technological packages, which leads to crosses with chickens adapted to the environmental and handling conditions of the different rural areas, causing a loss and wear of the adaptation and survival characteristics of the creole chickens. The third subgroup included the Huixtepec 4, San Antonino 2, Teotitlán, and Totolapam 1 populations; these populations share similar allelic frequencies, suggesting variability in unique phenotypic traits characteristic of creole chickens.

Figure 2: Dendrogram of the chicken populations, constructed with the UPGMA method based on the Euclidean distances obtained from the frequencies of 109 microsatellite alleles

Conclusions and implications The creole chickens in Valles Centrales, Oaxaca, are genetically diverse; this is evidenced by the 109 alleles detected with the ten microsatellites used and expected heterozygosity of 0.738. The allelic profiles in this study allowed estimating a low degree of differentiation 68

Rev Mex Cienc Pecu 2021;12(1):58-71

between individuals (FST=0.059) in the populations located in the geographic cores. In particular, the genetic diversity is more complex in the Tlacolula (0.072) and Ocotlán (0.063) populations. A minimal proportion (5.9 %) of the total genetic diversity is located between the creole chicken populations; the remaining 94.1 % resides within the populations.

Literature cited: 1. Abebe AS, Mikko S, Johansson AM. Genetic diversity of five local Swedish chicken breeds detected by microsatellite markers. PLoS One. 2015;10(4):1–13.

2. FAO. La situación de los recursos zoogenéticos mundiales para la alimentación y la agricultura. Food Agric Organ United Nations. 2010.

3. FAO. Recursos genéticos animales 56. Food Agric Organ United Nations. 2015;171.

4. Kaya M, Yildiz MA. Genetic diversity among Turkish native chickens, Denizli and Gerze, estimated by microsatellite markers. Biochem Genet 2008;46(7–8):480–91.

5. Muir WM, Cheng HW. Genetic influences on the behavior of chickens associated with welfare and productivity. 2nd ed. Genetics and the behavior of domestic animals.

Elsevier Inc. 2014. http://dx.doi.org/10.1016/B978-0-12-394586-0.00009-3.

6. Dorji N, Daungjinda M, Phasuk Y. Genetic characterization of Thai indigenous chickens compared with commercial lines. Trop Anim Health Prod 2011;43(4):779–85.

7. Qu L, Li X, Xu G, Chen K, Yang H, Zhang L, et al. Evaluation of genetic diversity in Chinese indigenous chicken breeds using microsatellite markers. Sci China, Ser C Life Sci 2006;49(4):332–341.

8. Sukhatme, PV. Sampling Theory of Surveys with Application. Iowa State College Press.

Ames, Iowa. 1970.

9. Crooijmans RP, van Oers PA, Strijk JA, van der Poel JJ, Groenen MA. Preliminary linkage map of the chicken (Gallus domesticus) genome based on microsatellite markers: 77 new markers mapped. Poult Sci 1996;75(6):746–54.

10. Ya-bo Y, Jin-yu W, Mekki DMM, Qing-Ping A, Hui-Fang L, Rong G, et al. Evaluation of genetic diversity and genetic distance between twelve Chinese indigenous chicken breeds based on microsatellite markers. Int J Poult Sci 2006;5(6):550–556.

11. Horbańczuk JO, Kawka M, Sacharczuk M, Cooper RG, Boruszewska K, Parada R, et al.

A search for sequence similarity between chicken (Gallus domesticus) and ostrich (Struthio camelus) microsatellite markers. 2007;25(4):283–288.

12. SAS 9.4 Software. Institute Inc., Cary, North Carolina, USA. 2016.

69

Rev Mex Cienc Pecu 2021;12(1):58-71

13. Al-Qamashoui B, Simianer H, Kadim I, Weigend S. Assessment of genetic diversity and conservation priority of Omani local chickens using microsatellite markers. Trop Anim Heal Prod 2014;46:1–6.

14. Antos P, Andres K, Kapkowska E. Preliminary studies on genetic diversity of selected Polish local chicken varieties. J Cent Eur Agric 2013;14(1):11–22.

15. Bao WB, Shu JT, Wu XS, Musa HH, Ji CL, Chen GH. Genetic diversity and relationship between genetic distance and geographical distance in 14 Chinese indigenous chicken breeds and red jungle fowl. Czech J Anim Sci 2009;54(2):74–83.

16. Mukesh. Ruheena J, Uma G, Han J, Sathyakumar S. Cross-species applicability of chicken microsatellite markers for investigation of genetic diversity in Indian duck (Anas platyrhynchos) populations. African J Biotechnol. 2011;10(76):17623–17631.

17. Illel JH, Roenen MAMG, Reidlin PJF, Äki AM, Ortwijn MO. Biodiversity of 52 chicken populations assessed by microsatellite typing of DNA pools. Genet Sel Evol 2003;35:533–557.

18. Esfahani EN, Eskandarinasab MP, Khanian SE, Nikmard M, Molaee V. Genetic diversity of a native chicken breed in Iran. J Genet 2012;91:1–4.

19. Choi NR, Seo DW, Jemaa SB, Sultana H, Heo KN, Jo C, et al. Discrimination of the commercial Korean native chicken population using microsatellite markers. J Anim Sci Technol 2015;57(5):1–8.

20. Huo JL, Wu GS, Chen T, Huo HL, Yuan F, Liu LX, et al. Genetic diversity of local Yunnan chicken breeds and their relationships with red junglefowl. Genet Mol Res 2014;13(2):3371–3383.

21. Suh S, Sharma A, Lee S, Cho C, Kim J, Choi S. Genetic Diversity and Relationships of Korean Chicken Breeds Based on 30 Microsatellite Markers. Asian Australas J Anim Sci 2014;27(10):1399–1405.

22. Yang K, Luo X, Wang Y, Yu Y, Chen Z. Eight trinucleotide microsatellite DNA markers from Tibetan chicken, Gallus gallus domesticus. Conserv Genet Resour 2009;1:225– 237.

23. Chatterjee RN, Bhattacharya TK, Dange M, Dushyanth K, Niranjan M, Reddy BLN, et al. Genetic heterogeneity among various Indigenous and other chicken populations with microsatellite markers. J Appl Anim Res 2015;43(3):266–271.

24. Yang K, Luo X, Wang Y, Yu Y, Chen Z. Ten polymorphic microsatellite loci in Tibetan chicken, Gallus gallus domesticus. Conserv Genet 2010;11(3):671–683.

70

Rev Mex Cienc Pecu 2021;12(1):58-71

25. Snyder L. Freifelder AD, Hartl DL. General genetics. UK: Jones and Bartlett publishers, Inc.;1985.

26. Ramadan S, Kayang BB, Inoue E, Nirasawa K, Hayakawa H. Evaluation of genetic diversity and conservation priorities for Egyptian chickens. Open J Anim Sci 2012;2(3):183–190.

27. Dorji N, Duangjinda M, Phasuk Y. Genetic characterization of Bhutanese native chickens based on an analysis of Red Jungle fowl (Gallus gallus gallus and Gallus gallus spadecieus), domestic Southeast Asian and commercial chicken lines (Gallus gallus domesticus). Genet Mol Biol 2012;35(3):603–609.

28. Ding FX, Zhang GX, Wang JY, Li Y, Zhang LJ, Wei Y, et al. Genetic diversity of a Chinese native chicken breed, Bian chicken, based on twenty-nine microsatellite markers. Asian-Australasian J Anim Sci 2010;23(2):154–161.

29. Zhao J, Li H, Kong X, Tang Z. Identification of single nucleotide polymorphisms in avian uncoupling protein gene and their association with growth and body composition traits in broilers. Can J Anim Sci 2006;345–350.

30. Noah O, Ngeranwa JJN, Binepal YS, Kahi AK, Bramwel WW, Ateya LO, et al. Genetic diversity of indigenous chickens from selected areas in Kenya using microsatellite markers. J Genet Eng Biotechnol 2017;15(2):489–495.

31. Kumar V, Mathew J, Sharma D, Kumar V, Shukla SK, Mathew J, et al. Genetic diversity and population structure analysis between Indian Red Jungle fowl and domestic chicken using microsatellite markers. Anim Biotechnol 2015;37–41.

71

https://doi.org/10.22319/rmcp.v12i1.4764 Article

Milk fatty acid profile of crossbred Holstein x Zebu cows fed on cake licuri

Antonio Ferraz Porto Junior a* Fabiano Ferreira da Silva b Robério Rodrigues Silva b Dicastro Dias de Souza c Edvaldo Nascimento Costa c Evely Giovanna Leite Costa c Bismarck Moreira Santiago c Geónes da Silva Gonçalves c

a

University of Southwest Bahia State - UESB. D.sc. Nutrition and Ruminant Production.

INOVAPEC, Itapetinga, BA, 45700-000, Brazil. b

University of Southwest Bahia State - UESB, Department of Rural and Animal Technology, Itapetinga, BA, Brazil.

University of Southwest Bahia State – UESB. Nutrition and Ruminant Production.

UESB, Itapetinga, BA, Brazil. c

*Corresponding autor: ferrazporto@hotmail.com

Abstract: The objective was to evaluate the inclusion level of licuri cake (LC) in the diet of confined cows on fatty acid profile and milk cholesterol. Four cows with a blood level of ½ to ¾ Holstein x Zebu blood were used, distributed in a 4 x 4 Latin square, where the inclusion levels of the cake in the total diet were 0.0, 5.5, 11.0 and 16.5%, replacing soybean meal in the diet. There was a linear decreasing effect for the fatty acids Lauric, Elaidic, Gamma-Linolenic and conjugated linoleic acid isomers (C18:2cis9trans11; C18:2trans10cis12) from the inclusion levels of LC. The inclusion of licuri cake negatively influenced the 72

Rev Mex Cienc Pecu 2021;12(1):72-86

concentrations of polyunsaturated fatty acids and conjugated linoleic acid isomers, in addition to the fatty acids of the Omega-6 series, which is not interesting from the human nutrition point of view.

Key words: Conjugated linoleic acid, Biohydrogenation, By-product, Cromatography.

Received: 08/02/2018 Accepted: 03/12/2019

Introduction The licuri fruit (Syagrus coronata) (Martius) Beccari, is a typical palm tree of arid regions of the Caatinga biome. The cake is the main product after oil extraction(1), it can be used as an alternative source to lower production costs at a certain time of the year. However, the reduction in food costs depends of many factors, among others, proximity between ownership, by-product availability, nutritional characteristics and freight cost. Traditional ingredients used, such as corn, soybean, cotton, and biodiesel agribusiness by-products have been used as alternative sources.

The composition of the diet is the main factor influencing the fatty acid (FA) composition of meat and milk, since the fatty acids that reaches the duodenum are at least partly of food origin, as well as microbial bio hydrogenation of the diet dietary lipid rumen(2).

In order to meet the demand of an increasingly demanding market for the consumption of certain saturated fats, due to their negative effects on human health, the manipulation of milk constituents, especially in relation to fat has been increasingly studied(3), because they have some fatty acids, precursors of blood cholesterol (LDL) that are linked to cardiovascular problems. Thus, there is a real increase in the demand for healthy foods that has low levels of saturated fat and preferably those that are beneficial to human health.

However, human intake of essential FA and conjugated linoleic acid (CLA) decreased, reflecting their low concentrations in ruminant milk as well as the consumption of low fat dairy products(4). Therefore, the objective of this study was to evaluate the levels of inclusion of licuri cake in diets of confined cows on the fatty acid and cholesterol profile of milk.

73

Rev Mex Cienc Pecu 2021;12(1):72-86

Material and methods Animals and treatments

The experiment was conducted on Fazenda Valeu Boi, located in the municipality of Encruzilhada – Bahia, between May 03 and August 22, 2016, 2016, and approved by the Ethics Committee on the Use of Animals (ECUA) under protocol nº. 104/2015 of April 15, 2015.

Four crossbred Holstein x Zebu cows (blood level between ½ and ¾ H x Z blood) were used, at the third or fourth lactation order, with average milk production between 4,500 and 6,000 kg in the previous lactation, adjusted for 300 d of lactation, with a mean body weight of 548 ± 17 kg. Cows were also selected according to lactation days, between 80 and 120 d at the beginning of the experimental period. They were arranged in a 4 x 4 Latin square, consisting of four experimental periods, with 21 d each, for which the first 16 d corresponded for adaptation and the last 5 d for data collection.

The licuri cake was purchased from Lipe Indústria de Sabão e Velas Ltda, Guanambi Bahia. Inclusion levels of the by-product in the total diet were 0.0, 5.5, 11.0 and 16.5 %, which corresponded to the replacement of 0.0, 25.0, 50.0 and 75.0 % of the crude protein of the total diet.

The diets were formulated in an attempt to be isoenergetic and isoproteic, in order to contain sufficient nutrients for maintenance, body weight gain of 0.15 kg d-1 and production of 25 kg milk d-1, adjusted to 3.5 % of fat, according to the requirements table(5), and based on the chemical-bromatological composition data of sugarcane, corn, soybean meal and LC, previously analyzed before the beginning of the experimental period.

The bulk source used was sugarcane (Saccharum officinarum), variety RB 72-454, treated with 1% urea-ammonium sulfate mixture (9:1), on a fresh matter basis. Table 1 shows the proportions of the ingredients in the concentrates and the ratio bulk source:concentrate, on a dry matter basis.

74

Rev Mex Cienc Pecu 2021;12(1):72-86

Table 1: Proportions of ingredients based on dry matter Levels of licuri cake (%DM) Ingredients 0.0 5.5 11.0 Sugarcane 49.9 49.8 50.2 Ground corn 35.4 32.7 29.7 Soybean meal 12.9 10.4 7.8 Licuri cake 0.0 5.3 10.6 1 Minerals salt 1.0 1.0 1.0 Limestone 0.6 0.6 0.5 Dicalcium phosphate 0.2 0.2 0.2 Chemical bromatological composition Dry matter 94.2 91.7 91.1 Crude protein 23.3 21.1 20.7 Ether extract 5.81 6.2 5.9 2 Neutral detergent fiber 12.4 16.2 18.4 Acid detergent fiber 9.3 13.4 17.5 Non-fibrous carbohydrates 53.1 51.4 50.1 Mineral matter 5.4 6.2 6.1 Lignin 1.5 4.2 6.8 3 *NDIN 15.7 25.5 34.9 4 *ADIN 15.6 18.1 19.4 5 NDFi 1.1 5.4 9.9

16.5 50.1 27.0 5.3 15.9 1.0 0.5 0.2 91.7 20.2 6.6 22.9 22.8 45.4 6.0 9.1 34.9 25.7 13.9

1

Composition: Calcium 200 g, Cobalt 200 mg, Copper 1.650 mg, Sulfur 12 g, Iron 560 mg, Fluorine (max) 1.000 g, Phosphorus 100 g, Iodine 195 mg, Magnesium 15 g, Manganese 1.960 mg, Nickel 40 mg, Selenium 32 mg, Sodium 68 g, Zinc 6.285 mg, 2Corrected for ash and protein; 3Neutral detergent insoluble nitrogen; 4Acid detergent insoluble nitrogen and 5Indigestible neutral detergent fiber. *Values in percentage of dry matter of the total nitrogen.

The animals were allocated in covered individual 16m2 bays, with troughs and drinking fountains. The diets were provided to the animals in two daily fractions in the form of a complete mixture, always at the same time, at 0700 and 1400 h at will, in order to allow 5% of leftovers. In each experimental period, bulk source and supplements were collected to assess the fatty acid profile (Table 2). Sample lipid extraction of the samples was based on the procedure proposed(6).

75

Rev Mex Cienc Pecu 2021;12(1):72-86

Table 2: Lipid profile of sugarcane and concentrates consumed Licuri cake levels (%DM) 1 Fatty acids Fatty acid concentration2 (mg g-1) Sugarcane 0.0 5.5 11.0 C4:0 104.8 nd* 0.0 0.0 C6:0 nd* nd* 0.02 0.05 C8:0 nd * nd* 0.1 0.3 C10:0 nd* nd* 2.8 5.6 C12:0 nd* nd* 1.7 3.4 C13:0 2.8 nd* nd* nd* C14:0 11.0 nd* 10.2 20.3 C16:0 10.3 14.3 15.6 16.6 C18:0 7.1 nd* 1.2 2.5 C18:1n9t nd* 3.6 4.0 4.5 C18:1n9c 14.4 nd* 2.0 3.9 C18:2n6 nd* 35.1 32.2 28.8 C20:1 nd* 0.8 0.7 0.7 C18:3n6 nd* 46.7 42.6 37.9 C21:0 nd* 2,3 1,9 1,6 C20:3n6 nd* 0.2 0.2 0.1 C20:3n3 0,6 nd* nd* nd* C24:0 nd* 0.2 0.2 0.2 -1 Totals fatty acids (mg g ) SFA3 135.9 16.8 33.8 50.6 4 MUFA 14.4 4.3 6.7 9.1 5 PUFA 0.6 81.8 74.9 66.8

16.5 0.1 0.1 0.4 8.5 5.1 nd* 30.7 18.5 3.7 5.1 5.9 27.8 0.7 35.9 1,3 0.1 nd* 0.2 68.6 11.7 63.9

1

Usual nomenclature expressed in mg g-1 fat, Butyric (C4:0), Caproic (C6:0), Caprylic (C8:0), Capric (C10:0), Lauric (C12:0), Tridecanoic (C13:0), Myristic (C14:0), Palmitic (C16:0), Stearic (C18:0), Elaidic (C18:1n-9t), Oleic (C18:1n-9c), Gamma-linoleic (C18:2n-6), Eicosenoic (C20:1), Gamma-Linolenic (C18:3n6), Heneicosylic (C21:0), Dihomo-gamma-linolenic (C20:3n6), Eicosatrienoic (C20:3n3), Lignoceric (C24:0), 3saturated fatty acids, 4 monounsaturated fatty acids, 5polyunsaturated fatty acids and *Not detect.

Analysis of fatty acids

Analyses were performed in the Laboratory of Chemical Separation Methods (LABMESQ), at the State University of Southwest Bahia (UESB). For the extraction of total lipids from fresh milk, 50 mL of each thawed sample were centrifuged at 12,000 rpm for 30 min at 4ºC, in a high-speed microcentrifuge (Himac CF-16RX II). The solid layer formed in the upper part was collected and stored in eppendorfs for further analysis, following the methodology proposed(7).

76

Rev Mex Cienc Pecu 2021;12(1):72-86

The lipids extracted from fresh milk were submitted to the preparation of fatty acid methyl esters, according to the procedure described(8), with modifications described(9). Fatty acid esters were analyzed using a gas chromatograph, (GC-2010 Plus Shimadzu), equipped with a Flame Ionization Detector (FID) and a Rt-2560 fused silica capillary column (100 m, 0.25 mm d.i). Gas flow (White Martins) was 40 mL min-1 for the carrier gas (H2); 30 mL min-1 for the auxiliary gas (N2) and 4,000 mL min-1 for the synthetic air flame. The sample split ratio was 90:10. The operating parameters were set after verification of the best resolution conditions. Injector and detector temperatures were 225 °C and 260 °C, respectively. The column temperature was programmed at 140 °C for 5 min, followed by of 3 °C min-1 ramp to reach 245 °C for 20 min. The total analysis time was 60 min.

Injections were performed in duplicate and injection volume was 0.7 μL. The peak areas of fatty acid methyl esters were determined using the LCSolution® software.

Identification of methyl esters

Methyl esters were tentatively identified by the retention time, comparing the standard containing 37 fatty acid methyl esters (189-19 Sigma, USA) and the retention times of fatty acid methyl ester standards containing the c9t11 and t10c12 linoleic acid isomers (O-5632 Sigma, USA)(9).

In order to evaluate the response of the flame ionization detector, a mixture solution consisting of standards (Sigma) of fatty acid methyl esters was used at a known concentration and was calculated by the equation according to the method proposed by Ackman(10). These factors were obtained from the mean of four replicates: FR =

A23:0  C3 Ax  C 23:0

Where: FR= Response factor in relation to methyl tricosanoate; A23:0= Area of methyl tricosanoate; C3= Concentration of fatty acid methyl esters; Ax= Area of fatty acid methyl esters and C23:0= Concentration of methyl tricosanoate.

For fresh milk samples, fatty acids were quantified in mg g-1 total lipids, using the internal standard methyl tricosanoate (23:0) (Sigma, USA). After weighing the lipids (~ 150 mg) for transesterification, 1000 μL of the internal standard solution at a known concentration (1.00 g mL-1), were added to all samples with the aid of a micropipette. The concentration of fatty acids in the samples was calculated according(11).

C (mg g-1) =

AX  M 23:0  FRT A23:0  M A  FCT

77

Rev Mex Cienc Pecu 2021;12(1):72-86

Where: AX= Area of fatty acid methyl esters; A23:0= Area of the internal standard; M23:0= Mass of the internal standard added to the sample (in milligrams); MA= Sample mass (in grams); FRT= Theoretical response factor of fatty acid methyl esters and FCT= Conversion factor to express the results of fatty acids, in mg, per g of total lipids (LT).

Extraction and identification of milk cholesterol

Extraction, detection, identification and quantification of cholesterol were performed, following the methodology of Bauer, et al(12). A C18 (250 mm x 4.6mm x 5 µm) analytical column was used. The mobile phase consisted of acetonitrile:isopropanol (95:5), at a flow rate of 2 mL min; the analysis time was 28 min. Chromatograms were run at 202 nm using an HPLC apparatus (Shimadzu), equipped with a degasser (DGU – 20 A5R) and two pumps (LC-20 AR), with a UV-Visible detector (SPD – 20 A). Cholesterol was identified by comparing the sample retention time with the standard, and quantification by the corresponding peak areas was performed by external standardization, using a SigmaAldrich® cholesterol standard (Cholesterol, code C8667).

Statistical analysis

The obtained results were evaluated through analysis of variance and regression, using the Statistical Analysis System - SAS software (SAS, 2003). The statistical models were chosen according to the significance of the regression coefficients, using the F test at 5% probability and coefficient of determination (R2), according to the following statistical model: Yijk= µ + li + cj + tk(ij) + eijk Where: Yijk= observed value of the variable; µ= general average; li = effect of line i; cj = effect of column j; tk(ij) = effect of treatment k; eijk = random error (residual).

78

Rev Mex Cienc Pecu 2021;12(1):72-86

Results For the concentrations of saturated fatty acids, butyric (C4:0), caproic (C6:0), caprylic (C8:0), capric (C10:0) and hendecanoic (C11:0), no significant difference (P>0.05) was observed with the inclusion of different levels of LC in the diet of confined dairy cows (Table 3).

Table 3: Saturated fatty acid composition of dairy cows fed on different levels of inclusion of licuri cake licuri cake levels (%DM) Fatty acids1 Eq.2 CV%3 P4 0.0 5.5 11.0 16.5 C4:0 12.6 12.9 13.6 12.9 13.0 9.6 0.7 C6:0 12.2 11.9 12.7 11.5 12.1 8.1 0.5 C8:0 8.0 7.7 8.1 7.2 7.7 7.3 0.2 C10:0 19.1 17.8 19.2 17.1 18.3 6.1 0.1 C11:0 3.1 2.8 2.9 2.5 2.8 11.5 0.1 5 C12:0 24.2 25.7 30.4 32.4 7.4 0.0 C13:0 0.4 0.4 0.4 0.4 0.4 13.1 0.6 C14:0 71.4 72.1 76.9 74.1 73.6 4.4 0.2 C15:0 8.7 6.9 6.8 6.1 7.1 17.7 0.1 C16:0 227.7 242.6 233.7 222.5 231.6 8.3 0.5 C17:0 16.1 15.7 15.3 13.9 15.3 10.8 0.4 C18:0 36.7 33.8 34.9 35.7 35.3 10.1 0.7 C20:0 0.5 0.5 0.5 0.5 0.5 8.8 0.9 C21:0 0.7 0.6 0.6 0.6 0.6 12.2 0.4 1

Usual nomenclature expressed in mg g-1 fat, Butyric (C4:0), Caproic (C6:0), Caprylic (C8:0), Capric (C10:0), Hendecanoic (C11:0), Lauric (C12:0), Tridecanoic (C13:0), Myristic (C14:0), Pentadecenoic (C15:0), Palmitic (C16:0), Margaric (C17:0), Stearic (C18:0), Arachidic (C20:0), Henecosanoic (C21:0), 2Regression equations, 3 Coefficient of variation, 4Probability of error and 5Y = 0.5316x + 23.804, R² = 0,96.

For lauric acid (C12:0), there was significant effect (P<0.05) with the inclusion of different levels of LC. There was at growing linear effect on the concentration of lauric acid in milk samples, resulting from the by-product (Table 2), which contributed 0.0, 1.5, 2.7 and 3.6 % among treatments.

Milk saturated fatty acids represent more than 80 % in their composition, which demonstrate the biohydrogenation capacity of cattle in transforming monounsaturated and polyunsaturated fatty acids into saturated fatty acids, even with the diet contributing with more than 52 % monounsaturated and polyunsaturated fatty acids (Table 2). Among the saturated fatty acid profiles, the most abundant were palmitic acid (C16:0), myristic acid (C14:0) and stearic acid (C18:0), palmitic acid had the highest mean concentration among treatments, 231.60 mg g-1.

79

Rev Mex Cienc Pecu 2021;12(1):72-86

Table 4 shows the mono and polyunsaturated fatty acids of milk samples. There were no significant differences (P>0.05) between the inclusion levels of LC in the diet, on the fatty acid profile of myristoleic, pentadecenoic, palmitoleic, 10-heptadecenoic, oleic, linoleic, eicosatrienoic and arachidonic acids. Among these fatty acids, myristoleic (C14:1) and oleic (C18:1n9c) had higher mean concentrations, 10.2 and 78.1 mg g-1, respectively.

As for the fatty acids Elaidic and Gamma-Linolenic, a linear decreasing effect (P<0.05) was observed, with a reduction of 0.1 and 0.2, respectively, for each unit (mg g-1) of LC added in the diet.

Table 4: Mono and polyunsaturated fatty acid composition of dairy cows fed on different inclusion levels of licuri cake Licuri cake levels (%DM) Fatty acids1 Eq.2 CV%3 P4 0.0 5.5 11.0 16.5 C14:1 10.3 10.4 10.5 9.7 10.2 7.4 0.5 C15:1 0.9 0.9 0.9 0.9 0.9 25.5 0.9 C16:1 2.9 2.7 2.7 2.7 2.7 4.8 0.1 C17:1 1.4 1.2 1.1 1.1 1.2 11.5 0.2 5 C18:1n9t 5.2 4.7 3.9 3.6 15.0 0.0 C18:1n9c 90.6 86.0 51.7 84.2 78.1 8.8 0.5 C18:2n6 2.1 1.8 1.7 1.9 1.9 18.6 0.6 6 C18:3n6 9.4 8.2 7.0 5.9 9.2 0.0 C20:3n3 0.5 0.4 0.4 0.4 0.4 8.9 0.6 C20:4n6 1.1 1.0 1.0 1.0 1.0 8.2 0.3 1

Usual nomenclature expressed in mg g-1 fat, Myristoleic (C14:1), Pentadecenoic (C15:1), Palmitoleic (C16:1), 10- Heptadecenoic (C17:1), Elaidic (C18:1n9t), Oleic (C18:1n9c), Gamma-linoleic (C18:2n6), Gammalinolenic (C18:3n6), Eicosatrienoic (C20:3n3), Arachidonic (C20:4n6), 2Regression equations, 3Coefficient of variation, 4Probability of error. 5Y = -0.1042x + 5.197, R² = 0.97 and 6Y = -0.214x + 9,378, R² = 0,99.

The levels of CLA (C18:2cis9trans11) and (C18:2trans10cis12) in milk were influenced by the inclusion levels of LC in the diets (P<0.05) and, in the treatment with 16.5 % by-product inclusion level (Table 5), CLA levels reduced 0.01 and 0.03 mg g-1 fat, respectively.

Table 5: Conjugated linoleic acid composition and milk fat of dairy cows fed on different inclusion levels of licuri cake Licuri cake levels (%DM) Fatty acids1 Eq.2 CV%3 P4 0.0 5.5 11.0 16.5 5 CLA C18:2c9t11 0.5 0.5 0.4 0.3 7.8 0,0 6 CLA C18:2t10c12 2.1 1.7 1.6 1.4 7.8 0.0 Composition (%) Fat 4.4 5.0 4.9 4.9 4.8 8.2 0.2 1

Usual nomenclature expressed in mg g-1 fat, Conjugated linoleic acid (CLAcis9trans11) and (CLAtrans10cis12), 2 Regression equations, 3Coefficient of variation and 4Probability of error. 5Y = -0.0147x + 0.534, R² = 0.99; 6Y = -0.0347x + 1.954, R² = 0,94.

80

Rev Mex Cienc Pecu 2021;12(1):72-86

There was no significant difference (P>0.05) for saturated fatty acids, monounsaturated, omega 3 and the omega 6/omega 3 ratio, as a function of the tested levels of LC (Table 6). The sum of polyunsaturated fatty acids and omega 6 decreased (P<0.05). Regarding the polyunsaturated/saturated fatty acids ratio, there was a linear decreasing effect (P<0.05). Regarding the cholesterol analysis of milk samples, there was no statistical difference (P>0.05) in cholesterol concentrations between the evaluated treatments, with a mean of 2.1 mg 100 mL-1, as can be seen in Table 6. This result followed the same effect for fat composition in milk (Table 5).

Table 6: Fatty acid sum and milk cholesterol of dairy cows fed on different inclusion levels of licuri cake Licuri cake levels (%DM) Fatty acids1 Eq.2 CV%3 P4 0.0 5.5 11.0 16.5 Saturated 441.5 451.2 455.9 437.3 446.5 5.8 0.7 Monounsaturated 111.3 105.9 100.7 102.3 105.0 7.4 0.3 5 Polyunsaturated 15.5 13.5 12.1 10.9 8.1 0.0 8 6 PUFA / SFA 0.3 0.2 0.1 0.0 9.3 0.0 9 n-3 0.5 0.4 0.4 0.4 0.4 8.9 0.6 10 7 n-6 12.5 10.9 9.7 8.8 9.8 0.1 11 n-6 / n-3 27.9 26.1 22.1 21.4 24.4 15.6 0.2 -1 Cholesterol (mg 100 mL ) 2.3 2.1 1.9 2.2 2.1 14.1 0.4 1

Usual nomenclature expressed in mg g-1 fat, 2Regression equations, 3Coefficient of variation, 4Probability of error, 5Y = -0.2793x + 15.309, R² = 0.99, 6Y = -0.0006x + 0,0338, R² 0.91, 7Y = -0.2278x + 12.382, R² = 0.99, 8Ratio polyunsaturated/saturated fatty acids, 9Totals omega-3: 20:3n3, 10Totals omega-6: 18:2n6, 18:3n6, 20:4n6 and 11Ration between omega-6 and omega-3.

Discussion Fatty acid concentrations C4:0, C6:0, C8:0, C10:0 and C11:0 were not altered, probably due to the de novo synthesis and the reduced number of acetate and β-hydroxybutyrate synthesis precursors resulting from fermentation in the rumen, the main metabolic pathway involving acetyl-CoA carboxylase(13).

The increase in lauric acid concentration of LC was sufficient to alter the concentrations of the lipid profile of milk samples, from the inclusion levels used in the diet. The major contributions of lauric acid in milk may be related to the inclusion of foods from coconut(14), which have an expressive amount of (C12:0), and may be a probable justification for the results found in this study, corroborating those of(15), who evaluated palm cake for confined dairy cows. In studies conducted by(16), they reported that lauric acid is considered to be responsible for the negative effects on human health, since it is a fatty acid present in milk, mainly of animals that consumed diets containing coconut or its by-products.

81

Rev Mex Cienc Pecu 2021;12(1):72-86

Among the saturated fatty acids, the most abundant palmitic and myristic what may have been influenced by the higher percentages of these fatty acids present in LC. Palmitic and myristic acids have the potential to act negatively on human health, since they can be rapidly incorporated into cellular triglycerides, contributing to an increase in cholesterolemia(17). Stearic acid can be converted into a mono and polyunsaturated fatty acid by ruminants(18,19) Saturated fatty acids are capable of raising LDL (low-density lipoprotein) levels in human blood(20).

The absence of significance among mono and polyunsaturated fatty acids may be associated with the behavior of the Δ9-desaturase enzymatic activity in the mammary gland. According to some authors(21), Δ9-desaturase is responsible for the conversion of saturated fatty acids to monounsaturated fatty acids.

The results for fatty acids Elaidic and Alpha-Linolenic demonstrate that the profile of these acids in milk can be altered by modifications in the ruminal fermentation pattern through the action of microorganisms, and the main are Butyrovibrio fibrisolvens and Anaerovibrio lipolytica, able to hydrolyze ester bonds(22), minimizing the toxic effects of fatty acids. Even with increasing levels of by-product in the diet (Table 2), there was a reduction in (C18:1n9t), demonstrating the biohydrogenation capacity of ruminants acting as a defense mechanism.

The reduction in CLA with the inclusion of LC indicate that the milk obtained from confined animals, receiving sugarcane as a bulk source, supplemented with LC in the diet, showed that the increase in by-product partition negatively affects the concentration of conjugated linoleic acid. Trans-10 cis-12 CLA isomers are the main fatty acids responsible for the milk fat depression syndrome (SARA) but, although these isomers are present in the fat of the evaluated samples, their concentrations were low, which apparently could not act deleteriously on the de novo synthesis of fatty acids and, consequently, were not able to influence fat composition(20).

This decrease in CLA content in milk samples was more accentuated from the inclusion levels of the by-product, even though it contained 44.9 % polyunsaturated fatty acids (Table 2), they were not sufficient to increase the levels of CLA in milk. Thus, low levels of C18:2n-6 and C18:3n-6 intake in the diet contributed to a decrease in duodenal flow and, consequently, a decrease in CLA concentrations in milk. Conjugated linoleic acid is produced through the incomplete biohydrogenation of linoleic and linolenic acids in the rumen(23) CLA has shown beneficial effects on human health, which are mainly attributed to two of its isomers: cis-9, trans-11 and trans-10, cis-12(24).

The reduction of polyunsaturated fatty acids and omega-6 reflects the consumption of polyunsaturated fatty acids (Table 2) ruminants do not synthesize C18:2 and its isomers(25), especially those of the omega-6 and omega-3 families, which are obtained through the diet.

82

Rev Mex Cienc Pecu 2021;12(1):72-86

This decrease among treatments was lower than the proportion recommended by Wood et al(26), which should be above 0.4 polyunsaturated fatty acids for saturated fatty acids.

Therefore, further research is necessary to improve the PUFA:SFA ratio in milk.

Although the dietary balance between PUFA (omega 3) is formed from alpha-linolenic acid (C18:3) and omega 6 is formed from linoleic acid (C18:2)(27), they are considered essential for humans, in addition to conjugated linoleic acid (CLA)(9).

One of the main reasons that may explain the high concentration of saturated fatty acids in milk samples (Figure 1) is the significant reduction in PUFA consumption from LC (Table 2), as well as the biohydrogenation process. Different results were observed by others(28), in a comparative study of fatty acids of bovine and buffalo milk, which had 74.2 and 75.3 % saturated fatty acids in their composition.

Figure 1. Saturated, polyunsaturated and monounsaturated percentage fatty acids in the milk of dairy cows fed different inclusion levels of licuri cake

Conclusions and implications The inclusion levels of LC modified the lipid profile of milk, mainly the concentrations of polyunsaturated fatty acids, conjugated linoleic acid isomers (CLAs) and Omega 6 fatty acids, which is not interesting from the human nutrition point of view. Cholesterol levels remained unchanged, regardless of inclusion level.

Acknowledgements The authors are grateful to the Coordination for the Improvement of Higher Education Personnel (CAPES) and Program Postgraduate in Animal Science (UESB) for their

83

Rev Mex Cienc Pecu 2021;12(1):72-86

support. Thanks to the Research Support Foundation of the State of Bahia (FAPESB), Pronex Project PNX0004 / 2014 and the Postgraduate Program in Animal Science (UESB) for their support.

Literature cited: 1. Borja MS, Oliveira RL, Ribeiro CVDM, Bagaldo AR, Carvalho GGP, Silva TM, et al.

Effects of feeding licury (Syagrus coronate) cake to growing goats. Asian-Aust J Anim Sci 2010;23(11):1436-1444.

2. Buccioni A, Decandia M, Minieri S, Molle G, Cabiddu A. Lipid metabolism in the rumen: New insights on lipolysis and biohydrogenation with an emphasis on the role of endogenous plant factors. Anim Feed Sci Technol 2012;174:1-2.

3. Eifert EC, Lana RP, Lanna DPD, Leopoldino WM, Arcuri PB, Leão MI, et al. Perfil de ácidos graxos do leite de vacas alimentadas com óleo de soja e monensina no início da lactação. Rev Bras Zootec 2006;35:219-228.

4. Elgersma A, Tamminga S, Ellen G. Modifying milk composition through forage. Anim Feed Sci Technol 2006;131:207-225.

5. NRC - National Research Council. Nutrient requirements of dairy cattle. 7 ed.

Washington, D.C.: National Academy Press; 2001.

6. Bligh EG, Dyer WJ. Rapid method of total extraction and purification. Can J Biochem Physiol 1959;37(3):911-917.

7. Folch J, Lees M, Stanley GHS. A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem 1957;226(1):497-509.

8. Bannon CD, Breen GJ, Craske JD, Hai NT, Harper NL, Orourke KL. Analysis of fatty acid methyl esters with high accuracy and reliability. J Chromatog 1982;247:71-89.

9. Simionato JI, Garcia JC, Santos GT, Oliveira CC, Visentainer JV, Souza NE. Validation of the determination of fatty acids in milk by gas chromatography. J Braz Chem Soc 2010;21(3):520-524.

10. Ackman RG. The analyses of fatty acids and related materials by gas-liquid chromatography. Prog Chem Fats Other Lipids 1972;12:165-284.

11. Visentainer JV, Franco MRB. Ácidos Graxos em óleos e gorduras: identificação e quantificação. São Paulo: Varela, 2006.

12. Bauer LC, Santana DA, Macedo MS, Torres AG, Souza NE, Simionato JIJ. Method validation for simultaneous determination of cholesterol and cholesterol oxides in milk by RP-HPLC-DAD. J Braz Chem Soc 2014; 25(1):161-168.

84

Rev Mex Cienc Pecu 2021;12(1):72-86

13. Chilliard Y, Ferlay A, Mansbridge RM, Doreau MA. Ruminant milk fat plasticity: nutritional control of saturated, polyunsaturated, trans and conjugated fatty acids.

Ann Zootec 2000;49:181-205.

14. Machado GC, Chaves JBP, Antoniassi R. Composição em ácidos graxos e caracterização física e química de óleos hidrogenados de coco babaçu. Ceres 2006;53(308):463-470.

15. Pimentel LR, Silva FF, Robério RS, Rodrigues ESO, Meneses MA, Porto Junior AF, et al. Perfil de ácidos graxos do leite de vacas alimentadas com torta de dendê. Sem Cienc Agr 2016;37(4):2773-2784.

16. Ribeiro CGS, Lopes FCF, Gama MAS, Morenz MJF, Rodrigues NM. Desempenho produtivo e perfil de ácidos graxos do leite de vacas que receberam níveis crescentes de óleo de girassol em dietas à base de capim-elefante. Arq Bras Med Vet Zootec 2014;66(5):1513-1521.

17. Lottenberg AMP. Importância da gordura alimentar na prevenção e no controle de distúrbios metabólicos e da doença cardiovascular. Arq Bras Endocrinol 2009;53(5):595-607.

18. Shaefer EJ. Lipoproteins, nutrition, and heart disease. Amer Soc Clin Nutr 2002;75:191-212.

19. Tsiplakou E, Kominakis A, Zervas G. The interaction between breed and diet on CLA and fatty acids content of milk fat of four sheep breeds kept indoors or at grass. Small Ruminant Res 2008;74:179-187.

20. Oliveira RL, Ladeira MM, Barbosa MAA, Matsushita M, Santos GT, Bagaldo AR, Oliveira RL. Composição química e perfil de ácidos graxos do leite e muçarela de búfalas alimentadas com diferentes fontes de lipídeos. Arq Bras Med Vet Zootec 2009;61(3):736-744.

21. Malau-Aduli AEO Siebert BD, Bottema CDK, Pitchford WSA. Comparison of the fatty acid composition of triacylglycerols in adipose tissue from Limousin and Jersey cattle. Aust J Agri Res 1997;48:715-722.

22. Parodi PW. Conjugated linoleic acid and other anticarcinogenic agents of bovine milk fat. J Dairy Sci 1999;82:1339–1349.

23. Holanda MAC, Holanda MCR, Mendoça Júnior AF. Suplementação dietética de lipídios na concentração de ácido linoléico conjugado na gordura do leite. Acta Vet Bras 2011;5(3):221-229.

24.Bhattacharyaa A, Banua J, Rahmana M, Causeyb J, Fernandes GJ. Biological effects of conjugated linoleic acids in health and disease. J Nutr Biochem 2006;17:789-810.

85

Rev Mex Cienc Pecu 2021;12(1):72-86

25.Martin CA, Almeida VV, Ruiz MR, Visentainer JEL, Matshushita M, Souza NE, Visentainer JV. Ácidos graxos poliinsaturados ômega-3 e ômega-6: importânica e ocorrência em alimentos. Rev Nutr 2006;19(6):761-770.

26.Wood JD, Richardson RI, Nute GR, Fisher AV, Compo MM, Kasapidou E, Sheard PR, Enser M. Effects of fatty acids on meat quality: a review. Meat Sci 2003;66:2132.

27. Williams CM. Dietary fatty acids and human health. Ann Zootech 2000;49:165-180.

28. Pignata MC, Fernandes SAA, Ferrão SPB, Faleiro AS, Conceição DG. Estudo comparativo da composição química, ácidos graxos e colesterol de leites de búfala e vaca. Rev Caatinga 2014;27(4):226-233.

86

https://doi.org/10.22319/rmcp.v12i1.5529 Article

Milk yield derived from the energy and protein of grazing cows receiving supplements under an agrosilvopastoral system

Sherezada Esparza-Jiménez a Benito Albarrán-Portillo a* Manuel González-Ronquillo b Anastacio García-Martínez a José Fernando Vázquez-Armijo a Carlos Manuel Arriaga-Jordán c

a

Universidad Autónoma del Estado de México. Centro Universitario UAEM Temascaltepec. Km 67.5 Carretera Toluca-Tejupilco, Temascaltepec. 51300. Estado de México, México. b

Universidad Autónoma del Estado de México. Facultad de Medicina Veterinaria y Zootecnia. Estado de México, México. c

Universidad Autónoma del Estado de México. Instituto de Ciencias Agropecuarias y Rurales (ICAR). Estado de México, México.

* Corresponding autor: balbarranp@uaemex.mx

Abstract: Dual purpose farms southwest of the State of Mexico produce milk and calves under subtropical agrosilvopastoral systems (ASPS). During the dry season, farmers supplement their cattle due to the low availability and quality of grasses, without considering, besides grasses, the contribution of woody species to dry matter intake, metabolizable energy (ME), and crude protein (CP) requirements of cows. The aim of this study was to determine milk produced from forage energy (MFe) and protein (MFp) of grazing cow with three types of supplement. First supplement consisted of cracked maize and commercial concentrate resulting on 14 % of CP (S14). To the S14 mixture 7 % of soybean meal was added to increase CP to 16 % (S16), and commercial concentrate

87

Rev Mex Cienc Pecu 2021;12(1):87-104

of 16 % CP was used as a third supplement (SC16). Six lactating cows were allocated in a 3x3 replicated Latin Square (three cows per square), three experimental periods (EP) (three weeks per EP). There were no significant effects of supplements (P=0.80) on performance variables. Mean milk yield was 6.8 kg/cow/d. Milk from forage energy and protein were 0.8 and 6.1 kg/cow/day, respectively. Mean milk urea nitrogen (MUN) was high regardless of supplement; but nitrogen in urine (44.1 mg/dL) and feces (1.4 mg/g) were higher for SC16 (P=0.001 and 0.04, respectively). Cows obtained 90 and 10 % of their CP and metabolizable energy requirements for maintenance and production from the agrosilvopastoral system.

Key words: Agrosilvopastoral, Milk from forage, Supplements, Nitrogen excretions.

Received: 04/10/2019 Accepted: 29/06/2020

Introduction Mexico is the eighth largest milk producer in the world (counting the European Union as a single entity) with a projected production of 12.4 million tons for 2019, but is the largest importer of dry non-fat milk with projections for 2018 equivalent to over 30 % of demand(1), with a growth rate of 1.6 % during 2018.

The national cattle herd was estimated at 33.5 million head with 51 % in the tropical and subtropical regions of the country under extensive grazing systems, where dual purpose farms are predominant and contribute to around 18 % of national milk production(2).

These systems fulfil an important social role by providing vital livelihoods for families in the subtropical and tropical regions of the country(3).

Forage availability and quality during the dry season (November to May) is low; so, farmers resort to supplementation strategies aimed to maintain milk yields and body condition in cows, as well as weight gains in calves(4).

Feeding represents a large proportion of milk production cost(2), and supplements can be up to 70 % of production costs in dual-purpose subtropical farms(5). In order to reduce costs, some farmers mixed maize ears (with husks) produced in their farms, with commercial concentrate (50:50) resulting in a supplement with 14 % of crude protein (CP), while other farmers prefer more expensive commercial concentrates with a CP content that range from 16 to 18 % CP(3,5).

The amount of supplement assigned to a cow range from 5 to 9 kg/cow/d, that represents between 40 and 75 % of cow’s dry matter intake (DMI). The amount assigned is firstly 88

Rev Mex Cienc Pecu 2021;12(1):87-104

based on milk yield and varies over the dry season depending on forage availability (mainly grasses) on swards, without considering other resources like forbs or trees from which cows browse to complement their DMI, energy and protein requirements. This results in unbalanced diets that could lead to inadequate supply of nutrients causing low production, health problems or high production costs(6).

Tropical grasses are the main source of nutrients for cattle in traditional tropical livestock production; however, their low nutritional characteristics (i.e. low crude protein, energy and digestibility) restrict cattle productivity. The lack of technical knowledge regarding sward management, assessment of forage availability and quality along with basic animal nutritional requirements, leaves farmers with no other management tool but to use supplements based on grains as the only mean to counter the low availability and quality of grasses during the dry season(3,4).

Milk from forage intake by grazing cows can be estimated by subtracting the theoretical milk production from concentrates intake, assuming that maintenance requirements are met by forage intake(7). In order to account for the contribution of forage to energy and protein, milk from forage (MF) may be estimated following the procedure already described(8).

The objective of the study was to estimate the amount of produced milk from forage energy (MFe) and crude protein (MFp), of cows grazing on an agrosilvopastoral system, with three different types of supplement. The second objective was to estimate income over supplement cost.

Material and methods Location

The study took place in a dual-purpose farm in the municipality of Zacazonapan in the south of the State of Mexico between 19º 00’ 17’’ and 19º 16’ 17’’ N and between 100º 12’ 55’’ and 100º 18’ 13’’ W, at an altitude of 1,470 m. Climate is a semi-hot of the A group, sub-humid with summer rains and a marked dry season from November to May, classified as A(C) (w2) (w), with mean temperature of 23oC and 1,115 mm of annual rainfall. The experiment was conducted during the dry season from March 22nd to June 13th of 2010. Cattle was handled in the same way as the farmer does habitually, respecting routines and avoiding stressing the cattle.

89

Rev Mex Cienc Pecu 2021;12(1):87-104

Agrosilvopastoral system description

The farm has a land surface of 100 ha fenced in the perimeter, where cows grazed at a stocking density of 0.25 AU ha. Forage resources within the agrosilvopastoral systems have been reported previously(9), and consisted of: sward (continuous grass covered area); browse (includes leaf and twig growth of shrubs, woody vines, trees etc.); forbs (herbaceous broadleaf plant that is not a grass and is not grass-like) and crops residues(10).

Sward component consisted of Star of Africa (Cynodon plectostachyus) as the main grass with 44 % presence, the rest of the grasses in order of abundance were Brachiaria plantaginea (17 %), Paspalum convexum (12 %), Cynodon dactylon (11 %), Eleusine indica (5 %), Paspalum notatum (4 %), Paspalum conjugatum (4 %), Paspalum scrobicunatum (2 %), Digitaria bicornis (1 %).

The browse component included 27 woody species that are well accepted and consumed by cattle. Of these species cattle consume foliage, flowers, and fruits. Forbs consisted of 22 species and most of them are consumed by cattle. Lastly, maize (Zea mays) and sugar cane (Saccharum officinarum) are cultivated in the farm on 30 % of available land, and after harvest cattle have access to crop residues during the late dry season.

Experimental units and management

Six multiparous Brown Swiss cows were used in the experiment with an average of 4 ± 1.2 calving, 73 ± 27 d in milk, mean live weight (LW) of 491 ± 57 kg and 2.5 body condition score (BCS) on a 1 - 5 scale. Cows had a pre-experimental mean milk yield of 5.3 kg/cow/d and were hand milked once a day from 0700 to 0900 h. Before being milked, calves were allowed to suckle for few seconds the first milk from the four teats of their dams in order to stimulate milk let down; afterwards calves were tied to a pole close to their dams while they were milked.

Once the cows were milked, calves were allowed to suck residual milk and remained with their dams in grazing areas until 1400 h. Subsequently, they were separated from their mothers and were enclosed into a paddock where they grazed in a sward of characteristics above described. Calves were supplemented with 1.8 kg/day (DM basis) of cracked maize and commercial concentrate (14 % of CP) and had ad libitum access to water and mineral mix.

90

Rev Mex Cienc Pecu 2021;12(1):87-104

Supplements

Supplements used in this study were intended to replicate the characteristics and ingredients of those commonly used by farmers in the study region. Cracked maize ears were mixed with commercial concentrate (50:50), resulting in a supplement with 14 % of CP (S14). S14, was mixed with 7 % of soybean meal to increase CP to 16 % (S16); and commercial concentrate with 16 % of CP (SC16) was the third supplement used. Table 1 shows the chemical composition of the ingredients used.

Table 1: Chemical composition of ingredients used in supplements Ingredients, g/kg DM

Dry matter

Crude protein

Cracked maize ears with husks Commercial concentrate (16 % CP) Soybean meal

980 918 943

83 161 437

Neutral detergent fiber 324 198 110

Acid detergent fiber 120 103 47

Before milking, cows received 4.5 kg/cow/d (DM basis) of the experimental supplements in a bag tied to the neck. Milking duration was enough for the cow to finish the assigned supplement; in case they did not, the bag remained tied until the cow finished the assigned amount.

Sampling and analyses

Milk yields kg/cow/d from individual cows were recorded for two consecutive days, during the last week of each experimental period (EP), using a clock spring balance with capacity for 20 kg. After recording milk yield from individual cows, two milk samples were taken. One milk sample was used to determine milk components (fat, protein, and lactose), using a portable ultrasound milk analyzer at the farm within 2 h after taking the samples. The second sample (40 ml), was preserved by adding Bromopol and transported in ice to laboratory. Samples were kept at -20°C until posterior analyses. Samples were thawed at room temperature and subjected to the enzymatic colorimetric technique(11) to determine milk urea nitrogen (MUN).

Cows liveweight was recorded after milking for two consecutive days at the beginning of the experiment and on the third week of every EP using a portable electronic cattle weighbridge. Body condition score was assessed immediately after weight recording(12).

Urine samples (60 ml) were collected from cows via vulva stimulations after weighing, for two consecutive days during the last week of each EP. Sample was preserved by adding 15 ml of 0.05N HSO4. Urine urea nitrogen (UUN) was analyzed using the method(11). Also, feces samples were collected in a cup and were stored at -20 oC for

91

Rev Mex Cienc Pecu 2021;12(1):87-104

further analysis. Feces were dried in a forced-air oven at 60oC for 48 h, and ground through a 1 mm screen. Nitrogen in feces was determined following standard procedures(13).

Supplements were sampled daily during the last week of each EP and composited to get a subsample for chemical analyses. Samples were subjected to dry matter determination by drying at 60 °C in a forced-air oven for 48 h, and ashes was obtained by incineration in a muffle furnace at 550 °C for 6 h. CP was estimated by the Kjeldahl method, and neutral detergent fiber (NDF) and acid detergent fiber (ADF) by the Ankom micro-bag technique(13). The in vitro dry matter digestibility (IVDMD) of supplements, was determined using the in vitro gas production technique(14).

Calculations Milk from forage based on energy and protein(8).

Energy: 𝑀𝐹 𝑒𝑛𝑒𝑟𝑔𝑦 (𝑘𝑔) = ECM(kg) [𝑁𝐸𝐿 supplement (Mcal) − 𝑁𝐸𝐿 𝑟𝑒𝑞 𝐵𝑊 𝑐ℎ𝑎𝑛𝑔𝑒 (𝑀𝑐𝑎𝑙)] − 0.75 𝑀𝑐𝑎𝑙 / 𝑘𝑔 𝑚𝑖𝑙𝑘 where ECM (4 % fat, 3.4 % CP, kg) = milk (kg) x (0.124 % fat + 0.073 % CP + 0.256).

NEL concentrate (Mcal) = DMI (kg) x ∑𝑛𝑖=1 𝑝𝑒𝑟𝑐𝑒𝑛𝑡𝑎𝑔𝑒 of DMI supplementi + NEL of supplementi (Mcal/kg). where i = 1, 2… n, and n is the number of supplements.

NEL req for BW change (Mcal) = BW change (kg) x NEL req (Mcal/kg of BW change), where NEL (Mcal/kg of BW change) = 5.34 Mcal/kg of BW gain = -4.68 Mcal/kg of BW lost.

Protein: 𝑀𝐹 𝑝𝑟𝑜𝑡𝑒𝑖𝑛 (𝑘𝑔) = PCM(kg) −

[CP supplement (𝑘𝑔) − CP 𝑟𝑒𝑞 𝐵𝑊 𝑐ℎ𝑎𝑛𝑔𝑒 (𝑘𝑔)] 0.088 𝑘𝑔 𝑜𝑓 𝐶𝑃 / 𝑘𝑔 𝑚𝑖𝑙𝑘

where PCM (protein-corrected milk; 3.4% CP, kg) = milk (kg) x 0.294 % CP. CP concentrate (kg) = DMI (kg) x ∑𝑛𝑖=1[ % 𝐷𝑀𝐼 𝑜𝑓 𝑠𝑢𝑝𝑝𝑙𝑒𝑚𝑒𝑛𝑡𝑖 𝑥 𝐶𝑃 𝑜𝑓 𝑠𝑢𝑝𝑝𝑙𝑒𝑚𝑒𝑛𝑡𝑖 (%)] where i = 1, 2…n, and n is the number of supplements.

92

Rev Mex Cienc Pecu 2021;12(1):87-104

CP req for BW change (kg) = BW change (kg) x CP req (kg of CP/kg of BW change) where CP req (kg of CP/kg of BW change) = 0.078 kg of CP/kg of BW gain = -0.094 kg of CP/kg of BW lost.

Forage intake estimations

Forage dry matter intake (DMI) were estimated indirectly following the utilized metabolizable energy method(15), taking metabolizable energy (ME) requirements for the cows(16). Estimated ME (eME) provided by supplements was subtracted from total ME requirements, and the result divided into eME of the forage to obtain estimated forage DMI. Total DMI was the sum of estimated forage DMI plus supplement DMI.

Cost benefit analyses

Cost benefit analysis was done by partial budgets procedure to determine the costs of supplementation and returns from milk sales(17). Partial budgets evaluate only the changes in the expenditures and incomes derived from implementing an alternative (supplements), not taking into consideration other factors or activities that are not modified as labor, fuels, cost of grazing. Cost benefit analysis results are expressed in US dollars.

Statistical analysis

The experimental design was a replicated 3x3 Latin square design (21-d period).

Supplement sequences were randomized for square one, and square two followed a mirror image in the treatment sequences to account for carry-over effects. Experimental periods lasted three weeks, the first two weeks were considered as adaptation period to the supplements and the last two days of the third week for sampling and measurements of animal response variables. Cows were assigned randomly to treatment sequence in both squares.

Response variables were analyzed with the Proc Mixed procedure of SAS (18) using the following equation(19): Yijkm =  + Sm + Ci(m) + Pj(m) + Supk + eijkm where:

93

Rev Mex Cienc Pecu 2021;12(1):87-104

 = General mean, Sm = fixed effect of squares (m = 1 and 2), Ci(m) = random effect of cow within square (i = 1, 2, 3), Pk= fixed effect of experimental periods j within square m (j = 1, 2, 3), Supl= fixed effect of supplement (k = S14, S16, and SC16) eijkm= Residual error term.

Significant differences between means (P<0.05) were tested with the Tukey test.

Correlation analyses for milk protein, MUN, NF and UUN were performed using the Corr procedure of SAS(18). Correlation coefficients were considered low when r ≤0.39 and moderate when r ≥0.40 and ≤0.60.

Results Chemical composition of supplements

Table 1 shows the chemical composition of ingredients of supplements and Table 2 shows ingredient inclusion levels and chemical composition of supplements. The DM, OM, NDF, and ADF content were numerically similar between supplements. Important differences were in CP as intended with 141 for S14, 159 for S16, and 161 g/kg DM for SC16. Supplement IVDMD of S14 was 5 and 9 % higher than S16 and SC16, respectively. A similar trend was observed for estimated ME MJ/kg DM S14 (12.6) was higher than S16 (12.0) and SC16 (11.4).

94

Rev Mex Cienc Pecu 2021;12(1):87-104

Table 2: Ingredients inclusion level and chemical composition of supplements with 14 % (S14) and 16 % (S16, SC16) of crude protein, offered to Brown Swiss cows on agrosilvopastoral system during the dry season Inclusion level (%) Cracked maize ears with husks Commercial concentrate (16 % CP) Soybean meal Total

S14 50 50 100

Nutrient, g/kg DM Dry matter 907 Organic matter 842 Crude protein 141 Neutral detergent fiber 190 Acid detergent fiber 90 IVDMD 800 Estimated metabolizable energy, MJ/kg DM 12.6 IVDMD = In vitro dry matter digestibility.

S16 46.5 46.5 7 100

SC16

889 846 159 174 84 758 12.0

918 813 161 198 103 729 11.4

100 100

Animal variables

Treatment effects on DMI, milk yield, milk composition and N excretions are shown in Table 3. There were no effects on performance variables due to supplements (P>0.05).

Average milk yield was 6.8 ± 1 kg/cow/d. Fat, protein and lactose contents were 20.8 ± 7, 31.0 ± 1 and 44.6 ± 2 g/kg, respectively. Average live weight was 495 ± 53 kg, and a body condition score of 2.6 ± 0.1 points.

Table 3: Animal response variables of grazing lactating cows receiving three sources of supplements with two crude protein levels (14 vs 16 % CP) Treatment

S14

S16

SC16

P=

SEM

DM intake, kg/d 12.9 12.8 13.0 0.40 0.25 Milk yield, kg/d 6.7 6.7 6.9 0.80 0.70 Fat, g/kg 22.9 22.0 17.4 0.16 2.0 Protein, g/kg 31.0 30.8 31.3 0.85 1.6 Lactose, g/kg 44.9 44.1 44.9 0.79 1.6 Live weight, kg 491 491 503 0.36 25.27 Body condition score 2.5 2.7 2.5 0.20 0.02 MUN, mg/dL 23.3 22.4 29.7 0.47 2.58 b b a UUN, mg/dL 25.7 23.0 44.1 0.001 2.4 NF, mg/g DM 1.3a 1.5b 1.4ab 0.04 0.06 S14 = grounded maize ears with husks and commercial dairy concentrate (50:50); S16 = 43 % ground maize ears with husks: 50 % commercial dairy concentrate and 7 % soya bean meal; SC16 = 16 % commercial dairy concentrate. SEM = Standard error of the mean. MUN= milk urea nitrogen; UUN = urine urea nitrogen and, NF = nitrogen in feces.

95

Rev Mex Cienc Pecu 2021;12(1):87-104

There were no differences on milk urea nitrogen (MUN) due to supplements (P=0.47).

Urine urea nitrogen (UUN) mg/dL was higher (P<0.01) for SC16 (44.1) than S14 (25.7) and S16 (23.0) supplements (Table 3). Also, differences were detected for nitrogen in feces (NF) (P=0.04), where S16 and SC16 were similar, but S16 was different from S14.

There were significant effects of experimental periods on some variables. Dry matter intake decreased from 13.0 to 12.6 (3 %) from EP1 to EP3 (P=0.04). Milk protein decreased 6 % and lactose 7 %. The greatest reduction was on MUN concentration which decreased from 32.9 to 15.7 mg/dL, that is a 52 % reduction from EP1 to EP3. There was a trend (P=0.08) for fat to decrease as EP progressed (from 25.0 to 18.9). The rest of the performance variables and nitrogen excretions in urine and feces remained constant from the beginning to the end of the trial.

Table 4 shows the correlation coefficients between MY, milk protein, MUN, UUN and NF. A moderate but significant correlation was detected between MPr and MUN (r=0.49).

A negative correlation between MPr and NF (r=-0.58, P<0.01), and NF with MUN (r=0.48). The remaining correlations were low and not significant (P>0.05).

Table 4: Correlation coefficients between milk yield kg/day, milk protein g/kg, milk urea nitrogen (MUN) mg/dL, Nitrogen in feces (NF) mg/g and urine urea nitrogen (UUN) mg/dL Milk yield M. Protein MUN NF

M. Protein

MUN

NF

UUN

-0.32

-0.35 0.49*

0.09 -0.58** -0.48*

-0.12 0.36 0.37 -0.39

* P<0.05, ** P<0.01.

Calculations

Milk yield from grazing

Table 5 shows the calculations of milk allowed from forage according to contributions of ME and CP to cow requirements. Milk allowed from ME of forage was not greater than 1.0 kg/d, with a trend for higher MFe when cows received supplements S14 (0.9) and SC16 (1.0), than when on S16 (0.5 kg/d). Milk allowed from forage CP were on average 6.1 kg/cow/d, with no effect due to supplement (P=0.74). Allowable milk from forage ME was on average 0.8 kg/d. Average milk from forage (MFe + MFp / 2) was 3.3 kg/d indicating that 49 % of milk yields were due to forage contributions.

96

Rev Mex Cienc Pecu 2021;12(1):87-104

Table 5: Milk allowance from energy and protein from forage by cow grazing on agrosilvopastoral system, with three sources of supplements and two crude protein levels (14 vs 16 %) Treatment

S14

S16

SC16

P=

SEM

MF energy, kg/d 0.9 0.5 1.0 0.06 0.32 MF protein, kg/d 6.0 6.0 6.3 0.74 0.57 MF average, kg/d 3.1 3.3 3.6 0.13 0.39 MF energy = milk from forage on an energy basis; MF protein = milk from forage on protein basis; and MF average = average milk from forage.

Cost benefit analyses

Table 6 shows benefit over supplementation costs in US dollars ($) for the use of supplements to grazing dual purpose cows. The SC16 supplement had the highest cost 0.34 followed by S16 0.29, and the lowest was S14 0.28 $/kg, which was 3 and 18 % cheaper than S16 and SC16, respectively. Total MY differences among S14 and SC16 was only 3 %, having the same difference in total returns. The highest profit margin was obtained with S14 0.22 that was 19 % higher compared with the lowest obtained with SC16 of 0.18 $/kg.

Table 6: Supplementation costs and returns ($ USD) for milk production from three types of supplements Treatment

S14

S16

SC16

Supplement cost, $/kg 0.28 0.29 0.34 Total supplement cost 516 546 634 Milk yield/treatment, kg 2,523 2,514 2,596 Total returns 1,058 1,054 1,088 Gross margin 544 509 455 Cost / returns ratio 0.49 0.52 0.58 Milk production cost, $/kg 0.20 0.22 0.24 Milk selling price , $/kg 0.42 0.42 0.42 Profit margin, $/kg 0.22 0.20 0.18 S14 = grounded maize ears with husks and commercial dairy concentrate (50:50); S16 = 43 % cracked maize ears with husks: 50 % and commercial dairy concentrate: 7 % soya bean meal; SC16 = 16 % commercial dairy concentrate.

97

Rev Mex Cienc Pecu 2021;12(1):87-104

Discussion Supplementation in this study contributed to sustain dry matter and energy intake of cows avoiding milk yields and body weight losses, regardless of supplement type. Supplements have advantages and disadvantages to farmers. Supplements mixed in the farm (S14) using local resources like cracked maize ears, proved to be of higher nutritional quality, that was more digestible and with higher energy density than the other supplements, and at a lower cost. The disadvantages of this strategy according to farmers is that it requires more labor and time to make the mixture, but most importantly is the lack of technical advice or knowledge in order to balance rations according to cow requirements(4,6).

Commercial concentrate spares them from the extra labor, it however comes at a higher cost reducing profitability(20), and the quality of ingredients is not ideal judging by the lower IVDMD, high ADF and lower ME content. The lower ME density of supplements S16 and SC16 could be due to the higher CP content that reduced ME. A strategy to reduce the unbalance between CP and energy in supplements would be the use of high energy ingredients like molasses, starch or fat, when cows graze on low quality forage(21,22).

Average milk yields were lower than those reported from crossbreed cows of 13.5 kg/cow/d grazing Cynodon nlemfuensis swards, supplemented with 5.1 kg/cow/d of concentrate and also lower than 14.5 kg/cow/d from same type of cows grazing on an intensive silvopastoral system composed of Leucaena and C. nlemfuensis receiving 5.5 kg/cow/d of concentrate. These results were obtained from a study carried out with cows and sward under intensive management in a tropical region(23), whereas this study was carried out under extensive conditions on a commercial farm, where weaned calf production is also important. In order to achieve maximum weight gains calves remained with their mothers five hours during the day, suckling continuously which is a factor that reduces next day milk yields. Similar milk yields (7.0 kg/cow/d) and milk protein (32.3 g/kg) were reported from cows under extensive grazing on swards of native and introduced tropical grasses, receiving similar amounts of supplements as the present study(24).

Fat concentration was lower than normal values reported in the literature but are in line with a report that found low fat concentration (2 %) from dual purpose farms in the same region of this study and, under similar management conditions(25). One possible explanation of the low milk fat concentration is fiber quality, it is well known that tropical grasses are of low quality containing high NDF fractions and low digestibility(22). Low fat concentration in milk have an economic implication, since fat along with protein concentration in milk are the most important components considered for milk payments to farmers, in regions of the country where milk production is linked with the dairy industry; however, this is not the case in the region where this study was performed, and

98

Rev Mex Cienc Pecu 2021;12(1):87-104

milk price is establish regardless components. In this case, low fat concentration in milk is a temporary effect(25), due to forages diminished quality and low restricted availability because of the dry season.

The correlation between MUN and milk protein in our study indicate a linear relationship.

Both variables had a higher concentration at the beginning of the experiment and as it progressed values of both variables decreased. Milk protein and MUN were negatively correlated with nitrogen in feces, which indicates that as the first two decreased from EP1 to EP3, nitrogen in feces tended to increase.

These results evidence the importance of trees and forbs most of them legumes present in the agrosilvopastoral system(9) as CP sources for the lactating cows. Forages provided 62, 11 and 89 % of DMI, ME and CP, respectively for maintenance and production. These results show the evident importance of supplements sustain milk yields and bodyweight.

Average MUN was above benchmark values of 12 mg/dL(26), which indicates that cows consumed CP in excess of their requirements. Based on this, supplements should be of lower CP and higher in energy density using readily available energy sources (like molasses) and non-protein nitrogen (urea) in order to optimize microbial ammonia capture(27).

Crude protein reduction in supplements not only will allow reductions of milk production costs, since protein is the most expensive ingredient in cow diets(22), but also will increase forage CP utilization efficiency, reducing fecal and urinary nitrogen excretions to the environment(27). But, in order to determine the appropriate CP levels in supplements, MUN must be constantly monitored in order to make appropriate adjustments(28).

The reduction of MUN concentrations (52 %) in the last experimental period (advanced dry season), indicated that forage availability and nutritional value decreased, having a reduction on DMI of cows, but without effect on in cow performance. In a different study in the same farm(5), a 34 % reduction of CP and a 12 and 15 % increase of NDF and ADF respectively and a 14 % reduction of IVDMD of grasses from early to late dry season was documented.

Decreasing levels of MUN will decrease N excretions in urine. However, there is evidence that under silvopastoral systems emissions of N2O from UUN are lower than those from cattle grazing on monoculture pastures(29).

This agrees with a comprehensive literature review paper(30), which shows that fodder from woody legumes (that contain condensed tannins) enhance N recycling, reducing nitrogen volatilization and lowering the risk of N2O emissions and N losses.

Sustainability of dual-purpose farms in the study region was evaluated considering agroecological, socio-territorial and economic scales. In the first two scales sustainability scores were high (87 and 73 out of 100 points, respectively), but the economic scale had 99

Rev Mex Cienc Pecu 2021;12(1):87-104

the lowest scores (56 out of 100 points), becoming the limiting factor for the whole system. Dependency on external inputs such as commercial concentrates, and the low or nil added value to milk were the items that limited sustainability within the economic scale(20).

Therefore, the development of feeding strategies based on the efficient use of local resources like woody species as fodder banks during the dry season, as well as, supplements formulation using local resources such as maize and molasses, as readily available sources of energy in supplements, will increase the efficiency of use of low quality forage during the dry season at a lower cost.

Conclusions and implications Under the conditions of this study, it is possible to reduce milk production costs by using a 14 % or even lower CP supplement made with homegrown maize ears with husks, without affecting cow performance, bodyweight or body condition score. Cows on an agrosilvopastoral system obtained 50 % of their energy and crude protein requirements for maintenance and milk production from grazing. The high levels of milk urea nitrogen indicated that cows grazing on the agrosilvopastoral system consumed fodder rich in crude protein. In order to maximize the used of these forage resources, readily sources energy should be included to properly balanced energy and crude protein in the diets of the cows. Therefore, it is important to monitor MUN as a tool to determine CP levels in supplements, avoiding over feeding of crude protein in cow diets.

Acknowledgements

The authors would like to thank the participating farmer for his cooperation towards the project. Our gratitude also to Universidad Autónoma del Estado de México for funding the project (grant UAEM 2564/2007U); and SEP-PROMEP (grant 103.5/07/2781), our thanks as well to the Mexican National Council for Science and Technology (Consejo Nacional de Ciencia y Tecnología - CONACYT) for the postgraduate grant awarded to the first author. Finally, to the reviewer for its suggestion to improve the manuscript.

100

Rev Mex Cienc Pecu 2021;12(1):87-104

Literature cited: 1.

IndexMundi.

Agricultural

production,

supply

and

distribution.

www.indexmundi.com/agriculture/. Accessed July 15, 2019.

2.

Lactodata Información sobre el sector lechero.

Reporte 11 www.lactodata.info/produccion-de-leche-de-vaca. 2017. Consultado julio 2, 2018.

3. Albarrán-Portillo B, Rebollar-Rebollar S, García-Martínez A, Rojo-Rubio R, AvilésNova F, Arriaga-Jordán CM. Socioeconomic and productive characterization of dual purpose farms oriented to milk production in a subtropical region of Mexico. Trop Anim Health Prod 2015;47:519-523.

4. Absalón-Medina VA, Blake RW, Gene Fox D, Juárez-Lagunes EG, Nicholson FC, Canudas-Lara EG. Limitations and potentials of dual-purpose cow’s herds in central coastal Veracruz, Mexico. Trop Anim Health Prod 2011;44:1131-1142. https://doi.org/10.1007/s11250-011-0049-1.

5. Salas-Reyes IG, Arriaga-Jordán CM, Estrada-Flores JG, García-Martínez A, RojoRubio R, Vázquez-Armijo JF, et al. Productive and economic response to partial replacement of cracked maize ears with ground maize or molasses in supplements for dual-purpose cows. Rev Mex Cienc Pecu 2019;10(2):335-352. https://doi.org/10.22319/rmcp.v10i2.4569.

6. Deen AU, Tyagi N, Yadav RD, Kumar S, Tyagi AK, Kumar Singh, S. Feeding balanced rations can improve the productivity and economics of milk production in dairy cattle: a comprehensive field study. Trop Anim Health Prod 2019;51:737-744 https://doi.org/10.1007/s11250-018-1747-8.

7. Charbonneau E, Chouinard PY, Allard G, Lapierre H, Pellerin D. Milk from forage as affected by carbohydrates source and degradability with alfalfa silage-based diets. J Dairy Sci 2006;89:283-293.

8. Charbonneau E, Bregard A, Allard G, Lefebvre D, Pellerin D. Revisiting the prediction of milk from forage according to NRC 2001 [abstract]. Can J Anim Sci 2003; 83:647.

101

Rev Mex Cienc Pecu 2021;12(1):87-104

9. Albarrán-Portillo B, García-Martínez A, Ortiz-Rodea A, Rojo-Rubio R, VázquezArmijo JF, Arriaga-Jordán CM. Socioeconomic and productive characteristics of dual purpose farms based on agrosilvopastoral systems in subtropical highlands of central Mexico. Agroforest Syst 2018;93:1939-1947. doi: 10.1007/s10457-0180299-2.

10. Grazing terminology. Terminology for grazing lands grazing animals. Forage information system. Oregon State University. Accessed April 2nd 2020. https://forages.oregonstate.edu/fi/topics/pasturesandgrazing/grazingsystemdesign/g razingterminology.

11. Broderick GA, and Clayton MK. A statistical evaluation of animal and nutritional factors influencing concentrations of milk urea nitrogen. J Dairy Sci 1997;80:2964– 2971. doi:10.3168/jds.S0022-0302(97)76262-3.

12. Wildman EE, Jones GM, Wagner PE. A dairy cow body condition scoring system and its relationship to select production characteristics. J Dairy Sci 1982;265:495-501.

13. AOAC. Official Methods of Analysis. 15th ed. AOAC International, Arlington, VA, USA. 2000.

14. Mauricio MR, Mould FL, Dhanoa MS, Owen E, Channa K, Theodorou MK. A semiautomated in vitro gas production technique for ruminant feedstuff evaluation. Anim Feed Sci Technol 1999;79(4):321-330.

15. Baker RD. Estimating herbage intake from animal performance. In: Leaver JD editor.

Herbage Intake Handbook. Hurley: British Grassland Society. UK. 1982:77-93.

16. AFRC. Agricultural and Food Research Council. An advisory manual prepared by the AFRC Technical Committee on Responses to Nutrients. Wallingford: CAB International. 1993.

17. Harper JK, Cornelisse S, Kime LF, Hyde J. Budgeting for agricultural decision making. Pennsylvania State University. College of Agricultural Sciences. 2013. https://extension.psu.edu/budgeting-for-agricultural-decision-making.

Accessed November 19, 2018.

102

Rev Mex Cienc Pecu 2021;12(1):87-104

18. SAS. SAS/STAT User’s guide. (Version 9 ed.). Cary, NC, USA. 1989.

19. Kononoff PJ, Handford KJ. Technical Note: Estimating statistical power of mixed models used in dairy nutrition experiments. Faculty Papers and Publications in Animal Science.

Paper 725.

2006 http://digitalcommons.unl.edu/animalscifacpub/725.

20. Salas-Reyes IG, Arriaga-Jordán CM, Rebollar-Rebollar S, García-Martínez A, Albarrán-Portillo B. Assessment of the sustainability of dual-purpose farms by the IDEA method in the subtropical area of central Mexico. Trop Anim Health Prod 2015;47:1187-1194.

21. Gehman AM, Bertrand JA, Jenkins TC, Pinkerton BW. The effect of carbohydrate source on nitrogen capture in dairy cows on pasture. J Dairy Sci 2006;89(7):26592667.

22. Granzin BC, Dryden G McL. Monensin supplementation of lactating cows fed tropical grasses and cane molasses or grain. Anim Feed Sci Technol 2005;120:1-16.

23. Bottini-Luzardo MB, Aguilar-Pérez CF, Centurión-Castro FG, Solorio-Sánchez FJ, Ku-Vera JC. Milk yield and blood urea nitrogen in crossbred cows grazing Leucaena leucocephala in a silvopastoral system in the Mexican tropics. Trop GrasslandsForrajes Trop 2016; 4:159–167. doi:10.17138/TGFT(4)159-167.

24. Salvador-Loreto I, Arriaga-Jordán CM, Estrada-Flores JG, Vicente-Mainar F, GarcíaMartínez A, Albarrán-Portillo B. Molasses supplementation for dual-purpose cows during the dry season in subtropical Mexico. Trop Anim Health Prod 2016;48(3):643-648. doi:10.1007/s11250-016-1012-y.

25. Morales CH, Montes AH, Villegas De Gante AZ, Mandujano EA. El proceso sociotécnico de producción de Queso Añejo de Zacazonapan, Estado de México. Rev Mex Cienc Pecu 2011;2:161–176.

26. Kohn RA, Kalscheur KF, Russek-Cohen E. Evaluation of models to estimate urinary nitrogen and expected milk urea nitrogen. J Dairy Sci 2002;85:227-233.

27. Tamminga S. Nutrition management of dairy cows as a contribution of pollution control. J Dairy Sci 1992;75:345-357.

103

Rev Mex Cienc Pecu 2021;12(1):87-104

28. Jonker JS, Kohn RA, High J. Use of milk urea nitrogen to improve dairy cow diets. J Dairy Sci 2002;85:939-946.

29. Rivera JL, Chára J, Barahona R. CH4, CO2, and N2O emissions from grasslands and bovine excreta in two intensive tropical dairy production system. Agroforest Syst 2019;93:915-928. https://doi.org/10.1007/s10457-018-0187-9.

30. Vandermeulen S, Ramírez-Restrepo CA, Beckers Y, Claessens H, Bindelle,J. Agroforestry for ruminants: a review of trees and shrubs as fodder in silvopastoral temperate and tropical production systems. Anim Prod Sci 2018;58:767-777. https://doi.org/10.1071/AN16434.

104

https://doi.org/10.22319/rmcp.v12i1.5076 Article

Nutritional management of steers raised in graze and in feedlot: intake, digestibility, performance and economic viability Sinvaldo Oliveira de Souza*a Robério Rodrigues Silva a Fabiano Ferreira da Silva a Ana Paula Gomes da Silva a Marceliana da Conceição Santos a Rodrigo Paiva Barbosa a Raul Lima Xavier a Tarcísio Ribeiro Paixão a Gabriel Dallapicola da Costa a Adriane Batista Peruna a Mariana Santos Souza a Laize Vieira Santos a

a

Universidade Estadual do Sudoeste da Bahia. BR 415, KM 04, S/N, CEP 45700-000 Itapetinga, Bahia, Brasil.

*Corresponding author: sinvalsouza79@hotmail.com

Abstract: This study aimed to evaluate nutrient intake and digestibility, performance and economic viability of steers during the rearing phase in Brachiaria brizantha cultivar Marandu graze and in feedlot. Were used fifty crossbred steers in the rearing phase, with a mean weight of 275 ± 8.18 kg, distributed in a completely randomized design with ten replications per treatments: Mineral supplementation, nitrogen supplementation,

105

Rev Mex Cienc Pecu 2021;12(1):105-119

Concentrate supplementation in the order of 1 and 2 g/kg body weight and total feedlot.

The total dry matter intake and body weight showed a difference (P<0.05) for animals in feedlot. Crude protein, ether extract, neutral detergent fiber corrected for ashes and protein, non-fibrous carbohydrates, total digestible nutrients showed differences for the animals that received mineral supplementation in comparison to the other managements adopted. The same performance was observed for animals in feedlot. The digestibility coefficients of dry matter, crude protein, ether extract, non-fibrous carbohydrates and total digestible nutrients showed a difference (P<0.05) for the animals that received mineral supplementation, in comparison to the other managements adopted. (P<0.05).

The mean daily gain was lower (P<0.05) for animals receiving mineral supplementation.

The gross margin was higher (P<0.05) for animals handled in feedlot. Considering the obtained results, it was possible to observe that the animals kept in graze with good availability of dry matter presented satisfactory performance. It is feasible to confine the animals in rearing, since it shortens the production cycle, generating favorable economic results.

Key words: Cattle, Ingestion, Management, Nutrients.

Received: 26/09/2018 Accepted: 12/03/2020

Introduction In tropical regions, graze is the main nutritional resource for the production of beef cattle.

Tropical grasses are the basis of the cattle grazing system and provide low-cost energy substrates, mainly fibrous carbohydrates(1). However, when used exclusively, without supplements, they rarely meet the nutritional requirements of the animals for adequate productivity, presenting some nutritional restrictions, mainly in protein and energy, which vary throughout the year(1), resulting in unsatisfactory animal performance.

Dry matter intake is undoubtedly one of the most important factors for animal performance and maintenance, since it is the starting point responsible for the entry of nutritional sources, mainly energy and protein, necessary to meet the requirements of maintenance and animal production. Therefore, animal supplementation aims to result in additional gains that depend on the objective of the producer, which can only be achieved with the intake of forage and mineral supplementation, allowing the animal to increase nutrient intake and improve their digestibility.

Thus, a program of continuous meat production that aims to be efficient and competitive, should seek to eliminate the negative phases of the production process, providing the animal conditions for adequate development throughout the year, in order to reach the

106

Rev Mex Cienc Pecu 2021;12(1):105-119

conditions of early slaughter. An alternative for animals to be slaughtered younger is to keep the animals in graze during the rainy season, where there is high availability of forage with good nutritional value, aiming to reduce production costs and, during food restriction periods, an interesting strategy is to confine the animals. In addition to improving the final product, it accelerates capital turnover, reduces stocking in graze, increases the production scale of the property. The objective of this study was to evaluate the nutrient intake and digestibility, performance and economic viability of crossbred steers managed in Brachiaria brizantha cultivar Marandu graze and in feedlot during the rearing phase.

Material and methods Field work was conducted on the Princesa do Mateiro Farm, located in the municipality of Ribeirão do Largo, state of Bahia, Brazil, with coordinates of 15° 26′ 46″ S and 40° 44′ 24″ W. In an area of 14 ha, divided into 12 paddocks with approximately 1.17 ha each, formed of ‘Brachiaria brizantha cultivar Marandu. The experiment started in February/2017 and ended on June/2017.

Fifty (50) crossbred Holstein x Zebu male steers with average initial weight of 275 ± 8.18 kg and 12 mo of age were used. The animals were distributed in a completely randomized design with 10 replicates per treatment: Mineral supplementation ad libitum (MS); nitrogen supplementation ad libitum (NS); concentrate supplementation in the order of 0.1% body weight (SC 1); concentrate supplementation in the order of 0.2% body weight (SC 2); total feedlot (C 3). The proportion of each ingredient in diets is described in Table 1.

Table 1: Composition, in g.kg-1, of the supplements, based on natural matter Ingredient Corn grain 2 Engordim pellet Ground sorghum grain Soybean meal Urea 1 Mineral salt Total

Mineral salt Nitrogen salt 1000 1000

250 750 1000

1

Concentrate

Feedlot

560 200 150 90 1000

850 150 1000

Calcium 175 g; Phosphorus 60 g; Sodium 107; Sulfur 12 g; Magnesium 5000 mg; Cobalt 107 mg; Copper 1,300 mg; Iodine 70 mg; Manganese 1,000 mg; Selenium 18 mg; Zinc 4,000 mg; Iron 1,400 mg; Fluorine (maximum) 600 mg.

2 Vitamin A (min) 35,000 IU/kg, Vitamin D3 (min) 7,000 IU/kg, Vitamin E (min) 50 IU/kg, Copper (min) 50 mg/kg, Manganese (min) 200 mg kg, Cobalt (min) 0.6 mg/kg, Iodine (min) 3 mg/kg, Selenium (min) 1.2 mg/kg, Chromium 20-50 g/kg, Phosphorus (min) 8,000 mg/kg, Potassium (min) 20 g/kg, Sodium (min) 10 g/kg, Sulfur (min) 5,000 mg/kg, crude protein (min) 360 mg/kg, NNP 180 g/kg, Ethereal extract (max) 25 g/kg, Mineral matter (max) 350 g/kg, Crude fiber (max) 100 g/kg, Detergent fiber acid (max) 200 g kg, Monensin sodium 120 mg/kg, Virginiamycin 125 mg/kg.

107

Rev Mex Cienc Pecu 2021;12(1):105-119

Forage evaluation

The grazing method adopted was that of rotational stocking with 7 grazing days and 28 d of rest for each paddock. Graze was evaluated every 28 d. To reduce the influence of biomass variation between paddocks, the steers remained in each paddock for 7 d and, after that period, they were transferred to another, in a pre-established direction, at random. To estimate dry matter availability, the methodology described by McMeniman(2). Residual dry matter biomass (RDB) was estimated in the four pickets, according to the double sampling method(3). Before cutting, sample dry matter biomass was visually estimated, using the cut values, when 60 times the square were thrown and the forage biomass was then expressed in kg/ha(4)..

The triple pairing technique, methodology(5), was used to evaluate biomass accumulation over time, with the four pickets that remained fenced for 28 d, functioning as exclusion cages. The accumulation of DM in the experimental period was calculated by multiplying the value of the daily accumulation rate by the number of days in the period. The daily DM accumulation rate was estimated through the equation proposed by Campbell(6).

Digestibility assays Fecal excretion estimates for grazing animals were obtained with the use of chromium oxide in the amount of 10 g/animal/d, packed in paper cartridges, supplied by hand and orally, at 0600 for 12 d; the initial 7 d were for regulating the excretion flow of the indicator, and the final 5 d were for feces collection. Fecal production was estimated, based on the ratio between the amount of the supplied indicator and its concentration in the feces(7). The concentration of chromium oxide in the feces was estimated at the Animal Nutrition Laboratory of the DZO/UFV, by atomic absorption(8).

To determine the dry matter intake of the supplement (DM), the external marker titanium dioxide (TiO2) was used, and the amount of 15 g/animal/d was supplied, mixed with the supplement at 1000 h(9). Titanium concentration was estimated according to the methodology described by Detmann et al(10).

For feedlot animals, apparent digestibility and dry matter intake (TDM) were estimated from fecal production. Indigestible neutral detergent fiber (iNFD) was used to estimate animal fecal production. For the animals in feedlot, only the intake of individual dry matter (TDM) was estimated, from the daily fecal production and the knowledge of the content of the indigestible component iNFD in the total diet.

The forage and the collected material of each animal were placed in properly identified plastic bags and frozen at -10 °C for further analysis. They were then thawed, pre-dried separately per day of collection in a forced ventilation oven at 55 ºC for 72 h.

108

Rev Mex Cienc Pecu 2021;12(1):105-119

Subsequently, they were milled in a Willey mill with of 1 and 2 mm mesh sieves. The voluntary intake of dry matter from the forage (FDMI) was determine using the internal marker indigestible NDF (iNDF), obtained after 288 h of in situ incubation(10).

Chemical analysis

The samples of the supplement, forage and feces, after being pre-dried in a forced ventilation oven at 55 ºC for 72 h, milled in a Willey mill at 1 mm, were analyzed for the contents of dry matter (DM), mineral matter (MM), protein (CP), neutral detergent fiber corrected for ash and protein (NDFap), acid detergent fiber (ADF), according to AOAC(11). The ether extract (EE) content was analyzed using an Ankom® machine (XT15)(12).

The content of non-fibrous carbohydrates (NFCap) was obtained by the equation(13): NFCap = 100 – [(CP% − (CP%from urea + %urea) + %NDFap + %EE + %ash]; where CP, crude protein content in the concentrate supplement; CP% from urea, protein equivalent of urea; urea%, urea content in the concentrate supplement; EE, ether extract content; NDFap, neutral detergent fiber corrected for ash and protein. All terms are expressed as % of DM. Total digestible nutrients (TDN) were calculated(14): NDF and NFCap corrected for ash and protein, by the following equation: TND (%)= DCP + DNDFap + DNFCap + 2.25DEE where, DCP= digestible CP; DNFDap= nonfibrous carbohydrates. The chemical composition of the feedstuffs used in the experimental diets is described in Table 2.

Table 1: Dry-matter-based chemical composition of fodder and concentrate(g/kg)

Dry matter Mineral matter Crude protein Ether extract NDFap NFCap ADF TDN

Brachiaria brizantha

Concentrate

Feedlot

222 97.6 95 17.5 652 139 315.9 569.3

893 107 45 36.6 16 243.7 57.6 569.2

900 80 180 1.35 170 600 48.2 600

1

Simulated grazing, NDFap = Neutral detergent fiber corrected for ash and protein, NFCap = Non-fibrous carbohydrates, ADF = Acid detergent fiber, TDN = Total digestible nutrients.

109

Rev Mex Cienc Pecu 2021;12(1):105-119

Animal performance The animals were weighed at the beginning and at the end of the experiment, and intermediate weightings were performed every 28 d for adjustment mean daily gain (ADG) and of supplementation. Weighing was preceded by a 12-h fasting.

Supplementation was provided daily in uncovered plastic pads. The supplement was offered once a day, always at the same time (1000 h). The feedlot animals were weighed every 14 d without previous fasting. Supplementation was provided daily in a covered trough. The supplement was offered twice a day, in the morning and afternoon. Animal performance was determined by the difference between the initial live weight (IBW) and final live weight (FBW), divided by the experimental period in days. Feed conversion (FC) was determined according to intake and performance.

Economic evaluation The study of economic viability was determined considering that the producer already had the entire system of animal rearing implanted. It is necessary to take into account that the groups received mineral salt, nitrogenous salt, of 1 and 2 g/kg of body weight in supplement containing 60 % crude protein in their high-grain diet composition.

The formulas used to determine the costs of the system were: TC = Total cost = operating costs + opportunity + land Gross margin = revenue (sale value of the animal) – effective operating cost Net margin = (revenue) - total operating cost; Net profit = revenue – total cost Profitability = (net profit / total cost * 100) RMA = monthly income of the activity = (net revenue per animal / cost per animal × 100) / experimental period) × 30 d of the month.

Supplement prices/kg= were US$ 0.39 for mineral salt; 0.34 nitrogenous salt; 0.24 semifeedlot. 1 and 2 g/kg of body weight, US$ 0.28 for feedlot.

Data on intake, digestibility, performance and economic viability were submitted to analysis of variance, adopting 0.05 as a critical level of probability. The comparison between treatments was performed by the decomposition of the sum of squares, related to this source by means of orthogonal contrasts, except economic viability.

Results Forage characteristics

Grazing showed mean availability of 3,904.59 kg DM per hectare (Table 3).

110

Rev Mex Cienc Pecu 2021;12(1):105-119

Table 3: Availability of dry matter and morphological components of Brachiaria Brizantha cultivar Marandu Components

Mean

Total dry matter (DM) availability, kg/ha Potentially digestible (pd) dry matter, kg/ha Forage supply, DM kg (BW) Forage supply, DM pd kg (BW) Green dry matter

3,904.59 2319 12.80 8.00 3,232

The dry matter intake of forage was similar (P>0.05) among grazing animals, independent of the adopted management. Total dry matter intake (Total DM), as well as intake as a function of body weight (BW), did not show differences (P>0.05) for the animals that received mineral supplementation, in comparison to the other treatments (Table 4).

Table 4: Forage characteristics as a function of the management: mineral supplementation, concentrate protein/energy supplementation in Brachiaria brizantha cultivar Marandu grazed and in feedlot Contrasts Nutritional management

Forage DM Total DM DM (%BW) CP NDFap EE NFCap TDN

MS x TD

NS x (1;2)

SC1 x SC2

C3 x (1;2)

MS

NS

SC1

SC2

C3

CV %

6.31

6.42

6.19

5.94

-----

18.77 0.188 0.4770 0.6654 ------

6.31

6.42

6.45

6.59

9.1

13.71 0.539 0.1210 0.8485 <.001

2.04

2.07

2.02

2.12

2.43

9.7

0.207 0.3419 0.8482 <.001

0.65 4.15 0.10 0.92 3.67

0.69 4.18 0.10 0.98 3.93

0.74 4.08 0.11 1.02 3.97

0.95 3.98 0.12 1.05 4.06

1.82 1.54 0.18 5.06 6.91

18.61 12.6 17.6 24.25 17.88

<.001 <.001 0.001 <.001 0.014

0.3002 <.0001 0.2124 0.5623 0.4464

0.1290 0.3220 0.3220 0.7589 0.4103

<.001 <.001 <.001 <.001 <.001

SM x TD= Mineral salt versus other nutritional managements; SN x (SC1; SC2): nitrogenized salt vs concentrate supplementation; SC1 x SC2: concentrate supplementation at 1 g/kg BW vs concentrate supplementation at 2 g/kg BW; C3 x (1;2): feedlot vs concentrate supplementation.

Total dry matter intake Total DM (kg/d), dry matter intake based in body weight (Total DM %BW), crude protein (CP), ether extract (EE), neutral detergent fiber corrected for ash and protein (NDFap), nonfibrous carbohydrates (NFC), total digestible nutrient (TDN) for grazed animals.

CP, NDFap, EE, NFC and TDN showed a difference (P<0.05) for the animals that received mineral supplementation, in comparison to the other managements adopted.

There was a difference (P<0.05) in CP, NDFap, for grazed animals that received nitrogen

111

Rev Mex Cienc Pecu 2021;12(1):105-119

supplementation, when compared to grazed animals that received concentrate protein / energy supplementation in the order of 1 and 2 g/kg of body weight. Total DM, BW, as well as CP, NDFcp, EE, NFC and TDN, showed a difference (P<0.05) for feedlot animals, when compared to grazing animals receiving Concentrate protein/energy supplementation in the order of 1 and 2 g/kg of body weight. DM, EE, NDFap, NFCap and TDN showed a difference (P<0.05), for grazed animals supplemented with mineral mixture, in comparison to the other management adopted (Table 5).

Table 5: Apparent dry matter digestibility (DM), crude protein (CP), neutral detergent fiber corrected for ash and protein (NDFap), ether extract (EE), non-fibrous carbohydrates (NFC) and total digestible nutrient (TDN), in (%) dry matter Contrasts Nutritional management

DM CP NDFap EE NFC TDN

MS

NS

SC1

57.07 44.70 61.60 66.40 66.91 56.86

57.20 51.60 64.40 64.10 65.96 57.71

58.80 52.50 61.40 67.80 70.41 56.30

SC2

C3

CV % 61.60 76.1 3.27 66.50 80.0 13.16 63.70 76.3 4.44 68.80 82.2 8.96 71.47 81.80 9.55 58.86 68.02 3.77

SM x TD

SN x (1;2)

SC1 x SC2

C3 x (1;2)

<.001 0.375 <.001 <.001 <.001 <.001

<.0001 <.0001 0.0393 0.0282 0.0174 0.8548

0.0020 0.0008 0.0286 0.6334 0.6881 0.0019

<.001 <.001 <.001 <.001 <.001 <.001

Descriptive probability levels for type I error associated with orthogonal tests for the comparisons between the adopted managements. SM x TD: Mineral salt vs other nutritional managements; SN x (1;2): Nitrogenized salt versus Concentrate supplementation; SC1 x SC2: Concentrate supplementation at 1 g/kg BW vs Concentrate supplementation at 2 g/kg BW; C3 x (1;2): Feedlot vs Concentrate supplementation

There were differences (P<0.05) for DM, CP, EE, NDFap and NFC between grazed animals supplemented with nitrogenized salt, compared to animals supplemented with concentrate in the order of 1 and 2 g/kg of body weight. The same performance was observed for DM, CP, NDFap, TDN, for grazing animals supplemented with the concentrate in the order of 1 and 2 g/kg of body weight, when compared to each other (Table 6).

The coefficients of DM, CP, NDFap, EE, NFC and TDN showed a presented difference (P<0.05) for confined animals when compared to grazing animals receiving Concentrate protein / energy supplementation in the order of 1 and 2 g/kg of body weight.

112

Rev Mex Cienc Pecu 2021;12(1):105-119

Table 6: Initial body weight (IBW, kg), final body weight (FBW), mean daily gain (ADG), feed conversion (FC) of steers in several rearing systems Contrasts Nutritional management

IBW FBW ADG FC

SM

SN

SC1

SC2

C3

CV %

275 344 0.50 13.90

274 346 0.52 12.47

275 361 0.62 12.36

274 348 0.53 10.48

288 370 1.52 5.28

17.59 14.88 24.11 33.09

SM x TD

SN x (1;2)

SC1 x SC2

C3 x (1;2)

0.849 0.375 <.001 0.130

0.4587 0.5247 0.4796 0.9070

0.9455 0.3565 0.2780 0.0399

0.963 0.679 <.001 <.001

SM x TD: Mineral salt vs other nutritional managements; SN x (SC1; SC2): Nitrogenized salt vs Concentrate supplementation; SC1 x SC2: Concentrate supplementation at 1 g/kg BW vs Concentrate supplementation at 2 g/kg WB; C3 x (SC1; SC2): Feedlot vs Concentrate supplementation

For animal performance, there was no difference (P>0.05) for initial body weight (IBW) and final body weight (FBW), regardless of the ADG for grazed animals supplemented with mineral mixture, in comparison to the other management practices adopted. The ADG was similar (P>0.05) between grazed animals supplemented with nitrogen salt, compared to animals supplemented with concentrate in the order of 1 and 2 g/kg of body weight. FC was similar (P>0.05) among the animals that received mineral supplementation, in comparison to the other treatments. The same results were observed for grazing animals that received nitrogen supplementation, when compared to animals receiving protein/energy concentrate supplementation in the order of 1 and 2 g/kg of body weight (Table 7).

Table 7: Economic evaluation of the production systems of crossbred steers supplemented in Brachiaria brizantha grazing and in feedlot (US$) Variables Total cost Gross margin Net margin Net profit Profitability MIA

SM 411.16a 46.50b 46.50b 11.65b 0.77b 0.46b

SN

SC1

SC2

410.45a 49.82b 49.82b 15.06b 0.48b 0.37b

412.91a 66.48ab 66.48ab 31.52b 2.11a 0.25b

411.67a 56.15b 56.15b 15.81b 1.15b 0.46b

C3 402.47a 86.77a 86.77a 52.03a 3.42a 2.56a

Mean CV(%) 409.83 61.14 61.01 25.21 1.50 0.48

16.00 31.63 14.49 17.38 25.17 13.20

Mineral supplementation (SM); Nitrogen supplementation (SN): Concentrate supplementation in the order of 1 g/kg of body weight (SC1); Concentrate supplementation in the order of 2 g/kg of body weight (SC2); = Feedlot, C3. MIA = monthly income of the activity. ab Means followed by the same letter in the row do not differ (P>0.05).

The total cost in the experimental period was similar (P>0.05), regardless of the adopted management. Gross and net margins were similar (P>0.05) for grazing systems, being different (P<0.05) only for the feedlot system. The monthly income was higher (P<0.05)

113

Rev Mex Cienc Pecu 2021;12(1):105-119

for animals in feedlot, compared to animals supplemented in grazing that received mineral mixture, nitrogenous salt and concentrate in the order of 2 g/kg (BW). The same behavior was observed for the monthly rate.

Discussion The supply and the quality of the forage are determining factors for animal development and performance. The availability of potentially digestible dry matter found in this study was 2,000 kg ha-1. The higher the content of potentially digestible dry matter, the better the biological performance and, consequently, the economic performance will be favored, since the cheapest basic nutritional resource available for livestock is grazing and, the better it is used, the greater the financial return(15). When carrying out an extensive literature review(16) recommend a minimum supply of potentially digestible dry matter of 6 % or (6 kg of MSpd per 100 kg of body weight). In this study, 8 kg was found, an MSpd value higher than those recommended by these authors.

The average forage supply observed in this study was 12.8 %. This is in agreement with that recommended by others(16); they also recommend forage supply of 10 to 12 % for tropical grasses, evidencing that the value found is above the minimum recommended by the authors to assure forage availability with quality and quantity to the animals. The similarity for forage dry matter intake can be attributed to its expressive quality, which demonstrated crude protein levels of 9.5% MS of the forage, within the minimum limits of 7 to 11 % of DM in the diet.

The similarity in the total dry matter intake and in relation to the body weight for grazing animals was possibly due to the dry matter availability of good quality forage being the same for grazing animals and for being groups of homogeneous animals with the same age group. The similarity of these variables shows that grazed animals did not find quantitative and qualitative limitations during the experimental period regarding forage availability and possibly reached the maximum physical limit of intake.

According to Lazzarini et al(17) the response to nitrogen supplementation in forage intake becomes less evident when the CP content of the basal diet is greater than 7 to 8 % in MS, as observed in this study: a crude protein of 9.5 %. This high protein content of the forage possibly contributed to the fact that there was no difference in dry matter intake among grazed animals.

Total dry matter intake and body weight gain were higher for animals in feedlot. This result can be justified by the fact that the animals were supplied with 100 % concentrate ad libitum; consequently, they had a greater weight gain due to the higher dry matter intake. Dry matter intake is undoubtedly one of the fundamental factors that influences animal performance, and it is the starting point for nutrient input, mainly protein and energy, necessary to meet the requirement of animal maintenance and production. This

114

Rev Mex Cienc Pecu 2021;12(1):105-119

difference in intake may have occurred due to the higher dry matter intake of the group of confined animals, contributing to the increase in their body weight.

The values found for mean CP intake among rearing systems allowed to infer that the CP requirement of the animals in the BRCorte described by Valadares et al(18) was satisfied by the diet available to the animals. The ingestion of protein by animals is of fundamental importance, since this nutrient is part of the synthesis of all body tissues, besides participating in the growth and microbial synthesis in the ruminal environment, a microbiota that has the function of degrading the compounds of the diet to release nutrients for absorption, in addition to producing microbial protein available for absorption in the small intestine.

The difference in crude protein intake for grazed animals receiving a mineral mixture may be justified by the higher non-protein nitrogen intake via supplementation provided to the other groups of animals. The similarity in the crude protein intake for grazing animals supplemented with nitrogen salt and protein / energy concentrate supplement evidences that this result may be associated to the dry matter intake, since it was similar, contributing to the fact that there was no difference in the intake of this nutrient. Crude protein intake was higher for animals in feedlot, compared to those supplemented with protein / energy concentrate. The crude protein content of the diet met the requirements of the animals and consequently contributed to a better performance, when compared to the other rearing systems.

It is presumed that part of the difference found for the intake of NDFap is due to the composition of the diet, in which its content was lower, respectively, in the diet of confined animals. These results demonstrate that the animals fed with one hundred percent of concentrate ingested fiber in less quantity, in relation to grazed animals.

The difference in the intake of EE, NFC, TDN, for grazed animals supplemented with mineral salt can be justified by the additional contribution of these nutrients from the supplementation, when compared to animals supplemented with concentrate. When the concentrate is offered to animals, it increases the concentration of the non-fibrous constituents in the diets, increasing the availability and nutrients in the gastrointestinal tract of the animals. Carbohydrates are a source of energy for ruminants, when converted to volatile fatty acids (acetic, butyric and propionic), are directed towards the deposition of muscle tissue.

The absence of differences in intake of EE, as well as NFC, TDN for animals supplemented with nitrogenous salt, compared to those supplemented with protein / energy concentrate, can be justified by the low level of concentrate supplementation (1 and 2 g/kg BW), not enough to influence the ingestion of these nutrients.

The intake of EE, NDFap and NFC, TDN, were higher for animals in feedlot. These results can be attributed to the fact that these animals receive a diet containing 100 % 115

Rev Mex Cienc Pecu 2021;12(1):105-119

concentrate non-fibrous carbohydrate, contributing to an increase in the intake of these fractions due to the higher concentration of these nutrients in the diet, mainly due to the higher intake of NFC and other more digestible nutrients. Thus, the increase in the intake of these dietary components is unique and exclusively due to its greater contribution, provided by the diet. The reduction in fiber intake in neutral detergent corrected for ash and protein (FDNcp), was due to the lower participation in the diet. The dry matter intake is directly associated with performance, since it contributes to the determination of the amount of nutrients ingested, being sufficient to meet the energy and nutritional requirements of the animals and, consequently, the greater efficiency in animal production.

The difference in DM, EE, NDFap and NFC were different compared for grazed animals supplemented with mineral mixture, in relation to the other managements adopted. These results may be associated to the benefits generated in the digestibility of the fibrous fraction of the diet, when the concentrate supplement is added to the ruminant diet.

Thus, the digestibility of a given diet is a result of the interactive and associative effects of all the nutrients in the diet and not only of the isolated effect of a particular constituent of the food. Even with 100 % concentrate offered to the confined animals, digestibility was not impaired, probably due to the balance between the rumen degradable dietary protein and the energy content of the diet, since this association helps maintain fiber digestion, even in situations where starch-rich supplements are supplied to animals.

The difference in the DM, CP, NDFap, EE, and NFC for animals receiving nitrogen supplementation in grazing compared to grazed animals that received concentrate supplementation in the order of (1 and 2 g/kg) of body weight. The same behavior was observed in DM, CP, NDFap, for grazed animals supplemented with protein / energy concentrate, when compared to each other. This result demonstrates the benefits that the addition of the concentrate in the ruminant diet provides for the grazing animal production system. This difference in crude protein digestibility and in the other nutrients may be associated to the higher nitrogen supplementation in the ruminal environment, making it more favorable to the growth and development of the microorganisms present in the rumen, favoring the growth of the microbial population by balancing protein and energy in the diet.

There was a similarity in the total nutrient digestibility coefficient (TDN) for animals receiving nitrogen supplementation in grazing, compared to grazed animals receiving protein/energy concentrate supplementation in the order of 1 and 2 g/kg of body weight.

The same performance for EE and NFC was observed for grazed animals that received protein/energy concentrate supplementation in the order of (1 and 2 g/kg) body weight, when compared. Possibly due to the nutritional requirements of the microbial population, it is possible that there was no limitation of these nutrients, leaving the ruminal environment under favorable conditions for microbial growth.

116

Rev Mex Cienc Pecu 2021;12(1):105-119

The best DM of CP, neutral detergent fiber corrected for ashes and NDFap, EE, and NFC for animals in feedlot in comparison to other management practices can be justified by the greater participation of these dietary nutrients in the diet. Since the association of structural and non-structural carbohydrates in the diet allows improvements in nutrient digestibility as a function of the synchrony of energy and protein availability, providing substrates to the microorganisms, resulting in improvements in the absorption efficiency of the ingested nutrients. It is worth mentioning that, when consuming diets with a lower proportion of fiber due to the increase in concentrate, ruminants can show a faster rate of passage and when the intake of diets containing high proportion of fiber occurs, the rate of passage occurs more slowly, therefore allowing greater nutrient digestibility. The difference in the digestibility coefficient of NDFap, EE, and NFC for the feedlot. system, in comparison to other rearing systems, probably occurred due to the greater contribution of nutrients from the concentrate supplement, improving the ruminal environment and increasing the digestibility of the fibrous fraction of the digestion.

The difference in the mean daily gain for grazing animals supplemented with mineral mixture, in comparison to the other managements adopted and for the animals in feedlot. when compared to grazing animals that received concentrate protein/energetic supplementation, may be associated with a higher intake of non-fibrous carbohydrate, contributing to a greater contribution of nutrients, leading to an improvement in animal performance. Non-fibrous carbohydrates are fast-degradation compounds consisting of starch, pectin and glucans of easy fermentation, providing a greater contribution of energy to the growth of the ruminal microorganisms, favoring nutrient digestion. The mean daily gain is an important index in beef cattle, and the profitability of the system depends on this gain.

The productive performance of grazed animals is directly related to the quality and quantity of forage available for grazing. These characteristics influence the intake of nutrients and nutritional attributes by grazing animals, and ingestion is the main determinant of animal performance.

The similarity in mean daily gain among grazed animals supplemented with nitrogen salt compared to animals supplemented with concentrate on the order of 1 and 2 g/kg of body weight is observed, since there was no difference in total dry matter intake, it contributes to the fact that there was no difference in animal performance. The mean daily gain, respectively, was a numerator to obtain an important variable of feed conversion (FC), in which it was not observed a difference in feed conversion between grazing managements.

The similarity in the performance of the animals between grazing production systems demonstrates that, when there is a great quantity of forage and quality cattle raised in grazing can meet their requirements and achieve satisfactory gains in the period of high food availability, making the system economically viable.

117

Rev Mex Cienc Pecu 2021;12(1):105-119

Animals in feedlot perform better in comparison to those kept in grazing, since they spend less energy in search of food(19), since the food is supplied directly in the trough and in a superior quality to that of grazing.

Rearing was economically viable for grazing and feedlot systems, a fact evidenced by the positive net income, characterized for the profit, since the gross income was able to cover the total cost of the rearing system.

The animals in feedlot obtained the highest gross margin in the activity, net margin and net profit observed, justified by its best performance. Therefore, grazed animals receiving concentrate supplementation in the order of 1 g/kg and in feedlot, allowed a greater return on invested capital (US$ invest / US$ ret) in the activity. The monthly rate of return was higher for animals in feedlot, which optimized animal performance. It is interesting to always seek a balance between productivity, which in this case is expressed by economic viability and performance.

Conclusions and implications Considering the obtained results, it was possible to observe that the animals kept in graze with good availability of dry matter showed satisfactory performance. It is feasible to confine the animals in rearing, since it shortens the production cycle, generating favorable economic results.

Literature cited: 1. Paulino M, Detmann E, Valadares FS. Bovinocultura funcional nos trópicos. In: VI Simpósio de Produção de Gado de Corte e II Simpósio Internacional de Produção de Gado de Corte, Viçosa. Anais. Viçosa: UFV 2008;(06):275-305.

2. McMeniman N. Methods of estimating intake of grazing animals. In: Reunião Anual da Sociedade Brasileira de Zootecnia, Simpósio Sobre Tópicos Especiais em Zootecnia, Juiz de Fora. Anais. Juiz de Fora: Sociedade Brasileira de Zootecnia, 1997;34(07):131-168.

3. Wilm H, Costello D, Klipple G. Estimating forage yield by the double sampling method. J Am Soc Agronomy 1994;36(03):194-203.

4. Gardner A. Técnicas de pesquisa em pastagem e aplicabilidade de resultados em sistema de produção. Brasília: II CA/EMBRAPA CNPGL. 1986;(05):197.

5. Moraes A, Moojen E, Maraschin G. Comparação de métodos de estimativa de taxas de crescimento em uma pastagem submetida a diferentes pressões de pastejo. In: Reunião Anual da Sociedade Brasileira de Zootecnia, 1990, Campinas. Anais.

Campinas, 1990;2(05):332.

118

Rev Mex Cienc Pecu 2021;12(1):105-119

6. Campbell A. Grazed pastures parameters. I. Pasture dry-matter production and availability in a stocking rate and grazing management experiment with dairy cows.

J Agr Sci 1966;67(08):211-216.

7. Smith A, Reid J. Use of chromic oxide as an indicator of fecal output for the purpose of determining the intake of pasture herbage by grazing cows. J Dairy Sci 1955;38(05):515- 524.

8. Willians C, David D, Iismaa O. The determination of cromic oxide in faeces samples by atomic absorption spectrophotometry. J Agr Sci 1962;59(11):381-385.

9. Valadares FS, Moraes E, Detmann E. Perspectivas do uso de indicadores para estimar o consumo individual de bovinos alimentados em grupo. In: Gonzaga Neto S, Costa R, Pimenta FE, Castro J. (Org.). Anais do Simpósio da 43ª Reunião Anual da Sociedade Brasileira de Zootecnia. João Pessoa: Anais. SBZ: UFPB, 2006; 35(07):291 -322.

10. Detmann E, Souza M, Valadares FS, Queiroz A, Berchielli T, Saliba E, et al. Métodos para análise de alimentos. 2012. ISBN: 9788581790206.

11. AOAC. Official Methods of Analysis of AOAC International 16th ed. Association of Official Analytical Chemists, Arlington. 1995.

12. AOacs. American Oil Chemists’ Society. Official Method Am 5–04, Rapid determination of oil/fat utilizing high temperature solvent extraction. Urbana: Official Methods and Recommended Practices of the Am Oil Chemists’ Soc. 2005.

13. Hall M, Challenges with non-fiber carbohydrate methods. J Anim Sci 2003;8(12):3226–3232.

14. NRC. National Research Council. Nutrient requirements of dairy cattle. 7th ed.

Washington, DC: National Academic Press; 2001.

15. Detmann E, Paulino M, Valadares FS. Otimização do uso de recursos forrageiros basais. In: Simpósio de produção de gado de corte. Viçosa. Anais. Viçosa: Sim corte, 2010;7(07):191– 240.

16. Silva FF, SÁ, JF, Schio A, Sá J, Silva R, Itavo L, Mateus R. Suplementação a pasto: disponibilidade e qualidade x níveis de suplementação x desempenho. Rev Bras Zootec 2009;38(07):371-389.

17. Lazzarini I, Detmann E, Sampaio C, Paulino M, Valadares FS, Souza M, Oliveira F. Intake and digestibility in cattle fed low-quality tropical forage and supplemented with nitrogenous compounds. Rev Bras Zootec 2009;38:(06):2021-2030.

18. Valadares FS, Marcondes M, Chizzotti M, Paulino P. Exigências nutricionais de zebuínos puros e cruzados BR-Corte. 2.ed. Viçosa: UFV, DZO. 2010;2(02):193.

19. Souza S, Ítavo L, Rimoli J, Ítavo C, Dias A. Comportamento ingestivo diurno de bovinos em confinamento e em pastagens. Archiv Zootec 2007;5(03):67-77.

119

https://doi.org/10.22319/rmcp.v12i1.5445 Article

Production and evaluation of probiotic milk inocula obtained from the digestive tract of piglets (Sus scrofa domesticus) proposed for pig feed

Carmen Rojas Mogollón a Gloria Ochoa Mogollón b Rubén Alfaro Aguilera c Javier Querevalú Ortiz d Héctor Sánchez Suárez e*

a

Universidad Nacional de Tumbes. Facultad de Agronomía, Escuela de Agroindustria.

Perú. b

Universidad Nacional de Tumbes. Facultad de Ciencias de la Salud. Laboratorio de Biología Molecular. Perú. c

Facultad de Ciencias de la Salud. Laboratorio de Biotecnología. Biodes- Jefatura de práctica. Perú. d

Universidad Nacional de Tumbes. Facultad de Agronomía. Escuela de Agroindustria.

Laboratorio de procesamiento de alimentos. Perú. e

Universidad Nacional de Tumbes. Facultad Ciencias Agrarias. Escuela de Medicina Veterinaria y Zootecnia. Perú.

*

Corresponding author: hsanchezs@untumbes.edu.pe

Abstract: In order to evaluate a probiotic milk inoculum (MI), from lactic acid bacteria (LAB) native to the piglet for use as feed (yogurt) in piglets, samples were taken from the final part of the digestive tract (excreta) of ten piglets raised in the backyard and sown in selective medium (MRS agar with aniline blue). To verify its purity, biochemically characterized and probiotic capacity, tests were performed (low pH tolerance, high bile salts, and NaCl, oxidase, catalase, gas production, and antagonism tests), molecular

120

Rev Mex Cienc Pecu 2021;12(1):120-137

identification by standard method CTAB-DTAB. For the elaboration of MI (yogurt), with selected, reactivated and homogenized probiotic strains (OD from 1 to 600 nm), each LAB was activated in pasteurized milk (1 ml/100 ml) obtaining mixture one and two with the strains 1, 5, 2 and 1, 5, 6 respectively. They were evaluated every 5 days for 15 days in refrigeration. The following bacteria were molecularly identified: 01 Lactobacillus reuteri, 04 Enterococcus faecium (LAB), and Escherichia fergusonii, Shigella flexneri (pathogenic). The LAB were selected by tolerance as probiotics: 2.3x104 CFU/ml in pH 3.5, 7.00x103 CFU/ml in 5% bile salt, and 2.80x104 CFU/ml in 13% NaCl. In viability of the milk inoculum (yogurt) was obtained according to the Peruvian technical norm NTP 202.092:2014 and to the norm INEN 710: 1996, stored in refrigeration for 15 days; mixture one turned out to be better, and mixture two, acceptable, with counts of 106 CFU/ml and 107 CFU/ml of probiotic cells. Therefore, they are both suitable as probiotic milk inocula to be provided orally to piglets.

Key words: Piglets, LAB, Probiotics, Lactic Inoculum, Safe food, Antagonism.

Received: 11/07/2019 Accepted: 21/11//2019

Introduction Pigs are born without bacterial flora in their digestive tract; they become infected as maternal antibodies disappear, installing a pattern of microorganisms and production of digestive enzymes that adapt to each stage of digestion, thus avoiding microbiological imbalance. The intestinal bacterial flora native to the piglet is changing(1,2), colonizes, is replaced or lost according to age, type of feed and changes in the environment. When the microbiological balance is broken, the diarrhea syndrome related to weaning is generated(3-6).

Lactic acid bacteria (LAB), are part of the normal intestinal microbiota of many animals and act as probiotics. They share common morphological, physiological and metabolic characteristics; they are cocci or Gram-positive, non-sporulated, immobile, anaerobic, microaerophilic or aerotolerant bacilli and they are oxidase and catalase negative.

Likewise, as the main product of carbohydrate fermentation, they generate lactic acid(2,7); they grow at different temperatures and high salt concentration; they tolerate acid or alkaline pH, and they are the main microorganisms used as probiotics(3,8,9).

Probiotics are live microorganisms that, when supplied in the diet, benefit the development of microbial flora in the intestine, stimulate the protective functions of the

121

Rev Mex Cienc Pecu 2021;12(1):120-137

digestive system, and are biotherapeutic, bioprotective or bioprophylactic(7,8,10), capable of producing antimicrobial compounds. Their reproduction time is short; they have the ability to cross the gastric barrier (secretions from the stomach and duodenum), and they must be stable during the manufacturing and marketing process, so that they can reach the intestine alive. They also act by preventing the adhesion of pathogenic bacteria in the receptors of the intestinal epithelium(10), neutralizing toxic metabolites(7,9,11) and they adapt to a particular region of the intestine according to the age of the piglet(3,12,13).

In pig nutrition, probiotics help establish beneficial microbiota and inhibit the enteropathogens Escherichia coli and Salmonella typhimurium(3). Also, Lactobacillum plantarum has probiotic potential in piglets(14), and Rhodopseudomonas spp, Lactobacillus spp and Saccharomyces spp inhibit the growth of Salmonella tiphymurium, L. acidophilus SS80 and Streptococcus thermophilus(15,16,17). In addition, probiotics are also present in saliva, and it is recommended that they be used in the same host species from which they were isolated (9,10).

These probiotics can be supplied as MI (yogurt), which is a product without excessive acidification, where the LAB are viable to incubation and storage; there are time tolerant strains such as L. acidophilus and others that deteriorate rapidly in refrigeration when Lactobacillus bulgaricus is used(18,19,20). Most of the microorganisms used to manufacture yogurt are commercial. Cow's and goat's milk are used to prepare yogurt, which has good syneresis, viability of LAB and probiotic characteristics(17,18,20); its consumption improves food efficiency and avoids contracting gastrointestinal diseases(5,19,20), being of little use for animal nutrition.

In this context, it was proposed to produce a dairy inoculum with native LAB isolated from the pig's digestive tract, phenotypically and genotypically characterized, innocuous and with probiotic properties for the feeding of piglets.

Material and methods Population and sample

Ten lactating backyard piglets aged 35 days fed with antibiotic-free diets, coming from the El Limón farm, located in the Pampas district of Hospital, department of Tumbes (3°43'35" S, 80°26'38" W), were used. The sample included lactic acid bacteria isolated from the final part of the digestive tract (excrements).

122

Rev Mex Cienc Pecu 2021;12(1):120-137

Sample collection

From each piglet, excrements were collected with sterile swabs (scraping) and placed individually in sterile and airtight plastic tubes, to be transported in a cold chain(19) to the Molecular Biology Laboratory located at the Faculty of Health Sciences of the National University of Tumbes.

Microbiological analysis

Each sample was immersed in a sterile physiological saline solution at 0.85% (diluent); the dilutions were homogenized for 5 to 10 seconds, and 1 ml was transferred for the following tubes with 9 ml of MRS Broth, 10-1 to 10-5 dilutions for bacterial colony counting. The seeding was carried out by the surface method, taking 25 µl of the decimal dilutions in plates with selective agar for LAB (MRS agar + Aniline Blue 0. 13%); selecting the colonies stained with blue (from the surface of the agar), purified in MRS agar by the striae method, and verifying the population of LAB. The macroscopic characterization was carried out according to size, shape, color, density, consistency, and Gram staining for identification(21,22). The LAB were preserved in tubes with MRS agar tilted at an angle of 20º, sown by the striae method, kept at 4 ºC, and cryopreserved in TSB medium with 30% glycerol at -20 ºC, after refrigeration(21,22).

For the pathogenic samples, the sowing was done by the exhaustion method, in specific media such as SS agar (salmonella, shiguella) and EMB agar (methylene blue eosin)(22).

The strains of the samples, obtained from the fluid excretions of piglets, were isolated, purified, identified and preserved.

Biochemical analysis and tolerance tests

The isolated and purified LAB strains were tested for selection as probiotics: oxidase test, using paper strips impregnated with the reagent para-amino-N-dimethylaniline, which in the presence of the cytochrome enzyme C-oxidase changes its color, considered as positive or negative. Catalase test: the capacity was observed to split H2O2 at 30%, in water and oxygen; it was verified with the intense bubbling that can be determined as positive or negative (attributed to the catalase enzyme)(16,23). Gas (CO2) was generated by the metabolic fermentative process. For the tolerance tests, the selected LAB strains were used, and cultivated in MRS Broth at 37 °C for 24 h; their growth was measured by optical density (OD=1) at 600 nm in a UV spectrophotometer, and one ml of LAB was used for each test. Viability was evaluated by counting bacteria on MRS agar before and after

123

Rev Mex Cienc Pecu 2021;12(1):120-137

incubation(15,16,23). Tolerance to low pH: in 15 ml falcon tubes: 10 ml of MRS broth adjusted to pH 2.5, 3.5, 4.5 with HCl were added. Tolerance to bile salts: in 15 ml capacity falcon tubes, 10 ml of MRS broth enriched with 1 g (1% w/v), 5 g (5% w/v) and 10 g (10% w/v) of Ox-Bilis(15,16,23) were added. Tolerance to NaCl concentrations, in 15 ml falcon tubes, 10 ml of MRS Broth enriched with 5 g (5% w/v), 9 g (9% w/v) and 13 g (13% w/v) of NaCl were added(15,16,23).

Inhibitory activity against pathogenic microorganisms of the piglets

It consists in the confrontation of each of the selected LAB strains against each pathogenic strain of the piglets (E. fergusonii and S. flexneri). Cells and supernatants were used according to the proposed method; the observation of the halo was considered as a positive inhibitory activity(2,15,16). LAB and pathogenic bacteria (homogenized DO=1, at 600 nm) were preserved in tubes with PCA agar slants, activated at 37 °C during 24 h for their use.

Direct or contact method. The LAB strain was sown in Petri dishes, on MRS agar, using the swab technique; at the same time, 25 µl of the pathogenic strain were sown in Mueller Hinton agar, by surface technique. Circular bits with a diameter of 6 mm were extracted from the plate with LAB and placed on the plate with the pathogen(15,16).

Non-neutralizing dish method. The LAB strain was sown in MRS broth at 37 °C during 24 h, the pH was determined, and 1 ml of the broth was added in 1.5 microtubes for centrifugation at 16,800 xg during 10 min, in order to obtain the supernatant to perform the antagonism tests. Sowing in parallel 25 µl of the pathogenic strain in Mueller Hinton agar by the surface method, on which cylindrical perforations of a 6 mm diameter were made, where 35 to 40 µl of the LAB supernatant were added(15,16).

Neutralizing dish method. The procedure was the same as for the non-neutralizing dish method; the supernatant changed, having been neutralized by adjusting it to pH 7 with a 1N NaOH solution(15,16).

Molecular analysis

LAB bacteria from healthy piglets and pathogenic bacteria from piglets with diarrhea were molecularly identified, adapting the DNA extraction by Gustincich’s standard CTAB-DTAB method for bacterial cells(15,24). For PCR (Polymerase Chain Reaction), the amplification of the 16S rRNA gene, the universal primers 8F (5' AGA GTT TGA TCC TGG CTC AG 3') and 1510R (5' GGT TAC CTT GTT ACG ACT T 3') described by

124

Rev Mex Cienc Pecu 2021;12(1):120-137

Weisburg for bacterial phylogenetic studies were used; the electrophoresis was performed in 1% agarose gel. For the sequencing of the PCR products, 10 μl were used; 5 μl portions of each universal primer for the 16S rRNA gene were deposited in 0.2 ml microtubes, which were then packaged and sent for sequencing to Macrogen company in Korea(15).

The DNA sequences were aligned using the free software MEGA 7 and compared with the 16S rRNA sequences, which are in the GenBank public access database using the free software BLAST (Basic Local Alignment Search Tool)(15,24).

Preparation of the milk inoculum (MI)

The elaboration and evaluation of the MI were carried out according to the norms of the INEN(25). The stages were: reception of fresh milk; organoleptic inspection; sieving; mechanical homogenization(21,26,27); pasteurization, carried out at 75 °C during 10 min; cooling, and incubation, at a temperature ranging between 40 and 45 °C(26,27).

Milk inoculum mixture. Selected LABs with probiotic capacity were activated(28-29) on MRS agar and incubated at 37 ºC for 48 to 72 h, depending on the strain; an aliquot was sown in 10 ml MRS broth and incubated at 37 ºC for 48 h, to be used it was homogenized at OD= 1; at 600 nm(26,27,28). 100 ml of pasteurized milk and 1 ml of MRS broth with a selected LAB strain were placed in 250 ml sterile flasks and incubated at 32 ºC during 12 h. For the preparation of the final mixture of MI (yogurt), 50 ml of each previous inoculum (per strain) were extracted and mixed (strains 1, 2 and 5 and strains 1, 5 and 6) in half a liter of pasteurized milk, incubated at 32 ºC during 12 h and kept at 4 ºC(27, 28,).

Chemical analysis of the milk inoculum. The pH, titratable acidity, syneresis and colony count were evaluated at 0, 5, 10 and 15 days in refrigeration at 4 °C. The pH value of the MI was measured according to method 981.12 (AOAC, 1990), using the digital potentiometer, calibrated. 40 to 45 ml of the MI were placed in a container; the pH electrode was introduced, and the reading was recorded. In order to determine the titratable acidity, 5 g of sample were taken, and three drops of phenolphthalein were homogenized and titrated with NaOH 0.1N, until a persistent pale pink color was obtained (lactic acid formula factor 0.09)(29,30,31). For the evaluation of syneresis, 10 g of sample were used, placed in falcon tubes, and centrifuged for 20 min at 4,200 xg; after centrifugation, the weight of the supernatant was obtained, and the percentage of syneresis (w/w) was calculated based on the relationship between the weight of the supernatant and the weight of the sample multiplied by 100(31,32,33).

Microbiological analysis of the milk inoculum. This analysis was carried out taking into account the bacterial identity for yogurt, utilized by NTP 202.092:2014. The ISO 7889:2003 method (IDF 117:2003) was used according to the enumeration of characteristic microorganisms with the technique of counting colonies at 37 °C(27,28,30,34).

125

Rev Mex Cienc Pecu 2021;12(1):120-137

Results and discussion Evaluation of microbiological analysis

Ten strains with LAB characteristics were found after discarding in MRS agar + aniline blue and purification on MRS agar and confirmed by method validation(16,23,29). LAB are stained an intense blue in the selective medium by the presence of colony metabolites reacting with aniline blue(23,24,29); the literature also confirms that LAB are Gram positive and can include different forms of bacilli, coconut and cocobacilli(16,19,29), as shown in Table 1, where the growth of LAB is also exhibited, being greater the 05 strain(2). 80 x 104 CFU/ml), followed by the 01 strain (2.60 x 104 CFU/ml). The 04, 09, 07 and 02 strains had similar values; however, the 03, 06, 08 and 10 strains presented less growth (1.00 x 104 to 1.20 x 104 CFU/ml), understanding that the reproduction capacity of the LAB strains is variable according to the temperature and environment conditions(29,35,36).

Table 1: Initial evaluation of isolated strains for determining the characteristics of LAB LAB

01 Strain 02 Strain 03 Strain 04 Strain 05 Strain 06 Strain 07 Strain 08 Strain 09 Strain

Size (mm)

Sh

Ele

Mar

Col

Den

Con

Group

Shape

Size CFU/ml

P 1.72

C

Convex

w

W

O

Viscous

Gram +

Bacilli

2.60x104

P 1.82

C

Convex

w

W

O

Viscous

Gram +

Coccobacil lus

1.70x104

M 2.44

C

Flat

w

W

O

Viscous

Gram +

Bacilli

1.10x104

P 1.28

C

Flat

w

W

O

Viscous

Gram +

Bacilli

2.20x104

P 1.51

C

Convex

w

W

O

Viscous

Gram +

Cocci

2.80x104

M 3.54

C

Convex

w

W

O

Viscous

Gram +

Coccobacil lus

1.10x104

M C Convex w W O Viscous Gram + Cocci 1.70x104 3.54 D C Convex w W O Viscous Gram + Bacilli 1.20x104 0.48 D 0.4 C Flat w W O Viscous Gram + Bacilli 1.90x104 8 10 D C Flat w W O Viscous Gram + Bacilli 1.00x104 Strain 0.48 LAB= lactic acid bacteria; Sh= shape; Ele= elevation; Mar= margin; Col= color; Den= density; Con= consistency.

C= circular, w= whole, W= white, o= opaque.

126

Rev Mex Cienc Pecu 2021;12(1):120-137

Assessment of the biochemical analysis of LAB

Test for oxidase, hydrogen peroxide, gas generation and tolerance to pH, NaCl and bile salts. Table 2 shows that the 10 strains were negative oxidase (they do not produce the cytochrome enzyme C-oxidase in their breathing process). They are not aerobic; therefore, they do not need oxygen in their cell membrane. Furthermore, they exhibited negative catalase reaction (not reacting with H2O2) and did not produce CO2(7,16,24) (except 04, 08 and 10). In the experiment, strains 03, 04, 08, 09 and 10 did not achieve tolerance to the concentrations of pH, NaCl, or bile salts, which are characteristic of probiotic cells(19,23,29); therefore, they were definitely discarded.

Table 2: Biochemical and tolerance evaluation of LAB strains as a probiotic

Strain

Oxi

pH

GG

Tolerance to Tolerance to pH NaCl, % 2.5 3.5 4.5

01 02 03 04 05 06 07 08 09 10

-

+ -

+ + +

-

+ + + + + -

+ + + + + -

Tolerance to bile Salt, %

5

9

13

1

5

10

+ + + + + -

+ + + + -

+ + + -

+ + + + + -

+ + + + + -

-

Oxi= oxidasa; pH= hydrogen peroxide; GG= gas generation; Positive test: + Negative test: -

Table 3 shows the initial and final amount, in CFU/ml, of the strains submitted to different tolerance concentrations for selection purposes. The 1st strain was the one that presented the highest final growth, followed by strains 2, 5 and 6 in pH 4.5 and 3.5, which are sufficient for selection(3,16,35); however, they were all susceptible to the highly acidic culture medium (pH 2.5). The same table shows the tolerance to NaCl, where stumps 5, 1 and 6 evidenced greater tolerance in all the concentrations, while stumps 2 and 7 were susceptible to the highest concentration (w/v). Also, tolerance to bile salts is observed in all the stumps at a maximum concentration of 5%, which is a reason for their selection(24,29,35); of these, stump 5 exhibited the greatest growth –7.0 x 103 CFU/ml–, followed by the stumps 6, 1, 2 and 7.

127

Rev Mex Cienc Pecu 2021;12(1):120-137

Table 3: Evaluation of the final count of LAB colonies (CFU/ml), according to the tolerance of strains as probiotics pH tolerance NaCl tolerance, % Bile salt tolerance, % Strain 2.5 3.5 4.5 5 9 13 1 5 10 1

Base line Final

2

Base line Final

5

Base line Final

6

Base line Final

7

Base line Final

6.80x1 03

7.90x1 1.30x1 2.85x1 3.75x1 3.25x1 03 04 03 03 03 2.30x1 3.80x1 1.05x1 1.19x1 5.25x1 04 04 04 04 03 6.30x1 7.20x1 9.20x1 2.50x1 2.55x1 2.90x1 03 03 03 03 03 03 1.90x1 2.90x1 9.73x1 04 04 03 6,40x1 7.50x1 1.30x1 5.03x1 1.50x1 7.56x1 03 03 04 04 04 03 1.80x1 2.30x1 1.13x1 2.80x1 2.80x1 04 04 04 04 04 4.70x1 6.50x1 1.30x1 4.67x1 5.20x1 3.25x1 03 03 04 03 03 03 1,80x1 2.30x1 9.80x1 1,00x1 5.25x1 04 04 03 04 03 4.50x1 5.50x1 1.00x1 4.50x1 4.80x1 3.00x1 03 03 04 03 03 03 9.50x1 2.00x1 7.50x1 5.50x1 03 04 03 03 Negative test: - ; LAB colony forming unit = CFU/ml.

2.10x1 04 6.40x1 03 1.00x1 04 6.30x1 03 1.70x1 04 1.10x1 04 1.20x1 04 7.50x1 03 7.10x1 03 5.30x1 03

9.40x1 03 4.90x1 03 8.60x1 03 5.00x1 03 1.40x1 04 7.00x1 03 7.10x1 03 5.80x1 03 4.50x1 03 3.80x1 03

6.50x1 03 2.90x1 03 1.70x1 04 6.20x1 03 5.00x1 03 -

The LABs found in the study exhibited probiotic characteristics evaluated according to tolerance to low pH concentrations, as stated by most authors, who consider 3 to 3.4 as survival pH values, and 3.5 as an optimal pH(14,35,36). They also exhibited tolerance to high concentrations of bile salts and NaCl similar to those of other researches(7,35,36) – conditions considered to be mandatory as probiotics–; thus, the LAB strains (5, 1, 2 and 6) were found to exhibit viability for their selection as probiotics according to the methodology carried out by other researchers(16,37,38).

Evaluation of the molecular analysis. DNA sequencing

Table 4 presents the molecular identification of the LAB strains and pathogenic bacteria of the work with a high percentage of identity (99 %).

128

Rev Mex Cienc Pecu 2021;12(1):120-137

Table 4: Molecular identification by the 16S rRNA gene of strains extracted from the final part of the piglet's gastrointestinal tract Sequence size Identity Accession Strains Identified species (pb) (%) Number LAB 01 LAB 02 LAB 05 LAB 06 LAB 07 (A) (B)

1371 1328 1344 1366 1383 1352 1359

Lactobacillus reuteri Enterococcus faecium Enterococcus faecium Enterococcus faecium Enterococcus faecium Escherichia fergusonii Shigella flexneri

99 99 99 99 99 99 99

NR075036.1 NR113904.1 NR113904.1 NR113904.1 NR113904.1 NR074902.1 NR026331.1

The E. faecium and L. reuteri LAB strains detected and molecularly identified are present as native microorganisms of the pigs’ digestive tract and have an antagonistic effect against Escherichia, similar to that against E. faecium NCIMB 10415 and E. faecium NCIMB 11181(38,39,40), as well as against L. reuteri I5007 and L. reuteri KT260178, Lactobacillus sp, and L. acidophilus, used as probiotics in swine production(29,41,42).

Samples of pathogenic bacteria from piglets, (Table 4) are reported to be most prevalent in pig breeding(39,40).

Evaluation of the inhibitory activity of LABs against pathogenic bacteria

When comparing the three methods in order to determine the inhibitory activity (Table 4), it can be seen that the direct method and the neutralized dish method show less inhibition than the non-neutralizing dish method, given that the latter has an acidic pH due to the organic acids present in it, which have bactericidal activity(29,35,41).

E. faecium and L. reuteri had greater antagonistic activity against E. fergunsonii, which is more susceptible, than against S. flexneri, as reported by others(12,38,39). Also, Eschericha is susceptible to most lactic acid bacteria, such as Lactobacillus spp strains extracted from lactating calves, L. plantarum isolated from creole pigs, and L. lactis isolated from piglets(40,41,42).

Direct method. The results of Table 5 show the inhibitory effect of LAB through direct contact. Strains 5, 6 and 7 showed inhibition against the two pathogenic strains with larger halos against E. fergunsonii, the most prominent of which is strain 5, with halo of 8.46 ± 3.02. Strains 1 and 2 showed less halos than the pathogenic ones(38,41).

129

Rev Mex Cienc Pecu 2021;12(1):120-137

Table 5: Halo size of LAB inhibition tests against the pathogens of Shigella flexneri and Escherichia fergusonii Escherichia fergusonii Strains Direct 01 02 05 06 07

6.52 ± 0.132 6.94 ± 0.44 8.46 ± 3.02 8.33 ± 2.70 8.25 ± 2.53

Shigella flexneri

UnNeutralized Direct neutralized 7.54 ± 0.43 7.90 ± 0.078 8.86 ± 0.62 9.72 ± 1.88 9.24 ± 0.60

6.85 ± 036 7.10 ± 0.60 8.76 ± 3.80 8.52 ± 3.17 8.65 ± 3.51

6.00 6.00 6.9 ± 0.45 6.72 ± 0.25 6.24 ± 0.02

UnNeutralized neutralized 6.30 ± 0.56 7.34 ± 0.05 10.34 ± 0.13 9.84 ± 0.40 10.10 ± 2.0

6.00 6.00 7.34 ± 0.89 6.84 ± 0.35 7.10 ± 0.60

Negative test: 6.00

Non-neutralizing dish method. The test was performed using the supernatant of the LAB culture, with an average pH of 4.486 ± 0.001. Table 5 shows that all the stumps exhibit inhibition halos in the confrontation against E. fergusonii; the most prominent stumps were Nos. 6 and 7, followed by stump 5 and, finally, by stumps 2 and 1. The halos formed in the presence of S. flexneri were of a larger size than those formed with the other pathogen, the stumps (in order of size from the largest to the smallest) were 5, 7, 6, 2, and 1 respectively.

LAB 5, 7 and 6 (E. faecium) exhibited larger halos in the presence of S. flexneri, and similar and smaller halos to those obtained in the test with Lactobacillus spp, compared to pathogens of the pig; halos ranging between 11.24 ± 0.03 and 32.62 ± 0.04 have been reported in the presence of Salmonella sp(19,36,41). In tests using the bacterial supernatant without neutralization, it has exhibited a greater inhibition action, due to the effect of the organic acids, according to the antagonism tests(29,35,40).

Neutralizing dish method. In this case, the supernatant of the LAB culture was adjusted to pH 7.00 (neutralized with sodium hydroxide) in order to exclude the inhibition of organic acids. All the strains exhibited halos (Table 5) against E. fergusonii, but of a smaller size than in the test without neutralizing, the largest halos being for strains 5, 7 and 6 in the test with S. flexneri. In this method, since there is no acid action, the antimicrobial action is attributed to the presence of non-acid metabolites. Reportedly, LAB produce peptide substances that have a bactericidal or bacteriostatic mode of action(16,42), which is also referred to the activity of protein metabolites or complex lipid molecules or carbohydrates(11).

With all three methods, the assessed strains 5, 6 and 7 (E. faecium) exhibited the largest halos against E. fergunsonii, the non-neutralizing dish method being the one that generated the largest halos, as previously reported(11,16). The antagonism of LAB is influenced by several factors, such as the type of bacterium, the place where it was obtained, the host species, the temperature, and the incubation time(14,15,41). The LAB with 130

Rev Mex Cienc Pecu 2021;12(1):120-137

probiotic activity exhibited antagonism against pig pathogens, and its action is compared with the majority of probiotics obtained from bacteria Lactobacillus ssp. L. acidophilus, L. plantarum, (L. casei and L. brevis)(14,19,29), which act against the pathogenic bacteria E. coli ATCC 25922 and S. typhimurium(14).

Evaluation of the milk inoculum

Physical-chemical evaluation (pH, acidity and syneresis). Strains 1, 2, 5 and 6 were selected from the evaluated LAB as probiotics. Two mixtures were prepared with them as MI (yogurt); the first mixture utilized strains 1, 2, and 5, and the second one, strains 1, 5 and 6 (1 ml of activated strain in 100 ml of milk). 50 ml of each strain were used, according to the mixture, in order to evaluate its viability, at 0, 5, 10 and 15 days of storage until its use as MI (yogurt). Table 6 shows that mixture one exhibited better stability; in it, the pH values were inversely proportional to the acidity, which decreases according to the number of days of refrigeration. The pH at 15 days was pH of 4.53 for mixture one, and pH 4.78 for mixture two; these values are within the acceptable parameters of stability and useful life, related to the time of degradation of lactose to lactic acid. The results obtained are acceptable, comparable to those obtained with pH 4.65 in the manufacture of yogurt with goat's or cow's milk using commercial fermenting microorganisms and symbiotic yogurts(26,27); besides, they comply with the Codex standard STAN 243-2003(43), which states that all yogurts must have a pH of ≤ 4. 6 to 4.90 –values similar to those of yogurts and non-traditional milk products(25,27,30). The pH obtained was similar to that of milk ferments for pigs, ensilaged with milk products that maintain pH values of 3 to 4.9(18,35,44). Despite the fact that mixture two presented slightly higher pH, this is also within the technical norms, NTP 202.092:2014 and Norm INEN 710 of 1996(20); the pH is modified to cover a greater range when incorporating wheat fiber and other grains into Mexican artisanal yogurts(18,32,33). Although the yogurt is refrigerated, the growth of LAB strains ceases. However, the acidity proceeds slowly, due to its residual activity(26,30,31); its shelf life is increased by incorporating acid fruits and pectin shakes(27,34), and its quality and flavor are also improved by adding fruits (lucuma, banana, mango, and others) with functional components(34,45); therefore, the pH in the incubation and storage of MI determines its acceptability for use(31).

131

Rev Mex Cienc Pecu 2021;12(1):120-137

Table 6: Evaluation of pH, % acidity, degree of syneresis and viable LAB count of MI (yogurt) at different days of storage at 4 °C Mixture 01 Mixture 02 Days

pH

0 5 10 15

4.65 4.61 4.57 4.53

Acidity Syneresis % % 0.80 0.86 0.90 0.93

0.36 0.49 0.55 0.61

CFU/g

Ph

4.8x106 1.5x107 2.7x107 3.9x107

4.94 4.88 4.82 4.78

Acidity Syneresis % CFU /g % 0.47 0.50 0.55 0.58

0.39 0.45 0.53 0.58

2.8x104 7.4x104 9.6x104 1.1x106

The acidity value (%) is a function of the content of lactic acid, reaching up to 0.93 and 0.58 %, considered acceptable in a dairy product according to the standard for the preparation of yogurt as established by Codex STAN 243-2003(44), to the Standard INEN 710 of 1996. It has a final range of 0.6 to 1.5 % during refrigeration(20), and the percentage of acidity obtained is accepted in fermented foods and silage(28,35,44). The degree of measured syneresis of MI (yogurt) increased slowly during storage, an effect caused by loss of stability, water retention, and its components. Table 6 shows the values of the evaluation of the degree of syneresis during storage; at 15 d of refrigeration, it exhibited an acceptable range of 0.36 to 0. 61 % (mixture one and two) –results similar to those obtained in yogurt and goat milk shake with fruits(26,27,34), but higher than those obtained for modified yogurts, because of the addition of commercial stabilizers, microcapsules of gum Arabic and maltodextrin (0.12 to 0.1 %)(27,30), and fiber that helps to prevent the separation of whey(32,33).

Microbiological evaluation. Table 6 shows the viability of LAB as probiotics in the MI (yogurt). Mixture one shows greater increase of probiotic microorganisms than mixture two, during its evolution in refrigeration. The LAB count in both mixtures is similar to that recommended by NTP 202.092:2014 for the preparation of yogurt with the ISO 7889:2003 (IDF 117:2003) method(33), which considers – at least for total number of lactic bacteria microorganisms in yogurt during its useful life– a concentration of 107 CFU/g.

Mixtures one and two attained this concentration (3. 9 x 107 CFU/g and 1.1 x 106 CFU/g, respectively) at 15 d of refrigeration. Thereby, the processed product was guaranteed to contain and preserve its viability and probiotic activity, as in the manufacture of the different yogurts, in which goat or cow milk, commercial fermenting bacteria, flavorings, fruits, and fiber are utilized, with a concentration of 107 CFU/g to 106 CFU/g of viable probiotic cells in the first 16 d(30,34,46). Currently the consumer demands less processed and more natural, functional foods (antioxidant fruits)(33,45); therefore, it also seeks to improve their life span by providing antimicrobial qualities using beneficial native bacteria(17,18,42). Reuterine, produced by L. reuteri, is an antibacterial that can be used as a biopreservative with potential probiotic controller of Salmonella spp. and E. coli in food for people or animals. The trend is the use of native LAB and its bacterial extracts as isolated probiotic potentials used in the same animal species(12,38,39).

132

Rev Mex Cienc Pecu 2021;12(1):120-137

Conclusions and implications The biochemical characterization, the tolerance tests, and the antagonistic effect of the selected LAB were of great importance for the growth and survival of four probiotic strains (three Enterococcus faecium and one Lactobacillus reuteri strain). The production of organic acids presents in the non-neutralized supernatants stood out for their antimicrobial activity, and there is a non-acid action by metabolic modifiers in neutralized supernatants with bactericidal effect. It was possible to elaborate a lactic inoculum (yogurt) with acceptable, viable and innocuous characteristics with the isolated stumps for it to be considered as a potential probiotic for oral administration, with 15 d of useful life.

Acknowledgements

The authors thank the National University of Tumbes (Universidad Nacional de Tumbes), the unconditional support provided for the research, as well as the workers' staff of the Faculty of Agricultural Sciences (FCA).

Literature cited: 1.

Hevia RM. Microbiota digestiva del cerdo: determinación del patrón en condiciones de salud y enfermedad [tesis doctoral]. León, España: Universidad de León; 2018.

2.

Balasingham K, Valli C, Radhakrishnan L. Balasuramanyam D. Caracterización probiótica de bacterias del ácido láctico aisladas de intestino porcino. Mundo Vet 2017;10(7):825.

3.

Gámez HJ, Aguirre D, Ramírez CJRMC. Caracterización de bacterias probióticas aisladas del intestino grueso de cerdos como alternativa al uso de antibióticos. Rev MVZ Córd 2009;14(2):1723-1735.

4.

Miranda-Yuquilema JE, Marin-Cárdenas A, Oliva-Bello H, Baño-Ayala D, BarrosRodríguez M, Jácome-Vargas H, Villamarín-Barragán D. Influence of a microbial additive on the productive behavior of pregnant sows, as well as, hematochemical and diarrheal incidence in their offspring. Trop Subtrop Agroecosyst 2018;21(1):3945.

5.

Reis de Souza TC, Mariscal Landín G, Escobar García K, Aguilera Barreyro A, Magné Barrón A. Cambios nutrimentales en el lechón y desarrollo morfoisiológico de su aparato digestivo. Vet Méx 2012;43(2):155-173.

133

Rev Mex Cienc Pecu 2021;12(1):120-137

6.

Pérez FA. Prácticas de manejo del lechón en maternidad: estrategias para mejorar su sobrevida y aumentar la productividad. Rev Electr Vet 2010;11(1):177-190.

7.

Cossio DS, Hernández YG, Mendoza JD. Development of probiotics for animal production. experience in Cuba. Cuba J Agric Sci 2018;52(4):357-373.

8.

Quintero MJV. Bacterias del ácido láctico un potencial para la producción de alimentos probióticos fermentados en la industria láctea de Panamá. KnE Eng 2018;3(1):38-47.

9.

Ávila J, Ávila M, Tovar B, Brizuela M, Perazzo Y, Hernández H. Capacidad probiótica de cepas del género Lactobacillus extraídas del tracto intestinal de animales de granja. Rev Cienc 2010;20(2):161-169.

10. Martín C, Escobedo S, Suárez JE, Quirós LM, Pérez-Martínez G, Coll-Marqués JM, et al. Two alkaline motifs in the lactobacillus salivarius Lv72 OppA surface are important to its adhesion function. Benefic Microbiol 2019;10(1):101-109.

11. Lu X, Zhang M, Zhao L, Ge K, Wang Z, Jun L, et al. Growth performance and postweaning diarrhea in piglets fed a diet supplemented with probiotic complexes. J Microbiol Biotechnol 2018;28(11):1791-1799.

12. Chengjun H, Weigang X, Xiaohua L, Xiuzhu Z, Ke L, Jia L, et al. Effects of dietary supplementation of probiotic Enterococcus faecium on growth performance and gut microbiota in weaned piglets. AMB Express. 2019;9(1):11-12.

13. Fengjuan Y, Aina W, Xiangfang Z, Chengli H, Hong L, Shiyan Q. Lactobacillus reuteri I5007 modulates tight junction protein expression in IPEC-J2 cells with LPS stimulation and in newborn piglets under normal conditions. BMC Microbiology 2015;15(1):10-11.

14. Vera-Mejía R, Ormaza-Donoso J, Muñoz-Cedeño J, Arteaga-Chávez F, SánchezMiranda L. Cepas de Lactobacillus plantarum con potencialidades probióticas aisladas de cerdos criollos. Rev Salud Anim 2018;40(2):11-12.

15. Sánchez SH, Ochoa MG, Rojas MC, Peralta OT, Ordinola ZA. Aislamiento de péptidos inhibidores de bacterias a partir de bacterias ácido lácticas del tracto digestivo del lechón e identificación mediante prueba proteómica. Sci Agropec 2017;8(4):437-443.

16. Vélez Zea JM. Evaluación de la actividad antimicrobiana de bacterias probióticas extraídas del calostro de cerdas de granjas del Aburrá sur [tesis doctoral]. Medellín, Colombia: Universidad Nacional de Colombia-Sede Medellín; 2015.

17. Barón LVC. Probióticos y prebióticos como alimentos funcionales en nutrición animal. Zoocienc 2016;3(2):15-21.

134

Rev Mex Cienc Pecu 2021;12(1):120-137

18. Medina PJG. Propiedades tecnológicas de bacterias ácido lácticas aisladas de productos lácteos fermentados artesanales expendidos en la región Ciénega de Jalisco. Adv Invest Food Saf 2018;1(1):230-234.

19. Ming-Lun C, Hsi-Chia C, Kun-Nan C, Yu-Chun L, Ya-Ting L, Ming-Ju C. Optimizing production of two potential probiotic Lactobacilli strains isolated from piglet feces as feed additives for weaned piglets. Asian-Austral J Anim Sci 2015;28(8):1163-1170.

20. Landa-Salgado P, Caballero-Cervantes Y, Ramírez-Bribiesca E, HernándezAnguiano AM, Ramírez-Hernández LM, Espinosa-Victoria D, Hernández-Sánchez D. Aislamiento e identificación de bacterias ácido lácticas con potencial probiótico para becerros del altiplano mexicano. Rev Mex Cienc Pecu 2019;10(1):68-83.

21. Flores Fuentes GD. Propuesta de un manual de procedimientos operativos estándar sobre la toma de muestras de alimentos para uso de la Defensoría del Consumidor [tesis doctoral]. El Salvador: Universidad de El Salvador; 2015.

22. Botero Ospina MJ, Castaño DRT, Castaño Zapata J. Manual práctico de microbiología general. No. Doc. 26157. CO-BAC, Bogotá. 2011.

23. MacFaddin JF. Pruebas bioquímicas para la identificación de bacterias de importancia clínica: Métodos microbiológicos. Capítulo 17. 18a. ed: Editorial Panamericana; 2002.

24. Arteaga-Chávez F, López-Vera M, Laurencio-Silva M, Rondón-Castillo A, MiliánFlorido G, Barrios-González V. Selección e identificación de aislados de Bacillus spp. del tracto digestivo de pollos de traspatio, con potencial probiótico. Pastos y Forrajes 2017:155-164.

25. ECUADOR NTE INEN IJR, Quito, Ecuador. Instituto Ecuatoriano de Normalización Norma técnica Ecuatoriana del Yogurt INEN 2395:2011.https://www.normalizacion.gob.ec/buzon/normas/nte-inen-2395-2r.pdf. consultado nov 15, 2018.

26. Zapata IC, Sepúlveda-Valencia U, Rojano BA. Efecto del tiempo de almacenamiento sobre las propiedades fisicoquímicas, probióticas y antioxidantes de yogurt saborizado con mortiño (Vaccinium meridionale Sw). Inf Tech 2015;26(2):17-28.

27. Ortega LAJ, Ramírez LB, Rodríguez EA. Desarrollo y evaluación de un yogurt bebible adicionado de extracto liofilizado de Justicia spicigera como colorante natural. e-CUBA 2018;(9):25-34.

28. Miranda MO, Espinosa REN, Ponce PI. Características físico-químicas y propiedades nutricionales del suero resultante del proceso de obtención del yogurt Griego. Rev Cubana Alim Nutri 2016;26(1):172-174.

135

Rev Mex Cienc Pecu 2021;12(1):120-137

29. Hernández-García JE, Sebastián-Frizzo L, Rodríguez-Fernández JC, Valdez-Paneca G, Virginia-Zbrun M, Calero-Herrera I. Evaluación in vitro del potencial probiótico de Lactobacillus acidophilus SS80 y Streptococcus thermophilus SS77. Rev Salud Anim 2019;41(1):1-13.

30. Huertas RAP. Efecto del té verde (Camellia Sinensis L.) en las características fisicoquímicas, microbiológicas, proximales y sensoriales de yogurt durante el almacenamiento bajo refrigeración. @ limentech, Cient Tech food 2013;11(1):5664.

31. Sánchez J, Enríquez D, Castro PJAS. Efecto de la concentración de sólidos totales de la leche entera y tipo de cultivo comercial en las características reológicas del yogurt natural tipo batido Agroind Sci 2012;2(2):173-80.

32. Díaz Jiménez B, Sosa Morales M, Vélez Ruiz J. Efecto de la adición de fibra y la disminución de grasa en las propiedades fisicoquímicas del yogur. Rev Mex Ing Quím 2004;3(3):287-305.

33. Simanca MM, Andrade RD, Arteaga MR. Efecto del salvado de trigo en las propiedades fisicoquímicas y sensoriales del yogurt de leche de búfala. Inf Tech 2013;24(1):79-86.

34. Vásquez-Villalobos V, Aredo V, Velásquez L, Lázaro M. Propiedades fisicoquímicas y aceptabilidad sensorial de yogur de leche descremada de cabra frutado con mango y plátano en pruebas aceleradas. Sci Agropecu 2015;6(3):177189.

35. Sánchez SH, Fabián DF, Ochoa MG, Alfaro AR. Sucesión bacteriana del tracto digestivo del lechón alimentado con ensilado biológico. Rev Inv Vet Perú 2019;30(1):214-223.

36. Ng SY, Koon SS, Padam BS, Chye FY. Evaluation of probiotic potential of lactic acid bacteria isolated from traditional Malaysian fermented Bambangan (Mangifera pajang). CyTA: J Food 2015;13(4):563-572.

37. Jurado GH, Aguirre FD, Ramírez TC. Caracterización de bacterias probióticas aisladas del intestino grueso de cerdos como alternativa al uso de antibióticos. Rev MVZ Córdova 2009;4(2):1723-1735.

38. Kern M, Aschenbach JR, Tedin K, Pieper R, Loss H, Lodemann U. Characterization of inflammasome components in pig intestine and analysis of the influence of probiotic Enterococcus faecium during and Escherichia coli challenge. Immunology Res 2017;46(7):742-757.

39. Chae JP, Pajarillo EAB, Oh JK, Kim H, Kang DK. Revealing the combined effects of lactulose and probiotic enterococci on the swine faecal microbiota using 454 pyrosequencing. Microb Biotechnol 2016;9(4):486-495.

136

Rev Mex Cienc Pecu 2021;12(1):120-137

40. Dowarah R, Verma AK, Agarwal N, Singh P, Singh BR. Selection and characterization of probiotic lactic acid bacteria and its impact on growth, nutrient digestibility, health and antioxidant status in weaned piglets. PLoS One 2018;13(3):1-24.

41. Estrada MAC, Gutiérrez RLA, Montoya COI. Evaluación in vitro del efecto bactericida de cepas nativas de Lactobacillus sp. contra Salmonella sp. y Escherichia coli in vitro. Rev FNAgron Medellín 2005;58(1):2601-2609.

42. Andrea M. Probióticos y su mecanismo de acción en alimentación animal. Agron Mesoamericana 2019;30(2):601-611.

43. Codex para leches fermentadas. Leche y productos lácteos segunda edición. STAN 243-2003. www.fao.org/3/a-i2085s.pdf. Consultado nov 20, 2018.

44. Caicedo WO, Moyano JC, Valle SB, Díaz LA, Caicedo ME. Calidad fermentativa de ensilajes líquidos de chontaduro (Bactris gasipaes) tratados con yogur natural, suero de leche y melaza. Rev Inv Vet Perú 2019;30(1):167-177.

45. Paucar-Menacho LM. Lúcuma (Pouteria lucuma): Composición, componentes bioactivos, actividad antioxidante, usos y propiedades beneficiosas para la salud. Sci Agropec 2020;11(1):135-142.

46. Benítez-de la Torre A, Montejo-Sierra IL, Morales-García YE, Muñoz-Rojas J, Díaz-Ruíz R, López PA. Adición de fuentes energéticas e inoculantes en la elaboración de yogurt de yuca. Pastos Forrajes 2018;4(1):30-34.

137

https://doi.org/10.22319/rmcp.v12i1.5131 Article

In vivo anthelmintic activity of Acacia cochliacantha leaves against Haemonchus contortus in Boer goat kids

Gastón Federico Castillo-Mitre a Rolando Rojo-Rubio a Agustín Olmedo-Juárez b* Pedro Mendoza de Gives b José Fernando Vázquez-Armijo a Alejandro Zamilpa c Héctor Aarón Lee-Rangel d Leonel Avendaño-Reyes e Ulises Macias-Cruz e

a

Universidad Autónoma del Estado de México, Centro Universitario UAEM-Temascaltepec.

b

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias, Centro Nacional de Investigación en Disciplinaria en Salud Animal e Inocuidad, carretera Federal Cuernavaca, Cuautla No. 8534/ Col. Progreso. 62550 Jiutepec, Morelos/A.P. 206-CIVAC, México. c

Instituto Mexicano del Seguro Social. Centro de Investigación Biomédica del Sur. México.

d

Universidad Autónoma de San Luís Potosí. Facultad de Agronomía,

e

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas,

*Corresponding author: olmedo.agustin@inifap.gob.mx; aolmedoj@gmail.com

138

Rev Mex Cienc Pecu 2021;12(1):138-150

Abstract: This study aimed to evaluate the effect of supplementing the maintenance diet of Boer goat kids with Acacia cochliacantha leaves. The endpoints evaluated were Haemonchus contortus fecal egg count (FEC) and water and dry matter intake. Two experimental treatments were evaluated on ten recently weaned goat kids (16.850 ± 1.630 kg of initial live weight and three months of age) experimentally infested with H. contortus larvae (L3) (350 larvae per live weight kilogram).

Treatment 1 (T1) served as the control and consisted of infested animals without diet supplementation with A. cochliacantha leaves. Treatment 2 (T2) consisted of infested animals fed diets supplemented with 5% of A. cochliacantha leaves. Animals were grouped from highest to lowest based on their FEC. The two animals groups with the highest values were randomly assigned to T1 or T2; this was repeated until completing five repetitions per treatment. The evaluated variables were: FEC (per gram of feces), water intake, and dry matter intake (DMI). The results show that goat kids fed diets with 5% of A. cochliacantha leaves have lower (P<0.05) FEC than the control. There were no significant differences in water intake and DMI (g d-1) between treatments. This study demonstrates the anthelmintic activity of diets supplemented with A. cochliacantha leaves in goat kids. Thus, this arboreal legume could represent a viable option for the comprehensive management of the nematodiasis of growing Boer goat kids.

Key words: Goat kids, Anthelmintic, Acacia cochliacantha, Haemonchus contortus.

Received: 28/10/2018 Accepted: 28/10/2019

Introduction The diseases caused by gastrointestinal nematodes (GIN) affect the health and productivity of small ruminants, representing an important problem worldwide. Haemonchus contortus is the main GIN responsible for the greatest economic losses in the livestock industry in Mexico; this problem can represent up to 445.1 million dollars annually(1-3). In the last decades, the indiscriminate use of antiparasitic agents against GIN has generated anthelmintic resistance, in addition to the residual effects of some drugs on the organisms and the environment(4,5). This problem has prompted research on sustainable control alternatives focused on studying the anthelmintic properties of the secondary metabolites in legume plants(6-9). Among these compounds are condensed tannins, terpenes, saponins, and flavonoids(10). Specifically, the synergistic nematicide activity of

139

Rev Mex Cienc Pecu 2021;12(1):138-150

flavonoids and free condensed tannins against GIN has been demonstrated(11,12). Acacia cochliacantha is a legume known as “cubata,” used in traditional medicine to treat gastrointestinal diseases(13). Various studies have reported the in vitro nematicide activity of leaf extracts(13) or specific compounds like tannins, quercetin, and caffeic, coumaric, and ferulic acids(12). This study aimed to evaluate the effect of a diet supplemented with A. cochliacantha leaves on egg shedding, dry matter and water intakes in growing Boer goat kids experimentally infested with H. contortus.

Material and methods Area of study

This study was carried out in the Experimental unit for small ruminants of the UAEM, Temascaltepec. This area has a mean altitude of 1,740 m asl, with a tropical savanna climate with summer precipitations (Aw)(14).

Plant material

Fresh leaves (young and mature) from A. cochliacantha were collected in Salitre Palmarillos, municipality of Amatepec, Mexico State, Mexico; located at 18°43'28'' N and 100°17'03'' W. The plant material was collected between March and April 2016 during the early hours of the morning.

Leaves were stored in a freezer to inhibit changes in their chemical structure due to photooxidation and were then transported to the Animal Nutrition laboratory at the UAEM, Temascaltepec; here, a specimen was selected for its identification in the Herbario Nacional de México of the Universidad Nacional Autónoma de México (UNAM). The plant material was identified by Prof.

Rafael Torres-Colín and deposited in the Herbario Nacional under the collection code OD07042016. The fresh leaves were shadow-dried at room temperature until reaching constant weight; after drying, leaves were ground to a particle size of 4 to 6 mm using an electrical Wiley® mill (Mod. TS3375E15).

140

Rev Mex Cienc Pecu 2021;12(1):138-150

Chemical analysis

The bromatological analysis of the experimental diets and the A. cochliacantha leaves was performed using the following methods: dry matter (DM), organic matter (OM), crude protein (CP), and ether extract (EE)(15); cell wall fractions (NDF and ADF) were evaluated using the methodology described by Van Soest et al(16). The content of total condensed tannins (TCT) in the percentage of inclusion of A. cochliacantha leaves was determined following the technique described by Terrill et al(17) and modified by López et al(18); the protein- and fiber-bound condensed tannins were determined with the method reported by Porter et al(19) and modified by Hagerman(20).

Biological material Infective larvae of H. contortus (L3, INIFAP strain) were obtained from a donor sheep (22.3  0.5 kg of live weight) infected with a single oral dose of 350 L3 per kg of live weight. The lamb was cared for according to the NOM-062-ZOO-1999. The infective larvae of H. contortus were obtained from cultures following the technique reported by Baermann(21).

Experimental animals

A total of 14 male Boer goat kids (16.850 ± 1.6 kg of live weight and 3 mo of age) from the Salitre farm, UAEM, Temascaltepec, were used. Before initiating the experiment, all animals were dewormed with a single dose of commercial ivermectin (0.22 mg-1 kg of live weight) to eliminate any natural infection with GIN. After applying the antiparasitic agent, goat kids were housed in individual cages (equipped with shade and drinking and feeding troughs). Then, it was confirmed that animals were negative for GIN infection using the McMaster technique(22), and on d 16, animals were inoculated with a single dose of 350 L3 of H. contortus per kilogram of live weight.

Once goat kids were diagnosed as positive for H. contortus (d 30), they were assigned into two groups (n=7) based on their FEC and their body weight. Before infection, animals received an adaptation diet without A. cochliacantha leaves (Table 1). Diets were balanced based on the requirements of growing goat kids using the NRC tables of 2007 for small ruminants(23).

141

Rev Mex Cienc Pecu 2021;12(1):138-150

Table 1: Ingredients, protein, and metabolizable energy of the experimental maintenance diets fed to goat kids infected with H. contortus Treatment Ingredient (%) 1 2 Acacia cochliacantha 0.00 5.00 Alfalfa hay 33.00 28.00 Ground corn 5.00 5.00 Ground sorghum 17.50 17.50 Soybean meal 7.00 7.00 Wheat bran 10.00 10.00 Oat straw 25.00 25.00 Molasses 0.00 0.00 Vitamins and minerals premix 2.50 2.50 Total 100.00 100.00 Crude protein 12.78 12.76 1 Metabolizable energy (MJ/kg DM) 2.84 2.83 T1: control (animals infected, without diet supplementation with A. cochliacantha leaves); T2: animals infected, fed diets supplemented with 5% of A. cochliacantha leaves.

1 Calculated based on the individual energy contents of each feed included in the diet (23).

Experimental design

During the experiment, the life of four goat kids was endangered due to post-weaning stress. These animals showed decreased packed-cell volumes (PCV), which indicate a severe anemic state, and high fecal egg counts (FEC > 12,500); therefore, these animals were removed from the experiment, leaving only ten goat kids, which were assigned into the two previously established treatments: T1: control (animals infected with L3 larvae of H. contortus, without diet supplementation with A. cochliacantha leaves) and T2: treatment (animals infected with L3 larvae of H. contortus fed diets supplemented with 5% of A. cochliacantha leaves). Response variables were: FEC per gram of feces, dry matter and water intake. Samples were collected weekly (post-infection d 1, 7, 14, 21, and 28) directly from the rectum. The FEC per gram of feces was determined following the McMaster technique(22). Dry matter and water intake were determined daily by subtracting the rejected water or feed from what was offered. The antiparasitic efficacy was estimated using Abbott's formula: Efficacy (reduction of FEC per g of feces, %) = [(FEC of control group - FEC of treated group) / FEC of control group)]*100

142

Rev Mex Cienc Pecu 2021;12(1):138-150

Statistical analysis

Results were processed through an analysis of variance using the GLM procedure of SAS (24). The experiment followed a completely randomized design; when there were differences between treatments, means were separated using the PDIFF test, STDERR statement. Statistical difference was declared at a P≤0.05 and the 0.05 < P ≤ 0.10 trend(25).

Results Chemical analysis

The chemical composition of the experimental diets and the tannin content in A. cochliacantha leaves are shown in Tables 1 and 2.

Table 2: Chemical proximate analysis and tannin content of dehydrated A. cochliacantha leaves

A. cochliacantha

OM

CP

NDF

ADF

FCT

PBCT

FBCT

TCT

937.0

163.0

698.6

581.7

140.0

26.0

36.0

202.0

OM= organic matter, CP= crude protein, NDF= neutral detergent fiber, ADF= acid detergent fiber, FCT= free condensed tannins, PBCT= protein-bound condensed tannins, FBCT= fiber-bound condensed tannins, TCT= total condensed tannins.

Fecal egg count

Table 3 shows the results for FEC and efficacy percentage of the diet supplemented with A. cochliacantha leaves. The reduction percentage caused by this legume ranged between 32.8-70.8 from day 14 to 28, respectively.

143

Rev Mex Cienc Pecu 2021;12(1):138-150

Table 3: Fecal egg count of H. contortus (FEC, mean ± standard deviation) and efficacy percentage of the diet supplemented with A. cochliacantha leaves Days of sampling Treatment 1 7 14 21 28 FEC (/g of T1 1100±120 3250±735b 2980±345ª 5300±435a 6850±1432.90ª feces) % ---------------Efficacy FEC (/g of T2 1100±133 6850±828ª 2000±367b 2050±432b 2000±178b feces) % ----110.7 32.8 81.1 70.8 Efficacy P value > 0.15 <0.05 < 0.01 < 0.01 < 0.01 T1: control (animals infected with L3 larvae of H. contortus); T2: animals infected with L3 larvae of H. contortus supplemented with 5% of A. cochliacantha leaves.

Water and dry matter intake

Table 4 shows the results for water and dry matter intake. No effect was observed in both variables (P>0.05).

Table 4: Water intake (WI) and dry matter intake (DMI) per day in goat kids infected with H. contortus and fed a diet supplemented with A. cochliacantha leaves

T 1 2 P

Days of sampling 1 7 14 21 28 WI DMI WI DMI WI DMI WI DMI WI DMI 1.7±0. 436.3±47. 1.6±0. 530.0±80. 1.8±0. 650.4±17 1.7±0.

647.7±20 1.8±0. 651.5±21 3 6 1 4 1 3.2 08 6.7 2 1.0 1.6±0. 448.7±10 1.5±0. 559.7±14 1.8±0. 625.0±21 1.7±0.

745.1±27 1.7±0. 694.5±19 3 0.0 4 1.3 5 6.6 4 2.5 4 4.2 0.71 0.80 0.69 0.69 0.76 0.84 0.90 0.52 0.75 0.76 T= treatment; 1= control (animals infected with L3 larvae of H. contortus); T2= infected animals supplemented with 5% of A. cochliacantha leaves. Water intake in liters and dry matter intake in grams per day.

144

Rev Mex Cienc Pecu 2021;12(1):138-150

Discussion This study demonstrated the antiparasitic effect of a diet supplemented with A. cochliacantha leaves in goat kids; the prolonged consumption of this legume has benefits on animal health.

Recently, this legume was evaluated in vitro against sheep and cattle gastrointestinal parasites with positive results(8,12). These studies demonstrated the ovicidal and larvicidal activities against different GIN, Haemonchus contortus among them. With this background, the results confirm the in vivo antiparasitic effect against the most important gastrointestinal nematodes in small ruminants.

Similar results were previously reported in hair sheep infected with L3 larvae of H. contortus and fed diets supplemented with Lysiloma acapulcensis dehydrated leaves; these sheep showed a 67.7 % decrease in fecal egg count per gram of feces(9). A different study in Brazil reported a decrease of up to 70 % after supplying Mimosa caesalpiniifolia leaves in sheep infected with H. contortus(26).

Moreover, ruminants fed legume trees not only obtain health benefits, but they also increase their daily protein intake as a result of the high CP content, more than 18 %, in the organic matter of these forage resources, which are high concentrations compared to those of grasses that rarely exceed 10 %. Therefore, these plants exert a nutraceutical effect on animals(27). Consequently, several studies have hypothesized that in animals fed grasses and legumes, the intake proportion will depend on the protein content of grasses. If it is lower than 8 %, legume intake would increase; legumes can be arboreal or shrubs. Méndez-Ortíz et al(28) observed that sheep infected with H. contortus consumed more arboreal legume (Havardia albicans) rich in secondary metabolites.

However, these legumes can have positive or negative effects on confined animals, directly affecting the level of dietary intake and metabolizable protein, which is directly related to the amount of condensed tannins per gram of dry matter. A previous report mentioned that to obtain benefits, condensed tannins must not exceed 5 % of the total diet(29).

In this study, there were no negative effects on water and dry matter intake in animals fed a diet supplemented with A. cochliacantha, which demonstrated that the intake of total condensed tannins did not affect dry matter intake. According to that reported in the literature, high dietary levels of secondary compounds, particularly free condensed tannins (greater than 50 g kg-1 of DM), could inhibit the microbial activity in the rumen and thus affect the digestibility of the potentially digestible fraction of the nutrients, decreasing dry matter intake as a result of the increase in the rumen mean retention time(30). Although this phenomenon could have a positive effect on the metabolism of nitrogenous compounds by decreasing ruminal proteolysis, which would increase

145

Rev Mex Cienc Pecu 2021;12(1):138-150

the bypass protein and the amino acid flux to the duodenum, it would increase the metabolizable protein for productive purposes in the animals(31).

The analysis of the condensed tannins in A. cochliacantha (Table 2) revealed that this plant could have similar effects to that explained before since it contains 20.2 % of total condensed tannins and 14.0 % of free condensed tannins (FCT), which are the bioactive compounds and can sequester carbohydrates and proteins from the diet. However, since it was only included 5% of A. cochliacantha leaves in the total diet, the intake of total condensed tannins (TCT) was 5.70 g, and of these, only 3.9 g were FCT; this concentration was not enough to decrease dry matter intake in the animals fed a diet supplemented with A. cochliacantha leaves. These results are similar to those reported by León-Castro et al(32); they observed a significant decrease in the FEC per gram of feces in goat kids artificially infected with H. contortus and fed diets supplemented with 10 % of A. cochliacantha leaves without negative health effects.

Future studies should consider the dose-response on dry and organic matter intake, and the digestibility of basal diets with different amounts of A. cochliacantha leaves. Plants rich in secondary metabolites, such as tannins, contain nutraceutical properties(7), and it has been confirmed in numerous animal nutrition studies that tannins are the polyphenols responsible for improving the nutritional value of livestock diets. Similarly, plant extracts rich in tannins have been reported to have antiparasitic properties(32-35). However, although it could be inferred that the high amounts of condensed tannins in A. cochliacantha are responsible for the antiparasitic activity, Castillo-Mitre et al(12) reported that the compounds with antiparasitic properties derived from the hydroxycinnamic acid (caffeic, coumaric, ferulic, and methyl caffeate acids). Hence, the antiparasitic activity of this legume could be due to these compounds, and tannins could act as secondary collaborators on the control of H. contortus by protecting the dietary protein from the rumen microorganisms. Therefore, this in vivo study, in addition to previous in vitro studies(12) with A. cochliacantha, could be important for future research on its nutraceutical properties in small ruminants.

Conclusions and implications These results show that Acacia cochliacantha has antiparasitic properties and can function as an important feed source for goat kids infected with GIN since it does not affect water and dry matter intake.

146

Rev Mex Cienc Pecu 2021;12(1):138-150

Conflicts of interest

Authors declare no conflicts of interest.

Acknowledgments

This study was partially funded by INIFAP (project SIGI 8215734475), the Universidad Autónoma del Estado de México (UAEM project 4585/2018/CIP), and the Red Temática de Farmoquímicos, CONACYT (Project number 294727, 2018). This study was part of the doctoral thesis of Gastón Federico Castillo-Miter under the direction of Dr. Rolando Rojo-Rubio and Dr. Agustín OlmedoJuárez.

Literature cited: 1. Rodíguez-Vivas RI, Grisi L, Pérez-de León AA, Silva-Villela H, Torres-Acosta JFJ, FragosoSánchez H. et al. Evaluación del impacto económico potencial de los parásitos del ganado bovino en México. Revisión. Rev Mex Cienc Pecu 2017; 8(1):61-74.

2. Marume U, Chimonyo M, Dzama K. A preliminary study on the responses to experimental Haemonchus contortus infection in indigenous goat genotypes. Small Ruminant Res 2011; 95:70–74.

3. Githiori J, Athanasiadou S, Thamsbprg S. Use of plants in novel approaches for control of gastrointestinal helminthes in livestock with emphasis on small ruminants. Vet Parasitol 2006;139:308-320.

4. Jackson F, Coop RL. The development of anthelmintic resistance in sheep nematodes. Parasitol 2000;120:95-107.

5. Tsiboukis D, Sazakli E, Jelastopulu E, Leotsinidis M. Anthelmintics residues in raw milk.

Assessing intake by a children population. Pol J Vet Sci 2013;16:85-91.

6. Olmedo-Juárez A, Rojo-Rubio R, Arece-García J, Mohamed AZS, Kholif EA, Morales AE. In vitro of Pithecellobium dulce and Lysiloma acapulcensis on the exogenous development of gastrointestinal strongyles in sheep. Ital J Anim Sci 2014;13:303-307.

147

Rev Mex Cienc Pecu 2021;12(1):138-150

7. García-Hernández C, Arece-García J, Rojo-Rubio R, Mendoza-Martínez GD, Albarrán-Portillo B, Vázquez-Armijo JF, et al. Nutraceutic effect of free condensed tannins of Lysiloma acapulcensis (Kunth) Benth on parasite infection and performance of Pelibuey sheep. Trop Anim Health Prod 2017;49:55-61.

8. Olmedo-Juárez A, Rojo-Rubio R, Zamilpa A, Mendoza-de Gives P, Arece-García J, LópezArellano ME, et al. In vitro larvicidal effect of a hydroalcoholic extract from Acacia cochliacantha leaf against ruminant parasitic nematodes. Vet Res Commun 2017;41:227-232.

9. González-Cortazar M, Zamilpa A, López-Arellano ME, Aguilar-Marcelino L, Reyes-Guerrero DE, Olazarán-Jenkins S, et al. Lysiloma acapulcensis leaves contain anthelmintic metabolites that reduce the gastrointestinal nematode egg population in sheep faeces. Comp Clin Pathol 2018;27:189-197.

10. Williams AR, Ropiak HM, Fryganas C, Desrues O, Mueller-Harvey I,Thamsborg SM. Assessment of the anthelmintic activity of medicinal plant extracts and purified condensed tannins against free-living and parasitic stages of Oesophagostomum dentatum. Parasit Vectors 2014;7:518-527.

11. Klongsiriwet C, Quijada J, Williams AR, Mueller-Harvey I, Williamson EM, Hoste H. Synergistic inhibition of Haemonchus contortus exsheathment by flavonoid monomers and condensed tannins. International J Parasitol Drugs Drug Resist 2015; 5:17-134.

12. Castillo-Mitre GF, Olmedo-Juárez A, Rojo-Rubio R, Cortázar-González M, Mendoza-de Gives P, Hernández-Beteta EE, et al. Caffeoyl and coumaroyl derivatives from Acacia cochliacantha exhibit ovicidal activity against Haemonchus contortus. J Ethnopharmacol 2017;204:125-131.

13. Argueta VA, Cano ALM, Radoarte ME. Atlas de plantas de la medicina tradicional mexicana.

México, D.F., 1994.

14. García E. Modificaciones al sistema de clasificación climática de Koeppen. Universidad Nacional Autónoma de México, México. 1987.

15. AOAC (Association of Official Analytical Chemists) Official Methods of Analysis, 16th edition. AOAC, Arlington, VA, USA. 1997.

16. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74:3583-3597.

17. Terrill TH, Rowan AM, Douglas GB, Barry TN. Determination of extractable and bound condensed tannins concentration in forage plants, protein concentrate meals and cereal grains.

J Sci Food Agric 1992;58:321-329.

148

Rev Mex Cienc Pecu 2021;12(1):138-150

18. López J, Tejada I, Vásquez C, Garza JD, Shimada A. Condensed tannins in humid tropical fodder crops and their in vitro biological activity: part 1. J Sci Food Agric 2004; 84:291-294.

19. Porter LJ, Hrstich LN, Chan BG. The conversion of procyanidins and prodelphinidins to cyanidin and delhpinidin. Phytochem 1986;25:223-230.

20. Hagerman AE, Butler, LG. In Herbivores: Their interactions with secondary plant metabolites.

Volume I. New York: Academic Press; 1991:355-388.

21. Mesquita JR, Mega C, Coelho C, Cruz R, Vala H, Esteves F, et al. ABC series on diagnostic parasitology part 3: The Baermann technique. The Veterinary Nurse 2017;8:10. doi.org/10.12968/vetn.2017.8.10.558 22. Arece J, Mahieu M, Archiméde H, Aumont G, Fernández M, González E, et al. Comparative efficacy of six anthelmintics for the control of nematodes in sheep in Matanzas, Cuba. Small Ruminant Res 2004;5(1–2):61–67.

23. NRC. Nutrient requirements of small ruminants, sheep, goats, cervids, and new world camelids.

The National Academy Press, Washington, DC, 2007.

24. SAS Institute SAS User’s Guide: Statistics. Ver 9.0. SAS Institute, Cary, N.C., USA, 2006.

25. Steel RGD, Torrie JH. Bioestadística: Principios y procedimientos. McGraw-Hill. México, 1980.

26. Brito DRB, Costa-Júnior LM, Garcia JL, Torres-Acosta JFJ, Louvandini H, Cutrim-Júnior JAA, et al. Supplementation with dry Mimosa caesalpiniifolia leaves can reduce the Haemonchus contortus worm burden of goats. Vet Parsitol 2018;252:47-51.

27. Hoste H, Torres-Acosta JFF, Quijada J, Chan-Pérez I, Dakhel MM, Kommuru DS, et al.

Interactions between nutrition and infections with Haemonchus contortus and related gastrointestinal nematodes in small ruminants. Adv Parasitol 2016;93:239-351.

28. Méndez-Ortíz FA, Sandoval-Castro CA, Torres-Acosta JFJ. Short term consumption of Havardia albicans tannin rich fodder by sheep: Effects on feed intake, diet digestibility and excretion of Haemonchus contortus eggs. Anim Feed Sci Technol 2012; 176:185-191.

29. Frutos P, Hervás G, Giráldez FJ, Mantecón AR. Review. Tannins and ruminant nutrition. Span J Agric Res 2004;2:191–202.

30. Waghorn GC, McNabb WC. Consequences of plant phenolic compounds for productivity and health of ruminants. Proc Nut Soc 2003;62:383–392.

149

Rev Mex Cienc Pecu 2021;12(1):138-150

31. Barry TN. Condensed tannins: their role in ruminant protein and carbohydrate digestion and possible effects upon the rumen ecosystem. In: Nolan JV, et al, editors. The roles of protozoa and fungi in ruminant digestion. Armidale, NSW, Australia: Pernambul Books; 1989:153– 167.

32. León-Castro Y, Olivares-Pérez J, Rojas-Hernández S, Villa-Mancera A, Valencia-Almazán MT, Hernández-Castro E, et al. Effect of three fodders tree on Haemonchus contortus control and weight variations in kids. Eco Rec Agro 2015;2:193–201.

33. Barrau E, Fabre N, Fouraste I, Hoste H. Effect of bioactive compounds from Sainfoin (Onobrychis viciifolia Scop.) on the in vitro larval migration of Haemonchus contortus: role of tannins and flavonol glycosides. Parasitol 2005;31(4):531-538.

34. Brunet S, Hoste H. Monomers of condensed tannins affect the larval exsheathment of parasitic nematodes of ruminants. J Agric Food Chem 2006; 54(20):7481-7487.

35. Quijada J, Fryganas C, Ropiak HM, Ramsay A, Mueller-Harvey I, Hoste H. Anthelmintic activities against Haemonchus contortus or Trichostrongylus colubriformis from small ruminants are influenced by structural features of condensed tannins. J Agric Food Chem 2015;63(28):6346-6354.

150

https://doi.org/10.22319/rmcp.v12i1.5455 Article

The effect of silkworm pupae and mealworm larvae meals as dietary protein components on performance indicators in rabbits

Dorota Kowalska a Janusz Strychalski b* Andrzej Gugołek b

a

National Research Institute of Animal Production. Department of Small Livestock Breeding. Balice n. Kraków, Poland. b

University of Warmia and Mazury. Faculty of Animal Bioengineering. Department of Fur-bearing Animal Breeding and Game Management. Olsztyn, Poland.

*Corresponding author: janusz.strychalski@uwm.edu.pl

Abstract: This study aimed to evaluate the effect of feeding rabbits with silkworm pupae and mealworm larvae meals on their performance indicators. Ninety (90) rabbits were divided into three groups. Control group (C) was fed with 10% soybean meal (SBM), SPM group received the diet including 5 % SBM and 4 % of silkworm pupae meal, and MLM group received the diet including 5 % SBM and 4 % of mealworm larvae meal.

The body weight of rabbits and average daily gains were determined. Feed conversion ratio (FCR) was calculated. At the end of fattening period, the animals were euthanized, skinned and eviscerated to determine their carcasses characteristic. Hind leg and loin muscles were collected for analyses of the chemical composition. At the end of fattening period, rabbits from groups SPM and MLM were heavier than C rabbits (2,606.5 and 2,584.8 vs 2,404.0 g), which also improved their overall carcass characteristic while FCR was similar between groups. However, feeding rabbits with the addition of insect's meals increased the amount of ether extract in their muscles.

Based on the results obtained, it may be concluded that SBM may be partially replaced by silkworm pupae and mealworm larvae meals in rabbit diets.

Key words: Growth performance, Mealworm larvae meal, Rabbit feeding, Silkworm pupae meal, Soybean meal substitution.

151

Rev Mex Cienc Pecu 2021;12(1):151-162

Received: 16/07/2019 Accepted: 10/01/2020

Introduction The use of different species of insects as a source of dietary protein and fat has been increasingly addressed recently. In many countries, invertebrates are a popular source of protein in compound feeds for livestock. Farm animals are fed with larvae of the black soldier fly (Hermetia illucens)(1), the house fly (Musca domestica)(2), mealworm (Tenebrio molitor)(3,4), silkworm (Bombyx mori)(5) as well as insects of the order Orthoptera, i.e. locusts and crickets(6).

In many European countries, the main source of protein for broiler rabbits is imported extracted soybean meal and, to a lesser extent, rapeseed meal and sunflower meal(7,8).

Other protein sources are also tested, such as legume seeds and DDGS(9,10,11). Literature on the use of insects in rabbit feeding is scarce, although interest in this subject has increased in recent years. As the first, the possibility of replacing soybean meal with silkworm chrysalis meal was studied(12). Recently, the possibility of adding Tenebrio molitor oil and Hermetia illucens fat to rabbit diets was explored(13,14,15). The feeding of insect meals to herbivorous animals is currently prohibited in Europe to minimize the risk of transmission of transmissible spongiform encephalopathies (TSEs). In addition, insect meals are expensive in Europe, therefore their use in animal nutrition is economically unjustified. It is worth noting, however, that Liu et al(16) consider silkworm pupae not as a treatment factor but as a normal ingredient of rabbit diets, which may be indicative of their widespread use in China. The Derwent Innovations Index database of Web of Science (accessed 31 Dec 2018), lists Chinese patents for feeding rabbits with yellow mealworm powder (four patents) and silkworm pupae 23 patents) in addition to other dietary ingredients.

It can be hypothesized that feeding growing rabbits with insect meals may be a viable alternative to soybean meal feeding. The objective of this study is to highlight the effect of feeding rabbits with silkworm pupae meal and mealworm larvae meal on their performance indicators.

152

Rev Mex Cienc Pecu 2021;12(1):151-162

Material and methods The study was carried out in Aleksandrowice located in southern Poland, Europe (50o04’53” N and 19o45’48” E). The project was approved by the local ethics committee (case no. 1192/2015).

The experimental factor was the contribution of silkworm pupae meal and mealworm larvae meal in pelleted feed mixtures. The chemical composition and energy value of these components and of the soybean meal (SBM) have been determined (Table 1). The control feed mixture (C group) contained 10 % extracted soybean meal (SBM). In the first experimental group (SPM), the diet contained 5 % SBM and 4 % of silkworm pupae meal. In the second group (MLM), the diet included 5 % soybean meal and 4 % of mealworm larvae meal (Table 2). Chemical composition and energy content of pelleted feed mixtures have been determined (Table 3).

Table 1: Chemical composition (% of DM) and measured energy content (MJ/kg) of soybean meal, silkworm pupae meal and mealworm larvae meal Soybean meal Silkworm pupae Mealworm meal larvae meal Dry matter 893.5 944.0 943.0 Crude ash 67.3 44.0 34.0 Crude protein 502.6 517.5 513.4 Ether extract 21.5 241.9 279.5 Neutral detergent fibre 150.2 64.9 114.2 Acid detergent fibre 78.4 54.9 75.9 Acid detergent lignin 39.6 24.6 12.6 Lysine 32.7 29.0 28.2 Methionine + cystine 14.1 21.3 10.7 Threonine 19.1 21.1 21.6 Tryptophan 6.6 7.1 6.1 Gross energy 16.38 23.94 22.50

153

Rev Mex Cienc Pecu 2021;12(1):151-162

Table 2: Ingredients of feed mixtures (%) Group Control 10 0 0 25 4 4 25 5 10 7 5 1 1 0.2 1.3 0.5 1 100

Soybean meal Silkworm pupae meal Mealworm larvae meal Alfalfa meal Rapeseed meal Corn DDGS1 Wheat bran Ground wheat Ground barley Dried beet pulp Arbocel2 Fodder yeast Dried whey Salt Ground limestone Feed phosphate Vitamin-mineral premix3 Total

SPM 5 4 0 25 4 4 26 5 10 7 5 1 1 0.2 1.3 0.5 1 100

MLM 5 0 4 25 4 4 26 5 10 7 5 1 1 0.2 1.3 0.5 1 100

Dried distillers’ grains with solubles.

2 Crude fibre concentrate.

3 1 kg: vit A 3 500 000 IU, vit D3 200 000 IU, vit E 28 000 mg, vit K3 200 mg, vit B1 1 500 mg, vit B2– 2 800 mg, vit B6 2 800 mg, vit B12– 20 000 mcg, folic acid 200 mg, niacin 10 000 mg, biotin 200 000 mcg, calcium pantothenate 7 000 mg, choline 30 000 mg, Fe 17 000 mg, Zn 2 000 mg, Mn 1 000 mg, Cu (copper sulfate x 5H2O, 24.5%) 800 mg, Co 1 000 mg, I 100 mg, methionine 150 g, Ca 150 g, P 100 g.

1

Table 3: Chemical composition (% of DM) and measured energy content (MJ/kg) of feed mixtures Group Control SPM MLM Dry matter 892.0 894.0 894.0 Crude ash 79.3 78.3 78.0 Crude protein 187.1 187.7 187.6 Ether extract 31.2 40.1 41.4 Neutral detergent fibre 274.6 271.3 273.0 Acid detergent fibre 154.1 153.0 153.8 Acid detergent lignin 36.1 35.5 35.0 Lysine 8.7 8.6 8.5 Methionine + cystine 5.2 5.5 5.1 Threonine 6.9 7.0 7.1 Tryptophan 2.4 2.4 2.4 Gross energy 16.86 16.95 16.94 154

Rev Mex Cienc Pecu 2021;12(1):151-162

Ninety New Zealand White (NZW) rabbits were divided into three equal groups, being analogous in terms of origin, proportion of sexes, and body weight. The experiment was carried out from September to October and started when rabbits were weaned at 35 d of age and terminated when they reached 90 d of age. Rabbits were kept in a closed experimental pavilion, in wire net flat- deck cages (0.5  0.6  0.4 m; 1 animal each), and were fed pelleted diets ad libitum. They were kept under standard conditions: temperature of 18 to 20 °C and relative air humidity of 60 to 75 %, intensive ventilation of rooms, and regulated photoperiod (16-h lighting and 8-h darkness).

The rabbits were weighed on an electronic scale on d 35, 56, 70 and 90 (n= 30). These data allowed calculating daily body weight gains (DBWG) of the rabbits and the feed conversion ratio (FCR): body weight gains (g)/feed intake (g). At the end of the production trial, after 24-h fasting, the animals were weighed and killed according to the accepted recommendations for euthanasia of experimental animals (rabbits were stunned and bled, and the whole procedure took about 2 min.). After the slaughter, the animals were skinned and eviscerated. After cooling the carcasses (for 24 h, at 4 ºC), muscle samples (hind leg and loin, n= 20) were taken for chemical analyses, and dressing percentage (DP; n= 20) was calculated as follows: DP (%) = chilled carcass weight without head and giblets (kg) / live weight (kg)  100%.

Chemical composition of feed and animal muscles was determined by AOAC(17) standard methods in duplicate samples. Dry matter content was determined in a laboratory drier, at 103 ºC. Crude ash content was estimated by sample mineralization in a muffle furnace (Czylok, Poland) at 600 ºC. Total nitrogen content was determined by the Kjeldahl method, in the FOSS TECATOR Kjeltec 2200 Auto Distillation Unit.

Ether extract content was estimated by the Soxhlet method, in the FOSS SOXTEC SYSTEM 2043. NDF (neutral detergent fibre), ADF (acid detergent fibre) and ADL (acid detergent lignin) were estimated in the FOSS TECATOR Fibertec 2010 System.

NDF was determined according to the procedure proposed by Van Soest et al(18). ADF and ADL were determined according to procedures of AOAC(17). The levels of amino acids were determined using the Biochrom 20 plus amino acid analyser and Biochrom amino acid analysis reagents (Biochrom Ltd., Cambridge, England). Gross energy content was determined using a bomb calorimeter (IKA® C2000 basic, Germany).

Data are expressed as means ± standard error of the mean (SEM). The results were processed statistically using least squares means in GLM procedures. For comparison of data, the Yijk = µ + αi + βj + αiβj + εijk model was used, where µ is the general mean, αi is the effect of diet, βj is the effect of sex, αiβj is the interaction effect between diet and sex, and εijk is the random error. The significance of the differences among groups was determined with Duncan’s multiple range test. Analyses did not reveal significant effects of sex or significant interactions between fixed effects, therefore they are not reported in the tables. Calculations were made with Statistica software(19).

155

Rev Mex Cienc Pecu 2021;12(1):151-162

Results Body weights of rabbits at 35 d were similar between groups, however, when measured at 56 d, rabbits from MLM group were heavier than rabbits from the control and SPM groups (Table 4). At 70 d, differences in body weight were noted between all three groups. The highest body weight was observed in MLM rabbits (1,954.1 g), followed

by SPM (1,883.3 g) and C rabbits (1,818.3 g). At the end of fattening period, rabbits from groups SPM and MLM were heavier than control rabbits (2,606.5 and 2,584.8 vs 2,404.0 g). Accordingly to the body weights measured, DBWG from 35 to 56 d was higher in MLM group (28.93 g/d) than in C group (22.38 g/d) and SPM group (23.31 g/d). No significant differences were observed between the groups in daily weight gains of the rabbits from 57 to 70 d. In the final fattening period, DBWG of the SPM rabbits were higher than those calculated for the other groups (36.16 g/d in SPM vs. 29.28 g/d in C and 31.53 g/d in MLM). In general, DBWG of the rabbits from 35 to 90 d were higher in SPM (33.2 g/d) and MLM groups (32.9 g/d) than in C group (only 29.6 g/d).

FCR was similar between groups and ranged from 3.62 g/g in SPM group to 3.65 g/g in C group. We did not record any losses of animals during growth period.

Table 4: Growth performance, daily body weight gains, feed conversion ratio and mortality of rabbits (mean±SEM) Group P Control SPM MLM BW 35 d, g 778.3±9.6 782.5±6.6 773.3±7.2 0.717 b b a BW 56 d, g 1,248.3±34.2 1,272.1±22.9 1,380.8±24.7 0.004 c BW 70 d, g 1,818.3±35.9 1,883.3±10.3b 1,954.1±35.3a 0.010 BW 90 d, g 2,404.0±27.2b 2,606.5±23.1a 2,584.8±21.5a ˂0.001 DBWG 35-56, g/d 22.38±3.62b 23.31±3.80b 28.93±3.97a 0.026 DBWG 57-70, g/d 40.71±5.03 43.66±5.29 40.95±5.12 0.288 b a b DBWG 71-90, g/d 29.28±4.71 36.16±4.42 31.53±4.85 0.006 b a a DBWG 35-90, g/d 29.6±1.4 33.2±1.4 32.9±1.5 <0.001 FCR, g/g 3.65±0.11 3.62±0.10 3.64±0.11 0.698 Mortality, % 0 0 0 1.000 SEM= standard error of the mean; BW= body weight; DBWG= daily body weight gains; FCR= feed conversion ratio. a,b,c Values with different superscripts are significantly different at P<0.05.

Hot carcass weight with head differed between the groups and ranged from 1,437.7 g in SPM group to 1,356.0 g in MLM group and 1,270.8 g in the control group, where rabbits were fed without silkworm and mealworm larvae (Table 5). SPM group was characterized by higher dressing percentage compared to C and MLM groups (59.88 % vs 57.67 % and 57.49 %). Weights of livers ranged from 74.33 g in C group to 79.83 g in MLM group, however, differences in this feature were not statistically significant. No significant differences were observed between the groups in the weights of digestive 156

Rev Mex Cienc Pecu 2021;12(1):151-162

tract. There were no differences in the amount of inguinal, shoulder and perirenal fat, either. Carcass muscle weight was higher in SPM and MLM groups compared to C group (1,092.5 g and 10,56.7 g vs 914.9 g).

Table 5: Carcass characteristic of rabbits (mean±SEM) Group Control SPM MLM Hot carcass weight with 1,270.8±17.1c 1,437.7±22.6a 1,356.0±17.3b head, g Dressing percentage 57.67±0.30b 59.88±0.61a 57.49±0.036b Liver weight, g 74.33±3.85 76.00±1.29 79.83±3.00 Weight of heart, kidneys and 42.50±2.81 43.33±1.54 44.16±2.01 lungs, g Weight of digestive tract, g 424.16±10.11 477.16±26.88 498.33±22.38 Weight of inguinal fat, g 4.66±0.84 4.33±0.49 4.83±0.40 Weight of shoulder fat, g 12.50±1.78 11.67±0.61 12.33±0.92 Weight of perirenal fat, g 14.16±1.53 15.66±2.78 15.83±1.53 b a Carcass muscle weight, g 914.9±17.1 1092.5±45.2 1056.7±14.5a a,b,c

P ˂0.001 0.002 0.165 0.853 0.064 0.841 0.212 0.188 0.001

SEM= standard error of the mean.

Values with different superscripts are significantly different at P<0.05.

Analysis of the basic chemical composition of hind leg and loin muscles revealed no between-group differences in the amount of dry matter, ash and crude protein (Table 6).

Protein content in hind leg muscles ranged from 21.85 % in the control rabbits to 22.10 % in rabbits supplemented with silkworm pupae meal. Protein content in loin muscles was slightly higher and varied from 22.95 % in MLM group to 23.37 % in SPM group.

Crude ash content ranged from 1.19 to 1.21 % in hind leg muscles and from 1.22 to 1.25 % in loin. Proportion of ether extract in hind leg muscles did not differ significantly between groups, however, a tendency towards a higher share of this compound in the experimental groups than in the control group was observed (2.06 % in SPM and 2.25 % in MLM groups vs 1.72 % in C group). In turn, in loin muscles, content of ether extract was significantly higher in rabbits belonging to MLM group than in those from C group (1.90 vs 1.22 %).

157

Rev Mex Cienc Pecu 2021;12(1):151-162

Table 6: Proximate chemical composition (% of fresh matter) of hind leg and loin muscles of rabbits (mean±SEM) Group P Control SPM MLM Hind leg muscles Dry matter 23.84±0.17 24.51±0.27 24.42±0.30 0.161 Crude ash 1.20±0.01 1.19±0.01 1.21±0.01 0.192 Crude protein 21.85±0.15 22.10±0.17 21.88±0.10 0.442 Ether extract 1.72±0.12 2.06±0.20 2.25±0.30 0.061 Loin muscles Dry matter 25.28±0.26 24.90±0.16 24.87±0.17 0.304 Crude ash 1.23±0.02 1.22±0.01 1.25±0.01 0.525 Crude protein 22.98±0.20 23.37±0.16 22.95±0.20 0.246 b a a Ether extract 1.22±0.06 1.37±0.10 1.90±0.37 0.038 a,b

SEM= standard error of the mean.

Values with different superscripts are significantly different at P<0.05.

Discussion The control diet contained 10 % of SB, and the experimental diets (SPM and MLM) contained 5 % of soybean meal, and 4 % of silkworm pupae or 4 % of mealworm larvae meals, respectively. It was found that partial replacement of soybean meal with the experimental components improved the weight gains and body weights of rabbits, but had no effect on FCR. These results correspond with the ether extract content and energy value of the diets. However, the higher proportion of ether extract in the diets with insect meals, especially with mealworm larvae, increased the share of this compound in rabbit's muscles.

Similar results to ours, in terms of the body weights of NZW rabbits, were observed earlier(20). Similar DBWG in NZW rabbits, although calculated for the age range of 3080 d, were also reported(21). NZW rabbits involved in this experiment belongs to the average productive genetic line. Although they grow slightly more rapidly than equally popular California broiler rabbits(22), commercially bred hybrid rabbits may reach over 3000 g on d 84 of age(8,23).

The protein content was determined to be 187.1 g/kg in the control diet and 187.7 g/kg and 187.6 g/kg in the experimental diets. However, both silkworm pupae and mealworm larvae contain chitin. It is a polysaccharide composed of acetylglucosamine (N-acetylD-glucose-2-amine) mers. The nitrogen in mers increases the level of protein in laboratory analyses. Silkworm pupae contain 3-4% chitin(24). Chitin content in mealworm larvae is around 5 %(25). It may reduce nutrient digestibility(26), but the 158

Rev Mex Cienc Pecu 2021;12(1):151-162

present experiment showed that chitin had no adverse effect on FCR. It is worth mentioning that chitin may have health beneficial properties. Chitin is not degraded in the small intestine and it can be fermented by the microbiota of the large intestine. It is suggested that chitin may restore the compositional balance of the microbial community. In addition, chitin, or derivate, seems to exhibit anti-viral, anti-tumour, antifungal activities and antimicrobial properties and a bacteriostatic effect on pathogenic bacteria(26).

The range of DP obtained in this study was higher than that reported by other Polish authors(20,27). Particular attention should be given to liver weight, the high value of which may suggest that the diet places an excessive burden on the animal’s body.

Certain between-group differences were observed in liver weights of the rabbits (ranging from 74.33 g in C group to 79.83 g in MLM group), but within-group differences were too high to show a significant effect of the diet on liver weight. The analysis of liver weight against carcass weight shows the ratios of 5.85 %, 5.29 % and 5.89 % for successive rabbit groups (data not shown in table). Because the highest liver weight in MLM rabbits corresponds with the amount of dietary fat and the amount of carcass fat, at this stage it is difficult to conclude whether mealworm larvae added to the diet have a negative impact on the health of rabbits. This aspect should be continuously investigated in future, more extensive research. It is of interest to note, however, that in a previous experiment performed in the same pavilion with the same line of NZW rabbits, rabbits fed with 5% of corn DDGS had an average liver weight of 95.8 g(20).

The obtained content of dry matter, protein, ash and ether extract in meat is characteristic of broiler rabbits. Similar protein and ash contents of rabbit meat to those observed in the present study were also reported by other authors(27,28,29). Intramuscular fat is one of the major determinants of sensory meat quality. The amounts of fat obtained in our study seem typical for NZW rabbits, which are slaughtered at around 90 days of age. It should be noted, however, that use of insect's meals in rabbits feeding increased the amount of ether extract in their muscles. Lower ranges of fat (0.27 to 0.33 %) were noted by Daszkiewicz et al(27), whereas Chełmińska and Kowalska(20) found fat content to be 2.31 % in the control group, 3.72 % in the group receiving 5 % of DDGS, and as much as 4.94 % in the group fed with 10 % of DDGS.

Conclusions and implications Partial replacement of soybean meal with silkworm pupae and mealworm larvae meals in rabbit diets may improve the body weight and body weight gains of rabbits, together with some carcass characteristic, without influencing FCR. The use of insects as a source of feed for rabbits neither has an effect on the content of dry matter, crude protein and crude ash, but increases the amount of ether extract in their muscles.

159

Rev Mex Cienc Pecu 2021;12(1):151-162

Literature cited: 1.

Diener S, Zurbrügg C, Roa Gutiérrez F, Nguyen DH, Morel A, Koottatep T, Tockner K. Black soldier fly larvae for organic waste treatment – prospects and constraints. Proc 2nd International Conference on Solid Waste Management in the Developing Countries, Khulna, Bangladesh. 2011:52-59.

2.

Calvert CC, Martin RD, Morgan NO. Housefly pupae as food for poultry. J Econ Entomol 1969;62(4):938-939.

3.

Klasing KC, Thacker P, Lopez MA, Calvert CC. Increasing the calcium content of mealworms (Tenebrio molitor) to improve their nutritional value for bone mineralization of growing chicks. J Zoo Wild Medic 2000;31(4):512-517.

4.

Bovera F, Loponte R, Marono S, Piccolo G, Parisi G, Iaconisi V, Gasco L, Nizza A. Use of larvae meal as protein source in broiler diet: Effect on growth performance, nutrient digestibility, and carcass and meat traits. J Anim Sci 2016;94(2):639-647.

5.

Donatti FC. Utilization of silkworm pupae meal (Bombyx mori L.) as a source of protein in the diet of growing-finishing pigs. R Soc Bras Zootec 1992;21(3):378383.

6.

Kierończyk B, Rawski M, Józefiak A, Mazurkiewicz J, Świątkiewicz S, Siwek M, et al. Effects of replacing soybean oil with selected insect fats on broilers. Anim Feed Sci Technol 2018;240:170-183.

7.

Matusevicius P, Zduńczyk Z, Juśkiewicz J, Jeroch H. Rapeseed meal as a partial replacement for sunflower meal in diets for growing rabbits – gastrointestinal tract response and growth performance. Europ Poult Sci 2014;78:1-11.

8.

Gugołek A, Juśkiewicz J, Wyczling P, Kowalska D, Strychalski J, Konstantynowicz M, Zwoliński C. Productivity results and physiological response of the gastrointestinal tract of rabbits fed diets containing rapeseed cake and wheat distillers dried grains with solubles. Anim Prod Sci 2015;55:777-785.

9.

Volek Z, Volková L, Marounek M. Effect of a diet containing white lupin hulls (Lupinus albus cv. Amiga) on total tract apparent digestibility of nutrients and growth performance of rabbits. World Rabbit Sci 2013;21:17-21.

10. Strychalski J, Juśkiewicz J, Gugołek A, Wyczling P, Daszkiewicz T, Zwoliński C. Usability of rapeseed cake and wheat-dried distillers’ grains with solubles in the feeding of growing Californian rabbits. Archiv Anim Nutr 2014;68:227-244.

160

Rev Mex Cienc Pecu 2021;12(1):151-162

11. Zwoliński C, Gugołek A, Strychalski J, Kowalska D, Chwastowska-Siwiecka I, Konstantynowicz M. The effect of substitution of soybean meal with a mixture of rapeseed meal, white lupin grain, and pea grain on performance indicators, nutrient digestibility, and nitrogen retention in Popielno White rabbits. J Appl Anim Res 2017;45:570-576.

12. Carregal RD, Takahashi R. Use of silkworm (Bombyx mori L.) chrysalis meal as a replacement for soyabean meal in the feeding of growing rabbits. R Soc Bras Zootec 1987;16(2):158-162.

13. Gasco L, Dabbou S, Meneguz M, Trocino A, Xiccato G, Capucchio MT, et al.

Effect of dietary supplementation with insect fats on growth performance, digestive efficiency and health of rabbits. J Anim Sci Biotech 2019;10:4.

14. Dalle Zotte A, Cullere M, Martins C, Alves SP, Freire JPB, Falcão-e-Cunha L, Bessa RJB. Incorporation of Black Soldier Fly (Hermetia illucens L.) larvae fat or extruded linseed in diets of growing rabbits and their effects on meat quality traits including detailed fatty acid composition. Meat Sci 2018;146:50-58.

15. Martins C, Cullere M, Dalle Zotte A, Cardoso C, Alves SP, Branquinho de Bessa RJ, Bengala FJP, Falcão-e-Cunha L. Incorporation of two levels of black soldier fly (Hermetia illucens L.) larvae fat or extruded linseed in diets of growing rabbits: effects on growth performance and diet digestibility. Czech J Anim Sci 2018;63:356-362.

16. Liu ML, Tang LM, Yan JP, Liu YG. Effects of concentrated rapeseed protein on growing rabbits. J Sichuan Agric Univ 1987;2:20-22.

17. AOAC. Association of Official Analytical Chemists. Official methods of analysis.

18th ed. Arlington (VA): Association of Analytical Communities. 2006.

18. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74:3583-3597.

19. StatSoft®. Statistica (data analysis software system), version 10. 2011. Available in: www.statsoft.com.

20. Chełmińska A, Kowalska D. The effectiveness of maize DDGS in rabbit diets. Ann Anim Sci 2013;13:571-585.

21. Cardinali R, Cullere M, Dal Bosco A, Mugnai C, Ruggeri S, Mattioli S, Castellini C, Trabalza Marinucci M, Dalle Zotte A. Oregano, rosemary and vitamin E dietary supplementation in growing rabbits: Effect on growth performance, carcass traits, bone development and meat chemical composition. Livest Sci 2015;175:83-89.

161

Rev Mex Cienc Pecu 2021;12(1):151-162

22. Strychalski J, Gugołek A, Daszkiewicz T, Konstantynowicz M, Kędzior I, Zwoliński C. A comparison of selected performance indicators, nutrient digestibility and nitrogen balance parameters in Californian and Flemish Giant rabbits. J Appl Anim Res 2014b;42:389-394.

23. Dänicke S, Ahrens P, Strobel E, Brettschneider J, Wicke M, von Lengerken G. Effects of feeding rapeseed to fattening rabbits on performance, thyroid hormone status, fatty acid composition of meat and other meat quality traits. Arch Geflügelkd 2004;68:15-24.

24. Suresh HN, Mahalingam CA, Pallavi. Amount of chitin, chitosan and chitosan based on chitin weight in pure races of multivoltine and bivoltine silkworm pupae Bombyx mori L. Int J Sci Nat 2012;3(1):214-216.

25. Song Z, Li G, Guan F, Liu W. Application of chitin/chitosan and their derivatives in the papermaking industry. Polymers 2018;10(4):389.

26. Piccolo G, Iaconisi V, Marono S, Gasco L, Loponte R, Nizza S, Bovera F, Parisi G. Effect of Tenebrio molitor larvae meal on growth performance, in vivo nutrients digestibility, somatic and marketable indexes of gilthead sea bream (Sparus aurata). Anim Feed Sci Technol 2017;226:12-20.

27. Daszkiewicz T, Gugołek A, Janiszewski P, Kubiak D, Czoik M. The effect of intensive and extensive production systems on carcass quality in New Zealand White rabbits. World Rabbit Sci 2012;20(1):25-32.

28. Dal Bosco A, Castellini C, Mugnai C. Rearing rabbits on a wire net floor or straw litter: behaviour, growth and meat qualitative traits. Livest Prod Sci 2002;75:149156.

29. Maj D, Bieniek J, Łapa P. Meat quality of New Zealand White and Californian rabbits and their crosses. Med Wet 2008;64:351-353.

162

https://doi.org/10.22319/rmcp.v12i1.5273 Article

Evaluation of productive indicators in goat herds vaccinated with RB51– SOD, RB51 (Brucella abortus) and Rev-1 (Brucella melitensis) strains

Baldomero Molina-Sánchez a David Izcoatl Martínez-Herrera a* Violeta Trinidad Pardío-Sedas a Ricardo Flores-Castro b José A. Villagómez-Cortés a José F. Morales-Álvarez c

a

Universidad Veracruzana. Facultad de Medicina Veterinaria y Zootecnia. Av. Miguel Ángel de Quevedo s/n, esq. Yáñez, Col. Unidad Veracruzana, 91710, Veracruz, Veracruz, México. b

Laboratorios Tornel, S.A. de C.V., Naucalpan de Juárez, Estado de México, México.

c

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad (CENID-SAI), Ciudad de México, México.

*Corresponding author: dmartinez@uv.mx

Abstract: Kidding rates, miscarriages and births of weak offspring were determined in herds vaccinated with the RB51-SOD (B. abortus) strain in order to evaluate the productive improvement and compare it with Rev-1 (B. melitensis) and RB51 (B. abortus) vaccines. Three subgroups of 36 goats each were vaccinated with Rev-1 (1-2x109 CFU), RB51 (3x108-3x109 CFU) and RB51-SOD (3x108-3x109 CFU) strains, with each strain having a control subgroup.

Individual records were established for calculating post-vaccination rates in two kidding seasons. In the first, the kidding rate for Rev-1 was 66.6 % (95%CI: 48.9-80.9), RB51

163

Rev Mex Cienc Pecu 2021;12(1):163-176

50.0 % (95%CI:33.2-66.7), and RB51-SOD 69.4 % (95%CI:51.7-83.0). Miscarriages occurred in all three vaccinated subgroups, Rev-1 and RB51-SOD 5.5 % (95%CI: 0.9-20.0) and RB51 2.7 % (95%CI: 0.1-16.2). Weak offspring births occurred only in animals vaccinated with Rev-1 5.5 % (95%CI: 0.9-20.0). During the second epoch, the kidding rate in Rev-1 vaccinated females was 91.6 % (95% CI:76.4-97.8), RB51 94.4 % (95% CI:79.999.0), and RB51-SOD 94.4 % (95% CI:79.9-99.0). Animals vaccinated with Rev-1 and RB51 strains had 5.5 % (95%CI: 0.9-20.0) and 2.7 % (95%CI: 0.1-16.2) miscarriages, respectively; in vaccinated subgroups there were no births of weak offspring. The control subgroups behaved similarly to the vaccinated subgroups. Animals vaccinated with the RB51-SOD strain showed no significant difference from those that received the Rev-1 and RB51 strains, nor from the control subgroups (P>0.01); therefore, the RB51-SOD vaccine can generate protection against brucellosis and benefits in the production of goat herds.

Key words: Vaccination, Abortions, Brucellosis, Goats, RB51- SOD.

Received: 21/02/2019 Accepted: 13/12/2019

Introduction Brucellosis is an emerging and globally distributed disease that is considered among the 10 zoonoses neglected by health authorities(1,2). From an economic point of view, it is important because of the effects it has on animal production units, as well as the risk it poses for the human population.(3). Goat producers state that the activity presents technological and sanitary lags, and highlight the persistence of goat brucellosis, which reduces productivity, lowers milk quality and represents a risk of infection for humans(4). Bacteria of the genus Brucella cause the disease; the most virulent species are Brucella melitensis and Brucella abortus, responsible for the disease in small ruminants and cattle, respectively(5). The clinical manifestation of infection in pregnant animals includes miscarriage, birth of offspring that die in peripartum, and arthritis(6,7). In affected goat herds, low productive efficiency is observed due to the infertility caused in infected animals; miscarriages increase by up to 20%, and the productive capacity of sick females decreases by up to 30%(8,9).

The low kidding rate is the result of miscarriages that occur due to sanitary conditions, including the persistent prevalence of brucellosis and severe nutritional restriction during gestation(10-13). In herds infected with brucellosis, vaccination, diagnosis and selective slaughter of animals are alternatives for the control or eradication of the disease(2). Currently,

164

Rev Mex Cienc Pecu 2021;12(1):163-176

the Rev-1 strain of Brucella melitensis is a modified live strain used to control the infection in sheep and goats. However, it has limitations, such as the ability to induce abortionin pregnant females, be excreted into the milk, infect humans, and potentially be resistant to streptomycin, an antibiotic that, in combination with doxycycline, is the most effective treatment for brucellosis in humans(12,14,15).

Brucella abortus strain RB51 is used for the control of brucellosis in cattle and has been evaluated in small ruminants under controlled conditions with good protection against experimental challenge with B. melitensis(14). There is information that sustains that the protection conferred is lower than that obtained with the Rev-1 strain and that it causes miscarriages and stillbirths in goats(14). However, it has the advantage of not producing postvaccination diagnostic interference, compared to conventional serology(16,17,18).

DNA plasmid vaccines have the potential to be the future for brucellosis control.

Homologous overexpression strains have been evaluated to induce an immune response.

Overexpression of Cu/Zn SOD (superoxide dismutase), which is a periplasmic protein that has developed protection, in murine models, against experimental infection with virulent B. abortus strain 2308 has been shown to achieve protection equal to that induced by RB51 (B. abortus)(16,19). Oñate et a.(19) evaluated the SOD strain in cattle and obtained antibody response and Th-1 type MIC, and protection against B. abortus challenge. Further studies are required to know the role of different types of T cells in the protection induced by vaccination with pcDNA-SOD and its results in productive systems(19-22). Immune response and vaccine efficacy may differ between laboratory animals and susceptible ruminants(22). Because there is a lack of information on the use of the RB51 - SOD strain in domestic animals, its effects and benefits, as well as its safety in preventing abortion induction by effect of the vaccine and protection for the improvement of production in goat herds. The objective of this study was to determine farrowing rates, miscarriages and births of weak offspring in herds vaccinated with the RB51-SOD strain (Brucella abortus) in order to evaluate the productive improvement and compare it with that obtained when using the Rev-1 (Brucella melitensis) and RB51 (Brucella abortus) vaccines.

Material and methods Study area The study was conducted in goat production units in the community of Xaltepec in the municipality of Perote, located in the central zone of the state of Veracruz, Mexico. The community is located at the coordinates 97°21'22.21.21'' W and 19°22'50.06.06'' N, and at

165

Rev Mex Cienc Pecu 2021;12(1):163-176

an altitude of 2,358 masl, and it borders the state of Puebla; its climate is cold and dry, with an average annual temperature of 12 ºC and an average annual rainfall of 493.6 mm(23).

The main livestock activity is goat and sheep production, under a semi-stabled system where the owners and family members tend to the animals. The herds are composed of an average of 64 goats, most of which graze communal land. During the peak fodder-production season, some producers confine them in order to use the agricultural residues produced in the area.

The main production is milk for cheese production, and meat through the sale of kids at weaning and of cull females(24).

Study type and sample size The study was a Phase III clinical trial conducted from September 2016 to March 2018 to evaluate farrowing rates, miscarriages, and weak offspring births in brucellosis-positive goat herds vaccinated with Brucella abortus RB51-SOD, Brucella abortus RB51, and Brucella melitensis Rev-1 strains. The sample size was estimated using the Win Episcope Ver. 2.0 program, a prevalence of 0.52 % in goats having been found in a previous study in that area of Veracruz(24), with a 95% confidence interval and an error of 5%. The minimum sample size was 72 goats for each treatment group (strain); each block consisted of a vaccinated subgroup (36) and a control subgroup (36). Each group studied consisted of goats aged over three months that tested seronegative for brucellosis and had never been vaccinated. The brucellosis-seropositive animals identified during an initial sampling performed prior to vaccination to determine seropositive animals were kept in the herds in order to undergo permanent exposure along with the susceptible animals. The animals in each group were identified with metal earrings in the left ear.

The research protocol was reviewed and approved by the Bioethics Commission of the Faculty of Veterinary Medicine and Animal Husbandry of Universidad Veracruzana.

Vaccination Animals in the vaccinated subgroups of each group were administered 2 ml of vaccine subcutaneously on the left side of the middle third of the neck. The first group received the Rev-1 strain of Brucella melitensis at doses of 1 – 2x109 CFU; the second group received the RB51 strain of Brucella abortus at doses of 3x108 to 3x109 CFU; and the third group received the RB51-SOD strain of Brucella abortus at doses of 3x108 to 3x109 CFU. The latter vaccine was imported for research purposes by the National Center for Disciplinary Research in Animal Health and Safety (Centro Nacional de Investigación Disciplinaria en Salud Animal

166

Rev Mex Cienc Pecu 2021;12(1):163-176

e Inocuidad, CENID-SAI) of the National Institute for Research on Forestry, Agriculture and Livestock (Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, INIFAP) and was provided by Dr. Gerhardt Shurig, of the Virginia Polytechnic Institute and State University. Each vaccinated subgroup had its control subgroup, i.e. animals that received 2 ml of physiological saline solution subcutaneously in the left side of the middle third of the neck as a placebo.

Tracking of individual records Individual records were kept for each of the animals in the sample, in accordance with INIFAP's recommendations for the reproductive management of goats on pasture(25), in order to record the dates of births, miscarriages and issues during gestation. Gestation, parturition and abortion rates were calculated to determine the initial situation of the herds, considered as baseline information for the study. Likewise, the animals in the sample were monitored daily for two parturition periods, in order to determine post-vaccination behavior, as well as for indicators such as parturition, miscarriages and births of weak offspring; the dates corresponded to the seasonal kidding periods defined in the herds (October - February)

Calculation of kidding rates, miscarriages and births of weak offspring Kidding rates, miscarriages and births of weak offspring in the three groups were integrated by using the information included in the individual records. Differences between groups and the significance of association were estimated based on categorical data analysis (Chi2) and the degree of association by Relative Risk (RR)(26).

Results Table 1 shows the productive indicators identified in the goat herds in the community of Xaltepec, in the municipality of Perote, prior to vaccination of the animals with the experimental strains, comprising 529 head of goats. The average gestation, kidding and abortion rates were 69.2, 95.2 and 2.7 %, respectively; this information was considered as a baseline for the herds under study. The herds utilized had an overall prevalence of brucellosis confirmed by the radial immunodiffusion test (RID) of 1.2% (95%CI: 0.5- 2.7)(27).

167

Rev Mex Cienc Pecu 2021;12(1):163-176

Table 1: Inventory and reproductive indicators in herds in the community of Xaltepec, Perote, Veracruz, Mexico, prior to vaccination Rate Inventory Strain (animals) Pregnancy Births Abortions Rev – 1 134 67.5 96.5 2.0 RB51 192 69.0 95.6 3.0 RB51– SOD 203 71.3 93.6 3.3 Total 529 Average 69.2 95.2 2.7

After vaccination, production indicators were evaluated in the herds during two kidding seasons. Table 2 shows the rates for kidding, abortions and births of weak offspring during the first kidding period, and it may be observed that the vaccinated subgroups had a similar behavior in relation to kidding and abortion rates. However, in the animals vaccinated with the Rev-1 strain, there was a rate of 5.5 % percentage (95%CI: 0.9 - 20.0) of weak offspring births, but in the subgroups vaccinated with the RB51 and RB51-SOD strains this condition did not occur. The control subgroups showed similar behavior to the vaccinated subgroups.

Table 3 shows the relative risk (RR) and Chi2 for births, abortions and weak-kids born in the first post-vaccination kidding period and shows that there was no significant difference (P>0.01) between vaccinated and control subgroups.

Table 2: Production indicators during the first kidding period in goat flocks vaccinated with different strains in the community of Xaltepec, Perote, Veracruz, Mexico Births Strains Group

No. % Vaccinated 36 24

66.6

Control

36 22

61.1

Vaccinated 36 18

50.0

Control

36 21

58.3

Vaccinated 36 25

69.4

Control

66.6

Rev 1

RB51

RB51 – SOD

Abortions

Weak offspring

No.

% (95% CI)

No. %

(95% CI)

2

5.5

2

5.5

0.9 20.0

1

2.7

0

0.0 0.0

1

2.7

0

0.0 0.0

1

2.7

0

0.0 0.0

2

5.5

0

0.0 0.0

1

2.7

0

0.0 0.0

N

36 24

(95% CI) 48.9 80.9 43.5 76.3 33.2 66.7 40.8 74.0 51.7 83.0 48.9 80.9

– – – – – –

168

0.9 20.0 0.1 16.2 0.1 16.2 0.1 16.2 0.9 20.0 0.1 16.2

– – – – – –

–

Rev Mex Cienc Pecu 2021;12(1):163-176

Table 3: Relative Risk and Chi2 values of births, abortions and births of weak offspring from the first post-vaccination kidding period Strain Rev 1 RB51 RB51– SOD

Births

Abortions

Weak offspring

RR

(IC95%)

Chi2

RR

(IC95%)

0.4 0.4

0.1 – 1.3 2.68 0.1 – 2.0 1.42

2.0 1.0

0.5

0.1 – 2.6 0.73

2.0

Chi2

Chi2

RR

(IC95%)

0.2 – 21.1 0.4 0.1 – 15.4 0.0

0.9 0.0

0.1 – 2.9 0.4 0.0 0.0

0.2 – 21.1 0.4

0.0

0.0

0.0

(P<0.01).

In the second kidding period, the performance of the productive indicators of the vaccinated females and the control subgroups was evaluated as shown in Table 4, where it is observed that the vaccinated subgroups improved the indicator in relation to the kidding rate compared to the first kidding period. Miscarriages occurred only in animals vaccinated with the Rev-1 strain and in their control group, 2.7 % (95%CI: 0.1-16.2) and 5.5 % (95%CI: 0.9-20.0), respectively. Animals vaccinated with the RB51 and RB51-SOD strains had no abortions; however, the RB51 strain control group had a rate of 2.7 % (95%CI: 0.1-16.2). In the three vaccinated subgroups, as well as in the controls, there were no cases of birth of weak offspring. In Table 5, the statistical analysis of these results reveals that there is no significant difference between vaccinated subgroups and controls (P>0.01).

Table 4: Production indicators during the second kidding period in goat flocks vaccinated with different strains Births Strain Rev 1 RB51 RB51 – SOD

Group Vaccinated Control Vaccinated Control Vaccinated Control

Abortions

Weak offspring

N 36 36 36 36 36 36

N

%

(95% CI)

N

%

(95% CI)

N

%

(95%CI)

33 28 34 31 34 32

91.6 77.7 94.4 86.1 94.4 88.8

76.4 – 97.8 60.4 – 89.2 79.9 – 99.0 69.7 – 94.7 79.9 – 99.0 73.0 – 96.3

1 2 0 1 0 0

2.7 5.5 0.0 2.7 0.0 0.0

0.1 – 16.2 0.9 – 20.0 0.0 0.1 – 16.2 0.0 0.0

0 0 0 0 0 0

0.0 0.0 0.0 0.0 0.0 0.0

0.0 0.0 0.0 0.0 0.0 0.0

169

Rev Mex Cienc Pecu 2021;12(1):163-176

Table 5: Relative Risk (RR) and Chi2 values for parturitions, abortions and weak-born kids of the second post-vaccination parturition period Strain Rev 1 RB51 RB51– SOD

Births

Abortions RR

(95% CI)

Chi2

RR

(95% CI)

Chi2

0.1 – 1.3 2.7 0.1 – 1.9 1.4

0.5 0.0

0.1 – 5.3 0.0

0.4 0.0

0.0 0.0

0.0 0.0

0.0 0.0

0.1 – 2.6 0.7

0.0

0.0

0.4

0.0

0.0

0.0

RR

(95% CI)

0.3 0.4 0.5

Chi2

Weak offspring

(P>0.01).

Discussion In the flocks of the experiment, the animals that tested seropositive to the confirmatory serological test of radial immunodiffusion (RID) for brucellosis diagnosis, remained in their herds of origin during the whole period of the study, in order to allow the natural, direct challenge of vaccinated animals and controls in the flocks that had an overall seroprevalence of 1.2 % (95%CI: 0.5 - 2.7)(27). This value is higher than the general average of 0.52 % (95%CI: 0.1 - 1.6) found in 14 municipalities in the central zone of the state of Veracruz and the 0.05 % reported by SENASICA at the national level in goat flocks(24). Exposure of vaccinated females within infected herds allows challenging the protection conferred under natural conditions; in this study, the challenge to the field strain by the experimental animals was assessed through seroprevalence confirmed with the SRD test(27). For the challenge of experimental herds in field conditions, it is necessary to consider the seroprevalence of the disease detected with more specific (confirmatory) tests; otherwise, the challenge of vaccinated herds with seropositive animals is not guaranteed. This is because when using only a screening test, there is the possibility of having false positive animals considered as infected. In this case, the seropositivity may be due to the window generated by the seroconversion as a consequence of vaccination with strains that have this characteristic in those animals, or even of cross-reactions with other microorganisms, and therefore may hinder correct discrimination between infected and merely reactive animals(16,17).

Table 1 shows the farrowing and abortion rates, which average 96.6 % and 1.8 %, respectively. This behavior is similar to that reported by other researchers in goat farming in the states of Oaxaca and Nuevo León, located in the two regions that account for 70.2 % of the national goat inventory(4,28). However, herds characterized as under pasture conditions in the country have a gestation rate of less than 65 %, as a result of abortions, poor sanitary conditions and severe nutritional restriction during pregnancy(11). Comparison between the results of the vaccinated subgroups and controls with the indicators observed in the present

170

Rev Mex Cienc Pecu 2021;12(1):163-176

study in the Xaltepec goat farm shows that it is not sufficient to establish vaccination programs to prevent or control diseases such as brucellosis: adequate feeding according to the breed characteristics of the animals that make up the herd and the production system must be also included in order to improve their productivity. In addition, the improvement in the indicators of kidding, abortions or births of healthy offspring in the first post-vaccination kidding period cannot be attributed exclusively to vaccination(11,13).

During the first post-vaccination kidding period, the kidding rate in all groups that were part of the clinical trial, both vaccinated and controls, was lower compared to the initial indicators, because not all females in the experiment entered mating, possibly due to their age, poor body condition and nutritional status ―a situation that coincides with the effects of malnutrition during development and early postnatal life-, since this causes permanent and irreversible effects during puberty, as well as in the adult life of smaller ruminants(13).

Abortions occurred in both subgroups of animals vaccinated with Rev-1 (B. melitensis) and RB51-SOD (B. abortus) strains. In the control subgroups, abortions also occurred, at a rate of 2.7 % (95%CI: 0.1 - 16.2). When comparing between the vaccinated and control groups, no significant difference was found (P<0.01).

Birth of weak offspring occurred only in two females that were vaccinated with the Rev-1 strain; this is a condition that can occur in the offspring of brucellosis-infected animals ―a situation that coincides with the results of serology performed by the SDR test, where two females had positive serology(6,27). Fetal losses and miscarriages in goat herds are the main reproductive issue, which is caused not only by infectious agents but also by nutritional stress in goats(11). In addition, malnutrition affects animals exposed to vaccine or field strains by preventing the animal from producing antibodies that can be measured by conventional serological tests, or from establishing protection against the causal agent(29-33).

During the second kidding period after vaccination, the kidding rates observed in the three groups exhibited similar behavior. However, abortions occurred in the Rev-1 vaccine and control subgroups, 5.5 % (95%CI: 0.9 - 20.0) and in the RB51 control subgroup, 2.7 % (95%CI: 0.1 - 16.2). No vaccinated subgroup gave birth to weak offspring. Statistical analysis showed that there was no significant difference (P<0.01). It should be noted that vaccination status is not associated with the presence of abortion. Villa et al(17) conducted the evaluation of vaccines for the control of brucellosis and found that the RB51 strain (B. abortus) had a abortion rate of 74.2 %, which is considered high, in addition to presenting the highest relative risk of abortion, compared to the results of other studies in which goats and pregnant sheep were vaccinated with this strain and abortion rates of less than 10 % were found(29,31,33).

Therefore, this vaccine is not recommended for use in goats. However, this information differs from the findings of this study in the community of Xaltepec, since, according to other studies, its application in small ruminants can cause up to 1% of abortions in susceptible females due to vaccine effect(31). Thus, it is advisable to vaccinate females older than three 171

Rev Mex Cienc Pecu 2021;12(1):163-176

months and not pregnant, a condition that must be met in order to avoid the risk of abortion due to vaccine effect ―a situation that some countries have established as a rule in order to avoid economic losses(18). The RB51 vaccine strain (B. abortus) is authorized for use in Mexico only for the bovine species. However, in 2005, the health authority registered a vaccine with these characteristics for use in goats(34) and it agrees with this study in that the strain is safe because it did not produce abortion in the females of the corresponding subgroup in the community of Xaltepec.

There is information indicating that up to 2 % of abortions may occur in susceptible females due to the effect of vaccination(14,31). However, it is important to consider that there are factors specific to each susceptible individual, such as age, sex, reproductive status, immune and nutritional condition, as well as the agent, which alter the development of the protection generated by the vaccine and, in general, the protection conferred by vaccines against brucellosis, which ranges between 85 and 90 %(30,32,35). The birth of weak offspring that die during the peripartum is a condition that can occur in the offspring of brucellosis-infected animals; this agrees with the results of a serology performed using the SDR test, where two females tested positive(6,27).

The Rev-1 (B. melitensis) and RB51 (B. abortus) strains have been evaluated for their protection and side effects in vaccinated animals. Today, DNA plasmid vaccines have been developed that offer an alternative to homologous overexpression vaccines such as the RB51SOD (CU/Zn) strain used in this study, which in murine models shows better protection against B. abortus than that established by RB51(19) and is considered one of the DNA vaccines that demonstrate the capacity to produce cellular and humoral immunity and a certain degree of protective immunity(16,31,33). In cattle, it suggests the production of antibodies and Th-1 type MICs, and generates protection in vaccinated animals when challenged with B. abortus(19). When evaluating the behavior of the RB51 - SOD strain in the field in goat herds with seroprevalences of 1.2 % (95%CI: 0.5 - 2.7), the animals vaccinated with this strain did not present abortion, nor births of weak offspring. It is important to point out that according to published results, animals vaccinated with this strain do not seroconvert to conventional tests at 90 d post-vaccination, and therefore do not generate diagnostic confusion(27).

Regarding the effect on increased kid births, there was no significant difference (P<0.01) between goats vaccinated with the Rev-1 (B. melitensis) and those administered the RB51 (B. abortus) strains. Olsen et al(24), when evaluating the RB51-SOD strain in bison and comparing it with the RB51 strain, found no differences in the behavior of both strains, and suggest that the data obtained for the RB51 - SOD strain is safe for this species, since the presence of the vaccine agent in tissues is not observed. However, vaccine efficacy results recommend the RB51 strain as preferable to RB51-SOD for the vaccination of bison

172

Rev Mex Cienc Pecu 2021;12(1):163-176

calves(24). However, its condition for the development of cellular and humoral immunity in goats, as well as its efficacy and safety in young and adult animals need to be evaluated.

Conclusions and implications When evaluating the rates of kiddings, abortos and births of weak offspring in flocks vaccinated with the RB51 - SOD (B. abortus) strain, there was no significant difference between animals inoculated with Rev-1 (B. melitensis) and RB51 (B. abortus), strains available for use in official Animal Health Campaigns, as well as with the control subgroups.

This suggests that the RB51 - SOD strain can generate similar benefits in the protection of the flock against the disease to maintain a healthy inventory and avoid negative effects on the productive life and the health of the females, as well as to guarantee the health of the flock. However, it is necessary to consider complementary activities of management and feeding of the flock to improve productive conditions of the susceptible animals.

Acknowledgments and conflicts of interest The authors are grateful to the Doctorate Program in Agricultural Sciences of the Universidad Veracruzana and to CONACYT for the opportunity received to develop the first author's Doctorate studies in Sciences. Also, to the National Center for Disciplinary Research on Animal Health and Safety of the National Institute for Research on Forestry, Agriculture and Livestock (Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, INIFAP) for the importation of the RB51-SOD vaccine, and to Dr. Gerhardt Shurig, of the Virginia Institute of Technology, for donating it for the study. And to the producers of the community of Xaltepec, municipality of Perote, Veracruz - Mexico, for the facilities granted to carry out this experiment in their goat production units.

Literature cited: 1. Dean AS, Crump L, Greter H, Schelling E, Zinsstag J. Global burden of human brucellosis: a systematic review of disease frequency. PLoS Negl Trop Dis 2012;6(10):1865. http://dx.doi.org/10.1371/journal.pntd.0001865.

2. Moreno E. Retrospective and prospective perspectives on zoonotic brucellosis. Front Microbiol 2014;(5):213.

3. Godfroid J, Scholz HC, Barbier T, Nicolas C, Wattiau P, Fretin D, Saegerman C. Brucellosis at the animal ecosystem human interface at the beginning of the 21st century.

Prev Vet Med 2011;102(2):118-131.

173

Rev Mex Cienc Pecu 2021;12(1):163-176

4. SAGARPA – Comité Nacional Sistema Producto Caprinos (CNSPC). Plan Anual de Fortalecimiento. México, D.F. http://www.cnsp.caprinos.org.mx. 2015.

5. Ducrotoy MJ, Conde-Álvarez R, Blasco JM, Moriyón I. A review of the basis of the immunological diagnosis of ruminant brucellosis. Vet Immunol Immunopathol 2016;171:81-102.

6. Blasco JM. Control and eradication strategies for Brucella melitensis infection in sheep and goats. Prilozi 2010;31(1):145-165.

7. Guzmán-Hernández RL, Contreras-Rodríguez A, Ávila-Calderón ED, Morales-García MR. Brucelosis: zoonosis de importancia en México. Rev Chilena Infect 2016;33(6):656-662.

8. Montiel DO, Bruce M, Frankena K, Udo H, Van DZA, Rushton J. Financial analysis of brucellosis control for small-scale goat farming in the Bajío region, Mexico. Prev Vet Med 2015;118(4):247-259.

9. Robles C. Sanitary aspects in small ruminants in extensive systems in South America. Rev Arg Prod Anim 2017;37(1):5-8.

10. Cantú CA, Álvarez OG, Zapata CCC. Situación epidemiológica de las principales enfermedades en cabras. Avances en la producción de pequeños rumiantes en el noreste de México. Ediciones UAT. 2015:55-56.

11. Mellado M, Olivares L, López R, Mellado J. Influence of lactation, liveweight and lipid reserves at mating on reproductive performance of grazing goats. J Anim Vet Ad 2005;4(4):420-423.

12. SAGARPA. Norma Oficial Mexicana NOM-041-ZOO-1995, Campaña Nacional contra la Brucelosis en los Animales. SAGARPA: Secretaría de Agricultura Ganadería y Desarrollo Rural, México. 1996.

13. Mellado M. Técnicas para el manejo reproductivo de las cabras en agostadero. Trop Subtrop Agroecosys 2008;9(1):47-63.

14. Blasco JM, Molina FB. Control and eradication of Brucella melitensis infection in sheep and goats. Vet Clin Food Anim 2011;(27):95–104.

15. Menzies PI. Vaccination programs for reproductive disorders of small ruminants. Anim Reprod Sci 2012;130(3):162-172.

16. Dorneles EM, Sriranganathan N, Lage AP. Recent advances in Brucella abortus vaccines.

Vet Res 2015;46(1):76.

174

Rev Mex Cienc Pecu 2021;12(1):163-176

17. Villa R, Perea M, Díaz AE, Soberón MA, Hernández AL, Suárez GF. Abortions and stillbirths in goats immunized against brucelosis using RB51, rfbK and Rev 1 vaccines.

Téc Pecu Méx 2008;46(3):249-258 18. Martínez HDI, Morales MJA, Peniche CAE, Molina SB, Rodríguez CMA, Loeza LR, Flores-Castro R. Use of RB51 Vaccine for small ruminants Brucellosis prevention, in Veracruz, México. Int J Dairy Sci 2010;(5):10-17.

19. Oñate AA, Céspedes S, Cabrera A, Rivers R, González A, Muñoz C, Folch H. DNA vaccine encoding Cu, Zn superoxide dismutase of Brucella abortus induces protective immunity in BALB/c mice. Infect Immun 2003;71(9):4857-4861.

20. Solorio-Rivera JL, Segura-Correa JC, Sánchez-Gil LG. Seroprevalence of and risk factors for brucelosis of goats in herds of Michoacan, Mexico. Prev Vet Med 2007;(82):282–290.

21. Olsen SC. Recent developments in livestock and wildlife brucellosis vaccination. Rev Sci Tech 2013;32(1):207-17.

22. Olsen SC, Boyle SM, Schurig GG, Sriranganathan NN. Immune responses and protection against experimental challenge after vaccination of bison with Brucella abortus strain RB51 or RB51 overexpressing superoxide dismutase and glycosyltransferase genes.

Clin Vaccine Immunol 2009;16(4):535-540.

23. INEGI. Anuario estadístico y geográfico de Veracruz de Ignacio de la Llave. 2016.

24. Román-Ramírez DL, Martínez-Herrera DI, Villagómez-Cortés JAJ, Peniche-Cardeña AE, Morales-Álvarez JF, Flores-Castro R. Epidemiología de la brucelosis caprina en la Zona Centro del Estado de Veracruz. Gac Med Mex 2017;153(1):26-30.

25. Raúl AC, Clemente LCJ, Ivone MPM, Denis OAJ, Melesio SH. Manejo reproductivo de los caprinos en agostaderos de B.C.S. INIFAP. 2009.

26. Thrusfield M. Veterinary epidemiology. 3ra ed. USA: Blackwell Science Ltd; 2005.

27. Molina SB, Martínez HDI, Pardío SVT, Flores CR, Morales AJF, Murguía GJ, et al.

Evaluación de la seroconversión en cabras vacunadas con diferentes cepas contra la brucelosis en Veracruz, México. Avances en Investigación Agrícola, Pecuaria, Forestal, Acuícola, Pesquería, Desarrollo Rural, Transferencia de tecnología, Biotecnología, Ambiente, Recursos naturales y Cambio climático 2017;1(1):810-819.

28. Banda CA. Seroprevalencia de brucelosis y su efecto sobre la productividad de hatos caprinos en Aramberri, Nuevo León [tesis doctorado]. México: Universidad Autónoma de Nuevo León. 2015.

175

Rev Mex Cienc Pecu 2021;12(1):163-176

29. Ochoa DV. Protección conferida por la vacunación con Rev 1 Brucella melitensis; RB51 y rfbK Brucella abortus, en borregas desafiadas experimentalmente con Brucella melitensis [tesis maestría]. México: Universidad Nacional Autónoma de México; 2002.

30. Mellado M, Olivares L, Díaz H, Villarreal JA. Placental traits in pen-fed goats and goats kept on rangeland. J App Anim Res 2006;29(2):133-136.

31. Moriyón I, Grilló MJ, Monreal D, González D, Marín C, López-Goñi I, Blasco JM. Rough vaccines in animal brucellosis: structural and genetic basis and present status.

Vet Res 2004;35(1):1-38.

32. Estein SM. Brucelosis bovina (revisión bibliográfica) Revista Electrónica de Veterinaria REDVET 2013.

ISSN 1695 – 7504, 7(5). http://www.veterinaria.org/revistas/redvet/n050506.html 33. El Idrissi AH, Benkirane A, El Maadoudi M, Bouslikhane M, Berrada J and Zerouali A. Comparison of the efficacy of Brucella abortus strain RB51 and Brucella melitensis Rev 1 live vaccines against experimental infection with Brucella melitensis in pregnant ewes.

Rev Sci Tech Off Int Epiz 2001;20(3):741-747.

34. SENASICA. Dirección General de Salud Animal. Regulación y Registro de Productos Veterinarios.

Lista de Productos Biológicos 2019. https://www.gob.mx/cms/uploads/attachment/file/455887/LISTADO_PRODUCTOS_ BIOLOGICOS_2019.pdf 35. Schurig GG, Sriranganathan N, Corbel M J. Brucellosis vaccines: past, present and future.

Vet Microbiol 2002;(90)479–496.

176

https://doi.org/10.22319/rmcp.v12i1.5283 Article

Body distribution of ticks (Acari: Ixodidae and Argasidae) associated with Odocoileus virginianus (Artiodactyla: Cervidae) and Ovis canadensis (Artiodactyla: Bovidae) in three northern Mexican states

Mariana Cuesy León a Zinnia Judith Molina Garza a* Roberto Mercado Hernández a Lucio Galaviz Silva a

a

Universidad Autónoma de Nuevo León, Facultad de Ciencias Biológicas, Ave. Universidad S/N, Ciudad Universitaria. 66455 San Nicolás de los Garza, Nuevo León. México.

*Corresponding author: zinnia.molinagr@uanl.edu.mx; molinazinnia@hotmail.com

Abstract: Ticks are important vectors of medical and veterinary importance pathogens in Mexico; however, the taxonomic studies of abundance, prevalence, intensity, and body distribution in white-tailed deer (Odocoileus virginianus) and bighorn sheep (Ovis canadensis) are limited.

This study aimed to fill this knowledge gap in the Mexican states of Sonora, Nuevo León, and Tamaulipas. The area of study included authorized game farms where hunting is practiced. A total of 372 ticks [21 nymphs (5.65 %) and 351 adults (94.35 %); 41% female and 59 % male] were collected from 233 O. virginianus and four O. canadensis. The ticks collected from O. virginianus were identified as Otobius megnini, Rhipicephalus (Boophilus) microplus, and Dermacentor (Anocentor) nitens. Dermacentor hunteri was the only species collected from O. canadensis. Ears were the most infested region (83 females, 70 males, and 21 nymphs, 46.77 %), and the least infested body parts were the legs (10 males and nine females, 5.1 %). This study reports for the first time the abundance, intensity, and prevalence of ticks in O. virginianus in northern Mexico, particularly in the states of Tamaulipas and

177

Rev Mex Cienc Pecu 2021;12(1):177-193

Nuevo León, since the O. canadensis ticks had already been reported in Sonora. These results show that although ungulates are kept semi-captive, it is essential to control tick infestation by applying acaricide treatments on their preferred adherence sites to avoid the transmission of pathogens.

Key words: White-tailed deer, Bighorn sheep, Ticks, Rhipicephalus microplus, Otobius megnini, Dermacentor nitens, Dermacentor hunteri.

Received: 26/02/2019 Accepted:20/11/2019

Introduction Ticks are hematophagous ectoparasites of amphibians, reptiles, birds, and mammals(1). As a result of their eating habits, ticks directly decrease their host weight gain and exert traumatic, toxic, infectious, or spoliation actions, in addition to the indirect effects that deteriorate the skin and cause death by dermal diseases(2,3). During their life cycle, ticks can horizontally or vertically acquire(4) and transmit a wide range of medical and veterinary important pathogens, such as Babesia spp., Borrelia spp., Anaplasma phagocytophilum, and Rickettsia spp.; hence, ticks are considered as vectors of global importance, surpassed only by mosquitoes(5).

Wildlife constitutes an important component in the transmission cycle of the vector-hostpathogen triangle, where humans are frequently included as accidental hosts, which makes it a zoonotic cycle(6). Therefore, the prevalence of new and reemerging tick-transmitted diseases represents a global public health problem(7). The spatial distribution of ticks is mainly influenced by climatic and geographic conditions, the type of vegetation, the agricultural landscape, the population dynamics of their wild hosts(3), and the illegal movement of cattle and Odocoileus virginianus for commercialization purposes without meeting the sanitary standards(8). These factors facilitate tick dispersion to places where it was not naturally found, increasing the human risk of acquiring diseases associated with these vectors(9,10). Previous studies have reported that Rhipicephalus annulatus has a specific preference for deer(11), and that Dermacentor spp. and Ixodes spp. specifically adhere to head and neck(12).

In Mexico, a total of 77 tick species has been identified; from these, those with national livestock importance due to their direct and indirect effects are R. (Boophilus) microplus, B. anulatus, Amblyomma cajennense, A. imitador. A. maculatum, A. triste, A. americanum, and 178

Rev Mex Cienc Pecu 2021;12(1):177-193

Anocentor nitens. However, the most important due to their economic impact are R. microplus and A. cajennense(13,14), with losses of US $ 573’608,076(15). In Sonora, Nuevo León, and Tamaulipas, O. virginianus and Ovis canadensis have been used to increase income through legalized hunting practices in game farms. In 1996, a conservation program that consisted of constructing an enclosure for the reproduction of economically important species in semi-captivity was implemented in Rancho El Plomito, Sonora, in an area of 961 ha. By 2014, their reproductive population of O. canadensis, O. v. couesi, and O. hemionus was enough for the first repopulations performed by the Organización de Vida Silvestre (OVIS, AC)(16). Mexican authorities reformed the operation of game farms by implementing the current system of Wildlife Management and Conservation Units (UMA, acronym in Spanish). This system allows the conservation and management of wildlife in their natural habitat, in addition to the rational use of wildlife or semi-captive populations and specimens(17,18). In the studied Mexican states, regulated hunting of these ungulates is allowed, but population studies of ectoparasites, their body distribution, and the presence of species of game importance are scarce(3,12). Thus, these results will allow to plan the body areas where proven successful acaricide treatments or devices will be applied for tick control(12). This study aimed to i) taxonomically identify the tick species, ii) determine their prevalence, iii) estimate their abundance and intensity, and iv) describe their body distribution in O. virginianus and O. canadensis in game farms in Sonora, Nuevo León, and Tamaulipas. This information helps to understand the potential risk of ticks as vectors of diseases and implement preventive and corrective measures.

Material and methods Areas of study

This study took place in different areas of Tamaulipas, Nuevo León, and Sonora from 2014 to 2018 in the months from October to February; these months correspond to the legal hunting period in UMAs in situ or ex situ of O. virginianus and O. canadensis(17,18). Two areas of study were located in the Sierra Madre Occidental in Sonora: Rancho El Aigame (UMA registration: DGVS-CR-EX-1271-SON), La Colorada municipality (28º 43’ 41” N, 110º 2’0.65” W) at 400 m asl and Rancho El Pitiquito (UMA registration: SEMARNAT-UMAEX-250-SON) (30º 15’ 0.0’’ N, 112º 22’0.12’’ W)(16-18), El Pitiquito municipality, with a predominantly arid and semiarid climate and mean annual precipitation of 450 mm(19). In Nuevo León, ticks were collected in Rancho Mamulique (UMA registration: DFYFS-CREX-0333-NL), Salinas Victoria municipality (26º 7’ 0.59’’ N, 100º 19’ 0.58’’W), at 464 m asl, with warm arid steppe climate, annual mean temperature of 21-23 °C and annual mean

179

Rev Mex Cienc Pecu 2021;12(1):177-193

precipitation of 380 mm(19). In Tamaulipas, tick collection took place in two localities, Rancho Santa Clara (UMA registration: DGVS-CR-EX-1819-TAM), Nuevo Laredo (27° 33’0.11’’ N, 99° 47’ 59.9’’ W), which has the most arid and extreme climate in the State, ranging from -14 °C during winter and 40 °C during summer, and mean annual precipitation of 472.5 mm(19). The second locality was Rancho Los Columpios (UMA registration: DGVSCR-EX-2066-TAM), Guerrero municipality (26° 33’ 18’’ N, 99° 22’ 0.37’’ W), located on the Río Bravo basin, Tamaulipas. These localities have an arid climate with annual mean precipitation of 440 mm(18-20).

Tick collection and taxonomic identification

Ticks were collected from hunted specimens of O. virginianus and O. canadensis during the hunting season through the authorization issued by the Ministry of Environment and Natural Resources of Mexico to each UMA(16-18). The utilization rate of these species is oriented to the hunting of male and adult specimens. After acquiring a hunting package, hunters were accompanied by OVIS technicians(16). During collection, using sterile forceps, ticks were individually removed from the head (top part), ear, scapula, mid-dorsal neck, and inferior extremities of hunted animals(21). Live ticks were transported to the Molecular and Experimental Pathology Laboratory (LPME, FCB, UANL) in 12 ml-vials containing a cotton pad moistened with sterile double-distilled water and labeled with the date, host, stage, locality, and body part from which the tick was collected; vials were stored at 4 °C. Ticks that died during transportation were placed in vials containing absolute ethyl alcohol as a preservative to avoid deterioration of the morphological traits needed for taxonomic identification(22).

The genus, species, sex, and stage of ticks were determined with a stereomicroscope at 10X - 40X (EZ4E, Leica Microsystem, Guadalajara, Jalisco, Mexico) and employing a specific tick taxonomic key(23-25). In the taxonomic identification of ticks, the following distinctive structures of each of the species were considered: Otobius megnini: Lack of dorsal shield, ventral gnathosoma, rectangular and straight basis capitulum, absent eyes, vestigial or atrophied hypostome, integument with spines, ambulacrum absent at the end of the legs (Figure 1).

180

Rev Mex Cienc Pecu 2021;12(1):177-193

Figure 1: Taxonomic characteristics of Otobius megnini

A) Dorsal view. Illustration and picture of a nymph. B) Ventral view with details of the anterior gnathosoma, rectangular basis capitulum in the box. C) Integument with spines (the integument is smooth between the spines).

Rhipicephalus (Boophilus) microplus: Males have ventral plates and a caudal appendage, a shield that covers the dorsal region of males and the anterior dorsal region of females, eyes, a hexagonal basis capitulum, a coxa I with double spines, a dorsally visible regular size and prominent coxa IV, and no festoons (Figure 2).

The Dermacentor species has an anterior gnathosoma with a rectangular and straight basis capitulum, festoons, a big coxa IV in males, and a coxa I with big and paired spurs (Figure 3). D hunteri and D. nitens differ in the number of festoons. D. hunteri has 11 festoons and an ornament with a characteristic pattern, with large spiracular plates forming a ring, rear to leg IV (Figure 4); D. nitens has seven festoons (Figure 5). All illustrations were obtained from tick identification keys(24,25).

181

Rev Mex Cienc Pecu 2021;12(1):177-193

Figure 2: Morphologic characteristics for the taxonomic identification of Rhipicephalus (Boophilus) microplus

A) Dorsal shield. B) Anterior gnathosoma, basis capitulum with angular margins. C) Eyes. D) No festoons. E) Ventral plates and caudal appendage. F) Coxa I and IV. G) Female and male adult specimens.

Figure 3: Morphologic characteristics for the taxonomic identification of Dermacentor spp

A) Dorsal shield. B) Anterior gnathosoma, rectangular and straight basis capitulum. C) Eyes. D) Morphology of coxa I and IV. E) Festoons in posterior end.

182

Rev Mex Cienc Pecu 2021;12(1):177-193

Figure 4: Morphologic characteristics for the taxonomic identification of Dermacentor hunteri

A) 11 festoons. B) Ornamentation (shown in the pattern). C) Complete male specimen.

Figure 5: Morphologic characteristics for the taxonomic identification of Dermacentor (Anocentor) nitens

A) Seven festoons. B) Big spiracular plates, posterior to leg IV (forms a ring). C) No ornamentation, complete male specimen.

Statistical analysis

The prevalence (percentage of infested hosts by tick species), intensity (number of ticks/infested hosts by each tick species), abundance (number of ticks by species/hosts), and sex proportion by tick species were calculated(26). The significant association between the vector, host location, sex, and locality was determined with a Chi-squared (X2) test at a significance level of 95% of the lower and upper confidence interval (CI). Additionally, the data were analyzed with the Z test to compare the population proportions between stages, species, localities, and hosts with the SPSS program, version 17(12).

183

Rev Mex Cienc Pecu 2021;12(1):177-193

Results A total of 237 hosts were inspected, 233 O. virginianus specimens and four O. canadensis specimens; the body infestation percentages were 17.16 % and 100 %, respectively. Of the 372 ticks collected, 5.65 % were nymphs and 94.35 % adults. Four tick species were identified: Rhipicephalus (Boophilus) microplus (Canestrini, 1887), Dermacentor (Anocentor) nitens (Neumann, 1897), and Dermacentor hunteri (Bishopp, 1912) from the Argasidae; and Otobius megnini (Dugès 1883) from the Argasidae family (Table 1).

Table 1: Tick identification by host (Odocoileus virginianus and Ovis canadensis), sex, and locality Locality Sonora

Host (n/+) O. virginianus (16/6) O. canadensis (4/4)

Nuevo León

Tamaulipas Total O. virginianus

Total O. canadensis

O. virginianus (202/28) O. virginianus (15/6) (233/40)

(4/4)

Sex Species

TS/ST (%)

* Otobius megnini

19/204 (9.3)

NA

*O. megnini Dermacentor hunteri Rhipicephalus microplus D. nitens R. microplus

2/204 (0.98) 183/204 (89.7)

NA NA 28/(13.7) 155/(76)

98/151 (64.9)

84/(55.6) 14/(9.3)

53/151 (35.1) 17/17 (100)

19/(12.6) 34/(22.5) 13/(76.5) 4/(23.5)

*19/372 (5.1)

NA

NA

168/372 (45.2)

116/(41)

52/(59)

*2/372 (0.53)

NA

NA

183/372 (49.19)

28/

155/

NA

NA

F n/(%) M n/(%) NA

TS/ST= Ticks by species/ State total (%); n= number of specimens; *= nymphs; NA= non applicable.

Regarding sex, 41 % of ticks were female and 59 % male (Table 1). However, most ticks in O. virginianus were female (116/168, 69 %), only 31% were male (52/168). On the contrary, in O. canadensis, D. hunteri specimens were mainly male (155/183, 84.7 %), females represented 15.3 % (28/183). There was a significant association between the male and female proportion of ticks between O. virginianus and O. canadensis (X2= 104.57, g.l.= 1, P<0.05). A significant association was also observed in the female and male proportion between the four tick species in O. virginianus (X2= 39.92, g.l.= 1, P<0.05), and between

184

Rev Mex Cienc Pecu 2021;12(1):177-193

males and females by locality (X2= 105.01, g.l.= 2, P<0.05). These results were consistent with the population proportions between stages, species, localities, and hosts since it was confirmed with the Z test, which showed a significant association (Z> 1.2, IC 95%).

Table 2: Percentage of the body distribution of the identified tick species Body region Head Ear

Neck Back Legs

Sex ♀ ♂ ♀ ♂ N ♀ ♂ ♀ ♂ ♀ ♂

Total by species (n/%)

R. microplus n/(%) 21 (5.7) 5 (1.3) 58 (15.6) 11 (2.9) NF 9 (2.4) 1 (0.3) 4 (1.1) NF 6 (1.6) NF

D. nitens n/(%) 6 (1.6) 5 (1.3) 17 (4.6) 11 (2.9) NF 4 (1.1) 5 (1.3) NF NF 2 (0.5) 3 (0.8)

O. megnini D. hunteri n/(%) n/(%) NF 7 (1.9) NF 31 (8.3) NF 8 (2.2) NF 48 (12.9) 21 (5.7) NF NF 5 (1.3) NF 29 (7.8) NF 6 (1.6) NF 31 (8.3) NF 2 (0.5) NF 16 (4.3)

Total n/(%) 34 (9.1) 41 (11.1) 83 (22.3) 70 (18.8) 21 (5.7) 18 (4.8) 35 (9.4) 10 (2.7) 31 (8.3) 10 (2.7) 19 (5.1)

115 (30.9)

53 (14.2)

21 (5.7)

372 (100)

183 (49.2)

N= nymphs; n= number of specimens; NF= not found.

In Sonora, 54.8 % (204/372) of the ticks from both hosts were collected. In O. virginianus, 9.3 % (19/204) were O. megnini nymphs. O. canadensis had 0.98 % (2/204) of O. megnini nymphs and 89.7 % of D. hunteri (Table 1). In Nuevo León, 40.6 % (151/372) of ticks were collected from O. virginianus; two different species were identified: R. microplus (98/151, 64.9 %) and D. nitens (34/151, 35.1 %). In Tamaulipas, only 17 specimens of R. microplus were collected from O. virginianus; this represents 4.56 % (17/372) of the total adult ticks collected in the three localities.

Ticks, from all four species, were more abundant on ears, with a total of 174 ticks (46.77 %) (22.3 % females, 18.8 % males, and 5.7 % nymphs), and the upper part of the head (9.1% females and 11.1% males), followed by the neck, scapula, and, lastly, inferior extremities.

Without considering the host or locality, there was a significant association between the different tick species and their body distribution (X2= 46.18, g.l.= 8, P<0.05); even O. megnini nymphs were located exclusively on the ears. Also, the females and males from different species were significantly associated with body location (X2 = 13.25, g.l.= 4, P<0.05).

185

Rev Mex Cienc Pecu 2021;12(1):177-193

In O. virginianus, R. microplus was the most prevalent (30.9%), abundant (0.49), and intense (2.88) species; in O. canadensis, D. hunteri was the most outstanding species (Table 3).

Table 3: Prevalence, abundance, and intensity of infestation by tick species O. virginianus (40/233) O. canadensis (4/4) Species Prev (%) Abund X̅ Intens Prev (%) Abund X̅ Intens R. microplus D. nitens O. megnini D. hunteri

115 (30.9) 53 (14.2) 19(5.1) --

0.49

2.88

--

--

--

0.23 0.082 --

1.33 0.48 --

-2 (0.54) 183 (49.2)

-0.5 45.8

-0.5 45.8

Prev= prevalence; Abund= abundance; Intens= intensity.

Discussion Rhipicephalus (Boophilus) microplus, also known as cattle tick, was the most prevalent species in O. virginianus in Nuevo León and Tamaulipas because it inhabits the same hunting territory. This tick is considered of high incidence in livestock production systems due to the significant economic losses it causes worldwide(27); additionally, it is a vector of Babesia bovis, B. bigemina, and Anaplasma marginale. This study considers that O. virginianus plays an important role as a natural reservoir of these diseases in the areas of study, as it has been previously reported in Texas, USA, which shares borders with Nuevo León and Tamaulipas(27). During insecticide treatment, female ticks and larvae scape to favorable habitats to survive; this facilitates the upsurge of infestations in cattle and ungulates(28).

However, the O. virginianus specimens analyzed in Sonora were free of R. microplus; SADER/SENASICA reported that the Animal and Plant Health Inspection Service (APHIS) of the United States Department of Agriculture (USDA) declared Sonora was free from this tick(17). In Nuevo León and Tamaulipas, efforts to eradicate R. microplus continue despite the program operating a permanent quarantine zone in south Texas, USA, along the Mexican border(28). In northern Mexico, O. virginianus is handled in game farms due to the income received from hunting permits, furs, and meat for human consumption. In these farms, semicaptive O. virginianus specimens share the same feeding, drinking, and transportation areas as cattle, representing a possible infestation risk factor and complicating the eradication of this tick(29,30).

186

Rev Mex Cienc Pecu 2021;12(1):177-193

The prevalence of R. microplus in northern Mexico was 31%, which is lower than in Yucatán, Mexico, where 97 % was reported in Cervus elaphus, an important host for this tick species; R. microplus not only feeds from its host, it also completes its nymph developing cycle(3).

This species was also the most common in O. v. yucatanensis and Mazama temama, with a 28.4 % frequency and an intensity of 25.2 ticks per animal(31). In contrast, R. annulatus was exclusively reported in C. elaphus with a prevalence of 7.9 % in Cádiz, Spain(11).

In Nuevo León, D. nitens has not been previously reported in O. virginianus; however, it was able to collect specimens from this species. There are several reports of this tick in different Mexican states in hosts such as cattle, horses, dogs, mules, and rodents(32). The veterinary importance of this ectoparasite is that female specimens of D. nitens transmit Babesia caballi to their offspring transovarially, and all stages are competent for this disease, besides being the etiologic agent of equine piroplasmosis(33).

In Sonora, this study reported nymphs of the spinous ear tick (O. megnini) in O. virginianus (5.1 %) and O. canadensis (0.53 %); the adult stage is not an ectoparasite(34). Although this tick has been reported from the southwest of the USA to the south of Mexico and South America, it has not received the same importance as other ixodid ticks. O. megnini can have multiple blood ingestions and deposit batches of eggs that represent a danger in the veterinary and clinical fields, as it has a predilection for the ear canal, which can result in otoacariasis, with complications of external otitis, ear pain in 90 % of the cases, and other signs of internal otitis, such as facial and respiratory paralysis. This tick affects the people that have a close contact with livestock animals, be it cows, mules, goats, rabbits, and sheep(35). This ectoparasite can affect the host in several ways, such as severe irritations, weight loss, and offspring behavior(36). In ungulates and other hosts, when a tick or nymph feeds, it causes blood loss, which attracts other insects, causing stress to the hosts(37). Additionally, these ticks act as rickettsial vectors, responsible for spotted fever and Coxiella burnetii (Q fever)(38).

In Sonora, ticks were more abundant in bighorn sheep. From the total amount of collected ticks, 49.19% belonged to the D. hunteri species; males had a higher proportion with 41.6%.

D. hunteri was almost exclusively collected from this host, similar to previous reports. This tick has also been reported in Baja California, in wild populations of O. canadensis(32,39). In California, USA, bighorn sheep populations were seropositive to Anaplasma spp(40); it is even considered as a primary vector of A. ovis (Lestoquard, 1924)(41,42) and Rickettsia spp., which suggests the importance of this ectoparasite in the epidemiology of these diseases(42).

Based on the body region, when considering the total amount of ticks, the four identified tick species preferred the ears, followed by the head. In Capreolus capreolus, 61% of ticks preferred the head area(12,21); in cattle, 32.02 % preferred ears and head; in sheep, 48.08 % also preferred the head, which included ears. These previous reports are similar to what was 187

Rev Mex Cienc Pecu 2021;12(1):177-193

observed in this study. Ectoparasites prefer the head and ears because of the skin thickness in these areas, where the skin is relatively thin and vascularized(43,44).

In O. canadensis, males had similar proportions in each body region, with an increased number in ears and head. A study in Mexican tropical regions showed similar results; the Ixodidae tick distribution in sheep infestation was 26.50 % in head and neck(45). Previous reports have stated that tick density in O. virginianus can vary depending on the collection season and the age of the ungulates(12,46). In this study, ticks were collected during the fallwinter season, when hunting is allowed, and ticks are in their adult stage, except O. megnini, which parasitic stage is nymphal. Ixodes and Dermacentor ticks preferred younger ungulates due to their habits and thinner skin in Capreolus capreolus. Adult ticks had no preference for the sex of the host, but they did for their body mass(12,46). Although in south Texas, where there is a quarantine area for eradicating ticks in cattle, ticks have not been eradicated due to unregulated movements of illegal cattle and the dispersal of wildlife animals such as O. virginianus in Mexico(27).

Conclusions and implications This study reports three tick species in O. virginianus (O. megnini, R. microplus, and D. nitens) and two species in O. canadensis (O. megnini and D. hunteri) in game farms from northern Mexico. These species play an important role in pathogen epizootiology(47); for this reason, it is essential to identify potential vectors of diseases and tick-associated pathogens in ungulates of game importance and implement control measures. The most and least infested body regions were ears and legs, respectively, due to skin thickness. One of the main strategies for tick eradication is knowing their host specificity (O. virginianus or other ungulates); this information helps recommend applying specific acaricides or ivermectins based on the type of soil or pasture(48). It is also important to consider the life cycle of the tick since it could change its susceptibility to the insecticide(37). Consequently, knowing the tick distribution in northern Mexico and their abundance and intensity in O. virginianus and O. canadensis will help implement preventive or control measures in game farms and livestock, as well as in the importation or hunting of these ungulates. This information will also prevent the development of new vectors of infectious diseases that could represent a public health or zoonotic problem.

188

Rev Mex Cienc Pecu 2021;12(1):177-193

Acknowledgments

To OVIS, S.A. DE C.V. for their participation in tick collection. To CONACyT for the scholarship granted to the first author during her Master’s degree.

Literature cited: 1. Klompen JSH, Black WC, Keirans JE, Oliver Jr JH. Evolution of Ticks. Annu Rev Entomol 1996;41:141–161. doi:10.1146/annurev.en.41.010196.001041.

2. García-Vázquez Z. Garrapatas que afectan al ganado bovino y enfermedades que trasnmiten en México. 1er. Simposium de Salud y Producción de Bovinos de Carne en la Zona Norte-Centro de México 2010;1–9. http://biblioteca.inifap.gob.mx:8080/jspui/handle/123456789/3281 Consultado 5 Jun, 2019.

3. Rodríguez-Vivas RI, Ojeda-Chi MM, Rosado-Aguilar JA, Trinidad-Martínez IC, TorresAcosta JFJ, Ticante-Perez V, et al. Red deer (Cervus elaphus) as a host for the cattle tick Rhipicephalus microplus (Acari: Ixodidae) in Yucatan, Mexico. Exp Appl Acarol 2013;60:543–552. doi:10.1007/s10493-013-9672-z.

4. Koneman E, Koneman AS: Diagnostico microbiologico/Texto y atlas en color. 6ta ed.

Buenos Aires, Argentina: Editorial Médica Panamericana; 2008.

5. Claerebout E, Losson B, Cochez C, Casaert S, Dalemans AC, De Cat A, et al. Ticks and associated pathogens collected from dogs and cats in Belgium. Parasit Vectors 2013;6:183. doi:10.1186/1756-3305-6-183.

6. Sosa-Gutiérrez G, Vargas M, Torres J. Gordillo-Pérez G. Tick-borne rickettsial pathogens in rodents from Mexico.

J Biomed Sci Eng 2014;7:884–889. doi:10.4236/jbise.2014.711087.

7. CDC. Centers for Disease Control and Prevention. New & Emerging Tickborne diseases: Agents, clinical features & surveillance.

2018. https://www.cdc.gov/ticks/diseases/trends.html#2013-video Accessed 12 Sept, 2018.

8. Bush JD, Stone NE, Nottingham R, Araya-Anchetta A, Lewis J, Hochhalter C, et al.

Widespread movement of invasive cattle fever ticks (Rhipicephalus microplus) in southern Texas leads to shared local infestations on cattle and deer. Parasit Vectors 2014;7:188. doi:10.1186/1756-3305-7-188.

9. Shaw MT, Keesing F, McGrail R, Ostfeld RS. Factors influencing the distribution of larval blacklegged ticks on rodent hosts. Am J Trop Med Hyg 2003;68:447–452.

189

Rev Mex Cienc Pecu 2021;12(1):177-193

10. Blagburn BL, Dryden MW. Biology, treatment, and control of flea and tick infestations.

Vet ClinNorth Am Small Anim Pract 2009;39:1173–1200. doi:10.1016/j.cvsm.2009.07.001.

11. Ruiz-Fons F, Fernandez de Mera IG, Pelayo-Acevedo UH, Höfle U, Vicente J, De la Fuente J, et al. Ixodid ticks parasitizing Iberian red deer (Cervus elaphus hispanicus) and European wild boar (Sus scrofa) from Spain : Geographical and temporal distribution Vet Parasitol 2006;140:133–142. doi:10.1016/j.vetpar.2006.03.033.

12. Vor T, Kiffner C, Hagedorn P, Niedrig M, Ru F. Tick burden on European roe deer (Capreolus capreolus). Exp Appl Acarol 2010;51:405–417. doi:10.1007/s10493-0109337-0.

13. Martínez Arzate SG. Análisis filogenético molecular de la secuencia de la proteína Bm86 de la garrapata Rhipicephalus (boophilus) microplus de Colima, México [tesis maestria].

Toluca, Estado de México. Universidad Autónoma del Estado de México; 2014.

14. SENASICA. Situación actual del control de la garrapata Boophilus spp. 2016. https://www.gob.mx/senasica/documentos/situacion-actual-del-control-de-lagarrapata-boophilus-spp. Consultado 20 Sept, 2019.

15. Rodríguez Vivas RI, Grisi L, Pérez de León A, Silva Villela H, Torres Acosta J, Fragoso H, et al. Potential economic impact assessment for cattle parasites in Mexico. Review.

Rev Mex Cienc Pecu 2017;8(1):61-74.

16. OVIS. PROGRAMAS.2011. http://ovis.org.mx/programas/ Consultado 10 Nov, 2017.

17. SEMARNAT. Reglamento de la ley general de vida silvestre. Diario Oficial de La Federación; 2014; DOF 09-05-2014.

1–52. http://biblioteca.semarnat.gob.mx/janium/Documentos/Ciga/agenda/DOFsr/DO2008.p df. Consultado 15 Abr, 2018.

18. SEMARNAT. Registros de unidades de manejo para la conservación de la vida silvestre (UMA). 2019. https://datos.gob.mx/busca/dataset/registros-de-unidades-de-manejopara-la-conservacion-de-la-vida-silvestre-uma/resource/8815e80b-1779-469f-80b8b4a4756f61c3.

19.

INEGI. Cuentame.

2017. http://www.inegi.org.mx/ http://www.cuentame.inegi.org.mx/monografias/informacion/son/territorio/div_munici pal.aspx?tema=me&e=26. Consultado 21 Mar, 2018.

20.

OCDE. (2018).

Nuevo Laredo, Tamaulipas | OCDE Mexico. http://www.ocdemexico.org.mx/Tamaulipas/Nuevo-Laredo/. Consultado Mar 25, 2018.

190

Rev Mex Cienc Pecu 2021;12(1):177-193

21. Warwick BT, Bak E, Baldassare J, Gregg E, Kioko J, Saning K, et al. Abundance estimations of ixodid ticks on Boran cattle and Somali sheep in Northern Tanzania. Int J Acarol 2016;42:12–17. doi:10.1080/01647954.2015.1109708.

22. Amerasinghe F, Breisch N, Azad A. Distribution, density, and Lyme disease spirochete infection in Ixodes dammini (Acari: Ixodidae) on white-tailed deer in Maryland. J Med Entomol 1992;29:54–61.

23. Keirans JE, Litwak TR. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J Med Entomol 1989;26:435–448.

24. Delabra G, Fragoso H, Franco R, Martínez F, Ortiz M, Ortiz A, et al. Manual de identificación de las especies de garrapatas de importancia en México. México: Dirección General de Salud Animal. Secretaría de Agricultura, Ganadería y Desarrollo Rural. 1996.

25. Walker AR, Bouattor A, Camicas J, Estrada-Pena, Horak IG, Latiff A, et al. Ticks of domestic animals in Africa, a guide to identification of species. Edinburgh Scotland, U.K: Bioscience Reports. 2014.

26. Bush AO, Lafferty KD, Lotz JM, Shostak AW. Parasitology meets ecology on its own terms: Margolis et al. revisited. J Parasitol 1997;83(4):575-583.

27. Busch JD, Stone NE, Nottingham R, Araya-Anchetta A, Lewis J, Hochhalter, et al.

Widespread movement of invasive cattle fever ticks (Rhipicephalus microplus) in southern Texas leads to shared local infestations on cattle and deer. Parasit Vectors 2014;7:188.

28. Wang HH, Teel PD, Grant WE, Schuster G, Pérez de León AA. Simulated interactions of white-tailed deer (Odocoileus virginianus), climate variation and habitat heterogeneity on southern cattle tick (Rhipicephalus (Boophilus) microplus) eradication methods in south Texas, USA. Ecol Modell 2016;342:82–96.

29. Cantú-Martinez M, Salinas-Meléndez JA, Zarate-Ramos J, Ávalos-Ramírez R, MartínezMuñoz A, Segura-Correa J. Prevalence of antibodies against Babesia bigemina and B. bovis in white-tailed deer (Odocoileus virginianus texanus) in farms of northeastern Mexico. J Anim Vet Adv 2008;7:121–123.

30. Medrano C, Boadella M, Barrios H, Cantú A, García Z, De la Fuente J, et al. Zoonotic pathogens among white-tailed deer, northern Mexico, 2004-2009. Emerg Infect Dis 2012;18:1372–1374.

191

Rev Mex Cienc Pecu 2021;12(1):177-193

31. Ojeda-Chi M, Rodriguez-Vivas RI, Esteve-Gasent MD, Pérez de León A, Modarellid J J, Villegas-Perez S. Molecular detection of rickettsial tick-borne agents in white-tailed deer (Odocoileus virginianus yucatanensis), mazama deer (Mazama temama), and the ticks they host in Yucatan, Mexico. Ticks Tick Borne Dis 2019;10:365-370. doi: 10.1016/j.ttbdis.2018.11.018 32. Guzmán-Cornejo C, Robbins RG, Guglielmone AA, Montiel-Parra G, Rivas G, Pérez TM. The Dermacentor (Acari, Ixodida, ixodidae) of Mexico: Hosts, geographical distribution and new records. ZooKeys 2016;569:1–22. doi:10.3897/zookeys.569.7221.

33. Schwint ON, Knowles DP, Ueti MW, Kappmeyer LS, Scoles GA. Transmission of Babesia caballi by Dermacentor nitens (Acari: Ixodidae) is restricted to one generation in the absence of alimentary reinfection on a susceptible equine host. J Med Entomol 2008;45:1152–1155. doi:10.1603/0022-2585(2008)45[1152:TOBCBD]2.0.CO;2.

34. Nava S, Mangold J, Guglielmone AA. Field and laboratory studies in a Neotropical population of the spinose ear tick, Otobius megnini. Med Vet Entomol 2009;23:1–5. doi:10.1111/j.1365-2915.2008.00761.x 35. Cakabay T, Gokdogan O, Kocyigit M. Human otoacariasis : Demographic and clinical outcomes in patients with ear-canal ticks and a review of literature. J Otol 2016;11:111– 117. doi:10.1016/j.joto.2016.06.003.

36. Niebuhr CN, Mays SE, Breeden JB, Lambert BD, Kattes DH. Efficacy of chemical repellents against Otobius megnini (Acari :Argasidae) and three species of ixodid ticks.

Exp Appl Acarol 2014;64:99-107. doi:10.1007/s10493-014-9799-6.

37. Almada Resende JDS, Daemon E, De Olivera Montero CM, Maturano R, Prata DA, Rodrigues AFS. Toxicity of solvents and surfactants to Amblyomma cajennense (Fabricius, 1787) (Acari:Ixodidae) and Dermacentor nitens (Neumann, 1897) (Acari : Ixodidae) larvae. Exp Parasitol 2012;131:139–142. doi:10.1016/j.exppara.2012.03.002.

38. Diyes GCP, Rajakaruna RS. Seasonal dynamics of spinose ear tick Otobius megnini associated with horse otoacariasis in Sri Lanka. Acta Trop 2016;159:170–175. doi:10.1016/j.actatropica.2016.03.025.

39. Crosbie P, Goff W, Stiller D, Jessup D. The distribution of Dermacentor hunteri and Anaplasma sp. in desert bighorn sheep (Ovis canadensis). Med Vet Entomol 1997;83:31–37.

40. De la Fuente J, Atkinson MW, Hogg JT, Miller DS, Naranjo V, Almazán C, et al. Genetic characterization of Anaplasma ovis strains from bighorn sheep in Montana. J Wildl Dis 2006;42:381–385. doi:10.7589/0090-3558-42.2.381.

192

Rev Mex Cienc Pecu 2021;12(1):177-193

41. Stiller D, Crosbie PR, Boyce WM, Goff WL. Dermacentor hunteri (Acari: Ixodidae): an experimental vector of Anaplasma marginale and A. ovis (Rickettsiales:Anaplasmataceae) to calves and sheep. J Med Entomol 1999;36:321–324.

42. Yabsley MJ, Davidson WR, Stallknecht DE, Varela AS, Swift PK, Devos JC, et al.

Evidence of tick-borne organisms in mule deer (Odocoileus hemionus) from the Western United States. Vector Borne Zoonotic Dis 2005;5:351–362.

43. Bloemer SR, Zimmerman RH, Fairbanks K. Abundance, attachment sites, and density estimators of lone star ticks (Acari:Ixodidae) infesting white-tailed deer. J Med Entomol 1988;25:95–300. doi:10.1093/jmedent/25.4.295.

44. L’Hostis M, Diarra O, Seegers H. Sites of attachment and density assessment of female Ixodes ricinus (Acari:Ixodidae) on dairy cows. Exp Appl Acarol 1994;18:681–689. doi:10.1007/BF00051535 45. Coronel-Benedett KC, Ojeda-Robertos NF, Gonzalez-Garduño R, Martinez- Ibañez F, Rodriguez-Vivas RI. Prevalence , intensity and population dynamics of hard ticks (Acari :Ixodidae ) on sheep in the humid tropics of Mexico. Exp Appl Acarol 2018:74:99-105.

46. Kiffner C, Lödige C, Alings M, Vor T, Rühe F. Body-mass or sex-biased tick parasitism in roe deer (Capreolus capreolus). A GAMLSS approach. Med Vet Entomol 2011;25:39–44. doi:10.1111/j.1365-2915.2010.00929.x 47. Han S, Hickling GJ, Tsao JI. High Prevalence of Borrelia miyamotoi among adult blacklegged ticks from white-tailed deer. Emerg Infect Dis 2016;22: 22–24.

48. Pound JM, George JE, Kammlah DM, Lohmeyer KH, Davey RB. Evidence for role of white-tailed deer (Artiodactyla: Cervidae) in epizootiology of cattle ticks and Southern cattle ticks (Acari:Ixodidae) in reinfestations along the Texas/Mexico border in South Texas: A Review and Update. J Econ Entomol 2010;103:211–218. doi:10.1603/EC09359

193

https://doi.org/10.22319/rmcp.v12i1.5267 Article

Detection of anti-Neospora spp. antibodies associated with different risk factors in horses from Mexico

Kenia Jasher Padilla-Díaz a Leticia Medina-Esparza a* Carlos Cruz- Vázquez a Irene Vitela-Mendoza a Juan F. Gómez-Leyva b Teódulo Quezada-Tristán c

a

Instituto Tecnológico El Llano Aguascalientes, Km 18 Carretera Ags-SLP., Municipio de El Llano, Ags., 20330, Aguascalientes, México. b

Universidad Autónoma Aguascalientes, México.

C

de

Aguascalientes. Centro

de

Ciencias Agropecuarias,

Instituto Tecnológico de Tlajomulco, Tlajomulco de Zúñiga, Jalisco, México.

* Corresponding author: lmedinaesparza@yahoo.com.mx

Abstract: Neospora spp. is a protozoan parasite that causes abortions and diseases in the Central Nervous System (CNS) of several domestic and wild animal species. In horses, this parasite causes abortions, neonatal mortality, and CNS diseases. The Neospora species identified in horses is different from Neospora caninum and is called Neospora hughesi. This study aimed to detect the presence of anti-Neospora spp. antibodies associated with different risk factors in horses from Mexico. Risk factors were identified by surveying each stable and individual animal from four

194

Rev Mex Cienc Pecu 2021;12(1):194-204

different regions (Center, North, West, and South). A total of 684 serum samples were obtained from horses in the different regions, 52.3 % (358) males and 47.7 % (326) females. Samples were subjected to an indirect immunofluorescence (IIF) assay; results were analyzed to estimate the association between seropositivity and risk factors. The seroprevalence of Neospora spp. was 2.34 %. The positive cases were mainly found in three of the four regions included in this study and were significantly associated with anti-Neospora spp. antibodies. The coexistence of the horses with other animals obtained an OR value of 2.34 (95% CI : 0.28 - 19.0; P<0.04). This study concludes that Neospora spp. is present in horses from Mexico.

Key words: Neospora hughesi, Neospora spp., Horses, Risk factors.

Received: 19/02/2019 Accepted: 12/03/2020

Introduction The first case of neosporosis reported in horses was that of a late-term fetus and placenta infected with Neospora caninum(1). The second case corresponded to a one-month-old foal with congenital blindness and neurological disorders(2). Molecular, antigenic, and structural studies have shown that the species found in horses with neurological problems does not correspond to the one reported, identifying it as Neospora hughesi(3). N. caninum and N. hughesi are obligate intracellular protozoa. These species belong to the phylum Apicomplexa, class Sporozoea, order Eucoccidiida, and family Sarcocystidae(4). In horses, N. caninum has been associated with abortions and reproductive problems(5-8), and N. hughesi with neurological diseases(9-11) and Sarcosystis neuronae, the causal agent of the equine protozoal myeloencephalitis (EPM). EPM is a severe neurological disease that produces significant losses in equine production; this has been mainly reported in the United States(12).

The definitive hosts of N. caninum are domestic dogs(13), coyotes(14), Australian dingoes(15), and gray wolves(16). Additionally, several domestic and wild animal species have been identified as intermediate hosts(17). However, the definitive hosts of N. hughesi are still unknown, and horses are considered the only potential intermediate host(18). Infection can occur after ingesting sporulated oocysts in contaminated feed or water. Vertical transmission is currently considered only as an alternative route(19,20).

195

Rev Mex Cienc Pecu 2021;12(1):194-204

The serological techniques used to detect anti-Neospora spp. antibodies are indirect immunofluorescence (IIF), enzyme-linked immunoassay (ELISA), Neospora agglutination test (NAT), and Western blot (WB). Additionally, N. caninum tachyzoite antigens are used to evaluate seropositivity for Neospora spp. due to the cross-reaction of this parasite(21); DNA-based techniques are used to differentiate between N. hughesi and N. caninum(22). This study aimed to detect the presence of anti-Neospora spp. antibodies associated with different risk factors in horses from Mexico.

Material and methods Area of study This study was carried out in the Central, North, West, and South regions of Mexico (Figure 1).

Regions were selected according to their geographic and climatic characteristics.

Figure 1: Geographic division of Mexico by study region

196

Rev Mex Cienc Pecu 2021;12(1):194-204

Study design A transversal epidemiological study was conducted from October 2016 to October 2017. This study consisted of two stages: field and laboratory. During the field stage, 5 mL of venous blood were collected in Vacutainer® tubes without anticoagulant (BD Vacutainer®) by puncturing the jugular vein of apparently healthy horses. A total of 684 samples were collected; 75 corresponded to the Central region (10.96 %), 54 to the North region (7.89 %), 298 to the West region (43.57 %), and 257 to the South region (37.57 %).

All horses were subjected to a physical exam to determine their health status. Additionally, a survey was applied to the owners to collect information about the general characteristics of the animals (breed, age, sex, and reproductive status) and the specific management of the stable (use of horses, feed, housing, water source, and contact with other animals). Blood samples were transported under refrigeration at 4 °C. In the laboratory, samples were centrifuged at 3,500 rpm for 10 min to separate the serum, which was then transferred to 1.5-mL microtubes and stored at -20 °C until further analysis.

Serologic test The IIF assay was performed using a commercial kit to detect the circulating IgG antibodies against Neospora spp. This kit (SLD-IFA-NC) employs slides antigenated with N. caninum tachyzoites (strain NC-1) and an anti-equine IgG-fluorescein isothiocyanate conjugate (FITCConjugate VMRD). Serum samples were diluted 1:25 in phosphate-buffered saline (PBS).

Positive and negative controls were used as standards. The assay was performed following the manufacturer's instructions. All sera that fluoresced at the initial dilution were considered positive and were further diluted to the titer endpoint. The highest serum dilution showing fluorescence was considered the endpoint titer.

Data analysis The data obtained through the surveys (independent variables) and the presence of anti-Neospora spp. antibodies (dependent variable) were analyzed using the statistical software STATA, version 10. The seroprevalence distribution was obtained with the independent variables, and the association between the seroprevalence of N. caninum in horses and other animals was obtained using a logistic regression model (Chi-square), considering P<0.05. Finally, the odds ratios (OR)

197

Rev Mex Cienc Pecu 2021;12(1):194-204

between the positive results, the negative results, and the relationship with the confidence interval were calculated.

Results The presence of anti-Neospora spp. antibodies was detected in serum samples obtained from horses using the IIF technique (N. caninum NC-1). Serum samples with titers at a 1:50 dilution were considered positive. The overall seroprevalence was 2.34 % (16/684).

The reproductive status variable was analyzed based on the total number of animals seropositive for Neospora spp. A total of 50 % (8/16) of the animals had anti-Neospora spp. antibodies at different dilutions, greater at the cut-off point (1:50). Table 1 shows that in entire males (4/16) the maximum dilution was 1:200; however, pregnant females (3/16) reached dilutions of 1:200, two of them reached 1:400.

Table 1: Percentage of anti-Neospora spp. antibody titers according to serial dilutions using IIF technique Titers Animals 1:50 1:100 1:200 1:400 Castrated 18.75 (3/16) Entire 25.00 (4/16) 18.75 (3/16) 6.25 (1/16) Filly 6.25 (1/16) Mare 12.50 (2/16) Pregnant 18.75 (3/16) 18.75 (3/16) 18.75 (3/16) 12.50 (2/16) Empty 6.25 (1/16) Recent foaling 12.50 (2/16) 12.50 (2/16) mare Total 100.0 (16/16) 50.00 (8/16) 25.00 (4/16) 12.50 (2/16) The survey variables included in the study were analyzed to identify possible risk factors associated with the presence of anti-Neospora spp. antibodies. Table 2 shows the results obtained from this analysis; the highest number of positive cases (62.5 %) was observed in the horses from the West region, 6.25 % corresponded to the Central region, and 31.25 % to the South. There were no positive cases in the North region. This variable had no statistical significance (P<0.05).

Of the positive animals, 43.75 % were male and 56.25 % female. The variable of coexistence of horses with other animals obtained an OR of 2.34 (95% CI: 0.28 - 19.0; P=0.04). The use of horses and housing variables had a P-value <0.20. After analysis with logistic regression, the housing variable had an OR of 3.12. The age, breed, reproductive status, and water source variables were not statistically significant (P>0.05).

198

Rev Mex Cienc Pecu 2021;12(1):194-204

Table 2: Distribution of Neospora spp. in positive and negative sera and associated factors of horses from Mexico Variable Region: Central North West South Sex: Male Female Age: Young (7-24 m) Adult (25-48 m) Old (>48 m) Breed: Creole Pure Reproductive status: Entire Castrated Filly Mare Pregnant Empty Recent foaling mare Use of horses: Racing Not racing Feed: Forage Grazing Mixed Housing: Stable Paddock Coexistence with other animals: Yes No Water sources: Open pit Water bank Total

Samples N %

Neospora spp. + -

75 54 298 257

10.96 7.89 43.57 37.57

1 (6.25) 0 (0.00) 10 (62.50) 5 (31.25)

74 54 288 252

358 326

52.34 47.66

7 (43.75) 9 (56.25)

351 317

68 375 241

9.94 54.82 35.23

1 (6.25) 10 (62.50) 5 (31.25)

67 365 236

262 422

38.30 61.70

6 (37.50) 10 (62.50)

256 412

293 65 26 121 53 115 11

42.84 9.50 3.80 17.69 7.75 16.81 1.61

4 (25.00) 3 (18.75) 1 (6.25) 2 (6.25) 3 (18.75) 1 (6.25) 2 (12.50)

329 355

48.10 51.90

6 (37.50) 10(62.50)

323 345

325 269 90

47.51 39.33 13.16

9 (56.25) 4 (25.00) 3 (18.75)

316 265 87

340 344

49.71 50.29

8 (50.00) 8 (50.00)

598 86

87.43 12.57

341 343 684

P-value

0.36

OR (95% CI)

0.79 (0.49-1.29)

0.49

0.45 (0.03-6.18)

0.21

1.09 (0.47-2.51)

0.68

1.09 (0.22-5.40)

0.13

0.69 (0.32-1.49)

0.10

0.25 (0.04-1.35)

0.06

1.14 (0.27-4.76)

332 336

0.20

3.12 (0.49-21)

15 (93.75) 1 (6.25)

583 85

0.04

2.34 (0.28-19)

49.85 50.15

8 (50.00) 8 (50.00)

333 335

0.78

0.86 (0.31-2.41)

100.00

16 (100.00)

668

-

-

199

289 62 25 119 50 114 9

Rev Mex Cienc Pecu 2021;12(1):194-204

Discussion The seroprevalence reports of neosporosis in horses vary worldwide(23-26). This study, reported a seroprevalence for anti-Neospora spp. antibodies of 2.34 %. Other studies have showed similar results. In Brazil, a study reported a seroprevalence of 2.5 % and 4.1 % of Neospora spp.(6,18); 3.5 % in Costa Rica; 3.7 % in Nineveh, Iraq; and 3% in Durango, Mexico, for the presence of anti-N. hughesi antibodies(27-29). However, some studies have reported higher values for antiNeospora caninum antibodies; 34 % in the United States, 20 % in Iran, 48.27 % in Brazil, and 12 % in Peru(23-26). The detection of antibodies against Neospora spp. contributes to the epidemiological information of this disease in Mexico and horses, representing an important production system in livestock farms. The seroprevalence of Neospora spp. in females and males was 2.7 % and 2.0 %, respectively. Studies in Brazil reported a seroprevalence of 4.3 % in females and 3.7 % in males(6), while in Israel, a study reported 10.9 % in females and 13.0% in males(8). These results coincide with those reported in Brazil, which despite not being statistically significant, it should be noted that both females and males have a similar risk of infection.

The horses in this study were from different regions in Mexico. The West and South regions had the highest percentage of horses with anti-Neospora spp. antibodies compared to the Central and North regions. Similar studies in Brazil reported differences in the coastal (5.6 %) and mountain (2.6 %) regions(6). In Jordan, the presence of Neospora spp. in horses varies across regions(30).

This suggests that the geographic localization and the climate of each region influence the presence of Neospora spp. in horses.

The OR in this study was 1.1 for the variables of age, breed, and feed. There were no statistical differences. These results are similar to those reported in Israel(8), Brazil(25), Jordan(30), and Italy(31) and suggest that the increase of these variables, although not statistically different, augments the probability of infection by Neospora spp. As for the housing variable, the OR obtained in this study was 3.12, similar to that reported in Israel(8), which means that housing is an important risk factor that increases the probability of infection with Neospora spp. The variable of coexistence with other animals was associated with the presence of Neospora spp., the OR= 2.34 (P<0.05), which coincides with several studies in Brazil that analyzed the same variable with an OR= 1.35 (P<0.05)(5,6,25). These results indicate that coexistence with other animals increases the risk of infection with Neospora spp.

200

Rev Mex Cienc Pecu 2021;12(1):194-204

Conclusions and implications In this study, was detected anti-Neospora spp. antibodies in horses from different regions in Mexico; this demonstrates the presence of Neosporosis in equine farms. None of the positive cases showed characteristic clinical signs of the disease. The coexistence with other animals was the risk factor with the greatest association to seropositivity. However, it is necessary to perform an analysis considering the different categories of each variable. Further studies are required to identify the definitive host of Neospora spp. and its transmission mechanisms to horses.

Additionally, it is essential to identify the Neospora species that affects horses.

Acknowledgments

The authors would like to thank the owners of the animals for facilitating this study.

Literature cited: 1.

Dubey JP, Porterfield, ML. Neospora caninum (Apicomplexa) in an aborted equine fetus. Int J Parasitol 1990;76:732-734.

2.

Lindsay DS, Steinberg H, Dubielzig RR, Semrad SD, Konkle DM, Miller PE, et al. Central nervous system neosporosis in a foal. J Vet Diagn Invest 1996;8:507–510.

3.

Marsh AE, Barr BC, Packham AE, Conrad PA. Description of a new Neospora species (Protozoa: Apicomplexa: Sarcocystidae). J Parasitol 1998;84(5):983–991.

4.

Goodswen SJ, Kennedy PJ, Ellis JT. A review of the infection, genetics, and evolution of Neospora caninum: from the past to the present. Infect Genet Evol 2013;13:133–150.

5.

Abreu RA, Weiss RR, Thomaz-Soccol V, Locatelli-Dittrich R, Laskoski LM, Bertol MA, et al. Association of antibodies againts Neospora caninum in mares with reproductive problems and presence of seropositive dogs as a risk factor. Vet Parasitol 2014;202(34):128-131.

6.

Moura AB, Silva MO, Farias JA, Vieira-Neto A, Souza AP, Sartor AA. Neospora spp. antibodies in horses from two geographical regions of the states of Santa Catarina, Brazil.

Rev Bras Parasitol Vet 2013;22(4): 597-601.

201

Rev Mex Cienc Pecu 2021;12(1):194-204

7.

Veronesi F, Diaferia M, Mandara MT, Marenzoni ML, Cittadini F, Piergili-Fioretti DP. Neospora spp. infection associated with equine abortion and/or stillbirth rate. Vet Res Commun 2008;32: 223-226.

8.

Kligler EB, Shkap V, Baneth G, Mildenberg Z, Steinman A. Seroprevalence of Neospora spp. among asymptomatic horses, aborted mares and horses demonstrating neurological signs in Israel. Vet Parasitol 2007;148:109-113.

9.

Renier AC, Morrow JK, Graves AJ, Finno CJ, Howe DK, Owens SD, et al. Diagnosis of equine protozoal myeloencephalitis using indirect fluorescent antibody testing and enzymelinked immunosorbent assay titer ratios for Sarcocystis neurona and Neospora hughesi. J Equine Vet Sci 2016;36:49–51.

10. Antonello AM, Pivoto FL, Camillo G, Braunig P, Sangioni LA, Pompermayer E, et al. The importance of vertical transmission of Neospora sp. in naturally infected horses. Vet Parasitol 2012;187:367–370.

11. Finno CJ, Eaton JS, Alemán M. Hollingsworth SR. Equine protozoal myeloencephalitis due to Neospora hughesi and equine motor neuron disease in a mule. Vet Ophthalmol 2010;13(4):259-265.

12. Dubey JP, Calero-Bernal R, Rosenthal BM, Speer CA, Fayer R. Sarcocystosis of animals and humans. 2nd ed. Boca Raton, Florida: CRC Press.; 2016.

13. McAllister MM, Dubey JP, Lindsay DS, Jolley WR, Wills RA, McGuire AM. Rapid communication: Dogs are definitive hosts of Neospora caninum. Int J Parasitol 1998;28(9):1473–1499.

14. Gondim LFP, McAllister MM, Pitt WC, Zemlicka DE. Coyotes (Canis latrans) are definitive hosts of Neospora caninum. Int J Parasitol 2004;34:159-166.

15. King JS, Slapeta J, Jenkins DJ, Al-Qassab SE, Ellis JT, Windsor PA. Australian dingoes are definitive hosts of Neospora caninum. Int J Parasitol 2010;40:945–950.

16. Dubey JP, Jenkins MC, Rajendran C, Miska K, Ferreira LR, Martins J, et al. Gray wolf (Canis lupus) is a natural definitive host for Neospora caninum. Vet Parasitol 2011;181:382– 387.

17. Dubey JP, Schares G. Neosporosis in animals-the last five years. Vet Parasitol 2011;180:90– 108.

202

Rev Mex Cienc Pecu 2021;12(1):194-204

18. Hoane JS, Gennari SM, Dubey JP, Ribeiro MG, Borges AS, Yai LE, et al. Prevalence of Sarcocystis neurona and Neospora spp. infection in horses from Brazil based on presence of serum antibodies to parasite surface antigen. Vet Parasitol 2006;136:155-159.

19. Dubey JP, Hemphill A, Calero-Bernal R, Schares G. Neosporosis en animales. Boca Raton, Florida: CRC Press.; 2017.

20. Pusterla N, Conrad PA, Packham AE, Mapes SM, Finno CJ, Gardner IA, et al. Endogenous transplacental transmmission of Neospora hughesi in naturally infected horses. J Parasitol 2011;97:281–285.

21. Gondim LF, Lindsay DS, McAllister MM. Canine and bovine Neospora caninum control sera examined for cross-reactivity using Neospora caninum and Neospora hughesi indirect fluorescent antibody tests. J Parasitology 2009;95(1):86-88.

22. Al-Qassab S, Reichel MP, Ivens A, Ellis JT. Genetic diversity amongst isolates of Neospora caninum, and the development of a multiplex assay for the detection of distinct strains. Mol Cell Probes 2009;23:132-139.

23. James KE, Smith WA, Conrad PA, Packham AE, Guerrero L, Ng M, et al. Seroprevalence of Sarcocystis neurona and Neospora hughesi among healthy horses in the United States.

Proc Am Assoc Equine Pract. 2015;61:524.

24. Tavalla M, Sabaghan M, Abdizadeh R, Khademvatan S, Rafiei A, Razavi-Piranshahi A. Seroprevalence of Toxoplasma gondii and Neospora spp. infections in Arab horses, southwest of Iran. J J Microbiol 2015;8:e14939.

25. Cazarotto CJ, Balzan A, Grosskopf RK, Boito JP, Portella LP, Vogel FF, et al. Horses seropositive for Toxoplasma gondii, Sarcocystis spp. and Neospora spp.: Possible risk factors for infection in Brazil. Microb Pathog 2016;99:30–35.

26. Luza M, Serrano-Martínez E, Tantaleán M, Quispe M, Casas G. Primer reporte de Neospora caninum, en caballos de carrera de Lima, Perú. Salud Tecnol Vet 2013;1:40-45.

27. Dangoudoubiyam S, Oliveira JB, Víquez C, Gómez-García A, González O, Romero JJ. Detection of antibodies against Sarcocystis neurona, Neospora spp., and Toxoplasma gondii in horses from Costa Rica. J Parasitol 2011;97:522–524.

28. Al-Obaidii WA, Al-Kennany ER. Investigation of Neospora hughesi antibodies by using ELISA in horses in Nineveh Province. Assiut Veterinary Med J 2014;60:167–170.

29. Yeargan MR, Alvarado-Esquivel C, Dubey JP, Howe K. Prevalence of antibodies to Sarcocystis neurona and Neospora hughesi in horses from Mexico. Parasite 2013;20:29.

203

Rev Mex Cienc Pecu 2021;12(1):194-204

30. Talafha AQ, Abutarbush SM, Rutley DL. Seroprevalence and potential risk factors associated with Neospora spp. infection among asymptomatic horses in Jordan. Korean J Parasitol 2015;53:163-167.

31. Bártová E, Machacová T, Sedlák K, Budíková M, Mariani U, Veneziano V. Seroprevalence of antibodies of Neospora spp. and Toxoplasma gondii in horses from southern Italy. Folia Parasitol (Praha) 2015;62:043.

204

https://doi.org/10.22319/rmcp.v12i1.5377 Article

Productive performance and costs of swine farms with different PRRS virus vaccination protocols

Elizabeth Araceli Quezada-Fraide a Claudia Giovanna Peñuelas-Rivas b Frida Saraí Moysén-Albarrán c María Elena Trujillo-Ortega d Francisco Ernesto Martínez-Castañeda c*

a

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán.

Departamento de Ciencias Pecuarias. México. b

Kansas Smith Farms. EE.UU.

c

Universidad Autónoma del Estado de México. Instituto de Ciencias Agropecuarias y Rurales. México. d

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia.

Ciudad de México, México.

*Corresponding author: femartinezc@uaemex.mx

Abstract: In order to evaluate the productive performance and production costs per weaned piglet and finished pig in swine farms with different PRRS virus vaccination protocols under field conditions, the indicators total piglets born alive, stillborn piglets, weaned piglets, birth and weaning weights, fattening days and final weight, as well as the costs per weaned piglet and finished pig of two farms under a semi-technification regime were analyzed: a) Protocol 1 (P1), a farm with vaccination of breeding sows and piglets; and b) Protocol 2 (P2), vaccination of breeding sows only. The productivity indicators up to weaning were evaluated with a Time-Repeated Measures Design, and the fattening indicators were evaluated with an analysis of variance with comparison of means. The costs were determined using the general 205

Rev Mex Cienc Pecu 2021;12(1):205-216

cost formula. It was possible to observe differences in total number of piglets born and of mummies (P<0.05) in favor of P2, weaned piglets, as well as in birth and weaning weights in favor of P1, but no differences in the rest of the variables. Pigs finished in P1 resulted in 12 more days of fattening and a final weight of 3.13 kg more than P2. The costs per weaned piglet were $389.55 and $424.25 Mexican pesos, and the average cost per day of fattening were $10.01 and $11.43, respectively.

Key words: Productivity, Costs, Pigs, Vaccination, PRRS.

Received: 20/05/2019 Accepted: 08/01/2020

Introduction Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) in swine has caused significant economic losses to the swine industry worldwide(1). Losses range from 75,000 euros, in a 1,000-sow farm with a "light" infection, to 698,000 euros(2) and $664 million USD per year in the United States(3). The disease is caused by an arterovirus that emerged in the late 1980s in the USA(4) and later in Europe, spread rapidly and became enzootic in the pig population worldwide(5). The disease exhibits a wide variety of signs that reflect the virulence of the strain and are related to the physiological stage of the animals, their immune status and the presence of other diseases(5,6). The first phase lasts approximately 2 wk and is characterized by acute viremia causing anorexia and lethargy, as well as pyrexia, tachypnea and dyspnea and cutaneous hyperemia with cyanotic extremities. The second phase, which may begin before the first phase is completed and can last up to 4 mo, is characterized by reproductive failure, mainly in sows that were infected during their third of gestation(5), and also it generates a respiratory condition in growing pigs(7).

The disease is caused by a RNA virus of which there are two varieties: classical strains (CPRRSV) and highly virulent strains (HP-PRRSV)(8). It is also classified according to its genetic variations and antigenic differences, into two types: PRRSV-1, the European type and PRRSV-2, the North American type(9). Animal health can be complicated when the virus is associated with other pathogens such as type II porcine circovirus (PCVII), Pasteurella multocida, Haemophilus parasuis, Bordetella bronchiseptic, and Mycoplasmas(10,11,12).

After the outbreak, farm production tends to improve gradually (4 to 6 mo), not reaching preoutbreak production levels. On the other hand, when PRRSV remains circulating, the farm is exposed to disease outbreaks and to the persistence of the virus in the herd(12).

206

Rev Mex Cienc Pecu 2021;12(1):205-216

The results of interventions to reduce the cost of the disease, mainly in the fattening stages, have been positive, but they allow and cause greater losses in breeding. In 2005, losses in the U.S. breeding herd were 12 % of the total cost of PRRS, while in 2011, the cost in the breeding herd amounted to 45 %(3). During this period, different intervention protocols have been implemented, including vaccination, depopulation, and biosecurity protocols(13), among others.

The negative impact of PRRS on the economic margin per pig produced has stimulated efforts to control and eventually eradicate the disease. PRRS virus control relies on aspects such as early diagnosis and monitoring, biosecurity, herd management and immunization(14).

However, these standard control methods have not been effective as vaccines do not reduce disease prevalence and many producers have to depopulate after an outbreak(15).

PRRS is a host/virus model in which disease is determined by virus pathogenicity, breeding herd susceptibility and phenotype, bacterial co-infection pressure, and environmental conditions(16).

Therefore, the objective of this study was to evaluate the productive performance and production costs per weaned piglet and finished pig in swine farms with two PRRS virus vaccination protocols to determine their effectiveness and which one offers the producer better productive and economic indicators.

Material and methods The study was carried out in two farms, which, according to the general technological classification of SAGARPA, correspond to semi-technified farms. The farms are located in the Central Highlands of Mexico. One is in the state of Hidalgo and has a dry temperate climate, an average annual temperature of 14 ºC, and an annual rainfall of about 610 mm.

The other is in the State of Mexico with a semi-dry temperate climate, an average annual temperature of 16 to 17 ºC, and an annual rainfall of about 600 mm. The number of breeding sows was 480 and 180 respectively. The data analyzed were taken from individual sows’ records. The period was from their first birth to the last recorded birth, with cutoff as of September 2017, in a lapse of their productive life, the latest data recorded being the births of the first half of 2017.

The technical indicators analyzed were total piglets born, piglets born alive, piglets born dead, mummies, piglets weaned, piglets’ weight at birth, piglets’ weight at weaning, age of the pigs at slaughter, weight of the pigs at slaughter, weight of the pigs at slaughter. The farms have been PRRS-positive since 2003 and a vaccination schedule is being implemented on both farms. Vaccination protocol 1 (P1) considers the farm that vaccinates breeding sows

207

Rev Mex Cienc Pecu 2021;12(1):205-216

and piglets at approximately 21 days of age. Vaccination protocol 2 (P2) considers the farm that vaccinates only the breeding sows. Mass/blanket vaccination of breeding sows in both farms occurs every four months. Both protocols use a modified live PRRS vaccine with a dose of 2 ml per animal.

Both farms have similar biosecurity, genetics and feeding schemes.

The cost analyses were performed using the modification to the general cost formula of Muñoz and Rouco(17).

TC=F+V, where TC= cost per weaned piglet, F= fixed costs and V=variable costs.

Fixed costs were formed by F=L=L+S+Co+R+A+A+Fi+OC+Oth<, where: L=labor costs, S=supply costs, Co=energy and fuel costs, R= repair and maintenance, A=depreciation of fixed assets, OC=opportunity costs, and Oth=other minor costs.

Variable costs consisted of the following items: V=((ABS+FB+FP+M+T+OC/(TOTS*W))*z; where: ABS= amortization costs of breeding stock; FS= feeding of the sows; FB= feeding the boar; AB= amortization of the boar; FP= feeding of piglets; M= medications; T= transportation; OC= opportunity costs; TOTS= total number of sows on the farm; W= Weighting factor, since all variable costs will refer to the production unit of a commercial piglet, and z=number of weaned piglets.

Depreciation of breeding animals was calculated as follows: ABS=(PPS-(SCP-(1-MORBS)))/(ANFS/FSY)-BR; where: PPS= purchase price of the sow, SCP= sow cull price, MORBS= mortality of breeders expressed as a percentage, ANFS= average number of farrowing sow, FSY= number of farrowing per sow per year, and BR= breeder replacement.

The average number of births per breeding herd can be calculated at any time during production, regardless of the physiological stage of the sows.

ANSF = ∑(NS * n)/TOTS; where: NS= the number of sows and n= farrowing number.

FSY=365/(114,5+LAC+INT)*(1-NM+NES/SER)), LAC= duration of lactation, INT= weaning-first fertile service interval, NM= total number of miscarriages, NES= number of empty sows, SER= services performed. In turn, INT is formed by the sum of the weaningfirst service intervals (INT1), p. 100 first repetitions*21 (INT2), p. 100 second repetitions*42 (INT3), p. 100 third repetitions*63 (INT4) and p. 100 acyclic repetitions average days of onset.

REP=FSY/ANFS and the weighting factor is w = FSY * PBA * (1 - MOR)*(1-MORT); where: FSY= number of farrowing per sow per year, PBA= piglets born alive per farrowing,

208

Rev Mex Cienc Pecu 2021;12(1):205-216

MOR= mortality in lactation, MORT= mortality in transition from weaning to commercial piglet expressed in percentage points.

For the calculation of fattened pig costs, the formulas are as follows: F= F=L+S+Co+R+A+Fi+CO+Oth, applicable for the fattening process and V=((M+FP+OC)/w)*z, applicable to the fattening process, where z is the number of piglets fattened.

In order to determine differences in sow productivity by farrowing (parity) and by type of vaccination protocol, a time-repeated design was used. The best covariance structure was determined and an adjusted Tukey’s test was used to determine significance(18). As for the fattening production data, the variables days to sale and slaughter weight were determined through an analysis of variance.

The differences in income were determined using as a measure 1 weaned piglet and 1 kilogram of fattened pig. The price for the calculation was $28.00 MXN. In the case of weaned piglets, an average value of $800.00 MXN was used.

Results The two farms analyzed showed similar levels of technology, animal genetics, feeding, production and sanitary management, with the exception of the PRRS vaccination protocols.

Table 1 summarizes the productive performance of breeding sows and their piglets between vaccination protocols. It is noteworthy that although Protocol 2 (P2) resulted in a higher number of piglets born (P<0.05), the number of piglets weaned was higher (P<0.05) with Protocol 1 (P1).

Table 1: Comparison of results of the vaccination protocol Protocol 1 (n=1658) 2 (n=972) Total piglets born 10.880.10 11.430.12 P<0.0006 Piglets born alive Stillbirths Mummies Weaned piglets Litter weight at birth Litter weight at weaning

10.130.13 0.500.04 0.340.03 8.940.08 14.110.13 52.330.52

10.080.15 1.000.12 0.500.03 8.310.09 12.440.10 49.530.59

209

P>0.05 P>0.05 P<0.0001 P<0.0001 P<0.0001 P<0.0005

Rev Mex Cienc Pecu 2021;12(1):205-216

In this sense, the number of total piglets born per parity was only different in sows in their first farrowing (P<0.05) with values of 10.14 0.11 and 11.28 0.16 for protocols 1 and 2, respectively.

With respect to parities (Tables 2 and 3), differences were observed in the number of mummies in parity one (0.36  0.03 and 0.66  0.05) and parity five (0.36  0.03 and 0.66  0.05); the number of piglets weaned in parity two (9.19  0.11 and 8.01  0.14) and parity three (9.30  0.13 and 7.89  0.17) in favor of P1. In relation to litter weights at birth, the performance was better for P1 at parities one through five. Litter weight at weaning, however, differed in favor of P1 only, in parities of 1 to 3.

Table 2: Reproductive performance over time (parity of 1 to 4)

T TP

PBA

SB

MM

WP

LWB

LWW

Parity number 1 1 2 (n=493) (n=261) 10.140. 11.280.

11 16 P<0.0001 9.390.1 9.650.2 7 3 P>0.05 0.380.0 0.930.0 3 7 P>0.05 0.360.0 0.660.0 3 5 P<0.0001 8.700.1 8.270.1 0 4 P>0.05 13.550. 12.490.

14 20 P<0.0001 51.800. 46.210.

59 81 P<0.0001

2 1 (n=401) 10.840.

16 P>0.05 10.440.

19 P>0.05 0.310.0 3 P>0.05 0.320.0 4 P>0.05 9.190.1 1 P<0.0001 14.700.

16 P<0.0001 55.180.

66 P<0.0001

2 (n=204) 10.860.

18 9.590.2 6 0.810.1 2 0.430.0 5 8.010.1 4 12.400.

22 46.340.

92

3 1 (n=284) 11.380.

15 P>0.05 10.570.

22 P>0.05 0.460.0 6 P>0.05 0.380.0 4 P>0.05 9.300.1 3 P<0.0001 14.770.

19 P<0.0001 55.470.

78 P<0.0001

2 (n=160) 11.540.

20 10.530.

29 1.120.1 9 0.530.0 6 7.890.1 7 12.790.

25 46.941.

03

4 1 (n=208) 11.560.

17 P>0.05 10.560.

26 P>0.05 0.460.0 5 P>0.05 0.510.0 5 P>0.05 9.230.1 5 P>0.05 14.690.

21 P<0.0001 54.360.

90 P>0.05

2 (n=125) 11.770.

23 10.340.

33 0.950.0 9 0.550.0 7 8.460.2 0 12.820.

28 50.391.

16

T= treatments; TP= total piglets born; PBA= piglets born alive; SB= stillbirths; MM= mummies; WP= weaned piglets; LWB= litter weight at birth; LWW= litter weight at weaning.

210

Rev Mex Cienc Pecu 2021;12(1):205-216

T TPB PBA SB MM WP LWB LWW

Table 3: Reproductive performance over time (parity of 5 to 7) Parity number 5 6 7 1 (n=144) 2 (n=98) 1 (n=93) 2 (n=76) 1 (n=34) 11.230.21 11.710.26 10.900.26 11.700.29 10.100.42 P>0.05 P>0.05 P>0.05 10.240.31 10.400.38 10.240.39 10.050.43 9.200.62 P>0.05 P>0.05 P>0.05 0.470.06 1.080.12 0.530.08 1.130.15 0.890.23 P>0.05 P>0.05 P>0.05 0.360.03 0.660.05 0.320.04 0.360.09 0.180.12 P<0.006 P>0.05 P>0.05 9.050.18 8.670.22 8.460.23 8.590.25 8.670.37 P>0.05 P>0.05 P>0.05 14.550.26 12.330.31 13.620.32 12.730.36 12.890.53 P<0.0001 P>0.05 P>0.05 52.141.08 52.891.31 48.071.33 51.411.48 49.302.18 P>0.05 P>0.05 P>0.05

2 (n=48) 11.290.36 9.990.53 0.810.13 0.440.11 8.290.31 12.480.44 52.551.85

T= treatments; TPB= total piglets born; PBA= piglets born alive; SB= stillbirths; MM= mummies; WP= weaned piglets; LWB= litter weight at birth; LWW= litter weight at weaning.

The number of total piglets born on the farm with P1, recorded an increase in parities 2, 3, 4 and 5 with respect to farrowing 1 (P<0.05). The values were 10.14  0.11, 10.84  0.16, 11.38  0.15, 11.56  0.17 and 11.23  0.21, respectively. In the farm where P2 was applied, there was no difference in the indicator. The number of mummies in P1 exhibited no differences, while the number of mummies in P2 differed (P<0.05) in farrowings 1, 6 and 7.

The values were 0.66  0.05 (birth one), 0.43  0.05, 0.36  0.09 and 0.44  0.11. The piglet weaning performance with P1 was different in farrowings 2 and 3 with respect to farrowing 1, while no differences in this indicator were recorded for pigs in P2. Birth weights with P1 were lower in farrowings 2, 3, 4 and 5 (P<0.05) and exhibited no differences with P2. Finally, litter weaning weights behaved in a regular manner, with differences in piglets weaned under P1 in farrowing 2 and 3, in relation to farrowing 1; in P2, the difference was observed in parity five.

In the case of fattening, the days to sale recorded were 181.08 5.01 and 168.81 4.81 for P1 and P2, respectively (P<0.05); the final weight was 95.46  3.27 and 92.28  3.93 (P<0.05), respectively.

Production costs per weaned piglet in P1 were $389.55 pesos, and $424.25 in P2. Of the total costs, 93.62 % were variable costs in P1 while, in P2, variable costs were 96.27 %.

211

Rev Mex Cienc Pecu 2021;12(1):205-216

The fattening cost was $1,812.81 in P1 and $1,930.07 in P2. With these production indicators, the average cost per day of fattening was $10.01/day in P1, and $11.43/day in P2.

The income per weaned piglet was $410.45 M/N for P1, and $375.75 in P2. Likewise, for a finished pig, the income was $860.07 and 653.77 M/N, respectively.

Discussion When breaking down the data by parameter, by farm and by parity and comparing it to the PIC(19) production cluster for Mexico, 2.75 and 2.2 fewer total piglets were born in farms with P1 and P2, respectively. As for the number of piglets born alive, the difference was 2.18 and 2.23, and for piglets weaned, -1.95 and -2.58, respectively. These PIC data correspond to the top 10% in terms of production. However, the farms with P1 and P2 are the values are lower by 1.21 and 1.26, respectively, compared to the 10% with the worst productive performance(20). Similarly, weaning weights were lower in the analyzed farms: 470 and -360 g.

In general, the differences in these results suggest that PRRS affecting breeders can cross the placenta approximately at day 70 of gestation, causing premature deliveries, on the one hand, and a higher number of stillborn piglets and mummies, on the other. Likewise, it is possible to register an increase in pre-weaning mortality, meaning a lower number of weaned piglets(14,21). Although the literature mentions that an affected farm returns to "relative normality" within six months(14), there are some farms where this disease is chronically found(21). The PRRS virus creates synergy with other viruses or bacteria that may be the cause of increased mortality during lactation(22). In an open cycle, the PRRS virus in unstable farms can be detected in all groups of pigs, including piglets(16), which implies that adverse outcomes caused by the virus can occur, even including vaccination protocols.

In studies involving PRRS virus vaccination of multiparous sows and gilts, it has been shown that passive immune protection is conferred on piglets up to 84 days of age, regardless of whether or not the piglets are vaccinated before this period(23). Although studies on protection at older ages are scarce, these data suggest susceptibility in fattening animals, as long as they are not immunized.

In a study carried out in stable farms with modified live PRRS virus vaccination, it was found that there are some losses and negative changes in the sows' productive indicators(24). There was a slight increase in the preweaning mortality rate, and there were no significant changes

212

Rev Mex Cienc Pecu 2021;12(1):205-216

in the rate of miscarriages, neonatal losses, pigs weaned per litter and wean-to-first-service interval.

Mass vaccination of the entire breeding herd has been reported as a favorable strategy for protection against the PRRS virus, increasing by 1 weaned piglet per sow per year(25).

However, other studies suggest that the change is minimal(24) with no significant differences(26) and even adverse indicators have been reported(27).

Regarding fattening performance, taking as a reference the average PIC results for Mexico, the difference in age was 18 days more for P1 and 6 days more for P2 and -23.63 kg for P1 and -26.81 kg for P2.

PRRS affects fattening pigs by producing respiratory type diseases with pulmonary lesions, allowing other viral or bacterial diseases such as Influenza, Streptococcus suis, Mycoplasma hyopneumoniae, Salmonella cholerasuis, Haemophilus parasuis, Pasteurella multocida, Porcine circovirus, Porcine coronavirus, and Actinobacillus pleuroneumoniae(14,22) to be associated with it. These diseases reduce pig growth, decrease daily gain, and increase days to slaughter.

It is important to note that the farms used in this study are PRRS-stable farms according to the American Association of Swine Veterinarians, and these results are not applicable to PRRS-free farms or PRRS-positive unstable farms.

Despite differences between scientific reports, after 20 years, vaccination against the PRRS virus with modified live virus vaccines continues to provide protection, and the results have been confirmed in 35 million pigs that have been vaccinated(28).

Conclusions and implications As mentioned, these data provide information to feed economic models that will assist swine production specialists and producers in making field-evidenced decisions regarding the use of PRRS vaccination as a preventive strategy. Although no significance was observed on farms vaccinating breeders, the cost per weaned piglet was lower with P1, at $389.55, than with P2 ($424.25). For the fattening or finishing stage, vaccinating both the breeding sows and the piglets (P1) had the best productive and economic results.

213

Rev Mex Cienc Pecu 2021;12(1):205-216

Acknowledgments and conflict of interest The authors are grateful to the producers for their support and willingness, and to CONACyT for the scholarship that financed the studies of Dr. Elizabeth Araceli Quezada Fraide, veterinary physician.

The authors declare that they have no conflict of interests.

Literature cited: 1. Lunney JK, Benfield D, Rowland RRR. Porcine reproductive and respiratory syndrome virus: an update on an emerging and re-emerging viral disease of swine. Virus Res 2010;154:1–6.

2. Nauthes H, Alarcon P, Rushton J, Jolie R, Fiebig K, Jimenez M, Geurts V. Cost of porcine reproductive and respiratory syndrome virus at individual farm level – An economic disease model. Prev Vet Med 2017;142:16-29.

3. Holtkamp DJ, Kliebenstein JB, Neumann EJ, Zimmerman JJ, Rotto HF, Yoder TK, et al.

Assessment of the economic impact of porcine reproductive and respiratory syndrome virus on United States pork producers. J Swine Health Prod 2013;21(2):72-84.

4. Keffaber KK. Reproductive failure of unknown etiology. Amer Assoc Swine Pract 1989;1:1-10.

5. Zimmerman JJ, Karriker LA, Ramirez A, Schwartz KJ, Stevenson GW. Diseases of swine.

10th ed. USA: Wiley-Blackwell; 2012.

6. Wang G, Yu Y, He X, Wang M, Cai X. Zimmerman JJ. Porcine reproductive and respiratory syndrome virus infection of bone marrow: Lesions and pathogenesis. Vir Res 2019;265:20-29.

7. Oh T, Kim H, Park KH, Jeong J, Yang S, Kang I, Chae C. Comparison of four commercial PRRSV MLV vaccines inherds with co-circulation of PRRSV-1 and PRRSV-2. Comp Immunol Microbiol Infect Dis 2019;63:66-73.

8. Wang G, Yu Y, Zhang C, Tu Y, Tong J, Liu Yonggang, et al. Immune responses to modified live virus vaccines developed from classical or highly pathogenic PRRSV following challenge with highly pathogenic PRRSV strain. Dev Comp Immunol 2016;62:1-7.

214

Rev Mex Cienc Pecu 2021;12(1):205-216

9. Xie J, Christiaens I, Yang B, Van Breedam W, Cui T, Nauwynck H. Molecular cloning of porcine Siglec-3, Siglec-5 and Siglec-10, and identification of Siglec-10 as an alternative receptor for porcine reproductive and respiratory syndrome virus (PRRSV).

J Gen Virol 2017;98:2030-2042.

10. Yin SH, Xiao CT, Gerber PF, Beach NM, Meng XJ, Halbur PG, Opriessnig T. Current porcine circovirus type 2a (PCV2a) or PCV2b infection increases the rate of amino acid mutations of porcine reproductive and respiratory syndrome virus (PRRSV) during serial passages in pigs. Vir Res 2013;178:445-451 .

11. Li J, Wang S, Li C, Wang C, Liu Y, Wang G, et al. Secondary Haemophilus parasuis infection enhances highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) infection-mediated inflammatory responses. Vet Microbiol 2017;204:35-42.

12. Willis RW, Zimmerman JJ, Yoon KJ, Swenson SL, McGinley MJ, et al. Porcine reproductive and respiratory syndrome virus: a persistent infection. Vet Microbiol 1997;55,231-240.

13. Silva GS, Corbellini LG, Linharesa DLC, Bakera KL, Holtkamp DJ. Development and validation of a scoring system to assess the relative T vulnerability of swine breeding herds to the introduction of PRRS virus. Prev Vet Med 2018;160:116-122.

14. Pileri E, Mateu E. Review on the transmission porcine reproductive and respiratory syndrome virus between pigs and farms and impact on vaccination. Vet Res 2016;47:108-121.

15. Prather RS, Whitworth KM, Schommer SK, Wells KD. Genetic engineering alveolar macrophages for host resistance to PRRSV. Vet Micriobiol 2017;209:124-129.

16. Drigo M, Giacomini E, Lazzaro M, Pasotto D, Bilato D, Rueggeri J, Boniotti MB, Alborali GA, Amadori M. Comparative evaluation of immune responses if swine in PRRS-stable unstable herds. Vet Immunol Immunopatol 2018;200:32-39.

17. Muñoz LA, Rouco YA. Análisis de costos de producción de lechón comercial en explotaciones tipo de la Región de Murcia. Archiv Zoot 1995;44:391-402.

18. Kramer CY. Extension of multiple range tests to group means with unequal numbers of replications. Biometrics 1956;12:307–310.

19. PIC. Análisis de la industria porcina en Latinoamérica. PIC 2017;15:1-20.

20. PigCHAMP Magazine. Benchmark. 2016. USA.

215

Rev Mex Cienc Pecu 2021;12(1):205-216

21. Morilla A. Manual para el control de las enfermedades infecciosas de los cerdos. 2a ed. ed. México: Manual Moderno; 2005.

22. Schwartz KJ. Swine disease manual. Third ed, Perry, USA: American Association of Swine Practitioners 2005.

23. Kittiwan N, Yamsakul P, Tadee P, Tadee P, Nuangmek A, Chuammitri P, Patchanee P. Immunological response to porcine reproductive and respiratory syndrome virus in young pigs obtained from a PRRSV-positive exposure status herd in a PRRSV endemic area. Vet Immunol Immunopat 2019;218: 09935.

24. Moura CAA, Johnson C, Baker SR, Holtkamp DJ, Wang C, Linhares DCL. Assessment of immediate production impact following attenuated PRRS type 2 virus vaccination in swine breeding herds. Porc Health Manag 2019;5:13.

25. Linhares DCL, Johnson C, Morrison RB. Economic analysis of immunization strategies for PRRS control. PLoS One. 2015;10(12): e0144265.

26. Eclercy J, Renson P, Lebret A, Hirchaud E, Normand V, Andraud M, et al. A field recombinant strain derived from two type 1 porcine reproductive and respiratory syndrome virus (PRRSV-1) modified live vaccines shows increased viremia and transmission in SPF pigs. Viruses 2019;11(3).

27. Dewey CE, Wilson S, Buck P, Leyenaar JK. The reproductive performance of sows after PRRS vaccination depends on stage of gestation. Prev Vet Med 1999;40(3-4):233–241.

28. Jeong J, Choi K, Kang I, Park C, Chae C. Evaluation of a 20 year old porcine reproductive and respiratory syndrome (PRRS) modified live vaccine (Ingelvac1 PRRS MLV) against two recent type 2 PRRS virus isolates in South Korea. Vet Microb 2016;192:102-109.

216

https://doi.org/10.22319/rmcp.v12i1.5088 Article

Bird roles in small-scale poultry production: the case of a rural community in Hidalgo, Mexico

Ana Rosa Romero-López a*

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia.

Ciudad de México, México.

*Corresponding author: anarosa.romero.lopez@gmail.com

Abstract: In Mexico, various studies emphasize that the importance of small-scale poultry farming in the rural setting falls on two of the roles assigned to poultry: 1) Contribution to food security and 2) Generation of economic income. Few studies identify and describe the complementary functions of poultry in small-scale production systems and how these species contribute to the welfare of the producing family. In this study, was identified and analyzed the roles assigned by the producing families to the poultry species in the 26 bird production units, out of 29, in the rural community of La Cuchilla, Hidalgo, Mexico. It was found that poultry could be assigned six different functions, not mutually exclusive: nutritional (26.9 %), environmental (24.4 %), cultural (17.9 %), economic (16.7 %), social (11.5 %), and recreational (2.6 %). Each one of these roles contributed to the family welfare in five different spheres: food security, availability of economic resources, strengthening of social relationships, link to the market, and transmission of vernacular knowledge. This study concludes that poultry can have multiple roles beyond their contribution to food security (nutritional role) and economic resources (economic role). These roles can be used as strategies by the producers to achieve family welfare in five different spheres.

Comprehensively understanding the concept of role is essential to design development strategies based on the production aims and logic of the producing family.

Key words: Backyard, Rural development, Food security, Family poultry farming.

217

Rev Mex Cienc Pecu 2021;12(1):217-237

Received: 30/09/2018 Accepted: 07/11/2019

Introduction In the rural sector, small-scale poultry (SSP) is one of the most practiced livestock activities, in which the needs of the producing family, and not the market demands, dictate the production strategies. Several authors have highlighted two main roles of poultry production in rural communities: the high-quality and low-cost protein contribution to the family diet and the extra income generated from selling poultry products, which allows the acquisition of complementary goods and services to satisfy the family's needs(1,2).

However, Centeno(3) proposed that the farm animals in a small-scale production system can fulfill additional roles, such as a socio-cultural one (in community festivities and family celebrations, and as an educational instrument). Moreover, other authors have observed that producing families can also use farm animals for environmental (manure), social (strengthening of ties and social hierarchy), and work-related purposes (pack animals and traction), as well as a source of savings or insurance (by providing the family with assets in times of crisis)(4,5).

Producing families assign diverse roles to their farm animals based on their strategies to improve the family welfare. Each strategy is determined by the capacities of the producing family (labor force, experience, and knowledge availability), their needs (economic income, health services, food, etc.), resources, particular objectives, and values(3,5).

Although the roles and dynamics of small-scale poultry production are closely linked to the livelihood and welfare characteristics and needs of the producing family, few studies in Mexico have identified or analyzed the different roles assigned to poultry and how they improve family welfare.

This study aimed to identify the roles assigned to the poultry species in the rural community of La Cuchilla, Nopala de Villagrán, Hidalgo, Mexico, as proposed by several authors(4,6) and how these roles contribute to the welfare of the poultry producing families.

218

Rev Mex Cienc Pecu 2021;12(1):217-237

Material and methods Study area

This study takes place in La Cuchilla, a highly marginalized rural community in Nopala de Villagrán, Hidalgo. La Cuchilla is one of the 112 communities of Nopala de Villagrán, which, according to the INEGI, is the second municipality with the highest number of poultry in the State of Hidalgo (689,850 heads); it concentrates 18% of the total poultry in the State. This community has a humid subtropical climate with rains during the summer. It is classified as a rural community with a high degree of marginalization(7).

Research stages and data collection

This study followed a non-experimental design using a descriptive method. During the first stage, an agricultural census was carried out to identify the total number of family farm production units (FFPUs) and the type and number of animal species in the community. After recognizing the FFPUs used for poultry production (26/29), bird species were identified.

During the second stage, semi-structured questionnaires were applied to the person responsible for the poultry production in the selected production units to identify the roles assigned to the poultry, following the classification proposed by various authors(4,6). In this study, bird roles were defined as the function that the family assigns to their poultry based on the benefits they expect to obtain from their breeding and production. Roles were identified and classified by applying semi-structured questions designed to obtain information about the following characteristics: Nutritional role: production destined for family consumption, amount of production destined to family consumption, and frequency of use of poultry-derived products.

Cultural role: participation of sons and daughters in poultry production and reasons to include them in breeding and poultry production activities.

Economic role: production percentage destined for sale.

Social role: production destined for celebrations, parties (weddings, baptisms, birthdays), or gifts to family or neighbors.

219

Rev Mex Cienc Pecu 2021;12(1):217-237

Environmental role: chicken manure destined as fertilizer.

Recreational role: bird breeding for pleasure.

Family welfare spheres were defined based on previous reports that identified the contribution of small-scale livestock at the family level: food security(8,9), availability of economic resources(10), strengthening of social ties(11), market connection(8), and transmission of vernacular knowledge(5). The family welfare spheres were defined as those positive impacts in the daily life of the producing family that result from the roles assigned to the poultry.

Egg-sale strategies were identified using semistructured questions about the points of sale (direct or indirect), the types of consumers, and sales periodicity. These sale strategies were classified as proposed by LEADER(12).

Data analysis

The collected data were analyzed by descriptive statistics (absolute and relative frequencies) using the statistical software for social sciences SPSS 15.0 and Excel 2010.

Results General characteristics of the family farm production units (FFPU)

Of the total FFPU, 93.1 % (27/29) reported having animals. There were 1,089 animals in the community; the most abundant species were poultry (48 %), followed by sheep (39 %), dairy cattle (11 %), rabbits (1 %), horses (0.6 %), and pigs (0.3 %). Of the total FFPUs with animals, 96.3 % (26/27) had poultry, of which 96.15 % were used for egg production and 3.85 % for meat. Laying hens were the most abundant poultry species (71 %), followed by chickens (10.4 %), roosters (6.4 %), turkeys (6.1%), fighting poultry (4.7 %), ducks (0.8 %), and geese (0.6 %).

220

Rev Mex Cienc Pecu 2021;12(1):217-237

Family members involved in the FFPU

Poultry activities were performed by women in 100% of the FFPUs. However, in 57 % of the cases, the interviewed women were entirely in charge of the poultry; in the rest of the cases, the mother (4 %), husband (14 %), children (14 %), and adult daughters (11 %) were involved in poultry production and frequently or sporadically contributed to various activities, such as egg collection, feedlot cleaning, feeding, cleaning of drinking and feeding troughs, and egg selling.

Importance of poultry

The FFPUs with animals had 2.4 ± 0.9 animal species in a range from 1 to 6 species; in the community, the livestock activity tended more towards diversification than its production specialization. Overall, poultry animals were considered the most important species (Table 1). However, FFPU with less than three animal species were the ones that considered poultry the most important species (82.3 %); this shows that as the diversity of animal species increased (from 4 to 6), the importance attributed to poultry decreased (17.7 %).

Table 1: Most important livestock activity according to the interviewed producers in La Cuchilla Livestock activity

Frequency

%

17 7 2 1 27

63.0 25.9 7.4 3.7 100.0

Poultry Dairy cattle Sheep Rabbits Total

Due to the numerous benefits obtained from poultry farming, food security being the most mentioned benefit, 63 % of the producers consider it the most crucial activity in their FFPU (Table 2).

221

Rev Mex Cienc Pecu 2021;12(1):217-237

Table 2: Reasons why poultry species are considered the most important by the interviewed producers in La Cuchilla Reasons

Frequency

%

Family food source (food security)

9

37.4

Hens are used as food during food shortage.

1

4.2

The sale of eggs and chicks allows obtaining money that satisfies family needs

4

16.6

1

4.2

1

4.2

1

4.2

1 2 2

4.2 8.3 8.3

1

4.2

Poultry are considered as part of the family

1

4.2

TOTAL

24

100.0

Avoid external purchase of chicken and eggs Possibility of selling a bird or sheep in family emergencies For special occasions (family visits, celebrations, family gatherings) Recreation and hobby It is their only species Provides a sense of ownership Egg collection

The role of poultry in small-scale production systems

Roles were classified into six categories based on the different uses and purposes assigned to the poultry products and poultry by the producers (Table 3). On average, each producer assigned three roles to the poultry, these roles were not mutually exclusive.

222

Rev Mex Cienc Pecu 2021;12(1):217-237

Table 3: Roles assigned by the interviewed producers in La Cuchilla Role Nutritional Environmental

Cultural

Economic Social

Recreational

Frequency

%

21

26.9

19

24.4

14

17.9

Family consumption of poultry products Use of manure as an organic fertilizer in the milpa (cornfield) Transmission of vernacular knowledge, teaching work ethic and values through the breeding and caring of the poultry Sale of poultry products to obtain economic income Use of poultry products in celebrations (weddings, parties, birthdays) Obtaining pleasure and satisfaction from bird care

16.7

13

11.5

9 2

2.6

a) Nutritional role On average, producing families consumed bird meat from their production one time every 24 ± 5.61 wk (6 mo). Producing families only consume poultry meat in specific situations, such as in times of food shortage or special occasions (Table 4). Moreover, poultry was mainly used for egg production purposes, not for family meat consumption.

Table 4: Reasons why producers consume the chicken meat from their production units in La Cuchilla Reasons

Frequency

%

Food shortage Taste Old poultry that are sick or no longer used for egg production Celebration (birthdays, family visit)

7 7

26.92 26.92

5

19.23

4

15.38

When there is no money to buy meat Meat is not consumed Avoid spending money in "free range" meat

1 1 1 26

3.85 3.85 3.85 100.0

Total 223

Rev Mex Cienc Pecu 2021;12(1):217-237

Of the total FFPUs with poultry, 96.15 % were engaged in egg production. Eggs were mainly used for family consumption (54.76 %), sale (35.71 %), and as gifts to their neighbors or family members that no longer live in the community to strengthen ties (9.53 %). b) Cultural role In this study, 100 % of the producers with family members younger than 17 yr old, either from their nuclear or extended family, used poultry farming to teach them values and work ethic by involving their family members in bird care and production activities. The cultural role of poultry farming consisted in: 1) Teaching children how to work from an early age and make them responsible for one activity to keep their minds focused on something positive that will help them in the future; 2) Teaching them about savings; 3) Preserving across generations the culture and knowledge that states that through hard work, children can procure their own food; 4) Teaching them how to take care of the animals in order to harvest tangible (money, food) or intangible benefits (knowledge, experience in animal handling); 5)Teaching them the value of things; 6) Leaving a legacy for the children, which can constitute a means of life for the future. c) Economic role Of the total egg producing FFPU, 60 % sell their products in the local area. The egg-selling price was $2.00/egg in the entire community, except for one producer that sold it at $2.50/egg. The weekly economic income obtained from egg sales ranged from $20 to $ 420.

This variation resulted from the number of hens per FFPU and the percentage of eggs for sale.

The small producers used different short food supply chains (SFSC) to reach consumers inside and outside the community. In this study, 10 SFSC were identified and classified into three groups, as proposed by LEADER(12): local markets (25.92 %), direct sale to the FFPU (55.56 %), and home delivery (18.52 %) (Table 5).

224

Rev Mex Cienc Pecu 2021;12(1):217-237

Table 5: Egg short food supply chains (SFSC) used by the producers in La Cuchilla SFSC Sales in stores SFSC1 (25.92 %)

Venue/ Actor

Frequency

%

Supermarkets and butcher shops

2

7.41

Tianguis (open-air market)

3

11.11

Restaurants

1

3.70

Bakery

1

3.70

8

29.63

Neighbors Direct sales in Family members from a different State or the FFPU municipality SFSC2 Neighbors - to complete their orders (cooperation) (55.56 %) Visit in the FFPU Home delivery Specific people by previous orders SFSC3 (18.52 %) Door-to-door sales in the municipality

4

14.81

2

7.41

1

3.70

3 2

11.11 7.41

Although 60 % of the FFPUs sold their eggs, not all production was intended for sale. The number of eggs produced was distributed based on the profit that each producer intended to obtain. The FFPUs were divided into three groups based on the number of eggs destined for sale.

Group 1 (Economic): producers that destined the largest number of eggs for sale locally (66.67 %) (Table 6).

225

Rev Mex Cienc Pecu 2021;12(1):217-237

Table 6: Short food supply chains (SFSC) used by the producers who sold the majority of the eggs produced in their FFPU Type of role

SFSC SFSC2

Economic

%

Neighbors

28.57

Cooperation

9.52

Family members

9.52

Visit to the FFPU

4.76

SFSC1

Bakery

4.76

28.57 %

Tianguis market)

52.38 %

Group 1.

Venue/ Actor

SFSC3

(open-air 14.29

Supermarket

9.52

Previous orders

14.29

Door-to-door sales

4.76

19.05 % Group 2 (Family consumption): producers that destined the largest number of eggs for family consumption (26.67 %) (Table 7).

Table 7: Short food supply chains (SFSC) applied by the producers who used most of their egg production for family consumption Type of role

SFSC SFSC2 60 %

Group 2.

SFSC1 20 %

Family consumption SFSC3 20 %

Venue/ Actor

%

Family members

40

Neighbors

20

Restaurants Door-to-door sales

20 20

Group 3 (Social): producers that used most of their eggs as gifts to family members or close neighbors (6.67 %).

226

Rev Mex Cienc Pecu 2021;12(1):217-237

As shown in Tables 6 and 7, the variety of places used to sell eggs differed according to the group to which each FFPU belonged. For example, group 1 had a wider variety of places to sell eggs by SFSC than group 2. Group three consisted of only one FFPU. These results indicate that although most FFPU sold their eggs, some used most of their products for other social or nutritional roles. d) Social role As mentioned before, a percentage of the eggs produced in the FFPUs was assigned a social purpose. These eggs were consumed in family events (family visits or birthdays) or used as gifts for family members or neighbors to strengthen their ties. In this case, the consumption of poultry meat in special events was not reported. e) Environmental role Chicken manure was used as a milpa (cornfield) fertilizer by 83.3 % of the producers; 8.3 % did not use it at all, and 4.2 % sold it or used it in the herbarium (4.2 %). Furthermore, 52 % of the producers used the corn from their milpa (cornfield) to feed their poultry; this practice decreases the purchase of external supplies. This feeding practice changed at specific times of the year (non-sowing seasons or water scarcity). f) Recreational role According to 2.6 % of producers, poultry farming represents a recreational and relaxing activity that allows them to rest from their daily activities, bringing them pleasure and satisfaction.

Family welfare spheres

Each of the roles assigned to poultry contributed to the family welfare in different ways, classified in five spheres: food security, availability of economic resources, strengthening of social relationships, link to the market, and transmission of vernacular knowledge. Food security (availability and accessibility): poultry eggs or meat were consumed in times of food shortage, for pleasure, and as savings or when money was not available.

Availability of economic resources: the economic income obtained from each FFPU was used to obtain several goods and services that improved family welfare, allowed reinvesting in the various livestock activities of the family, and contributed to their food security by allowing them to purchase food that was not produced in their FFPU (Table 8).

227

Rev Mex Cienc Pecu 2021;12(1):217-237

Table 8: Use of the economic income obtained by the producers from the sale of eggs in La Cuchilla Use of the economic resources Frequency % Food for family 12 57.14 Poultry feed

4

19.06

Feed for other species Fare School fare for children

1 2 1 1 21

4.76 9.52 4.76 4.76 100

Mill use Total

Strengthening social ties: eggs were used as gifts for their neighbors or family members who no longer lived in the community as a symbol of reciprocity and trust.

In this case, it was possible to infer that egg production allowed the establishment of close relationships between the producers through cooperation mechanisms; one producer could complete the number of eggs of another producer so that the latter could sell the required number of eggs (cooperation strategies).

Link to the market: Small producers used different SFSC to sell the eggs produced in their FFPU. The SFSC included strategies that connected them with consumers both inside and outside the community. According to the producers, the advantages provided by the SFSC included the inexistence or low number of intermediaries involved in egg commercialization, which allowed them to sell their product directly to the consumers and concentrate their profits.

Transmission of vernacular knowledge: producers with family members younger than 17 yr old, either from their nuclear or extended family, used poultry farming to teach them values and work ethic by involving their family members in poultry care and production activities.

Producers also transmit vernacular knowledge about production strategies and means of subsistence.

Discussion General characteristics of the FFPU in the rural community The current data about the state of rural communities in Mexico only correspond to population density, marginalization degree, social lag degree, number of housing units, and

228

Rev Mex Cienc Pecu 2021;12(1):217-237

household deficiency indicators. However, the data about the production and productivity of agricultural and non-agricultural activities in rural communities are scarce. These data are available per municipality or state, not per rural community.

The search of poultry production data at a micro-level in rural communities is difficult because the data provided by the INEGI have the following limitations: 1) The information provided is solely at the municipal level and focuses on the population density of its poultry, the number of poultry products sold, and their access to technology. 2) INEGI only considers the production units that report having more than 1,000 poultry, ignoring small-scale producers. 3) The data do not distinguish the dynamics between large-scale and small-scale poultry production systems based on their access to technology or animal density.

In the specific case of La Cuchilla, there are no previous data about the overall production characteristics of its agricultural and non-agricultural activities or its technological level, productivity, income, or employment.

Therefore, it is essential to carry out studies that collect and analyze data from rural communities at a micro-level. These studies will provide basic information for future and more complex studies that will help understand the dynamics of the FFPU in rural communities at a local, national, and international level and how they survive in a capitalist system.

The data in this study allow us to glimpse the activities practiced in La Cuchilla and the importance of poultry production for producing families.

Importance of poultry

Several studies carried out in Mexico highlight two common reasons for which small-scale poultry farming exists in the rural sector, family consumption and the sale of poultry products. For example, previous studies in Yucatan reported that poultry products were used for selling purposes, family consumption, and, in some cases, for incubation(13,14).

In some Oaxacan communities, eggs are mostly used for selling and incubation purposes; in other communities, like Zompantle, eggs are mainly sold and used for breeding chicks(15). In the Oaxacan coast, poultry products are mostly sold, used for family consumption, or as gifts.

In other communities, also in Oaxaca, poultry products are mainly sold to neighbors and used for family consumption(16).

229

Rev Mex Cienc Pecu 2021;12(1):217-237

As reported by different studies carried out in Mexico, the roles assigned to poultry in rural communities are based solely on the use of poultry products. These roles have not been described, studied, or analyzed as a way to establish strategies to achieve the welfare of the producing families.

Contrary to previous studies, which technically characterize small-scale poultry farming in Mexico and focus on its nutritional and economic roles, several authors highlight that poultry must be considered as a means to improve the lifestyle of rural communities, that is, family welfare. Poultry are also important for pest control, as a source of organic fertilizer, and essential in special festivities and traditional ceremonies(6,11).

This study indicates that producing families guide their production based not only on technical-economic interests(17); they also consider non-economic interests, such as their basic needs (nutritional, economic, social, and cultural)(18,19). These results highlight the multiple roles of poultry, not their zootechnical purpose. a) Nutritional role Increasing food production, by itself, is not enough to mitigate hunger and malnutrition; it is also important that the food satisfies the tastes and preferences of those who consume it, in addition to making it more available to those who need it(20).

Several authors agree that small-scale animal production systems can potentially contribute to the food security of the inhabitants of developing countries(6,9,21,22). This study reports similar results; it shows that poultry farming increases the availability and accessibility of chicken meat and eggs, particularly during food shortage. b) Cultural role The importance of poultry as a means to teach work ethic and values to family members younger than 17 yr old has not been previously reported; however, the transmission of vernacular knowledge, work ethic, and values through backyard practices to younger generations has been reported(5).

This study shows that producers use poultry farming as a means of informal education to teach and promote their agricultural practices among young people, teaching them a way of living. Other studies focus on the use of poultry in religious activities, traditional medicine, and farm waste control(20); however, during this study, not such uses were observed. c) Economic role The economic role of poultry was fulfilled through the sale of eggs to obtain immediate economic income. A previous study reported that in Oaxaca, 50 % of the eggs was sold, the

230

Rev Mex Cienc Pecu 2021;12(1):217-237

remaining 50 % was used for incubation purposes(15). However, in this study, 60 % of producers sold a fraction of their egg production in the local area.

Similar to what was previously reported in Ethiopia(20), the economic income obtained from the sale of poultry products was mainly used to purchase complementary goods and services to meet the family needs, such as food that was not produced in their FFPU, and to pay the corn milling in the local mill(18,19).

Some authors consider that small-scale producers are reorienting their production profile towards the generation of products destined for the market due to a greater demand for cash to meet new needs and obligations that were not present at the beginning of the century(23).

However, these data show that the relative importance of the nutritional role has not decreased in this rural community. In fact, the different roles assigned to poultry have met the needs of the producers and their families, and the economic role is not the only way to achieve family welfare. d) Social role Animals social roles are mainly used to meet the responsibilities acquired through the social relationships established between the family and members of the community, such as family celebrations (weddings, baptisms, funerals), local festivities (Patron Saint Festivals), traditions (Day of the Dead, Holy Week), gifts, or barter(1,3,5). The data from this study show that eggs were consumed in special events (birthdays, festivities, etc.) and gifted to family members or neighbors to strengthen social relationships, which is similar to that reported in studies carried out in Asia and Africa(10,21,24). e) Environmental role The studied FFPU show the possibility of carrying out different activities, both agricultural and non-agricultural. The interrelationship between livestock and agriculture is important because it strengthens the symbiotic connections between both agricultural activities.

According to several studies, poultry has three important environmental roles: pest control, by collecting the waste from grains and forages(25); chicken manure as organic fertilizer; and weed control(20). In this study, results showed that, within the environmental role, poultry were only used as a source of organic fertilizer; this activity reduced the residues produced by poultry. f) Recreational role Some authors have reported that breeding and producing small-scale animals results in tangible and intangible benefits to the women in charge of this activity. It has been reported that although the intangible benefits have a direct positive effect on the mood of the producers, they cannot be transformed into money(26). Other studies have identified the acquisition of poultry for companionship or combat purposes, as in the case of gamecocks, 231

Rev Mex Cienc Pecu 2021;12(1):217-237

considering them as a means of entertainment(27). In this study, poultry, specifically their breeding and production, functions as a distraction from daily activities, bringing satisfaction to the producers and contributing to their welfare (intangible benefits).

Family welfare spheres

Food security: a family has food security when it has access to the food required by all its members for a healthy live (adequate in terms of quality, quantity, security, and cultural acceptability)(9). This study identified that poultry production contributes to food security; however, it is necessary to evaluate other food security elements to determine its contribution more accurately.

Availability of economic resources: producers in rural communities often do not have access to financial markets, such as banks. Livestock, as a “source of living savings”, offers an alternative to save or accumulate capital. In times of crisis, producers can sell their cattle, pigs, and sheep to obtain money. In this study, poultry were not sold to solve financial crises, probably because the economic value of poultry is low compared to cattle. However, it was possible to identify egg sale strategies that gave access to complementary goods and services(4).

Strengthening of social ties: Animals assigned social roles are mainly used to meet the responsibilities acquired through the social relationships established between the family and members of the community, such as family celebrations (weddings, baptisms, funerals), local festivities (Patron Saint Festivals), traditions (Day of the Dead, Holy Week), gifts, or barter(1,3). In this case, it was possible to infer that egg production allowed to establish close relationships between producers based on egg sale cooperation mechanisms.

Link to the market: To face the economic, social, technological, and political changes, small producers have developed commercialization strategies to ensure the generation of family income and the continuity of the FFPU across generations(22). In this study, producers used various short food supply chains to sell their poultry products; this allowed them to find different niche markets, where producers could also sell other products generated in their FFPU. Transmission of vernacular knowledge: A study performed in Yucatan reported that smallscale production unites the family and community through activities focused on preserving, enriching, and spreading the knowledge of its inhabitants; backyard production reflects how

232

Rev Mex Cienc Pecu 2021;12(1):217-237

much a family knows about their environment(28). This study identified the essential elements transmitted through poultry production: values, work ethic, and production strategies.

It is necessary to identify the elements transmitted through this livestock activity, such as production strategies to reduce the use of external supplies, traditional treatments for diseases, sales strategies, etc.

In developing countries, livestock activities have been mainly focused on generating income and meeting the growing needs of the production units. These efforts prioritize technologies that maximize individual animal productivity, technology transfer, and thus, the dissemination of technical information(29,30). However, these actions should not only focus on increasing the yield of poultry production and income, because the FFPUs are not necessarily developed under a capitalist logic and, therefore, may not correspond to the context in which they are developed(4). Actions must be accompanied by a comprehensive understanding of the bird role and the context in which it develops so that the design and implementation of programs or strategies respond to the problems and concerns of the producers and are consistent with their objectives and production strategies(20,25).

Conclusions and implications Producers from the rural community La Cuchilla could assign up to six different roles, not mutually exclusive, to their poultry: nutritional, environmental, cultural, economic, social, and recreational. Each of the roles assigned contributed to the family welfare in five different spheres: food security, availability of economic resources, strengthening of social relationships, link to the market, and transmission of vernacular knowledge. This study concludes that poultry can have multiple roles beyond their contribution to food security (nutritional role) and economic resources (economic role). These roles can be used as strategies by the producers to achieve family welfare in five different spheres.

Comprehensively understanding the concept of role is essential to design development strategies based on the production aims and logic of the producing family.

233

Rev Mex Cienc Pecu 2021;12(1):217-237

Acknowledgments

Thanks to Dr. Fernando Manzo Ramos for his valuable comments and recommendations during the proposal and development of my master’s thesis, “Poultry production systems, their role, local market, and short food supply chains; a comprehensive study of small-scale poultry farming in a Mexican rural community”, from which this paper derives.

Literature cited: 1.

Camacho M, Lezama P, Jeréz M, Kollas J, Vásquez M, García J, et al. Avicultura indígena mexicana: Sabiduría milenaria en extinción. Actas Iberoam Conserv Anim 2011;375.

2.

Navarrete N, Sánchez E, Nava G, Espinoza A. Identificación y evaluación de indicadores en la crianza campesina. VII Congreso AMER; 2007.

3.

Centeno S, Manzo F. Propuesta de modelo para el estudio de la ganadería en comunidades campesinas. Estudio de caso del ejido de Almeya, Puebla, México. En: Ganadería y seguridad alimentaria en tiempo de crisis. México: Universidad Autónoma de Chapingo; 2009.

4.

Randolph T, Schelling E, Grace D, Nicholson C, Leroy J, Cole D, et al. Role of livestock in human nutrition and health for poverty reduction in developing countries. Am Soc Anim Sci. 2007;85:2788-2800.

5.

García A, Guzmán E. La ganadería familiar, elemento cotidiano de los traspatios de la comunidad Juan Nepomuceno Álvarez, Copala, Guerrero, México. Cienc Biológicas 2014;1-11.

6.

Mack S, Hoffman D, Otte J. The contribution of poultry to rural development. World Poult Sci Assoc 2005;61:7-13.

7.

INEGI. Panorama agropecuario en Hidalgo. INEGI. México; 2012.

234

Rev Mex Cienc Pecu 2021;12(1):217-237

8.

Cruz B, Muñóz M, Santoyo V, Martínez E, Aguilar N. Potencial y restricciones de la avicultura de traspatio sobre la seguridad alimentaria en Guerrero, México. Agric Soc Desarro 2016;13:257-275.

9.

Bruyn J, Wong J, Bagnoi B, Pengelly B, Alders R. Family poultry and food security.

CAB Reviews Perspectives in Agriculture Veterinary Science Nutrition and Natural Resources 2015;10(13):1-9.

10. Aklilu H, Udo H, Almekinders C, Van der Zipp A. How resource poor households value and access poultry: Village poultry keeping in Tigray, Ethiopia. Agric Syst 2008;96:175-183.

11. Alders R. Producción avícola por beneficio y por placer. Roma: FAO; 2005.

12. LEADER. Comercialización de productos locales circuitos cortos y circuitos largos.

Observatorio Europeo; 2000.

13. Gutiérrez M, Segura J, López L, Santos J, Santos R, Sarmiento L, et al. Características de la avicultura de traspatio en el municipio de Tetiz, Yucatán, México. Trop Subtrop Agroecosystems 2007;7:217-24.

14. Gutiérrez-Ruíz E, Aranda F, Rodríguez R, Bolio R, Ramírez S, Estrella J. Factores sociales de la crianza de animales de traspatio en Yucatán, México. Bioagrociencias 2012;5(1):20-28.

15. Chincoya H, Jeréz M, Herrera J, Mendoza P. Caracterización fenotípica y sistema de producción de las gallinas criollas en comunidades de Oaxaca. Rev Mex Agroecosistemas 2016;3(2):87-98.

16. Viveros J, Chávez J, Jeréz M, Villegas Y. Manejo de gallinas de traspatio en seis comunidades de los valles centrales de Oaxaca. Rev Mex Agroecosistemas.

2016;3(2):75-86.

17. López J, Damián M, Álvarez F, Parra F, Zuluaga G. La economía de traspatio como estrategia de supervivencia en San Nicolás de los Ranchos, Puebla, México. Rev Geogr Agríc 2012;48:51-62.

235

Rev Mex Cienc Pecu 2021;12(1):217-237

18. Shanin T. Naturaleza y lógica de la economía campesina. Argentina: Nueva Visión; 1976.

19. Chayanov A. Theory of Peasant Cooperatives. Great Britain: Ohio State University Press; 1991.

20. Tadelle D, Ogle B. Village poultry production systems in the central highlands of Ethiopia. Trop Anim Health Prod 2001;33:521-537.

21. Muchadeyi F, Sibanda S, Kusina J, Makuza S. The village chicken production system in Rushinga district of Zimbabwe. Livest Res Rural Develop 2004;16(6). Art. 40.

22. Mcainsh C, Kusina J, Madsen J, Nvoni O. Traditional chicken production in Zimbabwe.

Worlds Poult Sci J 2004;60:233-246.

23. Cáceres D. Estrategias campesinas en sociedades rurales contemporáneas. Rev Fac Agron 15(1):67-72.

24. FAO. Family poultry development. Issues, opportunities and constraints. Animal Production and Health Working Paper. Animal Production and Health Working Paper; 2014.

25. Moreki J, Petheram R, Tyler L. A study of small-scale poultry production systems in Serowe-Palapye sub-district of Botswanna. Livest Res Rural Develop 2010;22(3).

26. Vieyra J, Castillo A, Losada H, Cortés J, Alonso G, Ruíz T, et al. La participación de la mujer en la producción traspatio y sus beneficios tangibles e intangibles. Cuad Desarro Rural 2004;53:9-23.

27. Itza M, Carrera JM, Castillo Y, Ruíz O, Aguilar E, Sangines J. Caracterización de la avicultura de traspatio en una zona urbana de la frontera norte, México. Rev Científica 2016;26(5):300-305.

28. Molina M. Comparación de dos sistemas de producción y manejo sanitario de las aves criollas de traspatio en los municipios de Ignacio de la Llave y Teocelo, [tesis licenciatura].Veracruz: Universidad Veracruzana; 2013.

29. Elkashef O, Sarmiento L, Torres J. Backyard chicken production skills of rural women in Yucatán, México. Asian J Agric Ext 2016;10(1):1-12.

236

Rev Mex Cienc Pecu 2021;12(1):217-237

30. Salah O, Sarmiento L, Torres F, Fernandez L. Understanding the information acquisition sources of backyard chicken production practices amongst rural Mayan women in Yucatan, México. Agric Soc Desarro 2017;14:219-237.

237

https://doi.org/10.22319/rmcp.v12i1.5213 Article

Cognitive dissonance in the face of climate change in beekeepers: A case study in Mexico

Felipe Gallardo-López a Blanca Patricia Castellanos-Potenciano b* Gabriel Díaz-Padilla c Arturo Pérez-Vásquez a Cesáreo Landeros-Sánchez a Ángel Sol-Sánchez d

a

Colegio de Postgraduados, Campus Veracruz. Manlio Fabio Altamirano, Veracruz México. b

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias - Centro de Investigación Regional Pacífico Sur, Valles Centrales de Oaxaca. México. c

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias - Centro de Investigación Regional Golfo Centro, Teocelo, Veracruz. México. d

Colegio de Postgraduados. Campus Tabasco. Cárdenas, Tabasco. México.

*Corresponding author: castellanos.blanca@inifap.gob.mx

Abstract: Climate change in beekeeping is perceived as a relational phenomenon, and it is necessary to adopt adaptation strategies to maintain economic activity. Festinger's theory of Cognitive Dissonance helps understand the constraints to the adoption of climate change adaptation strategies. For this purpose, a survey was applied to explore the relationship between the perception, attitude, and behavior of beekeepers in the face of climate change in Mexican 238

Rev Mex Cienc Pecu 2021;12(1):238-255

territory. It was noted that: 1) Beekeepers identified climate change as the main problem for beekeeping; 2) They exhibit dissonance between their attitude and their behavior regarding adaptation strategies, and 3) Cognitive dissonance is reduced through justifications for their behavior. Thus, the present state of dissonance is a limitation for adopting climate change adaptation actions, evidencing the need to modify the behavior of beekeepers, through training to inform and explain the nature of climate change and its impacts; to place the beekeepers within this context, where they can contribute technical elements that may allow them to reorient their work, promoting an objective and constructive perception, which will generate a positive attitude in the face of the challenges that climate change represents, so that they may modify their behavior as much as necessary in order to keep the activity profitable in Mexico.

Key words: Adaptation, Perception, Attitude, Beekeepers, Apis mellifera.

Received: 08/01/2019 Accepted: 27/11/2019

Introduction Climate change is the greatest challenge for humankind in the 21st century. The greenhouse effect associated with the phenomenon causes negative environmental, social and economic effects in the various productive sectors(1). Therefore, maintaining optimal development of the primary sector in rainfed systems poses a challenge for Latin American countries in the face of the negative effects of climate change(2).

Beekeeping is an important activity and an option for the growth of the primary sector in developing countries(3). Worldwide, Mexico ranks sixth in honey production and, on average, third as an exporter of this product, generating foreign exchange for $93,725 million dollars(4).

Beekeeping depends on a range of stable climatic conditions for its optimal development(5).

The impacts of climate change on beekeeping occur as a relational phenomenon within a local context(6). Therefore, both a potential direct impact on this activity (considering the intra- and interspecific response of the flora and the honey bees), through the space-time mobility of melliferous blooms(7), and an indirect impact on the socio-economic factors of beekeepers are to be expected(8).

239

Rev Mex Cienc Pecu 2021;12(1):238-255

Beekeepers have empirical and technical knowledge regarding the bees and their environment, as well as local climate variability(9), which defines their perception of climate change and the generation of ideas that can influence the acceptance of adaptation strategies and their behavior(10).

Leon Festinger's Cognitive Dissonance Theory (CDT) helps explain the individual and societal incongruity that climate change generates in people, as well as the justification for such an attitude or behavior. According to this theory, the ideal state is the cognitive congruence or harmony and, therefore, the internal incongruence of the system of ideas or cognitions that are generated in an individual arises in the face of simultaneous contradiction between two of them or of a behavior contrary to their beliefs(11).

When dissonance occurs, the stress generated thereby makes the individuals uncomfortable and, therefore, these try, unconsciously, to reduce their own discomfort or stress in various ways, e.g., a) through thoughts that justify their behavior, whereby the individual accepts that the action taken is the right one; b) through modification of behavior, and c) by living with the internal conflict, although this generates other states in the mental health of the individual(12,13).

Research in this area has shown that there is cognitive dissonance between the perception of climate change (according to the belief system of the individual) and its influence on the adoption of adaptation strategies in the agricultural sector(14,15).

Hence, there is a need for beekeepers to distinguish their perception of climate change from the cognitive dissonance generated in them between their perception, their attitude and their behavior in relation to the adaptation strategies in the face of climate change, as well as to determine the manner in which this incongruence of cognitions can be reduced, so that they may understand those ideas that limit the adoption of adaptation strategies and propose these actions themselves(16).

Material and methods The state of Veracruz is the fifth largest producer of honey and the first producer of beeswax in Mexico. Within the state, the central beekeeping region (97° 27' 0'' N, 95° 26' 41.9'' N, 18°31' W), of which has approximately 244.86 km2 are forests, 1.37 km2 is jungle, 101.88 km2 (1.72 %) is shrubbery, and 2,698.68 km2 are agro-ecosystems, and which contributes over 35% of the state’s production of honey and beeswax, was selected(17).

240

Rev Mex Cienc Pecu 2021;12(1):238-255

Sample and procedure

In order to obtain the information, a survey was designed and applied to 88 beekeepers, so as to explore the cognitive relationship, based on Festinger's CDT(18), between perception, attitude and behavior in the face of climate change, as well as the adaptation strategies that are practiced or that can be implemented.

Because there was no official beekeeping census in the central region, the list of beekeepers who were issued a Varroa destructor infestation certificate (which was not considered as an indicator or selection parameter) by the national governing body in the state delegation of the Ministry of Agriculture, Livestock, Rural Development, Fisheries and Food (SAGARPA) during the 2012-2013 period, was considered as the sample population, being the only information available to obtain a list of beekeepers.

The sample size was estimated by means of William Scheaffer's formula(19), n= N𝜎 2 /[(N1)D+𝜎 2], considering as the sample population the list of beekeepers described above. The values utilized were: n= 247, standard deviation of the number of beehives (𝜎)= 200.6 and B= 34.4. With the information collected, an exploratory analysis was carried out with the Statistica© 7 software, using univariate methods, for the cognition forms perception, attitude and behavior. Finally, these three cognition forms were associated through a bivariate analysis in order to explore the presence of dissonance among them.

Questionnaire

A questionnaire with 10 open questions for the perception and behavior cognitions, categorized according to the answers of the beekeepers, was designed and applied; a content analysis was carried out(20) to identify emerging analytical categories.

The attitude questions considered the willingness of beekeepers to adopt nine climate change adaptation strategies; for this purpose, each item was arranged in a Lickert scale, in which the categories and their values were: (5) Strongly Agree (SA), (4) Agree (AG), (3) Neutral (IN), (2) Disagree (DG), (1) Strongly Disagree (SD) Considering the response value (3) as a low positive attitude, and the response (5), as a very high positive attitude.

The Lickert formula was defined as: LI=TS/TNOS, where LI (Lickert index); TS (total score), and TNOS (total number of statements).

241

Rev Mex Cienc Pecu 2021;12(1):238-255

The cognitive dissonant elements were explored by analyzing bivariate histograms delimited by a matrix for interpreting the inconsistent state(21). Four quadrants were used, each of which represents a potential cognitive status of the beekeepers, in a positive or negative way as follows (Figure 1): Quadrant I, positive dissonant: (1) and (2) has a negative attitude towards adaptation strategies but carries them out. Quadrant II, positive consonant: (1), (2) and (3), has a positive attitude towards adaptive strategies and carries them out. Quadrant III, negative consonant: (1) and (2) has a negative attitude towards adaptive strategies and does not carry them out. And Quadrant IV, negative consonant: (1), (2) and (3) has a positive attitude towards adaptive strategies but does not carry them out.

Figure 1: Attitude versus behavior cognitive status decision matrix

Results Beekeepers' perception of climate change

In order to determine whether climate change was a problem and how important it might be in relation to other situations, the first question was: What do you think is the main problem that beekeeping faces today? 66.4 % of the answers were "climate variation", followed by "the variation in the flowering seasons". The next most frequent answer was the lack of space or the increase in the number of apiaries per area (17.1 %) (Figure 2).

242

Rev Mex Cienc Pecu 2021;12(1):238-255

Answers

Figure 2: Perception of the main problem for beekeeping in the central region

Climate variation Variation of the flowering Lack of spaces Materials and supplies costs Bureaucratic procedures Others Stealing of beehives Plagues and diseases

0.0

5.0

10.0

15.0

20.0

25.0

30.0

35.0

40.0

45.0

Percentage

In question number two, what do you understand by climate change? 30.2 % answered that it is "a problem of seasonality"; another 24 % defined it as "changes in natural cycles due to deforestation"; 13.5 % answered "I don't know", and 12.5 % mentioned "global warming" (GW) (Figure 3).

Figure 3: Beekeepers' perception of the concept of climate change

When asked through which media they had learned about climate change, most beekeepers answered, through the television (39 %) as the most important information medium, followed by the newspapers (20 %).

The next question was: Do you remember any extreme weather events that have affected beekeeping? 70 % answered "Yes". Of those 58 % mentioned as the main event "the shortage of blooms", because of a climatic event that beekeepers called "an unexpected frost", in two different areas; one was the area of the high plains (51 %) corresponding to

243

Rev Mex Cienc Pecu 2021;12(1):238-255

the state of Veracruz, and the other, the area of the high plains corresponding to the state of Puebla (59 %).

Given that the producers of the region had an average experience of 20 yr in the activity(8), they were asked: "Do you remember a particular year in which the production of honey has been low or bad?” 35.2 % of the beekeepers perceived 2010 to have been such a year, due to the presence of a hurricane. Although when reviewing the state's production volume records, 2005 was found to be the year with the lowest production(17), while only 1.4 % of beekeepers remembered that year as, "a bad year in bee production" (Figure 4). In 2010, Mexico was hit by hurricane Karl, which affected this beekeeping region through the loss of beehives(22), and thereby the relationship between the meteorological phenomenon and honey production was confirmed, although this does not coincide with the official records of production in that year(17). Nevertheless, for beekeepers, the economic impact marked that year as a bad year for production.

Figure 4: Perception of the years with presence of extreme weather events that damaged beekeeping in the central region, versus the total production reported in the state

Based on the perception of the climatic conditions in the last two decades, 97.7 % of the beekeepers perceive that the climate in the region has changed. Hence, the following question: How have the climatic factors temperature, rainfall, drought, and frost changed in the last twelve years? In order to answer this question, three categories of change were established: a) qualitative: whether the beekeeper perceived an increase, decrease or constancy in the climatic factors; b) frequency: whether an increase, decrease or constancy in the pattern of the event was perceived; and, finally, c) intensity: whether the events had decreased or increased the force of impact.

244

Rev Mex Cienc Pecu 2021;12(1):238-255

Reportedly, 95.5 % of the producers perceived a qualitative increase in temperature; 71.6 %, in precipitation, and 47.7 %, in drought, but no change in frost. Regarding changes in frequency, 83 % of the individuals perceived an increase in temperature; 56.8 %, in precipitation, and 30.7 %, in droughts, while no changes were perceived in frosts. In terms of intensity, 87.5 % of the individuals perceived that changes in temperature are more severe; 69.3 %, that precipitation is more intense, while 59.1 % perceived that drought conditions remain the same, and 38.6%, that frosts have remained constant (Figure 5).

Figure 5: Changes in four climatic factors involved in the beekeeping activity.

In regard to question eight — “In the last years have you noticed changes in the beekeeping interest blooms?—, 100 % perceived changes in the blooming and changes that affected the volumes of honey production. Based on this fact, they were asked if they knew of any adaptation measures in beekeeping to reduce the impact of climate change, and which ones they knew of. 71.6 % were aware of certain adaptation strategies: reforestation with melliferous species (35 %), artificial feeding (32 %), queen replacement (11.1 %), better apiary management (11.1 %), and transhumance (10 %).

Beekeepers' attitude to climate change Table 1 shows the frequency of response in the nine statements, where the activity of "Reforesting" stands out, with 92 % of the interviewees having said to "SA" with the "Replacement of certified queens", while fifty-one percent "SA", although the lack of productive viability of the acquired biological material, the costs, and the lack of trust in the distributors have a negative influence on this activity. For example, in the state of Yucatan, 245

Rev Mex Cienc Pecu 2021;12(1):238-255

queen breeders cover less than 1% of the demand. The remaining percentage is covered (when extremely necessary) with queen bees from different states that may be carriers of diseases or genotypes that will not prove highly productive in the region(23).

Table 1: Percentage of responses in attitude variables Attitude Variable 1

2

3

Reforesting

4

5

8.0

92.0

23.9

72.7

Replacement wih own queens

1.1

2.3

Replacement with certified queens

1.1

3.4

4.5

39.8

51.1

Changes in management tasks

8.0

10.2

8.0

23.9

50.0

17.0

79.5

Technical assistance

1.1

Adoption of GBP

1.1

26.1

72.7

More working hours

1.1

19.3

79.5

3.4

17.0

76.1

4.5

15.9

79.5

Bloom logs

1.1

Driving and work logs

2.3

The statement "Changes in apiary management" had a cumulative percentage of 50% in "SA" and while the other half showed a "IN" (neutral) or negative attitude. Despite the fact that 72.7 % said they were willing to adopt the provisions of the Good Beekeeping Practices "GBP". In the case of beekeepers, the "adoption" of such practices is perceived merely as a requirement to access support programs and not as a method to produce honey under technical recommendations, which should help beekeepers to carry out management records for the planning of the next cycle, similarly to the actions carried out by beekeepers in other countries such as Nigeria(4).

Two attitudinal questions including perception and behavior were established. The first is: “Are you willing to implement any of the above strategies that you are not currently carrying out within your beekeeping activities, and what activity would that be?” The most frequent response was "reforestation", with 59 %, followed by a percentage of the population that answered "none" (29 %); others answered, "artificial feeding" (7 %) and "change management" (3 %), and only 1 % mentioned "receiving technical assistance or training".

246

Rev Mex Cienc Pecu 2021;12(1):238-255

The last question in the section was: “What actions do you think federal and state institutions should be taking to help beekeepers adapt to climate change?” 46.6 % said that "economic resources should be allocated directly" to them, allowing them to decide on how to spend these; 13.6 % stated that "melliferous species reforestation programs should be implemented", and 10.2 % said that institutions should "facilitate and speed up beekeeping procedures" for transhumant beekeepers. The remaining percentage considered actions such as: "prohibition of pesticides" (7.9 %), "conservation of natural areas" (7.9 %), "beekeeping training" (5.7 %), "supervision of apiaries" (3.4 %), "dissemination of the importance of pollinators" (2.3 %) and "promote national consumption of honey" (2.2 %).

Behavior of beekeepers in the face of climate change In this section, the question was asked: “Have you implemented any strategies to adapt to current climate conditions and maintain production?” 80.7% said that at least some of the strategies have been implemented as an adaptation measure. However, the remaining 20.3% carry out some of these activities, but do not identify them as adaptation strategies. For example, artificial feeding (42.3 %), reforestation of melliferous species (26.8 %), replacement of queens (12.7 %), management changes in the apiary (9.9 %), transhumance (7.0 %), and genetic improvement (1.4 %).

To conclude the section, was asked: “What is the main limitation or obstacle for not carrying out any of the previous strategies?” Only 89.7 % answered: 56.9 % said "lack of economic capital"; 15.4 %, "indifference"; 5.0 %, "lack of own physical spaces" (for reforestation); 7.6 %, "lack of support from the government"; 5.0 %, "lack of time", and 2.5 %, "institutional bureaucracy" in procedures for the mobility of beehives.

Cognitive dissonance in the face of climate change Beekeepers were observed to perceive climate change as a problem for their activity, through a system of ideas associated with beekeeping, i.e., a lag or change in the seasons (rain, dry and frost) and in blooming within an annual cycle.

This shows that the perception is built based on the effects that occur in beekeeping and ignores the origins and causes of the phenomenon at the global level. Therefore, the attitude and behavior regarding implementing adaptation strategies will depend on the perception of the negative impacts of the phenomenon on beekeeping, as shown by the decision matrix in Figure 1, and are as follows: Reforesting. - It exhibited negative dissonance, since 72.73 % of the beekeepers expressed that they "SA" to carry out this practice. They regard the reforestation of melliferous 247

Rev Mex Cienc Pecu 2021;12(1):238-255

species as relevant; however, only 19.33 % perform this action (Figure 6A); the dissonant beekeepers justify themselves by reinforcing the idea that they lack spaces of their own to implement it.

Figure 6: Cognitive dissonance in beekeepers regarding attitude and behavior in adaptation strategies

A) Reforestation, B) Replacement with own queen broods, C) Replacement with certified queen broods, D) Management, E) Good production and manufacturing practices, F) Increased number of visits to the apiary, G) Technical assistance for artificial feeding, H) Registration of blooms for transhumance.

Strongly Agree (SA), Agree (AG), Neutral (IN), Disagree (DG), Strongly Disagree (SD) 248

Rev Mex Cienc Pecu 2021;12(1):238-255

Queen replacement. – It exhibited a negative dissonance, 71.59 % of the beekeepers “totally agree", and 23.86 % disagree, but only 1.14 % carry out this practice. However, in this same strategy, negative consonant beekeepers were observed, 2.27 % of whom claimed to “disagree", and 1.14 %, to “totally disagree” (Figure 6B). As for replacement with their own queens, this activity exhibited a similar state of dissonance between the "disagree" (43.18 %) and “agree” (7.95 %) attitude versus behavior, since only 9.09 % carry out this action, while 4.55 % maintained the negative consonant status (Figure 6C).

Management activities. – Here, most of the beekeepers who “totally disagreed" (47.73 %), "agreed" (20.45 %), and were "neutral" (7.95 %) were in a negative dissonant state, and only 5.68 % had made any changes in the management of their apiaries. A lower percentage were negative consonant in the "disagree" (7.95 %) and "totally disagree" attitudes (7.95 %) (Figure 6D).

GBPs. - There was a negative dissonance between the percentage of beekeepers who said that they “totally agree" ( 75 %), "agree" (15.91 %) and are "neutral" (1.14 %), versus 7.96 % who said they had taken action to implement GBPs (Figure 6E).

Artificial feeding and technical assistance - Artificial feeding of bees as an element linked to technical training was contrasted with the willingness of beekeepers to attend training courses, so that the negative cognitive dissonant state occurred in 65.91 % of beekeepers who "agree" and "totally agree" versus behavior, as only 30.68 % said that they were carrying out this practice, while negative consonance occurred in 2.28 % of the beekeepers (Figure 6G).

Bloom log, work log, and transhumance - Although transhumance is the main type of beekeeping practiced, it is not conceived as an adaptation strategy per se; however, when contrasting this activity with the willingness to keep bloom logs, 92.05 % of the beekeepers were observed to be willing to make such records and identify the need and importance of it, but only 4.55 % do so (Figure 6H), displaying negative dissonance between these two ideas.

Table 2 shows that most beekeepers are in a state of negative cognitive dissonance, which, according to the CDT, is a common cognitive status, as few things are clear enough to allow opinions and behaviors to be anything other than a mixture of contradictions(12).

249

Rev Mex Cienc Pecu 2021;12(1):238-255

Table 2: Cognitive status between attitude and behavior of adaptation strategies in beekeeping Strategy

Reforesting

Dissonant Consonant (+) (-)

Consonant Dissonant Total (%) (+) (-)

1.1

6.8

19.3

72.8

100

Replacement with own queens

0

3.3

1.1

95.6

100

Replacement with certified queens

0

4.5

10.3

85.2

100

2.3

16

5.7

76.0

100

Technical assistance

1

2.2

30.8

66.0

100

Adoption of GBPs

0

1.1

8.0

90.9

100

More working days

0

0

7.9

92.1

100

2.2

4.6

92.1

100

Changes in management tasks

Bloom log

1.1

Discussion The analysis of the beekeepers' cognitive system on climate change according Festinger's CDT showed that most beekeepers have a negative cognitive dissonance. Beekeepers perceive the effects of climate change on beekeeping; however, they do not have a precise definition of the concept and causes of this phenomenon —a fact that evidences information gaps, as well as erratic ideas(24).

This confusion of the concept is attributed to the information received from the media(25).

For example, the scientific community talks about climate change, the news of global warming and the emission of greenhouse gases (GHG) by oil industry. This produces a heterogeneous idea in the public, while the correct subjective assessment of the phenomenon by the population should motivate changes in behavior under personal responsibility. Given which, understanding the human influence on climate change is a prerequisite for accepting the need to carry out adaptation and mitigation actions(26,27).

250

Rev Mex Cienc Pecu 2021;12(1):238-255

In this research, the perception of climate change in beekeeping was motivated by the productive needs of beekeepers and the negative impacts generated in beekeeping(6,28) — similarly to beekeepers and honey hunters in Africa, who perceive the negative effects of climate change, through the increase or decrease in temperature and rainfall patterns, depending on the season and the type of beekeeping they carry out(29), as well as to maize producers in the northern United States, who recognize that some form of climate change exists, but minimize the participation of human activities in it(15).

When contrasting attitude and behavior, the majority exhibited a state of negative dissonance despite the positive disposition of the beekeepers (IL: 4.7). The simultaneous incompatibility between these two cognitions generated arguments aimed at reducing the dissonant state(13). People do not incorporate the effects or the origins of climate change(12), and they consciously delegate the responsibility and solution to other citizens or groups, including authorities, specialists or government institutions(30).

The above shows that climate change is perceived and recognized in a certain way(26), but only when the problem has an economic impact is it common sense to incorporate it into the system of cognitions as a priority(25).

Therefore, the presence of dissonance is generated when the beekeepers are not capable of carrying out the actions that they say they would be willing to perform in order to maintain their livelihood, relativizing the problem as a way of reducing the stress generated by the incongruence in the cognitive system(13). This may cause potential negative effects on beekeeping, such as low profitability, poverty, and abandonment of the activity(7), since the beekeepers assume that "nothing can be done against the climate".

Therefore, it is necessary to integrate a training program aimed at informing and explaining the nature of climate change and its impacts; to situate the beekeepers within this context, where they can adopt elements that may allow them a clear perception that will promote a positive attitude and motivate their actions. In this sense, it is necessary to design not only formal training programs but also informative and dissemination programs that may reach the population through mass media.

251

Rev Mex Cienc Pecu 2021;12(1):238-255

Conclusions and implications The study shows that beekeepers perceive the phenomenon of climate change as the main problem for their activity but do not relate the causes and effects of the phenomenon to other aspects of their daily life. Despite having a positive attitude towards adaptation strategies, they generally fail to implement them. Thus, the cognitive dissonance present between attitude and behavior is reduced through rational arguments that allow them to justify the incongruence between what they want to do and what they do. Finally, it is recommended to include the needs and belief systems of the beekeepers that can influence the adoption of adaptation strategies. This requires involving other social, economic, and technological variables that may influence the present state of cognitive dissonance.

Literature cited: 1. Ocampo O. El cambio climático y su impacto en el agro. Rev Ing 2011(33):115-123. https://www.redalyc.org/articulo.oa?id=121022658012. Consultado: Jul 20, 2018.

2. Vergara W, Rios A, Trapido P, Malarín H. Agricultura y Clima Futuro en América Latina y el Caribe: Impactos sistémicos y posibles respuestas. Washington, D.C.: Banco Interamericano de Desarrollo. 2014:24.

3. Huerta G. La apicultura en el desarrollo. 2008:25-27.

4. FAOSTAT. Datos sobre alimentación y agricultura. Ganadería primaria/producción.

FAO. 2019. http://www.fao.org/faostat/es/#data/QL. Consultado Feb 17, 2017.

5. Delgado DI, Eglee PM, Galindo-Cardona A, Giray T. Forecasting the influence of climate change on agroecosystem services: Potential impacts on honey yields in a small-island developing state. https://doi.org/10.1155/2012/951215 Psyche 2012:1-10.

Accessed: Ago 14, 2018.

6. Smith WJ, Liu Z, Safi AS, Chief K. Climate change perception, observation and policy support in rural Nevada: A comparative analysis of Native Americans, non-native ranchers and farmers and mainstream America. Environ Sci Policy 2014;42:101-122. http://www.sciencedirect.com/science/article/pii/S1462901114000641. Accessed: Jul 17, 2018.

7. Castellanos-Potenciano B, Gallardo-López F, Díaz-Padilla G, Pérez-Vázquez A, Landeros-Sánchez C. Spatio-temporal mobility of apiculture affected by the climate change in the beekeeping of the Gulf of Mexico. Appl Ecol Environ Res 2017;15(4):163-175. http://www.aloki.hu/indvol15_4.htm.

252

Rev Mex Cienc Pecu 2021;12(1):238-255

8. Castellanos-Potenciano BP, Gallardo-López F, Díaz-Padilla G, Pérez-Vázquez A, Landeros-Sánchez C, Sol-Sánchez A. Apiculture in the humid tropics: Socio-economic stratification and beekeeper production technology along the Gulf of Mexico. Glob Sci Res J 2015;3(9):321-329. Accessed: Sep 10, 2018.

9. Lehébel-Péron A, Sidawy P, Dounias E, Schatz B. Attuning local and scientific knowledge in the context of global change: The case of heather honey production in southern France. J Rur Stu 2016; 44:132-142.

10. Tam J, McDaniels TL. Understanding individual risk perceptions and preferences for climate change adaptations in biological conservation. Environ Sci Pol 2013; 27:114123. http://www.sciencedirect.com/science/article/pii/S1462901112002328.

11. Festinger L. A theory of cognitive dissonance. Stanford, California: Stanford University Press; 2017.

12. Oltra C, Sola R, Sala R, Prades A, Gamero N. Cambio climático: Percepciones y discursos públicos. Cambio climático: Percepciones y discursos públicos. Barcelona: Centro de Investigación Sociotécnica-CIEMAT; 2009:1-23.

13. Ramoa-Meza J. Acciones para reducir la disonancia cognitiva en el personal civil de la Escuela de Formación de Guardias Nacionales (Esguarnac). Rev Mun FESC 2018;7(14):31-41. http://www.fesc.edu.co/Revistas/OJS/index.php/mundofesc/article/view/139/187.

Consultado: Jun 8, 2018 14. Ayal DY, Leal Filho W. Farmers' perceptions of climate variability and its adverse impacts on crop and livestock production in Ethiopia. J Ar Environ 2017;140:20-28. http://www.sciencedirect.com/science/article/pii/S0140196317300071.

15. Mase AS, Cho H, Prokopy LS. Enhancing the Social Amplification of Risk Framework (SARF) by exploring trust, the availability heuristic, and agricultural advisors' belief in climate change.

J Environ Psycho 2015; 41:166-176. http://www.sciencedirect.com/science/article/pii/S027249441500002X. 16. Magrin G. Adaptación al cambio climático en América Latina y el Caribe In: (CEPAL) CEpALyeC editor. Adaptación al cambio climático en América Latina y el Caribe Impreso en Naciones Unidas, Santiago de Chile 2015:80.

253

Rev Mex Cienc Pecu 2021;12(1):238-255

17. SIAP. Anuario Estadístico de la Producción Ganadera. Anuario Estadístico de la Producción Ganadera. 2017.

18. Ovejero A. La teoría de la disonancia cognoscitiva. Psicothema 1993;5(1):201-206. https://www.redalyc.org/articulo.oa?id=72705116. Consultado: Nov 14, 2017.

19. Scheaffer R, William M, Lyman O. Elementos del muestreo. 6ta ed.; Madrid, España: Paraninfo; 2006.

20. Kaefer F, Roper J, Sinha PA. Software-assisted qualitative content analysis of news articles: Example and reflections. Forum: Qualitative Social Res 2015;16(2).

21. Cisneros SP. Percepción, actitud y comportamiento de productores ganaderos y otros actores sociales hacia la sustentabilidad de la ganadería bovina [Tesis doctorado].

Veracruz, México: Colegio de Postgraduados; 2015.

22. CONAGUA. Resumen del huracán Karl. In: CONAGUA editor. Resumen del huracán Karl. 2010.

23. De Araujo FC, Quezada EJJ. Las abejas reinas en los sistemas apícolas.

Bioagrociencias 2011;4(2):28-31.

24. Ukamaka DM, Eberechukwu NL. Indigenous climate change adaptation strategies used by honey producers in rural communities of Enugu State, Nigeria. J Agri Exten 2018;22(2):180-192.

25. González GEJ. La representación social del cambio climático: una revisión internacional. Rev Mex Inv Educ 2012; 17:1035-1062.

26. McClelland JC. Reconstructing student conceptions of climate change; An inquiry approach [Thesis or Dissertation]. Minnesota, USA: University of Minnesota 2015.

27. Sander van der L. Determinants and measurement of climate change risk perception, worry, and concern. In: Nisbet MC, et al editors. The Oxford encyclopedia of climate change communication. Oxford, UK: Oxford University Press; 2017:1-58.

28. Hegland SJ, Nielsen A, Lázaro A, Bjerknes AL, Totland O. How does climate warming affect plant-pollinator interactions?

Ecol Lett 2009;12(2):184-195. https://doi.org/10.1111/j.1461-0248.2008.01269.x.

29. Paraïso A, Sossou A, Iz-Haquou D, Nérice RAS. Perceptions and adaptations of beekeepers and honey hunters to climate change: The case of the communes of Natitingou and Tanguieta in northwest of Benin. Afri Crop Sci J 2012;20:523-532.

254

Rev Mex Cienc Pecu 2021;12(1):238-255

30. Peláez GM, Bravo DB, Gutiérrez-Yurrita J. Percepción ciudadana de la institucionalización de la política mexicana de cambio climático. Rev Aran de Der Amb 2015;30.

255

https://doi.org/10.22319/rmcp.v12i1.5408 Article

Evaluation of two supplemental zilpaterol hydrochloride sources on meat quality and carcass traits of crossbred Bos indicus bulls in the tropics

Pedro Antonio Alvarado García a María Salud Rubio Lozano a* Héctor Salvador Sumano López b Luis Ocampo Camberos b Graciela Guadalupe Tapia Pérez c Enrique Jesús Delgado Suárez d Jeny Aguilar Acevedo b

a

Universidad Nacional Autónoma de México (UNAM). Facultad de Medicina Veterinaria y Zootecnia (FMVZ), Centro de Enseñanza Práctica, Investigación en Producción y Salud Animal. México. b

UNAM, FMVZ Departamento de Fisiología y Farmacología. México.

c

UNAM, FMVZ, Departamento de Genética y Bioestadística, Departamento de Medicina Preventiva y Salud Pública. México. d

UNAM, FMVZ. Avenida Universidad 3000, Ciudad Universitaria, Ciudad de México, México.

* Corresponding author:msalud65@gmail.com

Abstract: It was studied the effect of two zilpaterol hydrochloride (ZH) brands on carcass and meat quality traits of crossbred Bos indicus young bulls under tropical conditions. The patented ZH formulation (Zilmax®, ZHp) and a generic brand (Zipamix®, ZHg) were added to the 256

Rev Mex Cienc Pecu 2021;12(1):256-272

feed (6 ppm) for 30 d before slaughter. Animals (n= 288) were randomly assigned to 1 of 3 diets, with 32 animals per pen and 3 replicates, for a total of 96 bulls per treatment: 1) basal diet without ZH (Control), 2) basal diet supplemented with Zipamix® at 6 ppm in the diet, as fed-basis (ZHg), and 3) basal diet supplemented with Zilmax® at the same concentration in the feed (ZHp). Carcass yield traits were significantly improved by ZH supplementation.

Carcasses of ZH-treated bulls were 6-9 kg heavier (P=0.0023) and produced about 8-10 kg more of lean tissue (P<0.0001) as compared to the Control group. Carcass quality traits were less affected by ZH supplementation. Among meat quality attributes, ultimate pH of ZHg (5.81) and ZHp (5.89) was higher (P=0.0022) than that of the Control (5.78). Results showed both ZH brands, when administered for 30 d before slaughter, as recommended by the manufacturer, improve most carcass yield traits without compromising carcass or meat quality attributes. Hence, tropical beef producers may use the ZH formulation of lowest cost to improve their productivity.

Key words: Zilpaterol hydrochloride, Generic, Yield grade, Quality grade, Carcass, Beef, Bos indicus.

Received: 07/06/2019 Accepted: 09/12/2019

Introduction The food demand is predicted to increase 70 % by the year 2050(1). This imposes a significant challenge on food production, particularly meats, which represent a significant proportion of the human diet(1). Consequently, meat producers have adopted different technologies aimed at maximizing productivity. Among these, growth promoters have been shown to improve animal performance and carcass traits in several livestock species, including beef cattle(2).

Zilpaterol hydrochloride (ZH) is approved as a growth promoter for beef cattle in Mexico, North America and South Africa. It has been reported that steers supplemented with ZH improve their carcass weight between 5 and 7 % and their dressing percentage between 3 % and 3.5 %, as compared to untreated animals(3,4). Moreover, feed supplementation with ZH has been shown to increase the longissimus muscle area(5), which is positively correlated with meat yield.

257

Rev Mex Cienc Pecu 2021;12(1):256-272

While positive effects of ZH on carcass traits are well documented in Bos taurus cattle, studies on Bos indicus are very limited. This information is relevant in several countries, such as Mexico, where 90 % of the slaughter population have a strong B. indicus genetic background(6), which is associated with poorer growth performance, carcass traits, and meat quality characteristics. Moreover, although ZH supplementation is known to increase utility per animal(7), the cost per kilogram of meat produced with ZH has been estimated at 1.53 to 1.62 USD(8), which represents around 35 to 40 % of the average market price per kg of beef carcasses in Mexico(9). After the patent for ZH formulation expired, several generic ZH brands (ZHg) have become available. Since ZHg may represent a cheaper alternative as compared to the patented product (ZHp), ZHg brands have been recently studied. Avendaño-Reyes et al(2) observed no differences in slaughter weight or carcass traits of crossbred cattle (75 % B. indicus, 25 % B. taurus) treated with either a ZHg or the ZHp. However, this study was conducted with a limited number of animals per treatment (n=15). A former publication by the same research group of this study(10) also reports no differences in feedlot performance, beef proximate composition or consumer acceptability of meat from crossbred cattle (75 % B. indicus, 25 % B. taurus) treated with either a ZHg or the ZHp. Nonetheless, data on their effects on carcass and meat quality traits are limited. This information is necessary for a better assessment of the cost-benefit ratio of ZH use in feedlot cattle of B. indicus genotypes under commercial conditions. Therefore, the objective of this study is to assess differences in carcass traits and meat quality of B. indicus young bulls supplemented with either a ZHg (Zipamix®, PiSA agropecuaria, Mexico) or ZHp (Zilmax, MSD, Summit, NJ, USA) under tropical conditions.

Material and methods Animals and treatments

The study was conducted during the summer of 2016 in a company from San Luis Potosi, Mexico, which integrates a commercial feedlot and a beef slaughterhouse operation. All animals were managed according to official Mexican standards for the care and management of animals during transport and slaughter(11,12).

A total of 810 crossbred young bulls were selected for the experiment, based on the following criteria: 1) Only healthy animals were admitted, 2) A minimum of 50 % B. indicus genetic background, 3) Not older than 24 mo of age, and 4) Not less than 430 kg live weight. Animals meeting these requirements were distributed in nine pens of 90 animals each. Pens were 40 x 45 m and had 16 % of shade covering mainly the feeders. The animals had ad libitum access

258

Rev Mex Cienc Pecu 2021;12(1):256-272

to water by means of automated water systems (two per pen), which were located at the side of each pen.

Upon selection, all bulls received an ivermectin injection (Dectiver®, Lapisa, Mexico) at a dose of 200 µg/kg, to control ectoparasites, and were vaccinated for clostridial diseases (Ultrabac/somubac®; Zoetis, Mexico). They also received an anabolic implant (200 mg of trenbolone acetate and 28 mg of estradiol benzoate, Synovex-plus®, Zoetis, Mexico) in the left ear. Animals were subjected to an adaptation period of 2 mo before beginning the test.

Bulls were monitored daily and animals with evident signs of disease or injuries were removed from the trial. Finally, to conduct the experiment, animals were randomly assigned to three groups (n= 32) with three replicates each, as follows: 1) Basal diet without ZH (control), 2) Basal diet supplemented with the generic ZH brand Zipamix® at 6 ppm in the diet, as fed-basis (ZHg), per manufacturer’s instructions, and 3) Basal diet supplemented with the patented ZH brand Zilmax® at the same concentration in the feed (ZHp), as recommended by the manufacturer. Both ZH commercial brands contain 48 g of the active ingredient per kilo of product, and the amount of commercial preparation added was 125 g/kg of feed in both cases.

All groups received the same corn-based basal diet (Table 1). Both ZH brands were included in the vitamin-mineral premix before it was incorporated into the basal diet. For that purpose, we weighed supplemental ZH to the nearest 0.001 g and mixed it thoroughly for about 5 min with the other premix ingredients in a paddle mixer. To prevent cross-contamination, the mixer was cleaned before preparing each experimental diet. The premix was prepared weekly, and the feed was prepared with and without ZH twice daily. We tested the uniformity of ZH mixing in batches of 5, 6, and 7 tons of ZH-supplemented feed (12 samples from each batch), with the aid of micro-tracers (Micro-Tracers Inc., San Francisco, USA), as previously described(13). Feed was served twice daily (0700 and 1300) using Rotomix® automated trucks (International Trucks®, TX, USA), with an integrated weighing machine to verify the quantity. A 3 % food excess was delivered based on previous food consumption records per body weight. Unconsumed feed was removed, weighed and recorded daily.

259

Rev Mex Cienc Pecu 2021;12(1):256-272

Table 1: Dietary ingredients and chemical composition of the basal diet on dry matter (DM) basis Ingredient Dry-rolled corn Dry distillers grains Barley straw Sugar cane molasses Corn silage Tallow Elit-f (vitamin-mineral premix) Soybean flour

% 61.0 14.0 8.0 6.0 5.0 3.0 2.5 0.5

Chemical composition1 DM, % Crude protein, % Crude fat (ether extract), % Carbohydrates (excluding fiber), % Neutral-detergent fiber, % Acid-detergent fiber, % Ash, % Calcium, % Phosphorus, % NEm, Mcal/kg NEg, Mcal/kg

80.9 14.0 6.6 56.4 18.4 11.5 4.6 0.9 0.3 2.2 1.5

NEm and NEg calculations using equations proposed by NRC (2000).

The experimental feeding period lasted 30 d, followed by a 3-d withdrawal period of ZHg and ZHp, when all animals received the non-supplemented basal diet. On the third ZH withdrawal day, the bulls received only 40 % of their regular daily ration. Subsequently, 32 animals from each treatment were randomly selected and ship to the slaughterhouse for three consecutive days. Hence, a total of 96 bulls per treatment were actually evaluated.

Transportation to the slaughterhouse was done early in the morning (at around 0500 h). The trip took about 10 min since the slaughterhouse is only 1 km off the feedlot.

To prevent bias, the trial was conducted as a randomized blind study. Thus, the investigators involved in carcass and meat quality evaluation did not know to which treatment the animals belonged. Moreover, animals from each treatment were slaughtered in a different order each of the 3 d. Slaughter and fabrication were carried out in a Federally Inspected slaughterhouse,

260

Rev Mex Cienc Pecu 2021;12(1):256-272

following official regulations(11,12,14,15). It was recorded hot carcass weight (HCW) before carcass cooling at 2 °C for 24 h.

Carcass traits

Carcass traits were evaluated according to the USDA Beef Carcasses Grading System (16).

Overall maturity was determined based on lean and skeletal maturity. Carcasses were assigned to one of the following overall maturity degrees: 100=USDA A100/B00 or less, 200=USDA B00-C00, 300=USDA C00-D00, 400=USDA D00-E00, 500=USDA E00 or higher. It was also used USDA visual standards to determine the marbling degree of the m. longissimus thoracis (LM): 100=practically devoid00, 200=traces00, 300=slight00, 400=small00, 500=modest00, 600=moderate00 and 700=slightly abundant00. USDA quality grades were assigned based on marbling and maturity, as follows: Utility=300, Commercial=400, Standard=500, Select=600, Choice=700, Prime=800.

Kidney, pelvic and heart fat (KPH) was estimated as a percentage of hot carcass weight. It was also measured backfat thickness at the 12th rib, at ¾ of the top of the ribeye and perpendicular to the LM. Moreover, the lean area of the ribeye was drawn in an acetate and this was used to determined LM area with the aid of a planimeter (Digital type roller Placom KP-90N). These factors were used to assign carcasses to USDA yield grades 1 to 5(16).

Meat quality attributes

Beef color and ultimate pH (pHu) of LM were also determined at 24 h post mortem, after evaluating carcass traits. The pHu was determined as the average of two measures taken with a digital Hanna H199163 pH meter, with automatic temperature compensation and coupled with a penetration probe (Hanna Instruments, Woonsocket, Rhode Island, USA).Color measurements were performed following the American Meat Science Association Guidelines(17). The LM was allowed to bloom at 2 to 3 ºC for about 30 min before measuring instrumental color variables. It was used a HunterLab® MiniScan EZ 4500L (Hunter Associates Laboratory, Reston, Virginia) with a 10º observer and a 25-mm aperture size, set with illuminant A, the specular component excluded, and the CIELAB scale. The spectrophotomer was calibrated before conducting color measurements and at 100-reading intervals. It was taken a total of 3 to 4 readings of each LM, in a region free of fat deposits and/or connective tissue. The resulting color data (lightness, L*; redness, a*; yellowness, b*; hue, h*; chroma, C*) were averaged for statistical comparisons.

261

Rev Mex Cienc Pecu 2021;12(1):256-272

It was used pHu and L* values to estimate the incidence of dark-cutting beef for each treatment. The criteria used to identify a dark-cutter were pHu>6.0(18) and L*<35(19).For Warner-Bratzler shear force (WBSF) and cooking loss analyses, it was took a 2.5 cm thick steak from the LM between the 10th and the 12th ribs. The steak was vacuum-packed and aged for 11 d at 11 ºC. On d 12, it was frozen at -18 ºC for about 2 wk and slowly thawed at 4 ºC for 48 h before conducting the analyses. Both cooking loss and WBSF were determined according to the American Meat Science Association Research Guidelines for Cookery, Sensory Evaluation, and Instrumental Tenderness Measurements of Fresh Meat(20), as previously described(21).

Statistical analysis

The effect of ZH supplementation on carcass and meat quality traits was tested for significance through a one-way analysis of variance. It was used the General Linear Model procedure of Statgraphics Centurion XV software, version 15.2.05 for Windows (Statpoint Technologies Inc., Warrenton, VA). Initial weight, degree of B. indicus genotype and slaughter age did not differ between treatments. Hence, these variables were not considered as sources of variation in the model. When significant (P<0.05) differences between treatments were detected, means were discriminated using the Tukey’s range procedure. For proportion variables, it was conducted a chi-square test to determine if there was association between these variables and treatments.

Results and discussion Feed supplementation with both ZH brands significantly improved most carcass yield traits as compared to the control group (Table 2). In average, carcasses of ZH-supplemented bulls were 6 to 8 kg heavier than those of untreated animals. They also had higher LM areas and produced nearly 10 kg more of lean in relation to bulls fed the basal diet. Among the two carcass fatness variables, KPH was lowest in the ZHg treatment (P=0.0169). However, USDA yield grade was similar in both ZH treatments, and lower compared to the control group. This is consistent with the higher lean content of carcasses from ZH supplemented animals, which resulted in a higher proportion of USDA yield grade 1 in both ZH treatments (Figure 1). Overall, carcass yield traits across ZH brands were comparable.

262

Rev Mex Cienc Pecu 2021;12(1):256-272

Table 2: Effect of ZH supplementation on yield-related traits of bull carcasses Treatments1 Variable P-value Control ZHg ZHp 2 n=96 n=96 n=96 SEE Initial liveweight, kg 466.44 464.97 465.80 15.40 0.8032 Slaughter weight, kg 511.28 518.80 513.60 24.05 0.0872 a b b Hot carcass weight, kg 311.48 319.96 317.22 17.00 0.0023 a b b Lean, kg 181.42 191.42 189.68 12.98 <0.0001 2 a b b Longissimus muscle area, cm 69.17 75.53 76.89 10.63 <0.0001 Backfat thickness, cm 0.40 0.35 0.40 0.19 0.0562 b a ab Kidney, pelvic and heart fat, % 1.68 1.49 1.58 0.46 0.0169 b a a USDA yield grade 2.42 2.07 2.06 0.53 <0.0001 1

Treatments, control: no ZH supplementation, ZHg: generic ZH (Zipamix®) at 6 ppm in the diet for 30 d, ZHp: patented ZH (Zilmax®) at 6 ppm in the diet for 30 d.

2 Standard error of estimation. a,b Means with different superscript within row are different (P<0.05).

Figure 1: Relative frequency of USDA yield grade in carcasses of young bulls with no ZH supplementation (control) or supplemented with either a generic ZH (ZHg, Zipamix ®) or a patented ZH (ZHp, Zilmax ®) formulation at 6 ppm in the diet for 30 d (n=96 per treatment)

These findings are consistent with previous studies documenting a positive effect of ZH supplementation on carcass traits of B. taurus cattle(22,23). In general, results are also consistent with previous reports documenting a similar effect of different ZH brands on carcass traits of B. indicus bulls(10) and lambs(24). Nonetheless, these results fail to support previous observations of a limited effect of ZH supplementation on carcass leanness of B.

263

Rev Mex Cienc Pecu 2021;12(1):256-272

indicus cattle(2). This could be partially explained by differences in sample size, composition of the basal diet, as well as animal selection criteria between experiments, among other factors. Moreover, bulls we subjected to a pre-trial adaptation period of 2 mo, instead of the 7-d period used by Avendaño-Reyes et al(2), which may have led to different outcomes.

The changes induced by ZH supplementation on carcass quality traits were less pronounced (Table 3). For instance, dietary ZH did not affect marbling score (P=0.4991). In average, it remained around 300 (Slight category) across treatments, which is typical of bull carcasses from the tropics. In contrast, numeric values for overall maturity were significantly lower (P=0.0217) in carcasses from ZH-supplemented bulls as compared to the control group.

These differences, however, lack of practical importance since the average overall maturity of all treatments corresponded to the A category, which is typical of young animals.

Moreover, the average USDA quality grade for all treatments corresponded to a quality category between “Standard” and “Select”. In fact, around 90 % of carcasses from all treatments were graded as Standard or Select (Figure 2). Overall, as observed for yieldrelated traits, results for carcass quality traits were similar across ZH brands.

Table 3: Effect of ZH supplementation on quality-related traits of bull carcasses

Variable Marbling score3 Overall maturity4 Quality grade5 1

Treatment 1 Control ZHg n=96 n=96 305.10 303.23 b 136.26 116.46a 538.46 563.54

ZHr n=96 291.77 116.17a 556.38

SEE2 84.73 56.16 81.55

P-value 0.4991 0.0217 0.0993

Treatments, control: no ZH supplementation, ZHg: generic ZH (Zipamix®) at 6 ppm in the diet for 30 d, ZHp: patented ZH (Zilmax®) at 6 ppm in the diet for 30 d.

2 Standard error of estimation. Means with different superscript within row are different (P<0.05).

3 200=traces, 300=Slight, 400=Small.

4 100-199=A maturity; 200-299=B maturity; 300-399=C maturity.

5 Utility=300, Commercial=400, Standard=500, Select=600, Choice=700, Prime=800.

264

Rev Mex Cienc Pecu 2021;12(1):256-272

Figure 2: Relative frequency of USDA quality grade in carcasses of young bulls with no ZH supplementation (Control) or supplemented with either a generic ZH (ZHg, Zipamix ®) or a patented ZH (ZHp, Zilmax ®) formulation at 6 ppm in the diet for 30 d (n=96 per treatment)

It has been proposed that the slight decrease of marbling scores induced by ZH supplementation is not enough to modify carcass quality grade in B. taurus cattle(25). This is also applicable to the present experiment, considering B. indicus bulls produce leaner, lowquality carcasses. Overall, these results support previous findings documenting a limited effect of ZH supplementation on carcass quality attributes(2,26-28).

Regarding meat quality attributes (Table 4), beef from all treatments had similar WBSF values (P=0.1507). Despite meat was aged for 11 d, WBSF remained quite above 45 N, which is typical of tough meat(29), a phenomenon that is frequently observed in ZH-supplemented cattle(30-32). Moreover, this research involved young bulls with a strong B. indicus genetic background, which are known to produce tougher meat as compared to other sex and/or breed categories(33-35). It should be noted, however, that differences in WBSF among muscles are well documented(36-38). WBSF values reported here are limited to the LM muscle cooked to 70 ºC (well done) and subjected to 11 d of aging. It has been demonstrated that meat tenderness may differ if considering other muscles, longer aging times or a different endpoint cook temperature(32,39,40).

265

Rev Mex Cienc Pecu 2021;12(1):256-272

Table 4: Effect of ZH supplementation on meat quality attributes of bulls Treatments1 Control ZHg ZHr Variable n=96 n=95 n=93 SEE2 P-value Cooking loss, % 25.10 25.48 25.51 5.99 0.8704 WB shear force, N 59.70 64.16 63.61 17.26 0.1507 L* 40.40 39.88 39.66 3.72 0.3654 b a a a* 28.91 28.03 27.70 2.84 0.0099 b a a b* 20.65 19.68 19.02 2.82 0.0003 b a a C* 35.53 34.27 33.62 3.85 0.0024 b a a h* 35.43 34.86 34.40 1.83 0.0006 a b b pHu 5.78 5.81 5.89 0.23 0.0022 1

Treatments control: no ZH supplementation, ZHg: generic ZH (Zipamix®) at 6 ppm in the diet for 30 d, ZHp: patented ZH (Zilmax®) at 6 ppm in the diet for 30 d.

2 Standard error of estimation. a,b Means with different superscript within row are different (P<0.05).

Cooking loss was also similar across treatments (around 25 %), which is in the order of that observed in lean muscles(41,42). Again, these results may change if considering other cooking methods and targeted endpoint temperatures, as previously demonstrated(43,44). Ultimate pH was higher in meat from ZH-supplemented animals as compared to that from the untreated ones (P=0.0022). This may be an advantage from a meat processing standpoint since higher pH values are associated with better water holding capacity(45). However, the average pHu across treatments falls within the typical interval of “normal quality” beef(46).

Among instrumental color variables, only L* was not affected by ZH supplementation (P=0.3654). Conversely, both ZH brands reduced redness (a*) and yellowness (b*) of meat, which resulted in a less vivid red color, as shown by the lower C* and h* values. According to recent research(47), it is unlikely that these differences would have economic implications since Mexican consumers appreciate beef with a light red color.

The occurrence of dark-cutting beef does have a strong economic importance. While the frequency of dark cutters observed here is higher than that reported elsewhere(48,49), there is no evidence supporting it was due to ZH supplementation. In fact, the percentage of dark cutters was similar across treatments (𝜒 2 = 3.6; 𝑃 = 0.1661), with a rate of 6.3, 7.4 and 8.3 %, for control, ZHg, and ZHp, respectively. Therefore, the higher rates in relation to other trials are likely associated with differences in production practices, pre-slaughter handling procedures, as well as criteria used to classify carcasses as dark cutters.

266

Rev Mex Cienc Pecu 2021;12(1):256-272

Conclusions and implications In general, THE results showed dietary ZH supplementation of crossbred B. indicus young bulls, under tropical conditions, improves most carcass yield traits without compromising carcass or meat quality attributes. These effects are similar for the two ZH brands tested here when administered for 30 d before slaughter. Therefore, tropical beef producers may use the ZH formulation of lowest cost to improve their productivity.

Literature cited: 1.

FAO. Overview of the world meat market. http://www.fao.org/ag/againfo/themes/es/meat/background.html. Accessed May 15, 2019.

2. Avendaño-Reyes L, Meraz F, Pérez C, Figueroa F, Correa A, Álvarez F, Guerra J, López G, Macias U. Evaluation of the efficacy of Grofactor, a beta-adrenergic agonist based on zilpaterol hydrochloride, using feedlot finishing bulls. J Anim Sci 2016;94:29542961.

3. Shook JN, VanOverbeke DL, Kinman LA, Krehbiel CR, Holland BP, Streeter MN, Yates DA, Hilton GG. Effects of zilpaterol hydrochloride and zilpaterol hydrochloride withdrawal time on beef carcass cutability, composition, and tenderness1. J Anim Sci 2009;87(11):3677-3685.

4. Strydom PE, Frylinck L, Montgomery JL, Smith MF. The comparison of three β-agonists for growth performance, carcass characteristics and meat quality of feedlot cattle. Meat Sci 2009;81(3):557-564.

5. Castellanos-Ruelas AF, Rosado-Rubio JG, Chel-Guerrero LA, Betancur-Ancona DA. Using zilpaterol in an intensive feeding system for steers in Yucatán, México. Arch Latinoam Prod Anim 2006;14:56-59.

6. Mendez RD, Meza CO, Berruecos JM, Garces P, Delgado EJ, Rubio MS. A survey of beef carcass quality and quantity attributes in Mexico. J Anim Sci 2009;87(11):3782-3790.

7. Martínez-Vázquez DE, Sánchez-López E, Avendaño-Reyes L, Meráz-Murillo FJ, TorresRodríguez V. Economic evaluation of the use of two β -adrenergic agonists on finishing feedlot steers. Interciencia 2016;41(2):98-102.

267

Rev Mex Cienc Pecu 2021;12(1):256-272

8. Longo Joachin PA, Vargas Orellana CR. Evaluación de dos presentaciones comerciales de clorhidrato de zilpaterol (Zilmax ®) y (GroFactor ®) como aditivos en la dieta para finalización de toretes confinados. Escuela Agrícola Panamericana, Zamorano, Honduras . 2017.

9. SNIIM. Comentarios de Mercado Pecuarios. Sistema Nacional de Información e Integración de Mercados. http://www.secofi-sniim.gob.mx/nuevo/. Consultado 15 May, 2019.

10. Nieto-Carmona A, Aguilar-Acevedo J, Rubio-Lozano MS, Alvarado-García PA, Tapia G, Ocampo-Camberos L, Sumano H. Non-inferiority trial of two commercial zilpaterol HCl brands in Bos indicus cattle under humid tropical conditions. Veter México OA 2018;5(2).

11.

SAGARPA. Trato humanitario en la movilización de animales. http://www.dof.gob.mx/nota_detalle.php?codigo=4870842&fecha=23/03/1998.

Consultado 15 May, 2019.

12. SAGARPA. Métodos para dar muerte a los animales domésticos y silvestres. http://www.dof.gob.mx/nota_detalle.php?codigo=5405210&fecha=26/08/2015.

Consultado 15 May, 2019.

13. Djuragic O, Levic J, Sredanovic S, Levic L. Evaluation of homogeneity in feed by method of microtracers®. Archiva Zootechnica 2009;12(4):85-91.

14. SAGARPA. Especificaciones zoosanitarias para la construcción y equipamiento de establecimientos para el sacrificio de animales y los dedicados a la industrialización de productos cárnicos. https://www.gob.mx/senasica/documentos/nom-008-zoo-1994.

Consultado 15 May, 2019.

15.

SAGARPA. Proceso sanitario de la carne. https://www.gob.mx/senasica/documentos/nom-009-zoo-1994. Consultado 15 May, 2019.

16. USDA. United States Standards for Grades of Carcass Beef. USDA Agricultural Marketing Service. Livestock and Seed Division https://www.ams.usda.gov/rulesregulations/united-states-standards-grades-carcass-beef-0. Accessed May 15, 2019.

17. AMSA. Meat color measurement guidelines. American Meat Science Association. http://www.meatscience.org/publications-resources/printed-publications/amsa-meatcolor-measurement-guidelines. Accessed May 5, 2018.

268

Rev Mex Cienc Pecu 2021;12(1):256-272

18. Mounier L, Dubroeucq H, Andanson S, Veissier I. Variations in meat pH of beef bulls in relation to conditions of transfer to slaughter and previous history of the animals. J Anim Sci 2006;(84):1567-1576.

19. Holman BW, van de Ven RJ, Mao Y, Coombs CE, Hopkins DL. Using instrumental (CIE and reflectance) measures to predict consumers' acceptance of beef colour. Meat Sci 2017;127:57-62.

20. AMSA. Research guidelines for cookery, sensory evaluation, and instrumental tenderness measurements of meat. Second edition (version 1.0). Champaign, IL: American Meat Science Association. http://www.meatscience.org/docs/default-source/publicationsresources/amsa-sensory-and-tenderness-evaluation-guidelines/research-guide/2015amsa-sensory-guidelines-1-0.pdf?sfvrsn=6. Accessed May 14, 2019.

21. Delgado-Suárez EJ, Rubio-Lozano MS, Toledo-López VM, Torrescano-Urrutia GR, Ponce-Alquicira E, Huerta-Leidenz N. Quality traits of pork semimembranosus and triceps brachii muscles sourced from the United States and Mexico. Meat Sci 2016;122:125-131.

22. Baxa TJ, Hutcheson JP, Miller MF, Brooks JC, Nichols WT, Streeter MN, Yates DA, Johnson BJ. Additive effects of a steroidal implant and zilpaterol hydrochloride on feedlot performance, carcass characteristics, and skeletal muscle messenger ribonucleic acid abundance in finishing steers. J Anim Sci 2010;88(1):330-337.

23. Kononoff PJ, Defoor PJ, Engler MJ, Swingle RS, James ST, Deobald HM, Deobald JL, Marquess FLS. Impact of a leptin single nucleotide polymorphism and zilpaterol hydrochloride on growth and carcass characteristics in finishing steers. J Anim Sci 2013;91(10):5011-5017.

24. Rivera-Villegas A, Estrada-Angulo A, Castro-Perez BI, Urias-Estrada JD, Rios-Rincon FG, et al. Comparative evaluation of supplemental zilpaterol hydrochloride sources on growth performance, dietary energetics and carcass characteristics of finishing lambs.

Asian-Australas J Anim Sci 2019;32(2):209-216.

25. Montgomery JL, Krehbiel CR, Cranston JJ, Yates DA, Hutcheson JP, Nichols WT, et al.

Dietary zilpaterol hydrochloride. I. Feedlot performance and carcass traits of steers and heifers. J Anim Sci 2009;87(4):1374-1383.

26. Parr SL, Chung KY, Galyean ML, Hutcheson JP, Dilorenzo N, Hales KE, May ML, Quinn MJ, Smith DR, Johnson BJ. Performance of finishing beef steers in response to anabolic implant and zilpaterol hydrochloride supplementation1. J Anim Sci 2011;89(2):560-570.

269

Rev Mex Cienc Pecu 2021;12(1):256-272

27. Holland BP, Krehbiel CR, Hilton GG, Streeter MN, Vanoverbeke DL, Shook JN, et al.

Effect of extended withdrawal of zilpaterol hydrochloride on performance and carcass traits in finishing beef steers. J Anim Sci 2010;88(1):338-348.

28. McEvers TJ, Nichols WT, Hutcheson JP, Edmonds MD, Lawrence TE. Feeding performance, carcass characteristics, and tenderness attributes of steers sorted by the Igenity tenderness panel and fed zilpaterol hydrochloride. J Anim Sci 2012;90(11):4140-4147.

29. Belew JB, Brooks JC, McKenna DR, Savell JW. Warner–Bratzler shear evaluations of 40 bovine muscles. Meat Sci 2003;64(4):507-512.

30. Hope-Jones M, Strydom PE, Frylinck L, Webb EC. The efficiency of electrical stimulation to counteract the negative effects of β-agonists on meat tenderness of feedlot cattle. Meat Sci 2010;86(3):699-705.

31. Claus HL, Dikeman ME, Murray L, Brooks JC, Shook J, Hilton GG, et al. Effects of supplementing feedlot steers and heifers with zilpaterol hydrochloride on Warner– Bratzler shear force interrelationships of steer and heifer longissimus lumborum and heifer triceps brachii and gluteus medius muscles aged for 7, 14 and 21 d. Meat Sci 2010;85(2):347-355.

32. Chávez A, Pérez E, Rubio MS, Méndez RD, Delgado EJ, Díaz D. Chemical composition and cooking properties of beef forequarter muscles of Mexican cattle from different genotypes. Meat Sci 2012;91(2):160-164.

33. Rubio LM, Mendez MR, Huerta-Leidenz N. Characterization of beef semimembranosus and adductor muscles from US and Mexican origin. Meat Sci 2007;76(3):438-43.

34. Marti S, Realini CE, Bach A, Pérez-Juan M, Devant M. Effect of castration and slaughter age on performance, carcass, and meat quality traits of Holstein calves fed a highconcentrate diet. J Anim Sci 2013;91(3):1129-1140.

35. González-Ríos H, Dávila-Ramírez JL, Peña-Ramos EA, Valenzuela-Melendres M, Zamorano-García L, Islava-Lagarda TY, Valenzuela-Grijalva NV. Dietary supplementation of ferulic acid to steers under commercial feedlot feeding conditions improves meat quality and shelf life. Anim Feed Sci Technol 2016;222:111-121.

36. Nelson JL, Dolezal HG, Ray FK, Morgan JB. Characterization of certified Angus beef steaks from the round, loin, and chuck. J Anim Sci 2004;82:1437-1444.

37. Rhee MS, Wheeler TL, Shackelford SD, Koohmaraie M. Variation in palatability and biochemical traits within and among eleven beef muscles. J Anim Sci 2004;82:534-550.

270

Rev Mex Cienc Pecu 2021;12(1):256-272

38. Searls GA, Maddock RJ, Wulf DM. Intramuscular tenderness variation within four muscles of the beef chuck. J Anim Sci 2005;83:2835-2842.

39. Wheeler TL, Shackelford SD, Koohmaraie M. Tenderness classification of beef: III. Effect of the interaction between end point temperature and tenderness on WarnerBratzler shear force of beef longissimus. J Anim Sci 1999;77(2):400-407.

40. King DA, Wheeler TL, Shackelford SD, Koohmaraie M. Comparison of palatability characteristics of beef gluteus medius and triceps brachii muscles. J Anim Sci 2009;87(1):275-284.

41. Jeremiah LE, Dugan MER, Aalhus JL, Gibson LL. Assessment of the chemical and cooking properties of the major beef muscles and muscle groups. Meat Sci 2003;65(3):985-992.

42. Vieira C, Diaz MT, Martínez B, García-Cachán MD. Effect of frozen storage conditions (temperature and length of storage) on microbiological and sensory quality of rustic crossbred beef at different states of ageing. Meat Sci 2009;83(3):398-404.

43. Yancey JW, Wharton MD, Apple JK. Cookery method and end-point temperature can affect the Warner-Bratzler shear force, cooking loss, and internal cooked color of beef longissimus steaks. Meat Sci 2011;88(1):1-7.

44. Walsh H, Martins S, O’ Neill EE, Kerry JP, Kenny T, Ward P. The effects of different cooking regimes on the cook yield and tenderness of non-injected and injection enhanced forequarter beef muscles. Meat Sci 2010;84(3):444-448.

45. Huff-Lonergan E. 6 - Fresh meat water-holding capacity. In: Kerry JP, Ledward D editors. 6 - Fresh meat water-holding capacity. Woodhead Publishing; 2009:147-160.

46. Holdstock J, Aalhus JL, Uttaro BA, Lopez-Campos O, Larsen IL, Bruce HL. The impact of ultimate pH on muscle characteristics and sensory attributes of the longissimus thoracis within the dark cutting (Canada B4) beef carcass grade. Meat Sci 2014;98(4):842-849.

47. Ngapo TM, Brana VD, Rubio LMS. Mexican consumers at the point of meat purchase.

Beef choice. Meat Sci 2017;134:34-43.

48. Montgomery JL, Krehbiel CR, Cranston JJ, Yates DA, Hutcheson JP, Nichols WT, et al.

Effects of dietary zilpaterol hydrochloride on feedlot performance and carcass characteristics of beef steers fed with and without monensin and tylosin. J Anim Sci 2009;87(3):1013-1023.

271

Rev Mex Cienc Pecu 2021;12(1):256-272

49. Loneragan GH, Thomson DU, Scott HM. Increased mortality in groups of cattle administered the β-Adrenergic agonists ractopamine hydrochloride and zilpaterol hydrochloride. PLoS ONE 2014;9(3):e91177.

272

https://doi.org/10.22319/rmcp.v12i1.5392 Technical note

Rhipicephalus microplus infestation level and its association with climatological factors and weight gain in Bos taurus x Bos indicus cattle

Roberto Omar Castañeda Arriola a Jesús Antonio Álvarez Martínez b Carmen Rojas Martínez b José Juan Lira Amaya b Ángel Ríos Utrera a* Francisco Martínez Ibáñez c

a

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), Campo Experimental La Posta, kilómetro 22.5 carretera federal Veracruz-Córdoba, Paso del Toro, Medellín, Veracruz, México. b

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), CENIDSAI, Morelos, México. c

Servicios de Sanidad, Inocuidad y Calidad Agroalimentaria (SENASICA), Ciudad de México, México.

*Corresponding author: rios.angel@inifap.gob.mx

Abstract: Tick infestation is an ongoing challenge in cattle production, but chemical control methods can pose a risk to both animals and handlers. An evaluation was done of natural Rhipicephalus microplus infestation, its correlation to climatological factors and its effect on weight gain in dual-purpose cattle. Individuals consisted of 31 Bos taurus x Bos indicus cattle of both sexes with an average age of 307 d. Every 28 d for 15 mo, counts of semi-engorged ticks (4.5 to 8.0 mm in diameter) were done and the animals weighed. Tick counts were done 273

Rev Mex Cienc Pecu 2021;12(1):273-285

from the head to the base of the tail, including the fore and hind limbs, and the ventral region.

Response variables were tick count and average weight per animal. Average tick count per animal was higher (P<0.05) in the hottest month (July) than in the other months. Calf’s sex and breed group had no effect (P>0.05) on tick count. Individual weight gain decreased 34 g (P<0.05) for each semi-engorged tick per 28-day period. Tick count had a low correlation (P<0.01) with environmental temperature and relative humidity, but average weight gain was negatively and moderately correlated with tick count (-0.67; P<0.01). Animals with a high infestation level (61+ ticks) exhibited lower average weight gain (P=0.001) than those with a medium (31 to 60 ticks) or low level (0 to 30 ticks). Boophilus microplus infestation in dual-purpose cattle requires stricter control during high-temperature months (April to July).

Key words: Ticks, Infestation level, Weight gain, Environmental temperature, Linear regression.

Received: 22/05/2019 Accepted: 03/06/2020

In Mexico, the tick Rhipicephalus microplus poses a serious risk to the livestock sector since it negatively affects both meat and milk production. It also threatens export of live cattle to the United States of America, activity that generates 700 million dollars annually(1). This tick vector is commonly controlled by applying chemical compounds, although these are expensive and can be toxic to livestock and their handlers. Excessive and inadequate use of chemical tick control methods has generated resistance among ticks and caused a rethink of these methods(2). Comprehensive pest management is considered the best option for controlling ticks but requires detailed knowledge of the interactions between the environment, the host and the parasite. However, this control method can maintain tick populations at low levels, keeping livestock healthy. These low levels are still sufficient to infect animals with hemotropic pathogens at an early age, thus generating immunity against them and achieving enzootic stability(3).

Adequate control of ticks in livestock requires thorough knowledge of variations in annual tick populations and of the influence of climate and management practices on these populations. The present study objective was to evaluate the degree of natural Rhipicephalus microplus infestation in dual-purpose cattle, identify any correlations between infestation and climatological factors, and its effect on weight gain.

Field work was done at La Posta Research Station, which belongs to the National Institute for Forestry, Agricultural and Livestock Research (Instituto Nacional de Investigaciones 274

Rev Mex Cienc Pecu 2021;12(1):273-285

Forestales, Agrícolas y Pecuarias - INIFAP), in the state of Veracruz, Mexico (19°00’49” N; 96°10’ W; 12 m asl). Regional climate is subhumid (Aw1), with a 25°C annual average temperature (35.3°C maximum, 15°C minimum), 1,641 mm annual average rainfall and 74.4% average relative humidity (RH).

Experimental animals consisted of 31 Bos taurus x Bos indicus cattle (13 heifers and 18 bulls), which were 11/16 Holstein x 5/16 Zebu (3.2%), 11/16 Brown Swiss x 5/16 Zebu (3.2%), 3/4 Holstein x 1/4 Zebu (16.1%), 3/4 Brown Swiss x 1/4 Zebu (25.8%), 5/8 Holstein x 3/8 Zebu (25.8%), 5/8 Brown Swiss x 3/8 Zebu (6.5%), undefined Holstein x Zebu crosses (16.1%), and undefined Brown Swiss x Zebu crosses (3.2%). At the beginning of the experiment average animal age was 307 d. Bulls and heifers were kept separate, under a rotational grazing system in contiguous pastures of established grasses: Tanzania (Megatyrsus maximus), Signal (Urocholoa decumbens), Pangola (Digitaria decumbes) and Mombaza (Megatyrsus maximus). Mineral salts and water were offered freely year round.

During the dry season (December to May) sorghum (Sorghum vulgare) silage was provided ad libitum. The animals were vaccinated annually (August) against paralytic rabies and semiannually (March and September) against clostridiasis. They were also treated for gastroenteric nematodes every 6 mo. A feed concentrate (18% crude protein, 70% total digestible nutrients) was provided at 1 kg per animal per day.

The population dynamics of R. microplus on the sampled animals was documented by counting all the semi-engorged ticks (4.5 to 8.0 mm in diameter) found on them. Samples were collected every 28 d for 15 mo, from August 2014 to October 2015. Tick collection and counting were done by the same field technician. Collections were done in the morning (08:00 h) by placing an animal in a covered handling pen and inspecting it from the head to the base of the tail, including the anterior and posterior limbs and the ventral region(4). At each sampling, animal body weight was measured using an electronic scale. No chemical tick control methods were applied during the study period. As ticks were removed from the animals they were placed in a 70% alcohol solution. All were identified and taxonomically classified at La Posta’s Animal Health Laboratory, following established criteria(5). Data on environmental temperature and relative humidity were obtained from La Posta’s weather station, which belongs to the National Network of Automated Agricultural Weather Stations of INIFAP. Rainfall data were not available for the study period.

The studied response variables were number of semi-engorged ticks (tick count) per animal, individual weight gain and average weight gain per animal. Tick count was the number of ticks collected from the left side of the animal after a period of 28 d. This variable has a high correlation (>0.90) with the number of ticks on the animal’s entire body(6). Overall average tick count per animal was 39.4, with a range of 0 to 264. Individual average tick counts were used to classify tick infestation level: 1) low (0 to 30 ticks); 2) moderate (31 to 60 ticks); and 3) high (61+ ticks). Individual weight gain consisted of the body weight (kg) gained by an 275

Rev Mex Cienc Pecu 2021;12(1):273-285

animal after a 28-d period. Average weight gain per animal was calculated by dividing the sum of individual weight gain results per 28 d by the total number of measurements.

All statistical analyses were run using the SAS statistical package(7). Tick count per animal was analyzed with the GENMOD procedure (PROC GENMOD), using a repeated measurements model that included the fixed effects of sampling month (period), calf’s sex and breed group. For this variable, a Poisson distribution was declared as a subroutine in GENMOD, and a first-order autoregressive covariance structure [AR(1)] model was applied.

Individual weight gain was analyzed with the MIXED procedure (PROC MIXED), using a repeated measurements model that included calf’s sex and breed group as categorical variables, and tick count, environmental temperature and RH as covariates; the previously mentioned covariance structure was applied. In the analysis of individual weight gain, environmental temperature and RH were included in the statistical model, rather than month (period) of sampling. This was done because the focus was not on differences in weight gain between months, but rather on more accurate adjustment for climatological factors and production of a linear regression coefficient of individual weight gain on tick count per animal. Average weight gain was analyzed with the GLM procedure (PROC GLM), using a model that included infestation level (high, medium and low). In a preliminary analysis, the effects of calf’s sex and breed group were found not to be significant (P>0.05), and were therefore not included in the definitive model. In the analyses of tick count per animal and average weight gain the differences between means were tested with the PDIFF option. A Pearson’s correlation coefficient, run with the CORR procedure (PROC CORR), was used to estimate degree of association between tick count per animal and environmental temperature and RH, as well as between average tick count and average weight gain.

Average tick count per animal varied widely from a low of 6 to a high of 94, and infestation level varied correspondingly (Table 1). Average individual weight gain also varied broadly from a low of 8 kg to a high of 18 kg, with an overall average of 11.9 kg.

276

Rev Mex Cienc Pecu 2021;12(1):273-285

Table 1: Average semi-engorged tick (Boophilus microplus) count per animal (ATC), infestation level per animal (IL) and average weight gain per animal (AWG; kg) Animal ATC IL AWG Animal ATC IL AWG 1 27 Low 12 17 87 High 3 2 47 Medium 15 18 48 Medium 12 3 45 Medium 12 19 58 Medium 12 4 94 High 9 20 63 High 8 5 30 Low 16 21 53 Medium 11 6 45 Medium 13 22 65 High 12 7 15 Low 13 23 50 Medium 12 8 62 High 10 24 72 High 12 9 25 Low 13 25 22 Low 15 10 14 Low 15 26 36 Medium 14 11 6 Low 14 27 65 High 10 12 6 Low 13 28 39 Medium 11 13 33 Medium 12 29 64 High 10 14 32 Medium 18 30 62 High 10 15 62 High 13 31 48 Medium 11 16 15 Low 13 Sampling month had a significant effect on tick count (P=0.0199), and the linear effect of tick count was significant for individual weight gain (P=0.0212). Infestation level (IL) had a significant effect on average weight gain (P=0.001). Average tick count was higher (P<0.05) in the hottest month (July) than in all other sampling months (Table 2).

277

Rev Mex Cienc Pecu 2021;12(1):273-285

Table 2: Least square means (± standard errors) for tick count, and mean temperature (Temp) and relative humidity (RH), by month £ Month Tick count Temp RH ef January 20.7 ± 2.5 18.6 86.9 ef February 18.5 ± 2.7 19.0 86.1 cd March 32.4 ± 4.5 20.8 88.0 b April 45.0 ± 6.8 25.2 86.2 b May 43.0 ± 4.4 26.2 85.6 b June 45.1 ± 4.3 25.9 85.4 a July 62.9 ± 6.9 26.8 87.7 bc August 39.3 ± 7.5 26.0 87.0 cd August 2 27.9 ± 3.2 26.5 87.8 de September 24.5 ± 2.9 25.1 91.0 f September 2 16.3 ± 3.3 25.8 89.9 f October 14.4 ± 3.2 24.4 87.5 g October 2 5.9 ± 1.6 25.2 87.3 c November 32.5 ± 3.4 21.5 86.0 f December 17.4 ± 2.5 20.6 89.4 £

a,b,c,d,e,f,g

August 2, September 2 and October 2 indicate these months in 2015.

Different letter superscripts in the same column indicate significant difference (P<0.05).

For example, in the most extreme cases, in the month of July the animals exhibited 46.6 and 57.0 more ticks than in September (2015) and October (2015), respectively. Tick count did not differ (P>0.05) between April (45.0), May (43.0) and June (45.1), months which had similar values for environmental temperature and RH. Again, tick count did not differ (P>0.05) between January (20.7) and February (18.5), both months with relatively low temperatures. Of note is that the tick counts in these cooler months was lower (P<0.05) than in relatively warmer months such as April, May and June. This trend is supported by the corresponding Pearson’s correlation coefficient results, which indicated that tick count per animal was higher at higher temperatures (0.21; P<0.0001). There was a weaker correlation between lower RH and higher tick counts (-0.19; P<0.0001).

The annual fluctuations in tick population observed in the present data coincide with previous studies in which variations responded to regional climate conditions. For example, in a study using ¾ Bos taurus x ¼ Bos indicus cattle R. microplus infestation (average ticks per animal) was found to be highest in May (93) and June (82) but lowest (<10) in November and March when RH was lower than in May and June(8). A more recent study using Criollo Lechero Tropical cattle in central Veracruz found that tick (Amblyomma cajennense + Boophilus microplus) infestation (ticks per animal) was highest in August (11.1 ± 0.6) and October (12.0 ± 0.6), both high rainfall months (11.9 and 17.9 mm, respectively), but lowest (2.9 ± 278

Rev Mex Cienc Pecu 2021;12(1):273-285

0.6) in May which has low rainfall (1.4 mm); environmental temperatures did not differ between these months(9). In a study done in the dry tropics of Mexico (Culiacán, Sinaloa), infestation levels (average number of ticks per animal) in cattle were affected by temperature, with high levels (50) during the hottest months from July to October and lower levels (30) as temperatures dropped in November and December(10). This contrasts with a report on terminal cross calves in which B. microplus infestation levels (ticks per animal) were higher (155 ± 10) in February and March, which are cooler and drier (22°C average temperature; 49 mm rainfall), than levels (26 ± 15) in September and October, which are hotter and have more precipitation (26.4°C average temperature; 271 mm precipitation)(11).

Males tended to have more ticks than females (29.9 vs 22.1 ticks; Table 3), although the difference was not significant (P<0.055). This generally coincides with a study done in Australia in which tick count was 90% higher in male than in female cattle, suggesting that sex hormones exercise a strong effect on parasite resistance(12). However, the present results contrast slightly with the lack of difference in infestation levels between eight-month-old male and female calves under humid tropical conditions(11). Another study also reported a lack of difference in tick count between bulls and heifers (3.2 ± 0.6 vs 3.5 ± 0.4) of the Criollo Lechero Tropical breed in Mexico(9).

Table 3: Least square means (± standard errors) and 95% confidence intervals for tick (Boophilus microplus) count by sex Confidence interval Sex

Mean

Lower limit

Upper limit

Females

22.1 ± 2.3

18.1

27.1

Males

29.9 ± 3.2

24.2

37.0

(P>0.05).

Infestation levels did not differ between the evaluated breed groups (P>0.05), although 11/16 Brown Swiss x 5/16 Zebu calves tended to have fewer ticks than those of the other breed groups (Table 4). This lack of difference may be an artifact of sample size in the present study. If the overall sample size had been larger the means probably would have had lower standard errors, allowing identification of inter-breed group differences in tick count.

Previous reports do identify inter-breed group variation in tick count. A study comparing ¾ B. taurus x ¼ B. indicus to ½ B. taurus x ½ B. indicus cattle found that the former had higher tick counts than the latter in nine months of the year(8); that is, the higher the proportion of genes from European breeds the higher the count. This is noteworthy since the 62.5 to 75.0% European breed percentage interval in the present study is lower than the 50 to 75% interval in the cited study(8), which would imply greater genetic diversity in the latter. However, interbreed group differences in tick count have been reported between crosses with uniform 279

Rev Mex Cienc Pecu 2021;12(1):273-285

proportions of B. taurus versus B. indicus; one study found that ½ Braunvieh-¼ Holstein-¼ Zebu calves had higher natural tick infestation levels than ½ Black Angus-¼ Holstein-¼ Zebu and ½ Red Angus-¼ Holstein-¼ Zebu calves(11).

Zebu breeds (B. indicus) have been reported to be more resistant to ticks than European breeds (B. taurus)(13,14). For example, in one study with Nelore cattle counts for engorged B. microplus females increased progressively as the proportion of European genes increased: 3.3 in Nelore; 25.2 in ½ Nelore x ½ Fleckvieh; 22.5 in ½ Nelore x ½ Chianina; 21.0 in ½ Nelore x ½ Charolais; and 59.7 ticks in 3/8 Nelore x 5/8 Angus(15). A study done in South Africa also reported higher tick counts in cattle as the proportion of European genes increased: 5.3 in Nguni (tropically adapted African breed, B. taurus x B. indicus); 24.1 in Bonsmara (5/8 Afrikaner and 3/8 Hereford or Shorthorn); and 37.4 in B. taurus (Hereford).

A study in South Africa(16) found that the average number of ticks was 37.4, 24.1 and 5.3 in Hereford, Bonsmara (5/8 Afrikaner and 3/8 Hereford or Shorthorn) and Nguni (tropically adapted African breed, product of the combination of breeds B. taurus and B. indicus), respectively.

In one study under field conditions (i.e. natural infestation) in Australia B. taurus x B. indicus cattle were found to carry fewer ticks than B. taurus (Shorthorn x Hereford) cattle(12). It has been argued that this disparity in IL may be due to Zebu breeds’ exhibition of behavior aimed at avoiding ticks, their greater skin sensitivity and more frequent and thorough grooming habits in comparison to exotic B. taurus breeds(17). Differences in tick counts by breed have also been reported between B. indicus breeds; for instance, in a study of one-year-old animals, Brahman cattle were found to have twice as many B. microplus ticks as Nelore cattle(18).

Table 4: Least square means (± standard errors) and 95% confidence intervals for tick (Boophilus microplus) count by breed group Confidence interval £ Breed group Mean Lower limit Upper limit a 11/16 HO 28.7 ± 2.1 24.9 33.0 a 11/16 BS 15.2 ± 0.4 14.5 16.0 a 3/4 HO 48.4 ± 3.2 42.4 55.2 a 3/4 BS 37.3 ± 5.6 27.8 50.0 a 5/8 HO 20.7 ± 3.3 15.1 28.3 a 5/8 BS 30.8 ± 18.4 9.5 99.6 a X HO 34.6 ± 5.5 25.4 47.2 a X BS 32.4 ± 2.4 28.0 37.4 £

11/16 HO= 11/16 Holstein x 5/16 Zebu; 11/16 BS= 11/16 Brown Swiss x 5/16 Zebu; 3/4 HO= 3/4 Holstein x 1/4 Zebu; 3/4 BS= 3/4 Brown Swiss x 1/4 Zebu; 5/8 HO= 5/8 Holstein x 3/8 Zebu; 5/8 BS= 5/8 Brown Swiss x 3/8 Zebu; X HO= undefined Holstein x Zebu crosses; X BS= undefined Brown Swiss x Zebu crosses. a (P>0.05).

280

Rev Mex Cienc Pecu 2021;12(1):273-285

The linear regression coefficient for weight gain on tick count (-0.03442 kg/tick; P<0.05) represents a 34 g weight loss per tick during a 28-d period. Under the studied conditions this means that in the month of July each evaluated animal lost an average of 2.1 kg of body weight. This weight loss is only slightly higher than the 28 g per adult Amblyomma hebraeum tick reported in Brahman, Brahman x Simmental, Sanga and Hereford bulls(19). However, the coefficient calculated here is lower than the -0.42 kg/tick/10 mo (i.e. 420 g weight loss over ten months) reported elsewhere(20). Of note is that the present results and those of the aforementioned studies are far in excess of the 4.4 g weight loss per engorged tick reported for Rhipicephalus appendiculatus in cattle(21).

The Pearson’s correlation coefficient (-0.67; P<0.0001) supported the above findings in that it showed average weight gain to be negative as tick count increased. This coincides with the coefficient of -0.61 estimated between weight gain and cumulative tick count (Amblyomma americanum) in Angus x Zebu cattle in Texas(22). A study done in Zambia in two herds of Sanga breed cattle found that weight gain was negative (-0.72 and -0.70) and moderately correlated to tick count (Amblyomma variegatum)(23). Another study reported a negative and moderate correlation (-0.52) between weight gain and tick count (A. variegatum) in the Gudali breed (B. indicus) in Cameroon(24).

Compared to the animals with a high IL, those with a medium level gained 2.88 kg more weight per sampling period while those with a low level gained 3.87 kg more (P<0.05; Table 5). A study done in Brazil with Holstein-Zebu cattle also reported greater weight gain at low infestation levels than at medium and high levels, although it did not specify the criteria for classifying infestation level(25). In an evaluation of the effects of engorged tick load (Boophilus microplus; diameter >5 mm) in Norman cattle, highly-infested animals (138 to 300 ticks) weighed 24 kg less at d 125 of the test than lightly-infested animals (0 to 33 ticks)(26). There are multifold reasons why some animals have higher tick counts than others in the same environment, although several authors suggest that an animal’s immunological response to ticks may affect their tick count(27-29).

281

Rev Mex Cienc Pecu 2021;12(1):273-285

Table 5: Least square means (± standard errors) and 95% confidence intervals for average weight gain (kg) by infestation level Confidence interval Infestation level

Mean

Lower limit

Upper limit

9.82 ± 0.66a

8.46

11.18

Medium

12.70 ± 0.61b

11.46

13.94

Low

13.69 ± 0.70b

12.25

15.12

High

a,b

Different letter superscripts indicate significant difference (P<0.01).

The present results indicate a lack of adequate control of B. microplus infestation during the warmest months (April to July) in the study area. Calf’s sex and breed group had no effect on tick counts. The correlation between average tick count and average weight gain was negative and moderate, meaning animals with high infestation levels had lower weight gain than those with medium and low levels. Tick infestation clearly affects animal productive potential and needs to be effectively controlled.

Literature cited: 1. González SPJR, Hernández OR. Boophilus microplus: estado actual de la resistencia a los acaricidas en la frontera México Estados Unidos y su impacto en la relación comercial.

Rev Mex Cienc Pecu 2012;3(Supl 1):1-8.

2. Rajput ZI, Song-hua H, Wan-jun Ch, Arijo AG, Chen-wen X. Importance of ticks and their chemical and immunological control in livestock. J Zhejiang Univ Science B 2006;7(11):912-921.

3. García BA. Situación actual de la campaña nacional contra la garrapata en México. IV Seminario Internacional de Parasitología Animal. Puerto Vallarta, Jalisco, México.

1999:47-50.

4. Wharton RH, Utech KBW. The relation between engorgement and dropping of B. microplus (Canestrini) (Ixodidae) to the assessment of tick numbers on cattle. J Aust Entomol Soc 1970;9:171-182.

5. Rodríguez-Vivas RI, Domínguez AJ, Cob GL. Técnicas diagnósticas de parasitología veterinaria. Mérida, Yucatán, México. Universidad Autónoma de Yucatán. 1994:131140.

282

Rev Mex Cienc Pecu 2021;12(1):273-285

6. González-Cerón F, Becerril-Pérez CM, Torres-Hernández G, Díaz-Rivera P. Garrapatas que infestan regiones corporales del bovino Criollo Lechero Tropical en Veracruz, México. Agrociencia 2009;43(1):11-19.

7. SAS Institute Inc. SAS/STAT® 9.3 User’s guide. Cary, NC: SAS Institute Inc. 2011.

8. Alonso-Díaz MA, López-Silva BJ, de Magalhães-Labarthe ACL, Rodríguez-Vivas RI. Infestación natural de hembras de Boophilus microplus Canestrini, 1887 (Acari: Ixodidae) en dos genotipos de bovinos en el trópico húmedo de Veracruz, México. Vet Méx 2007;38(4):503-509.

9. González-Cerón F, Becerril-Pérez CM, Torres-Hernández G, Díaz-Rivera P, SantellanoEstrada E, Rosendo-Ponce A. Infestación natural por Amblyomma cajennese y Boophilus microplus en bovinos Criollo Lechero Tropical durante la época de lluvias.

Agrociencia 2009;43:577-584.

10. Gaxiola CSM, Borbolla IJE, Quintero MMT, Rodríguez MJ, Borbolla IJ, Castro CN, et al. Infestación natural de bovinos con Boophilus microplus en el municipio de Culiacán, Sinaloa, México [resumen]. IV Seminario Internacional de Parasitología Animal. Puerto Vallarta, Jalisco, México. 1999:225-226.

11. Rodríguez-Gallegos CE, Acosta-Rodríguez MR. Genetic and environmental factors influencing the resistance of terminal cross calves to tick Rhipicephalus (Boophilus) microplus and horn fly Haematobia irritans. Trop Subtrop Agroecosys 2011;13:437444.

12. Seifert GW. Variations between and within breeds of cattle in resistance to field infestations of the cattle tick (Boophilus microplus). Aust J Agric Res 1971;22:159-168.

13. Sutherst RW. Resistance of cattle to ticks and one element in control programme in Mexico. FAO Animal Production and Health Paper. 1989; Pp. 154-164.

14. Castro JJ. Sustainable tick and tickborne disease control in livestock improvement in developing countries. Vet Parasitol 1997;71:77-97.

15. Gomes A, Honer MR, Schenck MAM, Curvo JBE. Populations of the cattle tick Boophilus microplus on purebred Nelore, Ibagé and Nelore×European crossbreds in the Brazilian Savanna. Trop Anim Health Prod 1989;21:20-24.

16. Scholtz MM, Spickett AM, Lombard PE, Enslin CB. The effect of tick infestation on the productivity of cows of three breeds of cattle. Onderstepoort J Vet Res 1991;58:71-74.

17. Meltzer MI. A possible explanation of the apparent breed-related resistance in cattle to Bont tick (Amblyomma hebraeum) infestations. Vet Parasitol 1996;67:275-279.

283

Rev Mex Cienc Pecu 2021;12(1):273-285

18. Brizuela CM, Ortellano CA, Sanchez TI, Walker AR. Formulation of an integrated control of Boophilus microplus in Paraguay. Vet Parasitol 1996;63:95-108.

19. Norval RAI, Sutherst RW, Kerr JD. Infestations of the bont tick Amblyomma hebraeum (Acari: Ixodidae) on different breeds of cattle in Zimbabwe. Exp Appl Acarology 1996;20:599-605.

20. Frisch JE, O'Neill CJ. Comparative evaluation of beef cattle breeds of African, European and Indian origins. 2. Resistance to cattle ticks and gastrointestinal nematodes. Anim Sci 1998;67:39-48.

21. Norval RAI, Sutherst RW, Kurki J, Gibson JD, Kerr JD. The effect of the brown ear-tick (Rhipicephalus appendiculatus) on the growth of Sanga and European breed cattle. Vet Parasitol 1988;30:149-164.

22. Tolleson DR, Teel PD, Stuth JW, Strey OF, Welsh Jr. TH, Carstens GE, et al. Effects of a lone star tick (Amblyomma americanum) burden on performance and metabolic indicators in growing beef steers. Vet Parasitol 2010;173:99-106.

23. Pegram RG, Lemche J, Chizyuka HGB, Sutherst RW, Floyd RB, Kerr JD, et al. Effect of tick control on liveweight gain of cattle in central Zambia. Med Vet Entomol 1989;3:313-320.

24. Stachurski F, Musonge EN, Achu-kwi MD, Saliki JT. Impact of natural infestation of Amblyomma variegatum on the liveweight gain of male Gudali cattle in Adamawa (Cameroon). Vet Parasitol 1993;9:299-311.

25. Labruna MB, Veríssimo CJ. Observações sobre a infestação por Boophilus microplus (Acari: Ixodidae) em bovinos mantidos em rotação de pastagem, sob alta densidade animal. Arq Inst Biol, São Paulo, 2001;68(2):115-120.

26. Corrier DE, Vizcaino O, Terry M, Betancourt A, Kuttler KL, Carson CA, et al. Mortality, weight loss and anaemia in Bos taurus calves exposed to Boophilus microplus ticks in the tropics of Colombia. Trop Anim Health Prod 1979;11:215-221.

27. Mattioli RC, Pandey VS, Murray M, Fitzpatrick JL. Immunogenetic influences on tick resistance in African cattle with particular reference to trypanotolerant N’Dama (Bos taurus) and trypanosusceptible Gobra zebu (Bos indicus) cattle. Acta Tropica 2000;75:263-277.

28. Das G, Ghosh S, Ray DD. Reduction of Theileria annulata infection in ticks fed on calves immunized with purified larval antigens of Hyalomma anatolicum anatolicum. Trop Anim Health Prod 2005;37:345-361.

284

Rev Mex Cienc Pecu 2021;12(1):273-285

29. Jonsson NN. The productivity effects of cattle tick (Boophilus microplus) infestation on cattle, with particular reference to Bos indicus cattle and their crosses. Vet Parasitol 2006;137:1-10.

285

https://doi.org/10.22319/rmcp.v12i1.5999 Technical note

Histopathology and PCR detection of bovine fibropapillomatosis in cattle in San Luis Potosí, Mexico

Isaura Méndez Rodríguez a Fernando Alberto Muñoz Tenería a Milagros González Hernández a Alan Ytzeen Martínez Castellanos a Luisa Eugenia del Socorro Hernández Arteaga a*

a

Universidad Autónoma de San Luís Potosí. Facultad de Agronomía y Veterinaria. Carretera San Luis-Matehuala Km 14.5, Ejido Palma de la Cruz, 78321 Soledad de Graciano Sánchez, SLP, México.

* Corresponding author: socorro.hernandez@uaslp.com

Abstract: Bovine papillomavirus (BPV) occurs worldwide and has myriad signs, including cutaneous papillomas, fibromas and fibropapillomas. Histology and PCR were used to identify the presence of BPV in tissue samples collected from cattle manifesting skin lesions suggestive of papillomas, fibromas and fibropapillomas in production units in the state of San Luis Potosí, Mexico. Eleven skin biopsies were taken from animals between 5 and 18 months’ age in stabled, semi-stabled and pastured beef and dairy production systems. Lesions were suggestive of papillomas, fibropapillomas and squamous cell carcinomas. Samples were evaluated by histopathology. Detection of BPV was also done using DNA extracted from the samples and analyzed by PCR with the FAP59/FAP64 and MY09/MY11 oligonucleotide pairs. The lesions were classified into fibromas (45.45 %) and fibropapillomas (54.54 %).

Lesion type distribution exhibited no patterns by anatomical location, animal age, production system or end purpose. Most (72.72 %, n= 8) of the samples were positive for BPV by PCR; 45.45 % (n= 5) with the FAP pair and 54.54 % (n= 6) with the MY pair. This is the first study 286

Rev Mex Cienc Pecu 2021;12(1):286-297

identifying the presence of BPV in San Luis Potosí. The results will be useful in establishing detection and control measures to improve production system health measures and end product quality.

Key words: Bovine papillomavirus, Bovine fibropapillomatosis, Histopathology, PCR, San Luis Potosí.

Received: 21/08/2018 Accepted: 11/03/2020

Bovine papillomavirus (BPV) causes bovine fibropapillomatosis, an infectious, speciesspecific disease found worldwide. It mainly affects young cattle and is associated with various predisposing factors such as immunosuppression conditions, animal age, nutritional status, parasitosis, improper management, stress and immunosuppressive drugs, among others(1,2). Papillomaviruses are a family of small, non-enveloped oncogenic viruses that infect birds, mammals and fish. The Papillomaviridae family comprises 29 genera that encompass 189 viral types of which 120 have been isolated from humans, 64 from mammals, 3 from birds, and 2 from reptiles(2,3).

Ten BPV viral types capable of causing infection at different anatomical sites in bovines have been characterized to date. Lesion characteristics respond to viral type. For example, BPV-1 is known to produce papillomas and fibropapillomas in the penile region, while BPV-2 manifests as papillomas and fibropapillomas on the skin and in the digestive tract. Bovine papillomavirus types 3 and 8 cause skin tags, and BVP-4 has been associated with the appearance of papillomas in the gastrointestinal tract. Fibropapillomas on the udder can be caused by BVP-5 while papillomas on the udder are associated with BVP-6, -9 and -10(3-7).

Fibromas, papillomas or fibropapillomas are benign proliferative neoplasms. They can be exophytic or endophytic, solitary or multiple, partially delimited, plaque-like and papillary.

Their appearance can vary from that of a grain of rice to the texture of cauliflower, and their texture can be dry or firm. They can become necrotic and detach, and may exhibit secondary bacterial contamination(8,9).

Lesions caused by BVP can regress spontaneously or remain for six to eighteen months.

Depending on their location, multiple lesions can lead to loss of body condition. Clinical signs of BVP vary by location on the body; for example, if located in the interdigital space, they can cause pain, leading to lameness or prostration. Rarely do BVP lead to clinical manifestations in the gastrointestinal tract although they can cause anorexia or bloat. When 287

Rev Mex Cienc Pecu 2021;12(1):286-297

infecting the mammary gland BVP can make milking difficult or complicate with secondary infections and generate mastitis. Lesions in the vagina or on the penis can interfere with intercourse, may bleed or become infected and can interfere with reproduction(10-12).

On a microscopic level papillomas consist of papillary projections of squamous epithelium, supported by fibrovascular stroma. These epithelial projections exhibit marked hyperplasia and hyperkeratosis, as well as ortho- and parakeratosis. In some papillomas, keratinocytes, mainly those of the stratum spinosum, have abundant clear cytoplasm or a perinuclear halo and pyknotic nuclei, which are called koilocytes (cells with cytopathic changes). Conditions present in certain regressing papillomas include reduction of epidermal hyperplasia, increased fibroblast proliferation, collagen deposits, and lymphocyte infiltration.

Fibropapillomas have two components: a lining epithelium which alternates with fibrous tissue arranged in short interlocking bundles, and reactive fibroblasts. The lining epithelium does not exhibit cytopathological changes, but does have marked hyperplasia and plexiform acanthosis(1,13,14). In large lesions, the epithelium may erode and come to resemble fibroids, in which proliferation of fibroblasts with dense collagen deposits has been observed(15).

Different strategies have been developed for using PCR to detect BPV in fibromas and fibropapillomas. The FAP59/FAP64 oligonucleotide pair, designed based on analysis of conserved regions of the human papillomavirus (HPV) L1 gene, has proven effective to this end. In addition to being useful in detecting a wide spectrum of HPV types in skin tumors and healthy skin, it has also been applied in detection of cutaneous papillomaviruses in various species, including BPV types 1-12. Similarly, the MY09/MY11 pair, originally designed to detect mucosa- and genital-associated HPV types, have been shown capable of amplifying regions of the L1 gene in BPV types 1, 3, 5 and 6(16,17).

In Mexico, data on molecular detection and identification of BPV infection have only been reported for cattle in the state of Tamaulipas(18). No epidemiological data on the incidence, prevalence, or the BPV viral types most frequently involved in the development of papillomas or fibropapillomas in cattle have been reported from other regions of the country.

The present study objective was to identify the presence of different BPV types in tissue samples from skin lesions with a histopathological diagnosis of papillomas and/or fibropapillomas collected from cattle from two regions in the state of San Luis Potosí, Mexico.

Incisional and excisional biopsies of skin exhibiting lesions suggestive of fibromas, papillomas, and/or fibropapillomas were collected from eleven animals in two regions of San Luis Potosí (Table 1, Figure 1).

288

Rev Mex Cienc Pecu 2021;12(1):286-297

ID

Breed

1 2 3 4 5 6 7 8 9 10 11

Swiss-Zebu Swiss-Zebu Lidia Swiss Cross Holstein Holstein Holstein Holstein Holstein Zebu Cross Swiss Cross

Table 1: Descriptive information on sampled cattle Age Production Sex Location (months) system 18 Female Stabled Tamuín 5 Male Pastured Éban 6 Male Stabled Villa de Reyes 6 Male Semi-stabled Villa de Zaragoza 15 Female Stabled Soledad de Graciano Sánchez 10 Female Stabled Soledad de Graciano Sánchez 10 Female Stabled Soledad de Graciano Sánchez 12 Female Stabled Soledad de Graciano Sánchez 13 Female Stabled Soledad de Graciano Sánchez 7 Male Pastured Tamuín 8 Male Semi-stabled Tamasopo

Figure 1: Sample site locations (red dots) in San Luis Potosí; at sites where more than one sample was collected the number is indicated

Each tissue sample was divided into two portions. One was placed in 15 ml Falcon tubes containing 10% formalin and evaluated by histopathology. The other was placed in a phosphate buffer solution (PBS) at pH 7.2 and stored in a cryogenic container until later PCR analysis. All samples were transported to the Immunology and Virology Laboratory of the Autonomous University of San Luis Potosí (Universidad Autónoma de San Luis Potosí UASLP) for processing.

289

Rev Mex Cienc Pecu 2021;12(1):286-297

The sample portions intended for histopathological evaluation were fixed in 10% formalin, embedded in paraffin and processed by routine histological techniques. Thin sections (3 to 5 µm) were cut and stained with hematoxylin and eosin (H&E).

Extraction of DNA from the collected samples was done by processing 25 mg tissue with the DNeasy Blood & Tissue reagent set (Qiagen, Valencia, California, USA) following manufacturer instructions. The extracted DNA was stored at -80 °C until use. Its purity and quantify were verified with a Nano-200 drop spectrophotometer (Allsheng, Beijing, China).

Integrity of the DNA was verified with 2% TAE-agarose gel electrophoresis.

The PCR analysis was run using two oligonucleotide pairs: FAP-59/FAP-64 (Macrogen, Seoul, South Korea) (FAP-59: 5'-TAACWGTIGGICAYCCWTATT-3'; FAP-64: 5'CCWATATCWVHCATITCICCATC-3'), and MY-09/MY-11 (IDT, San Diego, California, USA) (MY-09: 5'-CGTCCAAAAGGAAACTGAGC-3'; MY-11: 5'GCACAGGGACATAACAATGG-3'). Both oligonucleotide pairs detect the open reading frame of the gene for the majority protein of the L1 capsid, which is highly conserved in all types of bovine and human PV. The PCR mixtures (50 µl) were prepared with the Invitrogen PCR Reagent Set (Invitrogen, Massachusetts, USA). These mixtures contained 1 × buffer, 200 µM DNTp, 2mM MgCl2, 20 pM oligonucleotides, 5 UI Taq polymerase and 10 ng DNA. Analyses were run in a Multigene Optimax Thermal Cycler (LabNET, California, USA). For the MY09/MY11 pair, the PCR program was 10 min initial denaturation at 94 °C; 35 cycles of 90 sec at 94 °C, 60 sec at 50 °C and 90 sec at 72 °C; and a final extension of 5 min at 72 °C. For the FAP59/FAP64 pair, the program was 10 min initial denaturation at 94 °C; 45 cycles of 90 sec at 94 °C, 90 sec at 50 °C and 90 sec at 72 °C; and a final extension of 5 min at 72 °C. The PCR products were analyzed by electrophoresis of 5 µl of product on 2% TAE-agarose gel at 80 V for 80 min. The gel was then impregnated with ethidium bromide (Sigma-Aldrich, Missouri, USA) and an image taken with a Gel Doc EZ System photodocumenter (Bio-Rad, Hercules, California, USA).

All eleven skin biopsies exhibited common histological characteristics such as irregular hyperplasia and marked hyperkeratosis of the epidermis, erosions, ulcers and serocellular crusts. Some also had papillary projections supported by fibrovascular stroma alternating with dense collagen and ballooning degeneration of the epithelium, with inclusion bodies.

Proliferation of mature fibrous connective tissue was observed in the dermis, interspersed with reactive fibroblasts, dense collagen, newly formed lymphatic vessels, and multiple aggregates of lymphocytes, plasma cells and macrophages. In one tissue section, scattered atypical epithelial cells were observed which exhibited loss of the nucleus cytoplasm

290

Rev Mex Cienc Pecu 2021;12(1):286-297

relationship, abundant intensely eosinophilic cytoplasm, a large nucleus with notches, chromatin displaced to the periphery and one to three nucleoli evident (Figure 2).

Figure 2: Histological lesions representative of the fibromas, papillomas and fibropapillomas identified in the bovine skin samples

A) Fibropapilloma: Epidermis exhibits irregular hyperplasia and marked diffuse hyperkeratosis, as well as formation of papillary projections supported by fibrovascular stroma. H&E, 4X; B) Fibroma: Epidermis exhibits irregular hyperplasia and marked diffuse hyperkeratosis, dermis exhibits proliferation of fibrous connective tissue interspersed with congested blood vessels and aggregates of lymphocytes and plasma cells.

H&E, 4X; C) Fibroma: Epidermis exhibits irregular hyperplasia and marked hyperkeratosis, and ballooning degeneration of keratinocytes present in different strata, dermis exhibits proliferation of reactive fibroblasts and aggregates of lymphocytes and plasma cells. H&E, 10X; D and E) Fibroma: keratinocytes exhibit ballooning degeneration and presence of amorphous amphophilic structures compatible with inclusion bodies (Arrow). H&E, 100X; F) Fibroma: some epithelial cells show marked anisokaryosis with loss of the nucleus cytoplasm relationship, abundant intensely eosinophilic cytoplasm, a large nucleus with notches, chromatin displaced to the periphery, and 1 to 3 evident nucleoli. H&E, 40X.

291

Rev Mex Cienc Pecu 2021;12(1):286-297

The lesions observed histologically were suggestive of a benign viral-type neoplastic process compatible with fibromas and fibropapillomas. This conclusion is based on characteristics such as irregular hyperplasia and epidermal hyperkeratosis; presence of papillary projections of the epidermis; proliferation of mature fibrous connective tissue interspersed with reactive fibroblasts, dense collagen, and aggregates of lymphocytes, plasma cells and macrophages.

Koilocytes and intranuclear amphophilic inclusion bodies were also observed (Table 2).

ID 1 2 3 4 5 6 7 8 9 10 11 Total

Table 2: Production type, histology and PCR results Production type Histological Diagnosis PCR FAP Beef Fibroma Beef Fibropapilloma Exhibition Fibropapilloma Beef Fibroma + Dairy Fibropapilloma + Dairy Fibropapilloma + Dairy Fibroma Dairy Fibroma Dairy Fibropapilloma Beef Fibroma + Beef Fibropapilloma + 5

PCR MY + + + + + 6

In the FAP59/FAP64 PCR analysis an amplicon was observed between 480 and 538 bp. In 45.45 % (n= 5) of the samples, this corresponds to the PCR amplification product of the BPV L1 gene. No PCR product was observed in 27.27 % (n= 3) of the samples. Overall, 72 % of the samples analyzed with this oligonucleotide pair were positive for DNA sequences corresponding to the BPV L1 gene (Figure 3, Table 2).

292

Rev Mex Cienc Pecu 2021;12(1):286-297

Figure 3: FAP59/FAP64 PCR results

Lane 1: sample 5, 485 bp amplicon; Lane 2: sample 6, 511 bp amplicon; Lane 7: sample 10, 521 bp amplicon; Lane 9: sample 11, 515 bp amplicon; Lane 11: sample 4, 513 bp amplicon; Lane 12: negative control (no DNA); Lane 13: 100 bp ladder. Lanes 3, 4, 5, 6, 8 and 10: no PCR product observed.

In the MY09/MY11 analysis, a band was present between 470 and 490 bp in samples 1, 2, 5, 6, 8 and 9 (54.5% of all samples). Again, this corresponds to the PCR amplification product of the BPV L1 gene (Figure 4).

Figure 4: MY09/11 PCR results

Lane 1: sample 5, 472 bp amplicon; Lane 2: sample 6, 479 bp amplicon; Lane 5: sample 9, 492 bp amplicon; Lane 6: sample 1, 488 bp amplicon; Lane 8: sample 3, 483 bp amplicon; Lane 9: sample 4, 486 bp amplicon; Lane 12: negative control (no DNA); Lane 13: 100 bp ladder. Lanes 3, 4, 7, 10 and 11: no PCR product observed.

293

Rev Mex Cienc Pecu 2021;12(1):286-297

Most of the examined lesions were indicative of fibroids. However, some papillomas and fibropapillomas can exhibit regression or morphological changes during their evolution which make them resemble fibroids; their presence depend on animal chronicity and immune status(13,15). Given the timing of the sampling, it is therefore highly probable that the incidence of fibroids reported here constitutes an overestimate since lesion etiology and evolution can follow a common pattern.

The analyzed samples were collected from skin from different anatomical regions and no pattern of lesion restriction to a specific body region was observed. These results coincide with a previous study reporting that skin lesions associated with BPV infection can be generalized and that appearance site may correlate to BPV virus type(4).

The lesions sampled here were only cutaneous, suggesting that the viral types involved were most probably BPV-2, BPV-3, BPV-6, BPV-8, BPV-9 or BPV-10. This possibility requires confirmation through PCR product sequencing.

It seems this is the first study addressing molecular level detection of BPV in cattle in the state of San Luis Potosí. The present results will help to identify areas of opportunity in which greater detection and control is needed to improve animal health and the quality of livestock products.

The most frequent lesions observed in the epidermis during the histological analysis were irregular hyperplasia, marked diffuse hyperkeratosis and ballooning degeneration of keratinocytes, while in the dermis they were proliferation of reactive fibroblasts, fibrous connective tissue and aggregates of lymphocytes and plasma cells. These characteristics are widely reported as lesions suggesting papillomavirus infection(19,20).

Previous studies in Japan using the FAP-59/FAP-64 pair reported a 100 % BPV prevalence in skin lesions(21), while a study in Iran found a 12.5 % prevalence in Holstein cattle(22).

Overall infection frequency for any BPV type was 72 % in the present study. This level is only slightly lower than the 86 % BPV positive sample frequency reported in Brazil(23), and just above the 2 to 70 % positive sample frequency reported in the state of Tamaulipas, Mexico(18). In 27.27 % of the present samples the histological lesions were highly suggestive of viral infection, but PCR results were negative for BPV. In these cases a possible association of BPV with these lesions cannot be ruled out due to the genomic integration process which occurs in the natural history of BPV infection(4,24).

Papillomavirus infections have been described worldwide but genotype regional prevalence varies(1,25,26). In the present study, samples were collected from cattle in the central and Huasteca regions of San Luis Potosí. Climate in the former is dry arid while in the latter it is 294

Rev Mex Cienc Pecu 2021;12(1):286-297

subtropical. The present sample is too small to make conclusions about prevalence in these two regions, but ranchers in the Huasteca region report a higher incidence of lesions suggestive of BPV infection. This would agree with a previous report of a probable association between cutaneous papillomatosis frequency and tropical rainy climates(27).

This is the first description of BPV in cattle from the state of San Luis Potosí, Mexico.

Frequency in the evaluated samples was high, but similar to that found in a region bordering the state. In the present study there were no apparent patterns based on animal age or breed, or production system type. The BPV present in San Luis Potosí has not yet been characterized to the viral type level. This is a vital next step since it will allow characterization of specific distribution patterns (clusters) and consequent development of biological strategies aimed at viral types.

Acknowledgements

Isaura Méndez Rodríguez received a Ph.D. grant from the CONACYT (Mexico).

Conflicts of interest

The authors declare no conflict of interest in terms of the creation, edition and publication of this manuscript.

Literature cited: 1. Díaz RV, Duch CE, Gómez AD, Duato EGL, Rico LB. Papilomatosis bovina: epidemiología y diversidad de papilomavirus bovinos (BPV). Rev Complutense Cienc Vet 2012;6(2):38-58.

2. Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA. Virus taxonomy: VIIIth report of the International Committee on Taxonomy of Viruses. California, USA: Academic Press; 2005.

3. De Villiers EM, Fauquet C, Broker TR, Bernard HU, Zur Hausen H. Classification of papillomaviruses. Virology 2004;324(1):17-27.

4. Borzacchiello G, Roperto F. Bovine papillomaviruses, papillomas and cancer in cattle. Vet Res 2008;39(5):1.

295

Rev Mex Cienc Pecu 2021;12(1):286-297

5. Ogawa T, Tomita Y, Okada M, Shirasawa H. Complete genome and phylogenetic position of bovine papillomavirus type 7. J General Virol 2007;88(7):1934-1938.

6. Tomita Y, Literak I, Ogawa T, Jin Z, Shirasawa, H. Complete genomes and phylogenetic positions of bovine papillomavirus type 8 and a variant type from a European bison.

Virus Genes 2007;35(2):243-249.

7. Hatama S, Nobumoto K, Kanno T. Genomic and phylogenetic analysis of two novel bovine papillomaviruses, BPV-9 and BPV-10. J General Virol 2008;89(1):158-163.

8. Pattar J. Autogenous vaccination and immunomodulation for management of cutaneous papillomatosis in a crossbred cow. Intas Polivet 2013;14(2):423-425.

9. Munday J. Bovine and human papillomaviruses: a comparative review. Vet Pathol 2014;51(6):1063-1075.

10. Corteggio A, Altamura G, Roperto F, Borzacchiello G. Bovine papillomavirus E5 and E7 oncoproteins in naturally occurring tumors: are two better than one? Infectious Agents and Cancer 2013;8(1):1.

11. Knight CG, Munday JS, Rosa BV, Kiupel M. Persistent, widespread papilloma formation on the penis of a horse: a novel presentation of equine papillomavirus type 2 infection.

Vet Dermatol 2011;22(6):570-574.

12. Salib, FA, Farghali HA. Clinical, epidemiological and therapeutic studies on Bovine Papillomatosis in Northern Oases, Egypt in 2008. Vet World 2011;4(2)53-59.

13. Guzmán LSO, Barboza Q, González RRA. Biología del virus del papiloma humano y técnicas de diagnóstico. Medicina Universitaria 2010;12(49):231-238.

14. Henry M, Ioffe O. Squamous premalignancy of the cervix: advantages of a 2-tiered versus 3-tiered terminology. AJSP: Reviews & Reports 2013;18(4):177-182.

15. Jang JS, Kim JH, Shin TK, Cho GJ, Kwon OD. A case of cutaneous fibroma in a Korean indigenous cattle. J Vet Clin 2008;25(3):200-201.

16. Forslund O, Antonsson A, Nordin P, Stenquist BO, Hansson BG. A broad range of human papillomavirus types detected with a general PCR method suitable for analysis of cutaneous tumours and normal skin. J General Virol 1999;80(9):2437-2443.

17. Antonsson A, Hansson BG. Healthy skin of many animal species harbors papillomaviruses which are closely related to their human counterparts. J Virol 2002;76(24):12537-12542.

296

Rev Mex Cienc Pecu 2021;12(1):286-297

18. Rojas-Anaya E, Cantú-Covarrubias A, Álvarez JFM, Loza-Rubio E. Detection and phylogenetic analysis of bovine papillomavirus in cutaneous warts in cattle in Tamaulipas, Mexico. Canad J Vet Res 2016;80(4):262-268.

19. Jarrett WF, Campo MS, Blaxter ML, O'neil BW, Laird HM, Moar MH, et al. Alimentary fibropapilloma in cattle: a spontaneous tumor, nonpermissive for papillomavirus replication. J Natl Cancer Inst 1984;73(2):499-504.

20. Campo MS. Bovine papillomavirus and cancer. The Vet Journal 1997;154(3):175-188.

21. Ogawa T, Tomita Y, Okada M, Shinozaki K, Kubonoya H, Kaiho I, et al. Broad-spectrum detection of papillomaviruses in bovine teat papillomas and healthy teat skin. J General Virol 2004;85(8):2191-2197.

22. Babaahmady E, Taherpour K. Verrugas en los pezones de vacas lecheras. REDVET. Revista electrónica de Veterinaria 2011;12(6):1-6.

23. Santos EUD, Silva MAR, Pontes NE, Coutinho LCA, Paiva SSL, Castro RS, et al.

Detection of different bovine papillomavirus types and co‐infection in bloodstream of cattle. Transboundary Emerging Diseases 2016;63(1):e103-e10863.

24. Agrawal R, Pelkonen J, Rytkönen M, Mäntyjärvi RA. Integration of bovine papillomavirus type 1 DNA and analysis of the amplified virus-cell junctions in transformed primary mouse fibroblasts. J General Virol 1992;73(1):201-206.

25. Orozco ANM, Padilla MHJ. Manual alternativas de tratamiento contra la papilomatosis bovina [tesis doctoral]. Managua, Nicaragua: Universidad Nacional Agraria; 2016.

26. Charry DJV, Hinojosa LMB. Estudio de papilomatosis bovina en cinco propiedades de ganadería de leche, en cantón Pedro Vicente Maldonado en la provincia de Pichincha [tesis de licenciatura]. Quito, Ecuador: Universidad de las Américas; 2011.

27. Violet L, Montes D, Cardona J. Frecuencia de papilomatosis en bovinos (Bos taurus) del departamento de Córdoba, Colombia. Revista Colombiana de Ciencia Animal-RECIA 2017;9(2):294-300.

297

https://doi.org/10.22319/rmcp.v12i1.5378 Technical note

Prevalence of the qnrB, qnrA and blaTEM genes in temperate bacteriophages of Escherichia coli isolated from wastewater and sewer water from slaughterhouses in the State of Mexico

Juan Martín Talavera-González a Jorge Acosta-Dibarrat a Nydia Edith Reyes-Rodríguez b Celene Salgado-Miranda a Martín Talavera-Rojas a*

a

Universidad Autónoma del Estado de México. Facultad de Medicina Veterinaria y Zootecnia. Centro de Investigación y Estudios Avanzados en Salud Animal. Carretera Panamericana Toluca-Atlacomulco, Km 15.5, 50200 Toluca, Estado de México, México. b

Universidad Autónoma del Estado de Hidalgo. Instituto de Ciencias Agropecuarias.

Tulancingo de Bravo, Hidalgo, México.

* Corresponding author: talaverarojas@gmail.com

Abstract: Antibiotic resistance genes (ARG) have been described mainly in bacteria, but are known to occur in temperate phages. Prevalence of the qnrB, qnrA and blaTEM genes was identified in Escherichia coli strains and temperate phages by lytic cycle induction. From a total of 48 samples collected from drinking water, wastewater and sewer water in slaughterhouses in the State of Mexico, Mexico, 37 contained E. coli isolates. Resistance was highest to tetracycline (32/37; 86.4 %), followed by trimethoprim-sulfamethoxazole (19/37; 51.3 %) and ampicillin and nalidixic acid (18/37; 48.6 %). Prevalence of the blaTEM gene was 37.8 % in the bacterial isolates and 3.5 % in the phage isolates. The bacterial isolates contained 8.1 % qnrA and 29.7 % qnrB genes, while the phage isolates contained 2.7 and 24.3 %, respectively. Presence

298

Rev Mex Cienc Pecu 2021;12(1):298-305

of ARG in the bacterial isolates was linked to phage DNA, highlighting the significant role it plays in the spread of ARG in the studied slaughterhouses. Understanding the mechanisms of antimicrobial resistance will contribute to developing effective control measures.

Key words: Bacteriophages, Escherichia coli, Genes, Resistance.

Received: 13/05/2019 Accepted:31/03/2020

Among the most important medical advances of the last century, antibiotic therapy is a vital resource in the fight against infectious bacterial diseases. However, its widespread use has led to the advent of antibiotic-resistant bacteria(1). Rapid spread of resistant strains, driven in part by human migration and the increasing industrialization of food and animal production, is a recogized worldwide health problem. One cause of strains developing resistance is the presence of antibiotic resistance genes (ARG), which can be acquired and transferred through mobile genetic elements (MGE) such as bacteriophages(2).

Lysogenic bacteriophages containing ARG have been identified, largely in aquatic environments(2,3). They have also been reported in fecal samples collected in hospitals from clinically healthy patients, suggesting that these phages may be universally present though undetected in health safety screening programs(4,5). Various studies of lysogenic bacteriophages have detected ARGs that have claimed the lives of thousands of people and generated millions of dollars in losses worldwide. These studies have also elucidated phages’ contribution to the spread of ARGs in the environment(1). The present study objective was to improve understanding of bacteriophages’ role in the spread of ARG by quantifying the prevalence of the blaTEM, qnrA and qnrB genes in bacterial and phage DNA. Water samples were collected from municipal slaughterhouses (SLH1, SLH2, SLH3 and SLH4) in the State of Mexico, Mexico, from September to December 2015. Samples were collected based on probabilistic criteria(6), and following official guidelines(7). A total of 48 samples were collected from the animal processing area of each slaughterhouse: 16 from potable water (PW); 16 from wastewater (WW); and 16 from sewers (SW). Each sample was collected with a swab, which was then rubbed along the edges of the lid surface(7). Genotypic confirmation of E. coli isolation was done using an endpoint PCR to amplify the uidA gene (primers listed in Table 1), under established conditions(8). Antibiotic susceptibility was quantified using fourteen antimicrobial substances in different concentration ranges following the disk diffusion method guidelines of CLSI(9). Results interpretation was done according to CLSI guidelines(10).

299

Rev Mex Cienc Pecu 2021;12(1):298-305

Table 1: Specific primers used in PCR analysis Primer UAL1939b UAL2105b MultiTSO-F_for MULTITSOT_rev QnrAm_F QnrAm_R QnrBm_F QnrBm_R

Sequence (5'--- 3')

Gene

Reference

ATGGAATTTCGCCGATTTTGC uidA Aguilar et al. 2015 ATTGTTTGCCTCCCTGCTGC CATTTCCGTGTCGCCCTTATTC CGTTCATCCATAGTTGCCTGAC blaTEM Dallene et al. 2010 AGAGGATTTCTCACGCCAGG TGCCAGGCACAGATCTTGAC GGMATHGAAATTCGCCACTG TTTGCYGYYCGCCAGTCGAA

qnrA Kraychete et al. 2016 qnrB

Phage isolation was done with mitomycin C, and phage lysis verified with the spot-test method and double layer test(11). Phage DNA was isolated with the phenol-chloroform method(12). Bacterial DNA removal and the presence of phage DNA were confirmed with an endpoint PCR test in a MultigeneTM Mini Personal thermal cycler (Labnet International Inc., Edison, NJ, USA) with uidA amplification as a negative control(3).

Bacterial DNA extraction was done following a published protocol(13), and phage and bacterial DNA concentration and purity quantified with a spectrometer (Quawell q500).

Endpoint PCR was used to detect the qnrA, qnrB and blaTEM genes, under previously reported conditions(14,15). Statistical analyses consituted an analysis of variance (ANOVA) and a linear correlation test run using StatCalc ver. 8.2.2 (Copyright © 2016 AcaStat Software).

Significance was set at P<0.05.

Of the 48 collected samples, 37 (77 %) produced Escherichia coli isolates with varying resistance indices (Table 2). Of the 37 isolates, 13 (35.1 %) were from SLH1, while 8 each (21.6 %) were from SLH2, SLH3 and SLH4. The higher (P<0.05) number of isolates from SLH1 was probably a function of the larger number of animals pocessed there compared to the other slaughterhouses. A positive correlation (r= 1) was observed between the 19 (51.3 %) isolates from wastewater samples and the 18 (48.6 %) from sewage samples. This is to be expected since both sites exhibit similar conditions which are adequate for bacterial growth.

300

Rev Mex Cienc Pecu 2021;12(1):298-305

Table 2: Antibiotic resistance patterns for E. coli isolates from wastewater and sewer water collected from municipal slaughterhouses in northern State of Mexico Antib/Conc SLH1 SLH2 SLH3 SLH4 (g) W W 4

S W 3

Total (%) 7/18 (38.8) 0/1 (0)

W W 0

S W 2

Total (%) 2/18 (11.1) 0/1 (0)

W W 4

S W 1

Total (%) 5/18 (27.7) 1/1 (100) 4/19 (21) 3/5 (60) 1/5 (20) 0/0 (0)

W W 2

S W 2

Ampicillin (10) Amikacin 0 0 0 0 1 0 0 0 (30) Carbenicillin 4 3 7/19 2 2 4/19 3 1 2 2 (100) (36.8) (21) Gentamicin 1 1 2/5 (40) 0 0 0/5 (0) 2 1 0 0 (10) Cefalotin 0 1 1/5 (20) 1 0 1/5 1 0 1 1 (30) (20) Cefotaxime 0 0 0/0 (0) 0 0 0/0 (0) 0 0 0 0 (30) Netilmicin 0 0 0/1 (0) 0 0 0/1 (0) 0 0 0/1 (0) 1 0 (30) Cyprofloxacin 0 0 0/3 (0) 1 1 2/3 1 0 1/3 0 0 (5) (66.6) (33.3) Norfloxacin 0 1 1/3 1 0 1/3 1 0 1/3 0 0 (10) (33.3) (33.3) (33.3) Cloramphenicol 7 3 10/23 4 3 7/23 1 1 2/23 2 2 (30) (43.4) (30.4) (8.6) Trimethoprim7 4 11/19 1 3 4/19 1 0 1/19 2 1 sulfamethoxasole (57.8) (21) (5.2) (25) Nitrofurantoin 0 1 1/6 2 0 2/6 1 0 1/6 2 0 (300) (16.6) (33.3) (16.6) Nalidixic acid 1 2 3/18 2 3 5/18 2 4 6/18 3 1 (30) (16.7) (27.7) (33.3) Tetracycline 7 5 12/32 3 4 7/32 3 3 6/32 3 4 (30) (37.5) (21.8) (18.7) Antib= antibiotic; WW = wastewater; SW = sewer water; Conc = concentration.

Total (%) 4/18 (22.2) 0/1 (0) 4/19 (21) 0/5 (0) 2/5 (40) 0/0 (0) 1/1 (100) 0/3 (0) 0/3 (0) 4/23 (17.3) 3/19 (15.7) 2/6 (33.3) 4/18 (22.2) 7/32 (21.8)

The number of isolates with ARG was higher in wastewater than in sewer water (P0.05), and there were no isolates from the potable water samples (Table 3). Most probably due to the wide range of ARG variants and their different resistance mechanisms, the identified bacterial isolates which exhibited intermediate phenotypic resistance and susceptiblility also amplified blaTEM, qnrA and qnrB.

301

Rev Mex Cienc Pecu 2021;12(1):298-305

Table 3: Phenotype/genotype characterization and relation of bacterial and phage isolates collected from municipal slaughterhouses in northern State of Mexico Isolate source and Bacterial DNA gene Phage DNA gene type Antibiotic resistance pattern type (count) (count) R= 10 blaTEM (7) blaTEM (2) a WW I= 1 blaTEM (1) S= 8 blaTEM (2) Ampicillin R= 8 blaTEM (3) blaTEM (3) b SW I= 2 S= 8 blaTEM (1) R= 8 qnrA (2), qnrB (3) qnrA (1), qnrB (1) a WW I= 7 qnrA (1), qnrB (3) qnrB (1) S= 4 qnrB (1) Nalidixic acid R= 10 qnrB (2) qnrB (2) b SW I= 3 qnrB (1) S= 5 qnrB (1) WW = wastewater; SW = sewer water; R = resistant; I = intermediate resistance; S = susceptible. abc Different letter superscripts in the same column indicate statistical difference (P0.05).

A bacteriophage pool was obtained from each bacterial isolate for detection of blaTEM, qnrA and qnrB; all the isolates presented temperate phages. The blaTEM gene was the most prevalent in all the bacterial and phage isolates (Table 4). These results coincide with a previous study of water samples collected from wastewater treatment plants and slaughterhouses in which blaTEM was highly prevalent (80 to 100 %) and had high gene copy densities (± 3.3 log10)(3). The blaTEM gene is the most frequently reported worldwide(16,17), especially in Gram negative bacteria. This is assumed to be due to its broad dissemination via migratory waterfowl and the large number of β-lactamase enzymes synthesized by bacteria. In the bacterial isolates, prevalence of qnrA was 8.1 % and that of qnrB was 29.7 %, while in the phage isolates it was 2.7 and 10.8 %, respectively. In the phage isolates these prevalences contrast with previously reported prevalences in wastewater samples(3,18).

High qnrA prevalences have also been reported in samples obtained from a health center(4).

Although the observed prevalence is not high, quinolone resistance has been increasing due to indiscriminate use in veterinary and human medicine(18).

302

Rev Mex Cienc Pecu 2021;12(1):298-305

Table 4: Distribution of blaTEM, qnrA and qnrB in bacterial and phage isolates from samples collected from municipal slaughterhouses in northern State of Mexico blaTEM qnrA qnrB Slaughterhouse/ Bacterial Phagic Bacterial Phagic Bacterial Phagic isolate count DNA DNA DNA DNA DNA DNA (%) (%) (%) (%) (%) (%) SLH1/13 3 (23) 1 (7.6) 1 (7.6) 8 (61.5) 2 (15.3) SLH2/8 4(50) 1 (2.5) 1 (12.5) 1 (12.5) 1 (12.5) 1 (12.5) SLH3/8 4/(50) 1 (2.5) 1 (12.5) 1 (12.5) SLH4/8 3 (37.5) 2 (2.5) 1 (12.5) 1 (12.5) Total= 37 14 (37.5) 5 (13.5) 3 (8.1) 1 (2.7) 11 (29.7) 4 (10.8) The amount of ARG identified in the bacterial DNA and phage DNA was positively correlated (r= 0.99) (Table 4). This correlation coincides with the widely reported presence, in multi-resistant bacteria, of phages capable of disseminating portions of ARG-containing bacterial genome throughout the environment. These phages can transduce ARG to commensal and pathogenic bacteria, providing them new adaptive (short-term) and evolutive (long-term) abilities, and contributing to generation of new resistant pathogenic strains which are potentially fatal.

The highest number of bacterial isolates exhibiting presence of the three evaluated ARG was recorded in SLH1, while in SLH2 all three genes were found in the phage isolates (Table 4).

The contamination and unhygienic conditions in the sampled municipal slaughterouses provide many of the factors required for successful viral transduction: temperature, pH, concentration, and bacterial and phage physiological state.

Human lifestyles promote a steady increase in antibiotic resistance among microbes.

Consciousness of the consequences of indiscriminate and unnecessary use of antimicrobials is slowly growing but numerous studies still report highly virulent and resistant bacteria in areas of human activity(1). The bacterial and phage isolates analyzed here exhibited the presence of blaTEM, qnrA and qnrB in highly variable distributions; at least one of these genes was present in all the sampled slaughterhouses. Phages belonging to the MGE group play a vital role in the transfer of ARG between pathogenic-commensal and pathogenic-pathogenic bacteria(5). Better understanding of the mechanisms of antimicrobial resistance is an important tool in the ongoing development of effective strategies to reduce this phenomenon.

303

Rev Mex Cienc Pecu 2021;12(1):298-305

Literature cited: 1. Balcazar JL. Bacteriophages as vehicles for antibiotic resistance genes in the environment.

PLoS Pathog 2014;10(7):e1004219.

2. Colomer-Lluch M, Jofre J, Muniesa M. Antibiotic resistance genes in the bacteriophage DNA fraction of environmental samples. PLoS One 2011;6(3):e17549 .

3. Colomer-Lluch M, Calero-Cáceres W, Jebri S, Hmaied F, Muniesa M, Jofre, J. Antibiotic resistance genes in bacterial and bateriophage fractions of Tunisian and Spanish wastewater as markers to compare the antibiotic resistance patterns in each population.

Environment Int 2014a;(73):167-175.

4. Quirós P, Colomer-Lluch M, Martínez-Castillo A, Miró E, Argente M, Jofre J, et al.

Antibiotic resistance genes in the bacteriophage DNA fraction of human fecal samples.

Antimicrob Agents Chemother 2014;58(1):606-609.

5. Iversen H, L´Ábée-Lund TM, Aspholm M, Arnesen LP, Lindbäck T. Commensal E. coli Stx2 lysogens produce high levels of phages after spontaneous propahge induction.

Front Cell Infect Microbiol 2015;(5):1-8.

6. Jaramillo ACJ, Martínez MJJ. Epidemiología Veterinaria. 1ra ed. México: El Manual Moderno; 2010.

7. SS. Secretaria de Salud. Salud Ambiental. Agua para uso y consumo humano, requisitos sanitarios que se deben cumplir en los sistemas de abastecimiento públicos y privados durante el manejo del agua. Procedimientos sanitarios para el muestreo. NOM-230SSA1-2002. Diario Oficial de la Federación, México.

8. Aguilar MOS, Talavera RM, Soriano VE, Barba LJ, Vazquez, NJ. Determination of extended spectrum -lactamases and plasmid-mediated quinolone resistance in Escherichia coli isolates obtained from bovine carcasses in Mexico. Trop Anim Health Prod 2015;47(5):975-981.

9. CLSI. Clinical and Laboratory Standard Institute. Performance standards for antimicrobial disk susceptibility tests, 19th ed. Approved Standard M02-A11. Wayne, PA: CLSI. 2012.

10. CLSI. Clinical and Laboratory Standard Institute. Performance standards for antimicrobial susceptibility testing, 25nd informational supplement. M100-S25. Wayne, PA: CLSI. 2015.

11. Raya RR, Hébert EM. Isolation of phage via induction of lysogens. In: Clokie MRJ, Kropinski AM, editors. Bacteriophages. Methods and Protocols, Volume 1: Isolation, characterization, and interactions. UK: Humana Press; 2009:23-32.

304

Rev Mex Cienc Pecu 2021;12(1):298-305

12. Pickard DJ. Preparation of bacteriophage lysate and pure DNA. In: Clokie MRJ, Kropinski AM, editors. Bacteriophages. Methods and protocols, Volume 2: Molecular and Applied Aspects. UK: Humana Press; 2009:3-9.

13. Ahmed AM, Ishida Y, Shimamoto T. Molecular characterization of antimicrobial resistance in Salmonella isolated from animals in Japan. J Appl Microbiol 2009;106(2):402-409.

14. Kraychete GB, Botelho LA, Campana EH, Picão RC, Bonelli RR. Updated multiplex PCR for detection of all six plasmid-mediated qnr gene families. Antimicrob Agents Chemother 2016;60(12):7524-7526.

15. Dallenne C, Da Costa A, Decré D, Favier C, Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J Antimicrob Chemother 2010;65(3):490-495.

16. Ouedraogo SA, Sanou M, Kissou A, Sanou S, Solaré H, Kaboré F, et al. High prevalence of extended-spectrum -lactamase producing enterobacteriaceae among clinical isolates in Burkina Faso. BMC Infect Dis 2016;(16):326.

17. Jang J, Suh YS, Di DY, Unno T, Sadowsky MJ, Hur HG. Pathogenic Escherichia coli strains producing extended-spectrum β‐lactamases in the Yeongsan River Basin of South Korea. Environ Sci Technol 2012;47(2):1128-1136.

18. Colomer-Lluch M, Jofre J, Muniesa M. Quinolone resistance genes (qnrA and qnrS) in bacteriophage particles from wastewater samples and the effect of inducing agents on packaged antibiotic resistance genes. J Antimicrob Chemother 2014;69(5):1265-1274.

305

https://doi.org/10.22319/rmcp.v12i1.5454 Technical note

Sensory quality of meat from suckling kids of two indigenous Spanish goat breeds raised in grazing production systems

Francisco De-la-Vega Galán a* José Luis Guzmán Guerrero b Manuel Delgado Pertíñez a Luis Ángel Zarazaga Garcés b Pilar Ruiz Pérez-Cacho c Hortensia Galán-Soldevilla c

a

Universidad de Sevilla, Escuela Técnica Superior de Ingeniería Agronómica, Departamento de Ciencias Agroforestales, Sevilla, España.

Universidad de Huelva “Campus de Excelencia Internacional Agroalimentario, ceiA3", Escuela Técnica Superior de Ingeniería, Departamento de Ciencias Agroforestales. Campus Universitario de la Rábida, Carretera de Huelva-Palos de la Frontera. s/n. 21819, Huelva, España. b

c

Universidad de Córdoba, E.T.S. de Ingenieros Agrónomos y Montes, Departamento de Bromatología y Tecnología de los Alimentos, Córdoba, España.

* Corresponding author: fdelavega@colvet.es

Abstract: In Spain, there is growing interest in the conservation of native goat breeds in grazing production systems, and the possibility of conventional farms transitioning to organic.

This requires a complete understanding of the repercussions of this transition, including its effect on end product sensory quality. An evaluation was done of the sensory attributes of suckling goat meat from two indigenous Spanish breeds (Payoya and Blanca Andaluza) raised in conventional and organic grazing production systems. Of 306

Rev Mex Cienc Pecu 2021;12(1):306-317

the 21 suckling kids used, 12 were raised in an organic system (6 Payoya and 6 Blanca Andaluza) and 9 in a conventional system (3 Payoya and 6 Blanca Andaluza). Meat sensory profile was evaluated by an analytical panel. The meat from kids raised in organic systems had less intensity of smell and a softer, more tender and juicier texture than meat from the conventional systems. Meat from Blanca Andaluza kids exhibited lower odor intensity and a softer, more tender and juicier texture than the Payoya kid meat. These are promising preliminary results that highlight some of the benefits resulting from the transition from conventional to organic grazing systems for goat production.

Key words: Sensory quality, Kid meat, Ecological.

Received: 15/07/2019 Accepted: 13/02/2020

There is growing interest in Spain, both in government and among producers, in the conservation of indigenous livestock breeds raised in extensive or semi-extensive grazing systems. Many of these breeds, such as the Blanca Andaluza and Payoya goat breeds, are considered to be endangered(1). Both are largely produced on farms in remote mountainous areas in the Andalusia Autonomous Community (Comunidad Autónoma de Andalucía)(2).

The Blanca Andaluza breed is raised for meat production. In areas where it is traditionally eaten kids are still raised with the mother in a grazing system and then slaughtered at five months of age at about 25to 30 kg live weight. However, commercial production is mostly of suckling kid(2). The Payoya breed is representative of grazingbased dairy-producing goat breeds in the region. Farms raising this breed focus mainly on dairy production with suckling kid meat as an appealing secondary product due to its high market price. In this system kids are slaughtered at 8 to 9 kg live weight.

Farms commercially producing these two goat breeds can easily be transformed into organic farms(3,4). Determining the feasibility of this transformation requires analyses of technical and economic viability, as well as study of product quality. Our research group has produced two studies on the fatty acid profile(5,6) and two on meat quality in these breeds(7,8), using animals from the same farms as those used in the present study.

No significant differences were observed between kids raised in conventional and organic farms in terms of most fatty acids in intramuscular fat or other fatty deposits, and meat attributes. These findings suggest that, from a product quality perspective, there is no impediment to making the transformation. It seems that no previous research 307

Rev Mex Cienc Pecu 2021;12(1):306-317

has been published on the sensory quality of meat from the Blanca Andaluza and Payoya breeds. Based on previous studies it is improbable that the sensory quality of suckling kid meat from these breeds exhibits notable differences between conventional and organic production systems. If this is the case, the transformation of conventional farms to the organic system would become that much more appealing. The present study objective was to quantify the sensory quality of suckling kid meat from the Payoya and Blanca Andaluza breeds raised in grazing-based organic and conventional production systems.

The evaluated meat was sourced from suckling kids raised on four semi-extensive goat farms (two conventional and two organic)(5,6). Both types of farm were certified according to the regulations of the European Council (EC) (No. 834/2007)(9), and the guidelines for each breed (Payoya and Blanca Andaluza). Diets for the goats on all four farms were based on grazing of natural Mediterranean shrub-type grasses. The study area is dominated by shrubs (60 to 80% coverage, approximately 0.6 to 1.8 m height) and trees (mainly Mirtus communis, Pistacia lentiscus, Quercus ilex, Cistus salvifolius and Arbutus unedo). There are also grasses (Lolium spp., Phalaris aquatica, Hainardia cylindrica, Hordeum bulbosum), legumes (Trifolium subterraneum, T. pallidum, T. aquamosum, T. squarrosum, T. istmocarpum, Scorpiurus muricatus, S. vermiculatus, among others) and other dicotyledons (Cichorium spp., Carlina racemosa, Cynara humilis, Echium plantagineum, Galactites tomentosa, Scolymus spp., among others). At all four farms the goats were grazed daily, regardless of grass availability, and penned at night to allow the kids to nurse. Feed concentrate supplements were provided in all cases. For the Payoya breed these were used at 1 kg/head/day in the conventional farms and 0.5 kg/head/day in the organic farms. For the Blanca Andaluza breed they were used at 0.6 kg/head/day in the conventional farms and 0.35 kg/head/day in the organic farms (Table 1).

308

Rev Mex Cienc Pecu 2021;12(1):306-317

Table 1: Concentrate supplement ingredients and chemical composition in conventional and organic goat production systems Payoya Blanca Andaluza Ingredients (% fresh matter) Conventional Organic Conventional Organic Barley grain 10.0 74.0 74.0 Fava bean 60.0 Beet pulp 9.5 Carob 4.0 4.0 By-pass fat 1.5 Gluten feed 12.0 Peas 5.0 40.0 5.0 Maiz kernals 26.0 Soy meal 18.2 Cane sugar molasses 2.0 Sunflower seed meal 5.0 Sunflower seeds 5.0 5.0 Wheat bran 4.0 4.0 Wheat flour 12.0 Wheat husk 5.0 5.0 Calcium carbonate 1.8 2.5 2.5 Manganese oxide 0.2 Sodium bicarbonate 0.8 Salt 0.8 0.5 0.5 Vitamin-mineral corrector 0.2 free Chemical composition (% dry matter): Dry matter (%) 92 93 88 93 Organic matter 93 94 97 94 Crude protein 21 19 22 19 Crude fat 2 2 1 2 Animals of both breeds grazed year round. Supplements: Payoya, 1 kg/head/day on conventional farms and 0.5 kg/head/day on organic farms; Blanca Andaluza, 0.6 kg/head/day on conventional farms and 0.35 kg/head/day on organic farms.

Experimental animals were 21 suckling kids, born of double births. Of these, twelve were raised using an organic system (6 Payoya, 6 Blanca Andaluza), and nine using a conventional system (3 Payoya, 6 Blanca Andaluza). Mother/kid pairs were randomly selected at each farm within the same season. The kids had access to their mothers throughout the lactation period, but not to other foods.

All kids were slaughtered at a live weight of 8.12 ± 0.49 kg (Payoya) or 7.52 ± 0.64 kg (Blanca Andaluza) in a government slaughterhouse in Huelva, Spain. They were killed after fasting for 16.00 ± 0.75 h (Payoya) or 19.81 ± 2.49 h (Blanca Andaluza) with free access to water. After slaughter, the carcasses were refrigerated at 4 °C and cured for 24 309

Rev Mex Cienc Pecu 2021;12(1):306-317

h. The left half of each carcass was transported under refrigeration to the University of Huelva. The half carcasses were butchered and the legs separated(10), and all cuts vacuum packed and frozen at -20 ºC until analysis. Mean leg weight was 0.65 ± 0.03 kg in the Payoya kids and 0.56 ± 0.07 kg in the Blanca Andaluza kids.

Prior to sensory analysis, the legs were thawed inside the vacuum bag by immersion in running water at 17 to 19 °C. The whole legs were cooked in an electric oven, until reaching an internal temperature of 65 to 70 ºC as measured with a thermocouple (JENWAY 2000). Once cooked, the semimembranosus muscle was extracted and cut into 2 x 2 cm subsamples. These were individually wrapped in aluminum foil previously coded with a random three-digit number. The subsamples were kept warm in an electric oven preheated to 60 ºC and then served to tasters in tasting booths, one by one in random order. The tasters consisted of a trained panel of seven tasters, selected and trained according to international standards (ISO 8586)(11), and belonging to the analytical panel of the Sensory Laboratory of the Department of Bromatology and Food Technology of the University of Cordova. Samples from the 21 legs were analyzed in six sessions of no more than 1 h, each taster evaluating a maximum of four samples per session. This methodology is an adaptation of an established methodology for sensory analysis of meat from small ruminants(12). All analyses were done near mid-day (1200 to 1300 h) in the tasting room of the Córdoba Hospitality School. Tasters cleared their palate with mineral water between samples. Six sensory attributes were analyzed: 1 for appearance (color intensity); 1 for smell (overall smell intensity); 3 for texture (tenderness, mastication and juiciness); and 1 for aroma (overall aroma intensity). Each attribute was graded using an unstructured linear scale that was 10 cm in length and anchored 1 cm from either end. Qualitative evaluations were done of odor (orthonasal) and aroma (retronasal) notes and basic flavors.

The quantitative sensory attributes were analyzed using a two-way analysis of variance (ANOVA) (production system x breed), using the General Linear Model (GLM) of the IBM SPSS for Windows statistical package (version 22.0; IBM Corp., Armonk, New York, USA ). An additional ANOVA was done for each sensory attribute to assess whether the panel had worked as a group. After parameter analysis, a factor analysis was run using the principal components (PC) method and selecting those factors with an associated eigenvalue greater than 1.

The results indicated that the panel worked as a group for all the quantified sensory attributes (P>0.05). Differences between production systems (P<0.05) were found for all sensory attributes except color intensity and overall aroma intensity (Table 2).

Differences were also identified between breeds for overall smell intensity (P<0.001), tenderness (P<0.01) and juiciness (P<0.01), as well as for the interactions (production system x breed) for color intensity (P<0.001) and tenderness (P<0.05).

310

Rev Mex Cienc Pecu 2021;12(1):306-317

Table 2: Descriptive measures (mean ± standard error) and analysis of variance (production system x breed) for sensory attributes of analyzed suckling kid meat Production System (PS) Attributes Color intensity Overall smell intensity Tenderness Mastication Juiciness Overall aroma intensity

Breed (B)

Significance

Organic (n=12)

Conventional (n=9)

Blanca (n=12)

Payoya (n=9)

PS

B

PS ×B

4.9±0.19 5.8±0.07

5.2±0.16 6.2±0.08

5.1±0.16 5.8±0.08

5.0±0.19 6.1±0.05

ns ***

ns ***

*** ns

4.3±0.11 5.0±0.15 4.1±0.12

5.0±0.17 4.5±0.19 3.8±0.16

4.5±0.13 4.9±0.16 4.2±0.15

4.7±0.17 4.5±0.17 3.7±0.07

*** *** *

** ns **

* ns ns

5.4±0.07

5.8±0.10

5.4±0.07

5.8±0.09

ns

ns

ns

* P<0.05; ** P<0.01; *** P<0.001; ns= not significant.

Suckling kid meat from the organic systems had less intensity of smell and a softer, more tender and juicier texture than that from the conventional systems. This is partially supported by previous results produced using the same set of animals as in the present study. In this earlier study water retention capacity (WRC) and texture or meat shear resistance exhibited almost no differences between production systems in both breeds(7,8). The exception was Payoya kids from the organic system, which had a higher WRC than the other systems, providing some support for the positive results observed in organic Payoya kids in the present study. No similar studies on differences in meat sensory quality between suckling kids in organic and conventional systems have been published to date, but some have addressed differences in kid meat sensory attributes between animals raised in different feeding regimes. For example, a study of the sensory profile of meat from Blanca Serrana Andaluza kids slaughtered at 19 kg only found a higher overall aroma intensity in meat from intensive systems (6.2) than in meat from extensive systems (5.2), which is attributed to higher fat content in the former(13).

Other studies(14) identified differences in sensory attributes between the meat of suckling kids fed with natural milk or a milk substitute. The smell and taste of meat from kids fed the milk substitute was stronger, despite the lack of differences in the percentage of intramuscular fat between the two diets. These differences are attributed to possible variations in the degree of unsaturation of intramuscular fat in response to differences between the diets.

The feed regime of the mothers of the kids used in the present study was similar, suggesting that inter-system variations in the meat sensory profile could be attributed to the nutritional contributions from grazing and the feed concentrate supplements(5,6). In addition, no differences in intramuscular fat content were observed between meats from the two systems(5,6). However, differences in sensory attributes between production systems could be partially due to the higher percentages of some fatty acids in the 311

Rev Mex Cienc Pecu 2021;12(1):306-317

intramuscular fat of both breeds when raised under organic conditions; in the Blanca Andaluza they were C17:0, C17:1, C20:1, C20:4 n-6, C22:2 and some n-3 fatty acids (omega-3 docosahexaenoic acid C22:5-DPA- and C22:6-DHA-)(5), in Payoya they were C14:0, C18:1 trans-11- (VA) and the n-3 fatty acids C20:5 (EPA), DHA and DPA(6).

This is supported by a recent study on the effects of adding a milk substitute (16 % dry matter) to kid diets on meat sensory quality(15). Compared to low DHA levels (0.9 %), addition of a high levels of DHA (1.8 %) produced meat with an unpleasant smell and taste and low general acceptance scores. This suggests that, because the animals were very young, they were depositing high quantities of DHA in intramuscular fat, leading to the lower sensory quality rating. Dietary DHA intake of the evaluated kids was not quantified but its content in the meat was higher in those from organic production (0.13 to 0.19 %) than in those from conventional production (0.9 to 0.10 %). Higher intake did not of itself improve the sensory attributes of the organic meat. Perhaps the differences in sensory quality observed here could be explained by this minor difference in DHA levels in conjunction with other fatty acids.

In the inter-breed comparison, the Blanca Andaluza meat had lower odor intensity and a softer, more tender and juicier texture than the Payoya meat. This could be explained in part by the higher meat texture values of the Payoya meat (7.26 kg/cm2) compared to Blanca Andaluza meat (5.59 kg/cm2) (P<0.001, unpublished data). Differences in meat sensory attributes have been reported for different goat breeds and genotypes(16,17), but very few publications address meat sensory quality in the two indigenous breeds studied here, and none compare them. Animal breeds can affect quality and even justify establishing a quality brand(18).

In the qualitative analysis of meat sensory attributes by breed and production system (Table 3), the Blanca Andaluza breed exhibited differences in the odor and aroma descriptors and the basic flavors. Kid meat from the organic system was described as having olfactory notes of cooked meat and metallic flavor while that of the conventional system had a cooked meat olfactory note as well as the smell/aroma of liver and kid and an acid flavor. For meat from Payoya breed kids no clear differences between production systems were apparent in the odor and aroma descriptors, but in terms of basic flavors the organic meat was tasty while the conventional meat had a slightly higher metallic flavor.

312

Rev Mex Cienc Pecu 2021;12(1):306-317

Table 3: Frequencies (%) of qualitative analysis descriptors (odor/aroma and basic flavors) of suckling kid meat by breed and production system Blanca Andaluza Payoya Descriptor Organic Conventional Organic Conventional (n=6) (n=6) (n=6) (n=3) Odor and aroma: Cooked meat 100 67 83 33 Liver 17 100 50 67 Kid 0 50 0 0 Urine 0 17 0 0 Basic flavors: Tasty 17 17 50 0 Metallic 67 0 50 67 Acidic 0 50 17 0 A principal component analysis (PCA) was run in an attempt to group the samples by production system and breed. The first two principal components (CPs) explain almost 66 % of the total variance in sensory quality attributes (37.86 and 27.88 %, for the first and second, respectively). The CP1 is formed mainly by the texture attributes mastication and juiciness (right of graph), and tenderness (left) (Figure 1a). The CP2 is characterized by the quality attributes intensity of smell and aroma (both at top of graph). In the PCA for production systems (Figure 1b), in the plane defined by the two CPs, the results are variable. However, organic system kids tended to be located on the right side (greater juiciness and mastication, and less tenderness) and lower portion (less intensity of smell and aroma), whereas conventional system kids tended to be in the left and upper portions. Again, the PCA for breeds is variable, but two general groups can be seen. That in the lower portion corresponds to Blanca Andaluza (less intensity of smell and aroma) and that on the left corresponds to Payoya (less juiciness and mastication).

313

Rev Mex Cienc Pecu 2021;12(1):306-317

Figure 1: Principal components factorial analysis

a) Kid meat sensory attributes in plane defined by two principal components.

b) Kids by production system in plane defined by two principal components.

314

Rev Mex Cienc Pecu 2021;12(1):306-317

c) Kids by breed in plane defined by two principal components.

Overall, the sensory quality evaluation showed meat from organically-produced Blanca Andaluza kids to have better sensory attributes (more tender, juicier, greater mastication) and less odor intensity than those from conventional systems and/or the Payoya breed. For the Blanca Andaluza breed there were clear differences between systems for the smell and aroma descriptors and basic flavors, whereas for the Payoya breed there were only clear differences between systems for the basic flavors. Although the samples exhibited broad variability, these preliminary results suggest that transitioning from conventional grazing systems to organic ones could improve meat sensory quality. Further research using larger samples is still needed to more clearly determine the possible benefits of this switch in systems.

Acknowledgements

The research reported here was financed by the Instituto Andaluz de Investigación y Formación Agraria, Pesquera, Alimentaria y de la Producción Ecológica of the Consejería de Agricultura y Pesca of the Junta de Andalucía (Nº 75, 92162/1). Thanks are due the producers Francisca Delgado Méndez, Domingo Ginés Domínguez, Benjamín Bombas González, Manuel Sánchez Sánchez and Daniela Hinojo Antille for providing animals, and the analytical panel of the Laboratorio Sensorial del Departamento de Bromatología y Tecnología de los Alimentos, Universidad de Córdoba.

315

Rev Mex Cienc Pecu 2021;12(1):306-317

Literature cited: 1.

Real Decreto 2129/2008, de 26 de diciembre, por el que se establece el Programa nacional de conservación, mejora y fomento de las razas ganaderas. B.O.E. nº 23, martes 27 de enero de 2009: 9211-9242.

2.

FEAGAS. Federación Española de Asociaciones de Ganado Selecto 2014; 38.

3.

Mena Y, Ligero M, Ruiz FA. Organic and conventional dairy goat production systems in Andalusian mountainous areas. Option Méditerranéennes A 2009;91:253-256.

4.

Mena Y, Nahed J, Ruiz FA. Proximity to the organic model of dairy goat systems in the Andalusian mountains (Spain). Trop Subtrop Agroecosyst 2009;11:69-73.

5.

De-La-Vega F, Guzmán JL, Delgado-Pertíñez M, Zarazaga LA, Argüello A. Fatty acid composition of muscle and adipose tissues of organic and conventional Blanca Andaluza suckling kids. Spanish J Agric Res 2013;1(3):770-779.

6.

De-La-Vega F, Guzmán JL, Delgado-Pertíñez M, Zarazaga LA, Argüello A. Fatty acid composition of muscle and internal fat depots of organic and conventional Payoya goat kids. Spanish J Agric Res 2013;11(3):759-769.

7.

Guzmán JL, De-la-Vega F, Zarazaga LA, Argüello A, Delgado-Pertíñez M. Carcass and meat quality of Blanca Andaluza kids fed exclusively with milk from their dams under organic and conventional grazing-based management systems.

Italian J Anim Sci 2019;18 (1):1186-1191.

8.

Guzmán JL, De-La-Vega F, Zarazaga LA, Argüello A, Delgado-Pertíñez M. Carcass characteristics and meat quality of Payoya breed conventionally and organically reared dairy goat suckling kids. Ann Anim Sci 2019;9(4):1149-1159.

9.

Reglamento (CE) nº 834/2007 del Consejo, de 28 de junio de 2007, sobre producción y etiquetado de los productos ecológicos y por el que se deroga el Reglamento (CEE) nº 2092/91. Diario Oficial de la Unión Europea L 189: 1-23.

10. Colomer-Rocher F, Morand-Fehr P, Kirton H. Standard methods and procedures for goat carcass evaluation, jointing and tissue separation. Livest Prod Sci 1987;17: 149-159.

11. ISO 8586. International Organization for Standardization Publications. Sensory analysis —Methodology—. General guidance for the selection, training and monitoring of selected assessors and expert sensory assessors. 2012.

316

Rev Mex Cienc Pecu 2021;12(1):306-317

12. Guerrero L. Determinación sensorial de la calidad de la carne. En: Cañeque V, Sañudo C editores. Metodología para el estudio de la calidad de la canal y de la carne en rumiantes, Madrid, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria 2000;205-220.

13. Germano Costa R, Galán H, Camacho Vallejo ME, Vallecillo A, Delgado Vermejo JV, Argüello Henríquez A. Perfil sensorial de la carne de cabritos de la raza Blanca Serrana Andaluza. Arch Zoot 2008;57:67-70.

14. Bañon S, Vila R, Price A, Ferrandini E, Garrido MD. Effects of goat milk or milk replace diet on milk quality and fat composition of suckling goat kids. Meat Sci 2006;72:216-221.

15. Moreno-Indias I, Sánchez-Macías D, Martínez de-la-Puente J, Morales de la Nuez A, Hernández-Castellano LE, Castro N, Argüello A. The effect of diet and DHA addition on the sensory quality of goat kid meat. Meat Sci 2012;90:393-397.

16. Lemes JS, Monge P, Campo MM, Guerra V, Sañudo, C. Estudio comparativo de la calidad de productos caprinos locales frente a sus posibles competidores. Congreso de la SEOC 2011;154-157.

17. Ngambu S, Muchenje V, Chimonyo M, Marume U. Correlations among sensory characteristics and relationships between aroma scores, flavour scores, off-flavour scores and off-flavour descriptors of chevon from four goat genotypes. African J Biotech 2011;10(34):6575-6580.

18. Sañudo C. Calidad de la canal y de la carne ovina y caprina y los gustos de los consumidores. Rev Brasileña Zoot 2008;37:143-160.

317

Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 12 Núm 1, pp. 1-317, ENERO-MARZO-2021

ISSN: 2448-6698

CONTENIDO CONTENTS Pags.

Efecto de la selección genética en contra de las emisiones de metano sobre los componentes de la leche

Relationships among ß-hydroxybutyrate, calcium and non-esterified fatty acids in blood with milk yield losses at early lactation

Relaciones entre el ß-hidroxibutirato, el calcio y los ácidos grasos no esterificados en la sangre con pérdidas de producción de leche en la lactancia temprana Rufino López-Ordaz, Gabriela Pérez-Hernández, Hugo Alonso Ramírez-Ramírez, Reyes López-Ordaz, Germán David Mendoza-Mar�nez, Agus�n Ruíz-Flores……………………………………………………………………………………………………………………………………….………………………………….………..….......….....…18

Caracterización genética de la oveja Pelibuey de México usando marcadores microsatélites

Genetic characterization of Mexican Pelibuey sheep using microsatellite markers Cecilio Ubaldo Aguilar Mar�nez, Bertha Espinoza Gu�érrez, José Candelario Segura Correa, José Manuel Berruecos Villalobos, Javier Valencia Méndez, Antonio Roldán Roldán…………………….……………….…………….……………..….……………………………..…………..…………..…………..…………..………..……………….36

Diversidad genética de gallinas criollas en valles centrales de Oaxaca usando marcadores microsatélites

Genetic diversity of creole chickens in Valles Centrales, Oaxaca, using microsatellite markers Héctor Luis-Chincoya, José Guadalupe Herrera-Haro, Amalio Santacruz-Varela, Martha Patricia Jerez-Salas, Alfonso Hernández-Garay ..................……….........………….........…………………..….……………………….58

Milk fatty acid profile of crossbred Holstein x Zebu cows fed on cake licuri

Perfil de ácidos grasos de la leche de vacas Holstein x Cebú alimentadas con pasta de licuri Antonio Ferraz Porto Junior, Fabiano Ferreira da Silva, Robério Rodrigues Silva, Dicastro Dias de Souza, Edvaldo Nascimento Costa, Evely Giovanna Leite Costa, Bismarck Moreira San�ago, Geónes da Silva Gonçalves……………………………..............….…..………………………………………...………..…………..……………………72

Milk yield derived from the energy and protein of grazing cows receiving supplements under an agrosilvopastoral system

Rendimiento de leche derivado de energía y proteína de vacas en pastoreo recibiendo suplementos en un sistema agrosilvopastoril Sherezada Esparza-Jiménez, Benito Albarrán-Por�llo, Manuel González-Ronquillo, Anastacio García-Mar�nez, José Fernando Vázquez-Armijo, Carlos Manuel Arriaga-Jordán…..…………………………...……….87

Nutritional management of steers raised in graze and in feedlot: intake, digestibility, performance and economic viability

Manejo nutricional de novillos criados en pastoreo y en corral: efectos en el consumo, digestibilidad, rendimiento y viabilidad económica Sinvaldo Oliveira de Souza, Robério Rodrigues Silva, Fabiano Ferreira da Silva, Ana Paula Gomes da Silva, Marceliana da Conceição Santos, Rodrigo Paiva Barbosa, Raul Lima Xavier, Tarcísio Ribeiro Paixão, Gabriel Dallapicola da Costa, Adriane Ba�sta Peruna, Mariana Santos Souza, Laize Vieira Santos……………………………………………………....……………………………….….....105

Producción y evaluación de inóculos lácteos probióticos obtenidos del tracto digestivo de lechón (Sus scrofa domesticus) propuestos para alimentación porcina

Production and evaluation of probiotic milk inocula obtained from the digestive tract of piglets (Sus scrofa domesticus) proposed for pig feed Carmen Rojas Mogollón, Gloria Ochoa Mogollón, Rubén Alfaro Aguilera, Javier Querevalú Or�z, Héctor Sánchez Suárez………………………………………………………………..…………..…………..…………...…………..…….120

Actividad antihelmíntica in vivo de hojas de Acacia cochliacantha sobre Haemonchus contortus en cabritos Boer

In vivo anthelmintic activity of Acacia cochliacantha leaves against Haemonchus contortus in Boer goat kids Gastón Federico Cas�llo-Mitre, Rolando Rojo-Rubio, Agus�n Olmedo-Juárez, Pedro Mendoza de Gives, José Fernando Vázquez-Armijo, Alejandro Zamilpa, Héctor Aarón Lee-Rangel, Leonel Avendaño-Reyes, Ulises Macias-Cruz ……………………………………………………………………………………………………..…………..…………..…………..…………..………….....138

The effect of silkworm pupae and mealworm larvae meals as dietary protein components on performance indicators in rabbits

Efecto de la harina de pupas y larvas de gusano de seda como componentes proteicos de la dieta sobre indicadores de rendimiento en conejos Dorota Kowalska, Janusz Strychalski, Andrzej Gugołek…………………………..….………………………...……………………………………………………………………….…………………………………………………………………..…………..…………..151

Evaluación de indicadores productivos en rebaños caprinos vacunados con cepas RB51–SOD, RB51 (Brucella abortus) y Rev-1 (Brucella melitensis)

Evaluation of productive indicators in goat herds vaccinated with RB51–SOD, RB51 (Brucella abortus) and Rev-1 (Brucella melitensis) strains Baldomero Molina-Sánchez, David Izcoatl Mar�nez-Herrera, Violeta Trinidad Pardío-Sedas, Ricardo Flores-Castro, José A. Villagómez-Cortés, José F. Morales-Álvarez……………………………………..…………..…163

Distribución corporal de garrapatas (Acari: Ixodidae y Argasidae) asociadas a Odocoielus virginianus (Artiodactyla: Cervidae) y Ovis canadensis (Artiodactyla: Bovidae) en tres estados del norte de México

Body distribution of ticks (Acari: Ixodidae and Argasidae) associated with Odocoileus virginianus (Artiodactyla: Cervidae) and Ovis canadensis (Artiodactyla: Bovidae) in three northern Mexican states Mariana Cuesy León, Zinnia Judith Molina Garza, Roberto Mercado Hernández,Lucio Galaviz Silva……………………………………..………………....…………………..…………..…………..…………..…………..…………..…………....177

Detección de anticuerpos de Neospora spp. en caballos, asociados a diferentes factores de riesgo en México

Detection of anti-Neospora spp. antibodies associated with different risk factors in horses from Mexico colectados de colonias de abeja melífera africanizada en dos apiarios en Yucatán,México Kenia Jasher Padilla-Díaz, Le�cia Medina-Esparza, Carlos Cruz- Vázquez, Irene Vitela-Mendoza, Juan F. Gómez-Leyva, Teódulo Quezada-Tristán……………………………………..……………………..…………….........…..194

Desempeño productivo y costos de granjas porcinas con diferentes protocolos de vacunación al virus del PRRS

Productive performance and costs of swine farms with different PRRS virus vaccination protocols Elizabeth Araceli Quezada-Fraide, Claudia Giovanna Peñuelas-Rivas, Frida Saraí Moysén-Albarrán, María Elena Trujillo-Ortega, Francisco Ernesto Mar�nez-Castañeda …………………..….…………………………..205

Las funciones de las aves en la producción avícola de pequeña escala: el caso de una comunidad rural en Hidalgo, México

Bird roles in small-scale poultry production: the case of a rural community in Hidalgo, Mexico Ana Rosa Romero-López……………………..……………………………………………………………………………………………………………….…………………………………………………..…………..…………..…………..…………..…………..…………..…...217

Disonancia cognitiva ante el cambio climático en apicultores: un caso de estudio en México

Cognitive dissonance in the face of climate change in beekeepers: A case study in Mexico Felipe Gallardo-López, Blanca Patricia Castellanos-Potenciano, Gabriel Díaz-Padilla, Arturo Pérez-Vásquez, Cesáreo Landeros- Sánchez, Ángel Sol-Sánchez ……………………........……….………………..……………..238

Evaluation of two supplemental zilpaterol hydrochloride sources on meat quality and carcass traits of crossbred Bos indicus bulls in the tropics

Evaluación de dos fuentes suplementarias de clorhidrato de zilpaterol sobre la calidad de la carne y los rasgos de la canal de toros Bos indicus cruzados en los trópicos Pedro Antonio Alvarado García, Maria Salud Rubio Lozano, Héctor Salvador Sumano López, Luis Ocampo Camberos, Graciela Guadalupe Tapia Pérez, Enrique Jesús Delgado Suárez, Jeny Aguilar Acevedo……………………………………………….………………………………………….……………..…………..…………..…………..…………..………………...256

NOTAS DE INVESTIGACIÓN Nivel de infestación de Rhipicephalus microplus y su asociación con factores climatológicos y la ganancia de peso en bovinos Bos taurus x Bos indicus

Rhipicephalus microplus infestation level and its association with climatological factors and weight gain in Bos taurus x Bos indicus cattle Roberto Omar Castañeda Arriola, Jesús Antonio Álvarez Mar�nez, Carmen Rojas Mar�nez, José Juan Lira Amaya, Ángel Ríos Utrera, Francisco Mar�nez Ibáñez …………………………………………….........……..…273

Características histopatológicas y detección de Papilomavirus en la fibropapilomatosis bovina en el estado de San Luis Potosí, México

Histopathology and PCR detection of bovine fibropapillomatosis in cattle in San Luis Potosí, Mexico Isaura Méndez Rodríguez, Fernando Alberto Muñoz Tenería, Milagros González Hernández, Alan Ytzeen Mar�nez Castellanos, Luisa Eugenia del Socorro Hernández Arteaga………………..…………..……..……286

Prevalencia de genes qnrB, qnrA y blaTEM en bacteriófagos atemperados de Escherichia coli aislados en agua residual y alcantarillas de rastros del Estado de México

Prevalence of the qnrB, qnrA and blaTEM genes in temperate bacteriophages of Escherichia coli isolated from wastewater and sewer water from slaughterhouses in the State of Mexico Juan Mar�n Talavera-González, Jorge Acosta-Dibarrat, Nydia Edith Reyes-Rodríguez, Celene Salgado-Miranda, Mar�n Talavera-Rojas……..…………..…………..…………...…………..……………………………………………298

Calidad sensorial de la carne de cabritos lechales criados en sistemas de producción basados en pastoreo

Sensory quality of meat from suckling kids of two indigenous Spanish goat breeds raised in grazing production systems Francisco De-la-Vega Galán, José Luis Guzmán Guerrero, Manuel Delgado Per�ñez, Luis Ángel Zarazaga Garcés, Pilar Ruiz Pérez-Cacho, Hortensia Galán-Soldevilla ……..…………..…………………………………....306

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm 1, pp. 1-317, ENERO-MARZO-2021

Genetic selection aimed to reduce methane emissions and its effect on milk components René Calderón-Chagoya, Juan Heberth Hernández-Medrano, Felipe de Jesús Ruiz-López, Adriana García-Ruiz, Vicente Eliezer Vega-Murillo, Enoc Israel Mejía-Melchor, Phil Garnsworthy, Sergio Iván Román-Ponce…........….....….………..…………..…………..…………..…………..…………..…………..…………...1

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 1, pp. 1-317, ENERO-MARZO-2021