__MAIN_TEXT__
feature-image

Page 1

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm 1, pp. 1-317, ENERO-MARZO-2021

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 1, pp. 1-317, ENERO-MARZO-2021


Aves criollas de la comunidad de Nopala de Villagrán, Hidalgo, México en producción a pequeña escala. Fotografía: M.C. Ana Rosa Romero López

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 12 Número 1, EneroMarzo 2021. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 04-2016-060913393200-203. ISSN: 2428-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en marzo de 2021.

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dr. Martin Talavera Rojas, Universidad Autónoma del Estado de México, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México

Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, UAEH, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

I


REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

total por publicar es de $ 5,600.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 325.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II


REVISTA MEXICANA DE CIENCIAS PECUARIAS

REV. MEX. CIENC. PECU.

VOL. 12 No. 1

ENERO-MARZO-2021

CONTENIDO

ARTÍCULOS Pág. Efecto de la selección genética en contra de las emisiones de metano sobre los componentes de la leche Genetic selection aimed to reduce methane emissions and its effect on milk components René Calderón-Chagoya, Juan Heberth Hernández-Medrano, Felipe de Jesús Ruiz-López, Adriana García-Ruiz, Vicente Eliezer Vega-Murillo, Enoc Israel Mejía-Melchor, Phil Garnsworthy, Sergio Iván Román-Ponce ………………………………………………………………………………………………………1 Relationships among ß-hydroxybutyrate, calcium and non-esterified fatty acids in blood with milk yield losses at early lactation Relaciones entre el ß-hidroxibutirato, el calcio y los ácidos grasos no esterificados en la sangre con pérdidas de producción de leche en la lactancia temprana Rufino López-Ordaz, Gabriela Pérez-Hernández, Hugo Alonso Ramírez-Ramírez, Reyes López-Ordaz, Germán David Mendoza-Martínez, Agustín Ruíz-Flores ………………………………………18 Caracterización genética de la oveja Pelibuey de México usando marcadores microsatélites Genetic characterization of Mexican Pelibuey sheep using microsatellite markers Cecilio Ubaldo Aguilar Martínez, Bertha Espinoza Gutiérrez, José Candelario Segura Correa, José Manuel Berruecos Villalobos, Javier Valencia Méndez, Antonio Roldán Roldán ……………………36 Diversidad genética de gallinas criollas en valles centrales de Oaxaca usando marcadores microsatélites Genetic diversity of creole chickens in Valles Centrales, Oaxaca, using microsatellite markers Héctor Luis-Chincoya, José Guadalupe Herrera-Haro, Amalio Santacruz-Varela, Martha Patricia Jerez-Salas, Alfonso Hernández-Garay ………………………………………………………………………….……….58 Milk fatty acid profile of crossbred Holstein x Zebu cows fed on cake licuri Perfil de ácidos grasos de la leche de vacas Holstein x Cebú alimentadas con pasta de licuri Antonio Ferraz Porto Junior, Fabiano Ferreira da Silva, Robério Rodrigues Silva, Dicastro Dias de Souza, Edvaldo Nascimento Costa, Evely Giovanna Leite Costa, Bismarck Moreira Santiago, Geónes da Silva Gonçalves …………………………………………………………………………………………………..72

III


Milk yield derived from the energy and protein of grazing cows receiving supplements under an agrosilvopastoral system Rendimiento de leche derivado de energía y proteína de vacas en pastoreo recibiendo suplementos en un sistema agrosilvopastoril Sherezada Esparza-Jiménez, Benito Albarrán-Portillo, Manuel González-Ronquillo, Anastacio GarcíaMartínez, José Fernando Vázquez-Armijo, Carlos Manuel Arriaga-Jordán …………………………………..87 Nutritional management of steers raised in graze and in feedlot: intake, digestibility, performance and economic viability Manejo nutricional de novillos criados en pastoreo y en corral: efectos en el consumo, digestibilidad, rendimiento y viabilidad económica Sinvaldo Oliveira de Souza, Robério Rodrigues Silva, Fabiano Ferreira da Silva, Ana Paula Gomes da Silva, Marceliana da Conceição Santos, Rodrigo Paiva Barbosa, Raul Lima Xavier, Tarcísio Ribeiro Paixão, Gabriel Dallapicola da Costa, Adriane Batista Peruna, Mariana Santos Souza, Laize Vieira Santos……………………………………………………………………………………………………………………………….105 Producción y evaluación de inóculos lácteos probióticos obtenidos del tracto digestivo de lechón (Sus scrofa domesticus) propuestos para alimentación porcina Production and evaluation of probiotic milk inocula obtained from the digestive tract of piglets ( Sus scrofa domesticus) proposed for pig feed Carmen Rojas Mogollón, Gloria Ochoa Mogollón, Rubén Alfaro Aguilera, Javier Querevalú Ortiz, Héctor Sánchez Suárez ………………………………………………………………………………………………………120 Actividad antihelmíntica in vivo de hojas de Acacia cochliacantha sobre Haemonchus contortus en cabritos Boer

In vivo anthelmintic activity of Acacia cochliacantha leaves against Haemonchus contortus in Boer goat kids

Gastón Federico Castillo-Mitre, Rolando Rojo-Rubio, Agustín Olmedo-Juárez, Pedro Mendoza de Gives, José Fernando Vázquez-Armijo, Alejandro Zamilpa, Héctor Aarón Lee-Rangel, Leonel Avendaño-Reyes, Ulises Macias-Cruz …………………………………………………………………………………..138 The effect of silkworm pupae and mealworm larvae meals as dietary protein components on performance indicators in rabbits Efecto de la harina de pupas y larvas de gusano de seda como componentes proteicos de la dieta sobre indicadores de rendimiento en conejos Dorota Kowalska, Janusz Strychalski, Andrzej Gugołek ………………………………………………………….151 Evaluación de indicadores productivos en rebaños caprinos vacunados con cepas RB51– SOD, RB51 (Brucella abortus) y Rev-1 (Brucella melitensis) Evaluation of productive indicators in goat herds vaccinated with RB51–SOD, RB51 (Brucella abortus) and Rev-1 (Brucella melitensis) strains Baldomero Molina-Sánchez, David Izcoatl Martínez-Herrera, Violeta Trinidad Pardío-Sedas, Ricardo Flores-Castro, José A. Villagómez-Cortés, José F. Morales-Álvarez ……………………………………….…163

IV


Distribución corporal de garrapatas (Acari: Ixodidae y Argasidae) asociadas a Odocoielus virginianus (Artiodactyla: Cervidae) y Ovis canadensis (Artiodactyla: Bovidae) en tres estados del norte de México Body distribution of ticks (Acari: Ixodidae and Argasidae) associated with Odocoileus virginianus (Artiodactyla: Cervidae) and Ovis canadensis (Artiodactyla: Bovidae) in three northern Mexican states Mariana Cuesy León, Zinnia Judith Molina Garza, Roberto Mercado Hernández, Lucio Galaviz Silva …………………………………………………………………………………………………………..…173 Detección de anticuerpos de Neospora spp. en caballos, asociados a diferentes factores de riesgo en México Detection of anti-Neospora spp. antibodies associated with different risk factors in horses from Mexico Kenia Jasher Padilla-Díaz, Leticia Medina-Esparza, Carlos Cruz- Vázquez, Irene Vitela-Mendoza, Juan F. Gómez-Leyva, Teódulo Quezada-Tristán………………………………………………………………..….194 Desempeño productivo y costos de granjas porcinas con diferentes protocolos de vacunación al virus del PRRS Productive performance and costs of swine farms with different PRRS virus vaccination protocols Elizabeth Araceli Quezada-Fraide, Claudia Giovanna Peñuelas-Rivas, Frida Saraí Moysén-Albarrán, María Elena Trujillo-Ortega, Francisco Ernesto Martínez-Castañeda ……………………………………..…205 Las funciones de las aves en la producción avícola de pequeña escala: el caso de una comunidad rural en Hidalgo, México Bird roles in small-scale poultry production: the case of a rural community in Hidalgo, Mexico Ana Rosa Romero-López ………………………………………………………………………………………………….…217 Disonancia cognitiva ante el cambio climático en apicultores: un caso de estudio en México Cognitive dissonance in the face of climate change in beekeepers: A case study in Mexico Felipe Gallardo-López, Blanca Patricia Castellanos-Potenciano, Gabriel Díaz-Padilla, Arturo PérezVásquez, Cesáreo Landeros- Sánchez, Ángel Sol-Sánchez …………………………………………………..…238 Evaluation of two supplemental zilpaterol hydrochloride sources on meat quality and carcass traits of crossbred Bos indicus bulls in the tropics Evaluación de dos fuentes suplementarias de clorhidrato de zilpaterol sobre la calidad de la carne y los rasgos de la canal de toros Bos indicus cruzados en los trópicos Pedro Antonio Alvarado García, Maria Salud Rubio Lozano, Héctor Salvador Sumano López, Luis Ocampo Camberos, Graciela Guadalupe Tapia Pérez, Enrique Jesús Delgado Suárez, Jeny Aguilar Acevedo…………………………………………………………………………………………………………………………….256

V


NOTAS DE INVESTIGACIÓN

Nivel de infestación de Rhipicephalus microplus y su asociación con factores climatológicos y la ganancia de peso en bovinos Bos taurus x Bos indicus

Rhipicephalus microplus infestation level and its association with climatological factors and weight gain in Bos taurus x Bos indicus cattle Roberto Omar Castañeda Arriola, Jesús Antonio Álvarez Martínez, Carmen Rojas Martínez, José Juan Lira Amaya, Ángel Ríos Utrera, Francisco Martínez Ibáñez ……………………………….…….273 Características histopatológicas y detección de Papilomavirus en la fibropapilomatosis bovina en el estado de San Luis Potosí, México Histopathology and PCR detection of bovine fibropapillomatosis in cattle in San Luis Potosí, Mexico Isaura Méndez Rodríguez, Fernando Alberto Muñoz Tenería, Milagros González Hernández, Alan Ytzeen Martínez Castellanos, Luisa Eugenia del Socorro Hernández Arteaga.……………………. 286 Prevalencia de genes qnrB, qnrA y blaTEM en bacteriófagos atemperados de Escherichia coli aislados en agua residual y alcantarillas de rastros del Estado de México Prevalence of the qnrB, qnrA and blaTEM genes in temperate bacteriophages of Escherichia coli isolated from wastewater and sewer water from slaughterhouses in the State of Mexico Juan Martín Talavera-González, Jorge Acosta-Dibarrat, Nydia Edith Reyes-Rodríguez, Celene Salgado-Miranda, Martín Talavera-Rojas ………………………………………………………………………………298 Calidad sensorial de la carne de cabritos lechales criados en sistemas de producción basados en pastoreo Sensory quality of meat from suckling kids of two indigenous Spanish goat breeds raised in grazing production systems Francisco De-la-Vega Galán, José Luis Guzmán Guerrero, Manuel Delgado Pertíñez, Luis Ángel Zarazaga Garcés, Pilar Ruiz Pérez-Cacho, Hortensia Galán-Soldevilla ………………………………………306

VI


Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

6.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes). Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo. El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

4.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

5.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

7.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8.

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

VII


Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

referencias, aunque pueden insertarse en el texto (entre paréntesis).

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés.

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus.

12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

VIII


I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

XI)

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

IX


XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

xg

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50 g

vs

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s)

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

X


Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

4.

5.

6.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts). All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt. Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias”. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

7.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

8.

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

9.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts:

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

b) Technical Notes. They should be brief and be

evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which

XI


should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of t he research article but without section titles.

names(s), the number of the edition, the country, the printing house and the year. e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to

summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume

Key rules for references

II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one.

III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given

b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article).

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets). d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

XII


Organization, as author

Organization as author XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

In press VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Books and other monographs

Author(s)

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Chapter in a book IX)

Electronic publications

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003.

Conference paper X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003. XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

13. Final version. This is the document in which the authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII


14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m µl µm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v. J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

vs

versus

xg

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIV


https://doi.org/10.22319/rmcp.v12i1.5347 Artículo

Efecto de la selección genética en contra de las emisiones de metano sobre los componentes de la leche

Rene Calderón-Chagoya a,c,f Juan Heberth Hernández-Medrano a,b,f Felipe de Jesús Ruiz-López c,f Adriana García-Ruiz c,f Vicente Eliezer Vega-Murillo d,f Enoc Israel Mejía-Melchor a,f Phil Garnsworthy b Sergio Iván Román-Ponce e,f*

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Av. Universidad 300, 04510, Ciudad de México. México. b

The University of Nottingham. School of Biosciences, Sutton Bonington Campus. Loughborough LE 12 5RD, UK. c

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal. Querétaro, México. d

INIFAP. Centro de Investigación Regional Golfo-Centro. Campo Experimental La Posta. Veracruz, México. e

INIFAP. Centro de Investigación Regional Norte-Centro. CE La Campana. Chihuahua, México. f

Red de Investigación e Innovación Tecnológica para la Ganadería Bovina Tropical (REDGATRO).

1


Rev Mex Cienc Pecu 2021;12(1):1-17 *

Autor de correspondencia: roman.sergio@inifap.gob.mx

Resumen: El objetivo de este trabajo fue estimar la respuesta a la selección a través de diferentes índices de selección entre producción de metano y producción y componentes de la leche en los sistemas de lechería tropical especializada, doble propósito y lechería familiar. El muestreo de las emisiones de metano se realizó durante la ordeña mediante el equipo Guardian-NG. Se tomaron muestras de leche de manera individual durante el muestreo de metano. La extracción de ADN se realizó de folículos pilosos de todos los animales incluidos en el estudio. La estimación de los componentes de varianza y covarianza se realizó mediante la metodología de modelos mixtos. Se utilizaron los marcadores moleculares para construir la matriz de relaciones genómicas (Matriz G), debido a que no se contaba con información genealógica completa. La heredabilidad estimada para las emisiones de metano durante la ordeña fue de 0.18 y 0.32 para los análisis univariados y bivariados, respectivamente. Los resultados de las correlaciones genéticas entre porcentaje de grasa y proteína en leche con las emisiones de metano durante la ordeña fueron negativas, -0.09 y -0.18 respectivamente. La respuesta a la selección estimada mediante los índices de selección demostró que es factible obtener reducciones de hasta 0.021 mg/l de emisiones de metano durante la ordeña en cinco generaciones; lo anterior sin detrimento en los componentes de la leche. Palabras clave: Metano, Leche, Heredabilidad, Correlación genética.

Recibido: 21/04/2019 Aceptado: 26/08/2020

Introducción En los últimos años el Grupo Intergubernamental de Expertos sobre el Cambio Climático (IPCC)(1), La Organización de las Naciones Unidas para la Alimentación y Agricultura (FAO)(2), han señalado que el sector agropecuario es la principal fuente de gases de efecto invernadero (GEI) de vida corta, metano (CH4) y óxido nitroso (N2O). Algunas estrategias para la mitigación de metano proveniente del ganado lechero incluyen la reducción del hato bovino, el cambio de alimentación, el uso de suplementos, la

2


Rev Mex Cienc Pecu 2021;12(1):1-17

inmunización contra las arqueas metanogénicas y la selección de animales con menor producción de CH4(3). Para crear estrategias de selección de animales con menor producción de metano es necesario el conocimiento de las correlaciones genéticas entre la producción de CH4 y otras características de importancia productiva y económica(4). El índice de selección es una metodología para maximizar la mejora genética en un objetivo específico(5). Los índices de selección se han aplicado extensivamente en la estimación del valor de reproducción del ganado lechero para rasgos individuales, así como para combinaciones de rasgos para propósitos de selección(6). En bovinos y ovinos, se han demostrado la existencia variación de las emisiones de CH4 entre los individuos alimentados con la misma dieta(7). De Haas et al(8) mencionan que existe la posibilidad de seleccionar vacas con baja emisión de CH4, ya que la variación genética sugiere que las reducciones serian de 11 a 26 % en 10 años, y podrían ser aún mayores en un programa de selección genómica. Sin embargo, en la actualidad, la información disponible sobre las oportunidades para mitigar el CH4 entérico a través del mejoramiento genético es escasa, pero se podría pensar que la selección genética en contra de las emisiones de metano podría tener repercusiones en características productivas de interés económico. El objetivo de este trabajo fue estimar la respuesta a la selección a través de diferentes índices de selección entre producción de metano y la producción de leche y sus componentes en tres sistemas de producción de leche en México.

Material y métodos El presente estudio se realizó en tres unidades de producción (UP) del sistema de doble propósito (DP), dos de lechería tropical especializada (LTE) y cuatro de sistema familiar (SF) (Cuadro 1). Se midió los componentes de la leche y emisiones de metano a un total de 274 vacas (98, 74 y 102 en los sistemas de DP, LTE y SF respectivamente).

3


Rev Mex Cienc Pecu 2021;12(1):1-17

Cuadro 1: Sistemas de producción muestreados Rancho

Sistema

n

Localización

Razas

La Posta El Zapato La Doña Santa Elena Aguacatal Rancho 5 Rancho 6 Rancho 7 Rancho 8

DP DP DP LTE LTE SF SF SF SF

33 16 49 37 37 16 32 24 30

Veracruz Veracruz Puebla Puebla Puebla Jalisco Jalisco Jalisco Jalisco

HOC y SPC HOC HOC, SPC y SMC HO, SP y HOSP HO, SP y HOSP HO HO HO HO

DP= doble propósito; LTE= lechería tropical especializada; SF= familiar. HOC= Holstein x Cebú, SPC= Suizo Pardo x Cebú, SMC= Simmental x Cebú, HO= Holstein, SP= Suizo Pardo, HOSP= Holstein x Suizo Pardo.

Dos de las tres UP de DP se encuentran ubicadas en el municipio Medellín de Bravo, Veracruz, con un clima tropical subhúmedo cálido Aw(o) y una altitud de 12 msnm(9). La temperatura media anual es de 25 °C, así como la precipitación pluvial media anual es de 1,460 mm(9). La tercera UP de DP, al igual que las UP de LTE, se encuentra en el municipio de Hueytamalco, Puebla; con una altitud de 240 msnm. El clima es subtropical húmedo Af(c) con temperatura media anual de 23 ºC y precipitación pluvial media que varía de 2,200 a 2,500 mm(9). Las cuatro UP del SF se encuentran en el municipio de Tepatitlán, Jalisco con un clima templado subhúmedo cálido (A)C(w1) (e)g a una altitud de 1,927 msnm., con temperatura media anual de 18 ºC y precipitación pluvial media anual de 715 mm(9). En el sistema de DP se utilizan principalmente ganado cruzado Bos taurus taurus y Bos taurus indicus. En el caso de las razas Bos taurus indicus las más utilizadas son Brahman, Gyr y Sardo Negro; mientras que para las razas Bos taurus taurus se encuentran principalmente Holstein, Suizo Pardo y Simmental(10). Una de las variantes de los sistemas tropicales de producción de leche bovina es la LTE. Este sistema se caracteriza por la utilización de razas puras tales como Holstein y Suizo Pardo. El manejo general de la LTE es muy similar al manejo del sistema de DP; salvo en la crianza de becerros, que se realiza de manera artificial, y en la ordeña que se realiza sin el apoyo del becerro(10). Los SF se caracterizan por pequeñas unidades de producción que fluctúan entre 3 y 30 vacas. Las unidades de producción están condicionadas a pequeñas superficies de terreno, aledañas

4


Rev Mex Cienc Pecu 2021;12(1):1-17

a las viviendas, por lo que se le llama también de "traspatio". Pueden ser de tipo estabulado o semiestabulado, de acuerdo con las condiciones del campo de cultivo. Los animales son en su mayoría de la raza Holstein. El nivel tecnológico se puede considerar escaso; ya que los productores no realizan prácticas adecuadas de alimentación, manejo reproductivo, medicina preventiva o mejoramiento genético. En este sistema se carece de registros de producción y las instalaciones son rudimentarias, principalmente se realiza el ordeño manual. La alimentación es basada en el pastoreo o en el suministro de forrajes y esquilmos provenientes de los cultivos del productor(11).

Muestreo de metano

Para el muestreo de CH4 se utilizó la metodología desarrollada por Garnsworthy et al(12), mediante un análisis continuo de concentraciones de gas, a través de un sistema de doble longitud de onda no disperso, el cual recupera la información segundo a segundo de la concentración de gases en el ambiente, esto por medio de los Guardian NG- Infrared Gas Monitor (Edinburgh Instruments, Escocia, Reino Unido). Los equipos se instalaron en los comederos donde se les ofrecía alimento a las vacas durante la ordeña. Se realizaron adaptaciones a los diferentes tipos de comederos, de tal manera que se creara una atmosfera cerrada, para evitar que las corrientes de aire sesgaran las concentraciones de CH4. Lo anterior con el objetivo de generar el menor disturbio en la rutina de ordeño. Lo que permitiría tomar una muestra de la atmósfera del comedero mientras el animal se alimenta normalmente. Se realizó un periodo de adaptación de una semana a la presencia de los nuevos comederos. El periodo de medición consistió en dos semanas de muestreo de CH4 durante la ordeña; con el objetivo de contar con un mínimo de 10 días efectivos de medición en cada UP.

Muestreo de leche

Se obtuvo una muestra de leche de manera individual durante el ordeño; cada muestra consistió en un mínimo de 50 ml de leche obtenida directamente de los pesadores al inicio de las mediciones. Las muestras se conservaron con bronopol y se identificaron mediante el número de la UP y el número de identificación del animal. El análisis de la leche se realizó en el laboratorio de calidad de leche de la Asociación Holstein de México A.C. mediante la técnica de infrarrojo medio para medir el porcentaje de grasa y porcentaje de proteína.

5


Rev Mex Cienc Pecu 2021;12(1):1-17

Muestreo y extracción de ADN

Se obtuvieron muestras de pelos con folículos pilosos directamente de la cola de todos los animales involucrados en el experimento. Las muestras de pelo fueron identificadas y enviadas al laboratorio GENESEEK (Lincoln, Nebraska). En este laboratorio se extrajo el ADN y se obtuvieron los genotipos mediante microarreglos de alta densidad. Para los animales provenientes del SF, se utilizó el arreglo GGP BOVINE LD V4, mismo que permite obtener 30,125 SNP. En el caso de los animales cruzados del LTE y DP se optó por el arreglo de GGDP BOVINE 150K que hace posible la identificación de 138,962 SNP por animal; lo anterior obedeció a que los animales cruzados requieren un mayor número de marcadores para que la información sea útil. En este estudio solo se incluyeron los SNP ubicados en los 29 cromosomas autosómicos. El control de calidad de los genotipos se realizó a través del software PLINK 1.7(13), y consistió en: 1) remover los individuos con menos del 90 % de la información genotípica, 2) remover los animales con un valor menor a 5 % en la frecuencia del alelo menor, y 3) remover los animales con una proporción menor de 90 % de marcadores útiles. Al final del control de calidad y manteniendo los marcadores en común en ambas plataformas el número de marcadores disponibles fue de 20,776 SNP para cada animal.

Análisis estadístico

Estimación de relaciones genéticas genómicas

La estimación de componentes de varianza se realizó mediante la metodología de modelos mixtos. Debido a que no se contó con información genealógica completa para la construcción de la matriz de relaciones aditivas (Matriz A), se utilizaron los marcadores moleculares para construir la matriz de relaciones genómicas entre todos los animales (G). La matriz G se basó en el método propuesto por VanRaden(14), que consiste en construir la matriz M a través de las dimensiones número de individuos (n) por el número de marcadores (m). Los elementos de la matriz se codificaron como -1 (homocigótico para un alelo), 0 (heterocigotos) y 1 para (homocigótico para el otro alelo). A la matriz M se le substrae la matriz P(nxm) que contiene columnas con todos los elementos 2(pi-0.5), donde pi es la frecuencia del segundo alelo en el locus i y se genera la matriz Z (Z = M – P). Finalmente, la matriz G se calculó como: 𝑍𝑍´ 𝐺= 2∑𝑝𝑖 (1 − 𝑝𝑖 )

6


Rev Mex Cienc Pecu 2021;12(1):1-17

Estimación de componentes de varianza

La estimación de componentes de varianza para las emisiones de CH4 durante el ordeño y los componentes de la leche (porcentaje de grasa y proteína), se implementaron mediante el programa ASReml-R(15). La selección del modelo se realizó con los efectos de producción diaria de leche durante las mediciones, días en lactancia, periodo de lactancia, número de lactancia, sistema de producción, número de hato y raza dentro del sistema, para las variables respuesta producción de metano durante la ordeña, porcentaje de grasa, porcentaje de proteína. Se probaron todas las combinaciones lógicas dentro de los efectos fijos y aleatorios que lograran converger con las variables respuesta, de donde se obtuvo el presente modelo. El modelo univariado se representa de la siguiente manera: 𝑦 = 𝜇 + 𝑋𝑏 + 𝑍1 𝑎 + 𝑊1 𝑛 + 𝑒 Donde, 𝒚 es el vector de las variables respuesta (producción de CH4 durante la ordeña, porcentaje de grasa o proteína); 𝝁 es la media general a la variable respuesta; 𝑿 es la matriz de incidencia para los efectos fijos de producción diaria de leche durante las mediciones y número de lactación; 𝒃 es el vector de soluciones para los efectos fijos de producción diaria de leche durante las mediciones y número de lactación; 𝑍 es la matriz de incidencia de los efectos aleatorios del animal; 𝒂 es el vector de soluciones de los efectos aleatorios del animal ~ 𝑁 (0, 𝐺𝜎 2 𝑎 ); 𝑾 es la matriz de incidencia para el efecto aleatorio del sistema de producción; 𝒏 es el vector de soluciones para el efecto aleatorio del sistema de producción; 𝒆 es el vector de los efectos aleatorios de los residuales ~ 𝑁 (0, 𝐼𝜎 2 𝑒 ).

Estimación de componentes de covarianza

La estimación de componentes de covarianza entre las emisiones de CH4 durante el ordeño y los componentes de la leche, se calcularon mediante el programa ASReml-R(15). Se utilizaron las varianzas estimadas mediante los modelos univariados como valores iniciales para la estimación de las covarianzas.

7


Rev Mex Cienc Pecu 2021;12(1):1-17

El modelo bivariado se representa en términos matriciales de la siguiente manera: 𝑦1 𝑒1 𝑋 0 𝑏 𝑍 0 𝑎1 𝑊 0 𝑛1 |𝑦 | = | 1 | | 1 | + | 1 | |𝑎 | + | 1 | |𝑛 | + |𝑒 | 2 0 𝑋2 𝑏2 0 𝑍2 2 0 𝑊2 2 2 Donde, 𝑦1 y 𝑦2 son los vectores de las variables respuesta (producción de CH4 durante la ordeña, porcentaje de grasa o proteína); 𝑋1 y 𝑋2 son las matrices de incidencia para los efectos fijos de producción diaria de leche durante las mediciones y número de lactación; 𝑏1 y 𝑏2 son los vectores de soluciones para los efectos fijos de producción diaria de leche durante las mediciones y número de lactación; 𝑍1 y 𝑍2 son las matrices de incidencia de los efectos aleatorios del animal; 𝑎 y 𝑎2 son los vectores de soluciones de los efectos aleatorios del animal ~ 𝑁 (0, 𝐺𝜎 2 𝑎 ); 𝑊1 y 𝑊2 son las matrices de incidencia para el efecto aleatorio del sistema de producción; 𝑛1 y 𝑛2 son los vectores de soluciones para el efecto aleatorio del sistema de producción; 𝑒1 y 𝑒2 son los vectores de los efectos aleatorios de los residuales ~ 𝑁 (0, 𝐼𝜎 2 𝑒 ).

Estimación de parámetros genéticos Las h2 fueron obtenidas a partir de los componentes de varianza estimados con los modelos univariados. Las correlaciones genéticas (𝑟𝑥𝑦 ) fueron estimadas a partir de los modelos bivariados. La h2 fue estimada dividiendo la varianza aditiva (𝜎 2 𝑎 ) entre la varianza fenotípica (𝜎 2𝑓 ), como la siguiente ecuación(16): 𝜎2𝑎 2 ℎ = 2 𝜎 𝑓 Las 𝑟𝑥𝑦 fueron estimadas al dividir la covarianza genética (𝜎𝑥𝑦 ) de las variables x y y entre la raíz del producto de la varianza genética de la variable x y y, como la siguiente ecuación(16): 𝜎𝑥𝑦 𝑟𝑥𝑦 = √𝜎 2 𝑥 𝜎 2 𝑦

Índice de selección La estimación de la respuesta a la selección se llevó a cabo mediante diferentes índices de selección entre producción de metano y la producción de leche y sus componentes. Se realizó un análisis de sensibilidad, en el cual se identificaron diferentes escenarios en los que se podía seleccionar emisiones de CH4, porcentaje de grasa y porcentaje de proteína, y de esta manera observar la dinámica entre la exactitud de los índices y su ganancia genética (Cuadro 2). Los índices de selección se realizaron a cinco generaciones. A las características que se incluyeron en los índices se les asigno un valor dependiendo la importancia e intensidad de selección, la suma de los valores en cantidades absolutas debe ser igual a 100. A las emisiones de CH4 se le dieron valores que iban desde el 0 al -100 y al porcentaje de grasa y porcentaje de proteína valores que iban del 0 al 100. 8


Rev Mex Cienc Pecu 2021;12(1):1-17

Cuadro 2: Índices de selección e intensidad de selección de cada característica del modelo Índice CH4 Grasa Proteína Índice CH4 Grasa Proteína INDEX1 INDEX2 INDEX3 INDEX4 INDEX5 INDEX6 INDEX7 INDEX8 INDEX9 INDEX10 INDEX11 INDEX12 INDEX13 INDEX14 INDEX15 INDEX16 INDEX17 INDEX18 INDEX19 INDEX20 INDEX21 INDEX22 INDEX23 INDEX24 INDEX25 INDEX26 INDEX27 INDEX28 INDEX29 INDEX30 INDEX31 INDEX32 INDEX33

-100 -90 -90 -80 -80 -80 -70 -70 -60 -70 -70 -60 -50 -60 -50 -40 -60 -60 -50 -30 -40 -50 -20 -40 -10 -30 -50 0 -50 -20 -40 -30 -10

0 0 10 0 10 20 0 10 0 20 30 10 0 20 10 0 30 40 20 0 10 30 0 20 0 10 40 0 50 10 30 20 10

0 10 0 20 10 0 30 20 40 10 0 30 50 20 40 60 10 0 30 70 50 20 80 40 90 60 10 100 0 70 30 50 80

INDEX34 INDEX35 INDEX36 INDEX37 INDEX38 INDEX39 INDEX40 INDEX41 INDEX42 INDEX43 INDEX44 INDEX45 INDEX46 INDEX47 INDEX48 INDEX49 INDEX50 INDEX51 INDEX52 INDEX53 INDEX54 INDEX55 INDEX56 INDEX57 INDEX58 INDEX59 INDEX60 INDEX61 INDEX62 INDEX63 INDEX64 INDEX65 INDEX66

9

0 -40 -20 -30 -40 -10 0 -40 -30 -20 -10 -30 -20 0 -30 -10 -30 -20 -20 -10 -20 0 0 -20 -10 0 -10 -10 0 -10 0 0 0

10 40 20 30 50 20 20 60 40 30 30 50 40 30 60 40 70 50 60 50 70 50 40 80 60 60 70 80 70 90 80 90 100

90 20 60 40 10 70 80 0 30 50 60 20 40 70 10 50 0 30 20 40 10 50 60 0 30 40 20 10 30 0 20 10 0


Rev Mex Cienc Pecu 2021;12(1):1-17

Los componentes de varianza y covarianza utilizados fueron los obtenidos mediante los modelos previamente descritos para los componentes de la leche (porcentaje de grasa y porcentaje de proteína) y producción de CH4 durante la ordeña. La especificación original del índice de selección prevé el uso de una variable correlacionada (I) basada en el rendimiento fenotípico de cada animal para varias características(5). Por lo tanto, se define como: I=bp Donde p es un vector de valores fenotípicos para el conjunto de criterios de selección y b son los factores de ponderación utilizados en la toma de decisiones de selección. Con el fin de maximizar la correlación de I con la contribución de cualquier candidato para la selección como posible padre, la información se combina como: Ga = Pb Donde G es una matriz nxm de variancias genéticas y covarianzas entre todos los rasgos m, a es un vector mx1 de valores relativos a la intensidad de selección para todos los rasgos. P es una matriz nxn de variancias fenotípicas y covarianzas entre los n rasgos medidos y disponibles como criterios de selección y b es un vector nx1 de factores de ponderación que se aplicará a los rasgos utilizados en la toma de decisiones de selección. La ecuación precedente se resuelve entonces como: P-1 Ga = b Para obtener los factores de ponderación contenidos en b y los candidatos para la selección se clasifican en base al índice (I). La precisión del índice (𝑟𝐻𝐼 ) puede describirse como la correlación entre el índice en el que se basa la selección y el valor genético, esta se calcula de la siguiente manera: 𝑏 𝑃𝑏

𝑟𝐻𝐼 = 𝑎 𝑄𝑎 Donde, b es un vector de factores de ponderación que se aplicará a las características utilizadas en la toma de decisiones de selección; P es una matriz de variancias fenotípicas y covarianzas entre las características medidas y disponibles como criterios de selección; a es un vector de valores relativos para todas las características; Q es una matriz de varianzas genéticas y covarianzas entre todas las características consideradas parte del sistema. Se estimó la ganancia genética (∆𝑔) para cada característica, la cual nos indica el aumento en el rendimiento que se logra a través de programas de mejoramiento genético, de la siguiente manera:

10


Rev Mex Cienc Pecu 2021;12(1):1-17

𝐸 (∆𝑔) =

𝑖G´b 𝜎𝐼

Donde, i= es la intensidad de la selección; G= es la matriz de la varianza-covarianza genética de las características; b= es un vector de factores de ponderación que se aplicará a las características utilizadas en la toma de decisiones de selección.; 𝜎𝐼 = es la desviación estándar del índice. La desviación estándar del índice se calculó de la siguiente manera: 𝜎𝐼 = √b′Pb Donde, b= es un vector de factores de ponderación que se aplicará a las características utilizadas en la toma de decisiones de selección; P= es una matriz de variancias fenotípicas y covarianzas entre las características medidas y disponibles como criterios de selección.

Resultados Las emisiones de CH4 en el sistema de LTE fueron de 0.08 mg de CH4/ L, y en SF y DP en ambos casos fue de 0.06 mg de CH4/ L (Cuadro 3). El promedio general para los tres sistemas fue de 0.065 mg de CH4/ L. En el caso de los componentes de la leche, el promedio del porcentaje de grasa en los tres sistemas fue de 4.82 %, y para cada uno de los sistemas fue 3.69 % (LTE), 3.72 % (SF) y 6.84 % (DP). En el caso del porcentaje de proteína en el sistema de LTE, SF y DP fue de 3.20 %, 3.29 % y 3.21 %, respectivamente. Siendo 3.23 % el promedio combinado para los tres sistemas. Cuadro 3: Estadísticas descriptivas de la producción de metano y los componentes de la leche en tres sistemas de producción en México Metano (mg/L) % de grasa % de proteína Sistema Media DE Media DE Media DE DP (n=98) 0.06 0.039 6.84 4.938 3.21 0.405 SF (n=102) 0.06 0.014 3.72 0.632 3.29 0.315 LTE (n=74) 0.08 0.016 3.69 0.492 3.20 0.417 Promedio 0.065 0.028 4.828 3.344 3.234 0.380 DP= sistema de doble propósito, SF= lechería Familiar, LTE= lechería tropical especializada, n= número de observaciones, DE= desviación estándar.

La h2 estimada para emisiones de CH4 durante la ordeña con el modelo univariado fue de 0.19, de la misma manera porcentaje de grasa presento una h2 de 0.39 y porcentaje de proteína de 0.18. En contraste, las h2 estimadas mediante los modelos bivariados para las emisiones de CH4 durante la ordeña fue de 0.32±0.245 y el porcentaje de grasa fue de 0.46±0.278, 11


Rev Mex Cienc Pecu 2021;12(1):1-17

respectivamente. En cambio, la h2 para porcentaje de proteína no mostro cambios con respecto al modelo univariado, sin embargo, la h2 de CH4 es similar a la encontrada en el análisis bivariado con porcentaje de grasa (0.35). Las correlaciones genéticas entre el porcentaje de grasa y proteína con las emisiones de CH4 durante la ordeña fueron de -0.090 ± 0.080 y -0.18 ± 0.575, respectivamente. La exactitud de los índices de selección (𝑟𝐻𝐼 ) y la ganancia genética (∆𝑔) se presentan en el Cuadro 4 y Figura 1. Se puede observar que en todos los índices de selección al disminuir las emisiones de CH4 durante la ordeña no afecta negativamente a los componentes de la leche. Por otro lado, la 𝑟𝐻𝐼 de los índices más exactos son aquellos donde se selecciona para las emisiones de CH4 durante la ordeña. Cuadro 4. Índices de selección y ganancia genética para CH4 y los componentes de la leche CH4 Grasa Proteína CH4 Grasa Proteína Índice rHI Índice rHI (mg/L) (%) (%) (mg/L) (%) (%) INDEX1 19.58 -0.021 0.030 0.073 INDEX34 10.72 -0.013 0.015 0.117 INDEX2 18.38 -0.021 0.029 0.078 INDEX35 10.63 -0.021 0.030 0.086 INDEX3 17.92 -0.021 0.030 0.073 INDEX36 10.41 -0.018 0.023 0.110 INDEX4 17.23 -0.021 0.029 0.082 INDEX37 10.32 -0.020 0.027 0.100 INDEX5 16.72 -0.021 0.030 0.078 INDEX38 10.12 -0.021 0.031 0.078 INDEX6 16.26 -0.021 0.030 0.072 INDEX39 9.95 -0.016 0.020 0.115 INDEX7 16.14 -0.021 0.028 0.088 INDEX40 9.70 -0.014 0.016 0.117 INDEX8 15.57 -0.021 0.029 0.083 INDEX41 9.70 -0.021 0.032 0.069 INDEX9 15.13 -0.020 0.027 0.093 INDEX42 9.62 -0.020 0.029 0.094 INDEX10 15.06 -0.021 0.030 0.078 INDEX43 9.56 -0.018 0.025 0.107 INDEX11 14.61 -0.021 0.031 0.072 INDEX44 9.01 -0.017 0.022 0.113 INDEX12 14.49 -0.020 0.028 0.089 INDEX45 9.01 -0.020 0.030 0.087 INDEX13 14.21 -0.020 0.026 0.099 INDEX46 8.77 -0.019 0.027 0.103 INDEX14 13.92 -0.021 0.029 0.084 INDEX47 8.70 -0.014 0.018 0.117 INDEX15 13.50 -0.020 0.027 0.095 INDEX48 8.49 -0.021 0.032 0.078 INDEX16 13.41 -0.019 0.025 0.104 INDEX49 8.12 -0.017 0.024 0.111 INDEX17 13.40 -0.021 0.030 0.078 INDEX50 8.09 -0.020 0.033 0.067 INDEX18 12.96 -0.021 0.031 0.071 INDEX51 8.05 -0.020 0.029 0.097 INDEX19 12.86 -0.020 0.028 0.090 INDEX52 7.41 -0.020 0.031 0.089 INDEX20 12.74 -0.018 0.023 0.110 INDEX53 7.28 -0.018 0.026 0.107 INDEX21 12.63 -0.019 0.026 0.101 INDEX54 6.90 -0.020 0.033 0.078 INDEX22 12.27 -0.021 0.030 0.085 INDEX55 6.78 -0.016 0.022 0.114 INDEX23 12.23 -0.017 0.020 0.114 INDEX56 6.78 -0.015 0.020 0.116 INDEX24 11.90 -0.020 0.027 0.097 INDEX57 6.52 -0.020 0.034 0.064 INDEX25 11.89 -0.015 0.017 0.117 INDEX58 6.52 -0.019 0.029 0.100

12


Rev Mex Cienc Pecu 2021;12(1):1-17

INDEX26 INDEX27 INDEX28 INDEX29 INDEX30 INDEX31 INDEX32 INDEX33

11.89 11.76 11.75 11.32 11.30 11.23 11.08 10.91

-0.018 -0.021 -0.013 -0.021 -0.017 -0.020 -0.019 -0.015

0.024 0.031 0.014 0.032 0.021 0.029 0.025 0.018

0.107 0.078 0.118 0.070 0.112 0.092 0.104 0.116

INDEX59 INDEX60 INDEX61 INDEX62 INDEX63 INDEX64 INDEX65 INDEX66

5.89 5.86 5.35 5.08 5.02 4.40 3.90 3.67

-0.017 -0.020 -0.020 -0.017 -0.019 -0.018 -0.018 -0.017

0.025 0.032 0.034 0.028 0.036 0.032 0.035 0.037

0.110 0.091 0.077 0.104 0.057 0.092 0.073 0.044

Figura 1: Precisión de los índices de selección y ganancia genética para CH4 y los componentes de la leche

En los índices con mayor 𝑟𝐻𝐼 , índices del 1 al 10, éste varía de 15.06 a 19.58 en cinco generaciones. Lo que significaría reducciones de entre 0.021 a 0.020 mg/L de emisiones de CH4 durante la ordeña, e incrementos que van de 0.027 a 0.030 para porcentaje de grasa y de 0.072 a 0.093 para el porcentaje de proteína, lo que significaría a su vez que está disminuyendo la producción de leche a cambio de disminuir las emisiones de CH4. Para el resto de los índices los valores el comportamiento en emisiones de CH4 durante la ordeña, el porcentaje de grasa y el porcentaje de proteína no cambian mucho, sin embargo la 𝑟𝐻𝐼 es menor.

13


Rev Mex Cienc Pecu 2021;12(1):1-17

Discusión Las emisiones de CH4 durante la ordeña estimadas en el presente estudio son menores a los publicados por Bell et al(17)., posiblemente debido a la hetereogeneidad de las dietas en el presente estudio. Las explotaciones medidas en este trabajo tiene los animales en pastoreo y en los sistemas especializados tienen dietas a base de concentrados. Las h2 aquí estimadas para la producción de CH4 durante la ordeña son similares a los publicados por otros autores, los cuales midieron en cámaras metabólicas(18,19) o incluso con las obtenidas mediante ecuaciones de predicción(8). Estos resultados concuerdan con los estimadores obtenidos mediante metodologías similares para la medición de CH4 publicado por otros autores(20). Lo anterior, sugiere que la medición de CH4 durante la ordeña es una característica que puede ser utilizada en programas de mejoramiento genético, debido a que puede ser incorporada fácilmente a programas de control de producción, y su medición utiliza equipos poco sofisticados en comparación con las cámaras respiratorias; además de que puede ser movilizado a lugares de difícil acceso. Las h2 estimadas para el porcentaje de grasa en este trabajo son mayores a la observada en otros estudios(21-22). La h2 estimada para el porcentaje de proteína es menor a la publicada por Othmane et al(23) con una h2 de 0.23, lo cual puede ser reflejo de la heterogeneidad propia de las unidades de producción de leche en función de la alimentación y la composición racial de los hatos. Las correlaciones genéticas obtenidas entre emisiones de CH4 y los componentes de la leche sugieren un antagonismo genético; sin embargo, los estimadores de este trabajo no fueron diferentes de cero. En comparación a los presentados por Pszczola et al(4) cuyo valor para la correlación entre CH4 y gramos de grasa en leche fue de mayor magnitud (0.21), y Lassen et al(24) para los resultados de correlación de CH4 y gramos de proteína en leche fue de la misma magnitud (0.39); en ambos casos el signo contrario; cabe mencionar que esta diferencia se debe a las unidades de medida, ya que la producción de leche y los porcentajes de los componentes de la leche tienen una correlación negativa, mientras que la producción de leche con el contenido de los componentes de la leche tiene una correlación positiva(25). En la actualidad, se ha propuesto la factibilidad de reducir las emisiones de CH4 a través de la selección genética, misma que puede disminuir en 10 años las emisiones de CH4 entre un 11 y 26 % en el ganado lechero(8) y un 5 % para el ganado de carne(26). Los índices de selección elaborados por Kandel et al(27) incluyen producción de grasa y proteína, los cuales obtuvieron correlaciones positivas con la producción de CH4, si se toma en cuenta las unidades de medida, el resultado es similar al obtenido en este trabajo, ya que como se mencionó la producción de leche y los porcentajes de los componentes de la leche tienen una correlación negativa, mientras que la producción de leche con el contenido de los componentes de la leche tiene una correlación positiva(27).

14


Rev Mex Cienc Pecu 2021;12(1):1-17

Conclusiones e implicaciones Las correlaciones genéticas aquí estimadas entre las emisiones de CH4 con los componentes de la leche (porcentaje de grasa y porcentaje de proteína) sugieren la factibilidad de proponer un programa de mejoramiento genético para disminuir las emisiones de CH4, y simultáneamente aumentar los porcentajes de los componentes de la leche. En otras palabras, los resultados aquí presentados hacen posible el seleccionar genéticamente para disminuir las emisiones de CH4 y sin afectar de manera negativa la composición de la leche. Lo anterior se confirma mediante las ganancias genéticas predichas por generación a partir de los índices de selección. Lo anterior, con reducciones de entre 0.013 a 0.021 mg/L de emisiones de CH4 durante la ordeña en cinco generaciones, sin decremento de los porcentajes de grasa y proteína en la leche. Agradecimientos Los autores agradecen al Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias y al Consejo Nacional de Ciencia y Tecnología. Conflictos de interés Los autores declaran no tener conflicto de intereses. Literatura citada: 1.

IPCC. Climate Change 2007: Impacts, adaptation and vulnerability. 1a ed. Cambridge University Press, 2007. doi:10.2134/jeq2008.0015br.

2.

FAO. Greenhouse gas Emissions from the Dairy Sector. Roma, Italy, 2010. doi:10.1016/S0301-4215(01)00105-7.

3.

Wall E, Simm G, Moran D. Developing breeding schemes to assist mitigation of greenhouse gas emissions. Animal 2010;4(03):366– 376.doi:10.1017/S175173110999070X.

4.

Pszczola M, Calus MPL, Strabel T. Short communication: Genetic correlations between methane and milk production, conformation, and functional traits. J Dairy Sci 2019;102:1–5. doi:10.3168/jds.2018-16066.

5.

MacNeil MD, Nugent RA, Snelling WM. Breeding for profit: an introduction to selection index concepts. Range Beef Cow Symposium. 1997.

6.

Philipson J, Banos G, Arnason T. Present and future uses of selection index methodology in dairy cattle. J Dairy Sci 1994;77:3252–3261. doi:10.3168/jds.s002215


Rev Mex Cienc Pecu 2021;12(1):1-17

0302(94)77266-0. 7.

Grainger C, Clarke T, McGinn SM, Auldist MJ, Beauchemin KA, Hannah MC, et al Methane emissions from dairy cows measured using the sulfur hexafluoride (SF6) tracer and chamber techniques. J Dairy Sci 2007;90:2755–2766. doi:10.3168/jds.2006-697.

8.

De Haas Y, Windig JJ, Calus MPL, Dijkstra J, Haan M De, Bannink A, Veerkamp RF. Genetic parameters for predicted methane production and potential for reducing enteric emissions through genomic selection. J Dairy Sci 2011;94:6122– 6134.doi:10.3168/jds.2011-4439.

9.

García E. Modificaciones al sistema de clasificación Köppen. Quinta ed. México; Instituto de Geografía-UNAM; 2014.

10. Román PH, Ortega RL, Ruiz LFJ, Medina CM, Vera AHR, Núñez HG, et al. Producción de leche de bovino en el sistema de doble propósito. Libro técnico. INIFAP-CIRGOC. Veracruz, Ver. 2009. 11. Vera A, Hernández A, Espinoza G, Díaz A, Román P, Núñez H, Al E. Producción de leche de bovino en el sistema familiar. Libro técnico. INIFAP-CIRGOC. Veracruz, Ver. 2009. 12. Garnsworthy PC, Craigon J, Hernandez-Medrano JH, Saunders N. Variation among individual dairy cows in methane measurements made on farm during milking. J Dairy Sci 2012;95:3181–3189.doi:10.3168/jds.2011-4606. 13. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira M, Bender D, et al. PLINK (1.07). PLINK: a toolset for whole-genome association and population-based linkage analysis. Am J Human Genet 2007;81:1– 293.doi:http://pngu.mgh.harvard.edu/purcell/plink/. 14. VanRaden PM. Efficient methods to compute genomic predictions. J Dairy Sci 2008;91:4414–23. doi:10.3168/jds.2007-0980. 15. Butler DG, Cullis BR, Gilmour AR, Gogel BJ. Analysis of mixed models for S language environments: ASReml-R reference manual. 2009:145. doi:citeulike-articleid:10128936. 16. Cameron N. Selection indices and prediction of genetic merit in animal breeding. CAB international, 1997. 17. Bell M, Saunders N, Wilcox R, Homer E, Goodman J, Craigon J, Garnsworthy P. Methane emissions among individual dairy cows during milking quantified by eructation peaks or ratio with carbon dioxide. J Dairy Sci 2014;97:6536–6546. doi:10.3168/jds.2013-7889. 16


Rev Mex Cienc Pecu 2021;12(1):1-17

18. Pinares-Patiño CS, Hickey SM, Young EA, Dodds KG, MacLean S, Molano G, et al. Heritability estimates of methane emissions from sheep. Animal 2013;7(2):316– 321.doi:10.1017/S1751731113000864. 19. Pickering NK, Chagunda MGG, Banos G, Mrode R, Mcewan JC, Wall E. Genetic parameters for predicted methane production and laser methane detector measurements. Am Soc Anim Sci 2015;92(1):11–20.DOI:10.2527/jas2014-8302. 20. Lassen J, Lovendahl P, Madsen J. Accuracy of noninvasive breath methane measurements using Fourier transform infrared methods on individual cows. J Dairy Sci 2012;95:890–898.doi:10.3168/jds.2011-4544. 21. Miglior F, Sewalem A, Jamrozik J, Bohmanova J, Lefebvre DM, Moore RK. Genetic analysis of milk urea nitrogen and lactose and their relationships with other production traits in Canadian Holstein Cattle. J Dairy Sci 2007;90(5):2468–2479. doi:10.3168/jds.2006-487. 22. González-Peña D, Guerra D, Evora JC, Portales A, Ortiz J, González S, Ramírez R. Heredabilidad y tendencia genética de la producción de leche y grasa en vacas Siboney de Cuba. Ciencia y Tecnología Ganadera 2009;3(1):27–32. 23. Othmane MH, De La Fuente LF, Carriedo JA, San Primitivo F. Heritability and genetic correlations of test day milk yield and composition, individual laboratory cheese yield, and somatic cell count for dairy ewes. J Dairy Sci 2002;85(10):2692–2698. doi:10.3168/jds.S0022-0302(02)74355-5. 24. Lassen J, Poulsen NA, Larsen MK, Buitenhuis AJ. Genetic and genomic relationship between methane production measured in breath and fatty acid content in milk samples from Danish Holsteins. Anim Prod Sci 2016;56(3):298–303. doi:10.1071/AN15489. 25. Schutz MM, Hansen LB, Steuernagel GR, Reneau JK, Kuck AL. Genetic parameters for somatic cells, protein, and fat in milk of Holsteins. J Dairy Sci 1990;73:494–502. doi:10.3168/jds.S0022-0302(90)78697-3 26. Hayes BJ, Donoghue KA, Reich CM, Mason BA, Bird-Gardiner T, Herd RM, Arthur PF. Genomic heritabilities and genomic estimated breeding values for methane traits in Angus cattle. J Anim Sci 2016;94:902–908. doi:10.2527/jas.2015-0078. 27. Kandel P, Vanderick S, Vanrobays ML, Soyeurt H, Gengler N. Consequences of genetic selection for environmental impact traits on economically important traits in dairy cows. Anim Prod Sci 2018;58(1966):1779–1787. doi:10.1071/AN1659.2

17


https://doi.org/10.22319/rmcp.v12i1.5105 Artículo

Relaciones entre el ß-hidroxibutirato, el calcio y los ácidos grasos no esterificados en la sangre con pérdidas de producción de leche en la lactancia temprana

Rufino López-Ordaz a* Gabriela Pérez-Hernández a Hugo Alonso Ramírez-Ramírez b Reyes López-Ordaz c Germán David Mendoza-Martínez c Agustín Ruíz-Flores a

a

Universidad Autónoma Chapingo. Posgrado en Producción Animal. Carr. MéxicoTexcoco. 56230. Chapingo, Estado de México. México. b

Iowa State University. Animal Science Department. Ames, IA.USA.

c

Universidad Autónoma Metropolitana. Departamento de Producción Agrícola. Ciudad de México, México.

*Autor de correspondencia: rlopezor@yahoo.com

Resumen: Los objetivos fueron estudiar las asociaciones de las concentraciones de β-ácido de hidroxibutirato (BHBA), calcio (Ca2+) y ácidos grasos no esterificados (NEFA) en el suero sanguíneo 7 días antes del parto con pérdidas en el rendimiento de la leche (RL) y disfunciones metabólicas a los días 7 y 14 de la lactancia. Se tomaron muestras de 336 vacas Holstein-Frisian (780 ± 36 kg de peso vivo) que habían lactado más de dos veces, por venipuntura coxígea, 7 días antes, y 7 y 14 días después del parto. Para cada muestra y metabolito, las concentraciones séricas se estratificaron en umbrales y se relacionaron 18


Rev Mex Cienc Pecu 2021;12(1):18-35

con el RL. En aquellos casos en que los niveles de BHBA eran elevados 7 días antes del parto y estaban relacionados con el RL en el 7° día del postparto, se observó que el 11 % de las vacas perdieron 0.370 kg día-1 de leche. Por el contrario, no se observó ninguna relación entre el BHBA preparto y el RL en el 14° día de la lactancia. No se observó ninguna asociación entre los niveles elevados de NEFA y bajos de Ca2+ del preparto y el RL. Las concentraciones de NEFA ≥ 0.5 mmol L-1 en el 7° día antes del parto fueron 7.6 veces más susceptibles a la incidencia de cojera (P≤ 0.01), y en aquellos casos en que el BHBA fue ≥ 0.8 mmol L-1, las vacas tuvieron 2.4 veces más probabilidades de desarrollar cetosis (P≤0.05) en los primeros 60 días en leche. En resumen, los datos indican que una alta proporción de vacas está por encima de los umbrales de β-hidroxibutirato y de ácidos grasos no esterificados, y también son deficientes en calcio, cuando se determina una semana antes del parto. Los umbrales de riesgo de cada metabolito no se asociaron con la cantidad de leche perdida en el día 14 después del parto. Palabras clave: Balance energético negativo, Biomarcadores, Metabolitos, producción de leche, Disfunciones metabólicas.

Recibido: 08/10/2018 Aceptado: 22/11/2019

Introducción La salud de los animales y la productividad de los hatos son los desafíos más difíciles a los que se enfrentan regularmente los productores de leche. El período alrededor del parto es crítico debido a la reducción en el consumo de materia seca (CMS), el aumento de la demanda de nutrientes, energía y calcio (Ca2+) para el mantenimiento y la síntesis de la leche. Debido a la reducción del CMS, los requerimientos de los animales no pueden ser satisfechos, y el déficit permite que el animal caiga en un balance energético negativo (BEN). Durante la lactancia temprana, la concentración de glucosa en el suero sanguíneo es baja, con un aumento paralelo de la concentración de ácidos grasos no esterificados (NEFA), y de cuerpos cetónicos(1). El cuerpo cetónico más destacado que circula en los rumiantes es el β-hidroxibutirato (BHBA), que se utiliza como fuente de energía en tejidos corporales como el cerebro, el corazón(2), el riñón y el músculo esquelético(3). Sin embargo, el aumento del BHBA por encima de 1.2 mmol L-1 es un indicador de cetosis subclínica en las vacas lecheras(4). El aumento de la BHBA en plasma reduce la glucosa circulante en

19


Rev Mex Cienc Pecu 2021;12(1):18-35

la sangre(5) y aumenta el riesgo de cetosis, hipocalcemia, desplazamiento abomasal y metritis con la consiguiente reducción de RL(6). Las mediciones de las concentraciones de BHBA, Ca2+ y NEFA en torno al parto pueden ser indicadores potenciales de la capacidad de la vaca para superar los desafíos metabólicos en el período de transición, y posiblemente permitan predecir algunos riesgos de enfermedad y posibles pérdidas de rendimiento de leche (RL) al comienzo de la lactancia. Las concentraciones de calcio demuestran la capacidad de la vaca para reemplazar la pérdida extracelular de Ca2+ como resultado del proceso de producción de leche, y el equilibrio entre el hueso y la eficiencia de absorción de la insulina y el Ca2+(7). Los ácidos grasos no esterificados sirven de indicador de la movilización de la grasa corporal y reflejan la particularidad de la vaca para adaptarse al BEN. A nivel de la vaca, las reducciones de las concentraciones de Ca2+ en el suero, los aumentos de NEFA y BHBA se han asociado con un mayor riesgo de contraer enfermedades(8) y de pérdida de leche(9). Los umbrales a nivel de la vaca de estos metabolitos se han utilizado para identificar a las personas que corren el riesgo de perjudicar su salud y su productividad. Sin embargo, las intervenciones individuales para reducir al mínimo los efectos indeseables del BHBA en la hipocalcemia, la cetosis u otros trastornos metabólicos en torno al parto son difíciles de lograr. Basándose en esta premisa, el objetivo de este estudio fue determinar las concentraciones séricas de β-hidroxibutirato, Ca2+ y, ácidos grasos no esterificados, siete días antes del parto, y las relaciones entre ellas y las pérdidas de leche a los siete y 14 días de lactancia en vacas Holstein-Friesian en confinamiento.

Material y métodos Área de estudio El estudio se llevó a cabo en un establo lechero comercial situado en la región de la Comarca Lagunera, en el norte de México. El establo se seleccionó en base a la accesibilidad del gerente para participar en el estudio; cumplía con los criterios de tener aproximadamente 2,000 vacas de ordeño y manejar con dos ordeños por día y dietas completas de sorgo-soya. La granja está ubicada en San Pedro, Coahuila, a 1,100 m (25° 44' 36"N y 103° 10' 22" O). La temperatura en los corrales de los animales fue de 4 a 20 °C durante el período de estudio. El clima de la región es desértico. Las precipitaciones son de aproximadamente 300 mm por año, distribuidas principalmente de julio a septiembre(10).

20


Rev Mex Cienc Pecu 2021;12(1):18-35

Alimentación y manejo de animales Los animales utilizados en el estudio fueron 336 vacas gestantes de raza Holstein-Friesian, aproximadamente 30 días antes de la fecha probable del parto. El peso corporal (PC) fue de aproximadamente 780 ± 36 kg, con un puntaje de condición corporal (PCC) de 3.5 (escala 1= delgada a 5= gorda) y con más de dos lactancias. Las posibles fechas de parto se obtuvieron de las listas generadas por el programa informático de la AfiFarm' (Ltd., Kibbutz Afikim, Israel). Las vacas se seleccionaron teniendo en cuenta los registros de producción de leche de la lactancia anterior. El criterio de selección fue la producción promedio indicada en kilogramos de leche para 305 días de un año anterior. El número de vacas consideradas en el estudio se obtuvo según los criterios de Fox et al(11) para el tamaño de la muestra, considerando la población total de vacas lecheras menos el 16.0 % correspondiente a las vacas en período seco y el 12.0 %, a aquellas vacas que tenían una sola lactancia. También se descartaron a aquellas a las que se diagnosticó mastitis, o bien, trastornos metabólicos o problemas respiratorios. Por último, se utilizaron 336 vacas en el muestreo. Los animales seleccionados fueron muestreados a 7 días antes, y 7 y 14 días después del parto (-7d, +7d y +14d). Cada grupo de vacas lecheras (pre y post parto) se alimentó con la dieta respectiva. En cada dieta se utilizaron los mismos ingredientes. Se proporcionó a las vacas acceso a agua fresca a voluntad y se les alimentó con una dieta completa (DC) diaria que se diseñó para cumplir con los requerimientos nutricionales del ganado recomendados del NRC(12) para las vacas pre-parto y posparto. La dieta de preparto fue a base de heno de avena, harina de soya y maíz partido, y la dieta de las vacas posparto, a base de alfalfa y harina de soya (Cuadro 1). Cuadro 1: Ingredientes y composición química de la ración mixta total suministrada a vacas Holstein-Friesian en condiciones de confinamiento antes y después del parto Ingrediente Dieta pre-parto, %1 Dieta posparto, %2 Heno de alfalfa 7.75 20.41 Frijol de soya 13.78 25.36 Semilla de algodón 6.82 Grano de destilería 4.68 1.47 Grano de sorgo, hojuelas 4.75 Grano de maíz, hojuelas 3.43 Pulpa de cítricos 12.76 Cáscaras de soya 10.62 1.51 Ensilado de maíz 3.40 Heno de avena 44.18 Maíz quebrado 7.15 Minerales 0.81 0.45 21


Rev Mex Cienc Pecu 2021;12(1):18-35

Melaza Sales de calcio de ácidos grasos Bicarbonato de sodio Fosfato dicálcico Premezcla vitamínica 1

9.24

0.05 1.38 0.36 Composición química Energía metabolizable, Mcal Kg-1 1.68 Energía neta de la lactancia, Mcal 1.06 -1 Kg Proteína cruda, % 12.60 Fibra detergente ácida, % 21.70 Fibra detergente neutra, % 25.60

12.76 5.98 0.05 1.45 0.30 3.08 2.04 22.00 18.00 18.70

1

El período pre-parto fue de la semana 3 a la semana 0 antes del parto. 2 El período de dieta posparto fue desde el parto hasta el día 60 de lactancia. 3 Las composiciones químicas se determinaron en el laboratorio siguiendo los procedimientos de la AOAC(31), mientras que la FDN y la FDA se analizaron según los métodos de Goering y Van Soest(32).

Análisis del suero En cada día de muestreo se recolectaron aproximadamente 10.0 ml de sangre de la vena o arteria coxígea en tubos al vacío sin anticoagulante (Beckton-Dickinson, Franklin Lakes, NJ) inmediatamente después del ordeño de la mañana y antes de la ingesta de alimento. Las muestras se mantuvieron bajo refrigeración y se permitió su coagulación. La sangre se centrifugó a 1,500 rpm durante 25 min; el suero se separó y almacenó a -20 °C en un período no superior a 6 h después de la recolección. Las muestras para medir el BHBA y los NEFA se analizaron en los laboratorios de la Universidad Autónoma Nacional de México. Las concentraciones de NEFA en el suero sanguíneo se determinaron con un ensayo colorimétrico enzimático número 11 383 175 001, distribuido por los laboratorios Sigma Aldrich (Roche, Diagnostics, Mannheim, Alemania); mientras que el BHBA se analizó con un kit colorimétrico enzimático a través de un lector de placas. Este kit es distribuido por los laboratorios Stanbio (EKF Diagnostics-Stanbio, Boerne, TX, USA). Se utilizó un espectrofotómetro de absorción atómica (Analista 700, Perkin Elmer) para analizar las concentraciones de Ca2+ en el suero sanguíneo. Las concentraciones de calcio se determinaron siguiendo los procedimientos del fabricante(13).

Registro de enfermedades El hato lechero se visitó diariamente. Los veterinarios registraban los eventos de las enfermedades después del ordeño matutino, utilizando una hoja de cálculo estándar, que se manejaba en el área de sistemas con el software AfiFarm (Ltd., Kibbutz Afikim, Israel). Las disfunciones metabólicas tales como la acidosis, la hipocalcemia, la cetosis y la cojera 22


Rev Mex Cienc Pecu 2021;12(1):18-35

se clasificaron como eventos clínicos. Los veterinarios normalizaron la información recopilada según los protocolos establecidos por la granja para la detección de enfermedades y trastornos. Las definiciones de las enfermedades ya han sido descritas anteriormente por LeBlanc et al(14).

Análisis estadístico Los análisis estadísticos se realizaron utilizando el software SAS(15), con la vaca como unidad experimental. Las estadísticas descriptivas se obtuvieron con el procedimiento UNIVARIATE; se muestran en el Cuadro 2. Cuadro 2: Umbral y estadísticas descriptivas de las muestras del experimento utilizado para evaluar la relación entre las concentraciones de metabolitos del suero sanguíneo y la producción de leche de las vacas Holstein-Friesian en confinamiento Umbral Desviación Ítem Media estándar Bajo Medio Alto Puntaje de la 2.25-3.50 3.55 0.18  2.25  3.50 condición corporal (95) (116) (130) (número de vacas) _________________________________________________________________________________

Lactancia (número de vacas)

 3.00 (104)

Producción de 18.20 leche, kg vaca-1día- (122) 1 , (número de vacas)

3.0-4.00 (108) 18.2036.32 (123)

 4.00 (124)

2.69

0.83

 36.33 (91)

38.44

10.33

Las diferencias entre las concentraciones de BHBA, Ca2+ y NEFA se analizaron usando PROC MIXED en un diseño completamente aleatorio para medidas repetidas. El modelo final es el indicado, tras eliminar las covariables y las interacciones dobles o triples que no fueron significativas (P≥0.05). Yijk =  + VACAi + DÍA DE MUESTREOj + VACA x DÍA DE MUESTREOij + Eijk Donde: Yijk es una observación de las variables de respuesta;  es la media general; VACAi es el efecto aleatorio de la i-ésima vaca (i= 1, 2,…336); DÍA DE MUESTREO es el efecto del j-ésimo día de muestreo (j= -7, 7 y 14); VACA x DÍA DE MUESTREOij es la interacción entre la vaca y el día de muestreo; Eijk es el error aleatorio.

23


Rev Mex Cienc Pecu 2021;12(1):18-35

La estructura de covarianza para las concentraciones de BHBA y NEFA fue de simetría compuesta, mientras que la más apropiada para el Ca2+ fue autorregresiva de orden uno. Ambas se basaban en el criterio de información de Akaike más bajo. Los niveles de BHBA, Ca2+ y NEFA en el suero sanguíneo fueron dicotomizados y evaluados individualmente en relación con el RL en los días 7 y 14 después del parto. Las variables ficticias RL y BCS se definieron siguiendo los procedimientos publicados por López-Ordaz et al(16). Para el SCB, las vacas fueron clasificadas como moderadas (2.25 a 3.25) y gordas (≥ 3.5). Las vacas con SCB > 3.5 se clasificaron con el número uno y se consideraron como factor de riesgo. Estos valores se realizaron utilizando la frecuencia Proc de SAS. Para cada metabolito y fecha de muestreo se establecieron por lo menos tres tipos de umbrales (bajo, medio y alto). Los umbrales se formaron siguiendo la metodología propuesta por Chapinal et al(9). Para predecir el volumen de leche perdida o no cosechada, se utilizó la categorización de las vacas en grupos de riesgo bajo, medio y alto. Para estudiar la diferencia entre los umbrales se crearon variables Dummy jerárquicas; los valores categóricos fueron 1.0 y 0.0 para las vacas consideradas de alto y bajo riesgo, respectivamente, basándose en las concentraciones séricas de cada metabolito en cada día de muestreo de los umbrales utilizados. En la mayoría de los umbrales el nivel medio funcionó como punto de referencia. Con los umbrales de alto riesgo definidos para BHBA, Ca2+ y NEFA, la proporción de vacas que estaban por encima y por debajo de los mismos umbrales para cada metabolito y para cada fecha de muestreo se determinó con la prueba de Chi cuadrado (Cuadro 3); mientras que las concentraciones en sangre de BHBA, Ca2+ y NEFA para los animales que estaban por encima o por debajo de los umbrales de alto riesgo se analizaron con Proc mezclado de SAS. Cuando las diferencias eran significativas entre las vacas, se utilizó la prueba de contrastes ortogonales para establecer la magnitud de las diferencias. Cuadro 3: Estadísticas descriptivas de las muestras del experimento utilizado para evaluar la relación entre las concentraciones de metabolitos en el suero sanguíneo y la producción de leche Media Desviación Ítem Mínima Máxima (n=336) estándar BHBA, mmol L-1 0.73 0.45 0.20 3.84 Ca2+, mmol L-1

2.46

0.57

1.24

4.98

NEFA, mmol L-1

0.59

0.46

0.12

2.95

24


Rev Mex Cienc Pecu 2021;12(1):18-35

Para predecir el RL perdido o no cosechado, así como la posible relación entre los metabolitos y los trastornos metabólicos, se utilizó la clasificación de bajo, medio y alto; el RL se clasificó como bajo (≤ 18.20), medio (18.21 a 36.33) y alto (≥ 36.33 kg d-1) y se le denominó 0, -1 y 1, respectivamente, sobre la base de las variables discretas reportadas por López-Ordaz et al(16). Para cada umbral de concentración y día de muestreo se elaboraron modelos de regresión logística condicional multivariante (Proc Glimmix), utilizando una distribución binaria y una función de enlace logístico. Las variables de interés fueron las concentraciones de BHBA, Ca2+ y NEFA (las proporciones dicotomizadas de animales en el grupo de riesgo bajo, moderado o alto), la fecha de muestreo de interés y la fecha anterior (cuando el día -7 era la fecha de interés, se incluyó en el modelo el día 7 después del parto). También se incluyeron CC, PL y fecha de nacimiento; los resultados se presentan como índice de probabilidad e intervalos de confianza (IC = 95%) entre los animales por encima y por debajo del umbral de referencia. El índice de probabilidad expresa la ventaja o probabilidad de experimentar un evento (por ejemplo, pérdida o no recolección de leche) para un grupo de alto riesgo (por encima del umbral) en comparación con un grupo de bajo riesgo (por debajo del umbral).

Resultados El Cuadro 2 muestra los umbrales y el número de vacas para la evaluación del SCB, la lactancia y el RL de los animales utilizados en el estudio; mientras que el Cuadro 3 muestra el número de repeticiones, los valores medios y las desviaciones estándar de las concentraciones de metabolitos en el suero sanguíneo de los animales considerados en el estudio. En el Cuadro 4 se indican las fechas de muestreo y la proporción de vacas que estaban por encima y por debajo de los umbrales. La proporción de vacas por encima de los umbrales para la BHBA en día -7 fue menor (P≤0.05) que las observadas en los días 7 y 14. Por el contrario, no se observaron diferencias entre los días 7 y 14. La proporción de vacas por encima de los umbrales para el Ca2+ fue mayor (P≤0.001) para los días -7 y 7 en comparación con el día 14. Sin embargo, para los NEFA, la proporción fue mayor (P≤0.001) en el día 14 que los otros días (224 vs 108 y 30, para los días 7 y - 7, respectivamente).

25


Rev Mex Cienc Pecu 2021;12(1):18-35

Cuadro 4: Vacas por encima o por debajo de los umbrales, y estadísticas descriptivas de las muestras del experimento utilizado para evaluar la relación entre las concentraciones de metabolitos en el suero sanguíneo Vacas por encima de Ítem n los umbrales EEM P 14 -7 7 a b BHBA ≤ 0.8 336 9 24 27b 2.12 0.05 -1 mmol L Calcio ≤ 2.3 336 108b 108b 84a 11.34 0.001 -1 mmol L NEFA ≥ 0.5 336 30a 108b 224c 28.55 0.001 -1 mmol L Vacas por debajo de los umbrales BHBA ≤ mmol L-1 Calcio ≤ mmol L-1 NEFA ≥ mmol L-1 ab

0.8

336

327

312

309

3.00

0.05

2.3

336

228a

228a

252b

9.87

0.04

0.5

336

306c

228b

122a

17.99

0.001

Letras diferentes en una misma fila indican diferencia estadística (P<0.05) entre tratamientos.

La proporción de vacas por debajo de los umbrales de BHBA en los días 7 y 14 fue menor (P≤ 0,05) que las observadas en el día -7. Por el contrario, no se observaron diferencias entre el día 7 y el día 14 (Cuadro 4). La proporción de vacas por debajo de los umbrales para el Ca2+ fue mayor (P≤ 0.04) que en los días - 7 y 7 que en el día 14. Sin embargo, para los NEFA, la proporción fue mayor (P≤0.001) en el día - 7 que en los otros días (306 vs 228 y 122, para los días 7 y 14, respectivamente). En el Cuadro 5 se muestran las concentraciones de metabolitos observadas en las vacas que estaban por encima y por debajo de los umbrales obtenidos para BHBA, Ca2+ y NEFA, en los días -7, 7 y 14. En las vacas que estaban por encima de los umbrales, las concentraciones de BHBA en los días 7 y 14 fueron mayores (P≤0.02) que las observadas en el día - 7. Por el contrario, no hubo diferencia (P≥0.05) entre las concentraciones de Ca2+ y NEFA de los días - 7, 7 y 14 preparto.

26


Rev Mex Cienc Pecu 2021;12(1):18-35

Cuadro 5: Concentraciones de metabolitos, vacas por encima y por debajo de los umbrales, y estadísticas descriptivas de las muestras del experimento utilizado para evaluar la relación entre las concentraciones de metabolitos en el suero sanguíneo Vacas por encima de Ítem n los umbrales EEM P -7 7 14 a b BHBA ≤ 0.8 336 1.04 1.65 1.68b 0.12 0.05 -1 mmol L Calcio ≤ 2.3 336 108b 108b 84a 11.34 0.001 -1 mmol L NEFA ≥ 0.5 336 30a 108b 224c 28.55 0.001 -1 mmol L Vacas por debajo de los umbrales BHBA ≤ 0.8 mmol L-1 Calcio ≤ 2.3 mmol L-1 NEFA ≥ 0.5 mmol L-1 ab

336

0.49a

0.71b

0.66b

0.06

0.02

336

1.93

1.85

1.88

0.05

0.02

336

0.20a

0.42b

0.41b

0.05

0.01

Letras diferentes en una misma fila indican diferencia estadística (P<0.05) entre tratamientos.

Con respecto a las vacas por debajo de los umbrales, las concentraciones de BHBA en los días 7 y 14 fueron diferentes (P≤0.02) de las del día -7; por el contrario, no se observó ninguna diferencia (P≥0.02) entre los días 7 y 14. Mientras que, para la misma fecha, las concentraciones de Ca2+ no fueron diferentes (P≥0.12) en comparación con las otras dos fechas. Las concentraciones de NEFA del día 7 fueron diferentes (P≤0.01) a la concentración en los días 7 y 14 postparto. Por el contrario, no se observó ninguna diferencia entre los días 7 y 14. Con respecto a las vacas que se encuentran por debajo de los umbrales, las vacas del séptimo día después del parto mostraron un alto riesgo con concentraciones de NEFA en la sangre. La relación entre las concentraciones en sangre determinadas en el día 7 antes del parto y la incidencia de disfunciones metabólicas en los primeros 7 días de la lactancia tuvo un efecto significativo en la incidencia de la cojera (P≤0.01), con un índice estimado de 7.6 [1.50 – 38.74; IC = 95%; P=0.01] veces más probabilidad de presentar este trastorno clínico cuando los NEFA son ≥0.5 mmol L-1. También se observó que en el 11 % de las vacas con altas concentraciones de HCBH se perdieron aproximadamente 0.37 kg de leche por vaca por día [Índice de probabilidad = 0.37; (0.14 a 1.01; IC = 95%; P=0.05)]. 27


Rev Mex Cienc Pecu 2021;12(1):18-35

Discusión Se sabe que los cuerpos cetónicos, de los cuales el BHBA es el principal, intervienen en la expresión de la cetosis, como depresores del CMS y afectan negativamente a la fertilidad de las vacas lecheras(17). Se determinaron las concentraciones séricas de BHBA, Ca2+ y NEFA 7 días antes del parto, y 7 y 14 días después del mismo, para establecer las relaciones entre esas concentraciones y las pérdidas de leche en las vacas HolsteinFriesian en confinamiento. En el presente estudio, la baja proporción de vacas por encima de los umbrales de BHBA en el día -7 en comparación con los días 7 y 14 de la lactancia se explicó por las adaptaciones metabólicas y endocrinas de la vaca durante el período seco en ausencia de las necesidades de nutrientes para el RL; mientras que en la lactancia; el metabolismo de los nutrientes está relacionado con el balance energético negativo (BEN) causado por el RL y el consumo inadecuado de alimentos. La adaptación necesaria se refleja en los cambios de varios parámetros sanguíneos. Como se ha señalado en otros estudios, la concentración de glucosa disminuye, mientras que las concentraciones de BHBA y NEFA aumentan, concomitantemente con los cambios relacionados en el sistema endocrino, principalmente la insulina y el glucagón(18). La diferencia en las concentraciones de BHBA antes y después del parto también se observó en otros estudios. Chapinal et al(9) en un gran estudio multirregional realizado en 55 establos, para validar las relaciones entre las concentraciones de BHBA con las enfermedades al comienzo de la lactancia, observaron que las vacas muestreadas en el día -7 estaban cuatro veces por debajo del umbral de riesgo de BHBA, en comparación con las muestreadas siete días después del parto. La diferencia se explicaba por el metabolismo de la energía en diferentes estados fisiológicos. En el estudio de Chapinal et al(9) las concentraciones de BHBA fueron similares a las observadas aquí. En el presente estudio, las concentraciones séricas de BHBA encontradas fueron en promedio de 0.73, con una variación de 0.20 a 3.84 mmol L-1. Las concentraciones más altas se obtuvieron en los días 7 y 14 de la lactancia en comparación con las obtenidas en el día -7. El umbral a nivel de vaca de <0.8 mmol L-1 utilizado en el presente estudio es similar a los sugeridos en otros trabajos(9-19). Es concebible que la cetosis subclínica pueda comenzar a niveles de BHBA superiores a 1.0 mmol L-1; sin embargo, la decisión de establecer un umbral subclínico apropiado utilizando BHBA sérico o plasmático parece ser algo arbitraria.

28


Rev Mex Cienc Pecu 2021;12(1):18-35

Kelly(20) sugirió que se utilizara 1.0 mmol L-1 para separar las vacas con concentraciones bajas y altas de BHBA; mientras que Suthar et al(21) seleccionaron un umbral de cetosis subclínica de 1.2 mmol L-1 de BHBA. Dado que se considera que el aumento de los cuerpos cetónicos después del parto forma parte de una respuesta metabólica normal al aumento de la demanda de energía, parece que el punto de corte para definir las altas concentraciones de cuerpos cetónicos debería basarse tanto en la producción como en el deterioro de la salud. Otros factores, como la edad de la vaca, también forman parte de la explicación de los altos niveles de BHBA en la lactancia temprana. En el presente estudio, las vacas con tres o más lactancias (2.5 frente a 3.6 ± 1.5) fueron más productivas que las vacas jóvenes, como consecuencia de lo cual una mayor proporción estaba por encima del umbral de riesgo (aproximadamente el 19 %). Las vacas mayores (> 4 lactancias) consumen más alimento que las vacas más jóvenes, movilizan más glucosa y responden con mayores aumentos de BHBA debido a las necesidades de la lactancia(13). De acuerdo con estos criterios, en el presente estudio se consideraría que aproximadamente el 3, 7 y 8 % de las vacas tienen cetosis subclínica; porque sus concentraciones de BHBA eran superiores a 1.0 mmol L-1 para los días -7, 7 y 14, respectivamente. Puede ser una llamada de atención a la salud y a las posibles demandas de leche en el hato estudiado. En particular, el hato en estudio tiene los registros más productivos y reproductivos de la zona, lo que significa que otros hatos con parámetros más bajos podrían presentar cetosis subclínica en mayores proporciones en la zona de estudio. El calcio juega un papel fundamental en el RL, porque está involucrado en la transmisión de los impulsos nerviosos, la contracción de los músculos, la coagulación de la sangre, la actividad secretora de las células, la diferenciación celular, la respuesta inmune y la activación enzimática(22). En el presente estudio, la proporción de vacas por encima de los umbrales de Ca2+ fue menor en el día 14 que en los días 7 y -7; esto puede deberse a que la movilidad del Ca2+ durante el final de la gestación sólo tiene fluctuaciones muy leves porque los cambios en los requerimientos del mineral no son muy variables. Por el contrario, en los días posteriores al parto, las necesidades del metabolito aumentan drásticamente a medida que aumenta la síntesis de la leche producida. Según los NRC(11), al comienzo de la lactancia, aproximadamente todas las vacas tienen un balance negativo de Ca2+, por lo que a medida que la lactancia progresa y RL aumenta en volumen, como consecuencia la necesidad de mineral aumenta. Van't Klooster(23) indicó que la absorción de Ca2+ aumentó un 22 % hacia el final de la preñez, llegando al 36 % para el día 8 de lactancia en las vacas que consumieron la dieta completa (DC). Lo que representó un aumento de aproximadamente 1.6 veces en la 29


Rev Mex Cienc Pecu 2021;12(1):18-35

absorción de Ca2+. Después de ese período, los cambios fueron pequeños y en respuesta a los incrementos de la DC. Chapinal et al(9) indicaron que tiende efectivamente a aumentar el Ca2+ a fin de cubrir la demanda del mineral para la síntesis de la leche. Este estudio incluyó 48 hatos, de los cuales el 33 % estaba por encima del umbral de riesgo cuando se determinó el Ca2+ en el día -7, en comparación con el 40 % de ellos que estaban por encima del mismo umbral cuando se determinó el Ca2+ en el día 7 después del parto. En el presente estudio, las concentraciones de Ca2+ en el suero fueron de aproximadamente 2.46 mmol L-1, con un amplio rango de variación de 1.24 a 4.98 mmol L-1. Como se ha indicado, el umbral de Ca2+ fue <2.3 mmol L-1, lo que sugiere que una elevada proporción de vacas corría el riesgo de presentar hipocalcemia subclínica (concentración sérica de Ca2+ <1.8 mmol L-1(24); aunque los signos de fiebre láctea eran imperceptibles. Como se ha indicado, el hato estudiado tiene los indicadores productivos más altos de la cuenca lechera, y aun así presenta un elevado número de vacas propensas a la hipocalcemia subclínica. La inferencia podría ser cierta para hatos con condiciones de manejo similares, en los que esa condición puede ser un problema que limita el RL. Otra parte de la explicación también tiene que ver con la edad de la vaca. Las vacas adultas con más de cuatro lactancias (aproximadamente el 19 %) fueron más propensas a la hipocalcemia y estaban por encima del umbral propuesto para el Ca2+. En apoyo de lo anterior, Venjakob et al(25) observaron que las vacas primíparas con concentraciones séricas de Ca2+ < 2.0 mmol L-1 no tenían ningún efecto sobre el RL, mientras que las vacas adultas no sólo presentaban hipocalcemia, sino que también producían menos leche (-2.19 kg animal-1d-1) que las vacas libres de la enfermedad. Neves et al(26) observaron que las vacas preparadas con concentraciones de Ca2+ de ≤ 2,4 mmol L-1 tuvieron un mayor riesgo de ser clasificadas como hipocalcemia subclínica una semana antes del parto. Los autores indicaron que el umbral de Ca2+ (≤ 2,4 mmol L-1) es necesario para identificar los animales en preparto con mayor probabilidad de presentar hipocalcemia subclínica. Aquellos estudios a nivel de hato que utilicen este punto de corte podrían establecer objetivos para medir el éxito de las estrategias preventivas. Se requieren estudios adicionales para determinar los tiempos de muestreo de la sangre alrededor del parto y para evaluar la relación entre los ácidos grasos y el Ca2+ en el preparto. En las explotaciones lecheras modernas, el período periparto (aproximadamente 3 semanas antes y después del parto) presenta los mayores riesgos de desarrollar enfermedades y mortalidad en las vacas. Ferguson(27) sugirió que aproximadamente una de cada dos vacas sufre efectos adversos en su salud, y que aproximadamente el 75 % de las enfermedades se producen durante el período periparto(13). Las enfermedades 30


Rev Mex Cienc Pecu 2021;12(1):18-35

metabólicas más comunes, como la hipocalcemia y la hipercetonemia, han demostrado que alteran el sistema inmunológico de la vaca, aumentan el riesgo de otras enfermedades y reducen el comportamiento productivo(17). En el presente estudio, aproximadamente 30 vacas estaban por encima de ese umbral de NEFA en el día -7, mientras que durante los días 7 y 14 de la lactancia el número de vacas aumentó de 108 a 224, respectivamente. El aumento de los niveles de NEFA en el período posparto podría explicarse por el aumento de las necesidades nutricionales debido a las necesidades particulares de la lactancia. Este efecto está relacionado con el hecho de que la mayoría de las vacas están en BEN y necesitan movilizar sus reservas corporales de lípidos para cubrir sus necesidades energéticas(11,28). A partir de un estudio con un mayor número de vacas y de lugares que éste, pero basado en los mismos umbrales de BHBA, Ca2+ y NEFA, Chapinal et al(9) concluyeron que aproximadamente el 11 % de los hatos estudiados estaban por encima del umbral de riesgo en el día -7, en comparación con el 23 % de los hatos en el séptimo día de lactancia. Los autores concluyeron que entre el 5 y el 50 % de los animales muestreados con niveles de NEFA por encima de los umbrales, tanto una semana antes como una semana después, estaban asociados a riesgos de desplazamiento del abomaso, pérdida de leche y reducción de la preñez en la primera inseminación. En el presente estudio, los niveles de NEFA promediaron 0.59 mmol L-1 con un rango entre 0.12 y 2.95 mmol L-1. Esto sugiere que las vacas del estudio estarían en riesgo de perder leche al comienzo de la lactancia, principalmente debido a alguna asociación con la hipocalcemia y la hipercetonemia debido a los niveles circulantes de NEFA. Los resultados obtenidos en el presente estudio coinciden con los de otros estudios. Ospina et al(19) encontraron que las concentraciones de NEFA > 0.3 mEq L-1 del día 14 al 2 preparto, y NEFA > 0.6, y BHBA > 10 mg dL-1 del día 3 a 14 posparto, tanto los valores preparto como posparto por encima de estos umbrales se asociaron con aumentos en la cetosis, la metritis, el desplazamiento abomasal y la retención de la placenta. En el presente estudio, se buscó a través de la regresión logística condicional para relacionar las concentraciones de metabolitos con las disfunciones metabólicas alrededor del parto. Sin embargo, las asociaciones obtenidas no fueron significativamente importantes y debido a esto no fueron reportadas. Una observación única y significativa fue que a medida que aumentaban los NEFA en sangre (≥ 0.5 mmol L-1) había un incremento de hasta 7.6 veces [Índice de probabilidad = 7.61; (1.50 a 38.74; IC = 95%; P=0.01)] de las posibilidades de que se presentara laminitis; esto puede deberse a que la cojera produce fiebre y dolor en las pezuñas, lo que altera el comportamiento de descanso y alimentación de los animales(29,30). 31


Rev Mex Cienc Pecu 2021;12(1):18-35

La fiebre reduce el apetito de la vaca, y el dolor en las pezuñas perjudica su capacidad de caminar y buscar alimento. La deficiencia de alimento aumenta la posibilidad de eliminar las reservas del cuerpo, aumentando los ácidos grasos libres. Los resultados del presente estudio fueron observados igualmente por otros. Collard et al(29) indicaron que las muestras de plasma con concentraciones de NEFA de 0.6 a 0.8 mmol L-1 se asociaban con la presencia de cojera alrededor del parto en las vacas lecheras Holstein-Friesian alimentadas con DC. Los resultados obtenidos en el presente estudio en relación con los niveles de NEFA y laminitis son contradictorios con otros estudios de la literatura. Calderón y Cook(30) informaron de que no había relación entre la cojera y los NEFA en las vacas HolsteinFriesian en torno al parto en una instalación comercial de estabulación libre sobre colchón. También observaron que las vacas cojas tuvieron tiempos de reposo más largos durante todo el período de transición y, en particular, durante tres días antes y después del parto. La cojera también se asoció con un mayor riesgo de cetosis en la granja de estudio, como lo demuestra la elevada concentración de BHBA encontrada en las vacas. Los resultados obtenidos en el presente estudio ofrecen la oportunidad de examinar los efectos de las concentraciones pre y postparto de NEFA y BHBA en el RL a nivel de vaca. La identificación de estos niveles de preparto permitirá a los productores de leche mejorar sus estrategias de manejo nutricional, a fin de evitar pérdidas en el RL o la presencia de trastornos metabólicos como la laminitis. Los resultados obtenidos muestran también cómo el estado del metabolismo influye en la salud de la vaca durante el período de transición, lo que sugiere que la gestión nutricional debe revisarse cuidadosamente debido a su impacto en la lactancia posterior.

Conclusiones e implicaciones Un elevado porcentaje de vacas estuvo por encima de los umbrales de β-hidroxibutirato y ácidos grasos no esterificados, y la mayoría de ellas también presentó deficiencias de calcio una semana antes del parto. Las altas concentraciones de β-hidroxibutirato podrían promover pérdidas en el RL de hasta 0.37 kg vaca-1d-1 siete días después del parto en vacas Holstein-Friesian. Los altos niveles de grasa no esterificada se asociaron con un riesgo 7.6 veces mayor de laminitis. Los umbrales de riesgo para cada metabolito no se asociaron con la cantidad de leche perdida 14 días después del parto en las vacas Holstein-Friesian.

32


Rev Mex Cienc Pecu 2021;12(1):18-35

Agradecimientos Los autores agradecen a Biotecap, especialmente al Ing. Juan de Dios y al Dr. Adelfo Vite, por proporcionar las instalaciones para la realización de la fase de campo de este estudio. Los agradecimientos se extienden al Dr. Agustín Garza por facilitar los animales utilizados en el experimento. También se agradece al CONACYT por proveer los fondos para que la segunda autora cursara sus estudios de Maestría en Ciencias. Literatura citada: 1. Gross J, van Dorland HA, Bruckmaier RM, Schwarz FJ. Performance a metabolic profile energy balance with subsequent re-alimentation. J Dairy Sci 2011;94:1820– 1830, doi: 10.3168/jds.2010-3707. 2. Veech RL, Chance B, Kashiwaya Y, Lardy HA, Cahill GF. Ketone bodies, potential therapeutic uses. Inter Union Biochem Mol Biol 2001;51:241-247, doi:10.1080/152165401753311780. 3. Ruderman NB, Goodman MN. Regulation of ketone body metabolism in skeletal muscle. Amer J Phys 1973;224:1391-1397. doi: 10.1152/ajplegacy.1973.224.6.1391.4. 4. Ospina PA, Nydam DV, Stokol T, Overton, TR. Associations of elevated non-esterified fatty acids and β-hydroxybutyrate concentrations with early lactation reproductive performance and milk production in transition dairy cattle in the northeastern of Unites States. J Dairy Sci 2010;93:1596–1603. doi:10.3168/jds.2009-2852. 5. Schlumbohm C, Harmeyer J. Hyperketonemia impairs glucose metabolism in pregnant and nonpregnant ewes. J Dairy Sci 2004;87:350-358. doi:10.3168/jds.S00220302(04)73174-4. 6. Duffield T, Lissemore K, McBride M, Leslie K. Impact of hyperketonemia in early lactation dairy cows on health and production. J Dairy Sci 2009;92:571-580. doi: 10.3168/jds.2008-1507. 7. Horst RL, Goff JP, Reinhardt TA. Calcium and vitamin D metabolism in the dairy cow. J Dairy Sci 1994;77:1936–1951. doi: 10.3168/jds.S0022-0302(94)77140X. 8. Seifi HA, LeBlanc SJ, Leslie KE, Duffield TF. Metabolic predictors of postpartum disease and culling risk in dairy cattle. Vet J 2011; 188:216220. doi: 10.1016/j.tvjl.2010.04.007. 9. Chapinal N, LeBlanc S, Carson M, Leslie K, Godden S, Capel M, Duffield T. Herdlevel association of serum metabolites in the transition period with disease, milk 33


Rev Mex Cienc Pecu 2021;12(1):18-35

production, and early-lactation reproductive performance. J Dairy Sci 2012;95:13011309. doi:10.3168/jds.2011-4724. 10. García E. Modificaciones al sistema de clasificación climática de Köppen. Instituto de Geografía. 5ta. ed. México: UNAM; 2005. 11. Fox N, Hunn A, Mathers N. Sampling and sample size calculation. The National Institute for Health Research. USA: NHR RDs eM/YH; 2009. 12. NRC. Nutrient Requirements of Dairy Cattle. 7th revised ed. National Academy of Sciences, Washington, DC USA: National Academy Press; 2001. 13. Perkin Elmer. Perkin Elmer Corporation. Analytical methods for atomic absorption. Associations of Official Analytical chemists. 2000. Norwalk, Connecticut; 1996. 14. LeBlanc SJ, Duffield TF, Leslie KE, Bateman KG, Ten-Hag J, Walton JS, Johnson WH. The effect of prepartum injection of vitamin E on health in transition dairy cows. J Dairy Sci 2002;85:1416–1426. doi: 10.3168/jds.S0022-0302(02)74209-4. 15. SAS. SAS User’s Guide: Statistics (Version 9.1.3). SAS Inst. Inc. Cary, NC, USA; 2012. 16. López-Ordaz R, Tinajero, PT, López OR, Mendoza G, Roldan MJ, Vite A, Ruiz FA. Relaciones entre calcio, ácidos grasos no esterificados, e insulina sanguínea en preparto y leche bovina perdida en el inicio de la lactancia. Nova Scientia 2017;9(19):306-328. doi:10.21640/ns.v9i19.1053. 17. Raboisson D, Mounie M, Maigne M. Disease, reproductive performance, and changes in milk production associated with subclinical ketosis in dairy cows: A meta-analysis and review. J Dairy Sci 2015;97:7457–7563. doi: 10.3168/jds.2014-8237. 18. Bruckmaier RM, Gross JJ. Lactational changes in transition dairy cows. Anim Prod Sci 2017; 57:1471-1483. doi.org/10.1071/ANI1657. 19. Ospina PA, Nydam DV, Stokol T, Overton TR. Association between the proportions of sampled transition cows with increased nonesterified fatty acids and betahydroxybutyrate and disease incidence, pregnancy rate, and milk production at the herd level. J Dairy Sci 2010;93:3595–3601. doi: 10.3168/jds.2010-3074. 20. Kelly JM. Changes in serum B hydroxybutyrate concentrations in dairy cows kept under commercial farm conditions. Vet Rec 1977;101:499–502. 21. Suthar VS, Canelas-Raposo J, Deniz A, Heuwieser W. Prevalence of subclinical ketosis and relationships with postpartum diseases in European dairy cows. J Dairy Sci 2013;96:2925–2938. doi: 10.3168/jds.2012-6035. 34


Rev Mex Cienc Pecu 2021;12(1):18-35

22. Mori M, Rossi S, Bonferoni MC, Ferrari F, Giuseppina S, Riva F, Del Fant C, Perotti C, Caramella C. Calcium alginate particles for the combined delivery of platelet lysate and vancomycin hydrochloride in chronic skin ulcers. Int J Pharmac 2014;461:505-513. doi.org/10.1016/j.ijpharm.2013.12.020. 23. van´t Klooster AT. Adaptation of calcium absorption from the small intestine of dairy cows’ changes in the dietary calcium intake and at the onset of lactation. Zeitschrift fuer Thierphysiology 1976;37:169-182. 24. Duffield TF, Lissemore KD, McBride BW, Leslie KE. Impact of hyperketonemia in early lactation dairy cow on health and production. J Dairy Sci 2005;92:571–580. doi:10.3168/jds.2008-1507. 25. Venjakob PL, Paiper L, Heuwieser W, Borchardt S. Association of postpartum hypocalcemia with early-lactation milk yield, reproductive performance, and culling in dairy cows. J Dairy Sci 2018;101:1-10. doi:10.3168/jds.2016-11714. 26. Neves RC, Leno BM, Curler MD, Thomas MJ, Overton TR, McArt JAA. Association diseases, culling, reproduction, and milk production in Holstein cows. J Dairy Sci 2017;100:547-5. doi:10.3168/jds.2017-13313. 27. Ferguson JD. Nutrition and reproduction in dairy herds. Vet Clin N Am Food Anim Pract 2005;21:325-333. 28. Bernabucci UL, Basiricó P, Morera D, Dipasquale A, Vitali F, Piccioli C, Calamari L. Effect of summer season on milk protein fractions in Holstein cow. J Dairy Sci 2015;98:1815-1827. doi: 10.3168/jds.2014-8788. 29. Collard BL, Boettcher PJ, Dekkers JCM, Petitclerc D, Schaeffer LR. Relationships between energy balance and health traits of dairy cattle in early lactation. J Dairy Sci 2000;83:2683–2690. doi: 10.3168/jds.S0022-0302(00)75162-9. 30. Calderon DF, Cook NB. The effect of lameness on the resting behavior and metabolic status of dairy cattle during the transition period in a free stall-housed dairy herd. J Dairy Sci 2011;94:2883-2894. doi:10.3168/jds.2010-3855. 31. AOAC. Association of Official Analytical Chemists. Official methods of analysis. 18th. ed. Association of Official Analytical Chemists Press. Gaithersburg, MD. AOAC International. 2006. 32. Goering HK, Van Soest PJ. Forage fiber analyses (apparatus, reagents, procedures, and some applications) Agricultural handbook no. 379. ARSUSDA, Washington, DC, USA. ARS-USDA Press Inc. 1970.

35


https://doi.org/10.22319/rmcp.v12i1.5106 Artículo

Caracterización genética de la oveja Pelibuey de México usando marcadores microsatélites

Cecilio Ubaldo Aguilar Martínez a Bertha Espinoza Gutiérrez b José Candelario Segura Correa c José Manuel Berruecos Villalobos d Javier Valencia Méndez a Antonio Roldán Roldán e*

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Reproducción. Avenida Universidad 3000, Ciudad Universitaria, Ciudad de México, México. b

Universidad Nacional Autónoma de México. Instituto de Investigaciones Biomédicas, Departamento de Inmunología. Ciudad de México, México. c

Universidad Autónoma de Yucatán. Campus de Ciencias Biológicas y Agropecuarias. Yucatán, México d

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Genética y Bioestadística. Ciudad de México, México. e

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Fisiología y Farmacología. Ciudad de México, México.

*Autor de correspondencia: arre@comunidad.unam.mx

Resumen: El objetivo fue caracterizar genéticamente 23 subpoblaciones de oveja Pelibuey de México y un rebaño cubano mediante nueve marcadores microsatélites. En el análisis por iniciadores, se observaron 99 alelos y un contenido de información polimórfica (PIC) de 0.84. El FIS, FST y FIT tuvieron valores de 0.007, 0.151 y 0.158, respectivamente. Tres 36


Rev Mex Cienc Pecu 2021;12(1):36-57

iniciadores (OarFCB304, OarJMP29 e ILSTS5) mostraron desviaciones en el equilibrio de Hardy-Weinberg (HWE; P<0.05). En el análisis por subpoblaciones, se observó un rango de 28 a 49 alelos por subpoblación, número medio de alelos (MNA) de 4.08 y número efectivo de alelos (NE) de 3.25. Los valores de heterocigosis observada (HO) y esperada (HE) fueron 0.726 y 0.731, respectivamente. Seis de las 24 subpoblaciones evaluadas mostraron desviaciones del HWE (P<0.05). Los valores de FIS por subpoblación variaron entre -0.71 y 0.138. Se registraron nueve alelos privados y no se detectaron alelos compartidos por todas las subpoblaciones. Mediante un análisis de componentes principales (PCA), las subpoblaciones se agruparon en dos clústeres. La prueba de Mantel determinó que la distancia genética (medida mediante las distancias mínimas insesgadas de Nei) no se relacionó con la distancia geográfica (r= -0.062; P>0.05). El análisis de estructura poblacional determinó que el número de poblaciones ancestrales (K) fue igual a 2, mostrando consistencia con el PCA. Se concluye que la oveja Pelibuey de México tiene una alta diversidad genética y que sus subpoblaciones se agrupan en dos grupos, uno de los cuales muestra el material genético más preservado. Palabras clave: Pelibuey, Caracterización genética, Microsatélites, Oveja de pelo.

Recibido: 10/10/2018 Aceptado: 01/07/2020

Introducción

La oveja Pelibuey es la raza de pelo más importante en México. Esta raza ingresó al país entre 1930 y 1940 procedente de Cuba(1,2,3), y desde entonces no ha entrado al país material genético nuevo. Inicialmente, la oveja Pelibuey se distribuyó en las regiones tropicales. Sin embargo, actualmente se encuentra diseminada en todo el país(4). La oveja Pelibuey no es una raza altamente productiva, pero su importancia biológica radica en su capacidad para adaptarse a diferentes ambientes y climas(5) y su habilidad para reproducirse a lo largo del año(6). El amplio rango de ambientes en los cuales la oveja Pelibuey fue criada, llevaron al desarrollo de respuestas adaptativas a esos ambientes, las cuales son parte de su acervo genético. Sin embargo, en años recientes, esta raza ha sido objeto de cruzas indiscriminadas con otras razas especializadas en la producción de carne para hacerla más productiva(3,7). Esto ha puesto en riesgo la diversidad genética original de la raza. Además, prácticas como la inseminación artificial y el flujo intenso de material genético entre los rebaños han acentuado el problema(8).

37


Rev Mex Cienc Pecu 2021;12(1):36-57

Un paso inicial para la conservación de los recursos genéticos animales es la caracterización de las razas. La Organización de las Naciones Unidas para la Alimentación y la Agricultura (FAO) ha propuesto que la caracterización inicialmente debe consistir en una descripción fenotípica de la raza y el posterior uso de marcadores moleculares para llevar a cabo la caracterización genética de diferentes razas de ovinos(9). Marcadores moleculares, como los microsatélites, se han utilizado en estudios de genética de poblaciones para caracterizar un gran número de razas(9). Un conocimiento más profundo sobre la diversidad y variabilidad genética, así como la estructura poblacional en diferentes rebaños de México, permitirá determinar el grado de riesgo de la oveja Pelibuey y, en su caso, sugerir estrategias viables para su conservación. Por lo tanto, el objetivo de este trabajo es caracterizar genéticamente mediante microsatélites diferentes subpoblaciones de Pelibuey en México.

Material y métodos Muestreo

Se recolectaron 119 muestras de sangre de oveja Pelibuey que incluyeron 23 rebaños nacionales y un rebaño cubano. Los rebaños nacionales se muestrearon en las zonas agroecológicas correspondientes al trópico húmedo, trópico seco y la región montañosa central. La localización geográfica de los rebaños nacionales muestreados se puede observar en la Figura 1. Once de los 24 rebaños muestreados pertenecen a universidades e institutos de investigación, los 13 restantes corresponden a productores particulares. Todos los rebaños incluidos en el estudio se manejaron de acuerdo a los lineamientos del Subcomité Interno para el Cuidado y Uso de los Animales de Experimentación (SICUAE) de la Facultad de Medicina Veterinaria y Zootecnia de la UNAM. Los rebaños pertenecientes al Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP) que se localizan en Yucatán (INIFAP Mocochá=IN-MOC) y Puebla (INIFAP Las Margaritas= IN-MAR) fueron considerados como las subpoblaciones nacionales de referencia, porque fueron los primeros en establecerse en México y su manejo ha tenido como objetivo la conservación de la raza. Asimismo, ambos han servido como base para la formación de otros rebaños nacionales. Los criterios para incluir a los animales en el muestreo fueron los siguientes: que tuvieran una apariencia externa característica de la oveja Pelibuey y que fueran hembras, clínicamente sanas y no emparentadas entre sí.

38


Rev Mex Cienc Pecu 2021;12(1):36-57

Figura 1: Localización de los rebaños nacionales de oveja Pelibuey que se incluyeron en el estudio

El orden de las subpoblaciones puede consultarse en el Cuadro 2. 1. INIFAP Mocochá (IN-MOC), 2. INIFAP Las Margaritas (IN-MAR), 3. Centro de Enseñanza, Investigación y Extensión en Ganadería Tropical (CEIEGT)-UNAM, 4. Centro de Enseñanza, Investigación y Extensión en Producción y Salud Animal (CEPIPSA)-UNAM, 5. Instituto Tecnológico de Conkal (ITC), 6. Universidad del Papaloapan (UNPA), 7. Colegio de Postgraduados Campus Córdoba (COLPOS-COR), 8. Universidad Veracruzana (UV), 9. Benemérita Universidad Autónoma de Puebla (BUAP), 10. Colegio de Postgraduados Campus Texcoco (COLPOS-TEX), 11. Universidad de Colima (UCOL), 12. Rancho San Alberto, 13. Rancho Garrido, 14. Rancho Belbesah, 15. Rancho Libertad, 16. Rancho Jalapa, 17. Rancho El Porvenir, 18. Rancho El Paraíso, 19. Rancho Santa Anita, 20. Posta El Cuatro, 21. Finca El Cielo, 22. Rancho La Fama y, 23. Rancho El Carrizal.

Siguiendo con las recomendaciones de la FAO, en el análisis se incluyeron cinco individuos de cada rebaño(10). Debido a que el ADN de algunas muestras se degradó, en dos rebaños (Rancho Jalapa y Rancho El Carrizal) únicamente se incluyeron cuatro muestras. Las muestras de sangre (6 ml) se obtuvieron mediante venopunción de la yugular, en tubos Vacutainer® con EDTA como anticoagulante y se identificaron al momento del muestreo. Las muestras se almacenaron a -80°C hasta su procesamiento y análisis.

Extracción de ADN y reacción en cadena de la polimerasa (PCR) El aislamiento de ADN se llevó a cabo tomando como base un protocolo simple y barato para la extracción de ADN a partir de sangre de aves(11), el cual posteriormente fue adaptado para sangre de ovinos(12).

39


Rev Mex Cienc Pecu 2021;12(1):36-57

Los aislamientos se evaluaron para determinar su rendimiento y pureza por medio de espectrofotometría (NanoDrop Thermo Scientific, Wilminton, DE). Los resultados obtenidos se corroboraron mediante la elaboración de un gel de agarosa al 0.8%, utilizando 10 µl del ADN extraído. El ADN obtenido se almacenó a -80°C hasta su uso en la técnica de PCR. Nueve marcadores microsatélites se amplificaron mediante PCR de acuerdo a las recomendaciones de la Sociedad Internacional de Genética Animal (ISAG) y de la FAO(10,13). Las reacciones de PCR se llevaron a cabo en un volumen final de 25 µl y consistieron de 100 ng de ADN genómico (2 µl), 0.2 µM de cada uno de los iniciadores (Forward y Reverse; 0.5 µl), 200 µM de cada dNTP (2.5 µl), 2.5 mM de MgCl2+ (0.5 µl), 1.25 U de Taq DNA polimerasa (0.25 µl), amortiguador para PCR 10x (2.5 µl) y 16.25 µl de agua estéril. Las reacciones de PCR se llevaron a cabo en un termociclador (Axygen Scientific Inc.). El protocolo de PCR fue como sigue: un paso inicial de desnaturalización a 95 °C por 5 min; 35 ciclos con fases de desnaturalización a 94 °C por 45 seg, alineamiento por 1 min a temperatura variable y extensión a 72 °C por 1 min; con un paso de extensión final a 72 °C por 10 min. Las reacciones de PCR se conservaron a 4 °C hasta su análisis.

Electroforesis Las reacciones de PCR fueron sometidas a electroforesis en geles de poliacrilamida no desnaturalizantes al 12%. La electroforesis se llevó a cabo con TBE 0.5% como buffer de corrimiento. Para determinar el tamaño de los fragmentos de ADN, se utilizó un marcador de peso de 25 pb (Invitrogen Life Technologies, Carsbard, USA). Los geles se tiñeron con bromuro de etidio a una concentración de 0.5 µg/ml y fueron fotodocumentados en presencia de luz ultravioleta (Kodak Gel Logic 2200 Imaging System). Las imágenes de los geles se procesaron mediante el programa MyImageAnalysisSystemTM (Fisher).

Análisis estadístico El número de alelos (NA), número efectivo de alelos (NE) número medio de alelos (MNA), índice de Shannon (I), heterocigosis observada (HO) y heterocigosis esperada (HE) para cada marcador fueron estimadas usando los programas POPGENE v.1.31(14) y FSTAT(15). El contenido de información polimórfica (PIC) se calculó usando el programa CERVUS v 3.0.7(16). Se realizaron pruebas exactas para determinar la desviación del equilibrio de Hardy-Weinberg (HWE) para cada marcador mediante técnicas de simulación Monte Carlo basadas en cadenas de Markov con el programa GENEPOP v 4.7.0(17,18). La estructura genética se analizó por medio de los estadísticos F. Los valores del índice de endogamia dentro de la población (FIS), índice de fijación de la población total (FIT)

40


Rev Mex Cienc Pecu 2021;12(1):36-57

e índice de diferenciación genética entre poblaciones (FST) se calcularon usando el programa GENEPOP v 4.7.0 realizando 1,000 permutaciones(17,18). El análisis de alelos privados se realizó por medio del programa GENALEX v 6.5(19,20). El análisis de alelos compartidos entre las subpoblaciones consistió en la elaboración de una matriz binaria en la que se registró la presencia (1) y ausencia (0) de cada uno de los alelos en las subpoblaciones. Posteriormente, se calcularon las proporciones de las subpoblaciones que presentaron los alelos compartidos más comunes y los menos comunes. El flujo génico entre las subpoblaciones fue medido a través del número de migrantes por generación (Nm) y calculado a partir del FST entre pares de subpoblaciones mediante el programa GENETIX v. 4.05(21). El aislamiento por distancia entre las subpoblaciones, se analizó mediante una prueba de Mantel(22), la cual consistió en correlacionar las distancias genéticas (medidas a través de las distancias mínimas insesgadas de Nei(23)) y las distancias geográficas entre los pares de subpoblaciones usando el programa XLSTAT. Para la prueba se utilizó una significancia de 0.05 y 10,000 permutaciones. Las relaciones espaciales entre las subpoblaciones se analizaron mediante un análisis de componentes principales (PCA), el cual se implementó en el programa PCAGEN(24). La estructura de la población y el grado de mezcla se estimaron usando un modelo de agrupamiento bayesiano implementado en el programa STRUCTURE v 2.3(25). El análisis llevado a cabo involucró un modelo de mezcla con frecuencias de alelos correlacionadas. Para elegir el número apropiado de clústeres inferidos (K) para modelar los datos, se realizó la inferencia de 2-24 clústeres con 20 corridas independientes en cada uno. Todas las corridas usaron 100,000 interacciones (burn-in) seguidas por 1,000,000 interacciones (MCMC). El número más probable de K fue calculado con el algoritmo ΔK, a través del programa en línea STRUCTURE HARVESTER(26). Finalmente, los resultados fueron procesados mediante el programa en línea CLUMPAK(27) para interpretar las inferencias obtenidas.

Resultados Diversidad genética de la población entera Las estadísticas globales generadas con los nueve microsatélites se muestran en el Cuadro 1. Para la población entera de Pelibuey, se detectaron 99 alelos en 119 animales genotipificados con nueve iniciadores microsatélites. Todos los loci fueron polimórficos en las subpoblaciones analizadas. El número de alelos por locus varió de 9 (OarCP34, OarFCB304 e ILSTS5) a 14 (OarJMP58). Se observó un número promedio de alelos por locus de 11. El NE fue de 5.31 (OarCP34) a 8.68 (OarJMP58).

41


Rev Mex Cienc Pecu 2021;12(1):36-57

Cuadro 1: Estadísticas

globales generadas con los nueve microsatélites

Marcador

TA (°C)

RT (bp)

NA

NE

HO

HE

PIC

I

HWE

FIT

FST

OarCP34

58

96134

9

5.31

0.731

0.740

0.79

1.90

N.S.

0.111*

0.099*

OarFCB304

58

140210

11

7.34

0.812

0.741

0.85

2.11

0.0285*

0.075*

0.154

OarJMP29

56

110180

12

6.67

0.694

0.807

0.83

2.11

0.0002*

0.185

0.056*

OarJMP58

58

130185

14

8.68

0.737

0.761

0.87

2.35

N.S.

0.173

0.148

DYMS1

58

155225

11

8.53

0.697

0.778

0.87

2.26

N.S.

0.217*

0.130

ILSTS5

58

180235

9

6.65

0.781

0.664

0.84

2.00

0.0180*

0.092*

0.228*

SRCRSP5

58

146200

12

6.24

0.699

0.667

0.82

2.06

N.S.

0.180

0.215*

SRCRSP9

58

95135

10

7.65

0.657

0.723

0.86

2.14

N.S.

0.255*

0.180

MAF33

60

115170

11

5.73

0.730

0.707

0.80

1.97

N.S.

0.123

0.150

11

6.97

0.726

0.732

0.84

2.1

0.158

0.151

Promedio

Temperatura de alineamiento (TA), rango de tamaño de alelos (RT), número de alelos (NA), número efectivo de alelos (NE), heterocigosis observada (HO), heterocigosis esperada (HE), contenido de información polimórfica (PIC), índice de Shannon (I), desviación del equilibrio de Hardy-Weinberg (HWE), índice de fijación de la población total (FIT) e índice de diferenciación entre poblaciones (FST) de nueve marcadores microsatélites utilizados en la caracterización genética de la oveja Pelibuey NS= no significativo; *P<0.05.

La HO tuvo valores entre 0.657 (SRCRSP9) y 0.812 (OarFCB304). El promedio de la HO para la población entera fue 0.726. Por otro lado, la HE fue de 0.664 (ILSTS5) a 0.807 (OarJMP29), con un promedio de 0.732. El PIC para cada marcador, varió de 0.79 (OarCP34) a 0.87 (OarJMP58 y DYMS1), con un promedio global de 0.84. El I se encontró entre 1.90 (OarCP34) y 2.35 (OarJMP58), con un promedio global de 2.1. Los marcadores microsatélites fueron probados para la desviación del HWE. La mayoría de los loci estuvieron en HWE. Sin embargo, OarFCB304, OarJMP29 e ILSTS5 mostraron una desviación significativa del HWE (P<0.05). Los valores globales del FIS, del FIT y del FST fueron 0.007, 0.158 y 0.151, respectivamente y no mostraron diferencias significativas (P>0.05). El valor más alto de FIS (0.136) fue observado en el marcador OarJMP29, mientras que el valor más bajo (-0.176) se observó en el marcador ILSTS5. El valor más alto de FIT (0.255) se observó en el locus SRCRSP9 y el más bajo (0.075) en el locus OarFCB304. Asimismo, el valor más alto de FST (0.228) fue observado en el locus ILSTS5 y el más bajo (0.056) en el locus OarJMP29. Las diferencias entre subpoblaciones evaluadas por medio de los valores multilocus de FST revelaron que, la mayor parte de la variación genética corresponde a diferencias entre

42


Rev Mex Cienc Pecu 2021;12(1):36-57

individuos dentro de las subpoblaciones (84.9%) y 15.1% resulta de las diferencias entre subpoblaciones.

Diversidad genética entre subpoblaciones Las medidas de la diversidad genética para cada subpoblación se muestran en el Cuadro 2. La diversidad genética más alta fue observada en la subpoblación UNPA (49 alelos) y la más baja en la subpoblación IN-MOC (28 alelos), con un promedio global de 36.6 alelos por subpoblación. El MNA y NE mostraron promedios de 4.08 y 3.25, respectivamente, con valores más altos en la subpoblación UNPA (5.44 y 4.20, respectivamente) y valores más bajos en la subpoblación IN-MOC (3.11 y 2.46, respectivamente). Cuadro 2: Número de animales (n), número total de alelos (TNA), número medio de alelos (MNA), número efectivo de alelos (NE), heterocigosis observada (HO), heterocigosis esperada (HE) y coeficiente de endogamia dentro de la población (FIS) en 24 subpoblaciones de ovejas Pelibuey, basado en el análisis de nueve marcadores microsatélites Población IN-MOC IN-MAR CEIEGT CEPIPSA ITC UNPA COL-CORD UV BUAP COL-TEX UCOL Rancho San Alberto Rancho Garrido Rancho Belbesah Rancho Libertad Rancho Jalapa Rancho El Porvenir Rancho El Paraíso Rancho Santa Anita Posta El Cuatro Finca El Cielo Rancho La Fama Rancho El Carrizal Cuba Total/Promedio

Estado

n

TNA MNA

Yucatán Puebla Veracruz CdMx Yucatán Oaxaca Veracruz Veracruz Puebla Edo. México Colima Yucatán Yucatán Yucatán Yucatán Tabasco Tabasco Puebla SLP Jalisco Sinaloa Sinaloa BCS La Habana

5 5 5 5 5 5 5 5 5 5

28 30 30 30 36 49 37 37 37 43

5 5 5 5 5 4 5 5 5 6 5 5 4 5 119

36 38 38 39 43 32 37 34 31 44 38 39 36 37 36.6

NE

HO

HE

FIS

3.11 3.33 3.33 3.33 4.11 5.44 4.11 4.11 4.11 4.78

2.46 2.73 2.62 2.73 3.0 4.20 3.72 3.28 3.32 4.10

0.666 0.733 0.689 0.779 0.778 0.778 0.756 0.711 0.711 0.800

0.627 0.664 0.651 0.677 0.721 0.840 0.782 0.674 0.738 0.803

-0.071 -0.118* -0.064 -0.171* -0.089* 0.081 0.038 -0.062 0.041 0.003

4.0 4.22 4.22 4.33 4.89 3.56 4.11 3.78 3.44 4.89 4.22 4.33 4.0 4.11 4.08

3.10 3.47 3.20 3.58 3.89 2.92 3.32 2.77 2.82 3.45 3.40 3.60 3.26 3.27 3.25

0.733 0.711 0.689 0.733 0.711 0.694 0.733 0.733 0.689 0.685 0.711 0.733 0.694 0.779 0.726

0.709 0.733 0.751 0.758 0.812 0.706 0.733 0.686 0.699 0.735 0.746 0.787 0.778 0.738 0.731

-0.039 0.033 0.091* 0.036 0.138* 0.019 0.000 -0.077 0.015 0.075 0.051 0.076 0.122* -0.060 0.0072

INIFAP: Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias; CEIEGT: Centro de Enseñanza, Investigación y Extensión en Ganadería Tropical; CEPIPSA: Centro de Enseñanza, Investigación y Extensión en Producción y Salud Animal; COLPOS: Colegio de Postgraduados; BUAP: Benemérita Universidad Autónoma de Puebla. *Indica FIS diferente de cero (P˂0.05).

43


Rev Mex Cienc Pecu 2021;12(1):36-57

El promedio de la HO fue de 0.726. El valor más bajo se observó en la subpoblación INMOC (0.666) y el más alto en la subpoblación COL-TEX (0.800). El promedio de la HE fue 0.731. El valor más bajo se observó en la subpoblación IN-MOC (0.627) y el más alto en la subpoblación UNPA (0.840). Los valores promedio de FIS para cada subpoblación considerando todos los loci, variaron de -0.171 (CEPIPSA) a 0.138 (Rancho Libertad). Nueve de las 24 subpoblaciones analizadas (IN-MOC, ITC, UV, CEIEGT, IN-MAR, Rancho El Paraíso, CEPIPSA, UCOL y Cuba) mostraron valores negativos de FIS, las 15 subpoblaciones restantes tuvieron valores positivos. Seis subpoblaciones mostraron (Cuadro 2) un FIS diferente de cero (P<0.05) con valores positivos (Rancho Garrido, Rancho Libertad y Rancho El Carrizal) y negativos (ITC, IN-MAR y CEPIPSA). El análisis de alelos (Cuadro 3; final del escrito) reveló la presencia de nueve alelos privados (9.09% de los 99 alelos) distribuidos en siete subpoblaciones (29.1 % de los 24 rebaños). La subpoblación Posta El Cuatro mostró tres alelos privados y las subpoblaciones CEIEGT, COLPOS-CORD, Rancho San Alberto, Rancho Belbesah, Rancho Libertad y Rancho Jalapa un alelo privado. Los loci que contribuyeron con alelos privados fueron OarFCB304 (2), OarJMP29 (2), SRCRSP5 (2), MAF33 (2) y SRCRSP9 (1). Las frecuencias de alelos privados variaron desde 0.083 en la subpoblación Posta El Cuatro (iniciadores OarFCB304 y OarJMP29) hasta 0.400 en la subpoblación CEIEGT (iniciador SRCRSP9). El rebaño Pelibuey cubano no mostró alelos privados. A pesar que no se detectaron alelos compartidos por todas las subpoblaciones, se identificaron dos alelos (“110” y “150” de los loci OarCP34 y OarJMP29, respectivamente) que fueron compartidos por 23 subpoblaciones (95.83 %). El análisis de flujo génico (medido a través del Nm) puede apreciarse en el Cuadro 4 (final del escrito). El valor de Nm más alto se observó entre las subpoblaciones CEIEGT y CEPIPSA. De las 276 comparaciones de subpoblaciones posibles, 222 (80.43 %) mostraron un Nm mayor a 1; mientras que en 14 (5.07 %) el Nm fue mayor a 4. Para tratar de comprobar el aislamiento por distancia en las subpoblaciones, se llevó a cabo la prueba de Mantel (Figura 2). El resultado de este análisis mostró que, la diferenciación genética entre las subpoblaciones de oveja Pelibuey (medida mediante las distancias mínimas insesgadas de Nei) no tiene relación con las distancias geográficas entre las mismas (r= -0.062; P>0.05).

44


Rev Mex Cienc Pecu 2021;12(1):36-57

Figura 2: Relación entre los pares de las distancias genéticas mínimas insesgadas de Nei y distancias geográficas (r=-0.062; P>0.05).

Relaciones genéticas entre subpoblaciones y análisis de estructura poblacional Se realizó un PCA utilizando las frecuencias de los 99 alelos observados en la población. El PCA global se muestra en la Figura 3. Los primeros dos componentes principales explicaron el 30.21 % de la variación total. El primer eje contribuyó con el 17.04 % de la varianza y separa a los rebaños en dos clústeres, uno de ellos con las subpoblaciones INMOC, IN-MAR, CEIEGT, CEPIPSA e ITC. El segundo eje contribuyó con el 13.17 % de la varianza y separó a las subpoblaciones UCOL, COLPOS-CORD, Rancho el Paraíso, Universidad Veracruzana, ITC e IN-MAR.

45


Rev Mex Cienc Pecu 2021;12(1):36-57

Figura 3: Análisis de componentes principales entre subpoblaciones de oveja Pelibuey de México. Se incluyeron los dos primeros componentes

El análisis con el programa STRUCTURE reveló la presencia de dos poblaciones ancestrales (K), lo cual es consistente con el PCA. El primer grupo estuvo constituido por las subpoblaciones IN-MOC, IN-MAR, CEIEGT, CEPIPSA, e ITC (Figura 4). Si hipotéticamente se considerara una K=3 o K=4, se puede observar la formación de nuevos clústeres, pero las subpoblaciones del primer grupo permanecen constantes. Figura 4: Agrupamiento mediante el programa STRUCTURE de diferentes subpoblaciones de ovejas Pelibuey de México

Cada individuo está representado por una barra vertical, la cual generalmente se segmenta en varios colores. Los colores representan las proporciones de las poblaciones ancestrales (K=2, K=3, K=4) que componen el genoma individual. Las subpoblaciones están separadas por líneas negras.

46


Rev Mex Cienc Pecu 2021;12(1):36-57

Discusión Diversidad genética de la población entera

Este es el primer estudio sobre la caracterización de la oveja Pelibuey usando microsatélites. El promedio del NA fue de 11, un valor más bajo que los 14.27 alelos reportados por en un estudio que se realizó en 13 razas de ovejas colombianas usando 11 marcadores microsatélites(28), pero es muy similar al 10.96 reportado en nueve razas españolas, cubanas, mexicanas y africanas usando 26 marcadores microsatélites(29). El promedio del NE fue 3.25, el cual es más bajo que el 3.73 encontrado en cinco razas de ovejas chinas(30) y el 4.68 observado en razas de ovejas colombianas(28). Cuando se contemplaron todos los loci, el NA fue más alto que el NE, lo cual indica que los alelos se distribuyen de manera irregular en cada uno de los loci. Lo anterior puede ser causado por el aislamiento geográfico, selección o flujo de material genético entre subpoblaciones(31). La heterocigosis es un parámetro que refleja la diversidad genética en la población. Los valores promedio de HO y HE (0.726 y 0.732, respectivamente) fueron muy similares en todos los loci. Los valores concuerdan con lo observado en varias razas de ovejas de España, Cuba, México y África, en las que se registró un valor promedio de HE de 0.731(29). En otro estudio, se encontraron valores de HO y HE de 0.744 y 0.755, respectivamente, en varias razas de ovejas de Hungría(32). En cuatro de los nueve marcadores analizados (OarFCB304, ILSTS5, SRCRSP5 y MAF33) la HO fue más alta que la HE, sugiriendo un exceso de heterocigotos en las subpoblaciones analizadas. Los valores de PIC obtenidos en este estudio fueron superiores a 0.7, lo cual indica que los marcadores utilizados son apropiados para medir la diversidad genética. El valor promedio del índice de Shannon (2.1) fue similar al valor de 2.2 obtenido en 14 tipos de ovejas de Irán(33) y 2.38 reportado en 4 razas de ovejas nigerianas(34). Este resultado refleja la alta variabilidad genética de las subpoblaciones analizadas. Tres de los nueve marcadores mostraron una desviación del HWE: dos debido a una alta heterocigosis (OarFCB304 e ILSTS5) y uno (OarJMP29) debido a baja heterocigosis. Aunque la desviación del HWE puede tener implicaciones biológicas como la selección intensiva, endogamia, migración, mutación o un insuficiente número de muestras(35), también es probable que se deba a errores en el genotipificado(36). En el presente estudio, únicamente se observó desviación del HWE en 20 de las 216 pruebas exactas de Fisher, por lo que se decidió mantener todos los marcadores en los análisis subsecuentes. El valor de FIT observado (0.158) indica que hay una deficiencia global de individuos heterocigotos del 15.8 % en la población. Asimismo, a partir del valor de FST (0.151), se

47


Rev Mex Cienc Pecu 2021;12(1):36-57

deduce que el 15.1 % de la variación genética corresponde a diferencias entre subpoblaciones. Valores similares en ambos índices fueron encontrados en varias razas de ovejas, en donde se observaron valores de FIT y FST de 14.2 y 13.4 %, respectivamente(29). Por lo tanto, ambos valores indican que existe una diferenciación genética moderada entre los rebaños estudiados.

Diversidad genética entre subpoblaciones Los valores más altos de NA, MNA y NE correspondieron a las subpoblaciones UNPA, COL-TEX, Rancho Libertad y Posta El Cuatro. El alto grado de diversidad genética en esas subpoblaciones se puede atribuir a la introducción de nuevos individuos en las mismas, lo cual fue corroborado en los libros de registros de los rebaños. Asimismo, la Posta El Cuatro corresponde a una unidad destinada a la producción de ejemplares de registro de la raza Pelibuey. En los últimos años, los criadores de Pelibuey puro han logrado mejorar sustancialmente el desempeño productivo de los animales de la raza, recurriendo a los cruzamientos entre diferentes líneas de la misma. En el caso del Rancho Libertad, los altos valores de FIS (0.138) no apoyan lo anteriormente expuesto. Sin embargo, este resultado puede atribuirse al reducido tamaño de muestra de la subpoblación. Los valores más bajos de NA, MNA y NE fueron observados en las subpoblaciones IN-MOC, IN-MAR, CEIEGT y CEPIPSA, lo cual podría deberse a que esas subpoblaciones pertenecen a institutos de investigación y universidades, los cuales se han conservado como núcleos cerrados que no han permitido la introducción de nuevos animales. Por lo tanto, es de esperarse que ellos tengan una mejor conservación del material genético original de la raza. Los valores negativos de FIS confirman que en esos rebaños se sigue una política de apareamientos de mínima consanguinidad. Los valores de HO (0.726) y HE (0.731) obtenidos en este estudio, fueron más altos que los encontrados en un rebaño de Pelibuey en Querétaro, México, en el que se observaron valores de 0.652 y 0.659 para HO y HE, respectivamente(29). Asimismo, en un rebaño de Pelibuey colombiana se estimaron valores para HO y HE de 0.72 y 0.71, respectivamente(28). Los altos valores globales obtenidos de HO y HE podrían atribuirse a que se analizaron varias subpoblaciones, en contraste con los otros estudios en los cuales sólo un rebaño estuvo involucrado. El valor total de FIS fue de 0.0072, sin embargo, en nueve subpoblaciones (IN-MOC, UV, Rancho El Paraíso, IN-MAR, ITC, UCOL, CEIEGT, CEPIPSA y Cuba) el valor de FIS fue negativo, sugiriendo un exceso de heterocigotos. En las subpoblaciones restantes, los valores de FIS fueron positivos, lo cual significa que tuvieron una deficiencia de heterocigotos. Lo anterior concuerda con los valores de heterocigosis, ya que, en las mismas subpoblaciones, los valores de HO fueron más altos que los de HE. Estudios previos en ovejas Pelibuey reportaron valores de FIS de 0.023(29) y 0.02(28), indicando una deficiencia ligera de heterocigotos. La presencia en este estudio de rebaños con valores negativos de FIS es explicada por la ausencia de endogamia, valores de heterocigosis altos y baja presión de selección, como ha sido señalado en otros estudios(33). Los altos 48


Rev Mex Cienc Pecu 2021;12(1):36-57

valores de FIS en el Rancho Garrido, Rancho Libertad y Rancho El Carrizal indican deficiencia de heterocigotos, lo cual es comúnmente atribuido a selección y endogamia(37). En las poblaciones de animales domésticos, la endogamia es un hallazgo común debido a las fallas en los programas reproductivos y que se trata de poblaciones relativamente pequeñas. Asimismo, la cantidad tan pequeña de individuos muestreados por subpoblación también pudo contribuir a tal estimación en esas subpoblaciones. Los alelos privados se definen como aquellos que se presentan en una sola población (en el presente estudio, subpoblación). Nueve alelos privados fueron detectados en seis de las subpoblaciones estudiadas. La subpoblación con mayor número de alelos privados fue Posta El Cuatro, con 3. Las subpoblaciones CEIEGT, COLPOS-CORD, Rancho San Alberto, Rancho Belbesah, Rancho Libertad y Rancho Jalapa mostraron un alelo privado. A excepción del alelo “95” (subpoblación CEIEGT, locus SRCRSP9) que tuvo una frecuencia de 0.400, los otros alelos privados mostraron frecuencias relativamente bajas (0.083-0.125), lo que indica que tienen más riesgo de desaparecer si esto no se toma en cuenta en los programas reproductivos. Los alelos privados con frecuencias más altas indican que una población es única y tiene cierto grado de aislamiento(38), lo cual es compatible con la historia reciente del rebaño CEIEGT, que se ha comportado como un núcleo cerrado, evitando la entrada de material genético nuevo. Además, el valor negativo de FIS (-0.064) descarta la posibilidad que la alta frecuencia del citado alelo se deba a un proceso de endogamia. La presencia de alelos privados con bajas frecuencias dentro de las subpoblaciones analizadas pudiera deberse a eventos de mutación relativamente recientes(39). Los microsatélites tienen tasas de mutación altas que van de 10-6 a 1x10-2(40), lo que hace posible la aparición eventual de una mutación en el rango de 1/1,000,000-1/100 individuos/generación. Además, los alelos privados también pueden deberse al alto flujo genético entre subpoblaciones(41). Lo anterior, es apoyado por el valor global de FST (0.151) observado en el presente trabajo, que indica la presencia de flujo génico moderado entre las subpoblaciones. El análisis de alelos privados no permitió diferenciar la subpoblación cubana de los rebaños nacionales. Al respecto, se debe considerar que al introducir la raza Pelibuey a México, se estableció un efecto fundador en el que únicamente se seleccionaron unos cuantos ejemplares de la población total de la raza que en ese momento existía en Cuba. En los ejemplares de Pelibuey introducidos a México, la deriva génica jugó un papel muy importante en la extinción o fijación de los alelos disponibles. Asimismo, las mutaciones pudieron contribuir de manera importante a la aparición de nuevos alelos dentro del rebaño recién formado. Por lo tanto, cabría esperar una diferencia sustancial entre la diversidad genética de los rebaños mexicanos y el rebaño cubano. Sin embargo, en el presente trabajo se observó que el rebaño cubano comparte sus alelos con los rebaños mexicanos. Lo anterior puede atribuirse a que la población cubana analizada estuvo constituida únicamente por cinco individuos, constituyendo una muestra mínima de la diversidad genética actual. Por lo tanto, en el presente trabajo, no se pudo establecer una 49


Rev Mex Cienc Pecu 2021;12(1):36-57

comparación objetiva entre ambas subpoblaciones y los resultados únicamente deben ser considerados como indicativos. Al analizar los alelos compartidos por las subpoblaciones, no se logró identificar alelos con presencia en todas ellas. Sin embargo, los alelos “110” y “150”, correspondientes a los loci OarCP34 y OarJMP29 se encontraron en 23 de las 24 subpoblaciones analizadas, estando ausentes únicamente en las subpoblaciones UV y Rancho Belbesah, respectivamente. Por lo tanto, en estudios posteriores, se recomienda enfocar la atención en dichos alelos con el fin de determinar si pueden ser utilizados como marcadores de la raza Pelibuey. El análisis de flujo génico medido a través del Nm mostró que las subpoblaciones con mayor flujo génico entre ellas son CEIEGT y CEPIPSA (Nm= 16.39), lo cual concuerda con el libro de registros de tales rebaños, ya que pertenecen a la Universidad Nacional Autónoma de México (UNAM) y desde hace algunos años de manera regular, en el CEPIPSA se han introducido sementales provenientes del CEIEGT. Asimismo, el análisis del Nm confirmó que en el 80.43 % de los pares de subpoblaciones, el valor obtenido fue superior a uno, mientras que el 5.07 % de los pares de subpoblaciones, alcanzó valores superiores a cuatro. Los valores de Nm menores a uno, indican que el flujo génico no es suficiente para contrarrestar la diferenciación causada por la deriva génica entre las subpoblaciones, por lo que éstas tienden a diferenciarse, mientras que valores superiores a uno impiden la diferenciación de las mismas. En cambio, si el Nm es mayor a 4, las subpoblaciones se comportan como una población panmíctica(42). Lo anterior es apoyado por el valor global de FST (0.151), el cual indica un flujo génico moderado entre las subpoblaciones. La correlación entre las distancias genéticas y geográficas no resultó significativa, lo que permite deducir que la estructura genética de los rebaños de Pelibuey analizados no se ajusta a un modelo de aislamiento por distancia entre subpoblaciones. Lo anterior puede atribuirse al flujo de ejemplares de la raza Pelibuey a lo largo de todo el territorio de México.

Relaciones genéticas entre subpoblaciones y análisis de estructura poblacional El PCA mostró que el primer componente separó a las subpoblaciones IN-MOC, INMAR, CEIEGT, CEPIPSA e ITC, del resto. Este resultado se esperaba ya que esas subpoblaciones pertenecen a institutos de investigación y universidades, donde el objetivo primario es la investigación y la conservación de la raza. Lo anterior fue comprobado previamente al mostrar valores de FIS negativos, que indican alta heterocigosis. Por el contrario, el segundo grupo estuvo compuesto por rebaños que pertenecen a otras universidades e institutos de investigación (BUAP, COL-TEX, COLCOR, UCOL, y UNPA), todos los productores particulares y el rebaño de Cuba. La

50


Rev Mex Cienc Pecu 2021;12(1):36-57

divergencia del segundo grupo probablemente se deba al flujo de individuos que actualmente ocurre entre las subpoblaciones de Pelibuey en México, lo cual es apoyado por el valor de FST moderado (0.151) y por la gran proporción de pares de subpoblaciones que tienen un Nm superior a uno. Actualmente, las biotecnologías reproductivas como la transferencia de embriones e inseminación artificial han permitido un mejoramiento genético más rápido(8). Tales tecnologías y el flujo de individuos de una unidad productiva a otra (principalmente sementales) probablemente hayan causado que la diversidad genética original de la oveja Pelibuey se haya modificado sustancialmente en los últimos años. Asociado a esto, actualmente ha aumentado de manera importante la mezcla con otras razas, provocando una mayor divergencia, ante lo cual, se tendrían que realizar estudios exhaustivos para tratar de comprobar la erosión genética de la raza. El segundo componente del PCA, separó a las subpoblaciones UCOL, COLPOS-CORD, Rancho el Paraíso, Universidad Veracruzana, ITC e IN-MAR. Estas subpoblaciones pertenecen tanto a centros de investigación y universidades como a productores particulares. Aunque es difícil explicar, este agrupamiento de subpoblaciones puede deberse a los manejos particulares a los que han sido sometidos los rebaños en años recientes. Por ejemplo, los rebaños UCOL e IN-MAR han reducido dramáticamente su población, en cambio, Rancho El Paraíso ha comenzado a introducir material genético nuevo. El análisis con el programa STRUCTURE sugiere que todas las subpoblaciones de Pelibuey en México se originaron a partir de dos poblaciones ancestrales, las cuales han divergido como resultado de varios años de adaptación a diferentes ambientes y manejos a los cuales han sido sujetas. Asimismo, cada una de las subpoblaciones muestra una mezcla en mayor o menor grado de ambos clústeres. Las subpoblaciones IN-MOC, INMAR, CEIEGT, CEPIPSA e ITC, se agruparon en un clúster, al igual que en el PCA (primer componente). La relación entre las subpoblaciones nacionales de referencia y los otros rebaños se confirmó mediante el análisis de alelos compartidos mencionado previamente. Asimismo, el análisis con STRUCTURE muestra bajos niveles de mezcla entre las subpoblaciones de este clúster con las del otro clúster. También, se confirma que en esas subpoblaciones el objetivo primario ha sido la investigación y la conservación de la raza. Si hipotéticamente se considerara una K=3 o K=4, es posible observar que las subpoblaciones IN-MOC, IN-MAR, CEIEGT, CEPIPSA e ITC se siguen agrupando juntas. Esto permite concluir que esas subpoblaciones tienen el material genético más preservado.

Conclusiones e implicaciones Las subpoblaciones de oveja Pelibuey aquí estudiadas muestran alta diversidad genética y diferenciación genética entre ellas. El análisis de componentes principales, así como el de estructura de población permiten concluir que las subpoblaciones IN-MOC, IN-MAR, CEIEGT, CEPIPSA e ITC tienen el material genético más preservado. Este resultado hace

51


Rev Mex Cienc Pecu 2021;12(1):36-57

posible recomendar el uso de animales de esas subpoblaciones para implementar programas nacionales para la conservación de la raza Pelibuey. Durante la realización del estudio, se observó que a pesar del gran valor de la oveja Pelibuey en el desarrollo de la ovinocultura y en la investigación, existen rebaños como IN-MAR y UCOL en los cuales se ha reducido el número de individuos, por lo que están en peligro de desaparecer. Actualmente existen grupos de investigadores y organizaciones en México como la Unidad Nacional de Ovinocultores, los cuales han reconocido la importancia que la oveja Pelibuey representa en la ovinocultura nacional, y mediante esfuerzos individuales han tratado de contribuir a su conservación. Se requiere de un plan integral para la conservación de la raza, que garantice la preservación de su material genético. Asimismo, se recomienda realizar estudios más profundos para determinar si realmente existe erosión genética de la oveja Pelibuey en México. Agradecimientos El trabajo de investigación fue soportado financieramente por el proyecto PAPIIT 28RN219115. Los autores agradecen a todos y cada uno de los encargados y dueños de los rebaños que fueron incluidos en el presente estudio y en especial al MC. Octavio Rojas del INIFAP Mocochá. Literatura citada: 1. Berruecos VJM, Valencia ZM, Castillo RH. Genética del borrego Tabasco o Peligüey. Téc Pecu 1975;29:59-65. 2. Montalvo MP, Romualdo MJG, Sierra VA, Ortiz OJ, Hernández ZJ, Medrano HA. El ovino Pelibuey en el trópico mexicano. En: Delgado BJV, Nogales BS editores. Biodiversidad ovina iberoamericana. Caracterización y uso sustentable. España, Universidad de Córdoba. Servicio de Publicaciones 2009:363-375. 3. Aguilar-Martínez CU, Berruecos-Villalobos JM, Espinoza-Gutiérrez B, Segura-Correa JC, Valencia-Méndez J, Roldán-Roldán A. Origen, historia y situación actual de la oveja Pelibuey en México. Trop Subtrop Agroecosys 2017;20(3):429-439. 4. Arteaga CJD. Diagnóstico actual de los ovinos en México. En: Memorias del 8 Congreso Mundial de la Lana y el Cordero. Asociación Mexicana de Criadores de Ovinos. Querétaro, Qro.2007:9-12. 5. Magaña-Monforte JG, Huchin-Cab M, Ake-López RJ, Segura-Correa JC. A field study of reproductive performance and productivity of Pelibuey ewes in southeaster Mexico. Trop Anim Health Prod 2013;45(8):1771-1776. 6. Valencia J, Porras A, Mejía O, Berruecos JM, Trujillo J, Zarco L. Actividad reproductiva de la oveja Pelibuey durante la época de anestro: influencia de la presencia del macho. Rev Científica FCV-LUZ 2006;16(2):136-141.

52


Rev Mex Cienc Pecu 2021;12(1):36-57

7. Arredondo-Ruiz V, Macedo-Barragán R, Molina-Cárdenas J, Magaña-Álvarez AJ, Prado-Rebolledo O, García-Márquez LJ, Herrera-Corredor A, Lee-Rangel H. Morphological characterization of Pelibuey sheep in Colima, México. Trop Anim Health Prod 2013;45(4):895-900. 8. Taberlet P, Valentini A, Rezaei HR, Naderi S, Pompanon F, Negrini R, AjmoneMarsan P. Are cattle, sheep and goats endangered species? Mol Ecol 2008;17(1):275-284. 9. Organización de las Naciones Unidas para la Alimentación y la Agricultura (FAO). The second Report on the State of the World’s Animal Genetic Resources for Food and Agriculture. Scherf BD, Pilling D (eds). FAO Commission on Genetic Resources for Food and Agriculture Assessments. Rome 2015. 10. Organización de las Naciones Unidas para la Alimentación y la Agricultura (FAO). Molecular genetic characterization of animal genetic resources. FAO Animal Production and Health Guidelines. No. 9. Roma 2011. 11. Bailes SM, Devers JJ, Kirby JD, Rhoads DD. An inexpensive, simple protocol for DNA isolation from blood for high-throughput genotyping by polymerase chain reaction or restriction endonuclease digestion. Poult Sci 2007;86(1):102-106. 12. Roldán RA. Identificación de ovejas Pelibuey con actividad reproductiva continua mediante polimorfismos de ADN [tesis maestría]. México, D. F.: Universidad Nacional Autónoma de México; 2015. 13. International Society for Animal Genetics (ISAG). Panel of markers for parentage verification tested 2001/02 ISAG comparison test. 2002. 14. Yeh FC, Yang RC, Boyle T. POPGENE version 1.31. Microsoft Windows based freeware for population genetic analysis, University of Alberta and the Centre for International Forestry Research, Edmonton, 1999. 15. Goudet J. FSTAT, a program to estimate and test gene diversities and fixation indices F-statistics. Version 2.9.3. 2001. Disponible en: http://wwww.unil.ch/izea/softwares/fstat.html. 16. Kalinowsky ST, Taper ML, Marshall TC. Revising how the computer program CERVUS accommodates error increases success in paternity assignment. Mol Ecol 2007;16(5):1099-1106. 17. Raymond M, Rousset F. GENEPOP (version 1.2) population genetics software for exact test and ecumenicism. J Hered 1995;86(3):248-249. 18. Rousset F. Genepop’007: a complete reimplementation of the GENEPOP software for Windows and Linux. Mol Ecol Resour 2008;8(1):103-106.

53


Rev Mex Cienc Pecu 2021;12(1):36-57

19. Peakall R, Smouse PE. GENALEX 6: a genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 2006;6:288-295. 20. Peakall R, Smouse PE. GenAlEx 6.5: genetics analysis in Excel. Population software for teaching and research-an update. Bioinformatics 2012;28(19):2537-2539. 21. Belkhir K, Borsa P, Chikhi L, Raufaste N, Bonhomme F. GENETIX 4.05, logiciel sous WindowsTM pour la génetique des populations. Laboratoire Génome. Populations, Interactions, CNRS UMR 5000, Université de Montpellier II, Montpellier (France) 1996-2004. 22. Mantel N. The detection of disease clustering and a generalized regression approach. Cancer Res 1967;27(2):209-220. 23. Nei M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 1978;89(3):583-590. 24. Goudet J. PCAGEN. Principal component analysis of gene frequency data (version 1.2). Lausanne, Switzerland: Population Genetics Laboratory, University of Lausanne. 1999. 25. Pritchard JK, Stephens M, Donnelly P. Inference of populations structure using multilocus genotype data. Genetics 2000;155(2):945-959. 26. Earl DA, VonHoldt BM. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Resour 2012;4(2):359-361. 27. Kopelman NM, Mayzel J, Jakobsson M, Rosenberg NA, Mayrose I. CLUMPAK: a program for identifying clustering modes and packaging populations structure inferences across K. Mol Ecol Resour 2015;15(5):1179-1191. 28. Ocampo R, Cardona H, Martínez R. Genetic diversity of Colombian sheep by microsatellite markers. Chil J Agric Res 2016;76(1):40-47. 29. Álvarez I, Capote J, Traouré A, Fonseca N, Pérez K, Cuervo M, Fernández I, Goyache F. Genetic relationships of the Cuban hair sheep inferred from microsatellite polymorphism. Small Ruminant Res 2012;104(1-3):89-93. 30. Sun W, Chang, H, Tsunoda K, Musa H, Ma Y, Guan W. Analysis of geographic and pairwise genetic distances among sheep populations. Biochem Genet 2010;48(56):376-384. 31. Qu D, Yang Z, Guo X, Mao Y, Sun W, Gen R et al. Study of polymorphisms of microsatellite DNA of six Chinese indigenous sheep and goat breeds. Front Agr China 2007;1(4):472-477.

54


Rev Mex Cienc Pecu 2021;12(1):36-57

32. Neubauer V, Volg C, Seregi J, Sáfar L, Brem G. Genetic diversity and population structure of Zackel sheep and other Hungarian sheep breeds. Arch Anim Breed 2015;58:343-350. 33. Taghi VEM, Mhammadabadi M, Esmailizadeth A. Using microsatellite markers to analyze genetic diversity in 14 sheep types in Iran. Arch Anim Breed 2017;60:183189. 34. Agaviezor BO, Peters SO, Adefenwa MA, Yakubu A, Adebambo OA, Ozoje MO et al. Morphological and microsatellite DNA diversity of Nigerian indigenous sheep. J Anim Sci Biotechnol 2012;3(1):38. 35. Usha AP, Simpson SP, Williams JL. Probability of random sire exclusion using microsatellite markers for parentage verification. Anim Genetic 1995(26):155-161. 36. Morin PA, Leduc RG, Archer FI, Martien KK, Huebinger R, Bickham JW, Taylor BL. Significant deviations from Hardy-Weimberg equilibrium caused by low levels of microsatellite genotyping errors. Mol Ecol Res 2009;9(2):498-504. 37. Bhatia S, Arora R. Genetic diversity in Kheri-A pastarolist developed Indian sheep using microsatellite markers. Indian J Biotechnol 2008;7(1):108-112. 38. Dalvit C, De Marchi M, Zanetti E, Cassandro M. Genetic variation and population structure of Italian native sheep breeds undergoing in situ conservation. J Anim Sci 2009;87(12):3837-3844. 39. Konzen ER, Martins MP. Contrasting levels of genetic diversity among populations of the endangered tropical palm Euterpe edulis. CERNE 2017;23(1):31-42. 40. Schlötterer C. Evolutionary dinamics of microsatellite DNA. Chromosoma 2000;109(6):365-371. 41. Slatkin M. Gene flow in natural populations. Annu Rev Ecol Syst 1985;16(1):393430. 42. Piñero D, Barahona A, Eguiarte L, Rocha OA, Salas LR. La variabilidad genética de las especies: aspectos conceptuales y sus aplicaciones y perspectivas en México. In: Sarukhán KJ et al. (editores). Capital natural de México, vol. I: Conocimiento actual de la biodiversidad. CONABIO, México, D. F. CONABIO 2009:603-649.

55


Rev Mex Cienc Pecu 2021;12(1):36-57

Cuadro 3: Alelos privados y alelos compartidos en 24 subpoblaciones de oveja Pelibuey caracterizadas genéticamente con nueve marcadores microsatélites Alelos privados Número AP (% de SP)

SP con AP Alelos (frecuencia)

Alelos compartidos Alelo más compartido Número de SP (%) Alelo menos compartido Número de SP (%) Media de SP con AC (%)

OarCP34

OarFCB304

OarJMP29

OarJMP58

DYMS1

ILSTS5

SRCRSP5

SRCRSP9

MAF33

0 (0)

2 (4.33)

2 (8.33)

0 (0)

0 (0)

0 (0)

2 (8.33)

1 (4.17)

2 (8.33)

Posta El Cuatro 140 (0.083) 210 (0.083)

Rancho Libertad 170 (0.100) Posta El Cuatro 180 (0.083)

COLPOSCORD 172 (0.100) Rancho Jalapa 200 (0.125)

CEIEGT 95 (0.400)

San Alberto 170 (0.100) Rancho Belbesah 160 (0.100)

110 23 (95.83)

164 15 (62.5)

150 23 (95.83)

135 16 (67.5)

175/200 16/16 (66.7/66.7)

225 19 (79.17)

152 17 (70.83)

125 14 (58.3)

120 18 (75)

100 2 (8.33)

150 7 (29.17)

110/140 3/3 (12.5/12.5)

177/185 2/2 (8.33/8.33)

225 (4) 16.67

180 3 (12.5)

154 2 (8.33)

135 5 (20.8)

155 5 (20.83)

11 (45.8)

10.3 (42.8)

9 (37.5)

7.36 (30.7)

10.91 (45.45)

9.89 (44.79)

7.42 (33.3)

9.2 (38.3)

8.18 (34.1)

AP= alelos privados; SP= subpoblación, AC= alelos compartidos.

56


Rev Mex Cienc Pecu 2021;12(1):36-57

Cuadro 4: Flujo génico medido a través del número de migrantes (Nm) entre pares de subpoblaciones de ovejas Pelibuey en México * La numeración de las subpoblaciones sigue el mismo orden que el Cuadro 2.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

1 ― 3.13 2.56 2.62 1.66 2.15 0.94 0.81 0.79 1.12 0.65 1.17 1.06 1.16 1.18 1.04 0.82 0.59 0.90 0.91 1.54 1.13 0.80 1.33

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

― 1.73 1.83 2.34 1.42 1.05 0.77 0.80 1.07 0.93 1.09 0.92 1.13 1.36 1.09 0.73 0.98 0.91 0.95 1.19 1.06 0.87 1.12

― 16.39 1.29 1.48 0.87 0.82 0.96 1.18 0.71 1.29 1.04 1.32 1.56 1.98 0.93 0.73 1.16 1.18 1.43 1.28 0.86 1.06

― 2.25 1.62 0.92 1.21 1.13 1.22 0.78 2.13 1.19 1.36 1.93 1.79 1.05 0.80 1.29 1.14 1.99 1.66 0.87 1.29

― 2.10 1.74 1.49 1.04 1.21 1.39 1.11 1.05 1.26 1.40 1.07 0.94 1.37 0.85 1.18 1.55 1.53 0.97 1.17

― 5.40 1.40 2.23 4.17 2.56 2.39 2.19 3.05 2.40 1.73 8.18 1.25 1.54 1.78 7.73 2.59 2.81 2.35

― 1.41 1.90 2.08 2.41 1.16 1.36 1.68 2.24 1.17 1.87 1.53 0.93 1.31 1.77 1.48 2.01 1.14

― 1.35 1.07 0.80 0.81 0.90 1.04 1.31 0.82 0.84 0.73 0.70 1.07 1.08 1.87 0.99 0.89

― 2.20 1.26 1.17 1.37 1.31 2.20 1.08 1.99 0.98 1.31 2.38 1.28 1.77 2.68 1.25

― 1.55 1.91 2.64 2.14 6.43 1.49 2.41 1.30 1.53 1.49 1.73 3.37 3.79 2.55

― 1.00 1.45 1.45 1.37 0.84 3.81 1.28 0.93 1.07 0.97 1.34 1.32 0.90

― 1.92 1.91 4.34 1.87 1.52 0.86 2.53 1.47 2.25 1.53 1.62 1.56

― 3.40 3.91 1.90 5.12 1.29 2.08 2.25 1.69 7.85 4.54 2.51

― 5.53 1.92 3.14 1.16 1.80 1.81 3.15 3.07 2.36 1.86

― 5.41 1.81 1.34 2.50 2.21 2.89 9.46 5.72 2.75

― 1.18 0.81 2.38 1.78 2.47 2.05 1.93 1.62

― 1.12 1.13 1.71 1.41 2.14 1.93 1.26

― 0.75 0.86 0.96 1.05 0.99 0.96

― 2.12 1.78 1.42 2.30 1.75

― 1.65 2.73 1.77 1.37

― 2.52 1.44 2.18

― 2.41 1.94

― 1.55

57


https://doi.org/10.22319/rmcp.v12i1.5109 Artículo

Diversidad genética de gallinas criollas en valles centrales de Oaxaca usando marcadores microsatélites

Héctor Luis-Chincoya a José Guadalupe Herrera-Haro a Amalio Santacruz-Varela b* Martha Patricia Jerez-Salas c Alfonso Hernández-Garay a

a

Colegio de Postgraduados., Campus Montecillos. Recursos Genéticos y ProductividadGanadería. Texcoco, México. b

Colegio de Postgraduados. Campus Montecillos. Recursos Genéticos y ProductividadGenética. Texcoco, México. c

Instituto Tecnológico del Valle de Oaxaca. Xoxocotlán, Oaxaca, México.

*

Autor de correspondencia: asvarela@colpos.mx

Resumen: Las poblaciones de gallinas criollas en explotaciones en pequeña escala poseen una gran diversidad y son parte del reservorio genético avícola en México; además, constituyen una importante fuente de proteína para las familias del medio rural. Con el propósito de conocer la variabilidad genética de poblaciones de gallinas criollas en la región central de Oaxaca, se tomaron muestras de sangre de 109 gallinas criollas, provenientes de 17 poblaciones y de 30 gallinas Plymouth Rock como testigos. Se usaron 10 marcadores de tipo microsatélites, con los que se detectó un total de 109 alelos, con 10.9 ± 3.1 alelos por locus en promedio. La heterocigosidad observada (Ho) varió de 0.575 (San Lucas) a 0.750 (San Antonino 2) y la esperada (He) de 0.625 (Testigo) a 0.733 (Huixtepec 2). A nivel general se encontró un incremento en el número de heterocigotos evidenciado por un nivel de endogamia global 58


Rev Mex Cienc Pecu 2021;12(1):58-71

(FIT) de 0.042; el índice FST de diferenciación entre poblaciones fue moderado (0.059) y la endogamia de individuos dentro de poblaciones (FIS) resultó negativa (-0.017), lo que indica un exceso de heterocigotos a ese nivel. El análisis de conglomerados agrupó a las poblaciones de Nazareno, ITVO, San Lucas y San Antonio, evidenciando que son poblaciones de gallinas criollas aisladas y diferenciadas genéticamente en algunas características. Esta información es importante para diseñar futuros programas de conservación, selección y multiplicación de esta especie a nivel de traspatio en la región central de Oaxaca, México. Palabras clave: Aves locales, SSR, Diversidad genética, Recursos zoogenéticos.

Recibido:16/10/2018 Aceptado: 03/02/2020

Introducción El desarrollo de sistemas de producción avícola intensivos, altamente eficientes y rentables, aunado a la exigencia del mercado de productos de buena calidad y uniformes en la carne y huevo, propicia la incorporación de razas especializadas con alto rendimiento en estas características, provocando la disminución y erosión genética de los genotipos locales, denominados “criollos” por la disminución de su tamaño efectivo de población(1). Estos genotipos criollos son explotados en forma rústica en unidades de producción de menor escala, adaptados al clima y a sistemas de producción de bajos insumos, en condiciones de bienestar y tolerantes a enfermedades(2), además de formar parte del patrimonio cultural de las comunidades rurales. Por ello, la FAO(3) señala la importancia que tiene para la humanidad la identificación y conservación de las gallinas locales dándoles atención especial a su mejora y conservación(4), las cuales por su diversidad biológica presentan cambios continuos debido a los procesos de selección natural y migración. Los microsatélites son marcadores moleculares para evaluar la variabilidad genética a nivel de ADN, basados en repeticiones en tándem de una a seis bases y estos son ampliamente utilizados por su distribución al azar en el genoma, alto polimorfismo y herencia codominante(5,6). Mediante esta técnica se obtienen estadísticas genéticas descriptivas como heterocigosidad, distancia genética, número de alelos efectivos y contenido de información polimórfica de los marcadores entre poblaciones estrechamente relacionadas. En México, los estudios realizados en la avicultura en pequeña escala con gallinas criollas, que aportan información sobre su diversidad genética basada en marcadores moleculares son escasos. En consecuencia, surge la necesidad de identificar las poblaciones avícolas 59


Rev Mex Cienc Pecu 2021;12(1):58-71

existentes y desarrollar programas para su mejora y conservación que beneficien a los productores que viven en zonas rurales(7). El objetivo de la investigación fue determinar la diversidad genética de poblaciones de gallinas criollas en la región de Valles Centrales, Oaxaca.

Material y métodos Toma de muestras La colección de muestras se realizó durante enero-diciembre de 2015, se utilizó un muestreo probabilístico por conglomerados en dos etapas(8). Las unidades primarias las constituyeron los siete distritos y como unidades secundarias las unidades de producción (UP) dentro de los distritos. Se escogió una muestra de tres unidades primarias (n) y dentro de las unidades primarias se eligieron aleatoriamente un total de 17 unidades secundarias. En cada unidad secundaria (UP) se eligieron 6 gallinas, constituyendo un tamaño de muestra total de 109 gallinas adultas de las cuales: 93 gallinas criollas adultas, en primera etapa de postura, con peso promedio de 2.0 kg, 16 gallos adultos. El inventario estimado de gallinas adultas fue de 2,004 animales para la región de Valles Centrales, lo que constituyó el 6 % de la población muestreada. El tamaño de muestra fue obtenido con una precisión del 10 % y confiabilidad del 90 %. El muestreo fue distribuido en seis núcleos geográficos (ITVO: Nazareno e Itvo; Cuilápam: San Antonio, San Lucas y Cuilápam; Etla: San Juan y Suchilquitongo; Huixtepec: Huixtepec 1, 2, 3 y 4; Ocotlán: Chichicapam, San Antonino 1 y 2; y Tlacolula: Teotitlán, Totolapam 1 y 2, más un Testigo de gallinas Plymouth Rock. A cada animal de la vena cubital del ala se le extrajeron 2 ml de sangre, enseguida la sangre se depositó en tubos vacutainer con anticoagulante EDTA, conservándose a una temperatura de -20 °C hasta su procesamiento en el laboratorio.

Extracción de ADN, marcadores microsatélites y procedimiento de PCR El ADN se extrajo con el kit comercial ChargeSwitch® gDNA Plant Kit (Invitrogen), usando el protocolo del proveedor. La cuantificación del ADN se realizó con un espectrofotómetro de ultra-bajo volumen (NanoDrop 2000, Thermo Scientific, Wilmington, DE, USA) ajustando las concentraciones de ADN a 10 ng μl-1. Se utilizaron 10 pares de iniciadores de microsatélites para evaluar diversidad genética (Cuadro 1) reportados previamente(9-11). Los iniciadores se marcaron con las etiquetas fluorescentes (6-FAM, HEX o ROX) en el extremo 5’ para su detección por PCR múltiplex.

60


Rev Mex Cienc Pecu 2021;12(1):58-71

Cuadro 1: Descripción de los iniciadores de los loci de microsatélites utilizados, temperatura de alineamiento (Tm), tamaño de fragmento esperado Tm Tamaño (°C) (pb) 53.6 273 a 314

Iniciador

Secuencia 5' - 3'

MCW32-F MCW32-R MCW68-F MCW68-R MCW94-F MCW94-R MCW95-F MCW95-R MCW114F MCW114R MCW131F MCW131R MCW134F MCW134R MCW135F MCW135R MCW145F MCW145R MCW158F MCW158R

AGTTCCTTGTACAATTGTTA TCATTACTAGTACAATCAAGATGG CCTCACTGTGTAGTGTGGTAGTCA 62 GAGAAGCTTGAACCTACCAGTCTT GGAGCTGGTATTTGTCCTAAG 53.6 GCACAGCCTTTTGACATGTAC GATCAAAACATGAGAGACGAAG 62 TTCATAGCTTGAATTGCATAGC 62 AGCAAACTGCTCAGTGCTGTG

171 a 193 77 a 95 72 a 91

Referencia b c a a

261 a 293 c

GCGTTGAAAGTAGTGCTTCCG 53.6 195 a 217 GTTGCTGATTCTAAGGCAGGC

c

TTGCAGTTGTAAAGGTGTAGC 62

260 a 284

GGAGACTTCATTGTGTAGCAC

b

ACCAAAAGACTGGAGGTCAAC 62

124 a 150

ATATGCTGCAGAGGGCAGTAG

a

CATGTTCTGCATTATTGCTCC 62

164 a 212

ACTTTATTCTCCAAATTTGGCT

b

AAACACAATGGCAACGGAAAC 53.6 164 a 224 GATCCATTTATAAAGACCCCAC TTCAATACTCCTTTGTAAAGCA a: Crooijmans et al. (1996); b: Yu et al. (2006); c: Horbańczuk et al. (2007).

61

a


Rev Mex Cienc Pecu 2021;12(1):58-71

El procedimiento de PCR constó de un volumen total de 25 µl que contenían: 5 µl de Buffer 5X (Promega), 2 µl a 25 mM de MgCl2 (Promega), 0.5 µl mezcla de DNTPs (Promega) a 2 mM, 1 µl de cada iniciador (5 pmol), 1U de Taq polimerasa (Promega) y 1 µl de ADN molde (10 ng µl-1). La amplificación se realizó en un termociclador (Bio-Rad C1000TM) con las siguientes condiciones: desnaturalización inicial a 94 °C por 5 min, seguido de 35 ciclos de desnaturalización de 94 °C por 45 seg, alineación para grupos de iniciadores a 53.6 °C, 56.6 °C y 62 °C durante 1 min, una extensión de 72 °C por 1 min, y una extensión final a 72 °C durante 10 min. Los productos de PCR fueron separados por electroforesis capilar en un secuenciador automático de ADN (Genetic Analyzer ABI-3130 Applied Biosytems, Foster City, CA, USA) y analizados con el programa GeneMapper® de Applied Biosystems.

Análisis estadístico

Con base en el perfil alélico determinado en cada individuo para cada locus, se calcularon las frecuencias alélicas, heterocigosidad observada (Ho) y heterocigosidad esperada (He), así como el equilibrio Hardy-Weinberg. Con base en el grado de diferenciación genética de las poblaciones, se estimó con los estadísticos F de Wright (FIS; FIT y FST), considerando como criterio de agrupación los núcleos geográficos de origen de los individuos, para definir los parámetros de diversidad genética, se usó el programa POPGENE (Versión 1.3.2). Adicionalmente con las frecuencias alélicas de cada loci de las poblaciones, se realizó un análisis de componentes principales con el paquete SAS V. 9.4(12) y un análisis de agrupamiento por el método de UPGMA basado en distancias euclidianas para las poblaciones de gallinas criollas y grupo de referencia, para determinar su patrón de similitud genética.

Resultados y discusión Diversidad genética

Se identificaron en total 109 alelos en las 18 poblaciones de gallinas, considerando los 10 loci evaluados, el número de alelos varió desde seis para MCW145 hasta 16 para MCW158, con un promedio de 10.9 alelos por locus; todos los loci fueron polimórficos (Cuadro 2) coincidiendo en algunos de los iniciadores en un mapeo en pollos(9). El MCW145, fue la excepción porque presentó un menor valor con respecto a lo reportado previamente(9,10).

62


Rev Mex Cienc Pecu 2021;12(1):58-71

Cuadro 2: Parámetros de diversidad genética detectados con los de 10 loci microsatélites evaluados en 109 gallinas criollas distribuidas en 17 poblaciones Loci MCW131 MCW158 MCW32 MCW94 MCW114 MCW134 MCW135 MCW145 MCW68 MCW95 Media Desviación estándar

Ra

Na

Ne

Ho

He

7 8 6 7 7 9 7 8 7 7

8 16 13 10 11 12 15 6 9 9 10.9 3.142

2.493 8.682 5.175 5.170 3.748 5.065 10.982 2.210 4.035 2.176 4.974 2.866

0.596 0.525 0.877 0.912 0.590 0.927 0.845 0.080 0.749 0.476 0.658 0.133

0.601 0.888 0.809 0.809 0.736 0.805 0.912 0.549 0.755 0.542 0.738 0.133

Ra= alelos reportados previamente, Na= número de alelos, Ne= número de alelos efectivos, Ho= heterocigosidad observada, He= heterocigosidad esperada, por cada locus de las poblaciones.

En investigaciones realizadas en diferentes razas locales de gallinas criollas, encontraron un número total de alelos por locus menor al presente estudio, utilizando diferentes loci de microsatélites aplicados en la misma especie. Así, en Suecia, Alemania y Polonia, se reportaron 113, 217 y 62 alelos observados con 24, 29 y 10 loci respectivamente(1,13,14); por otro lado en China, Tailandia e India se encontraron valores similares 276, 227 y 170 alelos con 29, 20 y 17 loci(6,15,16). De igual manera, investigadores de Israel e Irán(17,18) encontraron 211 y 310 alelos en poblaciones locales, usando 22 y 31 loci de microsatélites, respectivamente. Coincidiendo en un promedio similar al encontrado en este estudio. El numero promedio de alelos reportados en las poblaciones de Oaxaca, México, muestran una amplia diversidad de genes, la cual es similar a la de otros países que poseen razas de gallinas locales bien definidas. El número de alelos efectivos por locus varió desde 2.1 (MCW95) hasta 10.9 (MCW135), con un promedio de 4.9. El valor de heterocigosidad observada (Ho) osciló de 0.08 con el locus MCW145, y el valor más alto fue de 0.92 en el locus MCW134 (Cuadro 2), mientras que la heterocigosidad esperada (He) presentó valores de 0.54 (MCW95 y MCW145) hasta 0.91 (MCW135). Si bien esto sugiere la existencia de una amplia diversidad genética de las poblaciones analizadas, también indica discrepancias entre ambos tipos de heterocigosidad, lo que indica desviaciones del equilibrio de Hardy-Weinberg, siendo las causales los procesos de migración, que ocurren en las poblaciones estudiadas o la deriva genética, posiblemente atribuida al bajo número de individuos que normalmente componen cada una de las 63


Rev Mex Cienc Pecu 2021;12(1):58-71

poblaciones. Otros estudios(10,19) se han reportado valores de He para el locus MCW145 de 0.69 y 0.75, respectivamente; estos resultados fueron mayores a lo encontrado en este estudio (0.54), debido a que este locus se asocia con un menor número de alelos, que influyen de manera importante en el valor, pues cada alelo representa un término adicional a la sumatoria para el cálculo de He. En estudios(10,20) para el loci MCW134 se reportaron valores de He=0.68 y 0.64 en China, respectivamente. Son valores más bajos en referencia al valor obtenido en este estudio (0.805). El número de alelos encontrados en poblaciones por loci fueron en orden descendente: el genotipo de referencia Plymouth Rock, con 70 alelos, seguida de Cuilápam con 65 alelos, contrastando con la población Teotitlán con 41 alelos, siendo el valor más bajo (Cuadro 3). Sin embargo, la población San Antonino 1 presentó el mayor número de alelos efectivos (43.8), seguida de ITVO con 37.8 alelos, mientras la población de Suchilquitongo registró 29 alelos efectivos, lo que implica un alto número de alelos que puede ser transmitido a la siguiente generación de gallinas criollas. Cuadro 3: Número de alelos totales (NTa) y alelos efectivos totales (NTe), heterocigosidad observada (Ho) y esperada (He) en las poblaciones estudiadas Población

Ni*

Nazareno 7 ITVO 7 San Antonio 7 San Lucas 7 Cuilápam 7 Plymouth 30 Rock† Chichicapam 6 Teotitlán 6 San Juan 7 Suchilquitongo 7 San Antonino 1 7 San Antonino 2 6 Huixtepec 1 7 Huixtepec 2 7 Huixtepec 3 7 Huixtepec 4 6 Totolapam 1 7 Totolapam 2 8

NTa

NTe

Ho ± DE

He ± DE

49 60 48 48 65

35.288 37.805 31.166 32.506 39.618

0.577 ± 0.296 0.674 ± 0.248 0.630 ± 0.284 0.575 ± 0.205 0.615 ± 0.311

0.684 ± 0.258 0.692 ± 0.229 0.643 ± 0.234 0.732 ± 0.098 0.691 ± 0.236

70

37.639

0.631 ± 0.297

0.625 ± 0.253

53 41 53 53 63 45 58 53 52 46 42 57

34.564 30.550 32.539 29.88 43.851 35.533 34.179 36.984 34.482 36.009 32.729 36.746

0.633 ± 0.227 0.65 ± 0.298 0.587 ± 0.304 0.676 ± 0.361 0.690 ± 0.332 0.75 ± 0.316 0.67 ± 0.316 0.711 ± 0.262 0.7 ± 0.247 0.716 ± 0.324 0.673 ± 0.337 0.703 ± 0.325

0.656 ± 0.238 0.654 ± 0.252 0.643 ± 0.265 0.661 ± 0.112 0.716 ± 0.230 0.695 ± 0.266 0.71 ± 0.124 0.733 ± 0.121 0.718 ± 0.144 0.710 ± 0.204 0.673 ± 0.264 0.681 ± 0.222

Población de referencia Ni*= Número de individuos por población.

64


Rev Mex Cienc Pecu 2021;12(1):58-71

La heterocigosidad observada (Ho) en las poblaciones de gallinas varió desde 0.575 en la población San Lucas hasta 0.75 en la población San Antonino 2, con promedio de 0.741, mientras que la heterocigosidad esperada (He) fue más baja en el grupo de referencia (0.625), lo cual sugiere que existe un nivel de parentesco menor entre progenitores. Así mismo, las poblaciones Huixtepec 2, San Lucas y San Antonino 1 (0.733, 0.732 y 0.716, respectivamente), poseen la mayor diversidad genética, y por consiguiente un mayor potencial para su utilización en programas de mejoramiento. En estudios anteriores en gallinas locales(2,21-23) realizados en Suecia, Corea, China e India se reportaron valores de Ho y He más bajos. Por otro lado, en poblaciones de gallinas locales del Tíbet y China, encontraron valores de 0.798 y 0.76 para He(10,24), más elevados con respecto a lo encontrado en gallinas de Oaxaca, México; esto podria atribuirse al uso de diferentes loci de microsatelites.

Diferenciación genética de poblaciones de gallinas

Las agrupaciones de Ocotlán y Tlacolula presentaron los valores de FIS más bajos (-0.072 y -0.079), indicando un mayor número de individuos heterocigotos dentro de cada población. En general, las agrupaciones de gallinas criollas son poblaciones no consanguíneas, esto por los valores menores a cero; y cercanas al equilibrio de Hardy-Weinberg. Estudios han enfatizado la adaptación de las gallinas locales a las diferentes condiciones geográficas que existen en cada país y por ello el equilibrio Hardy-Weinberg se mantiene constante en cada generación(2,21). En el caso de FIT, los valores más bajos fueron para Ocotlán y el testigo (-0.003 y -0.037), a nivel de unidades de producción. Mientras en Ocotlán, como era de esperarse, debido al cambio constante de reproductores machos mediante compra directa en los mercados regionales, se genera un importante flujo de material genético avícola local a nivel regional. Mientras en el grupo testigo, por su origen y esquema de reproducción establecido, se maximiza la obtención de individuos heterocigotos. En este caso, el grupo de Cuilápam presentó los mayores valores para FIS (0.106) y FIT (0.177), con respecto al resto de las agrupaciones, pero estadísticamente, estableciendo intervalos de confianza, se encuentra en equilibrio de sus individuos heterocigotos (Cuadro 4), explicado por la falta de un proceso de sustitución de machos en las unidades de producción, aumentando la relación de parentesco y la proporción de loci homocigotos.

65


Rev Mex Cienc Pecu 2021;12(1):58-71

Cuadro 4: Estadísticos F de Wright de 10 loci de microsatélites para siete grupos de gallinas y sus límites de confianza en Valles Centrales de Oaxaca FIS, indicador de endogamia para individuos dentro de poblaciones individuales; F IT, indicador de

Poblaciones ITVO Cuilápam Testigo Etla Huixtepec Ocotlán Tlacolula Global

FIS 0.015 0.106 -0.037 -0.014 -0.040 -0.072 -0.079 -0.017

LS y LI

FIT

0.1424 a -0.111 0.253 a -0.040 0.090 a -0.165 0.248 a -0.277 0.170 a -0.250 0.076 a -0.220 0.172 a -0.330

0.091 0.177 -0.037 0.032 0.038 -0.003 -0.001 0.042

LS y LI 0.209 a -0.027 0.337 a 0.017 0.090 a -0.165 0.288 a -0.223 0.234 a -0.156 0.138 a -0.145 0.227 a -0.229

FST 0.077 0.079 0.000 0.046 0.076 0.063 0.072 0.059

endogamia a nivel del total de la población analizada y F ST, índice de diferenciación genética; LS: Límite superior y LI: Límite inferior.

Las agrupaciones de Cuilápam, ITVO y Huixtepec presentaron una diferenciación genética (FST) moderada(25) (0.079, 0.077 y 0.076, respectivamente); estos resultados indican que existe una diferenciación entre las poblaciones por aislamiento geográfico o de manejo, y por consiguiente, un reducido flujo genético entre individuos de las distintas regiones avícolas. El valor global para FST de 0.059 indica el 94.1% de la variación total está dentro las poblaciones y solamente el 5.9% se encuentra entre de las poblaciones(25) (Cuadro 4). Confirmando una moderada diversidad genética dentro de las poblaciones, lo que se asocia con la forma de selección de machos reproductores y hembras de remplazo realizado por las productoras y demuestra el potencial que existe para realizar mejoramiento genético intrapoblacional a través de esquemas de selección recurrente que permite aprovechar los efectos de la selección y recombinación en un proceso continuo. Resultados similares en cuanto a la diferenciación genética han sido reportados(26-28) en poblaciones de gallinas locales de Egipto, Bután, Asia y China, mientras que en otro estudio con ocho razas de pollos nativos de Corea(29) reportaron un mayor coeficiente de diferenciación (0.180).

Relaciones entre las poblaciones El análisis de componentes principales (CP) explicó un 32.2 % de la variación total con los tres primeros componentes, conformados por alelos más importantes de los 10 loci de microsatélites (Cuadro 5). En el plano de tridimensionalidad de las poblaciones (Figura 1), con base en los primeros tres componentes principales, se identifica a las poblaciones más alejadas: Nazareno= A, ITVO= B y Suchiquitongo= J y Huixtepec=N, caracterizadas por no permitir material genético avícola comercial, lo que sugiere un marcado flujo genético dentro de las mismas poblaciones. En otros estudios se han encontrado diferenciaciones claras en 66


Rev Mex Cienc Pecu 2021;12(1):58-71

las poblaciones de gallinas locales en Kenia(30), así como en la india(31), usando CP considerando a los dos primeros componentes con valores de 46.25 % y 23.37 % de la variación genética con gallinas locales. Figura 1: Plano de la dimensionalidad de las poblaciones de gallinas con los componentes principales CP1 vs CP2 vs CP3, generados con las frecuencias alélicas de 10 loci de microsatélites

Cuadro 5: Valores propios y proporción de varianza explicada de los 7 componentes principales con la matriz de frecuencias de 109 alelos de poblaciones de gallinas CP Valor propio Proporción Acumulada

1

14.6493163

0.1344

0.1344

2

10.7115308

0.0983

0.2327

3

9.7335336

0.0893

0.322

Alelos MCW32-A, MCW32-E, MCW94-B, MCW94-D, MCW94-F, MCW134-A, MCW135-C, MCW135-E, MCW135G, MCW135-I, MCW135-O, MCW145-A, MCW95-A, MCW95-B MCW158-B, MCW32-C, MCW32-D, MCW32-G, MCW32-H, MCW94-B, MCW114-K, MCW134-K, MCW135B, MCW135-J, MCW68-A MCW131-C, MCW131-H, MCW158K, MCW94-A, MCW114-E, MCW134G, MCW134-J, MCW135-D, MCW95D, MCW95-H

67


Rev Mex Cienc Pecu 2021;12(1):58-71

Los agrupamientos obtenidos por el análisis de conglomerados (Figura 2) fueron similares a los observados en plano de dimensionalidad del análisis de componentes principales, se distinguen tres agrupaciones principales (distancia genética de 0.90). El primer grupo conformado por Nazareno, ITVO, San Lucas y San Antonio, que incluye poblaciones aisladas y diferentes genéticamente por características únicas de las gallinas criollas, producto de un reducido flujo genético en estas poblaciones criollas con poblaciones avícolas con un grado de recombinación con razas conocidas como Plymouth Rock. En el subgrupo 2 están las poblaciones que poseen un mayor grado de parentesco genético, evidenciado por la proporción de alelos con el grupo de referencia (Plymouth Rock), como causa del proceso de introducción de esta raza comercial en las comunidades mediante paquetes tecnológicos y en consecuencia, se origina un proceso de cruzamientos con gallinas adaptadas a las condiciones ambientales y de manejo de las diferentes zonas rurales, ocasionando una pérdida o desgaste de las características de adaptación y supervivencia de las gallinas criollas. El tercer subgrupo estuvo conformado por las poblaciones de Huixtepec 4, San Antonino 2, Teotitlán y Totolapam 1, comparten frecuencias alélicas similares, lo que sugiere que tienen una variabilidad en rasgos fenotípicos únicos, propios de las gallinas criollas. Figura 2: Dendograma de las poblaciones de gallinas, construido con el método UPGMA con base en distancias euclidianas obtenidas a partir de frecuencias de 109 alelos de microsatélites

68


Rev Mex Cienc Pecu 2021;12(1):58-71

Conclusiones e implicaciones Existe una amplia diversidad genética evidenciada por un total de 109 alelos detectados por los 10 microsatélites usados y un valor de Heterosigocidad esperada de 0.738 en las gallinas criollas de los Valles Centrales de Oaxaca. Los perfiles alélicos encontrados permitieron estimar un bajo grado de diferenciación entre individuos (FST=0.059) entre las poblaciones localizadas en dichos s núcleos geográficos; en particular, la diversidad genética es más compleja en las poblaciones de Tlacolula (0.072) y Ocotlán (0.063). Una mínima proporción (5.9 %) de la diversidad genética total se localiza entre las poblaciones de gallinas criollas, mientras que el restante 94.1 % reside dentro de las mismas. Literatura citada: 1. Abebe AS, Mikko S, Johansson AM. Genetic diversity of five local Swedish chicken breeds detected by microsatellite markers. PLoS One. 2015;10(4):1–13. 2. FAO. La situación de los recursos zoogenéticos mundiales para la alimentación y la agricultura. Food Agric Organ United Nations. 2010. 3. FAO. Recursos genéticos animales 56. Food Agric Organ United Nations. 2015;171. 4. Kaya M, Yildiz MA. Genetic diversity among Turkish native chickens, Denizli and Gerze, estimated by microsatellite markers. Biochem Genet 2008;46(7–8):480–91. 5. Muir WM, Cheng HW. Genetic influences on the behavior of chickens associated with welfare and productivity. 2nd ed. Genetics and the behavior of domestic animals. Elsevier Inc. 2014. http://dx.doi.org/10.1016/B978-0-12-394586-0.00009-3. 6. Dorji N, Daungjinda M, Phasuk Y. Genetic characterization of Thai indigenous chickens compared with commercial lines. Trop Anim Health Prod 2011;43(4):779–85. 7. Qu L, Li X, Xu G, Chen K, Yang H, Zhang L, et al. Evaluation of genetic diversity in Chinese indigenous chicken breeds using microsatellite markers. Sci China, Ser C Life Sci 2006;49(4):332–341. 8. Sukhatme, PV. Sampling Theory of Surveys with Application. Iowa State College Press. Ames, Iowa. 1970. 9. Crooijmans RP, van Oers PA, Strijk JA, van der Poel JJ, Groenen MA. Preliminary linkage map of the chicken (Gallus domesticus) genome based on microsatellite markers: 77 new markers mapped. Poult Sci 1996;75(6):746–54.

69


Rev Mex Cienc Pecu 2021;12(1):58-71

10. Ya-bo Y, Jin-yu W, Mekki DMM, Qing-Ping A, Hui-Fang L, Rong G, et al. Evaluation of genetic diversity and genetic distance between twelve Chinese indigenous chicken breeds based on microsatellite markers. Int J Poult Sci 2006;5(6):550–556. 11. Horbańczuk JO, Kawka M, Sacharczuk M, Cooper RG, Boruszewska K, Parada R, et al. A search for sequence similarity between chicken (Gallus domesticus) and ostrich (Struthio camelus) microsatellite markers. 2007;25(4):283–288. 12. SAS 9.4 Software. Institute Inc., Cary, North Carolina, USA. 2016. 13. Al-Qamashoui B, Simianer H, Kadim I, Weigend S. Assessment of genetic diversity and conservation priority of Omani local chickens using microsatellite markers. Trop Anim Heal Prod 2014;46:1–6. 14. Antos P, Andres K, Kapkowska E. Preliminary studies on genetic diversity of selected Polish local chicken varieties. J Cent Eur Agric 2013;14(1):11–22. 15. Bao WB, Shu JT, Wu XS, Musa HH, Ji CL, Chen GH. Genetic diversity and relationship between genetic distance and geographical distance in 14 Chinese indigenous chicken breeds and red jungle fowl. Czech J Anim Sci 2009;54(2):74–83. 16. Mukesh. Ruheena J, Uma G, Han J, Sathyakumar S. Cross-species applicability of chicken microsatellite markers for investigation of genetic diversity in Indian duck (Anas platyrhynchos) populations. African J Biotechnol. 2011;10(76):17623–17631. 17. Illel JH, Roenen MAMG, Reidlin PJF, Äki AM, Ortwijn MO. Biodiversity of 52 chicken populations assessed by microsatellite typing of DNA pools. Genet Sel Evol 2003;35:533–557. 18. Esfahani EN, Eskandarinasab MP, Khanian SE, Nikmard M, Molaee V. Genetic diversity of a native chicken breed in Iran. J Genet 2012;91:1–4. 19. Choi NR, Seo DW, Jemaa SB, Sultana H, Heo KN, Jo C, et al. Discrimination of the commercial Korean native chicken population using microsatellite markers. J Anim Sci Technol 2015;57(5):1–8. 20. Huo JL, Wu GS, Chen T, Huo HL, Yuan F, Liu LX, et al. Genetic diversity of local Yunnan chicken breeds and their relationships with red junglefowl. Genet Mol Res 2014;13(2):3371–3383. 21. Suh S, Sharma A, Lee S, Cho C, Kim J, Choi S. Genetic Diversity and Relationships of Korean Chicken Breeds Based on 30 Microsatellite Markers. Asian Australas J Anim Sci 2014;27(10):1399–1405.

70


Rev Mex Cienc Pecu 2021;12(1):58-71

22. Yang K, Luo X, Wang Y, Yu Y, Chen Z. Eight trinucleotide microsatellite DNA markers from Tibetan chicken, Gallus gallus domesticus. Conserv Genet Resour 2009;1:225– 237. 23. Chatterjee RN, Bhattacharya TK, Dange M, Dushyanth K, Niranjan M, Reddy BLN, et al. Genetic heterogeneity among various Indigenous and other chicken populations with microsatellite markers. J Appl Anim Res 2015;43(3):266–271. 24. Yang K, Luo X, Wang Y, Yu Y, Chen Z. Ten polymorphic microsatellite loci in Tibetan chicken, Gallus gallus domesticus. Conserv Genet 2010;11(3):671–683. 25. Snyder L. Freifelder AD, Hartl DL. General genetics. UK: Jones and Bartlett publishers, Inc.;1985. 26. Ramadan S, Kayang BB, Inoue E, Nirasawa K, Hayakawa H. Evaluation of genetic diversity and conservation priorities for Egyptian chickens. Open J Anim Sci 2012;2(3):183–190. 27. Dorji N, Duangjinda M, Phasuk Y. Genetic characterization of Bhutanese native chickens based on an analysis of Red Jungle fowl (Gallus gallus gallus and Gallus gallus spadecieus), domestic Southeast Asian and commercial chicken lines (Gallus gallus domesticus). Genet Mol Biol 2012;35(3):603–609. 28. Ding FX, Zhang GX, Wang JY, Li Y, Zhang LJ, Wei Y, et al. Genetic diversity of a Chinese native chicken breed, Bian chicken, based on twenty-nine microsatellite markers. Asian-Australasian J Anim Sci 2010;23(2):154–161. 29. Zhao J, Li H, Kong X, Tang Z. Identification of single nucleotide polymorphisms in avian uncoupling protein gene and their association with growth and body composition traits in broilers. Can J Anim Sci 2006;345–350. 30. Noah O, Ngeranwa JJN, Binepal YS, Kahi AK, Bramwel WW, Ateya LO, et al. Genetic diversity of indigenous chickens from selected areas in Kenya using microsatellite markers. J Genet Eng Biotechnol 2017;15(2):489–495. 31. Kumar V, Mathew J, Sharma D, Kumar V, Shukla SK, Mathew J, et al. Genetic diversity and population structure analysis between Indian Red Jungle fowl and domestic chicken using microsatellite markers. Anim Biotechnol 2015;37–41.

71


https://doi.org/10.22319/rmcp.v12i1.4764 Artículo

Perfil de ácidos grasos de la leche de vacas Holstein x Cebú alimentadas con pasta de licuri

Antonio Ferraz Porto Junior a* Fabiano Ferreira da Silva b Robério Rodrigues Silva b Dicastro Dias de Souza c Edvaldo Nascimento Costa c Evely Giovanna Leite Costa c Bismarck Moreira Santiago c Geónes da Silva Gonçalves c

a

University of Southwest Bahia State - UESB. D.sc. Nutrition and Ruminant Production. INOVAPEC, Itapetinga, BA, 45700-000, Brazil. b

University of Southwest Bahia State - UESB, Department of Rural and Animal Technology, Itapetinga, BA, Brazil. University of Southwest Bahia State – UESB. Nutrition and Ruminant Production. UESB, Itapetinga, BA, Brazil. c

*Autor de correspondencia: ferrazporto@hotmail.com

Resumen: El objetivo de este estudio fue evaluar el efecto de dietas suplementadas con diferentes concentraciones de pasta de licuri (PL) en el perfil de ácidos grasos y colesterol de la leche de vacas confinadas. Cuatro vacas con ½ a ¾ de sangre Holstein x Cebú fueron distribuidas en un cuadrado latino 4 x 4, donde los niveles de inclusión de la pasta de licuri en la dieta total fueron 0.0, 5.5, 11.0 y 16.5%, sustituyendo la pasta de soya en la dieta. Los niveles de inclusión de PL ocasionaron una disminución lineal del ácido láurico, elaídico, gamma-linolénico y linoleico conjugado (C18:2cis9trans11; C18:2trans10cis12). 72


Rev Mex Cienc Pecu 2021;12(1):72-86

La pasta de licuri disminuyó las concentraciones de ácidos grasos poliinsaturados y del ácido linoleico conjugado; además de los ácidos grasos omega 6, que no son relevantes desde el punto de vista de la nutrición humana. Palabras clave: Cromatografía.

Ácido linoleico conjugado, Biohidrogenación,

Subproducto,

Recibido: 08/02/2018 Aceptado: 03/12/2019

Introducción El licuri (Syagrus coronata) (Martius) Beccari es una palmera característica de las regiones áridas del bioma Caatinga. La pasta es el principal producto que se obtiene después de la extracción de aceite(1). Este producto se puede utilizar como una fuente alternativa de bajo costo durante temporadas específicas del año. Sin embargo, la disminución del costo de alimentos depende de diversos factores, como cercanía, disponibilidad del subproducto, características nutricionales y costo del envío. Los ingredientes tradicionales, como el maíz, la soya, el algodón y los subproductos de la elaboración de biodiésel han sido utilizados como fuentes alternativas. Los componentes de la dieta influyen directamente en la composición de ácidos grasos (AG) de la carne y leche; los ácidos grasos que llegan al duodeno provienen directamente de la dieta o de la biohidrogenación microbiana ruminal de los lípidos(2). Para satisfacer el aumento de la demanda de productos con ciertas grasas saturadas, debido su efecto negativo en la salud humana, la manipulación de los componentes de la leche, especialmente su contenido graso, ha sido estudiado(3), ya que algunos ácidos grasos, precursores de colesterol (LDL), han sido asociados con problemas cardiovasculares. Es decir, existe un aumento real en la demanda de alimentos saludables con bajas concentraciones de grasas saturadas y preferiblemente con grasas que beneficien la salud humana. Sin embargo, la ingesta humana de AG esenciales y ácido linoleico conjugado (ALC) ha disminuido, lo que refleja la baja concentración de estos AG en la leche de rumiantes y el consumo de productos lácteos bajos en grasa(4). Por lo que, el objetivo de este estudio fue evaluar el efecto de los niveles de inclusión de pasta de licuri en el perfil de ácidos grasos y colesterol de vacas confinadas.

73


Rev Mex Cienc Pecu 2021;12(1):72-86

Material y métodos Animales y tratamientos

El experimento se realizó en la Fazenda Valeu Boi, localizada en el municipio de Encruzilhada, Bahía, durante el periodo comprendido entre el 3 de mayo y el 22 de agosto de 2016. Este estudio fue aprobado por el Comité de Ética para el Uso de Animales bajo el protocolo número 104/2015 del 15 de abril de 2015. Se utilizaron cuatro vacas Holstein x Cebú (con ½ a ¾ de sangre H x C) en su tercer o cuarto periodo de lactancia, con una producción de leche promedio de 4,500 a 6,000 kg en la lactancia previa, ajustada para 300 d de lactancia, con un peso corporal promedio de 548 ± 17 kg. Las vacas también se seleccionaron con base a sus días de lactancia, entre 80 y 120 días al inicio del periodo experimental. Las vacas fueron distribuidas en un cuadrado latino 4 x 4 que consistía en cuatro periodos experimentales de 21 días cada uno. Los primeros 16 días correspondieron al periodo de adaptación, y los datos se recopilaron en los últimos 5 días. La pasta de licuri se compró en Lipe Indústria de Sabão e Velas Ltda, Guanambi, Bahía. Los niveles de inclusión del subproducto en la dieta total fueron 0.0, 5.5, 11.0 y 16.5%; lo que sustituye el 0.0, 25.0, 50.0 y 75.0% de la proteína cruda en la dieta total. La formulación de la dieta es isoenergética e isoproteica, por lo que aporta los nutrientes necesarios para el mantenimiento de los animales, la ganancia de peso corporal de 0.15 kg d-1 y la producción de 25 kg de leche d-1, ajustada al 3.5% de grasa, de acuerdo con la tabla de requerimientos(5) y los datos de composición bromatológica de la caña de azúcar, el maíz, la pasta de soya y la PL, analizada antes de iniciar el periodo experimental. La fuente a granel utilizada fue la caña de azúcar (Saccharum officinarum) variedad RB 72-454, tratada con una mezcla de urea y sulfato de amonio (9:1) al 1%. El Cuadro 1 muestra la proporción de los ingredientes en los concentrados y la relación fuente a granel: concentrado sobre materia seca.

74


Rev Mex Cienc Pecu 2021;12(1):72-86

Cuadro 1: Proporción de los ingredientes sobre materia seca Concentración de pasta de licuri (%MS) Ingredientes 0.0 5.5 11.0 16.5 Caña de azúcar 49.9 49.8 50.2 50.1 Maíz molido 35.4 32.7 29.7 27.0 Harina de soya 12.9 10.4 7.8 5.3 Pasta de licuri 0.0 5.3 10.6 15.9 1 Sales minerales 1.0 1.0 1.0 1.0 Piedra caliza 0.6 0.6 0.5 0.5 Fosfato dicálcico 0.2 0.2 0.2 0.2 Composición bromatológica Materia seca 94.2 91.7 91.1 91.7 Proteína cruda 23.3 21.1 20.7 20.2 Extracto etéreo 5.81 6.2 5.9 6.6 2 Fibra detergente neutro 12.4 16.2 18.4 22.9 Fibra detergente ácido 9.3 13.4 17.5 22.8 Carbohidratos no fibrosos 53.1 51.4 50.1 45.4 Materia mineral 5.4 6.2 6.1 6.0 Lignina 1.5 4.2 6.8 9.1 3 *NIDN 15.7 25.5 34.9 34.9 4 *NIDA 15.6 18.1 19.4 25.7 5 FDNI 1.1 5.4 9.9 13.9 1

Composición: Calcio 200 g, Cobalto 200 mg, Cobre 1.650 mg, Azufre 12 g, Hierro 560 mg, Flúor (máx.) 1.000 g, Fósforo 100 g, Yodo 195 mg, Magnesio 15 g, Manganeso 1.960 mg, Níquel 40 mg, Selenio 32 mg, Sodio 68 g, Zinc 6.285 mg, 2Corregida para cenizas y proteína; 3Nitrógeno insoluble en detergente neutro; 4Nitrógeno insoluble en detergente ácido; 5Fibra detergente neutro indigestible (FDNi). *Valores en porcentaje de materia seca del nitrógeno total.

Los animales se alojaron en corrales cubiertos individuales de 16 m2 con comederos y bebederos. Las dietas fueron suministradas como dos fracciones diarias de una mezcla completa a las 0700 y 1400 h. Los animales comieron a voluntad y se esperaba un remanente de 5% de la dieta. En cada periodo experimental se evaluó el perfil de ácidos grasos del producto a granel y los suplementos (Cuadro 2). Los lípidos se extrajeron de la muestra siguiendo el procedimiento propuesto(6).

75


Rev Mex Cienc Pecu 2021;12(1):72-86

Cuadro 2: Perfil lipídico de la caña de azúcar y los concentrados consumidos Concentración de pasta de licuri (% MS) 1 Ácidos grasos Concentración de ácidos grasos2 (mg g-1) Caña de azúcar 0.0 5.5 11.0 16.5 C4:0 104.8 nd* 0.0 0.0 0.1 C6:0 nd* nd* 0.02 0.05 0.1 C8:0 nd* nd* 0.1 0.3 0.4 C10:0 nd* nd* 2.8 5.6 8.5 C12:0 nd* nd* 1.7 3.4 5.1 C13:0 2.8 nd* nd* nd* nd* C14:0 11.0 nd* 10.2 20.3 30.7 C16:0 10.3 14.3 15.6 16.6 18.5 C18:0 7.1 nd* 1.2 2.5 3.7 C18:1n9t nd* 3.6 4.0 4.5 5.1 C18:1n9c 14.4 nd* 2.0 3.9 5.9 C18:2n6 nd* 35.1 32.2 28.8 27.8 C20:1 nd* 0.8 0.7 0.7 0.7 C18:3n6 nd* 46.7 42.6 37.9 35.9 C21:0 nd* 2,3 1,9 1,6 1,3 C20:3n6 nd* 0.2 0.2 0.1 0.1 C20:3n3 0,6 nd* nd* nd* nd* C24:0 nd* 0.2 0.2 0.2 0.2 -1 Ácidos grasos totales (mg g ) AGS3 135.9 16.8 33.8 50.6 68.6 4 AGMI 14.4 4.3 6.7 9.1 11.7 5 AGPI 0.6 81.8 74.9 66.8 63.9 1

Nomenclatura común expresada en mg g-1 de grasa. Butírico (C4:0), Capróico (C6:0), Caprílico (C8:0), Cáprico (C10:0), Láurico (C12:0), Tridecanoico (C13:0), Mirístico (C14:0), Palmítico (C16:0), Esteárico (C18:0), Elaidico (C18:1n-9t), Oleico (C18:1n-9c), Gamma-linoleico (C18:2n-6), Eicosenoico (C20:1), Gamma-Linolénico (C18:3n6), Heneicosanoico (C21:0), Dihomo-gamma-linolénico (C20:3n6), Eicosatrienoico (C20:3n3), Lignocérico (C24:0), 3Ácidos grasos saturados, 4Ácidos grasos monoinsaturados, 5Ácidos grasos poliinsaturados y *No detectado.

Análisis de ácidos grasos Los análisis se realizaron en el Laboratorio de Métodos de Separación Química (LABMESQ) en la Universidad Estatal del Sudoeste de Bahía (UESB). Para extraer los lípidos totales de las muestras de leche fresca, se centrifugaron 50 ml de cada muestra a 12,000 rpm durante 30 min a 4 °C en una microcentrífuga de alta velocidad (Himac CF16RX II). La capa sólida superior se colectó y almacenó en microtubos para su posterior análisis siguiendo la metodología propuesta(7).

76


Rev Mex Cienc Pecu 2021;12(1):72-86

Los lípidos extraídos de la leche fresca se utilizaron para preparar ésteres metílicos de ácidos grasos siguiendo el procedimiento descrito modificado(8,9). Los ésteres de ácidos grasos se analizaron utilizando un cromatógrafo de gases (GC-2010 Plus Shimadzu) equipado con un detector de ionización de llama (FID, por sus siglas en inglés) y una columna capilar de sílice fundida Rt-2560 (100 m, 0.25 mm d.i). El flujo del gas acarreador (H2) (White Martins) fue de 40 ml min-1; 30 mL min-1 para el gas auxiliar (N2) y 4,000 ml min-1 para la llama de aire sintético. La relación entre el flujo de split y el flujo en columna fue de 90:10. Los parámetros de operación se configuraron después de verificar la mejor resolución. Las temperaturas del inyector y detector fueron 225 °C y 260 °C, respectivamente. La temperatura de la columna se programó a 140 °C durante 5 min, seguida de un aumento de 3 °C min-1 durante 20 min para alcanzar los 245 °C. El tiempo total de análisis fue de 60 min. Las inyecciones se realizaron por duplicado y el volumen de inyección fue de 0.7 μl. Las áreas de los picos correspondientes a los ésteres metílicos de ácidos grasos se determinaron utilizando el software LCSolution®.

Identificación de los ésteres metílicos Los ésteres metílicos fueron identificados con base a su tiempo de retención, comparándolos con los del estándar con 37 ésteres metílicos de ácidos grasos (189-19 Sigma, EUA) y los tiempos de retención de los estándares de ésteres metílicos de ácidos grasos con los isómeros c9t11 y t10c12 del ácido linoleico (O-5632 Sigma, EUA)(9). Para evaluar la respuesta del detector de ionización de llama, se utilizó una mezcla con concentraciones conocidas de los estándares (Sigma) de los ésteres metílicos de ácidos grasos y la ecuación propuesta por Ackman(10). Estos factores se obtuvieron de la media de cuatro replicados: FR =

A23:0  C3 Ax  C 23:0

Donde: FR= factor de respuesta en función del tricosanoato de metilo; A23:0= área del tricosanoato de metilo; C3= concentración de ésteres metílicos de ácidos grasos; Ax= área de ésteres metílicos de ácidos grasos; C23:0= concentración de tricosanoato de metilo. Los ácidos grasos en las muestras de leche fresca se cuantificaron en mg g -1 de lípidos totales usando el estándar interno de tricosanoato de metilo (23:0) (Sigma, EUA). Después de pesar los lípidos (~ 150 mg) para su transesterificación, se agregaron 1,000 μl de una solución del estándar interno con concentración conocida (1.00 g ml-1) a todas las muestras. La concentración de ácidos grasos en las muestras se calculó con la siguiente ecuación(11): C (mg g-1) =

AX  M 23:0  FRT A23:0  M A  FCT

77


Rev Mex Cienc Pecu 2021;12(1):72-86

Donde: AX= área de ésteres metílicos de ácidos grasos; A23:0= área del estándar interno; M23:0= masa del estándar interna adicionado a la muestra (en miligramos); MA= masa de la muestra (en gramos); FRT= factor de respuesta teórico de ésteres metílicos de ácidos grasos; FCT= factor de conversión para expresar los resultados de ácidos grasos en mg por g de lípidos totales (LT).

Extracción e identificación del colesterol de la leche La extracción, detección, identificación y cuantificación del colesterol se realizaron siguiendo la metodología propuesta por Bauer, et al(12). Se empleó una columna analítica C18 (250 mm x 4.6mm x 5 µm). La fase móvil fue una mezcla de acetonitrilo:isopropanol (95:5) a un flujo de 2 ml/min; el tiempo de análisis fue de 28 min. Los cromatogramas se corrieron a 202 nm utilizando un equipo de HPLC (Shimadzu) equipado con un desgasificador (DGU – 20 A5R) y dos bombas (LC-20 AR), con un detector UV-Vis (SPD – 20 A). El colesterol se identificó al comparar el tiempo de retención de la muestra con el estándar y se cuantificó en función del área del pico, utilizando un estándar externo de colesterol (Sigma-Aldrich®, código C8667).

Análisis estadístico Los resultados se evaluaron con un análisis de varianza y regresión utilizando el programa Statistical Analysis System (SAS, 2003). Los modelos estadísticos se seleccionaron con base a la significancia de los coeficientes de regresión utilizando la prueba de F a una probabilidad y coeficiente de determinación del 5%, conforme al siguiente modelo estadístico: Yijk= µ + li + cj + tk(ij) + eijk Donde: Yijk= valor observado de la variable; µ= promedio general; li = efecto de la línea i; cj = efecto de la columna j; tk(ij) = efecto del tratamiento k; eijk = error aleatorio (residual).

Resultados No se observaron diferencias significativas (P>0.05) en las concentraciones de ácidos grasos saturados, butírico (C4:0), capróico (C6:0), caprílico (C8:0), cáprico (C10:0) y hendecanóico (C11:0), en la leche de vacas alimentadas con diferentes concentraciones de PL (Cuadro 3).

78


Rev Mex Cienc Pecu 2021;12(1):72-86

Cuadro 3: Composición de ácidos grasos saturados en la leche de vacas alimentadas con diferentes concentraciones de PL Concentración de pasta de licuri 1 (% MS) Ácidos grasos Eq.2 CV%3 P4 0.0 5.5 11.0 16.5 C4:0 12.6 12.9 13.6 12.9 13.0 9.6 0.7 C6:0 12.2 11.9 12.7 11.5 12.1 8.1 0.5 C8:0 8.0 7.7 8.1 7.2 7.7 7.3 0.2 C10:0 19.1 17.8 19.2 17.1 18.3 6.1 0.1 C11:0 3.1 2.8 2.9 2.5 2.8 11.5 0.1 5 C12:0 24.2 25.7 30.4 32.4 7.4 0.0 C13:0 0.4 0.4 0.4 0.4 0.4 13.1 0.6 C14:0 71.4 72.1 76.9 74.1 73.6 4.4 0.2 C15:0 8.7 6.9 6.8 6.1 7.1 17.7 0.1 C16:0 227.7 242.6 233.7 222.5 231.6 8.3 0.5 C17:0 16.1 15.7 15.3 13.9 15.3 10.8 0.4 C18:0 36.7 33.8 34.9 35.7 35.3 10.1 0.7 C20:0 0.5 0.5 0.5 0.5 0.5 8.8 0.9 C21:0 0.7 0.6 0.6 0.6 0.6 12.2 0.4 1

Nomenclatura común expresada en mg g-1 de grasa. Butírico (C4:0), Capróico (C6:0), Caprílico (C8:0), Cáprico (C10:0), Hendecanóico (C11:0), Láurico (C12:0), Tridecanoico (C13:0), Mirístico (C14:0), Pentadecanoico (C15:0), Palmítico (C16:0), Margárico (C17:0), Esteárico (C18:0), Araquídico (C20:0), Heneicosanoico (C21:0); 2Ecuaciones de regresión; 3Coeficiente de variación; 4Probabilidad de error; 5Y= 0.5316x + 23.804, R² = 0,96.

Se observaron diferencias significativas (P<0.05) en el contenido de ácido láurico (C12:0) con los diferentes niveles de inclusión de PL. La concentración de ácido láurico en las muestras de leche aumentó de forma lineal con los diferentes niveles de inclusión de PL, esto resultó del subproducto (Cuadro 2), que aportó 0.0, 1.5, 2.7 y 3.6% entre los tratamientos. Los ácidos grasos saturados representan más del 80 % de la composición de ácidos grasos de la leche, lo que demuestra la capacidad de biohidrogenación del ganado en la transformación de ácidos grasos monoinsaturados y poliinsaturados en ácidos grasos saturados; incluso con dietas que contribuyen más del 52 % de ácidos grasos monoinsaturados y poliinsaturados (Cuadro 2). Entre los ácidos grasos saturados, los más abundantes fueron el ácido palmítico (C16:0), mirístico (C14:0) y esteárico (C18:0). El ácido palmítico presentó la concentración media más alta, 231.60 mg g-1. El Cuadro 4 muestra los ácidos grasos monoinsaturados y poliinsaturados en las muestras de leche. Los diferentes niveles de inclusión de PL no ocasionaron diferencias significativas (P>0.05) en el contenido de ácido miristoleico, pentadecanoico, palmitoleico, 10-heptadecanoico, oleico, linoleico, eicosatrienoico y araquidónico. De estos ácidos grasos, el miristoleico (C14:1) y oleico (C18:1n9c) presentaron las

79


Rev Mex Cienc Pecu 2021;12(1):72-86

concentraciones medias más elevadas, 10.2 y 78.1 mg g-1, respectivamente. En los ácidos elaídico y gamma-linolénico se observó un efecto lineal decreciente (P<0.05), con una reducción de 0.1 y 0.2, respectivamente, por cada unidad (mg g-1) de PL adicionada a la dieta. Cuadro 4: Composición de ácidos grasos monoinsaturados y poliinsaturados en la leche de vacas alimentadas con diferentes concentraciones de pasta de licuri Concentración de pasta de 1 licuri (% MS) Ácidos grasos Eq.2 CV%3 P4 0.0 5.5 11.0 16.5 C14:1 10.3 10.4 10.5 9.7 10.2 7.4 0.5 C15:1 0.9 0.9 0.9 0.9 0.9 25.5 0.9 C16:1 2.9 2.7 2.7 2.7 2.7 4.8 0.1 C17:1 1.4 1.2 1.1 1.1 1.2 11.5 0.2 5 C18:1n9t 5.2 4.7 3.9 3.6 15.0 0.0 C18:1n9c 90.6 86.0 51.7 84.2 78.1 8.8 0.5 C18:2n6 2.1 1.8 1.7 1.9 1.9 18.6 0.6 6 C18:3n6 9.4 8.2 7.0 5.9 9.2 0.0 C20:3n3 0.5 0.4 0.4 0.4 0.4 8.9 0.6 C20:4n6 1.1 1.0 1.0 1.0 1.0 8.2 0.3 1

Nomenclatura común expresada en mg g-1 de grasa. Miristoleico (C14:1), Pentadecanoico (C15:1), Palmitoleico (C16:1), 10-Heptadecanoico (C17:1), Elaídico (C18:1n9t), Oleico (C18:1n9c), Gamma-linoleico (C18:2n6), Gamma-linolénico (C18:3n6), Eicosatrienoico (C20:3n3), Araquidónico (C20:4n6); 2Ecuaciones de regresión; 3Coeficiente de variación; 4Probabilidad de error. 5Y = -0.1042x + 5.197, R² = 0.97 y 6Y = 0.214x + 9,378, R² = 0,99.

Los diferentes niveles de inclusión de PL afectaron (P<0.05) la concentración de ALC (C18:2cis9trans11 y C18:2trans10cis12) en la leche; en el tratamiento con 16.5% (Cuadro 5) de PL, los niveles de ALC disminuyeron 0.01 y 0.03 mg g-1 de grasa, respectivamente. Cuadro 5: Composición de ácido linoleico conjugado y grasa en la leche de vacas alimentadas con diferentes concentraciones de pasta de licuri Concentración de pasta de 1 licuri (% MS) Ácidos grasos Eq.2 CV%3 P4 0.0 5.5 11.0 16.5 5 ALC C18:2c9t11 0.5 0.5 0.4 0.3 7.8 0,0 6 ALC C18:2t10c12 2.1 1.7 1.6 1.4 7.8 0.0 Composición (%) Grasa 4.4 5.0 4.9 4.9 4.8 8.2 0.2 1

Nomenclatura común expresada en mg g-1 de grasa. Ácido linoleico conjugado (ALCcis9trans11 y ALCtrans10cis12); 2Ecuaciones de regresión; 3Coeficiente de variación; 4Probabilidad de error. 5Y = -0.0147x + 0.534, R² = 0.99; 6Y = -0.0347x + 1.954, R² = 0,94.

80


Rev Mex Cienc Pecu 2021;12(1):72-86

No se observaron diferencias significativas (P>0.05) con los diferentes niveles de inclusión de PL en la concentración de ácidos grasos saturados, monoinsaturados, omega 3 y la proporción omega 6/omega 3 (Cuadro 6). La suma de ácidos grasos poliinsaturados y omega 6 disminuyó (P<0.05). En cuanto a la proporción de ácidos grasos poliinsaturados/saturados, se observó una disminución lineal (P<0.05). No se observaron diferencias significativas (P>0.05) en la concentración de colesterol con los diferentes tratamientos evaluados, con una concentración media de 2.1 mg 100 ml-1, como se observa en el Cuadro 6. Se observó un resultado similar en la composición de grasa de la leche (Cuadro 5). Cuadro 6: Suma de ácidos grasos y colesterol en la leche de vacas alimentadas con diferentes concentraciones de pasta de licuri Concentración de pasta de 1 licuri (% MS) Ácidos grasos Eq.2 CV%3 P4 0.0 5.5 11.0 16.5 Saturados 441.5 451.2 455.9 437.3 446.5 5.8 0.7 Monoinsaturados 111.3 105.9 100.7 102.3 105.0 7.4 0.3 5 Poliinsaturados 15.5 13.5 12.1 10.9 8.1 0.0 8 6 AGPI / AGS 0.3 0.2 0.1 0.0 9.3 0.0 9 n-3 0.5 0.4 0.4 0.4 0.4 8.9 0.6 10 7 n-6 12.5 10.9 9.7 8.8 9.8 0.1 11 n-6 / n-3 27.9 26.1 22.1 21.4 24.4 15.6 0.2 -1 Colesterol (mg 100 ml ) 2.3 2.1 1.9 2.2 2.1 14.1 0.4 1

Nomenclatura común expresada en mg g-1 de grasa. 2Ecuaciones de regresión; 3Coeficiente de variación; 4 Probabilidad de error; 5Y = -0.2793x + 15.309, R² = 0.99, 6Y = -0.0006x + 0,0338, R² 0.91, 7Y = 0.2278x + 12.382, R² = 0.99, 8Proporción de ácidos grasos poliinsaturados/saturados; 9Total de omega 3: 20:3n3, 10Total de omega 6: 18:2n6, 18:3n6, 20:4n6; 11Proporción de omega 6 y omega 3.

Discusión Las concentraciones de los ácidos grasos C4:0, C6:0, C8:0, C10:0 y C11:0 no fueron afectadas, probablemente debido a la síntesis de novo y al reducido número de acetato y precursores de la síntesis de β-hidroxibutirato, productos de la fermentación ruminal, la principal ruta metabólica de la acetil-CoA carboxilasa(13). El aumento de la concentración de ácido láurico en la PL fue suficiente para alterar las concentraciones de este lípido en las muestras de leche. El mayor aporte de ácido láurico en la leche puede estar asociado con la inclusión de alimentos derivados del coco (14), los cuales tienen una concentración importante de (C12:0); esto explicaría los resultados reportados en este estudio y corroboraría otros resultados(15), donde evaluaron la inclusión de pasta de palma en vacas lecheras confinadas. En un estudio previo(16), los autores reportaron que el ácido láurico es el responsable de los efectos adversos en la salud humana, ya que es un ácido graso presente en la leche de animales alimentados con dietas que contienen coco o sus subproductos. 81


Rev Mex Cienc Pecu 2021;12(1):72-86

Entre los ácidos saturados, los más abundantes fueron el palmítico y el mirístico; estos ácidos grasos se encuentran en altos porcentajes en la PL. Los ácidos palmítico y mirístico tienen el potencial de generar efectos adversos en la salud humana, debido a que pueden incorporarse rápidamente a los triglicéridos celulares, aumentando la colesterolemia(17). Los rumiantes pueden convertir el ácido esteárico a un ácido graso monoinsaturado o poliinsaturado(18,19). Los ácidos grasos saturados aumentan los niveles de LDL (lipoproteínas de baja densidad, por sus siglas en inglés) en la sangre humana(20). La ausencia de significancia entre los ácidos grasos monoinsaturados y poliinsaturados puede estar relacionada con la actividad enzimática de la Δ9-desaturasa en la glándula mamaria. Según algunos autores(21), la Δ9-desaturasa convierte los ácidos grasos saturados a ácidos grasos monoinsaturados. La concentración del ácido elaídico y alfa-linolénico reportada en este estudio demuestra que el perfil de estos ácidos grasos en la leche puede ser modificado por cambios en el patrón de fermentación microbiana ruminal, principalmente por Butyrovibrio fibrisolvens y Anaerovibrio lipolytica, que hidrolizan los enlaces éster(22) y minimizan los efectos tóxicos de los ácidos grasos. Incluso con el aumento de la concentración del subproducto en la dieta (Cuadro 2), la disminución de C18:1n9t demuestra que la capacidad de biohidrogenación de los rumiantes actúa como un mecanismo de defensa. La reducción del ALC con la inclusión de la PL en la leche obtenida de vacas alimentadas con una dieta a base de caña de azúcar y suplementada con PL indica que el aumento en la partición de subproductos afecta negativamente la concentración del ácido linoleico conjugado. Los isómeros trans-10 cis-12 del ALC son los principales responsables del síndrome de depresión de grasa láctea. En este estudio, las concentraciones de estos isómeros no fueron los suficientemente altas en las muestras evaluadas, por lo que no ejercen efectos adversos en la síntesis de novo de los ácidos grasos y, por lo tanto, no influyen en la composición grasa de la leche(20). Esta disminución en el contenido de ALC en las muestras de leche fue más evidente con los niveles de inclusión del subproducto, aun cuando contenía 44.9 % de ácidos grasos poliinsaturados (Cuadro 2), esta concentración no fue suficiente para aumentar la concentración de ALC en la leche. Así, las bajas concentraciones de C18:2n-6 y C18:3n-6 en la dieta disminuyen el flujo duodenal y, en consecuencia, disminuyen las concentraciones de ALC en la leche. El ácido linoleico conjugado es resultado de la biohidrogenación incompleta del ácido linoleico y linolénico en el rumen(23). Anteriormente, se ha demostrado que los isómeros cis-9, trans-11 y trans-10, cis-12(24) del ALC benefician la salud humana. La disminución de los ácidos grasos poliinsaturados y el omega-6 refleja el consumo de ácidos grasos poliinsaturados (Cuadro 2); los rumiantes no sintetizan C18:2 ni sus isómeros(25), especialmente aquellos de la familia de omega-6 y omega-3, que obtienen de la dieta. 82


Rev Mex Cienc Pecu 2021;12(1):72-86

Está disminución fue menor a la proporción recomendada por Wood et al(26), quienes establecen que la proporción de ácidos grasos poliinsaturados y ácidos grasos saturados debe estar por encima de 0.4. Por lo tanto, se requieren más estudios enfocados en mejorar la proporción de AGPI:AGS en la leche. Aunque el balance dietético entre los AGPI (omega-3) está conformado por el ácido alfa-linolénico (C18:3) y el omega-6 por el ácido linoleico (C18:2)(27), estos son considerados esenciales para los humanos, aunados al ALC(9). Las altas concentraciones de ácidos grasos en las muestras de leche (Figura 1) se podrían deber a la importante reducción del consumo de AGPI provenientes de la PL (Cuadro 2) y al proceso de biohidrogenación. En un estudio previo se reportaron resultados diferentes(28), el estudio comparativo reportó 74.2 y 75.3 % de ácidos grasos saturados en la leche de bovinos y búfalos. Figura 1. Porcentaje de ácidos grasos saturados, poliinsaturados y monoinsaturados en la leche de vacas alimentadas diferentes concentraciones de pasta de licuri

Conclusiones e implicaciones Los diferentes niveles de inclusión de PL modificaron el perfil lipídico de la leche, principalmente las concentraciones de ácidos grasos poliinsaturados, isómeros del ALC y omega-6, lo cual no es relevante desde el punto de vista de la nutrición humana. La inclusión de PL no afectó la concentración de colesterol. Agradecimientos Los autores agradecen a la Coordinación para el Mejoramiento del Personal de la Educación Superior (CAPES) y al Programa de Posgrado en Ciencia Animal (UESB) por su apoyo. Gracias al Research Support Foundation of the State of Bahia (FAPESB), Pronex Project PNX0004 / 2014.

83


Rev Mex Cienc Pecu 2021;12(1):72-86

Literatura citada: 1. Borja MS, Oliveira RL, Ribeiro CVDM, Bagaldo AR, Carvalho GGP, Silva TM, et al. Effects of feeding licury (Syagrus coronate) cake to growing goats. Asian-Aust J Anim Sci 2010;23(11):1436-1444. 2. Buccioni A, Decandia M, Minieri S, Molle G, Cabiddu A. Lipid metabolism in the rumen: New insights on lipolysis and biohydrogenation with an emphasis on the role of endogenous plant factors. Anim Feed Sci Technol 2012;174:1-2. 3. Eifert EC, Lana RP, Lanna DPD, Leopoldino WM, Arcuri PB, Leão MI, et al. Perfil de ácidos graxos do leite de vacas alimentadas com óleo de soja e monensina no início da lactação. Rev Bras Zootec 2006;35:219-228. 4. Elgersma A, Tamminga S, Ellen G. Modifying milk composition through forage. Anim Feed Sci Technol 2006;131:207-225. 5. NRC - National Research Council. Nutrient requirements of dairy cattle. 7 ed. Washington, D.C.: National Academy Press; 2001. 6. Bligh EG, Dyer WJ. Rapid method of total extraction and purification. Can J Biochem Physiol 1959;37(3):911-917. 7. Folch J, Lees M, Stanley GHS. A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem 1957;226(1):497-509. 8. Bannon CD, Breen GJ, Craske JD, Hai NT, Harper NL, Orourke KL. Analysis of fatty acid methyl esters with high accuracy and reliability. J Chromatog 1982;247:71-89. 9. Simionato JI, Garcia JC, Santos GT, Oliveira CC, Visentainer JV, Souza NE. Validation of the determination of fatty acids in milk by gas chromatography. J Braz Chem Soc 2010;21(3):520-524. 10. Ackman RG. The analyses of fatty acids and related materials by gas-liquid chromatography. Prog Chem Fats Other Lipids 1972;12:165-284. 11. Visentainer JV, Franco MRB. Ácidos Graxos em óleos e gorduras: identificação e quantificação. São Paulo: Varela, 2006. 12. Bauer LC, Santana DA, Macedo MS, Torres AG, Souza NE, Simionato JIJ. Method validation for simultaneous determination of cholesterol and cholesterol oxides in milk by RP-HPLC-DAD. J Braz Chem Soc 2014; 25(1):161-168. 13. Chilliard Y, Ferlay A, Mansbridge RM, Doreau MA. Ruminant milk fat plasticity: nutritional control of saturated, polyunsaturated, trans and conjugated fatty acids. Ann Zootec 2000;49:181-205.

84


Rev Mex Cienc Pecu 2021;12(1):72-86

14. Machado GC, Chaves JBP, Antoniassi R. Composição em ácidos graxos e caracterização física e química de óleos hidrogenados de coco babaçu. Ceres 2006;53(308):463-470. 15. Pimentel LR, Silva FF, Robério RS, Rodrigues ESO, Meneses MA, Porto Junior AF, et al. Perfil de ácidos graxos do leite de vacas alimentadas com torta de dendê. Sem Cienc Agr 2016;37(4):2773-2784. 16. Ribeiro CGS, Lopes FCF, Gama MAS, Morenz MJF, Rodrigues NM. Desempenho produtivo e perfil de ácidos graxos do leite de vacas que receberam níveis crescentes de óleo de girassol em dietas à base de capim-elefante. Arq Bras Med Vet Zootec 2014;66(5):1513-1521. 17. Lottenberg AMP. Importância da gordura alimentar na prevenção e no controle de distúrbios metabólicos e da doença cardiovascular. Arq Bras Endocrinol 2009;53(5):595-607. 18. Shaefer EJ. Lipoproteins, nutrition, and heart disease. Amer Soc Clin Nutr 2002;75:191-212. 19. Tsiplakou E, Kominakis A, Zervas G. The interaction between breed and diet on CLA and fatty acids content of milk fat of four sheep breeds kept indoors or at grass. Small Ruminant Res 2008;74:179-187. 20. Oliveira RL, Ladeira MM, Barbosa MAA, Matsushita M, Santos GT, Bagaldo AR, Oliveira RL. Composição química e perfil de ácidos graxos do leite e muçarela de búfalas alimentadas com diferentes fontes de lipídeos. Arq Bras Med Vet Zootec 2009;61(3):736-744. 21. Malau-Aduli AEO Siebert BD, Bottema CDK, Pitchford WSA. Comparison of the fatty acid composition of triacylglycerols in adipose tissue from Limousin and Jersey cattle. Aust J Agri Res 1997;48:715-722. 22. Parodi PW. Conjugated linoleic acid and other anticarcinogenic agents of bovine milk fat. J Dairy Sci 1999;82:1339–1349. 23. Holanda MAC, Holanda MCR, Mendoça Júnior AF. Suplementação dietética de lipídios na concentração de ácido linoléico conjugado na gordura do leite. Acta Vet Bras 2011;5(3):221-229. 24.Bhattacharyaa A, Banua J, Rahmana M, Causeyb J, Fernandes GJ. Biological effects of conjugated linoleic acids in health and disease. J Nutr Biochem 2006;17:789-810. 25.Martin CA, Almeida VV, Ruiz MR, Visentainer JEL, Matshushita M, Souza NE, Visentainer JV. Ácidos graxos poliinsaturados ômega-3 e ômega-6: importânica e ocorrência em alimentos. Rev Nutr 2006;19(6):761-770.

85


Rev Mex Cienc Pecu 2021;12(1):72-86

26.Wood JD, Richardson RI, Nute GR, Fisher AV, Compo MM, Kasapidou E, Sheard PR, Enser M. Effects of fatty acids on meat quality: a review. Meat Sci 2003;66:2132. 27. Williams CM. Dietary fatty acids and human health. Ann Zootech 2000;49:165-180. 28. Pignata MC, Fernandes SAA, Ferrão SPB, Faleiro AS, Conceição DG. Estudo comparativo da composição química, ácidos graxos e colesterol de leites de búfala e vaca. Rev Caatinga 2014;27(4):226-233.

86


https://doi.org/10.22319/rmcp.v12i1.5529 Artículo

Rendimiento de leche derivado de energía y proteína de vacas en pastoreo recibiendo suplementos en un sistema agrosilvopastoril

Sherezada Esparza-Jiménez a Benito Albarrán-Portillo a* Manuel González-Ronquillo b Anastacio García-Martínez a José Fernando Vázquez-Armijo a Carlos Manuel Arriaga-Jordán c

a

Universidad Autónoma del Estado de México. Centro Universitario UAEM Temascaltepec. Km 67.5 Carretera Toluca-Tejupilco, Temascaltepec. 51300. Estado de México, México. b

Universidad Autónoma del Estado de México. Facultad de Medicina Veterinaria y Zootecnia. Estado de México, México. c

Universidad Autónoma del Estado de México. Instituto de Ciencias Agropecuarias y Rurales (ICAR). Estado de México, México.

* Autor de correspondencia: balbarranp@uaemex.mx

Resumen: En el suroeste del Estado de México producen leche y becerros en sistemas agrosilvopastoriles subtropicales. Durante la época de estiaje, el ganado es suplementado debido a la baja disponibilidad y calidad de los pastos, sin considerar la contribución de especies leñosas a las necesidades de consumo de energía metabolizable (EM) y proteína cruda (PC). El objetivo del estudio fue determinar leche producida a partir de aportes de energía (LFe) y proteína (LFp) de forrajes, de vacas en pastoreo con tres tipos de suplemento. El primero consistió en mazorca de maíz molida y concentrado comercial (14 % de PC) (S14). A la mezcla S14 se añadió 7 % de pasta de soya para incrementar a 16 % la PC (S16); y se utilizó concentrado comercial 16 % de PC (SC16) como tercer

87


Rev Mex Cienc Pecu 2021;12(1):87-104

suplemento. Seis vacas en lactación se asignaron al azar en un diseño de cuadro latino 3x3 repetido (tres vacas/cuadro), y tres periodos experimentales (PE). El tipo de suplemento no tuvo efecto sobre las variables de respuesta (P=0.80). Leche producida a partir de LFe y LFp de forrajes fue 0.08 y 6.1 kg/vaca/día, respectivamente. Se detectaron altos niveles de nitrógeno ureico en leche (NUL), sin importar el tipo de suplemento. El tratamiento SC16 incrementó los niveles de nitrógeno en orina (44.1 mg/dl) (P=0.001) y en heces (1.4 mg/g) (P=0.04). Las vacas obtuvieron el 90 y 10 % de sus necesidades de PC y EM para mantenimiento y producción de leche a partir de forrajes consumidos en un sistema agrosilvopastoril. Palabras clave: Leche, Forraje, Excreción de nitrógeno.

Recibido: 04/10/2019 Aceptado: 29/06/2020

Introducción México es el octavo productor mundial de leche (considerando a la Unión Europea como un solo bloque), con una producción de 12.4 millones de toneladas en el año 2019, pero es el mayor importador de leche descremada en polvo con un equivalente al 30 % de la demanda nacional(1), y una tasa de crecimiento de 1.6 % en el año 2018. El inventario nacional de ganado bovino se estima en 33.5 millones de cabezas de las cuáles el 51 % se localiza en regiones tropicales y subtropicales en pastoreo extensivo, en donde predominan unidades de producción de doble propósito que contribuyen con el 18 % de la producción nacional(2). Estas unidades de producción tienen un papel social importante al proveer los modos de vida de las familias(3). La disponibilidad y calidad de forraje durante la época de estiaje (noviembre a mayo) es baja, por lo que los productores recurren al uso de suplementos con el objetivo de mantener rendimientos de leche y peso corporal de las vacas, así como ganancias de peso de los becerros(4). El uso de suplementos representa una proporción importante en los costos de producción(2), alcanzando hasta el 70 % de los costos de producción en unidades de producción de doble propósito(5). Para reducir costos algunos productores mezclan mazorca de maíz (con hoja) producida en la unidad de producción con concentrados comerciales (50:50), con un contenido de proteína cruda (PC) de 14 % en la mezcla resultante, mientras que otros productores prefieren utilizar concentrados comerciales con concentraciones de PC que varían entre 16 y 18 % de PC(3,5). La cantidad de suplemento asignado a las vacas oscila entre 5 y 9 kg/vaca/día, lo que representa entre el 40 y 75 % del consumo de materia seca (CMS). La cantidad asignada 88


Rev Mex Cienc Pecu 2021;12(1):87-104

se basa principalmente en los rendimientos de leche y varía durante la época de estiaje dependiendo de la disponibilidad de forraje (principalmente pastos) en las praderas, sin tomar en cuenta otros recursos disponibles como árboles y arbustos forrajeros presentes en los potreros, muchos de los cuales contribuyen a las necesidades de CMS, energía y proteína. Lo anterior, ocasiona desbalances en las raciones de las vacas causando baja productividad, problemas de salud o altos costos de producción(6). Los pastos tropicales son la principal fuente de nutrientes para el ganado en unidades de producción de DP en los trópicos; sin embargo, su bajo valor nutritivo (bajo contenido de PC, energía y digestibilidad) restringen la productividad del ganado. La falta de conocimiento técnico acerca del manejo de praderas, evaluación de la disponibilidad y calidad de forraje, además de conocimientos básicos de las necesidades nutricionales del ganado, deja a los productores sin ninguna otra herramienta que el uso de suplementos basados en granos para contrarrestar la falta de forraje en cantidad y calidad adecuada durante la época de estiaje(3,4). La leche producida a partir de forraje de vacas en pastoreo puede ser estimada a partir de substraer la producción teórica de leche debida al consumo de concentrados, asumiendo que los requerimientos de mantenimiento son cubiertos por el consumo de forrajes(7). Para poder contabilizar la contribución del consumo de forraje a las necesidades de energía y proteína, la leche a partir de forraje (LF) puede ser estimada siguiendo los procedimientos ya descritos(8). El objetivo del estudio fue estimar la cantidad de leche producida a partir de energía y proteína de forraje (LFe y LFp, respectivamente), de vacas pastoreando en un sistema agrosilvopastoril, con tres diferentes tipos de suplemento. El segundo objetivo fue estimar el ingreso sobre costo de suplemento.

Material y métodos Localización El estudio se realizó en una unidad de producción de doble propósito en el municipio de Zacazonapan, Estado de México entre las coordenadas 19° 00ʼ 17” y 19° 16ʼ 17” N, y entre 100° 12ʼ 55” y 100° 18ʼ 13” O, a una altitud de 1,470 m. El clima es semiseco del grupo A, subhúmedo con lluvias en verano y una marcada estación seca de noviembre a mayo, clasificado como A(c) (w2) (w), con una temperatura promedio de 23 °C y 1,115 mm de precipitación anual. El experimento se llevó a cabo del 22 de marzo al 13 de junio del año 2010. El manejo del ganado se llevó a cabo de la misma forma que el productor maneja al ganado, respetando rutinas de manejo y horarios evitando estresar a los animales.

89


Rev Mex Cienc Pecu 2021;12(1):87-104

Descripción del sistema agrosilvopastoril

La unidad de producción (UP) tiene una superficie de 100 ha con cerco perimetral, en donde el ganado pastorea con una carga animal de 0.25 UA por ha. Las fuentes de forraje dentro del sistema agrosilvopastoril han sido reportadas previamente(9), y consisten en: pradera (áreas con cobertura continua de pastos); ramoneo (incluye hojas y ramas de arbóreas y arbustivas y guías trepadoras); herbáceas (plantas de hoja ancha diferentes a pastos); y residuos de cultivos (maíz y caña de azúcar)(10). El componente pradera consistió en pasto Estrella de África (Cynodon plectostachyus) como el principal con 44 % de presencia, el resto de los pastos en orden de importancia fueron Brachiaria plantaginea (17 %), Paspalum convexum (12 %), Cynodon dactylon (11 %), Eleusine indica (5 %), Paspalum notatum (4 %), Paspalum conjugatum (4 %), Paspalum scrobicunatum (2 %), Digitaria bicornis (1 %). El componente ramoneo consistió en 27 especies leñosas que son consumidas por el ganado. De estas especies el ganado consume hojas, flores y frutos. Se encontraron 22 especies de herbáceas la mayoría de las cuales son consumidas por al ganado. Finalmente, a mediados o finales de la época de estiaje, el ganado tiene acceso a residuos de la cosecha de cultivo de maíz (Zea mays) y caña de azúcar (Saccharum officinarum), que son cultivados en el 30 % de la superficie de la UP.

Unidades experimentales y manejo general Se utilizaron seis vacas multíparas de la raza Pardo Suizo con un promedio de 4 ± 1.2 partos, 73 ± 27 días en lactación, con un peso promedio (PV) de 491 ± 57 kg y 2.5 puntos de condición corporal (CC) en escala de 1 a 5. Las vacas tuvieron un rendimiento promedio de leche de 5.3 kg/vaca/día, y fueron ordeñadas a mano una vez al día de 0700 a 0900 h. Antes de ser ordeñadas, se utilizó a los becerros de las vacas para despuntar y estimular la bajada de la leche por pocos segundos (manejo habitual en la UP); posteriormente los becerros se amarraban al cuello de las vacas para ser ordeñadas. Las vacas se ordeñaban completamente y una vez terminada la ordeña, se les permitía a los becerros mamar la leche residual y permanecer con sus madres hasta las 1400 h. Posteriormente, los becerros eran separados de sus madres y confinados en una pradera de características similares a las descritas anteriormente. Los becerros eran suplementados con 1.8 kg/día (base seca) de mazorca de maíz y concentrado comercial (14 % de PC), teniendo agua y mezcla de minerales ad libitum.

Suplementos Los suplementos utilizados en este estudio pretendieron replicar las características e ingredientes de los suplementos comúnmente utilizados por los productores de la región de estudio. Se mezcló mazorca de maíz molida con concentrado comercial (50:50),

90


Rev Mex Cienc Pecu 2021;12(1):87-104

resultando en una concentración de 14 % de PC (S14). A la mezcla S14 se le adicionó 7 % de pasta de soya para incrementar la concentración de PC a 16 % (S16); y concentrado comercial con 16 % de PC (SC16) como tercer suplemento. En el Cuadro 1 se muestra la composición química y los ingredientes utilizados. Cuadro 1: Composición química de los ingredientes utilizados en los suplementos Materia Proteína Fibra Fibra Ingredientes, g/kg MS seca cruda detergente detergente neutro ácido Mazorca de maíz 980 83 324 120 Concentrado comercial (16 % 918 161 198 103 PC) Pasta de soya 943 437 110 47 Previo al ordeño, las vacas recibían 4.5 kg/vaca/día (base seca) de los suplementos experimentales en bolsas atadas a la cabeza. La duración de la ordeña era suficiente para que cada vaca consumiera el total del suplemento ofrecido; en caso contrario, la bolsa permanecía atada a la cabeza de la vaca hasta que esta consumiera la totalidad del suplemento.

Muestreo y análisis Los rendimientos de leche kg/vaca/día fueron registrados individualmente por dos días consecutivos, durante la última semana de cada periodo experimental (PE), utilizando una báscula colgante de 20 kg de capacidad. Después del registro individual del rendimiento de leche, se colectaron dos muestras de leche. A la primera muestra se le determinó la composición (grasa, proteína y lactosa), utilizando un analizador de leche por ultrasonido portátil dentro de las dos primeras horas posteriores a la ordeña. A la segunda muestra (40 ml), se le adicionó Bromopol como conservador manteniéndose en hielo hasta llegar a laboratorio. En el laboratorio las muestras se congelaron a -20°C hasta que fueron analizadas. Para poder ser analizadas las muestras se descongelaron a temperatura ambiente, y procesadas mediante la técnica de colorimetría enzimática(11) para la determinación de nitrógeno ureico en leche (NUL). El peso de las vacas se registró posterior a la ordeña durante dos días consecutivos al inicio del experimento y al final de la tercera semana de cada PE, utilizando una báscula ganadera portátil. La condición corporal se estimó después del pesaje(12). Se obtuvieron muestras de orina (60 ml) por estimulación vulvar posterior al pesaje por dos días consecutivos durante la última semana de cada PE. Las muestras se preservaron adicionándoles 15 ml de 0.05N H2SO4. Las muestras se congelaron a -20°C hasta que fueron analizadas. A las muestras se les determinó nitrógeno ureico por colorimetría(11). Las muestras de heces se colectaron en un envase de plástico con tapa y se almacenaron a -20°C. Posteriormente, las muestras de heces se colocaron en charolas de aluminio para 91


Rev Mex Cienc Pecu 2021;12(1):87-104

ser secadas en una estufa de aire forzado a 60°C por 48 h, y posteriormente molidas utilizando una criba de 1 mm. El nitrógeno en heces se determinó de acuerdo con el procedimiento estándar(13). Los suplementos se muestrearon diariamente durante la última semana de cada PE, se mezclaron para obtener una submuestra compuesta para la determinación de la composición química. A las muestras se les determinó la materia seca mediante el secado a 60°C en una estufa de aire forzado por 48 h, y las cenizas se obtuvieron por incineración de una submuestra en una mufla a 550°C. La PC fue determinada mediante la técnica Kjeldahl, y fibra detergente neutro y detergente ácido mediante la técnica de micro bolsas Ankom(13). La digestibilidad in vitro de la materia seca (DIVMS) de los suplementos, fue determinada utilizando la técnica de producción de gas in vitro(14).

Cálculos Leche a partir de energía y proteína de forrajes(8). Energía 𝐿𝐹 𝑒𝑛𝑒𝑟𝑔í𝑎 (𝑘𝑔) = LCE(kg) [𝐸𝑁𝐿 suplemento (Mcal) − 𝐸𝑁𝐿 𝑟𝑒𝑞 𝑐𝑎𝑚𝑏𝑖𝑜 𝑑𝑒 𝑃𝑉 (𝑀𝑐𝑎𝑙)] − 0.75 𝑀𝑐𝑎𝑙 / 𝑘𝑔 𝑙𝑒𝑐ℎ𝑒 en dónde LCE = leche corregida a energía (4% grasa, 3.4% proteína PC, kg) = leche (kg) x (0.124% grasa + 0.073% PC + 0.256). ENL = energía neta de lactación del suplemento (Mcal) = CMS (kg) x ∑𝑛𝑖=1 𝑝𝑜𝑟𝑐𝑒𝑛𝑡𝑎𝑗𝑒 de CMS del suplementoi + ENL del suplementoi (Mcal/kg), en dónde i = 1,2…n y n es el número de suplementos. ENL requerimientos (req) para cambio de PV (Mcal) = cambio de PV (kg) x EN L req (Mcal/kg de cambio de PV), en donde ENL (Mcal/kg de cambio de PV) = 5.34 Mcal/kg de ganancia de PV = -4.68 Mcal/kg de pérdida de PV. Proteína 𝐿𝐹 𝑝𝑟𝑜𝑡𝑒í𝑛𝑎 (𝑘𝑔) = LCP(kg) −

[PC supplemento (𝐾𝑔) − PC 𝑟𝑒𝑞 𝑐𝑎𝑚𝑏𝑖𝑜 𝑑𝑒 𝑃𝑉 (𝑘𝑔)] 0.088 𝑘𝑔 𝑑𝑒 𝑃𝐶 / 𝑘𝑔 𝑙𝑒𝑐ℎ𝑒

en dónde LCP = (leche corregida a proteína; 3.4% PC, kg) = leche (kg) x 0.294 % PC. PC del suplemento (kg) = CMS (kg) x ∑𝑛𝑖=1[ % 𝐶𝑀𝑆 𝑑𝑒𝑙 𝑠𝑢𝑝𝑙𝑒𝑚𝑒𝑛𝑡𝑜𝑖 𝑥 𝑃𝐶 𝑑𝑒𝑙 𝑠𝑢𝑝𝑙𝑒𝑚𝑒𝑛𝑡𝑜𝑖 (%)]

92


Rev Mex Cienc Pecu 2021;12(1):87-104

en donde i = 1,2…n, y n es el número de suplementos. Requerimientos (req) de PC para cambio de PV (kg) = cambio PV (kg) x PC req (kg de PC/ kg de cambio PV), dónde PC req (kg de PC/kg de cambio PV) = 0.078 kg de PC/kg de ganancia de PV = -0.094 kg de PC/kg de pérdida de PV.

Estimaciones de consumo de forraje

El consumo de materia seca de forraje se estimó indirectamente utilizando el método de energía metabolizable(15), tomando los requerimientos de energía metabolizable (EM) para las vacas(16). La EM estimada (EMe) provista por los suplementos fue substraída del total de requerimientos de EM, y el resultado dividido entre EMe del forraje para obtener el CMS de forraje estimado. El total del CMS fue la suma del el consumo de forraje y el consumo de los suplementos en base seca.

Análisis costo beneficio

El análisis costo beneficio fue realizado a partir del procedimiento de presupuestos parciales para determinar el costo por concepto de suplemento y los retornos por la venta de leche(17). Los presupuestos parciales evalúan únicamente los cambios en los gastos e ingresos derivados de la implementación de una alternativa (suplemento), sin considerar otros factores o actividades que no cambian tales como mano de obra, combustible, costo de pastoreo. Los resultados del análisis de costo beneficio están expresados en dólares de Estados Unidos ($ EUA).

Análisis estadístico

El diseño experimental fue un cuadro latino 3x3 repetido (con periodos de 21 días). Las secuencias de suplementos fueron aleatorizadas para el cuadro uno, y el cuadro dos funcionó como espejo en la secuencia de tratamientos para dar cuenta de efectos residuales. Los periodos experimentales duraron tres semanas, las primeras dos se consideraron como de adaptación a los suplementos y en los dos últimos días de la tercera semana se tomaron muestras y mediciones en las variables de respuesta. Las vacas fueron asignadas al azar a la secuencia de tratamientos en ambos cuadros. Las variables de respuesta fueron analizadas utilizando el procedimiento Proc Mixed del programa SAS(18) de acuerdo con la siguiente ecuación(19):

93


Rev Mex Cienc Pecu 2021;12(1):87-104

Yijkm =  + Sm + Ci(m) + Pj(m) + Supk + eijkm donde:  = media general, Sm = efecto fijo de los cuadros (m = 1 y 2), Ci(m) = efecto aleatorio de la vaca dentro de cuadro (i = 1, 2 y 3), Pj(m) = efecto fijo del periodo j dentro de cuadro m (j = 1, 2 y 3), Supk = efecto fijo del suplemento (k = S14, S16 y SC16), y eijkm = error residual. Diferencias significativas entre medias (P<0.05) fueron estimadas con la prueba de Tukey. Se realizó un análisis de correlación entre proteína en leche, NUL, nitrógeno en heces y nitrógeno ureico en orina utilizando el procedimiento Corr de SAS(18). Los coeficientes de correlación ≤0.39 se consideraron bajos, mientras que ≥0.40 y ≤0.60 se consideraron moderados.

Resultados Composición química de los suplementos

En el Cuadro 1 se muestra la composición química de los ingredientes utilizados en la elaboración de los suplementos y en el Cuadro 2 se muestra el nivel de inclusión de los ingredientes y la composición química de los suplementos. Los contenidos de MS, MO, FDN y FDA fueron numéricamente similares entre suplementos. Se observaron diferencias en la concentración de PC de acuerdo con lo balanceado con 141 para S14, 159 para S16 y 161 para SC16 g/kg MS. La DIVMS de S14 fue 5 y 9 % mayor que S16 y SC16, respectivamente. Una tendencia similar se observó para la energía metabolizable estimada (Eme) MJ/kg MS, S14 (12.6) fue mayor que S16 (12.0) y SC16 (11.4).

94


Rev Mex Cienc Pecu 2021;12(1):87-104

Cuadro 2: Nivel de inclusión y composición química de los suplementos con 14 % (S14) y 16 % (S16, SC16) de proteína cruda, ofrecido a vacas en un sistema agrosilvopastoril Nivel de inclusión (%) Mazorca de maíz Concentrado comercial (16 % PC) Pasta de soya Total

S14 50 50

Nutriente, g/kg MS Materia seca Materia orgánica Proteína cruda Fibra detergente neutro Fibra detergente ácido DIVMS Energía metabolizable estimada, MJ/kg MS

SC16

100

S16 46.5 46.5 7 100

907 842 141 190 90 800 12.6

889 846 159 174 84 758 12.0

918 813 161 198 103 729 11.4

100 100

DIVMS = Digestibilidad in vitro de la materia seca.

Variables de respuesta animal

El efecto de los suplementos sobre las variables CMS, rendimientos de leche, composición de leche y excreciones de N se observa en el Cuadro 3. No existieron diferencias significativas en las variables de respuesta debida a los suplementos (P>0.05). Los rendimientos promedio de leche fueron 6.8 ± 1 kg/vaca/día. Las concentraciones de grasa, proteína y lactosa fueron 20.8 ± 7, 31.0 ± 1, y 44.6 ± 2 g/kg, respectivamente. Peso vivo promedio fue 495 ± 53 (kg), y la condición corporal fue de 2.6 ± 0.1 puntos. No existieron diferencias en NUL debida a suplementos (P=0.47). El NUO fue mayor (P>0.01) para SC16 (44.1) que S14 (25.7) y S16 (23.9 mg/dl) (Cuadro 3). También, se determinaron diferencias para NH (P=0.04), S16 y SC16 fueron iguales, pero S16 fue diferente de S14.

95


Rev Mex Cienc Pecu 2021;12(1):87-104

Cuadro 3: Variables de respuesta de vacas en pastoreo con tres tipos de suplemento y dos niveles de proteína cruda (14 vs 16 % PC) Tratamiento S14 S16 SC16 P= EEM Consumo de MS, kg/día Leche, kg/día Grasa, g/kg Proteína, g/kg Lactosa, g/kg Peso vivo, kg Condición corporal NUL, mg/dl NUO, mg/dl NH, mg/g MS

12.9 6.7 22.9 31.0 44.9 491 2.5 23.3 25.7b 1.3a

12.8 6.7 22.0 30.8 44.1 491 2.7 22.4 23.0b 1.5b

13.0 6.9 17.4 31.3 44.9 503 2.5 29.7 44.1a 1.4ab

0.40 0.80 0.16 0.85 0.79 0.36 0.20 0.47 0.001 0.04

0.25 0.70 2.0 1.6 1.6 25.27 0.02 2.58 2.4 0.06

S14 = Mazorca de maíz + concentrado comercial lechero 16% (50:50); S16 = Mazorca de maíz (43 %) + concentrado comercial lechero 16% PC (50%) + Pasta de soya (7 %); SC16 = Concentrado comercial lechero (16 % PC). EEM= Error estándar de la media. NUL = Nitrógeno ureico en leche; NUO = Nitrógeno ureico en orina; NH = Nitrógeno en heces.

Existieron diferencias significativas entre periodos experimentales en algunas variables. El CMS disminuyó de 13.0 a 12.6 (3 %) del PE1 al PE3 (P=0.04). La concentración de proteína en leche disminuyó 6 y lactosa 7 % en los mismos PE. La mayor reducción entre periodos se observó en la concentración de NUL la cual decreció de 32.9 a 15.7 mg/dl, que representa una reducción de 52 % del PE1 al PE3. Existió una tendencia (P=0.08) para grasa en leche la cual decreció al avanzar los periodos experimentales (de 25.0 a 18.9). El resto de las variables de respuesta y excreciones de nitrógeno en orina y heces se mantuvo constante de principio a fin del experimento. En el Cuadro 4 se muestran los coeficientes de correlación entre rendimiento de leche (RL), proteína en leche (PL) NUL, NUO y NH. Se detectó una moderada pero significativa correlación entre PL y NUL (r= 0.49). Una correlación negativa entre PL y NH (r=-0.58, P<0.01), y NH con NUL (r= -0.48). Las restantes correlaciones fueron bajas y no significativas (P>0.05). Cuadro 4: Coeficiente de correlación entre leche kg/día, proteína en leche g/kg, nitrógeno ureico en leche (NUL) mg/dl, Nitrógeno en heces (NH) mg/g y Nitrógeno ureico en orina (NUO) mg/dl Proteína en NUL NH NUO leche Leche -0.32 -0.35 0.09 -0.12 Proteína en leche 0.49* -0.58** 0.36 NUL -0.48* 0.37 NH -0.39 * P<0.05, ** P<0.01.

96


Rev Mex Cienc Pecu 2021;12(1):87-104

Cálculos

Rendimientos de leche a partir de pastoreo

En el Cuadro 5 se muestran los cálculos de leche LF de acuerdo con los aportes de EM y PC a las necesidades de las vacas. Leche producida a partir de EM de forrajes no fue mayor a 1.0 kg/día, con una tendencia hacia una mayor LF cuando las vacas consumieron S14 (0.9) y SC16 (1.0), comparado con S16 (0.05 kg/día). Leche producida a partir de PC de forrajes fue en promedio 6.1 kg/vaca/día, sin efecto significativo debido a suplementos (P=0.74). Leche producida a partir de EM de forrajes fue en promedio 0.8 kg/día. La producción promedio de leche a partir de forraje (LFe + LFp/2) fue 3.3 kg/día lo que indica que el 49 % de los rendimientos de leche fueron debidos al consumo de forraje. Cuadro 5: Leche a partir de energía y proteína de forrajes de vacas en pastoreo en un sistema agrosilvopastoril, con tres tipos de suplemento y dos niveles de proteína cruda (14 vs 16 %) Tratamiento S14 S16 SC16 P= EEM LF energía, kg/día 0.9 0.5 1.0 0.06 0.32 LF proteína, kg/día 6.0 6.0 6.3 0.74 0.57 LF promedio, kg/día 3.1 3.3 3.6 0.13 0.39 LF energía = Leche a partir de energía de forrajes; LF proteína = Leche a partir de proteína de forrajes; y LF promedio = Promedio de leche a partir de forrajes.

Análisis de costo beneficio

En el Cuadro 6 se muestra el beneficio sobre costo de suplementación en dólares (EUA) del uso de suplementos en vacas en pastoreo. El SC16 tuvo el mayor costo 0.34 seguido por S16 0.29, siendo el más bajo para S14 0.28 $/kg, el cual fue 3 y 18 % más barato que S16 y SC16, respectivamente. La diferencia de producción total de leche entre S14 y SC16 fue solo de 3 %, mientras que los retornos fueron iguales entre ambos suplementos. El mayor margen de ganancia se obtuvo con S14 0.22 que fue 19 % mayor comparado con el más bajo que fue para SC16 de 0.18 $/kg.

97


Rev Mex Cienc Pecu 2021;12(1):87-104

Cuadro 6: Costos y retornos por concepto de suplementos $/kg ($ dólares EUA) de la producción de leche y tres tipos de suplemento Tratamiento S14 S16 SC16 Costo de suplemento, $/kg Costo total de suplemento Leche/tratamiento, kg Retornos totales Margen bruto Costo/retorno Costo de producción de leche, $/kg Leche precio de venta, $/kg Margen de ganancia, $/kg

0.28 516 2,523 1,058 544 0.49 0.20 0.42 0.22

0.29 546 2,514 1,054 509 0.52 0.22 0.42 0.20

0.34 634 2,596 1,088 455 0.58 0.24 0.42 0.18

S14 = Mazorca de maíz + concentrado comercial lechero 18 % (50:50); S16 = Mazorca de maíz (43 %) + concentrado comercial lechero 16 % PC (50%) + Pasta de soya (7 %); SC16 = Concentrado comercial lechero (16 % PC).

Discusión El uso de suplementos en este estudio contribuyó a mantener el consumo de materia seca y energía de las vacas evitando pérdidas de producción de leche y peso vivo sin importar el tipo de suplemento. Los suplementos tienen ventajas y desventajas para los productores. El suplemento S14 elaborado en la unidad de producción utilizando recursos locales como la mazorca de maíz, resultó ser de mayor valor nutricional al ser más digestible y con una mayor densidad energética, con un menor costo comparado con los otros dos suplementos. La desventaja de esta estrategia de acuerdo con los productores es que requiere de mayor mano de obra para realizar la mezcla, pero la mayor desventaja es la falta de asesoría técnica para balancear los suplementos que cubran de forma adecuada los requerimientos de las vacas(4,6). Los concentrados comerciales tienen la ventaja de que no se requiere mano de obra extra, sin embargo, su costo es mayor reduciendo las ganancias(20), así como su calidad no es la ideal juzgando por la menor DIVMS, mayor FDA y menor contenido de EM. La menor densidad energética de los suplementos S16 y SC16 pudo ser debida al mayor contenido de PC que reduce la EM. Una estrategia para reducir el desbalance entre PC y energía en suplementos, puede ser el uso de ingredientes energéticos como la melaza, almidón o grasa en situaciones en que las vacas consumen pastos de baja calidad(21,22). Los rendimientos de leche fueron menores a los reportados por vacas cruzadas (13.5 kg/vaca/día) pastoreando praderas de Cynodon nlemfuensis, y suplementadas con 5.1 kg/vaca/día de concentrado, y también menores a 14.5 kg/vaca/día en vacas cruzadas pastoreando en un sistema silvopastoril intensivo con leucaena y C. nlemfuensis recibiendo 5.5 kg de concentrado. Estos resultados fueron obtenidos en estudios 98


Rev Mex Cienc Pecu 2021;12(1):87-104

realizados bajo manejo intensivo de vacas y pastoreo(23), mientras que en este estudio se desarrolló bajo condiciones extensivas en una unidad de producción comercial, en dónde la producción de becerros destetados es igual de importante. Bajo este sistema de manejo los becerros permanecen con sus madres durante cinco horas diarias, mamando continuamente lo que contribuye a menores rendimientos de leche en la ordeña del siguiente día. Los rendimientos de leche y proteína en leche obtenidos en este estudio fueron similares a los 7.0 kg/vaca/día de leche y 32.3 g/kg de proteína en leche, fueron reportados y corresponden a vacas en condiciones de pastoreo extensivo en praderas de pastos tropicales nativos e introducidos, con cantidades de suplemento similares a las utilizadas en este estudio(24). La concentración de grasa fue más baja a los valores normales reportados en la literatura, pero similares a otro reporte (2 %) de unidades de producción de doble propósito en la misma región de estudio, y bajo condiciones similares de manejo(25). Una posible explicación de los bajos niveles de grasa en leche puede ser la calidad de fibra, ya que es bien sabido que los pastos tropicales son de baja calidad conteniendo altas cantidades de fracciones de FDN y baja digestibilidad(22). Los bajos contenidos de grasa en leche tienen implicaciones económicas, ya que los contenidos de grasa y proteína en leche son los principales componentes considerados para establecer el pago de leche al productor, en regiones del país en dónde la producción de leche está vinculada a la industria lechera; sin embargo, no es el caso en la región de estudio, ya que el pago de la leche a los productores no se determina en base a su composición. En este estudio, las bajas concentraciones de grasa pueden deberse a un efecto temporal(25), debido a la baja disponibilidad y calidad de forrajes por la época de estiaje. La correlación entre NUL y proteína en leche en este estudio indican una relación lineal. Ambas variables tuvieron una alta concentración al inicio del experimento y en la medida que este progresó la concentración en ambas también disminuyó. Proteína en leche y NUL estuvieron negativamente correlacionadas con NH, lo que indica que las dos primeras decrecieron del PE1 al PE3, mientras que el NH tendió a incrementarse. Los resultados en este estudio demuestran la importancia de los árboles y los arbustos de los cuales muchos son leguminosas presentes en el sistema agrosilvopastoril(9) como fuentes de PC para vacas en lactación. Los forrajes aportaron 62, 11 y 89 % de las necesidades de CMS, EM y PC, respectivamente para mantenimiento y producción. Estos resultados muestran también la importancia de los suplementos para mantener rendimientos de leche y peso vivo. El valor promedio de NUL fueron mayores a los valores de referencia de 12 mg/dL(26), lo cual indica que las vacas consumieron PC en exceso a sus requerimientos. Basado en lo anterior, los suplementos pueden balancearse con menores concentraciones de PC y una mayor densidad energética, utilizando fuentes de energía rápidamente disponible a nivel 99


Rev Mex Cienc Pecu 2021;12(1):87-104

ruminal como la melaza, así como nitrógeno no proteico (urea) con el objetivo de optimizar la captura de amoniaco a nivel ruminal(27). La reducción de PC en los suplementos no solo permitirá reducciones en el costo de producción, ya que la proteína es el ingrediente de mayor costo en la dieta de las vacas(22), sino que también permitirá el incremento de la utilización de la PC de los forrajes, reduciendo principalmente las excreciones de nitrógeno en heces y orina al medio ambiente(27). Pero, para poder determinar el nivel adecuado de PC en el suplemento, el NUL debe ser monitoreado constantemente para poder hacer ajustes a la dieta de las vacas de forma apropiada(28). La reducción de las concentraciones de NUL (52 %) que se observó en el último PE (avanzada época de estiaje), indica que una disminución en la disponibilidad y sobre todo valor nutricional del forraje consumido por las vacas, a partir del menor CMS observado; sin embargo, lo anterior no afectó el comportamiento productivo de las vacas. En un estudio diferente en la misma unidad de producción(5), se documentó la disminución de la calidad nutricional de los pastos disponibles para vacas en pastoreo, observándose una disminución de 34 % en el contenido de PC, un incremento de 12 y 15 % en FDN y FDA, así como una reducción de 14 % en la DIVMS de inicio de la época de estiaje a finales de ésta. La reducción de los niveles de NUL disminuirá las excreciones de N en orina. Sin embargo, existen evidencias de que las emisiones de N2O a partir de NUO son menores en sistemas silvopastoriles comparado con sistemas de pastoreo en monocultivos(29). Lo anterior concuerda con una amplia revisión de literatura(30), en la cual se muestra que forraje proveniente de leguminosas leñosas (que contienen taninos condensados) mejoran el reciclaje de N, reducen la volatilización de este, disminuyendo las emisiones N2O y pérdidas de N. La sostenibilidad de unidades de producción de doble propósito en la región de estudio fue evaluada considerando las escalas agroecológicas, socio-territorial y económica. En las dos primeras, los puntajes de sostenibilidad fueron altos (87 y 73 de 100 puntos, respectivamente), pero la escala económica tuvo el menor puntaje (56 de 100 puntos), convirtiéndose en el factor limitante en las unidades de producción. La dependencia de insumos externos como los concentrados comerciales, aunado al bajo o nulo valor agregado a la producción de leche fueron los indicadores que limitaron la sostenibilidad en la escala económica(20). Por lo tanto, el desarrollo de estrategias de alimentación basadas en el uso de recursos locales como las especies leñosas, bancos de proteína durante la época de estiaje, aunado a la formulación de suplementos utilizando recursos locales como maíz mazorca y melaza (fuente de energía rápidamente disponible), incrementará le eficiencia de la utilización de forrajes de baja calidad durante la época de estiaje a bajo costo.

100


Rev Mex Cienc Pecu 2021;12(1):87-104

Conclusiones e implicaciones Bajo las condiciones en las que se realizó este estudio, es posible reducir los costos de producción al utilizar suplementos con un contenido de 14 % de PC e incluso menor, elaborados con mazorca de maíz producido en la unidad de producción sin afectar los rendimientos productivos de las vacas, peso o condición corporal. Vacas en sistemas agrosilvopastoriles obtuvieron 50 % de los requerimientos energía y proteína cruda para mantenimiento y producción de leche a partir del pastoreo. Los altos niveles de nitrógeno ureico en leche indicaron que las vacas en un sistema agrosilvopastoril consumieron forrajes ricos en proteína cruda. Para maximizar el aprovechamiento de este tipo de recursos forrajeros se debe incluir fuentes de energía rápidamente disponible en las raciones de vacas de forma que el balance entre energía y proteína cruda sea adecuado. Por lo tanto, es importante monitorear los niveles de NUL como una herramienta que ayude a determinar el correcto nivel de PC en los suplementos, con el fin de evitar excesos de proteína cruda en las dietas de las vacas.

Agradecimientos

Se agradece la cooperación del titular de la unidad de producción participante. A la Universidad Autónoma del Estado de México por el financiamiento al proyecto de investigación (UAEM 2564/2007U); así como a la SEP-PROMEP (103.5/07/2781). Al Consejo Nacional de Tecnología por la beca de posgrado del primer autor. Finalmente, a los árbitros por las sugerencias para mejorar este trabajo. Literatura citada: 1.

IndexMundi. Agricultural production, supply www.indexmundi.com/agriculture/. Accessed July 15, 2019.

and

distribution.

2.

Lactodata Información sobre el sector lechero. Reporte 11 www.lactodata.info/produccion-de-leche-de-vaca. 2017. Consultado julio 2, 2018.

3. Albarrán-Portillo B, Rebollar-Rebollar S, García-Martínez A, Rojo-Rubio R, AvilésNova F, Arriaga-Jordán CM. Socioeconomic and productive characterization of dual purpose farms oriented to milk production in a subtropical region of Mexico. Trop Anim Health Prod 2015;47:519-523. 4. Absalón-Medina VA, Blake RW, Gene Fox D, Juárez-Lagunes EG, Nicholson FC, Canudas-Lara EG. Limitations and potentials of dual-purpose cow’s herds in central coastal Veracruz, Mexico. Trop Anim Health Prod 2011;44:1131-1142. https://doi.org/10.1007/s11250-011-0049-1.

101


Rev Mex Cienc Pecu 2021;12(1):87-104

5. Salas-Reyes IG, Arriaga-Jordán CM, Estrada-Flores JG, García-Martínez A, RojoRubio R, Vázquez-Armijo JF, et al. Productive and economic response to partial replacement of cracked maize ears with ground maize or molasses in supplements for dual-purpose cows. Rev Mex Cienc Pecu 2019;10(2):335-352. https://doi.org/10.22319/rmcp.v10i2.4569. 6. Deen AU, Tyagi N, Yadav RD, Kumar S, Tyagi AK, Kumar Singh, S. Feeding balanced rations can improve the productivity and economics of milk production in dairy cattle: a comprehensive field study. Trop Anim Health Prod 2019;51:737-744 https://doi.org/10.1007/s11250-018-1747-8. 7. Charbonneau E, Chouinard PY, Allard G, Lapierre H, Pellerin D. Milk from forage as affected by carbohydrates source and degradability with alfalfa silage-based diets. J Dairy Sci 2006;89:283-293. 8. Charbonneau E, Bregard A, Allard G, Lefebvre D, Pellerin D. Revisiting the prediction of milk from forage according to NRC 2001 [abstract]. Can J Anim Sci 2003; 83:647. 9. Albarrán-Portillo B, García-Martínez A, Ortiz-Rodea A, Rojo-Rubio R, VázquezArmijo JF, Arriaga-Jordán CM. Socioeconomic and productive characteristics of dual purpose farms based on agrosilvopastoral systems in subtropical highlands of central Mexico. Agroforest Syst 2018;93:1939-1947. doi: 10.1007/s10457-0180299-2. 10. Grazing terminology. Terminology for grazing lands grazing animals. Forage information system. Oregon State University. Accessed April 2nd 2020. https://forages.oregonstate.edu/fi/topics/pasturesandgrazing/grazingsystemdesign/g razingterminology. 11. Broderick GA, and Clayton MK. A statistical evaluation of animal and nutritional factors influencing concentrations of milk urea nitrogen. J Dairy Sci 1997;80:2964– 2971. doi:10.3168/jds.S0022-0302(97)76262-3. 12. Wildman EE, Jones GM, Wagner PE. A dairy cow body condition scoring system and its relationship to select production characteristics. J Dairy Sci 1982;265:495-501. 13. AOAC. Official Methods of Analysis. 15th ed. AOAC International, Arlington, VA, USA. 2000. 14. Mauricio MR, Mould FL, Dhanoa MS, Owen E, Channa K, Theodorou MK. A semiautomated in vitro gas production technique for ruminant feedstuff evaluation. Anim Feed Sci Technol 1999;79(4):321-330. 15. Baker RD. Estimating herbage intake from animal performance. In: Leaver JD editor. Herbage Intake Handbook. Hurley: British Grassland Society. UK. 1982:77-93.

102


Rev Mex Cienc Pecu 2021;12(1):87-104

16. AFRC. Agricultural and Food Research Council. An advisory manual prepared by the AFRC Technical Committee on Responses to Nutrients. Wallingford: CAB International. 1993. 17. Harper JK, Cornelisse S, Kime LF, Hyde J. Budgeting for agricultural decision making. Pennsylvania State University. College of Agricultural Sciences. 2013. https://extension.psu.edu/budgeting-for-agricultural-decision-making. Accessed November 19, 2018. 18. SAS. SAS/STAT User’s guide. (Version 9 ed.). Cary, NC, USA. 1989. 19. Kononoff PJ, Handford KJ. Technical Note: Estimating statistical power of mixed models used in dairy nutrition experiments. Faculty Papers and Publications in Animal Science. Paper 725. 2006 http://digitalcommons.unl.edu/animalscifacpub/725. 20. Salas-Reyes IG, Arriaga-Jordán CM, Rebollar-Rebollar S, García-Martínez A, Albarrán-Portillo B. Assessment of the sustainability of dual-purpose farms by the IDEA method in the subtropical area of central Mexico. Trop Anim Health Prod 2015;47:1187-1194. 21. Gehman AM, Bertrand JA, Jenkins TC, Pinkerton BW. The effect of carbohydrate source on nitrogen capture in dairy cows on pasture. J Dairy Sci 2006;89(7):26592667. 22. Granzin BC, Dryden G McL. Monensin supplementation of lactating cows fed tropical grasses and cane molasses or grain. Anim Feed Sci Technol 2005;120:1-16. 23. Bottini-Luzardo MB, Aguilar-Pérez CF, Centurión-Castro FG, Solorio-Sánchez FJ, Ku-Vera JC. Milk yield and blood urea nitrogen in crossbred cows grazing Leucaena leucocephala in a silvopastoral system in the Mexican tropics. Trop GrasslandsForrajes Trop 2016; 4:159–167. doi:10.17138/TGFT(4)159-167. 24. Salvador-Loreto I, Arriaga-Jordán CM, Estrada-Flores JG, Vicente-Mainar F, GarcíaMartínez A, Albarrán-Portillo B. Molasses supplementation for dual-purpose cows during the dry season in subtropical Mexico. Trop Anim Health Prod 2016;48(3):643-648. doi:10.1007/s11250-016-1012-y. 25. Morales CH, Montes AH, Villegas De Gante AZ, Mandujano EA. El proceso sociotécnico de producción de Queso Añejo de Zacazonapan, Estado de México. Rev Mex Cienc Pecu 2011;2:161–176. 26. Kohn RA, Kalscheur KF, Russek-Cohen E. Evaluation of models to estimate urinary nitrogen and expected milk urea nitrogen. J Dairy Sci 2002;85:227-233. 27. Tamminga S. Nutrition management of dairy cows as a contribution of pollution control. J Dairy Sci 1992;75:345-357.

103


Rev Mex Cienc Pecu 2021;12(1):87-104

28. Jonker JS, Kohn RA, High J. Use of milk urea nitrogen to improve dairy cow diets. J Dairy Sci 2002;85:939-946. 29. Rivera JL, Chára J, Barahona R. CH4, CO2, and N2O emissions from grasslands and bovine excreta in two intensive tropical dairy production system. Agroforest Syst 2019;93:915-928. https://doi.org/10.1007/s10457-018-0187-9. 30. Vandermeulen S, Ramírez-Restrepo CA, Beckers Y, Claessens H, Bindelle,J. Agroforestry for ruminants: a review of trees and shrubs as fodder in silvopastoral temperate and tropical production systems. Anim Prod Sci 2018;58:767-777. https://doi.org/10.1071/AN16434.

104


https://doi.org/10.22319/rmcp.v12i1.5076 Artículo

Manejo nutricional de novillos criados en pastoreo y en corral: efectos en el consumo, digestibilidad, rendimiento y viabilidad económica Sinvaldo Oliveira de Souza*a Robério Rodrigues Silva a Fabiano Ferreira da Silva a Ana Paula Gomes da Silva a Marceliana da Conceição Santos a Rodrigo Paiva Barbosa a Raul Lima Xavier a Tarcísio Ribeiro Paixão a Gabriel Dallapicola da Costa a Adriane Batista Peruna a Mariana Santos Souza a Laize Vieira Santos a

a

Universidade Estadual do Sudoeste da Bahia. BR 415, KM 04, S/N, CEP 45700-000 Itapetinga, Bahia, Brasil.

*Autor de correspondencia: sinvalsouza79@hotmail.com

Resumen: Este estudio buscó evaluar la ingesta y digestibilidad de nutrientes, el rendimiento y la viabilidad económica de novillos alimentados con Brachiaria brizantha cultivar Marandú y criados bajo sistemas de pastoreo y engorda en corral. Se utilizaron 50 novillos cruzados en fase de crecimiento con un peso medio de 275 ± 8.18 kg. Los novillos se distribuyeron en un diseño completamente al azar con 10 repeticiones por tratamiento: suplementación mineral, suplementación de nitrógeno, suplementación del concentrado en el orden de 1

105


Rev Mex Cienc Pecu 2021;12(1):105-119

y 2 g/kg de peso corporal y engorda total en corral total. El consumo de materia seca total y el peso corporal fueron significativamente diferentes (P<0.05) para los animales en engorde en corral. La proteína cruda, el extracto etéreo, la fibra detergente neutra corregida para cenizas y proteína, los carbohidratos no fibrosos y los nutrientes digestibles totales fueron diferentes en los animales suplementados con minerales en comparación con los otros tratamientos. El mismo rendimiento se observó en los animales en engorde. Los coeficientes de digestibilidad de materia seca, proteína cruda, extracto etéreo, carbohidratos no fibrosos y nutrientes digestibles totales en los animales suplementados con minerales fueron significativamente diferentes (P<0.05) a los otros tratamientos. (P<0.05). La ganancia diaria promedio fue menor (P<0.05) en los animales suplementados con animales. El mayor margen bruto (P<0.05) se observó en los animales bajo engorde en corral. Los resultados obtenidos en este estudio indican que los animales en pastoreo con una buena disponibilidad de materia seca presentan un rendimiento satisfactorio. Es factible confinar a los animales en fase de cría debido a que se acorta el ciclo de producción y se obtienen resultados económicos favorables. Palabras clave: Ganado bovino, Ingesta, Manejo, Nutrientes.

Recibido: 26/09/2018 Aceptado: 12/03/2020

Introducción En regiones tropicales, el pastoreo es la principal fuente de nutrientes para la producción de bovinos de carne. Los pastos tropicales son la base del sistema de pastoreo bovino y proporcionan sustratos energéticos de bajo costo, principalmente carbohidratos fibrosos(1). Sin embargo, sin el uso de suplementos alimenticios, estos pastos muy pocas veces cubren los requerimientos nutricionales de los animales, los cuales varían a lo largo del año. Estas deficiencias nutricionales, principalmente proteica y energética(1), ocasionan un menor rendimiento animal. El consumo de materia seca es sin duda uno de los factores más importantes para el rendimiento y mantenimiento de los animales, ya que es la principal fuente de nutrientes energéticos y proteicos. Por lo tanto, la suplementación animal se utiliza para obtener ganancias adicionales encaminadas al objetivo del productor. Esta suplementación se logra con el consumo de forrajes y minerales, los cuales aumentan la ingesta de nutrientes y mejoran su digestibilidad. Así, un programa de producción de carne continua que busque ser eficiente y competitivo debe buscar eliminar las fases negativas del proceso de producción, proveyendo al animal con condiciones de desarrollo favorables durante todo el año para alcanzar las

106


Rev Mex Cienc Pecu 2021;12(1):105-119

condiciones de matanza temprana. Una alternativa para que los animales sean sacrificados más jóvenes es mantenerlos en un sistema de pastoreo durante la temporada de lluvias, donde la disponibilidad de forrajes de buen valor nutricional aumenta, reduciendo los costos de producción, y confinarlos durante periodos de restricción alimentaria. Además de mejorar el producto final, acelera la rotación de capital, reduce la población en pastoreo y aumenta la escala de producción de la propiedad. El objetivo de este estudio fue evaluar la ingesta y digestibilidad de nutrientes, el rendimiento y la viabilidad económica de novillos cruzados alimentados con Brachiaria brizantha cultivar Marandú y criados bajo sistemas de pastoreo y engorda en corral.

Material y métodos El trabajo de campo se realizó en la finca Princesa do Mateiro, ubicada en el municipio de Ribeirão do Largo, Bahía, Brasil, en las coordenadas 15° 26′ 46″ S y 40° 44′ 24″ O. Las 14 ha que formaron el área de estudio fueron divididas en 12 parcelas de aproximadamente 1.17 ha cada una, cultivadas con Brachiaria brizantha cultivar Marandú. El experimento inició en febrero de 2017 y concluyó en junio de 2017. Se emplearon 50 novillos Holstein x Cebú machos con un peso inicial promedio de 275 ± 8.18 kg y 12 meses de edad. Los animales se distribuyeron en un diseño completamente al azar con diez repeticiones por tratamiento. Suplementación mineral ad libitum (SM); suplementación de nitrógeno ad libitum (SN); concentrado, 0.1% del peso corporal (SC1); concentrado, 0.2% del peso corporal (SC2), engorde a corral (C3). En el Cuadro 1 se describe la proporción de cada ingrediente en las dietas. Cuadro 1: Composición de los suplementos en g.kg-1 con base en su materia seca Sal Engorda Ingrediente Nitrógeno Concentrado mineral en corral Grano de maíz 850 2 Engordim pellet 150 Grano de sorgo 560 molido Pasta de soya 200 Urea 250 150 1 Sal mineral 1000 750 90 Total 1000 1000 1000 1000 1

Minerales: Calcio 175 g, Fósforo 60 g, Sodio 107 g; Azufre 12 g, Magnesio 5000 mg, Cobalto 107 mg, Cobre 1300 mg, Yodo 70 mg, Manganeso 1,000 mg, Selenio 18 mg, Zinc 4,000 mg, Hierro 1,400 mg, Flúor (máximo) 600 mg. 2 Vitamina A (mín) 35,000 UI/ kg, Vitamina D3 (mín) 7,000 UI/ kg, Vitamina E (mín) 50 UI/ kg, Cobre (mín) 50 mg/kg, Manganeso (mín) 200 mg/ kg, Cobalto (mín) 0.6 mg/ kg, Yodo (mín) 3 mg/ kg, Selenio (mín) 1.2 mg/kg, Cromo 20-50 g/kg, Fósforo (mín) 8,000 mg/kg, Potasio (mín) 20 g/kg, Sodio (mín) 10 g/kg, Azufre (mín) 5000 mg/ kg, proteína cruda (mín) 360 mg/kg, NNP 180 g / kg, Extracto etéreo (máx) 25 g/kg, Materia mineral (máx) 350 g/kg, Fibra cruda (máx) 100 g/kg, Fibra detergente ácido (máx) 200 g/kg, Monensina de sodio 120 mg/kg, Virginiamicina 125 mg/kg.

107


Rev Mex Cienc Pecu 2021;12(1):105-119

Evaluación del forraje

Se empleó el método de pastoreo rotacional, con siete días de pastoreo y 28 días de descanso. El forraje se evaluó cada 28 días. Para reducir la influencia de la variación de la biomasa entre parcelas, los novillos pastaban durante 7 días en una parcela y después de ese periodo eran transferidos a una parcela diferente, el orden de las parcelas fue aleatoriamente preestablecido. Se utilizó la metodología descrita por McMeniman para estimar la disponibilidad de materia seca(2). La biomasa de materia seca residual (MSR) se estimó en los cuatro estacas de acuerdo con el método de doble muestreo(3). Antes del corte, la biomasa de materia seca se estimó de forma visual, utilizando los valores de corte, cuando el cuadrado se arrojó 60 veces y la biomasa del forraje se expresó en kg/ha(4). La técnica de triple emparejamiento se utilizó para evaluar la acumulación de biomasa en relación con el tiempo(5); los cuatro estacas que permanecieron cercados durante 28 d funcionaron como jaulas de exclusión. La acumulación de MS durante el periodo experimental se calculó multiplicando el valor de la tasa de acumulación diaria por el número de días en el periodo. La tasa de acumulación diaria de MS se estimó con la ecuación propuesta por Campbell(6).

Ensayos de digestibilidad La excreción fecal de animales en pastoreo se determinó utilizando 10 g/ animal/ día de óxido de cromo contenido en cartuchos de papel y suministrados oralmente a las 0600 h durante 12 d. Los siete días iniciales fueron para regular el flujo de excreción del indicador; en los últimos cinco días se colectó la materia fecal. La excreción fecal se estimó por medio de la proporción de indicador suministrado y su concentración en las heces(7). La concentración de óxido de cromo en las heces se determinó en Laboratorio de Nutrición Animal de la DZO/UFV por absorción atómica(8). El consumo de materia seca (MS) se determinó con una mezcla del suplemento y 15 g/ animal/ d de dióxido de titanio (TiO2), como marcador externo; la mezcla se proporcionó a los animales a las 1000 h(9). La concentración de titanio se calculó con base a la metodología descrita por Detmann et al(10). En el caso de los animales en engorde a corral, la digestibilidad aparente y el consumo de materia seca (CMS) se estimaron a partir de la producción fecal. La fibra detergente neutro indigestible (FDNi) se utilizó para calcular la producción fecal. En el caso de los animales en engorde a corral, únicamente se calculó el CMS; el cálculo se realizó a partir de la producción fecal diaria y el contenido de FDNi en la dieta total.

108


Rev Mex Cienc Pecu 2021;12(1):105-119

El forraje y el material obtenido de cada animal fue etiquetado y almacenado en bolsas de plástico a -10 °C. En el laboratorio, estas muestras fueron descongeladas y secadas de acuerdo con su día de colección en un horno de ventilación forzada a 55 ºC durante 72 h. Posteriormente, las muestras fueron trituradas en un molino Willey con tamiz de malla de 1 y 2 mm. El consumo voluntario de la materia seca correspondiente al forraje (CMSF) se determinó utilizando FDNi como marcador interno, éste se obtuvo después de 288 h de incubación in situ(10).

Análisis químico Las muestras deshidratadas del suplemento, forraje y heces fueron analizadas conforme a la AOAC para determinar su contenido de MS, materia mineral (MM), proteína cruda (PC), fibra detergente neutro corregido para cenizas y proteínas (FDNcp) y fibra detergente ácido (FDA)(11). El contenido extracto etéreo (EE) se analizó utilizando el extractor Ankom® (XT15)(12). El contenido de carbohidratos no fibrosos (CNFcp) se calculó con la ecuación(13): CNFcp = 100 – [(% de PC − (% de PC de la urea + % de urea) + %FDNcp + % de EE + % de cenizas], donde PC, contenido de proteína cruda en el concentrado; % de PC de la urea, equivalente proteico de la urea; % de urea, contenido de urea en el concentrado; EE, extracto etéreo; FDNcp, fibra detergente neutro corregido para cenizas y proteínas. Todos los términos se expresan como % de MS. Los nutrientes digestibles totales (NDT) se calcularon(14): La FDNcp y los CNFcp se calcularon con la siguiente ecuación: NDT (%) = PCD + FDNcp + CNFcp + 2.25 EE, donde PCD = PC digestible; CNFcp = carbohidratos no fibrosos. La composición química de los alimentos utilizados en las dietas experimentales se describe en el Cuadro 2. Cuadro 2: Composición química en base seca del forraje y concentrado (g/ kg)

Materia seca Materia mineral Proteína cruda Extracto etéreo FDNcp CNFcp FDA NDT

Brachiaria brizantha

Concentrado

Engorda en corral

222 97.6 95 17.5 652 139 315.9 569.3

893 107 45 36.6 16 243.7 57.6 569.2

900 80 180 1.35 170 600 48.2 600

1

Pastoreo simulado, FDNcp = Fibra detergente neutro corregida para cenizas y proteínas, CNFcp = Carbohidratos no fibrosos, FDA = Fibra detergente ácido, NDT = Nutrientes digestibles totales.

109


Rev Mex Cienc Pecu 2021;12(1):105-119

Rendimiento animal Los animales se pesaron al inicio y al final del experimento, también se realizaron pesajes intermedios cada 28 días para calcular la ganancia diaria de peso y ajustar la cantidad de suplemento. El peso se determinaba después de 12 h de ayuno. Los suplementos se proporcionaban todos los días en contenedores de plástico sin cubierta. El suplemento se ofrecía una vez al día, siempre a la misma hora (1000 h). Los animales en engorde a corral se pesaron cada 14 días sin ayuno previo. Los suplementos se proporcionaron diario en un comedero cubierto. El suplemento se ofreció dos veces por día, en la mañana y en la tarde. El rendimiento animal se determinó con la diferencia entre el peso vivo inicial (PVI) y el peso vivo final (PVF), dividida entre los días del periodo experimental. La conversión alimenticia (CA) se determinó con base en el consumo y el rendimiento.

Evaluación económica El estudio de viabilidad económica se realizó considerando que el productor ya tenía implantado el sistema de crianza animal. Es necesario considerar que los grupos recibieron sales minerales, sales de nitrógeno, 1 a 2 g/kg de peso corporal de un concentrado suplementado con 60% de proteína cruda en su dieta. Las fórmulas empleadas para determinar los costos del sistema fueron: CT = Costo total = costos de operación + oportunidad + terreno Margen bruto = ingresos (valor de venta del animal) - costo de operación efectivo Margen neto = (ingresos) - costo de operación total; Ganancia neta = ingresos - costo total Rentabilidad = (ganancia neta / costo total * 100) IMA = ingreso mensual de la actividad = (ingreso neto por animal / costo por animal × 100) / periodo experimental) × 30 días del mes. Precios del suplemento/kg = US$ 0.39 para la sal mineral; US$ 0.34 para la sal de nitrógeno; US$ 0.24 para el engorde a corral semi-intensivo. 1 y 2 g/kg de peso corporal, US$ 0.28 para engorde a corral. Los datos de consumo, digestibilidad, rendimiento y viabilidad económica se sometieron a un análisis de varianza, considerando 0.05 como un valor crítico de probabilidad. La comparación de los tratamientos se realizó por medio de la descomposición en suma de cuadrados, relacionada con esta fuente mediante contrastes ortogonales, excepto la viabilidad económica.

Resultados Características del forraje El pastoreo presentó una disponibilidad media de 3,904.59 kg de materia seca por hectárea (Cuadro 3).

110


Rev Mex Cienc Pecu 2021;12(1):105-119

Cuadro 3: Disponibilidad de materia seca y componentes morfológicos de Brachiaria Brizantha cultivar Marandú Componentes

Media

Disponibilidad de materia seca total, kg/ha Materia seca potencialmente digestible, kg/ha Suministro de forraje, kg (PV) Suministro de forraje potencialmente digestible, kg (PV) Materia seca verde

3,904.59 2,319 12.80 8.00 3,232 El consumo de materia seca proveniente del forraje fue similar (P>0.05) entre los animales en pastoreo, independientemente del manejo adoptado. El CMS total y el consumo como función del PV no fueron significativamente diferentes (P>0.05) en los animales que recibieron suplementación animal en comparación con los otros tratamientos (Cuadro 4). Cuadro 4: Características del forraje en función del manejo: suplementación mineral, concentrado proteico/energético en Brachiaria brizantha cultivar Marandú proporcionado en pastoreo o en corral Contrastes Manejo nutricional

MSFO MS total MS (%PV) PC FDNcp EE CNFcp NDT

SM x TD

SN x (1;2)

SC1 x SC2

C3 x (1;2)

SM

SN

SC1

SC2

C3

6.31 6.31

6.42 6.42

6.19 6.45

5.94 6.59

----9.1

CV % 18.77 0.188 0.4770 0.6654 -----13.71 0.539 0.1210 0.8485 <.001

2.04

2.07

2.02

2.12

2.43

9.7

0.207 0.3419 0.8482 <.001

0.65 4.15 0.10 0.92 3.67

0.69 4.18 0.10 0.98 3.93

0.74 4.08 0.11 1.02 3.97

0.95 3.98 0.12 1.05 4.06

1.82 1.54 0.18 5.06 6.91

18.61 12.6 17.6 24.25 17.88

<.001 <.001 0.001 <.001 0.014

0.3002 <.0001 0.2124 0.5623 0.4464

0.1290 0.3220 0.3220 0.7589 0.4103

<.001 <.001 <.001 <.001 <.001

SM x TD = Sal mineral versus otros manejos nutricionales; NS x (SC1; SC2): sal nitrogenada vs concentrado; SC1 x SC2: concentrado a 1 g/kg de PV vs concentrado a 2 g/kg de PV; C3 x (1;2): engorda en corral vs concentrado. Consumo de materia seca total (kg/día), consumo de materia seca con base al peso vivo (CMS %PV), proteína cruda (PC), extracto etéreo (EE), fibra detergente neutro corregida para cenizas y proteína (FDNcp), carbohidratos no fibrosos (CNF), nutrientes digestibles totales (NDT) para animales en pastoreo.

PC, FDNcp, EE, CNF y NDT fueron significativamente diferentes (P<0.05) en los animales que recibieron sales minerales, en comparación con los otros tratamientos. La PC y FDNcp en los animales en pastoreo que recibieron sales de nitrógeno difirieron

111


Rev Mex Cienc Pecu 2021;12(1):105-119

(P<0.05) de aquellos que recibieron 1 y 2 g/kg de peso corporal de concentrado proteico/energético. La MS total, PC, FDNcp, EE, CNF y NDT fueron significativamente diferentes (P<0.05) en los animales en engorde a corral al compararlas con los animales en pastoreo que recibieron 1 y 2 g/kg de peso corporal de concentrado proteico/energético. La MS, FDNcp, EE, CNFcp y NDT fueron significativamente diferentes (P<0.05) en los animales en pastoreo suplementados con una mezcla mineral, esto en comparación con los otros tratamientos (Cuadro 5). Cuadro 5: Digestibilidad aparente de materia seca (MS), proteína cruda (PC), fibra detergente neutro corregida para cenizas y proteínas (FDNcp), extracto etéreo (EE), carbohidratos no fibrosos (CNF), nutrientes digestibles totales (NDT) en (%) de materia seca Contrastes Manejo nutricional

MS PC FDNcp EE CNF NDT

SM

SN

SC1

57.07 44.70 61.60 66.40 66.91 56.86

57.20 51.60 64.40 64.10 65.96 57.71

58.80 52.50 61.40 67.80 70.41 56.30

SC2

C3

CV % 61.60 76.1 3.27 66.50 80.0 13.16 63.70 76.3 4.44 68.80 82.2 8.96 71.47 81.80 9.55 58.86 68.02 3.77

SM x TD

SN x (1;2)

SC1 x SC2

C3 x (1;2)

<.001 0.375 <.001 <.001 <.001 <.001

<.0001 <.0001 0.0393 0.0282 0.0174 0.8548

0.0020 0.0008 0.0286 0.6334 0.6881 0.0019

<.001 <.001 <.001 <.001 <.001 <.001

Niveles de probabilidad descriptiva para el error de tipo I asociado a pruebas ortogonales para las comparaciones entre los diferentes tratamientos. SM x TD: Sal mineral vs otros manejos nutricionales; NS x (1;2): Sal de nitrógeno vs Concentrado; SC1 x SC2: Concentrado a 1 g/kg de PV vs Concentrado a 2 g/kg de PV; C3 x (0.1;0.2): Engorda en corral vs Concentrado

Se observaron diferencias (P<0.05) en el contenido de MS, PC, EE, FDNcp y CNF entre animales en pastoreo suplementados con sales de nitrógeno y aquellos suplementados con 1 y 2 g/kg de PV de concentrado. Se observó el mismo rendimiento para la MS, PC, FDNcp y NDT de los animales en pastoreo suplementados con 1 y 2 g/kg de PV de concentrado (Cuadro 6). Los coeficientes de MS, PC, FDNcp, EE, CNF y NDT fueron significativamente diferentes (P<0.05) en los animales confinados en comparación con aquellos en pastoreo que recibieron 1 y 2 g/kg de peso corporal de concentrado proteico/energético.

112


Rev Mex Cienc Pecu 2021;12(1):105-119

Cuadro 6: Peso vivo inicial (PVI, kg), peso vivo final (PVF), ganancia diaria promedio (GDP) y conversión alimenticia (CA) de novillos en diversos sistemas de crianza Contrastes Manejo nutricional

PVI PVF GDP CA

SM

SN

SC1

SC2

C3

275 344 0.50 13.90

274 346 0.52 12.47

275 361 0.62 12.36

274 348 0.53 10.48

288 370 1.52 5.28

CV % 17.59 14.88 24.11 33.09

SM x TD

SN x (1;2)

SC1 x SC2

C3 x (1;2)

0.849 0.375 <.001 0.130

0.4587 0.5247 0.4796 0.9070

0.9455 0.3565 0.2780 0.0399

0.963 0.679 <.001 <.001

SM x TD: Sal mineral vs otros manejos nutricionales; NS x (SC1; SC2): Sal de nitrógeno vs Concentrado; SC1 x SC2: Concentrado a 1 g/kg de PV vs Concentrado a 2 g/kg de PV; C3 x (SC1; SC2): Engorda en corral vs Concentrado

En cuanto al comportamiento productivo, no se observaron diferencias (P>0.05) entre el PVI y el PVF, independientemente de la GDP de los animales en pastoreo suplementados con la mezcla de minerales, en comparación con las otras prácticas adoptadas. La GDP fue similar (P>0.05) entre animales en pastoreo suplementados con sales de nitrógeno y aquellos suplementados con 1 y 2 g/kg de PV de concentrado. La CA fue similar (P>0.05) entre los animales suplementados con minerales y aquellos suplementados con los otros tratamientos. Se observaron los mismos resultados en los animales en pastoreo suplementados con nitrógeno y en aquellos que recibieron 1 y 2 g/kg de PV de un concentrado proteico/energético (Cuadro 7). Cuadro 7: Evaluación económica de los sistemas de producción de novillos cruzados alimentados con Brachiaria brizantha y criados bajo sistemas de pastoreo y engorda (US$) Variables Costo total Margen bruto Margen neto Ganancia neta Rentabilidad IMA

SM 411.16a 46.50b 46.50b 11.65b 0.77b 0.46b

SN

SC1

SC2

410.45a 49.82b 49.82b 15.06b 0.48b 0.37b

412.91a 66.48ab 66.48ab 31.52b 2.11a 0.25b

411.67a 56.15b 56.15b 15.81b 1.15b 0.46b

C3 402.47a 86.77a 86.77a 52.03a 3.42a 2.56a

Media CV% 409.83 61.14 61.01 25.21 1.50 0.48

16.00 31.63 14.49 17.38 25.17 13.20

Suplementación mineral (SM); Suplementación con nitrógeno (SN): Suplementación con 1 g/kg de PC de concentrado (SC1); Suplementación con 2 g/kg de PV de concentrado (SC2); = Engorde a corral, C3. IMA = ingreso mensual de la actividad. ab Medias con la misma letra en una misma fila no son significativamente diferentes (P>0.05).

El costo total en el periodo experimental fue similar (P>0.05), independientemente del tratamiento. El margen bruto y neto fue similar (P>0.05) en los sistemas en pastoreo; solo se observaron diferencias (P<0.05) en el sistema de engorde a corral. El ingreso mensual

113


Rev Mex Cienc Pecu 2021;12(1):105-119

fue mayor (P<0.05) en los animales en engorde a corral en comparación con los animales en pastoreo suplementados con una mezcla mineral, sales de nitrógeno y 2 g/kg de PV de concentrado. Se observó el mismo comportamiento para la tasa mensual.

Discusión El suministro y la calidad del forraje determinan el desarrollo y rendimiento del animal. La disponibilidad de materia seca potencialmente digestible en este estudio fue de 2,000 kg ha-1. Cuanto mayor sea el contenido de materia seca potencialmente digestible, mejor será el rendimiento biológico y, por lo tanto, el rendimiento económico también será mayor ya que el recurso nutricional básico más barato y disponible para el ganado es el pastoreo; mientras mejor se use este recurso, mayor será el rendimiento financiero(15). En una exhaustiva revisión bibliográfica(16), recomienda un suministro mínimo de materia seca potencialmente digestible de 6% o 6 kg de MSpd por 100 kg de PV. En este estudio se reportaron 8 kg de MSpd, este valor es mayor al recomendado por estos autores. El suministro promedio de forraje observado es este estudio fue de 12.8%. Esto coincide con lo recomendado previamente por otros(16). Estos autores también recomiendan un suministro de forraje de 10 a 12% para pastos tropicales; el valor obtenido en este estudio está por encima del recomendado para asegurar la disponibilidad de forraje de calidad para los animales. La similitud del consumo de materia seca proveniente del forraje se puede atribuir a su calidad, con un contenido de PC de 9.5% de la MS del forraje, dentro de los límites mínimos de 7 a 11% de MS en la dieta. La similitud en el consumo de materia seca total y su relación con el PV de los animales en pastoreo posiblemente se debe a que la disponibilidad de MS de forraje de buena calidad es la misma para los animales en pastoreo, los cuales tenían la misma edad y estaban agrupados homogéneamente. La similitud de estas variables muestra que, durante el periodo experimental, los animales en pastoreo no se encontraron con limitaciones, ya sea cuantitativas o cualitativas, en cuanto a la disponibilidad de forraje, por lo que probablemente alcanzaron el límite físico máximo de consumo. De acuerdo con Lazzarini et al(17), la respuesta a la suplementación con nitrógeno del consumo de forraje se vuelve menos evidente cuando el contenido de PC de la dieta basal es mayor al 7-8% de MS, como se observó en este estudio, con un contenido de CP de 9.5%. Esta concentración de PC en el forraje posiblemente contribuyó a que no hubiera una diferencia significativa en el consumo de materia seca entre los animales en pastoreo. El consumo de materia seca total y la ganancia de peso corporal fueron mayores en los animales en engorde a corral. Este resultado se debe a que los animales recibieron concentrado al 100% ad libitum; por lo que, su ganancia de peso fue mayor debido al mayor consumo de materia seca. El consumo de materia seca es sin duda uno de los factores más importantes para el rendimiento animal y es el punto de partida para la

114


Rev Mex Cienc Pecu 2021;12(1):105-119

entrada de nutrientes, principalmente energéticos y proteicos, necesarios para el mantenimiento y producción animal. Esta diferencia en el consumo puede deberse a la mayor ingesta de materia seca del grupo de animales confinados, contribuyendo así al aumento de su peso corporal. Los valores promedio de consumo de PC de los sistemas de crianza indican que los requisitos de PC de los animales en el BRCorte descritos por Valadares et al.(18) fueron cubiertos por la dieta disponible. La ingesta de proteínas es de vital importancia para los animales ya que participan en la síntesis de todos los tejidos corporales y en el crecimiento y la síntesis de microorganismos ruminales, los cuales degradan los componentes de la dieta y liberan nutrientes para su absorción. Además, estos microorganismos representan una fuente de proteína que es absorbida en el intestino delgado. La diferencia de consumo de PC en los animales en pastoreo que recibieron una mezcla de minerales se puede deber al mayor consumo de nitrógeno no proteico por medio de la suplementación proporcionada a los otros grupos de animales. La similitud del consumo de PC entre los animales en pastoreo alimentados con sales de nitrógeno y concentrado proteico/energético indica que este resultado podría estas asociado con el consumo de materia seca, ya que no se observaron diferencias en el consumo de este nutriente. El consumo de PC fue mayor en los animales en engorde a corral que en aquellos suplementados con un concentrado proteico/energético. El contenido de PC de la dieta cumplió con los requisitos de los animales y por lo tanto contribuyó a un mejor rendimiento, en comparación con los otros sistemas de crianza. Se presume que parte de la diferencia en el consumo de FDNcp se debe a la composición de la dieta; la dieta de los animales confinados presentaba una baja concentración de este nutriente. Estos resultados demuestran que los animales alimentados con concentrado al 100% consumieron una menor cantidad de fibra en comparación con los animales en pastoreo. La diferencia en el consumo de EE, CNF y NDT de animales en pastoreo suplementados con sales minerales en comparación con aquellos que recibieron el concentrado se puede deber a la contribución adicional de minerales. El concentrado aumenta la concentración de los componentes no fibrosos de la dieta, incrementando la disponibilidad de los nutrientes en el tubo gastrointestinal de los animales. Los carbohidratos son una fuente energética para los rumiantes, los cuales los transforman en ácidos grasos volátiles (acético, butírico y propiónico); estos ácidos grasos se acumulan en el tejido muscular. No se observaron diferencias en el consumo de EE, CNF y NDT de los animales suplementados con sales de nitrógeno, en comparación con aquellos que recibieron un concentrado proteico/energético. Esto se debe a la baja concentración de concentrado utilizado (1 y 2 g/kg PV), la cual no fue suficiente para influir en la ingesta de estos nutrientes.

115


Rev Mex Cienc Pecu 2021;12(1):105-119

El consumo de EE, FDNcp, CNF y NDT fue mayor en animales en engorde a corral. Estos resultados se pueden atribuir a que estos animales recibieron una dieta con carbohidratos no fibrosos concentrados al 100%, los cuales contribuyeron al aumento en el consumo de estas fracciones, principalmente CNF y otros nutrientes más digeribles. Por lo que, el aumento del consumo de estos componentes dietéticos se debe exclusivamente a la dieta. La reducción del consumo de FDNcp se debió a la menor participación en la dieta. El consumo de materia seca está directamente relacionado con el rendimiento ya que contribuye a la determinación de la cantidad de nutrientes necesarios para satisfacer los requerimientos energéticos y nutricionales de los animales, aumentando así la eficiencia de la producción animal. Se comparó la diferencia en MS, EE, FDNcp y CNF entre los animales en pastoreo suplementados con mezcla mineral y aquellos que recibieron el resto de los tratamientos. Estos resultados pueden estar asociados a los beneficios generados en la digestibilidad de la fracción fibrosa de la dieta cuando se añade el concentrado a la dieta ruminal. Por lo que, la digestibilidad de una dieta es el resultado de la interacción de todos sus nutrientes y no de un solo componente. El concentrado al 100% suministrado a los animales confinados no afectó la digestibilidad; probablemente por el balance entre la proteína digerible en el rumen y el contenido energético de la dieta, ya que esta asociación mantiene la digestión de la fibra, incluso cuando los animales reciben suplementos ricos en almidón. Se encontró diferencia en MS, PC, FDNcp, EE y CNF entre los animales en pastoreo que recibieron nitrógeno y aquellos en pastoreo que recibieron concentrado (1 y 2 g/kg de PV). Se observó el mismo comportamiento en la MS, PC y FDNcp al comparar a los animales en pastoreo suplementados con los concentrados proteicos/energéticos. Este resultado demuestra los beneficios de la adición del concentrado en la dieta ruminal de animales en pastoreo. Esta diferencia en la digestibilidad de PC, y otros nutrientes, puede estar relacionada con la mayor suplementación de nitrógeno en el ambiente ruminal, lo que favorece el crecimiento y desarrollo de los microorganismos en el rumen como resultado del balance proteico y energético de la dieta. Se encontró una similitud del coeficiente NDT entre los animales en pastoreo que recibieron nitrógeno y los animales en pastoreo que recibieron el concentrado (1 y 2 g/kg de PV). Se observó el mismo rendimiento para EE y CNF entre los animales en pastoreo que recibieron el 1 y 2 g/kg de PV de concentrado proteico/energético. Posiblemente, debido a los requerimientos nutricionales de la población microbiana, no hubiera una limitación de estos nutrientes, permitiendo condiciones favorables para el crecimiento de microorganismos ruminales. Los animales en engorda en corral presentaron la mejor MS de PC, FDNcp, EE y CNF en comparación con los otros tratamientos; esto se puede deber a la mayor participación de estos nutrientes en la dieta. La asociación de los carbohidratos estructurales y no 116


Rev Mex Cienc Pecu 2021;12(1):105-119

estructurales en la dieta permite mejorar la digestibilidad de los nutrientes en función de la sincronía de la disponibilidad de energía y proteína, proporcionando substratos para los microorganismos y aumentando la eficiencia de absorción de los nutrientes ingeridos. Es importante mencionar que, cuando se consumen dietas con una menor proporción de fibra, debido al aumento del concentrado, la tasa de pasaje de los rumiantes es más rápida, y cuando los animales consumen dietas con mucha fibra, la tasa de pasaje es más lenta, lo que permite una mejor digestión de los nutrientes. La diferencia en el coeficiente de digestibilidad de FDNcp, EE y CNF en los animales en engorde a corral, en comparación con otros sistemas de crianza, se debe probablemente a la mayor contribución de nutrientes por parte del concentrado, lo que mejora el ambiente ruminal y aumenta la digestibilidad de la fracción fibrosa. La diferencia en la GDP entre los animales en pastoreo suplementados con una mezcla mineral y el resto de los tratamientos y los animales en engorde a corral, en comparación con los animales en pastoreo que recibieron el concentrado proteico/energético, puede estar asociada a un mayor consumo de CNF, lo que contribuye a un mayor aporte de nutrientes, mejorando el rendimiento animal. Los carbohidratos no fibrosos son compuestos de rápida degradación que incluyen al almidón, la pectina y glucanos de fácil fermentación. Estos compuestos son una importante fuente energética para el crecimiento de los microorganismos en el rumen, lo cual favorecen la digestión de los nutrientes. La GDP es un índice de bovinos de carne importante; la rentabilidad del sistema depende de esta ganancia. El rendimiento productivo de animales en pastoreo está directamente relacionado con la calidad y cantidad de forraje disponible. Estas características influyen en el consumo de nutrientes y los atributos nutricionales de los animales en pastoreo; el consumo es el principal determinante de rendimiento animal. La GDP entre los animales en pastoreo suplementados con sal de nitrógeno y aquellos suplementados con 1 y 2 g/kg de PV de concentrado fue similar. Este resultado, aunado a que no se observaron diferencias en el consumo de materia seca total, contribuye al hecho de que no se registraron diferencias en el rendimiento animal. La GDP fue un numerador para obtener la conversión alimenticia (CA). No se observó ninguna diferencia en la CA entre los animales en pastoreo. La similitud en el rendimiento de animales en pastoreo demuestra que, cuando existe una buena cantidad de forraje de calidad, los animales criados en pastoreo pueden cubrir sus requerimientos nutricionales y obtener ganancias de peso satisfactorias en el periodo de alta disponibilidad de alimento, lo que hace que este sistema sea económicamente viable. El rendimiento de los animales en engorde a corral es mejor al de los animales en pastoreo, esto se debe a que gastan menos energía en buscar alimento(19), ya que obtienen su alimento, de mejor calidad, de los comederos dentro del corral.

117


Rev Mex Cienc Pecu 2021;12(1):105-119

El pastoreo y la engorda en corral fueron sistemas económicamente viables, lo cual fue evidenciado por el ingreso neto positivo, caracterizado por las ganancias, ya que el ingreso neto fue capaz de cubrir el costo total del sistema de crianza. Los animales en engorda presentaron el mayor margen bruto, margen y ganancia netos; debido a su mejor rendimiento. Por otro lado, los animales en pastoreo que recibieron 1 g/kg de concentrado y en engorde a corral obtuvieron un mayor retorno del capital invertido (US$ invertido/ US$ recuperado) en la actividad. La tasa mensual de retorno fue mayor para los animales en engorde a corral, lo cual optimizó el rendimiento animal. Siempre es interesante buscar un balance entre la productividad, expresada como viabilidad económica, y el rendimiento.

Conclusiones e implicaciones Los resultados obtenidos en este estudio indican que el rendimiento de animales en pastoreo es satisfactorio cuando hay materia seca disponible. Es factible confinar a los animales en fase de cría debido a que se acorta el ciclo de producción y se obtienen resultados económicos favorables. Literatura citada: 1. Paulino M, Detmann E, Valadares FS. Bovinocultura funcional nos trópicos. In: VI Simpósio de Produção de Gado de Corte e II Simpósio Internacional de Produção de Gado de Corte, Viçosa. Anais. Viçosa: UFV 2008;(06):275-305. 2. McMeniman N. Methods of estimating intake of grazing animals. In: Reunião Anual da Sociedade Brasileira de Zootecnia, Simpósio Sobre Tópicos Especiais em Zootecnia, Juiz de Fora. Anais. Juiz de Fora: Sociedade Brasileira de Zootecnia, 1997;34(07):131-168. 3. Wilm H, Costello D, Klipple G. Estimating forage yield by the double sampling method. J Am Soc Agronomy 1994;36(03):194-203. 4. Gardner A. Técnicas de pesquisa em pastagem e aplicabilidade de resultados em sistema de produção. Brasília: II CA/EMBRAPA CNPGL. 1986;(05):197. 5. Moraes A, Moojen E, Maraschin G. Comparação de métodos de estimativa de taxas de crescimento em uma pastagem submetida a diferentes pressões de pastejo. In: Reunião Anual da Sociedade Brasileira de Zootecnia, 1990, Campinas. Anais. Campinas, 1990;2(05):332. 6. Campbell A. Grazed pastures parameters. I. Pasture dry-matter production and availability in a stocking rate and grazing management experiment with dairy cows. J Agr Sci 1966;67(08):211-216.

118


Rev Mex Cienc Pecu 2021;12(1):105-119

7. Smith A, Reid J. Use of chromic oxide as an indicator of fecal output for the purpose of determining the intake of pasture herbage by grazing cows. J Dairy Sci 1955;38(05):515- 524. 8. Willians C, David D, Iismaa O. The determination of cromic oxide in faeces samples by atomic absorption spectrophotometry. J Agr Sci 1962;59(11):381-385. 9. Valadares FS, Moraes E, Detmann E. Perspectivas do uso de indicadores para estimar o consumo individual de bovinos alimentados em grupo. In: Gonzaga Neto S, Costa R, Pimenta FE, Castro J. (Org.). Anais do Simpósio da 43ª Reunião Anual da Sociedade Brasileira de Zootecnia. João Pessoa: Anais. SBZ: UFPB, 2006; 35(07):291 -322. 10. Detmann E, Souza M, Valadares FS, Queiroz A, Berchielli T, Saliba E, et al. Métodos para análise de alimentos. 2012. ISBN: 9788581790206. 11. AOAC. Official Methods of Analysis of AOAC International 16th ed. Association of Official Analytical Chemists, Arlington. 1995. 12. AOacs. American Oil Chemists’ Society. Official Method Am 5–04, Rapid determination of oil/fat utilizing high temperature solvent extraction. Urbana: Official Methods and Recommended Practices of the Am Oil Chemists’ Soc. 2005. 13. Hall M, Challenges with non-fiber carbohydrate methods. J Anim Sci 2003;8(12):3226–3232. 14. NRC. National Research Council. Nutrient requirements of dairy cattle. 7th ed. Washington, DC: National Academic Press; 2001. 15. Detmann E, Paulino M, Valadares FS. Otimização do uso de recursos forrageiros basais. In: Simpósio de produção de gado de corte. Viçosa. Anais. Viçosa: Sim corte, 2010;7(07):191– 240. 16. Silva FF, SÁ, JF, Schio A, Sá J, Silva R, Itavo L, Mateus R. Suplementação a pasto: disponibilidade e qualidade x níveis de suplementação x desempenho. Rev Bras Zootec 2009;38(07):371-389. 17. Lazzarini I, Detmann E, Sampaio C, Paulino M, Valadares FS, Souza M, Oliveira F. Intake and digestibility in cattle fed low-quality tropical forage and supplemented with nitrogenous compounds. Rev Bras Zootec 2009;38:(06):2021-2030. 18. Valadares FS, Marcondes M, Chizzotti M, Paulino P. Exigências nutricionais de zebuínos puros e cruzados BR-Corte. 2.ed. Viçosa: UFV, DZO. 2010;2(02):193. 19. Souza S, Ítavo L, Rimoli J, Ítavo C, Dias A. Comportamento ingestivo diurno de bovinos em confinamento e em pastagens. Archiv Zootec 2007;5(03):67-77.

119


https://doi.org/10.22319/rmcp.v12i1.5445 Artículo

Producción y evaluación de inóculos lácteos probióticos obtenidos del tracto digestivo de lechón (Sus scrofa domesticus) propuestos para alimentación porcina

Carmen Rojas Mogollón a Gloria Ochoa Mogollón b Rubén Alfaro Aguilera c Javier Querevalú Ortiz d Héctor Sánchez Suárez e*

a

Universidad Nacional de Tumbes. Facultad de Agronomía, Escuela de Agroindustria. Perú. b

Universidad Nacional de Tumbes. Facultad de Ciencias de la Salud. Laboratorio de Biología Molecular. Perú. c

Facultad de Ciencias de la Salud. Laboratorio de Biotecnología. Biodes- Jefatura de práctica. Perú. d

Universidad Nacional de Tumbes. Facultad de Agronomía. Escuela de Agroindustria. Laboratorio de procesamiento de alimentos. Perú. e

Universidad Nacional de Tumbes. Facultad Ciencias Agrarias. Escuela de Medicina Veterinaria y Zootecnia. Perú.

*

Autor de correspondencia: hsanchezs@untumbes.edu.pe

Resumen: Con la finalidad de evaluar un inóculo lácteo (IL) probiótico, de bacterias ácido lácticas (BAL) nativas del lechón para ser usado como alimento (yogurt) en lechones, se tomaron muestras de la parte final del tracto digestivo (excretas) de diez lechones, criados en traspatio, sembradas en medio selectivo (agar MRS con azul de anilina). Para verificar su pureza, caracterizadas bioquímicamente y capacidad probiótica, se realizaron pruebas

120


Rev Mex Cienc Pecu 2021;12(1):120-137

(tolerancia pH bajos, sales biliares y NaCl altos, pruebas oxidasa, catalasa, producción de gas y pruebas de antagonismo), identificación molecular por método estándar CTABDTAB. Para la elaboración del IL (yogurt), con cepas probióticas seleccionadas, reactivadas y homogenizadas (DO de 1 a 600 nm), cada BAL fue activada en leche pasteurizada (1 ml/100 ml) obteniendo mezcla uno y dos con las cepas 1, 5, 2 y 1, 5, 6 respectivamente. Evaluadas cada 5 días por 15 días en refrigeración. Molecularmente se identificó: 01 Lactobacillus reuteri, 04 Enterococcus faecium (BAL) y Escherichia fergusonii, Shigella flexneri (patógena). La selección de la BAL como probiótico fue por tolerancia 2.3x104 UFC/ml en pH 3.5; 7.00x103 CFU/ml en sal biliar al 5%; 2.80x104 CFU/ml en NaCl al 13%. En viabilidad del inóculo lácteo (yogurt) fue obtenida siguiendo norma NTP 202.092:2014 e INEN 710 de 1996, en 15 días de almacenamiento refrigerado, siendo mejor la mezcla uno y la mezcla dos aceptable, con recuento de 10 6 UFC/ml y107 UFC/ml de células probióticas. Por lo tanto, son adecuados como inóculos lácteos probióticos para ser proporcionado vía oral a lechones. Palabras clave: Lechones, BAL, Probióticas, Inóculo lácteo, Alimento inocuo, Antagonismo.

Recibido: 11/07/2019 Aceptado: 21/11//2019

Introducción Los cerdos nacen sin flora bacteriana en su tracto digestivo, estos se infectan a medida que los anticuerpos maternos van desapareciendo, instalándose un patrón de microorganismos y producción de enzimas digestivas que se adaptan a cada etapa de digestión, evitando así el desequilibrio microbiológico. La flora bacteriana intestinal nativa del lechón, es cambiante(1,2), coloniza, se reemplaza o pierde según la edad, tipo de alimento y cambios en el ambiente. Cuando se rompe el equilibrio microbiológico se genera el síndrome diarreico relacionado con el destete(3-6). Las bacterias ácido lácticas (BAL), forman parte de la microbiota intestinal normal de muchos animales y actúan como probióticos. Comparten características morfológicas, fisiológicas y metabólicas en común; son cocos o bacilos Gram positivos, no esporulados, inmóviles, anaeróbicos, microaerofílicos o aerotolerantes, son negativos a la oxidasa y catalasa. Asimismo, como principal producto de la fermentación de carbohidratos generan ácido láctico(2,7), crecen a diferentes temperaturas y alta concentración de sal, toleran pH ácido o alcalino y son principales microorganismos utilizados como probióticos(3,8,9).

121


Rev Mex Cienc Pecu 2021;12(1):120-137

Los probióticos son microorganismos vivos que aportados en la dieta, beneficia el desarrollo de la flora microbiana en el intestino, estimulan las funciones protectoras del sistema digestivo, son bioterapéuticos, bioprotectores o bioprofilácticos(7,8,10), capaces de producir compuestos antimicrobianos. El tiempo de reproducción es corto, tienen la capacidad de atravesar la barrera gástrica (secreciones del estómago y duodeno), debe ser estable durante el proceso de fabricación y comercialización, para que puedan llegar vivos al intestino. También actúan evitando la adhesión de bacterias patógenas en los receptores del epitelio intestinal(10), neutralizando metabolitos tóxicos(7,9,11) y se adaptan a una región determinada del intestino según la edad del lechón(3,12,13). En la nutrición del cerdo, los probióticos ayudan al establecimiento de la microbiota benéfica e inhiben a los enteropatógenos Escherichia coli y Salmonella typhimurium(3). Asimismo, Lactobacillum plantarum, tiene potencial probiótico en lechones(14), al igual que Rhodopseudomonas spp, Lactobacillus spp y Saccharomyces spp inhiben el crecimiento de Salmonella tiphymurium, L. acidophilus SS80 y Streptococcus thermophilus(15,16,17). Además, los probióticos también están presentes en saliva y se recomienda que su utilización sea en la misma especie hospedera de la que fue aislada(9, 10) . Estos probióticos pueden ser suministrados como IL (yogurt), que es un producto sin acidificación excesiva, donde las BAL son viables a la incubación y almacenamiento; existiendo cepas tolerantes al tiempo como L. acidophilus y otros que se deterioran rápidamente en refrigeración cuando se utiliza Lactobacillus bulgaricus(18,19,20). La mayoría de microorganismos utilizados para fabricar yogurt son comerciales. La leche de vaca y cabra son utilizadas para preparar yogurt, el cual tiene buena sinéresis, viabilidad de las BAL y características probióticas(17,18,20); su consumo mejora la eficiencia alimenticia y evita contraer enfermedades gastrointestinales(5,19,20) siendo de poco uso para la alimentación animal. Bajo este contexto, se planteó producir un inóculo lácteo con BAL nativas aislados del tracto digestivo del cerdo, caracterizados fenotípicamente y genotípicamente y con propiedades probióticas e inocuo para la alimentación de lechones.

Material y métodos Población y muestra Se utilizaron 10 lechones de traspatio, de 35 días de edad, en lactación, alimentados con dietas sin antibióticos, provenientes del caserío El Limón, ubicado en el distrito Pampas de Hospital, departamento de Tumbes (3°43´35” S, 80°26´38” W). La muestra comprende bacterias ácido lácticas aisladas de la parte final del tracto digestivo (excretas).

122


Rev Mex Cienc Pecu 2021;12(1):120-137

Obtención de las muestras De cada lechón, se colectó excretas con hisopos estériles (raspado) y fue colocado individualmente en tubos plásticos estériles y herméticos, para ser transportados en cadena de frío(19) hasta el Laboratorio de Biología Molecular ubicado en la Facultad de Ciencias de la Salud de la Universidad Nacional de Tumbes.

Análisis microbiológico Se sumergió cada muestra en solución salina fisiológica estéril al 0.85 % (diluyente), las diluciones se homogeneizaron por 5 a 10 seg y se transfirió 1 ml para los siguientes tubos con 9 ml de caldo MRS, diluciones de 10-1 hasta 10-5 para recuento de colonias bacterianas. La siembra se realizó por el método de superficie, tomando 25 µl de las diluciones decimales en placas con agar selectivo para BAL (agar MRS + Azul de anilina 0.13%), seleccionando las colonias teñidas de azul (de la superficie del agar), las que se purificaron en agar MRS realizándose por el método de estría, verificando así la población de BAL, y se realizó la caracterización macroscópica por tamaño, forma, color, densidad, consistencia y tinción Gram para identificación(21,22). Para la conservación se realizó en tubos con agar MRS inclinado con ángulo de 20º, sembrado por el método de estría, conservando a 4 ºC, crio preservados en medio TSB con glicerol al 30 % a -20 ºC, previa refrigeración(21,22). Para las muestras patógenas se procedió a la siembra por el método de agotamiento, en medios específico como: agar SS (salmonella, shiguella) y agar EMB (eosina azul de metileno)(22). Se aislaron, purificaron, identificaron y conservaron las cepas de las muestras, obtenidas de las excretas fluidas de lechones.

Análisis bioquímico y pruebas de tolerancia A las cepas BAL aisladas y purificadas, se les realizaron pruebas para ser seleccionadas como probiótico: prueba de oxidasa, utilizando tiras de papel impregnadas con el reactivo para-amino-N-dimetil-anilina, que por la presencia de la enzima citocromo C-oxidasa, cambia el color, considerado positivo o negativo. Prueba de la catalasa, se observó la capacidad para desdoblar el H2O2 al 30 %, en agua y oxígeno, se verificó con el burbujeo intenso que puede determinarse como positivo o negativo (atribuida a la enzima catalasa) (16,23) . La generación de gas (CO2), se verificó por el proceso fermentativo metabólico. Para las pruebas de tolerancia, se utilizó las cepas BAL seleccionadas, y cultivadas en caldo MRS a 37 °C por 24 h, se midió su crecimiento por densidad óptica (DO= 1) a 600 nm en un espectrofotómetro UV y se utilizó un ml de BAL para cada prueba. Se evaluó la viabilidad mediante el recuento de bacterias en el agar MRS antes y después de incubación(15,16,23). Tolerancia a pH bajos, en tubos falcón de 15 ml de capacidad se añadió 10 ml de caldo MRS ajustados a los pH 2.5, 3.5, 4.5 con HCl. Tolerancia a sales biliares, en tubos falcón de 15 ml de capacidad se añadió 10 ml de caldo MRS enriquecidos con 1

123


Rev Mex Cienc Pecu 2021;12(1):120-137

g (1% p/v), 5 g (5% p/v) y 10 g (10% p/v) de Ox-Bilis(15,16,23). Tolerancia a concentraciones de NaCl, en tubos falcón de 15 ml de capacidad se añadió 10 ml de caldo MRS enriquecidos con 5 g (5% p/v), 9 g (9% p/v) y 13 g (13% p/v) de NaCl(15,16,23).

Actividad inhibitoria frente a microorganismos patógenos del lechón Consiste en el enfrentamiento de cada una de las cepas BAL seleccionada contra cada cepa patógena del lechón (E. fergusonii y S. flexneri). Se utilizaron las células y sobrenadantes según el método propuesto; se consideró como actividad inhibitoria positiva la observación del halo(2,15,16). Las BAL y bacterias patógenas (homogeneizadas DO= 1; a 600 nm), fueron conservadas en tubos con agar PCA inclinado y se activaron a 37 °C por 24 h para su uso. Método directo o por contacto. En placas de Petri se sembró la cepa BAL en agar MRS por técnica de hisopado, paralelamente en agar Mueller Hinton se sembró 25 µl de la cepa patógena por técnica de superficie. De la placa con BAL se extrajo bocados circulares de 6 mm de diámetro y se colocaron sobre la placa con el patógeno(15,16). Método de pocillo sin neutralizar. Se sembró la cepa BAL en caldo MRS a 37 °C por 24 h, se determinó el pH y se agregó 1 ml del caldo en microtubos de 1.5 para centrifugar a 16,800 xg durante 10 min, obteniendo el sobrenadante para realizar las pruebas de antagonismo. Sembrando paralelamente en agar Mueller Hinton 25 µl de la cepa patógena por el método de superficie, aquí se realizó perforaciones cilíndricas de 6 mm diámetro donde se agregó 35 a 40 µl del sobrenadante de la BAL(15,16). Método de pocillo neutralizado. El procedimiento fue igual al método del pocillo sin neutralizar, cambia el sobrenadante, ya que este se neutralizó, ajustándolo a pH 7 con una solución de NaOH 1N(15,16).

Análisis molecular Se realizó la identificación molecular de las bacterias BAL de lechones sanos y bacterias patógenas de lechón con diarrea, siendo la extracción de ADN, por el método estándar CTAB-DTAB de Gustincich, adaptado para células bacterianas(15,24), para la PCR (Reacción en cadena polimerasa) se utilizó la amplificación del gen 16S ARNr, los cebadores universales 8F (5´ AGA GTT TGA TCC TGG CTC AG 3´) y 1510R (5´ GGT TAC CTT GTT ACG ACT T 3´) descritos por Weisburg para estudios filogenéticos bacterianos, la electroforesis se realizó en gel agarosa al 1%. Para la secuenciación de los productos de la PCR, se empleó 10 μl, se depositó en microtubos de 0.2 ml porciones de 5 μl de cada cebador universal para el gen 16S ARNr, los cuales fueron empacados y enviados para su secuenciación a la empresa Macrogen de Korea(15). Las secuencias de ADN se alinearon con el software libre MEGA 7 y comparadas con las secuencias de 16S

124


Rev Mex Cienc Pecu 2021;12(1):120-137

ARNr, que se encuentra en la base de datos de acceso público del GenBank mediante el software libre BLAST (Basic Local Alignment Search Tool)(15,24).

Elaboración del inóculo lácteo (IL) La elaboración y evaluación del IL, se realizó según las normas del INEN(25). Las etapas fueron, recepción de leche fresca, inspección organoléptica, tamizado, homogeneización mecánica(21,26,27), pasteurización, que se realizó a 75 °C por 10 min, enfriamiento e incubación, que oscila entre los 40 y 45 °C(26,27). Mezcla del inóculo lácteo. Se activaron las BAL seleccionadas con capacidad probiótica(28-29), en agar MRS y se incubó a 37 ºC por 48 a 72 h según la cepa, una alícuota se sembró en 10 ml caldo MRS y se incubó a 37 ºC por 48 h, para ser utilizada se homogeneizó a DO= 1; a 600 nm(26,27,28). En frascos estériles de 250 ml, se agregaron 100 ml de leche pasteurizada y 1 ml del caldo MRS con cepa BAL seleccionada y se incubó a 32 ºC por 12 h. Para la preparación de la mezcla final de IL (yogurt) se retiraron 50 ml de cada inóculo anterior (por cepa) y se mezcló (cepas 1, 2 y 5 y cepas 1, 5 y 6) en medio litro de leche pasteurizada, se incubó a 32 ºC por 12 h y se conservó a 4 ºC(27,28,). Análisis químico del inóculo lácteo. Se evaluó el pH, acidez titulable, sinéresis y recuento de colonias a los 0, 5, 10 y 15 días en refrigeración a 4 °C. El valor de pH del IL se midió por el método 981.12 (AOAC, 1990) con el potenciómetro digital, calibrado, se tomó entre 40 a 45 ml del IL en un recipiente, se introdujo el electrodo del pH y registró la lectura. Para la determinación de la acidez titulable, se tomaron 5 g de muestra, tres gotas de fenolftaleína, se homogeneizó y tituló con NaOH 0.1N, hasta obtener un color rosa pálido persistente (factor de fórmula 0.09 de ácido láctico)(29,30,31). Para la evaluación de sinéresis, se utilizaron 10 g de muestra, se colocaron en tubos falcon, se centrifugó por 20 min a 4,200 xg; después de la centrifugación se obtuvo el peso del sobrenadante y se calculó el porcentaje de sinéresis (p/p) mediante la relación entre peso del sobrenadante y el peso de la muestra multiplicado por 100(31,32,33). Análisis microbiológico del inóculo lácteo. Se realizó teniendo en cuenta la identidad bacteriana para yogurt, empleado por NTP 202.092:2014, se utilizó el método ISO 7889:2003 (IDF 117:2003) según la enumeración de microorganismo característicos por la técnica de recuento de colonias a 37 °C(27,28,30,34).

Resultados y discusión Evaluación del análisis microbiológico Se encontraron 10 cepas con características BAL después del descarte en agar MRS + azul de anilina y purificación en agar MRS, confirmados por método(16,23,29), las BAL se tiñen de color azul intenso en el medio selectivo por la presencia de metabolitos de las

125


Rev Mex Cienc Pecu 2021;12(1):120-137

colonias al reaccionar con el azul de anilina(23,24,29); la literatura también confirma que las BAL son Gram positivas y pueden tener diferentes formas bacilos, coco y cocobacilos(16,19,29), así como observa en el Cuadro 1, donde también se presenta el crecimiento de las BAL siendo mayor la cepa 05 (2.80 x 104 UFC/ml), seguido por la cepa 01 (2.60 x 104 UFC/ml). Las cepas 04, 09, 07 y 02 tuvieron valores similares; sin embargo, las cepas 03, 06, 08 y 10 presentaron menos crecimiento (1.00 x 104 a 1.20 x 104 UFC/ml), entendiendo que la capacidad de reproducción de las cepas BAL es variable en función a temperatura y condiciones del medio(29,35,36). Cuadro 1: Evaluación inicial de cepas aisladas para determinar características de BAL BAL

Tam (mm)

For

Ele

Mar

Col

Den

Con

Grupo

Forma

Tamaño UFC/ml

Cepa P 1.72 C Convexa e B O Viscosa Gram + Bacilos 2.60x104 01 Cepa P 1.82 C Convexa e B O Viscosa Gram + Cocobacilo 1.70x104 02 Cepa M C Plana e B O Viscosa Gram + Bacilos 1.10x104 03 2.44 Cepa P 1.28 C Plana e B O Viscosa Gram + Bacilos 2.20x104 04 Cepa P 1.51 C Convexa e B O Viscosa Gram + Cocos 2.80x104 05 Cepa M C Convexa e B O Viscosa Gram + Cocobacilo 1.10x104 06 3.54 Cepa M C Convexa e B O Viscosa Gram + Cocos 1.70x104 07 3.54 Cepa D C Convexa e B O Viscosa Gram + Bacilos 1.20x104 08 0.48 Cepa D C Plana e B O Viscosa Gram + Bacilos 1.90x104 09 0.48 Cepa D C Plana e B O Viscosa Gram + Bacilos 1.00x104 10 0.48 BAL= bacterias ácido lácticas; Tam= tamaño; For= forma; Ele= elevación; Mar= margen; Col= color; Den= densidad; Con= consistencia. C= circular, e= entero, b= blanco, o= opaca.

Evaluación del análisis bioquímico de las BAL Prueba de oxidasa, peróxido de hidrógeno, generación de gas y tolerancia a pH, NaCl y sales biliares. En el Cuadro 2, se observa que las 10 cepas fueron oxidasa negativa (no producen la enzima citocromo C–oxidasa en su proceso de respiración), no son aeróbicas, por lo que no necesitan oxígeno en su membrana celular; éstas también presentaron reacción catalasa negativa (no reaccionar con el H2O2) y no produjeron CO2 (7,16,24) (excepto 04, 08 y 10). En el experimento las cepas 03, 04, 08, 09 y 10, no lograron tener tolerancia a las concentraciones de pH, ClNa y sales biliares, características de células probióticas(19,23,29), por lo que fueron descartadas definitivamente.

126


Rev Mex Cienc Pecu 2021;12(1):120-137

Cuadro 2: Evaluación bioquímica y de tolerancia de cepas BAL como probiótico Tolerancia Cepa

Oxi

pH

pH

GG

2.5 3.5 4.5 01 02 03 04 05 06 07 08 09 10

-

+ -

+ + +

-

+ + + + + -

+ + + + + -

Tolerancia ClNa, %

Tolerancia sales biliares, %

5

9

13

1

5

10

+ + + + + -

+ + + + -

+ + + -

+ + + + + -

+ + + + + -

-

Oxi= oxidasa; pH= peróxido de hidrógeno; GG= generación de gas; Prueba positiva: + Prueba negativa: -

En el Cuadro 3, se presenta la cantidad inicial y final en UFC/ml de las cepas sometidas a diferentes concentraciones de tolerancia con fines de selección, siendo la cepa 1 la que presentó mayor crecimiento final, seguida de las cepas 2, 5 y 6 en pH 4.5 y 3.5, suficiente para selección(3,16,35), pero, todas fueron susceptibles al medio de cultivo muy ácido (pH 2.5). En el mismo cuadro, se presenta la tolerancia a ClNa, donde la cepa 5, 1 y 6 evidenciaron mayor tolerancia en todas las concentraciones y las cepas 2 y 7 fueron susceptibles a la mayor concentración (p/v). También, se observa tolerancia a sales biliares en todas las cepas en concentración máxima de 5 % motivo de selección(24,29,35), donde la cepa 5 presentó mayor crecimiento 7.0 x 103 UFC/ml, seguido de las cepas 6, 1, 2 y 7.

127


Rev Mex Cienc Pecu 2021;12(1):120-137

Cuadro 3: Evaluación del recuento final de las colonias BAL (UFC/ml), según la tolerancia de cepas como probióticos Tolerancia sales Tolerancia pH Tolerancia ClNa, % Cep biliares, % a 2.5 3.5 4.5 5 9 13 1 5 10 1

2

5

6

7

Inici al

6.80x1 03

7.90x1 1.30x1 2.85x1 3.75x1 3.25x1 2.10x1 03 04 03 03 03 04 2.30x1 3.80x1 1.05x1 1.19x1 5.25x1 6.40x1 Final 04 04 04 04 03 03 Inici 6.30x1 7.20x1 9.20x1 2.50x1 2.55x1 2.90x1 1.00x1 al 03 03 03 03 03 03 04 1.90x1 2.90x1 9.73x1 6.30x1 Final 04 04 03 03 Inici 6,40x1 7.50x1 1.30x1 5.03x1 1.50x1 7.56x1 1.70x1 al 03 03 04 04 04 03 04 1.80x1 2.30x1 1.13x1 2.80x1 2.80x1 1.10x1 Final 04 04 04 04 04 04 Inici 4.70x1 6.50x1 1.30x1 4.67x1 5.20x1 3.25x1 1.20x1 al 03 03 04 03 03 03 04 1,80x1 2.30x1 9.80x1 1,00x1 5.25x1 7.50x1 Final 04 04 03 04 03 03 Inici 4.50x1 5.50x1 1.00x1 4.50x1 4.80x1 3.00x1 7.10x1 al 03 03 04 03 03 03 03 9.50x1 2.00x1 7.50x1 5.50x1 5.30x1 Final 03 04 03 03 03 Prueba negativa: - UFC=unidad formadora de colonias BAL= UFC/ml.

9.40x1 03 4.90x1 03 8.60x1 03 5.00x1 03 1.40x1 04 7.00x1 03 7.10x1 03 5.80x1 03 4.50x1 03 3.80x1 03

6.50x1 03 2.90x1 03 1.70x1 04 6.20x1 03 5.00x1 03 -

Las BAL encontradas en el estudio demostraron características probióticas evaluadas según la tolerancia a concentraciones bajas de pH, lo que coincide con la mayoría de autores, que consideran sobrevivencia a pH 3 a 3.4 y un óptimo pH 3.5(14,35,36). También presentaron tolerancia a concentraciones altas de sales biliares y NaCl como las encontradas en otras investigaciones(7,35,36), condiciones que son consideradas obligatorias como probióticas encontrando que las cepas BAL (5, 1, 2 y 6) presentaron ser viables para su selección como probióticas según la metodología realizada por otros investigadores(16,37,38).

Evaluación del análisis molecular. Secuenciación de ADN

En el Cuadro 4 se presenta la identificación molecular de las cepas BAL y bacterias patógenas del trabajo con alto porcentaje de identidad (99 %).

128


Rev Mex Cienc Pecu 2021;12(1):120-137

Cuadro 4: Identificación molecular mediante el gen 16S ARNr de cepas extraídas de la parte final del tracto gastrointestinal del lechón Tamaño de Identidad N° de Cepas Especie identificada secuencia (pb) % accesión BAL 01 BAL 02 BAL 05 BAL 06 BAL 07 (A) (B)

1371 1328 1344 1366 1383 1352 1359

Lactobacillus reuteri Enterococcus faecium Enterococcus faecium Enterococcus faecium Enterococcus faecium Escherichia fergusonii Shigella flexneri

99 99 99 99 99 99 99

NR075036.1 NR113904.1 NR113904.1 NR113904.1 NR113904.1 NR074902.1 NR026331.1

Las cepas BAL, E. faecium y L. reuteri, encontradas e identificadas molecularmente, están presentes como microorganismos nativos del tracto digestivo del cerdo y tienen efecto antagónico contra Escherichia, semejante también con la evaluación del E. faecium NCIMB 10415 y E. faecium NCIMB 11181(38,39,40) y el L. reuteri I5007 y L. reuteri KT260178, Lactobacillus sp, L. acidophilus, utilizados como probióticos en la producción porcina(29,41,42).

Las muestras de bacterias patógenas de lechones, (Cuadro 4) son reportadas con mayor incidencia en la crianza de cerdos(39,40).

Evaluación de la actividad inhibitoria de las BAL contra bacterias patógenas Al comparar los tres métodos para determinar la actividad inhibitoria (Cuadro 5), se observa que el método directo y de pocillo neutralizado, presentan menor inhibición que el de pocillo sin neutralizar, ya que este último tiene pH ácido como consecuencia de los ácidos orgánicos presentes, los cuales tienen actividad bactericida(29,35,41). El E. faecium y L. reuteri, tuvieron mayor actividad antagónica frente a la E. fergunsonii que es más susceptible que a S. flexneri como los reportados por otros(12,38,39); así también la Eschericha es susceptible a la mayoría de bacterias acido lácticas como son a cepas de Lactobacillus spp extraídos de terneros lactantes, L. plantarum aislados de cerdos criollos y L. lactis aislados de lechones(40,41,42). Método directo, los resultados del Cuadro 5, muestran el efecto inhibitorio por contacto directo de las BAL. Las cepas 5, 6 y 7 mostraron inhibición contra las dos cepas patógenas, con mayor tamaño de halos frente a E. fergunsonii, destacando la cepa 5 con halo de 8.46 ± 3.02. Las cepas 1 y 2 presentaron menores halos frente a las patógenas(38,41).

129


Rev Mex Cienc Pecu 2021;12(1):120-137

Cuadro 5: Tamaño de halo de las pruebas de inhibición de BAL contra los patógenos de Shigella flexneri y Escherichia fergusonii Escherichia fergusonii Cepas Directo 01 02 05 06 07

6.52 ± 0.132 6.94 ± 0.44 8.46 ± 3.02 8.33 ± 2.70 8.25 ± 2.53

Shigella flexneri

Sin Neutralizado Directo neutralizar 7.54 ± 0.43 7.90 ± 0.078 8.86 ± 0.62 9.72 ± 1.88 9.24 ± 0.60

6.85 ± 036 7.10 ± 0.60 8.76 ± 3.80 8.52 ± 3.17 8.65 ± 3.51

Sin Neutralizado neutralizar

6.00 6.30 ± 0.56 6.00 7.34 ± 0.05 6.9 ± 0.45 10.34 ± 0.13 6.72 ± 0.25 9.84 ± 0.40 6.24 ± 0.02 10.10 ± 2.0

6.00 6.00 7.34 ± 0.89 6.84 ± 0.35 7.10 ± 0.60

Prueba negativa: 6.00

Método de pocillo, sin neutralizar, la prueba se realizó con el sobrenadante del cultivo de las BAL, con pH promedio de 4.486 ± 0.001. En el Cuadro 5, se observa que todas las cepas presentan halos de inhibición en el enfrentamiento contra E. fergusonii, sobresaliendo las cepas 6 y 7, seguido de la cepa 5 y finalmente las cepas 2 y 1. Los halos formados frente a S. flexneri fueron de mayor tamaño frente al otro patógeno, siendo las cepas (ordenadas de mayor a menor tamaño) 5, 7, 6, 2 y 1 respectivamente. Las BAL 5, 7 y 6 (E. faecium) presentaron mayores halos frente a S. flexneri, resultados semejantes y menores a los obtenidos en prueba con Lactobacillus spp, enfrentados a patógenos del cerdo, presentando halos desde 11.24 ± 0.03 a 32.62 ± 0.04 frente a la Salmonella sp han sido reportados(19,36,41). En pruebas utilizando el sobrenadante bacteriano sin neutralizar, tiene mayor acción de inhibición, debido al efecto de los ácidos orgánicos según las pruebas de antagonismo(29,35,40). Método de pocillo neutralizado, para este caso el sobrenadante del cultivo de las BAL se ajustó a pH 7.00 (neutralizado con hidróxido de sodio) con el fin de excluir la inhibición de los ácidos orgánicos. Todas las cepas presentaron halos (Cuadro 5), en el enfrentamiento con E. fergusonii, pero en menor tamaño que la prueba sin neutralizar, siendo los halos mayores para las cepas 5, 7 y 6, en la prueba con S. flexneri. En este método al no haber acción ácida se atribuye la acción antimicrobiana a la presencia de metabolitos no ácidos. Se reporta que las BAL producen sustancias peptídicas que producen un modo de acción bactericida o bacteriostático(16,42), lo que también está referido a la actividad de metabolitos proteicos o moléculas complejas lipídicas o carbohidratos(11). Las cepas 5, 6 y 7 (E. faecium) evaluados, presentaron en los tres métodos los mayores halos frente a E. fergunsonii, siendo el método de pocillo sin neutralizar las que generaron mayores halos, semejante a lo ya reportado(11,16). El antagonismo de la BAL está influenciado por varios factores como son el tipo de bacteria, lugar de donde ésta se obtuvo, especie hospedera, temperatura y tiempo de incubación(14,15,41). Las BAL con 130


Rev Mex Cienc Pecu 2021;12(1):120-137

actividad probiótica presentaron antagonismo frente a patógenos del cerdo y su acción se compara con la mayoría de probióticos obtenidos de bacterias Lactobacillus ssp. L. acidophilus, L. plantarum, (L. casei y L. brevis)(14,19,29), que actúan frente a la bacteria patógena E. coli ATCC 25922 y S. typhimurium(14).

Evaluación del inóculo lácteo Evaluación físico-química (pH, acidez y sinéresis). De la evaluación de las BAL como probiótico quedaron seleccionadas las cepas 1, 2, 5 y 6 con los cuales se preparó dos mezclas como IL (yogur), en la primera mezcla se utilizaron las cepas 1, 2, y 5 y en la segunda las cepas 1, 5 y 6, (1 ml de cepa activada en 100 ml de leche), utilizando 50 ml de cada cepa según la mezcla, para evaluar su viabilidad, a los 0, 5, 10 y 15 días de almacenamiento hasta su uso como IL (yogurt). En el Cuadro 6, se observó que la mezcla uno presentó mejor estabilidad, donde los valores del pH fueron inversamente proporcional a la acidez, la cual disminuye en función a los días de refrigeración, llegando a los 15 días con pH de 4.53 y pH 4.78 de la mezcla uno y dos respectivamente, valores que están en los parámetros aceptables de estabilidad y vida útil, relacionado con el tiempo de degradación de la lactosa a ácido láctico. Los resultados obtenidos son aceptables, comparables al pH de 4.65 obtenido en la fabricación de yogur con leche de cabra o vaca utilizando microorganismos fermentadores comerciales y yogures simbióticos(26,27), así mismo cumple con la norma del Codex stan 243–2003(43), la cual refiere que todos los yogures deben tener un pH ≤ a 4.6, hasta un pH de 4.90, valores semejantes a los yogures y productos lácteos no tradicionales(25,27,30), el pH obtenido fue semejante a fermentos lácteos para cerdos, ensilados con productos lácteos que mantienen los pH entre 3 a 4.9(18,35,44). A pesar de que la mezcla dos presentó pH ligeramente mayor, este también se encuentra dentro de las normas técnicas, NTP 202.092:2014 y Norma INEN 710 de 1996(20), el pH se modifica en mayor rango al incorporar fibra de trigo y otros granos en yogures artesanales mexicanos(18,32,33). A pesar de que el yogurt este en refrigeración, se detiene el crecimiento de las cepas BAL, sin embargo, la acidez continúa lentamente por su actividad residual(26,30,31), se aumenta la vida útil al incorporar frutas ácidas y batidos con pectina(27,34), también se mejora la calidad y sabor agregando frutas con componentes funcionales (lúcuma, plátano, mango y otros)(34,45), por lo tanto, el pH en la incubación y almacenamiento del IL determina su aceptabilidad para ser utilizado(31).

131


Rev Mex Cienc Pecu 2021;12(1):120-137

Cuadro 6: Evaluación de pH, % acidez, grado de sinéresis y recuento viable de BAL de los IL (yogur) a diferentes días de almacenamiento a 4 °C Mezcla 01 Mezcla 02 Días

pH

0 5 10 15

4.65 4.61 4.57 4.53

Acidez Sinéresis % % 0.80 0.86 0.90 0.93

0.36 0.49 0.55 0.61

UFC/g

Ph

4.8x106 1.5x107 2.7x107 3.9x107

4.94 4.88 4.82 4.78

Acidez % Sinéresis % UFC/g 0.47 0.50 0.55 0.58

0.39 0.45 0.53 0.58

2.8x104 7.4x104 9.6x104 1.1x106

El valor de la acidez (%) está en función al contenido de ácido láctico, llegando hasta 0.93 y 0.58 % valores considerados aceptables como producto lácteo según la norma de preparación del yogurt de acuerdo a lo establecido por Codex stan 243–2003(44), Norma INEN 710 de 1996, tiene un rango final entre 0.6 a 1.5 % durante la refrigeración(20), el porcentaje de acidez obtenido es aceptada en alimentos fermentados y ensilados(28,35,44). El grado de sinéresis medido de los IL (yogur) aumentó lentamente durante su almacenamiento, efecto debido a la pérdida de estabilidad, retención de agua y de sus componentes. En el Cuadro 6 se presentan los valores de la evaluación del grado de sinéresis durante su almacenamiento, a 15 días de refrigeración presentó un rango aceptable de 0.36 a 0.61 % (mezcla uno y dos), resultados semejantes a los obtenidos en yogur y batido de leche de cabra con frutas(26,27,34), pero son mayores a yogures modificados, por la adición de estabilizantes comerciales, microcápsulas de goma arábiga y maltodextrina (0.12 a 0.1 %)(27,30) y fibra que ayuda a prevenir la separación de lactosuero (32,33). Evaluación microbiológica. En el Cuadro 6, se presenta la viabilidad de BAL como probióticos en el IL (yogurt), la mezcla uno, muestra mayor aumento de microorganismos probióticos que la mezcla dos, durante su evolución en refrigeración. El recuento de las BAL en ambas mezclas es semejante a lo que recomienda la NTP 202.092:2014, utilizando el método ISO 7889:2003 (IDF 117:2003) para la preparación de yogurt(33), considerando como mínimo para número de microorganismo de bacterias lácticas totales en el yogurt, durante su vida útil de 107 UFC/g, obtenidos por la mezcla uno y dos a los 15 días de refrigeración (3.9 x 107 UFC/g y 1.1 x 106 UFC/g respectivamente), garantizando que el producto elaborado, contiene y conserva su viabilidad y actividad probiótica como en la fabricación de los diferentes yogures utilizando leche de cabra o de vaca, bacterias fermentadores comerciales, saborizantes, frutas y fibra, con una concentración de 107 UFC/g a 106 UFC/g de células probióticas viables en los 16 primeros días(30,34,46). Actualmente el consumidor demanda alimentos funcionales (frutas antioxidantes)(33,45), menos procesados y más naturales, así también se busca mejorar su vida útil proporcionando cualidades antimicrobianas utilizando bacterias nativas benéficas(17,18,42). La reuterina, producida por L. reuteri, es un antibacteriano que puede ser utilizado como un bioconservante con potencial probiótico controlador de Salmonella

132


Rev Mex Cienc Pecu 2021;12(1):120-137

spp. y E. coli en alimentos para personas o animales, la tendencia es el uso de las BAL nativas y sus extractos bacterianos como potenciales probióticos aislados y utilizados en la misma especie animal(12,38,39).

Conclusiones e implicaciones La caracterización bioquímica, las pruebas de tolerancia y efecto antagónico de las BAL seleccionadas, fueron de gran importancia en el crecimiento y supervivencia de cuatro cepas probióticas (tres Enterococcus faecium y una cepa Lactobacillus reuteri), destacando la producción de ácidos orgánicos presente en los sobrenadantes sin neutralizar para su actividad antimicrobiana y existe acción no ácida por metabólicos en sobrenadantes neutralizados con efecto bactericida. Con las cepas aisladas se logró elaborar un inóculo lácteo (yogur) con características aceptables, viables e inocuas para ser considerado como probiótico potencial de administración oral, con 15 días de vida útil. Agradecimientos

A la Universidad Nacional de Tumbes, por su apoyo incondicional a la investigación y al personal obrero de la FCA Literatura citada: 1.

Hevia RM. Microbiota digestiva del cerdo: determinación del patrón en condiciones de salud y enfermedad [tesis doctoral]. León, España: Universidad de León; 2018.

2.

Balasingham K, Valli C, Radhakrishnan L. Balasuramanyam D. Caracterización probiótica de bacterias del ácido láctico aisladas de intestino porcino. Mundo Vet 2017;10(7):825.

3.

Gámez HJ, Aguirre D, Ramírez CJRMC. Caracterización de bacterias probióticas aisladas del intestino grueso de cerdos como alternativa al uso de antibióticos. Rev MVZ Córd 2009;14(2):1723-1735.

4.

Miranda-Yuquilema JE, Marin-Cárdenas A, Oliva-Bello H, Baño-Ayala D, BarrosRodríguez M, Jácome-Vargas H, Villamarín-Barragán D. Influence of a microbial additive on the productive behavior of pregnant sows, as well as, hematochemical and diarrheal incidence in their offspring. Trop Subtrop Agroecosyst 2018;21(1):3945.

5.

Reis de Souza TC, Mariscal Landín G, Escobar García K, Aguilera Barreyro A, Magné Barrón A. Cambios nutrimentales en el lechón y desarrollo morfoisiológico de su aparato digestivo. Vet Méx 2012;43(2):155-173.

133


Rev Mex Cienc Pecu 2021;12(1):120-137

6.

Pérez FA. Prácticas de manejo del lechón en maternidad: estrategias para mejorar su sobrevida y aumentar la productividad. Rev Electr Vet 2010;11(1):177-190.

7.

Cossio DS, Hernández YG, Mendoza JD. Development of probiotics for animal production. experience in Cuba. Cuba J Agric Sci 2018;52(4):357-373.

8.

Quintero MJV. Bacterias del ácido láctico un potencial para la producción de alimentos probióticos fermentados en la industria láctea de Panamá. KnE Eng 2018;3(1):38-47.

9.

Ávila J, Ávila M, Tovar B, Brizuela M, Perazzo Y, Hernández H. Capacidad probiótica de cepas del género Lactobacillus extraídas del tracto intestinal de animales de granja. Rev Cienc 2010;20(2):161-169.

10. Martín C, Escobedo S, Suárez JE, Quirós LM, Pérez-Martínez G, Coll-Marqués JM, et al. Two alkaline motifs in the lactobacillus salivarius Lv72 OppA surface are important to its adhesion function. Benefic Microbiol 2019;10(1):101-109. 11. Lu X, Zhang M, Zhao L, Ge K, Wang Z, Jun L, et al. Growth performance and postweaning diarrhea in piglets fed a diet supplemented with probiotic complexes. J Microbiol Biotechnol 2018;28(11):1791-1799. 12. Chengjun H, Weigang X, Xiaohua L, Xiuzhu Z, Ke L, Jia L, et al. Effects of dietary supplementation of probiotic Enterococcus faecium on growth performance and gut microbiota in weaned piglets. AMB Express. 2019;9(1):11-12. 13. Fengjuan Y, Aina W, Xiangfang Z, Chengli H, Hong L, Shiyan Q. Lactobacillus reuteri I5007 modulates tight junction protein expression in IPEC-J2 cells with LPS stimulation and in newborn piglets under normal conditions. BMC Microbiology 2015;15(1):10-11. 14. Vera-Mejía R, Ormaza-Donoso J, Muñoz-Cedeño J, Arteaga-Chávez F, SánchezMiranda L. Cepas de Lactobacillus plantarum con potencialidades probióticas aisladas de cerdos criollos. Rev Salud Anim 2018;40(2):11-12. 15. Sánchez SH, Ochoa MG, Rojas MC, Peralta OT, Ordinola ZA. Aislamiento de péptidos inhibidores de bacterias a partir de bacterias ácido lácticas del tracto digestivo del lechón e identificación mediante prueba proteómica. Sci Agropec 2017;8(4):437-443. 16. Vélez Zea JM. Evaluación de la actividad antimicrobiana de bacterias probióticas extraídas del calostro de cerdas de granjas del Aburrá sur [tesis doctoral]. Medellín, Colombia: Universidad Nacional de Colombia-Sede Medellín; 2015. 17. Barón LVC. Probióticos y prebióticos como alimentos funcionales en nutrición animal. Zoocienc 2016;3(2):15-21.

134


Rev Mex Cienc Pecu 2021;12(1):120-137

18. Medina PJG. Propiedades tecnológicas de bacterias ácido lácticas aisladas de productos lácteos fermentados artesanales expendidos en la región Ciénega de Jalisco. Adv Invest Food Saf 2018;1(1):230-234. 19. Ming-Lun C, Hsi-Chia C, Kun-Nan C, Yu-Chun L, Ya-Ting L, Ming-Ju C. Optimizing production of two potential probiotic Lactobacilli strains isolated from piglet feces as feed additives for weaned piglets. Asian-Austral J Anim Sci 2015;28(8):1163-1170. 20. Landa-Salgado P, Caballero-Cervantes Y, Ramírez-Bribiesca E, HernándezAnguiano AM, Ramírez-Hernández LM, Espinosa-Victoria D, Hernández-Sánchez D. Aislamiento e identificación de bacterias ácido lácticas con potencial probiótico para becerros del altiplano mexicano. Rev Mex Cienc Pecu 2019;10(1):68-83. 21. Flores Fuentes GD. Propuesta de un manual de procedimientos operativos estándar sobre la toma de muestras de alimentos para uso de la Defensoría del Consumidor [tesis doctoral]. El Salvador: Universidad de El Salvador; 2015. 22. Botero Ospina MJ, Castaño DRT, Castaño Zapata J. Manual práctico de microbiología general. No. Doc. 26157. CO-BAC, Bogotá. 2011. 23. MacFaddin JF. Pruebas bioquímicas para la identificación de bacterias de importancia clínica: Métodos microbiológicos. Capítulo 17. 18a. ed: Editorial Panamericana; 2002. 24. Arteaga-Chávez F, López-Vera M, Laurencio-Silva M, Rondón-Castillo A, MiliánFlorido G, Barrios-González V. Selección e identificación de aislados de Bacillus spp. del tracto digestivo de pollos de traspatio, con potencial probiótico. Pastos y Forrajes 2017:155-164. 25. ECUADOR NTE INEN IJR, Quito, Ecuador. Instituto Ecuatoriano de Normalización Norma técnica Ecuatoriana del Yogurt INEN 2395:2011.https://www.normalizacion.gob.ec/buzon/normas/nte-inen-2395-2r.pdf. consultado nov 15, 2018. 26. Zapata IC, Sepúlveda-Valencia U, Rojano BA. Efecto del tiempo de almacenamiento sobre las propiedades fisicoquímicas, probióticas y antioxidantes de yogurt saborizado con mortiño (Vaccinium meridionale Sw). Inf Tech 2015;26(2):17-28. 27. Ortega LAJ, Ramírez LB, Rodríguez EA. Desarrollo y evaluación de un yogurt bebible adicionado de extracto liofilizado de Justicia spicigera como colorante natural. e-CUBA 2018;(9):25-34. 28. Miranda MO, Espinosa REN, Ponce PI. Características físico-químicas y propiedades nutricionales del suero resultante del proceso de obtención del yogurt Griego. Rev Cubana Alim Nutri 2016;26(1):172-174.

135


Rev Mex Cienc Pecu 2021;12(1):120-137

29. Hernández-García JE, Sebastián-Frizzo L, Rodríguez-Fernández JC, Valdez-Paneca G, Virginia-Zbrun M, Calero-Herrera I. Evaluación in vitro del potencial probiótico de Lactobacillus acidophilus SS80 y Streptococcus thermophilus SS77. Rev Salud Anim 2019;41(1):1-13. 30. Huertas RAP. Efecto del té verde (Camellia Sinensis L.) en las características fisicoquímicas, microbiológicas, proximales y sensoriales de yogurt durante el almacenamiento bajo refrigeración. @ limentech, Cient Tech food 2013;11(1):5664. 31. Sánchez J, Enríquez D, Castro PJAS. Efecto de la concentración de sólidos totales de la leche entera y tipo de cultivo comercial en las características reológicas del yogurt natural tipo batido Agroind Sci 2012;2(2):173-80. 32. Díaz Jiménez B, Sosa Morales M, Vélez Ruiz J. Efecto de la adición de fibra y la disminución de grasa en las propiedades fisicoquímicas del yogur. Rev Mex Ing Quím 2004;3(3):287-305. 33. Simanca MM, Andrade RD, Arteaga MR. Efecto del salvado de trigo en las propiedades fisicoquímicas y sensoriales del yogurt de leche de búfala. Inf Tech 2013;24(1):79-86. 34. Vásquez-Villalobos V, Aredo V, Velásquez L, Lázaro M. Propiedades fisicoquímicas y aceptabilidad sensorial de yogur de leche descremada de cabra frutado con mango y plátano en pruebas aceleradas. Sci Agropecu 2015;6(3):177189. 35. Sánchez SH, Fabián DF, Ochoa MG, Alfaro AR. Sucesión bacteriana del tracto digestivo del lechón alimentado con ensilado biológico. Rev Inv Vet Perú 2019;30(1):214-223. 36. Ng SY, Koon SS, Padam BS, Chye FY. Evaluation of probiotic potential of lactic acid bacteria isolated from traditional Malaysian fermented Bambangan (Mangifera pajang). CyTA: J Food 2015;13(4):563-572. 37. Jurado GH, Aguirre FD, Ramírez TC. Caracterización de bacterias probióticas aisladas del intestino grueso de cerdos como alternativa al uso de antibióticos. Rev MVZ Córdova 2009;4(2):1723-1735. 38. Kern M, Aschenbach JR, Tedin K, Pieper R, Loss H, Lodemann U. Characterization of inflammasome components in pig intestine and analysis of the influence of probiotic Enterococcus faecium during and Escherichia coli challenge. Immunology Res 2017;46(7):742-757. 39. Chae JP, Pajarillo EAB, Oh JK, Kim H, Kang DK. Revealing the combined effects of lactulose and probiotic enterococci on the swine faecal microbiota using 454 pyrosequencing. Microb Biotechnol 2016;9(4):486-495.

136


Rev Mex Cienc Pecu 2021;12(1):120-137

40. Dowarah R, Verma AK, Agarwal N, Singh P, Singh BR. Selection and characterization of probiotic lactic acid bacteria and its impact on growth, nutrient digestibility, health and antioxidant status in weaned piglets. PLoS One 2018;13(3):1-24. 41. Estrada MAC, Gutiérrez RLA, Montoya COI. Evaluación in vitro del efecto bactericida de cepas nativas de Lactobacillus sp. contra Salmonella sp. y Escherichia coli in vitro. Rev FNAgron Medellín 2005;58(1):2601-2609. 42. Andrea M. Probióticos y su mecanismo de acción en alimentación animal. Agron Mesoamericana 2019;30(2):601-611. 43. Codex para leches fermentadas. Leche y productos lácteos segunda edición. STAN 243-2003. www.fao.org/3/a-i2085s.pdf. Consultado nov 20, 2018. 44. Caicedo WO, Moyano JC, Valle SB, Díaz LA, Caicedo ME. Calidad fermentativa de ensilajes líquidos de chontaduro (Bactris gasipaes) tratados con yogur natural, suero de leche y melaza. Rev Inv Vet Perú 2019;30(1):167-177. 45. Paucar-Menacho LM. Lúcuma (Pouteria lucuma): Composición, componentes bioactivos, actividad antioxidante, usos y propiedades beneficiosas para la salud. Sci Agropec 2020;11(1):135-142. 46. Benítez-de la Torre A, Montejo-Sierra IL, Morales-García YE, Muñoz-Rojas J, Díaz-Ruíz R, López PA. Adición de fuentes energéticas e inoculantes en la elaboración de yogurt de yuca. Pastos Forrajes 2018;4(1):30-34.

137


https://doi.org/10.22319/rmcp.v12i1.5131 Artículo

Actividad antihelmíntica in vivo de hojas de Acacia cochliacantha sobre Haemonchus contortus en cabritos Boer

Gastón Federico Castillo-Mitre a Rolando Rojo-Rubio a Agustín Olmedo-Juárez b* Pedro Mendoza de Gives b José Fernando Vázquez-Armijo a Alejandro Zamilpa c Héctor Aarón Lee-Rangel d Leonel Avendaño-Reyes e Ulises Macias-Cruz e

a

Universidad Autónoma del Estado de México, Centro Universitario UAEM-Temascaltepec.

b

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias, Centro Nacional de Investigación en Disciplinaria en Salud Animal e Inocuidad, carretera Federal Cuernavaca, Cuautla No. 8534/ Col. Progreso. 62550 Jiutepec, Morelos/A.P. 206-CIVAC, México. c

Instituto Mexicano del Seguro Social. Centro de Investigación Biomédica del Sur. México.

d

Universidad Autónoma de San Luís Potosí. Facultad de Agronomía,

e

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas,

*Autor de correspondencia: olmedo.agustin@inifap.gob.mx; aolmedoj@gmail.com

138


Rev Mex Cienc Pecu 2021;12(1):138-150

Resumen: El objetivo del presente trabajo fue evaluar el efecto de la inclusión de hojas de Acacia cochliacantha en una dieta de mantenimiento para cabritos de la raza Boer en el conteo fecal de huevos (CFH) de Haemonchus contortus, consumo de agua y materia seca. Diez cabritos recién destetados (16.850 ± 1.630 kg de peso vivo inicial y 3 meses de edad), fueron experimentalmente infestados con larvas (L3) de H. contortus (350 larvas por kilogramo de peso vivo), para probar dos tratamientos: T1: testigo (animales infectados con larvas L3 de H. contortus, sin inclusión de hojas de A. cochliacantha) y T2: animales infectados con larvas L3 de H. contortus, con inclusión de 5% hojas de A. cochliacantha en la dieta. Antes de asignar los tratamientos a los animales, se realizó un CFH por gramos de heces en cada uno de ellos y de esta manera agruparlos de mayor a menor en relación a la cantidad de huevos presentes en las heces, en los dos animales con valores más altos se asignaron aleatoriamente T1 o T2 y así sucesivamente hasta completar cinco repeticiones verdaderas para cada tratamiento. Las variables medidas fueron: CFH (por gramo de heces), consumo de agua y consumo de materia seca (CMS). Los resultados encontrados demostraron reducción (P<0.05) en el CFH de H. contortus en los cabritos donde se incluyó el 5% de hojas de A. cochliacantha en su dieta. Para el consumo de agua y CMS (g día-1) no existieron diferencias entre tratamientos (P> 0.05). Se concluye que la adición de hojas de A. cochliacantha en dietas para cabritos tienen actividad antihelmíntica, por lo que esta leguminosa arbórea podría representar una opción en el manejo integral de la nematodiasis de cabritos Boer en crecimiento. Palabras clave: Cabritos, Antihelmíntico, Acacia cochliacantha, Haemonchus contortus.

Recibido: 28/10/2018 Aceptado: 28/10/2019

Introducción Las enfermedades causadas por los nematodos gastrointestinales (NGI) en los pequeños rumiantes representan uno de los mayores problemas en el mundo, ya que afectan su salud y productividad. Haemonchus contortus es el principal NGI, que ocasiona las mayores pérdidas económicas en la industria ganadera en México, se estima que este problema puede representar hasta 445.1 millones de dólares anuales(1-3). En las últimas décadas, el uso indiscriminado de antiparasitarios para el control de NGI, ha ocasionado resistencia antihelmíntica; además del efecto residual que tienen algunos fármacos en el organismo y el ambiente(4,5). Esta problemática se está investigando para proponer alternativas de control sostenibles, focalizándose en el estudio de los metabolitos secundarios de las plantas leguminosas con propiedades antihelmínticas(6-9). Dentro de dichos

139


Rev Mex Cienc Pecu 2021;12(1):138-150

compuestos se tienen a los taninos condensados, terpenos, saponinas y flavonoides(10). De manera particular se ha demostrado que los flavonoides presentan actividad nematicida, que junto con taninos condensados libres actúan sinérgicamente potenciando su efecto contra los NGI(11,12). Acacia cochliacantha es una leguminosa conocida como “cubata” que se ha utilizado en la medicina tradicional para el tratamiento de enfermedades gastrointestinales(13). Diversos trabajos han reportado actividad nematicida in vitro a partir de extractos de sus hojas(8, 12), o compuestos específicos como los taninos, quercetina, ácido cafeico, cumárico y ferúlico(12). El objetivo del presente trabajo fue evaluar el efecto de la adición de hojas de A. cochliacantha en la dieta de cabritos Boer en crecimiento infectados experimentalmente con H. contortus, sobre la eliminación de huevos, consumo de materia seca y agua.

Material y métodos Zona de estudio El presente trabajo se desarrolló en la unidad experimental de pequeños rumiantes del Centro Universitario UAEM Temascaltepec; este lugar presenta una altura media sobre el nivel del mar de 1,740 m, con un clima del tipo cálido sub-húmedo con lluvias en verano (Aw)(14).

Material vegetal Se recolectaron hojas frescas (jóvenes y maduras) de Acacia cochliacantha en la localidad “El Salitre Palmarillos”, municipio de Amatepec, Estado de México, México, cuya localización está a 18°43'28'' N y 100°17'03'' O. El material vegetativo se colectó entre marzo y abril de 2016, durante las primeras horas de la mañana; las hojas fueron depositadas en una hielera para evitar cambios en su estructura química por efectos de fotoxidación, posteriormente se transportaron al laboratorio de nutrición animal del Centro Universitario UAEM Temascaltepec, donde se seleccionó un ejemplar para su identificación en el Herbario Nacional de México de la Universidad Nacional Autónoma de México. El material vegetal fue identificado por el Prof. Rafael Torres-Colín y depositado en el Herbario Nacional bajo el código de colecta OD07042016. Las hojas frescas se secaron a temperatura ambiente bajo la sombra hasta alcanzar peso constante, y así molerlas a un tamaño de partícula de 4 a 6 mm utilizando un molino eléctrico Wiley Mod. TS3375E15.

Análisis químicos Se realizó análisis bromatológico de las dietas experimentales y hojas de A. cochliacantha utilizando los siguientes métodos: materia seca (MS), materia orgánica (MO), proteína cruda (PC), extracto etéreo (EE)(15); para el fraccionamiento de la pared celular (FDN y FDA) se utilizó la

140


Rev Mex Cienc Pecu 2021;12(1):138-150

metodología descrita por Van Soest et al(16). El porcentaje de inclusión de las hojas de A. cochliacantha se le determinó el contenido de taninos condensados totales (TCT), de acuerdo a la técnica descrita por Terrill et al(17), modificada por López et al(18); taninos condensados ligados a proteína y a fibra se utilizando el método de Porter et al(19) con las modificaciones realizadas por Hagerman(20).

Material biológico

Se obtuvieron larvas infectantes de Haemonchus contortus (L3, cepa INIFAP) a partir de un ovino donador (22.3  0.5 kg de peso vivo) infectado con una dosis oral única de 350 L3 por kilo de peso vivo. El cordero fue atendido de acuerdo a la norma (NOM-062-ZOO-1999). Las larvas infectantes de H. contortus se obtuvieron a partir de cultivos mediante la técnica de Baermann(21).

Animales experimentales

Se utilizaron catorce cabritos machos de la raza Boer (16.850 ± 1.6 kg de peso vivo y 3 meses de edad) procedentes del rancho el Salitre, perteneciente al Centro Universitario UAEM Temascaltepec. Antes de iniciar el experimento, todos los animales se desparasitaron con ivermectina comercial a una dosis única de 0.22 mg-1 kg de peso vivo, esto con la finalidad de eliminar cualquier infección natural de NGI. Después de aplicar el antiparasitario, los cabritos se alojaron en corraletas individuales (equipados con sombra, comedero y bebedero). Pasado ese periodo, se corroboró que los animales estuvieran negativos a infección de NGI mediante la técnica de McMaster(22) y al día 16 se inocularon experimentalmente de forma individual con una dosis única de 350 L3 por Kg de peso vivo de H. contortus. Una vez que los cabritos fueron diagnosticados como positivos a la presencia de huevos de H. contortus (día 30), se lotificaron en dos grupos (n= 7) acorde a su eliminación de huevos por gramo de heces (HPG) y a su peso corporal. Previo a la infección, los animales recibieron una dieta de adaptación sin hojas de A. cochliacantha (Cuadro 1). Las dietas se balancearon basándose a los requerimientos para cabritos en crecimiento mediante las tablas del NRC del 2007 para pequeños rumiantes(23).

141


Rev Mex Cienc Pecu 2021;12(1):138-150

Cuadro 1: Ingredientes, aporte proteína y energía metabolizable de las dietas experimentales de mantenimiento proporcionadas a cabritos infectados con Haemonchus contortus Tratamiento Ingrediente (%) 1 2 Acacia cochliacantha 0.00 5.00 Heno de alfalfa 33.00 28.00 Maíz molido 5.00 5.00 Sorgo molido 17.50 17.50 Pasta de soya 7.00 7.00 Salvado de trigo 10.00 10.00 Paja de avena 25.00 25.00 Melaza 0.00 0.00 Premezcla de vitaminas y minerales 2.50 2.50 Total 100.00 100.00 Aporte de proteína cruda 12.78 12.76 1 Aporte de energía metabolizable (MJ/kg MS) 2.84 2.83 T1: control (animales infectados, sin inclusión de hojas de A. cochliacantha) y T2: animales infectados, con inclusión de 5% hojas de A. cochliacantha en la dieta. 1 Calculado de acuerdo a los contenidos individuales de energía de cada alimento incluido en la dieta(23).

Diseño experimental Durante el desarrollo del experimento y debido a que los cabritos estaban bajo un estrés pos destete, se puso en peligro la vida de cuatro de ellos, ya que los valores de volumen celular aglomerado (VCA) eran muy bajos, lo que indicó un estado grave de anemia, y los conteos fecales de huevos eran demasiados altos (HPG > 12,500), por lo que fue necesario retirarlos del experimento, quedando solo 10 de ellos, los cuales se asignaron a los dos tratamientos previamente establecidos: T1: control (animales infectados con larvas L3 de H. contortus y sin adición de hojas de A. cochliacantha en su dieta) y T2: tratamiento (animales infectados con larvas L3 de H. contortus y adición de 5% hojas de A. cochliacantha en su dieta). Las variables de respuesta fueron: CFH por gramo de heces, consumo de materia seca y agua. Semanalmente se tomaron muestras de heces (días pos-infección: 1, 7, 14, 21 y 28) directamente del recto de cada animal. El material fecal se procesó para estimar el CFH por gramo de heces utilizando la técnica de McMaster(22). El consumo de materia seca y agua se determinó diariamente mediante la sustracción del alimento o agua ofrecida menos el rechazo. La eficacia antiparasitaria fue estimada mediante la fórmula de Abbott: Eficacia (reducción de CFH g heces, %)= [(CFH g heces del grupo control – CFH g heces de grupo tratado) / CFH g heces del grupo control)]*100

142


Rev Mex Cienc Pecu 2021;12(1):138-150

Análisis estadístico

Los resultados se procesaron mediante un análisis de varianza utilizando el procedimiento GLM del SAS(24). Bajo un diseño completamente al azar, cuando existieron diferencias entre tratamientos, las medias se separaron mediante la prueba PDIFF, STDERR statement. La significancia se declaró a un nivel de P≤ 0.05 y la tendencia de 0.05 < P ≤ 0.10(25).

Resultados Análisis químico

Los resultados de la composición química de las dietas experimentales, así como el contenido de taninos en las hojas de A. cochliacantha se muestran en los Cuadros 1 y 2. Cuadro 2: Análisis químico proximal de hojas deshidratadas de Acacia cochliacantha y su contenido de taninos

A. cochliacantha

MO

PC

FDN

FDA

TCL

TCP

TCF

TCT

937.0

163.0

698.6

581.7

140.0

26.0

36.0

202.0

MO= materia orgánica, PC= proteína cruda, FDN= fibra detergente neutro, FDA= fibra detergente acido, TCL= taninos condensados libres, TCP= taninos condensados ligados a proteína, TCF= taninos condensados ligados a fibra, TCT= taninos condensados totales.

Conteo fecal de huevos

Los resultados del CFH por gramo de heces y porcentaje de eficacia de la dieta que contenía hojas deshidratadas de A. cochliacantha se presentan en el Cuadro 3. El porcentaje de reducción causado por esta leguminosa estuvo en intervalos de 32.8-70.8 a partir del día 14 al 28 respectivamente.

143


Rev Mex Cienc Pecu 2021;12(1):138-150

Cuadro 3: Conteo fecal de huevos de Haemonchus contortus (CFH, media ± desviación estándar) y porcentaje de eficacia de la dieta adicionada con hojas de Acacia cochliacantha Días de muestreo Tratamiento 1 7 14 21 28 CFH (/g T1 1100±120 3250±735b 2980±345ª 5300±435a 6850±1432.90ª de heces) % ---------------Eficacia CFH (/g T2 1100±133 6850±828ª 2000±367b 2050±432b 2000±178b de heces) % ----110.7 32.8 81.1 70.8 Eficacia Valor de P > 0.15 <0.05 < 0.01 < 0.01 < 0.01 T1= testigo (animales infectados con larvas L3 de H. contortus) y T2= animales infectados con larvas L3 de H. contortus, con inclusión de 5% hojas de A. cochliacantha en la dieta.

Consumo de agua y materia seca Los resultados de consumo de agua y materia seca son mostrados en el Cuadro 4. No se encontró (P>0.05) efecto en ambas variables. Cuadro 4: Consumo de agua (CA) y materia seca (MS) por día en cabritos infectados con Haemonchus contortus recibiendo una dieta adicionada con hojas de Acacia cochliacantha

T 1 2 P

Días de muestreo 1 7 14 21 28 CA MS CA MS CA MS CA MS CA MS 1.7±0. 436.3±47. 1.6±0. 530.0±80. 1.8±0. 650.4±17 1.7±0. 647.7±20 1.8±0. 651.5±21 3 6 1 4 1 3.2 08 6.7 2 1.0 1.6±0. 448.7±10 1.5±0. 559.7±14 1.8±0. 625.0±21 1.7±0. 745.1±27 1.7±0. 694.5±19 3 0.0 4 1.3 5 6.6 4 2.5 4 4.2 0.71 0.80 0.69 0.69 0.76 0.84 0.90 0.52 0.75 0.76 T= tratamiento; 1= testigo (animales infectados con larvas L3 de H. contortus) y T2: animales infectados con inclusión de 5% hojas de A. cochliacantha en la dieta. Consumo de agua en litros y consumo de materia seca en gramos por día.

Discusión El presente estudio mostró efecto antiparasitario atribuido al consumo de hojas de A. cochliacantha en los cabritos, de tal forma que el consumo prolongado de esta leguminosa tiene beneficios sobre

144


Rev Mex Cienc Pecu 2021;12(1):138-150

la salud de los animales. Recientemente esta leguminosa fue evaluada contra parásitos gastrointestinales de bovinos y ovinos bajo condiciones in vitro, y se encontraron resultados positivos(8,12). En esos trabajos se demostró la actividad ovicida y larvicida en contra de diferentes NGI, entre ellos a Haemonchus contortus. Con estos antecedentes, la presente investigación confirma el efecto antiparasitario in vivo contra los nematodos gastrointestinales de mayor importancia en la salud de los pequeños rumiantes. Estos mismos resultados han sido reportados en investigaciones previas, cuando la inclusión de hojas deshidratadas de Lysiloma acapulcensis en la dieta de ovinos de pelo que fueron infectados experimentalmente con larvas (L3) de H. contortus, disminuyó en 67.7 % la excreción fecal de huevos por gramo de heces(9). En otro trabajo realizado en Brasil se reportaron reducciones hasta del 70 % al suministrar hojas de Mimosa caesalpiniifolia en ovinos infectados con H. contortus(26). Por otra parte, es sabido que, cuando arboles leguminosos forman parte de la dieta de los rumiantes, no solo se obtendrán beneficios en la salud, sino que también se incrementa la ingesta de proteína dietaría, dado que la mayoría de estos recursos forrajeros contienen más del 18 % de PC en su materia orgánica, concentraciones altas si son comparadas con aquellas de las gramíneas que raramente sobrepasan el 10 %, con esto queda de manifiesto que, estás plantas tienen un efecto nutraceútico en los animales(27). En este sentido, existen diversas investigaciones que han hipotetizado que animales alimentados a base de gramíneas y leguminosas, la proporción de consumo dependerá del nivel de proteína en las gramíneas. Y si éste llegara a ser menor a 8 %, los animales incrementarán su consumo de leguminosas, las cuales pueden ser arbustivas y arbóreas. Al respecto, en un estudio realizado por Méndez-Ortíz et al(28) observaron que ovinos infectados por H. contortus consumían mayor cantidad de una leguminosa arbórea rica en metabolitos secundarios (Havardia albicans). Sin embargo, cuando este tipo de leguminosas son suministradas en las dietas de los animales en confinamiento, los efectos pueden ser positivos o negativos, afectando directamente el nivel de ingesta alimenticia y proteína metabolizable, lo cual está relacionado directamente con la cantidad de taninos condensados por gramo de materia seca. Se menciona que para obtener beneficios, la cantidad de taninos condensados no debería sobrepasar el 5% del total de la dieta(29). En el presente estudio no se observaron efectos negativos en el consumo de agua y materia seca en los animales que estuvieron consumiendo la dieta adicionada con hojas de A. cochliacantha, lo cual demostró que la ingesta de taninos condensados totales no afectó el consumo de materia seca. De acuerdo a lo reportado en la literatura, se menciona que cuando la dieta contiene altos niveles de compuestos secundarios y de manera particular taninos condensados libres (superiores a los 50 g kg-1 de MS), se podría inhibir la actividad microbiana afectando la digestibilidad de la fracción potencialmente digestible de los nutrientes y por consecuencia deprimir el consumo de materia seca al aumentar el tiempo medio de retención en el rumen(30). Aunque este fenómeno podría tener

145


Rev Mex Cienc Pecu 2021;12(1):138-150

un efecto positivo en el metabolismo de los compuestos nitrogenados al disminuir la proteólisis ruminal, lo que derivaría en un aumento de la proteína de sobrepaso e incrementar el flujo de aminoácidos a duodeno, aumentando el conjunto de proteína metabolizable para fines productivos en los animales(31). Los resultados del análisis en taninos condesados presentes en A. cochliacantha, (Cuadro 2) revelaron que es una planta que podría tener efectos como los explicados anteriormente ya que tiene 20.2 % de taninos condensados totales y 14.0 % de taninos condensados libres (TCL), los cuales son los compuestos bioactivos y pueden secuestrar a los carbohidratos y proteínas de la dieta. Sin embargo, debido a que sólo se incluyó el 5 % de las hojas de A. cochliacantha en la dieta total el consumo de taninos condensados totales (TCT) fue el 5.70 g y de estos solo sólo 3.9 g fueron de TCL, concentración que no fue suficiente para deprimir el consumo de materia seca en los animales que se les incluyó hojas de A. cochliacantha en su dieta. Estos resultados están relacionados con un estudio realizado por León-Castro et al(32) donde reportaron importantes reducciones de HPG de H. contortus en cabritos infectados de forma artificial que estuvieron alimentados con un 10 % de inclusión de follaje de A. cochliacantha sin observar efectos negativos en la salud de los animales. No obstante, futuros estudios serán considerados como la dosis respuesta sobre el consumo, digestibilidad de la materia seca y orgánica de dietas basales con diferentes niveles de hojas de A. cochliacantha. Se conoce que las plantas ricas en metabolitos secundarios como los taninos contienen propiedades nutracéuticas(7) y en muchos trabajos de nutrición animal se ha comprobado que los taninos son los poli-fenoles responsables de mejorar el valor nutricional de las dietas para el ganado. Del mismo modo, se ha reportado que extractos de plantas ricas en taninos pueden contener propiedades antiparasitarias(32-35). Sin embargo, pese a que A. cochliacantha contiene altas cantidades de taninos condensados se podría inferir que estos compuestos son los probables responsables de la actividad antiparasitaria; no obstante Castillo-Mitre et al(12), reportaron que los compuestos responsables de la actividad fueron derivados del ácido hidroxicináminco (ácido cafeico, cumárico, ferúlico y metil cafeatos). Por lo tanto, la actividad antiparasitaria de esta leguminosa podría deberse a estos compuestos y los taninos podrían colaborar de forma secundaria sobre el control de H. contortus mediante la protección de proteína de la dieta a los microorganismos del rumen. En este sentido, los resultados del presente trabajo (in vivo) y los de otros estudios in vitro(12) con A. cochliacantha podrían ser importantes para realizar futuras investigaciones sobre sus propiedades nutracéuticas en pequeños rumiantes.

146


Rev Mex Cienc Pecu 2021;12(1):138-150

Conclusiones e implicaciones Los resultados del presente trabajo muestran que Acacia cochliacantha contiene propiedades antiparasitarias y puede ser una fuente de alimento importante para cabritos infectados con NGI, ya que no se deprime el consumo de agua y alimento. Conflicto de intereses Los autores declaran que no existe conflicto de intereses. Agradecimientos Parte de este trabajo fue financiado por INIFAP (proyecto SIGI 8215734475) y la Universidad Autónoma del Estado de México (Proyecto UAEM 4585/2018/CIP) y la Red Temática de Farmoquímicos, CONACYT (Proyecto número 294727, 2018). Este estudio fue parte de tesis doctoral de Gastón Federico Castillo-Mitre bajo la dirección del Dr. Rolando Rojo-Rubio y el Dr. Agustín Olmedo-Juárez. Literatura citada: 1. Rodíguez-Vivas RI, Grisi L, Pérez-de León AA, Silva-Villela H, Torres-Acosta JFJ, FragosoSánchez H. et al. Evaluación del impacto económico potencial de los parásitos del ganado bovino en México. Revisión. Rev Mex Cienc Pecu 2017; 8(1):61-74. 2. Marume U, Chimonyo M, Dzama K. A preliminary study on the responses to experimental Haemonchus contortus infection in indigenous goat genotypes. Small Ruminant Res 2011; 95:70–74. 3. Githiori J, Athanasiadou S, Thamsbprg S. Use of plants in novel approaches for control of gastrointestinal helminthes in livestock with emphasis on small ruminants. Vet Parasitol 2006;139:308-320. 4. Jackson F, Coop RL. The development of anthelmintic resistance in sheep nematodes. Parasitol 2000;120:95-107. 5. Tsiboukis D, Sazakli E, Jelastopulu E, Leotsinidis M. Anthelmintics residues in raw milk. Assessing intake by a children population. Pol J Vet Sci 2013;16:85-91. 6. Olmedo-Juárez A, Rojo-Rubio R, Arece-García J, Mohamed AZS, Kholif EA, Morales AE. In vitro of Pithecellobium dulce and Lysiloma acapulcensis on the exogenous development of gastrointestinal strongyles in sheep. Ital J Anim Sci 2014;13:303-307.

147


Rev Mex Cienc Pecu 2021;12(1):138-150

7. García-Hernández C, Arece-García J, Rojo-Rubio R, Mendoza-Martínez GD, Albarrán-Portillo B, Vázquez-Armijo JF, et al. Nutraceutic effect of free condensed tannins of Lysiloma acapulcensis (Kunth) Benth on parasite infection and performance of Pelibuey sheep. Trop Anim Health Prod 2017;49:55-61. 8. Olmedo-Juárez A, Rojo-Rubio R, Zamilpa A, Mendoza-de Gives P, Arece-García J, LópezArellano ME, et al. In vitro larvicidal effect of a hydroalcoholic extract from Acacia cochliacantha leaf against ruminant parasitic nematodes. Vet Res Commun 2017;41:227-232. 9. González-Cortazar M, Zamilpa A, López-Arellano ME, Aguilar-Marcelino L, Reyes-Guerrero DE, Olazarán-Jenkins S, et al. Lysiloma acapulcensis leaves contain anthelmintic metabolites that reduce the gastrointestinal nematode egg population in sheep faeces. Comp Clin Pathol 2018;27:189-197. 10. Williams AR, Ropiak HM, Fryganas C, Desrues O, Mueller-Harvey I,Thamsborg SM. Assessment of the anthelmintic activity of medicinal plant extracts and purified condensed tannins against free-living and parasitic stages of Oesophagostomum dentatum. Parasit Vectors 2014;7:518-527. 11. Klongsiriwet C, Quijada J, Williams AR, Mueller-Harvey I, Williamson EM, Hoste H. Synergistic inhibition of Haemonchus contortus exsheathment by flavonoid monomers and condensed tannins. International J Parasitol Drugs Drug Resist 2015; 5:17-134. 12. Castillo-Mitre GF, Olmedo-Juárez A, Rojo-Rubio R, Cortázar-González M, Mendoza-de Gives P, Hernández-Beteta EE, et al. Caffeoyl and coumaroyl derivatives from Acacia cochliacantha exhibit ovicidal activity against Haemonchus contortus. J Ethnopharmacol 2017;204:125-131. 13. Argueta VA, Cano ALM, Radoarte ME. Atlas de plantas de la medicina tradicional mexicana. México, D.F., 1994. 14. García E. Modificaciones al sistema de clasificación climática de Koeppen. Universidad Nacional Autónoma de México, México. 1987. 15. AOAC (Association of Official Analytical Chemists) Official Methods of Analysis, 16th edition. AOAC, Arlington, VA, USA. 1997. 16. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74:3583-3597. 17. Terrill TH, Rowan AM, Douglas GB, Barry TN. Determination of extractable and bound condensed tannins concentration in forage plants, protein concentrate meals and cereal grains. J Sci Food Agric 1992;58:321-329.

148


Rev Mex Cienc Pecu 2021;12(1):138-150

18. López J, Tejada I, Vásquez C, Garza JD, Shimada A. Condensed tannins in humid tropical fodder crops and their in vitro biological activity: part 1. J Sci Food Agric 2004; 84:291-294. 19. Porter LJ, Hrstich LN, Chan BG. The conversion of procyanidins and prodelphinidins to cyanidin and delhpinidin. Phytochem 1986;25:223-230. 20. Hagerman AE, Butler, LG. In Herbivores: Their interactions with secondary plant metabolites. Volume I. New York: Academic Press; 1991:355-388. 21. Mesquita JR, Mega C, Coelho C, Cruz R, Vala H, Esteves F, et al. ABC series on diagnostic parasitology part 3: The Baermann technique. The Veterinary Nurse 2017;8:10. doi.org/10.12968/vetn.2017.8.10.558 22. Arece J, Mahieu M, Archiméde H, Aumont G, Fernández M, González E, et al. Comparative efficacy of six anthelmintics for the control of nematodes in sheep in Matanzas, Cuba. Small Ruminant Res 2004;5(1–2):61–67. 23. NRC. Nutrient requirements of small ruminants, sheep, goats, cervids, and new world camelids. The National Academy Press, Washington, DC, 2007. 24. SAS Institute SAS User’s Guide: Statistics. Ver 9.0. SAS Institute, Cary, N.C., USA, 2006. 25. Steel RGD, Torrie JH. Bioestadística: Principios y procedimientos. McGraw-Hill. México, 1980. 26. Brito DRB, Costa-Júnior LM, Garcia JL, Torres-Acosta JFJ, Louvandini H, Cutrim-Júnior JAA, et al. Supplementation with dry Mimosa caesalpiniifolia leaves can reduce the Haemonchus contortus worm burden of goats. Vet Parsitol 2018;252:47-51. 27. Hoste H, Torres-Acosta JFF, Quijada J, Chan-Pérez I, Dakhel MM, Kommuru DS, et al. Interactions between nutrition and infections with Haemonchus contortus and related gastrointestinal nematodes in small ruminants. Adv Parasitol 2016;93:239-351. 28. Méndez-Ortíz FA, Sandoval-Castro CA, Torres-Acosta JFJ. Short term consumption of Havardia albicans tannin rich fodder by sheep: Effects on feed intake, diet digestibility and excretion of Haemonchus contortus eggs. Anim Feed Sci Technol 2012; 176:185-191. 29. Frutos P, Hervás G, Giráldez FJ, Mantecón AR. Review. Tannins and ruminant nutrition. Span J Agric Res 2004;2:191–202. 30. Waghorn GC, McNabb WC. Consequences of plant phenolic compounds for productivity and health of ruminants. Proc Nut Soc 2003;62:383–392.

149


Rev Mex Cienc Pecu 2021;12(1):138-150

31. Barry TN. Condensed tannins: their role in ruminant protein and carbohydrate digestion and possible effects upon the rumen ecosystem. In: Nolan JV, et al, editors. The roles of protozoa and fungi in ruminant digestion. Armidale, NSW, Australia: Pernambul Books; 1989:153– 167. 32. León-Castro Y, Olivares-Pérez J, Rojas-Hernández S, Villa-Mancera A, Valencia-Almazán MT, Hernández-Castro E, et al. Effect of three fodders tree on Haemonchus contortus control and weight variations in kids. Eco Rec Agro 2015;2:193–201. 33. Barrau E, Fabre N, Fouraste I, Hoste H. Effect of bioactive compounds from Sainfoin (Onobrychis viciifolia Scop.) on the in vitro larval migration of Haemonchus contortus: role of tannins and flavonol glycosides. Parasitol 2005;31(4):531-538. 34. Brunet S, Hoste H. Monomers of condensed tannins affect the larval exsheathment of parasitic nematodes of ruminants. J Agric Food Chem 2006; 54(20):7481-7487. 35. Quijada J, Fryganas C, Ropiak HM, Ramsay A, Mueller-Harvey I, Hoste H. Anthelmintic activities against Haemonchus contortus or Trichostrongylus colubriformis from small ruminants are influenced by structural features of condensed tannins. J Agric Food Chem 2015;63(28):6346-6354.

150


https://doi.org/10.22319/rmcp.v12i1.5455 Artículo

Efecto de la harina de pupas y larvas de gusano de seda como componentes proteicos de la dieta sobre indicadores de rendimiento en conejos

Dorota Kowalska a Janusz Strychalski b* Andrzej Gugołek b

a

National Research Institute of Animal Production. Department of Small Livestock Breeding. Balice n. Kraków, Poland. b

University of Warmia and Mazury. Faculty of Animal Bioengineering. Department of Fur-bearing Animal Breeding and Game Management. Olsztyn, Poland.

* Autor de correspondencia: janusz.strychalski@uwm.edu.pl

Resumen: El objetivo de este estudio es evaluar el efecto de la alimentación de conejos con harinas de pupas de gusanos de seda y larvas de gusanos de la harina sobre sus indicadores de rendimiento. Se dividieron noventa (90) conejos en tres grupos. El grupo testigo (T) fue alimentado con un 10% de harina de soya (HS), el grupo HS recibió una dieta que incluía un 5% de HS y un 4% de harina de pupas de gusanos de seda, y el grupo HLGH recibió una dieta que incluía un 5% de HS y un 4% de harina de larvas de gusanos de seda. Se determinó el peso corporal de los conejos y la ganancia media diaria. Se calculó el índice de conversión alimenticia (ICA). Al final del periodo de engorde, los animales fueron sometidos a eutanasia, desollados y eviscerados para determinar las características de sus canales. Se recogieron los músculos del pernil y del lomo para analizar la composición química. Al final del período de engorde, los conejos de los grupos HS y HLGH eran más pesados que los conejos T (2.606,5 y 2.584,8 frente a 2.404,0 g), lo que también mejoró las características generales de la canal, mientras que el ICA fue similar en los diversos grupos. Sin embargo, el alimentar a los conejos con harinas adicionadas con insectos aumentó la cantidad de extracto etéreo en sus músculos. Con base en los resultados obtenidos, se puede concluir que en las dietas de 151


Rev Mex Cienc Pecu 2021;12(1):151-162

los conejos se puede sustituir parcialmente la harina de soya con las harinas de pupas de gusanos de seda y de larvas de gusanos de harina. Palabras clave: Rendimiento de crecimiento, Alimentación de conejos, Pupas de gusano de la seda, Harina de soya, Larvas de gusano.

Recibido: 16/07/2019 Aceptado: 10/01/2020

Introducción Se ha abordado en forma creciente el uso de diversas especies de insectos como fuente de proteínas y grasas en la dieta. En muchos países, los invertebrados son una fuente popular de proteínas en los piensos compuestos para el ganado. Los animales de granja son alimentados con larvas de la mosca soldado negra (Hermetia illucens)(1), la mosca doméstica (Musca domestica)(2), el gusano de la harina (Tenebrio molitor)(3,4) y el gusano de seda (Bombyx mori)(5), así como insectos del orden Orthoptera, es decir, langostas y grillos(6). En muchos países europeos, la principal fuente de proteínas para los conejos de engorde es la harina de soya extraída importada y, en menor medida, la harina de colza y de girasol(7,8). También se prueban otras fuentes de proteínas, como las semillas de legumbres y los granos secos de destilería con solubles (DDGS)(9,10,11). La literatura sobre el uso de insectos en la alimentación de los conejos es escasa, aunque el interés por este tema ha aumentado en los últimos años. En primer lugar se estudió la posibilidad de sustituir la harina de soya por harina de crisálida de gusano de seda(12), y recientemente se exploró la posibilidad de añadir aceite de Tenebrio molitor y grasa de Hermetia illucens a las dietas de los conejos(13,14,15). La alimentación de animales herbívoros con harinas de insectos está actualmente prohibida en Europa, pues se busca minimizar el riesgo de transmisión de las encefalopatías espongiformes transmisibles (EET). Además, en Europa las harinas de insectos son costosas, por lo que su uso en la alimentación animal no se justifica económicamente. No obstante, cabe señalar que Liu et al(16) consideran que las pupas de gusanos de seda no son un factor de tratamiento sino un ingrediente normal de las dietas para conejos, lo que puede ser indicativo de su uso generalizado en China. La base de datos Derwent Innovations Index de Web of Science (consultada el 31 de diciembre de 2018), enumera las patentes chinas para alimentar a los conejos con polvo de gusano de harina amarillo (cuatro patentes) y con pupas de gusano de seda (23 patentes), además de otros ingredientes dietéticos. Se puede hipotetizar que las harinas de insectos pueden ser una alternativa viable a la alimentación con harina de soya en la alimentación de los conejos en crecimiento. El 152


Rev Mex Cienc Pecu 2021;12(1):151-162

objetivo de este estudio es destacar el efecto de la alimentación de los conejos con harina de pupas de gusano de seda y harina de larvas de gusano de seda en sus indicadores de rendimiento.

Material y métodos El estudio se llevó a cabo en Aleksandrowice, población situada en el sur de Polonia, Europa (50o04'53" N y 19o45'48" E). El proyecto fue aprobado por el comité de ética local (caso nº 1192/2015). El factor experimental consistió en añadir la harina de pupas de gusanos de seda y de la harina de larvas de gusanos de seda en las mezclas de piensos en gránulos. Se ha determinado la composición química y el valor energético de estos componentes y de la harina de soya (HS) (Cuadro 1). La mezcla de dietas del grupo testigo (T) contenía un 10 % de harina de soya extraída (HS). La dieta del primer grupo experimental (HS) contenía un 5 % de harina de soya y un 4 % de harina de pupas de gusano de seda. La del segundo grupo (HLGH) incluía un 5 % de harina de soya y un 4 % de harina de larvas de gusanos de la harina (Cuadro 2). Se determinó la composición química y el contenido energético de las mezclas de dietas granuladas (Cuadro 3). Cuadro 1: Composición química (% de MS) y contenido energético medido (MJ/kg) de la harina de soya, la harina de pupas de gusano de seda y la harina de larva de gusano de seda Larvas de Pupas de gusanos Soya gusanos de de seda seda Materia seca 893.5 944.0 943.0 Ceniza bruta 67.3 44.0 34.0 Proteína cruda 502.6 517.5 513.4 Extracto etéreo 21.5 241.9 279.5 Fibra detergente neutra 150.2 64.9 114.2 Fibra detergente ácida 78.4 54.9 75.9 Lignina detergente ácida 39.6 24.6 12.6 Lisina 32.7 29.0 28.2 Metionina + cistina 14.1 21.3 10.7 Treonina 19.1 21.1 21.6 Triptófano 6.6 7.1 6.1 Energía bruta 16.38 23.94 22.50

153


Rev Mex Cienc Pecu 2021;12(1):151-162

Cuadro 2: Ingredientes de las mezclas de las dietas (%) Grupo Testigo HS Harina de soya 10 5 Harina de pupas de gusanos de seda 0 4 Harina de larvas de gusano de seda 0 0 Harina de alfalfa 25 25 Harina de canola 4 4 1 DDGS de maíz 4 4 Salvado de trigo 25 26 Trigo molido 5 5 Cebada molida 10 10 Pulpa de remolacha seca 7 7 2 Arbocel 5 5 Levadura forrajera 1 1 Suero de leche seco 1 1 Sal 0.2 0.2 Piedra caliza molida 1.3 1.3 Fosfato de las dietas 0.5 0.5 3 Premezcla de vitaminas y minerales 1 1 Total 100 100

HLGH 5 0 4 25 4 4 26 5 10 7 5 1 1 0.2 1.3 0.5 1 100

1

Granos secos de destilería con solubles. 2 Concentrado de fibra cruda. 3 1 kg: vit A 3 500 000 UI, vit D3 200 000 UI, vit E 28 000 mg, vit K3 200 mg, vit B1 1 500 mg, vit B22 800 mg, vit B6 2 800 mg, vit B12- 20 000 mcg, ácido fólico 200 mg, niacina 10 000 mg, biotina 200 000 mcg, pantotenato de calcio 7 000 mg, colina 30 000 mg, Fe 17 000 mg, Zn 2 000 mg, Mn 1 000 mg, Cu (sulfato de cobre x 5H2O, 24. 5%) 800 mg, Co 1 000 mg, I 100 mg, metionina 150 g, Ca 150 g, P 100 g

Cuadro 3: Composición química (% de MS) y contenido energético medido (MJ/kg) de las mezclas de piensos Grupo Testigo HS HLGH Materia seca 892.0 894.0 894.0 Ceniza bruta 79.3 78.3 78.0 Proteína cruda 187.1 187.7 187.6 Extracto etéreo 31.2 40.1 41.4 Fibra detergente neutra 274.6 271.3 273.0 Fibra detergente ácida 154.1 153.0 153.8 Lignina detergente ácida 36.1 35.5 35.0 Lisina 8.7 8.6 8.5 Metionina + cistina 5.2 5.5 5.1 Treonina 6.9 7.0 7.1 Triptófano 2.4 2.4 2.4 Energía bruta 16.86 16.95 16.94 154


Rev Mex Cienc Pecu 2021;12(1):151-162

Noventa (90) conejos blancos de Nueva Zelanda (NZW) se dividieron en tres grupos iguales, siendo análogos en términos de origen, proporción de sexos y peso corporal. El experimento se llevó a cabo de septiembre a octubre y comenzó cuando los conejos fueron destetados a los 35 días de edad y terminó cuando alcanzaron los 90 días de edad. Los conejos se mantuvieron en un pabellón experimental cerrado, en jaulas planas de red de alambre (0,5 0,6 0,4 m; 1 animal cada una), y fueron alimentados con piensos granulados a voluntad. Se mantuvieron en condiciones estándar: a una temperatura de 18 a 20 °C y a una humedad relativa del aire de 60 a 75 %, con ventilación intensiva de las salas y fotoperiodo regulado (16 h de iluminación y 8 h de oscuridad). Los conejos se pesaron en una báscula electrónica los días 35, 56, 70 y 90 (n= 30). Estos datos permitieron calcular las ganancias diarias de peso corporal (GDC) de los conejos y el índice de conversión alimenticia (ICA): ganancias de peso corporal (g)/ingreso de alimento (g). Al final del ensayo de producción, tras 24 h de ayuno, los animales fueron pesados y sacrificados según las recomendaciones aceptadas para la eutanasia de los animales de experimentación (los conejos fueron aturdidos y desangrados, y todo el procedimiento duró unos 2 min). Tras la matanza, los animales fueron desollados y eviscerados. Después de enfriar las canales (durante 24 h, a 4 ºC), se tomaron muestras de músculo (pernil y lomo, n= 20) para los análisis químicos y se calculó el porcentaje de aliño (PA; n= 20) de la siguiente manera: PA (%) = peso de la canal refrigerada sin cabeza ni menudillos (kg) / peso vivo (kg) x 100%. La composición química de las dietas y de los músculos de los animales se determinó mediante los métodos estándar de la Asociación de Químicos Agrícolas Oficiales (AOAC)(17) en muestras duplicadas. El contenido de materia seca se determinó en un secador de laboratorio, a 103 ºC. El contenido de cenizas brutas se estimó mediante la mineralización de la muestra en un horno de mufla (Czylok, Polonia) a 600 ºC. El contenido de nitrógeno total se determinó por el método Kjeldahl, en la unidad de destilación automática FOSS TECATOR Kjeltec 2200. El contenido de extracto etéreo se estimó por el método Soxhlet, en el FOSS SOXTEC SYSTEM 2043. La FDN (fibra detergente neutra), la FDA (fibra detergente ácida) y la LDA (lignina detergente ácida) se estimaron mediante el sistema FOSS TECATOR Fibertec 2010. La FDN se determinó según el procedimiento propuesto por Van Soest et al(18). La ADF y la ADL se determinaron según los procedimientos de la AOAC(17). Los niveles de aminoácidos se determinaron utilizando el analizador de aminoácidos Biochrom 20 plus y los reactivos de análisis de aminoácidos Biochrom (Biochrom Ltd., Cambridge, Inglaterra). El contenido energético bruto se determinó mediante un calorímetro de bomba (IKA® C2000 básico, Alemania). Los datos se expresaron como media ± error estándar de la media (EEM). Los resultados se procesaron estadísticamente utilizando medias de mínimos cuadrados en procedimientos GLM. Para la comparación de los datos, se utilizó el modelo Yijk = µ + αi + βj + αiβj + εijk, donde µ es la media general, αi es el efecto de la dieta, βj es el efecto del sexo, αiβj es el efecto de interacción entre la dieta y el sexo, y εijk es el error 155


Rev Mex Cienc Pecu 2021;12(1):151-162

aleatorio. La significancia de las diferencias entre los grupos se determinó mediante la prueba de rangos múltiples de Duncan. Los análisis no revelaron efectos significativos del sexo ni interacciones significativas entre los efectos fijos, por lo que no se presentan en las tablas. Los cálculos se realizaron con el software Statistica(19).

Resultados El peso corporal de los conejos a los 35 días fue similar entre los grupos. Sin embargo, cuando se midió a los 56 días, los conejos del grupo HLGH eran más pesados que los conejos de los grupos testigo y HS (Cuadro 4). A los 70 días, se observaron diferencias en el peso corporal entre los tres grupos. El mayor peso corporal se observó en los conejos HLGH (1,954.1 g), seguidos de los conejos HS (1,883.3 g) y T (1,818.3 g). Al final del periodo de engorde, los conejos de los grupos HS y HLGH eran más pesados que los conejos del grupo testigo (2,606.5 y 2,584.8 vs 2,404.0 g). De acuerdo con los pesos corporales medidos, el IDPC de 35 a 56 d fue mayor en el grupo HLGH (28.93 g/día) que en el grupo C (22.38 g/día) y en el grupo HS (23.31 g/día). No se observaron diferencias significativas entre los grupos en los incrementos diarios del peso corporal de los conejos de 57 a 70 d. En el período final de engorda, los incrementos diarios de peso de los conejos HS fueron superiores a los calculados para los otros grupos (36.16 g/día en el grupo HS frente a 29.28 g en el grupo T y 31.53 g en HLGH). En general, el IDPC de los conejos de 35 a 90 días fue mayor en los grupos HS (33.2 g/día) y HLGH (32.9 g) que en el grupo T (sólo 29.6 g). El ICA fue similar entre los grupos y osciló entre 3.62 g/g en el grupo HS y 3.65 g/g en el grupo T. No se registró ninguna pérdida de animales durante el periodo de crecimiento. Cuadro 4: Rendimiento de crecimiento, ganancias diarias de peso corporal, índice de conversión alimenticia y mortalidad de los conejos (media±EEM) Grupo P Testigo HS HLGH PC 35 días, g 778.3±9.6 782.5±6.6 773.3±7.2 0.717 b b a PC 56 días, g 1,248.3±34.2 1,272.1±22.9 1,380.8±24.7 0.004 c PC 70 días, g 1,818.3±35.9 1,883.3±10.3b 1,954.1±35.3a 0.010 PC 90 días, g 2,404.0±27.2b 2,606.5±23.1a 2,584.8±21.5a ˂0.001 IDPC 35-56, g/día 22.38±3.62b 23.31±3.80b 28.93±3.97a 0.026 IDPC 57-70, g/día 40.71±5.03 43.66±5.29 40.95±5.12 0.288 b a b IDPC 71-90, g/día 29.28±4.71 36.16±4.42 31.53±4.85 0.006 IDPC 35-90, g/día 29.6±1.4b 33.2±1.4a 32.9±1.5a <0.001 ICA, g/g 3.65±0.11 3.62±0.10 3.64±0.11 0.698 Mortalidad, % 0 0 0 1.000 EEM= error estándar de la media; PC= peso corporal; IDPC= incremento diario del peso corporal; ICA= índice de conversión alimenticia. a,b,c Los valores con diferentes superíndices son diferentes (P<0.05).

156


Rev Mex Cienc Pecu 2021;12(1):151-162

El peso de la canal caliente con cabeza difirió entre los grupos y osciló entre 1,437.7 g en el grupo HS, 1,356.0 g en el grupo HLGH y 1,270.8 g en el grupo testigo, en el que los conejos se alimentaron sin larvas de gusanos de seda o de harina (Cuadro 5). El grupo HS se caracterizó por un mayor porcentaje de aliño en comparación con los grupos T y HLGH (59.88 % frente a 57.67 % y 57.49 %). El peso de los hígados osciló entre 74.33 g en el grupo T y 79.83 g en el grupo HLGH; sin embargo, las diferencias en esta característica no fueron estadísticamente significativas. No se observaron diferencias significativas entre los grupos en los pesos del tracto digestivo. La cantidad de grasa inguinal, del hombro y perirrenal tampoco mostró diferencias. El peso muscular de la canal fue mayor en los grupos HS y HLGH en comparación con el grupo T (1,092.5 g y 1,056.7 g frente a 914.9 g). Cuadro 5: Características de la canal de los conejos (media±EEM) Grupo Testigo HS HLGH Peso de la canal en caliente 1,270.8±17.1c 1,437.7±22.6a 1,356.0±17.3b con cabeza, g Porcentaje de aliño 57.67±0.30b 59.88±0.61a 57.49±0.036b Peso del hígado, g 74.33±3.85 76.00±1.29 79.83±3.00 Peso del corazón, los riñones 42.50±2.81 43.33±1.54 44.16±2.01 y los pulmones, g Peso del tracto digestivo, g 424.16±10.11 477.16±26.88 498.33±22.38 Peso de la grasa inguinal, g 4.66±0.84 4.33±0.49 4.83±0.40 Peso de grasa del hombro, g 12.50±1.78 11.67±0.61 12.33±0.92 Peso de la grasa perirrenal, g 14.16±1.53 15.66±2.78 15.83±1.53 b a Peso muscular de la canal, g 914.9±17.1 1092.5±45.2 1056.7±14.5a a,b,c

P ˂0.001 0.002 0.165 0.853 0.064 0.841 0.212 0.188 0.001

EEM= error estándar de la media. Los valores con diferentes superíndices son significativamente diferentes con un valor de P<0.05.

El análisis de la composición química básica de los músculos del pernil y del lomo no reveló diferencias entre los grupos en cuanto a la cantidad de materia seca, cenizas y proteína cruda (Cuadro 6). El contenido de proteínas en los músculos de las patas traseras osciló entre el 21.85 %, en los conejos del grupo testigo, y el 22.10 %, en los conejos suplementados con harina de pupas de gusanos de seda. El contenido de proteínas en los músculos del lomo fue ligeramente superior y varió del 22.95 % en el grupo HLGH al 23.37 % en el grupo HS. El contenido de cenizas brutas osciló entre el 1.19 y el 1.21 % en los músculos de las patas traseras y entre el 1.22 y el 1.25 % en el lomo. La proporción de extracto etéreo en los músculos de las patas traseras no difirió significativamente entre los grupos. Sin embargo, se observó una tendencia a una mayor proporción de este compuesto en los grupos experimentales que en el grupo testigo (2.06 % en los grupos HS y 2.25 % en HLGH frente a 1.72 % en el grupo T). A su vez, en los músculos del lomo, el contenido de extracto etéreo fue significativamente mayor

157


Rev Mex Cienc Pecu 2021;12(1):151-162

en los conejos pertenecientes al grupo HLGH que en los del grupo T (1.90 frente a 1.22 %). Cuadro 6: Composición química aproximada (% de materia fresca) de los músculos de la pata trasera y del lomo de los conejos (media±EEM) Grupo P Testigo HS HLGH Músculos patas traseras Materia seca Cenizas brutas Proteína bruta Extracto etéreo Músculos del lomo

23.84±0.17 1.20±0.01 21.85±0.15 1.72±0.12

24.51±0.27 1.19±0.01 22.10±0.17 2.06±0.20

24.42±0.30 1.21±0.01 21.88±0.10 2.25±0.30

0.161 0.192 0.442 0.061

Materia seca Cenizas brutas Proteína bruta Extracto etéreo

25.28±0.26 1.23±0.02 22.98±0.20 1.22±0.06b

24.90±0.16 1.22±0.01 23.37±0.16 1.37±0.10a

24.87±0.17 1.25±0.01 22.95±0.20 1.90±0.37a

0.304 0.525 0.246 0.038

a,b

EEM= error estándar de la media. Los valores con superíndices distinto son diferentes (P<0.05).

Discusión La dieta del grupo testigo contenía un 10 % de frijol de soya, y las dietas experimentales (HS y HLGH) contenían un 5 % de harina de soya, y un 4 % de harinas de gusanos de seda o un 4 % de larvas de gusanos de harina, respectivamente. Se comprobó que la sustitución parcial de la harina de soya por los componentes experimentales mejoraba los incrementos del peso y los pesos corporales de los conejos, pero no tenía ningún efecto sobre el ICA. Estos resultados se corresponden con el contenido de extracto etéreo y el valor energético de las dietas. Sin embargo, la mayor proporción de extracto etéreo en las dietas con harinas de insectos, especialmente con larvas de gusanos de la harina, elevó la proporción de este compuesto en los músculos del conejo. Anteriormente se observaron resultados similares a los del presente estudio, en cuanto al peso corporal de los conejos NZW(20). También se informó de un IDPC similar en los conejos NZW, aunque calculada para el rango de edad de 30-80 días(21). Los conejos NZW involucrados en este experimento pertenecen a la línea genética productiva media. Aunque crecen un poco más rápido que los conejos californianos(22), los conejos híbridos criados comercialmente pueden alcanzar un peso de más de 3,000 g en el día 84 de edad(8,23). Se determinó que el contenido de proteínas era de 187.1 g/kg en la dieta del grupo testigo y de 187.7 g/kg y 187.6 g/kg en las dietas experimentales. Sin embargo, tanto las pupas del gusano de seda como las larvas del gusano de la harina contienen quitina. Es 158


Rev Mex Cienc Pecu 2021;12(1):151-162

un polisacárido compuesto por mers de acetilglucosamina (N-acetil-D-glucosa-2amina). El nitrógeno de los mers aumenta el nivel de proteínas en los análisis de laboratorio. Las pupas de los gusanos de seda contienen un 3-4% de quitina(24). El contenido de quitina en las larvas del gusano de la harina es de alrededor del 5 %(25); puede reducir la digestibilidad de los nutrientes(26), pero el presente experimento demostró que la quitina no tenía ningún efecto adverso sobre el ICA. Cabe mencionar que la quitina puede tener propiedades benéficas para la salud. La quitina no se degrada en el intestino delgado y puede ser fermentada por la microbiota del intestino grueso. Se sugiere que la quitina puede restaurar el equilibrio de la composición de la comunidad microbiana. Además, al parecer la quitina, o sus derivados, presentan actividades antivirales, antitumorales y antifúngicas, así como propiedades antimicrobianas y un efecto bacteriostático sobre las bacterias patógenas(26). El rango de PA obtenido en este estudio fue mayor que el reportado por otros autores polacos(20,27). Debe prestarse especial atención al peso del hígado, cuyo valor elevado puede sugerir que la dieta supone una carga excesiva para el organismo del animal. Se observaron ciertas diferencias entre grupos en el peso del hígado de los conejos (desde 74.33 g en el grupo T hasta 79.83 g en el grupo HLGH), pero las diferencias dentro de los grupos fueron demasiado elevadas para mostrar un efecto significativo de la dieta sobre el peso del hígado. El análisis del peso del hígado con respecto al peso de la canal muestra las proporciones de 5.85 %, 5.29 % y 5.89 % para los grupos sucesivos de conejos (datos no mostrados en el cuadro). Dado que el mayor peso del hígado en los conejos HLGH se corresponde con la cantidad de grasa de la dieta y la cantidad de grasa de la canal, en esta etapa es difícil concluir si las larvas de gusano de la harina añadidas a la dieta tienen un impacto negativo en la salud de los conejos. Sería necesario continuar realizando en el futuro investigaciones más amplias sobre este aspecto. Sin embargo, es interesante señalar que en un experimento anterior llevado a cabo en el mismo pabellón con la misma línea de conejos NZW, los conejos alimentados con un 5% de DDGS de maíz tuvieron un peso medio del hígado de 95.8 g(20). El contenido obtenido de materia seca, proteínas, cenizas y extracto etéreo en la carne es característico de los conejos de engorda. Otros autores han señalado contenidos de proteínas y cenizas en la carne de conejo similares a los observados en el presente estudio(27,28,29). La grasa intramuscular es uno de los principales determinantes de la calidad sensorial de la carne. Las cantidades de grasa obtenidas en este estudio parecen típicas de los conejos NZW, que se sacrifican a una edad aproximada de 90 días. No obstante, cabe señalar que el uso de harinas de insectos en la alimentación de los conejos elevó la cantidad de extracto etéreo en sus músculos. Daszkiewicz et al(27) observaron rangos más bajos de grasa (0.27 a 0.33 %), mientras que Chełmińska y Kowalska(20) encontraron que el contenido de grasa era del 2.31 % en el grupo testigo, del 3.72 % en el grupo que recibió un 5 % de DDGS, y hasta del 4.94 % en el grupo alimentado con un 10 % de DDGS.

159


Rev Mex Cienc Pecu 2021;12(1):151-162

Conclusiones e implicaciones La sustitución parcial de la harina de soya por las harinas de pupas de gusanos de seda y de larvas de gusanos de harina en las dietas para conejos puede mejorar el peso corporal y los incrementos del peso corporal de los conejos, así como algunas características de la canal, sin influir en el índice de conversión alimenticia. El uso de insectos como fuente de alimentación para los conejos no tiene efecto sobre el contenido de materia seca, proteína bruta y cenizas brutas, pero aumenta la cantidad de extracto etéreo en sus músculos. Literatura citada: 1.

Diener S, Zurbrügg C, Roa Gutiérrez F, Nguyen DH, Morel A, Koottatep T, Tockner K. Black soldier fly larvae for organic waste treatment – prospects and constraints. Proc 2nd International Conference on Solid Waste Management in the Developing Countries, Khulna, Bangladesh. 2011:52-59.

2.

Calvert CC, Martin RD, Morgan NO. Housefly pupae as food for poultry. J Econ Entomol 1969;62(4):938-939.

3.

Klasing KC, Thacker P, Lopez MA, Calvert CC. Increasing the calcium content of mealworms (Tenebrio molitor) to improve their nutritional value for bone mineralization of growing chicks. J Zoo Wild Medic 2000;31(4):512-517.

4.

Bovera F, Loponte R, Marono S, Piccolo G, Parisi G, Iaconisi V, Gasco L, Nizza A. Use of larvae meal as protein source in broiler diet: Effect on growth performance, nutrient digestibility, and carcass and meat traits. J Anim Sci 2016;94(2):639-647.

5.

Donatti FC. Utilization of silkworm pupae meal (Bombyx mori L.) as a source of protein in the diet of growing-finishing pigs. R Soc Bras Zootec 1992;21(3):378383.

6.

Kierończyk B, Rawski M, Józefiak A, Mazurkiewicz J, Świątkiewicz S, Siwek M, et al. Effects of replacing soybean oil with selected insect fats on broilers. Anim Feed Sci Technol 2018;240:170-183.

7.

Matusevicius P, Zduńczyk Z, Juśkiewicz J, Jeroch H. Rapeseed meal as a partial replacement for sunflower meal in diets for growing rabbits – gastrointestinal tract response and growth performance. Europ Poult Sci 2014;78:1-11.

8.

Gugołek A, Juśkiewicz J, Wyczling P, Kowalska D, Strychalski J, Konstantynowicz M, Zwoliński C. Productivity results and physiological response of the gastrointestinal tract of rabbits fed diets containing rapeseed cake and wheat distillers dried grains with solubles. Anim Prod Sci 2015;55:777-785.

160


Rev Mex Cienc Pecu 2021;12(1):151-162

9.

Volek Z, Volková L, Marounek M. Effect of a diet containing white lupin hulls (Lupinus albus cv. Amiga) on total tract apparent digestibility of nutrients and growth performance of rabbits. World Rabbit Sci 2013;21:17-21.

10. Strychalski J, Juśkiewicz J, Gugołek A, Wyczling P, Daszkiewicz T, Zwoliński C. Usability of rapeseed cake and wheat-dried distillers’ grains with solubles in the feeding of growing Californian rabbits. Archiv Anim Nutr 2014;68:227-244. 11. Zwoliński C, Gugołek A, Strychalski J, Kowalska D, Chwastowska-Siwiecka I, Konstantynowicz M. The effect of substitution of soybean meal with a mixture of rapeseed meal, white lupin grain, and pea grain on performance indicators, nutrient digestibility, and nitrogen retention in Popielno White rabbits. J Appl Anim Res 2017;45:570-576. 12. Carregal RD, Takahashi R. Use of silkworm (Bombyx mori L.) chrysalis meal as a replacement for soyabean meal in the feeding of growing rabbits. R Soc Bras Zootec 1987;16(2):158-162. 13. Gasco L, Dabbou S, Meneguz M, Trocino A, Xiccato G, Capucchio MT, et al. Effect of dietary supplementation with insect fats on growth performance, digestive efficiency and health of rabbits. J Anim Sci Biotech 2019;10:4. 14. Dalle Zotte A, Cullere M, Martins C, Alves SP, Freire JPB, Falcão-e-Cunha L, Bessa RJB. Incorporation of Black Soldier Fly (Hermetia illucens L.) larvae fat or extruded linseed in diets of growing rabbits and their effects on meat quality traits including detailed fatty acid composition. Meat Sci 2018;146:50-58. 15. Martins C, Cullere M, Dalle Zotte A, Cardoso C, Alves SP, Branquinho de Bessa RJ, Bengala FJP, Falcão-e-Cunha L. Incorporation of two levels of black soldier fly (Hermetia illucens L.) larvae fat or extruded linseed in diets of growing rabbits: effects on growth performance and diet digestibility. Czech J Anim Sci 2018;63:356-362. 16. Liu ML, Tang LM, Yan JP, Liu YG. Effects of concentrated rapeseed protein on growing rabbits. J Sichuan Agric Univ 1987;2:20-22. 17. AOAC. Association of Official Analytical Chemists. Official methods of analysis. 18th ed. Arlington (VA): Association of Analytical Communities. 2006. 18. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74:3583-3597. 19. StatSoft®. Statistica (data analysis software system), version 10. 2011. Available in: www.statsoft.com. 20. Chełmińska A, Kowalska D. The effectiveness of maize DDGS in rabbit diets. Ann Anim Sci 2013;13:571-585. 161


Rev Mex Cienc Pecu 2021;12(1):151-162

21. Cardinali R, Cullere M, Dal Bosco A, Mugnai C, Ruggeri S, Mattioli S, Castellini C, Trabalza Marinucci M, Dalle Zotte A. Oregano, rosemary and vitamin E dietary supplementation in growing rabbits: Effect on growth performance, carcass traits, bone development and meat chemical composition. Livest Sci 2015;175:83-89. 22. Strychalski J, Gugołek A, Daszkiewicz T, Konstantynowicz M, Kędzior I, Zwoliński C. A comparison of selected performance indicators, nutrient digestibility and nitrogen balance parameters in Californian and Flemish Giant rabbits. J Appl Anim Res 2014b;42:389-394. 23. Dänicke S, Ahrens P, Strobel E, Brettschneider J, Wicke M, von Lengerken G. Effects of feeding rapeseed to fattening rabbits on performance, thyroid hormone status, fatty acid composition of meat and other meat quality traits. Arch Geflügelkd 2004;68:15-24. 24. Suresh HN, Mahalingam CA, Pallavi. Amount of chitin, chitosan and chitosan based on chitin weight in pure races of multivoltine and bivoltine silkworm pupae Bombyx mori L. Int J Sci Nat 2012;3(1):214-216. 25. Song Z, Li G, Guan F, Liu W. Application of chitin/chitosan and their derivatives in the papermaking industry. Polymers 2018;10(4):389. 26. Piccolo G, Iaconisi V, Marono S, Gasco L, Loponte R, Nizza S, Bovera F, Parisi G. Effect of Tenebrio molitor larvae meal on growth performance, in vivo nutrients digestibility, somatic and marketable indexes of gilthead sea bream (Sparus aurata). Anim Feed Sci Technol 2017;226:12-20. 27. Daszkiewicz T, Gugołek A, Janiszewski P, Kubiak D, Czoik M. The effect of intensive and extensive production systems on carcass quality in New Zealand White rabbits. World Rabbit Sci 2012;20(1):25-32. 28. Dal Bosco A, Castellini C, Mugnai C. Rearing rabbits on a wire net floor or straw litter: behaviour, growth and meat qualitative traits. Livest Prod Sci 2002;75:149156. 29. Maj D, Bieniek J, Łapa P. Meat quality of New Zealand White and Californian rabbits and their crosses. Med Wet 2008;64:351-353.

162


https://doi.org/10.22319/rmcp.v12i1.5273 Artículo

Evaluación de indicadores productivos en rebaños caprinos vacunados con cepas RB51–SOD, RB51 (Brucella abortus) y Rev-1 (Brucella melitensis)

Baldomero Molina-Sánchez a David Izcoatl Martínez-Herrera a* Violeta Trinidad Pardío-Sedas a Ricardo Flores-Castro b José A. Villagómez-Cortés a José F. Morales-Álvarez c

a

Universidad Veracruzana. Facultad de Medicina Veterinaria y Zootecnia. Av. Miguel Ángel de Quevedo s/n, esq. Yáñez, Col. Unidad Veracruzana, 91710, Veracruz, Veracruz, México. b

Laboratorios Tornel, S.A. de C.V., Naucalpan de Juárez, Estado de México, México.

c

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad (CENID-SAI), Ciudad de México, México.

*Autor de correspondencia: dmartinez@uv.mx

Resumen: Se determinaron tasas de pariciones, abortos y nacimiento de crías débiles en rebaños vacunados con la cepa RB51–SOD (B. abortus) para evaluar la mejora productiva y compararla con las vacunas Rev–1 (B. melitensis) y RB51 (B. abortus). Se vacunaron tres subgrupos de 36 cabras cada uno con cepas Rev–1 (1–2x109 UFC), RB51 (3x108-3x109 UFC) y RB51–SOD (3x108-3x109 UFC), cada cepa tuvo un subgrupo control. Se establecieron registros individuales para calcular las tasas posvacunación en dos épocas de pariciones. En 163


Rev Mex Cienc Pecu 2021;12(1):163-176

la primera, la tasa de partos para Rev-1 fue 66.6 % (IC95%: 48.9–80.9), RB51 50.0 % (IC95% :33.2–66.7) y RB51-SOD 69.4 % (IC95% :51.7–83.0). Los abortos se presentaron en los tres subgrupos vacunados, Rev-1 y RB51-SOD 5.5 % (IC95% :0.9–20.0) y RB51 2.7 % (IC95%: 0.1–16.2). Los nacimientos de crías débiles se presentaron solo en animales vacunados con Rev-1 5.5 % (IC95%: 0.9–20.0). Durante la segunda época, la tasa de partos en hembras vacunadas con Rev-1 fue de 91.6 % (IC95% :76.4–97.8), RB51 94.4 % (IC95% :79.9–99.0) y RB51-SOD 94.4 % (IC95% :79.9–99.0). Tuvieron abortos animales vacunados con cepas Rev-1 y RB51, 5.5 % (IC95%: 0.9–20.0) y 2.7 % (IC95%: 0.1–16.2), respectivamente; en subgrupos vacunados no hubo nacimiento de crías débiles. Los subgrupos controles tuvieron un comportamiento similar a los vacunados. Los animales vacunados con la cepa RB51–SOD no mostraron diferencia significativa con los que recibieron las cepas Rev-1 y RB51, ni con los subgrupos control (P>0.01); por lo anterior, la vacuna RB51-SOD puede generar protección contra la brucelosis y beneficios en la producción de rebaños caprinos. Palabras clave: Vacunación, Abortos, Brucelosis, Cabras, RB51- SOD.

Recibido: 21/02/2019 Aceptado: 13/12/2019

Introducción La brucelosis es una enfermedad emergente y de distribución mundial que se considera entre las 10 zoonosis olvidadas por las autoridades sanitarias(1,2). Desde el punto de vista económico, reviste importancia por las afectaciones que provoca en las unidades de producción animal, así como por el riesgo para la población humana(3). Los productores de cabras manifiestan que la actividad presenta rezagos tecnológicos y sanitarios, y destacan la persistencia de la brucelosis caprina, misma que merma la productividad, reduce la calidad de la leche y representa un riesgo de infección al hombre(4). La enfermedad es causada por bacterias del género Brucella; las especies más virulentas son Brucella melitensis y Brucella abortus, responsables de la enfermedad en pequeños rumiantes y ganado vacuno, respectivamente(5). La manifestación clínica de la infección en los animales gestantes incluye: aborto, nacimiento de crías que mueren en el periparto y artritis(6,7). En los rebaños caprinos afectados, se aprecia una baja eficiencia productiva por la infertilidad que provoca en animales infectados; los abortos se incrementan hasta un 20 % y disminuye la capacidad productiva en hembras enfermas hasta en 30 %(8,9).

164


Rev Mex Cienc Pecu 2021;12(1):163-176

La baja tasa de parición es el resultado de abortos que ocurren debido a las condiciones sanitarias, entre ellas la prevalencia persistente de la brucelosis y la severa restricción nutricional durante la gestación(10-13) En los rebaños infectados por brucelosis, la vacunación, el diagnóstico y el sacrificio selectivo de animales, son alternativas para el control o erradicación de la enfermedad(2). En la actualidad la cepa Rev–1 de Brucella melitensis, es una cepa viva modificada que se utiliza para controlar la infección en ovinos y caprinos; no obstante, tiene limitantes como la capacidad para inducir aborto en hembras gestantes, excretarse en leche, infectar a los humanos y su posible resistencia a la estreptomicina, un antibiótico que, en combinación con la doxiciclina, constituye el tratamiento más efectivo para la brucelosis en humanos(12,14,15). La cepa RB51 de Bruella abortus se utiliza para el control de la brucelosis en bovinos y ha sido evaluada en pequeños rumiantes en condiciones controladas con buena protección contra el desafío experimental con B. melitensis(14). Existe información que sostiene que la protección conferida es menor que la obtenida con la cepa Rev–1 y que causa abortos y mortinatos en caprinos(14); sin embargo, tiene la ventaja de no producir interferencia diagnóstica posvacunal frente a la serología convencional(16,17,18). Las vacunas de plásmidos de ADN tienen potencial para ser el futuro para el control de la brucelosis, se han evaluado cepas de sobreexpresión homóloga para inducir una respuesta inmunitaria. Se ha demostrado que la sobreexpresión de Cu/Zn SOD (superóxido dismutasa), que es una proteína periplásmica que ha desarrollado protección en modelos murinos, frente a la infección experimental con B. abortus cepa virulenta 2308 consigue una protección igual a la inducida por RB51 (B. abortus)(16,19). Oñate at al(19) evaluaron la cepa SOD en bovinos y obtuvieron respuesta de anticuerpos y CMI de tipo Th-1, y protección al desafío de B. abortus. Se requieren otros estudios para conocer el papel de diferentes tipos de células T en la protección inducida por vacunación con pcDNA-SOD y sus resultados en sistemas productivos(19-22). La respuesta inmunológica y la eficacia de las vacunas pueden diferir entre los animales de laboratorio y los rumiantes susceptibles(22). Debido a que se carece de información sobre el uso de la cepa RB51 – SOD en animales domésticos, sus efectos y beneficios, así como su seguridad para evitar la inducción de aborto por efecto vacunal y la protección para la mejora productiva en rebaños caprinos, el objetivo de este estudio fue determinar las tasas de pariciones, abortos y nacimiento de crías débiles en rebaños vacunados con la cepa RB51–SOD (Brucella abortus) para evaluar la mejora productiva y compararla con la obtenida al utilizar las vacunas Rev–1 (Brucella melitensis) y RB51 (Brucella abortus).

165


Rev Mex Cienc Pecu 2021;12(1):163-176

Material y métodos Localización del estudio El estudio se realizó en unidades de producción caprina de la comunidad de Xaltepec del municipio de Perote, ubicadas en la zona centro del estado de Veracruz, México. La comunidad se encuentra ubicada a 97°21’22.21’’ O y 19°22’50.06’’ N, a una altitud 2,358 msnm y colinda con el estado de Puebla; el clima es frío – seco, con temperatura media anual de 12 ºC y precipitación media anual de 493.6 mm(23). La principal actividad pecuaria es la producción de caprinos y ovinos, bajo un sistema semiestabulado donde los propietarios y los familiares atienden a los animales. Los rebaños están integrados en promedio por 64 caprinos; los cuales en su mayoría pastorean terrenos comunales. En la temporada de mayor producción de forraje, algunos productores los confinan para utilizar los esquilmos agrícolas que se producen en la zona. Su principal producción es la leche para la elaboración de queso, y la carne a través de la venta de cabritos al destete y hembras de desecho(24).

Tipo de estudio y tamaño de muestra El estudio fue un ensayo clínico de fase III, realizado de septiembre de 2016 a marzo de 2018 para evaluar las tasas de parición, abortos y crías débiles en rebaños caprinos que resultaron positivos a brucelosis y que fueron vacunados con las cepas RB51–SOD, RB51 de Brucella abortus y Rev–1 de Brucella melitensis. Se estimó el tamaño de muestra a través del programa Win Episcope Ver. 2.0, con una prevalencia de 0.52 % en cabras encontrada en un estudio previo en esa zona de Veracruz(24), un intervalo de confianza de 95% y un error del 5%. El tamaño mínimo de muestra fue de 72 cabras para cada grupo por tratamiento (cepa); cada bloque estuvo integrado por un subgrupo vacunado (36) y un subgrupo testigo (36). Cada grupo estudiado se integró con cabras mayores de tres meses, seronegativas a brucelosis y nunca vacunadas. Los animales seropositivos a brucelosis e identificados durante un muestreo inicial realizado previo a la vacunación para determinar los animales seropositivos, se mantuvieron en los rebaños para someterse a una exposición permanente en conjunto con los animales susceptibles. Los animales de cada grupo se identificaron con arete metálico en la oreja izquierda. Para la realización de este trabajo se contó con la revisión del protocolo de investigación y la aprobación del mismo por la Comisión de Bioética de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Veracruzana.

166


Rev Mex Cienc Pecu 2021;12(1):163-176

Vacunación

A los animales de los subgrupos vacunados de cada grupo, se les aplicaron 2 ml de la vacuna por vía subcutánea en el lado izquierdo del tercio medio del cuello. Al primer grupo se le aplicó la cepa Rev–1 de Brucella melitensis a dosis de 1 – 2x109 UFC; el segundo con cepa RB51 de Brucella abortus, recibió 3x108 a 3x109 UFC y el tercero con RB51–SOD de Brucella abortus a dosis de 3x108 a 3x109 UFC; esta última es una vacuna importada por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad (CENID-SAI) del Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP) para investigación y proporcionada por el Dr. Gerhardt Shuring del Instituto Tecnológico de Virginia. Cada subgrupo vacunado tuvo su subgrupo testigo, animales que recibieron 2 ml de solución salina fisiológica por la vía subcutánea en el lado izquierdo del tercio medio del cuello como placebo.

Seguimiento de registros individuales Se establecieron registros individuales para cada uno de los animales integrantes de la muestra, de acuerdo con lo recomendado por el INIFAP para el manejo reproductivo de los caprinos en agostadero(25), con la finalidad de tener las fechas de los nacimientos, abortos y problemas presentados durante la gestación. Se realizó el cálculo de las tasas de gestación, pariciones y abortos para conocer la situación inicial de los rebaños, considerada como información de línea base para el estudio; asimismo, se dio seguimiento diario a los animales de la muestra por dos periodos de pariciones, para conocer el comportamiento posvacunación, así como indicadores como partos, abortos y nacimiento de crías débiles; las fechas correspondieron a la estacionalidad de pariciones que se tienen definidas en los rebaños (octubre – febrero).

Cálculo de tasas de partos, abortos y pariciones de crías débiles Las tasas de partos, abortos y nacimiento de crías débiles en los tres grupos se integraron al utilizar la información incorporada en los registros individuales. Las diferencias entre grupos y la significancia de asociación, se realizó por análisis de datos categóricos (Ji2) y el grado de asociación por Riesgo Relativo (RR)(26).

Resultados El Cuadro 1 muestra los indicadores productivos identificados en los rebaños caprinos en la comunidad de Xaltepec, del municipio de Perote, previo a la vacunación de los animales con las cepas del experimento, integrados por un total de 529 cabezas de caprinos. Las tasas 167


Rev Mex Cienc Pecu 2021;12(1):163-176

promedio de gestación, pariciones y abortos fueron de 69.2, 95.2 y 2.7 %, respectivamente; esta información se consideró como línea base para los rebaños en estudio. Los rebaños utilizados presentaron una prevalencia general de brucelosis confirmada con la prueba de inmunodifusión radial (SRD) de 1.2 % (IC95%: 0.5– 2.7)(27). Cuadro 1: Indicadores de inventario y reproductivos en rebaños de la comunidad de Xaltepec, Perote, Veracruz, México, previos a la vacunación Tasa Inventario Cepa (animales) Gestación Pariciones Abortos Rev – 1 134 67.5 96.5 2.0 RB51 192 69.0 95.6 3.0 RB51– SOD 203 71.3 93.6 3.3 Total 529 Promedio 69.2 95.2 2.7

Posterior a la vacunación, se evaluaron los indicadores de producción en los rebaños durante dos épocas de parición. En el Cuadro 2 se muestran las tasas de pariciones, abortos y nacimiento de crías débiles en el primer período de pariciones y se puede observar que los subgrupos vacunados tuvieron un comportamiento similar en relación a las tasas de partos y abortos; sin embargo, en los animales vacunados con la cepa Rev–1 se presentó una tasa de 5.5 % (IC95%: 0.9 – 20.0) de crías débiles, pero en los subgrupos vacunados con las cepas RB51 y con la RB51–SOD no se presentó esta condición. Los subgrupos controles mostraron un comportamiento similar a los subgrupos vacunados. En el Cuadro 3 se muestra el Riesgo Relativo (RR) y la Ji2 de las pariciones, abortos y crías nacidas débiles del primer periodo de pariciones posvacunación y se aprecia que no hubo diferencia significativa (P>0.01) entre los subgrupos vacunados y los subgrupos controles. Cuadro 2: Indicadores de producción durante primer período de partos en rebaños caprinos vacunados con diferentes cepas en la comunidad de Xaltepec, Perote, Veracruz, México Pariciones Cepa Rev 1 RB51 RB51 – SOD

Grupo Vacunado Control Vacunado Control Vacunado Control

Abortos

Crías débiles No %

(IC95%)

2 0 0 0 0 0

0.9 – 20.0 0.0 0.0 0.0 0.0 0.0

N 36 36 36 36 36 36

No %

(IC95%)

N

% (IC95%)

24 22 18 21 25 24

48.9 – 80.9 43.5 – 76.3 33.2 – 66.7 40.8 – 74.0 51.7 – 83.0 48.9 – 80.9

2 1 1 1 2 1

5.5 2.7 2.7 2.7 5.5 2.7

66.6 61.1 50.0 58.3 69.4 66.6

168

0.9 – 20.0 0.1 – 16.2 0.1 – 16.2 0.1 – 16.2 0.9 – 20.0 0.1 – 16.2

5.5 0.0 0.0 0.0 0.0 0.0


Rev Mex Cienc Pecu 2021;12(1):163-176

Cuadro 3: Valores de Riesgo Relativo y Ji2 de pariciones, abortos y crías nacidas débiles del primer período de pariciones posvacunación Cepa Rev 1 RB51 RB51– SOD

Pariciones

Abortos RR

(IC95%)

Ji2

RR

(IC95%)

0.1 – 1.3 2.68 0.1 – 2.0 1.42

2.0 1.0

0.2 – 21.1 0.4 0.1 – 15.4 0.0

0.9 0.0

0.1 – 2.9 0.4 0.0 0.0

0.1 – 2.6 0.73

2.0

0.2 – 21.1 0.4

0.0

0.0

RR

(IC95%)

0.4 0.4 0.5

Ji2

Crías débiles Ji2

0.0

(P<0.01).

En el segundo período de pariciones, se evaluó el comportamiento de los indicadores productivos de las hembras vacunadas y de los subgrupos control, los que se muestran en el Cuadro 4, donde se observa que los subgrupos vacunales en relación a la tasa de pariciones mejoraron el indicador en comparación con el primer periodo de pariciones. Los abortos sólo se presentaron en los animales vacunados con la cepa Rev–1 y en su grupo control, 2.7 % (IC95%: 0.1–16.2) y 5.5 % (IC95%: 0.9–20.0), respectivamente. Los animales vacunados con las cepas RB51 y RB51–SOD, no presentaron abortos; sin embargo, el grupo control de la cepa RB51 tuvo una tasa de 2.7 % (IC95%: 0.1–16.2). En los tres subgrupos vacunados, así como en los controles, no se presentaron casos de nacimiento de crías débiles. En el Cuadro 5, el análisis estadístico de estos resultados revela que no existe diferencia significativa entre los subgrupos vacunados y los controles (P>0.01).

Cuadro 4: Indicadores de producción durante segundo período de partos en rebaños caprinos vacunados con diferentes cepas Pariciones Cepa Rev 1 RB51 RB51 – SOD

Grupo Vacunado Control Vacunado Control Vacunado Control

Abortos

Crías débiles

N 36 36 36 36 36 36

N

%

(IC95%)

N

%

(IC95%)

N

%

(IC95%)

33 28 34 31 34 32

91.6 77.7 94.4 86.1 94.4 88.8

76.4 – 97.8 60.4 – 89.2 79.9 – 99.0 69.7 – 94.7 79.9 – 99.0 73.0 – 96.3

1 2 0 1 0 0

2.7 5.5 0.0 2.7 0.0 0.0

0.1 – 16.2 0.9 – 20.0 0.0 0.1 – 16.2 0.0 0.0

0 0 0 0 0 0

0.0 0.0 0.0 0.0 0.0 0.0

0.0 0.0 0.0 0.0 0.0 0.0

169


Rev Mex Cienc Pecu 2021;12(1):163-176

Cuadro 5: Valores de Riesgo Relativo (RR) y Ji2 de pariciones, abortos y crías nacidas débiles del segundo período de pariciones posvacunación Cepa Rev 1 RB51 RB51– SOD

Pariciones

Abortos

Crías débiles

RR

(IC95%)

Ji2

RR

(IC95%)

Ji2

RR

(IC95%)

Ji2

0.3 0.4

0.1 – 1.3 2.7 0.1 – 1.9 1.4

0.5 0.0

0.1 – 5.3 0.0

0.4 0.0

0.0 0.0

0.0 0.0

0.0 0.0

0.5

0.1 – 2.6 0.7

0.0

0.0

0.4

0.0

0.0

0.0

(P>0.01).

Discusión En los rebaños del experimento, los animales seropositivos a la prueba serológica confirmatoria de inmunodifusión radial (SDR) para diagnóstico de brucelosis, permanecieron durante todo el período del estudio en sus rebaños de origen, para permitir el desafío directo natural de los animales vacunados y controles en los rebaños que contaron con una seroprevalencia general de 1.2 % (IC95%: 0.5 – 2.7)(27), valor mayor al promedio general encontrado de 0.52 % (IC95%: 0.1 – 1.6) en 14 municipios de la zona centro del estado de Veracruz y al 0.05 % que reporta el SENASICA a nivel nacional en rebaños caprinos(24). La exposición de las hembras vacunadas dentro de los rebaños infectados permite desafiar la protección conferida en condiciones naturales; en este estudio, el desafío de los animales experimentales a la cepa de campo se evaluó a través de la seroprevalencia confirmada con la prueba SRD(27). Para el desafío de rebaños experimentales en condiciones de campo es necesario considerar la seroprevalencia de la enfermedad detectada mediante pruebas más específicas (confirmatorias), porque de lo contrario no se garantiza el desafío de los rebaños vacunados con los animales seropositivos, ya que al usar solo una prueba tamiz, existe la posibilidad de tener animales falsos positivos considerados como infectados, y entonces la seropositividad puede deberse a la ventana que implica la seroconversión por el hecho mismo de la vacunación con cepas que tienen esta característica en esos animales o incluso por reacciones cruzadas con otros microorganismos y no permitir una correcta discriminación entre animales infectados y sólo reactores(16,17). En el Cuadro 1 se muestran las tasas de pariciones y abortos que en promedio son de 96.6 % y 1.8 %, respectivamente; un comportamiento similar a lo señalado por otros investigadores en la caprinocultura de Oaxaca y Nuevo León, estados ubicados en las dos regiones que concentran 70.2 % del inventario caprino nacional(4,28); sin embargo, los rebaños caracterizados bajo condiciones de agostadero en el país registran una tasa de gestación menor a 65 %, lo que ocurre como producto de abortos, pobres condiciones sanitarias y severa restricción nutricional durante la gestación(11). Al comparar los resultados de los

170


Rev Mex Cienc Pecu 2021;12(1):163-176

subgrupos vacunados y controles con los indicadores observados en el presente estudio en la caprinocultura de Xaltepec, muestran que no es suficiente establecer programas de vacunación para prevenir o controlar enfermedades como la brucelosis, si no se incluye una alimentación adecuada de acuerdo con las características raciales de los animales que integran el rebaño y al sistema de producción, con la finalidad de mejorar la productividad de los mismos, además de que la mejora en los indicadores de pariciones, abortos o nacimiento de crías sanas en el primer periodo de pariciones posvacunación no es atribuible solo a la vacunación(11,13). Durante el primer período de partos posvacunación, la tasa de pariciones en todos los grupos que formaron parte del ensayo clínico, tanto vacunados como controles fue menor en comparación con los indicadores iniciales, debido a que no todas las hembras del experimento ingresaron al empadre; lo anterior pudo deberse a la edad, pobre condición corporal y a su estado nutricional; situación que coincide con los efectos que tiene la desnutrición durante el desarrollo y la vida postnatal temprana, ya que provocan efectos permanentes e irreversibles durante la pubertad, así como en la vida adulta de los pequeños rumiantes(13). Los abortos se presentaron tanto en los subgrupos de animales vacunados con las cepas Rev–1 (B. melitensis), como con la RB51–SOD (B. abortus); en los subgrupos controles también se presentaron abortos con una tasa del 2.7 % (IC95%: 0.1 – 16.2); al compararse los grupos vacunados y controles, no se encontró diferencia significativa (P<0.01). Las tasas de nacimiento de crías débiles solo se presentaron en dos hembras que fueron vacunadas con la cepa Rev–1; es una condición que se puede presentar en las crías de animales infectados por brucelosis, situación que coincide con los resultados de serología realizada mediante la prueba de SDR donde dos hembras tuvieron serología positiva(6,27). Las pérdidas fetales y abortos en los rebaños caprinos constituyen el principal problema reproductivo, que no solo se presenta por agentes infecciosos, sino también por el estrés nutricional de las cabras(11). Aunado a ello, la desnutrición afecta a los animales expuestos a las cepas vacunales o de campo, al provocar que el animal no produzca anticuerpos mesurables por las pruebas serológicas convencionales o no establezca una protección contra el agente causal(29-33). Durante el segundo período de partos después de la vacunación, las tasas de pariciones observadas en los tres grupos mostraron un comportamiento similar; sin embargo los abortos se presentaron en los subgrupos vacunal y control de la capa Rev–1, 5.5 % (IC95%: 0.9 – 20.0) y en el subgrupo control de la RB51, 2.7 % (IC95%: 0.1 – 16.2); ningún subgrupo vacunado tuvo nacimiento de crías débiles; al realizar el análisis estadístico se observó que no hubo diferencia significativa (P<0.01); cabe señalar que la condición de vacunación no está asociada con la presencia del aborto . Villa et al(17) realizaron la evaluación de vacunas para el control de la brucelosis y encontraron que la cepa RB51 (B. abortus) tuvo una tasa de 171


Rev Mex Cienc Pecu 2021;12(1):163-176

abortos de 74.2 %, el cual se considera alto, además de presentar el mayor riesgo relativo de presentar abortos en comparación con resultados de otros estudios en los que se vacunaron con esa cepa cabras y borregas gestantes y se encontraron tasas de abortos menores a 10 %(29,31,33); por ello no se recomienda utilizarla en cabras. Sin embargo, esta información difiere de lo encontrado en este estudio en la comunidad de Xaltepec ya que, de acuerdo con otros estudios, se encontró que su aplicación en pequeños rumiantes puede ocasionar hasta el 1 % de abortos en las hembras susceptibles por efecto vacunal(31). De este modo, es recomendable vacunar hembras mayores de tres meses y no gestantes, condición que es necesario cumplir para evitar el riesgo de abortos por efecto vacunal, situación que algunos países han establecido como norma para evitar pérdidas económicas(18). La cepa vacunal RB51 (B. abortus), está autorizada para su uso en México solo para la especie bovina; sin embargo, la autoridad sanitaria en el año 2005 registró una vacuna con estas características para uso en cabras(34) y que coincide con este estudio, en el sentido de que la cepa es segura porque no produjo abortos en las hembras del subgrupo correspondiente en la comunidad de Xaltepec. Existe información que señala que se puede presentar hasta un 2 % de abortos en las hembras susceptibles por efecto vacunal(14,31); sin embargo, es importante considerar que existen factores propios de cada individuo susceptible como son edad, sexo, estado reproductivo, condición inmunitaria y nutricional, así como del agente, que alteran el desarrollo de la protección que genera la vacuna y en general, la protección que confieren las vacunas contra brucelosis la cual oscila entre 85 y 90 %(30,32,35). El nacimiento de crías débiles que mueren en el peri-parto es una condición que se puede presentar en las crías de animales infectados por brucelosis, situación que coincide con los resultados de serología realizada mediante la prueba de SDR donde dos hembras tuvieron serología positiva(6,27). Las cepas Rev–1 (B. melitensis) y RB51 (B. abortus) son cepas que han sido evaluadas en su protección, así como en sus efectos colaterales en los animales vacunados. En la actualidad se han desarrollado vacunas de plásmidos de ADN las que representan una alternativa de vacuna de sobreexpresión homóloga como la cepa RB51–SOD (CU/Zn) utilizada en este estudio, la que en modelos murinos presenta una protección mejor contra B. abortus que la establecida por la RB51(19) y se considera dentro de las vacunas de ADN que demuestran capacidad de producir inmunidad celular, humoral y cierto grado de inmunidad protectora(16,31,33). En bovinos se sugiere la producción de anticuerpos y CMI de tipo Th-1, y genera protección en los animales vacunados al desafío con B. abortus(19). Al evaluar el comportamiento de la cepa RB51 – SOD en campo en rebaños caprinos con seroprevalencias del 1.2 % (IC95%: 0.5 – 2.7), los animales vacunados con esta cepa no presentaron aborto, ni nacimientos de crías débiles. Es importante señalar que de acuerdo con resultados publicados, los animales vacunados con esta cepa no seroconvierten a las pruebas convencionales a los 90 días posvacunación, por lo cual tampoco genera confusión diagnóstica(27).

172


Rev Mex Cienc Pecu 2021;12(1):163-176

Respecto al efecto que tiene sobre el incremento del nacimiento de crías, no hubo diferencia significativa (P<0.01) entre las cabras vacunadas con las cepas Rev–1 (B. melitensis) y RB51 (B. abortus). Olsen et al(24)l, al evaluar la cepa RB51–SOD en bisontes y compararla con la cepa RB51, no encontraron diferencias en el comportamiento de ambas cepas, y sugieren que los datos obtenidos para la cepa RB51 – SOD es segura para esa especie, ya que no se observa la presencia del agente vacunal en tejidos; sin embargo, los resultados de la eficacia vacunal recomiendan que la cepa RB51 sería preferible a la RB51–SOD para la vacunación de crías de bisonte(24); no obstante, es necesario evaluar su condición del desarrollo de la inmunidad de tipo celular y humoral en las cabras; así como su eficacia y seguridad en animales jóvenes y adultos.

Conclusiones e implicaciones Al evaluar las tasas de pariciones, abortos y nacimiento de crías débiles en rebaños vacunados con la cepa RB51 – SOD (B. abortus) no se tuvo diferencia significativa entre los animales inoculados con la Rev-1 (B. melitensis) y la RB51 (B. abortus), cepas disponibles para uso en las Campañas Zoosanitarias oficiales, así como con los subgrupos control; lo que sugiere que la cepa RB51 – SOD puede generar beneficios similares en la protección contra la enfermedad en el rebaño para mantener el inventario sano y evitar los efectos negativos sobre la vida productiva, la salud de las hembras, así como garantizar la sanidad del rebaño; sin embargo, es necesario considerar actividades complementarias de manejo y alimentación del rebaño para mejorar condiciones productivas de los animales susceptibles. Agradecimientos y conflictos de intereses: Al Programa de Doctorado en Ciencias Agropecuarias de la Universidad Veracruzana y al CONACYT por la oportunidad recibida para desarrollar los estudios de Doctorado en Ciencias del primer autor; así también al CENID-SAI del Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias por la importación de la vacuna RB51– SOD y al Dr. Gerhardt Shuring del Instituto Tecnológico de Virginia por donarla para el estudio. A los productores de la comunidad de Xaltepec, municipio de Perote, Veracruz – México, por las facilidades otorgadas para realizar el presente experimento en sus unidades de producción caprina. Literatura citada: 1. Dean AS, Crump L, Greter H, Schelling E, Zinsstag J. Global burden of human brucellosis: a systematic review of disease frequency. PLoS Negl Trop Dis 2012;6(10):1865. http://dx.doi.org/10.1371/journal.pntd.0001865.

173


Rev Mex Cienc Pecu 2021;12(1):163-176

2. Moreno E. Retrospective and prospective perspectives on zoonotic brucellosis. Front Microbiol 2014;(5):213. 3. Godfroid J, Scholz HC, Barbier T, Nicolas C, Wattiau P, Fretin D, Saegerman C. Brucellosis at the animal ecosystem human interface at the beginning of the 21st century. Prev Vet Med 2011;102(2):118-131. 4. SAGARPA – Comité Nacional Sistema Producto Caprinos (CNSPC). Plan Anual de Fortalecimiento. México, D.F. http://www.cnsp.caprinos.org.mx. 2015. 5. Ducrotoy MJ, Conde-Álvarez R, Blasco JM, Moriyón I. A review of the basis of the immunological diagnosis of ruminant brucellosis. Vet Immunol Immunopathol 2016;171:81-102. 6. Blasco JM. Control and eradication strategies for Brucella melitensis infection in sheep and goats. Prilozi 2010;31(1):145-165. 7. Guzmán-Hernández RL, Contreras-Rodríguez A, Ávila-Calderón ED, Morales-García MR. Brucelosis: zoonosis de importancia en México. Rev Chilena Infect 2016;33(6):656-662. 8. Montiel DO, Bruce M, Frankena K, Udo H, Van DZA, Rushton J. Financial analysis of brucellosis control for small-scale goat farming in the Bajío region, Mexico. Prev Vet Med 2015;118(4):247-259. 9. Robles C. Sanitary aspects in small ruminants in extensive systems in South America. Rev Arg Prod Anim 2017;37(1):5-8. 10. Cantú CA, Álvarez OG, Zapata CCC. Situación epidemiológica de las principales enfermedades en cabras. Avances en la producción de pequeños rumiantes en el noreste de México. Ediciones UAT. 2015:55-56. 11. Mellado M, Olivares L, López R, Mellado J. Influence of lactation, liveweight and lipid reserves at mating on reproductive performance of grazing goats. J Anim Vet Ad 2005;4(4):420-423. 12. SAGARPA. Norma Oficial Mexicana NOM-041-ZOO-1995, Campaña Nacional contra la Brucelosis en los Animales. SAGARPA: Secretaría de Agricultura Ganadería y Desarrollo Rural, México. 1996. 13. Mellado M. Técnicas para el manejo reproductivo de las cabras en agostadero. Trop Subtrop Agroecosys 2008;9(1):47-63. 14. Blasco JM, Molina FB. Control and eradication of Brucella melitensis infection in sheep and goats. Vet Clin Food Anim 2011;(27):95–104.

174


Rev Mex Cienc Pecu 2021;12(1):163-176

15. Menzies PI. Vaccination programs for reproductive disorders of small ruminants. Anim Reprod Sci 2012;130(3):162-172. 16. Dorneles EM, Sriranganathan N, Lage AP. Recent advances in Brucella abortus vaccines. Vet Res 2015;46(1):76. 17. Villa R, Perea M, Díaz AE, Soberón MA, Hernández AL, Suárez GF. Abortions and stillbirths in goats immunized against brucelosis using RB51, rfbK and Rev 1 vaccines. Téc Pecu Méx 2008;46(3):249-258 18. Martínez HDI, Morales MJA, Peniche CAE, Molina SB, Rodríguez CMA, Loeza LR, Flores-Castro R. Use of RB51 Vaccine for small ruminants Brucellosis prevention, in Veracruz, México. Int J Dairy Sci 2010;(5):10-17. 19. Oñate AA, Céspedes S, Cabrera A, Rivers R, González A, Muñoz C, Folch H. DNA vaccine encoding Cu, Zn superoxide dismutase of Brucella abortus induces protective immunity in BALB/c mice. Infect Immun 2003;71(9):4857-4861. 20. Solorio-Rivera JL, Segura-Correa JC, Sánchez-Gil LG. Seroprevalence of and risk factors for brucelosis of goats in herds of Michoacan, Mexico. Prev Vet Med 2007;(82):282–290. 21. Olsen SC. Recent developments in livestock and wildlife brucellosis vaccination. Rev Sci Tech 2013;32(1):207-17. 22. Olsen SC, Boyle SM, Schurig GG, Sriranganathan NN. Immune responses and protection against experimental challenge after vaccination of bison with Brucella abortus strain RB51 or RB51 overexpressing superoxide dismutase and glycosyltransferase genes. Clin Vaccine Immunol 2009;16(4):535-540. 23. INEGI. Anuario estadístico y geográfico de Veracruz de Ignacio de la Llave. 2016. 24. Román-Ramírez DL, Martínez-Herrera DI, Villagómez-Cortés JAJ, Peniche-Cardeña AE, Morales-Álvarez JF, Flores-Castro R. Epidemiología de la brucelosis caprina en la Zona Centro del Estado de Veracruz. Gac Med Mex 2017;153(1):26-30. 25. Raúl AC, Clemente LCJ, Ivone MPM, Denis OAJ, Melesio SH. Manejo reproductivo de los caprinos en agostaderos de B.C.S. INIFAP. 2009. 26. Thrusfield M. Veterinary epidemiology. 3ra ed. USA: Blackwell Science Ltd; 2005.

175


Rev Mex Cienc Pecu 2021;12(1):163-176

27. Molina SB, Martínez HDI, Pardío SVT, Flores CR, Morales AJF, Murguía GJ, et al. Evaluación de la seroconversión en cabras vacunadas con diferentes cepas contra la brucelosis en Veracruz, México. Avances en Investigación Agrícola, Pecuaria, Forestal, Acuícola, Pesquería, Desarrollo Rural, Transferencia de tecnología, Biotecnología, Ambiente, Recursos naturales y Cambio climático 2017;1(1):810-819. 28. Banda CA. Seroprevalencia de brucelosis y su efecto sobre la productividad de hatos caprinos en Aramberri, Nuevo León [tesis doctorado]. México: Universidad Autónoma de Nuevo León. 2015. 29. Ochoa DV. Protección conferida por la vacunación con Rev 1 Brucella melitensis; RB51 y rfbK Brucella abortus, en borregas desafiadas experimentalmente con Brucella melitensis [tesis maestría]. México: Universidad Nacional Autónoma de México; 2002. 30. Mellado M, Olivares L, Díaz H, Villarreal JA. Placental traits in pen-fed goats and goats kept on rangeland. J App Anim Res 2006;29(2):133-136. 31. Moriyón I, Grilló MJ, Monreal D, González D, Marín C, López-Goñi I, Blasco JM. Rough vaccines in animal brucellosis: structural and genetic basis and present status. Vet Res 2004;35(1):1-38. 32. Estein SM. Brucelosis bovina (revisión bibliográfica) Revista Electrónica de Veterinaria REDVET 2013. ISSN 1695 – 7504, 7(5). http://www.veterinaria.org/revistas/redvet/n050506.html 33. El Idrissi AH, Benkirane A, El Maadoudi M, Bouslikhane M, Berrada J and Zerouali A. Comparison of the efficacy of Brucella abortus strain RB51 and Brucella melitensis Rev 1 live vaccines against experimental infection with Brucella melitensis in pregnant ewes. Rev Sci Tech Off Int Epiz 2001;20(3):741-747. 34. SENASICA. Dirección General de Salud Animal. Regulación y Registro de Productos Veterinarios. Lista de Productos Biológicos 2019. https://www.gob.mx/cms/uploads/attachment/file/455887/LISTADO_PRODUCTOS_ BIOLOGICOS_2019.pdf 35. Schurig GG, Sriranganathan N, Corbel M J. Brucellosis vaccines: past, present and future. Vet Microbiol 2002;(90)479–496.

176


https://doi.org/10.22319/rmcp.v12i1.5283 Artículo

Distribución corporal de garrapatas (Acari: Ixodidae y Argasidae) asociadas a Odocoielus virginianus (Artiodactyla: Cervidae) y Ovis canadensis (Artiodactyla: Bovidae) en tres estados del norte de México

Mariana Cuesy León a Zinnia Judith Molina Garza a* Roberto Mercado Hernández a Lucio Galaviz Silva a

a

Universidad Autónoma de Nuevo León, Facultad de Ciencias Biológicas, Ave. Universidad S/N, Ciudad Universitaria. 66455 San Nicolás de los Garza, Nuevo León. México.

*Autor de correspondencia: zinnia.molinagr@uanl.edu.mx; molinazinnia@hotmail.com

Resumen: Las garrapatas impactan como vectores por transmitir patógenos de importancia médica y veterinaria en México, pero los estudios taxonómicos de abundancia, prevalencia, intensidad y preferencia en la distribución corporal de venado cola blanca (Odocoileus virginianus) y borrego cimarrón (Ovis canadensis) son precarios, por lo cual estos fueron los objetivos del presente trabajo en Sonora, Nuevo León y Tamaulipas, México. El área de estudio abarcó ranchos cinegéticos autorizados donde se practica la cacería. Se examinaron 233 O. virginianus y cuatro O. canadensis, recolectándose 372 garrapatas [21 ninfas (5.65 %) y 351 adultos (94.35 %)]; 41 % fueron hembras y 59 % machos. Las garrapatas presentes en O. virginianus fueron Otobius megnini, Rhipicephalus (Boophilus) microplus y Dermacentor (Anocentor) nitens, mientras que Dermacentor hunteri fue la única en O. canadensis. Las orejas fue la región más infestada (83 hembras, 70 machos y 21 ninfas, 46.77 % en total) y la menos infestada fueron las piernas (10 machos y nueve hembras, 5.1 %), con diferencia significativa (P<0.005). Este estudio reporta por primera vez la abundancia, intensidad y

177


Rev Mex Cienc Pecu 2021;12(1):177-193

prevalencia de garrapatas en O. virginianus en el norte de México y particularmente en los estados de Tamaulipas y Nuevo León, pues solo las garrapatas de O. canadensis habían sido reportadas en Sonora. Estos resultados indican que, aunque los ungulados están en semicautiverio, es importante controlar la infestación por garrapatas de acuerdo a los sitios de adherencia preferidos para aplicar los tratamientos acaridas, debido a la importancia como vectores en la transmisión de patógenos. Palabras clave: Venado cola blanca, Borrego cimarrón, Garrapatas, Rhipicephalus microplus, Otobius megnini, Dermacentor nitens, Dermacentor hunteri.

Recibido: 26/02/2019 Aceptado:20/11/2019

Introducción Las garrapatas son ectoparásitos de anfibios, reptiles, aves y mamíferos, hematófagos en todos sus estadios(1). Debido a sus hábitos alimenticios, causan efectos directos en sus hospederos como escasa ganancia de peso, acción traumática, tóxica, infecciosa o expoliadora y también, efectos indirectos que ocasionan deterioro de piel y muerte por enfermedades dérmicas(2,3). Durante su ciclo de vida, la garrapata puede adquirir patógenos de forma horizontal o vertical(4) y transmitir una amplia gama de microorganismos de importancia médica y veterinaria como Babesia spp., Borrelia spp., Anaplasma phagocytophilum y Rickettsia spp., considerándose como vectores de importancia mundial, superados únicamente por los mosquitos(5). La fauna silvestre constituye un componente en el ciclo de transmisión del triángulo vectorhospedero-patógeno, donde frecuentemente se incluye al humano como hospedero accidental, convirtiéndose en un ciclo zoonótico(6). Por lo tanto, la prevalencia de enfermedades nuevas y re-emergentes transmitidas por garrapatas, conforman un problema de salud pública en el mundo(7). La distribución geográfica de las garrapatas está influenciada principalmente por las variaciones climáticas y geográficas, el tipo de vegetación, el paisaje agrícola, la dinámica poblacional de sus hospederos silvestres(3); así como el movimiento ilegal de ganado y de Odocoileus virginianus para comercialización sin cumplir normas sanitarias(8), los cuales son factores que facilitan su dispersión hacia sitios donde no se encontraba naturalmente, aumentando en el humano el riesgo de exposición para adquirir enfermedades asociadas a estos vectores(9,10). Los estudios de garrapatas reportan preferencias específicas de Rhipicephalus annulatus por cérvidos(11), así como especificidad de Dermacentor spp. e Ixodes spp. por cabeza y cuello(12).

178


Rev Mex Cienc Pecu 2021;12(1):177-193

En México, se han identificado 77 especies de garrapatas, de las cuales en la ganadería nacional las de importancia por los daños directos e indirectos son R. (Boophilus) microplus, B. anulatus, Amblyomma cajennense, A. imitador. A. maculatum, A. triste, A. americanum y Anocentor nitens, sin embargo, las que sobresalen por su mayor impacto económico son R. microplus y A. cajennense,(13,14).con pérdidas por US $ 573’608,076(15). En los estados de Sonora, Nuevo León y Tamaulipas, se ha aprovechado la presencia de O. virginianus y Ovis canadensis para aumentar los ingresos a través de la caza legalizada que se realiza en ranchos cinegéticos. En 1996, se inició en el Rancho El Plomito, Sonora, el programa de conservación que consistió en la construcción de un encierro para la reproducción de especies de importancia económica en condiciones de semi-cautiverio en una superficie de 961 ha. Para el 2014, se contó con una población reproductiva de O. canadensis, O. v. couesi y O. hemionus para realizar las primeras repoblaciones por la Organización de Vida Silvestre (OVIS, AC)(16). Las autoridades mexicanas reformaron la operatividad de los ranchos cinegéticos mediante la implementación del actual sistema de Unidades de Manejo para la Conservación de la Vida Silvestre (UMA), que permite la conservación y ordenación de la fauna silvestre en su hábitat natural, así como el aprovechamiento racional de poblaciones y ejemplares de especies silvestres o en semi-cautiverio(17,18). En las localidades estudiadas está permitido la caza regulada de estos ungulados, pero los estudios poblacionales de ectoparásitos, su distribución corporal y la presencia de especies de interés cinegético son escasos(3,12). Por lo cual, los resultados obtenidos con el presente estudio permitirán planificar las zonas del cuerpo donde se aplicarán los tratamientos o dispositivos acaricidas para su control, que han demostrado éxito en su erradicación(12). Los objetivos de este estudio fueron i) identificar taxonómicamente las especies de las garrapatas, ii) determinar su prevalencia, iii) estimar la abundancia e intensidad y iv) describir la distribución corporal en O. virginianus y O. canadensis en ranchos cinegéticos de Sonora, Nuevo León y Tamaulipas en la región norte de México. La información obtenida ayuda a comprender el riesgo potencial de las garrapatas como vectores de enfermedades de importancia y establecer medidas preventivas y correctivas.

Material y métodos Localidades estudiadas El presente estudio se realizó del año 2014 al 2018 en distintas localidades del estado de Tamaulipas, Nuevo León y Sonora, ubicados en el norte de México, en los meses de octubre a febrero, período de caza legal en UMAs in situ o ex situ de especies como O. virginianus y O. canadensis(17,18). Dos localidades se ubican en la Sierra Madre Occidental en el estado de Sonora: Rancho El Aigame (registro de la UMA: DGVS-CR-EX-1271-SON) municipio La Colorada (28º 43’ 41” N, 110º 2’0.65” W) a 400 msnm y Rancho El Pitiquito (registro de la UMA SEMARNAT-UMA-EX-250-SON) (30º 15’ 0.0’’ N, 112º 22’0.12’’ W)(16-18),

179


Rev Mex Cienc Pecu 2021;12(1):177-193

municipio El Pitiquito, donde predomina el clima seco y semiseco con precipitación media de 450 mm anuales(19). En el estado de Nuevo León, las colectas se realizaron en el Rancho Mamulique (clave de registro DFYFS-CR-EX-0333-NL), municipio de Salinas Victoria (26º 7’ 0.59’’ N, 100º 19’ 0.58’’W), a 464 msnm, con clima semicálido y seco estepario caliente; cuenta con una temperatura media anual de 21-23 °C y precipitación media anual de 380 mm(19). En el estado de Tamaulipas, las colectas se realizaron en dos localidades, una en el Rancho Santa Clara (registro de la UMA DGVS-CR-EX-1819-TAM), Nuevo Laredo (27° 33’0.11’’ N, 99° 47’ 59.9’’ W), con clima caracterizado por ser el más seco y extremoso del estado, con oscilaciones que varían desde -14 °C en invierno y hasta los 40 °C en verano; su precipitación media anual es de 472.5 mm(19). La segunda localidad fue Rancho Los Columpios (clave de registro DGVS-CR-EX-2066-TAM), municipio de Guerrero (26° 33’ 18’’ N, 99° 22’ 0.37’’ W) ubicado sobre la cuenca del río Bravo, Tamaulipas. Su clima se considera de tipo seco, muy cálido y con una precipitación media anual de 440 mm (18-20).

Colecta e identificación taxonómica de garrapatas Todos los ejemplares de garrapatas se obtuvieron de ejemplares cazados de O. virginianus y O. canadensis durante la temporada de caza, a través de la autorización emitida por la Secretaría del Medio Ambiente y Recursos Naturales a cada UMA(16-18). La tasa de aprovechamiento de estas especies se orienta a la caza de ejemplares machos y adultos; los cazadores, después de adquirir un paquete de cacería, fueron acompañados por técnicos del grupo OVIS(16). Durante las colectas y utilizando pinzas estériles, las garrapatas fueron individualmente removidas de la parte superior de la cabeza, el oído, la escapula, la parte media dorsal del cuello y extremidades inferiores de los animales cazados(21). Las garrapatas vivas se transportaron en viales de 12 ml previamente etiquetado con fecha, hospedero, estadio, localidad y distribución corporal de la garrapata en el hospedero que contenían algodón humedecido con agua bidestilada estéril y posteriormente fueron trasladados al Laboratorio de Patología Molecular y Experimental (LPME, FCB, UANL), conservándose a 4 °C. Para aquellos ectoparásitos que morían en el trayecto, se prepararon viales con alcohol etílico absoluto como preservador, evitándose el deterioro de los caracteres morfológicos para posterior identificación taxonómica(22). La identificación taxonómica de garrapatas se realizó con ayuda de un estereoscopio a 10X – 40X (EZ4E, Leica Microsystem, Guadalajara, Jalisco, México) y con base en claves taxonómicas específicas se determinó el género y la especie a la que pertenecen y se registró el sexo y estadio(23-25). En la identificación taxonómica de las garrapatas se consideraron las siguientes estructuras distintivas de cada una de las especies: Otobius megnini: Sin escudo dorsal y con gnatostoma ventral, base del capítulo recto y rectangular, ojos ausentes, hipostoma vestigial o atrofiado, tegumento con espinas, ambulacro ausente al final de las patas (Figura 1).

180


Rev Mex Cienc Pecu 2021;12(1):177-193

Figura 1: Características taxonómicas de Otobius megnini

A) Vista dorsal. Diagrama y fotografía de ninfa. B) Vista ventral con detalles del gnastoma anterior, base del capítulo rectangular en el recuadro. C) Integumento con espinas (entre las espinas el integumento es liso).

Rhipicephalus (Boophilus) microplus: Los machos presentan placas ventrales y un apéndice caudal, escudo cubre la región dorsal del macho y escudo cubre la región dorsal anterior de la hembra, ojos presentes, base del capítulo hexagonal, coxa I con espina doble y la coxa IV del tamaño normal, prominente y visible desde la vista dorsal, festones ausentes (Figura 2). Las especies de Dermacentor presentan un gnastoma anterior con la base del capítulo recto y rectangular, festones, la coxa IV muy grande en machos mientras que la coxa I tiene espuelas grandes y pareadas (Figura 3). Para la diferenciación entre las especies de D hunteri y D. nitens, se contaron el número de festones: D. hunteri tiene 11 y presenta un ornamento con un patrón característico, con placas espiraculares grandes y posteriores a la IV pata, en forma de anillo (Figura 4), mientras que D. nitens cuenta con siete festones (Figura 5). Todos los esquemas de las figuras fueron tomadas de las claves taxonómicas(24,25).

181


Rev Mex Cienc Pecu 2021;12(1):177-193

Figura 2: Características morfológicas para la identificación taxonómica de Rhipicephalus (Boophilus) microplus

A) Escudo dorsal presente. B) Gnastoma anterior, base del capítulo con márgenes angulares. C) ojos presentes. D) Festones ausentes. E) Placas ventrales y apéndice caudal. F) Coxa I y IV. G) Ejemplares adultos hembra y macho.

Figura 3: Características morfológicas para la identificación taxonómica de Dermacentor spp

A) Escudo dorsal presente. B) Gnastoma anterior, base del capítulo recto y rectangular. C) Ojos presentes. D) Morfología de la coxa I y IV. E) Festones en extremo posterior.

182


Rev Mex Cienc Pecu 2021;12(1):177-193

Figura 4: Características morfológicas para la identificación taxonómica de Dermacentor hunnteri

A) Once festones. B) Ornamento presente (mostrado en el patrón). C) Ejemplar (macho) completo.

Figura 5: Características morfológicas para la identificación taxonómica de Dermacentor (Anocentor) nitens

A) Siete festones. B) Placas espiraculares grandes y posteriores a la IV pata (forma un anillo). C) Ornamento ausente, ejemplar (macho) completo.

Análisis estadístico Se calcularon la prevalencia (porcentaje de hospederos infestados por especie de garrapata), intensidad (total de garrapatas/hospederos infestados por cada especie de garrapata), abundancia (total de garrapatas por especie/total de hospederos) y la proporción de sexos por especie de garrapata(26). Se determinó la asociación significativa entre el vector, la ubicación del hospedero, sexo y localidad de colecta de las garrapatas a partir de una prueba de Chi cuadrada (X2) a un nivel de significancia del 95 % del intervalo de confianza inferior y superior (IC). Adicionalmente, los datos se analizaron con la prueba Z para comparar proporciones poblacionales entre estadios, especies de garrapatas, localidades y hospederos con el programa del SPSS versión 17(12).

183


Rev Mex Cienc Pecu 2021;12(1):177-193

Resultados Se inspeccionaron un total de 237 hospederos, de los cuales 233 fueron ejemplares de O. virginianus y cuatro de O. canadensis, los porcentajes de infestación corporal fueron 17.16 % y 100 %, respectivamente. Se colectó un total de 372 garrapatas, 5.65 % ninfas y 94.35 % adultas. Las garrapatas se identificaron en cuatro especies distintas, tres pertenecientes a la familia Ixodidae: Rhipicephalus (Boophilus) microplus (Canestrini, 1887), Dermacentor (Anocentor) nitens (Neumann, 1897) y Dermacentor hunteri (Bishopp, 1912); y Otobius megnini (Dugès 1883) de la familia Argasidae (Cuadro 1). Cuadro 1: Identificación de garrapatas por hospedero (Odocoileus virginianus y Ovis canadensis), sexo y localidad Localidad Sonora

Hospedero (n/+) O. virginianus (16/6) O. canadensis (4/4)

Nuevo León

Tamaulipas Total O. virginianus

Total O. canadensis

O. virginianus (202/28) O. virginianus (15/6) (233/40)

(4/4)

Sexo Especies

GE/TE (%)

H n/(%)

M n/(%)

* Otobius megnini

19/204 (9.3)

NA

NA

*O. megnini Dermacentor hunteri Rhipicephalus microplus D. nitens R. microplus

2/204 (0.98) 183/204 (89.7)

NA NA 28/(13.7) 155/(76)

98/151 (64.9)

84/(55.6) 14/(9.3)

53/151 (35.1) 17/17 (100)

19/(12.6) 34/(22.5) 13/(76.5) 4/(23.5)

*19/372 (5.1)

NA

NA

168/372 (45.2)

116/(41)

52/(59)

*2/372 (0.53)

NA

NA

183/ 372(49.19)

28/

155/

NA

NA

GE/TE= Garrapatas por especie /total del Estado (%); n= número de ejemplares; *= ninfas; NA= no aplica.

En cuanto al sexo de las garrapatas, el 41 % fueron hembras y 59 % machos (Cuadro 1), pero distribuidas por sexo y por hospedero, en O. virginianus la mayoría fueron hembras (116/168, 69 %) con 31 % machos (52/168). Por el contrario, en O. canadensis la mayor prevalencia de D. hunteri fue de machos (155/183, 84.7 %) con respecto al 15.3 % (28/183) de hembras, con asociación significativa entre la proporción de machos y hembras de garrapatas entre O.

184


Rev Mex Cienc Pecu 2021;12(1):177-193

virginianus y O. canadensis (X2= 104.57, g.l.= 1, P<0.05). La proporción de hembras y machos entre las cuatro especies de garrapatas en O. virginianus también mostró asociación significativa (X2= 39.92, g.l.= 1, P<0.05), igual que entre machos y hembras por localidad (X2= 105.01, g.l.= 2, P< 0.05). Esto fue consistente con el análisis de proporciones poblacionales entre estadios, especies de garrapatas, localidades y hospederos, ya que fue confirmatoria con la prueba Z que mostró una asociación significativa (Z> 1.2, IC 95%). Cuadro 2: Porcentaje de la distribución corporal de las especies de garrapatas identificadas Región Sexo corporal Cabeza ♀ ♂ Oreja ♀ ♂ N Cuello ♀ ♂ Lomo ♀ ♂ Patas ♀ ♂ Total por especie (n/%)

R. microplus n/(%) 21 (5.7) 5 (1.3) 58 (15.6) 11 (2.9) NE 9 (2.4) 1 (0.3) 4 (1.1) NE 6 (1.6) NE

D. nitens n/(%) 6 (1.6) 5 (1.3) 17 (4.6) 11 (2.9) NE 4 (1.1) 5 (1.3) NE NE 2 (0.5) 3 (0.8)

O. megnini D. hunteri n/(%) n/(%) NE 7 (1.9) NE 31 (8.3) NE 8 (2.2) NE 48 (12.9) 21 (5.7) NE NE 5 (1.3) NE 29 (7.8) NE 6 (1.6) NE 31 (8.3) NE 2 (0.5) NE 16 (4.3)

Total n/(%) 34 (9.1) 41 (11.1) 83 (22.3) 70 (18.8) 21 (5.7) 18 (4.8) 35 (9.4) 10 (2.7) 31 (8.3) 10 (2.7) 19 (5.1)

115 (30.9)

53 (14.2)

21 (5.7)

372 (100)

183 (49.2)

N= ninfas; n= número de ejemplares; NE= no se encontraron.

En el estado de Sonora se colectó el 54.8 % (204/372) de las garrapatas de los dos hospederos; en O. virginianus el 9.3 % (19/204) fueron ninfas de O. megnini y 0.98 % (2/204) ninfas del mismo ectoparásito en O. canadensis junto con 89.7 % de D. hunteri (Cuadro 1). En Nuevo León se colectaron 40.6 % (151/372) garrapatas de O. virginianus con dos especies diferentes: R. microplus (98/151, 64.9 %) y D. nitens (34/151, 35.1 %). En Tamaulipas, en O. virginianus se colectaron únicamente 17 ejemplares de R. microplus, que representa el 4.56 % (17/372) del total de garrapatas adultas en las tres localidades. La distribución corporal de las garrapatas en los hospederos fue mayor en las orejas con un total de 174 (46.77 %) de las cuatro especies (22.3 % de hembras, 18.8 % de machos y 5.7 % ninfas) y en la parte superior de la cabeza (9.1 % hembras y 11.1 % machos), seguida por el cuello, escapula y por último en las extremidades inferiores. Al analizar las diferentes especies de garrapatas y su distribución corporal, sin importar hospedero y localidad, presentaron asociación significativa (X2= 46.18, g.l.= 8, P<0.05), aún en O. megnini las ninfas se localizaron exclusivamente en las orejas. También las hembras y machos de las 185


Rev Mex Cienc Pecu 2021;12(1):177-193

diferentes especies de garrapatas se asociaron significativamente con la ubicación corporal (X2 = 13.25, g.l.= 4, P<0.05). En cuanto a la prevalencia, abundancia e intensidad de las garrapatas de O. virginianus, R. microplus presentó la mayor con el 30.9 %, 0.49 y 2.88, respectivamente; pero en O. canadensis, D. hunteri es la más sobresaliente (Cuadro 3). Cuadro 3: Prevalencia, abundancia e intensidad de infestación por especie de garrapatas O. virginianus (40/233) O. canadensis (4/4) Especie Prev (%) Abund X̅ Intens Prev %) Abund X̅ Intens R. microplus D. nitens O. megnini D. hunteri

115 (30.9) 53 (14.2) 19(5.1) --

0.49

2.88

--

--

--

0.23 0.082 --

1.33 0.48 --

-2 (0.54) 183 (49.2)

-0.5 45.8

-0.5 45.8

Prev= prevalencia; Abund= abundancia; Intens= intensidad.

Discusión Rhipicephalus (Boophilus) microplus conocida como garrapata del ganado, en O. virginianus de Nuevo León y Tamaulipas es la que presentó mayor prevalencia debido a que habitan el mismo territorio cinegético. Esta garrapata es considerada de mayor incidencia en los sistemas de producción ganadera, debido a las grandes pérdidas económicas que causa a nivel mundial(27) además de ser vector biológico de Babesia bovis, B. bigemina y Anaplasma marginale; en este estudio, se considera que O. virginianus juega un papel importante como reservorio natural de estas enfermedades en las zonas de estudio, tal como se ha reportado en áreas de Texas, EUA que limitan con Nuevo León y Tamaulipas(27). Durante el control con insecticidas, las garrapatas hembras y larvas escapan hacia hábitats favorables para sobrevivir después del tratamiento, lo que facilita el recrudecimiento de las infestaciones en el ganado y de estos ungulados(28). En cambio en los ejemplares de O. virginianus analizados en Sonora, no se encontró R. micropulus debido a que es un estado libre de esta garrapata, según el Servicio de Inspección de Sanidad Animal y Vegetal (APHIS) del Departamento de Agricultura de EUA (USDA), reportado por SADER/SENASICA(17), pero en estados como Nuevo León y Tamaulipas, siguen los esfuerzos para su erradicación a pesar de que el programa opera una zona de cuarentena permanente en el sur de Texas, EUA, a lo largo de la frontera con México(28). En el norte de México, el manejo del O. virginianus es a través de ranchos cinegéticos, debido a los ingresos que se perciben con los permisos de cacería, las pieles y la carne para consumo humano; en estos ranchos, O. virginianus en semi-cautiverio, comparten las mismas áreas de alimentación, bebida y traslados con el ganado bovino, por

186


Rev Mex Cienc Pecu 2021;12(1):177-193

lo que esto puede ser un factor de riesgo de infestación y se torna difícil la erradicación de esta garrapata(29,30). La prevalencia de R. micropulus fue de 31 % en el norte de México, menor que en Yucatán, México, donde se reportó un 97 % en Cervus elaphus, que se considera como un importante hospedero competente de esta especie de garrapata, la cual, además de alimentarse, completa su ciclo de desarrollo ninfal(3). Esta misma especie, también fue la más común en O. v. yucatanensis y Mazama temama, con una frecuencia del 28.4 % y una intensidad de 25.2 de garrapatas por animal(31). En cambio, R. annulatus fue reportada exclusivamente en C. elaphus con una prevalencia de 7.9 % en la provincia de Cádiz, España(11). En Nuevo León, se colectó D. nitens que hasta la fecha no ha sido reportada para el estado en O. virginianus, aunque existen reportes en varios estados del país, pero en diferentes hospederos como ganado, caballos, perros, mulas y roedores(32). La importancia veterinaria de este ectoparásito es que las hembras de D. nitens transmiten Babesia caballi a su progenie trasováricamente, y todos sus estadios son competentes para esta enfermedad, además de ser agente causal de piroplamosis en caballos(33). En este estudio se reportaron ninfas de la garrapata espinosa (O. megnini) en O. virginianus (5.1 %) y O. canadensis (0.53 %) de Sonora, porque el estado adulto no es ectoparásito(34), a pesar de que su distribución se extiende desde el suroeste de EUA hasta el sur de México y Suramérica, a esta ninfa no se les ha dado la misma importancia que a otras garrapatas Ixodidas, como O. megnini, ya que puede tener múltiples ingestas sanguíneas y depositar lotes de huevos que representan un peligro en el ámbito veterinario y clínico, por presentar una predilección por el canal auditivo, que puede resultar en una otoacariasis, con complicaciones de otitis externa, el 90 % de los casos con dolor ótico, entre otros signos de otitis interna como son parálisis facial y/o respiratoria; afecta a las personas que mantienen un alto contacto operativo con animales de ganado, ya sean vacas, mulas, cabras, conejos y borregos(35). Este ectoparásito puede causar daño en el hospedero como severas irritaciones, pérdida de peso y puede afectar el comportamiento de las crías(36). En ungulados y otros hospederos, cuando una garrapata o ninfa se alimenta causa pérdida de sangre lo que predispone a la atracción de otros insectos causándoles estrés en los hospederos(37), además actúan como vectores de rickettsias causantes de fiebre manchada y Coxiella burnetii (fiebre Q)(38). En Sonora, fue donde se encontró la mayor abundancia de garrapatas en borrego cimarrón, del total de garrapatas colectadas, el 49.19 % pertenecieron a la especie D. hunteri y en machos tuvo mayor proporción con 41.6 %. Esta garrapata se ha observado casi exclusivamente en este hospedero, lo cual concuerda con otros autores y se tiene registrada también en Baja California en poblaciones silvestres de O. canadensis(32,39). En California USA, las poblaciones de este hospedero fueron seropositivas a Anaplasma spp(40), inclusive 187


Rev Mex Cienc Pecu 2021;12(1):177-193

se considera como vector primario de A. ovis (Lestoquard, 1924)(41,42), y otras rikettsias, lo que sugiere la importancia de este ectoparásito en la epidemiología de estas enfermedades(42). De acuerdo con la región corporal del hospedero, al tomar en cuenta el total de garrapatas, se observa que las cuatro especies de garrapatas tuvieron mayor predilección por las orejas, seguido de la cabeza. En Capreolus capreolus, el 61 % de las garrapatas prefirieron zonas en la cabeza(12,21), con un 32.02 % de garrapatas en ganado en la combinación con orejas y cabeza y a su vez, en ovejas relacionaron la predilección alimenticia en cabeza que incluye las orejas con el 48.08 %, lo cual es consistente con los resultados encontrados en el presente estudio. La preferencia de estos ectoparásitos por la cabeza y las orejas sobre la posición del hospedero se relaciona por grosor de la piel que es relativamente delgada y vascularizada en ambas regiones corporales(43,44). En O. canadensis, los machos tuvieron una proporción similar para cada región corporal, con acentuación en las orejas y cabeza. Los resultados fueron similares en un estudio de regiones tropicales de México, la distribución de las garrapatas de la familia Ixodidae en la infestación de las ovejas fue de 26.50 % en cabeza y cuello(45). Se ha reportado que la densidad de garrapatas en O. virginianus puede ser muy variable, y que esta depende de la época estacional en que se colecte y la edad de los ungulados(12,46). En este estudio se colectó en la temporada otoño-invierno justo cuando se permite la cacería coincidente con que las garrapatas fueran adultas, a excepción de O. megnini, en la cual su estado parasítico fue ninfal. En las garrapatas del género Ixodes y Dermacentor presentaron una preferencia hacia los ungulados más jóvenes, debido a sus hábitos y al grosor de la piel más delgada en Capreolus capreolus, además las garrapatas adultas no tuvieron preferencia sobre el sexo del hospedero pero sí por su masa corporal(12,46). Aunque en el sur de Texas, EUA, donde existe un área de cuarentena de erradicación de garrapatas en el ganado, no se logran erradicar por movimientos no regulados de ganado ilegal y la dispersión de animales de vida silvestre como O. virginianus en México(27).

Conclusiones e implicaciones Este trabajo reporta la presencia de cuatro especies de garrapatas en O. virginianus (O. megnini, R. microplus y D. nitens) y dos en O. canadensis (O. megnini y D. hunteri) de ranchos cinegéticos del norte de México, las cuales juegan un papel crítico en la epizootiología de patógenos(47), considerándose necesario realizar más estudios que identifiquen a potenciales vectores de enfermedades y microorganismos patógenos asociados a las garrapatas de los ungulados de importancia cinegética en el país y determinar el control de los mismos. La región corporal más infestada fueron las orejas y las menos infestadas fueron las piernas como respuesta al grosor de la piel en estas regiones corporales. Una de las principales estrategias para la erradicación de las garrapatas, es el conocimiento por la

188


Rev Mex Cienc Pecu 2021;12(1):177-193

especificidad del hospedero como O. virginianus y otros ungulados, en el cual se recomendaría dispersar acaricidas, ivermectinas específicas según el tipo de suelo o pastizal(48), además de tomar en cuenta su ciclo de vida, ya que podría variar la susceptibilidad al insecticida(37). Por consiguiente, el conocimiento de la distribución de garrapatas en el norte de México, su abundancia e intensidad de las mismas sobre O. virginianus y O. canadensis, ayudará a implementar medidas preventivas o control en ranchos cinegéticos y en la ganadería, así como en la importación o caza de estos ungulados, además de prevenir el desarrollo de nuevos vectores que pueden ser causantes potenciales de enfermedades infecciosas de salud pública y zoonótica. Agradecimientos Al grupo OVIS, S.A. DE C.V. por su participación en la colecta de garrapatas. A CONACyT por la beca de Maestría en Ciencias otorgada al primer autor. Literatura citada: 1. Klompen JSH, Black WC, Keirans JE, Oliver Jr JH. Evolution of Ticks. Annu Rev Entomol 1996;41:141–161. doi:10.1146/annurev.en.41.010196.001041. 2. García-Vázquez Z. Garrapatas que afectan al ganado bovino y enfermedades que trasnmiten en México. 1er. Simposium de Salud y Producción de Bovinos de Carne en la Zona Norte-Centro de México 2010;1–9. http://biblioteca.inifap.gob.mx:8080/jspui/handle/123456789/3281 Consultado 5 Jun, 2019. 3. Rodríguez-Vivas RI, Ojeda-Chi MM, Rosado-Aguilar JA, Trinidad-Martínez IC, TorresAcosta JFJ, Ticante-Perez V, et al. Red deer (Cervus elaphus) as a host for the cattle tick Rhipicephalus microplus (Acari: Ixodidae) in Yucatan, Mexico. Exp Appl Acarol 2013;60:543–552. doi:10.1007/s10493-013-9672-z. 4. Koneman E, Koneman AS: Diagnostico microbiologico/Texto y atlas en color. 6ta ed. Buenos Aires, Argentina: Editorial Médica Panamericana; 2008. 5. Claerebout E, Losson B, Cochez C, Casaert S, Dalemans AC, De Cat A, et al. Ticks and associated pathogens collected from dogs and cats in Belgium. Parasit Vectors 2013;6:183. doi:10.1186/1756-3305-6-183. 6. Sosa-Gutiérrez G, Vargas M, Torres J. Gordillo-Pérez G. Tick-borne rickettsial pathogens in rodents from Mexico. J Biomed Sci Eng 2014;7:884–889. doi:10.4236/jbise.2014.711087.

189


Rev Mex Cienc Pecu 2021;12(1):177-193

7. CDC. Centers for Disease Control and Prevention. New & Emerging Tickborne diseases: Agents, clinical features & surveillance. 2018. https://www.cdc.gov/ticks/diseases/trends.html#2013-video Accessed 12 Sept, 2018. 8. Bush JD, Stone NE, Nottingham R, Araya-Anchetta A, Lewis J, Hochhalter C, et al. Widespread movement of invasive cattle fever ticks (Rhipicephalus microplus) in southern Texas leads to shared local infestations on cattle and deer. Parasit Vectors 2014;7:188. doi:10.1186/1756-3305-7-188. 9. Shaw MT, Keesing F, McGrail R, Ostfeld RS. Factors influencing the distribution of larval blacklegged ticks on rodent hosts. Am J Trop Med Hyg 2003;68:447–452. 10. Blagburn BL, Dryden MW. Biology, treatment, and control of flea and tick infestations. Vet ClinNorth Am Small Anim Pract 2009;39:1173–1200. doi:10.1016/j.cvsm.2009.07.001. 11. Ruiz-Fons F, Fernandez de Mera IG, Pelayo-Acevedo UH, Höfle U, Vicente J, De la Fuente J, et al. Ixodid ticks parasitizing Iberian red deer (Cervus elaphus hispanicus) and European wild boar (Sus scrofa) from Spain : Geographical and temporal distribution Vet Parasitol 2006;140:133–142. doi:10.1016/j.vetpar.2006.03.033. 12. Vor T, Kiffner C, Hagedorn P, Niedrig M, Ru F. Tick burden on European roe deer (Capreolus capreolus). Exp Appl Acarol 2010;51:405–417. doi:10.1007/s10493-0109337-0. 13. Martínez Arzate SG. Análisis filogenético molecular de la secuencia de la proteína Bm86 de la garrapata Rhipicephalus (boophilus) microplus de Colima, México [tesis maestria]. Toluca, Estado de México. Universidad Autónoma del Estado de México; 2014. 14. SENASICA. Situación actual del control de la garrapata Boophilus spp. 2016. https://www.gob.mx/senasica/documentos/situacion-actual-del-control-de-lagarrapata-boophilus-spp. Consultado 20 Sept, 2019. 15. Rodríguez Vivas RI, Grisi L, Pérez de León A, Silva Villela H, Torres Acosta J, Fragoso H, et al. Potential economic impact assessment for cattle parasites in Mexico. Review. Rev Mex Cienc Pecu 2017;8(1):61-74. 16. OVIS. PROGRAMAS.2011. http://ovis.org.mx/programas/ Consultado 10 Nov, 2017. 17. SEMARNAT. Reglamento de la ley general de vida silvestre. Diario Oficial de La Federación; 2014; DOF 09-05-2014. 1–52. http://biblioteca.semarnat.gob.mx/janium/Documentos/Ciga/agenda/DOFsr/DO2008.p df. Consultado 15 Abr, 2018.

190


Rev Mex Cienc Pecu 2021;12(1):177-193

18. SEMARNAT. Registros de unidades de manejo para la conservación de la vida silvestre (UMA). 2019. https://datos.gob.mx/busca/dataset/registros-de-unidades-de-manejopara-la-conservacion-de-la-vida-silvestre-uma/resource/8815e80b-1779-469f-80b8b4a4756f61c3. 19.

INEGI. Cuentame. 2017. http://www.inegi.org.mx/ http://www.cuentame.inegi.org.mx/monografias/informacion/son/territorio/div_munici pal.aspx?tema=me&e=26. Consultado 21 Mar, 2018.

20.

OCDE. (2018). Nuevo Laredo, Tamaulipas | OCDE Mexico. http://www.ocdemexico.org.mx/Tamaulipas/Nuevo-Laredo/. Consultado Mar 25, 2018.

21. Warwick BT, Bak E, Baldassare J, Gregg E, Kioko J, Saning K, et al. Abundance estimations of ixodid ticks on Boran cattle and Somali sheep in Northern Tanzania. Int J Acarol 2016;42:12–17. doi:10.1080/01647954.2015.1109708. 22. Amerasinghe F, Breisch N, Azad A. Distribution, density, and Lyme disease spirochete infection in Ixodes dammini (Acari: Ixodidae) on white-tailed deer in Maryland. J Med Entomol 1992;29:54–61. 23. Keirans JE, Litwak TR. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J Med Entomol 1989;26:435–448. 24. Delabra G, Fragoso H, Franco R, Martínez F, Ortiz M, Ortiz A, et al. Manual de identificación de las especies de garrapatas de importancia en México. México: Dirección General de Salud Animal. Secretaría de Agricultura, Ganadería y Desarrollo Rural. 1996. 25. Walker AR, Bouattor A, Camicas J, Estrada-Pena, Horak IG, Latiff A, et al. Ticks of domestic animals in Africa, a guide to identification of species. Edinburgh Scotland, U.K: Bioscience Reports. 2014. 26. Bush AO, Lafferty KD, Lotz JM, Shostak AW. Parasitology meets ecology on its own terms: Margolis et al. revisited. J Parasitol 1997;83(4):575-583. 27. Busch JD, Stone NE, Nottingham R, Araya-Anchetta A, Lewis J, Hochhalter, et al. Widespread movement of invasive cattle fever ticks (Rhipicephalus microplus) in southern Texas leads to shared local infestations on cattle and deer. Parasit Vectors 2014;7:188. 28. Wang HH, Teel PD, Grant WE, Schuster G, Pérez de León AA. Simulated interactions of white-tailed deer (Odocoileus virginianus), climate variation and habitat heterogeneity on southern cattle tick (Rhipicephalus (Boophilus) microplus) eradication methods in south Texas, USA. Ecol Modell 2016;342:82–96.

191


Rev Mex Cienc Pecu 2021;12(1):177-193

29. Cantú-Martinez M, Salinas-Meléndez JA, Zarate-Ramos J, Ávalos-Ramírez R, MartínezMuñoz A, Segura-Correa J. Prevalence of antibodies against Babesia bigemina and B. bovis in white-tailed deer (Odocoileus virginianus texanus) in farms of northeastern Mexico. J Anim Vet Adv 2008;7:121–123. 30. Medrano C, Boadella M, Barrios H, Cantú A, García Z, De la Fuente J, et al. Zoonotic pathogens among white-tailed deer, northern Mexico, 2004-2009. Emerg Infect Dis 2012;18:1372–1374. 31. Ojeda-Chi M, Rodriguez-Vivas RI, Esteve-Gasent MD, Pérez de León A, Modarellid J J, Villegas-Perez S. Molecular detection of rickettsial tick-borne agents in white-tailed deer (Odocoileus virginianus yucatanensis), mazama deer (Mazama temama), and the ticks they host in Yucatan, Mexico. Ticks Tick Borne Dis 2019;10:365-370. doi: 10.1016/j.ttbdis.2018.11.018 32. Guzmán-Cornejo C, Robbins RG, Guglielmone AA, Montiel-Parra G, Rivas G, Pérez TM. The Dermacentor (Acari, Ixodida, ixodidae) of Mexico: Hosts, geographical distribution and new records. ZooKeys 2016;569:1–22. doi:10.3897/zookeys.569.7221. 33. Schwint ON, Knowles DP, Ueti MW, Kappmeyer LS, Scoles GA. Transmission of Babesia caballi by Dermacentor nitens (Acari: Ixodidae) is restricted to one generation in the absence of alimentary reinfection on a susceptible equine host. J Med Entomol 2008;45:1152–1155. doi:10.1603/0022-2585(2008)45[1152:TOBCBD]2.0.CO;2. 34. Nava S, Mangold J, Guglielmone AA. Field and laboratory studies in a Neotropical population of the spinose ear tick, Otobius megnini. Med Vet Entomol 2009;23:1–5. doi:10.1111/j.1365-2915.2008.00761.x 35. Cakabay T, Gokdogan O, Kocyigit M. Human otoacariasis : Demographic and clinical outcomes in patients with ear-canal ticks and a review of literature. J Otol 2016;11:111– 117. doi:10.1016/j.joto.2016.06.003. 36. Niebuhr CN, Mays SE, Breeden JB, Lambert BD, Kattes DH. Efficacy of chemical repellents against Otobius megnini (Acari :Argasidae) and three species of ixodid ticks. Exp Appl Acarol 2014;64:99-107. doi:10.1007/s10493-014-9799-6. 37. Almada Resende JDS, Daemon E, De Olivera Montero CM, Maturano R, Prata DA, Rodrigues AFS. Toxicity of solvents and surfactants to Amblyomma cajennense (Fabricius, 1787) (Acari:Ixodidae) and Dermacentor nitens (Neumann, 1897) (Acari : Ixodidae) larvae. Exp Parasitol 2012;131:139–142. doi:10.1016/j.exppara.2012.03.002. 38. Diyes GCP, Rajakaruna RS. Seasonal dynamics of spinose ear tick Otobius megnini associated with horse otoacariasis in Sri Lanka. Acta Trop 2016;159:170–175. doi:10.1016/j.actatropica.2016.03.025.

192


Rev Mex Cienc Pecu 2021;12(1):177-193

39. Crosbie P, Goff W, Stiller D, Jessup D. The distribution of Dermacentor hunteri and Anaplasma sp. in desert bighorn sheep (Ovis canadensis). Med Vet Entomol 1997;83:31–37. 40. De la Fuente J, Atkinson MW, Hogg JT, Miller DS, Naranjo V, Almazán C, et al. Genetic characterization of Anaplasma ovis strains from bighorn sheep in Montana. J Wildl Dis 2006;42:381–385. doi:10.7589/0090-3558-42.2.381. 41. Stiller D, Crosbie PR, Boyce WM, Goff WL. Dermacentor hunteri (Acari: Ixodidae): an experimental vector of Anaplasma marginale and A. ovis (Rickettsiales:Anaplasmataceae) to calves and sheep. J Med Entomol 1999;36:321–324. 42. Yabsley MJ, Davidson WR, Stallknecht DE, Varela AS, Swift PK, Devos JC, et al. Evidence of tick-borne organisms in mule deer (Odocoileus hemionus) from the Western United States. Vector Borne Zoonotic Dis 2005;5:351–362. 43. Bloemer SR, Zimmerman RH, Fairbanks K. Abundance, attachment sites, and density estimators of lone star ticks (Acari:Ixodidae) infesting white-tailed deer. J Med Entomol 1988;25:95–300. doi:10.1093/jmedent/25.4.295. 44. L’Hostis M, Diarra O, Seegers H. Sites of attachment and density assessment of female Ixodes ricinus (Acari:Ixodidae) on dairy cows. Exp Appl Acarol 1994;18:681–689. doi:10.1007/BF00051535 45. Coronel-Benedett KC, Ojeda-Robertos NF, Gonzalez-Garduño R, Martinez- Ibañez F, Rodriguez-Vivas RI. Prevalence , intensity and population dynamics of hard ticks (Acari :Ixodidae ) on sheep in the humid tropics of Mexico. Exp Appl Acarol 2018:74:99-105. 46. Kiffner C, Lödige C, Alings M, Vor T, Rühe F. Body-mass or sex-biased tick parasitism in roe deer (Capreolus capreolus). A GAMLSS approach. Med Vet Entomol 2011;25:39–44. doi:10.1111/j.1365-2915.2010.00929.x 47. Han S, Hickling GJ, Tsao JI. High Prevalence of Borrelia miyamotoi among adult blacklegged ticks from white-tailed deer. Emerg Infect Dis 2016;22: 22–24. 48. Pound JM, George JE, Kammlah DM, Lohmeyer KH, Davey RB. Evidence for role of white-tailed deer (Artiodactyla: Cervidae) in epizootiology of cattle ticks and Southern cattle ticks (Acari:Ixodidae) in reinfestations along the Texas/Mexico border in South Texas: A Review and Update. J Econ Entomol 2010;103:211–218. doi:10.1603/EC09359

193


https://doi.org/10.22319/rmcp.v12i1.5267 Artículo

Detección de anticuerpos de Neospora spp. en caballos, asociados a diferentes factores de riesgo en México

Kenia Jasher Padilla-Díaz a Leticia Medina-Esparza a* Carlos Cruz- Vázquez a Irene Vitela-Mendoza a Juan F. Gómez-Leyva b Teódulo Quezada-Tristán c

a

Instituto Tecnológico El Llano Aguascalientes, Km 18 Carretera Ags-SLP., Municipio de El Llano, Ags., 20330, Aguascalientes, México. b

Universidad Autónoma Aguascalientes, México. C

de

Aguascalientes. Centro

de

Ciencias Agropecuarias,

Instituto Tecnológico de Tlajomulco, Tlajomulco de Zúñiga, Jalisco, México.

* Autor de correspondencia: lmedinaesparza@yahoo.com.mx

Resumen: Neospora spp. es un parásito protozoario causante de abortos y enfermedad del Sistema Nervioso Central (SNC) en diversas especies domésticas y silvestres. En equinos, se le ha involucrado como causa de aborto, mortalidad neonatal y enfermedades del SNC. La especie identificada en equinos es distinta a Neospora caninum y se denomina Neospora hughesi. El objetivo del presente, fue detectar la presencia de anticuerpos anti-Neospora spp., asociados a factores de riesgo en caballos de México. Se realizó una encuesta de cada cuadra y animales individuales de

194


Rev Mex Cienc Pecu 2021;12(1):194-204

cuatro regiones del país (Centro, Norte, Occidente y Sur) para identificación de los factores de riesgo. Se obtuvo un total de 684 muestras de sueros de caballos de las diferentes regiones, 52.3 % (358) machos y 47.7 % (326) hembras. Los sueros fueron conservados a -20 °C. El diagnóstico se realizó mediante la técnica de inmunofluorescencia indirecta (IFI), los resultados de este fueron analizados para estimar la asociación entre la seropositividad y los factores de riesgo. La seroprevalencia a Neospora spp. fue de 2.34 % en la población estudiada; los casos positivos se encontraron principalmente en tres de las cuatro regiones incluidas, que presentaron una relación significativa a la presencia de anticuerpos anti-Neospora spp.; la convivencia de los caballos con otros animales obtuvo un valor de OR de 2.34 (IC 95%: 0.28 - 19.0; P<0.04). Se concluye que, Neospora spp., está presente en los caballos de México. Palabras clave: Neospora hughesi, Neospora spp., Equinos, Caballos, Factores de riesgo.

Recibido: 19/02/2019 Aceptado: 12/03/2020

Introducción La neosporosis fue asociada por primera vez en caballos al reportarse la evidencia de Neospora caninum en un feto tardío y en la placenta(1); el segundo caso, fue en un potro de un mes de edad, que presentó ceguera congénita y desórdenes neurológicos(2). Estudios moleculares, antigénicos y estructurales demuestran que la especie aislada en caballos con problemas neurológicos es diferente a la reportada, y la denominan Neospora hughesi(3). Las especies caninum y hughesi son protozoarios intracelulares obligados del género Neospora, pertenece al Phylum Apicomplexa, clase Sporozoea, orden Eucoccidiida, familia Sarcocystidae(4). La N. caninum en caballos ha sido asociada a abortos y problemas reproductivos(5-8), mientras que N. hughesi está relacionada con enfermedades neurológicas(9-11), también, asociada con Sarcosystis neuronae, causante de mieloencefalitis protozoaria equina (MPE), identificada como una enfermedad neurológica grave de los caballos, que produce pérdidas significativas en la producción equina, principalmente reportado en Estados Unidos(12). Los hospederos definitivos de N. caninum identificados son el perro doméstico(13), coyote(14), dingo australiano(15) y lobo gris(16), y como hospederos intermediarios varias especies silvestres y domésticas(17), sin embargo, los hospederos definitivos de N. hughesi, no se han identificado y el caballo es considerado como único hospedero intermediario potencial(18). La infección puede

195


Rev Mex Cienc Pecu 2021;12(1):194-204

ocurrir debido a la ingestión de ooquistes esporulados en alimento o agua contaminados; con respecto a la transmisión vertical actualmente es considerada solo como ruta alternativa(19,20). Las técnicas serológicas utilizadas para la identificación de anticuerpos de Neospora spp., son: técnica de inmunofluorescencia indirecta (IFI), ensayo inmunoenzimático (ELISA), test de aglutinación de Neospora (TAN), Western blot (WB), manejan taquizoítos de N. caninum como antígeno, el uso de éste supone seropositividad para Neospora spp., debido a la reacción cruzada que presenta el parásito(21), solo la biotecnología del ADN se utiliza para distinguir N. hughesi de N. caninum(22). El objetivo del estudio fue detectar la presencia de anticuerpos anti-Neospora spp., asociados a factores de riesgo en caballos de México.

Material y métodos Lugar de estudio Para este estudio se seleccionaron cuatro regiones de México según sus características geográficas y climáticas: Región Centro, Región Norte, Región Occidente, y Región Sur (Figura 1). Figura 1: División geográfica de México por regiones de estudio

196


Rev Mex Cienc Pecu 2021;12(1):194-204

Diseño del trabajo Se realizó un estudio epidemiológico de tipo transversal, durante el periodo comprendido del mes de octubre de 2016 a octubre de 2017. Se llevó a cabo en dos etapas; de campo y de laboratorio. Durante la etapa de campo se colectaron 5 ml de sangre completa en tubos vacutainer sin anticoagulante (BD Vacutainer®) por punción de la vena yugular de caballos aparentemente sanos, obteniendo un total de 684 muestras de las cuales correspondieron 75 a la Región Centro (10.96 %), 54 a la Región Norte (7.89 %), 298 a la Región Occidente (43.57 %) y 257 a la Región Sur (37.57 %). A todos los animales que fueron muestreados se les realizó un examen físico para determinar su estado de salud, y se aplicó una encuesta a los propietarios de los caballos, la cual consistió en recabar información de las características generales de los animales (raza, edad, sexo y estado reproductivo) y sobre el manejo especifico de la cuadra (uso de caballos, alimentación, alojamiento, fuentes de agua y contacto con otros animales). Las muestras de sangre obtenidas, se transportaron al laboratorio en refrigeración a 4.0 °C, donde fueron centrifugadas a 3,500 rpm durante 10 min para obtener el suero, el cual posteriormente fue separado con una pipeta de transferencia a tubos EppendorfTM de 1.5 ml, los cuales se almacenaron a -20 °C hasta su análisis.

Prueba serológica La técnica de IFI, se realizó mediante un kit comercial para detectar anticuerpos IgG circulantes específicos de Neospora spp., utilizando laminillas antigenadas con taquizoitos de N. caninum cepa NC-1, (SLD-IFA-NC) y conjugado anti-equine IgG marcado con isotiacianato de fluoresceína (FITC-Conjugate VMRD). Las muestras de suero se diluyeron 1:25 en solución salina tamponada con fosfato (PBS). Se usó un control positivo y negativo como estándar, realizando la técnica de acuerdo con las recomendaciones del fabricante. Todos los sueros que presentaron fluorescencia en la dilución inicial se consideraron positivos y se diluyeron aún más hasta el punto final del título. La dilución más alta del suero que presenta fluorescencia se consideró como el título de punto final en esta técnica.

Análisis de los datos Los datos generados a través de la encuesta (variables independientes) y los resultados positivos a la presencia de anticuerpos de Neospora spp. (variable dependiente) fueron analizados por el Software Estadístico STATA versión 10. Se obtuvo la distribución de la seroprevalencia con las variables independientes. La asociación entre la seroprevalencia de N. caninum en caballos y la presencia de otros animales, se realizó mediante un modelo de regresión logística (Ji cuadrada),

197


Rev Mex Cienc Pecu 2021;12(1):194-204

considerando P<0.05. Finalmente se calcularon las razones de probabilidad (OR) entre los resultados positivos, los resultados negativos y la relación con el intervalo de confianza.

Resultados Se detectó la presencia de anticuerpos anti-Neospora spp. en muestras de suero de caballos analizados mediante la técnica de IFI (Nc-1 Neospora caninum); las muestras de suero que presentaron títulos en una dilución de 1:50 fueron consideradas positivas. La seroprevalencia general obtenida fue de 2.34 % (16/684). En base al total de animales seropositivos a Neospora spp, se analizó la variable estado reproductivo; donde el 50 % (8/16) de los animales presentaron anticuerpos anti-Neospora spp, en diferentes niveles de dilución, mayores al punto de corte (1:50), en el Cuadro 1, se observa que, en los machos enteros (4/16), la dilución máxima fue de 1:200, sin embargo, las hembras gestantes (3/16) alcanzaron diluciones de 1:200 y dos de ellas 1:400.

Cuadro 1. Porcentaje de niveles de titulación de anticuerpos de Neospora spp. según diluciones seriadas mediante la técnica de IFI Títulos Animales 1:50 1:100 1:200 1:400 Castrado 18.75 (3/16) Entero 25.00 (4/16) 18.75 (3/16) 6.25 (1/16) Potranca 6.25 (1/16) Yegua 12.50 (2/16) Gestante 18.75 (3/16) 18.75 (3/16) 18.75 (3/16) 12.50 (2/16) Vacía 6.25 (1/16) Recién parida 12.50 (2/16) 12.50 (2/16) Total 100.0 (16/16) 50.00 (8/16) 25.00 (4/16) 12.50 (2/16) Las variables de la encuesta incluidas en el estudio, se analizaron para identificar los posibles factores de riesgo asociados a la presencia de anticuerpos anti-Neospora spp. Los resultados se presentan en el Cuadro 2, observándose que, el mayor número de casos positivos (62.50 %) fue en caballos de la región occidente, en la centro, de 6.25 %, sur 31.25 % y en la región norte no hubo casos positivos, esta variable no tuvo significancia estadística (P<0.05). Del total de animales positivos a la presencia de anticuerpos anti- Neospora spp. el 43.75 % fueron machos y el 56.25 % hembras. Para la variable convivencia de los caballos con otros animales se observó un OR de 2.34 (IC 95%: 0.28 - 19.0; P=0.04). Mientras que las variables uso de los caballos y alojamiento mostraron valores de P<0.20, al ser analizadas con regresión logística la variable

198


Rev Mex Cienc Pecu 2021;12(1):194-204

alojamiento obtuvo un OR de 3.12. Las variables edad, raza, estado reproductivo y fuente de agua no presentaron significancia estadística (P>0.05). Cuadro 2: Distribución de Neospora spp. en sueros positivos y negativos en caballos de México y los factores asociados Variable Región: Centro Norte Occidente Sur Sexo: Macho Hembra Edad: Joven (7-24 m) Adulto (25-48 m) Viejo (>48 m) Raza: Criollo Puro Estado reproductivo: Entero Castrado Potranca Yegua Gestante Vacía Recién Parida Uso de los caballos: Competencia No competencia Alimentación: Forraje Pastoreo Mixto Alojamiento: Caballeriza Potrero Conviven otros

Muestras N %

Neospora spp. + -

75 54 298 257

10.96 7.89 43.57 37.57

1 (6.25) 0 (0.00) 10 (62.50) 5 (31.25)

74 54 288 252

358 326

52.34 47.66

7 (43.75) 9 (56.25)

351 317

68 375 241

9.94 54.82 35.23

1 (6.25) 10 (62.50) 5 (31.25)

67 365 236

262 422

38.30 61.70

6 (37.50) 10 (62.50)

256 412

293 65 26 121 53 115 11

42.84 9.50 3.80 17.69 7.75 16.81 1.61

4 (25.00) 3 (18.75) 1 (6.25) 2 (6.25) 3 (18.75) 1 (6.25) 2 (12.50)

329 355

48.10 51.90

6 (37.50) 10(62.50)

323 345

325 269 90

47.51 39.33 13.16

9 (56.25) 4 (25.00) 3 (18.75)

316 265 87

340 344

49.71 50.29

8 (50.00) 8 (50.00)

332 336

199

289 62 25 119 50 114 9

P-value OR (CI 95%)

0.36

0.79 (0.49-1.29)

0.49

0.45 (0.03-6.18)

0.21

1.09 (0.47-2.51)

0.68

1.09 (0.22-5.40)

0.13

0.69 (0.32-1.49)

0.10

0.25 (0.04-1.35)

0.06

1.14 (0.27-4.76)

0.20

3.12 (0.49-21)

0.04

2.34 (0.28-19)


Rev Mex Cienc Pecu 2021;12(1):194-204

animales: Si No Fuentes de agua: Pozo abierto Bordo

598 86

87.43 12.57

15 (93.75) 1 (6.25)

583 85

341 343

49.85 50.15

8 (50.00) 8 (50.00)

333 335

0.78

0.86 (0.31-2.41)

Total

684

100.00

16 (100.00)

668

-

-

Discusión La neosporosis en caballos ha sido reportada a nivel mundial con diferente seroprevalencia(23-26). En el presente estudio se detectó el 2.34 % de anticuerpos anti-Neospora spp. en caballos de cuatro regiones de México. Otros estudios han reportado seroprevalencias similares al presente, en Brasil del 2.5 % y 4.1 % a la presencia de Neospora spp.(6,18), Costa Rica el 3.5 %, Nineveh región de Iraq 3.7 % y en Durango, México reportaron una seroprevalencia del 3 % a la presencia de anticuerpos anti-N. hughesi(27-29), sin embargo se han reportado seroprevalencias más altas a la presencia de anticuerpos anti- Neospora caninum en Estados Unidos 34 %, Irán 20 %, Brasil 48.27 % y Perú 12 %(23-26). La importancia de detectar en caballos la presencia de anticuerpos anti- Neospora spp., contribuye con la aportación del estado epidemiológico que guarda esta enfermedad en México, y en esta especie que representa un sistema productivo importante en las explotaciones pecuarias. La seroprevalencia a Neospora spp. detectada en hembras y machos fue de 2.7 % y 2.0 % respectivamente. Estudios en Brasil reportaron un 4.3 % en hembras y 3.7 % en machos(6); a diferencia de los resultados de Israel que fueron el 13,0 % en machos y 10.9 % en hembras(8), coincide con lo reportado en Brasil, que a pesar de no ser estadísticamente significativo, se debe observar que tienen similitud de riesgo de infección tanto hembras como machos. Los caballos que participaron en el presente estudio, fueron de diferentes regiones de México, observándose que las regiones occidente y sur presentaron un mayor porcentaje de caballos positivos a la presencia de anticuerpos anti-Neospora spp. en comparación de la región centro y norte. Estudios similares reportaron que en Brasil hubo variaciones 5.6 % y 2.6 % en las regiones costeras y de las montañas respectivamente(6); en Jordania también se documenta la presencia del parásito en los caballos de acuerdo a su ubicación(30), esto podría sugerir la influencia de la presencia de Neospora spp. en caballos por su localización geográfica y el clima de cada región. En este estudio se obtuvo un OR de 1.1 para las variables edad, raza y alimentación, no observándose diferencia estadística. Estos resultados coinciden con los reportes de Israel(8), Brasil(25), Jordania(30) e Italia(31), y se puede considerar que estas variables, aunque no sean

200


Rev Mex Cienc Pecu 2021;12(1):194-204

estadísticamente significativas, la importancia biológica como factor de riesgo es mayor con su incremento, aumenta la probabilidad de adquirir la infección de este parásito. Para la variable tipo de alojamiento el OR obtenido fue de 3.12 en este estudio, coincidiendo con lo reportado en Israel(8), considerándose como un factor de riesgo para aumentar la probabilidad de infección a Neospora spp. La variable convivencia con otros animales asociada a la presencia de Neospora spp., el OR obtenido fue 2.34 (P<0.05), coincidiendo con diversos estudios realizados principalmente en Brasil(5,6,25), que analizaron la misma variable con un OR 1.35 (P<0.05). Estos resultados indican, que la presencia de otros animales aumenta el riesgo de los caballos a adquirir el parásito Neospora spp.

Conclusiones e implicaciones En este estudio se identificaron anticuerpos anti Neospora spp. en los caballos de las regiones estudiadas, lo que implica el riego de la presencia de Neosporosis en las explotaciones equinas; de los casos positivos ninguno mostro signos clínicos característicos de la enfermedad. La variable convivencia con otros animales es el factor de riesgo que presentó mayor relación con la seropositividad, sin embargo, es necesario realizar un análisis considerando las diferentes categorías de cada variable. Se requiere realizar estudios que permitan identificar al huésped definitivo para conocer mejor el mecanismo de transmisión de la enfermedad a los caballos, e identificar de manera precisa la especie de Neospora presente en caballos. Agradecimientos Se agradece a los propietarios de los animales incluidos en el estudio por las facilidades prestadas para el desarrollo del trabajo. Literatura citada: 1.

Dubey JP, Porterfield, ML. Neospora caninum (Apicomplexa) in an aborted equine fetus. Int J Parasitol 1990;76:732-734.

2.

Lindsay DS, Steinberg H, Dubielzig RR, Semrad SD, Konkle DM, Miller PE, et al. Central nervous system neosporosis in a foal. J Vet Diagn Invest 1996;8:507–510.

3.

Marsh AE, Barr BC, Packham AE, Conrad PA. Description of a new Neospora species (Protozoa: Apicomplexa: Sarcocystidae). J Parasitol 1998;84(5):983–991.

4.

Goodswen SJ, Kennedy PJ, Ellis JT. A review of the infection, genetics, and evolution of Neospora caninum: from the past to the present. Infect Genet Evol 2013;13:133–150.

201


Rev Mex Cienc Pecu 2021;12(1):194-204

5.

Abreu RA, Weiss RR, Thomaz-Soccol V, Locatelli-Dittrich R, Laskoski LM, Bertol MA, et al. Association of antibodies againts Neospora caninum in mares with reproductive problems and presence of seropositive dogs as a risk factor. Vet Parasitol 2014;202(34):128-131.

6.

Moura AB, Silva MO, Farias JA, Vieira-Neto A, Souza AP, Sartor AA. Neospora spp. antibodies in horses from two geographical regions of the states of Santa Catarina, Brazil. Rev Bras Parasitol Vet 2013;22(4): 597-601.

7.

Veronesi F, Diaferia M, Mandara MT, Marenzoni ML, Cittadini F, Piergili-Fioretti DP. Neospora spp. infection associated with equine abortion and/or stillbirth rate. Vet Res Commun 2008;32: 223-226.

8.

Kligler EB, Shkap V, Baneth G, Mildenberg Z, Steinman A. Seroprevalence of Neospora spp. among asymptomatic horses, aborted mares and horses demonstrating neurological signs in Israel. Vet Parasitol 2007;148:109-113.

9.

Renier AC, Morrow JK, Graves AJ, Finno CJ, Howe DK, Owens SD, et al. Diagnosis of equine protozoal myeloencephalitis using indirect fluorescent antibody testing and enzymelinked immunosorbent assay titer ratios for Sarcocystis neurona and Neospora hughesi. J Equine Vet Sci 2016;36:49–51.

10. Antonello AM, Pivoto FL, Camillo G, Braunig P, Sangioni LA, Pompermayer E, et al. The importance of vertical transmission of Neospora sp. in naturally infected horses. Vet Parasitol 2012;187:367–370. 11. Finno CJ, Eaton JS, Alemán M. Hollingsworth SR. Equine protozoal myeloencephalitis due to Neospora hughesi and equine motor neuron disease in a mule. Vet Ophthalmol 2010;13(4):259-265. 12. Dubey JP, Calero-Bernal R, Rosenthal BM, Speer CA, Fayer R. Sarcocystosis of animals and humans. 2nd ed. Boca Raton, Florida: CRC Press.; 2016. 13. McAllister MM, Dubey JP, Lindsay DS, Jolley WR, Wills RA, McGuire AM. Rapid communication: Dogs are definitive hosts of Neospora caninum. Int J Parasitol 1998;28(9):1473–1499. 14. Gondim LFP, McAllister MM, Pitt WC, Zemlicka DE. Coyotes (Canis latrans) are definitive hosts of Neospora caninum. Int J Parasitol 2004;34:159-166. 15. King JS, Slapeta J, Jenkins DJ, Al-Qassab SE, Ellis JT, Windsor PA. Australian dingoes are definitive hosts of Neospora caninum. Int J Parasitol 2010;40:945–950.

202


Rev Mex Cienc Pecu 2021;12(1):194-204

16. Dubey JP, Jenkins MC, Rajendran C, Miska K, Ferreira LR, Martins J, et al. Gray wolf (Canis lupus) is a natural definitive host for Neospora caninum. Vet Parasitol 2011;181:382– 387. 17. Dubey JP, Schares G. Neosporosis in animals-the last five years. Vet Parasitol 2011;180:90– 108. 18. Hoane JS, Gennari SM, Dubey JP, Ribeiro MG, Borges AS, Yai LE, et al. Prevalence of Sarcocystis neurona and Neospora spp. infection in horses from Brazil based on presence of serum antibodies to parasite surface antigen. Vet Parasitol 2006;136:155-159. 19. Dubey JP, Hemphill A, Calero-Bernal R, Schares G. Neosporosis en animales. Boca Raton, Florida: CRC Press.; 2017. 20. Pusterla N, Conrad PA, Packham AE, Mapes SM, Finno CJ, Gardner IA, et al. Endogenous transplacental transmmission of Neospora hughesi in naturally infected horses. J Parasitol 2011;97:281–285. 21. Gondim LF, Lindsay DS, McAllister MM. Canine and bovine Neospora caninum control sera examined for cross-reactivity using Neospora caninum and Neospora hughesi indirect fluorescent antibody tests. J Parasitology 2009;95(1):86-88. 22. Al-Qassab S, Reichel MP, Ivens A, Ellis JT. Genetic diversity amongst isolates of Neospora caninum, and the development of a multiplex assay for the detection of distinct strains. Mol Cell Probes 2009;23:132-139. 23. James KE, Smith WA, Conrad PA, Packham AE, Guerrero L, Ng M, et al. Seroprevalence of Sarcocystis neurona and Neospora hughesi among healthy horses in the United States. Proc Am Assoc Equine Pract. 2015;61:524. 24. Tavalla M, Sabaghan M, Abdizadeh R, Khademvatan S, Rafiei A, Razavi-Piranshahi A. Seroprevalence of Toxoplasma gondii and Neospora spp. infections in Arab horses, southwest of Iran. J J Microbiol 2015;8:e14939. 25. Cazarotto CJ, Balzan A, Grosskopf RK, Boito JP, Portella LP, Vogel FF, et al. Horses seropositive for Toxoplasma gondii, Sarcocystis spp. and Neospora spp.: Possible risk factors for infection in Brazil. Microb Pathog 2016;99:30–35. 26. Luza M, Serrano-Martínez E, Tantaleán M, Quispe M, Casas G. Primer reporte de Neospora caninum, en caballos de carrera de Lima, Perú. Salud Tecnol Vet 2013;1:40-45.

203


Rev Mex Cienc Pecu 2021;12(1):194-204

27. Dangoudoubiyam S, Oliveira JB, Víquez C, Gómez-García A, González O, Romero JJ. Detection of antibodies against Sarcocystis neurona, Neospora spp., and Toxoplasma gondii in horses from Costa Rica. J Parasitol 2011;97:522–524. 28. Al-Obaidii WA, Al-Kennany ER. Investigation of Neospora hughesi antibodies by using ELISA in horses in Nineveh Province. Assiut Veterinary Med J 2014;60:167–170. 29. Yeargan MR, Alvarado-Esquivel C, Dubey JP, Howe K. Prevalence of antibodies to Sarcocystis neurona and Neospora hughesi in horses from Mexico. Parasite 2013;20:29. 30. Talafha AQ, Abutarbush SM, Rutley DL. Seroprevalence and potential risk factors associated with Neospora spp. infection among asymptomatic horses in Jordan. Korean J Parasitol 2015;53:163-167. 31. Bártová E, Machacová T, Sedlák K, Budíková M, Mariani U, Veneziano V. Seroprevalence of antibodies of Neospora spp. and Toxoplasma gondii in horses from southern Italy. Folia Parasitol (Praha) 2015;62:043.

204


https://doi.org/10.22319/rmcp.v12i1.5377 Artículo

Desempeño productivo y costos de granjas porcinas con diferentes protocolos de vacunación al virus del PRRS

Elizabeth Araceli Quezada-Fraide a Claudia Giovanna Peñuelas-Rivas b Frida Saraí Moysén-Albarrán c María Elena Trujillo-Ortega d Francisco Ernesto Martínez-Castañeda c*

a

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán. Departamento de Ciencias Pecuarias. México. b

Kansas Smith Farms. EE.UU.

c

Universidad Autónoma del Estado de México. Instituto de Ciencias Agropecuarias y Rurales. México. d

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México.

*Autor de correspondencia: femartinezc@uaemex.mx

Resumen: Con el objetivo de evaluar el desempeño productivo y los costos de producción por lechón destetado y cerdo finalizado en granjas porcinas con diferentes protocolos de vacunación al virus del PRRS en condiciones de campo, se analizaron los indicadores total de lechones nacidos, nacidos vivos, mortinatos, destetados, pesos al nacimiento y al destete, días de engorda y peso final así como, los costos por lechón destetado y cerdo finalizado, de dos granjas en régimen de semitecnificación: a) Protocolo 1 (P1), granja con vacunación a reproductoras y a lechones; y b) Protocolo 2 (P2), vacunación únicamente a cerdas

205


Rev Mex Cienc Pecu 2021;12(1):205-216

reproductoras. Los indicadores productivos hasta el destete se evaluaron con un Diseño de Medidas repetidas en el tiempo y los de engorda con un Análisis de varianza con comparación de medias. Los costos se determinaron utilizando la fórmula general de costos. Fue posible observar diferencias en los lechones nacidos totales y momias (P<0.05) a favor del P2, de lechones destetados, pesos al nacimiento y al destete a favor del P1 y sin diferencia en el resto de variables. Los cerdos finalizados en P1 tuvieron 12 días más de engorda y un peso final de 3.13 kg más que P2. Los costos por lechón destetado fueron de $389.55 y $424.25 Pesos Mexicanos, y el costo medio por día de engorda fueron de $10.01 y $11.43, respectivamente. Palabras clave: Productividad, Costos, Cerdos, Vacunación, PRRS.

Recibido: 20/05/2019 Aceptado: 08/01/2020

Introducción El virus del Síndrome reproductivo y respiratorio porcino (PRRSV) del cerdo ha causado significativas pérdidas económicas en la industria porcina en todo el mundo(1). Las pérdidas van desde 75 mil euros en una granja de mil cerdas con una infección “ligera”, hasta pérdidas de 698 mil euros(2) y 664 millones de dólares al año en Estados Unidos(3). Es una enfermedad causada por un Arterovirus que emergió a finales de la década de los años ochenta en los EE.UU.(4) y posteriormente en Europa, se dispersó rápidamente y se volvió enzóotica en la población de cerdos del mundo entero(5). La enfermedad se presenta con una gran variedad de signos que reflejan la virulencia de la cepa y que se relacionan con la etapa fisiológica de los animales, su estado inmunológico y la presencia de otras enfermedades(5,6). El cuadro se presenta en dos fases; la primera tiene una duración aproximada de dos semanas, se caracteriza por una viremia aguda que causa anorexia y letargia, así como pirexia, taquipnea y disnea e hiperemia cutánea con extremidades cianóticas. La segunda fase, que puede iniciar antes que la primera se haya completado y puede durar hasta cuatro meses, se caracteriza por la falla reproductiva, principalmente en las cerdas que fueron infectadas durante su tercer tercio de gestación(5), mientras que genera un cuadro respiratorio en cerdos en crecimiento(7). La enfermedad es causada por un virus RNA del cual existen dos variedades; cepas clásicas (C-PRRSV) y cepas de alta virulencia (HP-PRRSV)(8). También se clasifica de acuerdo con sus variaciones genéticas y diferencias antigénicas en dos tipos; PRRSV-1, el tipo europeo y PRRSV-2, el tipo norteamericano(9). La salud de los animales se puede complicar cuando el

206


Rev Mex Cienc Pecu 2021;12(1):205-216

virus se asocia con otros patógenos como: Circovirus porcino tipo II (PCVII), Pasteurella multocida, Haemophilus parasuis, Bordetella bronchiseptica y Micoplasmas(10,11,12). Luego de producido el brote, la producción de la granja tiende a mejorar paulatinamente (de 4 a 6 meses), no alcanzando los niveles de producción anteriores al brote. Por otra parte, al quedar el PRRSV circulando, la granja queda expuesta a rebrotes de la enfermedad y a la persistencia del virus en la piara(12). Los resultados de las intervenciones para reducir el costo de la enfermedad, principalmente en las etapas de engorda han sido positivas, pero dejan y causan mayores pérdidas en la crianza. En 2005, las pérdidas en la piara reproductora de Estados Unidos fueron el 12 % del costo total del PRRS, mientras que, en 2011, el costo en el hato reproductor ascendió a 45 %(3). En este periodo se han implementado diferentes protocolos de intervención que incluyen vacunación, despoblación, protocolos de bioseguridad(13) entre otros. El impacto negativo del PRRS en el margen económico por cerdo producido ha estimulado los esfuerzos para controlar y eventualmente erradicar la enfermedad. El control del virus de PRRS descansa en aspectos como diagnóstico temprano y monitoreo, bioseguridad, manejo del hato e inmunización(14), sin embargo, estos métodos estándar de control no han sido efectivos toda vez que las vacunas no reducen la prevalencia de la enfermedad y muchos productores tienen que despoblar después de un brote(15). El PRRS es un modelo hospedero/virus en el cual la enfermedad se determina por la patogenicidad del virus, la susceptibilidad del hato reproductor y el fenotipo, la presión de co-infecciones bacterianas y las condiciones ambientales(16). Por lo anterior, el objetivo del presente trabajo fue evaluar el desempeño productivo y los costos de producción por lechón destetado y cerdo finalizado en granjas porcinas con dos protocolos de vacunación al virus del PRRS para determinar la eficacia de los mismos y cuál de estos ofrece al productor, mejores indicadores productivos y económicos.

Material y métodos El estudio se realizó en dos granjas, que, de acuerdo con la clasificación general tecnológica de la SAGARPA, corresponden a granjas semi-tecnificadas. Las granjas se localizan en el Altiplano. Una en el estado de Hidalgo con un clima templado seco, temperatura media anual de 14 ºC y precipitación pluvial anual de alrededor de 610 mm. La otra en el Estado de México con un clima templado semi-seco, temperatura media anual de 16 a 17 ºC y precipitación pluvial anual de alrededor de 600. El número de cerdas reproductoras fue de 480 y 180 respectivamente. Los datos analizados se tomaron de los registros individuales por

207


Rev Mex Cienc Pecu 2021;12(1):205-216

cerda. El periodo fue desde su primer parto hasta el último registrado, con corte a septiembre de 2017. en un lapso de su vida productiva, siendo el último dato registrado los partos del primer semestre de 2017. Los indicadores técnicos analizados fueron: lechones nacidos totales, lechones nacidos vivos, lechones nacidos muertos, momias, lechones destetados, peso de los lechones al nacimiento, peso de los lechones al destete, edad de los cerdos al rastro, peso de los cerdos al rastro. Las granjas tienen un diagnóstico positivo a PRRS desde 2003 y se implementa en ambas un calendario de vacunación. En el protocolo de vacunación 1 (P1) se consideró a la granja que vacuna a las cerdas reproductoras y a los lechones a los 21 días de edad, aproximadamente. En el protocolo de vacunación 2 (P2), se consideró a la granja que solo vacuna a las cerdas reproductoras. La vacunación de las cerdas reproductoras en ambas granjas es cada cuatro meses en “sábana”. Las dos utilizan una vacuna contra PRRS con virus vivo modificado y una dosis por animal de 2 ml. Ambas granjas tienen similar esquema de bioseguridad, genética y alimentación. Los análisis de costos se realizaron utilizando la modificación a la fórmula general de costos de Muñoz y Rouco(17). TC=F+V; donde: TC= costo de lechón destetado, F= costos fijos y V=costos variables. Los costos fijos se formaron por: F=L+S+Co+R+A+Fi+CO+Ot<, donde: L= costos laborales, S=costos de suministros, Co=costos de energía y combustible, R= reparación y mantenimiento, A= amortización de los activos fijos, CO= costos de oportunidad y Ot= otros costos menores. Los costos variable se conformaron por las partidas: V=((AR+AM+AV+AMV+AL+M+T+CO/(TOTCER*W))*z; donde: AR= costos de amortización de los reproductores, AM= alimentación de las cerdas, AMV= alimentación del verraco, AV= amortización del verraco, AL= alimentación de los lechones, M= medicaciones, T= transporte, CO= costos de oportunidad, TOTCER= número total de cerdas en la explotación, W= Factor de ponderación en virtud de que todos los costos variables se referirán a la unidad de producción de un lechón comercial y z=número de lechones destetados. La depreciación de los animales reproductores se calculó de la siguiente manera: AR=(PH-(PD-(1-MORR)))/(PARM/PAR)-REP; donde: PH= precio de compra de la cerda, PD= precio de desecho de la cerda, MORR= mortalidad de reproductoras expresado en porcentaje, PARM= número promedio de partos de las cerdas, PAR= número de partos por cerda y año, y REP=reemplazos de reproductoras.

208


Rev Mex Cienc Pecu 2021;12(1):205-216

El promedio de nacimientos por hato reproductor puede ser calculado en cualquier momento de la producción, sin importar la etapa fisiológica en que se encuentren las cerdas. PARM = ∑(CER * n)/TOTCER; donde: CER= el número de cerdas y n= número de parto. PAR=365/(114,5+LAC+INT)*(1-NAB+VAC/CUB)), LAC= duración de la lactancia, INT= intervalo destete-cubrición fértil, NAB= número total de abortos, VAC= número de cerdas vacías, CUB= número de cubriciones realizadas. A su vez, INT está formado por la suma de los intervalos destete primera cubrición (INT1), p. 100 de primeras repeticiones*21 (INT2), p. 100 segundas repeticiones*42 (INT3), p. 100 de terceras repeticiones*63 (INT4) y p. 100 de repeticiones acíclicas días medios de aparición. REP=PAR/PARM y el factor de ponderación es: w = PAR * VIV * (1 - MOR)*(1-MORT); donde: PAR= número de partos por cerda y año, VIV= lechones nacidos vivos por parto, MOR= mortalidad en lactación, MORT= mortalidad en transición destete-lechón comercial expresada en puntos porcentuales. Para el cálculo de costos de cerdo cebado las fórmulas son: F= F=L+S+Co+R+A+Fi+CO+Ot, aplicable para el proceso de engorda y V=((M+AL+CO)/w)*z, aplicable al proceso de engorda, donde z es el número de lechones engordados. Para determinar las diferencias en productividad de las cerdas por parto (paridad) y por tipo de protocolo de vacunación, se utilizó un diseño de medidas repetidas en el tiempo. Se determinó la mejor estructura de covarianza y para determinar la significancia se utilizó una prueba de Tuckey ajustada(18). Por su parte, para los datos productivos de la engorda, se utilizó un análisis de varianza para las variables días a venta y peso al sacrificio. Para determinar las diferencias en ingresos, se utilizó como medida 1 lechón destetado y 1 kilogramo de cerdo engordado. El precio para el cálculo fue de $28.00 M/N. En el caso de el lechón destetado se utilizó un valor medio de $800.00 M/N.

Resultados Las dos granjas analizadas presentaron similares niveles tecnológicos, de genética de los animales, de alimentación, de manejo productivo y sanitario, a excepción de los protocolos de vacunación contra PRRS. El Cuadro 1 resume el desempeño productivo de las cerdas reproductoras y sus lechones entre protocolos de vacunación. Destaca que a pesar de que el Protocolo 2 (P2) fue mejor en el número de lechones nacidos totales (P<0.05) el número de lechones destetados fue favorable (P<0.05) para el Protocolo 1 (P1).

209


Rev Mex Cienc Pecu 2021;12(1):205-216

Cuadro 1: Comparación de resultados del protocolo de vacunación Protocolo 1 (n=1658) 2 (n=972) Lechones nacidos totales P<0.0006 10.880.10 11.430.12 Lechones nacidos vivos P>0.05 10.130.13 10.080.15 Mortinatos P>0.05 0.500.04 1.000.12 Momias P<0.0001 0.340.03 0.500.03 Lechones destetados P<0.0001 8.940.08 8.310.09 Peso camada al P<0.0001 14.110.13 12.440.10 nacimiento Peso camada al destete P<0.0005 52.330.52 49.530.59 En este sentido, el número de lechones nacidos totales por paridad solo fue diferente en cerdas en su primer parto (P<0.05) con valores de 10.14  0.11 y 11.28  0.16 para los protocolos 1 y 2, respectivamente. Con respecto a las paridades (Cuadros 2 y 3), se observaron diferencias en el número de momias en la paridad uno (0.36  0.03 y 0.66  0.05) y paridad cinco (0.36  0.03 y 0.66  0.05); el número de lechones destetados en las paridades dos (9.19  0.11 y 8.01  0.14) y paridad tres (9.30  0.13 y 7.89  0.17) a favor del P1. En relación con los pesos de la camada al nacimiento, el desempeño fue mejor para P1 en las paridades uno a la cinco. El peso de la camada al destete, sin embargo, solo fue diferente, a favor de P1 en las paridades una a la tres.

T LT

LV

MR

Cuadro 2: Desempeño reproductivo en el tiempo (paridad 1 a 4) Número de paridad 1 2 3 4 1 2 1 2 1 2 1 (n=493) (n=261) (n=401) (n=204) (n=284) (n=160) (n=208) 10.140 11.280 10.840 10.860 11.380 11.540 11.560 .11 .16 .16 .18 .15 .20 .17 P<0.0001 P>0.05 P>0.05 P>0.05 9.390. 9.650. 10.440 9.590. 10.570 10.530 10.560 17 23 .19 26 .22 .29 .26 P>0.05 P>0.05 P>0.05 P>0.05 0.380. 0.930. 0.310. 0.810. 0.460. 1.120. 0.460. 03 07 03 12 06 19 05 P>0.05 P>0.05 P>0.05 P>0.05

210

2 (n=125) 11.770 .23 10.340 .33 0.950. 09


Rev Mex Cienc Pecu 2021;12(1):205-216

MM 0.360. 03 P<0.0001 LD 8.700. 10 P>0.05 PN 13.550 .14 P<0.0001 PD 51.800 .59 P<0.0001

0.660. 05

0.320. 04 P>0.05 8.270. 9.190. 14 11 P<0.0001 12.490 14.700 .20 .16 P<0.0001 46.210 55.180 .81 .66 P<0.0001

0.430. 05

0.380. 04 P>0.05 8.010. 9.300. 14 13 P<0.0001 12.400 14.770 .22 .19 P<0.0001 46.340 55.470 .92 .78 P<0.0001

0.530. 06

0.510. 05 P>0.05 7.890. 9.230. 17 15 P>0.05 12.790 14.690 .25 .21 P<0.0001 46.941 54.360 .03 .90 P>0.05

0.550. 07 8.460. 20 12.820 .28 50.391 .16

T= tratamientos; LT= lechones nacidos totales; LV= lechones nacidos vivos; MR= mortinatos; MM= momias; LD= lechones destetados; PN= peso de la camada al nacimiento; PD= peso de la camada al destete.

T LNT LNV MOR MOM LD PCN PCD

Cuadro 3: Desempeño reproductivo en el tiempo (paridad 5 a 7) Número de paridad 5 6 7 1 (n=144) 2 (n=98) 1 (n=93) 2 (n=76) 1 (n=34) 11.230.21 11.710.26 10.900.26 11.700.29 10.100.42 P>0.05 P>0.05 P>0.05 10.240.31 10.400.38 10.240.39 10.050.43 9.200.62 P>0.05 P>0.05 P>0.05 0.470.06 1.080.12 0.530.08 1.130.15 0.890.23 P>0.05 P>0.05 P>0.05 0.360.03 0.660.05 0.320.04 0.360.09 0.180.12 P<0.006 P>0.05 P>0.05 9.050.18 8.670.22 8.460.23 8.590.25 8.670.37 P>0.05 P>0.05 P>0.05 14.550.26 12.330.31 13.620.32 12.730.36 12.890.53 P<0.0001 P>0.05 P>0.05 52.141.08 52.891.31 48.071.33 51.411.48 49.302.18 P>0.05 P>0.05 P>0.05

2 (n=48) 11.290.36 9.990.53 0.810.13 0.440.11 8.290.31 12.480.44 52.551.85

T= tratamientos; LNT= lechones nacidos totales; LNV= lechones nacidos vivos; MOR= mortinatos; MOM= momias; LD= lechones destetados; PCN= peso de la camada al nacimiento; PCD= peso de la camada al destete.

El número de lechones nacidos totales en la granja con el P1, registró un incremento en las paridades 2, 3, 4 y 5, con respecto al parto 1 (P<0.05). Los valores fueron: 10.14  0.11, 10.84  0.16, 11.38  0.15, 11.56  0.17 y 11.23  0.21, respectivamente. En la granja con el P2, no hubo diferencia en el indicador. El número de momias en P1, no presentó

211


Rev Mex Cienc Pecu 2021;12(1):205-216

diferencias, por su parte, el número de momias bajo P2 fue diferente (P<0.05) en los partos 1, 6 y 7. Los valores fueron de: 0.66  0.05 (parto uno), 0.43  0.05, 0.36  0.09 y 0.44  0.11. El desempeño en lechones destetados para P1 fue diferente en los partos 2 y 3 con respecto a parto 1, mientras que no se registraron diferencias en este indicador para los cerdos en P2. Los pesos al nacimiento en P1 registró una disminución en los partos 2, 3, 4 y 5 (P<0.05) y sin diferencia en P2. Finalmente, los pesos de la camada al destete se comportaron de manera regular, con diferencias en los lechones destetados bajo P1 en los partos 2 y 3, con relación a parto 1 y en P2, la diferencia se observó en la paridad cinco. Para el caso de engorda los días a venta registrados fueron de 181.08  5.01 y 168.81  4.81 para P1 y P2 respectivamente (P<0.05); el peso final fue de: 95.46  3.27 y 92.28  3.93 (P<0.05), respectivamente. Los costos de producción por lechón destetado en P1 fue de $389.55 pesos y de $424.25 para P2. El 93.62 % del total de los costos fueron costos variables en el P1 mientras que, en el P2, los costos variables fueron de 96.27 %. El costo en engorda fue de $1,812.81 en P1 y de $ 1,930.07 en P2. Con estos indicadores productivos, el costo medio por día de engorda fue de $10.01/día en P1 y $11.43/día en P2, respectivamente. El ingreso por lechón destetado fue de $410.45 M/N para el P1 y de $375.75 en el P2. Así mismo, para un cerdo finalizado, el ingreso fue de $860.07 y 653.77 M/N, respectivamente.

Discusión Al desglosar los datos por parámetro por granja y por paridad y comparándolos con el conglomerado de producción de PIC(19) para México, las granjas se encuentran 2.75 y 2.2 lechones nacidos totales menos, en las granjas con P1 y P2, respectivamente. En el número de lechones nacidos vivos la diferencia fue de -2.18 y 2.23, lechones destetados de -1.95 y -2.58, respectivamente. Estos datos de PIC corresponden al 10 % superior en producción, en términos de producción. Sin embargo, las granjas con P1 y P2, están abajo en 1.21 y 1.26, respectivamente, comparándolos con el 10 % con peor desempeño productivo(20). Igualmente, el peso al destete fue menor en las granjas analizadas: -470 y -360 g. Las diferencias en estos resultados en general sugieren que el PRRS al afectar a las reproductoras puede atravesar la placenta alrededor del día 70 de la gestación, provocando que se presenten partos prematuros, por un lado, y por el otro, una mayor cantidad de lechones nacidos muertos y momias. Igualmente, es posible registrar un aumento de mortalidad predestete, significando un menor número de lechones destetados(14,21). Aun

212


Rev Mex Cienc Pecu 2021;12(1):205-216

cuando la literatura menciona que una granja afectada en un lapso de seis meses regresa a una “relativa normalidad”(14), hay algunas granjas donde esta enfermedad se encuentra de forma crónica(21). El virus del PRRS crea sinergia con otros virus o bacterias que pueden ser la causa de mayor mortalidad en la lactancia(22). En un ciclo abierto, el virus del PRRS en granjas inestables puede ser detectado en todos los grupos de cerdos incluyendo a los lechones(16), lo que implica que se pueden presentar resultados adversos causados por el virus, aún incluyendo los protocolos de vacunación. En estudios donde se incluye la vacunación del virus del PRRS en cerdas multíparas y en cerdas primerizas, se ha demostrado que se confiere una protección inmunológica pasiva a los lechones de hasta 84 días, independientemente de si los lechones son o no vacunados antes de este periodo(23). A pesar de que no se tiene muchos estudios de la protección a mayor edad, estos datos sugieren, susceptibilidad en los animales de engorda, toda vez que no sean inmunizados. En un estudio realizado en granjas estables con vacunación con virus vivo modificado de PRRS, se encontró, que existen algunas pérdidas y cambios negativos en los indicadores productivos de las cerdas(24). Se registró un ligero incremento en la tasa de mortalidad predestete y sin cambios significativos en la tasa de abortos, pérdidas neonatales, cerdos destetados por ceda e intervalo destete primer servicio. La vacunación en masa de todo el hato reproductor ha sido reportada como estrategia favorable de protección contra el virus del PRRS, incrementando en un lechón destetado por cerda al año(25); sin embargo, otros estudios sugieren que el cambio es mínimo(24) no hay diferencias significativas(26) e inclusive, se han reportado indicadores adversos(27). En cuanto al desempeño en la engorda, tomando como referencia los resultados promedio de PIC para México, la diferencia en edad fue de 18 días más para P1 y 6 días más para P2 y -23.63 kg para P1 y -26.81 kg para P2. El PRRS afecta a los cerdos en engorda produciendo enfermedades de tipo respiratorio con lesiones pulmonares, permitiendo que otras enfermedades virales o bacterianas como la Influenza, Streptococcus suis, Mycoplasma hyopneumoniae, Salmonella cholerasuis, Haemophilus parasuis, Pasteurella multocida, Circovirus porcino, Coronavirus porcino, Actinobacillus pleuroneumoniae(14,22) se asocien con ésta. Estas enfermedades reducen el crecimiento de los cerdos, la ganancia diaria disminuye y aumentan los días al rastro. Es importante resaltar que las granjas utilizadas en este estudio son granjas estables a PRRS de acuerdo a la Asociación Americana de Veterinarios de cerdos, y estos resultados no son aplicables a granjas libres de PRRS o a granjas PRRS positivas inestables.

213


Rev Mex Cienc Pecu 2021;12(1):205-216

A pesar de las diferencias en diferentes reportes científicos, después de 20 años de vacunación contra el virus de PRRS con vacunas de virus vivo modificado, ésta sigue brindando protección y los resultados han sido confirmados en 35 millones de cerdos a los que se les ha aplicado(28).

Conclusiones e implicaciones Como se ha mencionado, estos datos proveen información para alimentar modelos económicos que ayuden a especialistas en producción porcina y a productores, en la toma de decisiones con evidencias de campo, acerca del uso de la vacunación de PRRS como una estrategia preventiva. Si bien no se observaron significancias en las granjas que vacunan a las reproductoras, el costo por lechón destetado fue menor, $389.55 en el P1 que en el P2 $424.25. Para la etapa de engorda o finalización, vacunar tanto a las cerdas reproductoras como a los lechones bajo el P1, tuvo los mejores resultados tanto productivos como económicos. Agradecimientos y conflicto de intereses A los productores por su apoyo y disposición. Al CONACyT por la beca para la realización de los estudios de la MVZ Elizabeth Araceli Quezada Fraide. No existe ni existió conflicto de interés alguno. Literatura citada: 1. Lunney JK, Benfield D, Rowland RRR. Porcine reproductive and respiratory syndrome virus: an update on an emerging and re-emerging viral disease of swine. Virus Res 2010;154:1–6. 2. Nauthes H, Alarcon P, Rushton J, Jolie R, Fiebig K, Jimenez M, Geurts V. Cost of porcine reproductive and respiratory syndrome virus at individual farm level – An economic disease model. Prev Vet Med 2017;142:16-29. 3. Holtkamp DJ, Kliebenstein JB, Neumann EJ, Zimmerman JJ, Rotto HF, Yoder TK, et al. Assessment of the economic impact of porcine reproductive and respiratory syndrome virus on United States pork producers. J Swine Health Prod 2013;21(2):72-84. 4. Keffaber KK. Reproductive failure of unknown etiology. Amer Assoc Swine Pract 1989;1:1-10. 5. Zimmerman JJ, Karriker LA, Ramirez A, Schwartz KJ, Stevenson GW. Diseases of swine. 10th ed. USA: Wiley-Blackwell; 2012.

214


Rev Mex Cienc Pecu 2021;12(1):205-216

6. Wang G, Yu Y, He X, Wang M, Cai X. Zimmerman JJ. Porcine reproductive and respiratory syndrome virus infection of bone marrow: Lesions and pathogenesis. Vir Res 2019;265:20-29. 7. Oh T, Kim H, Park KH, Jeong J, Yang S, Kang I, Chae C. Comparison of four commercial PRRSV MLV vaccines inherds with co-circulation of PRRSV-1 and PRRSV-2. Comp Immunol Microbiol Infect Dis 2019;63:66-73. 8. Wang G, Yu Y, Zhang C, Tu Y, Tong J, Liu Yonggang, et al. Immune responses to modified live virus vaccines developed from classical or highly pathogenic PRRSV following challenge with highly pathogenic PRRSV strain. Dev Comp Immunol 2016;62:1-7. 9. Xie J, Christiaens I, Yang B, Van Breedam W, Cui T, Nauwynck H. Molecular cloning of porcine Siglec-3, Siglec-5 and Siglec-10, and identification of Siglec-10 as an alternative receptor for porcine reproductive and respiratory syndrome virus (PRRSV). J Gen Virol 2017;98:2030-2042. 10. Yin SH, Xiao CT, Gerber PF, Beach NM, Meng XJ, Halbur PG, Opriessnig T. Current porcine circovirus type 2a (PCV2a) or PCV2b infection increases the rate of amino acid mutations of porcine reproductive and respiratory syndrome virus (PRRSV) during serial passages in pigs. Vir Res 2013;178:445-451 . 11. Li J, Wang S, Li C, Wang C, Liu Y, Wang G, et al. Secondary Haemophilus parasuis infection enhances highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) infection-mediated inflammatory responses. Vet Microbiol 2017;204:35-42. 12. Willis RW, Zimmerman JJ, Yoon KJ, Swenson SL, McGinley MJ, et al. Porcine reproductive and respiratory syndrome virus: a persistent infection. Vet Microbiol 1997;55,231-240. 13. Silva GS, Corbellini LG, Linharesa DLC, Bakera KL, Holtkamp DJ. Development and validation of a scoring system to assess the relative T vulnerability of swine breeding herds to the introduction of PRRS virus. Prev Vet Med 2018;160:116-122. 14. Pileri E, Mateu E. Review on the transmission porcine reproductive and respiratory syndrome virus between pigs and farms and impact on vaccination. Vet Res 2016;47:108-121. 15. Prather RS, Whitworth KM, Schommer SK, Wells KD. Genetic engineering alveolar macrophages for host resistance to PRRSV. Vet Micriobiol 2017;209:124-129.

215


Rev Mex Cienc Pecu 2021;12(1):205-216

16. Drigo M, Giacomini E, Lazzaro M, Pasotto D, Bilato D, Rueggeri J, Boniotti MB, Alborali GA, Amadori M. Comparative evaluation of immune responses if swine in PRRS-stable unstable herds. Vet Immunol Immunopatol 2018;200:32-39. 17. Muñoz LA, Rouco YA. Análisis de costos de producción de lechón comercial en explotaciones tipo de la Región de Murcia. Archiv Zoot 1995;44:391-402. 18. Kramer CY. Extension of multiple range tests to group means with unequal numbers of replications. Biometrics 1956;12:307–310. 19. PIC. Análisis de la industria porcina en Latinoamérica. PIC 2017;15:1-20. 20. PigCHAMP Magazine. Benchmark. 2016. USA. 21. Morilla A. Manual para el control de las enfermedades infecciosas de los cerdos. 2a ed. ed. México: Manual Moderno; 2005. 22. Schwartz KJ. Swine disease manual. Third ed, Perry, USA: American Association of Swine Practitioners 2005. 23. Kittiwan N, Yamsakul P, Tadee P, Tadee P, Nuangmek A, Chuammitri P, Patchanee P. Immunological response to porcine reproductive and respiratory syndrome virus in young pigs obtained from a PRRSV-positive exposure status herd in a PRRSV endemic area. Vet Immunol Immunopat 2019;218: 09935. 24. Moura CAA, Johnson C, Baker SR, Holtkamp DJ, Wang C, Linhares DCL. Assessment of immediate production impact following attenuated PRRS type 2 virus vaccination in swine breeding herds. Porc Health Manag 2019;5:13. 25. Linhares DCL, Johnson C, Morrison RB. Economic analysis of immunization strategies for PRRS control. PLoS One. 2015;10(12): e0144265. 26. Eclercy J, Renson P, Lebret A, Hirchaud E, Normand V, Andraud M, et al. A field recombinant strain derived from two type 1 porcine reproductive and respiratory syndrome virus (PRRSV-1) modified live vaccines shows increased viremia and transmission in SPF pigs. Viruses 2019;11(3). 27. Dewey CE, Wilson S, Buck P, Leyenaar JK. The reproductive performance of sows after PRRS vaccination depends on stage of gestation. Prev Vet Med 1999;40(3-4):233–241. 28. Jeong J, Choi K, Kang I, Park C, Chae C. Evaluation of a 20 year old porcine reproductive and respiratory syndrome (PRRS) modified live vaccine (Ingelvac1 PRRS MLV) against two recent type 2 PRRS virus isolates in South Korea. Vet Microb 2016;192:102-109.

216


https://doi.org/10.22319/rmcp.v12i1.5088 Artículo

Las funciones de las aves en la producción avícola de pequeña escala: el caso de una comunidad rural en Hidalgo, México

Ana Rosa Romero-López a*

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México.

*Autor de correspondencia: anarosa.romero.lopez@gmail.com

Resumen: En México, diversos estudios enfatizan que la importancia de la avicultura de pequeña escala en el ámbito rural recae en dos funciones que se les asignan a las aves: 1) aporte a la seguridad alimentaria y 2) generación de ingresos económicos. Pocos son los estudios que identifican y describen las funciones complementarias que tienen las aves en sistemas de producción de pequeña escala y la manera en que dicha especie contribuye al bienestar de la familia productora. En el presente estudio se identificaron y analizaron las funciones que las familias productoras le asignaban a la especie avícola en las 26 unidades de producción que poseían aves, de un total de 29, en la comunidad rural La Cuchilla, Hidalgo, México. Se encontró que las aves podían tener 6 diferentes funciones, no mutuamente excluyentes: nutrimental (26.9 %), medioambiental (24.4 %), cultural (17.9 %), económica (16.7 %), social (11.5 %) y de recreación (2.6 %). Cada una de las funciones contribuían al bienestar familiar en cinco diferentes esferas: seguridad alimentaria, disponibilidad de recursos económicos, reforzamiento de relaciones sociales, vinculación al mercado y transmisión de conocimientos vernáculos. Se concluye que las aves pueden tener una multifuncionalidad que va más allá de su aporte a la seguridad alimentaria (función nutrimental) y generación de recursos económicos (función económica). Las funciones de las aves pueden ser estrategias que los productores definen para alcanzar el bienestar familiar en cinco diferentes esferas. La comprensión integral del concepto de función es importante para el diseño de estrategias de desarrollo acordes a los objetivos y lógica de producción de la familia productora. Palabras clave: Traspatio, Desarrollo rural, Seguridad alimentaria, Avicultura familiar. 217


Rev Mex Cienc Pecu 2021;12(1):217-237

Recibido: 30/09/2018 Aceptado: 07/11/2019

Introducción La avicultura de pequeña escala (APE) es una de las actividades pecuarias con mayor presencia en el sector rural, una de sus particularidades radica en que sus formas de producción responden a las necesidades de la familia productora y no tanto a la satisfacción de las demandas del mercado. Diversos autores resaltan dos funciones primordiales que tiene la producción avícola en comunidades rurales. Por un lado, su aporte de proteína de alta calidad y de bajo costo a la dieta familiar y por otro, los ingresos extras generados por la venta de sus productos, siendo estos últimos los que permiten la adquisición de bienes y servicios complementarios que satisfacen las necesidades familiares(1,2). Centeno(3) propone que los animales domésticos en un sistema de producción de pequeña escala pueden satisfacer funciones más allá de las nutricionales (consumo familiar) y de las económicas (venta para obtención de dinero o trueque), tales como son las socioculturales (uso en festividades comunitarias, celebraciones familiares, instrumento de educación). Por su parte otros autores proponen diversas funciones que también pueden tener los animales domésticos, que contribuyen al bienestar familiar y que responden a las razones por las cuales las familias productoras tienen animales en su unidad de producción, tales como son: función medioambiental (obtención de estiércol), de trabajo (carga, tracción, entre otros), de ahorro, de seguro (al proveer a la familia de bienes en tiempos de crisis) y social (reforzamiento de lazos y jerarquía social)(4,5). Las funciones que la familia productora le asigna a los animales domésticos pueden ser diversas y estar influenciadas por sus estrategias, las cuales se establecen para alcanzar un beneficio específico que contribuye al bienestar familiar. Así, cada estrategia estará determinada por las capacidades de la familia productora (disponibilidad de mano de obra, experiencia, conocimientos), sus necesidades (ingreso económico, servicios de salud, obtención de alimento, entre otros), recursos, objetivos particulares y valores(3,5). En el caso de las aves, si bien la función y la dinámica de su producción a pequeña escala está estrechamente ligada a las características y necesidades de sustento y bienestar de la familia productora, son pocos los estudios en México que identifican y analizan las funciones que a las aves se les asigna, más allá del discurso redundante de su función nutrimental y económica, y la manera en que la que dicha producción favorece el bienestar familiar.

218


Rev Mex Cienc Pecu 2021;12(1):217-237

El presente estudio pretende identificar las funciones que se le asignan a las aves, en la comunidad rural La Cuchilla, Nopala de Villagrán, Hidalgo, México a partir de las funciones que proponen diversos autores(4,6) y la manera en que éstas contribuyen al bienestar de las familias que desarrollan la avicultura.

Material y métodos Área de estudio El presente trabajo se llevó a cabo en la comunidad rural La Cuchilla, considerada como de alta marginación, en el municipio de Nopala de Villagrán, Hidalgo. La Cuchilla es una de las 112 comunidades pertenecientes al municipio de Nopala de Villagrán que, de acuerdo con INEGI, corresponde al segundo municipio con mayor número de aves de corral del estado de Hidalgo (689,850 cabezas) al concentrar el 18 % del total de aves del estado. Dicha comunidad cuenta con un clima templado subhúmedo con lluvias en verano y está catalogada como una comunidad rural con grado de marginación alto(7).

Etapas de investigación y recolección de datos El estudio se desarrolló bajo un diseño no experimental usando un método descriptivo. En la primera etapa se realizó un censo agropecuario para la identificación del número total de unidades de producción familiar (UPF) y tipo y número de especies animales presentes en la comunidad. Posteriormente se seleccionaron las UPF que llevaban a cabo la producción avícola (26/29), con el fin de identificar la presencia de aves. En la segunda etapa se aplicaron cuestionarios semiestructurados a la persona responsable de la producción avícola de las unidades de producción seleccionadas, con el fin de identificar las funciones que se les asignaba a las aves, siguiendo la clasificación propuesta por diversos autores(4,6). Las funciones de las aves se definieron como aquel rol que la familia les asignaba a sus aves según los beneficios que esperaban obtener de su cría y producción. Para identificar y clasificar las funciones que se les asignaba a las aves, se definieron preguntas semiestructuradas que dieran información sobre los siguientes aspectos. Función nutrimental: destino de la producción para consumo familiar, cantidad de la producción destinada al consumo familiar y frecuencia de consumo de los productos avícolas. Función cultural: grado de involucramiento de los hijos a la actividad avícola y razones para integrar a los hijos a las actividades de cría y producción avícola. Función económica: porcentaje de la producción destinada a la venta.

219


Rev Mex Cienc Pecu 2021;12(1):217-237

Función social: destino de la producción para celebraciones, fiestas (boda, bautismo, cumpleaños) o regalo a vecinos o familiares. Función medioambiental: destino de la gallinaza o pollinaza. Función de recreación: cría de aves por placer. Las esferas del bienestar familiar se definieron según lo reportado en estudios que denotan los aportes de la ganadería de pequeña escala a nivel familiar: seguridad alimentaria(8,9), disponibilidad de recursos económicos(10), reforzamiento de relaciones sociales(11), vinculación al mercado(8) y transmisión de conocimientos vernáculos(5). Las esferas del bienestar familiar se consideraron como aquellos impactos positivos que conllevaba el cumplimiento de las funciones de las aves en la vida cotidiana de la familia productora. Las estrategias utilizadas para la venta del huevo de gallina se identificaron mediante preguntas semiestructuradas con respecto a los puntos de venta (directos e indirectos), los tipos de consumidores y la periodicidad de venta. Dichas estrategias de venta se clasificaron según lo propuesto por LEADER(12).

Manejo de datos y análisis Los datos recolectados se analizaron a partir de estadística descriptiva (frecuencias absolutas y relativas) a través del programa estadístico para las ciencias sociales SPSS 15.0 y Excel 2010.

Resultados Características generales de las unidades de producción familiar (UPF) El 93.1 % (27/29) de las UPF reportaron tener presencia de animales. El total de animales existentes en la comunidad fueron 1,089 y la especie animal con mayor número de cabezas fueron las aves (48 %), seguidas de ovinos (39 %), bovinos productores de leche (11 %), conejos (1 %), caballos (0.6 %) y cerdos (0.3 %). Del total de las UPF que contaban con animales, el 96.3 % (26/27) poseían aves, de las cuales el 96.15 % se dedicaban a la producción de huevo y 3.85 %, carne. La especie avícola más abundante fueron las gallinas para la producción de huevo (71 %), seguida de pollos (10.4 %), gallos (6.4 %), guajolotes (6.1 %), aves de pelea (4.7 %), patos (0.8 %) y gansos (0.6 %).

220


Rev Mex Cienc Pecu 2021;12(1):217-237

Miembros de la familia involucradas en la UPF En el 100 % de las UPF la actividad avícola era responsabilidad de las mujeres. Sin embargo, en algunos casos la mujer entrevistada se encargaba en su totalidad de las aves (57 %) y en otros, la mamá (4 %), el esposo (14 %), los hijos pequeños (14 %) e hijas adultas (11 %) se involucraban en la producción avícola y apoyaban en la realización de determinadas actividades como: recolección de huevo, limpieza de corrales, alimentación, limpieza de bebederos y comederos y venta de huevo, ya fuera de manera constante o esporádica.

Importancia de las aves Las UPF con presencia de animales contaban con 2.4 ± 0.9 especies animales en un rango de entre 1 a 6 especies, por lo que la actividad pecuaria en la comunidad tendía más a la diversificación que a la especialización de su producción. En general, la especie animal considerada como la más importante fueron las aves (Cuadro 1), sin embargo, el porcentaje de UPF que consideraba a las aves como las más importantes, era mayor en aquellas con presencia de menos de tres especies animales (82.3 %). Lo anterior muestra que conforme la diversidad de especies animales incrementaba (entre 4 a 6), la importancia que se le atribuían a las aves disminuía (17.7 %).

Cuadro 1: Actividad pecuaria que se considera como la más importante para las productoras entrevistadas de la comunidad La Cuchilla Actividad pecuaria

Frecuencia

%

17 7 2 1 27

63.0 25.9 7.4 3.7 100.0

Aves Bovinos productores de leche Ovinos Conejos Total

Las razones por las cuales el 63 % de las productoras consideraban a la avicultura como la actividad más importante en comparación con las demás actividades en sus UPF, era debido a los diversos beneficios que éstas obtenían de dicha actividad, resaltando el aporte a la seguridad alimentaria como el beneficio más mencionado (Cuadro 2).

221


Rev Mex Cienc Pecu 2021;12(1):217-237

Cuadro 2: Razones por las cuales las aves son consideradas las más importantes para las productoras entrevistadas en la comunidad La Cuchilla Razones

Frecuencia

%

9

37.4

1

4.2

4

16.6

Evita la compra externa de pollo y huevo Posibilidad de venta de un ave o borrego en emergencias familiares Es un alimento para ocasiones especiales (visita de hijos, celebraciones, fiestas familiares)

1

4.2

1

4.2

1

4.2

Se entretiene y es un pasatiempo

1 2 2

4.2 8.3 8.3

1

4.2

Son consideradas parte de la familia

1

4.2

TOTAL

24

100.0

Es una fuente de alimento para la familia (aporte a la seguridad alimentaria) Las gallinas representan un alimento ante la escasez de comida La venta de huevo y pollitos permite la obtención de dinero para la satisfacción de necesidades familiares

Es su única especie Proporciona un sentido de propiedad Permite la obtención de huevo

Las funciones de las aves en el sistema de producción de pequeña escala

De acuerdo a los diversos usos y destinos que las productoras le daban a los productos avícolas y a las aves, las funciones de la especie avícola se clasificaron en seis (Cuadro 3). En promedio cada productora les asignaba tres funciones a las aves, siendo éstas no mutuamente excluyentes.

222


Rev Mex Cienc Pecu 2021;12(1):217-237

Cuadro 3: Las funciones que se les asignan a las aves las productoras entrevistadas de la comunidad La Cuchilla Función Nutrimental Medioambiental

Cultural

Económico

Social

Recreación

Consumo de productos avícolas a nivel familiar Uso del excremento como abono natural para su uso en la milpa Transmisión de conocimiento vernáculo, enseñanza de ética de trabajo y valores a través de la cría y cuidado de las aves Venta de productos avícolas para la obtención de ingresos económicos Uso de los productos avícolas en celebraciones (boda, fiestas, cumpleaños) Obtención de placer y satisfactores a partir del cuidado de las aves

Frecuencia

%

21

26.9

19

24.4

14

17.9

16.7 13

9

2

11.5

2.6

a) Función nutrimental El consumo familiar de carne de ave proveniente de su propia producción fue en promedio 1 vez cada 24 ± 5.61 semanas (6 meses). El bajo consumo de carne al mes era debido a que su consumo se realizaba únicamente en situaciones específicas como lo era en época de escasez de alimentos o por un simple gusto, principalmente (Cuadro 4). Además, la función prioritaria de las aves no era la de proveer carne para el consumo familiar sino más bien era la producción de huevo.

223


Rev Mex Cienc Pecu 2021;12(1):217-237

Cuadro 4: Razones de consumo de carne de gallina proveniente de la unidad de producción La Cuchilla Razones

Frecuencia

%

Escasez de comida Gusto Aves viejas, que ya no ponen o están enfermas

7 7 5

26.92 26.92 19.23

Celebración (cumpleaños, visita de algún familiar)

4

15.38

Cuando no hay dinero para comprar carne No consume Evitar la compra de carne “de granja” y evitar el gasto

1 1 1 26

3.85 3.85 3.85

Total

100.0

En este sentido, el 96.15 % de las UPF con aves se dedicaban a la producción de huevo cuyos diferentes usos y destinos eran principalmente para consumo familiar (54.76 %), para venta (35.71 %) y como regalo a sus vecinos o para sus familiares que ya no habitaban en la comunidad, y con los cuales se buscaba reforzar lazos de reciprocidad, confianza y trato entre ellos (9.53 %). b) Función cultural El 100 % de las productoras que tenían algún miembro de la familia menor a 17 años, ya fuera de la familia nuclear o extensa, utilizaban a la avicultura como medio para transmitir valores y enseñar ética de trabajo a partir del involucramiento de sus integrantes de la familia en el cuidado y producción de las aves. Dentro de los elementos trasmitidos se mencionaron: 1) Enseñar a trabajar a los hijos desde temprana edad y a hacerlos pensar en que deben realizar una actividad en la casa para que ocupen su mente en algo positivo que les ayude en un futuro; 2) Enseñar que es un ahorro; 3) Preservar de generación en generación la cultura y el conocimiento de que a partir de trabajo y esfuerzo, los hijos pueden obtener su propio alimento; 4) Enseñar a cuidar a los animales para poder obtener beneficios tangibles (dinero, alimentos de origen animal) o intangibles (conocimiento, experiencia en el cuidado de los animales); 5) Enseñar el trabajo que cuesta tener las cosas y a saberlas valorar; 6) Dejar un legado para los hijos, que pueda ser trabajado continuamente para que constituya un medio de vida para el futuro. c) Función económica Del total de UPF que llevaban a cabo la producción de huevo, el 60 % destinaban parte de su producción para la venta a nivel local. El precio de venta de huevo era de $2.00/pieza en toda la comunidad, a excepción de una productora, quien mencionó venderlo a $2.50/pieza. Los ingresos económicos generados a partir de la venta de huevo oscilaban entre $20 hasta $420 pesos por semana. La variación existente entre ingresos económicos obtenidos era debido a que estos dependían de la cantidad de gallinas presentes por UPF y el porcentaje de huevo destinado a la venta.

224


Rev Mex Cienc Pecu 2021;12(1):217-237

Para la venta de huevo, las pequeñas productoras utilizaban diferentes circuitos cortos de comercialización (CCC) que las enlazaba con consumidores dentro y fuera de la comunidad rural. Se identificaron 10 CCC, los cuales se clasificaron en tres grupos, de acuerdo a LEADER(12): venta a mercados locales (25.92 %), venta directa en la UPF (55.56 %) y entrega a domicilio (18.52 %) (Cuadro 5).

Cuadro 5: Circuitos cortos de comercialización (CCC) de huevo utilizados por productoras de la comunidad La Cuchilla CCC

Lugar/Actor

Frecuencia

%

Venta en tiendas

Tienda de abarrotes y carnicería

2

7.41

Tianguis

3

11.11

CCC1 (25.92%) Venta directa en la UPF CCC2 (55.56 %)

Restaurantes

1

3.70

Pastelería Vecinos para su autoconsumo

1 8

3.70 29.63

Miembros de la familia de otro estado o municipio

4

14.81

Vecinos para completar sus pedidos (cooperación)

2

7.41

Visita en la UPF

1

3.70

Personas específicas por pedidos previos

3

11.11

Casa por casa en el municipio

2

7.41

Reparto a domicilio CCC3 (18.52 %)

Si bien el 60 % de las UPF vendían su huevo, no toda la producción se destinaba para su venta, sino que el número de huevos obtenidos se distribuía dependiendo del beneficio que cada productora pretendía obtener. De acuerdo al número de huevos que destinaba las productoras para su venta fue posible dividir las UPF en tres grupos: Grupo 1 (Económica): productoras que destinaban el mayor número de huevos para su venta a nivel local (66.67 %) (Cuadro 6).

225


Rev Mex Cienc Pecu 2021;12(1):217-237

Cuadro 6: Circuitos cortos de comercialización (CCC) utilizados por las productoras entrevistadas que vendían huevo y cuyo mayor número de huevos producidos eran destinados para la venta Tipo de función

CCC CCC2

Económica

%

Vecinos

28.57

Cooperación

9.52

Familiares

9.52

Visita a UPF

4.76

Pastelería

4.76

Tianguis

14.29

Tienda de abarrotes

9.52

CCC3

Pedidos previos

14.29

19.05 %

Venta casa por casa

4.76

52.38 %

Grupo 1.

Lugar/Actor

CCC1 28.57 %

Grupo 2 (Consumo familiar): productoras que destinaban el mayor número de huevos para el consumo familiar (26.67 %) (Cuadro 7). Cuadro 7: Circuitos cortos de comercialización (CCC) utilizados por las productoras entrevistadas que vendían huevo, pero cuyo mayor número de huevos producidos eran destinados para consumo Tipo de función

CCC

%

CCC2 60 %

Familiares

40

Vecinos

20

CCC1 20 %

Restaurante

CCC3 20 %

Venta casa por casa

Grupo 2. Consumo familiar

Lugar/Actor

20 20

Grupo 3 (Social); productoras que destinaban el mayor número de huevos para regalo a familiares o vecinos cercanos (6.67 %). Como lo muestran el Cuadro 6 y 7, la diversidad de lugares utilizados para la venta del huevo difería según el grupo al que cada UPF pertenecía. Por ejemplo, el grupo 1 tenía una mayor

226


Rev Mex Cienc Pecu 2021;12(1):217-237

diversidad de lugares para la venta de huevo por CCC en comparación con el grupo 2. El grupo 3 lo conformaba solo una UPF que destinaba el mayor número de huevos para regalarlo a sus familiares. Lo anterior indica que a pesar de que existían UPF que vendían el huevo, no todas ellas destinaban la mayor parte de su producción para la venta por lo que privilegiaban otro tipo de funciones tales como son la social o nutrimental. d) Función social Como se mencionó, un porcentaje del huevo producido en las UPF se le asignaba una función social debido a que este era consumido en eventos familiares (visitas de parientes cercanos o cumpleaños), así como también se destinaba para regalo a familiares o vecinos con el objetivo de reforzar los lazos de reciprocidad, confianza y trato entre ellos. En este caso, no se reportó el consumo de carne de ave en eventos especiales. e) Función medioambiental El 83.3 % de las productoras utilizaba la gallinaza como abono para su milpa o para la milpa de un familiar, el 8.3 % no le daba ningún uso, el 4.2 % la vendía o usaba en el herbario (4.2 %). Por otra parte, el 52 % de los productores utilizaban el maíz que ellos mismos producían en su milpa para alimentar a las aves, lo que permitía disminuir la compra de insumos externos. Cabe mencionar que dicha relación se veía afectada en determinadas épocas del año (temporadas de no siembra o escasez de agua). f) Función de recreación De acuerdo con 2.6 % de las entrevistadas, la avicultura era una actividad de recreación y relajante, que les permitía descansar de sus actividades cotidianas y la cual les generaba gusto y satisfacción.

Esferas del bienestar familiar Cada una de las funciones de las aves contribuían al bienestar familiar en diferentes vertientes, las cuales se clasificaron en cinco esferas: seguridad alimentaria, disponibilidad de recursos económicos, reforzamiento de relaciones sociales, vinculación al mercado y transmisión de conocimientos vernáculos. Seguridad alimentaria (disponibilidad y accesibilidad): el huevo o la carne de las aves se consumía en época de escasez de comida, por gusto, como ahorro o cuando no había disponibilidad de dinero. Disponibilidad de recursos económicos: los ingresos económicos obtenidos por cada UPF eran utilizados para obtener diversos bienes y servicios que permitían mejorar el bienestar familiar, también favorecían la reinversión en las diversas actividades pecuarias de la familia

227


Rev Mex Cienc Pecu 2021;12(1):217-237

y contribuían a la seguridad alimentaria al permitir la compra de alimentos que no eran producidos dentro de la UPF (Cuadro 8). Cuadro 8: Destino de los ingresos económicos obtenidos por las productoras entrevistadas a partir de la venta de huevo en la comunidad La Cuchilla Uso de los recursos económicos Frecuencia % Compra de alimento para la familia 12 57.14 Compra de alimento para aves

4

19.06

Compra de alimento para otras especies Pasaje Pasaje de hijos para la escuela

1 2 1

4.76 9.52 4.76

Pago del molino Total

1 21

4.76 100

Reforzamiento de relaciones sociales: el huevo producido se utilizaba como regalo a los vecinos para reforzar lazos de reciprocidad, confianza y trato entre ellos o para sus familiares que ya no habitaban en la comunidad. En este caso, fue posible inferir que la producción de huevo permitía el establecimiento de relaciones estrechas entre productoras a partir de mecanismos de cooperación para la venta de huevo, en donde una productora podía completar el número de piezas de huevo a otra productora para que esta pudiera vender la cantidad de huevos que requería (estrategias de cooperación). Vinculación al mercado: Las pequeñas productoras utilizaban diferentes CCC para la venta de su huevo. El tipo de circuitos utilizados por las productoras para comercializar su huevo, incluían estrategias que las conectaban tanto con consumidores dentro de la comunidad como fuera de esta. De acuerdo con sus criterios, las ventajas de los circuitos comerciales empleados para la venta de huevo eran la inexistencia o escaso número de intermediarios involucrados para la comercialización del huevo lo que permitía vender de manera directa el huevo a los consumidores y concentrar de las ganancias obtenidas por parte del productor. Transmisión de conocimientos vernáculos: las productoras que tenían algún miembro de la familia menor a 17 años, ya fuera parte de la familia nuclear o extensa, utilizaban a la avicultura como medio para transmitir valores y enseñar ética de trabajo a partir del involucramiento de sus integrantes de la familia en el cuidado y producción de las aves, así como también para heredar conocimientos vernáculos sobre formas de producción y medios de subsistencia.

228


Rev Mex Cienc Pecu 2021;12(1):217-237

Discusión Características generales de las UPF de la comunidad rural Los datos disponibles y generados a nivel nacional que denotan la situación de las comunidades rurales en México corresponden únicamente a la densidad poblacional, grado de marginación, grado de rezago social, número de viviendas e indicadores de carencia de vivencia. Dado lo anterior, hay una escasez en la disponibilidad de datos sobre la producción y productividad de las actividades agropecuarias y no agropecuarias de las comunidades rurales, pues dichos datos se conocen por municipio o por estado, pero no por comunidad rural. La búsqueda de datos a nivel micro sobre la producción avícola en una comunidad rural se dificulta, pues la información que proveen los censos de INEGI tiene las limitantes que a continuación se describen: 1) La información que se provee es únicamente a nivel municipal y se centra en la densidad poblacional de sus aves, cantidad de venta de los productos avícolas y su acceso a tecnología. 2) Los datos corresponden únicamente a aquellas unidades de producción que reportan la existencia de más de 1,000 aves, situación que ignora a aquellas producciones de pequeña escala que poseen un número pequeño de aves. 3) Los datos no permiten distinguir la dinámica entre sistemas de producción avícola a gran escala o de pequeña escala, según su acceso a tecnologías o densidad animal En el caso específico de la comunidad La Cuchilla, no hay datos previamente existentes que ayuden a vislumbrar las características generales de producción de sus actividades agropecuarias y no agropecuarias ni de su nivel tecnológico, su productividad o la generación de ingresos o de empleos. Antes este escenario, es posible determinar la importancia de trabajos de investigación, como el presente estudio, que se adentren a la recolección y análisis a nivel micro de las comunidades rurales y que proporcionen información básica y fundamental para el diseño de estudios más complejos que ayuden a entender la dinámica de las UPF de comunidades rurales a nivel local, nacional e internacional y la forma en la que perviven en un sistema económico capitalista. Los datos que en el presente estudio se reportan sobre la comunidad rural La Cuchilla, permiten vislumbrar las actividades de la comunidad y la importancia de la producción de aves para las familias productoras.

229


Rev Mex Cienc Pecu 2021;12(1):217-237

Importancia de las aves Diversos estudios realizados en México resaltan dos razones comunes por las cuales la avicultura de pequeña escala existe en el sector rural, ya sea por consumo familiar y, en menor medida, por la venta de productos avícolas. Por ejemplo, en comunidades de Yucatán se reportó que el destino de los productos avícolas era para la venta, el consumo familiar y en algunos casos para incubación(13,14). En algunas comunidades de Oaxaca se ha resaltado que el destino de la producción de huevos ha sido para venta e incubación, mientras que en otras comunidades, por ejemplo Zompantle, la principal finalidad era la venta y la cría de polluelos(15). En el caso de la costa del estado de Oaxaca se ha mencionado que la finalidad de las aves era la producción de alimentos para consumo familiar, venta u obsequio. En otras comunidades del mismo estado, se ha reportado que la producción ha sido esencialmente para consumo familiar y venta con los vecinos(16). Los datos obtenidos en diferentes estudios realizados en México permiten inferir que las funciones que satisfacen las aves en el ámbito rural han sido reportadas únicamente por el destino que se les da a los productos avícolas y no han sido descritas, estudiadas o analizadas como un medio para establecer estrategias que permitan alcanzar el bienestar de las familias productoras. En contraste a las contribuciones científicas que caracterizan de manera técnica a la avicultura de pequeña escala en México y que resaltan, principalmente, su aporte nutricional y económico a nivel familiar, diversos autores enfatizan que las aves deben ser consideradas como un medio para mejorar los modos de vida rurales y, por ende, el bienestar de las familias, pues las aves permiten el control de pestes, son proveedores de abono, son requeridas para festividades especiales y son esenciales para ceremonias tradicionales(6,11). Los resultados del presente estudio permiten vislumbrar que la familia productora, no necesariamente toma decisiones productivas guiadas por intereses de carácter técnicoeconómico, pues su fin principal no es alcanzar el máximo beneficio económico(17), sino que también se toman en consideración cuestiones no económicas, como lo son las necesidades básicas de la persona y de su familia (nutricionales, económicas, sociales y culturales), para definir en mayor medida el carácter de su producción(18,19) y las funciones que le asigna a los animales, de manera que los resultados del presente trabajo enfatizan la multifuncionalidad de las aves y no el fin zootécnico de las mismas. a) Función nutrimental Para mitigar el hambre y la malnutrición no solo es necesario producir más alimentos, sino también que estos satisfagan los gustos y preferencias de quien lo consume, además de hacerlos más disponibles para aquellos que lo necesitan(20). Diversos autores concuerdan en

230


Rev Mex Cienc Pecu 2021;12(1):217-237

que los sistemas de producción animal a pequeña escala tienen un potencial importante para contribuir a la seguridad alimentaria de los habitantes de países en vías de desarrollo(6,9,21,22). Los datos del presente estudio coincidieron con dichos estudios en los que se indica que la avicultura ha contribuido a hacer más disponibles y accesibles la carne y huevo de gallina, particularmente cuando hay escasez de alimento. b) Función cultural La importancia que tienen las aves como medio para trasmitir una ética de trabajo o valores a los hijos o integrantes de la familia menores a 17 años no se encuentra como tal reportada en otros estudios, sin embargo, si existen estudios que consideran que el traspatio constituye un medio para la trasmisión de conocimientos vernáculos, valores y ética de trabajo a las generaciones de jóvenes para mantener vigente la cría de animales(5). Los datos que se muestran aquí permiten inferir la importancia de la avicultura como medio de educación informal a los jóvenes que pueden promover su arraigo al campo además de representar una opción de vida. Otros estudios resaltan el papel de las aves en la religión, en la medicina tradicional y como medios para consumir los desperdicios de las fincas(20) sin embargo en el presente estudio no se encontró ningún caso en el que se emplearan a las aves para dichos fines. c) Función económica La función económica de las aves se cumplía a través de la venta de huevo para la obtención de ingresos económicos inmediatos. En contraste con datos reportados en Oaxaca, donde el 50 % de los huevos se destinaban a la venta y el otro 50 % se destinaba a la incubación(15), en el presente estudio el 60 % de las productoras, destinaban parte de su producción para la venta de huevo a nivel local. Similar a lo reportado en Etiopia(20), el ingreso económico obtenido por la venta de los productos avícolas era utilizado principalmente para obtener bienes y servicios complementarios para cubrir las necesidades familiares como lo era la compra de alimentos para consumo familiar que no eran producidos en la UPF e inclusive para el pago de la molienda del maíz en el molino local(18,19). Algunos autores consideran que los pequeños productores están teniendo una reorientación de su perfil productivo hacia la generación de productos destinados al mercado debido a una mayor demanda de dinero en efectivo para hacer frente a nuevas necesidades y obligaciones que no estaban presentes en sociedades campesinas de principio de siglo(23). Sin embargo, los datos del presente estudio mostraron que la función nutrimental no ha disminuido su importancia relativa en esta comunidad rural, más bien a partir de las diversas funciones que se les asignaban a las aves había sido posible la satisfacción de las necesidades de las productoras y sus familias sin ser la función económica la única vía para alcanzar el bienestar familiar. 231


Rev Mex Cienc Pecu 2021;12(1):217-237

d) Función social Los animales con funciones sociales se han utilizado principalmente para cumplir con las responsabilidades generadas por las relaciones sociales que establecen las familias con los demás miembros de la comunidad, como es el caso de las celebraciones familiares (bodas, bautizos, velorios), festividades locales (fiesta patronal o de barrio), tradiciones (día de muertos, semana santa), regalo o trueque(1,3,5). Los datos del presente estudio mostraron que el consumo de huevo de ave se realizaba en eventos especiales (cumpleaños, festividades, entre otras) así como también se regalaban a familiares o vecinos con el fin de reforzar relaciones sociales entre las personas involucradas, datos que concordaron con estudios realizados en Asia y África(10,21,24). e) Función medioambiental Las UPF estudiadas mostraron la posibilidad de llevar a cabo diferentes actividades tanto agropecuarias como no agropecuarias. La interrelación entre la ganadería y la agricultura era importante, ya que se reforzaban conexiones simbióticas entre ambas actividades agropecuarias. En el caso específico de las aves, según diversos estudios, su función medioambiental ha sido considerada importante por tres roles que estas pueden desempeñar: ser recolectoras de desperdicios de los granos y forrajes (evita presencia de fauna nociva)(25), ser proveedoras de abono natural a la milpa y limpiadoras de malezas(20). En este estudio, los resultados mostraron que el único rol importante de las aves dentro de su función medioambiental fue el uso que se le daba a las excretas como abono natural a la milpa lo que disminuía la generación de residuos de esta actividad. f) Función de recreación Algunos autores han reportado que la cría y producción de animales a pequeña escala permite la obtención de satisfactores tangibles e intangibles a las mujeres encargadas de dicha actividad. Dentro de los satisfactores intangibles se han reportado aquellos que proporciona bienestar a la mujer pero que no pueden ser transformados en dinero, sin embargo tienen un efecto directo en el estado anímico de las personas(26). Otros estudios han identificado la adquisición de aves para fines de compañía o para combate, como en el caso de gallos de pelea, considerándolos como un medio de entretenimiento(27). En el presente estudio, fue posible vislumbrar que específicamente la cría y producción de aves era considerado un medio de distracción para las mujeres productoras que generaba satisfacción y bienestar (beneficios intangibles).

232


Rev Mex Cienc Pecu 2021;12(1):217-237

Esferas del bienestar familiar Seguridad alimentaria: una familia tiene seguridad alimentaria cuando tiene acceso a los alimentos requeridos para una vida sana para todos sus miembros (adecuada en términos de calidad, cantidad, seguridad y culturalmente aceptados)(9). En este caso fue posible identificar que la producción avícola tiene un aporte a la seguridad alimentaria en las familias que llevan a cabo esta actividad, sin embargo, falta la evaluación de otros elementos que también forman parte del concepto de seguridad alimentaria, para determinar de manera más precisa su verdadero aporte. Disponibilidad de recursos económicos: los productores en comunidades rurales frecuentemente no tienen acceso a mercados financieros, como los bancos. La ganadería ofrece una alternativa para ahorrar o acumular capital como una “fuente de ahorro vivo”. La venta de especies como bovinos, cerdos y borregos permiten su transformación en dinero en tiempos de crisis. En este estudio, no se identificaron casos donde las aves se vendieran con el propósito de solventar una crisis financiera, pues las aves no poseen un valor económico alto por cabeza como los bovinos, sin embargo, sí fue posible identificar estrategias de venta de huevo para obtener dinero y con ello acceder a bienes y servicios complementarios(4). Reforzamiento de relaciones sociales: Los animales a los cuales se les asigna funciones sociales se utilizan principalmente para cumplir con las responsabilidades generadas por las relaciones sociales que establecen las familias con los demás miembros de la comunidad, como en celebraciones familiares (bodas, bautizos, velorios), festividades locales (fiesta patronal o de barrio), tradiciones (día de muertos, semana santa), regalo o trueque(1,3). En este caso, fue posible inferir que la producción de huevo permitía el establecimiento de relaciones estrechas entre productoras a partir de mecanismos de cooperación para la venta de huevo. Vinculación al mercado: La necesidad de obtener ingresos para responder a los cambios económicos, sociales, tecnológicos y políticos ha fomentado a que las pequeñas productoras desarrollen estrategias de comercialización para asegurar la generación de ingresos familiares y la continuidad tras generacional de la UPF(22). Tal como lo muestran los datos del presente estudio, las productoras eran capaces de utilizar diversos canales cortos de comercialización para la venta de su producto avícola, lo que les permitió encontrar diferentes nichos de mercado que bien pueden permitir la venta de otros productos también generados en la UPF. Transmisión de conocimientos vernáculos: En un estudio realizado en Yucatán, se señala que la pequeña escala tiene la función de dar cohesión a la unidad familiar y a la comunidad, a través de acciones para la preservación, enriquecimiento y difusión del saber de sus habitantes, ya que en el manejo de traspatio se refleja gran parte del conocimiento que poseen la familia tiene sobre su entorno(28). En el presente estudio fue posible identificar los

233


Rev Mex Cienc Pecu 2021;12(1):217-237

elementos esenciales que se trasmiten a través de la producción avícola como lo son valores, ética de trabajo y formas de producción. Cabe mencionar que es necesario identificar los elementos particulares que se difunden, a través de esta producción pecuaria como lo son: estrategias de producción para disminuir la dependencia a insumos externos, tratamientos tradicionales a enfermedades, estrategias de venta etc. Los esfuerzos para el desarrollo de la ganadería en países en vías de desarrollo han sido principalmente dirigidos a generar ingresos y satisfacer las necesidades crecientes de las unidades de producción. Estos esfuerzos generalmente dan prioridad a tecnologías que maximicen la productividad individual de los animales, a la transferencia de tecnología y con ello, a la difusión de información técnica(29,30). Sin embargo, estas acciones no solo deben ir encaminadas al aumento del rendimiento de la producción avícola y aumentar la generación de ingresos, pues las UPF no necesariamente se desarrollan bajo una lógica capitalista y, por lo tanto, pueden no estar apropiadas al contexto en el que se desarrollan(4). Las acciones deben ir acompañadas de una comprensión integral de la función del ave y el contexto en el que ésta se desarrolla para que el diseño e implementación de programas o estrategias den respuesta a problemas y preocupaciones de los productores y vayan acorde a sus objetivos y estrategias de producción(20,25).

Conclusiones e implicaciones Las productoras de la comunidad rural de La Cuchilla le podían asignar 6 diferentes funciones, no mutuamente excluyentes, a las aves: nutrimental, medioambiental, cultural, económica, social y de recreación. Cada una de las funciones contribuían al bienestar familiar en cinco diferentes esferas: seguridad alimentaria, disponibilidad de recursos económicos, reforzamiento de relaciones sociales, vinculación al mercado y transmisión de conocimientos vernáculos. Se concluye que las aves pueden tener una multifuncionalidad que va más allá de su aporte a la seguridad alimentaria (función nutrimental) y generación de recursos económicos (función económica). Las funciones de las aves pueden ser estrategias que los productores definen para alcanzar el bienestar familiar en cinco diferentes esferas. La comprensión integral del concepto de función es importante para el diseño de estrategias de desarrollo acordes a los objetivos y lógica de producción de la familia productora. Agradecimientos Al Dr Fernando Manzo Ramos por sus valiosos comentarios y recomendaciones en la propuesta y desarrollo de mi tesis de maestría “El sistema de producción avícola, las funciones de las aves, el mercado local y los circuitos cortos de comercialización; un estudio

234


Rev Mex Cienc Pecu 2021;12(1):217-237

integral de la avicultura de pequeña escala en una comunidad rural de México”, de la cual deriva la esencia de esta investigación. Literatura citada: 1.

Camacho M, Lezama P, Jeréz M, Kollas J, Vásquez M, García J, et al. Avicultura indígena mexicana: Sabiduría milenaria en extinción. Actas Iberoam Conserv Anim 2011;375.

2.

Navarrete N, Sánchez E, Nava G, Espinoza A. Identificación y evaluación de indicadores en la crianza campesina. VII Congreso AMER; 2007.

3.

Centeno S, Manzo F. Propuesta de modelo para el estudio de la ganadería en comunidades campesinas. Estudio de caso del ejido de Almeya, Puebla, México. En: Ganadería y seguridad alimentaria en tiempo de crisis. México: Universidad Autónoma de Chapingo; 2009.

4.

Randolph T, Schelling E, Grace D, Nicholson C, Leroy J, Cole D, et al. Role of livestock in human nutrition and health for poverty reduction in developing countries. Am Soc Anim Sci. 2007;85:2788-2800.

5.

García A, Guzmán E. La ganadería familiar, elemento cotidiano de los traspatios de la comunidad Juan Nepomuceno Álvarez, Copala, Guerrero, México. Cienc Biológicas 2014;1-11.

6.

Mack S, Hoffman D, Otte J. The contribution of poultry to rural development. World Poult Sci Assoc 2005;61:7-13.

7.

INEGI. Panorama agropecuario en Hidalgo. INEGI. México; 2012.

8.

Cruz B, Muñóz M, Santoyo V, Martínez E, Aguilar N. Potencial y restricciones de la avicultura de traspatio sobre la seguridad alimentaria en Guerrero, México. Agric Soc Desarro 2016;13:257-275.

9.

Bruyn J, Wong J, Bagnoi B, Pengelly B, Alders R. Family poultry and food security. CAB Reviews Perspectives in Agriculture Veterinary Science Nutrition and Natural Resources 2015;10(13):1-9.

10. Aklilu H, Udo H, Almekinders C, Van der Zipp A. How resource poor households value and access poultry: Village poultry keeping in Tigray, Ethiopia. Agric Syst 2008;96:175-183. 11. Alders R. Producción avícola por beneficio y por placer. Roma: FAO; 2005.

235


Rev Mex Cienc Pecu 2021;12(1):217-237

12. LEADER. Comercialización de productos locales circuitos cortos y circuitos largos. Observatorio Europeo; 2000. 13. Gutiérrez M, Segura J, López L, Santos J, Santos R, Sarmiento L, et al. Características de la avicultura de traspatio en el municipio de Tetiz, Yucatán, México. Trop Subtrop Agroecosystems 2007;7:217-24. 14. Gutiérrez-Ruíz E, Aranda F, Rodríguez R, Bolio R, Ramírez S, Estrella J. Factores sociales de la crianza de animales de traspatio en Yucatán, México. Bioagrociencias 2012;5(1):20-28. 15. Chincoya H, Jeréz M, Herrera J, Mendoza P. Caracterización fenotípica y sistema de producción de las gallinas criollas en comunidades de Oaxaca. Rev Mex Agroecosistemas 2016;3(2):87-98. 16. Viveros J, Chávez J, Jeréz M, Villegas Y. Manejo de gallinas de traspatio en seis comunidades de los valles centrales de Oaxaca. Rev Mex Agroecosistemas. 2016;3(2):75-86. 17. López J, Damián M, Álvarez F, Parra F, Zuluaga G. La economía de traspatio como estrategia de supervivencia en San Nicolás de los Ranchos, Puebla, México. Rev Geogr Agríc 2012;48:51-62. 18. Shanin T. Naturaleza y lógica de la economía campesina. Argentina: Nueva Visión; 1976. 19. Chayanov A. Theory of Peasant Cooperatives. Great Britain: Ohio State University Press; 1991. 20. Tadelle D, Ogle B. Village poultry production systems in the central highlands of Ethiopia. Trop Anim Health Prod 2001;33:521-537. 21. Muchadeyi F, Sibanda S, Kusina J, Makuza S. The village chicken production system in Rushinga district of Zimbabwe. Livest Res Rural Develop 2004;16(6). Art. 40. 22. Mcainsh C, Kusina J, Madsen J, Nvoni O. Traditional chicken production in Zimbabwe. Worlds Poult Sci J 2004;60:233-246. 23. Cáceres D. Estrategias campesinas en sociedades rurales contemporáneas. Rev Fac Agron 15(1):67-72. 24. FAO. Family poultry development. Issues, opportunities and constraints. Animal Production and Health Working Paper. Animal Production and Health Working Paper; 2014.

236


Rev Mex Cienc Pecu 2021;12(1):217-237

25. Moreki J, Petheram R, Tyler L. A study of small-scale poultry production systems in Serowe-Palapye sub-district of Botswanna. Livest Res Rural Develop 2010;22(3). 26. Vieyra J, Castillo A, Losada H, Cortés J, Alonso G, Ruíz T, et al. La participación de la mujer en la producción traspatio y sus beneficios tangibles e intangibles. Cuad Desarro Rural 2004;53:9-23. 27. Itza M, Carrera JM, Castillo Y, Ruíz O, Aguilar E, Sangines J. Caracterización de la avicultura de traspatio en una zona urbana de la frontera norte, México. Rev Científica 2016;26(5):300-305. 28. Molina M. Comparación de dos sistemas de producción y manejo sanitario de las aves criollas de traspatio en los municipios de Ignacio de la Llave y Teocelo, [tesis licenciatura].Veracruz: Universidad Veracruzana; 2013. 29. Elkashef O, Sarmiento L, Torres J. Backyard chicken production skills of rural women in Yucatán, México. Asian J Agric Ext 2016;10(1):1-12. 30. Salah O, Sarmiento L, Torres F, Fernandez L. Understanding the information acquisition sources of backyard chicken production practices amongst rural Mayan women in Yucatan, México. Agric Soc Desarro 2017;14:219-237.

237


https://doi.org/10.22319/rmcp.v12i1.5213 Artículo

Disonancia cognitiva ante el cambio climático en apicultores: un caso de estudio en México

Felipe Gallardo-López a Blanca Patricia Castellanos-Potenciano b* Gabriel Díaz-Padilla c Arturo Pérez-Vásquez a Cesáreo Landeros-Sánchez a Ángel Sol-Sánchez d

a

Colegio de Postgraduados, Campus Veracruz. Manlio Fabio Altamirano, Veracruz México. b

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias - Centro de Investigación Regional Pacífico Sur, Valles Centrales de Oaxaca. México. c

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias - Centro de Investigación Regional Golfo Centro, Teocelo, Veracruz. México. d

Colegio de Postgraduados. Campus Tabasco. Cárdenas, Tabasco. México.

*Autor de correspondencia: castellanos.blanca@inifap.gob.mx

Resumen: El cambio climático en la apicultura se percibe como un fenómeno relacional y la adopción de estrategias de adaptación son necesarias para mantener la actividad económica. La teoría de la Disonancia Cognitiva de Festinger, ayuda a comprender las limitantes para la adopción de estrategias de adaptación al cambio climático. Para ello se aplicó una encuesta que permitiera explorar la relación entre la percepción, la actitud y el comportamiento de 238


Rev Mex Cienc Pecu 2021;12(1):238-255

los apicultores frente al cambio climático en territorio mexicano. Se observó que: 1) los apicultores identificaron el cambio climático como el principal problema de la apicultura; 2) existe disonancia entre la actitud y el comportamiento respecto a las estrategias de adaptación y 3) la disonancia cognitiva se reduce con justificaciones, para su comportamiento. Por lo tanto el estado de disonancia presente es una limitante para adoptar acciones de adaptación frente al cambio climático, dejando en evidencia la necesidad de modificaciones en el comportamiento de los apicultores, a través de la capacitación dirigida para informar y explicar la naturaleza del cambio climático y sus impactos; de ubicar al apicultor dentro de este contexto donde pueda aportar elementos técnicos que le permitan reorientar su trabajo, promoviendo una percepción objetiva y constructiva, que genere la actitud positiva suficiente, frente a los retos que el cambio climático representa; para que modifique el comportamiento lo necesario, para mantener la actividad rentable en México. Palabras clave: Adaptación, Percepción, Actitud, Apicultores, Apis mellifera.

Recibido: 08/01/2019 Aceptado: 27/11/2019

Introducción El cambio climático representa el mayor desafío para la humanidad en el siglo XXI. El efecto invernadero asociado al fenómeno provoca efectos negativos ambientales, sociales y económicos en los diferentes sectores productivos(1). Así que mantener el óptimo desarrollo del sector primario, en los sistemas de temporal, representa un reto para los países de América Latina ante los efectos negativos del cambio climático(2). La apicultura es una actividad importante y una opción para el crecimiento del sector primario de países en desarrollo(3). A nivel mundial, México ocupa el sexto lugar en producción de miel y en promedio la tercera posición como exportador de este producto; generando divisas por $93,725 millones de dólares(4). Esta actividad depende de un intervalo de condiciones climáticas estables para su óptimo desarrollo(5). Los impactos del cambio climático en la apicultura se manifiestan como un fenómeno relacional en un contexto local(6). Por lo que para esta actividad se espera un impacto potencial directo (considerando la respuesta intra e interespecífica de la flora y las

239


Rev Mex Cienc Pecu 2021;12(1):238-255

abejas melíferas), a través de la movilidad espacio-temporal de la floración melifera(7) y un impacto indirecto en los factores socioeconómicos de los apicultores(8). Los apicultores poseen conocimiento empírico y técnico sobre las abejas y su entorno, así como de la variabilidad climática local(9), lo que define la percepción del cambio climático y en la generación de ideas, que pueden influir en la aceptación de estrategias de adaptación y en su comportamiento(10). La Teoría de la disonancia cognitiva (TDC) de Leon Festinger ayuda a explicar la incongruencia a nivel individual y social que el cambio climático genera en las personas, así como la justificación a tal actitud o comportamiento. Esta teoría, plantea que el estado ideal es la congruencia o armonía cognitiva, por lo que la incongruencia interna del sistema de ideas o cogniciones que se generan en un individuo surge, ante la contradicción simultánea entre dos de ellas; o por un comportamiento contrario a sus creencias(11). Cuando la disonancia se presenta, el estrés que se genera incomoda al individuo, por lo que éste, de forma inconsciente intenta reducir la incomodidad o estrés, a través de diferentes formas como: a) pensamientos que justifiquen su comportamiento así, el individuo acepta que la acción emprendida es la correcta b) modificación de la conducta y c) convivir con el conflicto interno, aunque esto genere otros estados en la salud mental del individuo(12,13). Investigaciones en este rubro, han demostrado que existe disonancia cognitiva entre la percepción del cambio climático (según el sistema de creencias de los individuos) y su influencia en la adopción de las estrategias de adaptación en el sector agropecuario(14,15). Así, se identifica la necesidad de distinguir la percepción del cambio climático y la disonancia cognitiva que se genera en los apicultores entre percepción, actitud y comportamiento, ante las estrategias de adaptación para el cambio climático y como, se reduce esta incongruencia de cogniciones; para ayudar a comprender las ideas que limitan la adopción de estrategias de adaptación y el proponer ellos mismos, estas acciones(16).

Material y métodos El estado de Veracruz es el quinto estado productor de miel y el primero como productor de cera, en México. Dentro del estado se seleccionó la región centro apícola (97° 27’ 0’’ N, 95° 26’ 41.9’’ N, 18° 31’ O), que posee aproximadamente 244.86 km2 son bosques, 1.37 km2 es selva, 101.88 km2 (1.72 %) es matorral y 2,698.68 km2 son agroecosistemas y que aporta más del 35 % de la producción estatal de miel y cera(17).

240


Rev Mex Cienc Pecu 2021;12(1):238-255

Muestra y procedimiento Para obtener la información se diseñó y aplicó una encuesta, a 88 apicultores para explorar la relación cognitiva con base a la TDC de Festinger(18), entre la percepción, actitud y comportamiento frente al cambio climático; así como las estrategias de adaptación que se practican o que pueden llegar a implementarse. Debido a que no se contaba con un censo apícola oficial de la región centro, se consideró como población muestral el listado de apicultores a quienes se le expidió la constancia de niveles de infestación de Varroa destructor, (el cual no se consideró como indicador o parámetro de selección), emitida por el órgano rector nacional, en la delegación estatal de la Secretaria de Agricultura Ganadería, Desarrollo rural, Pesca y Alimentación (SAGARPA) durante el periodo 2012-2013; por ser esta la única información disponible para obtener un listado de apicultores. Para estimar el tamaño de muestra se aplicó la fórmula de Scheaffer, William(19), n= N𝜎 2 /[(N-1)D+𝜎 2], considerando como población el listado de apicultores, descrito. Los valores utilizados fueron: n= 247, desviación estándar del número de colmenas (𝜎)= 200.6 y B= 34.4. Con la información colectada se realizó un análisis exploratorio en el programa Statistica© 7, empleando métodos univariados, para las cogniciones percepción, actitud y comportamiento. Finalmente, con análisis bivariados se asociaron las tres cogniciones para explorar la presencia de la disonancia entre ellas.

Cuestionario Se diseñó y aplicó un cuestionario con 10 preguntas abiertas para las cogniciones de percepción y comportamiento que se categorizaron de acuerdo con las respuestas de los apicultores; se realizó un análisis de contenido(20), identificándose categorías analíticas emergentes. Las preguntas de actitud consideraron la disposición de los apicultores ante nueve estrategias de adaptación ante el cambio climático, para ello se dispuso cada ítem en escala de Lickert, donde las categorías y sus valores fueron: (5) Totalmente de acuerdo (TDA), (4) De acuerdo (DA), (3) Indiferente (IN), (2) En desacuerdo (ED), (1) Totalmente en desacuerdo (TED). Considerando el valor de respuesta (3) como una actitud positiva baja y la respuesta (5) como una actitud positiva muy alta. La fórmula Lickert se definió como: , donde, IL (índice Lickert); PT (puntuación total) y Ni (número total de afirmaciones).

241


Rev Mex Cienc Pecu 2021;12(1):238-255

Para explorar los elementos disonantes a nivel cognitivo se analizaron histogramas bivariados, delimitados por una matriz para interpretar el estado incongruente(21). Se emplearon cuatro cuadrantes en el que cada uno representa un posible estado cognitivo en los apicultores, de forma positiva o negativa de la siguiente forma (Figura 1): Cuadrante I, disonante positivo: actitud negativa (1) y (2) hacia las estrategias de adaptación, pero que si las lleva a cabo. Cuadrante II, consonante positiva: actitud positiva (1), (2) y (3), hacia las estrategias de adaptación y que si las lleva a cabo. Cuadrante III, consonante negativa: actitud negativa (1) y (2) hacia las estrategias de adaptación y no las lleva a cabo. Y Cuadrante IV, disonante negativo: actitud positiva (1), (2) y (3) hacia las estrategias de adaptación pero que no las lleva a cabo. Figura 1: Matriz de decisión del estado cognitivo entre la actitud versus el comportamiento

Resultados Percepción de los apicultores ante el cambio climático Para saber si, el cambio climático representaba un problema y la importancia que pudiera tener con relación a otras situaciones, la primera pregunta fue: ¿Para usted cuál es el principal problema que enfrenta la apicultura actualmente? El 66.4 % de las respuestas fue “la variación climática” seguido de “la variación en las temporadas de floración”. La siguiente respuesta con mayor frecuencia fue la falta de espacio o incremento en el número de apiarios por área (17.1 %) (Figura 2).

242


Rev Mex Cienc Pecu 2021;12(1):238-255

Figura 2: Percepción del principal problema de la apicultura en la región centro

En la pregunta número dos, ¿Qué entiende por cambio climático? el 30.2 % dijo que es “un problema de desfase en las estaciones del año”, otro 24 % como “los cambios en los ciclos naturales por causa de la deforestación”, un 13.5 % respondió que “no sabe” y un 12.5 % mencionó “el calentamiento global” (CG) (Figura 3). Figura 3: Percepción del concepto del cambio climático por los apicultores

Al preguntar ¿Por qué medio de comunicación se enteró del cambio climático? La mayor frecuencia de respuesta fue por la televisión (39 %) como el medio de comunicación más importante para obtener información, seguida por la información difundida en los periódicos (20 %). La siguiente pregunta ¿Recuerda algún evento climático extremo que haya afectado la apicultura? el 70 % respondió “Si”. De esos el 58 % mencionó como principal evento “la 243


Rev Mex Cienc Pecu 2021;12(1):238-255

escasez de floración”, como consecuencia de un evento climático que los apicultores denominaron “una helada inesperada”, en dos zonas diferentes; una fue la zona del altiplano (51 %) correspondiente al estado de Veracruz y la otra en el altiplano correspondiente al estado de Puebla (59 %). Dado que el promedio de experiencia de los productores, de la región era de 20 años en la actividad(8), se preguntó ¿Recuerda un año en particular en el que la producción de miel haya sido baja o mala?, el 35.2 % de los apicultores percibió el 2010, por la presencia de un huracán. Aunque al revisar los registros del volumen de producción del estado, el año 2005 fue el de menor producción(17) y solo el 1.4 % de los apicultores, recordó ese año como, “un mal año en la producción apícola” (Figura 4). Se observó que, en el 2010 México fue impactado por el huracán Karl que afecto esta región apícola con la perdida de colmenas(22), confirmando la relación entre el fenómeno meteorológico y la producción de miel, a pesar que este suceso no coincide con los registros oficiales de producción en ese año(17). Pero para los apicultores el impacto económico marco ese año, como un mal año para la producción. Figura 4: Percepción de los años con presencia de eventos climáticos extremos que dañaron la apicultura de la región centro, contra la producción total reportada en el estado

Con base en la percepción de las condiciones climáticas en las últimas dos décadas el 97.7 % percibe que el clima en la región ha cambiado. Por ello en la siguiente pregunta: ¿Cómo han cambiado los siguientes factores climáticos: temperatura, precipitación, sequía y heladas en los últimos doce años? Para dar respuesta, se establecieron tres categorías de cambio: a) cualitativo, si el apicultor percibió un aumento, disminución o constancia de los factores climáticos; b) frecuencia, si se percibía un aumento, disminución o constancia en el patrón del evento y por último c) intensidad, si los eventos habían disminuido o incrementado la fuerza de impacto. 244


Rev Mex Cienc Pecu 2021;12(1):238-255

Se registró que el 95.5 % de los productores percibieron un incremento cualitativo en la temperatura, 71.6 % en precipitación y 47.7 % en sequias, pero ningún cambio en las heladas. Respecto a los cambios en frecuencia el 83 % de los individuos percibió un aumento en la temperatura, 56.8 % en precipitación y 30.7 % las sequias, mientras que en las heladas no se percibieron cambios. En intensidad, 87.5 % percibió que los cambios en temperatura son más severos, 69.3 % que la precipitación es más intensa, a su vez que un 59.1 % percibe que las condiciones de sequias se mantienen igual y 38.6 % que las heladas se ha mantenido constantes (Figura 5). Figura 5: Cambios en cuatro factores climáticos que intervienen en la actividad apícola

En la pregunta ocho ¿En los últimos años ha notado cambios en las floraciones de interés apícola? el 100 %, percibió cambios en las floraciones y que han afectado los volúmenes de producción miel. Con base a ello, se les pregunto ¿Conoce, algunas medidas de adaptación en la apicultura para reducir el impacto del cambio climático? y ¿Cuáles conoce?, el 71.6 % tenían conocimiento de alguna estrategia de adaptación: reforestación con especies melíferas (35 %), alimentación artificial (32 %), recambio de reinas (11.1 %), mejor manejo de apiario (11.1 %) y la trashumancia (10 %).

245


Rev Mex Cienc Pecu 2021;12(1):238-255

Actitud de los apicultores frente al cambio climático La frecuencia de respuesta en las nueve afirmaciones, se observan el Cuadro 1 donde la actividad de “Reforestar”, sobresale con un 92%, que dijo estar “TDA”. El 51.1% de los entrevistados dijo estar “TDA” con el “Recambio de reinas certificadas” aunque, la falta de viabilidad productiva en material biológico que se adquiere, los costos y la desconfianza hacia los distribuidores, influyen de forma negativa en esta actividad. Por ejemplo, en el estado de Yucatán para el recambio de reinas existen criadores de reinas que cubren menos del 1% de la demanda, por lo que el porcentaje faltante se cubre (cuando es en extremo necesario) con abejas reinas de otros estados que elevan el riesgo de portar enfermedades y de ser genotipos poco productivos en la región, por lo que los apicultores, prefieren, posponer esta actividad, el mayor tiempo posible(23). Cuadro 1: Porcentaje de respuestas en las variables de actitud Actitud

Variable 1

2

3

Reforestar

4

5

8.0

92.0

23.9

72.7

Recambio reinas propias

1.1

2.3

Recambio reinas certificadas

1.1

3.4

4.5

39.8

51.1

Cambios en labores de manejo

8.0

10.2

8.0

23.9

50.0

17.0

79.5

Asistencia técnica

1.1

Adopción de las BPPPM

1.1

26.1

72.7

Más horas de trabajo

1.1

19.3

79.5

3.4

17.0

76.1

4.5

15.9

79.5

Registros de floración

1.1

Registros de manejo y labores

2.3

La afirmación de “Cambios en el manejo del apiario ” tuvo un porcentaje acumulado del 50 % en “TDA” y mientras que la otra mitad manifestó una actitud “IN” o negativa. A pesar de que un 72.7 % dijo estar dispuesto a adoptar lo establecido en las Buenas Prácticas Pecuarias en la Producción Primaria de Miel “BPPPM” , su “adopción” se percibe solo como un requisito para acceder a programas de apoyos y no como el método para producir miel bajo recomendaciones técnicas, que debieran ayudar a los apicultores a

246


Rev Mex Cienc Pecu 2021;12(1):238-255

realizar los registros de manejo, para la planeación de trabajo del siguiente ciclo, similar a las acciones que realizan apicultores de otros países como Nigeria(4). Se establecieron dos interrogantes de actitud, que incluyeron percepción y comportamiento. La primera ¿Está usted dispuesto en llevar a cabo alguna de las estrategias anteriores y que no esté realizando actualmente dentro de sus actividades apícolas? y ¿Qué actividad sería esa? La mayor frecuencia de respuesta fue “la reforestación” con el 59 % seguido de un porcentaje de la población que respondió “ninguna” (29 %), otros dijeron “alimentación artificial” (7 %), “cambiar el manejo” (3 %), y solo un 1 % expreso el “recibir asistencia técnica o capacitación”. La última pregunta de la sección fue: ¿Qué acciones cree deberían estar haciendo las instituciones federales y estatales para ayudar a los apicultores a adaptarse al cambio climático? El 46.6 % dijo que “se deben destinar recursos económicos directos”, para que ellos decidan su ejercicio, un 13.6 % que “se deben implementar programas de reforestación de especies melíferas” y un 10.2 % dijo que las instituciones deben “facilitar y agilizar los trámites apícolas”, para los apicultores trashumantes. El porcentaje restante considero acciones como: “prohibición de plaguicidas” (7.9 %), “conservación de áreas naturales” (7.9 %), “capacitación apícola” (5.7 %), “supervisión de apiarios” (3.4 %), “difusión de la importancia de los polinizadores” (2.3 %) y “promover el consumo nacional de miel” (2.2 %).

Comportamiento de los apicultores frente al cambio climático

En esta sección, se preguntó ¿Usted ha implementado alguna estrategia para adaptarse a las condiciones actuales del clima y mantener la producción?, el 80.7 % dijo llevar a cabo al menos alguna de las estrategias, como medida de adaptación. No obstante, el 20.3 % restante realiza alguna de estas actividades, pero no las identifican como estrategias de adaptación, como son, la alimentación artificial (42.3 %), la reforestación de especies melíferas, (26.8 %), el recambio de reinas (12.7 %), cambios de manejo en el apiario (9.9 %), la trashumancia (7.0 %) y mejoramiento genético (1.4 %). Para finalizar la sección se preguntó ¿Cuál es la principal limitante u obstáculo para no realizar alguna de las estrategias anteriores?; solo el 89.7 % respondió, de esos 56.9 % dijo por “falta de capital económico”; 15.4 % “por indiferencia”; 5.0 % “falta de espacios físicos propios” (para reforestar), 7.6 % “falta de apoyos por el gobierno”, 5.0 % “falta de tiempo” y 2.5 % por “burocracia institucional” en trámites para la movilidad de colmenas.

247


Rev Mex Cienc Pecu 2021;12(1):238-255

Disonancia cognitiva ante el cambio climático

Se observó que los apicultores perciben el cambio climático como un problema en la actividad que desempeñan, mediante un sistema de ideas asociadas a su actividad, es decir, como desfase o cambio en las estaciones (lluvias, secas y heladas) y floraciones en un ciclo anual. Esto demuestra que la percepción se construye con base a las afectaciones que se presentan en la apicultura y se ignoran, los orígenes y causas del fenómeno a nivel global. Por lo que, la actitud y el comportamiento para implementar estrategias de adaptación, dependerá de la percepción de los impactos negativos del fenómeno en la apicultura, tal y como se observa por la matriz de decisión en la Figura 1 y se aprecian de la siguiente forma: Reforestación. - Presentó disonancia negativa, ya que el 72.73 % de los apicultores expresaron estar “TDA” en realizarla. Para ellos la reforestación de especies melíferas es relevante, sin embargo, solo el 19.33 % realiza esta acción (Figura 6A); los apicultores disonantes se justifican reforzando la idea de la falta de espacios propios para realizarla.

248


Rev Mex Cienc Pecu 2021;12(1):238-255

Figura 6: Disonancia cognitiva en los apicultores respecto a la actitud y comportamiento en las estrategias de adaptación A

B

C

D

F

E

G

H

A) Reforestación, B) Recambio con crías de reinas propias, C) Recambio con crías de reinas certificadas, D) Manejo, E) Buenas prácticas de producción y manufactura, F) Mayor número de visitas al apiario, G) Asistencia técnica para alimentación artificial, H) Registro de floraciones para la trashumancia.

El Recambio de reinas. - Presentó una disonancia negativa, los apicultores están “TDA” (71.59 %) y “DA” (23.86 %) pero solo el 1.14 % realiza esta práctica. No obstante, en esta 249


Rev Mex Cienc Pecu 2021;12(1):238-255

misma estrategia se observaron apicultores consonantes negativos que, afirmaron estar “ED” (2.27 %) y “TED” (1.14 %) (Figura 6B). Respecto al recambio con reinas propias, esta actividad presentó un estado similar de disonancia entre la actitud “TDA” (43.18 %) y DA (7.95) versus el comportamiento, ya que solo 9.09 % llevan a cabo esta acción. Mientras 4.55 % mantuvo el estado consonante negativo (Figura 6C). Actividades de manejo. - Aquí se observó que la mayoría de los apicultores que estuvieron “TDA” (47.73 %), “DA” (20.45 %) y los “in” (7.95 %) se encontraron en un estado disonante negativo y solo el 5.68 % a realizado algún cambio en el manejo de sus apiarios. Y en menor porcentaje los consonante negativos en “ED” (7.95 %) y “TED” (7.95 %) (Figura 6D). BPPPM. - Presentó disonancia negativa entre el porcentaje de apicultores que dijeron estar, “TDA” (75 %), “DA” (15.91 %) e “IN” (1.14 %), versus el 7.96 % que si ha realizado acciones con las BPPPM (Figura 6E). La alimentación artificial y asistencia técnica.- La alimentación artificial de las abejas por ser un elemento ligado a la capacitación técnica, se contrasto con la disposición en los apicultores de asistir a cursos de capacitación, por lo que el estado cognitivo disonante negativo se presentó en el 65.91 % de los apicultores “TDA” y “DA” versus el comportamiento, ya que solo el 30.68 % dijo llevar acabo esta práctica; mientras que los apicultores consonantes negativos se presentaron en un 2.28 % (Figura 6G). Bitácora de floración, de trabajo y Trashumancia.- Las trashumancia aunque es el principal tipo de apicultura que se práctica no se concibe como una estrategia de adaptación, per se, sin embargo al contrastar esta actividad con la disposición de realizar bitácoras de floraciones, se observó que el 92.05 % estaría dispuesto a realizar dichos registros e identifican la necesidad e importancia de ello, pero, solo un 4.55 % lo hace (Figura 6H), demostrando un estado de disonancia negativa entre estas dos ideas. En el Cuadro 2 se observa que la mayoría de los apicultores se encuentra en un estado de disonancia cognitiva negativa, lo que, de acuerdo con la TDC, es un estado cognitivo común, ya pocas cosas son lo suficientemente claras como para que las opiniones y conductas no sean una mezcla de contradicciones (12).

250


Rev Mex Cienc Pecu 2021;12(1):238-255

Cuadro 2: Estado cognitivo entre la actitud y comportamiento de las estrategias de adaptación en la apicultura Estrategia

Reforestar

Disonante Consonante Consonante Disonante Total (%) (+) (-) (+) (-) 1.1

6.8

19.3

72.8

100

Recambio de reinas propias

0

3.3

1.1

95.6

100

Recambio reinas certificadas

0

4.5

10.3

85.2

100

2.3

16

5.7

76.0

100

Asistencia técnica

1

2.2

30.8

66.0

100

Adopción de BPPPM

0

1.1

8.0

90.9

100

Más días de trabajo

0

0

7.9

92.1

100

2.2

4.6

92.1

100

Cambios en labores de manejo

Registro de floración

1.1

Discusión El análisis del sistema de cogniciones de los apicultores desde la TDC de Festinger, sobre el cambio climático, demostró que la mayoría de los apicultores presentan disonancia cognitiva negativa. Los apicultores perciben los efectos del cambio climático en la apicultura; sin embargo, no poseen una definición precisa del concepto y de las causas del fenómeno, lo que demuestra vacíos de información, así como, ideas erráticas(24). Esta confusión del concepto se atribuye a la información mediática que se recibe(25). Por ejemplo, la comunidad científica habla de cambio climático, los noticieros de calentamiento global y la industria petrolera de gases efecto invernadero (GEI); lo que produce una idea heterogénea en el público. Ya que, la correcta valoración subjetiva en la población sobre el fenómeno debería motivar cambios en el comportamiento bajo una responsabilidad personal. Dado que, la comprensión de la influencia humana al cambio climático es un requisito previo para aceptar la necesidad de llevar a cabo acciones de adaptación y mitigación(26,27). En esta investigación la percepción del cambio climático en la apicultura estuvo motivada por las necesidades productivas de los apicultores y en los impactos negativos que en la 251


Rev Mex Cienc Pecu 2021;12(1):238-255

apicultura se generan(6,28). Similar a apicultores y cazadores de miel en África, que perciben los efectos negativos del cambio climático, a través del aumento o descenso de los patrones de temperatura y precipitación, según la temporada del año y de acuerdo con el tipo de apicultura que realizan(29). Y como productores de maíz en el norte de EE.UU. quienes, reconocen que alguna forma de cambio climático existe, pero, minimizan la participación de las actividades humanas(15). Al contrastar la actitud y el comportamiento la mayoría presentó un estado de disonancia negativa; a pesar de la disposición positiva de los apicultores (IL: 4.7). La incompatibilidad simultánea entre esas dos cogniciones generó argumentos dirigidos a reducir el estado disonante(13). Los individuos no incorporan los efectos y orígenes del cambio climático(12) y de forma consciente delegan la responsabilidad y solución a otros ciudadanos o grupos, incluyendo autoridades, especialistas o instituciones de gobierno(30). Lo anterior demuestra que, el cambio climático se percibe y reconoce de cierta forma(26) pero, solo cuando la problemática impacta de forma económica, es que, por sentido común, se incorpora al sistema de cogniciones como prioridad(25). Por lo anterior la presencia de disonancia se genera cuando, el apicultor no es capaz de llevar a cabo las acciones que dice estaría dispuesto a realizar para mantener su medio de vida. Relativizando la problemática para reducir el estrés generado ante la incongruencia en el sistema cognoscitivo(13). Lo que podría causar efectos negativos potenciales en la apicultura como: una baja rentabilidad, pobreza y el abandono de la actividad(7), ya que asumen que “contra el clima nada puede hacerse”. Por ello se requiere integrar un programa de capacitación dirigido a informar y explicar la naturaleza del cambio climático y sus impactos; de ubicar al apicultor dentro de este contexto, donde pueda adoptar elementos que le permitan una percepción clara, que promueva una actitud positiva y motive sus acciones. En tal sentido, se requiere diseñar programas no solo de capacitación formal, si no de información y divulgación que, por los medios de comunicación masiva, puedan llegar a la población.

Conclusiones e implicaciones El estudio demuestra que el fenómeno del cambio climático es perceptible en los apicultores como el principal problema de la actividad, no obstante, las causas y efectos del fenómeno no se relacionan a otros aspectos en su vida cotidiana. A pesar de tener una actitud positiva hacia las estrategias de adaptación, éstas en general no se llevan a cabo, por lo que la disonancia cognitiva presente entre la actitud y el comportamiento se reduce a través de argumentos racionales que les permiten justificar la incongruencia entre lo que 252


Rev Mex Cienc Pecu 2021;12(1):238-255

quieren hacer y lo que realmente hacen. Para finalizar se recomienda incluir las necesidades de los apicultores y considerar el sistema de creencias que pueden influir en la adopción de estrategias de adaptación. Lo que hace necesario involucrar otras variables sociales, económicas y tecnológicas que pudieran influir en el estado de disonancia cognitiva presente. Literatura citada: 1. Ocampo O. El cambio climático y su impacto en el agro. Rev Ing 2011(33):115-123. https://www.redalyc.org/articulo.oa?id=121022658012. Consultado: Jul 20, 2018. 2. Vergara W, Rios A, Trapido P, Malarín H. Agricultura y Clima Futuro en América Latina y el Caribe: Impactos sistémicos y posibles respuestas. Washington, D.C.: Banco Interamericano de Desarrollo. 2014:24. 3. Huerta G. La apicultura en el desarrollo. 2008:25-27. 4. FAOSTAT. Datos sobre alimentación y agricultura. Ganadería primaria/producción. FAO. 2019. http://www.fao.org/faostat/es/#data/QL. Consultado Feb 17, 2017. 5. Delgado DI, Eglee PM, Galindo-Cardona A, Giray T. Forecasting the influence of climate change on agroecosystem services: Potential impacts on honey yields in a small-island developing state. https://doi.org/10.1155/2012/951215 Psyche 2012:1-10. Accessed: Ago 14, 2018. 6. Smith WJ, Liu Z, Safi AS, Chief K. Climate change perception, observation and policy support in rural Nevada: A comparative analysis of Native Americans, non-native ranchers and farmers and mainstream America. Environ Sci Policy 2014;42:101-122. http://www.sciencedirect.com/science/article/pii/S1462901114000641. Accessed: Jul 17, 2018. 7. Castellanos-Potenciano B, Gallardo-López F, Díaz-Padilla G, Pérez-Vázquez A, Landeros-Sánchez C. Spatio-temporal mobility of apiculture affected by the climate change in the beekeeping of the Gulf of Mexico. Appl Ecol Environ Res 2017;15(4):163-175. http://www.aloki.hu/indvol15_4.htm. 8. Castellanos-Potenciano BP, Gallardo-López F, Díaz-Padilla G, Pérez-Vázquez A, Landeros-Sánchez C, Sol-Sánchez A. Apiculture in the humid tropics: Socio-economic stratification and beekeeper production technology along the Gulf of Mexico. Glob Sci Res J 2015;3(9):321-329. Accessed: Sep 10, 2018. 9. Lehébel-Péron A, Sidawy P, Dounias E, Schatz B. Attuning local and scientific knowledge in the context of global change: The case of heather honey production in southern France. J Rur Stu 2016; 44:132-142. 253


Rev Mex Cienc Pecu 2021;12(1):238-255

10. Tam J, McDaniels TL. Understanding individual risk perceptions and preferences for climate change adaptations in biological conservation. Environ Sci Pol 2013; 27:114123. http://www.sciencedirect.com/science/article/pii/S1462901112002328. 11. Festinger L. A theory of cognitive dissonance. Stanford, California: Stanford University Press; 2017. 12. Oltra C, Sola R, Sala R, Prades A, Gamero N. Cambio climático: Percepciones y discursos públicos. Cambio climático: Percepciones y discursos públicos. Barcelona: Centro de Investigación Sociotécnica-CIEMAT; 2009:1-23. 13. Ramoa-Meza J. Acciones para reducir la disonancia cognitiva en el personal civil de la Escuela de Formación de Guardias Nacionales (Esguarnac). Rev Mun FESC 2018;7(14):31-41. http://www.fesc.edu.co/Revistas/OJS/index.php/mundofesc/article/view/139/187. Consultado: Jun 8, 2018 14. Ayal DY, Leal Filho W. Farmers' perceptions of climate variability and its adverse impacts on crop and livestock production in Ethiopia. J Ar Environ 2017;140:20-28. http://www.sciencedirect.com/science/article/pii/S0140196317300071. 15. Mase AS, Cho H, Prokopy LS. Enhancing the Social Amplification of Risk Framework (SARF) by exploring trust, the availability heuristic, and agricultural advisors' belief in climate change. J Environ Psycho 2015; 41:166-176. http://www.sciencedirect.com/science/article/pii/S027249441500002X. 16. Magrin G. Adaptación al cambio climático en América Latina y el Caribe In: (CEPAL) CEpALyeC editor. Adaptación al cambio climático en América Latina y el Caribe Impreso en Naciones Unidas, Santiago de Chile 2015:80. 17. SIAP. Anuario Estadístico de la Producción Ganadera. Anuario Estadístico de la Producción Ganadera. 2017. 18. Ovejero A. La teoría de la disonancia cognoscitiva. Psicothema 1993;5(1):201-206. https://www.redalyc.org/articulo.oa?id=72705116. Consultado: Nov 14, 2017. 19. Scheaffer R, William M, Lyman O. Elementos del muestreo. 6ta ed.; Madrid, España: Paraninfo; 2006. 20. Kaefer F, Roper J, Sinha PA. Software-assisted qualitative content analysis of news articles: Example and reflections. Forum: Qualitative Social Res 2015;16(2). 21. Cisneros SP. Percepción, actitud y comportamiento de productores ganaderos y otros actores sociales hacia la sustentabilidad de la ganadería bovina [Tesis doctorado]. Veracruz, México: Colegio de Postgraduados; 2015. 254


Rev Mex Cienc Pecu 2021;12(1):238-255

22. CONAGUA. Resumen del huracán Karl. In: CONAGUA editor. Resumen del huracán Karl. 2010. 23. De Araujo FC, Quezada EJJ. Las abejas reinas en los sistemas apícolas. Bioagrociencias 2011;4(2):28-31. 24. Ukamaka DM, Eberechukwu NL. Indigenous climate change adaptation strategies used by honey producers in rural communities of Enugu State, Nigeria. J Agri Exten 2018;22(2):180-192. 25. González GEJ. La representación social del cambio climático: una revisión internacional. Rev Mex Inv Educ 2012; 17:1035-1062. 26. McClelland JC. Reconstructing student conceptions of climate change; An inquiry approach [Thesis or Dissertation]. Minnesota, USA: University of Minnesota 2015. 27. Sander van der L. Determinants and measurement of climate change risk perception, worry, and concern. In: Nisbet MC, et al editors. The Oxford encyclopedia of climate change communication. Oxford, UK: Oxford University Press; 2017:1-58. 28. Hegland SJ, Nielsen A, Lázaro A, Bjerknes AL, Totland O. How does climate warming affect plant-pollinator interactions? Ecol Lett 2009;12(2):184-195. https://doi.org/10.1111/j.1461-0248.2008.01269.x. 29. Paraïso A, Sossou A, Iz-Haquou D, Nérice RAS. Perceptions and adaptations of beekeepers and honey hunters to climate change: The case of the communes of Natitingou and Tanguieta in northwest of Benin. Afri Crop Sci J 2012;20:523-532. 30. Peláez GM, Bravo DB, Gutiérrez-Yurrita J. Percepción ciudadana de la institucionalización de la política mexicana de cambio climático. Rev Aran de Der Amb 2015;30.

255


https://doi.org/10.22319/rmcp.v12i1.5408 Artículo

Evaluación de dos fuentes suplementarias de clorhidrato de zilpaterol sobre la calidad de la carne y los rasgos de la canal de toros Bos indicus cruzados en los trópicos

Pedro Antonio Alvarado García a María Salud Rubio Lozano a* Héctor Salvador Sumano López b Luis Ocampo Camberos b Graciela Guadalupe Tapia Pérez c Enrique Jesús Delgado Suárez d Jeny Aguilar Acevedo b

a

Universidad Nacional Autónoma de México (UNAM). Facultad de Medicina Veterinaria y Zootecnia (FMVZ), Centro de Enseñanza Práctica, Investigación en Producción y Salud Animal. México. b

UNAM, FMVZ Departamento de Fisiología y Farmacología. México.

c

UNAM, FMVZ, Departamento de Genética y Bioestadística, Departamento de Medicina Preventiva y Salud Pública. México. d

UNAM, FMVZ. Avenida Universidad 3000, Ciudad Universitaria, Ciudad de México, México.

* Autor de correspondencia:msalud65@gmail.com

Resumen: Se estudió el efecto de dos marcas de clorhidrato de zilpaterol (ZH) en las características de la canal y la calidad de la carne de toros jóvenes de la especie Bos indicus cruzados en 256


Rev Mex Cienc Pecu 2021;12(1):256-272

condiciones tropicales. La formulación patentada de ZH (Zilmax®, ZHp) y una marca genérica (Zipamix®, ZHg) se añadieron al pienso (6 ppm) durante 30 días antes del sacrificio. Los animales (n= 288) se asignaron aleatoriamente a 1 de 3 dietas, con 32 animales por corral y 3 réplicas, con un total de 96 toros por tratamiento: 1) dieta basal sin ZH (testigo), 2) dieta basal suplementada con Zipamix® a 6 ppm en la dieta como base de la alimentación (ZHg), y 3) dieta basal suplementada con Zilmax® a la misma concentración en la alimentación (ZHp). Los rasgos de rendimiento de la canal mejoraron significativamente con la suplementación con ZH. Las canales de los toros tratados con ZH pesaron 6-9 kg más (P=0.0023, y produjeron unos 8-10 kg más de tejido magro (P<0.0001), que el grupo testigo. Los rasgos de calidad de la canal se vieron menos afectados por la suplementación con ZH. Entre los atributos de calidad de la carne, el pH final de ZHg (5.81) y ZHp (5,89) fue mayor (P=0.0022) que el del grupo testigo (5.78). Los resultados mostraron que ambas marcas de ZH, cuando se administran durante 30 días antes del sacrificio, tal como recomienda el fabricante, mejoran la mayoría de los rasgos de rendimiento de la canal sin comprometer los atributos de calidad de la canal o de la carne. Por lo tanto, los productores de carne de vacuno tropical pueden utilizar la formulación ZH de menor coste para mejorar su productividad. Palabras clave: Clorhidrato de zilpaterol, Genérico, Grado de rendimiento, Grado de calidad, Carcasa, Res, Bos indicus.

Recibido: 07/06/2019 Aceptado: 09/12/2019

Introducción Se prevé que la demanda de alimentos aumentará un 70 % para el año 2050(1). Esto supone un reto importante para la producción de alimentos, especialmente de carnes, que representan una proporción significativa de la dieta humana(1). En consecuencia, los productores de carne han adoptado diferentes tecnologías destinadas a maximizar la productividad. Entre ellas, se ha demostrado que los promotores del crecimiento mejoran el rendimiento de los animales y los rasgos de la canal en varias especies ganaderas, como el ganado vacuno de carne(2). El clorhidrato de zilpaterol (ZH) está aprobado como promotor del crecimiento del ganado vacuno en México, Norteamérica y Sudáfrica. Se ha reportado que los novillos suplementados con ZH mejoran su peso en canal entre un 5 y un 7 % y su porcentaje de faenado entre un 3 y un 3.5 %, en comparación con los animales no tratados(3,4). Además, se ha demostrado que la suplementación del alimento con ZH aumenta el área del músculo longissimus(5), que está positivamente correlacionada con el rendimiento de la carne.

257


Rev Mex Cienc Pecu 2021;12(1):256-272

Mientras que los efectos positivos de la ZH sobre los rasgos de la canal están bien documentados en el ganado Bos taurus, los estudios sobre Bos indicus son muy limitados. Esta información es relevante en varios países, como México, donde el 90 % de la población de sacrificio tiene un fuerte antecedente genético de B. indicus(6), el cual se asocia con rendimiento de crecimiento, rasgos de la canal y características de calidad de la carne inferiores. Además, aunque se sabe que la suplementación con ZH aumenta la utilidad por animal(7), el coste por kilo de carne producida con ZH se ha estimado entre 1.53 y 1.62 USD(8), lo que representa entre el 35 y el 40 % del precio medio de mercado por kilo de carne en canal en México(9). Tras la expiración de la patente de la fórmula de la ZH, han aparecido varias marcas genéricas de ZH (ZHg). Dado que el ZHg puede representar una alternativa más barata en comparación con el producto patentado (ZHp), recientemente se han estudiado marcas de ZHg. Avendaño-Reyes et al(2) no observaron diferencias en el peso de sacrificio ni en los rasgos de la canal del ganado cruzado (75 % B. indicus, 25 % B. taurus) tratados con un ZHg o con el ZHp. Sin embargo, este estudio se realizó con un número limitado de animales por tratamiento (n=15). Una publicación anterior de nuestro grupo de investigación(10) también informa de que no hay diferencias en el rendimiento en el engorde, la composición proximal de la carne o la aceptabilidad por parte del consumidor de la carne del ganado cruzado (75 % B. indicus, 25 % B. taurus) tratado con ZHg o con ZHp. Sin embargo, los datos sobre sus efectos en las características de la canal y la calidad de la carne son limitados. Hace falta esta información para lograr una mejor evaluación de la relación coste-beneficio del uso de ZH en el ganado de engorde de los genotipos de B. indicus en condiciones comerciales. Por lo tanto, el objetivo de este estudio fue evaluar las diferencias en los rasgos de la canal y la calidad de la carne de los toros B. indicus jóvenes suplementados con ZHg (Zipamix®, PiSA agropecuaria, México) o con ZHp (Zilmax, MSD, Summit, NJ, EEUUA) en condiciones tropicales.

Material y métodos Animales y tratamientos El estudio se realizó durante el verano de 2016 en una empresa de San Luis Potosí, México, que integra una operación de engorde comercial y un matadero de ganado vacuno. Todos los animales fueron manejados de acuerdo con las normas oficiales mexicanas para el cuidado y manejo de animales durante el transporte y el sacrificio(11,12). Se seleccionaron para el experimento un total de 810 toros jóvenes cruzados, basándose en los siguientes criterios: 1) Sólo se admitieron animales sanos, 2) con un mínimo de 50 % de antecedentes genéticos de B. indicus, 3) de 24 meses de edad o menos, y 4) con no menos de 430 kg de peso vivo. Los animales que cumplían estos requisitos se distribuyeron en nueve corrales de 90 animales cada uno. Los corrales eran de 40 x 45 m y tenían un 16 % de sombra

258


Rev Mex Cienc Pecu 2021;12(1):256-272

que cubría principalmente los comederos. Los animales tenían acceso a agua a voluntad por medio de sistemas de agua automatizados (dos por corral), situados en el lateral de cada corral. Tras la selección, a todos los toros se les inyectó una dosis de 200 µg/kg de ivermectina (Dectiver®, Lapisa, México) para controlar los ectoparásitos, y se los vacunó contra las enfermedades (Ultrabac/somubac®; Zoetis, México). También recibieron un implante anabólico (200 mg de acetato de trembolona y 28 mg de benzoato de estradiol, Synovexplus®, Zoetis, México) en la oreja izquierda. Los animales se sometieron a un periodo de adaptación de 2 meses antes de iniciar la prueba. Los toros se controlaron diariamente, y los animales con signos evidentes de enfermedad o lesiones se retiraron del ensayo. Finalmente, para realizar el experimento, los animales se asignaron aleatoriamente a tres grupos (n= 32) con tres réplicas cada uno, como sigue 1) Dieta basal sin ZH (testigo), 2) Dieta basal suplementada con la marca genérica de ZH Zipamix® a 6 ppm en la dieta, como base de la alimentación (ZHg), según las instrucciones del fabricante, y 3) Dieta basal suplementada con la marca patentada de ZH Zilmax® a la misma concentración en la alimentación (ZHp), según las recomendaciones del fabricante. Las dos marcas comerciales de ZH contienen 48 g de ingrediente activo por kilo de producto, y la cantidad de preparado comercial añadido fue de 125 g/kg de pienso en ambos casos. Todos los grupos recibieron la misma dieta basal a base de maíz (Cuadro 1). Ambas marcas de ZH se incluyeron en la premezcla de vitaminas y minerales antes de incorporarla a la dieta basal. Para ello, se pesó el suplemento de ZH con una precisión de 0.001 g y se mezcló bien durante unos 5 minutos con los demás ingredientes de la premezcla en una batidora de palas. Para evitar la contaminación cruzada, se limpió la batidora antes de preparar cada dieta experimental. La premezcla se preparó semanalmente, y el alimento con y sin ZH se preparó dos veces al día. Se probó la uniformidad de la mezcla de ZH en lotes de 5, 6 y 7 toneladas de alimento suplementado con ZH (12 muestras de cada lote), con la ayuda de microtrazadores (Micro-Tracers Inc., San Francisco, USA), como se describió previamente(13). El alimento se sirvió dos veces al día (a las 0700 y a las 1300 h) utilizando camiones automáticos Rotomix® (International Trucks®, TX, USA), con una máquina de pesaje integrada para verificar la cantidad. Se entregó un exceso de alimento del 3 % basado en los registros de consumo de alimentos anteriores por peso corporal. El alimento no consumido se retiró, se pesó y se registró diariamente.

259


Rev Mex Cienc Pecu 2021;12(1):256-272

Cuadro 1: Ingredientes de la dieta y composición química de la dieta basal con base de materia seca (MS) Ingrediente Maíz laminado en seco Granos secos de destilería Paja de cebada Melaza de caña de azúcar Ensilado de maíz Sebo Elit-f (premezcla de vitaminas y minerales) Harina de soya

% 61.0 14.0 8.0 6.0 5.0 3.0 2.5 0.5

Composición química1 MS, % Proteína bruta, % Grasa bruta (extracto de éter), % Carbohidratos (excluyendo la fibra), % Fibra detergente neutra, % Fibra detergente ácida, % Ceniza, % Calcio, % Fósforo, % NEm, Mcal/kg NEg, Mcal/kg

80.9 14.0 6.6 56.4 18.4 11.5 4.6 0.9 0.3 2.2 1.5

Cálculos de NEm y NEg utilizando las ecuaciones propuestas por el NRC (2000).

El periodo de alimentación experimental duró 30 días, seguido de un periodo de retirada de ZHg y ZHp de 3 días, durante los cuales todos los animales recibieron la dieta basal no suplementada. El tercer día de retirada de ZH, los toros recibieron sólo el 40 % de su ración diaria habitual. Posteriormente, 32 animales de cada tratamiento se seleccionaron al azar y enviados al matadero durante tres días consecutivos. Por lo tanto, se evaluó un total de 96 toros por tratamiento. El transporte al matadero se realizó a primera hora de la mañana (hacia las 0500 h). El viaje duró unos 10 min, ya que el matadero está a sólo 1 km del cebadero. A fin de evitar el sesgo, el ensayo se realizó como un estudio ciego aleatorio. Así, los investigadores que participaron en la evaluación de la calidad de la canal y de la carne no sabían a qué tratamiento pertenecían los animales. Además, los animales de cada tratamiento se sacrificaron en un orden diferente cada uno de los 3 días. El sacrificio y la fabricación se llevaron a cabo en un matadero inspeccionado por el gobierno federal, siguiendo la norma

260


Rev Mex Cienc Pecu 2021;12(1):256-272

oficial(11,12,14,15). Se registró el peso de la canal en caliente (PCC) antes del enfriamiento de la canal a 2°C durante 24 h.

Características de la canal Los rasgos de la canal se evaluaron según el Sistema de Clasificación de Canales de Vacuno del Departamento de Agricultura de Estados Unidos (USDA)(16). La madurez general se determinó en base a la madurez magra y esquelética. Se asignó a las canales uno de los siguientes grados de madurez global: 100=USDA A100/B00 o menos, 200=USDA B00-C00, 300=USDA C00-D00, 400=USDA D00-E00, 500=USDA E00 o más. También se utilizaron los estándares visuales del USDA para determinar el grado de marmoleo del músculo longissimus thoracis (LT): 100= prácticamente desprovisto 00, 200= trazas00, 300=ligero00, 400=moderado00, 500=pequeño00, 600=moderado00 y 700=poco00. Los grados de calidad del USDA se asignaron en función del marmoleo y la madurez, como sigue: Utilitaria=300, Comercial=400, Estándar=500, Selecta=600, Preferida=700, Óptima=800. La grasa de riñón, pelvis y corazón (RPC) se estimó como porcentaje del peso de la canal caliente. También se midió el espesor de la grasa dorsal en la 12ª costilla, en ¾ de la parte superior del costillar y perpendicular al LT. Además, se dibujó en un acetato el área magra del costillar y se utilizó para determinar el área del músculo longissimus (ML) con la ayuda de un planímetro (rodillo tipo digital Placom KP-90N). Estos factores se utilizaron para asignar las canales a los grados de rendimiento 1 a 5 según el USDA(16).

Atributos de calidad de la carne También se determinó el color de la carne y el pH final o pH último (pHu) del LT a las 24 h post mórtem, tras evaluar los rasgos de la canal. El pHu se determinó como la media de dos medidas tomadas con un medidor de pH digital Hanna H199163, con compensación automática de temperatura y acoplado a una sonda de penetración (Hanna Instruments, Woonsocket, Rhode Island, EE.UU.).Las medidas de color se realizaron siguiendo las directrices de la American Meat Science Association(17). Se dejó que el LT floreciera a 2 o 3 ºC durante unos 30 min antes de medir las variables instrumentales de color. Se utilizó un HunterLab® MiniScan EZ 4500L (Hunter Associates Laboratory, Reston, Virginia) con un observador de 10º y un tamaño de apertura de 25 mm, ajustado con el iluminante A, el componente especular excluido, y la escala CIELA. El espectrofotómetro se calibró antes de realizar las mediciones de color y a intervalos de 100 lecturas. Se tomaron un total de 3 a 4 lecturas de cada ML, en una región libre de depósitos de grasa o tejido conectivo. Los datos de color resultantes (luminosidad, L*; rojez, a*; amarillez, b*; tono, h*; croma, C*) se promediaron para realizar comparaciones estadísticas.

261


Rev Mex Cienc Pecu 2021;12(1):256-272

Se utilizaron los valores de pHu y L* para estimar la incidencia de la carne de vacuno de corte oscuro para cada tratamiento. Los criterios utilizados para identificar un corte oscuro fueron pHu>6,0(18) y L*<35(19). Para los análisis de la fuerza de corte Warner-Bratzler (WBSF) y de la pérdida de cocción, se tomó un filete de 2.5 cm de grosor del ML entre las costillas 10ª y 12ª. El filete se envasó al vacío y se añejó durante 11 días a 11ºC. Al 12° día, se congeló a -18 ºC durante unas 2 semanas y se descongeló lentamente a 4 ºC durante 48 h antes de realizar los análisis. Tanto la pérdida de cocción como el análisis WBSF se determinaron de acuerdo con las Directrices de Investigación de la Asociación Americana de Ciencias de la Carne para la cocción, la evaluación sensorial y las mediciones instrumentales de la terneza de la carne fresca(20), como se ha descrito anteriormente(21).

Análisis estadístico El efecto de la suplementación con ZH sobre los rasgos de la canal y la calidad de la carne se comprobó mediante un análisis de varianza de una vía. Se utilizó el procedimiento del Modelo Lineal General del software Statgraphics Centurion XV, versión 15.2.05 para Windows (Statpoint Technologies Inc., Warrenton, VA). El peso inicial, el grado de genotipo de B. indicus y la edad de sacrificio no difirieron entre los tratamientos. Por lo tanto, estas variables no se consideraron como fuentes de variación en el modelo. Cuando se detectaron diferencias significativas (P<0.05) entre los tratamientos, las medias se diferenciaron mediante el procedimiento de rango de Tukey. Para las variables de proporción, se realizó una prueba de Ji cuadrada con la finalidad de determinar si había asociación entre estas variables y los tratamientos.

Resultados y discusión La suplementación del alimento con ambas marcas de ZH mejoró significativamente la mayoría de los rasgos de rendimiento de la canal en comparación con el grupo testigo (Cuadro 2). Por término medio, las canales de los toros suplementados con ZH eran de 6 a 8 kg más pesadas que las de los animales no tratados. También tuvieron mayores áreas ML y produjeron casi 10 kg más de carne magra que los toros alimentados con la dieta basal. Entre las dos variables de engrasamiento de la canal, el RPC fue menor con el tratamiento ZHg (P=0.0169). Sin embargo, el grado de rendimiento USDA fue similar en ambos tratamientos ZH, y más bajo en comparación con el grupo testigo. Esto es coherente con el mayor contenido de carne magra de las canales de los animales suplementados con ZH, que dio lugar a una mayor proporción de grado de rendimiento 1 del USDA en ambos tratamientos con ZH (Figura 1). En general, los rasgos de rendimiento de la canal entre las marcas de ZH fueron comparables.

262


Rev Mex Cienc Pecu 2021;12(1):256-272

Cuadro 2: Efecto de la suplementación con ZH en los rasgos relacionados con el rendimiento de las canales de los toros Tratamientos1 Valor de Variable Testigo ZHg ZHp P n=96 n=96 n=96 SEE2 Peso vivo inicial, kg 466.44 464.97 465.80 15.40 0.8032 Peso al sacrificio, kg 511.28 518.80 513.60 24.05 0.0872 a b b Peso de la canal en caliente, kg 311.48 319.96 317.22 17.00 0.0023 a b b Carne magra, kg 181.42 191.42 189.68 12.98 <0.0001 2 a b b Área de Longissimus, cm 69.17 75.53 76.89 10.63 <0.0001 Espesor de la grasa dorsal, cm 0.40 0.35 0.40 0.19 0.0562 b a ab Grasa renal, pélvica y cardíaca, % 1.68 1.49 1.58 0.46 0.0169 b a a Grado de rendimiento USDA 2.42 2.07 2.06 0.53 <0.0001 1

Tratamientos: testigo, sin suplementación con ZH; ZHg, ZH genérico (Zipamix®) a 6 ppm en la dieta durante 30 d; ZHp, ZH de patente (Zilmax®) a 6 ppm en la dieta durante 30 d. 2 Error estándar de estimación. a,b Las medias con diferente superíndice dentro de una misma fila son diferentes (P<0.05).

Figura 1: Frecuencia relativa del grado de rendimiento USDA en las canales de toros jóvenes sin suplementación con ZH (testigo) o suplementados con una formulación genérica de ZH (ZHg, Zipamix ®) o una formulación patentada de ZH (ZHp, Zilmax ®) a 6 ppm en la dieta durante 30 días (n=96 por tratamiento) Grado de rendimiento USDA 1.00-1.99 2.00-2.99 3.00-4.00

Frecuencia relativa, %

100 80 60

40 20 0 Control

ZHg

ZHp

Estos resultados son coherentes con estudios anteriores que documentan un efecto positivo de la suplementación con ZH en los rasgos de la canal del ganado B. taurus(22,23). En general, los resultados también son coherentes con informes anteriores que documentan un efecto

263


Rev Mex Cienc Pecu 2021;12(1):256-272

similar de diferentes marcas de ZH sobre los rasgos de la canal de los toros B. indicus(10) y los corderos(24). Sin embargo, los resultados de este trabajo no apoyan las observaciones anteriores de un efecto limitado de la suplementación con ZH en el adelgazamiento de la canal del ganado B. indicus(2). Esto podría explicarse en parte por las diferencias en el tamaño de la muestra, la composición de la dieta basal, así como los criterios de selección de los animales entre los experimentos, entre otros factores. Además, se sometieron a los toros a un periodo de adaptación de 2 meses previamente al ensayo, en lugar del periodo de 7 días utilizado por Avendaño-Reyes et al(2), lo que puede haber producido resultados diferentes. Los cambios inducidos por la suplementación con ZH en los rasgos de calidad de la canal fueron menos pronunciados (Cuadro 3). Por ejemplo, el ZH dietético no afectó al puntaje de marmoleo (P=0.4991). En promedio, éste se mantuvo en alrededor de 300 (categoría leve) en todos los tratamientos, lo que es típico de las canales de toros de los trópicos. En cambio, los valores numéricos de la madurez general fueron significativamente inferiores (P=0.0217) en las canales de los toros suplementados con ZH en comparación con que en los del grupo testigo. Estas diferencias, sin embargo, carecen de importancia práctica, ya que la madurez global media de todos los tratamientos correspondía a la categoría A, que es la típica de los animales jóvenes. Además, el grado de calidad USDA promedio para todos los tratamientos correspondió a una categoría de calidad entre "Estándar" y "Selecta". De hecho, alrededor del 90% de las canales de todos los tratamientos fueron clasificadas como estándar o selectas (Figura 2). En general, al igual que lo observado para los rasgos relacionados con el rendimiento, los resultados de los rasgos de calidad de la canal fueron similares para ambas marcas de ZH. Cuadro 3: Efecto de la suplementación con ZH en los rasgos relacionados con la calidad de las canales de los toros

Variable Puntaje de marmoleo3 Madurez general4 Grado de calidad 5

Tratamiento 1 Testigo ZHg n=96 n=96 305.10 303.23 b 136.26 116.46a 538.46 563.54

1

ZHr n=96 291.77 116.17a 556.38

SEE2 84.73 56.16 81.55

Valor de P 0.4991 0.0217 0.0993

Tratamientos, testigos: sin suplementación con ZH, ZHg: ZH genérico (Zipamix®) a 6 ppm en la dieta durante 30 d, ZHp: ZH de patente (Zilmax®) a 6 ppm en la dieta durante 30 d. 2 Error estándar de estimación. Las medias con distinto superíndice dentro de una misma fila son diferentes (P<0.05). 3 200=Trazas, 300=Ligero, 400=Pequeño. 4 100-199=Madurez A; 200-299= Madurez B; 300-399= Madurez C. 5 Utilitaria=300, Comercial=400, Estándar=500, Selecta=600, Preferida=700, Óptima=800.

264


Rev Mex Cienc Pecu 2021;12(1):256-272

Figura 2: Frecuencia relativa del grado de calidad USDA en las canales de toros jóvenes sin suplementación de ZH (testigo) o suplementados con una formulación genérica de ZH (ZHg, Zipamix ®) o una formulación patentada de ZH (ZHp, Zilmax ®) a 6 ppm en la dieta durante 30 d (n=96 por tratamiento) Grado de calidad USDA Utility Commercial Standard

Select

Choice

Frecuencia relativa, %

100 80 60 40 20 0 Control

ZHg

ZHp

Se ha sugerido que la ligera reducción de los puntajes de marmoleo inducida por la suplementación con ZH no es suficiente para modificar el grado de calidad de la canal en el ganado B. taurus(25). Esto también es aplicable al presente experimento, considerando que los toros B. indicus producen canales más magras y de menor calidad. En general, estos resultados apoyan los hallazgos anteriores que documentan un efecto limitado de la suplementación con ZH sobre los atributos de calidad de la canal(2,26-28). En cuanto a los atributos de calidad de la carne (Tabla 4), la carne de vacuno de todos los tratamientos tenía valores similares de WBSF (P=0.1507). A pesar de que la carne fue añejada durante 11 días, el valor de WBSF se mantuvo bastante por encima de 45 N, lo que es típico de la carne dura(29), un fenómeno que se observa con frecuencia en el ganado suplementado con ZH. La carne de todos los tratamientos tenía valores de WBSF similares(30-32). Además, en esta investigación participaron toros jóvenes con un fuerte fondo genético de B. indicus, que se sabe que producen una carne más dura en comparación con otras categorías de sexo y/o raza(33-35). Sin embargo, hay que tener en cuenta que las diferencias en el valor de WBSF entre los músculos están bien documentadas(36-38). Los valores de WBSF que se presentan aquí se limitan al músculo LT cocinado a 70 ºC (bien cocido) y sometido a 11 días de añejamiento. Se ha demostrado que la terneza de la carne puede diferir si se consideran otros músculos, tiempos de añejamiento más largos o una temperatura de cocción final diferente(32,39,40).

265


Rev Mex Cienc Pecu 2021;12(1):256-272

Cuadro 4: Efecto de la suplementación con ZH en los atributos de calidad de la carne de los toros Tratamientos1 Testigo ZHg ZHp Variable n=96 n=95 n=93 SEE2 Valor de P Pérdida por cocción, % 25.10 25.48 25.51 5.99 0.8704 Fuerza de corte WB, N 59.70 64.16 63.61 17.26 0.1507 L* 40.40 39.88 39.66 3.72 0.3654 b a a a* 28.91 28.03 27.70 2.84 0.0099 b a a b* 20.65 19.68 19.02 2.82 0.0003 b a a C* 35.53 34.27 33.62 3.85 0.0024 b a a h* 35.43 34.86 34.40 1.83 0.0006 a b b pHu 5.78 5.81 5.89 0.23 0.0022 1

Tratamientos, testigos: sin suplementación con ZH, ZHg: ZH genérico (Zipamix®) a 6 ppm en la dieta durante 30 d, ZHp: ZH de patente (Zilmax®) a 6 ppm en la dieta durante 30 d. 2 Error estándar de estimación. a,b Las medias con distinto superíndice dentro de una misma fila son diferentes (P<0.05).

La pérdida por cocción también fue similar en todos los tratamientos (alrededor del 25 %), que es del orden de la observada en los músculos magros(41,42). Una vez más, estos resultados pueden cambiar si se consideran otros métodos de cocción y temperaturas finales específicas, como se demostró anteriormente(43,44). El pH final fue mayor en la carne de los animales suplementados con ZH en comparación con la de los animales no tratados (P=0.0022). Esto puede ser una ventaja desde el punto de vista del procesamiento de la carne, ya que los valores de pH más altos están asociados con una mejor capacidad de retención de agua(45). Sin embargo, la media del pHu en todos los tratamientos está dentro del intervalo típico de la "calidad normal" de la carne de vacuno(46). Entre las variables instrumentales de color, sólo la L* no se vio afectada por la suplementación de ZH (P=0.3654). Por el contrario, ambas marcas ZH redujeron la rojez (a*) y la amarillez (b*) de la carne, lo que dio lugar a un color rojo menos vivo, como muestran los valores C* y h* más bajos. Según una investigación reciente(47), es poco probable que estas diferencias tengan implicaciones económicas, ya que los consumidores mexicanos aprecian la carne de vacuno de color rojo claro. La carne de vacuno de corte oscuro tiene una gran importancia económica. Si bien la frecuencia de los cortes oscuros observada aquí es mayor que la reportada en otros lugares(48,49), no hay pruebas que apoyen que se deba a la suplementación con ZH. De hecho, el porcentaje de carne de corte oscuro fue similar en todos los tratamientos (χ^2=3,6; P=0.1661), con una tasa de 6.3 para el grupo testigo, 7.4 para el de ZHg y 8.3 % para el de

266


Rev Mex Cienc Pecu 2021;12(1):256-272

ZHp. Por lo tanto, las tasas más altas en relación con otros ensayos están probablemente asociadas a las diferencias en las prácticas de producción, los procedimientos de manipulación antes del sacrificio y los criterios utilizados para clasificar las canales como oscuras.

Conclusiones e implicaciones En general, los resultados mostraron que la suplementación con ZH en la dieta de toros B. indicus jóvenes en condiciones tropicales mejora la mayoría de las características de rendimiento de la canal sin comprometer los atributos de calidad de la canal o de la carne. Estos efectos son similares para las dos marcas de ZH probadas aquí cuando se administran durante 30 días antes del sacrificio. Por lo tanto, los productores de carne de vacuno tropical pueden utilizar la formulación ZH de menor coste para mejorar su productividad. Literatura citada: 1.

FAO. Overview of the world meat market. http://www.fao.org/ag/againfo/themes/es/meat/background.html. Accessed May 15, 2019.

2. Avendaño-Reyes L, Meraz F, Pérez C, Figueroa F, Correa A, Álvarez F, Guerra J, López G, Macias U. Evaluation of the efficacy of Grofactor, a beta-adrenergic agonist based on zilpaterol hydrochloride, using feedlot finishing bulls. J Anim Sci 2016;94:29542961. 3. Shook JN, VanOverbeke DL, Kinman LA, Krehbiel CR, Holland BP, Streeter MN, Yates DA, Hilton GG. Effects of zilpaterol hydrochloride and zilpaterol hydrochloride withdrawal time on beef carcass cutability, composition, and tenderness1. J Anim Sci 2009;87(11):3677-3685. 4. Strydom PE, Frylinck L, Montgomery JL, Smith MF. The comparison of three β-agonists for growth performance, carcass characteristics and meat quality of feedlot cattle. Meat Sci 2009;81(3):557-564. 5. Castellanos-Ruelas AF, Rosado-Rubio JG, Chel-Guerrero LA, Betancur-Ancona DA. Using zilpaterol in an intensive feeding system for steers in Yucatán, México. Arch Latinoam Prod Anim 2006;14:56-59. 6. Mendez RD, Meza CO, Berruecos JM, Garces P, Delgado EJ, Rubio MS. A survey of beef carcass quality and quantity attributes in Mexico. J Anim Sci 2009;87(11):3782-3790.

267


Rev Mex Cienc Pecu 2021;12(1):256-272

7. Martínez-Vázquez DE, Sánchez-López E, Avendaño-Reyes L, Meráz-Murillo FJ, TorresRodríguez V. Economic evaluation of the use of two β -adrenergic agonists on finishing feedlot steers. Interciencia 2016;41(2):98-102. 8. Longo Joachin PA, Vargas Orellana CR. Evaluación de dos presentaciones comerciales de clorhidrato de zilpaterol (Zilmax ®) y (GroFactor ®) como aditivos en la dieta para finalización de toretes confinados. Escuela Agrícola Panamericana, Zamorano, Honduras . 2017. 9. SNIIM. Comentarios de Mercado Pecuarios. Sistema Nacional de Información e Integración de Mercados. http://www.secofi-sniim.gob.mx/nuevo/. Consultado 15 May, 2019. 10. Nieto-Carmona A, Aguilar-Acevedo J, Rubio-Lozano MS, Alvarado-García PA, Tapia G, Ocampo-Camberos L, Sumano H. Non-inferiority trial of two commercial zilpaterol HCl brands in Bos indicus cattle under humid tropical conditions. Veter México OA 2018;5(2). 11.

SAGARPA. Trato humanitario en la movilización de animales. http://www.dof.gob.mx/nota_detalle.php?codigo=4870842&fecha=23/03/1998. Consultado 15 May, 2019.

12. SAGARPA. Métodos para dar muerte a los animales domésticos y silvestres. http://www.dof.gob.mx/nota_detalle.php?codigo=5405210&fecha=26/08/2015. Consultado 15 May, 2019. 13. Djuragic O, Levic J, Sredanovic S, Levic L. Evaluation of homogeneity in feed by method of microtracers®. Archiva Zootechnica 2009;12(4):85-91. 14. SAGARPA. Especificaciones zoosanitarias para la construcción y equipamiento de establecimientos para el sacrificio de animales y los dedicados a la industrialización de productos cárnicos. https://www.gob.mx/senasica/documentos/nom-008-zoo-1994. Consultado 15 May, 2019. 15.

SAGARPA. Proceso sanitario de la carne. https://www.gob.mx/senasica/documentos/nom-009-zoo-1994. Consultado 15 May, 2019.

16. USDA. United States Standards for Grades of Carcass Beef. USDA Agricultural Marketing Service. Livestock and Seed Division https://www.ams.usda.gov/rulesregulations/united-states-standards-grades-carcass-beef-0. Accessed May 15, 2019.

268


Rev Mex Cienc Pecu 2021;12(1):256-272

17. AMSA. Meat color measurement guidelines. American Meat Science Association. http://www.meatscience.org/publications-resources/printed-publications/amsa-meatcolor-measurement-guidelines. Accessed May 5, 2018. 18. Mounier L, Dubroeucq H, Andanson S, Veissier I. Variations in meat pH of beef bulls in relation to conditions of transfer to slaughter and previous history of the animals. J Anim Sci 2006;(84):1567-1576. 19. Holman BW, van de Ven RJ, Mao Y, Coombs CE, Hopkins DL. Using instrumental (CIE and reflectance) measures to predict consumers' acceptance of beef colour. Meat Sci 2017;127:57-62. 20. AMSA. Research guidelines for cookery, sensory evaluation, and instrumental tenderness measurements of meat. Second edition (version 1.0). Champaign, IL: American Meat Science Association. http://www.meatscience.org/docs/default-source/publicationsresources/amsa-sensory-and-tenderness-evaluation-guidelines/research-guide/2015amsa-sensory-guidelines-1-0.pdf?sfvrsn=6. Accessed May 14, 2019. 21. Delgado-Suárez EJ, Rubio-Lozano MS, Toledo-López VM, Torrescano-Urrutia GR, Ponce-Alquicira E, Huerta-Leidenz N. Quality traits of pork semimembranosus and triceps brachii muscles sourced from the United States and Mexico. Meat Sci 2016;122:125-131. 22. Baxa TJ, Hutcheson JP, Miller MF, Brooks JC, Nichols WT, Streeter MN, Yates DA, Johnson BJ. Additive effects of a steroidal implant and zilpaterol hydrochloride on feedlot performance, carcass characteristics, and skeletal muscle messenger ribonucleic acid abundance in finishing steers. J Anim Sci 2010;88(1):330-337. 23. Kononoff PJ, Defoor PJ, Engler MJ, Swingle RS, James ST, Deobald HM, Deobald JL, Marquess FLS. Impact of a leptin single nucleotide polymorphism and zilpaterol hydrochloride on growth and carcass characteristics in finishing steers. J Anim Sci 2013;91(10):5011-5017. 24. Rivera-Villegas A, Estrada-Angulo A, Castro-Perez BI, Urias-Estrada JD, Rios-Rincon FG, et al. Comparative evaluation of supplemental zilpaterol hydrochloride sources on growth performance, dietary energetics and carcass characteristics of finishing lambs. Asian-Australas J Anim Sci 2019;32(2):209-216. 25. Montgomery JL, Krehbiel CR, Cranston JJ, Yates DA, Hutcheson JP, Nichols WT, et al. Dietary zilpaterol hydrochloride. I. Feedlot performance and carcass traits of steers and heifers. J Anim Sci 2009;87(4):1374-1383. 26. Parr SL, Chung KY, Galyean ML, Hutcheson JP, Dilorenzo N, Hales KE, May ML, Quinn MJ, Smith DR, Johnson BJ. Performance of finishing beef steers in response to

269


Rev Mex Cienc Pecu 2021;12(1):256-272

anabolic implant and zilpaterol hydrochloride supplementation1. J Anim Sci 2011;89(2):560-570. 27. Holland BP, Krehbiel CR, Hilton GG, Streeter MN, Vanoverbeke DL, Shook JN, et al. Effect of extended withdrawal of zilpaterol hydrochloride on performance and carcass traits in finishing beef steers. J Anim Sci 2010;88(1):338-348. 28. McEvers TJ, Nichols WT, Hutcheson JP, Edmonds MD, Lawrence TE. Feeding performance, carcass characteristics, and tenderness attributes of steers sorted by the Igenity tenderness panel and fed zilpaterol hydrochloride. J Anim Sci 2012;90(11):4140-4147. 29. Belew JB, Brooks JC, McKenna DR, Savell JW. Warner–Bratzler shear evaluations of 40 bovine muscles. Meat Sci 2003;64(4):507-512. 30. Hope-Jones M, Strydom PE, Frylinck L, Webb EC. The efficiency of electrical stimulation to counteract the negative effects of β-agonists on meat tenderness of feedlot cattle. Meat Sci 2010;86(3):699-705. 31. Claus HL, Dikeman ME, Murray L, Brooks JC, Shook J, Hilton GG, et al. Effects of supplementing feedlot steers and heifers with zilpaterol hydrochloride on Warner– Bratzler shear force interrelationships of steer and heifer longissimus lumborum and heifer triceps brachii and gluteus medius muscles aged for 7, 14 and 21 d. Meat Sci 2010;85(2):347-355. 32. Chávez A, Pérez E, Rubio MS, Méndez RD, Delgado EJ, Díaz D. Chemical composition and cooking properties of beef forequarter muscles of Mexican cattle from different genotypes. Meat Sci 2012;91(2):160-164. 33. Rubio LM, Mendez MR, Huerta-Leidenz N. Characterization of beef semimembranosus and adductor muscles from US and Mexican origin. Meat Sci 2007;76(3):438-43. 34. Marti S, Realini CE, Bach A, Pérez-Juan M, Devant M. Effect of castration and slaughter age on performance, carcass, and meat quality traits of Holstein calves fed a highconcentrate diet. J Anim Sci 2013;91(3):1129-1140. 35. González-Ríos H, Dávila-Ramírez JL, Peña-Ramos EA, Valenzuela-Melendres M, Zamorano-García L, Islava-Lagarda TY, Valenzuela-Grijalva NV. Dietary supplementation of ferulic acid to steers under commercial feedlot feeding conditions improves meat quality and shelf life. Anim Feed Sci Technol 2016;222:111-121. 36. Nelson JL, Dolezal HG, Ray FK, Morgan JB. Characterization of certified Angus beef steaks from the round, loin, and chuck. J Anim Sci 2004;82:1437-1444.

270


Rev Mex Cienc Pecu 2021;12(1):256-272

37. Rhee MS, Wheeler TL, Shackelford SD, Koohmaraie M. Variation in palatability and biochemical traits within and among eleven beef muscles. J Anim Sci 2004;82:534-550. 38. Searls GA, Maddock RJ, Wulf DM. Intramuscular tenderness variation within four muscles of the beef chuck. J Anim Sci 2005;83:2835-2842. 39. Wheeler TL, Shackelford SD, Koohmaraie M. Tenderness classification of beef: III. Effect of the interaction between end point temperature and tenderness on WarnerBratzler shear force of beef longissimus. J Anim Sci 1999;77(2):400-407. 40. King DA, Wheeler TL, Shackelford SD, Koohmaraie M. Comparison of palatability characteristics of beef gluteus medius and triceps brachii muscles. J Anim Sci 2009;87(1):275-284. 41. Jeremiah LE, Dugan MER, Aalhus JL, Gibson LL. Assessment of the chemical and cooking properties of the major beef muscles and muscle groups. Meat Sci 2003;65(3):985-992. 42. Vieira C, Diaz MT, Martínez B, García-Cachán MD. Effect of frozen storage conditions (temperature and length of storage) on microbiological and sensory quality of rustic crossbred beef at different states of ageing. Meat Sci 2009;83(3):398-404. 43. Yancey JW, Wharton MD, Apple JK. Cookery method and end-point temperature can affect the Warner-Bratzler shear force, cooking loss, and internal cooked color of beef longissimus steaks. Meat Sci 2011;88(1):1-7. 44. Walsh H, Martins S, O’ Neill EE, Kerry JP, Kenny T, Ward P. The effects of different cooking regimes on the cook yield and tenderness of non-injected and injection enhanced forequarter beef muscles. Meat Sci 2010;84(3):444-448. 45. Huff-Lonergan E. 6 - Fresh meat water-holding capacity. In: Kerry JP, Ledward D editors. 6 - Fresh meat water-holding capacity. Woodhead Publishing; 2009:147-160. 46. Holdstock J, Aalhus JL, Uttaro BA, Lopez-Campos O, Larsen IL, Bruce HL. The impact of ultimate pH on muscle characteristics and sensory attributes of the longissimus thoracis within the dark cutting (Canada B4) beef carcass grade. Meat Sci 2014;98(4):842-849. 47. Ngapo TM, Brana VD, Rubio LMS. Mexican consumers at the point of meat purchase. Beef choice. Meat Sci 2017;134:34-43. 48. Montgomery JL, Krehbiel CR, Cranston JJ, Yates DA, Hutcheson JP, Nichols WT, et al. Effects of dietary zilpaterol hydrochloride on feedlot performance and carcass characteristics of beef steers fed with and without monensin and tylosin. J Anim Sci 2009;87(3):1013-1023. 271


Rev Mex Cienc Pecu 2021;12(1):256-272

49. Loneragan GH, Thomson DU, Scott HM. Increased mortality in groups of cattle administered the β-Adrenergic agonists ractopamine hydrochloride and zilpaterol hydrochloride. PLoS ONE 2014;9(3):e91177.

272


https://doi.org/10.22319/rmcp.v12i1.5392 Nota de investigación

Nivel de infestación de Rhipicephalus microplus y su asociación con factores climatológicos y la ganancia de peso en bovinos Bos taurus x Bos indicus

Roberto Omar Castañeda Arriola a Jesús Antonio Álvarez Martínez b Carmen Rojas Martínez b José Juan Lira Amaya b Ángel Ríos Utrera a* Francisco Martínez Ibáñez c

a

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), Campo Experimental La Posta, kilómetro 22.5 carretera federal Veracruz-Córdoba, Paso del Toro, Medellín, Veracruz, México. b

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), CENIDSAI, Morelos, México. c

Servicios de Sanidad, Inocuidad y Calidad Agroalimentaria (SENASICA), Ciudad de México, México.

*Autor de correspondencia: rios.angel@inifap.gob.mx

Resumen: El objetivo fue evaluar el grado de infestación natural por Rhipicephalus microplus, así como determinar su correlación con factores climatológicos y su efecto sobre la ganancia de peso en bovinos doble propósito. Se utilizaron 31 bovinos cruzados, Bos taurus x Bos indicus, de ambos sexos, con una edad promedio de 307 días. El conteo de garrapatas semi-repletas (4.5 a 8.0 mm de diámetro) y el pesaje de los animales se realizaron cada 28 días. El conteo de 273


Rev Mex Cienc Pecu 2021;12(1):273-285

garrapatas se realizó desde la cabeza hasta la base de la cola, abarcando miembros anteriores y posteriores, así como la región ventral de los animales. Las variables de respuesta estudiadas fueron número de garrapatas semi-repletas y ganancia de peso promedio del animal. En julio el número promedio de garrapatas por animal fue mayor (P<0.05) que en el resto de los meses del año. Por el contrario, el sexo y el grupo racial del animal no afectaron (P>0.05) el número de garrapatas. La ganancia de peso disminuyó 34 g (P<0.05) por cada garrapata semi-repleta por periodo. El número de garrapatas tuvo una correlación baja (P<0.01) con la temperatura ambiental y humedad relativa; ganancia de peso promedio correlacionó negativa y moderadamente con el número de garrapatas (-0.67; P<0.01). Los bovinos con un nivel de infestación alto (61 garrapatas o más) tuvieron una ganancia de peso promedio menor (P=0.001) que aquellos con nivel de infestación medio (31 a 60 garrapatas) y bajo (0 a 30 garrapatas). La infestación de bovinos de doble propósito con Boophilus microplus requiere un control más estricto en los meses de mayor temperatura ambiental (abril a julio). Palabras clave: Garrapatas, Nivel de infestación, Ganancia de peso, Temperatura ambiental, Regresión lineal.

Recibido: 22/05/2019 Aceptado: 03/06/2020

El vector Rhipicephalus microplus representa un gran riesgo para el sector ganadero, debido a que afecta la producción de carne y leche. Además, es importante destacar que representa una barrera comercial y una amenaza para la venta de ganado en pie a los Estados Unidos de América, actividad que genera 700 millones de dólares al año(1). La estrategia empleada para el control de la garrapata se ha basado en la aplicación de compuestos químicos, no obstante, estos pueden resultar tóxicos y costosos. Aunado a esto, hay que considerar que la generación de resistencia de las garrapatas ha propiciado replanteamientos sobre este método(2). El manejo integral de plagas se considera la mejor opción en el control de las garrapatas, pero para lograrlo es necesario tener profundos conocimientos de las interacciones entre ambiente, hospedero y parásito. Mediante esta forma de control se logra tener poblaciones de garrapatas en cantidades bajas, para no poner en riesgo la salud de los bovinos, pero que a su vez sean suficientes para infectarlos con patógenos hemotrópicos a temprana edad; de esta forma, podrán generar inmunidad contra los mismos, logrando por consiguiente una estabilidad enzoótica(3). El conocimiento de la variación poblacional a lo largo del año, así como de la influencia del clima y del manejo sobre la garrapata, son fundamentales para establecer un adecuado 274


Rev Mex Cienc Pecu 2021;12(1):273-285

control. Por lo anterior, el objetivo del presente trabajo fue evaluar el grado de infestación natural por Rhipicephalus microplus, así como determinar su correlación con factores climatológicos y su efecto sobre la ganancia de peso en bovinos doble propósito. El estudio se desarrolló en el campo experimental La Posta, perteneciente al Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), localizado en el kilómetro 22.5 de la carretera federal Veracruz-Córdoba, en Paso del Toro, Medellín, Veracruz, México, a los 19° 00’ 49” N y 96° 10’ O, a una altura de 12 m sobre el nivel del mar, con clima subhúmedo (Aw1), temperaturas máxima, media y mínima de 35.3, 25.0 y 15.0°C, respectivamente, precipitación anual de 1,641 mm y humedad relativa de 74.4%. Se utilizaron 31 bovinos (13 vaquillas y 18 toretes) cruzados Bos taurus x Bos indicus, 11/16 Holstein x 5/16 Cebú (3.2%), 11/16 Suizo Pardo x 5/16 Cebú (3.2%), 3/4 Holstein x 1/4 Cebú (16.1%), 3/4 Suizo Pardo x 1/4 Cebú (25.8%), 5/8 Holstein x 3/8 Cebú (25.8%), 5/8 Suizo Pardo x 3/8 Cebú (6.5%), cruzas indefinidas de Holstein x Cebú (16.1%), y cruzas indefinidas de Suizo Pardo x Cebú (3.2%). La edad promedio de los animales al inicio del experimento fue de 307 días. Los toretes y las vaquillas se mantuvieron separados, en pastoreo rotacional en potreros contiguos establecidos con Tanzania (Megatyrsus maximus), Señal (Urocholoa decumbens), Pangola (Digitaria decumbes) y Mombaza (Megatyrsus maximus). Se ofrecieron sales minerales y agua a libertad todo el año; además, en la época de sequía (diciembre a mayo) se proporcionó ensilaje de sorgo forrajero (Sorghum vulgare) ad libitum. La vacunación contra derriengue (rabia paralítica) se realizó anualmente, en agosto. Los animales se desparasitaron contra nematodos gastroentéricos cada seis meses y se vacunaron contra clostridiasis en marzo y septiembre. Los bovinos se suplementaron con un alimento concentrado (18% de proteína cruda y 70% de nutrientes digestibles totales) a razón de 1 kg por animal por día. Los animales fueron inspeccionados con la finalidad de registrar la dinámica poblacional del vector Rhipicephalus microplus mediante el conteo de garrapatas semi-repletas (4.5 a 8.0 mm de diámetro), alojadas sobre ellos; los muestreos de garrapatas se realizaron de agosto del 2014 a octubre del 2015. La colecta y el conteo de garrapatas los realizó una misma persona, en un corral de manejo techado, iniciando a las 08:00 h. La periodicidad de los conteos fue cada 28 días, los cuales se realizaron desde la cabeza hasta la base de la cola, abarcando miembros anteriores y posteriores, así como la región ventral de los animales(4). En cada muestreo se obtuvo el peso corporal de los animales con una báscula electrónica. Durante el estudio, no se aplicó ningún garrapaticida a los animales. En cada muestreo, las garrapatas se colectaron en una solución de alcohol al 70%; posteriormente se llevaron al laboratorio de sanidad animal del campo experimental La Posta, para corroborar su clasificación taxonómica de acuerdo como lo describen Rodríguez-Vivas et al(5). Los datos de temperatura ambiental y humedad relativa se obtuvieron de la estación climatológica del campo experimental La Posta, la cual pertenece a la Red Nacional de Estaciones 275


Rev Mex Cienc Pecu 2021;12(1):273-285

Agroclimatológicas Automatizadas del INIFAP. Datos de precipitación pluvial no estuvieron disponibles para el periodo de estudio. Las variables de respuesta estudiadas fueron número de garrapatas semi-repletas por bovino, ganancia de peso individual y ganancia de peso promedio por animal. El número de garrapatas semi-repletas por bovino consistió en el número de estos parásitos presentes en el lado izquierdo del animal en un periodo de 28 días. González-Cerón et al(6) demostraron que esta variable tuvo una correlación alta (mayor a 0.90) con el número de garrapatas presentes en todo el cuerpo del animal. El número de garrapatas varió de 0 a 264, con un promedio general de 39.4 garrapatas por animal. A partir del número de garrapatas semi-repletas por bovino se determinó el número promedio de garrapatas por animal, el cual se utilizó para clasificar a los bovinos en: 1) bajamente infestados (0 a 30 garrapatas), 2) medianamente infestados (31 a 60 garrapatas) y 3) altamente infestados (61 garrapatas o más). La ganancia de peso individual consistió en los kilogramos de peso corporal ganados por el animal en un periodo de 28 días. La ganancia de peso promedio por animal se calculó dividiendo la suma de las ganancias de peso individuales obtenidas cada 28 días entre el número de pesajes. El número de garrapatas semi-repletas por bovino se analizó con el procedimiento GENMOD (PROC GENMOD) del paquete estadístico SAS(7), utilizando un modelo de mediciones repetidas que incluyó los efectos fijos de mes (periodo) de muestreo y sexo y grupo racial del becerro. Para la variable número de garrapatas se declaró una distribución Poisson como subrutina en el procedimiento GENMOD de SAS(7); además, se aplicó una estructura de covarianzas auto-regresiva de primer orden [AR(1)]. La ganancia de peso individual se analizó con el procedimiento MIXED (PROC MIXED) del programa SAS(7), utilizando un modelo de mediciones repetidas que incluyó sexo y grupo racial del becerro como variables categóricas, y número de garrapatas semi-repletas por bovino, temperatura ambiental y humedad relativa como covariables, aplicando la misma estructura de covarianzas mencionada previamente. Para ganancia de peso individual se incluyeron en el modelo estadístico temperatura ambiental y humedad relativa en lugar de mes (periodo) de muestreo, porque no se tuvo interés en saber si existían diferencias entre meses en la ganancia de peso, sino que el objetivo fue ajustar de una manera más específica por factores climatológicos, para obtener el coeficiente de regresión lineal de la ganancia de peso individual sobre el número de garrapatas semi-repletas por bovino. La ganancia de peso promedio se analizó con el procedimiento GLM (PROC GLM) de SAS(7), utilizando un modelo que incluyó nivel de infestación (alto, medio y bajo). En un análisis preliminar se encontró que los efectos sexo y grupo racial del becerro no fueron importantes (P>0.05), por lo cual no se incluyeron en el modelo definitivo. En los análisis estadísticos del número de garrapatas semi-repletas por bovino y la ganancia de peso promedio, las diferencias entre medias se probaron con la opción PDIFF del programa SAS(7). El grado de asociación entre número de garrapatas semirepletas por bovino con temperatura ambiental y humedad relativa, así como el grado de asociación entre el número promedio de garrapatas y la ganancia de peso promedio, se 276


Rev Mex Cienc Pecu 2021;12(1):273-285

estimaron a través del coeficiente de correlación de Pearson, con el procedimiento CORR (PROC CORR) del paquete SAS(7). El promedio general de las ganancias de peso individuales fue 11.9 kg. El número promedio de garrapatas semi-repletas, el nivel de infestación y la ganancia de peso promedio, por animal, se presentan en el Cuadro 1.

Cuadro 1: Número promedio de garrapatas (Boophilus microplus) semi-repletas (NPG), nivel de infestación (NIVEL) y ganancia de peso promedio (GPP; kg), por animal Animal 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

NPG 27 47 45 94 30 45 15 62 25 14 6 6 33 32 62 15

Nivel Bajo Medio Medio Alto Bajo Medio Bajo Alto Bajo Bajo Bajo Bajo Medio Medio Alto Bajo

GPP 12 15 12 9 16 13 13 10 13 15 14 13 12 18 13 13

Animal 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

NPG 87 48 58 63 53 65 50 72 22 36 65 39 64 62 48

Nivel Alto Medio Medio Alto Medio Alto Medio Alto Bajo Medio Alto Medio Alto Alto Medio

GPP 3 12 12 8 11 12 12 12 15 14 10 11 10 10 11

El mes de muestreo resultó ser una fuente de variación significativa (P=0.0199) para el número de garrapatas, el efecto lineal del número de garrapatas fue significativo (P=0.0212) para ganancia de peso individual, y nivel de infestación fue significativo (P=0.001) para ganancia de peso promedio. En julio, mes en que se presentó la mayor temperatura ambiental, el número promedio de garrapatas por animal fue mayor (P<0.05) que en los otros once meses del año (Cuadro 2).

277


Rev Mex Cienc Pecu 2021;12(1):273-285

Cuadro 2: Medias de cuadrados mínimos con sus errores estándar para número de garrapatas (Boophilus microplus) semi-repletas, y medias de temperatura ambiental y humedad relativa, por mes Temperatura Humedad £ Mes Número de garrapatas ambiental relativa ef Enero 20.7 ± 2.5 18.6 86.9 ef Febrero 18.5 ± 2.7 19.0 86.1 cd Marzo 32.4 ± 4.5 20.8 88.0 b Abril 45.0 ± 6.8 25.2 86.2 b Mayo 43.0 ± 4.4 26.2 85.6 b Junio 45.1 ± 4.3 25.9 85.4 a Julio 62.9 ± 6.9 26.8 87.7 bc Agosto 39.3 ± 7.5 26.0 87.0 cd Agosto2 27.9 ± 3.2 26.5 87.8 de Septiembre 24.5 ± 2.9 25.1 91.0 f Septiembre2 16.3 ± 3.3 25.8 89.9 f Octubre 14.4 ± 3.2 24.4 87.5 g Octubre2 5.9 ± 1.6 25.2 87.3 c Noviembre 32.5 ± 3.4 21.5 86.0 f Diciembre 17.4 ± 2.5 20.6 89.4 £

Agosto2, Septiembre2 y Octubre2 se refieren a los meses de agosto, septiembre y octubre de 2015. a,b,c,d,e,f,g Medias con distinta literal son diferentes (P<0.05).

Por ejemplo, en los casos más extremos, en el mes de julio los animales presentaron 46.6 y 57.0 garrapatas más que en los meses de septiembre (año 2015) y octubre (año 2015). En los meses de abril, mayo y junio, meses en los que la temperatura ambiental y la humedad relativa fueron similares, el número de garrapatas por animal también fue similar (P>0.05), 45.0, 43.0 y 45.1 garrapatas, respectivamente. En enero y febrero, meses con una temperatura ambiental relativamente baja, los animales presentaron, en promedio, un número similar (P>0.05) de garrapatas (20.7 y 18.5, respectivamente); sin embargo, en estos dos primeros meses del año el número promedio de garrapatas por animal fue menor (P<0.05) que en abril, mayo y junio, meses en los que se presentó una temperatura ambiental relativamente más alta. Estos resultados son acordes con el coeficiente de correlación de Pearson correspondiente, que indicó que a mayor temperatura ambiental mayor número de garrapatas en el animal (0.21; P<0.0001); por el contrario, a menor humedad relativa mayor número de garrapatas en el animal (-0.19; P<0.0001); sin embargo, la correlación entre este último par de características fue un poco más débil. Fluctuaciones en la población de garrapatas a lo largo del año también han sido observadas en reportes previos, donde la variación en la población dependió de las condiciones climáticas de cada región. Alonso-Díaz et al(8), en Martínez de la Torre, Veracruz, encontraron que la mayor infestación por Rhipicephalus microplus en bovinos ¾ Bos taurus x ¼ Bos indicus se presentó en los meses de mayo y junio (93 y 82 garrapatas, en 278


Rev Mex Cienc Pecu 2021;12(1):273-285

promedio, por bovino), mientras que la menor infestación se presentó en noviembre y marzo (<10 garrapatas, en promedio, por bovino), meses en los que la humedad relativa fue menor en comparación con los meses de mayo y junio. En otra investigación un poco más reciente(9), realizada con bovinos Criollo Lechero Tropical, en la zona centro del estado de Veracruz, se encontró que los meses de mayor infestación fueron agosto y octubre, con 11.1 ± 0.6 y 12.0 ± 0.6 garrapatas (Amblyomma cajennense + Boophilus microplus) por bovino, respectivamente; contrariamente, la menor infestación se presentó en mayo (2.9 ± 0.6 garrapatas por animal), mes en que la precipitación pluvial fue más baja, en comparación con los meses de agosto y octubre (1.4 vs 11.9 y 17.9 mm); sin embargo, en estos tres meses las temperaturas ambientales fueron similares. Otra investigación(10) realizada en el trópico seco mexicano (Culiacán, Sinaloa), también reportó elevadas infestaciones en bovinos, principalmente durante los meses de julio a octubre, con 50 garrapatas en promedio por bovino, observándose una disminución durante los meses de noviembre y diciembre, con 30 garrapatas en promedio por bovino, disminución que coincidió con la época invernal, la cual se caracteriza por bajas temperaturas. Por su parte, Rodríguez-Gallegos y Acosta-Rodríguez(11), en un estudio realizado con becerros de cruza terminal, encontraron un mayor número de garrapatas Boophilus microplus en febrero y marzo que en septiembre y octubre (155 ± 10 vs 26 ± 15), observándose que en los primeros meses del año la temperatura ambiental y la precipitación pluvial fueron menores que en los últimos meses del año (22.0 vs 26.4°C, y 49 vs 271 mm). Los machos tendieron a tener más garrapatas que las hembras (29.9 vs 22.1 garrapatas; Cuadro 3); sin embargo, la diferencia no fue estadísticamente significativa (P<0.055). Cuadro 3: Medias de cuadrados mínimos con sus errores estándar e intervalos de confianza al 95% para número de garrapatas (Boophilus microplus) semi-repletas, por sexo Intervalo de confianza Sexo

Media

Límite inferior

Límite superior

Hembras

22.1 ± 2.3

18.1

27.1

Machos

29.9 ± 3.2

24.2

37.0

(P>0.05).

En un estudio realizado en Australia(12) se observó que el conteo de garrapatas fue 90 % mayor en bovinos machos que en hembras, argumentando los autores que el efecto del sexo implica una fuerte influencia de las hormonas sexuales sobre la resistencia a dicho parásito. Por el contrario, Rodríguez-Gallegos y Acosta-Rodríguez(11), utilizando animales de ocho meses de edad en condiciones de trópico húmedo, encontraron que becerros machos tuvieron niveles de infestación similares a los de becerros hembras. En un estudio realizado en México 279


Rev Mex Cienc Pecu 2021;12(1):273-285

con la raza Criollo Lechero Tropical, González-Cerón et al(9) tampoco encontraron diferencia en el número de garrapatas presentes en toretes y vaquillas (3.2 ± 0.6 vs 3.5 ± 0.4). Los becerros 11/16 Suizo Pardo x 5/16 Cebú tendieron a tener menor número de garrapatas que los becerros de los otros grupos raciales, pero las diferencias entre los grupos raciales evaluados no fueron estadísticamente importantes (P>0.05; Cuadro 4). Cuadro 4: Medias de cuadrados mínimos con sus errores estándar e intervalos de confianza al 95% para número de garrapatas (Boophilus microplus) semi-repletas, por grupo racial Intervalo de confianza Grupo racial£ Media Límite inferior Límite superior a 11/16 HO 28.7 ± 2.1 24.9 33.0 a 11/16 SP 15.2 ± 0.4 14.5 16.0 a 3/4 HO 48.4 ± 3.2 42.4 55.2 a 3/4 SP 37.3 ± 5.6 27.8 50.0 a 5/8 HO 20.7 ± 3.3 15.1 28.3 a 5/8 SP 30.8 ± 18.4 9.5 99.6 a X HO 34.6 ± 5.5 25.4 47.2 a X SP 32.4 ± 2.4 28.0 37.4 £

11/16 HO= 11/16 Holstein x 5/16 Cebú, 11/16 SP= 11/16 Suizo Pardo x 5/16 Cebú, 3/4 HO= 3/4 Holstein x 1/4 Cebú, 3/4 SP= 3/4 Suizo Pardo x 1/4 Cebú, 5/8 HO= 5/8 Holstein x 3/8 Cebú, 5/8 SP= 5/8 Suizo Pardo x 3/8 Cebú, X HO= Cruzas Holstein x Cebú indefinidas, X SP= Cruzas Suizo Pardo x Cebú indefinidas. (P>0.05).

Por el contrario, Alonso-Díaz et al(8) encontraron que bovinos ¾ B. taurus x ¼ B. indicus tuvieron un mayor número de garrapatas en la mayoría de los meses del año (enero, febrero, abril, mayo, junio, julio, septiembre, octubre, diciembre) que bovinos ½ B. taurus x ½ B. indicus; en otras palabras, los animales con un mayor porcentaje de genes de raza europea presentaron una mayor infestación por el ácaro; sin embargo, el intervalo del porcentaje de raza europea fue menor en el presente estudio (62.5 a 75.0%) que en el estudio citado(8), donde dicho intervalo fue de 50 a 75%, lo que implica una mayor diversidad (diferencia) genética entre bovinos. A pesar de ello, es probable que la inclusión de un mayor número de animales en el presente estudio hubiera resultado en menores errores estándar de las medias, permitiendo a su vez detectar diferencias en el número de garrapatas entre grupos raciales. Sutherst(13) y Castro(14) habían reportado previamente que bovinos de razas Cebú (B. indicus) son más resistentes a las garrapatas que bovinos de razas europeas (B. taurus). Otros investigadores(15) encontraron que el conteo diario de hembras Boophilus microplus repletas fue 3.3, 25.2, 22.5, 21.0 y 59.7 en bovinos Nelore, ½ Nelore x ½ Fleckvieh, ½ Nelore x ½ Chianina, ½ Nelore x ½ Charolais y 3/8 Nelore x 5/8 Angus. En condiciones de campo (infestación natural) en Australia(12) se demostró que bovinos B. taurus x B. indicus portaron 280


Rev Mex Cienc Pecu 2021;12(1):273-285

menos garrapatas que bovinos B. taurus (Shorthorn x Hereford). En un estudio realizado en Sudáfrica(16) se encontró que el número promedio de garrapatas fue 37.4, 24.1 y 5.3 en bovinos Hereford, Bonsmara (5/8 Afrikaner y 3/8 Hereford o Shorthorn) y Nguni (raza africana tropicalmente adaptada, producto de la combinación de razas B. taurus y B. indicus), respectivamente. Al respecto, se ha argumentado que el comportamiento etológico para evitar las garrapatas, la sensibilidad de la piel y un mayor acicalamiento en las razas Cebú pueden explicar la menor carga de este parásito comparada con la carga parasitaria en las razas exóticas B. taurus(17). Diferencias raciales en el número de garrapatas también han sido encontradas dentro de la especie indicus(18) donde se menciona que bovinos Brahman portaron dos veces más garrapatas (Boophilus microplus) que bovinos Nelore (animales de un año de edad en ambas razas). Por su parte, Rodríguez-Gallegos y Acosta-Rodríguez(11) también encontraron efecto del grupo racial sobre el número de garrapatas, aunque no compararon animales B. taurus contra animales B. indicus y/o B. taurus x B. indicus, observando que becerros ½ Braunvieh-¼ Holstein-¼ Cebú tuvieron una mayor infestación natural que becerros ½ Angus Negro-¼ Holstein-¼ Cebú y ½ Angus Rojo-¼ Holstein-¼ Cebú. El coeficiente de regresión lineal de la ganancia de peso sobre el número de garrapatas fue 0.03442 kg/garrapata (P<0.05), lo que significa que la ganancia de peso disminuyó 34 g por cada garrapata semi-repleta presente en el animal en un periodo de 28 días. Por lo tanto, bajo las condiciones del presente estudio, en el mes de julio los animales perdieron, en promedio, 2.1 kg de peso corporal. En un estudio realizado con toretes Brahman, Brahman x Simmental, Sanga y Hereford, se estimó que la pérdida en la ganancia de peso fue de 28 g por garrapata (Amblyomma hebraeum) adulta repleta(19), resultado similar al encontrado en el presente estudio. Por el contrario, Frisch y O’Neill(20) reportaron que el coeficiente de regresión de la ganancia de peso sobre el número de garrapatas fue -0.42 kg/garrapata/10 meses, lo que significa que la ganancia de peso en dicho estudio disminuyó 420 g por garrapata en un periodo de 10 meses. También se ha reportado que cada garrapata repleta (Rhipicephalus appendiculatus) estuvo asociada con una pérdida de peso corporal de 4.4 g, pérdida menor a la encontrada en la presente investigación(21). El coeficiente de correlación de Pearson (-0.67; P<0.0001) reveló que la ganancia de peso promedio fue menor conforme aumentó el número de garrapatas en los animales. Similarmente, en un estudio realizado en Texas con bovinos Angus x Cebú(22) se estimó una correlación de -0.61 entre la ganancia de peso y el número acumulado de garrapatas (Amblyomma americanum). En otro estudio realizado en Zambia con bovinos de la raza Sanga(23) se encontró que la ganancia de peso estuvo negativa y moderadamente correlacionada con el número de garrapatas (Amblyomma variegatum) en dos diferentes hatos (-0.72 y -0.70), resultado similar al encontrado en el presente estudio. En otro estudio realizado en Camerún(24) con bovinos de la raza Gudali (B. indicus), también se encontró una correlación negativa y moderada entre la ganancia de peso y el número de garrapatas 281


Rev Mex Cienc Pecu 2021;12(1):273-285

(Amblyomma variegatum); sin embargo, en este último estudio la correlación fue menor (-0.52). Los bovinos con niveles medios y bajos de infestación ganaron, en promedio, 2.88 y 3.87 kg más (P<0.05) por periodo de muestreo, respectivamente, que aquellos con altos niveles de infestación (Cuadro 5). Cuadro 5: Medias de cuadrados mínimos con sus errores estándar e intervalos de confianza al 95% para ganancia de peso promedio (kg), por nivel de infestación Intervalo de confianza Nivel de infestación Media Límite inferior Límite superior 9.82 ± 0.66a

8.46

11.18

Medio

12.70 ± 0.61b

11.46

13.94

Bajo

13.69 ± 0.70b

12.25

15.12

Alto

a,b

Medias con distinta literal son diferentes (P<0.01).

Estos resultados son parcialmente similares a los obtenidos en Brasil con ganado HolsteinCebú(25) donde se observó que animales con bajos niveles de infestación tuvieron mayor ganancia de peso que animales con niveles medios y altos de infestación; sin embargo, este estudio no describe como se realizó la categorización de los animales con base en el número de garrapatas que portaban los mismos. Similarmente, Corrier et al(26), al evaluar la carga de garrapatas repletas (Boophilus microplus; diámetro >5 mm) en bovinos de la raza Normando, encontraron que animales altamente infestados (138 a 300 garrapatas) pesaron 24 kg menos en el día 125 de la prueba que animales ligeramente infestados (0 a 33 garrapatas). Varios autores han reportado que existen animales que consistentemente portan menos garrapatas que otros en el mismo ambiente, debido a su mayor habilidad para responder inmunológicamente a las garrapatas(27-29). En conclusión, la infestación por el ácaro Boophilus microplus requiere un control más estricto en los meses de mayor temperatura ambiental (abril a julio). El sexo y el genotipo de los bovinos no influyeron en la cantidad de garrapatas que portaron los animales. La correlación entre el número promedio de garrapatas y la ganancia de peso promedio fue negativa y moderada, encontrándose que bovinos con altos niveles de infestación con este vector tuvieron menores ganancias de peso que bovinos con medios y bajos niveles de infestación.

282


Rev Mex Cienc Pecu 2021;12(1):273-285

Literatura citada: 1. González SPJR, Hernández OR. Boophilus microplus: estado actual de la resistencia a los acaricidas en la frontera México Estados Unidos y su impacto en la relación comercial. Rev Mex Cienc Pecu 2012;3(Supl 1):1-8. 2. Rajput ZI, Song-hua H, Wan-jun Ch, Arijo AG, Chen-wen X. Importance of ticks and their chemical and immunological control in livestock. J Zhejiang Univ Science B 2006;7(11):912-921. 3. García BA. Situación actual de la campaña nacional contra la garrapata en México. IV Seminario Internacional de Parasitología Animal. Puerto Vallarta, Jalisco, México. 1999:47-50. 4. Wharton RH, Utech KBW. The relation between engorgement and dropping of B. microplus (Canestrini) (Ixodidae) to the assessment of tick numbers on cattle. J Aust Entomol Soc 1970;9:171-182. 5. Rodríguez-Vivas RI, Domínguez AJ, Cob GL. Técnicas diagnósticas de parasitología veterinaria. Mérida, Yucatán, México. Universidad Autónoma de Yucatán. 1994:131140. 6. González-Cerón F, Becerril-Pérez CM, Torres-Hernández G, Díaz-Rivera P. Garrapatas que infestan regiones corporales del bovino Criollo Lechero Tropical en Veracruz, México. Agrociencia 2009;43(1):11-19. 7. SAS Institute Inc. SAS/STAT® 9.3 User’s guide. Cary, NC: SAS Institute Inc. 2011. 8. Alonso-Díaz MA, López-Silva BJ, de Magalhães-Labarthe ACL, Rodríguez-Vivas RI. Infestación natural de hembras de Boophilus microplus Canestrini, 1887 (Acari: Ixodidae) en dos genotipos de bovinos en el trópico húmedo de Veracruz, México. Vet Méx 2007;38(4):503-509. 9. González-Cerón F, Becerril-Pérez CM, Torres-Hernández G, Díaz-Rivera P, SantellanoEstrada E, Rosendo-Ponce A. Infestación natural por Amblyomma cajennese y Boophilus microplus en bovinos Criollo Lechero Tropical durante la época de lluvias. Agrociencia 2009;43:577-584. 10. Gaxiola CSM, Borbolla IJE, Quintero MMT, Rodríguez MJ, Borbolla IJ, Castro CN, et al. Infestación natural de bovinos con Boophilus microplus en el municipio de Culiacán, Sinaloa, México [resumen]. IV Seminario Internacional de Parasitología Animal. Puerto Vallarta, Jalisco, México. 1999:225-226. 11. Rodríguez-Gallegos CE, Acosta-Rodríguez MR. Genetic and environmental factors influencing the resistance of terminal cross calves to tick Rhipicephalus (Boophilus) 283


Rev Mex Cienc Pecu 2021;12(1):273-285

microplus and horn fly Haematobia irritans. Trop Subtrop Agroecosys 2011;13:437444. 12. Seifert GW. Variations between and within breeds of cattle in resistance to field infestations of the cattle tick (Boophilus microplus). Aust J Agric Res 1971;22:159-168. 13. Sutherst RW. Resistance of cattle to ticks and one element in control programme in Mexico. FAO Animal Production and Health Paper. 1989; Pp. 154-164. 14. Castro JJ. Sustainable tick and tickborne disease control in livestock improvement in developing countries. Vet Parasitol 1997;71:77-97. 15. Gomes A, Honer MR, Schenck MAM, Curvo JBE. Populations of the cattle tick Boophilus microplus on purebred Nelore, Ibagé and Nelore×European crossbreds in the Brazilian Savanna. Trop Anim Health Prod 1989;21:20-24. 16. Scholtz MM, Spickett AM, Lombard PE, Enslin CB. The effect of tick infestation on the productivity of cows of three breeds of cattle. Onderstepoort J Vet Res 1991;58:71-74. 17. Meltzer MI. A possible explanation of the apparent breed-related resistance in cattle to Bont tick (Amblyomma hebraeum) infestations. Vet Parasitol 1996;67:275-279. 18. Brizuela CM, Ortellano CA, Sanchez TI, Walker AR. Formulation of an integrated control of Boophilus microplus in Paraguay. Vet Parasitol 1996;63:95-108. 19. Norval RAI, Sutherst RW, Kerr JD. Infestations of the bont tick Amblyomma hebraeum (Acari: Ixodidae) on different breeds of cattle in Zimbabwe. Exp Appl Acarology 1996;20:599-605. 20. Frisch JE, O'Neill CJ. Comparative evaluation of beef cattle breeds of African, European and Indian origins. 2. Resistance to cattle ticks and gastrointestinal nematodes. Anim Sci 1998;67:39-48. 21. Norval RAI, Sutherst RW, Kurki J, Gibson JD, Kerr JD. The effect of the brown ear-tick (Rhipicephalus appendiculatus) on the growth of Sanga and European breed cattle. Vet Parasitol 1988;30:149-164. 22. Tolleson DR, Teel PD, Stuth JW, Strey OF, Welsh Jr. TH, Carstens GE, et al. Effects of a lone star tick (Amblyomma americanum) burden on performance and metabolic indicators in growing beef steers. Vet Parasitol 2010;173:99-106. 23. Pegram RG, Lemche J, Chizyuka HGB, Sutherst RW, Floyd RB, Kerr JD, et al. Effect of tick control on liveweight gain of cattle in central Zambia. Med Vet Entomol 1989;3:313-320.

284


Rev Mex Cienc Pecu 2021;12(1):273-285

24. Stachurski F, Musonge EN, Achu-kwi MD, Saliki JT. Impact of natural infestation of Amblyomma variegatum on the liveweight gain of male Gudali cattle in Adamawa (Cameroon). Vet Parasitol 1993;9:299-311. 25. Labruna MB, Veríssimo CJ. Observações sobre a infestação por Boophilus microplus (Acari: Ixodidae) em bovinos mantidos em rotação de pastagem, sob alta densidade animal. Arq Inst Biol, São Paulo, 2001;68(2):115-120. 26. Corrier DE, Vizcaino O, Terry M, Betancourt A, Kuttler KL, Carson CA, et al. Mortality, weight loss and anaemia in Bos taurus calves exposed to Boophilus microplus ticks in the tropics of Colombia. Trop Anim Health Prod 1979;11:215-221. 27. Mattioli RC, Pandey VS, Murray M, Fitzpatrick JL. Immunogenetic influences on tick resistance in African cattle with particular reference to trypanotolerant N’Dama (Bos taurus) and trypanosusceptible Gobra zebu (Bos indicus) cattle. Acta Tropica 2000;75:263-277. 28. Das G, Ghosh S, Ray DD. Reduction of Theileria annulata infection in ticks fed on calves immunized with purified larval antigens of Hyalomma anatolicum anatolicum. Trop Anim Health Prod 2005;37:345-361. 29. Jonsson NN. The productivity effects of cattle tick (Boophilus microplus) infestation on cattle, with particular reference to Bos indicus cattle and their crosses. Vet Parasitol 2006;137:1-10.

285


https://doi.org/10.22319/rmcp.v12i1.5999 Nota de investigación

Características histopatológicas y detección de Papilomavirus en la fibropapilomatosis bovina en el estado de San Luis Potosí, México

Isaura Méndez Rodríguez a Fernando Alberto Muñoz Tenería a Milagros González Hernández a Alan Ytzeen Martínez Castellanos a Luisa Eugenia del Socorro Hernández Arteaga a*

a

Universidad Autónoma de San Luís Potosí. Facultad de Agronomía y Veterinaria. Carretera San Luis-Matehuala Km 14.5, Ejido Palma de la Cruz, 78321 Soledad de Graciano Sánchez, SLP, México.

* Autor de correspondencia: socorro.hernandez@uaslp.com

Resumen: El objetivo del trabajo fue determinar la presencia del papilomavirus bovino (PVB) en muestras de tejidos de bovinos con lesiones cutáneas sugerentes de papilomas, fibromas y fibropapilomas en unidades de producción de ganado bovino en el estado de San Luis Potosí. Se obtuvieron 11 biopsias de piel de bovinos de entre 5 y 18 meses provenientes de sistemas de producción estabulado, semiestabulado y de agostadero con fines productivos de carne y leche, con lesiones sugerentes de papilomas, fibropapilomas y carcinomas de células escamosas. Estas muestras se procesaron mediante histopatología y se realizó extracción de ADN para la detección del PVB mediante PCR con los oligonucleótidos FAP59/FAP64 y MY09/MY11. Las lesiones se clasificaron en fibromas (45.45 %) y fibropapilomas (54.54 %) sin que se observara distribución de un tipo de lesión específica de acuerdo a la localización anatómica, edad, sistema de producción o fin zootécnico. El 72.72 % (n= 8) de las muestras mostraron resultados positivos para PVB mediante PCR; 45.45 % (n= 5) con los oligos FAP y 54.54 % (n= 6) con los oligos MY. Hasta donde se sabe, este es el primer 286


Rev Mex Cienc Pecu 2021;12(1):286-297

estudio que describe la presencia de PVB en el estado de San Luis Potosí, por lo que estos resultados aportan datos útiles para establecer medidas de detección y control necesarias para mejorar las condiciones zoosanitarias de los animales. Palabras clave: Papilomavirus bovino, Fibropapilomatosis bovina, Histopatología, PCR, San Luis Potosí.

Recibido: 21/08/2018 Aceptado: 11/03/2020

La fibropapilomatosis bovina es una enfermedad viral infecciosa, especie específica y de distribución mundial que afecta principalmente bovinos jóvenes causada por el papilomavirus bovino (PVB) asociado a diversos factores predisponentes como estados de inmunosupresión, edad de los animales, estado nutricional, parasitosis, mal manejo, estrés, fármacos inmunosupresores entre otros(1,2). Los papilomavirus son una familia de virus oncogénicos pequeños, no envueltos, capaces de infectar aves, mamíferos y peces. La familia papillomaviridae comprende 29 géneros que agrupan 189 tipos virales, de los cuales, 120 se han aislado de humanos, 64 de mamíferos, 3 de aves y 2 de reptiles(2,3). Hasta el momento, se han caracterizado 10 tipos virales capaces de causar infección en diferentes sitios anatómicos de los bovinos, y se ha descrito que dependiendo el tipo viral será la forma de presentación de la lesión. Así, el BPV-1 produce papilomas y fibropapilomas en la región del pene; el tipo 2, papilomas y fibropapilomas cutáneos y del tracto alimentario; los tipos 3 y 8, papilomas cutáneos; el tipo 4 se ha asociado a la aparición de papilomas del tracto gastrointestinal; el tipo 5, fibropapilomas en la ubre y los tipos 6, 9 y 10 se han encontrado asociados a la aparición de papilomas en ubres(3-7). Los fibromas, papilomas o fibropapilomas son neoplasias proliferativas benignas que pueden ser exofíticas o endofíticas, solitarias o múltiples, parcialmente delimitadas, tipo placa, papilares, con aspecto de grano de arroz o coliflor, secas y de consistencia firme que pueden necrosarse y desprenderse o exhibir contaminación bacteriana secundaria(8,9). Estas lesiones pueden tener regresión espontanea o permanecer hasta 6 a 18 meses; en caso de ser múltiples o dependiendo de su localización pueden ocasionar pérdida de la condición corporal. Los signos clínicos varían dependiendo de su localización; por ejemplo, si se localizan en espacio interdigital son dolorosos y pueden provocar cojeras o postración. En el tracto gastrointestinal, rara vez conducen a manifestaciones clínicas, pero pueden causar anorexia o timpanismo. En la glándula mamaria pueden dificultar el ordeño o complicarse

287


Rev Mex Cienc Pecu 2021;12(1):286-297

con infecciones secundarias y generar mastitis. En vagina o pene pueden interferir con el coito, sangrar, infectarse e interferir con la reproducción(10-12). Histológicamente los papilomas están constituidos por proyecciones papilares de epitelio escamoso, sostenidas por estroma fibrovascular. El epitelio de estas proyecciones exhibe hiperplasia e hiperqueratosis, orto y paraqueratosis marcada. En algunos papilomas, los queratinocitos, principalmente los del estrato espinoso, presentan abundante citoplasma claro o un halo perinuclear y núcleos picnóticos, las cuales son denominadas coilocitos (células con cambios citopáticos). En ciertos papilomas en regresión se aprecia reducción de la hiperplasia epidermal, incremento en la proliferación de fibroblastos, depósitos de colágena e infiltración por linfocitos. Los fibropapilomas tienen dos componentes: el epitelio de revestimiento que alterna con tejido fibroso dispuesto en haces cortos entrelazados y fibroblastos reactivos. El epitelio de revestimiento no muestra cambios citopatológicos, pero presenta hiperplasia marcada y acantosis plexiforme(1,13,14). En las lesiones grandes, el epitelio se puede erosionar semejando fibromas, en los cuales se observa proliferación de fibroblastos con depósitos de colágena densa(15). Se han desarrollado diferentes estrategias para la detección del PVB en fibromas y fibropapilomas mediante PCR. En este sentido, los oligonucleótidos FAP59/FAP64, diseñados a partir del análisis de regiones conservadas del gen L1 del papilomavirus humano (VPH), además de detectar un amplio espectro de tipos de VPH en tumores cutáneos y piel sana, han demostrado ser de utilidad en la detección de papilomavirus cutáneos de diversas especies, incluyendo los Papilomavirus bovinos tipo 1 - 12. De manera similar, los oligos MY09/MY11, diseñados originalmente para detectar tipos de VPH asociados a la mucosa y los genitales, han demostrado ser capaces de amplificar regiones del gen L1 de los tipos 1, 3, 5 6 del PVB(16,17). En México solamente se han informado datos de detección e identificación molecular de la infección por el PVB en el estado de Tamaulipas(18). No existen datos epidemiológicos sobre la incidencia, prevalencia o los tipos virales más frecuentemente involucrados en el desarrollo de papilomas o fibropapilomas en ganado bovino de otras regiones del país. El objetivo de este trabajo es determinar la presencia de diferentes tipos de PVB en muestras de tejidos de bovinos con lesiones cutáneas con diagnóstico histopatológico de papilomas y fibropapilomas en diferentes regiones del estado de San Luis Potosí. Se obtuvieron biopsias incisionales y excisionales de piel de bovino con lesiones sugerentes de fibromas, papilomas, y fibropapilomas de 11 animales de diferentes regiones del estado de San Luis Potosí (Cuadro 1 y Figura 1).

288


Rev Mex Cienc Pecu 2021;12(1):286-297

Cuadro 1: Características de los bovinos incluidos en el muestreo Sistema de ID Raza Edad Sexo Ubicación producción 1 Suizo-Cebú 18 meses hembra Estabulado Tamuín 2 Suizo-Cebú 5 meses macho Agostadero Éban 3 Lidia 6 meses macho Estabulado Villa de Reyes 4 Cruza de 6 meses macho SemiVilla de Zaragoza Suizo estabulado 5 Holstein 15 meses hembra Estabulado Soledad de Graciano Sánchez 6 Holstein 10 meses hembra Estabulado Soledad de Graciano Sánchez 7 Holstein 10 meses hembra Estabulado Soledad de Graciano Sánchez 8 Holstein 12 meses hembra Estabulado Soledad de Graciano Sánchez 9 Holstein 13 meses hembra Estabulado Soledad de Graciano Sánchez 10 Cruza de 7 meses macho Agostadero Tamuín Cebú 11 Cruza de 8 meses macho SemiTamasopo Suizo estabulado Figura 1: Localización geográfica y cantidad de muestras obtenidas en las localidades del estado de San Luis Potosí

El tejido diseccionado se fragmentó en porciones pequeñas las cuales se dividieron para su estudio en dos partes: la primera porción se colocó en tubos Falcón de 15 ml con formalina al 10%, para su evaluación histopatológica y la segunda porción se colocó en una solución amortiguadora de fosfatos (PBS) pH 7.2 para la realización de PCR. Las muestras en PBS se colocaron en un contenedor criogénico y se transportaron al Laboratorio de Inmunología y

289


Rev Mex Cienc Pecu 2021;12(1):286-297

Virología de la UASLP para su procesamiento. Las muestras colocadas en formaldehído fueron transportadas a temperatura ambiente al mismo laboratorio. Para la evaluación histopatológica, los fragmentos de tejido previamente fijados en formalina al 10%, se incluyeron en parafina y se procesaron por la técnica histológica de rutina, se hicieron cortes de 3 a 5 µm de grosor y se tiñeron con hematoxilina y eosina (H&E). Para la extracción de ADN de las muestras colectadas se procesaron 25 mg de tejido con el juego de reactivos DNeasy Blood &Tissue (Qiagen, Valencia, California, EUA) siguiendo el procedimiento establecido por el fabricante. El ADN extraído fue almacenado a -80°C hasta su uso. Para comprobar la pureza y cuantificar el ADN extraído, se empleó un microespectofotómetro de gota Nano-200 (All sheng, Beijing, China). Para verificar la integridad del ADN, se realizó una electroforesis en gel TAE-Agarosa al 2%. Las muestras de ADN fueron sometidas a PCR empleando las parejas de oligos FAP-59/FAP64 (Macrogen, Seoul Rep. de Korea) (FAP-59: 5'-TAACWGTIGGICAYCCWTATT-3'; FAP-64: 5'- CCWATATCWVHCATITCICCATC-3') y MY-09/MY-11 (IDT, San Diego, California, USA) (MY-09: 5'- CGTCCAAAAGGAAACTGAGC-3'; MY-11: 5'GCACAGGGACATAACAATGG-3'). Ambas parejas de oligos detectan el marco abierto de lectura del gen de la proteína mayoritaria de la cápside L1, altamente conservada en todos los tipos de PV bovinos y humanos. Se prepararon mezclas de PCR de 50µl con el juego de reactivos para PCR Invitrogen (Invitrogen, Massachusetts, USA). Estas mezclas contenían: buffer 1×, DNTp 200 µM, MgCl2 2mM, oligonucleótidos 20 pM y 5 UI de Taq polimerasa y 10 ng de ADN. Estas mezclas se colocaron en un Termociclador Multigene Optimax (LabNET, California, USA). Para los oligos MY09/MY11, el programa de PCR consistió en 10 min de desnaturalización inicial a 94 °C, 35 ciclos de 90 seg a 94 °C, 60 seg a 50 °C, 90 seg a 72 °C y una extensión final de 5 min a 72 °C. Para la pareja FAP59/FAP64, el programa empleado consistió en 10 min de desnaturalización inicial a 94 °C, 45 ciclos de 90 seg a 94 °C, 90 seg a 50 °C, 90 seg a 72°C y una extensión final de 5 min a 72 °C. Los productos de PCR fueron analizados mediante electroforesis de 5 µl del producto en gel de TAE-agarosa al 2%. La electroforesis se realizó aplicando un voltaje de 80 V durante 80 min; transcurrido este tiempo, el gel se impregnó con bromuro de etidio (Sigma - Aldrich, Missouri, EUA) y la imagen se capturó con un fotodocumentador Gel Doc EZ System (BioRad, Hercules, California, EUA). Las secciones histológicas de las 11 biopsias de piel, presentaban características en común tales como hiperplasia irregular e hiperqueratosis marcadas de la epidermis, erosiones, ulceras y costras serocelulares, en algunas, se observaron además proyecciones papilares 290


Rev Mex Cienc Pecu 2021;12(1):286-297

sostenidas por estroma fibrovascular que alterna con colágena densa y degeneración epitelial balonoide con cuerpos de inclusión. En la dermis se observó proliferación de tejido conectivo fibroso maduro, entremezclado con fibroblastos reactivos, colágena densa, vasos linfáticos de nueva formación, así como múltiples agregados de linfocitos, células plasmáticas y macrófagos. Además, en una de las secciones de tejido se apreciaron células epiteliales atípicas dispersas, las cuales presentaban pérdida de la relación núcleo citoplasma, abundante citoplasma intensamente eosinofílico; núcleo grande, con escotaduras, cromatina desplazada a la periferia y uno a tres nucléolos evidentes (Figura 2). Figura 2: Lesiones histológicas representativas de los fibromas, papilomas y fibropapilomas encontrados en la piel del ganado

A) Fibropapiloma: la epidermis exhibe hiperplasia irregular e hiperqueratosis marcada difusa, así como formación de proyecciones papilares sostenidas por estroma fibrovascular. H&E, 4X; B) Fibroma: la epidermis exhibe hiperplasia irregular e hiperqueratosis marcada difusa, en la dermis se observa proliferación de tejido conectivo fibroso entremezclado con vasos sanguíneos congestionados y agregados de linfocitos y células plasmáticas. H&E, 4X; C) Fibroma: la epidermis exhibe hiperplasia irregular e hiperqueratosis marcada, además se observa degeneración balonoide de los queratinocitos en diferentes estratos; en la dermis se aprecia proliferación de fibroblastos reactivos y agregados de linfocitos y células plasmáticas. H&E, 10X; D y E) Fibroma: los

291


Rev Mex Cienc Pecu 2021;12(1):286-297

queratinocitos exhiben degeneración balonoide y presencia de estructuras anfofílicas amorfas compatibles con cuerpos de inclusión (Flecha) H&E, 100X; F) Fibroma: algunas células epiteliales exhiben marcada anisocariosis con pérdida de la relación núcleo citoplasma, abundante citoplasma intensamente eosinofílico; núcleo grande, con escotaduras, cromatina desplazada a la periferia y uno a tres nucléolos evidentes. H&E, 40X.

Las lesiones histológicas observadas fueron sugerentes de un proceso neoplásico benigno de tipo viral compatibles con fibromas y fibropapilomas con base en características como: hiperplasia irregular e hiperqueratosis epidérmica, presencia de proyecciones papilares de la epidermis; proliferación de tejido conectivo fibroso maduro, entremezclado con fibroblastos reactivos, colágena densa y agregados de linfocitos, células plasmáticas y macrófagos. Además de presencia de coilocitos y cuerpos de inclusión anfofílicos intranucleares. Los diagnósticos histopatológicos definitivos se resumen en el Cuadro 2. Cuadro 2: Finalidad de explotación de los bovinos, resultados histológicos y de PCR de las muestras obtenidas ID Propósito de cría Diagnóstico histológico PCR FAP PCR MY 1 Carne Fibroma + 2 Carne Fibropapiloma 3 Exhibición Fibropapiloma + 4 Carne Fibroma + + 5 Leche Fibropapiloma + + 6 Leche Fibropapiloma + + 7 Leche Fibroma 8 Leche Fibroma 9 Leche Fibropapiloma 10 Carne Fibroma + 11 Carne Fibropapiloma + Total 5 6 En la reacción de amplificación con los oligos FAP59/FAP64, se observó un amplicón de entre 480 a 538 pb correspondiente al producto de la amplificación por PCR del gen L1 de PVB en el 45.45 % del total de las muestras (n= 5). En el 27.27 % (n= 3) del total de las muestras, no se observó ningún producto de PCR. De manera global, hasta un 72 % de las muestras fueron positivas para secuencias de ADN correspondientes a secuencias del gen L1 del virus del PVB (Figura 3 y Cuadro 2).

292


Rev Mex Cienc Pecu 2021;12(1):286-297

Figura 3: Producto de PCR con los oligos FAP59/FAP64

Carril 1: muestra 5, amplicón de 485 pb. Carril 2: muestra 6, amplicón de 511 pb; Carril 7: muestra 10, amplicón de 521 pb; Carril 9: muestra 11, amplicón de 515 pb; Carril 11: muestra 4, amplicón de 513 pb. Carril 12: testigo negativo (Sin DNA); Carril 13: escalera de 100 pb. Carriles 3, 4, 5, 6, 8 y 10: no se observa producto de PCR.

El análisis electroforético de los productos de PCR obtenidos con los oligos MY09/MY11 mostró bandas de entre 470 a 490 pb en las muestras 1, 2, 5, 6, 8 y 9 (54.5 % del total de las muestras), este amplicón es coincidente con el esperado para la PCR del gen L1 del virus del PVB (Figura 4). Figura 4: PCR con los oligos MY09/11

Carril 1: muestra 5, amplicón de 472 pb. Carril 2: muestra 6, amplicón de 479 pb; Carril 5: muestra 9, amplicón de 492 pb; Carril 6: muestra 1, amplicón de 488 pb; Carril 8: muestra 3, amplicón de 483 pb. Carril 9: muestra 4, amplicón de 486 pb Carril 12: testigo negativo (Sin DNA); Carril 13: escalera de 100 pb. Carriles 3, 4, 7, 10 y 11: no se observa producto de PCR.

293


Rev Mex Cienc Pecu 2021;12(1):286-297

La mayoría de las lesiones examinadas fueron sugerentes de fibromas, sin embargo, es importante considerar que algunos papilomas y fibropapilomas pueden presentar regresión o cambios morfológicos durante su evolución que los hacen semejar fibromas en función de la cronicidad y estado inmunológico del animal(13,15). Por esta razón es altamente probable que la incidencia de fibromas reportada en este trabajo esté sobreestimada con respecto al momento en que los animales fueron muestreados, dado que la etiología y evolución de estas lesiones pueden seguir un patrón común. Las muestras incluidas en este estudio provenían de piel de diferentes regiones anatómicas de bovinos sin que se observara un patrón de restricción de las lesiones a una zona determinada en el cuerpo del animal. Estos resultados concuerdan con lo descrito por Borzacchiello et al(4) quienes señalan que la presentación de lesiones cutáneas en la infección por PVB puede ser de manera generalizada y que además el sitio de aparición de estas lesiones se pueden correlacionar con el tipo viral involucrado. Dado que las lesiones muestreadas se presentaron únicamente en la piel de los bovinos, es probable que los tipos virales involucrados correspondan al PVB-2, PVB-3, PVB-6 PVB-8 PVB-9 o PVB-10. Este hallazgo, sin embargo, deberá ser confirmado mediante secuenciación de los productos de PCR obtenidos. Hasta donde se sabe, este es el primer trabajo que se ocupa de la detección a nivel molecular de la infección por el PVB en bovinos del estado de San Luis Potosí. Por lo cual los datos contenidos en este trabajo señalan las áreas de oportunidad en las cuales es necesario trabajar para implementar las medidas de detección y control necesarias para impactar favorablemente en la salud de los animales y mejorar la calidad de los productos pecuarios. En la evaluación histológica, las lesiones más frecuentemente observadas en los fragmentos de piel, fueron la hiperplasia irregular de la epidermis, hiperqueratosis marcada difusa y degeneración balonoide de queratinocitos y en la dermis, proliferación de fibroblastos reactivos, tejido conectivo fibroso y agregados de linfocitos y células plasmáticas. Estas características han sido señaladas en extenso como lesiones sugerentes de una infección por papilomavirus(19,20). Estudios previos realizados en Japón empleando la pareja de oligos FAP-59 / FAP-64 informan una prevalencia de hasta el 100% de PVB en lesiones cutáneas(21). Un estudio en Irán informa una prevalencia del 12.5 % en ganado Holstein(22). En el presente estudio se encontró una frecuencia global de infección por algún tipo de PVB del 72 %; dato similar a lo informado por Santos et al(23) quienes encontraron una prevalencia de hasta el 86 % de muestras positivas a PVB en Brasil, y por Rojas et al(18) quienes informan de 2 a 70 % de muestras positivas en el estado de Tamaulipas, México. En el 27.27 % de las muestras, las lesiones histológicas fueron altamente sugestivas de una infección viral, sin embargo, estas 294


Rev Mex Cienc Pecu 2021;12(1):286-297

resultaron negativas por PCR a PVB por lo que no se descarta la posibilidad de asociación del PVB con estas lesiones, debido al proceso de integración genómica presente en la historia natural de la infección por PVB(4,24). Las infecciones por papilomavirus se han descrito en todo el mundo, aunque no todos los genotipos presentan la misma prevalencia regional(1,25,26). En este trabajo se incluyeron muestras colectadas de bovinos de las regiones centro y huasteca del estado de San Luis Potosí, México, las cuales poseen climas muy diferentes entre sí (seco árido en el centro y subtropical en la huasteca). A pesar de que la mayoría de las muestras provenían de la región centro, los habitantes de las localidades de la región huasteca del estado informan de forma empírica una mayor incidencia de lesiones sugerentes de infección por PVB lo que concuerda con lo informado por Violet et al(27) quienes señalan una probable asociación entre la frecuencia de presentación de papilomatosis cutánea y climas de tipo tropical lluvioso. En este trabajo se describió por primera ocasión la presencia de PVB en bovinos del estado de San Luis Potosí, México. La presencia de este agente en bovinos de la entidad es alta, pero se considera similar a la encontrada en una región aledaña al estado y no se encuentra restringida a un patrón de presentación relacionado con la edad, raza o sistema de producción de los animales. Debido a que los tipos de PVB circulantes en el estado de SLP no han sido caracterizados hasta el tipo viral, es importante su identificación, lo que permitirá caracterizar patrones de distribución específicos (clúster) y el desarrollo de biológicos efectivos específicamente contra estos tipos virales. Agradecimientos La Maestra Isaura Méndez Rodríguez, desea agradecer al CONACYT (México) por la beca otorgada para realizar sus estudios doctorales. Conflictos de interés Los autores declaran no tener conflictos de interés, en relación a la elaboración, revisión y publicación de este trabajo. Literatura citada: 1. Díaz RV, Duch CE, Gómez AD, Duato EGL, Rico LB. Papilomatosis bovina: epidemiología y diversidad de papilomavirus bovinos (BPV). Rev Complutense Cienc Vet 2012;6(2):38-58. 2. Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA. Virus taxonomy: VIIIth report of the International Committee on Taxonomy of Viruses. California, USA: Academic Press; 2005. 295


Rev Mex Cienc Pecu 2021;12(1):286-297

3. De Villiers EM, Fauquet C, Broker TR, Bernard HU, Zur Hausen H. Classification of papillomaviruses. Virology 2004;324(1):17-27. 4. Borzacchiello G, Roperto F. Bovine papillomaviruses, papillomas and cancer in cattle. Vet Res 2008;39(5):1. 5. Ogawa T, Tomita Y, Okada M, Shirasawa H. Complete genome and phylogenetic position of bovine papillomavirus type 7. J General Virol 2007;88(7):1934-1938. 6. Tomita Y, Literak I, Ogawa T, Jin Z, Shirasawa, H. Complete genomes and phylogenetic positions of bovine papillomavirus type 8 and a variant type from a European bison. Virus Genes 2007;35(2):243-249. 7. Hatama S, Nobumoto K, Kanno T. Genomic and phylogenetic analysis of two novel bovine papillomaviruses, BPV-9 and BPV-10. J General Virol 2008;89(1):158-163. 8. Pattar J. Autogenous vaccination and immunomodulation for management of cutaneous papillomatosis in a crossbred cow. Intas Polivet 2013;14(2):423-425. 9. Munday J. Bovine and human papillomaviruses: a comparative review. Vet Pathol 2014;51(6):1063-1075. 10. Corteggio A, Altamura G, Roperto F, Borzacchiello G. Bovine papillomavirus E5 and E7 oncoproteins in naturally occurring tumors: are two better than one? Infectious Agents and Cancer 2013;8(1):1. 11. Knight CG, Munday JS, Rosa BV, Kiupel M. Persistent, widespread papilloma formation on the penis of a horse: a novel presentation of equine papillomavirus type 2 infection. Vet Dermatol 2011;22(6):570-574. 12. Salib, FA, Farghali HA. Clinical, epidemiological and therapeutic studies on Bovine Papillomatosis in Northern Oases, Egypt in 2008. Vet World 2011;4(2)53-59. 13. Guzmán LSO, Barboza Q, González RRA. Biología del virus del papiloma humano y técnicas de diagnóstico. Medicina Universitaria 2010;12(49):231-238. 14. Henry M, Ioffe O. Squamous premalignancy of the cervix: advantages of a 2-tiered versus 3-tiered terminology. AJSP: Reviews & Reports 2013;18(4):177-182. 15. Jang JS, Kim JH, Shin TK, Cho GJ, Kwon OD. A case of cutaneous fibroma in a Korean indigenous cattle. J Vet Clin 2008;25(3):200-201. 16. Forslund O, Antonsson A, Nordin P, Stenquist BO, Hansson BG. A broad range of human papillomavirus types detected with a general PCR method suitable for analysis of cutaneous tumours and normal skin. J General Virol 1999;80(9):2437-2443.

296


Rev Mex Cienc Pecu 2021;12(1):286-297

17. Antonsson A, Hansson BG. Healthy skin of many animal species harbors papillomaviruses which are closely related to their human counterparts. J Virol 2002;76(24):12537-12542. 18. Rojas-Anaya E, Cantú-Covarrubias A, Álvarez JFM, Loza-Rubio E. Detection and phylogenetic analysis of bovine papillomavirus in cutaneous warts in cattle in Tamaulipas, Mexico. Canad J Vet Res 2016;80(4):262-268. 19. Jarrett WF, Campo MS, Blaxter ML, O'neil BW, Laird HM, Moar MH, et al. Alimentary fibropapilloma in cattle: a spontaneous tumor, nonpermissive for papillomavirus replication. J Natl Cancer Inst 1984;73(2):499-504. 20. Campo MS. Bovine papillomavirus and cancer. The Vet Journal 1997;154(3):175-188. 21. Ogawa T, Tomita Y, Okada M, Shinozaki K, Kubonoya H, Kaiho I, et al. Broad-spectrum detection of papillomaviruses in bovine teat papillomas and healthy teat skin. J General Virol 2004;85(8):2191-2197. 22. Babaahmady E, Taherpour K. Verrugas en los pezones de vacas lecheras. REDVET. Revista electrónica de Veterinaria 2011;12(6):1-6. 23. Santos EUD, Silva MAR, Pontes NE, Coutinho LCA, Paiva SSL, Castro RS, et al. Detection of different bovine papillomavirus types and co‐infection in bloodstream of cattle. Transboundary Emerging Diseases 2016;63(1):e103-e10863. 24. Agrawal R, Pelkonen J, Rytkönen M, Mäntyjärvi RA. Integration of bovine papillomavirus type 1 DNA and analysis of the amplified virus-cell junctions in transformed primary mouse fibroblasts. J General Virol 1992;73(1):201-206. 25. Orozco ANM, Padilla MHJ. Manual alternativas de tratamiento contra la papilomatosis bovina [tesis doctoral]. Managua, Nicaragua: Universidad Nacional Agraria; 2016. 26. Charry DJV, Hinojosa LMB. Estudio de papilomatosis bovina en cinco propiedades de ganadería de leche, en cantón Pedro Vicente Maldonado en la provincia de Pichincha [tesis de licenciatura]. Quito, Ecuador: Universidad de las Américas; 2011. 27. Violet L, Montes D, Cardona J. Frecuencia de papilomatosis en bovinos (Bos taurus) del departamento de Córdoba, Colombia. Revista Colombiana de Ciencia Animal-RECIA 2017;9(2):294-300.

297


https://doi.org/10.22319/rmcp.v12i1.5378 Nota de investigación

Prevalencia de genes qnrB, qnrA y blaTEM en bacteriófagos atemperados de Escherichia coli aislados en agua residual y alcantarillas de rastros del Estado de México

Juan Martín Talavera-González a Jorge Acosta-Dibarrat a Nydia Edith Reyes-Rodríguez b Celene Salgado-Miranda a Martín Talavera-Rojas a*

a

Universidad Autónoma del Estado de México. Facultad de Medicina Veterinaria y Zootecnia. Centro de Investigación y Estudios Avanzados en Salud Animal. Carretera Panamericana Toluca-Atlacomulco, Km 15.5, 50200 Toluca, Estado de México, México. b

Universidad Autónoma del Estado de Hidalgo. Instituto de Ciencias Agropecuarias. Tulancingo de Bravo, Hidalgo, México.

* Autor de correspondencia: talaverarojas@gmail.com

Resumen: Los genes de resistencia a los antibióticos (ARG) han sido descritos principalmente en bacterias; sin embargo, en fagos atemperados los estudios han sido escasos. En este estudio se determinó la prevalencia de los genes qnrB, qnrA y blaTEM en cepas de Escherichia coli y en fagos atemperados obtenidos por inducción del ciclo lítico en dichos aislamientos. Se recolectaron 48 muestras de agua potable, agua residual y alcantarillado en rastros del Estado de México obteniendo 37 aislamientos de E. coli. La mayor resistencia fue para tetraciclina 32/37 (86.4 %), seguido de trimetoprim-sulfametoxasol 19/37 (51.3 %) y por último ampicilina y ácido nalidíxico con el mismo número de aislamientos 18/37 (48.6 %). La prevalencia del gen blaTEM en aislamientos bacterianos fue 37.8 %, mientras que en los

298


Rev Mex Cienc Pecu 2021;12(1):298-305

aislamientos fágicos fue 3.5 %. Los genes qnrA y qnrB fueron encontrado s en 8.1 % y 29.7 % respectivamente en aislamientos bacterianos, mientras que en los aislamientos fágicos fueron obtenidos 2.7 y 24.3 % respectivamente. Los resultados muestran que los ARG presentes en aislamientos bacterianos se relacionan en el ADN fágico, lo que indica el papel significativo en la propagación de ARG en los rastros estudiados. Comprender los mecanismos de resistencia a antimicrobianos, permitirá establecer medidas efectivas para disminuir este fenómeno. Palabras clave: Bacteriófagos, Escherichia coli, Genes, Resistencia.

Recibido: 13/05/2019 Aceptado:31/03/2020

La terapia con antibióticos representa uno de los avances médicos más importantes del siglo XX, y es un recurso valioso para el combate de enfermedades infecciosas causadas por bacterias. Sin embargo, su uso terapéutico ha sido asociado con la aparición de bacterias resistentes a antibióticos(1). Reconocido como un problema global, genera un aumento en el costo de tratamientos debido a la rápida diseminación de las cepas por la migración humana e industrialización tanto alimentaria como animal. Esta resistencia puede ser causada por la presencia de genes de resistencia a los antibióticos (ARG), los cuales pueden ser adquiridos y transferidos mediante elementos genéticos móviles (MGE) como los bacteriófagos(2). Los bacteriófagos lisogénicos con la presencia de ARG se han encontrado, en su mayoría, en ambientes acuáticos(2,3), pero de igual forma los han reportado en muestras fecales obtenidas en hospitales de pacientes clinicamente sanos, sugiriendo que los fagos pueden estar presentes en todos los ambientes sin ser detectados en programas de inocuidad(4,5). El conjunto de estudios realizados en bacteriófagos lisogénicos no solo muestran la presencia de los ARG que ha cobrado la vida de miles de personas y causado pérdidas millonarias en todo el mundo, sino también la contribución de los fagos en la propagación de los ARG en el ambiente(1). Por lo tanto, este trabajo tiene como objetivo colaborar en la comprensión del rol que juegan los bacteriófagos en la propagación de ARG determinando la prevalencia de los genes blaTEM, qnrA y qnrB en el ADN bacteriano y fágico. Durante septiembre – diciembre de 2015, se realizó un muestreo probabilístico de juicio o de criterio(6), donde se recolectaron 48 muestras con base a la normatividad oficial(7) provenientes de cuatro rastros municipales (SLH1, SLH2, SLH3 y SLH4), 16 de estas fueron tomadas de agua potable (AP), 16 de agua residual (AR) y 16 de alcantarillas (AC) ubicadas en el área del sacrificio; para su recolección se utilizó un hisopo, el cual se frotó sobre las

299


Rev Mex Cienc Pecu 2021;12(1):298-305

orillas de la superficie de la tapa(7). Para la confirmación genotípica de aislamiento de E. coli se usó una PCR punto final amplificando el gen uidA siguiendo las condiciones de Aguilar et al(8). Los primers usados son mencionados en el Cuadro 1. Se usaron 14 antimicrobianos con diferente margen de concentración para realizar la prueba de sensibilidad mediante el método de difusión en disco de acuerdo a los lineamientos del CLSI(9). La interpretación de los resultados se hizo de acuerdo a los lineamientos de CLSI(10). Cuadro 1: Primers específicos utilizados en la PCR Primer UAL1939b UAL2105b MultiTSO-F_for MULTITSOT_rev QnrAm_F QnrAm_R QnrBm_F QnrBm_R

Secuencia (5´--- 3´)

Gen

Referencia

ATGGAATTTCGCCGATTTTGC uidA Aguilar et al. 2015 ATTGTTTGCCTCCCTGCTGC CATTTCCGTGTCGCCCTTATTC CGTTCATCCATAGTTGCCTGAC blaTEM Dallene et al. 2010 AGAGGATTTCTCACGCCAGG TGCCAGGCACAGATCTTGAC GGMATHGAAATTCGCCACTG TTTGCYGYYCGCCAGTCGAA

qnrA Kraychete et al. 2016 qnrB

Mediante la metodología descrita por Raya y Hébert(11) se realizó el aislamiento fágico con Mitomicina C, comprobando la existencia de lisis fágica con el método de spot test y la prueba de “doble capa”. Para la obtención de ADN fágico se usó el método fenol-cloroformo descrito por Pickard(12). Se confirmó la eliminación de ADN bacteriano y la presencia del ADN fágico por una prueba de PCR de punto final en un termociclador MultigeneTM Mini Personal (Labnet International Inc., Edison, NJ, USA) utilizando como control negativo la amplificación del gen uidA(3). Para la extracción de ADN bacteriano se consideró la metodología propuesta por Ahmed et al(13). La concentración y pureza del ADN fágico y bacteriano fueron determinadas usando un espectrómetro (Quawell q500). Para la detección de los genes qnrA, qnrB y blaTEM se empleó una PCR de punto final con las condiciones que reporta Kraychete et al(14) y Dallene et al(15) respectivamente. Los análisis estadísticos se realizaron mediante análisis de varianza (ANOVA) y la prueba de correlación lineal usando StatCalc Version 8.2.2 (Copyright  2016 AcaStat Software). Se consideraron diferencias significativas a un nivel de P0.05. De las 48 muestras recolectadas se obtuvieron 37 (77 %) aislamientos de Escherichia coli mostrando diferentes índices de resistencia (Cuadro 2). Del total de aislamientos, 13/37 (35.1 %) fueron recolectados de SLH1 mostrando alta significancia en comparacion con SLH2, SLH3 y SLH4 donde se aislaron 8/37 (21.6 %) en cada uno, debido al número de sacrificios practicados (P0.05). Cabe resaltar que hubo una correlación positiva (r=1) entre 300


Rev Mex Cienc Pecu 2021;12(1):298-305

los 19 (51.3 %) aislamientos procedentes de agua residual y 18 (48.6 %) de alcantarilla, ya que ambos sitios mantienen condiciones similares y necesarias para un crecimiento bacteriano adecuado. Cuadro 2: Patrón de resistencia a antibióticos de los aislamientos de Escherichia coli de agua residual y agua de alcantarilla, obtenidos en los rastros municipales de la zona norte del Estado de México SLH2 SLH3 SLH4 Antib/Conc(g) SLH1 AR

AC

Total (%) 7/18 (38.8) 0/1 (0)

AR

AC

Total AR AC Total AR AC (%) (%) Ampicilina/10 4 3 0 2 2/18 4 1 5/18 2 2 (11.1) (27.7) Amikacina/30 0 0 0 0 0/1 1 0 1/1 0 0 (0) (100) Carbenicilina/100 4 3 7/19 2 2 4/19 3 1 4/19 2 2 (36.8) (21) (21) Gentamicina/10 1 1 2/5 0 0 0/5 2 1 3/5 0 0 (40) (0) (60) Cefalotina/30 0 1 1/5 1 0 1/5 1 0 1/5 1 1 (20) (20) (20) Cefotaxima/30 0 0 0/0 (0) 0 0 0/0 0 0 0/0 0 0 (0) (0) Netilmocina/30 0 0 0/1 (0) 0 0 0/1 0 0 0/1 1 0 (0) (0) Ciprofloxacina/5 0 0 0/3 (0) 1 1 2/3 1 0 1/3 0 0 (66.6) (33.3) Norfloxacina/10 0 1 1/3 1 0 1/3 1 0 1/3 0 0 (33.3) (33.3) (33.3) Cloranfenicol/30 7 3 10/23 4 3 7/23 1 1 2/23 2 2 (43.4) (30.4) (8.6) Trimetoprim7 4 11/19 1 3 4/19 1 0 1/19 2 1 sulfametoxasol/25 (57.8) (21) (5.2) Nitrofurantoina/300 0 1 1/6 2 0 2/6 1 0 1/6 2 0 (16.6) (33.3) (16.6) Ácido nalidíxico/30 1 2 3/18 2 3 5/18 2 4 6/18 3 1 (16.7) (27.7) (33.3) Tetraciclina/30 7 5 12/32 3 4 7/32 3 3 6/32 3 4 (37.5) (21.8) (18.7) Antib= antibiótico, AR=agua residual, AC= agua de alcantarilla, Conc= concentración.

Total (%) 4/18 (22.2) 0/1 (0) 4/19 (21) 0/5 (0) 2/5 (40) 0/0 (0) 1/1 (100) 0/3 (0) 0/3 (0) 4/23 (17.3) 3/19 (15.7) 2/6 (33.3) 4/18 (22.2) 7/32 (21.8)

El número de aislamientos con ARG fue significativamente alto en agua residual comparada con el alcantarillado (P0.05), no se obtuvieron aislamientos de agua potable (Cuadro 3). Debido, probablemente, a la amplia gama de variantes que tienen los ARG y los diferentes mecanismos de resistencia, se obtuvieron aislamientos bacterianos con resistencia fenotípica intermedia y sensibles que amplificaban blaTEM, qnrA y qnrB.

301


Rev Mex Cienc Pecu 2021;12(1):298-305

Cuadro 3: Caracterización fenotípica/genotípica y relación de los aislamientos bacterianos y fágicos recolectados en rastros municipales de la zona norte del Estado de México Origen y patrón de Tipo y número de Tipo y número de Antibiótico resistencia de los genes encontrados en el genes encontrados en el aislamientos ADN bacteriano ADN fágico a AR R= 10 blaTEM (7) blaTEM (2) I= 1 blaTEM (1) S= 8 blaTEM (2) Ampicilina b AC R= 8 blaTEM (3) blaTEM (3) I= 2 S= 8 blaTEM (1) a AR R= 8 qnrA (2), qnrB (3) qnrA (1), qnrB (1) I= 7 qnrA (1), qnrB (3) qnrB (1) Ácido S= 4 qnrB (1) b nalidíxico AC R= 10 qnrB (2) qnrB (2) I= 3 qnrB (1) S= 5 qnrB (1) AR= agua residual, AC= alcantarillado, R= resistente, I= resistencia intermedia, S= sensible. abc Las diferentes literales en columnas indican diferencias estadísticas significativas.

Se obtuvo un pool de bacteriófagos de cada uno de los aislamientos bacterianos para la detección de los genes blaTEM, qnrA, qnrB; todos los aislamientos bacterianos presentaron fagos atemperados. El Cuadro 4 muestra que el gen blaTEM fue el más prevalente en aislamientos bacterianos y fágicos; estos resultados coinciden con los de Colomer-Lluch et al(3) quienes reportan a este gen con más prevalencia (80 a 100 %) y altas densidades de copias de genes (±3.3 log10) en muestras recolectadas de plantas tratadoras de agua residual y rastros. El gen blaTEM es el más reportado a nivel global(16,17), sobre todo en bacterias Gram negativas; esto se supone por su diseminación a través de aves acuáticas migratorias y a la gran cantidad de enzimas -lactamasas sintetizadas por las bacterias. Por otra parte, la prevalencia de qnrA y qnrB fue de 8.1 y 29.7 % en aislamientos bacterianos respectivamente, mientras que en aislamientos fagicos, respectivamente, fue de 2.7 y 10.8 %. La prevalencia, en aislamientos fágicos, reportada en este estudio contrasta con lo mencionado por ColomerLluch et al(3,18) en muestras recolectadas de aguas residuales; así mismo, se reporta(4) una alta prevalencia alta del gen qnrA en muestras obtenidas de un Centro de Salud. Aunque la prevalencia no es alta, actualmente la resistencia a las quinolonas ha ido en aumento; esto se debe al uso indiscriminado en la clínica veterinaria y humana(18).

302


Rev Mex Cienc Pecu 2021;12(1):298-305

Cuadro 4: Distribución de los genes blaTEM, qnrA y qnrB en los aislamientos bacterianos y fágicos de los rastros municipales de la zona norte del Estado de México blaTEM qnrA qnrB Rastro/No. de ADN ADN ADN ADN ADN ADN aislamientos bacteriano fágico bacteriano fágico bacteriano fágico (%) (%) (%) (%) (%) (%) 2 SLH1/13 3 (23) 1 (7.6) 1 (7.6) 8 (61.5) (15.3) 1 1 SLH2/8 4(50) 1 (2.5) 1 (12.5) 1 (12.5) (12.5) (12.5) 1 SLH3/8 4/(50) 1 (2.5) 1 (12.5) (12.5) SLH4/8 3 (37.5) 2 (2.5) 1 (12.5) 1 (12.5) 5 4 Total= 37 14 (37.5) 3 (8.1) 1 (2.7) 11 (29.7) (13.5) (10.8) Se obtuvo una correlación positiva (r=0.99) entre la cantidad de ARG registrados en el ADN bacteriano y ADN fágico (Cuadro 4). Este hecho es indicativo que en bacterias multirresistentes existe la presencia de fagos que, según diversos autores, pueden diseminar porciones genómicas bacterianas con la presencia de ARG en el ambiente y transducirlos a bacterias comensales y patógenas, confiriéndoles nuevas habilidades de adaptación (corto plazo) y evolución (largo plazo), y contribuir a la generación de nuevas cepas patógenas causantes de enfermedades mortales. Además, el mayor número de aislamientos bacterianos con la presencia de los tres genes que confieren resistencia a los antibióticos se registró en SLH1, mientras que en SLH2 se registró la presencia de los tres genes en aislamientos fágicos (Cuadro 4). La contaminación e insalubridad mostrada en los rastros municipales reúnen factores como temperatura, pH, concentración, estado fisiológico bacteriano y fágico necesarios para el desarrollo de una transducción exitosa. El estilo de vida de los seres humanos ha provocado que la resistencia vaya en aumento, y aunque el uso indiscriminado e innecesario de los antimicrobianos actualmente se comienza a controlar; en diversos estudios reportan bacterias altamente virulentas con una gran resistencia a los antibióticos en diversos sitios de acciones antropogénicas(1). En este estudio, los aislamientos bacterianos y fágicos con la presencia de los genes blaTEM, qnrA y qnrB muestran una distribución muy variable registrando la presencia de al menos uno de estos genes en los rastros. Los fagos, al pertenecer al grupo de MGE, juegan un rol muy importante en la transferencia de ARG, entre bacterias patógenas – comensales y patógenas –

303


Rev Mex Cienc Pecu 2021;12(1):298-305

patógenas(5). La comprensión de los mecanismos de resistencia a antimicrobianos, será útil para el desarrollo de estrategias efectivas para la reducción de este fenómeno. Literatura citada: 1. Balcazar JL. Bacteriophages as vehicles for antibiotic resistance genes in the environment. PLoS Pathog 2014;10(7):e1004219. 2. Colomer-Lluch M, Jofre J, Muniesa M. Antibiotic resistance genes in the bacteriophage DNA fraction of environmental samples. PLoS One 2011;6(3):e17549 . 3. Colomer-Lluch M, Calero-Cáceres W, Jebri S, Hmaied F, Muniesa M, Jofre, J. Antibiotic resistance genes in bacterial and bateriophage fractions of Tunisian and Spanish wastewater as markers to compare the antibiotic resistance patterns in each population. Environment Int 2014a;(73):167-175. 4. Quirós P, Colomer-Lluch M, Martínez-Castillo A, Miró E, Argente M, Jofre J, et al. Antibiotic resistance genes in the bacteriophage DNA fraction of human fecal samples. Antimicrob Agents Chemother 2014;58(1):606-609. 5. Iversen H, L´Ábée-Lund TM, Aspholm M, Arnesen LP, Lindbäck T. Commensal E. coli Stx2 lysogens produce high levels of phages after spontaneous propahge induction. Front Cell Infect Microbiol 2015;(5):1-8. 6. Jaramillo ACJ, Martínez MJJ. Epidemiología Veterinaria. 1ra ed. México: El Manual Moderno; 2010. 7. SS. Secretaria de Salud. Salud Ambiental. Agua para uso y consumo humano, requisitos sanitarios que se deben cumplir en los sistemas de abastecimiento públicos y privados durante el manejo del agua. Procedimientos sanitarios para el muestreo. NOM-230SSA1-2002. Diario Oficial de la Federación, México. 8. Aguilar MOS, Talavera RM, Soriano VE, Barba LJ, Vazquez, NJ. Determination of extended spectrum -lactamases and plasmid-mediated quinolone resistance in Escherichia coli isolates obtained from bovine carcasses in Mexico. Trop Anim Health Prod 2015;47(5):975-981. 9. CLSI. Clinical and Laboratory Standard Institute. Performance standards for antimicrobial disk susceptibility tests, 19th ed. Approved Standard M02-A11. Wayne, PA: CLSI. 2012. 10. CLSI. Clinical and Laboratory Standard Institute. Performance standards for antimicrobial susceptibility testing, 25nd informational supplement. M100-S25. Wayne, PA: CLSI. 2015.

304


Rev Mex Cienc Pecu 2021;12(1):298-305

11. Raya RR, Hébert EM. Isolation of phage via induction of lysogens. In: Clokie MRJ, Kropinski AM, editors. Bacteriophages. Methods and Protocols, Volume 1: Isolation, characterization, and interactions. UK: Humana Press; 2009:23-32. 12. Pickard DJ. Preparation of bacteriophage lysate and pure DNA. In: Clokie MRJ, Kropinski AM, editors. Bacteriophages. Methods and protocols, Volume 2: Molecular and Applied Aspects. UK: Humana Press; 2009:3-9. 13. Ahmed AM, Ishida Y, Shimamoto T. Molecular characterization of antimicrobial resistance in Salmonella isolated from animals in Japan. J Appl Microbiol 2009;106(2):402-409. 14. Kraychete GB, Botelho LA, Campana EH, Picão RC, Bonelli RR. Updated multiplex PCR for detection of all six plasmid-mediated qnr gene families. Antimicrob Agents Chemother 2016;60(12):7524-7526. 15. Dallenne C, Da Costa A, Decré D, Favier C, Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J Antimicrob Chemother 2010;65(3):490-495. 16. Ouedraogo SA, Sanou M, Kissou A, Sanou S, Solaré H, Kaboré F, et al. High prevalence of extended-spectrum -lactamase producing enterobacteriaceae among clinical isolates in Burkina Faso. BMC Infect Dis 2016;(16):326. 17. Jang J, Suh YS, Di DY, Unno T, Sadowsky MJ, Hur HG. Pathogenic Escherichia coli strains producing extended-spectrum β‐lactamases in the Yeongsan River Basin of South Korea. Environ Sci Technol 2012;47(2):1128-1136. 18. Colomer-Lluch M, Jofre J, Muniesa M. Quinolone resistance genes (qnrA and qnrS) in bacteriophage particles from wastewater samples and the effect of inducing agents on packaged antibiotic resistance genes. J Antimicrob Chemother 2014;69(5):1265-1274.

305


https://doi.org/10.22319/rmcp.v12i1.5454 Nota de investigación

Calidad sensorial de la carne de cabritos lechales criados en sistemas de producción basados en pastoreo

Francisco De-la-Vega Galán a* José Luis Guzmán Guerrero b Manuel Delgado Pertíñez a Luis Ángel Zarazaga Garcés b Pilar Ruiz Pérez-Cacho c Hortensia Galán-Soldevilla c

a

Universidad de Sevilla, Escuela Técnica Superior de Ingeniería Agronómica, Departamento de Ciencias Agroforestales, Sevilla, España. Universidad de Huelva “Campus de Excelencia Internacional Agroalimentario, ceiA3", Escuela Técnica Superior de Ingeniería, Departamento de Ciencias Agroforestales. Campus Universitario de la Rábida, Carretera de Huelva-Palos de la Frontera. s/n. 21819, Huelva, España. b

c

Universidad de Córdoba, E.T.S. de Ingenieros Agrónomos y Montes, Departamento de Bromatología y Tecnología de los Alimentos, Córdoba, España.

* Autor de correspondencia: fdelavega@colvet.es

Resumen: En España, hay un interés creciente por la conservación de las razas caprinas autóctonas con formas de producción basadas en el pastoreo y por la posibilidad de transformación en producciones ecológicas. El objetivo ha sido evaluar las características sensoriales de la carne de cabrito lechal de dos razas autóctonas, criados en sistemas de producción convencional y ecológica, basados en el pastoreo. Se utilizaron 21 cabritos lechales de los cuales 12 fueron criados en un sistema ecológico (6 de raza Payoya y 6 de raza Blanca Andaluza) y 9 en un sistema convencional (3 de raza Payoya y 6 de raza Blanca Andaluza). El perfil sensorial de la carne se evaluó mediante un panel analítico. Con 306


Rev Mex Cienc Pecu 2021;12(1):306-317

relación al sistema de explotación, los resultados obtenidos indican que las carnes procedentes de sistemas ecológicos tenían menos intensidad de olor y una textura más blanda, tierna y jugosa que las carnes del sistema convencional. Respecto a la raza, el estudio mostró que las carnes de cabrito de la raza Blanca Andaluza presentaron una intensidad de olor menor y una textura más blanda, tierna y jugosa que las carnes de cabrito de la raza Payoya. Estos resultados preliminares podrían ser favorables para la transformación de las explotaciones convencionales, basadas en pastoreo, a ecológicas. Palabras clave: Calidad sensorial, Carne, Cabrito, Ecológico.

Recibido: 15/07/2019 Aceptado: 13/02/2020

Actualmente hay un interés creciente, por parte de la administración y de los ganaderos españoles, en la conservación de las razas autóctonas, criadas en sistemas extensivos o semiextensivos, basados en el pastoreo. Muchas de estas razas, como es el caso de las razas caprinas Blanca Andaluza y Payoya, están consideradas como razas en peligro de extinción(1), estando la mayor parte de las explotaciones localizadas en zonas de sierra de difícil acceso, en la Comunidad Autónoma de Andalucía(2). La raza Blanca Andaluza es una raza de aptitud cárnica. En la actualidad, aunque se sigue produciendo el “chivo” (animal criado a pasto con la madre, sacrificado a los 5 meses de edad con 25-30 kg. de peso vivo), principalmente en zonas donde es tradicional el consumo de la carne de estos animales, el tipo comercial más en uso es “cabrito lechal”(2). La raza Payoya es una de las mejores representantes de las razas de producción de leche basada en pastoreo. El principal objetivo de las explotaciones es la producción láctea y de manera secundaria la de carne de “cabrito lechal”, sacrificado con un peso de 8 a 9 kg, favorecido por su alto precio en el mercado. De acuerdo con los requerimientos de la producción ecológica, las explotaciones de estas razas pueden ser fácilmente trasformados en explotaciones ecológicas(3,4). El estudio de las posibilidades de transformación necesita, además del análisis de viabilidad técnica y económica, el estudio de la calidad de los productos. En este sentido, tomando como base las mismas explotaciones que las utilizadas en el presente trabajo, se publicaron dos trabajos sobre el perfil de ácidos grasos(5,6) y dos trabajos sobre la calidad de la carne(7,8), en los que se concluye que no hay diferencias significativas en la gran mayoría de los ácidos grasos presentes en la grasa intramuscular, o en otros depósitos grasos entre los cabritos criados en explotaciones convencionales y ecológicas, así como en la mayoría de los atributos de la carne, con lo que la transformación, desde este punto de vista, podría realizarse fácilmente. Puesto que no se conocen trabajos sobre la calidad sensorial de la carne de cabrito de estas razas autóctonas y teniendo en cuenta los trabajos anteriores, la hipótesis planteada es 307


Rev Mex Cienc Pecu 2021;12(1):306-317

que no habría diferencias importantes en la calidad sensorial de la carne según el sistema convencional y ecológico en ambas razas, lo que facilitaría la transformación de las granjas convencionales al sistema ecológico. Por ello, el objetivo de este estudio ha sido estudiar la calidad sensorial de la carne de los cabritos de las razas Payoya y Blanca Andaluza en sistemas de producción ecológicos y convencionales basados en el pastoreo. Para este trabajo se utilizaron cabritos lechales pertenecientes a cuatro explotaciones caprinas con sistemas semi-extensivos(5,6), una de cada tipo de producción (convencional y ecológica, con certificación Reglamento según el (CE) nº 834/2007 del Consejo(9) y de cada raza (Payoya y Blanca Andaluza). Las cabras de todas las explotaciones han tenido una alimentación basada en pastos naturales tipo arbustivo Mediterráneo. El área de estudio está dominada por arbustos (60 a 80 % de cobertura y alrededor de 0.6 a 1.8 m de altura) y árboles (principalmente Mirtus communis, Pistacia lentiscus, Quercus ilex, Cistus salvifolius and Arbutus unedo). También hay pastos formados por especies de gramíneas (Lolium spp, Phalaris acuatica, Hainardia cylindrica, Hordeum bulbosum), leguminosas (Trifolium subterraneum, T. pallidum, T. aquamosum, T. squarrosum, T. istmocarpum, Scorpiurus muricatus, S. vermiculatus, son las más comunes) y otras familias de dicotiledóneas (Cichorium spp., Carlina racemosa, Cynara humilis, Echium plantagineum, Galactites tomentosa, Scolymus spp., son las más comunes). Independientemente de la disponibilidad de pastos, los animales de ambas razas pastan durante todos los días del año, aunque las cabras se mantienen en los corrales durante la tarde-noche para el amamantamiento de los cabritos (en ambas razas). Los pastos se complementan en todos los casos con el suministro de concentrados. En el presente estudio se utilizaron suplementos con alimentos concentrados a razón de 1 kg y 0.5 kg por cabeza y día en las explotaciones convencionales y ecológicas, respectivamente, de raza Payoya; así como 0.6 kg y 0.35 kg en las explotaciones convencionales y ecológicas, respectivamente, de raza Blanca Andaluza (Cuadro 1). Cuadro 1: Ingredientes y composición química de los concentrados suplementados en los sistemas de producción convencional y ecológico Payoya Blanca Andaluza Ingredientes (% de materia fresca) Convencional Ecológico Convencional Ecológico Granos de cebada 10.0 74.0 74.0 Habas 60.0 Pulpa de remolacha 9.5 Algarroba 4.0 4.0 Grasa by-pass 1.5 Gluten feed 12.0 Guisantes 5.0 40.0 5.0 Granos de maíz 26.0 Harina de soja 18.2 Melaza caña de azúcar 2.0 308


Rev Mex Cienc Pecu 2021;12(1):306-317

Harina de girasol 5.0 Semilla de girasol Salvado de trigo Harina de trigo 12.0 Cascarilla de trigo Carbonato cálcico 1.8 Oxido de manganeso 0.2 Bicarbonato de sodio 0.8 Sal 0.8 Corrector vitamínico-mineral 0.2 Composición química (% materia seca): Materia seca (%) 92 Materia orgánica 93 Proteina bruta 21 Grasa bruta 2

5.0 4.0 5.0 2.5 0.5 -

free

5.0 4.0 5.0 2.5 0.5 -

93 94 19 2

88 97 22 1

93 94 19 2

Los animales de ambas razas pastan durante todos los días del año y se suplementan con 1 kg y 0.5 kg por cabeza y día en las explotaciones convencionales y ecológicas, respectivamente, de raza Payoya; así como 0.6 kg y 0.35 kg en las explotaciones convencionales y ecológicas, respectivamente, de raza Blanca Andaluza.

Se utilizaron 21 cabritos lechales, nacidos de partos dobles: 12 cabritos criados en un sistema ecológico (6 de raza Payoya y 6 de raza Blanca Andaluza) y 9 cabritos criados en un sistema convencional (3 de raza Payoya y 6 de raza Blanca Andaluza). Las cabras y los cabritos de cada una de las granjas fueron seleccionados al azar dentro de la misma estación. Los cabritos, durante todo el periodo de lactación, tuvieron acceso a las madres, pero no a otros alimentos. Todos los cabritos se sacrificaron con un peso vivo de 8.12 ± 0.49 kg (Payoya) y 7.52 ± 0.64 kg (Blanca Andaluza) en un matadero oficial de Huelva (España), después de 16.00 ± 0.75 h (Payoya) y 19.81 ± 2.49 h (Blanca Andaluza) de ayuno con libre acceso al agua. Después del sacrificio, las canales se refrigeraron a 4 °C durante un período de maduración de 24 h. A continuación, se obtuvo la media canal izquierda que se transportó refrigerada a las instalaciones de la Universidad de Huelva. Allí se procedió al despiece y obtención de las piernas(10), que se envasaron al vacío y se congelaron a -20 ºC hasta su posterior análisis. Los pesos medios de las piernas fueron de 0.65 ± 0.03 kg en los cabritos de raza Payoya y 0.56 ± 0.07 kg en los de raza Blanca Andaluza. Previamente al análisis sensorial, las piernas se descongelaron dentro de la bolsa de vacío, por inmersión en agua corriente a una temperatura de 17 a 19 °C. Las piernas enteras se cocinaron en un horno eléctrico, hasta llegar a una temperatura interna de 65 a 70 ºC, controlada con un termopar (JENWAY 2000). Una vez cocinada la carne, se extrajo el músculo Semimembranosus y se cortó en submuestras de 2 x 2 cm, siendo posteriormente envueltas individualmente en papel de aluminio, previamente codificado con un número aleatorio de tres cifras. Las muestras se sirvieron en las cabinas de cata, 309


Rev Mex Cienc Pecu 2021;12(1):306-317

donde se mantuvieron calientes en un horno eléctrico precalentado a 60 ºC hasta el momento del análisis. Posteriormente se sirvieron aleatoriamente de una en una a un panel entrenado de siete catadores, seleccionados y entrenados según las normas internacionales ISO 8586(11), y pertenecientes al panel analítico del Laboratorio Sensorial del Departamento de Bromatología y Tecnología de los Alimentos de la Universidad de Córdoba. Las muestras de las 21 piernas se analizaron en seis sesiones de no más de 1 h de duración, evaluándose un máximo de cuatro muestras por sesión. La metodología seguida es una adaptación de la propuesta por Guerrero(12) para el análisis sensorial de carnes de pequeños rumiantes. Todos los análisis se realizaron en horario de mañana (1200 a 1300 h) en la sala de cata de la Escuela de Hostelería de Córdoba. Entre muestras, los jueces utilizaron agua mineral para limpiarse las papilas. Se analizaron seis atributos sensoriales: 1 de apariencia (intensidad de color), 1 de olor (intensidad global de olor), 3 de textura (dureza, facilidad de masticación y jugosidad) y 1 de aroma (intensidad global de aroma) en una escala lineal no estructurada de 10 cm de longitud anclada a 1 cm de sus extremos. Además, se evaluaron cualitativamente las notas de olor (ortonasal) y aroma (retronasal) y los sabores básicos. Los atributos sensoriales cuantitativos se analizaron mediante un análisis de varianza de dos vías (sistema de explotación x raza), usando el Modelo Lineal General (GLM) del paquete estadístico IBM SPSS para Windows (versión 22.0; IBM Corp., Armonk Nueva York, USA). Además, se realizó un análisis de varianza (catador) para cada atributo sensorial con el objetivo de evaluar si el panel trabajaba como un grupo. Con todos los parámetros analizados se realizó un análisis factorial utilizando el método de los componentes principales (CP) y seleccionando aquellos factores con un autovalor asociado mayor a 1. Los resultados indicaron que para todos los atributos sensoriales cuantificados el panel trabajó como grupo (P>0.05). En el Cuadro 2 se presentan los valores medios, las desviaciones estándar y el análisis de varianza (sistema de explotación x raza) para cada atributo sensorial. El análisis de varianza muestra que existen diferencias significativas entre formas de producción (P<0.05) para todos los atributos sensoriales analizados excepto para la intensidad de color y la intensidad global de aroma; diferencias significativas entre razas para los atributos intensidad global de olor (P<0.001), dureza (P<0.01) y jugosidad (P<0.01) e interacciones (sistema explotación x raza) para los atributos intensidad de color (P<0.001) y dureza (P<0.05).

310


Rev Mex Cienc Pecu 2021;12(1):306-317

Cuadro 2: Medidas descriptivas (valores medios y error estándar de la media) y análisis de la varianza (sistema de explotación x raza) de los atributos sensorial de las carnes de cabrito analizadas Sistema de explotación Raza (R) Significación (SE) Atributos Ecológico Convencional Blanca Payoya SE × SE R (n=12) (n=9) (n=12) (n=9) R Intensidad de 4.9±0.19 5.2±0.16 5.1±0.16 5.0±0.19 ns ns *** color Intensidad global 5.8±0.07 6.2±0.08 5.8±0.08 6.1±0.05 *** *** ns olor Dureza 4.3±0.11 5.0±0.17 4.5±0.13 4.7±0.17 *** ** * Facilidad de 5.0±0.15 4.5±0.19 4.9±0.16 4.5±0.17 *** ns ns masticación Jugosidad 4.1±0.12 3.8±0.16 4.2±0.15 3.7±0.07 * ** ns Intensidad global 5.4±0.07 5.8±0.10 5.4±0.07 5.8±0.09 ns ns ns aroma * P<0.05; ** P<0.01; *** P< 0,001; ns= no significativo.

Así, en el presente estudio se observó que las carnes procedentes de sistemas ecológicos tenían menos intensidad de olor y una textura más blanda, tierna y jugosa que las carnes del sistema convencional. Utilizando los mismos animales que en el presente estudio, los parámetros de capacidad de retención de agua (CRA) y textura o resistencia al corte de la carne no presentaron diferencias significativas entre sistemas en ambas razas(7,8),excepto en la raza Payoya, en la que los cabritos de sistema ecológico presentaron una mayor CRA, lo que contribuiría a explicar, al menos parcialmente, los resultados positivos obtenidos en los cabritos ecológicos de esta raza. Aunque no hay referencias bibliográficas de trabajos similares que establezcan diferencias sensoriales entre los cabritos lechales pertenecientes a ambos sistemas, sí hay algunos trabajos que han estudiado las diferencias observadas entre diferentes regímenes de alimentación. Así, en el trabajo de Costa et al(13) sobre el perfil sensorial de carne de cabritos de la raza Blanca Serrana Andaluza con pesos de 19 kg, sólo encontraron diferencias para la intensidad global de aroma en los cabritos criados en sistemas intensivos (6.2) en comparación a los criados en sistemas extensivos (5.2), explicando estas diferencias en función de un mayor contenido en grasa en los cabritos en intensivo. Otros autores(14) también han encontrado diferencias sensoriales en la carne de cabritos lechales alimentados con leche natural o con un sustituto de leche, observando un mayor olor y sabor en los cabritos alimentados con este último, a pesar de no encontrar diferencias en el porcentaje de grasa intramuscular entre las dos dietas. Estos autores indicaron que las diferencias podrían estar relacionadas con las variaciones en el grado de insaturación de esa grasa intramuscular como consecuencia de las diferencias en la alimentación.

311


Rev Mex Cienc Pecu 2021;12(1):306-317

En el presente trabajo y de forma general, la alimentación recibida por las madres ha sido similar, por lo que las variaciones en el perfil sensorial de las carnes entre explotaciones se podrían atribuir a los aportes nutritivos procedentes del pastoreo y a los concentrados suplementados(5,6). Además, las carnes de cabrito estudiadas(5,6) no presentaron diferencias significativas en el contenido de grasa intramuscular, no obstante los porcentajes de los ácidos grasos C17:0, C17:1, C20:1, C20:4 n-6, C22:2 y algunos ácidos grasos n-3 (el ácido omega-3 docosahexaenoico C22:5 –DPA- y el ácido C22:6 –DHA-), fueron más altos en la grasa intramuscular de los cabritos ecológicos de raza Blanca Andaluza(5) y los porcentajes de C14:0, C18:1 trans-11- (VA) y de los ácidos grasos n-3 C20:5 (EPA), DHA y DPA fueron también más altos en la grasa intramuscular de los cabritos ecológicos de raza Payoya(6), lo que podría explicar las diferencias en estos atributos sensoriales. En este sentido, en un estudio reciente sobre la alimentación con sustituto de leche (16 % de materia seca) de cabritos(15), la evaluación de la calidad sensorial de la carne ha mostrado que la adición de una alta dosis de DHA (1.8 %) da lugar a carnes con olor y sabor desagradables y puntuaciones bajas de aceptación general, en comparación a dosis bajas (0.9 %), lo que podría indicar que al ser animales muy jóvenes este ácido graso seguramente se depositó en la grasa intramuscular en cantidades altas y eso daría lugar a una valoración sensorial inferior. En nuestro trabajo no se ha determinado la ingestión de DHA en la dieta de los cabritos, pero, aunque los animales ecológicos han presentado significativamente un mayor porcentaje de DHA en la carne (0.13 a 0.19 % en los cabritos ecológicos y 0.09 a 0.10 % en los convencionales), sus características sensoriales no han sido mayores que la de los cabritos convencionales. La pequeña diferencia en este ácido n-3 entre cabritos, junto al efecto y relaciones con otros ácidos grasos podrían explicar los resultados sensoriales encontrados en el presente estudio. Respecto a la raza, el estudio indicó que las carnes de cabrito de la raza Blanca Andaluza presentaron una intensidad de olor menor y una textura más blanda, tierna y jugosa que las carnes de cabrito de la raza Payoya. Los resultados podrían explicarse parcialmente por la mayor textura de la carne de los cabritos de raza Payoya (7.26 kg/cm2) que la de los cabritos de la raza Blanca Andaluza (5.59 kg/cm2) (P<0,001, datos no publicados). Diversos autores también han encontrado algunas diferencias sensoriales entre razas o diferentes genotipos(16,17) pero apenas hay publicaciones que estudien la calidad sensorial de las dos razas autóctonas estudiadas en el presente trabajo y ninguno que las compare. Como ya indicaba Sañudo(18), la raza es un factor que puede hacer variar la calidad del producto y que en muchos casos justifica, por si sola, la existencia de marcas de calidad. En Cuadro 3 se presentan los resultados del análisis cualitativo para cada raza según la forma de producción. En relación con la raza Blanca andaluza, los resultados muestran diferencias para los descriptores del olor y aroma y los sabores básicos para las muestras estudiadas dependiendo de la forma de producción: las carnes del sistema ecológico fueron descritas con notas olfativas a carne de cocido y sabor metálico mientras que las carnes del sistema convencional además de la nota olfativa carne de cocido, tenían 312


Rev Mex Cienc Pecu 2021;12(1):306-317

olor/aroma a hígado y cabrito y un sabor ácido. En cambio, en la raza Payoya no se observan claras diferencias entre ambas formas de producción para los descriptores de olor y aroma, pero sí para los sabores básicos. En este sentido, aunque las carnes de ambas formas de producción son metálicas, la ecológica es además sabrosa. Cuadro 3: Frecuencias (%) de los descriptores del análisis cualitativo (olor/aroma y sabores básicos) de la carne de cabrito lechal, para cada raza y forma de producción Blanca Andaluza Payoya Descriptor Ecológico Convencional Ecológico Convencional (n=6) (n=6) (n=6) (n=3) Olor y aroma: Carne de cocido 100 67 83 33 Hígado 17 100 50 67 Cabrito 0 50 0 0 Orina 0 17 0 0 Sabores básicos: Sabrosa 17 17 50 0 Metálico 67 0 50 67 Acida 0 50 17 0 Para intentar agrupar las muestras según la forma de producción y la raza de procedencia se realizó un análisis de componentes principales. Los dos primeros CP explican casi el 66 % del total de la varianza de los atributos de calidad sensorial (37.86 y 27.88 %, para el primer y segundo componente respectivamente). El CP1 estaría formado principalmente por las siguientes medidas de la textura de la carne: por un lado, la facilidad de masticación y la jugosidad, situados a la derecha del gráfico, y por otro, la dureza situada a la izquierda del gráfico (Figura 1a). El CP2 se caracteriza por la intensidad del olor y del aroma, ambos atributos de calidad situados en la parte superior del gráfico. La Figura 1b muestra la proyección de los cabritos, para las dos formas de producción, en el plano definido por los dos CP. Aunque las muestras de carne han presentado gran variación, el sistema ecológico está preferentemente localizado en la parte derecha (mayor jugosidad y facilidad de masticación y menor dureza) e inferior (menos intensidad de olor y aroma) de la figura, mientras que el sistema convencional se localiza preferentemente en la parte izquierda y superior. La Figura 1c muestra la proyección de los cabritos para las razas, en el plano definido por los dos CP. A pesar de la variabilidad de los datos al igual que para el sistema, se pueden observar dos grupos, uno en la parte inferior del gráfico que se corresponde con la raza Blanca Andaluza (menos intensidad de olor y aroma) y otro a la izquierda del gráfico correspondiente a la raza Payoya (menos jugosidad y facilidad de masticación).

313


Rev Mex Cienc Pecu 2021;12(1):306-317

Figura 1: Resultados del análisis factorial de componentes principales (CP)

a) Proyección de los atributos de calidad sensorial de la carne de cabrito en el plano definido por los dos componentes principales.

b) Proyección de los cabritos, para los dos sistemas de producción estudiados, en el plano definido por los dos componentes principales 314


Rev Mex Cienc Pecu 2021;12(1):306-317

c) Proyección de los cabritos, para las dos razas estudiadas, en el plano definido por los dos componentes principales En conclusión, los cabritos procedentes del sistema ecológico y los procedentes de la raza Blanca andaluza, en comparación a los del sistema convencional y de la raza Payoya, presentaron en general carnes con mejores atributos sensoriales (más tiernas, más jugosas, con mayor facilidad a la masticación) y menos intensidad de olor. En la raza Blanca andaluza existen claras diferencias entre sistemas para los descriptores del olor y aroma y sabores básicos, en cambio, en la raza Payoya sólo se observan claras diferencias entre sistema para los sabores básicos. Aunque la muestra presenta una gran variabilidad, por lo que son necesarios nuevos estudios con mayor número de animales, estos resultados preliminares serían favorables para promocionar la transformación de las explotaciones convencionales en ecológicas basadas en sistemas de pastoreo. Agradecimientos Los autores agradecen al Instituto Andaluz de Investigación y Formación Agraria, Pesquera, Alimentaria y de la Producción Ecológica de la Consejería de Agricultura y Pesca de la Junta de Andalucía por la financiación del proyecto (Nº 75, 92162/1), a los ganaderos Francisca Delgado Méndez, Domingo Ginés Domínguez, Benjamín Bombas González, Manuel Sánchez Sánchez y Daniela Hinojo Antille por contribuir con la aportación de sus animales y al panel analítico del Laboratorio Sensorial del Departamento de Bromatología y Tecnología de los Alimentos de la Universidad de Córdoba.

315


Rev Mex Cienc Pecu 2021;12(1):306-317

Literatura citada: 1.

Real Decreto 2129/2008, de 26 de diciembre, por el que se establece el Programa nacional de conservación, mejora y fomento de las razas ganaderas. B.O.E. nº 23, martes 27 de enero de 2009: 9211-9242.

2.

FEAGAS. Federación Española de Asociaciones de Ganado Selecto 2014; 38.

3.

Mena Y, Ligero M, Ruiz FA. Organic and conventional dairy goat production systems in Andalusian mountainous areas. Option Méditerranéennes A 2009;91:253-256.

4.

Mena Y, Nahed J, Ruiz FA. Proximity to the organic model of dairy goat systems in the Andalusian mountains (Spain). Trop Subtrop Agroecosyst 2009;11:69-73.

5.

De-La-Vega F, Guzmán JL, Delgado-Pertíñez M, Zarazaga LA, Argüello A. Fatty acid composition of muscle and adipose tissues of organic and conventional Blanca Andaluza suckling kids. Spanish J Agric Res 2013;1(3):770-779.

6.

De-La-Vega F, Guzmán JL, Delgado-Pertíñez M, Zarazaga LA, Argüello A. Fatty acid composition of muscle and internal fat depots of organic and conventional Payoya goat kids. Spanish J Agric Res 2013;11(3):759-769.

7.

Guzmán JL, De-la-Vega F, Zarazaga LA, Argüello A, Delgado-Pertíñez M. Carcass and meat quality of Blanca Andaluza kids fed exclusively with milk from their dams under organic and conventional grazing-based management systems. Italian J Anim Sci 2019;18 (1):1186-1191.

8.

Guzmán JL, De-La-Vega F, Zarazaga LA, Argüello A, Delgado-Pertíñez M. Carcass characteristics and meat quality of Payoya breed conventionally and organically reared dairy goat suckling kids. Ann Anim Sci 2019;9(4):1149-1159.

9.

Reglamento (CE) nº 834/2007 del Consejo, de 28 de junio de 2007, sobre producción y etiquetado de los productos ecológicos y por el que se deroga el Reglamento (CEE) nº 2092/91. Diario Oficial de la Unión Europea L 189: 1-23.

10. Colomer-Rocher F, Morand-Fehr P, Kirton H. Standard methods and procedures for goat carcass evaluation, jointing and tissue separation. Livest Prod Sci 1987;17: 149-159. 11. ISO 8586. International Organization for Standardization Publications. Sensory analysis —Methodology—. General guidance for the selection, training and monitoring of selected assessors and expert sensory assessors. 2012. 12. Guerrero L. Determinación sensorial de la calidad de la carne. En: Cañeque V, Sañudo C editores. Metodología para el estudio de la calidad de la canal y de la carne en rumiantes, Madrid, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria 2000;205-220. 316


Rev Mex Cienc Pecu 2021;12(1):306-317

13. Germano Costa R, Galán H, Camacho Vallejo ME, Vallecillo A, Delgado Vermejo JV, Argüello Henríquez A. Perfil sensorial de la carne de cabritos de la raza Blanca Serrana Andaluza. Arch Zoot 2008;57:67-70. 14. Bañon S, Vila R, Price A, Ferrandini E, Garrido MD. Effects of goat milk or milk replace diet on milk quality and fat composition of suckling goat kids. Meat Sci 2006;72:216-221. 15. Moreno-Indias I, Sánchez-Macías D, Martínez de-la-Puente J, Morales de la Nuez A, Hernández-Castellano LE, Castro N, Argüello A. The effect of diet and DHA addition on the sensory quality of goat kid meat. Meat Sci 2012;90:393-397. 16. Lemes JS, Monge P, Campo MM, Guerra V, Sañudo, C. Estudio comparativo de la calidad de productos caprinos locales frente a sus posibles competidores. Congreso de la SEOC 2011;154-157. 17. Ngambu S, Muchenje V, Chimonyo M, Marume U. Correlations among sensory characteristics and relationships between aroma scores, flavour scores, off-flavour scores and off-flavour descriptors of chevon from four goat genotypes. African J Biotech 2011;10(34):6575-6580. 18. Sañudo C. Calidad de la canal y de la carne ovina y caprina y los gustos de los consumidores. Rev Brasileña Zoot 2008;37:143-160.

317


Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 12 Núm 1, pp. 1-317, ENERO-MARZO-2021

ISSN: 2448-6698

CONTENIDO CONTENTS Pags. Efecto de la selección genética en contra de las emisiones de metano sobre los componentes de la leche

Relationships among ß-hydroxybutyrate, calcium and non-esterified fatty acids in blood with milk yield losses at early lactation

Relaciones entre el ß-hidroxibutirato, el calcio y los ácidos grasos no esterificados en la sangre con pérdidas de producción de leche en la lactancia temprana Rufino López-Ordaz, Gabriela Pérez-Hernández, Hugo Alonso Ramírez-Ramírez, Reyes López-Ordaz, Germán David Mendoza-Mar�nez, Agus�n Ruíz-Flores……………………………………………………………………………………………………………………………………….………………………………….………..….......….....…18

Caracterización genética de la oveja Pelibuey de México usando marcadores microsatélites

Genetic characterization of Mexican Pelibuey sheep using microsatellite markers Cecilio Ubaldo Aguilar Mar�nez, Bertha Espinoza Gu�érrez, José Candelario Segura Correa, José Manuel Berruecos Villalobos, Javier Valencia Méndez, Antonio Roldán Roldán…………………….……………….…………….……………..….……………………………..…………..…………..…………..…………..………..……………….36

Diversidad genética de gallinas criollas en valles centrales de Oaxaca usando marcadores microsatélites

Genetic diversity of creole chickens in Valles Centrales, Oaxaca, using microsatellite markers Héctor Luis-Chincoya, José Guadalupe Herrera-Haro, Amalio Santacruz-Varela, Martha Patricia Jerez-Salas, Alfonso Hernández-Garay ..................……….........………….........…………………..….……………………….58

Milk fatty acid profile of crossbred Holstein x Zebu cows fed on cake licuri

Perfil de ácidos grasos de la leche de vacas Holstein x Cebú alimentadas con pasta de licuri Antonio Ferraz Porto Junior, Fabiano Ferreira da Silva, Robério Rodrigues Silva, Dicastro Dias de Souza, Edvaldo Nascimento Costa, Evely Giovanna Leite Costa, Bismarck Moreira San�ago, Geónes da Silva Gonçalves……………………………..............….…..………………………………………...………..…………..……………………72

Milk yield derived from the energy and protein of grazing cows receiving supplements under an agrosilvopastoral system

Rendimiento de leche derivado de energía y proteína de vacas en pastoreo recibiendo suplementos en un sistema agrosilvopastoril Sherezada Esparza-Jiménez, Benito Albarrán-Por�llo, Manuel González-Ronquillo, Anastacio García-Mar�nez, José Fernando Vázquez-Armijo, Carlos Manuel Arriaga-Jordán…..…………………………...……….87

Nutritional management of steers raised in graze and in feedlot: intake, digestibility, performance and economic viability

Manejo nutricional de novillos criados en pastoreo y en corral: efectos en el consumo, digestibilidad, rendimiento y viabilidad económica Sinvaldo Oliveira de Souza, Robério Rodrigues Silva, Fabiano Ferreira da Silva, Ana Paula Gomes da Silva, Marceliana da Conceição Santos, Rodrigo Paiva Barbosa, Raul Lima Xavier, Tarcísio Ribeiro Paixão, Gabriel Dallapicola da Costa, Adriane Ba�sta Peruna, Mariana Santos Souza, Laize Vieira Santos……………………………………………………....……………………………….….....105

Producción y evaluación de inóculos lácteos probióticos obtenidos del tracto digestivo de lechón (Sus scrofa domesticus) propuestos para alimentación porcina

Production and evaluation of probiotic milk inocula obtained from the digestive tract of piglets (Sus scrofa domesticus) proposed for pig feed Carmen Rojas Mogollón, Gloria Ochoa Mogollón, Rubén Alfaro Aguilera, Javier Querevalú Or�z, Héctor Sánchez Suárez………………………………………………………………..…………..…………..…………...…………..…….120

Actividad antihelmíntica in vivo de hojas de Acacia cochliacantha sobre Haemonchus contortus en cabritos Boer

In vivo anthelmintic activity of Acacia cochliacantha leaves against Haemonchus contortus in Boer goat kids Gastón Federico Cas�llo-Mitre, Rolando Rojo-Rubio, Agus�n Olmedo-Juárez, Pedro Mendoza de Gives, José Fernando Vázquez-Armijo, Alejandro Zamilpa, Héctor Aarón Lee-Rangel, Leonel Avendaño-Reyes, Ulises Macias-Cruz ……………………………………………………………………………………………………..…………..…………..…………..…………..………….....138

The effect of silkworm pupae and mealworm larvae meals as dietary protein components on performance indicators in rabbits

Efecto de la harina de pupas y larvas de gusano de seda como componentes proteicos de la dieta sobre indicadores de rendimiento en conejos Dorota Kowalska, Janusz Strychalski, Andrzej Gugołek…………………………..….………………………...……………………………………………………………………….…………………………………………………………………..…………..…………..151

Evaluación de indicadores productivos en rebaños caprinos vacunados con cepas RB51–SOD, RB51 (Brucella abortus) y Rev-1 (Brucella melitensis)

Evaluation of productive indicators in goat herds vaccinated with RB51–SOD, RB51 (Brucella abortus) and Rev-1 (Brucella melitensis) strains Baldomero Molina-Sánchez, David Izcoatl Mar�nez-Herrera, Violeta Trinidad Pardío-Sedas, Ricardo Flores-Castro, José A. Villagómez-Cortés, José F. Morales-Álvarez……………………………………..…………..…163

Distribución corporal de garrapatas (Acari: Ixodidae y Argasidae) asociadas a Odocoielus virginianus (Artiodactyla: Cervidae) y Ovis canadensis (Artiodactyla: Bovidae) en tres estados del norte de México

Body distribution of ticks (Acari: Ixodidae and Argasidae) associated with Odocoileus virginianus (Artiodactyla: Cervidae) and Ovis canadensis (Artiodactyla: Bovidae) in three northern Mexican states Mariana Cuesy León, Zinnia Judith Molina Garza, Roberto Mercado Hernández,Lucio Galaviz Silva……………………………………..………………....…………………..…………..…………..…………..…………..…………..…………....177

Detección de anticuerpos de Neospora spp. en caballos, asociados a diferentes factores de riesgo en México

Detection of anti-Neospora spp. antibodies associated with different risk factors in horses from Mexico colectados de colonias de abeja melífera africanizada en dos apiarios en Yucatán,México Kenia Jasher Padilla-Díaz, Le�cia Medina-Esparza, Carlos Cruz- Vázquez, Irene Vitela-Mendoza, Juan F. Gómez-Leyva, Teódulo Quezada-Tristán……………………………………..……………………..…………….........…..194

Desempeño productivo y costos de granjas porcinas con diferentes protocolos de vacunación al virus del PRRS

Productive performance and costs of swine farms with different PRRS virus vaccination protocols Elizabeth Araceli Quezada-Fraide, Claudia Giovanna Peñuelas-Rivas, Frida Saraí Moysén-Albarrán, María Elena Trujillo-Ortega, Francisco Ernesto Mar�nez-Castañeda …………………..….…………………………..205

Las funciones de las aves en la producción avícola de pequeña escala: el caso de una comunidad rural en Hidalgo, México

Bird roles in small-scale poultry production: the case of a rural community in Hidalgo, Mexico Ana Rosa Romero-López……………………..……………………………………………………………………………………………………………….…………………………………………………..…………..…………..…………..…………..…………..…………..…...217

Disonancia cognitiva ante el cambio climático en apicultores: un caso de estudio en México

Cognitive dissonance in the face of climate change in beekeepers: A case study in Mexico Felipe Gallardo-López, Blanca Patricia Castellanos-Potenciano, Gabriel Díaz-Padilla, Arturo Pérez-Vásquez, Cesáreo Landeros- Sánchez, Ángel Sol-Sánchez ……………………........……….………………..……………..238

Evaluation of two supplemental zilpaterol hydrochloride sources on meat quality and carcass traits of crossbred Bos indicus bulls in the tropics

Evaluación de dos fuentes suplementarias de clorhidrato de zilpaterol sobre la calidad de la carne y los rasgos de la canal de toros Bos indicus cruzados en los trópicos Pedro Antonio Alvarado García, Maria Salud Rubio Lozano, Héctor Salvador Sumano López, Luis Ocampo Camberos, Graciela Guadalupe Tapia Pérez, Enrique Jesús Delgado Suárez, Jeny Aguilar Acevedo……………………………………………….………………………………………….……………..…………..…………..…………..…………..………………...256

NOTAS DE INVESTIGACIÓN Nivel de infestación de Rhipicephalus microplus y su asociación con factores climatológicos y la ganancia de peso en bovinos Bos taurus x Bos indicus

Rhipicephalus microplus infestation level and its association with climatological factors and weight gain in Bos taurus x Bos indicus cattle Roberto Omar Castañeda Arriola, Jesús Antonio Álvarez Mar�nez, Carmen Rojas Mar�nez, José Juan Lira Amaya, Ángel Ríos Utrera, Francisco Mar�nez Ibáñez …………………………………………….........……..…273

Características histopatológicas y detección de Papilomavirus en la fibropapilomatosis bovina en el estado de San Luis Potosí, México

Histopathology and PCR detection of bovine fibropapillomatosis in cattle in San Luis Potosí, Mexico Isaura Méndez Rodríguez, Fernando Alberto Muñoz Tenería, Milagros González Hernández, Alan Ytzeen Mar�nez Castellanos, Luisa Eugenia del Socorro Hernández Arteaga………………..…………..……..……286

Prevalencia de genes qnrB, qnrA y blaTEM en bacteriófagos atemperados de Escherichia coli aislados en agua residual y alcantarillas de rastros del Estado de México

Prevalence of the qnrB, qnrA and blaTEM genes in temperate bacteriophages of Escherichia coli isolated from wastewater and sewer water from slaughterhouses in the State of Mexico Juan Mar�n Talavera-González, Jorge Acosta-Dibarrat, Nydia Edith Reyes-Rodríguez, Celene Salgado-Miranda, Mar�n Talavera-Rojas……..…………..…………..…………...…………..……………………………………………298

Calidad sensorial de la carne de cabritos lechales criados en sistemas de producción basados en pastoreo

Sensory quality of meat from suckling kids of two indigenous Spanish goat breeds raised in grazing production systems Francisco De-la-Vega Galán, José Luis Guzmán Guerrero, Manuel Delgado Per�ñez, Luis Ángel Zarazaga Garcés, Pilar Ruiz Pérez-Cacho, Hortensia Galán-Soldevilla ……..…………..…………………………………....306

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm 1, pp. 1-317, ENERO-MARZO-2021

Genetic selection aimed to reduce methane emissions and its effect on milk components René Calderón-Chagoya, Juan Heberth Hernández-Medrano, Felipe de Jesús Ruiz-López, Adriana García-Ruiz, Vicente Eliezer Vega-Murillo, Enoc Israel Mejía-Melchor, Phil Garnsworthy, Sergio Iván Román-Ponce…........….....….………..…………..…………..…………..…………..…………..…………..…………...1

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 1, pp. 1-317, ENERO-MARZO-2021

Profile for Revista Mexicana de Ciencias Pecuarias

RMCP Vol. 12 Núm. 1 (2021): Enero-Marzo [versión en español]  

RMCP Vol. 12 Núm. 1 (2021): Enero-Marzo [versión en español]  

Advertisement

Recommendations could not be loaded

Recommendations could not be loaded

Recommendations could not be loaded

Recommendations could not be loaded