__MAIN_TEXT__

Page 1

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 11 Núm 4, pp. 933-1230, OCTUBRE-DICIEMBRE-2020

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 11 Núm. 4, pp. 933-1230, OCTUBRE-DICIEMBRE-2020


Conejo de 35 días de edad, raza California del Instituto de Ciencias Agropecuarias, Universidad Autónoma del Estado de Hidalgo. Fotografía: Dra. Maricela Ayala Martínez

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 11 Número 4, OctubreDiciembre 2020. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 04-2016-060913393200-203. ISSN: 2448-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en octubre de 2020.

DIRECTORIO FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITOR EN JEFE Arturo García Fraustro

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dra. Elisa Margarita Rubí Chávez, UNAM, México Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dr. Martin Talavera Rojas, Universidad Autónoma del Estado de México, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dra. Silvia Elena Buntinx Dios, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, UAEH, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

I


REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria.

total por publicar es de $ 5,600.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx.

Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados.

La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx.

The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products.

For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 325.00 per article in both printed languages.

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II


REVISTA MEXICANA DE CIENCIAS PECUARIAS REV. MEX. CIENC. PECU.

VOL. 11 No. 4

OCTUBRE-DICIEMBRE-2020

CONTENIDO ARTÍCULOS

Pág. Detección molecular de coronavirus bovino asociado al complejo respiratorio bovino en ganado de engorda del valle de Mexicali, Baja California, México Molecular detection of bovine coronavirus associated with the bovine respiratory complex in beef cattle in the Mexicali Valley, Baja California, Mexico Carolina Orozco-Cabrera, Gilberto López-Valencia, Luis Mario Muñoz-Del Real, Soila Maribel Gaxiola-Camacho, Nohemí Castro-del Campo, Sergio Arturo Cueto-González, José Guadalupe Guerrero-Velázquez, Kattya MorenoTorres, Kelvin Orlando Espinoza-Blandón, Sergio Daniel Gómez-Gómez, Enrique Trasviña-Muñoz, Francisco Javier Monge-Navarro …………………………………………………………………………………………………………………….………………….933

Frecuencia de M. hyopneumoniae, M. hyorhinis y M. hyosynoviae en muestras nasales y de pulmón de cerdos con síntomas de neumonía enzoótica porcina Frequency of M. hyopneumoniae, M. hyorhinis and M. hyosynoviae in nasal and lung samples from pigs with symptoms of porcine enzootic pneumonia

Rosa Elena Miranda Morales, Verónica Rojas Trejo, Luis Enrique López-Cerino, Erika Margarita Carrillo Casas, Rosa Elena Sarmiento Silva, María Elena Trujillo Ortega, Rolando Beltrán Figueroa, Francisco José Trigo Tavera………………………………………………………………………………………………………………………………………………….….946

Presencia de Hymenolepis nana y diminuta en roedores de la ciudadela las Piñas, MilagroEcuador y su riesgo en salud pública Presence of Hymenolepis nana and diminuta in rodents of the Las Pinas citadel, in Milagro, Ecuador, and its risk for public health Roberto Darwin Coello-Peralta, Galo Ernesto Martínez-Cepeda, Douglas Pinela-Castro, Enrique Omar ReyesEcheverria, Enrique Xavier Rodríguez-Burnham, Maria de Lourdes Salazar Mazamba, Betty Pazmiño-Gómez, Antonella Ramírez-Tigrero, Manuel Bernstein, Pedro Cedeño-Reyes…………………………………………………………….…961

Frecuencia de contaminación y de serotipos de Salmonella enterica y Escherichia coli en una operación integrada de matanza y deshuese de bovinos Frequency of contamination and serovars of Salmonella enterica and Escherichia coli in an integrated cattle slaughtering and deboning operation Jorge Alfredo de la Garza-García, María Salud Rubio Lozano, María del Carmen Wacher-Rodarte, Armando Navarro Ocaña, Rigoberto Hernández-Castro, Juan Xicohtencatl-Cortes, Enrique Jesús Delgado Suárez..........................................................................................................................................................971

III


Antimicrobial resistance of Escherichia coli isolated from cattle carcasses and feces in Center of Mexico La resistencia antimicrobiana en Escherichia coli aislada de canales y heces bovinas de rastros en el centro de México Vicente Vega Sánchez, Martín Talavera Rojas, Jeannette Barba León, Andrea Paloma Zepeda Velázquez, Nydia Edith Reyes Rodríguez…………………………………………………………………………………………………………………………………….…991

Resistencia antimicrobiana de Salmonella spp aisladas de canales de cerdo obtenidas de dos tipos de rastros en Jalisco, México Antimicrobial resistance in Salmonella spp. isolated from pig carcasses in two slaughterhouse types in Jalisco, Mexico Vicente Vega-Sánchez, Jeannette Barba-León, Delia Guillermina González-Aguilar, Elisa Cabrera-Díaz, Carlos Pacheco-Gallardo, Adriana Guadalupe Orozco-García…..………………………………………………………………….………….1004

Influence of milking method, storage conditions and somatic cell counts on the milk quality form tanks La influencia del método de ordeño, las condiciones de almacenamiento y el recuento de células somáticas en la calidad de la leche cruda en tanques Joadilza da Silva Bezerra, Juliana Paula Felipe de Oliveira, Danielle Cavalcanti Sales, Yhêlda Maria de Oliveira Silva, Stela Antas Urbano, Luis Henrique Fernandes Borba, Lisandra Murmann, Adriano Henrique do Nascimento Rangel………………………………………………………………………………………………………………………………………………...…1016

Serotypes and Stx2 subtyping of Shiga toxin producing Escherichia coli isolates from cattle carcasses and feces Serotipos y aislamientos de Escherichia coli productora del subtipo Stx2 de la toxina Shiga provenientes de canales y heces de ganado bovino Nydia Edith Reyes-Rodríguez, Jeannette Barba-León, Armando Navarro-Ocaña, Vicente Vega-Sánchez, Fabián Ricardo Gómez De Anda, Juan Martín Talavera-González, Martín Talavera-Rojas……………………………………………1030

Impacto de la inclusión de información extranjera sobre la evaluación genética mexicana de sementales Holstein Impact of the inclusion of foreign information on Mexican genetic evaluation of Holstein sires Gustavo Javier Martínez Marín, Felipe de Jesús Ruiz López, Carlos Gustavo Vásquez Peláez, Sergio Iván Román Ponce, Adriana García Ruiz……………………………………………………………………………………………………………………….1045

Análisis genómico de diversidad y estructura genómica de las poblaciones bovinas de la raza mexicana de Lidia Genomic diversity and structure of Lidia breed cattle in Mexico Paulina G. Eusebi, Oscar Cortés, Susana Dunner, Javier Cañón……………………………………………………………..…..1059

IV


Análisis del pedigrí en diez poblaciones mexicanas de ovinos Pedigree analysis in ten sheep populations in Mexico Joel Domínguez-Viveros, Felipe Alonso Rodríguez-Almeida, Adán Medellín-Cázares, Juan Pablo GutiérrezGarcía……………………………………………………………………………………………………………..……………………………………..1071

Acumulación de forraje de Lotus corniculatus L., en función a diferentes estrategias de cosecha Forage accumulation in Lotus corniculatus L. as a function of harvest strategy Perpetuo Álvarez Vázquez. Juan de Dios Guerrero Rodríguez, Gabino Garcia De Los Santos, Maria Esther Ortega Cerrilla, Sergio Iban Mendoza Pedroza, Santiago Joaquín Cancino……………………………………………………………………………………………………………………………………............….1087

Presence of the yeast Kodamaea ohmeri associated with Aethina tumida (Coleoptera: Nitidulidae) collected in Africanized honey bee colonies from two apiaries of Yucatan, Mexico Presencia de la levadura Kodamaea ohmeri en escarabajos Aethina tumida (Coleoptera: Nitidulidae) colectados de colonias de abeja melífera africanizada en dos apiarios en Yucatán, México Azucena Canto, Luis A. Medina-Medina, Elisa Chan, Rosalina Rodríguez…………………………..….……………………..…1101

Factores determinantes del uso de sorgo para alimentación de ganado bovino en el noroeste de México Determining factors for the use of sorghum as fodder for bovines in Northwestern Mexico Venancio Cuevas-Reyes, Blanca Isabel Sánchez Toledano, Roselia Servín Juárez, Juan Esteban Reyes Jiménez, Alfredo Loaiza Meza, Tomas Moreno Gallegos……………………………………….………………………………………………....1113

Mejoramiento genético de la biomasa aérea y sus componentes en alfalfa: selección familial de medios hermanos Genetic improvement of aerial alfalfa biomass and its components: half-sib family selection Milton Javier Luna-Guerrero, Cándido López-Castañeda, Alfonso Hernández-Garay……………………………………..…1126

REVISIONES DE LITERATURA

Post vitrification pregnancy rate of in vivo produced embryos derived from equids. Review Tasa de preñez post vitrificación en los embriones de équidos producidos in vivo. Revisión Christian Urías-Castro, Ana Myriam Boeta……………………………………………………………………………..……1142

Herramientas moleculares utilizadas para el análisis metagenómico. Revisión Molecular tools used for metagenomic analysis. Review Nohemí Gabriela Cortés-López, Perla Lucía Ordóñez-Baquera, Joel Domínguez-Viveros…………………..1150

Origen metabólico y propiedades bioactivas de ácidos grasos ramificados e impares en leche de rumiantes. Revisión Metabolic origin and bioactive properties of odd and branched-chain fatty acids in ruminants’ milk. Review… Pilar Gómez-Cortés, Miguel Ángel de la Fuente………………………………………………………………………….1174

V


NOTAS DE INVESTIGACIÓN

Análisis de QTL asociados a polimorfismos de nucleótido único (SNP) involucrados en el fenotipo lechero del ganado Holstein QTL analysis associated to single nucleotide polymorphisms (SNP) involved in the dairy phenotype of Holstein cattle José Manuel Valdez-Torres, Juan Alberto Grado Ahuir, Beatriz Elena Castro-Valenzuela, M. Eduviges BurrolaBarraza……………………………………………………………………………………………………………….……….1192

Efecto de la adición de clorhidrato de zilpaterol genérico en el perfil bioquímico y hematológico de ovinos de pelo engordados en corral Evaluation of the biochemical and hematological profiles of feedlot hair sheep after the supplementation with generic zilpaterol hydrochloride Arnulfo Vicente Pérez, Leonel Avendaño Reyes, Ulises Macías Cruz, Antonio Aguilar Quiñones, Ricardo Vicente Pérez, Miguel Mellado Bosque, Miguel Ángel Gastélum Delgado, Abelardo Correa Calderón, G. López-Rincón, Juan Eulogio Guerra Liera…………………………………………………………………….………………1208

Dietary supplementation effects with Ruta graveolens on performance, carcass traits and meat quality on rabbits Efectos de la suplementación dietética con Ruta graveolens en el desempeño, las características de la canal y la calidad de la carne de conejo Maricela Ayala Martínez, Armando Zepeda-Bastida, Sergio Soto-Simental………………………….…………..1220

VI


Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

6.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes). Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo. El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

4.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

5.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

7.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8.

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

VII


Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

referencias, aunque pueden insertarse en el texto (entre paréntesis).

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés.

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus.

12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

VIII


I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

XI)

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

IX


XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

xg

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50 g

vs

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s)

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

X


Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

2.

3.

4.

5.

6.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts). All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt. Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias�. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

7.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

8.

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

9.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary works and may show partial or final results of research. The text of the article must include the following parts:

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

b) Technical Notes. They should be brief and be

evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which

XI


should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of t he research article but without section titles.

names(s), the number of the edition, the country, the printing house and the year. e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume

Key rules for references

II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one.

III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given

b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article).

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets). d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

XII


Organization, as author

Organization as author XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

In press VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Books and other monographs

Author(s)

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Chapter in a book IX)

Electronic publications

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003.

Conference paper X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003. XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

13. Final version. This is the document in which the authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII


14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m Âľl Âľm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v. J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

vs

versus

xg

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIV


https://doi.org/10.22319/rmcp.v11i4.5137 Artículo

Detección molecular de coronavirus bovino asociado al complejo respiratorio bovino en ganado de engorda del valle de Mexicali, Baja California, México

Carolina Orozco-Cabrera a Gilberto López-Valencia a Luis Mario Muñoz-Del Real a Soila Maribel Gaxiola-Camacho b Nohemí Castro-del Campo b Sergio Arturo Cueto-González a José Guadalupe Guerrero-Velázquez a Kattya Moreno-Torres a Kelvin Orlando Espinoza-Blandón a Sergio Daniel Gómez-Gómez a Enrique Trasviña-Muñoz a Francisco Javier Monge-Navarro a*

a

Universidad Autónoma de Baja California. Instituto de Investigaciones en Ciencias Veterinarias. Km. 3.5 Carretera a San Felipe, Fraccionamiento Campestre, 21386, Mexicali, Baja California, México. b

Universidad Autónoma de Sinaloa. Facultad de Medicina Veterinaria y Zootecnia, Culiacán Sinaloa, México.

* Autor de correspondencia: fmonge@uabc.edu.mx

933


Rev Mex Cienc Pecu 2020;11(4):933-945

Resumen: El complejo respiratorio bovino (CRB) es la principal causa de enfermedad y muerte en el ganado de engorda en todo el mundo. Es un síndrome infeccioso multifactorial provocado por distintos virus y bacterias que disminuyen la eficiencia productiva y ocasionan pérdidas económicas. En México, el CRB se ha reportado en todas las regiones donde se engorda ganado; sin embargo, esos reportes carecen de información sobre la presencia del coronavirus respiratorio bovino (CVB), haciendo necesario contar con herramientas de diagnóstico confiables y precisas para detectar la presencia de CVB en el ganado que se engorda en México, para proponer las medidas sanitarias apropiadas para su manejo clínico. En este trabajo, se desarrolló una plataforma de diagnóstico molecular de PCR en tiempo real (rt-PCR) que amplifica un fragmento de la proteína S del CVB en muestras de exudado nasal. Al aplicar la plataforma rt-PCR para CVB en bovinos de engorda en aparente estado de salud y con signos de enfermedad respiratoria asociados a CRB se encontró que 19/50 (38 %) resultaron positivos, confirmando la presencia de ese virus en el ganado de la región. Los resultados de este trabajo significan el primer reporte sobre la presencia del CVB asociado al CRB en la región ganadera del noroeste de México y sienta las bases para futuras investigaciones sobre papel que juega este virus en la presentación de la patología del CRB en los sistemas de explotación de bovinos de engorda en nuestra región y el país. Palabras clave: Coronavirus respiratorio bovino, Complejo respiratorio bovino, PCR, Proteína S, Bovinos de engorda.

Recibido: 30/10/2018 Aceptado: 09/09/2019

Introducción El complejo respiratorio bovino (CRB) se considera la principal causa de enfermedad clínica y muerte en ganado de engorda estabulado en todo el mundo, ocasionando pérdidas económicas para el ganadero(1). Tradicionalmente, el CRB se relaciona con enfermedad producida de forma individual o combinada del virus sincitial respiratorio bovino (VSR), herpes virus bovino tipo 1 (RIB), virus de parainfluenza 3 bovina (PI3) y virus de la diarrea viral bovina (DVB), los cuales desarrollan una infección primaria con signos clínicos leves(2). Asimismo, el CRB se asocia a la presencia de las bacterias Pasteurella multocida, Mannheimia haemolytica, Histophilus somni y Mycoplasma bovis, las cuales actúan como patógenos oportunistas durante condiciones de estrés o infección viral primaria(3,4). Además de los virus mencionados, el coronavirus bovino (CVB) también se ha reportado como agente 934


Rev Mex Cienc Pecu 2020;11(4):933-945

viral asociado al CRB, ocasionando enfermedad respiratoria y reducción en la ganancia de peso en ganado de engorda(5- 9). Las infecciones producidas por el CVB han sido reportadas en todo el mundo y se considera como una enfermedad endémica en explotaciones de bovinos de leche y bovinos de engorda estabulados(7). La principal vía de transmisión del CVB es a través de la ruta fecal-oral, aunque también se ha demostrado el contagio a través de la vía respiratoria por inhalación de aerosoles que contienen las partículas virales. Cuando el CVB ingresa al tracto gastrointestinal, desencadena un cuadro clínico de diarrea, deshidratación, acidosis e hipoglucemia en animales jóvenes(10). Cuando el CVB ingresa por inhalación, infecta el epitelio respiratorio de cornetes nasales, tráquea y pulmones. La replicación conduce a la eliminación del virus en las secreciones nasales y la enfermedad produce un cuadro con signos clínicos que varían de ausentes a graves, incluyendo depresión, fiebre, conjuntivitis, dificultad respiratoria y tos leve a severa(11). En México, el CRB se ha reportado en todas las regiones donde se engorda ganado (12,13,14). Sin embargo, esos reportes carecen de información sobre la presencia del CVB en las explotaciones de bovinos de engorda; siendo de la mayor importancia contar con herramientas de diagnóstico que permitan confirmar la presencia del CVB en el ganado. El diagnóstico del CVB se logra utilizando distintas técnicas serológicas(10,15) o aislamiento viral a partir de exudado nasal y biopsias de diferentes tejidos(10,16,17). Recientemente, se ha reportado la aplicación de técnicas moleculares incluyendo PCR convencional (PCR) y en tiempo real (rt-PCR) para la detección de CVB asociado al CRB(6,10,14); sobresaliendo la utilización de plataformas que amplifican el gen que codifica para la proteína S del CVB, la cual representa la estructura viral más importante para la producción de anticuerpos neutralizantes(7,18). El gen de la proteína S es altamente conservado entre las cepas de CVB y ha sido ampliamente utilizado como gen objetivo de pruebas moleculares para diagnóstico de esta enfermedad en el ganado y otras especies animales, incluyendo el hombre(6,19,20). El presente trabajo tuvo como objetivo el desarrollo y utilización de una plataforma de diagnóstico molecular por rt-PCR para detectar un fragmento del gen que codifica para la proteína S del CVB en muestras de exudado nasal de ganado bovino. Los resultados indican que el sistema rt-PCR es altamente sensible y específico para detectar el CVB y puede ser utilizado en en los sistemas de explotación de bovinos de engorda de la región y del país.

Material y métodos El presente estudio se realizó en la Unidad de Laboratorios de Diagnóstico (ULADI) del Instituto de Investigaciones en Ciencias Veterinarias de la Universidad Autónoma de Baja California, Campus Mexicali.

935


Rev Mex Cienc Pecu 2020;11(4):933-945

Muestras de exudado nasal Se recolectaron 50 muestras de exudado nasal de bovinos de engorda estabulados, pertenecientes a un sistema de explotación de bovinos tecnificado, ubicado en el valle de Mexicali, Baja California. Las muestras se obtuvieron de animales de nuevo ingreso a corral con menos de 30 días de arribo a la explotación y contaban con 18 meses de edad en promedio. Se colectaron 30 muestras de animales que presentaban descarga nasal, tos, depresión o temperatura corporal mayor de 38.5 °C (Grupo 1), los cuales se clasificaron como enfermos, y 20 muestras de animales aparentemente sanos que no mostraban ninguno de los signos mencionados(21). Las muestras de exudado nasal se colectaron por vía intranasal profunda, utilizando hisopos de dacrón tipo escobetilla. Una vez realizada la toma de muestra, la escobetilla del hisopo se sumergió en un tubo que contenía solución salina de fosfatos (PBS) estéril, pH 7.4, recortando el mango de tal forma que el tubo pudiera ser cerrado para proteger la muestra de posible contaminación, e identificando con número progresivo el grupo correspondiente. Una vez colectadas, las muestras se transportaron al laboratorio para su procesamiento.

Extracción de ARN de exudado nasal Para la extracción de ARN se utilizaron los juegos de reactivos Aurum Total RNA Fibrous Tissue (Bio Rad, Hercules, California, EUA) siguiendo las instrucciones del fabricante. De cada extracción se recuperó ARN en un volumen de 50 µl de la solución de elución suministrada en los juegos de reactivos. El ARN extraído se almacenó en congelación a -20 °C hasta el momento de las pruebas rt-PCR.

Diseño de oligonucleótidos para CVB Se diseñaron oligonucleótidos a partir de la secuencia del gen que codifica para la proteína S del coronavirus bovino cepa R-AH187 (CVB-S), con número de acceso GenBank EF424620.1. El gen corresponde a una molécula de 4,090 pares de bases publicada en julio de 2016. Se utilizó el programa de diseño de oligonucleótidos Primer3Plus versión 20062007, que se encuentra disponible en: http://www.bioinformatics.nl/cgibin/primer3plus/primer3plus.cgi. A partir de la secuencia del gen CVB-S se generó el oligonucleótido de banda positiva denominado CVBf con secuencia 5’– CTACTTGGAATAGGAGATTTG-3´, mientras que para el oligonucleótido de banda negativa denominado CVBr, la secuencia seleccionada fue 3´TACACGGACAGAAATTTGTG-5´; la amplificación de esos oligonucleótidos por rt-PCR genera un producto de 132 pares de bases y contenido de GC de 36 %, con temperatura de disociación (Tm) de 77.0 ºC para ese producto de PCR. Las características de los oligonucleótidos se muestran en el Cuadro 1. Los oligonucleótidos se sintetizaron por 936


Rev Mex Cienc Pecu 2020;11(4):933-945

GenScript LTD (Piscataway, New Jersey, EUA), y fueron reconstituidos con agua grado biología molecular equivalente a 10 veces el valor de la concentración en nano moles (nM) referida por el fabricante, para obtener una concentración estándar de 100 micro molar (µM). Para las pruebas rt-PCR la concentración de trabajo de los oligonucleótidos se estableció en 10 µM. Cuadro 1. Secuencias y propiedades de los oligonucleótidos diseñados a partir del gen CVB-S con referencia GenBank EF424620.1 Oligonucleótido: CVBf Secuencia:

CTACTTGGAATAGGAGATTTG

Inicio: nucleótido 1337

Longitud: 21 pb

Tm: 55.4 ºC

Oligonucleótido:

CVBr

Secuencia:

TACACGGACAGAAATTTGTG

Fin: nucleótido 1469

Longitud: 20 pb

Tm: 54.3 ºC

Producto:

132 pb

Tm: 77.0 ºC

GC: 38%

GC: 40%

Mezcla maestra En este trabajo se utilizó la mezcla maestra I Script One-Step RT-PCR (Bio Rad, Hercules, California, EUA) formulada con el fluoróforo SYBR Green I en una solución de mezcla maestra que utiliza ambos oligonucleótidos a una concentración de 400 nM, 2 µl de ARN templete y agua grado biología molecular para un volumen de reacción total optimizado a 10 µl.

Controles positivos de ARN para BoCV Como control positivo se utilizó ARN extraído de la fracción líquida de la vacuna Scourgard 4 K7C (Zoetis, New Jersey, USA), la cual contiene coronavirus bovino cepa Hansen inactivado, además de rotavirus bovino serotipos G6 y G10 inactivados, E. coli enterotoxigénica K 99 y toxoide de Clostridium perfringens tipo C. El procedimiento para extracción de ARN fue aplicando el protocolo de los juegos de reactivos Bio Rad AurumTotal RNA Fibrous Tissue utilizando 300 µl de la vacuna. El ARN extraído fue dividido en alícuotas de 10 µl y almacenado en congelación a -20° C hasta el momento de ejecutar las pruebas RT-PCR.

937


Rev Mex Cienc Pecu 2020;11(4):933-945

Protocolos de pruebas RT-PCR Las pruebas rt-PCR se realizaron en un termociclador CFX96 de Bio Rad. Los parámetros de desnaturalización, hibridación y extensión se calcularon empleando la herramienta Protocol Autowriter de la paquetería CFX96 integrada al termociclador, tomando en consideración el tamaño del producto del PCR, la secuencia de los oligonucleótidos y el tipo de enzima de la mezcla maestra, resultando un paso inicial a 50 °C por 10 min para transcripción reversa, seguido de un ciclo de desnaturalización de 95 °C durante 3 min, y continuando con 39 ciclos desnaturalización a 95° C por 10 seg, 20 seg a 51.0 °C para hibridación de oligonucleótidos y 15 seg a 72 °C para extensión. Asimismo, para cada corrida se realizó el análisis de curva de disociación a partir de 65 °C y hasta 95 °C para la identificación de curvas de amplificación dentro de la temperatura estimada de 77.0 °C +/- 1 °C del producto del PCR de 132 pb y discriminar entre artefactos distintos a la amplificación del templete de ARN esperado.

Interpretación de resultados Los resultados de las pruebas rt-PCR para CVB fueron considerados positivos cuando la muestra correspondiente obtuvo una señal fluorescente de amplificación antes del ciclo 40, por encima de la línea umbral de control que el programa CFX96 establece de manera automática, y que corresponde a 10 veces la desviación estándar del promedio de índice de fluorescencia generada por todas las muestras durante los 10 primeros ciclos de cada corrida. Los resultados se consideraron negativos cuando la muestra correspondiente no logró desarrollar una señal fluorescente de amplificación por encima de la línea umbral del control negativo de referencia en un máximo de 40 ciclos.

Resultados Estandarización del RT-PCR para BoCV El gráfico de amplificación y la curva de disociación calculados por la paquetería CFX96 de BioRad para el sistema rt-PCR de CVB demostraron que la combinación óptima de reactivos para obtener la máxima amplificación de los oligonucleótidos CVBf y CVBr se logra a una concentración de 400 nM con 2 µl de ARN templete. Bajo estas condiciones los controles positivos extraídos de la vacuna Scourguard 4 K/C desarrollaron una señal por encima de la línea umbral con un ciclo de amplificación (Cq) promedio de 31.09 en 40 ciclos totales de cada corrida de amplificación; los controles negativos no mostraron evidencia de amplificación (Figura 1). Asimismo, el análisis de la curva de disociación (Tm) para el ARN control positivo mostró un rango de temperatura de disociación entre 76.0 y 78.0 °C, con una

938


Rev Mex Cienc Pecu 2020;11(4):933-945

temperatura promedio de 77.0 °C (Figura 2); estos parámetros permiten considerar a la prueba rt-PCR para CVB como válida. Figura 1: Curva de amplificación de los controles de coronavirus bovino extraídos de la vacuna Scourguard 4 K/C utilizando los oligonucleótidos CVBf y CVBr a una concentración de 400 nM con 2 µl de ARN templete

Figura 2: Curva de disociación de los controles positivos del rt-PCR para coronavirus bovino mostrando una temperatura promedio de 77.0 °C

939


Rev Mex Cienc Pecu 2020;11(4):933-945

Resultados del RT-PCR para muestras de exudado nasal Se probaron por duplicado 50 muestras de ARN proveniente de exudado nasal de bovinos de engorda estabulados de las cuales 19 (38.0 %) lograron una amplificación por encima de la línea umbral que establece la paquetería CFX96 y por lo tanto fueron consideradas como positivas. De las muestras que resultaron positivas, 5 (10.0 %) pertenecían al Grupo 1, que corresponde a animales con signos y síntomas asociados al CRB y 14 (28.0 %) al Grupo 2, conformado por animales sin signos ni síntomas de enfermedad respiratoria. El Cq promedio de las muestras de ambos grupos fue de 34.60 ciclos con rango de Cq entre 30.87 y 35.95 ciclos y Tm promedio de 77.0 °C (Figura 2).

Discusión El CVB es un virus patógeno de distribución mundial que produce enfermedades entéricas en becerros jóvenes y disentería de invierno en bovinos adultos. El CVB también está implicado en infecciones asociadas al CRB en ganado de engorda. Aunque las infecciones por CVB producen una mortalidad menor al 2 %, la morbilidad de este virus puede alcanzar el 100 % de los animales de una explotación, ocasionando síndromes respiratorios o digestivos que afectan de forma negativa la tasa de ganancia de peso o de producción de leche, además de los costos por servicios veterinarios, antibióticos y otros medicamentos que en conjunto, ocasionan pérdidas económicas para el sector pecuario(10,15). El desarrollo e instrumentación de la plataforma rt-PCR para CVB aquí presentada, surge como respuesta a la necesidad de contar con herramientas de diagnóstico confiables, precisas y rápidas para detectar una enfermedad de origen viral que ha sido reportada como parte del CRB pero que debido a la gran cantidad de signos y síntomas que comunes que producen los agentes patógenos, resulta difícil establecer con precisión cuál es el principal agente causal al que puede atribuirse el estado patológico en un animal o hato(22,23); especialmente cuando el proceso infeccioso se desarrolla con síntomas mínimos o imperceptibles, ocasionando retraso en la iniciación de la terapia correspondiente, extendiendo en el tiempo requerido para recuperar el estado de salud y como consecuencia afectando de forma negativa los niveles de productividad de los animales enfermos(20,24). En este trabajo, se diseñó, desarrolló e instrumentó una plataforma de rt-PCR que detecta y amplifica un fragmento del gen que codifica para la proteína S del CVB, resultando en una plataforma de diagnóstico molecular altamente sensible y específica para la detección de CVB a partir de muestras de exudado nasal. Si bien en este trabajo no se realizó la cuantificación de partículas virales, la sensibilidad de las plataformas rt-PCR para CVB a partir de muestras de exudado nasal ha sido reportada previamente con rangos de detección que van desde 102 copias de cDNA(25) hasta 103 copias de cDNA(26) por reacción, con curvas 940


Rev Mex Cienc Pecu 2020;11(4):933-945

de amplificación desarrolladas después del ciclo 34 para ambos estudios, lo cual coincide con el Cq promedio de 34.60 desarrollado por las muestras analizadas en este trabajo, por lo que se propone que la plataforma rt-PCR para CVB aquí reportada tiene una sensibilidad estimada entre 102 y 103 copias de cDNA por reacción. Debido a las propiedades genéticas de la proteína S, caracterizadas por una alta homología ente las distintas cepas virales y su alta reactividad inmunológica(22,24), distintos fragmentos del gen de la proteína S del CVB han sido utilizado como base metodológica de referencia para el desarrollo de plataformas de diagnóstico molecular y serológico para la detección y diagnóstico de este virus de forma rápida y con altos niveles de sensibilidad y especificidad, incluso en muestras que contienen pequeñas cantidades de virus donde las pruebas de diagnóstico convencionales pueden resultar poco concluyentes(23). Los resultados obtenidos indican que 19 muestras (38 %) provenientes de ambos grupos de estudio resultaron positivas a la plataforma rt-PCR para CVB. Sobresale el hecho que cinco de las muestras del grupo de animales enfermos (n= 30) resultaron positivas, mientras que 14 de las muestras provenientes del grupo de animales aparentemente sanos (n= 20) resultaron positivas a las pruebas. Contrario a lo que se anticipaba, el 70 % de las muestras del grupo de animales aparentemente sanos resultó positivo a la plataforma rt-PCR para CVB. Lo anterior puede deberse a que el CVB puede infectar hasta el 45 % de ganado de reciente arribo a corral sin mostrar signos o síntomas evidentes de enfermedad(27,28); sin embargo, se ha comprobado que la eliminación vía nasal de CVB en ganado aparentemente sano es 1.6 veces más propenso a sufrir al menos un episodio enfermedad respiratoria y 2.2 veces más probabilidad de desarrollar lesiones pulmonares comparado con animales que no eliminan virus por esta vía(7,29), por lo que es posible que esos animales se encontraban incubando el virus y todavía no desarrollaban el cuadro clínico respiratorio característico del CRB. La prevalencia de 38 % es similar a la reportada en otras regiones del mundo. En un estudio realizado en Australia en ganado de engorda para exportación se analizaron muestras de exudado nasal empleando una plataforma rt-PCR similar a la empleada aquí, encontrando una prevalencia de 40.1 % para CVB, seguido de 0.4 % para DVB, 0.3 % para RIB, 0.3 % para VSR y 0.3 % para PI3, haciendo evidente la magnitud de la influencia del CVB sobre la presentación de enfermedad respiratoria del CRB en ese país(29). Asimismo, los resultados muestran una tasa de positivos superior a la reportada en Irlanda, donde se realizó un estudio para establecer la prevalencia de agentes patógenos asociados al CRB a partir de muestras de exudado nasal empleando rt-PCR, encontrando una tasa de positivos de 22.9 % para CVB, 11.6 % para VSRB, 7.0 % para PI3, 6.1 % para RIB y 5 % para DVB; destacando el hecho que el CVB es el virus asociado al CRB que más frecuentemente se diagnostica en el ganado de engorda de ese país(30). En los Estados Unidos de América, el CVB es el virus asociado al CRB con mayor prevalencia en el ganado que se engorda en ese país. Los reportes de 941


Rev Mex Cienc Pecu 2020;11(4):933-945

prevalencia de patógenos asociados al CRB en muestras de exudado nasal provenientes de ganado de engorda y analizadas por técnicas rt-PCR reportan una prevalencia de 62.8 % para CVB, seguido de DVB con 15.7 %, IBR con 14.9 %, VSRB con 9.1 % y 8.3 % para PI3(23). La tasa de prevalencia de los EUA supera la reportada para Australia e Irlanda, así como lo reportado para México a través de este trabajo, debido principalmente a que las explotaciones de bovinos de engorda en los EUA alojan cientos de miles de cabezas de ganado en una región determinada, donde el contacto cercano entre animales sanos y enfermos puede favorecer la transmisión y persistencia del CVB entre el ganado(31). Los resultados aquí presentados significan el primer reporte sobre la presencia del CVB asociado al CRB en la región ganadera correspondiente al noroeste de México y colocan al CVB en la segunda posición de la tabla de prevalencia de virus asociados al CRB detectados previamente en la zona, donde el virus sincitial respiratorio bovino (VSRB) ocupó la primera posición con 80.6 % de prevalencia, seguido del virus de parainfluenza 3 (PI3) con 23.8 %, herpes virus bovino 1 (IBR) con 20.4 % y virus de diarrea viral bovina (DVB) con 11.3 %(15).

Conclusiones e implicaciones Se concluye que el CVB se encuentra presente en el ganado bovino estabulado del valle de Mexicali, Baja California. La plataforma rt-PCR para CVB aquí reportada es una herramienta de diagnóstico molecular rápida, sensible y específica para detectar el CVB en muestras de exudado nasal proveniente de ganado de engorda estabulado. La prevalencia de 38.0 % para CVB reportada en este trabajo debe ser el punto de partida para futuras investigaciones sobre papel que juega este virus en la presentación de la patología del CRB en los sistemas de explotación de bovinos de engorda en nuestra región y el país. Los autores de este trabajo declaran que no existe conflicto de interés de ningún tipo.

Literatura citada: 1. Hay KE, Morton JM, Schibrowski ML, Clements ACA, Mahony TJ, Barnes TS. Associations between prior management of cattle and risk of bovine respiratory disease in feedlot cattle. Prev Vet Med 2016;(127):37-43. 2. Gershwin LJ, Van Eenennaam AL, Anderson ML, McEligot HA, Shao MX, ToaffRosenstein R, et al. Single pathogen challenge with agents of the bovine respiratory disease complex. PLOS ONE 2015;10(11):e0142479. 3. Hilton WM. BRD in 2014: where have we been, where are we now, and where do we want to go? Anim Health Res Rev 2014;(15):120-122. 942


Rev Mex Cienc Pecu 2020;11(4):933-945

4. Xue W, Ellis J, Mattick D, Smith L, Brady R, Trigo E. Immunogenicity of a modified-live virus vaccine against bovine viral diarrhea virus types 1 and 2, infectious bovine rhinotracheitis virus, bovine parainfluenza-3 virus, and bovine respiratory syncytial virus when administered intranasally in young calves. Vaccine 2010;(28):3784-3792. 5. Thomas CJ, Hoet AE, Sreevatsan S, Wittum TE, Briggs RE, Duff GC, Saif LJ. Transmission of bovine coronavirus and serologic responses in feedlot calves under field conditions. Am J Vet Res 2006;(67):1412-1420. 6. Bidokhti MR, Travén M, Ohlson A, Baule C, Hakhverdyan M, Belák S, et al. Tracing the transmission of bovine coronavirus infections in cattle herds based on S gene diversity. Vet J 2012;(193):386-390. 7. Saif LJ. Bovine respiratory coronavirus. Vet Clin North Am Food Anim Pract 2010;(26): 349-364. 8. Hick PM, Read AJ, Lugton I, Busfield F, Dawood KE, Gabor L, et al. Coronavirus infection in intensively managed cattle with respiratory disease. Aust Vet J 2012;(90):381-386. 9. Liu L, Hagglund S, Hakhverdyan M, Alenius S, Larsen LE, Belák S. Molecular epidemiology of bovine coronavirus on the basis of comparative analyses of the S gene. J Clin Microbiol 2006;(44):957-960. 10. Oma VS, Travén M, Alenius S, Myrmel M, Stokstad M. Bovine coronavirus in naturally and experimentally exposed calves; viral shedding and the potential for transmission. Virol J 2016;(13):1-11. 11. Park SJ, Kim GY, Choy HE, Hong YJ, Saif LJ, Jeong JH, et al. Dual enteric and respiratory tropisms of winter dysentery bovine coronavirus in calves. Arch Virol 2007;(152):1885-1900. 12. Figueroa-Chávez D, Segura-Correa JC, García-Márquez LJ, Pescador-Rubio A, Valdivia-Flores AG. Detection of antibodies and risk factors for infection with bovine respiratory syncytial virus and parainfluenza virus 3 in dual-purpose farms in Colima, Mexico. Trop Anim Health Prod 2012;(44):1417-1421. 13. Solís-Calderón JJ, Segura-Correa JC, Aguilar-Romero F, Segura-Correa VM. Detection of antibodies and risk factors for infection with bovine respiratory syncytial virus and parainfluenza virus-3 in beef cattle of Yucatan, Mexico. Prev Vet Med 2007;(82):102110. 14. Rodríguez-Castillo JL, Lopez-Valencia, G, Monge-Navarro FJ, Medina-Basulto GE, Hori-Oshima S, Cueto-González SA, et al. Detection and economic impact related to 943


Rev Mex Cienc Pecu 2020;11(4):933-945

bovine respiratory disease, shrink, and traveling distance in feedlot cattle in Northwest Mexico. Turk J Vet Anim Sci 2017;(41):294-301. 15. Amer HM, Wahed AAE, Shalaby MA, Almajhdi FN, Hufert FT, Weidmann M. A new approach for diagnosis of bovine coronavirus using a reverse transcription recombinase polymerase amplification assay. J Virol Methods 2013;(193):337-340. 16. Decaro N, Mari V, Desario C, Campolo M, Elia G, Martella V, et al. Severe outbreak of bovine coronavirus infection in dairy cattle during the warmer season. Vet Microbiol 2008;(126):30-39. 17. Toftaker I, Toft N, Stokstad M, Solverod L, Harkiss G, Watt N, et al. Evaluation of a multiplex immunoassay for bovine respiratory syncytial virus and bovine coronavirus antibodies in bulk tank milk against two indirect ELISAs using latent class analysis. Prev Vet Med 2018;(154):1-8. 18. Workman AM, Kuehn LA, McDaneld TG, Clawson ML, Chitko-Mckown CG, Loy JD. Evaluation of the effect of serum antibody abundance against bovine coronavirus on bovine coronavirus shedding and risk of respiratory tract disease in beef calves from birth through the first five weeks in a feedlot. Am J Vet Res 2017;(78):1065-1076. 19. Singasa K, Songserm T, Lertwatcharasarakul P, Arunvipas P. Molecular and phylogenetic characterization of bovine coronavirus virus isolated from dairy cattle in Central Region, Thailand. Trop Anim Health Prod 2017;(49):1523-1529. 20. Bok M, Miño S, Rodriguez D, Badaracco A, Nuñes I, Souza SP, et al. Molecular and antigenic characterization of bovine Coronavirus circulating in Argentinean cattle during 1994-2010. Vet Microbiol 2015;(181):221-229. 21. Villagómez-Cortés JA, Martínez-Herrera DI. Epidemiological evaluation of clinical bovine respiratory disease complex in a tropical Mexican feedlot. ROAVS 2013;(3):315-321. 22. Belouzard S, Millet JK, Licitra BN, Whittaker GR. Mechanisms of coronavirus cell entry mediated by the viral spike protein. Viruses 2012;(4):1011-1033. 23. Fulton RW, d´Offay JM, Landis C, Miles DG, Smith RA, Saliki JT, et al. Detection and characterization of viruses as field and vaccine strains in feedlot cattle with bovine respiratory disease. Vaccine 2016;(34):3478-3492. 24. Li F. Structure, function, and evolution of coronavirus spike proteins. Annu Rev Virol 2016;(3):237-261.

944


Rev Mex Cienc Pecu 2020;11(4):933-945

25. Escutenaire S, Mohamed N, Isaksson M, ThorĂŠn P, Klingeborn B, BelĂĄk S, et al. SYBR green real-time reverse transcription-polymerase chain reaction assay for the generic detection of coronaviruses. Arch Virol (2007);152(1):41-58. 26. Amer HM, Almajhdi FN. Development of a SYBR Green I based real-time RT-PCR assay for detection and quantification of bovine coronavirus. Mol Cell Probes (2011);25(2):101-107. 27. Hick PM, Read AJ, Lugton I, Busfield F, Dawood KE, Gabor L, et al. Coronavirus infection in intensively managed cattle with respiratory disease. Aust Vet J 2012;(90):381-386. 28. Lathrop SL, Wittum TE, BrocK KV, Loerch SC, Perino LJ, Bingham HR, et al. Association between infection of the respiratory tract attributable to bovine coronavirus and health and growth performance of cattle in feedlots. Am J Vet Res 2000;(61):10621066. 29. Moore SJ, O'dea MA, Perkins N, O'hara AJ. Estimation of nasal shedding and seroprevalence of organisms known to be associated with bovine respiratory disease in Australian live export cattle. J Vet Diagn Invest 2014;(27):6-17. 30. O'Neill R, Mooney J, Connaghan E, Furphy C, Graham DA. Patterns of detection of respiratory viruses in nasal swabs from calves in Ireland: a retrospective study. Vet Rec 2015;175(14):351. 31. Wolfger B, Timsit E, White BJ, Orsel K. A systematic review of bovine respiratory disease diagnosis focused on diagnostic confirmation, early detection, and prediction of unfavorable outcomes in feedlot cattle. Vet Clin North Am Food Anim Pract 2015;(31):351-65.

945


https://doi.org/10.22319/rmcp.v11i4.5124 Artículo

Frecuencia de M. hyopneumoniae, M. hyorhinis y M. hyosynoviae en muestras nasales y de pulmón de cerdos con síntomas de neumonía enzoótica porcina

Rosa Elena Miranda Morales a* Verónica Rojas Trejo a Luis Enrique López-Cerino a Erika Margarita Carrillo Casas b Rosa Elena Sarmiento Silva a María Elena Trujillo Ortega c Rolando Beltrán Figueroa c Francisco José Trigo Tavera d

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Microbiología e Inmunología. UNAM. Ciudad Universitaria, 04519, CDMX, México. Hospital General “Dr. Manuel Gea González”, Departamento de Biología Molecular e Histocompatibilidad. CDMX, México. b

c

Universidad Nacional Autónoma de México, Facultad de Medicina Veterinaria y Zootecnia, Departamento de Cerdos. CDMX, México. d

Universidad Nacional Autónoma de México, Facultad de Medicina Veterinaria y Zootecnia, Departamento de Patología. CDMX, México.

*Autor de correspondencia: roelmimo@yahoo.com.mx

946


Rev Mex Cienc Pecu 2020;11(4):946-960

Resumen: M. hyopneumoniae, M. hyorhinis y M. hyopsynoviae son especies genéticamente relacionadas del género Mycoplasma que afectan la producción porcina. El objetivo de este trabajo fue el aislamiento e identificación por PCR de M. hyopneumoniae, M. hyorhinis y M. hyosynoviae a partir de hisopos nasales y muestras de pulmón de cerdos de diferentes regiones mexicanas para determinar la frecuencia de estas especies y evaluar la PCR como herramienta diagnóstica para NEP. Se incluyeron cerdos de 4 a 8 semanas con diagnóstico clínico de NEP. Se obtuvieron muestras de pulmón e hisopos nasales para el aislamiento de Mycoplasma en medio Friis líquido y se identificaron mediante la PCR especie-específica basada en la subunidad 16S rRNA. El aislamiento se logró en 37.11 % (36/97) muestras. Las tres especies de Mycoplasma se identificaron en muestras de pulmón e hisopos nasales. La co-infección por Mycoplasma se identificó en el 27.77 % (10/36). Los géneros bacterianos asociados a las infecciones por Mycoplasma fueron E. coli, Bordetella, Enterobacter, SCN, Corynebacterium, Pasteurella, Streptococcus, Shigella y Kebsiella. La infección mixta estuvo presente en 26 hisopos nasales (45.61 %) y ausente en pulmones. Se concluyó que la frecuencia de Mycoplasma en las fincas de producción fue mayor a la esperada (40.27 %). También se identificaron otras especies de Mycoplasma involucradas en el desarrollo de la NEP. Por lo tanto, la vigilancia asistida por el aislamiento y las técnicas moleculares pueden ser de gran ayuda para la eliminación de Mycoplasma de las explotaciones porcinas y para los proveedores de pie de cría. Palabras clave: Micoplasmosis, M. hyopneumoniae, M. hyorhinis, M. hyosynoviae, Neumonía enzoótica porcina.

Recibido: 29/10/2018 Aceptado: 09/09/2019

Introducción El complejo de enfermedades respiratorias porcinas (CREP) es un problema de salud de importancia para la industria porcina a nivel mundial(1). Se debe a la asociación de infecciones como Mycoplasma, virus del síndrome respiratorio y reproductivo porcino (Por sus siglas en inglés: PRRSV), Circovirus porcino tipo 2 (Por sus siglas en inglés: PCV2), Pasteurella multocida, Actinobacillus pleuroneumoniae, Streptococcus suis, Haemophilus parasuis, Bordetella bronchiseptica y Arcanobacterium pyogenes(1,2). Un factor predisponente es la neumonía enzoótica porcina (NEP), primariamente causada por Mycoplasma hyopneumoniae(3), el cual se adhiere al epitelio respiratorio, daña las células 947


Rev Mex Cienc Pecu 2020;11(4):946-960

ciliadas de la tráquea, bronquios y bronquiolos(4), y suprime la respuesta inmune del tracto respiratorio superior que favorece el desarrollo del CREP(5,6). La NEP es una enfermedad respiratoria crónica de alta prevalencia con alta morbilidad y baja mortalidad. Del 30 al 80 % de los animales destinados al abasto presentan lesiones de consolidación típicas(7,8). A lo largo de la vida productiva del cerdo, la prevalencia de M. hyopneumoniae va incrementando hasta llegar a la edad de sacrificio, aun cuando se trate de animales vacunados(9). Las hembras reproductoras son un reservorio que perpetúa la continua circulación de los patógenos respiratorios asociados a NEP(10,11). La gravedad de la enfermedad difiere entre los hatos, y presenta una alta prevalencia en las granjas porcinas convencionales(12). El signo clínico más significativo de la NEP es una tos crónica, seca y no productiva, que se produce en cerdos de engorda entre las 16 y 22 semanas de edad. La lesión macroscópica principal es una consolidación pulmonar craneoventral(5), que se caracteriza histológicamente por una neumonía bronco-intersticial con hiperplasia del tejido linfoide-alveolar (Por sus siglas en inglés: BALT)(13). El principal factor de riesgo para NEP es la transmisión vertical de la cerda al lechón durante la lactancia. Debido a que la vacunación no garantiza la protección(14) y a que M. hyopneumoniae es circulante en animales vacunados(15) y en animales de vida libre como el jabalí, con el que se comparte la vulnerabilidad a M. hyopneumoniae, y puede ser un reservorio(16). La severidad de la enfermedad, al momento del sacrificio, es un predictor de la prevalencia inicial al destete con base en las variables indicativas de infección (promedio de lesiones pulmonares, porcentaje de tejido pulmonar afectado, presencia de M. hyopneumoniae en el epitelio bronquial y seroconversión), ya que entre estas dos variables existe una correlación positiva(17). La mayoría de las infecciones por Mycoplasma permanecen subclínicas(18) y pueden involucrar otras especies del mismo género bacteriano como M. hyorhinis, un habitante comensal de la mucosa del tracto respiratorio superior y de las amígdalas(19). M hyosynoviae, una especie asociada principalmente a artritis aguda y en menor grado a neumonía supurativa con consolidación pulmonar severa y pleuritis(20,21,22). M. hyopneumoniae, M. hyorhinis y M. hyosynoviae son especies de interés porcino genéticamente relacionadas(23), que pueden ser discriminadas por PCR con base en las regiones hipervariables de la subunidad 16S del género(23,24). El objetivo de este trabajo fue el aislamiento e identificación por PCR de M. hyopneumoniae, M. hyorhinis y M. hyosynoviae a partir de hisopos nasales y muestras de cerdos de distintas regiones de la República Mexicana, para determinar la frecuencia de estas especies y evaluar la PCR como herramienta diagnóstica de la neumonía enzoótica porcina. 948


Rev Mex Cienc Pecu 2020;11(4):946-960

Material y métodos Animales y colección de muestras Cerdos de 4 a 8 semanas con diagnóstico de NEP de acuerdo a los signos clínicos y con lesiones gruesas en pulmón (áreas de tejido consolidado de tonos purpura a gris en el lóbulo pulmonar cráneo-ventral) fueron incluidos en este estudio. Se obtuvieron asépticamente 40 muestras de pulmón y 57 hisopos nasales con presión en la pared estructural del tejido(25). La recolección de muestras se realizó en granjas de cuatro regiones de México, de mayo 2015 a enero 2016 (Cuadro 1). Cada muestra se colectó por duplicado para el aislamiento de Mycoplasma y para la bacteriología tradicional. Todos los procedimientos animales fueron aprobados por el Comité Institucional para el Cuidado y Uso de Animales de Experimentación de la Universidad Nacional Autónoma de México (CICUAE), en seguimiento de los estándares éticos internacionales. Cuadro 1: Regiones de procedencia de las muestras de pulmón e hisopos nasales incluidos en este trabajo Muestras 40 pulmones 57 hisopos nasales

Región geográfica México Veracruz Hidalgo Guanajuato

Total

Número de muestras 12 28 25 32 97

Aislamiento de Mycoplasma Para el aislamiento de Mycoplasma, los hisopos nasales se resuspendieron en 2 ml de medio Friis. Las muestras de pulmón se congelaron a -20 °C hasta su seguimiento en el laboratorio. Las muestras de pulmón se procesaron de forma rutinaria por maceración en 3 ml de medio Friis para el aislamiento(18,26,27). De cada muestra macerada, 200 μl de la suspensión en medio Friis se inocularon en 1.8 ml de medio Friis suplementado con suero de cerdo (10 %), suero de caballo (10 %), y penicilina (100 μg/ml) para optimizar la recuperación de M. hyopneumoniae(28), y suplementado con L-arginina (0.05 %) para la recuperación de M. hyosynoviae(29). Posteriormente, se realizaron diluciones seriadas hasta 10−6 y finalmente 10 μl se sembraron en agar Friis(27). Los tubos se incubaron a 37 °C hasta que se observó un cambio de color en el medio, o hasta 30 días, antes de ser descartados. Las muestras positivas fueron aquellas que desarrollaron al menos una unidad de cambio de color, las muestras negativas se consideraron aquellas que después de 30 días no tuvieron cambio de color. Las placas de agar se incubaron a 37 °C con 5 % CO2 durante 1 a 2 949


Rev Mex Cienc Pecu 2020;11(4):946-960

semanas. Cada colonia aislada, posteriormente se inoculó en 2 ml de medio Friis e incubada posteriormente. Tras observar el cambio de color, los cultivos se evaluaron para confirmar su pureza y posterior uso para discriminación de la especie por PCR.

PCR especie-específica para la identificación de Mycoplasma La PCR basada en la subunidad 16S rRNA para la identificación de las tres especies de Mycoplasma fue aplicada a cada uno de los aislamientos. Las cepas de referencia M. hyopneumoniae ATCC 25617, M. hyorhinis ATCC 17981, M. hyosynoviae cepa S-16, y M. bovis Donetta PG45, ambas gentilmente donados por la Universidad de Aarhus, en Aarhus, Dinamarca, se cultivaron en 50 ml de medio, concentradas por centrifugación para la extracción de ADN de acuerdo al protocolo con tiocianato de guanidinio(30). Cada aislamiento fue también procesado para la extracción de ADN y conservado a -70 °C para posterior análisis. La amplificación de la subunidad 16S rRNA se realizó en un volumen de reacción total de 25 µl conteniendo 0.25 µl de Taq PCR Reaction Mix (Sigma-Aldrich, Austria), 10 pmol de cada iniciador sentido y antisentido (Cuadro 2)(24), y 10 µl de ADN(31). Las condiciones de reacción fueron: desnaturalización inicial a 96 °C, por 5 min, seguido de 30 ciclos de desnaturalización a 94 °C por 45 seg, alineación a 72 °C por 2 min, y extensión a 72 °C por 4 min. ADN de cultivos puros de M. hyopneumoniae ATCC 25617, M. hyorhinis ATCC 17981 y M. hyosynoviae cepa S-16 se aplicaron como controles positivos y M. bovis Donetta PG45, como control negativo. Cuadro 2: Iniciadores de PCR basados en 16S rRNA de M. hyopneumoniae, M. hyorhinis y M. hyosynoviae Especie de Mycoplasma M. hyopneumoniae

M. hyorhinis M. hyosynoviae

Producto (bp)

Secuencia (5 -3)

F 5'-TTC AAA GGA GCC TTC AAG CTT C- 1000 3' R 5'-GAC GTC AAA TCA TCA TGC CTC T3' F 5' CGGGATGTAGCAATACATTCAG 3' 1129 R 5' GACGTCAAATCATCATGCCTCT 3' F 5' CAGGGCTCAACCCTGGCTCGC 3' 585 R 5' GACGTCAAATCATCATGCCTCT 3'

950

Referencia 30

30 Este trabajo Gen Bank No de acceso NR029183.1


Rev Mex Cienc Pecu 2020;11(4):946-960

Resultados Aislamiento de Mycoplasma Se colectaron 97 muestras: 40 de pulmón con lesiones típicas de Mycoplasma sugerentes de NEP (Figura 1) y 57 hisopos nasales de porcinos de distintas regiones geográficas de la república mexicana (Cuadro 1). De las muestras de pulmón 22.5 % (9/40) fueron positivas al aislamiento de Mycoplasma spp y 77.5 % (31/40) fueron negativas. De los hisopos nasales 47.36 % (27/57) fueron positivos, y 52.63 % (30/57) fueron negativos. En las muestras positivas, el cambio de color del medio de cultivo, se observó tan temprano como el 5.o día o hasta el 12.o día. En promedio, el cambio de color se observó al 7.o día. Las muestras restantes fueron determinadas negativas después de 30 días sin cambio de color. Figura 1: Lesiones típicas de Mycoplasma en los pulmones recolectados para este estudio

En (A) pulmón con lesión neumónica típica de NEP, distribuida en todos los lóbulos pulmonares, (B) acercamiento a la consolidación pulmonar, (C) Pulmón con mayor grado de consolidación pulmonar, (D) Secuestro pulmonar resultante de la evolución de la lesión, (E) Evidencia de cicatrices en el tejido pulmonar.

951


Rev Mex Cienc Pecu 2020;11(4):946-960

Resultados de PCR Los fragmentos amplificados de 1,000 pb de M. hyopneumoniae, 1,129 pb de M. hyorhinis, y 585 pb de M. hyosynoviae empleando las cepas de referencia (ATCC 25617, ATCC 17981, y M. hyosynoviae cepa S-16), se visualizaron por electroforesis en gel de agarosa al 1.5 % a 80 V por 60 min, teñidos con bromuro de etidio y visualizados en un transiluminador UV, como se muestra en la Figura 2. Los aislamientos de muestras de pulmón (AMP) de Mycoplasma fueron positivas en 22 % (2/9) a M. hyopneumoniae, 55.5 % (5/9) a M. hyorhinis y 44 % (4/9) a M. hyosynoviae. Los AMP negativos a la PCR especie-específica fueron 44 % (4/9). Los aislamientos de hisopo nasal (AHN) fueron positivos en 7.40 % (2/ 27) a M. hyopneumoniae, en 51.85 % (14/27) a M. hyorhinis y en 33.3 % (9/27) a M. hyosynoviae. Los AHN negativos a la PCR especie-específica fueron 22.22 % (6/27) (Cuadro 3). A pesar de obtenerse el aislamiento, cuatro AMP y seis AHN no fueron identificados con la PCR especie-específica. Figura 2: Perfiles electroforéticos de los fragmentos amplificados de M. hyopneumoniae, M. hyorhinis 16S rRNA

Carril 1, Marcador de peso molecular (1 Kb plus Invitrogen), Carril 2, M. hyopneumoniae ATCC 25617, 1000 pb; Carril 3. M. bovis Donetta PG45, donada por la Universidad de Aarhus, Dinamarca, Carril 4, M. hyorhinis, ATCC17981, 585 pb, Carril 6, Producto no relacionado a este trabajo de 685 pb de p97 de M. hyopneumoniae, ATCC25617, Carril 7, M. hyosynoviae, cepa S-16, 1129 pb, también donada por la Universidad de Aarhus, Dinamarca, Carril 8, Marcador de peso molecular (1 Kb plus Invitrogen). 952


Rev Mex Cienc Pecu 2020;11(4):946-960

Cuadro 3: Relación de aislados identificados por PCR especie-específica para M. hyopneumoniae, M. hyorhinis, y M hyosynoviae Aislamiento positivo (%) M. M. hyopneumoniae hyorhinis 2/9 (22.0) 5/9 (55.5) 2/27 (7.4) 14/27 (51.8) 4/36 (11.1) 19/36 (52.7)

Muestra Pulmón Hisopo nasal Total

M. hyosynoviae 4/9 (44.0) 9/27 (33.3) 13/36 (36.1)

Mycoplasma spp 4/9 (44.0) 6/27 (22.2) 10/36 (27.7)

La coexistencia de M. hyopneumoniae, M. hyorhinis y M hyosynoviae se detectó en diez muestras que representan el 27.77 % (10/36): en dos pulmones las tres especies, en otros dos pulmones y cinco hisopos nasales se identificó a M. hyorhinis y M. hyosynoviae, y solo un hisopo contenía M. hyopneumoniae y M. hyorhinis (Cuadro complementario 1). Adicionalmente, los géneros bacterianos asociados identificados por bacteriología general en hisopos nasales fueron E. coli, Enterobacter, Staphylococcus coagulasa-negativos, Klebsiella, Bordetella, Corynebacterium, Pasteurella, Shigella y Streptococcus. En muestras de pulmón, no se identificó crecimiento bacteriano. Cuadro suplementario 1: Identificación de los aislamientos de Mycoplasma por PCR especie-específico Número Descripción

Tipo de M. muestra* hyop

M. hyor

M. hyos

1 2 3 4 5 6

111 112 113 114 115 116

HN HN HN HN HN HN

-

+ + + +

+ + -

7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

117 118 119 120 121 122 123 124 125 126 127 130 133 148 159

HN HN HN HN HN HN HN HN HN HN HN HN HN HN HN

+ +

+ + + + + + +

+ + + + -

953

Géneros bacterianos SCN E. coli , Shigella Pasteurella Klebsiella, SCN Klebsiella, E. coli, SCN E. coli, SCN, Bordetella, Corynebacterium SCN, Corynebacterium SCN, Corynebacterium Enterobacter Corynebacterium Klebsiella, SCN Corynebacterium Klebsiella, SCN SCN Corynebacterium Corynebacterium Klebsiella, Corynebacterium SCN E. coli SCN Sin crecimiento bacteriano


Rev Mex Cienc Pecu 2020;11(4):946-960

22 160 HN + SCN 23 161 HN + Pasteurella 24 162 HN + + E. coli, SCN 25 165 HN + Streptococcus, SCN 26 168 HN + E. coli 27 170 HN + + SCN 28 182 P + + Sin crecimiento bacteriano 29 183 P + + Sin crecimiento bacteriano 30 186 P Sin crecimiento bacteriano 31 188 P Sin crecimiento bacteriano 32 194 P + + + Sin crecimiento bacteriano 33 206 P + + + Sin crecimiento bacteriano 34 207 P + Sin crecimiento bacteriano 35 208 P Sin crecimiento bacteriano 36 210 P Sin crecimiento bacteriano M. hyop= M. hyopneumoniae; M. hyor= M. hyorhinis; M. hyos= M. hyosynoviae; *HN= hisopo nasal, P= pulmón, SCN= Staphylococcus coagulasa-negativos.

Discusión En México hay pocos estudios sobre la asociación de estas tres especies de Mycoplasma a NEP, principalmente por las dificultades del aislamiento y las inherentes a la muestra biológica. La concentración de microorganismos frecuentemente está por debajo del límite de detección como consecuencia del uso generalizado de antibióticos para el control de la micoplasmosis porcina. Por lo tanto, los procedimientos de aislamiento son necesarios para favorecer su crecimiento e identificación para fines de investigación y vigilancia. El procedimiento utilizado permitió identificar la asociación de las tres especies relacionadas con la producción porcina. M. hyopneumoniae es la especie de Mycoplasma más frecuentemente aislada de cerdos con signos clínicos de neumonía y tiene una baja tasa de transmisión. Sin embargo, en asociación es capaz de aumentar la gravedad de las infecciones causadas por virus y bacterias(32). M. hyorhinis ha pasado de ser un patógeno secundario(33,34), a ser considerado agente causal de NEP y CREP(35). En este estudio, esta especie de Mycoplasma es la más prevalente en los hisopos nasales 51.85 % (14/57). Esta observación puede ser explicada por el éxito de las medidas de control que se han implementado en las granjas de producción porcina. Aquí se reporta que M. hyosynoviae está en estrecha interacción con las otras dos especies de Mycoplasma en pulmones con lesiones típicas de NEP. M. hyosynoviae se presentó en los hisopos nasales como un microorganismo asociado en alto porcentaje 33 % (9/27). Por lo que este Mycoplasma comensal podría tener potencial patógeno y se requerirán estudios adicionales para evaluar su papel en el desarrollo de la NEP. 954


Rev Mex Cienc Pecu 2020;11(4):946-960

El cultivo bacteriológico es el “estándar de oro” para el diagnóstico. Entre sus desventajas están el ser muy laborioso, rara vez usado como método de rutina, y no distingue entre las especies asociadas a la NEP. La PCR basada en la subunidad 16S rRNA permitió discernir entre M. hyopneumoniae y M. hyorhinis con precisión y rapidez. Por otro lado, se identificaron 10 casos, en los que las especies evaluadas en este trabajo, no estuvieron involucradas. Este resultado plantea la posibilidad de que otras especies de Mycoplasma pueden estar involucradas. El método de colección (hisopo nasal, moco traqueobronquial, hisopado profundo postmortem, lavado broncoalveolar o tejido pulmonar) tiene un efecto significativo en la frecuencia de M. hyopneumoniae, ya que la frecuencia reportada varía de acuerdo al método del 3 al 40 %(36). Previamente en lechones, los hisopos nasales han sido el método de recolección de muestras antemortem a nivel de hato(28,37). Pieters et al(38) sugieren que los hisopos laríngeos son útiles en la etapa temprana de la infección en lechones. Otros autores afirman que el sitio de muestreo óptimo para la detección por métodos moleculares para M. hyopneumoniae es la colección de moco traqueobronquial (CMTB), ya que su sensibilidad es 3.5 veces más sensible en lechones de menos de 25 días(36). El tracto respiratorio superior (cavidad nasal y faringe) desempeña un papel importante en el monitoreo y limpieza de microrganismos patógenos y también en la inducción de la respuesta inmune apropiada. M. hyopneumoniae coloniza principalmente los cilios del tracto respiratorio del cerdo(39). En animales adultos de granjas de producción, el CMTB se vuelve difícil y costoso de obtener. El manejo de animales es restringido en concordancia con las medidas vigentes para la prevención de la influenza porcina y de acuerdo a nuestra experiencia, recomendamos el uso de hisopos nasales como la técnica de muestreo adecuada. La prevalencia de M. hyopneumoniae en cerdas infectadas naturalmente es de 36.4 %(40), en lechones puede variar de 3.6 a 16 %. La frecuencia aquí determinada de Mycoplasma fue mayor a la esperada 37.11 % (36/97): La presencia de Mycoplasma en pulmón fue de 22.50 % (9/40) y en hisopos nasales 47.36 % (27/57). La infección por una sola especie de Mycoplasma fue 44.44 % (16/36): en AMP 11.11 % (1/9) y en AHN 55.55 % (15/27). La asociación de más de una especie de Mycoplasma estuvo presente en el 27.77 % (10/36): la asociación de las tres especies representó el 2 % (2/10), y la asociación de M. hyorhinis y M. hyosynoviae el 5.15 % (5/10). La co-infección de M. hyopneumoniae y M. hyorhinis, y la de M. hyosynoviae y M. hyorhinis han sido previamente asociadas con problemas articulares. En este trabajo se identificaron ambas asociaciones en el tracto respiratorio de animales en las granjas porcinas con NEP.

955


Rev Mex Cienc Pecu 2020;11(4):946-960

La tasa de Mycoplasma asociados a NEP es variable, independientemente de que la tasa de infecciones mixtas permanezca constante(35). En este estudio, los géneros bacterianos asociados en infecciones mixtas fueron similares a los previamente reportados(41). La PCR puede ser complemento o alternativa al diagnóstico histopatológico, y representa una opción para la vigilancia epidemiológica e investigación. Además de que puede asistir en la eliminación de Mycoplasma spp de las granjas de producción porcina, ya que hasta el momento es la mejor estrategia de control a largo plazo, para muchos productores porcinos y proveedores de pie de cría(42).

Conclusiones e implicaciones La frecuencia de Mycoplasma en granjas porcinas en los estados de Hidalgo, Guanajuato, Veracruz y México fue mayor a la esperada (40.27 %). Existen otras especies de Mycoplasma que pueden estar involucradas en el desarrollo de NEP y este trabajo agrega evidencia de M. hyorhinis como agente causal de NEP.

Agradecimientos Este trabajo fue financiado dentro del Proyecto DGAPA UNAM PAPITT IN 222515.

Literatura citada: 1. Hansen MS, Pors SE, Jensen HE, Bille-Hansen V, Bisgaard M, Flachs EM, et al. An investigation of the pathology and pathogens associated with porcine respiratory disease complex in Denmark. J Comp Pathol 2010;143(2-3):120-131. 2. Sibila M, Pieters M, Molitor T, Maes D, Haesebrouck F, Segales J. Current perspectives on the diagnosis and epidemiology of Mycoplasma hyopneumoniae infection. Vet J 2009;181(3):221-231. 3. Maes D, Segales J, Meyns T, Sibila M, Pieters M, Haesebrouck F. Control of Mycoplasma hyopneumoniae infections in pigs. Vet Microbiol 2008;126(4):297-309. 4. Seymour LM, Deutscher AT, Jenkins C, Kuit TA, Falconer L, Minion FC, et al. A processed multidomain Mycoplasma hyopneumoniae adhesin binds fibronectin, plasminogen, and swine respiratory cilia. J Biol Chem 2010;285(44):33971-33978. 5. Thacker EL, Minnion FC. Mycoplasmosis. In. Zimmerman JJ, Karriker LA, Ramirez A, Schwartz KJ, Stevenson GW, editors. Diseases of Swine. USA; Wiley-Blackwell; 2012:779-797. 956


Rev Mex Cienc Pecu 2020;11(4):946-960

6. Shen Y, Hu W, Wei Y, Feng Z, Yang Q. Effects of Mycoplasma hyopneumoniae on porcine nasal cavity dendritic cells. Vet Microbiol 2017;198:1-8. 7. Pointon AM, Byrt D, Heap P. Effect of enzootic pneumonia of pigs on growth performance. Aust Vet J 1985;62(1):13-18. 8. Ross RF, Mycoplasmal diseases. In: Leman AD, Straw B, Mengeling W, D’Allaire S, Taylor D, editors. Diseases of swine,7 th ed. Ames, Iowa, USA: Iowa State University Press; 1992:537-551. 9. Sibila M, Nofrarias M, López-Soria S, Segalés J, Valero O, Espinal A, et al. Chronological study of Mycoplasma hyopneumoniae infection, seroconversion and associated lung lesions in vaccinated and non-vaccinated pigs. Vet Microbiol 2007;122(1-2):97-107. 10. Fablet C, Marois C, Kuntz-Simon G, Rose N, Dorenlor V, Eono F, et al. Longitudinal study of respiratory infection patterns of breeding sows in five farrow-to-finish herds. Vet Microbiol 2011;147:329-339. 11. Takeuti K, De Barcellos D, de Lara A, Kunrath C, Pieters M. Detection of Mycoplasma hyopneumoniae in naturally infected gilts over time. Vet Microbiol 2007;203:215-220. 12. Sibila M, Calsamiglia M, Vidal D, Badiella L, Aldaz A, Jensen JC. Dynamics of Mycoplasma hyopneumoniae infection in 12 farms with different production systems. Can J Vet Res 2004;68(1):12-18. 13. Caswell JL, Williams K. The respiratory system. In: Maxie MG et al. editors. Jubb, Kennedy, and Palmer’s Pathology of Domestic Animals, 5th ed. Edinburgh, UK: Elsevier; 2007:523-655. 14. Meyns T, Dewulf J, de Kruif A, Calus D, Haesebrouck F, Maes D. Comparison of transmission of Mycoplasma hyopneumoniae in vaccinated and non-vaccinated populations. Vaccine 2006:24(49-50):7081-7086. 15. Maes D, Deluyker H, Verdonck M, Castryck F, Miry C, Vrijens B, et al. Effect of vaccination against Mycoplasma hyopneumoniae in pig herds with an all-in/all-out production system. Vaccine 1999;17(9):1024-1034. 16. Sibila M, Mentaberre G, Boadella M, Huerta E, Casas-Díaz E, Vicente J, et al. Serological, pathological and polymerase chain reaction studies on Mycoplasma hyopneumoniae infection in the wild boar. Vet Miocrobiol 2010;144(1-2):214-218. 17. Fano E, Pijoan C, Dee S, Deen J. Effect of Mycoplasma hyopneumoniae colonization at weaning on the disease severity in growing pigs. Can J Vet Res 2007;71(3):195-200. 957


Rev Mex Cienc Pecu 2020;11(4):946-960

18. Friis FN. A selective medium for Mycoplasma suipneumoniae. Acta Vet Scand 1971;12(3):454-466. 19. MarĂŠ CJ, Switzer WP. Virus pneumonia of pigs: propagation and characterization of a causative agent. Am J Vet Res 1966;27(121):1687-1693. 20. Ross R, Hill M, Wood RL. Swine Arthritis. Pork Industry Handbook. Herd Health. USA, Michigan State University Cooperative Extension Service; 2003:1-4. 21. Hagedorn-Olsen T, Nielsen NC, Friis NF. Induction of arthritis with Mycoplasma hyosynoviae in pigs: Clinical response and re-isolation of the organism from body fluids and organs. Zentralbl Veterinarmed A 1999;46(6):317-325. 22. Dahlia H, Tan LJ, Zarrahimah Z, Maria J. Isolation of Mycoplasma hyosynoviae from pneumonic lung of swine. Trop Biomed 2009;26(3):341-345. 23. Stemke GM, Laigret F, Grau O, Bove JM. Phylogenetic relationships of three porcine mycoplasmas; Mycoplasma hyopneumoniae, Mycoplasma flocculare, and Mycoplasma hyorhinis, and complete 16S rRNA sequence of M. flocculare. Int J Syst Bacteriol 1992;42(2):220-225. 24. Stakenborg T, Vicca J, Butaye P, Imberechts H, Peeters J, De Kruif A, et al. A Multiplex PCR to identify porcine Mycoplasmas present in broth cultures. Vet Res Comm 2006;30(3):239-247. 25. Pieters M, Pijoan C, Fano E, Dee S. An assessment of the duration of Mycoplasma hyopneumoniae infection in an experimentally infected population of pigs. Vet Microbiol 2009;134(3-4):261-266. 26. Cook BS, Beddow JG, Manso-SilvĂĄn L, Maglennon GA, Rycroft AN. Selective medium for culture of Mycoplasma hyopneumoniae. Vet Microbiol 2016;195:158-164. 27. Friis NF. Some recommendations concerning primary isolation of Mycoplasma suipneumoniae and Mycoplasma flocculare a survey. Nord Vet Med 1975;27(6):337339. 28. Marois C, Le Carrou J, Kobisch M, Gautier-Bouchardon AV. Isolation of Mycoplasma hyopneumoniae from different sampling sites in experimentally infected and contact SFP piglets. Vet Microbiol 2007;120(1-2):96-104. 29. Kobisch M, Friis NF. Swine Mycoplasmoses. Rev Sci Tech Off Int Epiz 1996;15(4):1569-1605.

958


Rev Mex Cienc Pecu 2020;11(4):946-960

30. Nelson JE, Krawetz SA. Purification of cloned and genomic DNA by guanidine thiocyanate/isobutyl alcohol fractionation. Ann Biochem 1992;207(1):197-201. 31. Nathues H, Beilage E, Kreienbrock L, Rosengarten R, Spergser J. RAPD and VNTR analyses demonstrate genotypic heterogeneity of Mycoplasma hyopneumoniae isolates from pigs housed in a region with high pig density. Vet Microbiol 2011;152(3-4):338345. 32. Opriessnig T, Thacker EL, Yu S, Fenaux M, Meng XJ, Halbur PG. Experimental reproduction of postweaning multisystemic wasting syndrome in pigs by dual infection with Mycoplasma hyopneumoniae and porcine circovirus type 2. Vet Pathol 2004;41(6):624-640. 33. Charlebois A, Marois-CrĂŠhan C, HĂŠlie P, Gagnon CA, Gottschalk M, Archambault M. Genetic diversity of Mycoplasma hyopneumoniae isolates of abattoir pigs. Vet Microbiol 2014;168(2-4):348-356. 34. Kawsashima K, Yamada S, Kobayashi H, Narita M. Detection of porcine reproductive and respiratory syndrome virus and Mycoplasma hyorhinis antigens in pulmonary lesions of pigs suffering from respiratory distress. J Comp Pathol 1996;114(3):315323. 35. Lin J, Chen S, Yeh K, Weng C. Mycoplasma hyorhinis in Taiwan: Diagnosis and isolation of swine pneumonia pathogen. Vet Microbiol 2006;115(1-3):111-116. 36. Vangroenweghe F, Karriker L, Main R, Christianson E, Marsteller T, Hammen K, et al. Assessment of litter prevalence of Mycoplasma hyopneumoniae in preweaned piglets utilizing an antemortem tracheobronchial mucus collection technique and a real-time polymerase chain reaction assay. J Vet Diagn Invest 2015;27(5):606-610. 37. Kurth KT, Hsu T, Snook ER, Thacker EL, Thacker BJ, Minion FC. Use of a Mycoplasma hyopneumoniae nested polymerase chain reaction test to determine the optimal sampling sites in swine. J Vet Diagn Invest 2002;14(6):463-469. 38. Pieters M, Daniels J, Rovira A. Comparison of sample types and diagnostic methods for in vivo detection of Mycoplasma hyopneumoniae during early stages of infection. Vet Microbiol 2017;203:103-109. 39. Maes D, Verdonck M, Deluyker H, de Kruif A. Enzootic pneumonia in pigs. Vet Q 1996;18(3):104-109.

959


Rev Mex Cienc Pecu 2020;11(4):946-960

40. Takeuti KL, de Barcellos DESN, de Lara AC, Kunrath CF, Pieters M. Detection of Mycoplasma hyopneumoniae in naturally infected gilts over time. Vet Microbiol 2017;203:215-220. 41. Siquiera FM, PĂŠrez-Wohlfeil E, Carvalho FM, Trelles O, Schrank IS, Vasconcelos ATR, et al. Microbiome overview in swine lungs. PLosONE 2017;12(7):e0181503. 42. Holst S, Yeske P, Pieters M. Elimination of Mycoplasma hyopneumoniae from breedto-wean farms: a review of current protocols with emphasis on herd closure and medication. J Swine Health Prod 2015;23(6):321-230.

960


https://doi.org/10.22319/rmcp.v11i4.5182 Artículo

Presencia de Hymenolepis nana y diminuta en roedores de la ciudadela las Piñas, Milagro-Ecuador y su riesgo en salud pública

Roberto Darwin Coello-Peralta a Galo Ernesto Martínez-Cepeda a* Douglas Pinela-Castro a Enrique Omar Reyes-Echeverria a Enrique Xavier Rodríguez-Burnham a Maria de Lourdes Salazar Mazamba a Betty Pazmiño-Gómez b Antonella Ramírez-Tigrero a Manuel Bernstein a Pedro Cedeño-Reyes a

a

Universidad de Guayaquil. Facultad de Medicina Veterinaria y Zootecnia. Km 27 ½ vía a Daule, Guayaquil, Ecuador. b

Universidad Estatal de Milagro. Facultad Ciencias de la Salud, Milagro, Ecuador.

*Autor de correspondencia: galomartinez88@gmail.com

Resumen: La Hymenolepidiosis es una zoonosis de prevalencia mundial, sobre todo en niños, es causada por cestodos de roedores denominados Hymenolepis (H) nana e Hymenolepis diminuta, es muy frecuente en países en vías de desarrollo, con climas cálidos, templados y secos. El ciclo biológico de la H. nana no requiere de hospederos intermediarios, y su transmisión habitual es fecal-oral (por ingesta de huevos infectivos); y la infección de H. diminuta se da a través de la ingestión de artrópodos tenebriónidos con la forma larvaria cisticercoides. El objetivo de este estudio fue determinar la presencia de H. nana e H.

961


Rev Mex Cienc Pecu 2020;11(4):961-970

diminuta en la ciudadela Las Piñas, de la ciudad de Milagro (Ecuador) y dar a conocer a través de charlas informativas el riesgo en salud pública; para esta investigación se capturaron roedores con ayuda de trampas Tomahawk y Sherman en complementariedad con cebos no tóxicos (carne, mortadela, pescado, pan). Mediante un estudio aplicado, con enfoque cualitativo, de tipo descriptivo-prospectivo-transversal, realizado entre el 1 de febrero al 30 de julio del 2018, se analizaron las muestras fecales por métodos directos y de flotación-centrifugación con solución salina sobresaturada. De 87 roedores capturados y procesados, 20 casos (22.99 %) se determinó para Hymenolepis nana y 10 casos (11.49 %) para H. diminuta. Constituyéndose en el primer reporte de Hymenolepis nana y diminuta en roedores en el país. Se concluye que es evidente la presencia de estos parásitos en el sitio de estudio, lo que podría convertirse en un serio problema de salud pública, por el riesgo de transmitirse a los habitantes del sector. Palabras clave: Trampeo, Métodos coproparasitarios, Parasitismo en roedores, Salud pública.

Recibido: 05/12/2018 Aceptado: 03/09/2019

Introducción Los agentes infecciosos transmitidos de animales a humanos representan la mayoría de los brotes de nuevos patógenos en todo el mundo(1), con más de mil millones de casos de enfermedades humanas atribuibles a enfermedades zoonóticas cada año, por lo cual, la identificación de reservorios silvestres de patógenos zoonóticos es una prioridad en Salud Pública(2). En el caso de Rattus norvegicus (rata marrón) y Rattus rattus (rata negra) son reservorios conocidos de bacterias, virus y parásitos zoonóticos de importancia Veterinaria(3,4). Las helmintosis afectan al 20% de la población latinoamericana y se consideran enfermedades desatendidas, que infectan aproximadamente a 3,800 millones de personas en todo el mundo(5). Estas infecciones son frecuentes en poblaciones rurales y en zonas superpobladas, sobre todo en países en clima tropical y subtropical, asociadas con la pobreza y marginación y no reciben la debida atención nacional e internacional(6,7). Entre los factores sociales determinantes de dichas enfermedades incluyen deficientes condiciones de vivienda (sin techos, paredes o pisos adecuados), la falta de acceso a agua potable y segura, saneamiento básico e higiene, los bajos ingresos, la educación deficiente y las barreras de acceso a los servicios de salud en general y, en especial, a la atención primaria en salud(7,8). La Himenolepiasis es una parasitosis de prevalencia mundial causada por cestodos del género Hymenolepis y Rodentolepis (Hymenolepipidae: Cyclophyllidea). Los ciclos de 962


Rev Mex Cienc Pecu 2020;11(4):961-970

vida de estos parásitos implican humanos, ratas y ratones como huéspedes definitivos, y artrópodos (Tenebriónidos) como huéspedes intermedios. La presencia de tenebriónidos en las viviendas y condiciones de insalubridad generadas por la falta de servicios básicos, factores ambientales y socio-económicos, los cuales componen un factor predisponente para el desarrollo de la enfermedad en áreas cálidas y húmedas; causando mayores afectaciones a la población infantil(9,10). Las ratas y ratones actúan como hospedadores definitivos de Hymenolepis y su ocurrencia de esta parasitosis en humanos es habitualmente transmitido por vía fecal-oral por ingesta de huevo (H. nana); sin embargo, ocasionalmente también puede transmitirse por ingestión de un artrópodo para completar su ciclo de vida (H. diminuta)(11,12). Se estima que 20 millones de personas en el mundo están parasitadas con estos dos parásitos(13). Sin embargo, ambas parasitosis comparten algunas características epidemiológicas, tales como prevalencia en niños de áreas marginadas con malos hábitos de higiene, condiciones sanitarias y hacinamiento(12). Ecuador es un país con gran variedad de climas con cuatro regiones delimitadas: costa, sierra, oriente y región insular. La ciudadela “Las Piñas”, se encuentra localizada en la costa ecuatoriana, se caracteriza por tener un clima tropical además de altos porcentajes de humedad debido a los ríos y planicies que posee. La ciudadela mencionada posee un sector urbano marginal con 2,500 viviendas, en donde se encuentra: casas desocupadas, sembríos de caña, cacao, banano y pastizales; además, se encuentran zanjas, pozos sépticos; por otra parte, no posee alcantarillado, pocos hogares poseen agua potable, por lo consiguiente, reúne las condiciones necesarias para contar con la presencia de roedores que representan un riesgo sanitario(14). Además, en el país no se ha reportado la presencia de Hymenolepis nana y diminuta en roedores, por lo cual, es necesario dar a conocer casos de estas parasitosis, ya que son potenciales fuentes de parásitos, que podrían conllevar a problemas de salud pública por su transmisión a los humanos. Por otra parte, el objeto de este estudio es informar a las autoridades de salud pública y profesionales de la salud sobre casos de Hymenolepidiasis en roedores, además de informar a la población y guiarlos en los esfuerzos de prevención.

Material y métodos Área y tiempo de estudio El estudio se realizó en la ciudadela urbano-marginal llamada “Las Piñas”, ubicada en la parte norte del cantón Milagro, provincia del Guayas, en la costa ecuatoriana, sus coordenadas geográficas son 2° 7' 0" S y 79° 36' 0" O. La comunidad “Las Piñas” posee 12,000 habitantes, cuenta con un clima tropical-húmedo, con marcada diferencia entre el invierno y verano, con temperaturas que fluctúan entre los 22 a 36 °C(14,15).

963


Rev Mex Cienc Pecu 2020;11(4):961-970

Encuesta Se visitó cada uno de los hogares seleccionados, se explicó sobre el estudio y el riesgo que tienen las parasitosis en su entorno, luego de su consentimiento, y asentimiento firmado (para menores), se aplicó una encuesta dirigida, y posterior se entregó un frasco estéril por cada persona. La encuesta presentó las siguientes preguntas: ¿Conoce sobre la hymenolepidiasis? ¿Cuál es el origen del agua de consumo?, ¿Cuál es el manejo de excretas dentro del hogar?, ¿Existe la presencia de roedores intra y peridomiciliarios?, ¿Tiene depósitos de alimentos farináceos (arroz, maíz, cebada, etc)?, ¿Hay presencia de Tenebriónidos (escarabajos, pulgas, gorgojos, etc) en los depósitos de alimentos farináceos? y ¿ Tiene alcantarillado?.

Muestreo Previamente a realizar el estudio se solicitó el respectivo permiso a las autoridades de la Facultad de Medicina Veterinaria y Zootecnia (FMVZ) de la Universidad de Guayaquil para que acceda a dar el permiso respectivo para realizar el estudio en el laboratorio de Microbiología de la FMVZ; también, contó con el permiso y colaboración del Comité Pro mejoras “Nuevos Horizontes de Las Piñas”. Por otro lado, la metodología de la investigación fue analizada y aprobada por la Coordinación de Investigación de la FMVZ. Se realizó un estudio descriptivo, transversal y prospectivo, entre el 1 de febrero al 31 de julio del 2018; se investigaron 70 viviendas con una población total de 320 personas, entre invierno y verano, con temperatura aproximada de 27 a 32 °C. Durante la investigación se muestrearon 87 roedores, provenientes de tres áreas seleccionadas 1) roedores en casas habitadas, solares baldíos, zanjas, y basureros, 2) zanjas y basureros, y 3) Unidad Policial Comunitaria (UPC), zanjas, basureros y solares baldíos. Es importante mencionar que todas las áreas investigadas registraron concentraciones de basura. Por otra parte, se realizó la encuesta a 90 personas del sector, dividido en 30 por cada sector ya mencionado.

Captura de roedores Se realizaron capturas de roedores con ayuda de trampas, Tomahawk y Sherman, y de cebos no tóxicos (carne, mortadela, pescado, pan) tomando medidas de bioseguridad recomendadas. Estas trampas se colocaron de forma estratégica en “Las Piñas” la cual es una ciudadela urbanomarginal, la cual posee lugares con riesgo como: botaderos de basuras, zanjas, pastizales, y en las casas de ciertos colaboradores de la comunidad que aseguran tener roedores(16). Aquellos roedores capturados vivos fueron sacrificados con cloroformo puro empapado en algodón para la eutanasia; cuyo método es el sugerido por el CICUAL de la Facultad 964


Rev Mex Cienc Pecu 2020;11(4):961-970

de Medicina Veterinaria y Zootecnia de la Universidad de Guayaquil, además se roció fipronil al 0.15% antes de proceder con la necropsia, como norma de bioseguridad para los profesionales que la realizaron. Una vez capturados los animales se transportaron vivos hasta el laboratorio de Microbiología de la FMVZ de la Universidad de Guayaquil, donde se realizó la necropsia del animal y se extrajo la muestra para posteriormente ser analizado mediante las técnicas reportadas por Aluja y Constantino(17,18).

Análisis de laboratorio Las muestras se analizaron por los métodos directos y sedimentación con solución salina saturada(17,19), luego se examinaron al microscopio óptico usando objetivos de 10X y 40X. Los parámetros a seguir durante la necropsia para la extirpación del aparato gastrointestinal de los roedores fueron los reportados por de Aluja y Constantino(18). Además se realizó la técnica cualitativa de Travassos, con el fin de obtener parásitos adultos(18,20). Se revisaron las mucosas de los órganos ya lavados para detectar helmintos adultos o juveniles adheridos a la mucosa o por debajo de ella.

Resultados Después del armado y cebado de las trampas en los diferentes sitios de estudio, se esperó por un lapso de 12 h, posteriormente al tiempo indicado, se realizó la revisión de las trampas, procediendo a identificar taxonómicamente las especies de roedores(16,17), encontrando un total 87 roedores capturados (40 roedores Rattus rattus y 47 roedores Rattus norvegicus) y analizados, de los cuales 20 (22.99 %) resultaron positivos para H. nana y 10 (11.49 %) fueron positivos para H. diminuta, mediante el método coproparasitario directo y sedimentación con solución salina saturada. Además, se logró identificar la distribución del parásito en las especies de roedores estudiados; H. nana 12 (100 %) y H. diminuta (0 %) en Rathus rathus, mientras que H. diminuta 10 (55.5 %) y H. nana 8 (44.5 %) en Rathus norvegicus. En todas las áreas estudiadas se encontraron casos de Hymenolepis nana y diminuta. En el área 1, hubo un total de 4 casos de H. nana y 2 casos para H. diminuta. En el área 2, se presentaron 7 casos de H. nana y 3 casos para H. diminuta. En el área 3, se determinó un total de 9 casos de H. nana y 5 casos para H. diminuta (Cuadro 1).

965


Rev Mex Cienc Pecu 2020;11(4):961-970

Cuadro 1: Total de los parásitos por área Área 1 (%)

Área 2 (%)

Área 3 (%)

Total

%

Hymenolepis nana

4 (4.59)

7 (8.04)

9(10.34)

20

22.97

Hymenolepis diminuta

2 (2.29)

3 (3.44)

5(5.74)

10

11.47

Además, se encuestaron 90 personas con preguntas sobre el riesgo de transmisión de enfermedades de roedores a humanos, en donde, todos manifestaron desconocer sobre Hymenolepidiasis; 60 personas (66.67 %) manifestaron consumir agua de bidones y 30 (33.33 %) mencionaron comprar agua de tanqueros. Todas las personas encuestadas manifestaron descartar sus excretas por pozo séptico. Para el caso de las excretas de los roedores, los encuestados indicaron suponer que caían al suelo. Según la presencia de roedores intra y peridomiciliarios, 32 personas (35.55 %) manifestaron ver roedores intradomiciliarios; 48 personas (53.33 %) manifestaron ver roedores peridomiciliarios; 10 personas (11.11 %) manifestaron no ver roedores dentro y fuera de sus casas. Por otro lado, solo 17 personas (18.88 %) declararon tener en sus casas depósitos de alimentos farináceos. Así mismo, 13 personas (14.44 %) indicaron ver Tenebriónidos en sus depósitos de alimentos farináceos localizados en sus hogares. Respecto a la situación sanitaria, 70 personas encuestadas (77.78 %) mencionaron no poseer agua potable y el 100 % de los encuestados manifestaron no contar con alcantarillado. En relación a los sitios de captura, en el área 1, se determinaron casos de parásitos intestinales en roedores que rondaban áreas como: casas habitadas, solares baldíos, zanjas y basureros. En el área 2, se determinaron parásitos intestinales en roedores que merodeaban en: zanjas y basureros. En el área 3, se determinaron casos de parásitos intestinales en roedores de alrededores de la Unidad Policial Comunitaria (UPC), zanja, basurero y solares baldíos. Para el cálculo de casas afectadas por la presencia cercana de roedores se utilizó un radio de acción de 40 a 50 m. para la especie Rattus rattus y de 30 a 45 m para Rattus novergicus respectivamente(21). Dentro del estudio de impacto en la población, se logró evidenciar en el área 1 que los casos de roedores positivos tenían dentro de su perímetro de afectación un promedio de 10 a 18 casas, lo cual sugiere un perjuicio directo de 10 a 18 familias respectivamente. En el área 2. Las trampas donde se encontraron roedores positivos tomando el radio de acción comprometían entre 15 a 18 casas. En el área 3, las trampas donde se encontraron roedores positivos tomando el radio de acción comprometían entre 10 a 25 casas.

966


Rev Mex Cienc Pecu 2020;11(4):961-970

Discusión La prevalencia de Hymenolepis nana encontrada del 22.99 %, es mayor que la determinada en Costa Rica (0.97 %)(22); en Cuba (2.56 %)(23); en Perú (6.8 %)(17); en Brasil (8.8 %)(24); en Argentina (8.2 %)(19). Así mismo, se determinan prevalencias bajas de H. nana en países de otros continentes como: en Irán el 2.5 %(25), entre el 3.3 al 10.3 % en China; en Países bajos entre el 3.3 % al 4.1 %(26); pero se ha registrado prevalencias mayores en Taiwán 21.8 %(26), Brasil 35.7 %(27) e Italia 100 %(26). Cabe destacar que la región costera de Ecuador es una zona donde existe una temperatura ambiental alta y constante durante todo el año, debido a la presencia de dos estaciones anuales (inviernoverano), las cuales se caracterizan por el alto grado de humedad y presencia de lluvias moderadas a torrenciales en la primera estación, y escasez de lluvias y altas temperaturas ambientales respectivamente. El 10.64 % de Himenolepis diminuta determinada es menor que la expresada en Cuba con el 11.5 %(23), en Argentina con el 12.2 %(19), en Perú entre el 25.7 y el 43.8 %(28) y en Costa Rica con el 43.68 %(22). También, se determinó prevalencias bajas de H. diminuta en países de otros continentes como: Taiwán con 6.3 %(26) e Irán con 1.7 %(25), en contraste con prevalencias por encima de la encontrada (10.64 %) en países como China (27.8 %)(26), Irán (38.8 %)(25), Países bajos (10.2 a 50 %), Serbia (30.5 %) e India (62.5 %)(26). Es de notable relevancia que en todas las áreas estudiadas se encontraron casos de H. diminuta y H. nana, parásitos zoonóticos, que en el caso de las personas encuestadas manifestaron desconocer sobre la enfermedad que producen. Por otro lado, el 33.33 % mencionaron comprar agua de tanqueros, todas las personas manifestaron descartar sus excretas por pozo séptico, el 35.56 % manifestaron ver roedores intradomiciliarios y el 53.33 % manifestaron ver roedores peridomiciliarios. Así mismo, el 18.88 % mencionaron tener en sus casas depósitos de alimentos farináceos que son principal fuente de Tenebriónidos, que son hospederos intermediarios de la H. diminuta(29), lo que podría conllevar a la aparición de casos en humanos, sobre todo en la época invernal cuando el número de vectores aumenta(25). El 77.78 % de los encuestados mencionaron no poseer agua potable, y también todos los encuestados manifestaron no contar con alcantarillado, lo cual es un riesgo potencial para el incremento de roedores frente al presente incremento de la población(21), a su vez, estos últimos mencionados son indicadores importantes de parasitosis desatendidas en poblaciones vulnerables(7,30). Finalmente, se determinaron casos de parásitos intestinales en roedores de casas habitadas, zanjas, basureros, solares y terrenos baldíos que son sitios en donde hay mayor proliferación de estos mamíferos(21).

967


Rev Mex Cienc Pecu 2020;11(4):961-970

Conclusiones e implicaciones Este estudio determinó la presencia de H. diminuta y H. nana en heces de roedores de la ciudadela “Las Piñas” del cantón Milagro, así mismo, se concluye que es evidente la presencia de estos parásitos helmintos en el sitio de estudio, lo que constituye un problema de salud pública y existe el riesgo de presentarse nuevos casos. Por otra parte, se hace hincapié en fomentar un estudio epidemiológico a fondo para identificar los miembros más vulnerables dentro de los núcleos familiares, para el desarrollo de campañas de concientización dirigidas a grupos etarios con riesgo de sufrir la parasitosis.

Agradecimientos y conflicto de interés Se agradece la colaboración de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad de Guayaquil y a su vez al Comité Pro mejoras Nuevos Horizontes de “Las Piñas”, cuya participación y apertura al presente estudio permitió develar los datos expuestos.

Literatura citada: 1.

Han BA, Schmidt JP, Bowden SE, Drake JM. Rodent reservoirs of future zoonotic diseases. Proc Nat Academy Sci. United States of America. 2015;112(22):70397044.

2.

Karesh WB, Dobson A, Lloyd-Smith JO, Lubroth J, Dixon MA, Bennett M, et al. Ecology of zoonoses: natural and unnatural histories. Lancet (London, England). 2012;380(9857):1936-1945.

3.

Franssen F, Swart A, van Knapen F, van der Giessen J. Helminth parasites in black rats (Rattus rattus) and brown rats (Rattus norvegicus) from different environments in the Netherlands. Infect Ecol Epidemiol 2016;6:1-14.

4.

Reperant LA, Hegglin D, Tanner I, Fischer C, Deplazes P. Rodents as shared indicators for zoonotic parasites of carnivores in urban environments. Parasitology 2009;136(3):329-337.

5.

Acuña A, Calegari L, Cuto S, Lindner C, Rosa R, Salvatella R. Helmintiasis intestinal. Manejo de las Geohelmintiasis http://www.higiene.edu.uy/parasito/parasitologia_archivos/GEOHELMI%20para% 20medicos.pdf 2003; 1(1):[42].

6.

Kenyon PA, Roses PR. Regional approaches to neglected tropical diseases control in Latin America and the Caribbean. Institute of Medicine Forum on Microbial Threats. Washington, DC. USA: National Academies Press; 2011.

7.

WHO. Investing to overcome the global impact of neglected tropical diseases. EEUU: STAG-NTD; 2015. 968


Rev Mex Cienc Pecu 2020;11(4):961-970

8.

Zonta ML, Navone GT, Oyhenart EE. Parasitosis intestinales en niños de edad preescolar y escolar: situación actual en poblaciones urbanas, periurbanas y rurales en Brandsen, Buenos Aires, Argentina: Parasitol Latinoam 2007;62:54-60.

9.

Llop A, Valdés M, Zuazo J. Microbiología y parasitología médicas. 1a Ed, La Habana-Cuba: Editorial de Ciencias Médicas; 2001.

10. Hernández W. Determinación de la presencia de Hymenolepis nana e Hymenolepis diminuta en roedores sinantrópicos, en la comunidad Los Lirios, Masagua, Escuintla, Guatemala [Tesis]. Guatemala: San Carlos de Guatemala; 2016. 11. Mikhail MW, Metwally AM, Allam KA, Mohamed AS. Rodents as reservoir host of intestinal helminthes in different Egyptian agroecosystems. J Egyptian Soc Parasitol 2009;39(2):633-640. 12. Martínez I, Gutiérrez M, Aguilar J, Shea M, Gutiérrez M, Ruíz L. Infección por Hymenolepis diminuta en una estudiante universitaria. Rev Biomed 2012;23(1):6164. 13. Rossomando MJ, Márquez W, Prado J, Chacón N. Epidemiología de himenolepiosis y otras parasitosis intestinales en una comunidad suburbana de Escuque, TrujilloVenezuela. Rev Fac Med 2008;31:101-110. 14. Municipio-Milagro. Características ecológicas del cantón Milagro y descripción de la ciudadela "Las Piñas". Pazmiño B, editor. Municipio del cantón Milagro. 2018. 15. Milagro-Map. Mapa satelital del cántón Milagro. 2018. 16. Hancke D, Navone GT, Suarez OV. Endoparasite community of Rattus norvegicus captured in a shantytown of Buenos Aires City, Argentina. Helminthologia 2011;48(3):167. 17. De Sotomayor R, Serrano E, Tantaleán M, Quispe M, Casas G. Identificación de parásitos gastrointestinales en ratas de Lima Metropolitana. Rev Inv Vet Perú 2015;26(2):273-281. 18. Aluja A, Constantino F. Técnicas de necropsia en animales domésticos. 2da. ed. Mexico: Editoral el Manual Moderno; 2002. 19.

Fitte B, Robles MR, Dellarupe A, Unzaga JM, Navone GT. Hymenolepis diminuta and Rodentolepis nana (Hymenolepididae: Cyclophyllidea) in urban rodents of Gran La Plata: association with socio-environmental conditions. J Helminthol 2018;92(5):549-553.

20. Leguia G, Casas E. Enfermedades parasitarias y atlas parasitológico de camélidos sudamericanos. Lima: Editorial de Mar; 1999. 21. OPS. Manual para el control integral de roedores. Colombia: Ministerio de Salud y Protección Social y OPS; 2012. 969


Rev Mex Cienc Pecu 2020;11(4):961-970

22. Vives N, Zeledón R. Observaciones parasitológicas en ratas de San José, Costa Rica. Rev Biol Trop 1957;5(2):173-194. 23. Companioni-Ibañez A, Atencio-Millán I, Cantillo-Padrón J, Hernández-Contreras N, González-Rizo A, Núñez-Fernández F. Prevalencia de endoparásitos en roedores sinantrópicos (Rodentia: Muridae) en una localidad de La Habana, Cuba. Rev Cubana Med Trop 2016;68:240-247. 24. Simoes RO, Luque JL, Gentile R, Rosa MC, Costa-Neto S, Maldonado A. Biotic and abiotic effects on the intestinal helminth community of the brown rat Rattus norvegicus from Rio de Janeiro, Brazil. J Helminthol 2016;90(1):21-27. 25. Arzamani K, Salehi M, Mobedi I, Adinezade A, Hasanpour H, Alavinia M, et al. Intestinal Helminths in Different Species of Rodents in North Khorasan Province, Northeast of Iran. Iranian J Parasitol 2017;12(2):267-273. 26. Yang D, Zhao W, Zhang Y, Liu A. Prevalence of Hymenolepis nana and H. diminuta from Brown Rats (Rattus norvegicus) in Heilongjiang Province, China. Korean J Parasitol 2017;55(3):351-355. 27. Chagas CRF, Gonzalez IHL, Favoretto SM, Ramos PL. Parasitological surveillance in a rat (Rattus norvegicus) colony in Sao Paulo Zoo animal house. Ann Parasitol 2017;63(4):291-297. 28. Abad D, Chávez A, Pinedo R, Tantaleán M, González O. Helmintofauna gastrointestinal de importancia zoonótica y sus aspectos patológicos en roedores (Rattus spp) en tres medioambientes. Rev Inv Vet Perú 2016;27(4):376-750. 29. Makki MS, Mowlavi G, Shahbazi F, Abai MR, Najafi F, Hosseini-Farash BR, et al. Identification of Hymenolepis diminuta Cysticercoid Larvae in Tribolium castaneum (Coleoptera: Tenebrionidae) beetles from Iran. J Arthropod-borne Diseases 2017;11(2):338-43. 30. World Health Organization. (WHO). Neglected tropical diseases: hidden successes, emerging opportunities. USA 2009. http://www.who.int/neglected_diseases/resources/9789241598705/en/.

970


https://doi.org/10.22319/rmcp.v11i4.5111 Artículo

Frecuencia de contaminación y de serotipos de Salmonella enterica y Escherichia coli en una operación integrada de matanza y deshuese de bovinos

Jorge Alfredo de la Garza-García a María Salud Rubio Lozano a María del Carmen Wacher-Rodarte b Armando Navarro Ocaña c Rigoberto Hernández-Castro d Juan Xicohtencatl-Cortes e Enrique Jesús Delgado Suárez a*

a

Universidad Nacional Autónoma de México (UNAM). Facultad de Medicina Veterinaria y Zootecnia, Ciudad de México, México. b

UNAM. Facultad de Química. Ciudad de México. México.

c

UNAM. Facultad de Medicina. Ciudad de México. México.

d

Hospital General Dr. Manuel Gea González, Departamento de Ecología de Agentes Patógenos. Ciudad de México. México. e

Hospital Infantil de México Dr. Federico Gómez, Laboratorio de Bacteriología Intestinal. Ciudad de México. México.

*

Autor de correspondencia: enriquedelgado.suarez@gmail.com

971


Rev Mex Cienc Pecu 2020;11(4):971-990

Resumen: El objetivo fue determinar la frecuencia de contaminación y la diversidad de serotipos de Salmonella enterica (SE) y Escherichia coli (EC) en diferentes etapas de los procesos de matanza y deshuese de bovinos. Se tomaron muestras de heces, canales y cortes primarios (100 de cada tipo) en un rastro Tipo Inspección Federal ubicado en Mexicali, Baja California. EC no se analizó en heces, por ser esta bacteria parte de la microbiota intestinal. La identidad de las cepas se confirmó por métodos bioquímicos y por PCR: genes taxonómicos invA y gadA, para SE y EC, respectivamente. En EC se investigó también la presencia de genes asociados con los principales patotipos. SE tuvo una frecuencia de 34 % en heces, 3 % en canales y 2 % en cortes, siendo Montevideo el serotipo predominante (72.5 % del total de cepas). EC se detectó en canales (34 %) y en cortes (11 %), en concentraciones promedio de 0.012 y 0.33 log UFC cm-2, respectivamente. Aunque varios de los serotipos de EC identificados están asociados con cepas enterotoxigénicas o productoras de toxinas tipo Shiga, ninguno portaba factores de virulencia característicos de estos patotipos. En resumen, las canales y cortes de bovino no son una fuente relevante de cepas patógenas de EC. En contraste, los bovinos constituyen un importante reservorio de SE, lo cual representa un riesgo para la salud pública. Se requieren estudios genómicos sobre el perfil de virulencia y los genes asociados con infecciones subclínicas en cepas de SE provenientes de animales aparentemente sanos. Palabras clave: Escherichia coli, Salmonella spp., Bovinos, Sacrificio, Serotipos, Patotipos.

Recibido: 16/10/2018 Aceptado: 23/09/2019

Introducción Las infecciones intestinales causadas por Salmonella enterica y los distintos patotipos de E. coli, como los productores de las toxinas tipo Shiga (STEC), constituyen un problema de salud pública a escala global(1). Ambos patógenos suelen contaminar la carne de diferentes especies, entre ellas la de bovino(2,3), el segundo tipo de carne de mayor consumo en México(4). Por ello, la caracterización de las cepas circulantes de S. enterica y E. coli en la cadena productiva de bovinos de carne es de vital importancia para mejorar la gestión de los riesgos asociados con ambos patógenos. La mayoría de los estudios realizados en este campo en México se concentran en un solo punto de la cadena productiva. Por ejemplo, varios autores han observado frecuencias

972


Rev Mex Cienc Pecu 2020;11(4):971-990

moderadas (8 a 15 %) de Salmonella spp. en canales de bovino(5-7), aunque no en todos los casos se reportan los serotipos representados. En estudios más completos se reportan niveles de contaminación más elevados (25 a 100 %) en piel, heces, linfonodos, canales no refrigeradas y carne(8-10), detectándose predominancia de ciertos serotipos en algunas de las matrices analizadas. Sin embargo, la comparación entre estudios es difícil, debido a variaciones en cuanto al tipo de muestra analizada, segmento de la cadena productiva, metodología de análisis empleada, así como zona geográfica, sistema de producción animal y condiciones sanitarias del proceso en estudio. En el caso de E. coli, la situación es similar. La mayoría de los estudios se enfoca en un segmento de la cadena productiva y en cepas STEC entero-hemorrágicas, tales como E. coli O157:H7(6,11,12). Aunque en estudios previos se ha reportado baja frecuencia (1a 3 %) de cepas patógenas de E. coli en canales y en heces de bovinos(11-13), no se ha explorado a fondo la distribución de éstas a lo largo de la cadena productiva. Esta información puede contribuir a identificar patrones de diseminación en diferentes procesos y en distintas zonas geográficas, así como medidas encaminadas a garantizar la inocuidad de los alimentos y a proteger la salud pública. Por tanto, el presente estudio tiene como objetivo determinar la frecuencia de contaminación y diversidad de serotipos de S. enterica y E. coli en un rastro Tipo Inspección Federal con integración horizontal de los procesos de matanza y deshuese de bovinos.

Material y métodos Diseño del estudio y determinación del tamaño de muestra Se realizó un muestreo en tres etapas del proceso de transformación del bovino desde la matanza hasta el deshuese: 1) contenido rectal obtenido después de la evisceración, 2) canales calientes y 3) cortes primarios. Cada etapa se consideró como un muestreo independiente, pues no fue posible determinar con anticipación el destino de los animales, los cuales se vendieron como canales enteras en algunos casos y en otros como cortes primarios. El tamaño de muestra para cada etapa a evaluar se calculó mediante la fórmula estadística para determinar el tamaño de muestra para una proporción de una población, cuando no se conoce el número de elementos en esa población(14): n=

𝑍𝛼2 ∗𝑝∗𝑞 𝑑2

; n= tamaño de muestra; Zα2 = valor de Z en una distribución normal Zα = 1.96

cuando α= 0.05; p= proporción de la población con la característica estudiada (si se desconoce se emplea 0.5, como en este caso); q= proporción aproximada de la población carente de la característica estudiada(1-p); d= error o precisión deseada, la cual se fijó en 10% (0.1).

973


Rev Mex Cienc Pecu 2020;11(4):971-990

Con dicha fórmula se obtuvo un tamaño de muestra por etapa de 96, el cual se redondeó a 100, para un total de 300 muestras en el estudio. El estudio se realizó en septiembre de 2013, en una empresa integrada de producción de carne de bovino situada en Mexicali, Baja California, con operaciones de engorda intensiva en corral, matanza y deshuese. Las canales muestreadas provenían de bovinos machos enteros, cruzas de Bos indicus, con una edad promedio de 24 a 30 meses, originarios de ocho estados de la República Mexicana y finalizados durante un promedio de 190 días en la engorda. La empresa fue seleccionada por sus características integrales, las cuales permiten tener un modelo de la cadena productiva en un solo sitio. El rastro se encuentra a 1 km de los corrales de engorda y tiene capacidad para procesar 300 bovinos por turno de 8 h.

Toma de muestras Contenido rectal Las muestras de heces se tomaron del recto, después de la evisceración, a los 20 min post mortem. De cada recto se tomaron aproximadamente 100 g de heces. Para ello, se retuvieron momentáneamente los paquetes de vísceras en la rampa de eviscerado, se abrió la ligadura del recto y se usaron guantes nuevos de nitrilo para recolectar las muestras de heces, las cuales se depositaron en bolsas estériles y se mantuvieron en hieleras con geles refrigerantes (≈4 ºC) hasta su posterior procesamiento en el laboratorio. Cada muestra se tomó con un nuevo par de guantes. Como E. coli forma parte de la microbiota intestinal del bovino, se asumió que todas las muestras resultarían positivas y con altas concentraciones. Por esta razón, no se hizo el muestreo de rectos para E. coli, solamente para S. enterica. Canales sin refrigerar Se empleó la metodología utilizada por el Departamento de Agricultura de los Estados Unidos en sus estudios microbiológicos de línea base para la especie bovina(15) con ligeras modificaciones. En lugar de canales refrigeradas, se muestrearon canales calientes y se empleó el agua peptonada de una misma canal para la detección de E. coli y S. enterica. En todos los casos, se muestrearon medias canales (lado derecho) empleando esponjas prehumedecidas con 10 ml de agua peptonada tamponada y marcos estériles desechables de 10 x 10 cm2 (Meat/Turkey Carcass Sampling Kit, NASCO®, EEUU) en tres puntos de la canal (pierna, falda y pecho) con una superficie total de muestreo de 300 cm2 por canal. Cortes En la sala de cortes, una vez obtenidos los cortes primarios y antes del empacado, se seleccionaron al azar piernas, faldas y pechos para la toma de muestras. Para ello, se utilizó

974


Rev Mex Cienc Pecu 2020;11(4):971-990

el mismo método descrito anteriormente para las canales, excepto porque se tomó un solo marco de 100 cm2 por corte.

Análisis microbiológicos Una vez tomadas las muestras, las esponjas se sellaron en bolsas estériles de plástico y se mantuvieron en hieleras con geles refrigerantes (≈4 ºC) para su traslado al laboratorio de la planta. De los 10 ml de agua peptonada se inocularon por triplicado 100 μl en placas con agar Salmonella-Shigella (SS) (MCD Lab®, PRONADISA-CONDA®, España), se incubaron a 37 ºC y se revisaron a las 24, 48 y 72 h. Las placas sin crecimiento de colonias con morfología típica de Salmonella spp. a las 72 h se consideraron negativas. Para las muestras de heces, se emplearon hisopos estériles para realizar la siembra directa en medio SS y se procedió de igual forma para la incubación y lectura de las placas. Cuando se obtuvieron colonias con morfología sugerente de Salmonella spp. (con producción de ácido sulfhídrico, colonias redondeadas, convexas de borde regular), éstas fueron resembradas en medio CHROMAgar Salmonella Plus (CHROMAgar®, Francia) para su purificación e identificación. Todas las colonias sugerentes a Salmonella spp. (productoras de ácido sulfhídrico o de coloración morada en CHROMAgar Salmonella Plus) fueron recuperadas. Los aislamientos puros y confirmados con el medio selectivo y diferencial fueron sembrados en agar tripticaseína de soya (TSA, MCD Lab®, PRONADISA-CONDA®, España) para su identificación por métodos bioquímicos y por PCR. Del volumen restante del agua peptonada, se tomó 1 ml para cada placa rehidratable 3M Petrifilm® E. coli/Coliformes (3M, USA), para estimar la concentración de Escherichia coli genérica. Las placas 3M Petrifilm fueron incubadas a 37 °C y analizadas a las 24 y 48 h, de acuerdo con las instrucciones del fabricante. Se empleó el medio CHROMAgar ECC (CHROMAgar®, Francia) para aislar las cepas identificadas en las placas 3M Petrifilm.

Identificación bioquímica Las cepas de Salmonella se identificaron con substratos preparados en el laboratorio, de acuerdo con los resultados de las siguientes pruebas(16): triple azúcar hierro (TSI, por sus siglas inglesas); ácido sulfhídrico, indol y motilidad (SIM, por sus siglas en inglés); citrato de Simmons; urea; rojo de metilo-Vosges-Proskauer; malonato-fenilalanina; gluconato; enzimas descarboxilasas de arginina, ornitina, lisina y testigo. Se utilizó Salmonella enterica subsp. enterica ser. Typhimurium ST19, como control positivo, la cual se obtuvo del cepario del Hospital General Dr. Manuel Gea González, de la Ciudad de México, aislada y caracterizada por VITEK 2 (bioMerieiux, Francia)(17). Para E. coli se usaron las mismas pruebas, excepto la de descarboxilación de aminoácidos(16) y se empleó como control positivo una cepa de E. coli K12.

975


Rev Mex Cienc Pecu 2020;11(4):971-990

Identificación molecular La identificación molecular se realizó mediante PCR de punto final, empleando iniciadores de secuencias específicas de genes típicos de cada especie (Cuadro 1). El ADN genómico se extrajo con el kit “DNeasy Blood & Tissue Kit” (Qiagen, Inc., USA), según instrucciones del fabricante, a partir de las cepas puras, previamente refrescadas en caldo tripticasa soya (MCD Lab®, PRONADISA-CONDA®, España) por 18 a 24 h. Para S. enterica se utilizó el gen invA(18) y para E. coli, el gen gadA(19), el cual codifica para la subunidad alfa de la glutamato descarboxilasa, perteneciente al sistema de resistencia al estrés ácido en E. coli. Además, para identificar los patotipos presentes, se incluyeron seis genes asociados con cepas enteropatogénicas (EPEC), enterotoxigénicas (ETEC) y productoras de toxina tipo Shiga (STEC). Entre estos, se seleccionó el gen eaeA, el cual codifica para una intimina, proteína importante para la adhesión mediante el receptor translocado de intimina(20) y se encuentra presente en el genoma de los patotipos EPEC y STEC. Por su parte, los genes codificantes de las toxinas tipo Shiga 1 (stx1) y 2 (stx2) suelen presentarse en las cepas STEC, las cuales manifiestan el mismo fenotipo cuando portan uno de estos genes o ambos(20). También se investigó la presencia de genes codificantes para las toxinas termoestable (estA) y termolábil (eltA), asociados con cepas ETEC(21); así como el gen bfp (del inglés bundle forming pilus), codificante de los pili formadores de penachos, involucrados en la adhesión al epitelio intestinal, el cual se encuentra en el genoma de cepas EPEC(2). Las reacciones de PCR se realizaron en un volumen total de 25 μl y se utilizaron los reactivos del Top Taq Master Mix Kit (QIAGEN®, USA) con las siguientes concentraciones finales: 1.25 Unidades de Taq Polimerasa, 1.5 mM MgCl2, 1x Buffer para PCR, 200 μM de cada dNTP. Las condiciones empleadas para cada reacción fueron las mismas descritas en publicaciones anteriores (Cuadro 1). Cuadro 1: Genes e iniciadores empleados para la caracterización molecular de Salmonella spp. y Escherichia coli Patógeno

Gen

Salmonella spp.

invA

Fragmento amplificad o (pb) 284

gadA

670

eaeA

890

stx1

582

stx2

255

estA

190

E. coli

Secuencia de Iniciadores 5´3´ 139 GTGAAATTATCGCCACGTTCGGGCAA 141 TCATCGCACCGTCAAAGGAACC gadA1: ACCTGCGTTGCGTAAATA gadA2: GGGCGGGAGAAGTTGATG EAE1: GTGGCGAATACTGGCGAGACT EAE2: CCCCATTCTTTTTCACCGTCG STX1F: ACACTGGATGATCTCAGTGG STX1R: CTGAATCCCCCTCCATTATG STX2F: GGCACTGTCTGAAACTGCTCC STX2R: TCGCCAGTTATCTGACATTCTG STa-F CTAATGTTGGCAATTTTTATTTCTGTA

976

Ref.

(19) (20) (21) (21) (21) (22)


Rev Mex Cienc Pecu 2020;11(4):971-990

eltA

132

bfp

324

STa-R AGGATTACAACAAAGTTCACAGCAGTAA LT-1 AGCAGGTTTCCCACCGGATCACCA LT-2 GTGCTCAGATTCTGGGTCTC EP1, CAATGGTGCTTGCGCTTGCT EP2, GCCGCTTTATCCAACCTGGT

(22) (2)

Los productos de amplificación por PCR fueron procesados por electroforesis en geles de agarosa (SeaKem® LE Agarose, Lonza, ME, USA) al 1% para los productos de alto peso molecular (gadA, eaeA, stx1) y al 2% para los más pequeños (eltA y estA). Los geles se corrieron en buffer tris/borato/EDTA (TBE 1x), a 80 V por 50 min. Se usó SYBR Safe DNA Gel Stain (Invitrogen, USA) para revelar los fragmentos de ADN. La visualización y digitalización de imágenes se realizó en un fotodocumentador Gel Logic 2200 (Kodak, USA) con el software Care Stream® (Carestream Health, Inc., USA). Se utilizaron como controles positivos las mismas cepas de ambos patógenos referidas en la identificación bioquímica. Además, para la identificación de los patotipos de E. coli se incluyeron como controles cepas de cada uno de los patotipos investigados (EPEC, ETEC y STEC), también provenientes del cepario del laboratorio del Hospital General Dr. Manuel Gea González, previamente identificados por medio del sistema VITEK 2.

Serotipificación Salmonella spp. Tipificación serológica del antígeno somático (O). La identificación serológica de las cepas de Salmonella se realizó de acuerdo al esquema de Kauffmann–White(22,23). La obtención del antígeno somático (O) se llevó a cabo hirviendo los cultivos bacterianos (≈94 ºC) durante 1 h. El antígeno O se determinó utilizando sueros polivalentes anti-O A, B, D, D, E, F y G de (DIFCO, BD) y sueros anti-O monovalentes (específicos) de los serogrupos A, C, D, E y F (DIFCO, BD). Tipificación serológica del antígeno flagelar (H). Este antígeno se obtuvo inoculando las cepas en medio semisólido en tubos de Cragie´s y resembrando en caldo nutritivo. El antígeno H de fase I y II de las cepas se determinó utilizando el sistema de antisueros-H Spicer-Edwars (DIFCO) y sueros monovalentes (específicos) de los serogrupos A, B, C, D, E y F. Aunque la determinación del serotipo no se realizó en un laboratorio de referencia, el genoma completo de las cepas obtenidas fue secuenciado, como parte de otra investigación(24). Ello permitió confirmar, mediante análisis in silico de las secuencias crudas, los resultados preliminares de serotipificación y determinar el serotipo de las cepas no tipificables por métodos bioquímicos. 977


Rev Mex Cienc Pecu 2020;11(4):971-990

E. coli Las cepas de E. coli fueron serotipificadas utilizando microaglutinación en placa de 96 pozos y 187 sueros anti-antígeno somático (O) y 53 sueros anti-antígeno flagelar (H) obtenidos en conejo (SERUNAM), empleando el método descrito por Ørskov y Ørskov(25), con modificaciones menores. Clasificación por filogrupos. Como ciertos filogrupos de E. coli están asociados con animales o con humanos, así como con diferentes patotipos de la bacteria, se decidió realizar la clasificación en grupos filogenéticos mediante PCR, según el esquema de Clermont(26). Esta técnica permite dividir a los aislamientos de E. coli en siete grupos filogenéticos característicos de la especie (A, B1, B2, C, D, E y F) y un grupo adicional, correspondiente al Clado Críptico I. La prueba se realizó mediante una reacción de PCR cuádruple inicial, para detectar los genes arpA, chuA, yjaA y TSPE4.C2. Además, en caso de obtener resultados sugerentes de filogrupos E y C, se realiza un PCR dúplex adicional dirigida hacia una variante alélica del gen arpA (específica del grupo E) o bien, a una variante alélica del gen trpA (específica para el grupo C), más un control interno dirigido para el gen trpBA. Las reacciones se llevaron a cabo directamente, a partir de colonias frescas crecidas 24 h en agar TSA. Las reacciones de PCR se realizaron a un volumen de 25 μl, bajo las mismas condiciones descritas previamente(26). Los productos de amplificación por PCR fueron procesados por electroforesis en gel de agarosa (SeaKem® LE Agarose, Lonza, EEUU) al 2%, corriendo a voltaje constante de 80 V por 50 min. La visualización y digitalización de imágenes se realizó de la misma forma antes descrita para S. enterica. Se incluyeron como controles positivos E. coli K12 y cepas representativas de cada uno de los filogrupos de E. coli, provenientes del cepario del Hospital General Dr. Manuel Gea González, clasificadas previamente según el esquema de Clermont(26).

Análisis de la información Se calculó la frecuencia de positividad para ambos patógenos en las muestras evaluadas, así como la concentración, sólo en el caso de E. coli. Se utilizó la prueba de Ji cuadrada y la razón de momios para detectar asociación entre la positividad a los patógenos y el tipo de muestra

Resultados De las muestras analizadas (300 para Salmonella spp. y 200 para E. coli) se obtuvieron 84 aislamientos, 39 de ellos fueron identificados como Salmonella spp. y otros 45 como E. coli, con una frecuencia global de 13.0 y 22.5 %, respectivamente. Sólo una de las muestras, proveniente de una canal, fue positiva para ambas bacterias. 978


Rev Mex Cienc Pecu 2020;11(4):971-990

Salmonella spp. La frecuencia de contaminación con Salmonella spp. fue de 34 % en heces y de 3 y 2 % en canales y en cortes, respectivamente (Figura 1). Todos los aislamientos obtenidos fueron identificados como Salmonella spp. mediante pruebas bioquímicas y PCR. Inicialmente se habían aislado otras dos cepas, con resultados positivos basados en pruebas bioquímicas y en PCR, pero resultaron no tipificables. No obstante, al confirmar el serotipo, por análisis in silico con las lecturas crudas de la secuenciación del genoma, estas dos cepas fueron descartadas, pues se identificaron como Pseudomonas putida, una especie también portadora del gen invA(27). Figura 1: Presencia de Salmonella spp. en heces, canales y cortes de bovino (n=100 por tipo de muestra)

La prueba de Ji cuadrada evidenció la existencia de una fuerte asociación (χ2=58.5, P<0.0001) entre el tipo de muestra y la frecuencia de contaminación con Salmonella spp (Cuadro 2). Esto fue confirmado por la razón de momios, según la cual la probabilidad de encontrar muestras positivas a Salmonella spp. en heces fue 20.1 veces mayor en relación con las demás matrices. Cuadro 2: Asociación entre la frecuencia de contaminación con Salmonella spp. y Escherichia coli y el tipo de muestra Tipo de muestra Salmonella spp. Heces Canales/cortes E. coli Canales Cortes

% positividad

Razón de momios

I. C. al 95%1

χ2

P2

100 200

34 5

20.1

7.5-53.5

58.5

<0.0001

100 100

34 11

4.2

2.0-8.8

15.2

<0.0001

n

1

Intervalo de confianza al 95% para la razón de momios. 2 Nivel de significancia (probabilidad). 979


Rev Mex Cienc Pecu 2020;11(4):971-990

Con respecto a los serotipos presentes (Figura 2), se logró tipificar 35 de los 39 aislamientos por métodos serológicos. Las otras cuatro cepas sólo pudieron ser caracterizadas parcialmente, pues presentaron un antígeno O rugoso, por lo que sólo fue posible obtener una fórmula antigénica parcial, basada en el antígeno flagelar. No obstante, el análisis in silico, con las lecturas crudas de secuenciación genómica completa reportado en otra investigación(24), permitió determinar el serotipo del 100 % de los aislamientos. En total, se identificaron cinco serovariedades: Bergen (n= 1), Reading (n= 2), Muenster (n= 3), Newport (n= 4) y Montevideo (n= 29). Todos los aislamientos correspondientes al serotipo Montevideo fueron monofásicos para el antígeno H, aunque las fórmulas antigénicas permitieron identificar dos subgrupos dentro de este serotipo, 22 de ellos provenientes de heces, canales y cortes, con la fórmula 6,7:g,m,s:-. Las siete cepas restantes, todas provenientes de heces, presentaron la fórmula 6,7:g,m,p,s:-. Figura 2: Distribución de serotipos de Salmonella enterica subsp. enterica de acuerdo con el origen de la muestra (n=100 por tipo de muestra)

La distribución de serotipos por clase de muestra evidenció la presencia de Salmonella enterica subsp. enterica ser. Montevideo en todas las matrices analizadas. Por el contrario, las cepas de Salmonella enterica subsp. enterica ser. Newport y Reading, detectadas en menor frecuencia que Salmonella Montevideo, sólo se detectaron en las heces (Figura 2).

E. coli E. coli se encontró en 34 % de las canales y en 11 % de los cortes. Se evidenció una fuerte asociación (χ2=15.2, P<0.0001) entre el tipo de muestra y la frecuencia de contaminación con E. coli (Cuadro 2). Esto fue confirmado por la razón de momios, la cual mostró que la probabilidad de encontrar muestras positivas en canales fue mayor que en cortes (razón de probabilidades 4.2, intervalo de confianza al 95% 2.0-8.8, P<0.0001. 980


Rev Mex Cienc Pecu 2020;11(4):971-990

En los cortes, las muestras positivas se distribuyeron de forma relativamente homogénea, obteniéndose cinco cepas del pecho, tres de la falda y tres de la pierna. La concentración de esta bacteria fue baja, tanto en canales como en cortes, con valores entre 1 y 8 UFC cm-2. De los 45 aislamientos obtenidos, identificados mediante placas 3M petrifilm y CHROMAgar ECC, 41 mostraron un fenotipo característico de la especie. Las cuatro cepas restantes, todas provenientes de canales, presentaron resultados atípicos; tres de ellas indol negativas y con lenta fermentación de lactosa y una más resultó positiva a citrato, malonato y celobiosa. No obstante, todas las cepas fueron confirmadas molecularmente por PCR, empleando el gen gadA como marcador taxonómico. Se identificaron total o parcialmente 31 serotipos de E. coli (Cuadro 3). Los serogrupos más frecuentes fueron O8 (29%) y O71 (19.4%) y el serotipo más comúnmente encontrado fue el O1:H6 (9.7 %). Cuadro 3: Frecuencia de serotipos de Escherichia coli parcial o totalmente identificados por tipo de muestra Tipo de muestra

n

Canal

1 3 1 3 1 1 1 1 1 1 5 1 1 1 1 1 1 2 1 1 2

Pierna Pecho

Falda

Serotipo O28ab:-:H30 -:H32 O1:H6 O113:O154:H21 O156:O166:H21 O32:O6:O8:O8:H19 O8:H2 O8:H21 -:H32 O124:O71:O71:H12 O8:H8 O7:H39 O71:H12

Los grupos filogenéticos predominantes fueron A (60 %) y B1 (26.7 %), el grupo B2 estuvo ausente y los grupos C y D se presentaron en frecuencias bajas (2.2 y 6.7 %). Hubo dos cepas 981


Rev Mex Cienc Pecu 2020;11(4):971-990

con resultados no concluyentes, por lo cual no se asignaron a un filogrupo. Resultó interesante observar cómo algunos serogrupos estuvieron fuertemente asociados con ciertos grupos filogenéticos. En el serogrupo O8, 8 de 9 cepas pertenecen al filogrupo B1. De igual forma, 4 de 5 cepas del serogrupo O71 pertenecen al filogrupo A y todas las cepas del serogrupo O1 pertenecen al filogrupo D (Figura 3). Figura 3: Grupos filogenéticos de E. coli, según el esquema de Clermont(26), representados en cada uno de los serogrupos identificados (n=43)

Discusión En varios países desarrollados, con sistemas de explotación intensiva de ganado bovino similares a los que existen en naciones en desarrollo, como México, los niveles de contaminación con Salmonella spp. suelen ser bajos, tanto en canales y carne como en muestras de heces(28-30). Sin embargo, en este trabajo se observó una frecuencia moderadamente alta de contaminación en heces, la cual coincide con la reportada en otros rastros TIF del país(9). Esto indica que, en México, las granjas de bovinos de engorda pueden constituir un importante reservorio de este patógeno. Sin duda, esto representa un desafío considerable para las intervenciones aplicadas durante la matanza, donde se reduce drásticamente la contaminación de las canales en relación con las excretas, pero no alcanzan a controlar por completo el patógeno. Asimismo, Salmonella también fue detectada en cortes primarios, evidencia del potencial de este organismo para diseminarse a lo largo de la cadena productiva. Esto se demuestra al detectar cepas de un mismo serotipo en heces, canales y cortes. Además, los resultados son similares a los de estudios previos (2 a 30 % de positividad 982


Rev Mex Cienc Pecu 2020;11(4):971-990

a Salmonella) en muestras de carne en supermercados(31,32), los cuales sólo expenden carne proveniente de rastros TIF. Esta situación implica un panorama epidemiológico más preocupante en las cadenas de comercialización asociadas con rastros municipales, los cuales carecen de la infraestructura y de las condiciones sanitarias existentes en rastros TIF(33). De hecho, la frecuencia de positividad a Salmonella en puntos de venta de carne de rastros municipales por lo general supera el 50%(10,34). Lo analizado hasta el momento evidencia la necesidad de reforzar las medidas de control de Salmonella spp. en animales vivos, ya que las intervenciones aplicadas en granja son limitadas. En este sentido, la evaluación de la prevalencia de Salmonella spp. en los becerros destinados a las granjas de engorda, el monitoreo de animales infectados, su manejo separado y así la detección de posibles reservorios del patógeno, son sólo algunas de las medidas favorables para disminuir el porcentaje de animales recibidos en el rastro portadores de esta bacteria. Con respecto a los serotipos detectados, todos han sido relacionados previamente con infecciones humanas en México(35), por lo cual el riesgo de estas cepas para la salud pública no debe minimizarse. El claro predominio de Salmonella Montevideo en los procesos estudiados es notorio, además de sorpresivo, tomando en cuenta que la empresa participante engorda animales provienentes de ocho Estados del país. También resulta interesante la ausencia de serotipos anteriormente comunes en muestras asociadas con ganado bovino en México, tales como Typhimurium, Anatum y Agona, entre otros(36). Aunque se ha reportado una distribución variable de serotipos de Salmonella spp. en función del tiempo, así como entre zonas geográficas y estudios, la predominancia de Salmonella Montevideo en la muestra estudiada es consistente con la creciente prevalencia de este serotipo en América del Norte(37,38). Asimismo, en estudios recientes realizados en México se reportan serotipos como Montevideo y Reading, pero no Typhimurium, en cepas obtenidas de heces, canales y linfonodos de bovinos(8, 9). En cualquier caso, resulta difícil determinar los factores asociados con el predominio de ciertas cepas en sistemas de producción animal sin recurrir a estudios moleculares en los cuales se aborde la diversidad genética de las poblaciones, así como la presencia de genes asociados con virulencia, persistencia ambiental e infecciones subclínicas. No obstante, los resultados indican que bovinos aparentemente sanos pueden portar Salmonella spp. en frecuencias moderadamente altas, así como la capacidad del patógeno para diseminarse más allá del proceso de matanza y faenado, con los riesgos consecuentes en términos de inocuidad de alimentos. En relación con E. coli, aunque se encontró con una frecuencia similar a la de Salmonella en canales y en un porcentaje más elevado en cortes, esta bacteria se presentó en bajas concentraciones (<8 UFC cm-2). A pesar de que E. coli es parte de la microbiota intestinal, las intervenciones aplicadas en el rastro lograron reducir tres veces la frecuencia de esta bacteria en los cortes, en los cuales se observó una menor probabilidad de encontrar muestras 983


Rev Mex Cienc Pecu 2020;11(4):971-990

positivas en relación con las canales. Además, al parecer existe en el país una escasa circulación de cepas patógenas en bovinos, a diferencia de otros países, como Estados Unidos de América, en los que éstas se consideran un problema de salud pública(39). Así lo demostró la ausencia de factores de virulencia asociados con los patotipos STEC, EPEC y ETEC en las muestras estudiadas. Estos hallazgos coinciden con investigaciones previas(13) en las que se detectaron serovariedades (O157 y no O157) asociadas con cepas STEC (n= 146), pero sólo dos de éstas portaban los factores de virulencia característicos. Esta tendencia se mantiene en estudios posteriores, en los cuales se reportan tasas bajas (<1 %) de contaminación con cepas patógenas de E. coli en canales y carne molida de bovinos en México(9,40,41). Tal comportamiento podría obedecer a múltiples factores. Entre estos, el fotoperíodo, más largo durante el verano en los países situados más al norte, se ha considerado como responsable del marcado efecto estacional en la prevalencia de E. coli patogénica en ganado bovino en estas naciones. Otros autores han sugerido que la circulación de otras enterobacterias, con reactividad cruzada de antígenos somáticos (O), en las poblaciones bovinas de México, podría ser un factor de selección negativa de patotipos de E. coli(42). Ello coincide con el alto porcentaje de muestras de suero bovino, proveniente de animales aparentemente sanos, con respuesta bactericida contra E. coli O157 (71 %) en hatos del centro de México(43). En cuanto a los filogrupos de E. coli identificados, el predominio de los grupos A y B1 es consistente con lo comúnmente observado en cepas de origen animal(44,45). En línea con la ausencia de genes de virulencia asociados con patotipos, solamente una cepa fue clasificada en el grupo C, al cual pertenecen otras cepas STEC de origen animal(44,46). No obstante, prácticamente todos los serotipos identificados han sido asociados con los patotipos STEC o ETEC, ambos de importancia en enfermedades transmitidas por alimentos(47-49). Aunque no se ha estudiado el riesgo a la salud en cepas de serotipos carentes de genes de virulencia, éste no debe descartarse del todo, puesto que cepas no patógenas podrían adquirir dichos factores mediante la incorporación de plásmidos y/o fagos(50,51), un área donde se requiere de más investigación.

Conclusiones e implicaciones En este estudio se comprobó que más de la tercera parte de los bovinos aprobados para la matanza portan diferentes serotipos de Salmonella enterica en las heces, a pesar de ser animales aparentemente sanos. Además, los resultados evidencian la capacidad del patógeno para diseminarse hacia los siguientes segmentos de la cadena productiva, con los riesgos consecuentes para la salud pública. De ahí la importancia de realizar estudios posteriores sobre los factores genéticos de S. enterica asociados con el establecimiento de infecciones subclínicas en el bovino, así como con su persistencia en las poblaciones ganaderas. Por otra parte, los resultados para E. coli evidencian, al igual que en otras zonas del país, una escasa 984


Rev Mex Cienc Pecu 2020;11(4):971-990

circulación de cepas patógenas de E. coli en canales y cortes de bovino. No obstante, las muestras analizadas provienen de un solo rastro y el alcance del presente trabajo, para E. coli, no considera muestras de piel o de heces, en las cuales existe mayor probabilidad de encontrar cepas patógenas.

Agradecimientos y conflictos de interés Este estudio fue realizado con recursos del fondo sectorial SAGARPA-CONACYT, proyecto 109127. Se agradece el apoyo técnico de los profesionales del Hospital General “Dr. Manuel Gea González”, de la Facultad de Medicina, Universidad Nacional Autónoma de México y de la Universidad Autónoma de Baja California, por su asistencia en la conducción de los experimentos y en los análisis de laboratorio. Los autores declaran que no tienen conflictos de interés con respecto a la presente publicación.

Literatura citada: 1. WHO. WHO estimates of the global burden of foodborne diseases. Foodborne disease burden epidemiology reference group 2007-2015. World Health Organization. http://www.who.int/foodsafety/areas_work/foodborne-diseases/ferg/en/. Accessed Oct 25, 2018. 2. Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev 2013;26(4):822-880. 3. Koohmaraie M, Scanga JA, De La Zerda MJ, Koohmaraie B, Tapay L, Beskhlebnaya V, et al. Tracking the sources of Salmonella in ground beef produced from nonfed cattle. J Food Protect 2012;75(8):1464-1468. 4. FAOSTAT. Food Balance Sheets. Food and Agricultural Organization of the United Nations, Statistics Division. http://faostat3.fao.org/download/FB/FBS/E. Consultado 25 Feb, 2019. 5. Varela-Guerrero JA, Talavera-Rojas M, Gutiérrez-Castillo AC, Reyes-Rodríguez NE, Vázquez-Guadarrama J. Phenotypic-genotypic resistance in Salmonella spp. isolated from cattle carcasses from the north central zone of the State of Mexico. Trop Anim Health Prod 2013;45(4):995-1000. 6. Hernández-San Juan S, Zúñiga-Estrada A, Sánchez-Ortega I, Castro-Rosas J, RománGutiérrez AD, Santos-López EM. Condiciones microbiológicas en el proceso de sacrificio en un rastro municipal del estado de Hidalgo, México. Vet Mex 2007;38(2):187-194.

985


Rev Mex Cienc Pecu 2020;11(4):971-990

7. Pérez-Montaño JA, González-Aguilar D, Barba J, Pacheco-Gallardo C, Campos-Bravo CA, García S, Heredia NL, Cabrera-Díaz E. Frequency and antimicrobial resistance of Salmonella serovars on beef carcasses at small abattoirs in Jalisco State, Mexico. J Food Prot 2012;75(5):867-873. 8. Gragg SE, Loneragan GH, Nightingale KK, Brichta-Harhay DM, Ruiz H, Elder JR, et al. Substantial within-animal diversity of Salmonella isolates from lymph nodes, feces, and hides of cattle at slaughter. Appl Environ Microbiol 2013;79(15):4744-50. 9. Narvaez-Bravo C, Miller MF, Jackson T, Jackson S, Rodas-Gonzalez A, Pond K, Echeverry A, Brashears MM. Salmonella and Escherichia coli O157:H7 Prevalence in cattle and on carcasses in a vertically integrated feedlot and harvest plant in Mexico. J Food Prot 2013;76(5):786-795. 10. Zaidi MB, McDermott P, Fedorka-Cray P, Leon V, Canche C, Hubert S, et al. Nontyphoidal Salmonella from human clinical cases, asymptomatic children and raw retail meats in Yucatan, Mexico. Clin Infect Dis 2006;42:21-28. 11. Callaway TR, Anderson RC, Téllez G, Rosario C, Nava GM, Eslava C, et al. Prevalence of Escherichia coli O157 in cattle and swine in central Mexico. J Food Prot 2004;67(10):2274-2276. 12. Amézquita-López BA, Quinones B, Cooley MB, Leon-Felix J, Castro-del Campo N, Mandrell RE, et al. Genotypic analyses of shiga toxin-producing Escherichia coli O157 and non-O157 recovered from feces of domestic animals on rural farms in Mexico. PLoS One 2012;7(12):e51565. 13. Varela-Hernández JJ, Cabrera-Díaz E, Cardona-López MA, Ibarra-Velázquez LM, Rangel-Villalobos H, Castillo A, et al. Isolation and characterization of Shiga toxinproducing Escherichia coli O157:H7 and non-O157 from beef carcasses at a slaughter plant in Mexico. Int J Food Microbiol 2007;113(2):237-41. 14. Jekel JF, Katz DL, Elmore JG. Epidemiology, biostatistics, and preventive medicine. Third ed. Philadelphia, PA, United States of America: SAUNDERS ELSEVIER; 2007. 15. USDA/FSIS. Nationwide Sponge Microbiological Baseline Data Collection Program: Cattle. https://www.fsis.usda.gov/wps/wcm/connect/197ddb9c-1fa5-411e-ab3f3d253c879370/Baseline_Data_Cattle.pdf?MOD=AJPERES. Accessed Mar 5, 2019. 16. Barrow GI, Feltham RKA. Cowan and Steel's manual for the identification of medical bacteria. 3rd Ed. ed. Cambridge, United Kingdom: Cambridge University Press; 1993.

986


Rev Mex Cienc Pecu 2020;11(4):971-990

17. Bruins MJ, Bloembergen P, Ruijs GJHM, Wolfhagen MJHM. Identification and susceptibility testing of Enterobacteriaceae and Pseudomona aeruginosa by direct inoculation from positive BACTEC blood culture bottles into Vitek 2. J Clin Microbiol 2004;42(1):7-11. 18. Rahn K, De Grandis SA, Clarke RC, Curtiss R, Gyles CL. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes 1992;6:271-279. 19. McDaniels AE, Rice EW, Reyes AL, Johnson CH, Haugland RA, Stelma GNJ. Confirmational identification of Escherichia coli, a comparison of genotypic and phenotypic assays for glutamate decarboxylase and β-d-glucuronidase. Appl Environ Microbiol 1996;62(9):3350-3354. 20. DebRoy C, Roberts E. Screening petting zoo animals for the presence of potentially pathogenic Escherichia coli. J Vet Diagn Invest 2006;18(6):597-600. 21. Bisi-Johnson MA, Obi CL, Vasaikar SD, Baba KA, Hattori T. Molecular basis of virulence in clinical isolates of Escherichia coli and Salmonella species from a tertiary hospital in the Eastern Cape, South Africa. Gut Pathog 2011;3(9). 22. Grimont PAD, Weill F. Antigenic formulae of the Salmonella serovars. WHO Collaborating Centre for Reference and Research on Salmonella, Institut Pasteur. https://www.pasteur.fr/sites/default/files/veng_0.pdf. Accessed Feb 25, 2019. 23. Popoff MY, Le Minor LE. Salmonella. In: Bergey's Manual of Systematics of Archaea and Bacteria. Whitman FR, et al editors. Hoboken, New Jersey: John Wiley & Sons, Inc.; 2015:764-799 24. Delgado-Suárez EJ, Selem-Mojica N, Ortiz-López R, Gebreyes WA, Allard MW, Barona-Gómez F, Rubio-Lozano MS. Whole genome sequencing reveals widespread distribution of typhoidal toxin genes and VirB/D4 plasmids in bovine-associated nontyphoidal Salmonella. Sci Rep 2018;8(1):9864. 25. Ørskov F, Ørskov I. Serotyping of Escherichia coli. Method Microbiol 1984;14:43-112. 26. Clermont O, Christenson JK, Denamur E, Gordon DM. The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylogroups. Environ Microbiol Rep 2013;5(1):58-65. 27. Duan J, Jiang W, Cheng Z, Heikkila JJ, Glick BR. The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4. PLoS One 2013;8(3):e58640.

987


Rev Mex Cienc Pecu 2020;11(4):971-990

28. Eguale T, Engidawork E, Gebreyes WA, Asrat D, Alemayehu H, Medhin G, Johnson RP, Gunn JS. Fecal prevalence, serovar distribution and antimicrobial resistance of Salmonellae in dairy cattle in central Ethiopia. BMC Microbiol 2016;16:20. 29. Sandt CH, Fedorka-Cray PJ, Tewari D, Ostroff S, Joyce K, M'Ikanatha NM. A comparison of non-typhoidal Salmonella from humans and food animals using pulsedfield gel electrophoresis and antimicrobial susceptibility patterns. PLoS One 2013;8(10):e77836. 30. Khen BK, Lynch OA, Carroll J, McDowell DA, Duffy G. Prevalence and characteristics of Salmonella in the beef chain in the Republic of Ireland. Zoonoses Public Health 2014;61(8):534-6. 31. Ballesteros-Nova N, Rubio-Lozano MS, Delgado-Suárez EJ, Méndez-Medina RD, Braña-Varela D, Rodas Suárez O. Perfil de resistencia a antibióticos de serotipos Salmonella spp. aislados de carne de res molida en la Ciudad de México. Salud Pública México 2016;58(3):1-7. 32. Rubio-Lozano MS, Martínez-Bruno JF, Hernández-Castro R, Bonilla-Contreras C, Méndez MRD, Núñez-Espinosa JF, et al. Detección de Listeria monocytogenes, Salmonella y Yersinia enterocolitica en carne de res en puntos de venta en México. Rev Mex Cienc Pecu 2013;4(1):107-115. 33. Signorini M. Evaluación de riesgos de los rastros y mataderos municipales. Nacameh 2007;1(2):118-141. 34. Cabrera-Díaz E, Barbosa-Cárdenas CM, Pérez-Montano JA, González-Aguilar D, Pacheco-Gallardo C, Barba J. Occurrence, serovar diversity, and antimicrobial resistance of Salmonella in ground beef at retail stores in Jalisco state, Mexico. J Food Prot 2013;76(12):2004-2010. 35. Gutiérrez-Cogco L, Montiel-Vázquez E, Aguilera-Pérez P, González-Andrade MC. Serotipos de Salmonella identificados en los servicios de salud de México. Salud Publica Mex 2000;42(6):490-495. 36. Zaidi MB, Calva JJ, Estrada-García MT, León V, Vázquez G, Figueroa G, et al. Integrated food chain surveillance system for Salmonella spp. in Mexico. Emerg Infect Dis 2008;14(3):429-435. 37. Habing GG, Manning S, Bolin C, Cui Y, Rudrik J, Dietrich S, Kaneene JB. Within-Farm Changes in dairy farm-associated Salmonella subtypes and comparison to human clinical isolates in michigan, 2000-2001 and 2009. Appl Environ Microbiol 2015;81(17):5724-35.

988


Rev Mex Cienc Pecu 2020;11(4):971-990

38. Webb HE, Brichta-Harhay DM, Brashears MM, Nightingale KK, Arthur TM, Bosilevac JM, et al. Salmonella in peripheral lymph nodes of healthy cattle at slaughter. Front Microbiol 2017;8:2214. 39. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson M, Roy SL, et al. Foodborne illness acquired in the united states—major pathogens. Emerg Infect Dis 2011;17(1):715. 40. Gómez-Aldapa CA, Díaz-Cruz CA, Cerna-Cortés JF, Torres-Vitela MR, VillarruelLópez A, Rangel-Vargas E. Escherichia coli O157 in ground beef from local retail markets in Pachuca, Mexico. J Food Prot 2013;76(4):680-684. 41. Gallegos M, Morales A, Álvarez G, Vázquez J, Morales L, Martínez I, Maldonado J. Caracterización de aislados de Escherichia coli O157:H7 en canales de bovinos y porcinos mediante PCR. Revista Científica, FCV-LUZ 2009;XIX(2):139-146. 42. Chart H, Okubadejo A, Rowe B. The serological relationship between Escherichia coli O157 and Yersinia enteocolitica O9 using sera from patients with brucellosis. Epidemiol Infect 1992;108(1):77-85. 43. Navarro A, Eslava C, García de la Torre G, León LA, Licona D, León L, Zarco LA, Cravioto A. Common epitopes in LPS of different Enterobacteriaceae are associated with an immune response against Escherichia coli O157 in bovine serum samples. J Med Microbiol 2007;56:1447-1454. 44. Clermont O, Olier M, Hoede C, Diancourt L, Brisse S, Keroudean M, et al. Animal and human pathogenic Escherichia coli strains share common genetic backgrounds. Infect Genet Evol 2011;11(3):654-662. 45. Carlos C, Pires MM, Stoppe NC, Hachich EM, Sato MI, Gomes TA, Amaral LA, Ottoboni LM. Escherichia coli phylogenetic group determination and its application in the identification of the major animal source of fecal contamination. BMC Microbiol 2010;1(10):161. 46. CDC. Center for Disease Control and Prevention. Multistate outbreak of shiga toxinproducing Escherichia coli O145 infections (final update). https://www.cdc.gov/ecoli/2012/o145-06-12/index.html. Accessed Mar 5, 2019. 47. Blanco M, Blanco JE, Mora A, Dhabi E, Alonso MP, González EA, et al. Serovars, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from cattle in Spain and identification of a new intimin variant gene (eae-xi). J Clin Microbiol 2004;42(2):645-651.

989


Rev Mex Cienc Pecu 2020;11(4):971-990

48. Bettelheim KA. The Non-O157 Shiga-Toxigenic (Verocytotoxigenic) Escherichia coli; under-rated pathogens. Crit Rev Microbiol 2007;33(1):67-87. 49. De Moura C, Ludovico M, Valadares GF, Gatti MSV, Leite DS. Detection of virulence genes in Escherichia coli strains isolated from diarrheic and healthy feces of dairy calves in Brazil. Arq Inst Biol 2012;79(2):273-276. 50. MartĂ­nez-Castillo A, Muniesa M. Implications of free Shiga toxin-converting bacteriophages occurring outside bacteria for the evolution and the detection of Shiga toxin producing Escherichia coli. Front Cell Infect Microbiol 2014;4:46. 51. Hallewell J, Niu YD, Munns K, McAllister TA, Johnson RP, Ackermann HW, Thomas JE, Standford K. Differing populations of endemic bacteriophages in cattle shedding high and low numbers of Escherichia coli O157:H7 Bacteria in feces. Appl Environ Microbiol 2014;80(13):3819-3825.

990


https://doi.org/10.22319/rmcp.v11i4.5073 Artículo

La resistencia antimicrobiana en Escherichia coli aislada de canales y heces bovinas de rastros en el centro de México

Vicente Vega Sánchez a Martín Talavera Rojas b Jeannette Barba León c Andrea Paloma Zepeda Velázquez a Nydia Edith Reyes Rodríguez a*

a

Universidad Autónoma del Estado de Hidalgo. Instituto de Ciencias Agropecuarias. Área Académica de Medicina Veterinaria y Zootecnia. Tulancingo, Hidalgo, México. b

Universidad Autónoma del Estado de México. Facultad de Medicina Veterinaria y Zootecnia. Centro de Investigación y Estudios Avanzados en Salud Animal. Toluca, México. c

Universidad de Guadalajara. Centro Universitario de Ciencias Biológicas y Agropecuarias. Departamento de Salud Pública, Jalisco, Mexico.

*Autor de correspondencia: nydia_reyes@uaeh.edu.mx

Resumen: Escherichia coli es importante en la microbiota intestinal de los animales y los humanos. Su presencia en los alimentos es un indicador de una posible contaminación fecal. Algunas cepas pueden causar enfermedades, lo cual se deben principalmente al consumo de agua y/o alimento contaminado. Como aportación al panorama epidemiológico en México, el objetivo de este estudio fue determinar la resistencia a compuestos antimicrobianos y el carácter genético de cepas de E. coli presente en las canales y heces de bovinos sacrificados en rastros. Este trabajo se llevó a cabo con 32 cepas aisladas de muestras colectadas de bovinos en tres rastros municipales del centro de México. Se analizó el perfil de resistencia y la relación genética entre los diferentes aislados mediante genotipificación con la enzima XbaI y la técnica PFGE. Se construyó un dendrograma utilizando el coeficiente de similitud de Dice con una tolerancia del 1.5 %. El 75 % 991


Rev Mex Cienc Pecu 2020;11(4):991-1003

(24/32) de los aislados presentaron resistencia a algún antibiótico. El 84.3 % (27/32) de ellos tenían un perfil intermedio y el 12.5 % (4/32) eran sensibles a todos los antibióticos. El 28.1 % (9/32) fueron resistentes a múltiples fármacos (MDR). Se identificaron 27 pulsotipos en el PFGE. En el dendrograma se formaron siete racimos con dos o más aislados (A-F e I) y dos integrados de una cepa (G y H). Los resultados demuestran la diversidad de resistencia antimicrobiana entre las cepas de E. coli presentes en las canales y heces bovinas en México. Estas cepas son un claro factor de riesgo y un problema de salud pública. Palabras clave: Escherichia coli, Contaminación de heces, Canal, Contaminación de alimentos.

Recibido: 01/10/2018 Aceptado: 12/11/2019

Introducción Escherichia coli (E. coli) puede colonizar al tracto gastrointestinal tanto de los humanos como los animales sin causar daño. Existen varias cepas patógenas de E. coli las cuales constituyen un grupo heterogéneo de organismos con diferentes propiedades de virulencia, serotipos O:H y epidemiología. Con base en los factores de virulencia específicos y las características fenotípicas de cada cepa, las cepas se han subdividido en seis grupos patogénicos: E. coli enteropatógena (EPEC); E. coli enteroagregativa (EAEC); E. coli enterotoxigénica (ETEC); E. coli de difusadherente (DAEC); E. coli enteroinvasora (EIEC) y E. coli enterohemorrágica (EHEC)(1). Uno de los más importantes factores de virulencia en las E. coli son las toxinas Shiga (Stx) y los productos de la isla de patogenicidad como el locus del borrado del enterocito (LEE por sus siglas en inglés). Las cepas que producen la Stx se denominan E. coli productora de toxina Shiga (STEC), y uno de los serotipos más comunes es el E. coli O157:H7. Sin embargo, hay otros serotipos no-O157:H7(2), y estos se han detectado en diferentes productos, como carnes, lácteos, pescados, mariscos, bebidas, hielo y legumbres(3). Principalmente han sido implicados en brotes asociados al consumo de carne bovina, su principal reservorio(4). En bovinos sanos las cepas STEC se encuentran con prevalencias de 7 a 30 %, y parece que no son patógenas para los animales. Empero, se han detectado con mayor frecuencia en animales que tienen diarrea(5), sugiriendo que la carne puede contaminarse por medio de materia fecal que contiene E. coli durante un procesamiento inadecuado del canal en el rastro. La E. coli puede intercambiar material genético a través de elementos genéticos móviles (MGE por sus siglas en inglés) como plásmidos, transposones e integrones. Este intercambio facilita su adaptación a entornos nuevos y adversos, desde luego 992


Rev Mex Cienc Pecu 2020;11(4):991-1003

contribuyendo a las enfermedades intestinales o extraintestinales. Aunque las cepas de E. coli se diferencian por su virulencia, resistencia, incidencia y gravedad, también se distinguen por el resultado de su interacción con los factores del huésped y el medio ambiente(4). En animales se utilizan a los compuestos antimicrobianos con tres propósitos principales: promoción del crecimiento, medidas profilácticas y como terapia cuando ocurre una enfermedad(6,7). Su uso constante ha promovido la supervivencia de cepas resistentes que constantemente están desarrollando nuevos mecanismos de resistencia. Estas se están extendiendo por todo el mundo y como consecuencia poniendo en peligro la capacidad para tratar enfermedades infecciosas comunes, además de prolongar la enfermedad e incrementar la discapacidad y la mortalidad(8). Algunas cepas resistentes de E. coli están presentes en las personas, los animales y el medio ambiente (agua, suelo y aire). Se pueden transmitir de las personas a los animales y viceversa, incluso a través del consumo de productos de origen animal. Desde luego un manejo inadecuado del control de las infecciones, las condiciones de procesamiento, la higiene y la manipulación de los alimentos puede promover la propagación de la resistencia a los antimicrobianos(8). El impacto de la enfermedad causada por las STEC hace hincapié a la necesidad de incrementar las medidas preventivas de manipulación de alimentos y la vigilancia de brotes(9). Además de las investigaciones epidemiológicas tradicionales, el principal método molecular de vigilancia es la electroforesis de gel de campo pulsado (PFGE por sus siglas en inglés). Este método es lo recomendado por el Centro para el Control y la Prevención de Enfermedades (CDC por sus siglas en inglés)(10), dado que es crucial en detectar las infecciones por STEC(11). En México existen serotipos de STEC en bovinos que pueden estar involucrados en las enfermedades transmitidas por alimentos(12,13). El objetivo del presente estudio fue caracterizar y relacionar STEC de diferentes orígenes para contribuir a la descripción de su diversidad genética en México.

Material y métodos Aislados Se usaron un total de 32 aislados de E. coli en el análisis. Se obtuvieron de canales y heces de ganado que se muestrearon en tres rastros municipales (A, B y C) en el centro de México. Los aislados pertenecían a 16 serotipos según una serie de ensayos de aglutinación de serotipificación utilizando placas de microtitulación de 96 pocillos y sueros de conejo (SERUNAM, Ciudad de México, México) en las que probaron 187 antígenos somáticos y 53 antígenos flagelares para E. coli y 45 antígenos somáticos para especies de Shigella. Todos los aislados se recuperaron de cultivos madre congelados. Se cultivaron en agar MacConkey a 37 °C durante 24 h. Se seleccionaron las colonias con la morfología típica, las cuales se cosecharon y sembraron en caldo de tripticasa de soja para su posterior caracterización adicional. 993


Rev Mex Cienc Pecu 2020;11(4):991-1003

Pruebas de susceptibilidad a los antimicrobianos La evaluación de la resistencia bacteriana a los compuestos antimicrobianos se realizó mediante la técnica de Kirby-Bauer estandarizada por el Clinical Laboratory Standards Institute (CLSI). La cepa control fue E. coli ATCC 25922. En las pruebas se usaron doce compuestos antimicrobianos: amikacina (AK 30 μg), ampicilina (AM 10 μg), carbencilina (CB 100 μg), cefalotina (CF 30 μg), cefotaxima (CTX 30 μg), ceftriaxona (CRO 30 μg), cloranfenicol (CL 30 μg), gentamicina (GE 10 μg), netilmicina (NET 30 μg), nitrofurantoína (NF 300 μg), pefloxacina (PEF 5 μg) y trimetoprima-sulfametoxazol (STX 25 μg) (Sensidisks, Gram Negative BIO-RAD Cat# 71080280). Se ajustó el inóculo bacteriano a una turbidez equivalente a 0.5 de la escala de McFarland y se sembró en Agar Mueller Hinton con un hisopo estéril. Se colocaron los Sensidisks sobre el inóculo y se incubaron a 37 °C durante 24 h. Todos los aislados se clasificaron como resistentes, intermedios o susceptibles. Los aislados que presentaban resistencia a tres o más tipos de agentes antimicrobianos se clasificaron como resistentes a fármacos múltiples (MDR por sus siglas en inglés)(14).

Electroforesis en gel de campo pulsado (PFGE) El análisis de relación clonal de los aislados de E. coli se realizó mediante la técnica PFGE según el protocolo estandarizado por el CDC para la PulseNet. Como marcador se utilizó la cepa de Salmonella Serovar Braenderup H9812(15). Las condiciones de electroforesis fueron las establecidas según el protocolo de PulseNet sugerido para el modelo Cheef DrII (Bio-Rad, Múnich, Alemania): tiempo inicial: 2.2 seg, tiempo final: 63.8 seg, voltaje: 6v/cm2, y tiempo de ejecución: 21 h(10). Se tiñó el gel con 200 mL de bromuro de etidio durante 40 min a 100 rpm y posteriormente se lavó con 200 mL de agua destilada durante 1 h a 100 rpm. El patrón de bandas se visualizó bajo la luz ultravioleta (UV) y se tomó una imagen digital de los patrones por medio de un SmartGeL II (Sagecreation). Las bandas obtenidas se analizaron con el software BioNumerics versión 7.5 (Applied Maths, Austin, TX). Este programa permite comparar los patrones de bandas obtenidos en diferentes geles e identificar los diferentes perfiles de restricción. El establecimiento de la relación genética entre las cepas se realizó aplicando el coeficiente de similitud de Dice entre los diferentes patrones de bandas obtenidos. Con los resultados se construyó un dendrograma mediante el método de agrupación de pares no ponderado con medias aritméticas (UPGMA por sus siglas en inglés) con un valor de tolerancia del 1.5 %.

Resultados Del total de los 32 aislados probados la mayoría (75 %; 24 de 32) mostraron resistencia a alguno de los antibióticos utilizados. Nueve de los aislados (28.1 %) se clasificaron como 994


Rev Mex Cienc Pecu 2020;11(4):991-1003

MDR, 27 (84.3 %) presentaron un perfil intermedio en al menos un antibiótico y cuatro (12.5 %) fueron sensibles a todos los antimicrobianos. La frecuencia de resistencia varió ampliamente entre los antimicrobianos: 46.9 % (15/32) con CB, 50 % (16/32) con CF, 37.5 % (12/32) con AK, 28.1 % (9/32) con GE, 21.9 % (7/32) con AM y 3.1 % (1/32) con CTX. Varios aislados mostraron un perfil de resistencia intermedio: 56.3 % (18/32) con AM y 46.9 % (15/32) con PEF. Solo el SXT generó sensibilidad en todos los aislados (Figuras 1 y 2). Figura 1: Perfil de PFGE (XbaI) generado con aislados de STEC de canales y heces de ganado de tres rastros municipales en el centro de México

Columnas (izq. a der.): serotipos (O:H), identificación, origen (Heces, Canal), rastro (A, B, C), perfil de virulencia (stx, etcétera) y perfil de resistencia (NF-Nitrofurantoína, CB-Carbencilina, PEF- Pefloxacina, NET-Netilmicina, GE-Gentamicina, CTX-Cefotaxina, STX-Trimetoprima-sulfametoxazol, AKAmikacina, AM-Ampicilina, CRO-Ceftriaxona, CL-Cloranfenicol y CF-Cefalatoxina; S = susceptible, R = resistente, I = intermedio).

Se analizó la relación genética entre los diferentes aislados de E. coli mediante la genotipificación con la enzima XbaI-PFGE. De los 32 aislados estudiados se observaron 27 pulsotipos de PFGE. Se formaron siete agregaciones con dos o más aislados (A-F e I) y dos constituidas por una sola cepa (G y H); todos estos tenían porcentajes de similitud superiores al 85% (Figura 2). Las agregaciones D, E, F y G agruparon los aislados clasificados como MDR. Se identificaron cinco pulsotipos clonales. Los pulsotipos clonales 1 y 2 son del serotipo O22:H8 (agregación B). El primero proviene de diferentes fuentes como canales (aislado 48) y heces (aislado 50) mientras el segundo es de heces (aislados 46 y 51); sin embargo, sus perfiles de resistencia son diferentes. El tercer pulsotipo clonal (agregación D) es del serotipo O118:H21 y su origen es heces y canales 995


Rev Mex Cienc Pecu 2020;11(4):991-1003

(aislados 44 y 21), pero el perfil de resistencia es diferente. El cuarto pulsotipo (agregación F) es del serotipo O?:H51 y proviene de canales y heces (aislados 25 y 28); uno de los aislados es MDR. El quinto pulsotipo (agregación I) es del serotipo O37:H7, es de heces y canales (aislados 3 y 6) y ambos están sensibles a todos los antimicrobianos. Es de notar que los aislados MDR se encuentran en diferentes pulsotipos, lo que muestra su diversidad (Figura 2). Figura 2: Resistencia antimicrobiana de los aislados STEC de canales y heces bovinas de tres rastros municipales en el centro de México

Discusión Cada año las STEC contribuyen a 265,000 casos de enfermedades transmitidas por alimentos en los Estados Unidos; hay informes de la resistencia a los fármacos antimicrobianos entre las STEC pero es probable que la subestiman(16). Responsable por más de 700,000 muertes al año, la resistencia a los compuestos antimicrobianos entre los microbios es uno de los problemas más graves en el ámbito médico actual(17). En las bacterias la resistencia se debe a una aceleración de los genes de resistencia a los antimicrobianos (ARG por sus siglas en inglés) a través de una mutación de novo. La transferencia horizontal de MGE, como los plásmidos, los transposones y los integrones(18), se puede volver un asunto grave de salud pública particularmente en las bacterias transmitidas por la carne ya que es un importante portador de las cepas de E. coli resistentes a los antimicrobianos(17). En el presente estudio se identifica las cepas de STEC en canales y heces bovinos y el 28.1 % de ellas son MDR, representando un riesgo especial. Todos los aislados STEC se mostraron sensibles al STX, pero su uso como tratamiento en infecciones de STEC en los humanos puede inducir la producción de la toxina Shiga lo cual puede llevar a una enfermedad más grave(19). La mejor estrategia para evitar las infecciones con STEC es tener un control del procesamiento de la canal. Varios estudios indican que los alimentos de origen animal suelen estar contaminados con bacterias y que es necesario mejorar el procesamiento del canal ya que la contaminación de las canales se produce por un mal manejo del contenido intestinal de los animales portadores(2). Por ejemplo, en un estudio realizado en México 996


Rev Mex Cienc Pecu 2020;11(4):991-1003

usando muestras aisladas de carne de res se encontró que el 92.4 % de las cepas eran MDR(20). En contraste al presente estudio, estas cepas mostraron patrones de resistencia contra siete a nueve antibióticos a la vez (44 %, n= 77), lo que podría deberse a que las muestras se obtuvieron en supermercados. La contaminación cruzada es de suma importancia ya que la exposición en la etapa de venta representa una exposición cumulativa a toda la cadena de producción (desde la granja hasta la mesa) lo que incrementa el riesgo potencial para la salud pública(17). En otro estudio se analizaron aislados de STEC asociados con brotes, recolectados durante 2010-2014 y guardados en el Laboratorio de Referencia del Departamento de Salud y Servicios Humanos de Michigan (Lansing, MI, EE.UU.)(16). Estos aislados presentaron resistencia a la ampicilina, la trimetoprima/sulfametoxazol y la ciprofloxacina, y su frecuencia de resistencia varió según su ubicación y origen, aunque no hubo diferencias en frecuencia entre localidades, lo cual coincide con observaciones en México. Una vigilancia permanente de los antibióticos utilizados en el ganado es de gran importancia para determinar la presencia y prevalencia de las cepas resistentes en las canales(8). Cuando no se manipula y cocina adecuadamente la carne de res contaminada con bacterias resistentes a los antimicrobianos estas pueden transferir sus genes de resistencia a otros patógenos, además de dejar sus toxinas, lo que podría conducir a enfermedades más difíciles de tratar(21). Cocinar la carne contaminada resulta en una reducción mayor del riesgo de enfermedad(17). Sin embargo, hay estudios que muestran que la E. coli puede sobrevivir al calentamiento hasta los 70 °C, conservando sus características y los genes que codifican la resistencia, y manteniendo la capacidad de transferir por electroporación, resaltando el riesgo de una transformación natural(22). Por lo tanto, la estrategia más indicada para reducir el riesgo de infecciones por STEC consiste en reducir su prevalencia en el ganado aplicando prácticas de producción adecuadas y mejoras en el manejo de canales en los rastros. En los presentes resultados se identifican varios elementos importantes de las STEC. El serotipo O157:H7, lo cual puede presentarse de forma asintomática o puede causar el desarrollo de diarrea, colitis hemorrágica y/o síndrome urémico hemolítico(2), mostró resistencia a cinco antibióticos: AK, AM, CB , CF y GE. El serotipo O117:H4, un serotipo emergente con una presencia epidemiológicamente fuerte que causa sepsis en humanos y se ha encontrado en bovinos con diarrea(23), presentó resistencia solo al AM. El serotipo O22:H8 presentó resistencia al AK, CB, CF y GE. Se ha asociado a la enfermedad en humanos y se ha identificado en Brasil(24), Francia(25) y Argentina(26). Estos resultados coinciden con la variabilidad en resistencia reportada en otros partes de México y el mundo. En un estudio en el Valle de Culiacán, en el noroeste de México, varias cepas de O157 y no-O157 STEC se encontraron resistentes a los antimicrobianos pertenecientes a clases como los aminoglucósidos, betalactámicos y cefalosporinas(19). En el estado de Tamaulipas, México, un análisis de muestras de carne a la venta a menudo encontró que el 92.4 % de las cepas aislados fueron resistentes a la cefalotina, la ampicilina, la cefotaxima y la nitrofurantoína(20). En un estudio realizado en Etiopía, las resistencias más frecuentes entre los aislados fueron contra la cefoxitina, la ampicilina y la 997


Rev Mex Cienc Pecu 2020;11(4):991-1003

amoxicilina(27). Aislados de E. coli de muestras de dos granjas avícolas intensivas en China coleccionadas entre el 2000 y el 2012 mostraron ser fuertemente resistentes al SXT, la AM y la GM(28). En el mismo estudio se encontró cepas con resistencia a las sulfonamidas, pero esto se debe a que las unidades de producción avícola sufren de cuadros diarreicos de origen bacteriano y parasitario. Asimismo, las STEC no-O157 aisladas de los seres humanos y de animales han mostrado resistencia a múltiples antimicrobianos, incluida la resistencia a la trimetoprima-sulfametoxazol(28). Un análisis de aislados de animales y humanos (niños con diarrea) en Egipto encontró que presentaron resistencia a uno o más agentes antibióticos, y que fueron resistentes a la cefalotina, de manera independiente de su origen (alimenticio o humano). Estos mismos aislados han estado estrechamente relacionados (97 %) con las heces del ganado Suizo y las enfermedades en humanas en Alemania(29). En conjunto con los resultados de los estudios citados, los presentes resultados resaltan que el uso de antibióticos en entornos ganaderos puede llevar a la existencia de bacterias multirresistentes. El serotipo O157:H7 se encontró únicamente en el rastro C, en cuatro muestras de canales y una de heces, todas tomadas en diferentes momentos. Este resultado enfatiza la importancia del manejo de canales en los rastros y demuestra la ocurrencia de la contaminación cruzada. Los hechos de que tomaron las muestras en diferentes momentos y que ninguno de estos aislados era clones (tienen un 83.3 % de similitud) confirma la contaminación cruzada. En un estudio sobre los productos cárnicos llevado a cabo desde el 2004 hasta el 2013, también se encontró una similitud del 67% y la ausencia de una relación clonal entre los aislados(30). Este confirma una vez más que los productos cárnicos son una fuente importante de la contaminación debido a un manejo inadecuado durante el procesamiento de canales y la obtención de productos y subproductos de origen bovino(31). Un ejemplo adicional es un estudio en Argentina, donde el 12% de las infecciones con cepas de E. coli son de origen bovino(32). Se identificaron aislados del mismo origen en humanos con síndrome urémico hemolítico, en salsas y en carne de res cocida y cruda. En el presente estudio los seis aislados del serotipo O22:H8 presentaron diversidad y se agruparon en cuatro pulsotipos: los primeros dos en canales y heces, con perfiles de resistencia diferentes; y los otros dos solo en heces. Este sugiere que estos aislamientos probablemente pertenecen a animales que se encontraron en la misma unidad de producción (91.1 % de similitud). Este serotipo se identificó solo en el rastro C, pero representa un riesgo serio ya que se ha asociado con una enfermedad grave en los humanos. Del serotipo O112:H2 se identificaron tres aislados diferentes: dos de canal y uno de heces. Cada aislado viene de un rastro diferente (A, B y C) y tiene un 88.1 % de similitud, sugiriendo que este serotipo se encuentra a través del área central de México. También se ha encontrado el O112:H2 en carne de vacuno(33) y en hamburguesas(34), indicando que la fuente más probable será la canal. Los clones del serotipo O118:H21 vienen de canal y de heces muestreados del mismo rastro (C), aunque en diferentes momentos. Desde luego existe la posibilidad de que los animales sean de la misma unidad de producción o que este serotipo no sea tan diverso. La variación en serotipos encontrado 998


Rev Mex Cienc Pecu 2020;11(4):991-1003

en el presente estudio es menos que la reportada en otros estudios en México. Por ejemplo, en un análisis de aislados de E. coli de cuatro fincas rurales en Culiacán, México, se encontró que el serotipo O157:H7 presenta seis pulsotipos en uno de los clones identificados que viene de bovinos, ovinos y aves(12). En otro estudio realizado en un rastro tipo inspección federal (TIF) en México en 2009-2010, se encontraron 49 pulsotipos en 97 aislados de O157:H7 agrupados en tres agregaciones y con un 80% de similitud(13). Las diferencias entre los estudios en cuanto al número de aislados y serotipos probablemente es un resultado de los distintos manejos de los animales y/o las canales en cada lugar de muestreo. En las fincas de Culiacán el control del manejo sería menos minucioso que en el rastro TIF donde siguen protocolos estrictos en el manejo de los canales. En el presente estudio los aislados originaron de muestras de rastros municipales, donde el manejo es mucho menos riguroso y los animales vienen de varias unidades de producción. La presencia de STEC en los animales que procesan estos rastros, que abastecen una de las principales áreas metropolitanas de México, es causa de preocupación ya que incrementa de manera considerable la posibilidad de la contaminación de los productos cárnicos durante el procesamiento. Los resultados del presente estudio hacen hincapié a la necesidad de un monitoreo mucho más extenso y profundo en la industria agropecuaria de México. También sugieren que hay un proceso de contaminación cruzada muy amplia que involucra una variedad de serotipos de E. coli. Este problema no es exclusivo a México. Por ejemplo, en una investigación epidemiológica realizada en el noreste de Inglaterra, indagaron sobre las infecciones producidas por STEC y asociadas con el consumo de productos cárnicos y unidades de producción ganadera. Al secuenciar los aislados se encontró nexos epidemiológicos entre los casos clínicos, los carniceros y la finca proveedora del producto, mostrando de esta manera la contaminación cruzada por medio de la carne molida, entre otros productos(35).

Conclusiones e implicaciones El ganado es el principal reservorio de las cepas de E. coli y desde luego el manejo que se da en las unidades de producción pecuaria y los rastros es de suma importancia. Se recomienda un uso prudente de los antibióticos en el ganado con tal de evitar el desarrollo de la resistencia a ellos y de mantener su eficacia. Su uso inadecuado fomenta la evolución de cepas de bacterias resistentes que pueden colonizar el tracto gastrointestinal humano a través de la cadena alimentaria, como los serotipos que se identificaron en este estudio. Con frecuencia estos serotipos conllevan la presencia de toxinas, que puedan causar efectos adversos y tener implicaciones clínicas. La presencia en México de varios serotipos de E. coli con resistencia comprobada a los antibióticos es, sin duda, un grave problema de salud pública.

999


Rev Mex Cienc Pecu 2020;11(4):991-1003

Literatura citada: 1. Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol;2004;2(2):123-40. 2. Krüger A, Lucchesi PM. Shiga toxins and stx phages: highly diverse entities. Microbiol 2015;161(3):451-462. 3. Al-Nabulsi AA, Holley RA. Effects on Escherichia coli O157:H7 and meat starter cultures of bovine lactoferrin in broth and microencapsulated lactoferrin in dry sausage batters. Int J Food Microbiol 2007;113(1):84-91. 4. Krüger A, Burgán J, Friedrich AW, Rossen JWA, Lucchesi PMA. ArgO145, a Stx2a prophage of a bovine O145:H- STEC strain, is closely related to phages of virulent human strains. Infect Genet Evol 2018;(60):126-132. 5. Melton-Celsa AR, O’Brien AD. E. coli Methods in Molecular Medicine. First ed. l. Totowa, New Jersey: Humana Press 2003:55-75. 6. Galland JC, Hyatt DR, Crupper SS, Acheson DW. Prevalence, antibiotic susceptibility, and diversity of E coli 0157:H7 isolates from a longitudinal study of beef cattle feedlots. Applied Environ Microbiol 2001;67(4):1619-1627. 7. Schroeder MC, Zhao C, DebRoy C, Torcolini J, Zhao S, White DG, et al. Antimicrobial Resistance of Escherichia coli O157 Isolated from Humans, Cattle, Swine, and Food. Applied Envirol Microbiol 2002;68(2):576-581. 8. World Health Organization. Antimicrobial. Resistance. Global report on Surveillance. WHO, Geneva, Switzerland (2014). http://apps.who.int/iris/bitstream/10665/112642/1/9789241564748_eng.pdf?ua=1. Accessed Feb 12, 2018. 9. Bustamante AV, Sanso AM, Parma AE, Lucchesi PM. Subtyping of STEC by MLVA in Argentina. Front Cell Infect Microbiol 2012;(22):111. 10. Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB, Swaminathan B, Barrett TJ. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis 2006;3(1):59-67. 11. Bustamante AV, Sanso AM, Lucchesi PM, Parma AE. Genetic diversity of O157:H7 and non-O157 verocytotoxigenic Escherichia coli from Argentina inferred from multiple-locus variable-number tandem repeat analysis (MLVA). Int J Med Microbiol 2010;300(4):212-217.

1000


Rev Mex Cienc Pecu 2020;11(4):991-1003

12. Amézquita-López BA, Quiñones B, Cooley MB, León-Félix J, Castro-del Campo N, Mandrell RE, Jiménez M, Chaidez C. Genotypic analyses of shiga toxinproducing Escherichia coli O157 and non-O157 recovered from feces of domestic animals on rural farms in Mexico. PLoS One 2012;7(12):515-565. 13. Narváez-Bravo C, Echeverry A, Miller MF, Rodas-González A, Brashears MT, Aslam M, et al. Virulence characterization and molecular subtyping of typical and atypical Escherichia coli O157:H7 and O157:H(-) isolated from fecal samples and beef carcasses in Mexico. J Food Prot 2015;78(2):264-72. 14. CLSI (2015) Clinical and Laboratory Standard Institute. Performance standards for antimicrobial susceptibility testing; Twenty-Fifth Informational Supplement. CLSI document M100-S25, Wayne, PA. 15. Jaros P, Cookson AL, Campbell DM, Besser TE, Shringi S, Mackereth GF, et al. A prospective case-control and molecular epidemiological study of human cases of Shiga toxin-producing Escherichia coli in New Zealand. BMC Infect Dis 2013;(30):450. 16. Mukherjee S, Mosci RE, Anderson CM, Snyder BA, Collins J, Rudrik JT, et al. Antimicrobial Drug-Resistant Shiga Toxin-Producing Escherichia coli Infections, Michigan, USA. Emerg Infect Dis 2017;23(9):1609-1611. 17. Nekouei O, Checkley S, Waldner C, Smith BA, Invik J, Carson C, et al. Exposure to antimicrobial-resistant Escherichia coli through the consumption of ground beef in Western Canada. Int J Food Microbiol 2018;(272):41-48. 18. Zhang Y, Gu AZ, Cen T, Li X, Li D, Chen J. Petrol and diesel exhaust particles accelerate the horizontal transfer of plasmid-mediated antimicrobial resistance genes. Environ Int 2018;(114):280-287. 19. Amézquita-López BA, Quiñones B, Soto-Beltrán M, Lee BG, Yambao JC, LugoMelchor OY, et al. Antimicrobial resistance profiles of Shiga toxin-producing Escherichia coli O157 and Non-O157 recovered from domestic farm animals in rural communities in Northwestern Mexico. Antimicrob Resist Infect Control 2016;(5):1. 20. Martínez-Vázquez AV, Rivera-Sánchez G, Lira-Méndez K, Reyes-López MA, Bocanegra-García V. Prevalence, antimicrobial resistance and virulence genes in Escherichia coli isolated from retail meats in Tamaulipas, México. J Glob Antimicrob Resist 2018;(14):266-272. 21. Donkersgoed JV, Graham T, Gannon V. The prevalence of verotoxins, Escherichia coli O157, and Salmonella in the feces and rumen of cattle at processing. Can Vet J 1999;40(5):332-338.

1001


Rev Mex Cienc Pecu 2020;11(4):991-1003

22. Le Devendec L, Jouy E, Kempf I. Evaluation of resistance gene transfer from heattreated Escherichia coli. Int J Food Microbiol 2018;(270):39-43. 23. Mandal PK. Synthesis of the pentasaccharide repeating unit of the O-antigen of E. coli O117:K98:H4. Beilstein J Org Chem 2014;(10):2724-2728. 24. Timm CD, Irino K, Gomes TA, Vieira MM, Guth BE, Vaz TM, et al. Virulence markers and serotypes of Shiga toxin-producing Escherichia coli, isolated from cattle in Rio Grande do Sul, Brazil. Lett Appl Microbiol 2007;44(4):419-425. 25. Pradel N, Livrelli V, De Champs C, Palcoux JB, Reynaud A, Scheutz F, et al. Prevalence and characterization of Shiga toxin-producing Escherichia coli isolated from cattle, food, and children during a one-year prospective study in France. J Clin Microbiol 2000;38(3):1023-1031. 26. Bentancor A, Rumi MV, Carbonari C, Gerhardt E, Larzábal M, Vilte DA, et al. Profile of Shiga toxin-producing Escherichia coli strains isolated from dogs and cats and genetic relationships with isolates from cattle, meat and humans. Vet Microbiol 2012;156(3-4):336-342. 27. Shecho M, Thomas N, Kemal J, Muktar Y. Cloacael Carriage and Multidrug Resistance Escherichia coli O157:H7 from Poultry Farms, Eastern Ethiopia. J Vet Med 2017;(2017):8264583. 28. Gai W, Wang J, Wang J, Cui Z, Qu Z, Cui J, et al. Molecular classification and drug resistance analysis of Escherichia coli isolated from poultry in China. Int J Clin Exp Med 2015;8(1):836-844. 29. Hamed OM, Sabry MA, Hassanain NA, Hamza E, Hegazi AG, Salman MB. Occurrence of virulent and antibiotic-resistant Shiga toxin-producing Escherichia coli in some food products and human stool in Egypt. Vet World 2017;10(10):12331240. 30. Jure MA, Condorí MS, Pérez Terrazzino G, Catalán MG, López Campo A, Zolezzi G, et al. Isolation and characterization of Escherichia coli O157 in bovine meat products and cattle in the province of Tucuman. Rev Argent Microbiol 2015;47(2):125-131. 31. Bibbal D, Loukiadis E, Kérourédan M, Ferré F, Dilasser F, Peytavin de Garam C, et al. Prevalence of carriage of Shiga toxin-producing Escherichia coli serotypes O157:H7, O26:H11, O103:H2, O111:H8, and O145:H28 among slaughtered adult cattle in France. Appl Environ Microbiol 2015;81(4):1397-1405. 32. D'Astek BA, del Castillo LL, Miliwebsky E, Carbonari C, Palladino PM, Deza N, et al. Subtyping of Escherichia coli O157:H7 strains isolated from human infections and healthy cattle in Argentina. Foodborne Pathog Dis 2012;9(5):457-464.

1002


Rev Mex Cienc Pecu 2020;11(4):991-1003

33. Hussein HS. Prevalence and pathogenicity of Shiga toxin-producing Escherichia coli in beef cattle and their products. J Anim Sci 2007;85(13):63-72. 34. Franci T, Sanso AM, Bustamante AV, Lucchesi PM, Parma AE. Genetic characterization of non-O157 verocytotoxigenic Escherichia coli isolated from raw beef products using multiple-locus variable-number tandem repeat analysis. Foodborne Pathog Dis 2011;8(9):1019-1023. 35. Wilson D, Dolan G, Aird H, Sorrell S, Dallman TJ, Jenkins C, et al. Farm-to-fork investigation of an outbreak of Shiga toxin-producing Escherichia coli O157. Microb Genom 2018;4(3):1-7.

1003


https://doi.org/10.22319/rmcp.v11i4.5386 Artículo

Resistencia antimicrobiana de Salmonella spp aisladas de canales de cerdo obtenidas de dos tipos de rastros en Jalisco, México

Vicente Vega-Sánchez a Jeannette Barba-León b* Delia Guillermina González-Aguilar b Elisa Cabrera-Díaz b Carlos Pacheco-Gallardo b† Adriana Guadalupe Orozco-García b

a

Universidad Autónoma del Estado de Hidalgo, Instituto de Ciencias Agropecuarias, Hidalgo, México. b

Universidad de Guadalajara, Centro Universitario de Ciencias Biológicas y Agropecuarias, Departamento de Salud Pública, Camino Ramón Padilla Sánchez No. 2100 Nextipac, Zapopan. 45200, Jalisco México.

* Autor de correspondencia: jeannette.barba@academicos.udg.mx

Resumen: Salmonella es una de las principales bacterias que originan enfermedades transmitidas por alimentos. El estudio de la resistencia mostrada por Salmonella a diferentes antimicrobianos ha cobrado importancia en los últimos años debido a las complicaciones en el tratamiento de las infecciones causadas por cepas resistentes. Este estudio muestra el perfil de resistencia de cepas de Salmonella aisladas en dos rastros que se diferencian en los procesos de sacrificio y faenado del ganado porcino. Los resultados de este estudio muestran que el rastro que ha implementado y cumple con los procesos sanitarios de obtención de la carne tiene una menor cantidad de aislamientos de Salmonella (1.3 %), que aquel cuyas prácticas de higiene son menos rigurosas (46.8 %) (P<0.05). Los principales serotipos de Salmonella encontrados fueron London (44.7 %), Anatum (15.8 %), Agona, Muenchen y Typhimurium (7.9 %). La resistencia a los aminoglucósidos (100 %), tetraciclinas (73.7 %) y ciprofloxacina (44.7 %) fueron predominantes en los

1004


Rev Mex Cienc Pecu 2020;11(4):1004-1015

aislamientos evaluados. El 66.6 % de las cepas evaluadas fueron resistentes a 3 ó 4 clases diferentes de antimicrobianos, y se encontró la presencia del gen que codifica para la integrasa 1. Los resultados muestran que Salmonella ha adquirido diferentes elementos genéticos que la vuelven resistente a diferentes clases de antimicrobianos, complicando el tratamiento de una infección causada por este patógeno. Así mismo, sugieren que la implementación y cumplimiento de los procesos sanitarios de obtención de la carne del ganado porcino disminuyen los aislamientos de Salmonella en las canales. Palabras clave: Rastros, Salmonella, Canales de cerdo, Serotipos, Resistencia antimicrobiana.

Recibido: 20/05/2019 Aceptado: 25/11/2019

Introducción El estudio de la frecuencia de bacterias patógenas en alimentos, así como el análisis de la resistencia a antimicrobianos que poseen, es uno de los temas de estudio que han cobrado relevancia en años recientes debido a la dificultad observada en el tratamiento de las enfermedades ocasionadas por bacterias patógenas resistentes(1). En la reunión de expertos convocada por la Organización de las Naciones Unidas para la Alimentación y la Agricultura (FAO, por sus siglas en inglés) y la Organización Mundial de la Salud (OMS) que se llevó a cabo en el 2018, trataron el tema de los patógenos resistentes en alimentos, su papel en el ambiente, los cultivos y los biocidas. Estableciendo cinco áreas prioritarias de vigilancia, entre las que destacan la presencia de bacterias resistentes, residuos tóxicos y genes de resistencia en el ambiente cercano a la producción de alimentos; el uso frecuente de anitimicrobianos en la producción de alimentos y su relación con el desarrollo de bacterias resistentes, y la integración de sistemas de supervisión integrada, que vigilen las prácticas que se siguen en los procesos de todas las etapas de la producción y distribución de alimentos(2). Al respecto, Estados Unidos de Norteamérica y los países que conforman la Unión Europea, han implementado sistemas de supervisión como el Sistema Nacional de Monitoreo de la Resistencia Antimicrobiana (NARMS, por sus siglas en inglés) y la Autoridad Europea en Seguridad Alimentaria (EFSA, por sus siglas en inglés)(3,4). Existe una gran cantidad de reportes que muestran que la frecuencia de bacterias patógenas y resistentes en alimentos es un problema que se presenta en diversos países. La cantidad de cepas patógenas resistentes reportadas es diferente en cada región del

1005


Rev Mex Cienc Pecu 2020;11(4):1004-1015

mundo, pero dicha cantidad está en relación a la implementación y seguimiento de medidas de control en los procesos de producción de alimentos(4-6). El consumo de carne de cerdo en México se ha incrementado debido a que su precio es competitivo con el reportado para otro tipo de carnes como las de ave o bovino. Para el 2017, el consumo de carne de cerdo en la población mexicana fue 19 kg/persona/año(7) y a nivel internacional en 2018 se estimó que México ocuparía el décimo lugar en la producción mundial de carne de cerdo, con una aportación de 1.5 millones de toneladas. Para ese mismo año, se pronosticó que la producción anual de carne de cerdo crecería en un 2.3 % con una producción de 113.5 millones de toneladas, siendo Jalisco, Sonora, Puebla, Yucatán y Veracruz las entidades donde se concentraría el 69.4 % de la producción nacional(8). En México operan dos tipos de rastros, los rastros Tipo Inspección Federal (TIF) y los rastro no certificados de competencia municipal (RNC)(9). El rastro TIF es una instalación de sacrificio de animales de abasto e industrializadores de productos y subgrupos cárnicos, que es objeto de una inspección sanitaria permanente por parte de la Secretaría de Agricultura y Desarrollo Rural (SADER) donde se garantizan productos de óptima calidad higiénico sanitaria(10). Por su parte los rastros RNC son instalaciones propiedad del municipio, que se destinan al sacrificio y faenados de animales de abasto y que deben de cumplir con lo establecido en la NOM-194-SSA-2004(11).

Material y métodos El objetivo de este estudio fue aislar Salmonella enterica en canales de cerdo procesadas en dos tipos de rastro (TIF y RNC) y analizar la resistencia de los aislamientos contra 10 antimicrobianos de uso humano y veterinario. Para este estudio se recolectaron 159 muestras de la superficie de canales de cerdo, 79 de ellas de un establecimiento RNC y 80 de un tipo TIF, ubicados en las zonas Centro y Sur de los Altos de Jalisco, respectivamente. El periodo del muestreo comprendió los meses de octubre del 2013 a mayo del 2014 y se procesaron ocho muestras provenientes de cada rastro cada quince días. Las muestras se colectaron de la superficie de canales seleccionadas aleatoriamente en cada visita. Con una esponja estéril humedecida con 10 ml de agua peptonada amortiguada (APA, DB), se frotó una superficie de 100 cm2 de cada una de las regiones del vientre (panza), jamón y papada para una superficie total de 300 cm2. Las esponjas se introdujeron en bolsas estériles y se colocaron en hieleras con refrigerantes para su transporte al laboratorio de Inocuidad de Alimentos de la Universidad de Guadalajara, donde se analizaron de acuerdo a lo especificado por la técnica MLG 4.04(12).

1006


Rev Mex Cienc Pecu 2020;11(4):1004-1015

El aislamiento de Salmonella spp se llevó a cabo de las esponjas recolectadas adicionándoles 50 ml de APA para obtener un volumen total de 60 ml, posteriormente la muestra se homogenizó en un homogenizador peristáltico (BagMixer ®) por 1 min y se incubó a 35 ± 2°C durante 20 a 24 h. De cada muestra homogenizada se transfirieron 0.1 ml en 9.9 ml de caldo tetrationato (CTT) (BD) y 1 ml en 9 ml de caldo Rappaport Vassiliadis modificado (mRV) (BD). Los caldos selectivos se incubaron a 42 ± 1 °C durante 24 h. La discriminación de muestras se realizó por medio de la reacción de cadena de la polimerasa (PCR) amplificando los genes invA y fimA usando condiciones previamente descritas(13). Transcurridas las 24 h de incubación, se tomaron 500 µl del CTT y 500 µl del mRV para purificar ADN con el kit comercial Wizard (PROMEGA) siguiendo las condiciones del fabricante. Las muestras en donde se observó la amplificación de los genes invA y fimA se continuaron para aislamiento selectivo en agar verde brillante sulfa (VBS, BD) y en Agar Xilosa-lisina-tergitol (XLT4, DB). Las placas de VBS y XLT4 se incubaron a 35 °C ± 2 °C durante 24 a 48 h. De cada agar se seleccionaron tres colonias con morfología típica de Salmonella y se sometieron a pruebas bioquímicas en agar triple azúcar y hierro y en agar hierro y lisina (BD) a 35 ± 2 °C por 24 h. Los aislamientos que mostraron el perfil bioquímico típico de Salmonella se confirmaron por la amplificación de invA y fimA por PCR(13). Cincuenta (50) cepas con morfología y perfil bioquímico típico de Salmonella y confirmadas por PCR, se seleccionaron al azar considerando el envío de una cepa presuntamente positiva por muestra, al Instituto de Diagnóstico y Referencia Epidemiológicos (InDRE) para su confirmación y serotipificación por el método descrito por Kauffmann(14). La comparación entre el número de aislamientos de Salmonella confirmados por el InDRE en cada rastro por mes de aislamiento, se analizó mediante la prueba de análisis de varianza (ANOVA), con el programa estadístico GraphPad Prism8(15). El perfil de susceptibilidad a 10 agentes antimicrobianos de las cepas aisladas de Salmonella, se determinó siguiendo la técnica de Kirby-Bauer, estandarizada por el Clinical and Laboratory Standards Institute(16). Los antimicrobianos evaluados fueron ampicilina (AM, 10 μg), ácido nalidíxico (NA, 30 μg), cefalotina (CF, 30 μg), ceftriaxona (CRO, 30 μg), ciprofloxacino (CIP, 30 μg), cloranfenicol (C, 30 μg), estreptomicina (S, 10 μg), gentamicina (GM, 10 μg), kanamicina (K, 30 μg), tetraciclina (TE, 30 μg) y trimetoprima-sulfametoxazol (SXT, 1.25 y 23.75 μg). La medición de los halos de inhibición (mm) se interpretaron de acuerdo a las tablas del CLSI(17). Escherichia coli ATCC 25922 fue utilizada como control. Se analizó por PCR la presencia de los genes de resistencia tetA y tetB(18) en todos los aislamientos que mostraron resistencia a TE, y de las integrasas 1 (intI1) y 2 (intI2), en las cepas que resultaron multirresistentes a tres o mas clases de antimicrobianos(17) siguiendo un protocolo previamente establecido(18).

1007


Rev Mex Cienc Pecu 2020;11(4):1004-1015

Resultados y discusión Los aislamientos de Salmonella observados en el rastro TIF y en el rastro RNC fueron de 1.3 % (1/80) y 46.8 % (37/79), respectivamente. El análisis de ANOVA realizado muestra diferencias significativas (P<0.05) entre el número de aislamientos obtenidos entre los meses de octubre, enero y febrero, no siendo así para los meses de marzo y abril (Cuadro 1). Estos resultados sugieren que las medidas de control implementadas en el rastro TIF disminuyen significativamente el número de aislamientos de Salmonella en las canales que ahí se procesan, así como el hecho de que sólo se procesan cerdos en dicho rastro. De acuerdo con la EFSA, la implementación de medidas de control en los procesos de sacrificio del ganado porcino tiene un gran impacto en la reducción de la presencia bacterias patógenas que causan gastroenteritis en las canales(4). La cantidad de aislamientos de Salmonella observada en las canales del rastro RNC puede estar relacionada con fallas en el proceso de evisceración. Existe evidencia que demuestra que después de la evisceración del ganado porcino, la contaminación por enterobacterias aumenta en la canal y la cantidad de éstas es diferencial en cada una de las partes de la canal(5), aumentando la contaminación bacteriana en la áreas anteriores y ventrales de la canal cuando hay cortes en las amígdalas durante la remoción de las vísceras, y disminuye cuando las herramientas utilizadas en la remoción de éstas son higienizados posterior a la remoción de las amígdalas(5). Así mismo, la contaminación observada en el rastro RNC puede ser originada por la contaminación cruzada entre las bacterias presentes en el ganado porcino y bovino, debido a que en el rastro RNC evaluado en este estudio, también se lleva a cabo el sacrificio de ganado bovino(19). Cuadro 1: Serotipo, mes de aislamiento y perfil de resistencia de 38 cepas Salmonella enterica aisladas de canales de cerdo en dos tipos de rastros Tipo de rastro

Serotipo

TIF

Typhimurium Agona

Anatum

Bovismorbificans Bredeney Derby

Mes de aislamiento Abril Febrero Febrero Febrero Enero Octubre Enero Enero Enero Enero Octubre Octubre Octubre Enero Febrero Febrero Octubre 1008

Perfil de resistencia GM, K, S, C, NA, TE K, S K K K, NA, STX, TE K, SXT, TE K, NA, TE K, NA K, S K K K, S, C, TE K K K, S, AM, C, TE K, S, NA, TE K, NA, TE


Rev Mex Cienc Pecu 2020;11(4):1004-1015

Octubre Octubre Enero Enero Enero Febrero Febrero Marzo Octubre Enero Enero Enero Febrero Febrero Octubre Febrero Enero Enero Octubre Octubre Octubre

RNC

London

Montevideo Muenchen Typhimurium Senftenberg

K, NA, TE K, NA, TE K, NA, TE K, NA, TE K, NA, TE K, NA, TE K, NA, TE K, NA, TE K, TE K, TE K, TE K, TE K, TE K, TE K K, C, NA, TE K, S, C, TE K, NA, TE GM, K, S, C, NA, TE K, S, C, SXT, TE K, C, TE

TIF= Tipo Inspección federal; RNC= rastro no certificado de competencia municipal, GM= gentamicina, K= kanamicina, , S= estreptomicina, C= cloranfenicol, NA= ácido nalidixico TE= tetraciclina, SXT= trimetoprima-sulfametoxazol AM= ampicilina.

Los serotipos aislados en el rastro RNC fueron Salmonella London (45.9 %, 17/37), Anatum (16.2 %, 6/37), Agona y Muenchen (8.1 % cada una, 3/37), Derby y Typhimurium (5.4 %, 2/37), Bredeney, Bovismorficans, Montevideo y Senftenberg (2.7 % cada una, 1/37), mientras que el único serotipo aislado en el rastro TIF fue S. Typhimurium (Cuadro 1). Los serotipos predominantes en reportes previos de aislamientos son diversos y dependen del año y el lugar, así como del tipo de alimento analizado. En muestras de canales de cerdo de Estados Unidos, colectadas de 2003 al 2015, los cinco serotipos predominantes fueron S. Typhimurium monofásica (4,(5),12:i:-), Infantis, Johannesburg, Typhimurium y Derby(20). En Bélgica, en un estudio realizado entre octubre del 2015 y febrero del 2016, S. Typhimurium, Derby, Livingstone, Rissen y Bredeney fueron los serotipos prevalentes(5), mientras que en España, en un estudio realizado entre noviembre de 2012 y mayo de 2014, los serotipos aislados fueron S. Rissen, Typhimurium, Panama y Brandenburg(6). En contraste, en la República de China, en el análisis realizado de octubre de 2012 a julio de 2013, los serotipos encontrados fueron S. Saintpaul, Agona, Give y Corvallis, y en menor proporción Derby e Infantis(21). Los serotipos S. Agona, Typhimurium y Derby encontrados en el presente estudio coinciden con aquellos recuperados de canales de cerdo en muestreos realizados en los países mencionados. En la reunión organizada en conjunto por la FAO y la OMS en junio del 2018, expertos en el área discutieron al respecto de la resistencia antimicrobiana en patógenos aislados de alimentos y establecieron como un área prioritaria, la investigación de bacterias 1009


Rev Mex Cienc Pecu 2020;11(4):1004-1015

resistentes a antimicrobianos y genes de resistencia, con énfasis en la búsqueda de patógenos resistentes a antimicrobianos que son responsables de causar enfermedades por el consumo de alimentos(2). Debido a que el estudio de la resistencia de Salmonella a los antimicrobianos es de interés mundial, se analizó la susceptibilidad de los 38 aislamientos obtenidos (37 del rastro RNC y 1 del rastro TIF) a 10 agentes antimicrobianos. Los resultados muestran que los 38 aislamientos fueron resistentes a K y susceptibles a CIP y a las cefalosporinas evaluadas (CF y CRO), resaltando que el 100 % de los aislamientos fueron resistente al menos a una clase de antimicrobianos. El 73.7 % (28/38) de los aislamientos fueron resistentes a TE, el 44.7 % a NA (17/38), 23.7 % a S (9/38), 21.1 % a C (8/38), 7.9 % a SXT (3/38), 5.3 % a GM (2/38) y 2.6 % a AM (1/38). Los aislamientos de S. Derby, Bovismorficans y Montevideo sólo mostraron resistencia a K (Figura 1). Figura 1: Porcentaje de cepas de Salmonella enterica aisladas de canales de cerdo que resultaron resistentes a diversas clases de antimicrobianos evaluados

Algunos de los aislamientos de S. Agona (3), Anatum (4), Bovismorbificans (1), Derby (2), London (6) y Montevideo (1) presentaron resistencia a uno o dos clases de antimicrobianos. En contraste, los otros aislamientos de S. Anatum (3), Bredeney (1), London (11), Muenchen (3), Typhimurium (3) y Senftenberg (1) mostraron resistencia a tres y/o cuatro clases de antimicrobianos (Cuadro 2), siendo los aminoglucósidos, las tetraciclinas y la ciprofloxacina, las clases y el antimicrobiano a los cuales se observó mayor resistencia (Figura 1). En Estados Unidos, el NARMS reportó un incremento en la resistencia contra fluoroquinolonas (CIP), cefalosporinas de tercera generación (CF) y macrólidos (azitromicina), antimicrobianos que se usan de manera frecuente en el tratamiento de las infecciones producidas por S. Typhi, Paratyphi y Salmonella no tifoidea(3). En contraste, en los aislamientos obtenidos de rastros de sacrificio de cerdos y de carne vendida en expendios en China, se observó resistencia a las tetraciclinas, aminopenicilinas (AM), sulfamidas (SXT) y aminoglucósidos (S)(21).

1010


Rev Mex Cienc Pecu 2020;11(4):1004-1015

Cuadro 2: Número de aislamientos resistentes de serotipos de Salmonella enterica aislados de canales de cerdos en dos tipos de rastros No. de clases de antimicrobianos Serotipo Agona Anatum Bovismorbificans Bredeney Derby London Montevideo Muenchen Typhimurium Senftenberg TOTAL

No. 3 6 1 1 2 17 1 3 3 1 38

% 7.9 15.8 2.6 2.6 5.3 44.7 2.6 7.9 7.9 2.6 100

1 3 2 1

2

3

4

1

2

1

1 2 6

10

1

2

1 3

1

7

9

1 16

6

La resistencia observada a los diferentes agentes antimicrobianos es difícil de comparar entre diferentes estudios, debido a que ésta se ve influenciada por el tipo agentes utilizados en la región durante en crecimiento del ganado porcino(6), así como por la presencia de los residuos de antimicrobianos en el agua, el suelo de las granjas o rastros donde se desarrollan o sacrifican los animales(2). El 73.7 % (28/38) de los aislamientos fueron resistentes a tetraciclina, por ello se determinó la presencia de tetA y tetB por PCR, dos de los genes que confieren la resistencia a TE(6). Sin que se observara amplificación de estos genes en ninguno de los aislamientos resistentes a TE. Otro agente al que un gran número de aislamientos mostró resistencia fue NA (44.7 %). La resistencia a este antimicorbiano es relevante porque disminuye la susceptibilidad a CIP, agente que es usado comúnmente en el tratamiento de la salmonelosis(3). La resistencia a AM-C-S-SXT-TE y AM-S-SXT-TE (fenotipos ACSSuT y ASSuT, respectivamente) es buscada comúnmente en Salmonella no tifoideas, debido a las complicaciones encontradas en el tratamiento de la salmonelosis(3). En este estudio no se encontraron aislamientos de Salmonella con esos fenotipos específicos, pero sí se encontraron cepas con resistencia a cuatro clases de antimicrobianos, lo cual también puede representar un problema en el tratamiento de la enfermedad producida en humanos (Cuadros 1 y 2). La adquisición de elementos de resistencia es a través de la transferencia horizontal de genes o grupos de genes y es mediada por elementos genéticos móviles (integrones, plásmidos o transposones)(6,22). Los integrones son sistemas de recombinación constituídos principalmente por una integrasa, un sitio de recombinación y un promotor fuerte. En enterobacterias, tres clases de integrones están asociados a la adquisión de casetes de resistencia; la clase 1 se asocia con resistencia a la mayoría de los β-lactámicos conocidos, aminoglicósidos, trimetropima, rifampicina, cloranfenicol, quinolonas, 1011


Rev Mex Cienc Pecu 2020;11(4):1004-1015

eritromicina y compuestos cuternarios de amonio(22). Seis de los aislamientos que mostraron resistencia a 3 ó 4 clases de antimicrobianos, se seleccionaron para la detección de integrones clase 1 y 2, encontrando que cuatro aislamientos de los serotipos Anatum (1), London (1) y Typhimurium (2) mostraron la amplificación del gen intI1 (integron clase 1). Se ha reportado que el integron clase 1 es el más frecuente en aislamientos resistentes de patógenos como Klebsiella, Salmonella, Shigella y Yersinia(22). Ninguna banda de amplificación para los genes intI1 y intI2 se observó en las cepas aisladas de los serotipos Bredeny y Muenchen (Cuadro 3) por lo que el perfil de resistencia observado puede deberse a un integron clase 3, o a otro elemento móvil. Cuadro 3: Amplificación de los genes intl1 e intl2 en aislamientos de Salmonella enterica obtenidos de canales de cerdo en dos tipos de rastros Perfil de resistencia a Detección Detección Origen Serotipo antimicrobianos de intI1 de intI2 Rastro TIF Typhimurium GM, K, S, C, NA, TE + Rastro RNC Anatum K, NA, SXT, TE + Bredeney K, S, C, TE London K, S, AM, C, TE + Muenchen K, C, NA, TE Typhimurium K, S, C, SXT, TE + TIF= Tipo Inspección federal; RNC= rastro no certificado de competencia municipal. AM= ampicilina, C= cloranfenciol, GM= gentamicina, K= kanamicina, NA= ácido nalidixico, S= estreptomicina, TE= tetraciclina, SXT= trimetropima con sulfametoxasol.

Conclusiones e implicaciones Este estudio evidencia la presencia de cepas de Salmonella resistentes a diferentes clases de antimicrobianos en canales de cerdo. La presencia de estas cepas multirresistentes en la carne de cerdo destinada para consumo de la población, podría causar un problema de salud pública, debido a que, al ser consumida en alimentos con prácticas deficientes en el manejo, puede ocasionar una infección de difícil tratamiento. Así mismo, enfatiza la importancia de implementar buenas prácticas de manufactura y medidas de control durante el proceso de sacrificio y obtención de la carne para reducir la presencia de Salmonella y como consecuencia la diseminación de elementos móviles portadores de genes de resistencia hacia otro tipo de enterobacterias. No obstante, los hallazgos encontrados, este estudio presenta limitaciones con respecto a la evaluación y verificación del proceso de higienización llevado a cabo en cada rastro, por lo que la conclusión relacionada a que, la implementación de buenas prácticas de manufactura reduce la presencia de Salmonella, se realizó con base a la información obtenida en otros estudios(23). Así mismo, los resultados mostrados son inherentes a los rastros estudiados y no hay datos suficientes para inferir en qué grado estos representan la situación de los rastros RNC y TIF en la zona o el país. 1012


Rev Mex Cienc Pecu 2020;11(4):1004-1015

Agradecimientos Agradecemos profundamente el trabajo realizado en este proyecto por el M. en C. Carlos Pacheco Gallardo, quien falleció el 14 de octubre del 2019. Apreciamos la asistencia técnica en la recolección y procesamiento de muestras a Diana Arcelia Castro de Sales, María Guadalupe Pilar Soto, José Antonio Vilchis Carmona y Manuel Alejandro Cortez Gómez.

Literatura citada: 1. Karkey A, Thwaites GE, Baker S. The evolution of antimicrobial resistance in Salmonella Typhi. Curr Opin Gastroenterol 2018;34(1):25-30. 2. FAO/WHO. Food and Agriculture Organization of the United Nations/ World Health Organization. FAO/WHO expert meeting on foodborne antimicrobial resistance: Role of environment, crops and biocides. Rome, Italy. 2018. 3. CDC. National Antimicrobial Resistance Monitoring System for Enteric Bacteria (NARMS). Human Isolates Surveillance Report for 2015. Atlanta, Georgia: U.S. Department of Health and Human Services, Centers for Disease Control, CDC. 2018. 4. EFSA. European Food Safety Authority. Scientific opinion on a quantitative microbiological risk assessment of Salmonella in slaughter and breeder pigs. Parma, Italy. 2010. 5. Biasino W, De Zutter L, Mattheus W, Bertrand S, Uyttendaele M, Van Damme I. Correlation between slaughter practices and the distribution of Salmonella and hygiene indicator bacteria on pig carcasses during slaughter. Food Microbiol 2018;70:192-199. 6. Cameron-Veas K, Fraile L, Napp S, Garrido V, Grillo MJ, Migura-Garcia L. Multidrug resistant Salmonella enterica isolated from conventional pig farms using antimicrobial agents in preventative medicine programs. Vet J 2018;234:36-42. 7.

Consejo Mexicano de la Carne. Compendio Estadístico http://comecarne.org/wp-content/uploads/2018/05/CompendioEstad%C3%ADstico-2017-v7-1-sin-elab.pdf. Consultado 20 Ene, 2019.

2017.

8. CIMA. Centro de Información de Mercados Agroalimentarios & ASERCA. Agencia de Servicios a la Comercialización y Desarrollo de Mercados Agropecuarios. Reporte del Mercado de Carne de Porcino. 2018. https://www.cima.aserca.gob.mx/work/models/cima/pdf/cadena/2018/Reporte_mer cado_porcino_290618.pdf. Consultado 20 Ene, 2020.

1013


Rev Mex Cienc Pecu 2020;11(4):1004-1015

9. SADER. Secretaría de Agricultura y Desarrollo Rural. Rastros no certificados. https://www.gob.mx/senasica/acciones-y-programas/rastros-no-certificados. Consultado: 20 Ene, 2020. 10. SADER. Secretaría de Agricultura y Desarrollo Rural. Rastros Tipo Inspección Federal. https://www.gob.mx/firco/articulos/sabes-que-es-un-rastro-tipoinspeccion-federal?idiom=es. Consultado: 20 Ene, 2020. 11. S.S. Secretaría de Salud. Norma Oficial Mexicana NOM-194-SSA1-2004, Productos y servicios. Especificaciones sanitarias en los establecimientos dedicados al sacrificio y faenado de animales para abasto, almacenamiento, transporte y expendio. Especificaciones sanitarias de productos. Estados Unidos Mexicanos: S.S. 2004. 12. USDA. United State Department of Agriculture. Food Safety and Inspection Service. Isolation and identification of Salmonella from meat, poultry and eggs products, MLG 4.04. Isolation and identification of Salmonella from meat, poultry and eggs products, MLG 4.04. Athens, GA. USA: Food Safety and Inspection Service. Laboratory QA/QC Division; 2008. 13. Perez-Montano JA, Gonzalez-Aguilar D, Barba J, Pacheco-Gallardo C, CamposBravo CA, Garcia S, et al. Frequency and antimicrobial resistance of Salmonella serotypes on beef carcasses at small abattoirs in Jalisco State, Mexico. J Food Prot 2012;75(5):867-73. 14. Kauffmann F. On the history of Salmonella research. Zentralblatt fur Bakteriologie, Parasitenkunde, Infektionskrankheiten und Hygiene 1 Abt Medizinisch-hygienische Bakteriologie, Virusforschung und Parasitologie Originale 1966;201(1):44-8. 15. GraphPad. Computer software GraphPad Prism8. Computer software GraphPad Prism8. San Diego, CA: Digital Millennium; 2018. 16. CLSI. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial disk susceptibility test. M2-A9. Wayne, PA, USA: CLSI; 2006. 17. CLSI. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; 27th Informational Suppl. M100-S27. CLSI, Wayne, PA, USA; 2017. 18. Lapierre L, Cornejo J, Borie C, Toro C, San Martin B. Genetic characterization of antibiotic resistance genes linked to class 1 and class 2 integrons in commensal strains of Escherichia coli isolated from poultry and swine. Microb Drug Resist 2008;14(4):265-72. 19. Bersisa A, Tulu D, Negera C. Investigation of bacteriological quality of meat from abattoir and butcher shops in Bishoftu, Central Ethiopia. Int J Microbiol 2019;641683.

1014


Rev Mex Cienc Pecu 2020;11(4):1004-1015

20. Yuan C, Krull A, Wang C, Erdman M, Fedorka-Cray PJ, Logue CM, et al. Changes in the prevalence of Salmonella serovars associated swine production and correlations of avian, bovine and swine-associated serovars with human-associated serovars in the United States (1997-2015). Zoonoses Public Health. 2018. 21. Li Y, Cai Y, Tao J, Kang X, Jiao Y, Guo R, et al. Salmonella isolated from the slaughterhouses and correlation with pork contamination in free market. Food Control 2016;59:591-600. 22. Kaushik M, Kumar S, Kapoor RK, Virdi JS, Gulati P. Integrons in Enterobacteriaceae: diversity, distribution and epidemiology. Int J Antimicrob Agents 2018;51(2):167176. 23. Fajardo-Guerrero M, Rojas-Quintero C, Chamorro-Tobar I, Zambrano C, Sampedro F, Carrascal-Camacho AK. Exposure assessment of Salmonella spp. in fresh pork meat from two abattoirs in Colombia. Food Sci Technol Int 2019:1082013219864746.

1015


https://doi.org/10.22319/rmcp.v11i4.5255 Artículo

La influencia del método de ordeño, las condiciones de almacenamiento y el recuento de células somáticas en la calidad de la leche cruda en tanques

Joadilza da Silva Bezerra a Juliana Paula Felipe de Oliveira b* Danielle Cavalcanti Sales a Yhêlda Maria de Oliveira Silva a Stela Antas Urbano a Luis Henrique Fernandes Borba a Lisandra Murmann a Adriano Henrique do Nascimento Rangel a

a

Universidade Federal do Rio Grande do Norte, Unidade Acadêmica Especializada em Ciências Agrárias, Macaíba, Brasil. b

Universidade Federal de Campina Grande, Centro de Saúde e Tecnologia Rural, Patos, Brasil.

*Autor de correspondencia: jupaula.oliv@yahoo.com.br

Resumen: Las condiciones del ordeño y almacenamiento pueden afectar a la calidad de la leche cruda. Se hizo una evaluación de la influencia del método de ordeño, las condiciones de almacenamiento y el aumento en el recuento de células somáticas (RCS) en la calidad de la leche cruda. Se realizaron evaluaciones mensuales durante un año en 21 tanques mediante el monitoreo de la temperatura de refrigeración y el tiempo de almacenamiento de la leche en el tanque. Los tanques se agruparon en tres rangos de temperatura. Se establecieron intervalos de tiempo de almacenamiento de leche en cada tanque: hasta 24 h; de 24 a 48 h; y más de 48 h. El efecto de RCS sobre la composición

1016


Rev Mex Cienc Pecu 2020;11(4):1016-1029

se evaluó en tres categorías: RCS bajo; RCS intermedio; y RCS alto. En el período analizado, solo el 10.8 % de los tanques tuvieron un RCS bajo, el 46.5 % tuvieron uno intermedio, y el 42.7 % uno alto. Hubo una correlación positiva entre el RCS y el nivel de la proteína, y una correlación negativa entre el RCS y el nivel de la lactosa. Los resultados indican que el método de ordeño no influye en la contaminación microbiana de la leche. En contraste, un mayor tiempo de almacenamiento y el aumento de la temperatura causaron un aumento en el RCS y el conteo microbiano total. Las prácticas de higiene en los hatos y los tanques estudiados requieren de mejoramiento, ya que el 42.7 % de los tanques presentaron un RCS alto y los conteos bacterianos totales presentaron valores superiores a los recomendados por la legislación. Palabras claves: CBT, Composición química, Higiene, Temperatura.

Recibido:12/02/2019 Aceptado: 25/11/2019

Introducción La sociedad espera que el sector primario proporcione alimentos de alto valor biológico que además sean seguros y saludables. Esta expectativa orienta a la legislación, la investigación y la transferencia de tecnología para que se cumplan estas demandas. Se vincula de manera directa a la competitividad y rentabilidad del sector, siendo de fundamental importancia para poder ingresar y mantener productos en los mercados(1). La leche de todas las especies mamíferos es una mezcla heterogénea de secreción láctea que contiene varios componentes y muestra una amplia variedad de actividades químicas y funcionales(2). Sus características están asociadas a parámetros fisicoquímicos y estos se utilizan para desarrollar estándares adecuados de higiene y sanitación en el ordeño(3). La calidad de la leche responde a una interacción entre: la salud general del hato, la salud de la glándula mamaria, las condiciones de ordeño y el almacenamiento de la leche(4). El proceso de la producción de la leche cruda bajo refrigeración y con almacenamiento en tanques facilita la logística de recolección y reduce las pérdidas económicas por la actividad acidificante de las bacterias mesófilas(5). La mastitis es una enfermedad común en los hatos lecheros que ocasiona altas pérdidas económicas por alteraciones en el tejido secretor de la glándula mamaria. Además, provoca una reducción en la vida productiva de las vacas y modifica los principales componentes de la leche(6).

1017


Rev Mex Cienc Pecu 2020;11(4):1016-1029

El recuento de células somáticas (RCS) es uno de los principales parámetros utilizado en la evaluación de la calidad de la leche ya que tiene una relación directa con la composición de leche, el rendimiento industrial y la seguridad alimentaria. Los niveles altos de RCS y de conteo bacteriano total (CBT) se asocian con una mayor actividad enzimática en la leche, la cual puede dañar los componentes de la leche y degradar su calidad y características(7). El objetivo de este estudio fue evaluar la influencia del método de ordeño (manual y mecánico), los efectos de las condiciones de almacenamiento (forma, temperatura y tiempo de almacenamiento) y el RCS sobre la calidad de la leche cruda almacenada en tanques.

Material y métodos Ubicación y recolección de muestras

Las muestras de leche cruda enfriada fueron recolectadas de tanques de productores vinculados a la Associação de Pequenos Agropecuaristas do Sertão de Angicos (APASA), ubicada en la región semiárida del estado de Rio Grande do Norte, Brasil (5°39’56” S, 36°36’04” O; 110 m de altitud). Según la clasificación de Köppen-Geiger, el clima de la región es BSh (árido), presentando temperaturas entre 25 y 33 °C y una precipitación media anual de 753 mm. Los animales lecheros se desempeñaron en un sistema de producción semi-intensivo. Se realizaron evaluaciones mensuales durante un año de 21 tanques de almacenamiento de leche (15 individuales y 6 colectivos). La recolección de la leche se realizó después de la homogeneización mediante agitación mecánica. Las muestras de leche se retiraron del tanque usando una cuchara de acero inoxidable desinfectada, se identificaron y se guardaron a una temperatura entre los 2 y 6 ºC para su transporte al laboratorio. Los tanques se clasificaron por temperatura, tiempo de almacenamiento, método de ordeño (manual y mecánico) y forma de almacenamiento (individual y colectivo). La temperatura de la leche en el tanque se midió después de una homogeneización previa de 5 min, después de los cuales se midió la temperatura mediante un termómetro digital con marcador láser (Mt-350-Minipa). Los rangos de temperatura se estandarizaron por medio de una escala de tres niveles: Escala 1, 0 a 4 °C (temperatura ideal); Escala 2, 4.01 a 7 °C (temperatura intermedia); y Escala 3, superior a 7 °C (temperatura alta). Los tanques se asignaron a las escalas de temperatura según los resultados, los cuales se expresaron como un porcentaje del total de los tanques, e indicando el tipo de tanque.

1018


Rev Mex Cienc Pecu 2020;11(4):1016-1029

Se estandarizó el período de almacenamiento de la leche agrupando los tanques en tres intervalos expresados como un porcentaje del total de los tanques: Intervalo 1 (< 24 h de almacenamiento); intervalo 2 (24 a 48 h); e intervalo 3 (> 48 h). La cantidad de leche recolectada se verificó directamente en el tanque en el momento de la recolección utilizando una regla de acero inoxidable específicamente para este propósito. Los datos sobre el método de ordeño (manual o mecánico) y el tipo de tanque (individual o colectivo) se obtuvieron de una base de datos proporcionada por la empresa a cargo de los tanques. Todos los procedimientos se llevaron a cabo siguiendo a los lineamientos establecidos por el Comité de Ética de Investigación (CEP/UFRN, número de licencia 2.054.761). No se realizaron experimentos con animales en el presente estudio en cumplimiento a la Ley No. 11.794 del 8 de octubre de 2008, que rige el ítem VII del § 1 del artículo 225 de la Constitución Federal de Brasil lo cual establece los procedimientos para el uso científico de animales; deroga la Ley No. 6.638, de 8 de mayo de 1979; y hace otras disposiciones.

Análisis fisicoquímico y microbiológico

Se tomaron alícuotas de cada muestra de leche para evaluar el RCS y el CBT. Se empacaron las alícuotas en botellas de plástico de 40 ml con el conservante Bronopol® (2-bromo-2-nitro-1,3-propanodiol) para el RCS y el Azidiol® para el CBT. Con el fin de correlacionar los valores de RCS con la composición química se realizó una clasificación según los valores encontrados, dando lugar a tres categorías: Bajo, <200,000; Intermedio, 201,000 a 400,000; y Alto, >400,000 células mL-1. Los análisis de RCS y CBT se realizaron en un laboratorio integrado a la Red Brasileña de Calidad de la Leche (RBQL). Se midió el RCS mediante el método de citometría de flujo a través de un contador electrónico SomaScope® [Delta, ISO 13366/International Dairy Federation-IDF-148-2](8), y los resultados se expresaron como miles de células somáticas por mililitro. Se midió la CBT con la citometría de flujo a través de un contador electrónico Bactocount® [Bentley Instruments Inc., ISO 21187/International Dairy Federation-IDF-196], con los resultados expresados como el número de unidades formadoras de colonias (UFC) por ml. Las variables del contenido de grasa, proteína, lactosa, sólidos totales, caseína y nitrógeno ureico se midieron por el método de espectroscopía infrarroja de transformación de Fourier (FTIR por sus siglas en inglés) usando un dispositivo LactoScope® [Delta, ISO 9622/International Dairy FederationIDF-141C](9).

1019


Rev Mex Cienc Pecu 2020;11(4):1016-1029

Análisis estadístico

Para alcanzar una distribución normal de los datos se analizaron los resultados de RCS por medio de un puntaje de células somáticas (SCS por sus siglas en inglés). El SCS se produce por medio de la transformación log del RCS con la formula RCS = log2(RCS/100) + 3(10). Se transformaron a los resultados del CBT a un logaritmo (log10 UFC ml) y se hizo la transformación logarítmica del CBT (x 1000 UFC ml-1) al logCBT (log10 UFC ml)(11). El modelo matemático general fue: yij    t i   ij Donde: Y = variables dependientes, características de la composición o indicador de la calidad de la leche; µ = media general; t = variable independiente, clases de RCS, donde i= 1 a 3 (1= RCS < 200,000; 2= RCS de 200,001 a 400,000; y 3= RCS > 400,000; o método de ordeño, donde i= 1 para manual o 2 = para mecánica). ε= error aleatorio. Se aplicó el modelo matemático general por medio de un análisis de varianza y una prueba de Tukey para la comparación de las medias. Se llevó a cabo una prueba del coeficiente de correlación de Pearson entre los componentes de la leche. El análisis estadístico se hizo aplicando los procedimientos de MEANS, GLM y CORR con el paquete estadística SAS ver. 9.1.

Resultados y discusión No se observó ninguna influencia del método de ordeño sobre el CBT (P>0.05), lo cual sugiere que se pueden utilizar ambos métodos de producción para producir una leche de calidad. Este resultado contrasta con un reporte en el cual se observó una mayor contaminación bacteriana en la leche obtenida por el método de ordeño mecánico, en comparación con el manual(12). La discrepancia entre los presentes resultados y este estudio, pueden deberse a fallas en el funcionamiento del equipo de ordeño, el cual puede ocasionar lesiones en el epitelio de la glándula mamaria, provocando mastitis y por tanto un aumento en la contaminación microbiana. Independientemente del método de ordeño, las muestras de leche evaluadas presentaron valores de CBT por encima del límite recomendado por la legislación vigente para la 1020


Rev Mex Cienc Pecu 2020;11(4):1016-1029

región y el periodo de estudio(13). Este hecho puede ser un reflejo de varios factores como la presencia de mastitis, prácticas inadecuadas de higiene en el ordeño y condiciones de almacenamiento/enfriamiento ineficientes en el hato, así como el uso de agua de mala calidad(14). Por ejemplo, se observó una reducción de más de 90 % en el CBT y un 74.3 % de RCS en un estudio de implementación de buenas prácticas de ordeño y de medidas sanitarias para controlar la mastitis en hatos lecheros(15). Los resultados destacaron la influencia de las técnicas adecuadas de producción y sanidad en la calidad de la leche. De acuerdo con la escala establecida en el presente estudio, los tanques colectivos experimentaron una menor oscilación de la temperatura que en los individuales (Figura 1). Además, se encontró una correlación positiva entre la temperatura de la leche y su RSC, y una mayor proliferación de bacterias en tanques con alta temperatura de almacenamiento. Esto demuestra la importancia de conservar la leche almacenada en tanques a una baja temperatura después del ordeño, con el fin de minimizar el crecimiento de los microbios(16). Mantener la temperatura de la leche en el nivel máximo permitido, representa un punto crítico para la calidad de ésta y puede tener consecuencias futuras; por ejemplo, la temperatura de la leche en un camión isotérmico puede aumentar antes de llegar a su destino. Por lo tanto, aunque la legislación permita almacenar la leche a una temperatura de hasta 7 °C, es importante que se mantenga a temperaturas inferiores a 4 °C para salvaguardar su calidad y mantener el rendimiento, así como la rentabilidad en la industria. Figura 1: Distribución de los tanques de leche (%) entre los intervalos de tiempo de almacenamiento (horas)

Intervalos de tiempo: 1, <24 h (ideal); 2, 24 a 48 h (intermedio); y 3, >48 h (alto).

1021


Rev Mex Cienc Pecu 2020;11(4):1016-1029

El CBT promedio de la leche cruda en los tanques de almacenamiento difirió (P<0.05) entre los intervalos de tiempo de almacenamiento (Figure 2). Además, había una correlación positiva (r= 0.24; P<0.05) entre el tiempo de almacenamiento y el CBT de la leche, indicando que el conteo de microrganismos incrementó en los tiempos más largos de almacenamiento. Figura 2: El CBT (UFC ml-1) promedio de la leche cruda en los tanques en diferentes intervalos de tiempo de almacenamiento

CBT= CBT (x105 UFC ml-1); Intervalos de tiempo: 1, <24 h (ideal); 2, 24 a 48 h (intermedio) y 3: >48 h (alto).

No hubo diferencia en el CBT entre los intervalos 1 y 2, pero si hubo (P<0.05) entre los intervalos 1 y 3. Esto demuestra la importancia de un periodo de almacenamiento mínimo para mantener a la multiplicación bacteriana en los niveles más bajos posible. Es importante señalar que todos los valores de CBT registrados en los tres intervalos de almacenamiento se consideran altos. Un procedimiento adecuado de almacenamiento de la leche en los tanques, puede minimizar los riesgos de pérdidas cualitativas de la materia prima. La calidad de ésta repercute en las propiedades y durabilidad de sus productos derivados(17). Aun cuando la leche está refrigerada a una temperatura adecuada, el tiempo de almacenamiento de ésta en el tanque es un factor determinante en la multiplicación de los microorganismos psicotróficos(4). Un aumento indebido del conteo bacteriano puede llevar a una disminución en la vida útil de la leche pasteurizada y sus derivados, ya que involucra la producción de lipasas y proteasas microbianas termorresistentes; la presencia de estas lipasas y proteasas en la leche es un importante punto de control a verificar(18). La composición química de la leche proveniente de los tanques se presenta en el Cuadro 1, cuyos valores están acordes con la legislación vigente.

1022


Rev Mex Cienc Pecu 2020;11(4):1016-1029

Cuadro 1: Composición química (%) de la leche almacenada en tanques Variable Grasa Proteína Caseína Lactosa Solidos totales ESD

N

Media ± DE

Mínimo

Máximo

CV (%)

273 269 269 238 257 257

3.59±0.55 3.00±0.20 2.33±0.36 4.61±0.25 12.11±0.70 8.51±0.40

1.51 2.21 1.17 3.38 9.32 6.57

7.37 3.84 5.25 5.05 15.63 9.41

15.24 6.72 15.26 5.48 5.84 4.64

N= número de observaciones; DE= desviación estándar; CV= coeficiente de variación; ESD = extracto seco desengrasado (%).

Los promedios de las variables de la calidad de la leche en el presente estudio (RCS, SCS y CBT) indican que el nivel general de CBT estaba alto mientras que el RCS cumplía con los niveles establecidos en la legislación (Cuadro 2). Cuadro 2: Calidad higiénica-sanitaria de la leche almacenada en tanques en términos de recuento de células somáticas (RCS), puntaje de células somáticas (SCS) y conteo bacteriano total (CBT) Variable RCS (cel ml-1) SCS (cel ml-1) CBT (UFC ml-1)

N

Media ± SD

267 457.0 ±314.0 267 5.93±0.64 124 1.35 x106±1.32 x106

Mínimo

Máximo

CV (%)

30.0 3.40 6.2x104

2532.0 7.84 6.23x106

69.0 10.73 97.98

SCS = [log2(RCS/100,000) + 3]; N= número de observaciones; DE= deviación estándar; CV= coeficiente de variación.

En un estudio usando datos de 44,000 hatos lecheros de todo Brasil, se encontró que el 62 % de los hatos tenía un valor de RCS hasta 500,000 cel L-1, y aproximadamente 23,760 de ellos (54 %) tenían el CBT hasta 300,000 UFC ml-1(19). Sin embargo, estos niveles de RCS y CBT cumplen con la legislación vigente para el periodo(20). Aunque la mayoría de los hatos tenían niveles de RCS y CBT legales, de todas maneras, estos valores son altos y pueden llevar a pérdidas durante el procesamiento, en el rendimiento industrial y una menor vida útil de los derivados. En un estudio similar la composición de la leche almacenada en tanques estaba dentro de las especificaciones, pero el RCS excedía los límites permitidos(21). Otro estudio sobre la leche almacenada en tanques encontró que las características de la leche cumplían con las especificaciones, pero el RCS promedio era de 750,000 cel ml-1(22). Un nivel tan alto de RCS indica que el control de la mastitis en la región era inadecuado en términos de los procedimientos de higiene para el ordeño, y de los instrumentos y el equipo utilizado. En los resultados del análisis de RCS solo 10.8 % de las muestras tenían un valor de RCS bajo mientras que el 42.7 % tenían un valor elevado (Figura 3). Estos altos niveles son un reflejo de la presencia de ineficiencias en el control de la higiene de las glándulas 1023


Rev Mex Cienc Pecu 2020;11(4):1016-1029

mamarias y desde luego de la presencia de la mastitis. También los valores altos pueden estar relacionados con una falta de monitoreo de la leche por parte de las empresas compradoras, que no establecen criterios de RCS para los proveedores, o si existen no los hacen cumplir. Esta situación es preocupante ya que es posible que los productores, quizá hasta los compradores, no sean conscientes de los grandes daños causados por un alto RCS, los cuales abarcan: la salud del hato, la calidad de la materia prima, el producto final y la salud del consumidor. En los tanques a granel para el almacenamiento de la leche es habitual utilizar los valores de RCS como indicadores de la calidad de la leche y la salud del hato, para monitorear la implementación de las prácticas de producción, y evaluar los cambios en la leche y los productos lácteos(23). El RCS de la leche almacenada en tanque es un indicador general de la salud de la ubre en las vacas de un hato, y se considera un método indirecto para medir la calidad de la leche(24). Por ejemplo, una vaca se considera infectada cuando el RCS de su leche supera las 200,000 cel ml-1. A valores de RCS superiores a las 200,000 cel ml-1 también cambian los componentes de la leche(19). Figura 3: Distribución (%) de las muestras de leche almacenadas en tanques entre las tres categorías de valor de RCS

RCS Bajo = <200,000; RCS Intermedio = 200,001 a 400,000; RCS Alto = >400,000 cel ml-1.

En el presente estudio, no hubo variación (P>0.05) en la composición química de la leche entre las diferentes categorías de RCS (Cuadros 2 y 3). El RCS alto está relacionado con el tipo de proteína, cambios en la composición de los ácidos grasos, la lactosa, los iones y la concentración mineral y un pH más alto en la leche cruda(25). Además puede provocar una disminución en la producción de la leche(6). Estos cambios en los componentes de la leche se deben a lesiones inducidas por mastitis en el epitelio glandular. Los daños en este epitelio resultan en una reducción en la síntesis en los alvéolos mamarios y un aumento de la entrada de componentes sanguíneos en la leche, como el sodio, el cloro, las inmunoglobulinas y otras proteínas séricas. 1024


Rev Mex Cienc Pecu 2020;11(4):1016-1029

El efecto del RCS sobre la composición de la leche no es consistente. Por ejemplo, en un estudio de dos valores de RCS en la leche cruda no se encontraron efectos significativos sobre las características fisicoquímicas (pH, acidez titulable, grasa, proteína, lactosa y sólidos totales); sin embargo, las categorías de RCS fueron altas a pesar de la diferencia en los tipos de leche(26). Esto contrasta con un reporte en el cual se observó una disminución en el contenido de lactosa, grasa, caseína, calcio y fósforo en leche con un alto RCS. La causa de la disminución es un aumento en la actividad de las enzimas proteolíticas y lipolíticas, las cuales forman parte de los procesos de degradación en la leche(27). En estos procesos los componentes de la leche pueden concentrarse, aumentando así sus porcentajes, lo que es causado por una reducción significativa en el volumen de leche producida. Cuadro 3: Promedios y coeficiente de variación (CV) de los indicadores de la calidad de la leche según las categorías de recuento de células somáticas (RCS) (%) Variable Grasa Proteína Caseína Lactosa Solidos totales ESD

N 267 267 236 255 255 255

RCS Bajo

RCS Inter

RCS Alto

Media 3.61 2.97 2.31 4.63 12.14 8.53

Media 3.60 2.97 2.32 4.62 12.09 8.48

Media 3.57 3.03 2.34 4.59 12.12 8.54

CV (%) 15.34 6.66 15.37 5.50 5.88 4.65

N= número de observaciones; RCS Bajo= <200,000; RCS Intermedio= 200,001 a 400,000; RCS Alto= >400,000 cel ml-1; ESD= extracto seco desengrasado (%).

En este trabajo se observó que el RCS tuvo una correlación positiva con la cantidad de la proteína en la leche y una correlación negativa con el nivel de la lactosa (Cuadro 4). Este resultado contrasta con un estudio en que el RCS no tenía ningún efecto sobre los niveles de la proteína y la lactosa en leche almacenada en tanques (RCS entre un mínimo de 58,000 y un máximo de 516,000 cel ml-1)(28). En otro estudio se analizó la influencia de cuatro niveles de RCS (<400,000 cel L-1 a >1,000,000 células L-1) sobre la composición de la leche y se encontró que los RCS tenían una correlación positiva con los porcentajes de lactosa y extracto seco desgrasado, pero no con lo de la proteína(29). En un análisis de muestras de leche almacenadas en tanques y recolectadas en la región de Rio Grande do Norte, Brasil, un incremento en el RCS resultó en un incremento en el porcentaje de grasa(7). Esto podría estar relacionado con una marcada disminución en la producción de leche y un aumento consecuente en la concentración de sólidos totales, incluida la grasa. El aumento en proteína, con la consiguiente disminución en la lactosa, que se muestra en los resultados de este trabajo podría ser causado por lesiones en las células alveolares de la ubre. Estas bajan la síntesis de lactosa y alteran la permeabilidad del epitelio de la glándula mamaria, aumentando el paso de proteínas séricas de la sangre a la leche y provocando así un cambio en las características proteicas de la leche(30). 1025


Rev Mex Cienc Pecu 2020;11(4):1016-1029

Cuadro 4: Coeficientes de correlación de Pearson (P<0.05) entre los parámetros de la grasa, la proteína, la caseína, la lactosa, el total del extracto seco, el extracto seco desengrasado y el recuento de células somáticas Variables Grasa Proteína Caseína Lactosa TES ESD RCS

Grasa

Proteína Caseína

1.00

ns 1.00

ns 0.56 1.00

Lactosa

TES

ESD

RCS

ns 0.38 0.25 1.00

0.81 0.44 0.28 0.48 1.00

ns ns 0.41 0.84 s 1.00

ns 0.14 ns -0.13 ns ns 1.00

TES= total del extracto seco; ESD= extracto seco desengrasado (%); RCS= recuento de células somáticas; ns= no significativo.

Conclusiones e implicaciones Cuando los procedimientos de ordeño, la refrigeración y el tiempo de almacenamiento de la leche en tanques son inadecuados causan efectos negativos sobre las características de la leche y las condiciones de higiene. La asociación entre las prácticas eficientes de producción y gestión destinadas a controlar la mastitis y el almacenamiento adecuado de la leche puede mejorar la calidad de la leche cruda y aumentar la rentabilidad de la industria.

Agradecimientos La investigación se financió por la CAPES Foundation (Gobierno Brasileño). Los autores agradecen a la Industria Lechera APASA por su apoyo.

Literatura citada: 1. Henrichs SC, Macedo REF, Karam LB. Influência de indicadores de qualidade sobre a composição química do leite e influência das estações do ano sobre esses parâmetros. R Acad Cienc Agrar Ambient 2014;12(3):199-208. 2. Park YW, Nam MS. Bioactive peptides in milk and dairy products: a review. Korean J Food Sci Animal Resour 2015;35(6):831-840. 3. Murphy SC, Martin NH, Barbano DM, Wiedmann M. Influence of raw milk quality on processed dairy products: How do raw milk quality test results relate to product quality and yield? J Dairy Sci 2016;99(12):10128-10149. 1026


Rev Mex Cienc Pecu 2020;11(4):1016-1029

4. Reis KTMG, Souza CHBS, Santana EHW, Roig SM. Qualidade microbiológica do leite cru e pasteurizado produzido no Brasil: revisão. J Health Sci 2013;15(1):411421. 5. Cempírková R, Mikulová M. Incidence of psychrotrophic lipolytic bacteria in cow’s raw milk. Czech J Anim Sci 2009;54(2):65-73. 6. Montanhini MTM, Moraes DHM, Montanhini-Neto R. Influência da contagem de células somáticas sobre os componentes do leite. Ver Inst Latic Cândido Tostes 2013;68(392):18-22. 7. Silva VN, Rangel AHN, Novaes LP, Borba LHF, Bezerril RF, Lima-Júnior DM. Correlação entre a contagem de células somáticas e composição química no leite cru resfriado em propriedades do Rio Grande do Norte. Ver Inst Latic Cândido Tostes 2014;69(3):165-172. 8. INTERNATIONAL DAIRY FEDERATION (IDF). International Organization for Standardization (ISO) 13366/IDF 148-2: Milk – Enumeration of determination of somatic cell Part 2: Guidance on the operation of fluoro-opto-electronic counters. Brussels: IDF; 2006. 9. INTERNATIONAL DAIRY FEDERATION (IDF). International Organization for Standardization (ISO) 9622/IDF 141C: Determination of milk fat, protein and lactose content – Guidance on the operation of mid-infrared instruments. Brussels: IDF; 2013. 10. Ali AKA, Shook GE. An optimum transformation for somatic cell concentration in milk. J Dairy Sci 1980;63(3):487-490. 11. Lopes-Júnior JEF, Lange CC, Brito MAVP, Santos FR, Silva MAS, Moraes LCD, et al. Relationship between total bacteria counts and somatic cell counts from mammary quarters infected by mastitis pathogens. Ciênc Rural 2012;42(4):691696. 12. França AIM, Silva MAP, Barros JCB, Silva MR, Neves RBS, Nascimento LEC, et al. Qualidade do leite cru refrigerado granelizado coletado no sudoeste goiano. Rev Inst Latic Cândido Tostes 2015;70(6):316-325. 13. Ministério da Agricultura, Pecuária e Abastecimento. Instrução Normativa nº 7, de 3 de Maio de 2016. Regulamento Técnico de Produção, Identidade e Qualidade do Leite tipo A, o Regulamento Técnico de Identidade e Qualidade de Leite Cru Refrigerado, o Regulamento Técnico da Coleta de Leite Cru Refrigerado e seu Transporte a Granel. Diário Oficial da União, Brasília, Seção 1, 04 de Maio de 2016.

1027


Rev Mex Cienc Pecu 2020;11(4):1016-1029

14. Reche NLM, Thaler-Neto A, D`Ovideo L, Felipus NC, Pereira LC, Cardozo LL, et al. Multiplicação microbiana no leite cru armazenado em tanques de expansão direta. Ciênc Rural 2015;45(5):828-834. 15. Bozo GA, Alegro LCA, Silva LC, Santana EHW, Okano W, Silva LCC. Adequação da contagem de células somáticas e da contagem bacteriana total em leite cru refrigerado aos parâmetros da legislação. Arq Bras Med Vet Zootec 2013;65(2):589-594. 16. Oliveira RV, Cunha AF, Castilho NPA, Fernandes EN, Silva SQ, Souza FN, et al. Temperatura do leite mensurada pelo termostato e termômetro em diferentes pontos do tanque de expansão. Ver Bras Tecnol Agroind 2016;10(1):1991-2003. 17. Lee AP, Barbano DM, Drake MA. Short communication: The effect of raw milk cooling on sensory perception and shelf life of high-temperature, short-time (HTST)–pasteurized skim milk. J Dairy Sci 2016;99(12):9659–9667. 18. Ângelo FF, Ribeiro CS, Oliveira L, Araújo TF, Cardarelli HR. Bactérias psicrotróficas em leite cru refrigerado. Rev Cient Med Vet 2014;22(22):1-14. 19. Cassoli LD, Silva J, Machado PF. Mapa da Qualidade: Contagem de Células Somáticas. Piracicaba, SP: Clínica do Leite; 2016. 20. Cassoli LD, Machado PF. Mapa da Qualidade: Contagem Bacteriana Total. Piracicaba, SP: Clínica do Leite; 2016. 21. Campos PPLE, Rangel AHN, Borba LH, Urbano SA, Novaes LP, Galvão-Júnior JGB, et al. Quality indicators of tank milk in different production systems of tropical regions. Semina Ciênc Agrar 2016;37(4):2819-2830. 22. Rangel AHN, Araújo VM, Bezerra KC, Barreto MLJ, Medeiros HR, Lima-Júnior DM et al. Avaliação da qualidade do leite cru com base na contagem de células somáticas em rebanhos bovinos comerciais no estado do Rio Grande do Norte, Brasil. Arch Vet Sci 2013;18(1):40-45. 23. Boland F, Grady LO, Mais SJ. Investigating a dilution effect between somatic cell count and milk yield and estimating milk production losses in Irish dairy cattle. J Dairy Sci 2013;96(3):477-1484. 24. Schukken YH, Wilson DH, Welcome F, Garrison-Tikofsky L, Gonzalez RN. Monitoring udder health and milk quality using somatic cell counts. Vet Res 2003;34(5):579-596. 25. Umam AAK, Lin M, Radiati LE. Study on the bulk milk somatic cell counts and milk quality in different seasons. Sch J Agri Vet Sci 2017;4(11):498-503.

1028


Rev Mex Cienc Pecu 2020;11(4):1016-1029

26. Corassin CH, Rosim RE, Oliveira CAF. Atividade de plasmina e plasminogênio no leite longa vida com alta e baixa contagem de células somáticas durante o armazenamento. Ciênc Rural 2010;40(12):2588-2592. 27. Gargouri A, Hamed H, Elfeki A. Analysis of Raw Milk Quality at Reception and During Cold Storage: Combined Effects of Somatic Cell Counts and Psychrotrophic Bacteria on Lipolysis. J Food Sci 2013;78(9):1405-1411. 28. Savić NR, Mikulec DP, Radovanović RS. Somatic cell counts in bulk milk and their importance for milk processing. In: 59th International Meat Industry Conference Meatcon 2017. IOP Conf. Series: Earth and Environmental Science. 2017:85. 29. Silva VN, Rangel AHN, Galvão-Júnior JGB, Urbano SA, Borba LHF, Novaes LH, et al. Influence of somatic cell count in the composition of girolando cow’s milk in tropical zone. Trop Sub Agro 2016;19(2):101-107. 30. Auldist MJ, Hubble IB. Effects of mastitis on raw milk and dairy products. Aust J Dairy Tech 1998;53(1):28-36.

1029


https://doi.org/10.22319/rmcp.v11i4.5049 Artículo

Serotipos y aislamientos de Escherichia coli productora del subtipo Stx2 de la toxina Shiga provenientes de canales y heces de ganado bovino

Nydia Edith Reyes-Rodríguez a Jeannette Barba-León b Armando Navarro-Ocaña c Vicente Vega-Sánchez a Fabián Ricardo Gómez De Anda a Juan Martín Talavera-González d Martín Talavera-Rojas d*

a

Universidad Autónoma del Estado de Hidalgo. Instituto de Ciencias Agropecuarias, Área Académica de Medicina Veterinaria y Zootecnia. Tulancingo de Bravo, Estado de Hidalgo, México. b

Universidad de Guadalajara. Centro Universitario de Ciencias Biológicas y Agropecuarias, Departamento de Salud Pública. Zapopan, Jalisco, México. c

Universidad Nacional Autónoma de México. Facultad de Medicina, Departamento de Salud Pública. Ciudad Universitaria, México. d

Universidad Autónoma del Estado de México. Facultad de Medicina Veterinaria y Zootecnia, Centro de Investigación y Estudios Avanzados en Salud Animal. Toluca, Estado de México, México.

*Autor de correspondencia: talaverarojas@gmail.com

1030


Rev Mex Cienc Pecu 2020;11(4):1030-1044

Resumen: La bacteria E. coli productora de la toxina Shiga (STEC) es un importante patógeno causante de enfermedades transmitidas por los alimentos; esto se ha relacionado con brotes epidémicos en el pasado, principalmente debido al consumo de carne de vacuno. El objetivo de este estudio fue identificar los serotipos y subtipos de Stx2 y asociarlos con su posible epidemiología. Se analizaron un total de 65 aislamientos de la colección del Centro de Investigación y Estudios Avanzados en Salud Animal, Facultad de Medicina Veterinaria y Zootecnia de la Universidad Autónoma del Estado de México, a partir de canales y heces de bovinos en tres diferentes rastros municipales. La identificación del gen Stx2 por PCR en el punto final, secuenciado y analizado con la ayuda del programa BLAST. Se encontraron los estereotipos O157:H7, O70:H16, O91:H10, O112ac:H2, O128ac:H26, cuya presencia se ha reportado en brotes infecciosos anteriormente transmitidos por alimentos en todo el mundo; 63.07% (41/65) de las cepas de Escherichia coli se amplificaron para el Stx2 y después del análisis con BLAST se confirmó su presencia, así como la de una hipotética proteína. La presencia de estos serotipos en combinación con los diferentes subtipos Stx2a, Stx2c y Stx2d en las canales y las heces de los bovinos debe considerarse un riesgo potencial de enfermedades, un importante problema de salud pública. Palabras clave: Canales de ganado, Escherichia coli, Serotipado, stx2.

Recibido: 04/09/2018 Aceptado: 09/12/2019

Introducción Algunos serotipos patógenos de Escherichia coli (E. coli) son causa de enfermedades de origen alimentario y se asocian principalmente al consumo de carne de vacuno, leche no pasteurizada, jugo de manzana, yogur, queso, agua fresca y ensaladas crudas(1,2). Para que E. coli cause una enfermedad en los seres humanos se requieren diversas condiciones; sin embargo, hay algunas cepas patógenas que se consideran agentes primarios debido a que han adquirido factores de virulencia a través de plásmidos, transposones o bacteriófagos o transmitidos por elementos genéticos móviles (EGMs)(2). Es importante tener en cuenta que el ganado es el principal reservorio y que los productos y subproductos que se obtienen de él se consideran una fuente de infección por la E. coli productora de la toxina Shiga (STEC)(1-4). Actualmente en los rastros municipales existen riesgos sanitarios. Los rastros 1031


Rev Mex Cienc Pecu 2020;11(4):1030-1044

muestreados tienen un riesgo sanitario medio y un riesgo sanitario alto, de acuerdo con la Guía para el diagnóstico sanitario y la detección de necesidades operativas de los rastros municipales de la COFEPRIS (Comisión Federal para la Protección contra Riesgos Sanitarios), la cual menciona que aproximadamente el 18% del sacrificio anual de ganado se realiza en establecimientos con riesgo sanitario alto o muy alto; esto es motivo de preocupación, ya que anualmente se producen 112,000 t de carne de vacuno en establecimientos considerados de alto o muy alto riesgo para la salud, y tomando en cuenta el consumo anual de carne de res per cápita, se esperaría que aproximadamente un total de 7'103,300 personas consuman carne de vacuno producida en establecimientos de alto o muy alto riesgo. Todo ello probablemente debido a las malas condiciones sanitarias, como la falta de instalaciones y equipos sanitarios inadecuados, los malos hábitos sanitarios de los trabajadores y la deficiente limpieza de los utensilios y la ropa de trabajo. Se estima que cada año ocurren en Estados Unidos 265,000 casos de STEC(5). El principal serotipo implicado en las condiciones clínicas en los seres humanos es el O157:H7(6), que causa alrededor del 36% de estas infecciones, y el 64 % es causado por el serotipo no-O157. Las opiniones de los expertos en salud pública se basan en estimaciones y no en datos reales debido a que no todas las infecciones por ETS se diagnostican y notifican, ya que no hay laboratorios aprobados para el aislamiento de los serotipos no O157(7) o los laboratorios varían mucho en sus protocolos de cultivo de heces y en su capacidad para detectar este organismo. La familia de la toxina Shiga incluye varias toxinas relacionadas con la toxina Shiga de Shigella dysenteriae que comparten una estructura y una actividad biológica similares. La nomenclatura de la toxina Shiga es un sistema basado en la secuencia filogenética basada en la relación de las proteínas; la nomenclatura Stx se designa como Stx1a, Stx1c, Stx1d, Stx2a, Stx2b, Stx2c, Stx2d, Stx2e, Stx2f y Stx2g(8). El stx2a puede causar un daño mayor que el stx1; el stx2a se asoció con el serotipo O104:H4 en un brote de origen alimentario en Alemania y otros países que afectó a más de 4,000 personas en 2011; el 23 % de estos casos evolucionaron hasta desarrollar el síndrome urémico hemolítico (SUH)(9). Otros serotipos con esta variante son O157:H7(10) y O26:H11(11); esto sugiere que el stx2a está directamente asociado con el SUH(9-11). La toxina Stx2b suele estar presente en ovejas, cabras y ciervos, mientras que la toxina Stx2c se encuentra en cerdos sanos o enfermos(6). La toxina Stx2d fue identificada en el serotipo O26 de un paciente con diarrea sanguinolenta y síndrome urémico hemorrágico en Alemania; también se la encontró en el queso y la carne de res(12), así como en los subproductos de la carne de puerco y de cerdos salvajes(6). La variante stx2f ha sido reportada en palomas(13), pero hasta ahora, los reportes de enfermedades en humanos son escasos(8). El objetivo de este estudio fue identificar los serotipos y subtipos de Stx2 y asociarlos con su posible epidemiología; hay estudios donde existe una correlación entre el serotipo y subtipo de stx2 con el tipo de virulencia, además del riesgo de que esté asociado con infecciones importantes.

1032


Rev Mex Cienc Pecu 2020;11(4):1030-1044

Material y métodos Antecedentes

Los rastros en los que se tomaron muestras de las canales y las heces tienen un riesgo sanitario medio y alto, según la Guía para la realización del diagnóstico sanitario y la detección de necesidades operativas de los rastros municipales de la COFEPRIS. Durante el verano se realizó un muestreo en los rastros donde se sacrifican cerdos, ovejas y principalmente ganado vacuno; los animales que llegan son de la producción ganadera de los municipios adyacentes a los rastros. Para este estudio se tomó el número de animales sacrificados semanalmente en los 3 (A, B y C), con un sacrificio de 120, 80 y 375 respectivamente. Se contabilizaron 575 bovinos sacrificados por semana, y se obtuvo el tamaño de la muestra, considerando una prevalencia del 2,7 % y un nivel de confianza del 95 %, mediante la fórmula de tamaño de muestra de población finita, por lo que se obtuvo el siguiente tamaño de muestra: rastro A, 8; rastro B, 5; y rastro C, 25. Se realizaron tres repeticiones en cada rastro tomando muestras aparejadas (114 de canales y 114 de heces). Las muestras de las canales se tomaron después de que fueran lavadas y antes de que fueran puestas en refrigeración; las muestras de materia fecal se tomaron después de la evisceración de los animales.

Cepas en estudio

Se analizaron un total de 65 aislamientos de Escherichia coli de la colección del Centro de Investigación y Estudios Avanzados en Salud Animal de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Autónoma del Estado de México. Éstos se obtuvieron de las canales y las heces de los bovinos de tres rastros municipales (A, B y C) en el centro de México.

Serotipado

Éste se realizó según el procedimiento descrito por Orskov y Orskov(14). Se utilizó suero específico anti-H y anti-O (SERUNAM, México) para un total de 185 antígenos somáticos y 56 flagelados.

1033


Rev Mex Cienc Pecu 2020;11(4):1030-1044

Extracción de ADN Se extrajo ADN de células bacterianas congeladas a -70 °C; primero se tomaron 20 μl de cultivo bacteriano y se suspendieron en 200 μL de agua destilada estéril, y luego se incubaron a 100 °C durante 10 min para ser utilizados directamente en las reacciones de PCR(15).

Identificación de la toxina Shiga 2

Se emplearon los siguientes cebadores: 5´CTT CGG TAT CCT ATT CCC GG3´, 5´CTG CTG TGA CAG TGA CAA AAC GC3´(16) y 5´GGC ACT GTC TGA AAC TGC TCC 3´ y 5´TCG CCA GTT ATC TGA CAT TCT G3´(17). Se utilizó la cepa EDL933 de E. coli como control positivo; las condiciones de la PCR fueron descritas según los autores mencionados anteriormente. Los productos de la amplificación se separaron por electroforesis en geles de agarosa al 2%, y se visualizaron y capturaron con un fotodocumentador de imágenes (Transiluminador UVP Modelo M-20E y sistema de documentación y análisis de electroforesis Kodak Digital Science 120). Las cepas que resultaron positivas a stx2 y la reacción de PCR fueron purificadas usando el kit de gel Wizard® SV y el sistema de limpieza PCR (Promega) y secuenciadas en un analizador ABI PRISM 3730XL (Macrogen, Inc., Corea). La secuencia de nucleótidos de las toxinas Stx2 probadas fueron analizadas con la herramienta de búsqueda de nucleótidos estándar BLAST (Basic Local Alignment Search Tool).

Resultados En este estudio se encontraron 36 serotipos diferentes: 12.31 % (7/41) O157:H7, 9.23 % (6/65) O22:H8, 6.15 % (4/65) O?:H7, 4.62 % (3/65) O112ac:H2, O128ac:H26, O185:H2 y OR:H7, 3.07 % (2/65) O18ac:H21, O37:H10, O103:H16, O117:H4, O147:H28, O154:H53 y O?:H51, 1.54 % (1/65) O7:H30, O8:H25, O18ac:NM, O18ac:H7, O37:H?, O40:NM, O53:H2, O65:H16, O70:H16, O91:H10, O118ac:H21, O120:H10, O136:H16, O149:H2, O172:H45, O184:H12, O185:H7, OR:H2, OR:H?, O?:H2 y O?:H11 (Figura 1, Cuadro 1 ).

1034


Rev Mex Cienc Pecu 2020;11(4):1030-1044

Figura 1: Amplificación del ADN por PCR

Carril M Marcador de peso molecular; Carril 1 muestra positiva a stx2 (O157:H7); Carril 2-3 muestra positiva a la proteína hipotética (O18ac:NM y O102:H40); Carril 4 control positivo; Carril 5 control negativo.

En las muestras tomadas del rastro A se identificaron 9 serotipos (O37:H10, O40:NM, O65:H16, O70:H16, O112:H2, O157:H7, O172:H45, 0184:H12 y O?:H2) a partir de 10 aislamientos, en el 50% (5/10) de los cuales se identificó la toxina stx2. En 10 aislamientos tomados del rastro B se observaron 9 serotipos (O18:H7, O112:H2, O120:H10, O128:H26, O185:H7, OR:H2, ORH?, O?:H7 y O?H11); el 20 % (2/10) de ellos resultó positivo a stx2. En el rastro C se encontraron 23 serotipos diferentes a partir de 45 aislamientos; el 64.4 % dieron positivo a stx2. En este lugar se encontró que los serotipos se amplificaban con cebadores, pero después de la secuenciación, sólo el 17,8 % (11/45) se identificó como una hipotética proteína (Figura 1, Cuadro 1).

1035


Rev Mex Cienc Pecu 2020;11(4):1030-1044

Cuadro 1: Identificación del gen Stx2 en la Escherichia coli productora de la toxina Shiga y serotipos aislados de canales de ganado bovino Tipo de Número de Serotipo Aislamiento Stx2 Subtipos muestra* muestreo O8:H25

43

Canal (C)

+

Stx2a

KT356574

O18ac:NM

49

Canal (C)

+

PH

KT356580

O18ac:H7

11

Canal (B)

O18ac:H21

39

Canal (C)

+

Stx2a

KT356571

45

Canal (C)

+

Stx2a

KT356576

47

Canal (C)

+

Stx2a

KT356578

50

Canal (C)

+

Stx2d

KT356581

O37:H10

6

Canal (A)

O40:NM

7

Canal (A)

+

Stx2a

KT356555

O65:H16

1

Canal (A)

+

Stx2c

KT356546

O91:H10

27

Canal (C)

+

Stx2c

KT356564

O102:H40

22

Canal (C)

+

PH

KT356560

O112ac:H2

2

Canal (A)

+

Stx2a

KT356548

(2)

19

Canal (B)

O118ac:H21

21

Canal (C)

O120:H10

20

Canal (B)

Negativo

O128ac:H26

16

Canal (B)

Negativo

(2)

41

Canal (C)

Negativo

O22:H8 (3)

Negativo

Negativo +

+ 1036

Stx2c

Stx2c

KT356559

KT356573


Rev Mex Cienc Pecu 2020;11(4):1030-1044

O136:H16

52

Canal (C)

+

Stx2c

KT356582

O149:H2

35

Canal (C)

+

PH

KT356567

O154:H53

32

Canal (C) Negativo

(2)

33

Canal (C)

23

Canal (C)

+

Stx2c

KT356561

3A

Canal (C)

+

Stx2c

KT356551

4A

Canal (C)

+

Stx2c

KT356552

5A

Canal (C)

+

Stx2c

KT356553

6A

Canal (C)

+

Stx2c

KT356554

O172:H45

9

Canal (A)

Negativo

O185:H2

29

Canal (C)

Negativo

1A

Canal (C)

+

Stx2a

KT356547

2A

Canal (C)

+

Stx2a

KT356549

C

Canal (C)

+

Stx2a

KT356585

ONT:H2

4

Canal (A)

Negativo

ONT:H7

14

Canal (B)

Negativo

(2)

G

Canal (C)

ONT:H11

12

Canal (B)

ONT:H51

25

Canal (C)

O157:H7 (5)

OR:H7 (3)

+

PH

KT356586

Negativo +

Stx2a

( ) Planta de matanza A, B, o C. PH= proteína hipotética; NM= no móvil; NT= no tipificable; R= rugoso.

1037

KT356563


Rev Mex Cienc Pecu 2020;11(4):1030-1044

En este estudio, el 63,07 % (41/65) de las cepas de Escherichia coli amplificadas a stx2, tras el análisis de su secuencia en BLAST se confirmó que el 71.5 % (33/41) eran Stx2; también se encontraron cepas amplificadas con cebadores, pero tras el análisis de la secuencia realizada en BLAST se identificó que el 19,5% (8/41) eran proteínas hipotéticas y se enviaron a la base de datos del GenBank, con los números de acceso son: KT356546, KT356547, KT356548, KT356549, KT356550, KT356551, KT356552, KT356553, KT356554, KT356555, KT356556, KT356557, KT356558, KT356559, KT356560, KT356561, KT356562, KT356563, KT356564, KT356565, KT356566, KT356567, KT356568, KT356569, KT356570, KT356571, KT356572, KT356573, KT356574, KT356575, KT356576, KT356577, KT356578, KT356579, KT356580, KT356581, KT356582, KT356583, KT356584, KT356585 y KT356586 (Cuadro 1).

Discusión La Escherichia coli ha sido asociada con diversas condiciones patológicas(4); desde 1980 hasta el presente se han reconocido más de 6,600 entradas que representan 1,152 STEC serotipos(18); algunos de ellos están implicados en brotes de enfermedades esporádicas en los seres humanos y el ganado, y sus productos actúan como una fuente primaria de contaminación(1,3). En México hay pocos informes de serotipos de E. coli, en este estudio se encontraron 36 serotipos diferentes. Amézquita-López et al(19) identificaron 19 serotipos a partir de heces de animales domésticos en granjas rurales de Culiacán, Sinaloa, México; el principal serotipo encontrado fue el O157:H7 con un 43.1 % (28/65), del cual el 57 % (16/28) procedía de bovinos. Otros serotipos encontrados fueron O8:H19, O15:NT, O73:NT, O75:H8 y O168:NT. En este estudio el serotipo O157:H7 fue también el más frecuente (12.31 %), pero no se identificó ninguno de los serotipos reportados por Amézquita-López et al(19). En Argentina y Alemania el serotipo más importante en el ganado y sus subproductos es el O178:H19(4) y representa un serotipo emergente frecuentemente aislado en brotes de colitis hemorrágica y síndrome urémico hemolítico en humanos(20). Otros estudios encontraron que los serotipos O70:H16, O91:H10, O112ac:H2 y O128ac:H26 son la causa del síndrome urémico hemorrágico en Alemania(6); en este estudio se encontraron estos mismos serotipos, por lo que son un hallazgo importante para la salud pública en México. Fernández et al(21) identificaron con mayor frecuencia los serotipos O113:H21, O130:H11 y O178:H19 en heces de bovinos en Argentina. Un estudio realizado en Alemania identificó los serotipos O113:H21, O22:H8, O174:H21, O178:H19, O113:H4 y O91:H14 y mencionó que éstos son los serotipos más comunes en el ganado bovino en el mundo(6). En Francia se reportaron los serotipos O157:H7, O26:H11, O103:H2, O111:H8 y O145:H28 en heces bovinas provenientes de rastros(22). El más frecuente fue el O157:H7, con un porcentaje de hasta 1.2 %, el cual es más bajo que el obtenido en este estudio (9.23 %); esta diferencia puede ser 1038


Rev Mex Cienc Pecu 2020;11(4):1030-1044

resultado de las condiciones particulares del rastro, o bien, del período en que se realizó el estudio. En el serogrupo O128, aunque es más común aislado de las ovejas, se ha encontrado en pacientes humanos, ganado sano y carne de res; en este estudio se encontró en las canales y en las heces de los bovinos con la presencia de Stx2c(18). Hoy en día este serogrupo ya no se limita a una especie específica. La distribución y la frecuencia de los serotipos y patotipos pueden variar considerablemente de una región a otra; en ese sentido los serotipos pueden variar en su patogenicidad o pueden convertirse en serotipos emergentes(23). Las toxinas Shiga se consideran los principales factores de virulencia en el desarrollo del SUH(2). Friesema et al(13) mencionaron que la presencia de los subtipos stx2 mostró una diferencia en el punto de las manifestaciones clínicas en los seres humanos, en este estudio, el 63,07 % (41/65) de las cepas de Escherichia coli amplificadas a stx2, después del análisis de su secuencia en BLAST se confirmó que el 71,5 % (33/41) eran Stx2; también se encontraron cepas amplificadas con cebadores, pero después del análisis de la secuencia realizado con BLAST se identificó que el 19.5 % (8/41) era una proteína hipotética. En un estudio llevado a cabo en China se encontraron los subtipos Stx2b, Stx2c y Stx2e en la carne de res de los supermercados(3). En el serogrupo O22 aislado de la carne de res se encontró la toxina stx2b. Estos resultados son significativos porque el mismo serotipo encontrado podría tener esta misma variedad; sin embargo, otro estudio mencionó que esta variedad puede ser la causa potencial del síndrome urémico hemolítico en el serogrupo O26(11). En un informe sobre carnes crudas de venta al menudeo en China se identificó la toxina Stx2a en el serogrupo O40; también se informó del serogrupo O91 en carne de puerco y de cordero con presencia de Stx2e y Stx2b, respectivamente(3), y en este estudio el mismo serogrupo también puede tener esas variedades, aunque este aislado fue obtenido de canales de bovinos. En un estudio de 210 pacientes con síndrome urémico hemorrágico de diferentes regiones de Alemania, se informó del serotipo O91:H2(24) y se comparó su virulencia con la de O91:H10 como causa principal del SUH. Bai et al(3) consideran que tener un serotipo con toxina Stx2 presente en las canales de ganado para consumo humano podría ser un riesgo importante. También identificó el serogrupo O103 sin la presencia de la toxina Stx2. En este estudio se obtuvieron dos aislamientos del mismo serogrupo, pero sólo uno tenía la presencia de Stx2; este serogrupo es importante, ya que se ha informado que causa SUH(20). Otro estudio encontró que el serogrupo O128 con Stx2b(3); en este estudio se encontró el mismo serogrupo que en el Stx2c. En Alemania se investigó la presencia de STEC durante la labor de diagnóstico de rutina en el Instituto de Higiene y Microbiología y se identificaron cepas de Stx2c que no eran de O157; también se mencionó que era más probable encontrar SUH en esta variante, mientras que la presencia de Stx2d puede manifestarse en una forma más leve(25). En Turquía se ha asociado una mayor citotoxicidad en el desarrollo del SUH a partir de la cepa O157:H7 con la presencia de Stx2c(26); esto concuerda con otro estudio realizado en Suiza en el que se asocia la presencia de stx2a/stx2d/stx2c en pacientes con diarrea, y con SUH(27). En este estudio se identificó en el mismo serotipo la toxina stx2c, la cual podría ser un factor de riesgo de enfermedad. 1039


Rev Mex Cienc Pecu 2020;11(4):1030-1044

En el rastro A se identificaron 9 serotipos (O37:H10, O40:NM, O65:H16, O70:H16, O112:H2, O157:H7, O172:H45, 0184:H12 y O?:H2) a partir de 10 aislamientos, en 50% (5/10) de los cuales se identificó la toxina stx2. En los 10 aislamientos del rastro B se observaron 9 serotipos (O18:H7, O112:H2, O120:H10, O128:H26, O185:H7, OR:H2, ORH?, O?:H7 y O?H11); el 20 % (2/10) de ellos resultó ser positivo a Stx2. En el rastro C, a partir de los 45 aislamientos se encontraron 23 distintos serotipos; el 64.4 % resultó positivo a Stx2. En este lugar se encontró que los serotipos se amplificaban con cebadores; pero después de la secuenciación sólo se identificó el 17.8 % (11/45) como una proteína hipotética (Cuadro 1). Las enfermedades transmitidas por los alimentos (ETA) se producen por la ingestión de alimentos o agua contaminados con agentes biológicos, lo que afecta a la salud del consumidor, y pueden ser causadas por la manipulación inadecuada de los alimentos en cualquier etapa de su cadena de producción. En México las enfermedades gastrointestinales ocupan el segundo lugar según la Secretaría de Salud, con 6'106,572 casos acumulados en 2017, considerando que de estos, 5'606,759 no han sido asociados con un agente etiológico. En el área del Altiplano Central de México se han reportado 94,081 casos. Sin embargo, en México los estudios epidemiológicos no revelan en todos los casos cuáles son los alimentos asociados con las ETA ni qué microorganismos las causan, mucho menos si los casos de SUH se relacionan con Escherichia coli. Tan solo la Dirección General de Epidemiología de la Secretaría de Salud registra un número significativo de casos cada año, con tasas que ascienden a 4,859 casos por cada 100 mil habitantes. Otra estimación indica que, si hay unos 5 millones de casos anuales de enfermedades diarreicas en México, y un ajuste conservador indica que sólo el 50 % son causadas directamente por los alimentos, con un subregistro de 1 por cada 100 episodios, el número real de casos sería de unos 250 millones de episodios por año, equivalentes a 2.5 episodios por persona por año. Esto conlleva un impacto económico significativo, puesto que reduce la productividad de las personas debido al ausentismo o al mal desempeño en el trabajo, ocasiona pérdidas económicas para el país debido al aumento de la demanda de medicamentos y de servicios médicos y hospitalarios, y tiene un impacto negativo en el turismo y en el desarrollo del comercio nacional e internacional. Así que un estudio del Instituto Panamericano de Protección de Alimentos y Zoonosis (INPPAZ), estimaron las pérdidas económicas por ETA en México, en 1.1 mil billones de dólares tan sólo por la reducción de la productividad. Este trabajo demuestra la importancia de los bovinos portadores de E. coli con serotipos considerados importantes en la salud pública, pues cuando se hace un manejo inadecuado en los rastros se pueden contaminar las canales; de allí que exista la necesidad de mejorar el proceso para obtener información sobre la carne, y por ende, una estrategia para reducir el riesgo de infecciones por serotipos de este lenguaje en los seres humanos sería reducir su prevalencia en el ganado, así como mejorar el manejo del mismo en los rastros. 1040


Rev Mex Cienc Pecu 2020;11(4):1030-1044

Conclusiones e implicaciones Se demostró la presencia de diversos serotipos de STEC en las canales de bovinos y en las heces de los rastros municipales de México. También se demostró la presencia de serotipos importantes para la salud humana y animal que presentan la toxina stx2, la cual puede tener el potencial de causar el síndrome urémico hemolítico, por lo que se considera un importante factor de riesgo capaz de desencadenar enfermedades humanas. Un rastro se ocupa de la transformación de uno o varios tipos de ganado vacuno para el consumo humano a través de una serie de etapas básicas y determinantes en la calidad de la carne, y existe una autoridad responsable que tiene la facultad legal de establecer y hacer cumplir los requisitos en relación con la higiene de la carne. Existen programas sobre higiene de la carne, y su principal objetivo es la protección de la salud pública, además de que basan sus decisiones en la evaluación científica de los posibles riesgos para la salud humana, donde se consideran todos los peligros alimentarios identificados en las actividades de investigación, vigilancia y otras actividades pertinentes, de modo que la higiene de los alimentos se define como todas las condiciones y medidas necesarias para garantizar la inocuidad y la idoneidad de los alimentos en todas las etapas de la cadena de producción de alimentos. La seguridad de una producción no está garantizada por el examen bacteriológico del producto terminado, sino por el estricto cumplimiento de cada una de las etapas del proceso de obtención de la carne.

Literatura citada: 1. Ferens WA, Hovde CJ. Escherichia coli O157:H7: Animal reservoir and sources of human infection. Foodborne Pathog Dis 2011;8(4):465−487. 2. Krüger A, Lucchesi PM. Shiga toxins and stx phages: highly diverse entities. Microbiol 2014;61(3):451−462. 3. Bai X, Wang H, Xin Y, Wei R, Tang X, Zhao A, et al. Prevalence and characteristics of Shiga toxin-producing Escherichia coli isolated from retail raw meats in China. Int J Food Microbiol 2015;4(200):31−38. 4. Miko A, Rivas M, Bentancor A, Delannoy S, Fach P, Beutin L. Emerging types of Shiga toxin-producing E. coli (STEC) O178 present in cattle, deer, and humans from Argentina and Germany. Front Cell Infect Microbiol 2014;17(4):1−14. 5. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson MA, Roy SL, et al. Foodborne illness acquired in the United States---major pathogens. Emerg Infect Dis 2011;17(1):7−15.

1041


Rev Mex Cienc Pecu 2020;11(4):1030-1044

6. Martin A, Beutin L. Characteristics of Shiga toxin-producing Escherichia coli from meat and milk products of different origins and association with food producing animals as main contamination sources. Int J Food Microbiol 2011;146(1):99−104. 7. Centers for Disease Control and Prevention (CDC). 2012. National shiga toxin-producing Escherichia coli (STEC) surveillance overview. Atlanta, Georgia: US Department of Health and Human Services. Available at: https://www.cdc.gov/ncezid/dfwed/pdfs/national-stec-surveillance-overiew-508c.pdf. Accessed Sep 1, 2017. 8. Smith JL, Fratamico PM, Gunther NW. Shiga toxin-producing Escherichia coli. Adv Appl Microbiol 2014;86:145−197. 9. Beutin, L, Martin A. Outbreak of Shiga toxin-producing Escherichia coli (STEC) O104:H4 infection in Germany causes a paradigm shift with regard to human pathogenicity of STEC strains. J Food Prot 2012;75(2):408−418. 10. Soborg B, Lassen SG, Müller L, Jensen T, Ethelberg S, Mølbak K, et al. A verocytotoxinproducing E. coli outbreak with a surprisingly high risk of haemolytic uraemic syndrome, Denmark, September-October 2012. Euro Surveill 2013;18(2):1−3. 11. Bielaszewska M, Mellmann A, Bletz S, Zhang W, Köck R, Kossow A, et al. Enterohemorrhagic Escherichia coli O26:H11/H-: a new virulent clone emerges in Europe. Clin Infect Dis 2013;56(10):1373−1381. 12. Delannoy S, Mariani-Kurkdjian P, Bonacorsi S, Liguori S, Fach P. Characteristics of emerging human-pathogenic Escherichia coli O26:H11 strains isolated in France between 2010 and 2013 and carrying the Stx2d gene only. J Clin Microbiol 2015;53(2):486−492. 13. Friesema I, Van-der-Zwaluw K, Schuurman T, Kooistra-Smid M, Franz E, et al. Emergence of Escherichia coli encoding Shiga toxin 2f in human Shiga toxin-producing E. coli (STEC) infections in the Netherlands, January 2008 to December. European Surveillance 2014;19(17):26−32. 14. Orskov F, Orskov I. Serotyping of Escherichia coli. Methods Microbiol 1984;41:43−112. 15. Reyes-Rodríguez NE, Soriano-Vargas E, Barba-León J, Navarro A, Talavera-Rojas M, Sanso AM, et al. Genetic characterization of Escherichia coli isolated from cattle carcasses and feces in Mexico State. J Food Prot 2015;78(4):796−801.

1042


Rev Mex Cienc Pecu 2020;11(4):1030-1044

16. Blanco M, Padola NL, Krüger A, Sanz ME, Blanco JE, González EA, et al. Virulence genes and intimin types of Shiga-toxin-producing Escherichia coli isolated from cattle and beef products in Argentina. Int Microbiol 2004;7(4):269−276. 17. Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev 1998;11(3):450−479. 18. Bettelheim K, Goldwater P. Serotypes of Non-O157 Shigatoxigenic Escherichia coli (STEC). Adv Microbiol 2014;4(7):377−389. 19. Amézquita-López BA, Quiñones B, Cooley MB, León-Félix L, Castro-del-Campo N, Mandrell RE, et al. Genotypic analyses of shiga toxin-producing Escherichia coli O157 and non-O157 recovered from feces of domestic animals on rural farms in Mexico. PLoS One 2012;7(12): E51565. 20. Mellmann A, Bielaszewska M, Köck R, Friedrich AW, Fruth A, Middendorf B, et al. Analysis of collection of hemolytic uremic syndrome-associated enterohemorrhagic Escherichia coli. Emerg Infect Dis 2008;14(8):1287−1290. 21. Fernández D, Irino K, Sanz ME, Padola NL, Parma AE. Characterization of Shiga toxinproducing Escherichia coli isolated from dairy cows in Argentina. Lett Appl Microbiol 2010;51(4):377−382. 22. Bibbal D, Loukiadis E, Kérourédan M, Ferré F, Dilasser F, Peytavin-de-Garam C, et al. Prevalence of carriage of shiga toxin-producing Escherichia coli serotypes O157:H7, O26:H11, O103:H2, O111:H8, and O145:H28 among slaughtered adult cattle in France. Appl Environ Microbiol 2015;81(4):1397−1405. 23. Vu-Khac H, Holoda E, Pilipcinec E, Blanco M, Blanco JE, Dahbi G, et al. Serotypes, virulence genes, intimin types and PFGE profiles of Escherichia coli isolated from piglets with diarrhea in Slovakia. Vet J 2007;174(1):176−187. 24. Mellmann A, Fruth A, Friedrich AW, Wieler LH, Harmsen D, Werber D, et al. Phylogeny and disease association of Shiga toxin-producing Escherichia coli O91. Emerg Infect Dis 2009;15(9):1474−1477. 25. Friedrich AW, Bielaszewska M, Zhang WL, Pulz M, Kuczius T, Ammon A, et al. Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J Inf Dis 2001;185(1):74−84.

1043


Rev Mex Cienc Pecu 2020;11(4):1030-1044

26. Ayaz ND, Gencay YE, Erol I. Prevalence and molecular characterization of sorbitol fermenting and non-fermenting Escherichia coli O157:H7 (+)/H7 (-) isolated from cattle at slaughterhouse and slaughterhouse wastewater. Int J Food Microbiol 2014;17(174):31−38. 27. Nüesch-Inderbinen M, Morach M, Cernela N, Althaus D, Jost M, Mäusezahl M, et al. Serotypes and virulence profiles of Shiga toxin-producing Escherichia coli strains isolated during 2017 from human infections in Switzerland. Int J Med Microbiol 2018;08(7):933-939

1044


https://doi.org/10.22319/rmcp.v11i4.5379 ArtĂ­culo

Impacto de la inclusiĂłn de informaciĂłn extranjera sobre la evaluaciĂłn genĂŠtica mexicana de sementales Holstein Gustavo Javier MartĂ­nez MarĂ­n a Felipe de JesĂşs Ruiz LĂłpez a Carlos Gustavo VĂĄsquez PelĂĄez b Sergio IvĂĄn RomĂĄn Ponce a Adriana GarcĂ­a Ruiz a*

a

Instituto Nacional de Investigaciones Forestales, AgrĂ­colas y Pecuarias. Centro Nacional de InvestigaciĂłn Disciplinaria en FisiologĂ­a y Mejoramiento Animal. Km 1 carretera AjuchitlĂĄn-ColĂłn, AjuchitlĂĄn, QuerĂŠtaro, MĂŠxico. b

Universidad Nacional AutĂłnoma de MĂŠxico, Facultad de Medicina Veterinaria y Zootecnia, Ciudad de MĂŠxico, MĂŠxico.

*Autor de correspondencia: garcia.adriana@inifap.gob.mx

Resumen: El objetivo del presente estudio fue evaluar el impacto de la inclusiĂłn de informaciĂłn extranjera de sementales de la raza Holstein, sobre su evaluaciĂłn genĂŠtica para las caracterĂ­sticas de producciĂłn de leche (PL), grasa (PG) y proteĂ­na (PP) en kilogramos. Lo anterior, se logrĂł mediante la comparaciĂłn de valores genĂŠticos (VG) y confiabilidades (CF), agrupaciĂłn de sementales por nĂşmero de hijas, ordenamiento de los sementales y la superioridad genĂŠtica esperada por aĂąo (â&#x2C6;&#x2020;đ??źđ?&#x2018; â &#x201E;đ?&#x2018;Śđ?&#x2018; ), con diferentes escenarios determinados por la intensidad de selecciĂłn (đ?&#x2018;&#x2013;đ?&#x2018;?đ?&#x2018;  ) de sementales usados en la evaluaciĂłn genĂŠtica nacional (EGMEX), los incorporados a la evaluaciĂłn genĂŠtica internacional con hijas en MĂŠxico (EG-I) y la evaluaciĂłn genĂŠtica internacional con o sin hijas en MĂŠxico (EG-MACE). En total, se analizĂł la informaciĂłn de 5,825 sementales en la para PL y 3,914 para PG y PP. El impacto

1045


Rev Mex Cienc Pecu 2020;11(4):1045-1058

de la información extranjera en la EG-MEX es positivo, debido a que mejora la CF de los VG de los sementales usados en México. También, permitió observar diferencias importantes de los VG y CF entre las evaluaciones, generando una oportunidad de mejoramiento en la población Holstein mexicana; por lo que, es recomendable continuar con la participación en el programa de Interbull, y considerar el uso de la información validada de manera internacional en los procesos de selección de animales productores de leche y sus componentes. Estas acciones pueden contribuir de manera importante en el incremento del progreso genético productivo a nivel nacional. Palabras clave: Valor genético, Confiabilidad, Evaluación genética, Correlación genetica.

Recibido: 14/05/2019 Aceptado: 22/11/2019

Introducción La evaluación genética consiste en la predicción del mérito o valor genético (VG) de un animal considerando la información genealógica, fenotípica (registros de producción y componentes de la leche, conteo de células somáticas, y conformación, entre otras)(1). La primera evaluación genética del ganado Holstein en México, fue realizada en 1974, por la Universidad de Guelph (Ontario, Canadá) a solicitud de la Asociación Holstein de México (AHM), incluyendo solamente características de conformación. Durante las siguientes décadas, se integraron características de producción de leche (PL), grasa (PG), proteína (PP) en kilogramos, entre otras, y se realizaron modificaciones en el sistema de calificación para la identificación de animales altamente productivos y funcionales que eran utilizados en nuestro país(1,2,3). Actualmente, la AHM junto con el Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal (CENID-FyMA) perteneciente al Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), son los encargados de realizar cada cuatro meses las evaluaciones genéticas para producción y calidad de leche, 27 caracteres de conformación, longevidad, células somáticas y los índices de selección de ganado Holstein registrado ante la AHM. La metodología utilizada para la predicción de estos VG, es la del Mejor Predictor Lineal Insesgado (BLUP), que consiste en un modelo mixto que engloba ecuaciones simultaneas de efectos fijos y aleatorios para realizar la estimación de componentes de varianza, basado en el rendimiento individual y en la representación de todas las relaciones genéticas entre los individuos(4). Los resultados de estas evaluaciones, sirven como identificadores de los mejores ejemplares, proporcionando diversas opciones a los ganaderos para los procesos de selección.

1046


Rev Mex Cienc Pecu 2020;11(4):1045-1058

A medida que aumenta el intercambio de material genético alrededor del mundo, existe la posibilidad de que un mismo animal tenga descendencia en diferentes países y, por lo tanto, cuente con más de una evaluación genética. En el caso de México, un alto porcentaje de material genético es importado en forma de semen congelado y para cuando los sementales importados tienen información en México para la predicción de su VG, estos ya cuentan con una evaluación genética en su país de orígen con más información que la generada en nuestro país. Ante la inquietud de incorporar la información generada a nivel global, Schaeffer(5) propuso la metodología de evaluación genética que integra información de múltiples países (MACE). Para lograr lo anterior, se construyen ecuaciones de regresión con el objeto de predecir los VG de los sementales importados en la base del país importador, ajustando según el origen de la información(6,7). Existen numerosas ventajas de utilizar el sistema MACE, entre las cuales destacan: 1) el rendimiento de sementales ajustado por la información de producción de las hijas provenientes de las diversas evaluaciones de los países participantes y; 2) la identificación de ejemplares existentes en otros países que puedan ser mejoradores bajo las condiciones propias del país importador(5,7). El objetivo del presente estudio fue evaluar el impacto de la inclusión de información extranjera de sementales de la raza Holstein sobre su evaluación genética para las características de PL, PG y PP, y predecir las tasas de mejoramiento genético esperadas de la utilización de las evaluaciones resultantes. Con la incorporación de dicha información, se espera mejorar la precisión de los VG y por ende, las tasas de mejoramiento genético de las características evaluadas.

Material y métodos Base de datos Los registros productivos de leche y sus componentes se recopilaron por el sistema de control de producción oficial de la AHM y procesados por el CENID-FyMA-INIFAP. Para el cálculo de VG de la evaluación genética mexicana (EG-MEX) se utilizó la información de 623,207 registros de PL, correspondientes a 355,786 animales provenientes de 527 hatos y 193,236 registros para PG y PP, correspondientes a 103,829 animales provenientes de 167 hatos. Los establos de los cuales se obtuvo la información, se encuentran distribuidos en 17 diferentes entidades federativas de la República Mexicana. La información genealógica constó de 403,817 animales, incluyendo registros de hasta cinco generaciones para los animales con producción disponible. Los registros con información productiva fuera de los parámetros biológicos observados en el sistema de producción y en la raza (PL ajustada a 305 días <3,500 kg o >22,000 kg por lactación, PG y PP <1.5% o >8.0%)(1) fueron eliminados del estudio.

1047


Rev Mex Cienc Pecu 2020;11(4):1045-1058

EstimaciĂłn de los valores genĂŠticos y confiabilidades El proceso de estimaciĂłn de VG de la EG-MEX, se realizĂł por medio de un modelo animal de repetibilidad(1,8), usando el software BLUPF90 con la paqueterĂ­a SS-BLUPF90(9,10). El modelo utilizado para cada una de las tres caracterĂ­sticas de producciĂłn(11), fue el siguiente: đ?&#x2018;Ś = đ?&#x2018;&#x2039;đ?&#x203A;˝ + đ?&#x2018;?1 đ?&#x2018;˘ + đ?&#x2018;?2 đ?&#x2018;? + đ?&#x2018;&#x2019; donde: đ?&#x2019;&#x161; = vector de los registros productivos ajustados a 305 dĂ­as y equivalente de madurez (leche, grasa o proteĂ­na respectivamente); đ?&#x153;ˇ = vector de efectos fijos (hato-aĂąo-estaciĂłn, interacciĂłn semental-hato y edad al parto); đ?&#x2018;ż = matriz de incidencia relacionada con los efectos fijos; đ?&#x2019; đ?&#x;? = matriz de incidencia relacionada con los efectos aleatorios de đ?&#x2018;˘; đ?&#x2019;&#x2013; = vector aleatorio de efectos genĂŠticos aditivos; đ?&#x2019; đ?&#x;? = matriz de incidencia relacionada con efectos aleatorios de ambiente permanente; đ?&#x2019;&#x2018; = vector de efectos de ambiente permanente; đ?&#x2019;&#x2020; = vector de efectos residuales. Conjuntamente a la estimaciĂłn de VG de los animales, se calculĂł su confiabilidad(8,12) como: đ?&#x2018;&#x192;đ??¸đ?&#x2018;&#x2030; [1 â&#x2C6;&#x2019; ( 2 ) (đ?&#x153;&#x2020;)] đ?&#x153;&#x17D;đ??¸ 2 donde: đ?&#x153;&#x17D;đ??¸ = Varianza ambiental; đ?&#x153;&#x2020; = la proporciĂłn de la varianza ambiental (đ?&#x153;&#x17D;đ??¸2 ) entre la varianza genĂŠtica aditiva (đ?&#x153;&#x17D;đ??´2 ) que es igual a [(1 â&#x2C6;&#x2019; â&#x201E;&#x17D;2 )â &#x201E;â&#x201E;&#x17D;2 ]; đ?&#x2018;&#x192;đ??¸đ?&#x2018;&#x2030; = Varianza del error de predicciĂłn, estimado como: 2 2 đ?&#x2018;&#x192;đ??¸đ?&#x2018;&#x2030; = (1 â&#x2C6;&#x2019; đ?&#x2018;&#x;đ??´đ??´ Ě&#x201A; )đ?&#x153;&#x17D;đ??´ 2 2 donde: đ?&#x2018;&#x;đ??´đ??´ Ě&#x201A; = Coeficiente de correlaciĂłn entre el VG predicho y VG verdadero; đ?&#x153;&#x17D;đ??´ = varianza aditiva.

Durante este proceso, se estimaron los VG y las CF de 7,489 sementales para PL y de 5,148 para PG y PP. Dicha informaciĂłn fue proporcionada a Servicio Internacional de EvaluaciĂłn de Sementales (Interbull) para su integraciĂłn al sistema de EG-I.

EvaluaciĂłn genĂŠtica internacional La informaciĂłn de VG y CF proveniente de la EG-MEX (7,489 sementales para PL y 5,148 para PG y PP), fue procesada bajo los lineamientos establecidos por el Ă rea de Intercambio de InformaciĂłn Interbull (IDEA, por sus siglas en inglĂŠs), para su validaciĂłn e incorporaciĂłn a la evaluaciĂłn genĂŠtica internacional (EG-I)(7). La informaciĂłn de cada uno de los paĂ­ses participantes es recopilada y ajustada por Interbull con el procedimiento MACE con base en la cantidad, la estructura de los grupos contemporĂĄneos y las correlaciones internacionales(13,14). Del total de la informaciĂłn proporcionada por MĂŠxico, 5,825 1048


Rev Mex Cienc Pecu 2020;11(4):1045-1058

sementales para PL y 3,914 para PG y PP contaron con informaciĂłn productiva de al menos una hija en mĂĄs de un paĂ­s, por lo que pudieron ser incorporados a la base productiva y de pedigrĂ­ a nivel internacional. Conjuntamente al proceso de EG-I, se realizĂł la prueba de correlaciones genĂŠticas internacionales (CGI), en la cual, solo se integraron por paĂ­s participante a aquellos sementales que cumplieron con los requisitos mĂ­nimos de prueba especificados por Interbull(7,15). MĂŠxico aportĂł informaciĂłn de 553 sementales para PL, 183 para PG y 181 para PP, para dicha prueba.

ComparaciĂłn de los valores genĂŠticos y sus confiabilidades entre las evaluaciones genĂŠticas nacional e internacional Las tendencias genĂŠticas se analizaron a partir de los VG promedio obtenidos tanto en la EG-MEX como en la EG-I por aĂąo de nacimiento de los sementales. Con el objetivo de evaluar si el impacto de la informaciĂłn extranjera sobre la EG-MEX estĂĄ relacionada con el nĂşmero de hijas del semental en MĂŠxico, a cada semental se le asignĂł un grupo (mĂĄs de 50, entre 10 y 50 y menos de 10 hijas) y se calcularon las medias y desviaciones estĂĄndar de VG y CF para cada grupo y evaluacion genĂŠtica (EG-MEX y EG-I). Adicionalmente, para evaluar la concordancia entre las evaluaciones, se calcularon correlaciones de Pearson (ď ˛P) tanto para VG como para CF de las tres caracterĂ­sticas (PL, PG y PP). TambiĂŠn, se calculĂł la tasa de mejoramiento genĂŠtico esperado (β) de la utilizaciĂłn de las EG-MEX y EG-I en la elecciĂłn de sementales a travĂŠs de un anĂĄlisis de regresiĂłn lineal. Posteriormente, se ordenaron a los sementales de forma descendente por su VG tanto para la EG-MEX como para la EG-I y fueron clasificados en diferentes escenarios de selecciĂłn, tomando en cuenta los percentiles (đ?&#x2018;&#x2013;đ?&#x2018;?đ?&#x2018; = el mejor 10 %, 20 %, 30 %, 40 % y 50 %), para con ello, realizar las comparaciones de medias para VG y CF de las tres caracterĂ­sticas (PL, PG y PP) por grupo, del nĂşmero en comĂşn de sementales en ambas evaluaciones durante el ordenamiento, su asociaciĂłn monĂłtona por medio de la correlaciĂłn de Spearman (ď ˛S) y el cĂĄlculo de la superioridad genĂŠtica esperada de los sementales por aĂąo (â&#x2C6;&#x2020;đ??źđ?&#x2018;  â &#x201E;đ?&#x2018;Śđ?&#x2018; ) por el mĂŠtodo descrito por Bourdon(16) como: â&#x2C6;&#x2020;đ??źđ?&#x2018;  â &#x201E;đ?&#x2018;Śđ?&#x2018;  = đ?&#x2018;&#x2013;đ?&#x2018;?đ?&#x2018;  đ?&#x2018;&#x;đ?&#x2018;  đ?&#x153;&#x17D;đ??´ /đ??żđ?&#x2018;  donde, đ?&#x2018;&#x2013;đ?&#x2018;?đ?&#x2018;  = intensidad de selecciĂłn definida por el porcentaje de sementales genotĂ­picamente superiores (10%, 20%, 30%, 40% y 50%), đ?&#x2018;&#x;đ?&#x2018;  = precisiĂłn de los VG de los sementales, đ?&#x153;&#x17D;đ??´ =desviaciĂłn genĂŠtica aditiva de los sementales, y đ??żđ?&#x2018;  =Intervalo generacional de 6 aĂąos para sementales padres de vacas(17). Para cada uno de los escenarios de selecciĂłn por percentiles, se calculĂł la â&#x2C6;&#x2020;đ??źđ?&#x2018;  /đ?&#x2018;Śđ?&#x2018;  tomando las diferentes đ?&#x2018;&#x2013;đ?&#x2018;?đ?&#x2018;  , pero con los resultados de la EG-MEX, EG-I y la evaluaciĂłn genĂŠtica internacional completa (EG-MACE), esta Ăşltima haciendo referencia a todos los sementales

1049


Rev Mex Cienc Pecu 2020;11(4):1045-1058

participantes en la prueba internacional (150,300 sementales) ordenados de manera decendente y que pueden o no tener hijas en México.

Resultados y discusión Los VG obtenidos en la prueba difieren en promedio 120 kg en PL (de -200 ± 315 kg en EGMEX a -80.1 ± 411.5 kg para EG-I), 4.6 para PG (de -2.4 ± 8.2 kg en EG-MEX a 2.2 ± 12.5 para EG-I) y 5.8 para PP (-3.6 ± 7.9 kg en EG-MEX a 2.2 ± 12.3 kg para EG-I). Las CF en promedio son mayores en la EG-I que en EG-MEX, e incluso llegan a ser el doble (de 73 a 30 para PL y de 74 a 29 para PG y PP) al considerar información de hijas en producción en los diversos países participantes. En ambas evaluaciones (EG-MEX y EG-I) se observó una tendencia positiva en el mejoramiento genético promedio por año de nacimiento resultando la EG-I con los mayores VG durante todo el periodo de estudio (Figura 1). También, se muestra un descenso de la CF promedio en los últimos años de estudio, evento que coincide con la disminución del número de sementales nacidos en los últimos años (Figura 2). El decenso de las CF puede ser explicada por la menor cantidad de hijas de sementales jóvenes evaluadas(18,19). Un estudio previo sugiere que la disminución de los promedios de los VG pueden ser debido a que en un inicio todos los sementales son probados a través de la evaluación de algunas crías y una vez que se identifican a los mejores ejemplares, se utilizan de manera frecuente para incrementar el promedio de las tendencias genéticas dentro de la población y el número de hijas por semental(20), efecto que puede ayudar a aumentar las similitudes de los VG calculados con las dos evaluaciones utilizadas. Lo anterior, se corrobora al observar las diferencias entre los grupos creados según el numero de hijas que aportan al estudio (Cuadro 1), en donde, al incrementar esta cantidad, el promedio de VG y CF de EG-MEX y EG-I se aproximan, y como consecuencia, las P entre ambas evaluaciones ascienden de manera gradual. Las β y sus errores estándar calculados a través de los análisis de regresión, muestran un decremento de aproximadamente la mitad para PL y dos terceras partes para PG y PP, de la EG-MEX con la EG-I (de 23 ± 0.6 kg a 42 ± 0.7 kg para PL, de 0.3 ± 0.02 kg a 0.92 ± 0.03 kg para PG y de 0.48 ± 0.02 kg a 1.1 ± 0.02 kg para PP), pero el comportamiento de ambas evaluaciones a través de los años es muy similar, diferencia que puede ser explicada por el ajuste en las bases genéticas. Las conclusiones de otro estudio señalan que la información generada en la evaluación internacional es un indicador más preciso en comparación con los resultados obtenidos en hijas evaluadas en un solo país(21), situación que se comprueba en este estudio al encontrar incrementos en las CF para las EG-I en las tres características.

1050


Rev Mex Cienc Pecu 2020;11(4):1045-1058

VG de PG

VG de PL

Figura 1: Tendencia de los valores genéticos (VG) por año de nacimiento de sementales incluidos en la evaluación mexicana (EG-MEX) e internacional (EG-I) para producción de leche (PL), grasa (PG) y proteína (PP) en kilogramos

25 20 10 5 0 -5 -10

Año de nacimiento MACE

1051

MEX

2012

2011

2010

2009

2008

2007

2006

2005

2004

2003

2002

2001

2000

1999

1998

1997

1996

1995

1994

1993

1992

1991

-15

1990

VG de PP

15


Rev Mex Cienc Pecu 2020;11(4):1045-1058

Figura 2: Tendencias de las confiabilidades (CF) por año de nacimiento de sementales incluidos en la evaluación mexicana (EG-MEX) e internacional (EG-I) para producción de leche (PL), grasa (PG) y proteína (PP) en kilogramos 90 80

CF para PL

70 60 50 40 30 20 10 0

90

80

CF para PG

70 60 50 40 30 20 10 0

90 80 60 50

40 30 20 10

Año de nacimiento Confiabilidad MACE

1052

Confiabilidad MEX

2012

2011

2010

2009

2008

2007

2006

2005

2004

2003

2002

2001

2000

1999

1998

1997

1996

1995

1994

1993

1992

1991

0

1990

CF para PP

70


Rev Mex Cienc Pecu 2020;11(4):1045-1058

Cuadro 1: Valores genĂŠticos (VG), confiabilidades (CF) y correlaciones de Pearson (ď ˛P) para sementales clasificados por el nĂşmero de hijas en MĂŠxico y participantes en las evaluaciones genĂŠticas mexicanas (EG-MEX) e internacionales (EG-I) para producciĂłn de leche (PL), grasa (PG) y proteĂ­na (PP) en kilogramos (P<0.05) VG EGVG CF CF ď ˛P ď ˛P MEX EG-I EG-MEX EG-I VG CF >50 -2Âą325 88Âą333 45Âą18 86Âą11 0.73 0.48 PL >10 y â&#x2030;¤50 -137Âą302 44Âą364 31Âą9 74Âą6 0.52 0.28 â&#x2030;¤10 -261Âą295 -151Âą420 26Âą7 70Âą5 0.61 0.19 >50 0.7Âą11.2 4.7Âą12.5 56Âą18 84Âą9 0.66 0.62 PG >10 y â&#x2030;¤50 -1.1Âą9.4 4.1Âą12.6 35Âą11 76Âą5 0.46 0.24 â&#x2030;¤10 -3.1Âą7.2 1.4Âą12.4 24Âą8 71Âą5 0.45 0.19 >50 1.5Âą9.1 5.9Âą11.2 56Âą18 85Âą8 0.64 0.62 PP >10 y â&#x2030;¤50 -1.3Âą8.2 5.8Âą11.1 35Âą11 77Âą5 0.42 0.22 â&#x2030;¤10 -4.7Âą7.4 0.9Âą12.4 25Âą8 71Âą6 0.53 0.17 Al realizar el primer anĂĄlisis de reordenamiento de sementales de acuerdo a su VG (EG-MEX y EG-I), se observa que existe un reordenamiento en los sementales comprobado por las bajas ď ˛S calculadas (0.63 para PL, 0.48 para PG y 0.55 para PP). Esta correlaciĂłn disminuye su valor al incrementar la đ?&#x2018;&#x2013;đ?&#x2018;?đ?&#x2018; , siendo el grupo de 10 % superior para las tres caracterĂ­sticas el que mayor reordenamiento presenta, resultando con solamente 35 % de sementales en comĂşn. Los resultados de los otros grupos se presentan en el Cuadro 2. Cuadro 2. Valores genĂŠticos (VG), confiabilidades (CF) y correlaciones de Spearman (ď ˛S) para sementales agrupados por diferentes percentiles (đ?&#x2018;&#x2013;đ?&#x2018;?đ?&#x2018;  ) y ordenados de manera descendente por la evaluaciĂłn genĂŠtica de MĂŠxico (EG-MEX) e internacional (EG-I), con el porcentaje de sementales en comĂşn en ambos ordenamientos (%Sc) para producciĂłn de leche (PL), grasa (PG) y proteĂ­na (PP) en kilogramos (P<0.05)

PL

PG

PP

ORDENADOS POR EG-MEX VG CF CF EG-I EG-MEX EG-I

ORDENADOS POR EG-I VG CF CF EG-I EG-MEX EG-I

ď ˛S VG

VG EG-MEX

79Âą11

0.21

149Âą264

654Âą177

28Âą14

73Âą9

*

34Âą15

77Âą10

0.23

96Âą271

504Âą199

29Âą13

73Âą9

0.17

252Âą330

32Âą14

76Âą10

0.33

52Âą276

402Âą218

29Âą13

74Âą9

0.26

114Âą177

194Âą346

32Âą14

75Âą10

0.39

13Âą279

319Âą238

30Âą13

74Âą9

0.33

58Âą195

137Âą359

31Âą13

74Âą9

0.48

-30Âą285

248Âą256

30Âą13

74Âą9

0.43

26

11.4Âą5.2

12.6Âą11.1

35Âą17

75Âą8

0.18

4.1Âą8.4

25.5Âą5.7

25Âą14

73Âą7

0.14

20

42

8.4Âą5

10.9Âą11.5

32Âą16

74Âą8

0.19

3.3Âą8.1

20.4Âą6.6

26Âą14

74Âą7

0.14

30

53

6.8Âą5.1

9.8Âą11.7

31Âą15

73Âą7

0.21

2.3Âą7.9

27.1Âą13.9

17Âą7

74Âą7

0.21

40

58

4.7Âą5.3

7.7Âą11.8

30Âą14

73Âą7

0.32

1.4Âą7.9

27.8Âą14.1

14Âą7

74Âą7

0.26

50

66

3.4Âą5.5

6.7Âą11.8

30Âą14

73Âą7

0.33

0.8Âą7.8

28.4Âą14.1

12Âą8

74Âą7

0.27

10

29

10.1Âą3.5

12.6Âą11.1

34Âą17

76Âą8

*

3.3Âą6.9

24.6Âą5.4

24Âą13

74Âą7

*

đ?&#x2019;&#x160;đ?&#x2019;&#x2018;đ?&#x2019;&#x201D;

% Sc

VG EG-MEX

10

35

356Âą148

364Âą278

37Âą16

20

53

249Âą151

312Âą309

30

64

176Âą162

40

70

50

74

10

1053

ď ˛S VG


Rev Mex Cienc Pecu 2020;11(4):1045-1058

20

47

7.2Âą3.8

10.9Âą11.5

32Âą16

75Âą8

0.16

2.4Âą7.3

19.9Âą6.1

26Âą14

74Âą7

0.13

30

59

5.8Âą4.1

9.8Âą11.7

31Âą16

75Âą8

0.26

1.9Âą7.4

16.8Âą6.7

27Âą14

74Âą7

0.16

40

63

3.7Âą4.7

7.7Âą11.8

31Âą15

74Âą7

0.37

0.8Âą7.6

14.3Âą7.3

28Âą14

74Âą7

0.28

50

68

2.5Âą5.1

6.7Âą11.8

30Âą15

74Âą7 0.44 *=(P>0.05).

0.2Âą7.6

12.1Âą7.9

28Âą14

75Âą7

0.32

En el anĂĄlisis de â&#x2C6;&#x2020;đ??źđ?&#x2018; , al utilizar la đ?&#x2018;&#x2013;đ?&#x2018;?đ?&#x2018;  mayor (que incluye al percentil mĂĄs alto), se observĂł un incremento mĂĄs grande para las tres evaluaciones (EG-MEX, EG-I y EG-MACE) en las tres caracterĂ­sticas, lo que sugiere el uso de estos sementales para las siguientes generaciones (Cuadro 3); pero habrĂ­a que tomar en cuenta diversos factores dentro de la poblaciĂłn (tasas de consanguinidad, trato preferencial, adaptaciĂłn a los sistemas de producciĂłn, etc.), para optimizar el aprovechamiento de dichos ejemplares. AdemĂĄs, se pudo observar un mayor â&#x2C6;&#x2020;đ??źđ?&#x2018;  cuando se usan los resultados de EG-MACE, debido a la mayor disponibilidad de animales, ya que representa una oportunidad para incrementar las â&#x2C6;&#x2020;đ??źđ?&#x2018;  , incrementar la variabilidad genĂŠtica y proporcionar mayor cantidad de material de selecciĂłna los productores; sin embargo, para recomendar su uso, es necesario considerar factores como genotipo ambiente, disponibilidad del germoplasma y la selecciĂłn para otros caracteres de interĂŠs en la poblaciĂłn. Cuadro 3: Superioridad genĂŠtica esperada por aĂąo (â&#x2C6;&#x2020;đ??źđ?&#x2018;  ) de los sementales agrupados por diferentes intensidades de selecciĂłn (đ?&#x2018;&#x2013;đ?&#x2018;?đ?&#x2018;  ) y ordenados de manera descendente para la evaluaciĂłn genĂŠtica en MĂŠxico. Bajo dicho orden, se tomĂł en cuenta el valor genĂŠtico estimado en MĂŠxico (MEX), el internacional con hijas en MĂŠxico (I) y a todos aquellos sementales que participaron en la prueba internacional completa y que pueden o no, tener hijas en MĂŠxico (MACE)

PL

PG

PP

đ?&#x2019;&#x160;đ?&#x2019;&#x2018;đ?&#x2019;&#x201D; 10 20 30 40 50 10 20 30 40 50 10 20 30 40 50

â&#x2C6;&#x2020;đ?&#x2018;°đ?&#x2019;&#x201D; -MEX 18.5 14.7 11.9 10.2 8.4 0.55 0.44 0.36 0.30 0.25 0.54 0.43 0.35 0.30 0.25 1054

â&#x2C6;&#x2020;đ?&#x2018;°đ?&#x2019;&#x201D; -I 24.1 19.2 15.6 13.3 10.9 0.84 0.67 0.55 0.46 0.38 0.83 0.66 0.54 0.46 0.38

â&#x2C6;&#x2020;đ?&#x2018;°đ?&#x2019;&#x201D; - MACE 28.5 22.7 18.5 15.7 12.9 0.90 0.72 0.58 0.50 0.41 1.83 1.46 1.19 1.01 0.83


Rev Mex Cienc Pecu 2020;11(4):1045-1058

Otra manera de evaluar la similitud entre los diferentes sistemas de evaluación, es por medio de las CGI entre las EG-MEX y los países participantes en las EG-I, en donde el promedio entre EG-MEX y los 29 países participantes fue de 0.79  0.04 para PL, de 0.80  0.04 para PG y de 0.81  0.04 para PP. Las CGI con los países con los que México tiene mayor intercambio de germoplasma y que fueron calculadas con base en más de 200 sementales, como lo son Estados Unidos de América, Canadá, Países Bajos, Alemania-Austria, Gran Bretaña, Italia y Francia, alcanzaron niveles medios (0.80 aproximadamente), mientras que, las correlaciones más altas se observaron con con Israel, Eslovenia, Estonia, Letonia y Lituania (alcanzando CGI de 0.85, 0.86 y 0.87, para PL, PG y PP respectivamente), lo que pudiera estar explicado por el bajo número de sementales en común (<50 sementales) y su la alta preferencia que se encuentra corroborado por el alto número de hijas (>20 hijas) . Las CGI más bajas resultaron de países en los que predominan sistemas de producción diferentes a los encontrados en México, como son: Nueva Zelanda, Australia e Irlanda con valores de 0.69 para PL y de 0.7 para PG y PP). Las diferencias observadas entre las CGI en los diferentes países, podría estar explicada por la adaptación del semental a un país en específico y no a las diferencias en los modelos o trato preferencial de los sementales(21), por lo que, si esta aseveración es correcta, las estimaciones de los VG de los sementales utilizados a nivel nacional, serán más aproximadas a las obtenidas en países con las condiciones de producción similares a las de México. Lo anterior podría explicar los resultados obtenidos con países que contribuyen en gran proporción al número de hijas en México, como Estados Unidos de América, Canadá y los Países Bajos, pero que no tienen las CGI más altas con México. Estos países presentan diferencias con México en las condiciones de producción, la definición de las bases genéticas, los diferentes índices de heredabilidad (h2) estimados por cada país, y en la complejidad de los modelos utilizados para las estimaciones de los VG, así como los efectos aplicados en cada uno de ellos. Por lo anterior, es recomendable analizar a los grupos integrados por países con condiciones de evaluación semejantes; y así ampliar las expectativas de mercado internacional e intercambio de información de manera eficiente. Una área de oportunidad para los países que son miembros de Interbull, es el uso e intercambio de información genómica, que puede traer importantes beneficios a los sistemas de evaluaciones genéticas, como por ejemplo, realizar una predicción más efectiva y rápida de las interacciones genéticas(22), la disminución en el tiempo de comercialización del material genético, refiriéndose a características de importancia reproductiva y de consanguinidad(23) y que en conjunto, se ve reflejado en el aumento de la precisión de los VG y de sus CF(24).

1055


Rev Mex Cienc Pecu 2020;11(4):1045-1058

Conclusiones e implicaciones El impacto de la información extranjera en la EG-MEX es positivo, debido a que mejora la CF de los VG de los sementales usados en México, sobre todo de aquellos que tienen una cantidad limitada de hijas en nuestro país, por lo que se recomienda continuar con la participación en el programa de Interbull. En este estudio, al realizar el ordenamiento de los sementales y al verificar la superiordidad genética por año, se pudieron observar diferencias importantes de los valores genéticos entre las evaluaciones, generando una oportunidad de mejoramiento en la población Holstein mexicana. Los sementales no usados en México y que tienen un alto potencial genético para las características evaluadas, representan una oportunidad de mejoramiento en la población; por lo que, es importante realizar su identificación, valoración y posible incorporación en la población Holstein de nuestro país. Los resultados obtenidos al incorporar la EG-MEX a la EG-I, muestran las diferencias entre diversos países participantes (explicadas por los diversos sistemas de producción, factores ambientales, etc.), por lo que es primordial considerar el uso de la información validada de manera internacional en los procesos de selección de animales productores de leche y sus componentes de la raza Holstein en México, ya que contribuirá de manera importante al incremento del progreso genético, productivo y reproductivo de la población.

Agradecimientos Al INIFAP-CENIDFyMA por su apoyo y financiamiento para la realización de este trabajo, a través del proyecto “Estudio de la consanguinidad y su efecto sobre características productivas y reproductivas en ganado Holstein” SIGI : 11513634465 y a la Facultad de Ciencias Naturales de la Universidad Autónoma de Querétaro por el apoyo y financiamiento parcial del trabajo a través del proyecto “Desarrollo de evaluaciones genéticas internacionales de ganado Holstein en México”.

Conflicto de intereses Los autores declaran que no existen conflictos de interés.

Literatura citada: 1. Ruiz-López FJ, García-Ruiz A, Martínez-Marín GJ. ¿Qué Toro? Evaluación genética de toros y vacas Holstein para producción de leche, conformación y longevidad. Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal, INIFAPSAGARPA y Asociación Holstein de México. Libro Técnico No. 58, Colón, Querétaro. 2018.

1056


Rev Mex Cienc Pecu 2020;11(4):1045-1058

2. Moro-Méndez J, Ruiz-López FJ. Mejoramiento genético de características de conformación en ganado Holstein. Vet Méx 1998;9(4):385-398. 3. REDGATRO. Red de Investigación e Innovación Tecnológica para la Ganadería Bovina Tropical. Estado del arte sobre investigación e innovación tecnológica en ganadería bovina tropical. Consejo Nacional de Ciencia y Tecnología. Libro Técnico No. 4, Ciudad de México. 2015. 4. VanRaden PM, Wiggans GR. Derivation, calculation, and use of national animal model information. J Dairy Sci 1991;74(8):2737-2746. 5. Schaeffer LR, Zhang W, Robinson A, Chesnais J, Wilmink H, Wiggans G, et al. Multiple trait across country evaluation of dairy sires. Interbull Bulletin 1993:1-21. 6. Mäntysaari EA, Liu Z, VanRaden PM. Interbull validation test for genomic evaluations. Interbull Bulletin 2010; 41:17-21. 7. INTERBULL. International Bull Evaluation Service. Code of practice for the international genetic/genomic evaluation of dairy bulls at the Interbull Centre. DABG-ICAR. 2017. 8. Cameron ND. Selection indices and prediction of genetic merit in animal breeding. 1st ed. UK: CAB International; 1997. 9. Misztal I, Tsuruta S, Strabel T, Auvray B, Druet T, Lee DH. BLUPF90 and related programs (BGF90). In: CD-ROM communication, Proceedings of the 7th World congress on genetics applied to livestock production. Montpellier, France. 2002:7-28. 10. Misztal I. Computational techniques in animal breeding. 1st ed. USA: University of Georgia; 2000. 11. Lynch M, Walsh B. Genetics and analysis of quantitative traits. 1st ed. USA: Sinauer Associates; 1998. 12. Gilmour AR, Gogel BJ, Cullis BR, Thompson R. ASReml User Guide. Relase 3.0. UK: VSN International Ltd; 2009. 13. Fikse WF, Banos G. Weighting factors in international genetic evaluations: effects on international breeding values and reliability estimates. Interbull Bulletin 1999;(22):1-6. 14. Schaeffer LR. Multiple-country comparison of dairy sires. J Dairy Sci 1994;77(9):26712678. 15. Schaeffer LR. Multiple trait animal models. Technical notes, Univ. Guelph 1999; (15) 113. http://www.aps.ouguelph.ca/~1rs/Animalz/lesson15. Accessed 6 Apr, 2019. 16. Bourdon RM. Understanding animal breeding. 2nd ed. USA: Prentice Hall; 2000. 1057


Rev Mex Cienc Pecu 2020;11(4):1045-1058

17. Schaeffer LR. Strategy for applying genome-wide selection in dairy cattle. J Anim Breed Genet 2006;123(4):218-223. 18. Powell RL, Wiggans GR, VanRaden PM. Factors affecting calculation and use of conversion equations for genetic merit of dairy bulls. J Dairy Sci 1994;77(9):2679-2686. 19. Miglior F, Muir BL, Van Doormaal BJ. Selection indices in Holstein cattle of various countries. J Dairy Sci 2005;88(3):1255-1263. 20. Benhajali H, Jakobsen J, Mattalia S, Ducrocq V. Illustration of an international genetic evaluation robust to inconsistencies of genetic trends in national evaluation. Interbull Bulletin 2013;(47):82-89. 21. Jones LP. A simple approximation to the reliability of Interbull proofs for foreign bulls. Interbull Bulletin 1997;(16):13-15. 22. VanRaden PM, Sullivan PG. International genomic evaluation methods for dairy cattle. Genetics Selection Evolution 2010;42(1):7-15. 23. Hayes BJ, Daetwler HD, Bowman P, Moser G, Tier B, Crump R, et al. Accuracy of genomic selection: Comparing theory and results. Association for the Advancement of Animal Breeding and 30th Anniversary Conference. Proc Assoc Advmt Animal Breed 2009;(17):352-355. 24. Lund MS, de Roos AP, de Vries AG, Druet T, Ducrocq V, Fritz S, et al. A common reference population from four European Holstein populations increases reliability of genomic predictions. Genet Sel Evol 2011;43(1):43-50.

1058


https://doi.org/10.22319/rmcp.v11i4.5302 Artículo

Análisis genómico de diversidad y estructura genómica de las poblaciones bovinas de la raza mexicana de Lidia

Paulina G. Eusebi a* Oscar Cortés a Susana Dunner a Javier Cañón a

a

Universidad Complutense de Madrid. Facultad de Veterinaria, Departamento de Producción Animal. Avenida Puerta de Hierro, s/n, 28040, Madrid, España.

* Autor de correspondencia: paulig01@ucm.es

Resumen: La raza bovina de Lidia ha sido seleccionada desde el siglo XIII para participar en festejos sociales reconocidos bajo el término de “Tauromaquia”. En la actualidad forman parte de la identidad de las culturas regionales de varios países. En México, la raza se especializó a finales del siglo XIX cuando cuatro familias mexicanas importaron un número reducido de bovinos de España. De estas importaciones actualmente solo permanecen las líneas derivadas de las familias Llaguno y González. En la familia Llaguno se llevaron diferentes estrategias de reproducción. Antonio Llaguno cruzó los recién importados bovinos españoles entre sí; de dichas cruzas derivó la línea que actualmente es reconocida como “Pura”. Por otro lado, Julián Llaguno realizó cruzas entre hembras criollas con machos españoles, línea conocida como “Impura”. Por último, entre1996 y 1997, un grupo de ganaderos importó bovinos pertenecientes a ciertos encastes españoles como Domecq, Murube, Santa Coloma, entre otros. El objetivo del presente estudio fue investigar la diversidad genómica, estructura poblacional, niveles de endogamia y relaciones genéticas entre las poblaciones de Lidia mexicana, utilizando marcadores moleculares de tipo SNP. La población fue dividida en cinco grupos: Antonio Llaguno, Julián Llaguno, González, y dos grupos que incluían bien importaciones recientes de origen Domecq, o bien importaciones recientes de origen Santa Coloma. Los resultados permiten apreciar diferentes orígenes genéticos dentro de la familia Llaguno en función de su origen histórico: Antonio y Julián. En el resto de grupos también se observa una 1059


Rev Mex Cienc Pecu 2020;11(4):1059-1070

clara diferenciación genética. Este aislamiento genético entre poblaciones de Lidia mexicana es una característica de su singularidad. Palabras clave: Raza de Lidia, Genética de poblaciones, Diversidad genética, Estructura genética.

Recibido: 23/02/2019 Aceptado: 07/10/2019

Introducción La raza bovina de Lidia, seleccionada por caracteres de comportamiento que potencian la agresividad, ha sido utilizada desde el siglo XIII en la Península Ibérica para participar en festejos de índole civil y religioso(1). En la actualidad dichas prácticas forman parte de un fenómeno social reconocido como “Tauromaquia”, el cual hace referencia a todas aquellas representaciones culturales y subjetivas que involucran ganado bovino(2,3). Hoy en día varios países consideran a las diferentes tauromaquias como prácticas que refuerzan la identidad de las culturas regionales(2,3); inclusive, en países como España y Perú se le ha nombrado patrimonio cultural inmaterial(4). Además, esta raza se caracteriza por una baja intercambiabilidad genética y ecológica(5,6). En México el primer festejo taurino documentado ocurrió en 1523, utilizando bovinos de comportamiento agresivo que provenían principalmente de la región de Navarra, donde procede el ganado bovino de Casta Navarra(7), pero no fue, sin embargo, hasta finales del siglo XIX cuando comenzó la cría especializada de la raza en México, al importar un número reducido de animales de la raza de Lidia de España por cuatro familias de criadores: Llaguno, González, Barbabosa y Madrazo(8,9). Actualmente sólo se tiene evidencia de la permanencia de las líneas derivadas de dos de estas familias: Llaguno y González(8,10). Dentro de la familia Llaguno, localizada en la región centro-norte de la República Mexicana, Antonio Llaguno, mantuvo un sistema cerrado de reproducción cruzando solamente los animales de la raza de Lidia importados entre sí; a los animales derivados de esta línea se les denomina actualmente en el medio ganadero mexicano como “Puros”. Por otro lado su hermano Julián Llaguno llevó a cabo otra estrategia de reproducción cruzando vacas criollas con toros de Lidia de origen español; a los animales derivados de ésta línea hoy se les denomina como “Impuros”(8,9). Por otro lado, la familia González, ubicada en la región centro-sur de la República Mexicana, cruzó los animales de la raza de Lidia importados con bovinos locales seleccionados por su agresividad(8); por último, entre 1996 y 1997, un grupo de ganaderos 1060


Rev Mex Cienc Pecu 2020;11(4):1059-1070

mexicanos importó animales pertenecientes a ciertos encastes españoles, entre los que se encuentran Domecq, Murube, Santa Coloma y Saltillo, entre otros(10), posteriormente se cerraron las fronteras a importaciones por cuestiones sanitarias(10). Actualmente el censo de la población bovina de Lidia mexicana asciende aproximadamente a 110,000 animales distribuidos en un área de alrededor de 135,000 ha(10). Este tipo de ganado es criado en condiciones de producción extensivo, lo cual favorece la conservación de especies endémicas tanto de flora como de fauna. Los festejos en los que se utiliza la raza Lidia en México tienen un papel clave en la economía pecuaria mexicana, formando parte de las tradiciones sociales que refuerzan la identidad de las comunidades locales(7,10,11). En estudios anteriores se analizó la variabilidad genética de la población Lidia mexicana con respecto a la población original Española por medio de marcadores autosómicos de tipo microsatélite, encontrando una diferenciación entre encastes españoles y las familias mexicanas Llaguno y González(12). Resultados que fueron confirmados cuando la información molecular que se utilizó fue la obtenida mediante chips de ADN para marcadores bi-alélicos tipo SNP. En este caso, además, se observó una clara diferenciación genética entre familias Mexicanas(13,14). Sin embargo, dichos análisis no incluían animales de procedencia Julián Llaguno o denominados “Impuros”, así como tampoco bovinos procedentes de las importaciones recientes de encastes mayoritarios españoles como Domecq y Santa Coloma. El objetivo del presente estudio fue investigar la diversidad genómica, estructura poblacional, niveles de endogamia y relaciones genéticas entre las poblaciones representativas de la raza de Lidia mexicana, utilizando marcadores moleculares de tipo SNP. La población fue dividida en función a su origen histórico dentro de cinco grupos: Antonio Llaguno, Julián Llaguno, González, y dos grupos que incluían bien importaciones recientes de origen Domecq e importaciones recientes de origen Santa Coloma.

Material y métodos Un total de 306 muestras de sangre fueron recolectadas aleatoriamente de bovinos pertenecientes a 32 ganaderías mexicanas afiliadas a la Unión de Criadores de Toros de Lidia, agrupadas históricamente en cinco grupos (Cuadro 1). Las muestras se recolectaron en tubos con conservante Magic Buffer® (Biogen Diagnostica, España) y se mantuvieron a 15° C hasta su uso para la extracción del ADN. El ADN genómico se extrajo mediante un protocolo estándar de fenol/cloroformo(15), posteriormente las muestras se genotiparon con el Chip bovino de SNPs de mediana densidad 50K (http://www.illumina.com).

1061


Rev Mex Cienc Pecu 2020;11(4):1059-1070

Cuadro 1: Número de animales analizados (N), diversidad génica (He), heterocigosis observada (Ho), nivel de consanguinidad (FIS) y distancia genética promedio FST de cada ganadería con respecto al resto de ganaderías dentro de grupo, así como de cada ganadería Origen Ganadería N FST FIS HO HE Julian llaguno

Antonio Llaguno

González

Importaciones recientes Domecq

Pozo Hondo 21

0.05

0.13

0.27

0.73

Valparaiso El Sauz Caparica Total San Mateo Reyes Huerta Fernando de la Mora Los Cues Garfias Antigua Xajay Teófilo Gómez Celia Barbabosa Boquilla del Cármen Fermín Rivera Corlomé Arroyo Zarco Marrón La Punta Total Tenexac Yturbe De Haro Castañeda Zacatepec Rancho Seco Total La Joya

15 8 11 55 6 39

0.06 0.07 0.05 promedio 0.06 0.09 0.06

0.19 0.21 0.17

0.25 0.24 0.26

0.75 0.76 0.74

0.21 0.21

0.24 0.24

0.76 0.76

6

0.10

0.04

0.30

0.70

7 6 6 6 6

0.07 0.08 0.09 0.05 0.07

0.29 0.26 0.27 0.15 0.19

0.22 0.23 0.23 0.26 0.25

0.78 0.77 0.77 0.74 0.75

6

0.06

0.15

0.26

0.74

6

0.06

0.29

0.22

0.78

6

0.07

0.18

0.25

0.75

6 6

0.13 0.05

0.00 0.18

0.31 0.26

0.69 0.74

6 19 137 8 5 6 6 12 6

0.05 0.10 promedio 0.07 0.13 0.11 0.08 0.11 0.12 0.14

0.11 0.11

0.28 0.27

0.72 0.73

0.29 0.14 0.12 0.25 0.03 0.05

0.22 0.27 0.27 0.23 0.30 0.29

0.78 0.73 0.73 0.77 0.70 0.71

43 17

promedio 0.11 0.10 0.15

0.26

0.74

1062


Rev Mex Cienc Pecu 2020;11(4):1059-1070

Importaciones recientes Santa Coloma

Santa Ma. De Xalpa Jaral de Peñas Torreon de Cañas Jose Julian Llaguno Total Los Encinos

17

0.08

0.06

0.29

0.71

17

0.06

-0.03

0.32

0.68

6

0.09

-0.02

0.32

0.68

10

0.07

0.00

0.31

0.69

106 5

promedio 0.08 0.02 0.17

0.26

0.74

San José Total

6 11

0.02 0.10 promedio 0.02

0.28

0.72

Por medio del Software PLINK V 1.07(16) se depuró la información, excluyendo a los SNP localizados en cromosomas sexuales, aquellos que presentaron una frecuencia del alelo menos común (MAF), inferior a 0.01, con menos del 20 % de genotipos faltantes y aquellos marcadores que se separaban del equilibrio de Hardy-Weinberg (P<0.001). Finalmente se obtuvieron 41.455 SNP para su análisis. Se analizaron parámetros de diversidad genética tales como heterocigosis observada (Ho), heterocigosis esperada (He) y coeficiente de endogamia (FIS) estimado como1Ho/He mediante el software PLINK V 1.07(16). Los coeficientes de FST se calcularon por medio del software ARLEQUIN v3.0(17). Para cada individuo se obtuvo la proporción de orígenes genéticos que se podían identificar utilizando el algoritmo de agrupamiento bayesiano implementado en el software ADMIXTURE(18,19). Las gráficas se realizaron con el Software POPHELPER v1.0.10(20). Se llevó a acabo también un Análisis Molecular de Varianza (AMOVA) mediante un modelo lineal(17) para evaluar la variación genética entre y dentro de grupos. Se realizó el análisis en un modo jerárquico con tres niveles (entre grupos, entre ganaderías dentro de grupos y dentro de ganaderías). También se calculó la distancia promedio de los grupos en términos de FST utilizando el mismo software. Finalmente, se identificaron los ROHs (Runs of Homozygosity) individuales por individuo(21), utilizando Plink v.1.07 con ventanas de 30 SNP, permitiendo <100 kb entre dos SNP homocigotos consecutivos, menos de dos genotipos faltantes, un heterocigoto, y con una longitud mínima de 500 kbp. Posteriormente se obtuvo el valor promedio por ganadería y por grupo.

1063


Rev Mex Cienc Pecu 2020;11(4):1059-1070

Resultados y discusión Diversidad genética En el Cuadro 1 se presentan los resultados de diversidad génica (He), heterocigosis observada (Ho) así como valores de consanguinidad (FIS) y la distancia genética FST de cada ganadería con respecto al resto de ganaderías dentro de cada grupo. Se puede observar que los valores promedio de FIS por ganadería oscilaron entre -0,03 (Jaral de Peñas) y 0.29 (Los Cues, Boquilla del Cármen y Tenexac). El exceso de heterocigotos de las ganaderías de Jaral de Peñas y Torreón de C., pertenecientes al grupo de “Importaciones recientes origen Domecq”, explica los valores negativos de FIS como consecuencia del efecto Wallhund(22). Las distancias promedio FST estimadas por grupo fueron similares entre ellos, con valores de entre 0.06 y 0.11, mientras que los valores de las distancias FST promedio estimadas por ganadería oscilaron entre 0.02 (Los Encinos y San José) y 0.14 (Rancho Seco). En la población mexicana existe la práctica entre ganaderos de intercambiar hembras y sementales, siendo una práctica más común entre ganaderos pertenecientes a los mismos grupos u orígenes. Si bien, la frecuencia y cantidad de animales en dichos intercambios depende del criterio del ganadero, esto va a explicar que las distancias genéticas no difieran mucho entre ganaderías dentro del mismo grupo. El AMOVA evidenció que el 10.8 % de la variabilidad genética total se debe a las diferencias entre grupos, que las diferencias entre las ganaderías dentro de los grupos explican un 6,9% (Cuadro 2). Es de esperar que al no intercambiar individuos entre grupos la diferencia entre estos sea mayor que dentro de grupos, donde se dan intercambios de forma más regular. El valor FST promedio entre grupos (0.18) es similar al valor FST promedio obtenido en la población española de Lidia (0.15) y mayor al observado en otras razas bovinas con valores alrededor de 0.07(6). Los valores elevados de FST son consecuencia de la estructura que caracteriza a la raza de Lidia, en la que la subdivisión en subpoblaciones o grupos resulta en tamaños efectivos pequeños por grupo.

Nivel

Cuadro 2: Resultados del análisis molecular de varianza ANOVA Componente de varianza % de variación

Entre grupos

686.54

10.76

Entre ganaderías dentro de grupos

437.74

6.86

Dentro de ganaderías Residual

5259.13 6383.41

82.39

1064


Rev Mex Cienc Pecu 2020;11(4):1059-1070

Estructura genética y diferenciación de la población

El error de validación cruzada (CV) utilizado en el Software ADMIXTURE determina valores que disminuyen al aumentar el número de poblaciones ancestrales hipotéticas (K). En el momento en que dicho valor de CV comienza a aumentar es indicativo de la predicción de poblaciones hipotéticas más probable. En este caso la predicción más acertada se identificó en k=5(18,19). Las proporciones promedio de los individuos de cada ganadería asignada a cada una de las 5 poblaciones ancestrales se presentan en la Figura 1 en donde se agruparon de acuerdo al origen las ganaderías. Cada uno de los cinco grupos se asocia mayoritariamente a cada una de las cinco poblaciones ancestrales definidas. No obstante, entre el grupo “Julián Llaguno” y “Antonio Llaguno” la discriminación es menos evidente entre algunas ganaderías de ambos grupos, mientras que, en otras, como El Sauz y Valparaíso (Julián Llaguno) o Garfias, Los Cués y La Antigua (Antonio Llaguno) la diferenciación es mayor. Aunque el análisis realizado no permite conocer con precisión las causas de la ligera diferenciación entre algunas ganaderías en el caso de la Familia Llaguno (Antonio y Julián) podría ocurrir que diferencia entre ambos grupos se deban al diferente material genético en origen, siendo Julián quien cruzó hembras criollas con machos de Lidia españoles. En todo caso, se puede observar que ambos grupos (Antonio y Julián Llaguno) comparten mayoritariamente orígenes genéticos comunes. Por otro lado, en los grupos de Gonzáles y las importaciones recientes origen Domecq y Santa Coloma sí que se puede observar una clara diferenciación genética entre grupos. Figure 1: Análisis de errores de validación cruzada de poblaciones ancestrales hipotéticas (K) utilizando ADMIXTURE

Cada línea vertical representa el genoma total por individuo, y la proporción que de cada color (grupo genético, K) hay en dicha línea vertical, es la proporción del genoma de ese individuo representado de acuerdo a los cinco orígenes ancestrales (K). 1065


Rev Mex Cienc Pecu 2020;11(4):1059-1070

Finalmente se procedió a identificar las regiones de homocigosis o ROHs por grupo. En la Figura 2 se muestra la estadística sobre el número promedio de regiones o segmentos y la longitud promedio de los ROH en cada uno de los cinco grupos. En general se observan patrones similares en cuánto a número y longitud de los ROH entre los diferentes grupos. Se sabe que un mayor número de segmentos y longitud de los ROH están correlacionados con eventos de consanguinidad reciente(23). Figura 2: Número promedio de regiones de homocigosis (ROH) y tamaño promedio en Mb de los cinco grupos de la población mexicana de Lidia

En el Cuadro 3 figura el número y tamaño de ROHs promedio por ganadería, observando que la diferencia entre la longitud promedio de ROHs oscila entre 5 (Jaral de Peñas) y 7.7 Mb (Boquilla del Carmen y el Sauz), lo cual es coherente con los valores promedios de FIS obtenidos (Cuadro 1) dónde los valores más altos (>0.20) corresponden a las ganaderías de Boquilla del Carmen y el Sauz y los más bajos a la ganadería de Jaral de Peñas.

1066


Rev Mex Cienc Pecu 2020;11(4):1059-1070

Cuadro 3: Regiones de homocigosis (ROH) promedio por ganadería; número de segmentos (NSEG) y longitud promedio en Mb Origen Julián Llaguno

Antonio Llaguno

González

Importaciones recientes Domecq

Importaciones recientes Santa Coloma

Ganadería Pozo Hondo Valparaiso El Sauz Caparica Pomedio San Mateo Reyes Huerta Fernando de la Mora Garfias Los Cués La Antigua Xajay Teófilo Gómez Celia Barbabosa Boquilla del Cármen Fermín Rivera Corlomé Arroyo Zarco Marrón La Punta Pomedio Tenexac Gonzalo Yturbe De Haro C.Castañeda Zacatepec Rancho Seco Pomedio La Joya Sta. Maria de Xalpa Jaral de Peñas José Julián Llaguno Torréon de Cañas Pomedio Los Encinos San José Pomedio

1067

NSEG 108 134 111 114 117 141 124 87 139 131 144 115 135 126 132 131 79 124 105 104 121 135 110 113 134 83 95 109 113 92 64 72 73 85 120 105 112

Mb. promedio 5.3 6.2 7.7 6.5 6.1 6.5 5.9 5.8 7.1 7.3 6.9 6.6 6.0 5.8 7.7 6.1 5.3 6.3 6.2 6.1 6.2 7.4 6.3 5.6 6.9 5.7 5.2 6.2 6.3 5.7 5.0 5.1 5.2 5.5 6.4 5.8 6.1


Rev Mex Cienc Pecu 2020;11(4):1059-1070

En situaciones de aislamiento, en poblaciones con tamaño relativamente pequeño, se incrementa la probabilidad de que los animales hereden segmentos idénticos de ADN que justifican la presencia de ROH(23). En estudios previos se han asociado el elevado número y longitud de los ROH a prácticas endogámicas(23), lo cual concuerda con los resultados obtenidos para los cinco grupos mexicanos de Lidia, en los que se observan valores mayores a los observados en análisis previos en los que se analizan regiones de homocigosis en razas autóctonas españolas y criollas americanas(13).Tanto los valores de los ROHs como de FIS en la población de Lidia mexicana son reflejo de la subdivisión en grupos, y sus consecuencias: reducción de tamaños efectivos e incremento en los valores de consanguinidad(24). Aunque esta subdivisión es una alternativa en la preservación de la variabilidad genética de una población(25), en cada subpoblación, como consecuencia de la deriva genética se produce un aumento de la consanguinidad y pérdida de la variabilidad genética, lo que aconseja monitorizar la evolución de la endogamia.

Conclusiones e implicaciones La diferenciación genética de la población mexicana entre grupos e inclusive entre ganaderías se debe o bien a los diferentes orígenes genéticos de algunos grupos (importaciones recientes Domecq y Santa Coloma), o debido al aislamiento genético que se ha mantenido en los grupos restantes (Antonio y Julián Llalguno y el grupo González). Tanto los análisis de estructura genética como el comportamiento de los ROH revelan que el aislamiento genético de los grupos que componen a la población mexicana de Lidia ha contribuido a las variaciones genómicas con respecto a poblaciones de ganado de Lidia europeo; reflejando su grado de singularidad.

Agradecimientos La financiación de este trabajo proviene del “Macro-proyecto de Caracterización genética de la Raza de Lidia Mexicana”, realizado con apoyo del Consejo Nacional de los Recursos Genéticos Pecuarios (CONARGEN) y la Asociación de Criadores de Toros de Lidia. También se agradece al Laoboratorio de Genética del Departamento de Producción Animal de la Facultad de Veterinaria en la Universidad Complutense de Madrid, y a los ganaderos mexicanos de Lidia.

Literatura citada: 1. Domecq JP. Del toreo a la bravura. España, Alianza Editorial, 2009. 2. Maudet JB. Terres de taureaux: les jeux taurins de L´Europe à L´Amerique. 1ra ed. España, Casa de Velzaquez, 2010. 3. Prieto-Garrido JL. El toro bravo, ganaderías míticas. España Editorial Almuzara, 2012.

1068


Rev Mex Cienc Pecu 2020;11(4):1059-1070

4. Cárdenas RVC. Situación del todo de Lidia y de la fiesta en los países de HispanoAmérica. Editado por García AL. Congreso Mundial Taurino de Veterinaria, Consejo General de Colegios Veterinarios de España, 2017. 5. Crandall KA, Bininda-Emonds OR, Mace GM, Wayne RK. Considering evolutionary processes in conservation biology. Trends Ecol Evol 2000;15:290-295. 6. Cañón J, Tupac-Yupanqui I, Garcia-Atance MA, Cortés O, Garcia D, Fernandez J, Dunner S. Genetic variation within the Lidia bovine breed. Anim Genet 2008;39:439-445. 7. Scherrer HL. Historia del toro bravo mexicano. México, Asociación Nacional de Criadores de Toros de Lidia (ANCTL), 1983. 8. Niño de Rivera L. Sangre de Llaguno, la razón de ser del toro bravo mexicano.1ra ed. México: Punto de Lectura; 2004. 9. Villanueva Lagar JA. San Mateo, encaste con historia. México: Aldus; 2005. 10. ANCTL. Asociación Nacional de Criadores de Toros de Lidia. México. 2019. 11. Censo Agrícola, Ganadero y Forestal 2007. INEGI. http://www.inegi.org.mx 12. Eusebi PG, Cortés O, Dunner S, Cañón J. Genetic diversity of the Mexican Lidia bovine breed and its divergence from the Spanish population. J Anim Breed Genet 2017;134(4):332-339. 13. Eusebi PG, Cortés O, Dunner S, Cañón J. Genomic diversity and population structure of Mexican and Spanish bovine Lidia breed. Anim Genet 2017;8(6):682-685. 14. Eusebi PG, Gardyn OC, Boxberger SD, Ferreras JC. Genetic diversity analysis of the Mexican Lidia bovine breed population and its relation with the Spanish population by using a subset of SNPs under low gametic disequilibrium. Rev Mex Cienc Pecu 2018;9(1):121-134. 15. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual, 2nd ed. NY, USA: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989. 16. Purcell SM, Neale B, Todd-Brown K, Thomas L, Ferreira MAR. et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 2007;81:559-575. 17. Excoffier L, Laval G, Schneider S. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evol Bioinform Online 2005:1, 47. 18. Alexander DH, Novembre J, Lange K. Fast model-based estimation of ancestry in unrelated individuals. Genome Res 2009;19:55–64.

1069


Rev Mex Cienc Pecu 2020;11(4):1059-1070

19. Alexander DH, Lange K. Enhancements to the ADMIXTURE algorithm for individual ancestry estimation. BMC bioinformatics 2011;12:246. 20. Francis RM. Pophelper: an R package and web app to analyze and visualize population structure. Mol Ecol Resour 2016. 21. Purfield DC, Berry DP, McParland S, Bradley DG. Runs of homozygosity and population history in cattle. BMC Genetics 2012;13:70. 22. Crow JF, Kimura M. An Introduction to Population Genetics Theory. New York. USA: Harper & Row, Publ; 1970. 23. Upadhyay MR, Chen W, Lenstra JA. et al. Genetic origin, admixture and population history of aurochs (Bos primigenius) and primitive European cattle. Heredity 2016;118:169–76. 24. Cortés O, Tupac-Yupanqui I, Dunner S, Fernández J, Cañón J. Y chromosome genetic diversity in the Lidia bovine breed: a highly fragmented population. J Anim Breed Genet 2011:491-498. 25. Wright S. The genetical structure of populations. Ann Eugenics 1951;15:323-354.

1070


https://doi.org/10.22319/rmcp.v11i4.5457 Artículo

Análisis del pedigrí en diez poblaciones mexicanas de ovinos

Joel Domínguez-Viveros a* Felipe Alonso Rodríguez-Almeida a Adán Medellín-Cázares a Juan Pablo Gutiérrez-García b

a

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología. Periférico Francisco R. Almada km 1. 31453, Chihuahua, Chih. México. b

Universidad Complutense de Madrid. Facultad de Veterinaria. Madrid. España.

*

Autor de correspondencia: joeldguezviveros@yahoo.com.mx; jodominguez@uach.mx

Resumen: Se analizó el pedigrí en diez razas de ovinos mediante parámetros genéticos poblacionales. Las poblaciones fueron Blackbelly (BBL; 19,695), Charollais (CHA; 5,033), Dorper (DOR; 42,171), Dorper Blanco (DOB; 4,213), Dorset (DOS; 5,557), Hampshire (HAM; 12,210), Katahdin (KAT; 77,955), Pelibuey (PEL; 42,256), Rambouillet (RAM; 11,951) y Suffolk (SUF; 14,099); nacidos de 1992 a 2018. Los análisis se realizaron con el software Endog. En padres conocidos, los valores oscilaron de 76.4 % (SUF) a 95.3 % (KAT), con promedio general de 86.0%, los animales con padres desconocidos correspondieron a los fundadores. La población consanguínea (como porcentaje de la población total) fluctuó del 12.3 % en DOS al 48.7 % en DOB, con promedio general de 29.7 %; la consanguinidad (F) promedio osciló de 3.9 (KAT) a 14.6 (DOB), con promedio general de 8.0. La evolución de F y sus componentes fue: en todas las poblaciones, la proporción de consanguíneos se incrementó (P<0.05); los niveles de relación genética (RG) son estables; y, la F presentó tendencias negativas (P<0.05). KAT, DOB y BBL con altas tasas de crecimiento en población consanguínea; DOB y DOS, DOB y CHA con los niveles más altos de F y RG, respectivamente. Seis poblaciones presentaron tamaño efectivo (Ne) mayor a 50; el resto 1071


Rev Mex Cienc Pecu 2020;11(4):1071-1086

presentaron Ne menor a 37, lo cual señala el estatus de cuidado para monitorear la evolución de F y sus posibles implicaciones. El intervalo generacional (IG) osciló de 3.0 a 4.15, con promedio general de 3.45 años, los mayores IG fueron para RAM y SUF, BBL y DOR con IG menores. Palabras clave: Consanguinidad, Tamaño efectivo, Parámetros poblaciones, Intervalo generacional, Tamaño efectivo, Ancestros fundadores.

Recibido: 17/07/2019 Aceptado: 31/03/2020

Introducción En México, la ovinocultura se distribuye en todo el territorio nacional bajo un esquema de tipo regional, condicionada por la disponibilidad de recursos naturales y el mercado(1). El Organismo de la Unidad Nacional de Ovinocultores agrupa a los criadores de ovinos especializados y de registro; coordina el registro genealógico de pureza de raza, así como los programas de mejoramiento genético con base en las evaluaciones genéticas(2). Sin embargo, la selección con base en el mejor predictor lineal insesgado (BLUP), producto de las evaluaciones genéticas, favorece la selección de animales emparentados y por consiguiente incrementos en la consanguinidad(3); además, los niveles de consanguinidad y parentesco están implicados en el proceso de evaluaciones genéticas y las predicciones BLUP(4,5). Los esquemas de selección conllevan al impacto de un reducido número de reproductores o familias selectas, generan cambios en la estructura de las poblaciones, así como incrementos en los niveles de consanguinidad, reducción de la variabilidad genética y posibles efectos de deriva genética(6,7). La variabilidad genética determina la capacidad de respuesta a la selección y el progreso genético; identificar los factores que la afectan permite evaluar las acciones realizadas, continuar con el esquema de selección o tomar acciones de corrección(8). El análisis del pedigrí, con base en parámetros genéticos poblacionales, describe la dinámica y variabilidad genética de las poblaciones; la estructura genética de una población permite conocer como se ha realizado el flujo de genes, proporciona información de los ancestros fundadores y sus aportaciones a la variabilidad de la población actual(9,10). Con base en lo anterior, el objetivo del presente estudio fue analizar el pedigrí y la estructura de la población en diez razas de ovinos mediante parámetros genéticos poblacionales, tales como: integridad del pedigrí, número de generaciones, parentesco y consanguinidad, ancestros y fundadores, número efectivo, intervalo generacional, entre otros. Los resultados 1072


Rev Mex Cienc Pecu 2020;11(4):1071-1086

serán de utilidad para desarrollar esquemas de selección, con el objetivo de optimizar la respuesta a la selección limitando la tasa de perdida de variabilidad genética.

Material y métodos La información analizada correspondió a la base de datos del registro genealógico de las poblaciones nacionales de ovinos Blackbelly (BBL), Charollais (CHA), Dorper (DOR), Dorper Blanco (DOB), Dorset (DOS), Hampshire (HAM), Katahdin (KAT), Pelibuey (PEL), Rambouillet (RAM) y Suffolk (SUF); los pedigrí fueron de individuos nacidos en el periodo de 1992 a 2018; en el Cuadro 1 se describe la información genealógica utilizada; los análisis de los pedigrís se realizaron con el software Endog v4.0(11) y los parámetros genéticos poblacionales evaluados fueron: Cuadro 1: Estructura del pedigrí, coeficiente de relación promedio (CRP) y niveles de consanguinidad en diez poblaciones de ovinos mexicanos Ítem

Pedigrí

BBL

19,695

CHA

5,033

DOR

42,171

DOB

4,213

DOS

5,557

HAM

12,210

KAT

77,955

PEL

42,256

RAM

11,951

SUF

14,099

Padres (PS) 544 (29.7) 266 (17.5) 1,571 (24.1) 166 (22.7) 173 (25.5) 467 (22.9) 2,927 (27.3) 1,285 (26.3) 291 (37.1) 347 (30.2)

Madres (PM) 5,847 (2.8) 1,433 (3.4) 12,818 (2.9) 1,287 (2.9) 1,601 (2.8) 3,687 (2.7) 23,844 (3.3) 13,293 (2.6) 3,534 (3.1) 4,006 (2.8)

SM% (M/S) 32.4 (10.7) 33.8 (5.4) 34.1 (8.2) 34.4 (7.7) 31.9 (9.3) 33.4 (8.5) 34.3 (8.2) 34.5 (10.3) 32.1 (12.1) 30.1 (11.5)

Fi (PFi) 26.8 (8.4) 45.8 (8.0) 26.9 (6.1) 48.7 (14.6) 12.3 (9.8) 21.3 (5.9) 47.8 (3.9) 22.8 (6.8) 24.9 (7.4) 19.2 (9.2)

Fm (PFm) 16.9 (9.1) 36.5 (10.1) 17.2 (6.9) 32.3 (14.9) 8.6 (9.9) 12.6 (6.3) 33.5 (4.1) 13.8 (7.7) 15.4 (7.5) 14.2 (9.6)

P F 5.6x * -0.29x ns 5.6x * -0.56x * 6.5x * -0.77x * 5.6x * -0.59x * 5.5x * -0.42x ns 4.9x * -0.54x * 6.5x * -0.01x ns 7.7x * -0.24x * 7.4x * -0.17x * 1.4x ns -0.53x *

CRP 0.88 3.06 0.66 7.78 1.00 1.13 1.28 0.47 1.21 0.86

Pedigrí, total de individuos en el pedigrí. Padres, total de sementales en el pedigrí (PS, promedio de crías por semental). Madres, total de madres en el pedigrí (PM; promedio de crías por madre). Fi, porcentaje de animales consanguíneos (PFi, consanguinidad promedio). Fm, porcentaje de madres consanguíneas (PFm, consanguinidad promedio de las madres). Pendiente para porcentaje de animales (P) consanguíneos y niveles de consanguinidad (F); Poblaciones: Blackbelly (BBL), Charollais (CHA), Dorper (DOR), Dorper Blanco (DOB), Dorset (DOS), Hampshire (HAM), Katahdin (KAT), Pelibuey (PEL), Rambouillet (RAM) y Suffolk (SUF). ns estadísticamente igual a cero (P>0.05); * estadísticamente diferente de cero (P<0.05).

1073


Rev Mex Cienc Pecu 2020;11(4):1071-1086

Integridad del pedigrí El nivel de integridad se evaluó con base en(8,12): proporción de ancestros conocidos hasta la tercera generación (padres, abuelos y bisabuelos); número de generaciones completas (NGC), el cual muestra la generación más lejana con dos ancestros conocidos; número de generaciones trazadas (NGT), como indicador del número de generaciones que separan a un individuo de su ancestro más lejano; número de generaciones completas equivalentes (NGE), el cual expresa la suma de todos los ancestros conocidos con base en el número (n) de generaciones que separan al individuo de cada ancestro (NGE =  (1/2)n).

Manejo reproductivo PS, promedio de crías por semental; PM, promedio de crías por madres; SM%, total de sementales y madres, como proporción de la población total del pedigrí; M/S, relación del número de madres / número de sementales.

Consanguinidad (F) Con la subrutina mtdfnrm del software mtdfreml(13) se estimó la consanguinidad de cada individuo (Fi) y de su madre (Fm); con el año de nacimiento de los individuos consanguíneos se generaron las tendencias a través del tiempo, analizando la información de 2010 a 2018. Para el porcentaje de animales consanguíneos (P) y consanguinidad promedio (F) se realizó un análisis de regresión lineal en el periodo 2010 a 2018, con base en el modelo ŷ = 0 + x; donde, ŷ correspondió a la variable analizada en el año x; 0, el intercepto; , corresponde a la pendiente o tasa de cambio; el análisis se realizó con el software para análisis estadístico SAS(14).

Intervalo generacional (IG) Con el planteamiento de la edad media de un animal reproductor, a la que es reemplazado por un descendiente suyo(15); se calculó como la edad promedio de los padres cuando nace su descendencia, a través de las cuatro rutas de selección: padre – hijo, padre – hija, madre – hijo y madre – hija(16,17).

Relación genética aditiva promedio (CRP) El CRP se obtuvo a partir de la matriz de relaciones genéticas aditivas entre todos los individuos del pedigrí; el cálculo corresponde al valor promedio de los coeficientes de cada individuo con el resto del pedigrí(9,18). 1074


Rev Mex Cienc Pecu 2020;11(4):1071-1086

Número efectivo de fundadores (fe) Individuo fundador, todo aquel animal con padres desconocidos; el fe se definió como el número de fundadores que, contribuyendo en igual medida, producirían la diversidad genética existente en la población(10,19).

Número efectivo de ancestros (fa) Ancestro, todo individuo fundador o no, que ha contribuido a la variabilidad genética de la población; el fa se definió como el número de ancestros necesarios para explicar la variabilidad genética total de la población; considera la variabilidad genética aportada por un animal, que no se explica por la contribución de alguno de sus hijos(19,20).

Tamaño efectivo de la población (Ne) El Ne realizado se estimó a partir de 1 / 2ΔF; donde, ΔF fue el cambio promedio en consanguinidad y se calculó a partir del número (t) de generaciones completas equivalentes (ΔF = 1 – (1-Fi)1/(t-1)); este Ne considera la cantidad de información genealógica del pedigrí y el traslape generacional(21,22). El Ne define el número de reproductores que podrían generar la consanguinidad calculada y/o tasa de cambio en la varianza genética bajo el esquema de población ideal(10,23).

Resultados y discusión La precisión y veracidad en el análisis de la estructura de una población depende de la integridad del pedigrí y el contenido de información genealógica a través de generaciones; con información incompleta, la asignación de individuos a generaciones es aproximada, los cálculos de F y Ne son imprecisos. En el Cuadro 2 se describe el porcentaje de ancestros, donde por la vía materna se observó mayor contenido de información genealógica. A nivel de padres, los valores oscilaron de 76.4 % (SUF) a 95.3 % (KAT), con un promedio general de 86.0 %; los porcentajes de animales con padres desconocidos correspondió al conjunto de animales fundadores. En los pedigrís de las razas Nilagiri, Sandyno(24), Santa Inés(25) y Malpura(17) reportaron integridad y contenido de información genealógica en los niveles del presente estudio; no obstante, para las razas Mehraban(12), Guilan(26) y Morada Nova(8) los pedigrí analizados presentaron porcentajes de padres conocidos por abajo del 60 %, para abuelos los niveles fueron menores al 40 % y para bisabuelos las porcentajes fueron menores al 30 %; en todos los citados casos, el contenido de información genealógica fue superior por la vía materna.

1075


Rev Mex Cienc Pecu 2020;11(4):1071-1086

Cuadro 2: Porcentaje de progenitores conocidos a través de las diez poblaciones de ovinos mexicanos BBL CHA DOR DOB DOS HAM KAT PEL RAM SUF Padres S 82.0 92.6 89.9 89.5 79.5 82.6 95.4 80.1 90.2 74.3 M 83.2 95.5 90.1 89.5 80.1 81.2 95.1 80.4 91.2 78.5 Abuelos SS 59.6 61.6 63.4 63.9 36.4 56.9 90.7 57.4 67.3 39.1 MS 58.9 68.0 64.6 63.7 42.7 58.2 89.9 57.9 70.4 42.3 SM 59.8 81.9 74.9 76.2 46.8 57.5 89.5 53.8 60.1 48.1 MM 59.2 86.4 75.2 75.3 49.4 57.6 89.1 54.3 60.6 48.1 Bisabuelos SSS 37.2 31.9 37.2 32.8 14.7 27.8 79.7 39.0 43.6 20.5 MSS 38.4 38.6 37.6 32.8 15.6 30.1 78.7 38.1 43.8 19.4 SMS 39.9 49.6 47.9 35.9 18.5 40.7 79.8 38.1 28.1 30.3 MMS 38.2 57.8 46.3 34.9 20.8 41.9 79.6 38.7 27.5 27.7 SSM 38.9 38.9 46.5 42.7 21.4 33.3 79.1 36.4 42.2 26.5 MSM 38.6 46.9 47.5 42.5 24.1 33.3 77.6 36.5 42.4 27.0 SMM 38.7 66.3 55.2 55.3 29.1 35.9 77.9 32.9 31.8 29.9 MMM 39.1 71.1 55.0 54.3 30.0 35.0 77.1 33.8 31.9 28.4 Poblaciones: Blackbelly (BBL), Charollais (CHA), Dorper (DOR), Dorper Blanco (DOB), Dorset (DOS), Hampshire (HAM), Katahdin (KAT), Pelibuey (PEL), Rambouillet (RAM) y Suffolk (SUF). Progenitores: S, padre; M, madre.

La integridad del pedigrí se relaciona con las estimaciones de NGC, NGT y NGE (Cuadro 3), donde los valores máximos son similares a través de las diez poblaciones; sin embargo, en los promedios dentro de poblaciones hay marcadas diferencias, los máximos fueron para KAT en contraste con DOS, con los promedios más bajos. La estructura de una población es producto de los esquemas de selección y manejo reproductivo adoptados por los criadores; las diferencias observadas a través de las poblaciones analizadas se pueden atribuir al manejo reproductivo con base en los sementales, con posibles implicaciones en el Ne e IG; los valores de PS y PM (Cuadro 1) muestran la magnitud y la extensión en el uso de los reproductores a través de generaciones, y las estimaciones de SM% y M/S están relacionadas con la intensidad y presión de selección.

1076


Rev Mex Cienc Pecu 2020;11(4):1071-1086

Cuadro 3: Resultados para el número de generaciones, ancestros fundadores y tamaño efectivo en diez poblaciones de ovinos mexicanas Ítem

NGC

NGT

NGE

Anc

Anc%

BBL

5.0 (1.66) 4.0 (1.67) 5.0 (1.65) 4.0 (1.67) 4.0 (1.06) 4.0 (1.29) 6.0 (2.70) 6.0 (1.50) 5.0 (1.60) 4.0 (1.09)

11.0 (3.23) 11.0 (4.73) 12.0 (4.66) 10.0 (3.58) 8.0 (2.4) 10.0 (3.33) 13.0 (6.12) 11.0 (3.12) 8.0 (2.98) 9.0 (2.60)

7.19 (2.24) 5.89 (2.67) 6.75 (2.55) 5.61 (2.31) 5.0 (1.60) 5.28 (1.97) 8.03 (4.02) 6.99 (2.10) 5.78 (2.12) 5.39 (1.65)

2,110 (105.0) 235 (35.0) 2,836 (173.0) 271 (14.0) 735 (86.0) 1,380 (74.0) 2,578 (109.0) 5,296 (196) 1,073 (93.0) 1,746 (82.0)

39 (3.3) 13 (7.1) 74 (3.0) 7 (22.3) 32 (4.2) 28 (4.7) 48 (3.9) 94 (3.6) 38 (5.6) 44 (5.1)

CHA DOR DOB DOS HAM KAT PEL RAM SUF

Fund 3,425 (182.3) 299 (44.3) 4,219 (226.1) 441 (16.9) 1,104 (143.4) 2,090 (124.4) 3,295 (227.6) 8,348 (349.3) 1,111 (147.7) 3,332 (159.1)

Ne 36.8 22.1 53.8 12.2 50.0 56.8 73.5 51.5 53.2 34.7

Valores máximos (valores promedio) del número de generaciones completas (NGC), número de generaciones trazadas (NGT) y número de generaciones completas equivalentes (NGE). Anc= total de ancestros (tamaño efectivo de los ancestros). Anc%= número de ancestros que explican el 50 % de la variabilidad en el pedigrí (máximo porcentaje que un ancestro explica en la variabilidad del pedigrí). Fund= total de fundadores (tamaño efectivo de fundadores). Ne= tamaño efectivo realizado. Poblaciones: Blackbelly (BBL), Charollais (CHA), Dorper (DOR), Dorper Blanco (DOB), Dorset (DOS), Hampshire (HAM), Katahdin (KAT), Pelibuey (PEL), Rambouillet (RAM) y Suffolk (SUF).

Con relación a la población consanguínea (Cuadro 1; como porcentaje de la población total) los niveles fluctuaron del 12.3 % en DOS al 48.7 % en DOB, con un promedio general de 29.7 %; los niveles de F (como promedio de la población consanguínea) oscilaron de 3.9 % en KAT a 14.6 % en DOB, con un promedio general de 8.0 %. Los niveles y las tendencias de la F, así como sus componentes (CRP, Ne, fe y fa), permiten evaluar la evolución de la variabilidad genética a través del tiempo; los animales consanguíneos son los directamente afectados por los efectos de depresión endogámica y todas las consecuencias que trae consigo el incremento de F. En ovinos, dado la importancia de los efectos maternos(27,28) los posibles efectos de la depresión endogámica también se deben de evaluar a través de los niveles de

1077


Rev Mex Cienc Pecu 2020;11(4):1071-1086

consanguinidad de las madres; en el Cuadro 1, se presenta la proporción de madres consanguíneas y la consanguinidad promedio. Los escenarios observados en la evolución de F fueron: a) en todas las poblaciones el porcentaje de animales consanguíneos se incrementó a través del tiempo (Cuadro 1; Figura 1), con valores (P) en el intervalo de 1.4 a 7.7 %; b) sin embargo, los niveles de consanguinidad presentaron tendencias negativas (Cuadro 1; Figura 2), con un valor (F) promedio de -0.412 a través de las diez poblaciones; y, c) los niveles del CRP se han mantenido estables (Figura 3). Los esquemas de mejora genética deben de considerar un adecuado equilibrio entre intensidad de selección, consanguinidad y variabilidad genética. Los escenarios en la evolución de la F se pueden atribuir al uso de reproductores emparentados con gran cantidad de la población y bajos niveles de CRP; la selección con base en BLUP aumenta la probabilidad de selección de animales emparentados; avances en tecnologías reproductivas con lleva a una reducción en el número de progenitores para producir la próxima generación de animales reproductores(3,4,10). Figura 1: Tendencias de la proporción (%) de individuos consanguíneos. Blackbelly (BBL), Charollais (CHA), Dorper (DOR), Dorper Blanco (DOB), Dorset (DOS), Hampshire (HAM), Katahdin (KAT), Pelibuey (PEL), Rambouillet (RAM) y Suffolk (SUF)

1078


Rev Mex Cienc Pecu 2020;11(4):1071-1086

Figura 2: Tendencias de la consanguinidad promedio en la población consanguínea. Blackbelly (BBL), Charollais (CHA), Dorper (DOR), Dorper Blanco (DOB), Dorset (DOS), Hampshire (HAM), Katahdin (KAT), Pelibuey (PEL), Rambouillet (RAM) y Suffolk (SUF). Consanguinidad, niveles de homocigosis en los individuos producto de progenitores emparentados

Figura 3: Tendencias del coeficiente de relación promedio. Blackbelly (BBL), Charollais (CHA), Dorper (DOR), Dorper Blanco (DOB), Dorset (DOS), Hampshire (HAM), Katahdin (KAT), Pelibuey (PEL), Rambouillet (RAM) y Suffolk (SUF)

1079


Rev Mex Cienc Pecu 2020;11(4):1071-1086

Las poblaciones de KAT, PEL y RAM presentaron las más altas tasas de crecimiento en población consanguínea (Cuadro 1; Figura 1); DOB y DOR presentaron las mayores tendencias negativas de F; y, DOB y CHA tienen los niveles más altos del CRP. En estudios afines con resultados diversos, Danchin-Burge et al(29) publicaron tendencias de F cercanas a cero en siete poblaciones de ovinos; sin embargo, Stachowicz et al(10) reportaron tendencias positivas en los niveles de F en seis razas de ovinos de Canadá; además, Li et al(30), Gowane et al(17) y Gowane et al(18) en ovinos Finnsheep, Merino y Malpura, respectivamente, reportaron tendencias positivas en los niveles de F y CRP. El concepto de Ne se desarrolló con base en los lineamientos de la población ideal; el Ne realizado refleja la acumulación de relaciones genéticas entre individuos y permite predecir los cambios en los niveles de F; además, como resultado de la deriva genética y cambios en las frecuencias génicas presenta los cambios en la varianza genética(31). La estructura de apareamientos y la demografía reproductiva de las poblaciones de ovinos evaluadas difieren a los planteamientos de la población ideal; sin embargo, el Ne realizado tiende a ajustar por algunas de las diferencias(32). Bajos Ne se relacionan con disminución de la variabilidad genética, aumento de apareamientos entre individuos emparentados, fijación de alelos y la mayor reducción en respuesta a la selección(33). El Ne es un concepto básico para el diseño de programas de conservación y/o mejoramiento genético, un Ne menor a 50 es considerado como de cuidado; para el desarrollo de poblaciones recomiendan Ne igual o mayor a 50, el cual considera aumento en los niveles de F menor o igual al 1 %(34); para poblaciones sujetas a mejoramiento genético recomiendan Ne mayores, que permitan optimizar la respuesta a la selección con el mínimo incremento de F(35). Seis de las poblaciones evaluadas presentaron estimaciones de Ne en el intervalo de 50 a 73.5 (Cuadro 3), lo cual señala que los incrementos de F serán igual o menores al 1%; por otro lado, cuatro poblaciones presentaron Ne en el intervalo de 12.2 a 36.8, lo cual las coloca en el estatus de cuidado para monitorear la evolución de la F y el CRP, y sus posibles implicaciones en el mejoramiento genético. En otras poblaciones, Leroy et al(32) evaluando los métodos de estimación de Ne en 40 razas de ovinos, reportaron Ne realizado en el intervalo de 38 a 675, y un valor promedio de 191; asimismo, diversos investigadores(29,30,36.37), que en su conjunto evaluaron el pedigrí de 15 poblaciones de ovinos, reportaron estimaciones de Ne en el intervalo de 55 a 276. Las relaciones genéticas entre los fundadores y el fe exponen la variabilidad genética inicial; la contribución de los fundadores a la variabilidad del pedigrí exhibe el conjunto de genes que se ha mantenido a través de generaciones(38); en DOB, CHA y SUF, 7, 13 y 44 individuos, respectivamente, explican el 50% de la variabilidad del pedigrí (Cuadro 3); un reducido número de ancestros que expliquen la variabilidad del pedigrí está asociado a incrementos en los niveles de CRP y F. El fa comprende las posibles causas de pérdida en la variabilidad genética; por lo general fe > fa, conforme aumenta esa diferencia indica una menor participación de los fundadores a lo largo de generaciones; la relación fe / fa muestra un manejo reproductivo diferencial y considera los posibles cuellos de botella que ha 1080


Rev Mex Cienc Pecu 2020;11(4):1071-1086

experimentado la población. Conforme se incrementa ese cociente indica que la mayoría de los ancestros fueron fundadores, con ausencia de cuellos de botella(39). En el Cuadro 3 se presentan la cantidad de individuos fundadores y ancestros, así como el tamaño efectivo de ambos; la relación fe/fa osciló de 1.2 a 2.0, los cuales coinciden con los resultados publicados por Tahmoorespur y Sheikhloo(16), Ghafouri-Kesbi(40), Mokhtari et al(36), Mokhtari et al(37) y McManus et al(8) en ovinos Baluchi, Afshari, Kermani, Moghani y Morada Nova, respectivamente. El CRP puede ser un resumen del manejo reproductivo que ha tenido la población; la F, como consecuencia del apareamiento de animales emparentados, no explica por qué se dieron esos apareamientos; asimismo, el CRP permite diseñar los empadres manteniendo ciertos niveles de F en la progenie. Las Figuras 2 y 3 muestran la relación entre el CRP y F, al mantenerse los niveles de CRP, no se incrementan los niveles de F; sin embargo, la Figura 1 muestra el manejo reproductivo a través del tiempo, los reproductores provienen de un reducido número de familias y tienden a estar relacionados genéticamente, seleccionados dentro de rebaño con poco flujo a través de rebaños. Por otro lado, en la relación de fe y la F, el CRP de un fundador indica el porcentaje de la población originada por él(11). El IG es de suma importancia para validar las pérdidas de variabilidad genética y el progreso genético a través del tiempo; la intensidad de selección, asociada a SM% y M/S, tiende a reducir el IG, pero resulta en pérdidas de variabilidad genética dado la poca contribución de esos reproductores a la población(9,38). En el Cuadro 4 se presentan las estimaciones del IG por las cuatro vías, los valores oscilaron de 3.0 a 4.15, con un promedio general de 3.45 años y no se observan diferencias sustanciales a través de vías de estimación; sin embargo, a través de poblaciones, las mayores estimaciones fueron para RAM y SUF, en contraste con BBL y DOR con los IG menores. Danchin-Burge et al(29) en siete razas de ovinos de Francia, reportaron estimaciones de IG promedio de 3.5 años, en un intervalo de 1.9 a 5.0; no obstante, en ovinos Xalda(19) y en ovinos Somalí(41) reportaron IG promedio de 2.9 y 2.1 años, respectivamente.

1081


Rev Mex Cienc Pecu 2020;11(4):1071-1086

Cuadro 4: Estimaciones del intervalo generacional (años) en diez poblaciones de ovinos mexicanas Ítem

Padre - hijo

Padre - hija

Madre - hijo

Madre - hija

Media

BBL CHA DOR DOB DOS HAM KAT PEL RAM SUF

3.15 3.77 3.04 3.70 3.28 3.23 3.47 3.31 3.55 3.86

3.12 3.64 3.13 3.55 3.69 3.33 3.25 3.09 4.15 3.59

3.06 3.55 3.02 3.00 3.97 3.31 3.53 3.46 3.89 3.84

3.02 3.29 3.08 3.30 3.79 3.64 3.29 3.36 4.06 3.58

3.09 3.56 3.07 3.39 3.68 3.37 3.38 3.30 3.91 3.71

Media

3.44

3.45

3.46

3.44

Poblaciones: Blackbelly (BBL), Charollais (CHA), Dorper (DOR), Dorper Blanco (DOB), Dorset (DOS), Hampshire (HAM), Katahdin (KAT), Pelibuey (PEL), Rambouillet (RAM) y Suffolk (SUF).

Conclusiones e implicaciones Estos resultados muestran un resumen del manejo genético y reproductivo que han realizado los criadores; son de utilidad en el diseño de programas de selección previendo la relación entre respuesta a la selección y los incrementos de consanguinidad, con las consecuencias que conlleva. Los resultados con respecto a las tendencias fueron similares a través de las poblaciones evaluadas: los niveles de consanguinidad tienden a disminuir con pendientes negativas diferentes de cero (P<0.05); las relaciones genéticas fueron estables a través del tiempo; sin embargo, el incremento de la población consanguínea fue significativo, con pendientes positivas diferentes de cero (P<0.05). En magnitud, KAT, PEL y RAM con altas tasas de crecimiento en población consanguínea; DOB y DOS, DOB y CHA con los niveles más altos de consanguinidad y relaciones genéticas, respectivamente; BBL, CHA, DOB, y SUF presentaron bajas estimaciones de tamaño efectivo y se debe monitorear la evolución de la consanguinidad y sus posibles implicaciones.

Literatura citada: 1. Partida de la PJA, Braña VD, Jiménez SH, Ríos RFG, Buendía RG. Producción de carne de ovina. Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Libro técnico No. 5. México. 2013.

1082


Rev Mex Cienc Pecu 2020;11(4):1071-1086

2. Domínguez-Viveros J, Rodríguez-Almeida FA. Resumen de evaluaciones genéticas en ovinos. Catálogo de sementales de alto valor genético de doce razas. Organismo de la unidad nacional de ovinocultores. Universidad Autónoma de Chihuahua. Chihuahua, México. 2017. 3. Verrier E, Colleau J, Foulley JL. Long-term effects of selection based on the animal model BLUP in a finite population. Theo Applied Genet 1993;87:446-454. 4. Wu L, Schaeffer R. Reducing the effect of parent averages from animal solution in mixed model equations. J Anim Breed Genet 2000;117:361-374. 5. Ruiz-Flores A, García-Munguia CA, Núñez-Domínguez R, Ramírez-Valverde R, LópezOrdaz R, García-Muñiz JG. Inclusión del coeficiente de consanguinidad en los modelos de evaluación genética de bovinos Jersey y Suizo Americano en México. Rev Mex Cienc Pecu 2011;2:381-391. 6. Selvaggi M, Dario C, Peretti V, Ciotola F, Carnicella D, Dario M. Inbreeding depression in Leccese sheep. Small Ruminant Res 2010;89:42-46. 7. Vostry L, Milerski M, Schmidova J, Vostra-Vydrova H. Genetic diversity and effects of inbreeding on litter size of the Romanov. Small Ruminant Res 2018;168:25-31. 8. McManus C, Facó O, Shiotsuki L, Jivago de PRJL, Peripolli V. Pedigree analysis of Brazilian Morada Nova hair sheep. Small Ruminant Res 2019;120:37-42. 9. Gutiérrez JP, Altarriba J, Diaz C, Quintanilla R, Cañón J, Piedrafita J. Pedigree analysis of eight Spanish beef cattle breeds. Genet Sel Evol 2003;35:43-64. 10. Stachowicz K, Brito LF, Oliveira HR, Miller SP, Schenkel FS. Assessing genetic diversity of various Canadian sheep breeds through pedigree analysis. Can J Anim Sci 2018;98:741-749. 11. Gutiérrez JP, Goyache F. A note on ENDOG: a computer program for analysis pedigri information. J Anim Breed Genet 2005;122:172-176. 12. Yavarifard R, Hossein-Zadeh NG, Shadparvar AA. Population genetic structure analysis and effect of inbreeding on body weights at different ages in Iranian Mehraban sheep. J Anim Sci Tech 2014;56:31-39. 13. Boldman KG, Kriese LA, Van Vleck DL, Van Tassell CP, Kachman SD. A Manual for use of MTDFREML. A set of programs to obtain estimates of variances and covariances (Draft). USDA. ARS. 1995.

1083


Rev Mex Cienc Pecu 2020;11(4):1071-1086

14. SAS. SAS/STAT User's Guide (Release 9.0). Cary, NC, USA. SAS Inst. Inc. 2005. 15. James JW. A note on selection differentials and generation length when generations overlap. Animal Prod 1977;24:109-112. 16. Tahmoorespur M, Sheikhloo M. Pedigree analysis of the closed nucleus of Iranian Baluchi sheep. Small Ruminant Res 2011;99:1-6. 17. Gowane GR, Ashish C, Misra S, Prince LL. Genetic diversity of a nucleus flock of Malpura sheep through pedigree analyses. Small Ruminant Res 2014;120:35-41. 18. Gowane GR, Prakash V, Ashish C, Prince LL. Population structure and effect of inbreeding on lamb growth in Bharat Merino sheep. Small Ruminant Res 2013;114:7279. 19. Goyache E, Gutiérrez JP, Fernández L, Gómez E, Álvarez I, Diez J, Royo LR. Using pedigree information to monitor genetic variability of endangered populations: the Xalda sheep of Asturias as an example. J Anim Breed Genet 2003;120:95-105. 20. Sheikhlou M, Abbasi MA. Genetic diversity of Iranian Lori-Bakhtiari sheep assessed by pedigree analysis. Small Ruminant Res 2016;141:99-105. 21. Gutiérrez JP, Cervantes I, Molina A, Varela M, Goyache F. Individual increase in inbreeding allows estimating realized effective sizes from pedigrees. Genet Sel Evol 2008;40:359-378. 22. Gutiérrez JP, Cervantes I, Goyache F. Improving the estimation of realized effective population sizes in farm animals. J Anim Breed Genet 2009;126:327-332. 23. Falconer DS, Mackay. TFC Introducción a la genética cuantitativa. Editorial Acribia. Zaragoza, España. 1996. 24. Venkataramanan R, Subramanian A, Sivaselvam SN, Sivakumar T, Sreekumar C, Iyue M. Effect of inbreeding and individual increase in inbreeding on growth in Nilagiri and Sandyno breeds of sheep. Animal Genetic Res 2016;58:63-71. 25. Teixeira NMR, Ferreira CJ, Souza CPL, Mendes MCH, Neves FHH. Parâmetros populacionais da raça ovina Santa Inês no Brasil. Pesq Agrop Bras 2013;48:1589-1595. 26. Eteqadi B, Hossein-Zadela NG, Ahad SA. Population structure and inbreeding effects on body weight traits of Guilan sheep in Iran. Small Ruminant Res 2014;119:45-51. 27. Bradford GE. The role of maternal effects in animal breeding. VII. Maternal effects in sheep. J Anim Sci 1972;35:1324-1334.

1084


Rev Mex Cienc Pecu 2020;11(4):1071-1086

28. Gowane GR, Ashish C, Prakash V, Prince LL. The role of maternal effects in sheep breeding: a review. Indian J Small Rumin 2014;20:1-11. 29. Danchin-Burge C, Palhiere I, Francois D, Bibé B, Leroy G, Verrier E. Pedigree analysis of seven small French sheep populations and implications for the management of rare breeds. J Anim Sci 2010;88:505-516. 30. Li MH, Strandén I, Kantanen J. Genetic diversity and pedigree analysis of the Finnsheep breed. J Anim Sci 2009;87:1598-1605. 31. Crow JF, Kimura M. An introduction to population genetic theory. Haper & Row, New York, USA. 1970. 32. Leroy G, Mary-Huard T, Verrier E, Danvy S, Charvolin E, Danchin-Burge C. Methods to estimate effective population size using pedigree data: examples in dog, sheep, cattle and horse. Genet Sel Evol 2013;45:1-10. 33. Breda FC, Euclydes RF, Silva PC, Robledo de AT, Souza CPL, Rocha SJL, de Almeida TFR, França MAK. Endogamia e Limite de Seleção em Populações Selecionadas Obtidas por Simulação. Rev Brasil Zoot 2004;33:2017-2025. 34. FAO. Secondary guidelines for development of national farm animal genetic resources management plans: management of small populations at risk. Rome, Italy. 1998. 35. Meuwissen THE, Sonesson AK. Maximizing the response of selection with a predefined rate of inbreeding: overlapping generations. J Anim Sci 1998;76:2575-2583. 36. Mokhtari MS, Moradi SM, Esmailizadeh AK, Abdollahi-Arpanahi R, Gutiérrez JP. Genetic diversity in Kermani sheep assessed from pedigree analysis. Small Ruminant Res 2013;114:202-205. 37. Mokhtari MS, Miraei-Ashtiani SR, Jafaroghli M, Gutiérrez JP. Studying genetic diversity in Moghani sheep using pedigree analysis. J Agric Sci Tech 2015;17:1151-1160. 38. Biochard D, Maignel L, Verrier E. The value of using probabilities of gene origin to measure genetic variability in a population. Genet Select Evol 1997;29:5-23. 39. Barros EA, de A Brasil LH, Tejero JP, Delgado-Bermejo JV, Ribeiro MN. Population structure and genetic variability of the Segureña Sheep breed through pedigree analysis and inbreeding effects on growth traits. Small Rumianant Res 2017;149:128-133. 40. Ghafouri-Kesbi F. Using pedigree information to study genetic diversity and reevaluating a selection program in an experimental flock of Afshari sheep. Arch Tierz 2012;55:375-384.

1085


Rev Mex Cienc Pecu 2020;11(4):1071-1086

41. Paiva SR, Olivardo F, Faria DA, Lacerda T, Baretto GB, Carneiro PLS, Lobo RNB, McManus C. Molecular and pedigree analysis applied to conservation of animal genetic resources: the case of Brazilian Somali hair sheep. Trop Animal Health Prod 2011;43:1449-1457.

1086


https://doi.org/10.22319/rmcp.v11i4.4950 Artículo

Acumulación de forraje de Lotus corniculatus L., en función a diferentes estrategias de cosecha

Perpetuo Álvarez Vázquez a Juan de Dios Guerrero Rodríguez b* Gabino García De Los Santos c María Esther Ortega Cerrilla d Sergio Iban Mendoza Pedroza d Santiago Joaquín Cancino e

a

Universidad Autónoma Agraria Antonio Narro. Departamento de Recursos Naturales Renovables. México. b

Colegio de Postgraduados. Campus puebla, Desarrollo Agrícola Regional. México.

c

Colegio de Postgraduados. Campus Montecillo, Recursos Genéticos y Productividad Producción de Semillas. México. d

Colegio de Postgraduados. Campus Montecillo, Recursos Genéticos y ProductividadGanadería. Estado de México, México. e

Universidad Autónoma de Tamaulipas. Facultad de Ingeniería y Ciencias. México.

*Autor de correspondencia: grjuan2000mx@yahoo.com

Resumen: El objetivo del estudio fue determinar la mejor estrategia de cosecha en Lotus corniculatus, dependiente de diferentes porcentajes de luz interceptada (LI) por el dosel y una denominada corte fijo (CF) definido estacionalmente, en dos periodos de producción. Los tratamientos (LI y CF) se distribuyeron en un diseño de bloques al azar, con tres repeticiones. El 1087


Rev Mex Cienc Pecu 2020;11(4):1087-1100

rendimiento de forraje del CF fue 27 % menor al 95 % de LI en el primer periodo (19,915 vs 28,417 kg MS ha-1), y 29 % al promedio de los porcentajes de LI en el segundo periodo (19,100 vs 26,952 kg MS ha-1). El rendimiento promedio estacional fue mayor en primavera (9,447 kg MS ha-1), comparado con otoño (3,120 kg MS ha-1), en ambos periodos. La hoja fue el componente que mayor aporte tuvo (56 %), principalmente en primavera con 95 % de LI. Con 90, 95 y 100 % de LI se registraron las alturas mayores (21.5 cm) y con un CF las alturas menores (17 cm). Entre estaciones, las alturas mayores (24 cm) se presentaron en primavera y las menores en invierno (17 cm). En ambos periodos, se presentó la relación promedio hoja:tallo mayor en el CF (2.3), seguido del 90, 95 y 100 % de LI. El comportamiento mejor de Lotus corniculatus genotipo 255301, se presentó cuando éste fue cosechado usando los porcentajes de luz interceptada como indicador; sin embargo, la mayor cantidad de hoja se produjo con 95 % de luz interceptada. Palabras clave: Lotus corniculatus L., Producción de forraje, Estrategia de cosecha, Luz interceptada.

Recibido: 15/06/2018 Aceptado: 23/10/2019

Introducción Lotus corniculatus L., conocida comúnmente como trébol pata de pájaro, es la especie forrajera de mayor importancia de su género; registra alrededor de 200 especies entre anuales y perennes(1), las cuales ocupan un 90 % del área sembrada en el mundo(2). Es comparada con la alfalfa (Medicago sativa L.) y el trébol blanco (Trifolium repens L.), ya que, su rendimiento y su calidad nutricional (entre 18.9 a 21.8 % de proteína cruda, en base seca), es similar o superior a estas especies(3). Contiene además, menos celulosa y más carbohidratos no estructurales(4) y no produce meteorismo en rumiantes en pastoreo, debido a la presencia de taninos condensados(5). Sin embargo, como en el resto de las especies forrajeras su productividad y persistencia están en función de la acumulación de forraje, y ambas características son determinadas por la estrategia de cosecha(6), a la par de una eficiencia en ésta(7). Así mismo, el crecimiento de las plantas y las prácticas de manejo, son variables que interaccionan con el suelo y clima(8), por lo tanto, a medida que avanza el crecimiento de la planta se propicia la competencia entre ellas; principalmente, en los periodos de rebrote, donde se reduce la cantidad y calidad luminosa en la pradera(9). En otros estudios mencionan que, cuando en la pradera se alcanza un valor de 95 % de luz interceptada, se llega a un punto 1088


Rev Mex Cienc Pecu 2020;11(4):1087-1100

óptimo de cosecha, donde se obtiene la mejor productividad(10). En consecuencia, un buen manejo de la cantidad de luz interceptada por la pradera, asegura una mejor productividad de la misma(11). En leguminosas de clima templado se han encontrado correlaciones altas entre la acumulación de forraje y la cantidad de luz interceptada(12), no obstante, en L. corniculatus, es poco lo que se ha generado en investigación a este respecto. Por lo tanto, el objetivo de este trabajo fue determinar la mejor estrategia de cosecha de Lotus corniculatus, genotipo 255301, sometido a cuatro intervalos de cosecha; tres dependientes del porcentaje de intercepción de luz y un corte fijo definido estacionalmente.

Material y métodos Se realizaron dos experimentos en condiciones de campo en el periodo de otoño-verano 2014-2015 (POV1) y otoño-verano 2015-2016 (POV2), en el Colegio de Postgraduados, Texcoco, México (19029´ N, 98054’ O y 2,250 msnm). La textura del suelo es franco arenosa, ligeramente alcalina, con un pH de 7.8(13). El clima del lugar es templado subhúmedo con régimen de lluvias en verano, precipitación y temperatura media anual de 645 mm y 15 0C, respectivamente(14). Durante el estudio, los datos de temperatura del aire (mínima y máxima) y precipitación durante se obtuvieron de la estación meteorológica de la Universidad Autónoma Chapingo (Figura 1), ubicada a 2 km de distancia del área experimental. La precipitación acumulada del POV1 fue de 1,043 mm y del POV2 de 877 mm. En ambos periodos, las máximas temperaturas se presentaron en primavera-verano. Figura 1: Temperatura media mensual máxima, mínima y precipitación acumulada mensual

POV1=Periodo de otoño 2014-verano 2015; POV2 = Periodo de otoño 2015-verano 2016. Datos de la estación meteorológica Universidad Autónoma Chapingo. 1089


Rev Mex Cienc Pecu 2020;11(4):1087-1100

Se evaluó una pradera de Lotus corniculatus L., genotipo 255301, establecida mediante trasplante en marzo de 2014, a una distancia entre plantas de 33 cm. Las plantas se obtuvieron de material reproducido en invernadero. No se aplicó ningún tipo de fertilizante y en las estaciones de poca o nula precipitación, se proporcionaron riegos a capacidad de campo cada dos semanas. Al inicio del estudio (5 de septiembre de 2014), se realizó un corte manual a 7 cm sobre el nivel del suelo, para uniformización de la altura del forraje. La unidad experimental consistió en parcelas de 4 m2. Los tratamientos consistieron en cuatro estrategias de cosecha manual; tres intervalos de corte cuando la pradera alcanzó porcentajes de luz interceptada de 90, 95 y 100 % y uno denominado corte fijo definido por estación del año; otoño: 35, invierno: 42, y primavera -verano: 28 días entre corte, a una altura de forraje residual de 7 cm en todos los tratamientos(3). Los porcentajes de luz interceptada por la pradera se monitorearon previos al corte, tomando seis lecturas en cada parcela a las 1200 h, utilizando un ceptómetro modelo LP-80 (Decagon Devices, EE.UU). Los cuatro tratamientos se asignaron aleatoriamente en cuatro parcelas de 4 m2 en un diseño de bloques completamente al azar con tres repeticiones, cuatro parcelas por bloque, generando 12 parcelas experimentales. El rendimiento de forraje (kg MS ha-1) se determinó con la biomasa cosechada en dos cuadrantes fijos de 0.25 m2 por repetición, establecidos al inicio del experimento. El material cosechado se depositó en bolsas etiquetadas y se deshidrató a 60 0C hasta peso constante en una estufa de aire forzado (Felisa, Mod. FE-243A). Del forraje cosechado se cuantificó la composición botánica y morfológica (CBM), tomando una sub-muestra de aproximadamente del 10 %, la cual se separó en hoja, tallo, material muerto (material senescente) y maleza y se calculó el aporte al rendimiento en kg MS ha-1. Los datos obtenidos de hoja y tallo, de la CBM, se utilizaron para determinar la relación hoja:tallo, al dividir el peso de la hoja entre el tallo. Por otra parte, para estimar la altura de planta promedio, un día antes del corte, se tomaron al azar 12 lecturas por repetición, con una regla graduada a 50 cm y se promediaron los valores de los cortes pertenecientes a cada estación. De estos, se calculó la equivalencia en rendimiento de forraje por centímetro de altura de planta, dividiendo el rendimiento entre la altura entre el número de cortes(15). Para investigar el efecto de los tratamientos (estrategia de cosecha) sobre las variables de respuesta, los datos se agruparon de forma estacional y por periodo de estudio, esto para facilitar su análisis y discusión. Se analizaron conforme a un diseño experimental de bloques al azar con cuatro tratamientos y tres repeticiones, mediante el procedimiento PROC GLM del paquete estadístico SAS(16). La comparación de medias se realizó por medio de la prueba Tukey (P≤0.05).

1090


Rev Mex Cienc Pecu 2020;11(4):1087-1100

Resultados y discusión Rendimiento de forraje Los mayores rendimientos promedios estacionales se presentaron en primavera (9,447 kg MS ha-1), sin ser diferentes a verano del POV1, y los menores en otoño (3,120 kg), siendo similar a invierno del mismo periodo (Cuadro 1). Este comportamiento tuvo relación directa con las temperaturas óptimas (22 0C) para el crecimiento de Lotus corniculatus(3). Las temperaturas favorables se presentaron en primavera (Figura 1), lo cual benefició el crecimiento y producción de la especie. Esto concuerda con lo reportado en cinco poblaciones de L. corniculatus, al utilizar un intervalo de pastoreo severo y uno intenso de 20 y 40 días, respectivamente(17). Por lo tanto, los cambios estacionales en el rendimiento de una especie forrajera, pueden ser atribuidos a las condiciones ambientales presentes en cada estación del año(18). Al respecto, se han encontrado distribuciones estacionales en la producción de forraje de L. corniculatus de 32, 30, 23 y 15 % para primavera, verano, invierno y otoño, respectivamente, concentrándose un 62 % en primavera–verano(19). También, se han registrado rendimientos promedios de 7,700 kg MS ha-1, en un intervalo de corte de 45 días, en Texcoco, Edo. de México, influenciados por el clima, manejo y hábito de crecimiento del genotipo(3). Cuadro 1: Rendimiento de forraje (kg MS h-1) de L. corniculatus, genotipo 255301, en función del porcentaje de luz interceptada (LI) y un corte fijo definido estacionalmente LI (%) POV1 90 95 100 Corte fijo Promedio EEM POV2 90 95 100 Corte fijo Promedio EEM

Otoño

Invierno

Primavera

Verano

Acumulado

EEM

4527 Ab 4956 Ab 4235 Ab 3300 Ab 4255 b 683

2736 Bb 4422 Ab 2716 Bb 2431 Bb 3076 b 522

10326 Aa 10346 Aa 11002 Aa 8147 Aa 9956 a 1432

9746 Aa 9942 Aa 9178 Aa 6851 Ba 8929 a 637

27336 AB 28417 A 27132 AB 20730 B 25904 2461

1271 481 802 529 564

4749 Ac 4676 Ab 5501 Ac 4603 Ab 4882 c 628

3247 Ad 3835 Ab 3749 Ad 1826 Bc 3164 d 329

9953 Aa 9087 ABa 9732 Aa 6982 Ba 8938 a 940

8565 Ab 9515 Aa 8246 Ab 5689 Bb 8004 b 668

26515 A 27113 A 27227 A 19100 B 24989 2397

355 505 477 402 306

Corte fijo; otoño: 35, invierno: 42, y primavera -verano: 28 días entre corte. POV1= periodo de otoño 2014verano 2015; POV2= periodo de otoño 2015-verano 2016. EEM = error estándar de la media. Promedios con letra mayúscula diferente en una columna y letra minúscula diferente en una hilera son diferentes (P0.05). 1091


Rev Mex Cienc Pecu 2020;11(4):1087-1100

En ambos periodos de estudio, los tratamientos presentaron diferencias (P≤0.05) en el forraje acumulado. El rendimiento menor correspondió al corte fijo con 27 % menos respecto al 95 % LI (28,417 vs 20,730 kg MS ha-1) en el POV1 y 29 % respecto al promedio de los tres porcentajes de luz interceptada (26,952 vs 19,100 kg MS ha-1) en el POV2 (Cuadro 1). Lo anterior, puede estar relacionado con un intervalo de cosecha menor de 33 días, correspondiente al corte fijo, respecto al intervalo de cosecha promedio de 70 días de los tratamientos cosechados con base a las intercepciones luminosas (Figura 2). En el cultivar 202700 en Texcoco, México, se reportó una menor adaptación de la especie Lotus corniculatus a un corte definido por estación, respecto a, cortes dependientes del porcentaje de luz interceptada, ya que, rindió 29 % menos forraje que el resto de los tratamientos(20). En algunas especies forrajeras, los cortes frecuentes disminuyen su rendimiento y área foliar, e incrementan la presencia de especie indeseables(21) y con ello una mayor competencia con la especie deseada y el agotamiento de sus reservas de carbohidratos(22). Figura 2: Intervalos de corte (promedios), de L. corniculatus, genotipo 255301

Tres cuando la pradera alcanzó porcentajes de luz interceptada de 90, 95 y 100 % y uno denominado corte fijo (CF) definido por estación; otoño: 35, invierno: 42, y primavera -verano: 28 días entre corte.

Composición botánica y morfológica Dentro de los componentes morfológicos, la hoja fue la que más aportó al rendimiento con promedio de 14,273 kg MS ha-1, que representó el 56 %, seguido por el tallo (30.5 %), material muerto (8.5 %) y maleza (4.5 %). Entre tratamientos, con 95 % de luz interceptada se presentó mayor cantidad de hoja con un promedio de 16,526 kg MS ha-1, siendo diferente (P≤ 0.05) al resto de los tratamientos en el POV2. El corte fijo, presentó menor cantidad de hojas y de tallos con 12,276 y 4,710 kg MS ha-1, en ambos periodos, respectivamente. El

1092


Rev Mex Cienc Pecu 2020;11(4):1087-1100

material muerto y la maleza, no presentaron diferencias (P≥0.05), en ambos periodos (Cuadro 2). Cuadro 2: Rendimiento de forraje acumulado estacional (kg MS h-1), por componente botánico y morfológico de L. corniculatus, genotipo 255301, en función del porcentaje de luz interceptada (LI) y un corte fijo definido estacionalmente LI (%) POV1 90 95 100 Corte fijo Promedio EEM POV2 90 95 100 Corte fijo Promedio EEM

Hoja

Tallo

MM

Maleza

EEM

13829 Aa 15979 Aa 14540 Aa 12715 Aa 14266 a 1332

8426 Ab 9450 Ab 7964 ABb 5364 Bb 7801 b 1048

3337 Ac 2051 Ac 4622 Ac 2616 Ab 3156 c 971

459 Ad 937 Ac 1291 Ac 1329 Ab 1004 d 662

961 836 754 1692 753

14315 ABa 17074 Aa 13893 ABa 11838 Ba 14280 a 1102

7996 Bb 9412 ABb 10403 Ab 4056 Cb 7967 b 757

1608 Ac 969 Ac 2326 Ac 1718 Ac 1655 c 570

970 Ac 719 Ac 605 Ad 2053 Abc 1087 c 750

1022 877 533 748 565

Corte fijo; otoño: 35, invierno: 42, y primavera -verano: 28 días entre corte. POV1= periodo de otoño 2014verano 2015; POV2 = periodo de otoño 2015-verano 2016. EEM = error estándar de la media. Promedios con letra mayúscula diferente en una columna y letra minúscula diferente en una hilera son diferentes (P<0.05).

Una mayor producción de hoja y tallo con 95 % LI, puede estar relacionada con un incremento en la edad de crecimiento del cultivo(23). También, un aumento en la cantidad de hojas desde el corte fijo hasta un 95 % LI, puede ser el resultado de una compensación en el incremento de la biomasa de los tallos, debido a un mayor periodo de crecimiento, que implica mayor tiempo produciendo fotosintatos(24). Estacionalmente, la hoja fue el componente que más aportó al rendimiento de forraje (Figura 3). El mayor y menor rendimiento promedio en ambos periodos se registró durante primavera e invierno con 5,141 y 1,580 kg MS ha-1, donde la estrategia de cosecha con 95 % de luz interceptada y el corte fijo, presentaron los mayores y menores rendimientos de 5,852 y 1,163 kg MS ha-1, respectivamente. También en primavera e invierno se presentaron la mayor y menor cantidad de tallos con 3,347 y 772 kg MS ha-1. Estos resultados pueden ser consecuencia de las condiciones ambientales concurrentes en cada estación del año, presentes durante el estudio (Figura 1). Al respecto, se ha encontrado que los cambios en la producción de tallos están en función de las variaciones estacionales por la cantidad y calidad de luz, la 1093


Rev Mex Cienc Pecu 2020;11(4):1087-1100

precipitación y la temperatura, que incide sobre la pradera(18). En cuanto al material muerto y la maleza, la mayor producción correspondió a verano con 873 y 268 kg MS ha-1, sin ser diferente (P≥0.05) a primavera del primer periodo, mientras la menor a otoño con 237 y 133 kg MS ha-1, respectivamente. Lo anterior, puede ser el resultado de un auto sombreado de la planta a nivel del área basal, debido a un mayor crecimiento de esta en las estaciones con condiciones favorables para su desarrollo(25). Figura 3: Composición botánica y morfológica de L. corniculatus, genotipo 255301, en función del porcentaje de luz interceptada y un corte fijo (CF) definido por estación= otoño: 35, invierno: 42, y primavera -verano: 28 días entre corte 1 Periodo de otoño 2014-verano

Periodo de otoño 2015-verano 2016 (POV2)

Rendimiento de forraje (kg MS ha-1)

2015 (POV1)

CF0

90

95 Hoja

100 Tallo

1094

CF0 Material muerto

90

95 Maleza

100


Rev Mex Cienc Pecu 2020;11(4):1087-1100

Altura de planta

Hubo diferencias entre tratamientos y estaciones (P0.05). Las alturas mayores, se registraron en 90, 95 y 100 % de luz interceptada con 21.5 cm promedio, siendo diferentes (P≥0.05) al 90 % de IL en POV2, mientras que, las alturas menores se presentaron en el corte fijo con 17 cm, en promedio de ambos periodos (Cuadro 3). Estos resultados están relacionados con la edad de la pradera, ya que, en parcelas cosechadas en función del porcentaje de luz interceptada, la planta tuvo más días de rebrote con 70 días respecto al corte fijo con 33 días, promedio de ambos periodos (Figura 2). En el corte fijo, la edad de la planta fue menor, con cortes más frecuentes, reflejándose en un rendimiento de forraje menor(17). Al respecto, se ha señalado que a una altura mayor corresponde un rendimiento mayor de forraje(15) y en el caso de Lotus corniculatus, el rendimiento y la altura, también se ha relacionado con los hábitos de crecimiento erectos y postrados(3).

Cuadro 3: Altura de planta (cm) de L. corniculatus, genotipo 255301, en función del porcentaje de luz interceptada (LI) y un corte fijo definido estacionalmente LI (%) Otoño Invierno Primavera Verano Promedio EEM POV1 90 21 ABa 18 Ab 23 Aa 24 Aa 22 A 0.9 95 23 Aa 17 Aa 23 Aba 24 Aa 22 A 2.4 100 18 Bc 20 Abc 24 Aa 23 Aab 21 A 1.6 Corte fijo 24 Aa 12 Bc 21 Bab 18 Bb 19 B 1.5 Promedio 21 a 17 b 23 a 22 a 21 1.5 EEM 1.6 1.1 0.6 0.7 0.8 POV2 90 19 Ab 13 Bc 24 Ba 24 ABa 20 B 1.0 95 17 ABc 22 Ab 30 Aa 24 Ab 23 A 1.1 100 19 Ac 26 Ab 31 Aa 22 ABbc 25 A 1.2 Corte fijo 15 Bb 8 Cc 16 Cb 22 Ba 15 C 0.8 Promedio 18 c 17 c 25 a 23 b 21 0.4 EEM 1.2 1.3 0.9 0.9 0.5 Corte fijo = otoño: 35, invierno: 42, y primavera -verano: 28 días entre corte. POV1= periodo de otoño 2014verano 2015; POV2= periodo de otoño 2015-verano 2016. EEM = error estándar de la media. Promedios con letra mayúscula diferente en una columna y letra minúscula diferente en una hilera son diferentes (P0.05).

1095


Rev Mex Cienc Pecu 2020;11(4):1087-1100

Entre estaciones, en ambos periodos de estudio, la altura promedio mayor se registró en primavera con 24 cm, siendo similar a verano y otoño (P≥0.05) en el POV1, y la menor en invierno con 17 cm, siendo similar a otoño (P≥0.05), en el POV2. Las alturas mayores de la planta se encontraron en las estaciones con condiciones más óptimas de humedad y temperatura para su crecimiento y rendimiento de la especie (Figura 1). Estos resultados son similares a los reportados en el Estado de México, México; en 12 genotipos de L. corniculatus(3). También, se ha reportado que en condiciones adecuadas de fotoperiodo, temperatura y humedad, las plantas forrajeras aceleran su crecimiento y presentan cambio en la altura en las diferentes estaciones(26), lo cual, tiene una relación directa con el rendimiento de forraje(12), asociado con el hábito de crecimiento postrado del genotipo 255301(3). Es así que, la altura de la pradera da una idea del forraje producido(8). Por lo tanto, al calcular la equivalencia de los mayores rendimientos estacionales y de los tratamientos, por centímetro de altura de planta, se obtuvo que cada centímetro correspondió 167 kg MS ha-1, promedio de ambos periodos, para primavera y 144 kg MS ha-1, para el 95 % LI (POV1) y 192 kg , para el promedio de las intercepciones 90, 95 y 100 % del POV2.

Relación hoja:tallo

La relación promedio mayor de hoja:tallo se presentó en el corte fijo (P≤0.05), seguido de 90, 95 y 100 % de luz interceptada, en ambos periodos (Cuadro 4). En el POV1, el corte fijo superó 36 % al promedio de los tratamientos con 90, 95 y 100 % de luz interceptada (2.8 vs 1.8), mientras que en el POV2 este mismo tratamiento fue de 44 % respecto al 100 % de LI (3.2 vs 1.4). Esta relación hoja:tallo mayor en el corte fijo, fue el resultado de cosechas más frecuentes con 33 días promedio (Figura 2), lo cual no permitió que la especie fuese cosechada en su momento óptimo, sino, en la fase de crecimiento acelerado, donde se encuentra el mayor porcentaje de hojas jóvenes y poca cantidad de tallos(27). Así mismo, posterior al corte, la calidad y cantidad de luz incidente al interior de la pradera, es alterada por el intervalo de corte que causa variaciones en la producción de hojas y tallos y por tanto, en la relación hoja:tallo(10).

1096


Rev Mex Cienc Pecu 2020;11(4):1087-1100

Cuadro 4: Relación hoja:tallo de L. corniculatus, genotipo 255301, en función del porcentaje de luz interceptada y un corte fijo definido estacionalmente LI (%) Otoño Invierno Primavera Verano Promedio EEM POV1 90 2.5 Aa 2.0 Bab 1.7 Bb 1.5 Ab 1.9 B 0.2 95 1.9 Aa 2.3 Ba 1.5 Ba 1.4 Aa 1.8 B 0.3 100 2.1 Aa 2.2 Ba 1.8 Ba 1.8 Aa 1.8 B 0.2 Corte fijo 2.5 Ab 4.0 Aa 2.6 Ab 2.1 Ab 2.8 A 0.4 Promedio 2.3 ab 2.6 a 1.9 b 1.7 b 2.1 0.2 EEM 0.2 0.3 0.2 0.4 0.2 POV2 90 2.1 Ab 2.9 Ba 1.7 Bb 1.7 Bb 2.1 B 0.1 95 3.0 Aa 1.8 Cb 1.0 Cc 1.7 Bb 1.9 B 0.1 100 2.3 Aa 1.3 Cb 1.0 Cb 1.2 Cb 1.4 C 0.2 Corte fijo 2.9 Aa 3.7 Aa 3.4 Aa 2.7 Aa 3.2 A 0.3 Promedio 2.6 a 2.4 a 1.8 b 1.8 b 2.2 0.1 EEM 0.3 0.2 0.2 0.1 0.1 Corte fijo= otoño: 35, invierno: 42, y primavera –verano 28 días entre corte. POV1= periodo de otoño 2014verano 2015; POV2= periodo de otoño 2015-verano 2016. EEM= error estándar de la media. Promedios con letra mayúscula diferente en una columna y letra minúscula diferente en una hilera son diferentes (P0.05).

La relación hoja:tallo entre estaciones, fue mayor en invierno (P≤0.05), con 2.6 en el POV1, y 2.5 promedio de otoño e invierno en el POV2. En algunas especies forrajeras se ha encontrado una relación hoja:tallo mayor en estaciones donde el crecimiento de las plantas es menor (otoño e invierno), debido a una mayor densidad de tallos, pero de menor peso(27). En primavera y verano se registraron los menores valores, en ambos periodos (P≤0.05), resultado de un peso individual de tallos mayor(26), lo cual puede ser en respuesta a una translocación de asimilados mayor de las hojas hacia los tallos en estas estaciones(7).

Conclusiones e implicaciones Las estrategias de cosecha dependientes del porcentaje de luz interceptada tuvieron rendimientos de forraje y alturas de planta similares, marcando diferencia con el corte fijo definido estacionalmente, no obstante, esta última estrategia presentó mayor relación hoja:tallo, siendo la hoja, el componente morfológico que mayor aporte hizo al rendimiento de forraje en todos los tratamientos, principalmente cuando las parcelas fueron cosechadas con 95 % de luz interceptada.

1097


Rev Mex Cienc Pecu 2020;11(4):1087-1100

Literatura citada: 1. Lagler JC. Lotus: Un género que no acaba en dos especies. Rev Forrajes y Granos 2003;(62):72-76. 2. Escaray FJ, Menendez AB, Gárriz A, Pieckenstain FL, Estrella MJ, Castagno LN, et al. Ecological and agronomic importance of the plant genus Lotus. Its application ingrassland sustainability and the amelioration of constrained and contaminated soils. Plant Sci 2012;(182):121-133. 3. García BDV, Guerrero RJD, García DSG. Lagunes RSA. Rendimiento y calidad de forraje de genotipos de Lotus corniculatus L., en el Estado de México. Nova Scientia 2014;7(13):170-189. 4. Grant FW. Lotus corniculatus. Sci Topics. 2009. http://www.scitopics.com/ Lotus_corniculatus.html. Accessed Sep 30, 2017. 5. MacAdam JW, Bruner J, Islam A, Shewmaker G. The benefits of tannin-containing forages. Plants, Soils and Climate, Utah State University AG/Forages 2013;03. 6. Da Silva NIM, Lima DSA, De Moura ZA, Gonçalves DAJ, De Jesus FD, Buranelo TFL, et al. Morphogenetic and structure characteristics of marandu grass subjected to grazing management strategies. Biolog Rhythm Res 2017;929-1016. 7. Giacomini AA, Da-Silva CS, Sarmento DLDO, Zeferino VC, Souza JS, Da-Trindade KJ, et al. Growth of marandu palisadegrass subjected to strategies of intermittent stocking. Sci Agric Piracicaba 2009;66(6):733-741. 8. Parsons A, Rowarth J, Thornley J, Newton P. Primary production of grassalands, herbage accumulation and use, and impacts of climate change. In: Lemaire G, et al. editors. Grassland productivity and ecosystems services. CABI, 2011:1-18. 9. Da Silva SC, Hernández GA. Manejo del pastoreo en praderas tropicales. En: Velazco ZME et al. editores. Los forrajes y su impacto en el trópico. 1ra. ed. Chiapas, México: Universidad Autónoma de Chiapas; 2010:63-95. 10. Montagner DB, Nascimento-Jr D, Vilela HH, Sousa MLB, Euclides BVP, Da-Silva CS, et al. Tillering dynamics in pastures of guinea grass subjected to grazing severities under intermittent stocking. Rev Bras Zootec 2012;41(3):544-549. 11. Difante GS, Nascimento-Jr D, Da-Silva SC, Bautista EVP, De-Moura ZA, Adese B. Dinâmica do perfilhamento do capim-marandu cultivado em duas alturas e três intervalos de corte. Rev Bras Zootec 2008;37(2):89-196.

1098


Rev Mex Cienc Pecu 2020;11(4):1087-1100

12. Rojas GAR, Hernández GA, Joaquín CS, Maldonado PMA, Mendoza PSI, Álvarez VP, et al. Comportamiento productivo de cinco variedades de alfalfa. Rev Mex Cienc Agríc 2016;7(8):1855-1866. 13. Delgado R, Escalante J, Díaz R, Trinidad SA, Morales E, Sosa E. Defoliación en maíz y su efecto sobre el rendimiento de frijol-maíz en asociación. Rev Mex Cienc Agríc 2014;5(6):1015-1027. 14. García E. Modificación al sistema de clasificación climática de Köppen. 4ta ed. Instituto de Geografía, Universidad Autónoma de México; 2004. 15. Hakl J, Hrevusˇova´ Z, Hejcman M, Fuksa P. The use of a rising plate meter to evaluate lucerne (Medicago sativa L.) height as an important agronomic trait enabling yield estimation. Grass Forage Sci 2012;67:589-596. 16. SAS Institute. SAS/STAT® 9.2. User Guide Release. Cary, NC: SAS Institute Inc. USA. 2009. 17. Scheffer BMS, Brustolin R, Dall AM. Performance of Lotus corniculatus L. genotypes submitted to cutting interval: subsidies to a breeding program. Rev Bras Zootec 2011;40(8):1645-1650. 18. Sbrissia AF, Da-Silva CS, Sarmento DOL, Molan LK, Andrade MF, Goncalves CA, et al. Tillering dynamics in palisadegrass swards continuously stocked by cattle. Plant Eco 2010;(206):349-359. 19. Álvarez VP, Hernández GA, García DSG, Guerrero RJD, Mendoza PSI, Ortega CME, et al. Potencial forrajero de Lotus corniculatus L. con diferentes estrategias de manejo. Rev Agroproductividad 2018;11(5):24-28. 20. Álvarez VP, García DSG, Guerrero RJD, Mendoza PSI, Ortega CME, Hernández GA. Comportamiento productivo de Lotus corniculatus L. dependiente de la estrategia de cosecha. Rev Agrociencia 2018;52(8):1081-1093. 21. Mendoza PSI, Hernández GA, Pérez PJ, Quero CAR, Escalante EJAS, Zaragoza RJL, et al. Respuesta productiva de la alfalfa a diferentes frecuencias de corte. Rev Mex Cienc Pecu 2010;1(3):287-296. 22. Teixeira EI, Derrick JM, Hamish BB, Fletcher LA. The dynamics of lucerne (Medicago sativa L.) yield components in response to defoliation frequency. Eur J Agron 2007;(26):394-400. 23. Gomide AMC, Chavesb SC, Ribeiroc KG, Sollenbergerd EL, Paciulloa SCD, Pereirae TP, et al. Structural traits of elephant grass (Pennisetum purpureum Schum.) genotypes under rotational stocking strategies. Afr J Range Forage Sci 2014:1-7. 1099


Rev Mex Cienc Pecu 2020;11(4):1087-1100

24. Pereira JC, Gomes FK, Oliveira DBLM, Lara ASM, Bernardes TF, Casagrande DR. Defoliation management affects morphogenetic and structural characteristics of mixed pastures of brachiaria grass and forage peanut. Afr J Range Forage Sci 2017;34(1):1319. 25. Baguet HA y Bavera GA. Fisiología de la planta pastoreada. Facultad de Agronomía y Veterinaria. Universidad Nacional del Río Cuarto. Provincia de Córdoba,Argentina2001.http://www.produccionovina.com.ar/produccioymanejopastra s/pastoreosistemas/04fisiologia_de_la_planta_pastoreada.htm. Accessed Sep 10, 2017. 26. Villegas AY, Hernández GA, Pérez PJ, López CC, Herrera HJG, Enríquez QJF, et al. Patrones estacionales de crecimiento de dos variedades de alfalfa (Medicago sativa L.). Téc Pecu Méx 2004;42(2):145-158. 27. Barbosa RA, Nacimiento-Jr D, Vilela HH, Da-Silva CS, Batista-Euclides PV, Sbrissia FA, Da-Lana SB. Morphogenic and structural characteristics of guinea grass pastures submitted to three frequencies and two defoliation severities. Rev Bras Zootec 2011;(40):947-954.

1100


https://doi.org/10.22319/rmcp.v11i4.5301 Artículo

Presencia de la levadura Kodamaea ohmeri en escarabajos Aethina tumida (Coleoptera: Nitidulidae) colectados de colonias de abeja melífera africanizada en dos apiarios en Yucatán, México

Azucena Canto a* Luis A. Medina-Medina b Elisa Chan a Rosalina Rodríguez a

a

Centro de Investigación Científica de Yucatán AC. Unidad de Recursos Naturales, Calle 43, Num. 130, Colonia Chuburná de Hidalgo, Mérida, 97200, Yucatán, México. b

Universidad Autónoma de Yucatán, Facultad de Medicina Veterinaria y Zootecnia, Mérida, Yucatán, México.

* Autor de correspondencia: azucanto@cicy.mx

Resumen: Aethina tumida (Coleoptera: Nitidulidae), comúnmente conocido como el Pequeño Escarabajo de la Colmena (PEC), se está posicionando como una plaga importante en la industria apícola fuera de su rango de distribución natural. En México, informes recientes indican que el PEC está distribuido en toda la península de Yucatán. La invasión de las colonias de abeja melífera por el PEC está químicamente mediada por compuestos volátiles producidos por la levadura Kodamaea ohmeri, considerada un simbionte secundario del PEC. Se analizó la presencia de esta levadura en colonias de abeja melífera en Yucatán con base en la premisa de que los simbiontes se encuentran frecuentemente distribuidos junto con su huésped, por lo que la presencia de K. ohmeri en colmenas estaría fuertemente asociada con la presencia del PEC. En colonias manejadas de abeja melífera africanizada (AMA), se aislaron e identificaron levaduras asociadas con escarabajos adultos y los

1101


Rev Mex Cienc Pecu 2020;11(4):1101-1112

resultados muestran que el PEC junto con su levadura asociada, K. ohmeri, ha invadido colonias de AMA en Yucatán. También se reportó por primera vez la presencia de levaduras diferentes a K. ohmeri asociadas con el PEC en esta región geográfica. Palabras clave: Aethina tumida, Apis mellifera, Asociación escarabajo-levadura, Simbionte secundario, Kodamaea ohmeri, PEC, ADN ribosómico, Apicultura tropical.

Recibido: 26/03/2019 Aceptado: 23/09/2019

Introducción Aethina tumida Murray1867 (Coleoptera: Nitidulidae), comúnmente conocido como el Pequeño Escarabajo de la Colmena (PEC), es un parásito oportunista que invade los nidos de la abeja Apis mellifera y se está posicionando como una plaga importante en la industria apícola fuera de su rango de distribución natural. Las hembras del PEC proliferan dentro de las colonias de abeja melífera y sus larvas consumen el polen, la miel y las crías presentes en las colmenas, provocando la fermentación de la miel y el colapso de la colonia(1,2). El PEC se reportó por primera vez en México en 2007 en el estado de Coahuila(3), posteriormente se han reportado en otros estados, incluyendo Campeche, Michoacán, Jalisco, Quintana Roo, San Luis Potosí y Yucatán, que son los principales estados productores de miel(4). Los PEC se reportaron por primera vez en 2012 en apiarios ubicados al noreste del estado de Yucatán(5), y reportes recientes indican su presencia en toda la península de Yucatán(6). La invasión de adultos del PEC en colonias de abeja melífera parece estar mediada químicamente por compuestos volátiles producidos por la fermentación microbiana de las reservas de alimentos. Uno de los factores que predisponen la invasión del PEC en colonias de abejas es la asociación con la levadura fermentativa Kodamaea ohmeri(7,8). Esta levadura es un simbionte facultativo o secundario del PEC y se ha aislado del tubo digestivo de escarabajos adultos, huevos y larvas(7,9-11); se considera el principal factor responsable de la fermentación del alimento almacenado en las colonias y de producir los compuestos que atraen a otros escarabajos adultos(7,12,13). En esta interacción, los simbiontes ayudan al huésped a colonizar nuevos hábitats y a expandirse a nuevas áreas geográficas, ya que juegan un papel importante en la nutrición del insecto hospedero(14-17). Las levaduras proporcionan nutrientes esenciales, como esteroles, y producen químicos que atraen a los insectos dispersores y favorecen la migración dirigida a un nuevo ambiente(17). Es factible que los PEC adultos al colonizar nuevas colmenas y apiarios, transporten

1102


Rev Mex Cienc Pecu 2020;11(4):1101-1112

a la levadura K. ohmeri con ellos. El objetivo de este estudio fue analizar la presencia de levaduras, específicamente K. ohmeri, asociadas con el PEC adulto que invade colonias manejadas de abeja melífera africanizada en Yucatán. Con base en la premisa de que los simbiontes se distribuyen junto con su huésped, se asume que, en esta región, K. ohmeri se encuentra a menudo asociada con PEC adultos(15,16). Los resultados ayudarán a dilucidar la relación entre el PEC y sus levaduras asociadas y su impacto en colonias de abeja melífera, además de que, permitirán diseñar estrategias adecuadas para controlar esta plaga empleando levaduras simbióticas del PEC en ambientes de Neotrópico.

Material y métodos Este estudio se realizó en el periodo de febrero a julio de 2016 en colonias de A. mellifera africanizadas ubicadas en dos sitios diferentes en el estado de Yucatán, México. Un grupo de colonias se ubicó en el apiario experimental del Campus de Ciencias Biológicas y Agropecuarias de la Universidad Autónoma de Yucatán en el municipio de Mérida (20° 51' 51.62 "N; 89° 36' 45.35" O), el segundo grupo se ubicó en un apiario de propiedad privada en el municipio de Motul (21° 08′ 03″ N 89° 19′ 03″ O). Los apiarios contenían aproximadamente 30 colonias de abejas, de las cuales se seleccionaron aleatoriamente seis colonias para el muestreo. De cada colonia, fueron retirados todos los panales, la caja, tapa, fondo y alimentadores artificiales (alimentadores internos) de la colmena, y buscamos y se colectaron PEC adultos. Los escarabajos adultos fueron colectados del fondo de la colmena, los panales con cría y los alimentadores artificiales. En todos los lugares se observó un gran número de PEC. Cada escarabajo se colectó con pinzas esterilizadas en alcohol al 99% para evitar la contaminación entre escarabajos. Posteriormente, cada escarabajo se colocó en un frasco estéril con una tapa de rosca y se etiquetó conforme a la colonia de origen, el lugar dentro de la colmena y el número de espécimen. Los escarabajos adultos se identificaron morfológicamente conforme a los métodos estándar para la identificación a nivel de especie(18). En total, se colectaron 27 escarabajos adultos vivos (de 1 a 6 escarabajos por colonia). Para obtener las levaduras, cada escarabajo se colocó individualmente dentro de cajas con agar YPD (extracto de levadura, peptona y dextrosa) y se le permitió caminar libremente en toda la superficie de la caja con agar durante 40 min. No se esterilizó el exterior del escarabajo con alcohol, ni tampoco se enjuagó con agua estéril, esto con la finalidad de mantener al escarabajo vivo e imitar la forma natural de dispersión dentro de las colonias de la abeja melífera. A cada escarabajo se le permitió mordisquear y moverse libremente sobre la superficie del agar, imitando la forma en que los escarabajos diseminan la levadura cuando se mueven a través de los panales de abeja melífera. Este método aumenta la probabilidad de obtener levaduras de las piezas bucales y el sistema

1103


Rev Mex Cienc Pecu 2020;11(4):1101-1112

digestivo del escarabajo(15). Después de los 40 min de inoculación del agar, los escarabajos se sacrificaron y se almacenaron en alcohol al 70 %. Las cajas con agar se incubaron a 25 °C y se revisaron cada 24 h para detectar el crecimiento de levaduras. Se monitoreo el crecimiento de las colonias microbianas mediante la observación de cada placa en un estereoscopio a una magnificación de 50x. Para aislar y purificar las levaduras de las placas con agar, seleccionamos colonias de cada morfotipo y se colocaron individualmente en tubos Eppendorf con 600 µl de agua destilada estéril. Las colonias se resuspendieron y sembraron en una nueva caja con agar. Estas cajas se incubaron a 25 °C durante 5 días o hasta la aparición de crecimiento microbiano. Este procedimiento se realizó por duplicado para cada morfotipo observado en las cajas originales. Todos los morfotipos de levadura se almacenaron en la colección de levaduras del Centro de Investigación Científica de Yucatán (CICY). La identificación de las especies se realizó por medio de la secuenciación simétrica del dominio D1/D2 (nucleótidos 63-642 de Saccharomyces cerevisiae) de la subunidad grande (LSU, por sus siglas en inglés) del ribosoma, siguiendo los protocolos estándar de extracción de ADN(19,20). Para la extracción del ADN, las células se cultivaron durante aproximadamente 48 h en caldo YPD (3 g de extracto de levadura, 3 g de extracto de malta, 5 g de peptona y 10 g de glucosa por litro de agua destilada) en un agitador orbital a 100 rpm a 27 °C y se colectaron por centrifugación. La pastilla de células precipitadas se sumergió en nitrógeno líquido durante 10 min y se trituró en un mortero antes de colocarlo en un tubo estéril con 800 µl de solución amortiguadora (50 mM de Tris-HCl, 250 mM de NaCl, 50 mM de EDTA, 0.3 % de dodecilsulfato sódico). Se añadieron 20 µl de RNasa para limpiar las muestras, las cuales se calentaron en un termobloque a 65 °C durante 30 min y se agitaron suavemente cada 10 min. Posteriormente las muestras se enfriaron a 23 °C y se adicionaron 500 µl de cloroformo para extraer el ADN. Las muestras se centrifugaron a 1,300 rpm durante 10 min. Se recuperó el sobrenadante y se adicionaron 700 µl de isopropanol. Las muestras se mezclaron suavemente y centrifugaron durante 5 min para precipitar el ADN. La pastilla de ADN se recuperó y enjuagó con 500 µl de etanol al 70% y se centrifugó durante 5 min. Se desechó el sobrenadante y se secó el ADN durante 24 h a temperatura ambiente. Posteriormente, la pastilla se resuspendió en 70 µl del amortiguador TE (10 mM de Tris-HCl, 1 mM de EDTA [pH 7.4]). Las muestras de ADN se prepararon para la PCR empleando 5 µl (120-500 ng) de las muestras diluidas con 1 ml de TE 0.5X. Para verificar la extracción, se tomaron 5 µl (120-500 ng) del ADN y se realizó una electroforesis en gel de agarosa al 1 % empleando TBE (Tris-Borato-EDTA) 0.5X y una corriente de 100 V durante 15 min. A continuación, el ADN se cuantificó por espectrofotometría con un NanoDrop 2000 (ThermoFisher Scientific) y diluyó a 20 ng/μl para la PCR. La amplificación de la secuencia D1/D2 se realizó utilizando los iniciadores NL-1 (5´GCATATCAATAAGCGGAGGAAAAG-3´) y NL-4 (5´-GGTCCGTGTTTCAAGACGG-3´)(20) y siguiendo el protocolo de PCR: 95 °C durante 12 min seguidos de 40 ciclos de desnaturalización a 94 °C durante 15 s, alineación a 55 °C durante 10 s y extensión a 72 °C durante 20 s; con una

1104


Rev Mex Cienc Pecu 2020;11(4):1101-1112

extensión final de 5 min a 72 °C. El ADN amplificado se preparó para secuenciación con el kit BigDye® Terminator v3.1 Cycle Sequencing (Applied Biosystems) siguiendo las instrucciones del fabricante con los iniciadores NL-1 y NL-4. Las muestras se inyectaron individualmente para electroforesis en un Analizador de DNA ABI 3730xl (Applied Biosystems). Las secuencias se alinearon y ensamblaron, se obtuvo una secuencia consenso para cada cepa aislada de levadura usando el software bioinformático Geneious Pro 8.1.7 (Biomatters Ltd, Auckland, Nueva Zelanda). Se consultó la base de datos de nucleótidos GenBank utilizando la herramienta básica de búsqueda de alineación local (BLAST, por sus siglas en inglés)(21) para buscar especies de levadura con secuencias de DNA que coincidieran con nuestras cepas aisladas. Todas las secuencias produjeron correlaciones significativas con las levaduras en GenBank, con 98.8-100 % de cobertura e identidad. El grado de divergencia en la porción D1/D2 entre las secuencias de las cepas iasladas y las secuencias concordantes encontradas en GenBank no excedieron el 1%; por lo tanto, se consideraron secuencias coespecíficas(22). Las secuencias obtenidas en este estudio se depositaron en GenBank bajo los números de acceso mostrados en el Cuadro 1. Cuadro 1: Levaduras aisladas de PEC adultos colectados en colonias de la abeja africanizada Apis mellifera en apiarios de Yucatán, México Clave de Espécimen Colonia Número Especies de Sitio de cepa de de DF* de levadura colecta colección escarabajo abejas GenBank CICY 1 1 1

1 1 1

Kodamaea ohmeri Kodamaea ohmeri Meira argovae

2

2

Kodamaea ohmeri

2

2

Kodamaea ohmeri

2

2

Citeromyces siamensis

2

2

Kodamaea ohmeri

2

2

Kodamaea ohmeri

2

2

Citeromyces siamensis

3

2

Kodamaea ohmeri

3

2

Kodamaea ohmeri

3

2

Citeromyces siamensis

Panal con cría Panal con cría Panal con cría Alimentador artificial Alimentador artificial Alimentador artificial Alimentador artificial Alimentador artificial Alimentador artificial Alimentador artificial Alimentador artificial Alimentador artificial

1105

0 0 1

CICYRN1044 CICYRN1045 CICYRN1047

MF431846 MF431847 MF431848

0

CICYRN1048

MF431849

0

CICYRN1049

MF431850

0

CICYRN1050

MF431851

0

CICYRN1051

MF431852

0

CICYRN1052

MF431853

1

CICYRN1053

MF431854

0

CICYRN1054

MF431855

0

CICYRN1055

MF431856

0

CICYRN1056

MF431857


Rev Mex Cienc Pecu 2020;11(4):1101-1112

Alimentador 0 CICYRN1058 MF431858 artificial Alimentador 4 2 Citeromyces siamensis 0 CICYRN1059 MF431859 artificial Alimentador 5 2 Lachancea fermentati 0 CICYRN1060 MF431860 artificial 6 3 Kodamaea ohmeri Piso colmena 0 CICYRN1062 MF431861 Piso colmena 7 3 Kodamaea ohmeri 0 CICYRN1063 MF431862 Piso colmena 7 3 Kodamaea ohmeri 0 CICYRN1064 MF431863 Piso colmena 8 3 Kodamaea ohmeri 0 CICYRN1066 MF431864 Piso colmena 9 4 Kodamaea ohmeri 0 CICYRN1069 MF431865 Piso colmena 9 4 Kodamaea ohmeri 0 CICYRN1070 MF431866 Piso colmena 10 4 Kodamaea ohmeri 1 CICYRN1072 MF431867 Piso colmena 10 4 Kodamaea ohmeri 0 CICYRN1073 MF431868 Piso colmena 11 4 Kodamaea ohmeri 0 CICYRN1091 MF431869 Piso colmena 12 4 Kodamaea ohmeri 0 CICYRN1074 MF431870 Piso colmena 13 4 Kodamaea ohmeri 0 CICYRN1075 MF431871 Piso colmena 13 4 Kodamaea ohmeri 0 CICYRN1076 MF431872 Piso colmena 14 4 Kodamaea ohmeri 0 CICYRN1089 MF431873 Piso colmena 14 4 Kodamaea ohmeri 0 CICYRN1090 MF431874 Piso colmena 15 5 Kodamaea ohmeri 0 CICYRN1077 MF431875 Piso colmena 16 5 Kodamaea ohmeri 0 CICYRN1078 MF431876 Piso colmena 17 6 Kodamaea ohmeri 0 CICYRN1081 MF431877 Piso colmena 18 6 Kodamaea ohmeri 0 CICYRN1082 MF431878 Piso colmena 19 6 Kodamaea ohmeri 0 CICYRN1084 MF431879 Piso colmena 20 6 Kodamaea ohmeri 0 CICYRN1086 MF431880 Piso colmena 20 6 Kodamaea ohmeri 0 CICYRN1087 MF431881 Piso colmena 20 6 Kodamaea ohmeri 0 CICYRN1088 MF431882 * Diferencias de nucleótidos de ADNr entre el tipo de cepa de GenBank y el aislado conespecífico de este estudio. 3

2

Kodamaea ohmeri

Resultados Los escarabajos adultos de A. tumida se encontraron en todas las colonias de AMA examinadas, se encontraron principalmente en las pequeñas grietas del piso de la colmena. La presencia de levaduras se detectó en las placas con agar (cada una representativa de un solo escarabajo) después de cinco días de incubación. Se obtuvieron 37 cepas de 20 de los 27 escarabajos colectados, de las cuales se identificaron cuatro especies diferentes de levadura; tres de las cuales se reportaron asociadas a A. tumida por primera vez. La levadura identificada con mayor frecuencia fue K. ohmeri con 31 colonias aisladas, seguida de Citeromyces siamensis con cuatro colonias, Lachancea fermentati y Meira argovae con una colonia, respectivamente (Cuadro 1). Con respecto al lugar dentro de la colmena en donde se colectaron los especímenes, los PEC adultos encontrados en el piso de la colmena estaban asociados únicamente con K. ohmeri, mientras que los escarabajos

1106


Rev Mex Cienc Pecu 2020;11(4):1101-1112

colectados de los panales con cría estaban asociados con K. ohmeri y M. argovae. Los escarabajos colectados en los alimentadores artificiales estaban asociados con tres especies de levadura: K. ohmeri, C. siamensis y L. fermentati.

Discusión De las cuatro especies de levadura identificadas, solo K. ohmeri se puede considerar estrechamente asociada con el PEC(11). Esta levadura se aisló de la mayoría de los escarabajos colectados en la colmena, y se considera un simbionte secundario de A. tumida(7). Los resultados muestran que los simbiontes se encuentran distribuidos junto con su hospedero(15,16), y señalan que la invasión del PEC en apiarios de esta región mexicana ha generado la expansión y distribución de K. ohmeri a nuevas zonas en las que no se había detectado previamente. En cambio, las otras levaduras aisladas del PEC no se pueden definir como simbiontes y probablemente fueron adquiridas de forma externa por PEC adultos durante sus movimientos a través de los panales con cría, alimentadores y otras estructuras dentro de la colmena. Citeromyces siamensis, que pertenece al orden Saccharomycetales, es una levadura fermentativa asociada con alimentos altamente concentrados, como el calamar salado y la soya fermentada(23). En este estudio, se aisló a esta levadura de los escarabajos que se alimentaban del jarabe de sacarosa en los alimentadores artificiales y es probable que el escarabajo haya adquirido esta levadura de forma pasiva al alimentarse del jarabe. A diferencia de C. siamensis, L. fermentati (Saccharomycetales), otra levadura fermentativa, está asociada con el intestino de insectos como las moscas de la fruta y los neurópteros(24), y se ha aislado de una gran variedad de sustratos líquidos como jugo de fruta y fermentos de oliva y tequila(25). En este estudio, L. fermentati se aisló de un escarabajo que se encontraba en un alimentador artificial, lo que se considera una adquisición circunstancial. Meira argovae es un hongo basidiomiceto anamórfico tipo levadura de la clase Ustilaginomycetes que se ha reportado asociado con ácaros fitófagos(26) en vástagos de bambú(27). Es probable que Meira argovae tenga potencial para controlar estos ácaros en cultivos importantes ya que secreta sustancias antagónicas(28). M. argovae se aisló de un escarabajo colectado de un panal con cría de una colonia; por lo que, la adquisición de esta levadura por el PEC adulto pudo ocurrir cuando el escarabajo caminó a través de los panales con cría. Kodamaea ohmeri (Saccharomycetales, familia Metschnikowiaceae) fue la especie aislada con mayor frecuencia en nuestro estudio y también es la única especie aislada de forma repetida del material fermentado encontrado en colonias de A. mellifera infestadas con el PEC, y del cuerpo de los escarabajos(2,7,8,29). La importancia de la relación entre el PEC y K. ohmeri no es clara, aunque se ha demostrado que la presencia de K. ohmeri aumenta la capacidad de invasión y reproducción del escarabajo en colonias de A. mellifera(7,30), ya que esta levadura es responsable de producir

1107


Rev Mex Cienc Pecu 2020;11(4):1101-1112

componentes volátiles en el alimento, los cuales actúan como fuertes atrayentes para otros escarabajos(31). Los resultados muestran que el PEC asociado con la levadura K. ohmeri ha invadido colonias de A. mellifera en Yucatán, lo que sugiere que el impacto del escarabajo en colonias de A. mellifera en esta región puede aumentar debido a la presencia de K. ohmeri. Sin embargo, se requieren experimentos adicionales para comprobar la hipótesis de que la presencia de K. ohmeri en este estudio aumenta la capacidad del PEC de infestar apiarios. En Yucatán, A. mellifera africanizada tiene un comportamiento similar al de sus ancestros africanos, los cuales atrapan, encapsulan y confinan PEC adultos dentro de las grietas y hendiduras de la colmena, también retiran los huevos y larvas del escarabajo, evitando la fermentación del panal, la producción de químicos y la atracción de más escarabajos dentro de las colonias. Se ha propuesto utilizar a K. ohmeri para fermentar sustitutos de polen o polen como atrayente en trampas de escarabajo y así poder controlar al PEC en las colonias de abeja melífera. Además del uso de K. ohmeri como atrayente, también se requieren datos experimentales con C. siamensis, L. fermentati y M. argovae para explorar el papel de estas levaduras en la atracción de escarabajos. Aunque K. ohmeri no es exclusiva del PEC, ya que se ha asilado de nidos de abejorros como Bombus impatiens y Bombus pensylvanicus que no tienen PEC en sus colonias(12), es admisible asumir que el PEC es un dispersor activo de K. ohmeri y otras levaduras a nuevos recursos y hospederos(8,16).

Conclusiones e implicaciones Los resultados indican que el PEC se encuentra en apiarios africanizados en la región de Yucatán y que esta colonización también ha generado la dispersión de su simbionte facultativo K. ohmeri y de otras levaduras asociadas a alimentos e invertebrados (C. siamensis, L. fermentati y M. argovae) en sustratos no registrados previamente para estas levaduras, y por primera vez, en una región donde no se habían observado.

Agradecimientos A Matilde Margarita Ortiz García por su ayuda con los métodos de PCR.

1108


Rev Mex Cienc Pecu 2020;11(4):1101-1112

Financiamiento Está investigación recibió apoyo del Consejo Nacional de Ciencia y Tecnología a través del proyecto número 219922.

Declaración de divulgación Los autores no reportan un potencial conflicto de interés.

Literatura citada: 1.

Neumann P, Ellis JD. The small hive beetle (Aethina tumida Murray, Coleoptera: Nitidulidae): distribution, biology and control of an invasive species. J Apicult Res 2008;47(3):181-183.

2.

Neumann P, Pettis JS, Schäfer MO. Quo vadis Aethina tumida? Biology and control of small hive beetles. Apidologie 2016;47(3):427-466.

3.

Del Valle-Molina J. Informe de notificación inmediata. Small hive beetle infestation (Aethina tumida) in Mexico: Immediate notification report (Report No. OIE: 6397) OIE World Organization for Animal Health. 2007.

4.

SAGARPA. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Servicio de Información Agroalimentaria y Pesquera (SIAP). Avance de la producción pecuaria por producto, México. http://www.gob.mx/siap/acciones-y-programas/produccionpecuaria. Consultado 1 Dic, 2016.

5.

Galván-Hernández G. Nota informativa: Hallazgo de presencia de Aethina tumida (Pequeño Escarabajo de la Colmena: PEC) en flora silvestre en el estado de Yucatán en la periferia de un apiario negativo a PEC. Servicio de Sanidad, Inocuidad y Calidad Agroalimentaria. SAGARPA Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Mexico. 2013.

6.

Reyes-Escobar O, Dosal-Alonso E, Lara-Álvarez C, Lara-Álvarez LG, Dorantes-Ugalde JA, Saldaña-Loza LM. Lethal effect of boric acid and attractants against the small hive beetle, Aethina tumida Murray (Coleoptera: Nitidulidae). J Apicult Res 2016;(54):1-7.

7.

Benda ND, Boucias D, Torto B, Teal P. Detection and characterization of Kodamaea ohmeri associated with small hive beetle Aethina tumida infesting honey bee hives. J Apicult Res 2008;47(3):194-201.

1109


Rev Mex Cienc Pecu 2020;11(4):1101-1112

8.

Conklin TM. Investigations of small hive beetle-yeast associations [Doctoral dissertation]. Pennsylvania, USA: Pennsylvania State University; 2012.

9.

Torto B, Boucias DG, Arbogast RT, Tumlinson JH, Tea PEA. Multitrophic interaction facilitates parasite–host relationship between an invasive beetle and the honey bee. PNAS 2007;(104):8374-8378.

10. Leemon D. In-hive fungal biocontrol of small hive beetle. Brisbane Queensland, Australia: Rural Industries Research and Development Corporation; 2012. 11. Amos BA, Leemon D, Hayes RA, Cribb BW, Furlong MJ. Associations between the small hive beetle and the yeast Kodamaea ohmeri throughout the host life cycle. J Econom Entomol 2018;111(4):1501-1508. 12. Graham JR, Ellis JD, Carroll MJ, Teal P. Aethina tumida (Coleoptera: Nitidulidae) attraction to volatiles produced by Apis mellifera (Hymenoptera: Apidae) and Bombus impatiens (Hymenoptera: Apidae) colonies. Apidologie 2011;(42):326-336. 13. Neumann P, Hoffmann D, Duncan M, Spooner-Hart R, Pettis JS. Long-range dispersal of small hive beetles. J Apicult Res 2012;(51):214-215. 14. Ishikawa H. Insect Symbiosis: An Introduction. In: Bourtzis K, Miller TA, editors. Insect Symbiosis. Boca Raton, FL, USA: CRC Press; 2003:1-22. 15. Vega FE, Dowd PF. The role of yeasts as insect endosymbionts. In: Vega FE, Blackwell M, editors, Insect-fungal associations: ecology and evolution. Oxford, USA: Oxford University Press; 2005:211-243. 16. Henry LM, Peccoud J, Simon JC, Hadfield JD, Maiden MJC, Ferrari J, et al. Horizontally transmitted symbionts and host colonization of ecological niches. Curr Biol 2013;23(17):1713-1717. 17. Blackwell M. Made for each other: Ascomycete yeasts and insects. Microbiol Spectr 2017;5(3): FUNK-0081-2016. doi:10.1128/microbiolspec.FUNK-0081-2016. 18. Neumann P, Evans JD, Pettis JS, Pirk C. Schäfer MO, Tanner G, Ellis JD. Standard methods for small hive beetle research. J Apicult Res 2013;(52):1-32. 19. Tapia-Tussell R, Lappe P, Ulloa M, Quijano-Ramayo A, Cáceres-Farfán M, Larqué-Saavedra A, Perez-Brito D. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes. Mol Biotechnol 2006;(33):67-70.

1110


Rev Mex Cienc Pecu 2020;11(4):1101-1112

20. Kurtzman CP, Robnett CJ. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek, 1998;(73):331-371. 21. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25(17):3389-3402. 22. Peterson SW, Kurtzman CP. Ribosomal RNA sequence divergence among sibling species of yeasts. Syst Appl Microbiol 1991;(14):124-129. 23. Nagatsuka Y, Kawasaki H, Limtong S, Mikata K, Seki T. Citeromyces siamensis sp. nov., a novel halotolerant yeast isolated in Thailand. Int J Syst Evol Microbiol 2002;(52):2315-2319. 24. Nguyen NN, Suh S, Blackwell M. Five novel Candida species in insect-associated yeast clades isolated from Neuroptera and other insects. Mycologia 2007;(99):842-858. 25. Lachance MA, Kurtzman CP. Lachancea Kurtzman (2003). In: Kurtzman CP, Fell JW, Boekhout T. editors. The yeasts, a taxonomic study. London: Elsevier; 2011:511-520. 26. Boekhout T, Theelen B, Houbraken J, Robert V, Scorzetti G, Gafni A, et al. Novel anamorphic mite-associated fungi belonging to the Ustilaginomycetes: Meira geulakonigii gen. nov., sp. nov., Meira argovae sp. nov. and Acaromyces ingoldii gen. nov., sp. nov. Int J Syst Evol Microbiol 2003;(53):1655-1664. 27. Tanaka E, Shimizu K, Imanishi Y, Yasuda F, Tanaka C. Isolation of basidiomycetous anamorphic yeast-like fungus Meira argovae found on Japanese bamboo. Mycoscience 2008;(49):329-333. 28. Paz Z, Bilkis I, Gerson U, Kerem Z, Sztejnberg A. Argovin, a novel natural product secreted by the fungus Meira argovae, is antagonistic to mites. Entomol Exp Appl 2011;(140):247253. 29. Torto B, Fonbong A, Mutyabai DM, Muli E, Arbogast RT, Teal P. Aethina tumida (Coleoptera: Nitidulidae) and Oplostomus haroldi (Coleoptera: Scarabaeidae): occurrence in Kenya, distribution within honey bee colonies, and responses to host odors. Ann Entomol Soc Am 2010;(103):389-396. 30. Arbogast RT, Torto B, Willms S, Fombong AT, Duehl A, Teal P. Estimating reproductive success of Aethina tumida (Coleoptera: Nitidulidae) in honey bee colonies by trapping emigrating larvae. Environ Entomol 2012;41(1):152-158.

1111


Rev Mex Cienc Pecu 2020;11(4):1101-1112

31. Torto B, Arbogast RT, Alborn H, Suazo A, Engelsdorp D, Boucias D, et al. Composition of volatiles from fermenting pollen dough and attractiveness to the small hive beetle Aethina tumida, a parasite of the honeybee Apis mellifera. Apidologie 2007;(38):380-389. 32. Torto B, Arbogast RT, Engelsdorp DV, Willms S, Purcell D, Boucias D, et al. Trapping of Aethina tumida Murray (Coleoptera: Nitidulidae) from Apis mellifera L. (Hymenoptera: Apidae) colonies with an in-hive baited trap. Environ Entomol 2007;(36):1018-1024.

1112


https://doi.org/10.22319/rmcp.v11i4.5292 Artículo

Factores determinantes del uso de sorgo para alimentación de ganado bovino en el noroeste de México

Venancio Cuevas-Reyes a Blanca Isabel Sánchez Toledano b* Roselia Servín Juárez c Juan Esteban Reyes Jiménez d Alfredo Loaiza Meza d Tomas Moreno Gallegos d

a Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias (INIFAP). Campo Experimental Valle de México. Estado de México, México. b INIFAP. Campo Experimental Zacatecas, Zacatecas, México. c Colegio de Postgraduados Campus Córdoba, Córdoba, Veracruz, México. d INIFAP. Campo Experimental Valle de Culiacán, Sinaloa, México.

*Autor de correspondencia: sugammx@hotmail.com

Resumen: El objetivo del estudio fue analizar los factores que determinan el uso de variedades de polinización libre de sorgo en el norte del estado de Sinaloa, con la finalidad de caracterizar el tipo de productores que utilizan este tipo de semillas. Se utilizó un modelo de elección discreta para identificar los factores que inciden en la adopción de sorgo de 199 ganaderos. Posteriormente, a través de pruebas no paramétricas se caracterizaron los adoptadores (n= 11) y no adoptadores (n= 188) de la tecnología. Los resultados muestran que 5.5 % de los productores han adoptado variedades de sorgo. El número de años con asistencia técnica y

1113


Rev Mex Cienc Pecu 2020;11(4):1113-1125

la producción de leche resultaron significativas (P<0.05) para la adopción. En tanto, la caracterización de los ganaderos mostró que aquellos que cuentan con mayor cantidad de recursos: infraestructura, maquinaria, ganado, tierra, jornales y asistencia técnica, son los que adoptaron las variedades de sorgo. Se concluye que la adopción de semillas es baja y necesita de bienes públicos, como la extensión agrícola, para la difusión de sus beneficios que permita una mayor apropiación de los ganaderos en la región de estudio. Palabras clave: Forraje, Polinización libre, Adopción, Innovación tecnológica, Doble propósito, Probit.

Recibido: 14/03/2019 Aceptado: 06/09/2019

Introducción El sorgo es uno de los alimentos básicos para la población más pobre del mundo. Desde el punto de vista genético, este cultivo se adapta bien a zonas agroecológicas cálidas y secas en las que resulta difícil cultivar otros cereales. En muchas de esas zonas, tanto al grano como al forraje del sorgo se les concede un alto valor de uso(1). México es el segundo productor de sorgo en el mundo con una participación del 10 % de la producción mundial(2). En 2017, la superficie sembrada de sorgo en México fue de 1’456,330 ha, con una producción de 4’853,109 t. Dentro de los principales estados productores se encuentra Sinaloa, el cual ocupa el tercer lugar nacional en superficie sembrada con 109,382.59 ha(3). En el año 2017, en Sinaloa se cultivó 1 millón 149 mil 320 ha, de las cuales el cultivo de hortalizas ocupó el 6.18 % del total, los granos 67.52 %; oleaginosas 13.14 %; caña de azúcar 0.30 %; frutas 3.63 %; y, otros cultivos 9.24 %; el cultivo del sorgo representó el 14.10 % de la superficie sembrada en el estado(3). Las variedades de sorgo de mayor uso en Sinaloa son materiales de “polinización libre”: Costeño-201, Fortuna y Gavatero 203 del Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP) que han mostrado aceptación por los productores, y que al cosecharse se pueden utilizar para la siembra sin ser afectada la calidad genética del grano producido(4). A pesar de que el grano de sorgo es un importante alimento para animales, se le atribuye una “digestibilidad” baja respecto a otros cereales debido a la presencia de taninos condensados. Por lo general, los “taninos” se encuentran en granos de sorgo de color café,

1114


Rev Mex Cienc Pecu 2020;11(4):1113-1125

no así en sorgo de grano blanco, y escasamente en sorgo de grano rojo; en Sinaloa, la mayoría de las variedades de sorgo desarrolladas por el INIFAP son de grano blanco o crema(4). Estudios realizados sobre los factores que explican la baja adopción de variedades de semillas mejoradas identifican entre otros, la falta de adaptación de los materiales ofertados, la alta percepción del riesgo que conlleva su empleo al no conocer las ventajas de su uso en comparación con la usada por el productor, así como su deficiente distribución(5). Algunas de las variedades generadas por el INIFAP y que actualmente son demandadas por los productores son: gavatero 203, costeño 201, sinaloense y en menor medida perla 101(6,7,8,9). El sorgo gavatero 203 es el que ha tenido mayor aceptación por los productores; en el año 2016 se distribuyó semilla de esta variedad para la siembra de 70 mil ha de temporal en Sinaloa(10). El sorgo gavatero es de ciclo intermedio (61 días a la floración y 110 días a la cosecha), su grano es de color anaranjado rojizo, tiene un rendimiento de grano de 2,849 kg ha-1 y 35,367 kg ha-1 de forraje verde, además cuenta con 66.4 % de digestibilidad y 7.3 % de proteína(6). El éxito logrado de esta variedad radica en su consistencia y buen comportamiento en condiciones de temporal (350-600 mm) y la aceptación del forraje por el ganado bovino. Aunado a que en condiciones adversas (sequía), la variedad se muestra vigorosa en etapas tempranas de desarrollo y su semilla se puede producir en cualquier época del año. Para el caso de Sinaloa, la adopción de variedades de polinización libre de sorgo para ensilaje o forraje en utilización directa por el ganado bovino ha sido parcial y solo se ha avanzado en su uso en la zona centro y sur del estado, donde han sido realizadas las evaluaciones y demostraciones de siembra de este cultivo(6). El presente estudio tiene como objetivo analizar los factores que determinan el uso de variedades de polinización libre de sorgo en el norte del estado de Sinaloa con la finalidad de caracterizar el tipo de productores que utilizan este tipo de semillas.

Material y métodos Localización de la zona de estudio Sinaloa se ubica dentro de la planicie costera noroccidental, la cual a su vez colinda directamente con la Sierra Madre Occidental. Geográficamente se localiza al noroeste de la República Mexicana, colindando al norte con los estados de Sonora y Chihuahua, al este con Durango, al sur con Nayarit y al oeste con el Océano Pacífico y Golfo de California (Figura 1), limitado por las coordenadas extremas 22°31' y 26°56' N y ls 105°24' y 109°27' O del meridiano de Greenwich(11).

1115


Rev Mex Cienc Pecu 2020;11(4):1113-1125

Figura 1: Localización de la zona de estudio

Colecta de datos La información analizada proviene de una encuesta personal y cara a cara, realizada en 2015, a una muestra de 214 productores del sistema bovinos de doble propósito (PSBDP) en el trópico seco de Sinaloa. Las encuestas se realizaron en el norte de Sinaloa, región que cuenta con tres municipios con condiciones climatológicas y geográficas favorables para la producción de sorgo: Ahome, El Fuerte y Guasave. La selección de los productores se realizó por muestreo no probabilístico(12). Para ello, se utilizaron los siguientes criterios de inclusión: a) ser propietario de ganado, b) no haber participado en programas de extensión agrícola previamente y, c) estar de acuerdo en responder la encuesta de diagnóstico inicial de su unidad de producción ganadera. La encuesta consistió en recolectar datos de cada productor mediante un cuestionario con información estructurada en diez apartados, con preguntas de tipo cerrado y abierto, el cual se probó antes de su aplicación definitiva. Las variables incluidas en el cuestionario se dividieron en los siguientes apartados: 1) aspectos generales de la unidad productiva, 2) características sociales y económicas del productor, 3) tipo de propiedad de la superficie agrícola, 4) nivel de recursos disponibles (número de animales en posesión, tierras de uso agrícola, tierras de agostadero, fuentes de agua), 5) instalaciones disponibles (infraestructura, maquinaria y equipo), 6) aspectos sobre reproducción animal, 7) tipo de alimentación y suplementación del ganado, 8) aspectos relacionados con la sanidad pecuaria del hato, 9) aspectos relacionados con el manejo de ordeño y finalmente, 10) temas relacionadas con el mercado de productos pecuarios. En el análisis de la información se identificaron 15 encuestas con datos atípicos (por ejemplo, encuestas repetidas y datos fuera del promedio), por lo que solo fueron consideradas 199 encuestas con información confiable para el estudio. 1116


Rev Mex Cienc Pecu 2020;11(4):1113-1125

Esta encuesta fue parte de un proyecto que tenĂ­a como objetivo caracterizar los sistemas de producciĂłn pecuario en el norte de Sinaloa, los resultados de la caracterizaciĂłn, asĂ­ como la descripciĂłn y cĂĄlculo del Ă­ndice de infraestructura, maquinaria y equipo se describen en Cuevas-Reyes y Rosales-Nieto(13).

Modelo Probit El modelo Probit, es un modelo de elecciĂłn discreta, el cual se caracteriza porque la variable dependiente toma dos Ăşnicos valores; 0 y 1(14), que corresponden con cada una de las dos alternativas posibles (en este estudio: 1 adopta y 0 no adopta variedades de polinizaciĂłn libre de sorgo). El modelo utiliza una FunciĂłn de DistribuciĂłn Acumulativa (FDA) normal, de acuerdo a Gujarati(15) la decisiĂłn de elegir una alternativa depende de un Ă­ndice de conveniencia no observable đ??źđ?&#x2018;&#x2013; , determinado por una o diversas variables explicativas (Xi), el Ă­ndice Ii puede ser expresado de la forma siguiente: đ??źđ?&#x2018;&#x2013; = đ?&#x203A;˝0 + đ?&#x203A;˝đ?&#x2018;&#x2DC; đ?&#x2018;&#x2039;đ?&#x2018;&#x2013; . Con el supuesto de normalidad, la probabilidad (Pi ) de que đ??źđ?&#x2018;&#x2013;â&#x2C6;&#x2014; sea menor o igual que đ??źđ?&#x2018;&#x2013; se calcula a partir de la FDA normal estĂĄndar como:

Pi = P[Y = 1|X] = P(đ??źđ?&#x2018;&#x2013;â&#x2C6;&#x2014; â&#x2030;¤ đ??źđ?&#x2018;&#x2013; ) = P(đ?&#x2018;?đ?&#x2018;&#x2013; â&#x2030;¤ đ?&#x203A;˝0 + đ?&#x203A;˝đ?&#x2018;&#x2DC; đ?&#x2018;&#x2039;đ?&#x2018;&#x2013; ) = Ď&#x2022;(đ?&#x203A;˝0 + đ?&#x203A;˝đ?&#x2018;&#x2DC; đ?&#x2018;&#x2039;đ?&#x2018;&#x2013; )

(1)

En la cual, P[Y = 1|X] significa la probabilidad de que un suceso ocurra dado el valor de Xi, Zi es la variable normal estandarizada; es decir, đ?&#x2018;?đ?&#x2018;&#x2013; ~ N(0, đ?&#x153;&#x17D; 2 ) y Ď&#x2022;(Xi β) representa la distribuciĂłn acumulativa (FDA) de una variable normal estĂĄndar(15). Para obtener informaciĂłn sobre I, asĂ­ como đ?&#x203A;˝0 y đ?&#x203A;˝đ?&#x2018;&#x2DC; se toma la inversa de la ecuaciĂłn (1):

đ??źđ?&#x2018;&#x2013; = đ?&#x153;&#x2122; â&#x2C6;&#x2019;1 (đ??źđ?&#x2018;&#x2013; ) = đ?&#x153;&#x2122; â&#x2C6;&#x2019;1 (đ?&#x2018;&#x192;đ?&#x2018;&#x2013; ) = đ?&#x203A;˝0 + đ?&#x203A;˝đ?&#x2018;&#x2DC; đ?&#x2018;&#x2039;đ?&#x2018;&#x2DC;đ?&#x2018;&#x2013;

(2)

En la cual: Ii= variable dependiente dicotĂłmica que refleja la diferencia entre el uso y no uso de una tecnologĂ­a (1 si la adopciĂłn de la variedad de sorgo tiene lugar, 0 en caso contrario). đ?&#x153;&#x2122; â&#x2C6;&#x2019;1 es la inversa de la FDA normal. đ?&#x203A;˝0 = es una constante. đ?&#x203A;˝đ?&#x2018;&#x2DC; , k = 1, 2 ... n son los coeficientes de las variables independientes a estimar. Xki = vector de variables exĂłgenas que explican la adopciĂłn de las variedades de sorgo.

1117


Rev Mex Cienc Pecu 2020;11(4):1113-1125

Una vez estimado el modelo (1), si se toma la derivada parcial se obtiene(14): â&#x2C6;&#x201A;Ď&#x2022; â&#x2C6;&#x201A;đ?&#x2018;&#x2039;đ?&#x2018;&#x2DC;

= đ?&#x153;&#x2122;(đ?&#x2018;Ľđ?&#x2018;&#x2DC;đ?&#x2018;&#x2013; đ?&#x203A;˝)đ?&#x203A;˝đ?&#x2018;&#x2DC;

(3)

AsĂ­ la ecuaciĂłn (3) representa el efecto del cambio (probabilidad marginal) de una unidad de Xki, sobre la probabilidad de que I = 1. La estimaciĂłn del modelo se realizĂł mediante el mĂŠtodo de mĂĄxima verosimilitud, que proporciona estimadores consistentes y asintĂłticamente eficientes. Para contrastar la significancia individual de cada parĂĄmetro se utilizĂł el test de Wald, cuyo estadĂ­stico, z, sigue una distribuciĂłn normal tipificada. En cuanto a la evaluaciĂłn de la bondad global de los ajustes, se utilizĂł el R2 de McFadden, y el estadĂ­stico LR o razĂłn de verosimilitud. Los resultados del modelo economĂŠtrico se obtuvieron en el paquete Data Analysis and Statistical Software (Stata) versiĂłn 12. Una vez identificados los factores que determinan el uso de las variedades de sorgo, se procediĂł a caracterizar los productores que utilizan (o adoptan) las variedades de sorgo en comparaciĂłn con los productores que decidieron no adoptarlas. Para analizar los grupos identificados se utilizaron estadĂ­sticas descriptivas, para las variables ordinales se aplicĂł la prueba de Mann-Whitney, toda vez que al realizar la prueba de normalidad a las variables cuantitativas ĂŠstas no cumplieron con la prueba de normalidad (Kolmogorovâ&#x20AC;&#x201C;Smirnov) de datos (P<0.05), la informaciĂłn se procesĂł en el sistema de anĂĄlisis estadĂ­stico SPSSÂŽ versiĂłn 21 (IBM Corp).

Resultados y discusiĂłn Factores que determinan el uso de variedades de sorgo En el Cuadro 1 se muestran los resultados obtenidos del modelo probabilĂ­stico binario, el valor del Ji cuadrada se utilizĂł para el contraste de la significancia global del modelo; su hipĂłtesis nula es que todos los coeficientes de la ecuaciĂłn, excepto la constante, son nulos. El nĂşmero de casos correctamente clasificados fue de 96.98 %, el estadĂ­stico LR Ji2(9) fue de 40.04 y la probabilidad asociada fue menor a 0.05, por lo que se rechaza la hipĂłtesis nula, siendo de esta manera el modelo global estadĂ­sticamente significativo. El estadĂ­stico z aplicado a los coeficientes del modelo muestra que dos variables (asistencia tĂŠcnica y la producciĂłn de leche) fueron significativas (P<0.05) para explicar la probabilidad de adoptar variedades de sorgo en la regiĂłn de estudio.

1118


Rev Mex Cienc Pecu 2020;11(4):1113-1125

Cuadro 1: Variables que influyen en la probabilidad de adoptar variedades de sorgo Variable Coeficiente z P>z dy/dx Índice de maquinaria y equipo, % Índice de infraestructura, % Asistencia técnica, años Edad, años Escolaridad, años Distancia al municipio, km Número de vacas adultas Superficie agrícola, ha Producción de leche, L Constante

0.0057 0.0346 0.2149 -0.0167 -0.1470 -0.0073 0.0379 -0.0224 -0.0306 -1.6908

0.47 1.65 2.47 -0.91 -1.19 -0.28 1.42 -1.07 -2.46 -1.50

0.639 0.100 0.013* 0.361 0.234 0.779 0.155 0.238 0.014* 0.134

0.00008 0.0004 0.0030 -0.0002 -0.0020 -0.0001 0.0005 -0.0003 0.0004

dy/dx es el efecto marginal de la variable x sobre la variable dependiente y; Nivel de significancia dy/dx: P<0.05*. Numero de observaciones (n): 199. LR Ji2(9) =40.04; Prob >Ji2=0.0000; Pseudo R2=0.4706, Correctamente clasificados= 96.98 %.

Los efectos marginales de las variables significativas fueron pequeños, los PSBDP que cuentan con asistencia técnica tienen una probabilidad de 0.3 % de adoptar nuevas variedades de sorgo, en tanto, la probabilidad de adoptar esta tecnología para los productores que desean incursionar en la producción de leche apenas es del 0.04 %. Los resultados obtenidos en la variable de asistencia técnica en este estudio concuerdan con lo encontrado por otros autores(16-19), quienes señalan la existencia de una relación positiva de la asistencia técnica con la adopción o uso de tecnología. Un factor relevante en la adopción de nuevas variedades lo representa el precio de las semillas, el precio es un atributo extrínseco que afecta la decisión de compra del agricultor(20). En el caso del sorgo Gavatero 203 el precio de compra durante el 2018 fue de $12.00 por kg, el cual tuvo el mismo precio que la variedad comercial sorgo “milon” (generación F2 o F3 de híbridos forrajeros Silo Miel, Cow Vittles u otros) que utilizan los productores. No obstante, al comparar ambos tipos de sorgo se observó que el sorgo Gavatero presenta mejor calidad, con 90 % de semillas completas y viables, en comparación con 75 % del “milon”. Así mismo, cuenta con una mayor viabilidad de germinación (entre 85 y 90 %) en contraste con un 75 a 80 % de otros sorgos(4). Una ventaja adicional de las variedades de polinización libre es su bajo precio respecto a los híbridos de sorgo. Al respecto, en la región de estudio existen semillas de híbridos de sorgo para ensilaje cuyo precio de venta al productor es de alrededor de $63.00 pesos por kilo, este precio representa un 425 % más alto respecto al precio ($12.00 por kg) de las variedades de polinización libre recomendadas en la zona de estudio.

1119


Rev Mex Cienc Pecu 2020;11(4):1113-1125

Estudios realizados sobre la adopción de variedades de maíz generados por el INIFAP, encontraron en el estado de Veracruz que las variables asociadas con la decisión del productor de utilizar semilla fueron: la cercanía del lugar de compra, el conocimiento de las semillas del INIFAP y en menor grado, la preferencia por sembrar semilla mejorada en sustitución de la variedad criolla(21). Por otro lado, en la Península de Yucatán, a pesar de conocer las semillas mejoradas del INIFAP, el proceso de adopción se ve interrumpido por factores como la escasa disponibilidad de estas semillas en el mercado, o la falta de recurso económico por parte del productor para la adquisición de la semilla(22). Al igual que en Yucatán, uno de los factores que limita la adopción de sorgo en Sinaloa es la escasa disponibilidad y conocimiento de estos materiales por parte de los usuarios. Por lo que para mejorar la adopción se deben considerar los recursos disponibles y las decisiones de los productores(23), así como promover la reproducción de estas semillas a través de organizaciones de productores que cultiven u oferten más de un tipo de semilla y que reciban capacitación constante sobre tecnología de producción, beneficio, distribución, empaque y comercialización de variedades de polinización libre(24). La producción de sorgo para la alimentación del ganado en la región de estudio constituye una alternativa importante toda vez que al ser una variedad de polinización libre el mismo productor puede almacenar semilla para los siguientes ciclos. No obstante, para mantener su calidad genética se requiere de la producción controlada de este tipo de semillas. En la región de estudio la Fundación Produce Sinaloa es la única Institución que ha desarrollado un esquema de producción de algunas de las variedades de sorgo de polinización libre liberadas por el INIFAP, sin embargo, el mayor esfuerzo en la actualidad lo realizan productores individuales que por iniciativa y riesgo propio están incursionando en esta actividad para satisfacer la demanda de los PSBDP en todo el estado.

Caracterización de adoptadores y no adoptadores de variedades de sorgo

Los resultados obtenidos concuerdan con estudio previos que señalan que la adopción de variedades de polinización libre por parte de los productores es baja(5,21,22), al respecto, en el presente estudio solo 5.5 % de los productores adoptó nuevas variedades de sorgo. A continuación, se caracteriza a los productores adoptantes y no adoptantes en sus aspectos sociales, productivos y tipos de productos obtenidos.

1120


Rev Mex Cienc Pecu 2020;11(4):1113-1125

Aspectos sociales Las variables sociales analizadas entre el grupo de adoptadores y no adoptadores fueron iguales en ambos grupos (P>0.05), por lo que desde el punto de vista social son familias con características similares (Cuadro 2). Estos resultados difieren a lo encontrado por otros autores(25), quienes señalan que las características sociales son variables que diferencian a los usuarios de las innovaciones tecnológicas. Cuadro 2: Variables sociales entre adoptadores y no adoptadores (mediana) Variable Adoptadores No adoptadores P* Edad, años 55.0 47.5 0.497 Escolaridad, años 3.0 3.0 0.389 Dependientes mayores de 18 años, # 1.0 1.0 0.224 *U de Mann-Whitney.

Disponibilidad de recursos productivos En seis variables productivas se identificaron diferencias significativas (P<0.05) entre los adoptadores y no adoptadores: índice de infraestructura, índice de maquinaria y equipo, tipo de jornal utilizado; eventual o asalariado, número de unidades animal, superficie total agrícola y número de años que ha contado con asistencia técnica. Es decir, los productores que adoptan las semillas de sorgo tienen más recursos productivos (superficie agrícola, número de unidades animal), mayor infraestructura y equipo, y además cuentan con mano de obra asalariada y asistencia técnica (Cuadro 3). El mayor número de hectáreas lo tienen los adoptadores (mediana de 15 ha), en comparación con los no adoptadores (mediana de 8 ha); pareciera que la disponibilidad de tierra en conjunto con otros recursos productivos, hace menos adverso al riesgo al productor y con ello puede incursionar en la siembra de nuevas variedades. Cuadro 3: Variables productivas entre adoptadores y no adoptadores (mediana) No adoptadores Variable Índice de infraestructura, % Índice de maquinaria y equipo, % Jornal (0= eventual; 1=contratado) Total de vacas adultas, # Unidades animal, # Superficie agrícola, ha Asistencia técnica, años

Adoptadores 36.36 40.00 1.00 20.00 34.30 15.00 4.00

*U de Mann-Whitney. 1121

18.18 20.00 0.00 13.50 21.30 8.00 0.00

P* 0.000 0.006 0.010 0.102 0.027 0.029 0.000


Rev Mex Cienc Pecu 2020;11(4):1113-1125

La adopción tecnológica se asocia positivamente con mayor tamaño de las parcelas y mayores ingresos(26). Sin embargo, es normal que los agricultores suelan enfrentar cualquier innovación con incertidumbre y preconceptos sobre las afectaciones de las mismas(27). Los resultados obtenidos respecto a las variables tamaño de la finca y contacto con servicios de asistencia técnica coinciden con diversos estudios realizados sobre el uso de variedades de arroz y trigo con pequeños productores(28,29).

Tipos de productos obtenidos: leche y carne Las variables explicativas producción de leche resultó significativa al 1% (P=0.000) para los no adoptadores y al 5 % (P=0.005) para la producción de becerros en el grupo de adoptadores. Este resultado indica que el grupo de adoptadores de nuevas variedades de sorgo están inclinados a la producción de becerros. Los adoptadores tuvieron una mediana de 0 y los no adoptadores una mediana de 30 L de leche. En contraste, la producción de becerros en los adoptadores tuvo una mediana de 2 y los no adoptadores una mediana de 0. Parece ser entonces que el uso de nuevas variedades de sorgo tiene que ver con la posibilidad de contar con mayor cantidad de forraje para mejorar la producción de becerros para engorda. El uso de variedades de polinización libre de sorgo en la zona de estudio presenta diversas ventajas respecto a otros materiales e híbridos, entre las cuales se puede citar; 1) mejor rendimiento en grano y forraje, 2) bajo precio respecto a los sorgos comerciales, 3) produce aún bajo condiciones de sequía, 4) el productor puede “cosechar” su semilla para el siguiente ciclo de siembra. Sin embargo, las variedades son poco conocidas por los productores. En este sentido, Kaliba et al(30) mencionan que para lograr una mayor adopción de semillas de variedades de sorgo se necesita una vinculación entre la investigación, los servicios de extensión y los tomadores de decisión para promover tecnología agrícola apropiada de fácil acceso y actual a los productores que enfrentan restricciones de producción, mercado y acceso de información.

Conclusiones e implicaciones En la región de estudio solo 5.5 % de los productores decidieron utilizar variedades de polinización libre de sorgo como forraje para la alimentación del ganado. La asistencia técnica y la producción de leche fueron las variables que resultaron significativas para adoptar el uso de nuevas variedades de sorgo. Mediante la caracterización de los grupos analizados se pudo identificar que los productores que cuentan con asistencia técnica y mayor cantidad de recursos como tierra y ganado, tienen mayor disponibilidad a innovar con nuevas alternativas tecnológicas. Los resultados de la investigación permiten concluir que la adopción de variedades de polinización libre no es tan rápida debido a la poca disponibilidad de los nuevos materiales de sorgo, y a la falta de acciones de difusión y de transferencia de 1122


Rev Mex Cienc Pecu 2020;11(4):1113-1125

tecnología hacia los productores del sistema bovinos de doble propósito. Se requiere diseñar esquemas para la reproducción y difusión de semillas de sorgo de polinización libre, así como de otros bienes públicos, como la extensión agrícola, para que se pueda concretar la difusión y transferencia de estas innovaciones tecnológicas y lograr una mayor adopción por parte de los productores de ganado del norte de Sinaloa y en regiones con características y problemática similares.

Agradecimientos Al INIFAP por el financiamiento otorgado de la presente investigación. El cual se enmarca en el proyecto “Evaluación del proceso de capacitación agropecuaria y uso de la tecnología promovida en los programas integrales de capacitación 2015-2018”. Con número SIGI:14462132918

Literatura citada: 1. FAO. Organización de las Naciones Unidas para la Alimentación y la Agricultura. La economía del sorgo y del mijo en el mundo: hechos, tendencias y perspectivas. Italia, 1997. http://www.fao.org/3/w1808s/w1808s00.htm#Contents. Consultado 28 Feb, 2019. 2. FAOSTAT. Organización de las Naciones Unidas Para la Alimentación y la AgriculturaEstadísticas. 2019. http://faostat.fao.org. Consultado 5 Mar, 2019. 3. SIAP. Servicio de Información Agroalimentaria y Pesquera. Avances de Siembras y Cosechas por Estado y Año Agrícola. México. 2019. http:// www.gob.mx/siap. Consultado 6 Mar, 2019. 4. Palacios VO, Moreno GT, Loaiza MA, Reyes JJE, Medina ChS. Gavatero-203, Nueva variedad de sorgo forrajero para Sinaloa. INIFAP-CIRNO. Campo Experimental Valle de Culiacán. Folleto técnico No. 31. Culiacán, Sinaloa. 2009. 5. López PMA, García JC. Las industrias de la semilla de maíz en Brasil y México: desempeño anterior, problemas actuales y perspectivas para el futuro. Documento de Trabajo de Economía del CIMMYT 97-02. CIMYT. México. 1997. 6. Hernández ELA, Moreno GT, Loaiza MA, Reyes JJE. Gavatero-203, nueva variedad de sorgo forrajero para el estado de Sinaloa. Rev Mex Cienc Agric 2010;1(5):727-731. 7. Hernández ELA, Moreno GT, Loaiza MA, Reyes JJE. Sinaloense-202, nueva variedad de sorgo para el estado de Sinaloa. Rev Mex Cienc Agric 2010;1(5):733-737.

1123


Rev Mex Cienc Pecu 2020;11(4):1113-1125

8. Hernández ELA, Moreno GT, Loaiza MA, Reyes JJE. Perla-101: nueva variedad de sorgo para el estado de Sinaloa. Rev Mex Cienc Agric 2011;2(5):779-784. 9. Hernández ELA, Moreno GT, Loaiza MA, Reyes JJE. Costeño-201: nueva variedad de sorgo de temporal de doble propósito para Sinaloa. Rev Mex Cienc Agric 2011;2(5):785-790. 10. SENASICA. Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria. Reporta el Cesavesin rendimientos de 10 toneladas por hectárea de maíz durante las primeras trillas en el estado. México. 2016. http://sinavef.senasica.gob.mx/ALERTAS/inicio/pages/single.php?noticia=1531. Consultado 5 Mar, 2019. 11. INEGI. Instituto Nacional de Estadística y Geografía. Anuario estadístico y geográfico de Sinaloa 2017. México 2017. https://www.datatur.sectur.gob.mx/ITxEF_Docs/SIN_ANUARIO_PDF.pdf. Consultado 10 Ene, 2019. 12. Abascal FE, Grande El. Análisis de encuestas. España: Edit. ESIC; 2005. 13. Cuevas-Reyes V, Rosales-Nieto C. Caracterización del sistema bovino doble propósito en el noroeste de México: productores, recursos y problemática. Rev MVZ 2018;23(1):6448-6460. 14. Aldrich JH, Nelson FD. Linear Probability, Logit, and Probit Models. Newbury Park, California, USA: Sage Publications; 1984. 15. Gujarati DN, Porter DC. Econometría. México. McGraw Hill; 2010. 16. Galindo GG. Uso de Innovaciones en el grupo de ganaderos para la validación y transferencia de tecnología "Joachin", Veracruz, México. Terra 2001;(19):385-392. 17. McGinty MM, Swisher EM. Agroforestry adoption and maintenance: self-efficacy attitudes and socio-economic factors. Agrof Syst 2008;(73):99-108. 18. Solís D, Bravo-Ureta BE, Quiroga RE. Technical efficiency among peasant farmers participating in natural resource management programs in Central America. J Agric Econ 2009;60(1):202-219. 19. Cuevas RV, Baca MJ, Cervantes EF, Espinosa GJA, Aguilar AJ, Loaiza MA. Factores que determinan el uso de innovaciones tecnológicas en la ganadería de doble propósito en Sinaloa, México. Rev Mex Cienc Pecu 2013;4(1):31-46.

1124


Rev Mex Cienc Pecu 2020;11(4):1113-1125

20. Lockshin L, Jarvis W, D'Hauteville F, Perrouty J. Using simulations from discrete choice experiments to measure consumer sensitivity to brand, region, price, and awards in wine choice. Food Qual Prefer 2006;7(3-4):166-178. 21. Del Angel-Pérez A, Villagómez-Cortés J, Larqué-Saavedra B, Adame-García J, TapiaNaranjo C, Sangerman-Jarquin D, et al. Preferencias y percepciones asociadas con semilla mejorada de maíz según productores de Veracruz Central, México. Rev Mex Cienc Agric 2018;9(1):163-173. 22. Uzcanga PNG, Larqué SB, Del Ángel PAL, Rangel FMA, Cano GAJ. Preferencias de los agricultores por semillas mejoradas y nativas de maíz en la Península de Yucatán, México. Rev Mex Cienc Agric 2017;(5):1021-1033. 23. Sánchez-Toledano BI, Kallas Z, Gil JM. Importancia de los objetivos sociales, ambientales y económicos de los agricultores en la adopción de maíz mejorado en Chiapas, México. Rev Fac Cienc Agrar 2017;49(2):269-287. 24. Trejo HL, Gil MA, Sánchez HM, Carballo CA, López PA. Producción de semilla mejorada por organizaciones de agricultores caso "Productora de maíz teocintle". Rev Fitotec Mex 2004;27(1):93-100. 25. Sánchez-Toledano BI, Zegbe JA, Espinoza-Arellano JJ, Rumayor-Rodríguez AF. Adopción tecnológica de surcos-doble hilera con pileteo en cebada maltera. Trop Subtrop Agroecosyt 2017;20(1):25-33. 26. Chirwa, E. Adoption of fertilizer and hybrid seeds by smallholder maize farmers in Southern Malawi. Dev South Afr 2005;22(1):1-12. 27. Allub, L. Aversión al riesgo y adopción de innovaciones tecnológicas en pequeños productores rurales de zonas áridas: un enfoque causal. Est Soc 2001;(2):467-493. 28. Hagos H, Ndemo E, Yosuf, J. Factors affecting adoption of upland rice in Tselemti district, northern Ethiopia. Agric & Food Secur 2018;7-59. 29. Chandio AA, Yuansheng J. Factors influencing the adoption of improved wheat varieties by rural households in Sindh, Pakistan. AIMS Agri Food 2018;3(3): 216-228. 30. Kaliba AR, Mazvimavi K, Gregory TL, Mgonja FM, Mgonja, M. Factors affecting adoption of improved sorghum varieties in Tanzania under information and capital constraints. Agric Econ 2018;6-18.

1125


1126

https://doi.org/10.22319/rmcp.v11i4.5344 Artículo

Mejoramiento genético de la biomasa aérea y sus componentes en alfalfa: selección familial de medios hermanos

Milton Javier Luna-Guerrero a Cándido López-Castañeda a* Alfonso Hernández-Garay a†

a

Colegio de Postgraduados. Postgrado en Recursos Genéticos y Productividad. Carretera México-Texcoco km. 36.5, Montecillo, Texcoco, Estado de México, México.

*Autor de correspondencia: clc@colpos.mx

Resumen: Se estudió la variación genética en biomasa aérea (BM) o rendimiento de materia seca (RMS) y sus componentes en 400 familias de medios hermanos (FMH) de alfalfa, derivadas de las cruzas directa (CD, San Miguel x Oaxaca) y recíproca (CR, Oaxaca x San Miguel), y las variedades originales (SM, San Miguel y O, Oaxaca). El experimento se realizó en macetas en condiciones de intemperie en Montecillo, Texcoco, Estado de México, México. Se hicieron cortes de plantas completas a 5 cm de altura, cada cinco semanas en otoño-invierno 2014-2015 y cada cuatro semanas en primavera-verano 2015. El RMS, TAC (tasa absoluta de crecimiento), EUR (eficiencia en el uso de la radiación), NT (número de tallos por planta) y AP (altura de planta) fueron 32, 31, 32, 6 y 36 % más altos en la CD, y el RMS, TAC, EUR y AP fueron 30, 28, 30 y 34 % más altos en la CR que la media de SM y O. La selección permitió identificar 13 y 17 % de FMH sobresalientes en RMS y sus componentes en las CD y CR. El RMS de las FMH sobresalientes de la CD fue 11 % mayor que el RMS de las FMH sobresalientes de la CR, indicando la presencia de efectos genéticos maternos. Palabras clave: Efectos genéticos maternos, Heredabilidad, Selección, Materia seca.

Recibido: 16/04/2019 Aceptado: 27/09/2019 1126


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

Introducción La alfalfa (Medicago sativa L.) es una especie polimórfica con amplia variabilidad genética que se adapta a diversas condiciones de suelo y clima. La herencia en alfalfa es compleja en gran parte debido a la naturaleza autotetraploide de la meiosis; esta especie produce un gameto diploide (2n= 32), característica genética que afecta profundamente su comportamiento fenotípico. La alfalfa es una especie alógama que depende de los insectos para la polinización y produce algunas plantas autoestériles o autoincompatibles, y en menor proporción, plantas que producen polen y óvulos estériles(1). La selección de nuevas variedades de alfalfa tiene como objetivo primario maximizar el rendimiento de forraje con valor nutritivo óptimo, sin compuestos detrimentales de la calidad y con alta persistencia en campo, y con un uso mínimo de fertilizantes, pesticidas o herbicidas(2). La calidad del forraje rara vez se ha incluido en los programas de selección, sin embargo, dada su importancia en la producción pecuaria hay interés en la obtención de cultivares con alta calidad de forraje(3). La relación hoja:tallo es un indicador de la calidad de forraje debido a su relación positiva con la digestibilidad y el consumo de forraje(4), que resultan de una mayor digestibilidad de las hojas con relación a los tallos(5). La selección por alto rendimiento y alta calidad del forraje, al utilizar a la acumulación de materia seca en los órganos aéreos de la planta y la relación hoja:tallo, podría facilitar la identificación de genotipos superiores en rendimiento y calidad del forraje en una plataforma de fenotipado en condiciones controladas. La complejidad de los mecanismos hereditarios de la alfalfa y su naturaleza autotetraploide hacen difícil elegir el mejor método de selección. Sin embargo, la selección individual a diferencia de la selección inter o intrapoblacional, permite identificar alelos de caracteres genéticos individuales en el fenotipo con mayor facilidad que los métodos de selección poblacional, donde el flujo de genes de una población a otra es abierto y menos controlado, además de requerir un gran número de plantas y tener menores frecuencias de genes favorables(6). La selección de familias o selección familial permite evaluar el genotipo de cada planta; se cosecha la semilla de las plantas seleccionadas en una población de polinización abierta o policruza; la semilla de cada planta seleccionada se conserva por separado y se siembra en pruebas de progenie replicadas; las peores familias se eliminan y las mejores familias se cruzan entre sí, para permitir la recombinación y la producción de generaciones subsecuentes(6). En alfalfa la amplia variabilidad en rendimiento y sus componentes, debido a su naturaleza polimórfica, ofrecen grandes oportunidades para la selección. Sin embargo, aunque la selección por rendimiento de forraje es favorecida por la gran variabilidad genética que posee la alfalfa, en algunos casos su expresión en el fenotipo, puede ser inhibida por una baja heredabilidad como consecuencia de efectos genéticos noaditivos(3). En alfalfa el alto impacto de la variación genética no-aditiva en el rendimiento de forraje se atribuye a la alta interacción intra-locus, debida a la autotetraploidia (la cual 1127


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

incluye también interacciones tri y tetra-alélicas), así como interacciones de genes complementarios que involucran alelos favorables con efectos aditivos en bloques de ligamiento(7). Al eliminar los efectos genéticos no-aditivos, la evaluación se basa en efectos aditivos y por lo tanto en efectos genéticos heredables, que se pueden manifestar en genotipos altamente productivos con alelos aditivos superiores(2,8,9). No obstante, la complejidad de la herencia genética, la selección también se podría llevar a cabo con diferentes estrategias como son: las pruebas de paternidad en germoplasma diverso, la introgresión de caracteres cuantitativos y la selección genómica(10). En México, el germoplasma en uso comercial incluye variedades tradicionales de baja productividad y variedades nuevas, generalmente introducidas, las cuales tienen baja adaptación y persistencia en campo. Los nuevos retos que plantean el cambio climático y la mayor demanda de forraje de alta calidad, requieren la obtención de nuevo germoplasma con mayor adaptación a ambientes con estrés, productividad, calidad de forraje y durabilidad en condiciones de campo. El presente estudio tuvo como objetivo evaluar la variabilidad en biomasa aérea o rendimiento de materia seca y sus componentes en 400 familias de medios hermanos, derivadas de las poblaciones segregantes San Miguel x Oaxaca y Oaxaca x San Miguel, y las poblaciones originales San Miguel y Oaxaca, para realizar el primer ciclo de selección familial en macetas en condiciones de intemperie.

Material y métodos Localización El experimento se realizó en macetas de plástico en los ciclos otoño-invierno 2014-2015 y primavera-verano 2015, en el Colegio de Postgraduados, Texcoco, Estado de México (19° 29’ N, 98° 54’ O y 2,250 msnm). El clima es templado subhúmedo (Cb(wo)(w)(i´)g), con lluvias en verano, media anual de 637 mm de precipitación y 15 °C de temperatura(11).

Material vegetal Se utilizaron 200 familias de medios hermanos (FMH) derivadas de las variedades comerciales San Miguel y Oaxaca (Semilla certificada obtenida de Casa Cobos S.A. de C.V., Central de Abastos, Ciudad de México, México) y 200 FMH derivadas de las poblaciones segregantes San Miguel (progenitor femenino) x Oaxaca (progenitor masculino) (cruza directa) y Oaxaca (progenitor femenino) x San Miguel (progenitor masculino) (cruza recíproca). La semilla de las poblaciones segregantes se obtuvo por cruzamiento genético entre las variedades San Miguel y Oaxaca (cruza directa) y Oaxaca y San Miguel (cruza recíproca), mediante la utilización de insectos polinizadores (abejas) en condiciones de campo (Figura 1). Las variedades San Miguel y Oaxaca, se eligieron para los cruzamientos en virtud de su notoria durabilidad mostrada en condiciones de campo, en un experimento establecido para el estudio del comportamiento productivo de 1128


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

cinco variedades comerciales de alfalfa (San Miguel, Oaxaca, Moapa, Valenciana y Cuf101) en el mes de marzo del año 2000(12) y conducido hasta el ciclo invierno-primavera2006 en el Colegio de Postgraduados, Montecillo, Texcoco, Estado de México. Figura 1: Sistema de cruzamiento genético entre dos variedades de alfalfa con la utilización de insectos polinizadores en condiciones de campo. Montecillo, Municipio de Texcoco, Edo. de México

La producción de la semilla tuvo lugar en el periodo de enero a mayo de 2006. La semilla producida se cosechó en conjunto de todas las plantas presentes en la población de cada cruza y se utilizó para establecer el primer ciclo de selección familial(6). Se utilizó una caja de unicel para almacigo con 100 celdas para cada población. Se sembraron cinco semillas del mismo tamaño en cada celda. El suelo utilizado fue de textura franco-arenosa, con 41.6 % de capacidad de campo (CC), 28.2 % de marchitamiento permanente (PMP), 9.3 % de materia orgánica, 0.019 % de nitrógeno, 4.8 ppm de fósforo, 4 mmol L-1 de potasio, 1.5 dSm-1 de conductividad eléctrica y pH de 6.9. La siembra se realizó el día 6 de junio del 2014; cuando las plántulas presentaron la primera hoja trifoliada (15 días después de la siembra, dds), se eligió la plántula más vigorosa de cada celda y se trasplantó en una maceta de plástico con capacidad de 3 kg de suelo. Las FMH de cada población se asignaron aleatoriamente a las macetas de plástico en un diseño completamente al azar. Se fertilizó con la dosis 60-140-00 a los 15 y 240 dds, con urea como fuente de nitrógeno y superfosfato de calcio triple como fuente de fósforo. Se efectuó un corte de uniformización en las plantas a los 98 dds. Cada tercer día se aplicó agua, manteniendo la humedad edáfica cercana a CC durante el experimento.

1129


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

Variables Cada cinco semanas se realizaron cortes en el periodo otoño-invierno 2014-2015 y cada cuatro semanas en primavera-verano 2015 a partir del día 98; los cortes se hicieron a una altura de 5 cm sobre el nivel del suelo. La composición morfológica de la planta se evaluó en una submuestra de cuatro tallos secundarios completos de cada planta y corte en todas las FMH, separando las hojas (foliolos y peciolos) y tallos; la submuestra y el resto de los tallos secundarios de la planta se secaron a 65 °C hasta peso constante y posteriormente se obtuvo el peso. La altura de planta (AP, cm) se midió en todas las FMH antes del corte con una regla de madera de 1 m de longitud (graduada en cm) desde la superficie del suelo hasta el ápice del tallo. El número de tallos secundarios (NT) por planta se determinó en cada corte en todas las FMH. El rendimiento de materia seca (RMS, g de MS planta-1) o biomasa aérea se obtuvo al sumar el peso seco de la submuestra de los cuatro tallos y el peso seco del resto de la planta. La relación hoja:tallo (H:T) se calculó con los datos de peso seco de las hojas (PSH) y el peso seco de los tallos secundarios (PST) (H:T = PSH / PST). La tasa absoluta de crecimiento (TAC, g de MS planta-1 día-1) se calculó al dividir el RMS entre el número de días (t) transcurrido entre un corte y el siguiente (TAC = RMS/t). La eficiencia en el uso de la radiación (EUR, g de MS MJ-1) se calculó al dividir el RMS entre la cantidad de radiación fotosintéticamente activa (RFA, MJ m-2 d-1) acumulada (RFA= radiación global incidente (cal cm-2 d-1) x 0.5 x 0.04148) entre un corte y el siguiente (EUR= RMS / RFA)(13); los datos de radiación global incidente se obtuvieron de la estación meteorológica de la Universidad Autónoma Chapingo, Chapingo, Estado de México, localizada a 4 km de distancia del lugar en el que se realizó el experimento.

Temperatura del aire y lluvia Los datos de temperatura máxima (TM) y mínima (Tm) del aire se registraron diariamente a las 0800 h con un termómetro de máxima y mínima, marca Taylor modelo 5458P, colocado a una altura de 2 m sobre el nivel piso. La TM varió de 23.5 a 29.9 °C y la Tm de 4.0 a 12.6 °C durante el experimento. Los datos diarios de lluvia se determinaron con un pluviómetro de acumulación semanal, colocado junto a las plantas; la precipitación pluvial total fue 1,042 mm con los niveles más bajos en el periodo de noviembre 2014 a enero 2015, sin que esto haya tenido efectos desfavorables en el crecimiento de las plantas, al aplicarse riego conforme fue necesario.

Análisis estadístico El análisis de varianza para todas las variables medidas se hizo con el programa SAS para Windows, Versión 9.1(14) y el modelo estadístico: Yijk = µ + Pobi + Fam(Pob)ik + Cortej + (Pob*Corte)ij + Corte*Fam(Pob)ijk + Eijk; Donde: 1130


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

Yijk representa el valor de la variable de respuesta en la población i del nivel de corte j y nivel k de FMH; µ es la media general, Pobi es el efecto de la Población al nivel i = 1, 2, 3 y 4; Fam(Pob)ik es el efecto de familias de medios hermanos anidadas a las poblaciones al nivel i y k; Cortej es el efecto de la fecha de corte al nivel j = 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 y 11; (Pob*Corte)ij es el efecto de la interacción Población x Corte al nivel i y j; Corte*Fam(Pob)ijk es el efecto de la interacción Corte x FMH anidadas a las poblaciones al nivel i, j, k; Eijk es el error experimental. El componente Corte*Fam(Pob)ijk, no se pudo separar del error, debido a que no hubo una fuente de variación para repeticiones en el análisis de varianza.

Efectos genéticos y ambientales Los efectos genéticos y ambientales se calcularon a través de la varianza fenotípica (𝜎𝑓2 ) y sus componentes varianza genética (𝜎𝑔2 ) y varianza ambiental (𝜎𝑒2 ), donde la varianza total o fenotípica es la suma de 𝜎𝑔2 y 𝜎𝑒2 (𝜎𝑓2 = 𝜎𝑔2 + 𝜎𝑒2 )(15). Las varianzas se estimaron con los cuadrados medios de cada población de acuerdo al análisis de varianza obtenido con el modelo estadístico; Yijk = µ + Fam(Poblaciones)ij + Eijk; donde Yijk representa el valor de la variable de respuesta en la población i del nivel j de FMH; µ es la media general; Fam(Poblaciones)ij es el efecto de las FMH anidadas a las poblaciones al nivel i, j y Eijk es el error experimental. También, se estimó la heredabilidad en sentido amplio (h2b = 𝜎𝑔2 / 𝜎𝑓2 = 𝜎𝑔2 /(𝜎𝑔2 + 𝜎𝑒2 ))(15,16). Las FMH estadísticamente superiores se seleccionaron en las poblaciones segregantes, al utilizar el valor de la intensidad de selección (i= D / f), calculada como el cociente entre el diferencial de selección estandarizado (D) y la desviación estándar fenotípica (f)(15), y el valor de la proporción seleccionada o presión de selección (p)(15,17)..

Resultados y discusión Parámetros de selección La selección familial aumentó 32, 31, 32, 6 y 36 %, el RMS, TAC, EUR, NT y AP en la población San Miguel x Oaxaca, y 30, 28, 30 y 34 % el RMS, TAC, EUR y AP en Oaxaca x San Miguel con respecto a la media de los progenitores, mientras que la relación H:T disminuyó 48 % en San Miguel x Oaxaca y 51 % en Oaxaca x San Miguel (Cuadro 1). La ganancia en RMS obtenida en el presente estudio fue mayor que la reportada con pruebas de progenie; las FMH y FHC (familias de hermanos completos) derivadas de polinización abierta (OP1) de una cruza dialélica (F1) produjeron sólo 8 y 9 % mayor rendimiento de materia verde, y 5 y 12 % mayor número de tallos por planta que las 1131


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

variedades originales(18). Los resultados de selección familial contra selección masal en alfalfa han indicado porcentajes similares para RMS (16 y 14 %) y fibra cruda (-1.6 vs. -1.5 %)(19). Cuadro 1. Parámetros de selección y cálculo de la presión de selección (p) para el rendimiento de materia seca (RMS), tasa absoluta de crecimiento (TAC), eficiencia en el uso de la radiación (EUR), relación hoja:tallo (H:T), número de tallos (NT) y altura de planta (AP) en dos poblaciones segregantes. Ciclo 2014-2015 Variables Poblaciones µ1 µ2 D i p f San Miguel x Oaxaca 8.03 5.45 2.58 1.58 1.63 13 % RMS (g de MS planta-1) Oaxaca x San Miguel 7.78 5.45 2.33 1.58 1.47 17 % San Miguel x Oaxaca 0.26 0.18 0.08 0.05 1.6 13 % TAC (g MS planta-1 día-1) Oaxaca x San Miguel 0.25 0.18 0.07 0.05 1.4 17 % San Miguel x Oaxaca 0.84 0.57 0.27 0.17 1.59 13 % EUR (g de MS MJ-1) Oaxaca x San Miguel 0.81 0.57 0.24 0.17 1.41 17 % San Miguel x Oaxaca 0.97 1.44 -0.47 0.21 -2.24 H:T Oaxaca x San Miguel 0.95 1.44 -0.49 0.21 -2.33 San Miguel x Oaxaca 18 17 1 5.05 0.2 NT Oaxaca x San Miguel 17 17 0 5.05 0 San Miguel x Oaxaca 58 37 21 5.08 4.13 AP (cm) Oaxaca x San Miguel 56 37 19 5.08 3.74 µ1= media de las 100 FMH derivadas de San Miguel x Oaxaca y Oaxaca x San Miguel; µ2 = media de las 200 FMH derivadas de las variedades originales San Miguel y Oaxaca; D = diferencial de selección; f = desviación estándar fenotípica, i = intensidad de selección; p = presión de selección.

Los valores obtenidos para los parámetros de selección (D, f, i y p) permitieron detectar que el 13 % de las FMH derivadas de San Miguel x Oaxaca, y 17 % de las FMH derivadas de Oaxaca x San Miguel tuvieron mayor RMS, TAC y EUR por planta que el resto de las FMH (Cuadro 1). La media (µ1) de RMS, TAC y EUR para las 13 FMH derivadas de San Miguel x Oaxaca y las 17 FMH derivadas de Oaxaca x San Miguel fue mayor que la media (µ2) de las FMH derivadas de las variedades originales San Miguel y Oaxaca. En contraste la relación H:T, número de tallos y altura de planta mostraron un comportamiento diferente al RMS; la media de la relación H:T de las FMH derivadas de San Miguel x Oaxaca y Oaxaca x San Miguel fue menor que la media de San Miguel y Oaxaca; la media del NT de las FMH de San Miguel x Oaxaca fue mayor que la media de San Miguel y Oaxaca, y el NT en Oaxaca x San Miguel fue similar a la media de San Miguel y Oaxaca; la media de AP de las FMH derivadas de las dos poblaciones segregantes fue mucho mayor que la media de San Miguel y Oaxaca (Cuadro 1). La selección individual intrapoblacional es efectiva en la identificación de genotipos superiores, utilizando la prueba de progenies(6). Los altos valores promedio de la relación H:T, NT y AP observadas en las poblaciones segregantes, no permitió detectar FMH sobresalientes para estas características de la planta (Cuadro 1).

1132


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

Rendimiento de materia seca y sus componentes

El análisis de varianza detectó 13 FMH sobresalientes por su RMS, TAC y EUR en la población San Miguel x Oaxaca (Cuadro 2) y 17 FMH en la población Oaxaca x San Miguel (Cuadro 3); se presentan también datos para las cinco familias con el más bajo RMS en estas poblaciones (Cuadros 2 y 3). Las 13 FMH sobresalientes de la población San Miguel x Oaxaca produjeron 53 % mayor RMS que el promedio de las variedades originales, y 82 % mayor RMS que la media de las FMH de más bajo rendimiento (Cuadro 2), mientras las FMH sobresalientes derivadas de la población Oaxaca x San Miguel produjeron 47 y 68 % mayor RMS que la media de las variedades originales y la media de las familias de más bajo rendimiento (Cuadro 3). Cuadro 2: Rendimiento de materia seca (RMS), tasa absoluta de crecimiento (TAC) y eficiencia en el uso de la radiación (EUR), para las FMH estadísticamente superiores y las cinco FMH con más bajo rendimiento derivadas de San Miguel x Oaxaca, en promedio de 11 cortes sucesivos. Ciclo 2014-2015 RMS TAC EUR Número de Genealogía familia FMH estadísticamente superiores 282

Familia-82

13.8

0.45

1.45

264

Familia-64

12.1

0.39

1.26

268

Familia-68

11.9

0.39

1.22

260

Familia-60

11.7

0.38

1.22

212

Familia-12

11.7

0.38

1.21

201

Familia-1

11.6

0.38

1.21

253

Familia-53

11.2

0.36

1.17

300

Familia-100

11.1

0.36

1.16

248

Familia-48

10.9

0.36

1.14

252

Familia-52

10.9

0.35

1.15

219

Familia-19

10.9

0.36

1.14

250

Familia-50

10.9

0.36

1.13

237

Familia-37

10.8

0.36

1.13

11.5

0.38

1.20

Media

1133


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

FMH con el más bajo rendimiento 276

Familia-76

2.5

0.08

0.26

266

Familia-66

2.5

0.08

0.26

257

Familia-57

2.2

0.07

0.24

220

Familia-20

2.1

0.07

0.22

272

Familia-72

2.1

0.07

0.21

2.3

0.07

0.24

Desviación estándar (f) de las 200 familias de medios hermanos de 1.6 Oaxaca y San Miguel

0.05

0.17

Media (µ2) de las 200 familias de medios hermanos de San Miguel y 5.4 Oaxaca

0.18

0.57

Media

RMS (g MS planta-1); TAC (g MS dia-1); EUR (g MS MJ-1).

Cuadro 3: Rendimiento de materia seca (RMS), tasa absoluta de crecimiento (TAC) y eficiencia en el uso de la radiación (EUR), para las FMH estadísticamente superiores y las cinco FMH con más bajo rendimiento derivadas de Oaxaca x San Miguel, en promedio de 11 cortes sucesivos. Ciclo 2014-2015 RMS TAC EUR Número de Genealogía familia FMH estadísticamente superiores 646

Familia-46

11.4

0.37

1.21

619

Familia-19

11.1

0.37

1.16

694

Familia-94

11.0

0.35

1.15

661

Familia-61

10.7

0.35

1.11

631

Familia-31

10.4

0.34

1.09

639

Familia-39

10.3

0.33

1.08

697

Familia-97

10.3

0.34

1.08

605

Familia-5

10.2

0.33

1.07

690

Familia-90

10.2

0.33

1.07

630

Familia-30

10.1

0.33

1.06

1134


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

652

Familia-52

10.1

0.33

1.06

649

Familia-49

9.9

0.33

1.02

685

Familia-85

9.8

0.32

1.02

673

Familia-73

9.7

0.32

1.01

609

Familia-9

9.7

0.31

1.01

623

Familia-23

9.6

0.31

1.00

682

Familia-82

9.5

0.31

1.00

10.2

0.33

1.07

Media FMH con el más bajo rendimiento 687

Familia-87

4.2

0.13

0.43

688

Familia-88

4.2

0.14

0.42

683

Familia-83

2.8

0.09

0.29

678

Familia-78

2.7

0.09

0.27

641

Familia-41

2.6

0.09

0.26

3.3

0.11

0.26

Desviación estándar (f) de las 200 familias de medios hermanos de 1.6 Oaxaca y San Miguel

0.05

0.17

Media (µ2) de las 200 familias de medios hermanos de San Miguel y 5.4 Oaxaca

0.18

0.57

Media

RMS (g MS planta-1); TAC (g MS dia-1); EUR (g MS MJ-1).

El RMS de las FMH sobresalientes derivadas de la población San Miguel x Oaxaca (cruza directa) (Cuadro 2) fue 11 % mayor que el RMS de las FMH sobresalientes derivadas de Oaxaca x San Miguel (cruza recíproca) (Cuadro 3) y por el contrario, las FMH con el más bajo rendimiento derivadas de la población San Miguel x Oaxaca produjeron 30 % menor RMS (Cuadro 2) que las FMH con el más bajo rendimiento derivadas de Oaxaca x San Miguel (Cuadro 3). El comportamiento genético diferencial entre las FMH derivadas de la cruza directa (San Miguel x Oaxaca) (Cuadro 2) y la cruza recíproca (Oaxaca x San Miguel) (Cuadro 3) en el RMS y sus componentes, puede ser indicativo de la presencia de moléculas de ADN en los organelos citoplásmicos (específicamente cloroplastos y mitocondria), que se conoce también como herencia citoplásmica o efectos genéticos maternos que se expresan 1135


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

en las cruzas recíprocas, al mostrar diferentes resultados con respecto a la cruza directa(16). La selección de progenies sobresalientes derivadas de poblaciones parentales con efectos genéticos citoplásmicos en la herencia del RMS, es importante para maximizar las ganancias genéticas en la productividad(20). Las FMH sobresalientes de San Miguel x Oaxaca exhibieron una TAC= 0.2 g de MS d-1 más alta que la media de los progenitores y 0.3 g de MS d-1 que las FMH de más bajo RMS (Cuadro 2); las FMH sobresalientes de Oaxaca x San Miguel mostraron una TAC= 0.15 g de MS d-1 más alta que la media de San Miguel y Oaxaca, y una TAC= 0.22 g de MS d-1 más alta que la media de las FMH de más bajo RMS (Cuadro 3). Las diferencias observadas en la TAC entre las FMH sobresalientes y las FMH de más bajo RMS fueron similares a las que se observaron para el RMS en otros estudios(12). La TAC es un componente muy importante del RMS; en un estudio previo se mostró que las variedades San Miguel, Oaxaca y Moapa produjeron más alta TAC y RMS estacional que las variedades Cuf-101 y Valenciana en Montecillo, Texcoco, Edo. de México(12); la TAC también tiene una relación importante con la acumulación de materia seca y el índice de área foliar en condiciones de campo, no así con el número de hojas por tallo(21). Las FMH sobresalientes de San Miguel x Oaxaca produjeron 52 % mayor EUR que el promedio de las variedades originales y 82 % mayor que la media de las FMH de más bajo RMS (Cuadro 2); de la misma forma, las FMH sobresalientes de Oaxaca x San Miguel produjeron 47 % mayor EUR que la media de los progenitores y 78 % mayor EUR que la media de FMH de más bajo RMS (Cuadro 3). La eficiencia con que las plantas capturan la radiación solar y la transforman en biomasa está determinada por la eficiencia en el uso de la radiación (EUR); diversos estudios han determinado que la EUR en alfalfa varía alrededor de 1.13 g de MS MJ-1- en la producción de biomasa(22). La EUR se incrementa linealmente de 0.60 a 1.60 g MS MJ-1 en promedio, cuando se incrementa la temperatura del aire entre 6 a 18 °C(23). Con respecto a AP, NT y relación H:T se debe considerar su importancia para el RMS y la calidad del forraje en la selección de nuevas variedades, pues en el presente estudio, la selección por alto RMS resultó en plantas altas con baja relación H:T y NT. No obstante, se identificaron algunas FMH con características de altos RMS, relación H:T (FMH-201) y NT (FMH-219, FMH-250, FMH-260 y FMH-282) en la población San Miguel x Oaxaca (Cuadro 2), y altos RMS, relación H:T (FMH-652, FMH-673 y FMH-685) y NT (FMH-605, FMH-623, FMH-631, FMH-639, FMH-652, FMH-673, FMH-685 y FMH690) en la población Oaxaca x San Miguel (Cuadro 3). La selección por RMS y otros caracteres morfológicos de la planta depende del número de genes que controlan el carácter de interés para los mejoradores (genes aditivos, de dominancia o epistáticos); los caracteres cualitativos (controlados por uno o pocos genes) son más fáciles de seleccionar que los caracteres cuantitativos (controlados por numerosos genes); es importante también considerar el nivel de heredabilidad e interacciones génicas negativas que al mejorar un carácter genético inhiben la expresión de otro, y los pasos generales apropiados como los objetivos del mejoramiento, creación/colección de la variabilidad, 1136


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

selecciĂłn, evaluaciĂłn y liberaciĂłn de cultivares; utilizaciĂłn de mĂŠtodos y tĂŠcnicas con base en el modo de reproducciĂłn de las especies; autogamĂ­a, alogamĂ­a o propagaciĂłn clonal(24).

Efectos genĂŠticos, ambientales y heredabilidad La cruza directa (San Miguel x Oaxaca) mostrĂł mayor varianza genĂŠtica para el RMS y sus componentes que la cruza recĂ­proca (Oaxaca x San Miguel); las variedades San Miguel y Oaxaca presentaron valores de varianza genĂŠtica, intermedios entre las dos cruzas (Cuadro 4). La varianza genĂŠtica proviene de la contribuciĂłn de genes segregantes y sus interacciones con otros genes en la planta, de tal forma que la selecciĂłn efectiva de individuos genĂŠticamente superiores requiere que: 1) la variaciĂłn fenotĂ­pica sea la adecuada en la poblaciĂłn original y 2) la heredabilidad sea suficientemente alta para una selecciĂłn efectiva; en general se considera que un incremento en la heredabilidad y la varianza fenotĂ­pica se reflejarĂĄ en un aumento en la ganancia genĂŠtica a travĂŠs de la selecciĂłn(25). El RMS, NT y AP presentaron mayor varianza genĂŠtica que los demĂĄs componentes del rendimiento tanto en las cruzas como en las variedades progenitoras. Uno de los mayores aspectos a considerar en los programas de mejoramiento genĂŠtico es la heredabilidad (h2) de caracteres Ăştiles de la planta, presentes en la variabilidad genĂŠtica disponible. La heredabilidad fue de moderada a alta en RMS y sus componentes en la cruza directa y de baja a moderada en la cruza recĂ­proca, excepto para la AP que mostrĂł mayor heredabilidad que las otras caracterĂ­sticas de la planta (Cuadro 4). La heredabilidad mide la contribuciĂłn del genotipo a la varianza fenotĂ­pica total; teĂłricamente puede variar de cero, cuando no hay variaciĂłn genĂŠtica presente, a la unidad, cuando toda la variaciĂłn observada es genĂŠtica en su origen. Sin embargo, debe distinguirse entre la heredabilidad en sentido amplio (h2b), antes definida, y la heredabilidad en sentido estrecho (h2n), la cual representa el cociente entre la varianza aditiva en lugar de la varianza genĂŠtica total y la varianza fenotĂ­pica(26). Cuadro 4: Varianza genĂŠtica (đ?&#x153;&#x17D;đ?&#x2018;&#x201D;2 ) y ambiental (đ?&#x153;&#x17D;đ?&#x2018;&#x2019;2 ), y heredabilidad en sentido (h2b) amplio para el rendimiento de materia seca (RMS), tasa absoluta de crecimiento (TAC), eficiencia en el uso de la radiaciĂłn (EUR), relaciĂłn hoja:tallo (H:T), nĂşmero de tallos (NT) y altura de planta (AP) en cuatro poblaciones de alfalfa. Ciclo 2014-2015 Variables RMS TAC EUR H:T NT AP

San Miguel đ?&#x153;&#x17D;đ?&#x2018;&#x201D;2 2.9 0.003 0.03 0.04 18.2 20.1

đ?&#x153;&#x17D;đ?&#x2018;&#x2019;2 4.4 0.01 0.05 0.06 37.4 55.2

h2b 0.40 0.34 0.41 0.41 0.33 0.27

San Miguel x Oaxaca đ?&#x153;&#x17D;đ?&#x2018;&#x201D;2 đ?&#x153;&#x17D;đ?&#x2018;&#x2019;2 5.8 7.1 0.006 0.01 0.06 0.08 0.02 0.02 31.9 29.0 45.1 40.0

Oaxaca h2b 0.45 0.42 0.43 0.51 0.52 0.53

1137

đ?&#x153;&#x17D;đ?&#x2018;&#x201D;2 1.5 0.001 0.02 0.04 11.6 21.8

đ?&#x153;&#x17D;đ?&#x2018;&#x2019;2 4.0 0.01 0.04 0.07 37.5 49.0

h2b 0.27 0.21 0.28 0.35 0.24 0.31

Oaxaca x San Miguel đ?&#x153;&#x17D;đ?&#x2018;&#x201D;2 đ?&#x153;&#x17D;đ?&#x2018;&#x2019;2 2.9 7.8 0.003 0.01 0.03 0.09 0.01 0.02 10.5 33.1 30.9 29.5

h2b 0.27 0.23 0.27 0.36 0.24 0.51


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

El RMS y la calidad del forraje, representada por la relación H:T son objetivos primordiales en el mejoramiento de la alfalfa; la heredabilidad para el RMS y la relación H:T, y los demás componentes del crecimiento fue más alta en San Miguel x Oaxaca que en Oaxaca x San Miguel. Sin embargo, los datos corroboran la presencia de genotipos con alto RMS y relación H:T, y demás componentes del crecimiento en ambas poblaciones (Cuadros 2 y 3). Estos resultados contrastan con los obtenidos para el RMS y la relación H:T en FMH y líneas (S1) de alfalfa, en los que el rendimiento de forraje y la relación H:T fueron independientes, debido a la ausencia de variabilidad en la relación H:T de los materiales seleccionados por alto RMS(9). No obstante, estos resultados indican que la selección permitió identificar FMH que combinan alto RMS con otros caracteres deseables como la relación H:T, NT, TAC y EUR (Cuadros 2 y 3), lo cual puede favorecer una respuesta continua a la selección(26). La combinación de caracteres de herencia génica nuclear, debida a la varianza genética aditiva y caracteres de herencia citoplásmica o herencia de efectos maternos, debida a la presencia de moléculas de ADN en la mitocondria y los cloroplastos, puede contribuir a maximizar la ganancia genética en el RMS e incrementar la eficiencia de la selección en alfalfa y otras especies cultivadas, donde los efectos génicos maternos estén presentes y se expresen en el fenotipo de las progenies. El mejorador apenas tiene ocasión de tratar con caracteres genéticos portados por uno u otro de dichos organelos, sin embargo, algunas veces, estos organelos pueden ser portadores de caracteres de excepcional importancia en el mejoramiento genético; tal es el caso de la androesterilidad citoplásmica que reside en la mitocondria(27).

Conclusiones e implicaciones La selección permitió identificar algunas FMH sobresalientes que combinan atributos de alto RMS con alta relación H:T en las dos poblaciones; estas FMH podrían utilizarse para formar una nueva variedad sintética y/o una población de amplia base genética, para continuar con ciclos subsecuentes de selección. La cruza directa (San Miguel x Oaxaca) mostró mayor varianza genética y heredabilidad para el RMS y sus componentes que la cruza recíproca (Oaxaca x San Miguel); las FMH sobresalientes de la cruza directa (San Miguel x Oaxaca) produjeron mayor RMS que las FMH sobresalientes de la cruza recíproca (Oaxaca x San Miguel), indicando que la variedad San Miguel, utilizada como progenitor femenino tuvo mejor comportamiento genético en las progenies que la variedad Oaxaca. En un futuro, la obtención de nuevas variedades mejoradas de alfalfa podría ser más práctica, al realizar cruzas directas y recíprocas en los programas de mejoramiento, para identificar al progenitor que tenga mejor comportamiento como citoplasma femenino, y que permita maximizar el rendimiento de materia seca a través de la selección.

1138


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

Literatura citada: 1. Busbice TH, Hill RR (Jr.), Carnahan HL. Genetics and breeding procedures. In: Hanson CH editor. Alfalfa science and technology. American Society of Agronomy. Number 15, Series Agronomy. Madison, WI, USA;1972:283-318. 2. Brummer EC, Bouton JH, Casler MD, McCaslin MH, Wadron BL. Grasses and legumes: Genetics and plant breeding. In: Wedin WF, Fales SL editors. Grassland: Quietness and strength for a new American agriculture. Am Soc Agron. Madison WI, USA;2009:157-171. 3. Annicchiarico P, Barrett B, Brummer EC, Julier B, Marshall AH. Achievements and challenges in improving temperate perennial forage legumes. Crit Rev Plant Sci 2015;34(1-3):327–380. 4. Lemaire G, Allirand JM. Relation entre croissance et qualité de la luzerne: interaction génotype-mode d’ exploitation. Fourr 1993;134:183-198. 5. Marten GC, Buxton DR, Barnes RF. Feeding value (Forage quality). In: Hanson AA, et al editors. Alfalfa and alfalfa improvement. Agronomy Monograph 29, ASA, Madison, WI. USA;1988:463-491. Doi:10.2134/agronmonogr29.c14. 6. Rumbaugh MD, Caddel JL, Rowe DE. Breeding and quantitative genetics. In: Hanson AA, et al editors. Alfalfa and alfalfa improvement. Agronomy Monograph 29, ASA, Madison, WI. USA;1988:777-808. Doi:10.2134/agronmonogr29.c25. 7. Bingham ET, Groose RW, Woodfield DR, Kidwell KK. Complementary gene interactions in alfalfa are greater in autotetraploids than diploids. Crop Sci 1994;34(4):823-829. 8. Katepa-Mutondwa FM, Christie BR, Michaels TE. An improved breeding strategy for autotetraploid alfalfa (Medicago sativa L.). Euphytica 2002;123(1):139–146. 9. Annicchiarico P. Alfalfa forage yield and leaf/stem ratio: narrow-sense heritability, genetic correlation and parent selection procedures. Euphytica 2015;205(2):409– 420. Doi:10.1007/s10681-015-1399-y. 10. Li X, Brummer EC. Applied genetics and genomics in alfalfa breeding. Agron 2012;2:40–61. Doi:10.3390/agronomy2010040. 11. García E. Modificaciones al sistema climático de Köppen. 5a. ed, Instituto de Geografía. Serie de libros No. 6. Universidad Nacional Autónoma de México. México, DF. México;2004. 12. Rivas-Jacobo MA, López-Castañeda C, Hernández-Garay A, Pérez-Pérez J. Efecto de tres regímenes de cosecha en el comportamiento productivo de cinco variedades comerciales de alfalfa (Medicago sativa L.). Téc Pecu Méx 2005;43(1):79-92.

1139


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

13. The international system of units (SI) – Conversion factors for general use. In: Butcher K, Crown L, Gentry EJ, Hockert C editors. Weights and Measures Division, Technology Services, NIST, Special Publication 1038. Department of Commerce, USA;2006. 14. SAS. The SAS System release 9.1 for windows. Institute Inc., Cary, North Carolina, United States. 2009. 15. Márquez SF. Genotecnia vegetal. Tomo I. México, DF: AGT Editor, SA; 1992. 16. Hartl DL, Freifelder D, Snyder LA. Cytoplasmic inheritance. In: Basic genetics. Jones and Bartlett Publishers, Inc. Portola Valley, CA, USA;1988:179-193. 17. Falconer DS. Introducción a la genética cuantitativa. Traducción de Fidel Márquez Sánchez, PhD. C.E.C.S.A. México, DF; 1984. 18. Milić D, Katić S, Boćanski J, Karagić Đ, Mikić A, Vasiljević S. Importance of progeny testing in alfalfa breeding (Medicago sativa L.). Genetika 2010;42(3):485492. 19. Bakheit BR, Ali MA, Helmy AA. Effect of selection for crown diameter of forage yield and quality components in alfalfa (Medicago sativa L.). Asian J Crop Sci 2011;3(2):68-76. Doi:10.3923/ajcs.2011.68.76. 20. Rebetzke GJ, Richards RA, López-Castañeda C. Nuclear and maternal gene action affect selection for early vigour in wheat. In: Langridge P, et al editors. Proc. Aust Plant Breed Conf. Adelaide, South Australia; 1999:146-147. 21. Villegas-Aparicio Y, Hernández-Garay A, Pérez-Pérez J, López-Castañeda C, Herrera-Haro JG, Enríquez-Quiroz JF, et al. Patrones estacionales de crecimiento de dos variedades de alfalfa (Medicago sativa L.). Téc Pecu Méx 2004;42(2):145-158. 22. Khaiti M, Lemaire G. Dynamics of shoot and root growth of lucerne after seeding and after cutting. Europ J Agron 1992;1(4):241-247. 23. Brown HE, Moot DJ, Teixeira EI. Radiation use efficiency and biomass partitioning of lucerne (Medicago sativa) in a temperate climate. Europ J Agron 2006;25(4):319327. 24. Aquaah G. Conventional plant breeding principles and techniques. In: Al-Khayri J, et al editors. Advances in plant breeding strategies: Breeding, biotechnology and molecular tools 2015:115-158. Doi:10.1007/978-3-319-22521-0_5. 25. Brewbaker JL. Agricultural genetics. New Jersey, United States of America: PrenticeHall, Inc.; 1964. 26. Hill J, HC Becker, PMA Tigerstedt. Quantitative and ecological aspects of plant breeding. London, England: Chapman and Hall; 1998. 1140


Rev Mex Cienc Pecu 2020;11(4): 1126-1141

27. Cubero JI. Introducción a la mejora genética vegetal. 3.a ed. España: Ediciones Mundi-Prensa; 2013.

1141


https://doi.org/10.22319/rmcp.v11i4.5437 Revisión bibliográfica

Tasa de preñez post vitrificación en los embriones de équidos producidos in vivo. Revisión Christian Urías-Castro a* Ana Myriam Boeta b

a

Universidad Autónoma de Sinaloa. Facultad de Medicina Veterinaria y Zootecnia, Boulevard San Ángel S/N, Fraccionamiento San Benito, Predio Las Coloradas, Culiacán Sinaloa, México. b

Universidad Nacional Autónoma de México. Facultad de Veterinaria y Zootecnia, Departamento de Reproducción . Ciudad de México, México.

*

Autor de correspondencia: cesar.urias@uas.edu.mx

Resumen: La vitrificación es un método de criopreservación que se utiliza a menudo con los embriones que se obtienen de yeguas o de burras. Consiste en la drástica reducción de la temperatura a niveles cercanos a los -196 °C lo cual causa que la solución criopreservadora que contiene el embrión pase del estado líquido al vítreo. Varias mejoras en los protocolos de vitrificación han hecho posible criopreservar embriones de diferentes tamaños. Los embriones recolectados al sexto día después de la ovulación (DO) suelen tener un diámetro menor o igual a 300 micrómetros (≤300 µmØ) y se pueden vitrificar de forma rutinaria siguiendo protocolos simples. Las tasas de preñez post vitrificación (TPPV) son más altas con embriones pequeños que con los grandes (˃300 µmØ). Las TPPV elevadas en los embriones ≤300 µmØ se debe a que la cápsula embrionaria (CE) aún no está completamente desarrollada y desde luego tiene una alta permeabilidad a las soluciones criopreservadoras. Los embriones recolectados en el séptimo u octavo día DO son ˃300 µmØ y se caracterizan por tener una baja supervivencia post vitrificación. Para aumentar la TPPV con los embriones ˃300 µmØ se puede perforar la CE para hacerla más permeable a las soluciones criopreservadoras, reducir su tamaño aspirando el fluido del blastocele e inducir un alto 1142


Rev Mex Cienc Pecu 2020;11(4):1142-1149

índice de transferencia de temperatura para alcanzar con más rapidez la vitrificación a los -196 °C. Palabras clave: Yeguas, Burras, Embrión, Criopreservación, Vitrificación, Tasa de preñez.

Recidido: 02/07/2019 Aceptado: 21/10/2019

Introducción Según estimaciones de la FAO(1), durante el período 2007-2017 el número de burros (Equus africanus asinus) se redujo en países como Brasil (1’163,316 a 841,307), China (7’306,000 a 4’568,500), Ecuador (102,058 a 49,729), India (438,000 a 247,000) e Italia (24,000 a 20,928). La población de burros también ha disminuido en el continente africano debido a la demanda del mercado chino por productos como la piel de burro(2). Sin embargo, en países como Italia(3) y Brasil(4) los burros forman una parte importante de la industria de los équidos por su producción de leche(5,6), queso(7) y carne(4). La recuperación de la población de burros es un asunto importante debido al papel que juegan en la economía de los países emergentes(8) y en la producción de animales híbridos como las mulas(9). Los ciclos estrales de las burras y las yeguas (Equus ferus caballus) difieren principalmente en la duración del período del celo; el estro es de mayor duración en las burras(10). Sin embargo, el intervalo entre la ovulaciónfertilización y la entrada del embrión en el útero parece ser similar entre las burras(11,12,13) y las yeguas(14,15). El tamaño del embrión recuperado durante el sexto, séptimo, octavo o noveno día después de la ovulación (DO) varía drásticamente tanto en las burras(12,13,16,17) como en las yeguas(15,16,18), aunque la tendencia de aumentar en tamaño es similar entre ellas. En los équidos se sabe que el embrión ingresa al útero al sexto día DO(18). En el proceso de la recolecta de embriones en las burras y las yeguas para la preservación por vitrificación, el día DO seleccionado (día de la infusión intrauterina de soluciones y recolección) determina la etapa de desarrollo del embrión (mórula, blastocisto o blastocisto expandido). Desde luego, dicta el protocolo adecuado para optimizar la tasa de preñez post vitrificación (TPPV)(12,13,15,19-22). Al infusionar el útero en el sexto DO, el embrión recuperado generalmente será de un tamaño menor que 300 micrómetros(12,16,21), mientras que los embriones recolectados en el séptimo, octavo o noveno día DO tendrán un tamaño igual o mayor a 300 micrómetros(12,13,20,23,24). Para optimizar los protocolos de vitrificación embrionaria se requiere de una determinación precisa del día de la ovulación (día cero) para calcular con exactitud la edad/etapa del embrión. Esto es vital porque los embriones recolectados durante el sexto día DO no requieren de una reducción en tamaño antes de la 1143


Rev Mex Cienc Pecu 2020;11(4):1142-1149

vitrificación, pero los recolectados el séptimo, octavo o el noveno día DO sí la requieren(12,21,25,26,27). Las biotecnologías como la vitrificación de embriones podrían facilitar la reproducción en burras y promover la recuperación gradual de sus poblaciones. El objetivo del presente estudio fue generar información enfocada al mejoramiento del protocolo de la vitrificación de embriones y un consecuente incremento de la TPPV para embriones ˃300 µmØ tanto en burras como en yeguas.

Relevancia del tamaño del embrión sobre la tasa de preñez post vitrificación (TPPV) Durante los primeros diez años del Siglo XXI el tamaño del embrión que se utilizaba en el protocolo de vitrificación afectaba claramente la TPPV, con los embriones pequeños (≤300 µmØ) resultando en tasas más altas y los grandes (˃300 µmØ) en tasas más bajas(15). En yeguas se obtuvieron TPPV cercanas al 62 % usando embriones vitrificados ≤300 µmØ(28), mientras que las tasas eran de 10 % cuando se utilizaron embriones vitrificados ˃300 µmØ(29). A partir del 2010, se desarrollaron ajustes a los protocolos de criopreservación diseñados para embriones ˃300 µmØ. Entre ellos se encuentran la punción de la cápsula embrionaria (CE) y la reducción de su tamaño mediante la aspiración del fluido del blastocele (FB)(23). Estos ajustes permitieron la vitrificación exitosa de embriones ˃300 µmØ, la supervivencia del embrión post vitrificación en burras(30) y TPPV superiores al 40 % en yeguas(31). No se han realizado investigaciones sobre el efecto del tamaño del embrión en la TPPV utilizando embriones derivados de burras(17,30).

Asociación entre la permeabilidad de la capsula embrionaria (CE) y la tasa de preñez post vitrificación (TPPV) En las especies équidas los embriones desarrollan una estructura glucoproteica denominada cápsula embrionaria (CE) la cual es necesaria para una adecuada progresión de la gestación(32). La vitrificación de los embriones derivados de las yeguas ha demostrado que la presencia de la CE disminuye la permeabilidad del embrión a soluciones criopreservadoras, tanto in vitro(33) como in vivo(34,35). Una de las primeras preñeces exitosas en una yegua con embriones vitrificados ˃300 µmØ se logró gracias al tratamiento de la CE con tripsina previo al proceso de vitrificación para aumentar su permeabilidad a las criopreservados(36). Sin embargo, el aumento en la permeabilidad de la CE por medio de la tripsina o los inhibidores de microfilamentos (citocalasina-B) no han producido resultados positivos de manera consistente(37). En embriones equinos ˃300 µmØ el grado de integridad de la CE parece estar relacionado estrechamente con la TPPV. Este se debe a que la CE está mucho más desarrollada en esta categoría de embriones y cualquier alteración dramática de ella puede 1144


Rev Mex Cienc Pecu 2020;11(4):1142-1149

reducir la TPPV(23). Todavía faltan estudios sobre la permeabilidad de la CE en embriones de burra o mula y para determinar si la permeabilidad está asociada con la TPPV.

Punción de la capsula embrionaria (CE) y extracción del fluido del blastocele (FB) antes de la vitrificación En embriones equinos ˃300 µmØ es importante perforar la CE(38) y extraer la FB para reducir su tamaño antes de proceder con la vitrificación(39). Varios estudios han reportado un incremento en la TPPV como resultado de este procedimiento(23,24,31,38,40,41). Por ejemplo, antes del 2010 las TPPV en las yeguas usando embriones ˃300 µmØ eran inferiores al 40 %(15,29), pero después del 2010 la aplicación de la punción de la CE y la reducción de su tamaño arrojó TPPV entre el 60 y el 80 %(23,24,40). Hay pocos datos sobre la eficacia de este procedimiento en embriones derivados de burras. Un estudio reciente demostró que la reducción del tamaño del embrión por aspiración del FB antes de la vitrificación resultó en una tasa de supervivencia del embrión del 83 % post vitrificación(30). Es importante notar que en este estudio no se transfirieron los embriones al útero de una burra posterior a la vitrificación y por lo tanto no se documentó el desarrollo del embrión in vivo ni la TPPV. Todavía está por determinar si la punción de le CE es necesaria en embriones ˃300 µmØ derivados de burras(21,30), ya que ningún estudio ha documentado aún el TPPV en embriones de burras después de la punción de la CE y la reducción del tamaño(16,17,21,30). Cabe la posibilidad de que este procedimiento no sea necesario en los embriones de burras ya que un estudio de embriones de yegua y de burra demostró que los embriones de las burras parecían tolerar mejor la vitrificación(16); no se han realizado estudios para probar directamente esta hipótesis. Son pocos los estudios que evalúan el TPPV en embriones de las burras(21) y es claro que se necesita más trabajo en esta área(16,17,21).

La influencia de un incremento en el índice de transferencia de temperatura (ITT) sobre la tasa de preñez post vitrificación (TPPV) en embriones de équidos En équidos, un ITT elevado durante el proceso de vitrificación y desvitrificación mejora el TPPV de los embriones ˃300 µmØ. Este índice está relacionado con la velocidad y la cantidad de la temperatura transferida del nitrógeno líquido (alrededor de -196 °C) a la solución criopreservadora que contiene el embrión (temperatura cercana a los 25 °C). Un aumento en el ITT representa un aumento en la velocidad a la cual la temperatura de la solución criopreservadora que contiene el embrión alcanza los -196 °C. Hay diferentes maneras de promover un aumento en el ITT. Una es poner la solución criopreservadora con el embrión en contacto directamente con el nitrógeno líquido, y otra es reducir el volumen de la solución que se pondrá en contacto con el nitrógeno líquido. Recientemente se ha logrado un aumento en la supervivencia de los embriones post vitrificación a niveles 1145


Rev Mex Cienc Pecu 2020;11(4):1142-1149

superiores al 60 % tanto en yeguas(23,40) como en burras(17) por medio de un aumento del ITT y utilizando volúmenes de soluciones criopreservadoras inferiores a un microlitro al sumergir el embrión en el nitrógeno líquido. En otro estudio la TPPV se incrementó en yeguas en respuesta al uso de la punción de la CE, un aumento del ITT y el uso de contenedores de volumen pequeño (<1 ml), pero bajó cuando se usó un ITT reducido y contenedores de volumen grande (≥1 ml)(40). En teoría el uso de contenedores de pequeño volumen aumenta el ITT. Un estudio de embriones derivados de burras apoya esta suposición ya que al usar un volumen final de la solución de vitrificación <1 ml se incrementó la supervivencia del embrión post vitrificación entre un 40 y 50 %(17). No se estableció la TPPV en este estudio ya que no se realizó la punción de la CE ni se transfirieron los embriones al útero de una burra.

Agradecimientos La presente revisión de literatura forma parte de las investigaciones financiadas por el Proyecto PROFAPI2015/287.

Literatura citada: 1. FAO, 2018 Statistical Database Website, Food and Agriculture Organization. Rome Italy (Home page: http://www.fao.org/faostat/en/#data/QA). 2. Cox L. Dramatic decline in donkey populations blamed on consumer demand for 'ejiao'. Vet Rec 2017;(181):610. 3. Camillo F, Rota A, Biagini L, Tesi M, Fanelli D, Panzani D. The current situation and trend of donkey industry in Europe. J Equine Vet Sci 2018;(65):44-49. 4. Carneiro GF, Lucena JE, de Oliveira Barros L. The current situation and trend of the donkey industry in South America. J Equine Vet Sci 2018;(65):106-110. 5. Monti G, Bertino E, Muratore MC, Coscia A, Cresi F, Silvestro L, et al. Efficacy of donkey's milk in treating highly problematic cow's milk allergic children: an in vivo and in vitro study. Pediat Allergy Immunol 2007;(3):258-264. 6. Licitra R, Li J, Liang X, Altomonte I, Salari F, Yan J, et al. Profile and content of sialylated oligosaccharides in donkey milk at early lactation. LWT 2019;(115):108437. 7. D'Alessandro AG, Martemucci G, Loizzo P, Faccia M. Production of cheese from donkey milk as influenced by addition of transglutaminase. J Dairy Sci 2019;16615. 8. Getachew AM, Trawford AF, Feseha G, Reid SWJ. Gastrointestinal parasites of working donkeys in Ethiopia. Trop Anim Health Prod 2010;(42):27–33. 1146


Rev Mex Cienc Pecu 2020;11(4):1142-1149

9. Vidament M, Vincent P, Martin FX, Magistrini M, Blesbois E. Differences in ability of jennies and mares to conceive with cooled and frozen semen containing glycerol or not. Anim Reprod Sci 2009;(112):22-35. 10. Hagstrom D. Donkeys are different: an overview of reproductive variations from horses. 2004. http://livestocktrail.illinois.edu/horsenet/paperDisplay.cfm?ContentID=7449 Accessed March 15, 2019. 11. Allen WR, Kydd J, Boyle MS, Antczak DF. Between‐species transfer of horse and donkey embryos: A valuable research tool. Equine Vet J 1985;(17):53-62. 12. Vendramini OM, Bruyas JF, Fieni F, Battut I & Tainturier D. Embryo transfer in Poitou donkeys, preliminary results. Theriogenology 1997;(47):409. 13. Pérez-Marín CC, Vizuete G, Galisteo JJ. Embryo recovery results in Hispano-Arabe horse and Spanish donkey breeds. Livestock Sci 2017;(206):76-81. 14. Oguri N, Tsutsumi Y. Non-surgical egg transfer in mares. Reproduction 1974;(41):313320. 15 Eldridge-Panuska WD, di Brienza VC, Seidel Jr GE, Squires EL, Carnevale EM. Establishment of pregnancies after serial dilution or direct transfer by vitrified equine embryos. Theriogenology 2005;(63):1308-1319. 16. Pérez‐Marín CC, Vizuete G, Vazquez‐Martinez R, Galisteo JJ. Comparison of different cryopreservation methods for horse and donkey embryos. Equine Vet J 2018;(50):398404. 17. Bottrel M, Ortiz I, Pereira B, Díaz-Jiménez M, Hidalgo M, Consuegra R, et al. Cryopreservation of donkey embryos by the cryotop method: Effect of developmental stage, embryo quality, diameter and age of embryos. Theriogenology 2018;(125):242248. 18. Freeman DA, Weber JF, Geary RT, Woods GL. Time of embryo transport through the mare oviduct. Theriogenology 1991;(36):823-830. 19. McKinnon AO, Squires EL. Equine embryo transfer. Vet Clin North Am Equine Prac 1988;(2):305-333. 20. Silva PC, Oliveira JP, Dutra GA, Paiva SO, Caram DF, Junqueira RG, et al. Taxa de recuperação e características morfológicas de embriões muares (Equus caballus x Equus asinus). Pesqui Vet Bras 2018;(7):1453-1457. 21. Panzani D, Rota A, Romano C, Pratelli G, Sabatini C, Camillo F. Birth of the first donkey foals after transfer of vitrified embryos. J Equine Vet Sci 2012;(32):419. 1147


Rev Mex Cienc Pecu 2020;11(4):1142-1149

22. Bottrel M, Fortes T, Ortiz I, Hidalgo M, Dorado J. Establishment and maintenance of donkey-in-mule pregnancy after embryo transfer in a non-cycling mule treated with oestradiol benzoate and long-acting progesterone. Span J Agric Res 2017;(4):10. 23. Diaz F, Bondiolli K, Paccamonti D, Gentry GT. Cryopreservation of day 8 equine embryos after blastocyst micromanipulation and vitrification. Theriogenology 2016;(85):894-903. 24. Wilsher S, Rigali F, Couto G, Camargo S, Allen WR. Vitrification of equine expanded blastocysts following puncture with or without aspiration of the blastocoele fluid. Equine Vet J 2018;(0):1-6. 25. Camillo F, Panzani D, Scollo C, Rota A, Crisci A, Vannozzi I, et al. Embryo recovery rate and recipients' pregnancy rate after nonsurgical embryo transfer in donkeys. Theriogenology 2010;(73):959-965. 26. Betteridge KJ, Eaglesome MD, Mitchell D, Flood PF, Beriault R. Development of horse embryos up to twenty two days after ovulation: observations on fresh specimens. J Anat 1982;(135):191-209. 27. Iuliano MF, Squires EL, Cook VM. Effect of age of equine embryos and method of transfer on pregnancy rate. J Anim Sci 1985;(60):258-263. 28. Campos-Chillon LF, Suh TK, Barcelo-Fimbres M, Seidel GE Jr, Carnevale EM. Vitrification of early-stage bovine and equine embryos. Theriogenology 2009;(79):349354. 29. Barfield JP, McCue PM, Squires EL, Seidel Jr GE. Effect of dehydration prior to cryopreservation of large equine embryos. Cryobiology 2009;(59):36-41. 30. Ottmann L, Reigner F, Allamellou JM, Magistrini M, Guignot F. Preimplantation genetic diagnosis in donkey embryos after biopsy. J Equine Vet Sci 2018;(66):195. 31. Ferris RA, McCue PM, Trundell DA, Morrissey JK, Barfield JP. Vitrification of large equine embryos following manual or micromanipulator-assisted blastocoele collapse. J Equine Vet Sci 2016;(41):64-65. 32. Stout TAE, Meadows S, Allen WR. Stage-specific formation of the equine blastocyst capsule is instrumental to hatching and to embryonic survival in vivo. Anim Reprod Sci 2005;(87):269-281. 33. Gillard Kingma SE, Thibault ME, Betteridge KJ, Schlaf M, Gartley CJ, Chenier TS. Permeability of the equine embryonic capsule to ethylene glycol and glycerol in vitro. Theriogenology 2011;(76):1540-1551.

1148


Rev Mex Cienc Pecu 2020;11(4):1142-1149

34. Legrand E, Krawiecki JM, Tainturier D, Corniere P, Delajarraud H, Bruyas JF. Does the embryonic capsule impede the freezing of equine embryos? Proceedings of the 5th International Symposium on Equine Embryo Transfer, Havemeyer Foundation Monograph 2000;(3):62-65. 35. Scott BR, Carwell DB, Hill RA, Bondioli KR, Godke RA, Gentry GT. Evaluation of capsule permeability in the equine blastocyst. J Equine Vet Sci 2012;(32):795-798. 36. Legrand E, Bencharif D, Barrier-Battut I, Delajarraud H, Corniere P, Fieni F, et al. Comparison of pregnancy rates for days 7-8 equine embryos frozen in glycerol with or without previous enzymatic treatment of their capsule. Theriogenology 2002;(58):721723. 37. Maclellan LJ, Carnevale EM, Coutinho da Silva MA, McCue PM, Seidel Jr GE, Squires EL. Cryopreservation of small and large equine embryos pre-treated with cytochalasinB and/or trypsin. Theriogenology 2002;(58):717-720. 38. Guignot F, Blard T, Barrière P, Gasgogne T, Gaude Y, Yvon JM, et al. Easy, quick and cheap technique to cryopreserve Welsh B pony blastocyst. J Equine Vet Sci 2016;(41):53-60. 39. Choi YH, Velez IC, Riera FL, Roldán JE, Hartman DL, Bliss SB, et al. Successful cryopreservation of expanded equine blastocysts. Theriogenology 2011;( 76):143-152. 40. Sánchez R, Blanco M, Weiss J, Rosati I, Herrera C, Bollwein H, et al. Influence of embryonic size and manipulation on pregnancy rates of mares after transfer of cryopreserved equine embryos. J Equine Vet Sci 2017;(49):54-59. 41. Guignot F, Reigner F, Perreau C, Tartarin P, Babilliot JM, Bed'hom B, et al. Preimplantation genetic diagnosis in Welsh pony embryos after biopsy and cryopreservation. J Anim Sci 2015;(93):5222-5231.

1149


https://doi.org/10.22319/rmcp.v11i4.5202 Revisión bibliográfica

Herramientas moleculares utilizadas para el análisis metagenómico. Revisión

Nohemí Gabriela Cortés-López a Perla Lucía Ordóñez-Baquera a* Joel Domínguez-Viveros a

a

Universidad Autónoma de Chihuahua, Facultad de Zootecnia y Ecología. Chihuahua, México.

*Autor de correspondencia: plordonez@uach.mx

Resumen: La metagenómica utiliza técnicas de biología molecular para analizar la diversidad de los genomas microbianos (metagenomas). La diversidad de los metagenomas se ha analizado mediante marcadores moleculares para clasificar bacterias y arqueas en grupos taxonómicos a nivel de género. Entre los marcadores moleculares más utilizados se encuentran los genes ribosomales, genes que codifican subunidades del citocromo C y algunos genes constitutivos (gyrB, rpoB, rpoD, recA, atpD, infB, groEL, pmoA, sodA). El marcador más utilizado es el gen 16S rRNA para clasificar bacterias y arqueas de muestras metagenómicas, aunque no permite clasificar de forma adecuada algunas secuencias. Sin embargo, con la secuenciación del gen completo 16S rRNA se identifican todas las secuencias de las regiones hipervariables, por lo que se ha logrado clasificar hasta nivel taxonómico de especie con este marcador molecular. La secuenciación de próxima generación, también llamada secuenciación masiva o de alto rendimiento ha ayudado a describir metagenomas complejos como los de muestras ambientales, con importancia ecológica, así como metagenomas que crecen en ambientes extremos. También han ayudado a estudios relacionados con sanidad animal y en humanos, y en el ámbito agroalimentario. Específicamente, tanto el uso del marcador molecular 16S rRNA como la secuenciación de alta eficiencia combinadas con el uso de las herramientas bioinformáticas para el análisis metagenómico se han usado para describir el metagenoma

1150


Rev Mex Cienc Pecu 2020;11(4):1150-1173

ruminal, una comunidad microbiana de gran importancia debido a que está involucrada en la producción animal de carne y leche. A pesar de los muchos estudios que se han realizado en este campo, aún faltan microorganismos por descubrir y caracterizar. Palabras clave: Marcador molecular, Gen 16S rRNA, Metagenómica, Diversidad microbiana, Secuenciación de alto rendimiento.

Recibido: 17/12/2018 Aceptado: 23/10/2019

Introducción La metagenómica se basa en el uso de técnicas de biología molecular para analizar la diversidad de genomas microbianos, llamados también metagenomas, a partir de muestras ambientales. La diversidad microbiana de los metagenomas se ha analizado mediante el uso del gen 16S rRNA, que codifica para el ARN ribosómico que conforma la subunidad pequeña de los ribosomas. Este gen comprende regiones conservadas y variables en bacterias y arqueas. El gen 16S rRNA se ha utilizado como marcador molecular, ya que permite clasificar a las bacterias y arqueas en grupos taxonómicos de acuerdo con las familias o géneros. En los primeros estudios de diversidad microbiana de muestras ambientales se utilizaban métodos dependientes de cultivo, donde sólo se lograban estudiar aquellos microorganismos que se pudieran aislar en el laboratorio. Mediante el avance de las técnicas de biología molecular, se ha logrado analizar la diversidad microbiana a través del uso de métodos independientes de cultivo, obteniendo información más precisa de los genomas bacterianos. Uno de estos métodos más usados es la amplificación por PCR de fragmentos del gen 16S rRNA y en algunos casos seguida de electroforesis en gel de gradiente desnaturalizante (DGGE). Estas técnicas se han utilizado para analizar la diversidad bacteriana ruminal, los cambios que se producen en la comunidad microbiana y la expresión génica después de los cambios en la dieta del rumiante(1,2). Otro avance que ha permitido analizar de forma más amplia la diversidad microbiana del rumen, es la secuenciación dirigida de las regiones variables del gen 16S para diferenciar los microorganismos filogenéticamente muy cercanos, analizar los genes y genomas que degradan la biomasa en el rumen, caracterizar la microbiota ruminal y estudiar los efectos de levaduras sobre la diversidad bacteriana en el rumen(3,4,5). El reciente desarrollo de la metagenómica ha permitido el estudio de la diversidad microbiana de muestras ambientales aislando y analizando el material genético total presente en una 1151


Rev Mex Cienc Pecu 2020;11(4):1150-1173

muestra ambiental(6,7). En sus inicios esta estrategia se utilizó para la búsqueda de nuevas enzimas con potencial biotecnológico, extrayendo el ADN total contenido en una muestra ambiental, fragmentándolo y clonando genes de diferente tamaño en vectores como plásmidos (15 kb), fagos (hasta 20 kb), fósmidos y cósmidos (hasta 40 kb) y Cromosomas Artificiales Bacterianos (para fragmentos mayores). Estos vectores se insertaban en diferentes cepas huésped y se usaban sustratos fluorogénicos como indicadores de expresión. Sin embargo, en la búsqueda funcional de genes a través de los clones, la expresión de proteínas y la actividad enzimática eran de pequeña magnitud(8,9,10). Una parte crucial en la construcción de librerías metagenómicas es la extracción de los ácidos nucleicos a partir de la muestra. Existen dos estrategias principales para la extracción de ADN metagenómico: el tratamiento químico y la lisis directa con métodos mecánicos. Ambos métodos presentan ventajas y desventajas, con la lisis mecánica se recupera ADN de mayor diversidad microbiológica que con el tratamiento químico, sin embargo, con el tratamiento químico se obtiene ADN de mayor peso molecular. Respecto a la extracción de ARN se utilizan los mismos métodos de extracción para cualquier análisis de expresión, en los cuales se incluyen inhibidores de RNAsas y se recomienda congelar las muestras a -80 ºC inmediatamente después de su recolección para evitar la degradación del ARN(9). Para seleccionar el método ideal de extracción se debe de tomar en cuenta el tipo de muestra, el ácido nucleico que se quiera purificar y el tipo de análisis que se pretenda realizar. Para el análisis metagenómico se han utilizado diferentes estrategias. Dentro de los métodos mecánicos se han usado perlas magnéticas para muestras de origen fecal, oral, piel, suelo y agua donde se han obtenido secuencias de alta calidad(11). Para el análisis de microbiomas ruminales, se han utilizado métodos que combinan extracción por perlas magnéticas (lisis mecánica) con columnas de extracción (tratamiento químico) para purificar ADN de microbioma ruminal(11,12). Esta combinación aumentó el rendimiento de extracción respecto al uso de perlas magnéticas y columnas de extracción por separado. Otros métodos de identificación utilizan sondas de isótopos estables (Stable-isotope probing SIP) mediante las que se identifican los microorganismos que incorporan dichos isótopos a través del uso sustratos marcados. En particular, la técnica de sondas de isótopos estables de ácidos nucleicos (Nucleic acids-SIP) utiliza sustratos con isótopos de 13C y/o 15N, los cuales se incorporan a los genomas bacterianos y de esta manera pueden ser rastreados(13). Otros sustratos con sondas de isótopos estables son 13CH3-OH, 13C-fenol y 5-bromo-2deoxiuridina. Sin embargo, las limitaciones del uso de sustratos marcados con isótopos estables incluyen el entrecruzamiento y el reciclaje de los isótopos dentro de la comunidad microbiana, lo que resulta en la pérdida del enriquecimiento específico de los microorganismos analizados(13).

1152


Rev Mex Cienc Pecu 2020;11(4):1150-1173

También se han desarrollado técnicas para identificar genes que cambian sus niveles de expresión durante distintos procesos biológicos. Por ejemplo, la hibridación sustractiva supresora (Suppression Subtractive Hybridization SSH) se ha utilizado para identificar variaciones entre muestras complejas de ADN como las del ambiente ruminal(9,13). Los análisis de expresión diferencial permiten comparar el perfil de expresión genética de una comunidad microbiana antes y después de estar expuesta a una condición y/o sustrato específico y de esta forma identificar genes de importancia que presentan cambios en los perfiles de expresión génica por efecto de dicha condición y/o sustrato(13). Otra técnica ampliamente utilizada en estudios de expresión génica son los microarrays, que ofrecen como ventaja una rápida identificación y caracterización de un número elevado de clones. Aunque los microarrays se pueden usar para la identificación de un gran número de genes conservados, dependen de secuencias conocidas reportadas previamente en bases de datos, por lo que se elimina la posibilidad de identificar genes nuevos(8,10). Más recientemente se ha usado la secuenciación masiva para obtener toda la información posible del metagenoma presente en una muestra. Uno de los primeros trabajos con secuenciación masiva fue la identificación del metagenoma del Mar de los Sargazos en donde se generaron, anotaron y analizaron 1.045 billones de pares de bases de secuencias no redundantes para identificar el contenido genético, diversidad y abundancia relativa de los microorganismos. Se estimó que los datos obtenidos provenían de al menos 1,800 especies genómicas que incluyeron 148 filotipos de bacterias desconocidas y más de 782 genes nunca antes descritos que codifican para fotorreceptores parecidos a rodopsinas(10,14). La secuenciación masiva del metagenoma por “shotgun” tiene la característica de secuenciar todo el ADN presente en la muestra por lo que se pueden clasificar a los microorganismos taxonómicamente hasta el nivel de especie. Además, con las secuencias obtenidas por este tipo de secuenciación se pueden llegar a descubrir genes con funciones nunca antes descritas e incluso se pueden seleccionar las secuencias que pertenecen al gen 16S rRNA para realizar anotaciones taxonómicas. Estas clasificaciones se realizan con el uso de herramientas bioinformáticas que busquen homología con las secuencias analizadas en diferentes bases de datos ya existentes(15). Específicamente en ambientes ruminales, se han analizado librerías metagenómicas para evaluar los efectos de dietas en el microbioma ruminal mediante perfiles metagenómicos y se ha utilizado el marcador del gen 16S rRNA para la determinación y clasificación de la diversidad microbiana de las secuencias(3,5). Sin embargo, algunas de las secuencias de estas muestras no se han logrado clasificar adecuadamente, por lo que utilizar al menos otro marcador filogenético molecular diferente al gen 16S rRNA podría mejorar la clasificación taxonómica(15). En el presente trabajo se hace una revisión de las herramientas utilizadas para el análisis de metagenomas que van desde los marcadores moleculares clásicos hasta los utilizados con datos obtenidos a partir de secuenciaciones masivas, con énfasis en los metagenomas de ambientes ruminales. 1153


Rev Mex Cienc Pecu 2020;11(4):1150-1173

Marcadores moleculares para el análisis metagenómico Un marcador molecular es un segmento de ADN que corresponde a un gen o regiones no codificantes del genoma, estos segmentos de ADN permiten identificar diferentes variantes (alelos) y se localizan en un sitio determinado en los cromosomas (locus). Las diferencias que se obtienen en estos fragmentos de ADN se conocen como polimorfismos y se pueden detectar por hibridación de secuencias de ácidos nucleicos, secuenciación de nucleótidos, comparación de la longitud de los fragmentos producidos por la reacción en cadena de la polimerasa (PCR) y a través de sitios reconocidos por enzimas de restricción. Los marcadores moleculares se pueden utilizar para clasificar grupos taxonómicos, poblaciones, familias o individuos, tanto en eucariotas como en procariotas(16,17). En estudios genéticos se han utilizado diversos marcadores moleculares en animales domésticos, en fauna silvestre, en especies en peligro de extinción, así como en pruebas forenses y de paternidad. Los más conocidos son RFLPs, minisatélites, AFLPs, RAPDs, microsatélites y SNPs (Cuadro 1). Las características más relevantes que deben tener los marcadores moleculares para optimizar los estudios metagenómicos incluyen: (1) que sean genes de copia única (genes que sólo tienen una o dos copias en todo el genoma) ya que proporcionan menor incertidumbre que los marcadores de genes que presentan copias múltiples (gen con copias repetidas en el genoma); (2) que la secuencia del gen del marcador sea de fácil alineamiento para facilitar el análisis filogenético; (3) que la proporción de la región de sustitución del gen sea la suficiente para proporcionar información necesaria para su clasificación; (4) que los cebadores sean selectivos para amplificar el gen del marcador, pero no universales, para evitar falsos positivos; (5) que no haya excesiva variación en la secuencia del marcador que limite la determinación de la ancestría. Los genes que se utilizan como marcadores moleculares para clasificar microorganismos se describen a continuación.

Genes ribosomales Los genes de RNA ribosomal se consideran la herramienta idónea para la clasificación taxonómica ya que son genes altamente conservados y evolutivamente estables, pero que contienen regiones hipervariables. La secuenciación de dichas regiones ha generado grandes bases de datos que ayudan a la clasificación taxonómica(18). Los ribosomas de bacterias y arqueas constan de dos subunidades, la subunidad pequeña contiene un solo tipo de ARN (16S) y una subunidad grande que contiene dos tipos de ARN (5S y 23S)(17). 16S rRNA. Este gen también se designa 16S rDNA, pero la Sociedad Americana de Microbiología (American Society for Microbiology, ASM) ha decidido utilizar el término “16S rRNA” para uniformizar la información. Tiene una secuencia aproximada de 1.550 pb de longitud y contiene regiones variables y conservadas con secuencias de oligonucleótidos 1154


Rev Mex Cienc Pecu 2020;11(4):1150-1173

únicas para cada grupo filogenético(18,19). La comparación de las secuencias del gen 16S rRNA de bacterias desconocidas con secuencias conocidas en las bases de datos es de gran ayuda para clasificar a las bacterias a nivel de género e incluso se ha llegado a identificar especies en algunos casos(20,21). 5S rDNA. Es un gen de aproximadamente 120 nucleótidos de longitud, se encuentra prácticamente en todos los ribosomas con excepción de los mitocondriales, de algunos hongos, de animales superiores y de la mayoría de protistas. Aunque la secuencia de este gen está altamente conservada, la fiabilidad de este gen como marcador está cuestionada debido a que su longitud es muy pequeña y por lo tanto no ofrece la suficiente resolución para contribuir significativamente a comprender relaciones filogenéticas entre taxones(17). 23S rDNA. Es un gen de aproximadamente 3,000 nucleótidos de longitud que se localiza en la subunidad grande de los ribosomas en procariotas. Este gen presenta inserciones y deleciones más grandes que el gen 16S rRNA. Las inserciones estables y deleciones de algunas bases en el gen 23S rDNA son características comunes en algunas clases y subclases de bacterias. Estos cambios complican los análisis, ya que las diferentes posiciones no pueden considerarse para realizar clasificaciones filogenéticas correctas(22). El gen 23S rDNA se ha utilizado en conjunto con el 16S rRNA para la clasificación taxonómica de bacterias no cultivables. Además se ha utilizado el espaciador intergénico (ITS) localizado en la región 16S-23S, la cual es una región muy variable para diferenciar entre dos cepas pertenecientes a la misma subespecie(22,23).

Genes que codifican subunidades del citrocromo c Citocromo oxidasa I/II (COI/II). La enzima citocromo c oxidasa es una proteína de la cadena transportadora de electrones que se encuentra tanto en bacterias como en las mitocondrias de organismos eucariotas. Los genes COI y COII codifican para dos de las siete subunidades polipeptídicas del complejo citocromo c oxidasa. El gen COI evoluciona más lentamente en comparación con otros genes mitocondriales y es ampliamente utilizado en estudios filogenéticos(17).

Genes que codifican proteínas con funciones conservadas En estudios donde se ha encontrado mayor diversidad de microorganismos se han utilizado técnicas de análisis de comunidades moleculares basadas en el gen 16S rRNA respaldado por estudios de análisis de secuencias multilocus (MLSA), que implican la secuenciación de varios genes que codifican proteínas con funciones conservadas (housekeeping genes) para evaluar la diversidad en colecciones de cepas aisladas(24). En estos estudios las secuencias parciales de genes que codifican para proteínas con funciones conservadas se utilizan para 1155


Rev Mex Cienc Pecu 2020;11(4):1150-1173

generar árboles filogenéticos y posteriormente resolver filogenias. La principal desventaja del uso del gen 16S rRNA como marcador filogenético es su resolución insuficiente a nivel de especie. No obstante, el empleo de un análisis filogenético complementario basado en genes codificadores de proteínas(25) permite incrementar la resolución de las filogenias a nivel infragenérico y determinar nuevas cepas. Hay más de 50 esquemas individuales de MLSA disponibles y las bases de datos de MLSA (http://www.mlst.net/ y http://www.pubmlst.org) también se pueden usar para identificar secuencias microbianas no conocidas a nivel de especie(24,26). Los genes que se han utilizado en MLSA son aquellos que codifican subunidades de enzimas ubicuas, como la subunidad β de la ADN girasa (gyrB), la subunidad β de la ARN polimerasa (rpoB), el factor sigma 70 (sigma D) de la ARN polimerasa (rpoD) , la recombinasa A (recA), la subunidad β de ATP sintasa F0F1 (atpD), el factor de iniciación de traducción IF-2 (infB), la modificación del tRNA GTPasa ThdF o TrmE (thdF) y la chaperonina GroEL (groEL)(24,26). La subunidad β de la metano-monooxigenasa en partículas (pmoA) se ha utilizado como marcador funcional para la detección de metanótrofos aerobios. La metano-monooxigenasa es la enzima responsable de la etapa de conversión inicial de metano a metanol. Se conocen dos formas de esta enzima, la metano-monooxigenasa soluble (sMMO) y una enzima unida a la membrana, la metano-monooxigenasa en partículas (pMMO). El gen pmoA es el marcador utilizado con mayor frecuencia, ya que está presente en la mayoría de las bacterias aeróbicas metanotróficas. También está presente en bacterias desnitrificadoras anaeróbicas(27). Otro marcador que se puede usar para la detección de metanótrofos es el gen mxaF que codifica la subunidad mayor de la metanol deshidrogenasa(27,28). Como ejemplo de esta aproximación, se puede citar el trabajo de Sánchez-Herrera et al(26), que han utilizado el gen 16S rRNA como marcador molecular de referencia para identificar y clasificar cepas del género Nocardia a nivel de género. Sin embargo, por ser un gen con múltiples copias genera problemas en la identificación de cepas aisladas de casos clínicos. Tras testar otros genes a través de la amplificación por PCR de sus segmentos: sodA (gen que codifica la enzima superóxido dismutasa), hsp65 (proteína de choque térmico), secA1 (subunidad de translocasa de la preproteína secA), gyrB (subunidad β de la ADN girasa), rpoB (subunidad β de la ARN polimerasa) y el espaciador intergénico 16S-23S, los autores únicamente pudieron discriminar entre especies estrechamente relacionadas de Nocardia mediante el gen sodA. El fragmento de 386 pb del gen sodA presenta regiones variables, con segmentos de 4 y 5 pb, y tiene potencial para ser utilizado como marcador molecular. En conclusión, si bien existe una gran diversidad de marcadores moleculares para analizar comunidades microbianas, hasta el momento el estándar de oro para la clasificación de secuencias obtenidas a partir de muestras sigue siendo el gen 16S rRNA. 1156


Rev Mex Cienc Pecu 2020;11(4):1150-1173

El uso de secuenciación masiva en la metagenómica Si bien el análisis metagenómico se inició con el uso de distintos marcadores moleculares como AFLP, RAPDs, 16S rRNA etc. (Cuadro 1), se ha visto que algunos de estos marcadores mejoran su eficiencia cuando la técnica que se utiliza para identificarlos incluye su secuenciación en lugar de caracterizarlos por medio de reacciones con enzimas de restricción y/o amplificación por PCR. Desde sus inicios, la secuenciación del ADN con la tecnología de Sanger generó un gran impacto prácticamente en todas las ramas de las ciencias biológicas dentro de las cuales se encuentran los estudios de comunidades microbianas. Actualmente, el uso de la secuenciación Sanger puede generar hasta 96 secuencias por corrida con una longitud promedio de 650 pb, lo que podría ser suficiente para un análisis de marcadores filogenéticos(15). Este tipo de estudios se conocen como secuenciación de primera generación y da como resultado secuencias de alta calidad de una longitud entre 500 a 1000 pb. Sin embargo su desventaja es que la proporción de marcadores moleculares que pueden ser secuenciados en una corrida, comparado con el total de microorganismos presentes en una muestra metagenómica es muy baja(11).

Cuadro 1: Métodos moleculares utilizados en estudios genéticos Marcador molecular

Características

Referencia

Se basa en los cambios de nucleótidos en un genoma Khlestkina(16) que se dan en un sitio de reconocimiento de enzimas (50) (polimorfismo de restricción. En ciencias forenses se ha utilizado Wakchaure et al de longitud de para probar si los tejidos provenientes de las escenas fragmentos de del crimen (sangre, piel, esperma, etc.) pertenecen a restricción) algún sospechoso. En manejo de razas de animales para rastrear la progenie además de usarse para pruebas de paternidad y para el diagnóstico de enfermedades. RFLP

Minisatélites o Son secuencias cortas de 10 a 60 pb, repetidas en Kumar et al(51) VNTR número variable en uno o más sitios del genoma. Se (52) han utilizado para identificar linajes paternos en Lang et al (variaciones en individuos y evaluar la diversidad genética en el número de poblaciones de animales domésticos, de fauna repeticiones en silvestre y de gramíneas. tándem)

1157


Rev Mex Cienc Pecu 2020;11(4):1150-1173

Es la amplificación de fragmentos genómicos Khlestkina(16) digeridos con enzimas de restricción que reconocen (51) (polimorfismo secuencias dispersas a lo largo del genoma. Se ha Kumar et al de longitud de utilizado para estudios de ADN “fingerprinting”, fragmento para clonar y mapear secuencias de ADN específicas amplificado) y para hacer mapas genéticos. AFLP

RAPD (ADN polimórfico amplificado azar)

Utilizan cebadores cortos de secuencia arbitraria Beuzen et al(53) para dirigir una reacción de amplificación en (54) regiones discretas del genoma y se obtienen Vignal et al fragmentos de diversos tamaños. Se han utilizado (50) al para estudio de ADN “fingerprinting”, para Wakchaure et al relacionar especies cercanas, en mapeo genético, en genética de poblaciones, en genética evolutiva molecular y en estudios de razas genéticas en animales y plantas.

Microsatélites o Son secuencias de 2 a 6 pb repetidas en tándem en SSR todo el genoma y presentan un elevado polimorfismo en función del número de repeticiones que se (secuencias encuentran en regiones de genes no codificantes. Se simples han utilizado en estudios de identificación de repetidas) animales, evaluación de recursos genéticos, pruebas de paternidad, investigación de enfermedades, determinación de la variación genética dentro y entre razas, genética de poblaciones, migración mapeo de genes y genomas y para detectar polimorfismos incluso en estudios in silico.

Khlestkina(16)

SNP

Khlestkina(16)

Son regiones de ADN en las que se observa la sustitución de un nucleótido por otro, o la adición o (polimorfismo eliminación de uno o pocos nucleótidos. Se ha de un solo utilizado en el análisis de genes de herencia nucleótido) biparental y en el análisis de diferencias genéticas, para hacer mapas genéticos y para detectar variaciones genéticas dentro de especies.

Beuzen et al(53) Kumar et al(51) Duran et al(55)

Yu et al(56) Beuzen et al(53) Kumar et al(51)

Con el surgimiento de las tecnologías de secuenciación masiva, conocidas como “Next Generation Sequencing technologies (NGS)” se pueden secuenciar millones de moléculas de ADN de manera simultánea, lo que facilita en gran medida el estudio de la diversidad microbiana(15). Una de las primeras tecnologías de secuenciación de alto rendimiento fue la pirosecuenciación 454, que se utilizó para la secuenciación dirigida de amplicones de genes de RNA ribosomal(29). Esta técnica tenía la ventaja de que se podían obtener secuencias de hasta 1,200 pb, pero con un error significativamente mayor al de otras plataformas de 1158


Rev Mex Cienc Pecu 2020;11(4):1150-1173

secuenciación (1%) y a un mayor costo(15). La secuenciación de segunda generación, también conocida como secuenciación de lecturas cortas (50 a 400 pb) utiliza principalmente la plataforma Illumina(11). Entre sus ventajas, cabe mencionar que se pueden obtener una mayor cantidad de lecturas, tienen un porcentaje de error aproximado de 0.1% y comparativamente su costo es reducido(15). Actualmente es la tecnología más popular, pero requiere de una fase de análisis bioinformático más complejo que el de otras plataformas. Tradicionalmente, cuando se usan estas dos plataformas (pirosecuenciación 454 e Illumina) para el análisis metagenómico con el uso del marcador 16S rRNA, se realiza un paso previo de amplificación por PCR, limitando las especies identificadas únicamente a bacterias y arqueas ya que los cebadores serán siempre para amplificar fragmentos del gen 16S rRNA. Si la población también incluye a microorganismos eucariotas como levaduras y protozoarios, estos no podrán ser detectados. Por otro lado, este paso de amplificación por PCR conlleva un enriquecimiento del ADN lo que produce un sesgo hacia las especies que se encuentran en mayor proporción provocando que las especies que se encuentran en menor porcentaje difícilmente puedan ser detectadas. Finalmente, este tipo de análisis identifica microorganismos hasta nivel de género(29). Una alternativa para el aumento de la resolución a nivel taxonómico radica en el estudio metagenómico con las técnicas de secuenciación masiva llamadas “Whole Genome Shotgun sequencing” (WGS) y “Shotgun metagenomics sequencing (SMS)”, en las cuales el ADN metagenómico total es secuenciado(30,31). La mayor ventaja de estos métodos es que los microorganismos se pueden clasificar hasta nivel de especie además de que se pueden identificar no solo procariotas sino también eucariotas y de que no requiere el paso previo de amplificación por PCR por lo que se elimina el sesgo. Otra ventaja de estas secuenciaciones es que al tener secuencias de todo el ADN presente en la muestra se pueden seleccionar las correspondientes al gen 16S rRNA para utilizarlo como marcador molecular taxonómico y además se pueden buscar secuencias de genes de otros marcadores polimórficos constitutivos (MLSA) que ayudarían a hacer una mejor clasificación de los microorganismos. Las principales desventajas son el mayor costo que la secuenciación dirigida del gen 16S rRNA y que requieren de análisis bioinformáticos de datos más complejos(32). Se han realizado varios estudios para identificar metagenomas en una amplia gama de ambientes poblacionales y se ha utilizado tanto la secuenciación dirigida del gen 16S rRNA como la secuenciación completa de metagenomas mediante WGS y/o SMS.

Herramientas bioinformáticas para el análisis metagenómico Es importante señalar que los datos obtenidos de secuenciación masiva requieren utilizar herramientas bioinformáticas para poder ser analizados. Cuanto mayor sea la cantidad de 1159


Rev Mex Cienc Pecu 2020;11(4):1150-1173

datos generados se requerirá de mayores recursos bioinformáticos(15), tanto de aplicaciones que implementen algoritmos de análisis, como de bases de datos con información sobre genomas microbianos (Cuadro 2).

Cuadro 2: Programas bioinformáticos para el análisis de secuencias metagenómicas Aplicación Método de análisis bioinformática

Referencia

MG-RAST

Asignación de anotaciones estructurales y Meyer et al(33) funcionales de acuerdo con bases de datos de nucleótidos y proteínas por homología.

MOTHUR

Analiza secuencias del gen 16S rRNA, cuantifica Schloss et al(34) parámetros ecológicos para medir diversidad α y β, visualiza el análisis mediante diagramas de Venn, heat maps y dendogramas, selecciona colecciones de secuencias basadas en su calidad y calcula la distancia de secuencia por pares.

QUIIME

Analiza secuencias microbianas del gen 16S rRNA, Kuczynski et al(35) realiza perfiles taxonómicos y filogenéticos, y comparaciones entre las muestras.

PhaMe

Realiza comparaciones basados en SNPs de genomas Ahmed et al(36) completos, secuencias ensambladas y secuencias son procesar para el análisis filogenético y de evolución molecular.

VITCOMIC1

Hace un análisis del gen 16S rRNA y secuencias de Mori et al(37) alto rendimiento para visualizar la composición filogenética de muestras metagenómicas.

16SPIP

Detección rápida de microorganismos patógenos en Miao et al(38) muestras clínicas basadas en secuencias metagenómicas del gen 16S rRNA.

PICRUSt

Algoritmo que tiene un enfoque de metagenómica Langille et al(39) predictiva a partir de datos del gen 16S rRNA y de una base de datos de genomas de referencia.

CowPI

Utiliza PICRUSt para analizar datos del gen 16S Wilkinson et al(57) rRNA del microbioma ruminal.

1160


Rev Mex Cienc Pecu 2020;11(4):1150-1173

Kraken

Asignación de etiquetas taxonómicas en secuencias Wood et al(58) de DNA metagenómico utilizando la alineación de kmers logrando una clasificación más precisa en comparación con BLAST.

Kaiju

Clasificador de metagenomas que encuentra Menzel et al(59) coincidencias máximas a nivel de proteína utilizando la transformación de Burrows-Wheeler, clasifica lecturas con mayor sensibilidad y precisión similar en comparación con los clasificadores basados en kmers, especialmente en los géneros que están subrepresentados en las bases de datos de referencia.

Una de las aplicaciones más usada desde su lanzamiento es el servidor MG-RAST(33) que asigna anotaciones funcionales a las secuencias analizadas comparando dichas secuencias con bases de datos de proteínas y de nucleótidos por homología, además de permitir la realización de análisis filogenéticos. Esta herramienta es gratuita, de fácil acceso y se alimenta con la información proporcionada por los investigadores por lo que ayuda a terminar con el principal cuello de botella en el análisis de secuencias de metagenomas, que radica en la disponibilidad de información para asignar anotaciones genómicas(33). Otras dos herramientas bioinformáticas de amplio uso en metagenómica son MOTHUR(34), que también es de libre acceso y que se alimenta de la información metagenómica que los usuarios van agregando a una base de datos que se actualiza mensualmente y QUIIME(35), que se utiliza para el análisis de la comunidades microbianas de datos bacterias y arqueas. Otro programa de amplio uso para el análisis de metagenomas es PhaME(36) (Phylogenetic and Molecular Evolutionary), que utiliza SNP de genomas completo para medir la diversidad interespecífica mediante análisis filogenético. PhaME(36) se puede utilizar para medir la divergencia entre las especies y entre cepas aisladas, además de minimizar los errores de secuenciación y ensamblaje. La genómica comparativa, incluidos los análisis filogenéticos basados en genes ortólogos y SNP requieren de genomas ensamblados o terminados. PhaME utiliza el enfoque basado en SNP de genomas completos disponibles en las bases de datos, secuencias ensambladas (contigs) y secuencias sin procesar para realizar análisis filogenéticos y de evolución molecular. Este programa combina algoritmos para hacer alineamientos de todo el genoma, mapeo de lecturas y construcción filogenética; utiliza comandos internos para inferir el genoma principal y SNP, inferir árboles y realizar otros análisis de evolución molecular. PhaME es especialmente útil para el análisis y detección de organismos poco abundantes en muestras de metagenomas y se ha utilizado en datos de muestras bacterianas, de virus, como el del ébola en Zaire y levaduras, entre otros(36).

1161


Rev Mex Cienc Pecu 2020;11(4):1150-1173

Otras herramientas se focalizan en el análisis de las regiones hipervariables del gen 16S rRNA, como por ejemplo VITCOMIC1(37), que combina la información obtenida de la secuenciación dirigida del gen 16S rRNA así como de la secuenciación masiva WGS o SMS para visualizar mejor la composición filogenética de muestras metagenómicas, además de generar un registro más exacto de la comunidad microbiana. De la misma manera, la aplicación 16SPIP(38) también se ha utilizado para la detección rápida de microorganismos patógenos en muestras clínicas basada en datos de secuencias metagenómicas del 16S rRNA. En cuanto a los enfoques de "metagenómica predictiva", cabe destacar el algoritmo PICRUSt(39), que utiliza modelos evolutivos para predecir metagenomas a partir de datos del gen 16S rRNA y una base de datos de genomas de referencia. Esta herramienta se ha utilizado con datos de muestras de microbiomas de suelos, de intestinos de mamíferos, de tapetes microbianos y de humanos(39), como por ejemplo el estudio de la microbiota bucal de humanos en el que se analizaron 6,431 muestras del gen 16S rRNA del Proyecto del Microbioma Humano(39,40).

Ejemplos de caracterización metagenómica con metodologías de alto rendimiento Existen diversos trabajos de caracterización metagenómica para identificar microorganismos que viven en ambientes de interés por su gran variabilidad e importancia ecológica (Cuadro 3). A continuación, se presentan algunos ejemplos de estos trabajos sin ánimo de ser exhaustivos. Por ejemplo, a partir de muestras de tres estaciones marinas que son parte de la expedición global Tara, se realizó una secuenciación masiva de 29 metagenomas(29). Al realizar el análisis taxonómico con los datos de las secuencias correspondientes al gen 16S rRNA se lograron identificar todas las regiones variables del gen (V1 a V9). Con fines comparativos también se realizó la secuenciación dirigida de gen 16S rRNA. Los resultados que obtuvieron indicaron que la eficiencia en la clasificación taxonómica con el uso de base de datos ribosomales RDP (Ribosomal Database Project) es similar para ambos tipos de secuenciación. No obstante, la secuenciación masiva ofrece dos grandes ventajas, reduce el error ocasionado en la PCR de amplicones y se genera una gran cantidad de datos funcionales que se pueden analizar a la par del análisis taxonómico.

1162


Rev Mex Cienc Pecu 2020;11(4):1150-1173

Cuadro 3: Ejemplos de caracterizaciรณn metagenรณmica Muestra

Tipo de anรกlisis

Referencia

Plancton marino de Perfiles taxonรณmicos y estructura de Logares et al(29) estaciones marinas de la comunidades procariotas mediante expediciรณn Tara Oceans secuenciaciรณn masiva dirigida de 16S rRNA Sedimentos Sundarban

del

Manglar Anรกlisis de diversidad y distribuciรณn de Basak et al(41) bacterias a travรฉs de la secuenciaciรณn dirigida de 16S rRNA

Sedimentos del mar Arรกbigo

Anรกlisis de la estructura y diversidad Nair et al(42) bacteriana en base a la secuenciaciรณn de una librerรญa de 16S rRNA

Aguas termales de Sungai Anรกlisis de diversidad mediante la Chan et al(43) Klah de Malasia secuenciaciรณn dirigida de la regiรณn V3-V4 de 16S rRNA Aguas termales de Mushroom Diversidad microbiana basada en la Thiel et al(44) Spring del Parque Nacional secuenciaciรณn dirigida del gen 16S rRNA y de Yellowstone secuenciaciรณn metagenรณmica. Hielo basal del Matanuska, Alaska

Glaciar Anรกlisis de diversidad microbiana de Kayani et al(45) secuenciaciรณn dirigida del gen 16S rRNA y secuenciaciรณn metagenรณmica

Sangre de donantes sanos

Anรกlisis del microbioma mediante Paรฏsse et al(46) amplificaciรณn por PCR y secuenciaciรณn dirigida de 16S rRNA

Microbioma fecal humano

Estudio comparativo del genoma completo Ranjan et al(32) por secuenciaciรณn masiva y secuenciaciรณn dirigida de 16S rRNA

Queso Gouda pasteurizado y Anรกlisis de diversidad mediante la Salazar et al(47) no pasteurizado secuenciaciรณn dirigida del gen 16S rRNA Microbiota ileal y cecal de Anรกlisis de diversidad mediante la Mohd-Shaufi pollos de engorda amplificaciรณn de la regiรณn V3 del gen 16S al(48) rRNA Microbiota adherida a la fibra Caracterizaciรณn de los genes y genomas de en rumen bovino ADN metagenรณmico

1163

Hess et al(3)

et


Rev Mex Cienc Pecu 2020;11(4):1150-1173

Rumen de bovinos Análisis taxonómico del microbioma del productores de leche y carne rumen a través de la pirosecuenciación dirigida del gen 16S rRNA

Wu et al(20)

Microbiota ruminal en Análisis de la diversidad microbiana del Pinloche et al(5) bovinos suplementados con rumen a través de la pirosecuenciación levaduras dirigida de la región ribosomal V1 del gen 16S rRNA Microbiota ruminal en Análisis de la diversidad bacteriana a través Pan et al(49) bovinos suplementados con de la secuenciación dirigida del gen 16S tiamina rRNA Microbioma de piel sana y Caracterización del microbiana y Zinicola et al(30) con dermatitis digital bovina composición de genes funcionales de la piel sana, piel en etapas de lesión activa e inactiva mediante secuenciación masiva del genoma completo y anotación de las muestras mediante MG-RAST Liquido ruminal de tres Perfiles metagenómicos del rumen Ross et al(31) fracciones del rumen bovino mediante la secuenciación masiva paralela no dirigida en ADN metagenómico.

Otro trabajo metagenómico en el ámbito de la secuenciación masiva se centró en analizar la diversidad y la distribución bacteriana presente en sedimentos del manglar tropical de Sundarban(41). Para esta identificación se hizo uso de la secuenciación dirigida del 16S rRNA a través de pirosecuenciación 454, obteniendo un total de 153,926 secuencias. El análisis con el software MG-RAST posibilitó la identificación de 56,547 especies pertenecientes a 44 filotipos diferentes, siendo el más dominante el filotipo Proteobacteria. Por otro lado, el análisis metagenómico de sedimentos del mar Arábigo(42) con secuenciación Sanger dirigida a 16S rRNA clasificó las secuencias obtenidas en siete filotipos distintos donde también predominó el filotipo Proteobacteria. Un gran número de trabajos se han centrado en la caracterización de metagenomas de ambientes extremos. Por ejemplo, la secuenciación del 16S rRNA y de genomas completos se ha utilizado para identificar la diversidad de bacterias termófilas presentes en aguas termales de Malasia cuya temperatura varía entre 50 y 110 ºC(43). Al analizar los datos del 16S rRNA se encontraron cerca de 35 filotipos de los cuales Firmicutes y Proteobacteria representaron el 57% del microbioma. Respecto a las termófilas el 70% de las detectadas fueron anaerobias estrictas, sin embargo, Hydrogenobacter spp. (termofilotipos quimiolitotróficos obligados) representaron uno de los taxones con mayor frecuencia, encontrando también muchos microorganismos fotosintéticos termofílicos. La mayoría de 1164


Rev Mex Cienc Pecu 2020;11(4):1150-1173

los filotipos identificados coincidieron con lo encontrado en la secuenciación de genomas completos. Gracias a este tipo de análisis se pudieron identificar y clasificar microorganismos extremos como lo son los termófilotipos, los anaerobios y los quimiolitotróficos que difícilmente se hubieran podido caracterizar con los métodos microbiológicos clásicos(43). Otro estudio para identificar microbiota de ambientes extremos fue realizado a partir de muestras de microorganismos que crecen en los hongos que habitan el parque Yellowstone a través de la secuenciación dirigida de 16S rRNA(44). A lo largo de los años el estudio de los microorganismos de este hábitat se ha enfocado en bacterias clorofototróficas pertenecientes a los filotipos Cyanobacteria y Chloroflexi. Sin embargo, los resultados del estudio dieron a conocer que la variación microbiana está dominada por un solo taxón: Roseiflexus spp. que pertenece al grupo de los microorganismos fotótrofos anoxigénicos(44). La secuenciación dirigida del 16S rRNA junto con la de genomas completos se ha utilizado también en glaciares, para los que la información microbiana también está muy limitada. El primer estudio metagenómico de glaciares reportado(45) permitió identificar nueve diferentes genomas entre los cuales se encuentran Anaerolinea, Synthrophus y Thiobacillus y se encontraron rutas metabólicas involucradas en la oxidación del azufre y en la nitrificación. Existen ejemplos del uso de la secuenciación masiva en poblaciones metagenómicas dentro del ámbito de la salud, y agroalimentario. A modo de ejemplo en el ámbito de la salud humana, estudios de secuenciaciones dirigidas del 16S rRNA para describir la microbiota presente en la sangre de individuos sanos han mostrado que la sangre de personas sanas no es un tejido estéril(46). A nivel de filotipos, más del 80% de los microorganismos presentes en sangre pertenecían a Proteobacterias aunque también se encontraron filotipos de Actinobacteria, Firmicutes y Bacteriodetes. Ranjan et al(32) utilizaron diferentes estrategias para caracterizar el microbioma fecal humano. A partir de una sola muestra obtuvieron 194.1 x106 lecturas provenientes de distintas estrategias de secuenciación (secuenciación dirigida de 16S rRNA, Illumina HiSeq, Illumina MiSeq) al compararlas, especialmente la secuenciación dirigida del gen 16S rRNA respecto a la secuenciación WGS concluyeron que esta última presenta más ventajas, ya que se aumenta la capacidad de identificar especies bacterianas, se aumenta la detección de la diversidad y de la predicción de genes y también se mejora la precisión en la detección de especies al aumentar la longitud de las secuencias. En el ámbito agroalimentario la secuenciación dirigida de 16S rRNA también se ha utilizado para identificar microorganismos presentes en queso Gouda(47) cuando se preparó ya sea con leche de pasteurizada o sin pasteurizar, evaluando además los cambios por efecto del añejamiento. Dicho estudio permitió identificar 120 géneros en el queso sin pasteurizar y 92 en el queso pasteurizado. Además, en función del tiempo de añejamiento tenía una influencia significativa en la presencia de microbiota. Los géneros más abundantes en todas las muestras fueron Bacillaceae, Lactococcus, Lactobacillus, Streptococcus y Staphylococcus.

1165


Rev Mex Cienc Pecu 2020;11(4):1150-1173

En el caso de pollos de engorda en crecimiento, se ha estudiado la variación de la microbiota ileal y cecal a través del tiempo(48). Para ello, se amplificó y secuenció la región hipervariable V3 del gen 16S rRNA. Los resultados mostraron que las comunidades microbianas cecales tuvieron más diversidad que las ileales. Además, se observó que la presencia de la bacteria Clostridium (potencialmente patógena) aumentaba conforme los animales iban creciendo y que la población de microorganismos benéficos como Lactobacillus era baja en todos los intervalos(48). En el caso de los metagenomas ruminales, cabe destacar que uno de los primeros estudios de secuenciación se realizó para la búsqueda de enzimas celulolíticas nunca antes descritas(3). En dicho estudio, se realizó pirosecuenciación 454, obteniendo 268 gigabases de información de ADN metagenómico. A partir de esta información, se lograron identificar 27,755 supuestos genes de enzimas carbohidrato-activas de los cuales 90 codificaban para posibles proteínas y de ellas el 57% eran enzimáticamente activadas por sustratos celulósicos. Otro estudio centrado en el metagenoma ruminal de becerros de ganado lechero y de novillos de ganado de carne(20) utilizó pirosecuenciación dirigida de 16S rRNA para evaluar la variación entre las poblaciones respecto al tipo de ganado. En este estudio se encontraron 8 filotipos, 11 clases, 15 familias y 17 géneros distintos, y diferencias en la abundancia de los filotipos encontrados entre ganado lechero y de carne. Los filotipos más abundantes fueron Bacteriodetes, Firmicutes, Proteobacteria, Fibrobacteres y Spirochaetes en ambos tipos de ganado, pero con una menor abundancia de Bacteriodetes y Proteobacteria en ganado de carne. Es conocido que el uso de levaduras como aditivos nutriciones en bovinos trae mejoras en la producción de leche y en la ganancia de peso. Sin embargo, no se sabe si el efecto que provocan las levaduras es un estímulo general a todas las especies microbianas o solo afecta algunas del ambiente ruminal. Debido a lo anterior se realizó un estudio para evaluar los cambios en la microbiota ruminal cuando los animales se alimentaban con aditivo de levaduras y comparándolos cuando consumían solo la dieta basal(5). En este trabajo se utilizó pirosecuenciación 454 de la región V1 del gen 16S rRNA para identificar la población de los microorganismos ruminales. Los resultados mostraron que se observaba un cambio en las principales bacterias fibrolíticas (Fibrobacter y Ruminococcus) y en bacterias utilizadoras de lactato (Megasphaera y Selenomonas) cuando se adicionaba el aditivo de levaduras. La secuenciación dirigida del gen 16S rRNA en la población de microorganismos ruminales de bovinos lecheros adultos cuando se combinaba con dietas de alto contenido de grano, se ha utilizado para evaluar el efecto de la tiamina como aditivo en la nutrición animal(49). Los resultados confirmaron que la suplementación de tiamina puede mejorar la función ruminal ya que se aumentó el número de bacterias celulolíticas cuando se les administró dicho aminoácido. En el campo de la sanidad animal, también se ha utilizado la secuenciación de metagenomas completos. Por ejemplo, se ha comparado el metagenoma de piel con dermatitis digital bovina activa y en recesión con la piel de bovinos sanos para ver si se detectaban patógenos 1166


Rev Mex Cienc Pecu 2020;11(4):1150-1173

que estuvieran involucrados con la patogénesis de la enfermedad(30). Las secuencias obtenidas se analizaron con MG-RAST y se lograron identificar seis filotipos principales, de entre los cuales, Firmicutes y Actinobacteria fueron los predominantes en el microbioma de los sanos mientras de Spirochetes, Bacteroidetes y Proteobacteria fueron los más abundantes en los enfermos activos y de recesión, confirmando así que la presencia de la enfermedad cambia la población del metagenoma. La obtención de perfiles metagenómicos ruminales se ha realizado mediante la secuenciación de metagenomas completos a partir de muestras de líquido ruminal provenientes de tres diferentes bovinos y entre localizaciones diferentes del rumen(31). Además de comparar con el metagenoma proveniente de heces de los mismos animales, los resultados indicaron que la variación de los perfiles metagenómicos era menor entre las muestras tomadas del mismo animal, aunque fueran tomadas de diferentes regiones del rumen. Contrariamente a lo esperado, no se encontró relación con el perfil metagenómico de heces y de líquido ruminal del mismo animal.

Conclusiones Tradicionalmente el análisis metagenómico utilizaba metodologías laboriosas, como el uso de electroforesis en gradiente desnaturalizante, la digestión de los genomas con enzimas de restricción y su visualización mediante geles de agarosa y/o de acrilamida. El desarrollo de las metodologías de secuenciación de ácidos nucleicos, sobre todo de las nuevas tecnologías de secuenciación masiva, han ayudado a disminuir esta problemática. El gen 16S rRNA se ha considerado tradicionalmente el estándar de oro para clasificar microorganimos procariotas (bacterias y arqueas), ya que cumple con todas las características necesarias para ser un marcador molecular. No obstante, pese al gran número de trabajos que han empleado la secuenciación de las regiones hipervariables de este marcador, presenta la desventaja de no poder determinar taxones a nivel infragenérico. Una estrategia utilizada para mejorar la clasificación taxonómica ha sido la combinación del marcador 16S rRNA con algún otro gen de expresión constitutiva como los genes sodA, hps65, gyrB, entre otros, e incluso también se han usado genes que codifican para subunidades del complejo enzimático del citocromo c para llegar a clasificar a los microorganismos hasta especie. En la última década, las tecnologías de secuenciación masiva han hecho posible que las poblaciones microbianas puedan ser analizadas con más profundidad, bien sea secuenciando el gen completo 16S rRNA, incrementando así la resolución de dicho marcador, o bien combinando la información de ese gen con la secuenciación de metagenomas completos. En este último tipo de análisis se obtienen secuencias de todo el material genómico presente en la muestra, lo que ofrece la gran ventaja de que además de hacer la clasificación taxonómica 1167


Rev Mex Cienc Pecu 2020;11(4):1150-1173

también se puede obtener información funcional de los genes detectados. Así, a pesar de las limitaciones del análisis bioinformático requerido, el empleo de estas metodologías permite realizar análisis más completos. No obstante, pese al desarrollo de las técnicas de secuenciación de alto rendimiento, la secuenciación dirigida del 16S rRNA en la plataforma de Sanger no está del todo obsoleta y la selección de la estrategia de análisis dependerá de los objetivos del estudio, del grado de precisión que se desee, del tamaño muestral y de los recursos económicos que se puedan destinar por parte del equipo investigador. Por ejemplo, si lo que se está buscando es la presencia y/o ausencia de un solo género bacteriano en particular, la secuenciación Sanger sería lo ideal ya que tiene la capacidad de secuenciar fragmentos relativamente grandes con mayor precisión que la de cualquier plataforma de secuenciación masiva. Si lo que se quiere es discriminar entre especies de un solo género bacteriano se pueden usar dos estrategias: la secuenciación de alguna región hipervariable del 16S rRNA con el uso de algún otro gen constitutivo (MLSA); o bien la secuenciación de todo el gen para obtener la información de todas las regiones hipervariables. Actualmente, la metagenómica se enfrenta a numerosos retos derivados de la gran cantidad de información generada, su almacenamiento y la forma en la que esta debe ser tratada. A pesar de que se han diseñado muchas herramientas y aplicaciones para el análisis bioinformático de metagenomas, no existe un solo “protocolo” de análisis, por lo que cada estudio debe ser adaptado a la naturaleza de las muestras y a los objetivos del experimento. En conclusión, en estudios de diversidad microbiana el uso del marcador molecular 16S rRNA siempre estará vigente para hacer clasificaciones taxonómicas, ya sea a través de la secuenciación de una o dos de sus regiones hipervariables o del gen completo, e incluso se puede combinar con el uso de otro gen constitutivo como marcador molecular para realizar una mejor clasificación taxonómica. Por otro lado, las tecnologías de secuenciación masiva han mejorado mucho la capacidad de estudio y la velocidad de análisis de metagenomas. Esto se ha producido de forma particular en muestras ambientales con importancia ecológica, en sanidad tanto humana como animal, en estudio simbióticos de plantas con hongos endófitos, en la evaluación de metagenomas ruminales, por mencionar algunas.

Literatura citada: 1.

Li W, Huan X, Zhou Y, Ma Q, Chen Y. Simultaneous cloning and expression of two cellulase genes from Bacillus subtilis newly isolated from Golden Takin (Budorcas taxicolor Bedfordi). Biochem Biophys Res Commun 2009;383(4):397-400.

2.

Sadet S, Martin C, Meunier B, Morgavi DP. PCR-DGGE analysis reveals a distinct diversity in the bacterial population attached to the rumen epithelium. Animal 2007;1(7):939-944. 1168


Rev Mex Cienc Pecu 2020;11(4):1150-1173

3.

Hess M, Sczyrba A, Egan R, et al. Metagenomic discovery of biomass-degrading genes and genomes from cow rumen. Science 2011;331(6016):463-467.

4.

Li RW, Connor EE, Li C, Ransom L, Baldwin VI, Sparks ME. Characterization of the rumen microbiota of pre-ruminant calves using metagenomic tools. Environ Microbiol 2012;14(1):129-139.

5.

Pinloche E, McEwan N, Marden JP, Bayourthe C, Auclair E, Newbold CJ. The Effects of a probiotic yeast on the bacterial diversity and population structure in the rumen of cattle. PLoS One 2013;8(7):e67824.

6.

Kumar M, Shrivastava N, Teotia P, et al. Omics: Tools for assessing environmental microbial diversity and composition. In: Varma A. SA, ed. Modern tools and techniques to understand microbes. Springer, Cham; 2017:273-283.

7.

Marshall IPG, Karst SM, Nielsen PH, Jørgensen BB. Metagenomes from deep Baltic Sea sediments reveal how past and present environmental conditions determine microbial community composition. Mar Genomics 2018;37:58-68.

8.

Simon C, Daniel R. Metagenomic analyses: Past and future trends. Appl Environ Microbiol 2011;77(4):1153-1161.

9.

Cowan D, Meyer Q, Stafford W, Muyanga S, Cameron R, Wittwer P. Metagenomic gene discovery: Past, present and future. Trends Biotechnol 2005;23(6):321-329.

10.

Streit WR, Schmitz RA. Metagenomics - The key to the uncultured microbes. Curr Opin Microbiol 2004;7(5):492-498.

11.

Pacheco-Arjona JR, Sandoval-Castro CA. Tecnologías de secuenciación del metagenoma del rumen. Trop Subtrop Agroecosyt 2018;21:587-598.

12.

Yu Z, Morrison M. Improved extraction of PCR-quality community DNA from digesta and fecal samples. BioTechniques 2004;36:808-812.

13.

Singh B, Bhat TK, Kurade NP, Sharma OP. Metagenomics in animal gastrointestinal ecosystem: a microbiological and biotechnological perspective. Indian J Microbiol 2008;48:216-227.

14.

Venter JC, Remington K, Heidelberg JF, et al. Environmental genome shotgun sequencing of the Sargasso sea. Science 2004;304(5667):66-74.

15.

Escobar-Zepeda A, Vera-Ponce de León A, Sanchez-Flores A. The road to metagenomics: From microbiology to DNA sequencing technologies and bioinformatics. Front Genet 2015;6:348.

1169


Rev Mex Cienc Pecu 2020;11(4):1150-1173

16.

Khlestkina EK. Molecular markers in genetic studies and breeding. Russ J Genet Appl Res 2014;4(3):236-244.

17.

Patwardhan A, Samit R, Roy A. Molecular markers in phylogenetic studies-A Review. J Phylogenetics Evol Biol 2014;02(02).

18.

D´Amore R, Ijaz UZ, Schirmer M, Kenny JG, Gregory R, Darby AC, et al. A comprenhensive benchmarking study of protocols and sequencing platforms for 16S rRNA community profiling. BMC Genomics. 2016;17:55.

19.

Clarridge JE. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin Microbiol Rev 2004;17(4):840862.

20.

Wu S, Baldwin RL, Li W, Li C, Connor EE, Li RW. The bacterial community composition of the bovine rumen detected using pyrosequencing of 16S rRNA genes. Metagenomics 2012;1:235571.

21.

Valenzuela-Gonzalez F, Martínez-Porchas M, Villalpando-Canchola E, VargasAlbores F. Studying long 16S rDNA sequences with ultrafast-metagenomic sequence classification using exact alignments (Kraken). J Microbiol Methods 2016;122:38-42.

22.

Ludwig W, Schleifer KH. Bacterial phylogeny based on 16S and 23S rRNA sequence analysis. FEMS Microbiol Rev 1994;15(2-3):155-173.

23.

Osorio CR, Collins MD, Romalde JL, Toranzo AE. Variation in 16S-23S rRNA intergenic spacer regions in Photobacterium damsalae: a Mosaic-Like structure. Appl Environ Microbiol 2005;71(2):636-645.

24.

Glaeser SP, Kämpfer P. Multilocus sequence analysis (MLSA) in prokaryotic taxonomy. Syst Appl Microbiol 2015;38(4):237-245.

25.

Case RJ, Boucher Y, Dahllöf I, Holmström C, Doolittle WF, Kjelleberg S. Use of 16S rRNA and rpoB genes as molecular markers for microbial ecology studies. Appl Environ Microbiol 2007;73(1):278-288.

26.

Sánchez-Herrera K, Sandoval H, Mouniee D, et al. Molecular identification of Nocardia species using the sodA gene: Identificación molecular de especies de Nocardia utilizando el gen sodA. New Microbes New Infect 2017;19:96-116.

27.

Dumont MG. Primers: Functional marker genes for Methylotrophs and Methanotrophs. In: McGenity T, Timmis KNB, editors. Hydrocarbon and lipid microbiology protocols - Springer Protocols Handbooks. Berlin: Springer Protocols Handbooks; 2014.

1170


Rev Mex Cienc Pecu 2020;11(4):1150-1173

28.

Kolb S, Stacheter A. Prerequisites for amplicon pyrosequencing of microbial methanol utilizers in the environment. Front Microbiol 2013;4(SEP):1-12.

29.

Logares R, Sunagawa S, Salazar G, Cornejo-Castillo FM, Ferrera I, Sarmento H, et al. Metagenomic 16S rDNA Illumina tags are a powerful alternative to amplicon sequencing to explore diversity and structure of microbial communities. Environ Microbiol. 2014;16(9):2659-2671.

30.

Zinicola M, Higgins H, Lima S, Machado V, Guard C, Bicalho R. Shotgun metagenomics sequencing reveals functional genes and microbiome associated with bovine digital dermatitis. PLoS ONE 2015;10(7)e0133674.

31.

Ross EM, Moate PJ, Bath CR, Davidson SE, Sawbridge TI, Guthridge KM, Cocks BG, Hayes BJ. High throughput whole rumen metagenome profiling using untargeted massively parallel sequencing. BMC Genetics 2012;13:53.

32.

Ranjan R, Rani A, Metwally A, McGee HS, Perkins DL. Analysis of microbiome: Advantages of whole genome shotgun versus 16S amplicon sequencing. Biochem Biophys Res Commun 2016;469:967-977.

33.

Meyer F, Paarmann D, D`Souza M, Olson R, Glass EM, Kubal M, et al. The metagenomics RAST server - a public resource for the automatic phylogenetic and functional analysis of metagenomes. BMC Bioinformatics 2008;9:386.

34.

Schloss PD, Westcott S. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol 2009;75(23):7537-7541.

35.

Kuczynski J, Stombauhg, Walters WA, Gonzalez A, Caporaso JG, Knight R. Using QIIME to analyze 16S rRNA gene sequences from microbial communities. Curr Protoc Bioinformatics 2011;10:7.

36.

Ahmed SA, Lo CC, Li PE, Davenport KW, Chain PSG. From raw reads to trees: Whole genome SNP phylogenetics across the tree of life. bioRxiv 2015:032250.

37.

Mori H, Maruyama T, Yano M, Yamada T, Kurokawa K. VITCOMIC2: visualization tool for the phylogenetic composition of microbial communites based on 16S rRNA gene amplicons and metagenomic shotgun sequencing. BMC Systems Biol 2018;12(2):30.

38.

Miao J, Han N, Qiang Y, Zhang T, Li X, Zhang W. 16SPIP: a comprehensive analysis pipeline for rapid pathogen detection in clinical samples based on 16S metagenomic sequencing. BMC Bioinformatics 2017;18(16):568.

1171


Rev Mex Cienc Pecu 2020;11(4):1150-1173

39.

Langille MGI, Zaneveld J, Caporaso JG, et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat Biotechnol 2013;31(9):814-82.

40.

Human Microbiome Project Consortium. A framework for human microbiome research. Nature 2012;13;486(7402):215-21. doi: 10.1038/nature11209.

41.

Basak P, Pramanik A, Sengupta S, Nag S, Bhattacharyya A, Roy D, Pattanayak R, Ghosh A, Chattopadhyay D, Bhattachryya M. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing. Genomics Data 2016;7:76-78.

42.

Nair HP, Puthusseri RM, Vincent H, Bhat SG. 16S rDNA-based bacterial diversity analysis of Arabian Sea sediments: A metagenomic approach. Ecol Genet Genomics 2017;3(5):47-51.

43.

Chan CS, Chan KG, Tay YL, Chua TH, Goh KM. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing. Front Microbiol 2015;6:177.

44.

Thiel V, Wood JM, Olsen MT, Tank M, Katt CG, Ward DM, Bryant DA. The dark side of the mushroom spring microbial mat: Life in the shadow of chlorophototrophs. I. Microbial diversity based on 16S rRNA gene amplicons and metagenomic sequencing. Front Microbiol 2016;7:919.

45.

Kayani MR, Doyle SM, Sangwan N, Wang G, Gilbert JA, Christner BC, Zhu TF. Metagenomic analysis of basal ice from an Alaskan glacier. Microbiome 2018;6:123.

46.

PaĂŻsse S, Valle C, Servant F, Courtney M, Burcelin R, Amar J, Lelouvier B. Comprehensive description of blood microbiome from healthy donors assessed by 16S targeted metagenomic sequencing. Transfusion 2016;56:1138-1147.

47.

Salazar JK, Carstens CK, Ramachandran P, Shazer AG, Narula SS, Reed E, Ottesen A, Schill KM. Metagenomics of pasteurized and unpasteurized gouda cheese using targeted 16S rDNA sequencing. BMC Microbiology 2018;18:189.

48.

Mohd-Shaufi MA, Sieo CC, Chong CW, Gan HM, Ho YW. Deciphering chicken gut microbial dynamics based on high-throughput 16S rRNA metagenomics analyses. Gut Pathog 2015;7:4

49.

Pan X, Xue F, Nan X, Tang Z, Wang K, Beckers Y, Jiang L, Xiong B. Illumina sequencing approach to characterize thiamine metabolism related bacteria and the impacts of thiamine supplementation on ruminal microbiota in dairy cows fed highgrain diets. Front Microbiol 2017;8:1818. 1172


Rev Mex Cienc Pecu 2020;11(4):1150-1173

50.

Wakchaure R, Ganguly S, Para PA, Praveen PK, Qadri K. Molecular markers and their applications in farm animalsâ&#x20AC;Ż: A Review. Int J Recent Biotechnol 2015;3(January 2016):23-29.

51.

Kumar A, Tomar SS, Kumar A, Singh J. Importance of molecular markers in livestock improvement: a review. Int J Agric Res Innov Technol 2017;5(4):614-621.

52.

Lang T, Li G, Yu Z, Ma J, Chen Q, Yang E, Yang Z. Genome-wide distribution of novel Ta-3A1 mini-satellite repeats and its use for chromosome identification in wheat and related species. Agronomy 2019;9(2):60.

53.

Beuzen ND, Stear MJ, Chang KC. Molecular markers and their use in animal breeding. Vet J 2000;160(1):42-52.

54.

Vignal A, Milan D, San Cristobal M, Eggen A. A review on SNP and other types of molecular markers and their use in animal genetics. Genet Sel Evol 2002;34(2002):275-305.

55.

Duran C, Singhania R, Raman H, Batley J, Edwards D. Predicting polymorphic ESTSSRs in silico. Mol Ecol Resour 2013;13(3):538-545.

56.

Yu H, Xie W, Wang J, et al. Gains in QTL detection using an ultra-high density SNP map based on population sequencing relative to traditional RFLP/SSR markers. PLoS One 2011;6(3).

57. Wilkinson TJ, Huws SA, Edwards JE, Kingston-Smith A, Siu Ting K, et al. CowPI: a rumen microbiome focused version of the PICRUSt functional inference software. Frontiers in Microbiol 2018;(9):1095. 58. Wood DE, Salzberg SL. Kraken: ultrafast metagenomics sequence classification using exact alignments. Genome Biology. 2014;15(3):R46. 59. Menzel P, Ng KL, Krogh A. Fast and sensitive taxonomic classification for metagenomics with Kaiju. Nature communications 2016;7:11257.

1173


https://doi.org/10.22319/rmcp.v11i4.5171 Revisión bibliográfica

Origen metabólico y propiedades bioactivas de ácidos grasos ramificados e impares en leche de rumiantes. Revisión

Pilar Gómez-Cortés a* Miguel Ángel de la Fuente a

a

Instituto de Investigación en Ciencias de la Alimentación (CSIC-UAM), Nicolás Cabrera, 9. Universidad Autónoma de Madrid, 28049 Madrid, España.

* Autor de correspondencia: p.g.cortes@csic.es

Resumen: Los ácidos grasos de cadena impar y ramificada (AGCIR) son un grupo de lípidos en la leche que no supera el 5 % de los ácidos grasos (AG) totales, y que agrupa a un conjunto de moléculas entre las cuales los isómeros de los AG pentadecanoico (15:0, iso 15:0 y anteiso 15:0), hexadecanoico (iso 16:0) y heptadecanoico (17:0, iso 17:0 y anteiso 17:0) son los más abundantes. Los AGCIR son sintetizados por microorganismos ruminales a partir de moléculas producidas durante los procesos de la fermentación de alimentos. Investigaciones recientes señalan la posibilidad de síntesis endógena de algunos AG de cadena impar (15:0 y 17:0) y ramificada (iso 17:0 y anteiso 17:0). La presencia de estos AG en la leche está influenciada por factores dietéticos, principalmente con la proporción de almidón vs fibra, la relación forraje/concentrado y la suplementación con fuentes de grasa que generan cambios en el metabolismo lipídico, que inducen modificaciones en el perfil de AGCIR de la leche. La leche y los productos lácteos son la principal y casi única fuente de AGCIR de la dieta humana. A pesar de su baja concentración, los AGCIR representan propiedades bioactivas que han sido puestas de manifiesto en distintas investigaciones. Este trabajo revisa el origen metabólico, las propiedades bioactivas, así como las más recientes estrategias alimenticias dirigidas para manipular los contenidos y perfiles de AGCIR en la grasa láctea. Palabras clave: Rumiante, Ácidos grasos, Leche, Productos lácteos, Rumen, Lípidos.

1174


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

Recibido: 30/11/2018 Aceptado: 23/10/2019

Introducción Los lípidos de la leche se encuentran físicamente en forma de glóbulos formando una emulsión con la fase acuosa. En el interior de estos glóbulos se encuentran los triacilglicéridos (TG), que consisten en moléculas de glicerol esterificadas cada una con tres ácidos grasos (AG). Los TG, al ser los más abundantes (más del 95 % de los lípidos totales), son los principales responsables de las propiedades de los lípidos de la leche, y sus características varían en función de la composición de AG. Aunque la grasa de leche contiene más de 400 AG diferentes(1), apenas 30 o 40 están presentes en concentraciones superiores al 0.1 %. El perfil de AG de la leche y los productos lácteos siendo el principal relacionado con factores dietéticos, seguido por la especie de rumiante, y en menor grado, factores genéticos, rendimiento lechero y el estado de lactación. Considerando su estructura, los AG se dividen en saturados o insaturados. La mayor parte de los AG saturados contienen un número par de átomos de C, con longitudes que van de 4 hasta 20C. Aunque los más abundantes son los que tienen una longitud de cadena de 10 a 20 átomos de C, la grasa de leche de rumiante se caracteriza por la presencia de cantidades importantes de AG de cadena corta, especialmente el 4:0 y el ácido caproico (6:0). Dentro del grupo de insaturados, los cuales pueden tener de uno a cuatro enlaces, el más abundante (15 a 20 %) es el ácido oleico (cis-9 18:1). La presencia de pequeñas cantidades de ácidos linoleico (2 %) y α-linolénico (0.5 %) en la leche es originaria de la dieta ya que ambos no son sintetizados en los tejidos, por lo que se les da un carácter de AG esenciales. La leche de rumiantes contiene además AG de número impar de átomos de carbono y los de cadena metil-ramificada (AGCIR). Los de número impar de átomos de C representan 2 % del total de AG, siendo 15:0 y 17:0 los más abundantes y representativos (Cuadro 1). Los de cadena ramificada se encuentran en una proporción similar y engloban a un mayor número de moléculas, clasificadas como iso y anteiso, con concentraciones variables en productos lácteos. Aunque en conjunto los niveles en grasa láctea de AGCIR no suelen superar el 5 %, su presencia tiene gran interés porque se utilizan como indicadores de funcionamiento ruminal y, en humanos, como indicadores de la ingesta de productos lácteos. En comparación con sus homólogos no ramificados, los AG de cadena ramificada presentan puntos de fusión más bajos, especialmente los anteisos, característica que los permite contribuir a mantener la fluidez de la grasa láctea.

1175


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

Cuadro 1: Contenido (g/100 de ácidos grasos totales) de ácidos grasos de cadena impar y ramificada en productos lácteos Ácido graso iso 13:0 iso 14:0 iso 15:0 iso 16:0 iso 17:0 iso 18:0 anteiso 13:0 anteiso 15:0 anteiso 17:0 15:0 17:0

Leche (7)

Mant.

(58)

Yogurt

(59)

Nata

Queso

(43)

0.04 0.05-0.13

0.09

0.17

0.12-0.13

0.00-0.05

0.00-0.22

0.14-0.22

0.22

0.10

0.14-0.15

0.00-0.11

0.02-0.42

0.21

0.34

0.29-0.30

0.24

0.00-1.18

0.27

0.31

0.16-0.25

0.27-0.30

0.05-0.30

<0.01

0.00-0.04

<0.01

0.00-0.09

0.46

0.63

0.62-0.63

0.46-0.49

0.38-0.88

0.50

0.38

0.56-0.59

0.36-0.37

0.29-0.61

0.08 0.32-0.45

0.84-1.31 0.45-0.66

0.89 0.52

0.55-0.90 (7)

Mant= mantequilla; Fievez et al ; O´Donnell-Megaro et al(58); Shingfield et al(59); Ran-Ressler et al(43).

Aunque una gran proporción de los AGCIR contenidos en la grasa láctea son formados durante los procesos fermentativos en rumen, se ha sugerido recientemente que una pequeña cantidad podría sintetizarse en forma endógena (vgr. tejido mamario). Además, en la última década se han multiplicado las evidencias que apuntan que los AGCIR podrían jugar un papel relevante en la salud humana. Por ello, su presencia en los productos lácteos debería ser contemplada de forma positiva, ya que estos alimentos son casi la única fuente de estos componentes en la dieta. El objetivo de este manuscrito es, por un lado, actualizar la información sobre el origen y la síntesis de estos AG en rumiantes, revisando la influencia del tipo de alimentación sobre su contenido en leche y, por otro, recopilar las evidencias sobre los beneficios nutricionales que la presencia de estos componentes podría reportar en humanos.

Origen de los ácidos grasos de cadena impar y ramificada Síntesis ruminal de AGCIR Una de las características de la grasa de leche de rumiantes respecto a la de otros mamíferos es la alta concentración de AGCIR. Vlaeminck et al(2) recopilaron datos de

1176


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

numerosos estudios sobre la composición de AGCIR en leche y mostraron que los principales AGCIR son isómeros de los AG tetradecanoico (iso 14:0), pentadecanoico (15:0, iso 15:0 y anteiso 15:0), hexadecanoico (iso 16:0) y heptadecanoico (17:0, iso 17:0 y anteiso 17:0). Los AGCIR son sintetizados principalmente durante los procesos de fermentación microbiana a nivel ruminal. Las bacterias ruminales contienen entre 50 y 90 g/kg de lípidos en su materia seca, y alrededor de un 5 % de los mismos son AGCIR que se localizan preferentemente en las membranas(3). Los protozoos poseen menos AGCIR totales que las bacterias (110 vs 160 g/kg de AG totales), aunque presentan una mayor proporción de iso 16:0 y anteiso 17:0(4). Los precursores de la síntesis microbiana de AG ramificados en el rumen son leucina, isoleucina, y valina, aminoácidos de cadena ramificada procedentes de la dieta (Figura 1). Inicialmente la microbiota ruminal transforma estos aminoácidos en ácidos carboxílicos ramificados de cadena corta, isovalérico, 2-metil-butírico e isobutírico, respectivamente, unidos a la coenzima A. A continuación, se produce la elongación de cadena de estos AG gracias a la actividad de la enzima AG sintasa (AGS) de los microorganismos. Los iso de cadena par se originan a partir del ácido isobutírico, mientras que los iso y anteiso de cadena impar se generan a partir de los ácidos isovalérico y 2metil-butírico, respectivamente. El precursor de los AG impares de cadena media (13:0, 15:0 y 17:0) en el rumen es el ácido propiónico, que procede de la fermentación de ciertos componentes de la ración, aunque los AG 15:0 y 17:0 también pueden originarse por αoxidación a partir de los AG 16:0 y 18:0 presentes en los lípidos de la dieta. Figura 1: Síntesis de ácidos grasos de número de carbono impar y de cadena ramificada por la microbiota del rumen

Adaptada de Vlaeminck et al.(2) 1177


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

El perfil de AGCIR que se origina tras la digestión ruminal está fuertemente ligado a la actividad de los microorganismos presentes en esta cavidad digestiva(2). De ahí, que la variación en el perfil de AGCIR sea un reflejo de la abundancia relativa de las distintas especies de microorganismos que conforman el ecosistema ruminal(5-6). Las bacterias celulolíticas, es decir, aquellas que poseen enzimas capaces de hidrolizar la celulosa como Ruminococcus flavefaciens, Ruminococcus albus o Butyrivibrio fibrisolvens poseen contenidos destacados de AGCIR iso(7). Mayores proporciones de anteiso 15:0 indicarían la presencia de bacterias especializadas en la fermentación de pectina y azúcares(8) como Prevotella spp., Lachnospira multiparus y Succinovibrio dextrinosolvens. Las bacterias amilolíticas o digestoras de almidón como Succinivibrio dextrinosolvens, Succinimonas amylolytica, Ruminobacter amylophilus, Selenomonas ruminantium y Streptococcus bovis contienen una menor proporción de AG de cadena ramificada pero destacan por poseer más de cadena impar(2).

Transferencia de AGCIR desde el tracto digestivo a la glándula mamaría

Es bien conocido el papel preponderante de los microorganismos ruminales en la presencia de AGCIR en productos lácteos(9). Aunque informes recientes(2,10) han cuestionado que la correlación entre el contenido de AGCIR en el fluido intestinal y la grasa láctea sea tan estricta. Teóricamente, se podrían producir desajustes durante la transferencia de estos AG desde el aparato digestivo a los tejidos internos, particularmente en la glándula mamaria. Tales desajustes podrían tener lugar durante el proceso de absorción intestinal o durante el transporte a través del torrente sanguíneo. Al igual que otros AG que alcanzan el intestino delgado, los AGCIR son absorbidos en el yeyuno. Aparentemente la absorción intestinal de los AG de origen microbiano sería más alta(11), pero los pocos datos de los que se dispone no son suficientes para emitir una conclusión definitiva. Tras su absorción, tanto los AGCIR como el resto de AG, son esterificados en el glicerol para formar TG y fosfolípidos (FL) por las células epiteliales intestinales y transportados, primero al sistema linfático y posteriormente al torrente sanguíneo, donde entran a formar parte de complejos macromoleculares como quilomicrones y lipoproteínas de muy baja densidad (VLDL). Tanto quilomicrones como VLDL contienen distintas clases de lípidos (TG, FL, ésteres de colesterol (EC) y ácidos grasos libres) pero cada una de ellas difiere en composición puesto que cada tipo de AG se enlaza selectivamente a las distintas fracciones. El acceso de los AG desde el torrente sanguíneo al citoplasma de las células de la glándula mamaria se realiza una vez liberados de dichas macromoléculas, a través de la acción de la enzima lipoproteína lipasa (Figura 2).

1178


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

Figura 2: Vías metabólicas de síntesis de ácidos grasos en las células de la glándula mamaría de rumiantes

ACC: acetil-CoA carboxilasa; AGS: ácido graso sintasa; AG: ácido graso; TG: triacilglicérido; VLDL: lipoproteínas de muy baja densidad.

La principal diana de la lipoproteína lipasa son los AG de los TG. Por el contrario, los AG característicos de las fracciones de EC y FL se transfieren más pobremente a la grasa de leche debido a la baja afinidad de dicha enzima por ellas. Fievez et al(7) reportaron que los AG de cadena ramificada son más abundantes en los EC y los TG que en los FL o los ácidos grasos libres. Estas dos últimas fracciones, en contraste, son más ricas en AG de cadena impar. Sin embargo, la literatura disponible sobre la distribución de los AGCIR entre los diferentes tipos de lípidos del plasma es aún muy escasa para predecir tendencias o pronosticar comportamientos metabólicos consolidados. Por tanto, merecería la pena explorar en detalle los procesos metabólicos que tienen lugar en las células de la glándula mamaría, para encontrar los mecanismos responsables de las diferencias de los perfiles de AGCIR entre el líquido ruminal y la leche.

Síntesis endógena de AGCIR

La mayor parte de los AG saturados de número par de átomos de C presentes en la grasa láctea se sintetizan de novo en las células epiteliales de la glándula mamaria(12). Su síntesis se produce a partir de las moléculas de acetato y β-hidroxibutirato circulantes en el torrente sanguíneo, generadas en el rumen durante la fermentación de los hidratos de 1179


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

carbono de la dieta. Las dos enzimas responsables de esta síntesis de novo en la glándula mamaria son la acetil-CoA carboxilasa (ACC) y la AGS (Figura 2). El primer paso de la síntesis consiste en la activación del acetato a acetil-CoA, seguido de la condensación de dos moléculas de acetil-CoA para formar malonil-CoA. Esta etapa es catalizada por la ACC. A continuación, la AGS regula la elongación de cadena de los AG sintetizados de novo. Si el sustrato inicial en lugar del acetato fuese el propionato, su derivado el metilmalonato, o AG volátiles ramificados (isovalérico, isobutírico y 2-metilbutirico) los productos finales de la síntesis de novo serían potencialmente AG impares, AG metil sustituidos no terminales, o iso y anteiso, respectivamente tal como ocurre en el rumen (Figura 1). Los primeros trabajos llevados a cabo en este campo demostraron que 15:0 y 17:0 podrían ser sintetizados de novo en la glándula mamaría de rumiantes utilizando propionil-CoA en lugar de acetil-CoA como molécula cebadora o iniciadora(13). La elongación de dicha molécula catalizada por la AGS explicaría la presencia en leche de 5:0, 7:0, 9:0 y 11:0 así como el incremento de las cantidades de 13:0, 15:0 y 17:0 respecto a las ya generadas en el rumen y transferidas desde el duodeno. La importancia de esta síntesis endógena se vio confirmada en trabajos posteriores(10,14,15). Teóricamente estos AG de cadena impar (13:0, 15:0 y 17:0) podrían a su vez ser metabolizados a cis-monoinsaturados por acción de la enzima delta-9 desaturasa. Sin embargo, únicamente la conversión de 17:0 a cis-9 17:1 parece tener importancia cuantitativa(16) (Figura 2). En contraste a los AG de cadena impar, la síntesis mamaria de los AG iso y anteiso no respondió al aumento de disponibilidad de sus precursores biológicos, los AG isovalérico, 2-metil-butírico e isobutírico(13,14). Esta observación sería un indicio de que la enzima AGS podría no ser activa en el proceso de elongación y, por tanto, la síntesis de novo no tendría lugar en tejidos extraruminales. Estos resultados estarían, sin embargo, en aparente contradicción con los incrementos en los contenidos de iso 17:0 e anteiso 17:0 en grasa láctea, respecto a su presencia en el fluido intestinal, reportados por otros investigadores(2,10,17). Fievez et al(7) postularon que los valores más bajos que se desprendían de las relaciones iso 15:0/iso 17:0 y anteiso 15:0/anteiso 17:0 en leche comparadas con las de fluido duodenal podrían ser explicados si se demostrase viable la elongación de cadena de las moléculas de iso 15:0 y anteiso 15:0 una vez absorbidos al torrente sanguíneo. Parecía llamativo en este sentido que la secreción en la leche de iso 15:0 + iso 17:0 y anteiso 15:0 + anteiso 17:0 era muy similar a la suma de estos AG en el duodeno(7). Tales datos reforzaron la hipótesis sobre la existencia de una actividad elongasa extraruminal sobre los AG iso y anteiso de 15 átomos de C y además apoyó la idea de una transferencia casi completa de los AG de cadena ramificada totales desde el duodeno a la leche. En un estudio posterior Vlaeminck et al(15) observaron mayores niveles de iso 17:0 y anteiso 17:0 en grasa de leche, en comparación con sus contenidos en fluido duodenal (Cuadro 2). Este hecho, junto con unas relaciones iso-15:0/iso-17:0 y anteiso 15:0/anteiso 17:0 más bajas en leche descartarían la síntesis de novo postruminal de estos AG y 1180


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

confirmarían el papel predominante de elongasas post-absorción que ejercerían su actividad sobre los AG iso 15:0 y anteiso 15:0. El valor más bajo de la relación iso 15:0/iso 17:0 y anteiso 15:0/anteiso 17:0 en los TG del plasma sanguíneo, respecto a las muestras del fluido duodenal sería además un indicio de que la elongación podría tener lugar en tejidos distintos a la glándula mamaria.

Cuadro 2. Proporción de ácidos grasos del plasma sanguíneo de vacas Plasma sanguíneo Acido PDuodeno Leche TG AGL graso Ensayo g/100 g de ácidos grasos impares y de cadena value ramificada totales iso 15:0 1 12.87d 7.20b 9.13c 6.22ª <0.001 c b b 2 10.45 5.42ª 6.80 7.54 <0.001 d b c anteiso 15:0 1 26.98 14.54 19.07 12.47ª <0.001 c ab b 2 33.57 13.22ª 15.00 19.06 <0.001 b c d iso 17:0 1 5.76ª 8.85 10.02 13.45 <0.001 b b 2 5.79ª 6.64ª 9.54 10.09 <0.001 b bc c anteiso 17:0 1 7.32ª 13.24 14.21 15.50 <0.001 bc b c 2 9.90ª 16.18 14.41 17.63 <0.001 Relaciones C15/C17 iso 15:0/iso 1 2.28c 0.83b 0.92b 0.48ª <0.001 17:0 2 1.82b 1.18ab 0.78ª 0.77ª <0.001 b ant 15:0/ant 1 3.98 1.10ª 1.37ª 0.82ª <0.001 17:0 2 3.73ª 0.84b 1.10b 1.13b <0.001 a-d

TG= triacilglicéridos; AGL= ácidos grasos libres. Valores de una fila con un superíndice distinto son diferentes (P<0.05). Fuente: Vlaeminck et al(15).

La sobreexpresión del gen que codifica la elongasa ELOVL6 en rumiantes está descrita en células epiteliales mamarias(18), y, más recientemente, un estudio in vitro ha sido el primero en valorar el papel de esta enzima en la regulación de la elongación de AG(19). La sobrerregulación de ELOVL6 aumenta los índices de elongación de 16:0 y 18:0, lo que sugiere un papel importante de este enzima en el control de longitud de cadena de los AG en la glándula mamaría. Sin embargo, sus efectos sobre los AG ramificados todavía quedan pendientes por ser investigados.

1181


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

Influencia de la dieta del ganado sobre los contenidos de AGCIR en leche La composición química de la ración, tal como la proporción de almidón y fibra, la relación forraje/concentrado (F/C), así como el perfil lipídico en la dieta ejercen una gran influencia sobre el tipo de poblaciones microbianas ruminales y sobre la síntesis microbiana de AG, por lo tanto, la proporción de AGCIR que llega a intestino delgado es un reflejo de la composición y cantidad de microbiota en rumen(2,3,20).

Efectos de la dieta base Entre los distintos componentes de la dieta, la proporción de almidón y fibra juega un papel relevante en la producción de AGCIR a través de su influencia en el ecosistema microbiano, en particular sobre la proliferación de cepas bacterianas celulolíticas(21,22). Un aumento de almidón en las raciones limita el crecimiento de microorganismos celulolíticos, promoviendo la proliferación de bacterias amilolíticas. Como ya se expuso, las bacterias celulolíticas contienen en sus membranas predominantemente AG ramificados iso(7) y son sensibles a valores bajos de pH ruminal que son los característicos de alimentos con alto contenido de almidón(23). Vlaeminck et al(2) observaron que dietas ricas en almidón, caracterizadas por una mayor proliferación de bacterias amilolíticas, disminuían los niveles de iso 14:0, iso 15:0 e iso 16:0 (Cuadro 3). Cuadro 3: Contenido medio (g/100g de ácidos grasos totales) de ácidos grasos de cadena impar y ramificada en leche de rumiantes alimentados con diversos ingredientes Acido graso

iso 13:0 iso 14:0 iso 15:0 iso 16:0 iso 17:0 iso 18:0 anteiso 13:0 anteiso 15:0 anteiso 17:0 11:0 13:0 15:0 17:0

Shingfield et al(60) EP EM 0.03 0.08 0.21 0.21 0.74 0.03 0.05

0.04 0.06 0.18 0.23 0.91 0.01 0.07

0.39

0.37

1.22 0.63

0.78 0.54

Vlaeminck et al(2) EP EM

Patel et al(24)

Li et al(25)

EPA

RF

EPB

PF

Cívico et al(27) RF

RA

0.02 0.07 0.17 0.19 0.27 0.05

0.01 0.03 0.14 0.15 0.23 0.04

0.09 0.24 0.18 0.19

0.05 0.17 0.16 0.23

0.08 0.21 0.26 0.47

0.07 0.18 0.26 0.33

0.14 0.32

0.13 0.23

0.38

0.49

0.46

0.46

0.42

0.39

0.49

0.45

0.30

0.22

0.46

0.55

0.89

0.76

0.29

0.26

1.21 0.55

0.20 0.09 1.00 0.73

0.22 0.09 0.98 0.68

0.82

0.62

0.95 0.48

1.06 0.67

0.94 0.53

EP= ensilado de pasto; EM= ensilado de maíz; EPA= ensilado de pasto alto; EPB= ensilado de pasto bajo; RF= rico en fibra; PF= pobre en fibra; RA= rico en almidón.

1182


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

Estudios posteriores han reforzado la idea de la influencia que la proporción de fibra y almidón tiene sobre el contenido de AGCIR de la leche (Cuadro 3). Patel et al(24) reportaron que un aumento de fibra a través de la presencia de ensilados de pasto en las raciones aumentaba los contenidos en leche de iso 15:0, iso 17:0, 15:0 y 17:0 mientras que la sustitución de fibra en detrimento de almidón en la dieta incrementaba la proporción de iso 15:0 tanto en leche(25) como en el rumen(26). Estas respuestas se asociaron a una mayor abundancia de bacterias celulolíticas frente a las amilolíticas. Por otra parte, Cívico et al(27) midieron niveles más elevados de iso 14:0, iso 17:0 y 15:0 en grasa láctea cuando la alimentación estaba enriquecida en fibra y era pobre en almidón (Cuadro 3). La relación F/C en las raciones podría modificar los contenidos de AGCIR de los productos lácteos. Vlaeminck et al(2) concluyeron que una proporción mayor de forraje en la dieta base contribuía a un aumento selectivo de ciertos AGCIR como iso 14:0 e iso 15:0. En contraste, los niveles de anteiso 15:0 fueron menos afectados. Estos resultados se explican por cambios en el ecosistema ruminal inducidos por la variación en la relación F/C de las dietas. Un aumento de concentrado favorecería la proliferación de bacterias amilolíticas. podría aumentar los anteisos y los de cadena impar. Se han observado(10) niveles más bajos de 15:0 y 17:0 en leche de vacas alimentadas con dietas con una elevada relación F/C. El análisis de fluidos digestivos extraídos de cabras canuladas duodenalmente constató que el aumento de la relación F/C en la ración causaba un aumento de todos los AGCIR sintetizados de novo por las bacterias(5). Un experimento similar llevado a cabo en vacuno(28) mostró resultados parecidos. Más recientemente, Zhang et al(29) confirmaron que los perfiles de AGCIR en fluidos digestivos en bovino son afectados de forma drástica por la relación F/C de la dieta base. Las concentraciones de 11:0, 13:0, iso 15:0, iso 16:0, iso 17:0 y 17:0 eran más altas cuando la proporción de forraje en la ración era mayor. También observaron que sólo los anteiso 15:0 y 15:0 aumentaban con proporciones más elevadas de concentrado.

Efectos de la suplementación lipídica Los niveles de AGCIR en productos lácteos muestran una disminución significativa cuando proceden de animales cuya dieta ha sido suplementada con fuentes lipídicas. Esta pauta, observada en leche bovina(6,30) y de pequeños rumiantes(31,32) es característica de la suplementación con semillas de oleaginosas ricas en AG insaturados. Estos resultados podrían ser explicados por el efecto inhibitorio que los ácidos grasos poliinsaturados (PUFA) ejercen sobre la microbiota intestinal. La severidad del efecto de los AG incorporados de la dieta sobre la viabilidad de las bacterias del rumen es mayor a medida que aumenta el número de insaturaciones de las moléculas. Así mismo los efectos serían más acusados si la configuración geométrica de los dobles enlaces es de tipo cis(2,3). Además, no todos los microorganismos se verían afectados de la misma forma por la 1183


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

suplementación lipídica de la dieta. Se ha observado que las bacterias celulolíticas y Gram positivas son más sensibles a los lípidos dietéticos que las bacterias amilolíticas y Gram negativas(20,33,34).

Ácidos grasos ramificados como componentes bioactivos Microbiota intestinal de neonatos Estudios recientes han destacado el papel de los AG ramificados como componentes bioactivos protectores de la salud. La presencia de AG ramificados es muy escasa en los tejidos humanos de adultos pero, en contraste, son componentes bioactivos esenciales del tracto digestivo en los estadios finales del desarrollo fetal y tras el parto(35). Aproximadamente, 30 % de los AG totales presentes en el vérnix caseoso son AG de cadena ramificada, con una gran variedad de estructuras moleculares entre las que destacan el iso 14:0 y el iso 16:0(35). El vérnix es un material ceroso con una textura similar al queso que reviste la piel del feto y del recién nacido. Consiste en una mezcla de secreciones grasas originadas a partir de la 18 semana de gestación procedentes de las glándulas sebáceas. El vérnix evita la pérdida de agua, protegiendo la piel del feto de la deshidratación, impidiendo su endurecimiento y disminuyendo las rozaduras y el agrietamiento. Además, contribuye a regular la temperatura del feto al actuar como una capa aislante. No existe otro mamífero terrestre que produzca neonatos cubiertos de vérnix, en contraste a lo que ocurre con los fetos de mamíferos acuáticos que presentan esta misma película grasa compuesta por AG ramificados(36). Una hipótesis complementaria señala el papel del vérnix como agente antibacteriano. Esta idea se basa en que, durante los últimos meses del embarazo, las partículas de vérnix se desprenden de la piel y pasan al líquido amniótico incrementando su turbidez. En el último trimestre de gestación el feto ingiere buena parte del líquido amniótico y, de esta forma, su intestino quedaría impregnado de los AG ramificados presentes en el vérnix(35). Por otra parte, la gran cantidad de AG ramificados detectados en el meconio (las primeras heces fecales del neonato) constituye un indicio suficientemente relevante sobre el tipo de microorganismos que comienzan a colonizar el tracto intestinal del recién nacido y que se vería favorecido por la presencia de estos prebióticos no fermentables(35). Como se ha expuesto en párrafos precedentes, los AG ramificados están entre las moléculas más importantes de las membranas de muchos microorganismos, particularmente de la mayoría de las especies del genero bacilli (37). Se ha observado que la sustitución de grasa de la dieta por AG ramificados en crías de ratas neonatas favorece la alteración de su microbioma. Estos cambios se traducen en aumentos de los microorganismos capaces de incorporar AG ramificados en sus membranas y una reducción simultánea de la incidencia de enterocolitis necrotizante(38), una de las mayores causas de mortalidad en neonatos prematuros. También se sabe por estudios in vitro que los AG ramificados reducirían la

1184


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

motilidad y presumiblemente la virulencia de patógenos como Pseudomonas aeruginosa(39). La elevada concentración de AG ramificados, como consecuencia de la presencia del vérnix en el lumen intestinal del feto, es probable que juegue además un papel importante en el crecimiento y metabolismo de los enterocitos, así como en la salud y la regulación intestinal. Trabajos recientes han observado que los AG ramificados pueden ser incorporados a los FL de las membranas de los enterocitos, confiriéndoles actividad antiinflamatoria(40,41). Liu et al(42) postularon que esta incorporación de los AG ramificados en los FL contribuiría a modular las propiedades biofísicas de las membranas. Los AG ramificados tienen asignadas funciones biofísicas equiparables a los AG monoinsaturados con configuración cis pero tienen la ventaja de presentar una mayor estabilidad oxidativa por la ausencia de dobles enlaces en su estructura. Por otra parte, los menores puntos de fusión de los AG ramificados respecto a sus homólogos lineales estarían relacionados con el mantenimiento de la fluidez de las membranas celulares(43).

Otras propiedades bioactivas de los ácidos grasos de cadena ramificada Además de sus efectos positivos sobre la composición de la microbiota intestinal, la presencia de AG ramificados en la dieta podría redundar beneficiosamente en la prevención de distintas enfermedades. El primer trabajo donde se atribuye actividad anticancerígena a los AG ramificados data de principios de este siglo(44). En dicho estudio se describen los efectos inhibitorios de iso 15:0 sobre la proliferación celular y la inducción de la apoptosis en líneas celulares de cáncer de próstata, leucemia y adenocarcinoma. Más recientemente, Cai et al(45) dieron cuenta de que el iso 15:0 podría contribuir a la inhibición de linfomas humanos. Estudios desarrollados por otros investigadores(46,47) determinaron que los AG ramificados podrían también inducir apoptosis en células de cáncer de mama e inhibir el desarrollo de tumores en cultivos celulares y modelos animales. Por otro lado, un reciente estudio en humanos con sobrepeso(48) ha apuntado por primera vez la posibilidad de que la abundancia de AG ramificados iso en suero sanguíneo pueda correlacionarse inversamente con la presencia de TG y asociarse negativamente con otros indicadores característicos de procesos inflamatorios. En todo caso, los efectos beneficiosos de este grupo de AG precisan más investigaciones que contribuyan a esclarecer los mecanismos que subyacen en la prevención de estas patologías.

1185


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

Ácidos grasos de cadena impar como componentes bioactivos Distintos trabajos desarrollados durante estos últimos años han mostrado que 15:0 y 17:0, los AG impares más abundantes en productos lácteos, podrían ejercer efectos saludables en la salud humana(49,50). Se ha comprobado, por ejemplo, que existe una asociación inversa entre la concentración de ambos AG en plasma y el riesgo de padecer diabetes tipo 2(51-53). Este resultado se ha observado también en poblaciones europeas sometidas a distintos regímenes alimentarios(54). Incluso varios estudios de prospectiva sobre enfermedades cardiovasculares han comprobado que la concentración en plasma de estos AG estaría asociada con un riesgo más bajo de enfermedades cardiovasculares(55-57). Sin embargo, se precisa una investigación más detallada que contribuya a dilucidar las rutas metabólicas implicadas en estos efectos saludables.

Conclusiones La leche y los productos lácteos son la mayor fuente de AGCIR en la dieta humana. A pesar de sus bajas concentraciones, investigaciones llevadas a cabo durante los últimos años han mostrado su potencialidad como componentes bioactivos y su relevancia nutricional. Aunque su origen reside principalmente en la actividad de la microbiota ruminal, los últimos avances científicos no circunscriben su formación únicamente a los procesos bioquímicos que tienen lugar en el tracto digestivo de los rumiantes. La capacidad de otros tejidos de sintetizar endógenamente ciertos AGCIR debe ser considerada con atención y puede incentivar líneas de investigación muy prometedoras en el futuro.

Conflicto de interés Los autores declaran no tener conflictos de interés.

Literatura citada: 1. Schroeder M, Vetter W. Detection of 430 Fatty acid methyl esters from transesterified butter sample. J Am Oil Chem Soc 2013;90:771-790. 2. Vlaeminck B, Fievez V, van Laar H, Vlaeminck B, Fievez V, Cabrita ARJ, Fonseca AJM et al. Factors affecting odd- and branched-chain fatty acids in milk: A review. Anim Feed Sci Technol 2006;131:389-417. 3. Buccioni A, Decandia M, Minieri S, Molle G, Cabiddu, A. Lipid metabolism in the rumen: New insights on lipolysis and biohydrogenation with an emphasis on the role of endogenous plant factors. Anim Feed Sci Technol 2012;174:1-25.

1186


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

4. Or-Rashid MM, Odongo NE, McBride BW. Fatty acid composition of ruminal bacteria and protozoa, with emphasis on conjugated linoleic acid vaccenic acid, and oddchain and branched-chain fatty acids. J Animal Sci 2007;85:1228–1234. 5. Bas P, Archimède H, Rouzeau A, Sauvant, D. Fatty acid composition of mixed-rumen bacteria: effect of concentration and type of forage. J Dairy Sci 2003;86:2940-2948. 6. Baumann E, Chouinard PY, Lebeuf Y, Rico DE, Gervais R. Effect of lipid supplementation on milk odd- and branched-chain fatty acids in dairy cows. J Dairy Sci 2016;99:6311-6323. 7. Fievez V, Colman E, Castro-Montoya JM, Stefanov I, Vlaeminck B. Milk odd- and branched-chain fatty acids as biomarkers of rumen function-An update. Anim Feed Sci Technol 2012;172:51-65. 8. Bessa RJB, Maia, MRG, Jerónimo E, Belo AT, Cabrita ARJ, Dewhurst RJ, Fonseca AJM. Using microbial fatty acids to improve understanding of the contribution of solid associated bacteria to microbial mass in the rumen. Anim Feed Sci Technol 2009;150:197–206. 9. Keeney M, Katz I, Allison J. On the probable origin of milk fat acids in rumen microbial lipids. J Am Oil Chem Soc 1962;39:198–201. 10. Dewhurst RJ, Moorby JM, Vlaeminck B, Van Nespen T, Fievez V. Apparent recovery of duodenal odd- and branched-chain fatty acids in milk. J Dairy Sci 2007;90:1775– 1780. 11. Schmidely P, Glasser F, Doreau M, Sauvant D. Digestion of fatty acids in ruminants: a meta-analysis of flows and variation factors. 1. Total fatty acids. Animal 2008;2:677–690. 12. Palmquist DL. Milk fat: Origin of fatty acids and influence of nutritional factors thereon. In: Fox PF, McSweeney PLH editors. Advanced dairy chemistry, vol 2, Lipids, 3rd ed. New York, USA: Springer; 2006:43-92. 13. Massart-Leën AM, Roets E, Peeters G, Verbeke R. Propionate for fatty acid synthesis by the mammary gland of the lactating goat. J Dairy Sci 1983;66:1445-1454. 14. French EA, Bertics SJ, Armentano, LE. Rumen and milk odd-and branched-chain fatty acid proportions are minimally influenced by ruminal volatile fatty acid infusions. J Dairy Sci 2012;95:2015-2026. 15. Vlaeminck B, Gervais R, Rahman MM, Gadeyne F, Gorniak, M, Doreau M et al. Postruminal synthesis modifies the odd- and branched chain fatty acid profile from the duodenum to milk. J Dairy Sci 2015;98:4829-4840.

1187


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

16. Fievez V, Vlaeminck B, Dhanoa MS, Dewhurst RJ. Use of principal component analysis to investigate the origin of heptadecenoic and conjugated linoleic acids in milk. J Dairy Sci 2003;86:4047–4053. 17. Gervais R, Vlaeminck B, Fanchone A, Nozière P, Doreau M, Fievez V. Odd-and branched-chain fatty acids duodenal flows and milk yields in response to N underfeeding and energy source in dairy cows. J Dairy Sci 2011;94(Suppl 1):125– 126. 18. Xu HF, Luo J, Zhao WS, Yang YC, Tian HB, Shi HB et al. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells. J Dairy Sci 2016;99:783-795. 19. Shi HB, Wu M, Zhu JJ, Zhang CH, Yao, DW, Luo J et al. Fatty acid elongase 6 plays a role in the synthesis of long-chain fatty acids in goat mammary epithelial cells. J Dairy Sci 2017;100:4987-4995. 20. Enjalbert F, Combes S, Zened A, Meynadier A. Rumen microbiota and dietary fat: a mutual shaping. J Appl Microbiol 2017;123:782-797. 21. Vlaeminck B, Dewhurst RJ, Demeyer D, Fievez V. Odd and branched chain fatty acids to estimate proportions of cellulolytic and amylolytic particle associated bacteria. J Anim Feed Sci 2004;13:235–238. 22. Cabrita ARJ, Vale JMP, Bessa RJB, Dewhurst RJ, Fonseca AJM. Effects of dietary starch source and buffers on milk responses and rumen fatty acid biohydrogenation in dairy cows fed maize silage-based diets. Anim Feed Sci Technol 2009;52:267– 277. 23.Sun YZ, Mao SY, Zhu WY. Rumen chemical and bacterial changes during stepwise adaptation to a high-concentrate diet in goats. Animal 2010;4:210–217. 24. Patel M, Wredle E, Bertilsson J. Effect of dietary proportion of grass silage on milk fat with emphasis on odd- and branched-chain fatty acids in dairy cows. J Dairy Sci 2013;96:390-397. 25. Li F, Li Z, Li S, Ferguson JD, Cao Y, Yao J et al. Effect of dietary physically effective fiber on ruminal fermentation and the fatty acid profile of milk in dairy goats. J Dairy Sci 2014;97:2281-2290. 26. Li F, Yang XJ, Cao YC, Li SX, Yao JH, Li ZJ et al. Effects of dietary effective fiber to rumen degradable starch ratios on the risk of sub-acute ruminal acidosis and rumen content fatty acids composition in dairy goat. Anim Feed Sci Technol 2014;189:54– 62.

1188


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

27. Cívico A, Núñez Sánchez N, Gómez-Cortés P, De la Fuente MA, Peña Blanco F, Juárez M et al. Odd- and branched-chain fatty acids in goat milk as indicators of diet composition. Ital J Anim Sci 2017;16:68-74. 28. Vlaeminck B, Fievez V, Demeyer D, Dewhurst RJ. Effect of forage:concentrate ratio on fatty acid composition of rumen bacteria isolated from ruminal and duodenal digesta. J Dairy Sci 2006;89:2668-2678. 29. Zhang Y, Liu K, Hao X, Xin H. The relationships between odd- and branched-chain fatty acids to ruminal fermentation parameters and bacterial populations with different dietary ratios of forage and concentrate. J Anim Physiol Anim Nutr 2017;101:1103–1114. 30. Vazirigohar M, Dehghan-Banadaky M, Rezayazdi K, Nejati-Javaremi A, MirzaeiAlamouti H, Patra AK. Effects of diets containing supplemental fats on ruminal fermentation and milk odd- and branched-chain fatty acids in dairy cows. J Dairy Sci 2018;101:6133-6141. 31. Gómez-Cortés P, Toral PG, Frutos P, Juárez M, De la Fuente MA, Hervás, G. Effect of the supplementation of dairy sheep diet with incremental amounts of sunflower oil on animal performance and milk fatty acid profile. Food Chem 2011;125:644651. 32. Martínez-Marín AL, Gómez-Cortés P, Gómez CG, Juárez M, Pérez AL, Pérez HM et al. Animal performance and milk fatty acid profile of dairy goats fed diets added differently unsaturated plant oils on fatty acid profile of goat milk. J Dairy Sci 2011;94:5359-5368. 33. Maia MRG, Chaudhary LC, Figueres L, Wallace RJ. Metabolism of polyunsaturated fatty acids and their toxicity to the microflora of the rumen. Antonie van Leeuwenhoek 2007;91:303-314. 34. Yang SL, Bu DP, Wang JQ, Hu ZY, Li D, Wei HY, et al. Soybean oil and linseed oil supplementation affect profiles of ruminal microorganisms in dairy cows. Animal 2009;3:1562–1569. 35. Ran-Ressler RR, Devapatla S, Lawrence P, Brenna JT. Branched chain fatty acids are constituents of the normal healthy newborn gastrointestinal tract. Pediatr Res 2008;64:605-609. 36. Wang DH, Ran-Ressler R, St Leger J, Nilson E, Palmer L, Collins R et al. Sea lions develop human-like vernix caseosa delivering branched fats and squalene to the GI tract. Sci Rep 2018;8:7478. 37. Kaneda T. Fatty acids of the genus bacillus: An example of branched-chain preference. Bacteriol Rev 1977;41:391.

1189


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

38. Ran-Ressler RR, Khailova L, Arganbright KM, Adkins-Rieck CK, Jouni ZE, Koren O et al. Branched chain fatty acids reduce the incidence of necrotizing enterocolitis and alter gastrointestinal microbial ecology in a neonatal rat model. PLoS One 2011;6:e29032. 39. Inoue T, Shingaki R, Fukui K. Inhibition of swarming motility of Pseudomonas aeruginosa by branched-chain fatty acids. FEMS Microbiol Lett 2008;281:81-86. 40. Yan Y, Wang Z, Greenwald J, Kothapalli KSD, Park HG, Liu R et al. BCFA suppresses LPS induced IL-8 mRNA expression in human intestinal epithelial cells. Prostaglandins Leukot Essent Fatty Acids 2017;116:27-31. 41. Yan Y, Wang Z, Wang D, Lawrence P, Wang X, Kothapalli KSD et al. BCFAenriched vernix-monoacylglycerol reduces LPS-induced inflammatory markers in human enterocytes in vitro. Pediatr Res 2018;83:874-879. 42. Liu L, Wang Z, Park HG, Xu C, Lawrence P, Sub X et al. Human fetal intestinal epithelial cells metabolize and incorporate branched chain fatty acids in a structure specific manner. Prostaglandins Leukotr Essent Fatty Acids 2017;116:32-39. 43. Ran-Ressler RR, Bae S, Lawrence P, Wang DH, Brenna JT. Branched chain fatty acid content of foods and estimated intake in the USA. Br J Nutr 2014;112:565-572. 44. Yang Z, Liu S, Chen X, Chen H, Huang M, Zheng J. Induction of apoptotic cell death and in vivo growth inhibition of human cancer cells by a saturated branched-chain fatty acid, 13-methyltetradecanoic acid. Cancer Res 2000;60:505-509. 45. Cai Q, Huang H, Qian D, Chen K, Luo J, Tian Y et al. 13- methyltetradecanoic acid exhibits antitumor activity on T-cell lymphomas in vitro and in vivo by downregulating p-AKT and activating caspase-3. PLoS One 2013;8:e65308. 46. Wongtangtintharn S, Oku H, Iwasaki H, Toda T. Effect of branched-chain fatty acids on fatty acid biosynthesis of human breast cancer cells. J Nutr Sci Vitaminol 2004;50:137-143. 47. Wongtangtintharn S, Oku H, Iwasaki H, Inafuku M, Toda T, Yanagita T. Incorporation of branched-chain fatty acid into cellular lipids and caspase in dependent apoptosis in human breast cancer cell line, SKBR-3. Lipids Health Dis 2005;4:29. 48. Mika A, Stepnowski P, Kaska L, Proczko M, Wisniewski P, Sledzinski M et al. A Comprehensive study of serum odd- and branched-chain fatty acids in patients with excess weight. Obesity 2016;24:1669-1676. 49. Jenkins B, West JA, Koulman A. A review of odd-chain fatty acid metabolism and the role of pentadecanoic acid (C15:0) and heptadecanoic acid (C17:0) in health and disease. Molecules 2015;20:2425-2444.

1190


Rev Mex Cienc Pecu 2020;11(4): 1174-1191

50. Jenkins BJ, Seyssel K, Chiu S, Pan PH, Lin SY, Stanley E et al. Odd chain fatty acids; New insights of the relationship between the gut microbiota, dietary intake, biosynthesis and glucose intolerance. Sci Rep 2017;7:44845. 51. Yakoob MY, Shi PL, Willett WC, Rexrode KM, Campos H, Orav EJ et al. Circulating biomarkers of dairy fat and risk of incident diabetes mellitus among men and women in the United States in two large prospective cohorts. Circulation 2016;133:16451654. 52.Pfeuffer M, Jaudszus A. Pentadecanoic and heptadecanoic acids: multifaceted oddchain fatty acids. Adv Nutr 2016;7:730-734. 53. Risérus U, Marklund M. Milk fat biomarkers and cardiometabolic disease. Curr Opin Lipidol 2017;28:46-51. 54. Forouhi NG, Koulman A, Sharp SJ, Imamura F, Kroger J, Schulze MB et al. Differences in the prospective association between individual plasma phospholipid saturated fatty acids and incident type 2 diabetes: the EPIC-InterAct case-cohort study. Lancet Diabetes Endocrinol 2014;2:810-818. 55. Khaw KT, Friesen MD, Riboli E, Luben R, Wareham N. Plasma phospholipid fatty acid concentration and incident coronary heart disease in men and women: The EPIC-Norfolk prospective study. PLoS Med 2012;9:e1001255. 56. Otto MCD, Nettleton JA, Lemaitre RN, Steffen LM, Kromhout D, Rich SS et al. Biomarkers of dairy fatty acids and risk of cardiovascular disease in the multi-ethnic etudy of atherosclerosis. J Am Heart Assoc 2013;2:e000092. 57. Liang J, Zhou Q, Amakye WK, Su Y, Zhang Z. Biomarkers of dairy fat intake and risk of cardiovascular disease: A systematic review and meta analysis of prospective studies. Crit Rev Food Sci Nutr 2018;58:1122-1130. 58. O’Donnell-Megaro AM, Barbano DM, Bauman DE. Survey of the fatty acid composition of retail milk in the United States including regional and seasonal variations. J Dairy Sci 2011;94:59–65. 59. Shingfield KJ, Chilliard Y, Toivonen P, Kairenius P, Givens DI. Trans fatty acids and bioactive lipids in ruminant milk. Adv Exp Med Biol 2008;606:3-65. 60. Shingfield KJ, Reynolds CK, Lupoli B, Toivonen V, Yurawecz MP, Delmonte P et al. Effect of forage type and proportion of concentrate in the diet on milk fatty acid composition in cows given sunflower oil and fish oil. Anim Sci 2005;80:225–238.

1191


https://doi.org/10.22319/rmcp.v11i4.5295 Nota de investigación

Análisis de QTL asociados a polimorfismos de nucleótido único (SNP) involucrados en el fenotipo lechero del ganado Holstein

Jose Manuel Valdez-Torres a Juan Alberto Grado Ahuir a Beatriz Elena Castro-Valenzuela a M. Eduviges Burrola-Barraza a*

a

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología. Periférico Francisco R. Almada Km 1, C.P. 31453. Cd. Chihuahua, Chih. México.

*

Autor de correspondencia: mburrola1@uach.mx

Resumen: El objetivo fue identificar QTL asociados a polimorfismos de nucleótido único (SNP) cuya acción contribuya al desarrollo fenotípico productivo, reproductivo y de salud del ganado lechero de raza Holstein. Ubicados en 120 genes del genoma Bos taurus UMD_3.1.1, se identificaron 341 QTL asociados a 189 SNP con efectos sobre rasgos productivos (FY, NM, MY, MTCAS, MBLF y PL), reproductivos (CONCRATE, DPR, EMBSUR, DAYOPEN y CONCEPT) y de salud (SCC, BTBS y RESRATE). Los SNP fueron verificados en la base de datos dbSNP-NCBI donde 42 % se ubicaron en intrones. Con la plataforma Jvenn se supo que los SNP rs135744058, rs110828053 y rs109503725, fueron comunes en los tres rasgos. La red de correlaciones entre rasgos y genes generada por MetScape (Cytoscape 3.4), mostró una correlación positiva entre PL, DPR, DAYOPEN, CONCRATE y CONCEPT; y una negativa de FY hacia PL, NM, DPR y CONCRATE. La funcionalidad de cada gen fue validada en las bases Gene-NCBI y UniProt, y por ClueGo (Cytoscape 3.4) se seleccionaron vías funcionales con un valor de significancia menor a 0.05, lo que evidenció un entrelazamiento entre el desarrollo de la glándula mamaria, la activación del sistema inmune y la respuesta a hormonas esteroideas; siendo el gen GH quien dirige dicha funcionalidad.

1192


Rev Mex Cienc Pecu 2020;11(4):1192-1207

Aunque el panorama genético muestra que existe un antagonismo entre rasgos productivos y reproductivos, la actividad genética funcional debido a los 189 SNP analizados, muestra una acción entrelazada en vías ontológicas que influyen tanto en los procesos de producción, así como en vías de reproductivas y de salud. Palabras clave: QTL, SNP, Holstein.

Recibido: 19/03/2019 Aceptado: 17/09/2019

En el ganado Holstein, varios estudios han identificado locus de un carácter cuantitativo (QTL) asociados a rasgos productivos, reproductivos y de salud(1-3). Gracias al perfeccionamiento de los métodos estadísticos y al desarrollo de las herramientas moleculares ha sido posible realizar estudios de asociación del genoma completo (GWAS)(4,5), con lo que se han identificado QTL asociados a un locus, cuya influencia sobre el fenotipo puede variar entre individuos de una misma especie en el cambio de una simple base en el genoma, esto es lo que se conoce como polimorfismo de nucleótido único (SNP). Este tipo de QTL que se correlacionan con un solo SNP tienen un efecto sobre la funcionalidad de un gen específico y por ende una acción inmediata en el desarrollo de un rasgo fenotípico de interés(6). Así que identificar las vías biológicas y los genes que están asociados a SNP significativos, podría dar un conocimiento biológico más profundo sobre el mecanismo de expresión de un determinado rasgo fenotípico(7). El objetivo de este estudio se centró en buscar con herramientas bioinformáticas, aquellos QTL asociados a un SNP con un potencial efecto sobre los rasgos fenotípicos de producción, reproducción y salud del ganado lechero Holstein. Para la búsqueda de QTL se utilizaron 15 caracteres fenotípicos: duración de la vida productiva (PL), merito neto (NM), rendimiento de leche (MY), rendimiento de proteína de leche (PY), rendimiento de grasa en leche (FY), contenido de caseína (MTCAS), contenido de -lactoglobulina (MBLG), susceptibilidad a tuberculosis bovina (BTBS), frecuencia respiratoria (RESRATE), contento de células somáticas (SCC), tasa de concepción (CONCRATE), tasa de preñez de las hijas (DPR), sobrevivencia embrionaria temprana (EMBSUR), intervalo parto-concepción (DAYOPEN) y servicios por concepción (CONCEPT). La selección se realizó dentro de los 114,685 QTL reportados en la base de datos en QTLdb (en inglés Animal QTL Database)(2), aquellos QTL asociados a uno de los rasgos productivos y de salud, cuyo pico estuviera relacionado a un solo SNP con un valor de significancia menor a 0.05. Para el caso de los SNP reproductivos, se seleccionaron aquellos reportados por Cochran et al(8) que no tuvieron un efecto negativo sobre algún rasgo productivo. Tomando como base el genoma de Bos taurus UMD_3.1.1, 1193


Rev Mex Cienc Pecu 2020;11(4):1192-1207

cada SNP se verificó en la base de datos dbSNP del NCBI (en inglés National Center for Biotecnology Inormation, www.ncbi.nlm.nih.gov/snp/), donde se comprobó su ubicación cromosomal, así como el gen afectado y se clasificaron de acuerdo a su localización como: intrón (si estaba en un región intrónica), cambio de sentido (si provocaba un cambio en la secuencia de aminoácidos), sinónimo (si el cambio de base no implicaba un cambio en la secuencia de aminoácidos), promotor (si estaba localizado en el promotor del gen afectado), deleción/inserción (si el SNP resultaba en una deleción o una inserción de una base), UTR3´ y UTR5´ (si el SNP se localizaba en la región no traducida 5´o 3´ del RNAm). La función de cada uno de los genes implicados en este estudio fue validada tanto en la base de datos Gene del NCBI (www.ncbi.nlm.nih.gov/gene/) como en UniProt (del inglés The Universal Protein Resource, www.uniprot.org). Los SNP comunes entre los rasgos fenotípicos se identificaron a través de un diagrama de Venn utilizando la plataforma Jvenn(9). Mediante el algoritmo de Metscape(10) se calcularon los coeficientes de correlación de Pearson, para establecer asociaciones entre los rasgos fenotípicos con la presencia de un gen. Estos valores fueron visualizados como una matriz colorimétrica (heat map) compuesta de un espectro de color que fue del verde hacia el rojo con valores de correlación del -1 a 1, respectivamente. Estos datos también fueron analizados como un agrupamiento jerárquico y con ellos se generó una de red de correlaciones utilizando la aplicación MetScape del programa Cytoscape 3.4(11). La red funcional ontológica de los genes se realizó con la aplicación ClueGo del programa de Cytoscape 3.4, bajo los siguientes criterios: los datos ontológicos de cada gen se tomaron de la base de datos “GO Biological Process-GOA; con un intervalo “GO Tree” de 3 a 8; los términos de selección para cada vía incluyeron al menos 1 gen por “cluster” con un “kappa score” de 0.3; y se probó con una prueba estadística hipergeométrica bilateral con la corrección de Bonferroni, se tomaron en cuenta sólo aquellas vías con un valor de significancia menor a 0.05. Los resultados publicados a la fecha sobre GWAS en el bovino lechero, han proporcionado información sobre la influencia de los SNP en la expresión de un QTL(4,5,12). En el genoma, los SNP son las formas más abundantes del ADN y debido a su baja tasa de mutación son excelentes marcadores de selección(13,14), además de que es fácil y de bajo costo realizar su genotipificación(15). Tomando la información incluida en la base de datos QTLdb(2), se encontraron 341 QTL asociados a un SNP, de estos el 70 % fueron QTL de producción, 17 % involucrados en la salud y 13 % en rasgos reproductivos (Figura 1). Dentro del fenotipo de producción, el carácter más favorecido fue PY, seguido por MY, luego FY, NM, PL, MBLG y por último MTCAS. En los caracteres de salud, fue BTBS seguido de SCC y RESRATE. En los rasgos reproductivos se presentaron más QTL asociados a CONCRATE, luego a DPR, CONCEPT y el menos favorecido fue EMBSUR. Hubo QTL que tenían el mismo SNP, así como SNP que estaban presentes en diferentes regiones de un mismo gen. Por lo que al final se identificaron 341 QTL asociados a 189 SNP ubicados en 120 genes del

1194


Rev Mex Cienc Pecu 2020;11(4):1192-1207

genoma Bos taurus. Cada uno de los 189 SNP fueron verificados en la base de datos dbSNP del NCBI, donde se identificó su ubicación y el gen al que afectaban.

Figura 1: Distribución de 341 QTL asociados a un solo SNP, de acuerdo al fenotipo que favorecen

De acuerdo con la información recabada, el 42 % de los SNP fueron intrónicos, 27 % SNP estuvieron ubicados en regiones codificantes, de estos 17 % tuvo efecto en el cambio de aminoácido de la proteína y 5 % fueron mutaciones sinónimas, 6 % se localizaron en el extremo 3´ no traducido (UTR3´) y el 1 % en el UTR5´. El 6.7 % de los SNP estuvieron ubicados dentro del gen SAA2, 4.1 % se localizaron en el gen ATF3, 3.8 % en el gen HSD17B7, 3.0 % estuvieron en cada uno de los genes AP3B1 y CARD15. Los genes BCHE y PDE9A tuvieron el 2.6 %, mientras que dentro de los genes PCC8, CDKN1A y CSN2 se ubicaron en cada uno de ellos un 2 %. En las regiones de los genes APP, GNAS, NRPL48, SERPINA5, SLC8A1, CACNA1D, COQ9, DGAT1, DSC2, FASN, IGF1R, LEP, PRLR, CSNK1E, BRINP3 y HSD17B13 se ubicaron desde un 1.2 al 1.8 % de los SNP (Figura 2). Con excepción de los cromosomas Bta-9 y Bta-12, los 189 SNP se distribuyeron en los todos los autosomas y en el cromosoma X del genoma Bos taurus UMD 3.1.1 (Figura 3). Sin embargo, la distribución fue desigual; hubo cromosomas que presentaron más SNP que otros, y de la misma forma hubo cromosomas que incluyeron pocos SNP, pero estos estuvieron asociados a muchos QTL.

1195


Rev Mex Cienc Pecu 2020;11(4):1192-1207

Figura 2: Distribuciรณn porcentual de los genes con un SNP asociado a un QTL

1196


Rev Mex Cienc Pecu 2020;11(4):1192-1207

Figura 3: Distribuciรณn de los rasgos productivos, reproductivos y de salud en el genoma Bos taurus

PY,

FY,

RESRATE,

MY, CONCEPT,

NM,

PL,

MBLG,

CONCRATE,

MTCAS,

DAYOPEN,

DPR,

BTBS,

SCC,

EMBSUR

Los QTL que mรกs se identificaron fueron principalmente productivos, lo que apoya el hecho de que la cantidad y calidad de leche producida van de la mano con las ganancias econรณmicas(16). En el Bta-14, el SNP rs109421300 ubicado en el gen DGAT1, tiene mรกs influencia sobre los rasgos MY, FY y PY(14, 15, 17-19). El Bta-5 se asocia a MY, FY y PY con los SNP rs41591907, rs41256890, rs41592943, rs41592948, rs137408198 y 1197


Rev Mex Cienc Pecu 2020;11(4):1192-1207

rs133449166(7,17,20), ubicados en los genes BCATI, MGP, GUCY2C, GABARAPL1, CD27 y CSNK1E. Bta-18 ha sido asociado tanto a MY como a PY; debido a la influencia del SNP rs41581694(14,17), el cual está ubicado en el gen FOXA3. En el Bta-20, el SNP rs385640152 provoca un cambio en la proteína GHR que afecta MY y PY(7). En el Bta-21, el SNP rs41644615 ubicado en el gen SERPINE5 se asocia con MY y PY(19). Por último se asocia a PY el SNP rs110475419(14), el cual está en el gen ADAM12 en Bta-26. La leche está constituida por las proteínas -lactoalbúmina, -lactoglobulina y las caseínas ,  y (21). Se ha asociado el Bta-11 con las concentraciones en la leche de -lactoglobulina (MBLG), debido al efecto del gen PAEP, que tiene los SNP rs41255679(16,21,22), rs110066229(21) y el rs110180463(21). Por otro lado, Bta-6 ha sido relacionado con MTCAS a través del SNP rs109299401(23) que al expresarse en el gen CSN2, ocasiona un cambio funcional en la -caseína. MTCAS también se ha asociado a Bta-14 y Bta-19 debido al SNP rs110757796 y rs41923484, respectivamente(23). En el ganado lechero, la enfermedad más común y que más pérdidas económicas acarrea es la mastitis, en donde el conteo de células somáticas (SCC) en leche es un predictor asociado a esta enfermedad(12). Los cromosomas que más influencia tienen en SCC son los Bta-6, Bta-13, Bta-14, Bta-19 y Bta-20(24). En Bta6 hay 6 SNP, de los cuales rs43703013, rs43703011, rs109299401 están en la región codificante del gen CSN2, donde cada uno de ellos ocasiona un cambio de aminoácido en la proteína -caseína, mientras que rs110239379 y rs110118210 están ubicados en el mismo intrón del gen KIT; y el rs109757609 se localiza en el promotor del gen CSNIS1. La asociación con SCC en Bta-13 se relacionó con dos SNP en el gen SRC, el rs41703851 y el rs41602996. Bta-14 contribuyó a SCC debido a los SNP rs109162116 y rs109234250 en el gen DGAT1. Otros SNP asociados a SCC son rs109149276 y rs109149276, del gen FASN del Bta-19 y del promotor del gen PRLR en Bta-20, respectivamente(24); y de igual manera, el rs43315150 ubicado en el Bta-2 en un intrón del gen CYP27A1(20). La tuberculosis es otra enfermedad que provoca pérdidas económicas en la industria pecuaria, además de que siendo el bovino uno de los animales que más convive con el humano, se ha convertido en una de las principales fuentes de diseminación de esta enfermedad a nivel mundial(25). Richardson et al (1) encontraron asociado a BTBS a el Bta-1 con 9 SNP (rs42294486, rs29020933, rs29020933, rs42294431, rs42294441, rs110098599, rs132953892, rs41665131 y rs43741780), localizados en la región promotora del gen BCHE; también 2 SNP (rs109186526 y rs110679397) ubicados en el mismo intrón del gen KALRN. En el mismo trabajo, encontraron que los cromosomas Bta-3, Bta-8, Bta-10 y Bta-23, los SNP rs110622046, rs135916795, rs109277058 y rs41642913 ubicados en regiones intrónicas de los genes MAEL, PTPRD, AP3B1 y FKBP5, respectivamente. Por otro lado Finlay et al(26) reportaron que en el Bta-22 los SNP rs42286978, rs42287005 y rs42724727, que se ubican en la región promotora del gen SLC6A6, se asocian también con la susceptibilidad a

1198


Rev Mex Cienc Pecu 2020;11(4):1192-1207

tuberculosis. Wang et a (27) reportaron que en el Bta-18, el gen CARD15 presentaba 3 SNP dentro de la región codificante del exón 4 y un SNP localizado en intrón previo al exón 4. En cuanto a los rasgos reproductivos, estos estuvieron localizados muy cerca de rasgos productivos en los cromosomas Bta-1, Bta-3, Bta-5, Bta-10, Bta-15, Bta-16, Bta-18, Bta-22, Bta-23 y Bta-24 (Figura 3). Algo importante de mencionar es que aunque estos SNP representan sólo una pequeña porción de los genes involucrados en el proceso reproductivo, fueron seleccionados a partir de los trabajos de Cochran et al(8) y Ortega et al(28), quienes demostraron que estos SNP tienen un efecto positivo en rasgos reproductivos asociados con fertilidad, y al mismo tiempo no influyen de manera negativa en los rasgos productivos. Del total de SNP, solo rs135744058, rs110828053 y rs109503725, fueron comunes entre los rasgos de producción, salud y reproducción. El SNP rs135744058 está asociado con los caracteres MY(8), CONCRATE(8,28), DPR(8) y RESRATE(29). En el idioma genético está compuesto por las variantes A/G(8) y está ubicado en la región exónica del gen CACNAID donde ocasiona el cambio en la subunidad 1D del canal de voltaje de calcio(30). En el bovino se ha detectado su presencia a nivel del hipotálamo durante el desarrollo del sistema nervioso central(31). El SNP rs110828053 ha sido reportado asociado con NM(8), DPR(28), CONCRATE(28), CONCEPT(28) y RESTATE(29); y genera una permuta de A/G en el gen HSD17B7 que provoca un cambio treonina por alanina en la posición 308 de la proteína. El gen HSD17B7 codifica para la deshidrogenasa 7 hidroesteroide 17- que participa en la biosíntesis de esteroides sexuales y colesterol(28), ha sido localizado en el bovino en el células epiteliales del oviducto(32) siendo esencial para la función ovárica y la regulación de la fertilidad(33). El SNP rs109503725 compuesto por las variables T/C en el gen DSC2, está asociado a los caracteres PL(8), DPR(8,28), CONCRATE(28) y SCC(8). Este SNP genera un cambio del aminoácido 535 de triptófano por arginina en la proteína Desmocolina 2, la cual es una proteína involucrada en las uniones célula-célula conformando los desmosomas en las células epiteliales(34). Durante las últimas dos décadas en el ganado lechero, las estrategias de selección se han enfocado en desarrollar animales altamente productores de leche, lo que ha traído como consecuencia un declive en la capacidad reproductiva. Esto ha generado que exista una asociación genética negativa, es decir antagonista, entre los rasgos productivos y reproductivos(20,35-37). Ahora bien, en este estudio los SNP reproductivos fueron previamente reportados como no antagonistas con rasgos productivos(8,28); de hecho estos SNP se localizan en las mismas regiones que SNP asociados a rasgos productivos (Figura 3). Con el fin de ubicar aquellos rasgos que se relacionan de manera positiva, se realizó un análisis de correlación de los caracteres fenotípicos en base a los genes que compartían (Figura 4A). Este análisis logró clasificar los caracteres en dos grupos, agrupados en dos clados. El clado 1 agrupó todos los rasgos reproductivos juntamente con los caracteres PL y NM de los rasgos

1199


Rev Mex Cienc Pecu 2020;11(4):1192-1207

productivos. El resto de los caracteres productivos (MY, PY, FY, MTCAS y MBLG) quedaron agrupados junto con los rasgos de salud en el clado 2 (Figura 4B). Figura 4: Correlación de los rasgos fenotípicos en base a un SNP asociado a un QTL

(A) Matriz de correlación de Pearson (Heat map), el espectro de color va del verde hacia el rojo con valores de -1 a 1, respectivamente. (B) Agrupación jerárquica de A. DPR= tasas de preñez de las hijas; CONCRATE= tasa de concepción; PL= duración de la vida reproductiva; NM= mérito Neto; DAYOPEN= intervalo parto-concepción; CONCEPT= inseminaciones por concepción; RESRATE= frecuencia respiratoria; EMSUR= sobrevivencia embrionaria temprana; MY= rendimiento de leche; PY= rendimiento de proteína en leche; FY= rendimiento de grasa en leche; SCC= conteo de células somáticas en leche; MTCAS= contenido de caseína en leche; MBLG= contenido de β-lactoglobuina en leche; BTBS= susceptibilidad a tuberculosis bovina.

1200


Rev Mex Cienc Pecu 2020;11(4):1192-1207

Al analizar la red de correlaciones de los genes en base al rasgo, se pudo observar de la misma manera dos grupos de redes genéticas (Figura 5), el Grupo A correspondiente a aquellos genes presentes en los caracteres FY, MY y PY (rasgos de producción) y el Grupo B con genes presentes en BTBS, SCC, CONCEPT, CONCRATE, DAYOPEN, DPR, EMBSUR, NM, PL, RESRATE abarcando los fenotipos de salud, reproducción y producción. Esto resultados indican que a nivel genético existe un panorama antagonista entre los QTL de producción y reproducción. Figura 5: Red de correlación de Pearson de los genes asociados a un rasgo fenotípico

Los nodos representan el gen y las líneas negras representan las correlaciones entre los nodos. El análisis se realizó con la aplicación Metscape del programa Cytoscape considerando las positivas de 0.5 a +1. Entre más gruesa sea la línea más alta la correlación. Los nodos en color amarillo, morado, azul, verde y rosa; representan nodos con alta correlación generando grupos y los nodos en color rojo representan a los genes con más SNP implicados en el panel. Las leyendas dentro de los óvalos negros, representan el carácter fenotípico asociado a los genes en cada grupo de nodos. 1201


Rev Mex Cienc Pecu 2020;11(4):1192-1207

Con el fin de englobar la información funcional de los genes implicados en este estudio, se realizó una red ontológica donde se ubicaron aquellos genes cuyas funciones estuvieran relacionadas entre sí. En la Figura 6 se observa que partiendo del desarrollo de la glándula mamaria donde participan los genes CSN2, FASN, GH, GPAT4, SRC y TPH1; el gen GH enlaza hacia las vías que corresponden al desarrollo de lípidos, donde se encuentran los genes DGAT1, GPAT4 y THRSP. De aquí GH y GPAT4 enlazan hacia vías de crecimiento celular como lo es el desarrollo del tejido adiposo, donde participan los genes APP, ARID5B, FTO, GNAS, GPAT4, LEP, PPARGC1A; de los cuales ARID5B es quien dirige hacia la diferenciación de células grasas, mientras que FTO, LEP y PPARBC1A participan en la diferenciación hacia células grasas marrón. Aquí de nuevo GH, LEP y PPARGC1A son el engranaje para enlazarse junto con CSN1S1 hacia las vías funciones de respuesta a las hormonas esteroides y hacia la regulación del sistema inmune. Figura 6: Ontología genética (GO) de los genes que componen el Panel representados en una red de funciones biológicas, generada con la aplicación ClueGo del programa Cytoscape 3.4

Cada GO es representado como un nodo circular, cuyo tamaño se relaciona con la significancia (P<0.05) y el número de genes asociados a ese proceso biológico, agrupados por color que involucra un mismo proceso biológico. Los genes implicados en cada GO se encuentran en letras negras.

1202


Rev Mex Cienc Pecu 2020;11(4):1192-1207

En la respuesta a las hormonas esteroideas los genes que participan son CSN1S1, CYPP7B1, GH, HSD17B12, HSD17B7 y LEP; de aquí de nuevo GH y CSN1S1 dirigen hacia las vías de señalización de hormonas donde participan CNOT1, NRH13, SRC, UBR, CTBP2, CYPB7B1, NOD2 y UBR5. GH también enlaza hacia la regulación del sistema inmune, específicamente hacia la producción del factor de necrosis tumoral donde funcionan los genes APP, BAIAP2, GH, IGF1R, NOD2, SRC, STAT1 y TLR4. De aquí NO2 y TLR4 son el puente hacia otras vías del sistema inmune como lo son activación de citosinas e interleucinas y activación del sistema inmune innato lo realizan; interesantemente en este punto se encuentra de nuevo a LEP quien dirige de nuevo hacia el proceso metabólico de lípidos. Viendo esta vía ontológica funcional desde una perspectiva global, pareciera que el gen GH actúa como un gen maestro que dirige como si fuera el director de una orquesta, la actividad funcional de los demás genes implicados en el desarrollo del ganado lechero. El gen GH está ubicado en el Bta-19 y codifica para la proteína somatotropina. Este gen está asociado PY y MTCAS por el efecto que provoca el SNP rs41923484, que provoca un cambio en el aminoácido 153 de leucina por valina en la somatotropina(23). La somatotropina, también conocida como hormona de crecimiento, participa en múltiples actividades que va desde su efecto en el crecimiento y diferenciación celular de diversos tejidos como es el desarrollo de folículos(38) y de la glándula mamaria(39), así que no es de extrañar que su acción sea clave para que todo el organismo del ganado Holstein funcione de manera adecuada. El observar que la actividad funcional de los 120 genes asociados a 189 SNP dentro de 341 QTL, actúan de manera entrelazada en vías ontológicas que influyen tanto en los procesos de producción, como lo es el desarrollo mamario; así como en vías de reproductivas y de salud, abre la ventana de mejorar la selección para generar animales que vayan poco a poco adquiriendo características tanto productivas como reproductivas.

Agradecimientos Al CONACYT por el apoyo otorgado en el proyecto no. 216179.

Literatura citada: 1. Richardson IW, Berry DP, Wiencko HL, Higgins IM, More SJ, McClure J, et al. A genome-wide association study for genetic susceptibility to Mycobacterium bovis infection in dairy cattle identifies a susceptibility QTL on chromosome 23. Genet Sel Evol 2016;48:19-31. 2. Hu ZL, Park CA, Reecy JM. Developmental progress and current status of the Animal QTLdb. Nucleic Acids Res 2016;44(D1):D827-D833. 3. Yudin NS, Voevoda MI. Molecular genetic markers of economically important traits in dairy cattle. Russian J Genetics 2015;51(5):506-517. 1203


Rev Mex Cienc Pecu 2020;11(4):1192-1207

4. Abo-Ismail MK, Brito LF, Miller SP, Sargolzaei M, Grossi DA, Moore SS, et al. Genomewide association studies and genomic prediction of breeding values for calving performance and body conformation traits in Holstein cattle. Genet Sel Evol 2017;49(1):82-110. 5. Pegolo S, Mach N, Ramayo-Caldas Y, Schiavon S, Bittante G, Cecchinato A. Integration of GWAS, pathway and network analyses reveals novel mechanistic insights into the synthesis of milk proteins in dairy cows. Sci Rep 2018;8(1):566-580. 6. Wang M, Hancock TP, Chamberlain AJ, Vander Jagt CJ, Pryce JE, Cocks BG, et al. Putative bovine topological association domains and CTCF binding motifs can reduce the search space for causative regulatory variants of complex traits. BMC Genomics 2018;19(1):395-411. 7. Nayeri S, Sargolzaei M, Abo-Ismail MK, May N, Miller SP, Schenkel F, et al. Genomewide association for milk production and female fertility traits in Canadian dairy Holstein cattle. BMC Genet 2016;17(1):75-85. 8. Cochran SD, Cole JB, Null DJ, Hansen PJ. Discovery of single nucleotide polymorphisms in candidate genes associated with fertility and production traits in Holstein cattle. BMC genetics 2013;14(1):49-71. 9. Bardou P, Mariette J, EscudiĂŠ F, Djemiel C, Klopp C. jvenn: an interactive Venn diagram viewer. BMC bioinformatics 2014;15(1):293-299. 10. Basu S, Duren W, Evans CR, Burant CF, Michailidis G, Karnovsky A. Sparse network modeling and metscape-based visualization methods for the analysis of large-scale metabolomics data. Bioinformatics 2017;33(10):1545-1553. 11. Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome research 2003;13(11):2498-2504. 12. Duran Aguilar M, Roman Ponce SI, Ruiz Lopez FJ, Gonzalez Padilla E, Vasquez Pelaez CG, Bagnato A, et al. Genome-wide association study for milk somatic cell score in Holstein cattle using copy number variation as markers. J Anim Breed Genet 2017;134(1):49-59. 13. Karim L, Takeda H, Lin L, Druet T, Arias JA, Baurain D, et al. Variants modulating the expression of a chromosome domain encompassing PLAG1 influence bovine stature. Nat Genet 2011;43(5):405-413.

1204


Rev Mex Cienc Pecu 2020;11(4):1192-1207

14. Kolbehdari D, Wang Z, Grant JR, Murdoch B, Prasad A, Xiu Z, et al. A whole genome scan to map QTL for milk production traits and somatic cell score in Canadian Holstein bulls. J Anim Breed Genet 2009;126(3):216-227. 15. Fang M, Fu W, Jiang D, Zhang Q, Sun D, Ding X, et al. A multiple-SNP approach for genome-wide association study of milk production traits in Chinese Holstein cattle. PLoS One 2014;9(8):e99544-e99551. 16. Gambra R, Penagaricano F, Kropp J, Khateeb K, Weigel KA, Lucey J, et al. Genomic architecture of bovine kappa-casein and beta-lactoglobulin. J Dairy Sci 2013;96(8):5333-5343. 17. Gervais O, Pong-Wong R, Navarro P, Haley CS, Nagamine Y. Antagonistic genetic correlations for milking traits within the genome of dairy cattle. PLoS One 2017;12(4):e0175105-e0175117. 18. Cole JB, Wiggans GR, Ma L, Sonstegard TS, Lawlor TJ, Crooker BA, et al. Genomewide association analysis of thirty one production, health, reproduction and body conformation traits in contemporary US Holstein cows. BMC genomics 2011;12(1):408. 19. Pesek P, Pribyl J, Vostry L. Genetic variances of SNP loci for milk yield in dairy cattle. J Appl Genet 2015;56(3):339-347. 20. Pimentel EC, Bauersachs S, Tietze M, Simianer H, Tetens J, Thaller G, et al. Exploration of relationships between production and fertility traits in dairy cattle via association studies of SNPs within candidate genes derived by expression profiling. Anim Genet 2011;42(3):251-262. 21. Huang W, Penagaricano F, Ahmad KR, Lucey JA, Weigel KA, Khatib H. Association between milk protein gene variants and protein composition traits in dairy cattle. J Dairy Sci 2012;95(1):440-449. 22. Schopen GC, Visker MH, Koks PD, Mullaart E, van Arendonk JA, Bovenhuis H. Wholegenome association study for milk protein composition in dairy cattle. J Dairy Sci 2011;94(6):3148-158. 23. Viale E, Tiezzi F, Maretto F, De Marchi M, Penasa M, Cassandro M. Association of candidate gene polymorphisms with milk technological traits, yield, composition, and somatic cell score in Italian Holstein-Friesian sires. J Dairy Sci 2017;100(9):7271-7281. 24. Fontanesi L, Calo DG, Galimberti G, Negrini R, Marino R, Nardone A, et al. A candidate gene association study for nine economically important traits in Italian Holstein cattle. Anim Genet 2014;45(4):576-580.

1205


Rev Mex Cienc Pecu 2020;11(4):1192-1207

25. Wang W, Cheng L, Yi J, Gan J, Tang H, Fu MZ, et al. Health and production traits in bovine are associated with single nucleotide polymorphisms in the NOD2 gene. Genet Mol Res 2015;14(2):3570-3578. 26. Finlay EK, Berry DP, Wickham B, Gormley EP, Bradley DG. A genome wide association scan of bovine tuberculosis susceptibility in Holstein-Friesian dairy cattle. PLoS One 2012;7(2):e30545-e135094. 27. Wang Y, Wang S, Liu T, Tu W, Li W, Dong G, et al. CARD15 Gene Polymorphisms Are Associated with Tuberculosis Susceptibility in Chinese Holstein Cows. PLoS One 2015;10(8):e0135085. 28. Ortega MS, Denicol AC, Cole JB, Null DJ, Hansen PJ. Use of single nucleotide polymorphisms in candidate genes associated with daughter pregnancy rate for prediction of genetic merit for reproduction in Holstein cows. Anim Genetics 2016;47(3):288-297. 29. Dikmen S, Wang XZ, Ortega MS, Cole JB, Null DJ, Hansen PJ. Single nucleotide polymorphisms associated with thermoregulation in lactating dairy cows exposed to heat stress. J Anim Breed Genet 2015;132(6):409-419. 30. Srivastava U, Aromolaran AS, Fabris F, Lazaro D, Kassotis J, Qu Y, et al. Novel function of alpha1D L-type calcium channel in the atria. Biochem Biophys Res Commun 2017;482(4):771-776. 31. Peruffo A, Giacomello M, Montelli S, Panin M, Cozzi B. Expression profile of the poreforming subunits alpha1A and alpha1D in the foetal bovine hypothalamus: a mammal with a long gestation. Neurosci Lett 2013;556:124-128. 32. Cerny KL, Garrett E, Walton AJ, Anderson LH, Bridges PJ. A transcriptomal analysis of bovine oviductal epithelial cells collected during the follicular phase versus the luteal phase of the estrous cycle. Reprod Biol Endocrinol 2015;13:84-96. 33. Kemilainen H, Adam M, Maki-Jouppila J, Damdimopoulou P, Damdimopoulos AE, Kere J, et al. The hydroxysteroid (17beta) dehydrogenase family gene HSD17B12 is involved in the prostaglandin synthesis pathway, the ovarian function, and regulation of fertility. Endocrinology 2016;157(10):3719-3730. 34. Gehmlich K, Lambiase PD, Asimaki A, Ciaccio EJ, Ehler E, Syrris P, et al. A novel desmocollin-2 mutation reveals insights into the molecular link between desmosomes and gap junctions. Heart Rhythm 2011;8(5):711-718. 35. Pryce J, Royal M, Garnsworthy P, Mao IL. Fertility in the high-producing dairy cow. Livestock Prod Sci 2004;86(1-3):125-135. 1206


Rev Mex Cienc Pecu 2020;11(4):1192-1207

36. Pryce J, Veerkamp R. The incorporation of fertility indices in genetic improvement programmes. BSAP Occasional Publication 2001;26(1):237-249. 37. PeĂąagaricano F, Khatib H. Association of milk protein genes with fertilization rate and early embryonic development in Holstein dairy cattle. J Dairy Res 2011;79(01):47-52. 38. Cushman R, DeSouza J, Hedgpeth V, Britt J. Effect of long-term treatment with recombinant bovine somatotropin and estradiol on hormone concentrations and ovulatory response of superovulated cattle. Theriogenology 2001;55(7):1533-1547. 39. Akers RM. A 100-Year Review: Mammary development and lactation. J Dairy Sci 2017;100(12):10332-10352.

1207


https://doi.org/10.22319/rmcp.v11i4.5192 Nota de investigación

Efecto de la adición de clorhidrato de zilpaterol genérico en el perfil bioquímico y hematológico de ovinos de pelo engordados en corral

Arnulfo Vicente Pérez a† Leonel Avendaño Reyes b Ulises Macías Cruz b Antonio Aguilar Quiñones a Ricardo Vicente Pérez c Miguel Mellado Bosque d Miguel Ángel Gastélum Delgado e Abelardo Correa Calderón b G. López-Rincón f Juan Eulogio Guerra Liera e*

a

Universidad Autónoma de Sinaloa. Facultad de Medicina Veterinaria y Zootecnia, Culiacán, Sinaloa, México. b

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas. Ejido Nuevo León, Valle de Mexicali, Baja California, México. c

Universidad de Guadalajara. Centro Universitario de la Costa Sur. Autlán de Navarro, Jalisco, México. d

Universidad Autónoma Agraria Antonio Narro. Departamento de Nutrición Animal. Saltillo, Coahuila, México. e

Universidad Autónoma de Sinaloa. Facultad de Ciencias Agrícolas. Culiacán, Sinaloa, México. f

Laboratorios Virbac México, S.A. de C.V., Zapopan, Jalisco, México.

*Autor de correspondencia: dr.juanguerral@gmail.com †

Alumno del Doctorado en Ciencias Agropecuarias, FMVZ-UAS.

1208


Rev Mex Cienc Pecu 2020;11(4):1208-1219

Resumen: El objetivo fue evaluar la adición de clorhidrato de zilpaterol (CZ, genérico) en la dieta de ovinos de pelo de engorda, sobre variables hematológicas y bioquímicas como indicadores del estado de salud. Treinta y dos (32) corderos de pelo cruzados (Dorper x Pelibuey) se bloquearon por peso inicial y cuatro tratamientos y se asignaron aleatoriamente dentro de cada bloque: T1= dieta basal (grupo testigo), T2= dieta basal más 0.10 mg·kg-1 de PV d-1 de CZ (Grofactor®, Virbac México, Guadalajara, México), T3= dieta basal más 0.20 mg·kg-1 de PV d-1 de CZ y T4= dieta basal más 0.30 mg·kg-1 de PV d-1 de CZ. Se tomaron muestras de sangre los días 1, 15 y 30 del estudio. El perfil hematológico se estimó en muestras de sangre fresca, mientras que metabolitos, electrolitos y hormonas en muestras de suero. El diseño experimental fue bloques completos al azar y se efectuó análisis de polinomios ortogonales para determinar la tendencia de las respuestas a los niveles de CZ. Los niveles de colesterol y urea fueron mayores (P<0.05) en T3 que en T2; asimismo, el nivel de concentración corpuscular medio de hemoglobina fue mayor (P<0.05) en T1 que en T3, mientras que el ancho de distribución de eritrocitos fue mayor (P<0.05) en T2 y T3 que en T4. Los niveles de Na y el número de plaquetas mostraron tendencia lineal (P<0.05) a disminuir y aumentar, respectivamente, conforme los niveles de CZ aumentaron. Se observó tendencia cuadrática (P<0.05) en la concentración corpuscular media de hemoglobina y ancho de distribución de eritrocitos al aumentar la dosis de CZ (genérico). Las variables restantes no mostraron tendencias significativas a los niveles de CZ (genérico). Los valores de los perfiles bioquímico y hematológico se encontraron dentro del rango de referencia, lo que sugiere que la adición de CZ no alteró el estado de salud de corderos en engorda. Palabras clave: Hemoglobina, Corderos, Metabolitos, Electrolitos, Clorhidrato de zilpaterol.

Recibido: 23/12/2018 Aceptado: 25/09/2019 La ganadería ovina destinada a producir carne en México crece en forma considerable, pero la demanda de animales para abasto es mayor a lo que se produce, lo que se traduce en importaciones de ganado en pie y en canal de Estados Unidos, Nueva Zelanda y Australia, principalmente(1). Los ovinos de pelo han sido una alternativa para cubrir estas demandas de carne porque requieren menos cuidados que las razas de lana. Además, tienen la peculiaridad de adaptarse, reproducirse y producir bajo cualquier sistema de producción. Por mostrar baja estacionalidad reproductiva, esta especie mantiene la producción de cordero durante todo el año; sin embargo, tiene la desventaja de su limitada ganancia de peso(2). Por esto, los engordadores complementan usando promotores del crecimiento, que permiten obtener animales más eficientes para producir carne(3). Los

1209


Rev Mex Cienc Pecu 2020;11(4):1208-1219

agonistas adrenérgicos-beta (AA-β) son una atractiva estrategia que ha impactado positivamente la producción de ovinos en engorda(4). Comparando resultados de distintos AA-β (clorhidrato de zilpaterol, clorhidrato de ractopamina, terbutalina, isoprotenerol, etc.), se concluyó que el clorhidrato de zilpaterol (CZ) es buena opción en la engorda de ovinos(5). No obstante, los resultados observados son contradictorios en términos de rendimiento(4,6) y características de la canal(6,7). Dado que la adición de CZ en la dieta promueve cambios fisiológicos, metabólicos, hormonales y hematológicos, se puede comprometer la salud del animal(8). Además, el uso de AA-β en rumiantes y sus efectos negativos en el bienestar animal han sido de las preocupaciones más importantes en el sector agropecuario(9). Los efectos de la adición del CZ en la dieta se han centrado en el rendimiento animal y características de la canal, mientras que los efectos de este compuesto en la salud y bienestar se atienden de forma trivial(10). A pesar de que se ha encontrado mayor morbilidad en bovinos suplementados con AA-β en la finalización de la engorda(11), existen pocos estudios que evalúen su efecto en la salud animal y que incluyan el análisis de componentes bioquímicos y hematológicos. El objetivo de este estudio fue evaluar el efecto de adicionar distintas dosis del AA-β genérico CZ sobre variables hematológicas y bioquímicas en ovinos de pelo finalizados en corral. El estudio se realizó en la época otoño-invierno del 2015 en la Unidad Experimental Ovina del Instituto de Ciencias Agrícolas de la Universidad Autónoma de Baja California, en el Valle de Mexicali, Baja California, México (32.8o N, 114.6o O). Las condiciones climáticas de esta región son tipo Desierto de Sonora, definidas por un clima extremadamente seco y cálido, con temperaturas máximas en verano ≥ 42 °C y mínimas en invierno ≤ 0 °C; la precipitación pluvial anual promedia 85 mm(12). Se utilizaron 32 corderos de pelo F1 cruza de Dorper x Pelibuey con peso promedio de 29.3 ± 0.22 kg y edad entre 5 y 6 meses. Se formaron grupos de cuatro corderos por peso inicial y se asignaron aleatoriamente a uno de cuatro tratamientos: T1= dieta basal (grupo testigo); T2= dieta basal más 0.10 mg·kg-1 de PV d-1 de CZ (Grofactor®, Virbac México, Guadalajara, México); T3= dieta basal más 0.20 mg·kg-1 de PV d-1 de CZ y T4= dieta basal más 0.30 mg·kg-1 de PV d-1 de CZ. Los corderos se alojaron en corraletas individuales (1.0 x 1.5 m) provistas de comederos, bebedero y sombra. El alimento se ofreció dos veces por día (0700 y 1500 h) en proporción 40:60. La ración consistió en grano de trigo molido (60 %), heno de alfalfa (17.5 %), paja de trigo (11 %), harina de soya (7 %), aceite de soya (2 %), piedra caliza (1 %), fosfato dicálcico (1 %) y 0.5 % de sal común, la cual se formuló para aportar 15 % de PC y 2.9 Mcal de EM kg-1 de MS(13). Para garantizar el consumo del CZ, la dosis diaria del producto se mezcló en 30 g de grano de trigo molido y se ofreció por la mañana antes de servir la dieta basal. En el día 30 de la prueba, el CZ se retiró siguiendo con las indicaciones del fabricante del producto. El experimento duró 47 días (15 de adaptación, 30 de engorda y 2 de retiro).

1210


Rev Mex Cienc Pecu 2020;11(4):1208-1219

Para analizar metabolitos, electrolitos y componentes hematológicos se colectaron muestras de sangre en tubos vacutainer de 10 y 4 ml mediante punción en la vena yugular. La sangre se colectó antes de ofrecer la dieta por la mañana (0600 h) tres veces: fase inicial, intermedia y final de la engorda (días 1, 15 y 30). Se utilizaron muestras de sangre fresca para el análisis hematológico usando un equipo automatizado (Auto Hematology Analyzer, MINDRAY, BC-2800 Vet; Shenzhen, China). La sangre colectada en tubos de 10 ml se centrifugó a 3,500 rpm a 10º C por 15 min; después se separó el suero por duplicado en viales de 2 ml y se almacenaron a -20 ºC para el posterior análisis de los metabolitos glucosa (Glu), colesterol (Col), urea (Ur), triglicéridos (Trig) y proteína total (PT), electrolitos (Na, K y Cl) y hormonas tiroxina (T4) y triiodotironina (T3). Los metabolitos se determinaron con un equipo de química sanguínea (Model DT-60, Johnson Co.; High Wycombe, UK), mientras que los electrolitos con un equipo automatizado (Electrolyte Analyzer LW E60A; Landwind Medical; Shenzhen, China). La determinación de hormonas se realizó con un equipo automatizado para pruebas de Elisa y de Quimioluminiscencia (CLIA) marca Thunderbolt® Analyzer (Davis, CA, USA). Las respuestas se analizaron bajo un diseño de bloques completamente al azar. Se realizó un análisis de polinomios ortogonales para determinar la tendencia en las respuestas a través de los niveles del AA-β. Se declararon significancias a probabilidad de P≤0.05 mediante el uso del PROC MIXED de SAS. Dado que la tendencia cúbica no resultó significativa para ninguna variable analizada, se omitió de los cuadros de resultados. Todos los datos se procesaron en el paquete estadístico Statistical Analysis System(14). El Cuadro 1 muestra los resultados de la adición de dosis de CZ sobre metabolitos sanguíneos en corderos de engorda. Los niveles de Col y Ur fueron mayores (P<0.05) en T3 que en T2. Los niveles de Trig, Glu y PT no fueron afectados (P>0.05) por la adición de CZ. Estos valores obtenidos se encuentran dentro del rango de referencia para ovinos(15,16). Resultados similares reportaron López-Carlos et al(6) al no encontrar diferencias en PT, Glu ni Trig al suplementar dosis similares de CZ a las del presente estudio usando ovinos cruzados Dorper x Katahdin. Otros autores(17) reportaron que la adición de 0.20 mg·kg-1 de PV día-1 de CZ a ovinos de lana no modificó los niveles sanguíneos de Glu, Trig, PT ni Col, encontrando sólo una disminución en los niveles de Ur. También se ha mencionado que la administración de CZ en bovinos no modificó los metabolitos sanguíneos(8,18). Hatefi et al(19), en machos caprinos encontraron que la adición de CZ disminuyó los niveles plasmáticos de Glu y Col, sin afectar los niveles de Trig. La administración de AA-β tiene como consecuencia inmediata un incremento en la gluconeogénesis, lo que a su vez produce un aumento inminente de los niveles séricos de Glu(8); sin embargo, se estima que el aumento inicial en las concentraciones de Glu desaparece conforme se incrementa el tiempo de administración, hasta retornar a concentraciones normales por una disminución de sensibilidad tisular(20), efecto que pudo haberse presentado en el presente estudio, donde los niveles de metabolitos retornaron a sus concentraciones normales. Esto se afirma por el hecho de que los metabolitos 1211


Rev Mex Cienc Pecu 2020;11(4):1208-1219

asociados al estado energético y proteico no fueron afectados por la adición de diferentes dosis de CZ en la dieta, indicando que los corderos no modificaron ni comprometieron su homeostasis ni metabolismo. Por tanto, es posible considerar, de forma inicial, que el uso del AA-β Grofactor® no tuvo efectos perjudiciales para la salud de los ovinos. Sin embargo, a la fecha son pocos los estudios realizados sobre el efecto de AA-β en los metabolitos sanguíneos, y más aún, los resultados obtenidos aún son inconsistentes(19). Cuadro 1: Concentraciones séricas de metabolitos en ovinos de pelo en respuesta a distintas dosis de clorhidrato de zilpaterol Dosis de CZ ( mg·kg-1 de PV día-1) EEM Efectos 0 Col, mg/dl 49.4 ab Trig, mg/dl 26.0 Glu, mg/dl 64.3 PT, mg/dl 6.80 Urea, mg/dl 38.3ab

0.10 46.7 a 26.7 62.6 6.85 35.4a

0.20 55.4 b 25.8 65.7 6.82 40.9b

0.30 50.5 ab 26.4 61.8 7.03 38.5ab

3.02 1.40 4.12 0.108 1.69

L 0.36 0.95 0.83 0.17 0.40

C 0.71 0.98 0.82 0.47 0.91

ab

Promedios con distinta literal en la misma hilera difieren (P<0.05). EEM= error estándar de la media; L= lineal; C= cuadrática. Col= colesterol; Trig= Triglicéridos; Glu= Glucosa; PT= Proteína total.

Los resultados de suplementar distintas dosis de CZ en electrolitos sanguíneos y hormonas tiroideas se muestran en el Cuadro 2. La administración de CZ mostró reducción significativa (P<0.01) en los niveles séricos de Na, mostrando además una tendencia lineal con el incremento de los niveles de CZ en la dieta. Los niveles séricos de Cl, K, T3 y T4 no fueron afectados (P>0.05) por los distintos tratamientos. Los AA-β se consideran excelentes redistribuidores de nutrientes a favor de la formación de músculo esquelético y reducción del depósito de grasa en la canal(21), no obstante, es posible que afecten la concentración de diversos componentes bioquímicos involucrados en el desarrollo del tejido muscular y adiposo(22). El efecto cuadrático observado en las concentraciones de Na se dio en función de los niveles crecientes de CZ en la dieta. La adición de 0.10 mg de CZ causó un decremento de Na en el suero, mientras que la dosis de 0.20 mg de CZ mantuvo los niveles séricos de Na. Por otro lado, la adición de 0.30 mg de CZ disminuyó de forma considerable los niveles de este electrolito. A pesar de que se encontró diferencia significativa en los niveles de Na sérico entre dosis, todos los valores se encuentran dentro del rango de referencia normal para ovinos(15,16), lo cual sugiere que los animales tratados mantuvieron su presión osmótica y equilibrio ácido-base en el organismo, sin síntoma importante de estrés alguno. El K juega un papel importante en la regulación del agua dentro y fuera de la célula. Así, mantener niveles óptimos de K sérico es importante para el correcto funcionamiento del organismo. No obstante, Buntyn et al(23) encontraron que la adición de CZ promovió la disminución de niveles sanguíneos de K, resultados que pueden deberse a un aumento en el depósito de músculo magro durante la adición con CZ. El presente estudio tuvo

1212


Rev Mex Cienc Pecu 2020;11(4):1208-1219

resultados similares, ya que mostraron que el nivel más bajo de K se presentó en el nivel más alto de CZ. También se observó que los ovinos no tratados tuvieron mayor concentración de K con respecto a los tratados con 0.30 mg·kg-1. Frese et al(8) reportaron que la adición de CZ y clorhidrato de ractopamina no modificaron los niveles de K con respecto al testigo en novillos en finalización. Aunque no se ha reportado ningún estudio donde la ingestión de AA-β cause disminución de Na plasmático en ovinos, en ganado equino se reportó que la disminución de Na sanguíneo por efecto de AA-β puede darse en casos muy extremos, ya sea por la pérdida durante la sudoración profusa o por deterioro del transporte renal de Na; incluso, la hipocloremia puede estar asociada con la liberación endógena de glucocorticoides o insuficiencia renal(24), efecto que posiblemente no ocurrió en el presente estudio. Por su parte, otros trabajos(8,23) reportan que novillos y vaquillas en finalización de la engorda tuvieron similares concentraciones de Na al adicionar los AA-β CZ y clorhidrato de ractopamina en la dieta, resultados que fueron atribuidos a la disponibilidad y consumo a libre acceso de agua de los animales. Cuadro 2: Concentraciones séricas de electrolitos y hormonas tiroideas en ovinos de pelo en respuesta a distintas dosis de clorhidrato de zilpaterol Dosis de CZ ( mg·kg-1 de PV día-1) EEM Tendencia Na, mmol Cl, mmol K, mmol T3, ng/ml T4 ng/ml

0 139.7 a 113.3 6.29 a 1.40 2.92

0.10 138.2 ab 114.3 5.85 ab 1.19 3.06

0.20 138.5 ab 113.3 6.31 a 1.32 2.40

0.30 137.1 b 113.9 5.57 b 1.25 2.29

0.584 0.489 0.181 0.728 0.343

L <0.01 0.95 0.10 0.33 0.10

C 0.94 0.84 0.51 0.38 0.74

EEM= error estándar de la media; L= lineal; C= cuadrática. K= potasio; Na= sodio; Cl= cloro; T3= triiodotironina; T4= tiroxina. ab Promedios con distinta literal en la misma hilera difieren (P<0.05).

Se ha encontrado que las hormonas T4 y T3 no muestran variación durante tratamientos agudos o crónicos con AA-β(25), resultados que coinciden con los del presente estudio al no encontrar efectos por la adición de CZ durante 30 días. No obstante, Hatefi et al(19) reportaron que los niveles de T3 y T4 aumentaron después de la administración crónica de distintos AA-β en caprinos, resultados que pudieron haberse dado por el aumento en la lipólisis. Las hormonas tiroideas se relacionan ampliamente con aspectos del metabolismo de hidratos de carbono, como la absorción y movilización de glucosa hacia el tejido adiposo y músculo, aumento de glucólisis, gluconeogénesis e incremento de insulina(26), favoreciendo al incremento en la lipólisis. Sin embargo, los reportes sobre los efectos que tiene la administración de AA-β sobre los componentes bioquímicos y hormonas sanguíneas siguen siendo inconsistentes y escasos. Las concentraciones sanguíneas de componentes hemáticos circulantes en el organismo marcan la pauta de equilibrio fisiológico y salud en el animal; sin embargo, agentes externos al organismo pueden modificar las concentraciones óptimas de estos componentes y, consecuentemente, llevarlos a un desequilibrio fisiológico, afectando su bienestar. Por tanto, la evaluación de estos componentes pueden ser indicadores importantes del estado

1213


Rev Mex Cienc Pecu 2020;11(4):1208-1219

fisiológico y patológico de los seres vivos. Los resultados de las dosis de CZ sobre las concentraciones de variables hemáticas se muestran en el Cuadro 3. Cuadro 3: Concentraciones de componentes hematológicos en ovinos de pelo en respuesta a distintas dosis de clorhidrato de zilpaterol EEM= error estándar de la media; L= lineal; C= cuadrática.

Variables

Dosis de CZ ( mg·kg-1 de PV d-1)

Gr, x 10 L

0 11.90

0.10 12.21

0.20 11.32

0.30 11.27

0.457

Tendencia L C 0.16 0.70

Hgb, g/dl

10.68

10.67

10.19

10.25

0.374

0.26

0.91

Htc, %

35.60

36.30

35.00

34.8

1.15

0.48

0.68

VCM, x 1015 L HCM, Pg. CCMH, g/dl

30.21

30.27

31.30

31.90

0.870

0.12

0.78

9.10 29.96 a

8.79 29.3ab

8.98 28.8 b

9.24 29.2 ab

0.205 0.303

0.51 0.03

0.17 <0.05

ADE, %

17.96

18.70

18.62 a

17.58 b

0.375

0.46

<0.05

ab

a

445.3

517.0

549.7

575.5

46.07

<0.05

0.65

12

Pqt, x 10⁹ L

EEM

Gr= glóbulos rojos; Hgb= hemoglobina; Htc= hematocrito; VCM= volumen corpuscular medio; HCM= hemoglobina corpuscular media; CCMH= concentración corpuscular media de hemoglobina; ADE= ancho de distribución de eritrocitos; Pqt= plaquetas. ab Promedios con distinta literal en la misma hilera difieren (P<0.05).

La concentración corpuscular media de hemoglobina fue mayor (P<0.05) en T1 que en T3, mientras que el ancho de distribución de los eritrocitos fue mayor (P<0.05) en T2 y T3 que en T4. Los valores de concentración corpuscular media de hemoglobina (CMH) y ancho de distribución de eritrocitos (ADE) mostraron una tendencia cuadrática (P<0.05), observándose mayor concentración de CCMH en los corderos no suplementados en comparación con los suplementados con Grofactor (Cuadro 3); se observó también que la concentración de ADE fue más elevada en los tratamientos 0.10 y 0.20 mg/kg en comparación con los demás tratamientos; se observó una tendencia lineal (P<0.05) en los niveles de plaquetas, de tal forma que al incrementar los niveles de CZ en la dieta, las concentraciones de plaquetas incrementan. Para el resto de los componentes hematológicos no se observaron diferencias entre tratamientos (P>0.05). Una posible explicación a la disminución de CCMH en el torrente sanguíneo es que la utilización de promotores de crecimiento reduce marcadamente la cantidad de tejido adiposo mediante la lipólisis(18), promoviendo la vasodilatación periférica mediante la adición de ácidos grasos y glicerol al torrente sanguíneo durante este proceso, lo cual provoca el incremento en componentes hemáticos sobre el volumen plasmático(27). Algunos estudios han mostrado que la adición de AA-β ejerce efectos sobre algunos componentes hematológicos en rumiantes(19,28), mediante modificaciones en sus procesos fisiológicos como vasodilatación y la acción cardiovascular(28). Dentro de los efectos cardiovasculares que se presentan por la adición con AA-β se encuentra el incremento de

1214


Rev Mex Cienc Pecu 2020;11(4):1208-1219

la frecuencia respiratoria y cardiaca de los animales. Contrariamente a lo anterior, se ha descrito que el incremento en la frecuencia respiratoria conlleva a un aumento en los niveles de los componentes de glóbulos rojos en el torrente sanguíneo(29), debido a una alta demanda de oxígeno para activar mecanismos de disipación de calor por el incremento del calor metabólico. En este sentido, Boyd et al(30) encontraron que la temperatura del rumen fue más baja en novillos tratados con CZ en relación a los testigos. Los resultados obtenidos se atribuyeron a un incremento en la frecuencia respiratoria en animales tratados, como un mecanismo para disminuir el calor acumulado por el aumento de la fermentación ruminal. Por lo anterior, los resultados de este estudio sugieren que la adición de 0.10 mg de CZ incrementó la lipólisis, sin embargo, adicionar mayores dosis intensificaría la producción de calor metabólico, por lo cual el animal incrementaría la frecuencia respiratoria como mecanismo para mantener constante su temperatura corporal. No obstante, esto provocaría la vasodilatación, causando una disminución inminente de los glóbulos rojos. Resultados similares fueron reportados por Hateffi et al(19), quienes encontraron que la adición de 20 mg·kg-1 de CZ disminuyó los valores de hematocrito y hemoglobina, resultados que se atribuyeron al aumento de la frecuencia respiratoria. Sin embargo, los efectos de los AA-β sobre componentes hematológicos aun no son claros debido a que existen pocos estudios con relación al tema. El incremento en el promedio de plaquetas por efecto del CZ en la dieta pudo haberse debido a un efecto de trombocitosis sanguínea, incrementando la concentración plaquetaria como respuesta a las lesiones que puedan ocasionar el incremento de vasos sanguíneos, y al desbalance homeostático del organismo(16). Resultados similares obtuvieron Wagner et al(24) al encontrar en equinos niveles elevados de plaquetas adicionando 0.17 mg·kg-1 de CZ. No obstante, no se encontraron estudios en rumiantes donde se hayan evaluado los niveles plaquetarios al administrar AA-β. A pesar de lo anterior, los valores hematológicos de todas las variables obtenidas en este estudio se encontraron dentro del rango de referencia(31). Frese et al(8) realizaron un estudio para evaluar el efecto de la adición de zilpaterol y ractopamina en la dieta de bovinos en finalización sobre variables cardiovasculares, concluyendo que la adición de estos AA-β no afectó la tasa de arritmias, aunque hubo un leve aumento en la frecuencia cardiaca, la cual, finalmente, se mantuvo dentro de los rangos de referencia señalados por la literatura para este tipo de ganado. No obstante, es importante continuar con estos estudios para comprobar si estos productos representan un riesgo, tanto para el bienestar animal como para la salud humana. En resumen, se observaron diferencias mínimas en Col, urea, Na, así como en número de plaquetas, concentración corpuscular media de hemoglobina y ancho de distribución de eritrocitos. No obstante, todas las variables sobre hematología y bioquímica sanguínea se encontraron dentro del rango de referencia en respuesta a la adición de las dosis crecientes de clorhidrato de zilpaterol. Estos resultados sugieren que los animales experimentales no modificaron su estado acido-básico ni su homeostasis celular, además de que sus estados metabólico y fisiológico no fueron comprometidos por efecto del consumo de CZ en la dieta. Además, los resultados demuestran que no se generó un estado patológico en los 1215


Rev Mex Cienc Pecu 2020;11(4):1208-1219

ovinos de pelo como resultado de la adición de clorhidrato de zilpaterol (genérico) en la dieta.

Agradecimientos y conflictos de interés Se agradece a la Secretaría de Educación Pública (Proyecto Cuerpos Académicos PRODEP, programa No. 10427) y al Fondo de Educación Superior Empresa A.C. (programa No. 10994) por el apoyo recibido para la realización del presente estudio. Los autores establecen que no existe ningún conflicto de intereses.

Literatura citada: 1. Arteaga CJD. La industria ovina en México: Memoria 1er Simposium Internacional de Ovinos de Carne. Desafíos y oportunidades para la ovinocultura en México ante los nuevos esquemas de mercado abierto. Pachuca de Soto, Hidalgo. 2003. 2. Gastélum-Delgado MA, Avendaño-Reyes L, Álvarez-Valenzuela FD, CorreaCalderón A, Meza-Herrera CA, Mellado M, Macías-Cruz U. Circannual estrous behavior in Pelibuey ewes under arid conditions of Northwestern of Mexico. Rev Mex Cienc Pecu 2015;6(1):109-118. 3. Beermann DH. ASAS Centennial paper: A century of pioneers and progress in meat science in the United States leads to new frontiers. J Anim Sci 2009;87:1192-1198. 4. Avendaño-Reyes L, Macías-Cruz U, Álvarez-Valenzuela FD, Águila-Tepato E, Torrentera-Olivera NG, Soto-Navarro SA. Effects of zilpaterol hydrochloride on growth performance, carcass characteristics, and wholesale cut yield of hair-breed ewe lambs consuming feedlot diets under moderate environmental conditions. J Anim Sci 2011;89:4188-4194. 5. Partida-de-la-Peña JA, Casaya-Rodríguez TA, Rubio-Lozano MS, Méndez-Medina RD. Effect of zilpaterol hydrochloride on the carcass characteristics of Katahdin lamb terminal crosses. Vet Méx 2015;2(2):2448-6760. 6. López-Carlos MA, Ramírez RG, Aguilera SJ, Aréchiga CF, Méndez LF, Rodríguez H, Silva JM. Effect of ractopamine hydrochloride and zilpaterol hydrochloride on growth, diet digestibility, intake and carcass characteristics of feedlot lambs. Livest Sci 2010;131(1):23-30. 7. Estrada-Angulo A, Barreras-Serrano A, Contreras G, Obregón JF, Robles-Estrada JC, Plascencia A, Zinn RA. Influence of level of zilpaterol hydrochloride supplementation on growth performance and carcass characteristics of feedlot lambs. Small Ruminant Res 2008;80(1-3):107-110.

1216


Rev Mex Cienc Pecu 2020;11(4):1208-1219

8. Frese DA, Reinhardt CD, Bartle SJ, Rethorst DN, Bawa B, Thomason JD, Loneragan GH, Thomson DU. Effect of ractopamine hydrochloride and zilpaterol hydrochloride on cardiac electrophysiologic and hematologic variables in finishing steers. J Am Vet Med Assoc 2016;249:668-677. 9. FDA. New Animal Drug Application (NADA) 141-258. ZILMAX (Zilpaterol Hydrochloride) type A medicated article for cattle fed in confinement for slaughter. Approval date: 10 August, 2006. 10. Arcella D, Baert K, Binaglia M, Gervelmeyer A, Innocenti ML, Ribo O, Steinkellner H, Verhagen H. Review of proposed MRLs, safety evaluation of products obtained from animals treated with zilpaterol and evaluation of the effects of zilpaterol on animal health and welfare. EFSA 2016;14(9):4579. 11. Loneragan GH, Thomson DU, Scott HM. Increased mortality in groups of cattle administered the β-Adrenergic agonists ractopamine hydrochloride and zilpaterol hydrochloride. PLoS ONE 2014;9(3):e91177. 12. García, E. Modificaciones al sistema de clasificación climática de Koeppen. 3ra. ed, México, DF. Instituto de Geografía. Universidad Nacional Autónoma de México, 1985. 13. NRC. Nutrient requirements of sheep. National Academy Press, Washington, DC, 1985. 14. SAS Institute Inc.2004. SAS/STAT® User’s Guide. Cary, NC: SAS Institute Inc. 15. Radostits OM, Gay CC, Blood DC, Hinchcliff KW. Clínica Veterinária: um tratado de doenças dos bovinos, ovinos, suínos, caprinos e eqüinos. 9th ed. Guanabara Koogan, Rio de Janeiro, 2002. 16. Kaneko JJ, Harvey JW, Bruss ML. Clinical biochemistry of domestic animals. 6th ed. San Diego (USA): Academic Press; 2008. 17. Vahedi V, Towhidi A, Zare –Shahneh A, Sadeghia M, Zamanic F, Dunshea FR. Effects of β-agonist zilpaterol hydrochloride feeding and supplementation period on growth and carcass characteristics of Lori-Bakhtiari lambs. Small Ruminant Res 2014;4672:4677. 18. Bibber-Krueger CLV, Miller KA, Parsons GL, Thompson LK, Drouillard JS. Effects of zilpaterol hydrochloride on growth performance, blood metabolites, and fatty acid profiles of plasma and adipose tissue in finishing steers. J Anim Sci 2015;93:24192427. 19. Hatefi A, Towhidi A, Zali A, Zeinoaldini S, Ganjkhanlou M, Plascencia A. Effects of dietary zilpaterol hydrochloride (β2-agonist) supplementation on finishing castrated male goats: metabolic endocrine, blood constituents, plasma volume, respiratory rate and cardiac changes. J Appl Anim Res 2017;45(1):447-453.

1217


Rev Mex Cienc Pecu 2020;11(4):1208-1219

20. Zimmerli U, Blum J. Acute and longterm metabolic, endocrine, respiratory, cardiac and skeletal muscle activity changes in response to perorally administered β‐ adrenoceptor agonists in calves. J Anim Physiol Anim Nutr 1990;63:157-172. 21. Nourozi M, Abazari M, Raisianzadeh M, Mohammadi M, Zare-Shahne A. Effect of terbutaline and metaproterenol (two beta-adrenergic agonists) on performance and carcass composition of culled Moghani ewes. Small Ruminant Res 2008;74:72-77. 22. Chikhou FH, Moloney AP, Austin FH, Roche JF, Enright WJ. Effects of cimaterol administration on plasma concentrations of various hormones and metabolites in Friesian steers. Domest Anim Endocrinol 1991;8:471-480. 23. Buntyn JO, Steffen D, Burdick-Sanchez NC, Sieren SE, Jones SJ, Erickson GE, Carroll JA, Schmidt TB. Serum blood metabolite response and evaluation of select organ weight, histology, and cardiac morphology of beef heifers exposed to a dual corticotropin-releasing hormone and vasopressin challenge following supplementation of zilpaterol hydrochloride. J Anim Sci 2017;95:5327-5338. 24. Wagner A, Mostrom S, Hammer C, Thorson JF, Smith DJ. Adverse effects of zilpaterol administration in horses: three cases. J Equine Vet Sci 2008;28:238-243. 25. O’Connor RM, Butler WR, Finnerty KD, Hogue DE, Beermann DH. Acute and chronic hormone and metabolite changes in lambs fed the beta-agonist, cimaterol. Domest Anim Endocrinol 1991;8:537-548. 26. Dickson WM, Feldman EC, Hedge GA, Martin R, McDonald LE. Fisiología Veterinaria Cunningham. Cunningham JG editor. 3ra ed. Madrid, España: Elsevier; 2003. 27. Byrem TM, Beermann DH, Robinson TF. The beta-agonist cimaterol directly enhances chronic protein accretion in skeletal muscle. J Anim Sci 1998;76:988–998. 28. Shirato K, Tanihata J, Motohashi N, Tachiyashiki K, Tomoda A, Imaizumi K. β2agonist clenbuterol induced changes in the distribution of white blood cells in rats. J Pharmacol Sci 2007;104:146-152. 29. Vicente-Pérez A, Avendaño-Reyes L, Barajas-Cruz R, Macías-Cruz U, CorreaCalderón A, Vicente-Pérez R, Corrales-Navarro JL, Guerra-Liera JE. Parámetros bioquímicos y hematológicos en ovinos de pelo con y sin sombra bajo condiciones desérticas. Ecosist Recur Agropec 2018;5(14):259-269. 30. Boyd BM, Shackelford SD, Hales KE, Brown-Brandl TM, Bremer TM, Spangler ML, et al. Effects of shade and feeding zilpaterol hydrochloride to finishing steers on performance, carcass quality, heat stress, mobility, and body temperature. J Anim Sci 2015;93:5801-5811.

1218


Rev Mex Cienc Pecu 2020;11(4):1208-1219

31. Ahmadi-Hamedani M, Ghazvinian K, Atyabi N, Khanalizadeh P, Masoum MA, Ghodrati MS. Hematological reference values of healthy adult Sangsari sheep (Iranian fat-tailed sheep) estimated by Reference Value Advisor. J Appl Anim Res 2016;25:459-464.

1219


https://doi.org/10.22319/rmcp.v11i4.5460 Nota de investigación

Efectos de la suplementación dietética con Ruta graveolens en el desempeño, las características de la canal y la calidad de la carne de conejo

Maricela Ayala Martínez a Armando Zepeda-Bastida a Sergio Soto-Simental a*

Resumen: Ruta graveolens es una maleza que se puede utilizar como alimento de conejos. El objetivo de este estudio fue determinar la tasa de crecimiento, la calidad de la canal y de la carne de conejos después de la suplementación dietética con Ruta graveolens. En total, 60 conejos destetados fueron asignados aleatoriamente a cinco tratamientos: dieta control (C), dieta adicionada con hojas (25RL o 50RL) o la planta completa de Ruta graveolens (25CP o 50CP). Con el uso de Ruta graveolens se observó tasas de crecimiento y de conversión alimenticia similares al grupo control (P>0.05). La calidad de la canal difirió (P<0.05) entre tratamientos en peso de cuerpo vacío, tubo gastrointestinal vacío y grasa. El pH disminuyó en los conejos en crecimiento alimentados con Ruta graveolens, pero la carne presentó mejores parámetros de textura que el grupo control. Los resultados obtenidos sugieren que Ruta graveolens se puede considerar como una fuente alimenticia alternativa en la dieta de conejos. Palabras clave: Planta aromática, Calidad de la carne, Eficiencia del crecimiento, Conejo.

Recibido:24/07/2019 Aceptado: 25/09/2019

En los últimos años, ha habido un interés creciente en el uso de plantas para la producción animal debido a los compuestos bioactivos que contienen; los cuales mejoran el rendimiento productivo, las características de la canal y la calidad de la carne(1). En las dietas para conejos de engorda se utilizan numerosas plantas medicinales, estas son una fuente de fitoquímicos, los cuales poseen

1220


Rev Mex Cienc Pecu 2020;11(4):1220-1230

propiedades antioxidantes o antimicrobianas(1,2). La suplementación dietética con orujo de mora azul se utilizó como estrategia alimenticia para producir un desempeño nutricional favorable y cambios en los ácidos grasos contenidos en la carne de conejo(3). Aunado a esto, la suplementación con orégano y romero tuvo efectos positivos en la tasa de crecimiento y las características de la canal de conejos de engorda(4). En cambio, la suplementación con cebolla, arándano rojo, fresa y sus extractos no produjo diferencias en el desempeño productivo, la calidad de la carne y la estabilidad oxidativa en conejos destetados(5). Ruta graveolens es una planta utilizada en la medicina tradicional en todo el mundo, recibe diferentes nombres, como ruda, hierba de la gracia, entre otros(6). Esta planta es reconocida por sus propiedades antimicrobianas(7,8,9) y antioxidantes(1,2). Ruta graveolens es una planta con un alto contenido de metabolitos secundarios, como cumarinas, alcaloides, aceites volátiles, flavonoides y ácidos fenólicos, los cuales son responsables de diversos efectos biológicos(6). Hasta donde se sabe, ésta es la primera vez que Ruta graveolens se utiliza en dietas de conejos en crecimiento. Sin embargo, los extractos u hojas de esta planta fueron previamente utilizados para investigar su actividad antibacterial in vitro(7). Ruta graveolens y sus flavonoides se pueden utilizar como agentes antimicrobianos(8) o antioxidantes(8,10). La producción de conejos enfrenta un problema durante el crecimiento del conejo. El destete es un periodo crítico para los conejos, durante esta edad se observa un incremento en los problemas digestivos, probablemente debido a la susceptibilidad a diversos patógenos causada por elevadas tasas de estrés. La enteropatía epizoótica del conejo se caracteriza por la presencia de diarrea, meteorismo y distensión de la cavidad intestinal; esta enfermedad tiene altas tasas de morbilidad y mortalidad(2). Debido a sus propiedades antimicrobianas y antioxidantes, Ruta graveolens se podría utilizar como un suplemento alimenticio para incrementar los parámetros productivos y obtener canales y carne de mejor calidad. Con base en las consideraciones anteriores, este estudio buscó determinar los efectos de dietas suplementadas con dos concentraciones diferentes de hojas o planta completa de Ruta graveolens, en el desempeño productivo, las características de la canal y la calidad de la carne de conejos en crecimiento. El ensayo se realizó en la granja experimental del Instituto de Ciencias Agropecuarias (Tulancingo, Hidalgo, México) y fue aprobado por el Comité Institucional para el Cuidado y Uso de Animales de la Universidad Autónoma del Estado de Hidalgo. Se asignaron aleatoriamente 60 conejos destetados (35 d de edad, 25 machos y 35 hembras) a cinco tratamientos (n=12 por tratamiento), cada uno con tres repeticiones, y se alojaron en jaulas (90 cm x 60 cm) equipadas con comederos manuales y bebederos automáticos. Los conejos se criaron bajo condiciones controladas, con una temperatura promedio de 20 °C. Se utilizaron conejos híbridos de las razas Nueva Zelanda,

1221


Rev Mex Cienc Pecu 2020;11(4):1220-1230

California y Mariposa, con un peso promedio de 756.79 ± 97.69 g. Se formaron comprimidos del alimento empleando una máquina comprimidora (SKJ120 modelo, Shandong, China). Los animales se alimentaron ad libitum con dietas experimentales isoproteicas (17% de proteína cruda) e isoenergéticas (2.4 Mcal/kg de energía digestible), conforme a De Blas y Mateos(11). Los animales se dividieron en los siguientes tratamientos: dieta control, dieta suplementada con 25 y 50 g de hojas de ruda/kg de alimento, dieta suplementada con 25 y 50 g de planta completa/kg de alimento (Dieta C, 25RL, 50RL, 25CP, 50CP, respectivamente), como se indica en el Cuadro 1. Cuadro 1: Ingredientes de las dietas experimentales Tratamientos Ingrediente

C

25RL

50RL

25CP

50CP

1.79 1.61 1.07 0.78 1.54 0.77 1.90 0.25 0.30 0

1.81 1.37 0.99 0.78 1.60 0.77 1.90 0.25 0.30 0.23

1.82 1.14 0.99 0.78 1.60 0.77 1.90 0.25 0.30 0.46

1.81 1.37 0.99 0.78 1.60 0.77 1.90 0.25 0.30 0.23

1.82 1.14 0.99 0.78 1.60 0.77 1.90 0.25 0.30 0.46

16.6 16 8.7 2.5 0.8 0.5

16.7 16 8.7 2.5 0.8 0.5

16.6 16 8.7 2.5 0.8 0.5

16.7 16 8.7 2.5 0.8 0.5

16.7 16 8.7 2.5 0.8 0.5

Kg Maíz Paja de avena Salvado de trigo Cáscara de soya Harina de soya Harina de canola Sorgo Melaza Premezcla de vit. y minerales Ruta graveolens (ruda) Composición calculada Proteína cruda, % NDF, % ADF, % ED, Mcal/kg Ca, % P, %

C=Control, 25RL= 25 g.kg-1 de hojas de ruda; 50RL= 50 g.kg-1 de hojas de ruda; 25CP= 25 g.kg-1 de planta completa; 50CP= 50 g.kg-1 de planta completa.

La planta se colectó en Tulancingo, Estado de Hidalgo, en la zona central de México. Después de ser transportadas al laboratorio, las plantas se separaron en hojas (RL) y planta completa (CP) y se secaron a temperatura ambiente durante 5 d a la sombra. Todas las partes se molieron en un molino (Mexicana de Suministros Agropecuarios SA de CV, Tulancingo, Hidalgo, México) usando un tamiz de 5 mm diámetro. Posteriormente, la planta se almacenó en un contenedor de plástico oscuro

1222


Rev Mex Cienc Pecu 2020;11(4):1220-1230

hasta su uso. Durante el experimento, los conejos se pesaron de forma individual cada semana. La ingesta de alimento se midió diariamente durante el periodo de engorda. A partir de estos datos, se calculó la ganancia diaria de peso promedio (GDPP), la ganancia de peso total (GPT) y el índice de conversión alimenticia (ICA). Los conejos se sacrificaron a los 63 d de edad en el laboratorio de carne del Instituto de Ciencias Agropecuarias en Tulancingo, Hidalgo, México. No hubo ayuno previo al sacrificio de los conejos. El largo de los animales se determinó en animales en pie midiendo la distancia desde el atlas hasta el isquion mientras el animal se encontraba en posición dorsal. La pelvis y la circunferencia lumbar de animales vivos y canales se midieron utilizando una cinta métrica. Los animales se pesaron, aturdieron de forma mecánica y procesaron de acuerdo con la legislación nacional(12). Se pesó la canal caliente, el hígado, los riñones, el tubo gastrointestinal lleno y vacío, la vejiga llena y vacía, la grasa escapular y perirrenal, y la piel. Posteriormente, las canales se almacenaron en refrigeración a 4 °C durante 24 h. El peso de cuerpo vacío se calculó al medir las diferencias del peso lleno y vacío del tubo gastrointestinal y la vejiga. Las canales se destazaron después de 24 h en refrigeración(13). La cabeza se cortó a la altura del atlas, el cuarto delantero se obtuvo al cortar entre la 6a y 7a costilla, la caja torácica se determinó cortando la última costilla, y el lomo se obtuvo entre la 6ª y 7ª vértebra lumbar cortando transversalmente la columna vertebral para finalmente obtener la pata trasera. Se separó la grasa, huesos, y carne de las patas traseras. Todas estas piezas se pesaron por separado. El color de la carne se midió en la superficie del lomo entre la última costilla y la 6a vértebra lumbar a temperatura ambiente (22 °C) utilizando un colorímeto portátil i-Lab S560 (Microptix, Wilton, Maine, EE. UU.). Los valores se registraron en términos de espacio de color CIE L*a*b* usando un iluminante estándar tipo D65 y un observador de 2°, como se indica en los lineamientos de medición del color de la carne de la American Meat Science Association(14). El pH se determinó con un medidor de pH adecuado para muestras de carne (modelo HI99163, Hanna instruments, Cluj-Napoca, Rumanía). La capacidad de retención de agua (CRA) se expresó como porcentaje de pérdida de agua(15). Las pérdidas por cocción se midieron en los lomos. Las muestras se colocaron en una bolsa de plástico y cocinaron a 80 °C hasta alcanzar una temperatura interna de 68 °C, se utilizó un termómetro digital para monitorear la temperatura (Hanna Instruments, Portugal). Las muestras cocidas se enfriaron a temperatura ambiente y se pesaron, las pérdidas por cocción se determinaron al calcular la diferencia de peso antes y después de la cocción y se expresaron como porcentaje. Las muestras frías se utilizaron para el análisis de perfil de textura (APT). La muestra se cortó en cubos (1 cm por cada lado) y luego se comprimió al 50 % de forma perpendicular a la dirección de la fibra muscular, con una velocidad de la cruceta de 1 mm/seg(16). Posteriormente, se calculó la dureza, cohesión, elasticidad y masticabilidad con el software Texture Pro CT en un analizador de textura Brookfield CT3 (Brookfield, Middleboro, MA, EE. UU.).

1223


Rev Mex Cienc Pecu 2020;11(4):1220-1230

Se realizó un análisis de varianza con los datos obtenidos siguiendo el procedimiento general para el modelo lineal, donde el tratamiento fue el factor fijo, utilizando el software SAS Institute(17). Cuando se encontraban diferencias estadísticas (P<0.05), se utilizó una prueba de Tukey. En el Cuadro 2 se muestra la ganancia diaria de peso, la ganancia de peso total y el índice de conversión alimenticia durante el periodo de engorda en conejos. La ganancia diaria de peso durante la primera y cuarta semana de crecimiento fue diferente entre los tratamientos (P<0.05). La ganancia de peso total más alta (P<0.05) se encontró en los tratamientos C y 25CP (1,175 ± 131 y 1,190 ± 186, respectivamente). Además, el grupo control fue estadísticamente diferente (P<0.05) al grupo 25RL. Los valores del índice de conversión alimenticia durante el periodo de engorda fueron 2.21 y 2.78 en los tratamientos 25CP y 50CP, respectivamente. Sin embargo, el grupo 50CP presentó un índice de conversión alimenticia más alto en comparación con el grupo control (2.78 ± 0.58 y 2.22 ± 0.24 para el grupo 50CP y control, respectivamente). La ganancia diaria de peso más baja durante la primera semana (39.15) se observó en el grupo 25RL, la más alta (52.22) en el grupo control. En la cuarta semana, la ganancia diaria más alta (39.76) se presentó en el grupo 25CP y la más baja en el tratamiento 50RL. Finalmente, en la ganancia diaria de peso total mayor (41.98) se detectó en el grupo control y la más baja (33.35) en el grupo 25RL. La ganancia de peso más alta (1,175 g) se observó en el grupo control, la más baja (934 g) en el grupo 25RL. Los resultados obtenidos con la planta completa de Ruta graveolens a 25 g.kg-1 en conejos de engorda no fueron significativamente diferentes a los del grupo control en cuanto a la ganancia diaria de peso y el índice de conversión alimenticia durante el periodo de engorda. Cuadro 2: Efectos de la suplementación dietética con Ruta graveolens en el desempeño de conejos de engorda (Media ± DE) Tratamientos

PV35 d PV63 d GDP1 (g) GDP2 (g) GDP3 (g) GDP4 (g) GDPT (g)

C

25RL

50RL

25CP

50CP

629.54±15.06e

686.68±20.03d

765.62±95.4c

821.63±22.14b

889.54±19.80a

1763.18±150.0b

1632.50±95.4ab

1803.75±169.49ab

1928.48±255.59a

1816.98±222.19a

52.22±8.42a

39.15±7.92b

44.71±9.89ab

50.00±11.54ab

45.31±7.80ab

40.63±6.51

33.31±11.09

44.47±6.55

41.74±9.07

37.06±12.65

39.44±6.88

29.92±9.45

34.49±8.09

38.49±11.64

36.82±8.72

35.63±5.69a

33.05±12.28ab

17.96±17.93b

39.76±7.44a

25.87±17.42ab

41.98±4.70a

33.35±3.39b

35.40±4.34ab

42.49±6.65a

36.27±7.42ab

1224


Rev Mex Cienc Pecu 2020;11(4):1220-1230

GPT 1175.55±131.68a 934.09±95.17b 991.42±121.74ab 1190.00±186.41a 1015.55±207.85ab (g) ICA 2.22±0.24b 2.48±0.28ab 2.48±0.30ab 2.21±0.32b 2.78±0.58a C=Control, 25RL= 25 g.kg-1 de hojas de ruda; 50RL= 50 g.kg-1 de hojas de ruda; 25CP= 25 g.kg-1 de planta completa; 50CP= 50 g.kg-1 de planta completa; PV35d= peso vivo a 35 d de edad. PV63d= peso vivo a 63 d de edad. GDP1-4= ganancia diaria de peso durante 1-4 semanas de engorda. GDPT= ganancia diaria de peso durante todo el periodo de engorda. GPT= ganancia de peso total. ICA= índice de conversión alimenticia. abc Diferentes superíndices en la misma fila indican diferencias significativas (P<0.05).

Hasta ahora, existe poca información sobre el uso de la ruda como suplemento dietético en conejos. El uso de 2.5 g.kg-1 de ruda en conejos de engorda aumenta el peso de la canal y la proporción de carne(18). Algunos investigadores no encontraron una diferencia significativa en los parámetros productivos de conejos alimentados con dietas con Trametes maxima(19). Además, la dieta de conejos suplementada con 5 o 10 g kg-1 de Silybum marianum generó una productividad de rendimiento similar(20). Al mismo tiempo, la suplementación con Lythrum salicaria en dietas de conejos en crecimiento no aumentó la tasa de crecimiento(21). Se ha reportado la actividad antioxidante, antibacterial y anticancerígena in vitro de Ruta graveolens(8,9). En este estudio se demostró un rendimiento de crecimiento similar al del grupo de control, especialmente cuando los animales ingieren la planta completa. Los tallos, las hojas y la flor de la ruda se utilizan en la medicina tradicional por sus propiedades antihelmínticas, antiparasitarias, antidiarreicas y antimicrobianas(7). En el Cuadro 3 se muestran los efectos de la suplementación dietética con Ruta graveolens en la calidad de la canal de conejos. El peso del cuerpo vacío fue significativamente diferente entre los grupos (P<0.05). El peso de los conejos suplementados con 25CP (1,780.33 ± 216.84 g) y 50CP (1,821.78 ± 265.10 g) era mayor que el de aquellos suplementados con 25RL (1,496.33 ± 74.36 g); sin embargo, no hubo diferencias significativas (P>0.05) entre el grupo control (1,645.00 ± 13.36 g) y los conejos suplementados con la planta completa (25CP=1,780.33 ± 216.8 y 50CP=1,821.78 ± 265.1 g), produciendo canales más livianas (P<0.05) que el grupo control (control=1.94 frente a 50CP= 0.56). Estos hallazgos están respaldados por el aumento del peso vivo y el peso ganado en el grupo 50CP. La ruda, como suplemento dietético durante el crecimiento de conejos, podría utilizarse para promover la calidad de la canal. Sin embargo, estudios anteriores no han reportado diferencias en las características de la canal empleando una dieta suplementada con otras plantas. Las características de la canal de conejos alimentados con Silybum marianum fueron similares entre los tratamientos(20). Asimismo, otro grupo de investigación que reemplazó ingredientes convencionales con Amaranthus dubius a concentraciones de hasta 32% no observó un impacto negativo en las características de la canal, lo que sugiere que esta planta podría sustituir los ingredientes convencionales en las formulaciones de la dieta de conejos(22). Por otro lado, la suplementación con Lythrum salicaria en la dieta de conejos en crecimiento no generó diferencias en las características de la canal, lo que sugiere que esta planta se podría utilizar en la dieta de conejos durante el periodo de engorda(21).

1225


Rev Mex Cienc Pecu 2020;11(4):1220-1230

Cuadro 3: Efectos de la suplementación dietética con Ruta graveolens en las características de la canal de conejos de engorda (Media ± DE) Tratamientos Variable Peso de caliente

canal

C

25RL

50RL

25CP

976.11±46.69ab

897.77±58.90b

961.87±118.62ab 1617.88±187.04a

50CP

1061.11±125.0 4a 1780.33±216.8 4a

1097.22±182.62a

PCV, g/kg

1645.00±13.36ab 1496.33±74.36b

Canal caliente, %

59.44±2.29

60.10±4.59

59.40±1.92

59.66±2.02

60.01±2.13

CCY, %

57.48±2.01

58.05±3.92

56.95±2.162

57.14±1.872

56.25±2.74

Vísceras

250.40±2.11

278.20±3.46

288.40±5.55

287.70±2.44

274.4±7.13

Corazón

3.40±0.10

3.00±0.10

3.30±0.10

0.31±0.69

0.39±0.94

Pulmones

7.60±1.90

8.40±3.20

7.80±2.16

8.60±1.99

7.30±1.03

Bazo

0.60±0.10

0.70±0.20

0.60±0.09

0.60±0.06

0.70±0.30

Hígado

44.7±10.83

43.50±10.40

47.00±7.84

49.30±6.76

38.80±11.08

Riñones

6.70±0.90

6.30±0.74

6.40±1.18

6.90±1.16

7.20±0.86

PTGV

258.28±46.94b

260.95±36.12b

294.93±34.50ab

310.85±49.04ab 317.30±30.13a

Vejiga

2.10±0.50

2.70±1.11

1.70±0.47

2.20±1.08

2.80±1.19

Grasa de riñón

8.00±1.60

7.60±2.40

6.80±3.24

8.30±4.22

9.60±2.47

Peso de la grasa 2.40±0.70 escapular

2.10±0.80

1.90±0.69

2.20±1.13

3.20±1.79

Cabeza

57.9±0.41

b

1821.78±265.10a

63.40±7.90

61.30±5.53

59.40±5.43

57.6±8.79

Peso de la parte 139.30±6.90 delantera

137.60±11.00

138.00±6.16

140.80±7.04

139.90±6.32

PPI

57.10±9.50

54.70±8.07

52.80±4.80

54.00±7.61

Peso de la parte 111.80±7.80 trasera

107.20±12.60

106.50±10.37

110.70±11.58

112.10±9.70

Piernas

203.70±8.70

204.80±12.80

199.90±7.83

196.10±11.26

196.60±9.08

Carne

152.80±10.10

153.40±11.10

147.40±7.58

150.00±8.49

147.20±14.56

Hueso

45.40±7.30

46.50±7.00

48.70±9.46

41.10±6.55

44.60±6.84

ab

b

0.56±0.59b

Grasa diseccionable

53.10±4.70

1.94±0.12

a

1.44±0.97

a

0.81±0.62

0.75±0.68

C=Control, 25RL= 25 g.kg-1 de hojas de ruda; 50RL= 50 g.kg-1 de hojas de ruda; 25CP= 25 g.kg-1 de planta completa; 50CP= 50 g.kg-1 de planta completa. PCV= peso de cuerpo vacío; CCY= rendimiento de la canal fría; PTGV= peso del tubo gastrointestinal vacío; PPI= peso de la parte intermedia. abc Diferentes superíndices en la misma fila indican diferencias (P<0.05).

1226


Rev Mex Cienc Pecu 2020;11(4):1220-1230

En la Tabla 4 se presenta el color, pH, CRA y otras variables de la carne de conejos alimentados con dietas suplementadas con Ruta graveolens. Se encontraron diferencias significativas (P<0.05) en todas las características medidas, además del CRA y la dureza. Las hojas de Ruta graveolens afectaron (P<0.05) el color de la carne de conejo, generando valores más bajos de L* (25RL=55.3) y b* (50RL=8.22). La planta completa generó valores de a* (50CP=0.61) más bajos en comparación con el grupo control (1.23). Igualmente, el pH disminuyó cuando se alimentó a los conejos con una dieta suplementada con 25 g kg-1 de la planta completa. Los resultados del análisis del perfil de textura, mostraron que la dureza no mostró diferencias (P>0.05) entre los grupos, pero la resiliencia, cohesión, elasticidad y masticabilidad fueron diferentes en el grupo control y los tratados con Ruta graveolens . La resiliencia y cohesión fueron mayores en la carne de conejos alimentados con hojas de Ruta graveolens, mientras que la elasticidad fue más alta en 25RL (3.05), 50RL (4.00) y 25CP (2.35) que en el grupo control (0.60). Tabla 4: Efectos de la suplementación dietética con Ruta graveolens en la calidad de la carne de conejos de engorda (Media ± DE) Tratamientos Variable C 25RL 50RL 25CP 50CP L*

57.90±3.21a

55.30±3.60b

58.07±3.91a

58.21±3.05a

56.72±2.84ab

a*

1.23±1.75ab

1.65±1.43a

1.18±1.61ab

1.29±1.17ab

0.61±1.40b

b* pH

9.74±2.04a 5.85±0.11a

9.36±2.00ab 5.81±0.04ab

8.22±2.45b 5.77±0.03ab

8.96±2.23ab 5.75±0.05b

9.42±2.19ab 5.80±0.19ab

CRA, %

21.12±5.19

20.02±4.86

18.85±6.19

18.06±5.69

19.48±5.26

Dureza. N Resiliencia Cohesión Elasticidad Masticabilidad

8.31±2.17 3.05±0.17b 0.24±0.02c 0.60±0.13c 12.81±0.76b

9.76±3.13 5.08±0.77a 0.48±0.08ab 3.05±1.17b 19.47±5.91a

9.36±3.30 4.94±0.42a 0.54±0.01a 4.00±0.52a 22.42±4.59a

10.18±4.37 2.63±0.46b 0.44±0.08b 2.35±0.62b 8.75±1.97b

10.59±3.62 2.75±0.04b 0.22±0.01c 0.57±0.12c 13.56±2.79b

C=Control, 25RL= 25 g.kg-1 de hojas de ruda; 50RL= 50 g.kg-1 de hojas de ruda; 25CP= 25 g.kg-1 de planta completa; 50CP= 50 g.kg-1 de planta completa. abc Diferentes superíndices en la misma fila indican diferencias (P<0.05).

Estudios previos no han reportado diferencias en la calidad de la carne de conejos alimentados con una dieta suplementada con plantas. La calidad de la carne no afectó a los conejos alimentados con Silybum marianum(20). Al reemplazar ingredientes convencionales con Amaranthus dubius a concentraciones de hasta 32% no se observó un impacto negativo en la calidad de la carne, lo que sugiere que esta planta podría ser un potencial sustituto de los ingredientes convencionales en las formulaciones de la dieta de conejo(22). Se obtuvieron resultados similares con Lythrum salicaria,

1227


Rev Mex Cienc Pecu 2020;11(4):1220-1230

esta dieta no generó diferencias en las características de la canal, lo que sugiere que esta planta se podría utilizar en la dieta de conejos durante el periodo de engorda(19). El pH está asociado con el color. Se reportaron valores de pH bajos (4.49) en el músculo Longissimus dorsi de conejos alimentados con Amaranthus dubius(21). Mientras que se reportaron valores de L* de alrededor de 54 y un pH aproximado de 5.6 cuando los conejos fueron alimentados con salicaria(20). El color y el pH de la carne de conejo se pueden ver afectados por la edad, la raza, el tipo de músculo, el sexo, el alimento, las condiciones ante y posmortem, y otros factores(23,24). La suplementación dietética con Ruta graveolens en conejos de engorda se puede considerar un alimento alternativo viable para mantener los altos parámetros de producción y obtener características de la canal y calidad de la carne similares a las de los conejos bajo una alimentación convencional.

Agradecimientos Los autores agradecen al programa PRODEP por el apoyo financiero durante este estudio. Número de proyecto DSA/103.5/16/10281. SEP-PFCE 2018.

Literatura citada: 1. Zeng Z, Zhang S, Wang H, Piao X. Essential oil and aromatic plants as feed additives in nonruminant nutrition: a review. J Anim Sci Biotechnol 2015;(6):7-15. 2. Dalle-Zotte A, Celia C, Szendró Zs. Herbs and spices inclusion as feedstuff or additive in growing rabbit diets and as additive in rabbit meat: a review. Lives Sci 2016;(189):82-90. 3. Dabbou S, Renna M, Lussiana C, Gai F, Rotolo L, Kovitvadhi A, Brugiapaglia A, Helal AN, Schiavone A, Zoccarato I, Gasco L. Bilberry pomace in growing rabbit diets: effects on quality traits of hind leg meat. Ital J Anim Sci 2017;(16):371-379. 4. Cardinali R, Cullere M, Dal Bosco A, Mugnai C, Ruggeri S, Mattioli S, Castellini C, TrabalzaMarinucci M, Dalle-Zotte A. Oregano, rosemary and vitamin E dietary supplementation in growing rabbits: Effect on growth performance, carcass traits, bone development and meat chemical composition. Lives Sci 2015;(175):83-89. 5. Kone AP, Cinq-Mars D, Desjardins Y, Guay F, Gosselin A, Saucier L. Effects of plant extracts and essential oils as feed supplements on quality and microbial traits of rabbit meat. World Rabbit Sci 2016;(24):107-119.

1228


Rev Mex Cienc Pecu 2020;11(4):1220-1230

6. Malik S, Fernandes-Coutinho MD, Mendoḉa do Amaral FM, Sousa-Ribeiro MN. Ruta graveolens: Phytochemistry, pharmacology and biotechnology. In: S. Jha editor. Transgenesis and secondary metabolism. Sham, Switzerland: Springer International Publishing; 2017;177204. 7. França-Orlanda JF, Nascimento AR. Chemical composition and antibacterial activity of Ruta graveolens L. (Rutaceae) volatile oils, from São Luís, Maranhão, Brazil. S Afr J Bot 2015;(99):103-106. 8. Pushpa H, Ramya-Shree N, Shetty SP, Ramesh DH. (2015). Screening of antimicrobial, antioxidant and anticancer activity of Ruta graveolens. Adv Biol Res 2015;(9):257-264. 9. Chaftar N, Girardot M, Labanowski J, Ghrairi T, Hani K, Frere J, Imbert C. Comparative evaluation of the antimicrobial activity of 19 essential oils. Adv Exp Med Biol–Adv Microbiol Inf Dis Pub Health 2016;(901):1–15. 10. Mohammadi-Motamed S, Shahidi-Motlagh S, Bagherzadeh H, Azad-Forouz S, Tafazoli H. Evaluation of antioxidant activity of Ruta graveolens L. extract on inhibition of lipid peroxidation and DPPH radicals and the effects of some external factors on plant extract's potency. Res J Pharmacogn 2014;(1):45-50. 11. De Blas C, Mateos GG. Feed formulation. In: de Blas C, Wiseman J, editors. Nutrition of the rabbit. 2nd ed. Wallingford, UK: CAB International; 2010:222-232. 12. NOM-033- SAG/ZOO. Norma Oficial Mexicana. Métodos para dar muerte a los animales domésticos y silvestres. 2014. 13. Blasco A, Ouhayoun J, Masoero, G. Harmonization of criteria and terminology in rabbit meat research. World Rabbit Sci 1993;(1):3-10. 14. AMSA. Meat colour measurement guidelines. American Meat Science Association Champaign. Il. USA. 2012. 15. Honikel KO. How to measure the water-holding capacity of meat? Recommendation of standardized methods. In: Tarrant PV, et al editors. Evaluation and control of meat quality in pigs. Current topics in veterinary medicine and animal science. Volume 38. Dordrecht. Germany: Springer; 1987:129-142. 16. Bourne MC. Texture profile analysis. Food Technol 1978;(35):62-66. 17. SAS. SAS User’s guide: Statistics (version 5 ed.). Cary, NC, USA: SAS Inst Inc. 1999.

1229


Rev Mex Cienc Pecu 2020;11(4):1220-1230

18. Herrera-Soto IA, García-Flores M, Soto-Simental S, Zepeda-Bastida A, Ayala-Martinez M. Plantas aromáticas en la alimentación de conejos y su efecto en la carne. Abanico Veterinario 2018;(8):81-87. 19. Hernández-Martínez CA, Maldonado-Herrera JA, Méndez-Zamora G, Hernández-Luna CE, Gutiérrez-Soto G. Enzymatic extract of Trametes maxima CU1 on productive parameters and carcass yield of rabbits. Can J Anim Sci 2017;(97):683-688. 20. Cullere M, Dalle-Zotte A, Celia C, Renteria-Monterrubio AL, Gerencsér Zs, Szendró Zs, Kovács M, Kachlek ML, Matics Zs. Effect of Silybum marianum herb on the productive performance, carcass traits and meat quality of growing rabbits. Lives Sci 2016;(194):31-36. 21. Kovitvadhi A, Gasco L, Ferrocino I, Rotolo L, Dabbou S, Malfatto V, et al. Effect of purple loosestrife (Lythrum salicaria) diet supplementation in rabbit nutrition on performance, digestibility, health and meat quality. Animal 2016;(10):10–18. 22. Molina E, González-Redondo P, Moreno-Rojas R, Montero-Quintero K, Sánchez-Urdaneta A. Effect of the inclusion of Amaranthus dubius in diets on carcass characteristics and meat quality of fattening rabbits. J Appl Anim Res 2018;(46):218-223. 23. Hulot F, Ouhayoun J. Muscular pH and related traits in rabbits: A review. World Rabbit Sci 1999;(7):15-36. 24. Dalle-Zotte A. Perception of rabbit meat quality and major factors influencing the rabbit carcass and meat quality. Livest Prod Sci 2002;(75):11-32.

1230


Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 11 Núm 4, pp. 933-1230, OCTUBRE-DICIEMBRE-2020

ISSN: 2448-6698

Pags. Detección molecular de coronavirus bovino asociado al complejo respiratorio bovino en ganado de engorda del valle de Mexicali, Baja California, México

Molecular detection of bovine coronavirus associated with the bovine respiratory complex in beef cattle in the Mexicali Valley, Baja California, Mexico Carolina Orozco-Cabrera, Gilberto López-Valencia, Luis Mario Muñoz-Del Real, Soila Maribel Gaxiola-Camacho, Nohemí Castro-del Campo, Sergio Arturo Cueto-González, José Guadalupe Guerrero-Velázquez, Ka�ya Moreno-Torres, Kelvin Orlando Espinoza-Blandón, Sergio Daniel Gómez-Gómez, Enrique Trasviña-Muñoz, Francisco Javier Monge-Navarro…........….....….…...933

Frecuencia de M. hyopneumoniae, M. hyorhinis y M. hyosynoviae en muestrasnasales y de pulmón de cerdos con síntomas de neumonía enzoótica porcina

Frequency of M. hyopneumoniae, M. hyorhinis and M. hyosynoviae in nasal and lung samples from pigs with symptoms of porcine enzootic pneumonia Rosa Elena Miranda Morales, Verónica Rojas Trejo, Luis Enrique López-Cerino, Erika Margarita Carrillo Casas, Rosa Elena Sarmiento Silva, María Elena Trujillo Ortega, Rolando Beltrán Figueroa, Francisco José Trigo Tavera……………………………………………………………………………………………………………………………………….………………………………….….....…946

Presencia de Hymenolepis nana y diminuta en roedores de la ciudadela las Piñas, Milagro-Ecuador y su riesgo en salud pública

Presence of Hymenolepis nana and diminuta in rodents of the Las Pinas citadel, in Milagro, Ecuador, and its risk for public health Roberto Darwin Coello-Peralta, Galo Ernesto Mar�nez-Cepeda, Douglas Pinela-Castro, Enrique Omar Reyes-Echeverria, Enrique Xavier Rodríguez-Burnham, Maria de Lourdes Salazar Mazamba, Be�y Pazmiño-Gómez, Antonella Ramírez-Tigrero, Manuel Bernstein, Pedro Cedeño-Reyes…………………….……………….…………….……………..….…………………………………….961

Frecuencia de contaminación y de serotipos de Salmonella enterica y Escherichia coli en una operación integrada de matanza y deshuese de bovinos

Frequency of contamination and serovars of Salmonella enterica and Escherichia coli in anintegrated cattle slaughtering and deboning operation Jorge Alfredo de la Garza-García, María Salud Rubio Lozano, María del Carmen Wacher-Rodarte, Armando Navarro Ocaña, Rigoberto Hernández-Castro, Juan Xicohtencatl-Cortes, Enrique Jesús Delgado Suárez..........................………….........………….........………….........………….........………….........………….........………….……………………….971

Antimicrobial resistance of Escherichia coli isolated from cattle carcasses and feces in Center of Mexico

La resistencia antimicrobiana en Escherichia coli aislada de canales y heces bovinas de rastros en el centro de México Vicente Vega Sánchez, Mar�n Talavera Rojas, Jeanne�e Barba León, Andrea Paloma Zepeda Velázquez, Nydia Edith Reyes Rodríguez……………………………..............….…..………………………………………...…………991

Resistencia antimicrobiana de Salmonella spp aisladas de canales de cerdo obtenidas de dos tipos de rastros en Jalisco, México

Antimicrobial resistance in Salmonella spp. isolated from pig carcasses in two slaughterhouse types in Jalisco, Mexico Vicente Vega-Sánchez, Jeanne�e Barba-León, Delia Guillermina González-Aguilar, Elisa Cabrera-Díaz, Carlos Pacheco-Gallardo, Adriana Guadalupe Orozco-García…..…………………………………...……………….1004

Influence of milking method, storage conditions and somatic cell counts on the milk quality form tanks

La influencia del método de ordeño, las condiciones de almacenamiento y el recuento de células somáticas en la calidad de la leche cruda en tanques Joadilza da Silva Bezerra, Juliana Paula Felipe de Oliveira, Danielle Cavalcan� Sales, Yhêlda Maria de Oliveira Silva, Stela Antas Urbano, Luis Henrique Fernandes Borba, Lisandra Murmann, Adriano Henriquedo Nascimento Rangel………………………………………………………………………………………………………………………………………………………….….....1016

Serotypes and Stx2 subtyping of Shiga toxin producing Escherichia coli isolates from cattle carcasses and feces

Serotipos y aislamientos de Escherichia coli productora del subtipo Stx2 de la toxina Shiga provenientes de canales y heces de ganado bovino Verónica García Mendoza, Alex Edray Hernández Vázquez, José Luis Reyes Carrillo, Uriel Figueroa Viramontes, Jorge Sáenz Mata, Nydia Edith Reyes-Rodríguez, Jeanne�e Barba-León, Armando Navarro-Ocaña, Vicente Vega-Sánchez, Fabián Ricardo Gómez De Anda, Juan Mar�n Talavera-González, Mar�n Talavera-Rojas…………………………………………………………….1030

Impacto de la inclusión de información extranjera sobre la evaluación genética mexicana de sementales Holstein

Impact of the inclusion of foreign information on Mexican genetic evaluation of Holstein sires Gustavo Javier Mar�nez Marín, Felipe de Jesús Ruiz López, Carlos Gustavo Vásquez Peláez, Sergio Iván Román Ponce, Adriana García Ruiz……………………………………………………………………………………………...1045

Análisis genómico de diversidad y estructura genómica de las poblaciones bovinas de la raza mexicana de Lidia

Genomic diversity and structure of Lidia breed cattle in Mexico Paulina G. Eusebi, Oscar Cortés, Susana Dunner, Javier Cañón………………………………………………..….………………………...……………………………………………………………………….………………………………………………………….1059

Análisis del pedigrí en diez poblaciones mexicanas de ovinos

Pedigree analysis in ten sheep populations in Mexico Joel Domínguez-Viveros, Felipe Alonso Rodríguez-Almeida, Adán Medellín-Cázares, Juan Pablo Gu�érrez-García………………………………………………………………………..……………………………………………………………1071

Acumulación de forraje de Lotus corniculatus L., en función a diferentes estrategias de cosecha

Forage accumulation in Lotus corniculatus L. as a function of harvest strategy Perpetuo Álvarez Vázquez. Juan de Dios Guerrero Rodríguez, Gabino Garcia De Los Santos, Maria Esther Ortega Cerrilla, Sergio Iban Mendoza Pedroza, San�ago Joaquín Cancino………………………………………………………………………............….………………………..……………………………..………………....………….1087

Presence of the yeast Kodamaea ohmeri associated with Aethina tumida (Coleoptera: Nitidulidae) collected in Africanized honey bee colonies from twoapiaries of Yucatan, Mexico

Presencia de la levadura Kodamaea ohmeri en escarabajos Aethina tumida (Coleoptera: Nitidulidae) colectados de colonias de abeja melífera africanizada en dos apiarios en Yucatán,México Azucena Canto, Luis A. Medina-Medina, Elisa Chan, Rosalina Rodríguez……………………………………..…………………………………………………….....………………………….....………….....……..……………………………………………..1101

Factores determinantes del uso de sorgo para alimentación de ganado bovino en el noroeste de México

Determining factors for the use of sorghum as fodder for bovines in Northwestern Mexico Venancio Cuevas-Reyes, Blanca Isabel Sánchez Toledano, Roselia Servín Juárez, Juan Esteban Reyes Jiménez, Alfredo Loaiza Meza, Tomas Moreno Gallegos………………...….……………………………………………..1113

Mejoramiento genético de la biomasa aérea y sus componentes en alfalfa: selección familial de medios hermanos

Genetic improvement of aerial alfalfa biomass and its components: half-sib family selection Milton Javier Luna-Guerrero, Cándido López-Castañeda, Alfonso Hernández-Garay……………………..……………………………………………………………………………………………………………….…………………………………………..1126

REVISIONES DE LITERATURA Post vitrification pregnancy rate of in vivo produced embryos derived from equids. Review

Tasa de preñez post vitrificación en los embriones de équidos producidos in vivo. Revisión Chris�an Urías-Castro, Ana Myriam Boeta……………………………………………………………………………..…………………….........………………………........………........………........………........………........……….…………………………….. 1142

Herramientas moleculares utilizadas para el análisis metagenómico. Revisión

Molecular tools used for metagenomic analysis. Review Nohemí Gabriela Cortés-López, Perla Lucía Ordóñez-Baquera, Joel Domínguez-Viveros…………………..……………………………………………………………………………………….………………………………………….…………………...1150

Origen metabólico y propiedades bioactivas de ácidos grasos ramificados e imparesen leche de rumiantes. Revisión

Metabolic origin and bioactive properties of odd and branched-chain fatty acids in ruminants’ milk. Review Pilar Gómez-Cortés, Miguel Ángel de la Fuente…………………………………………………………………………………………………………………………………………………………………………………………………...…………………………….........1174

NOTAS DE INVESTIGACIÓN Análisis de QTL asociados a polimorfismos de nucleótido único (SNP) involucrados en el fenotipo lechero del ganado Holstein

QTL analysis associated to single nucleotide polymorphisms (SNP) involved in the dairy phenotype of Holstein cattle José Manuel Valdez-Torres, Juan Alberto Grado Ahuir, Beatriz Elena Castro-Valenzuela, M. EduvigesBurrola-Barraza…………………………………………………………………………......……………………………………………..…1192

Efecto de la adición de clorhidrato de zilpaterol genérico en el perfil bioquímico y hematológico de ovinos de pelo engordados en corral

Evaluation of the biochemical and hematological profiles of feedlot hair sheep after thesupplementation with generic zilpaterol hydrochloride Arnulfo Vicente Pérez, Leonel Avendaño Reyes, Ulises Macías Cruz, Antonio Aguilar Quiñones, RicardoVicente Pérez, Miguel Mellado Bosque, Miguel Ángel Gastélum Delgado, Abelardo Correa Calderón, G. López-Rincón, Juan Eulogio Guerra Liera………………………………………………………......………………………………......………………………………………..…….1208

Dietary supplementation effects with Ruta graveolens on performance, carcass traits and meat quality on rabbits

Efectos de la suplementación dietética con Ruta graveolens en el desempeño, las características de la canal y la calidad de la carne de conejo Maricela Ayala Mar�nez, Armando Zepeda-Bas�da, Sergio Soto-Simental………………………….…………..…………..…………..…………..…………..…………..…………..…………...…………..…………………………………………………..1220

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 11 Núm 4, pp. 933-1230, OCTUBRE-DICIEMBRE-2020

CONTENIDO CONTENTS

Rev. Mex. Cienc. Pecu. Vol. 11 Núm. 4, pp. 933-1230, OCTUBRE-DICIEMBRE-2020

Profile for Revista Mexicana de Ciencias Pecuarias

RMCP Vol. 11, Núm. 4 (2020): Octubre-Diciembre [versión en español]  

RMCP Vol. 11, Núm. 4 (2020): Octubre-Diciembre [versión en español]  

Advertisement