__MAIN_TEXT__

Page 1

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 11 Núm 3, pp. 605-932, JULIO-SEPTIEMBRE-2020

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 11 Núm. 3, pp. 605-932, JULIO-SEPTIEMBRE-2020


Cultivo de girasol en el Centro de Investigaciones Agrarias de Mabegondo (CIAM). Galicia, España. Fotografía: Aurora Sainz Ramírez.

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 11 Número 3, JulioSeptiembre 2020. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 04-2016-060913393200-203. ISSN: 2448-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en agosto de 2020.

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dra. Elisa Margarita Rubí Chávez, UNAM, México Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dr. Martin Talavera Rojas, Universidad Autónoma del Estado de México, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dra. Silvia Elena Buntinx Dios, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, UAEH, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

I


REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria.

total por publicar es de $ 5,600.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx.

Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados.

La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx.

The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products.

For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 325.00 per article in both printed languages.

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

II


REVISTA MEXICANA DE CIENCIAS PECUARIAS REV. MEX. CIENC. PECU.

VOL. 11 No. 3

JULIO-SEPTIEMBRE-2020

CONTENIDO ARTÍCULOS

Pág. Pasta de higuerilla desintoxicada en dietas para pollos de engorda Detoxified castor meal in broiler chickens’ diets Anabel Maldonado Fuentes, Juan Manuel Cuca García, Arturo Pro Martínez, Fernando González Cerón, José Guadalupe Herrera Haro, Eliseo Sosa Montes, Pablo Alfredo Domínguez Martínez ……………. 605

Efecto de la fecha de corte y del uso de aditivos en la composición química y calidad fermentativa de ensilado de girasol Effect of the cutting date and the use of additives on the chemical composition and fermentative quality of sunflower silage Aurora Sainz-Ramírez, Adrián Botana, Sonia Pereira-Crespo, Laura González-González, Marcos Veiga, César Resch, Juan Valladares, Carlos Manuel Arriaga-Jordán, Gonzalo Flores-Calvete………………. 620

Suplementación de clorhidrato de zilpaterol en corderos finalizados con dieta sin fibra de forraje Supplementation with zilpaterol hydrochloride in lambs finished with a non-forage fiber diet Ricardo Vicente Pérez, Ulises Macías-Cruz, Ramón Andrade Mancillas, Rogelio Vicente, Enrique O. García, Ricardo Martínez, Leonel Avendaño-Reyes, Oziel D. Montañez …………………………………………………………………………………………………………………………..……638

Changes in myoglobin content in pork Longissimus thoracis muscle during freezing storage Cambios en el contenido de mioglobina en el músculo porcino Longissimus thoracis durante el almacenamiento en congelación Jonathan Coria-Hernández, Rosalía Meléndez-Pérez, Abraham Méndez-Albores, José Luis ArjonaRomán............................................................................................................................................... 651

Indicadores de competitividad de la carne bovina de México en el mercado mundial Indicators of the competitiveness of Mexican beef in the world market Miguel Ángel Magaña Magaña, Carlos Enrique Leyva Morales, Juan Felipe Alonzo Solís, Carlos Gabriel Leyva Pech……………………………………………………………………………………………….......…………. 669

III


Adición de extracto acuoso de ajo (Allium sativum) en dieta de conejos (Oryctolagus cuniculus) sobre productividad, calidad física y microbiológica de la carne Effect of the addition of aqueous extract of garlic (Allium sativum) to the diet of rabbits (Oryctolagus cuniculus) on the productivity and on the physical and microbiological quality of the meat Dora Luz Pinzón Martínez, María Dolores Mariezcurrena Berasain, Héctor Daniel Arzate Serrano, María Antonia Mariezcurrena Berasain, Abdelfattah Zeidan Mohamed Salem, Alfredo Medina García ….. 686

El aceite esencial y bagazo de orégano (Lippia berlandieri Schauer) afectan el comportamiento productivo y la calidad de la carne de conejo Essential oil and bagasse of oregano (Lippia berlandieri Schauer) affect the productive performance and the quality of rabbit meat Jesica Leticia Aquino-López, América Chávez-Martínez, José Arturo García-Macías, Gerardo MéndezZamora, Ana Luisa Rentería-Monterrubio, Antonella Dalle-Zotte, Luis Raúl García-Flores ………… 701

Las rizobacterias halófilas mantienen la calidad forrajera de Moringa oleifera cultivada en sustrato salino Halophilic rhizobacteria maintain the forage quality of Moringa oleifera grown on a saline substrate Verónica García Mendoza, Alex Edray Hernández Vázquez, José Luis Reyes Carrillo, Uriel Figueroa Viramontes, Jorge Sáenz Mata, Héctor Mario Quiroga Garza, Emilio Olivares Sáenz, Pedro Cano Ríos, José Eduardo García Martínez…………………………………………………………………………………………………………….…….718

Efecto del reemplazo folicular (GnRH) y de somatotropina bovina (bST) sobre la fertilidad de vacas lecheras expuestas a estrés calórico Effect of follicular replacement (GnRH) and bovine somatotropin (bST) on the fertility of dairy cows exposed to heat stress Renato Raúl Lozano-Domínguez, Carlos Fernando Aréchiga-Flores, Marco Antonio López-Carlos, Zimri Cortés-Vidauri, Melba Rincón-Delgado, José Ma. Carrera-Chávez, Ulises Macías-Cruz, Joel HernándezCerón ................................................................................................................................................ 738

Efecto del tamaño interno de la colmena en la producción de cría, miel y polen en colonias de Apis mellifera en el altiplano central de México Effect of the internal size of the hive on brood, honey, and pollen production in Apis mellifera colonies in the central Mexican plateau Alfonso Hernández Carlos, Ignacio Castellanos ................................................................................ 757

Seroprevalencia de agentes virales del Complejo Respiratorio Bovino en razas criollas del Centro de Investigación Turipaná de AGROSAVIA Seroprevalence of viral agents of the Bovine Respiratory Complex in Creole breeds of the Turipaná Research Center of AGROSAVIA Matiluz Doria-Ramos, Teresa Oviedo-Socarras, Misael Oviedo-Pastrana, Diego Ortiz-Ortega ......... 771

IV


Frecuencia y factores de riesgo asociados a la presencia de Chlamydia abortus, en rebaños ovinos en México Frequency and risk factors associated with the presence of Chlamydia abortus in flocks of sheep in Mexico Erika G. Palomares Reséndiz, Pedro Mejía Sánchez, Francisco Aguilar Romero, Lino de la Cruz Colín, Héctor Jiménez Severiano, José Clemente Leyva Corona, Marcela I. Morales Pablos, Efrén Díaz Aparicio ............................................................................................................................................. 783

Linfonodos y carne molida de res como reservorios de Salmonella spp. de importancia en salud pública Lymph nodes and ground beef as public health importance reservoirs of Salmonella spp. Tania Palós Gutiérrez, María Salud Rubio Lozano, Enrique Jesús Delgado Suárez, Naisy Rosi Guzmán, Orbelin Soberanis Ramos, Cindy Fabiola Hernández Pérez, Rubén Danilo Méndez Medina………………………………………………………………………………………………………………………795

Uso de una PCR anidada para el diagnóstico del virus de la necrosis pancreática infecciosa (VNPI) en truchas de campo Diagnosis of the infectious pancreatic necrosis virus (IPNV) by nested PCR in wild trouts Catalina Tufiño-Loza, José Juan Marti ́nez-Maya, Amaury Carrillo-Gonzá lez, Diana Neria-Arriaga, Celene Salgado-Miranda, Edith Rojas-Anaya, Elizabeth Loza-Rubio ................................................ 811

Polymorphisms associated with the number of live-born piglets in sows infected with the PRRS virus in southern Sonora Mexico Polimorfismos asociados con el número de lechones nacidos vivos en cerdas infectadas con el virus del PRRS en el sur de Sonora México Carlos Martín Aguilar-Trejo, Guillermo Luna-Nevárez, Javier Rolando Reyna-Granados, Ricardo Zamorano-Algandar, Javier Alonso Romo-Rubio, Miguel Ángel Sánchez-Castro, R. Mark Enns, Scott E. Speidel, Milton G. Thomas, Pablo Luna-Nevárez ............................................................................... 828

Venta a granel de embutidos: una tendencia de comercialización asociada al riesgo de enfermedades trasmitidas por alimentos en Culiacán, México Bulk sales of cold cuts and sausages: a marketing trend associated to the risk of foodborne diseases in Culiacan, Mexico Maribel Jiménez-Edeza, Maritza Castillo-Burgos, Lourdes Janeth Germán-Báez, Gloria Marisol Castañeda-Ruelas ............................................................................................................................. 848

REVISIONES DE LITERATURA

Estudios de asociación genómica en ovinos de América Latina. Revisión Genome-wide association studies in sheep from Latin America. Review Karen Melissa Cardona Tobar, Diana Carolina López Álvarez, Luz Ángela Álvarez Franco ................ 859

V


NOTAS DE INVESTIGACIÓN

Crecimiento de corderos y productividad en ovejas Pelibuey mantenidas bajo condiciones tropicales de producción Lamb growth and ewe productivity in Pelibuey sheep under tropical conditions Carolina Atenea García-Chávez, Carlos Luna-Palomera, Ulises Macías-Cruz, José Candelario SeguraCorrea, Nadia Florencia Ojeda-Robertos, Jorge Alonso Peralta-Torres, Alfonso Juventino Chay-Canúl .......................................................................................................................................................... 884

Identification of candidate genes for reproductive traits in cattle using a functional interaction network approach La identificación de genes candidatos para rasgos de la reproducción en ganado utilizando un enfoque de redes de interacciones funcionales Francisco Alejandro Paredes-Sánchez, Daniel Trejo-Martínez, Elsa Verónica Herrera-Mayorga, Williams Arellano-Vera, Felipe Rodríguez Almeida, Ana María Sifuentes-Rincón ............................. 894

Tiempo de manejo y algunas conductas relacionadas con el estrés al manejar grupos grandes o reducidos de ganado en mangas rectas Effect of group size on processing time and some stress-related behaviors in cattle in straight chutes Miguel Ángel Damián, Virginio Aguirre, Agustín Orihuela, Mariana Pedernera, Saúl Rojas, Jaime Olivares ............................................................................................................................................. 905

Diversidad de la flora de interés apícola en el estado de Tamaulipas, México Diversity of melliferous flora in the State of Tamaulipas, Mexico Mario González-Suárez, Arturo Mora-Olivo, Rogel Villanueva-Gutiérrez, Manuel Lara-Villalón, Venancio Vanoye-Eligio, Antonio Guerra-Pérez ................................................................................ 914

VI


Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros. 6.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes).

2.

Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo.

3.

El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

4.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

5.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte. Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

7.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

8.

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

9.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales

VII


de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como referencias, aunque pueden insertarse en el texto (entre paréntesis).

Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés.

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus.

12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias.

Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o

VIII


menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”). I)

forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56. XI)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones

IX


http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

g gramo (s) ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003. 13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

xg

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50

vs

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50%

X


Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt.

3.

Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias�. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

5.

6.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts).

2.

4.

contain the following sections, and each one should begin on a separate page.

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

7.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

8.

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

9.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts:

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should

XI


In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

b) Technical Notes. They should be brief and be

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the names(s), the number of the edition, the country, the printing house and the year.

evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of t he research article but without section titles.

e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to

summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

Key rules for references a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one.

III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article).

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as

XII


Organization as author

influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organization, as author VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

In press

XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000.

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Books and other monographs

Author(s)

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003.

Conference paper X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

13. Final version. This is the document in which the

Thesis

authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989. XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII


14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m Âľl Âľm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v. J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

vs

versus

xg

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIV


https://doi.org/10.22319/rmcp.v11i3.5797 Artículo

Pasta de higuerilla desintoxicada en dietas para pollos de engorda

Anabel Maldonado Fuentes a Juan Manuel Cuca García a Arturo Pro Martínez a* Fernando González Cerón b José Guadalupe Herrera Haro a Eliseo Sosa Montes b Pablo Alfredo Domínguez Martínez c

a

Colegio de Postgraduados, Campus Montecillo, PRGP- Ganadería, Estado de México, México. b

Universidad Autónoma Chapingo, Departamento de Zootecnia, Estado de México, México. c

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, Departamento de Producción Animal, Estado de Durango, México.

*Autor de correspondencia: aproma@colpos.mx

Resumen: La pasta de higuerilla (Ricinus communis L) contiene sustancias altamente tóxicas, por lo que se evaluó la efectividad de tres métodos de desintoxicación y su inclusión en dietas para pollos de engorda. Se evaluaron cinco tratamientos (dietas experimentales): dieta testigo a base de maíz y pasta de soya (PS), pasta de higuerilla sin desintoxicar (PH), pasta de higuerilla tratada con autoclave (PHA), pasta de higuerilla tratada con el método químico (PHQ) y pasta de higuerilla tratada con autoclave y método químico (PHAQ). Cada tratamiento se asignó al azar a siete unidades experimentales con 10 pollos cada una. Las variables evaluadas fueron: consumo de alimento (COA), conversión alimenticia (CA), ganancia de peso (GP) rendimiento en canal (RC), rendimiento de pechuga (RP), rendimiento de pierna con muslo (RPM), desarrollo del 605


Rev Mex Cienc Pecu 2020;11(3):605-619

sistema digestivo, habilidad para caminar (HC), angulación valgus /varus (AVV) y latencia a postrarse (LP). Los pollos alimentados con PH y PHMQ tuvieron menor COA y GP (P<0.05), sin embargo, no hubo diferencias entre tratamientos para CA. Se encontraron diferencias entre tratamiento (P<0.05) para HC y AVV, mientras que en LP no hubo diferencias (P>0.05). Los resultados evidencian que el tratamiento con autoclave (1 atmosfera de presión durante 60 min a 121 °C) disminuyó la toxicidad en la pasta de higuerilla, ya que las aves del tratamiento PHMA tuvieron un comportamiento productivo similar (P>0.05) a las de la dieta testigo. Palabras clave: Ricinus communis L., Métodos de desintoxicación, Autoclave, Hidróxido de calcio, Pollos de engorda.

Recibido: 29/08/2018 Aceptado: 28/08/2019

Introducción La higuerilla o ricino (Ricinus communis L) es una planta originaria de África perteneciente a la familia Euphorbiaceae, se encuentra distribuida por todo el mundo, principalmente en India, China y Brasil; se destaca por su rusticidad, la tolerancia a la sequía y al alto contenido de aceite en sus semillas(1), en México hay condiciones agroecológicas propicias para el cultivo de higuerilla en el sur y sureste principalmente(2). El aceite de ricino se ha utilizado para la producción de biodiesel y como subproducto de su extracción se obtiene la pasta de higuerilla que corresponde aproximadamente al 55 % del peso de la semilla(3). La composición nutricional de la pasta de higuerilla(4,5), indica que es posible la inclusión en la alimentación animal, ya que puede ser una alternativa en la sustitución de ingredientes proteínicos y disminuir los costos de producción. Pero su utilización está limitada debido a la presencia de productos tóxicos y alérgenos, principalmente, ricina, ricinina, y el alérgeno CB-1A, siendo la ricina la más tóxica(6). Sin embargo, actualmente hay métodos eficientes para desintoxicar los subproductos de semillas de ricino y están enfocados en la disminución o eliminación de la ricina, el calor con presión en autoclave y los tratamientos con hidróxido de calcio son eficientes en la eliminación de los compuestos tóxicos(7,8); la cocción de la semilla, además de la fermentación en agua, disminuyen la toxicidad de la pasta de higuerilla y permiten su inclusión en las dietas para aves sin afectar el comportamiento productivo(9,10).

606


Rev Mex Cienc Pecu 2020;11(3):605-619

La ricina se inactiva a altas temperaturas y en álcalis fuertes; al respecto Anandan et al(7) no encontraron residuos de ricina en muestras de pasta de higuerilla tratada con autoclave (1 atm de presión y 121 °C por 60 min) o con hidróxido de calcio (40 g/kg) analizadas mediante electroforesis en gel de poliacrilamida. De esta forma la combinación de estos métodos podría potencializar su efecto en la inactivación de los compuestos tóxicos de la higuerilla; además, no se han realizado estudios donde se incluya pasta de higuerilla tratada por estos métodos en la alimentación de pollos de engorda. Por lo tanto, la hipótesis de este trabajo fue que el uso de los métodos de autoclave (una atmósfera de presión a 121 °C por 60 min), tratamiento químico (40 g de Ca(OH)2 /kg) de pasta de higuerilla o la combinación de éstos en la pasta de higuerilla, permitirán su inclusión en dietas para pollos de engorda, sin afectar las variables productivas y de bienestar animal. De esta forma, el objetivo del presente estudio fue evaluar el efecto de los métodos de autoclave, tratamiento químico o combinación de éstos en el comportamiento productivo y variables de bienestar en pollos de engorda.

Material y métodos Desintoxicación de la pasta de higuerilla

Para la desintoxicación de la pasta de higuerilla se emplearon tres métodos descritos por Anandan et al (7): método de autoclave (A), método químico con Ca(OH)2 (Q) y combinación de métodos de autoclave con químico (AQ).

Método de autoclave

Se utilizaron 40 muestras de pasta de higuerilla de 1,000 g cada una, las cuales se introdujeron en una autoclave Felisa, aplicando una atmósfera de presión, durante 60 min a 121 ºC. Posteriormente, se secaron al sol por 48 h y se almacenaron a temperatura ambiente(7).

Método químico con hidróxido de calcio Ca(OH)2

Veinte (20) muestras de pasta de higuerilla de 1,000 g cada una se mezclaron con hidróxido de calcio a una concentración de 40 g/kg, se dejaron durante 8 h por la noche y posteriormente se secaron al sol durante 48 h, se molieron con un molino manual

607


Rev Mex Cienc Pecu 2020;11(3):605-619

(Estrella, México) y se almacenaron a temperatura ambiente. El hidróxido de calcio fue diluido en agua, antes de ser mezclado con la pasta de higuerilla(7).

Combinación de métodos de autoclave con químico

Se emplearon los métodos de autoclave e hidróxido de calcio descritos por Anandan et al(7). Brevemente, después de haber tratado la pasta de higuerilla por el método de autoclave, se aplicó el método de hidróxido de calcio.

Aves y tratamientos

El experimento se realizó en las instalaciones avícolas del Colegio de Postgraduados, Campus Montecillo, Texcoco, Estado de México. Ubicado a una altitud de 2,247 msnm(11). Se evaluaron cinco tratamientos (dietas experimentales): dieta testigo maíz y pasta de soya (PS), pasta de higuerilla sin desintoxicar (PH), pasta de higuerilla tratada con autoclave (PHMA), pasta de higuerilla tratada con el método químico (PHMQ) y pasta de higuerilla tratada con autoclave y método químico (PHMAQ). Cada tratamiento se asignó al azar a 7 unidades experimentales con 10 pollos cada una. Las aves se alojaron en corrales de 1.5 m2 con cama de viruta de madera. Se proporcionó un régimen de iluminación 23 h luz durante las primeras dos semanas y posteriormente se disminuyó a 12 h. La temperatura ambiental fue de 33 °C al inicio del experimento, la cual se redujo 2 °C por semana hasta llegar a una temperatura de 21 °C. Este estudio se realizó de acuerdo con la Guía de Cuidado y Uso de Animales Experimentales aprobada por el Consejo Académico General del Colegio de Postgraduados. El programa de alimentación se dividió en dos fases: dieta de iniciación (1-21 días) que contenía: 3,025 kcal de energía metabolizable (EM) kg-1, 22 % de proteína cruda (PC), 0.96 % de Ca y 0.48 % de P disponible y dieta de finalización (22-42 días) que contenía: 3,100 kcal de EM kg-1, 19 de PC, 0.80 % de Ca y 0.40 % de P disponible (Cuadro 1). Las dietas se formularon para cubrir o exceder las recomendaciones nutricionales de la línea Ross 308(12).

608


Rev Mex Cienc Pecu 2020;11(3):605-619

Cuadro 1: Composición de las dietas experimentales para pollos de engorda Iniciación (1-21 días) Ingredientes (%) Pasta de soya Maíz Pasta de higuerilla Carbonato de calcio Fosfato dicálcico L-lisina DL-metionina L-treonina L-triptófano Aceite Coccidiostato Pigmento Sal Vitaminas y minerales* Total Análisis calculado (%) Proteína cruda EM, kcal Calcio Fósforo disponible Lisina Metionina Metionina+cistina Treonina Triptófano

PS

PH

PHA PHQ

35.4 1 56.2 9 0.00 1.25 2.03 0.32 0.49 0.13 0.00 3.43 0.05 0.00 0.30

33.3 4 53.9 4 4.16 1.22 2.06 0.36 0.49 0.14 0.00 3.64 0.05 0.00 0.30

33.3 4 53.9 4 4.16 1.22 2.06 0.36 0.49 0.14 0.00 3.64 0.05 0.00 0.30

33.3 4 54.0 8 4.13 1.16 2.06 0.36 0.49 0.14 0.00 3.60 0.05 0.00 0.30

0.30

0.30

0.30

100

100

21.0 3025 0.96 0.48 1.44 0.83 1.08 0.97 0.30

21.0 3025 0.96 0.48 1.44 0.83 1.08 0.97 0.30

Finalización (22-42 días) PHA Q

PHA Q

PS

PH

PHA PHQ

4.13 1.16 2.06 0.36 0.49 0.14 0.00 3.60 0.05 0.00 0.30

30.4 4 61.9 1 0.00 1.07 1.61 0.12 0.34 0.02 0.00 3.49 0.05 0.35 0.30

28.3 6 59.5 6 4.16 1.04 1.64 0.17 0.34 0.03 0.00 3.70 0.05 0.35 0.30

28.3 6 59.5 6 4.16 1.04 1.64 0.17 0.34 0.03 0.00 3.70 0.05 0.35 0.30

28.3 6 59.7 0 4.13 0.98 1.64 0.17 0.34 0.03 0.00 3.66 0.05 0.35 0.30

0.30

0.30

0.30

0.30

0.30

0.30

0.30

100

100

100

100

100

100

100

100

21.0 3025 0.96 0.48 1.44 0.83 1.08 0.97 0.30

21.0 3025 0.96 0.48 1.44 0.83 1.08 0.97 0.30

21.0 3025 0.96 0.48 1.44 0.83 1.08 0.97 0.30

19.0 3100 0.80 0.40 1.15 0.47 0.90 0.78 0.18

19.0 3100 0.80 0.40 1.15 0.66 0.90 0.78 0.27

19.0 3100 0.80 0.40 1.15 0.66 0.90 0.78 0.27

19.0 3100 0.80 0.40 1.15 0.66 0.90 0.78 0.27

19.0 3100 0.40 0.40 1.15 0.66 0.90 0.78 0.27

33.34 54.08

28.36 59.70 4.13 0.98 1.64 0.17 0.34 0.03 0.00 3.66 0.05 0.35 0.30

PS= testigo, dieta base soya-maíz; PH= dieta con higuerilla sin desintoxicar; PHA= dieta con higuerilla tratada con método de autoclave; PHQ= dieta con higuerilla tratada con método químico; PHAQ= dieta con higuerilla tratada con autoclave y con químico. *Premezcla de vitaminas por kilogramo de alimento: A, 12,000 UI; D3, 1,000 UI; E, 60 UI;K, 5.0 mg; B 2, 8.0 mg; B12, 0.030 mg; ácido pantoténico, 15 mg; niacina, 50 mg; ácido fólico, 1.5 mg; colina, 300 mg; biotina, 0.150 mg; tiamina, 3.0 mg. Premezcla de minerales por kilogramo de alimento: Fe, 50.0 mg; Zn, 110 mg; Mn, 100 mg; Cu, 12.0 mg; Se, 0.3 mg; I, 1.0 mg.

609


Rev Mex Cienc Pecu 2020;11(3):605-619

Comportamiento productivo, características de bienestar animal y rendimiento de canal

El consumo de alimento, ganancia de peso, y conversión alimenticia se registraron desde el día uno hasta el día 42. Al día 43 de edad se seleccionaron al azar 35 aves por tratamiento para evaluar habilidad para caminar, angulación valgus/varus y latencia a postrarse. La habilidad para caminar se evaluó de acuerdo con la metodología descrita por Kestin et al(13) modificada por Garner et al(14). La medición se realizó simultáneamente por dos evaluadores que calificaron a cada ave en una escala de 0 a 5 donde: 0. Aves que caminan normalmente; 1. Aves con una ligera dificultad para caminar; 2. Aves con un defecto definido e identificable en su forma de caminar, pero la lesión o daño no obstaculiza el movimiento o el consumo agua y alimento; 3. Aves con un defecto evidente, el cual afecta la habilidad para moverse; 4. Aves con un severo defecto y 5. Aves incapaces de caminar. La angulación valgus/varus se evaluó de acuerdo con la metodología descrita por Leterrier y Nys(15). Dependiendo del ángulo de tibia-metatarso, se definieron 4 puntuaciones: 0, pollo normal; 1, pollo con poca angulación (ángulo tibia-metatarso entre 10 y 25 °); 2, ave con angulación evidente (ángulo entre 25 y 45 °) y 3, angulación severa (ángulo mayor a 45 °). Las aves se sometieron a la prueba de latencia a postrarse, según lo descrito por Berg y Sanotra(16). Esta prueba se basa en el contacto corporal del pollo con el agua, que es una experiencia novedosa y adversa para los pollos de engorda. Las aves se colocaron en un recipiente de plástico con agua a 32 °C a una altura de 3 cm. Se registró el tiempo transcurrido en segundos hasta que cada ave se postró. Si el ave permaneció de pie después de 600 seg, la prueba se suspendió. Las aves se evaluaron individualmente sin contacto visual entre ellas. A los 42 días de edad se seleccionaron al azar siete aves por tratamiento para evaluar el rendimiento de la canal, peso de la pechuga y peso de piernas con muslos. El alimento se retiró 8 h antes del sacrificio, los pollos se sacrificaron usando un cuchillo aturdidor (modelo VS-200, potencia de entrada 120 V-1 A, potencia de salida 50 V-0,1 A, Midwest Processing Systems, Minneapolis, MN, EE. UU.), de acuerdo a la Norma Oficial Mexicana NOM-033-SAG/ZOO-2014(17).

Desarrollo del sistema digestivo y órganos accesorios

Para evaluar el desarrollo del sistema digestivo se utilizaron los pollos seleccionados para la evaluación del rendimiento en canal. Se midió la longitud del intestino delgado y 610


Rev Mex Cienc Pecu 2020;11(3):605-619

de los ciegos con una cinta métrica y se determinó el peso vacío de proventrículo, molleja, intestino delgado y ciegos, también se obtuvo el peso de hígado, bazo, bolsa de Fabricio, páncreas y corazón. La medición del intestino delgado y de los ciegos se realizó sobre una tela húmeda para evitar se contrajeran.

Análisis estadístico

Las variables, consumo de alimento, ganancia de peso, y conversión alimenticia se analizaron con un diseño completamente al azar, con un nivel de significancia de 0.05 usando el procedimiento GLM del SAS(18). Las medias de tratamientos se compararon usando la prueba de Tukey ajustada (P<0.05). Las variables, habilidad para caminar y angulación se analizaron con un diseño completamente al azar utilizando los procedimientos GLIMMIX (para datos no paramétricos) y FREC del SAS(18). Los pesos relativos del sistema digestivo, órganos accesorios y latencia a postrarse se analizaron con un diseño experimental completamente al azar con cinco tratamientos y siete repeticiones por tratamiento usando el procedimiento GLM del SAS(18). Las medias de tratamiento se compararon usando la prueba de Tukey y se presentaron como media ± error estándar.

Resultados Comportamiento productivo y rendimiento de canal

Los pollos de los tratamientos PH y PHMQ tuvieron menor (P<0.05) consumo de alimento y ganancia de peso, respecto a las aves del resto de tratamientos. No se observaron diferencias (P>0.05) entre tratamientos en conversión alimenticia (Cuadro 2). En cuanto a las variables de rendimiento de la canal, pechuga y pierna con muslo no hubo diferencias entre tratamientos.

611


Rev Mex Cienc Pecu 2020;11(3):605-619

Cuadro 2: Desempeño productivo de pollos de engorda de 1 a 42 días alimentados con pasta de higuerilla tratada con diferentes métodos de desintoxicación de 1 a 42 días de edad Tratamiento Variable PS PH PHA PHQ PHAQ EE P-valor COA, g 4499 a 3272 b 4492 a 3181 b 4575 a 66.41 0.0001 GP, g 2811 a 1980 b 2835 a 1923 b 2835 a 44.69 0.0001 CA, g/g 1.60 1.65 1.58 1.65 1.61 0.03 0.2322 RC, % 79.96 78.31 78.91 78.03 79.91 0.66 0.1467 RP, % 28.31 25.28 25.86 25.01 26.85 0.81 0.0510 RPM, % 20.16 21.02 21.18 20.11 20.11 0.74 0.7002 PS= testigo, dieta base soya-maíz; PH= dieta con higuerilla sin desintoxicar; PHA= dieta con higuerilla tratada con autoclave; PHQ= dieta con higuerilla tratada con químico; PHAQ= dieta con higuerilla tratada con autoclave y químico. COA= consumo de alimento; GP= ganancia de peso; CA= conversión alimenticia; RC= rendimiento en canal; RP= rendimiento de pechuga; RPM= rendimiento de pierna con muslo. ab Medias de tratamientos con diferentes letras son diferentes (P<0.05). EE=Error estándar.

Habilidad para caminar

Se encontraron diferencias (P<0.05) por efecto de tratamientos en la habilidad para caminar; los pollos alimentados con las dietas PH y PHMQ mostraron mayor proporción de aves sanas (calificación 0) en comparación con las aves de los otros tratamientos. Aves con calificación 4 y 5 no se observaron en este experimento (Cuadro 3).

612


Rev Mex Cienc Pecu 2020;11(3):605-619

Cuadro 3: Habilidad para caminar, grado de angulación valgus/varus (%) y latencia a postrarse(s) de pollos de engorda alimentados con higuerilla tratada, de 1 a 42 días de edad Tratamiento PS PH PHA PHQ PHAQ Puntuación Habilidad para caminar 0 0.00 25.71 5.71 28.57 14.29 1 42.86 51.43 51.43 48.57 31.43 2 37.14 22.86 34.29 22.86 40.00 3 20.00 0.00 8.57 0.00 14.29 4 0.00 0.00 0.00 0.00 0.00 5 0.00 0.00 0.00 0.00 0.00 P-valor 0.0009 Puntuación Angulación valgus/varus 0 14.29 48.57 34.29 60.00 34.29 1 65.71 42.86 60.00 40.00 60.00 2 20.00 8.57 5.71 0.00 5.71 3 0.00 0.00 0.00 0.00 0.00 P-valor 0.0024 Latencia a postrarse Segundos (s) 84 118 103 103 114 P-valor 0.6681 PS= testigo, dieta base soya-maíz; PH= dieta con higuerilla sin desintoxicar; PHA= dieta con higuerilla tratada con autoclave; PHQ= dieta con higuerilla tratada con químico; HAQ= dieta con higuerilla tratada con autoclave y químico.

Angulación valgus/varus

Se encontró efecto de tratamientos (P<0.05) en el grado de angulación valgus/varus. La mayor proporción de aves con calificación 0 se encontró en los tratamientos PH y PHMQ y menor proporción de aves con calificación 1. No se observaron pollos con grado de angulación 3 (Cuadro 3).

Latencia a postrarse

No hubo diferencias (P>0.05) entre tratamientos para latencia a postrarse (Cuadro 3).

613


Rev Mex Cienc Pecu 2020;11(3):605-619

Desarrollo del sistema digestivo y órganos accesorios

No hubo diferencias (P>0.05) por efecto de tratamientos en el peso relativo del bazo y corazón; sin embargo, el peso relativo del hígado fue menor (P<0.05) en los pollos alimentados con la dieta PS comparados con las aves alimentadas con los tratamientos que incluían pasta de higuerilla. El peso relativo de la bolsa de Fabricio fue menor (P<0.05) en los pollos alimentados con PH y PHMQ, respecto a los pollos con las dietas PS, PHMA y PHMAQ (Cuadro 4). El peso relativo del páncreas, molleja, intestino delgado, y longitud del intestino delgado fueron mayores (P<0.05) en los pollos alimentados con las dietas PH y PHMQ, respecto a PS, PHMA y PHMAQ. El peso relativo de los ciegos de los pollos alimentados con dietas PS, PHA y PHAQ fue menor (P<0.05) con respecto a los pollos del tratamiento PHQ y la longitud del ciego fue mayor (P<0.05) en los pollos alimentados con PH comparado con PHAQ. Cuadro 4: Peso relativo (g/kg) y longitud (cm/kg) de las diferentes secciones del sistema digestivo y órganos accesorios de pollos de engorda alimentados con higuerilla tratada, de1 a 42 días de edad Tratamientos PS

PH

PHA

PHQ

PHAQ

EE

Bazo Corazón Hígado Bolsa de Fabricio Páncreas Proventrículo Molleja Intestino delgado Ciegos Longitud de ciego

1.65 4.08 18.27b 1.62 a 1.63 b 2.94c 10.50b 19.46b 4.91b 6.36bc

1.79 4.38 24.16a 0.70 b 2.19 a 3.84ab 14.24a 25.17a 5.78ab 7.93a

2.00 4.15 21.78a 1.49 a 1.82 b 3.35bc 10.50b 21.12b 5.43b 6.65bc

1.77 4.35 24.34a 0.81 b 2.19 a 4.22a 14.24a 23.60a 7.13a 7.57ab

1.99 4.26 21.78a 1.32 a 1.50 b 2.94c 8.61b 20.49b 5.21b 6.10c

0.17 0.12 0.72 0.08 0.08 0.14 0.65 0.56 0.39 0.30

Pvalor 0.5189 0.3394 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0047 0.0007

Longitud intestino

62.22b

84.19a

69.88b

86.50a

63.81b

1.95

0.0001

PS= testigo, dieta base soya-maíz; PH= dieta con higuerilla sin desintoxicar; PHA= dieta con higuerilla tratada con autoclave; PHQ= dieta con higuerilla tratada con químico; PHAQ= dieta con higuerilla tratada con autoclave y químico. ab Medias de tratamientos con diferentes letras son diferentes (P<0.05). EE=Error estándar.

614


Rev Mex Cienc Pecu 2020;11(3):605-619

Discusión La respuesta de los animales alimentados con pasta de higuerilla desintoxicada está determinada por la efectividad del proceso de desintoxicación; de la concentración de la pasta de higuerilla en la dieta; el tiempo de alimentación y la especie animal(19). Se ha registrado en la literatura que los tratamientos con calor aplicados a la pasta de higuerilla disminuyen los compuestos tóxicos, principalmente de la ricina que es la más tóxica, aparentemente altas temperaturas la inactivan(20), estos tratamientos han permitido la inclusión en dietas para pollos de engorda de hasta 10 % sin afectar el comportamiento productivo y el rendimiento de la canal(21,22). En este estudio las aves alimentadas con PHMA y PHMAQ tuvieron un comportamiento productivo similar a las aves alimentadas con PS, esto indica que el calor y la presión en autoclave utilizados en la pasta de higuerilla disminuyeron su toxicidad. Por lo contrario, los pollos alimentados con PH y PHMQ tuvieron un menor consumo y menor ganancia de peso, esto podría atribuirse al contenido de sustancias tóxicas(23). El tratamiento con Ca(OH)2 no disminuyó aparentemente los compuestos tóxicos; los cuales inhiben la síntesis de proteína y afectan principalmente el sistema digestivo, causando descamación y disminución de la longitud de las vellosidades intestinales impidiendo la absorción de los nutrientes y por lo tanto el desarrollo normal de las aves(10,24). El uso de pasta sin desintoxicar en 5 % disminuye el consumo de alimento y la ganancia de peso en pollos de engorda(9,22,25). No se encontró en la literatura revisada estudios acerca del empleo de la pasta de higuerilla en dietas para pollos de engorda en variables de bienestar animal; sin embargo, en este estudio se encontró que el grado de habilidad para caminar disminuyó en las aves de los tratamientos PS, PHA y PHAQ y la angulación valgus/varus fue mayor en estas aves, esto puede explicarse porque las aves con mayor peso tienen menor habilidad para caminar en comparación con las aves más ligeras(26), pues el peso influye en estas características(27). Los pollos de engorda con mayor peso permanecen postrados más tiempo. En consecuencia, la condición de equilibrio y la angulación de estas aves se ven afectadas, lo que provoca incomodidad al caminar y deterioro en su bienestar(28). La inclusión de pasta de higuerilla en la dieta produce daños en riñones (inflamación y congestión), agrandamiento del hígado, pulmones inflamados, atrofia de la bolsa de Fabricio y necrosis el bazo(21,29). En el presente estudio, el tamaño del hígado fue mayor en los pollos alimentados con pasta de higuerilla, esto probablemente puede deberse a una mayor actividad metabólica por la presencia de residuos de los compuestos tóxicos(29). Además, se observó un incremento en el tamaño de páncreas, molleja, proventrículo, e intestino en pollos alimentados con PH y PHMQ con respecto al testigo (maíz-pasta de soya). Se han estudiado los pesos de los órganos en otras especies que fueron alimentadas con pasta de higuerilla sin tratar y tratada con hidróxido de calcio en 615


Rev Mex Cienc Pecu 2020;11(3):605-619

la dieta y no se encontraron diferencias en el peso de hígado, corazón riñón y bazo con respecto a la dieta testigo (pasta de soya)(30). El peso o tamaño de la bolsa de Fabricio es un indicador del estado de inmunocompetencia o inmunosupresión en el ave a nivel de los órganos linfoides(31). La relación del peso de la bolsa de Fabricio con el peso corporal (PBF/PC) puede estar correlacionada con inmunosupresión. Las aves de tres a seis semanas de edad tienen normalmente una relación PBF/PC de 2 a 4, valores de 1 o menor a 1 es indicativo de inmunosupresión y se observa en aves clínicamente enfermas(32). En este estudio la relación PBF/PC de los pollos que fueron alimentados con PH y PHMQ fue menor a 1, lo que indica que probablemente la pasta de higuerilla provocó inmunosupresión en los pollos por la presencia de compuestos tóxicos. Okoye et al(21) observaron una disminución de tamaño en órganos linfoides y necrosis en bolsa de Fabricio en pollos que consumieron una dieta con 10 y 15 % de inclusión de pasta de higuerilla tratada con calor en la dieta.

Conclusiones e implicaciones Es posible incluir la pasta de higuerilla desintoxicada con el método de autoclave en dietas de pollos de engorda sin afectar el comportamiento productivo y variables de bienestar. Sin embargo, se desconoce si la carne de estos pollos es apta para el consumo humano, ya que en este estudio no se cuantificaron los residuos de ricina en la carne, por lo que se sugiere realizar estudios para la cuantificación de residuos de ricina en la carne.

Agradecimientos La primera autora agradece al Consejo Nacional de Ciencia y Tecnologia (CONACyT) el apoyo financiero para realizar estudios de postgrado, asimismo, al Colegio de Postgraduados Campus Montecillo por la oportunidad brindada.

Literatura citada: 1. Silva-Lima RL, Severino LS, Silva LMS, Ferreira JJ, Silva VL, Macedo BNE. Substratos para produção de mudas de mamoneira compostos por misturas de cinco fontes de matéria orgánica. Ciênc Agrotec 2006; 30(3):474-479.

616


Rev Mex Cienc Pecu 2020;11(3):605-619

2. Rodríguez RH, Zamarripa CA. Competitividad de la higuerilla (Ricinus communis) para biocombustible en relación a los cultivos actuales en el Edo. de Oaxaca, México. Rev Mex Agr 2013;32:306-318. 3. Azevedo DM, Lima EFO. Agronegócio da mamona no Brasil. Brasília: Embrapa Informação Tecnológica 2001;350. 4. Jiménez OR, Cervantes MR, Vallejo VJA, Rosales RS, Ríos SJC. Perfil de aminoácidos de pastas residuales de piñón tropical (Jatropha curcas) e higuerilla (Ricinus communis). Agrofaz 2011;12(3):173-176. 5. Rostagno HS, Albino LFT, Donzele JL, Gomes PC, Oliveira RF, Lopes DC, et al. Tabelas brasileiras para aves e suínos: composição de alimentos e exigências nutricionais. 2a ed. Viçosa, Brasil: Editora Universitária; 2011. 6. Matos JJB, Días AN, Bueno CFD, Rodríguez PA, Veloso ALC, Faria DE. Metabolizable energy and nutrient digestibility of detoxified castor meal and castor cake for poultry. R Bras Zootec 2011;40(11):2439-2442. 7. Anandan S, Anil KGK, Ghosh J, Ramachandra KS. Effect of different physical and chemical treatments on detoxification of ricin in castor cake. Anim Feed Sci Tech 2004;120:159-168. 8. Oliveira AS, Oliveira MRC, Campos JMS, Machado OLT, Valadares SC, Detmann E, et al. Eficácia de Diferentes Métodos de Destoxificação da Ricina no Farelo de Mamona Conferencia: En: II Congreso de la Red Brasileña de Tecnología y Producción de Biodiesel de 2007. Brasilia. 9. Oso AO, Olayemi WA, Bamgbose AM, Fowoyo OF. Utilization of fermented castor oil seed (Ricinus communis L) meal in diets for cockerel chicks. Arch Zootec 2011;60(229):75-82. 10. Ani AO, Okorie AU. Effects of processed castor oil bean (Ricinus communis L) meal and supplementary dl- methionine on nutrient utilization by broiler chicks. J Anim Plant Sci 2013;23(5):1228-1235. 11.Vázquez JC, Pérez PR. Valores gasométricos estimados para las principales poblaciones y sitios a mayor altitud en México. Rev Inst Nal Enf Resp Mex 2000;13(1):06-13. 12. Aviagen. Ross Broiler Management Manual. Aviagen Ltd., Midlothian, UK. 2017. 13. Kestin SC, Knowles TG, Tinch AE, Gregory NG. Prevalence of leg weakness in broiler chickens and its relationship with genotype. Vet Rec 1992;131:190-194. 14. Garner JP, Falcone C, Wakenel P, Martin M, Mench JA. Reliability and validity of a modified gait scoring system and its use assessing tibial dyschondroplasia in broilers. Br Poultry Sci 2002;43(3):355-363. 617


Rev Mex Cienc Pecu 2020;11(3):605-619

15. Leterrier C, Nys Y. Clinical and anatomical differences in varus and valgus deformities of chick limbs suggest different aetio‐pathogenesis. Avian Pathol 1992; 21(3):429-442. 16. Berg C, Sanotra GS. Can a modified latency-to-lie test be used to validate gaitscoring results in commercial broiler flocks. Anim Welf 2003;12(4):655-659. 17. Norma Oficial Mexicana. NOM-033-SAG/ZOO-2014. Métodos para dar muerte a los animales domésticos y silvestres. Diario Oficial de la Federación. México. 26 de agosto de 2015. 18. SAS Institute, Inc. SAS User’s Guide: Statistics version. SAS Institute, Inc. Cary, NC. 2011. 19. Souheila A, Harinder PSM. Potential and constraints in utilizing coproducts of the non-edible oils-based biodiesel industry -an overview. Biofuel co-products as livestock feed Opportunities and challenges. FAO. Rome. 2012. 20. Gardner H, D'Aquin EL, Koltun SP, McCourtney EJ, Vix HLE, Gastrock EA. Detoxification and deallergenization of castor beans. J Amer Oil Chem Soc 1960;37(3):142-148. 21. Okoye JOA, Enunwaonye CA, Okorie AU, Anugwa FOI. Pathological effects of feeding roasted castor vean meal (Ricinus communis) to chicks. Avian Pathol 1987;16(2):283-290. 22. Nsa EE, Ukachukwu SN, Akpan IA, Okon B, Effiong OO, Oko OOK. Growth performance, internal organ development and hematological responses of broiler birds fed diets containing different thermal treated castor oil seed meal (Ricinus communis). Glob J Agr Sci 2010;9(2):27-34. 23. Ani AO, Okorie AU. Effects of graded levels of dehulled and cooked castor oil bean (Ricinus communis) meal and supplementary l-lysine on performance of broiler finishers. J Trop Agr Food 2007;6(1):89-97. 24. Audi JMD, Belson MMD, Patel MMD, Schier JMD, Osterloh JMD. Ricin Poisoning. A Comprehensive Review. J Amer Med Assoc 2005;294(18):23422351. 25. Agbabiaka LA, Esonu BO, Madubuike FN. Effect of processing on nutrients and anti-nutrients of castor oil bean (Ricinus communis) seeds and by-products. Pak J Nutr 2011;10(6):561-563. 26. Toscano MJ, Nasr MAF, Hothersall B. Correlation between broiler lameness and anatomical measurements of bone using radiographical projections with assessments of consistency across and within radiographs. Poul Sci 2013;92(9):2251-2258.

618


Rev Mex Cienc Pecu 2020;11(3):605-619

27. Alves MCF, Almeida PICL, Nääs IA, García RG, Caldara FR, Baldo GAA, et al. Equilibrium condition during locomotion and gait in broiler chickens. Rev Bras Cienc Avic 2016;18(3):419-426. 28. Almeida ICL, Garcia RG, Bernardi RIA, Caldara FR, Freitas LW, Seno LO, et al. Selecting appropriate bedding to reduce locomotion problems in broilers. Rev Bras Cienc Avic 2010;12(3):189-195. 29. Mustapha GG, Igwebuike JU, Kwari ID, Adamu SB, Abba Y. The Effect of replacement levels of boiled and fermented castor seed (Ricinus cummunis) meal on the productive performance, nutrient digestibility, carcass characteristics and cost effectiveness in broilers. Int J Sci Nat 2015;6(4):675-682. 30. Gowda NkS, Pal DT, Bellur SR, Bharadwaj U, Sridhar M, Satyanarayana ML, et al. Evaluation of castor (Ricinus communis) seed cake in the total. J Sci Food Agric 2008;89(2):216–220. 31. Cheema MA, Qureshi MA, Havenstein GB. A Comparison of the immune response of a 2001 commercial broiler with a 1957 randombred broiler strain when fed representative 1957 and 2001 broiler diets. Poul Sci 2003;82(10):1519-1529. 32. Giambrone JJ, Clay R. Evaluation of the immunogenicity, stability, pathogenicity, and immunodepressive potential of four commercial live infectious bursal disease vaccines. Poul Sci 1986;65(7):1287-1290.

619


https://doi.org/10.22319/rmcp.v11i3.5092 Artículo

Efecto de la fecha de corte y del uso de aditivos en la composición química y calidad fermentativa de ensilado de girasol

Aurora Sainz-Ramírez a Adrián Botana b Sonia Pereira-Crespo c Laura González-González b Marcos Veiga b César Resch b Juan Valladares b Carlos Manuel Arriaga-Jordán a* Gonzalo Flores-Calvete b

a

Universidad Autónoma del Estado de México. Instituto de Ciencias Agropecuarias y Rurales (ICAR). Toluca, México. b

Instituto Galego de Calidade Alimentaria, Centro de Investigacións Agrarias de Mabegondo (INGACAL-CIAM) Apartado 10, 15080 A Coruña, España. c

Laboratorio Interprofesional Galego de Análise do Leite (LIGAL) A Coruña, España.

* Autor de correspondencia: cmarriagaj@uaemex.mx

Resumen: El objetivo fue evaluar fechas de corte y del uso de aditivos sobre la calidad del ensilado de la planta entera de girasol. La variedad forrajera (Rumbosol-91) se cosechó en las semanas 1, 3 y 5 post-floración (F1, F2 y F3, respectivamente) y tratada con los siguientes aditivos:

620


Rev Mex Cienc Pecu 2020;11(3):620-637

1) 1.5 × 105 ufc de inoculante g-1 de forraje, a base de bacterias lácticas homofermentativas Enterococcus faecium, Pediococcus pentosaceus y Lactobacillus plantarum (INOC), 2) 3 ml kg-1 de forraje de una solución al 85% de ácido fórmico (FORM) y 3) sin aditivo (Testigo); siguiendo un diseño factorial 3x3 con cinco repeticiones. La producción de efluente y las pérdidas totales de materia seca (MS) se redujeron, desde 282 y 134 g kg-1 en F+1 hasta 96 y 87 g kg-1 en F+5 como resultado del alto contenido de humedad del forraje próxima a la floración. El análisis NIRS de las muestras de ensilaje mostró que los contenidos de proteína, fibra y digestibilidad descendían significativamente con la madurez de la planta; la rápida acumulación de aceite en la MS hizo que la concentración energética fuese superior en el estado fenológico más avanzado. La calidad fermentativa de los ensilajes fue satisfactoria, independientemente del momento de corte y del uso de aditivo. Se concluye que es preferible el corte de la planta a las cinco semanas post-floración, donde se espera una fermentación aceptable sin necesidad de conservantes. Palabras clave: Girasol, Madurez, Digestibilidad in vitro, Conservantes.

Recibido: 02/10/2018 Aceptado: 19/07/2019

Introducción El girasol (Helianthus annuus L.) es una planta anual, con numerosos genotipos o subespecies cultivadas como plantas ornamentales, oleaginosas y forrajeras. Los datos oficiales acerca de la superficie de girasol cultivado en México(1) indican que ascendió a aproximadamente 2,000 ha en 2016, muy por debajo de su potencial, estando orientadas a la producción de aceite, principalmente en zonas irrigadas(2). Por otra parte, se ha demostrado que el cultivo de girasol como forraje ensilado es una opción viable en la alimentación de rumiantes, dadas sus características de rápido desarrollo, tolerancia a bajas temperaturas y poca exigencia a humedad y fertilización, por lo que, se considera como una buena alternativa para las zonas de temporal, siendo una alternativa al cultivo del maíz en la alimentación animal(3). El uso del girasol como verde o de verano ensilado, fue popular en los Estados Unidos de América a comienzos del siglo XX, pero en la actualidad es menor en comparación con el maíz(4). Su establecimiento puede ser en monocultivo o combinado con el maíz(5) y es usado como ensilado en siembras cuando su establecimiento fue tardío o afectado por daños climáticos(6). 621


Rev Mex Cienc Pecu 2020;11(3):620-637

Su aprovechamiento como ensilado, es sujeto a controversia, dado que no se ha determinado el momento óptimo de aprovechamiento. Por una parte, algunos estudios, presentan como punto de cosecha alrededor de la floración, en función de valores máximos de digestibilidad y proteína(7), y por otra parte, otros autores recomiendan estados más avanzados, cuando las semillas estén bien formadas(8) o incluso cerca de la madurez fisiológica de la planta(9) para evitar una alta producción de efluente y reducción de pérdidas en el ensilaje El bajo contenido de materia seca del girasol, un moderado contenido en carbohidratos y una relativamente alta capacidad tampón, a lo largo de su ciclo; son factores que pueden comprometer la calidad de fermentación y su conservación en el silo(10,11), a pesar de esto, distintos autores han demostrado la posibilidad de obtener ensilados bien conservados(12). El desarrollo en el uso de aditivos para controlar la fermentación y reducción de pérdidas en el proceso de ensilaje fue uno de avances tecnológicos más relevantes del siglo pasado, y actualmente los inoculantes, a base de bacterias lácticas, son los aditivos más utilizados en Europa y América(13). Estos se añaden al forraje con el objetivo de controlar la población de bacterias que causan pérdidas del ensilado por una ineficiente fermentación de los azúcares(14). Además de lo anterior, también hay evidencias de la utilidad de los inoculantes en forrajes con alto contenido en humedad, no obstante, los resultados son inconsistentes(15). Ante esta situación, la acidificación directa del forraje con ácidos orgánicos, podría ser una alternativa. Existe numerosa bibliografía acerca de la efectividad del ácido fórmico sobre la mejora de la calidad de fermentación en la producción animal cuando se usa forraje con alta humedad(15-18). Aplicado en forma de solución comercial al 85 % y dosis entre 2 a 5 L t-1 de forraje fresco, reduce el pH de forma inmediata, favorece la acción de las bacterias lácticas frente a las enterobacterias y clostridios y restringe la intensidad de la fermentación, con lo cual, se minimiza el riesgo de la presencia de metabolitos indeseables en el ensilado que limitan su composición química(17). Frente a estas ventajas, la utilización de fórmico en forrajes con alta humedad puede, en ciertas ocasiones, incrementar la producción de efluente y el nivel de pérdidas totales respecto del control sin aditivo(15). Por lo tanto, el presente trabajo tuvo el objetivo de evaluar el efecto de la fecha de corte y del uso de aditivos sobre el nivel de pérdidas, producción de efluente, composición química y calidad fermentativa del ensilaje de girasol.

Material y métodos El estudio se realizó durante el periodo de verano-otoño de 2016, en el Centro de Investigaciones Agrarias de Mabegondo (CIAM), situada en la zona costera atlántica noroccidental de Galicia (España), 43º 14’ 18.45’’ N y 8º 15’ 59.60’’ O, a 100 msnm, en 622


Rev Mex Cienc Pecu 2020;11(3):620-637

condiciones de secanos húmedos. Se evaluaron tres fechas de corte y tres aditivos siguiendo un diseño factorial con cinco repeticiones. La duración total del ensayo entre la siembra y la última fecha de cosecha fue de 108 días. Durante el cultivo la temperatura media fue de 18.2 ºC y la precipitación acumulada 137 mm, algo inferior a lo habitual para el lugar. El inicio de la floración tuvo lugar a los 72 días tras la siembra, correspondiendo según la escala de Schneiter y Miller(18) al estado final de R4 (apertura de los botones florales comenzando a ser visibles las flores liguladas amarillas). Se utilizó la variedad forrajera Rumbosol-91, sembrada a finales de junio de 2016, que se cosechó en las semanas 1, 3 y 5 después de la floración (tratamientos F+1, F+3 y F+5, respectivamente). En cada fecha de corte se recolectaron aproximadamente 50 kg de forraje picado a 2-3 cm, homogeneizado y dividido en tres submuestras y se les asignó los aditivos: i) un inoculante (INOC) a base de bacterias lácticas homofermentativas Enterococcus faecium, Pediococcus pentosaceus y Lactobacillus plantarum (SILOSOLVE F100, 3F Technology) a dosis recomendada por el fabricante (1.5 x 105 ufc g-1 de forraje), ii) una solución de ácido fórmico al 85% (FORM) a dosis de 3 mL kg-1 de forraje y iii) un testigo sin aditivo (TESTIGO). Para cada combinación (fecha de corte y aditivo) se elaboraron cinco silos de laboratorio en bolsas de polietileno (40x10cm), dentro de un tubo de PVC de 2.2 L de capacidad útil dotado con un sistema de drenaje de efluente(19,20).

Análisis químico

Se determinó el peso neto del forraje de cada silo en el momento de su confección e inmediatamente antes de su apertura a los 60 días, así como el peso del efluente producido utilizando una balanza de precisión 0.1 g (AND, modelo HR-202). De cada muestra tomada al momento del llenado de cada silo, se determinó el contenido en materia seca (MS) secándolas en una estufa de aire forzado a 80 ºC durante 16 h. Utilizando un espectrofotómetro monocromador Foss NIRSystem 6500 (Foss NIRSystem Silver Spring, Washington, USA), se obtuvieron los espectros de las muestras secas y molidas a 1 mm y se estimó su composición en materia orgánica (MO), proteína bruta (PB), fibra ácido detergente (FAD), fibra neutro detergente (FND), carbohidratos solubles en agua (CSA), digestibilidad in vitro de la materia orgánica (DMOIV) y extracto etéreo (EE) utilizando para ello las calibraciones desarrolladas en el Centro de Investigaciones Agrarias de Mabegondo (CIAM)(19). La capacidad tampón (CTNaOH) se determinó por métodos de referencia(21), siendo expresada como meq de NaOH kg-1 MS. El coeficiente de fermentabilidad del forraje se estimó(22) según la ecuación CF= (MS + 80 x CSA) / (CTNaOH x 0.127 - 0.3), donde MS representa el % de contenido de MS, CSA representa la concentración de CHO solubles en agua expresados como % de la MS y CTNaOH es la capacidad tampón expresada en miliequivalentes de álcali por 100 g de MS. Valores de CF superiores a 45 indican facilidad 623


Rev Mex Cienc Pecu 2020;11(3):620-637

para ensilar, mientras que valores inferiores a 35 son indicativos de una alta probabilidad de mala fermentación.

Análisis fermentativo

Los silos se abrieron a los 60 días. En muestra fresca de ensilado se determinó el contenido en MS que fue posteriormente corregido por pérdida de volátiles para los productos de fermentación durante el secado(23). Utilizando calibraciones NIRS desarrolladas en el CIAM, se determinaron los valores de MO, PB, FAD, FND, DMOIV y EE de las muestras secas y molidas a 1 mm. La concentración en energía neta leche (ENL) del ensilado se calculó(24) según la expresión ENL (Mcal kg-1 MS) =(178 x DMOIV x MO + 0.008 x DMOIV2 x MO2) x 10-6, donde DMOIV se expresa en % y MO en %MS. A este valor se le adicionó la energía neta correspondiente al aceite de las muestras considerando un valor medio de 4.9 Mcal de ENL kg-1 de aceite(25) para los valores de EE en exceso de 4 %MS, ya que, la obtención de las calibraciones NIRS para estimación de la digestibilidad in vitro con líquido ruminal(20) se realizó con muestras desengrasadas cuando se superaba dicho valor de EE, a fin de evitar el efecto depresor del aceite de las muestras sobre la actividad de los microorganismos ruminales(26). Una segunda alícuota de ensilado se congeló a -18ºC hasta su análisis fermentativo, determinándose el pH mediante un pHmetro provisto de electrodo combinado, el nitrógeno amoniacal (N-NH3) con un electrodo selectivo (Orion) y el nitrógeno soluble (N-Soluble) mediante digestión macro Kjeldahl. Los ácidos de fermentación (láctico, acético, propiónico, butírico, valérico, caproico, isobutírico e isovalérico) y los alcoholes (etanol, butanol, propanol) se determinaron por cromatografía de gases(27). El valor de ácidos grasos volátiles totales (AGV) se calculó como la suma, expresada en mmoles kg-1 MS de las concentraciones de los ácidos de fermentación, con exclusión del láctico. Los valores de pérdidas totales, producción de efluente, parámetros de composición química y de calidad fermentativa se analizaron mediante análisis de varianza (ANOVA) utilizando el procedimiento GLM de SAS (SAS Institute 2009 v. 9.2) según el modelo: yijk=µ + αi F + βj A + (αβ)ij FxA + γk + εijk Donde la fecha de corte (F, i=3) y el aditivo (A, j=3) se consideraron factores fijos y la repetición (R, k=5) un factor aleatorio y FxA representan la interacción. La separación de medias de las variables cuando el test F en el ANOVA era significativo se realizó mediante el test HSD de Duncan (α=0.05).

624


Rev Mex Cienc Pecu 2020;11(3):620-637

Resultados y discusión Desarrollo del cultivo y producción de materia seca

En la primera fecha de corte (F+1) el estado era R5.5 (50% de las flores tubuladas en antesis o post-antesis), alcanzando en F+3 el estado R6 (floración completa, con las semillas formadas y las flores liguladas marchitas) y en F+5 el estado R7 (parte inferior del capítulo de color amarillo-pálido, con las semillas engrosadas, en estado lechoso-pastoso). El rendimiento en estas tres fechas fue estimado(28), en 9.1, 10.1 y 11.5 t MS ha-1 respectivamente. La mayor producción unitaria obtenida en la fecha de corte más tardía coincide con lo observado con otros trabajos realizados en el CIAM con la misma variedad forrajera(29), así como en informes previos con diversos genotipos(8,30), en los cuales señalan como estado más adecuado para ensilar el momento en que las plantas presenten capítulos con coloración verde-amarillenta en la base y las semillas estén bien formadas. La composición química, capacidad tampón, coeficiente de fermentabilidad y estimación de energía neta para lactación del girasol en estado fresco, se presentan en el Cuadro 1. El momento de corte afectó significativamente (P<0.001) al contenido en MS, composición química (a excepción del contenido en FAD), así como a los valores de digestibilidad in vitro y de energía neta leche del girasol al momento de ensilar. La MS del cultivo promedió 16 % en todos los cortes y aumentó con la edad de la planta desde un valor de 12.1 % en F+1 hasta el 18.6 % en F+5, a razón de 1.53 unidades porcentuales por semana. El contenido en MO mostró una tendencia cuadrática con un valor en F+3 (95.5 %MS) superior al de las otras dos fechas de corte (90.9 y 90.5 %MS). La madurez del girasol disminuyó los contenidos de proteína, pared celular, azúcares y digestibilidad, con valores de 9.4, 9.2 y 8.6 para PB, 41.8, 40.5 y 36.8 para FND, 16.9, 15.3 y 10.6 para CSA y 67.0, 65.7 y 58.4 para DMOIV en F+1, F+3 y F+5, respectivamente, contrastando con los valores de MS. Mientras que la concentración de EE aumentó de 2.7 a 17.6 % con el avance de la madurez como consecuencia de la conversión de carbohidratos no estructurales en aceite en las semillas, lo cual se hizo notar especialmente en la última fecha del ensilado. De la misma forma se comportó la concentración energética, la cual aumentó de ENL de 1.38, 1.57 y 1.83 Mcal kg-1 MS en las fechas F+1, F+3 y F+5 respectivamente. La capacidad tampón y el coeficiente de fermentabilidad no se vieron afectados (P≥0.05) por la fecha de corte, oscilando los valores de CTNaOH entre 320 y 346 meq NaOH kg-1 MS y de CF entre 45.7 y 38.6, aunque en este último cabe indicar una tendencia (P=0.10) que indica una mayor ensilabilidad de la planta en etapas más tempranas de desarrollo, debido al mayor contenido en azúcares, comparada con fechas más tardías.

625


Rev Mex Cienc Pecu 2020;11(3):620-637

Cuadro 1: Efecto de la fecha de corte sobre el contenido en MS, capacidad tampón, coeficiente de fermentabilidad y composición nutricional del girasol fresco Fecha de corte F+1 F+3 F+5 EEM P c b a Materia seca (MS), % 12.1 14.1 18.6 0. 098 *** -1 CT (meq NaOH kg MS) 320 346 335 6.94 NS Coeficiente de fermentabilidad 45.7 42.5 38.6 2.02 NS Composición química (%MS): MO 90.90 b 95.50 a 90.50 b 0.35 *** a a b PB 9.40 9.20 8.60 0.12 *** a b c FND 41.80 40.50 36.80 0.23 *** FAD 34.10 33.40 33.80 0.26 NS c b a EE 2.70 6.90 17.60 0.18 *** a b c CSA 16.90 15.30 10.60 0.31 *** a b c IVDMO, % 67.00 65.70 58.40 0.43 *** c b a ENL, Mcal/kg MS 1.38 1.57 1.83 0.018 *** EEM= error estándar de la media; CT= capacidad tampón; MO= materia orgánica; PB= proteína bruta; FDN= fibra detergente neutra; FDA= fibra detergente ácida; EE= extracto etéreo; CSA= carbohidratos solubles en agua; IVDMO= digestibilidad in vitro de la materia orgánica. (*** P<0.001; ** P<0.01; * P<0.05; NS= no significativo P>0.05).

Diversos estudios realizados en Brasil y Argentina con la variedad forrajera Rumbosol-91 muestran la variación de composición química con la madurez de la planta. En el primer país, en una cosecha realizada entre las 4 y las 7 semanas tras la floración, se obtuvieron valores de PB entre 9.9 y 7.0 base seca(31), mientras que, en otro trabajo con cortes entre los 97 y 112 días después de la siembra (Estados R7 a R9) se obtuvieron valores de PB entre 10.0 y 9.3 y de EE de 9.9 a 14.3 base seca, respectivamente(32). En otro estudio, con fecha de corte de 97 DDS, se obtuvo un amplio rango de variación en los contenidos en PB (de 9.4 a 14.5 %MS) y en FND (de 40.6 a 48.7 %MS)(33). Para la misma variedad Rumbosol-91, sembrada en primavera y cosechada en los estados R7 e R9 se obtuvieron valores de 9.6 y 8.3 %MS para PB, de 37.9 y 40.1 %MS para FND y de 15.1 y 13. 4 %MS para EE(34). Dos trabajos realizados en la finca experimental del CIAM, en variedad Rumbosol-91, en diferentes años y fechas de cortes(29,30), permitieron comparar los cortes de las semanas 2ª a la 6ª tras la floración siendo observado que en este intervalo se incrementaban los contenidos del forraje fresco en MS (de 15.6 a 22. 4 %), en MO (de 89.9 a 85.8 %MS), en EE (de 2.3 a 17.0 %MS) y en ENL (de 1.34 a 1.61 Mcal kg-1 MS), descendiendo los de carbohidratos solubles (de 22.4 a 8.4 %MS) y la digestibilidad (de 66.4 a 52.7 %MS). Estudios realizados en Francia a comienzos del último tercio del siglo pasado(32), indican valores de digestibilidad del 70 a 75 % al inicio de la floración y del 60 al 75 % para la planta en estado de grano 626


Rev Mex Cienc Pecu 2020;11(3):620-637

pastoso. Sin embargo, trabajos más recientes de autores italianos realizados en secanos del valle del Po(35), reportan valores de DMOIV cercanos al 60 % para la planta en plena floración, más acordes con los resultados obtenidos en este trabajo. De acuerdo con, los coeficientes estimados en F1, F2 y F3, la ensilabilidad de los tres estados de desarrollo del girasol puede calificarse de buena a media. A pesar de que trabajos realizados en Alemania(10) asignan bajos valores para esta especie, una amplia revisión efectuada por otros autores(36) señala que el girasol en estado fresco presenta habitualmente un contenido en azúcares y una capacidad tampón que pueden ser considerados como medios, en el entorno de 120 -200 g kg-1 MS y 350-550 meq NaOH kg-1 MS, al mismo nivel que el raigrás italiano o los guisantes forrajeros, lo cual coincide con los resultados obtenidos en el presente trabajo. Las pérdidas de materia seca, producción de efluente y composición nutricional de los ensilados, se presentan en el Cuadro 2. La fecha de corte ejerció un fuerte efecto significativo (P<0.001) sobre la producción de efluente, la cual fue muy elevada sobre todo en los dos primeros cortes (28.2 % del peso fresco inicialmente ensilado en F+1 y 17.4 % en F+3) como consecuencia del alto contenido en humedad del forraje, descendiendo posteriormente al 9.6 % en el último aprovechamiento. En consecuencia, las pérdidas totales de MS en los dos primeros cortes (13.4 % en el primero y 12.5 % en el segundo) fueron significativamente superiores (P<0.001) a las de la última fecha (8.7 %). Estudios que evaluaron el efecto del contenido en MS de la cosecha sobre las pérdidas del ensilado indican que con contenidos de MS del 30 % y superiores, las pérdidas por respiración y fermentación no deberían superar el 5 al 8 % de la MS ensilada, mientras que, en caso de cultivos cosechados con alta humedad (MS <25 %) las pérdidas suelen ser más elevadas debido a una mayor intensidad de la fermentación y, sobre todo, por las pérdidas causadas por el efluente(13,37).

627


Rev Mex Cienc Pecu 2020;11(3):620-637

Cuadro 2: Efecto de la fecha de corte y del uso de aditivo sobre la producción de efluente, nivel de pérdidas totales y composición nutricional del ensilaje de girasol Efectos principales

Interacción

Corte n

Aditivo

F+1

F+3

F+5

15

15

15

P

TES INOC FORM P

EEM

P

**

1.14

NS

15

15

15

*

8.8 b

10.9 b

14.8 a

***

16.8 b 17.50 b 20.9 a

***

0.666

**

16.3

16.5

NS

0.227

NS

Pérdidas de materia seca (%MS) PMS

13.4 a 12.5 a 8.7 b

Efluente (% materia fresca inicial) EFL

28.2 a 17.4 b 9.6 c

Materia seca (%) MS

14.8 b 15.3 b 19.0 a ***

16.3

Composición química (%MS) MO

89.3 b 90.3 a 89.0 b ***

90.1 a 90.1 a

88.5 b

***

0.154

NS

PB

11.4 a 11.3 a 9.3 b

10.7

10.6

FND FAD EE

45.5

a

37.5

a

2.7

c

43.9

b

35.7

b

7.8

b

***

38.9

c

32.3

c

18.0

a

10.7

42.1

b

***

34.3

b

***

b

***

9.1

42.6

b

34.8

b

9.7

a

NS

0.057

***

43.5

a

**

0.259

**

36.4

a

***

0.161

***

***

0.094

***

9.7

a

Digestibilidad in vitro IVDMO (%)

53.6 a 53.3 a 46.4 b ***

49.5 b 49.6 b

54.2 a

***

0.414

***

1.23 c 1.25 b

1.34 a

***

0.009

**

-1

Energía neta leche (Mcal kg MS) ENL

1.04 c 1.23 b 1.56 a ***

n= número de observaciones; EEM= error estándar de la media; MO= materia orgánica; PB= proteína bruta; FDN= fibra detergente neutra; FDA= fibra detergente ácida; EE= extracto etéreo; IVDMO= digestibilidad in vitro de la materia orgánica. (*** P<0.001; ** P<0.01; * P<0.05; NS: no significativo P>0.05). abc Valores afectados por distinto superíndice en la misma línea de cada efecto principal son significativamente diferentes (P<0.05).

Comparando los valores medios del girasol en estado fresco y del ensilado resultante se destaca un aumento del contenido en MS (+1.4 %) y de la concentración (en %MS) de PB (+1.6 ud), FAD (+3.0 ud), FND (+1.4 ud) y EE (+0.4 ud) unido a un fuerte descenso en el valor de IVDMO (-12.6 %) y de ENL (-0.31 Mcal kg-1MS), lo cual se atribuye a la elevada producción de efluente en todos los cortes. Como indican diversos estudios, es de esperar un incremento en la MS del ensilaje cuando el contenido en MS del forraje verde puesto en el silo es inferior al 23-25 %(38), así como escasas variaciones en el contenido de cenizas y nitrógeno total cuando los correspondientes valores del ensilaje resultante se expresan sobre la base de la materia seca corregida por las pérdidas de volátiles que tienen lugar durante el proceso de secado en estufa(22), mientras que, el contenido en fibra suele verse afectado significativamente por el ensilado, debido al 628


Rev Mex Cienc Pecu 2020;11(3):620-637

incremento pasivo provocado por pérdidas de materia seca no celulósica en el efluente o como gas durante la fermentación(39). Por otra parte, aunque en general se asume que la digestibilidad del ensilado es igual o ligeramente inferior a la del forraje original (40), existen evidencias de una importante disminución de la digestibilidad en el caso de forrajes ensilados con bajo contenido en materia seca, en razón a que el efluente contiene nutrientes altamente digestibles(41), habiéndose señalado para ensilados con contenidos en materia seca próximos al 16 % un descenso medio de 7.0 unidades porcentuales en los valores de digestibilidad de la MS(42), valor que fue superado ampliamente en nuestro estudio, debido probablemente a un mayor contenido en humedad. La fecha de corte afectó significativamente el contenido en MS, la composición química, la digestibilidad y la concentración energética del ensilado. En líneas generales, la variación observada en los distintos cortes en la calidad del ensilaje fue semejante a la observada para el forraje fresco original. Los valores de pérdidas totales de MS, contenido en MS y en PB no fueron afectados por el uso de aditivo (P>0.05), cuyo efecto sobre las características de los ensilajes fue comparativamente inferior al ejercido por la fecha de corte. Se destaca el efecto del ácido fórmico, que aumentó significativamente la producción de efluente (P<0.001) y el nivel de pérdidas totales de MS (P<0.01) con relación al inoculante y al control sin aditivo, con valores del 20.9 vs 17.2 y 16.8 % del peso fresco ensilado para el efluente y de 14.8 vs 10.9 y 8.8 % para el nivel de pérdidas, respectivamente. Adicionalmente, los ensilajes tratados con fórmico mostraron concentraciones significativamente inferiores de MO (88.5 vs 90.1 y 90.1 %MS) y superiores de FND (43.5 vs 42.6 y 42.1 %MS), FAD (36.4 vs. 34.8 y 34.3 %MS) y sobre todo de IVDMO (54.2 vs 49.6 y 49.5 %MS) y ENL (1.34 vs 1.25 y 1.23 Mcal kg-1 MS). Los resultados obtenidos coinciden con las observaciones de otros autores que apuntan al incremento de la producción de efluente y de pérdidas cuando se aplica ácido fórmico a forrajes de alta humedad(39) y a una mejora de la digestibilidad debido al menor gasto de carbohidratos no estructurales durante la fermentación(15). La respuesta del uso de inoculantes sobre el nivel de pérdidas de MS en el ensilado es variable, ya que existen informes que muestran un efecto negativo, con valores de recuperación de MS inferiores a un control sin aditivo(43), pero por lo general su efecto en condiciones de alta humedad es escaso(44), tal como se observó en este estudio.

Calidad fermentativa de los ensilajes

La fecha de cosecha y el uso de aditivo afectaron significativamente a los principales parámetros que definen la calidad fermetativa (Cuadro 3). Los valores de pH aumentaron con la fecha de corte, siendo diferentes entre sí en los tres aprovechamientos (F+1: 3.77, F+3: 3.94 y F+5: 4.04, P<0.001). Los contenidos en acético, AGV, N soluble y N-NH3 fueron 629


Rev Mex Cienc Pecu 2020;11(3):620-637

inferiores (P<0.001) en la primera fecha de corte comparado con las dos fechas posteriores, que no se diferenciaron entre sí (acético: 1.71 vs 2.54 y 2.41 %MS; AGV: 289 vs 426 y 405 mmoles kg-1 MS; N soluble: 32.8 vs 45.2 y 46.7 % N total; N-NH3: 3.87 vs 7.03 y 7.68 % N total). Los contenidos en láctico y etanol evolucionaron de forma contraria, siendo más elevados en los cortes más precoces en comparación con los más tardíos (láctico: 9.06, 7.66 y 6.36 %MS; etanol: 4.17, 4.92 y 3.39 %MS; F+1, F+3 y F+5 respectivamente). Los contenidos en butírico, propiónico y AGV de cadena más larga, así como de butanol y propanol fueron muy bajos en todas las fechas de corte. Cuadro 3: Efecto de la fecha de corte y del uso de aditivo sobre la calidad fermentativa del ensilaje de girasol Efectos principales

Interacción

Corte F+1 n pH

F+3

15 3.77

Aditivo F+5

15 c

3.94

P

15 b

4.04

TES

INOC FORM P

15

15

a

b

***

3.8

***

11.2 a

***

3.05

a

EEM

P

15 4.18 a

***

0.007

***

11.48 a 0.35 b

***

0.481

NS

***

0.086

*

3.77

c

Productos de fermentación (%MS) Láctico

9.06 a

7.66 b

6.36 b

Acético

1.71

b

a

a

Propiónico

0.013

NS

0.021

0.016

0.012

NS

0.003

NS

Butírico

0.015 a 0.002 b 0.003 b ***

0.007

0.006

0.008

NS

0.001

NS

NS

0.000

NS

*

0.000

NS

Valérico

0.002

2.54

2.41

0.016 b

0.00

0.021

b

0.005

Caproico

0.004

Isobutírico

0.003 a 0.001 ab 0.0 b

Isovalérico

0.002 b 0.0 b

Butanol

0.010

Etanol

4.17

Propanol

0.18

a

0.001

a

0.002

*

a

0.15

ab

0.007 3.39

b

b

0.09

0.003

1.00

0.002 a

0.001 b

*

0.002

0.001

0.001

NS

0.000

NS

0.003

0.002

0.001

NS

0.000

NS

0.009

0.009

0.01

NS

0.000

NS

b

b

***

0.261

***

NS

0.041

NS

513.6 c 437.9 b 169.1 a

***

14.9

*

0.707

NS

0.161

***

**

1.85

NS

0.13

1.95 0.17

0.001

b

0.005

*

0.002

c

NS

0.005 a **

0.011 4.92

a

2.61

b

8.68

a

0.12

Ácidos grasos volátiles (mmoles kg-1 MS) AGV

289 b

426 a

405.7 a ***

N soluble y amoniacal (% N total) N-Soluble

32.8 b

45.2 a

46.7 a

***

45.2 a

43.3 a

36.2 b

***

N-NH3

3.87 c

7.03 b

7.68 a

***

8.18 a

6.84 b

3.57 c

*** -1

n= número de observaciones; EEM= error estándar de la media; AGV= mmoles kg MS de acético, butírico, isobutírico, propiónico, valérico e isovalérico. (*** P<0.001; ** P<0.01; * P<0.05; NS: no significativo P>0.05). ab Valores afectados por distinto superíndice en la misma línea de cada efecto principal son diferentes (P<0.05).

630


Rev Mex Cienc Pecu 2020;11(3):620-637

Una buena calidad de fermentación de ensilajes de alta humedad se define, según criterios del INRA francés o DLG alemán(45), por valores de pH4.0, ausencia o trazas de butírico y propiónico, contenidos de acético <2-3 %MS, de N-NH3  5-8 % N total y de N soluble  50 % N total, acompañados con un contenido de AGV por debajo de 600 mmoles kg-1 MS. En relación a estos criterios, los resultados obtenidos en el presente trabajo reflejan una calidad de fermentación del girasol aceptable o buena en todo el ciclo de crecimiento considerado y sugiere que la mayor disponibilidad de azúcares en las fechas más precoces favorece, a pesar del mayor contenido en humedad, una mejor calidad de fermentación en comparación con el aprovechamiento más tardío, confirmando las indicaciones de los coeficientes de fermentabilidad obtenidos en estado fresco. El ensilado testigo mostró valores de pH (3.80), AGV (513 mmoles kg-1 MS), N soluble (45.2 % N total) y N-NH3 (8.1 % N total), lo que es indicativo de una calidad fermentativa aceptable, aunque tuvo una concentración de acético algo elevada (3.05 %MS). Comparado con el grupo testigo, el inoculante, con relación al control, redujo significativamente (P<0.001) el pH (3.77) y los contenidos de acético (2.61 %MS), AGV (437 mmoles kg-1 MS) y N-NH3 (6.84 % N total), mejorando ligeramente la fermentación. Los resultados obtenidos con la aplicación de inoculante al girasol concuerdan con los de los trabajos que muestran un efecto positivo de su uso sobre la calidad de fermentación(43,46), siendo de especial interés su efectividad aún en condiciones de alta humedad del forraje, como es el caso del presente estudio, consistentemente dicho efecto se suele observar con forrajes ensilados donde el contenido en MS es cercano al 30 % o superior(47). La adición de ácido fórmico redujo la intensidad de la fermentación en el ensilado, evidenciada por un valor medio de pH más elevado (4.18) y menores contenidos medios en láctico (0.35 %MS), acético (1.0 %MS), AGV (169 mmoles kg-1 MS), N soluble (36.2 % N total) y N-NH3 (3.5 % N total) significativamente diferentes (P<0.001) a los de los otros dos tratamientos de aditivo. Otro rasgo típico de la actividad del fórmico es la elevación del contenido en etanol, comparado con el inoculante y el testigo (8.68 vs. 1.85 y 1.95 %MS), lo que se atribuye a una mayor actividad de las levaduras, particularmente tolerantes a la acción del ácido fórmico(48), ligada a la mayor disponibilidad de azúcares en una fermentación menos intensa. Coincidiendo con estas observaciones, diversos estudios han mostrado que la aplicación de ácido fórmico produce ensilajes con bajos valores de ácidos láctico y acético, y una menor proporción láctico:acético así como una menor proporción de N amoniacal sobre el N total como consecuencia de la reducción de la intensidad de los procesos proteolíticos causada por el aditivo(15, 49). El efecto de los diferentes aditivos sobre los parámetros fermentativos fue relativamente homogéneo en las tres fechas de corte, como se evidencia por la escasa importancia cuantitativa de las interacciones con efecto significativo sobre el pH y los contenidos de 631


Rev Mex Cienc Pecu 2020;11(3):620-637

acético, etanol, AGV y N-NH3. Mientras el efecto del ácido fórmico fue semejante en las tres fechas de corte del girasol, el efecto positivo del inoculante en la mejora de la fermentación se pone de manifiesto con mayor intensidad cuando la planta se cosecha en las proximidades de la floración probablemente debido a la mayor disponibilidad de sustrato azucarado a disposición de las bacterias lácticas añadidas al forraje, que se muestran efectivas a pesar de la mayor humedad en este momento, coincidiendo con lo anticipado por el coeficiente de fermentabilidad calculado para el forraje fresco. Frente a la evidente mejora de la fermentación inducida por el uso de ácido fórmico se debe contraponer, por una parte, la dificultad de su aplicación por su carácter de ácido fuerte, potencialmente corrosivo y, por otra, el incremento de la producción de efluente, ya de por sí alta en el tratamiento testigo, causada por su aplicación. Desde este punto de vista y teniendo en cuenta el alto poder contaminante del efluente(50), no sería aconsejable la utilización del ácido fórmico frente al inoculante y al control sin aditivo. Por otra parte, dada la buena calidad fermentativa del ensilaje de girasol sin conservante, la justificación del gasto en la adición de inoculante está sujeta a controversia y a pesar de la mejora en la calidad fermentativa esperada, su uso debería confrontarse, en términos económicos, con la mejora de la productividad de los animales alimentados con los distintos tipos de ensilajes, aspecto que se sitúa fuera del objeto.

Conclusiones e implicaciones El ensilaje de girasol presenta un buen contenido energético y moderado de proteína. La fecha de corte afecta a la materia seca y energía, incrementándose a mayor edad de la planta, pero se minimizan el porcentaje de la primera. Como resultado del escaso margen de ventaja en términos de calidad de ensilado con el uso de aditivos, es necesario realizar análisis de costo-beneficio al respecto. Por su concentración de nutrientes, sus valores de composición química y características fermentativas, el ensilado de girasol puede ser un forraje complementario en la alimentación de vacas lecheras, pero el alto contenido en aceite en las proximidades del momento óptimo de cosecha puede representar una limitante en su utilización en la dieta.

Agradecimientos y conflictos de interés Trabajo financiado por los proyectos ATT 2016/106 de la Xunta de Galicia y RTA201200065-05-02 del INIA. Aurora Sáinz-Rodríguez fue beneficiaria de una ayuda de

632


Rev Mex Cienc Pecu 2020;11(3):620-637

CONACYT para realizar una estancia formativa en el CIAM. Los autores señalan la ausencia de conflictos de interés.

Literatura citada: 1. SAGARPA. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Planeación agrícola nacional 2017-2030, Oleaginosas. México. 2017. 2. CONAGUA. Comisión Nacional del Agua. Estadísticas Agrícolas de los Distritos de Riego Año Agrícola 2013-2014. Secretaría de Medio Ambiente y Comisión Nacional del Agua. México. 2017. 3. Bravo-Quirino F. Guía para el aprovechamiento del girasol como forraje. Instituto de Investigación y Capacitación Agropecuaria del Estado de México. México. 2014. 4. Panciera MT, Kunkle WE, Fransen MT. Minor silage crops In: Buxton DR, et al. editors. Silage science and technology. American Soc Agronom Inc., Crop Science Soc. of America Inc, Madison, Wisconsin, USA. 2003. 5. Fransen SC. Corn and sunflower intercropped for silage. Proc Northwest Dairy Shortcourse. Pullman, USA. Washington State Univ. 1987. 6. Park CS, Marx GD, Moon YS, Wiesenborn D, Chang KC, Hofman VL. Alternative uses of sunflower. In: Schneiter AA. editor. Sunflower technology and production. Agronom Monogr ASA, CSSA and SSSA. Madison, WI, USA. 1997. 7. Donaldson E, Henderson AR, Edwards RA, Harper FF. Studies on sunflower silage. Edinburg School of Agriculture. 1980. 8. Demarquilly C, Andrieu J. Chemical composition, digestibility and ingestibility of whole sunflower plant before and after ensiling. Ann Zootech 1972;21(2):147-162. 9. Gonçalves LC, Tomich TR, Pereira LGR. Produção e utilização de silagem de girassol. Simpósio: Forragicultura e Pastagens. Lavras Anais Lavras. UFLA. 2000. 10. Weissbach D. The silaging qualities of sunflowers. Green Chemistry ADDCON. 2007. http://www.addcon.com/en/feed/silage-additives/ensiling-tips/sunflowers/ Accessed Feb 28, 2018. 11. Tomich TR, Gonçalves LC, Tomich RGP, Rodrigues JÁ, Borges I. Características químicas e digestibilidade in vitro de silagens de girassol. R Bras Zootec 2004;33(6):1672-1682.

633


Rev Mex Cienc Pecu 2020;11(3):620-637

12. Edwards RA, Harper F, Henderson AR, Donaldson E. The potential of sunflower as a crop for ensiling. J Sci Food Agric 1978;(29):332-338. 13. Wilkinson JM, Muck RE. The future of ensiling: challenges and opportunities. In: Gerlach K, Südekum KH Editors. Proc. XVIII Int. Silage Conf. Germany. 2018. 14. Jones BA, Hatfield RD, Muck RE. Effect of fermentation and bacterial inoculation on lucerne cell walls. J Sci Food Agric 1992;(60):147-153. 15. Mayne CS. The effect of formic acid, sulphuric acid and a bacterial inoculant on silage fermentation and the food intake and milk production of lactating dairy cows. Anim Prod 1993;56(1):29-42. 16. Mayne CS, Steen RWJ. Recent research on silage additives for milk and beef production. 63rd Annual Report 1989-1990, Agricultural Research Institute of Northern Ireland, 1990. 17. McDonald P, Henderson AR, Heron SJE. The biochemistry of silage. 2nd ed. Marlow, England: Chalcombe Publ. 1991. 18. Schneiter AA, Miller JF. Description of sunflower growth stages. Crop Sci 1981;(21):901-903. 19. Flores G, González A, Castro J. Evaluación de la utilidad de los silos a pequeña escala para experimentación en calidad de ensilados. Actas de la XXXVII R.C. SEEP. España 1997. 20. Pereira S, Fernández B, Valladares J, Díaz N, Resch C, González A, Flores G. Evolución del rendimiento y calidad del girasol (Helianthus annus L.), aprovechado para forraje tras la floración y desarrollo de calibraciones NIRS para la predicción del valor nutricional de los componentes morfológicos. Pastos 2014;44(2):19-30. 21. Playne MJ, McDonald P. The buffering constituents of herbage and of silage. J Sci Food Agric 1966;17(6):264-268. 22. Weissbach F, Schmidt L, Hein E. Method of anticipation of the run fermentation in silage making, based on the chemical composition of the green fodder. Proc 12th Int Grassld Congress. Moscow. 1974. 23. Dulphy JP, Demarquilly C. Problèmes particuliers aux ensilages In: INRA editor. Prévision de la valeur nutritive des aliments des ruminants. París, Francia. 1981: 81-104. 24. Flores G, Arráez AG, Castro J, Castro P, Cardelle M, Fernández B, Valladares J. Evaluación de métodos de laboratorio para la predicción de la digestibilidad in vivo de

634


Rev Mex Cienc Pecu 2020;11(3):620-637

la materia orgánica de ensilajes de hierba y planta entera de maíz. Pastos 2005;(32):599. 25. FEDNA. Fundación Española para el Desarrollo de la Nutrición Animal. Tablas de composición y valor nutritivo de alimentos para la fabricación de piensos compuestos. 3ª ed. Fundación Española para el Desarrollo de la Nutrición Animal. España. 2010. 26. Valdez FR, Harrison JH, Fransen SC. Effect of feeding corn-sunflower silage on milk production, milk composition, and rumen fermentation of lactating dairy cows. J Dairy Sci 1988;71(9):2462-2469. 27. Stern M, Endres M. Laboratory manual. Research techniques in ruminant nutrition. Dep Anim Sci. University of Minnesota. USA. 1991. 28. Sáinz-Ramirez A, Botana A, Valladares J, Pereira S, Veiga M, Resch C, Flores G. Efecto de la variedad y de la fecha de corte sobre el rendimiento y el valor nutricional del girasol cosechado para ensilar en la zona atlántica de Galicia. 56a RC SEEP. Barcelona. 2017. 29. Flores G, Botana A, Pereira S, Valladares J, Pacio B, Aguión A, Resch C. Efecto del momento de corte sobre el rendimiento y valor nutricional de dos tipos de girasol (una variedad forrajera y otra de aceite) cultivados para ensilar a finales de verano en Galicia. Afriga 2016;(121):184-200. 30. Tosi H, Silveira AC, Faría VP, Pereira RL. Avaliação do girassol (Helianthus annuus) como planta para a ensilagem. Rev Soc Bras Zootec 2016;4(1):39-48. 31. Gonçalves LC, Rodriguez NM, Pereira LGR, Rodrigues JAS, Borges I, Borges ALCC, Saliba EOS. Evaluation of different harvest times of four genotypes of sunflower (Helianthus annuus L.) for ensiling. FAO Electronic Conference on Tropical Silage http://www.fao.org/ag/agp/agpc/gp/silage/PDF/7P5.pdf. Accessed Dec 15, 2017. 32. Hill JAG, Fleming JS, Montanhini Neto R, Camargo H, Flemming DF. Valor nutricional do girassol (Helianthus annuus L.) como forrageira. Arch Vet Sci 2003;8(1):41-48. 33. Mello R, Nörnberg JL, Restle J, Neumann M, César-Queiroz A, Barcellos-Costa P, Rodrigues-Magalhães AL, Bitencourt de David D. Características fenológicas, produtivas e qualitativas de híbridos de girassol em diferentes épocas de semeadura para produção de silagem. R Bras Zootec 2006;35(3):672-682. 34. Romero LA, Mattera J, Redolfi F, Gaggiotti M. Silaje de girasol: efecto del momento de corte sobre la producción y la calidad. Rev Arg Prod Anim 2009;29(1):401-610. 35. Peiretti PG, Meineri G. Evolution of Chemical Composition, Nutritive Value and Fatty Acids Content of Sunflower (Helianthus annuus L.) during the Growth Cycle. J Anim Vet Adv 2010;9(1):112-117. 635


Rev Mex Cienc Pecu 2020;11(3):620-637

36. Pitzz JW, Kaiser AG. Principles of Silage preservation. In: Kaiser AG et al. editors. Topfodder Successful Silage. New South Wales, Australia. 2004. 37. Rotz CA, Ford SA, Buckmaster DR. Silages in farming systems. In: Buxton DR, et al editors. Silage Science and Technology, Madison, WI, USA: Agronomy Publication 42, Am Soc Agronom. 2003. 38. Michalet-Doreau B, Demarquilly C. Prévision de la valeur énergétique des ensilages d´herbe. In: INRA editor. Prévision de la valeur nutritive des aliments des Ruminants. publications, París, Francia. 1981. 39. Haigh PM. Effluent production from grass silages treated with additives and made in large-scale bunker silos. Grass Forage Sci 1999;(543):208-218. 40. Harris CF, Raymond WF. The effect of ensiling on crop digestibility. Grass Forage Sci 1963;(18):204-212. 41. Demarquilly C, Dulphy JP, Andrieu JP. Valeurs nutritive et alimentaire des fourrages selon les techniques de conservation: foin, ensilage, enrubannage. Fourrages 1998;(155): 349-369. 42. Rogers GL, Bryant AM, Jury KE, Hutton JB. Silage and dairy cow production, N Z J Agric Res 1979;22(4):511-522. 43. Kung L, Muck RE. Animal Response to silage additives Proce Silage: Field to Feedbunk, North American Conference. 1997. 44. Gordon FJ. An evaluation through lactating cattle of a bacterial inoculant as an additive for grass silage. Grass Forage Sci 1989;(44):169-179. 45. Pflaum J, Gartner L, Demarquilly C, Andrieu JP. Silage additive testing: Comparison of the German DLG and the French INRA schemes BLT, Grub, Poing (Germany). 1996. 46. Oliviera AS, Weinberg ZG, Ogunade IM, Cervantes AP, Arriola KG, Jiang Y, Kim D, Li M. Meta-analysis of effects of inoculation with homofermentative and facultative heterofermentative lactic acid bacteria on silage fermentation, aerobic stability, and the performance of dairy cows. J Dairy Sci 2017;(100):4587-4603. 47. Kung LJ, Tung RS, Maciorowski KG, Buffum K, Knutsen K, Aimutis WR. Effects of plant cell-wall-degrading enzymes and lactic acid bacteria on silage fermentation and composition. J Dairy Sci 1991;(74):4284-4296. 48. Henderson AR, McDonald P, Woolford MK. Chemical changes and losses during the ensilage of wilted grass treated with formic acid. J Sci Food Agr 1972;(23):1079-1087.

636


Rev Mex Cienc Pecu 2020;11(3):620-637

49. Nagel SA, Broderick GA. Effect of formic acid or formaldehyde treatment of alfalfa silage on nutrient utilization by dairy cows. J Dairy Sci 1992;(75):140-154. 50. Wilkinson JM, Toivonen, MI. World silage: a survey of forage conservation around the world. Chalcombe Publications, Lincoln, Reino Unido. 2003.

637


https://doi.org/10.22319/rmcp.v11i3.5149 Artículo

Suplementación de clorhidrato de zilpaterol en corderos finalizados con dieta sin fibra de forraje

Ricardo Vicente-Pérez a Ulises Macías-Cruz b* Ramón Andrade Mancilla a Rogelio Vicente a Enrique O. García a Ricardo Martínez a Leonel Avendaño-Reyes b Oziel D. Montañez c

a

Universidad de Guadalajara, Departamento de Producción Agrícola-CUCSUR, Autlán de Navarro. Jalisco, México. b

Universidad Autónoma de Baja California, Instituto de Ciencias Agrícolas, Valle de Mexicali, Baja California, México. c Universidad de Guadalajara, Departamento de Ciencias de la Naturaleza-CUSUR, Ciudad Guzmán. Jalisco, México.

* Autor de correspondencia: ulisesmacias1988@hotmail.com

Resumen: Un total de 24 corderos de pelo Kathadin se distribuyeron bajo un diseño de bloques completamente al azar en dos tratamientos para evaluar el efecto de suplementar clorhidrato de zilpaterol genérico (CZ; 0 vs 10 mg/d/animal) en una dieta de finalización sin fibra de forraje, sobre comportamiento productivo, características de la canal, rendimiento de cortes 638


Rev Mex Cienc Pecu 2020;11(3):638-650

primarios y pesos de despojos expresados como un porcentaje del peso al sacrificio. Se realizó una prueba de comportamiento en corral de 30 días y después se sacrificó la mitad de los animales de cada tratamiento (n= 6). La suplementación del CZ no afectó la ganancia de peso, pero sí mejoró (P≤0.02) la eficiencia alimenticia, el peso y rendimiento de canal, y el área del músculo Longissimus dorsi, así como el rendimiento de pierna y lomo completo. Tanto grasa KPH como mesentérica se redujeron (P≤0.05) por efecto de CZ. El resto de los porcentajes de despojos de la canal no fueron afectados por CZ. Se concluye que la suplementación dietaría de CZ genérico mejoró la deposición de masa muscular por reducir la deposición de grasa interna, favoreciendo la eficiencia alimenticia de cordero engordados con dieta sin fibra de forraje. Palabras clave: Ovinos de pelo, Engorda de borregos, Agonista adrenérgico, Grofactor®.

Recibido: 14/11/2018 Aceptado: 1/07/2019

Introducción El inventario ovino mexicano tuvo un incremento del 20 % en la última década, lo que generó para el 2018 una producción de carne de 62,939 t y una disminución considerable en las importaciones de la misma(1). La producción de carne de ovino muestra desde hace algunas décadas ser un nicho de oportunidad en el mercado mexicano y, en general, a través del mundo, ya que la demanda es insatisfecha y el kilogramo de carne tiene un precio competitivo(2). En este sentido, la búsqueda de estrategias que permitan mejorar la producción de carne ovina es una necesidad inminente en la actualidad. El agonista adrenérgico β2 (AA β2) clorhidrato de zilpaterol (CZ) es un promotor de crecimiento que resulta efectivo para mejorar el comportamiento productivo y las características de la canal de importancia económica cuando se ofrece entre 4 y 5 semanas antes del sacrificio a corderos finalizados en corral(3-6), no así en pastoreo(7). Este AA β2 funciona como promotor de crecimiento porque redistribuye sustrato energético del tejido graso y algunos órganos hacia la formación de masa muscular (hipertrofia)(4,8,9). Cabe mencionar que la efectividad del CZ como promotor de crecimiento en corderos de engorda se ha demostrado ofreciendo dietas formuladas tanto con grano y forraje para favorecer el correcto funcionamiento ruminal. Sin embargo, en la actualidad se están formulando dietas

639


Rev Mex Cienc Pecu 2020;11(3):638-650

para engorda de ovinos usando fuentes de fibras alternas al forraje, ya que es escaso en algunas regiones y épocas del año, así como en ocasiones tiene un costo elevado(10). El aserrín y los desechos de agroindustria son dos fuentes de fibra alterna que no provocan problemas digestivos en corderos al sustituir el 100 % de la fracción de forraje en la dieta de engorda(11,12). No obstante, no se ha determinado la efectividad del CZ como promotor de crecimiento en corderos alimentados sin fibra de forraje. Por lo tanto, el objetivo fue evaluar el efecto del CZ sobre comportamiento productivo, características de la canal y rendimiento de cortes primarios en corderos de pelo finalizados en corral usando una dieta integral a base de grano sin fibra de forraje.

Material y métodos Todos los procedimientos implicados en el manejo y sacrificio de los animales se realizaron de acuerdo a Normas Oficiales Mexicanas de SAGARPA (NOM-051-ZOO-1995: Cuidado humanitario de los animales durante la movilización, y NOM-033-ZOO-1995: Sacrificio de animales domésticos y salvajes). El estudio consistió de una prueba de comportamiento en corral que duró 30 días en el rancho “El Tilzapote”, ubicado en el poblado de Ayutita, municipio de Autlán de Navarro, Jalisco. Posteriormente, se sacrificó la mitad de corderos en un rastro comercial ubicado en la cabecera municipal Tapalpa, Jalisco.

Animales, alojamiento y manejo pre-experimental

Se utilizaron 24 corderos enteros de la raza Katahdin, los cuales tenían una edad de 4 meses y un peso promedio al inicio de la prueba en corral de 35.8 ± 5.3 kg. Los corderos se alojaron en corraletas individuales y se adaptaron a una dieta base formulada para una ganancia diaria de peso de 300 g (Cuadro 1)(13) 15 días antes de la prueba. Adicionalmente, se desparasitaron cutáneamente con 1 ml de ivermectina al 1%/25 kg de peso vivo. La dieta se elaboró en una sola exhibición y dos muestras de alimento fueron tomadas de los diferentes costales para la determinación de los siguientes compuestos químicos: materia seca, proteína cruda, extracto etéreo, fibra total, fibra detergente ácida y neutra, y cenizas(14,15). También se calcularon con fórmulas(16,17) los nutrientes digestibles totales y los diferentes tipos de energías (digestible, metabolizable, neta de mantenimiento y neta de ganancia).

640


Rev Mex Cienc Pecu 2020;11(3):638-650

Cuadro 1: Ingredientes y composición química de la dieta base experimental Ingredientes, como se ofrece % Maíz molido 57 Aserrín de pino 20 Harina de soya 10 Salvado 8 Aceite de frituras 2 Pre-mezcla mineral 2 Urea 1 Composición química, en base a materia seca % Materia seca 94.2 Proteína cruda 14.4 Extracto etéreo 11.2 Fibra 21.5 Cenizas 11.2 Fibra detergente ácida 20.4 Fibra detergente neutra 30.6 Nutrientes digestibles totales, (NDT) 79.3 Energía de la dieta, en base a materia seca Mcal/kg Energía digestible, (ED) 3.5 Energía metabolizable, (EM) 2.9 Energía neta de mantenimiento, (ENm) 1.9 Energía neta de ganancia, (ENg) 1.3 NDT = 102.56 – (%FDA X 1.140) (Alves et al., 16); ED = NDT x 0,044 (NRC 1985); EM = 0.82 x ED (NRC 17 ); ENm = 1.37 x EM – 0.14EM2 + 0.01EM3 – 1.12 (NRC 17); ENg = 1.42 x EM – 0.17EM2 + 0.012EM3 – 1.65 (NRC 17).

Tratamientos y alimentación experimental

El primer día de prueba, los corderos se pesaron y se formaron parejas de similar peso (factor de bloqueo) para asignarlos aleatoriamente dentro de cada bloque a uno de los dos tratamientos dietarios (n= 12): 1) dieta basal sin CZ (testigo) y 2) dieta basal con 10 mg de CZ genérico/d/cabeza (Grofactor®, Virbac México, Guadalajara, México). La dosis diaria de CZ se calculó basada en la cantidad de producto comercial (208 mg) y se colocó en una cápsula de gel para ofrecerla oralmente a cada animal tratado con CZ antes de la alimentación de la mañana. En el caso del grupo testigo, a manera de placebo, una cápsula de gel que contenía 208 mg de harina de soya fue ofrecida diariamente a cada cordero. La dosis ofrecida de CZ estuvo acorde a recomendaciones de estudios previos(18,19). EL CZ se ofreció por 28 días, seguido de un periodo de retiro de 48 h antes de sacrificar los animales.

641


Rev Mex Cienc Pecu 2020;11(3):638-650

La cantidad de alimento diario por corral se estimó para un rechazo aproximado del 10 % y éste se ofreció en una sola exhibición a las 0700 h, justamente después de dar las cápsulas de tratamiento. La disponibilidad de agua fue ad libitum y todos los días se revisó el estado de salud de los animales por observación directa.

Comportamiento productivo

El comportamiento productivo se evaluó registrando el peso vivo al inicio (día 1) y final (día 31), antes de la alimentación en la mañana. La cantidad de alimento rechazado por corral también se registró. Con la información colectada se calculó el consumo diario de materia seca, la ganancia total, la ganancia diaria de peso y la eficiencia alimenticia del periodo completo (día1 a 30).

Características de canal y cortes primarios

Para la evaluación de la canal, solamente la mitad de los corderos de cada tratamiento (n= 6) se trasladó al rastro ubicado a 2 h del sitio de la prueba de comportamiento en corral. Dado que el estudio se realizó en un rancho privado, el productor definió que se sacrificaran los más pesados. En este sentido, se sacrificaron por el método de degüelle los corderos pertenecientes a los bloques del 7 al 12. El peso vivo individual de los corderos se registró nuevamente antes de entrar a línea de sacrificio. Los cuerpos de los corderos se evisceraron para registrar el peso de canal caliente (PCC), así como los pesos de cabeza, sangre, piel, corazón, pulmón, hígado, riñón, bazo, testículos y patas. Adicionalmente, se registró el peso de grasa mesentérica, omental y de riñón-pelvis-corazón (KPH por sus siglas en inglés). Posteriormente, las canales permanecieron por 24 h a 4° C y siguiendo las metodologías indicada por Avendaño-Reyes et al(18) y Macías Cruz et al(20), se registraron las siguientes variables: peso canal fría (PCF), área del músculo Longissimus dorsi (MLD) y espesor de grasa dorsal. También se registraron medidas morfométricas de la canal: largo de canal, pierna y paleta, asimismo circunferencia de tórax, cuello, pierna y paleta. Finalmente, la canal se cortó a través de la línea media y se registró el peso de la media canal derecha, la cual posteriormente se utilizó para obtener los siguientes cortes primarios: cuello, lomo, costilla con falda, pecho, pierna y paleta. El peso vivo al sacrificio se ajustó al 96 % por considerar que el contenido del tracto gastrointestinal era del 4 %. A excepción de grasa KPH, el peso de cada despojo de canal se expresó como un porcentaje del peso vivo al sacrificio. La grasa KPH se expresó como un

642


Rev Mex Cienc Pecu 2020;11(3):638-650

porcentaje del PCC. El rendimiento en canal se calculó expresando el PCC como un porcentaje del peso vivo a sacrificio ajustado. La pérdida de canal por enfriamiento también se calculó expresando la diferencia entre PCC y PCF como un porcentaje del PCC. El rendimiento de cada corte primario se calculó expresando los respectivos pesos de cada corte como un porcentaje del peso de la media canal.

Análisis estadístico

El análisis estadístico consistió de un análisis de varianza bajo un diseño de bloques completamente al azar usando el procedimiento GLM del programa SAS(21). Las medias se compararon con la prueba de Tukey a una α= 0.05. Tendencias no fueron consideradas dado el bajo número de repeticiones para variables relacionadas con sacrificio.

Resultados En la prueba de comportamiento productivo solamente eficiencia alimenticia fue afectada (P<0.01) por la suplementación de CZ, siendo 9.4 % mayor debido al AA-β2 (Cuadro 2). El consumo de alimento tendió (P=0.08) a disminuir por suplementación de CZ. En características de la canal (Cuadro 3), la suplementación de CZ aumentó (P≤0.02) en 7.5, 7.3, 5.7 y 10.2 % el PCC, el PCF, el rendimiento en canal y el área del MLD, respectivamente, pero también disminuyó (P=0.05) el porcentaje de grasa KPH. El resto de las características de la canal fueron similares (P≥0.17) entre tratamientos. En los pesos de despojos de la canal expresados como un porcentaje del peso vivo al sacrificio, la grasa mesentérica se redujo (P<0.01) 23.2 % por efecto del CZ dietario (Cuadro 4). Los pesos de los otros despojos no variaron (P≥0.08) con la suplementación de CZ. Finalmente, la suplementación de CZ aumentó (P≤0.04) 5.1 % el rendimiento de lomo y pierna, pero redujo (P=0.03) 8.1 % el rendimiento de costilla con falda (Cuadro 5). Los demás cortes primarios tuvieron similares (P≥0.18) rendimientos entre tratamientos.

643


Rev Mex Cienc Pecu 2020;11(3):638-650

Cuadro 2: Comportamiento productivo de corderos de pelo suplementados con clorhidrato de zilpaterol genérico durante la etapa de finalización en corral Clorhidrato de zilpaterol (mg/cabeza/día) Valor de EE Variables P 0 10 Peso vivo, kg Inicial 35.7 35.8 0.2 0.83 Intermedio 41.5 41.2 0.3 0.49 Final 46.0 46.4 0.2 0.23 Ganancia de peso total, kg 10.3 10.6 0.2 0.29 Ganancia diaria de peso, g/d 343.0 354.3 7.1 0.29 Consumo de alimento, kg 1.7 1.5 0.1 0.08 Eficiencia alimenticia, g/kg 204.6 223.9 4.4 <0.01 EE= error estándar.

Cuadro 3: Características y medidas morfométricas de la canal en corderos de pelo suplementados con clorhidrato de zilpaterol genérico durante la etapa de finalización en corral Clorhidrato de zilpaterol (mg/cabeza/día) Valor de EE Variables P 0 10 Peso de canal caliente, kg 22.7 24.4 0.2 <0.01 Peso de canal fría, kg 21.9 23.5 0.2 <0.01 Rendimiento en canal, % 49.1 51.9 0.4 <0.01 Pérdida por enfriamiento, % 3.3 3.5 0.2 0.52 2 Área del MLD, cm 17.6 19.4 0.2 0.02 Espesor de grasa dorsal, cm 0.3 0.2 0.1 0.33 Grasa KPH, % 4.6 3.3 0.4 0.05 Largo de canal, cm 63.2 63.3 0.6 0.92 Circunferencia de tórax, cm 74.5 75.2 0.5 0.36 Circunferencia de cuello, cm 40.1 39.8 1.0 0.87 Largo de pierna, cm 52.0 52.3 0.8 0.77 Circunferencia de pierna, cm 43.5 45.7 1.0 0.19 Largo de paleta, cm 41.7 41.0 0.8 0.59 Circunferencia de paleta, cm 33.1 34.6 0.7 0.17 EE= error estándar; MLD= Músculo Longissimus dorsi; Grasa KPH= La suma de las grasas acumuladas en riñones, pelvis y corazón.

644


Rev Mex Cienc Pecu 2020;11(3):638-650

Cuadro 4: Pesos de los despojos de la canal expresados como porcentaje del peso vivo al sacrificio ajustado en corderos de pelo suplementados con clorhidrato de zilpaterol genérico durante la etapa de finalización en corral (%) Clorhidrato de zilpaterol (mg/cabeza/día) Valor de EE Variables P 0 10 Cabeza 3.27 3.33 0.04 0.38 Sangre 4.14 3.93 0.12 0.26 Piel 10.0 9.92 0.41 0.89 Corazón 0.48 0.48 0.02 0.57 Pulmón 1.73 1.74 0.12 0.96 Hígado 2.23 1.69 0.17 0.08 Riñón 0.31 0.28 0.02 0.48 Bazo 0.24 0.18 0.02 0.08 Mesentérica 0.99 0.76 0.03 <0.01 Omental 2.45 2.54 0.15 0.72 Testículos 0.89 0.86 0.04 0.74 Patas 2.22 2.29 0.06 0.46 EE= error estándar.

Cuadro 5: Rendimiento de cortes primarios en corderos de pelo suplementados con clorhidrato de zilpaterol genérico durante la etapa de finalización en corral Clorhidrato de zilpaterol (mg/cabeza/día) Valor de EE Variables* P 0 10 Cuello, % 9.20 8.70 0.40 0.42 Lomo, % 19.20 20.17 0.26 0.04 Costilla con falda, % 16.84 15.47 0.33 0.03 Pecho, % 5.56 5.07 0.22 0.18 Pierna, % 29.12 30.60 0.29 0.01 Paleta, % 20.08 19.98 0.55 0.90 *Todos los pesos de los cortes fueron expresados como porcentaje del peso de la media canal. EE= error estándar.

Discusión La suplementación de CZ no resultó efectiva para mejorar el crecimiento, pero sí la eficiencia alimenticia de corderos finalizados con dietas sin fibra de forraje. Estos

645


Rev Mex Cienc Pecu 2020;11(3):638-650

resultados difieren parcialmente con lo encontrado en estudios previos(5,22,23), donde se reportó tanto mayor eficiencia alimenticia como ganancia de peso y peso final por suplementar este AA-β2 durante un periodo de 30 días antes del sacrificio. No obstante, hay una serie de investigaciones indicando la ausencia del efecto de la suplementación de CZ en la ganancia diaria de peso y peso final de corderos(7,24,25). Los corderos testigo fueron menos eficientes para aprovechar el alimento consumido porque la dieta tenía baja cantidad de fibra efectiva, dado que el aserrín estaba prácticamente molido. Esto pudo aumentar la tasa de pasaje gastrointestinal y disminuir la tasa de degradación de los microorganismos ruminales(26), aumentando el consumo de alimento y disminuyendo la eficiencia alimenticia. Así, la mejor eficiencia alimenticia observada en corderos alimentados con CZ se deba a que el AA-β2 mejoró la digestibilidad de la dieta por aumentar la población ruminal de bacterias y reducir la motilidad del tracto gastrointestinal(27). Así, los corderos tratados con CZ tendieron a disminuir su consumo diario de alimento sin afectar la tasa de crecimiento. Si bien el crecimiento de los corderos no se mejoró con la suplementación de CZ genérico, la deposición de músculo aumentó significativamente por incluir este AA-β2 como parte de la dieta. De tal manera que el PCC, el PCF, el rendimiento en canal y el área del MLD mejoraron con la suplementación del CZ, lo cual coincide con varios resultados de estudios previos(23,28,29). Estos resultados se atribuyeron a que el CZ promovió una redirección de sustratos energéticos para incrementar la síntesis de proteína al mismo tiempo que redujo la proteólisis muscular(8); ambas procesos conllevaron a una hipertrofia muscular en los corderos tratados con CZ. Inesperadamente, los resultados de este estudio mostraron que el origen del sustrato energético usado para la formación de músculo en los corderos suplementados con CZ fue principalmente a partir de tejido adiposo y no de órganos, viseras, cabeza, patas o testículos. Este hallazgo coincide con otras investigaciones en ovinos donde usaron CZ de la empresa Zilmax®(6,18,28), pero no con esas que suplementaron CZ de la empresa Grofactor®(22,23) como se hizo en este estudio. El CZ de Grofactor®(22,23) promueve en ovinos de engorda la formación de masa muscular por hacer uso de sustratos energéticos provenientes de una mejor repartición de energía dietaria, así como de algunos órganos, viseras o cabeza, pero no a partir de tejido graso. No se encontró una explicación respecto a porque cambió la forma de actuar del CZ en el presente estudio; aunque sí existen evidencias en bovinos de carne que este tipo de CZ remueve tejido graso para la formación de músculo(9). No obstante, los resultados sugieren que el tipo de fibra usada en la dieta de finalización de corderos de engorda, puede modificar el modo de acción de este AAβ2. Se requiere hacer investigaciones a nivel de metabolismo y cinética ruminal para dilucidar cómo el tipo de fibra dietaria modifica el mecanismo de acción del CZ.

646


Rev Mex Cienc Pecu 2020;11(3):638-650

Las medidas morfométricas de la canal no fueron afectadas por el CZ genérico, aun cuando se esperaba por lo menos piernas más largas y con mayor circunferencia considerando que algunos estudios han reportado que el mayor desarrollo muscular que provoca este AAβ2 se vuelve evidente físicamente en esta región corporal(4,20). En ovinos de pelo finalizados con diferentes dosis de CZ genérico en dos experimentos(22), se reportó un aumento cuadrático en el largo de canal, profundidad de tórax y perímetro de pierna como la dosis ofrecida de CZ aumentó de 0 a 0.20 mg/kg de peso vivo. En corderos(24,28) y corderas(19) también han encontrado un aumento en el perímetro de pierna sin efecto alguno en otras medidas morfométricas a consecuencia del CZ de patente. De acuerdo a la literatura, los resultados de efecto de CZ de patente o genérico en los rendimientos de cortes primarios son inconsistentes. En la actual investigación, el CZ genérico mejoró el rendimiento de pierna y lomo, coincidiendo parcialmente con hallazgos de otros estudios donde encontraron solo un aumento en el rendimiento de pierna debido a la suplementación del CZ genérico en corderos de engorda(22,23). Otros estudios no encontraron cambios en los rendimientos de cortes primarios por efecto de la CZ de patente en corderos finalizados en corral(7,28). Los resultados de este estudio se atribuyeron al hecho que tanto en pierna como en lomo predominan fibras musculares tipo II, en las cuales hay una gran cantidad de receptores adrenérgicos β2, sitios donde se unen los AAβ2 ofrecidos exógenamente en la dieta para llevar acabo su acción biológica(8,18).

Conclusiones e implicaciones Se concluye que la suplementación de CZ en corderos de engorda mejora la eficiencia alimenticia, el peso y rendimiento en canal, y el área del MLD, sin afectar la ganancia de peso vivo, cuando reciben dietas sin fibra derivada de un forraje. Adicionalmente, la suplementación de CZ mejora el rendimiento de lomo y pierna. Finalmente, la suplementación de CZ es una estrategia nutricional recomendable para aumentar la ganancia de peso en canal y el rendimiento de cortes primarios con importancia económica en corderos finalizados con dietas formuladas sin fibra de forraje.

Agradecimientos Al MVZ. Ramón Andrade Mancilla por las facilidades prestadas en su rancho “El Tilzapote”. Además, se reconoce el apoyo financiero otorgado al primer autor por parte del

647


Rev Mex Cienc Pecu 2020;11(3):638-650

Centro Universitario de la Costa Sur, de la Universidad de Guadalajara, en el marco del Proyecto P3e 2018 No. 239754 de investigación pertinente en ciencias agropecuarias y afines para el desarrollo regional.

Literatura citada: 1. SIAP. Estadísticas de la producción de ovinos del Servicio de Información Agroalimentario y Pesquero, SAGARPA. 2018. Disponible en: http://infosiap.siap.gob.mx/repoAvance_siap_gb/pecResumen.jsp. Consultado 1 Mar, 2019. 2. Muñoz-Osorio GA, Aguilar-Caballero AJ, Sarmiento-Franco LA, Wurzinger M, Cámara-Sarmiento R. Technologies and strategies for improve hair lamb fattening systems in a tropical region: A review. Rev Ecosist Rec Agropecu 2016;3(8):267-277. 3. Lopez-Carlos MA, Ramirez RG, Aguilera-Soto JI, Plascencia A, Rodriguez H, Arechiga CF, et al. Effect of two beta adrenergic agonists and feeding duration on feedlot performance and carcass characteristics of finishing lambs. Livest Sci 2011;138(13):251-258. 4. Aguilar López EY, González Ronquillo M, Salem AZM, Partida de la Peña JAP. Use of zilpaterol hydrochloride in sheep feeding. In: Salem AZM, editor. Nutritional strategies of animal feed additives. Nova Science Publishers; 2013:115-117. 5. Macías-Cruz U, Álvarez-Valenzuela FD, Soto-Navarro SA, Águila-Tepato E, AvendañoReyes L. Effect of zilpaterol hydrochloride on feedlot performance, nutrient intake, and digestibility in hair-breed sheep. J Anim Sci 2013;91(4):1844-1849. 6. Ortiz Rodea A, Amezcua Barbosa M, Partida de la Peña JA, González Ronquillo M. Effect of zilpaterol hydrochloride on animal performance and carcass characteristics in sheep: A meta-analysis. J Appl Anim Res 2016;44(1):104-112. 7.

Macías-Cruz U, Avendaño-Reyes L, Vicente-Pérez R, Álvarez-Valenzuela FD, Correa-Calderón A, González-Ríos H, et al. Growth and carcass characteristics of lambs finished with zilpaterol hydrochloride in grazing alfalfa | Crecimiento y características de la canal de corderos finalizados con clorhidrato de zilpaterol en pastoreo de alfalfa. Rev Mex Cien Pecu 2016;7(2):243-252.

8. Mersmann HJ. Overview of the effects of beta-adrenergic receptor agonists on animal growth including mechanisms of action. J Anim Sci 1998;76(1):160-172. 9. Avendaño-Reyes L, Meraz-Murillo FJ, Pérez-Linares C, Figueroa-Saavedra F, Correa A, Álvarez-Valenzuela FD, et al. Evaluation of the efficacy of Grofactor, a beta-

648


Rev Mex Cienc Pecu 2020;11(3):638-650

adrenergic agonist based on zilpaterol hydrochloride, using feedlot finishing bulls. J Anim Sci 2016;94(7):2954-2961. 10. Iñiguez-Covarrubias G, Díaz-Teres R, Sanjuan-Dueñas R, Anzaldo-Hernández J, Rowell RM. Utilization of by-products from the tequila industry. Part 2: potential value of Agave tequilana Weber azul leaves. Bioresour Technol 2001;77(2):101-108. 11. Guerra-Medina CE, Cobos-Peralta MA, Montañez-Valdez OD, Pérez-Sato M. Uso de aserrín de pino (Pinnus patula) como fuente de fibra en dietas para borregos en cebo. Trop Subtrop Agroecosys 2010;12(3):667-673. 12. Guerra-Medina CE, Montañez-Valdez OD, Ley-de Coss A, Reyes-Gutiérrez JA, Gómez-Peña JE, Martínez-Tinajero JJ, et al. Fuentes alternas de fibra en dietas integrales para ovinos en engorda intensiva. Quehacer Cient Chiapas 2015;10(1):3-8. 13. NRC. Nutrient requirements of small ruminants: Sheep, goats, cervids, and new world camelids; 2007. 14. AOAC. Official Methods of Analysis . 15th ed. Association of Official Analytical Chemists. Arlington, VA, USA. 1990. 15. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):223-232. 16. Alves AR, Beelen PMG, de Medeiros AN, Neto SG, Beelen RN. Consumo e digestibilidade do feno de sabiá por caprinos e ovinos suplementados com polietilenoglicol. Rev Caatinga 2011;24(2):152-157. 17. NRC. Nutrient requirements of sheep. 6th ed. Washington, DC, USA: National Academy Press; 1985. 18. Avendaño-Reyes L, Macías-Cruz U, Álvarez-Valenzuela FD, Águila-Tepato E, Torrentera-Olivera NG, Soto-Navarro SA. Effects of zilpaterol hydrochloride on growth performance, carcass characteristics, and wholesale cut yield of hair-breed ewe lambs consuming feedlot diets under moderate environmental conditions. J Anim Sci 2011;89(12):4188-4194. 19. Dávila-Ramírez JL, Macías-Cruz U, Torrentera-Olivera NG, González-Ríos H, PeñaRamos EA, Soto-Navarro SA, et al. Feedlot performance and carcass traits of hairbreed ewe lambs in response to zilpaterol hydrochloride and soybean oil supplementation. J Anim Sci 2015;93(6):3189-3196. 20. Macías-Cruz U, Álvarez-Valenzuela FD, Torrentera-Olivera NG, Velázquez-Morales JV, Correa-Calderón, Robinson PH, et al. Effect of zilpaterol hydrochloride on feedlot 649


Rev Mex Cienc Pecu 2020;11(3):638-650

performance and carcass characteristics of ewe lambs during heat-stress conditions. Anim Prod Sci 2010;50(10):983. 21. SAS institute. SAS/STAT: User’s Guide Statistics Released. 2004. 22. Avendaño-Reyes L, Torrentera-Olivera NG, Correa-Calderón A, López-Rincón G, Soto-Navarro SA, Rojo-Rubio R, et al. Daily optimal level of a generic beta-agonist based on zilpaterol hydrochloride for feedlot hair lambs. Small Ruminant Res 2018;165:48-53. 23. Rivera-Villegas A, Estrada-Angulo A, Castro-Pérez BI, Urías-Estrada JD, Ríos-Rincón FG, Rodríguez-Cordero D, et al. Comparative evaluation of supplemental zilpaterol hydrochloride sources on growth performance, dietary energetics and carcass characteristics of finishing lambs. Asian-Australas J Anim Sci 2018;00(00):1-8. 24. Dávila-Ramírez JL, Macías-Cruz U, Torrentera-Olivera NG, González-Ríos H, SotoNavarro SA, Rojo-Rubio R, et al. Effects of zilpaterol hydrochloride and soybean oil supplementation on feedlot performance and carcass characteristics of hair-breed ram lambs under heat stress conditions. J Anim Sci 2014;92(3):1184-1192. 25. Estrada-Angulo A, Barreras-Serrano A, Contreras G, Obregon JF, Robles-Estrada JC, Plascencia A, et al. Influence of level of zilpaterol chlorhydrate supplementation on growth performance and carcass characteristics of feedlot lambs. Small Ruminant Res 2008;80(1-3):107-110. 25. Salinas-Chavira J, Arzola C, García-Castillo RF, Briseño DA. Approaches to the level and quality of forage in feedlot diets for lambs. J Dairy Vet Anim Res 2017;5(3):9697. 27. McIntyre AS, Thompson DG. Review article: Adrenergic control of motor and secretory function in the gastrointestinal tract. Aliment Pharmacol Ther 1992:6:125142. 28. Rojo-Rubio R, Avendaño-Reyes L, Albarrán B, Vázquez JF, Soto-Navarro SA, Guerra JE, et al. Zilpaterol hydrochloride improves growth performance and carcass traits without affecting wholesale cut yields of hair sheep finished in feedlot. J Appl Anim Res 2018;46(1):375-379. 29. López-Carlos MA, Ramírez RG, Aguilera-Soto JI, Aréchiga CF, Méndez-Llorente F, Rodríguez H, et al. Effect of ractopamine hydrochloride and zilpaterol hydrochloride on growth, diet digestibility, intake and carcass characteristics of feedlot lambs. Livest Sci 2010;131(1):23-30.

650


https://doi.org/10.22319/rmcp.v11i3.5214 Artículo

Cambios en el contenido de mioglobina en el músculo porcino Longissimus thoracis durante el almacenamiento en congelación

Jonathan Coria-Hernández a* Rosalía Meléndez-Pérez a Abraham Méndez-Albores a José Luis Arjona-Román a

a

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán. Unidad de Investigación Multidisciplinaria. Carretera Cuautitlán-Teoloyucan km 2.5, 54740, Cuautitlán Izcalli, Estado de México, México.

*Autor de correspondencia: jonathancoria@outlook.com

Resumen: En este estudio se utilizó el músculo porcino Longissimus thoracis, el cual se congeló en una cámara y descongeló bajo condiciones controladas. Se evaluó el perfil de color y la mioglobina superficial. Se realizó un análisis térmico mediante calorimetría diferencial de barrido modulada (MDSC) y espectroscopia de infrarrojo por transformada de Fourier con reflectancia total atenuada (FTIR-ATR). Se observaron efectos importantes en la mioglobina debido al proceso de congelación-descongelación en parámetros como el pH, la luminosidad (L*) y el índice de saturación, así como las energías de activación (Ea) y entalpía (ΔH) de desnaturalización entre las formas de mioglobina. En la carne cruda se encontró una mayor proporción de desoximioglobina y en las muestras congeladas-descongeladas la metamioglobina era la forma más abundante, lo que indica que hay efectos significativos que se correlacionan con los cambios en las coordenadas triestímulo y con los parámetros térmicos y químicos en la carne de cerdo. Palabras clave: Mioglobina, Congelación-descongelación, Carne de cerdo, MDSC, Perfil de color, FTIR, Espectroscopia.

651


Rev Mex Cienc Pecu 2020;11(3):651-668

Recibido: 10/01/2019 Aceptado: 24/07/2019

Introducción Debido a su composición química, la carne es un producto altamente susceptible a la degradación provocada por diversos factores, como la temperatura de almacenamiento (enfriamiento y congelación), las atmósferas modificadas y los microorganismos. Generalmente, la carne de cerdo se consume como un platillo principal o en varios subproductos como embutidos madurados y cocidos. Sin embargo, se busca prolongar su vida útil al aplicar técnicas de conservación que no alteren sus propiedades, principalmente la sensorial, que es la más importante para los consumidores(1-3). Con el aumento del consumo de carne en México y su comercialización en lugares como Asia, Europa y Sudamérica, el almacenamiento en congelación en cámaras frigoríficas ha sido el método más utilizado, ya que, entre otros factores, es económico, controla el crecimiento microbiano e inhibe las reacciones enzimáticas y el deterioro químico. El método y la velocidad de congelación son determinantes para la formación de los cristales de hielo (tamaño y geometría); sin embargo, un mal manejo del proceso puede dañar las fibras musculares o desencadenar importantes reacciones bioquímicas como proteólisis y oxidación lipídica. Esta última puede afectar de forma irreversible las propiedades fisicoquímicas y funcionales de ciertas proteínas como las miofibrilares, sarcoplásmicas y conectivas(4-6). La mioglobina es la principal proteína responsable del color de la carne; pertenece al grupo de las proteínas sarcoplásmicas, solubles en agua. La mioglobina consiste en una cadena polipeptídica (8 hélices alfa), llamada globina, y un grupo prostético hemo con un átomo de hierro en el centro. Su peso molecular varía de 14 a 18 kDa. El color de la carne está influenciado por el contenido de pigmento y por la forma química y estructura de la mioglobina. Uno de los factores que determina el color de la carne es el estado de oxidación del hierro y los compuestos (oxígeno, agua u óxido nítrico) unidos a la molécula. La termoestabilidad de esta proteína también depende del estado químico, la desoximioglobina (DMb) es la forma más estable frente a la desnaturalización por calor, seguida de la oximioglobina (OMb) y la metamioglobina (MMb). Por lo tanto, la termodinámica de las reacciones de transformación entre la DMb, OMb y MMb es bastante similar, con la excepción de la transformación de OMb a MMb(7). Este trabajo buscó evaluar los cambios que ocurren en el estado de oxidación de la mioglobina en el músculo porcino durante el almacenamiento en congelación, y sus efectos 652


Rev Mex Cienc Pecu 2020;11(3):651-668

en diversos aspectos oxidativos que pudieran afectar las características sensoriales y de calidad del sistema, como el perfil de color y la estabilidad térmica de las diferentes formas químicas de la mioglobina.

Material y métodos Preparación de las muestras

El músculo Longissimus thoracis se obtuvo de cerdos macho castrados de la raza Pietrain (6 meses de edad) con un peso aproximado de 110 ± 2 kg. Los cerdos se alojaron en un corral (4.9 × 2.0 m) con piso de cemento y una canaleta de 0.5 m de ancho en la zona de excretas. Se les ofreció agua y alimento ad libitum. Nutrición Técnica Animal S.A. de C.V. fabricó los alimentos utilizados (Cuautitlán Izcalli, Estado de México, México). No se adicionaron antibióticos u otros agentes promotores del crecimiento a las dietas. Se obtuvieron cinco piezas de músculo de la sección de la 9a. y 13a. costilla, los cortes de 1 cm3 se refrigeraron durante 24 h después del rigor mortis. Subsecuentemente, las muestras se sellaron al vacío empleando películas flexibles de polietileno de baja densidad y se congelaron en una cámara (REVCO Ultima II, New Castle DE, EE. UU.) a -18 ± 2 °C durante 24 h, después se descongelaron a 4 ± 2 °C durante 5 h en una cámara común (Nieto, México) con una humedad relativa del 70 %. Todos los experimentos se realizaron en la UNAM-FES Cuautitlán, en la Unidad de Investigación Multidisciplinaria L13 (Análisis térmico y estructural de materiales y alimentos). La extracción de la mioglobina se realizó siguiendo la metodología propuesta por Warris (8). Brevemente, se homogeneizaron 5 g de carne durante 1 min en una solución 40 mM de fosfato de potasio (pH=6.8) a 2 °C; posteriormente, los homogenizados se centrifugaron a 50,000g durante 30 min a 5 °C en una centrífuga K3 (Centurion Scientific, Reino Unido), el sobrenadante se filtró a través de un papel filtro Whatman núm. 1.

Análisis químico

El análisis químico se realizó conforme a los métodos propuestos por la Asociación de Químicos Analíticos Oficiales(9): contenido de humedad (986.21), cenizas totales (990.08), lípidos (960.39) y proteínas (977.14). El pH se determinó empleando la metodología descrita

653


Rev Mex Cienc Pecu 2020;11(3):651-668

por Koniecko(10), empleando un medidor de pH (HI99163, Hanna Instruments, RI, EE. UU.). En todos los casos se realizaron cinco repeticiones,

Perfil de color

Se utilizĂł la metodologĂ­a descrita por la American Meat Science Association (AsociaciĂłn Americana de Ciencia de la Carne)(4) empleando un espectrofotĂłmetro de reflectancia CM600d (Konica Minolta, Tokio, JapĂłn). Las condiciones de mediciĂłn fueron: iluminante acoplado tipo A (incandescente con filamento de tungsteno a 2856 K), apertura de 8 mm y un ĂĄngulo de observaciĂłn de 10°. Los valores triestĂ­mulo (L*, a* y b*) se obtuvieron de conformidad con el sistema CieLab empleando el software Spectra Magic NXâ&#x201E;˘. Los fenĂłmenos de reflectancia y absorbancia se evaluaron en el intervalo de longitud de onda de 400 a 700 nm. A partir de los datos de calculĂł el ĂĄngulo de tonalidad (°tonalidad), el Ă­ndice de saturaciĂłn (C*) y la diferencia de color total (Î&#x201D;E*)(11-14).

FracciĂłn de mioglobina superficial

La fracciĂłn de mioglobina se cuantificĂł en la superficie de la carne (perpendicular a las fibras), conforme a las recomendaciones de Tang et al(15). Se emplearon las siguientes ecuaciones: (ec. 1) đ??ˇđ?&#x2018;&#x2019;đ?&#x2018; đ?&#x2018;&#x153;đ?&#x2018;Ľđ?&#x2018;&#x2013;đ?&#x2018;&#x161;đ?&#x2018;&#x2013;đ?&#x2018;&#x153;đ?&#x2018;&#x201D;đ?&#x2018;&#x2122;đ?&#x2018;&#x153;đ?&#x2018;?đ?&#x2018;&#x2013;đ?&#x2018;&#x203A;đ?&#x2018;&#x17D; = â&#x2C6;&#x2019;0.543đ?&#x2018;&#x2026;1 + 1.594đ?&#x2018;&#x2026;2 + 0.552đ?&#x2018;&#x2026;3 â&#x2C6;&#x2019; 1.329 đ?&#x2018;&#x201A;đ?&#x2018;Ľđ?&#x2018;&#x2013;đ?&#x2018;&#x161;đ?&#x2018;&#x2013;đ?&#x2018;&#x153;đ?&#x2018;&#x201D;đ?&#x2018;&#x2122;đ?&#x2018;&#x153;đ?&#x2018;?đ?&#x2018;&#x2013;đ?&#x2018;&#x203A;đ?&#x2018;&#x17D; = 0.722đ?&#x2018;&#x2026;1 â&#x2C6;&#x2019; 1.432đ?&#x2018;&#x2026;2 â&#x2C6;&#x2019; 1.659đ?&#x2018;&#x2026;3 + 2.599

(ec. 2)

đ?&#x2018;&#x20AC;đ?&#x2018;&#x2019;đ?&#x2018;Ąđ?&#x2018;&#x17D;đ?&#x2018;&#x161;đ?&#x2018;&#x2013;đ?&#x2018;&#x153;đ?&#x2018;&#x201D;đ?&#x2018;&#x2122;đ?&#x2018;&#x153;đ?&#x2018;?đ?&#x2018;&#x2013;đ?&#x2018;&#x203A;đ?&#x2018;&#x17D; = â&#x2C6;&#x2019;0.159đ?&#x2018;&#x2026;1 â&#x2C6;&#x2019; 0.085đ?&#x2018;&#x2026;2 + 1.262đ?&#x2018;&#x2026;3 â&#x2C6;&#x2019; 0.520 đ??´582 đ?&#x2018;&#x2026;1 = đ??´525 đ??´557 đ?&#x2018;&#x2026;2 = đ??´525 đ??´503 đ?&#x2018;&#x2026;3 = đ??´525

(ec. 3)

654

(ec. 4) (ec. 5) (ec. 6)


Rev Mex Cienc Pecu 2020;11(3):651-668

AnĂĄlisis tĂŠrmico

Las muestras se analizaron con un calorímetro diferencial de barrido de temperatura modulada (DSC 2920, TA Instruments, New Castle DE, EE. UU.). El enfriamiento se llevó a cabo utilizando un sistema de enfriamiento. La calibración de la temperatura y la capacidad de calorífica se realizó utilizando el software de TA Instruments con indio (punto de fusión de 156.6 °C) y zafiro (óxido de aluminio), respectivamente. El software de anålisis universal de TA Instruments (2000V 4.5A) se utilizó para registrar y analizar todos los termogramas. Las muestras (12 ¹ 0.53 mg) se envasaron en recipientes hermÊticos de aluminio y se analizaron por triplicado al calentar en el DSC modulado a una velocidad de 5 °C/min con una temperatura modulada de 0.8 °C cada 60 s. Se utilizó nitrógeno como gas de purga a una velocidad de flujo constante de 60 ml/min. Los datos de descomposición tÊrmica se colectaron a lo largo de un intervalo de temperatura de 20 a 90 °C(6,16-18).

EnergĂ­as de activaciĂłn (Ea)

La Ea requerida para la desnaturalizaciĂłn proteica se obtuvo empleando la metodologĂ­a descrita por Coria et al(11), Calzetta y Suarez(19) y Cornillion(20). TambiĂŠn se determinĂł el orden de reacciĂłn (n), la constante de Arrhenius (Z), el grado de conversiĂłn (Îą) y la tasa de conversiĂłn (dÎą/dt) empleando las siguientes ecuaciones: dÎą đ??¸đ?&#x2018;&#x17D; (ec. 7) ln ( ) = ln Z â&#x2C6;&#x2019; n ln(1 â&#x2C6;&#x2019; Îą) â&#x2C6;&#x2019; dt RT â&#x2C6;&#x2020;Hg (ec. 8) Îą= â&#x2C6;&#x2020;Ht Donde Î&#x201D;Hg es la entalpĂ­a para cada temperatura en la zona de transiciĂłn (J g-1), y Î&#x201D;Ht es la entalpĂ­a total (J g-1). Para obtener el valor de los factores desconocidos (Z, n y Ea) se realizĂł un anĂĄlisis de regresiĂłn lineal mĂşltiple (RLM) de la ec. 7.

Espectroscopia FTIR-ATR

Los grupos funcionales en la carne se caracterizaron con el espectrofotĂłmetro Frontier SP8000 (Perkin Elmer, Waltham, MA, EE.UU.) siguiendo las recomendaciones de Coria et al(21). Brevemente, las muestras se colocaron encima del cristal de reflectancia total atenuada (ATR), los espectros se colectaron en el intervalo de 400-4000 cm-1 a una resoluciĂłn de 4 655


Rev Mex Cienc Pecu 2020;11(3):651-668

cm-1 al coadicionar 32 barridos. Se obtuvo un espectro de fondo contra el aire todos los días durante el experimento.

Análisis estadístico

El experimento se realizó como un diseño completamente aleatorizado (la unidad experimental consistió en 25 cubos de 1 cm3 tomados aleatoriamente de cinco músculos Longissimus thoracis). Los datos experimentales se sometieron a un análisis de varianza (ANOVA) de una y dos vías, las medias se separaron con la prueba de Tukey. Se utilizó una probabilidad P<0.05 para distinguir diferencias significativas empleando el software Minitab 16.0.1 (Penn State University, Pensilvania, EE. UU.). Para el análisis de regresión lineal múltiple se utilizó el software Origin Pro 8 (OriginLab Corp., Northampton, MA, EE. UU.).

Resultados y discusión Análisis químico

La composición química de la carne cruda y descongelada se muestra en el Cuadro 1. Los resultados son similares a los reportados por Meléndez et al(6) y Karamucki et al(22). Se observan diferencias significativas en el contenido de humedad (P<0.05) entre los tratamientos. El proceso de congelación ocasiona la formación de largos cristales que rompen las fibras de carne; por lo que, en estas muestras se perdió cierta cantidad de agua por exudación. Además, la pérdida de agua en las muestras descongeladas también ejerció un efecto importante en la disminución del contenido de cenizas, pero no en el de proteínas o lípidos, como reportaron anteriormente Karamucki et al(22). Cuadro 1: Composición química de la carne cruda y descongelada Descongelada Componente Cruda a 74.86±0.46b Humedad 75.30±1.19 22.64±1.12a Proteínas 21.83±2.54a 1.96±0.20a Lípidos 1.87±0.09a 0.54±0.11b Cenizas 1.0±0.03a ab

Media ± desviación estándar Las medias con diferente letra en la misma fila son estadísticamente diferentes (P<0.05).

656


Rev Mex Cienc Pecu 2020;11(3):651-668

pH

Se observaron diferencias significativas (P<0.05) en el valor de pH de la carne congeladadescongelada en comparación con la carne cruda, con valores de 5.69 ± 0.08 y 5.63 ± 0.17, respectivamente. Por lo tanto, se confirmó que este proceso de conservación produce cambios importantes; entre ellos, las modificaciones en la dinámica redox de la mioglobina debido a una disminución en la formación de ácido láctico a partir del glucógeno muscular por glucogenólisis anaerobia(23). Esto genera diversas interconversiones, las cuales alteran la estructura de la carne y, por lo tanto, ocurren cambios importantes en la apreciación del color; esto conlleva a defectos en la calidad y resulta en la formación de carne PSE (pálida, suave y exudativa) o DFD (oscura, firme y seca)(24). Según Krzywicki(25), la disminución de los valores de pH está generalmente acompañada por una disminución en la profundidad de penetración de la luz y un aumento de la reflectancia, lo que genera un aumento en la luminosidad (L*) y una disminución en la cantidad de la forma reducida de la mioglobina (DMb). Al mismo tiempo, los valores más bajos de pH también están relacionados con una mayor susceptibilidad de los pigmentos musculares a la oxigenación y oxidación y, en consecuencia, la formación de mayores cantidades de OMb y MMb.

Perfil de color

Las medias de los parámetros del perfil de color se muestran en el Cuadro 2. Para la carne cruda, los valores de L*, a* y b* son similares a los reportados en otros estudios (26-30). En general, el proceso de congelación-descongelación genera cambios significativos en la coordenada de luminosidad (L*). Los cristales de hielo intra- y extracelulares tienen un ángulo molecular de 109.45° entre los átomos de hidrógeno(31,32); este ángulo fue diferente al que se observa en el agua líquida (104.50°), lo que genera rupturas en las fibras de carne y algunos enlaces, permitiendo así la salida de exudados. Además, el valor de L* depende de la cantidad total de luz absorbida y reflejada por la superficie de la carne. Por lo tanto, el impacto de la absorción y reflectancia en la apreciación de la luminosidad del color varía dependiendo del contenido de pigmento en el tejido y su estructura. Es bien conocido que el contenido relativo de la forma química de la mioglobina en la superficie de la carne también influye la coordenada L*(22). La coordenada a* generalmente se correlaciona con una coloración rojiza. En esta investigación, el valor promedio de a* fue ligeramente más alto en la carne descongelada, lo que se atribuye al hecho de que la mioglobina superficial sufrió modificaciones cuando las reacciones redox ocurrieron por efectos del tiempo en los procesos de congelación-descongelación. Se observó el mismo fenómeno en la coordenada b*. Según Lesiów y Xiong(27) y Skrlep y Candek-Potokar(30), el ángulo de la tonalidad para la carne 657


Rev Mex Cienc Pecu 2020;11(3):651-668

color rosa o rojo debe estar dentro del intervalo de 0 y 90°. En esta investigación, el proceso de congelación-descongelación afecta de forma significativa la tonalidad de la carne. Los valores obtenidos del índice de saturación (C*) coinciden con los reportados por otros investigadores(23,30). Las diferencias en el índice de saturación fueron estadísticamente significativas, lo que indica que los cambios en la saturación del color son imperceptibles. La diferencia de color total (ΔE*) entre la carne cruda y la congelada-descongelada tiene un valor promedio de 3.63 ± 0.68, lo que indica que el proceso de cristalización-fusión genera cambios en las tres coordenadas del perfil de color. Sin embargo, según la AMSA(4) y Chmiel et al(33), hasta 5 unidades en la diferencia de color total no eran perceptibles para el ojo humano. Cuadro 2: Parámetros del perfil de color en el sistema CieLab de la carne cruda y descongelada Ángulo de Muestra L* a* b* C* tonalidad Cruda 51.30±0.48a 4.98±1.14a 5.23±1.03a 46.38±3.51a 7.22±1.48a Descongelada 50.91±1.75b 5.39±0.90b 7.91±0.94b 55.76±5.20b 9.57±0.98b ab

Media ± desviación estándar. Las medias con diferente letra en la misma columna son diferentes (P<0.05).

La Figura 1-a muestra el espectro de reflectancia de la carne cruda y descongelada, la banda característica entre 500 y 600 nm corresponde a la mioglobina en su estado no oxidado (4). También es importante resaltar que las diferencias entre las muestras fueron significativas (P<0.05). Las muestras descongeladas presentaron cierta cantidad de líquidos exudados, lo que generó valores de reflectancia ligeramente inferiores. La luz juega un papel importante en la apreciación del color, ya que el fenómeno de palidez en la carne PSE se puede explicar por la contracción de las miofibrillas debido a bajos valores de pH, lo que aumenta la diferencia del índice de refracción y la reflectancia en la superficie de la carne(34), contrario a la carne congelada-descongelada. Existen varias teorías que establecen que la palidez se origina principalmente por la desnaturalización en frío y la precipitación de las proteínas miofibrilares y sarcoplásmicas(6). Aunado a esto, la mioglobina en la carne PSE de cerdo es muy susceptible a la desnaturalización en frío, lo que genera un pequeño cambio en la estructura helicoidal, modificando sus propiedades ópticas.

658


Rev Mex Cienc Pecu 2020;11(3):651-668

Figura 1: Espectros de la carne cruda y descongelada, curvas de (a) reflectancia, (b) absorbancia

Fracción de mioglobina superficial

Los espectros de absorbancia también se muestran en la Figura 1-b. En general, las muestras que presentan daño estructural debido a los procesos de congelación-descongelación muestran fuertes bandas de absorción. Este fenómeno fue posible debido a las rupturas de las fibras por la cristalización del agua. Este efecto genera diferencias en la superficie, lo que se refleja en cambios en los parámetros del perfil de color y la apreciación visual(4). Comúnmente, la absorbancia de la mioglobina en sus diferentes formas es de 503, 525, 557 y 582 nm. Conforme a los valores que se presentan en el Cuadro 3, en la carne cruda, la mayor cantidad de mioglobina se encontró en la forma de DMb, no se observaron alteraciones en su estructura. El proceso de enfriamiento de la carne después de la matanza tuvo efectos significativos que modifican la estructura de la proteína sarcoplásmica. En las muestras congeladas-descongeladas, la mioglobina se encontraba principalmente en su forma reducida MMb. El tratamiento calorífico y el contacto con la atmósfera aumentaron el valor del pH, lo que causó diferencias entre las muestras(34). Según Cho y Choy(35), la estabilidad conformacional de la molécula de mioglobina está fuertemente afectada por la unión del grupo hemo a la cadena polipeptídica. Los autores sugieren que la estructura del átomo de hierro es el principal factor que afecta la estabilidad de esta proteína en particular.

659


Rev Mex Cienc Pecu 2020;11(3):651-668

Cuadro 3: Fracción de las moléculas de mioglobina en la carne de cerdo Cruda Desoximioglobina Oximioglobina Metamioglobina ab

Descongelada a

0.3884±0.0023 0.2282±0.0021a 0.3843±0.0019a

0.3429±0.0006b 0.2769±0.0018b 0.3760±0.0012b

Media ± desviación estándar Las medias con diferente letra en la misma fila son diferentes (P<0.05).

En el intervalo de pH de la carne después de la matanza ocurrieron cambios en el índice de refracción miofibrilar; en consecuencia, la reflectancia aumentó y disminuyó. Conforme disminuye el pH, la absorbancia cambia de forma inversamente proporcional a la reflectancia. La fuerte birrefringencia intrínseca de las miofibrillas no contribuye necesariamente a la reflectancia y absorbancia, pero este fenómeno depende directamente de la cantidad de agua en la superficie y el estatus químico de la molécula de mioglobina(34,35).

Análisis térmico por MDSC

Se ha reportado que la temperatura de desnaturalización de la mioglobina está entre los 60 y 70 °C(35-38). La Figura 2 presenta el termograma del flujo de calor y el calor específico (Cp) para el extracto de mioglobina. La transición observada se presentó a una temperatura inicial (To) de 63.51 °C, la temperatura de desnaturalización (Tp) fue 68.58 °C con una entalpía (ΔH) de 1.334 J g-1. Se observaron cambios importantes en los valores de Cp, lo que indica que el proceso modifica de forma significativa la estructura de la proteína. Figura 2: Flujo de calor y calor específico (Cp) del extracto de mioglobina

660


Rev Mex Cienc Pecu 2020;11(3):651-668

En el caso de la carne cruda y congelada-descongelada, el termograma del flujo de calor (Figura 3-a) muestra las transiciones principales de las proteínas. Se observaron diferencias significativas entre los valores de flujo de calor. Estas endotermas están asociadas sin excepción a los fenómenos de desnaturalización de proteínas (miosina, actina y mioglobina)(6,17,39,40).

Figura 3: (a) Flujo de calor, (b) Flujo de calor derivado como una función de la temperatura de la carne cruda y descongelada

En la gráfica de la derivada del flujo de calor (Figura 3-b) no ocurrieron cambios significativos, por lo que, se observaron únicamente efectos de desnaturalización de la miosina, actina y proteínas sarcoplásmicas. Los valores de To, Tp y ΔH de cada transición se resumen en el Cuadro 4. En general, el valor de To de la carne descongelada fue menor que el de la carne cruda. El valor de ΔH para la desnaturalización proteica fue significativamente diferente (P0.05) entre las muestras de carne cruda y congelada-descongelada. La mioglobina, en su estructura nativa, no se vio afectada por el proceso de congelacióndescongelación, pero las pequeñas diferencias en las temperaturas de transición y las entalpías de desnaturalización podrían ser el resultado de la transformación química de la DMb en la carne cruda a la MMb en la carne congelada-descongelada.

661


Rev Mex Cienc Pecu 2020;11(3):651-668

Cuadro 4: Temperaturas (inicial y máxima) y entalpías de la carne cruda y descongelada Cruda To (°C) Tp (°C) ΔH (J g-1) To (°C) Tp (°C) ΔH (J g-1) To (°C) Tp (°C) ΔH (J g-1)

Miosina

Mioglobina

Actina

ab

Descongelada a

50.09±2.53 55.07±1.98a 0.16±0.05a 59.75±1.34a 65.34±3.43a 0.25±0.04a 73.32±1.12a 77.88±1.28a 0.22±0.07a

48.12±1.88b 53.38±2.01b 0.26±0.03b 59.36±1.55b 64.49±2.26b 0.24±0.06b 72.01±1.01ab 76.59±1.46ab 0.36±0.09b

Media ± desviación estándar. Las medias con diferente letra en la misma fila son diferentes (P<0.05).

En el caso de la carne congelada-descongelada, la MMb se encontraba en la más alta proporción (Cuadro 3). Por lo tanto, había una disociación reversible en el grupo hemo y la apoproteína, que es más factible en esta forma química de la mioglobina. Por lo que, la Tp de la mioglobina en la carne descongelada cambia a una temperatura menor y la ΔH disminuye, aunque la mioglobina se encontraba en su mayoría en el estado no oxidado (DMb). Estos resultados sugieren que las moléculas de agua, antes y después de la congelación, contribuyen a la estabilidad conformacional de la molécula de mioglobina(1). En este contexto, Chaijan et al(1), Ledward(37) y Atanasov y Mitova(41) reportaron que el valor de Tp de la mioglobina cambia a una menor temperatura cuando la formación de la MMb aumenta durante la refrigeración de la carne. Los autores concluyeron que la DMb es la forma más estable frente al calor, seguida por la OMb y la MMb, respectivamente. Los resultados coinciden con los reportados en esta investigación. En los estudios de MDSC, los cambios estructurales en las proteínas se pueden obtener a partir del flujo de calor mediante el valor de Cp, que se calcula de la relación de la amplitud modulada del flujo de calor y la amplitud modulada de la transformada discreta de Fourier(42). Los termogramas para la carne cruda y descongelada se presentan en la Figura 4. Se puede observar que ocurrieron cambios similares en la estructura proteica; sin embargo, estás variaciones fueron solo de magnitud.

662


Rev Mex Cienc Pecu 2020;11(3):651-668

Figura 4: Calor específico (Cp) de la carne cruda y descongelada

Energías de activación (Ea)

Las energías de activación necesarias para la desnaturalización proteica se obtuvieron mediante el análisis MLR. Los valores para el extracto de mioglobina, la carne cruda y las muestras descongeladas fueron 393.24 ± 2.14, 305.71 ± 3.74 y 327.89 ± 3.05 kJ mol-1, respectivamente. En general, la Ea mostró variaciones significativas atribuibles a varios factores, incluyendo la concentración de las proteínas desnaturalizadas y no desnaturalizadas, así como la modificación estructural de las proteínas cuando se someten al proceso de congelación. Bajo estas condiciones ocurrieron cambios conformacionales, los cuales desencadenaron una variación en la energía de activación, que también influye en la cantidad de proteínas solubles, como la mioglobina. Además, las variaciones en los valores de la Ea podrían atribuirse a las reacciones de oxigenación de la mioglobina por el aire, así como a los cambios estructurales que ocurrieron de la DMb a la MMb. Las reacciones redox modifican la estructura de la proteína; generalmente, la MMb requiere más energía y menos temperatura para iniciar el proceso de desnaturalización (Figura 3-a y 4). Aunque la MMb es menos termoestable; por lo que, se requiere más energía para desencadenar modificaciones conformacionales.

663


Rev Mex Cienc Pecu 2020;11(3):651-668

Espectroscopia FTIR-ATR

La Figura 5 muestra los espectros FTIR-ATR, los cuales se colectaron en el intervalo de 4000-400 cm-1. La banda característica alrededor de los 3,280 cm-1 está asociada con las vibraciones de estiramiento de las moléculas de agua (OH-) y la vibración del NH en las amidas secundarias. La información sobre los cambios bioquímicos que ocurren durante el proceso de congelación-descongelación se proporciona en el intervalo de 1,750-1,000 cm1(43) . La banda a 1,640 cm-1 indica la presencia de amidas primarias en la estructura molecular de la α-hélice en la DMb. La banda a 1,550 cm-1 fue asignada a las vibraciones en las amidas secundarias (estiramiento entre CN) de la molécula de mioglobina. Esta banda única parece ser más fuerte en la carne descongelada que en la carne cruda, lo que indica una mayor cantidad de grupos amida. Además, se observó un modo de vibración de estiramiento de amidas C-N a 1,398 cm-1. A 1,311 y 1,246 cm-1 hubo estiramiento C-N en las aminas, principalmente de la mioglobina y proteínas miofibrilares, y a 1,165 y 1,128 cm-1 se presentaron vibraciones de aminas, aminoácidos y estiramiento C-N. Estas bandas fueron más intensas después de los procesos de congelación-descongelación debido a la existencia de moléculas de agua. Finalmente, hubo cambios importantes entre la región de 1,292-1,371 cm-1, que pertenece a las aminas y amidas terciarias de proteínas solubles(44,45). Figura 5: Espectro FTIR-ATR de (a) carne cruda, (b) carne descongelada

664


Rev Mex Cienc Pecu 2020;11(3):651-668

Conclusiones e implicaciones El proceso de congelación-descongelación tiene efectos significativos en la forma de la mioglobina, estos a su vez producen importantes cambios en la termodinámica, las energías de activación y los grupos funcionales, todos asociados con cambios en el color de la carne.

Agradecimientos Los autores agradecen a la UNAM el apoyo económico para esta investigación a través de los proyectos PAPIIT IT201417 y PIAPI 1806 y 1820. Jonathan Coria-Hernández también agradece al CONACYT por la beca para estudios de Doctorado (447128).

Literatura citada: 1. Chaijan M, Benjakul S, Visessanguan W, Faustman C. Characterization of myoglobin from sardine (Sardinella gibbosa) dark muscle. Food Chem 2007;100:156-164. 2. Kerth CR. The science of meat quality. USA: Wiley – Blackwell Ed.; 2013. 3. Zhou GH, Xu XL, Liu Y. Preservation technologies for fresh meat – A review. Meat Sci 2010;86:119-128. 4. AMSA. Meat color measurement guidelines. USA: American Meat Science Association. 2012. 5. Berk Z. Food process engineering and technology. 2nd ed. United Kingdom: Elsevier; 2013. 6. Meléndez PR, Arjona RJL, Velázquez CRR, Méndez AA, Vázquez DA. On the thermal properties of frozen, refrozen and freeze drying porcine Longissimus dorsi. J Anim Vet Adv 2011;10(22):2956-2960. 7. Mancini RA, Hunt MC. Current research in meat color. Meat Sci 2005;71:100-121. 8. Warris PD. The extraction of ham pigments from fresh meat. J Food Technol 1979;14:7580.

665


Rev Mex Cienc Pecu 2020;11(3):651-668

9. AOAC. Official methods of analysis 17th. ed. Arlington, VA, USA: Association of Official Analytical Chemists. 2000. 10. Koniecko ES. Handbook for Meat Chemists. USA: Avery Publishing Group Inc. Wayne; 1979. 11. Coria HJ, Meléndez PR, Rosas MME, Llorente BA, Arjona RJL. Analysis of the color profile and shear force in ultrasonicated pork meat (Longissimus thoracis). Arctic J 2017;70(7):16-30. 12. Porras BLD, González HMI, Ochoa GOA, Sotelo DLI, Camelo MGA, Quintanilla CMX. Colorimetric image analysis as a factor in assessing the quality of pork ham slices during storage. Rev Mex Ing Quím 2015;14(2):243-252. 13. Tapp WN, Yancey JWS, Apple JK. How is the instrumental color of meat measured? Meat Sci 2011;89:1-5. 14. Yancey JWS, Kropf DH. Instrumental reflectance values of fresh pork are dependent on aperture size. Meat Sci 2008;79:734-739. 15. Tang J, Faustman C, Hoagland TA. Krzywicki revisited: Equations for spectrophotometric determination of myoglobin redox forms in aqueous meat extracts. J Food Sci 2004;69(9):717-720. 16. Agama AE, Bello PLA, Pacheco VG, Evangelista LS. Inner structure of plantain starch granules by surface chemical gelatinization: Morphological, physicochemical and molecular properties. Rev Mex Ing Quím 2015;14(1):73-80. 17. Coria HJ, Meléndez PR, Rosas MME, Llorente BA, Arjona RJL. Activation energy for protein denaturation in frozen and freeze-dried pork meat (Longissimus thoracis) by MDSC. Interciencia J 2017;47(7):22-32. 18. Zamudio FPB, Tirado GJM, Monter MJG, Aparicio SA, Torruco U, Salgado DR, Bello PLA. In vitro digestibility and thermal, morphological and functional properties of flours and oat starches of different varieties. Rev Mex Ing Quím 2015;14(1):81-97. 19. Calzetta AR, Suarez C. Gelatinization kinetics of amaranth starch. Int J Food Sci Technol 2001;36:441-448. 20. Cornillon P. Characterization of osmotic dehydrated Apple by NMR and DSC. LWT Food Sci Technol 2000;33:261-267. 21. Coria HJ, Méndez AA, Meléndez PR, Rosas MME, Arjona RJL. Thermal, structural, and rheological characterization of waxy starch as a cryogel for its application in food processing. Polymers 2018;10(359):1-13. 666


Rev Mex Cienc Pecu 2020;11(3):651-668

22. Karamucki T, Jakubowska M, Rybarczyk A, Gardzielewska J. The influence of myoglobin on the colour of minced pork loin. Meat Sci 2013;94:234-238. 23. Brewer MS, Zhu LG, Bidner B, Meisinger DJ, McKeith FK. Measuring pork color: effects of bloom time, muscle, pH and relationship to instrumental parameters. Meat Sci 2001;57:169-176. 24. Honikel KO. pH measurement. Encyclopedia of Meat Sciences, Vol. 1. United Kingdom: Elsevier; 2014. 25. Krzywicki K. Assement of relative content of myoglobin, oxymyoglobin and metmyoglobin at the surface of beef. Meat Sci 1979;3:1-10. 26. Irie M, Swatland HJ. Relationships between Japanese pork color standards and optical properties of pork before and after frozen storage. Food Res Int 1992;25:21-30. 27. Lesiów T, Xiong YL. A simple, reliable and reproductive method to obtain experimental pale, soft and exudative (PSE) pork. Meat Sci 2013;93:489-494. 28. Lindahl G, Karlsson AH, Lundström K, Andersen HJ. Significance of storage time on degree of blooming and colour stability of pork loin from different crossbreeds. Meat Sci 2006;72:603-612. 29. Lindahl G, Lundström K, Tornberg E. Contribution of pigment content, myoglobin forms and internal reflectance to the colour of pork loin and ham from pure breed pigs. Meat Sci 2001;59:141-151. 30. Skrlep M, Candek-Potokar M. Pork color measurement as affected by bloom time and measurement location. J Muscle Foods 2006;18:78-87. 31. Gap-Don K, Eun-Young J, Hyun-Jung L, Han-Sul Y, Seon-Tea J, Jin-Yeon J. Influence of meat exudates on the quality characteristics of fresh and freeze-thawed pork. Meat Sci 2013;95:323-329. 32. Kasaai MR. Use of water properties in food technology: A global view. Int J Food Prop 2014;17:1034-1054. 33. Chmiel M, Słowiński M, Dasiewicz K. Lightness of the color measured by computer image analysis as a factor for assessing the quality of pork meat. Meat Sci 2011;88:566580. 34. Swatland HJ. Spectrophotometry of beef muscle and adipose tissue during heating and cooling. J Muscle Foods 1997;8(1):1-12.

667


Rev Mex Cienc Pecu 2020;11(3):651-668

35. Cho KC, Choy CL. Thermal stability of hemoglobyn and myoglobin. Biochim Biophys Acta 1980;622:320-330. 36. Doster W, Bachleitner A, Dunau R, Hiebl M, Lüscher E. Thermal properties of water in myoglobin crystals and solutions at subzero temperatures. Biophys J 1986;50:213-219. 37. Ledward DA. Scanning calorimetric studies of some protein-protein interactions involving myoglobin. Meat Sci 1978;2:241-249. 38. Privalov PL, Griko YV, Venyaminov SY. Cold denaturation of myoglobin. J Mol Biol 1986;190:487-498. 39. Dina JB, Barón PJ, Zaritzky NE. Mathematical modeling of the heat transfer process and protein denaturation during the thermal treatment of Patagonian marine crabs. J Food Eng 2012;113:623-634. 40. Kazemi S, Ngadi OM, Gariépy C. Protein denaturation in pork Longissimus muscle of a different quality groups. Food Bioprocess Technol 2011;4:102-106. 41. Atanasov BP, Mitova SV. Thermal denaturation of Delphinus delphis ferromyoglobin derivates in alkaline pH regions. Biochim Biophys Acta 1971;243:457-466. 42. Verdonck E, Schaap K, Thomas LC. A discussion of the principles and applications of Modulated Temperature DSC (MTDSC). Int J Pharm 1997;192:3-20. 43. Wang Y, Boysen RI, Wood BR, Kansiz M, McNaughton D, Hearn MTW. Determination of the secondary structure of proteins in different environments by FTIR-ATR spectroscopy and PLS regression. Byopolymers 2008;89(11):895-905. 44. Prieto N, Roehe R, Lavín P, Batten G, Andrés S. Application of near infrared reflectance spectroscopy to predict meat and meat products quality: A review. Meat Sci 2009;83:175-186. 45. Uddin M, Okazaki E, Ahmad MU, Fukuda Y, Tanaka M. NIR spectroscopy: A nondestructive fast technique to verify heat treatment of fish-meat gel. Food Control 2006;17:660-664.

668


https://doi.org/10.22319/rmcp.v11i3.5798 Artículo

Indicadores de competitividad de la carne bovina de México en el mercado mundial

Miguel Ángel Magaña Magaña b Carlos Enrique Leyva Morales a* Juan Felipe Alonzo Solís a Carlos Gabriel Leyva Pech a

a

Universidad Autónoma de Yucatán. Facultad de Economía. Km 1 carretera Mérida-Tizimin, Cholul, Yucatán, México. b

Tecnológico Nacional de México/Instituto Tecnológico de Conkal. Conkal, Yucatán, México.

Autor de correspondencia: clmoral@correo.uady.mx

Resumen: El presente trabajo tiene por finalidad evaluar la posición y tendencia de la competitividad de la carne bovina en canal de México frente a la oferta externa, como la relación entre esta ventaja mercantil, la producción y la exportación nacional, que permitan proponer estrategias que potencialicen la ganadería en el mediano plazo. Para lograr este objetivo se calcularon cuatro indicadores de competitividad tomando en cuenta el procedimiento postulado por el Instituto Interamericano de Cooperación para la Agricultura, y el grado de asociación entre variables se determinó con el coeficiente de Pearson. El volumen de oferta primaria de carne bovina posiciona a México en el séptimo lugar mundial, mientras que como exportador se coloca en el quinceavo puesto; se halló que la exportación del país de este cárnico tiene como destino mayoritario el mercado de los Estados Unidos de América, y que la producción nacional presenta un bajo nivel de competitividad en el mercado internacional. En el comportamiento de la producción y exportación de la carne bovina mexicana influyen factores que se vinculan con las características del mercado y del proceso comercial, así como 669


Rev Mex Cienc Pecu 2020;11(3):669-685

con fenómenos naturales, los cuales determinan tanto la productividad, como la generación de saldos exportables de carne en canal y de valor para la economía del país. Palabras clave: Competitividad, Exportación, Ganadería bovina, Carne en canal.

Recibido: 22/08/2018 Aceptado: 05/07/2019

Introducción Desde la perspectiva macroeconómica, la competitividad es la capacidad de un sector productivo, como el de la ganadería bovina de carne en canal de México, para enfrentar la competencia mundial(1), esto implica que pueda vender en los mercados externos, que tenga la cualidad y eficiencia tanto para producir y mantener niveles crecientes de ganancias de sus recursos, así como minimizar el efecto de las importaciones. Así, la inclusión y duración de un producto en el mercado mundial dependen de su nivel de competitividad, en el que intervienen factores como la productividad y características del producto(2), movimientos de la tasa de cambio(3), disponibilidad de infraestructura para la comercialización y la dotación de factores productivos con bajos costos relativos(4). De acuerdo con FAO(5), en 2014 la producción mundial de carne bovina fue de 64.7 millones de toneladas, de los cuales Estados Unidos concentró el 17.7 %, le siguen Brasil (15.0 %), China (10.2 %), Argentina (4.13 %) y Australia (4 %). En el citado año, México fue el sexto productor de esta carne, participando con 2.8 %; en el comercio exterior, en 2013 ocupó el quinceavo lugar en exportación. Por otra parte, los principales países importadores de carne bovina en 2013 fueron Italia con 257.9 mil t, seguido por Países Bajos (214.1 mil t), Alemania (141 mil t), Francia (120.9 mil t) y China (104.2 mil t). La evolución del mercado mundial de la carne bovina y la competitividad que presentan los países participantes en éste, ejercen una influencia sobre la dinámica de la ganadería bovina de México, con lo cual se tienen repercusiones positivas o negativas, dependiendo del nivel de su competitividad. Lo anterior es relevante debido a que la ganadería es una actividad de importancia económica y, dentro de ésta, la producción de carne es la más productiva y practicada en todo el país; debido a que proporciona importantes materias primas, divisas y empleos, que se traducen en un mayor bienestar social de la población. Así lo evidencian las estadísticas correspondientes, las cuales muestran que de 1990 al 2000 el volumen de la producción y exportación de este cárnico exhibieron en lo general un comportamiento en 670


Rev Mex Cienc Pecu 2020;11(3):669-685

sentido opuesto; la primera creció en 26.5 % mientras que la segunda decayó 5.9 %; para el período 2001 a 2013 la producción creció (25.1 %) al igual que la exportación (6,928.2 %) de manera muy significativa(5,6). La situación descrita, trajo consecuencias benéficas en el subsector pecuario y en la economía nacional. Entre éstas destacan su efecto sobre el nivel de ingresos que se generan en poco más de un millón de unidades productoras; la creación de 1.1 millones de empleos directos y de 3 millones en forma indirecta(7) y, en la producción de carne bovina superior a los 24 mil millones de dólares. Esta última cifra representó el 23.70 % del valor de la producción pecuaria nacional del año 2013(6). Sin embargo, bajo el contexto anterior, la competitividad de la carne bovina de México en el mercado mundial, se refleja en la oferta exportable de sólo 0.8 % de la producción (20002013), mientras que el volumen de importaciones representó el 0.7 % del consumo nacional aparente. Estas participaciones evidencian que el mercado externo es pequeño, pero el superávit de la balanza comercial indica que existen condiciones favorables para mejorar la posición de México; por ello, y para contribuir a la escasa información respecto a este tema, el presente trabajo plantea evaluar la posición y tendencia de la competitividad que presenta la carne bovina en canal mexicana frente a la oferta externa de los países productores más importantes, como la relación que se establece entre esta ventaja mercantil, la producción y la exportación, que permitan proponer estrategias de acción que potencialicen la actividad ganadera en el mediano plazo.

Material y métodos El método general que se utilizó fue el deductivo de corte longitudinal de tendencia, y basado en parámetros estimados de información indirecta; la principal fuente fue el FAOSTAT(5) y la complementaria el SIACON(6). Los parámetros de interés, por su nivel de alcance y cobertura, son los considerados como indicadores de resultado o ex post(8), ya que permiten el análisis del comportamiento de un producto final proveniente de los eslabones de una cadena productiva en relación con los respectivos productos de los competidores extranjeros, esto, tanto en los mercados internos como externo. La medición del nivel de competitividad se llevó a cabo mediante cuatro índices cuyo cálculo se realizó con base en los procedimientos propuestos por el Instituto Interamericano de Cooperación para la Agricultura (IICA), en tanto que los parámetros complementarios, de carácter descriptivo o correlacional entre variables, se estimaron de acuerdo con Levin y Rubin(9). Los índices de interés se describen a continuación: 671


Rev Mex Cienc Pecu 2020;11(3):669-685

1. Indicador de Transabilidad (IT). Este mide la relación entre la balanza comercial neta y el consumo nacional aparente (CNA) de un país, es decir la participación de las exportaciones o las importaciones en el consumo de un producto. Su fórmula de cálculo: Tij = (Xij – Mij) / (Qij+Mij-Xij) Donde: Xij = exportaciones del producto i del país j; Mij = importaciones del producto i del país j; Qij = producción del bien i en el país j. Este índice tiene dos indicadores auxiliares: el grado de apertura exportadora y el grado de penetración de importaciones. 2. Indicador de Balanza Comercial Relativa (IBCR). Mide el balance comercial entre países respecto al mismo bien, y permite establecer el grado de ventaja o desventaja comparativa existente. Fue propuesto por Bela Balassa como variante del Índice de GrubellLloyd(10). Algebraicamente se representa como: BCR= (Xij – Mij) / (Xij + Mij), Donde: Xij = Exportaciones de un producto i por un país j al mercado mundial; Mij = Importaciones de un producto i por un país j al mercado mundial. Refleja ventaja competitiva cuando es positivo y desventaja cuando es negativo. 3. Especialización Internacional o de Lafay (EI). Este mide la relación entre la balanza comercial neta y las exportaciones mundiales de un producto, permite evaluar la vocación exportadora y la capacidad que tiene un país para construir ventajas competitivas permanentes. Se calcula mediante la siguiente expresión: IE = (Xij – Mij) / Xim Donde: Xim = Exportaciones del bien i realizadas por el mundo. Cuando este índice vale uno o 100%, el país es el único exportador, pero si es negativo no presenta algún grado de especialización y tiene dificultades competitivas. 4. Ventaja Comparativa Revelada (VCR). Este índice compara la eficiencia en el uso de los recursos en el tiempo tanto para la producción como para el consumo de todos los bienes de un país, revelada por su flujo comercial y donde es más eficiente aquel con el menor costo de oportunidad(11). Representa el resultado de la asignación de éstos en la economía y refleja su posición de especialización en el mercado. Se expresa como: VCRia = VCEia - VCIia Donde: VCE = ventaja comparativa revelada de las exportaciones; VCI = ventaja comparativa revelada de las importaciones. Estos componentes de la VCR se calcularon mediante las ecuaciones: VCEia = In [( Xia / Xin) / (Xra / Xrn)] VCIia = In [(Mia / Min) / (Mra / Mrn)] Las letras X y M expresan el valor de las exportaciones e importaciones; el subíndice (n) es el valor del comercio de todas las mercancías de todos los sectores menos el producto de interés (a); el superíndice (r) alude al valor del comercio del mundo menos el del país de referencia (i) y la expresión (ln) indica el logaritmo natural. Los posibles resultados en el VCR dependen del valor combinado del VCI y el VCE y son: 672


Rev Mex Cienc Pecu 2020;11(3):669-685

1. VCE>0, VCI<0; VCR>0. El país muestra ventaja comparativa en exportaciones de un producto y desventaja comparativa en importaciones, lo que resulta en un VCR positivo. 2. VCE>0, VCI>0; VCR> o <0. Existen ventajas comparativas en la exportación e importación, el VCR será mayor o menor que cero si VCE es mayor o menor que el VCI. 3. VCE<0, VCI>0; VCR<0. El país muestra desventaja comparativa en la exportación y ventaja comparativa en la importación, y el VCR es negativo. 4. VCE<0, VCI<0; VCR<0. Evidencia desventaja comparativa tanto en la exportación como en la importación de un producto, y el VCR puede ser positivo o negativo. El significado del VCR es ambiguo y puede conducir a errores de interpretación, por ejemplo un valor positivo indica que el país no interviene en forma significativa en el comercio mundial de exportaciones o importaciones(12).

Resultados Producción y balanza comercial mexicana de carne bovina

El volumen de producción de la carne bovina en canal en México presenta una tendencia general hacia la alza de 1990 a 2013 (Figura 1), su crecimiento fue del 62.2 %, y pasó de 1,114 a 1,806.8 mil toneladas, con un volumen promedio anual de 1,554.6 mil toneladas(6). Sin embargo, el nivel de rendimiento de carne en canal por animal (204.7 kg en el período 2004-2013) ubicó al país en el lugar 69 en productividad.

673


Rev Mex Cienc Pecu 2020;11(3):669-685

Figura 1: Producción y exportación de carne bovina de México 2000000

Toneladas

1500000 1000000 500000 0 -500000

Años Producción

Exportación

En el mercado mundial, el país se caracterizó por ocupar el quinceavo lugar como exportador de esta carne en el citado período, Polonia encabeza esta lista; en tanto en el continente americano se posicionó en el segundo puesto. El volumen promedio anual de las exportaciones mexicanas fue de 17.9 mil toneladas y representó el 1.2 % de la producción nacional. Esta cifra representó un avance notable, dado que en el primer quinquenio de la década de los noventa éste era casi inexistente, del 0.004%(5,6). La participación promedio de la oferta exportable de México al mercado mundial de carne bovina en el período 2004-2013 fue del 1.1% y, con respecto al continente americano, ésta fue del 10 %. Cabe mencionar que la región de América sólo aporta el 11.1 % de la exportación mundial de esta carne, la cual es liderada por la zona de Europa (80.1 %). Los principales destinos de la oferta exportable de carne bovina en canal de México en el año 2013(5), fueron los Estados Unidos de Norteamérica (95.5 %), Vietnam (2.7 %) y Japón (0.6 %). En tanto que, en 2004, Estados Unidos captó el 87.5 % de esta exportación, y la República de Corea (12 %) fue el otro destino de importancia. El primer país citado es el principal importador de esta carne en el mundo, y hacia él se canalizó en promedio el 97 % del total de las exportaciones nacionales en el período de estudio. En lo que respecta a la balanza comercial de la carne bovina en México del 2004 al 2013, el volumen de las exportaciones fue ascendente y creció 37.1 %, las importaciones también crecieron (58.9 %); pero al ser mayor el volumen de las exportaciones en relación con las importaciones, la balanza fue superavitaria (promedio anual de 23.9 mil t). Sin embargo, la mayor dinámica de las importaciones evidencia la existencia de una pérdida de competitividad de la ganadería bovina nacional, y porque el tratado de libre comercio con 674


Rev Mex Cienc Pecu 2020;11(3):669-685

Estados Unidos dejó al país en desventaja en cuanto a competitividad, ya que dicho país es el mayor productor y exportador de carne bovina en el mundo.

Indicadores de competitividad

Índice de transabilidad

Este índice evidencia que de 139 países productores de carne bovina Polonia ocupa la primera posición competitiva (Cuadro 1), ya que presentó la mayor relación entre su balanza comercial neta y el respectivo consumo aparente de dicha carne. Este nivel de competitividad es acorde con su nivel de apertura exportadora y su ínfima penetración de importaciones; el citado país exporta casi el 40 % de su producción, mientras que este parámetro fue de 0.5, 0.1 y 0.2 % para Estados Unidos, Brasil y Argentina, respectivamente. Lo anterior permite inferir que los principales países productores mantienen una baja relación entre su exportación y producción de carne bovina, y también afirmar que sin importar el nivel de desarrollo del país la exportación es relativamente baja con respecto a su producción nacional. Cuadro 1: Indicador de transabilidad de la carne bovina en el mercado mundial 2004-2013 Indicador Posición Apertura Penetración País de trans. competiv. Característica exportadora de import. (%) (%) (%) Estados Unidos Brasil

0.20 0.00

19 29

China

-0.31

39

Argentina 0.15 Australia 2.65 Federación de Rusia -10.10

21 12 48

México Francia Canadá Alemania Polonia

17 11 15 5 1

0.79 3.54 1.54 10.19 64.22

Exceso de oferta Exceso de demanda Exceso de demanda Exceso de oferta Exceso de oferta Exceso de demanda Exceso de oferta Exceso de oferta Exceso de oferta Exceso de oferta Exceso de oferta

0.54 0.05

0.34 0.05

0.03

0.34

0.20 2.66 0.00

0.06 0.02 10.10

1.07 12.19 2.44 18.94 65.22

0.28 8.65 0.90 8.75 1.00

Fuente: Elaboración propia con base en datos de FAOSTAT. 675


Rev Mex Cienc Pecu 2020;11(3):669-685

Por otra parte, la disponibilidad de excedentes de exportación de Polonia representa aproximadamente el 0.7 del volumen de su consumo nacional aparente de carne bovina, muy superior al registrado para los Estados Unidos, Brasil, Argentina y Australia. El contraste se tiene con Italia, el onceavo país productor de importancia de esta carne en el mundo, pero también es un importador significativo. El IT de Italia muestra un exceso de demanda del 18.6 % de su consumo nacional aparente (CNA), que se satisface con volúmenes procedentes de varios países; su grado de penetración de importaciones (22.01 %), le otorga una baja posición competitiva de su producción interna. De acuerdo con el IT, México ocupa el 17º lugar en competitividad; sus exportaciones de carne en canal de ganado bovino representan un poco más del 1 % de su CNA, en tanto que las importaciones representan menos de una centésima de esta variable. Estos valores evidencian, como para la mayoría de países en desarrollo, que más que exhibir capacidad exportadora, lo que tienen son recursos naturales para esta producción (pastizales y vegetación natural), un bajo nivel de ingreso per cápita(13) y una limitada preferencia por esta carne(14), lo que en conjunto genera los excedentes exportables. Una situación a destacar en el mercado mundial de la carne bovina es el de la India, cuyo indicador de transabilidad (1.1 %) lo sitúa en el lugar 16 en competitividad. Sin embargo, se distingue de otros países exportadores, porque: primero, no importa esta carne y su producción interna satisface el 101 % de su CNA; segundo, su hato ganadero es superado sólo por el de los Estados Unidos; tercero, más de 800 millones profesan el hinduismo que prohíbe el sacrificio de vacas (animal sagrado), por lo que su industria procesadora de carne se enfoca a la exportación; y, cuarto, ofrece un producto de bajo precio, que abastece mercados poco exigentes en cuanto a calidad (casi 40 % inferior al de Brasil); características con las que ha conquistado mercados del sudeste asiático y medio oriente(15); rasgos que no poseen países en desarrollo, como Argentina y México.

Indicador de balanza comercial relativa

Los países que presentaron mayor ventaja en el mercado internacional de la carne bovina con este índice fueron India y Vietnam, cuyos valores fueron 100 % (Cuadro 2); siguió en importancia Colombia (99.9 %), y las posiciones siguientes le correspondió a Uruguay (99.8 %) y Paraguay (99.7 %).

676


Rev Mex Cienc Pecu 2020;11(3):669-685

Cuadro 2: Balanza comercial relativa (BCR) de la carne bovina mexicana Indicador Saldo neto Posición País de BCR Característica Bal. comercial competiv. (%) (%) Estados Unidos Brasil China Argentina Australia Federación de Rusia México Francia Canadá Alemania Italia

22.24 -1.21 -85.02 55.75 98.85 -99.93 58.03 16.97 46.09 36.78 -72.97

25 29 37 18 7 46 17 26 23 24 33

Ventaja Desventaja Desventaja Ventaja Ventaja Desventaja Ventaja Ventaja Ventaja Ventaja Desventaja

229,701 -1,107 -184,151 43,050 552,522 -1940,720 131,702 515,858 194,312 1092,780 -2383,357

Fuente: Elaboración propia con base en datos de FAOSTAT.

La posición competitiva de México en el mundo con base a este indicador (58.03 %), se mantiene en la misma que le confirió el IT, el lugar diecisiete. La producción de carne bovina mexicana se caracteriza porque su oferta externa rebasa su demanda y por lo tanto se cuenta con excedentes para exportar; sin embargo, es superado por varios países de América como Brasil y Argentina, que presentan mejor ventaja competitiva. Es relevante señalar que, de los países productores de importancia, sólo Estados Unidos presentó un BCR favorable durante el período analizado (22.2 %), que lo ubica en el lugar 25. En contraste Brasil, China y la Federación de Rusia, al registrar saldos deficitarios en su balanza comercial y al presentar un BCR de -1.2, -85.0 y -99.9 %, respectivamente, demuestran una condición clara de desventaja en el mercado. De estas tres naciones, sólo China incrementó su déficit comercial, cuyo saldo pasó de 7,409 t de carne bovina en 2004 a 102,285 t en 2013; un incremento del 1,280.6 %. Por su parte, la Federación de Rusia redujo su déficit comercial, su balanza pasó de –184,363 t en 2004 a –92,807 en 2013; un decremento del 49.7 %. En tanto Brasil superó su déficit comercial a partir del año 2012, ya que el saldo de su balanza paso de -743 t en 2004 a un superávit de 5,695 en 2013.

Indicador de Especialización Internacional o de Lafay

La información contenida en el Cuadro 3, confirma que Polonia y Alemania poseen la más alta especialización comercial y competencia en el mercado mundial de la carne bovina en 677


Rev Mex Cienc Pecu 2020;11(3):669-685

canal, cuyos índices en el período 2004-2013 fueron de 96.9 y 72.9 %, respectivamente; demostrando así su capacidad para construir ventajas competitivas en este mercado. Cuadro 3: Especialización internacional en el mercado de la carne bovina 2004-2013 Indicador Participación Posición País de espec. Característica export. mundo competiv. (%) (%) Estados Unidos Brasil China Argentina Australia Federación Rusa México Francia Canadá Alemania Italia

1.53 -0.01 -1.23 0.29 3.69 -12.95 0.88 3.44 1.30 7.29 -15.91

13 35 43 19 5 49 16 6 14 2 50

Bajo Bajo Bajo Bajo Intermedio Bajo Bajo Bajo Bajo Alto Bajo

4.21 0.30 0.11 0.40 3.71 0.00 1.20 11.87 2.06 13.56 2.95

Fuente: Elaboración propia con base en datos de FAOSTAT.

Resulta significativo destacar que, de acuerdo al índice EI, Australia es el único país que presenta una competitividad de nivel intermedio en el mercado, en tanto la Federación de Rusia (-12.9 %) e Italia (-15.9 %), que integran el conjunto de principales países productores de este cárnico, no registraron grado de especialización alguno. México en este contexto se situó en el lugar 16 mundial, con una competitividad considerada como baja (0.9 %). Los dos indicadores de competitividad previos y este último, confirman la posición competitiva de México en el mercado de la carne bovina, la cual no resulta ideal para un país con bastos recursos naturales y con una actividad ganadera generalizada en todo su territorio; esto presupone una limitada productividad por superficie y por vientre, así como por un bajo rendimiento en canal por animal finalizado(6).

Índice de ventaja comparativa revelada

El indicador de VCR (Cuadro 4), constata que Australia es el país cuya oferta externa de carne bovina posee el más alto nivel de competitividad desde el punto de vista del costo de oportunidad de sus recursos productivos; su indicador promedió fue de 6.0 durante 20042013 y, en general, presentó una tendencia creciente; este valor fue superior al de México (1.7), que se ubicó en el segundo lugar. Argentina ocupó el tercer puesto (1.1), mientras que 678


Rev Mex Cienc Pecu 2020;11(3):669-685

Estados Unidos fue el cuarto (0.9). Brasil, China y la Federación Rusa, con presencia relevante en el mercado mundial, por el valor de su VCR, y el de sus índices de transabilidad y de especialización internacional, presentaron falta de competitividad en dicho mercado. Cuadro 4: Ventaja comparativa revelada por país productor de carne bovina 2004-2013 Indicador de ventaja comparativa revelada País 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 E.U.A Brasil China Argentina Australia Fed.Rusa Francia México Alemania Canadá Italia

-0.40 -0.73 -2.75 1.16 5.62 -8.85 0.42 2.36 1.43 1.77 -3.04

-0.15 -1.12 -2.76 1.21 6.32 -12.93 0.46 2.57 1.15 1.24 -2.93

0.35 -0.51 -1.91 1.44 6.39 0 0.68 1.51 1.26 0.62 -2.76

0.63 -0.66 -2.21 0.68 7.23 0 0.74 1.02 0.88 0.36 -2.56

1.48 -0.17 -2.58 1.38 6.54 -10.84 0.85 0.53 0.88 -0.03 -2.48

1.22 -0.68 -2.02 2.08 5.84 0 0.88 1.14 0.78 0.22 -2.69

1.33 -0.42 -2.47 0.45 5.40 -12.02 0.96 1.60 0.63 0.68 -2.50

1.35 -0.67 -2.72 1.34 4.95 -8.99 1.18 1.87 0.43 0.18 -2.30

1.16 -0.01 -2.67 -0.10 5.26 -5.74 0.73 2.06 0.12 -0.05 -2.45

1.50 0.59 -4.20 0 6.12 -6.03 0.61 2.08 0.04 0.04 -2.46

Fuente: Elaboración propia con base en datos de FAOSTAT.

De acuerdo al principio de la ventaja comparativa(16), el óptimo económico se alcanza cuando un país produce y exporta aquellos bienes para los cuales tiene ventaja e importa los que muestran desventaja, lo cual explica la asignación de recursos en los tres países antes citados. De acuerdo a esta lógica, si se pretende establecer empresas productivas con menor costo de oportunidad, el exportar menos o importar la carne bovina les reditúa un mayor beneficio económico, entonces esto confirma la estructura de las relaciones de intercambio por país productor, como ocurre en China, donde la producción industrial interna resulta de mayor importancia económica que la producción primaria. Asimismo, se comprueba que sólo dos países de América Latina, México y Argentina, registran niveles positivos de competitividad; a pesar de que en ambos casos el VCR presentó ligera tendencia hacia la baja con marcados altibajos (Figura 2), pero el rango de variación de Argentina resultó ligeramente mayor al de México. El VCR para Argentina se redujo en 2.1 puntos y su coeficiente de variación (CV) fue de 71.6 %, en tanto que para México éste osciló en 2.0 puntos y su CV fue de 38.1 %. En contraste, dicho índice para Estados Unidos y Australia se caracterizó por su mayor estabilidad, ya que su variación fue de 1.6 puntos (CV= 82.5 %) y 1.4 (CV= 60.8 %), respectivamente.

679


Rev Mex Cienc Pecu 2020;11(3):669-685

Figura 2: Indicadores de ventaja comparativa revelada 8,00 Estados Unidos de América

Indicador de VCR

6,00

Alemania

4,00 2,00

China

0,00

Argentina

-2,00 Australia

-4,00 -6,00

México

Años

Es importante señalar que en la mayoría de los años de 2004 a 2013, los coeficientes VCR de Argentina y México registraron un valor mayor a la unidad, que evidencia un mejor desempeño del subsector ganadero bovino de carne, estos en realidad resultaron ambiguos, dado que sus VCE fueron menores que cero en la mayor parte de los años, al igual que sus VCI, lo cual se interpreta que ambos tienen desventaja comparativa tanto en exportación como en importación, por lo que no intervienen significativamente en el comercio mundial de la carne bovina. Esto no se presenta para Australia y Alemania, que muestran ventaja comparativa en exportaciones y desventaja en importaciones, tal y como lo indica el criterio de análisis presentado en la metodología. Con base en lo expuesto, se infiere que México por su VCE negativo de 2004 a 2011, muestra desventaja comparativa en la producción de carne bovina, con tendencia a su reducción, pero se vuelve positivo en 2012 y 2013. Este comportamiento por componente del VCR significa que paulatinamente el país fue adquiriendo mayor nivel de competitividad. Las importaciones de carne bovina de 2004 al 2008, fueron acordes a la lógica del costo de oportunidad de disponibilidad de un producto; la producción nacional fue menos eficiente en términos de precio o de calidad que la de otros países, y por ello la importación se volvió una mejor alternativa para la economía. Por último, la relación que se establece entre los volúmenes de exportación de la carne bovina de México y el valor del índice VCE, y la que se da entre el índice de VCR y la oferta interna de carne bovina de 2004-2013, la primera fue acorde a los principios de la lógica económica del comercio internacional (Figura 3), en donde el coeficiente de correlación (r= 0.92) evidencia que existe una asociación alta y en el mismo sentido de variación entre la citada variable y el indicador de ventaja correspondiente. Con respecto a la segunda relación, ésta 680


Rev Mex Cienc Pecu 2020;11(3):669-685

presentó un coeficiente de correlación negativo (r= -0.09), lo cual revela que al incrementarse el nivel de competitividad del país en este mercado se reduce en términos relativos su oferta interna de carne bovina, esto último se observa en el comportamiento de sus exportaciones, las cuales en el período variaron a una mayor tasa promedio (37.1 %) que los respectivos volúmenes de carne producidos (1.8 %).

5,00

50000

4,00

40000

3,00

30000

2,00

20000

1,00

10000

0,00

0

-1,00

-10000

-2,00

-20000

-3,00

Toneladas

Indicador de VCRE

Figura 3: Relación entre ventas externas de carne bovina y la ventaja comparativa de exportación de México

-30000

Años Indicador de VCE

Toneladas EX

Discusión Es importante mencionar que sobre la calidad y diferenciación de la carne bovina producida en México, como sobre su rendimiento en canal, variables relacionadas con la producción y competitividad de las exportaciones, han influido diversos factores económicos en su comportamiento de largo plazo, entre estos destacan la firma e inicio del TLCAN en 1994(15), y los problemas de carácter estructural de la política económica aplicada por el gobierno federal(17) a partir del año 1982, los cuales se han reflejado en aspectos puntuales de esta actividad productiva, tales como: la pérdida de rentabilidad y competitividad (en costos y precios de venta), la desaparición de unidades de producción y en la pérdida de empleos; durante este proceso de transición de una actividad protegida a su inserción al libre mercado. En años posteriores, la ganadería nacional ha presentado una recuperación al impacto negativo del fenómeno anterior. En cuanto a la competitividad de la carne bovina en el mercado internacional, el análisis del IT permitió constatar que no todos los países que destacan como productores son a su vez los 681


Rev Mex Cienc Pecu 2020;11(3):669-685

principales exportadores, un claro ejemplo de esta situación es Italia, cuyo IT la sitúa en el lugar 49 en competitividad, cuando en realidad, y por su capacidad comercial, fue el onceavo exportador de carne bovina de 2004 al 2013. En este contexto, y de acuerdo con el índice de especialización internacional, la carne bovina de México se caracterizó por presentar un bajo nivel de ventaja competitiva, así como poca vocación exportadora, situación que coincide con lo reportado para el país de 1980 a 2009(18) y, en forma comparativa, con lo reportado por Depetris et al(19) del desempeño competitivo de la producción de leche en polvo de Argentina y Uruguay durante 1990-2005. El citado grado de competitividad de México podría mejorarse con incrementos en la calidad y la diferenciación de la carne bovina, dado que la exportación de ésta se da en la forma de carne fresca, refrigerada y congelada, pero el patrón de preferencias de los consumidores de los países importadores se orienta hacia los cortes selectos, contenido de grasa veteada, grado de terneza y tipo de carne(15,17). En respuesta a esta exigencia en la actividad ganadera nacional se han estado sustituyendo razas bovinas tradicionales por mejoradas, según exigencia del mercado; el rendimiento en canal creció en promedio 0.2 % al año de 1995 a 2014, bajo si se compara con el de Australia, donde este indicador creció 1.4 %(5); aspecto relacionado con el costo medio de producción. Por otra parte, del indicador de VCR, cuya relevancia considera la asignación de recursos productivos en la economía(16), se infiere que éste para el mediano plazo presente un valor mayor que cero, un comportamiento ascendente y que no fluctúe en exceso, porque cuando ocurre esto último, como el caso de la carne bovina de México, es indicio de que la competitividad no está apoyada sobre una base económica fuerte, sino que más bien es producto de factores volátiles como: variación de la paridad cambiaria y la imposición de barreras no arancelarias a los países competidores, por lo que estas oportunidades sólo benefician las ventas al exterior de esta carne de manera eventual. La situación anterior resulta consistente con lo reportado por Carrera y Bustamante (18), quienes señalan que del año 1996 al 2003 la producción de carne de bovino de México registró baja competitividad en el mercado mundial, debido a que el indicador de la VCE resultó inferior al de la VCI, en el que el proceso de apertura comercial del país (TLCAN) fue el factor que empeoró la competitividad de la producción nacional. Asimismo, lo encontrado en el presente también coincide con los resultados de Carrera et al(17) y Del Moral y Trujillo(20); los primeros autores indican que la situación de la ganadería bovina mexicana reflejó en lo general una VCR negativa para el período de 1990 a 2009, aunque a partir de 2004 se recupera como respuesta a las restricciones en la importación de los Estados Unidos y Canadá a raíz de la enfermedad de EEB; mientras que los segundos autores evidenciaron que de 1980 a 2010, la producción de esta carne en el país se caracterizó por su desventaja comparativa revelada, reflejándose en la disminución de la producción de este cárnico y en el empeoramiento de su balanza comercial. 682


Rev Mex Cienc Pecu 2020;11(3):669-685

Finalmente, el bajo grado de asociación encontrado entre el valor del indicador de VCR y la producción de carne bovina en México, se explica por las características del mercado y del proceso comercial. En primer lugar, en el país existe una deficiente infraestructura de comunicación y de comercialización(21), creciente participación de las tiendas de autoservicio en la distribución de productos cárnicos, cuya oferta se compone por un elevado número de productos importados, que impactan negativamente a toda la cadena de valor de la carne bovina nacional. En segundo lugar, el margen bruto del proceso de comercialización resulta relativamente alto con relación al precio que se paga al ganadero, ya que apenas obtiene la cuarta parte del valor total generado, y quien no está organizado para enfrentar el poder de mercado que ejercen los mayoristas y detallistas; además, la carne bovina importada a bajos precios condiciona el precio que se paga al productor inicial, lo que tiene como consecuencia pérdida de rentabilidad. La tercera característica de importancia en la citada asociación, es el deficiente acceso a los insumos alimenticios para el ganado, cuyos precios y calidad son desiguales respecto a Estados Unidos, como también lo son los subsidios que otorga el gobierno hacia esta actividad. La cuarta es la falta de integración y coordinación de la cadena productiva bovina, que se traduce en costos más elevados de producción, desaprovechamiento de economías de escala(22) y, por ende, menor competitividad de la cadena. La última característica, es la presencia de fenómenos naturales(20), como inundaciones por eventos meteorológicos extremos y períodos prolongados de sequía, que han afectado la productividad de la carne bovina nacional y elevado su costo de producción.

Conclusiones e implicaciones La carne de ganado bovino en canal de México se caracterizó en el ámbito mundial por su bajo nivel de competitividad durante el período 2004 al 2013, tal y como lo evidencian el valor de los índices de transabilidad, balanza comercial relativa, especialización internacional y los de ventaja comparativa revelada. Una característica de la exportación de esta carne es su único destino mayoritario, Estados Unidos de América. Asimismo, se demostró que, desde la década de los noventa, y como resultado de diversos sucesos económicos, la producción de carne bovina ha experimentado un crecimiento constante, aspecto que impactó positivamente la generación de saldos exportables; sin embargo, estos representan sólo una pequeña parte de la oferta primaria, acorde con la posición competitiva. La exportación de carne bovina no se sustenta en productos de calidad o en factores institucionales, sino es resultado de sucesos volátiles relacionados con el tipo de cambio e imposición a los países competidores de barreras no arancelarias. Dada las características de la producción de carne bovina nacional y su entorno macroeconómico, la consolidación de una mayor posición 683


Rev Mex Cienc Pecu 2020;11(3):669-685

competitiva de la oferta exportable, que permita a los productores del país negociar los precios, requiere que se mejore tanto la calidad y la diferenciación de la carne bovina a través de la incorporación de valor agregado, el rendimiento de carne por animal y la disposición de infraestructura comercial, como de la apertura de nuevos mercados, condiciones que permitirían en el mediano plazo obtener un mejor nivel de competitividad y protagonismo en el mercado internacional de esta carne. Además, este escenario también permitiría acrecentar los impactos positivos que tiene la ganadería bovina en la economía y el bienestar regional del país.

Literatura citada: 1. Porter ME. Ventaja Competitiva. España: Editorial Pirámide; 2010. 2. Coronado F. Indicadores de productividad y competitividad regional relacionados al agro. CENTRUM Católica’s Working Paper. No. 2015-08-0010. Lima, Perú: Pontificia Universidad Católica del Perú; 2015. http://vcentrum.pucp.edu.pe/investigacion/wps/pdf/CECYM_WP2015-08-0010.pdf. 3. Vázquez A, Reyes A. Fundamentos sobre la competitividad para el desarrollo en el sector primario. TLATEMOANI, Revista Académica de Investigación 2013;(4):1-29. 4. Gonzalez J, Zamora A, Celaya R, Navarro JC. Competitividad y logística del comercio exterior de México. Primera ed. Sonora, México: Instituto Tecnológico de Sonora y Universidad Michoacana de San Nicolás de Hidalgo; 2016. 5. FAOSTAT. Organización de las Naciones Unidas para la Agricultura y la Alimentación. Base de datos estadísticos con relación a la alimentación y agricultura. http://faostat.fao.org/site/535/DesktopDefault.aspx?PageID=535#ancor. Consultado 16 Dic, 2015. 6. SIACON. Sistema de Información Agroalimentaria de Consulta. Base de datos de la actividad agrícola, pecuaria y pesquera en México. http://www.siap.gob.mx/optestadisticasiacon. Consultado 15 Dic, 2015. 7. AMEG. Carne de bovino. Indicadores económicos. 14 ed. México; 2012. 8. IICA. Instituto Interamericano de Cooperación para la Agricultura. Elementos para un enfoque de la competitividad en el sector agropecuario. Colección de documentos IICA. Serie competitividad No 3. Santa Fe de Bogotá, Colombia; 2000. 9. Levin R, Rubin D. Estadística para administración y economía. Séptima ed. México, DF: Pearson/Prentice Hall; 2004. 684


Rev Mex Cienc Pecu 2020;11(3):669-685

10. Sierra SL, Peláez SJ. Amenazas comerciales del acuerdo CAN-Mercosur, para los sectores productivos del Valle del Cauca. Economía, Gestión y Desarrollo 2009;(7):47– 62. 11. Cue M. Economía internacional. Primera ed. México: Grupo Editorial Patria; 2014. 12. Vollrath T. A theoretical evaluation of alternative trade intensity measures of revealed comparative advantage. Weltwirtschaftliches Archiv 1991;264-280. 13. CONEVAL. Comisión Nacional para la Evaluación de las Políticas de Desarrollo Social. Evolución de las carencias sociales 2015 y su comparativo con la serie 2010-2014. http://www.coneval.org.mx/Medicion/EDP/Paginas/Datos-del-Modulo-deCondiciones-Socioeconomicas.aspx. Consultado 15 Dic, 2015. 14. FIRA. Panorama agroalimentario: Carne de bovino 2015. México: Dirección de investigación y evaluación económica y sectorial; 2015. 15. Omaña JM, Almora I, Cruz B, Hoyos G, Quintero JM, Fortis M. Competitividad de la carne de ganado bovino entre los países miembros del TLCAN 1997-2008. Rev Mex Cienc Agr 2014;5(2):175-189. 16. Salvatore D. Economía internacional. Octava ed. México, DF: Ed. Limusa; 2005. 17. Carrera B, Gómez M, Schwentesius R. La ganadería bovina de carne en México: un recuento necesario después de la apertura comercial. Chihuahua, México: Universidad Autónoma de Ciudad Juárez; 2014. 18. Carrera ChB, Bustamante LT. ¿Es la ganadería bovina de carne una actividad competitiva en México? Noesis. Rev Cienc Soci Humanid 2013;22(43):19-50. http://www.redalyc.org/pdf/859/85927874002.pdf 19. Depetris GE, García AR, Rossini G. Desempeño competitivo de Argentina y Uruguay en la leche en polvo. Problemas del desarrollo 2009;40(157):163-187. 20. Del Moral L, Murillo VB. Dinámica del mercado de la carne bovina en México: un análisis de competitividad. Paradigma económico 2015;7(1):107-125. 21. Rodríguez D, Riveros H. Esquemas de comercialización que facilitan la vinculación de productores agrícolas. San José, Costa Rica: IICA; 2016. 22. Nicholson W. Teoría microeconómica. Novena imp. México, DF: Cengage Learning SA; 2008.

685


https://doi.org/10.22319/rmcp.v11i3.4669 Artículo

Adición de extracto acuoso de ajo (Allium sativum) en dieta de conejos (Oryctolagus cuniculus) sobre productividad, calidad física y microbiológica de la carne

Dora Luz Pinzón Martínez a María Dolores Mariezcurrena Berasain a* Héctor Daniel Arzate Serrano b María Antonia Mariezcurrena Berasain c Abdelfattah Zeidan Mohamed Salem c Alfredo Medina García a

a

Universidad Autónoma del Estado de México. Facultad de Ciencias Agrícolas, Instituto Literario 100, 50000, Toluca, Edo. de México, México. b

Universidad Autónoma del Estado de México. Programa de Maestría y Doctorado en Ciencias Agropecuarias y Recursos Naturales, Toluca, Edo. de México, México. c

Universidad Autónoma del Estado de México. Facultad de Medicina Veterianria y Zootecnia, Toluca, Edo. de México, México.

* Autor de correspondencia: nekkane16@hotmail.com

Resumen: El ajo (Allium sativum) como antimicrobiano natural ha favorecido el bienestar animal, inocuidad y calidad de la carne. El objetivo de este estudio fue evaluar indicadores productivos, calidad física y microbiológica de la carne de conejos, engordados con la adición de extracto acuoso de ajo (EAA) en la dieta. Se realizó un diseño completamente aleatorio con tres tratamientos de 28 conejos Nueva Zelanda X Chinchilla (Oryctolagus cuniculus X Chinchilla chinchilla) cada uno (PV 1 ± 0,6 kg, 30 ± 5 días); grupo testigo (solo alimento),

686


Rev Mex Cienc Pecu 2020;11(3):686-700

tratamiento 1 (0.9% EAA) y tratamiento 2 (1.8% EAA) asperjado en el alimento cada tres días. Se determinó, ganancia de peso diaria y conversión alimenticia, durante cuatro semanas a partir del destete. Se cuantificó en la carne mesófilos aerobios, coliformes fecales, psicrófilos, y se determinó pH y color (L*, a* y b*), todo ello en Longissimus dorsi a los 1, 3, 5, 7 y 9 días de conservación en condiciones de refrigeración. Se realizó un análisis de varianza multivariado (P≤0,05) para los indicadores productivos, variables físicas y microbiológicas, más una prueba de Tukey 5%. No existieron diferencias significativas (P≥0,05) sobre los indicadores productivos y sí para psicrófilos y mesófilos aerobios, a lo largo del tiempo de conservación. No se observaron coliformes fecales en ninguna de las muestras. La adición de extracto acuoso de ajo 1.8% mejoró la vida útil al disminuir el contenido de piscrófilos y aumentar dos días la vida de anaquel (total 9 días), sin afectarse indicadores productivos, ni la calidad física de la carne. Palabras clave: Allium sativum, Vida útil, Análisis microbiológico, Calidad de carne.

Recibido: 21/10/2017 Aceptado: 26/09/2019

Introducción La industria cárnica emplea diversos métodos para retrasar los cambios que deterioran la carne y prolongan así el periodo de aceptabilidad; cambios que se relacionan directamente con la presencia de microorganismos. En la actualidad, se busca la combinación de dos o más factores (físicos, químicos o bilógicos, entre otros) que interaccionen aditiva o sinérgicamente, para controlar la población microbiana y evitar la aplicación de un solo factor de conservación en forma severa. Lo que mejora la calidad sensorial y nutricional del alimento y permite la producción de alimentos mínimamente procesados(1). El uso de antimicrobianos no naturales es común en la industria de la carne procesada, sin embargo, actualmente son rechazados por parte de los consumidores por los efectos que pueden causar a la salud. Por lo cual, ha surgido la necesidad de buscar otros antimicrobianos de origen natural(2). El ajo (Allium sativum) es un antimicrobiano natural con una amplia gama de propiedades nutracéuticas, debido a su contenido de compuestos sulfurados secundarios, entre ellos la alicina. Igualmente, se ha demostrado los efectos benéficos del extracto de ajo sobre la salud de animales, como es el caso de los conejos y sobre la carne de estos, en la cual puede prolongarse la vida útil y por consiguiente, la seguridad del consumidor(3-6). El deterioro de la carne de conejo en refrigeración se debe a la actividad de enzimas endógenas, 687


Rev Mex Cienc Pecu 2020;11(3):686-700

junto con la actividad de microorganismos contaminantes del producto durante el proceso de sacrificio y despiece. Cuando el producto se distribuye en temperaturas de refrigeración, la carne tiene una vida útil entre 6 y 8 días, tal como algunos reportes lo han mencionado(7-10). Otros autores(11) marinaron carne de cerdo con jugo de ajo y cebolla para determinar su efecto en la calidad durante el almacenamiento en refrigeración. Sensorialmente, los jugos de ajo y cebolla le proporcionaron a la carne mayor terneza y mejor sabor. Aunque existen trabajos sobre la utilización de extracto de ajo en carnes de diferentes especies, no se ha evaluado la carga microbiana en la carne al adicionar el extracto en la dieta en conejos. Por ello, el objetivo de este estudio fue evaluar el efecto de la adición de extracto acuoso de ajo en la dieta de conejos, sobre los indicadores productivos, así como en la calidad física y microbiológica de la carne en carne almacenada.

Material y métodos Material biológico

Se utilizaron 84 conejos Nueva Zelanda X Chinchilla (Oryctolagus cuniculus X Chinchilla chinchilla) destetados (1.0 ± 0.6 kg, 35 ± 5 días) machos y hembras, alojados en el interior de naves con ventilación natural y en clima templado (22 ± 2 °C), en un sistema modular de jaulas dispuesto en piso con bebederos automáticos tipo tetina y tolvas de alimentación, durante junio-julio 2015.

Lugar de estudio

El estudio se realizó en la granja matriz de Distribuidora de Conejos Nezahualcóyotl (DISCONNEZA), ubicada en el Municipio de Nezahualcóyotl, Estado de México. Se sitúa entre los paralelos 19° 24′ 02″ N y 99° 00′ 53″ O, con una altitud promedio de 2,235 m.s.n.m.

Preparación del extracto El extracto acuoso de ajo (EAA) se elaboró a partir de una dilución madre de 0.125 g/ml(12), para lo cual, los ajos sin cáscara se licuaron durante 5 min (Oster 6630-13) y dicho extracto se filtró dos veces con gasas. El EAA resultante se almacenó en refrigeración a (4 °C) hasta 688


Rev Mex Cienc Pecu 2020;11(3):686-700

su uso (7 días)(13). Los animales se dividieron en tres tratamientos; grupo testigo GT (sin EAA añadido), tratamiento 1 T1 (0.9 % EAA) y tratamiento 2 T2 (1.8 % EAA). Los extractos se asperjaron sobre el alimento comercial (Conejo plus Unión Tepexpan; proteína bruta: 16,5%; grasa bruta: 3%; fibra bruta: 15%; cenizas: 9% y humedad: 12%) cada tres días desde el inicio del ensayo. Las dosis seleccionadas corresponden a lo reportado por MariezcurrenaBerasain(13) para la mejor producción de gas y parámetros fermentativos, como mejor energía disponible para la producción de ácidos grasos de cadena corta (AGCC) y energía metabolizable (EM) en el estudio de la producción de gas in vitro. Para evaluar los indicadores productivos, los conejos se pesaron semanalmente (báscula digital Dibatec), retirando el alimento 12 h antes, y se registró la ganancia de peso total, junto con la ganancia de peso diario (de forma individual) y consumo de alimento, durante cuatro semanas. Agua y alimento se proporcionadron ad libitum.

Sacrificio

Los conejos fueron restringidos de alimento 24 h para ser sacrificados. Se insensibilizaron por dislocación atlanto-occipital(14), se degollaron y desangraron mediante corte en la yugular y carótida, se evisceraron, mediante un corte en la línea alba para retirar las vísceras abdominales y torácicas. Por último, se cortaron las extremidades y se disminuyó la temperatura de la canal hasta 4 °C. Las canales fueron identificadas y transportadas a temperatura de refrigeración al Laboratorio de Calidad de los Productos Agropecuarios, Facultad de Ciencias Agrícolas de la Universidad Autónoma del Estado de México, para los análisis correspondientes (agosto-diciembre 2015).

Análisis físicos

Se tomó la primera lectura de pH (Hanna Instruments, modelo HI 99163) y color (Minolta Chromameter CR 400, con iluminación D65 y 10° de observador) in situ de muestras del músculo Longissimus dorsi derecho de las canales a los 45 min post mortem (en canal caliente). Los análisis subsecuentes se realizaron en las muestras tomadas del mismo músculo durante los días 1, 3, 5, 7 y 9 en muestras conservadas en bandejas y cubiertas con film, a 4 °C y por duplicado.

689


Rev Mex Cienc Pecu 2020;11(3):686-700

Análisis microbiológicos

Se cuantificaron por duplicado las unidades formadoras de colonias (UFC) de coliformes fecales, mesófilos aerobios y psicrófilos a lo largo de la conservación. Para la cuantificación de coliformes fecales utilizó la norma francesa AFNOR-NF-V0860-1996(15), ya que en México no hay Norma Oficial para estos microorganismos(16).

Análisis estadístico Para los indicadores productivos se realizó un análisis de varianza (P≤0,05) y al encontrar diferencias significativas, se aplicó una comparación por la prueba de Tukey al 5%. Las variables de estudio fueron los tres tratamientos (GT, T1 y T2) y las variables de respuesta fueron: peso semanal, ganancia de peso semanal y eficiencia de conversión, durante un periodo de cuatro semanas. A los resultados del estudio microbiológico y fisicoquímicos obtenidos se les aplicó un análisis de varianza multivariado (P≤0,05) para determinar el efecto de los tratamientos y los días de conservación. Las variables respuesta fueron: UFC de coliformes fecales, mesófilos aerobios, psicrófilos, pH, luminosidad, índice de rojo e índice de amarillo. Para los valores que presentaron diferencias significativas, se realizó la prueba de Tukey al 5%, mediante el uso de Stat Graphics Centurion XV.I.

Resultados y discusión Indicadores productivos

Los resultados de las variables productivas se presentan en los Cuadros 1, 2 y 3, en las cuales, se puede observar que no se presentaron diferencias significativas para ninguna de ellas. El efecto del ajo sobre las variables productivas en conejos sigue siendo controversial, algunos autores han reportado que sus compuestos bioactivos tienen un efecto positivo sobre dichos aspectos(17,18). Reportes más recientes se contraponen y presentan que el ajo reduce los niveles plasmáticos de colesterol, la presión sanguínea y la agregación plaquetaria o promueve la respuesta inmune, sin afectar a estas variables, aunque pocas investigaciones citaron buenos resultados productivos cuando éste, se administra junto con otras plantas aromáticas. El presente trabajo concuerda en que no hubo efecto significativo (P≥0.05) para peso semanal, ganancia de peso semanal, ni en eficiencia de conversión alimenticia. En 690


Rev Mex Cienc Pecu 2020;11(3):686-700

pollos de engorda el extracto de ajo se ha reportado como estimulador para la ganancia de peso, en conejos se sugiere que la fisiología digestiva lo condiciona(19-22). Cuadro 1: Variable peso de los conejos por semana (kg/PV) Tratamiento

P

GT

1

2

Semana 1

1.14±0.02

1.09±0.03

1.03±0.04

0.2617

Semana 2

1.37±0.03

1.3±0.04

1.29±0.05

0.5028

Semana 3

1.59±0.03

1.50±0.04

1.53±0.05

0.1182

Semana 4

1.84±0.04

1.75±0.05

1.81±0.06

0.1721

GT= grupo testigo (sin EAA añadido); tratamiento 1= 0.9 % EAA; tratamiento 2= 1.8 % EAA. EAA= extracto acuoso de ajo.

Cuadro 2: Variable de ganancia de peso semanal (kg/PV) Tratamiento

P

GT

1

2

Semana 1

0.26±0.01

0.25±0.01

0.25±0.01

0.4845

Semana 2

0.23±0.01

0.24±0.01

0.26±0.02

0.3897

Semana 3

0.22±0.01a

0.16±0.0a

0.23±0.01a

0.0050

Semana 4

0.24±0.01

0.25±0.01

0.28±0.01

0.8360

Total

0.96±0.02

0.91±0.02

1.24±0.05

0.1790

GT= grupo testigo (sin EAA añadido); tratamiento 1= 0.9 % EAA; tratamiento 2= 1.8 % EAA. EAA= extracto acuoso de ajo. a,b,c Medias con diferente letra en una línea indican diferencias estadísticamente significativas.

Cuadro 3: Variable conversión alimenticia por semana (kg/PV) Tratamiento

P

GT

1

2

Semana 1

2.5±0.16

2.76±0.21

4.42±0.49

0.3474

Semana 2

3.15±0.56

3.14±0.73

5.21±1.52

0.9950

Semana 3

2.89±0.73

4.62±0.95

5.28±0.47

0.1541

Semana 4

2.88±0.34

2.96±0.44

3.95±0.72

0.8903

Total

2.84±0.1

3.1±0.13

4.29±0.47

0.1308

GT= grupo testigo (sin EAA añadido); tratamiento 1= 0.9 % EAA; tratamiento 2= 1.8 % EAA. EAA= extracto acuoso de ajo.

691


Rev Mex Cienc Pecu 2020;11(3):686-700

En relación a la ganancia de peso semanal, en el Cuadro 2 puede verse que el tratamiento 2 con 1.8% de EAA resultó en una mayor ganancia de peso semanal. Lo anterior concuerda con otras investigaciones(23,24) en donde mostraron que la alicina en el ajo promueve el rendimiento de la flora intestinal mejorando así la digestión y la utilización de la energía, lo que conduce a un mejor crecimiento en pollos de engorde. En relación a la conversión alimenticia (Cuadro 3), después de cuatro semanas, no se mostraron diferencias entre tratamientos. Sin embargo, se muestra una tendencia en aumentar dicha variable cuando se adiciona una mayor dosis de extracto.

Análisis físicos y microbiológicos Después de realizar el análisis de varianza (para día y para tratamiento) se encontraron diferencias significativas (P≤0,05) para mesófilos aerobios y psicrófilos en vida útil. Al encontrar diferencias significativas para estas variables, se aplicó una prueba de Tukey 5% que se presenta en el Cuadro 4. Cuadro 4: Perfil físico y microbiológico durante la vida útil de carne de conejo Tratamiento P EEM GT 1 2 MA (log10 UFC/ cm2) Día 1

1.50x

2.15

2.23

0.092

0.208

Día 3

2.08xy

2.35

2.18

0.675

0.210

Día 5

2.58xy

2.65

2.54

0.960

0.258

Día 7

2.46xy

2.51

2.68

0.642

0.167

Día 9

3.01y

2.99

2.40

0.460

0.371

P

0.009

0.097

0.781

Día 1

1.57x

1.65x

2.01x

0.348

0.207

Día 3

2.43xy

2.30y

2.77xy

0.255

0.182

Día 5

2.90y

2.85z

2.99y

0.805

0.156

Día 7

2.01xy

2.21y

3.15y

0.064

0.286

Día 9

3.19y

3.40z

3.02y

0.474

0.206

P

0.015

≤0.001

0.016

PSI (log10 UFC/ cm2)

pH 692


Rev Mex Cienc Pecu 2020;11(3):686-700

Día 1

6.64ab

6.26aw

7.01bx

0.0058

0.101

Día 3

6.66

6.49x

6.97x

0.0995

0.101

Día 5

6.86ab

6.55ay

7.01bx

0.0278

0.090

Día 7

6.38a

7.11bz

6.21ay

0.0108

0.147

Día 9

6.64a

7.08bz

6.54az

0.0137

0.937

P

0.469

0.000

0.000

Día 1

61.17

59.76

61.38

0.762

1.645

Día 3

58.41

59.76

57.42

0.683

1.842

Día 5

58.11

56.79

56.51

0.680

1.326

Día 7

58.13

57.17

57.55

0.901

1.478

Día 9

58.68

56.94

58.37

0.588

1.218

P

0.789

0.065

0.255

Día 1

2.04

1.99

1.25

0.167

0.280

Día 3

1.21

1.63

2.17

0.205

0.330

Día 5

3.75

1.57

2.38

0.422

1.106

Día 7

3.16

1.58

1.805

0.345

0.756

Día 9

2.80

1.73

1.916

0.589

0.752

P

0.582

0.783

0.360

Día 1

4.27

3.69

4.17

0.436

0.320

Día 3

3.48

4.46

2.78

0.376

0.784

Día 5

5.10

3.14

4.53

0.349

0.901

Día 7

5.17

3.76

4.14

0.443

0.754

Día 9

5.30

3.71

4.02

0.289

0.683

P

0.599

0.263

0.550

L*

a*

b*

GT= grupo testigo (sin EAA añadido), tratamiento 1 (0.9 % EAA) y tratamiento 2 (1.8 % EAA). EAA= extracto acuoso de ajo; EEM= error estándar de la media. MA= mesófilos aerobios; PSI= psicrófilos; L*= luminosidad; a*= intensidad rojos; b*= intensidad amarillos. a,b,c Medias con diferente letra en una línea indican diferencias significativas (P<0.05). x,y,z Medias con diferente letra en la misma columna son diferentes (P<0.05).

693


Rev Mex Cienc Pecu 2020;11(3):686-700

En mesófilos aerobios se encontraron diferencias significativas (P≤0.05) para los días de exposición únicamente en el GT, donde el día 9 presentó mayor población que el día 1 (Cuadro 4). El rango con el que se inició la vida útil en los tres tratamientos para esta población microbiana fue de 1.50 a 2.23 log10 UFC/cm2. Aunque en la Norma Mexicana no se indica un valor de referencia para esta población microbiana en carnes crudas de ninguna especie, se sugiere considerar que la Unión Europea de acuerdo a la European Commissions Directive 2001/471/EC(19) reporta valores aceptables menores a 3.50 log10 UFC/cm2 y no existen reportes para la carne de conejo. Así, en el último día de la vida útil del presente experimento (día 9) todos los tratamientos se encontraron dentro de los límites permisibles aunque no se observaron diferencias significativas (P≥0.05) entre ellos. La presencia de mesófilos aerobios se usa como indicador general de higiene y de la población de microorganismos presentes, como estimación de la calidad del manejo y manipulación de la carne, e incluye bacterias, mohos y levaduras capaces de desarrollarse a 30 °C(25). Otros estudios en carne de conejo sin suplementación en la dieta con antimicrobianos, reportan valores más altos de mesófilos aerobios (5.87 log10 UFC/cm2) que exceden el límite permisible a los 7 días de exposición(26). En el presente estudio no hubo diferencia significativa (P≥0,05) al final de la vida útil en ésta variable, lo cual sugiere, que el manejo e higiene fue adecuado en los tres tratamientos. Para el caso de los psicrófilos se encontraron diferencias significativas (P≤0,05) durante los días de exposición, más no entre tratamientos. El rango que se presentó al inicio de la vida útil fue de 1.57 a 2.01 log10 UFC/cm2. En la vida útil, la cinética de crecimiento mostró que el T2 comenzó con una carga mayor (2,01 log10 UFC/cm2) en comparación del GT y T1. Sin embargo, en el día 9 de vida útil del T2 el número de UFC (3,02 log10 UFC/cm2) en comparación con el GT y T1 (3.19 y 3.40 log10 UFC/cm2, respectivamente) fue menor. Por lo que el crecimiento de psicrófilos disminuyó en el T2 (1.8 % EAA), en comparación con el grupo testigo (TG) y la dosis más baja de EAA (T1). Estos microorganismos son importantes para predecir la estabilidad del producto bajo condiciones de refrigeración y se sugiere que el T2 (1.8 % EAA) mostró la mayor estabilidad, aunque no existen normativas para sus límites permisibles en carne de conejo. En mesófilos aerobios y psicrófilos existe problemática para establecer límites máximos permisibles, ya que la carne es un producto que mayoritariamente, antes de ser consumido, pasa por un proceso de cocción, donde se alcanzan altas temperaturas que eliminan dichos microorganismos. En otro trabajo de investigación(27) se menciona que el ayuno de 24 h mejora la calidad microbiológica ya que al vaciarse el tracto digestivo, disminuye la presencia de microorganismos no deseables en la canal. No se observó crecimiento de coliformes fecales en ninguno de los tratamientos. La carga inicial es proporcional a la población final que se alcanzó en una carne durante su vida útil. Las bacterias se reproducen exponencialmente, por lo que una población inicial alta, resultará en menor tiempo para alcanzar los niveles en que la carne se descomponga(27,28). A pesar de no haber diferencias significativas, en otra investigación(28), 694


Rev Mex Cienc Pecu 2020;11(3):686-700

al evaluar la capacidad antimicrobiana de extractos de ajo obtenidos por solventes adicionados a medallones de carne picada de cerdo mostraron que todos los extractos inhibían el crecimiento de Listeria monocytogenes y Escherichia coli 0157:H7. De igual forma, en otro trabajo, se investigó el potencial antimicrobiano de algunos compuestos azufrados presentes en el ajo contra el crecimiento microbiano de carne de res. Los resultados mostraron que éstos compuestos inhibieron el crecimieto de cinco cepas inoculadas intencionalmente a la carne (Salmonella typhimurium, Escherichia coli, Listeria monocytogenes, Staphylococcus aureus y Campylobacter jejuni)(29). Así el crecimiento microbiano se comportó semejante a otros resultados(28,29), con ajo fresco y en polvo adicionado directamente a carne de camello y que también reportaron un retardo en crecimiento microbiano en la conservación de la misma. Otros estudios han probado la efectividad de extractos de ajo en la conservación de canales de aves frescas almacenadas en refrigeración y han obtenido una reducción significativa en la contaminación microbiana, inhibido el crecimiento de microorganismos mesófilos y reducido el crecimiento de coliformes totales y fecales(30), que concuerdan con la inhibición de coliformes fecales en este estudio. Por otro lado, se ha reportado que soluciones acuosas de ajo sobre rebanadas de bagre dorado (Brachyplatystoma rousseauxii) almacenadas a 4 °C, mostraron una mejora en la calidad microbiologica, al inhibirse las bacterias psicrotróficas y bacterias lácticas, entre otras, durante al menos 15 días(31). La alicina del ajo se ha reportado exitosamente como antioxidante y antimicrobiano para incursionarse dichos beneficios en la vida útil de la carne de conejo, mediante la prevención o disminución de la oxidación de lípidos y proteínas. Aunque más estudios se requieren, el presente trabajo propone factible el prolongar la vida útil, bajo las condiciones ensayadas, semejante a otros trabajos con tomillo (Thymus vulgaris), ácido láctico o zumaque (Rhus coriaria L.) para la carne de esta especie. Ya que la presencia de la alicina en la canal puede haber aminorado el crecimiento de los microorganismos que contaminan la carne durante el despiece(21,32). Para la variable de pH, tanto en tratamientos como en vida útil, se encontraron diferencias significativas (P≤0,05). El rango fue de 6.26 a 7.01 entre tratamientos al inicio de la vida de útil. Al finalizar ésta (día 9), se presentó un rango de 6.54 a 7.08 entre los tratamientos. El pH del músculo de animales sanos es de alrededor de 7.04 y 7.30, alcanzando valores de 5,50 a 5,70 a las 24 h post mortem(33,34,35). Los presentes resultados correspondientes al día 9 se encontraron ligeramente elevados otros valores reportados(34) (pH 6.0); sin embargo, los autores reportan solamente con un día de vida de útil. Por lo que nuevamente se sugiere que la ligera alcalinización presentada ofrezca una presunta mejora en la vida útil. El valor de pH se ve afectado por el contenido en glucógeno del músculo y el cual, a su vez, por el estrés previo al sacrificio. Como se muestra en el Cuadro 4, los valores de pH fueron elevados durante la vida útil, lo que concuerda con otros reportes que sugieren que concentraciones bajas de glucógeno elevan el pH, siendo más susceptible la carne a la alteración microbiológica por una utilización temprana de aminoácidos(36,37). Sin embargo, en el presente estudio el glucógeno no fue evaluado para determinar si fue la causa del no descenso 695


Rev Mex Cienc Pecu 2020;11(3):686-700

del pH, siendo un área de oportunidad para futuras investigaciones. Como en otros alimentos proteicos mantenidos en refrigeración y en aerobiosis, el pH de la carne de conejo aumenta a medida que el almacenamiento progresa debido a la actividad bacteriana(38). Lo cual concuerda con los resultados de la presente investigación, donde los valores del pH presentaron un incremento conforme a la evolución de la vida útil, en los tres tratamientos analizados. Para las variables luminosidad, intensidad de rojo e intensidad de amarillo, no existieron diferencias significativas (P≥0,05) entre tratamientos ni en vida de útil (Cuadro 4). Los valores obtenidos oscilaron para L* en el primer día de vida útil, desde 59.76 hasta 61.38 y para el día 9, desde 56.94 a 58.68. Así, en el día 9, los valores se encontraron ligeramente por debajo de otras evaluaciones en carne de conejo que mencionaron un valor para la luminosidad de 59.48(39,40). En cuanto a otros reportes, los presentes valores se localizaron ligeramente por encima de los reportados con 54.9(41). En el caso de a*, el rango de los presentes reportes se encontró entre 1.21 y 3.75 que se asemejan a los indicados por los autores ya mencionados (2.49 y 2.84, respectivamente). En el caso de b*, la carne de la presente investigación presentó ligeros tonos más amarillos, ya que los valores de esta variable oscilaron entre 2.78 y 5.17, que concuerdan con otros valores de 4.3(41). Finalmente, el color no se vio afectado por los tratamientos, lo que sugiere que la calidad de la carne tratada con extracto acuoso de ajo pueda no causar cambios en la decisión de compra del consumidor.

Conclusiones e implicaciones La adición del extracto acuoso de ajo en la dieta de conejos tuvo un efecto principalmente en vida útil, ya que se aumentó la calidad microbiológica de la carne, al disminuir la cuenta de psicrófilos, y como consecuencia se obtuvo una mejora en la vida útil de dos días (Total de 9 días), sin tener efecto sobre los indicadores productivos ni la calidad física de la carne (pH y color).

Agradecimientos Al Consejo Nacional de Ciencia y Tecnología de México (CONACyT) por el apoyo brindado a lo largo del programa de maestría. Al financiamiento otorgado a través del Fondo Desarrollo de Capacidades en Ciencia de la Carne y Caracterización del Valor Nutritivo de las Carnes Comercializadas en México y Uruguay, así como al PCARN (Programa de 696


Rev Mex Cienc Pecu 2020;11(3):686-700

Maestría y Doctorado en Ciencias Agropecuarias y Recursos Naturales en el Área Académica de Alimentos y Tecnología Agroindustrial) de la Universidad Autónoma del Estado de México, en el cual Daniel Arzate Serrano obtuvo el Grado de Maestro. Publicación financiada con recursos PFCE2016.

Literatura citada: 1. González-Miguel ME, López-Malo A. Frutas conservadas por métodos combinados. Temas Selec Ing Alim 2010;4-2: 58-67. https://www.udlap.mx/WP/tsia/files/No4-Vol2/TSIA-4(2)-Gonzalez-Miguel-et-al-2010.pdf. Consultado 30 Mar, 2019. 2. Hernández P. Enhancement of nutritional quality and safety in rabbit meat. Meat Quality and Safety. 9° Word Rabbit Congress. Spain. 2008:1287-1300. 3. Briens C, Arturo-Schaan M, Grenet L, Robert F. Effect of plant extracts on antioxidant status of fattening rabbits. Proc. 11émes Journées de la Recherche Cunicole. France. 2005:217-220. 4. López T. El ajo propiedades farmacológicas e indicaciones terapéuticas. Offarm: Farmacia y Soc 2007;(26):8-81. 5. Goulas AE, Kontominas MG. Combined effect of light salting, modified atmosphere packaging and oregano essential oil on the shelf-life of sea bream (Sparus aurata): Biochemical and sensory attributes. Food Chem 2007;(100):287-296. 6. Cardinali R, Cullere M, Dal-Bosco A, Mugnai C, Ruggeri S, Mattioli S, et al. Oregano, rosemary and vitamin E dietary supplementation in growing rabbits: Effect on growth performance, carcass traits, bone development and meat chemical composition. Livest Sci 2015;(175):83-89. 7. Badr HM. Use of irradiation to control foodborne pathogens and extend the refrigerated market life of rabbit meat. Meat Sci 2004;(67):541-548. 8. Rodríguez JM, García ML, Santos JA, Otero A. Development of the aerobic spoilage flora of chilled rabbit meat. Meat Sci 2005;(70):389-394. 9. Nakyinsige K, Sazili AQ, Aghwan ZA, Zulkifli I, Goh YM, Abu-Bakar F et al. Development of microbial spoilage and lipid and protein oxidation in rabbit meat. Meat Sci 2015;(108):125-31. 10. Pereira M, Malfeito-Ferreira M. A simple method to evaluate the shelf life of refrigerated rabbit meat. Food Control 2015;(49):70-74.

697


Rev Mex Cienc Pecu 2020;11(3):686-700

11. Kim YJ, Jin SK, Park WY, Kim BW, Joo ST, Yang HS. The effect of garlic or onion marinade on the lipid oxidation and meat quality of pork during cold storage. J Food Qual 2010;(33):171-185. 12. Salem AZM, Ryena AC, Elghandour MMY, Camacho LM, Kholif AE, Salazar MC, et al. Influence of Salix babylonica extract in combination or not with increasing levels of minerals mixture on in vitro rumen gas production kinetics of a total mixed ration. Ital J Anim Sci 2014;(13):873-879. 13. Mariezcurrena-Berasain MD, Mariezcurrena-Berasain MA, Pinzón-Martínez DL, Arzate-Serrano HD, Ugbogu EA, Salem AZM. Influence of dietary supplementation of garlic (Allium sativum L.) extract on cecal productions of total gas, carbon dioxide and fermentation profiles in rabbits. Agroforest Syst 2018;(1):1-9. 14. NOM-033-SAG/ZOO-2014. Norma Oficial Mexicana, Métodos para dar muerte a los animales domésticos y silvestres. México, D.F., Diario Oficial de la Federación. 2014. 15. AFNOR. Microbiology of food and animal feedings stuffs. Enumeration of thermotolerant coliforms by colony-count technique at 44 °C, routine method. Association Française de Normalisation, Paris, France. 1996. 16. NOM-092-SSA1-1994. Norma Oficial Mexicana, Bienes y Servicios. Método para la cuenta de bacterias aerobias en placa. México, DF. Diario Oficial de la Federación. 1994. 17. Carreño WH, López LC. Extracto de ajo como alternativa a los promotores de crecimiento en pollos de engorde. Conexión Agrop JDC 2012;(2):35-43. 18. Ortserga DD, Andyar AC, Anthony TI. Growth performance of growing rabbits fed graded levels of garlic (Allium sativum). Proc 33rd Ann Conf Nigerian Soc Anim Protein. Nigeria. 2008:189-191. 19. Ademola SG, Farinu GO, Adelowo OO, Fadade MO, Babatunde GM. Growth performance antimicrobial activity of garlic and ginger mixture fed to broiler. Proc Nigerian Soc Anim Prod. Nigeria. 2005:71-74. 20. Alagawany M, Ashour EA, Reda FM. Effect of dietary suplementation of garlic (Allium sativum) and turmeric (Curcuma longa) on growth performance, carcass traits, blood profile and oxidative status in growing rabbits. Ann Anim Sci 2016;(16):489-505. 21. Dalle AZ, Celia C, Szendrὅ Z. Herbs and spices inclusion as feed stuf for additive in growing rabbit diets and as additive in rabbit meat: A review. Livestock Sci 2016;(189): 82–90.

698


Rev Mex Cienc Pecu 2020;11(3):686-700

22. Hossain MJ, Kamruzzaman M, Akbar MA, Haque MA. Feeding garlic powder on growth performance, nutrient digestibility and carcass characteristics of rabbit. Int J Nat Soc Sci 2015;2(5):74-81. 23. European Commission. Commission Regulation Directive of 8 June 2001 laying down rules for the regular checks on the general hygiene carried out by the operators in establishments according directive 64/433/EEC on health conditions for the productions and marketing of fresh meat and directive 71/118/EEC on health problems affecting the production and placing on the market of fresh poultry meat, 471/20001/EEC. Spain. 2001:48-53. 24. López H, Braña VD, Hernández HI. 2013. Estimación de la Vida útil de la Carne. SAGARPA/CONACYT/COFUPRO/INIFAP/UAM/SNITT. SAGARPA 2013;1: 77. http://www.anetif.org/files/pages/0000000034/21-estimacion-de-la-vida-de-anaquelde-la-carne.pdf. Consultado 27 Feb, 2019. 25. Ponce AE, Braña VD, López HL, Delgado SE. Aspectos microbiológicos como indicadores de frescura de la carne. Evaluación de la frescura de la carne. INIFAP 2013;(1):10-23. 26. Rodríguez-Calleja JM, Santos JA, Otero A, García-López ML. Microbiological quality of rabbit meat. J Food Protec 2004;(67):966-971. 27. Margüenda I, Martín NN, Rebollar PG, Robinson MV, Fernández LS, Machota SV, et al. Bleeding efficiency and meat oxidative stability and microbiological quality of New Zealand White rabbits subjected to halal slaughter without stunning and gas stun-killing. Asian Australas J Anim Sci 2014;(27):406-413. 28. Zwietering MH, Jongenburger I, Rombouts FM, Van’t RK. Modeling of the bacterial growth curve. Appl Environ Microb 1990;(56):1875-1881. 29. Zwietering MH, De Koos JT, Hasenack BE, Wit JC, Van’t K. Modeling of bacterial growth as a function of temperature. Appl Environ Microb 1991;(57):109-110. 30. Park SY, Chin KB. Evaluation of pre-heating and extraction solvents in antioxidant and antimicrobial activities of garlic, and their application in fresh pork patties. International J Food Sci Tech 2010;(45):365-373. 31. Yin MC, Cheng WS. Antioxidant and antimicrobial effects of four garlic-derived organosulfur compounds in ground beef. Meat Sci 2003;(63):23-28. 32. Gheisari HR, Ranjbar VR. Antioxidative and antimicrobial effects of garlic in ground camel meat. Turk J Vet Anim Sci 2012;(36):13-20.

699


Rev Mex Cienc Pecu 2020;11(3):686-700

33. De Moura KA, Santos-Mendonça RC, De Miranda LA, Dantas MC. Aqueous garlic extract and microbiological quality of refrigerated poultry meat. J Food Process Pres 2005;(29):98-108. 34. Pacheco JV, Tomé E, Guerra M, Raybaudi R. Efecto antioxidante y antimicrobiano de sales de ácidos orgánicos y extractos naturales en filetes de bagre dorado (Brachyplatystoma rousseauxii) refrigerados. Rev Venez Cien y Tec Alim 2011;2(1):016-040. 35. Albarracín W, Sánchez I. Caracterización del sacrificio de corderos de pelo a partir de cruces con razas criollas colombianas. Revista MVZ Córdoba 2013;(18): 3370-3378. 36. SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Manual de análisis de calidad en muestras de carne. México. 2001. 37. Garrido MD, Bañon S, Álvarez D. Medida del pH. En Cañeque V, Sañudo C, editores. Estandarización de las metodologías para evaluar la calidad del producto (animal vivo, canal, carne y grasa) en los rumiantes. Cádiz, España: INIA; 2005. 38. Dainty RH, Mackey BM. The relationship between the phenotypic properties of bacteria from chill-stored meat and spoilage processes. J Appl Bacteriol 1992;(73):103-114. 39. Nychas JE, Drosinos EH, Board RG. Chemical changes in stored meat. In: Davies A, Board R. The microbiology of meat and poultry. Blackie Acad Prof 1998;1:288-326. https://es.scribd.com/doc/88599812/Microbiology-of-Meat-and-Poultry. Accessed Feb 24, 2019. 40. Liste G, María GA, Villarroel M, López M, Olleta JL, Sañudo C, et al. Efecto del trasporte sobre la calidad de la carne y el bienestar del animal en conejos comerciales durante la estación cálida en Aragón. XXIX Symposium de Cunicultura. Ciudad de México:2004:62-68. 41. Ramírez J. Características bioquímicas del músculo, calidad de la carne y de la grasa de conejos seleccionados por velocidad de crecimiento [tesis doctoral]. Centro de Tecnología de la Carne. Barcelona, España: Universidad de Barcelona; 2004.

700


https://doi.org/10.22319/rmcp.v11i3.5420 Artículo

El aceite esencial y bagazo de orégano (Lippia berlandieri Schauer) afectan el comportamiento productivo y la calidad de la carne de conejo

Jesica Leticia Aquino-López a América Chávez-Martínez a José Arturo García-Macías a Gerardo Méndez-Zamora b Ana Luisa Rentería-Monterrubio a* Antonella Dalle-Zotte c Luis Raúl García-Flores a

a Universidad

Autónoma de Chihuahua. Facultad de Zootecnia y Ecología, Km. 1. Periférico Francisco R. Almada, Chihuahua, Chih. México. b

Universidad Autónoma de Nuevo León. Facultad de Agronomía. General Escobedo, Nuevo León, México. c

Universidad de Padua. Departamento de Medicina, Producción y Salud Animal. Legnaro, Italia.

* Autor de correspondencia: arenteria@uach.mx

Resumen: Se evaluó el efecto del aceite esencial de orégano (AEO) y bagazo de orégano (BO) incorporados en la dieta sobre los parámetros productivos, variables de sacrificio y calidad de la carne de conejos. Un total de 100 conejos (30 d de edad) fueron distribuidos en seis tratamientos T1: control, T2: 0.25 g/kg de AEO, T3: 0.40 g/kg de AEO, T4: 20% de BO, T5: 0.25 g/kg de AEO + 20% de BO y T6: 0.40 g / kg de AE + 20% de BO. El mayor peso vivo

701


Rev Mex Cienc Pecu 2020;11(3):701-717

fue el T6 (P˂0.0001). En 37, 44 y 51 días, T3 presentó el menor consumo de alimento (P=0.0089) y T6 tuvo la mejor ganancia de peso (P=0.0172). La conversión alimenticia fue mejor (P=0.0138) en T5 a los 37 días. El rendimiento de la canal fría y lomo fue más alto en T2, T4 y T5 (P<0.001). El pH incrementó (P=0.0190) en 10 días post mortem para T1, T4, T5 y T6. La capacidad de retención de agua fue mayor (P=0.0500) en T2, T4 y T6; a* aumentó (P<0.0004) en el día 10 post mortem, y b* fue menor (P˂0.0430) en T2 a 24 h y 10 días post mortem. En conclusión, 0.25 y 0.40 g/kg de AEO con 20% de BO influyeron positivamente en el comportamiento productivo, variables de sacrificio, características de la canal y calidad de la carne de conejo. Palabras clave: Aceite esencial, Comportamiento productivo, Sacrificio, Canal, Carne, Color.

Recibido: 21/06/2019 Aceptado: 28/08/2019

Introducción La carne de conejo destaca por sus características y propiedades nutricionales, siendo una carne magra, baja en grasa (60 % del total de los ácidos grasos son insaturados), rica en minerales (potasio, fósforo y magnesio), proteínas y aminoácidos de alto valor biológico, baja en colesterol y sodio (1-4). El orégano es una planta aromática que posee timol y carvacrol en su aceite esencial (AEO), los cuales le confieren un efecto antioxidante y antimicrobiano(5,6). Al extraer el aceite esencial del orégano se obtiene un residuo llamado bagazo de orégano (BO), que es rico en flavonoides, con actividad antioxidante y antimicrobiana(7,8). En la industria del orégano el producto de comercialización es el aceite esencial, y el bagazo es considerado un desecho(9). El orégano mexicano (Lippia berlandieri Schauer) es una especie caracterizada por un fuerte olor y alto rendimiento de aceites esenciales(10), características atribuidas al alto contenido de carvacrol que superan al Origanum vulgare(11). Los principales compuestos químicos del género Lippia son carvacrol, timol, cimeno, pineno y linalol. Estos componentes le proporcionan actividad antibacteriana, antioxidante, antiviral, anti-fúngico e insecticida(12). El AEO se ha utilizado en la producción y engorda de conejos(13,14,15,16), así como otros extractos de plantas y aceites esenciales. Sin embargo, el efecto del BO no ha sido reportado en el comportamiento productivo y calidad de la carne de conejo. Inclusive, el efecto de 702


Rev Mex Cienc Pecu 2020;11(3):701-717

aceites esenciales en la productividad de los conejos es controversial y aún está en investigación. El conejo es capaz de aprovechar una amplia variedad de ingredientes en su dieta debido a su fisiología digestiva(17,18), lo que permite incluir diferentes ingredientes en su dieta con el fin de mejorar las características productivas y modificar las características de la carne(13,19). El presente estudio tuvo como objetivo evaluar el efecto del aceite esencial y del bagazo de orégano sobre los parámetros productivos y calidad de la carne de conejos.

Material y métodos Crianza y tratamientos

Se utilizaron 100 conejos mestizos de ambos sexos (44 hembras y 56 machos) de 30 ± 2 días de edad y peso inicial de 0.778 ± 0.190 kg. Los conejos se distribuyeron aleatoriamente en seis tratamientos; T1: control (n=18), T2: 0.25 g/kg de AEO (n=14), T3: 0.40 g/kg de AEO (n=16), T4: 20% de BO (n=16), T5: 0.25 g/kg de AEO + 20% de BO (n=18) y T6: 0.40 g/kg de AE + 20% de BO (n=18). El AEO se extrajo de las hojas del orégano por arrastre con vapor de agua de acuerdo al protocolo del Centro de Investigación Biológica del Noroeste de México(20). El bagazo tuvo la siguiente composición porcentual: proteína cruda 11.5 7± 0.29, extracto etéreo 1.79 ± 0.18, fibra 14.05 ± 1.30, cenizas 6.31 ± 0.25 y materia seca 93.68 ± 0.25. La unidad experimental (UE) consistió en dos conejos del mismo sexo por jaula; T1 (9 repeticiones) 4 UE hembras y 5 UE machos, T2 (7 repeticiones) 3 UE hembras y 4 UE machos, T3 (8 repeticiones) 3 UE hembras y 5 UE machos, T4 (8 repeticiones) 4 UE hembras y 4 UE machos, T5 (9 repeticiones) 5 UE hembras y 4 UE machos y T6 (9 repeticiones) 3 UE hembras y 6 UE machos. Los conejos se alojaron en jaulas de alambre (45 x 60 x 40 cm) durante 42 días en un ambiente con 16 h de luz y 8 h de obscuridad y se les ofreció agua y alimento (Cuadro 1) ad libitum. El cuidado y manejo de los conejos durante la investigación fue de acuerdo a lo establecido en la Norma Oficial Mexicana NOM-062-ZOO(21).

703


Rev Mex Cienc Pecu 2020;11(3):701-717

Cuadro1: Raciones alimenticias experimentales suplementadas a conejos Trat.

M

PS

ST

Ingredientes (%) VyM CC FD Sal

ME

LI

AV

AEO (g/kg)

BO (%)

T1 74.10 19.50 2.60 0.60 2.20 1.00 0.50 0.40 0.00 16.00 0.00 0.00 T2 73.40 19.50 2.65 0.60 1.09 1.06 0.53 0.19 0.00 0.80 0.250 0.00 T3 73.10 19.80 2.65 0.60 1.09 1.06 0.53 0.19 0.00 0.80 0.400 0.00 T4 46.20 20.90 0.00 0.60 2.21 2.15 1.08 0.30 0.50 5.90 0.000 20.00 T5 45.71 21.12 0.00 0.50 2.23 2.23 1.09 0.30 0.50 5.90 0.250 20.00 T6 45.42 21.19 0.00 0.50 2.24 2.18 1.09 0.30 0.50 6.00 0.400 20.00 T1: control (n=18), T2: 0.25 g / kg de AEO (n=14), T3: 0.40 g / kg de AEO (n=16), T4: 20% de BO (n=16), T5: 0.25 g / kg de AEO + 20% de BO (n=18) y T6: 0.40 g / kg de AE + 20% de BO (n=18). M= maíz; PS= pasta de soya; ST= salvado de trigo; VyM= premezcla de vitaminas y minerales; CC= carbonato de calcio; FD= fosfato dicálcico; ME= metionina; LI= lisina; AV= aceite vegetal; AEO= aceite esencial de orégano; BO= bagazo de orégano.

Comportamiento productivo

El peso inicial (PI, kg) de cada conejo fue medido al inicio del experimento. Las variables estudiadas fueron peso del conejo (PC, kg), y consumo de alimento (CAL, kg) a los 37, 44, 51, 58, 65 y 72 días de engorda. Los datos obtenidos se utilizaron para estimar la ganancia de peso diaria por semana [GPS; (PCfinal – PCinicial - PI) / días] y la conversión alimenticia (CA; CAL / PC) como consumo de alimento en función del peso de los conejos.

Sacrificio, despiece de la canal y muestreo de carne

Finalizado el periodo de engorda, los conejos se identificaron y fueron transportados al Complejo de Ciencias de la Carne de la Universidad para su sacrificio de acuerdo a los lineamientos de la Norma Oficial Mexicana NOM-033-SAG/ZOO(22) y Simonová et al(23). El tiempo de transporte fue menor a 10 min. Los conejos no recibieron tiempo de ayuno para el sacrificio. Los conejos se insensibilizaron por medio de dislocación de la articulación atlanto-occipital, e inmediatamente se colgaron en ganchos de sacrificio por las patas traseras en la línea de proceso, y rápidamente desangrados por un corte en el cuello (vena yugular y arteria carótida) durante 3 min. Después, las patas delanteras, cabeza, piel con cola se separaron cuidadosamente; enseguida, la evisceración fue realizada, las patas traseras fueron separadas y la canal fue lavada. Finalmente, las canales se escurrieron durante 5 min y almacenadas a 4 ± 1.0 °C por 24 h. Durante este proceso, se registró el peso al sacrificio (PS), el peso de sangre, piel con cola, patas delanteras y traseras, cabeza, vísceras y el peso de la canal caliente (n= 100); así, estos pesos fueron expresados en porcentaje del PS, 704


Rev Mex Cienc Pecu 2020;11(3):701-717

considerándolos como variables de sacrificio: sangre, piel, cabeza, patas, vísceras y rendimiento de canal caliente (RCC). El peso de la canal fría se tomó 24 h post mortem para determinar el rendimiento de la canal fría (RCF). El promedio de peso al sacrificio fue de 1.86 ± 0.44 kg. Los cortes primarios (despiece: lomo, piernas, brazos y costillar) de las canales obtenidas (n= 100) se realizaron de acuerdo al criterio de armonización descrito por Blasco y Ouhayoub(24). Los pesos de las piezas se expresaron en función del PC. La canal considerada estaba desprovista de cabeza, hígado, riñones y órganos torácicos. Finalmente, los músculos Longissimus lumborum fueron separados y almacenados (4 ± 1.0 °C) hasta su evaluación de la calidad de la carne.

Propiedades fisicoquímicas de la carne La evaluación fisicoquímica de la carne se realizó por triplicado en el músculo Longissimus lumborum, a las 24 h y 10 días post mortem. El pH se midió con un potenciómetro con un electrodo de punción (Sentron Integrated Sensor® Technology, Modelo 101), estos valores se convertieron a antilogaritmo para su análisis. La capacidad de retención de agua (CRA) se determinó de acuerdo a la técnica descrita por Owen et al(25); 0.3 g de carne se compactaron bajo un peso de 5 kg por 10 min, la CRA se calculó a partir de la diferencia de peso antes y después de la presión expresada en porcentaje. El color se evaluó utilizando el sistema CIE Lab(26), L* (luminosidad), a* (tendencia al color rojo) y b* (tendencia al color amarillo) con un espectrofotómetro (Konica Minolta®, Tokyo, Japón; CIE Standard Illuminant/Observer: D65/10).

Análisis estadístico Los datos del comportamiento productivo se analizaron con la instrucción PROC MIXED(27) y se utilizó como covariable el peso inicial de los conejos. Las variables sacrificio, despiece y calidad de la carne (24 h y 10 d) se analizaron usando el modelo lineal general(27). Cuando existió diferencia (P≤0.05) entre tratamientos, las medias de las variables fueron analizadas con la prueba estadística Tukey.

Resultados y discusión El Cuadro 2 muestra el comportamiento productivo de conejos suplementados con aceite esencial y bagazo de orégano mexicano. Los conejos suplementados con BO tuvieron los pesos más altos. A los 37 días de edad (P<0.0001), los conejos del T4 presentaron el peso más alto (1.12 kg), mientras los conejos de la dieta control (T1) tuvieron los menores pesos (0.90 kg). A los 44, 51, 58, 65 y 72 d de edad (P<0.0001), los pesos vivos más altos estuvieron 705


Rev Mex Cienc Pecu 2020;11(3):701-717

en el T6 (1.38, 1.51, 1.79, 1.88 y 2.08 kg) y los más bajos en el T3 (1.03, 1,08, 1.32, 1.57 y 1.67 kg). Los resultados obtenidos a los 37 días de edad podría asociarse a que el periodo de adaptación de la flora intestinal de los conejos con el orégano aún continuaba(28), por lo que una dosis menor y la actividad biológica del BO dieron lugar a mejores pesos. Lo anterior se puede confirmar con los resultados de los periodos posteriores, donde los mayores pesos se presentaron en los conejos suplementados con 400 ppm de AEO + BO; en esta etapa los conejos ya estaban adaptados a la dosis de AEO y la actividad biológica de éste aunado al BO se expresó positivamente. Abdel-Khalek(29) indicó que la suplementación de conejos con antioxidantes como acetato de alfa tocoferol y vitamina C tiene un efecto positivo en los parámetros productivos. Por otro lado, el aporte de fibra del BO, pudo contribuir al equilibrio de la flora intestinal impactando positivamente en la eficiencia alimenticia(30). El T1 y los tratamientos con aceite esencial (T2 y T3) se comportaron de manera similar (P=0.9403). Estos resultados coinciden con los obtenidos por Cardinali et al(15), quiénes no encontraron diferencia en el peso vivo al adicionar aceites esenciales en la dieta de conejos. Cuadro 2: Comportamiento productivo de conejos suplementados con aceite esencial y bagazo de orégano (medias de cuadrados mínimos ± error estándar) Variable/ Días edad

Tratamientos T1

T2

T3

T4

T5

T6

Pvalue

Peso vivo (kg) 0.08bc

0.08c

0.94 ± 0.08bc

1.12 ± 0.08a

1.10 ± 0.08ab

1.09 ± 0.08ab

< 0.0001

± 0.08bc

0.08c

± 0.08ab

± 0.08ab

0.08a

< 0.0001

37

0.90 ±

44

1.07 ± 0.08abc

1.07

51

1.16 ± 0.09ab

1.21 ± 0.08bc

1.08 ± 0.08c

1.45 ± 0.08ab

1.44 ± 0.08ab

1.51 ± 0.08a

< 0.0001

58

1.44 ±

0.09bc

± 0.08bc

1.32 ±

0.08c

1.69

± 0.08ab

1.62

± 0.08ab

1.79 ±

0.08a

< 0.0001

1.53 ±

0.09ab

1.57 ±

0.08b

1.78

± 0.08ab

1.77

± 0.08ab

1.88 ±

0.08a

0.0002

1.72 ±

0.09ab

1.67 ±

0.08b

1.97

± 0.08ab

1.99

± 0.08ab

2.08 ±

0.08a

0.0031

65 72

0.92 ±

1.37

1.52 ± 1.68

0.09b

± 0.09ab

1.03 ±

1.31

1.33

1.38 ±

Consumo de alimento (kg) 37

0.34 ± 0.10b

0.37 ± 0.10b

0.39 ± 0.10b

0.79 ± 0.10a

0.72 ± 0.10a

0.74 ± 0.10a

44

0.26 ±

0.10b

± 0.10ab

0.19 ±

0.10b

0.32

± 0.10ab

± 0.10ab

0.47 ±

0.10a

0.0089

51

0.36 ±

0.11ab

0.20 ±

0.10b

0.39

± 0.10ab

0.45 ±

0.10a

0.0170

58

0.54 ± 0.11

0.32 ± 0.10

0.41 ± 0.10

0.42 ± 0.10

0.35 ± 0.10

0.44 ± 0.10

0.4518

65

0.40 ± 0.12

0.53 ± 0.11

0.76 ± 0.11

0.35 ± 0.11

0.51 ± 0.10

0.39 ± 0.10

0.0520

72

0.74 ± 0.11

0.59 ± 0.11

0.39 ± 0.11

0.63 ± 0.10

0.73 ± 0.10

0.70 ± 0.10

0.6343

0.27

0.42 ±

0.10a

0.35

0.45 ±

0.10a

< 0.0001

T1= control (n=18), T2= 0.25 g / kg de AEO (n=14), T3= 0.40 g / kg de AEO (n=16), T4= 20% de BO (n=16), T5= 0.25 g / kg de AEO + 20% de BO (n=18) y T6= 0.40 g / kg de AE + 20% de BO (n=18). abc Diferentes literales entre columnas indican diferencia significativa (P˂0.05).

El consumo de alimento fue influenciado por efecto de los tratamientos (P<0.0001). A los 37 días de edad, el mayor consumo (0.79 kg) lo tuvieron los conejos del T4. Al día 44 (P=0.0089), los conejos del T6 presentaron mayor consumo (0.47 kg), mientras que los conejos del T3 tuvieron los menores consumos (0.19 kg). A los 51 d de edad (P=0.0170), los 706


Rev Mex Cienc Pecu 2020;11(3):701-717

animales del T2, T5 y T6 presentaron los mayores consumos (0.42, 0.45 y 0.45 kg, respectivamente), en el mismo periodo los conejos del T3 tuvieron el menor consumo de alimento (0.20 kg). De los 58 a los 72 días, el tratamiento no influyó en el consumo de alimento (P=0.4518, 58 d; P=0.0520, 65 d; P=0.6343, 72 d). Los resultados encontrados podrían deberse al tipo de fibra aportada por el BO; Margüenda et al(31) mencionaron que el nivel y el tipo de fibra son factores importantes para regular el tiempo de retención en el ciego y por tanto el consumo de alimento. Por otra parte, Bakkali et al(5) indicaron que algunos componentes de los aceites esenciales no tienen objetivos celulares específicos, pero pueden provocar cierta toxicidad membranal, similar al mecanismo de acción bactericida; en los organismos eucariotas provocan despolarización de las membranas mitocondriales, disminuyendo el potencial de membrana, lo que afecta algunos canales iónicos, y como consecuencia el pH disminuye y modifica la actividad enzimática digestiva. Al respecto, se ha señalado(32) que los compuestos fenólicos presentes en el orégano favorecen la absorción de nutrientes y estimulan la secreción de enzimas digestivas. Esto pudo ocasionar que a los 37, 44 y 51 días los animales alimentados con BO presentaran mayor consumo y peso vivo, mientras que en el resto de los periodos no hubo diferencia entre tratamiento; probablemente porque los animales ya estaban habituados al alimento y aumentaron su consumo con respecto a los periodos anteriores. La ganancia semanal de peso fue influenciada por efecto de los tratamientos (Cuadro 3). Al día 37 (P<0.0001) los conejos suplementados con BO (T4) presentaron las mayores ganancias (0.34 kg), mientras que los de T1 y T2 las menores (0.13 kg). A los 44 d de edad (P=0.0172) la mejor ganancia de peso (0.28 kg) se observó en el T6, mientras que la menor se encontró en T3 (0.09 kg). Al día 51 (P=0.0126) las ganancias de peso más elevadas se registraron en los T2, T4 y T6 (0.14 kg), y las más bajas en T3 (0.05 kg). A los 65 d (P=0.0257), T3 tuvo la mayor ganancia de peso (0.23 kg), mientras que los animales de T6 fueron los que ganaron menos (0.10 kg). En 58 (P=0.3752) y 72 d (P=0.7100) no se encontró diferencia en la ganancia de peso, lo que coincide con el consumo de alimento en dichos periodos, similar en todos los tratamientos. La mayor ganancia de peso a los días 37, 44 y 51 d de T6 se puede explicar el mayor consumo de alimento observado en dicho tratamiento durante el mismo periodo. Los resultados encontrados muestran una clara relación entre el consumo de alimento y la ganancia de peso, sugiriendo que la suplementación con orégano influye sobre la ganancia de peso.

707


Rev Mex Cienc Pecu 2020;11(3):701-717

Cuadro 3: Eficiencia productiva de conejos suplementados con aceite esencial y bagazo de orégano mexicano (medias de mínimos cuadrados ± error estándar) Varia bles/ Días

Tratamientos T1

T2

T3

T4

T5

T6

Pvalue

Ganancia de peso semanal (kg) 37

0.13 ± 0.05b

0.13 ± 0.05b

0.15 ± 0.05b

0.34 ± 0.05a

0.32 ± 0.05a

0.31 ± 0.05a

< 0.0001

44

0.17 ± 0.05ab

0.16 ± 0.05ab

0.09 ± 0.05b

0.19 ± 0.05ab

0.22 ± 0.05ab

0.28 ± 0.05a

0.0172

51

0.11 ±

0.05ab

0.05ab

0.05a

0.0126

58

0.37 ± 0.05 0.05ab

65

0.11 ±

72

0.20 ± 0.05

0.14 ±

0.05a

0.17 ± 0.05 0.15 ±

0.05ab

0.17 ± 0.05

0.05 ±

0.05b

0.25 ± 0.05 0.23 ±

0.05a

0.10 ± 0.05

0.14 ±

0.05a

0.23 ± 0.05 0.09 ±

0.05b

0.19 ± 0.05

0.12 ±

0.18 ± 0.05 0.15 ±

0.05ab

0.14 ±

0.27 ± 0.05 0.10 ±

0.05b

0.3752 0.0257

0.22 ± 0.05

0.20 ± 0.05

0.7100

Conversión alimenticia 0.26a

3.00 ± 0.26ab

2.35 ± 0.26b

2.24 ± 0.26b

2.69 ± 0.26ab

0.0138

3.64 ± 0.26

4.61 ± 0.26

3.82 ± 0.26

3.30 ± 0.26

3.52 ± 0.26

0.1764

3.76 ± 0.28

3.40 ± 0.26

4.09 ± 0.26

3.16 ± 0.26

3.97 ± 0.26

3.35 ± 0.26

0.1310

58

3.67 ± 0.29

3.88 ± 0.26

3.93 ± 0.26

4.00 ± 0.27

3.51 ± 0.26

3.94 ± 0.26

0.5642

65

4.08 ± 0.30

4.31 ± 0.27

3.57 ± 0.27

4.02 ± 0.27

4.04 ± 0.26

4.15 ± 0.26

0.2297

72

4.13 ± 0.28

3.87 ± 0.27

4.05 ± 0.27

3.64 ± 0.27

3.57 ± 0.26

3.72 ± 0.26

0.1695

37

3.62 ±

44

3.48 ± 0.26

51

2.91 ±

0.26ab

T1= control (n=18), T2= 0.25 g / kg de AEO (n=14), T3= 0.40 g / kg de AEO (n=16), T4= 20% de BO (n=16), T5= 0.25 g / kg de AEO + 20% de BO (n=18) T6= 0.40 g / kg de AE + 20% de BO (n=18). ab Diferentes literales entre columnas indican diferencia significativa (P˂0.05).

La conversión alimenticia (CA) fue influenciada por efecto de los tratamientos al inicio del estudio. En el día 37 (P=0.0138) la mejor conversión estuvo en T5 (2.24), mientras que el tratamiento control presentó la mayor CA (3.62). A los 44 (P=0.1764), 51 (P=0.1310), 58 (P=0.5642), 65 (P=0.2297) y 72 d de edad (P=0.1695) el tratamiento no influyó sobre CA. Los resultados encontrados pueden ser debido a que durante los primeros días de estudio los conejos habían sido destetados, y movilizados del alojamiento en el que se encontraban, lo que pudo representar cierto nivel de estrés en ellos; sin embargo, los conejos que consumieron orégano presentaron la mejor conversión, y de acuerdo con Abdel-Khalek(29) la adición de agentes antioxidantes en la dieta de conejos contribuye a disminuir los efectos negativos del estrés. Lo anterior puede corroborarse con lo encontrado en las semanas posteriores, donde los conejos ya estaban habituados a las condiciones externas y por lo tanto no presentaron diferencia significativa en dichos periodos para la conversión alimenticia. El Cuadro 4 presenta el efecto del aceite esencial y bagazo de orégano en el sacrificio y características de la canal de conejos. El rendimiento de la canal caliente (RCC) presentó efecto de los tratamientos (P<0.0004); T2 (48.19 %), T4 (50.66%) y T5 (49.87 %) presentaron el mayor rendimiento y T1 tuvo el menor (44.27 %). El rendimiento de los 708


Rev Mex Cienc Pecu 2020;11(3):701-717

órganos del tracto digestivo también fue influenciado por los tratamientos (P<0.0020); T4 presentó el menor rendimiento (21.02 %), mientras que T1 y T3 mostraron los mayores rendimientos (29.67 y 28.36 % respectivamente). El rendimiento de la cabeza (P<0.0050) fue mayor en los conejos de T1 (10.28 %) y menor en T4 (8.70 %) y T6 (8.68 %). El rendimiento de las vísceras torácicas (P=0.4064), patas (P=0.6988), piel (P=0.0542) y sangre (P=0.0530) no fue influenciado por efecto de los tratamientos. El menor rendimiento de vísceras abdominales puede atribuirse a la fibra proporcionada por BO, ya que esta puede estimular mecánicamente los movimientos peristálticos, promoviendo la circulación del contenido gastrointestinal(33); así mismo, puede regular estos procesos a través de los compuestos generados por la fermentación del alimento ingerido(30). Por otra parte, los mayores rendimientos observados en los tratamientos que tenían orégano puede ser atribuido a lo indicado por Hernández y Dalle-Zotte(19), los conejos tienen la capacidad de mejorar la incorporación de ácidos grasos y nutrientes proporcionados en la dieta al músculo. Esto sugiere que los conejos suplementados con orégano, incorporaron algunos compuestos de este a la carne, y por lo tanto las características químicas de la carne se modificaron, incrementando el rendimiento.

Cuadro 4: Efecto del aceite esencial y bagazo de orégano en el rendimiento de los componentes cárnicos y no cárnicos de conejo (%) Tratamiento

Canal caliente Canal fría

T1

T2

T3

T4

T5

T6

Pvalue

44.27±1.12b

48.19±1.00a

47.27±1.24a

50.66±1.18a

49.87±1.00

47.20±0.97a

<0.004

b

b

a

b

47.80±0.93a

46.62±1.16a

48.54±0.93

46.87±0.91a

a

b

23.39±0.76

23.44±0.74c

cb

b

43.07±1.05b

49.63±1.10a

b

24.49±0.76b

28.36±0.94a

21.02±0.90c

<0.001

Tracto digestivo

29.67±0.85a

Vísceras torácicas2

1.22±0.43

1.19±0.38

1.14±0.47

1.10±0.45

1.18±0.38

1.19±0.37

Ns

Cabeza

10.28±0.31a

9.085±0.27b

10.27±0.34a

8.70±0.32c

9.07±0.27bc

8.68±0.27c

<0.005

b

c

Patas y manos

3.91±1.03

5.37±0.91

3.89±1.14

3.51±1.09

3.61±0.91

4.63±0.89

Ns

Piel

8.01±0.53

8.02±0.47

9.03±0.59

10.03±0.56

9.25±0.47

9.28±0.46

Ns

Sangre

3.14±0.54

4.62±0.48

2.65±0.60

4.45±0.57

3.26±0.48

4.19±0.47

Ns

37.58 ± 0.92

Ns

14.30 ± 0.37

Ns

<0.002

Rendimiento de cortes tecnológicos (%) Pierna

37.72 ± 1.11

36.83 ± 0.97

37.63 ± 1.26

37.72 ± 1.15

39.22 0.97

±

Brazos

14.56 ± 0.44

13.37 ± 0.38

14.46 ± 0.50

14.21 ± 0.46

14.57 0.38

±

709


Rev Mex Cienc Pecu 2020;11(3):701-717

Lomo

20.94 0.74b

±

Costillar

20.24 ± 0.59

24.65 0.64a

±

20.98 ± 0.51

23.46 0.84ab

±

21.90 ± 0.67

25.27 0.76a

±

22.49 ± 0.61

26.06 0.64a

±

21.94 0.51

±

24.89 0.61a

±

21.90 ± 0.49

<0.001 Ns

T1= control (n=18), T2= 0.25 g / kg de AEO (n=14), T3= 0.40 g / kg de AEO (n=16), T4= 20% de BO (n=16), T5= 0.25 g / kg de AEO + 20% de BO (n=18) y T6= 0.40 g / kg de AE + 20% de BO (n=18). Vísceras torácicas: Pulmones, tráquea, esófago y corazón. abc Diferentes literales en el mismo renglón indican diferencia significativa (P˂0.05).

Con respecto al rendimiento de los cortes tecnológicos de la canal, la suplementación con AEO y BO no influyeron sobre el rendimiento de las piernas (P=0.6256), los brazos (P=0.1587) y el costillar (P=0.1810); sin embargo, el rendimiento del lomo fue más alto (P<0.0001) en T2 (24.65 %), T4 (25.27 %), T5 (26.06 %) y T6 (24.89 %). De acuerdo con Dalle-Zotte y Szendrö(3), las piezas que conforman la canal (piernas, brazos, costillar y lomo), el lomo presenta bajo contenido de grasa; no obstante, el conejo tiene la capacidad de incorporar los ácidos grasos proporcionados en la dieta al tejido lipídico y la grasa inter e intramuscular; así podría explicarse el mayor rendimiento del lomo de animales alimentados con orégano. En relación a las piernas, brazos y costillar no se encontró diferencia significativa (P>0.05) de los tratamientos, ya que de manera normal presentan mayor contenido de grasa. Por otra parte, García et al(34) observaron que la fermentación cecal origina cantidades variables de ácidos grasos volátiles a partir de la fibra proporcionada en la dieta, los cuales al ser absorbidos parcialmente cubren del 10 al 30 % de los requerimientos de energía de mantenimiento(35,36,37), representando un aporte energético extra a lo esperado al momento de balancear la ración alimenticia. Con respecto al pH, se encontró que; el pH de la carne de los conejos en los T1 y T4 incrementó (P=0.0190) conforme transcurría el tiempo (5.18 – 5.90 y 5.75 – 5.90, 24 h y 10 días post mortem respectivamente), mientras que la carne de T2 y T3 se mantuvieron (P>0.5524) a lo largo del tiempo (Cuadro 5).

710


Rev Mex Cienc Pecu 2020;11(3):701-717

Cuadro 5: Efecto del aceite esencial y bagazo de orégano en el pH, capacidad de retención de agua y color de la carne de conejo Tratamientos T1

T2

T3

T4

T5

T6

Pvalue

24 h post mortem pH

5.18±0.03b

5.80±0.03ab

5.82±0.03a

5.75±0.03b

5.76±0.03b

5.73±0.02b

0.0002

CRA (%)

55.99±1.45ab

59.40±1.62a

53.07±1.77b

60.30±1.45a

57.52±1.45ab

60.59±1.45a

0.0500

L*

62.26±0.82

56.60±0.73

59.78±1.01

56.66±0.91

57.06±0.76

57.19±0.66

0.3373

a*

5.63±0.68

4.09±0.62

4.84±0.82

3.73±0.74

4.51±0.64

4.08±0.56

0.3111

b*

7.51±0.44a

4.44±0.40c

6.34±0.52a

4.68±0.47bc

5.33±0.41bc

5.18±0.37bc

0.0430

10 días post mortem pH

5.90±0.03

5.87±0.03

6.00±0.04

5.90±0.03

5.89±0.03

5.92±0.03

0.5464

L*

55.90±0.82

57.92±0.73

57.47±0.95

58.73±0.91

56.50±0.70

58.59±0.71

0.3373

a*

9.23±0.68

6.95±0.62

7.71±0.78

6.89±0.74

7.63±0.60

6.25±0.60

0.3111

b*

7.11±0.44a

4.94±0.40b

6.82±0.49a

5.81±0.47ab

5.57±0.39ab

5.76±0.39ab

0.0430

L* = luminosidad; a* = tendencia al color rojo; b* = tendencia al color amarillo; pH= potencial de hidrógeno; CRA= capacidad de retención de agua. T1= control (n=18), T2= 0.25 g / kg de AEO (n=14), T3= 0.40 g / kg de AEO (n=16), T4= 20% de BO (n=16), T5= 0.25 g / kg de AEO + 20% de BO (n=18) y T6= 0.40 g / kg de AE + 20% de BO (n=18). ab Diferentes literales entre líneas indican diferencia estadística entre tratamientos en el tiempo post mortem (P˂0.05).

La CRA fue influenciada por efecto de los tratamientos (P=0.0500); la carne de T2, T4 y T6 presentaron mayor CRA (59.40, 60.30 60.59 % respectivamente), y T3 (53.07 %) exhibió la menor CRA. La actividad antioxidante del orégano sobre las fibras musculares(38) pudo haber influido sobre CRA, ya que en especies como el pollo se ha encontrado que la adición de agentes antioxidantes en la dieta preserva la funcionalidad de las membranas e incrementan su actividad como barrera semipermeable(39). Contrariamente, Meineri et al(40) no observaron el mismo efecto al adicionar Salvia hispánica en la dieta de conejos. Por otra parte, el pH se relaciona directamente con la CRA y éste puede variar de acuerdo a la hidrolisis de proteínas con liberación de amoniaco y la hidrolisis de lípidos con liberación de ácidos grasos(41). Se ha mencionado(42) que los aceites esenciales pueden coagular el citoplasma dañando los lípidos y proteínas; el daño a la membrana celular puede provocar la salida de 711


Rev Mex Cienc Pecu 2020;11(3):701-717

macromoléculas y lisis(43,44) modificando el pH(5), lo que afectaría la estabilidad de las proteínas impactando directamente en la CRA(45). Por otra parte, Dalle-Zotte y Zsendrö(3) mencionaron que la carne de conejo se caracteriza por ser rica en ácidos grasos insaturados y esto representa un problema para la carne, ya que es más sensible a la oxidación(29); en consecuencia, la funcionalidad de las membranas celulares es disminuida parcial o totalmente(40). Distintos estudios(2,3,46) reportaron una actividad antioxidante de los compuestos del orégano, sin embargo Cox et al(42) encontraron que algunos componentes de las plantas aromáticas como el orégano pueden tener un efecto negativo sobre los lípidos y proteínas, debido a que no tienen receptores celulares específicos(5); esto podría atribuirse a la diferencia encontrada en pH a las 24 h y 10 d post mortem en la carne de animales de T4. Respecto al color; la luminosidad (L*) no fue influenciada por los tratamientos (P=0.3373) en 24 h y 10 días post mortem; a excepción del T1 de 24 h a 10 días, ya que la carne de T1 fue más luminosa a las 24 h. La tendencia al color rojo (a*) no fue influenciada por el tratamiento (P=0.3111) pero si por el tiempo (P<0.0004), ya que a los 10 días post mortem el valor de a* aumentó en todos los tratamientos. La tendencia al color amarillo (b*) fue influenciada por efecto de los tratamientos (P<0.0430); T1 y T3 presentaron el mayor valor, mientras que T2 presentó el menor. Los resultados encontrados difieren con lo reportado por algunos autores, quienes al adicionar hojas de orégano(14) en la dieta y AEO en el agua de conejos en crecimiento(23), no encontraron efecto; lo anterior puede ser debido a que la dosis de AEO administrada fue menor a la evaluada en esta investigación con AEO y BO mexicano que pudieron influir en el color de la carne, debido al contenido de algunos compuestos fenólicos(47). En otras especies como las aves, ha sido observado que dosis altas de aceite esencial (500 mg kg-1) en la dieta provocan un efecto antioxidante significativo(48). Además, la presencia de oxígeno sobre la fibra muscular oxida la carne, tomando un color más oscuro(45); esto explicaría el valor alto de a* encontrado en los 10 días post mortem de todos los tratamientos, y menor L* en el tratamiento control (T1), lo que indica un efecto de la actividad antioxidante de los compuestos del orégano(49). Esto podría sugerir cambios en las características nutricionales y físicas de la carne, que podrían ser de interés para los investigadores.

Conclusiones e implicaciones Los resultados confirman que el BO puede ser parte integral de la dieta de conejos de engorda. Incluir 20% de bagazo de orégano en la dieta, influye positivamente en la ganancia diaria de peso, conversión alimenticia, el rendimiento en canal y del lomo e incrementa la capacidad de retención en agua; así mismo la combinación 0.25 g kg-1 de AEO + 20% BO tiene un efecto similar. Finalmente, la concentración mínima de aceite esencial de orégano 712


Rev Mex Cienc Pecu 2020;11(3):701-717

(0.25 g kg-1 de AEO) es suficiente para impactar las características productivas y de calidad. En conclusión, la inclusión de aceite esencial y bagazo de orégano (solos o combinados) en la dieta de conejos de engorda mejora las características productivas, calidad de la canal y carne.

Literatura citada: 1. Dalle Zotte, A. Perception of rabbit meat quality and major factors influencing the rabbit carcass and meat quality. Livest Prod Sci 2002;75(1):11-32. 2. Pla, MA. comparison of the carcass traits and meat quality of conventionally and organically produced rabbits. Livest Sci 2008;115(1):1-12. 3. Dalle-Zotte A, Szendrö Z. The role of rabbit meat as functional food. Meat Sci 2011;88: 319-331. 4. Cullere M, Dalle Zotte A. Rabbit meat production and consumption: State of knowledge and future perspectives. Meat Sci 2018;143;137-146. 5. Bakkali F, Averbeck S, Averbeck D, Idaomar M. Biological effects of essential oils, review. Food Chem Toxicol 2008;46(2):446-475. 6. García-Pérez E, Castro-Álvarez FF, Gutiérrez-Uribe JA, García-Lara S. Revision of the production, phytochemical composition, and nutraceutical properties of Mexican oregano. Rev Mex Cienc Agríc 2012;3(2):339-353. 7. Zavala N, Loarca P, García G. Evaluación del contenido fenólico, capacidad antioxidante y actividad citotóxica sobre células CaCo-2 del extracto acuoso de orégano (Lippia graveolens kunth). Congreso Nacional de Química Médica, Querétaro, México. 2006. 8. Corral TLC. Aprovechamiento de los residuos que se generan en la extracción del aceite esencial de orégano (Lippia graveolens HBK.s.l.) [tesis maestría]. Instituto Politecnico Nacional. Durango, Mexico; 2011. 9. Rolando A. Aceite esencial de orégano: tratamiento por digestión anaeróbica de los residuos generados en su obtención [tesis licenciatura]. Buenos Aires, Argentina. Universidad Nacional de Luján; 2007. 10. Avila-Sosa R, Gastelum-Franco MG, Camacho-Davila A, Torres-Muñoz JV, NervárezMoorillon GV. Extracts of Mexican Oregano (Lippia berlandieri schauer) with antioxidant and antimicrobial activity. Food Bioprocess Technol 2010;3(3):434-440.

713


Rev Mex Cienc Pecu 2020;11(3):701-717

11. Arcila-Lozano CC, Loarca-Piña G, Lecona-Uribe S, Gonzales de Mejía E. El orégano: propiedades, composición y actividad biológica de sus componentes. Arch Latinoam Nutr 2004;54(1):100-111. 12. Vazquez SR, Dunford NT. Bioactive components of Mexican oregano oil as affected by moisture and plant maturity. J Essent Oil Res 2005;17:668-671. 13. Soultos N, Tzikas Z, Christaki E, Papageorgiou K, Steris V. The effect of dietary oregano essential oil on microbial growth of rabbit carcasses during refrigerated storage. Meat Sci 2009;81:474-478. 14. Rotolo R, Gai F, Nicola S, Zoccarato I, Brugiapaglia A, Gasco L. Dietary supplementation of oregano and sage dried leaves on performances and meat quality of rabbits. J Integr Agr 2013;12:1937-1945. 15. Cardinali R, Dal-Bosco A, Mugnai C, Matiolis S, Ruggeri S, Dalle-Zotte A, Sartori A, Cullere M, Castellini C. Proc 10 th World Rabbit Congress. Effect of different dietary aromatic essences on meat quality of rabbit. W.R.S.A. Shark El-Sheikh, Egypt. 2012. 16. Méndez-Zamora G, Durán-Meléndez LA, Aquino-López JL, Santellano-Estrada E, SilvaVázquez R. Efecto del aceite de orégano (Poliomintha longiflora Gray) sobre la productividad y calidad de carne de conejos. Ecosistemas y Recursos Agropecuarios 2016;3:259-265. 17. Carabaño R, Piquer J, Menoyo D, Badiola I. The digestive system of the rabbit. In: de Blas C, Wiseman J editors. Nutrition of the rabbit. 2nd ed. Wallingford, UK: CAB International; 2010:1-18. 18. Mora-Valverde D. Usos de la morera (Morus alba) en la alimentación del conejo. El rol de la fibra y la proteína en el tracto digestivo. Agronomía Mesoamericana 2010;21:357366. 19. Hernández P, Dalle Zotte A. Influence of diet on rabbit meat quality In: de Blas C, Wiseman J editors. Nutrition of the rabbit. 2nd ed. Wallingford, UK: CAB International; 2010;163-178. 20. Rodríguez-Álvarez M, Alcaraz-Meléndez L, Real-Cosío SM. Procedimientos para la extracción de aceites esenciales en plantas aromáticas. Centro de Investigaciones Biológicas del Noroeste, SC. La Paz, Baja California Sur, México. 2012. 21. NOM-062-ZOO-1999. Especificaciones técnicas para la producción, cuidado y uso de animales de laboratorio. Norma Oficial Mexicana 1999. http://www.economianoms.gob.mx/noms/consultasAction.do. Consultado 15 May, 2019.

714


Rev Mex Cienc Pecu 2020;11(3):701-717

22. NOM-033-SAG/ZOO-2014. Métodos para dar muerte a los animales domésticos y silvestres. Norma Oficial Mexicana 2014. http://www.economianoms.gob.mx/noms/consultasAction.do. Consultado 15 May, 2019. 23. Simonová MP, Chrastinová L’, Mojto J, Lauková A, Szábová R, Rafay J. Quality of rabbit meat and phyto-additives. Czech J Food Sci 2010;28:161-167. 24. Blasco A, Ouhayoun J. Harmonization of criteria and terminology in rabbit meat research. Revised proposal. World Rabbit Sci 1993;4(2):93-99. 25. Owen J, Nuñez F, Arias M, Cano de los Ríos O. Manual de prácticas para cursos de tecnología de la carne. Facultad de Zootecnia. Universidad Autónoma de Chihuahua., Chihuahua, Chih., México; 1982. 26. CIE. International Commission on Illumination. Colorimetry. Vienna, Austria: Bureau Central de la CIE 1976. http://www.cie.co.at/. Consultado 15 May, 2019. 27. SAS. Statistical Analysis System. Version 9.1.3. SAS Institute Inc. Cary, North Carolina, 2006. 28. Botsoglou NA, Florou-Paneri P, Christaki E, Giannenas I, Spais AB. Performance of rabbits and oxidative stability of muscle tissues as affected by dietary supplementation with oregano essential oil. Arch Anim Nutr 2004;58(3):209-218. 29. Abdel-Khalek AM. Supplemental antioxidants in rabbit nutrition: A Review. Livest Sci 2013;158:95-105. 30. Gidenne T. Recent advances in rabbit nutrition: emphasis on fiber requirements. A review. World Rabbit Sci 2010;8(1):23-32. 31. Margüenda I, Nicodemus N, Vadillo S, Sevilla L, García-Rebollar P, Villarroel M, Romero C, Carabaño R. Effect of dietary type and level of fiber on rabbit carcass yield and its microbiological characteristics. Livest Sci 2012;145:7-12. 32. Hashemi SR, Davoodi H. Herbal plants and their derivatives as growth and health promoters in animal nutrition. Vet Res Commun 2011;35(3):169-180. 33. Trocino A, Xiccato G, Queaque PI, Sartori A. Effect of transport duration and gender on rabbit carcass and meat quality. World Rabbit Sci 2003;11(1):23-32. 34. García J, Carabaño R, de Blas JC. Effect of fiber source on cell wall digestibility and rate of passage in rabbits. J Anim Sci 1999;77(4):898-905. 35. Hoover WH, Heitmann RN. Effects of dietry fibre levels on weight gain, cecal volume and volatile fatty-acid production in rabbits. J Nutr 1972;102:375-380. 715


Rev Mex Cienc Pecu 2020;11(3):701-717

36. Parker DS. The measurement of production rates of volatile fatty acids in the caecum of the conscious rabbit. Br J Nutr 1976;36(1):61-70. 37. Marty J, Vernay M. Absorption and metabolism of the volatile fatty acids in the hind-gut of the rabbit. Br J Nutri 1984;51(2):265-277. 38. Stanley DW, Parkin KL. Biological membrane deterioration and associated quality losses in food tissues. Crit Rev Food Sci 1991;30(5):487-553. 39. Asghar A, Lin CF, Gray JI, Buckley DJ, Booren AM, Crackel RL, Flegal CJ. Influence of oxidised dietary oil and antioxidant supplementation on membrane-bound lipid stability in broiler meat. Brit Poultry Sci 1989;30(4):815-823. 40. Meineri G, Cornale P, Tassone S, Peiretti PG. Effects of Chia (Salvia hispánica L.) seed supplementation on rabbit meat quality, oxidative stability and sensory traits. Ital J Anim Sci 2010;9(10):45-49. 41. Dal Bosco A, Gerencsér Zs, Szendrö Zs, Mugnai C, Cullere M, Kovács M, et al. Effect of dietary supplementation of spirulina (Arthrospira platensis) and thyme (Thymus vulgaris) on rabbit meat appearance, oxidative stability and fatty acid profile during retail display. Meat Sci 2014;96(Issue 1):114-119. 42. Cox SD, Gustafson JE, Mann CM, Markham JL, Liew YC, Hartland RP, Bell HC, Warmington JR, Wyllie SG. Tea tree oil causes K+ leakage and inhibits respiration in Escherichia coli. Lett Appl Microbiol 1998;26:355-358. 43. Cox SD, Mann CM, Markham JL, Bell HC, Gustafson JE, Warmington JR, Wyllie SG. The mode of antimicrobial action of essential oil Melaleuca alternifolia (tea tree oil). J Appl Microbiol 2000;88:170-175. 44. Lambert RJW, Skandamis PN, Coote PJ, Nychas GJE. A study of the minimum inhibitory concentration and mode of action of oregano essential oil, thymol and carvacrol. J Appl Microbiol 2001;91:453-462. 45. Hui YH, Guerrero I, Rosmini MR. Ciencia y tecnología de carnes. LIMUSA. México; 2013. 46. Amadio C, Medina R, Dediol C, Zimmermann ME, Miralles S. Aceite esencial de orégano: un potencial aditivo alimentario. Rev FCA UNCUYO 2011;43:237-245. 47. Vijayalaxmi S, Jayalakshmi SK, Sreeramulu K. Polyphenols from different agricultural residues: Extraction, identification and their antioxidant properties. J Food Sci Technol 2015;52:2761-2769.

716


Rev Mex Cienc Pecu 2020;11(3):701-717

48. López-Bote CJ, Sanz M, Rey A, Castaño A, Thos J. Lower lipid oxidation in the muscle of rabbits fed diets containing oats. Anim Feed Sci Tech 1998;70:1-9. 49. Fasseas MK, Mountzouris KC, Tarantilis PA, Polissiou M, Zervas G. Antioxidant activity in meat treated with oregano and sage essential oils. Food Chem 2007;106:1118-1194.

717


https://doi.org/10.22319/rmcp.v11i3.5175 Artículo

Las rizobacterias halófilas mantienen la calidad forrajera de Moringa oleifera cultivada en sustrato salino

Verónica García Mendoza a Alex Edray Hernández Vázquez a José Luis Reyes Carrillo a Uriel Figueroa Viramontes b Jorge Sáenz Mata c Héctor Mario Quiroga Garza a Emilio Olivares Sáenz d Pedro Cano Ríos a José Eduardo García Martínez a*

a

Universidad Autónoma Agraria Antonio Narro. Posgrado en Ciencias Agrarias, Blvd. Raúl López Sánchez Km. 2. 27054, Torreón, Coah., México.

b

INIFAP, Campo Experimental La Laguna, Matamoros, Coah., México.

c

Universidad Juárez del Estado de Durango. Facultad de Ciencias Biológicas. Gómez Palacio, Durango, México.

d

Universidad Autónoma de Nuevo León. Facultad de Agronomía. Gral. Escobedo, Nuevo León, México.

* Autor de correspondencia: edugarmartz@gmail.com

Resumen: Para obtener un incremento en la producción forrajera de Moringa oleifera Lam. y de buena calidad se puede combinar el uso de compost a base de estiércol bovino y la inoculación de 718


Rev Mex Cienc Pecu 2020;11(3):718-737

biofertilizantes a base de rizobacterias promotores del crecimiento vegetal (PGPR). La evaluaciĂłn de esta producciĂłn se realizĂł en invernadero en TorreĂłn, Coahuila, MĂŠxico. Se utilizĂł compost de estiĂŠrcol bovino como sustrato (compost 50%, arena 40% y perlita 10%). Se programaron tres inoculaciones al ĂĄrbol (a los 40, 74 y 152 dĂ­as despuĂŠs de la siembra) con cuatro cepas de PGPR, los siguientes fueron los tratamientos T1: Bacillus paralicheniformis, T2: Acinetobacter guillouiae, T3: Aeromonas caviae, T4: Pseudomonas lini y Testigo: Sin bacteria, las cepas provenientes de la Poza Salada, Valle de Sobaco, Coahuila, MĂŠxico. Se realizaron tres cosechas en el ciclo verano-otoĂąo-invierno 2016-2017. Se evaluaron variables agronĂłmicas y bromatolĂłgicas para determinar la producciĂłn y calidad del follaje del ĂĄrbol. Las cepas Pseudomonas lini y Bacillus paralicheniformis proporcionaron una respuesta positiva en el desarrollo de M. oleifera forrajera en el perĂ­odo de verano-otoĂąo, incrementando la altura en las primeras semanas de desarrollo y proporcionando diĂĄmetros mĂĄs gruesos y firmes. El rendimiento y las variables bromatolĂłgicas no presentaron diferencia entre los tratamientos, sin embargo, se produjo un forraje de buena calidad. En promedio las hojas presentaron el 13.56 % de cenizas, 70.15 % de total de nutrientes digestibles, 93.16 % de digestibilidad in vitro de la materia seca, 19.72 % de fibra detergente neutra, 25.35 % de fibra detergente ĂĄcida y 24.15 % de proteĂ­na cruda. Palabras clave: Biofertilizantes, Biomasa, Composta, Digestibilidad, Fertilizantes, InoculaciĂłn, ProteĂ­na, Rumiantes.

Recibido: 04/12/2018 Aceptado: 24/07/2019

IntroducciĂłn La alimentaciĂłn a rumiantes, especialmente para la producciĂłn lechera, requiere el suministro de niveles altos de energĂ­a y proteĂ­na(1). Los suministros de concentrados convencionales generalmente son costosos(2). El ĂĄrbol de Moringa oleifera Lam., es una especie con alto valor nutricional y buena producciĂłn de biomasa llegando a tener una producciĂłn anual de 25 đ?&#x2018;Ą â&#x2C6;&#x2122; â&#x201E;&#x17D;đ?&#x2018;&#x17D;â&#x2C6;&#x2019;1 en condiciones de bosque tropical seco(3). AdemĂĄs de que los costos de alimentaciĂłn son relativamente bajos, diez veces mĂĄs bajos al utilizar M. oleifera que alimentos balanceados(4). Las raciones para el ganado lechero formuladas con forraje de M. oleifera, proporcionan un alto valor proteico entre 15-30 %, 16-53 % de FDN, con digestibilidades entre 52-85 %(5). El suministro de una dieta de M. oleifera fresca puede 719


Rev Mex Cienc Pecu 2020;11(3):718-737

ocasionar un mal sabor y aroma en la leche, pero si la dieta es con ensilado de M. oleifera, la leche muestra buenas características organolépticas(6) por lo que M. oleifera es una opción para complementar la alimentación del ganado lechero. Por otro lado, la intensificación de la producción de la industria lechera aumenta la generación de estiércol, lo que representa un riesgo de contaminación(7). Las excretas del ganado lechero tienen un menor impacto ambiental cuando se usan como abonos orgánicos(8). Sin embargo se debe tener cuidado con la utilización de este puesto que las cinco sales solubles (Na, K, Ca, Mg y S) acumuladas pueden generar efectos adversos(9). El aumento de la salinidad influye en la calidad del forraje, incluyendo materia orgánica (MO), proteína cruda (PC), fibra detergente neutra (FDN)(10). Más de la mitad del territorio mexicano es árido y semiárido y la diversidad natural, incluyendo su suelo, está siendo amenazado(11). Los futuros escenarios predictivos de acuerdo con el cambio climático, muestran el creciente riesgo de salinización en diferentes latitudes que requerirán un esfuerzo especial para mantener la producción de cultivos bajo estrés salino(12). El uso de biofertilizantes a base de rizobacterias promotores del crecimiento vegetal (PGPR), son una opción para reducir la contaminación del suelo, también causada en parte por fertilizantes nitrogenados(13). Las PGPR ejercen efectos benéficos en las plantas a través mecanismos directos e indirectos como la fijación de nitrógeno, síntesis de fitohormonas, solubilización de fósforo, secreción de sideróforos, el incremento en la permeabilidad de las raíces, inducción de resistencia sistémica, entre otros(14,15). En efecto, la inoculación de diversas cepas de PGPR permite el desarrollo de plantas en lugares con problemas de sequías, en suelos contaminados con metales pesados e incluso suelos salinos(16). La hipótesis supone que si se produce en suelos o sustratos con conductividades eléctricas elevadas, se puede utilizar la inoculación de PGPR halófilas para obtener una buena producción e incrementar la calidad, en este caso del forraje de M. oleifera. El objetivo de este trabajo fue evaluar la calidad de la producción de M. oleifera para fines forrajeros inoculados con PGPR halófilas, utilizando compost en el sustrato y té de compost en el riego ambos de estiércol bovino.

Material y métodos La investigación se realizó en la Universidad Autónoma Agraria Antonio Narro Unidad Laguna (UAAAN-UL), ubicada en Torreón, Coahuila, México, el cual presenta una altitud de 1,120 msnm. En el ciclo verano-otoño-invierno 2016-2017, en condiciones de invernadero. Las temperaturas máximas y mínimas fueron registradas durante el experimento.

720


Rev Mex Cienc Pecu 2020;11(3):718-737

El diseño experimental utilizado fue en bloques al azar, cinco tratamientos correspondientes a cuatro diferentes cepas de PGPR (Cuadro 1); y cinco repeticiones por tratamiento. Las PGPR fueron proporcionadas por la Facultad de Ciencias Biológicas de la Universidad Juárez del Estado de Durango, las cuales fueron aisladas de la rizósfera del pasto halófilo Distichlis spicata, tomado de la Poza Salada en el Valle de Sobaco, ubicado en el Municipio de Cuatrociénegas, Coahuila, México(17). Cuadro 1: Características de las rizobacterias promotores del crecimiento vegetal (PGPR) utilizadas en cada tratamiento (T) ID de cepa

Género/Especie de bacteria

Producción de AIA (µg)

PS

GSF (mm)

TS (%)

T1

LBEndo1

Bacillus 23.444±2.531 + paralicheniformis

4.589±0.221 15

T2

NFbEndo 2M2

Acinetobacter guillouiae

T3

KBEndo3 Aeromonas caviae

T4

KBEcto4

Te

Sin bacteria

+

+

+

<5

+

+

+

<5

Pseudomonas lini 36.730±0.011 +

4.112±0.042 15

AIA= ácido indol-3 acético; PS= producción de sideróforos; GSF= grado de solubilización de fosfatos; TS= tolerancia a la salinidad; Te= testigo. Fuente: Palacio-Rodríguez et al(17).

Se realizó una siembra directa de semilla de M. oleifera L. el 10 de julio de 2016, en bolsas negras de polietileno horadadas de 18 L de capacidad. El sustrato utilizado fue una mezcla de compost (50 %), arena (40 %) y perlita (10 %). El compost fue adquirido del rancho Ampuero, al cual se le aplicó el método de solarización antes de su utilización(18). Se colocó una semilla por bolsa a una profundidad de 5 cm. Previo a la siembra se aplicó un lavado al sustrato, por cada kilo de sustrato un litro de agua, para la disminución de sales. El acomodo de las macetas fue en cuatro hileras, con arreglo topológico en tresbolillo, con una separación entre tallos de 0.25 x 0.25 m y alcanzando una densidad de 16 árboles m-2. La inoculación de las bacterias PGPR fue a los 40 días después de la siembra, colocando 3 ml a una concentración de 1x108 ufc ml-1de PGPR, en la base del tallo y se realizaron inoculaciones a los ocho días después del primer y segundo corte. 721


Rev Mex Cienc Pecu 2020;11(3):718-737

Las variables evaluadas fueron: rendimiento, variables bromatológicas y relación hoja/tallo. El muestreo se realizó cuando el árbol alcanzó una altura promedio de 1.50 m, y antes de que iniciara la floración, dejando un forraje remanente a los 0.25 m de altura. Los riegos que se aplicaron fueron con té de compost, 1 L cada tercer día. Este té se obtuvo sumergiendo 5 kg de compost de estiércol bovino en una red dentro de un recipiente de 200 L. El agua se colocaba un día antes para lograr la evaporación del cloro que pudiera tener. En cada elaboración se adicionaron 90 g de piloncillo y se colocaron oxigenadores dentro del recipiente de 200 L durante 12 h. Transcurrido este tiempo se retiraba la red que contenía el compost y el té estaba listo para utilizarse. El Cuadro 2 muestra la composición química del compost y el té de compost obtenido. Cuadro 2: Composición química de macro y micronutrientes del compost y té de compost utilizados para el sustrato y el riego de M. oleifera ----------Macronutrientes----------Componente pH

P

K

Ca

Mg

Carbono orgánico

CE

N

MO

mS/cm

-------------------------------------%------------------------------

Compost

8.35

12.77

0.11

0.45

2.95

18.8

0.94

17.75

30.60

7.52

3.27

0.25

0.15

0.28

1.33

0.12

-----

0.52

---------------Micronutrientes-----------------Componente

pH

CE

Na

Fe

Cu

Zn

Mn

Bo

mS/cm

%

-------------------------ppm------------------------

Compost

8.35

12.77

0.43

5100.0 0

62.00 200.00 390.00 1.00

7.52

3.27

0.18

3.21

0.86

2.96

3.44

-----

La única plaga presentada durante el experimento fue Tetranychus urticae la cual se controló con aplicaciones de eBioluzión Plus vO® (Febea bio), insecticida orgánico de amplio espectro. Las variables agronómicas evaluadas fueron tomadas una vez por semana: altura del árbol, diámetro de tallo, número de tallos, número de hojas, tamaño de hojas, peso de la raíz, peso fresco y seco del forraje, rendimiento la relación hoja/tallo. 722


Rev Mex Cienc Pecu 2020;11(3):718-737

La altura del ĂĄrbol se tomĂł con un estadal colocĂĄndolo en la parte basal del suelo y tomando la altura hasta el ĂĄpice de la rama apical. El diĂĄmetro del tallo se midiĂł con un vernier, 3 cm arriba de la parte basal. Se contĂł el nĂşmero de tallos despuĂŠs del segundo y tercer corte. Se contĂł el nĂşmero de hojas compuestas de cada tallo. Se midiĂł el tamaĂąo de hoja con una cinta mĂŠtrica, la lectura se tomĂł desde el raquis primario hasta el foliolo apical. Se utilizĂł una balanza digital para tomar el peso de la raĂ­z; para esto se cortĂł el tallo desde la parte basal y se retirĂł todo el sustrato tratando de mantener la mayor cantidad de raĂ­z. El forraje se pesĂł en fresco en una balanza digital al momento de hacer el corte con tijeras para poda, hojas y tallos en conjunto y por separado (hojas sin el raquis y tallos incluyendo el raquis de las hojas). Para obtener el peso seco se llevaron las muestras de forraje al laboratorio, se colocĂł cada muestra en bolsas de papel con su respectiva etiqueta para secarse en estufa de aire forzado a 60 °C durante 24 h hasta obtener un peso constante en las muestras. Utilizando una balanza analĂ­tica se registrĂł el peso seco con el cual despuĂŠs se calculĂł el rendimiento de materia seca, sumando el peso seco de hojas mĂĄs el peso seco de tallos. La relaciĂłn hoja/tallo se calculĂł al dividir el peso seco de las hojas (PSH) entre el peso seco de los tallos (PST), con la ecuaciĂłn H/T = PSH/PST. Las variables bromatolĂłgicas se realizaron solo en el Ăşltimo corte e incluyeron: materia fresca (MF), materia seca (MS), cenizas, grasa, fibra detergente neutra (FDN), fibra detergente ĂĄcida (FDA), fibra cruda (FC), proteĂ­na cruda (PC), extracto libre de nitrĂłgeno (ELN), carbohidratos no fibrosos (CNF), digestibilidad in vitro de materia seca (DIVMS), energĂ­a neta de lactancia (ENL) y total de nutrientes digestibles (TND). Las muestras se secaron a 60 °C durante 24 h hasta obtener un peso constante, despuĂŠs se trituraron a travĂŠs de un tamiz de 1 mm antes del anĂĄlisis. Las cenizas se analizaron utilizando el procedimiento de AOAC(19) La grasa se extrajo utilizando el mĂŠtodo Goldfisch. La FDN y FDA se obtuvieron por medio del mĂŠtodo de Van Soest(20). La FC se determinĂł por el mĂŠtodo de Weende. La PC fue determinada con el mĂŠtodo Kjeldahl. La DIVMS se obtuvo utilizando la incubadora Daisy (Ankom Technology). Para el cĂĄlculo de ELN, CNF, EN L y TND se utilizaron las siguientes fĂłrmulas: ELN (%) = 100 â&#x20AC;&#x201C; (MS + PC + FC + Grasa + Cenizas), CNF (%) = 100 â&#x20AC;&#x201C; (PC + FDN + Grasa + Cenizas), ENL=1.044 - (0.0124*FDA) y TND = 31.4 + (53.1* ENL). Las variables se sometieron a un anĂĄlisis de varianza utilizando el programa estadĂ­stico SAS para Windows versiĂłn 9.0. En los casos donde se encontraron diferencias entre medias se aplicĂł la prueba de diferencia mĂ­nima significativa (DMS), con una significancia de đ?&#x203A;ź= 0.05. Se utilizĂł el programa Excel de Office 2010 para determinar la ecuaciĂłn de regresiĂłn en la variable altura.

723


Rev Mex Cienc Pecu 2020;11(3):718-737

Resultados Crecimiento

El crecimiento del árbol de M. oleifera de la siembra a la primera cosecha mostró una diferencia significativa entre los tratamientos de los 216 a los 247 días julianos. La última semana antes de la primera cosecha no fue afectada por los tratamientos aplicados, no mostró diferencia significativa, esto puede deberse al inicio de la floración (Figura 1). Este crecimiento fue en el período de verano, el cual muestra una tendencia lineal. El incremento promedio que presentó el árbol es de 3.16 cm por día, llegando a obtener una altura promedio de 1.76 m a los 66 días. En este período, el árbol presentó el mayor crecimiento en el experimento. Las temperaturas presentadas en este período favorecieron al crecimiento, las cuales fueron de 20-22 °C como mínima y de 38-42 °C como máxima. Figura 1: Crecimiento de Moringa oleifera de la siembra a la primera cosecha (66 días) 2016

T1= Bacillus paralicheniformis, T2= Acinetobacter guillouiae, T3= Aeromonas caviae, T4= Pseudomonas lini, Te= sin bacteria. (*, **= Indica diferencia significativa y altamente significativa, respectivamente, entre tratamientos para la fecha respectiva).

En la segunda cosecha del árbol se obtuvo una diferencia significativa en el crecimiento a partir de los 277 a 299 días julianos, excepto en las siguientes cinco semanas antes de la cosecha. Esta segunda cosecha correspondió al período de otoño, el crecimiento muestra 724


Rev Mex Cienc Pecu 2020;11(3):718-737

también una tendencia lineal. Sin embargo, presenta una disminución de 52 %, con respecto al crecimiento de verano; el incremento promedio es de 1.51 cm por día. Este decremento se atribuye al cambio de estación y con ello la disminución de la temperatura, la cual osciló entre 15-16 °C como mínima y entre 36 y 40 °C como máxima. La altura promedio de 1.50 m para su corte se alcanzó a los 77 días después de la primera cosecha. El árbol requirió de 11 días más que la primera cosecha para alcanzar la altura promedio antes de realizar la cosecha. Después de la segunda cosecha coincide con la entrada del invierno, el árbol no presentó crecimiento durante el primer mes, esto debido a las bajas temperaturas que oscilaron entre 9.5-10.5 °C como mínima y de 32.5-35.5 °C como máxima. Por lo tanto, la tercera cosecha no presentó diferencia significativa entre los tratamientos. El crecimiento muestra que los datos asemejan una regresión polinomial de segundo grado debido al crecimiento lento. La altura promedio para realizar el corte se alcanzó hasta los 117 días. El árbol requirió 40 días más para alcanzar la altura promedio para el corte en comparación con la segunda cosecha y 51 días más en comparación con la primera cosecha. En esta última cosecha se presentaron las primeras floraciones (2%). La plaga que se presentó en el desarrollo del experimento fue presencia de Tetranychus urticae.

Variables agronómicas

De las variables agronómicas evaluadas, el diámetro de tallo presenta diferencia significativa entre los tratamientos en la segunda y tercera cosecha (Cuadro 3). Los tratamientos que mayor diámetro de tallo obtuvieron fueron T1: Bacillus paralicheniformis y T4: Pseudomonas lini, estadísticamente son iguales. Después de la primera cosecha inicia el crecimiento nuevamente, el tallo principal de 0.25 cm de alto presenta rebrotes o tallos secundarios. El número de tallos secundarios varían, en el experimento se presentaron hasta 8 rebrotes, pero solo de 1 a 4 se desarrollan satisfactoriamente. Lo mismo sucedió después de la tercera cosecha.

725


Rev Mex Cienc Pecu 2020;11(3):718-737

Cuadro 3: Medias para las variable diámetro de tallo (DT), número de tallos (NoT), número de hojas (NoH), tamaño de hojas (TH) y peso de raíz (PR), en la evaluación de M. oleifera Primera cosecha Tratamiento DT (cm) NoT NoH TH (cm) PR (g) T1 1.413 a 1.00 a 14.56 a 41.75 a T2 1.363 a 1.00 a 14.88 a 41.72 a T3 1.381 a 1.00 a 14.31 a 41.66 a T4 1.450 a 1.00 a 14.13 a 43.69 a 1.394 a 1.00 a 14.19 a 42.59 a Te Segunda cosecha T1 2.110 a 1.85 a 11.90 a 40.95 a T2 1.915 b 1.65 a 11.70 a 42.45 a T3 1.915 b 1.65 a 11.35 a 37.25 b T4 2.015 ab 1.60 a 11.65 a 42.75 a 1.930 b 1.60 a 11.50 a 43.00 a Te Tercera cosecha T1 2.440 a 2.85 a 14.60 a 34.05 a 220.35 b T2 2.230 bc 3.35 a 14.65 a 33.20 a 178.90 bc T3 2.195 c 2.80 a 16.40 a 33.85 a 159.10 c T4 2.355 ab 2.75 a 15.00 a 36.50 a 341.50 a 2.190 c 2.70 a 11.65 b 36.35 a 156.10 c Te T1= Bacillus paralicheniformis, T2= Acinetobacter guillouiae, T3= Aeromonas caviae, T4= Pseudomonas lini, Te= sin bacteria. ab Diferente letra indica diferencia significativa entre tratamientos (P<0.05).

La raíz de la M. oleifera es tipo bulbo. El peso de la raíz recabado en la tercera cosecha presenta diferencia significativa entre los tratamientos, siendo el T4: Pseudomonas lini el que presenta el mayor peso con 341.54 g. En la tercera cosecha el número de hojas entre los tratamientos son estadísticamente iguales pero superior al control. El tratamiento T3: Aeromonas caviae y T4: Pseudomonas lini presentan el mayor número de hojas 16.4 y 15 hojas respectivamente. El tamaño de las hojas en los árboles no se ve afectado por los tratamientos aplicados para ninguna de las tres cosechas. El tamaño de hoja presenta un decremento conforme pasan los cortes. Las longitudes del tratamiento T4: Pseudomonas lini son 43.69, 42.75 y 36.50 para la primera, segunda y tercera cosecha respectivamente.

726


Rev Mex Cienc Pecu 2020;11(3):718-737

El rendimiento promedio de materia fresca en hoja fue de 9.44 t ha-1y en materia seca de 4.86 t . El rendimiento promedio de materia fresca en tallo fue de 25.08 t y en materia seca de 7.08 t. El rendimiento no fue afectado por los tratamientos aplicados (Cuadro 4). Cuadro 4: Medias para la variable rendimiento (t ha-1) la evaluación de M. oleifera inoculada con cuatro PGPR para la primera, segunda y tercera cosecha Primea cosecha RH RT Materia fresca T1 2.68 9.06 T2 2.58 9.10 T3 2.59 9.07 T4 2.52 10.04 Te 2.61 9.10 Materia seca T1 1.40 2.49 T2 1.36 2.46 T3 1.39 2.50 T4 1.41 2.64 Te 1.47 2.54

Segunda cosecha RH RT

Tercera cosecha RH RT

Total RH

RT

3.47 3.30 2.80 3.19 3.50

9.08 7.95 6.26 8.73 8.85

3.64 3.66 3.51 3.83 3.31

8.20 7.14 6.37 8.53 7.92

9.79 9.54 8.90 9.54 9.42

26.34 24.19 21.70 27.30 25.87

2.04 2.04 1.95 2.06 2.07

2.79 2.60 2.40 2.75 2.74

1.43 1.41 1.41 1.49 1.39

2.01 1.82 1.72 2.03 1.90

4.87 4.81 4.75 4.96 4.93

7.29 6.88 6.62 7.42 7.18

T1= Bacillus paralicheniformis, T2= Acinetobacter guillouiae, T3= Aeromonas caviae, T4= Pseudomonas lini, Te= sin bacteria; RH= rendimiento en hoja; RT= rendimeinto en tallo. (P>0.05).

La relación hoja/tallo muestra un aumento conforme aumentan las cosechas. El promedio de la relación hoja/tallo de la primera cosecha fue de 0.556, en la segunda y tercera cosecha fue de 0.768 y 0.754, respectivamente. El porcentaje de hoja promedio fue de 35.72, 43.40 y 42.96 % para la primera, segunda y tercera cosecha respectivamente. El Cuadro 5 muestra la relación hoja/tallo y el porcentaje de hoja que presentó el árbol, estas variables no fueron afectadas por los tratamientos.

727


Rev Mex Cienc Pecu 2020;11(3):718-737

Cuadro 5: Relación hoja/tallo y porcentaje de hoja en la evaluación de M. oleifera inoculada con cuatro PGPR en cada una de las tres cosechas

Primer corte T1 T2 T3 T4 Te Segundo corte T1 T2 T3 T4 Te Tercer corte T1 T2 T3 T4 Te

Relación hoja/tallo

Porcentaje de hoja

0.561 0.552 0.555 0.534 0.580

35.9 35.5 35.7 34.8 36.7

0.731 0.787 0.813 0.751 0.757

42.2 44.0 44.8 42.9 43.1

0.709 0.775 0.822 0.734 0.731

41.5 43.7 45.1 42.3 42.2

T1= Bacillus paralicheniformis, T2= Acinetobacter guillouiae, T3= Aeromonas caviae, T4= Pseudomonas lini, Te= sin bacteria. (P>0.05).

Variables bromatológicas

Aunque la composición química del árbol se realizó únicamente en la última cosecha los valores obtenidos son muy buenos. En promedio se obtuvo en hojas el 13.57 % de cenizas, 70.15 % de TND, 93.16 % de DIVMS, 19.72 % de FDN, 25.35 % de FDA y un 24.15 % de PC. En tallo los promedios obtenidos fueron 11.21 % de cenizas, 45.32 % de TND, 61.83 % de DVMS, 59.07 % de FDN, 58.01 % de FDA y 7.23 % de PC. El Cuadro 6 presenta el conjunto de variables bromatológicas analizadas para cada uno de los tratamientos.

728


Rev Mex Cienc Pecu 2020;11(3):718-737

Cuadro 6: Medias por tratamiento de los análisis bromatológicos expresados en porcentaje Tratamiento Hoja MF MS Cenizas Grasa FDN FDA FC PC ELN CNF DIVMS ENL TND Tallo MF MS Cenizas Grasa FDN FDA FC PC ELN CNF DIVMS ENL TND

T1

T2

T3

T4

Te

74.01 25.99 13.55 4.49 19.26 24.77 9.70 23.79 22.48 38.91 94.89 0.737 70.53

74.87 25.13 14.55 4.70 20.24 24.06 9.33 24.45 21.84 36.06 91.70 0.746 70.99

73.22 26.78 13.78 4.77 20.09 25.53 9.61 23.46 21.61 37.91 93.49 0.727 70.02

73.62 26.38 12.89 4.92 19.33 26.39 9.12 23.57 23.11 39.28 93.98 0.717 69.46

73.23 26.77 13.07 4.29 19.70 26.01 9.05 25.49 21.33 37.45 91.76 0.722 69.71

81.78 18.22 11.21 2.02 58.62 60.71 37.62 7.49 23.44 20.66 60.38 0.291 46.87

82.76 17.24 11.47 1.99 56.77 57.99 38.67 7.00 23.64 22.79 65.38 0.325 48.66

81.71 18.29 11.07 1.95 58.27 67.94 38.06 7.28 23.37 21.44 61.90 0.202 42.10

82.82 17.18 10.68 1.74 60.94 64.66 39.18 6.84 24.38 19.82 60.86 0.242 44.26

82.72 17.28 11.63 1.61 60.75 63.95 41.36 7.55 20.57 18.46 60.65 0.251 44.73

T1= Bacillus paralicheniformis, T2= Acinetobacter guillouiae, T3= Aeromonas caviae, T4= Pseudomonas lini, Te= sin bacteria. Materia fresca (MF), Materia seca (MS), Fibra detergente neutra (FDN), Fibra detrgente ácida (FDA), Fibra cruda (FC), Proteína cruda (PC), Extracto libre de nitrógeno (ELN), Carbohidrátos no fibrosos (CNF), Digestibilidad in vitro de materia seca (DIVMS), Energía neta de lactancia (ENL), Total de nutrientes digestibles (TND). (P>0.05)

729


Rev Mex Cienc Pecu 2020;11(3):718-737

Discusión Crecimiento

En la etapa de germinación de M. olerifera se obtuvo un 100 % utilizando la siembra directa en las bolsas, teniendo en el sustrato una conductividad electrica (CE) de 12.77 mS/cm. Esto concuerda con lo obtenido por Noreem et al(21) que encontraron que las semillas de M. oleifera germinan solamente a 5 y 10 dS/m de niveles de salinidad, a CE mas altas de 15 y 20 dS/m no se presenta la germinación. El crecimiento promedio de los árboles de M. oleifera obtenidos entre los 4 tratamientos y el control del experimento para la primera, segunda y tercera cosecha son los siguientes, 176.75 cm, 140.39 cm y 120.50 cm respectivamente. Los tiempos transcurridos para cada cosecha fueron a los 66, 77 y 117 dds respectivamente. En un estudio comparativo, en condiciones similares a este experimento, de Moringa oleifera y Leucaena leucocephala durante la germinación y la etapa inicial de crecimiento, obtuvieron un 95% de germinación, a las 13 semanas una altura de 53.2 cm a los 91 días, utilizando en el sustrato 60 % de suelo franco-limoso alcalino, 10 % de arena y 20 % de estiércol bovino compostado(22). Las PGPR halófilas inoculadas en los árboles de M. oleifera, permitieron que el crecimiento se diera satisfactoriamente. El T4 presentó una altura significativa entre los tratamientos de 138.31 cm a los 47 dds, lo que representa un incremento del 61.68 % a lo obtenido por los autores anteriores y en la mitad del tiempo. La M. oleifera tiene una tasa de crecimiento inicial lenta en condiciones de bajas temperaturas en la temporada de otoño-invierno(23). Los climas tropicales parecen ser los mejores para el cultivo de M. oleifera; aún así se puede lograr un crecimiento reducido pero satisfactorio en climas inferiores a los óptimos, ya que los árboles parecen tolerar una temperatura de crecimiento más baja mediante adaptaciones fisiológicas(24). Lo dicho por los autores concuerda con lo obtenido en este experimento. Es evidente que el crecimiento del árbol de M. oleifera es afectado al disminuir las temperaturas y al ataque de T. urticae. Sin embargo, el crecimiento siguió.

Variables agronómicas

La calidad nutritiva de la M. oleifera está determinada en parte por las condiciones en las que se desarrolle. Las temperaturas bajas retardan su crecimiento(22). La densidad de siembra afecta el desarrollo de las raíces, el diámetro de tallo y la biomasa. A mayores densidades de siembra los diámetros de tallo del árbol son más delgados y frágiles(25). En este experimento 730


Rev Mex Cienc Pecu 2020;11(3):718-737

la siembra fue en bolsas negras de polietileno con una densidad de 16 árboles m-2, donde no se esperaría ninguna de las alteraciones indicadas por los autores anteriores. Al utilizar menores densidades de siembra, resulta favorable cosechar a mayores alturas, con tallos de mayor diámetro y mayor número de rebrotes(26). Sin embargo, en la Figura 2 se muestra el acame que presentó el tratamiento testigo antes de la tercera cosecha. Esto debido a los diámetros delgados de los tallos y a la saturación de salinidad por el constante riego con el té de compost que presentó una CE de 3.27 mS/cm. Se puede decir que la inoculación con las PGPR halófilas dan mayor firmeza y grosor a los tallos proporcionándoles resistencia. En un estudio comparativo de la germinación y la etapa inicial de crecimiento obtuvieron resultados de 0.92 cm de diámetro a las 7 semanas resultados que estan por debajo de los obtenidos en este experimento. El número de hojas obtenidos por rama fue de 16, similar a los obtenidos en este experimento(21). Lo que ocasiona los tallos delgados son las altas concentraciones de Na+ en la solución que inhibe la absorción de nutrientes, causando una disminución en las concentraciones de K+ y Ca2+ en los tejidos de los tallos y la raíz(27). La raíz es parte fundamental para el desarrollo de las plantas. Una raíz bien desarrollada puede obtener mayores nutrimentos, así como el Ca2+ es lo que da firmeza y estructura a la pared celular. Las PGPR halófilas permiten la absorción de nutrientes en medios salinos, sin causar desordenes nutrimentales al paso de las cosechas. El tamaño de hoja en el experimento presenta un decremento con el paso de los cosechas y con ello el cambio de estación y las temperaturas. Estos cambios ocasionan la pérdida de las hojas basales, lo que repercute en el rendimiento. El Cuadro 4 muesta los rendimientos del árbol de M. oleifera considerando 16 árboles m-2. Las investigaciones realizadas por la mayoría de los autores son a cielo abierto, algunas otras en invernadero o vivero pero solamente a nivel germinación y plántula. En una investigación realizada a cielo abierto en el noreste de México, se obtuvieron 14.4 y 14.5 t ha-1de materia seca total en tres cosechas pero con una densidad de 11 y 33 árboles m-2 respectivamente(28). En Nicaragua se evaluó la producción de biomasa a cielo abierto con diferentes densidades de siembra de la cual obtuvieron una produccion de MS de 11.6 t ha-1 al año, con una densidad de 100,000 árboles por hectárea y ocho cosechas por año(3). Un estudio sobre el establecimiento de M. oleifera con varias densidades de plantas a cielo abierto, consiguieron 100.98 g de MS con una densidad de 98,764 árboles por hectárea(24).

731


Rev Mex Cienc Pecu 2020;11(3):718-737

Figura 2: Acame de los tallos de Moringa oleifera debido a diámetros delgados en el tratamiento Te: Sin bacteria, en el período de la segunda a la tercera cosecha (117 días) 2016-2017

Las hojas del árbol de M. oleifera son las que contienen la mayor cantidad de nutrimentos aprovechables. Los tallos proporcionan nutrimentos en menor cantidad. La relación hoja/tallo presentada en el Cuadro 5 nos muestra la proporción de gramos de hoja en MS por cada gramo de tallo. Se puede observar que en la segunda cosecha aumentó la proporción en promedio 0.22 g de hoja. Esto atribuible al número de tallos. En la segunda y tercera cosecha la proporción se mantiene con valores similares. En el estudio realizado en el noreste de México, se observa que la relación tallo/hoja baja en la segunda cosecha y se incrementa en la tercera cosecha(27). El objetivo de producir un buen forraje en este tipo de arboles es obtener la mayor cantidad de hojas y la menor cantidad de tallos.

Variables bromatológicas

Los forrajes son sensibles a la salinidad en diferente grado. A medida que la salinidad aumenta se reduce su biomasa(10). El análisis bromatológico realizado a los árboles de M. oleifera (Cuadro 6), muestra que el contenido nutrimental es bueno, es decir, a pesar de desarrollarse en un sustrato salino la calidad del forraje no decayó. Aun y cuando no se muestra una diferencia entre los tratamientos se especula que en el cuarto corte el tratamiento 732


Rev Mex Cienc Pecu 2020;11(3):718-737

testigo reduciría su calidad y biomasa debido a la saturación de salinidad. En un estudio sobre la composición química de las hojas de M. oleifera sembrada a una altitud de 1100 msnm, obtuvieron un contenido de ceniza de 13.3 %, 29 % de PC, 8.5 % de fibra cruda (FC), 42.7 % de extracto libre de nitrógeno (ELN), 16.8 % de FDN, 12.1 % de FDA y 34.5 % de carbohidratos no fibrosos (CNF)(29). Los datos obtenidos por estos autores son muy similares a los obtenidos en esta investigación y a una altitud similar. La caracterización bromatológica del follaje de M. oleifera realizada en diferentes estadíos de desarrollo, sin riego ni fertilización; determinó que a medida que se incrementa la edad de rebrote disminuye su calidad nutrimental. La cantidad de FDN y lignina detergente ácida aumentan; la PC, DIVMS y TND disminuyen(30). Situación que no se presentó en esta investigación. En las distintas investigaciones sobre M. oleifera, se han encontrado diversos resultados en cuanto a los análisis bromatológicos pero las variaciones son debido a las distintas condiciones bajo las que se produce el árbol. Además se ha tratado de determinar el tiempo óptimo de corte de M. oleifera en el cual se obtenga la mayor calidad del forraje. Se evaluó la producción de M. oleifera a campo abierto y de temporal con diferentes densidades y fechas de corte, así como su composición química y recomiendan cosechar la M. oleifera a intervalos de 75 días para obtener mayor calidad del forraje y un mayor rendimiento de MS, dado que el valor nutritivo del forraje de M. oleifera en términos de PC y DIVMS permanece constante a diferentes intervalos de la cosecha. En el primer año con 8 cosechas obtuvieron 18.54 % de MS, 8.58 % de cenizas, 32.12 % de FDN, 22.76 % de FDA, 22.63 % de PC, 70.09 % de DIVMS(31). Se ha utilizado la M. oleifera como un suplemento proteico alternativo. Se han alimentado diversas especies animales bovinas y caprinas, con diferentes porcentajes de M. oleifera en combinación con diversos forrajes y concentrados(2,32-34). El suministro de este suplemento proteíco puede ser en fresco o ensilado. La composición química no tiene mucha variación. Suministrando M. oleifera en fresco se encontró 19.3 % de MS, 24.10 % de PC, 45.3 % de FDN, 29.9 % de FDA y 10.3 % de ceniza, mientras que en M. oleifera ensilada se obtuvo 26.70 % de MS, 22.6 % de PC, 43.50 % de FDN, 29.10 % de FDA y 11.6 % de cenizas. La diferencia considerable entre estas dos formas de suplemento es el sabor fuerte que proporciona la M. oleifera en fresco a la leche, al proporcionarla ensilada no cambian las características organolépticas de la leche(6). Los resultados obtenidos en esta investigación cumplen con los parámetros requeridos en un forraje para ser incluido en la formulación de una dieta balanceada (Cuadro 6). La PC y la DIVMS son valores indicativos de un buen forraje, (24.15 y 93.16 % respectivamente) obtenidos en esta investigación. Como ya se mencionó a mayor porcentaje de DIVMS menor contenido de lignina. El alto porcentaje de DIVMS nos indica que el consumo de MS en los animales se incrementará. Las investigaciones anteriores nos muestran que el forraje contiene en promedio los elementos requeridos para beneficiar a los animales que la ingieren. Aun y produciendo dicho forraje 733


Rev Mex Cienc Pecu 2020;11(3):718-737

en condiciones salinas inoculado con PGPR halófilas necesarias para que se desarrolle, se puede obtener un forraje de calidad como el obtenido en este experimento.

Conclusiones e implicaciones Los resultados de este estudio muestran que M. oleifera producida bajo condiciones salinas pero inoculada con PGPR halófilas no incrementa la calidad del forraje y mantiene las características de calidad para ser incluido como suplemento proteico en la alimentación de diversas especies animales. El tratamiento testigo mostró una resistencia sistémica a la salinidad, sin embargo, antes del tercer corte presentó el acame de tallos. Se debe continuar la investigación con las PGPR halófilas en diferentes suelos con problemas de salinidad e inoculadas a distintos forrajes y se podría sembrar en lugares que se creen incultivables.

Literatura citada: 1. Hoffmann EM, Muetzel S, Becker K. Effects of Moringa oleifera seed extract on rumen fermentation in vitro. Arch Anim Nutr 2003;57(1):65-81. 2. Mendieta-Araica B, Spörndly R, Reyes-Sánchez N, Spörndly E. Moringa (Moringa oleifera) leaf meal as a source of protein in locally produced concentrates for dairy cows fed low protein diets in tropical areas. Livest Sci 2011;137(1):10-17. 3. Mendieta-Araica B, Spörndly E, Reyes-Sánchez N, Salmerón-Miranda F, Halling M. Biomass production and chemical composition of Moringa oleifera under different planting densities and levels of nitrogen fertilization. Agrofor Syst 2013;87(1):81-92. 4. Pérez ÁR. Moringa oleifera: una alternativa forrajera para ovinos. Culiacán, Sin, Méx: Universidad Autónoma de Sinaloa; 2011. 5. García QII, Mora-Delgado J, Estrada AJ, Piñeros VR. ¿Cuál es el efecto de la Moringa oleifera sobre la Dinámica Ruminal? Revisión sistemática. Rev Inv Vet Perú 2017;28(1):43-55. 6. Mendieta-Araica B, Sporndly E, Reyes-Sanchez N, Sporndly R. Feeding Moringa oleifera fresh or ensiled to dairy cows - effects on milk yield and milk flavor. Trop Anim Health Prod 2011;43(5):1039-1047. 7. Sun J, Zeng B, Chen Z, Yan S, Huang W, Sun B et al. Characterization of faecal microbial communities of dairy cows fed diets containing ensiled Moringa oleifera fodder. Sci Rep 2017;7:1-9. 734


Rev Mex Cienc Pecu 2020;11(3):718-737

8. Galindo PFV, Hernández MF, Rangel PP, Valencia RT, Castruita MÁS, Vidal JAO. Caracterización físico-química de sustratos orgánicos para producción de pepino (Cucumis sativus L.) bajo sistema protegido. Rev Mex Cienc Agríc 2014;5(7):12191232. 9. Larney FJ, Olson AF, Miller JJ, Tovell BC. Soluble salts, copper, zinc, and solids constituents in surface runoff from cattle manure compost windrows. Can J Soil Sci 2014;94(4):515-527. 10. Robinson PH, Grattan SR, Getachew G, Grieve CM, Poss JA, Suarez DL et al. Biomass accumulation and potential nutritive value of some forages irrigated with saline-sodic drainage water. Anim Feed Sci Technol 2004;111(1):175-189. 11. Aguirre-Garrido JF, Montiel-Lugo D, Hernández-Rodríguez C, Torres-Cortes G, Millán V, Toro N et al. Bacterial community structure in the rhizosphere of three cactus species from semi-arid highlands in central Mexico. Antonie van Leeuwenhoek 2012;101(4):891-904. 12. Turral H, Burke J, Faurès JM. Climate change, water and food security. 36th ed. Roma, Italia: FAO; 2011. 13. Bhardwaj D, Ansari MW, Sahoo RK, Tuteja N. Biofertilizers function as key player in sustainable agriculture by improving soil fertility, plant tolerance and crop productivity. Microb Cell Fact 2014;13(66):1-10. 14. Ahemad M, Kibret M. Mechanisms and applications of plant growth promoting rhizobacteria: Current perspective. J King Saud Univ Sci 2013;26(1):1-20. 15. Glick BR. Plant growth-promoting bacteria: mechanisms and applications. Scientifica 2012;2012:1-15 16. Parray JA, Jan S, Kamili AN, Qadri RA, Egamberdieva D, Ahmad P. Current perspectives on plant growth-promoting rhizobacteria. J Plant Growth Regul 2016;35(3):877-902. 17. Palacio-Rodríguez R, Coria-Arellano JL, López-Bucio J, Sánchez-Salas J, Muro-Pérez G, Castañeda-Gaytán G et al. Halophilic rhizobacteria from Distichlis spicata promote growth and improve salt tolerance in heterologous plant hosts. Symbiosis 2017;73(3):179-189. 18. Vázquez VC, Salazar SE, Fortis HM, Reyes OMI, Zúñiga TR, Antonio GJ. Uso de cubiertas plásticas para solarización de estiércol bovino. Rev Mex Cienc Agríc 2010;1(4):619-625.

735


Rev Mex Cienc Pecu 2020;11(3):718-737

19. AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. 20. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):3583-3597. 21. Noreen F, Muhammad A, Muhammad S, Ghulam A, Mubshar H, Muhammad N et al. Germination, growth and ions uptake of moringa (Moringa oleifera L.) grown under saline condition. J Plant Nutr 2018;41(12):1-11. 22. Medina MG, García DE, Clavero T, Iglesias JM. Estudio comparativo de Moringa oleifera y Leucaena leucocephala durante la germinación y la etapa inicial de crecimiento. Zootecnia Trop 2007;25(2):83-93. 23. da Costa PF, Rabello dOPS, Borsoi A, Soares dVE, Taffarel LE, Tiago PJ et al. Initial growth of Moringa oleifera Lam. under different planting densities in autumn/winter in south Brazil. Afr J Agric Res 2015;10(5):394-398. 24. Muhl QE, Du Toit ES, Robbertse PJ. Moringa oleifera (Horseradish Tree) leaf adaptation to temperature regimes. Int J Agric Biol 2011;13(6):1021-1024. 25. Goss M. A study of the initial establishment of multi - purpose moringa (Moringa oleifera Lam) at various plant densities, their effect on biomass accumulation and leaf yield when grown as vegetable. Afr J Plant Sci 2012;6(3):125-129. 26. Padilla C, Fraga N, Scull I, Tuero R, Sarduy L. Efecto de la altura de corte en indicadores de la producción de forraje de Moringa oleifera vc. Plain. Rev Cubana de Cienc Agríc 2014;48(4):405-409. 27. Hu Y, Schmidhalter U. Drought and salinity: A comparison of their effects on mineral nutrition of plants. J Plant Nutr Soil Sci 2005;168:541-549. 28. Meza-Carranco Z, Bernal-Barragán H, Olivares-Sáenz E, Aranda-Ruiz J. Crecimiento y producción de biomasa de moringa (Moringa oleifera Lam.) bajo las condiciones climáticas del Noreste de México. TECNOCIENCIA Chih 2016;10(3):143-153. 29. Melesse A, Steingass H, Boguhn J, Rodehutscord M. In vitro fermentation characteristics and effective utilisable crude protein in leaves and green pods of Moringa stenopetala and Moringa oleifera cultivated at low and mid-altitudes. J Anim Physiol Anim Nutr 2013;97(3):537-546. 30. Méndez Y, Suárez FO, Verdecia DM, Herrera RS, Labrada JA, Murillo B et al. Caracterización bromatológica del follaje de Moringa oleifera en diferentes estadios de desarrollo. Cuban J Agric Sci 2018;53(3):1-10. 736


Rev Mex Cienc Pecu 2020;11(3):718-737

31. Reyes SN, Ledin S, Ledin I. Biomass production and chemical composition of Moringa oleifera under different management regimes in Nicaragua. Agrofor Syst 2006;66(3):231-242. 32. Moyo B, Masika PJ, Muchenje V. Effect of supplementing crossbred Xhosa lop-eared goat castrates with Moringa oleifera leaves on growth performance, carcass and noncarcass characteristics. Trop Anim Health Prod 2012;44(4):801-809. 33. Reyes SN, Spรถrndly E, Ledin I. Effect of feeding different levels of foliage of Moringa oleifera to creole dairy cows on intake, digestibility, milk production and composition. Livest Sci 2006;101(1):24-31. 34. Sultana N, Alimon AR, Huque KS, Sazili AQ, Yaakub H, Hossain J et al. The feeding value of moringa (Moringa oleifera) foliage as replacement to conventional concentrate diet in Bengal goats. Adv Anim Vet Sci 2015;3(3):164-173.

737


https://doi.org/10.22319/rmcp.v11i3.4828 Artículo

Efecto del reemplazo folicular (GnRH) y de somatotropina bovina (bST) sobre la fertilidad de vacas lecheras expuestas a estrés calórico

Renato Raúl Lozano-Domínguez a Carlos Fernando Aréchiga-Flores a* Marco Antonio López-Carlos a Zimri Cortés-Vidauri a Melba Rincón-Delgado a José Ma. Carrera-Chávez b Ulises Macías-Cruz c Joel Hernández-Cerón d

a

Universidad Autónoma de Zacatecas. Unidad Académica de Medicina Veterinaria y Zootecnia. El Cordovel, General Enrique Estrada, Zacatecas, México. b

Universidad Autónoma de Ciudad Juárez. Instituto de Ciencias Biomédicas. Departamento de Ciencias Veterinarias. Ciudad Juarez, Chihuahua, Mexico. c

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas. Mexicali, Baja California, Mexico. d

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Departamento de Reproducción. Ciudad Universitaria, Ciudad de México, México.

*autor de correspondencia: arechiga.uaz@gmail.com arechiga@uaz.edu.mx

738


Rev Mex Cienc Pecu 2020;11(3):738-756

Resumen: Tres protocolos reproductivos fueron evaluados: 1) PG: inyección de PGF2α en el día 50 posparto e inseminación (IA) en base a detección del estro. 2) OVS (Ovsynch: día 0, GnRH; día 7, PGF2α; día 9, GnRH; día 10, IA); y 3) ROV (GnRH + Ovsynch: día- 7, GnRH; día 0, GnRH; día 7, PGF2α; día 9, GnRH; día 10, IA). Además, el efecto de la somatotropina (bST) a la IA, sobre la fertilidad al primer servicio posparto (FERT), y la tasa de preñez a 99 días posparto (PP). FERT fue similar en ROV y OVS (36.2 vs 36.6 %) (P>0.05); y mayor a PG (27.3 %) (P<0.05). Igualmente, FERT fue similar con bST y sin bST (36.2 vs 30.6 %, P>0.05). PG y sin bST (22.5 %) fue menor que OVS con (38.5 %), y sin bST (33.7 %); y que ROV con bST (37.0 %) y sin bST (36.1 %); y PG con bST (32.9 %) (P<0.05). La tasa de preñez a 99 días PP fue: OVS (60.6 %); ROV (54.3 %), superior al grupo PG (46.8 %) (P<0.05). OVS con bST (64.7 %), y sin bST (56.5 %), y ROV sin bST fueron mayores que PG sin bST (41.1 %, P<0.05). En conclusión, GnRH previo al Ovsynch (ROV) y la bST al momento de la IA no incrementaron la fertilidad del primer servicio en vacas Holstein en estrés calórico. OVS y ROV incrementaron la fertilidad del primer servicio posparto y la tasa de preñez a 99 días posparto. La somatotropina incrementó la fertilidad del primer servicio posparto solo en vacas tratadas con PG. Palabras clave: Vaca lechera, Ovsynch, Somatotropina, Estrés calórico, GnRH.

Recibido: 28/03/2018 Aceptado: 18/09/2019

Introducción El estrés calórico (EC) compromete las tasas de no retorno al estro(1,2) y las tasas de concepción de las vacas lecheras(1-6). Los protocolos de sincronización de la ovulación (Ovsynch), han permitido incrementar la tasa de ovulación(7,8); el diámetro del folículo ovulatorio(8); la fertilidad al primer servicio(8-13) y la tasa de preñez acumulada a 120 días post-parto en vacas lecheras de alta producción(9-11,14). La inyección de un luteolítico (i.e., prostaglandina F2α ó PG), previo al Ovsynch(7,12), aumenta en más del 40 % la tasa de ovulación de un folículo apto para ser fertilizado(7), e incrementa el porcentaje de vacas con niveles mayores de progesterona circulante 3 días después de iniciar el Ovsynch(12). La inserción intravaginal de un dispositivo liberador de progesterona (CIDR), incrementó la tasa de concepción, en comparación a las vacas que solamente reciben el Ovsynch(12-13). Sin embargo, bajo condiciones ambientales de EC, los programas reproducttivos pueden ver 739


Rev Mex Cienc Pecu 2020;11(3):738-756

disminuida su eficiencia en comparación a su implementación bajo confort térmico(8,12,1415) . El tratamiento doble Ovsynch ha incrementado la fertilidad en 10 %(16). Varios estudios han determinado que aun cuando la fertilidad de los ovocitos fertilizados in vitro en las épocas de invierno y verano son similares(17); el porcentaje de embriones que alcanzaron la etapa de blastocito se compromete al utilizar ovocitos recolectados durante el verano(17,18), especialmente en las vacas repetidoras(17). Las vacas Holstein en plena lactancia(19) y no lactantes(20) expuestas a estrés calórico durante el verano(19), o solamente durante un ciclo folicular(20), presentan una disminución en el número de folículos sanos(20), en la calidad del cúmulo ovígero(19) y en el desarrollo embrionario(19-20). El recambio folicular es importante para eliminar a los folículos desarrollados y afectados por EC y se promueve con tratamientos repetidos de GnRH ó mediante la aspiración frecuente de los folículos de 3 a 7 mm(19) o mayores de 5 mm(20) y generar el desarrollo de folículos de mejor calidad y mayor porcentaje de embriones desarrollados a blastocito in vitro. El recambio folicular previo al Ovsynch(21,22), no mejoró la fertilidad del primer servicio(21,22), pero mejoró la fertilidad en vacas con problemas uterinos y con baja condición corporal(21). Por otro lado, la somatotropina bovina (bST) ha sido utilizada en vacas Holsteín por su efecto benéfico al incrementar la producción de leche(23-26). Se consideraba que este incremento en la producción de leche podría tener efecto detrimental en la reproducción de la vaca lechera. Tratamientos de 500 mg de bST a partir de los 61 a 63 días en leche y con aplicaciones repetidas de esta hormona cada 10 días(25) o 14 días(24,26), no compromete la fertilidad; la tasa de preñez(24-26), ni la eliminación de las vacas del hato; los días abiertos; el número de casos de mastitis, ni la incidencia de quistes foliculares y abortos(26), ni el bienestar o la salud del animal(27). Varios autores han establecido que el uso de bST al inicio del celo(28) y 10 días después de la IA en vacas lecheras(29) tiene un efecto positivo sobre la tasa de preñez, mejora el desarrollo del cuerpo lúteo e incrementa la producción de progesterona(28-29) tanto en vacas repetidoras(30-31), como en las vacas receptoras de embriones(32). Este efecto favorable de bST también ha causado un mayor porcentaje de embriones transferibles y menos ovocitos no fertilizados en vacas superovuladas(29,32,33), y parece estar asociado con el factor de crecimiento parecido a la insulina (IGF-I), y con la maduración final del ovocito, el desarrollo folicular, y la esteroidogénesis(30,34,35). De manera conjunta, Ovsynch y bST iniciando el d 63 PP incrementaron la fertilidad a la primera inseminación(28,36) y el porcentaje de preñez acumulado a 120 y 365 días postparto(32), pero disminuyó la detección de estros en vacas tratadas con bST(37), y no se incrementó la fertilidad de las vacas bajo condiciones de estrés calórico(24). El propósito del presente trabajo fue evaluar el efecto del reemplazo folicular (GnRH día-7) y la administración de somatotropina bovina (bST), al momento de la inseminación, sobre la fertilidad del primer servicio posparto y la tasa de preñez en vacas lecheras de alta producción expuestas a estrés calórico.

740


Rev Mex Cienc Pecu 2020;11(3):738-756

Material y métodos El estudio se realizó en vacas lecheras Holstein (n= 553) de dos hatos comerciales de producción intensiva del altiplano central de México (Aguascalientes, México), durante la época cálida, que contaban solo con sombras en los corrales de las vacas en producción y secas. Después del parto, las vacas se lotificaron por número de lactancia con una alimentación integral de acuerdo al nivel de producción láctea. La producción láctea estimada a 305 días del hato en vacas primíparas y multíparas fue de 8,493 ± 349.6 y 9,116.3 ± 307.02 kg, respectivamente.

Variables climáticas Durante el período de estudio de marzo a septiembre se registró la información climática cada 15 min de la temperatura ambiente (°C) y la humedad relativa (HR) de la estación meteorológica del INIFAP, Aguascalientes, la cual está ubicada a 5 km de los hatos lecheros donde se realizó el estudio. Se calculó el índice de temperatura-humedad (THI) (Cuadro 1) de acuerdo a lo establecido por Ingraham et al(37), donde se tomó el registro de la temperatura máxima y el promedio de la humedad relativa, mediante la siguiente ecuación: THI = ° F – (0.55 – (((HR / 100) x 0.55))) * (° F – 58)). Cuadro 1: Índice de temperatura humedad (THI) durante el estudio Mes THI Marzo 73.4 ± 0.39 a Abril 73.6 ± 0.39 a Mayo 76.6 ± 0.39 b Junio 77.5 ± 0.39 b Julio 77.1 ± 0.39 b Agosto 77.6 ± 0.41 b Septiembre 76.5 ± 0.42 b abc

Literales distintas indican diferencia significativa (P<0.01).

Manejo reproductivo En el estudio se incluyeron vacas lecheras que presentaron su parto en los meses de marzo y abril. El manejo reproductivo durante el posparto temprano y la implementación de programas de sincronización del estro se realizaron en los meses cálidos del año, de mayo a junio. La evaluación de la involución uterina y de los aspectos clínicos del aparato reproductor se realizó alrededor de los días 20 y 40 posparto (PP), así como la administración de 500 µg de prostaglandina sintética (Cloprostenol sódico, Virbac),

741


Rev Mex Cienc Pecu 2020;11(3):738-756

aproximadamente al día 50 PP. El período de espera voluntaria y el intervalo entre partos establecidos como metas fueron de 50 días y 13.8 meses, respectivamente. Se incluyeron vacas en plena lactancia (n= 553), clínicamente sanas y sin problemas anatomo-patológicos del aparato reproductor, que presentaron su parto en los meses de marzo y abril, y se registró el número de lactancia de cada una de ellas. En la Figura 1 se muestra el diseño experimental. Se inició el estudio considerando un periodo de espera voluntaria (PEV; 50 días en leche aproximadamente). Se registraron los días en leche (DEL); y se emplearon vacas con una condición física corporal aceptable (CFC) con una aproximación de 0.25 puntos de acuerdo a lo descrito por Ferguson et al(38). Figura 1: Diseño experimental Vacas Frescas PEV = 50 días

Tratamientos de sincronización del estro y ovulación

Prostaglandina (PG)

IA

Ovsynch (OVS)

Con bST

GnRH- OvSynch (ROV)

Sin bST

Diagnostico de gestación Gestante

IA Fertilidad del primer servicio

Vacía s

repetidoras Tratamientos de Ovsynch (Re-synch) IA Diagnóstico de gestación

742


Rev Mex Cienc Pecu 2020;11(3):738-756

Las vacas se asignaron al azar a los siguientes tratamientos (T): 1) Prostaglandina (PG) (n= 247 vacas). Inducción de la sincronización del estro con prostaglandina (500 µg de cloprostenol sódico, Virbac); y se les dio servicio de inseminación artificial 12 h después de la detección del estro por observación visual. 2) OVS (n= 161 vacas). Ovsynch: día 0, GnRH; día 7, PG; día 9, GnRH; día 10, IATF). Programa de sincronización del estro e inseminación artificial a tiempo fijo (IATF), en el cual a las vacas en el día cero (inicio del tratamiento) se les administró 100 µg del factor liberador de las gonadotropinas (GnRH) (acetato de gonadorelina, SYVA); posteriormente en el día siete y nueve a las vacas se les administró 500 µg de PG y 100 µg de GnRH, respectivamente. La inseminación artificial se realizó entre 12 y 16 h después de la última administración de GnRH. 3) ROV (n= 145 vacas). GnRH + Ovsynch: siete días previos al tratamiento de ovsynch (OVS) se les administró 100 µg de GnRH (i.e., día-7). La inseminación artificial se realizó entre 12 y 16 h después de la última administración de GnRH. Para la evaluación de la fertilidad del primer servicio posparto con días en leche similares de este servicio solo se consideraron las vacas que presentaron celo y fueron inseminadas en los tratamientos con PG, y todas aquellas con servicio a tiempo fijo (OVS y ROV). Las vacas de cada tratamiento y que mostraron estro fueron asignadas al azar a dos grupos: a) somatotropina bovina (C-bST) (n= 221); las vacas recibieron al momento de la inseminación 500 mg de somatotropina bovina (bST) (Lactotropina, Elanco). b) sin somatotropina bovina (S-bST) (n= 235). Las vacas que no recibieron tratamiento de bST al momento de la inseminación. Con la interacción de los efectos principales de tratamiento y la administración de bST al momento del primer servicio se formaron seis grupos experimentales a evaluar: 1. Sincronización del estro con PG sin bST (PG / S-bST) (n = 80). 2. Sincronización del estro con PG más bST al servicio (PG / C-bST) (n = 70). 3. Ovsynch sin bST (OVS / S-bST) (n=83). 4. Ovsynch más bST al servicio (OVS / C-bST) (n=78). 5. GnRH - Ovsynch sin bST (ROV / S-bST) (n = 72) 6. GnRH - Ovsynch más bST al servicio (ROV / C-bST) (n = 73). La fertilidad del primer servicio posparto (FERT) fue la relación entre las vacas gestantes y las vacas servidas. Se registró la fecha del primer servicio y de la concepción. Se calcularon los intervalos parto a primer servicio (IPPS) y parto a concepción (IPC). Independientemente del tratamiento recibido, todas las vacas que no se gestaron en el primer servicio fueron nuevamente servidas al observarse un nuevo celo natural; o cuando aquellas (alrededor del 30 %) que al diagnóstico de gestación estaban vacías, fueron

743


Rev Mex Cienc Pecu 2020;11(3):738-756

resincronizadas con un protocolo de Re-synch para darles servicio de inseminación artificial de nueva cuenta. Se realizó una distribución de frecuencias del intervalo parto a concepción de las vacas que tuvieron respuesta a la sincronización con prostaglandinas y que fueron inseminadas, y de aquellas con inseminación a tiempo fijo, para determinar el número de clases y su amplitud para este intervalo(39). De esta forma se estimó el porcentaje acumulado de vacas gestantes (GES) por cada clase definida: 1. menos de 100 días en leche. 2. 101 a 150 días en leche. 3. 151 a 201 días en leche. 4. 202 a 253 días en leche. 5. Más de 253 días en leche. Así mismo, se determinó el porcentaje de vacas gestantes del primero, segundo, tercero o cuarto ó más servicio por tratamiento, administración de bST y su interacción. Se calculó el intervalo parto a concepción y el número de servicios por concepción de todas las vacas del estudio, incluidas aquellas que no respondieron a la sincronización del celo con tratamiento de prostaglandina sin administración de somatotropina bovina al momento del servicio.

Variables a evaluar Las variables evaluadas fueron el número de lactancia; días en leche (DEL) y condición corporal (CFC) al inicio del estudio; intervalo parto a primer servicio posparto (IPPS); fertilidad del primer servicio posparto (FERT); porcentaje acumulado de vacas gestantes en diferentes períodos posparto (GES); distribución del intervalo parto concepción de las vacas con respuesta a la sincronización hasta los 150 días en leche; así como, el número de servicios (NSC) e intervalo parto a concepción (IPC), incluyendo en estos dos últimos parámetros las vacas sin respuesta a la sincronización con prostaglandina y que no fueron tratadas con bST al momento de la inseminación.

Análisis estadístico Se analizaron las variables: número de lactancias (NL), días en leche (DEL), condición física corporal (CFC), intervalo parto a primer servicio (IPPS), intervalo parto a concepción (IPC) y número de servicios por concepción (NSC) en un análisis de varianza con bloques al azar. El porcentaje acumulado de vacas gestantes en diferentes períodos posparto y por número de servicio fueron analizados por medio de Ji-cuadrada. El valor esperado del porcentaje de fertilidad del primer servicio posparto se analizó con un modelo de regresión logística múltiple de primer orden. El modelo fue ajustado por el método de máxima verosimilitud considerando los efectos: Tratamiento (T); la administración de bST (S); la interacción entre tratamiento y somatotropina bovina (T x S); y el hato lechero fue tomado como bloque(39). 744


Rev Mex Cienc Pecu 2020;11(3):738-756

Resultados Los días en leche al inicio del tratamiento (DEL= 56.6 ± 0.3); la condición física corporal (CFC= 3.1 ± 0.4); el número de lactancias (NL= 2.7 ± 0.1) y el intervalo parto a primer servicio (IPPS= 59.7 ± 0.3) fueron similares entre grupos de tratamientos (P>0.05) (Cuadro 2). La fertilidad al primer servicio posparto de los tratamientos Ovsynch (OVS, 36.6) y GnRH-Ovsynch (ROV, 36.2) fue superior al observado en el tratamiento con Prostaglandina (27.3 %) (P<0.05) (Figura 2). Cuadro 2: Condición física corporal, días en leche al inicio del estudio, número de lactancias e intervalo parto a primer servicio posparto por tratamiento Tratamientos Variables PG OVS ROV Número de observaciones 150 161 145 Condición física corporal inicial 3.1 ± 0.03 3.0 ± 0.03 3.1 ± 0.03 Días en leche a la sincronización 55.3 ± 0.3 57.6 ± 0.3 56.8 ± 0.3 Número de lactancias 2.6 ± 0.1 2.8 ± 0.1 2.6 ± 0.1 Intervalo parto a primer servicio 58.8 ± 0.3 60.5 ± 0.3 59.9 ± 0.3 (P>0.05).

Figura 2: Tasa de fertilidad del primer servicio posparto por efecto de tratamiento

No se detectó efecto simple de bST (P>0.05) sobre la fertilidad al primer servicio posparto de las vacas lecheras (36.2 vs 30.6 %, con bST y sin BST). PG-sin bST presentó una menor fertilidad al primer servicio posparto (22.5 %), que el resto de los tratamientos (P<0.05) (Figura 3).

745


Rev Mex Cienc Pecu 2020;11(3):738-756

Figura 3: Tasa de fertilidad del primer servicio posparto (FERT) del tratamiento (PG-OVS - ROV) con (C bST) o sin (S bST) administración de somatotropina

El porcentaje de vacas gestantes a los 99 d posparto fue mayor en los tratamientos Ovsynch (60.6 %) y ROV (54.3 %) que lo observado en el tratamiento con Prostaglandina (46.8 %) (P<0.05). Posteriormente entre 100 a 150 días posparto en el tratamiento con Prostaglandina se gestaron el 28.8 % de las vacas, dato superior a lo observado en los tratamientos de Ovsynch (17.5 %) y ROV (17.3 %) (P<0.05) (Figura 4). No se detectó efecto simple de bST (P>0.05) sobre el porcentaje de vacas gestantes a los 99 días posparto (P>0.05). Figura 4: Distribución porcentual de las vacas gestantes durante el posparto (DEL) por efecto del tratamiento

746


Rev Mex Cienc Pecu 2020;11(3):738-756

El porcentaje de vacas gestantes a 99 d posparto de los tratamientos de Ovsynch con o sin bST (64.7 y 56.5 %, respectivamente) y ROV sin bST (61.7 %) fue superior a lo observado en el tratamiento de PG sin bST (41.1 %) (P<0.01). De 100 a 150 días posparto, en el tratamiento de PG sin bST se gestaron el 34.2 % de las vacas, y fue superior a lo observado en los tratamientos OVS con bST (13.2 %) y a ROV sin bST (11.7 %) (P<0.05) (Figura 5). Figura 5: Distribución de las vacas gestantes durante el posparto (DEL) por efecto de la interacción tratamiento Con (C bST) o sin (S bST) administración de somatotropina

En la Figura 6 se muestra el porcentaje de vacas gestantes acumulado en los primeros 150 días posparto por efecto de tratamiento de sincronización, en el que se observa que los tratamientos OVS y ROV a partir del día 62 un porcentaje acumulado de vacas gestantes (29.2 y 33.8 %) superior a lo observado en el tratamiento PG (23.0 %) (P<0.05). Esta diferencia se incrementó substancialmente hacia el día 65 en los tratamientos OVS (38.7 %) y ROV (41.7 %) comparado con lo observado con el tratamiento PG (28.0 %) (P<0.05); los tratamientos OVS y ROV mantuvieron esta diferencia significativa hasta 109 y 145 días en leche, respectivamente (P<0.05). Después de los 150 días en leche el porcentaje de gestación acumulada entre los tres tratamientos fue similar (P>0.05).

747


Rev Mex Cienc Pecu 2020;11(3):738-756

Figura 6: Tasa de gestación acumulada durante el posparto por efecto de tratamiento

En el Cuadro 3 se presenta un mayor intervalo parto a concepción en las vacas tratadas con PG sin bST (144.6 días) que en el resto de los tratamientos (P<0.05); Se observaron menos servicios por concepción en los grupos de vacas tratadas con Ovsynch y con PG más bST al momento del servicio (2.2 y 2.3, respectivamente) respecto a lo observado en las vacas tratadas solamente con PG sin bST al servicio (2.8), en aquellas del grupo ROV con bST (2.7) (P<0.05). Cuadro 3: Efecto del tratamiento sobre el intervalo parto a concepción (IPC) y el número de servicios por concepción (NSC) Tratamiento n IPC NSC PG sin bST PG con bST OVS sin bST OVS con bST ROV sin bST ROV con bST

73 66 69 68 60 67

144.6 ± 6.7 a 108.4 ± 9.4 b 115.4 ± 9.2 b 106.4 ± 9.3 b 118.3 ± 9.9 b 125.3 ± 9.4 b

2.8 ± 0.1 a 2.3 ± 0.2 b 2.4 ± 0.2 ab 2.2 ± 0.2 b 2.4 ± 0.2 ab 2.7 ± 0.2 a

bST: Inyección de somatotropina al momento de la inseminación artificial (IA). OVS: [d 0, GnRH; d 7, PG; d 9, GnRH; d 10, IA]. ROV: [d -7, GnRH; más Ovsynch]. a,b Distintas literales por columna indican diferencia estadística significativa (P<0.05).

748


Rev Mex Cienc Pecu 2020;11(3):738-756

Discusión Los programas de sincronización del estro e inseminación artificial a tiempo fijo (IATF) mejoraron la fertilidad del primer servicio posparto en vacas lecheras en condiciones de estrés calórico; con lo que estos programas demuestran su bondad para superar el efecto negativo de la productividad de la vaca lechera sobre la fertilidad del primer servicio posparto(40,41), e incluso como efecto negativo aditivo al estrés calórico(1-6). Las tasas de fertilidad observadas en el primer servicio posparto en los IATF coinciden con lo informado en otros estudios(7-16,20); que pudiera estar relacionado con una mayor tasa de ovulación de un folículo apto para ser fertilizado(7), y con una mayor concentración circulante de la hormona progesterona(12,15), comparado con esquemas donde las vacas no fueron pre-sincronizadas. Sin embargo, otros estudios realizados en vacas lecheras bajo condiciones de estrés calórico encontraron una respuesta reproductiva menos eficiente que lo observado en vacas en confort térmico(12,14,15). Se ha establecido en vacas lecheras un efecto del estrés calórico que reduce la calidad de los folículos y la competencia del ovocito(16-20,42). la tasa de ovulación(7-8); y menores diámetros del folículo ovulatorio(8). Algunos estudios determinaron que al administrar el factor liberador de las gonadotropinas (GnRH)(19) o reemplazar a los folículos dominantes(20) en vacas lecheras durante la época de verano, se mejoraba la competencia del ovocito para ser fertilizado y obtenían un mayor porcentaje de embriones que alcanzarían el estadío de blastocito en estudios in vitro; y concluyeron que la competencia del ovocito estuvo comprometida por las condiciones de calor del verano(19-20). Esta falla en la competencia del ovocito, también ha sido informada por otros autores(17,18), bajo condiciones de estrés calórico. Especialmente en el caso de las vacas repetidoras(17,31); aún cuando la fertilidad de los ovocitos fertilizados in vitro en las épocas de invierno y verano fueron similares(17), lo que enfatiza la importancia de minimizar el efecto del estrés calórico y que probablemente los esquemas de IATF tuvieron un efecto benéfico al mejorar la calidad folicular y la competencia del ovocito. La administración del factor liberador de las gonadotropinas (GnRH: i.e., tratamiento ROV), previo al programa Ovsynch, con la intención de generar el reemplazo folicular, no mejoró la fertilidad del primer servicio posparto, la cual fue similar a la observada en vacas del grupo de OVS (Ovsynch), lo que puede indicar que este último esquema de inseminación artificial a tiempo fijo fue suficiente para mejorar la calidad folicular y la competencia del ovocito; cuyos resultados coinciden con lo observado en otros estudios(21,22), y que solo el recambio folicular previo al inicio del programa Ovsynch puede mejorar la fertilidad en aquellas vacas que presentaron problemas uterinos en el posparto temprano y con baja condición corporal(21).

749


Rev Mex Cienc Pecu 2020;11(3):738-756

Se ha determinado que la pérdida de la condición física corporal de la vaca y la profundidad del balance negativo de energía afectan la fertilidad del primer servicio posparto(43,44) al afectar la competencia del ovocito(45,46); y dadas las condiciones de salud y condición física corporal aceptables de las vacas en el presente estudio permiten inferir que estos efectos negativos fueron controlados. Por otra parte, al obtener una fertilidad del primer servicio posparto mayor al 36 % en los programas de inseminación artificial a tiempo fijo observados en el presente estudio en condiciones de estrés calórico fue excelente, si se compara con la fertilidad reportada en vacas con un alto potencial productivo(40-41,47) y en condiciones de estrés calórico(1-6). Por otro lado, la administración de somatotropina bovina (bST) al momento de la inseminación artificial a tiempo fijo no fue un efecto determinante como variable principal para mejorar la fertilidad del primer servicio posparto, como lo informa Jousan et al.(24), por lo que posiblemente los programas de sincronización del estro e inseminación artificial a tiempo fijo fueron suficientes al eliminar el folículo dañado por efecto del estrés calórico e inducir una nueva emergencia folicular, mejorar la calidad del folículo ovulatorio y la competencia del ovocito como se ha descrito en otros estudios(19,20). Sin embargo, el hecho que en el grupo de vacas tratadas sólo con prostaglandina sin la administración de somatotropina al momento del servicio hayan tenido entre 10.4 y 16 puntos porcentuales menos de fertilidad en el primer servicio posparto con respecto a lo observado en vacas tratadas con somatotropina, de forma significativa, indica un efecto positivo de ésta sobre la fertilidad del primer servicio posparto, como se ha documentado en otros estudios con tratamientos de bST a partir de los 61 a 63 días en leche y con aplicaciones repetidas de esta hormona cada 10(25,48,49) o 14 días(26,35,36), al mejorar el desarrollo del cuerpo lúteo e incrementar la producción de progesterona del mismo(28,29), tanto en vacas repetidoras(30,31), como en vacas receptoras de embriones(32); y se ha inferido que este efecto benéfico involucra al factor de crecimiento parecido a la insulina tipo I (IGF-1) que parece estar asociado con el proceso de la maduración final del ovocito, del desarrollo folicular, y la esteroidogénesis(34,50,51); e incrementa, en estudios in vitro, la tasa de preñez de los embriones transferidos(52). Por otra parte, se ha observado en los programas de administración de bST cada 14 días utilizados en vacas lecheras con el fin de incrementar la producción de leche(24-26) que se afecta negativamente la expresión del estro(25,36); por lo que se ha sugerido que el uso de bST se acompañe con protocolos de inseminación a tiempo fijo para asegurar el 100 % de las vacas inseminadas(36); con esto aún cuando la fertilidad del primer servicio posparto en condiciones de estrés calórico no tiene un efecto relevante con la bST como variable principal, al menos con la IATF se elimina el riesgo de no detectar en celo a las vacas. En consecuencia, al incrementarse el porcentaje de vacas gestantes en el primer tercio de la lactancia en los programas de inseminación a tiempo fijo entre 15.4 y 23.6% comparado con el manejo tradicional, como se ha confirmado en otros estudios(9-11,14), se asegura un nuevo ciclo productivo y se reduce el riesgo de eliminación de las vacas del hato por causas 750


Rev Mex Cienc Pecu 2020;11(3):738-756

reproductivas. Por otra parte, las vacas gestantes con tratamientos de sincronización del celo con prostaglandinas sin bST al servicio presentaron entre 19.3 y 38.6 más días abiertos que los demás tratamientos, lo que implica que al menos tienen entre uno y dos ciclos estrales pérdidos que significan costos extras en el ciclo reproductivo de la vaca lechera.

Conclusiones e implicaciones La administración del factor liberador de las gonadotropinas (GnRH) previo al programa Ovsynch (ROV) y la administración de somatotropina bovina (bST) al momento de la inseminación, no mejoraron la fertilidad del primer servicio posparto. Los esquemas de inseminación artificial a tiempo fijo mejoraron la fertilidad del primer servicio posparto e incrementaron la tasa de vacas gestantes en los primeros 99 días posparto. La somatotropina bovina incrementa la fertilidad del primer servicio posparto solo en vacas tratadas con prostaglandina, pero no en vacas en programas de inseminación a tiempo fijo en condiciones de estrés calórico.

Literatura citada: 1. Al-Katanani MY, Webb DW, Hansen PJ. Factors affecting seasonal variation in 90-d nonreturn rate to first service in lactating Holstein cows in a hot climate. J Dairy Sci 1999;82:2611-2616. 2. Ravagnolo O, Misztal I. Effect of heat stress on nonreturn rate in Holsteins: fixed-model analyses. J Dairy Sci 2002;85:3101-3106. 3. Wolfenson D, Roth Z, Meidan R. Impaired reproduction in heat-stressed cattle: basic and applied aspects. Anim Reprod Sci 2000;60:535-547. 4. Lozano-Dominguez RR, Vásquez-Peláez CG, González-Padilla E. Factores asociados del estrés calórico y producción de leche sobre la tasa de gestación en bovinos en sistemas intensivos. Tec Pecu Mex 2005;43(2):197-210. 5. Lozano-Domínguez RR, Asprón-Pelayo MA, Vásquez-Peláez CG, González-Padilla E, Aréchiga-Flores CF. Efecto del estrés calórico sobre la producción embrionaria en vacas superovuladas y la tasa de gestación en receptoras. Rev Mex Cienc Pecu 2010; 1(3):189-203. 6. Huang C, Tsuruta S, Bertrand JK, Misztal I, Lawlor TJ, Clay JS. Environmental effects on conception rate of Holstein in New York and Georgia. J Dairy Sci 2008;9(2):818– 825.

751


Rev Mex Cienc Pecu 2020;11(3):738-756

7. Borman JM, Radcliff RP, McCormack BL, Kojima FN, Patterson DJ, Macmillan KL, Lucy MC. Synchronisation of oestrus in dairy cows using prostaglandin F2alpha, gonadotrophin-releasing hormone, and oestradiol cypionate. Anim Reprod Sci 2003; 76(3-4):163-176. 8. Pereira MHC, Wiltbank MC, Barbosa LF, Costa Jr WM, Carvalho MA, Vasconcelos JLM. Effect of adding a gonadotropin-releasing-hormone treatment at the beginning and a second prostaglandin F2α treatment at the end of an estradiol-based protocol for timed artificial insemination in lactating dairy cows during cool or hot seasons of the year. J Dairy Sci 2014;98(2):947-959. 9. Thatcher WW, De la Sota RL, Schmitt EJ, Diaz TC, Badinga L, Simmen FA, Staples CR, Drost M. Control and management of ovarian follicles in cattle to optimize fertility. Reprod Fertil Dev 1996;8(2):203-217. 10. De la Sota RL, Burke JM, Risco CA, Moreira F, DeLorenzo MA, Thatcher WW. Evaluation of timed insemination during summer heat stress in lactating dairy cattle. Theriogenology 1998;49(4):761-770. 11. Cartmill JA, El-Zarkouny SZ, Hensley BA, Rozell TG, Smith JF, Stevenson JS. An alternative AI breeding protocol for dairy cows exposed to elevated ambient temperatures before or after calving or both. J Dairy Sci 2001;84:799-806. 12. Peters MW, Pursley JR. Fertility of lactating dairy cows treated with ovsynch after presynchronization injections of PGF2α and GnRH. J. Dairy Sci 2002;85:2403-2406. 13. Diskin MG, Austin EJ, Roche JF. Exogenous hormonal manipulation of ovarian activity in cattle. Dom Anim Endocrinol 2002; 23(1-2):211-228. 14. Aréchiga CF, Staples CR, McDowell LR, Hansen PJ. Effects of timed insemination and supplemental β carotene on reproduction and milk yield of dairy cows under heat stress. J Dairy Sci 1998;81:390-402. 15. Stevenson JS, Kobayashi Y, Thompson KE. Reproductive performance of dairy cows in various programmed breeding systems including Ovsynch and combinations of gonadotropin-releasing hormone and prostaglandin F2α. J Dairy Sci 1999;82:506-515. 16. Carvalho PD, Guenther JN, Fuenzalida MJ, Amundson MC, Wiltbank MC, Fricke PM. Presynchronization using a modified Ovsynch protocol or a single gonadotropinreleasing hormone injection 7 d before an Ovsynch-56 protocol for submission of lactating dairy cows to first timed artificial insemination. J Dairy Sci 2014;97(10): 6305-6315.

752


Rev Mex Cienc Pecu 2020;11(3):738-756

17. Ferreira RM, Ayres H, Chiaratti MR, Ferraz ML, Araújo AB, Rodrigues CA, et al. The low fertility of repeat-breeder cows during summer heat stress is related to a low oocyte competence to develop into blastocysts. J Dairy Sci 2011;94(5):2383-2392. 18. Edwards JL, Bogart AN, Rispoli LA, Saxton AM, Schrick FN. Developmental competence of bovine embryos from heat-stressed ova. J Dairy Sci 2009;92(2):563570. 19. Roth Z, Arav A, Zeron Y, Braw-Tal R, Wolfenson D. Improvement of quality of oocytes collected in the autumn by enhanced removal of impaired follicles from previously heat-stressed cows. Reproduction 2001;122:737-744. 20. Guzeloglu A, Ambrose JD, Kassa T, Diaz T, Thatcher MJ, Thatcher WW. Long-term follicular dynamics and biochemical characteristics of dominant follicles in dairy cows subjected to acute heat stress. Anim Reprod Sci 2001; 66:15-34. 21. Friedman E, Voet H, Reznikov D, Wolfenson D, Roth Z. Hormonal treatment before and after artificial insemination differentially improves fertility in subpopulations of dairy cows during the summer and autumn. J Dairy Sci 2014;97(12):7465-7475. 22. Bruno RG, Farias AM, Hernández-Rivera JA, Navarrete AE, Hawkins DE, Bilby TR. Effect of gonadotropin-releasing hormone or prostaglandin F2α-based estrus synchronization programs for first or subsequent artificial insemination in lactating dairy cows. J Dairy Sci 2013;98(3):1556-1567. 23. Bauman DE, Everett RW, Weiland WH, Collier RJ. Production responses to bovine somatotropin in northeast dairy herds. J Dairy Sci.1999; 82(12):2564-2573. 24. Jousan FD, De Castro e Paula LA, Block J, Hansen PJ. Fertility of lactating dairy cows administered recombinant bovine somatotropin during heat stress. J Dairy Sci 2007; 90(1):341-351. 25. Rivera F, Narciso C, Oliveira R, Cerri RLA, Correa-Calderon A, Chebel RC, Santos JEP. Effect of bovine somatotropin (500 mg) administered at ten-d intervals on ovulatory responses, expression of estrus, and fertility in dairy cows. J Dairy Sci 2010; 93(4):1500-1510. 26. Collier RJ, Byatt JC, Denham SC, Eppard PJ, Fabellar AC, Hintz RL, McGrath MF, McLaughlin CL, Shearer JK, Veenhuizen JJ, Vicini JL. Effects of sustained release bovine somatotropin (Sometribove) on animal health in commercial dairy herds. J Dairy Sci 2001;84(5):1098-1108. 27. Bauman DE, St-Pierre NR, Milliken GA, Collier RJ, Hogan JS, Shearer JK, Smith KL, Thatcher WW. An updated meta-analysis of bovine somatotropin: effects on health 753


Rev Mex Cienc Pecu 2020;11(3):738-756

and welfare of dairy cows. 24th Tri-State Dairy Nutrition Conference, Fort Wayne, Indiana, USA, 20-22 April, 2015. 28. Moreira F, Risco CA, Pires MF, Ambrose JD, Drost M, Thatcher WW. Use of bovine somatotropin in lactating dairy cows receiving timed artificial insemination. J Dairy Sci 2000;83(6):1237-1247. 29. Bilby CR, Macmillan KL, Verkerk GA, Peterson JA, Koenigsfeld A, Lucy MC. A comparative study of ovarian function in American (US) Holstein and New Zealand (NZ) Friesian lactating dairy cows [abstract]. J Dairy Sci 1998; 81(Suppl 1):222 . 30. Morales-Roura JS, Zarco L, Hernández-Ceron J, Rodríguez G. Effect of short-term treatment with bovine somatotropin at estrus on conception rate and luteal function of repeat-breeding dairy cows. Theriogenology 2001;55:1831-1841. 31. Mendoza-Medel G, Hernández-Cerón J, Zarco-Quintero LA, Gutiérrez CG. Porcentaje de concepción en vacas Holstein repetidoras tratadas con somatotropina bovina al momento de la inseminación. Rev Mex Cienc Pecu 2013;4(2):177-183. 32. Moreira F, Badinga L, Burnley C, Thatcher WW. Bovine somatotropin increases embryonic development in superovulated cows and improves post-transfer pregnancy rates when given to lactating recipient cows. Theriogenology 2002;57:1371-1387. 33. Moreira F, Orlandi C, Risco CA, Mattos R, Lopes F, Thatcher WW. Effects of presynchronization and bovine somatotropin on pregnancy rates to a timed artificial insemination protocol in lactating dairy cows. J Dairy Sci 2001;84(7):1646-1659. 34. Lucy MC. Reproductive loss in high-producing dairy cattle: where will it end? J Dairy Sci 2001;84(6):1277-1293. 35. Collier RJ, Miller MA, McLaughlin CL, Johnson HD, Baile CA. Effects of recombinant bovine somatotropin (rbST) and season on plasma and milk insulin-like growth factors I (IGF-I) and II (IGF-II) in lactating dairy cows. Domest Anim Endocrinol 2008;35(1):16-23. 36. Santos JEP, Juchem SO, Cerri RLA, Galvao KN, Chebel RC, Thatcher WW, Dei CR, Bilby CR. Effect of bST and reproductive management on reproductive performance of Holstein dairy cows. J Dairy Sci 2004;87(4):868-881. 37. Ingraham RH, Stanley RW, Wagner WC. Relationship of temperature and humidity to conception rate of Hosltein cows in Hawai. J Dairy Sci 1976;59(12):2086-2090. 38. Ferguson JD, Galligan DT, Thomsen N. Principal descriptors of body condition score in Holstein cows. J. Dairy Sci. 1994;77:2695-2703.

754


Rev Mex Cienc Pecu 2020;11(3):738-756

39. SAS. Statistical Analysis System. In: SAS/STATTM user's guide. Release 6.03. Cary, NC, SAS Institute Inc. 1988. 40. Royal M, Mann GE, Flint AP. Strategies for reversing the trend towards subfertility in dairy cattle. The Vet J 2000;160:53-60. 41. Ferris CP, Patterson DC, Gordon FJ, Watson S, Kilpatrick DJ. Calving traits, milk production, body condition, fertility, and survival of Holstein-Friesian and Norwegian Red dairy cattle on commercial dairy farms over 5 lactations. J Dairy Sci 2014; 97(8):5206–5218. 42. Al-Katanani YM, Paula-Lopes FF, Hansen PJ. Effect of season and exposure to heat stress on oocyte competence in Holstein cows. J Dairy Sci 2002;85:390-396. 43. Beam SW, Butler WR. Effects of energy balance on follicular development and first ovulation in postpartum dairy cows. J Reprod Fertil 1999;54(Suppl):411-424. 44. Pollott GE, Coffey MP. The effect of genetic merit and production system on dairy cow fertility, measured using progesterone profiles and on-farm recording. J Dairy Sci 2008;9(9):3649–3660. 45. Boland MP, Lonergan P, O'Callaghann D. Effect of nutrition on endocrine parameters, ovarian physiology, and oocyte and embryo development. Theriogenology 2001; 55:1323-1340. 46. Leroy JLMR, Vanholder T, Mateusen B, Christophe A, Opsomer GA, de Kruif G. Genicot G, Van Soom A. Non-esterified fatty acids in follicular fluid of dairy cows and their effect on developmental capacity of bovine oocytesin vitro. Reproduction 2005;130:485-495. 47. Royal MD, Darwash AO, Flint APF, Webb R, Wolliams JA, Lamming GE. Declining fertility in dairy cattle: changes in traditional and endocrine parameters of fertility. J Anim Sci 2000;70:487-501. 48. Bell A, Rodríguez OA, De Castro e Paula LA, Padua MB, Hernández-Cerón J, Gutiérrez CG, De Vries A, Hansen PJ. Pregnancy success of lactating Holstein cows after a single administration of a sustained-release formulation of recombinant bovine somatotropin. BMC Vet Res 2008;4:22. 49. Rodríguez A, Díaz R, Ortiz O, Gutiérrez CG, Montaldo H, García C, Hernández-Cerón J. Porcentaje de concepción al primer servicio en vacas Holstein tratadas con hormona del crecimiento bovina en la inseminación. Vet Méx 2009;40:1-7. 50. Lucy MC. Regulation of ovarian follicular growth by somatotropin and insulin-like growth factors in cattle. J Dairy Sci 2000;83(7):1635-1647. 755


Rev Mex Cienc Pecu 2020;11(3):738-756

51. Bilby TR, Sozzi A, Lopez MM, Silvestre FT, Ealy AD, Staples CR, Thatcher WW. Pregnancy, bovine somatotropin, and dietary n-3 fatty acids in lactating dairy cows: I. Ovarian, conceptus, and growth hormone-insulin-like growth factor system responses. J Dairy Sci 2006;89:3360-3374. 52. Block J, Hansen PJ. Interaction between season and culture with insulin-like growth factor-1 on survival of in vitro produced embryos following transfer to lactating dairy cows. Theriogenology 2007;67:1518-1529.

756


https://doi.org/10.22319/rmcp.v11i3.5019 Artículo

Efecto del tamaño interno de la colmena en la producción de cría, miel y polen en colonias de Apis mellifera en el altiplano central de México

Alfonso Hernández Carlos a Ignacio Castellanos a*

a

Universidad Autónoma del Estado de Hidalgo. Centro de Investigaciones Biológicas. Km 4.5 carretera Pachuca-Tulancingo s/n, 42184, Hidalgo, México.

*Autor de correspondencia: ignacioe.castellanos@gmail.com

Resumen: El objetivo del estudio fue analizar el efecto del tamaño interno de la colmena sobre la fortaleza (superficie con cría) y reservas de alimento (superficie con miel y polen) de abejas melíferas en la temporada invernal en una región semiárida del altiplano central mexicano. Se utilizaron cuatro bastidores de colmenas tipo Jumbo (45 x 28 cm) dentro de cámaras de cría con tres tamaños internos (52.2, 42.3 y 23.9 L), que contenían el mismo número de abejas melíferas. De manera simultánea se registraron las temperaturas dentro de las colmenas para determinar si la temperatura de la cámara de cría variaba con el volumen. La colmena de mayor tamaño, que corresponde al tipo Jumbo y la más utilizada en el altiplano central mexicano, presentó los valores más bajos de fortaleza y reservas de alimento, así como la menor temperatura interna. Estos resultados muestran que la utilización de colmenas tipo Jumbo puede repercutir en una disminución de la productividad de miel y polen para los apicultores del altiplano central de México, por lo que es necesario implementar alguna práctica o mecanismo que permita mantener las colonias de abejas fuertes para la cosecha de primavera. Palabras clave: Apis mellifera, Colmena, Cámara de cría, Invierno, Temperatura, Miel.

757


Rev Mex Cienc Pecu 2020;11(3):757-770

Recibido: 16/08/2018 Aceptado: 09/06/2019

Introducción El clima juega un papel fundamental en la actividad y el comportamiento de los insectos sociales(1). Por ejemplo, la actividad de vuelo de Apis mellifera tiene una respuesta lineal positiva con la temperatura ambiental desde los 14 hasta los 22 °C(2,3) y por encima de 22 °C, el pecoreo va disminuyendo hasta detenerse a los 35 °C(3). La postura de huevos de la abeja reina de esta especie inicia a los 24 °C y alrededor de los 33 °C llega a su máxima capacidad, disminuyendo posteriormente(4). Así mismo, la elección de las flores por la abeja melífera depende de muchos factores, pero en primer lugar de la disponibilidad floral, es decir, depende de las especies vegetales cuya floración coincide con el periodo de pecoreo y esta floración depende de las condiciones climáticas(5,6). Las abejas almacenan grandes cantidades de miel y polen para proporcionar energía y proteína a las crías, así como para la termorregulación, lo que permite mantener el nido de cría entre los 32 y 36 °C para el desarrollo adecuado de las larvas(7,8), a pesar de tener temperaturas exteriores que varían entre -20 y 48 °C. Para mantener estable la temperatura dentro de la colmena, las abejas emplean mecanismos activos y pasivos. Dentro de los mecanismos activos se encuentra la actividad física para generar calor (e.g., por medio de la contracción de los músculos alares) o disminuir la temperatura (e.g., empleando las alas para la ventilación)(1,7,8). Los mecanismos pasivos incluyen la selección del nido de cría y el desplazamiento de la cría a regiones con una temperatura más favorable(1,8). En general, las abejas silvestres de A. mellifera eligen un nido de cría basándose en diferentes características como el tamaño, altura y orientación de la entrada, así como su volumen interno(9,10,11). Por ejemplo, las obreras de A. mellifera seleccionan nidos de cría con volúmenes entre 15 y 100 L, aunque el tamaño más recurrente es de 35 L(11). Las características que las abejas seleccionan son importantes, ya que el nido de cría provee de protección contra temperaturas adversas y de estabilidad térmica para las abejas(8,12,13). En la apicultura, el lugar y el tamaño del nido de cría es determinado por el hombre y a este espacio se le conoce como colmena(14). En México, en términos generales, se manejan dos tipos de colmenas tecnificadas: Jumbo y Langstroth(15). El espacio interno de la cámara de cría de estas colmenas es de 52.1 y 41.7 L respectivamente(16). Las colmenas tecnificadas poseen estructuras móviles que permiten aumentar el espacio para la puesta de la reina, lo que posibilita incrementar el tamaño de la colonia o 758


Rev Mex Cienc Pecu 2020;11(3):757-770

disminuirlo cuando los factores ambientales externos son adversos(17). Por lo tanto, el manejo adecuado del espacio puede influir en la superviviencia de las colonias en épocas críticas(13,18). En años recientes se han presentado múltiples cambios en los eventos meteorológicos, propiciando temporales erráticos y heladas tempranas, lo cual no favorece las condiciones óptimas para el desarrollo de la flora apícola(19,20,21). Esto hace necesario evaluar cómo el espacio interno de las colmenas utilizadas en México está repercutiendo en el mantenimiento de las poblaciones en la época invernal (cuando las temperaturas bajan y las abejas deben calentar el nido de cría por medios activos), y determinar el efecto que tiene el tamaño de la colmena sobre las abejas y algunos de sus productos como la miel y polen, bajo condiciones específicas de cada región apícola. Por lo tanto, el objetivo del presente trabajo fue determinar el efecto que tiene el tamaño interno de la colmena en la producción de progenie y el almacenamiento de miel y polen, así como en la temperatura interna del nido de cría, en colonias de A. mellifera en la temporada invernal.

Material y métodos Área de estudio La investigación se llevó a cabo en la localidad de Huitzila, municipio de Tizayuca, el cual se localiza en el estado de Hidalgo (19°47’50’’ - 19°53’50’’ N; 99°02’ - 98°54’ O) a una altitud de 2,260 msnm(22) dentro del altiplano central mexicano. El clima de esta región es templado subhúmedo con lluvias en verano, temperatura media anual de 15.1 °C y precipitación promedio anual de 627 mm. El mes más frío es enero, con una temperatura mínima y media de 1.4 y 11.5 °C, respectivamente, mientras que el mes más cálido es mayo, con una temperatura mínima y media de 8.7 y 17.8 °C, respectivamente(23).

Preparación de abejas En diciembre de 2016, al terminar el flujo de néctar y polen, se seleccionaron 10 colonias que presentaban desarrollo homogéneo y de éstas se extrajeron aproximadamente 120,000 abejas adultas(24) para el experimento, de las cuales se asignaron 10,000 obreras de forma homogénea a cada una de las 12 colonias que se utilizaron en el experimento. Para contar a las abejas, se utilizó una cámara de crecimiento a -2 0C durante 10 min (Shel Lab, modelo LI15) para inmovilizarlas. Cada uno de los 12 grupos de 10,000 abejas se colocó dentro de 12 colmenas de diferentes volúmenes internos con capacidad para albergar diferente número de bastidores de cámara 759


Rev Mex Cienc Pecu 2020;11(3):757-770

tipo Jumbo (45 x 28 cm) (Figura 1). Se emplearon 4 colmenas con capacidad para albergar 4 bastidores, 4 para albergar 8 bastidores y 4 para 10 bastidores, cuyas medidas externas fueron de 51 x 30 x 21 cm para 4 bastidores, 51 x 30 x 34 cm para 8 bastidores y 51 x 30 x 41 cm para 10 bastidores, lo que permitió tener volúmenes internos de 23.9 L (colmena experimental), 42.3 L (colmena tipo Langstroth) y 52.2 L (colmena tipo Jumbo), respectivamente. Las colmenas se construyeron de madera de pino de 2 cm de espesor y se trataron con parafina. A cada colonia con 10,000 abejas se le colocaron 4 bastidores con cera estampada y una abeja reina recién fecundada de un mismo pie de cría y del mismo lote de una mezcla heterogénea de las razas Italiana y Carniola, lo cual permitió que las colonias comenzaran con las mismas condiciones iniciales (las reinas eran hermanas). A cada colmena se le suministraron 600 ml de jarabe preparado con agua y azúcar en una proporción de 1:1 y 150 g de suplemento proteico (Apitir plus de la empresa Tirtécnica) cada ocho días(25,26). El suministro de jarabe y suplemento proteico se mantuvo durante todo el experimento. Figura 1: Colmenas con diferentes volúmenes internos utilizadas en el experimento, A) colmena exprimental, B) colmena tipo Langstroth y C) colmena tipo Jumbo

Experimento Se utilizaron cuatro repeticiones para cada tamaño de colmena, dando un total de 12 unidades experimentales que fueron colocadas en un diseño completamente al azar, a una distancia de 2 m entre hileras y 1 m entre colmenas de la misma hilera(17). Se registró la temperatura interna de las colmenas utilizando 24 dataloggers (Thermochron iButton modelo DS1921G). En cada colmena se colocaron dos dataloggers en el tercer bastidor, uno en el centro y el segundo a la altura del cabezal para determinar si la temperatura interna variaba con el volumen de la cámara de cría. Adicionalmente, se registró la

760


Rev Mex Cienc Pecu 2020;11(3):757-770

temperatura ambiental a la sombra utilizando 12 dataloggers. Las temperaturas se registraron cada 60 min durante el experimento. El experimento comenzó la primera semana de diciembre y terminó el 28 de abril, al inicio de la floración. Se contabilizó la superficie con cría, miel y polen utilizando una mica de plástico transparente cuadriculado en centímetros(24) (Figura 2). No se contabilizó el número de individuos adultos para no romper la cohesión social(24). Los registros de cría, miel y polen se llevaron a cabo en ambos lados de cada bastidor únicamente en tres fechas (2 de febrero, 7 de marzo y 28 de abril) para preservar la cohesión social(24). Figura 2: A) Bastidor con y B) sin la cuadrícula transparente utilizada para la cuantificación de la superficie con cría, miel y polen

Análisis estadístico Se utilizó un análisis de varianza de una vía (ANOVA) para determinar si existen diferencias significativas entre los tratamientos (tipos de colmena) en el área de cría, miel y polen para cada fecha de muestreo. Las temperaturas promedio en el centro y a la altura del cabezal a lo largo del experimento se compararon también con un ANOVA. Se verificaron los supuestos del ANOVA utilizando la prueba de Kolmogorov-Smirnov para la normalidad y la prueba de Levene para la homogeneidad de varianzas y en caso de no cumplirse, se utilizó un ANOVA no paramétrico (Kruskal-Wallis). Se aplicó la prueba de comparación múltiple de Tukey en los casos en los que se obtuvieron diferencias

761


Rev Mex Cienc Pecu 2020;11(3):757-770

significativas (P˂0.05). Los análisis estadísticos se realizaron con el paquete estadístico SigmaStat 3.5(27). Se reportan promedios ± error estándar.

Resultados La superficie con cría de A. mellifera en la primera fecha de muestreo (2 de febrero) fue de 1,125.73 ± 136.65 cm2 para las colmenas de 23.9 L, 1,016.75 ± 364.64 cm2 para las de 42.3 L y 1,398.63 ± 334.67 cm2 para las de 52.2 L y estos valores no difirieron significativamente entre sí (F=0.44, g.l.=2,11, P>0.05) (Figura 3). La superficie con cría de A. mellifera en la segunda fecha de muestreo (7 de marzo) fue de 1,610.25 ± 83.37 cm2 para las colmenas de 23.9 L, 1,654.75 ± 473.37 cm2 para las de 42.3 L y 1,692.75 ± 68.03 cm2 para las de 52.2 L y estos valores no difirieron significativamente entre sí (H=0.50, g.l.=2, P>0.05). La superficie con cría sí difirió significativamente entre tipos de colmena al final del experimento (28 de abril) (F=23.88, g.l.=2,11, P˂0.001). La superficie con cría en colmenas con un volumen interno de 23.9 L fue en promedio de 3,077.25 ± 81.81 cm2 y en las colmenas de 42.3 L fue de 2,906.2 ± 94.6 cm2 y ambos valores fueron significativamente mayores que el valor en las colonias que se desarrollaron en colmenas de 52.2 L, cuya superficie con cría fue de 2,331.2 ± 59.5 cm2 (P˂0.01). La superficie con cría en las colmenas de 23.9 L no difirió significativamente de aquella en las colmenas de 42.3 L (P>0.05). Figura 3: Superficie con cría (promedio ± error estándar) en tres tamaños de colmenas al final del periodo de estudio

ab

Valores con letras distintas indican diferencias significativas (P˂0.05).

762


Rev Mex Cienc Pecu 2020;11(3):757-770

La superficie con miel en la primera fecha de muestreo fue de 980.38 ± 263.64 cm2 para las colmenas de 23.9 L, de 952.75 ± 201.76 cm2 para las de 42.3 L y 992.50 ± 93.93 cm2 para las de 52.2 L (F=0.01, g.l.=2,11, P>0.05) (Figura 4). La superficie con miel en la segunda fecha de muestreo fue de 905.75 ± 198.38 cm2 para las colmenas de 23.9 L, 465.25 ± 167.03 cm2 para las de 42.3 L y 621.50 ± 184.88 cm2 para las de 52.2 L (F=1.48, g.l.=2,11, P>0.05). La superficie con miel al final del periodo de estudio sí difirió significativamente entre tipos de colmena (H=8.80, g.l.=2,11, P˂0.01). El promedio de la superficie con miel en las colmenas de 23.9 L (1424 ± 56.9 cm2) fue significativamente mayor que en las colmenas de 52.2 L (849.5 ± 94.4 cm2, P˂0.05), pero no difirió significativamente del valor en las colonias de 42.3 L (1056 ± 19.7, P>0.05). La superficie con miel en las colmenas de 42.3 y 52.2 L fue similar (P>0.05). Figura 4: Superficie con miel (promedio ± error estándar) en tres tamaños de colmenas al final del periodo de estudio

ab

Valores con letras distintas indican diferencias significativas (P˂0.05).

La superficie con polen en la primera fecha de muestreo fue de 136.38 ± 26.67 cm2 para las colmenas de 23.9 L, de 242.75 ± 147.59 cm2 para las de 42.3 L y 112.50 ± 13.14 cm2 para las de 52.2 L (H=0.34, g.l.=2, P>0.05). La superficie con polen en la segunda fecha de muestreo fue 252.75 ± 77.03 cm2 para las colmenas de 23.9 L, de 146.5 ± 35.11 cm2 para las de 42.3 L y 192.5 ± 43.19 cm2 para las de 52.2 L (F=0.94, g.l.=2,11, P>0.05). La superficie con polen al final del periodo de estudio sí difirió significativamente entre tipos de colmena (F=9.12, g.l.=2,11, P˂0.01) (Figura 5). La superficie con polen al final del periodo de estudio fue significativamente mayor en la colmena de 23.9 L (227.0 ± 37.0 763


Rev Mex Cienc Pecu 2020;11(3):757-770

cm2) que en las colmenas de 42.3 L (87.7 ± 29.9 cm2) y 52.2 L (56.2 ± 21.3 cm2) (P˂0.05). La superficie con polen en las colmenas de 42.3 y 52.2 L no difirió significativamente (P>0.05) (Figura 5). Figura 5: Superficie con polen (promedio ± error estándar) en tres tamaños de colmenas al final del periodo de estudio

ab

Valores con letras distintas indican diferencias significativas (P˂0.05).

La temperatura promedio en el centro de las colmenas fue relativamente estable a lo largo del día durante el experimento, a pesar de que la temperatura ambiental varió en promedio entre 7 y 33 °C (Figura 6). La temperatura en el centro de las colmenas de 23.9 L fue de 33.6 ± 1.0 °C, en las de 42.3 L fue de 33.4 ± 0.8 °C y en las de 52.2 L fue de 33.7 ± 0.9 °C (F=0.04, g.l.=2,11, P>0.05). La temperatura promedio a la altura del cabezal varió a lo largo del día en los tres tipos de colmenas y fue significativamente mayor en las colmenas de 23.9 L (23.4 ± 0.5 °C) y de 42.3 L (23.8 ± 0.6 °C) que en las colmenas de 52.2 L (21.4 ± 0.4 °C) (F=6.92, g.l.=2,11, P˂0.05) (Figura 7). La temperatura a la altura del cabezal en las colmenas de 23.9 y 42.3 L no difirió significativamente (P>0.05).

764


Rev Mex Cienc Pecu 2020;11(3):757-770

Figura 6: Temperatura ambiental y en el interior (centro y cabezal del tercer bastidor) en tres tamaños de colmenas

Los valores representan promedios ± error estándar.

Figura 7: Temperatura a la altura del cabezal (promedio ± error estándar) en tres tamaños de colmenas durante el periodo de estudio

ab

Valores con letras distintas indican diferencias significativas (P˂0.05) 765


Rev Mex Cienc Pecu 2020;11(3):757-770

Discusión Los resultados obtenidos en este trabajo muestran que el desarrollo de la colonia expresado en superficie con cría al final del experimento fue menor cuando éstas se encontraban en las cámaras de cría tipo Jumbo, las de mayor tamaño (Figura 3). De manera similar, la superficie con miel y polen fue menor en las colmenas con volúmenes internos de mayor tamaño (52.2 y 42.3 L) que en las colmenas experimentales de 23.9 L (Figuras 4,5). Estos resultados concuerdan con los reportados por Abd-Elmawgood et al(15) quienes compararon tres tamaños internos de colmenas (38, 31 y 24 L) y la mejor respuesta (mayor cantidad de cría, polen y miel) la obtuvieron con las colmenas de menor tamaño. Al igual que en nuestro trabajo, también encontraron que las diferencias en cantidad de cría, polen y miel entre colmenas de diferentes tamaños internos se manifestaron al final del invierno e inicio de la primavera. De manera similar, Ballesteros et al(28) reportaron que la producción de jalea real fue mayor en colmenas de recría de 6 bastidores que en colmenas de 8 y 10 bastidores. También se encontró que la temperatura en el centro del nido de cría de A. mellifera no difirió significativamente con respecto al tamaño de la colmena, lo cual indica que independientemente del tamaño de la colmena, las abejas pueden termorregular y mantener la cría a temperaturas alrededor de 33 °C para que su progenie se desarrolle adecuadamente(7,8). Sin embargo, la temperatura en el cabezal fue significativamente menor en las colmenas tipo Jumbo (52.2 L) que en las de 42.3 y 23.9 L (Figuras 6,7). Estos resultados muestran que en las cámaras de cría de menor tamaño las abejas pueden conservar de forma más eficiente el calor generado durante el calentamiento del nido de cría, lo cual ya había sido sugerido(15,28). El menor porcentaje de superficie con cría, miel y polen encontrado en las colmenas de mayor tamaño puede estar relacionado con diferentes factores. Es probable que las abejas hayan consumido más miel en las colmenas con menor temperatura interna para obtener la energía metabólica necesaria para termorregular(29,30). Aunque no se cuantificó directamente la producción de calor por las abejas, sí se observó que en las colmenas tipo Jumbo las obreras permanecían agregadas alrededor del nido de cría durante más tiempo que en las colmenas de menor tamaño, lo cual sugiere que las obreras en las colmenas de mayor tamaño invirtieron más tiempo en la termoregulación que en la producción de cría(31) o en el pecoreo(2,3,18). Adicionalmente, una mayor temperatura dentro de las colmenas de menor tamaño pudo facilitar la construcción del nido ya que la elasticidad de la cera aumenta y el gasto energético para moldearla disminuye con el incremento de la temperatura(32,33). Finalmente, es necesario considerar que el desarrollo de la colonia también depende de los adultos presentes durante la época invernal(17), sin embargo, en este trabajo no se cuantificaron para evitar que su manipulación afectara la cohesión social de 766


Rev Mex Cienc Pecu 2020;11(3):757-770

las colonias(24), pero es necesario que estos datos sean considerados en estudios posteriores. Se ha planteado que es necesario utilizar colmenas que permitan incrementar la temperatura interna de la colmena de la abeja europea durante la temporada invernal(34,35,36). En este trabajo se compararon dos tipos de colmenas utilizadas comúnmente en México (Jumbo y Langstroth) y una colmena experimental de menor tamaño. Los resultados muestran que la colmena experimental provee de mejores condiciones térmicas y de un aumento en la fortaleza (mayor cantidad de cría) y productividad de la abeja melífera. Sin embargo, los requerimientos térmicos y de espacio interno de la colmena de A. mellifera pueden variar entre razas y entre climas(37-40), por lo que es necesario realizar estudios bajo las condiciones específicas de cada región apícola.

Conclusiones e implicaciones La mejor respuesta de fortaleza (mayor cantidad de cría) y mayores reservas de miel de la abeja melífera se registró cuando se utilizó la colmena con el menor tamaño interno (23.9 L). La colmena tipo Jumbo, utilizada en el altiplano central de México, presentó los valores más bajos de miel, polen y cría al final de la temporada invernal. Esto puede repercutir en una disminución de la productividad de miel y polen para los apicultores que utilizan este tipo de colmena, por lo que es conveniente implementar alguna práctica o mecanismo que permita mantener las colonias de abejas fuertes para la cosecha de primavera. Por ejemplo, se puede alimentar a las abejas con agua y sustitutos de néctar y polen y disminuir el tamaño interno de la colmena utilizando reductores de espacio. La época de invierno tradicionalmente es considerada una temporada donde la abeja reina deja de poner huevos y los requerimientos térmicos y alimenticios de la colonia disminuyen. Sin embargo, durante el trabajo realizado en el municipio de Tizayuca se registraron temperaturas ambientales superiores a 24 °C por más de 6 h al día durante el invierno, lo que permitió que la abeja reina pudiera mantener la postura de huevos durante esta época. Este comportamiento tan diferente hace necesario un mejor seguimiento del apicultor para mantener las colonias de abejas con suficientes reservas de alimento durante el invierno para evitar que se debiliten.

Agradecimientos Al Consejo Nacional de Ciencia y Tecnología (CONACYT) por la beca otorgada a AHC durante la realización de este trabajo. También se agradece al Centro de Investigaciones Biológicas y al Programa Anual de Investigación (2016) de la Universidad Autónoma del Estado de Hidalgo, así como a REFAMA (REFAMA CONACYT clave 251272 "Red Temática Biología, Manejo y Conservación de Fauna Nativa en Ambientes Antropizados" por el apoyo otorgado durante la realización de este trabajo. Finalmente, agradecemos a Iriana Zuria y a dos revisores anónimos su valiosa ayuda para mejorar el manuscrito. 767


Rev Mex Cienc Pecu 2020;11(3):757-770

Literatura citada: 1. Jones CV, Oldroyd BP. Nest thermoregulation in social insects. Adv Insect Physiol 2007;33:153-171. 2. Burril RM, Dietz A. The response of honey bees to variations in solar radiation and temperature. Apidologie 1981;12(4):319-328. 3. Reyes CJL, Cano RP. Manual de polinización apícola. Programa nacional para el control de la abeja africana-Instituto interamericano para la cooperación agrícola. Manual no. 7. Distrito Federal, México: Secretaría de Agricultura, Ganadería, Pesca y Alimentación (SAGARPA); 2003. 4. Dunham WE. Temperature gradient in the egg-laying activities of the queen bee. Ohio J Sci 1930;30(6):403-410. 5. Yuca-Rivas R. Variación intranual en el espectro polínico de la miel producida en Huarán (Cusco, Perú). Ecol Apl 2016;15(1):27-36. 6. Cho LH, Gynheung A. The control of flowering time by environmental factors. Plant J 2017;90:708-719. 7. Heinrich B. The hot-blooded insects: strategies and mechanisms of thermoregulation. Alemania, Berlin: Springer-Verlag; 1993. 8. Winston ML. The biology of the honey bee. Cambridge, Massachusetts, EUA: Harvard University Press; 1987. 9. Seeley TD, Morse RA. The nest of the honey bee (Apis mellifera L.). Insectes Soc 1976;23(4):495-512. 10. Seeley TD, Morse RA. Nest site selection by the honey bee, Apis mellifera. Insectes Soc 1978;25(4):323-337. 11. Seeley TD. Measurement of nest-cavity volume by the honey bee (Apis mellifera). Behav Ecol Sociobiol 1977;2(2):201-227. 12. Szabo TI. The Thermology of wintering honeybee colonies in 4-colony packs as affected by various hive entrances. J Apic Res 1985;24(1):27-37. 13. Toomemaa K, Mand M, Williams IH. Wintering of honey bee colonies in cylindrical nest cavities versus oblong box-hives in a North European climate. J Apic Res 2016;54(4):105-111.

768


Rev Mex Cienc Pecu 2020;11(3):757-770

14. Ros PJM. Iniciación a la apicultura. Murcia, España: Comunidad Autónoma de la Región de Murcia; 2009. 15. Romero NJM. Diseño de colmena [tesis maestría]. Ciudad de México, México; Universidad Nacional Autónoma de México; 2017. 16. SAGARPA. Manual de buenas prácticas pecuarias en la producción de miel. Distrito Federal, México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación (SAGARPA);2010. 17. Jean-Prost P, Le Conte Y. Apicultura: conocimiento de la abeja, manejo de la colmena 4ª ed. Barcelona, España: Mundi-Prensa; 2006. 18. Abd-Elmawgood BH, Al-Rajhi MA, El-Ashhab AO. Effect of the internal size and thermal insulation of the hive on bee colonies strength and productivity. Egyptian J Agric Res 2015;93:185-195. 19. Hoover SER, Hoover TM. Impact of environmental change on honeybees and beekeeping. In: Gupta R, et al editors. Beekeeping for poverty alleviation and livelihood security. Nueva York, EUA: Springer; 2014:463-480. 20. Reddy PVR, Verghese A, Rajan VV, Potential impact of climate change on honeybees (Apis spp.) and their pollination services. Pest Manag Hortic Ecosyst 2012;18:121-127. 21. Contreras EF, Pérez AB, Echazarreta CM, Cavazos AJ, Macías MJO, Tapia GJM. Características y situación actual de la apicultura en las regiones Sur y Sureste de Jalisco, México. Rev Mex Cienc Pecu 2013;4(3):387-398. 22. SPDRMH. Secretaría de planeación y desarrollo regional y metropolitano del estado de Hidalgo, México. http://intranet.ehidalgo.gob.mx/NormatecaE/Archivos/archivo6405.pdf. Consultado 30 Ago, 2017. 23. DCM. Datos Climáticos Mundiales. https://es.climate-data.org/. Consultado 4 Jun, 2017. 24. Delaplane KS, Steen JVD, Guzman-Novoa E. Standart methods for estimating strength parameters on Apis mellifera colonies. J Apic Res 2013;52(1):1-12. 25. Cervantes GER. Incidencia de la alimentación suplementaria en la producción y productividad de la apicultura (Apis mellifera) [tesis licenciatura]. Colimbuela, Ecuador; Universidad Técnica del Norte; 2010. 26. Martínez GEG, Pérez LH. La producción de miel en el trópico húmedo de México: avances y retos en la gestión de la innovación 1ª ed. Texcoco, México: Universidad Autónoma Chapingo; 2013. 769


Rev Mex Cienc Pecu 2020;11(3):757-770

27. Systat Software. SigmaStat 3.5. Chicago, EUA: Systat Software; 2006. 28. Ballesteros HH, Vásquez RE. Determinación de jalea real en colmenas de recría de diferentes dimensiones. Revista Corpoica 2007;8(1):75-78. 29. Southwick E. Metabolic energy of intact honey bee colonies. Com Biochem Physiol 1982;71(2):277-281. 30. Seeley TD, Visscher PK. Survival of honeybees in cold climates: the critical timing of colony growth and reproduction. Ecol Entomol 1985;10(1)81-88. 31. Vogt FD. Thermoregulation in bumblebee colonies. I. Thermoregulatory versus broodmaintenance behaviors during acute changes in ambient temperature. Physiol Zool 1986;59(1):55-59. 32. Hepburn HR. Honeybees and wax, an experimental natural history. Heidelberg, Alemania: Springer; 1986. 33. Karihaloo BL, Zhang K, Wang J. Honeybee combs: how the circular cells transform into rounded hexagons. J R Soc Interface 2013;10(86):20130299. 34. Abou-Shaara HF, Oways AA, Ibrahim YY, Basuny NK. A review of impacts of temperature and relative humidity on various activities of honey bees. Insectes Soc 2017;64(4):455-462. 35. Wineman E, Lensky Y, Mahrer Y. Solar heating of honey bee colonies (Apis mellifera L.) during the subtropical winter and its impact on hive temperature, worker population and honey production. Am Bee J 2003;43(7):565-570. 36. Erdogan Y, Dodologlu A, Emsen B. Some physiological characteristics of honeybee (Apis mellifera L.). housed in heated, fan wooden and insulated beehives. J Anim Vet Adv 2009;8(8):1516-1519. 37. Gould JL. Why do honey bees have dialects? Behav Ecol Sociobiol 1982;10(1):53-56. 38. Schmidt JO, Hurley R. Selection of nest cavities by Africanized and European honey bees. Apidologie 1995;26(6):467-475. 39. Schneider S, Blyther R. The habitat and nesting biology of the African honey bee Apis mellifera scutellata in the Okavango River Delta, Botswana, Africa. Insectes Soc 1988;35(2):167-181. 40. Hoover SER, Hoover TM. Beehives in the world. In: Gupta R, Reybroeck W, van Veen J, Gupta A editors. Beekeeping for poverty alleviation and livelihood security. Nueva York, EUA: Springer; 2014:125-170. 770


https://doi.org/10.22319/rmcp.v11i3.5154 Artículo

Seroprevalencia de agentes virales del Complejo Respiratorio Bovino en razas criollas del Centro de Investigación Turipaná de AGROSAVIA

Matiluz Doria-Ramos a* Teresa Oviedo-Socarras b Misael Oviedo-Pastrana a Diego Ortiz-Ortega c

Corporación Colombiana de Investigación Agropecuaria – AGROSAVIA, Centro de investigación Turipaná, Km 13 vía Montería. Cereté, Córdoba, Colombia. a

b

Universidad de Córdoba. Facultad Medicina Veterinaria y Zootecnia. Departamento de Ciencias Pecuarias. Montería, Colombia. Corporación Colombiana de Investigación Agropecuaria – AGROSAVIA. Centro de Investigación Tibaitatá, Mosquera-Cundinamarca. Colombia. c

* Autor de correspondencia: mdoriar@agrosavia.co

Resumen: Se realizó un estudio descriptivo de corte transversal para determinar la prevalencia y factores epidemiológicos asociados con las enfermedades virales del Complejo Respiratorio Bovino (CRB) en razas criollas del Centro de Investigación Turipaná - AGROSAVIA (Colombia). Se evaluaron 403 bovinos de la raza Romosinuano y 445 Costeño con Cuernos (CCC). A través de la técnica de ELISA indirecta se determinó la presencia de anticuerpos para diarrea viral bovina (DVB), rinotraqueitis infecciosa bovina (IBR), parainfluenza-3 (PI3) y virus sincitial respiratorio bovino (BRSV). Se obtuvieron las prevalencias y se evaluó la asociación entre los agentes virales y entre estos con las variables sexo, edad, tipo de hato y raza; la prueba de Ji-cuadrada se aplicó con un nivel de significancia del 5% y el efecto de la asociación fue determinado por la razón de probabilidades (OR). se constituyó un modelo de

771


Rev Mex Cienc Pecu 2020;11(3):771-782

regresión logística para explicar la enfermedad más prevalente. Las prevalencias medias en las dos razas fueron: DVB (33.02 %), BRSV (18.51 %), IBR (12.85 %) y PI3 (11.20 %); sin embargo, individualmente, la raza CCC presentó mayor prevalencia para todas las enfermedades. El modelo de regresión mostró una asociación entre DVB, IBR y PI3, las variables sexo, edad, hembras con más de 1 año de edad y la raza CCC. Para abordar las enfermedades del CRB, se recomiendan acciones con énfasis en el control y prevención de DVB y estudios más profundos para entender la dinámica y co-endemicidad de la DVB, IBR, BRSV y PI3 en las razas estudiadas. Palabras clave: Seroprevalencia, Complejo respiratorio bovino, Enfermedad respiratoria bovina, Romosinuano, Costeño con Cuernos.

Recibido: 20/11/2018 Aceptado: 23/09/2019

Introducción La enfermedad del complejo respiratorio bovino (CRB) es una de las principales causas de pérdidas económicas en las explotaciones ganaderas(1). Estas pérdidas se atribuyen a la disminución de la eficiencia productiva, los costos del tratamiento, el aumento del trabajo de parto y la muerte de los animales debido a la neumonía(2). El desarrollo de CRB está asociado con factores ambientales (manejo, estrés y alimentación), factores específicos del individuo (edad, condición corporal e inmunidad) y la acción de agentes infecciosos (virus, bacterias y parásitos)(1). Los agentes virales asociados con CRB incluyen el virus de la IBR, PI3, BRSV y DVB(3). La enfermedad respiratoria se produce cuando un virus patógeno infecta al hospedero y permite que las bacterias oportunistas, normalmente presentes en el tracto respiratorio superior, invadan los pulmones y produzcan neumonía grave y la muerte. Estas bacterias incluyen Pasteurella multocida, Mannheimia haemolytica, Mycoplasma bovis e Histophilus somni(1). Estudios epidemiológicos en el municipio de Montería, departamento de Córdoba, determinaron la seroprevalencia de los virus asociados con CRB, siendo de 74.7 % para IBR(4), 29.4 % para BVD(5), 13.5 % para PI-3(6) y 13 % para BRSV(7). El objetivo de este estudio fue analizar la presencia de los virus de la DVB, IBR, PI3 y BRSV, implicados en el CRB y los factores epidemiológicos asociados en las dos razas bovinas 772


Rev Mex Cienc Pecu 2020;11(3):771-782

criollas en el centro de investigación Turipaná de AGROSAVIA, en el municipio de Cereté, Córdoba.

Material y métodos Sitio de estudio El estudio se realizó en el centro de investigación Turipaná de AGROSAVIA, ubicado a 8º50'79 N y -75º47'58" O, en el municipio de Cereté, departamento de Córdoba, Colombia. El área está clasificada como bosque tropical seco, tiene una altitud de 14 msnm, temperatura promedio de 27.5 ºC, humedad relativa de 81% y precipitación promedio anual de 1,340 mm, donde el 85 % de la lluvia cae entre los meses de abril y noviembre(8).

Tipo de estudio y tamaño de muestra Se realizó un estudio epidemiológico descriptivo de tipo transversal entre todos los animales de las dos razas criollas, Romosinuano (403 animales) y Costeño Con Cuernos (445 animales), en el centro de investigación Turipaná de AGROSAVIA. El estudio se realizó en mayo a octubre de 2016.

Procesamiento de muestras Después de la desinfección del área, se recogieron 5 ml de sangre de la vena coccígea, en tubos vacutainer® sin anticoagulante. Las muestras se marcaron con el número del animal y la fecha de recolección y se almacenaron a una temperatura de 4 ºC. Posteriormente, se centrifugaron a 3,500 rpm durante 5 min para obtener suero, luego se colocaron en viales y se almacenaron a -20 °C hasta un análisis posterior. Se procesaron en el laboratorio en el centro de investigación Tibaitatá de AGROSAVIA, en el departamento de Cundinamarca, utilizando kits comerciales de prueba ELISA (Synbiotics® para BVD e IBR, Biox Prionics® para BRSV y PI3) siguiendo las recomendaciones del fabricante.

Análisis de datos El estudio de prevalencia se acompañó de una encuesta epidemiológica encaminada a determinar factores que podrían tener asociación con las patologías en estudio; se analizaron los factores sexo, raza (Romosinuano y CCC), edad (< 1 año y > 1 año) y tipo de hato (Banco de germoplasma y Mejoramiento genético). Estos factores se asociaron de forma univariada con los resultados serológicos (positivo o negativo) de cada uno de los agentes infecciosos estudiados; se aplicó el estadístico Ji-cuadrada y un nivel de significancia de 0.05; 773


Rev Mex Cienc Pecu 2020;11(3):771-782

adicionalmente, se determinaron las medidas de razón de probabilidades. Finalmente, se construyó un modelo de regresión logística para explicar la correlación entre los factores y las enfermedades estudiadas; como variable respuesta se seleccionó la enfermedad que tuvo la mayor prevalencia. Los datos se analizaron utilizando el software EpiInfo 7.2.1.0 ®.

Resultados y discusión Los virus de la DVB, IBR, PI3 y BRSV, que hacen parte del complejo CRB han sido reportados en diferentes granjas ganaderas en Colombia, sin embargo, este estudio es el primero que busca determinar su prevalencia en las razas criollas Romosinuano y CCC. Se afirma que estas razas son resistentes y bien adaptadas a las condiciones ecológicas del trópico bajo en la costa norte de Colombia(9,10), no obstante, ambas presentaron seroprevalencia para las cuatro enfermedades virales del complejo CRB, siendo la CCC la más susceptible (Cuadro 1). EL virus con mayor presencia en ambas razas fue el de la DVB con una prevalencia de 33.60 %, continuando casi con la mitad de porcentaje el virus BRSV (18.51 %), mientras los agentes con menor presencia fueron IBR y PI3 con prevalencias de 12.8 % y 11.20 %, respectivamente.

Cuadro 1: Seroprevalencia de las enfermedades virales del CRB en las razas criollas del C.I Turipaná (%) Enfermedad

Variables Categorías

DVB

Raza

BRSV

Raza

IBR

Raza

PI3

Raza

Romosinuano CCC Romosinuano CCC Romosinuano CCC Romosinuano CCC

n+

n-

Seroprevalencia

100 185 60 97 47 62 29 66

303 265 343 348 356 383 374 379

24.81 40.45 14.89 21.80 11.66 13.93 7.20 14.83

Al igual que en este estudio, se ha confirmado una alta seroprevalencia para DVB en otras regiones de Colombia; un estudio previo en el municipio de Montería reportó un 29.5 % de seropositividad(6) y otro en el departamento de Cesar obtuvo resultados de 46%(11).

774


Rev Mex Cienc Pecu 2020;11(3):771-782

Se cree que el BRSV prevalece en las poblaciones bovinas de todo el mundo. Estudios sobre este virus en animales con antecedentes de infertilidad en Montería obtuvieron seroprevalencias del 13 %(5) y en terneros recién nacidos 31 %(12). En Inglaterra, el 83 % del ganado tiene anticuerpos y en los Estados Unidos está implicado en más del 50 % de las enfermedades respiratorias del ganado de engorde(13). La prevalencia de IBR en bovinos ha sido reportada históricamente en varias regiones de Colombia. En 1982 se encontró seropositividad de 51.7 % en la región Caribe, 21.5 % en la región Andina y el 20.6 % en el Pie de Monte Llanero(14). Recientemente, se reportaron prevalencias de 55.5 % en la región de Magdalena(15) y 35.65 % en el municipio de Toca – Boyacá(16). De los reportes analizados, las seroprevalencias más altas para este virus han sido reportadas en el municipio de Montería, donde se encontró 74.7 % de seroprevalencia en hembras con antecedentes de infertilidad(4) y 60 % en terneros recién nacidos(12). El virus de la PI-3 es uno de los patógenos respiratorios virales más importantes del ganado joven y adulto asociado con el CRB(17). En el municipio de Montería se ha informado una prevalencia del 13.5 % en bovinos de doble propósito(7) y 41 % en terneros recién nacidos(12); en el departamento de Antioquia en la raza criolla Blanco Orejinegro, se reportó una prevalencia de 68.9 %(18). Seroprevalencias del 44.6 % fueron encontradas en Argentina(2) y 81.8 % en Perú(19). El análisis univariado de los factores estudiados sobre las diferentes enfermedades del CRB se presenta en los Cuadros 2,3,4 y 5. La mayor susceptibilidad de las hembras a las enfermedades del CRB podría explicarse como consecuencia al alto número de manejos realizados en hembras, debido a una mayor demanda productiva y reproductiva. Los factores asociados con el ordeño, la inseminación artificial y la transferencia de embriones se consideran factores de estrés que pueden hacer que las hembras sean más susceptibles a las enfermedades en comparación con los machos(20).

775


Rev Mex Cienc Pecu 2020;11(3):771-782

Cuadro 2: Análisis univariado de factores asociados al virus de la DVB en el hato bovino criollo del Centro de Investigación Turipaná de Corpoica IC 95% Variables Categorías n+ nP-valor OR Inferior Superior Macho 41 232 Sexo <0.001 4.025 2.776 5.833 Hembra 239 336 Edad

Hato

Raza

˂ 1 año

47

185

˃ 1 año

233

383

Mejoramiento 11 Genético

71

Banco 269 Germoplasma

497

Romosinuano

100

303

CCC

180

265

<0.001

2.395

1.672

3.430

<0.001

3.493

1.819

6.706

<0.001

2.058

1.532

2.763

Cuadro 3: Análisis univariado de factores asociados al virus de la IBR en el hato bovino criollo del Centro de Investigación Turipaná de AGROSAVIA PIC 95% Variables Categorías n+ nO.R Inferior Superior valor Macho 26 247 Sexo 0.045 1.602 1.005 2.554 Hembra 83 492 Edad

Hato

Raza

˂ 1 año ˃ 1 año Mejoramiento Genético Banco Germoplasma Romosinuano

37 72

195 544

11

71

98

668

47

356

CCC

62

383

776

0.098

0.698

0.454

1.071

0.873

0.946

0.484

1.849

0.324

1.226

0.817

1.839


Rev Mex Cienc Pecu 2020;11(3):771-782

Cuadro 4: Análisis univariado de factores asociados al BRSV en el hato bovino criollo del Centro de Investigación Turipaná de Corpoica PIC 95% Variables Categorías n+ nO.R Inferior Superior valor Macho 36 237 0.005 1.754 1.171 2.627 Sexo Hembra 121 454 Edad

Hato

Raza

˂ 1 año

50

182

˃ 1 año

107

509

Mejoramiento 19 Genético

63

Banco 138 Germoplasma

628

Romosinuano

60

343

CCC

97

348

0.162

0.765

0.525

1.115

0.253

0.728

0.422

1.256

0.009

1.593

1.117

2.272

Cuadro 5: Análisis univariado de factores asociados al virus PI3 en el hato bovino criollo del Centro de Investigación Turipaná de Corpoica Variables Categorías n+ nP-valor O.R IC 95% Inferior Superior Macho 9 264 Sexo <0.001 5.158 2.554 10.417 Hembra 86 489 ˂ 1 año

10

222

Edad

˃ 1 año

85

531

Hato

Mejoramiento Genético 1

Raza

3.554

1.812

6.971

0.002

11.330

1.558

8.237

<0.001

2.245

1.418

3.555

81

Banco Germoplasma 94 Romosinuano 29

672 374

CCC

379

66

0.000

La edad se asoció positivamente con BVD y PI3, siendo más afectados los animales >1 año (2.39 y 3.55 veces, respectivamente). Aunque el ganado es susceptible a la infección por BVD en todas las edades, es más probable que los animales mayores de un año sean seropositivos. Esto probablemente se deba a la disminución de la inmunidad pasiva derivada de los anticuerpos maternos y adicionalmente, a mayor tiempo de exposición a los patógenos involucrados en la enfermedad(21). 777


Rev Mex Cienc Pecu 2020;11(3):771-782

El tipo de hato también se asoció con BVD y PI3, en este sentido, el hato del Banco de Germoplasma se vio más afectado que el programa de Mejoramiento Genético (3.49 y 11.33 veces para BVD y PI3, respectivamente). La mayor susceptibilidad del ganado en el hato del Banco de Germoplasma podría explicarse por la mayor densidad de población en este grupo lo que favorece la dispersión aerógena de estos virus y a la mayor humedad en los potreros utilizados por estos animales también es un factor que favorece la presentación de la enfermedad(22). El análisis univariado arrojó asociación estadística entre la variable raza y BVD, BRSV y PI3, siendo los CCC los de mayor seropositividad a estos tres agentes infecciosos en comparación con la raza Romosinuano. La raza CCC fue 2.05 veces más seropositiva a BVD, 1.59 veces más seropositiva a BRSV y 2.24 veces más seropositiva a PI3. Sin embargo, el análisis multivariado solo reveló una asociación estadísticamente significativa entre el CCC y la BVD (OR = 1.845, IC 95% = 1.349-2.523, P<0.001). No hay estudios que demuestren una mayor exposición sobre el CCC que Romosinuano a estos agentes infecciosos. Por lo tanto, se sugiere que se lleven a cabo estudios inmunológicos específicos para investigar más a fondo la susceptibilidad específica de la raza a estas enfermedades. BVD y PI3 fueron los únicos agentes infecciosos que presentaron una asociación estadística con todas las variables estudiadas. Sin embargo, como BVD era más frecuente en los hatos estudiados, el modelo de regresión logística para las enfermedades virales del complejo BRD se basó en BVD. El modelo de regresión logística (Cuadro 6) mostró que BVD tiene una asociación con el sexo hembra, animales mayores de un año y la raza CCC, lo que sugiere que estos factores podrían contribuir significativamente al desarrollo de estas infecciones. La asociación entre BVD, IBR y PI3 también se demostró. Los animales positivos a IBR tienen 3.04 veces más probabilidad de tener BVD, mientras que los animales PI3 positivos tienen 3.81 veces más posibilidades; sin embargo, debido al tipo de diagnóstico serológico y debido a que es un estudio transversal, no es posible detectar la relación causal entre las tres enfermedades, ni evaluar una secuencia temporal en su presentación. Aunque el modelo final mostró relevancia epidemiológica, los estadístico log-likelihood y Hosmer-Lemeshow indicaron un pobre ajuste del modelo; sin embargo, no se consideró la eliminación de variable debido a que todas las que quedaron en el modelo final tienen importancia epidemiológica, lo cual fue confirmado mediante la estadística univariada. Nuevos estudios epidemiológicos son necesarios para investigar más a fondo estos aspectos.

778


Rev Mex Cienc Pecu 2020;11(3):771-782

Cuadro 6: Modelo de regresión logística para las enfermedades del CRB, con base en el virus de la DVB IC 95% Variables Categorías P-valor OR Inferior Superior Macho Sexo <0.001 3.833 2.587 5.678 Hembra ˂ 1 año Edad <0.002 1.871 1.262 2.773 ˃ 1 año Romosinuano Raza <0.001 2.564 1.846 3.561 CCC Negativo IBR <0.001 3.045 1.659 5.589 Positivo Negativo PI3 <0.001 3.811 1.966 7.386 Positivo

Conclusiones e implicaciones En conclusión, todos los principales agentes virales que participan en el complejo BRD están presentes en el ganado criollo del Centro de Investigación Turipaná. Se recomienda un plan de acción para controlar y prevenir estas enfermedades en el centro de investigación, con énfasis en el control y prevención de BVD; adicionalmente, se requieren más estudios de seguimiento para comprender la dinámica y los procesos de co-endemicidad de BVD, IBR, BRSV y PI3 en las razas Romosinuano y CCC.

Agradecimientos Los autores agradecen al Sistema de Bancos de Germoplasma de la Nación para la Alimentación y la Agricultura (SBGNAA) con sede en el C.I. Turipaná de AGROSAVIA, por permitir el acceso a los bovinos usados en esta investigación.

Conflicto de interés Los autores declaran la ausencia de cualquier conflicto de interés.

779


Rev Mex Cienc Pecu 2020;11(3):771-782

Literatura citada: 1.

Gershwin LJ, Van Eenennaam AL, Anderson ML, McEligot HA, Shao MX, ToaffRosenstein R et al. Single Pathogen Challenge with Agents of the Bovine Respiratory Disease Complex. PLoS One 2015; 10(11):142-479. https://doi.org/10.1371/journal.pone.0142479.

2.

Carbonero A, Maldonado A, Perea A, García-Bocanegra I, Borge C, Torralbo A et al. Factores de riesgo del síndrome respiratorio bovino en terneros lactantes de Argentina. Arch Zoot 2011; 60 (229):41-51. https://dx.doi.org/10.4321/S000405922011000100005.

3.

Grissett GP, White BJ, Larson RL. Structured literature review of responses of cattle to viral and bacterial pathogens causing bovine respiratory disease complex. J Vet Intern Med 2015;29(3):770-780. http://doi.org/10.1111/jvim.12597.

4.

Betancur C, González M, Reza L. Seroepidemiología de la rinotraqueitis infecciosa bovina en el municipio de Montería, Colombia. Rev MVZ Córdoba 2006;11(2):830836. https://doi.org/10.21897/rmvz.447.

5.

Betancur H, Rodas J, González M. Estudio seroepidemiológico del virus respiratorio sincitial bovino en el municipio de Montería, Colombia. Rev MVZ Córdoba 2011;16(3):2778-2784. https://doi.org/10.21897/rmvz.278.

6.

Betancur H, Gogorza LM, Martínez FG. Seroepidemiología de la diarrea viral bovina en Montería (Córdoba, Colombia). Analecta Vet 2007;27(2):11-16. http://sedici.unlp.edu.ar/handle/10915/11204.

7.

Betancur H, Orrego A, González M. Estudio seroepidemiológico del virus de parainfluenza 3 en bovinos del municipio de Montería (Colombia) con trastornos reproductivos. Rev Mev Vet 2010;20: 63-70. https://doi.org/10.19052/mv.583.

8.

Saraz GA. Influencia de los factores genéticos y ambientales en caracteres productivos y reproductivos de la raza criolla colombiana Romosinuano (No. Doc. 22372, CO-BAC, Bogotá). 2004.

9.

Ossa G, Abuabara Y, García JP, Martínez G. El ganado criollo colombiano Costeño con Cuernos (CCC). Anim Genet Resour 2011;48:101-107.

10. Elzo MA, Manrique C, Ossa G, Acosta O. Additive and nonadditive genetic variability for growth traits in the Turipana Romosinuano × Zebu multibreed herd. J Anim Sci 1998;76:1539-1549. https://doi.org/10.2527/1998.7661539x.

780


Rev Mex Cienc Pecu 2020;11(3):771-782

11. Peña IF. Estudio serológico de diarrea viral bovina en la microrregión del valle del Cesar. AICA 2011; 1:309-312. Disponible en: https://aicarevista.jimdo.com/. 12. Betancur HC, Castañeda TJ, González TM. Inmunopatología del complejo respiratorio bovino en terneros neonatos en Montería-Colombia. Rev Cient 2017;27(2):95-102. 13. Tjørnehøj K, Uttenthal Å, Viuff B, Larsen LE, Røntved C, Rønsholt L. An experimental infection model for reproduction of calf pneumonia with bovine respiratory syncytial virus (BRSV) based on one combined exposure of calves. Res Vet Sci 2003;74(1):5565. https://doi.org/10.1016/S0034-5288(02)00154-6. 14. Griffiths IB, Gallego M, Villamil L. Factores de infertilidad y pérdidas económicas en ganado de leche en Colombia (No. Doc. 4186)* CO-BAC, Santafé de Bogotá). 1982. 15. Piedrahita LE, Montoya LM, Pedraza FJ. Herpes Virus Bovino tipo 1 (BoHV-1) como posible causa de encefalitis en bovinos de la región del Magdalena Medio Colombiano: Estudio serológico y análisis epidemiológico. Rev Colom Cienc Pecu 2010;23(2):191198. 16. Ochoa X, Orbegozo M, Manrique F, Pulido M, Ospina J. Seroprevalencia de rinotraqueitis infecciosa bovina en hatos lecheros de Toca – Boyacá. Rev MVZ Córdoba 2012;17(2):2974-2982. 17. Sobhy NM, Mor SK, Bastawecy IM, Fakhry HM, Youssef CRB, Goyal SM. Surveillance, isolation and complete genome sequence of bovine parainfluenza virus type 3 in Egyptian cattle. Int J Vet Sci Med 2017;5(1):8-13. doi: 10.1016/j.ijvsm.2017.02.004. 18. Molina SH, Castaño J, Arboleda J, Cadavid J, Zapata M. Estudio serológico para el virus de parainfluenza-3 en el hato BON en el departamento de Antioquia. Rev Colomb Cienc Pecu 1998;11(2):81-86. 19. Cabello R, Quispe Ch, Rivera G. Frecuencia de los virus Parainfluenza-3, Respiratorio Sincitial y Diarrea Viral Bovina en un rebaño mixto de una comunidad campesina de Cusco. RIVEP 2006;17(2):167-172. http://dx.doi.org/10.15381/rivep.v17i2.1535. 20. Chamizo EG. Leucosis bovina enzootica: Revisión. REDVET 2005;6(7):21-25. http//www.redalyc.org/articulo.oa?id=63612652016. 21. Ellis J, West K, Cortese V, Konoby C, Weigel D. Effect of maternal antibodies on induction and persistence of vaccine-induced immune responses against bovine viral diarrhea virus type II in young calves. J Am Vet Med Assoc 2001;219(3):351-356. https://doi.org/10.2460/javma.2001.219.351. 781


Rev Mex Cienc Pecu 2020;11(3):771-782

22. Morรกn P, Di Santo M, Gogorza L. Transmisiรณn del virus de la diarrea viral bovina. Factores de riesgo en el ingreso y diseminaciรณn en los rodeos. Rev Vet 2006;17(1): 5058.

782


https://doi.org/10.22319/rmcp.v11i3.5269 Artículo

Frecuencia y factores de riesgo asociados a la presencia de Chlamydia abortus, en rebaños ovinos en México

Erika G. Palomares Reséndiz a Pedro Mejía Sánchez a Francisco Aguilar Romero a Lino de la Cruz Colín b Héctor Jiménez Severiano c José Clemente Leyva Corona d Marcela I. Morales Pablos d Efrén Díaz Aparicio a*

a

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias (INIFAP). CENID Salud Animal e Inocuidad. Carretera México –Toluca, colonia Palo Alto, 05110. Ciudad de México. México.

b

INIFAP. CIRCE. Pachuca. Hidalgo. México.

c

INIFAP. CENID Fisiología. Ajuchitlán, Querétaro. México.

d

Instituto Tecnológico de Sonora. Ciudad Obregón, Sonora. México.

*Autor de correspondencia: efredia@yahoo.com

783


Rev Mex Cienc Pecu 2020;11(3):783-794

Resumen: El objetivo fue evaluar la frecuencia serológica individual y de rebaño, así como detectar los factores de riesgo de C. abortus, en siete estados donde se realiza la producción ovina en México. Se efectuó un estudio multifactorial, transversal y estratificado, con análisis de 5,321 muestras serológicas en 323 rebaños de 61 municipios. Se realizó ELISA con un kit comercial. Los factores de riesgo asociados con la enfermedad se determinaron mediante cuestionarios y análisis estadísticos con una prueba de Ji cuadrada con un intervalo de confianza del 95%. Del total de 5, 231 muestras de suero que fueron colectadas, 581 (10.92 %) dieron positivas a la prueba de ELISA. Los resultados por estado de sueros positivos fueron: Tlaxcala 13.08% (73/558); Sonora 12.45 % (102/819); Chihuahua 11.56 % (107/925); Hidalgo 11.34 % (97/855); Chiapas 10.15 % (60/591); Querétaro 9.69 % (79/815); Estado de México 7.09 % (63/758). La frecuencia de hatos seropositivos, fue de 43.34 % (140/323). Los resultados al ser agrupados por estado fueron los siguientes: Hidalgo 67.39 % (31/46), Querétaro 67.18 % (43/64); Sonora 40.92 % (19/47); Tlaxcala 33.33 % (12/36); Chiapas 31.57 % (12/38); Estado de México 25.45 % (14/55) y Chihuahua 24.32 % (9/37). Los principales factores de riesgo que favorecen la presencia del aborto enzoótico de las ovejas, fueron que estuviesen gestantes, que tuviesen una edad entre los 37 a los 48 meses y que el sistema de producción fuese intensivo. Estos estudios serológicos identificaron la presencia del aborto enzoótico de las ovejas en México, así como algunos de los factores de riesgo que inciden para favorecer su presencia. Palabras clave: Chlamydia abortus, Ovejas, Seroprevalencia, Factores de riesgo, México.

Recibido: 20/02/2019 Aceptado: 02/10/2019

Introducción El aborto enzoótico de las ovejas (AEO) o la clamidiasis ovina, es una enfermedad infecciosa causada por Chlamydia abortus, una bacteria intercelular obligada Gram negativa. La bacteria tiene afinidad por las membranas mucosas, por lo tanto, después de la invasión placentaria, tiende a causar ulceración del epitelio endometrial, aborto o nacimiento de crías débiles(1-2).

784


Rev Mex Cienc Pecu 2020;11(3):783-794

Los casos de aborto son críticos para la ganadería, ya que contribuyen a que se presenten mermas económicas debidas a la falta de crías y de pérdida de la producción lechera. C. abortus tiene un potencial zoonótico, causa conjuntivitis, neumonía y aborto en humanos(3,4). Los abortos causados por la AEO, se presentan en el último tercio de la gestación, sin signos clínicos antes del momento del aborto y prevalecen en áreas donde los rebaños se mantienen en espacios sobrepoblados durante las temporadas de parto(3). Los signos clínicos presentes en los rebaños ovinos, incluyen epididimitis, neumonía, artritis y conjuntivitis(5-8). En México, se han realizado diversos estudios sobre pequeños rumiantes; en 1996, se informó el aislamiento de Chlamydia psittaci en infecciones subclínicas entéricas en rebaños de ovejas de cinco estados del país(9), y en 1997 se informó el primer aislamiento del aborto caprino(10). En 2001, se informó de zoonosis en México, ya que los humanos se infectaron con Chlamydia spp a partir de ganado caprino(11). Sin embargo, el hecho de que la enfermedad se considerara exótica en México hasta mayo de 2016 fue un factor para que se diseminará la enfermedad en nuestro País, debido a que se carecía de métodos de diagnóstico(12). En México, no hay estudios epidemiológicos extensos sobre poblaciones ovinas; sin embargo, se estima que el AEO está muy extendida en esta especie doméstica y, como tal, está causando daños a la cría de ovejas a nivel nacional. Además, es probable que la enfermedad continúe siendo introducida en muchos de los estados de la República Mexicana, debido al intercambio de animales entre productores y al contacto con otras especies infectadas, como bovinos o caprinos(13,14). El objetivo de este estudio fue evaluar la frecuencia serológica y los factores de riesgo de C. abortus, en las principales zonas de producción ovina de México.

Material y métodos Se obtuvieron un total de 5, 321 muestras de sueros de ovejas hembras mayores de seis meses de edad de 323 rebaños, en 61 municipios de siete estados de México: Hidalgo, Tlaxcala, Querétaro, Chihuahua, Sonora, Chiapas y México. Estos estados se eligieron tomando en cuenta la productividad y la oportunidad de poder tomar muestras en los diferentes rebaños. La mayoría de los animales fueron de origen mexicano; las ovejas importadas procedían de Australia, Nueva Zelanda y los Estados Unidos de América. El estudio fue multifactorial, transversal y estratificado; los rebaños se seleccionaron por las facilidades otorgadas por los productores. El número de animales muestreados se calculó 785


Rev Mex Cienc Pecu 2020;11(3):783-794

utilizando el software Win Epinfo Ver 2.0, usando el modo de estimación de porcentajes, para una frecuencia estimada de 5% de ovejas infectadas, un error de 5% y 95% de confianza. Para obtener la información sobre los factores de riesgo y relacionarlos con la presencia de C. abortus, se pidió a los propietarios de los rebaños que respondieran a dos cuestionarios. El primero se centró en los aspectos generales y en la gestión del rebaño, considerando aspectos de genética, nutrición, salud animal, reproducción y de las instalaciones. En el segundo cuestionario se recabó información de las ovejas muestreadas: edad, número de partos, e historial tanto clínico como de producción. El diagnóstico serológico se determinó mediante un ELISA indirecto (Pourquier® ELISA Chlamydiosis, IDDEX Maine, EE. UU.), que utiliza un antígeno de proteína recombinante de 80-90 kDa, específico para C. abortus, que no tiene reacción cruzada con Chlamydia pecorum(15). Los valores de frecuencia de C. abortus para ovejas individuales y para rebaños infectados se evaluaron y compararon con una prueba de Ji cuadrada, considerando la frecuencia y el intervalo de confianza de las ovejas y sus corderos, así como los parámetros de prueba en comparaciones, utilizando el software Win Epinfo Ver 2.0. Los valores se consideraron significativos con un valor de P<0.05, con un intervalo de confianza del 95%(16). Los factores de riesgo asociados a la infección se evaluaron con los cuestionarios, previamente validados. Los datos obtenidos se analizaron para determinar los factores de riesgo presentes en los rebaños, que podrían estar asociados a la presencia y al comportamiento epidemiológico de C. abortus en la población ovina (Cuadro 1).

786


Rev Mex Cienc Pecu 2020;11(3):783-794

Cuadro 1: Frecuencia y factores de riesgo correlacionados con la presencia de ovejas seropositivas a C. abortus Animales Frecuencia Factor Categoría FR IC 95% seropositivos (%) Estado Oveja gestante 132/538 24.53 3.47 * 1.22-9.59 productivo Oveja en lactación 235/1901 12.36 1.39* 0.59-3.17 Oveja dando 22/170 12.94 1.41* 0.54-3.36 lactación a su cría Oveja finalizando 106/1367 7.75 0.69 0.19-1.87 su lactación Ovejas no 65/961 6.76 0.61 0.10-2.13 gestantes y que no estaban en lactación Ovejas púberes, 21/384 5.46 0.49 0.06-3.92 en etapa no reproductiva Edad 6 a 11 meses 46/949 4.84 0.97 0.20-3.30 12 a 24 meses 78/1264 6.17 1.92* 0.50-4.10 25 a 36 meses 101/1017 9.93 2.10* 1.15-4.07 37 a 48 meses 356/2091 17.02 4.12* 2.62-6.34 Procedencia Nacido en el 460/3897 11.80 1.9 0.70-4.90 rebaño Comprado 116/1331 8.71 0.7 0.30-1.60 No hay datos 0/37 0.00 0 0 Tipo de Intensivo 95/525 18.09 2.23* 0.70-6.40 rebaño Semi-intensivo 370/3155 11.72 1.46* 0.50-3.20 Extensivo 116/1536 7.55 0.41 0.20-1.10 Total 581/5321 10.91 FR= factor de riesgo; IC= índice de concordancia. * Diferencia estadística (P<0.05) asociada al factor de riesgo.

Resultados Del total de 5,231 muestras de suero que fueron colectadas, 581 (10.92 %) dieron positivas a la prueba serológica para detectar anticuerpos contra C. abortus. La frecuencia de animales seropositivos al agruparla por Estados fue: en Sonora 12.45 % (102/819); en Chiapas 10.15 % (60/591); en Querétaro 67.18 % (43/64); en Chihuahua 24.32 % (9/37); en Tlaxcala 787


Rev Mex Cienc Pecu 2020;11(3):783-794

33.33 % (12/36); en Hidalgo 11.34 % (97/855); y en el Estado de México 7.09 % (63/758). Del total de 323 rebaños muestreados resultaron con al menos un ovino positivo a la prueba serológica para detectar anticuerpos contra C. abortus el 43.34 % (140/323). Los valores de frecuencia por rebaño fueron: en Sonora 40.42 % (19/47); en Chiapas 31.57 % (12/38); en Querétaro 67.18 % (43/64); en Chihuahua 24.32 % (9/37); en Tlaxcala 33.33 % (12/36); en Hidalgo 67.39 % (31/46); y en el Estado de México 25.45 % (14/55). Con respecto al estado productivo de los animales muestreados, 24.53 % de los animales seropositivos estaban gestantes; 12.36 % eran ovejas seropositivas que estaban en lactación; 12.94 % eran ovejas dando lactación a su cría; 7.75 % eran ovejas que estaban finalizando su lactación; 6.76 % eran ovejas no gestantes y que no estaban en lactación; y el 5.46 % fueron ovejas púberes en etapa no reproductiva. El estado de la producción se evaluó como posible factor de riesgo y el estudio encontró que las ovejas gestantes tenían 3.5 veces más probabilidades de ser seropositivas para C. abortus (Cuadro 1). Respecto a la seropositividad en relación con la edad, el 17.02 % de los animales tenía entre 37 a 48 meses, en contraste en el grupo de ovinos entre los 6 a 11 meses, las frecuencias de los animales seropositivos de estos jóvenes fueron muy bajas, ya que solo 46 de los 949 animales muestreados resultaron positivos. De acuerdo con la razón de probabilidades (RP) obtenida, los animales entre las edades de 37 y 48 meses tenían 4.12 veces más probabilidades de infectarse que en cualquier otra edad (Cuadro 1). Con respecto a la procedencia de los animales, el 11.8 % fueron animales que nacieron en el mismo rebaño y el 8.71 % fueron adquiridos de otros lugares; la procedencia no se estableció como un factor de riesgo después de analizar esta variable (Cuadro 1). Con respecto al manejo de los rebaños, 18.09 % (RP= 2.23; IC95%: 0.70-6.40) de los rebaños estudiados fueron de unidades de producción intensiva, 11.72 % (RM 1.46; IC95% 0.50-3.20 fueron semi-intensivos, y el 7.55 % restante (RP= 0.41; IC95% 0.20-1.10) provino de rebaños de tipo extensivo (Cuadro 1).

Discusión El AEO era considerado una enfermedad exótica en México, hasta mayo de 2016, que paso a ser una enfermedad de notificación obligatoria; este estudio establece una frecuencia del 10.92 % y confirma la presencia y diseminación de la enfermedad en las principales áreas de 788


Rev Mex Cienc Pecu 2020;11(3):783-794

producción ovina del país. El Estado de México es el único estado de la República en el que se han realizado estudios previos de prevalencia de AEO(9,12). Los datos del Estado de México en el presente estudio muestran que el 7.09 % (n= 758) de los animales muestreados fueron positivos, mientras que los estudios previos(9,12) se encontraron prevalencias del 40.64 % y 21.3 %, respectivamente. Es importante mencionar que estos autores trabajaron en rebaños que habían presentado problemas reproductivos, mientras que, en el presente estudio, los animales fueron muestreados sin considerar su estado reproductivo. Además, la alta prevalencia encontrada por Escalante en 1996, podría deberse al hecho de que utilizaron un antígeno soluble para su ELISA, que difiere del implementado en este estudio que tenía una sensibilidad del 95.7 % y una especificidad del 100 % que es específico para C. abortus, evitando la posibilidad de reacción cruzada con C. pecorum o algunas bacterias Gram negativas como Acinetobacter spp. La mayor frecuencia de AEO (13.08 %) se encontró en el estado de Tlaxcala, en rebaños en producción intensiva y semi-intensiva. Estos números de frecuencia coinciden con los descritos por Aitken(4), quienes informaron que, en los sistemas con explotación intensiva, la prevalencia de AEO y la presencia de trastornos reproductivos son mayores que los que se encuentran en los sistemas de producción extensiva. El factor de riesgo más importante que favorece que se disemine la enfermedad en los rebaños es la introducción de animales que no habían sido certificados previamente como negativos para las pruebas de diagnóstico(17), hecho que se determina en el elevado porcentaje de rebaños positivos en los principales estados donde se efectúa la producción de ovejas en México. Esto puede ser debido a que al ser considerada una enfermedad exótica no había posibilidad de realizar el diagnóstico por no existir pruebas comerciales, por lo que no era posible prevenir la propagación de la clamidia. Los países de origen de las ovejas importadas son principalmente Australia y Nueva Zelanda, que se mencionan como libres de C. abortus(4). Sin embargo, los animales importados no se prueban antes de su llegada y mantienen contacto con las ovejas nativas. Esto implica que la introducción de animales de países endémicos como los Estados Unidos de América podría ser uno de los factores de difusión de esta enfermedad, ya que este control no se lleva a cabo. Esto se apoya en el hecho de que algunas ovejas importadas tuvieron abortos en la última etapa de la gestación durante los períodos de cuarentena y poco después de ser llevadas a los rebaños. Los países que se dedican principalmente a la cría de ovejas muestran la mayor cantidad de problemas relacionados con los abortos inducidos por el AEO, el contacto de las ovejas infectadas con material contaminado constituye una de las formas en que la enfermedad puede transmitirse a otras especies animales(1,18). En un estudio realizado en Irán(19) 789


Rev Mex Cienc Pecu 2020;11(3):783-794

determinaron los factores de riesgo en pequeños rumiantes que presentaron abortos, de 300 fetos abortados (183 cabras y 117 borregas), 11 % fueron positivas a C abortus mediante PCR determinando que, un factor de riesgo importante es el manejo de los animales, pues si están en contacto entre ellos se facilita la transmisión de la enfermedad. Se determinó que el tipo de sistema de producción es un factor de riesgo asociado; sin embargo, la mayor frecuencia de seropositividad (18.9 %) se encontró en rebaños en sistemas de producción intensivos, lo que, debido a la naturaleza de sus características de manejo, facilita la propagación del AEO y de otras enfermedades(20). Además, este estudio corrobora que la cría de ovejas en la producción extensiva es un factor protector contra el AEO (OR = 0.41; IC95%: 0.2-1.1), lo que confirma que la propagación de la enfermedad es acelerada por el hacinamiento de los animales, porque el contacto entre ovejas sanas e infectadas se incrementa en rebaños intensivos y semi-intensivos(17,19,21,). Al establecer una relación entre la procedencia de las ovejas y la frecuencia de ovejas seropositivas a C. abortus, se determinó que era un factor de riesgo asociado. Esto nos permite inferir que es más probable que los animales procedentes de unidades de producción de otros estados o incluso de otros países, a su llegada a los centros donde son acopiados antes de distribuirlos a los rebaños, la infección puede propagarse más fácilmente al confinar a los animales en instalaciones difíciles de limpiar y desinfectar(18). Diferentes estudios coinciden con que uno de los principales riesgos para la transmisión del AEO, sea el lugar de procedencia de los animales, esto nos permite inferir que los animales procedentes de explotaciones de otros estados o incluso de otros países que son confinados en centros de acopio antes de que sean distribuidos a su destino final, en estos lugares debido al hacinamiento y a la carencia de medios adecuados para limpiar y desinfectar las instalaciones, la infección puede propagarse más fácilmente(17). Respecto de la procedencia u origen de los animales; los únicos requisitos que los productores consideran antes de ingresar una nueva oveja en su rebaño es el fenotipo y que los animales se observen clínicamente sanos, por lo que se descuida el diagnóstico de la enfermedad(1). El presente estudio indica que la bacteria se ha diseminado en todo el país, pero a diferentes tasas y proporciones en los diferentes estados. Sin embargo, al determinar si existía relación entre la procedencia de las ovejas y la frecuencia de ovejas seropositivas a C. abortus, no se estableció que era un factor de riesgo. Este estudio identificó que los animales gestantes son 3.4 veces más probables de infectarse. Esto podría deberse al hecho de que, durante la gestación, las ovejas están inmunodeprimidas y, por lo tanto, aumentan sus demandas nutricionales, lo que se agrava si su alimentación es inadecuada. Esto es una consecuencia del estrés creado por una fuente deficiente de

790


Rev Mex Cienc Pecu 2020;11(3):783-794

alimentos, lo que genera cortisol endógeno que contribuye a la inmunosupresión ya que es una sustancia con efecto tóxico para los linfocitos(18). La ausencia de estrategias para separar a las hembras infectadas que están cercanas al parto y cuando están recién paridas, contribuye enormemente a la infección porque las ovejas infectadas, eliminan elevadas cantidades de bacterias previamente, durante y después del parto o el aborto(1,22,23). Se observó que a medida que aumenta la edad, las probabilidades de exposición a la enfermedad aumentan proporcionalmente, por lo tanto, se acrecienta el número de ovejas seropositivas. También debe considerarse que las hembras que han estado en el rebaño durante largos períodos de tiempo, han permanecido allí porque son buenas madres, pero, con la edad, resienten las consecuencias causadas por el número de partos que llevan a cuestas y, por lo tanto, su susceptibilidad a la enfermedad aumenta(24,25). Hay otros factores que podrían estar involucrados en la propagación de la enfermedad, especialmente si no se toman medidas adecuadas de bioseguridad. Por ejemplo, los sistemas de explotación intensivos favorecen la contaminación de los corrales, ya que hay una gran acumulación de heces que no se pueden reciclar que, por lo tanto, causan contaminación atmosférica, del suelo y del agua. Esto se asocia con la falta de equipo y las medidas de higiene que se observaron en los rebaños de ovejas examinados en este estudio, y porque el agua, está contaminada con heces y otros materiales orgánicos(18,26). Las frecuencias elevadas, 43.34 % (140/323) encontradas a nivel de rebaño fueron constantes en las principales zonas de producción ovina mexicana, evidencias de que el AEO está ampliamente diseminada en todo el país y con ella, las consecuencias que han sido reportadas por diferentes autores(9-11,15) señalando al AEO como una de las principales causas del aborto, que tiene un alto impacto económico en los países europeos, norteamericanos y africanos(27), y por la falta de las herramientas diagnósticas necesarias para detectar la enfermedad, aún no se han determinado las consecuencias de su introducción a nuestro país que podría sufrir consecuencias similares a las que presentan los países señalados anteriormente. La diseminación del AEO no solo concierne a la producción de ovejas; estudios previos han reportado mediante el diagnóstico realizado por ELISA en hatos bovinos lecheros con antecedentes de aborto de ocho estados de la República Mexicana, una frecuencia de animales positivos a C. abortus de 14 % (145/1,032)(14), en bovinos la presencia de animales positivos a AEO se encuentran relacionados con la presencia de abortos y otros problemas reproductivos(28). Otro estudio encontró una seropositividad de C. abortus del 9.60 % en seis rebaños caprinos en el estado de Guanajuato y se obtuvo el aislamiento de la bacteria en el 26.98 % de las 791


Rev Mex Cienc Pecu 2020;11(3):783-794

cabras muestreadas(13). En un trabajo realizado en cabras que habían presentado abortos en los estados de Querétaro, Veracruz, Puebla, Jalisco y de la región de la Comarca Lagunera, se aisló C. abortus en 23.1 % de las muestras(29).

Conclusiones e implicaciones Se concluye que la frecuencia de serología positiva encontrada en los rebaños en las principales zonas productoras de ovejas de México, así como la detección de los factores de riesgo asociados con la presencia y con la propagación de la enfermedad, evidencian la diseminación del aborto enzoótico de las ovejas en México.

Literatura citada: 1. Longbottom D, Coulter LJ. Animal chlamydioses and zoonotic implications. J Comp Pathol 2003;128(4):217–244. 2. Rohde G, Straube E, Essig A, Reinhold P, Sachse K. Chlamydiale Zoonosen, Dtsch Arztebl Int 2010;107(10):174–1780. 3. Rodolakis A, Salinas J, Papp J. Recent advances on ovine chlamydial abortion, Vet Res 1998;29(3-4):275–288. 4. Aitken DI. Chlamydial abortion, Diseases of sheep. 3rd ed. Madrid, España: Blackwell Science; 2000. 5. Rekiki A, Sidi-Boumedine K, Souriau A, Jemli J, Hammami S, Rodolakis A. Isolation and characterization of local strains of Chlamydophila abortus (Chlamydia psittaci serotype 1) from Tunisia. Vet Res 2002;33(2):215–222. 6. Gerber A, Thoma R, Vretou E, Psarrou E, Kaiser C, Doherr MG, et al. Ovine enzootic abortion (OEA): A comparison of antibody responses in vaccinated and naturallyinfected Swiss sheep over a two-year period. BMC Vet Res 2007;28(3):24. 7. Zhong G. Killing me softly: chlamydial use of proteolysis for evading host defenses. Trends Microbiol 2009;17(10):467-474. 8. Polkinghorne A, Borel N, Becker A, Lu ZH, Zimmermann DR, Brugnera E, Pospischil A, Vaughan L. Molecular evidence for chlamydial infections in the eyes of sheep. Vet Microbiol 2009;135(1-2):142–146. 792


Rev Mex Cienc Pecu 2020;11(3):783-794

9. Escalante OC, Rivera FA, Trigo TF, Romero MJ. Detection of Chlamydia psittaci in enteric subclinical infections in adult sheep, through cell culture isolation. Rev Latinoam Microbiol 1996;38(1):17-23. 10. Escalante OC, Díaz AE, Segundo ZC, Suárez GF. Isolation of Chlamydia psittaci involved in abortion of goats in Mexico: first report. Rev Latinoam Microbiol 1997; 39(3-4):117-121. 11. Escalante OC, Lazcano C, Soberón A. Chlamydophila spp como agente zoonótico en México [resumen]. Reunión Nacional de Investigación Pecuaria. Tuxtla Gutiérrez, Chiapas. 2001. 12. Jiménez EJM, Escobedo GMR, Arteaga TG, López HM, De Haro CM, Montes De Oca JR, Guerra IFM. Detection of Chlamydophila abortus in sheep (Ovis aries) in Mexico. Am J Anim Vet Sci 2008;3(4):91-95. 13. Mora DJC, Díaz AE, Herrera LE, Suárez GF, Escalante OC, Jaimes VS, ArellanoReynoso B. Isolation of Chlamydia abortus in dairy goat herds and its relation to abortion in Guanajuato, Mexico. Vet Mex OA 2015;2(1). 14. Limón GM. Prevalencia de Leucosis y Clamidiosis en bovinos lecheros de Aguascalientes y Guanajuato [tesis licenciatura]. Cuautitlán, México: FES Cuautitlán, Universidad Nacional Autónoma de México; 2012. 15. Marques PX, Souda P, O'Donovan J, Gutierrez J, Gutierrez EJ, Worrall S, et al. Identification of immunologically relevant proteins of Chlamydophila abortus using sera from experimentally infected pregnant ewes. Clin Vaccine Immunol 2010;17(8):1274-1281. 16. Thrusfield M, Ortega C, de Blas I, Noordhuizen JP, Frankena K. Win Episcope 2.0: Improved epidemiological software for veterinary medicine. Vet Rec 2001;148:67-572. 17. Barkallah M, Jribi H, Ben Slima A, Gharbi Y, Mallek Z, Gautier M, et al. Molecular prevalence of Chlamydia and Chlamydia-like bacteria in Tunisian domestic ruminant farms and their influencing risk factors. Transbound Emerg Dis 2018;65(2):329-338. 18. Lenzko H, Moog U, Henning K, Lederbach R, Diller R, Menge C, Sachse K, Sprague LD. High frequency of chlamydial co-infections in clinically healthy sheep flocks. BMC Vet Res 2011;16(7):29. 19. Heidari S, Derakhshandeh A, Firouzi R, Ansari-Lari M, Masoudian M, Eraghi V. Molecular detection of Chlamydophila abortus, Coxiella burnetii, and Mycoplasma

793


Rev Mex Cienc Pecu 2020;11(3):783-794

agalactiae in small ruminants' aborted fetuses in southern Iran. Trop Anim Health Prod 2018;50(4):779-785. 20. Thrusfield M. Vet Epi 2005. Oxford, England. Blackwell Science. 21. Rodolakis A, Mohamad KY. Zoonotic potential of Chlamydophila. Vet Microbiol 2010;140(3-4):382-391. 22. Maley SW, Livingstone M, Rodger SM, Longbottom D, Buxton D. Identification of Chlamydophila abortus and the development of lesions in placental tissues of experimentally infected sheep. Vet Microbiol 2009;16(135):122-127. 23. Longbottom DG, Entrican N, Wheelhouse N, Brough H, Milne C. Evaluation of the impact and control of enzootic abortion of ewes. Vet J 2013;195(2):257-259. 24. Zhou DH, Zhao FR, Xia HY, Xu MJ, Huang SY, Song HQ, Zhu XQ. Seroprevalence of chlamydial infection in dairy cattle in Guangzhou, southern China. Ir Vet J 2013;66(1):2. 25. Qin SY, Yin MY, Cong W, Zhou DH, Zhang XX, Zhao Q, Zhu XQ, Zhou JZ, Qian AD. Seroprevalence and risk factors of Chlamydia abortus infection in Tibetan sheep in Gansu province, northwest China. Sci World J 2014:193464. 26. Bagdonas J, Petkevicius S, Russo P, Pepin M, Salomskas A. Prevalence and epidemiological features of ovine enzootic abortion in Lithuania. Pol J Vet Sci 2007; 10(4):239-244. 27. Vega S, Roche M, García A, Gómez T. Estudio de la etiología de los abortos en los pequeños rumiantes en la Comunidad Valenciana. XXIX Jornadas Científicas de la SEOC. 2003:262–264. 28. Sachse K, Vretou E, Livingstone M, Borel N, Pospischil A, Longbottom D. Recent developments in the laboratory diagnosis of chlamydial infections. Vet Microbiol 2009;135(1-2):2–21. 29. Sánchez RL. Presencia de Chlamydia abortus en cabras de México [tesis Maestría]. Cuautitlán, México: FES Cuautitlán, Universidad Nacional Autónoma de México. 2014.

794


https://doi.org/10.22319/rmcp.v11i3.5516 Artículo

Linfonodos y carne molida de res como reservorios de Salmonella spp. de importancia en salud pública

Tania Palós Gutiérrez a María Salud Rubio Lozano a* Enrique Jesús Delgado Suárez b Naisy Rosi Guzmán a Orbelin Soberanis Ramos b Cindy Fabiola Hernández Pérez c Rubén Danilo Méndez Medina d

a

Universidad Nacional Autónoma de México (UNAM). Facultad de Medicina Veterinaria y Zootecnia (FMVZ), Centro de Enseñanza Práctica, Investigación en Producción y Salud Animal, Avenida Universidad 3000, Ciudad Universitaria, Ciudad de México, México. b

UNAM, FMVZ. Departamento de Medicina Preventiva y Salud Pública. Ciudad de México. México. c

Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria. Departamento de Secuenciación y Bioinformática del Centro Nacional de Referencia de Plaguicidas y Contaminantes. Ciudad de México, México. d

UNAM, FMVZ. Departamento de Patología. Ciudad de México. México.

* Autor de correspondencia:msalud65@gmail.com

Resumen: El objetivo fue estimar la frecuencia de contaminación, diversidad de serotipos y tipificación por multilocus (MLST) de Salmonella enterica (SE) en linfonodos y carne 795


Rev Mex Cienc Pecu 2020;11(3):795-810

molida de bovino. Para ello, se analizaron 1,545 muestras provenientes de 400 canales bovinas. El muestreo incluyó linfonodos superficiales (LNS) y profundos, carne molida magra y con grasa, obtenidas en estación cálida (abril-julio) y fría (septiembre-diciembre) durante 2017 y 2018. Los aislamientos puros se sometieron a secuenciación completa del genoma. Con estos datos, se realizó la predicción in silico de serotipos y del perfil de MLST. En total, se obtuvieron 78 aislamientos de SE (5 % del total de muestras analizadas). La frecuencia de contaminación se asoció con el tipo de muestra (χ2=23.7, P<0.0001) y con la época del año (χ2=20.3, P<0.0001), siendo mayor en LNS (9.7 %) y en estación cálida (7.0 %). Los serotipos predominantes fueron Anatum y Reading (n=23 cada uno), Typhimurium (n= 11) y London (n= 9). El perfil de MLST de cepas de los serotipos Typhimurium (ST 19 y 34) y Kentucky (ST 198) se ha reportado previamente en aislamientos involucrados en casos clínicos. Se concluye que los linfonodos y la carne molida de res son reservorios de SE de importancia en salud pública, especialmente durante los meses cálidos del año. Por tanto, es necesario establecer medidas encaminadas a prevenir la diseminación, a lo largo de la cadena productiva, de las cepas asociadas con animales aparentemente sanos. Palabras clave: Salmonella, Bovinos, Linfonodos, Carne molida, Serotipos, MLST.

Recibido: 21/09/2019 Aceptado:25/11/2019

Introducción La salmonelosis transmitida por alimentos es una preocupación de salud pública a escala global(1). La carne de diferentes especies, entre ellas la de bovino, funciona como reservorio de su principal agente causal: Salmonella enterica subsp. enterica, de aquí en adelante referida como Salmonella(2). Particularmente, la carne de res molida se ha vinculado con brotes recientes de salmonelosis en América del Norte(3), por lo cual se considera uno de los principales vehículos de exposición humana a Salmonella. En México se han reportado porcentajes de muestras positivas de entre 16 y 68 % en carne molida en puntos de venta(4,5), por lo cual la investigación en esta área resulta relevante desde el punto de vista de salud pública.

796


Rev Mex Cienc Pecu 2020;11(3):795-810

Evidencia experimental reciente documenta el aislamiento de Salmonella a partir de nĂłdulos linfĂĄticos de bovinos aparentemente sanos, en frecuencias variables de entre <10 y hasta >90 %(6,7). Asimismo, se ha demostrado que los linfonodos superficiales presentan mayores tasas de contaminaciĂłn que los profundos; mientras que el nĂşmero de animales con linfonodos contaminados es mucho mayor en ganado de engorda comercial que en los de desecho(7,8). No obstante, los resultados suelen variar ostensiblemente segĂşn la zona geogrĂĄfica y la ĂŠpoca del aĂąo, un fenĂłmeno determinado por mecanismos aun sin descifrar. En trabajos con cepas de Salmonella obtenidas de animales de desecho, la tipificaciĂłn de aislamientos, por electroforesis en gel de campos pulsados, demostrĂł clonalidad entre cepas de linfonodos y las presentes en carne molida producida a partir de estos animales(9). Sin embargo, este tipo de estudios no se ha realizado en animales de engorda comercial. A pesar de las altas tasas de positividad a Salmonella reportadas en muestras bovinas en MĂŠxico(4-6), la contribuciĂłn de los linfonodos a este fenĂłmeno prĂĄcticamente no ha sido abordada. Por tanto, el objetivo del presente estudio es estimar la frecuencia de contaminaciĂłn y la diversidad de serotipos de Salmonella presentes en nĂłdulos linfĂĄticos, asĂ­ como en carne y grasa asociada con estos Ăşltimos, en diferentes ĂŠpocas del aĂąo.

Material y mĂŠtodos DiseĂąo del estudio y determinaciĂłn del tamaĂąo de muestra

El tamaĂąo de muestra se calculĂł mediante la fĂłrmula estadĂ­stica para estimar una proporciĂłn de una poblaciĂłn, cuando no se conoce el nĂşmero de elementos en esa poblaciĂłn(10): n=

đ?&#x2018;?đ?&#x203A;ź2 â&#x2C6;&#x2014;đ?&#x2018;?â&#x2C6;&#x2014;đ?&#x2018;&#x17E; đ?&#x2018;&#x2018;2

;

Donde: n= tamaĂąo de muestra; ZÎą2= Valor de Z en una distribuciĂłn normal ZÎą= 1.96 cuando Îą= 0.05; p= proporciĂłn de la poblaciĂłn con la caracterĂ­stica estudiada (si se desconoce se emplea 0.5, como en este caso); q= proporciĂłn de la poblaciĂłn sin la caracterĂ­stica estudiada(1-p); d= error o precisiĂłn deseada, fijado en 10% (0.1). Bajo estos supuestos, se obtuvo un tamaĂąo de muestra de 96, el cual se redondeĂł a 100. El muestreo se replicĂł dos veces por aĂąo, durante dos aĂąos consecutivos, con dos etapas en cada aĂąo. Las muestras tomadas entre abril y julio se designaron como muestras de estaciĂłn â&#x20AC;&#x153;cĂĄlidaâ&#x20AC;? y las recolectadas entre septiembre y diciembre como muestras de estaciĂłn â&#x20AC;&#x153;frĂ­aâ&#x20AC;?.

797


Rev Mex Cienc Pecu 2020;11(3):795-810

Las canales provenían de bovinos machos enteros, cruzas de Bos indicus, con una edad promedio de 24 a 36 meses, procesadas en un rastro Tipo Inspección Federal del estado de Veracruz y trasportadas en refrigeración (<4 ºC), durante aproximadamente 8 h, hasta un punto de venta de la Ciudad de México. Una vez allí, las canales se mantuvieron en refrigeración durante dos días hasta la recolección de las muestras (72 a 96 h post mortem). El punto de venta se visitó los lunes y martes de cada semana, hasta completar entre 5 y 10 canales por semana, según la cantidad de canales disponibles.

Toma de muestras

De cada canal se extrajeron linfonodos superficiales (LNS, cervical superficial y subilíaco) y profundos (LNP, axilar propio y celíaco). La selección de linfonodos se hizo tomando en cuenta la probabilidad de que fueran incluidos en el proceso de molienda, por su ubicación anatómica. Además de los linfonodos, se tomaron aproximadamente 200 g de carne magra (CM, 50 % del diezmillo y 50 % del sirloin, por ser los cortes más usados para producir carne molida) y de carne con grasa (CG), de las zonas circundantes de los LNS y LNP (aproximadamente 50 % de cada una). Previo a los análisis, las porciones individuales de cada tipo de muestra se combinaron para formar una sola muestra compuesta. En algunas ocasiones, ciertas partes de la canal estaban comprometidas para la venta y no estuvieron disponibles para el muestreo. Por ello, no fue posible obtener todos los tipos de muestra del 100 % de las canales. Por consiguiente, la unidad de muestreo se definió como la muestra compuesta de LNS, LNP, CM y CG. En total, se recolectaron 1,545 muestras de todas las fuentes en los dos años de duración del estudio (Cuadro 1). Cuadro 1: Distribución de las 1,545 muestras de carne y de linfonodos analizadas por estación y año entre el 3 de abril de 2017 y el 14 de diciembre de 2018 Estación cálida

Estación fría

Tipo de muestra

2017

2018

Total

2017

2018

Total

LNS

168

98

266

33

102

135

LNP CM CG Total

166 130 149

98 98 98

264 228 247 1,005

33 33 33

102 102 102

135 135 135 540

Estación cálida: abril-julio, estación fría: septiembre-diciembre. LNS= linfonodos superficiales, LNP= linfonodos profundos, CM= carne magra, CG= carne con grasa.

798


Rev Mex Cienc Pecu 2020;11(3):795-810

Las porciones individuales de cada tipo de muestra se colocaron en bolsas plásticas estériles, previamente identificadas y se mantuvieron en hieleras con geles refrigerantes (aproximadamente a 4º C), durante su traslado al laboratorio (duración de dos horas como máximo).

Análisis microbiológicos

La preparación de las muestras de linfonodos se realizó según métodos descritos previamente(11), con algunas modificaciones. Los linfonodos se pesaron y, posteriormente, se sumergieron en agua hirviendo durante 5 seg, con el fin de esterilizar su superficie. A continuación, se les agregó la mitad del agua peptonada tamponada (APT) necesaria para alcanzar una dilución aproximada de 1:10 (8 g de LNP en 80 ml de APT y 25 g de LNS en 225 ml de APT) y se molieron durante 3 seg en una licuadora Oster previamente esterilizada. Las muestras molidas se vaciaron en una bolsa Stomacher®, previamente identificada, y con el resto del APT se arrastró el remanente contenido en el vaso de la licuadora, asegurando la transferencia de toda la muestra a la bolsa Stomacher®, realizando posteriormente la homogenización de la mezcla durante 1 min. Para el análisis de las muestras de carne magra (CM), se tomaron 25 g y se molieron en una licuadora Oster estéril durante 30 seg. Posteriormente, el contenido se colocó en una bolsa de Stomacher® previamente identificada y se agregaron 225 ml de APT, homogenizando la mezcla durante 1 min. Por último, las muestras de carne con grasa (CG) se prepararon moliendo de manera conjunta en una licuadora Oster estéril, durante 30 seg, aproximadamente 1/3 de grasa y 2/3 de carne de las zonas circundantes de LNS y LNP (50 % proveniente de cada tipo de linfonodo). Después de la molienda se pesaron asépticamente 25 g y se siguió el mismo procedimiento descrito para la carne magra. Los homogenatos se dejaron reposar durante 2 h a temperatura ambiente, antes de seguir los procedimientos de pre-enriquecimiento, enriquecimiento selectivo, aislamiento y confirmación bioquímica de Salmonella spp., establecidos en la norma oficial mexicana vigente(12). También se realizó la confirmación molecular de los aislamientos presuntamente positivos a Salmonella spp., mediante PCR, utilizando el gen invA (284 pb), según métodos descritos previamente(13). El ADN se extrajo con el kit “Ez-10 Spin Column Bacterial Genomic DNA Miniprep Kit” (BioBasic, Inc., Canadá), siguiendo las instrucciones del proveedor, a partir de las cepas puras, previamente refrescadas en caldo tripticasa soya (MCD Lab®, PRONADISA-CONDA®, España) por 18-24 h. Se utilizaron los cebadores sentido (CGCCATGGTATGGATTTGTC) y contrasentido (GTGGTAAAGCTCATCAAGCG), en reacciones de PCR con un volumen total de 10 μl, empleando los reactivos del MyTaqTM Mix (Bioline, U. K.) con las siguientes

799


Rev Mex Cienc Pecu 2020;11(3):795-810

concentraciones finales: 5 μl de MyTaqTM Mix, 0.2 μl de cada dNTP y 2.1 μl de agua libre de nucleasas. Las condiciones de termociclado fueron: 94 ºC/3 min de desnaturalización inicial; posteriormente, 35 ciclos de desnaturalización, alineación y extensión (95ºC/45 seg, 62ºC/30 seg, 72ºC/45 seg, respectivamente) y 72ºC/2 min de extensión final. Los productos de amplificación por PCR se procesaron por electroforesis en gel de agarosa (SeaKem® LE Agarose, Lonza, EEUU) al 2%. Los geles se corrieron en buffer tris/borato/EDTA (TBE 1x), a 80 V por 50 min, utilizando SYBR Safe DNA Gel Stain (Invitrogen, USA) para revelar los fragmentos de ADN. La visualización y digitalización de imágenes se realizó en un fotodocumentador Gel Logic 2200 (Kodak, USA) con el software Care Stream® (Carestream Health, Inc., USA). En cada corrida se incluyó una cepa de S. enterica subsp. enterica ser. Typhimurium, del propio laboratorio, previamente confirmada por métodos bioquímicos, PCR y secuenciación completa del genoma. Los aislamientos confirmados se conservaron de dos modos. En el primero, se elaboraron inóculos de 1 ml tomando colonias frescas y mezclándolas en caldo infusión-cerebro-corazón (Merck, Germany) con 10% de glicerol y se mantuvieron a – 70 °C en un ultracongelador. Por otra parte, se realizó un respaldo de los aislamientos en agar soya tripticaseina (TSA, PRONADISA-CONDA®, España), almacenado a temperatura ambiente.

Predicción de serotipos y tipificación por multi-locus (MLST)

El serotipo de las cepas obtenidas se predijo a partir de los datos de secuenciación completa del genoma (lecturas crudas). El ADN genómico se extrajo a partir de colonias refrescadas en caldo TSA con agitación a 37 ºC durante aproximadamente 18 h. Transcurrido este tiempo, se tomó 1 ml de caldo TSA y se centrifugó a 5,000 xg durante 10 min para obtener un pellet de células. Posteriormente, se utilizó el kit de extracción “High Pure PCR Template Preparation Kit” (Roche Molecular Systems, Inc., Switzerland), según instrucciones del fabricante, para obtener el ADN genómico. La secuenciación se realizó en un equipo Illumina NextSeq (Illumina, USA), utilizando el kit Nextera XT versión 3 (Illumina, USA) para preparar la biblioteca de ADN, con un inserto de 150 pb y una profundidad estimada mínima de 30X. Las lecturas crudas así obtenidas se utilizaron para predecir el serotipo, mediante análisis in silico, con ayuda del programa SeqSero(14). Por último, se realizó la tipificación por multilocus (MLST), basada en siete genes esenciales (aroC, dnaN, hemD, hisD, purE, sucA)(15), en el servidor del Centro de Epidemiología Genómica(16). Como la tipificación por MLST se ha empleado por décadas y existe una base de datos de acceso público(17), es posible estimar la importancia epidemiológica de los aislamientos, mediante la comparación con las ST reportadas previamente en muestras clínicas de humanos y de animales. Además, el perfil de alelos se

800


Rev Mex Cienc Pecu 2020;11(3):795-810

utilizó para generar un árbol filogenético de mínima expansión, con ayuda del programa GrapeTree(18), para analizar la diversidad de ST en la muestra bajo estudio.

Análisis estadístico

Se utilizó la prueba de Ji-cuadrada para determinar si existía asociación entre el tipo de muestra, la época del año y el serotipo de Salmonella con la frecuencia de contaminación. En caso de observar asociación significativa, se utilizó la razón de probabilidades para estimar los factores con mayor influencia en la tasa de contaminación de las diferentes matrices estudiadas. Los datos se analizaron con el programa Statgraphics Centurion XV (StatPoint, Technologies, USA).

Resultados En general, se observó una frecuencia de contaminación con Salmonella spp. del 5.0 %, con 78 aislamientos obtenidos a partir de las 1,545 muestras analizadas en los dos años (Figura 1). Se evidenció una fuerte asociación entre el tipo de muestra y la positividad al patógeno (χ2=23.7, P<0.0001), con una mayor probabilidad de encontrar muestras positivas en LNS que en las demás fuentes (razón de probabilidades 3.2, intervalo de confianza al 95% 2.05.0, P<0.0001).

801


Rev Mex Cienc Pecu 2020;11(3):795-810

Figura 1: Frecuencia de contaminación con Salmonella spp. en muestras de carne magra (n=363), carne con grasa (n=382), linfonodos profundos (n=399) y linfonodos superficiales (n=401) de bovino, recolectadas entre abril de 2017 y diciembre de 2018

También se observó una asociación significativa entre la frecuencia de contaminación y la época del año (χ2=20.3, P<0.0001). La probabilidad de encontrar muestras positivas en la estación cálida fue mucho más alta que en la fría (razón de probabilidades 4.7, intervalo de confianza al 95% 2.2-9.8, P<0.0001) (Figura 2). Figura 2: Frecuencia de contaminación con Salmonella spp. en muestras de carne magra (n=363), carne con grasa (n=382), linfonodos profundos (n=399) y linfonodos superficiales (n=401) de bovino, recolectadas entre abril de 2017 y diciembre de 2018

802


Rev Mex Cienc Pecu 2020;11(3):795-810

El serotipo de Salmonella también estuvo asociado con el tipo de muestra ( χ 2=43.8, P=0.0025). Salmonella typhimurium sólo se detectó en muestras de carne de la estación cálida. Por el contrario, los serotipos Muenster (n=2) y Kentucky (n=5) sólo se presentaron en linfonodos, también de la estación cálida (Figura 3). Asimismo, la única cepa del serotipo Give se aisló a partir de LNS en la estación fría. Aunque la diversidad de serotipos fue mayor en ambos tipos de linfonodos que en carne magra o con grasa, en general, las cepas de los serotipos Reading y Anatum (n=23 de cada una), Typhimurium (n=11) y London (n=9), fueron las predominantes. Figura 3: Número de aislamientos de S. enterica subsp. enterica por serotipo y fuente de aislamiento en las estaciones cálida (a) y fría (b) a)

Anatum

Fresno

Give

Kentucky

London

Muenster

Reading

Typhimurium

Frecuencia absoluta

14 12 10 8 6 4 2 0 Carne magra

Carne con grasa

Carne magra

Carne con grasa

Linfonodos profundos

Linfonodos superficiales

b) 14

Frecuencia absoluta

12 10 8 6 4

2 0 Linfonodos profundos 803

Linfonodos superficiales


Rev Mex Cienc Pecu 2020;11(3):795-810

La tipificación por MLST mostró que los aislamientos de cada serotipo correspondieron a una misma ST (Figura 4). La excepción fue Salmonella typhimurium, la cual presentó dos ST (19 y 34). Sin embargo, ambos ST sólo se diferenciaron en el alelo dnaN. Por tanto, satisfacen el criterio para ser considerados como complejo clonal, al coincidir en seis de los siete alelos incluidos en el esquema de tipificación por MLST(15). Figura 4: Árbol de mínima expansión generado a partir del perfil de MLST de 78 aislamientos de S. enterica subsp. enterica.

Cada círculo corresponde a un ST y las divisiones dentro de un mismo círculo corresponden a un aislamiento. Los números en las ramas del árbol indican la cantidad de alelos con secuencias distintas entre ST. Los serotipos se indican mediante código de colores y la fuente de aislamiento se señala al interior o adyacente a cada círculo (en texto rojo, si provienen de estación cálida; o en azul, si son de estación fría).

804


Rev Mex Cienc Pecu 2020;11(3):795-810

Discusión Las frecuencias de positividad al patógeno aquí observadas (2.5 a 9.7 %), son inferiores a las reportadas en otros trabajos con carne molida (16-68 %)(4,5) y con linfonodos (5094 %)(6,19,20). No obstante, la variabilidad de este fenómeno entre zonas geográficas y épocas del año está bien documentada(20,21). En general, el estudio confirma la importancia de los bovinos aparentemente sanos como reservorio de diversos serotipos de Salmonella de importancia epidemiológica. Así lo demuestra la detección de cepas del serotipo Typhimurium, ST 19 y 34, las cuales se asocian con casos clínicos humanos y con la cepa DT104, ampliamente distribuida a escala global(22). De igual forma, los aislamientos del serotipo Kentucky (ST 198) se han asociado con infecciones en humanos y animales en Estados Unidos(23). Estos hallazgos resaltan la necesidad de continuar investigando las poblaciones de Salmonella de origen no clínico, asociadas con producción animal, por su papel como reservorio de infecciones humanas. Los resultados apoyan también observaciones previas sobre las mayores tasas de positividad al patógeno en linfonodos superficiales, especialmente en condiciones de clima cálido(7,8). Aunque no se han descifrado los factores ambientales causantes de esta variabilidad, la mayor incidencia de picaduras de moscas y de otros insectos en el verano se ha sugerido como un factor condicionante de esta variación estacional(19,24). No obstante, la escasa evidencia experimental relacionada con este factor no proviene de contextos naturales sino de estudios de desafío con moscas artificialmente infectadas con Salmonella. Los esfuerzos realizados hasta el momento para prevenir las infecciones asintomáticas con Salmonella en el ganado han sido infructuosos. El uso de vacunas basadas en genes involucrados en la captación de hierro, mineral con un papel central en el proceso infeccioso, no tuvo efecto alguno sobre la frecuencia de contaminación en linfonodos de bovinos de engorda(25). Tal hallazgo es poco sorprendente, considerando la redundancia funcional de Salmonella, la cual posee multiplicidad de genes en materia de captación y transporte de hierro (ej. iroBCDE, fepBCDEG, fhuBCD, exbBD, sitD y tonB)(26). Por otra parte, la supervivencia intracelular de la bacteria, internalizada en vacuolas de células eucariotas(27), como los macrófagos, sugiere que la suplementación con antibióticos es una estrategia poco factible. En este sentido, la administración de concentraciones crecientes de tilosina en la dieta de ganado Holstein, previamente inoculado con el patógeno, no mostró efecto alguno, pues se continuó recuperando Salmonella a partir de los linfonodos de los animales tratados(28).

805


Rev Mex Cienc Pecu 2020;11(3):795-810

Aparentemente, la redundancia funcional de Salmonella y sus mecanismos de supervivencia intracelular indican que la eventual eliminación del patógeno dependerá en última instancia del sistema inmune del hospedero. En animales inoculados experimentalmente con cepas del serotipo Montevideo, la eliminación total de la bacteria tomó cerca de un mes(29). En este contexto, el monitoreo de infecciones subclínicas por Salmonella en granjas de engorda, una medida escasamente aplicada, podría funcionar como método para segregar animales portadores y, de esta forma, limitar la diseminación del patógeno. Adicionalmente, la presencia de cepas de un mismo serotipo y ST en carne molida y en linfonodos, observada en este estudio, sugiere a la remoción de los linfonodos como una estrategia para reducir drásticamente la frecuencia de contaminación con Salmonella en carne de res molida. Esta medida es relativamente fácil de realizar a escala industrial, aunque sólo para los linfonodos superficiales, no para los profundos. No obstante, son precisamente los linfonodos superficiales los de mayor relevancia epidemiológica. Por tanto, el establecimiento de esta medida como obligatoria en la normatividad nacional podría funcionar como estrategia para mitigar los riesgos asociados con la presencia de Salmonella en carne de res molida. Por otra parte, resulta interesante analizar por qué algunos serotipos sólo se presentaron en muestras de carne (ej. Typhimurium), mientras que otros se detectaron en todas las matrices (ej. Anatum y Reading). Particularmente, el serotipo Anatum se ha reportado previamente como cepa predominante en muestras de origen no clínico, sobre todo en linfonodos(19,20). Estas evidencias llevan a razonar sobre la posibilidad de que algunas cepas de Salmonella estén mejor adaptadas para colonizar y sobrevivir en ciertos nichos ecológicos. En el contexto del presente trabajo, sin embargo, es difícil determinar si la representación relativa de serotipos en los linfonodos depende de factores genéticos específicos. Además, se requiere emplear análisis de mayor poder discriminatorio que MLST, para explorar con mayor precisión las relaciones filogéneticas intra e inter-serotipo, así como la dinámica evolutiva de estas poblaciones. Este tema será materia de futuras contribuciones en el área de genómica comparativa.

Conclusiones e implicaciones El estudio demuestra que los linfonodos y la carne de res molida, provenientes de animales aprobados para la matanza, funcionan como reservorios de cepas de Salmonella enterica de importancia clínica en humanos. Por tanto, es preciso establecer medidas de control para prevenir la diseminación de este patógeno a lo largo de la cadena productiva.

806


Rev Mex Cienc Pecu 2020;11(3):795-810

Agradecimientos y conflictos de interés

Esta investigación fue financiada por la Universidad Nacional Autónoma de México, a través del proyecto PAPIIT IN212817. Se agradece la colaboración del Centro Nacional de Referencia de Plaguicidas y Contaminantes por su apoyo en la secuenciación de los aislamientos y en los análisis bioinformáticos preliminares. También agradecemos la colaboración de los alumnos Tavata Meneses, Rosaurora Medina y Abril Viridiana García, así como del profesor Francisco Ruíz, de la Facultad de Medicina Veterinaria y Zootecnia de la UNAM, por su apoyo en las actividades de muestreo y análisis de laboratorio. Ninguno de los autores tiene conflicto de intereses con respecto a la presente publicación.

Literatura citada: 1. WHO. WHO estimates of the global burden of foodborne diseases. Foodborne disease burden epidemiology reference group 2007-2015. World Health Organization. http://www.who.int/foodsafety/areas_work/foodborne-diseases/ferg/en/. Accessed Oct 25, 2018. 2. Wilhelm BJ, Young I, Cahill S, Desmarchelier P, Nakagawa R, Rajic A. Interventions to reduce non-typhoidal Salmonella in pigs during transport to slaughter and lairage: Systematic review, meta-analysis, and research synthesis based infection models in support of assessment of effectiveness. Prev Vet Med 2017;145:133-144. 3. CDC. Outbreak of Salmonella Infections Linked to Ground Beef. Centers for Disease Control and Prevention (CDC) https://www.cdc.gov/salmonella/newport-1018/index.html. Accessed Feb 25, 2019. 4. Cabrera-Diaz E, Barbosa-Cardenas CM, Perez-Montano JA, Gonzalez-Aguilar D, Pacheco-Gallardo C, Barba J. Occurrence, serotype diversity, and antimicrobial resistance of Salmonella in ground beef at retail stores in Jalisco state, Mexico. J Food Prot 2013;76(12):2004-2010. 5. Ballesteros-Nova N, Rubio-Lozano MS, Delgado-Suárez EJ, Méndez-Medina RD, Braña-Varela D, Rodas Suárez O. Perfil de resistencia a antibióticos de serotipos Salmonella spp. aislados de carne de res molida en la Ciudad de México. Salud Pública México 2016;58(3):1-7.

807


Rev Mex Cienc Pecu 2020;11(3):795-810

6. Gragg SE, Loneragan GH, Nightingale KK, Brichta-Harhay DM, Ruiz H, Elder JR, et al. Substantial within-animal diversity of Salmonella isolates from lymph nodes, feces, and hides of cattle at slaughter. Appl Environ Microbiol 2013;79(15):4744-4750. 7. Webb HE, Brichta-Harhay DM, Brashears MM, Nightingale KK, Arthur TM, Bosilevac JM, et al. Salmonella in peripheral lymph nodes of healthy cattle at slaughter. Front Microbiol 2017;8:2214. 8. Gragg SE, Loneragan GH, Brashears MM, Arthur TM, Bosilevac JM, Kalchayanand N, et al. Cross-sectional study examining Salmonella enterica carriage in subiliac lymph nodes of cull and feedlot cattle at harvest. Foodborne Pathog Dis 2013;10(4):368-374. 9. Koohmaraie M, Scanga JA, De La Zerda MJ, Koohmaraie B, Tapay L, Beskhlebnaya V, et al. Tracking the sources of Salmonella in ground beef produced from nonfed cattle. J Food Prot 2012;75(8):1464-1468. 10. Jekel JF, Katz DL, Elmore JG. Epidemiology, biostatistics, and preventive medicine. Third ed. Philadelphia, PA, United States of America: Saunders Elsevier; 2007. 11. Brichta-Harhay DM, Arthur TM, Bosilevac JM, Kalchayanand N, Schmidt JW, Wang R, et al. Microbiological analysis of bovine lymph nodes for the detection of Salmonella enterica. J Food Prot 2012;75(5):854-858. 12. SSA. NORMA Oficial Mexicana NOM-210-SSA1-2014, Productos y servicios. Métodos de prueba microbiológicos. Determinación de microorganismos indicadores. Determinación de microorganismos patógenos. http://www.dof.gob.mx/nota_detalle.php?codigo=5398468&fecha=26/06/2015. Consultado 25 Feb, 2019. 13. Rahn K, De Grandis SA, Clarke RC, Curtiss R, Gyles CL. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes 1992;6:271-279. 14. Zhang S, Yin Y, Jones MB, Zhang Z, Deatherage Kaiser BL, Dinsmore BA, Fitzgerald C, Fields PI, Deng X. Salmonella serotype determination utilizing high-throughput genome sequencing data. J Clin Microbiol 2015;53(5):1685-1692. 15. Achtman M, Wain J, Weill FX, Nair S, Zhou Z, Sangal V, et al, Group SEMS. Multilocus sequence typing as a replacement for serotyping in Salmonella enterica. PLoS Pathog 2012;8(6):e1002776. 16. Larsen MV, Cosentino S, Rasmussen S, Friis C, Hasman H, Marvig RL, et al. Multilocus Sequence Typing of Total Genome Sequenced Bacteria. J Clin Microbiol 2012;50(4):1355-1361.

808


Rev Mex Cienc Pecu 2020;11(3):795-810

17. Alikhan NF, Zhou Z, Sergeant MJ, Achtman M. A genomic overview of the population structure of Salmonella. PLoS Genet 2018;14(4):e1007261. 18. Zhou Z, Alikhan NF, Sergeant MJ, Luhmann N, Vaz C, Francisco AP, et al. GrapeTree: visualization of core genomic relationships among 100,000 bacterial pathogens. Genome Res 2018;28(9):1395-1404. 19. Belk AD, Arnold AN, Sawyer JE, Griffin DB, Taylor TM, Savell JW, Gehring KB. Comparison of Salmonella Prevalence Rates in Bovine Lymph Nodes across Feeding Stages. J Food Prot 2018;81(4):549-553. 20. Nickelson KJ, Taylor TM, Griffin DB, Savell JW, Gehring KB, Arnold AN. Assessment of Salmonella prevalence in lymph nodes of U.S. and Mexican cattle presented for slaughter in Texas. J Food Prot 2019;82(2):310-315. 21. Cetin E, Serbetcioglu T, Temelli S, Eyigor A. Nontyphoid Salmonella carriage, serovar profile and antimicrobial resistance phenotypes in slaughter cattle. J Food Safety 2018;39(2). 22. Balleste-Delpierre C, Sole M, Domenech O, Borrell J, Vila J, Fabrega A. Molecular study of quinolone resistance mechanisms and clonal relationship of Salmonella enterica clinical isolates. Int J Antimicrob Agents 2014;43(2):121-125. 23. Haley BJ, Kim SW, Pettengill J, Luo Y, Karns JS, Van Kessel JA. Genomic and evolutionary analysis of two Salmonella enterica Serovar Kentucky sequence types Isolated from bovine and poultry sources in North America. PLoS One 2016;11(10):e0161225. 24. Olafson PU, Brown TR, Lohmeyer KH, Harvey RB, Nisbet DJ, Loneragan GH, Edrington TS. Assessing transmission of Salmonella to bovine peripheral lymph nodes upon horn fly feeding. J Food Prot 2016;79(7):1135-1142. 25. Cernicchiaro N, Ives SE, Edrington TS, Nagaraja TG, Renter DG. Efficacy of a Salmonella siderophore receptor protein vaccine on fecal shedding and lymph node carriage of Salmonella in commercial feedlot cattle. Foodborne Pathog Dis 2016;13(9):517-525. 26. Delgado-Suรกrez EJ, Selem-Mojica N, Ortiz-Lรณpez R, Gebreyes WA, Allard MW, Barona-Gรณmez F, Rubio-Lozano MS. Whole genome sequencing reveals widespread distribution of typhoidal toxin genes and VirB/D4 plasmids in bovine-associated nontyphoidal Salmonella. Sci Rep 2018;8(1):9864. 27. Fabrega A, Vila J. Salmonella enterica serovar Typhimurium skills to succeed in the host: virulence and regulation. Clin Microbiol Rev 2013;26(2):308-341.

809


Rev Mex Cienc Pecu 2020;11(3):795-810

28. Holzer K, Weissend C, Huebner K, Metcalf J, Geornaras I, Belk K, Morley P, Martin J. Presence and characteristics of Salmonella enterica recovered from subiliac lymph nodes of beef feedlot cattle enrolled in a randomized clinical trial of dietary additives. Meat Muscle Biol 2017;1(3):131. 29. Edrington TS, Loneragan GH, Genovese K, Hanson DL, Nisbet DJ. Salmonella persistence within the peripheral lymph nodes of cattle following experimental inoculation. J Food Prot 2016;79(6):1032-1035.

810


https://doi.org/10.22319/rmcp.v11i3.5242 Artículo

Uso de una PCR anidada para el diagnóstico del virus de la necrosis pancreática infecciosa (VNPI) en truchas de campo

Catalina Tufiño-Loza a José Juan Martínez-Maya a Amaury Carrillo-González b Diana Neria-Arriaga c Celene Salgado-Miranda d Edith Rojas-Anaya e Elizabeth Loza-Rubio e*

a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Ciudad de México, México. b

Universidad del Valle de México, Campus Toluca, Estado de México, México.

c

SENASICA, Ciudad de México, México.

d

Universidad Autónoma del Estado de México. Centro de Investigación y Estudios Avanzados en Salud Animal, Estado de México, México. e

INIFAP. Centro Nacional de Investigaciones Disciplinarias en Salud Animal e Inocuidad.

Carretera México-Toluca km 15.5, Colonia Palo Alto, Ciudad de México, México.

* Autor de correspondencia: loza.elizabeth@inifap.gob.mx, eli_rubio33@hotmail.com

811


Rev Mex Cienc Pecu 2020;11(3):811-827

Resumen: El aislamiento en cultivo celular es el método principal para el diagnóstico del virus de la necrosis pancreática infecciosa (VNPI). Aunque es un método confiable, resulta costoso y conlleva tres semanas en proporcionar un resultado. Para disminuir el tiempo en el diagnóstico y aumentar la sensibilidad para la detección del VNPI, el objetivo del presente estudio fue establecer y evaluar el uso de una PCR anidada (PCRa) para un diagnóstico rápido del VNPI. Para ello, se diseñaron dos pares de iniciadores basados en secuencias mexicanas. El primer par (RT-PCR) amplificó un producto de 682 pb y el segundo par (PCRa) 229 pb del gen VP2. Posteriormente, se infectaron 70 crías de truchas arcoíris (Oncorhynchus mykiss) con la cepa virulenta MEX3-CSM-05 a una dosis de 1X105.8 DICC50%/0.02 ml. De cada organismo se colectó el riñón, el bazo, los sacos pilóricos, el hígado, el intestino y las branquias. Para evaluar las pruebas, se utilizaron 26 truchas adultas clínicamente sanas de granjas comerciales del Estado de México. La frecuencia de detección del VNPI mediante RT-PCR en las branquias fue de 87.1 %, en el hígado 61.4 %, en los sacos pilóricos 61.4 %, en el riñón 58.6%, en el intestino 35.7 % y en el bazo 32.9 % (P<0.05). Las muestras negativas a la RT-PCR resultaron positivas en la PCRa. Asimismo, se mostraron positivas las muestras de los órganos de las truchas de campo. En conclusión, la RT-PCR tuvo menor sensibilidad que la PCRa, la cual mostró una sensibilidad del 100%. Por lo tanto, la PCRa es mejor para un diagnóstico confiable del VNPI en peces infectados y enfermos. Palabras clave: VNPI, PCR anidada, Trucha arcoíris, Diagnóstico.

Recibido: 30/01/2019 Aceptado: 09/12/2019

Introducción El crecimiento constante de la industria acuícola ha generado mayor incidencia y propagación de enfermedades, principalmente aquellas generadas por virus debido a su rápida dispersión y alto grado de infección. La necrosis pancreática infecciosa (NPI) es una enfermedad sistémica aguda que afecta principalmente a peces de la familia de los salmónidos. Causa una mortalidad elevada en alevines y crías, y los peces sobrevivientes eliminan el virus toda su vida(1,2). El agente etiológico de la NPI pertenece a la familia Birnaviridae, género Aquabirnavirus(3,4). Es un virus no envuelto, con una cápside en forma de icosaedro y un diámetro aproximado de 60 nm(5). Su genoma está compuesto por dos segmentos de ácido ribonucleico (ARN) de doble cadena(1). El virus de la NPI (VNPI) se

812


Rev Mex Cienc Pecu 2020;11(3):811-827

caracteriza por su gran variabilidad antigénica y genotípica. Su presencia ha sido notificada en salmónidos silvestres y de cultivo en diferentes países en todos los continentes, por lo que se considera una enfermedad de distribución mundial(6,7). Los brotes de la NPI se deben con frecuencia a las importaciones y la venta de huevo oculado y crías infectadas(8). En México, esta enfermedad fue identificada en el año 2000 en crías de trucha arcoíris (Oncorhynchus mykiss) importadas de Estados Unidos de América(9). En el 2009, se reportó una prevalencia nacional del 11.9 % y una diseminación en el 62.5 % en las principales entidades trutícolas nacionales. Sin embargo, no se ha calculado el impacto económico que ha provocado el virus desde su identificación en el 2002 a la fecha(10). El aislamiento viral en líneas celulares de peces, como fibroblasto de alevín Lepomis macrochirus (BF-2), células embrionarias de salmón Chinook (CHSE- 214) o fibroblastos de gónada de trucha arcoíris (RTG-2), seguido de su identificación inmunológica mediante inmunofluorescencia en peces aparentemente sanos, es el diagnóstico sugerido por la Organización Mundial de Sanidad Animal(7). Sin embargo, a pesar de ser un método confiable, resulta costoso y su realización conlleva al menos tres semanas para confirmar un resultado como negativo(11,12). Además, ese tiempo es crítico en la diseminación del virus, debido a la rápida dispersión en corrientes lóticas, lo que puede causar pérdidas económicas considerables(2,13). Existen otras pruebas para la identificación del virus como son: la inmunohistoquímica y ELISA (ensayo por inmuno-absorción ligado a enzimas) para la detección del antígeno(7). Sin embargo, problemas como la dependencia en la importación de estas pruebas y anticuerpos monoclonales, la autofluorescencia de los tejidos de los peces, un título viral alto, la dificultad para obtener muestras frescas de tejidos de peces y la reacción cruzada de los anticuerpos son las limitantes más comunes para el uso universal y rutinario de las técnicas mencionadas(14,15). Por lo anterior, se han propuesto varios protocolos para una identificación eficiente y rápida del VNPI a partir de cultivos celulares infectados o de muestras de tejidos, mediante el uso de la reacción de transcripción reversa de la cadena de la polimerasa (RT-PCR) y algunas de sus variantes(16-24). Con el propósito de disminuir el tiempo de diagnóstico para implementar diversas estrategias en el control de la NPI y prevenir su exposición en las unidades de producción, el objetivo del presente estudio fue establecer y evaluar el uso de una PCR anidada (PCRa) con iniciadores diseñados usando secuencias de aislamientos mexicanos, para el diagnóstico del VNPI a partir de tejidos de truchas infectadas experimentalmente y de truchas clínicamente sanas cultivadas en unidades de producción acuícola.

813


Rev Mex Cienc Pecu 2020;11(3):811-827

Material y métodos Línea celular

Se empleó la línea celular BF-2 de Lepomis macrochirus (ATCC® CCL 91) para la replicación de la cepa virulenta MEX2-CSM-05(25). La línea celular BF-2 se propagó a 20 °C, en medio Leibovitz (L-15) (In vitro, México) suplementado con suero fetal bovino al 10% (SFB) (Biowest, México) 100 IU/ml de penicilina, 100 g/ml de estreptomicina y 0.25 g/ml de anfotericina B (In vitro, México).

Virus La cepa virulenta MEX2-CSM-05 del VNPI notificada por Salgado-Miranda et al(25) se replicó en monoestratos confluentes de la línea celular BF-2 a 15 °C en medio Leibovitz (L-15) (In vitro, México) suplementado con suero fetal bovino al 2% (SFB) (Biowest, México). Una vez que se observó el efecto citopático (ECP) que consistió en la pérdida gradual del monoestrato y redondeamiento de la células, a las 72 h post-infección se congelaron las botellas de cultivo a -20 °C y descongelaron en dos ocasiones, posteriormente se recolectó el medio con las células en suspensión y se centrifugó a 1,200 g por 15 min a 4 °C(7) para la obtención del sobrenadante, a partir del cual se determinó el título viral (dosis infectiva en cultivo celular, DICC) mediante el método de Reed y Muench.

Truchas Para el estudio experimental, se adquirieron 100 crías de truchas arcoíris (O. mykiss) del Centro Acuícola El Zarco de la Comisión Nacional de Acuacultura y Pesca (CONAPESCA), con una talla promedio de 3 cm, un peso promedio de 1 g y 480 gradosdías (valor que se obtiene multiplicando la edad en días por el promedio de la temperatura en grados centígrados durante la vida útil)(26). Para evaluar la prueba, se adquirieron 26 truchas arcoíris (O. mykiss) adultas clínicamente sanas provenientes de unidades de producción comerciales en el Estado de México. La evaluación clínica de los peces consistió en una evaluación de su comportamiento, así como de su apariencia externa, en ella se observó un nado normal de la especie, a contracorriente, en donde responde a ruidos y estímulos (reacción de fuga). La coloración de los peces se observó normal, amarillo verdoso, vientre blanco y puntos negros en la parte dorsal y en las aletas. También se observó en ellas una piel suave, sin hematomas y aletas íntegras. En las truchas provenientes del centro acuícola se determinó su estatus sanitario previo al inicio del experimento mediante el análisis de 10 organismos para evaluar la presencia de bacterias, 814


Rev Mex Cienc Pecu 2020;11(3):811-827

parásitos y el virus de la necrosis pancreática infecciosa (VNPI) por aislamiento y PCR en el Laboratorio de Sanidad Acuícola del Centro de Investigación y Estudios Avanzados en Salud Animal de la Universidad Autónoma del Estado de México, cuyo resultado fue negativo para las bacterias, parásitos y el VNPI. De esta forma se determinó la utilización de animales clínicamente sanos para el experimento. En las truchas provenientes de las unidades de producción comerciales del Estado de México, únicamente se realizó la evaluación de comportamiento y apariencia externa, ya que éstas fueron utilizadas para evaluar la PCR anidada para la detección del VNPI. Los organismos se mantuvieron en estanques de polipropileno con 60 L de agua en re-circulación, con un fotoperiodo de 12 h de luz/ 12 h de oscuridad, una temperatura ambiental de entre 14-17 °C y alimentadas con producto comercial, suministrando el 3% de su biomasa total al día.

Infección experimental con VNPI A partir de las 100 truchas arcoíris provenientes del Centro Acuícola se inocularon 70 por vía intraperitoneal con 1X105.8 DICC 50%/0.02 ml de la cepa virulenta MEX3-CSM-05. Los 30 organismos restantes no fueron inoculados y se mantuvieron en otro estanque como control negativo a la detección del VNPI en tejido mediante la PCRa. Posterior a la inoculación, se realizó un examen clínico diariamente para identificar y seguir el curso de la enfermedad con los signos clínicos, que consistieron en la disminución del apetito, anorexia, hiperpigmentación, distención abdominal, exoftalmos moderado y nado errático en espiral. Cuando los peces mostraron signos clínicos muy avanzados se les practicó la eutanasia por sobreexposición a la anestesia con tricaína metanosulfonato (MS-222) (Sigma-Aldrich, 886-86-2, EUA) a una concentración de 50 μg/ml(27). Después de aplicar la eutanasia en los peces, se recolectaron los siguientes órganos: riñón, bazo, sacos pilóricos, hígado, intestino y branquias, los cuales fueron conservados a -80 ºC. Adicionalmente, y en las mismas fechas se realizó la eutanasia de dos truchas del estanque del control negativo cada día, para recolectar los órganos mencionados. Los peces provenientes de las unidades de producción comerciales del Estado de México, a su llegada al laboratorio se realizó la eutanasia para la recolección de los órganos. Todos los procedimientos que involucraron el manejo de los animales se realizaron de acuerdo a los lineamientos establecidos por el Comité de Bioética para el cuidado y uso razonable de los animales de experimentación en proyectos de investigación (autorización no. CBCURAE-006) en el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad del Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, donde se realizaron todos los procedimientos.

815


Rev Mex Cienc Pecu 2020;11(3):811-827

Extracción de ARN y síntesis de ADNc Los órganos se maceraron y homogeneizaron con solución salina fosfatada (PBS) estéril a un pH 7.2, de estos se tomaron 250 l para la extracción de ARN total con Trizol (Invitrogen, 15596018, EUA), siguiendo las instrucciones del fabricante. El ARN se resuspendió en agua libre de DNasas y RNasas. La síntesis de ADNc se realizó con el kit M-MLV Reverse Transcriptase, oligo (dT)12-18 (0.5g/l) (Invitrogen, EUA). El ARN se incubó con 1 l de oligo (dT)12–18 (0.5 µg/µl) y 1 l 10 mM de dinucleósidos trifosfato (dNTP) durante 5 min a 65 °C. Después de la incubación, se agregaron 4 l de 5X first strand buffer, 1 l de 0.1 M dithiothreitol (DTT) y 1 l de MML-V Reverse Transcriptase, se mezcló y se incubó durante 1 h a 50 °C. Posteriormente la reacción se inactivó a 70 °C durante 15 min y se almacenó a -20 °C, hasta su uso.

Iniciadores Los iniciadores para la detección de un fragmento del gen VP2 del VNPI y del gen constitutivo en este estudio aparecen en el Cuadro 1(10,28). Estos se sintetizaron en el Instituto de Biotecnología de la Universidad Nacional Autónoma de México (Cuernavaca, Morelos, México). Cuadro 1: Secuencia de iniciadores para detectar el gen VP2 del VNPI y del gen constitutivo EF-α.

RT-PCR

PCRa

EF-α

Secuencia

Posición

For 5’ CCGAATCAGGAAGTGGMMTTCTTG 3’

137–160

Rev 5’ GTGACCACKGGGACGTCATTGTC 3’

796–818

For 5’ TCACCGTCCTGAATCTACCAAC 3’

482-503

Rev 5’ GTTGTGGAGTTSACGATGTCSGC 3’

688–710

For -5 'GATCCAGAAGGAGGTCACCA 3'

561-583

Rev -5' TTACGTTCGACCTTCCATCC 3'

694-713

No. acceso GenBank

AF498320

Tamaño (pb)

Ta

689

60º

229

65º

150

55º

Ta= temperatura de alineamiento; pb= pares de bases.

PCR y PCRa Para la amplificación de todos los productos de PCR se utilizó el kit Dream Taq DNA Polymerase (Thermo Scientific, EUA) y las reacciones se prepararon con una concentración final de 2 mM MgCl2, 0.2 mM de dNTP’s Mix, 0.2 mM de cada iniciador (sentido y antisentido) descritos anteriormente, 5 l de ADNc de cada muestra y 1.25 U de

816


Rev Mex Cienc Pecu 2020;11(3):811-827

ADN polimerasa. La amplificación de la PCR se llevó a cabo bajo las siguientes condiciones: desnaturalización inicial de 95 ºC durante 1 min, seguida de 35 ciclos de desnaturalización a 95 ºC por 30 s, alineación a 60 ºC durante 30 s, una extensión a 72 ºC por 30 s; y se agregó una extensión final a 72 ºC durante 7 min. Posteriormente, el templado que se utilizó para la PCRa fue el producto de la PCR anterior y su amplificación se realizó bajo las mismas condiciones antes mencionadas, excepto que la temperatura de alineación fue de 65 ºC. Los productos de PCR y PCRa fueron analizados mediante electroforesis en un gel de agarosa al 1% en buffer TAE (40 mM Tris, 20 mM Ácido acético, 2 mM EDTA), teñido con GelRed (Biotium, EUA) y visualizado en el fotodocumentador Quantity One 1-D Analysis System (Bio-Rad, EUA).

Análisis estadístico La frecuencia de órganos positivos a la RT-PCR y PCRa de truchas infectadas experimentalmente se analizó en tablas de contingencia y a través de una prueba de Jicuadrada(25), adicionalmente, se evaluó la sensibilidad y especificidad de cada prueba (Cuadro 2). La proporción de muestras positivas a la RT-PCR en cada órgano se compararon con la prueba estadística de múltiples proporciones tipo Tukey con transformación angular en donde se consideró una significancia estadística de P<0.05(29). Cuadro 2: Generación de las celdas con las que se realizan los cálculos de sensibilidad y especificidad Estado de salud de los peces Infectados Positivo

Verdaderos positivos (VP)

Negativo

Falsos negativos (FN)

Prueba molecular

Sanos Falsos positivos (FP) Verdaderos negativos (VN)

Sensibilidad = VP / (VP+FN) Especificidad =VN / (FP+VN)

Resultados Las truchas infectadas experimentalmente comenzaron a mostrar signos clínicos sugerentes a la NPI a partir del día 7 y hasta el día 11 post-inoculación (pi) (Cuadro 3). La mortalidad se observó a partir del día 7 pi, alcanzando el 100 % de la mortalidad al día 11 pi. Los principales hallazgos de la necropsia en truchas inoculadas fueron: ausencia de alimento en

817


Rev Mex Cienc Pecu 2020;11(3):811-827

el estómago, el hígado se mostró pálido y con presencia de moco en el intestino, mientras que, las truchas provenientes de las unidades de producción se observaron clínicamente sanas y sin lesiones a la necropsia.

Cuadro 3: Cinética de la presentación de los signos clínicos en las truchas arcoíris inoculadas experimentalmente con la cepa MEX2-CSM-05 Día post-desafío

Descripción de los signos clínicos

1-6

No se observaron signos

7

8

9 10 11

Anorexia, hiperpigmentación, disminución del apetito, distención abdominal, exoftalmos moderado, nado errático en espiral en algunas truchas. Incremento de la presentación del nado errático en espiral en más truchas, además de hiperpigmentación, anorexia, distención abdominal. Aumento en el nado errático en espiral en más truchas, además de hiperpigmentación, anorexia, distención abdominal. Algunos organismos solo permanecían en el fondo. Nado errático en espiral, hiperpigmentación, anorexia, distención abdominal. Nado errático en espiral, hiperpigmentación, anorexia, distención abdominal.

Los resultados obtenidos de la RT-PCR en los diferentes órganos de las truchas inoculadas experimentalmente permitieron lograr la detección del VNPI en diferentes proporciones. Los órganos que mostraron mayor frecuencia de detección del virus fueron las branquias (87.1 %), el hígado (61.4 %), los sacos pilóricos (61.4 %) y el riñón (58.6 %) (P<0.05). Por otro lado, los que registraron la menor frecuencia de detección de VNPI fueron: el intestino (35.7 %) y bazo (32.9 %) (Cuadro 4) (P<0.05). Sin embargo, al realizar la PCRa en estas últimas muestras sí se detectó un producto de 229 pb, el cual previamente fue enviado a secuenciar y se corroboró que correspondiera al VNPI. Los órganos de las truchas recolectadas del estanque control fueron negativas a la amplificación de la PCRa.

818


Rev Mex Cienc Pecu 2020;11(3):811-827

Cuadro 4: Detección por RT-PCR y PCRa del gen VP2 del VNPI en los órganos de truchas arcoíris inoculadas con la cepa MEX2-CSM-05 RT-PCR PCRa Órgano Muestras Muestras % % positivas positivas Riñón 41/70 58.6 29/70 41.4 Hígado 43/70 61.4 27/70 38.6 Sacos pilóricos 43/70 61.4 27/70 38.6 Intestino 25/70 35.7 45/70 64.3 Branquias 61/70 87.1 9/70 12.9 Bazo 23/70 32.9 47/70 67.1 Con base en los resultados anteriores, la RT-PCR mostró menor sensibilidad que la PCRa en cada órgano analizado (Cuadro 5); sin embargo, la especificidad fue del 100 %; mientras que la PCRa, mostró una sensibilidad y especificidad del 100 %. Los órganos de las truchas provenientes de las unidades de producción comerciales del Estado de México amplificaron únicamente al utilizar la PCRa, la frecuencia de detección fue del 100 %.

Órgano Riñón Hígado Sacos pilóricos Intestino Branquias Bazo

Cuadro 5: Sensibilidad de la RT-PCR Sensibilidad (%) (IC) Especificidad (%) 58.6 (47.0, 70.1) 100 61.4 (50.0, 72.8) 100 61.4 (50.0, 72.8) 100 35.7 (24.5, 46.9) 100 87.1 (79.3, 95.0) 100 32.9 (21.9, 43.9) 100 IC= intervalos de confianza 95 %.

Discusión Actualmente, muchas enfermedades de peces usan técnicas moleculares para un diagnóstico rápido, sensible y específico. Esto ha permitido la detección oportuna de una gran cantidad de agentes infecciosos. En consecuencia, se han logrado desarrollar, implementar y mejorar las medidas de prevención y control de muchas enfermedades. Desde su detección inicial en la trucha Salvenilus fontinalis, el VNPI ha sido identificado en una amplia variedad de peces y especies invertebrado, pero con gran impacto en los

819


Rev Mex Cienc Pecu 2020;11(3):811-827

salmónidos con distribución mundial(30,31). Aunque se ha demostrado que actualmente el virus está presente en casi todos los estados productores de trucha del país(32), los casos reportados con enfermedad clínica son pocos, esto puede deberse a que los aislados mexicanos del VNPI están relacionados con la cepa VR-299 de origen norteamericano inicialmente reportada por Ortega et al(9), la cual es considerada de baja virulencia(33). Por esta razón, para este estudio, se diseñaron dos pares de iniciadores específicos para detectar las cepas mexicanas del VNPI que circulan en México y la cepa de referencia Sp(10), ya que debido a la variabilidad antigénica de este virus se ha demostrado que los iniciadores que reconocen cepas de otras partes del mundo no reconocen las cepas actualmente circulantes en el país(21,34). En los últimos años, las técnicas moleculares como la PCR se han utilizado ampliamente para la detección de virus de peces(9,30). El uso de la RT-PCR se ha aplicado en la detección del VNPI debido a su precisión, rapidez y alta sensibilidad(18,19,21,34). Esta técnica se puede aplicar específicamente para la detección del genoma viral sin haber realizado un aislamiento viral previo, esto se llevó a cabo en Irán, en donde mediante la RT-PCR se confirmó la presencia del VNPI por primera vez en las granjas piscícolas de trucha arcoíris de la provincia de Fars, cuyo aislado se asemeja a la cepa Ab(35). La aplicación de RT-PCR se ha descrito para detectar al genoma del VNPI de cultivos celulares, de peces inoculados experimentalmente, y de peces, crustáceos y moluscos infectados de manera natural(35). La infección por el VNPI es letal en salmónidos jóvenes, aunque este virus se puede aislar en diferentes órganos de los peces infectados en todos los rangos de edad(13). En el presente estudio, la PCRa mostró ser eficiente en la detección de un fragmento del genoma del VNPI tanto en las crías de trucha arcoíris como en las truchas provenientes de granjas comerciales, las cuales son de mayor peso y edad. Aunque el aislamiento de los birnavirus acuáticos de las especies aparentemente sanas puede ser común, se ha demostrado que la infección por VNPI puede no ser detectada aún cuando las muestras han sido examinadas por cultivo celular(36,37). Varios trabajos mostraron que la RT-PCR era más sensible que el aislamiento del cultivo celular para la detección del VNPI(38). La RT-PCR en tiempo real es ligeramente más sensible que el aislamiento viral en cultivo celular, este último es recomendado por la OIE para detectar el VNPI de peces portadores, los cuales han demostrado tener bajas concentraciones de virus en riñones, lo que puede limitar su detección por aislamiento viral(36,39). De acuerdo con Milne et al(13), los títulos relativamente altos del virus están presentes en los peces con signología avanzada por VNPI. Esto podría hacer más fácil la detección del genoma del virus por RT-PCR en punto final como una técnica molecular cualitativa. Sin embargo, como se mostró en nuestro estudio, un fragmento del genoma del VNPI fue detectado en un cierto porcentaje de los peces infectados experimentalmente en el ensayo 820


Rev Mex Cienc Pecu 2020;11(3):811-827

de RT-PCR, dependiendo del órgano evaluado. Sin embargo, al realizarse el ensayo de la PCRa en las muestras negativas mostraron ser positivas, con un incremento de sensibilidad al 100 %. Esto mismo se observó en las muestras de truchas juveniles provenientes de las unidades de producción comerciales, que se mostraban aparentemente sanas y resultaron ser positivas en la PCRa. Esto podría deberse a que la concentración de partículas virales en los portadores asintomáticos a menudo son bajas, lo cual dificulta la detección del virus por medio de la RT-PCR(13). Los resultados obtenidos en este estudio en peces adultos determinaron que los animales testados podrían ser portadores sanos, esto sucede cuando los peces sobreviven a la infección por VNPI y al continuar con su ciclo productivo contribuyen con la transmisión vertical del virus a través de las ovas o semen. Estos portadores asintomáticos pueden no mostrar signos clínicos aparentes o cambios patológicos(40,41) y dependiendo del progreso de la enfermedad a través del tiempo y/o de la respuesta inmunológica de cada espécimen, pueden no observarse cambios macro y microscópicos en los diferentes órganos de los peces. Sin embargo, los salmónidos persistentemente infectados con el VNPI son una potencial fuente de dispersión de la enfermedad y potencialmente detectables por la PCR. Cabe destacar que es muy probable que los casos detectados de VNPI mediante la PCRa se encuentren relacionados con cepas de baja virulencia, y por tanto no causen afectación significativa en la producción de trucha, sin embargo el riesgo potencial de la introducción y diseminación de otras cepas de VNPI también puede deberse a la importación de huevo oculado de los EUA principalmente, además de algunos países de Europa, África y Sudamérica que también son proveedores(32). Por esta razón, el uso de la PCRa propuesta en este estudio es de gran importancia para una detección oportuna, rápida y confiable. La alta sensibilidad de esta variante de PCR ya se ha demostrado en varias investigaciones. Se ha detectado una sensibilidad de hasta 10 pg en aislamientos de salmónidos a partir de muestras de ARN purificadas(34). Lopez-Lastra et al(18) desarrollaron una PCRa para detectar hasta 1 pg del VNPI en portadores asintomáticos a partir de muestras de campo. Suzuki et al(37) desarrollaron una PCRa, utilizando un par de iniciadores basados en la detección de la región de unión de la secuencia del gen VP2/NS de los birnavirus acuáticos con una sensibilidad de un 1 fg (femtogramo) de genoma viral en la muestra. La PCRa proporciona un aumento en la especificidad y reduce la detección de falsos positivos cuando el segundo par de iniciadores genera amplificación solo si el primer par desencadenó el fragmento de ADN esperado(21,34,42). Otra ventaja de la PCRa propuesta en este estudio es la detección del virus de los tejidos infectados sin llevar a cabo el aislamiento en cultivo celular, ya que, aunque se considera la prueba de referencia para su diagnóstico, es una técnica que restringe su uso a laboratorios con personal capacitado para el manejo de las líneas celulares, el equipo necesario para su mantenimiento e incubación y la identificación del efecto citopático(7). 821


Rev Mex Cienc Pecu 2020;11(3):811-827

Se debe mencionar que se han propuesto otras variantes de PCR y pruebas, pero su adopción depende del equipo disponible en los laboratorios. Por ejemplo, Rodríguez et al(21) realizaron una comparación de seis métodos de diagnóstico para el VNPI, en la que encontró que la RT-PCR y la citometría de flujo fueron los métodos más apropiados y sensibles para una detección rutinaria del VNPI. En otro estudio(23) encontraron una sensibilidad baja (43 %) con el uso de una RT-PCR, por lo que se propusieron utilizar un protocolo corto de incubación en cultivo celular como técnica complementaria, adicional a una PCR múltiplex utilizando tres pares de iniciadores en una sola reacción para incrementar la probabilidad de identificar todos los serotipos del serogrupo A del VNPI, así como prevenir un resultado falso negativo. Aunque se han propuesto otras técnicas moleculares para un diagnóstico rápido y con alta sensibilidad como la RT-PCR en tiempo real y RT-LAMP (Loop-mediated isothermal amplification, por sus siglas en inglés), estas requieren equipos especializados y capacitación tanto para el diseño de iniciadores como para la interpretación de los resultados(22,42). En México, el diagnóstico del VNPI se realiza principalmente mediante el aislamiento viral en cultivo celular y la detección de su genoma por RT-PCR en punto final, ya que esta técnica se lleva a cabo en la mayoría de los laboratorios de forma convencional. Por otro lado, la detección del VNPI en los diferentes órganos analizados en este estudio confirma la amplia diseminación del virus. Usualmente los órganos recomendados para la detección del VNPI en cultivos celulares son: riñón, hígado, bazo y fluido ovárico del pie de cría o el alevín entero(7). Sin embargo, el principal órgano blanco para la replicación es el riñón, donde el virus persiste(39). A diferencia del riñón, otros órganos blancos para la detección del virus son el páncreas, el intestino, el hígado y las branquias. El páncreas se encuentra anatómicamente difuso entre los sacos pilóricos y en él se genera una severa necrosis. En el intestino se ha reportado una enteritis aguda caracterizada por la necrosis celular y glándulas que se encuentran en el tracto digestivo, responsable la eliminación del virus con las heces y el moco que se produce(6). En el hígado, el VNPI induce marcadores de apoptosis, los cuales también se han encontrado en tejido intestinal y pancreático que corresponden a la acumulación viral y cambios patológicos en el tejido(43,44). Finalmente, las branquias que son el órgano encargado del intercambio de oxígeno, pueden observarse pálidas debido al daño degenerativo y necrótico del epitelio. En este estudio, los órganos donde se encontró la mayor frecuencia de detección del virus fueron los sacos pilóricos, intestino y branquias, los cuales como se mencionó, han sido identificados como órganos blanco para la detección temprana de la enfermedad, puesto que son sitios de replicación temprana del virus(45).

822


Rev Mex Cienc Pecu 2020;11(3):811-827

Conclusiones e implicaciones La PCRa utilizando iniciadores desarrollados para la identificación de aislamientos nacionales, es útil en el diagnóstico del VNPI, no solo en peces clínicamente enfermos, sino también para detectar peces infectados sin signos clínicos. Asimismo, se sugiere que ante un brote de la NPI en una unidad de producción, debe ser confirmada primero por este método. En casos necesarios, el aislamiento viral, estudios histopatológicos o inmunohistoquímicos, se recomiendan se lleven a cabo en los casos sospechosos o positivos a la PCRa.

Agradecimientos Esta investigación se llevó a cabo con el apoyo financiero del Consejo Nacional de Ciencia y Tecnología (CONACyT) del proyecto CB -2009-01-134099. Catalina Tufiño Loza recibió el apoyo de CONACYT. Los autores también agradecen a A. Mejía, A. Fabián, J.C. Gómez de la Universidad del Valle de México (UVM) por su excelente asistencia técnica.

Literatura citada: 1.

Rodríguez SJS, Borrego JJ, Perez PSI. Infectious pancreatic necrosis virus: biology, pathogenesis, and diagnostic methods. Adv Virus Res 2003;62(1):113-165.

2.

Salgado-Miranda C. Necrosis pancreática infecciosa: enfermedad emergente en la truticultura de México. Vet Méx 2006;37(4):467-477.

3.

Dobos P, Roberts TE. The molecular biology of infectious pancreatic necrosis virus: a review. Can J Microbiol 1983;29(4):377-384.

4.

King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ, King AMQ, et al, editors. Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses. New York, USA: Academic Press; 2012:499-507.

5.

Dobos P. Birnaviruses. Encyclopedia of life sciences. Nature Publishing Group 2001, London.

6.

Dhar A, LaPatra S, Orry A, Allnutt T. Infectious pancreatic necrosis virus. In: Woo PTK, Cipriano RC editors. Fish viruses and bacteria: Pathobiology and protection. 1rst ed. Wallingford, Oxfordshire, UK: CAB International; 2017: 1-12.

7.

OIE. Manual of diagnostic tests for aquatic animals. 5th ed. Paris, France: World Organization for Animal Health. 2006.

823


Rev Mex Cienc Pecu 2020;11(3):811-827

8.

Munro ES, Midtlyng PJ. Infectious pancreatic necrosis and associated aquatic birnaviruses. In: Woo PT, Bruno DW, editors. Fish diseases and disorders. Volume 3: viral, bacterial and fungal infections, 2nd ed. Oxfordshire, UK: CABI; 2011:1-65.

9.

Ortega SC, Montes de Oca R, Groman D, Yason C, Nicholson B, Blake S. Case report: viral infectious pancreatic necrosis in farmed Rainbow Trout from Mexico. J Aquat Anim Health 2002;14(4):305-310.

10. Salgado MC. Virulencia del virus de la necrosis pancreática infecciosa en trucha arcoíris (Oncorhynchus mykiss) a partir de aislamientos mexicanos [tesis doctorado]. México, DF: Universidad Nacional Autónoma de México; 2014. 11. Amos KH. Procedures for the detection and identification of certain fish pathogens, 3rd ed. Fish Health Section, American Fisheries Society, Corvallis; 1985. 12. Ahne W, Thomsen I. 1986. Infectious pancreatic necrosis: detection of virus and antibodies in rainbow trout IPNV-carrier (Salmo gairdneri). J Vet Med 1986;33(7):552-554. 13. Milne SA, Galachacher S, Cash P, Porter AJR. A reliable RTPCR-ELISA method for the detection of infectious pancreatic necrosis virus (IPNV) in farmed rainbow trout. J Virol Methods 2006;132(1-2):92-96. 14. Sanz F, Coll J. Techniques for diagnosing viral diseases of salmonid fish. Dis Aquat Org 1992;13:211-223. 15. LaPatra SE. The use of serological techniques for virus surveillance and certification of finfish. Annu Rev Fish Dis 1997;6:1-28. 16. Way-Shyan W, Yea-Ling W, Jainn-Shyan L. Single-tube, non-interrupted reverse transcription PCR for detection of IPNV. Dis Aquat Org 1997;28(3):229-233. 17. Pryde A, Melvin WT, Munro ALS. Nucleotide sequence analysis of the serotypespecific epitope of infectious pancreatic necrosis virus. Arch Virol 1993;129(1-4):287293. 18. Lopez-Lastra M, Gonzalez M, Jashes M, Sandino AM. A detection method for infectious pancreatic necrosis virus (IPNV) based on reverse transcription (RT)polymerase chain-reaction (PCR). J Fish Dis 1994;17(3):269-282. 19. Blake S, Lee MK, Singer J, McAllister PE, Nicholson BL. Detection and identification of aquatic birnavirus by polymerase chain reaction assay. J Clin Microbiol 1995;33(4):835-839.

824


Rev Mex Cienc Pecu 2020;11(3):811-827

20. Alonso M, Rodríguez S, Pérez-Prieto SI. Viral coinfection in salmonids: infectious pancreatic necrosis virus interferes with infectious hematopoietic necrosis virus. Arch Virol 1999;144(4):657-673. 21. Rodriguez SJ, Borrego JJ, Perez-Prieto SI. Comparative evaluation of five serological methods and RT-PCR assay for the detection of IPNV in fish. J Virol Methods 2001;97(1-2):23-31. 22. Bowers RM, Lapatra SE, Dhar AK. Detection and quantitation of infectious pancreatic necrosis virus by real-time reverse transcriptase-polymerase chain reaction using lethal and non-lethal tissue sampling. J Virol Methods 2008;147(2):226-34. 23. Barrera-Mejía M, Simón-Martínez J, Salgado-Miranda C, Vega F, Ortega C, Aragón A. Development and validation of a short-time cell culture and multiplex reverse transcriptase polymerase chain reaction assay for infectious pancreatic necrosis virus in Mexican farm-sampled rainbow trout. J Aquat Anim Health 2009;21(3):167-72. 24. Tapia D, Eissler Y, Torres P, Jorquera E, Espinoza JC, Kuznar J. Detection and phylogenetic analysis of infectious pancreatic necrosis virus in Chile. Dis Aquat Org 2015;116(3):173-84. 25. Salgado-Miranda C, Rojas-Anaya E, García-Espinoza G, Loza-Rubio E. Molecular characterization of the VP2 gene of Infectious Pancreatic Necrosis Virus (IPNV) isolates from Mexico. J Aquat Anim Health 2014;26(1):43-51. 26. Dorson M, Touchy C. The influence of fish age and water temperature on mortalities of rainbow trout, Salmo gairdneri Richardson, caused by a European strain of infectious pancreatic necrosis virus. J Fish Dis 1981;4(3):213–221. 27. de las Heras A, Perez-Prieto S, Rodríguez Saint-Jean S. In vitro and in vivo immune responses induced by a DNA vaccine encoding the VP2 gene of the infectious pancreatic necrosis virus. Fish Shellfish Immunol 2009;27(2):120-129. 28. Ingerslev HC, Fausa EP, Jakobsen RA, Petersen CB, Wergeland HI. Expression profiling and validation of reference gene candidates in immune relevant tissues and cells from Atlantic salmon (Salmo salar L.). Mol Immunology 2006;43(8):1194-1201. 29. Zar JH. Biostatistical analysis. 5th ed. New Jersey, USA: Prentice Hall; 2010. 30. Wolf K. Fish viruses and fish viral diseases. Ithaca, New York: Cornell University Press; 1988. 31. Smail DA, Bain N, Bruno DW, King JA, Thompson F, Pendrey DJ, Morrice S, Cunningham CO. Infectious pancreatic necrosis virus in Atlantic Salmon, Salmo salar L., post-smolts in the Shetland Isles, Scotland: virus identification, histopathology, 825


Rev Mex Cienc Pecu 2020;11(3):811-827

immunohistochemistry and genetic comparison with Scottish mainland isolates. J Fish Dis 2006;29(1):31–41. 32. Ortega C, Valladares B, Arguedas D, Vega F, Montes de Oca R, Murray A. Distribution of infectious pancreatic necrosis virus (IPNV) based on surveillance programs in freshwater trout farms of Mexico. J Aquat Anim Health 2016;28(1):21-26. 33. Barrera-Mejía M, Martínez S, Ortega C, Ulloa-Arvizu R. Genotyping of infectious pancreatic necrosis virus isolates from Mexico state. J Aquat Anim Health 2011;23(4):200-206. 34. Alonso MC, Cano I, Castro D, Perez-Prieto SI, Borrego JJ. Development of an in situ hybridization procedure for the detection of sole Aquabirnavirus in infected fish cell cultures. J Virol Meth 2004;116(2):133-138. 35. Akhlagi M, Hosseini A. First report on the detection of infectious pancreatic necrosis virus (IPNV) by RT-PCR in rainbow trout fry cultured in Iran. Bull Eur Ass Fish Pathol 2007;27(5):205-210. 36. Taksdal T, Ramstad A, Stangeland K, Dannevig BH. Induction of infectious pancreatic necrosis (IPN) in covertly infected Atlantic salmon Salmo salar L. post-smolts by stress exposure, by injection of IPN virus (IPNV) and by cohabitation. J Fish Dis 1998;21(3):193-204. 37. Suzuki S, Hosono N, Kusuda R. Detection of aquatic birnavirus gene from marine fish using a combination of reverse transcription and nested PCR. Mar Biotechnol 1997;5(4):205-209. 38. Taksdal T, Dannevig BH, Rimstad E. Detection of infectious pancreatic necrosis (IPN)-virus in experimentally infected Atlantic salmon parr by RT-PCR and cell culture isolation. Bull Eur Ass Fish Pathol 2001;21(5):214-219. 39. Ørpetveit I, Mikalsen AB, Sindre H, Evensen Ø, Dannevig BH, Midtlyng PJ. Detection of infectious pancreatic necrosis virus in subclinically infected Atlantic salmon by virus isolation in cell culture or real-time reverse transcriptase polymerase chain reaction: influence of sample preservation and storage. J Vet Diagn Invest 2010;22(6):886-895. 40. Gahlawat SK, Munro ES, Ellis AE. A non-destructive test for the detection of IPNV carriers in Atlantic halibut Hippoglossus hippoglossus (L.). J Fish Dis 2004;27(4):233239.

826


Rev Mex Cienc Pecu 2020;11(3):811-827

41. Rimstad E, Hornes E, Olsvik O, Hyllseth B. Identification of a double-stranded RNA virus by using polymerase chain reaction and magnetic separation of the synthesized DNA segments. J Clin Microbiol 1990;28(10):2275-2278. 42. Soliman H, Midtlyng PJ, El-Matbouli M. Sensitive and rapid detection of infectious pancreatic necrosis virus by reverse transcription loop mediated isothermal amplification. J Virol Methods 2009;158(1-2):77-83. 43. Imajoh M, Hirayama T, Oshima S. Frequent occurrence of apoptosis is not associated with pathogenic infectious pancreatic necrosis virus (IPNV) during persistent infection. Fish Shellfish Immunol 2005;18(2):163-177. 44. Santi N, Sandtrø A, Sindre H, Song H, Hong JR et al. Infectious pancreatic necrosis virus induces apoptosis in vitro and in vivo independent of VP5 expression. Virology 2005;342(1):13-25. 45. Shankar KM, Yamamoto T. Prevalence and pathogenicity of infectious pancreatic necrosis virus (IPNV) associated with feral lake trout, Salvelinus namaycush (Walbaum). J Fish Dis 1994;17(5):461-471.

827


https://doi.org/10.22319/rmcp.v11i3.5002 Artículo

Polimorfismos asociados con el número de lechones nacidos vivos en cerdas infectadas con el virus del PRRS en el sur de Sonora México

Carlos Martín Aguilar-Trejo a Guillermo Luna-Nevárez a Javier Rolando Reyna-Granados a Ricardo Zamorano-Algandar a Javier Alonso Romo-Rubio b Miguel Ángel Sánchez-Castro c R. Mark Enns c Scott E. Speidel c Milton G. Thomas c Pablo Luna-Nevárez a*

a

Instituto Tecnológico de Sonora, Departamento de Ciencias Agronómicas y Veterinarias, Calle 5 de Febrero # 818 Sur, Colonia Centro, Ciudad Obregón Sonora, México. b

Universidad Autónoma de Sinaloa, Facultad de Medicina Veterinaria y Zootecnia, Culiacán Sinaloa, México. c

Colorado State University, Department of Animal Sciences, Fort Collins Colorado, USA.

*Autor de orrespondencia: pluna@itson.edu.mx

828


Rev Mex Cienc Pecu 2020;11(3):828-847

Resumen: El síndrome reproductivo y respiratorio porcino (PRRS) es una enfermedad viral que afecta el comportamiento reproductivo de las cerdas generando severas pérdidas económicas. El objetivo del presente estudio fue identificar polimorfismos de nucleótido simple (SNP) asociados al número de lechones nacidos vivos al primer (LNV1) y segundo parto (LNV2) en cerdas reproductoras expuestas al virus del PRRS. El estudio incluyó 100 cerdas gestantes de la línea Landrace(¾)/Yorkshire(¼), de las cuales 75 fueron infectadas con el virus del PRRS y 25 permanecieron libres de PRRS. Muestras sanguíneas individuales (6 a 8 gotas) se depositaron en tarjetas FTA y posteriormente procesadas para la extracción de ADN, el cual fue genotipado usando un dispositivo para perfil genómico con 10,000 SNP. Los genotipos resultantes se analizaron usando un modelo mixto multi-locus, el cual detectó tres SNP asociados a LNV1 y cinco SNP asociados a LNV2 (P<0.001). Los ocho SNP fueron validados utilizando un modelo asociativo de efectos mixtos, que incluyó los términos genotipo y edad de la madre como efectos fijos, y el padre como efecto aleatorio. Los efectos de sustitución alélica se estimaron con el modelo anterior incluyendo el término genotipo como covariable. Los SNP rs81276080, rs81334603 y rs80947173 se asociaron a LNV1 (P<0.001), mientras que los SNP rs81364943, rs80859829, rs80895640, rs80893794 y rs81245908 se asociaron a LNV2 (P<0.001). Sólo dos SNP se ubican en regiones funcionales y el resto tiene posición intergénica. En conclusión, estos resultados sugieren la existencia de variantes génicas asociadas al desempeño reproductivo de cerdas infectadas por el virus del PRRS. Palabras clave: Alelos, Cerdas reproductoras, Genotipo, Lechones nacidos vivos, PRRS, SNP.

Recibido: 27/07/2018 Aceptado: 10/01/2020

Introducción El síndrome reproductivo y respiratorio porcino (PRRS) es una enfermedad de distribución mundial que genera pérdidas económicas en la industria porcina estimadas aproximadamente en $3.08 dólares americanos por cerdo al mercado(1).

829


Rev Mex Cienc Pecu 2020;11(3):828-847

El agente etiológico del PRRS es un virus ARN de cadena sencilla que pertenece al género Arterivirus, cuyas principales características son su elevada tasa de mutación, que le confiere una alta variabilidad antigénica, y su capacidad para inducir infecciones persistentes(2,3). El reporte inicial de la enfermedad del PRRS en México describió que las cerdas infectadas mostraban un cuadro de problema reproductivo y mortalidad en la línea de producción(4). La primer descripción clínica, epidemiológica y productiva de la enfermedad, así como el primer aislamiento del virus del PRRS, fueron reportados en los estados de México, Guanajuato, Veracruz y Puebla(5). La infección por el virus del PRRS se caracteriza por pobre conversión alimenticia que se traduce en bajos pesos de los cerdos en general, así como alteraciones en la fertilidad en hembras reproductoras tales como repetición del estro, mortalidad fetal, momificación, inducción de abortos y baja viabilidad de lechones al nacimiento(1). La vacunación es el método más común para el control del PRRS y a la fecha ha logrado prevenir en cierta medida la infección por PRRS. Sin embargo, la eficacia de las vacunas aún se encuentra lejos de ser universal, ya que el virus posee la habilidad para evadir la respuesta inmune del hospedador, y además, entre hospedadores existen diferencias de origen genético en su respuesta ante la presencia del virus(6,7). La vacunación puede tener cierta eficacia cuando se trata de cepas homólogas, pero al tratarse de cepas heterólogas su efectividad se reduce drásticamente. Por lo tanto, actualmente vacunar contra el virus del PRRS sólo garantiza una reducción en la duración de la viremia y del período de eliminación del virus, así como una disminución en el grado de presentación de signos y síntomas clínicos, pero no suprime la enfermedad(8). La existencia de variantes génicas asociadas a la interacción entre el virus del PRRS y su huésped, así como la evidencia de una variabilidad natural en la tolerancia y/o susceptibilidad al PRRS en las líneas porcinas comerciales, han abierto la puerta al uso de tecnologías moleculares como una valiosa herramienta para combatir la enfermedad del PRRS(9). Al respecto, la selección asistida por marcadores moleculares (SAM) puede emplearse para identificar, a través del estudio de genes candidatos, a aquellos animales que poseen una habilidad genética superior para la expresión de caracteres de importancia económica, entre los cuales se incluye la resistencia o tolerancia a enfermedades(10). Los primeros ejemplos de la aplicación de estas tecnologías en cerdos fueron la selección en contra del gen del halothano, y la identificación de una asociación significativa entre el gen del receptor del estrógeno y el número de lechones nacidos vivos(11). Sin embargo, el desarrollo actual de sistemas de cómputo más robustos ha facilitado la selección genómica completa, la cual involucra el uso extensivo de marcadores moleculares que cubren la totalidad del genoma, de tal manera que cientos de miles de variantes moleculares pueden ser estudiadas al mismo tiempo a fin de explicar la variación genética de una característica fenotípica(12). Este método permite realizar estudios asociativos que incluyen el análisis de una gran cantidad de 830


Rev Mex Cienc Pecu 2020;11(3):828-847

marcadores en forma simultánea a través del uso de dispositivos de baja (10k=10,000 SNP) o alta densidad (50k=50,000 a 60k=60,000 SNP). Diversas investigaciones se han realizado en cerdos con el fin de identificar regiones en el ADN relacionadas con rasgos de interés económico, entre los cuales se encuentra la resistencia al virus del PRRS(13,14,15). Reportes iniciales sugirieron la existencia de base genética asociada a la enfermedad del PRRS. Al respecto, cerdos de la raza Hampshire infectados con PRRS mostraron lesiones pulmonares más graves que cerdos de las razas Duroc y Meishan(16). Por otra parte, cerdos de la línea sintética Large White-Landrace mostraron una menor temperatura rectal y una reducción en la viremia después de ser infectados con el virus del PRRS, en comparación con cerdos de la línea sintética HampshireDuroc(17). Recientemente, se reportó una región génica dentro del cromosoma 4 asociada a la resistencia al virus del PRRS, lo cual evidenció la existencia de un fuerte componente genético asociado a esta habilidad(3). Sin embargo, actualmente es escasa la información reportada sobre genes y variantes génicas relacionadas a las diferencias fenotípicas observadas en la eficiencia reproductiva de hembras infectadas con el virus del PRRS. Por lo tanto, el análisis de la base genética de la respuesta reproductiva de dichas hembras, podría conducir a la identificación de marcadores genéticos asociados a un adecuado comportamiento reproductivo, lo cual sería de gran utilidad para la implementación de programas más eficientes de selección, que incluyan cerdas con habilidad genética superior para tolerar y/o resistir la infección del virus del PRRS. En base a lo anterior, el objetivo del presente estudio fue identificar polimorfismos de nucleótido simple asociados al número de lechones nacidos vivos al primer (LNV1) y segundo parto (LNV2) en cerdas reproductoras infectadas con el virus del PRRS.

Material y métodos Sitio y unidades experimentales

El presente estudio se realizó en una granja porcina comercial de ciclo completo ubicada en el valle del Yaqui, Sonora, México (LN: 27°17’, LO: 109°56’). Se utilizaron 100 cerdas reproductoras de la línea comercial Landrace(¾)/Yorkshire(/¼), de 12 meses de edad y libres de la enfermedad del PRRS.

831


Rev Mex Cienc Pecu 2020;11(3):828-847

Manejo sanitario y reproductivo

A los 15 días posteriores a su ingreso al área de pie de cría, 75 cerdas resultaron infectadas en forma natural por el virus del PRRS (positivas; n= 75), debido a que, aunque la granja era seronegativa a PRRS, ésta se encuentra ubicada en una región endémica afectada por diversas cepas de linaje norteamericano (PRRSV NA). Por otra parte, un grupo control negativo integrado por 25 hembras se mantuvo libre de la infección del PRRS (control; n= 25). Lo anterior fue confirmado por pruebas serológicas y moleculares realizadas desde el inicio y hasta el final del experimento. Dentro del área de pie de cría, las hembras iniciaron su manejo reproductivo que consistió en proporcionarles dos servicios con verracos de fertilidad probada después de ser observadas en estro. Una vez confirmadas como gestantes, las cerdas fueron trasladadas al área de gestación y permanecieron ahí hasta el día previo a su parto, momento en el cual fueron movilizadas al área de maternidad. Inmediatamente después del parto se contabilizó el número de lechones nacidos totales, nacidos vivos y nacidos muertos; los datos resultantes fueron registrados dentro del programa de cómputo PigWIN®. El mismo manejo reproductivo y registro de información antes descrito se repitió para la segunda cubrición de cada hembra y su parto correspondiente.

Análisis de laboratorio

Muestras de sangre fueron colectadas en forma individual por punción de la vena auricular a los días 7, 30, 120 y 240 posteriores al ingreso de las hembras al área de pie de cría, para la determinación sérica de los títulos de anticuerpos específicos contra el virus del PRRS usando la herramienta diagnóstica “ELISA-IDEXX” (Enzyme Linked Immunoassay, Lab Inc.). El aislamiento de ARN viral se realizó a partir del suero sanguíneo mediante un sistema de extracción automática de ácidos nucleicos por separación magnética (TACO System, Gene Reach Biotechnology Corporation). Con las muestras de ARN purificadas se realizó el análisis de PCR en tiempo real utilizando un Kit comercial (Tetracore Nextgen Real-Time QT-PCR), el cual reconoce un segmento del ORF 7 del virus del PRRS y cuyos resultados se reportan como número de copias de ARN del virus del PRRS por mL de muestra (Cepheid Smart Cycler V2.0d).

832


Rev Mex Cienc Pecu 2020;11(3):828-847

Estudio asociativo del genoma completo

Se obtuvo una muestra adicional de sangre (0.5 ml) de cada hembra la cual fue colocada en tarjetas FTA para recolección de ácidos nucleicos. Las tarjetas se almacenaron a 25°C y posteriormente fueron enviadas al Laboratorio Neogen donde se realizó la extracción, purificación y cuantificación del ADN para cada una de las hembras muestreadas. El ADN fue sometido a un proceso de genotipado utilizando un dispositivo de perfil genómico de baja densidad (Low Density Porcine BeadChip, Neogen®, Lincoln, NE) con capacidad para análisis de 10,000 polimorfismos de nucleótido simple (SNP). Una vez obtenidos los resultados, se utilizó el software PLINK (V1.07)(18) para el análisis de calidad y depuración de genotipos que consistió en la remoción de los SNP con tasa de genotipado por debajo del 90 %, frecuencia del alelo menor inferior al 5 % y tasa de error Mendeliano superior a 0.1. Al finalizar el estudio de calidad, un total de 8,826 SNP resultaron útiles e informativos para el estudio asociativo de genoma completo. Para ello, un modelo mixto multi-locus fue construido con el fin de identificar SNP asociados a los caracteres reproductivos de LNV1 y LNV2 utilizando el programa Golden Helix SVS 7 (Golden Helix Inc., Bozeman, Montana, USA). Al procesar el modelo asociativo antes mencionado, se utilizó el procedimiento “stepwise” para identificar los SNP significativos como covariables de efectos fijos. Además, el modelo permitió la utilización de una matriz de relaciones genómicas estimada a partir de los genotipos disponibles (SNP) para cada animal. Se consideró a los SNP como asociados a los fenotipos de interés a un α=0.001, y todos aquellos que resultaron significativos (P<0.001) fueron retenidos para su análisis de validación.

Análisis estadístico

Las estadísticas descriptivas para las variables de lechones nacidos totales, nacidos vivos y nacidos muertos se calcularon con el procedimiento MEANS del paquete estadístico SAS versión 9.4 (SAS Inst. Inc., Cary, NC). Un análisis de varianza fue utilizado para determinar si las variables antes mencionadas diferían entre hembras positivas y hembras negativas al PRRS (P<0.05), usando el procedimiento PROC GLM. Las pruebas de normalidad e igualdad de varianza fueron realizadas usando el procedimiento UNIVARIATE(19).

833


Rev Mex Cienc Pecu 2020;11(3):828-847

Validación de marcadores genéticos asociados a LNV1 y LNV2

El cálculo de las frecuencias alélicas y genotípicas, así como la prueba Ji-cuadrada (X2) para verificar posibles desviaciones del equilibrio Hardy-Weinberg, fueron desarrollados usando el procedimiento ALLELE(20). Los SNP que resultaron asociados (P<0.001) a los caracteres de LNV1 y LNV2, y que cumplieron con los criterios de frecuencia del alelo menor superior al 10 % (FAM>0.10) y no-desviación del equilibrio Hardy-Weinberg (X2>0.05), fueron sometidos a un análisis de validación a través de un estudio asociativo entre genotipo y fenotipo, empleando el procedimiento MIXED para variables de distribución continua. Dicho análisis de validación individual para cada SNP se efectuó a través de un modelo de efectos mixtos, el cual incluyó los efectos fijos del genotipo del polimorfismo y la edad de la madre, el efecto aleatorio del semental (ej. usando la estadística Z para probar si Ho:δw2=0), y el efecto residual (media=cero, varianza= δe2). Las comparaciones entre medias para los genotipos de los SNP asociados con las variables de LNV1 y LNV2 fueron obtenidas utilizando la opción PDIFF del procedimiento LSMEANS, incluyendo el ajuste Bonferroni, siempre y cuando el término genotipo del SNP resultó ser fuente de variación (P<0.05) en el análisis asociativo. Los efectos de sustitución alélica fueron estimados a través del modelo de efectos mixtos descrito previamente, el cual para este análisis incluyó el término genotipo como covariable(21).

Resultados Variables asociadas al PRRS

En el Cuadro 1 se muestran las estadísticas descriptivas de los caracteres reproductivos en estudio, así como de variables referentes a la viabilidad de los lechones al nacimiento y al destete. Los valores promedio para las variables de lechones nacidos totales y nacidos vivos al primer y segundo partos fueron significativamente (P<0.01) menores para hembras positivas a PRRS, en comparación con hembras negativas (testigo), mientras que el efecto opuesto fue observado para la variable de lechones nacidos muertos, lo cual sugiere que dichas variables están asociadas a la infección del virus del PRRS en el presente estudio.

834


Rev Mex Cienc Pecu 2020;11(3):828-847

Cuadro 1: Valores promedio ± EE para variables reproductivas y de viabilidad asociadas al primer y segundo parto en cerdas reproductoras positivas y negativas al PRRS Positivos a PRRS Negativos a PRRS Carácter N Media ± EE N Media ± EE Primer parto 25 12.65 ± 3.56b Lechones nacidos totales 75 11.24 ± 3.12a Lechones nacidos vivos 75 10.17 ± 3.27a 25 11.48 ± 3.59b Lechones nacidos muertos 75 1.16 ± 1.01a 25 0.91 ± 1.02b Número de lechones destetados 75 10.03 ± 3.02 25 10.96 ± 3.04 Peso total destetados (kg) 75 56.67 ± 13.05 25 67.84 ± 13.01 Peso promedio destetados (kg) 75 5.65 ± 0.86 25 6.19 ± 0.85 Segundo parto 75 25 11.92 ± 3.10b Lechones nacidos totales 10.67 ± 3.02a Lechones nacidos vivos Lechones nacidos muertos Número de lechones destetados Peso total destetados (kg) Peso promedio destetados (kg)

75 75 75 75 75

9.85 ± 3.25a 0.94 ± 1.02a 9.76 ± 1.64 48.89 ± 14.62 5.01 ± 0.84

25 25 25 25 25

10.75 ± 3.59b 0.75 ± 1.03b 10.92 ± 1.79 59.76 ± 14.51 5.47 ± 0.81

Estudio asociativo del genoma completo

Un total de 8,856 SNP cumplieron con los criterios de calidad para ser incluidos en el análisis genómico asociativo, el cual detectó regiones genómicas asociadas a LNV1 (cromosomas 6 y 7; Figura 1) y a LNV2 (cromosomas 2, 5, 7 y 8; Figura 2), las cuales explican el 3.6 y el 4.1% de la varianza asociada a los caracteres de LNV1 y LNV2, respectivamente. El análisis genómico individual detectó tres SNP asociados a la variable de LNV1 (P<0.001) y cinco SNP asociados a la variable de LNV2 (P<0.001). Sólo dos de los ocho SNP antes mencionados se encuentran ubicados dentro de regiones génicas funcionales (intrones), el rs81276080 dentro del gen TTR (Transthyretin) y el rs80893794 dentro del gen CWH43 (Cell wall biogenesis 43 C-terminal homolog). El registro de los ocho SNP detectados como asociados a los caracteres de LNV1 y LNV2, así como los genes y procesos biológicos relacionados con dichos SNP, se muestran en el Cuadro 2.

835


Rev Mex Cienc Pecu 2020;11(3):828-847

Figura 1: Grรกfica Manhattan que muestra la ubicaciรณn de los SNP asociados a la variable de LNV1 (umbral de significancia fijado a P<0.001)

Figura 2: Grรกfica Manhattan que muestra la ubicaciรณn de los SNP asociados con la variable LNV2. (umbral de significancia fijado a P<0.001)

836


Rev Mex Cienc Pecu 2020;11(3):828-847

Cuadro 2: Genes y procesos biológicos relacionados con los SNP asociados a las variables de LNV1 y LNV2 en cerdas reproductoras positivas y negativas al PRRS Variable SNP Variante Gen asociado Proceso asociado LNV1

LNV2

rs81276080

Intrón

TTR

Activación hormonal

rs81334603

Intergénica

KCNQ4

Transmisión neuronal

CTPS1

Respuesta inmune

rs80947173

Intergénica

FLRT2

Desarrollo neuronal

rs81364943

Intergénica

ISOC1

Ovogénesis

ADAMTS19

Activación enzimática

IRAK4

Respuesta inmune

ADAMTS20

Activación enzimática

rs80859829

Intergénica

rs80895640

Intergénica

CD83

Respuesta inmune

rs80893794

Intrón

CWH43

Activación celular

rs81245908

Intergénica

FAT4

Transmisión neuronal

LNV1= lechones nacidos vivos en el 1er. parto; LNV2= lechones nacidos vivos en el 2do. parto.

Validación de marcadores genéticos

Los ocho SNP identificados por su asociación con las variables reproductivas de LNV1 y LNV2, cumplieron con los criterios de no-desviación del equilibrio Hardy-Weinberg (X2=1.0, P>0.28) y de frecuencia del alelo menor superior al 10% (FMA>0.10; Cuadro 3), por lo que fueron considerados como genes candidatos en el presente estudio. Tres de estos SNP fueron validados como predictores de LNV1 (P<0.001) y cinco como predictores de LNV2 (P<0.001). El Cuadro 4 muestra las medias de cuadrados mínimos para los genotipos de cada uno de los SNP asociados a las variables de LNV1 y LNV2. Los SNP más favorables fueron rs81334603 y rs81364943 ya que mostraron los valores más altos para LNV1 (GG= 13.47 ± 1.11) y LNV2 (TT= 16.30 ± 3.01), respectivamente; mientras que los SNP menos favorables fueron rs81276080 y rs80859829 ya que mostraron los valores más bajos para LNV1 (GG= 7.59 ± 0.61) y LNV2 (CC= 5.94 ± 0.78), respectivamente. Sin embargo, cada uno de los ocho SNP validados en el presente estudio mostró un genotipo asociado favorablemente a los caracteres reproductivos analizados.

837


Rev Mex Cienc Pecu 2020;11(3):828-847

Cuadro 3: Frecuencias alélicas y genotípicas de los SNP asociados a LNV1 y LNV2 en cerdas reproductoras positivas y negativas al PRRS Frecuencias Frecuencias SNP Posición Variable alélicas genotípicas G LNV1

rs81276080

SSA 6

0.1878 A

rs81334603

SSA 6

0.3867 A

rs80947173

SSA 7

0.7431 C

LNV2

T 0.8122 G 0.6133 C 0.2569 T

GG

GT

0.0352 0.3052 AA

AG

0.1467 0.4800 AA

AC

0.5556 0.3750 CC

CT

TT 0.6596 GG 0.3733 CC 0.0694 TT

rs81364943

SSA 2

0.8266

0.1734

0.6800 0.2933

0. 026

rs80859829

SSA 5

0.3133

0.6867

0.0533 0.5200

0.4267

rs80895640

SSA 7

0.3379

0.6621

0.1622 0.3514

0.4865

rs80893794

SSA 8

0.3099

0.6901

0.1268 0.3662

0.5070

A rs81245908

SSA 8

0.3000

G 0.7000

AA

AG

0.0667 0.4667

GG 0.4667

LNV1 = lechones nacidos vivos en el 1er. parto; LNV2= lechones nacidos vivos en el 2do. parto.

Cuadro 4: Medias de cuadrados mínimos ± EE para los genotipos de los SNP asociados a las variables de LNV1 y LNV2 en cerdas reproductoras positivas y negativas al PRRS Variable SNP No Medias por genotipo ± EE Prob

LNV1

LNV2

rs81276080

100

rs81334603

100

rs80947173

100

rs81364943

100

rs80859829

100

TT 12.33±1.16a GG 13.47±1.11a AA 12.59±1.48a TT 16.30±3.01a TT 12.21±3.04a TT

838

TG 8.04±1.08b AG 10.51±0.75b AC 9.81±0.94b TC 12.94±0.95a TC 8.75±0.69 b TC

GG 7.59±0.61b AA 8.56±0.77b CC 8.31±0.68b CC 9.23±0.62b CC 5.94±0.78b CC

.0001 .0001 .0001 .0001 .0001


Rev Mex Cienc Pecu 2020;11(3):828-847

rs80895640

100

rs80893794

100

rs81245908

100

11.88±1.06a CC 13.42±1.07a GG 12.25±2.08a

9.61±0.91b TC 10.08±0.74b GA 8.57±0.74b

8.11±0.85b TT 7.95±0.84c AA 7.50±0.75b

.0001 .0001 .0001

LNV = lechones nacidos vivos en el 1er. parto; LNV2= lechones nacidos vivos en el 2do. parto.

Los efectos de substitución alélica para cada SNP se muestran en el Cuadro 5. Los alelos favorables de los SNP rs81276080, rs81334603 y rs80947173 asociados a LNV1, fueron T, G y A, ya que elevan en 3.28 ± 0.74, 3.52 ± 0.62 y 2.35 ± 0.68 el número de LNV1, respectivamente (P<0.005). Por otra parte, para los SNP rs81364943, rs80859829, rs80895640, rs80893794 y rs81245908 asociados a LNV2, los alelos favorables fueron T, T, T, C y G, ya que incrementan en 3.66 ± 0.85, 3.38 ± 0.82, 1.92 ± 0.58, 2.64 ± 0.61 y 3.18 ± 0.77 el número de LNV2, respectivamente (P<0.005). Los valores antes descritos indican una contribución favorable de los ocho SNP sobre los caracteres reproductivos evaluados en las cerdas incluidas en el estudio. Cuadro 5: Efectos de sustitución alélica para SNP asociados a las variables de LNV1 y LNV2 en cerdas reproductoras positivas y negativas al PRRS Efectos de substitución alélica Variable

SNP

LNV1

LNV2

rs81276080

Alelo favorable T

rs81334603

Prob 0.0005

Valor estimado 3.28

EE 0.7476

G

0.0002

3.52

0.6227

rs80947173

A

0.0013

2.35

0.6870

rs81364943

T

0.0001

3.66

0.8525

rs80859829

T

0.0002

3.38

0.8201

rs80895640

T

0.0022

1.92

0.5893

rs80893794

C

0.0001

2.64

0.6162

rs81245908

G

0.0002

3.18

0.7732

LNV = lechones nacidos vivos en el 1er. parto; LNV2= lechones nacidos vivos en el 2do. parto.

Discusión El efecto negativo de la infección por el virus del PRRS sobre el número de lechones nacidos vivos observado en el presente estudio ha sido previamente reportado en cerdas de diferentes 839


Rev Mex Cienc Pecu 2020;11(3):828-847

paridades(22,23). En un estudio similar realizado en cerdas infectadas con el virus del PRRS que fueron comparadas con cerdas sanas, se observó un incremento en los valores promedio de cerdos momificados y no-nacidos de 0.04 a 1.13 y 0.63 a 1.02, respectivamente, así como una reducción en el número de cerdos nacidos vivos de 10.3 a 9.8(24). Por otra parte, la existencia de variabilidad genética asociada al desempeño reproductivo de cerdas infectadas con el virus del PRRS también ha sido descrita en previas investigaciones. Al respecto, Rashidi et al(15) reportaron una variación de 3.83 ± 0.31 en el número de lechones nacidos vivos en cerdas infectadas con el virus del PRRS, en comparación con una variación de 1.96 ± 0.06 en el número de lechones nacidos vivos en cerdas sanas. La variabilidad antes mencionada, principalmente en las cerdas infectadas con PRRS, sugiere la existencia de una base genética asociada a la respuesta reproductiva ante la enfermedad. Por lo anterior, se ha señalado que una estrategia interesante para reducir el impacto negativo del PRRS en hembras reproductoras, es la identificación de marcadores moleculares que permitan un mejor entendimiento del control genético de la respuesta al virus, para eventualmente utilizarlos en la implementación de programas de selección asistida por marcadores (SAM)(25).. En el presente estudio, el análisis del genoma completo identificó regiones genómicas y un total de ocho SNP asociados a las variables de LNV1 y LNV2 (P<0.001) en cerdas reproductoras infectadas y no infectadas con el virus del PRRS. Dichos SNP mostraron una frecuencia del alelo menor superior al 10%, lo cual en términos generales es considerado como un requisito para evitar resultados falsos en estudios asociativos entre genotipo y fenotipo(26). En el análisis estadístico individual, los ocho SNP identificados fueron validados como predictores de las variables LNV1 y LNV2, y de los cuales sólo dos de ellos se encuentran dentro de regiones funcionales. Por una parte, el SNP rs81276080 (asociado a LNV1) se localiza en la región 5’ del gen TTR (Transthyretin), el cual codifica la síntesis de una proteína transportadora de hormonas tiroideas en plasma y fluido cerebroespinal. El TTR ha sido propuesto como un potencial gen candidato asociado a la respuesta fisiológica de cerdos sometidos a estrés por calor, el cual limita seriamente la capacidad reproductiva(27), ya que disminuye la calidad de los ovocitos y la viabilidad embrionaria, intensificando los efectos negativos del PRRS sobre la fertilidad de cerdas infectadas. Por otra parte, el SNP rs80893794 (asociado a LNV2) se localiza en una región intrónica del gen CWH43 (Cell wall biogenesis 43 C-terminal homolog). El gen CWH43 está involucrado en la remodelación de lípidos de la pared celular de las levaduras(28) y se ha reportado que dicho gen es homólogo al PGAP2 (Post-GPI attachment to proteins), el cual está implicado en los ciclos de deacetilación y re-acetilación de las proteínas que sintetizan Phosphatidyl Inositol (PI) en las células mamíferas(29). El PI es una familia de lípidos que participan en el mecanismo de segundo mensajero en la membrana celular, y que es empleado por diversas hormonas, entre 840


Rev Mex Cienc Pecu 2020;11(3):828-847

ellas la PGF2α, la cual juega un papel importante en la función ovárica y actividad uterina, y por lo tanto influye directamente en las variables de LNV1 y LNV2. Los restantes seis SNP se localizan en regiones intergénicas (posicionales). Al respecto, es importante puntualizar que, al explorar el genoma completo, resulta complicado detectar una variante causal o directamente responsable de los cambios fenotípicos en las poblaciones; sin embargo, debido a la propiedad del desequilibrio de ligamiento en el genoma, es posible detectar asociaciones indirectas entre diversos SNP y los fenotipos de interés. Lo anterior sustenta la importancia de tomar en cuenta genes con ubicación cromosómica cercana a aquellos SNP que resulten significativos y que tienen posiciones intergénicas (cuando menos en un rango de 100 mil pares de bases; 100 kbp)(30). Uno de estos SNP es el rs81334603 asociado a LNV1, mismo que se ubica a una distancia de 40.26 kbp del gen KCNQ4 (Potassium voltage-gated channel subfamily Q member 4). La expresión de este gen se encuentra disminuida en ganglios linfáticos traqueobronquiales de cerdos infectados con la cepa norteamericana VR-2332 del virus del PRRS(31). Además, aproximadamente a 72.77 kbp del SNP rs81334603 se localiza el gen CTPS1 (CTP Synthase 1), el cual codifica para la producción de la enzima CTP sintetasa encargada de la biosíntesis de nucleótidos de pirimidinas (UTP y CTP), así como también para la síntesis de ciclopentenilcitosina, un agente antiviral de amplio espectro(32). En lo que respecta al SNP rs80947173, también asociado a LNV1, el gen más cercano a su ubicación es FLRT2 (fibronectin leucine rich transmembrane protein 2) localizado a 889.05 kbp de distancia. Si bien es cierto que este gen se encuentra considerablemente alejado del SNP antes mencionado, niveles útiles de desequilibrio de ligamiento (>0.3) parecen extenderse a distancias mayores en cerdos que en ganado Holstein, lo que implica que paneles de SNP menos densos aún pueden brindar resultados confiables en estudios asociativos de genoma completo(33). Por su parte, se ha reportado que el gen FLRT2 se encuentra asociado al número de lechones nacidos vivos en poblaciones de cerdos Large White y Landrance(34). En el caso de los SNP asociados a LNV2, uno de ellos es el rs81364943, ubicado a 88.72 kbp de distancia del gen ISOC1 (isochorismatase domain containing 1) y a 178.67 kbp del gen ADAMTS19 (ADAM metallopeptidase with thrombospondin type 1 motif 19). El gen ISOC1 ha sido vinculado a procesos de actividad catalítica en ovocitos porcinos mediante un estudio de co-expresión genética(35), mientras que polimorfismos del gen ADAMTS19 en mujeres, se han relacionado con la presencia del síndrome de ovarios poliquísticos(36). Otro de los SNP asociados a LNV2 fue rs80859829, el cual se posiciona a 31.75 y 177.73 kbp de los genes ADAMTS20 (ADAM metallopeptidase with thrombospondin type 1 motif 20) e IRAK4 (interleukin 1 receptor associated kinase 4), respectivamente. La posible explicación de la asociación de este polimorfismo con el desempeño reproductivo al parto de cerdas reproductoras infectadas con PRRS, se atribuye a que el gen ADAMTS20 se expresa en alto grado en órganos como el cerebro y las gónadas(37), mismos que resultan afectados 841


Rev Mex Cienc Pecu 2020;11(3):828-847

tras la infección por el virus del PRRS(38). Del mismo modo, la quinasa asociada al receptor de interleucina-1 (producto proteico del gen IRAK4), se ha visto involucrada en los mecanismos de replicación viral del PRRS, puesto que su producción se limita o disminuye a causa de la acción de un conocido micro RNA (miRNA-373) con efectos provirales(39). El SNP rs80895640 también asociado a LNV2, se encuentra a 34.3 kbp del gen CD83 (CD83 molecule); este gen, ha sido previamente vinculado con el número de lechones nacidos totales y el número de lechones nacidos vivos en cerdos híbridos Ibérico X Meishan(40,41). De manera interesante, dentro del contexto inmunológico, la molécula CD83 ha sido recientemente señalada como una pieza clave del mecanismo de escape ante el sistema inmune que utiliza el virus del PRRS, ya que éste es capaz de regular positivamente la expresión en forma soluble de la molécula CD83 (sCD83), la cual se encuentra asociada a la inmunosupresión de la proliferación de células T en el hospedador(42). Similarmente, a 54.05 kbp del SNP rs80895640, se ubica el gen RNF182 (Ring finger protein 182), mismo que está involucrado en procesos de apoptosis neuronal(43) que ocurren comúnmente tras la infección de cepas altamente infecciosas del virus del PRRS(44). Finalmente, el SNP rs81245908 (asociado a LNV2) se encuentra a una distancia aproximada de 53.52 kbp del gen FAT4 (FAT atypical cadherin 4). La asociación de este polimorfismo podría explicarse a partir de un estudio que brinda evidencia de que la expresión del gen FAT4 en humanos ha sido identificada en el tejido cerebral fetal y en el cerebro de infantes(45), mientras que por otra parte, se ha comprobado que la infección materna por PRRS puede afectar el desarrollo neuronal en los lechones, reduciendo el número de neuronas del hipocampo y aumentando el número de glías(46).

Conclusiones e implicaciones La detección de regiones genómicas que explican el 3.6 y 4.1% de la variación asociada a las variables de lechones nacidos vivos al primer y segundo parto, así como la validación de ocho SNP localizados dentro de dichas regiones, sugieren la existencia de una base genética que sustenta la respuesta reproductiva de cerdas reproductoras infectadas con el virus del PRRS. Por lo tanto, se propone que los ocho SNP asociados con las variables de LNV1 y LNV2, dos funcionales y seis posicionales, sean considerados como marcadores genéticos en programas de selección enfocados a mejorar la eficiencia reproductiva de cerdas infectadas con el virus del PRRS. Se sugiere realizar estudios adicionales para evaluar la funcionalidad de los SNP detectados; asimismo, se considera importante validar las regiones genómicas y los genes reportados en el presente estudio, en poblaciones de cerdas infectadas con el virus del PRRS pero de diferente raza.

842


Rev Mex Cienc Pecu 2020;11(3):828-847

Agradecimientos Al Laboratorio de Diagnóstico ITSON-UGRPS; Laboratorio de Biotecnología Reproductiva ITSON; Unión Ganadera de Porcicultores del Estado de Sonora; Departamento de Ciencia Animal de la Universidad Estatal de Colorado (CSU), Facultad de MVZ de Universidad Autónoma de Sinaloa; y Consejo Nacional de Ciencia y Tecnología (Becario 279847/302410).

Literatura citada: 1. Holtkamp DJ, Kliebenstein JB, Neumann EJ, Zimmerman JJ, Rotto HF, Yoder TK, et al. Assessment of the economic impact of porcine reproductive and respiratory syndrome virus on United States pork producers. J Swine Health Prod 2013;21(2):72–84. 2. Lunney JK, Steibel JP, Reecy JM, Fritz E, Rothschild MF. Probing genetic control of swine responses to PRRSV infection: current progress of the PRRS host genetics consortium. BMC Proceedings 2011;5(4):S30. 3. Boddicker N, Waide EH, Rowland RRR, Lunney JK, Garrick DJ, Reecy JM, et al. Evidence for a major QTL associated with hot response to Porcine Reproductive and Respiratory virus syndrome challenge. J Anim Sci 2012;90(6):1733-1746. 4. Milian-Suazo F, Canto-Alarcón GJ, Weimersheimer-Rubí JE, Coba-Ayala MA, CorreaGirón P, Anaya-Escalera AM. Estudio seroepidemiológico para determinar la presencia de anticuerpos contra el virus del Síndrome Disgenésico y Respiratorio del Cerdo en México. Tec Pecu Mex 1994;32(3):139-144. 5. Ramírez R, Sierra N, Mota D. Aislamiento del virus de PRRS en México: Estudio clínico, serológico y virológico. Arch Med 2000;32(1):1-9. 6. Lewis CR, Ait-Ali T, Clapperton M, Archibald AL, Bishop, S. Genetic perspectives on host responses to porcine reproductive and respiratory syndrome (PRRS). Viral Immunol 2007;20(3):343-358. 7. Mateu E, Diaz I. The challenge of PRRS immunology. Vet J 2008;177(3):345-351. 8. Royaee AR, Husmann RJ, Dawson HD, Calzadanova G, Schnitzlein WM, Zuckermann A. Deciphering the involvement of innate immune factors in the development of the host response to PRRSV vaccination. Vet Immunol Immunopathol 2004;102(3):199-216. 9. Reiner G. Genetic resistance - an alternative for controlling PRRS?. Porcine Health Manag 2016;2(27):1-11. 843


Rev Mex Cienc Pecu 2020;11(3):828-847

10. Georges M. Mapping, fine mapping, and molecular dissection of quantitative trait loci in domestic animals. Annu Rev Genomics Hum Genet 2007;8:131-162. 11. Muñoz G, Ovilo C, Estellé J, Fernández A, Rodríguez C. Association with litter size of new polymorphisms on ESR1 and ESR2 genes in a Chinese-European pig line. Genet Sel Evol 2007;39(2):195-206. 12. Goddard ME, Hayes BJ. Genomic selection. J. Anim. Breed. Genet 2007;124(6):323330. 13. Long Y, Ruan GR, Su Y, Xiao SJ, Zhan ZY, Ren J, et al. Genome-wide association study identifies QTLs for EBV of backfat thickness and average daily gain in Duroc pigs. Genetika 2015;51(3):371-378. 14. Abella G, Pena R, Nogareda C, Armengol R, Vidal A, Moradell L, et al. A WUR SNP is associated with European Porcine Reproductive and Respiratory Virus Syndrome resistance and growth performance in pigs. Res Vet Sci 2016;104:117–122. 15. Rashidi H, Mulder HA, Mathur P, van Arendonk JAM, Knol EF. Variation among sows in response to porcine reproductive and respiratory syndrome. J Anim Sci 2014;92(1):95–105. 16. Halbur PG, Rothschild MF, Thacker BJ, Meng X-J. Paul PS, Bruna JD. Differences in susceptibility of Duroc, Hampshire, and Meishan pigs to infection with a high virulence strain (VR2385) of porcine reproductive and respiratory syndrome virus (PRRSV). J Anim Breed Genet 1998;115:181–189. 17. Petry DB, Holl JW, Weber JS, Doster AR, Osorio FA, Johnson RK. Biological responses to porcine respiratory and reproductive syndrome virus in pigs of two genetic populations. J Anim Sci 2007;83(7):1494–1502. 18. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, Bender D, et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 2007;81(3):559–575. 19. Littell, R, Stroup W, Freund R. SAS for linear models. 4th ed. SAS Institute Inc., Cary, NC. 2002. 20. Saxton AM, Balzarini MG, Cappio-Borlino A, Czika W, Fry JD, Gibson G, et al. Genetic analysis of complex traits using SAS. SAS Institute, Inc., North Carolina; 2004. 21. Sherman EL, Nkrumah JD, Murdoch BM, Li C, Wang Z, Fu A, et al. Polymorphisms and haplotypes in the bovine neuropeptide Y, growth hormone receptor, ghrelin, insulin–like growth factor 2, and uncoupling proteins 2 and 3 genes and their

844


Rev Mex Cienc Pecu 2020;11(3):828-847

associations with measures of growth, performance, feed efficiency, and carcass merit in beef cattle. J Anim Sci 2008;86(1):11–16. 22. Lewis CRG, Torremorell M, Bishop SC. Effects of porcine reproductive and respiratory syndrome virus infection on the performance of commercial sows and gilts of different parities and genetic lines. J Swine Health Prod 2009;17(3):140–147. 23. Lewis CRG, Torremorell M, Galina-Pantoja L, Bishop SC. Genetic parameters for performance traits in commercial sows estimated before and after an outbreak of porcine reproductive and respiratory syndrome. J Anim Sci 2009;87(3):876–884. 24. Lewis CR, Ait-Ali T, Clapperton M, Archibald AL, Bishop S. Genetic perspectives on host responses to porcine reproductive and respiratory syndrome (PRRS). Viral Immunol 2007;20(3):343-358. 25. Serão NV, Matika O, Kemp RA, Harding JC, Bishop SC, Plastow GS, et al. Genetic analysis of reproductive traits and antibody response in a PRRS outbreak herd. J Anim Sci 2014;92(7):2905–2921. 26. Balding DJ. A tutorial on statistical methods for population association studies. Nat Reviews 2006;7(10):781–791. 27. Seibert JT, Graves KL, Hale BJ, Keating AF, Baumgard LH, Ross JW. Characterizing the acute heat stress response in gilts: I. Thermoregulatory and production variables. J Anim Sci 2018;3(96):941-949. 28. Umemura M, Fujita M, Yoko-O T, Fukamizu A, Jigami Y. Saccharomyces cerevisiae CWH43 is involved in the remodeling of the lipid moiety of GPI anchors to ceramides. Mol Biol Cel. 2007;18(11):4304-4316. 29. Ghugtyal V, Vionnet C, Roubaty C, Conzelmann A. CWH43 is required for the introduction of ceramides into GPI anchors in Saccharomyces cerevisiae. 2007;65(6):1493-1502. 30. Abo-Ismail MK, Brito LF, Miller SP, Sargolzaei M, Grossi DA, Moore SS, et al. Genome-wide association studies and genomic prediction of breeding values for calving performance and body conformation traits in Holstein cattle. Genet Sel Evol 2017;49(1):49–82. 31. Miller LC, Fleming D, Arbogast A, Bayles DO, Guo B, Lager KM, et al. Analysis of the swine tracheobronchial lymph node transcriptomic response to infection with a Chinese highly pathogenic strain of porcine reproductive and respiratory syndrome virus. BMC Vet Res 2012;8(1):208.

845


Rev Mex Cienc Pecu 2020;11(3):828-847

32. De Clercq E, Murase J, Marquez VE. Broad-spectrum antiviral and cytocidal activity of cyclopentenylcytosine, a carbocyclic nucleoside targeted at CTP synthetase. Biochem Pharmacol 1991;41(12):1821–1829. 33. Veroneze R, Bastiaansen JW, Knol EF, Guimarães SE, Silva FF, Harlizius B, et al. Linkage disequilibrium patterns and persistence of phase in purebred and crossbred pig (Sus scrofa) populations. BMC Genet 2014;15(1):126. 34. Bergfelder-Drüing S, Grosse-Brinkhaus C, Lind B, Erbe M, Schellander K, Simianer H, et al. A genome-wide association study in large white and landrace pig populations for number piglets born alive. PloS ONE 2015;10(3):e0117468. 35. Kimble K. Transcriptome profiles of porcine oocytes and their corresponding cumulus cells reveal functional gene regulatory networks [masters thesis]. Alabama, USA: Auburn University; 2018. 36. Russell DL, Brown HM, Dunning KR. ADAMTS proteases in fertility. Matrix Biol 2015;44(46):54–63. 37. Llamazares M, Cal S, Quesada V, López-Otín C. Identification and characterization of ADAMTS-20 defines a novel subfamily of metalloproteinases-disintegrins with multiple thrombospondin-1 repeats and a unique GON-domain. J Biol Chem 2003;278(15):13382–13389. 38. Sur JH, Doster AR, Christian JS, Galeota JA, Wills RW, Zimmerman JJ, et al. Porcine reproductive and respiratory syndrome virus replicates in testicular germ cells, alters spermatogenesis, and induces germ cell death by apoptosis. J Virol 1997;71(12):9170– 9179. 39. Chen J, Shi X, Zhang X, Wang A, Wang L, Yang Y, et al. MicroRNA-373 facilitated the replication of porcine reproductive and respiratory syndrome virus (PRRSV) by its negative regulation of type I interferon induction. J Virol 2016; JVI-01311. 40. Noguera JL, Rodríguez C, Varona L, Tomás A, Muñoz G, Ramírez O, et al. A bidimensional genome scan for prolificacy traits in pigs shows the existence of multiple epistatic QTL. BMC Genomics 2009;10(1):636. 41. Fernandez-Rodriguez A, Munoz M, Fernandez A, Pena RN, Tomas A, Noguera JL, et al. Differential gene expression in ovaries of pregnant pigs with high and low prolificacy levels and identification of candidate genes for litter size. Biol Reprod 2011;84(2):299– 307. 42. Chen X, Zhang Q, Bai J, Zhao Y, Wang X, Wang H, et al. The nucleocapsid protein and non-structural protein 10 of highly pathogenic porcine reproductive and respiratory

846


Rev Mex Cienc Pecu 2020;11(3):828-847

syndrome virus enhance CD83 production via NF-κB and Sp1 signaling pathways. J Virol 2017;JVI-00986. 43. Nakamura N. The role of the transmembrane RING finger proteins in cellular and organelle function. Membranes 2011;1(4):354–393. 44. Chen XX, Quan R, Guo XK, Gao L, Shi J, Feng WH. Up-regulation of pro-inflammatory factors by HP-PRRSV infection in microglia: implications for HP-PRRSV neuropathogenesis. Vet Microbiol 2014;170(1):48–57. 45. Katoh Y, Katoh M. Comparative integromics on FAT1, FAT2, FAT3 and FAT4. Int J Mol Med 2006;18(3):523–528. 46. Balakrishnan B, Johnson RW. Altered brain development in fetal and neonatal piglets following maternal porcine respiratory and reproductive syndrome virus (PRRSV) infection. Brain Behav Immun 2015;49:e31.

847


https://doi.org/10.22319/rmcp.v11i3.5274 Artículo

Venta a granel de embutidos: una tendencia de comercialización asociada al riesgo de enfermedades trasmitidas por alimentos en Culiacán, México

Maribel Jiménez-Edeza a Maritza Castillo-Burgos a Lourdes Janeth Germán-Báez a Gloria Marisol Castañeda-Ruelas a*

a Universidad Autónoma de Sinaloa, Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación y Diagnóstico Microbiológico, Programa Regional de Posgrado en Biotecnología. Blvd. de las Américas and Josefa Ortiz de Domínguez S/N. Ciudad Universitaria, 80013, Culiacán, Sinaloa, México.

*Autor de correspondencia: gloria.ruelas@uas.edu.mx

Resumen: La naturaleza, producción y consumo de los embutidos definen al alimento como vulnerable, a la contaminación con microorganismos patógenos que propicien enfermedades transmitidas por los alimentos. El objetivo del estudio fue evaluar la influencia de la venta a granel de embutidos, sobre la calidad higienica y la prevalencia de L. monocytogenes y Salmonella. Para ello, se recolectaron 96 muestras de embutidos (salchicha y jamón) de 15 marcas nacionales, y se clasificaron equitativamente por tipo de venta; paquete original (n= 48) y granel (n= 48). La detección de coliformes totales, Escherichia coli, Salmonella, y L. monocytogenes se analizó mediante cultivo tradicional. El 42.7 % (41/96) de las muestras de embutidos estuvieron fuera de especificación sanitaria en términos de coliformes totales y E. coli. El análisis estadístico mostró que el tipo de venta es un indicador del riesgo microbiano en embutidos (χ2=40.0, P=0.000), ya que el número de muestras con deficiente calidad higiénica fue mayor para la venta a granel (69.0 %) comparada con las que se venden en paquete (17.0 %). Adicionalmente, el análisis de riesgo mostró que la venta a granel

848


Rev Mex Cienc Pecu 2020;11(3):848-858

incrementa 41.8 y 5.9 veces el riesgo de adquirir jamón y salchichas de mala calidad microbiológica (P<0.05), respectivamente. Mientras que, el tipo de venta no influenció la presencia de L. monocytogenes (6.3 %) en las muestras. Se recomienda a los consumidores evitar la compra a granel de los embutidos; y los productores y vendedores deben reforzar las buenas prácticas higiénicas que permitirán asegurar la inocuidad, y minimizar el riesgo de infecciones. Palabras clave: Embutidos, Granel, Inocuidad, L. monocytogenes.

Recibido: 21/02/2019 Aceptado: 29/08/2019

Introducción Los embutidos listos para el consumo (LPC) son alimentos de gran aceptación por sus atributos organolépticos y practicidad de consumo. En México, el consumo per cápita de estos productos va en aumento, ya que se estima que en el año 2014, se consumían 6.9 kg por persona, mientras que para el 2018 la cifra aumentó a 8.1 kg(1). No obstante, la naturaleza y producción de los embutidos son vulnerables a la contaminación con microorganismos que ocasionan su deterioro, así como por patógenos asociados a enfermedades transmitidas por los alimentos (ETA)(2). Listeria monocytogenes se considera la principal causa de retiro de embutidos en el mercado en EE. UU.(3-6), y uno de los principales agentes etiológicos de ETA con una tasa de mortalidad de hasta el 30 % en ciertos grupos de alto riesgo (inmunocomprometidos, ancianos, bebés y mujeres embarazadas)(2,4-6). Se ha reportado como la causa de 1,455 casos (16 % de mortalidad)(7) con un costo económico estimado de US$ 2.4 mil millones debido a la listeriosis anual(8). Sin embargo, en México no hay referencias oficiales para ese tipo de estimaciones. Afortunadamente, se publicó el Proyecto de Norma Oficial Mexicana PROY-NOM-213SSA1-2017(9), que ya establece el monitoreo de este patógeno. Sin embargo, debido a que este proyecto es reciente, hay escasa información de la prevalencia de Listeria monocytogenes en embutidos(10,11). Además, el Sistema Nacional de Vigilancia Epidemiológica, no considera a la listeriosis como una enfermedad de notificación obligatoria, por lo que se dificulta establecer relaciones entre la presencia de la bacteria en los alimentos y casos de enfermedad. Aún así, la calidad microbiológica de jamón y salchicha, ya ha sido cuestionada por la presencia de mesofílicos aerobios, así como

849


Rev Mex Cienc Pecu 2020;11(3):848-858

microorganismos patógenos (Salmonella, Staphylococcus aureus)(12). A pesar de esto, no se han realizado investigaciones orientadas a establecer el origen de la contaminación microbiológica de estos alimentos. Con el fin de garantizar la inocuidad de los embutidos, el proceso de producción está adherido a buenas prácticas higiénicas y al análisis de peligros y puntos críticos de control(4). A pesar de esto, la deficiente manipulación higiénica del embutido en los comercios minoristas se ha asociado como la causa de la mayoría de brotes epidemiológicos reportados(5). Diversas marcas de embutidos están disponibles en México, cuya venta puede ser a granel o en su paquete original. Particularmente, el hábito del consumidor mexicano de adquirir embutidos a granel, es un aspecto preocupante, dado que involucra la manipulación del alimento en el punto de venta, y la violación de la garantía de calidad de la marca. En consecuencia, la población mayormente afectada es aquella que busca economizar recursos a través de esta práctica, y que, además, no acude al médico en caso de contraer una ETA. Por ello, el propósito fue generar información sobre la influencia del tipo de venta en la calidad sanitaria (Salmonella, Escherichia coli, coliformes)(9,13) y la prevalencia de L. monocytogenes en los embutidos comercializados en el estado de Sinaloa, México.

Material y métodos Recolección de las muestras

Se realizó un muestreo intencional con la finalidad de valorar la influencia de dos estrategias de venta de embutidos (granel y paquete). Las muestras se seleccionaron según las principales marcas de distribución nacional y las mas populares entre los consumidores. Los puntos de venta (mercados y supermercados) seleccionados estuvieron condicionados por la disponibilidad de las marcas seleccionadas, así como por ofrecer los dos tipos de venta del producto. Se recolectaron 96 muestras de embutidos de pavo que consistían en salchichas (n= 48) y jamón (n= 48) provenientes de 15 marcas nacionales diferentes (A-O) y de 13 puntos de venta de Culiacán, México, durante el segundo semestre de 2017. Las muestras de embutidos se recolectaron y clasificaron equitativamente por el tipo de venta; paquete original (n= 48) y granel (n= 48). La compra de las muestras de “paquete original” se definió como la adquisición de la unidad completa y cerrada del producto. Mientras que, la compra “a granel” implicó la toma manual del embutido por parte del vendedor, el rebanado o corte mecánico, y la posterior colocación del producto en bolsas de plástico proporcionadas por el servicio minorista. La temperatura de almacenamiento del alimento se observó de 5 °C ±

850


Rev Mex Cienc Pecu 2020;11(3):848-858

2 °C, según los lectores digitales propios de los equipos de refrigeración en los puntos de venta. Las muestras se almacenaron dentro de una caja refrigerada durante el transporte al laboratorio para su análisis microbiológico en un periodo tiempo < 4 h posteriores a la recolección. La superficie exterior del empaque original y las bolsas de plástico provista durante la venta a granel fueron desinfectadas con alcohol (70%) previo al análisis microbiológico.

Cuantificación de Escherichia coli y coliformes totales La cuantificación de E. coli y coliformes totales se realizó en placas 3M™ Petrifilm™ siguiendo las instrucciones del proveedor. La cuantificación de cada microorganismo se realizó de acuerdo con la morfología colonial típica observada. Las concentraciones microbianas se expresaron como UFC/g, y se compararon con el límite microbiológico reportado en la NOM-213-SSA1-2002(13).

Aislamiento de Salmonella

Para el aislamiento de Salmonella en las muestras de embutidos se siguió el protocolo descrito en el Manual Analítico Bacteriológico(14). Los aislados de Salmonella se confirmaron amplificando un fragmento de 244 pb del gen invA mediante PCR(15).

Aislamiento de L. monocytogenes

El aislamiento de L. monocytogenes se realizó con el protocolo descrito por la USDAFSIS(16). Los aislados presuntivos de Listeria se confirmaron con el sistema Microgen Listeria-ID (Microgen LABTM). Se realizó una confirmación adicional de los aislados de L. monocytogenes a través del método de reacción en cadena de la polimerasa (PCR) mediante la amplificación de un fragmento de 234 pb del gen de Listeriolysin-O(17). Se incluyó L. monocytogenes ATCC 7644 como control positivo.

851


Rev Mex Cienc Pecu 2020;11(3):848-858

Análisis estadístico

El software IBM® SPSS se utilizó para el análisis estadístico de los resultados. Se realizó una prueba no paramétrica de χ2 de Pearson para determinar la asociación del tipo de venta con la calidad microbiológica del embutido. El análisis de riesgo se realizó mendiante el cálculo de odds ratio. Un valor de P < 0.05 se consideró estadísticamente significativo.

Resultados El Cuadro 1 muestra la calidad microbiológica de las muestras de embutidos según el tipo de venta y embutido. De manera general, el 42.7 % (41/96) de las muestras de embutidos incluidas en la categoría granel (69.0 %) y paquete (17.0 %) estuvieron fuera de especificación sanitaria (< 3 NMP/g)(9,13), dado que los valores cuantificados para E. coli y coliformes totales estuvieron en el rango de 10 a 2,860 UFC/g. El porcentaje de incidencia de muestras de salchicha y jamón que no cumplían con la especificación sanitaria varió entre 29.2 % (14/38) y 56.3 % (27/48), respectivamente. No se detectó Salmonella en ninguna de las muestras analizadas. Adicionalmente, el 6.3% (6/96) de las muestras fueron positivas para L. monocytogenes; granel (8.3 %) vs paquete (4.2 %). Cabe señalar que, el 60.0 % (9/15) de las marcas nacionales están fuera de especificación sanitaria(9,13), y cuatro de estas marcas (26.6 %) resultaron positivas para L. monocytogenes. Cuadro 1: Calidad microbiológica de las muestras de embutidos comercializados en paquete y a granel en México Detección (%) de los microorganismos Criterio Paquete Granel Total microbiológico* Salchicha Jamón Salchicha Jamón (n=96) (n=24) (n=24) (n=24) (n=24) Coliformes 8.3 4.2 45.8 91.7 37.5 E. coli 4.2 0 4.2 12.5 5.2 Salmonella 0 0 0 0 0 L. monocytogenes 4.2 4.2 4.2 12.5 6.3 Rechazadas** 12.0 21.0 46.0 92.0 42.7 Aceptadas 88.0 79.0 54.0 8.0 57.3 *La presencia de los coliformes y E. coli se basó en el límite sanitario (<3 NMP/g para coliformes fecales) para alimentos cocidos definido por NOM-213-SSA1-2002. **Las muestras categorizadas como rechazadas contenían al menos un microorganismo.

852


Rev Mex Cienc Pecu 2020;11(3):848-858

Los perfiles de calidad microbiológica destacan que el tipo de venta es un indicador del aseguramiento de la inocuidad de los embutidos en la mayoría de las marcas (χ2=40.0, P=0.000) (Figura 1) en términos de coliformes, siendo la venta a granel un factor de riesgo microbiológico, principalmente en el jamón. El tipo de venta no influenció la presencia de L. monocytogenes y E. coli (P<0.05) en las muestras de embutidos. El análisis de riesgo (odd ratio) definió que la venta a granel incrementa 11 veces el riesgo de adquirir un embutido no inocuo respecto a la venta del producto en su paquete original. Así mismo, el análisis de riesgo por tipo de embutido muestra que la venta a granel incrementa 41.8 y 5.9 veces el riesgo de adquirir jamón y salchichas de mala calidad microbiológica, respectivamente (Cuadro 2). No se observó significancia entre el riesgo de obtener productos a granel o paquete contaminados con L. monocytogenes, pero, este riesgo puede incrementarse de 1 – 3 veces si se opta por la compra a granel. Figura 1: Clasificación de los perfiles de calidad microbiológica por marca nacional para muestras de jamón (a) y salchichas (b) recolectadas en servicios minoristas en México

Las letras A-O representan las marcas nacionales, y el número de muestras por marca está representado entre paréntesis. La variabilidad del número de muestras por categoría dependió de la disponibilidad de la muestra .

853


Rev Mex Cienc Pecu 2020;11(3):848-858

Cuadro 2: Estimación del riesgo de adquirir embutidos no inocuos por venta a granel en México Categoría Coliformes totales y E. coli L. monocytogenes RP Significancia RP Significancia (IC 95%) P (IC 95%) P Embutidos 11.0 0.0001 2.1 0.4079 (4.15 – 29.13) (0.36 – 11.99) Jamón 41.8 0.0001 3.3 0.9970 (7.26 – 240.78) (0.32 – 34.08) Salchicha 5.9 0.0163 1.0 1.0000 (1.39 – 25.30) (0.06 – 16.97) RP= razón de probabilidades.

Discusión Los perfiles de calidad microbiológica revelaron que la mayoría de las marcas vendidas en Culiacán, Sinaloa no cumplieron con las especificaciones sanitarias requeridas para su consumo(9). Esto indica las malas condiciones higiénicas en las que se procesan algunos embutidos (marcas A, B, C, H), y la influencia de la integridad del empaque original durante la venta sobre la calidad microbiológica. A pesar de que puede producirse una contaminación primaria de los embutidos(18), su manejo posterior en los establecimientos y el hogar puede incrementar la carga microbiana patógena(4-5). A este respecto, la violación del empaque original, el contacto manual del vendedor, el corte y el uso de empaques no sanitarios para la venta a granel del embutido son atributos observados en el estudio, y son señalados como factores de contaminación microbiana en los alimentos(5). La detección de L. monocytogenes, y la cuenta de coliformes y E. coli en embutidos son indicadores del riesgo del desarrollo de listeriosis y gastroenteritis, dado que estos alimentos pueden consumirse sin tratamiento térmico previo a su ingesta. Es importante resaltar que estas marcas se distribuyen nacionalmente, y que el hábito de compra a granel es una práctica común realizada por la población mexicana, lo que exhibe un potencial problema de salud pública. El riesgo indistinto de adquirir embutidos de venta a granel y en empaque contaminados con L. monocytogenes observado, define al patógeno como un peligro potencial de contaminación en cualquier etapa de la cadena alimentaria. Kurpas et al(4) coinciden que la contaminación final de los productos cárnicos por L. monocytogenes ocurre, tanto en la planta de procesamiento, así como en el punto de venta. Esto se debe a las características de

854


Rev Mex Cienc Pecu 2020;11(3):848-858

crecimiento, las vías de propagación y reservorios de L. monocytogenes, así como la deficiente higiene del manipulador, ya que esta bacteria es persistente en condiciones relacionadas con la elaboración de alimentos(4). La contaminación de los alimentos por L. monocytogenes es uno de los desafíos más importantes que enfrenta la industria cárnica, debido a capacidad de la bacteria para multiplicarse durante el almacenamiento en refrigeración del alimento, y la posibilidad de consumir un alimento contaminado sin cocción adicional(19). Muchos estudios han informado la presencia de L. monocytogenes en embutidos cocidos, crudos, curados, salados, entre otros(18,20). Otras preocupaciones de la seguridad alimentaria que rodean a L. monocytogenes son la virulencia(21) y la resistencia a antibióticos(22), que son factores importantes en la gravedad de la listeriosis y en la persistencia del patógeno en el entorno de procesamiento. Estos atributos fenotípicos han sido también previamente reportados en cepas de L. monocytogenes recuperado de ciertos alimentos en México(10,11). La detección de L. monocytogenes en embutidos comercializados en México debe tomarse con atención, dado que previamente se ha documentado la importancia clínica y epidemiológica de la listeriosis en la población mexicana, resaltando la alta tasa de mortalidad y la severidad de las manifestaciones clínicas(23). La listeriosis puede presentarse en forma de septicemias, meningitis, endocarditis, abortos, infecciones localizadas, gastroenteritis(24). Adicionalmente, Castañeda et al(25) han establecido la relación clonal de una cepa de L. monocytogenes aislada de carne de pollo como potencial agente etiológico de listeriosis en México. Dado que L. monocytogenes es considerado un patógeno responsable de ETA(7), la prevención y control intencionado del patógeno en la cadena alimentaria resulta una pauta para minimizar la infección por esta bacteria. Dado que la venta a granel es un indicador de alto riesgo microbiológico de los embutidos de venta en los comercios minoristas, debe prestarse atención a este hábito de compra del consumidor mexicano, y diseñarse acciones que contribuyan a minimizar el riesgo de infecciones. El alto riesgo de adquirir un embutido no inocuo por su compra a granel denota la continua exposición del consumidor frente a peligros microbiológicos, y propone este hecho como una potencial causa de los casos de infecciones intestinales (5,771,681) e intoxicaciones alimentarias (38,815) reportadas anualmente en México, y cuya tipificación no es definida(26). La adherencia a las disposiciones regulatorias para la venta de estos productos, y la aplicación de los protocolos de buenas prácticas higiénicas garantizan la venta segura al consumidor(4,9,13). Algunos estudios delinean que los embutidos deben venderse en su empaque original para mantener la garantía de su producción(4). Adicionalmente, la educación del consumidor en temas de inocuidad es una acción importante para la enseñanza del manejo adecuado del alimento y minimizar el riesgo del desarrollo de ETA(27).

855


Rev Mex Cienc Pecu 2020;11(3):848-858

Conclusiones e implicaciones El alto nivel de contaminación microbiana y la detección de L. monocytogenes en los embutidos de diferentes marcas nacionales comercializados a granel o paquete, es un indicador común de la falta de buenas prácticas de higiene en la cadena alimentaria, y un alto riesgo de adquirir ETA, ya que son productos listos para el consumo, y se distribuyen en todo el país. Por esto, es imperativo llamar la atención de las autoridades mexicanas para exigir el monitoreo de L. monocytogenes en los embutidos, así como implementar estrategias de control microbiano en la formulación y venta. Finalmente, se recomienda a los consumidores elegir productos en su empaque original para mantener la inocuidad de los alimentos y la garantía de la marca.

Agradecimientos Este trabajo fue apoyado por la beca de la Convocatoria del Programa de Fomento y Apoyo a Proyectos de Investigación PROFAPI2014/043 de la Universidad Autónoma de Sinaloa.

Conflicto de intereses Los autores declaran no tener conflictos de intereses, financieros o de otra índole.

Literatura citada: 1. COMECARNE. Consejo Mexicano de Carne. Compendio Estadístico 2018. México. 2018. https://comecarne.org/estadisticas/. Consultado 19 Sep, 2018. 2. Olaoye OA. Meat: An overview of its composition, biochemical changes and associated microbial agents. Int Food Res J 2011;18(3):877-885. 3. USDA-FSIS. United States Department of Agriculture Food Safety and Inspection Service. Recall Case Archive. http://www.fsis.usda.gov/wps/portal/fsis/topics/recallsand-public-health-alerts/recall-case-archive. Accessed Sep 19, 2018. 4. Kurpas M, Wieczorek K, Osek J. Ready-to-eat meat products as a source of Listeria monocytogenes. J Vet Res 2018;61(1):49-55.

856


Rev Mex Cienc Pecu 2020;11(3):848-858

5. Endrikat S, Gallagher D, Pouillot R, Quesenberry HH, Labarre D, Schroeder CM, Kause J. A Comparative risk assessment for Listeria monocytogenes in prepackaged versus retail-sliced deli meat. J Food Prot 2010;73(4):612–619. 6. Leonge D, Alvarez-Ordoñez A, Jooste P, Jordan K. Listeria monocytogenes in food: Control by monitoring the food processing environment. Afr J Microbiol Res 2016;10:101–114. 7. Scallan E, Griffin P, Angulo F, Tauxe R, Widdowson M, Roy S, Jones J, Griffin P. Foodborne illness acquired in the United States. Emer Infect Dis 2011;17:7–15. 8. Ivanek R, Grohn YT, Tauer LW. The cost and benefit of Listeria monocytogenes food safety measures. Crit Rev Food Sci Nutr 2004;44:513–523. 9. SSA. Secretaría de Salud Proyecto de Norma Oficial Mexicana, Productos y servicios. Productos cárnicos procesados y los establecimientos dedicados a su proceso. Disposiciones y especificaciones sanitarias. Métodos de prueba. PROY-NOM-213SSA1-2017. México. 2017. 10. Castañeda GM, Castro N, León J, Valdez JB, Guzmán JR, Luchansky JB, Porto-Fett ACS, Shoyer AB, Chaidez C. Prevalence, levels, and relatedness of Listeria monocytogenes isolated from raw and ready-to-eat foods at retail markets in Culiacan, Sinaloa, México. J Microbiol Res 2013;3(2):92–98. 11. Silva LE, Pérez C, Barreras A, Figueroa F. Identification of Listeria sp. in hams and frankfurters products exhibited for sale. J Anim Vet Adv 2007;6(3):314–316. 12. Sarti E, Parrilla MC, Saldate O. Calidad sanitaria del jamón que se consume en la ciudad de México. Salud Públ Méx 1989;31(3):326-333. 13. SSA. Secretaría de Salud. Productos y Servicios. Productos cárnicos procesados. Especificaciones sanitarias. Métodos de prueba. NOM-213-SSA1-2002. México. 2005. 14. BAM. Bacteriological Analytical Manual. Chapter 5: Salmonella. Bacteriological Analytical Method. USA. 2018. https://www.fda.gov/food/laboratory-methodsfood/bacteriological-analytical-manual-bam-chapter-5-salmonella. Accessed Sep 19, 2017. 15. Chiu C, Ou J. Rapid identification of Salmonella serovars in feces by specific detection of virulence genes invA and spvC, by an enrichment broth culture-multiplex PCR combination assay. J Clin Microbiol 1996;34(10):2619–2622. 16. United States Department of Agriculture-Food Safety and Inspection Services (USDAFSIS). 2017. MLG8: Isolation and identification of Listeria monocytogenes from red meat, poultry, egg and environmental samples. 857


Rev Mex Cienc Pecu 2020;11(3):848-858

http://www.fsis.usda.gov/wps/wcm/connect/1710bee8-76b9-4e6c-92fcfdc290dbfa92/MLG-8.pdf?MOD=AJPERES. Accessed Sep 19, 2017. 17. Furrer B, Candrian U, Hoefelein C, Luethy J. Detection and identification of Listeria monocytogenes in cooked sausage products and in milk by in vitro amplification of haemolysin gene fragments. J Appl Bacteriol 1991;70(5):372-379. 18. Syne S, Ramsubhag A, Adesiyun A. Microbiological hazard analysis of ready-to-eat meats processed at a food plant in Trinidad, West Indies. Infect Ecol Epidemiol 2013;3(1):1–12. 19. Sofos JN. Challenges to meat safety in the 21st century. Meat Sci 2008;78(1-2):3–13. 20. Gómez D, Iguácel LP, Rota MC, Carramiñana JJ, Ariño A, Yangüela J. Occurrence of Listeria monocytogenes in ready-to-eat meat products and meat processing plants in Spain. Foods 2015;4(3):271–282. 21. Khan JA, Rathore RS, Khan S, Ahmad I. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method. Braz J Microbiol 2013;44(3):751–758. 22. Lungu BC, O’bryan A, Muthaiyan A, Milillo SR, Johnson MG, Crandall PG, Ricke SC. Listeria monocytogenes: Antibiotic resistance in food production. Foodborne Pathog Dis 2011;8(5):569–578. 23. Castañeda-Ruelas G, Eslava C, Castro N, León J, Chaidez C. Listeriosis en México: importancia clínica y epidemiológica. Salud Públ Méx 2014;56(6):654–659. 24. Doganay M. Listeriosis: clinical presentation. FEMS Immunol Med Microbiol 2003;35(3):173-175. 25. Castañeda-Ruelas G, Eslava C, Castro N, León J, Chaidez C. Listeria monocytogenes y Listeriosis, problema de salud pública en México. Salud Públ Méx 2018;60(4):376–377. 26. DGE. Dirección General de Epidemiología. Distribución de casos nuevos de enfemedad por fuente de notificación Estados Unidos Mexicanos 2017. http://www.epidemiologia.salud.gob.mx/anuario/2017/morbilidad/nacional/distribucio n_casos_nuevos_enfermedad_fuente_notificacion.pdf. Consultado 29 Ene, 2019. 27. Nesbitt A, Thomas MK, Marshall B, Snedeker K, Meleta K, Watson B, Bienefeld M. Baseline for consumer food safety knowledge and behaviour in Canada. Food Control 2014;(38):157-173.

858


https://doi.org/10.22319/rmcp.v11i3.5372 Revisión bibliográfica

Estudios de asociación genómica en ovinos de América Latina. Revisión

Karen Melissa Cardona Tobara * Diana Carolina López Álvarez a Luz Ángela Álvarez Franco a

a

Universidad Nacional de Colombia. Sede Palmira. Facultad de Ciencias Agropecuarias, Maestría en Ciencias Agrarias, Énfasis Producción Animal Tropical. Colombia. Grupo de Investigación en Recursos Zoogenéticos.

*Autor de correspondencia: kmcardonat@unal.edu.co

Resumen: Los ovinos, son una de las especies domésticas más importantes a nivel mundial, debido al potencial productivo y reproductivo que poseen. En este sentido, identificar los mejores animales para características productivas de interés económico, es el objetivo principal en los programas de selección y mejoramiento genético de los rebaños. Sin embargo, en la mayoría de los países de América Latina la selección de los animales no es eficiente, debido a la elección subjetiva de los mismos y a la naturaleza compleja de estas características, ya que, al ser de carácter cuantitativo, su expresión involucra la interacción de múltiples genes con el ambiente. En la actualidad, gracias a los avances en las tecnologías de nueva secuenciación, genotipado y análisis de asociación genómica (GWAS), se han podido identificar numerosas variaciones en el ADN de los animales, principalmente polimorfismos de nucleótido simple (SNP) que pueden encontrarse en genes que afectan la expresión de rasgos económicos de interés. Esta revisión presenta los avances de la implementación de los análisis de asociación genómica (GWAS), en América Latina, su aplicación en los sistemas productivos de ovinos y los resultados que se han obtenido al indagar en características de tipo productivo, reproductivo, funcional o de calidad. Palabras clave: Genes candidatos, GWAS, Mejoramiento genético, Caracteres fenotípicos, Caracteres genotípicos, SNP. 859


Rev Mex Cienc Pecu 2020;11(3):859-883

Recibido: 09/05/2019 Aceptado:18/09/2019

Introducción Los ovinos son una de las especies más distribuidas por todo el mundo, se les encuentra en todos los climas y ecosistemas(1). En América Latina, se estima una población de 80 millones de cabezas la mayoría concentradas en países como Brasil, Argentina, Perú, Bolivia, México y Uruguay(2); constituyendo su cría, una actividad que genera gran impacto en la economía y alimentación de comunidades indígenas y pequeños campesinos(3). En estas regiones los sistemas se caracterizan por utilizar ecotipos criollos y ser manejados de forma tradicional, lo que los hace menos competitivos frente a países de Asia y Europa, que se perfilan como los principales productores de carne, leche y lana(4,5). Actualmente, uno de los principales objetivos para mejorar la producción de los rebaños en América Latina, es identificar y mejorar genéticamente los animales superiores para características importantes económicamente; se ha reconocido que una de las alternativas para aumentar la productividad de los rebaños, a través de la selección, es utilizar herramientas biotecnológicas que combinen las técnicas de mejoramiento genético tradicional con información molecular(6). Estas herramientas involucran tecnologías de secuenciación del ADN, lo que permite identificar una cantidad considerable de marcadores en los genes de los animales, principalmente polimorfismos de nucleótido simple (SNP, por sus siglas en inglés), los cuales pueden tener efecto sobre rasgos productivos importantes(7,8). En este sentido, la genómica ha comenzado a impactar el estudio genético de los animales de producción, a través de metodologías como el estudio de asociación de genoma completo (GWAS, por sus siglas en inglés: Genome Wide Association Studies), que utiliza información de miles de SNP distribuidos a lo largo de todo el genoma y de la estimación de sus efectos para seleccionar e identificar regiones o loci involucrados en la variación de características cuantitativas (QTL)(9). Estos marcadores son utilizados para definir genes candidatos donde se localizan aquellos nucleótidos que influyen en la variación fenotípica (QTN) y descubrir los mecanismos moleculares que dirigen la expresión de características complejas en especies domésticas(10,11). En ovinos, los GWAS se han enfocado principalmente en estudiar rasgos de tipo productivo y algunos fenotípicos como el color del pelaje, presencia o ausencia de cuernos, entre otros(9).

860


Rev Mex Cienc Pecu 2020;11(3):859-883

Estado actual de los ovinos en América Latina

La importancia de los ovinos como especie doméstica radica en su alto potencial productivo y reproductivo, ya que aparte de utilizar ecosistemas no útiles para otras especies, se puede criar un mayor número de animales por unidad de área, poseen un intervalo generacional corto, elevada prolificidad, altas tasas de desarrollo, buena eficiencia alimentaria, son excelentes controladores de malezas y se puede obtener valor agregado de los productos derivados de la leche y carne(12-14). Al igual que otras especies de interés económico, los ovinos son producto de la domesticación de especies salvajes, la mayoría provenientes del Oriente medio en el denominado creciente fértil de Asia(15,16). Debido a la evolución y a la selección realizada por el humano, existen en el mundo una gran variedad de razas con características y aptitudes para diversos tipos de producción(17). La base racial de los ovinos de lana y pelo que existen en América Latina está compuesta principalmente por genotipos traídos durante la época de la colonización, que se criaron sin ningún orden reproductivo hace más de 500 años; esta situación produjo un mestizaje que perduró por siglos y que dio origen a una variedad de ovinos adaptados a diversos ecosistemas y a condiciones especiales de cada región, denominados criollos(16,18,19). En América Latina la mayoría de la población de ovinos es de este tipo, a excepción de Argentina, Chile y Uruguay cuya población está compuesta principalmente por animales mejorados importados de Australia y Europa. Los ovinos criollos constituyen un recurso zoogenético muy importante para América Latina, debido a que son animales adaptados al medio tropical, prolíficos y de fácil manejo; aparte, desempeñan una importante función social y económica, pues garantizan la seguridad alimentaria e ingresos económicos a poblaciones marginales y de extrema pobreza(13,14,18). En los últimos años la población de ovinos en América Latina ha sido fluctuante, pasando de tener junto a Oceanía y Europa más del 60% de la población en los años 80 y 90 a tener en la actualidad menos del 30 %(20,21). La población de América Latina participa con el 6.4 % de la población total de América, con el mayor número de animales reportados en Brasil, Argentina, Perú, Bolivia, México y Uruguay (Cuadro 1)(2). La disminución de este tipo de ovinos se debe principalmente a la falta de información acerca de estos animales y al hecho de que los productores se han limitado a usar razas foráneas para cruzamientos absorbentes, bajo el supuesto de que el desempeño productivo de este ganado es mejor, lo que ha hecho que la riqueza genética de estos ovinos se vea amenazada, poniendo en peligro su conservación(22,23).

861


Rev Mex Cienc Pecu 2020;11(3):859-883

Cuadro 1: Cabezas de ovinos en América latina (2014-2019) País Población de ovinos Brasil 17’976,367 Argentina 14’866,000 Perú 12’415,395 Bolivia 9’499,147 México 8’575,908 Uruguay 6’567,000 Cuba 2’173,400 Chile 2’037,516 Colombia 1’578,684 Ecuador 739,475 Guatemala 692,900 Venezuela 550,000 República Dominicana 123,000 Costa Rica 35,800 Panamá 18,665 Honduras 16,000 Nicaragua 13,800 El Salvador 11,493 Puerto Rico 10,759 Adaptado de(2, 21).

En América Latina, los sistemas de producción de ovinos se desarrollan generalmente con animales lanares y de pelo; obteniéndose del primero leche y derivados, lana y productos artesanales y del segundo productos cárnicos y vientres, algunos productores se dedican a ambas actividades(24,25). En este sentido los principales países productores de carne en América Latina son: Brasil con 21.13 %, México 14.26 % y Argentina con 12.05 %; mientras que para lana son: Argentina (30.59 %) y Uruguay (24.47 %). Por otro lado, la producción de leche de oveja en el continente americano representa solo el 0,9 % del total del mundo, la FAO reportó para el año 2017 datos de producción, solamente para México 57,754 t, Bolivia 35,000 t y Ecuador 4,300 t(26). Existen diferentes sistemas de producción con características particulares, destacándose principalmente los sistemas intensivo, extensivo y semi-extensivo; el sistema intensivo se caracteriza por el uso de tecnologías avanzadas y de razas mejoradas como Texel, Ile de France, Suffolk, Hampshire y Dorper en Brasil; Merino, Corriedale, Rommey Marsh, Lincoln, Frisona, Manchega y Pampinta en Argentina; Black Belly, Charollais, Dorper, Dorset, East Friesian, Katahdin, Pelibuey Cubano, Rambouillet, Romanov, Saint Croix, Damara y Texel en México, entre otros; en el sistema intensivo los índices productivos y reproductivos son mejores que en los sistemas extensivo y semi-extensivo(27). El sistema 862


Rev Mex Cienc Pecu 2020;11(3):859-883

extensivo se caracteriza por utilizar animales criollos o sus cruzamientos con razas mejoradas, ubicándose en grandes extensiones de tierra generalmente de baja capacidad agrícola y pocas prácticas de manejo(3). Finalmente, los sistemas semi-extensivos poseen características tanto de los sistemas intensivos y extensivos; los animales pastorean y a la vez son suplementados con forrajes, concentrados o bancos de proteína alternos, en este sistema generalmente se crían animales de doble propósito, ya sea para producir carne y leche o carne y lana, los parámetros productivos son mejores que los del sistema extensivo(12). Los principales ecotipos criollos utilizados en los sistemas semi- extensivos y extensivos de América Latina son: Morada nova y Santa Inés en Brasil(28-30), Pantaneira en Argentina y Brasil, Junin, Piura, Criollo de la Sierra y Criollo de Arequipa en Perú(31), Pelibuey en Cuba y México(32,33), Etíope y Sudan en Colombia(34-36), Ovino Criollo Uruguayo en Uruguay(37), Ovino Criollo Araucano en Chile(38), entre otros.

Estudios de asociación genómica GWAS y su aplicación en ovinos

Los GWAS son una metodología relativamente nueva en ovinos, puesto que estos surgieron inicialmente en medicina y genómica de humanos, como una herramienta para caracterizar y encontrar variantes asociadas a patologías o predisponentes al desarrollo de las mismas(39); también para conocer las interacciones existentes entre genes, la modificación de éstas y para detectar haplotipos de alto riesgo o combinaciones de múltiples SNP dentro de un único gen(40). Gracias a la popularidad de este tipo de estudios en humanos, su uso se extendió al campo de la medicina y producción animal(41), siendo una herramienta útil para la identificación de genes o regiones genómicas que causan la variación genética en los rasgos más importantes de interés productivo(10,19,40,42). En ovinos, los GWAS han evolucionado de forma cada vez más rápida tanto en ecotipos domésticos como silvestres, debido a la colaboración y beneficios que presentan proyectos liderados en los últimos años por instituciones como el International Sheep Genomics Consortium (ISGC por sus siglas en inglés, http://www.sheephapmap.org), EBI (The European Bioinformatics Institute por sus siglas en inglés) y el instituto Baylor College of Medicine Human Genome Sequencing Center, quienes secuenciaron el genoma de la oveja doméstica (Ovis aries), silvestre (Ovis aries musimon) y algunas razas de importancia económica como la Rambouillet(43). Actualmente, esta información se encuentra en bases de datos públicas como NCBI, ENSEMBL y UCS y se pueden encontrar diferentes versiones del genoma de la oveja doméstica, Ovis_aries_1.0 (2010), Oar_v3.1 (2012) y Oar_v4.0 (2015), estos datos han facilitado a la comunidad científica popularizar el uso de los GWAS en diferentes campos(44).

863


Rev Mex Cienc Pecu 2020;11(3):859-883

El abordaje de esta técnica en los ovinos también ha sido posible gracias al desarrollo de grandes colecciones o paneles de marcadores moleculares denominados microarreglos o chips de ADN, los cuales permiten identificar y explorar el genoma en busca de regiones o marcadores polimórficos asociados a caracteres de interés productivo(10,45). Generalmente, los polimorfismos incluidos en estos paneles son los SNP, ya que representan la mayor variación genética en un individuo, son los más comunes en el genoma, y se pueden ubicar en diferentes zonas de este: tanto en regiones que presiden la codificación del ARN y control de la replicación, como promotores, zonas blanco de microARN y regiones codificantes de proteínas; además; presentan baja tasa de mutación, niveles bajos de homoplasia y son fáciles de genotipar(7,46-49). En la actualidad casas comerciales como Illumina y Affymetrix, en compañía del Sheep Genomics Consortium, así como otras entidades alrededor del mundo han desarrollado matrices de genotipado con diferentes tipos de cobertura dentro del genoma. Illumina cuenta con: Ovine Infinium® HD SNP BeadChip, Ovine SNP50 BeadChip, OvineLD BeadChip con sondas dirigidas a 606.000, 54.241 y 15.000 SNPs y cobertura alta, media y baja, respectivamente. Affymetrix con Axiom™ Ovine Genotyping Array de densidad media y cobertura de 54.236 SNP(50). En la actualidad el chip más utilizado en ovinos es el OvineSNP50, el cual se diseñó con más de 3.000 muestras pertenecientes a 75 razas de ovejas domésticas (Ovis aries) y especies silvestres tales como muflones (Ovis aries musimon), borrego cimarrón norteamericano (Ovis canadensis), ovejas delgadas (Ovis dalli), uriales asiáticos (Ovis vignei) y argali (Ovis ammon)(19,51-53) . Con este chip se pueden analizar doce muestras de forma simultánea en una micro-matriz con las 54.241 sondas, cada matriz es de densidad media porque la distancia promedio entre cada SNP en el genoma es de 50.9 kb(54). Los primeros estudios de GWAS en ovinos se realizaron para identificar la estructura genética de polimorfismos asociados a la presencia o ausencia y tipo de cuernos en fenotipos silvestres de ovejas, encontrando que al analizar el genoma por medio de 36.000 SNP, el principal gen candidato para el carácter cuernos era RXFP2, un gen autosómico con implicación conocida en la determinación de las características sexuales primarias en humanos y ratones(43). Por otra parte, Zhao et al(55) realizaron un GWAS para encontrar mutaciones causales en el genoma de ovejas Corriedale con raquitismo y obtuvieron que la mutación R145X en el gen DMP1 era responsable de la aparición y herencia de esta patología. Otros estudios se han realizado para dilucidar la estructura filogenética de las poblaciones de ovejas y el resultado de siglos de evolución, Kijas y colaboradores encontraron la relación en términos de tiempos de divergencia entre 74 razas de ovejas estimada a partir del intercambio de haplotipos(44). En el 2012, identificaron 31 regiones genómicas que contienen genes para la pigmentación del pelaje, la morfología esquelética, el tamaño corporal, el crecimiento y la reproducción(53).

864


Rev Mex Cienc Pecu 2020;11(3):859-883

Nanekarani et al(56) encontraron que los genes de Calpastatina (CAST) y Callipyge (CLPG) se asociaron con características de calidad de carne; por ejemplo, animales que expresan el gen Callipyge presentan porcentajes de deposición de músculo superiores, mayor área del ojo del lomo y carne más magra. Guðmundsdóttir (42) encontró en ovejas islandesas 13 genes candidatos para la formación de músculo: SF3R, ADAM17, GADD45B, GRID2, SPG11, DAB2, FREM3, GAB1, KLF13, AKAP6, PNN, DOCK1, TRRAP y GADD45B. Otros autores(57), se centraron en dilucidar los mecanismos funcionales que regulan la producción de glucocorticoides inducidos por el estrés y su efecto en la salud de los ovinos; su estudio consistió en identificar aspectos genéticos claves que influyen en la respuesta del cortisol a un modelo de estrés inducido por endotoxinas bacterianas (BEIS)(57). Los resultados arrojaron que un total de 16 SNPs se asociaron significativamente con los niveles de cortisol; estos SNPs se encontraban cerca de genes importantes como CD14, ITGAM, ITGAL y SNX2. Aali et al(58) indagaron sobre la relación entre polimorfismos dentro del exón 6, los límites intrónicos del gen CAST y los perfiles de ácidos grasos, la composición fisicoquímica y las características de calidad del músculo Longissimus dorsi (LD), encontrando que seleccionar corderos con los genotipos "I", el haplotipo CAST-10, el genotipo "AA" de SNP G62A, y el genotipo "GT" de SNP G65T resulta en una mayor proporción de ácidos grasos saludables y carnes más tiernas(58). Otros investigadores(59) estudiaron el tamaño corporal de ovejas lecheras Frizarta y encontraron evidencia acerca de la influencia de 39 genes sobre este rasgo, incluidos algunos previamente descritos en otros estudios y algunos nuevos como TP53, NTN1 y ZNF521. En Francia, analizaron la estructura de una población de 547 ovejas, encontrando marcadores de selección tales como ABCG2, LCORL NCAPG, MSTN y genes involucrados en la pigmentación de la capa (ASIP, MC1R, MITF, TYRP1, EDN3 y BNC2), estatura y morfología (NPR2, MSTN (GDF-8), LCORL, NCAPG, ALX4 y EXT2), producción de leche (ABCG2), cuernos (RXFP2) y lana (IRF2BP2)(60).

Estudios de GWAS en ovinos de América Latina

En América Latina las técnicas de mejoramiento genético tradicionales aún son las más usadas en la mayoría de las especies; éstas se basan en la identificación y selección de individuos superiores a partir de la expresión fenotípica de las características de interés productivo(61), los resultados de este tipo de técnicas permiten caracterizar y categorizar los animales a partir de la estimación de parámetros genéticos poblacionales como heredabilidad (h2), correlaciones genéticas, varianzas (σ2 ) y covarianzas(46). A partir de estos datos, se pueden identificar y evaluar los polimorfismos de las secuencias de genes que puedan tener efectos sobre rasgos productivos de interés y realizar así, evaluaciones en las que se incorpore 865


Rev Mex Cienc Pecu 2020;11(3):859-883

la información molecular a los modelos de evaluación de datos productivos, generando como resultado parámetros genéticos más precisos(8). En este sentido, la tendencia en algunos países es utilizar herramientas como los GWAS que combinan el uso de información genómica con genealógica, registros productivos (información detallada de las actividades que se realizan en los sistemas productivos) y caracteres fenotípicos (cualquier característica detectable de un organismo (estructural, bioquímico, fisiológico o conductual, determinado por una interacción entre su genotipo y su medio) para mejorar la estimación de valores genéticos para características complejas, tales como crecimiento, prolificidad, calidad de carne, entre otras(7). Los reportes de GWAS en ovinos son pocos si se comparan con los realizados en bovinos y cerdos, encontrándose que la mayoría de los estudios en ovejas corresponden a Brasil(29,30, 62) , Colombia(23,34,63), Chile(38, 64) y Uruguay(65). Estos estudios se han centrado en encontrar genes relacionados con el crecimiento, característica importante que se asocia con la producción de carne y por ende presenta una repercusión económica para el productor y la industria. En Colombia, estudiaron la variabilidad genética de veintitrés SNP obtenidos de ovinos criollos y encontraron que veintiuno se ubicaron en genes con funciones conocidas y dos en proteínas que no han sido caracterizadas, estos y sus diferentes loci están relacionados con el sistema inmune y el crecimiento (formación de musculo y huesos)(66)(Cuadro 3). Por otro lado, se evaluó el genoma de una población de Camuros Criollos genotipados con el chip OvineSNP50 BeadChip para establecer la asociación entre el componente genético y la terneza de la carne del musculo Longissimus dorsi(63), encontrando efecto significativo de tres SNP, ubicados en los cromosomas OAR3, OAR4 y OAR9; el SNP OAR3_130491628.1 cuyo cambio nucleotídico es [C/T], se asocia con una porción exónica del gen MGAT4C el cual ha sido mapeado en el brazo q del cromosoma, cercano al gen DCN (Decorin) responsable de la degradación del colágeno postmortem. El SNP OAR4_118954127.1 cuyo cambio nucleotídico es [A/G], no se encontró asociado a ningún locus especifico, pero el SNP s43296.1 perteneciente al cromosoma 9 y cuyo cambio nucleotídico es [A/G] se encontró asociado a un locus que aún no ha sido caracterizado. Otro estudio de GWAS, relacionó las características de crecimiento muscular y calidad de la canal en ovinos de pelo colombiano, Etíope, Sudán y Pelibuey, en los departamentos de Cesar, Córdoba y Valle del Cauca, encontrando ocho genes candidatos (SLC44A3, PAM, CEP135, EMCN, PRDM13, BEND3, CHAMP1 y PIAS2; Cuadro 2) relacionados con crecimiento celular, apoptosis y angiogénesis, principalmente; además, la asociación permitió encontrar diferencias entre las variedades raciales, a pesar de que en Colombia los ovinos Etíope y Sudan aun no son reconocidos como razas(34). Lenis encontró polimorfismos en los SNP de los loci CAPN, CAST, LEP, GH e IGF-1 (Cuadro 2), al igual que una asociación significativa entre el gen CAST con la característica PN en ovinos criollos absorbidos por Pelibuey. Un estudio similar a los anteriores, pero en Uruguay, reporto SNPs ubicados dentro de genes que se asociaron con crecimiento, calidad de carne y canal PPARGC1A, DGAT1, CAST, GHR, GHRHR(67)(Cuadro 2). 866


Rev Mex Cienc Pecu 2020;11(3):859-883

Cuadro 2: Genes reportados por algunos autores de América Latina para características de importancia económica Gen Caracteristica Autor País CYP11A1, CYP1A1, CYP19, SFXN1 B2M, SFXN1, IL25, BMP4, TSHR, CCL28, PIK3R1, FGF10, IL15, IL2, TP-1, BPMG, BCL10, HSPD1, MALT1 ADAM10, IL6ST, TNFRF13B, SIVA1, JUN, PAX1, PIK3R1, SIT1, AKT1 SLC44A3, PAM, CEP135, EMCN, PRDM13, BEND3, CHAMP1, PIAS2 NPAS2, MRPS30, TPH2, TRHDE, CDH12, PARP14, DGAT2, WNT11 COPB2, DGAT2, ALCAM, PARP14, TPH2, TRHDE, FOXO3, OSTM1, TPH2, TRHDE, TNFAIP8, UBE3D, ME1, PLCXD3, C6, C7, CCDC88C, FBLN5, CACNA1C DGAT2, TRHDE, TPH2, ME1, C6, C7, UBE3D, PARP14 y MRPS30 GDF9, BMPR1-B, BMP15 TNNT2, HTRA3 CARTPT, PIK3R1, GHR MSX1, DRD5, SLCO4C1, OOEP, GATA6, CUL4A, ZFAND5, OPEP, PAGS

Transporte y construcción de moléculas de hierro, indicador de anemia.

Respuesta inmune y defensa del cuerpo

Berton 2017

et

al., Brasil

Diferenciación de las células T

Crecimiento y calidad de canal

Palacios, 2018

Colombia

Perfil de ácidos grasos saturados

Perfil de ácidos grasos monoinsaturados

Rovadoscki, 2017 Brasil

Perfil de ácidos grasos poliinsaturados

Composición de grasa Prolificidad Peso adulto Habilidad materna

Rovadoscki et al., Brasil 2018 Lacerda, 2016 Brasil

Eficiencia metabólica materna Partos gemelares

867

Amorim et al., 2018

Brasil


Rev Mex Cienc Pecu 2020;11(3):859-883

LDHA, MYC, BHLH, MDFIC, MSTN AOX1, LTBP1, PAK1, THRSP ADAMTS12, AMHR2, AQP3, ARHGAP24, C6, C9, COL1A1, COPS7B, DAB2, DROSHA, FGR, FYB, GDNF, GOLPH3, GPR158, GPR65, IL1RL1, KR8, MACROD2, MAPKAP1, MSRB3, NIPBL, PIK3CB, PLCB1, SKAP2, SMAD6, SNX27, SPEF2, TRPM8 CNTNAP2, FUT9, GDNF, ISPD, LIFR, MACROD2, MAPKAP1, NIPBL, CPLPP.P COL1A1, NIPBL, PDE6D y TRPM8 AMHR2, KRT8, NIPBL, PLAG1, PLCB1, RXFP2, SP1, SPAG6 y SPEF2 CAPN, CAST, LEP, GH e IGF-1 UBE2N, SOCS2, LAMC1, EPS15, ATP2B1, LRP8, GALNT4, MUC15 CAST, GHR, DGAT1, SERPINA3, GHRHR, HSPB1, DGAT2, SCAP, SCD5, ITGB1,

Peso metabólico adulto Score de condición corporal

Inmunidad

Simoni Gouveia Brasil et al., 2017

Desarrollo del sistema nervioso

Percepción sensorial

Reproducción

Lenis, 2019

Crecimiento

Colombia

Benavides et al., Brasil 2015

Inmunidad

Calidad de canal, crecimiento y calidad de carne

Armstrong et al., 2018

Uruguay

En Brasil, principal productor de carne de ovino en América Latina, los estudios se han enfocado en mejorar los aspectos nutricionales del producto final, como el perfil de ácidos grasos y calidad de la carne; en este sentido Rovadoscky(29), al analizar información genotípica y fenotípica de ovinos Santa Inés, encontró 28 genes candidatos relacionados con las características mencionadas anteriormente, de los cuales, solo los genes DGAT2 y TRHDE se encuentran anotados y relacionados con el perfil de ácidos grasos (Cuadro 2). Rovadoscki junto a otros investigadores indagaron acerca de la arquitectura genética de la 868


Rev Mex Cienc Pecu 2020;11(3):859-883

composición de ácidos grasos en el músculo Longissimus dorsi en ovinos Santa Inés, encontrando que existe variación genética para los rasgos evaluados, por lo tanto, es posible alterar los perfiles de ácidos grasos a través de la selección(30). Del GWAS obtuvieron diez SNP asociados con veintisiete regiones genómicas que influyen en la composición de ácidos grasos estos se ubicaron en los cromosomas 1, 2, 3, 5, 8, 12, 14, 15, 16, 17 y 18; estas regiones corresponden a 23 genes, entre los cuales se encuentran DGAT2, TRHDE, TPH2, ME1, C6, C7, UBE3D, PARP14 y MRPS30 (Cuadro 2). Otra característica de importancia económica estudiada en América Latina es la prolificidad. En Chile estudiaron el tamaño de camada a través de los genes BMP15 y GDF9 en la oveja Criolla Araucana, uno de los recursos zoogenéticos más importante para los agricultores del grupo étnico Mapuche. Para el gen GDF9 encontraron ocho SNP, siete documentados previamente para este gen y uno nuevo, llamado FecGA; de los SNP dos c.978A y c.994G son marcadores genéticos de fecundidad en ovinos criollos Araucanos(38). Previamente se estudiaron los polimorfismos de los genes BMPR1B, BMP15, GDF9 en tres razas de ovejas criollas Chilota, Araucana y Austral y encontraron que el alelo FecG1 se relacionó con el tamaño de la camada, en las tres razas(64) (Cuadro 3). Cuadro 3: Resumen de genes reportados por diferentes autores en América Latina SNP OAR Gen Característica Autor País G1

5

GDF9

FecBB 6 FecXI, FecXB, FecXH, FecXG X

BMPR1B

FecGH, FecG1

GDF9

FecXG , FecXL

5

Factor 9 diferenciación crecimiento

de Paz et al., Chile de 2014

Tamaño de camada

BMP15

Bravo et Chile al., 2016

Prolificidad

X

BMP15

Parto múltiple

OAR18_52089434.1

18

OAR5_37738161.1

5

OAR8_87794040.1

8

SLC44A3, PAM, CEP135, EMCN, PRDM13, BEND3, CHAMP1 y PIAS2

869

Argüello et al., 2014

Peso al nacimiento, peso al año, Ganancia pre- Palacios, destete, área del ojo 2018 del lomo, índice de compacidad de la canal y peso de la canal fría

México

Colombia


Rev Mex Cienc Pecu 2020;11(3):859-883

OAR14_14650208.1, s50332.1, s26449.1, 14 s72056.1, s56356.1, OAR14_15968361.1

MC1R

Pigmentación pelaje

del

OAR10_55949918.1

10

SPRY-2

Miogénesis

s11567.1 OAR3_56021384.1 OAR7_82985623.1

14 3 7

CDH13

Melanoma

YLPM1

Apoptosis celular

OAR21_52583090.1,

21

KAPS

OAR12_17005059.1

12

CAPN2

OAR8_91253490_X.1

8

QTL-OPG

s23985.1, OAR2_148350187.1, s26633.1

2 6

QTL-CE SPP1

OAR1_189179554.1 OAR1_23734999.1

Resistencia a endoparásitos

Muniz et Brasil al., 2016

Biagiotti, 2016

Brasil

CD200 1

LOC105605154

s12060.1

PLPPR4

s25125.1 OAR2_96008804.1 OAR3_61737307.1 OAR3_89348294.1 s62226.1 OAR5_107977075.1 OAR5_112451694.1 s11274.1 OAR6_27552838.1 OAR6_77919148.1 OAR7_85269064.1 OAR8_39977285.1 OAR8_50320412.1 s33129.1 OAR10_59207797.1 OAR10_91128145.1 OAR12_20575087.1

PDE4DIP MTAP RFN103 TMEM178A RDH14 PAM EFNA5 GABRG2 EMCN CEP135 CIPC PRDM13 MAP3K7 CNGB3 SLITRK1 CHAMP1 USH2A

2 3 5

6 7 8 9 10 12

Crecimiento

870

Noriega Colombia et al., 2018


Rev Mex Cienc Pecu 2020;11(3):859-883

s01263.1 OAR23_49635171_X.1 DU261801_281.1 OAR3_130491628.1

14 23 26 3

LOC101113879 PIAS2 PSD3 MGAT4C

Terneza de la carne

Ortiz et Colombia al., 2015

En Brasil, se estudió la prolificidad (número de corderos nacidos por oveja) a través de asociación genómica en ovinos de la raza Morada Nova, encontrándose que los genes GDF9, BMP15 y BMPR1-b se expresan en aquellos animales de partos múltiples(62) (Cuadro 2). Con los SNP obtenidos en este estudio se realizó un panel de baja densidad para la prolificidad, después de ser validado en ovejas de razas prolíficas con historial de parto simple y múltiple. Amorim et al(68) estudiaron la prolificidad en ovinos de la raza Santa Inés y al realizar GWAS para las variables eficiencia materna, eficiencia materna metabólica, parto de gemelos, peso del adulto, peso metabólico del adulto y el puntaje de condición corporal, encontraron seis regiones candidatas comunes para todas las variables; por otro lado, para peso adulto y peso metabólico del adulto, se hallaron 15 regiones en común, y finalmente peso adulto y condición corporal, coincidían en una región ubicada en el cromosoma 21. La única característica que no se relacionó con las demás variables fue el parto gemelar. Dentro de los genes encontrados en los cromosomas 16 y 5, se identificaron CARTPT, MSX1, DRD5, SLCO4C1, OOEP, GATA6, CUL4A, ZFAND5, OOEP, TNNT2, LDHA, MYC y MDFI; Cuadro 2, relacionados con la regulación del apetito, el balance energético, el mantenimiento del peso corporal y la respuesta al estrés, crecimiento muscular, desarrollo embrionario, comportamiento reproductivo, transportadores de membrana, secreción de progesterona, maduración de ovocitos y ovogénesis, complejo materno subcortical, contracción del músculo, regulación del calcio, regulador de la glucólisis y transcripción. En México, en ovinos Pelibuey encontraron por primera vez los polimorfismos FecXG y FecXL del gen BMP15 (Cuadro 3) y al realizar GWAS encontraron que los genotipos homocigotos de dichos polimorfismos se relacionaron con un mayor número de corderos, al haber más partos dobles(32). En América Latina, una de las principales causas que afecta la eficiencia de los sistemas de producción es la infestación por parásitos, los animales menos resistentes y adaptados a las condiciones ambientales son más susceptibles de perder peso, y hasta incluso morir, porque no se recuperan de la infestación parasitaria. En este sentido algunos estudios de asociación y selección genómica en programas de mejoramiento se han enfocado en buscar y seleccionar animales que presenten resistencia a la infección gastrointestinal por parásitos, como el caso de Biagiotti(69), que realizó un GWAS para estudiar la resistencia a parásitos en ovinos Santa Inés y encontró SNP (Cuadro 3) significativos asociados con puntuación de la condición corporal en el cromosoma 2, presencia de temblores en el cromosoma 21 y presencia de huevos del género Strongylus en los cromosomas 8 y 12. Posteriormente, en ovinos de la misma raza, también estudiaron la resistencia a parásitos particularmente Haemonchus 871


Rev Mex Cienc Pecu 2020;11(3):859-883

contortus a través de un panel de baja densidad (SNP12k BeadChip) de 12.785 SNPs, donde se encontraron varios genes candidatos ubicados en los cromosomas OAR1, OAR2, OAR3, OAR5, OAR8 y OAR15, relacionados con el desarrollo y activación del sistema inmune, respuesta inflamatoria y regulación de la proliferación de linfocitos y leucocitos(61). Estos genes (Cuadro 2) pueden ayudar en la selección de animales con mayor resistencia a los parásitos y el BeadChip Ovine SNP12k podría ser una herramienta adecuada para identificar regiones genómicas asociadas con rasgos relacionados con la resistencia a los parásitos gastrointestinales. En otro estudio, al realizar un GWAS para encontrar asociación entre la resistencia al parasito y el tipo de huésped, llevado a cabo en ovejas Maasai y Dorper adaptadas al ambiente tropical de Brasil, donde la exposición extrema al parásito es constante, especialmente Haemonchus contortus(70), se encontraron variantes inmunes candidatas para los genes involucrados en la respuesta a la infección, también información adicional de SNP útiles para la selección por resistencia a parásitos gastrointestinales en ovejas con antecedentes genéticos similares a la población estudiada. Dentro de los genes que se encontraron están: UBE2N, SOCS2, LAMC1, EPS15, ATP2B1, LRP8, GALNT4, MUC15 (Cuadro 2). Un estudio realizado por Periasamy et al(71) en 713 ovejas no relacionadas, involucrando ovinos Junin, Corriedale y Pampinta de Perú y Argentina, respectivamente; se identificaron 41 SNP en 38 genes candidatos, afines con la resistencia a nematodos gastrointestinales. Otros parámetros estudiados, se relacionan con características fenotípicas tales como el color del pelaje, asignación de razas y estructura de la población; importantes en los programas de selección dirigido a individuos puros, como el caso de la oveja de pelo Morada Nova en Brasil, que presenta animales de color blanco y rojo reconocidos por la Asociación Brasileña de Criadores de Ovejas, pero existen otras variantes de color negro y con la nariz pigmentada que no son aceptados en los registros genealógicos y algunos estudios sugieren que son similares. Otros investigadores(72) realizaron un GWAS para identificar regiones genómicas asociadas con el color de la capa y confirmar que las ovejas de color negro son similares a otras variedades de Morada Nova; encontrando que las diferencias entre las capas negras y rojas son el resultado de la expresión de diferentes alelos del mismo gen (MC1R ubicado en el cromosoma OAR14) sin afectar directamente las características productivas/reproductivas. Por otro lado, concluyeron que estas dos variedades mostraron una baja variación genética, insuficiente para definirlas como grupos diferentes. En Uruguay indagaron acerca de la diversidad genética de tres razas de ovinos Corriedale, Merino y Criolla, con el fin de confirmar la asignación de razas y analizar la estructura de la población de razas comerciales vs criollas y encontraron que al usar un subconjunto de 18.181 SNP, el análisis de componentes principales y el STRUCTURE arrojó la estratificación de la población dentro de las razas(52). Las líneas divergentes de Merino y Corriedale mostraron altos niveles de polimorfismo (89.4 y 86 %, respectivamente) y una 872


Rev Mex Cienc Pecu 2020;11(3):859-883

moderada diferenciación genética entre ellos (Fst= 0.08). En contraste, la oveja criolla solo tenía un 69 % de SNP polimórficos y mostró una mayor diferenciación genética (Fst= 0.17) con las otras dos razas. En Brasil, realizaron un estudio similar pero con ovejas de las razas criolla brasileña, Morada Nova y Santa Inés con el fin de encontrar regiones genómicas que pueden haber estado bajo selección y, por lo tanto, explicar las diferencias ecológicas y de producción observadas entre las tres razas(19); Cuadro 2. Los análisis realizados les permitieron identificar 86 genes candidatos; el análisis funcional reveló genes relacionados con la inmunidad, el desarrollo del sistema nervioso, la reproducción y la percepción sensorial, algunos de los genes son de particular interés, entre ellos: RXFP2, que recientemente se ha asociado con la presencia/ausencia y morfología de cuernos en ovejas; el gen TRPM8, involucrado en la regulación de la temperatura corporal a bajas temperaturas; DIS3L2, PLAG1 y NIPBL, asociados con la variación de altura; y finalmente, SPEF2 y SPAG6, importantes para la espermatogénesis. De Simoni Gouveia et al(19) también encontraron señales específicas de cada raza, que se relacionan con la adaptación al clima y condiciones de Brasil.

Ventajas y desventajas del uso de GWAS y selección genómica

Los GWAS y las pruebas basadas en información genómica permiten realizar selección de los mejores animales y aumentar la eficiencia de cría de los mismos(9,10), a través de la exploración del Desequilibrio de Ligamiento, es decir, la asociación entre genes que no es producto del azar debido a la cercanía de estos en un mismo segmento cromosómico(73-75); y de una gran cantidad de marcadores tipo SNP distribuidos a lo largo del genoma(9,72). De este modo, la suma de todos los efectos pequeños de los SNP permitirá predecir con mayor precisión los valores de cría, al recuperar las combinaciones haplotípicas favorables para las características de interés en todo el genoma(33,42) e identificar genes que afectan los rasgos de producción en los animales domésticos(43,72,76). En este sentido, se ha observado que en selección genómica, las características más favorecidas son aquellas que presentan baja heredabilidad y que están influenciadas fuertemente por el ambiente (peso al nacimiento, peso al destete, edad al primer parto, intervalo entre partos y ganancia diaria de peso al destete, entre otras)(34,36,77), lo cual representa un importante avance en la mejora genética de los animales pues se tiene un mayor control de los aspectos genéticos y se separa los efectos ambientales. En cuanto a caracteres difíciles de medir, la selección a partir de información genómica supone una desventaja, ya que la disponibilidad para descubrir nuevas variantes o validar las que ya existen requiere de infraestructura, recursos, muestras significativas y, sobre todo, de la generación de fenotipos(33). 873


Rev Mex Cienc Pecu 2020;11(3):859-883

A partir de la información genómica también se puede identificar individuos portadores de defectos genéticos, con el uso del SNP50 BeadChip en los GWAS se han encontrado con éxito los genes responsables de un gran número de enfermedades que afectan las ovejas, tales como microftalmia(78), epidermólisis ampollosa(79), raquitismo(55), lentivirus ovino(75) y condrodisplasia(80). El reconocimiento de cuál o cuáles son los animales portadores contribuiría a reducir el riesgo de pérdidas o incidencia de portadores de estas enfermedades en los rebaños. Una desventaja en este sentido radica en que estos estudios son útiles si los patrones a estudiar siguen un modelo de herencia recesiva, ya que solo se puede identificar regiones genómicas fijadas para un haplotipo que se comparte solo entre los individuos afectados, por el contrario, el mapeo de la homocigosidad no es aplicable a los rasgos dominantes donde los individuos sintomáticos pueden ser homocigotos o heterocigotos en la mutación causal(76). A través de la información generada por los GWAS también ha sido posible identificar aquellas modificaciones que han sufrido las especies domésticas y que son de interés desde el punto de vista morfológico, conductual, productivo, adaptativo y, en consecuencia, genético; aspectos que han permitido comprender mejor los procesos involucrados en la evolución de su genoma, así como descubrir y validar regiones genómicas involucradas en la manifestación de rasgos de interés económico y ecológico(19). Finalmente, la genómica genera gran cantidad de información acerca de la composición genética de los animales domésticos; actualmente se tiene a disposición el genoma completo de bovinos, aves, cerdos, ovejas, caballos, peces y otras especies de interés agrícola(9,10). En los últimos años se ha mejorado el ensamblaje de los genomas con el fin de anotar funcionalmente toda la información genética, una vez completada la anotación funcional, los nuevos genomas proporcionarían herramientas más eficaces para estudiar los mecanismos genéticos que controlan los rasgos de interés de los animales y aprovechar o mejorar los estudios basados en esta información(42). Otro tipo de información generada por la genómica son los SNPs, que pueden ser utilizados de forma simultánea como marcadores de población para verificar las filiaciones, el pedigrí y realizar estudios filogenéticos(81).

Perspectivas y retos de la ganadería ovina ante el uso de GWAS y selección genómica

El descubrimiento y desarrollo de nuevos marcadores para características de interés, o que resuelvan algún problema en los sistemas de producción está condicionado con la disponibilidad o generación de información fenotípica (registros), aspecto que no difiere de

874


Rev Mex Cienc Pecu 2020;11(3):859-883

la selección tradicional. En América Latina, el uso y disponibilidad de los registros es escaso, por lo tanto, así mismo son los progresos genéticos. Diversos estudios de GWAS y selección genómica han encontrado que los animales criollos son reservorios importantes de biodiversidad, presentan resistencia a enfermedades, elevada prolificidad, buen desempeño y productividad en ambientes difíciles, características que están determinadas genéticamente y que serían de gran importancia introducir en otras poblaciones. En este sentido, la cadena productiva de ovinos en América Latina debe considerar más la utilidad de los recursos zoogenéticos, ya que estos animales constituyen una alternativa a futuro para apoyar la producción comercial. Un reto para los productores de América Latina es mejorar la trazabilidad de los productos obtenidos a partir de la cría de ovinos. Con las técnicas moleculares actuales se pueden establecer mecanismos de trazabilidad donde a partir de la identificación del ADN de los productos, se puede rastrear los mismos, lo que contribuiría a revalorizar los sistemas de producción tradicionales. Implementar programas de conservación y de mejora en las razas locales de América Latina, que generalmente son mantenidas por productores a pequeña escala, implica un gran desafío. El registro de datos de comportamiento en estas condiciones es una labor extremadamente difícil y en algunas situaciones imposible. La relación costo-beneficio de la implementación de pruebas de ADN para asistir la selección genómica de características de interés económico en los ovinos está relacionada con los objetivos de cada sistema productivo. Es decir, se justifica la inversión en este tipo de pruebas, si la magnitud del cambio provisto por las mismas genera utilidad económica a través de los resultados esperados. En América Latina, el uso de estas herramientas ha sido efectivo en producción comercial, generalmente intensiva con animales de raza o mejorados, donde es posible obtener fenotipos que pueden validar la utilidad práctica del uso de marcadores genéticos. En América Latina existe una amplia variedad de razas, sin contar aquellas que han desaparecido y que son importantes debido a la adaptación que presentan a diversos ecosistemas, determinantes en algunas regiones. En este sentido, el uso de este tipo de estudios para detectar genes o huellas de selección que puedan ser de importancia para la conservación de estos animales resulta de gran utilidad.

875


Rev Mex Cienc Pecu 2020;11(3):859-883

Conclusiones A pesar de ser la genómica una herramienta que ayuda a comprender la arquitectura de rasgos complejos de interés productivo, y contribuir a mejorar los sistemas de producción de ovinos, su uso en América Latina se limita a unos pocos países, generalmente aquellos que tienen más población de ovinos y su producción es representativa a nivel mundial. En este sentido, resulta pertinente seguir indagando acerca del uso de los GWAS en América Latina y así, identificar más genes que influyen en la productividad de los ovinos, que por lo general son animales Criollos, adaptados a las condiciones de trópico.

Agradecimientos A la Universidad Nacional de Colombia-Sede Palmira por su apoyo a través de la convocatoria para el fortalecimiento de la investigación y creación artística de la Facultad de Ciencias Agropecuarias 2017-2018.

Conflictos de interés Los autores declaran que no tienen conflictos de interés con respecto al trabajo presentado en este reporte.

Literatura citada: 1.

Peacock C. Goats - A pathway out of poverty. Small Ruminant Res 2005;60:179-86.

2.

FAO. Población de ovinos en el mundo. FAO; 2016.

3.

Moreno D, Grajales H. Caracterización de los sistemas de producción ovinos de trópico alto en Colombia: manejo e indicadores productivos y reproductivos. Rev Med Vet Zoot 2017;64:36-51.

4.

Mueller JP. Programas de mejora genética de rumiantes menores basados en comunidades. Arch. Latinoam. Prod Anim 2017;25:61-75.

876


Rev Mex Cienc Pecu 2020;11(3):859-883

5.

Martínez H, Amezquita J, Espinal C. Cadena ovinos y caprinos en Colombia. Min Agricultura y Desarrollo Rural, Obs Agrocadenas Colombia 2006;125:40.

6.

Jahuey F. Análisis del genoma completo de caracteres de crecimiento en ganado Charolais de registro: Instituto Politécnico Nacional; 2014.

7.

Bejarano D. Estudio de asociación genómica para características de crecimiento en las razas bovinas Criollas Blanco Orejinegro y Romosinuano. Universidad Nacional de Colombia; 2016.

8.

Martínez C, Manrique C, Elzo M. Cattle genetic evaluation: a historical perception. RCCP 2012;25:293-311.

9.

Zhang L, Liu J, Zhao F, Ren H, Xu L, Lu J, et al. Genome-wide association studies for growth and meat production traits in sheep. PLoS ONE 2013;8:1-12.

10. Zhang H, Wang Z, Wang S, Li H. Progress of genome wide association study in domestic animals. J Anim Sci Biotechnol 2012;3:1-10. 11. Hu ZL, Park CA, Reecy JM. Building a livestock genetic and genomic information knowledgebase through integrative developments of Animal QTLdb and CorrDB. Nucleic Acids Res 2019;47:701-710. 12. Aréchiga C, Aguilera J, Rincón R, Méndez De Lara S, Bañuelos V, Meza-Herrera C. Situación actual y perspectivas de la producción caprina ante el reto de la globalización. Trop Subtrop Agroecosyst 2008;9:1-14. 13. Arcos J, Romero H, Vanegas M, Riveros E. Ovinos Colombianos de pelo. 1 ed. Tolima: Corporación Colombiana de Investigación Agropecuaria; 2002. 14. Simanca J, Vergara O, Bustamante M. Description of growth in sheep Santa Ines x Creole in extensive grazing in two populations from Cordoba, Colombia. Arch Med Vet 2016;57:61-67. 15. Salazar O. Evaluación de la implementación de Buenas Prácticas Pecuarias en la producción de ovinos y caprinos en la zona metropolitana de los municipios de Bucaramanga y Lebrija. Universidad de Manizales; 2015. 16. Delgado J, Nogales S. Biodiversidad Ovina Iberoamericana. Caracterización y uso sustentable. Libro Diversidad Ovina Latinoamericana; 2009. 17. Scintu MF, Piredda G. Typicity and biodiversity of goat and sheep milk products. Small Ruminant Res 2007;68:221-31.

877


Rev Mex Cienc Pecu 2020;11(3):859-883

18. Vivas N. Diversidad genética de ovinos criollos colombianos. Universidad Nacional de Colombia, Sede Palmira; 2013. 19. De Simoni Gouveia J, Paiva S, McManus C, Rodrigues A, Kijas J, Facó O, et al. Genome-wide search for signatures of selection in three major Brazilian locally adapted sheep breeds. Livest Sci 2017;197:36-45. 20. Rubianes E, Ungerfeld R. Perspectivas de la investigación sobre reproducción ovina en América Latina en el marco de las actuales tendencias productivas. Arch Latinoam Prod Anim 2002;10:117-25. 21. SAGARPA. Plan Rector Sistema Productivo Ovinos 2015-2024. 2016;1-47. 22. Montes D, Moreno J, Lugo NH, Ramirez R, Celis A, Garay G. Caracterización faneróptica y morfológica de la hembra ovina de pelo criollo (Camura) colombiana, en la subregión sabanas y golfo de Morrosquillo departamento de Sucre. RECIA 2013;5(1):104-115. 23. Lenis CP. Asociación de SNPs con características de crecimiento muscular en una población de ovinos criollos de pelo con alto mestizaje de Pelibuey en el Valle del Cauca. Universidad Nacional de Colombia, Sede Palmira; 2019. 24. Oliveros A. Comportamiento productivo de ovinos alimentados con dietas a base de fruta de pan (Artocarpus altilis). Universidad Técnica de Ambato; 2017. 25. Martínez R, Vásquez R, Vanegas J, Suárez M. Parámetros genéticos de crecimiento y producción de lana en ovinos usando la metodología de modelos mixtos. Cienc Tecnol Agropecu 2006;7(1):42-49. 26. FAO. Producción de ovinos en el mundo. FAO; 2017. 27. Mueller J. La Producción Ovina en la Argentina. INTA 2013:1-10. 28. Lima M, Júnior FV, Martins C. Características de carcaça de cordeiros nativos de Mato Grosso do Sul terminados em confinamento. Rev Agrarian 2012;5:384-92. 29. Rovadoscki GA. Associação genômica e parâmetros genéticos para características de perfil de ácidos graxos e qualidade de carne em ovinos da raça Santa Inês. Universidad de São Paulo; 2017. 30. Rovadoscki GA, Pertile SFN, Alvarenga AB, Cesar ASM, Pértille F, Petrini J, et al. Estimates of genomic heritability and genome-wide association study for fatty acids profile in Santa Inês sheep. BMC Genomics 2018;19:1-14.

878


Rev Mex Cienc Pecu 2020;11(3):859-883

31. Vargas SA. Biometría del ovino criollo en tres localidades de la sierra del Perú. Universidad Agraria la Molina; 2016. 32. Argüello-Hernández HJ, Cortez-Romero C, Rojas-Martínez RI, Segura-León OL, Herrera-Haro JG, Salazar-Ortiz J, et al. Polimorfismos de la proteína 15 morfogénica ósea (BMP15) y su relación con el tipo de parto en la oveja Pelibuey. Agrociencia 2014;48:53-69. 33. Landi V, Quiroz J. Los avances de las nuevas tecnologías genéticas y su aplicación en la selección animal. AICA 2011;33-43. 34. Palacios Y. Análisis genómico de características de crecimiento muscular y de calidad de la canal en poblaciones ovinas de pelo. Universidad Nacional de Colombia, Sede Palmira; 2018. 35. Ocampo RJ, Martinez RA, Rocha JJ, Cardona H. Genetic characterization of Colombian indigenous sheep. RCCP 2017;30(2):116-125. 36. Montes Vergara D, Lenis Valencia C, Hernández Herrera D. Polimorfismos de los genes Calpaína y Calpastatina en dos poblaciones de ovinos de pelo Colombiano. Rev MVZ Córdoba 2018:7113-7118. 37. Mernies BM, Filonenko F, Fernández YG. Índices zoométricos en una muestra de ovejas Criollas Uruguayas. Arch Zootec 2007;56:473-478. 38. Bravo S, Larama G, Paz E, Inostroza K, Montaldo HH, Sepúlveda N. Polymorphism of the GDF9 gene associated with litter size in Araucana creole sheep. Anim Genet 2016;47(3):390-391. 39. Chavez YA, Martinez B. Estudios de asociación mediante rastreo genómico y su contribución en la genética del asma. Salud Uninorte 2010;26(2):269-284. 40. Pasandideh M, Rahimi-Mianji G, Gholizadeh M. A genome scan for quantitative trait loci affecting average daily gain and Kleiber ratio in Baluchi sheep. Sari Agric Sci Natural Resour Univ 2018;97(2):493-503. 41. Zolezzi I. Genómica y medicina. Educ Quím 2011;22(1):15-27. 42. Guðmundsdóttir ÓÓ. Genome-wide association study of muscle traits in Icelandic sheep. Agricultural University of Island; 2015. 43. Johnston SE, McEwan JC, Pickering NK, Kijas JW, Beraldi D, Pilkington JG, et al. Genome-wide association mapping identifies the genetic basis of discrete and quantitative variation in sexual weaponry in a wild sheep population. Mol 2011;20(12):2555-2566. 879


Rev Mex Cienc Pecu 2020;11(3):859-883

44. Miller JM, Poissant J, Kijas JW, Coltman DW. A genome-wide set of SNPs detects population substructure and long-range linkage disequilibrium in wild sheep. Mol 2011;11:314-322. 45. Kawȩcka A, Gurgul A, Miksza-Cybulska A. The use of SNP microarrays for biodiversity studies of sheep - A review. Ann Anim Sci 2016;16(4):975-987. 46. Ángel P, Cardona H, Cerón M. Genómica en la producción animal. Rev Col Cienc Anim 2013;5(2):497-518. 47. Heaton M, Leymaster K, Kalbfleisch T, Kijas J, Clarke S, McEwan J, et al. SNPs for parentage testing and traceability in globally diverse breeds of sheep. PLoS ONE 2014;9(4):1-10. 48. Munnier N. Identificación y validación de Single Nucleotide Polymorphism (SNPs) distribuidos en el genoma de Eucalyptus globulus. Universidad de Concepción; 2015. 49. Sevilla S. Metodología de los estudios de asociación genética. Insuficiencia cardiaca 2007;2(3):111-114. 50. Chitneedi PK, Gutiérrez-Gil B, Arranz JJ. Evaluación de la imputación de genotipos desde un chip de baja densidad (3K) a media (Chip-50K) y alta (Chip-HD) densidad en el ganado ovino. AIDA 2017;522-524. 51. Goldammer T, Di Meo GP, Lühken G, Drögemüller C, Wu CH, Kijas J, et al. Molecular cytogenetics and gene mapping in sheep (Ovis aries, 2n =54). Cytogenet Genome Res 2009; 126:63-76. 52. Grasso AN, Goldberg V, Navajas EA, Iriarte W, Gimeno D, Aguilar I, et al. Genomic variation and population structure detected by single nucleotide polymorphism arrays in Corriedale, Merino and Creole sheep. Genet Mol 2014;37(2):389-395. 53. Kijas JW, Lenstra JA, Hayes B, Boitard S, Neto LR, Cristobal M, et al. Genome-wide analysis of the world's sheep breeds reveals high levels of historic mixture and strong recent selection. PLoS Biology 2012;10(2):1-14. 54. Agrigenomics. OvineSNP50 Genotyping BeadChip; 2015. 55. Zhao X, Dittmer KE, Blair HT, Thompson KG, Rothschild MF, Garrick DJ. A novel nonsense mutation in the DMP1 gene identified by a genome-wide association study is responsible for inherited rickets in Corriedale sheep. PLoS ONE 2011;6(7):1-6. 56. Nanekarani S, Goodarzi M. Polymorphism of candidate genes for meat production in Lori sheep. IERI Procedia 2014; 8:18-23.

880


Rev Mex Cienc Pecu 2020;11(3):859-883

57. Pant SD, You Q, Schenkel LC, Voort GV, Schenkel FS, Wilton J, et al. A genome-wide association study to identify chromosomal regions influencing ovine cortisol response. Livest Sci 2016;187:40-47. 58. Aali M, Moradi-Shahrbabak H, Moradi-Shahrbabak M, Sadeghi M, Yousefi AR. Association of the calpastatin genotypes, haplotypes, and SNPs with meat quality and fatty acid composition in two Iranian fat- and thin-tailed sheep breeds. Small Ruminant Res 2017;149:40-51. 59. Kominakis A, Hager-Theodorides AL, Zoidis E, Saridaki A, Antonakos G, Tsiamis G. Combined GWAS and ‘guilt by association’-based prioritization analysis identifies functional candidate genes for body size in sheep. Genet Sel Evol 2017;49(41):1-16. 60. Rochus CM, Tortereau F, Plisson-Petit F, Restoux G, Moreno-Romieux C, TosserKlopp G, et al. Revealing the selection history of adaptive loci using genome-wide scans for selection: An example from domestic sheep. BMC Genomics. 2018;19:1-17. 61. Berton MP, Oliveira Silva RM, Peripolli E, Stafuzza NB, Martin JF, Álvarez MS, et al. Genomic regions and pathways associated with gastrointestinal parasites resistance in Santa Inês breed adapted to tropical climate. J Anim Sci Biotechnol 2017;8(73):1-16. 62. Lacerda T. Genes relacionados à prolificidade e seu potencial uso em programas de conservação e melhoramento de ovinos. Universidade de Brasília; 2016. 63. Ortiz Y, Ariza M, Castro S, Ríos M, Sierra L. Identificación genómica de Snps asociados a terneza de la carne de ovino de pelo Criollo Colombiano. AICA 2015;6(1):388-397. 64. Paz E, Montaldo HH, Quiñones J, Sepúlveda N, Bravo S. Genotyping of BMPR1B, BMP15 and GDF9 genes in Chilean sheep breeds and association with prolificacy. Anim Genet 2014;46:98-99. 65. Casas E, White SN. Aplicación de la genómica en características de importancia económica en poblaciones ovinas. X Seminario internacional de producción de ovinos en el trópico 2015;35-44. 66. Noriega J, Hernández D, Bustamante M, Alvarez L, Ariza M, Vergara O. Polymorphisms of candidate genes to growth in two populations of Colombian Creole sheep. INDJSRT 2017;11(46):1-9. 67. Armstrong E, Ciappesoni G, Iriarte W, Da Silva C, Macedo F, Navajas EA, et al. Novel genetic polymorphisms associated with carcass traits in grazing Texel sheep. Meat Sci 2018;145:202-208.

881


Rev Mex Cienc Pecu 2020;11(3):859-883

68. Amorim ST, Kluska S, Berton MP, de Lemos MVA, Peripolli E, Stafuzza NB, et al. Genomic study for maternal related traits in Santa Inês sheep breed. Livest Sci 2018;217:76-84. 69. Biagiotti D. Associação e seleção genômica ampla em ovinos Santa Ines para caracteristicas relacionadas a resi A resistência à endoparasitas. Universidade Federal du Piauí; 2016. 70. Benavides MV, Sonstegard TS, Kemp S, Mugambi JM, Gibson JP, Baker RL, et al. Identification of novel loci associated with gastrointestinal parasite resistance in a red Maasai x Dorper backcross population. PLoS ONE 2015;10(4):1-20. 71. Periasamy K, Pichler R, Poli M, Cristel S, Cetra B, Medus D, et al. Candidate gene approach for parasite resistance in sheep-variation in immune pathway genes and association with fecal egg count. PLoS ONE 2014;9(2):1-16. 72. Muniz MMM, Caetano AR, McManus C, Cavalcanti LC, Façanha DA, Leite JH, et al. Application of genomic data to assist a community-based breeding program: A preliminary study of coat color genetics in Morada Nova sheep. Livest Sci 2016;190:8993. 73. Suazo J, Santos JL, Silva V, Jara L, Palomino H, Blanco R. Estudio de asociación por desequilibrio de ligamiento entre los genes TGFA, RARA, y BCL3 y fisura labiopalatina no sindrómica (FLPNS) en la población chilena. Rev Med Chile 2005;133:1051-1058. 74. Cacheiro P. Métodos de selección de variables en estudios de asociación genética. Aplicación a un estudio de genes candidatos en Enfermedad de Parkinson. Universidad de Santiago de Compostela; 2011. 75. White SN, Mousel MR, Herrmann-Hoesing LM, Reynolds JO, Leymaster KA, Neibergs HL, et al. Genome-wide association identifies multiple genomic regions associated with susceptibility to and control of ovine lentivirus. PLoS ONE 2012;7(10):1-10. 76. Kijas JW, Serrano M, McCulloch R, Li Y, Salces J, Calvo JH, et al. Genome wide association for a dominant pigmentation gene in sheep. J Anim Breed Genet 2013; 130:468-475. 77. Galeano AP, Manrique C. Estimación de parámetros genéticos para características productivas y reproductivas en los sistemas doble propósito del trópico bajo colombiano. Rev Med Vet Zoot 2010;57(2):119-131.

882


Rev Mex Cienc Pecu 2020;11(3):859-883

78. Becker D, Tetens J, Brunner A, Burstel D, Ganter M, Kijas J, et al. Microphthalmia in Texel sheep is associated with a missense mutation in the paired-like homeodomain 3 (PITX3) gene. PLoS One 2010;5(1):1-9. 79. Momke S, Kerkmann A, Wohlke A, Ostmeier M, Hewicker-Trautwein M, Ganter M, et al. A frameshift mutation within LAMC2 is responsible for Herlitz type junctional epidermolysis bullosa (HJEB) in black headed mutton sheep. PLoS ONE 2011;6(5):16. 80. Zhao X, Onteru SK, Piripi S, Thompson KG, Blair HT, Garrick DJ, et al. In a shake of a lamb's tail: using genomics to unravel a cause of chondrodysplasia in Texel sheep. Anim Genet 2012;43(1):9-18. 81. Kijas JW, Townley D, Dalrymple BP, Heaton MP, Maddox JF, McGrath A, et al. A genome wide survey of SNP variation reveals the genetic structure of sheep breeds. PLoS ONE 2009;4(3):1-13.

883


https://doi.org/10.22319/rmcp.v11i3.5157 Nota de investigación

Crecimiento de corderos y productividad en ovejas Pelibuey mantenidas bajo condiciones tropicales de producción

Carolina Atenea García-Chávez a Carlos Luna-Palomera a* Ulises Macías-Cruz b José Candelario Segura-Correa c Nadia Florencia Ojeda-Robertos a Jorge Alonso Peralta-Torres a Alfonso Juventino Chay-Canúl a

a

Universidad Juárez Autómoma de Tabasco. División Académica de Ciencias Agropecuarias, Laboratorio de Reproducción y Genética Animal. Av. Universidad S/N, Zona de la Cultura, Col. Magisterial. Villahermosa, Tabasco, México. b

Universidad Autónoma de Baja California. Instituto de Ciencias Agrić olas. Valle de Mexicali, Baja California, México. c

Universidad Autónoma de Yucatán. Campus de Ciencias Agropecuarias. Mérida Yucatán México.

*Autor de correspondencia: carlos.luna@ujat.mx

Resumen: El objetivo fue evaluar los efectos de época y año de nacimiento, tipo de parto, sexo y número de parto sobre el crecimiento predestete y la productividad de las ovejas en ovinos de raza Pelibuey que producen bajo un sistema semi-extensivo en el trópico húmedo de México. Se usaron datos de 323 ovejas Pelibuey a partir de registros de producción de

884


Rev Mex Cienc Pecu 2020;11(3):884-893

2011-2017. Se evaluaron los pesos al nacimiento (PN) y al destete (PD, a 60 d), así como los pesos de camada al destete (PCD). Adicionalmente, se evaluó prolificidad, mortalidad hasta el destete y kilos de cordero producido por oveja en un ciclo de 240 días (PC240d). Todos los factores afectaron (P≤0.05) las variables de respuesta. Los corderos procedentes de partos múltiples tuvieron menor (P<0.05) PN y PD, pero mayor (P<0.05) PCD, PC240d y mortalidad que los corderos procedentes de partos simples. Los corderos nacidos en época de seca tuvieron mayores (P<0.05) PN y PD, mientras que las ovejas tuvieron mayores PCD y PC240d, comparado con otras épocas del año. Las ovejas primíparas tuvieron corderos más livianos (P<0.05) al nacimiento y al destete, así como menor (P<0.05) prolificidad, PCD y PC240d que las ovejas multíparas (≥3 partos). El año de nacimiento afectó (P<0.05) PN, PD, tasa de mortalidad y características de productividad. En conclusión, se observó un mejor desempeño en el crecimiento predestete para corderos Pelibuey nacidos de ovejas multíparas y con parto simple en la época de seca. Sin embargo, la productividad de la oveja fue mejor con la presencia de partos dobles, en tiempo de sequía, y con el aumento en número de partos. Palabras clave: Ovino de pelo, Peso al nacimiento, Crecimiento pre-destete, Corderos.

Recibido: 20/11/2018 Aceptado: 29/07/2019

El crecimiento pre-destete de los corderos y la productividad de las ovejas son aspectos críticos de la producción ovina que impactan en la rentabilidad de los rebaños. Estos aspectos deben estar en constante evaluación en las explotaciones ovinas, ya que son indicadores productivos que marcarán la pauta para ajustar o incorporar nuevas estrategias de manejo, nutricionales y de mejora genética(1,2). El número de corderos nacidos, peso al nacimiento, peso al destete ajustado a 60 días, intervalo entre parto y mortalidad predestete son características de importancia económica usadas en la estimación de parámetros de productividad(3,4,5). La productividad de la borrega se describe como una característica compuesta que es determinada por la fertilidad del rebaño, el número de corderos por parto, el peso total de la camada al nacimiento, el peso promedio de los corderos destetados, el peso total de la camada al destete y el número de corderos destetados(6). Desde el punto de vista práctico, cada una de estas características puede ser utilizada como un criterio de selección, pero se espera que la combinación de rasgos en un índice de selección apropiado pudiera lograr ganancias de mejora genética por generación o por año más eficientes(3,7,8,9).

885


Rev Mex Cienc Pecu 2020;11(3):884-893

La productividad, así como otras características de importancia económica, es el resultado de la interacción entre genotipo y ambiente. Los componentes genéticos incluyen factores como edad, prolificidad y número de partos de la oveja; mientras que en los factores ambientales se consideran manejo nutricional del rebaño, año de parto, condiciones ambientales de las épocas de parto y disponibilidad de forraje(10). Todos estos factores genéticos y ambientales impactan significativamente el desempeño reproductivo y la productividad de las ovejas, así como el desarrollo y el crecimiento de los corderos(10,11). A fin de establecer estrategias de manejo y selección dentro de los rebaños de ovinos Pelibuey en las regiones de trópico húmedo, resulta importante identificar los factores genéticos y ambientales que influyen en el crecimiento predestete de los corderos, así como en la productividad de las ovejas a corto y largo plazo(4). Cabe mencionar que, se requiere investigar más los factores asociados con el crecimiento de los corderos y la capacidad productiva de las ovejas Pelibuey. La generación de esta información es de gran relevancia para la toma de decisiones respecto al manejo y establecimiento de estrategias de mejora genético para la conservación de los ovinos Pelibuey bajo su hábitat natural. El objetivo de este estudio fue evaluar los efectos de algunos factores ambientales sobre el crecimiento predestete de los corderos y la productividad de las ovejas en ovinos Pelibuey bajo un sistema productivo semi-extensivo en el trópico húmedo. La información de este estudio se obtuvo de los registros productivos (2011-2017) de ovejas Pelibuey (n= 323) de una unidad de producción en Tabasco, México. El clima en la región es tropical húmedo con lluvias todo el año (2,550 mm en promedio). De acuerdo a las variaciones circanuales en las variables climáticas, en la región se identifican tres épocas: seca (marzo a mayo), lluviosa (junio a octubre) y de nortes (noviembre a febrero). Las temperaturas promedio de mínimas y máximas son 18 y 36 ºC, respectivamente, con un promedio anual general de 27 ºC. La humedad relativa fluctúa entre 60 y 95 %, dependiendo de la época del año(12). La unidad de producción tenía dos módulos. El primero tenía un área de 15 ha y estaba diseñado para realizar los empadres, es decir contaba con galeras, corrales de apareamiento, área de pastoreo (2 ha de pasto Panicum maximum y 9.5 ha de pasto Cynodon dactylon) y área de siembra de maíz para ensilado (3.5 ha). El segundo módulo (parideros) albergaba a las ovejas gestantes, y tenía una extensión de 5 ha provista de galeras techadas para el nacimiento y cuidado de los corderos. El manejo general de los animales de 2011 a 2017 consistió en monta natural controlada, con empadre continuo con 25 a 30 ovejas por semental. Al parto, los corderos permanecían confinados con sus madres las primeras semanas. Posteriormente, las ovejas salían a pastorear, mientras que los corderos tenían acceso libre a concentrado, en jaulas “creep

886


Rev Mex Cienc Pecu 2020;11(3):884-893

feeding” durante los 60 días de periodo predestete. Finalizado este periodo post-parto, los corderos se engordaban para abasto o se seleccionaban como sementales, mientras que las mejores corderas se apartaban como reemplazos y eran alojadas en corrales de pisos elevados. Las ovejas recibían complementos dietarios comerciales, esto para satisfacer los requerimientos nutricionales de acuerdo al estado fisiológico: empadre (proteína cruda [PC]= 12 % y energía metabolizable [EM]= 2.4 Mcal/kg de materia seca [MS]), gestación (PC= 11-12 % y EM= 2.4 Mcal/kg de MS) y lactación (PC= 12-16 % y EM= 2.2.-2.5 Mcal/kg de MS). En la época de baja disponibilidad de forraje para pastoreo, se ofrecía heno en corral junto con el complemento de concentrado comercial. La presencia de parásitos se monitoreaba cada mes mediante la prueba de FAMACHA©, desparasitando alternativamente con albendazole al 2.5 % (Valbazen, Zoetis®) y levamisole al 12.0 % (Riperocol, Zoetis®), previo examen coproparasitoscópico cada tres meses. Los animales se vacunaban contra clostridiasis y pasteurelosis neumónica cada 6 meses (abril y octubre) y el rebaño estaba libre de Brucelosis. La base de datos se elaboró con registros de 343 ovejas que parieron entre 2011 y 2017 y que produjeron 2,335 corderos. La información colectada para cada oveja fue: número de parto, época de parto, fecha de parto, y número de corderos nacidos, destetados y a los 240 d postparto. Para cada cría se obtuvo: identificación, sexo, y peso al nacimiento (PN), al destete (PD) y a los 240 d postparto. Se calculó la prolificidad (número de crías nacidas por oveja parida), tasa de mortalidad predestete (porcentaje de crías muertas en el periodo), y peso de camada al destete (PCD; peso total de la camada ajustado a 60 d) y a 240 d postparto (PC240d). La productividad ajustada a 240 días(2) se definió como el PCD ajustada por el intervalo entre partos de la oveja y multiplicada por 240 días (tiempo óptimo para obtener tres partos en dos años, bajo un sistema de apareamiento continuo). Toda la información se analizó con el paquete estadístico SAS(13). Para PN y PD, el modelo incluyó los efectos fijos de año de parto, época de nacimiento, tipo de parto, sexo, número de parto y las interacciones de primer orden. Para PCD y PC240d se utilizó el modelo anterior, pero sin incluir el efecto de sexo e interacciones. En el caso de prolificidad, el modelo incluyó los efectos de año de parto, época de nacimiento, número de parto e interacciones simples. Las interacciones no fueron significativas (P>0.05) para ninguna variable de estudio. La mortalidad predestete se analizó mediante pruebas de Ji-cuadrada. Todos los rasgos predestete y de productividad fueron afectados (P≤0.05) por los factores en estudio, excepto época sobre la prolificidad y mortalidad predestete. Los resultados de los efectos de tipo de nacimiento, época del año y sexo se presentan en el Cuadro 1. Los corderos de ovejas parto simple tuvieron mayores (P<0.05) PN y PD, pero menor PCD y PC240d que los corderos nacidos con otro tipo de parto. La mortalidad fue mayor en

887


Rev Mex Cienc Pecu 2020;11(3):884-893

corderos de parto triple, seguidos de aquellos de parto simple. Los corderos nacidos en época de secas tuvieron mayor (P<0.05) PN, PD, PCD y PC240d, pero similar prolificidad y tasa de mortalidad (P>0.05) que los corderos nacidos en las épocas de lluvias y nortes. Los corderos al nacimiento y destete fueron más pesados (P<0.05) que las corderas. El sexo no afectó (P>0.05) la tasa de mortalidad predestete. Cuadro 1: Medias de cuadrados mínimos y error estándar por efecto de tipo de parto, época del año y sexo para variables de crecimiento predestete de corderos y productividad de ovejas Pelibuey PC240d Mort PN (kg) PD (kg) PCD (kg) Prol (kg) (%) Tipo de parto Simple Doble Triple Época de parto Seca Lluvia Norte Sexo Macho Hembra

<0.0001

<0.0001

<0.0001

<0.0001

-

<0.01

3.14±0.03a 2.52±0.02b 2.04±0.05c <0.0001

12.82±0.15a 10.56±0.17b <0.0001

12.92±0.20a 20.76±0.22b <0.0001

11.56±0.39a 19.15±0.43b <0.0001

0.36

21.34b 15.07c 30.17a >0.05

2.63±0.04a 2.53±0.03b 2.54±0.03b <0.0001 2.64±0.03a 2.50±0.03b

12.45±0.23a 11.79±0.16b 10.82±0.17c <0.0001 12.11±0.16a 11.26±0.15b

18.09±0.31a 16.84±0.21b 15.59±0.22c -

16.67±0.46a 15.02±0.76b 14.36±0.39b -

1.61+0.04a 1.51+0.05a 1.56+0.05a -

22.10a 22.10a 22.38a >0.05 21.24a 23.14a

PN= peso al nacimiento, PD= peso al destete; PCD= peso camada al destete; PC240d= peso camada ajustado a 240 días; Prol= prolificidad; Mort= mortalidad predestete. abc Literales diferentes entre hileras indican diferencias estadísticas significativas (P<0.01).

Los resultados del número de parto por oveja se presentan en el Cuadro 2. Los corderos nacidos de ovejas primíparas tuvieron los más bajos (P<0.01) PN, PD, PCD, PC240d y prolificidad. Con respecto a la mortalidad las ovejas primíparas tuvieron mortalidad similar a las ovejas con seis partos.

888


Rev Mex Cienc Pecu 2020;11(3):884-893

Cuadro 2: Medias de cuadrados mínimos y error estándar por efecto de número de parto para variables de crecimiento predestete de corderos y productividad de ovejas Pelibuey PC240d PN (kg) PD (kg) PCD (kg) Prol Mort (%) (kg) Núm. parto 1 2 3 4 5 6 ≥7

<0.0001

<0.0001

<0.0001

<0.001

<0.01

2.20±0.03d 2.48±0.03c 2.59±0.03b 2.65±0.04a,b 2.72±0.04a 2.72±0.05a 2.61±0.05a,b

10.82±0.17d 11.94±0.20b 12.15±0.23ab 11.94±0.26b 11.92±0.30b 12.52±0.37a 11.40±0.32c

15.52±0.22b 17.02±0.26a 17.43±0.30a 17.18±0.34a 16.73±0.39a 17.32±0.47a 16.69±0.45a

13.50±0.43b 15.42±0.47a 15.89±0.50a 15.74±0.55a 15.84±0.64a 15.58±0.76a 15.50±0.88a

1.39+0.03c 1.45+0.04c 1.54+0.04b 1.72+0.05a 1.62+0.05a 1.50+0.05bc 1.60+0.06ab

<0.01 24.77a 19.99b 19.79b 23.08ab 20.15b 26.58a 20.99b

PN= peso al nacimiento; PD= peso al destete ajustado a 60 días, PCD= peso camada al destete, PC240d= peso camada ajustado a 240 días, Prol= prolificidad; Mort= mortalidad predestete. abcd Literales diferentes entre hileras indican diferencias estadísticas significativas (P<0.05).

El mejor PN y PD de las crías de ovejas de parto simple, no fue suficiente para que estás mostraran mejor productividad; ya que las ovejas de parto múltiple tuvieron mayor PCD y PC240d. Similares resultados sobre el crecimiento pre-destete de corderos y la productividad de la oveja Pelibuey han sido notificados en estudios previos, tanto en climas tropicales sub-húmedos(2) como áridos(1). El menor PN y crecimiento pre-destete de las crías provenientes de partos múltiples pude deberse una programación fetal de retardo en el crecimiento de las crías en el periodo pre-natal(14), así como por la presencia de un cuadro de subalimentación en los corderos, porque la producción de leche materna es insuficiente para nutrir adecuadamente a dos o más crías simultáneamente(15). Adicionalmente, el espacio uterino es limitado para fetos de preñez múltiple, reflejándose en corderos con ligero PN(1,15). Si bien, los corderos nacidos de parto múltiple presentan menor crecimiento y mayor tasa de mortalidad predestete, el tamaño de camada al destete por oveja es mayor, lo cual favorece que la cantidad de kilogramos de cordero destetado por oveja también aumente. Por otra parte, en congruencia con los resultados del efecto de sexo, diversos estudios reportan menor PN y PD en corderas que en corderos de la raza Pelibuey o sus cruzas(15,16,17). Esto se debe a que los corderos desde la etapa pre-natal hasta la postnatal están secretando testosterona; siendo esa hormona esteroidal importante en el crecimiento de los corderos, porque tiene efectos anabólicos y estimula la liberación de la hormona del crecimiento(18). La época y el año de nacimiento fueron otros factores que influyeron en el crecimiento de los corderos y la productividad de la oveja. El efecto de año y época era esperado debido a

889


Rev Mex Cienc Pecu 2020;11(3):884-893

las variaciones climáticas, así como a la disponibilidad y calidad de forraje que en los sistemas extensivos y semi-extensivos cambian de año en año(19). Los años y épocas donde hay más lluvia, y las temperaturas son más termoneutrales para los ovinos, los corderos presentan un mejor crecimiento debido a la mayor disponibilidad del alimento para la cría y la madre(16,20). En consecuencia, se disminuye la mortalidad pre-destete y aumentan los kilogramos de cordero destetado por oveja parida durante la mejor época del año. Lo anterior explica, porque el crecimiento de los corderos y la productividad de las ovejas fueron mejores en algunos años que en otros, lo cual coincide con resultados de estudios previos realizados en zonas tropicales de México(11,17,21). En el presente estudio, el mejor crecimiento de los corderos y la productividad de las ovejas Pelibuey en la época de sequía coincide parcialmente con estudios realizados en la misma región, donde uno de ellos(17) encontró mejor crecimiento predestete en los corderos Pelibuey nacidos en las épocas de secas y lluvias. Sin embargo, Tec et al(21) señalan un aumento en la productividad de la oveja al destete durante las épocas de sequías y nortes. Estas discrepancias en los resultados pueden deberse a variaciones entre los estudios con respecto a instalaciones, manejo y esquema nutricional. Por otra parte, los corderos nacidos de ovejas multíparas presentaron mejor PN y PD que los corderos nacidos de ovejas primíparas, lo que se reflejó en una mejor productividad para las ovejas multíparas. El número de partos constituye un rasgo de interés económico ya que influye en la eficiencia de la vida productiva de las ovejas y en el crecimiento de las crías. En ovejas Pelibuey(21,22) y Blackbelly(23) se ha documentado que, tanto PN y PD así como la prolificidad y la productividad de las ovejas al destete, mejoran a partir del segundo parto. El hecho que las ovejas primíparas paran crías con pesos ligeros y de menor capacidad de crecimiento predestete, posiblemente se deba a que estas ovejas no destinan la cantidad adecuada de nutrientes para el desarrollo y crecimiento del feto; esto como una consecuencia de la gran cantidad de nutrientes que requieren para su desarrollo(24). Existen evidencias(24) que sugieren que el útero de ovejas primíparas es de menor tamaño y tiene menos flexibilidad que el útero de ovejas multíparas; en consecuencia, la falta de espacio uterino también limita la capacidad de crecimiento fetal y el peso al nacer de la cría. En general, la tasa de mortalidad predestete en el presente estudio fue más alta que la reportada para corderos Black Belly(3) y Katahdin(25), pero comparable a la tasa de mortalidad encontrada para corderos de la cruza Pelibuey x Katahdin(5). La alta tasa de mortalidad predestete en los sistemas de producción de ovinos en el trópico húmedo de México es uno de los aspectos en los que se debe poner mayor atención, ya que impactan negativamente en la productividad de los rebaños. Es un tema complejo que incluye múltiples factores tales como la sobrevivencia del cordero, la habilidad materna de la oveja, prácticas sanitarias de manejo en el pre- y post-parto, producción de leche, clima, entre

890


Rev Mex Cienc Pecu 2020;11(3):884-893

otros(26,27,28). Los resultados de mortalidad sugieren que el clima, la habilidad materna y las prácticas de manejo en el rebaño juegan un rol importante para aumentar las posibilidades de sobrevivencia de los corderos. Se concluye que, bajo las condiciones semi-extensivas de trópico húmedo, el crecimiento predestete de los corderos y la productividad de las ovejas Pelibuey son afectados por factores ambientales e inherentes a la raza. Los corderos de nacimiento sencillo crecen más rápido, pero generan menos productividad por oveja al destete y en ciclos de 240 días. El mejor crecimiento pre-destete de los corderos y la mayor productividad de la oveja se presenta en la época de secas y en ovejas multíparas.

Agradecimientos Los autores agradecen al arquitecto Juan Carlos Domínguez García por permitirnos acceder a la información para caracterizar el rebaño y publicar los resultados.

Literatura citada: 1. Macías CU, Álvarez VFD, Correa CA, Molina RL, González RA, Soto NS, Avendaño RL. Pelibuey ewe productivity and subsequent pre-weaning lamb performance using hair sheep breeds under confinement system. J Appl Anim Res 2009;36:255-260. 2. Magaña MJG, Huchin CM, Ake LJR, Segura CJC. A field study of reproductive performance and productivity of Pelibuey ewes in Southeastern Mexico. Trop Anim Health Prod 2013;45:1771-1776. 3. Knights M, Siew N, Ramgattie R, Singh-Knights D, Bourne G. Effect of time of weaning on the reproductive performance of Barbados Blackbelly ewes and lamb growth reared in the tropics. Small Ruminant Res 2012;103:205-210. 4. Nasrat MM, Segura CJC, Magaña MJG. Breed genotype effect on ewe traits during the pre-weaning period in hair sheep under the tropical Mexican conditions. Small Ruminant Res 2016;137:157-161 5. Mellado M, Macías U, Avendaño L, Mellado J, García E. Crecimiento y mortalidad predestete de corderos híbridos Katahdin. Rev Colomb Cienc Pecu 2016;29:288-295. 6. Wildeus, S. Hair sheep genetic resources and their contribution to diversified small ruminant production in the United States. J Anim Sci 1997;75:630–640.

891


Rev Mex Cienc Pecu 2020;11(3):884-893

7. Afolayan RA, Gilmour AR, Fogarty NM. Selection indexes for crossbred ewe reproduction and productivity. Proc Assoc Advt Anim Breed Genet 2007;17:491-494. 8. Vanimisetti HB, Notter DR, Kuehn LA. Genetic (co) variance components for ewe productivity traits in Katahdin sheep. J Anim Sci 2007;85:60-68. 9. Mohammadi H, Shahrbabak MM, Shahrbabak HM. Genetic analysis of ewe productivity traits in Makooei sheep. Small Ruminant Res 2012;107:105-110. 10. Bermejo LA, Mellado M, Camacho A, Mata J, Arévalo JR. Factors affecting birth and weaning weights in Canarian hair lambs. J Appl Anim Res 2010;37:273–275. 11. Hinojosa CJA, Oliva HJ, Torres HG, Segura CJC, González GR. Productividad de ovejas F1 Pelibuey x Blackbelly y sus cruces con Dorper y Katahdin en un sistema de producción del trópico húmedo de Tabasco, México. Arch Med Vet 2015;47:167-174.

12. De Dios-Vallejo OO. Ecofisiología de los bovinos en sistemas de producción del trópico húmedo. Colección José N. Rovirosa. Villahermosa, Tabasco. México. 2001. 13. SAS. SAS/STAT User´s Guide (version 9.2 ed), Cary, NC, USA: SAS, Inst. Inc. 2009. 14. Macías CU, Vicente PR, Mellado M, Correa A, Meza HCA, Avendaño RL. Maternal undernutrition during the pre- and post-conception periods in twin-bearing hair sheep ewes: Effects on fetal and placental development at mid-gestation. Trop Anim Health Prod 2017;49:1393-1400. 15. Macedo R, Arredondo V. Efecto del sexo, tipo de nacimiento y lactancia sobre el crecimiento de ovinos Pelibuey en manejo intensivo. Arch Zootec 2008;57:219-228. 16. Hinojosa CJA, Oliva HJ, Torres HG, Segura CJC, Aranda IE, González CJM. Factores que afectan el crecimiento predestete de corderos Pelibuey en el trópico húmedo de México. Universidad y Ciencia 2012;28:163-171. 17. Hinojosa CJA, Oliva HJ, Torres HG, Segura CC, González GR. Crecimiento pre y postdestete de corderos Pelibuey en clima cálido húmedo. Nova Scientia 2018;10:328351. 18. O’Shaughnessy P. Testicular development. In: Knobil and Neill's Physiology of Reproduction. Plant TM, Zeleznik AJ editors. 4th ed. USA: Elsevier Inc.; 2015. 19. Kosgey IS, van Arendonk JAM, Baker RL. Economic values for traits of meat sheep in medium to high production potential areas of the tropics. Small Ruminant Res 2003; 50:187-202.

892


Rev Mex Cienc Pecu 2020;11(3):884-893

20. Chay CAJ, Magaña MJG, Chizzoti ML, Piñeiro VAT, Canul SJR, Ayala BAJ, Ku VJC, Tedeschi LO. Requerimientos energéticos de ovinos de pelo en las regiones tropicales de Latinoamérica. Revisión. Rev Mex Cienc Pecu 2016;7:105-125. 21. Tec CJE, Magaña MJG, Segura CJC. Environmental effects on productive and reproductive performance of Pelibuey ewes in Southeastern Mexico. J Appl Anim Res 2016;44:508-512. 22. López LY, Arece GJ, Torres HG, González GR. Efecto del número de partos en el comportamiento productivo de ovejas Pelibuey y mestizos de Pelibuey en condiciones de producción. Pastos y Forrajes 2017;40:73-77. 23. Cadena CPJ, Oliva HJA, Hinojosa CA. Productivity of Blackbelly ewes and their hybrid litter under grazing. J Anim Vet Adv 2012;11:97-102. 24. Gootwine E, Spencer TE, Bazer FW. Litter-size-dependent intrauterine growth restriction in sheep. Animal 2007;1:547-564. 25. Rastle SS, D´Souza K, Redhead A, Singh KD, Baptiste Q, Knights M. Effect of system of lamb rearing and season on early post-partum fertility of ewes and growth performance of lambs in Katahdin sheep. J Anim Physiol Anim Nutr 2017;101:e21e30. 26. Mandal A, Prasad H, Kumar A, Roy R, Sharma N. Factors associated with lamb mortalities in Muzaffarnagari sheep. Small Ruminant Res 2007;71:273–279. 27. Dwyer CM. Behavioral development in the neonatal lamb: effect of maternal and birthrelated factors. Theriogenology 2003;59:1027- 1050. 28. Wallace J. Young maternal age, body composition and gestational intake impact pregnancy outcome: Translational perspectives. In: Green L, Hester R editors. Parental obesity: Intergenerational programming and consequences. Physiology and health disease. New York, USA: Springer; 2016.

893


https://doi.org/10.22319/rmcp.v11i3.5279 Nota de investigación

La identificación de genes candidatos para rasgos de la reproducción en ganado utilizando un enfoque de redes de interacciones funcionales

Francisco Alejandro Paredes-Sánchez a Daniel Trejo-Martínez b Elsa Verónica Herrera-Mayorga c Williams Arellano-Vera d Felipe Rodríguez Almeida e Ana María Sifuentes-Rincón d*

a

Universidad Autónoma de Tamaulipas. IA-UAMM. Mante, México.

b

Instituto Politécnico Nacional. UPIIZ-, Zacatecas, México.

c

Universidad Autónoma de Tamaulipas IBI. UAMM. Mante, México

d

Instituto Politécnico Nacional. Centro de Biotecnología Genómica. Laboratorio de Biotecnología Animal. Blvd. Del Maestro esq. Elías Piña. Col. Narciso Mendoza s/n. Cd. Reynosa, Tam. México. e

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología. Chihuahua, México.

*Autor de correspondencia: asifuentes@ipn.mx

Resumen: La reproducción es un elemento clave en los sistemas de producción de ganado bovino. Se han aplicado los enfoques de biología de sistemas, incluidos los que involucran las redes de genes, a la disección genética de fenotipos complejos de ganado. Se hizo un análisis de la red proteína-proteína, incluyendo un conjunto de 385 genes asociados con rasgos reproductivos 894


Rev Mex Cienc Pecu 2020;11(3):894-904

en el ganado, para identificar y priorizar genes candidatos relacionados con las diferencias fenotípicas en la reproducción del ganado. Los genes que pertenecen a la familia de la ubiquitina - Ubiquitina C (Ubc, ID del gen: 444874) y Ubiquitina B (Ubb, ID del gen: 281370) - presentaron la mayor probabilidad de estar asociados con estos rasgos en el ganado. Se identificaron ambas proteínas como centros muy importantes en una red de interacción proteína-proteína ya que cada una tienen 3,775 interacciones de 3,856 posibles. Al resecuenciar la región de codificación del gen Ubb para evaluar la presencia de SNP en una población de descubrimiento, se identificó la transversión G/T (rs110366695), que provoca la aparición de un codón de terminación y una proteína truncada en 287 aa. Las distribuciones de frecuencia alélicas descubiertos en dos razas de ganado vacuno podrían justificar investigaciones adicionales enfocados en explorar tanto los efectos del truncamiento de proteínas como el potencial de estas proteínas como marcadores moleculares para la calidad del semen. Palabras clave: Bos taurus, Marcadores moleculares, Calidad de semen, Ubiquitinización.

Received: 25/02/2019 Accepted: 28/08/2019 La identificación de los genes que codifican rasgos complejos se ha logrado tradicionalmente por medio del escaneo del genoma entero en conjunto con el enfoque del gen candidato. Sin embargo, estos métodos no constituyen una estrategia confiable para la exploración sistemática de una red genética en la cual ocurre variación fenotípica en rasgos complejos(1). Las redes de proteínas proporcionan una visión general de la organización genética a nivel de los sistemas y permiten la disección de los módulos funcionales que subyacen a los rasgos complejos. Esto facilita la predicción de nuevos genes candidatos para un rasgo(2). En el ganado bovino, se han utilizado algunos enfoques relacionados con las redes de interacción para identificar los genes candidatos relacionados con diferencias fenotípicas. Algunos ejemplos de estos comprenden: el marmoleado(3), los genes involucrados en el estro (comportamiento) en el ganado lechero(4) y los polimorfismos de un solo nucleótido (SNP) asociados con rasgos de crecimiento en vacas de la raza Charolais en México(5). La reproducción es un elemento esencial en la producción de ganado y los rasgos genéticos de la fertilidad tienen una relevancia económica muy significativa. Este proceso complejo involucra varios eventos consecutivos, los cuales incluyen la gametogénesis, la fertilización y el desarrollo embrionario temprano, entre otros. Ellos deben de ocurrir de una manera bien orquestada para lograr una preñez exitosa(6). 895


Rev Mex Cienc Pecu 2020;11(3):894-904

Una mejor comprensiĂłn de los mecanismos que controlan los rasgos de fertilidad a nivel orgĂĄnico, celular y molecular podrĂ­a ayudar en el desarrollo de estrategias diseĂąadas para mejorar o controlar la fertilidad(4). El objetivo de este trabajo fue aplicar una red de interacciĂłn funcional para guiar a la identificaciĂłn de los genes clave que controlan los rasgos reproductivos en el ganado bovino y explorar la variaciĂłn genĂŠtica dentro de estos genes para descubrir los que tienen el potencial de estar asociados con rasgos reproductivos. Se llevĂł a cabo una revisiĂłn de la literatura. Se utilizĂł el software Genie (http://cbdm01.zdv.uni-mainz.de/~jfontain/cms/?page_id=6) para extraer de texto basada en el PubMed a los genes que se han asociado previamente con rasgos reproductivos en bovinos (es decir, los genes de referencia). Para identificar y priorizar los genes candidatos para la red funcional se extrajeron las interacciones de los genes de referencia y se calculĂł el grado de asociaciĂłn con la reproducciĂłn (DAR, por sus siglas en inglĂŠs) en la subred para cada uno de los genes usando la siguiente formula: đ??ˇđ??´đ?&#x2018;&#x2026; = ÎŁđ?&#x2018;&#x2014;â&#x2C6;&#x2C6;đ?&#x2018;&#x;đ?&#x2018;&#x2019;đ?&#x2018;&#x201C;đ?&#x2018;&#x201D;đ?&#x2018;&#x2019;đ?&#x2018;&#x203A;đ?&#x2018;&#x2019;đ?&#x2018; đ?&#x2018;&#x160;đ?&#x2018;&#x2013;đ?&#x2018;&#x2014; . ÎŁđ?&#x2018;&#x2014;â&#x2C6;&#x2C6;đ?&#x2018;&#x;đ?&#x2018;&#x2019;đ?&#x2018;&#x201C;đ?&#x2018;&#x201D;đ?&#x2018;&#x2019;đ?&#x2018;&#x203A;đ?&#x2018;&#x2019;đ?&#x2018;  đ?&#x2018;&#x192;đ?&#x2018;&#x2013;đ?&#x2018;&#x2014; Donde Wij es el peso del enlace que conecta la proteĂ­na i a la proteĂ­na de referencia j; y Pij es el nĂşmero de enlaces que conectan la proteĂ­na i a la proteĂ­na de referencia j (excluyĂŠndose a sĂ­ mismo). Desde luego, la probabilidad de que cada una de estas proteĂ­nas estĂĄ asociada con la reproducciĂłn se evaluĂł considerando sus interacciones con otros genes cuyas funciones biolĂłgicas se saben estĂĄn relacionadas con la reproducciĂłn(5). La selecciĂłn de los genes candidatos asociados con las variaciones fenotĂ­picas en los rasgos reproductivos se hizo por medio de la puntuaciĂłn DAR. Con ĂŠsta se calculĂł el valor predictivo positivo (VPP), el cual representa la probabilidad de que un gen estĂŠ asociado con la reproducciĂłn; el criterio de selecciĂłn fue el VPP mĂĄs alto resultando de este anĂĄlisis, es decir, 0.3(5,7). De los genes candidatos identificados, se seleccionĂł el gen Ubiquitina B (Ubb) como blanco. Luego se analizĂł la variaciĂłn genĂŠtica en el Ubb utilizando once muestras de ADN de cuatro razas de ganado diferentes (3 Holstein, 2 Charolais, 3 Brahman y 3 Angus). Los cebadores UBB-F 5â&#x20AC;&#x2122;-GAGAGATTTGTGAGAGATCTTGACG-3â&#x20AC;&#x2122; y UBB-R 5â&#x20AC;&#x2122;CCATTTTAACCTGTTGAGTACCCA-3â&#x20AC;&#x2122; fueron diseĂąados para cubrir y resecuenciar el Ubb bovino (nĂşmero de acceso GenBank: AC_000176.1). Se purificaron los fragmentos producidos en el PCR usando el Exo-SAP-it (Thermo Fisher Scientific, Waltham, MA, EE.UU.). Se hizo la secuenciaciĂłn bidireccional por medio del procedimiento BigDyeÂŽ Terminator y usando un secuenciador de ADN ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, EE.UU.). Las secuencias se alinearon con el programa de ClustalX 2.0.8(8).

896


Rev Mex Cienc Pecu 2020;11(3):894-904

Por medio de la inspección visual de los cromatogramas de secuencia se confirmó la presencia de los SNP en las secuencias resultantes. Se definieron a los SNP de acuerdo a su presencia en la población de selección asociada con los tres genotipos esperados. Se diseñaron sitios de restricción creados por la amplificación y acoplados al PCR (PCRACRS) para identificar los genotipos del SNP no sinónimo rs110366695 encontrados en el anterior cribado de secuenciación. Después de la PCR, se digirieron a los fragmentos usando 2.5 U del enzima Hinf I para luego analizarlos en un gel de agarosa al 2.5%. Se observaron los siguientes patrones de digestión: 210+132+130+18 pb (alelo G), y 210+155+150 pb (alelo T). Se identificaron los genotipos de una población de sesenta y siete toros jóvenes de las razas Angus y Charolais usando el PCR-ACRS. Las frecuencias alélicas y genotípicas se calcularon para cada raza y se probaron las desviaciones del equilibrio de Hardy-Weinberg con el paquete estadístico GENEPOP versión 4.2(9). Un conjunto de 385 genes de referencia asociados con rasgos reproductivos en bovinos se identificó por medio de sus SNP, sus perfiles de expresión o su función biológica. Según el VPP, los genes que presentaban un DAR≥11 tenían una probabilidad superior al 33% de estar asociados con rasgos reproductivos en el ganado. Los que cumplían este criterio pertenecían a la familia de la ubiquitina: Ubiquitina C (Ubc; ID del gen: 444874) y B (Ubb; ID del gen: 281370). Se determinó la importancia de estas proteínas, Ubb y Ubc, en la topología de la red de interacción en base con el número de interacciones de las cuales forman parte. Tanto Ubb como Ubc tienen 3,775 interacciones de 3,856 posibles, indicando que ambas son centros muy importantes. Por medio de la herramienta BiNGO (por sus siglas en inglés - Biological Network Gene Ontology) (https://www.psb.ugent.be/cbd/papers/BiNGO), se identificó que en la subred que forma Ubb y Ubc la anotación de “Gene Ontology 51094” (lo cual significa la “regulación positiva del proceso de desarrollo”) tiene un valor de p de 4.8 E-09, lo que indica una sobrerrepresentación. Este resultado tiene sentido y está relacionado con la reproducción en el ganado ya que este término del proceso biológico se refiere a cualquier proceso que activa o aumenta la tasa o la extensión del desarrollo y el resultado específico de lo cual es la progresión de un organismo a lo largo del tiempo desde una condición inicial (por ejemplo, un cigoto, o un adulto joven) a una condición posterior (por ejemplo, un animal multicelular o un adulto de edad avanzada). Este se vea apoyado en la representación de las interacciones del Ubb y Ubc con 23 módulos de genes de referencia, es decir, genes previamente asociados con la reproducción en bovinos (Figura 1)(8-33). L 897


Rev Mex Cienc Pecu 2020;11(3):894-904

a proteína ubiquitina (Ub) es común en todas las células eucariotas. La conservación de su estructura sugiere que tiene un papel importante en el metabolismo celular. A través del proceso de la ubiquitinación, el Ub guía la degradación de la proteína y regula diferentes eventos biológicos como son la progresión del ciclo celular, la endocitosis membranareceptor, la aparición de antígenos en el sistema inmune e incluso la infección retroviral(34). La ubiquitinación se logra mediante la unión covalente del 76-AA ubiquitina (8.5 kDa) al grupo ε-amino en los residuos Lys del sustrato a través del residuo AA C-terminal de la ubiquitina (G76). Este proceso requiere de la hidrólisis de ATP y un conjunto de factores para la conjugación de ubiquitina, entre ellos las enzimas activadoras de ubiquitina (UBA) y los conjugadores de ubiquitina (Ubc)(11). De las múltiples funciones del sistema Ub, las que participan en los procesos de desarrollo y reproducción son especialmente relevantes. Su papel en el desarrollo se ha estudiado usando modelos como las transiciones del desarrollo en Dictyostelium discoideum y la especificidad del desarrollo en Caenorhabditus elegans(35,36). Se sabe que el sistema Ub está involucrado en la embriogénesis en pollitos, así como en la miogénesis y el desarrollo del cerebro en los humanos(34). En cuanto a los procesos reproductivos, en los humanos la Ub es la proteína principal en el plasma seminal, y el sistema de ubiquitinación se ha relacionado con problemas de fertilidad en humanos y otras especies, incluido el ganado(37,38). En varias especies una alta proporción de espermatozoides ubiquitinados en el eyaculado está relacionada con infertilidad(38). En el ganado bovino, un aumento en los niveles de ubiquitina está asociado con un aumento en los niveles de daño al ADN espermático y con una reducción en la fertilidad(39). En los toros se ha reportado una correlación negativa entre el nivel de ubiquitina de los espermatozoides y el recuento de espermatozoides, la movilidad y el porcentaje de morfología normal; es decir, niveles elevados de ubiquitina en los espermatozoides auguran una mala calidad del semen y una baja fertilidad(39). A raíz de esta evidencia se puede utilizar a los espermatozoides ubiquitinados como una herramienta eficaz para identificar algunos problemas de fertilidad(40,41). Aunque existan evidencias de que los mecanismos biológicos en los sistemas de ubiquitinación puedan afectar la fertilidad en diferentes especies, el proceso del marcado de la ubiquitina de los espermatozoides y el papel que juega este proceso en la biología de los espermatozoides todavía no se entiende por completo. Al buscar datos adicionales para apoyar la posibilidad de que estos genes pueden ser genes candidatos, se logró la caracterización molecular del gen del Ubb. Según la base de datos del NCBI la longitud del gen es de 1898 pb y contiene un exón en la posición 841 a 1758. En esta base de datos se han reportado 19 SNP en las secuencias codificantes y 15 SNP en los no codificantes. El fragmento 1328 pb amplificado permitió la identificación de 5 SNP en la población de estudio, 3 (rs109592218, rs110007734 y rs110366695) en la región codificante y 2 (rs720990890 y rs439271103) en la región no codificante. La transversión rs110366695 898


Rev Mex Cienc Pecu 2020;11(3):894-904

(G/T) ubicada en el exón 1 es particularmente interesante porque causa un cambio funcional no sinónimo. Además, el codón GAG, que produce el ácido glutámico (Glu, E), cambia a UAG, que es un codón de terminación. Este cambio predice la presencia de una proteína truncada que es 287 aminoácidos más corta que la proteína no mutada. En el análisis de las frecuencias alélicas de SNP rs110366695 en el ganado vacuno de las razas Angus y Charolais el alelo G tenía las frecuencias más altas (0.542 y 0.750, respectivamente) (Figura 1). Había desviaciones significativas (P<0.001) del equilibrio de Hardy-Weinberg en la raza Angus, y el número de heterocigotos encontrado era más bajo de lo esperado para estos loci.

Figura 1: La red de interacción de Ubb and Ubc

A) Tasa de concepción de las vaquillas, son los SNP relacionados con el intervalo hasta la inseminación; B) Los efectos del sistema Well-of-the-Well (WOW) y la densidad embrionaria en las tasas de desarrollo, genes de regulación diferencial en embriones cultivados in vitro; C) Tasa de embarazo de la hija, tasa de concepción de las vaquillas, tasa de concepción de las vacas; D) Plazo de supervivencia en embriones de genes de regulación diferencial, potencial de los patrones de expresión de los genes endometriales y los embrionarios pretransferencia: E) Bloqueo de la apoptosis en embriones bovinos, embriones de genes de regulación diferencial tratados con CSF2; F) Función inmune y los genes de desarrollo expresados en el endometrio, genes endometriales de regulación diferencial en vacas lactantes; G) Genes de regulación diferencial en ovocitos en comparación con embriones de 8 células, activación global del genoma embrionario; H) Tasa de concepción de las vacas; I) Igf1 actúa en la protección termal en embriones bovinos, genes de regulación diferencial en embriones tratados con Igf1; J) Genes endometriales de regulación diferencial en vacas gestantes y asociaciones con la fertilidad en vacas lecheras lactantes; K) Genes de regulación diferencial en ovocitos en comparación con blastocistos, genes candidatos para la caracterización del desarrollo; L) Los 899


Rev Mex Cienc Pecu 2020;11(3):894-904 genes del hígado regulados de manera diferencial durante el período de transición, la determinación de las adaptaciones hepáticas que se producen al final de la gestación; M) Genes regulados de manera diferencial en el oviducto de vacas en diestro en comparación con el estro; N) Genes en las células del cúmulo regulados por la oleada de LH, células del cúmulo en desarrollo y la fertilidad de los ovocitos; O) Genes regulados de manera diferencial en diferentes etapas de la maduración de los ovocitos; P) Tasa de concepción relativa estimada, mérito neto y rendimiento de grasa; Q) Tasa de parto (ganado de vacuno), mérito neto, porcentaje de grasa y vida productiva; R) SNP relacionados con el intervalo a la inseminación; S) Desarrollo embrionario en la etapa del blastocisto; T) Regulación diferencial en células cúmulos de embriones in vivo en comparación con embriones in vitro; U) El anti-apoptótico en los embriones mejora la competencia del embrión; V) Genes mamarios regulados de manera diferencial durante la lactancia.

Hasta la fecha no hay estudios moleculares enfocados en la evaluación de los efectos de la variación genética de Ubb en la calidad del semen, a pesar de la importancia fisiológica del gen Ubb. Los resultados del presente estudio respaldan el gen Ubb como un gen candidato fuerte con variaciones genéticas que se deben de probar para confirmar su asociación con rasgos reproductivos. Desafortunadamente, en México el análisis de fenotipos para los rasgos reproductivos no es una práctica común. Este hecho resalta la necesidad de preparar una base de datos amplia para permitir la confirmación de su influencia genética en estos rasgos, particularmente de la transversión rs110366695 (G/T). Una red de interacción proteína-proteína basada en el análisis ha sido validada previamente como una herramienta útil en la identificación de los genes causales asociados con rasgos económicos en bovinos y otras especies. Los resultados obtenidos proporcionan información sobre el potencial de Ubb y de Ubc como genes candidatos para los rasgos reproductivos, en particular para la calidad del semen. Resaltan la importancia de una exploración más a fondo tanto sobre los efectos del truncamiento de las proteínas como su potencial como marcador molecular.

Agradecimientos La investigación reportada aquí recibió apoyo económico de los proyectos CONACYT 294826 y SIP 20195072.

Literatura citada: 1. Jiang Z, Ott TL. Reproductive genomics in domestic animals. Iowa, USA: WileyBlackwell; 2010.

900


Rev Mex Cienc Pecu 2020;11(3):894-904

2. Lee T, Hwang S, Kim CY, Shim H, Kim H, Ronald P, et al. WheatNet: A genome-scale functional network for hexaploid bread wheat, Triticum aestivum. Mol Plant 2017;(8):1133-1136. 3. Lim D, Kim NK, Park HS, Lee SH, Cho YM, Oh SJ, et al. Identification of candidate genes related to bovine marbling using protein-protein interaction networks. Int J Biol Sci 2011;(7):992-1002. 4. Hulsegge I, Woelders H, Smits M, Schokker D, Jiang L, Sørensen P. Prioritization of candidate genes for cattle reproductive traits, based on protein-protein interactions, gene expression, and text-mining. Physiol Genomics 2013;(10):400-406. 5. Paredes-Sánchez FA, Sifuentes-Rincón AM, Segura CA, García PCA, Parra BGM, Ambriz MP. Associations of SNPs located at candidate genes to bovine growth traits, prioritized with an interaction networks construction approach. BMC Genet 2015;(91):1-12. 6.- Han Y, Peñagaricano F. Unravelling the genomic architecture of bull fertility in Holstein cattle. BMC Genet 2016;(1):143. 7. Garza-Brenner E, Sifuentes-Rincón AM, Randel RD, Paredes-Sánchez FA, ParraBracamonte GM, et al. Association of SNPs in dopamine and serotonin pathway genes and their interacting genes with temperament traits in Charolais cows. J Appl Genet 2016;(3):1-9. 8. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007;(21):2947-2848. 9. Raymond M, Rousset F. GENEPOP (Version 1.2): Population genetics software for exact tests and ecumenicism. J Heredity 1995;(3):248-249. 10.- Cory AT, Price CA, Lefebvre R, Palin MF. Identification of single nucleotide polymorphisms in the bovine follicle-stimulating hormone receptor and effects of genotypes on superovulatory response traits. Anim Genet 2013;(2):197-201. 11.- Hoelker M, Rings F, Lund Q, Ghanem N, Phatsara C, Griese J. Effect of the microenvironment and embryo density on developmental characteristics and gene expression profile of bovine preimplantative embryos cultured in vitro. Reproduction 2009;(3):415-425. 12.- Cochran SD, Cole JB, Null DJ, Hansen PJ. Discovery of single nucleotide polymorphisms in candidate genes associated with fertility and production traits in Holstein cattle. BMC Genet 2013;(49):14-49. 13.- Fair T, Carter F, Park S, Evans AC, Lonergan P. Global gene expression analysis during bovine oocyte in vitro maturation. Theriogenology 2007;(68):91-97. 901


Rev Mex Cienc Pecu 2020;11(3):894-904

14.- Salilew WD, HĂślker M, Rings F, Ghanem N, Ulas-Cinar M, Peippo J, et al. Bovine pretransfer endometrium and embryo transcriptome fingerprints as predictors of pregnancy success after embryo transfer. Physiol Genomics 2010;(2):201-218. 15.- Loureiro B, Oliveira LJ, Favoreto MG, Hansen PJ. Colony-stimulating factor 2 inhibits induction of apoptosis in the bovine preimplantation embryo. Am J Reprod Immunol 2011;(65):578-588. 16.- Cerri RL, Thompson IM, Kim IH, Ealy AD, Hansen PJ, Staples CR, et al. Effects of lactation and pregnancy on gene expression of endometrium of Holstein cows at day 17 of the estrous cycle or pregnancy. J Dairy Sci 2012;(10):5657-575. 17.- Fayad T, LĂŠvesque V, Sirois J, Silversides DW, Lussier JG. Gene expression profiling of differentially expressed genes in granulosa cells of bovine dominant follicles using suppression subtractive hybridization. Biol Reprod 2004;(2):523-533. 18.- Misirlioglu M, Page GP, Sagirkaya H, Kaya A, Parrish JJ, First NL, et al. Dynamics of global transcriptome in bovine matured oocytes and preimplantation embryos. Proc Natl Acad Sci 2006;(50):18905-18910. 19.- Cochran SD, Cole JB, Null DJ, Hansen PJ. Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle. Biol Reprod 2013;(3):1-7. 20.- Bonilla AQ, Oliveira LJ, Ozawa M, Newsom EM, Lucy MC, Hansen PJ. Developmental changes in thermoprotective actions of insulin-like growth factor-1 on the preimplantation bovine embryo. Mol Cell Endocrinol 2011;(1-2):170-179. 21.- Mamo S, Sargent CA, Affara NA, Tesfaye D, El-Halawany N, Wimmers K, Gilles M, Schellander K, Ponsuksili S. Transcript profiles of some developmentally important genes detected in bovine oocytes and in vitro-produced blastocysts using RNA amplification and cDNA microarrays. Reprod Domest Anim 2006;(6):527-534. 22.- Graber M, Kohler S, Kaufmann T, Doherr MG, Bruckmaier RM, van Dorland HA. A field study on characteristics and diversity of gene expression in the liver of dairy cows during the transition period. J Dairy Sci 2010;(1):5200-5215. 23.- Bauersachs S, Rehfeld S, Ulbrich SE, Mallok S, Prelle K, Wenigerkind H, et al. Monitoring gene expression changes in bovine oviduct epithelial cells during the oestrous cycle. J Mol Endocrinol 2004;(2):449-466. 24.- Assidi M, Dieleman SJ, Sirard MA. Cumulus cell gene expression following the LH surge in bovine preovulatory follicles: potential early markers of oocyte competence. Reproduction 2010;(6):835-852. 902


Rev Mex Cienc Pecu 2020;11(3):894-904

25.- Salhab M, Tosca L, Cabau C, Papillier P, Perreau C, Dupont J, et al. Kinetics of gene expression and signaling in bovine cumulus cells throughout IVM in different mediums in relation to oocyte developmental competence, cumulus apoptosis and progesterone secretion. Theriogenology 2011;(1):90-104. 26.- Khatib H, Monson RL, Huang W, Khatib R, Schutzkus V, Khateeb H, et al. Short communication: Validation of in vitro fertility genes in a Holstein bull population. J Dairy Sci 2010;(93):2244-2249. 27.- Rosenkrans Jr C, Banks A, Reiter S, Looper M. Calving traits of crossbred Brahman cows are associated with Heat Shock Protein 70 genetic polymorphisms. Anim Reprod Sci 2010;(3-4):178-182. 28.- Pimentel EC, Bauersachs S, Tietze M, Simianer H, Tetens J, Thaller G, et al. Exploration of relationships between production and fertility traits in dairy cattle via association studies of SNPs within candidate genes derived by expression profiling. Anim Genet 2011;(3):251-262. 29.- Gad A, Besenfelder U, Rings F, Ghanem N, Salilew-Wondim D, Hossain MM, et al. Effect of reproductive tract environment following controlled ovarian hyperstimulation treatment on embryo development and global transcriptome profile of blastocysts: implications for animal breeding and human assisted reproduction. Hum Reprod 2011;(7):1693-1707. 30.- Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, et al. Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. Mol Reprod Dev 2009;(7):665-677. 31.- Jousan FD, Hansen PJ. Insulin-like growth factor-I promotes resistance of bovine preimplantation embryos to heat shock through actions independent of its anti-apoptotic actions requiring PI3K signaling. Mol Reprod Dev 2007;(2):189-196. 32.- Mani O, Kรถrner M, Sorensen MT, Sejrsen K, Wotzkow C, Ontsouka CE, et al. Expression, localization, and functional model of cholesterol transporters in lactating and nonlactating mammary tissues of murine, bovine, and human origin. Am J Physiol Regul Integr Comp Physiol 2010;(2):642-654. 33.- Fortes MR, Reverter A, Nagaraj SH, Zhang Y, Jonsson NN, Barris W, et al. A single nucleotide polymorphism-derived regulatory gene network underlying puberty in 2 tropical breeds of beef cattle. J Anim Sci. 2011;(6):1669-1683. 34.- Bebington C, Doherty FJ, Fleming SD. The possible biological and reproductive functions of ubiquitin. Hum Reprod Update 2001;(1):102-111.

903


Rev Mex Cienc Pecu 2020;11(3):894-904

35.- Clark A, Nomura A, Mohanty S, Firtel RA. A ubiquitin-conjuganting enzyme is essential for developmental transitions in Dictiostelium. Mol Biol Cell 1997;(8):1989-2002. 36.-Zhen M, Schein JE, Baille DL, Peter E, Candido M. An essential ubiquitin conjugating enzyme with tissue and developmental specificity in the nematode C. elegans. EMBO J 1996;(15):3229-3237 37.-Muratori M, Marchiani S, Forti G, Baldi E. Sperm ubiquitination positively correlates to normal morphology in human semen. Hum Reprod 2005;(20):1035-1043. 38.- Sutovsky P, Geary T, Baska KM, Manandhar G, Feng D, Lovercamp KW, Sutovsky M. Ubiquitin as an objective marker of semen quality and fertility in bulls. Proc Nebraska Appl Reprod Strat in Beef Cattle 2004;185-199. 39.- Rodríguez-Lozano I, Ávalos-Rodríguez A, Castillo-Juárez H, Borderas-Tordesillas F, Roa-Vidal JJ, Rosales-Torres AM. Percentage of ubiquinated spermatozoa does not correlate with fertilizing capacity of thawed bovine semen. Reprod Dom Anim 2013;(1):27-31. 40.- Sutovsky P, Terrada Y, Schatten G. Ubiquitin-based sperm assay for the diagnosis of male factor infertility. Hum Reprod 2001;(2):250–258. 41.- Sutovsky P, Hauser R, Sutovsky M. Increased levels of sperm ubiquitin correlate with semen quality in men from an andrology laboratory clinic population. Hum Reprod 2004;(3):628–638.

904


https://doi.org/10.22319/rmcp.v11i3.5127 Nota de investigación

Tiempo de manejo y algunas conductas relacionadas con el estrés al manejar grupos grandes o reducidos de ganado en mangas rectas

Miguel Ángel Damián a Virginio Aguirre a Agustín Orihuela a* Mariana Pedernera a Saúl Rojas b Jaime Olivares b

a

Universidad Autónoma del Estado de Morelos. Facultad de Ciencias Agropecuarias. Avenida Universidad 1001 Colonia Chamilpa, 62210, Cuernavaca, Morelos. México. b

Universidad Autónoma de Guerrero. Facultad de Medicina Veterinaria y Zootecnia, Cd. Altamirano, Guerrero. México.

* Autor de correspondencia: aorihuela@uaem.mx

Resumen: El objetivo del presente estudio fue evaluar el tiempo de manejo y el comportamiento indicativo de estrés en bovinos durante su paso por una manga recta. Se utilizaron ocho hatos de 50 animales Brahman x Pardo Suizo, cada hato constituido proporcionalmente por animales jóvenes, adultos, machos y hembras. Cuatro hatos se asignaron al azar a cada uno de los dos tratamientos: en el primer tratamiento, el hato se manejó en grupos de 4-5 animales (TS), mientras que, en el segundo, se manejó en grupos de 10 a 12 animales (TG). El manejo consistió en llevar los animales a través de una manga de 13 m de longitud donde recibieron una aplicación subcutánea de Ivermectina al 1%. Durante su paso por la manga, el tiempo promedio para manejar a los animales en cada tratamiento (42.5 ± 2.2 vs 51.04 ± 1.9 min; P<0.05), así como el número de animales que vocalizaron (5.5 ± 0.6 vs 7.7±0.2; P<0.05), se 905


Rev Mex Cienc Pecu 2020;11(3):905-913

regresaron (6.3 ± 0.4 vs 9.5 ± 0.6; P<0.05) y saltaron sobre sus compañeros (2.7 ± 0.5 vs 5.2 ± 0.5; P<0.05), fue menor en TS que en TG. Sin embargo, no se encontró diferencia entre los tratamientos (P>0.05) para el número de animales que se golpearon (TS: 2.7 ± 0.4 y TG: 5.5 ± 1.7) o se cayeron (TS: 2 ± 0.4 y TG: 3.7 ± 1.0). Se concluye que el manejo de bovinos en grupos pequeños requiere menos tiempo y puede ser menos estresante y peligroso que cuando se manejan grupos más numerosos. Palabras clave: Bienestar animal, Conducta, Instalaciones, Manga de manejo.

Recibido: 24/10/2018 Aceptado: 25/07/2019

En condiciones extensivas y semi-extensivas el ganado permanece en las áreas de pastoreo y sólo se conduce a los corrales para realizarles prácticas de manejo como marcaje, castración y medicina preventiva una o dos veces al año(1). Este manejo no siempre se lleva a cabo en instalaciones adecuadas, ya que en numerosas ocasiones particularmente en el medio rural tropical se cuenta con infraestructura rústica deficiente, conformada por una manga de manejo recta y en ocasiones un corral, generalmente construidos con material de la región(2). La falta de instalaciones impide el manejo de lotes homogéneos (tamaño, edad y sexo), y el manejo infrecuente impide la habituación del ganado a las instalaciones y a la presencia de operadores. Estos factores aunados a la falta de capacitación en los vaqueros(3), favorecen la presencia de condiciones estresantes para los animales y un manejo agitado del hato, que pueden exponerles junto con los vaqueros a un riesgo de lesionarse muy elevado(4,5). Estos factores también contribuyen a generar pérdidas económicas debidas a mala aplicación de tratamientos, lesiones de ganado, accidentes con el personal(6), mermas de peso, fallas reproductivas o muertes, así como deterioro en la calidad de la carne(7). La presión de hacinamiento y el manejo de grupos grandes son algunas variables que en general incrementan la tensión y el estrés de los bovinos(8). Los animales estresados, durante su manejo presentan alteraciones fisiológicas importantes que estimulan conductas como: orinar, defecar y salivar, así como: vocalizaciones, caídas, resbalones, golpes y brincos(9). Por otra parte, animales en estas condiciones, eliminan feromonas que pueden ser percibidas por otros animales, provocándoles también alerta y estrés, evitando así que el ganado circule con facilidad(10). En apoyo a lo anterior otros investigadores mencionan que el ganado tranquilo entra con facilidad al cajón de contención, pero si algún animal forcejea y se estresa, el resto de los animales se rehusará a ingresar con facilidad, dificultando el flujo del ganado(11,12). El manejo de animales en grupos pequeños podría facilitar el flujo durante su paso por la manga, disminuyendo situaciones estresantes y comportamientos que puedan representar un 906


Rev Mex Cienc Pecu 2020;11(3):905-913

riesgo, brindando a los animales la posibilidad de mantener un mejor estado de bienestar, permitiendo en consecuencia un manejo más eficiente y expedito. Por lo tanto, el objetivo del presente trabajo fue evaluar la velocidad de paso y la incidencia de algunas conductas relacionadas con el estrés, durante su manejo en grupos con diferente número de individuos, durante su paso por una manga recta para la aplicación de medicamento. El trabajo se realizó con productores comerciales de ganado de carne en el estado de Guerrero, México (18°25’ N y 100°31’ W) durante la época secas, bajo un clima cálido seco (AW0), con una temperatura de 35 a 40 °C, humedad relativa de 25 %, vegetación selva baja caducifolia y 250 msnm. En esta región, el ganado se maneja una o dos veces por año y se cuenta con una manga recta y corral rústico que comparten diferentes ganaderos de la zona. El manejo se realizó en una manga recta de 13 x 0.8 m, construida con tubos de acero, postes de concreto, piso de tierra y sin sombra. La manga tenía una puerta corrediza del mismo material en un extremo, y se colocaba un tubo para impedir que el último animal del grupo se moviera hacia atrás. Los animales antes de entrar a la manga se alojaron durante 20 min en un corral de espera de 300 m2 con 50 % de sombra, donde contaban con acceso libre al agua en un bebedero de 2.0 x 1.0 x 0.8 m, para permitir su recuperación luego del traslado. El corral contaba también con un embudo para facilitar el ingreso hacia la manga. Al salir de la manga los animales se alojaron en otro corral muy similar al anterior, donde permanecieron hasta terminar el manejo de todo el hato, para después ser trasladados nuevamente a las áreas de pastoreo. Se utilizaron ocho hatos comerciales, cada uno integrado por 50 bovinos cruza Brahman x Pardo Suizo en diferentes proporciones, criados en un sistema de manejo semi-extensivo. Cada hato estaba conformado con el 20 % de animales entre 8 meses a 2 años de edad (n= 10), 30 % entre los 2 a 4 años (n= 15) y 50 % de más de 4 años de edad (n= 25). En cada hato el 90 % de los animales fueron hembras y el 10 % machos. El día de la evaluación, un hato se trasladaba a las 0600 h, del área de pastoreo hacia las instalaciones de manejo, mediante el arreo durante 30 o 40 min, con un manejo tranquilo, hasta introducirlos en el corral de espera. Se trabajó un hato diferente diariamente durante un periodo de ocho días continuos, aplicando los tratamientos de forma alternada y manejando los animales bajo las mismas condiciones durante todo el periodo de evaluación que comprendió del 13 al 20 de febrero de 2018. Los ocho hatos se asignaron aleatoriamente a uno de dos tratamientos; Sistemas de manejo en grupos pequeños (TS) o en grupos más numerosos (TG). En el TS, se manejaban grupos integrados en forma aleatoria por cuatro a cinco animales, que se llevaban a la manga, y se les aplicaba el medicamento. Posteriormente se removía el ganado de la manga y se repetía 907


Rev Mex Cienc Pecu 2020;11(3):905-913

el procedimiento hasta completar el manejo de todo el hato. En TG el manejo era similar, pero el hato se trabajaba en grupos de 10 a 12 animales, que era la capacidad máxima de la manga. El manejo se realizó de una manera tranquila con la ayuda de cuatro personas con experiencia en el manejo de animales. Un médico veterinario aplicó Ivermectina subcutánea al 1% mientras estos permanecían en la manga, y una persona experimentada previamente entrenada se dedicó a la observación de los animales, registrando los tiempos y el comportamiento con base en el etograma que se describe en el Cuadro 1. Cuadro 1: Etograma de las conductas evaluadas durante el manejo de bovinos a través de una manga recta cuando este se realizó con grupos reducidos de animales o en grupos más numerosos Variable

Medición

Vocalizar

Animales que emitieron sonidos o llamados, originados desde sus gargantas y hocicos. Animales que perdieron el apoyo sobre sus extremidades y su cuerpo entró en contacto con el piso. Animales que golpearon o trataron de golpear a otros animales, vaqueros o las instalaciones, con las patas, cabeza o atropellando. Animales que avanzaron o trataron de avanzar pasando por encima de otros miembros del grupo. Animales que se dieron vuelta dentro de la manga tratando de circular en sentido contrario al flujo.

Caer Golpes Brincar Regresar

Durante la evaluación sólo se consideró el número de animales que realizaron las conductas registradas, independientemente de la frecuencia con que estas se realizaron. El tiempo invertido en el manejo de los animales se analizó mediante una prueba de “t” de Student, comparando los resultados de TS vs TG. Cada hato fue considerado como una repetición dentro de cada tratamiento, y cada animal constituyó la unidad experimental. Las variables de comportamiento entre los dos tratamientos se compararon mediante la prueba de Mann Whitney. Finalmente, se realizó una correlación de rangos Tau de Kendall entre las variables: tiempo y número de animales que vocalizan, caen, golpean, brincan y regresan. El tiempo promedio requerido para manejar los 50 animales fue menor en TS que en TG 42.5 ± 2.2 min vs 51.04 ± 1.9 min; P<0.05; respectivamente. Además, menos animales vocalizaron, se voltearon y brincaron encima de otros en TS en comparación con TG (5.5 ± 0.6 vs 7.7 ± 0.2; 6.3 ± 0.4 vs 9.5 ± 0.6 y 2.7 ± 0.5 vs 5.2 ± 0.5, respectivamente; Figura 1). 908


Rev Mex Cienc Pecu 2020;11(3):905-913

No se encontraron diferencias entre tratamientos (P>0.05) en el número de animales que cayeron al suelo ni en animales que golpearon. El tiempo invertido en el manejo mostró una correlación significativa (r= 0.56 a 0.79; P˂0.01) con el número de animales que vocalizan, caídos, golpean, brincan y regresan (Cuadro 2).

40 30 20 10

10 8

a

4 3

a

2 1 0

N Animales que brincan

Vocalizan (N de animales )

0

5

N Animales que golpean

b

a

50

b a

6 4 2 0 TS

6 5 4

a

3 2 1 0

Tratamientos

a

8 7 6 5

a

4 3 2 1 0 12

b

10

a

8 6 4 2 0

TS

TS TG Tratamientos

TG

ab

b

N° Animales que regresan

Tiempo (min)

60

N Animales que caen

Figura 1: Promedio (±EE) de tiempo de manejo y número de animales que muestran algunos comportamientos que indican estrés en bovinos manejados en grupos (TG) y grupos (TS) en una manga recta

TG Tratamientos

Diferente literal indica diferencia (P<0.05).

Cuadro 2: Correlación de rangos (TAU DE KENDALL) de algunas variables que indican estrés en bovinos manejados bajo diferentes tamaños de grupos a través de una manga recta

Tiempo Vocalizan Caen Golpean Brincan

Vocalizan 0.677**

Caen 0.624** 0.733***

Golpean 0.562** 0.699** 0.760***

*(P<0.05), **(P<0.01), ***(P<0.001).

909

Brincan 0.790*** 0.758*** 0.803*** 0.688**

Regresan 0.717*** 0.794*** 0.678** 0.740*** 0.812***


Rev Mex Cienc Pecu 2020;11(3):905-913

Al reducir el tamaño de los grupos se logra un manejo más eficiente y seguro para animales y vaqueros. El número de animales que realiza las conductas evaluadas está altamente relacionado con el tiempo de manejo. Lo anterior podría significar que, al requerir más tiempo para el arreo de grupos más grandes, éste ocasiona que más animales realicen conductas agresivas, quizá debido a periodos mayores de exposición a climas extremos, en contacto con animales invadiendo sus espacios individuales o dentro de instalaciones y con operadores que no les son familiares. O, por otro lado, que al haber un mayor número de animales realizando estas conductas, esto provoque que el paso de los animales por las instalaciones sea más tardado. Los resultados de este trabajo coinciden con los estudios realizados por otros investigadores, quienes indican que los animales presentan más conductas agresivas cuando el tiempo de contención es mayor(13,14). Paralelamente, el manejo de grupos reducidos podría ser un sistema más seguro, al observar que un menor número de animales realiza conductas que les ponen en riesgo de lesionarse durante su paso por la manga, disminuyendo el riesgo de accidentes entre los animales y hacia los vaqueros. El tamaño del grupo fue factor determinante para encontrar diferencia entre los tratamientos. El llenar la manga de manejo a su máxima capacidad con animales de diferente talla, edad y sexo, pudo provocar invasión del espacio individual de un mayor número de animales, así como favorecer que más animales sumisos fueran forzados a permanecer cerca de animales dominantes, propiciando así un mayor número de animales manifestando conductas indicativas de estrés. En un hato establecido, existe relaciones de dominancia sumisión bien establecidas, que permiten la coexistencia de los animales(15), por lo que cuando se les fuerza a interactuar con otros animales, incrementando su densidad y creando nuevos grupos de diferente rango de edad y peso, estos son factores clasificados como estresores bilógicos(16). Así mismo, estas prácticas se relacionan con una mala calidad en el manejo del ganado y se asocian con una mayor reactividad, más comportamientos indeseables y un mayor riesgo de accidentes(17,18). En suma toda situación que rompa con la organización social en una población animal puede desencadenar diferentes grados de estrés(14,19), esta situación fue propiciada en el presente estudio al provocar un cambio en el entorno espacial durante el llenado de la manga de manejo. Por otra parte, existe la posibilidad de que, al manejar grupos mayores, los últimos animales del grupo puedan percibir mayor cantidad de señales de estrés, porque frente a ellos hay una mayor cantidad de animales en estrés, reduciendo su velocidad de flujo. Esta misma situación podría presentarse al requerirse más tiempo en el manejo de mayor cantidad de animales, lo que también favorecería la emisión de señales de estrés, tanto conductuales como químicas, y la consecuente precepción de las mismas por los últimos animales de cada grupo(20). En ganado Bos taurus, Grandin(21,22) y Enríquez et al(23) encontraron resultados similares, 910


Rev Mex Cienc Pecu 2020;11(3):905-913

observando que grupos pequeños pueden dirigirse hacia la sala de matanza con mayor facilidad, provocando menos vocalizaciones, resbalones y caídas en los grupos. Con base en los resultados del presente experimento, se observa que el manejo de animales en TS puede ser un sistema alternativo y simple, que reduce las conductas indicativas de estrés sin generar un costo extra, y aprovechando la infraestructura mínima existente en la mayoría de los ranchos donde se maneja el ganado en condiciones semi-extensivas tropicales. El manejo de bovinos en grupos pequeños requiere menos tiempo, y menos animales realizan conductas indicativas de estrés durante su manejo en una manga recta, por lo que se considera que este sistema es más eficiente y proporciona un mayor grado de bienestar animal.

Conflicto de intereses

Los autores declaran no tener conflicto de intereses en relación con el presente trabajo

Agradecimientos

A los dueños de los hatos por su disposición para realizar el trabajo en sus unidades de producción y a los vaqueros que colaboraron para el manejo del ganado. Al Consejo Nacional de Ciencia y Tecnología (CONACYT) por el otorgamiento de beca para realizar estudio de Doctorado.

Literatura citada: 1.

Garcia MA, Albarran PB, Avilez NF. Dynamics and trends in dual purpose cattle management in southern Estado de México. Agrociencia 2015;9(2):125-139.

2.

Nájera GA, Piedra MR, Albarrán PB, García MA. Changes in dual purpose livestock farming system in the dry tropic of Estado de Mexico. Agrociencia 2016;50(6):701-710.

911


Rev Mex Cienc Pecu 2020;11(3):905-913

3.

Sant´Anna CA, Paranhos da Costa MJR. Como as práticas de bea podem mehorar a bovinocultura moderna. Simpósio da Ciência do Bem-estar Anima. Escola de veterinária da UFMG Belo Horizote MG, Brazil. 2009:42-47.

4.

Breuer K, Hemsworth PH, Barnett JL, Matthews LR, Coleman GR. Behavioral response to humans and the productivity of commercial dairy cows. Appl Anim Behav Sci 2000;66(4):273-288.

5.

Sutherland AM, Dowling KS. The relationship between responsiveness of first-lactation heifers to humans and the behavioral response to milking and milk production measures. J Vet Behav 2014;9(1):30-33.

6.

Paranhos da Costa MJR, Macedo de Toledo L, Schidek A. Boas Pácticas de manejo, Vacinação. 1a ed. Jaboticabal, Brazil: Livraria & Editora Funep; 2006.

7.

Gallo C, Tadich N. Transporte terrestre de bovinos: efectos sobre el bienestar animal y la calidad de la carne. Agrociencia 2005;21(2):37-49.

8.

Costa A, Dasso L. Manejo de bovinos en sistemas productivos: Caracterización de dos estilos de manejo y niveles sanguíneos de cortisol. Red Vet 2007;8(1):1695-7504.

9.

Vieuille TC, Signoret JP. Pheromonal transmission of an aversive experience in domestic pig. J Chem Ecol 1992;18(9):1551-1557.

10. Grandin T. Assessment of stress during handling and transport. J Anim Sci 1997;75(1):249–257. 11. Muñoz D, Strappini A, Gallo C. Indicators of animal welfare to detect problems in the box of desensitization of bovines. Arch Vet Med 2012;44(3):297-302. 12. Romero PM, Sanchez VJ. Animal welfare during transport and its relationship with meat quality. J MVZ Cordoba 2012;17(1):2936-2944. 13. Burdick NC, Rundel RD, Carroll JA, Welsh Jr TH. Interaction between temperament, stress, and immune function in cattle. Int J Zool 2011;20(11):1-9. 14. Proudfoot K, Habing G. Social stress as a cause of diseases in farm animals: current knowledge and future directions. Vet J 2015;206(1):15-21. 15. Fukasawa M, Tsakada H. Relationship between milk cortisol concentration and the behavioral characteristics of postpartum cows introduced to a new group. Anim Sci J 2010;81(5):612-617. 16. Asres A, Amha N. Efect of stress on animal health: a review. J Biol Agric Health 2004;4(27):116-121. 912


Rev Mex Cienc Pecu 2020;11(3):905-913

17. Ceballos MC, Sant´Anna AC, Góis KCR, Ferraudo AS, Negrao JA, Paranhos da Cosdta MJR. Investigating the relation-ship between human-animal interactions, reactivity, stress response and reproductive performance in Nellore heifers. Livest Sci 2018;217(1):65-75. 18. Ceballos MC, Sant´Anna AC, Boivin X, Oliveira Costa FO, Carvalhal MV de L, Paranhos da Costa MJR. Impact of good practices of handling training on beef cattle welfare and stock people attitudes and behaviors. Livest Sci 2018;216(1):24-31. 19. Enríquez D, Hotzel M, Ungerfeld R. Minimizing the stress of beef calves: a review. Acta Vet Scand 2011;53(1):2-8. 20. Orihuela JA, Solano JJ. Relationship between order of entry in slaughterhouse raceway and time to traverse raceway. Appl Anim Behav Sci 1994;40(3):313-317. 21. Grandin T, Deesing MJ, Struthers JJ, Swinker AM. Cattle with hair whorl patterns above the eyes are more behaviorally agitated during restraint. Appl Anim Behav Sci 1995;46(1-2):117-123. 22. Grandin T. Improving animal welfare: A practical approach. 2nd ed. Wallingford, UK: CABI International; 2015. 23. Enríquez DH, Ungerfeld R, Quintans G, Guidoni AL, Hotzel MG. The effects of alternative weaning methods on behaviour in beef calves. Livest Sci 2010;128(1-3): 2027.

913


https://doi.org/10.22319/rmcp.v11i3.4717 Nota de investigación

Diversidad de la flora de interés apícola en el estado de Tamaulipas, México

Mario González-Suárez a Arturo Mora-Olivo a* Rogel Villanueva-Gutiérrez b† Manuel Lara-Villalón a Venancio Vanoye-Eligio a Antonio Guerra-Pérez a

a

Universidad Autónoma de Tamaulipas, Instituto de Ecología Aplicada. Cd. Victoria, Tamaulipas, México. b

El Colegio de la Frontera Sur, Unidad Chetumal. Chetumal, Quintana Roo, México.

*Autor de correspondencia: amorao@uat.edu.mx

Resumen: El desarrollo de la apicultura en México ha incrementado el interés por conocer el potencial de la flora nectarífera y polinífera en diferentes estados. El objetivo del estudio fue ampliar el conocimiento sobre la flora de importancia apícola en Tamaulipas en las diferentes estaciones del año. Con base en trabajo de campo realizado entre 2012 y 2015, se obtuvo un inventario de las especies de plantas cuyas flores son pecoreadas por Apis mellifera L. Se registraron un total de 215 especies, pertenecientes a 173 géneros y 60 familias de plantas fanerógamas, siendo la mayoría nativas (87.91 %) y herbáceas (42.32 %). Las familias mejor representadas fueron Fabaceae y Asteraceae. La mayor proporción de plantas son las productoras de néctar (45.12 %), seguidas por nectaro-poliníferas (40 %) y por último las productoras de polen fueron (14.88 %). La vegetación secundaria y la selva baja caducifolia

914


Rev Mex Cienc Pecu 2020;11(3):914-932

son las comunidades vegetales más importantes por el número de especies identificadas que producen néctar y polen durante la época de verano. Palabras clave: Flora apícola, Época de floración, Néctar, Polen, Tamaulipas.

Recibido: 11/12/2017 Aceptado: 18/04/2019

La flora silvestre y cultivada conforma un recurso natural de gran importancia para el ser humano por los beneficios que de ella se obtienen. De las plantas se pueden aprovechar directamente sus productos como semillas, flores o frutos, e incluso aquellos que, como el néctar, son procesados por las abejas para producir miel(1). De acuerdo a Crane(2), el uso de la miel se remonta hasta la prehistoria, ya que los primeros hombres se alimentaban de este producto a partir de panales encontrados en huecos o grietas de árboles y rocas. En el siglo XVI el conocimiento de la apicultura en México, se concentraba en el aprovechamiento de abejas nativas (meliponicultura), y no fue sino hasta principios del siglo pasado, cuando la apicultura moderna, que se basa en la abeja europea, dio inicio y se difundió después de 1920(3). Los primeros trabajos publicados sobre flora apícola en México se llevaron a cabo por Wulfrath y Speck(4) y por Ordetx et al(5) quienes proporcionaron inventarios de plantas melíferas a nivel nacional. Algunas regiones como la Península de Yucatán, han sido intensamente estudiadas para conocer su flora nectarífero-polinífera(6-10). Y en el resto del país, estados como Michoacán(11), Colima(12), Guerrero(13), Chiapas(14) y Veracruz(15) también, han dado a conocer su flora de importancia apícola. Adicionalmente se han realizado numerosos trabajos locales sobre flora apícola a lo largo del país, aunque la porción norte ha sido escasamente estudiada en comparación con el sur. En el caso de Tamaulipas, el primer antecedente fue el de Lara(16) quien elaboró una lista preliminar de las plantas visitadas por Apis mellifera L. en la Reserva de la Biosfera El Cielo. Posteriormente, se realizó un catálogo de las principales especies nectaríferas y poliníferas del estado de Tamaulipas(1). Y por último, el trabajo de González-Rodríguez et al(17) enlista 147 especies poli-nectaríferas de plantas silvestres y cultivadas del mismo estado. El estado de Tamaulipas cuenta con una riqueza florística estimada en 5,000 especies silvestres(18), de las cuales Villaseñor(19) ha registrado 4,278 especies. Esta flora se distribuye en 20 distintos tipos de vegetación definidos por la Comisión Técnico Consultiva de Coeficientes de Agostadero y además, en la región existen extensos cultivos de cítricos y

915


Rev Mex Cienc Pecu 2020;11(3):914-932

otras plantas introducidas de importancia apícola(1). Sin embargo, aun con todo esto, se considera que en el estado no se ha aprovechado adecuadamente todo el potencial que existe para la apicultura. Es decir, no se obtiene una producción de miel proporcional al recurso vegetal existente en Tamaulipas. Y parte de este problema, radica en el escaso conocimiento que en ocasiones se tiene de las plantas nativas e introducidas que pueden ser aprovechadas por las abejas(1). Aunque el estado de Tamaulipas no es uno los mayores productores de miel en México (ocupa el 8º lugar), su actividad apícola y el consumo de miel se ha incrementado significativamente en los últimos años. En el año 2000 se habían censado en la entidad 14,069 colmenas, las cuales llegaron a 17,764 en 2008 y a 22,000 en 2010(20,21). En la actualidad, se encuentran registrados 350 productores en 12 asociaciones apícolas, alcanzándose una producción de miel de 716 t anuales, lo que representa un valor económico de cerca de 30 millones de pesos(22). Por lo anterior, el presente estudio tuvo como objetivo ampliar el conocimiento actual de la diversidad de flora de interés apícola en el estado de Tamaulipas. La información que se generó servirá para conocer con mayor detalle la diversidad de las especies nectaríferas y poliníferas que son pecoreadas por Apis mellifera en las diferentes temporadas del año y sitios de estudio. Se espera que esto contribuya a que los apicultores del estado, puedan aprovechar y manejar de forma más eficiente el recurso apibotánico disponible, repercutiendo en una mayor producción de miel en la región. El estado de Tamaulipas se localiza en el noreste de la República Mexicana, entre las coordenadas: 22°12’31” y 27°40’52” N, y 97°08’38” y los 100°08’51” O. Ocupa el séptimo lugar en cuanto a extensión territorial se refiere, contando con una superficie de 7’982,900 ha. Limita al norte con los Estados Unidos de América, al sur con los estados de Veracruz y San Luis Potosí, al este con el Golfo de México y al oeste con el estado de Nuevo León(23). Los tipos de climas existentes son secos, semisecos, cálidos, semicálidos y templados. En la llanura costera predomina el semiseco cálido y seco muy cálido. En zonas serranas del semicálido subhúmedo hasta los templados subhúmedos, dependiendo de las orientaciones y altitudes. Los suelos más característicos de Tamaulipas son los feozems, vertisoles, luvisoles, xerosoles, cambisoles, regosoles, rendzinas y litosoles. Otros como los gleysoles son comunes a lo largo de la zona costera y los fluvisoles se localizan en las márgenes de los ríos y arroyos(23). El territorio tamaulipeco incluye gran parte de la Planicie Costera Nororiental, la cual nace al sur del Río Bravo y se extiende a lo largo del litoral del Golfo de México. En la porción occidental, se localiza la Sierra Madre Oriental, con alturas máximas de 3,450 m en los límites con Nuevo León. Incluye 20 tipos de vegetación definidos por la Comisión Técnico Consultiva de Coeficientes de Agostadero(1), incluyendo selvas, bosques, matorrales, 916


Rev Mex Cienc Pecu 2020;11(3):914-932

palmares, pastizales, agrupaciones de halófitos e inundables, además de las zonas agrícolas. Del total de la superficie 557,566 ha están destinadas a la agricultura de riego, 1’118,412 ha para agricultura de temporal, 852,454 ha son de uso forestal, 4’683,528 ha son de uso ganadero y 770,940 ha están dedicadas a otros usos(1). El trabajo de campo se efectuó entre los años 2012 y 2015, en las cuatro estaciones del año. Se seleccionaron 27 apiarios que se encuentran establecidos en 11 municipios, con diferentes tipos de vegetación (natural y cultivos) y con características fisiográficas distintas (Cuadro 1, Figura 1). La ubicación de los mismos se hizo por medio de un geoposicionador Garmin GPS73, utilizando el sistema de coordenadas Universal Transverse Mercator (UTM) correspondiente a la zona 14 y el datum WGS 84. Se recolectaron ejemplares en floración a 2 km a la redonda de los apiarios, esto de acuerdo a las estimaciones promedio de vuelo de las abejas(12). Para esto se utilizó una prensa botánica, tijeras de campo y bolsas de plástico. En este proceso fueron tomadas en cuenta las especies visitadas frecuentemente por Apis mellifera, utilizando el método de apreciación visual(24,25) que consiste en inspeccionar durante 5 a 10 min la visita de la abeja sobre las flores.

No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

Cuadro 1: Características de los apiarios seleccionados Municipio Apiario Latitud Longitud Elevación Norte Oeste (msnm) Llera ANG 2582494 498097 497 Llera LLE 2580148 500744 255 Llera SAJ 2573323 494835 396 Güémez PLA1 2659910 486284 203 Güémez SJU 2646193 485295 447 Victoria CAB 2635979 482723 263 Mante CIN 2519777 494694 75 Hidalgo HID 2681353 453907 333 Hidalgo IND1 2678359 446361 398 Hidalgo IND2 2679732 445890 397 Güémez SAL1 2644211 491819 193 Güémez SAL2 2644273 488584 202 Güémez SAL3 2643413 486990 211 Padilla ELQ 2655879 494452 184 Padilla LAS 2662991 491708 187 Padilla PLA 2658774 505310 161 Soto la LAV 2605370 597070 41 Marina Jaumave SJO1 2603597 467749 631 Jaumave SJO2 2601748 467889 621

917

Tipo de vegetación MET/MEZ CA CA CA MET/MEZ CA CA CA CA MEZ MSM MSM SBS MSM MSM SBS CA CA CA


Rev Mex Cienc Pecu 2020;11(3):914-932

20 21 22 23 24 25 26 27

Jaumave Tula Tula Tula Tula San Fernando San Fernando Burgos

SJO3 FME SAU1 SAU2 TUL LMA1

2601306 2553554 2550791 2550342 2538716 2716847

466370 433556 429774 431098 422565 627994

650 1453 1293 1298 1118 7

MET/MEZ MET/MEZ SBC MEZ MEZ MEZ

LMA2

2717125

626482

8

MEZ

MAR

2764173

534345

127

MET

CA= cultivo agrícola, MET= matorral espinoso tamaulipeco, MEZ= mezquital, MSM= matorral submontano, SBS= selva baja subcaducifolia, SBC= selva baja caducifolia.

Figura 1: Ubicación de los apiarios en el área de estudio

Los ejemplares botánicos colectados fueron herborizados y depositados en el Herbario “Francisco González Medrano” del Instituto de Ecología Aplicada de la Universidad Autónoma de Tamaulipas. Con el fin de reconocer el conocimiento que los apicultores locales tienen sobre el recurso floral, se realizaron recorridos de campo acompañados por ellos, quienes mencionaron las especies vegetales pecoreadas por abejas, así como la época y duración de la floración. Con la información de campo, bases de datos y bibliografía, se obtuvo un inventario que contiene información relativa a estas especies agrupándolas de acuerdo a su forma biológica

918


Rev Mex Cienc Pecu 2020;11(3):914-932

(árbol, arbusto, hierba), forma de vida (erecta, ascendente, decumbente, postrada, rastrera, trepadora, roseta, epífita y flotante), origen (nativa, introducida), y producción (nectaríferas, poliníferas o nectaro-poliníferas). Así mismo, se registró el tipo de vegetación y la época de floración de las especies. La clasificación de las especies por familias se realizó de acuerdo al sistema internacional establecido por el Grupo para la Filogenia de las Angiospermas APG III(26). La diversidad vegetal de interés apícola en Tamaulipas se encuentra representada por 215 especies con 1 subespecie y 1 variedad, pertenecientes a 173 géneros y 60 familias de plantas vasculares (Anexo 1). La familia más sobresaliente fue Fabaceae (tradicionalmente conocida como Leguminosae) con 35 especies (16.28 %), seguida por Asteraceae con 26 especies (12.09 %). Solo 11 familias incluyen más del 50 % de la riqueza de géneros y especies de la flora apícola en el estado (Cuadro 2). Los géneros predominantes fueron Acacia con 6 especies y Croton y Mimosa con 5 especies cada uno. Cuadro 2: Familias y géneros mejor representados de la flora apícola en Tamaulipas Familias Géneros % Especies % Fabaceae 22 12.72 35 16.28 Asteraceae 21 12.14 26 12.09 Convolvulaceae 5 2.89 9 4.19 Euphorbiaceae 5 2.89 9 4.19 Malvaceae 6 3.47 9 4.19 Lamiaceae 6 3.47 8 3.72 Rutaceae 6 3.47 7 3.26 Boraginaceae 3 1.73 5 2.33 Sapindaceae 5 2.89 5 2.33 Scrophulariaceae 3 1.73 5 2.33 Verbenaceae 5 2.89 5 2.33 Subtotal 87 50.29 123 57.21 Restantes (49) 86 49.71 92 42.79 Total 173 100.00 215 100.00 La mayor parte de las especies estudiadas son nativas, lo que corresponde a un 87.91 %, en tanto que el resto son introducidas con un 12.09 %. Por su forma biológica, son 91 hierbas, 74 arbustos y 50 árboles. Por su forma de vida se registraron 169 especies erectas, 24 trepadoras, 6 ascendentes, 6 postradas, 5 rosetas, 2 flotantes, 1 rastrera y 1 epífita. Las plantas de interés apícola se localizaron en 26 diferentes tipos de vegetación, incluyendo a los cultivos. Las especies son más diversas en la vegetación secundaria (58 especies), aunque los tipos de vegetación natural que presentaron mayor número de especies fueron la

919


Rev Mex Cienc Pecu 2020;11(3):914-932

selva baja caducifolia y el matorral espinoso tamaulipeco (Cuadro 3). Las especies cultivadas no fueron muy diversas, correspondiendo 12 a cultivos agrícolas y 13 a cultivos ornamentales. De las 215 especies de plantas recopiladas, la mayor proporción son productoras de néctar con 97 especies, seguidas por las nectaro-poliníferas con 86, mientras que las productoras de polen son solamente 32. Cuadro 3: Riqueza de especies nectaro-poliníferas por tipo de vegetación en Tamaulipas Tipo de vegetación Especies % Vegetación secundaria 58 26.85 Selva baja caducifolia 23 10.65 Matorral espinoso tamaulipeco 18 8.33 Vegetación acuática 15 6.94 Mezquital 14 6.48 Selva baja subcaducifolia 14 6.48 Cultivos ornamentales 13 6.02 Cultivos anuales 12 5.56 Matorral submontano 12 5.56 Bosque de encino 11 5.09 Matorral desértico micrófilo 8 3.70 Selva mediana subperennifolia 7 3.24 Bosque de pino 4 1.85 Matorral desértico rosetófilo 4 1.85 Vegetación halófita 2 0.93 Bosque de pino-encino 1 0.46 Respecto a la distribución de las floraciones a lo largo del año y a través de las cuatro estaciones, se identifica una clara tendencia a disminuir en las épocas más frías. En primavera se reportan 355 especies que florecen, en verano 364, en otoño 288 y en invierno 233. Evaluando cada mes del periodo de estudio, se aprecia que el mes de junio es el que más recurso floral ofrece con 130 especies disponibles y el mes más pobre en oferta floral es diciembre con 64 especies (Figura 2).

920


Rev Mex Cienc Pecu 2020;11(3):914-932

Figura 2: Distribución de la floración mensual de las especies de importancia apícola en Tamaulipas

La riqueza de especies vegetales de importancia apícola registradas para Tamaulipas (215 especies) se considera importante, tomando en cuenta que el norte del país es menos diverso en recursos florísticos que la porción sur. A pesar de esto, el inventario obtenido en este estudio es el que hasta ahora da a conocer el mayor número de especies de plantas nectaropoliníferas, ya que los trabajos de Lara(16), de Villegas et al(1) y de González-Rodríguez et al(17) mencionaron 174, 150 y 146 especies respectivamente. Al igual que en otros estudios, las familias más importantes desde el punto de vista apícola fueron las leguminosas (Fabaceae) y las compuestas (Asteraceae), como también lo mencionan para otros estados del país(12,13,27). Con respecto al origen de la flora apícola, se esperaba que la mayor riqueza se presentara en especies nativas, ya que es el recurso vegetal más común en el estado de Tamaulipas, de acuerdo a los registros aportados por Villaseñor(19). Aunque es preciso mencionar que para Tamaulipas, durante el invierno los cítricos son de alta relevancia para la producción de néctar por las abejas europeas, por la gran extensión que existen de estos cultivos en el centro de la entidad, especialmente de naranjos(1). Las plantas herbáceas (91 especies) tuvieron una mayor proporción de especies en relación a los arbustos y los árboles, como suele pasar con otros trabajos similares(28,29). Aunque las plantas erectas representan la forma de vida más común para la flora apícola del estado, las

921


Rev Mex Cienc Pecu 2020;11(3):914-932

trepadoras juegan un papel también importante como lo mencionan también otros estudios del país como Yucatán, Michoacán, Veracruz, Guerrero y Chiapas(7,10,13-15). La vegetación secundaria aportó la mayor diversidad de especies de importancia apícola en Tamaulipas (26.98 %), quizá por la gran cantidad de plantas herbáceas presentes en distintos tipos de vegetación, como también es mencionado por Bello(28) en Michoacán y por Piedras y Quiroz(29) para el Valle de México. De hecho, malezas como Argemone spp. y Helianthus annuus subsp. annuus son comunes durante todo el año en el estado estudiado. También ya otros autores han señalado la importancia de las malezas para la apicultura en países como la India(30). En cuanto a la vegetación natural, la selva baja caducifolia es la comunidad vegetal que mayor oferta floral tiene en el estado, como ocurre en la Reserva de la Biosfera El Cielo(16). Y en realidad, tanto la selva baja caducifolia, como el matorral espinoso tamaulipeco, son de los tipos de vegetación más ampliamente distribuidos en el estado de Tamaulipas(23). En relación al recurso floral obtenido por las abejas, las plantas nectaríferas fueron las más diversas, lo que coincide con lo registrado para la flora apícola de Colima(11). Sin embargo, en otros casos las especies nectaro-poliníferas suelen ser las más diversas(17-30). A diferencia de otros estudios (11,27), la mejor oferta floral para las abejas en Tamaulipas es el verano, siendo junio el mes más productivo dado que florecen la mayoría de las especies de todas las formas biológicas y en distintos tipos de vegetación. Sin embargo, estas especies no siempre son abundantes como sí ocurre con otras como los mezquites (Prosopis spp.) y los cítricos (Citrus spp.) que en realidad son las que influyen mayormente en la producción de miel monofloral en el estado que se da durante el periodo febrero-abril, de acuerdo al calendario apícola vigente. Tamaulipas posee un amplio recurso florístico de importancia para la apicultura y en este estudio se cumplió con el objetivo de ampliar el conocimiento de la diversidad de especies pecoreadas por Apis mellifera. Las familias Fabaceae y Asteracea son la que aportan la mayor fuente de flores disponibles para el pecoreo de la abeja europea. La mayor proporción de especies son nativas (87.91 %) y herbáceas (42.32 %), siendo principalmente productoras de néctar. La vegetación secundaria y la selva baja caducifolia son las comunidades vegetales más importantes para la producción de miel en esta entidad, especialmente durante la época de verano. La información proporcionada en este estudio servirá de base para potencializar de una mejor manera el desarrollo de la apicultura en el estado de Tamaulipas, ya que los apicultores podrán aprovechar más eficientemente a través del año, el manejo de sus apiarios.

922


Rev Mex Cienc Pecu 2020;11(3):914-932

Agradecimientos A los apicultores que colaboraron brindando información importante para el estudio. El primer autor agradece al Posgrado en Ecología y Manejo de Recursos Naturales y al Consejo Nacional de Ciencia y Tecnología por la beca y el apoyo recibido para realizar este trabajo.

Literatura citada: 1. Villegas G, Bolaños A, Miranda JA, García J, Galván OM. Flora nectarífera y polinífera en el Estado de Tamaulipas. México, DF. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación; 2000. 2. Crane E. Honey: A comprehensive Survey. London, UK: Heinemann; 1975. 3. Labougle JM, Zozaya JA. La apicultura en México. Cienc Desar 1986;69:17-36. 4. Wulfrath A, Speck JJ. La flora melífera. México DF: Editora Agrícola Mexicana; 1953. 5. Ordetx GS, Zozaya-Rubio JA, Franco MW. Estudio de la flora apícola nacional. Chapingo, México: Dirección General de Extensión Agrícola; 1972. 6. Souza-Novelo N, Suárez-Molina V, Barrera-Vázquez A. Plantas melíferas y poliníferas de Yucatán. Mérida, México: Fondo Editorial de Yucatán; 1981. 7. Villegas G, Cajero AS, Bolaños A, Miranda JA, Pérez MA, Ku Y, Yam F, et al. Flora nectarífera y polinífera en la península de Yucatán. México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación; 1998. 8. Villanueva-Gutiérrez R. Nectar sources of European and africanized honey bees (Apis mellifera L.) in the Yucatan Peninsula, Mexico. J Apicult Res 1994;33(1):44-58. 9. Villanueva-Gutiérrez R. Polliniferous plants and foraging strategies of Apis mellifera in the Yucatán Peninsula, Mexico. Rev Biol Trop 2002;50(3/4):1035-1044. 10. Villanueva-Gutiérrez R, Moguel-Ordóñez YB, Echazarreta-González CM, Arana-López G. Monofloral honeys in the Yucatán Peninsula, Mexico. Grana 2009;48(3):214-223. 11. Villegas G, Bolaños A, Miranda JA, Quintana IL, Guzmán EO, Zavala JM. Flora nectarífera y polinífera en el estado de Michoacán. D.F, México: Secretaría de Agricultura Ganadería y Desarrollo Rural. 1999. 12. Santana-Michel FJ, Cervantes AN, Jiménez RN. Flora melífera del estado de Colima. B IBUG 2000;6:251-277. 923


Rev Mex Cienc Pecu 2020;11(3):914-932

13. Villegas G, Bolaños A, Miranda JA, González U. Flora nectarífera y polinífera en el estado de Guerrero. México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. 2002a. 14. Villegas G, Bolaños A, Miranda JA, Zenón AJ. Flora Nectarífera y polinífera en el estado de Chiapas. México: Secretaría de Agricultura, Ganadería y Desarrollo Rural. 2002b. 15. Villegas DG, Bolaños MA, Miranda JA, Sandoval HR, Lizama MJM. Flora nectarífera y polinífera en el estado de Veracruz. México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. 2003. 16. Lara M. Estudio preliminar de las especies vegetales visitadas por Apis mellifera en la Reserva de la Biosfera El Cielo. Biotam 1989;1(1):14-19. 17. González-Rodríguez LE, Mora-Olivo A, Guerra-Pérez A, Garza-Torres HA, CámaraArtigas R. Ordenamiento sustentable de la apicultura en Tamaulipas. Saltillo, México: Editorial Dolores Quintanilla; 2012. 18. Rzedowski J. Diversidad y orígenes de la flora fanerogámica de México. Acta Bot Mex 1991;14:3-21. 19. Villaseñor JL. Checklist of the native vascular plants of Mexico. Rev Mex Biodiver 2016;87:559-902. 20. SIAP. Servicio de Información Agroalimentaria y Pesquera. D.F., México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación; 2008. URL: http://www.siap.gob.mx/. Consultado 17 May, 2010. 21. González-Rodríguez, LE, Mora-Olivo A, Guerra-Pérez A, Garza-Torres H. La apicultura en Tamaulipas, una actividad muy dulce y nutritiva. Ciencia UAT 2010;16:8-12. 22. SIACON. Sistema de Información Agroalimentaria de Consulta. D.F., México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación; 2016. http://www.siap.gob.mx/optestadisticasiacon2012parcialsiacon-zip/ Consultado 15 Abr, 2016. 23. SPP. Secretaría de Programación y Presupuesto. Síntesis Geográfica del Estado de Tamaulipas. Instituto Nacional de Estadística, Geografía e Informática. México. 1983. 24. Sakagami SF, Laroca S, Moure JS. Wild bees biocenotics in São José dos Pinhais (PR), South Brazil. Preliminary report. J Fac Sci Hokkaido U. Series 6, Zoology 1967;19:25391. 25. Lopes CA, Marchini LC. Plantas visitadas por Apis mellifera L. no vale do rio Paraguaçu, Município de Castro Alves, Bahia. Rev Bras Bot 1999;22(2):333-338.

924


Rev Mex Cienc Pecu 2020;11(3):914-932

26. APG III. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG III. Bot J Linn Soc 2009;161:105-121. 27. Roman L, Palma JM. Árboles y arbustos tropicales nativos productores de néctar y polen en el estado de Colima, México. Avanc Investig Agrop 2007;11(3):3-24. 28. Bello MA. Plantas melíferas silvestres de la Sierra Purépecha, Michoacán, México. Rev Cienc Forest Mex 2007;32(102):103-126. 29. Piedras B, Quiroz DL. Estudio melisopalinológico de dos mieles de la porción sur del Valle de México. Polibotánica 2007;23:57-75. 30. Bhalchandra W, Baviskar RK, Nikam TB. Diversity of nectariferous and polleniferous bee flora at Anjaneri and Dugarwadi hills of Western Ghats of Nasik district (M. S.) India. J Entomol Zool Stud 2014;2(4):244-249.

925


Rev Mex Cienc Pecu 2020;11(3):914-932

Anexo 1. Inventario de la flora de importancia apícola en Tamaulipas, México. AR = Árbol, AB = Arbusto, HI = Hierba, ER = Erecta, As = Ascendente, DE = Decumbente, PS = Postrada, RA = Rastrera, RO = Roseta, TR = Trepadora, FL = Flotante, NA = Nativa, IN = Introducida, NE = Néctar, PO = Polen, NP = Néctar-polen, BP = Bosque de pino, BE = Bosque de encino, BE = Bosque de encino-pino, MDM = Matorral desértico micrófilo, MDR = Matorral desértico rosetófilo, MSM = Matorral submontano, MET = Matorral espinoso tamaulipeco, MEZ = Mezquital, SMS = Selva mediana subcaducifolia, SBS = Selva baja subcaducifolia, SBC = Selva baja caducifolia, VH = Vegetación halófila, VA = Vegetación acuática, VS = Vegetación secundaria, CA = Cultivo agrícola, CO = Cultivo ornamental.

FAMILIA

ACANTHACEAE ASPHODELACEAE AMARANTHACEAE ANACARDIACEAE

ANNONACEAE APOCYNACEAE

ARECACEAE

ASPARAGACEAE

ASTERACEAE

Nombre Científico

Avicennia germinans (L.) L. Aloe vera (L.) Burm. f. Amaranthus hybridus L. Mangifera indica L. Rhus microphylla Engelm. Rhus virens Lindh. ex A. Gray Schinus terebinthifolia Raddi Annona globiflora Schltdl. Asclepias angustifolia Schweigg. Asclepias curassavica L. Cascabela thevetia (L.) Lippold Acrocomia aculeata (Jacq.) Lodd. ex Mart. Brahea berlandieri Bartlett Sabal mexicana Mart. Agave lecheguilla Torr. Dasylirion berlandieri S. Watson Yucca filifera Chabaud Yucca treculeana Carrière Baccharis salicifolia (Ruiz & Pav.) Pers. Bidens odorata Cav. Bidens pilosa L. Bidens squarrosa Kunth Borrichia frutescens (L.) DC.

Forma biológica/Forma de vida/Origen/Tipo de vegetación

Primavera Nombre Común

AR/ER/NA/VA HI/RO/IN/CA HI/ER/NA/VS AR/ER/IN//CA AB/ER/NA/MDM AB/ER/NA/BPE AR/ER/IN/CO AB/ER/NA/SBC HI/ER/NA/BE HI/ER/NA/VS AB/ER/NA/CO AR/ER/NA/SMS

Mangle blanco Sábila Quelite Mango Correoso Lantrisco Cimarrón Chirimoya

AB/ER/NA/BE AR/ER/NA/SBC AB/RO/NA/MDR AB/RO/NA/MDR AR/ER/NA/MET AR/ER/NA/MET AB/ER/NA/VA HI/ER/NA/VS HI/ER/NA/VS HI/TR/NA/SMS HI/ER/NA/VH

Palmito Palma real Lechuguilla Sotol Palma china Pita Jara Aceitilla Aceitilla Té huasteco Saladilla

Quiebra muelas Cabeza de víbora Coyol

926

Recurso floral

Verano

Otoño

Invierno

M

A

M

J

J

A

S

O

N

D

E

F

N N N N N N NP NP N N N NP

x x x x

x x x x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x x

x

x

x

x x

x x

x x

x x

x x x

x

x

x

N NP NP NP N N NP NP NP N P

x x x

x x

x x

x x

x x

x

x x

x x

x x

x

x

x

x

x

x x

x x x x

x x

x x x x

x

x

x

x

x

x x

x x x x x x

x x

x

x x

x x

x

x x

x x

x

x x

x x x x

x x

x x x

x x x

x

x

x

x x

x x

x x x

x x x

x x x x

x x x


Rev Mex Cienc Pecu 2020;11(3):914-932

BASELLACEAE BIGNONIACEAE

BORAGINACEAE

BROMELIACEAE

Chromolaena odorata (L.) R.M. King & H. Rob. Cirsium mexicanum Dc. Conoclinium coelestinum (L.) DC. Elephantopus mollis Kunth Flourensia laurifolia DC. Gochnatia hypoleuca (DC.) A. Gray Helianthus annuus L. subsp. annuus Helianthus annuus var. macrocarpus (DC.) Cockerell Mikania cordifolia (L. f.) Willd. Parthenium hysterophorus L. Pluchea carolinensis (Jacq.) G. Don Pluchea salicifolia (Mill.) S.F. Blake Roldana aschenborniana (S. Schauer) H. Rob. & Brettell Senecio salignus DC. Simsia eurylepis S.F. Blake Sonchus oleraceus L. Tithonia diversifolia (Hemsl.) A. Gray Tridax coronopifolia (Kunth) Hemsl. Tridax procumbens L. Verbesina encelioides (Cav.) Benth. & Hook. f. ex A. Gray Verbesina persicifolia DC. Zinnia elegans Jacq. Anredera vesicaria (Lam.) C.F. Gaertn. Amphilophium crucigerum (L.) L.G. Lohmann Tecoma stans (L.) Juss. ex Kunth Crescentia alata Kunth Parmentiera aculeata (Kunth) Seem. Cordia boissieri A. DC. Cordia dentata Poir. Ehretia anacua (Terán & Berland.) I.M. Johnst. Heliotropium angiospermum Murray Heliotropium calcicola Fernald Tillandsia usneoides (L.) L.

HI/TR/NA/MET

Limpiatuna

HI/ER/NA/VS HI/ER/NA/VA HI/ER/NA/VS AB/ER/NA/MSM AB/ER/NA/MSM HI/ER/NA/VS HI/ER/NA/CA

Cardo

HI/TR/NA/VA HI/ER/NA/VS AB/ER/NA/VA AB/ER/NA/VA AB/ER/NA/BE

Guaco Amargoso Santa María Santa Isabel

AB/ER/NA/VA HI/ER/NA/VS HI/ER/IN/VS HI/ER/IN/VS HI/AS/NA/VS HI/PO/NA/VS HI/ER/NA/VS

Jarilla Chimalaco Borraja Botón de oro Coronilla Hierba del monte

AB/ER/NA/VS HI/ER/IN/CO HI/TR/NA/SBC HI/TR/NA/SMS

Hierba del toro Cartulina Hierba de la difunta

AB/ER/NA/SBC AR/ER/NA/SBC AB/ER/NA/SBC AR/ER/NA/MET AR/ER/NA/SBC AR/ER/NA/MEZ

Tronadora Guaje cirial Chote Anacahuita Baboso

HI/ER/NA/VS HI/ER/NA/MSM HI/EP/NA/BE

Alacrancillo

Hoja ancha Ocotillo Polocote Girasol

Barba

Hierba de la bruja

Lengua de vaca

Anacua

Paixtle

927

NP

x

x

NP P NP NP NP NP NP

x

x

NP N NP NP P

x x x x

NP NP NP NP P NP NP N NP NP NP N N N NP N N N N N

x

x x x x

x

x

x

x x x x

x x x x

x x x x x

x x x x

x

x

x

x

x

x

x

x x x

x

x

x

x

x

x

x

x x x

x x

x x x

x x x

x x

x

x

x x x

x

x x x

x

x

x

x x

x x

x x

x x

x x

x x

x

x

x

x

x

x

x

x

x

x

x

x

x

x x x

x

x x x x x

x

x

x x

x

x

x

x

x

x x

x x

x x

x x

x x

x x

x x

x x

x

x

x

x x

x x

x

x

x

x x x x

x x x x

x x x x

x x x x

x x x x

x x

x x

x x

x

x

x

x

x x

x

x x x x

x

x

x x x

x x

x x

x

x x


Rev Mex Cienc Pecu 2020;11(3):914-932

CACTACEAE

CANNABACEAE CANNACEAE CAPPARACEAE COMBRETACEAE COMMELINACEAE CONVOLVULACEAE

CUCURBITACEAE

CUPRESACEAE EBENACEAE EUPHORBIACEAE

Bromelia pinguin L. Hechtia glomerata Zucc. Cylindropuntia leptocaulis (DC.) F.M. Knuth Opuntia engelmannii Salm-Dyck ex Engelm. Pachycereus marginatus (DC.) Britton & Rose Stenocereus griseus (Haw.) Buxb. Celtis pallida Torr. Canna indica L. Quadrella incana (Kunth) Iltis & Cornejo Conocarpus erectus L. Commelina erecta L. Evolvulus alsinoides (L.) L. Ipomoea batatas (L.) Lam. Ipomoea carnea subsp. fistulosa (Mart. ex Choisy) D.F. Austin Ipomoea pes-caprae (L.) R. Br. Jacquemontia nodiflora (Desr.) G. Don Jacquemontia oaxacana (Meisn.) Hallier f. Jacquemontia pentantha G. Don Operculina pinnatifida (Kunth) O'Donell Turbina corymbosa (L.) Raf. Citrullus lanatus (Thunb.) Matsum. & Nakai Cucumis melo L. Luffa aegyptiaca Mill. Momordica charantia L. Taxodium mucronatum Ten. Diospyros palmeri Eastw. Diospyros texana Scheele Jatropha dioica Sessé Croton argenteus L. Croton cortesianus Kunth Croton niveus Jacq. Croton punctatus Jacq. Croton reflexifolius Kunth

AB/RO/NA/SBC HI/RO/NA/MDR AB/ER/NA/MET AB/ER/NA/MET AB/ER/NA/MDM

Huapilla Huapilla Tasajillo Nopal Órgano

AB/ER/NA/MET AB/ER/NA/MET HI/ER/NA/VS AB/ER/NA/MSM AB/ER/NA/VA HI/AS/NA/VS HI/PS/NA/MET HI/TR/NA/SBS AB/ER/NA/VS

Pitayo Granjeno Platanillo Vara blanca Mangle botoncillo Hierba del pollo Ojo de víbora Frijolillo

HI/RA/NA/VH HI/TR/NA/MEZ HI/TR/NA/SBS

Riñonina Campanita

HI/TR/NA/SBS HI/TR/NA/VS HI/TR/NA/SBS HI/PS/IN/CA

Campanita azul Gallinita

HI/PS/IN/CA HI/TR/IN/VS HI/TR/IN/SBS AR/ER/NA/VA AR/ER/NA/MSM AR/ER/NA/MSM AB/ER/NA/MDM HI/ER/NA/VS HI/ER/NA/MEZ AR/ER/NA/SBC HI/ER/NA/VS AB/ER/NA/SBC

Melón Estropajo Guadalupana Sabino Chapote Chapote prieto Sangre de drago Puntilla Palillo Olivo Hierba del jabalí Matilla

Mañanita

Campanita azul

Sandía

928

NP N NP

x

NP N

x

x

x

x

x

x

x

x

x

x

P N NP NP NP P N N N

x x x

x x

x x

NP N N

NP N N N N N NP NP P NP NP NP

x x

x

N N N NP

x

x x

x x

x x x x

x x x x

x x x x

x x x x

x x x x

x x x x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x x

x x

x

x

x

x

x

x

x x

x

x

x

x

x

x

x

x

x x

x

x

x

x

x

x

x

x x x

x x x x

x x x

x

x

x

x

x

x

x

x

x

x x

x

x

x

x

x x

x x

x

x x x

x x x

x x x x x

x x

x x x

x x x x

x x

x x

x


Rev Mex Cienc Pecu 2020;11(3):914-932

FABACEAE

Cnidoscolus multilobus (Pax) I.M. Johnst. Euphorbia heterophylla L. Ricinus communis L. Acacia angustissima (Mill.) Kuntze Acacia constricta Benth. Acacia coulteri Benth. Acacia farnesiana (L.) Willd. Acacia rigidula Benth. Acacia schaffneri (S. Watson) F.J. Herm. Bauhinia divaricata L. Caesalpinia mexicana A. Gray Canavalia villosa Benth. Dalea greggii A. Gray Dalea lutea (Cav.) Willd. Delonix regia (Bojer ex Hook.) Raf. Ebenopsis ebano (Berland.) Barneby & J.W. Grimes Erythrina herbacea L. Eysenhardtia polystachya (Ortega) Sarg. Eysenhardtia texana Scheele Gliricidia sepium (Jacq.) Kunth ex Walp. Havardia pallens (Benth.) Britton & Rose Leucaena leucocephala (Lam.) de Wit Lysiloma divaricatum (Jacq.) J.F. Macbr. Mimosa biuncifera Benth. Mimosa diplotricha C. Wright ex Sauvalle Mimosa monancistra Benth. Mimosa pigra L. Mimosa pudica L. Parkinsonia aculeata L. Parkinsonia texana var. macra (I.M. Johnst.) Isely Piscidia piscipula (L.) Sarg. Pithecellobium dulce (Roxb.) Benth. Prosopis glandulosa Torr. Prosopis laevigata (Humb. & Bonpl. ex Willd.) M.C. Johnst. Prosopis tamaulipana Burkart

AB/ER/NA/SBC HI/ER/NA/VS AB/ER/IN/VS AR/ER/NA/BE AB/ER/NA/MDM AR/ER/NA/SBC AB/ER/NA/VS AB/ER/NA/MET AB/ER/NA/MDM AB/ER/NA/SBC AB/ER/NA/VS HI/TR/NA/SBC AB/DE/NA/BE AB/AS/NA/BE AR/ER/IN/CO AR/ER/NA/MEZ

Mala mujer Contrahierba Higuerilla Barba de chivo Huizachillo Palo de arco Huizache Gavia Huizache chino Pata de vaca Hierba del potro Frijolillo Oreganillo Pinito Framboyán

AB/ER/NA/SBC AB/ER/NA/MEZ AB/ER/NA/MET AR/ER/IN/CO AR/ER/NE/MET AR/ER/IN/VS AR/ER/NA/SBC AB/ER/NA/MDM AB/TR/IN/VS

Colorín Vara dulce Vara dulce Palo de sol Tenaza Guaje Rajador Uña de gato

AB/ER/NA/MET AB/ER/NA/VA HI/ER/NA/VS AR/ER/NA/VS AR/ER/NA/MEZ

Charrasquillo Choveno Vergonzosa Retama

AR/ER/NA/SBC AR/ER/NA/SBC AR/ER/NA/MET AR/ER/NA/MET

Chijol Guamúchil Mezquite

AR/ER/NA/MEZ

Mezquite

Ébano

Sierrilla

Palo verde

Mezquite

929

NP N NP P P P P P P N N NP N P N N

x

NP N N NP N NP N P P

x

P P P N N N NP NP NP N

x

x x

x x

x x

x x

x

x

x x

x

x

x

x

x

x x x x x x

x

x x

x

x x

x

x x

x x x

x

x

x x

x

x

x x x

x

x x x x

x x

x x

x

x x x x

x x x x

x x x x

x

x

x

x

x

x x x

x x x

x x x

x x x

x x

x

x

x

x

x x x

x

x

x x x

x x x x x x x x

x

x

x x x

x x

x x x x x x

x x x

x

x

x x

x x

x

x

x

x

x x x x x x x

x x

x

x

x

x

x

x

x x x

x

x

x

x

x

x x


Rev Mex Cienc Pecu 2020;11(3):914-932

FAGACEAE SALICACEAE

LAMIACEAE

LAURACEAE

LOASACEAE LYTHRACEAE MALPIGHIACEAE MALVACEAE

MELIACEAE

MUSACEAE MYRTACEAE NYCTAGINACEAE

Senna atomaria (L.) H.S. Irwin & Barneby Stizolobium pruriens (L.) Medik. Tamarindus indica L. Quercus polymorpha Schltdl. & Cham. Neopringlea integrifolia (Hemsl.) S. Watson Xylosma flexuosa (Hemsl.) S. Watson Callicarpa acuminata Kunth Leonotis nepetifolia (L.) R. Br. Marrubium vulgare L. Salvia ballotiflora Benth. Salvia connivens Epling Salvia sp. Teucrium cubense Jacq. Vitex negundo L. Litsea glaucescens Kunth Nectandra salicifolia (Kunth) Nees Persea americana Mill. Cevallia sinuata Lag. Lagerstroemia indica L. Malpighia glabra L. Abutilon abutiloides (Jacq.) Garcke ex Hochr. Abutilon trisulcatum (Jacq.) Urb. Gossypium hirsutum L. Malvastrum americanum (L.) Torr. Malvastrum coromandelianum (L.) Garcke Malvaviscus arboreus Cav. Melochia pyramidata L. Melochia tomentosa L. Waltheria indica L. Trichilia havanensis Jacq. Azadirachta indica A. Juss. Melia azedarach L. Musa paradisiaca L. Psidium guajava L. Boerhavia coccinea Mill.

AR/ER/NA/SBC

Palo de zorrillo

HI/TR/NA/SMS AR/ER/IN/CA AR/ER/NA/BE AR/ER/NA/MSM

Picapica Tamarindo Encino

AR/ER/NA/SBC AR/ER/NA/SBC HI/ER/NA/VS AR/ER/IN//VS AB/ER/NA//MSM HI/ER/NA/BE HI/ER/NA/BE HI/ER/NA/VS AB/ER/IN/CO AB/ER/NA/BE AR/ER/NA/SBS AR/ER/NA/CA HI/AS/NA/VS AB/ER/IN/CO AB/ER/NA//SBS HI/ER/NA/VS

Capulín de corona Uvilla Betónica Manrubio Santa Isabel

HI/ER/NA/VS HI/ER/NA//CA HI/ER/NA/VS HI/ER/NA/VS

Tronadora Algodón Malva

AB/ER/NA/SBS HI/ER/NA/VS HI/ER/NA/VS HI/ER/NA/VS AB/ER/NA/SMS AR/ER/IN/CO AR/ER/IN/CO AB/ER/IN/CA AB/ER/NA/SBC HI/ER/NA/VS

Manzanita Malva Malva rosa Hierba del soldado Estribillo Neem Canelo Plátano Guayabo Pegajosa

Corva gallina

Verbena Árbol de la miel Laurel Aguacatillo Aguacate Ortiguilla ceniza Crespón Manzanita Malva rasposa

Malva loca

930

N

x

x

x

x

x x

x x

x x

x x

x

x

x

x

x

x

x

x

NP N NP NP N N N NP N N NP N NP P NP P

x

x

x

x x

x

x

x x x x

x x x x x

x x x x

x x x x x x x

x x x x x

x x x x x

x x x

x x x

x x x x x x x x x

x

x

x

x

x

x

x

x x x

x

x

NP NP NP P

x x x

NP NP P NP NP N NP N NP N

x

N N N NP

x x x x x

x

x

x

x

x

x

x

x

x

x

x

x

x

x x x x x x x x x x

x x x

x x x

x x x x x x x x x

x x x

x x x x

x x x

x x x x

x

x x

x

x

x

x

x x

x

x

x

x

x

x

x

x

x

x x x x

x x x x

x x x

x x x

x x x x

x x x

x

x

x

x

x

x

x x x

x x x

x

x

x

x x

x x x

x x x x

x x x x

x x x

x

x x

x x

x x x

x x x

x x x

x

x

x

x

x

x x

x

x x

x

x x

x x

x


Rev Mex Cienc Pecu 2020;11(3):914-932

NYMPHAEACEAE OLEACEAE ONAGRACEAE PAPAVERACEAE

PASSIFLORACEAE PETIVERIACEAE PINACEAE

PLANTAGINACEAE PLUMBAGINACEAE POACEAE POLYGONACEAE RHAMNACEAE ROSACEAE RUBIACEAE RUTACEAE

SAPINDACEAE

Boerhavia erecta L. Nymphaea ampla (Salisb.) DC. Nymphaea elegans Hook. Fraxinus berlandieriana A. DC. Ludwigia octovalvis (Jacq.) P.H. Raven Oenothera rosea L'Hér. ex Aiton Argemone grandiflora Sweet Argemone ochroleuca Sweet Argemone mexicana L. Bocconia frutescens L. Turnera diffusa Willd. Rivina humilis L. Pinus cembroides Zucc. Pinus teocote Schltdl. & Cham. Maurandya antirrhiniflora Humb. & Bonpl. ex Willd. Plumbago auriculata Lam. Sorghum halepense (L.) Pers. Zea mays L. Antigonon leptopus Hook. & Arn. Persicaria glabra (Willd.) M. Gómez Condalia hookeri M.C. Johnst. Karwinskia humboldtiana M.C. Johnst. Lindleya mespiloides Kunth Vauquelinia corymbosa Bonpl. Hamelia patens Jacq. Casimiroa greggii (S. Watson) F. Chiang Citrus aurantifolia Swingle Citrus sinensis (L.) Osbeck Esenbeckia runyonii C.V. Morton Helietta parvifolia (A. Gray ex Hemsl.) Benth. Murraya paniculata (L.) Jack Zanthoxylum fagara (L.) Sarg. Koelreuteria bipinnata Franch. Serjania brachycarpa A. Gray ex Radlk. Urvillea ulmacea Kunth Paullinia tomentosa Jacq. Sapindus saponaria L.

HI/AS/NA/VS HI/FL/NA/VA HI/FL/NA/VA AR/ER/NA/VA HI/ER/NA/VA HI/ER/NA/VS HI/ER/NA/VS HI/ER/NA/VS HI/ER/NA/VS AB/ER/NA/SBS HI/ER/NA/MSM HI/ER/NA//SBC AR/ER/NA/BP AR/ER/NA/BP HI/TR/NA/MSM

Pega pega Panza de vaca Lampazo Fresno Jarcia Hierba del golpe Chicalote blanco Chicalote Chicalote amarillo Calderona Damiana Cordilínea Pino piñonero Ocote

HI/ER/IN/CO HI/ER/IN/VS HI/ER/NA/CA HI/TR/NA/VS HI/ER/NA/VA AR/ER/NA/MEZ AB/ER/NA/MEZ AB/ER/NA/BP AR/ER/NA/BP AB/ER/NA/SBS AR/ER/NA/SBS AR/ER/IN/CA AR/ER/IN/CA AR/ER/NA/SBS AB/ER/NA/MSM

Jurica Zacate Johnson Maíz Flor de San Diego Chilillo Brasil Coyotillo Manzanilla silvestre Sierrilla Chacloco Chapote amarillo Limón Naranjo Limoncillo

AB/ER/IN//CO AB/ER/NA/MET AR/ER/IN/CO HI/TR/NA/MEZ HI/TR/NA/MEZ HI/TR/NA/SBS AR/ER/NA/SBC

Limonaria Colima Chino Guía Coronilla Arete de novia Jaboncillo

Hierba del corazón

Barreta

931

P P P N N NP P N N NP N N N N NP

x

x

x

x

x

x x x x x x x x x x x

x x x x x x x x x x x

x

x x x x x x

x x x

x

x

x x x x x x

x x x x x x

x

x

x

x x

x x

x x

x x x x

x x x

x x x

x

x

x

x x x x x x

x x x x x x x

x

x

x

x

x

x x x x x x x

x x

x

x

x

x

x

x x

x

x

x x

x

x

x

x x

x x

x x

x x

x

x

x x

x

x

x x x x

x x x x x

x

x

x

x

x

x

N NP N N N N N

x

x x x

x

x x

x x x x x x x x x

x x

x x

x

x x x x x x x x

P P P N N NP N N P NP N N N NP NP

x

x x x

x x x x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x x

x

x x

x

x

x

x x x

x

x

x x x

x x

x x

x x x


Rev Mex Cienc Pecu 2020;11(3):914-932

SAPOTACEAE SCROPHULARIACEAE

SOLANACEAE

TAMARICACEAE VERBENACEAE

VITACEAE ZYGOPHYLLACEAE

Sideroxylon celastrinum (Kunth) T.D. Penn. Buddleja scordioides Kunth Buddleja sessiliflora Kunth Capraria mexicana Moric. ex Benth. Leucophyllum frutescens (Berland.) I.M. Johnst. Leucophyllum pruinosum I.M. Johnst. Datura stramonium L. Lycopersicon esculentum Mill. Solanum erianthum D. Don. Tamarix aphylla (L.) H. Karst. Verbena carolina L. Citharexylum berlandieri B.L. Rob. Lantana hirta Graham Lippia graveolens Kunth Petrea volubilis L. Cissus verticillata (L.) Nicolson & C.E. Jarvis Guaiacum angustifolium Engelm. Kallstroemia maxima (L.) Hook. & Arn. Kallstroemia parviflora Norton Larrea tridentata (DC.) Coville

AR/ER/NA/MEZ

Coma

HI/ER/NA/MSR AB/ER/NA/VS AB/ER/NA/VS AB/ER/NA/MET

Escobilla Tepozán Jara

AB/ER/NA/MDM HI/ER/NA/VS HI/ER/NA/VS AB/ER/NA/VS AR/ER/IN/CO HI/ER/NA/VS AB/ER/NA/MEZ HI/ER/NA/MEZ HI/ER/NA/MSM AB/TR/NA/SMS HI/TR/NA/SBS

Cenizo Toloache Tomate Salvadora Rompevientos Hierba del negro Revienta cabras Peonía colorada Orégano Guirnalda

AB/ER/NA/MET HI/PS/NA/VS HI/PS/NA/VS AB/ER/NA/MDM

Guayacán Verdolaga de abrojo Quesillos Gobernadora

Cenizo

Hierba del buey

TOTAL

932

N N NP NP NP NP NP N NP NP NP NP N N N N N N P NP

x

x

x

x

x

x

x x

x

x x

x x

x

x

x

x

x

x

x

x

x

x

x x

x x

x x

x x x x x

x x x x x

x x x x x

x x

x x

x x x x x x

x x x x x x

x

x x x

x

x

x

x x x x x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x x x x

x

x

124

130

124 110

x

x

x

x

x x

x x

x x

x

x

x

x

x

x

x

x

x x x

116 115

x

x x x x

x

103

x

100 85

64 71

98


Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 11 Núm 3, pp. 605-932, JULIO-SEPTIEMBRE-2020

ISSN: 2448-6698

Pags. Pasta de higuerilla desintoxicada en dietas para pollos de engorda

Detoxified castor meal in broiler chickens’ diets Anabel Maldonado Fuentes, Juan Manuel Cuca García, Arturo Pro Mar�nez, Fernando González Cerón, José Guadalupe Herrera Haro, Eliseo Sosa Montes, Pablo Alfredo Domínguez Mar�nez…………………………………….....….…….....….…….....….…….....….…….....….…….....….…….....….…….....….…….....….....….....….…...……. 605

Efecto de la fecha de corte y del uso de aditivos en la composición química y calidad fermentativa de ensilado de girasol

Effect of the cutting date and the use of additives on the chemical composition and fermentative quality of sunflower silage Aurora Sainz-Ramírez, Adrián Botana, Sonia Pereira-Crespo, Laura González-González, Marcos Veiga, César Resch, Juan Valladares, Carlos Manuel Arriaga-Jordán, Gonzalo Flores-Calvete…………………………………………………………………………………………………………………………………….………………………………….….....……….620

Suplementación de clorhidrato de zilpaterol en corderos finalizados con dieta sin fibra de forraje

Supplementation with zilpaterol hydrochloride in lambs finished with a non-forage fiber diet Ricardo Vicente Pérez, Ulises Macías-Cruz, Ramón Andrade Mancillas, Rogelio Vicente, Enrique O. García, Ricardo Mar�nez, Leonel Avendaño-Reyes, Oziel D. Montañez………….…………………………………….…….638

Changes in myoglobin content in pork Longissimus thoracis muscle during freezing storage

Cambios en el contenido de mioglobina en el músculo porcino Longissimus thoracis durante el almacenamiento en congelación Jonathan Coria-Hernández, Rosalía Meléndez-Pérez, Abraham Méndez-Albores, José Luis Arjona-Román………………………………………………………………………………………………………………………………………………….…….651

Indicadores de competitividad de la carne bovina de México en el mercado mundial

Indicators of the competitiveness of Mexican beef in the world market Miguel Ángel Magaña Magaña, Carlos Enrique Leyva Morales, Juan Felipe Alonzo Solís, Carlos Gabriel Leyva Pech..………………………………………...............……....…....…....…....…....……………………………...……………….669

Adición de extracto acuoso de ajo (Allium sativum) en dieta de conejos (Oryctolagus cuniculus) sobre productividad, calidad física y microbiológica de la carne

Effect of the addition of aqueous extract of garlic (Allium sativum) to the diet of rabbits (Oryctolagus cuniculus) on the productivity and on the physical and microbiological quality of the meat Dora Luz Pinzón Mar�nez, María Dolores Mariezcurrena Berasain, Héctor Daniel Arzate Serrano, María Antonia Mariezcurrena Berasain, Abdelfa�ah Zeidan Mohamed Salem, Alfredo Medina García …………………………………………………………………………………………………………………………………...……………………….686

El aceite esencial y bagazo de orégano (Lippia berlandieri Schauer) afectan el comportamiento productivo y la calidad de la carne de conejo

Essential oil and bagasse of oregano (Lippia berlandieri Schauer) affect the productive performance and the quality of rabbit meat Jesica Le�cia Aquino-López, América Chávez-Mar�nez, José Arturo García-Macías, Gerardo Méndez-Zamora, Ana Luisa Rentería-Monterrubio, Antonella Dalle-Zo�e, Luis Raúl García-Flores…………………………………………………………………………………………………………………………………………………………………………………………………………………………………….…....……….701

Las rizobacterias halófilas mantienen la calidad forrajera de Moringa oleifera cultivada en sustrato salino

Halophilic rhizobacteria maintain the forage quality of Moringa oleifera grown on a saline substrate Verónica García Mendoza, Alex Edray Hernández Vázquez, José Luis Reyes Carrillo, Uriel Figueroa Viramontes, Jorge Sáenz Mata, Héctor Mario Quiroga Garza, Emilio Olivares Sáenz, Pedro Cano Ríos, José Eduardo García Mar�nez…………………………………………………………………………………………….………………………………………………………………….718

Efecto del reemplazo folicular (GnRH) y de somatotropina bovina (bST) sobre la fertilidad de vacas lecheras expuestas a estrés calórico

Effect of follicular replacement (GnRH) and bovine somatotropin (bST) on the fertility of dairy cows exposed to heat stress Renato Raúl Lozano-Domínguez, Carlos Fernando Aréchiga-Flores, Marco Antonio López-Carlos, Zimri Cortés-Vidauri, Melba Rincón-Delgado, José Ma. Carrera-Chávez, Ulises Macías-Cruz, Joel Hernández-Cerón……………………………………………………………………………………………………………………………………………………………………………………………………….……….738

Efecto del tamaño interno de la colmena en la producción de cría, miel y polen en colonias de Apis mellifera en el altiplano central de México

Effect of the internal size of the hive on brood, honey, and pollen production in Apis mellifera colonies in the central Mexican plateau Alfonso Hernández Carlos, Ignacio Castellanos……………………………………………………………………………………………………………………………………………………………………………….………………………………………………………….……. 757

Seroprevalencia de agentes virales del Complejo Respiratorio Bovino en razas criollas del Centro de Investigación Turipaná de AGROSAVIA

Seroprevalence of viral agents of the Bovine Respiratory Complex in Creole breeds of the Turipaná Research Center of AGROSAVIA Ma�luz Doria-Ramos, Teresa Oviedo-Socarras, Misael Oviedo-Pastrana, Diego Or�z-Ortega………………………………………………………………………………………………………….....…………………………………………………………….771

Frecuencia y factores de riesgo asociados a la presencia de Chlamydia abortus, en rebaños ovinos en México

Frequency and risk factors associated with the presence of Chlamydia abortus in flocks of sheep in Mexico Erika G. Palomares Reséndiz, Pedro Mejía Sánchez, Francisco Aguilar Romero, Lino de la Cruz Colín, Héctor Jiménez Severiano, José Clemente Leyva Corona, Marcela I. Morales Pablos, Efrén Díaz Aparicio………………………………………………………………………………………………………………………………………………………………………………....……………….783

Linfonodos y carne molida de res como reservorios de Salmonella spp. de importancia en salud pública

Lymph nodes and ground beef as public health importance reservoirs of Salmonella spp. Tania Palós Gu�érrez, María Salud Rubio Lozano, Enrique Jesús Delgado Suárez, Naisy Rosi Guzmán, Orbelin Soberanis Ramos, Cindy Fabiola Hernández Pérez, Rubén Danilo Méndez Medina………………………………………………………………………………………………….....……………………………………………………………………….795

Uso de una PCR anidada para el diagnóstico del virus de la necrosis pancreática infecciosa (VNPI) en truchas de campo

Diagnosis of the infectious pancreatic necrosis virus (IPNV) by nested PCR in wild trouts Catalina Tufiño-Loza, José Juan Mar�nez-Maya, Amaury Carrillo-González, Diana Neria-Arriaga, Celene Salgado-Miranda, Edith Rojas-Anaya, Elizabeth Loza-Rubio……………………………………………………………….811

Polymorphisms associated with the number of live-born piglets in sows infected with the PRRS virus in southern Sonora Mexico

Polimorfismos asociados con el número de lechones nacidos vivos en cerdas infectadas con el virus del PRRS en el sur de Sonora México Carlos Mar�n Aguilar-Trejo, Guillermo Luna-Nevárez, Javier Rolando Reyna-Granados, Ricardo Zamorano-Algandar, Javier Alonso Romo-Rubio, Miguel Ángel Sánchez-Castro, R. Mark Enns, Sco� E. Speidel, Milton G. Thomas, Pablo Luna-Nevárez…………………………………………………………………………………………………………………………………………………………….828

Venta a granel de embutidos: una tendencia de comercialización asociada al riesgo de enfermedades trasmitidas por alimentos en Culiacán, México

Bulk sales of cold cuts and sausages: a marketing trend associated to the risk of foodborne diseases in Culiacan, Mexico Maribel Jiménez-Edeza, Maritza Cas�llo-Burgos, Lourdes Janeth Germán-Báez, Gloria Marisol Castañeda-Ruelas……………………………………………………………………………….........………………………………………………….848

REVISIONES DE LITERATURA Estudios de asociación genómica en ovinos de América Latina. Revisión

Genome-wide association studies in sheep from Latin America. Review Karen Melissa Cardona Tobar, Diana Carolina López Álvarez, Luz Ángela Alvarez Franco……………………………………………………………………………………………………………………………………………………….………………….…….859

NOTAS DE INVESTIGACIÓN Crecimiento de corderos y productividad en ovejas Pelibuey mantenidas bajo condiciones tropicales de producción

Lamb growth and ewe productivity in Pelibuey sheep under tropical conditions Carolina Atenea García-Chávez, Carlos Luna-Palomera, Ulises Macías-Cruz, José Candelario Segura-Correa, Nadia Florencia Ojeda-Robertos, Jorge Alonso Peralta-Torres, Alfonso Juven�no Chay-Canúl........884

Identification of candidate genes for reproductive traits in cattle using a functional interaction network approach

La identificación de genes candidatos para rasgos de la reproducción en ganado utilizando un enfoque de redes de interacciones funcionales Francisco Alejandro Paredes-Sánchez, Daniel Trejo-Mar�nez, Elsa Verónica Herrera-Mayorga, Williams Arellano-Vera, Felipe Rodríguez Almeida, Ana María Sifuentes-Rincón………………………………………........894

Tiempo de manejo y algunas conductas relacionadas con el estrés al manejar grupos grandes o reducidos de ganado en mangas rectas

Effect of group size on processing time and some stress-related behaviors in cattle in straight chutes Miguel Ángel Damián, Virginio Aguirre, Agus�n Orihuela, Mariana Pedernera, Saúl Rojas, Jaime Olivares……………………………………………………………………………………………......…………………………………………….…….905

Diversidad de la flora de interés apícola en el estado de Tamaulipas, México

Diversity of melliferous flora in the State of Tamaulipas, Mexico Mario González-Suárez, Arturo Mora-Olivo, Rogel Villanueva-Gu�érrez, Manuel Lara-Villalón, Venancio Vanoye-Eligio, Antonio Guerra-Pérez...........................…………………………………………………………………….914

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 11 Núm 3, pp. 605-932, JULIO-SEPTIEMBRE-2020

CONTENIDO CONTENTS

Rev. Mex. Cienc. Pecu. Vol. 11 Núm. 3, pp. 605-932, JULIO-SEPTIEMBRE-2020

Profile for Revista Mexicana de Ciencias Pecuarias

RMCP Vol. 11, Núm. 3 (2020): Julio - Septiembre [versión en español]  

RMCP Vol. 11, Núm. 3 (2020): Julio - Septiembre [versión en español]  

Advertisement